U.S. patent application number 12/958376 was filed with the patent office on 2011-07-07 for compounds modulating c-kit and c-fms activity and uses therefor.
This patent application is currently assigned to Plexxikon, Inc.. Invention is credited to Dean R. Artis, Ryan Bremer, Clarence R. Hurt, Prabha N. Ibrahim, Wayne Spevak, Guoxian Wu, Chao Zhang, Jiazhong Zhang, Hongyao Zhu, Rebecca Zuckerman.
Application Number | 20110166174 12/958376 |
Document ID | / |
Family ID | 37683773 |
Filed Date | 2011-07-07 |
United States Patent
Application |
20110166174 |
Kind Code |
A1 |
Zhang; Chao ; et
al. |
July 7, 2011 |
COMPOUNDS MODULATING C-KIT AND C-FMS ACTIVITY AND USES THEREFOR
Abstract
Compounds active on the receptor protein tyrosine kinases c-kit
and c-fms are provided herewith. Also provided herewith are
compositions useful for treatment of c-kit mediated diseases or
condition and c-fms-mediated diseases or condition, and methods for
the use thereof.
Inventors: |
Zhang; Chao; (Moraga,
CA) ; Zhang; Jiazhong; (Oakland, CA) ;
Ibrahim; Prabha N.; (Mountain View, CA) ; Hurt;
Clarence R.; (San Ramon, CA) ; Zuckerman;
Rebecca; (Alameda, CA) ; Artis; Dean R.;
(Kensington, CA) ; Bremer; Ryan; (Albany, CA)
; Spevak; Wayne; (Berkeley, CA) ; Wu; Guoxian;
(Palo Alto, CA) ; Zhu; Hongyao; (Berkeley,
CA) |
Assignee: |
Plexxikon, Inc.
|
Family ID: |
37683773 |
Appl. No.: |
12/958376 |
Filed: |
December 1, 2010 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11435381 |
May 16, 2006 |
7846941 |
|
|
12958376 |
|
|
|
|
60682063 |
May 17, 2005 |
|
|
|
60682042 |
May 17, 2005 |
|
|
|
60682051 |
May 17, 2005 |
|
|
|
60692960 |
Jun 22, 2005 |
|
|
|
60692750 |
Jun 22, 2005 |
|
|
|
Current U.S.
Class: |
514/300 |
Current CPC
Class: |
A61P 11/00 20180101;
A61P 19/08 20180101; A61P 43/00 20180101; A61P 3/04 20180101; C07D
471/04 20130101; A61P 25/00 20180101; A61P 13/12 20180101; A61P
3/06 20180101; A61P 19/10 20180101; A61P 19/02 20180101; A61P 35/00
20180101; A61P 41/00 20180101; A61P 3/10 20180101; A61P 3/14
20180101; A61P 37/08 20180101; A61P 35/02 20180101; A61P 9/10
20180101; A61P 27/02 20180101; A61P 1/00 20180101; A61P 35/04
20180101; A61P 11/06 20180101; A61P 37/06 20180101 |
Class at
Publication: |
514/300 |
International
Class: |
A61K 31/437 20060101
A61K031/437; A61P 37/08 20060101 A61P037/08; A61P 11/06 20060101
A61P011/06; A61P 19/02 20060101 A61P019/02; A61P 25/00 20060101
A61P025/00; A61P 41/00 20060101 A61P041/00; A61P 3/10 20060101
A61P003/10; A61P 1/00 20060101 A61P001/00; A61P 27/02 20060101
A61P027/02 |
Claims
1.-35. (canceled)
36. A method for treating a subject suffering from or at risk of a
c-kit or c-fms mediated disease or condition, comprising
administering to the subject an effective amount of a compound
having the chemical structure: ##STR00228## all salts, tautomers,
and stereoisomers thereof, wherein: X.sub.1 is CR.sup.2, X.sub.2 is
CR.sup.6, Y.sub.1 is CR.sup.4, and Y.sub.2 is CR.sup.5; L.sup.1 is
lower alkylene; L.sup.2 is selected from the group consisting of
(alk).sub.a-S-(alk).sub.b-, -(alk).sub.a-O-(alk).sub.b- and
-(alk).sub.a-NR.sup.9-(alk).sub.b-, wherein alk is optionally
substituted C.sub.1-3 alkylene and a and b are independently 0 or
1; R.sup.1 is cycloalkyl or phenyl, wherein phenyl is substituted
with a substituent selected from the group consisting of fluoro,
chloro, methyl, methoxy and trifluoromethyl; R.sup.2 and R.sup.6
are hydrogen; one of R.sup.4 and R.sup.5 is selected from the group
consisting of fluoro, chloro, bromo, lower alkyl optionally
substituted with one or more fluoro, lower alkenyl, lower alkynyl,
cycloalkyl, --CN, and lower alkoxy optionally substituted with one
or more fluoro, lower alkoxy, di-alkylamino or cycloalkylamino, and
the other of R.sup.4 and R.sup.5 is selected from the group
consisting of hydrogen, fluoro, chloro, bromo, lower alkyl
optionally substituted with one or more fluoro, lower alkenyl,
lower alkynyl, cycloalkyl, --CN, and lower alkoxy optionally
substituted with one or more fluoro, lower alkoxy, dialkylamino, or
cycloalkylamino; Ar.sub.1 is a 6 membered optionally substituted
heteroarylene having the structure ##STR00229## wherein
##STR00230## indicates the point of attachment of L.sup.1 and
##STR00231## indicates the point of attachment of L.sup.2, and
wherein the indicated N is either .dbd.N-- or --N.dbd.; n is 1; F
and J are both C; P is CR and is CH, wherein R is hydrogen, methyl
or methoxy; T is CH; R.sup.9 at each occurrence is independently
selected from the group consisting of hydrogen, lower alkyl, and
lower alkyl substituted with one or more substituents selected from
the group consisting of fluoro, --OH, --NH.sub.2, lower alkoxy,
fluoro substituted lower alkoxy, lower alkylthio, fluoro
substituted lower alkylthio, mono-alkylamino, fluoro substituted
mono-alkylamino, di-alkylamino, fluoro substituted di-alkylamino,
and --NR.sup.12R.sup.13, provided, however, that when R.sup.9 is
substituted lower alkyl, any substitution on the alkyl carbon bound
to the --N-- of --NR.sup.9-- is fluoro; and R.sup.12 and R.sup.13
combine with the nitrogen to which they are attached to form a 5-7
membered heterocycloalkyl or 5-7 membered heterocycloalkyl
substituted with one or more substituents selected from the group
consisting of fluoro, --OH, --NH.sub.2, lower alkyl, fluoro
substituted lower alkyl, lower alkoxy, fluoro substituted lower
alkoxy, lower alkylthio, and fluoro substituted lower
alkylthio.
37-38. (canceled)
39. The method of claim 36, wherein the compound is approved for
administration to a human.
40. The method of claim 39, wherein the disease or condition is
selected from the group consisting of mast cell tumors, small cell
lung cancer, testicular cancer, gastrointestinal stromal tumors,
glioblastoma, astrocytoma, neuroblastoma, carcinomas of the female
genital tract, sarcomas of neuroectodermal origin, colorectal
carcinoma, carcinoma in situ, Schwann cell neoplasia associated
with neurofibromatosis, acute myeloid leukemia, acute lymphocytic
leukemia, chronic myelogenous leukemia, multiple myeloma,
mastocytosis, melanoma, breast cancer, ovarian cancer, canine mast
cell tumors, hypertrophy, asthma, rheumatoid arthritis, allergic
rhinitis, multiple sclerosis, inflammatory bowel syndrome,
transplant rejection, systemic lupus erythematosis, Wegener's
granulomatosis, Chronic Obstructive Pulmonary Disease, emphysema,
atherosclerosis, insulin resistance, hyperglycemia, lipolysis,
hypereosinophilia, osteoporosis, increased risk of fracture,
hypercalcemia, bone metastases, glomerulonephritis, interstitial
nephritis, Lupus nephritis, tubular necrosis, and
diabetes-associated renal complications.
41. (canceled)
42. A kit comprising a compound having the chemical structure:
##STR00232## all salts, tautomers, and stereoisomers thereof,
wherein: X.sub.1 is CR.sup.2, X.sub.2 is CR.sup.6, Y.sub.1 is
CR.sup.4, and Y.sub.2 is CR.sup.5; L.sup.1 is lower alkylene;
L.sup.2 is selected from the group consisting of
(alk).sub.a-S-(alk).sub.b-, -(alk).sub.a-O-(alk).sub.b- and
-(alk).sub.a-NR.sup.9-(alk).sub.b-, wherein alk is optionally
substituted C.sub.1-3 alkylene and a and b are independently 0 or
1; R.sup.1 is cycloalkyl or phenyl, wherein phenyl is substituted
with a substituent selected from the group consisting of fluoro,
chloro, methyl, methoxy and trifluoromethyl; R.sup.2 and R.sup.6
are hydrogen; one of R.sup.4 and R.sup.5 is selected from the group
consisting of fluoro, chloro, bromo, lower alkyl optionally
substituted with one or more fluoro, lower alkenyl, lower alkynyl,
cycloalkyl, --CN, and lower alkoxy optionally substituted with one
or more fluoro, lower alkoxy, di-alkylamino or cycloalkylamino, and
the other of R.sup.4 and R.sup.5 is selected from the group
consisting of hydrogen, fluoro, chloro, bromo, lower alkyl
optionally substituted with one or more fluoro, lower alkenyl,
lower alkynyl, cycloalkyl, --CN, and lower alkoxy optionally
substituted with one or more fluoro, lower alkoxy, dialkylamino, or
cycloalkylamino; Ar.sub.1 is a 6 membered optionally substituted
heteroarylene having the structure ##STR00233## wherein
##STR00234## indicates the point of attachment of L.sup.1 and
##STR00235## indicates the point of attachment of L.sup.2, and
wherein the indicated N is either .dbd.N-- or --N.dbd.; n is 1; F
and J are both C; P is CR and is CH, wherein R is hydrogen, methyl
or methoxy; T is CH; R.sup.9 at each occurrence is independently
selected from the group consisting of hydrogen, lower alkyl, and
lower alkyl substituted with one or more substituents selected from
the group consisting of fluoro, --OH, --NH.sub.2, lower alkoxy,
fluoro substituted lower alkoxy, lower alkylthio, fluoro
substituted lower alkylthio, mono-alkylamino, fluoro substituted
mono-alkylamino, di-alkylamino, fluoro substituted di-alkylamino,
and --NR.sup.12R.sup.13, provided, however, that when R.sup.9 is
substituted lower alkyl, any substitution on the alkyl carbon bound
to the --N-- of --NR.sup.9-- is fluoro; and R.sup.12 and R.sup.13
combine with the nitrogen to which they are attached to form a 5-7
membered heterocycloalkyl or 5-7 membered heterocycloalkyl
substituted with one or more substituents selected from the group
consisting of fluoro, --OH, --NH.sub.2, lower alkyl, fluoro
substituted lower alkyl, lower alkoxy, fluoro substituted lower
alkoxy, lower alkylthio, and fluoro substituted lower alkylthio;
wherein the compound is approved for a medical indication selected
from the group consisting of mast cell tumors, small cell lung
cancer, testicular cancer, gastrointestinal stromal tumors,
glioblastoma, astrocytoma, neuroblastoma, carcinomas of the female
genital tract, sarcomas of neuroectodermal origin, colorectal
carcinoma, carcinoma in situ, Schwann cell neoplasia associated
with neurofibromatosis, acute myeloid leukemia, acute lymphocytic
leukemia, chronic myelogenous leukemia, multiple myeloma,
mastocytosis, melanoma, breast cancer, ovarian cancer, canine mast
cell tumors, hypertrophy, asthma, rheumatoid arthritis, allergic
rhinitis, multiple sclerosis, inflammatory bowel syndrome,
transplant rejection, systemic lupus erythematosis, Wegener's
granulomatosis, Chronic Obstructive Pulmonary Disease, emphysema,
atherosclerosis, insulin resistance, hyperglycemia, lipolysis,
hypereosinophilia, osteoporosis, increased risk of fracture,
hypercalcemia, bone metastases, glomerulonephritis, interstitial
nephritis, Lupus nephritis, tubular necrosis, and
diabetes-associated renal complications.
43. The method of claim 36, wherein L.sup.1 is CH.sub.2.
44. The method of claim 36, wherein L.sup.2 is selected from the
group consisting of --O--CH.sub.2--, NH--CH.sub.2--,
--NH--CH(CH.sub.3)-- and --NH--C(O).
45. The method of claim 36, wherein L.sup.1 is CH.sub.2 and L.sup.2
is selected from the group consisting of --O--CH.sub.2--,
NH--CH.sub.2--, --NH--CH(CH.sub.3)-- and --NH--C(O).
46. The method of claim 36, wherein Y.sub.1 is CH and Y.sub.2 is
CR.sup.5.
47. The method of claim 46, wherein R.sup.5 is fluoro, chloro,
lower alkyl or lower alkoxy.
48. The method of claim 46, wherein R.sup.5 is chloro or
methoxy.
49. The method of claim 36, wherein Y.sub.2 is CH and Y.sub.1 is
CR.sup.4.
50. The method of claim 49, wherein R.sup.4 is fluoro, chloro,
lower alkyl or lower alkoxy.
51. The method of claim 49, wherein R.sup.4 is chloro or
methoxy.
52. The method of claim 40, wherein the disease or condition is
selected from the group consisting of mast cell tumors, small cell
lung cancer, testicular cancer, gastrointestinal stromal tumors,
glioblastoma, astrocytoma, neuroblastoma, carcinomas of the female
genital tract, sarcomas of neuroectodermal origin, colorectal
carcinoma, carcinoma in situ, Schwann cell neoplasia associated
with neurofibromatosis, acute myeloid leukemia, acute lymphocytic
leukemia, chronic myelogenous leukemia, multiple myeloma,
mastocytosis, melanoma, breast cancer, ovarian cancer and canine
mast cell tumors.
53. The method of claim 40, wherein the disease or condition is
selected from the group consisting of hypertrophy, asthma,
rheumatoid arthritis, allergic rhinitis, multiple sclerosis,
inflammatory bowel syndrome, transplant rejection, systemic lupus
erythematosis, Wegener's granulomatosis, Chronic Obstructive
Pulmonary Disease, emphysema, atherosclerosis, insulin resistance,
hyperglycemia, lipolysis, hypereosinophilia, osteoporosis,
increased risk of fracture, hypercalcemia, bone metastases,
glomerulonephritis, interstitial nephritis, Lupus nephritis,
tubular necrosis and diabetes-associated renal complications.
54. The method of claim 45, wherein the disease or condition is
selected from the group consisting of mast cell tumors, small cell
lung cancer, testicular cancer, gastrointestinal stromal tumors,
glioblastoma, astrocytoma, neuroblastoma, carcinomas of the female
genital tract, sarcomas of neuroectodermal origin, colorectal
carcinoma, carcinoma in situ, Schwann cell neoplasia associated
with neurofibromatosis, acute myeloid leukemia, acute lymphocytic
leukemia, chronic myelogenous leukemia, multiple myeloma,
mastocytosis, melanoma, breast cancer, ovarian cancer and canine
mast cell tumors.
55. The method of claim 45, wherein the disease or condition is
selected from the group consisting of hypertrophy, asthma,
rheumatoid arthritis, allergic rhinitis, multiple sclerosis,
inflammatory bowel syndrome, transplant rejection, systemic lupus
erythematosis, Wegener's granulomatosis, Chronic Obstructive
Pulmonary Disease, emphysema, atherosclerosis, insulin resistance,
hyperglycemia, lipolysis, hypereosinophilia, osteoporosis,
increased risk of fracture, hypercalcemia, bone metastases,
glomerulonephritis, interstitial nephritis, Lupus nephritis,
tubular necrosis and diabetes-associated renal complications.
56. The kit of claim 42, wherein the compound is approved for a
medical indication selected from the group consisting of mast cell
tumors, small cell lung cancer, testicular cancer, gastrointestinal
stromal tumors, glioblastoma, astrocytoma, neuroblastoma,
carcinomas of the female genital tract, sarcomas of neuroectodermal
origin, colorectal carcinoma, carcinoma in situ, Schwann cell
neoplasia associated with neurofibromatosis, acute myeloid
leukemia, acute lymphocytic leukemia, chronic myelogenous leukemia,
multiple myeloma, mastocytosis, melanoma, breast cancer, ovarian
cancer and canine mast cell tumors.
57. The kit of claim 42, wherein the compound is approved for a
medical indication selected from the group consisting of
hypertrophy, asthma, rheumatoid arthritis, allergic rhinitis,
multiple sclerosis, inflammatory bowel syndrome, transplant
rejection, systemic lupus erythematosis, Wegener's granulomatosis,
Chronic Obstructive Pulmonary Disease, emphysema, atherosclerosis,
insulin resistance, hyperglycemia, lipolysis, hypereosinophilia,
osteoporosis, increased risk of fracture, hypercalcemia, bone
metastases, glomerulonephritis, interstitial nephritis, Lupus
nephritis, tubular necrosis, and diabetes-associated renal
complications.
Description
RELATED PATENT APPLICATIONS
[0001] This application is a Continuation of U.S. patent
application Ser. No. 11/435,381, entitled Compounds Modulating
c-Kit Activity and Uses Therefor", filed May 16, 2006, which claims
the benefit of U.S. Provisional App. No. 60/682,063, entitled
"Compounds Modulating c-Kit Activity and Uses Therefor", filed May
17, 2005, U.S. Provisional App. No. 60/682,051, entitled "Compounds
Modulating c-Fms Activity and Uses Therefor", filed May 17, 2005,
U.S. Provisional App. No. 60/682,042, entitled "Compounds
Modulating c-Kit and c-Fms Activity and Uses Therefor", filed May
17, 2005, U.S. Provisional App. No. 60/692,750, entitled "Compounds
Modulating c-Kit and c-Fms Activity and Uses Therefor", filed Jun.
22, 2005, and U.S. Provisional App. No. 60/692,960, entitled
"Compounds and Methods for Kinase Modulation, and Indications
Therefor", filed Jun. 22, 2005, all of which are incorporated
herein by reference in their entireties and for all purposes.
FIELD OF THE INVENTION
[0002] This invention relates to ligands for c-kit and c-fms, and
to methods for use thereof. The information provided is intended
solely to assist the understanding of the reader. None of the
information provided nor references cited is admitted to be prior
art to the present invention. Each of the references cited is
incorporated herein in its entirety and for any purpose.
BACKGROUND OF THE INVENTION
[0003] C-kit and c-fms are both type III transmembrane receptor
protein tyrosine kinases (RPTKs) that regulate key signal
transduction cascades that control cellular growth and
proliferation. Both receptors have similar structural features
comprising five extracellular immunoglobulin (IG) domains, a single
transmembrane domain, and a split cytoplasmic kinase domain
separated by a kinase insert segment.
[0004] c-Kit
[0005] The Stem Cell Factor (SCF) receptor c-kit plays an important
role in the development of melanocytes and mast, germ and
hematopoietic cells. Stem Cell Factor (SCF) is a protein encoded by
the 51 locus, and has also been called "kit ligand" (KL) and mast
cell growth factor (MGF), based on the biological properties used
to identify it (reviewed in Tsujimura, Pathol Int 1996, 46:933-938;
Loveland, et al., J. Endocrinol 1997, 153:337-344; Vliagoftis, et
al., Clin Immunol 1997, 100:435-440; Broudy, Blood 1997,
90:1345-1364; Pignon, Hermatol Cell Ther 1997, 39:114-116; and
Lyman, et al., Blood 1998, 91:1101-1134.). Herein the abbreviation
SCF refers to the physiological ligand for c-kit.
[0006] SCF is synthesized as a transmembrane protein with a
molecular weight of 220 or 248 Dalton, depending on alternative
splicing of the mRNA to encode exon 6. The larger protein can be
proteolytically cleaved to form a soluble, glycosylated protein
which noncovalently dimerizes. Both the soluble and membrane-bound
forms of SCF can bind to and activate c-kit. For example, in the
skin, SCF is predominantly expressed by fibroblasts, keratinocytes,
and endothelial cells, which modulate the activity of melanocytes
and mast cells expressing c-kit. In bone, marrow stromal cells
express SCF and regulate hematopoiesis of c-kit expressing stem
cells. In the gastrointestinal tract, intestinal epithelial cells
express SCF and affect the interstitial cells of Cajal and
intraepithelial lymphocytes. In the testis, sertoli cells and
granulosa cells express SCF which regulates spermatogenesis by
interaction with c-kit on germ cells.
[0007] c-Fms
[0008] C-fms is a member of the family of genes originally isolated
from the Susan McDonough strain of feline sarcoma viruses. The
cellular proto-oncogene FMS (c-fms, cellular feline McDonough
sarcoma) codes for the receptor for the macrophage
colony-stimulating factor (M-CSF). C-fms is crucial for the growth
and differentiation of the monocyte-macrophage lineage, and upon
binding of M-CSF to the extracellular domain of c-fms, the receptor
dimerizes and trans-autophosphorylates cytoplasmic tyrosine
residues.
[0009] M-CSF, first described by Robinson and co-workers (Blood.
1969, 33:396-9), is a cytokine that controls the production,
differentiation, and function of macrophages. M-CSF stimulates
differentiation of progenitor cells to mature monocytes, and
prolongs the survival of monocytes. Furthermore, M-CSF enhances
cytotoxicity, superoxide production, phagocytosis, chemotaxis, and
secondary cytokine production of additional factors in monocytes
and macrophages. Examples of such additional factors include
granulocyte colony stimulating factor (G-CSF), interleukin-6
(IL-6), and interleukin-8 (IL-8). M-CSF stimulates hematopoiesis,
promotes differentiation and proliferation of osteoclast progenitor
cells, and has profound effects on lipid metabolism. Furthermore,
M-CSF is important in pregnancy. Physiologically, large amounts of
M-CSF are produced in the placenta, and M-CSF is believed to play
an essential role in trophoblast differentiation (Motoyoshi, Int J
Hematol. 1998, 67:109-22). The elevated serum levels of M-CSF in
early pregnancy may participate in the immunologic mechanisms
responsible for the maintenance of the pregnancy (Flanagan &
Lader, Curr Opin Hematol. 1998, 5:181-5).
[0010] Related to c-fms and c-kit are two platelet-derived growth
factor receptors, alpha (i.e., pdgfra) and beta (pdgfrb) (PDGF).
The gene coding for pdgfra is located on chromosome 4q11-q12 in the
same region of chromosome 4 as the oncogene coding for c-kit. The
genes coding for pdgfra and c-fms appear to have evolved from a
common ancestral gene by gene duplication, inasmuch as these two
genes are tandemly linked on chromosome 5. They are oriented
head-to-tail with the 5-prime exon of the c-fms gene located only
500 bp from the last 3-prime exon of the gene coding for pdgfra.
Most gastrointestinal stromal tumors (GIST) have activating
mutations in c-kit, and most patients with GISTs respond well to
Gleevec, which inhibits c-kit. Heinrich et al. (Science 2003,
299:708-10) have shown that approximately 35% of GISTs lacking
c-kit mutations have intragenic activation mutations in the gene
encoding pdgfra, and that tumors expressing c-kit or pdgfra are
indistinguishable with respect to activation of downstream
signaling intermediates and cytogenetic changes associated with
tumor progression. Thus, c-kit and pdgfra mutations appear to be
alternative and mutually exclusive oncogenic mechanisms in
GISTs.
[0011] Similarly, the observation that production of M-CSF, the
major macrophage growth factor, is increased in tissues during
inflammation points out a role for c-fms in diseases, such as for
example inflammatory diseases. More particularly, because elevated
levels of M-CSF are found in the disease state, modulation of the
activity of c-fms can ameliorate disease associated with increased
levels of M-CSF.
[0012] Accordingly, there is need in the art for potent and
specific inhibitors and modulators of c-kit and/or c-fms and
methods for designing them.
SUMMARY OF THE INVENTION
[0013] The present invention relates to compounds active on c-kit,
c-fms, or both c-kit and c-fms. In accordance with one aspect of
the present invention, it has been discovered that in the treatment
of diseases amenable to treatment by an effective amount of a
modulator of either c-kit alone or c-fms alone, the efficacy of
treatment can be enhanced if said compounds are dual inhibitors of
both c-kit and c-fms. In particular, the invention provides methods
of using compounds of Formula I as described below. Thus, the
invention provides methods of using compounds that can be used
therapeutically and/or prophylactically involving modulation of
c-kit, c-fms, or both c-kit and c-fms.
[0014] The compounds of Formula I have the following structure:
##STR00001##
all salts, prodrugs, tautomers, and isomers thereof, wherein:
[0015] X.sub.1 is N or CR.sup.2, X.sub.2 is N or CR.sup.6, Y.sub.1
is N or CR.sup.4, and Y.sub.2 is N or CR.sup.5, provided, however,
that not more than one of X.sub.2, Y.sub.1 and Y.sub.2 is N; [0016]
L.sup.1 is selected from the group consisting of optionally
substituted lower alkylene, --S--, --O--, --C(O)--, --C(S)--,
--S(O)--, --S(O).sub.2--, and --NR.sup.7--; [0017] L.sup.2 is
selected from the group consisting of a bond, optionally
substituted lower alkylene, -(alk).sub.a-S-(alk).sub.b-,
-(alk).sub.a-O-(alk).sub.b-, -(alk).sub.a-OC(O)-(alk).sub.b-,
-(alk).sub.a-C(O)O-(alk).sub.b-, -(alk).sub.a-OC(S)-(alk).sub.b-,
-(alk).sub.a-C(S)O-(alk).sub.b-, -(alk).sub.a-C(O)-(alk).sub.b-,
-(alk).sub.a-C(S)-(alk).sub.b-,
-(alk).sub.a-C(O)NR.sup.9-(alk).sub.b-,
-(alk).sub.a-OC(O)NR.sup.9-(alk).sub.b-,
-(alk).sub.a-OC(S)NR.sup.9-(alk).sub.b-,
-(alk).sub.a-C(S)NR.sup.9-(alk).sub.b-,
-(alk).sub.a-S(O)-(alk).sub.b-,
-(alk).sub.a-S(O).sub.2-(alk).sub.b-,
-(alk).sub.a-S(O).sub.2NR.sup.9-(alk).sub.b-,
-(alk).sub.a-NR.sup.9-(alk).sub.b-,
-(alk).sub.a-NR.sup.9C(O)-(alk).sub.b-,
-(alk).sub.a-NR.sup.9C(S)-(alk).sub.b-,
-(alk).sub.a-NR.sup.9C(O)NR.sup.9-(alk).sub.b-,
-(alk).sub.a-NR.sup.9C(S)NR.sup.9-(alk).sub.b-,
-(alk).sub.a-NR.sup.9C(O)O-(alk).sub.b-,
-(alk).sub.a-NR.sup.9C(S)O-(alk).sub.b-,
-(alk).sub.a-NR.sup.9S(O).sub.2-(alk).sub.b-, and
-(alk).sub.a-NR.sup.9S(O).sub.2NR.sup.9-(alk).sub.b-, wherein alk
is optionally substituted C.sub.1-3 alkylene and a and b are
independently 0 or 1; [0018] R.sup.1 is selected from the group
consisting of optionally substituted lower alkyl, optionally
substituted cycloalkyl, optionally substituted heterocycloalkyl,
optionally substituted aryl, and optionally substituted heteroaryl;
[0019] R.sup.2, R.sup.4, R.sup.5 and R.sup.6 are independently
selected from the group consisting of hydrogen, halogen, optionally
substituted lower alkyl, optionally substituted lower alkenyl,
optionally substituted lower alkynyl, optionally substituted
cycloalkyl, optionally substituted heterocycloalkyl, optionally
substituted aryl, optionally substituted heteroaryl, --OH,
--NH.sub.2, --NO.sub.2, --CN, --C(O)OH, --C(S)OH, --C(O)NH.sub.2,
--C(S)NH.sub.2, --S(O).sub.2NH.sub.2, --NHC(O)NH.sub.2,
--NHC(S)NH.sub.2, --NHS(O).sub.2NH.sub.2, --NR.sup.10R.sup.11,
--NHR.sup.3, --OR.sup.3, --SR.sup.3, --C(O)R.sup.3, --C(S)R.sup.3,
--S(O)R.sup.3, --S(O).sub.2R.sup.3, --C(O)OR.sup.3, --C(S)OR.sup.3,
--C(O)NHR.sup.3, --C(O)NR.sup.3R.sup.3, --C(S)NHR.sup.3,
--C(S)NR.sup.3R.sup.3, --S(O).sub.2NHR.sup.3,
--S(O).sub.2NR.sup.3R.sup.3, --NHC(O)R.sup.3,
--NR.sup.3C(O)R.sup.3, --NHC(S)R.sup.3, --NR.sup.3C(S)R.sup.3,
--NHS(O).sub.2R.sup.3, --NR.sup.3S(O).sub.2R.sup.3,
--NHC(O)OR.sup.3, --NR.sup.3C(O)OH, --NR.sup.3C(O)OR.sup.3,
--NHC(S)OR.sup.3, --NR.sup.3C(S)OH, --NR.sup.3C(S)OR.sup.3,
--NHC(O)NHR.sup.3, --NHC(O)NR.sup.3R.sup.3, --NR.sup.3C(O)NH.sub.2,
--NR.sup.3C(O)NHR.sup.3, --NR.sup.3C(O)NR.sup.3R.sup.3,
--NHC(S)NHR.sup.3, --NHC(S)NR.sup.3R.sup.3, --NR.sup.3C(S)NH.sub.2,
--NR.sup.3C(S)NHR.sup.3, --NR.sup.3C(S)NR.sup.3R.sup.3,
--NHS(O).sub.2NHR.sup.3, --NHS(O).sub.2NR.sup.3R.sup.3,
--NR.sup.3S(O).sub.2NH.sub.2, --NR.sup.3S(O).sub.2NHR.sup.3, and
--NR.sup.3S(O).sub.2NR.sup.3R.sup.3; [0020] Ar.sub.1 is a 5 or 6
membered optionally substituted heteroarylene having the
structure
[0020] ##STR00002## wherein
##STR00003## indicates the point of attachment of L.sup.1 and
##STR00004## indicates the point of attachment of L.sup.2, and
wherein the indicated N is either .dbd.N-- or --N.dbd.; [0021] n is
0 or 1; [0022] F and J are both C or one of F and J is C and the
other of F and J is N; [0023] P and Q are independently selected
from CR, N, NR, O or S; [0024] T is selected from CR or N; [0025]
wherein [0026] when n is 1, F and J are C, and P, T and Q are CR,
or any one of P, T and Q is N and the other two of P, T and Q are
CR, [0027] when n is 0 and F and J are both C, then one of P and Q
are CR, N or NR and the other of P and Q is C, N, NR, O or S,
provided both P and Q are not CR, [0028] when n is 0, one of F and
J is N and the other of F and J is C, then one of P and Q is N and
the other of P and Q is CR or both P and Q are CR, and [0029] R is
hydrogen or an optional substituent as defined herein for
optionally substituted heteroarylene that provides a stable
compound; [0030] R.sup.3 at each occurrence is independently
selected from the group consisting of optionally substituted lower
alkyl, optionally substituted lower alkenyl, provided, however,
that no alkene carbon thereof is bound to any --C(O)--, --C(S)--,
--S(O)--, --S(O).sub.2--, --O--, --S--, or --N-- of any of
--OR.sup.3, --SR.sup.3, --C(O)R.sup.3, --C(S)R.sup.3,
--S(O)R.sup.3, --S(O).sub.2R.sup.3, --C(O)OR.sup.3, --C(S)OR.sup.3,
--C(O)NHR.sup.3, --C(O)NR.sup.3R.sup.3, --C(S)NHR.sup.3,
--C(S)NR.sup.3R.sup.3, --S(O).sub.2NHR.sup.3,
--S(O).sub.2NR.sup.3R.sup.3, --NHR.sup.3, --NHC(O)R.sup.3,
--NR.sup.3C(O)R.sup.3, --NHC(S)R.sup.3, --NR.sup.3C(S)R.sup.3,
--NHS(O).sub.2R.sup.3, --NR.sup.3S(O).sub.2R.sup.3,
--NHC(O)OR.sup.3, --NR.sup.3C(O)OH, --NR.sup.3C(O)OR.sup.3,
--NHC(S)OR.sup.3, --NR.sup.3C(S)OH, --NR.sup.3C(S)OR.sup.3,
--NHC(O)NHR.sup.3, --NHC(O)NR.sup.3R.sup.3, --NR.sup.3C(O)NH.sub.2,
--NR.sup.3C(O)NHR.sup.3, --NR.sup.3C(O)NR.sup.3R.sup.3,
--NHC(S)NHR.sup.3, --NHC(S)NR.sup.3R.sup.3, --NR.sup.3C(S)NH.sub.2,
--NR.sup.3C(S)NHR.sup.3, --NR.sup.3C(S)NR.sup.3R.sup.3,
--NHS(O).sub.2NHR.sup.3, --NHS(O).sub.2NR.sup.3R.sup.3,
--NR.sup.3S(O).sub.2NH.sub.2, --NR.sup.3S(O).sub.2NHR.sup.3, or
--NR.sup.3S(O).sub.2NR.sup.3R.sup.3, optionally substituted lower
alkynyl, provided, however, that no alkyne carbon thereof is bound
to any --C(O)--, --C(S)--, --S(O)--, --S(O).sub.2--, --O--, --S--,
or --N-- of any of --OR.sup.3, --SR.sup.3, --C(O)R.sup.3,
--C(S)R.sup.3, --S(O)R.sup.3, --S(O).sub.2R.sup.3, --C(O)OR.sup.3,
--C(S)OR.sup.3, --C(O)NHR.sup.3, --C(O)NR.sup.3R.sup.3,
--C(S)NHR.sup.3, --C(S)NR.sup.3R.sup.3, --S(O).sub.2NHR.sup.3,
--S(O).sub.2NR.sup.3R.sup.3, --NHR.sup.3, --NHC(O)R.sup.3,
--NR.sup.3C(O)R.sup.3, --NHC(S)R.sup.3, --NR.sup.3C(S)R.sup.3,
--NHS(O).sub.2R.sup.3, --NR.sup.3S(O).sub.2R.sup.3,
--NHC(O)OR.sup.3, --NR.sup.3C(O)OH, --NR.sup.3C(O)OR.sup.3,
--NHC(S)OR.sup.3, --NR.sup.3C(S)OH, --NR.sup.3C(S)OR.sup.3,
--NHC(O)NHR.sup.3, --NHC(O)NR.sup.3R.sup.3, --NR.sup.3C(O)NH.sub.2,
--NR.sup.3C(O)NHR.sup.3, --NR.sup.3C(O)NR.sup.3R.sup.3,
--NHC(S)NHR.sup.3, --NHC(S)NR.sup.3R.sup.3, --NR.sup.3C(S)NH.sub.2,
--NR.sup.3C(S)NHR.sup.3, --NR.sup.3C(S)NR.sup.3R.sup.3,
--NHS(O).sub.2NHR.sup.3, --NHS(O).sub.2NR.sup.3R.sup.3,
--NR.sup.3S(O).sub.2NH.sub.2, --NR.sup.3S(O).sub.2NHR.sup.3, or
--NR.sup.3S(O).sub.2NR.sup.3R.sup.3, optionally substituted
cycloalkyl, optionally substituted heterocycloalkyl, optionally
substituted aryl, and optionally substituted heteroaryl; [0031]
R.sup.7 is selected from the group consisting of hydrogen,
optionally substituted lower alkyl, optionally substituted
cycloalkyl, optionally substituted heterocycloalkyl, optionally
substituted aryl, optionally substituted heteroaryl, --C(O)R.sup.8,
and --S(O).sub.2R.sup.8; [0032] R.sup.8 is selected from the group
consisting of optionally substituted lower alkyl, optionally
substituted cycloalkyl, optionally substituted heterocycloalkyl,
optionally substituted aryl and optionally substituted heteroaryl;
[0033] R.sup.9 at each occurrence is independently selected from
the group consisting of hydrogen, lower alkyl, and lower alkyl
substituted with one or more substituents selected from the group
consisting of fluoro, --OH, --NH.sub.2, lower alkoxy, fluoro
substituted lower alkoxy, lower alkylthio, fluoro substituted lower
alkylthio, mono-alkylamino, fluoro substituted mono-alkylamino,
di-alkylamino, fluoro substituted di-alkylamino, and
--NR.sup.12R.sup.13, provided, however, that when R.sup.9 is
substituted lower alkyl, any substitution on the alkyl carbon bound
to the --N-- of --NR.sup.9-- is fluoro; [0034] R.sup.10 and
R.sup.11 at each occurrence are independently selected from the
group consisting of optionally substituted lower alkyl, optionally
substituted lower alkenyl, provided, however, that no alkene carbon
thereof is bound to the nitrogen of --NR.sup.10R.sup.11, optionally
substituted lower alkynyl, provided, however, that no alkyne carbon
thereof is bound to the nitrogen of --NR.sup.10R.sup.11, optionally
substituted cycloalkyl, optionally substituted heterocycloalkyl,
optionally substituted aryl, and optionally substituted heteroaryl;
or [0035] R.sup.10 and R.sup.11 together with the nitrogen to which
they are attached form a monocyclic 5-7 membered optionally
substituted heterocycloalkyl or a monocyclic 5 or 7 membered
optionally substituted nitrogen containing heteroaryl; and [0036]
R.sup.12 and R.sup.13 combine with the nitrogen to which they are
attached to form a 5-7 membered heterocycloalkyl or 5-7 membered
heterocycloalkyl substituted with one or more substituents selected
from the group consisting of fluoro, --OH, --NH.sub.2, lower alkyl,
fluoro substituted lower alkyl, lower alkoxy, fluoro substituted
lower alkoxy, lower alkylthio, and fluoro substituted lower
alkylthio; [0037] provided, however that when compounds have the
structure
[0037] ##STR00005## [0038] and L.sup.1a is --CH.sub.2--,
--CH(OH)--, or --C(O)--, then R.sup.1a is not phenyl,
4-trifluoromethyl-phenyl, 4-methoxy-phenyl, 4-chloro-phenyl,
4-fluoro-phenyl, 4-methyl-phenyl, 3-fluoro-phenyl or thiophen-2-yl
and compounds do not have the structure
##STR00006##
[0039] In reference to Formula I, the core structure shown above
with X.sub.1, X.sub.2, Y.sub.1 and Y.sub.2 as CH and with
L.sup.1-Ar.sub.1-L.sup.2-R.sup.1 replaced with H is referred to as
the "azaindole core." For that azaindole core, reference to ring
atoms or ring positions is as shown in the following structure:
##STR00007##
[0040] In one embodiment of compounds of Formula I, compounds have
a structure selected from the following:
##STR00008##
wherein L.sup.1, Ar.sub.1, L.sup.2, R.sup.1, R.sup.2, R.sup.4,
R.sup.5 and R.sup.6 are as defined for Formula I.
[0041] In one embodiment of compounds of Formula I, X.sub.1 and
X.sub.2 are N or CH. In another embodiment, X.sub.1, X.sub.2 and
Y.sub.1 are N or CH, where in a further embodiment, Y.sub.2 is
CR.sup.5 and R.sup.5 is other than hydrogen. In another embodiment,
X.sub.1, X.sub.2 and Y.sub.2 are N or CH, where in a further
embodiment Y.sub.1 is CR.sup.4 and R.sup.4 is other than hydrogen.
In another embodiment, X.sub.1, X.sub.2 and Y.sub.1 are CH, where
in a further embodiment, Y.sub.2 is CR.sup.5 and R.sup.5 is other
than hydrogen. In another embodiment, X.sub.1, X.sub.2 and Y.sub.2
are CH, where in a further embodiment Y.sub.1 is CR.sup.4 and
R.sup.4 is other than hydrogen.
[0042] In one embodiment of compounds of Formula I, wherein
X.sub.1, X.sub.2, Y.sub.1 and Y.sub.2 are independently CR.sup.2,
CR.sup.6, CR.sup.4 and CR.sup.5 respectively, one of R.sup.4 or
R.sup.5 is other than hydrogen, preferably where R.sup.2 and
R.sup.6 are hydrogen. In one embodiment, wherein X.sub.1, X.sub.2,
Y.sub.1 and Y.sub.2 are independently CR.sup.2, CR.sup.6, CR.sup.4
and CR.sup.5 respectively, R.sup.2, R.sup.5 and R.sup.6 are
hydrogen and R.sup.4 is other than hydrogen. In one embodiment,
wherein X.sub.1, X.sub.2, Y.sub.1 and Y.sub.2 are independently
CR.sup.2, CR.sup.6, CR.sup.4 and CR.sup.5 respectively, R.sup.2,
R.sup.4 and R.sup.6 are hydrogen and R.sup.5 is other than
hydrogen.
[0043] In one embodiment of compounds of Formula I, X.sub.1 and
X.sub.2 are N or CH, preferably wherein both X.sub.1 and X.sub.2
are CH.
[0044] In one embodiment of compounds of Formula I, L.sup.1 is
selected from the group consisting of --S--, --O--, lower alkylene,
--C(O)--, --C(S)--, --S(O)--, --S(O).sub.2--, and --NR.sup.7--,
wherein lower alkylene is optionally substituted with fluoro, and
wherein when L.sup.2 is optionally substituted lower alkylene or
comprises optionally substituted C.sub.1-3 alkylene, the alkylene
is optionally substituted with fluoro or lower alkyl. In one
embodiment, L.sup.1 is selected from the group consisting of --S--,
--O--, --CH.sub.2--, --CF.sub.2--, --C(O)--, --C(S)--, --S(O)--,
--S(O).sub.2--, and --NH--.
[0045] In one embodiment of compounds of Formula I, L.sup.2 is
selected from the group consisting of a bond, optionally
substituted lower alkylene, --O-(alk).sub.b-, --OC(O)-(alk).sub.b-,
--C(O)O-(alk).sub.b-, --OC(S)-(alk).sub.b-, --C(S)O-(alk).sub.b-,
--C(O)-(alk).sub.b-, --C(S)-(alk).sub.b-,
--C(O)NR.sup.9-(alk).sub.b-, --OC(O)NR.sup.9-(alk).sub.b-,
--OC(S)NR.sup.9-(alk).sub.b-, --C(S)NR.sup.9-(alk).sub.b-,
--S(O)-(alk).sub.b-, --S(O).sub.2-(alk).sub.b-,
S(O).sub.2NR.sup.9-(alk).sub.b-, --NR.sup.9-(alk).sub.b-,
--NR.sup.9C(O)-(alk).sub.b-, --NR.sup.9C(O)O-(alk).sub.b-,
--NR.sup.9C(S)-(alk).sub.b-, --NR.sup.9C(S)O-(alk).sub.b-,
--NR.sup.9C(O)NR.sup.9-(alk).sub.b-,
--NR.sup.9C(S)NR.sup.9-(alk).sub.b-,
--NR.sup.9S(O).sub.2-(alk).sub.b-, and
--NR.sup.9S(O).sub.2NR.sup.9-(alk).sub.b-.
[0046] Further to any of the above embodiments of Formula I, when
L.sup.1 is substituted lower alkylene or when L.sup.2 is
substituted lower alkylene or comprises substituted C.sub.1-3
alkylene, the alkylene is substituted with one or more, preferably
1, 2, or 3 substituents selected from the group consisting of
fluoro, --OH, --NH.sub.2, lower alkoxy, lower alkylthio,
mono-alkylamino, di-alkylamino, and --NR.sup.12R.sup.13, wherein
the alkyl chain(s) of lower alkoxy, lower alkylthio,
mono-alkylamino or di-alkylamino are optionally substituted with
one or more, preferably 1, 2, or 3 substituents selected from the
group consisting of fluoro, --OH, --NH.sub.2, lower alkoxy, fluoro
substituted lower alkoxy, lower alkylthio, fluoro substituted lower
alkylthio, mono-alkylamino, di-alkylamino, or cycloalkylamino.
[0047] In one embodiment of the compounds of Formula I, the
variables P, J, Q, T, F, and n are selected to provide structures
of Ar.sub.1 selected from the group consisting of
##STR00009## ##STR00010## ##STR00011##
where each R is independently hydrogen or an optional substituent
as defined herein for optionally substituted heteroaryl.
[0048] The compounds of Formula I, and all sub-embodiments detailed
herein, may be used to treat a subject suffering from or at risk of
a Kit and/or Fms protein kinase mediated disease or condition, such
as those disclosed in this application.
[0049] In one embodiment, a compound of Formula I has a structure
according to the following sub-generic structure, Formula Ia,
##STR00012##
all salts, prodrugs, tautomers, and isomers thereof, wherein
L.sup.1, Ar.sub.1, R.sup.1, R.sup.2, R.sup.4, R.sup.5 and R.sup.6
are as defined for Formula I; [0050] L.sup.3 is selected from the
group consisting of a bond, optionally substituted lower alkylene,
--O-(alk).sub.b-, --S-(alk).sub.b-, --NR.sup.14-(alk).sub.b-,
--C(O)-(alk).sub.b-, --C(S)-(alk).sub.b-, --S(O)-(alk).sub.b-,
--S(O).sub.2-(alk).sub.b-, --NR.sup.14C(O)-(alk).sub.b-,
--C(O)NR.sup.14-(alk).sub.b-, --S(O).sub.2NR.sup.14-(alk).sub.b-,
--NR.sup.14S(O).sub.2-(alk).sub.b-,
--NR.sup.14C(O)NR.sup.14-(alk).sub.b-,
--NR.sup.14C(S)NR.sup.14-(alk).sub.b-, and
--NR.sup.14S(O).sub.2NR.sup.14-(alk).sub.b-; [0051] alk is
optionally substituted lower alkylene; [0052] b is 0 or 1; and
[0053] R.sup.14 is hydrogen or lower alkyl.
[0054] In another embodiment of compounds of Formula Ia, R.sup.2,
R.sup.5 and R.sup.6 are hydrogen, further wherein R.sup.4 is other
than hydrogen. In another embodiment, R.sup.2, R.sup.4 and R.sup.6
are hydrogen, further wherein R.sup.5 is other than hydrogen.
[0055] The compounds of Formula Ia, and all sub-embodiments
detailed herein, may be used to treat a subject suffering from or
at risk of a Kit and/or Fms protein kinase mediated disease or
condition, such as those disclosed in this application.
[0056] In particular embodiments the compound of Formula I has a
structure according to the following sub-generic structure, Formula
Ib,
##STR00013##
all salts, prodrugs, tautomers, and isomers thereof, wherein:
[0057] V and W are independently selected from the group consisting
of N and CH; [0058] U and Z are independently selected from the
group consisting of N and CR.sup.18, provided, however, that not
more than one of W, U and Z is N; [0059] A is selected from the
group consisting of --CR.sup.19R.sup.20--, --C(O)--, --C(S)--,
--S--, --S(O)--, --S(O).sub.2--, --NR.sup.21--, and --O--; [0060] n
is 0 or 1; [0061] F and J are both C or one of F and J is C and the
other of F and J is N; [0062] E and K are selected from C, N, O or
S; [0063] G is selected from C or N; [0064] wherein [0065] when n
is 1, F and J are C, and E, G and K are C, or any one of E, G and K
is N and the other two of E, G and K are C, provided that when E, G
or K is N, R.sup.15, R.sup.17 and R.sup.16, respectively, are
absent, [0066] when n is 0 and F and J are both C, then one of E
and K is C or N and the other of E and K is C, N, O or S, provided
both E and K are not C, and provided that when both E and K are N,
one of R.sup.15 and R.sup.16 is absent, and provided that when one
of E and K are N and the other is O or S, R.sup.15 and R.sup.16 are
absent, [0067] when n is 0, one of F and J is N and the other of F
and J is C, then one of E and K is N and the other of E and K is C,
or both E and K are C, provided that when E is N, R.sup.15 is
absent and when K is N, R.sup.16 is absent; [0068] R.sup.1 is
selected from the group consisting of optionally substituted lower
alkyl, optionally substituted cycloalkyl, optionally substituted
heterocycloalkyl, optionally substituted aryl and optionally
substituted heteroaryl; [0069] R.sup.15 is selected from the group
consisting of hydrogen, optionally substituted lower alkyl,
--OR.sup.22, --SR.sup.22 and halogen when E is C, is absent when E
is O or S or when n=1 and E is N, and is absent or selected from
the group consisting of hydrogen and optionally substituted lower
alkyl when n=0 and E is N; [0070] R.sup.16 is selected from the
group consisting of hydrogen, optionally substituted lower alkyl,
--OR.sup.22, --SR.sup.22 and halogen when K is C, is absent when K
is O or S or when n=1 and K is N, and is absent or selected from
the group consisting of hydrogen and optionally substituted lower
alkyl when n=0 and K is N; [0071] R.sup.17 is selected from the
group consisting of hydrogen, optionally substituted lower alkyl,
--OR.sup.22, --SR.sup.22 and halogen when G is C, or is absent when
G is N; [0072] R.sup.18 is selected from the group consisting of
hydrogen, halogen, optionally substituted lower alkyl, optionally
substituted aryl, optionally substituted heteroaryl, --OH,
--NH.sub.2, --NO.sub.2, --CN, --NHC(O)NH.sub.2, --NHC(S)NH.sub.2,
--NHS(O).sub.2NH.sub.2, --NR.sup.24R.sup.25, --NHR.sup.23,
--OR.sup.23, --SR.sup.23, --NHC(O)R.sup.23,
--NR.sup.23C(O)R.sup.23, --NHC(S)R.sup.23, --NR.sup.23C(S)R.sup.23,
--NHS(O).sub.2R.sup.23, --NR.sup.23S(O).sub.2R.sup.23,
--NHC(O)NHR.sup.23, --NR.sup.23C(O)NH.sub.2,
--NR.sup.23C(O)NHR.sup.23, --NHC(O)NR.sup.23R.sup.23,
--NR.sup.23C(O)NR.sup.23R.sup.23, --NHC(S)NHR.sup.23,
--NR.sup.23C(S)NH.sub.2, --NR.sup.23C(S)NHR.sup.23,
--NHC(S)NR.sup.23R.sup.23, --NR.sup.23C(S)NR.sup.23R.sup.23,
--NHS(O).sub.2NHR.sup.23, --NR.sup.23S(O).sub.2NH.sub.2,
--NR.sup.23S(O).sub.2NHR.sup.23, --NHS(O).sub.2NR.sup.23R.sup.23;
and --NR.sup.23S(O).sub.2NR.sup.23R.sup.23; [0073] M is selected
from the group consisting of a bond, --(CR.sup.19R.sup.20).sub.u--,
--(CR.sup.19R.sup.20).sub.t--C(O)--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--C(S)--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--C(O)O--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--C(S)O--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--C(O)NR.sup.26--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--C(S)NR.sup.26--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--S(O)--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--S(O).sub.2--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--S(O).sub.2NR.sup.26--(CR.sup.19R.sup.20).sub-
.s--, --(CR.sup.19R.sup.20).sub.t--O--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--OC(O)--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--OC(S)--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--OC(O)NR.sup.26--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--OC(S)NR.sup.26--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--S--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--NR.sup.26--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--NR.sup.26C(S)--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--NR.sup.26C(O)O--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--NR.sup.26C(S)O--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--NR.sup.26C(O)NR.sup.26--(CR.sup.19R.sup.20).-
sub.s--,
--(CR.sup.19R.sup.20).sub.t--NR.sup.26C(S)NR.sup.26--(CR.sup.19R.-
sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.t--NR.sup.26S(O).sub.2--(CR.sup.19R.sup.20).sub-
.s--, and
--(CR.sup.19R.sup.20).sub.t--NR.sup.26S(O).sub.2NR.sup.26--(CR.s-
up.19R.sup.20).sub.s--; [0074] wherein R.sup.19 and R.sup.20 at
each occurrence are independently selected from the group
consisting of hydrogen, fluoro, --OH, --NH.sub.2, lower alkyl,
lower alkoxy, lower alklylthio, mono-alkylamino, di-alkylamino, and
--NR.sup.27R.sup.28, wherein the alkyl chain(s) of lower alkyl,
lower alkoxy, lower alkylthio, mono-alkylamino, or di-alkylamino
are optionally substituted with one or more substituents selected
from the group consisting of fluoro, --OH, --NH.sub.2, lower
alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro
substituted lower alkylthio, mono-alkylamino, di-alkylamino, and
cycloalkylamino; or [0075] any two of R.sup.19 and R.sup.20 on the
same or different carbons combine to form a 3-7 membered monocyclic
cycloalkyl or 5-7 membered monocyclic heterocycloalkyl and any
others of R.sup.19 and R.sup.20 are independently selected from the
group consisting of hydrogen, fluoro, --OH, --NH.sub.2, lower
alkyl, lower alkoxy, lower alklylthio, mono-alkylamino,
di-alkylamino, and --NR.sup.27R.sup.28, wherein the alkyl chain(s)
of lower alkyl, lower alkoxy, lower alkylthio, mono-alkylamino, or
di-alkylamino are optionally substituted with one or more
substituents selected from the group consisting of fluoro, --OH,
--NH.sub.2, lower alkoxy, fluoro substituted lower alkoxy, lower
alkylthio, fluoro substituted lower alkylthio, mono-alkylamino,
di-alkylamino, and cycloalkylamino, and wherein the monocyclic
cycloalkyl or monocyclic heterocycloalkyl are optionally
substituted with one or more substituents selected from the group
consisting of halogen, --OH, --NH.sub.2, lower alkyl, fluoro
substituted lower alkyl, lower alkoxy, fluoro substituted lower
alkoxy, lower alkylthio, fluoro substituted lower alkylthio,
mono-alkylamino, di-alkylamino, and cycloalkylamino; [0076]
R.sup.21 and R.sup.22 at each occurrence are independently hydrogen
or optionally substituted lower alkyl; [0077] R.sup.23 at each
occurrence is independently selected from the group consisting of
optionally substituted lower alkyl, optionally substituted lower
alkenyl, provided, however, that no alkene carbon thereof is bound
to any --C(O)--, --C(S)--, --S(O).sub.2--, --O--, --S--, or --N--
of any of --NHR.sup.23, --OR.sup.23, --SR.sup.23, --NHC(O)R.sup.23,
--NR.sup.23C(O)R.sup.23, --NHC(S)R.sup.23, --NR.sup.23C(S)R.sup.23,
--NHS(O).sub.2R.sup.23, --NR.sup.23S(O).sub.2R.sup.23,
--NHC(O)NHR.sup.23, --NR.sup.23C(O)NH.sub.2,
--NR.sup.23C(O)NHR.sup.23, --NHC(O)NR.sup.23R.sup.23,
--NR.sup.23C(O)NR.sup.23R.sup.23, --NHC(S)NHR.sup.23,
--NR.sup.23C(S)NH.sub.2, --NR.sup.23C(S)NHR.sup.23,
--NHC(S)NR.sup.23R.sup.23, --NR.sup.23C(S)NR.sup.23R.sup.23,
--NHS(O).sub.2NHR.sup.23, --NR.sup.23S(O).sub.2NH.sub.2,
--NR.sup.23S(O).sub.2NHR.sup.23, --NHS(O).sub.2NR.sup.23R.sup.23,
or --NR.sup.23S(O).sub.2NR.sup.23R.sup.23, optionally substituted
lower alkynyl, provided, however, that no alkyne carbon thereof is
bound to any --C(O)--, --C(S)--, --S(O)--, --S(O).sub.2--, --O--,
--S--, or --N-- of any of --NHR.sup.23, --OR.sup.23, --SR.sup.23,
--NHC(O)R.sup.23, --NR.sup.23C(O)R.sup.23, --NHC(S)R.sup.23,
--NR.sup.23C(S)R.sup.23, --NHS(O).sub.2R.sup.23,
--NR.sup.23S(O).sub.2R.sup.23, --NHC(O)NHR.sup.23,
--NR.sup.23C(O)NH.sub.2, --NR.sup.23C(O)NHR.sup.23,
--NHC(O)NR.sup.23R.sup.23, --NR.sup.23C(O)NR.sup.23R.sup.23,
--NHC(S)NHR.sup.23, --NR.sup.23C(S)NH.sub.2,
--NR.sup.23C(S)NHR.sup.23, --NHC(S)NR.sup.23R.sup.23,
--NR.sup.23C(S)NR.sup.23R.sup.23, --NHS(O).sub.2NHR.sup.23,
--NR.sup.23S(O).sub.2NH.sub.2, --NR.sup.23S(O).sub.2NHR.sup.23,
--NHS(O).sub.2NR.sup.23R.sup.23, or
--NR.sup.23S(O).sub.2NR.sup.23R.sup.23, optionally substituted
cycloalkyl, optionally substituted heterocycloalkyl, optionally
substituted aryl, and optionally substituted heteroaryl; [0078]
R.sup.24 and R.sup.25 at each occurrence are independently selected
from the group consisting of optionally substituted lower alkyl,
optionally substituted lower alkenyl, provided, however, that no
alkene carbon thereof is bound to the nitrogen of
--NR.sup.24R.sup.25, optionally substituted lower alkynyl,
provided, however, that no alkyne carbon thereof is bound to the
nitrogen of --NR.sup.24R.sup.25, optionally substituted cycloalkyl,
optionally substituted heterocycloalkyl, optionally substituted
aryl, and optionally substituted heteroaryl; or [0079] R.sup.24 and
R.sup.25 together with the nitrogen to which they are attached form
a monocyclic 5-7 membered optionally substituted heterocycloalkyl
or a monocyclic 5 or 7 membered optionally substituted nitrogen
containing heteroaryl; [0080] R.sup.26 at each occurrence is
independently selected from the group consisting of hydrogen, lower
alkyl, and lower alkyl substituted with one or more substituents
selected from the group consisting of fluoro, --OH, --NH.sub.2,
lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio,
fluoro substituted lower alkylthio, mono-alkylamino, fluoro
substituted mono-alkylamino, di-alkylamino, fluoro substituted
di-alkylamino, and --NR.sup.27R.sup.28, provided, however, that
when R.sup.26 is substituted lower alkyl, any substitution on the
lower alkyl carbon bound to the --N-- of --NR.sup.26-- is fluoro;
[0081] R.sup.27 and R.sup.28 combine with the nitrogen to which
they are attached to form a 5-7 membered heterocycloalkyl or 5-7
membered heterocycloalkyl substituted with one or more substituents
selected from the group consisting of fluoro, --OH, --NH.sub.2,
lower alkyl, fluoro substituted lower alkyl, lower alkoxy, fluoro
substituted lower alkoxy, lower alkylthio, and fluoro substituted
lower alkylthio; [0082] u is 1-6; [0083] t is 0-3; and [0084] s is
0-3; [0085] provided that [0086] when V, W, U and Z are CH, n=1, E,
F, G, J, and K are C, R.sup.15, R.sup.16 and R.sup.17 are H, A is
--CH.sub.2--, --CH(OH)--, or --C(O)--, and M is --NHCH.sub.2--,
then R.sup.1 is not phenyl, 4-trifluoromethyl-phenyl,
4-methoxy-phenyl, 4-chloro-phenyl, 4-fluoro-phenyl,
4-methyl-phenyl, 3-fluoro-phenyl or thiophen-2-yl, [0087] when V,
W, U and Z are CH, n=1, E, F, G, J, and K are C, R.sup.15, R.sup.16
and R.sup.17 are H, and A is --CH.sub.2--, then M-R.sup.1 is not
--NHCH.sub.2CH(CH.sub.3).sub.2, [0088] when V, W, and U are CH,
n=1, E, F, G, J, and K are C, R.sup.15, R.sup.16 and R.sup.17 are
H, A is --CH.sub.2--, M-R.sup.1 is --OCH.sub.3, and Z is CR.sup.18,
then R.sup.18 is not thiophen-3-yl, and [0089] when V, W, and U are
CH, n=0, F, J, and K are C, E is N, R.sup.15 is CH.sub.3, R.sup.16
is H, A is --C(O)--, M-R.sup.1 is --CH(CH.sub.3).sub.3, and Z is
CR.sup.18, then R.sup.18 is not 3-((E)-2-carboxy-vinyl)phenyl.
[0090] In one embodiment of the compounds of Formula Ib, E, J, K,
G, F, n, R.sup.15, R.sup.16 and R.sup.17 are selected to provide
structures selected from the group consisting of
##STR00014## ##STR00015## ##STR00016##
wherein R.sup.15, R.sup.16 and R.sup.17 are as defined for
compounds of Formula Ib and wherein
##STR00017##
indicates the point of attachment of A and
##STR00018##
indicates the point of attachment of M.
[0091] In one embodiment of compounds of Formula Ib, M is selected
from the group consisting of --O--(CR.sup.19R.sup.20).sub.s--,
--(CR.sup.19R.sup.20).sub.s--,
--OC(O)--(CR.sup.19R.sup.20).sub.s--,
--OC(S)--(CR.sup.19R.sup.20).sub.s--,
--OC(O)NR.sup.26--(CR.sup.19R.sup.20).sub.s--,
--OC(S)NR.sup.26--(CR.sup.19R.sup.20).sub.s--,
--C(O)NR.sup.26--(CR.sup.19R.sup.20).sub.s--,
--C(S)NR.sup.26--(CR.sup.19R.sup.20).sub.s--,
--S(O).sub.2NR.sup.26--(CR.sup.19R.sup.20).sub.s--,
--NR.sup.26--(CR.sup.19R.sup.20).sub.s--,
--NR.sup.26C(O)--(CR.sup.19R.sup.20).sub.s--,
--NR.sup.26C(S)--(CR.sup.19R.sup.20).sub.s--,
--NR.sup.26C(O)O--(CR.sup.19R.sup.20).sub.s--,
--NR.sup.26C(S)O--(CR.sup.19R.sup.20).sub.s--,
--NR.sup.26C(O)NR.sup.26--(CR.sup.19R.sup.20).sub.s--,
--NR.sup.26C(S)NR.sup.26--(CR.sup.19R.sup.20).sub.s--,
--NR.sup.26S(O).sub.2--(CR.sup.19R.sup.20).sub.s--, and
--NR.sup.26S(O).sub.2NR.sup.26--(CR.sup.19R.sup.20).sub.s--.
[0092] In one embodiment of compounds of Formula Ib, R.sup.26 at
each occurrence is independently selected from the group consisting
of hydrogen, lower alkyl, or lower alkyl substituted with 1, 2, or
3 substituents selected from the group consisting of fluoro, --OH,
--NH.sub.2, alkoxy, lower alkylthio, mono-alkylamino, di-alkylamino
and cycloalkylamino, provided that any substitution on the carbon
that is bound to the nitrogen of --NR.sup.26 is fluoro.
[0093] In one embodiment of compounds of Formula Ib, R.sup.1 is
selected from the group consisting of optionally substituted aryl
and optionally substituted heteroaryl.
[0094] In one embodiment of the compounds of Formula Ib, Z is N or
CH, n is 1, E-R.sup.15 is N or CH, K--R.sup.16 is N or CH, and
G-R.sup.17 is N or CH, provided no more than one of E-R.sup.15,
K--R.sup.16 and G-R.sup.17 is N. In one embodiment, Z is N or CH, n
is 1, and E-R.sup.15, K--R.sup.16 and G-R.sup.17 are CH.
[0095] In one embodiment of the compounds of Formula Ib, V, W and Z
are CH, U is CR.sup.18, n is 1, E-R.sup.15 is N or CH, K--R.sup.16
is N or CH, and G-R.sup.17 is N or CH, provided no more than one of
E-R.sup.15, K--R.sup.16 and G-R.sup.17 is N. In another embodiment,
V, W and Z are CH, U is CR.sup.18, n is 1, and E-R.sup.15,
K--R.sup.16 and G-R.sup.17 are CH.
[0096] In one embodiment of the compounds of Formula Ib, Z is N or
CH, n is 1, E-R.sup.15, K--R.sup.16 and G-R.sup.17 are CH, A is
--CH.sub.2--, M is --NHCH.sub.2--, further wherein R.sup.1 is
optionally substituted phenyl. In another embodiment, V, Z, U and W
are CH, n is 1, E-R.sup.15 is N or CH, K--R.sup.16 is N or CH, and
G-R.sup.17 is N or CH, provided no more than one of E-R.sup.15,
K--R.sup.16 and G-R.sup.17 is N.
[0097] In one embodiment of the compounds of Formula Ib, Z is N or
CH, n is 1, E-R.sup.15 is N or CH, K--R.sup.16 is N or CH, and
G-R.sup.17 is N or CH, provided no more than one of E-R.sup.15,
K--R.sup.16 and G-R.sup.17 is N, and R.sup.1 is phenyl optionally
substituted with one or more substituents selected from the group
consisting of halogen, --OH, --NH.sub.2, --NO.sub.2, --CN,
optionally substituted lower alkyl and --OR.sup.29, where R.sup.29
is selected from the group consisting of optionally substituted
lower alkyl, optionally substituted cycloalkyl, optionally
substituted heterocycloalkyl, optionally substituted aryl and
optionally substituted heteroaryl.
[0098] In one embodiment of the compounds of Formula Ib, V, Z, U
and W are CH, n is 1, E-R.sup.15, K--R.sup.16 and G-R.sup.17 are
CH, A is --CH.sub.2--, M is --NHCH.sub.2, and R.sup.1 is optionally
substituted phenyl, further wherein R.sup.1 is phenyl optionally
substituted with one or more substituents selected from the group
consisting of halogen, --OH, --NH.sub.2, --NO.sub.2, --CN,
optionally substituted lower alkyl and --OR.sup.29, where R.sup.29
is selected from the group consisting of optionally substituted
lower alkyl, optionally substituted cycloalkyl, optionally
substituted heterocycloalkyl, optionally substituted aryl and
optionally substituted heteroaryl.
[0099] In one embodiment of the compounds of Formula Ib, V, W and Z
are CH, U is CR.sup.18, n is 1, E-R.sup.15, K--R.sup.16 and
G-R.sup.17 are CH, A is --CH.sub.2--, M is --NHCH.sub.2, and
R.sup.1 is optionally substituted phenyl, further wherein R.sup.1
is phenyl optionally substituted with one or more substituents
selected from the group consisting of halogen, --OH, --NH.sub.2,
--NO.sub.2, --CN, optionally substituted lower alkyl and
--OR.sup.29, where R.sup.29 is selected from the group consisting
of optionally substituted lower alkyl, optionally substituted
cycloalkyl, optionally substituted heterocycloalkyl, optionally
substituted aryl and optionally substituted heteroaryl.
[0100] In one embodiment of the compounds of Formula Ib, when n is
1, and E, K and G are C, at least one of R.sup.15, R.sup.16 and
R.sup.17 is other than hydrogen. In another embodiment, n is 1, one
of E, K, and G are N and the other two of E, K, and G are C and at
least one of R.sup.15, R.sup.16 and R.sup.17 is other than
hydrogen. In another embodiment, n is 1, E, K and G are C, and at
least one of R.sup.15, R.sup.16 and R.sup.17 is other than
hydrogen.
[0101] In one embodiment of the compounds of Formula Ib, n is 1, V
and W are CH, U and Z are independently CR.sup.18, one of E, K, and
G are N and the other two of E, K, and G are C and at least one of
R.sup.15, R.sup.16 and R.sup.17 is other than hydrogen. In another
embodiment, n is 1, V and W are CH, U and Z are independently
CR.sup.18, E, K and G are C, and at least one of R.sup.15, R.sup.16
and R.sup.17 is other than hydrogen.
[0102] In one embodiment of the compounds of Formula Ib, n is 1,
one of E, K, and G are N and the other two of E, K, and G are C, at
least one of R.sup.15, R.sup.16 and R.sup.17 is other than
hydrogen, A is --CH.sub.2--, M is --NHCH.sub.2--, further wherein
R.sup.1 is optionally substituted phenyl. In another embodiment, n
is 1, E, K, and G are C, at least one of R.sup.15, R.sup.16 and
R.sup.17 is other than hydrogen, A is --CH.sub.2--, M is
--NHCH.sub.2--, further wherein R.sup.1 is optionally substituted
phenyl.
[0103] In one embodiment of the compounds of Formula Ib, n is 1, V,
Z, U and W are CH, one of E, K, and G are N and the other two of E,
K, and G are C and at least one of R.sup.15, R.sup.16 and R.sup.17
is other than hydrogen. In another embodiment, V, Z, U and W are
CH, E, K and G are C, and at least one of R.sup.15, R.sup.16 and
R.sup.17 is other than hydrogen.
[0104] In one embodiment of the compounds of Formula Ib, Z is
CR.sup.18, wherein R.sup.18 is other than hydrogen, n is 1,
E-R.sup.15 is N or CH, K--R.sup.16 is N or CH and G-R.sup.17 is N
or CH. In another embodiment, Z is CR.sup.18, wherein R.sup.18 is
other than hydrogen, n is 1, and E-R.sup.15, K--R.sup.16 and
G-R.sup.17 are CH. In another embodiment, Z is CR.sup.18, wherein
R.sup.18 is other than hydrogen, U is CR.sup.18, V and W are CH, n
is 1, and E-R.sup.15, K--R.sup.16 and G-R.sup.17 are CH, further
wherein U is CH.
[0105] In one embodiment of the compounds of Formula Ib, Z is
CR.sup.18, wherein R.sup.18 is other than hydrogen, n is 1,
E-R.sup.15, K--R.sup.16 and G-R.sup.17 are CH, A is --CH.sub.2--, M
is --NHCH.sub.2--, further wherein R.sup.1 is optionally
substituted phenyl. In a further embodiment, Z is CR.sup.18,
wherein R.sup.18 is other than hydrogen, U is CR.sup.18, V and W
are CH, n is 1, E-R.sup.15, K--R.sup.16 and G-R.sup.17 are CH, A is
--CH.sub.2--, M is --NHCH.sub.2--, further wherein R.sup.1 is
optionally substituted phenyl. In a further embodiment, Z is
CR.sup.18, wherein R.sup.18 is other than hydrogen, V, U and W are
CH, n is 1, E-R.sup.15, K--R.sup.16 and G-R.sup.17 are CH, A is
--CH.sub.2--, M is --NHCH.sub.2--, further wherein R.sup.1 is
optionally substituted phenyl.
[0106] In one embodiment of the compounds of Formula Ib, U is
CR.sup.18, wherein R.sup.18 is other than hydrogen, n is 1,
E-R.sup.15 is N or CH, K--R.sup.16 is N or CH and G-R.sup.17 is N
or CH. In another embodiment, U is CR.sup.18, wherein R.sup.18 is
other than hydrogen, n is 1, and E-R.sup.15, K--R.sup.16 and
G-R.sup.17 are CH. In another embodiment, U is CR.sup.18, wherein
R.sup.18 is other than hydrogen, Z is CR.sup.18, V and W are CH, n
is 1, and E-R.sup.15, K--R.sup.16 and G-R.sup.17 are CH, further
wherein Z is CH.
[0107] In one embodiment of the compounds of Formula Ib, U is
CR.sup.18, wherein R.sup.18 is other than hydrogen, n is 1,
E-R.sup.15, K--R.sup.16 and G-R.sup.17 are CH, A is --CH.sub.2--, M
is --NHCH.sub.2--, further wherein R.sup.1 is optionally
substituted phenyl. In a further embodiment, U is CR.sup.18,
wherein R.sup.18 is other than hydrogen, Z is CR.sup.18, V and W
are CH, n is 1, E-R.sup.15, K--R.sup.16 and G-R.sup.17 are CH, A is
--CH.sub.2--, M is --NHCH.sub.2--, further wherein R.sup.1 is
optionally substituted phenyl. In a further embodiment, U is
CR.sup.18, wherein R.sup.18 is other than hydrogen, V, Z and W are
CH, n is 1, E-R.sup.15, K--R.sup.16 and G-R.sup.17 are CH, A is
--CH.sub.2--, M is --NHCH.sub.2--, further wherein R.sup.1 is
optionally substituted phenyl.
[0108] In one embodiment of the compounds of Formula Ib, further to
any of the above embodiments, R.sup.15, R.sup.16 and R.sup.17 are
independently selected from the group consisting of halogen, --OH,
lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and
fluoro substituted lower alkoxy. Further to any of these
embodiments R.sup.1 is phenyl optionally substituted with one or
more substituents selected from the group consisting of halogen,
--OH, --NH.sub.2, --NO.sub.2, --CN, optionally substituted lower
alkyl and --OR.sup.29, where R.sup.29 is selected from the group
consisting of optionally substituted lower alkyl, optionally
substituted cycloalkyl, optionally substituted heterocycloalkyl,
optionally substituted aryl and optionally substituted
heteroaryl.
[0109] In one embodiment of the compounds of Formula Ib, further to
any of the above embodiments, R.sup.18 is selected from the group
consisting of halogen, --OH, optionally substituted lower alkyl and
--OR.sup.29, where R.sup.29 is selected from the group consisting
of optionally substituted lower alkyl, optionally substituted
cycloalkyl, optionally substituted heterocycloalkyl, optionally
substituted aryl and optionally substituted heteroaryl. Further to
any of these embodiments, R.sup.1 is phenyl optionally substituted
with one or more substituents selected from the group consisting of
halogen, --OH, --NH.sub.2, --NO.sub.2, --CN, optionally substituted
lower alkyl and --OR.sup.29, where R.sup.29 is selected from the
group consisting of optionally substituted lower alkyl, optionally
substituted cycloalkyl, optionally substituted heterocycloalkyl,
optionally substituted aryl and optionally substituted
heteroaryl.
[0110] In another embodiment of compounds of Formula Ib, M is a
bond and R.sup.1 is other than thiophenyl.
[0111] In another embodiment of the compounds of Formula Ib, Z is N
or CR.sup.18 wherein R.sup.18 is not hydrogen. Further to this
embodiment, as allowed in the description of Formula Ib, E is
NR.sup.15 or CR.sup.15, K is NR.sup.16 or CR.sup.16 and G is
CR.sup.17, or combinations thereof, wherein at least one of
R.sup.15, R.sup.16 and R.sup.17 is not hydrogen.
[0112] The compounds of Formula Ib, and all sub-embodiments
detailed herein, may be used to treat a subject suffering from or
at risk of a Kit and/or Fms protein kinase mediated disease or
condition, such as those disclosed in this application.
[0113] In one embodiment, a compound of Formula I has a structure
according to the following sub-generic structure, Formula Ig,
##STR00019##
all salts, prodrugs, tautomers, and isomers thereof, wherein:
[0114] Z.sub.1 is selected from the group consisting of N and
CR.sup.34; [0115] U.sub.1 is selected from the group consisting of
N and CR.sup.35; [0116] A.sub.1 is selected from the group
consisting of --CH.sub.2-- and --C(O)--; [0117] M.sub.3 is selected
from the group consisting of a bond, --NR.sup.39--, --S--, --O--,
--NR.sup.39CH.sub.2--, --NR.sup.39CH(R.sup.40)--, --SCH.sub.2--,
--OCH.sub.2--, --C(O)NR.sup.39--, --S(O).sub.2NR.sup.39--,
--CH.sub.2NR.sup.39--, --CH(R.sup.40)NR.sup.39--,
--NR.sup.39C(O)--, and --NR.sup.39S(O).sub.2--; [0118] n is 0 or 1;
[0119] v is 0, 1, 2 or 3; [0120] F.sub.1 and J.sub.1 are both C or
one of F.sub.1 and J.sub.1 is C and the other of F.sub.1 and
J.sub.1 is N; [0121] E.sub.1 and K.sub.1 are selected from C, N, O
or S; [0122] G.sub.1 is selected from C or N; [0123] wherein [0124]
when n is 1, F.sub.1 and J.sub.1 are C, and E.sub.1, G.sub.1 and
K.sub.1 are C, or any one of E.sub.1, G.sub.1 and K.sub.1 is N and
the other two of E.sub.1, G.sub.1 and K.sub.1 are C, provided that
when E.sub.1, G.sub.1 or K.sub.1 is N, R.sup.36, R.sup.37 and
R.sup.38, respectively, are absent. [0125] when n is 0 and F.sub.1
and J.sub.1 are both C, then one of E.sub.1 and K.sub.1 is C or N
and the other of E.sub.1 and K.sub.1 is C, N, O or S, provided both
E.sub.1 and K.sub.1 are not C, and provided that when both E.sub.1
and K.sub.1 are N, one of R.sup.36 and R.sup.37 is absent, and
provided that when one of E.sub.1 and K.sub.1 are N and the other
is O or S, R.sup.36 and R.sup.37 are absent, [0126] when n is 0,
one of F.sub.1 and J.sub.1 is N and the other of F.sub.1 and
J.sub.1 is C, then one of E.sub.1 and K.sub.1 is N and the other of
E.sub.1 and K.sub.1 is C, or both E.sub.1 and K.sub.1 are C,
provided that when E.sub.1 is N, R.sup.36 is absent and when
K.sub.1 is N, R.sup.37 is absent; [0127] Cy is selected from the
group consisting of cycloalkyl, heterocycloalkyl, aryl and
heteroaryl; [0128] R.sup.34 and R.sup.35 are independently selected
from the group consisting of hydrogen, --OR.sup.41, --SR.sup.41,
--NHR.sup.41, --NR.sup.41R.sup.41, --NR.sup.39C(O)R.sup.41,
--NR.sup.39S(O).sub.2R.sup.41, halogen, lower alkyl, cycloalkyl,
heterocycloalkyl, aryl and heteroaryl, wherein lower alkyl is
optionally substituted with one or more substituents selected from
the group consisting of fluoro, lower alkoxy, fluoro substituted
lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio,
mono-alkylamino, di-alkylamino, cycloalkyl, heterocycloalkyl, aryl,
and heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl, and
heteroaryl as R.sup.34 or R.sup.35, or as substituents of lower
alkyl are optionally substituted with one or more substituents
selected from the group consisting of --OH, --NH.sub.2, --CN,
--NO.sub.2, --S(O).sub.2NH.sub.2, --C(O)NH.sub.2, --OR.sup.42,
--SR.sup.42, --NHR.sup.42, --NR.sup.42R.sup.42,
--NR.sup.39C(O)R.sup.42, --NR.sup.39S(O).sub.2R.sup.42,
--S(O).sub.2R.sup.42, halogen, lower alkyl, fluoro substituted
lower alkyl, and cycloalkylamino; [0129] R.sup.45 at each
occurrence is independently selected from the group consisting of
--OR.sup.41, --SR.sup.41, --NHR.sup.41, --NR.sup.41R.sup.41,
--NR.sup.39C(O)R.sup.41, --NR.sup.39S(O).sub.2R.sup.41, halogen,
lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl,
wherein lower alkyl is optionally substituted with one or more
substituents selected from the group consisting of fluoro, lower
alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro
substituted lower alkylthio, mono-alkylamino, di-alkylamino,
cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, wherein
cycloalkyl, heterocycloalkyl, aryl, and heteroaryl as R.sup.45, or
as substituents of lower alkyl are optionally substituted with one
or more substituents selected from the group consisting of --OH,
--NH.sub.2, --CN, --NO.sub.2, --S(O).sub.2NH.sub.2, --C(O)NH.sub.2,
--OR.sup.42, --SR.sup.42, --NHR.sup.42, --NR.sup.42R.sup.42,
--NR.sup.39C(O)R.sup.42, --NR.sup.39S(O).sub.2R.sup.42,
--S(O).sub.2R.sup.42, halogen, lower alkyl, fluoro substituted
lower alkyl, and cycloalkylamino; [0130] R.sup.36 is selected from
the group consisting of hydrogen, halogen, lower alkyl, fluoro
substituted lower alkyl, lower alkoxy, and fluoro substituted lower
alkoxy when E.sub.1 is C, is absent when E.sub.1 is O or S or when
n=1 and E.sub.1 is N, and is absent or selected from the group
consisting of hydrogen, lower alkyl, and fluoro substituted lower
alkyl when n=0 and E.sub.1 is N; [0131] R.sup.37 is selected from
the group consisting of hydrogen, halogen, lower alkyl, fluoro
substituted lower alkyl, lower alkoxy, and fluoro substituted lower
alkoxy when K.sub.1 is C, is absent when K.sub.1 is O or S or when
n=1 and K.sub.1 is N, and is absent or selected from the group
consisting of hydrogen, lower alkyl, and fluoro substituted lower
alkyl when n=0 and K.sub.1 is N; [0132] R.sup.38 is selected from
the group consisting of hydrogen, halogen, lower alkyl, fluoro
substituted lower alkyl, lower alkoxy, and fluoro substituted lower
alkoxy when G.sub.1 is C, or is absent when G.sub.1 is N; [0133]
R.sup.39 at each occurrence is independently selected from the
group consisting of hydrogen and lower alkyl; [0134] R.sup.49 is
selected from the group consisting of lower alkyl, and fluoro
substituted lower alkyl; [0135] R.sup.41 is selected from the group
consisting of lower alkyl, cycloalkyl, heterocycloalkyl, aryl and
heteroaryl, wherein lower alkyl is optionally substituted with one
or more substituents selected from the group consisting of fluoro,
lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio,
fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino,
cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, wherein
cycloalkyl, heterocycloalkyl, aryl, and heteroaryl as R.sup.41 or
as substituents of lower alkyl are optionally substituted with one
or more substituents selected from the group consisting of --OH,
--NH.sub.2, --CN, --NO.sub.2, --S(O).sub.2NH.sub.2, --C(O)NH.sub.2,
--OR.sup.42, --SR.sup.42, --NHR.sup.42, --NR.sup.42R.sup.42,
--NR.sup.39C(O)R.sup.42, --NR.sup.39S(O).sub.2R.sup.42,
--S(O).sub.2R.sup.42, halogen, lower alkyl, fluoro substituted
lower alkyl, and cycloalkylamino; and [0136] R.sup.42 at each
occurrence is independently selected from the group consisting of
lower alkyl, heterocycloalkyl and heteroaryl, wherein lower alkyl
is optionally substituted with one or more substituents selected
from the group consisting of fluoro, lower alkoxy, fluoro
substituted lower alkoxy, lower alkylthio, fluoro substituted lower
alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino.
[0137] In one embodiment of compounds of Formula Ig, n is 1,
G.sub.1 and K.sub.1 are C, and E is N or C, preferably wherein E is
C.
[0138] In one embodiment of compounds of Formula Ig, M.sub.3 is
selected from the group consisting of --NR.sup.39--, --O--,
--NR.sup.39CH.sub.2--, --NR.sup.39CH(R.sup.40)--, --SCH.sub.2--,
--OCH.sub.2--, --CH.sub.2NR.sup.39--, --NR.sup.39C(O)--, and
--NR.sup.39S(O).sub.2--, preferably wherein M.sub.3 is
--NR.sup.39CH.sub.2--, --NR.sup.39CH(R.sup.40)--, --SCH.sub.2--,
--OCH.sub.2--, or --CH.sub.2NR.sup.39--.
[0139] In one embodiment of compounds of Formula Ig, n is 1,
G.sub.1 and K.sub.1 are C, and E is N or C, preferably wherein E is
C, and M.sub.3 is selected from the group consisting of
--NR.sup.39--, --O--, --NR.sup.39CH.sub.2--,
--NR.sup.39CH(R.sup.40)--, --SCH.sub.2--, --OCH.sub.2--,
--CH.sub.2NR.sup.39--, --NR.sup.39C(O)--, and
--NR.sup.39S(O).sub.2--, preferably wherein M.sub.3 is
--NR.sup.39CH.sub.2--, --NR.sup.39CH(R.sup.40)--, --SCH.sub.2--,
--OCH.sub.2--, or --CH.sub.2NR.sup.39--.
[0140] In one embodiment of compounds of Formula Ig, each R.sup.45
is selected from the group consisting of --OH, --NH.sub.2, --CN,
--NO.sub.2, halogen, lower alkyl, fluoro substituted lower alkyl,
lower alkoxy, fluoro substituted lower alkoxy, lower thioalkyl,
fluoro substituted lower thioalkyl, mono-alkylamino, di-alkylamino
and cycloalkylamino, preferably wherein v is 0, 1, or 2, also 0 or
1.
[0141] In one embodiment of compounds of Formula Ig, n is 1,
G.sub.1 and K.sub.1 are C, and E is N or C, preferably wherein E is
C, M.sub.3 is selected from the group consisting of --NR.sup.39--,
--O--, --NR.sup.39CH.sub.2--, --NR.sup.39CH(R.sup.40)--,
--SCH.sub.2--, --OCH.sub.2--, --CH.sub.2NR.sup.39--,
--NR.sup.39C(O)--, and --NR.sup.39S(O).sub.2--, preferably wherein
M.sub.3 is --NR.sup.39CH.sub.2--, --NR.sup.39CH(R.sup.40)--,
--SCH.sub.2--, --OCH.sub.2--, or --CH.sub.2NR.sup.39--, and each
R.sup.45 is selected from the group consisting of --OH, --NH.sub.2,
--CN, --NO.sub.2, halogen, lower alkyl, fluoro substituted lower
alkyl, lower alkoxy, fluoro substituted lower alkoxy, lower
thioalkyl, fluoro substituted lower thioalkyl, mono-alkylamino,
di-alkylamino and cycloalkylamino, preferably wherein v is 0, 1, or
2, also 0 or 1.
[0142] In one embodiment of compounds of Formula Ig, Z.sub.1 is
CR.sup.34, U.sub.1 is CR.sup.35, and R.sup.34 and R.sup.35 are both
hydrogen. In one embodiment, Z.sub.1 is CR.sup.34, U.sub.1 is
CR.sup.35, and R.sup.34 and R.sup.35 are independently selected
from the group consisting of hydrogen, --OR.sup.41, halogen, lower
alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein
cycloalkyl, heterocycloalkyl, aryl and heteroaryl are optionally
substituted with one or more substituents selected from the group
consisting of --OH, --NH.sub.2, --CN, --NO.sub.2,
--S(O).sub.2NH.sub.2, --C(O)NH.sub.2, --OR.sup.42, --SR.sup.42,
--NHR.sup.42, --NR.sup.42R.sup.42, --NR.sup.39C(O)R.sup.42,
--NR.sup.39S(O).sub.2R.sup.42, --S(O).sub.2R.sup.42, halogen, lower
alkyl, fluoro substituted lower alkyl, and cycloalkylamino, and
wherein lower alkyl is optionally substituted with one or more
substituents selected from the group consisting of fluoro, lower
alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro
substituted lower alkylthio, mono-alkylamino, di-alkylamino, and
cycloalkylamino. In a further embodiment, one of R.sup.34 and
R.sup.35 is hydrogen, and the other of R.sup.34 and R.sup.35 is
selected from the group consisting of hydrogen, halogen, lower
alkyl, lower alkoxy, aryl and heteroaryl, wherein aryl and
heteroaryl are optionally substituted with one or more substituents
selected from the group consisting of --OH, --NH.sub.2, --CN,
--NO.sub.2, --S(O).sub.2NH.sub.2, --C(O)NH.sub.2, --OR.sup.42,
--SR.sup.42, --NHR.sup.42, --NR.sup.42R.sup.42,
--NR.sup.39C(O)R.sup.42, --NR.sup.39S(O).sub.2R.sup.42,
--S(O).sub.2R.sup.42, halogen, lower alkyl, fluoro substituted
lower alkyl, and cycloalkylamino, and wherein lower alkyl and lower
alkoxy are optionally substituted with one or more substituents
selected from the group consisting of fluoro, lower alkoxy, fluoro
substituted lower alkoxy, lower alkylthio, fluoro substituted lower
alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino,
further wherein the other of R.sup.34 and R.sup.35 is selected from
the group consisting of halogen, lower alkyl, and lower alkoxy,
wherein lower alkyl and lower alkoxy are optionally substituted
with one or more substituents selected from the group consisting of
fluoro, lower alkoxy, fluoro substituted lower alkoxy, lower
alkylthio, fluoro substituted lower alkylthio, mono-alkylamino,
di-alkylamino, and cycloalkylamino.
[0143] In one embodiment of compounds of Formula Ig, each R.sup.45
is independently selected from the group consisting of --OH,
--NH.sub.2, --CN, --NO.sub.2, halogen, lower alkyl, fluoro
substituted lower alkyl, lower alkoxy, fluoro substituted lower
alkoxy, lower thioalkyl, fluoro substituted lower thioalkyl,
mono-alkylamino, di-alkylamino and cycloalkylamino, preferably
wherein v is 0, 1, or 2, also 0 or 1, Z.sub.1 is CR.sup.34, U.sub.1
is CR.sup.35, and R.sup.34 and R.sup.35 are independently selected
from the group consisting of hydrogen, --OR.sup.41, halogen, lower
alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein
cycloalkyl, heterocycloalkyl, aryl and heteroaryl are optionally
substituted with one or more substituents selected from the group
consisting of --OH, --NH.sub.2, --CN, --NO.sub.2,
--S(O).sub.2NH.sub.2, --C(O)NH.sub.2, --OR.sup.42, --SR.sup.42,
--NHR.sup.42, --NR.sup.42R.sup.42, --NR.sup.39C(O)R.sup.42,
--NR.sup.39S(O).sub.2R.sup.42, --S(O).sub.2R.sup.42, halogen, lower
alkyl, fluoro substituted lower alkyl, and cycloalkylamino, and
wherein lower alkyl is optionally substituted with one or more
substituents selected from the group consisting of fluoro, lower
alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro
substituted lower alkylthio, mono-alkylamino, di-alkylamino, and
cycloalkylamino. In a further embodiment, both of R.sup.34 and
R.sup.35 are hydrogen.
[0144] In one embodiment of compounds of Formula Ig, each R.sup.45
is selected from the group consisting of --OH, --NH.sub.2, --CN,
--NO.sub.2, halogen, lower alkyl, fluoro substituted lower alkyl,
lower alkoxy, fluoro substituted lower alkoxy, lower thioalkyl,
fluoro substituted lower thioalkyl, mono-alkylamino, di-alkylamino
and cycloalkylamino, preferably wherein v is 0, 1, or 2, also 0 or
1, Z.sub.1 is CR.sup.34, U.sub.1 is CR.sup.35, one of R.sup.34 and
R.sup.35 is hydrogen, and the other of R.sup.34 and R.sup.35 is
selected from the group consisting of hydrogen, halogen, lower
alkyl, lower alkoxy, aryl and heteroaryl, wherein aryl and
heteroaryl are optionally substituted with one or more substituents
selected from the group consisting of --OH, --NH.sub.2, --CN,
--NO.sub.2, --S(O).sub.2NH.sub.2, --C(O)NH.sub.2, --OR.sup.42,
--SR.sup.42, --NHR.sup.42, --NR.sup.42R.sup.42,
--NR.sup.39C(O)R.sup.42, --NR.sup.39S(O).sub.2R.sup.42,
--S(O).sub.2R.sup.42, halogen, lower alkyl, fluoro substituted
lower alkyl, and cycloalkylamino, and wherein lower alkyl and lower
alkoxy are optionally substituted with one or more substituents
selected from the group consisting of fluoro, lower alkoxy, fluoro
substituted lower alkoxy, lower alkylthio, fluoro substituted lower
alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino,
further wherein the other of R.sup.34 and R.sup.35 is selected from
the group consisting of halogen, lower alkyl, and lower alkoxy,
wherein lower alkyl and lower alkoxy are optionally substituted
with one or more substituents selected from the group consisting of
fluoro, lower alkoxy, fluoro substituted lower alkoxy, lower
alkylthio, fluoro substituted lower alkylthio, mono-alkylamino,
di-alkylamino, and cycloalkylamino.
[0145] In one embodiment of compounds of Formula Ig, n is 1,
G.sub.1 and K.sub.1 are C, and E is N or C, preferably wherein E is
C, M.sub.3 is selected from the group consisting of --NR.sup.39--,
--O--, --NR.sup.39CH.sub.2--, --NR.sup.39CH(R.sup.40)--,
--SCH.sub.2--, --OCH.sub.2--, --CH.sub.2NR.sup.39--,
--NR.sup.39C(O)--, and --NR.sup.39S(O).sub.2--, preferably wherein
M.sub.3 is --NR.sup.39CH.sub.2--, --NR.sup.39CH(R.sup.40)--,
--SCH.sub.2--, --OCH.sub.2--, or --CH.sub.2NR.sup.39--, each
R.sup.45 is selected from the group consisting of --OH, --NH.sub.2,
--CN, --NO.sub.2, halogen, lower alkyl, fluoro substituted lower
alkyl, lower alkoxy, fluoro substituted lower alkoxy, lower
thioalkyl, fluoro substituted lower thioalkyl, mono-alkylamino,
di-alkylamino and cycloalkylamino, preferably wherein v is 0, 1, or
2, also 0 or 1, Z.sub.1 is CR.sup.34, U.sub.1 is CR.sup.35, and
R.sup.34 and R.sup.35 are both hydrogen.
[0146] In one embodiment of compounds of Formula Ig, n is 1,
G.sub.1 and K.sub.1 are C, and E is N or C, preferably wherein E is
C, M.sub.3 is selected from the group consisting of --NR.sup.39--,
--O--, --NR.sup.39CH.sub.2--, --NR.sup.39CH(R.sup.40)--,
--SCH.sub.2--, --OCH.sub.2--, --CH.sub.2NR.sup.39--,
--NR.sup.39C(O)--, and --NR.sup.39S(O).sub.2--, preferably wherein
M.sub.3 is --NR.sup.39CH.sub.2--, --NR.sup.39CH(R.sup.40)--,
--SCH.sub.2--, --OCH.sub.2--, or --CH.sub.2NR.sup.39--, each
R.sup.45 is selected from the group consisting of --OH, --NH.sub.2,
--CN, --NO.sub.2, halogen, lower alkyl, fluoro substituted lower
alkyl, lower alkoxy, fluoro substituted lower alkoxy, lower
thioalkyl, fluoro substituted lower thioalkyl, mono-alkylamino,
di-alkylamino and cycloalkylamino, preferably wherein v is 0, 1, or
2, also 0 or 1, Z.sub.1 is CR.sup.34 and U.sub.1 is CR.sup.35, and
R.sup.34 and R.sup.35 are independently selected from the group
consisting of hydrogen, --OR.sup.41, halogen, lower alkyl,
cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein
cycloalkyl, heterocycloalkyl, aryl and heteroaryl are optionally
substituted with one or more substituents selected from the group
consisting of --OH, --NH.sub.2, --CN, --NO.sub.2,
--S(O).sub.2NH.sub.2, --C(O)NH.sub.2, --OR.sup.42, --SR.sup.42,
--NHR.sup.42, --NR.sup.42R.sup.42, --NR.sup.39C(O)R.sup.42,
--NR.sup.39S(O).sub.2R.sup.42, --S(O).sub.2R.sup.42, halogen, lower
alkyl, fluoro substituted lower alkyl, and cycloalkylamino, and
wherein lower alkyl is optionally substituted with one or more
substituents selected from the group consisting of fluoro, lower
alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro
substituted lower alkylthio, mono-alkylamino, di-alkylamino, and
cycloalkylamino. In a further embodiment, one of R.sup.34 and
R.sup.35 is hydrogen, and the other of R.sup.34 and R.sup.35 is
selected from the group consisting of halogen, lower alkyl, lower
alkoxy, aryl and heteroaryl, wherein aryl and heteroaryl are
optionally substituted with one or more substituents selected from
the group consisting of --OH, --NH.sub.2, --CN, --NO.sub.2,
--S(O).sub.2NH.sub.2, --C(O)NH.sub.2, --OR.sup.42, --SR.sup.42,
--NHR.sup.42, --NR.sup.42R.sup.42, --NR.sup.39C(O)R.sup.42,
--NR.sup.39S(O).sub.2R.sup.42, --S(O).sub.2R.sup.42, halogen, lower
alkyl, fluoro substituted lower alkyl, and cycloalkylamino, and
wherein lower alkyl and lower alkoxy are optionally substituted
with one or more substituents selected from the group consisting of
fluoro, lower alkoxy, fluoro substituted lower alkoxy, lower
alkylthio, fluoro substituted lower alkylthio, mono-alkylamino,
di-alkylamino, and cycloalkylamino, further wherein the other of
R.sup.34 and R.sup.35 is selected from the group consisting of
halogen, lower alkyl, and lower alkoxy, wherein lower alkyl and
lower alkoxy are optionally substituted with one or more
substituents selected from the group consisting of fluoro, lower
alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro
substituted lower alkylthio, mono-alkylamino, di-alkylamino, and
cycloalkylamino, further wherein R.sup.34 is hydrogen.
[0147] The compounds of Formula Ig, and all sub-embodiments
detailed herein, may be used to treat a subject suffering from or
at risk of a Kit and/or Fms protein kinase mediated disease or
condition, such as those disclosed in this application.
[0148] In certain embodiments of the above compounds, compounds are
excluded where N (except where N is a heteroaryl ring atom), O, or
S is bound to a carbon that is also bound to N (except where N is a
heteroaryl ring atom), O, or S; or where N (except where N is a
heteroaryl ring atom), O, C(S), C(O), or S(O).sub.n (n is 0-2) is
bound to an alkene carbon of an alkenyl group or bound to an alkyne
carbon of an alkynyl group; accordingly, in certain embodiments
compounds which include linkages such as the following are excluded
from the present invention: --NR--CH.sub.2--NR--,
--O--CH.sub.2--NR--, --S--CH.sub.2--NR--, --NR--CH.sub.2--O--,
--O--CH.sub.2--O--, --S--CH.sub.2--O--, --NR--CH.sub.2--S--,
--O--CH.sub.2--S--, --S--CH.sub.2--S--, --NR--CH.dbd.CH--,
--CH.dbd.CH--NR--, --NR--C.ident.C--, --C.ident.C--NR--,
--O--CH.dbd.CH--, --CH.dbd.CH--O--, --O--C.ident.C--,
--C.ident.C--O--, --S(O).sub.0-2--CH.dbd.CH--,
--CH.dbd.CH--S(O).sub.0-2--, --S(O).sub.0-2--C.ident.C--,
--C.ident.C--S(O).sub.0-2--, --C(O)--CH.dbd.CH--,
--CH.dbd.CH--C(O)--, --C.ident.C--C(O)--, or --C(O)--C.ident.C--,
--C(S)--CH.dbd.CH--, --CH.dbd.CH--C(S)--, --C.ident.C--C(S)--, or
--C(S)--C.ident.C--.
[0149] In another aspect, the invention provides methods for
treating a c-kit-mediated disease or condition in an animal subject
(e.g. a mammal such as a human, other primates, sports animals,
animals of commercial interest such as cattle, farm animals such as
horses, or pets such as dogs and cats), e.g., a disease or
condition characterized by abnormal c-kit activity (e.g. kinase
activity). Invention methods involve administering to the subject
suffering from or at risk of a c-kit-mediated disease or condition
an effective amount of a compound of Formula I, Formula Ia, Formula
Ib, or Formula Ig, and all sub-embodiments thereof. In one
embodiment, the c-kit mediated disease is selected from the group
consisting of malignancies, including mast cell tumors, small cell
lung cancer, testicular cancer, gastrointestinal stromal tumors
(GISTs), glioblastoma, astrocytoma, neuroblastoma, carcinomas of
the female genital tract, sarcomas of neuroectodermal origin,
colorectal carcinoma, carcinoma in situ, Schwann cell neoplasia
associated with neurofibromatosis, acute myelocytic leukemia, acute
lymphocytic leukemia, chronic myelogenous leukemia, mastocytosis,
melanoma, and canine mast cell tumors, and inflammatory diseases,
including asthma, rheumatoid arthritis, allergic rhinitis, multiple
sclerosis, inflammatory bowel syndrome, transplant rejection, and
hypereosinophilia.
[0150] In a related aspect, compounds of Formula I, Formula Ia,
Formula Ib, or Formula Ig, and all sub-embodiments thereof, can be
used in the preparation of a medicament for the treatment of a
c-kit-mediated disease or condition selected from the group
consisting of malignancies, including mast cell tumors, small cell
lung cancer, testicular cancer, gastrointestinal stromal tumors
(GISTs), glioblastoma, astrocytoma, neuroblastoma, carcinomas of
the female genital tract, sarcomas of neuroectodermal origin,
colorectal carcinoma, carcinoma in situ, Schwann cell neoplasia
associated with neurofibromatosis, acute myelocytic leukemia, acute
lymphocytic leukemia, chronic myelogenous leukemia, mastocytosis,
melanoma, and canine mast cell tumors, and inflammatory diseases,
including asthma, rheumatoid arthritis, allergic rhinitis, multiple
sclerosis, inflammatory bowel syndrome, transplant rejection, and
hypereosinophilia.
[0151] In a further aspect, the invention provides methods for
treating a c-fms-mediated disease or condition in an animal subject
(e.g. a mammal such as a human, other primates, sports animals,
animals of commercial interest such as cattle, farm animals such as
horses, or pets such as dogs and cats), e.g., a disease or
condition characterized by abnormal c-fms activity (e.g. kinase
activity). Invention methods involve administering to the subject
suffering from or at risk of a c-fms-mediated disease or condition
an effective amount of compound of Formula I, Formula Ia, Formula
Ib, or Formula Ig, and all sub-embodiments thereof. In one
embodiment, the c-fms mediated disease is selected from the group
consisting of immune disorders, including rheumatoid arthritis,
systemic lupus erythematosis (SLE), Wegener's granulomatosis, and
transplant rejection, inflammatory diseases including Chronic
Obstructive Pulmonary Disease (COPD), emphysema, and
atherosclerosis, metabolic disorders, including insulin resistance,
hyperglycemia, and lipolysis, disorders of bone structure or
mineralization, including osteoporosis, increased risk of fracture,
hypercalcemia, and bone metastases, kidney diseases, including
nephritis (e.g. glomerulonephritis, interstitial nephritis, Lupus
nephritis), tubular necrosis, diabetes-associated renal
complications, and hypertrophy and cancers, including multiple
myeloma, acute myeloid leukemia, chronic myeloid leukemia (CML),
breast cancer, and ovarian cancer.
[0152] In a related aspect, compounds of Formula I, Formula Ia,
Formula Ib, or Formula Ig, and all sub-embodiments thereof, can be
used in the preparation of a medicament for the treatment of a
c-fms-mediated disease or condition selected from the group
consisting of immune disorders, including rheumatoid arthritis,
systemic lupus erythematosis (SLE), Wegener's granulomatosis, and
transplant rejection, inflammatory diseases including Chronic
Obstructive Pulmonary Disease (COPD), emphysema, and
atherosclerosis, metabolic disorders, including insulin resistance,
hyperglycemia, and lipolysis, disorders of bone structure or
mineralization, including osteoporosis, increased risk of fracture,
hypercalcemia, and bone metastases, kidney diseases, including
nephritis (e.g. glomerulonephritis, interstitial nephritis, Lupus
nephritis), tubular necrosis, diabetes-associated renal
complications, and hypertrophy and cancers, including multiple
myeloma, acute myeloid leukemia, chronic myeloid leukemia (CML),
breast cancer, and ovarian cancer.
[0153] In a further aspect, the invention provides methods for
treating a c-fms-mediated and/or c-kit-mediated disease or
condition in an animal subject (e.g. a mammal such as a human,
other primates, sports animals, animals of commercial interest such
as cattle, farm animals such as horses, or pets such as dogs and
cats), e.g., a disease or condition characterized by abnormal c-fms
activity and/or c-kit activity (e.g. kinase activity). Invention
methods involve administering to the subject suffering from or at
risk of a c-fms-mediated and/or c-kit mediated disease or condition
an effective amount of compound of Formula I, Formula Ia, Formula
Ib, or Formula Ig, and all sub-embodiments thereof. In one
embodiment, the c-fms and/or c-kit mediated disease is selected
from the group consisting of mast cell tumors, small cell lung
cancer, testicular cancer, gastrointestinal stromal tumors,
glioblastoma, astrocytoma, neuroblastoma, carcinomas of the female
genital tract, sarcomas of neuroectodermal origin, colorectal
carcinoma, carcinoma in situ, Schwann cell neoplasia associated
with neurofibromatosis, acute myeloid leukemia, acute lymphocytic
leukemia, chronic myelogenous leukemia, multiple myeloma,
mastocytosis, melanoma, breast cancer, ovarian cancer, canine mast
cell tumors, hypertrophy, asthma, rheumatoid arthritis, allergic
rhinitis, multiple sclerosis, inflammatory bowel syndrome,
transplant rejection, systemic lupus erythematosis, Wegener's
granulomatosis, Chronic Obstructive Pulmonary Disease, emphysema,
atherosclerosis, insulin resistance, hyperglycemia, lipolysis,
hypereosinophilia, osteoporosis, increased risk of fracture,
hypercalcemia, bone metastases, glomerulonephritis, interstitial
nephritis, Lupus nephritis, tubular necrosis, and
diabetes-associated renal complications.
[0154] In a related aspect, compounds of Formula I, Formula Ia,
Formula Ib, or Formula Ig, and all sub-embodiments thereof, can be
used in the preparation of a medicament for the treatment of a
c-fms-mediated and/or c-kit mediated disease or condition selected
from the group consisting of mast cell tumors, small cell lung
cancer, testicular cancer, gastrointestinal stromal tumors,
glioblastoma, astrocytoma, neuroblastoma, carcinomas of the female
genital tract, sarcomas of neuroectodermal origin, colorectal
carcinoma, carcinoma in situ, Schwann cell neoplasia associated
with neurofibromatosis, acute myeloid leukemia, acute lymphocytic
leukemia, chronic myelogenous leukemia, multiple myeloma,
mastocytosis, melanoma, breast cancer, ovarian cancer, canine mast
cell tumors, hypertrophy, asthma, rheumatoid arthritis, allergic
rhinitis, multiple sclerosis, inflammatory bowel syndrome,
transplant rejection, systemic lupus erythematosis, Wegener's
granulomatosis, Chronic Obstructive Pulmonary Disease, emphysema,
atherosclerosis, insulin resistance, hyperglycemia, lipolysis,
hypereosinophilia, osteoporosis, increased risk of fracture,
hypercalcemia, bone metastases, glomerulonephritis, interstitial
nephritis, Lupus nephritis, tubular necrosis, and
diabetes-associated renal complications.
[0155] In another aspect, the invention provides methods of using
compounds of Formula I, Formula Ia, Formula Ib, or Formula Ig, and
all sub-embodiments thereof, as described herein (e.g. compounds
that have advantageous levels of activity and/or selectivity on
c-kit, c-fms or both c-kit and c-fms). In certain embodiments, the
compounds are substituted at the 3-position of the core bicyclic
ring structure (azaindole core) with a substituent group that in
order includes a first linker bound to a first aryl or heteroaryl
group, which is bound to a linker of 1 to 3 atoms bound to a second
aryl or heteroaryl group. In certain embodiments including the
just-described 3-position substituent group, the first linker is
methylene, ethylene, --C(O)--, --C(S)--, --O--, --S--, or
--S(O).sub.2--; the first aryl or heteroaryl group is pyridinyl,
pyrimidinyl, pyrazinyl, pyridazinyl, pyrrolyl, imidazolyl,
triazolyl, thiazolyl, or oxazolyl; the second linker is methyl
amino (NHCH.sub.2), ethyl amino (NHCH.sub.2CH.sub.2), amide
(NHC(O)), or sulfonamide (NHSO.sub.2); the second aryl or
heteroaryl group is phenyl, pyridinyl, pyrimidinyl, pyrazinyl,
pyridazinyl, pyrrolyl, imidazolyl, triazolyl, thiazolyl, furanyl,
or oxazolyl; the second aryl or heteroaryl group is optionally
substituted with a lower alkyl group (e.g. a methyl group, an ethyl
group, a propyl group, or a butyl group), an alkoxy group (e.g. a
methoxy group, an ethoxy group, a propoxy group, or a butoxy
group), a halo substituted lower alkyl (e.g. --CH.sub.2F,
--CHF.sub.2, or --CF.sub.3), or halo (e.g. F or Cl). In particular
embodiments, the second aryl or heteroaryl group is a 6-membered
ring; the 6-membered ring is substituted at the para position; the
6-membered ring is substituted at the meta position; the 6-membered
ring is substituted at the ortho position; or the 6-membered ring
is substituted at the meta and para positions. In particular
embodiments, the second aryl or heteroaryl group is a 5-membered
ring; the 5-membered ring is substituted at a position adjacent to
the atom bound to the second linker; or the 5-membered ring is
substituted at a position not adjacent to the atom bound to the
second linker. In particular embodiments, the 3-position
substitutent group is the only non-hydrogen substitutent on the
azaindole core.
[0156] In particular embodiments, the compound has an IC.sub.50 of
less than 100 nM, less than 50 nM, less than 20 nM, less than 10
nM, or less than 5 nM as determined in a generally accepted kinase
activity assay. In certain embodiments, the selectivity of the
compound is such that the compound is at least 2-fold, 5-fold,
10-fold, or 100-fold more active on c-kit than on Ret, PDGF, or
both Ret and PDGF. In certain embodiments, the selectivity of the
compound is such that the compound is at least 2-fold, 5-fold,
10-fold, or 100-fold more active on c-kit than on c-fms. In certain
embodiments, the selectivity of the compound is such that the
compound is at least 2-fold, 5-fold, 10-fold, or 100-fold more
active on c-fms than on c-kit. In certain embodiments, the compound
has in combination each pairing of activity (e.g. IC.sub.50) and/or
selectivity as specified in this paragraph.
[0157] In particular embodiments, the compound has an IC.sub.50 of
less than 100 nM, less than 50 nM, less than 20 nM, less than 10
nM, or less than 5 nM as determined in a generally accepted kinase
activity assay for c-kit, c-fms, or both c-kit and c-fms kinase
activity. In certain embodiments, the selectivity of the compound
is such that the compound is at least 2-fold, 5-fold, 10-fold, or
100-fold more active on c-kit, c-fms, or both c-kit and c-fms than
on Ret, PDGF, or both Ret and PDGF.
[0158] An additional aspect of this invention relates to
compositions that include a therapeutically effective amount of a
compound of Formula I (including Formula Ia, Ib, Ig and all
sub-embodiments thereof) and at least one pharmaceutically
acceptable carrier, excipient, and/or diluent. The composition can
include a plurality of different pharmacologically active
compounds, which can include a plurality of compounds of Formula I
(including Formula Ia, Ib, Ig and all sub-embodiments thereof).
[0159] In a related aspect, the invention provides kits that
include a composition as described herein. In particular
embodiments, the composition is packaged, e.g., in a vial, bottle,
flask, which may be further packaged, e.g., within a box, envelope,
or bag; the composition is approved by the U.S. Food and Drug
Administration or similar regulatory agency for administration to a
mammal, e.g., a human; the composition is approved for
administration to a mammal, e.g., a human, for a c-kit- and/or
c-fms-mediated disease or condition; the kit of the invention
includes written instructions on use and/or other indication that
the composition is suitable or approved for administration to a
mammal, e.g., a human, for a c-kit- and/or c-fms-mediated disease
or condition; the composition is packaged in unit dose or single
dose form, e.g., single dose pills, capsules, or the like.
[0160] The invention also provides a method for identifying or
developing additional compounds active on c-kit and c-fms, e.g.,
improved modulators, by determining whether any of a plurality of
test compounds of Formula I, Formula Ia, Formula Ib, or Formula Ig,
and all sub-embodiments thereof, active on c-kit and c-fms provides
an improvement in one or more desired pharmacologic properties
relative to a reference compound active on c-kit and c-fms, and
selecting a compound 1f any, that has an improvement in the desired
pharmacologic property, thereby providing an improved
modulator.
[0161] In particular aspects of modulator development, the desired
pharmacologic property is serum half-life longer than 2 hr or
longer than 4 hr or longer than 8 hr, aqueous solubility, oral
bioavailability more than 10%, or oral bioavailability more than
20%.
[0162] Furthermore, in particular aspects of modulator development,
the process can be repeated multiple times, i.e., multiple rounds
of preparation of derivatives and/or selection of additional
related compounds and evaluation of such further derivatives of
related compounds can be carried out, e.g., 1, 2, 3, 4, 5, 6, 7, 8,
9, 10 or more additional rounds.
[0163] In another aspect, the present invention also provides a
method for modulating c-kit or c-fms activity by contacting c-kit
or c-fms with an effective amount of a compound of Formula I
(including Formula Ia, Ib, Ig and all sub-embodiments thereof)
active on c-kit and/or c-fms (such as compounds developed using
methods described herein). The compound is preferably provided at a
level sufficient to modulate the activity of the c-kit or c-fms by
at least 10%, more preferably at least 20%, 30%, 40%, 50%, 60%,
70%, 80%, 90%, or greater than 90%. In many embodiments, the
compound will be at a concentration of about 1 .mu.M, 100 .mu.M, or
1 mM, or in a range of 1-100 nM, 100-500 nM, 500-1000 nM, 1-100
.mu.M, 100-500 .mu.M, or 500-1000 .mu.M. In particular embodiments,
the contacting is carried out in vitro.
[0164] Additional aspects and embodiments will be apparent from the
following Detailed Description and from the claims.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0165] As used herein the following definitions apply:
[0166] "Halo" and "halogen" refer to all halogens, that is, chloro
(Cl), fluoro (F), bromo (Br), or iodo (I).
[0167] "Hydroxyl" and "hydroxy" refer to the group --OH.
[0168] "Thiol" refers to the group --SH.
[0169] "Lower alkyl" alone or in combination means an
alkane-derived radical containing from 1 to 6 carbon atoms (unless
specifically defined) that includes a straight chain alkyl or
branched alkyl. The straight chain or branched alkyl group is
attached at any available point to produce a stable compound. In
many embodiments, a lower alkyl is a straight or branched alkyl
group containing from 1-6, 1-4, or 1-2, carbon atoms, such as
methyl, ethyl, propyl, isopropyl, butyl, t-butyl, and the like.
"Optionally substituted lower alkyl" denotes lower alkyl that is
independently substituted, unless indicated otherwise, with one or
more, preferably 1, 2, 3, 4 or 5, also 1, 2, or 3 substituents,
attached at any available atom to produce a stable compound,
wherein the substituents are selected from the group consisting of
--F, --OH, --NH.sub.2, --NO.sub.2, --CN, --C(O)OH, --C(S)OH,
--C(O)NH.sub.2, --C(S)NH.sub.2, --S(O).sub.2NH.sub.2,
--NHC(O)NH.sub.2, --NHC(S)NH.sub.2, --NHS(O).sub.2NH.sub.2,
--C(NH)NH.sub.2, --OR.sup.a, --SR.sup.a, --OC(O)R.sup.a,
--OC(S)R.sup.a, --C(O)R.sup.a, --C(S)R.sup.a, --C(O)OR.sup.a,
--C(S)OR.sup.a, --S(O)R.sup.a, --S(O).sub.2R.sup.a,
--C(O)NHR.sup.a, --C(S)NHR.sup.a, --C(O)NR.sup.aR.sup.a,
--C(S)NR.sup.aR.sup.a, --S(O).sub.2NHR.sup.a,
--S(O).sub.2NR.sup.aR.sup.a, --C(NH)NHR.sup.a,
--C(NH)NR.sup.bR.sup.c, --NHC(O)R.sup.a, --NHC(S)R.sup.a,
--NR.sup.aC(O)R.sup.a, --NR.sup.aC(S)R.sup.a,
--NHS(O).sub.2R.sup.a, --NR.sup.aS(O).sub.2R.sup.a,
--NHC(O)NHR.sup.a, --NHC(S)NHR.sup.a, --NR.sup.aC(O)NH.sub.2,
--NR.sup.aC(S)NH.sub.2, --NR.sup.aC(O)NHR.sup.a,
--NR.sup.aC(S)NHR.sup.a, --NHC(O)NR.sup.aR.sup.a,
--NHC(S)NR.sup.aR.sup.a, --NR.sup.aC(O)NR.sup.aR.sup.a,
--NR.sup.aC(S)NR.sup.aR.sup.a, --NHS(O).sub.2NHR.sup.a,
--NR.sup.aS(O).sub.2NH.sub.2, --NR.sup.aS(O).sub.2NHR.sup.a,
--NHS(O).sub.2NR.sup.aR.sup.a, --NR.sup.aS(O).sub.2NR.sup.aR.sup.a,
--NHR.sup.a, --NR.sup.aR.sup.a, --R.sup.e, --R.sup.f, and
--R.sup.g. Further, possible substitutions include subsets of these
substitutions, such as are indicated herein, for example, in the
description of compounds of Formula I (including Formulae Ia, Ib,
Ig and all sub-embodiments thereof), attached at any available atom
to produce a stable compound. For example "fluoro substituted lower
alkyl" denotes a lower alkyl group substituted with one or more
fluoro atoms, such as perfluoroalkyl, where preferably the lower
alkyl is substituted with 1, 2, 3, 4 or 5 fluoro atoms, also 1, 2,
or 3 fluoro atoms. While it is understood that substitutions are
attached at any available atom to produce a stable compound, when
optionally substituted alkyl is an R group of a moiety such as
--OR, --NHR, --C(O)NHR, and the like, substitution of the alkyl R
group is such that substitution of the alkyl carbon bound to any
--O--, --S--, or --N-- of the moiety (except where --N-- is a
heteroaryl ring atom) excludes substituents that would result in
any --O--, --S--, or --N-- of the substituent (except where --N--
is a heteroaryl ring atom) being bound to the alkyl carbon bound to
any --O--, --S--, or --N-- of the moiety.
[0170] "Lower alkylene" refers to a divalent alkane-derived radical
containing 1-6 carbon atoms, straight chain or branched, from which
two hydrogen atoms are taken from the same carbon atom or from
different carbon atoms. Examples of lower alkylene include, but are
not limited to, methylene --CH.sub.2--, ethylene
--CH.sub.2CH.sub.2--, propylene --CH.sub.2CH.sub.2CH.sub.2--,
isopropylene --CH(CH.sub.3)CH--, and the like. "Optionally
substituted lower alkylene" denotes lower alkylene that is
independently substituted, unless indicated otherwise, with one or
more, preferably 1, 2, 3, 4 or 5, also 1, 2, or 3 substituents,
attached at any available atom to produce a stable compound,
wherein the substituents are selected from the group consisting of
--F, --OH, --NH.sub.2, --NO.sub.2, --CN, --C(O)OH, --C(S)OH,
--C(O)NH.sub.2, --C(S)NH.sub.2, --S(O).sub.2NH.sub.2,
--NHC(O)NH.sub.2, --NHC(S)NH.sub.2, --NHS(O).sub.2NH.sub.2,
--C(NH)NH.sub.2, --OR.sup.a, --SR.sup.a, --OC(O)R.sup.a,
--OC(S)R.sup.a, --C(O)R.sup.a, --C(S)R.sup.a, --C(O)OR.sup.a,
--C(S)OR.sup.a, --S(O)R.sup.a, --S(O).sub.2R.sup.a,
--C(O)NHR.sup.a, --C(S)NHR.sup.a, --C(O)NR.sup.aR.sup.a,
--C(S)NR.sup.aR.sup.a, --S(O).sub.2NHR.sup.a,
--S(O).sub.2NR.sup.aR.sup.a, --C(NH)NHR.sup.a,
--C(NH)NR.sup.bR.sup.c, --NHC(O)R.sup.a, --NHC(S)R.sup.a,
--NR.sup.aC(O)R.sup.a, --NR.sup.aC(S)R.sup.a,
--NHS(O).sub.2R.sup.a, --NR.sup.aS(O).sub.2R.sup.a,
--NHC(O)NHR.sup.a, --NHC(S)NHR.sup.a, --NR.sup.aC(O)NHR.sup.a,
--NR.sup.aC(O)NH.sub.2, --NR.sup.aC(S)NH.sub.2,
--NR.sup.aC(S)NHR.sup.a, --NHC(O)NR.sup.aR.sup.a,
--NHC(S)NR.sup.aR.sup.a, --NR.sup.aC(O)NR.sup.aR.sup.a,
--NR.sup.aC(S)NR.sup.aR.sup.a, --NHS(O).sub.2NHR.sup.a,
--NR.sup.aS(O).sub.2NH.sub.2, --NR.sup.aS(O).sub.2NHR.sup.a,
--NHS(O).sub.2NR.sup.aR.sup.a, --NR.sup.aS(O).sub.2NR.sup.aR.sup.a,
--NHR.sup.a, --NR.sup.aR.sup.a, --R.sup.e, --R.sup.f, and
--R.sup.g, or two substituents on any one carbon or a substituent
on each of any two carbons in the alkylene chain may join to form a
3-7 membered monocyclic cycloalkyl or 5-7 membered monocyclic
heterocycloalkyl wherein the monocyclic cycloalkyl or monocyclic
heterocycloalkyl are optionally substituted with one or more
substituents selected from the group consisting of halogen, --OH,
--NH.sub.2, lower alkyl, fluoro substituted lower alkyl, lower
alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro
substituted lower alkylthio, mono-alkylamino, di-alkylamino, and
cycloalkylamino.
[0171] "Lower alkenyl" alone or in combination means a straight or
branched hydrocarbon containing 2-6 carbon atoms (unless
specifically defined) and at least one, preferably 1-3, more
preferably 1-2, most preferably one, carbon to carbon double bond.
Carbon to carbon double bonds may be either contained within a
straight chain or branched portion. Examples of lower alkenyl
groups include ethenyl, propenyl, isopropenyl, butenyl, and the
like. "Substituted lower alkenyl" denotes lower alkenyl that is
independently substituted, unless indicated otherwise, with one or
more, preferably 1, 2, 3, 4 or 5, also 1, 2, or 3 substituents,
attached at any available atom to produce a stable compound,
wherein the substituents are selected from the group consisting of
--F, --OH, --NH.sub.2, --NO.sub.2, --CN, --C(O)OH, --C(S)OH,
--C(O)NH.sub.2, --C(S)NH.sub.2, --S(O).sub.2NH.sub.2,
--NHC(O)NH.sub.2, --NHC(S)NH.sub.2, --NHS(O).sub.2NH.sub.2,
--C(NH)NH.sub.2, --OR.sup.a, --SR.sup.a, --OC(O)R.sup.a,
--OC(S)R.sup.a, --C(O)R.sup.a, --C(S)R.sup.a, --C(O)OR.sup.a,
--C(S)OR.sup.a, --S(O)R.sup.a, --S(O).sub.2R.sup.a,
--C(O)NHR.sup.a, --C(S)NHR.sup.a, --C(O)NR.sup.aR.sup.a,
--C(S)NR.sup.aR.sup.a, --S(O).sub.2NHR.sup.a,
--S(O).sub.2NR.sup.aR.sup.a, --C(NH)NHR.sup.a,
--C(NH)NR.sup.bR.sup.c, --NHC(O)R.sup.a, --NHC(S)R.sup.a,
--NR.sup.aC(O)R.sup.a, --NR.sup.aC(S)R.sup.a,
--NHS(O).sub.2R.sup.a, --NR.sup.aS(O).sub.2R.sup.a,
--NHC(O)NHR.sup.a, --NHC(S)NHR.sup.a, --NR.sup.aC(O)NH.sub.2,
--NR.sup.aC(S)NH.sub.2, --NR.sup.aC(O)NHR.sup.a,
--NR.sup.aC(S)NHR.sup.a, --NHC(O)NR.sup.aR.sup.a,
--NHC(S)NR.sup.aR.sup.a, --NR.sup.aC(O)NR.sup.aR.sup.a,
--NR.sup.aC(S)NR.sup.aR.sup.a, --NHS(O).sub.2NHR.sup.a,
--NR.sup.aS(O).sub.2NH.sub.2, --NR.sup.aS(O).sub.2NHR.sup.a,
--NHS(O).sub.2NR.sup.aR.sup.a, --NR.sup.aS(O).sub.2NR.sup.aR.sup.a,
--NHR.sup.a, --NR.sup.aR.sup.a, --R.sup.d, --R.sup.f, and
--R.sup.g. Further, possible substitutions include subsets of these
substitutions, such as are indicated herein, for example, in the
description of compounds of Formula I (including Formulae Ia, Ib,
Ig and all sub-embodiments thereof), attached at any available atom
to produce a stable compound. For example "fluoro substituted lower
alkenyl" denotes a lower alkenyl group substituted with one or more
fluoro atoms, where preferably the lower alkenyl is substituted
with 1, 2, 3, 4 or 5 fluoro atoms, also 1, 2, or 3 fluoro atoms.
While it is understood that substitutions are attached at any
available atom to produce a stable compound, substitution of
alkenyl groups are such that --F, --C(O)--, --C(S)--, --C(NH)--,
--S(O)--, --S(O).sub.2--, --O--, --S--, or --N-- (except where
--N-- is a heteroaryl ring atom), are not bound to an alkene carbon
thereof. Further, where alkenyl is a substituent of another moiety
or an R group of a moiety such as --OR, --NHR, --C(O)R, and the
like, substitution of the moiety is such that any --C(O)--,
--C(S)--, --S(O)--, --S(O).sub.2--, --O--, --S--, or --N-thereof
(except where --N-- is a heteroaryl ring atom) are not bound to an
alkene carbon of the alkenyl substituent or R group. Further, where
alkenyl is a substituent of another moiety or an R group of a
moiety such as --OR, --NHR, --C(O)NHR, and the like, substitution
of the alkenyl R group is such that substitution of the alkenyl
carbon bound to any --O--, --S--, or --N-- of the moiety (except
where --N-- is a heteroaryl ring atom) excludes substituents that
would result in any --O--, --S--, or --N-- of the substituent
(except where --N-- is a heteroaryl ring atom) being bound to the
alkenyl carbon bound to any --O--, --S--, or --N-- of the moiety.
An "alkenyl carbon" refers to any carbon within an alkenyl group,
whether saturated or part of the carbon to carbon double bond. An
"alkene carbon" refers to a carbon within an alkenyl group that is
part of a carbon to carbon double bond.
[0172] "Lower alkynyl" alone or in combination means a straight or
branched hydrocarbon containing 2-6 carbon atoms (unless
specifically defined) containing at least one, preferably one,
carbon to carbon triple bond. Examples of alkynyl groups include
ethynyl, propynyl, butynyl, and the like. "Substituted lower
alkynyl" denotes lower alkynyl that is independently substituted,
unless indicated otherwise, with one or more, preferably 1, 2, 3, 4
or 5, also 1, 2, or 3 substituents, attached at any available atom
to produce a stable compound, wherein the substituents are selected
from the group consisting of --F, --OH, --NH.sub.2, --NO.sub.2,
--CN, --C(O)OH, --C(S)OH, --C(O)NH.sub.2, --C(S)NH.sub.2,
--S(O).sub.2NH.sub.2, --NHC(O)NH.sub.2, --NHC(S)NH.sub.2,
--NHS(O).sub.2NH.sub.2, --C(NH)NH.sub.2, --OR.sup.a, --SR.sup.a,
--OC(O)R.sup.a, --OC(S)R.sup.a, --C(O)R.sup.a, --C(S)R.sup.a,
--C(O)OR.sup.a, --C(S)OR.sup.a, --S(O)R.sup.a, --S(O).sub.2R.sup.a,
--C(O)NHR.sup.a, --C(S)NHR.sup.a, --C(O)NR.sup.aR.sup.a,
--C(S)NR.sup.aR.sup.a, --S(O).sub.2NHR.sup.a,
--S(O).sub.2NR.sup.aR.sup.a, --C(NH)NHR.sup.a,
--C(NH)NR.sup.bR.sup.c, --NHC(O)R.sup.a, --NHC(S)R.sup.a,
--NR.sup.aC(O)R.sup.a, --NR.sup.aC(S)R.sup.a,
--NHS(O).sub.2R.sup.a, --NR.sup.aS(O).sub.2R.sup.a,
--NHC(O)NHR.sup.a, --NHC(S)NHR.sup.a, --NR.sup.aC(O)NH.sub.2,
--NR.sup.aC(S)NH.sub.2, --NR.sup.aC(O)NHR.sup.a,
--NR.sup.aC(S)NHR.sup.a, --NHC(O)NR.sup.aR.sup.a,
--NHC(S)NR.sup.aR.sup.a, --NR.sup.aC(O)NR.sup.aR.sup.a,
--NR.sup.aC(S)NR.sup.aR.sup.a, --NHS(O).sub.2NHR.sup.a,
--NR.sup.aS(O).sub.2NH.sub.2, --NR.sup.aS(O).sub.2NHR.sup.a,
--NHS(O).sub.2NR.sup.aR.sup.a, --NR.sup.aS(O).sub.2NR.sup.aR.sup.a,
--NHR.sup.a, --NR.sup.aR.sup.a, --R.sup.d, --R.sup.e, and
--R.sup.g. Further, possible substitutions include subsets of these
substitutions, such as are indicated herein, for example, in the
description of compounds of Formula I (including Formulae Ia, Ib,
Ig and all sub-embodiments thereof), attached at any available atom
to produce a stable compound. For example "fluoro substituted lower
alkynyl" denotes a lower alkynyl group substituted with one or more
fluoro atoms, where preferably the lower alkynyl is substituted
with 1, 2, 3, 4 or 5 fluoro atoms, also 1, 2, or 3 fluoro atoms.
While it is understood that substitutions are attached at any
available atom to produce a stable compound, substitution of
alkynyl groups are such that --F, --C(O)--, --C(S)--, --C(NH)--,
--S(O)--, --S(O).sub.2--, --O--, --S--, or --N-- (except where
--N-- is a heteroaryl ring atom), are not bound to an alkyne carbon
thereof. Further, where alkynyl is a substituent of another moiety
or an R group of a moiety such as --OR, --NHR, --C(O)R, and the
like, substitution of the moiety is such that any --C(O)--,
--C(S)--, --S(O)--, --S(O).sub.2--, --O--, --S--, or --N-- thereof
(except where --N-- is a heteroaryl ring atom) are not bound to an
alkyne carbon of the alkynyl substituent or R group. Further, where
alkynyl is a substituent of another moiety or an R group of a
moiety such as --OR, --NHR, --C(O)NHR, and the like, substitution
of the alkynyl R group is such that substitution of the alkynyl
carbon bound to any --O--, --S--, or --N-- of the moiety (except
where --N-- is a heteroaryl ring atom) excludes substituents that
would result in any --O--, --S--, or --N-- of the substituent
(except where --N-- is a heteroaryl ring atom) being bound to the
alkynyl carbon bound to any --O--, --S--, or --N-- of the moiety.
An "alkynyl carbon" refers to any carbon within an alkynyl group,
whether saturated or part of the carbon to carbon triple bond. An
"alkyne carbon" refers to a carbon within an alkynyl group that is
part of a carbon to carbon triple bond.
[0173] "Cycloalkyl" refers to saturated or unsaturated,
non-aromatic monocyclic, bicyclic or tricyclic carbon ring systems
of 3-10, also 3-8, more preferably 3-6, ring members per ring, such
as cyclopropyl, cyclopentyl, cyclohexyl, adamantyl, and the like.
"Cycloalkylene" is a divalent cycloalkyl. A "substituted
cycloalkyl" is a cycloalkyl that is independently substituted,
unless indicated otherwise, with one or more, preferably 1, 2, 3, 4
or 5, also 1, 2, or 3 substituents, attached at any available atom
to produce a stable compound, wherein the substituents are selected
from the group consisting of halogen, --OH, --NH.sub.2, --NO.sub.2,
--CN, --C(O)OH, --C(S)OH, --C(O)NH.sub.2, --C(S)NH.sub.2,
--S(O).sub.2NH.sub.2, --NHC(O)NH.sub.2, --NHC(S)NH.sub.2,
--NHS(O).sub.2NH.sub.2, --C(NH)NH.sub.2, --OR.sup.a, --SR.sup.a,
--OC(O)R.sup.a, --OC(S)R.sup.a, --C(O)R.sup.a, --C(S)R.sup.a,
--C(O)OR.sup.a, --C(S)OR.sup.a, --S(O)R.sup.a, --S(O).sub.2R.sup.a,
--C(O)NHR.sup.a, --C(S)NHR.sup.a, --C(O)NR.sup.aR.sup.a,
--C(S)NR.sup.aR.sup.a, --S(O).sub.2NHR.sup.a,
--S(O).sub.2NR.sup.aR.sup.a, --C(NH)NHR.sup.a,
--C(NH)NR.sup.bR.sup.c, --NHC(O)R.sup.a, --NHC(S)R.sup.a,
--NR.sup.aC(O)R.sup.a, --NR.sup.aC(S)R.sup.a,
--NHS(O).sub.2R.sup.a, --NR.sup.aS(O).sub.2R.sup.a,
--NHC(O)NHR.sup.a, --NHC(S)NHR.sup.a, --NR.sup.aC(O)NH.sub.2,
--NR.sup.aC(S)NH.sub.2, --NR.sup.aC(O)NHR.sup.a,
--NR.sup.aC(S)NHR.sup.a, --NHC(O)NR.sup.aR.sup.a,
--NHC(S)NR.sup.aR.sup.a, --NR.sup.aC(O)NR.sup.aR.sup.a,
--NR.sup.aC(S)NR.sup.aR.sup.a, --NHS(O).sub.2NHR.sup.a,
--NR.sup.aS(O).sub.2NH.sub.2, --NR.sup.aS(O).sub.2NHR.sup.a,
--NHS(O).sub.2NR.sup.aR.sup.a, --NR.sup.aS(O).sub.2NR.sup.aR.sup.a,
--NHR.sup.a, --NR.sup.aR.sup.a, --R.sup.d, --R.sup.e, --R.sup.f,
and --R.sup.g. "Substituted cycloalkylene" is a divalent
substituted cycloalkyl.
[0174] "Heterocycloalkyl" refers to a saturated or unsaturated
non-aromatic cycloalkyl group having from 5 to 10 atoms in which
from 1 to 3 carbon atoms in the ring are replaced by heteroatoms of
O, S or N, and are optionally fused with benzo or heteroaryl of 5-6
ring members. Heterocycloalkyl is also intended to include oxidized
S or N, such as sulfinyl, sulfonyl and N-oxide of a tertiary ring
nitrogen. Heterocycloalkyl is also intended to include compounds in
which one of the ring carbons is oxo substituted, i.e. the ring
carbon is a carbonyl group, such as lactones and lactams. The point
of attachment of the heterocycloalkyl ring is at a carbon or
nitrogen atom such that a stable ring is retained. Examples of
heterocycloalkyl groups include, but are not limited to,
morpholino, tetrahydrofuranyl, dihydropyridinyl, piperidinyl,
pyrrolidinyl, pyrrolidonyl, piperazinyl, dihydrobenzofuryl, and
dihydroindolyl. "Heterocycloalkylene" is a divalent
heterocycloalkyl. A "substituted heterocycloalkyl" is a
heterocycloalkyl that is independently substituted, unless
indicated otherwise, with one or more, preferably 1, 2, 3, 4 or 5,
also 1, 2, or 3 substituents, attached at any available atom to
produce a stable compound, wherein the substituents are selected
from the group consisting of halogen, --OH, --NH.sub.2, --NO.sub.2,
--CN, --C(O)OH, --C(S)OH, --C(O)NH.sub.2, --C(S)NH.sub.2,
--S(O).sub.2NH.sub.2, --NHC(O)NH.sub.2, --NHC(S)NH.sub.2,
--NHS(O).sub.2NH.sub.2, --C(NH)NH.sub.2, --OR.sup.a, --SR.sup.a,
--OC(O)R.sup.a, --OC(S)R.sup.a, --C(O)R.sup.a, --C(S)R.sup.a,
--C(O)OR.sup.a, --C(S)OR.sup.a, --S(O)R.sup.a, --S(O).sub.2R.sup.a,
--C(O)NHR.sup.a, --C(S)NHR.sup.a, --C(O)NR.sup.aR.sup.a,
--C(S)NR.sup.aR.sup.a, --S(O).sub.2NHR.sup.a,
--S(O).sub.2NR.sup.aR.sup.a, --C(NH)NHR.sup.a,
--C(NH)NR.sup.bR.sup.c, --NHC(O)R.sup.a, --NHC(S)R.sup.a,
--NR.sup.aC(O)R.sup.a, --NR.sup.aC(S)R.sup.a,
--NHS(O).sub.2R.sup.a, --NR.sup.aS(O).sub.2R.sup.a,
--NHC(O)NHR.sup.a, --NHC(S)NHR.sup.a, --NR.sup.aC(O)NH.sub.2,
--NR.sup.aC(S)NH.sub.2, --NR.sup.aC(O)NHR.sup.a,
--NR.sup.aC(S)NHR.sup.a, --NHC(O)NR.sup.aR.sup.a,
--NHC(S)NR.sup.aR.sup.a, --NR.sup.aC(O)NR.sup.aR.sup.a,
--NR.sup.aC(S)NR.sup.aR.sup.a, --NHS(O).sub.2NHR.sup.a,
--NR.sup.aS(O).sub.2NH.sub.2, --NR.sup.aS(O).sub.2NHR.sup.a,
--NHS(O).sub.2NR.sup.aR.sup.a, --NR.sup.aS(O).sub.2NR.sup.aR.sup.a,
--NHR.sup.a, --NR.sup.aR.sup.a, --R.sup.d, --R.sup.e, --R.sup.f,
and --R.sup.g. "Substituted heterocycloalkylene" is a divalent
substituted heterocycloalkyl.
[0175] "Aryl" alone or in combination refers to a monocyclic or
bicyclic ring system containing aromatic hydrocarbons such as
phenyl or naphthyl, which may be optionally fused with a cycloalkyl
of preferably 5-7, more preferably 5-6, ring members. "Arylene" is
a divalent aryl. A "substituted aryl" is an aryl that is
independently substituted, unless indicated otherwise, with one or
more, preferably 1, 2, 3, 4 or 5, also 1, 2, or 3 substituents,
attached at any available atom to produce a stable compound,
wherein the substituents are selected from the group consisting of
halogen, --OH, --NH.sub.2, --NO.sub.2, --CN, --C(O)OH, --C(S)OH,
--C(O)NH.sub.2, --C(S)NH.sub.2, --S(O).sub.2NH.sub.2,
--NHC(O)NH.sub.2, --NHC(S)NH.sub.2, --NHS(O).sub.2NH.sub.2,
--C(NH)NH.sub.2, --OR.sup.a, --SR.sup.a, --OC(O)R.sup.a,
--OC(S)R.sup.a, --C(O)R.sup.a, --C(S)R.sup.a, --C(O)OR.sup.a,
--C(S)OR.sup.a, --S(O)R.sup.a, --S(O).sub.2R.sup.a,
--C(O)NHR.sup.a, --C(S)NHR.sup.a, --C(O)NR.sup.aR.sup.a,
--C(S)NR.sup.aR.sup.a, --S(O).sub.2NHR.sup.a,
--S(O).sub.2NR.sup.aR.sup.a, --C(NH)NHR.sup.a,
--C(NH)NR.sup.bR.sup.c, --NHC(O)R.sup.a, --NHC(S)R.sup.a,
--NR.sup.aC(O)R.sup.a, --NR.sup.aC(S)R.sup.a,
--NHS(O).sub.2R.sup.a, --NR.sup.aS(O).sub.2R.sup.a,
--NHC(O)NHR.sup.a, --NHC(S)NHR.sup.a, --NR.sup.aC(O)NH.sub.2,
--NR.sup.aC(S)NH.sub.2, --NR.sup.aC(O)NHR.sup.a,
--NR.sup.aC(S)NHR.sup.a, --NHC(O)NR.sup.aR.sup.a,
--NHC(S)NR.sup.aR.sup.a, --NR.sup.aC(O)NR.sup.aR.sup.a,
--NR.sup.aC(S)NR.sup.aR.sup.a, --NHS(O).sub.2NHR.sup.a,
--NR.sup.aS(O).sub.2NH.sub.2, --NR.sup.aS(O).sub.2NHR.sup.a,
--NHS(O).sub.2NR.sup.aR.sup.a, --NR.sup.aS(O).sub.2NR.sup.aR.sup.a,
--NHR.sup.a, --NR.sup.aR.sup.a, --R.sup.d, --R.sup.e, --R.sup.f,
and --R.sup.g. A "substituted arylene" is a divalent substituted
aryl.
[0176] "Heteroaryl" alone or in combination refers to a monocyclic
aromatic ring structure containing 5 or 6 ring atoms, or a bicyclic
aromatic group having 8 to 10 atoms, containing one or more,
preferably 1-4, more preferably 1-3, even more preferably 1-2,
heteroatoms independently selected from the group consisting of O,
S, and N. Heteroaryl is also intended to include oxidized S or N,
such as sulfinyl, sulfonyl and N-oxide of a tertiary ring nitrogen.
A carbon or nitrogen atom is the point of attachment of the
heteroaryl ring structure such that a stable compound is produced.
Examples of heteroaryl groups include, but are not limited to,
pyridinyl, pyridazinyl, pyrazinyl, quinaoxalyl, indolizinyl,
benzo[b]thienyl, quinazolinyl, purinyl, indolyl, quinolinyl,
pyrimidinyl, pyrrolyl, oxazolyl, thiazolyl, thienyl, isoxazolyl,
oxathiadiazolyl, isothiazolyl, tetrazolyl, imidazolyl, triazinyl,
furanyl, benzofuryl, and indolyl. "Nitrogen containing heteroaryl"
refers to heteroaryl wherein any heteroatoms are N. "Heteroarylene"
is a divalent heteroaryl. A "substituted heteroaryl" is a
heteroaryl that is independently substituted, unless indicated
otherwise, with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2,
or 3 substituents, attached at any available atom to produce a
stable compound, wherein the substituents are selected from the
group consisting of halogen, --OH, --NH.sub.2, --NO.sub.2, --CN,
--C(O)OH, --C(S)OH, --C(O)NH.sub.2, --C(S)NH.sub.2,
--S(O).sub.2NH.sub.2, --NHC(O)NH.sub.2, --NHC(S)NH.sub.2,
--NHS(O).sub.2NH.sub.2, --C(NH)NH.sub.2, --OR.sup.a, --SR.sup.a,
--OC(O)R.sup.a, --OC(S)R.sup.a, --C(O)R.sup.a, --C(S)R.sup.a,
--C(O)OR.sup.a, --C(S)OR.sup.a, --S(O)R.sup.a, --S(O).sub.2R.sup.a,
--C(O)NHR.sup.a, --C(S)NHR.sup.a, --C(O)NR.sup.aR.sup.a,
--C(S)NR.sup.aR.sup.a, --S(O).sub.2NHR.sup.a,
--S(O).sub.2NR.sup.aR.sup.a, --C(NH)NHR.sup.a,
--C(NH)NR.sup.bR.sup.c, --NHC(O)R.sup.a, --NHC(S)R.sup.a,
--NR.sup.aC(O)R.sup.a, --NR.sup.aC(S)R.sup.a,
--NHS(O).sub.2R.sup.a, --NR.sup.aS(O).sub.2R.sup.a,
--NHC(O)NHR.sup.a, --NHC(S)NHR.sup.a, --NR.sup.aC(O)NH.sub.2,
--NR.sup.aC(S)NH.sub.2, --NR.sup.aC(O)NHR.sup.a,
--NR.sup.aC(S)NHR.sup.a, --NHC(O)NR.sup.aR.sup.a,
--NHC(S)NR.sup.aR.sup.a, --NR.sup.aC(O)NR.sup.aR.sup.a,
--NR.sup.aC(S)NR.sup.aR.sup.a, --NHS(O).sub.2NHR.sup.a,
--NR.sup.aS(O).sub.2NH.sub.2, --NR.sup.aS(O).sub.2NHR.sup.a,
--NHS(O).sub.2NR.sup.aR.sup.a, --NR.sup.aS(O).sub.2NR.sup.aR.sup.a,
--NHR.sup.a, --NR.sup.aR.sup.a, --R.sup.d, --R.sup.e, --R.sup.f,
and --R.sup.g. "Substituted heteroarylene" is a divalent
substituted heteroaryl.
[0177] The variables R.sup.a, R.sup.b, R.sup.c, --R.sup.d,
--R.sup.e, --R.sup.f and --R.sup.g as used in the description of
optional substituents for alkyl, alkylene, alkenyl, alkynyl,
cycloalkyl, heterocycloalkyl, aryl and heteroaryl are defined as
follows:
each R.sup.a, R.sup.b, and R.sup.c are independently selected from
the group consisting of --R.sup.d, --R.sup.e, --R.sup.f, and
--R.sup.g, or R.sup.b and R.sup.c combine with the nitrogen to
which they are attached to form a 5-7 membered heterocycloalkyl or
a 5 or 7 membered nitrogen containing heteroaryl, wherein the 5-7
membered heterocycloalkyl or 5 or 7 membered nitrogen containing
heteroaryl are optionally substituted with one or more, preferably
1, 2, 3, 4 or 5, also 1, 2, or 3 substituents selected from the
group consisting of halogen, --NO.sub.2, --CN, --OH, --NH.sub.2,
--OR.sup.u, --SR.sup.u, --NHR.sup.u, --NR.sup.uR.sup.u, --R.sup.x,
and --R.sup.y; each --R.sup.d is independently lower alkyl, wherein
lower alkyl is optionally substituted with one or more, preferably
1, 2, 3, 4 or 5, also 1, 2 or 3 substituents selected from the
group consisting of fluoro, --OH, --NH.sub.2, --NO.sub.2, --CN,
--C(O)OH, --C(S)OH, --C(O)NH.sub.2, --C(S)NH.sub.2,
--S(O).sub.2NH.sub.2, --NHC(O)NH.sub.2, --NHC(S)NH.sub.2,
--NHS(O).sub.2NH.sub.2, --C(NH)NH.sub.2, --OR.sup.k, --SR.sup.k,
--OC(O)R.sup.k, --OC(S)R.sup.k, --C(O)R.sup.k, --C(S)R.sup.k,
--C(O)OR.sup.k, --C(S)OR.sup.k, --S(O)R.sup.k, --S(O).sub.2R.sup.k,
--C(O)NHR.sup.k, --C(S)NHR.sup.k, --C(O)NR.sup.kR.sup.k,
--C(S)NR.sup.kR.sup.k, --S(O).sub.2NHR.sup.k,
--S(O).sub.2NR.sup.kR.sup.k, --C(NH)NHR.sup.k,
--C(NH)NR.sup.mR.sup.n, --NHC(O)R.sup.k, --NHC(S)R.sup.k,
--NR.sup.kC(O)R.sup.k, --NR.sup.kC(S)R.sup.k,
--NHS(O).sub.2R.sup.k, --NR.sup.kS(O).sub.2R.sup.k,
--NHC(O)NHR.sup.k, --NHC(S)NHR.sup.k, --NR.sup.kC(O)NH.sub.2,
--NR.sup.kC(S)NH.sub.2, --NR.sup.kC(O)NHR.sup.k,
--NR.sup.kC(S)NHR.sup.k, --NHC(O)NR.sup.kR.sup.k,
--NHC(S)NR.sup.kR.sup.k, --NR.sup.kC(O)NR.sup.kR.sup.k,
--NR.sup.kC(S)NR.sup.kR.sup.k, --NHS(O).sub.2NHR.sup.k,
--NR.sup.kS(O).sub.2NH.sub.2, --NR.sup.kS(O).sub.2NHR.sup.k,
--NHS(O).sub.2NR.sup.kR.sup.k, --NR.sup.kS(O).sub.2NR.sup.kR.sup.k,
--NHR.sup.k, --NR.sup.kR.sup.k, --R.sup.i, and --R.sup.j; each
--R.sup.e is independently lower alkenyl, wherein lower alkenyl is
optionally substituted with one or more, preferably 1, 2, 3, 4 or
5, also 1, 2 or 3 substituents selected from the group consisting
of fluoro, --OH, --NH.sub.2, --NO.sub.2, --CN, --C(O)OH, --C(S)OH,
--C(O)NH.sub.2, --C(S)NH.sub.2, --S(O).sub.2NH.sub.2,
--NHC(O)NH.sub.2, --NHC(S)NH.sub.2, --NHS(O).sub.2NH.sub.2,
--C(NH)NH.sub.2, --OR.sup.k, --SR.sup.k, --OC(O)R.sup.k,
--OC(S)R.sup.k, --C(O)R.sup.k, --C(S)R.sup.k, --C(O)OR.sup.k,
--C(S)OR.sup.k, --S(O)R.sup.k, --S(O).sub.2R.sup.k,
--C(O)NHR.sup.k, --C(S)NHR.sup.k, --C(O)NR.sup.kR.sup.k,
--C(S)NR.sup.kR.sup.k, --S(O).sub.2NHR.sup.k,
--S(O).sub.2NR.sup.kR.sup.k, --C(NH)NHR.sup.k,
--C(NH)NR.sup.mR.sup.n, --NHC(O)R.sup.k, --NHC(S)R.sup.k,
--NR.sup.kC(O)R.sup.k, --NR.sup.kC(S)R.sup.k,
--NHS(O).sub.2R.sup.k, --NR.sup.kS(O).sub.2R.sup.k,
--NHC(O)NHR.sup.k, --NHC(S)NHR.sup.k, --NR.sup.kC(O)NH.sub.2,
--NR.sup.kC(S)NH.sub.2, --NR.sup.kC(O)NHR.sup.k,
--NR.sup.kC(S)NHR.sup.k, --NHC(O)NR.sup.kR.sup.k,
--NHC(S)NR.sup.kR.sup.k, --NR.sup.kC(O)NR.sup.kR.sup.k,
--NR.sup.kC(S)NR.sup.kR.sup.k, --NHS(O).sub.2NHR.sup.k,
--NR.sup.kS(O).sub.2NH.sub.2, --NR.sup.kS(O).sub.2NHR.sup.k,
--NHS(O).sub.2NR.sup.kR.sup.k, --NR.sup.kS(O).sub.2NR.sup.kR.sup.k,
--NHR.sup.k, --NR.sup.kR.sup.k, --R.sup.h, and --R.sup.j; each
--R.sup.f is independently lower alkynyl, wherein lower alkynyl is
optionally substituted with one or more, preferably 1, 2, 3, 4 or
5, also 1, 2 or 3 substituents selected from the group consisting
of fluoro, --OH, --NH.sub.2, --NO.sub.2, --CN, --C(O)OH, --C(S)OH,
--C(O)NH.sub.2, --C(S)NH.sub.2, --S(O).sub.2NH.sub.2,
--NHC(O)NH.sub.2, --NHC(S)NH.sub.2, --NHS(O).sub.2NH.sub.2,
--C(NH)NH.sub.2, --OR.sup.k, --SR.sup.k, --OC(O)R.sup.k,
--OC(S)R.sup.k, --C(O)R.sup.k, --C(S)R.sup.k, --C(O)OR.sup.k,
--C(S)OR.sup.k, --S(O)R.sup.k, --S(O).sub.2R.sup.k,
--C(O)NHR.sup.k, --C(S)NHR.sup.k, --C(O)NR.sup.kR.sup.k,
--C(S)NR.sup.kR.sup.k, --S(O).sub.2NHR.sup.k,
--S(O).sub.2NR.sup.kR.sup.k, --C(NH)NHR.sup.k,
--C(NH)NR.sup.mR.sup.n, --NHC(O)R.sup.k, --NHC(S)R.sup.k,
--NR.sup.kC(O)R.sup.k, --NR.sup.kC(S)R.sup.k,
--NHS(O).sub.2R.sup.k, --NR.sup.kS(O).sub.2R.sup.k,
--NHC(O)NHR.sup.k, --NHC(S)NHR.sup.k, --NR.sup.kC(O)NH.sub.2,
--NR.sup.kC(S)NH.sub.2, --NR.sup.kC(O)NHR.sup.k,
--NR.sup.kC(S)NHR.sup.k, --NHC(O)NR.sup.kR.sup.k,
--NHC(S)NR.sup.kR.sup.k, --NR.sup.kC(O)NR.sup.kR.sup.k,
--NR.sup.kC(S)NR.sup.kR.sup.k, --NHS(O).sub.2NHR.sup.k,
--NR.sup.kS(O).sub.2NH.sub.2, --NR.sup.kS(O).sub.2NHR.sup.k,
--NHS(O).sub.2NR.sup.kR.sup.k, --NR.sup.kS(O).sub.2NR.sup.kR.sup.k,
--NHR.sup.k, --NR.sup.kR.sup.k, --R.sup.h, and --R.sup.j; each
--R.sup.g is independently selected from the group consisting of
cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, wherein
cycloalkyl, heterocycloalkyl, aryl, and heteroaryl are optionally
substituted with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2
or 3 substituents selected from the group consisting of halogen,
--OH, --NH.sub.2, --NO.sub.2, --CN, --C(O)OH, --C(S)OH,
--C(O)NH.sub.2, --C(S)NH.sub.2, --S(O).sub.2NH.sub.2,
--NHC(O)NH.sub.2, --NHC(S)NH.sub.2, --NHS(O).sub.2NH.sub.2,
--C(NH)NH.sub.2, --OR.sup.k, --SR.sup.k, --OC(O)R.sup.k,
--OC(S)R.sup.k, --C(O)R.sup.k, --C(S)R.sup.k, --C(O)OR.sup.k,
--C(S)OR.sup.k, --S(O)R.sup.k, --S(O).sub.2R.sup.k,
--C(O)NHR.sup.k, --C(S)NHR.sup.k, --C(O)NR.sup.kR.sup.k,
--C(S)NR.sup.kR.sup.k, --S(O).sub.2NHR.sup.k,
--S(O).sub.2NR.sup.kR.sup.k, --C(NH)NHR.sup.k,
--C(NH)NR.sup.mR.sup.n, --NHC(O)R.sup.k, --NHC(S)R.sup.k,
--NR.sup.kC(O)R.sup.k, --NR.sup.kC(S)R.sup.k,
--NHS(O).sub.2R.sup.k, --NR.sup.kS(O).sub.2R.sup.k,
--NHC(O)NHR.sup.k, --NHC(S)NHR.sup.k, --NR.sup.kC(O)NH.sub.2,
--NR.sup.kC(S)NH.sub.2, --NR.sup.kC(O)NHR.sup.k,
--NR.sup.kC(S)NHR.sup.k, --NHC(O)NR.sup.kR.sup.k,
--NHC(S)NR.sup.kR.sup.k, --NR.sup.kC(O)NR.sup.kR.sup.k,
--NR.sup.kC(S)NR.sup.kR.sup.k, --NHS(O).sub.2NHR.sup.k,
--NR.sup.kS(O).sub.2NH.sub.2, --NR.sup.kS(O).sub.2NHR.sup.k,
--NHS(O).sub.2NR.sup.kR.sup.k, --NR.sup.kS(O).sub.2NR.sup.kR.sup.k,
--NHR.sup.k, --NR.sup.kR.sup.k, --R.sup.h, --R.sup.i, and
--R.sup.j; [0178] wherein R.sup.k, R.sup.m, and R.sup.n at each
occurrence are independently selected from the group consisting of
--R.sup.h, --R.sup.i, and --R.sup.j, or R.sup.m and R.sup.n combine
with the nitrogen to which they are attached form a 5-7 membered
heterocycloalkyl or a 5 or 7 membered nitrogen containing
heteroaryl, wherein the 5-7 membered heterocycloalkyl or 5 or 7
membered nitrogen containing heteroaryl are optionally substituted
with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2, or 3
substituents selected from the group consisting of halogen,
--NO.sub.2, --CN, --OH, --NH.sub.2, OR.sup.u, --SR.sup.u,
--NHR.sup.u, --NR.sup.uR.sup.u, --R.sup.x, and --R.sup.y; [0179]
wherein each --R.sup.h is independently lower alkyl optionally
substituted with one or more, preferably 1, 2, 3, 4 or 5, also 1,
2, or 3 substituents selected from the group consisting of fluoro,
--OH, --NH.sub.2, --NO.sub.2, --CN, --C(O)OH, --C(S)OH,
--C(O)NH.sub.2, --C(S)NH.sub.2, --S(O).sub.2NH.sub.2,
--NHC(O)NH.sub.2, --NHC(S)NH.sub.2, --NHS(O).sub.2NH.sub.2,
--C(NH)NH.sub.2, --OR.sup.r, --SR.sup.r, --OC(O)R.sup.r,
--OC(S)R.sup.r, --C(O)R.sup.r, --C(S)R.sup.r, --C(O)OR.sup.r,
--C(S)OR.sup.r, --S(O)R.sup.r, --S(O).sub.2R.sup.r,
--C(O)NHR.sup.r, --C(S)NHR.sup.r, --C(O)NR.sup.rR.sup.r,
--C(S)NR.sup.rR.sup.r, --S(O).sub.2NHR.sup.r,
--S(O).sub.2NR.sup.rR.sup.r, --C(NH)NHR.sup.r,
--C(NH)NR.sup.sR.sup.t, --NHC(O)R.sup.r, --NHC(S)R.sup.r,
--NR.sup.rC(O)R.sup.r, --NR.sup.rC(S)R.sup.r,
--NHS(O).sub.2R.sup.r, --NR.sup.rS(O).sub.2R.sup.r,
--NHC(O)NHR.sup.r, --NHC(S)NHR.sup.r, --NR.sup.rC(O)NH.sub.2,
--NR.sup.rC(S)NH.sub.2, --NR.sup.rC(O)NHR.sup.r,
--NR.sup.rC(S)NHR.sup.r, --NHC(O)NR.sup.rR.sup.r,
--NHC(S)NR.sup.rR.sup.r, --NR.sup.rC(O)NR.sup.rR.sup.r,
--NR.sup.rC(S)NR.sup.rR.sup.r, --NHS(O).sub.2NHR.sup.r,
--NR.sup.rS(O).sub.2NH.sub.2, --NR.sup.rS(O).sub.2NHR.sup.r,
--NHS(O).sub.2NR.sup.rR.sup.r, --NR.sup.rS(O).sub.2NR.sup.rR.sup.r,
--NHR.sup.r, --NR.sup.rR.sup.r, --R.sup.i, and --R.sup.j; [0180]
wherein each --R.sup.i is independently selected from the group
consisting of lower alkenyl and lower alkynyl, wherein lower
alkenyl or lower alkynyl are optionally substituted with one or
more, preferably 1, 2, 3, 4 or 5, also 1, 2 or 3 substituents
selected from the group consisting of fluoro, --OH, --NH.sub.2,
--NO.sub.2, --CN, --C(O)OH, --C(S)OH, --C(O)NH.sub.2,
--C(S)NH.sub.2, --S(O).sub.2NH.sub.2, --NHC(O)NH.sub.2,
--NHC(S)NH.sub.2, --NHS(O).sub.2NH.sub.2, --C(NH)NH.sub.2,
--OR.sup.r, --SR.sup.r, --OC(O)R.sup.r, --OC(S)R.sup.r,
--C(O)R.sup.r, --C(S)R.sup.r, --C(O)OR.sup.r, --C(S)OR.sup.r,
--S(O)R.sup.r, --S(O).sub.2R.sup.r, --C(O)NHR.sup.r,
--C(S)NHR.sup.r, --C(O)NR.sup.rR.sup.r, --C(S)NR.sup.rR.sup.r,
--S(O).sub.2NHR.sup.r, --S(O).sub.2NR.sup.rR.sup.r,
--C(NH)NHR.sup.r, --C(NH)NR.sup.sR.sup.t, --NHC(O)R.sup.r,
--NHC(S)R.sup.r, --NR.sup.rC(O)R.sup.r, --NR.sup.rC(S)R.sup.r,
--NHS(O).sub.2R.sup.r, --NR.sup.rS(O).sub.2R.sup.r,
--NHC(O)NHR.sup.r, --NHC(S)NHR.sup.r, --NR.sup.rC(O)NH.sub.2,
--NR.sup.rC(S)NH.sub.2, --NR.sup.rC(O)NHR.sup.r,
--NR.sup.rC(S)NHR.sup.r, --NHC(O)NR.sup.rR.sup.r,
--NHC(S)NR.sup.rR.sup.r, --NR.sup.rC(O)NR.sup.rR.sup.r,
--NR.sup.rC(S)NR.sup.rR.sup.r, --NHS(O).sub.2NHR.sup.r,
--NR.sup.rS(O).sub.2NH.sub.2, --NR.sup.rS(O).sub.2NHR.sup.r,
--NHS(O).sub.2NR.sup.rR.sup.r, --NR.sup.rS(O).sub.2NR.sup.rR.sup.r,
--NHR.sup.r, --NR.sup.rR.sup.r, and --R.sup.j; [0181] wherein each
--R.sup.j is independently selected from the group consisting of
cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, wherein
cycloalkyl, heterocycloalkyl, aryl, and heteroaryl are optionally
substituted with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2
or 3 substituents selected from the group consisting of halogen,
--OH, --NH.sub.2, --NO.sub.2, --CN, --C(O)OH, --C(S)OH,
--C(O)NH.sub.2, --C(S)NH.sub.2, --S(O).sub.2NH.sub.2,
--NHC(O)NH.sub.2, --NHC(S)NH.sub.2, --NHS(O).sub.2NH.sub.2,
--C(NH)NH.sub.2, --OR.sup.r, --SR.sup.r, --OC(O)R.sup.r,
--OC(S)R.sup.r, --C(O)R.sup.r, --C(S)R.sup.r, --C(O)OR.sup.r,
--C(S)OR.sup.r, --S(O)R.sup.r, --S(O).sub.2R.sup.r,
--C(O)NHR.sup.r, --C(S)NHR.sup.r, --C(O)NR.sup.rR.sup.r,
--C(S)NR.sup.rR.sup.r, --S(O).sub.2NHR.sup.r,
--S(O).sub.2NR.sup.rR.sup.r, --C(NH)NHR.sup.r,
--C(NH)NR.sup.sR.sup.t, --NHC(O)R.sup.r, --NHC(S)R.sup.r,
--NR.sup.rC(O)R.sup.r, --NR.sup.rC(S)R.sup.r,
--NHS(O).sub.2R.sup.r, --NR.sup.rS(O).sub.2R.sup.r,
--NHC(O)NHR.sup.r, --NHC(S)NHR.sup.r, --NR.sup.rC(O)NH.sub.2,
--NR.sup.rC(S)NH.sub.2, --NR.sup.rC(O)NHR.sup.r,
--NR.sup.rC(S)NHR.sup.r, --NHC(O)NR.sup.rR.sup.r,
--NHC(S)NR.sup.rR.sup.r, --NR.sup.rC(O)NR.sup.rR.sup.r,
--NR.sup.rC(S)NR.sup.rR.sup.r, --NHS(O).sub.2NHR.sup.r,
--NR.sup.rS(O).sub.2NH.sub.2, --NR.sup.rS(O).sub.2NHR.sup.r,
--NHS(O).sub.2NR.sup.rR.sup.r, --NR.sup.rS(O).sub.2NR.sup.rR.sup.r,
--NHR.sup.r, --NR.sup.rR.sup.r, cycloalkylamino, and --R.sup.x;
[0182] wherein each R.sup.r, R.sup.s, and R.sup.t at each
occurrence are independently selected from the group consisting of
lower alkyl, C.sub.3-6 alkenyl, C.sub.3-6 alkynyl, cycloalkyl,
heterocycloalkyl, aryl and heteroaryl, wherein lower alkyl is
optionally substituted with one or more, preferably 1, 2, 3, 4 or
5, also 1, 2, or 3 substituents selected from the group consisting
of --R.sup.y, fluoro, --OH, --NH.sub.2, lower alkoxy, fluoro
substituted lower alkoxy, lower alkylthio, fluoro substituted lower
alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino,
provided that any substitution of the lower alkyl carbon bound to
any --O--, --S--, or --N--, of --OR.sup.r, --SR.sup.r,
--C(O)OR.sup.r, --C(S)OR.sup.r, --C(O)NHR.sup.r, --C(S)NHR.sup.r,
--C(O)NR.sup.rR.sup.r, --C(S)NR.sup.rR.sup.r,
--S(O).sub.2NHR.sup.r, --S(O).sub.2NR.sup.rR.sup.r,
--C(NH)NHR.sup.r, --NR.sup.rC(O)R.sup.r, --NR.sup.rC(S)R.sup.r,
--NR.sup.rS(O).sub.2R.sup.r, --NHC(O)NHR.sup.r,
--NHC(S)NHR.sup.rR.sup.r, --NR.sup.rC(O)NH.sub.2,
--NR.sup.rC(S)NH.sub.2, --NR.sup.rC(O)NHR.sup.r,
--NR.sup.rC(S)NHR.sup.r, --NHC(O)NR.sup.rR.sup.r,
--NHC(S)NR.sup.rR.sup.r, --NR.sup.rC(O)NR.sup.rR.sup.r,
--NR.sup.rC(S)NR.sup.rR.sup.r, --NHS(O).sub.2NHR.sup.r,
--NR.sup.rS(O).sub.2NH.sub.2, --NR.sup.rS(O).sub.2NHR.sup.r,
--NHS(O).sub.2NR.sup.rR.sup.r, --NR.sup.rS(O).sub.2NR.sup.rR.sup.r,
--NHR.sup.r, or --NR.sup.rR.sup.r is selected from the group
consisting of fluoro and --R.sup.y, and wherein C.sub.3-6 alkenyl
or C.sub.3-6 alkynyl are optionally substituted with one or more,
preferably 1, 2, 3, 4 or 5, also 1, 2, or 3 substituents selected
from the group consisting of --R.sup.y, fluoro, lower alkyl, fluoro
substituted lower alkyl, lower alkoxy, fluoro substituted lower
alkoxy, lower alkylthio, fluoro substituted lower alkylthio,
mono-alkylamino, di-alkylamino, and cycloalkylamino, provided that
any substitution of the C.sub.3-6 alkenyl or C.sub.3-6 alkynyl
carbon bound to any --O--, --S--, or --N--, of --OR.sup.r,
--SR.sup.r, --C(O)OR.sup.r, --C(S)OR.sup.r, --C(O)NHR.sup.r,
--C(S)NHR.sup.r, --C(O)NR.sup.rR.sup.r, --C(S)NR.sup.rR.sup.r,
--S(O).sub.2NHR.sup.r, --S(O).sub.2NR.sup.rR.sup.r,
--C(NH)NHR.sup.r, --NR.sup.rC(O)R.sup.r, --NR.sup.rC(S)R.sup.r,
--NR.sup.rS(O).sub.2R.sup.r, --NHC(O)NHR.sup.r, --NHC(S)NHR.sup.r,
--NR.sup.rC(O)NH.sub.2, --NR.sup.rC(S)NH.sub.2,
--NR.sup.rC(O)NHR.sup.r, --NR.sup.rC(S)NHR.sup.r,
--NHC(O)NR.sup.rR.sup.r, --NHC(S)NR.sup.rR.sup.r,
--NR.sup.rC(O)NR.sup.rR.sup.r, --NR.sup.rC(S)NR.sup.rR.sup.r,
--NHS(O).sub.2NHR.sup.r, --NR.sup.rS(O).sub.2NH.sub.2,
--NR.sup.rS(O).sub.2NHR.sup.r, --NHS(O).sub.2NR.sup.rR.sup.r,
--NR.sup.rS(O).sub.2NR.sup.rR.sup.r, --NHR.sup.r, or
--NR.sup.rR.sup.r is selected from the group consisting of fluoro,
lower alkyl, fluoro substituted lower alkyl, or --R.sup.y, and
wherein cycloalkyl, heterocycloalkyl, aryl, and heteroaryl are
optionally substituted with one or more, preferably 1, 2, 3, 4 or
5, also 1, 2, or 3 substituents selected from the group consisting
of halogen, --OH, --NH.sub.2, --NO.sub.2, --CN, lower alkyl, fluoro
substituted lower alkyl, lower alkoxy, fluoro substituted lower
alkoxy, lower alkylthio, fluoro substituted lower alkylthio,
mono-alkyl amino, di-alkyl amino, and cycloalkylamino, or R.sup.s
and R.sup.t combine with the nitrogen to which they are attached
form a 5-7 membered heterocycloalkyl or a 5 or 7 membered nitrogen
containing heteroaryl, wherein the 5-7 membered heterocycloalkyl or
5 or 7 membered nitrogen containing heteroaryl are optionally
substituted with one or more, preferably 1, 2, 3, 4 or 5, also 1,
2, or 3 substituents selected from the group consisting of halogen,
--NO.sub.2, --CN, --OH, --NH.sub.2, OR.sup.u, --SR.sup.u,
--NHR.sup.u, --NR.sup.uR.sup.u, --R.sup.x, and --R.sup.y; [0183]
wherein each R.sup.u is independently selected from the group
consisting of lower alkyl, C.sub.3-6 alkenyl, C.sub.3-6 alkynyl,
cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, wherein lower
alkyl is optionally substituted with one or more, preferably 1, 2,
3, 4 or 5, also 1, 2, or 3 substituents selected from the group
consisting of
--R.sup.y, fluoro, --OH, --NH.sub.2, lower alkoxy, fluoro
substituted lower alkoxy, lower alkylthio, fluoro substituted lower
alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino,
provided that any substitution of the lower alkyl carbon bound to
the --O-- of --OR.sup.u, --S-- of --SR.sup.u, or --N-- of
--NHR.sup.u is fluoro or --R.sup.y, and wherein C.sub.3-6 alkenyl
or C.sub.3-6 alkynyl are optionally substituted with one or more,
preferably 1, 2, 3, 4 or 5, also 1, 2, or 3 substituents selected
from the group consisting of --R.sup.y, fluoro, --OH, --NH.sub.2,
lower alkyl, fluoro substituted lower alkyl, lower alkoxy, fluoro
substituted lower alkoxy, lower alkylthio, fluoro substituted lower
alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino,
provided that any substitution of the C.sub.3-6 alkenyl or
C.sub.3-6 alkynyl carbon bound to the --O-- of --OR.sup.u, --S-- of
--SR.sup.u, or --N-- of --NHR.sup.u is fluoro, lower alkyl, fluoro
substituted lower alkyl, or --R.sup.y, and wherein cycloalkyl,
heterocycloalkyl, aryl, and heteroaryl are optionally substituted
with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2, or 3
substituents selected from the group consisting of halogen, --OH,
--NH.sub.2, --NO.sub.2, --CN, lower alkyl, fluoro substituted lower
alkyl, lower alkoxy, fluoro substituted lower alkoxy, lower
alkylthio, fluoro substituted lower alkylthio, mono-alkyl amino,
di-alkyl amino, and cycloalkylamino; [0184] wherein each --R.sup.x
is selected from the group consisting of lower alkyl, lower alkenyl
and lower alkynyl, wherein lower alkyl is optionally substituted
with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2, or 3
substituents selected from the group consisting of --R.sup.y,
fluoro, --OH, --NH.sub.2, lower alkoxy, fluoro substituted lower
alkoxy, lower alkylthio, fluoro substituted lower alkylthio,
mono-alkyl amino, di-alkyl amino, and cycloalkylamino, and wherein
lower alkenyl or lower alkynyl are optionally substituted with one
or more, preferably 1, 2, 3, 4 or 5, also 1, 2, or 3 substituents
selected from the group consisting of --R.sup.y, fluoro, --OH,
--NH.sub.2, lower alkyl, fluoro substituted lower alkyl, lower
alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro
substituted lower alkylthio, mono-alkyl amino, di-alkyl amino, and
cycloalkylamino; [0185] wherein each --R.sup.y is selected from the
group consisting of cycloalkyl, heterocycloalkyl, aryl, and
heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl, and
heteroaryl are optionally substituted with one or more, preferably
1, 2, 3, 4 or 5, also 1, 2, or 3 substituents selected from the
group consisting of halogen, --OH, --NH.sub.2, --NO.sub.2, --CN,
lower alkyl, fluoro substituted lower alkyl, lower alkoxy, fluoro
substituted lower alkoxy, lower alkylthio, fluoro substituted lower
alkylthio, mono-alkyl amino, di-alkyl amino, and
cycloalkylamino.
[0186] "Lower alkoxy" denotes the group --OR.sup.z, where R.sup.z
is lower alkyl. "Substituted lower alkoxy" denotes lower alkoxy in
which R.sup.z is lower alkyl substituted with one or more
substituents as indicated herein, for example, in the description
of compounds of Formula I (including Formulae Ia, Ib, Ig and all
sub-embodiments thereof), including descriptions of substituted
cycloalkyl, cycloheteroalkyl, aryl and heteroaryl, attached at any
available atom to produce a stable compound. Preferably,
substitution of lower alkoxy is with 1, 2, 3, 4, or 5 substituents,
also 1, 2, or 3 substituents. For example "fluoro substituted lower
alkoxy" denotes lower alkoxy in which the lower alkyl is
substituted with one or more fluoro atoms, where preferably the
lower alkoxy is substituted with 1, 2, 3, 4 or 5 fluoro atoms, also
1, 2, or 3 fluoro atoms. While it is understood that substitutions
on alkoxy are attached at any available atom to produce a stable
compound, substitution of alkoxy is such that --O--, --S--, or
--N-- (except where N is a heteroaryl ring atom), are not bound to
the alkyl carbon bound to the alkoxy --O--. Further, where alkoxy
is described as a substituent of another moiety, the alkoxy oxygen
is not bound to a carbon atom that is bound to an --O--, --S--, or
--N-- of the other moiety (except where N is a heteroaryl ring
atom), or to an alkene or alkyne carbon of the other moiety.
[0187] "Lower alkylthio" denotes the group --SR.sup.aa, where
R.sup.aa is lower alkyl. "Substituted lower alkylthio" denotes
lower alkylthio in which R.sup.aa is lower alkyl substituted with
one or more substituents as indicated herein, for example, in the
description of compounds of Formula I (including Formulae Ia, Ib,
Ig and all sub-embodiments thereof), including descriptions of
substituted cycloalkyl, cycloheteroalkyl, aryl and heteroaryl,
attached at any available atom to produce a stable compound.
Preferably, substitution of lower alkylthio is with 1, 2, 3, 4, or
5 substituents, also 1, 2, or 3 substituents. For example "fluoro
substituted lower alkylthio" denotes lower alkylthio in which the
lower alkyl is substituted with one or more fluoro atoms, where
preferably the lower alkylthio is substituted with 1, 2, 3, 4 or 5
fluoro atoms, also 1, 2, or 3 fluoro atoms. While it is understood
that substitutions on alkylthio are attached at any available atom
to produce a stable compound, substitution of alkylthio is such
that --O--, --S--, or --N-- (except where N is a heteroaryl ring
atom), are not bound to the alkyl carbon bound to the alkylthio
--S--. Further, where alkylthio is described as a substituent of
another moiety, the alkylthio sulfur is not bound to a carbon atom
that is bound to an --O--, --S--, or --N-- of the other moiety
(except where N is a heteroaryl ring atom), or to an alkene or
alkyne carbon of the other moiety.
[0188] "Amino" or "amine" denotes the group --NH.sub.2.
"Mono-alkylamino" denotes the group --NHR.sup.bb where R.sup.bb is
lower alkyl. "Di-alkylamino" denotes the group --NR.sup.bbR.sup.cc,
where R.sup.bb and R.sup.cc are independently lower alkyl.
"Cycloalkylamino" denotes the group --NR.sup.ddR.sup.ee, where
R.sup.dd and R.sup.ee combine with the nitrogen to form a 5-7
membered heterocycloalkyl, where the heterocycloalkyl may contain
an additional heteroatom within the ring, such as --O--, --N--, or
--S--, and may also be further substituted with lower alkyl.
Examples of 5-7 membered heterocycloalkyl include, but are not
limited to, piperidine, piperazine, 4-methylpiperazine, morpholine,
and thiomorpholine. While it is understood that when
mono-alkylamino, di-alkylamino, or cycloalkylamino are substituents
on other moieties that are attached at any available atom to
produce a stable compound, the nitrogen of mono-alkylamino,
di-alkylamino, or cycloalkylamino as substituents is not bound to a
carbon atom that is bound to an --O--, --S--, or --N-- of the other
moiety.
[0189] As used herein, the term c-kit-mediated disease or condition
refers to a disease or condition in which the biological function
of c-kit affects the development and/or course of the disease or
condition, and/or in which modulation of c-kit alters the
development, course, and/or symptoms. For example, mutations in the
c-kit gene such as the W42, Wv, and W41 mutations reported by
Herbst et al (J. Biol. Chem., 1992, 267: 13210-13216) confer
severe, intermediate, and mild phenotypic characteristics,
respectively. These mutations attenuate the intrinsic tyrosine
kinase activity of the receptor to different degrees and are models
for the effect of modulation of c-kit activity. A c-kit mediated
disease or condition includes a disease or condition for which
c-kit inhibition provides a therapeutic benefit, e.g. wherein
treatment with c-kit inhibitors, including compounds described
herein, provides a therapeutic benefit to the subject suffering
from or at risk of the disease or condition.
[0190] As used herein, the term c-fms-mediated disease or condition
refers to a disease or condition in which the biological function
of c-fms affects the development and/or course of the disease or
condition, and/or in which modulation of c-fms alters the
development, course, and/or symptoms. For example, the
Csflr.sup.-/Csflr.sup.- mutant mouse of Dai et al (Blood, 2002, 99:
111-120) which lacks c-fms is an animal model for diseases or
conditions wherein c-fms activity has been abolished. A c-fms
mediated disease or condition includes a disease or condition for
which c-fms inhibition provides a therapeutic benefit, e.g. wherein
treatment with c-fms inhibitors, including compounds described
herein, provides a therapeutic benefit to the subject suffering
from or at risk of the disease or condition.
[0191] As used herein, the term "composition" refers to a
formulation suitable for administration to an intended animal
subject for therapeutic purposes that contains at least one
pharmaceutically active compound and at least one pharmaceutically
acceptable carrier or excipient.
[0192] The term "pharmaceutically acceptable" indicates that the
indicated material does not have properties that would cause a
reasonably prudent medical practitioner to avoid administration of
the material to a patient, taking into consideration the disease or
conditions to be treated and the respective route of
administration. For example, it is commonly required that such a
material be essentially sterile, e.g., for injectibles.
[0193] In the present context, the terms "therapeutically
effective" and "effective amount" indicate that the materials or
amount of material is effective to prevent, alleviate, or
ameliorate one or more symptoms of a disease or medical condition,
and/or to prolong the survival of the subject being treated.
[0194] Reference to particular amino acid residues in human c-kit
polypeptide is defined by the numbering corresponding to the Kit
sequence in GenBank NP.sub.--000213 (SEQ ID NO:1). Reference to
particular nucleotide positions in a nucleotide sequence encoding
all or a portion of c-kit is defined by the numbering corresponding
to the sequence provided in GenBank NM.sub.--000222 (SEQ ID NO:2).
Reference to particular amino acid residues in human c-fms
polypeptide is defined by the numbering corresponding to the FMS
precursor sequence in GenBank NP 005202 (SEQ ID NO:3). Reference to
particular nucleotide positions in a nucleotide sequence encoding
all or a portion of c-fms is defined by the numbering corresponding
to the sequence provided in GenBank NM 005211 (SEQ ID NO:4).
[0195] The terms "kit", "c-kit", and "c-Kit" mean an enzymatically
active kinase that contains a portion with greater than 90% amino
acid sequence identity to amino acid residues including the ATP
binding site of full-length c-kit (e.g., human c-kit, e.g., the
sequence NP.sub.--000213, SEQ ID NO:1), for a maximal alignment
over an equal length segment; or that contains a portion with
greater than 90% amino acid sequence identity to at least 200
contiguous amino acids of native c-kit and retains kinase activity.
Preferably the sequence identity is at least 95, 97, 98, 99, or
even 100%. Preferably the specified level of sequence identity is
over a sequence at least 100-500, at least 200-400, or at least 300
contiguous amino acid residues in length. Unless indicated to the
contrary, the term includes reference to wild-type c-kit, allelic
variants, and mutated forms (e.g., having activating
mutations).
[0196] The terms "fms", "c-fms", "FMS", and "c-Fms" mean an
enzymatically active kinase that contains a portion with greater
than 90% amino acid sequence identity to amino acid residues
including the ATP binding site of full-length c-fms (e.g. human
c-fms, e.g. residues 20-972 of GenBank sequence NP 005202, SEQ ID
NO:3), for a maximal alignment over an equal length segment; or
that contains a portion with greater than 90% amino acid sequence
identity to at least 200 contiguous amino acids of native c-fms and
retains kinase activity. Preferably the sequence identity is at
least 95, 97, 98, 99, or 100%. Preferably the specified level of
sequence identity is over a sequence at least 100-150, at least
200-400, or at least 300 contiguous amino acid residues in length.
Unless indicated to the contrary, the term includes wild-type
c-fms, allelic variants, and mutated forms (e.g. having activating
mutations). The term "pFMS" refers to phosphorylated c-fms. The
term "c-fms activity" refers to a biological activity of c-fms,
particularly including kinase activity. The abbreviation "M-CSF"
refers to the ligand for the c-fms RPTK, and the abbreviation "SCF"
refers to the ligand for the c-Kit RPTK.
[0197] The term "c-kit kinase domain" refers to a reduced length
c-kit (i.e., shorter than a full-length c-kit by at least 100 amino
acids) that includes the kinase catalytic region in c-kit. The term
"c-fms kinase domain" refers to a c-fms of reduced length (i.e.,
shorter than a full-length c-fms by at least 100 amino acids) that
includes the kinase catalytic region of c-fms. Highly preferably
for use in this invention, the kinase domain retains kinase
activity, preferably at least 60, 70, 80, 90, or 100% of the native
c-fms kinase activity. The term "the kinase" or terms of similar
import relate to either c-kit or c-fms.
[0198] As used herein, the terms "ligand" and "modulator" are used
equivalently to refer to a compound that changes (i.e., increases
or decreases) the activity of a target biomolecule, e.g., an enzyme
such as a kinase or kinase. Generally a ligand or modulator will be
a small molecule, where "small molecule" refers to a compound with
a molecular weight of 1500 daltons or less, or preferably 1000
daltons or less, 800 daltons or less, or 600 daltons or less.
[0199] The term "binds" in connection with the interaction between
a target and a potential binding compound indicates that the
potential binding compound associates with the target to a
statistically significant degree as compared to association with
proteins generally (i.e., non-specific binding). Thus, the term
"binding compound" refers to a compound that has a statistically
significant association with a target molecule. Preferably a
binding compound interacts with a specified target with a
dissociation constant (K.sub.D) of 1 mM or less. A binding compound
can bind with "low affinity", "very low affinity", "extremely low
affinity", "moderate affinity", "moderately high affinity", or
"high affinity" as described herein.
[0200] In the context of compounds binding to a target, the term
"greater affinity" indicates that the compound binds more tightly
than a reference compound, or than the same compound in a reference
condition, i.e., with a lower dissociation constant. In particular
embodiments, the greater affinity is at least 2, 3, 4, 5, 8, 10,
50, 100, 200, 400, 500, 1000, or 10,000-fold greater affinity.
[0201] Also in the context of compounds binding to a biomolecular
target, the term "greater specificity" indicates that a compound
binds to a specified target to a greater extent than to another
biomolecule or biomolecules that may be present under relevant
binding conditions, where binding to such other biomolecules
produces a different biological activity than binding to the
specified target. Typically, the specificity is with reference to a
limited set of other biomolecules, e.g., in the case of c-kit or
c-fms, other tyrosine kinases or even other type of enzymes. In
particular embodiments, the greater specificity is at least 2, 3,
4, 5, 8, 10, 50, 100, 200, 400, 500, or 1000-fold greater
specificity.
[0202] As used herein in connection with binding compounds or
ligands, the term "specific for c-kit kinase", "specific for
c-kit", and terms of like import mean that a particular compound
binds to c-kit to a statistically greater extent than to other
kinases that may be present in a particular sample. Also, where
biological activity other than binding is indicated, the term
"specific for c-kit" indicates that a particular compound has
greater biological effect associated with binding c-kit than to
other tyrosine kinases, e.g., kinase activity inhibition.
Preferably, the specificity is also with respect to other
biomolecules (not limited to tyrosine kinases) that may be present
in a particular sample. The term "specific for c-fms kinase",
"specific for c-fms", and terms of like import mean that a
particular compound binds to c-fms to a statistically greater
extent than to other kinases that may be present in a particular
sample. Also, where biological activity other than binding is
indicated, the term "specific for c-fms" indicates that a
particular compound has greater biological effect associated with
binding c-fms than to other tyrosine kinases, e.g., kinase activity
inhibition. Preferably, the specificity is also with respect to
other biomolecules (not limited to tyrosine kinases) that may be
present in a particular sample.
[0203] As used herein in connection with test compounds, binding
compounds, and modulators (ligands), the term "synthesizing" and
like terms means chemical synthesis from one or more precursor
materials.
[0204] By "assaying" is meant the creation of experimental
conditions and the gathering of data regarding a particular result
of the experimental conditions. For example, enzymes can be assayed
based on their ability to act upon a detectable substrate. A
compound or ligand can be assayed based on its ability to bind to a
particular target molecule or molecules.
[0205] As used herein, the term "modulating" or "modulate" refers
to an effect of altering a biological activity, especially a
biological activity associated with a particular biomolecule such
as c-kit or c-fms. For example, an agonist or antagonist of a
particular biomolecule modulates the activity of that biomolecule,
e.g., an enzyme.
[0206] The term "c-kit activity" refers to a biological activity of
c-kit, particularly including kinase activity. The term "c-fms
activity" refers to a biological activity of c-fms, particularly
including kinase activity.
[0207] In the context of the use, testing, or screening of
compounds that are or may be modulators, the term "contacting"
means that the compound(s) are caused to be in sufficient proximity
to a particular molecule, complex, cell, tissue, organism, or other
specified material that potential binding interactions and/or
chemical reaction between the compound and other specified material
can occur.
[0208] As used herein in connection with amino acid or nucleic acid
sequence, the term "isolate" indicates that the sequence is
separated from at least a portion of the amino acid and/or nucleic
acid sequences with which it would normally be associated.
[0209] In connection with amino acid or nucleic sequences, the term
"purified" indicates that the particular molecule constitutes a
significantly greater proportion of the biomolecules in a
composition than in a prior composition, e.g., in a cell culture.
The greater proportion can be 2-fold, 5-fold, 10-fold or more
greater.
I. General
[0210] In one aspect, the present invention concerns compounds of
Formula I, Formula Ia, Formula Ib, or Formula Ig and all
sub-embodiments thereof, that are inhibitors of c-kit, c-fms, or
both c-kit and c-fms, and the use of the compounds in treating
diseases that are mediated by c-kit, c-fms, or both c-kit and
c-fms.
[0211] Exemplary compounds of Formula I, Formula Ia, Formula Ib or
Formula Ig prepared following methods described in the Examples
herein are as follows: [0212]
Benzyl-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-amine
(P-0001), [0213]
(6-Benzylamino-pyridin-3-yl)-(1H-pyrrolo[2,3-b]pyridin-3-yl)-methanone
(P-0002), [0214]
[5-(1H-Pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(4trifluoromethyl--
benzyl)-amine (P-0003), [0215]
(4-Methoxy-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-
-amine (P-0004), [0216]
(4-Chloro-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]--
amine (P-0005), [0217]
(4-Fluoro-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]--
amine (P-0006), [0218]
(4-Methyl-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]--
amine (P-0007), [0219]
[5-(1H-Pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-thiophen-2-ylmethy-
l-amine (P-0008), [0220]
(4-Chloro-benzyl)-[5-(4-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrid-
in-2-yl]-amine (P-0009), [0221]
(4-Chloro-benzyl)-[5-(4-methoxy-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyri-
din-2-yl]-amine (P-0010), [0222]
[5-(4-Methoxy-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(4-trifl-
uoromethyl-benzyl)-amine (P-0011), [0223]
[6-Methoxy-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(4-trifl-
uoromethyl-benzyl)-amine (P-0012), [0224]
[6-Methyl-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(4-triflu-
oromethyl-benzyl)-amine (P-0013), [0225]
(4-Chloro-benzyl)-[6-methyl-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrid-
in-2-yl]-amine (P-0014), [0226]
[6-(4-Fluoro-benzylamino)-pyridin-3-yl]-(1H-pyrrolo[2,3-b]pyridin-3-yl)-m-
ethanone (P-0015), [0227]
[6-(3-Fluoro-benzylamino)-pyridin-3-yl]-(1H-pyrrolo[2,3-b]pyridin-3-yl)-m-
ethanone (P-0016), [0228]
(1H-Pyrrolo[2,3-b]pyridin-3-yl)-[6-(4-trifluoromethyl-benzylamino)-pyridi-
n-3-yl]-methanone (P-0017), [0229]
(1H-Pyrrolo[2,3-b]pyridin-3-yl)-{6-[(thiophen-2-ylmethyl)-amino]-pyridin--
3-yl}-methanone (P-0018), [0230]
3-(6-Isopropyl-pyridin-3-ylmethyl)-1H-pyrrolo[2,3-b]pyridine
(P-0019), [0231]
3-(6-tert-Butoxy-pyridin-3-ylmethyl)-1H-pyrrolo[2,3-b]pyridine
(P-0020), [0232]
Dimethyl-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-amine
(P-0021), [0233]
3-(6-Methoxy-pyridin-3-ylmethyl)-4-thiophen-3-yl-1H-pyrrolo[2,3-b]pyridin-
e (P-0022), [0234]
(6-Phenylamino-pyridin-3-yl)-(1H-pyrrolo[2,3-b]pyridin-3-yl)-methanone
(P-0023), [0235]
(6-Isopropylamino-pyridin-3-yl)-(1H-pyrrolo[2,3-b]pyridin-3-yl)-methanone
(P-0024), [0236]
(6-Isobutylamino-pyridin-3-yl)-(1H-pyrrolo[2,3-b]pyridin-3-yl)-methanone
(P-0025), [0237]
[6-(3-Benzyloxy-phenylamino)-pyridin-3-yl]-(1H-pyrrolo[2,3-b]pyridin-3-yl-
)-methanone (P-0026), [0238]
[6-(3-Hydroxy-phenylamino)-pyridin-3-yl]-(1H-pyrrolo[2,3-b]pyridin-3-yl)--
methanone (P-0027), [0239]
Isobutyl-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-amine
(P-0028), [0240]
(6-Isobutylamino-pyridin-3-yl)-(1H-pyrrolo[2,3-b]pyridin-3-yl)-methanol
(P-0029), [0241]
[6-(Cyclopropylmethyl-amino)-pyridin-3-yl]-(1H-pyrrolo[2,3-b]pyridin-3-yl-
)-methanone (P-0030), [0242]
[6-(Cyclohexylmethyl-amino)-pyridin-3-yl]-(1H-pyrrolo[2,3-b]pyridin-3-yl)-
-methanone (P-0031), [0243]
Cyclopropylmethyl-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]--
amine (P-0032), [0244]
Cyclohexylmethyl-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-a-
mine (P-0033), [0245]
[6-(Cyclopropylmethyl-amino)-pyridin-3-yl]-(1H-pyrrolo[2,3-b]pyridin-3-yl-
)-methanol (P-0034), [0246]
[6-(Cyclohexylmethyl-amino)-pyridin-3-yl]-(1H-pyrrolo[2,3-b]pyridin-3-yl)-
-methanol (P-0035), [0247]
(1H-Pyrrolo[2,3-b]pyridin-3-yl)-[6-(4-trifluoromethyl-benzylamino)-pyridi-
n-3-yl]-methanol (P-0036), [0248]
[6-(4-Chloro-benzylamino)-pyridin-3-yl]-(1H-pyrrolo[2,3-b]pyridin-3-yl)-m-
ethanol (P-0037), [0249]
[5-(5-Bromo-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(4-chloro--
benzyl)-amine (P-0038), [0250]
(4-Chloro-benzyl)-{5-[methoxy-(1H-pyrrolo[2,3-b]pyridin-3-yl)-methyl]-pyr-
idin-2-yl}-amine (P-0039), [0251]
(4-Chloro-3-trifluoromethyl-benzyl)-{5-[methoxy-(1H-pyrrolo[2,3-b]pyridin-
-3-yl)-methyl]-pyridin-2-yl}-amine (P-0040), [0252]
(4-Chloro-benzyl)-{5-[methoxy-(5-pyridin-3-yl-1H-pyrrolo[2,3-b]pyridin-3--
yl)-methyl]-pyridin-2-yl}-amine (P-0041), [0253]
(4-Chloro-benzyl)-(5-{[5-(3-methanesulfonyl-phenyl)-1H-pyrrolo[2,3-b]pyri-
din-3-yl]-methoxy-methyl}-pyridin-2-yl)-amine (P-0042), [0254]
{5-[Methoxy-(1H-pyrrolo[2,3-b]pyridin-3-yl)-methyl]-pyridin-2-yl}-(4-trif-
luoromethyl-benzyl)-amine (P-0043), [0255]
[6-(4-Chloro-benzylamino)-2-methyl-pyridin-3-yl]-(1H-pyrrolo[2,3-b]pyridi-
n-3-yl)-methanol (P-0046), [0256]
[2-Chloro-6-(4-chloro-benzylamino)-pyridin-3-yl]-(1H-pyrrolo[2,3-b]pyridi-
n-3-yl)-methanone (P-0048), [0257]
[2,6-Bis-(4-chloro-benzylamino)-pyridin-3-yl]-(1H-pyrrolo[2,3-b]pyridin-3-
-yl)-methanone (P-0049), [0258]
[2-Chloro-6-(4-chloro-benzylamino)-pyridin-3-yl]-(1H-pyrrolo[2,3-b]pyridi-
n-3-yl)-methanol (P-0050), [0259]
6-(4-Chloro-benzylamino)-3-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin--
2-ol (P-0051), [0260]
3-(2-Ethylsulfanyl-4,6-dimethyl-pyrimidin-5-ylmethyl)-1H-pyrrolo[2,3-b]py-
ridine (P-0052), [0261]
[5-(5-Methoxy-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(4-trifl-
uoromethyl-benzyl)-amine (P-0053), [0262]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(4-triflu-
oromethyl-benzyl)-amine (P-0054), [0263]
3-[6-(3-Chloro-benzyloxy)-pyridin-3-ylmethyl]-1H-pyrrolo[2,3-b]pyridine
(P-0055), [0264]
3-[6-(4-Chloro-benzyloxy)-pyridin-3-ylmethyl]-1H-pyrrolo[2,3-b]pyridine
(P-0056), [0265]
3-[6-(3-Trifluoromethyl-benzyloxy)-pyridin-3-ylmethyl]-1H-pyrrolo[2,3-b]p-
yridine (P-0057), [0266]
(4-Chloro-benzyl)-[5-(5-methoxy-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyri-
din-2-yl]-amine (P-0058), [0267]
(4-Chloro-benzyl)-[5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrid-
in-2-yl]-amine (P-0059), [0268]
{5-[5-(2-Diethylamino-ethoxy)-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl]-pyridi-
n-2-yl}-(4-trifluoromethyl-benzyl)-amine (P-0060), [0269]
3-[6-(4-Trifluoromethyl-benzylamino)-pyridin-3-ylmethyl]-1H-pyrrolo[2,3-b-
]pyridin-5-ol (P-0061), [0270]
3-[6-(4-Chloro-benzylamino)-pyridin-3-ylmethyl]-1H-pyrrolo[2,3-b]pyridin--
5-ol (P-0062), [0271]
(4-Chloro-benzyl)-{5-[5-(2-morpholin-4-yl-ethoxy)-1H-pyrrolo[2,3-b]pyridi-
n-3-ylmethyl]-pyridin-2-yl}-amine (P-0063), [0272]
{5-[5-(2-Pyrrolidin-1-yl-ethoxy)-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl]-pyr-
idin-2-yl}-(4-trifluoromethyl-benzyl)-amine (P-0064), [0273]
{5-[5-(2-Morpholin-4-yl-ethoxy)-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl]-pyri-
din-2-yl}-(4-trifluoromethyl-benzyl)-amine (P-0065), [0274]
{5-[5-(3-Diethylamino-propoxy)-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl]-pyrid-
in-2-yl}-(4-trifluoromethyl-benzyl)-amine (P-0066), [0275]
N-[5-(1H-Pyrrolo[2,3-b]pyridine-3-carbonyl)-pyridin-2-yl]-4-trifluorometh-
yl-benzamide (P-0067), [0276]
N-[5-(1H-Pyrrolo[2,3-b]pyridine-3-carbonyl)-pyridin-2-yl]-4-trifluorometh-
yl-benzenesulfonamide (P-0068), [0277]
(4-Chloro-benzyl)-{5-[5-(3-diethylamino-propoxy)-1H-pyrrolo[2,3-b]pyridin-
-3-ylmethyl]-pyridin-2-yl}-amine (P-0069), [0278]
[6-(4-Chloro-benzylamino)-2-trifluoromethyl-pyridin-3-yl]-(1H-pyrrolo[2,3-
-b]pyridin-3-yl)-methanone (P-0070), [0279]
N-[5-(1H-Pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-4-trifluoromethy-
l-benzenesulfonamide (P-0071), [0280]
N-[5-(1H-Pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-4-trifluoromethy-
l-benzamide (P-0072), [0281]
4-Fluoro-N-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-benzami-
de (P-0073), [0282]
4-Chloro-N-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-benzami-
de (P-0074), [0283]
[(S)-1-(4-Chloro-phenyl)-ethyl]-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)--
pyridin-2-yl]-amine (P-0075), [0284]
5-(1H-Pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridine-2-carboxylic acid
(4-chloro-phenyl)-amide (P-0076), [0285]
[2-(4-Chloro-benzylamino)-thiazol-5-yl]-(1H-pyrrolo[2,3-b]pyridin-3-yl)-m-
ethanone (P-0077), [0286]
(4-Chloro-phenyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-ylme-
thyl]-amine (P-0078), [0287]
3-[(5-Chloro-3-methyl-1-phenyl-1H-pyrazol-4-yl)-methoxy-methyl]-1H-pyrrol-
o[2,3-b]pyridine (P-0079), [0288]
3-(5-Chloro-3-methyl-1-phenyl-1H-pyrazol-4-ylmethyl)-1H-pyrrolo[2,3-b]pyr-
idine (P-0080), [0289]
(4-Chloro-benzyl)-[6-methoxy-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyri-
din-2-yl]-amine (P-0081), [0290]
(4-Chloro-benzyl)-[6-fluoro-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrid-
in-2-yl]-amine (P-0082), and [0291]
(4-Chloro-benzyl)-[4-chloro-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiaz-
ol-2-yl]-amine (P-0083), [0292]
3,5-Dimethyl-4-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrazole-1-carboxyli-
c acid benzylamide (P-0084), [0293]
3,5-Dimethyl-4-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrazole-1-carboxyli-
c acid phenylamide (P-0085), [0294]
[3,5-Dimethyl-4-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrazol-1-yl]-pheny-
l-methanone (P-0086), [0295]
1-[3,5-Dimethyl-4-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrazol-1-yl]-3-p-
henyl-propan-1-one (P-0087), [0296]
3-(3,5-Dimethyl-1-phenylmethanesulfonyl-1H-pyrazol-4-ylmethyl)-1H-pyrrolo-
[2,3-b]pyridine (P-0088), [0297]
3-[1-(Butane-1-sulfonyl)-3,5-dimethyl-1H-pyrazol-4-ylmethyl]-1H-pyrrolo[2-
,3-b]pyridine (P-0089), and [0298]
3,5-Dimethyl-4-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrazole-1-carboxyli-
c acid butylamide (P-0090).
[0299] Exemplary Diseases Associated with c-Kit.
[0300] The compounds described herein are useful for treating
disorders related to c-kit e.g., diseases related to unregulated
kinase signal transduction, including cell proliferative disorders,
fibrotic disorders and metabolic disorders, among others. As
described in more detail below and in Lipson et al., U.S.
20040002534 (U.S. application Ser. No. 10/600,868, filed Jun. 23,
2003) which is incorporated herein by reference in its entirety,
cell proliferative disorders which can be treated by the present
invention include cancers, and mast cell proliferative
disorders.
[0301] The presence of c-kit has also been associated with a number
of different types of cancers, as described below. In addition, the
association between abnormalities in c-kit and disease are not
restricted to cancer. As such, c-kit has been associated with
malignancies, including mast cell tumors, small cell lung cancer,
testicular cancer, gastrointestinal stromal tumors (GISTs),
glioblastoma, astrocytoma, neuroblastoma, carcinomas of the female
genital tract, sarcomas of neuroectodermal origin, colorectal
carcinoma, carcinoma in situ, Schwann cell neoplasia associated
with neurofibromatosis, acute myelocytic leukemia, acute
lymphocytic leukemia, chronic myelogenous leukemia, mastocytosis,
melanoma, and canine mast cell tumors, and inflammatory diseases,
including asthma, rheumatoid arthritis, allergic rhinitis, multiple
sclerosis, inflammatory bowel syndrome, transplant rejection, and
hypereosinophilia.
[0302] Exemplary Malignant Diseases Associated with c-kit
[0303] Aberrant expression and/or activation of c-kit has been
implicated in a variety of cancers. Evidence for a contribution of
c-kit to neoplastic pathology includes its association with
leukemias and mast cell tumors, small cell lung cancer, testicular
cancer, and some cancers of the gastrointestinal tract and central
nervous system. In addition, c-kit has been implicated in playing a
role in carcinogenesis of the female genital tract (Inoue, et al.,
1994, Cancer Res. 54(11):3049-3053), sarcomas of neuroectodermal
origin (Ricotti, et al., 1998, Blood 91:2397-2405), and Schwann
cell neoplasia associated with neurofibromatosis (Ryan, et al.,
1994, J. Neuro. Res. 37:415-432). It was found that mast cells are
involved in modifying the tumor microenvironment and enhancing
tumor growth (Yang et al., 2003, J Clin Invest. 112:1851-1861;
Viskochil, 2003, J Clin Invest. 112:1791-1793). Thus, c-kit is a
useful target in treating neurofibromatosis as well as malignant
tumors.
[0304] Small cell lung carcinoma: c-kit kinase receptor has been
found to be aberrantly expressed in many cases of small cell lung
carcinoma (SCLC) cells (Hibi, et al., 1991, Oncogene 6:2291-2296).
Thus, as an example, inhibition of c-kit kinase can be beneficial
in treatment of SCLC, e.g., to improve the long term survival of
patients with SCLC.
[0305] Leukemias: SCF binding to the c-kit protects hematopoietic
stem and progenitor cells from apoptosis (Lee, et al., 1997, J.
Immunol. 159:3211-3219), thereby contributing to colony formation
and hematopoiesis. Expression of c-kit is frequently observed in
acute myelocytic leukemia (AML), and in some cases of acute
lymphocytic leukemia (ALL) (for reviews, see Sperling, et al.,
1997, Haemat 82:617-621; Escribano, et al., 1998, Leuk. Lymph.
30:459-466). Although c-kit is expressed in the majority of AML
cells, its expression does not appear to be prognostic of disease
progression (Sperling, et al, 1997, Haemat 82:617-621). However,
SCF protected AML cells from apoptosis induced by chemotherapeutic
agents (Hassan, et al., 1996, Acta. Hem. 95:257-262). Inhibition of
c-kit by the present invention will enhance the efficacy of these
agents and can induce apoptosis of AML cells.
[0306] The clonal growth of cells from patients with
myelodysplastic syndrome (Sawada, et al., 1996, Blood 88:319-327)
or chronic myelogenous leukemia (CML) (Sawai, et al., 1996, Exp.
Hem. 2:116-122) was found to be significantly enhanced by SCF in
combination with other cytokines CML is characterized by expansion
of Philadelphia chromosome positive cells of the marrow
(Verfaillie, et al., Leuk. 1998, 12:136-138), which appears to
primarily result from inhibition of apoptotic death (Jones, Curr.
Opin. Onc. 1997, 9:3-7). The product of the Philadelphia
chromosome, p210.sup.BCR-ABL, has been reported to mediate
inhibition of apoptosis (Bedi, et al., Blood 1995, 86:1148-1158).
Since p210.sup.BCR-ABL and c-kit both inhibit apoptosis and
p62.sup.dok has been suggested as a substrate (Carpino, et al.,
Cell 1997, 88:197-204), clonal expansion mediated by these kinases
may occur through a common signaling pathway. However, c-kit has
also been reported to interact directly with p210.sup.BCR-ABL
(Hallek, et al., Brit. J Haem. 1996, 94:5-16), which suggests that
c-kit has a more causative role in CML pathology. Therefore,
inhibition of c-kit will be useful in the treatment of the above
disorders.
[0307] Gastrointestinal cancers: Normal colorectal mucosa does not
express c-kit (Bellone, et al., 1997, J. Cell Physiol. 172:1-11).
However, c-kit is frequently expressed in colorectal carcinoma
(Bellone, et al., 1997, J. Cell Physiol. 172: 1-11), and autocrine
loops of SCF and c-kit have been observed in several colon
carcinoma cell lines (Toyota, et al., 1993, Turn Biol 14:295-302;
Lahm, et al., 1995, Cell Growth &Differ 6:1111-1118; Bellone,
et al., 1997, J. Cell Physiol. 172:1-11). Furthermore, disruption
of the autocrine loop by the use of neutralizing antibodies (Lahm,
et al., 1995, Cell Growth & Differ. 6:1111-1118) and
downregulation of c-kit and/or SCF significantly inhibits cell
proliferation (Lahm, et al., 1995, Cell Growth & Differ
6:1111-1118; Bellone, et al., 1997, J. Cell Physiol. 172:1-11).
[0308] SCF/c-kit autocrine loops have been observed in gastric
carcinoma cell lines (Turner, et al., 1992, Blood 80:374-381;
Hassan, et al., 1998, Digest. Dis. Science 43:8-14), and
constitutive c-kit activation also appears to be important for
gastrointestinal stromal tumors (GISTs). GISTs are the most common
mesenchymal tumor of the digestive system. More than 90% of GISTs
express c-kit, which is consistent with the putative origin of
these tumor cells from interstitial cells of Cajal (ICCs) (Hirota,
et al., 1998, Science 279:577-580). ICCs are thought to regulate
contraction of the gastrointestinal tract, and patients lacking
c-kit in their ICCs exhibited a myopathic form of chronic
idiopathic intestinal pseudo-obstruction (Isozaki, et al., 1997,
Amer. J. of Gast. 9 332-334). The c-kit expressed in GISTs from
several different patients was observed to have mutations in the
intracellular juxtamembrane domain leading to constitutive
activation of c-kit (Hirota, et al., 1998, Science 279:577-580).
Hence, inhibition of c-kit kinase will be an efficacious means for
the treatment of these cancers.
[0309] Testicular cancers: Male germ cell tumors have been
histologically categorized into seminomas, which retain germ cell
characteristics, and nonseminomas which can display characteristics
of embryonal differentiation. Both seminomas and nonseminomas are
thought to initiate from a preinvasive stage designated carcinoma
in situ (CIS) (Murty, et al., 1998, Sem. Oncol. 25:133-144). Both
c-kit and SCF have been reported to be essential for normal gonadal
development during embryogenesis (Loveland, et al., 1997, J.
Endocrinol 153:337-344). Loss of either the receptor or the ligand
resulted in animals devoid of germ cells. In postnatal testes,
c-kit has been found to be expressed in Leydig cells and
spermatogonia, while SCF was expressed in Sertoli cells (Loveland,
et al., 1997, J. Endocrinol 153:337-344). Testicular tumors develop
from Leydig cells with high frequency in transgenic mice expressing
human papilloma virus 16 (HPV16) E6 and E7 oncogenes (Kondoh, et
al., 1991, J. Virol. 65:3335-3339; Kondoh, et al., 1994, J. Urol.
152:2151-2154). These tumors express both c-kit and SCF, and an
autocrine loop may contribute to the tumorigenesis (Kondoh, et al.,
1995, Oncogene 10:341-347) associated with cellular loss of
functional p53 and the retinoblastoma gene product by association
with E6 and E7 (Dyson, et al., 1989, Science 243:934-937; Werness,
et al., 1990, Science 248:76-79; Scheffner, et al., 1990, Cell
63:1129-1136). Defective signaling mutants of SCF (Kondoh, et al.,
1995, Oncogene 10:341-347) or c-kit (Li, et al., 1996, Canc. Res.
56:4343-4346) inhibited formation of testicular tumors in mice
expressing HPV16 E6 and E7. The c-kit kinase activation is pivotal
to tumorigenesis in these animals and thus modulation of the c-kit
kinase pathway by the present invention will prevent or treat such
disorders.
[0310] Expression of c-kit in germ cell tumors shows that the
receptor is expressed by the majority of carcinomas in situ and
seminomas, but c-kit is expressed in only a minority of
nonseminomas (Strohmeyer, et al., 1991, Canc. Res. 51:1811-1816;
Rajpert-de Meyts, et al., 1994, Int. J. Androl. 17:85-92;
Izquierdo, et al., 1995, J. Pathol. 177:253-258; Strohmeyer, et
al., 1995, J. Urol. 153:511-515; Bokenmeyer, et al., 1996, J.
Cancer Res. Clin. Oncol. 122:301-306; Sandlow, et al., 1996, J.
Androl. 17:403-408). Therefore, inhibition of c-kit kinase provides
a means for treating these disorders.
[0311] CNS cancers: SCF and c-kit are expressed throughout the CNS
of developing rodents, and the pattern of expression indicates a
role in growth, migration and differentiation of neuroectodermal
cells. Expression of both receptor and ligand have also been
reported in the adult brain (Hamel, et al., 1997, J. Neuro-Onc.
35:327-333). Expression of c-kit has also been observed in normal
human brain tissue (Tada, et al. 1994, J. Neuro 80:1063-1073).
Glioblastoma and astrocytoma, which define the majority of
intracranial tumors, arise from neoplastic transformation of
astrocytes (Levin, et al., 1997, Principles & Practice of
Oncology: 2022-2082). Expression of c-kit has been observed in
glioblastoma cell lines and tissues (Berdel, et al., 1992, Canc.
Res. 52:3498-3502; Tada, et al. 1994, J. Neuro 80:1063-1073;
Stanulla, et al., 1995, Act Neuropath 89:158-165).
[0312] Cohen, et al., 1994, Blood 84:3465-3472 reported that all 14
neuroblastoma cell lines examined contained c-kit/SCF autocrine
loops, and expression of both the receptor and ligand were observed
in 45% of tumor samples examined. In two cell lines, anti-c-kit
antibodies inhibited cell proliferation, suggesting that the
SCF/c-kit autocrine loop contributed to growth (will Cohen, et al.,
1994, Blood 84:3465-3472). Hence, c-kit kinase inhibitors can be
used to treat these cancers.
[0313] Exemplary Mast Cell Diseases Involving c-kit
[0314] Excessive activation of c-kit is also associated with
diseases resulting from an over-abundance of mast cells.
Mastocytosis is the term used to describe a heterogeneous group of
disorders characterized by excessive mast cell proliferation
(Metcalfe, 1991, J. Invest. Derm 93:2 S-4S; Golkar, et al., 1997,
Lancet 349:1379-1385). Elevated c-kit expression was reported on
mast cells from patients with aggressive mastocytosis (Nagata, et
al., 1998, Leukemia 12:175-181).
[0315] Additionally, mast cells and eosinophils represent key cells
involved in allergy, inflammation and asthma (Thomas, et al., 1996,
Gen. Pharmacol 27:593-597; Metcalfe, et al., 1997, Physiol Rev
77:1033-1079; Naclerio, et al., 1997, JAMA 278:1842-1848; Costa, et
al., 1997, JAMA 278:1815-1822). SCF, and hence c-kit, directly and
indirectly regulates activation of both mast cells and eosinophils,
thereby influencing the primary cells involved in allergy and
asthma through multiple mechanisms. Because of this mutual
regulation of mast cell and eosinophil function, and the role that
SCF can play in this regulation, inhibition of c-kit can be used to
treat allergy-associated chronic rhinitis, inflammation and
asthma.
[0316] Mastocytosis: SCF (also known as mast cell growth factor)
stimulation of c-kit has been reported to be essential for the
growth and development of mast cells (Hamel, et al., 1997, J.
Neuro-Onc. 35:327-333; Kitamura, et al., 1995, Int. Arch. Aller.
Immunol. 107:54-56). Mice with mutations of c-kit that attenuate
its signaling activity have exhibited significantly fewer mast
cells in their skin (Tsujimura, 1996, Pathol Int 46:933-938).
Excessive activation of c-kit can be associated with diseases
resulting from an over abundance of mast cells.
[0317] Mastocytosis is limited to the skin in the majority of
patients, but can involve other organs in 15-20% of patients
(Valent, 1996, Wein/Klin Wochenschr 108:385-397; Golkar, et al.,
1997, Lancet 349:1379-1385). Even among patients with systemic
mastocytosis, the disease can range from having a relatively benign
prognosis to aggressive mastocytosis and mast cell leukemia.
(Valent, 1996, Wein/Klin Wochenschr 108:385-397; Golkar, et al.,
1997, Lancet 349:1379-1385). c-kit has been observed on malignant
mast cells from canine mast cell tumors (London, et al., 1996, J.
Compar. Pathol. 115:399-414), as well as on mast cells from
patients with aggressive systemic mastocytosis (Baghestanian, et
al., 1996, Leuk.: 116-122; Castells, et al., 1996, J. Aller. Clin.
Immunol. 98:831-840).
[0318] SCF has been shown to be expressed on stromal cells as a
membrane-bound protein, and its expression can be induced by
fibrogenic growth factors such as PDGF. It has also been shown to
be expressed on keratinocytes as a membrane-bound protein in normal
skin. However, in the skin of patients with mastocytosis, an
increased amount of soluble SCF has been observed (Longley, et al.,
1993, New Engl. J. Med. 328:1302-1307).
[0319] Mast cell chymase has been reported to cleave
membrane-associated SCF to a soluble and biologically active form.
This mast cell-mediated process can generate a feedback loop to
enhance mast cell proliferation and function (Longley, et al.,
1997, Proc. Natl. Acad. Sci. 94:9017-9021), and may be important
for the etiology of mastocytosis. Transgenic mice overexpressing a
form of SCF that could not be proteolytically released from
keratinocytes did not develop mastocytosis, while similar animals
expressing normal SCF in keratinocytes exhibited a phenotype
resembling human cutaneous mastocytosis (Kunisada, et al., 1998, J.
Exp. Med. 187:1565-1573). Formation of large amounts of soluble SCF
can contribute to the pathology associated with mastocytosis in
some patients and the present invention can treat or prevent such
disorders by modulating the interaction between SCF and c-kit
kinase. Several different mutations of c-kit that resulted in
constitutive kinase activity have been found in human and rodent
mast cell tumor cell lines (Furitsu, et al., 1993, J. Clin. Invest.
92:1736-1744; Tsujimura, et al., 1994, Blood 9:2619-2626;
Tsujimura, et al., 1995, Int. Arch. Aller. Immunol 106:377-385;
Tsujimura, 1996, Pathol Int 46:933-938). In addition, activating
mutations of the c-kit gene have been observed in peripheral
mononuclear cells isolated from patients with mastocytosis and
associated hematologic disorders (Nagata, et al., 1998,
Mastocytosis Leuk 12:175-181), and in mast cells from a patient
with urticaria pigmentosa and aggressive mastocytosis (Longley, et
al., 1996, Nat. Gen. 12:312-314). Inhibition of c-kit kinase will
therefore prove to have an excellent therapeutic role in the
treatment of these disorders.
[0320] In some patients, activating mutations of c-kit may be
responsible for the pathogenesis of the disease and these patients
can be treated, or their diseases prevented, by modulation of the
SCF interaction with c-kit kinase. SCF activation of c-kit as been
shown to prevent mast cell apoptosis which may be critical for
maintaining cutaneous mast cell homeostasis (Iemura, et al., 1994,
Amer. J. Pathol 144:321-328; Yee, et al., 1994, J. Exp. Med.
179:1777-1787; Mekori, et al., 1994, J. Immunol 153:2194-2203;
Mekori, et al., 1995, Int. Arch. Allergy Immunol. 107:137-138).
Inhibition of mast cell apoptosis can lead to the mast cell
accumulation associated with mastocytosis. Thus, observation of
c-kit activation resulting from overexpression of the receptor,
excessive formation of soluble SCF, or mutations of the c-kit gene
that constitutively activate its kinase, provides a rationale that
inhibition of the kinase activity of c-kit will decrease the number
of mast cells and provide benefit for patients with
mastocytosis.
[0321] For cells with activating c-kit mutations, it was found that
inhibitors of c-kit inhibit or even kill the cells (Ma et al.,
2000, J Invest Dermatol. 114:392-394), particularly for mutations
in the regulatory region (Ma et al., 2002, Blood 99:1741-1744). Ma
et al., 2002, also showed that for mutations in the catalytic
region, inhibitors STI571 (Gleevec) and SU9529 did not inhibit the
cells, such that additional types of c-kit inhibitors are useful.
Thus, c-kit inhibitors can be used against both wild-type c-kit as
well as c-kit having mutations, e.g., activating mutations in the
regulatory region and/or catalytic region.
[0322] Asthma & Allergy: Mast cells and eosinophils represent
key cells in parasitic infection, allergy, inflammation, and asthma
(Thomas, et al., 1996, Gen. Pharmacol 27:593-597; Metcalfe, et al.,
1997, Physiol Rev 77:1033-1079; Holgate, 1997, CIBA Found. Symp.;
Naclerio, et al, 1997, JAMA 278:1842-1848; Costa, et al., 1997,
JAMA 778:1815-1822). SCF has been shown to be essential for mast
cell development, survival and growth (Kitamura, et al., 1995, Int.
Arch. Aller. Immunol. 107:54-56; Metcalfe, et al., 1997, Physiol
Rev 77:1033-1079). In addition, SCF cooperates with the
eosinophil-specific regulator, IL-5, to increase the development of
eosinophil progenitors (Metcalf, et al., 1998, Proc. Natl. Acad.
Sci., USA 95:6408-6412). SCF has also been reported to induce mast
cells to secrete factors (Okayama, et al., 1997, Int. Arch. Aller.
Immunol. 114:75-77; Okayama, et al., 1998, Eur. J. Immunol.
28:708-715) that promote the survival of eosinophils (Kay, et al.,
1997, Int. Arch. Aller. Immunol. 113:196-199), which may contribute
to chronic, eosinophil-mediated inflammation (Okayama, et al.,
1997, Int. Arch. Aller. Immunol. 114:75-77; Okayama, et al., 1998,
Eur. J. Immunol. 28:708-715). In this regard, SCF directly and
indirectly regulates activation of both mast cells and
eosinophils.
[0323] SCF induces mediator release from mast cells, as well as
priming these cells for IgE-induced degranulation (Columbo, et al.,
1992, J. Immunol. 149:599-602) and sensitizing their responsiveness
to eosinophil-derived granule major basic protein (Furuta, et al.,
1998, Blood 92:1055-1061). Among the factors released by activated
mast cells are IL-5, GM-CSF and TNF-.alpha., which influence
eosinophil protein secretion (Okayama, et al., 1997, Int. Arch.
Aller. Immunol. 114:75-77; Okayama, et al., 1998, Eur. J. Immunol.
28:708-715). In addition to inducing histamine release from mast
cells (Luckacs, et al., 1996, J. Immunol. 156:3945-3951; Hogaboam,
et al., 1998, J. Immunol. 160:6166-6171), SCF promotes the mast
cell production of the eosinophil chemotactic factor, eotaxin
(Hogaboam, et al., 1998, J. Immunol. 160:6166-6171), and eosinophil
infiltration (Luckacs, et al., 1996, J. Immunol.
156:3945-3951).
[0324] SCF also directly influences the adhesion of both mast cells
(Dastych, et al., 1994, J. Immunol. 152:213-219; Kinashi, et al.,
1994, Blood 83:1033-1038) and eosinophils (Yuan, et al., 1997, J.
Exp. Med. 186:313-323), which in turn, regulates tissue
infiltration. Thus, SCF can influence the primary cells involved in
allergy and asthma through multiple mechanisms. Currently,
corticosteroids are the most effective treatment for chronic
rhinitis and inflammation associated with allergy (Naclerio, et
al., 1997, JAMA 278:1842-1848; Meltzer, 1997, Aller. 52:33-40).
These agents work through multiple mechanisms including reduction
of circulating and infiltrating mast cells and eosinophils, and
diminished survival of eosinophils associated with inhibition of
cytokine production (Meltzer, 1997, Aller. 52:33-40). Steroids have
also been reported to inhibit the expression of SCF by fibroblasts
and resident connective tissue cells, which leads to diminished
mast cell survival (Finotto, et al., 1997, J. Clin. Invest. 99
1721-1728). Because of the mutual regulation of mast cell and
eosinophil function, and the role that SCF can play in this
regulation, inhibition of c-kit kinase will provide a means to
treat allergy-associated chronic rhinitis, inflammation and
asthma.
[0325] Inflammatory arthritis (e.g. rheumatoid arthritis): Due to
the association of mast cells with the arthritic process (Lee et
al., 2002, Science 297:1689-1692), c-kit provides a useful target
for prevention, delay, and/or treatment of inflammatory arthritis,
such as rheumatoid arthritis.
[0326] Multiple sclerosis: Mast cells have been shown to play an
extensive role in autoimmune diseases, as demonstrated in the mouse
model of multiple sclerosis (MS), experimental allergic
encephalomyelitis (EAE). Mast cells were indicated to be required
for full manifestation of the disease. Secor et al., 2000, J Exp
Med 191:813-821. Thus, c-kit also provides a useful target for the
prevention, delay, and/or treatment of multiple sclerosis.
[0327] Exemplary Diseases Associated with c-fms
[0328] The presence of c-fms has been associated with a number of
different types of diseases. As such, c-fms has been associated
with immune disorders, including rheumatoid arthritis, systemic
lupus erythematosis (SLE), Wegener's granulomatosis, and transplant
rejection, inflammatory diseases including Chronic Obstructive
Pulmonary Disease (COPD), emphysema, and atherosclerosis, metabolic
disorders, including insulin resistance, hyperglycemia, and
lipolysis, disorders of bone structure or mineralization, including
osteoporosis, increased risk of fracture, hypercalcemia, and bone
metastases, kidney diseases, including nephritis (e.g.
glomerulonephritis, interstitial nephritis, Lupus nephritis),
tubular necrosis, diabetes-associated renal complications, and
hypertrophy and cancers, including multiple myeloma, acute myeloid
leukemia, chronic myeloid leukemia (CML), breast cancer, and
ovarian cancer.
[0329] Aberrant expression and/or activation of c-fms has been
implicated in acute myeloid leukemia, AML (Ridge et al, Proc. Nat.
Acad. Sci., 1990, 87:1377-1380). Mutations at codon 301 are
believed to lead to neoplastic transformation by ligand
independence and constitutive tyrosine kinase activity of the
receptor. The tyrosine residue at codon 969 has been shown to be
involved in a negative regulatory activity, which is disrupted by
amino acid substitutions. Accordingly, c-fms mutations are most
prevalent (20%) in chronic myelomonocytic leukemia and AML type M4
(23%), both of which are characterized by monocytic
differentiation.
[0330] A condition related to AML is chronic myeloid leukemia
(CML). During the myeloid blast crisis (BC) of CML, non-random
additional chromosome abnormalities occur in over 80% of patients.
However, these cytogenetic changes have been reported to precede
the clinical signs of CML-BC by several months to years suggesting
that other biological events may participate in the multistep
process of acute transformation of CML. The autocrine production of
growth factors has been shown to occur in several hematological
malignancies and particularly in AML. Specchia et al [Br J
Haematol. 1992 March; 80(3):310-6] have demonstrated that IL-1 beta
gene is expressed in almost all cases of CML in myeloid blast
crisis, and that a high proportion of cases showed constitutive
expression of the M-CSF gene. Many of the same patients in the
Specchia et al study demonstrated simultaneous co-expression of
c-fms. After exposure of leukemic cells to phorbol myristate
acetate (PMA), release of M-CSF protein was documented in three of
five patients studied; however, no significant interleukin-3
(IL-3), granulocyte-macrophage colony-stimulating factor (GM-CSF)
or granulocyte colony-stimulating factor (G-CSF), was detected in
these patients. This demonstrates that different patterns of growth
factors secretion exist in AML and CML, and that distinct molecular
events are likely involved in the control of leukemic
proliferation.
[0331] The observation that production of M-CSF, the major
macrophage growth factor, is increased in tissues during
inflammation (Le Meur et al, J. Leukocyte Biology. 2002;
72:530-537) provides a role for c-fms in certain diseases. For
example, COPD is characterized by airflow limitation that is not
fully reversible. The airflow limitation is usually progressive and
associated with an abnormal inflammatory response of the lungs to
noxious particles or gases. The chronic inflammation of COPD is
observed through the airways, parenchyma, and pulmonary
vasculature. The inflammatory cell population consists of
neutrophils, macrophages, and T lymphocytes, along with eosinophils
in some patients. Macrophages are postulated to play an
orchestrating role in COPD inflammation by releasing mediators such
as TNF-.alpha., IL-8 and LTB4, which are capable of damaging lung
structures and/or sustaining neutrophilic inflammation.
[0332] Further, M-CSF/Fms signaling is critical to osteoclast
formation and survival of osteoclast precursors. For example,
estrogen loss in menopause results in increased M-CSF and thus
increased osteoclast number and bone resorption which leads to
increased risk of fracture and osteoporosis. Accordingly, blockage
of this signal is a target for the inhibition of bone resorption
(Teitelbaum, Science. 2000; 289:1504; Rohan, Science. 2000;
289:1508.)
[0333] Atherosclerosis, an inflammatory disease of the vessel
walls, is associated with significant morbidity and mortality. A
effect for c-fms inhibition in the treatment and prevention of
atherosclerosis depends on several observations (Libby, Nature.
2002; 420:868-874.) First, monocytes resident in the arterial
intima increase expression of scavenger receptors and internalize
modified lipoproteins. The resulting lipid-laden macrophages
develop into foam cells characteristic of the atherosclerotic
lesion. Macrophages in atheroma secrete cytokines and growth
factors involved in lesion progression. Additionally, macrophages
replicate within the intima. Through c-fms, M-CSF activates the
transition from monocyte to lipid-laden macrophage and augments
expression of scavenger receptor A. Indeed, atherosclerotic plaques
over-express M-CSF which is critical for atherosclerotic
progression. Mice deficient in M-CSF have been found to experience
less severe atherosclerosis than mice with normal M-CSF
(Rajavashisth, et. al., J. Clin. Invest. 1998; 101:2702-2710; Qiao,
et. al., Am. J. Path. 1997; 150:1687-1699). Accordingly, inhibitors
of c-fms disrupt M-CSF signaling, compromising monocyte to
macrophage foam cell progression, macrophage survival and
replication, and cytokine signaling that participates in lesion
progression.
[0334] Wegener's granulomatosis, also known as vasculitis, is
characterized by granulomatous inflammation of the blood vessels
with necrosis. This inflammation limits blood flow to organs with
consequent damage. Although the disease can involve any organ
system, Wegener's granulomatosis mainly affects the respiratory
tract (i.e., sinuses, nose, trachea, and lungs) and the kidneys.
The endothelium plays a central role in the immunopathology of
several vascular disorders in many inflammatory conditions such as
Wegener's granulomatosis in which use of intravenous immunoglobulin
(IV Ig) has been shown to be beneficial (see e.g., Basta et al, J
Clin Invest 1994, 94:1729-1735). It has been reported (Xu et al,
Am. J. Path. 1998; 153:1257-1266) that IV Ig inhibits endothelial
cell proliferation in a dose- and time-dependent manner and
down-regulates the expression of adhesion molecule mRNA (ICAM-1 and
VCAM-1), chemokine mRNA (MCP-1, M-CSF, and GM-CSF), and
proinflammatory cytokine mRNA (TNF-.alpha., IL-1.beta., and IL-6)
induced by TNF-.alpha. or IL-1.beta.. These results may explain, at
least in part, the therapeutic effect of IV Ig in vascular and
inflammatory disorders. Additionally, these results suggest that
inhibition of M-CSF activity at the level of interaction with c-fms
is an efficacious treatment strategy.
[0335] The role of M-CSF and c-fms in emphysema appears to involve
the regulation of elastin metabolism through control of matrix
metalloproteins. M-CSF has a role in the modulation of the
accumulation and function of alveolar macrophages (AMs) in vivo
(Shibata et al, Blood 2001, 98: pp. 2845-2852). Osteopetrotic
(Op/Op) mice have no detectable M-CSF and show variable
tissue-specific reductions in macrophage numbers. Accordingly, it
was hypothesized that AMs would be decreased in number and have
altered function in Op/Op mice because of the absence of M-CSF.
Shibata et al found that lung macrophages identified in lung
sections were decreased in number in 20-day-old Op/Op mice but not
Op/Op mice older than 4 months compared with findings in
age-matched littermate controls. The numbers of AMs recovered by
bronchoalveolar lavage (BAL) were also reduced in young but not
adult Op/Op mice compared with controls. Importantly, AMs of Op/Op
mice spontaneously release higher levels of matrix
metalloproteinases (MMPs) than AMs of controls. Consistent with an
increased release of MMP, Op/Op mice have abnormal elastin
deposition and spontaneously develop emphysema in the absence of
molecular or cellular evidence of lung inflammation. Accordingly,
the modulation of metalloelastase activity in macrophages by M-CSF
may control the degradation of elastin fibers in lungs or blood
vessels.
[0336] Metastatic cancer cells cause bone destruction, with
associated fracture, pain, deformation, and hypercalcaemia, due to
production of osteoclasticogenic factors including M-CSF by tumor
cells (Clohisy et al, Clin. Orthop. 2000, 373: 104-14). Binding of
M-CSF to the c-fms product stimulates formation of osteoclasts and
osteolytic activity (Kodama et al, J. Exp. Med. 1991, 173: 269-72;
Feng et al, Endocrinology 2002, 143: 4868-74). Accordingly,
inhibition of osteoclast activity at the level of c-fms offers a
compelling target for amelioration of bone metastasis.
[0337] Macrophage accumulation is a prominent feature in many forms
of glomerulonephritis. Local proliferation of macrophages within
the kidney has been described in human and experimental
glomerulonephritis and may have an important role in augmenting the
inflammatory response. Isbel et al (Nephrol Dial Transplant 2001,
16: 1638-1647) examined the relationship between local macrophage
proliferation and renal expression of M-CSF. Glomerular and
tubulointerstitial M-CSF expression was found to be up-regulated in
human glomerulonephritis, being most prominent in proliferative
forms of disease. Because this correlates with local macrophage
proliferation, it suggests that increased renal M-CSF production
plays an important role in regulating local macrophage
proliferation in human glomerulonephritis. In a model of renal
inflammation (UUO--unilateral ureteric obstruction) anti-c-fms
antibody treatment reduced macrophage accumulation (Le Meur et.
al., J Leukocyte Biology, 2002, 72: 530-537). Accordingly,
inhibition of c-fms offers a target for therapeutic intervention in
glomerulonephritis.
[0338] Insulin resistance and obesity are hallmark of type II
diabetes and there is a strong correlation between insulin
resistance and abdominal visceral fat accumulation (Bjorntrop,
Diabetes Metab. Res. Rev., 1999, 15: 427-441). Current evidence
indicates that macrophages accumulating in adipose tissue release
TNF-a and other factors that cause adipocyte changes (hypertrophy,
lipolysis, reduced insulin sensitivity) and also promote insulin
resistance in surrounding tissues. Therefore, macrophage
accumulation in type 2 diabetes is important for disease
progression. Accordingly, inhibition of c-fms has potential in
preventing the development of insulin resistance and
hyperglycemia.
[0339] Dewar et al. have recently demonstrated that the kinase
inhibitor imatinib also specifically targets the macrophage colony
stimulating factor receptor, c-fms, at therapeutic concentrations.
Although this finding has important implications with regard to
potential side effects in patients currently receiving imatinib
therapy, these results suggest that imatinib may also be useful in
the treatment of diseases where c-fms is implicated. This includes
breast and ovarian cancer and inflammatory conditions such as
rheumatoid arthritis. Dewar et al. also speculate that imatinib may
be used in diseases where bone destruction occurs due to excessive
osteoclast activity, such as in the haematologic malignancy,
multiple myeloma (Dewar et al., Cell Cycle 2005, 4(7):851-3).
[0340] To determine the importance of M-CSF in driving macrophage
proliferation during acute rejection, Jose et al. blocked the M-CSF
receptor, c-fms, in a mouse model of acute renal allograft
rejection. They observed that the severity of tubulointerstitial
rejection was reduced in the treatment group as shown by decreased
tubulitis and tubular cell proliferation. Macrophage proliferation
during acute allograft rejection is dependent on the interaction of
M-CSF with its receptor c-fms. They indicate that this pathway
plays a significant and specific role in the accumulation of
macrophages within a rejecting renal allograft (Jose et al., Am J
Transplant 2003, 3(3):294-300).
[0341] Further, modulators of both c-fms and c-kit function can be
used against diseases such as those indicated above, where in some
instances, the dual activity of the modulator for both c-fms and
c-kit provides distinct advantages in treating such diseases. The
complementary activities provided by a single compound would
provide added benefits over compounds targeting one or the other
activity, or separate compounds targeting these activities. For
example, by attenuating release of macrophage chemo-attractants by
mast cells or mast cell chemoattractants by macrophages, these
anti-inflammatory effects would synergize with the concomitant
inhibition of intrinsic cellular function. Limitations in
co-administration are absent in a dual inhibitor. Further, the dual
activity may result in much lower effective doses for
treatment.
II. Production of c-kit and c-fms Related Polypeptides
[0342] The native and mutated kinase polypeptides described herein
may be chemically synthesized in whole or part using techniques
that are well-known in the art (see, e.g., Creighton (1983)
Biopolymers 22(1):49-58).
[0343] Alternatively, methods which are well known to those skilled
in the art can be used to construct expression vectors containing
the native or mutated kinase polypeptide coding sequence and
appropriate transcriptional/translational control signals. These
methods include in vitro recombinant DNA techniques, synthetic
techniques and in vivo recombination/genetic recombination. See,
for example, the techniques described in Maniatis, T (1989).
Molecular cloning: A laboratory Manual. Cold Spring Harbor
Laboratory, New York. Cold Spring Harbor Laboratory Press; and
Ausubel, F. M. et al. (1994) Current Protocols in Molecular
Biology. John Wiley & Sons, Secaucus, N.J.
[0344] A variety of host-expression vector systems may be utilized
to express the kinase coding sequence. These include but are not
limited to microorganisms such as bacteria transformed with
recombinant bacteriophage DNA, plasmid DNA or cosmid DNA expression
vectors containing the kinase domain coding sequence; yeast
transformed with recombinant yeast expression vectors containing
the kinase domain coding sequence; insect cell systems infected
with recombinant virus expression vectors (e.g. baculovirus)
containing the kinase domain coding sequence; plant cell systems
infected with recombinant virus expression vectors (e.g.
cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or
transformed with recombinant plasmid expression vectors (e.g. Ti
plasmid) containing the kinase domain coding sequence; or animal
cell systems. The expression elements of these systems vary in
their strength and specificities.
[0345] Depending on the host/vector system utilized, any of a
number of suitable transcription and translation elements,
including constitutive and inducible promoters, may be used in the
expression vector. For example, when cloning in bacterial systems,
inducible promoters such as pL of bacteriophage .lamda., plac,
ptrp, ptac (ptrp-lac hybrid promoter) and the like may be used;
when cloning in insect cell systems, promoters such as the
baculovirus polyhedrin promoter may be used; when cloning in plant
cell systems, promoters derived from the genome of plant cells
(e.g. heat shock promoters; the promoter for the small subunit of
RUBISCO; the promoter for the chlorophyll a/b binding protein) or
from plant viruses (e.g. the 35S RNA promoter of CaMV; the coat
protein promoter of TMV) may be used; when cloning in mammalian
cell systems, promoters derived from the genorne of mammalian cells
(e.g. metallothionein promoter) or from mammalian viruses (e.g. the
adenovirus late promoter; the vaccinia virus 7.5K promoter) may be
used; when generating cell lines that contain multiple copies of
the kinase domain DNA, SV4O-, BPV- and EBV-based vectors may be
used with an appropriate selectable marker.
[0346] Exemplary methods describing methods of DNA manipulation,
vectors, various types of cells used, methods of incorporating the
vectors into the cells, expression techniques, protein purification
and isolation methods, and protein concentration methods are
disclosed in detail in PCT publication WO 96/18738. This
publication is incorporated herein by reference in its entirety,
including any drawings. Those skilled in the art will appreciate
that such descriptions are applicable to the present invention and
can be easily adapted to it.
III. Binding Assays
[0347] The methods of the present invention can involve assays that
are able to detect the binding of compounds to a target molecule.
Such binding is at a statistically significant level, preferably
with a confidence level of at least 90%, more preferably at least
95, 97, 98, 99% or greater confidence level that the assay signal
represents binding to the target molecule, i.e., is distinguished
from background. Preferably controls are used to distinguish target
binding from non-specific binding. A large variety of assays
indicative of binding are known for different target types and can
be used for this invention.
[0348] Binding compounds can be characterized by their effect on
the activity of the target molecule. Thus, a "low activity"
compound has an inhibitory concentration (IC.sub.50) or effective
concentration (EC.sub.50) of greater than 1 .mu.M under standard
conditions. By "very low activity" is meant an IC.sub.50 or
EC.sub.50 of above 100 .mu.M under standard conditions. By
"extremely low activity" is meant an IC.sub.50 or EC.sub.50 of
above 1 mM under standard conditions. By "moderate activity" is
meant an IC.sub.50 or EC.sub.50 of 200 nM to 1 .mu.M under standard
conditions. By "moderately high activity" is meant an IC.sub.50 or
EC.sub.50 of 1 nM to 200 nM. By "high activity" is meant an
IC.sub.50 or EC.sub.50 of below 1 nM under standard conditions. The
IC.sub.50 or EC.sub.50 is defined as the concentration of compound
at which 50% of the activity of the target molecule (e.g. enzyme or
other protein) activity being measured is lost or gained relative
to the range of activity observed when no compound is present.
Activity can be measured using methods known to those of ordinary
skill in the art, e.g., by measuring any detectable product or
signal produced by occurrence of an enzymatic reaction, or other
activity by a protein being measured.
[0349] By "background signal" in reference to a binding assay is
meant the signal that is recorded under standard conditions for the
particular assay in the absence of a test compound, molecular
scaffold, or ligand that binds to the target molecule. Persons of
ordinary skill in the art will realize that accepted methods exist
and are widely available for determining background signal.
[0350] By "standard deviation" is meant the square root of the
variance. The variance is a measure of how spread out a
distribution is. It is computed as the average squared deviation of
each number from its mean. For example, for the numbers 1, 2, and
3, the mean is 2 and the variance is:
.sigma. 2 = ( 1 - 2 ) 2 + ( 2 - 2 ) 2 + ( 3 - 2 ) 2 3 = 0.667 .
##EQU00001##
[0351] Surface Plasmon Resonance
[0352] Binding parameters can be measured using surface plasmon
resonance, for example, with a BIAcore.RTM. chip (Biacore, Japan)
coated with immobilized binding components. Surface plasmon
resonance is used to characterize the microscopic association and
dissociation constants of reaction between an sFv or other ligand
directed against target molecules. Such methods are generally
described in the following references which are incorporated herein
by reference. Vely F. et al., (2000) BIAcore.RTM. analysis to test
phosphopeptide-SH2 domain interactions, Methods in Molecular
Biology. 121:313-21; Liparoto et al., (1999) Biosensor analysis of
the interleukin-2 receptor complex, Journal of Molecular
Recognition. 12:316-21; Lipschultz et al., (2000) Experimental
design for analysis of complex kinetics using surface plasmon
resonance, Methods. 20(3):310-8; Malmqvist., (1999) BIACORE: an
affinity biosensor system for characterization of biomolecular
interactions, Biochemical Society Transactions 27:335-40; Alfthan,
(1998) Surface plasmon resonance biosensors as a tool in antibody
engineering, Biosensors & Bioelectronics. 13:653-63; Fivash et
al., (1998) BIAcore for macromolecular interaction, Current Opinion
in Biotechnology. 9:97-101; Price et al.; (1998) Summary report on
the ISOBM TD-4 Workshop: analysis of 56 monoclonal antibodies
against the MUC1 mucin. Tumour Biology 19 Suppl 1:1-20; Malmqvist
et al, (1997) Biomolecular interaction analysis: affinity biosensor
technologies for functional analysis of proteins, Current Opinion
in Chemical Biology. 1:378-83; O'Shannessy et al., (1996)
Interpretation of deviations from pseudo-first-order kinetic
behavior in the characterization of ligand binding by biosensor
technology, Analytical Biochemistry. 236:275-83; Malmborg et al.,
(1995) BIAcore as a tool in antibody engineering, Journal of
Immunological Methods. 183:7-13; Van Regenmortel, (1994) Use of
biosensors to characterize recombinant proteins, Developments in
Biological Standardization. 83:143-51; and O'Shannessy, (1994)
Determination of kinetic rate and equilibrium binding constants for
macromolecular interactions: a critique of the surface plasmon
resonance literature, Current Opinions in Biotechnology.
5:65-71.
[0353] BIAcore.RTM. uses the optical properties of surface plasmon
resonance (SPR) to detect alterations in protein concentration
bound to a dextran matrix lying on the surface of a gold/glass
sensor chip interface, a dextran biosensor matrix. In brief,
proteins are covalently bound to the dextran matrix at a known
concentration and a ligand for the protein is injected through the
dextran matrix. Near infrared light, directed onto the opposite
side of the sensor chip surface is reflected and also induces an
evanescent wave in the gold film, which in turn, causes an
intensity dip in the reflected light at a particular angle known as
the resonance angle. If the refractive index of the sensor chip
surface is altered (e.g. by ligand binding to the bound protein) a
shift occurs in the resonance angle. This angle shift can be
measured and is expressed as resonance units (RUs) such that 1000
RUs is equivalent to a change in surface protein concentration of 1
ng/mm.sup.2. These changes are displayed with respect to time along
the y-axis of a sensorgram, which depicts the association and
dissociation of any biological reaction.
[0354] High Throughput Screening (HTS) Assays
[0355] HTS typically uses automated assays to search through large
numbers of compounds for a desired activity. Typically HTS assays
are used to find new drugs by screening for chemicals that act on a
particular enzyme or molecule. For example, if a chemical
inactivates an enzyme it might prove to be effective in preventing
a process in a cell which causes a disease. High throughput methods
enable researchers to assay thousands of different chemicals
against each target molecule very quickly using robotic handling
systems and automated analysis of results.
[0356] As used herein, "high throughput screening" or "HTS" refers
to the rapid in vitro screening of large numbers of compounds
(libraries); generally tens to hundreds of thousands of compounds,
using robotic screening assays. Ultra high-throughput Screening
(uHTS) generally refers to the high-throughput screening
accelerated to greater than 100,000 tests per day.
[0357] To achieve high-throughput screening, it is advantageous to
house samples on a multicontainer carrier or platform. A
multicontainer carrier facilitates measuring reactions of a
plurality of candidate compounds simultaneously. Multi-well
microplates may be used as the carrier. Such multi-well
microplates, and methods for their use in numerous assays, are both
known in the art and commercially available.
[0358] Screening assays may include controls for purposes of
calibration and confirmation of proper manipulation of the
components of the assay. Blank wells that contain all of the
reactants but no member of the chemical library are usually
included. As another example, a known inhibitor (or activator) of
an enzyme for which modulators are sought, can be incubated with
one sample of the assay, and the resulting decrease (or increase)
in the enzyme activity used as a comparator or control. It will be
appreciated that modulators can also be combined with the enzyme
activators or inhibitors to find modulators which inhibit the
enzyme activation or repression that is otherwise caused by the
presence of the known the enzyme modulator.
[0359] Measuring Enzymatic and Binding Reactions During Screening
Assays
[0360] Techniques for measuring the progression of enzymatic and
binding reactions, e.g., in multicontainer carriers, are known in
the art and include, but are not limited to, the following.
[0361] Spectrophotometric and spectrofluorometric assays are well
known in the art. Examples of such assays include the use of
colorimetric assays for the detection of peroxides, as described in
Gordon, A. J. and Ford, R. A., (1972) The Chemist's Companion: A
Handbook Of Practical Data, Techniques, And References, John Wiley
and Sons, N.Y., Page 437.
[0362] Fluorescence spectrometry may be used to monitor the
generation of reaction products. Fluorescence methodology is
generally more sensitive than the absorption methodology. The use
of fluorescent probes is well known to those skilled in the art.
For reviews, see Bashford et al., (1987) Spectrophotometry and
Spectrofluorometry: A Practical Approach, pp. 91-114, IRL Press
Ltd.; and Bell, (1981) Spectroscopy In Biochemistry, Vol. I, pp.
155-194, CRC Press.
[0363] In spectrofluorometric methods, enzymes are exposed to
substrates that change their intrinsic fluorescence when processed
by the target enzyme. Typically, the substrate is nonfluorescent
and is converted to a fluorophore through one or more reactions. As
a non-limiting example, SMase activity can be detected using the
Amplex.RTM. Red reagent (Molecular Probes, Eugene, Oreg.). In order
to measure sphingomyelinase activity using Amplex.RTM. Red, the
following reactions occur. First, SMase hydrolyzes sphingomyelin to
yield ceramide and phosphorylcholine. Second, alkaline phosphatase
hydrolyzes phosphorylcholine to yield choline. Third, choline is
oxidized by choline oxidase to betaine. Finally, H.sub.2O.sub.2, in
the presence of horseradish peroxidase, reacts with Amplex.RTM. Red
to produce the fluorescent product, Resorufin, and the signal
therefrom is detected using spectrofluorometry.
[0364] Fluorescence polarization (FP) is based on a decrease in the
speed of molecular rotation of a fluorophore that occurs upon
binding to a larger molecule, such as a receptor protein, allowing
for polarized fluorescent emission by the bound ligand. FP is
empirically determined by measuring the vertical and horizontal
components of fluorophore emission following excitation with plane
polarized light. Polarized emission is increased when the molecular
rotation of a fluorophore is reduced. A fluorophore produces a
larger polarized signal when it is bound to a larger molecule (i.e.
a receptor), slowing molecular rotation of the fluorophore. The
magnitude of the polarized signal relates quantitatively to the
extent of fluorescent ligand binding. Accordingly, polarization of
the "bound" signal depends on maintenance of high affinity
binding.
[0365] FP is a homogeneous technology and reactions are very rapid,
taking seconds to minutes to reach equilibrium. The reagents are
stable, and large batches may be prepared, resulting in high
reproducibility. Because of these properties, FP has proven to be
highly automatable, often performed with a single incubation with a
single, premixed, tracer-receptor reagent. For a review, see
Owickiet al., (1997), Application of Fluorescence Polarization
Assays in High-Throughput Screening, Genetic Engineering News,
17:27.
[0366] FP is particularly desirable since its readout is
independent of the emission intensity (Checovich, W. J., et al.,
(1995) Nature 375:254-256; Dandliker, W. B., et al., (1981) Methods
in Enzymology 74:3-28) and is thus insensitive to the presence of
colored compounds that quench fluorescence emission. FP and FRET
(see below) are well-suited for identifying compounds that block
interactions between sphingolipid receptors and their ligands. See,
for example, Parker et al., (2000) Development of high throughput
screening assays using fluorescence polarization: nuclear
receptor-ligand-binding and kinase/phosphatase assays, J Biomol
Screen 5:77-88.
[0367] Fluorophores derived from sphingolipids that may be used in
FP assays are commercially available. For example, Molecular Probes
(Eugene, Oreg.) currently sells sphingomyelin and one ceramide
fluorophores. These are, respectively,
N-(4,4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-pentanoyl)sp-
hingosyl phosphocholine (BODIPY.RTM. FL C5-sphingomyelin);
N-(4,4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-dodecanoyl)s-
phingosyl phosphocholine (BODIPY.RTM. FL C12-sphingomyelin); and
N-(4,4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-pentanoyl)sp-
hingosine (BODIPY.RTM. FL C5-ceramide). U.S. Pat. No. 4,150,949,
(Immunoassay for gentamicin), discloses fluorescein-labelled
gentamicins, including fluoresceinthiocarbanyl gentamicin.
Additional fluorophores may be prepared using methods well known to
the skilled artisan.
[0368] Exemplary normal-and-polarized fluorescence readers include
the POLARION.RTM. fluorescence polarization system (Tecan AG,
Hombrechtikon, Switzerland). General multiwell plate readers for
other assays are available, such as the VERSAMAX.RTM. reader and
the SPECTRAMAX.RTM. multiwell plate spectrophotometer (both from
Molecular Devices).
[0369] Fluorescence resonance energy transfer (FRET) is another
useful assay for detecting interaction and has been described. See,
e.g., Heim et al., (1996) Curr. Biol. 6:178-182; Mitra et al.,
(1996) Gene 173:13-17; and Selvin et al., (1995) Meth. Enzymol.
246:300-345. FRET detects the transfer of energy between two
fluorescent substances in close proximity, having known excitation
and emission wavelengths. As an example, a protein can be expressed
as a fusion protein with green fluorescent protein (GFP). When two
fluorescent proteins are in proximity, such as when a protein
specifically interacts with a target molecule, the resonance energy
can be transferred from one excited molecule to the other. As a
result, the emission spectrum of the sample shifts, which can be
measured by a fluorometer, such as a fMAX multiwell fluorometer
(Molecular Devices, Sunnyvale Calif.).
[0370] Scintillation proximity assay (SPA) is a particularly useful
assay for detecting an interaction with the target molecule. SPA is
widely used in the pharmaceutical industry and has been described
(Hanselman et al., (1997) J. Lipid Res. 38:2365-2373; Kahl et al.,
(1996) Anal. Biochem. 243:282-283; Undenfriend et al., (1987) Anal.
Biochem. 161:494-500). See also U.S. Pat. Nos. 4,626,513 and
4,568,649, and European Patent No. 0,154,734. One commercially
available system uses FLASHPLATE.RTM. scintillant-coated plates
(NEN Life Science Products, Boston, Mass.).
[0371] The target molecule can be bound to the scintillator plates
by a variety of well known means. Scintillant plates are available
that are derivatized to bind to fusion proteins such as GST, His6
or Flag fusion proteins. Where the target molecule is a protein
complex or a multimer, one protein or subunit can be attached to
the plate first, then the other components of the complex added
later under binding conditions, resulting in a bound complex.
[0372] In a typical SPA assay, the gene products in the expression
pool will have been radiolabeled and added to the wells, and
allowed to interact with the solid phase, which is the immobilized
target molecule and scintillant coating in the wells. The assay can
be measured immediately or allowed to reach equilibrium. Either
way, when a radiolabel becomes sufficiently close to the
scintillant coating, it produces a signal detectable by a device
such as a TOPCOUNT NXT.RTM. microplate scintillation counter
(Packard BioScience Co., Meriden Conn.). If a radiolabeled
expression product binds to the target molecule, the radiolabel
remains in proximity to the scintillant long enough to produce a
detectable signal.
[0373] In contrast, the labeled proteins that do not bind to the
target molecule, or bind only briefly, will not remain near the
scintillant long enough to produce a signal above background. Any
time spent near the scintillant caused by random Brownian motion
will also not result in a significant amount of signal. Likewise,
residual unincorporated radiolabel used during the expression step
may be present, but will not generate significant signal because it
will be in solution rather than interacting with the target
molecule. These non-binding interactions will therefore cause a
certain level of background signal that can be mathematically
removed. If too many signals are obtained, salt or other modifiers
can be added directly to the assay plates until the desired
specificity is obtained (Nichols et al., (1998) Anal. Biochem.
257:112-119).
IV. Kinase Activity Assays
[0374] A number of different assays for kinase activity can be
utilized for assaying for active modulators and/or determining
specificity of a modulator for a particular kinase or group or
kinases. In addition to the assay mentioned in the Examples below,
one of ordinary skill in the art will know of other assays that can
be utilized and can modify an assay for a particular application.
For example, numerous papers concerning kinases described assays
that can be used.
[0375] Additional alternative assays can employ binding
determinations. For example, this sort of assay can be formatted
either in a fluorescence resonance energy transfer (FRET) format,
or using an AlphaScreen (amplified luminescent proximity
homogeneous assay) format by varying the donor and acceptor
reagents that are attached to streptavidin or the phospho-specific
antibody.
V. Organic Synthetic Techniques
[0376] A wide array of organic synthetic techniques exist in the
art to meet the challenge of constructing potential modulators.
Many of these organic synthetic methods are described in detail in
standard reference sources utilized by those skilled in the art.
One example of suh a reference is March, 1994, Advanced Organic
Chemistry; Reactions, Mechanisms and Structure, New York, McGraw
Hill. Thus, the techniques useful to synthesize a potential
modulator of kinase function are readily available to those skilled
in the art of organic chemical synthesis.
[0377] Regarding the synthetic examples described herein, solvents
include polar and non-polar solvents known to those of skill in the
art, including polar aprotic and polar protic solvents. Polar
solvents include, without limitation, protic solvents such as
methanol, ethanol, isopropyl alcohol, t-butanol, n-butanol, acetic
acid, formic acid or water, or aprotic solvents such as
tetrahydrofuran (THF), acetonitrile, dioxane, methylene chloride,
dimethylsulfoxide (DMSO), acetone, N,N-dimethylformamide (DMF),
N,N-dimethylacetamide (DMA), ethyl acetate, 1,2-dimethoxyethane,
1,2-dichloroethane, chloroform, 1,2-dichloroethane, or pyridine.
Polar solvents include a mixture of water with any of the above, or
a mixture of any two or more of the above. Apolar solvents include,
without limitation, toluene, benzene, chlorobenzene, xylenes and
hexanes.
[0378] Regarding the synthetic examples described herein, reducing
agent includes, without limitation, a reducing agent such as
catalytic reducing agents using hydrogen and transition metal
catalysts such as palladium, platinum, rhodium, etc. (e.g.
Pt/acetic acid/H.sub.2); a mixture of trifluoroacetic acid and
triethylsilane, borane tetrahydrofuran complex, diborane, borane
dimethylsulfide complex, and a combination of sodium borohydride
and boron trifluoride; metals such as reduced iron, zinc powder,
magnesium etc.; metal hydrogen complex compounds such as alkali
metal borohydrides (for example, potassium borohydride, sodium
borohydride, lithium borohydride, zinc borohydride, sodium
triacetoxyborohydride, etc.), aluminum lithium hydride, etc.; metal
hydrides such as sodium hydride, etc.; organic tin compounds
(triphenyltin hydride, etc.); and metal salts such as nickel
compounds, zinc compounds, tin compounds (for example tin(II)
chloride), and samarium iodide/pivalic acid/hexamethylphorphoric
triamide.
[0379] Regarding the synthetic examples described herein, oxidizing
agent includes, without limitation, an oxidizing agent such as
Dess-Martin reagent, TEMPO (2,2,6,6-tetramethylpiperidine-N-oxide),
DDQ (2,3-Dichloro-5,6-dicyano-1,4-benzoquinone), PDC (pyridinium
dichromate), PCC (pyridinium chlorochromate), Pyridine.SO3,
Chromium trioxide, p-nitroperbenzoic acid, magnesium
monoperoxyphthalate, sodium periodate, potassium periodate,
hydrogen peroxide, urea peroxide, alkali metal bromates, cumene
hydroperoxide, tert-butyl peroxide, peracids such as performic
acid, peracetic acid, pertrifluoroacetic acid, perbenzoic acid,
m-chloroperbenzoic acid, o-carboxyperbenzoic acid and the like;
sodium metaperiodate, bichromic acid; bichromates such as sodium
bichromate, potassium bichromate; permanganic acid; permanganates
such as potassium permanganate, sodium permanganate; and lead salts
such as lead tetraacetate.
VI. Alternative Compound Forms or Derivatives
[0380] (a) Isomers, Prodrugs, and Active Metabolites
[0381] Compounds contemplated herein are described with reference
to both generic formulae and specific compounds. In addition, the
invention compounds may exist in a number of different forms or
derivatives, all within the scope of the present invention. These
include, for example, tautomers, stereoisomers, racemic mixtures,
regioisomers, salts, prodrugs (e.g. carboxylic acid esters),
solvated forms, different crystal forms or polymorphs, and active
metabolites.
[0382] (b) Tautomers, Stereoisomers, Regioisomers, and Solvated
Forms
[0383] It is understood that certain compounds may exhibit
tautomerism. In such cases, the formulae provided herein expressly
depict only one of the possible tautomeric forms. It is therefore
to be understood that the formulae provided herein are intended to
represent any tautomeric form of the depicted compounds and are not
to be limited merely to the specific tautomeric form depicted by
the drawings of the formulae.
[0384] Likewise, some of the compounds according to the present
invention may exist as stereoisomers, i.e. they have the same
sequence of covalently bonded atoms and differ in the spatial
orientation of the atoms. For example, compounds may be optical
stereoisomers, which contain one or more chiral centers, and
therefore, may exist in two or more stereoisomeric forms (e.g.
enantiomers or diastereomers). Thus, such compounds may be present
as single stereoisomers (i.e., essentially free of other
stereoisomers), racemates, and/or mixtures of enantiomers and/or
diastereomers. As another example, stereoisomers include geometric
isomers, such as cis- or trans-orientation of substituents on
adjacent carbons of a double bond. All such single stereoisomers,
racemates and mixtures thereof are intended to be within the scope
of the present invention. Unless specified to the contrary, all
such steroisomeric forms are included within the formulae provided
herein.
[0385] In certain embodiments, a chiral compound of the present
invention is in a form that contains at least 80% of a single
isomer (60% enantiomeric excess ("e.e.") or diastereomeric excess
("d.e.")), or at least 85% (70% e.e. or d.e.), 90% (80% e.e. or
d.e.), 95% (90% e.e. or d.e.), 97.5% (95% e.e. or d.e.), or 99%
(98% e.e. or d.e.). As generally understood by those skilled in the
art, an optically pure compound having one chiral center is one
that consists essentially of one of the two possible enantiomers
(i.e., is enantiomerically pure), and an optically pure compound
having more than one chiral center is one that is both
diastereomerically pure and enantiomerically pure. In certain
embodiments, the compound is present in optically pure form.
[0386] For compounds in which synthesis involves addition of a
single group at a double bond, particularly a carbon-carbon double
bond, the addition may occur at either of the double bond-linked
atoms. For such compounds, the present invention includes both such
regioisomers.
[0387] Additionally, the formulae are intended to cover solvated as
well as unsolvated forms of the identified structures. For example,
the indicated structures include both hydrated and non-hydrated
forms. Other examples of solvates include the structures in
combination with isopropanol, ethanol, methanol, DMSO, ethyl
acetate, acetic acid, or ethanolamine.
[0388] (c) Prodrugs and Metabolites
[0389] In addition to the present formulae and compounds described
herein, the invention also includes prodrugs (generally
pharmaceutically acceptable prodrugs), active metabolic derivatives
(active metabolites), and their pharmaceutically acceptable
salts.
[0390] Prodrugs are compounds or pharmaceutically acceptable salts
thereof which, when metabolized under physiological conditions or
when converted by solvolysis, yield the desired active compound.
Typically, the prodrug is inactive, or less active than the active
compound, but may provide advantageous handling, administration, or
metabolic properties. For example, some prodrugs are esters of the
active compound; during metabolysis, the ester group is cleaved to
yield the active drug. Also, some prodrugs are activated
enzymatically to yield the active compound, or a compound which,
upon further chemical reaction, yields the active compound.
[0391] As described in The Practice of Medicinal Chemistry, Ch.
31-32 (Ed. Wermuth, Academic Press, San Diego, Calif., 2001),
prodrugs can be conceptually divided into two non-exclusive
categories, bioprecursor prodrugs and carrier prodrugs. Generally,
bioprecursor prodrugs are compounds that are inactive or have low
activity compared to the corresponding active drug compound, that
contain one or more protective groups and are converted to an
active form by metabolism or solvolysis. Both the active drug form
and any released metabolic products should have acceptably low
toxicity. Typically, the formation of active drug compound involves
a metabolic process or reaction that is one of the follow
types:
[0392] Oxidative reactions: Oxidative reactions are exemplified
without limitation to reactions such as oxidation of alcohol,
carbonyl, and acid functions, hydroxylation of aliphatic carbons,
hydroxylation of alicyclic carbon atoms, oxidation of aromatic
carbon atoms, oxidation of carbon-carbon double bonds, oxidation of
nitrogen-containing functional groups, oxidation of silicon,
phosphorus, arsenic, and sulfur, oxidative N-dealkylation,
oxidative O- and S-dealkylation, oxidative deamination, as well as
other oxidative reactions.
[0393] Reductive reactions: Reductive reactions are exemplified
without limitation to reactions such as reduction of carbonyl
groups, reduction of hydroxyl groups and carbon-carbon double
bonds, reduction of nitrogen-containing functions groups, and other
reduction reactions.
[0394] Reactions without change in the oxidation state: Reactions
without change in the state of oxidation are exemplified without
limitation to reactions such as hydrolysis of esters and ethers,
hydrolytic cleavage of carbon-nitrogen single bonds, hydrolytic
cleavage of non-aromatic heterocycles, hydration and dehydration at
multiple bonds, new atomic linkages resulting from dehydration
reactions, hydrolytic dehalogenation, removal of hydrogen halide
molecule, and other such reactions.
[0395] Carrier prodrugs are drug compounds that contain a transport
moiety, e.g., that improves uptake and/or localized delivery to a
site(s) of action. Desirably for such a carrier prodrug, the
linkage between the drug moiety and the transport moiety is a
covalent bond, the prodrug is inactive or less active than the drug
compound, the prodrug and any release transport moiety are
acceptably non-toxic. For prodrugs where the transport moiety is
intended to enhance uptake, typically the release of the transport
moiety should be rapid. In other cases, it is desirable to utilize
a moiety that provides slow release, e.g., certain polymers or
other moieties, such as cyclodextrins. (See, e.g., Cheng et al.,
U.S. Patent Publ. No. 2004/0077595, Ser. No. 10/656,838,
incorporated herein by reference.) Such carrier prodrugs are often
advantageous for orally administered drugs. Carrier prodrugs can,
for example, be used to improve one or more of the following
properties: increased lipophilicity, increased duration of
pharmacological effects, increased site-specificity, decreased
toxicity and adverse reactions, and/or improvement in drug
formulation (e.g. stability, water solubility, suppression of an
undesirable organoleptic or physiochemical property). For example,
lipophilicity can be increased by esterification of hydroxyl groups
with lipophilic carboxylic acids, or of carboxylic acid groups with
alcohols, e.g., aliphatic alcohols. Wermuth, The Practice of
Medicinal Chemistry, Ch. 31-32, Ed. Wermuth, Academic Press, San
Diego, Calif., 2001.
[0396] Prodrugs may proceed from prodrug form to active form in a
single step or may have one or more intermediate forms which may
themselves have activity or may be inactive.
[0397] Metabolites, e.g., active metabolites, overlap with prodrugs
as described above, e.g., bioprecursor prodrugs. Thus, such
metabolites are pharmacologically active compounds or compounds
that further metabolize to pharmacologically active compounds that
are derivatives resulting from metabolic process in the body of a
subject or patient. Of these, active metabolites are such
pharmacologically active derivative compounds. For prodrugs, the
prodrug compounds is generally inactive or of lower activity than
the metabolic product. For active metabolites, the parent compound
may be either an active compound or may be an inactive prodrug.
[0398] Prodrugs and active metabolites may be identified using
routine techniques known in the art. See, e.g., Bertolini et al.,
1997, J. Med. Chem., 40:2011-2016; Shan et al., 1997, J Pharm Sci
86(7):756-757; Bagshawe, 1995, Drug Dev. Res., 34:220-230; Wermuth,
The Practice of Medicinal Chemistry, Ch. 31-32, Academic Press, San
Diego, Calif., 2001.
[0399] (d) Pharmaceutically Acceptable Salts
[0400] Compounds can be formulated as or be in the form of
pharmaceutically acceptable salts. Pharmaceutically acceptable
salts are non-toxic salts in the amounts and concentrations at
which they are administered. The preparation of such salts can
facilitate the pharmacological use by altering the physical
characteristics of a compound without preventing it from exerting
its physiological effect. Useful alterations in physical properties
include lowering the melting point to facilitate transmucosal
administration and increasing the solubility to facilitate
administering higher concentrations of the drug.
[0401] Pharmaceutically acceptable salts include acid addition
salts such as those containing sulfate, chloride, hydrochloride,
fumarate, maleate, phosphate, sulfamate, acetate, citrate, lactate,
tartrate, methanesulfonate, ethanesulfonate, benzenesulfonate,
p-toluenesulfonate, cyclohexylsulfamate and quinate.
Pharmaceutically acceptable salts can be obtained from acids such
as hydrochloric acid, maleic acid, sulfuric acid, phosphoric acid,
sulfamic acid, acetic acid, citric acid, lactic acid, tartaric
acid, malonic acid, methanesulfonic acid, ethanesulfonic acid,
benzenesulfonic acid, p-toluenesulfonic acid, cyclohexylsulfamic
acid, fumaric acid, and quinic acid.
[0402] Pharmaceutically acceptable salts also include basic
addition salts such as those containing benzathine, chloroprocaine,
choline, diethanolamine, ethylenediamine, meglumine, procaine,
aluminum, calcium, lithium, magnesium, potassium, sodium, ammonium,
alkylamine, and zinc, when acidic functional groups, such as
carboxylic acid or phenol are present. For example, see Remington's
Pharmaceutical Sciences, 19.sup.th ed., Mack Publishing Co.,
Easton, Pa., Vol. 2, p. 1457, 1995. Such salts can be prepared
using the appropriate corresponding bases.
[0403] Pharmaceutically acceptable salts can be prepared by
standard techniques. For example, the free-base form of a compound
can be dissolved in a suitable solvent, such as an aqueous or
aqueous-alcohol solution containing the appropriate acid and then
isolated by evaporating the solution. In another example, a salt
can be prepared by reacting the free base and acid in an organic
solvent.
[0404] Thus, for example, if the particular compound is a base, the
desired pharmaceutically acceptable salt may be prepared by any
suitable method available in the art, for example, treatment of the
free base with an inorganic acid, such as hydrochloric acid,
hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, and
the like, or with an organic acid, such as acetic acid, maleic
acid, succinic acid, mandelic acid, fumaric acid, malonic acid,
pyruvic acid, oxalic acid, glycolic acid, salicylic acid, a
pyranosidyl acid, such as glucuronic acid or galacturonic acid, an
alpha-hydroxy acid, such as citric acid or tartaric acid, an amino
acid, such as aspartic acid or glutamic acid, an aromatic acid,
such as benzoic acid or cinnamic acid, a sulfonic acid, such as
p-toluenesulfonic acid or ethanesulfonic acid, or the like.
[0405] Similarly, if the particular compound is an acid, the
desired pharmaceutically acceptable salt may be prepared by any
suitable method, for example, treatment of the free acid with an
inorganic or organic base, such as an amine (primary, secondary or
tertiary), an alkali metal hydroxide or alkaline earth metal
hydroxide, or the like. Illustrative examples of suitable salts
include organic salts derived from amino acids, such as glycine and
arginine, ammonia, primary, secondary, and tertiary amines, and
cyclic amines, such as piperidine, morpholine and piperazine, and
inorganic salts derived from sodium, calcium, potassium, magnesium,
manganese, iron, copper, zinc, aluminum and lithium.
[0406] The pharmaceutically acceptable salt of the different
compounds may be present as a complex. Examples of complexes
include 8-chlorotheophylline complex (analogous to, e.g.,
dimenhydrinate:diphenhydramine 8-chlorotheophylline (1:1) complex;
Dramamine) and various cyclodextrin inclusion complexes.
[0407] Unless specified to the contrary, specification of a
compound herein includes pharmaceutically acceptable salts of such
compound.
[0408] (e) Polymorphic Forms
[0409] In the case of agents that are solids, it is understood by
those skilled in the art that the compounds and salts may exist in
different crystal or polymorphic forms, all of which are intended
to be within the scope of the present invention and specified
formulae.
VII. Administration
[0410] The methods and compounds will typically be used in therapy
for human patients. However, they may also be used to treat similar
or identical diseases in other vertebrates, e.g., mammals such as
other primates, animals of commercial significance, e.g., sports
animals, farm animals, e.g., bovines, equines, porcines, and
ovines, and pets such as dogs and cats.
[0411] Suitable dosage forms, in part, depend upon the use or the
route of administration, for example, oral, transdermal,
transmucosal, inhalant, or by injection (parenteral). Such dosage
forms should allow the compound to reach target cells. Other
factors are well known in the art, and include considerations such
as toxicity and dosage forms that retard the compound or
composition from exerting its effects. Techniques and formulations
generally may be found in Remington: The Science and Practice of
Pharmacy, 21.sup.st edition, Lippincott, Williams and Wilkins,
Philadelphia, Pa., 2005 (hereby incorporated by reference
herein).
[0412] Compounds of the present invention (i.e. Formula I,
including Formulae Ia, Ib, Ig and all sub-embodiments disclosed
herein) can be formulated as pharmaceutically acceptable salts.
[0413] Carriers or excipients can be used to produce compositions.
The carriers or excipients can be chosen to facilitate
administration of the compound. Examples of carriers include
calcium carbonate, calcium phosphate, various sugars such as
lactose, glucose, or sucrose, or types of starch, cellulose
derivatives, gelatin, vegetable oils, polyethylene glycols and
physiologically compatible solvents. Examples of physiologically
compatible solvents include sterile solutions of water for
injection (WFI), saline solution, and dextrose.
[0414] The compounds can be administered by different routes
including intravenous, intraperitoneal, subcutaneous,
intramuscular, oral, transmucosal, rectal, transdermal, or
inhalant. In some embodiments, oral administration is preferred.
For oral administration, for example, the compounds can be
formulated into conventional oral dosage forms such as capsules,
tablets, and liquid preparations such as syrups, elixirs, and
concentrated drops.
[0415] Pharmaceutical preparations for oral use can be obtained,
for example, by combining the active compounds with solid
excipients, optionally grinding a resulting mixture, and processing
the mixture of granules, after adding suitable auxiliaries, if
desired, to obtain tablets or dragee cores. Suitable excipients
are, in particular, fillers such as sugars, including lactose,
sucrose, mannitol, or sorbitol; cellulose preparations, for
example, maize starch, wheat starch, rice starch, potato starch,
gelatin, gum tragacanth, methyl cellulose,
hydroxypropylmethyl-cellulose, sodium carboxymethylcellulose (CMC),
and/or polyvinylpyrrolidone (PVP: povidone). If desired,
disintegrating agents may be added, such as the cross-linked
polyvinylpyrrolidone, agar, or alginic acid, or a salt thereof such
as sodium alginate.
[0416] Dragee cores are provided with suitable coatings. For this
purpose, concentrated sugar solutions may be used, which may
optionally contain, for example, gum arabic, talc,
poly-vinylpyrrolidone, carbopol gel, polyethylene glycol (PEG),
and/or titanium dioxide, lacquer solutions, and suitable organic
solvents or solvent mixtures. Dye-stuffs or pigments may be added
to the tablets or dragee coatings for identification or to
characterize different combinations of active compound doses.
[0417] Pharmaceutical preparations that can be used orally include
push-fit capsules made of gelatin ("gelcaps"), as well as soft,
sealed capsules made of gelatin, and a plasticizer, such as
glycerol or sorbitol. The push-fit capsules can contain the active
ingredients in admixture with filler such as lactose, binders such
as starches, and/or lubricants such as talc or magnesium stearate
and, optionally, stabilizers. In soft capsules, the active
compounds may be dissolved or suspended in suitable liquids, such
as fatty oils, liquid paraffin, or liquid polyethylene glycols
(PEGs). In addition, stabilizers may be added.
[0418] Alternatively, injection (parenteral administration) may be
used, e.g., intramuscular, intravenous, intraperitoneal, and/or
subcutaneous. For injection, the compounds of the invention are
formulated in sterile liquid solutions, preferably in
physiologically compatible buffers or solutions, such as saline
solution, Hank's solution, or Ringer's solution. In addition, the
compounds may be formulated in solid form and redissolved or
suspended immediately prior to use. Lyophilized forms can also be
produced.
[0419] Administration can also be by transmucosal, topical,
transdermal, or inhalant means. For transmucosal, topical or
transdermal administration, penetrants appropriate to the barrier
to be permeated are used in the formulation. Such penetrants are
generally known in the art, and include, for example, for
transmucosal administration, bile salts and fusidic acid
derivatives. In addition, detergents may be used to facilitate
permeation. Transmucosal administration, for example, may be
through nasal sprays or suppositories (rectal or vaginal).
[0420] The topical compositions of this invention are formulated
preferably as oils, creams, lotions, ointments, and the like by
choice of appropriate carriers known in the art. Suitable carriers
include vegetable or mineral oils, white petrolatum (white soft
paraffin), branched chain fats or oils, animal fats and high
molecular weight alcohol (greater than C.sub.12). The preferred
carriers are those in which the active ingredient is soluble.
Emulsifiers, stabilizers, humectants and antioxidants may also be
included as well as agents imparting color or fragrance, if
desired. Creams for topical application are preferably formulated
from a mixture of mineral oil, self-emulsifying beeswax and water
in which mixture the active ingredient, dissolved in a small amount
solvent (e.g. an oil), is admixed. Additionally, administration by
transdermal means may comprise a transdermal patch or dressing such
as a bandage impregnated with an active ingredient and optionally
one or more carriers or diluents known in the art. To be
administered in the form of a transdermal delivery system, the
dosage administration will, of course, be continuous rather than
intermittent throughout the dosage regimen.
[0421] For inhalants, compounds of the invention may be formulated
as dry powder or a suitable solution, suspension, or aerosol.
Powders and solutions may be formulated with suitable additives
known in the art. For example, powders may include a suitable
powder base such as lactose or starch, and solutions may comprise
propylene glycol, sterile water, ethanol, sodium chloride and other
additives, such as acid, alkali and buffer salts. Such solutions or
suspensions may be administered by inhaling via spray, pump,
atomizer, or nebulizer, and the like. The compounds of the
invention may also be used in combination with other inhaled
therapies, for example corticosteroids such as fluticasone
proprionate, beclomethasone dipropionate, triamcinolone acetonide,
budesonide, and mometasone furoate; beta agonists such as
albuterol, salmeterol, and formoterol; anticholinergic agents such
as ipratroprium bromide or tiotropium; vasodilators such as
treprostinal and iloprost; enzymes such as DNAase; therapeutic
proteins; immunoglobulin antibodies; an oligonucleotide, such as
single or double stranded DNA or RNA, siRNA; antibiotics such as
tobramycin; muscarinic receptor antagonists; leukotriene
antagonists; cytokine antagonists; protease inhibitors; cromolyn
sodium; nedocril sodium; and sodium cromoglycate.
[0422] The compounds of the invention may also be used in
combination with other therapies for treating the same disease.
Such combination use includes administration of the compounds and
one or more other therapeutics at different times, or
co-administration of the compound and one or more other therapies.
In certain embodiments, dosage may be modified for one or more of
the compounds of the invention or other therapeutics used in
combination, e.g., reduction in the amount dosed relative to a
compound or therapy used alone, by methods well known to those of
ordinary skill in the art.
[0423] It is understood that use in combination includes use with
other therapies, drugs, medical procedures etc., where the other
therapy or procedure may be administered at different times (e.g.
within a short time, such as within hours (e.g. 1, 2, 3, 4-24
hours), or within a longer time (e.g. 1-2 days, 2-4 days, 4-7 days,
1-4 weeks)) than a compound of the present invention, or at the
same time as a compound of the invention. Use in combination also
includes use with a therapy or medical procedure that is
administered once or infrequently, such as surgery, along with a
compound of the invention administered within a short time or
longer time before or after the other therapy or procedure. In
certain embodiments, the present invention provides for delivery of
compounds of the invention and one or more other drug therapeutics
delivered by a different route of administration or by the same
route of administration. The use in combination for any route of
administration includes delivery of compounds of the invention and
one or more other drug therapeutics delivered by the same route of
administration together in any formulation, including formulations
where the two compounds are chemically linked in such a way that
they maintain their therapeutic activity when administered. In one
aspect, the other drug therapy may be co-administered with one or
more compounds of the invention. Use in combination by
co-administration includes administration of co-formulations or
formulations of chemically joined compounds, or administration of
two or more compounds in separate formulations within a short time
of each other (e.g. within an hour, 2 hours, 3 hours, up to 24
hours), administered by the same or different routes.
Co-administration of separate formulations includes
co-administration by delivery via one device, for example the same
inhalant device, the same syringe, etc., or administration from
separate devices within a short time of each other. Co-formulations
of compounds of the invention and one or more additional drug
therapies delivered by the same route includes preparation of the
materials together such that they can be administered by one
device, including the separate compounds combined in one
formulation, or compounds that are modified such that they are
chemically joined, yet still maintain their biological activity.
Such chemically joined compounds may have a linkage that is
substantially maintained in vivo, or the linkage may break down in
vivo, separating the two active components.
[0424] The amounts of various compound to be administered as an
effective amount can be determined by standard procedures taking
into account factors such as the compound IC.sub.50, the biological
half-life of the compound, the age, size, and weight of the
subject, and the disorder associated with the subject. The
importance of these and other factors are well known to those of
ordinary skill in the art. Generally, a dose will be between about
0.01 and 50 mg/kg, preferably 0.1 and 20 mg/kg of the subject being
treated. Multiple doses may be used.
VIII. Manipulation of c-Kit and c-fms
[0425] As the full-length coding sequence and amino acid sequence
of c-kit and c-fms from various mammals including human is known,
cloning, construction of recombinant c-kit and c-fms, production
and purification of recombinant protein, introduction of c-kit or
c-fms into other organisms, and other molecular biological
manipulations of c-kit and c-fms are readily performed.
[0426] Techniques for the manipulation of nucleic acids, such as,
e.g., subcloning, labeling probes (e.g. random-primer labeling
using Klenow polymerase, nick translation, amplification),
sequencing, hybridization and the like are well disclosed in the
scientific and patent literature, see, e.g., Sambrook, ed.,
Molecular Cloning: a Laboratory Manual (2nd ed.), Vols. 1-3, Cold
Spring Harbor Laboratory, (1989); Current Protocols in Molecular
Biology, Ausubel, ed. John Wiley & Sons, Inc., New York (1997);
Laboratory Techniques in Biochemistry and Molecular Biology:
Hybridization With Nucleic Acid Probes, Part I. Theory and Nucleic
Acid Preparation, Tijssen, ed. Elsevier, N.Y. (1993).
[0427] Nucleic acid sequences can be amplified as necessary for
further use using amplification methods, such as PCR, isothermal
methods, rolling circle methods, etc., are well known to the
skilled artisan. See, e.g., Saiki, "Amplification of Genomic DNA"
in PCR Protocols, Innis et al., Eds., Academic Press, San Diego,
Calif. 1990, pp 13-20; Wharam et al., Nucleic Acids Res. 2001 Jun.
1; 29(11):E54-E54; Hafner et al., Biotechniques 2001 April;
30(4):852-6, 858, 860 passim; Zhong et al., Biotechniques 2001
April; 30(4):852-6, 858, 860 passim.
[0428] Nucleic acids, vectors, capsids, polypeptides, and the like
can be analyzed and quantified by any of a number of general means
well known to those of skill in the art. These include, e.g.,
analytical biochemical methods such as NMR, spectrophotometry,
radiography, electrophoresis, capillary electrophoresis, high
performance liquid chromatography (HPLC), thin layer chromatography
(TLC), and hyperdiffusion chromatography, various immunological
methods, e.g. fluid or gel precipitin reactions, immunodiffusion,
immuno-electrophoresis, radioimmunoassays (RIAs), enzyme-linked
immunosorbent assays (ELISAs), immuno-fluorescent assays, Southern
analysis, Northern analysis, dot-blot analysis, gel electrophoresis
(e.g. SDS-PAGE), nucleic acid or target or signal amplification
methods, radiolabeling, scintillation counting, and affinity
chromatography.
[0429] Obtaining and manipulating nucleic acids used to practice
the methods of the invention can be performed by cloning from
genomic samples, and, if desired, screening and re-cloning inserts
isolated or amplified from, e.g., genomic clones or cDNA clones.
Sources of nucleic acid used in the methods of the invention
include genomic or cDNA libraries contained in, e.g., mammalian
artificial chromosomes (MACs), see, e.g., U.S. Pat. Nos. 5,721,118;
6,025,155; human artificial chromosomes, see, e.g., Rosenfeld
(1997) Nat. Genet. 15:333-335; yeast artificial chromosomes (YAC);
bacterial artificial chromosomes (BAC); P1 artificial chromosomes,
see, e.g., Woon (1998) Genomics 50:306-316; P1-derived vectors
(PACs), see, e.g., Kern (1997) Biotechniques 23:120-124; cosmids,
recombinant viruses, phages or plasmids.
[0430] The nucleic acids of the invention can be operatively linked
to a promoter. A promoter can be one motif or an array of nucleic
acid control sequences which direct transcription of a nucleic
acid. A promoter can include necessary nucleic acid sequences near
the start site of transcription, such as, in the case of a
polymerase II type promoter, a TATA element. A promoter also
optionally includes distal enhancer or repressor elements which can
be located as much as several thousand base pairs from the start
site of transcription. A "constitutive" promoter is a promoter
which is active under most environmental and developmental
conditions. An "inducible" promoter is a promoter which is under
environmental or developmental regulation. A "tissue specific"
promoter is active in certain tissue types of an organism, but not
in other tissue types from the same organism. The term "operably
linked" refers to a functional linkage between a nucleic acid
expression control sequence (such as a promoter, or array of
transcription factor binding sites) and a second nucleic acid
sequence, wherein the expression control sequence directs
transcription of the nucleic acid corresponding to the second
sequence.
[0431] The nucleic acids of the invention can also be provided in
expression vectors and cloning vehicles, e.g., sequences encoding
the polypeptides of the invention. Expression vectors and cloning
vehicles of the invention can comprise viral particles,
baculovirus, phage, plasmids, phagemids, cosmids, fosmids,
bacterial artificial chromosomes, viral DNA (e.g. vaccinia,
adenovirus, foul pox virus, pseudorabies and derivatives of SV40),
P1-based artificial chromosomes, yeast plasmids, yeast artificial
chromosomes, and any other vectors specific for specific hosts of
interest (such as bacillus, Aspergillus and yeast). Vectors of the
invention can include chromosomal, non-chromosomal and synthetic
DNA sequences. Large numbers of suitable vectors are known to those
of skill in the art, and are commercially available.
[0432] The nucleic acids of the invention can be cloned, if
desired, into any of a variety of vectors using routine molecular
biological methods; methods for cloning in vitro amplified nucleic
acids are disclosed, e.g., U.S. Pat. No. 5,426,039. To facilitate
cloning of amplified sequences, restriction enzyme sites can be
"built into" a PCR primer pair. Vectors may be introduced into a
genome or into the cytoplasm or a nucleus of a cell and expressed
by a variety of conventional techniques, well described in the
scientific and patent literature. See, e.g., Roberts (1987) Nature
328:731; Schneider (1995) Protein Expr. Purif. 6435:10; Sambrook,
Tijssen or Ausubel. The vectors can be isolated from natural
sources, obtained from such sources as ATCC or GenBank libraries,
or prepared by synthetic or recombinant methods. For example, the
nucleic acids of the invention can be expressed in expression
cassettes, vectors or viruses which are stably or transiently
expressed in cells (e.g. episomal expression systems). Selection
markers can be incorporated into expression cassettes and vectors
to confer a selectable phenotype on transformed cells and
sequences. For example, selection markers can code for episomal
maintenance and replication such that integration into the host
genome is not required.
[0433] In one aspect, the nucleic acids of the invention are
administered in vivo for in situ expression of the peptides or
polypeptides of the invention. The nucleic acids can be
administered as "naked DNA" (see, e.g., U.S. Pat. No. 5,580,859) or
in the form of an expression vector, e.g., a recombinant virus. The
nucleic acids can be administered by any route, including peri- or
intra-tumorally, as described below. Vectors administered in vivo
can be derived from viral genomes, including recombinantly modified
enveloped or non-enveloped DNA and RNA viruses, preferably selected
from baculoviridiae, parvoviridiae, picornoviridiae,
herpesveridiae, poxyiridae, adenoviridiae, or picornnaviridiae.
Chimeric vectors may also be employed which exploit advantageous
merits of each of the parent vector properties (See e.g., Feng
(1997) Nature Biotechnology 15:866-870). Such viral genomes may be
modified by recombinant DNA techniques to include the nucleic acids
of the invention; and may be further engineered to be replication
deficient, conditionally replicating or replication competent. In
alternative aspects, vectors are derived from the adenoviral (e.g.
replication incompetent vectors derived from the human adenovirus
genome, see, e.g., U.S. Pat. Nos. 6,096,718; 6,110,458; 6,113,913;
5,631,236); adeno-associated viral and retroviral genomes.
Retroviral vectors can include those based upon murine leukemia
virus (MuLV), gibbon ape leukemia virus (GaLV), Simian Immuno
deficiency virus (SIV), human immuno deficiency virus (HIV), and
combinations thereof; see, e.g., U.S. Pat. Nos. 6,117,681;
6,107,478; 5,658,775; 5,449,614; Buchscher (1992) J. Virol.
66:2731-2739; Johann (1992) J. Virol. 66:1635-1640).
Adeno-associated virus (AAV)-based vectors can be used to transduce
cells with target nucleic acids, e.g., in the in vitro production
of nucleic acids and peptides, and in in vivo and ex vivo gene
therapy procedures; see, e.g., U.S. Pat. Nos. 6,110,456; 5,474,935;
Okada (1996) Gene Ther. 3:957-964.
[0434] The present invention also relates to fusion proteins, and
nucleic acids encoding them. A polypeptide of the invention can be
fused to a heterologous peptide or polypeptide, such as N-terminal
identification peptides which impart desired characteristics, such
as increased stability or simplified purification. Peptides and
polypeptides of the invention can also be synthesized and expressed
as fusion proteins with one or more additional domains linked
thereto for, e.g., producing a more immunogenic peptide, to more
readily isolate a recombinantly synthesized peptide, to identify
and isolate antibodies and antibody-expressing B cells, and the
like. Detection and purification facilitating domains include,
e.g., metal chelating peptides such as polyhistidine tracts and
histidine-tryptophan modules that allow purification on immobilized
metals, protein A domains that allow purification on immobilized
immunoglobulin, and the domain utilized in the FLAGS
extension/affinity purification system (Immunex Corp, Seattle
Wash.). The inclusion of a cleavable linker sequences such as
Factor Xa or enterokinase (Invitrogen, San Diego Calif.) between a
purification domain and the motif-comprising peptide or polypeptide
to facilitate purification. For example, an expression vector can
include an epitope-encoding nucleic acid sequence linked to six
histidine residues followed by a thioredoxin and an enterokinase
cleavage site (see e.g., Williams (1995) Biochemistry 34:1787-1797;
Dobeli (1998) Protein Expr. Purif. 12:404-414). The histidine
residues facilitate detection and purification while the
enterokinase cleavage site provides a means for purifying the
epitope from the remainder of the fusion protein. In one aspect, a
nucleic acid encoding a polypeptide of the invention is assembled
in appropriate phase with a leader sequence capable of directing
secretion of the translated polypeptide or fragment thereof.
Technology pertaining to vectors encoding fusion proteins and
application of fusion proteins are well disclosed in the scientific
and patent literature, see e.g., Kroll (1993) DNA Cell. Biol.
12:441-53.
[0435] The nucleic acids and polypeptides of the invention can be
bound to a solid support, e.g., for use in screening and diagnostic
methods. Solid supports can include, e.g., membranes (e.g.
nitrocellulose or nylon), a microtiter dish (e.g. PVC,
polypropylene, or polystyrene), a test tube (glass or plastic), a
dip stick (e.g. glass, PVC, polypropylene, polystyrene, latex and
the like), a microfuge tube, or a glass, silica, plastic, metallic
or polymer bead or other substrate such as paper. One solid support
uses a metal (e.g. cobalt or nickel)-comprising column which binds
with specificity to a histidine tag engineered onto a peptide.
[0436] Adhesion of molecules to a solid support can be direct
(i.e., the molecule contacts the solid support) or indirect (a
"linker" is bound to the support and the molecule of interest binds
to this linker). Molecules can be immobilized either covalently
(e.g. utilizing single reactive thiol groups of cysteine residues
(see, e.g., Colliuod (1993) Bioconjugate Chem. 4:528-536) or
non-covalently but specifically (e.g. via immobilized antibodies
(see, e.g., Schuhmann (1991) Adv. Mater. 3:388-391; Lu (1995) Anal.
Chem. 67:83-87; the biotin/strepavidin system (see, e.g., Iwane
(1997) Biophys. Biochem. Res. Comm. 230:76-80); metal chelating,
e.g., Langmuir-Blodgett films (see, e.g., Ng (1995) Langmuir
11:4048-55); metal-chelating self-assembled monolayers (see, e.g.,
Sigal (1996) Anal. Chem. 68:490-497) for binding of polyhistidine
fusions.
[0437] Indirect binding can be achieved using a variety of linkers
which are commercially available. The reactive ends can be any of a
variety of functionalities including, but not limited to: amino
reacting ends such as N-hydroxysuccinimide (NHS) active esters,
imidoesters, aldehydes, epoxides, sulfonyl halides, isocyanate,
isothiocyanate, and nitroaryl halides; and thiol reacting ends such
as pyridyl disulfides, maleimides, thiophthalimides, and active
halogens. The heterobifunctional crosslinking reagents have two
different reactive ends, e.g., an amino-reactive end and a
thiol-reactive end, while homobifunctional reagents have two
similar reactive ends, e.g., bismaleimidohexane (BMH) which permits
the cross-linking of sulfhydryl-containing compounds. The spacer
can be of varying length and be aliphatic or aromatic. Examples of
commercially available homobifunctional cross-linking reagents
include, but are not limited to, the imidoesters such as dimethyl
adipimidate dihydrochloride (DMA); dimethyl pimelimidate
dihydrochloride (DMP); and dimethyl suberimidate dihydrochloride
(DMS). Heterobifunctional reagents include commercially available
active halogen-NHS active esters coupling agents such as
N-succinimidyl bromoacetate and N-succinimidyl
(4-iodoacetyl)aminobenzoate (SIAB) and the sulfosuccinimidyl
derivatives such as sulfosuccinimidyl(4-iodoacetyl)aminobenzoate
(sulfo-SIAB) (Pierce). Another group of coupling agents is the
heterobifunctional and thiol cleavable agents such as
N-succinimidyl 3-(2-pyridyldithio)propionate (SPDP) (Pierce
Chemicals, Rockford, Ill.).
[0438] Antibodies can also be used for binding polypeptides and
peptides of the invention to a solid support. This can be done
directly by binding peptide-specific antibodies to the column or it
can be done by creating fusion protein chimeras comprising
motif-containing peptides linked to, e.g., a known epitope (e.g. a
tag (e.g. FLAG, myc) or an appropriate immunoglobulin constant
domain sequence (an "immunoadhesin," see, e.g., Capon (1989) Nature
377:525-531 (1989).
[0439] Nucleic acids or polypeptides of the invention can be
immobilized to or applied to an array. Arrays can be used to screen
for or monitor libraries of compositions (e.g. small molecules,
antibodies, nucleic acids, etc.) for their ability to bind to or
modulate the activity of a nucleic acid or a polypeptide of the
invention. For example, in one aspect of the invention, a monitored
parameter is transcript expression of a gene comprising a nucleic
acid of the invention. One or more, or, all the transcripts of a
cell can be measured by hybridization of a sample comprising
transcripts of the cell, or, nucleic acids representative of or
complementary to transcripts of a cell, by hybridization to
immobilized nucleic acids on an array, or "biochip." By using an
"array" of nucleic acids on a microchip, some or all of the
transcripts of a cell can be simultaneously quantified.
Alternatively, arrays comprising genomic nucleic acid can also be
used to determine the genotype of a newly engineered strain made by
the methods of the invention. Polypeptide arrays" can also be used
to simultaneously quantify a plurality of proteins.
[0440] The terms "array" or "microarray" or "biochip" or "chip" as
used herein is a plurality of target elements, each target element
comprising a defined amount of one or more polypeptides (including
antibodies) or nucleic acids immobilized onto a defined area of a
substrate surface. In practicing the methods of the invention, any
known array and/or method of making and using arrays can be
incorporated in whole or in part, or variations thereof, as
disclosed, for example, in U.S. Pat. Nos. 6,277,628; 6,277,489;
6,261,776; 6,258,606; 6,054,270; 6,048,695; 6,045,996; 6,022,963;
6,013,440; 5,965,452; 5,959,098; 5,856,174; 5,830,645; 5,770,456;
5,632,957; 5,556,752; 5,143,854; 5,807,522; 5,800,992; 5,744,305;
5,700,637; 5,556,752; 5,434,049; see also, e.g., WO 99/51773; WO
99/09217; WO 97/46313; WO 96/17958; see also, e.g., Johnston (1998)
Curr. Biol. 8:R171-R174; Schummer (1997) Biotechniques
23:1087-1092; Kern (1997) Biotechniques 23:120-124; Solinas-Toldo
(1997) Genes, Chromosomes & Cancer 20:399-407; Bowtell (1999)
Nature Genetics Supp. 21:25-32. See also published U.S. patent
applications Nos. 20010018642; 20010019827; 20010016322;
20010014449; 20010014448; 20010012537; 20010008765.
[0441] Host Cells and Transformed Cells
[0442] The invention also provides a transformed cell comprising a
nucleic acid sequence of the invention, e.g., a sequence encoding a
polypeptide of the invention, or a vector of the invention. The
host cell may be any of the host cells familiar to those skilled in
the art, including prokaryotic cells, eukaryotic cells, such as
bacterial cells, fungal cells, yeast cells, mammalian cells, insect
cells, or plant cells. Exemplary bacterial cells include E. coli,
Streptomyces, Bacillus subtilis, Salmonella typhimurium and various
species within the genera Pseudomonas, Streptomyces, and
Staphylococcus. Exemplary insect cells include Drosophila S2 and
Spodoptera Sf9. Exemplary animal cells include CHO, COS or Bowes
melanoma or any mouse or human cell line. The selection of an
appropriate host is within the abilities of those skilled in the
art.
[0443] Vectors may be introduced into the host cells using any of a
variety of techniques, including transformation, transfection,
transduction, viral infection, gene guns, or Ti-mediated gene
transfer. Particular methods include calcium phosphate
transfection, DEAE-Dextran mediated transfection, lipofection, or
electroporation.
[0444] Engineered host cells can be cultured in conventional
nutrient media modified as appropriate for activating promoters,
selecting transformants or amplifying the genes of the invention.
Following transformation of a suitable host strain and growth of
the host strain to an appropriate cell density, the selected
promoter may be induced by appropriate means (e.g. temperature
shift or chemical induction) and the cells may be cultured for an
additional period to allow them to produce the desired polypeptide
or fragment thereof.
[0445] Cells can be harvested by centrifugation, disrupted by
physical or chemical means, and the resulting crude extract is
retained for further purification. Microbial cells employed for
expression of proteins can be disrupted by any convenient method,
including freeze-thaw cycling, sonication, mechanical disruption,
or use of cell lysing agents. Such methods are well known to those
skilled in the art. The expressed polypeptide or fragment can be
recovered and purified from recombinant cell cultures by methods
including ammonium sulfate or ethanol precipitation, acid
extraction, anion or cation exchange chromatography,
phosphocellulose chromatography, hydrophobic interaction
chromatography, affinity chromatography, hydroxylapatite
chromatography and lectin chromatography. Protein refolding steps
can be used, as necessary, in completing configuration of the
polypeptide. If desired, high performance liquid chromatography
(HPLC) can be employed for final purification steps.
[0446] Various mammalian cell culture systems can also be employed
to express recombinant protein. Examples of mammalian expression
systems include the COS-7 lines of monkey kidney fibroblasts and
other cell lines capable of expressing proteins from a compatible
vector, such as the C127, 3T3, CHO, HeLa and BHK cell lines.
[0447] The constructs in host cells can be used in a conventional
manner to produce the gene product encoded by the recombinant
sequence. Depending upon the host employed in a recombinant
production procedure, the polypeptides produced by host cells
containing the vector may be glycosylated or may be
non-glycosylated. Polypeptides of the invention may or may not also
include an initial methionine amino acid residue.
[0448] Cell-free translation systems can also be employed to
produce a polypeptide of the invention. Cell-free translation
systems can use mRNAs transcribed from a DNA construct comprising a
promoter operably linked to a nucleic acid encoding the polypeptide
or fragment thereof. In some aspects, the DNA construct may be
linearized prior to conducting an in vitro transcription reaction.
The transcribed mRNA is then incubated with an appropriate
cell-free translation extract, such as a rabbit reticulocyte
extract, to produce the desired polypeptide or fragment
thereof.
[0449] The expression vectors can contain one or more selectable
marker genes to provide a phenotypic trait for selection of
transformed host cells such as dihydrofolate reductase or neomycin
resistance for eukaryotic cell culture, or such as tetracycline or
ampicillin resistance in E. coli.
[0450] For transient expression in mammalian cells, cDNA encoding a
polypeptide of interest may be incorporated into a mammalian
expression vector, e.g. pcDNA1, which is available commercially
from Invitrogen Corporation (San Diego, Calif., U.S.A.; catalogue
number V490-20). This is a multifunctional 4.2 kb plasmid vector
designed for cDNA expression in eukaryotic systems, and cDNA
analysis in prokaryotes, incorporated on the vector are the CMV
promoter and enhancer, splice segment and polyadenylation signal,
an SV40 and Polyoma virus origin of replication, and M13 origin to
rescue single strand DNA for sequencing and mutagenesis, Sp6 and T7
RNA promoters for the production of sense and anti-sense RNA
transcripts and a Col E1-like high copy plasmid origin. A
polylinker is located appropriately downstream of the CMV promoter
(and 3' of the T7 promoter).
[0451] The cDNA insert may be first released from the above
phagemid incorporated at appropriate restriction sites in the
pcDNAI polylinker. Sequencing across the junctions may be performed
to confirm proper insert orientation in pcDNAI. The resulting
plasmid may then be introduced for transient expression into a
selected mammalian cell host, for example, the monkey-derived,
fibroblast like cells of the COS-1 lineage (available from the
American Type Culture Collection, Rockville, Md. as ATCC CRL
1650).
[0452] For transient expression of the protein-encoding DNA, for
example, COS-1 cells may be transfected with approximately 8 .mu.g
DNA per 10.sup.6 COS cells, by DEAE-mediated DNA transfection and
treated with chloroquine according to the procedures described by
Sambrook et al, Molecular Cloning: A Laboratory Manual, 1989, Cold
Spring Harbor Laboratory Press, Cold Spring Harbor N.Y., pp.
16.30-16.37. An exemplary method is as follows. Briefly, COS-1
cells are plated at a density of 5.times.10.sup.6 cells/dish and
then grown for 24 hours in FBS-supplemented DMEM/F12 medium. Medium
is then removed and cells are washed in PBS and then in medium. A
transfection solution containing DEAE dextran (0.4 mg/ml), 100
.mu.M chloroquine, 10% NuSerum, DNA (0.4 mg/ml) in DMEM/F12 medium
is then applied on the cells 10 ml volume. After incubation for 3
hours at 37.degree. C., cells are washed in PBS and medium as just
described and then shocked for 1 minute with 10% DMSO in DMEM/F12
medium. Cells are allowed to grow for 2-3 days in 10%
FBS-supplemented medium, and at the end of incubation dishes are
placed on ice, washed with ice cold PBS and then removed by
scraping. Cells are then harvested by centrifugation at 1000 rpm
for 10 minutes and the cellular pellet is frozen in liquid
nitrogen, for subsequent use in protein expression. Northern blot
analysis of a thawed aliquot of frozen cells may be used to confirm
expression of receptor-encoding cDNA in cells under storage.
[0453] In a like manner, stably transfected cell lines can also
prepared, for example, using two different cell types as host: CHO
K1 and CHO Pro5. To construct these cell lines, cDNA coding for the
relevant protein may be incorporated into the mammalian expression
vector pRC/CMV (Invitrogen), which enables stable expression.
Insertion at this site places the cDNA under the expression control
of the cytomegalovirus promoter and upstream of the polyadenylation
site and terminator of the bovine growth hormone gene, and into a
vector background comprising the neomycin resistance gene (driven
by the SV40 early promoter) as selectable marker.
[0454] An exemplary protocol to introduce plasmids constructed as
described above is as follows. The host CHO cells are first seeded
at a density of 5.times.10.sup.5 in 10% FBS-supplemented MEM
medium. After growth for 24 hours, fresh medium is added to the
plates and three hours later, the cells are transfected using the
calcium phosphate-DNA co-precipitation procedure (Sambrook et al,
supra). Briefly, 3 .mu.g of DNA is mixed and incubated with
buffered calcium solution for 10 minutes at room temperature. An
equal volume of buffered phosphate solution is added and the
suspension is incubated for 15 minutes at room temperature. Next,
the incubated suspension is applied to the cells for 4 hours,
removed and cells were shocked with medium containing 15% glycerol.
Three minutes later, cells are washed with medium and incubated for
24 hours at normal growth conditions. Cells resistant to neomycin
are selected in 10% FBS-supplemented alpha-MEM medium containing
G418 (1 mg/ml). Individual colonies of G418-resistant cells are
isolated about 2-3 weeks later, clonally selected and then
propagated for assay purposes.
EXAMPLES
[0455] A number of examples illustrative of the present invention
are described below. In most cases, alternative techniques could
also be used. The examples are intended to be illustrative and are
not limiting or restrictive to the scope of the invention. Unless
specifically noted to the contrary, in cases where a compound
number is not preceded by a "P-" (e.g., "P-0001") in the Examples
section, compound naming and/or enumeration is not related to
naming and/or enumeration employed in other sections of this
application. Similarly, structure and substituent naming and
enumeration within the Examples are independent of structure and
substituent naming and enumeration in above sections of this
application unless clearly indicated otherwise.
Example 1
Synthesis of Compound of Formula I, where X.sub.1, X.sub.2, Y.sub.1
and Y.sub.2 are CH and L.sup.1 is --CH.sub.2--
[0456] Compounds of Formula I where X.sub.1, X.sub.2, Y.sub.1 and
Y.sub.2 are CH and L.sup.1 is --CH.sub.2-- or --CO--may be
synthesized from 7-azaindole according to one of the following
Schemes 1-3, where R.sup.24 is consistent with Ar.sub.1, which can
be further substituted to provide compounds where R.sup.24 is
Ar.sub.1-L.sup.2-R.sup.1 as described for Formula I.
##STR00020##
Step-1--Synthesis of Compound 2
[0457] Compound 2 is synthesized from commercially available
7-azaindole following the literature procedure (Robinson, J. Am.
Chem. Soc., 1955, 77, p. 457).
Step-2--Synthesis of Compound of Formula II
[0458] Compound of Formula II is synthesized by deprotonation using
base (e.g. BuLi, NaH) in aprotic solvent like tetrahydrofuran or
ether and reacting the anion with a silyl chloride (e.g. TIPS) or
an anhydride (e.g. Boc anhydride). The compound is isolated by
following standard procedure (quenching with ice-cold brine, work
up, and purification by flash silica gel chromatography).
Steps-3 and 4--Synthesis of Compound of Formula 1
[0459] Compounds of Formula I, wherein R.sup.24 is Ar.sub.1 as
defined in Formula I, is synthesized through the reaction of
compounds of Formula II with isopropyl chloroformate (or ethyl
chloroformate) at room temperature in toluene to give a
3-chloromethyl intermediate. This intermediate is cooled to
-78.degree. C. and immediately reacted with an organocopper
reagent, which is generated from the reaction between a Grignard
reagent (or organolithium reagent) and a solution of copper cyanide
and LiCl. The mixture is stirred at -78.degree. C. for one hour and
allowed to warm to room temperature. The reaction is quenched with
a solution of 4:1 ammonium chloride:ammonium hydroxide. The
reaction is worked up in the usual manner and purified by flash
silica gel chromatography to give the nitrogen-protected compound.
The final compound can be realized through the deprotection of the
protecting group (Boc, TIPS) using standard conditions (TFA or
NH.sub.4F) at room temperature.
##STR00021##
Step-1--Synthesis of Compound 3
[0460] Compound 3 is synthesized by reacting commercially available
7-azaindole, compound 1, with hexamethyltetramine and acetic acid
in water with heating to reflux for two hours. After cooling, the
desired compound is precipitated and collected by filtration.
Step-2--Synthesis of Compound of Formula III
[0461] Compound of Formula III, where P is a protecting group, is
synthesized by reacting compound 3 with an appropriate reagent to
introduce a protecting group (e.g. tert-butyloxycarbonyl di
anhydride) and a base (e.g. sodium hydride) in an appropriate
solvent (e.g. tetrahydrofuran) typically at room temperature for
12-18 hours. The compound can be isolated by conventional means
(e.g. extraction).
Step-3--Synthesis of Compound of Formula IV
[0462] Compound of Formula IV, wherein R.sup.24 is Ar.sub.1, is
synthesized by reacting compound of Formula III in an appropriate
solvent (e.g. 1,2-dimethoxyethane) with a Grignard reagent of the
formula R.sup.24MgCl or R.sup.24MgBr (e.g. pyridinyl magnesium
bromide) or an equivalent nucleophile in an appropriate solvent
(e.g. tetrahydrofuran) under inert atmosphere cooled typically to
-10.degree. C. The reaction is typically allowed to warm to room
temperature and stirred for 12-18 hours. The desired compound is
purified by reverse phase high pressure liquid chromatography.
Steps-4 and 5--Synthesis of an Intermediate of Compound of Formula
I
[0463] An intermediate of compound of Formula I is synthesized by
reacting compound of Formula IV with a reducing agent (e.g. sodium
borohydride) in a polar solvent (e.g. ethanol) typically with
heating to 80.degree. C. for 1-4 hours. The reaction is quenched
with the addition of methanol and concentrated and purified by
reverse phase high performance liquid chromatography. Compound of
Formula I where R.sup.24 is Ar.sub.1 is synthesized by reacting
this intermediate with an appropriate reagent to remove the
protecting group, P, (e.g. hydrochloric acid) in an apolar solvent
(e.g. dioxane). The final compound is isolated by standard
procedures (e.g. reverse phase preparative high pressure liquid
chromatography).
##STR00022##
Step-1--Synthesis of Compound of Formula I'
[0464] Compound of Formula I' where R.sup.24 is Ar.sub.1, is
synthesized by reacting compound 1 with an activating agent (e.g.
methyl magnesium bromide and zinc dichloride or anhydrous aluminum
chloride) and a heteroaryl acid chloride (e.g. nicotinic acid
chloride) in a non-reactive solvent (e.g. dichloromethane), under
inert atmosphere (e.g. argon), at room temperature or with heating
up to reflux for 18-24 hours. The compound is isolated by standard
procedures (e.g. extraction and silica-gel chromatography).
Example 2
Synthesis of intermediate
3-(6-Chloro-pyridin-3-ylmethyl)-1-triisopropylsilanyl-1H-pyrrolo[2,3-b]py-
ridine (6) and
(3-(6-Bromo-pyridin-3-ylmethyl)-1-triisopropylsilanyl-1H-pyrrolo[2,3-b]py-
ridine) (6a)
[0465] Compound 6, an intermediate to compounds of Formula I where
X.sub.1, X.sub.2, Y.sub.1 and Y.sub.2 are CH, n is 1, P, Q and T
are CH and L.sup.1 is --CH.sub.2--, may be synthesized in four
steps from 7-azaindole according to the following Scheme 4.
##STR00023##
Step-1--Synthesis of
dimethyl-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-amine (2)
[0466] Into a 3-neck round bottom flask was added Isopropyl alcohol
(320.0 mL) followed by the addition of 1H-pyrrolo[2,3-b]pyridine 1
(7.10 g, 60.1 mmol), dimethylamine hydrochloride (5.4 g, 0.066
mol), and formaldehyde (2.0 g, 0.066 mol). The reaction mixture was
stirred at room temperature for 12 hours, and then refluxed for 30
minutes. The suspension solution was evaporated to dryness in
vacuo. To the residue was added water (60.0 mL, 3.33 mol) and
concentrated hydrochloric acid (6.0 mL, 0.20 mol). The water layer
was extracted with ether and the aqueous layer was neutralized with
potassium carbonate. The aqueous layer was extracted with
dichloromethane, dried over sodium sulfate and concentrated to give
the compound, which was then further washed with ether and dried to
afford compound 2 (7.1 g, yield=67.4%), as a white solid.
Step-2--Synthesis of
dimethyl-(1-triisopropylsilanyl-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-amin-
e (4)
[0467] Into a round bottom flask 7-Azagramine 2 (5.38 g, 30.7
mmol), N,N-dimethylformamide (25.0 mL), and sodium hydride (1.35 g,
33.8 mol) were combined. Into the reaction was added
triisopropylsilyl chloride (6.8 mL, 0.032 mol). The reaction was
stirred at 20.degree. C. for 12 hours. The reaction mixture was
poured into water and extracted with ethyl acetate. The organic
layer was washed with brine, dried over sodium sulfate,
concentrated and purified with biotage to give compound 4 (6.0 g,
yield=58.8%) as a colorless oil.
Step-3--Synthesis of
3-chloromethyl-1-triisopropylsilanyl-1H-pyrrolo[2,3-b]pyridine
(5)
[0468] Into a round bottom flask was added compound 4 (500.0 mg,
1.51 mmol) and toluene (5.0 mL, 0.047 mol) under an atmosphere of
nitrogen. Into the reaction mixture 1.0 M isopropyl chloroformate
in toluene (1.6 mL) was added slowly at room temperature. The
reaction mixture was stirred for another 2 hours to give desired
compound 5 used for next step without purification.
Step-4--Synthesis of
3-(6-Chloro-pyridin-3-ylmethyl)-1-triisopropylsilanyl-1H-pyrrolo[2,3-b]py-
ridine (6)
[0469] Into a round bottom flask was added 5-iodo-2-chloro-pyridine
(315.0 mg, 1.32 mmol) and tetrahydrofuran (12.0 mL, 0.15 mol) at
-40.degree. C. under an atmosphere of nitrogen. Into the reaction
2.0 M of isopropylmagnesium chloride in tetrahydrofuran (0.72 mL,
1.44 mmol) was added. The reaction mixture was stirred for 40
minutes at -40.degree. C. TLC (hexane/ethyl acetate 2:1) indicated
no starting material. Into the reaction mixture 0.6 M of CuCN.2LiCl
in tetrahydrofuran (2.4 mL, 1.44 mmol) was added. The reaction
mixture was allowed to come to room temperature for 5 minutes and
trimethyl phosphite (0.29 mL, 2.4 mmol) was added. After 10
minutes, this solution was added into a round bottom flask
containing compound 5 (315.0 mg) and toluene (8.0 mL). The reaction
was stirred at 20.degree. C. for 40 hours. The reaction mixture was
poured into water and the compound extracted with ethyl acetate.
The organic layer was washed with brine, dried over sodium sulfate,
concentrated and purified with biotage (dichloromethane/methanol
1:10) to give compound 6 (230 mg, yield=59.0%) as a white solid.
Compound 6a
(3-(6-Bromo-pyridin-3-ylmethyl)-1-triisopropylsilanyl-1H-pyrrolo[2,3-b]py-
ridine) (MS (ESI) [M+H.sup.+].sup.+=288.1, 290.1) was prepared
substituting 5-iodo-2-chloro-pyridine with 5-iodo-2-bromo-pyridine
in Step 4, with reaction conditions and work up procedure the same
as that for the synthesis of compound 6.
Example 3
Synthesis of intermediate
(6-Chloro-pyridin-3-yl)-(1H-pyrrolo[2,3-b]pyridin-3-yl)-methanone
(7)
[0470] Compound 7, an intermediate to compounds of Formula I where
X.sub.1, X.sub.2, Y.sub.1 and Y.sub.2 are CH, n is 1, P, Q and T
are CH and L.sup.1 is --CO--, may be synthesized in one step from
7-azaindole according to the following Scheme 5.
##STR00024##
[0471] Into a round bottom flask was added aluminum trichloride
(16.0 g, 0.12 mol) and dichloromethane (100.0 mL) under an
atmosphere of nitrogen. Into the reaction mixture
1H-Pyrrolo[2,3-b]pyridine 1 (3.2 g, 0.027 mol) in dichloromethane
(20.0 mL) was added. The reaction was stirred at room temperature
for 70.0 minutes and 6-Chloropyridine-3-carbonyl chloride 8 (5.4 g,
0.031 mol) in dichloromethane (10.0 mL) was added. The reaction
mixture was stirred at room temperature for 3 hours. Methanol (10
mL) was added to the reaction mixture and the solvent was
evaporated in vacuo. The residue was poured into water and the
precipitated compound was removed by filtration. The aqueous layer
was extracted with ethyl acetate and the organic layer was dried
and concentrated and combined with the solid isolated by filtration
to give 7 (6.2 g, yield=88.6%) as a white solid. MS (ESI)
[M+H.sup.+].sup.+=258.
Example 4
Synthesis of
benzyl-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-amine
(P-0001)
[0472]
Benzyl-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-amine
(P-0001) was prepared in two steps from
3-(6-Chloro-pyridin-3-ylmethyl)-1-triisopropylsilanyl-1H-pyrrolo[2,3-b]py-
ridine (6) according to Scheme 6.
##STR00025##
Step-1--Synthesis of
benzyl-[5-(1-triisopropylsilanyl-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyr-
idin-2-yl]-amine (10)
[0473] Into a round bottom flask was added
3-(6-Chloro-pyridin-3-ylmethyl)-1-triisopropylsilanyl-1H-pyrrolo[2,3-b]py-
ridine 6 (160.0 mg, 0.40 mmol, prepared as described in Example 2),
benzylamine (32, 0.1 mL, 0.90 mmol), palladium acetate (17.0 mg,
0.076 mmol), toluene (10.0 mL), potassium tert-butoxide (80.0 mg,
0.71 mmol) and 2-(di-t-butylphosphino)biphenyl (31.4 mg, 0.11 mmol)
under an atmosphere of nitrogen. The reaction was stirred under
reflux for 3 hours. TLC and MS indicated no starting material. The
reaction mixture was poured into water and extracted with ethyl
acetate. The organic layer was washed with brine, dried over sodium
sulfate, concentrated and purified with biotage
(dichloromethane/methanol 1:20) to give compound 10 (110 mg,
yield=58.5%) as a white solid. MS (ESI) [M+H.sup.+].sup.+=471.
Step-2--Synthesis of
benzyl-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-amine
(P-0001)
[0474] Into a round bottom flask was added
benzyl-[5-(1-triisopropylsilanyl-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyr-
idin-2-yl]-amine 10 (400.0 mg, 0.85 mmol), tetrahydrofuran (20.0
mL) and tetra-n-butylammonium fluoride (240 mg, 0.93 mmol). The
reaction mixture was stirred at 20.degree. C. for 30 minutes. TLC
indicated no starting material. The reaction mixture was poured
into water and extracted with ethyl acetate. The organic layer was
washed with brine, dried over sodium sulfate, concentrated and
purified with biotage (dichloromethane/methanol 1:10) to give
compound P-0001 (220 mg, Yield=82.4%) as a white solid. MS (ESI)
[M+H.sup.+].sup.+=315.
[0475] Additional compounds were prepared following the protocol of
Scheme 6, substituting benzyl amine with a suitable amine in Step
1, and using either
3-(6-Chloro-pyridin-3-ylmethyl)-1-triisopropylsilanyl-1H-pyrrolo[2-
,3-b]pyridine 6 or
3-(6-Bromo-pyridin-3-ylmethyl)-1-triisopropylsilanyl-1H-pyrrolo[2,3-b]pyr-
idine 6a, in Step 1. The following compounds were made following
this procedure: [0476]
Dimethyl-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-amine
(P-0021), [0477]
(4-methoxy-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-
-amine (P-0004), [0478]
(4-chloro-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]--
amine (P-0005), [0479]
(4-fluoro-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]--
amine (P-0006), [0480]
(4-methyl-benzyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]--
amine (P-0007), and [0481]
[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-thiophen-2-ylmethy-
l-amine (P-0008). The following table indicates the amine used in
Step 1 in place of benzyl amine in Column 2, and whether
3-(6-Chloro-pyridin-3-ylmethyl)-1-triisopropylsilanyl-1H-pyrrolo[2,3-b]py-
ridine or
3-(6-Bromo-pyridin-3-ylmethyl)-1-triisopropylsilanyl-1H-pyrrolo[-
2,3-b]pyridine was used in Step 1 in Column 3 (Cl or Br,
respectively), with the compound structure in Column 4,
experimental mass spectrometry result in Column 5, and compound
number in Column 1.
TABLE-US-00001 [0481] MS(ESI) Starting [M + H.sup.+].sup.+
azaindole Amine Compound observed P-0021 Cl ##STR00026##
##STR00027## 253 P-0004 Br ##STR00028## ##STR00029## 344.4 P-0005
Br ##STR00030## ##STR00031## 348.8 P-0006 Br ##STR00032##
##STR00033## 332.4 P-0007 Br ##STR00034## ##STR00035## 328.4 P-0008
Br ##STR00036## ##STR00037## 330.4
Example 5
Synthesis of
(6-Benzylamino-pyridin-3-yl)-(1H-pyrrolo[2,3-b]pyridin-3-yl)-methanone
(P-0002)
[0482]
(6-Benzylamino-pyridin-3-yl)-(1H-pyrrolo[2,3-b]pyridin-3-yl)-methan-
one (P-0002) was prepared in one step from
(6-Chloro-pyridin-3-yl)-(1H-pyrrolo[2,3-b]pyridin-3-yl)-methanone
(7) according to Scheme 7.
##STR00038##
[0483] Into a pressure tube was added
(6-Chloro-pyridin-3-yl)-(1H-pyrrolo[2,3-b]pyridin-3-yl)-methanone 7
(270.0 mg, 1.05 mmol, prepared as described in Example 3), and
benzylamine (32, 0.7 mL, 0.006 mol) and tetrahydrofuran (25.0 mL)
under an atmosphere of nitrogen. The reaction mixture was heated to
185.degree. C. for 60 hours. The reaction mixture was concentrated
to remove most of the solvent and the residue was poured into water
and extracted with ethyl acetate. The organic layer was dried over
sodium sulfate, concentrated and purified with biotage
(dichloromethane/methanol 1:20) to give compound P-0002 (30 mg,
yield=8.7%) as a white solid. MS (ESI) [M+H.sup.+].sup.+=329.
[0484] Additional compounds were prepared following the protocol of
Scheme 7, replacing benzylamine with a suitable amine. The
following compounds were made following this procedure: [0485]
[6-(4-Fluoro-benzylamino)-pyridin-3-yl]-(1H-pyrrolo[2,3-b]pyridin-3-yl)-m-
ethanone (P-0015), [0486]
[6-(3-Fluoro-benzylamino)-pyridin-3-yl]-(1H-pyrrolo[2,3-b]pyridin-3-yl)-m-
ethanone (P-0016), [0487]
(1H-Pyrrolo[2,3-b]pyridin-3-yl)-[6-(4-trifluoromethyl-benzylamino)-pyridi-
n-3-yl]-methanone (P-0017), [0488]
(1H-Pyrrolo[2,3-b]pyridin-3-yl)-{6-[(thiophen-2-ylmethyl)-amino]-pyridin--
3-yl}-methanone (P-0018), [0489]
(6-Phenylamino-pyridin-3-yl)-(1H-pyrrolo[2,3-b]pyridin-3-yl)-methanone
(P-0023), [0490]
(6-Isopropylamino-pyridin-3-yl)-(1H-pyrrolo[2,3-b]pyridin-3-yl)-methanone
(P-0024), [0491]
(6-Isobutylamino-pyridin-3-yl)-(1H-pyrrolo[2,3-b]pyridin-3-yl)-methanone
(P-0025), [0492]
[6-(3-Benzyloxy-phenylamino)-pyridin-3-yl]-(1H-pyrrolo[2,3-b]pyridin-3-yl-
)-methanone (P-0026), [0493]
[6-(Cyclopropylmethyl-amino)-pyridin-3-yl]-(1H-pyrrolo[2,3-b]pyridin-3-yl-
)-methanone (P-0030), [0494]
[6-(Cyclohexylmethyl-amino)-pyridin-3-yl]-(1H-pyrrolo[2,3-b]pyridin-3-yl)-
-methanone (P-0031), The following table indicates the amine
substituted in place of benzylamine in column 2, to provide these
compounds, shown by structure in column 3. Column 1 provides the
compound number and column 4 gives the experimental mass
spectrometry result.
TABLE-US-00002 [0494] MS(ESI) [M + H.sup.+].sup.+ Amine Compound
observed P-0015 ##STR00039## ##STR00040## 347.0 P-0016 ##STR00041##
##STR00042## 347.1 P-0017 ##STR00043## ##STR00044## 396.9 P-0018
##STR00045## ##STR00046## 335.0 P-0023 ##STR00047## ##STR00048##
315.1 P-0024 ##STR00049## ##STR00050## 279 [M - H.sup.+].sup.-
P-0025 ##STR00051## ##STR00052## 293 [M - H.sup.+].sup.- P-0026
##STR00053## ##STR00054## 419 [M - H.sup.+].sup.- P-0030
##STR00055## ##STR00056## 293.1 P-0031 ##STR00057## ##STR00058##
335.2
Example 6
Synthesis of
Isobutyl-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-amine
P-0028
[0495] Compound P-0028 was synthesized in 1 step from
6-Isobutylamino-pyridin-3-yl)-(1H-pyrrolo[2,3-b]pyridin-3-yl)-methanone
P-0025 as shown in Scheme 8.
##STR00059##
Step-1--Synthesis of
Isobutyl-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-amine
(P-0028)
[0496] To
(6-Isobutylamino-pyridin-3-yl)-(1H-pyrrolo[2,3-b]pyridin-3-yl)-m-
ethanone (P-0025, 60.0 mg, 0.20 mmol, prepared as described in
Example 5) in 1,2-ethanediol (5.0 mL) was added hydrazine (1.0 mL,
0.032 mol) and potassium hydroxide (200.0 mg, 3.56 mmol). The
reaction mixture was heated to 180.degree. C. overnight. The
reaction mixture was poured into water and extracted with ethyl
acetate. The organic layer was washed with brine, dried over sodium
sulfate, concentrated and purified by silica gel column
chromatography eluting with 10% methanol in dichloromethane to give
compound (P-0028, 10 mg, 16.7%). MS (ESI)
[M+H.sup.+].sup.+=281.
Cyclopropylmethyl-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-a-
mine (P-0032)
##STR00060##
[0497] was prepared following the protocol of Scheme 8,
substituting
(6-Isobutylamino-pyridin-3-yl)-(1H-pyrrolo[2,3-b]pyridin-3-yl)-methanone
P-0025 with
[6-(Cyclopropylmethyl-amino)-pyridin-3-yl]-(1H-pyrrolo[2,3-b]pyridin-3-yl-
)-methanone P-0030 (prepared as described in Example 5). MS (ESI)
[M+H.sup.+].sup.+=279.
Cyclohexylmethyl-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-am-
ine (P-0033)
##STR00061##
[0498] was prepared following the protocol of Scheme 8,
substituting
(6-Isobutylamino-pyridin-3-yl)-(1H-pyrrolo[2,3-b]pyridin-3-yl)-methanone
P-0025 with
[6-(Cyclohexylmethyl-amino)-pyridin-3-yl]-(1H-pyrrolo[2,3-b]pyridin-3-yl)-
-methanone P-0031, (prepared as described in Example 5). MS (ESI)
[M+H.sup.+].sup.+=321.
Example 7
3-(6-Isopropyl-pyridin-3-ylmethyl)-1H-pyrrolo[2,3-b]pyridine
P-0019
[0499] 3-(6-Isopropyl-pyridin-3-ylmethyl)-1H-pyrrolo[2,3-b]pyridine
P-0019 was synthesized in 2 steps from
3-(6-Chloro-pyridin-3-ylmethyl)-1-triisopropylsilanyl-1H-pyrrolo[2,3-b]py-
ridine 6 as shown in Scheme 9.
##STR00062##
Step-1--Synthesis of
3-(6-Isopropyl-pyridin-3-ylmethyl)-1-triisopropylsilanyl-1H-pyrrolo[2,3-b-
]pyridine (39)
[0500] To
3-(6-Chloro-pyridin-3-ylmethyl)-1-triisopropylsilanyl-1H-pyrrolo-
[2,3-b]pyridine (6, 54.0 mg, 0.000135 mol, prepared as described in
Example 2) in Tetrahydrofuran (4.0 mL) were added
[1,1'-bis(diphenylphosphino)ferrocene]-dichloropalladium(II) (23.0
mg) and Isopropylmagnesium Chloride (0.15 mL, 2.0 M in
Tetrahydrofuran). The reaction was stirred at 20.degree. C. under
an atmosphere of Nitrogen for 3 hours. The reaction mixture was
poured into water and extracted with ethyl acetate. The organic
layer was washed with brine, dried over sodium sulfate,
concentrated and purified by silica gel column chromatography
eluting with 10% methanol in dichloromethane to give compound 39
(38 mg, 70.4%).
Step-2--Synthesis of
3-(6-Isopropyl-pyridin-3-ylmethyl)-1H-pyrrolo[2,3-b]pyridine
(P-0019)
[0501] To
3-(6-Isopropyl-pyridin-3-ylmethyl)-1-triisopropylsilanyl-1H-pyrr-
olo[2,3-b]pyridine (39, 35.0 mg, 0.086 mmol) in tetrahydrofuran
(3.0 mL) was added tetra-n-butylammonium fluoride (29 mg, 0.11
mmol). The reaction was stirred at 20.degree. C. for 30 minutes.
The reaction mixture was poured into water and extracted with ethyl
acetate. The organic layer was washed with brine, dried over sodium
sulfate, concentrated and purified by silica gel column
chromatography eluting with 10% methanol in dichloromethane to give
compound (P-0019, 18.0 mg, 81.9%). MS (ESI)
[M+H.sup.+].sup.+=252.
Example 8
Synthesis of
[5-(1H-Pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(4-trifluoromethyl-
-benzyl)-amine (P-0003)
[0502]
[5-(1H-Pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(4-trifluoro-
methyl-benzyl)-amine (P-0003) was prepared in three steps from
(6-Chloro-pyridin-3-yl)-(1H-pyrrolo[2,3-b]pyridin-3-yl)-methanone
(7) according to Scheme 10.
##STR00063##
Step-1--Synthesis of
(1H-Pyrrolo[2,3-b]pyridin-3-yl)-[6-(4-trifluoromethyl-benzylamino)-pyridi-
n-3-yl]-methanone (P-0017)
[0503] Into a pressure flask was added
(6-Chloro-pyridin-3-yl)-(1H-pyrrolo[2,3-b]pyridin-3-yl)-methanone 7
(3.5 g, 0.014 mol, prepared as described in Example 3),
4-(trifluoromethyl)benzylamine (30, 9.0 g, 0.051 mol),
tetrahydrofuran (30.0 mL, 0.37 mol), palladium acetate (200.0 mg,
0.890 mmol) and 2-(di-t-butylphosphino)biphenyl (200.0 mg, 0.67
mmol). The reaction mixture was stirred at 180.degree. C.
overnight, poured into water and extracted with ethyl acetate. The
organic layer was washed with brine, dried over sodium sulfate and
concentrated. To the residue was added acetic acid (15.0 mL) and
H.sub.2O (5.0 mL). The reaction mixture was stirred at 100.degree.
C. for 5 hours and concentrated to remove the acetic acid. The
residue was then treated with aqueous Na.sub.2HCO.sub.3 and
extracted with ethyl acetate. The organic layer was washed, dried,
concentrated and purified to give compound P-0017 (1.0 g,
yield=18.5%) as a light yellow solid. MS (ESI)
[M+H.sup.+].sup.+=397.
Step-2--Synthesis of
(1H-Pyrrolo[2,3-b]pyridin-3-yl)-[6-(4-trifluoromethyl-benzylamino)-pyridi-
n-3-yl]-methanol (14)
[0504] Into a round bottom flask was added
(1H-Pyrrolo[2,3-b]pyridin-3-yl)-[6-(4-trifluoromethyl-benzylamino)-pyridi-
n-3-yl]-methanone P-0017 (210.0 mg, 0.53 mmol) and sodium
tetrahydroborate (80.0 mg, 2.11 mmol), dissolved in
N,N-dimethylformamide (5.0 mL) and ethanol (20.0 mL). The reaction
was stirred at room temperature overnight, poured into water and
extracted with ethyl acetate. The organic layer was washed with
brine, dried over sodium sulfate, concentrated and purified with
biotage (dichloromethane/methanol 1:20) to give compound 14 (63 mg,
yield=30%) as a white solid. MS (ESI) [M+H.sup.+].sup.+=399.
Step-3--Synthesis of
[5-(1H-Pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(4-trifluoromethyl-
-benzyl)-amine (P-0003)
[0505] Into a round bottom flask was added
(1H-Pyrrolo[2,3-b]pyridin-3-yl)-[6-(4-trifluoromethyl-benzylamino)-pyridi-
n-3-yl]-methanol 14 (200.0 mg, 0.50 mmol), trifluoroacetic acid
(5.0 mL, 0.065 mol) and triethylsilane (3.0 mL, 0.019 mol). The
reaction was stirred at room temperature for 30 min, poured into
aqueous sodium bicarbonate, and extracted with ethyl acetate. The
organic layer was washed with brine, dried over sodium sulfate,
concentrated and purified to give pure compound P-0003 (120.0 mg,
yield=62.8%) as a white solid. MS (ESI) [M+H.sup.+].sup.+=383.
Example 9
Synthesis of Compounds of Formula I where n is 1, P, Q and T are CH
X.sub.1, X.sub.2 and Y.sub.2 are CH, Y.sub.1 is CR.sup.4, L.sup.1
is --CH2-, L.sup.2 is --NHCH.sub.2--, and R.sup.1 is 4 Substituted
Phenyl (Formula Ic)
[0506] Compounds of Formula Ic, where R.sup.4 is as defined for
Formula I and Z is a substituent as defined for optionally
substituted aryl, can be synthesized in five Steps from
2-amino-5-bromopyridines as shown in the following general Scheme
11.
##STR00064##
Step-1--Preparation of Compounds of Formula V
[0507] To a solution of an appropriately substituted benzaldehyde
(e.g. p-trifluoromethyl benzaldehyde) in a non-reactive solvent
(e.g. tetrahydrofuran) is added an appropriate
2-amino-5-bromo-pyridine 15, followed by appropriate reagents to
effect the reduction (e.g. dibutyltin dichloride and phenylsilane).
Typically the reaction is heated (e.g. 50.degree. C.) overnight.
The solvent is removed at reduced pressure after heating to
50.degree. C. overnight. Isolation by conventional means (e.g.
extraction) affords compounds of Formula V.
Step-2--Preparation of Compounds of Formula VI
[0508] Compound of Formula V is dissolved in a non-reactive solvent
(e.g. tetrahydrofuran) and typically cooled at -78.degree. C. under
an inert atmosphere. To this mixture is added an organo lithium
reagent (e.g. methyl lithium). The reaction mixture is typically
stirred at -78.degree. C. for several hours. To this mixture is
added an organo lithium reagent (e.g. tert-butyl lithium), and the
mixture is stirred for several hours. The reaction mixture is
maintained at -78.degree. C., and an appropriate formylating
reagent (e.g. 1-piperidine carboxaldehyde) is added. Typically, the
reaction is allowed to stir at -78.degree. C. for an additional
several hours and slowly warmed to room temperature. Isolation by
conventional means (e.g. extraction) affords compounds of Formula
VI.
Step-3--Preparation of Compounds of Formula VII
[0509] Compound of Formula VI is dissolved in a non-reactive
solvent (e.g. tetrahydrofuran) and stirred under an inert
atmosphere. To this solution is added a base (e.g. triethylamine)
and typically a catalyst (e.g. 4-dimethylaminopyridine). Typically,
the mixture is stirred for a few minutes and then a reagent
appropriate for the introduction of a protecting group (e.g.
di-tert-butyldicarbonate) is added. Typically, the reaction is
stirred overnight. Isolation by conventional means (e.g.
extraction) affords compounds of Formula VII.
Step-4--Preparation of Compounds of Formula VIII and IX
[0510] 4-Substituted 1H-pyrrolo[2,3-b]pyridine XXX is added to a
stirring solution of base (e.g. potassium hydroxide) in an
appropriate polar protic solvent (e.g. methanol). Compound of
Formula VII is added, and the mixture is typically stirred at room
temperature for several days. The solvent is evaporated, and 1 M
HCl is added to the residue. Isolation by conventional means (e.g.
extraction, silica gel chromatography) affords compounds of Formula
VIII and IX.
Step-5--Preparation of Compounds of Formula Ic
[0511] Typically, compounds of Formula VIII and IX is combined and
dissolved in an appropriate polar aprotic solvent (e.g.
acetonitrile). Reagents appropriate to effect the reduction (e.g.
triethylsilane and trifluoroacetic acid) are added. Typically, the
reactions are stirred at room temperature for several days.
Isolation by conventional means (e.g. extraction, silica gel
chromatography) affords compounds of Formula Ic.
Example 10
Synthesis of
[5-(4-Methoxy-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(4-trifl-
uoromethyl-benzyl)-amine (P-0011)
##STR00065##
[0513]
[5-(4-Methoxy-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(4-
-trifluoromethyl-benzyl)-amine P-0011 was synthesized as shown in
Scheme 12:
##STR00066## ##STR00067##
Step 1: Preparation of
(5-Bromo-pyridin-2-yl)-(4-trifluoromethyl-benzyl)-amine (17)
[0514] Into a round bottom flask fitted with stirrer and reflux
condenser was added 2-amino-5-bromopyridine (15, 1.73 mol, 300 g)
and p-trifluoromethylbenzaldehyde (16, 1.723 mol, 300 g) to a
solution of trifluoroacetic acid (400 mL), triethylsilane (825 mL)
and acetonitrile (7500 mL). The reaction was heated to reflux
overnight (24 hours). Solvents were removed and the residue was
poured into aqueous K.sub.2CO.sub.3 and extracted with ethyl
acetate. The organic layer was washed with brine, dried over sodium
sulfate, and concentrated. The crude compound was crystallized with
diethyl ether/hexane to afford compound 17, 420 g (73.6%) as off
white solid. MS (ESI) [M+H.sup.+].sup.+=331.1 and 333.1 (1:1
ratio).
Step 2: Preparation of
6-(4-Trifluoromethyl-benzylamino)-pyridine-3-carbaldehyde (18)
[0515] Into a 5 L round bottom flask was added compound 17 (0.6
mol, 198.6 g,) and tetrahydrofuran (2.5 L) under an atmosphere of
argon at -78.degree. C. Into the reaction mixture was added 1.7 M
tert-butyllithium in pentane (800 mL) over 60 mins. Two hours after
the addition of tert-butyllithium, N,N-dimethylformamide (100 mL)
was added. The reaction mixture was stirred at -78.degree. C. for 2
hours, then allowed to stand at room temperature for another 1
hour. The reaction mixture was poured into saturated ammonium
chloride solution and extracted with ethyl acetate. The organic
layer was washed with brine, dried over sodium sulfate,
concentrated and triturated with hexane/isopropyl ether (1:1) to
give aldehyde compound 18.
Step 3: Preparation of
(5-Formyl-pyridin-2-yl)-(4-trifluoromethyl-benzyl)-carbamic acid
tert-butyl ester (19)
[0516] Into a 2 L round bottom flask was added
di-tert-butyldicarbonate (90 g), aldehyde 18 (75 g), diisopropyl
ethyl amine (60 g), 4-dimethylaminopyridine (2.0 g,) and
dichloromethane (1000.0 mL). The reaction was stirred at room
temperature overnight (18 hours) and the solvent was evaporated to
give compound 19 (94 g).
Steps 4 and 5: Preparation of
[5-(4-Methoxy-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(4-trifl-
uoromethyl-benzyl)-amine (P-0011)
[0517] Step 4: Into a solution of methanol (20 mL, 0.5 mol) was
added sodium hydroxide (0.62 g, 0.016 mol), followed by
4-methoxy-7-azaindole (20, 600 mg, 4 mmol, prepared as described in
Example 12). Once the mixture was homogeneous, compound 19 (1.7 g,
4.46 mmol) was added and the mixture was stirred at room
temperature for 48 hours. The solvent was evaporated and dilute HCl
was added to the residue. The residue was extracted with ethyl
acetate and washed with 10% sodium bicarbonate, followed by brine.
The organic layer was dried over MgSO.sub.4, filtered and
evaporated to give a mixture of crude compounds 21 and 22, which
was used in the next step.
[0518] Step 5: The mixture of 21 and 22 from Step 4 (2.36 g, 4.46
mmol) was dissolved in dichloromethane (60 mL, 0.9 mol) to which
triethylsilane (3.6 mL, 0.022 mol) and trifluoroacetic Acid (2.1
mL, 0.027 mol) were added. The resulting mixture was stirred for 48
hours at room temperature. The solvent was evaporated and the
mixture was extracted with dichloromethane:methanol (3:1). The
organic layer was washed with saturated bicarbonate followed by
brine. The organic layer was dried over MgSO.sub.4, filtered and
evaporated to give crude compound as a residue. The residue was
purified by flash silica gel chromatography to give 1.15 g of solid
P-0011 for a 60% yield.
[0519] MS (ESI) [M+H.sup.+].sup.+=413.24.
[5-(4-Methoxy-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(4-chloro-
-benzyl)-amine P-0010
##STR00068##
[0520] was prepared following the protocol of Scheme 12,
substituting 4-trifluoro-benzylamine with 4-chloro-benzylamine in
Step 1. MS (ESI) [M+H.sup.+].sup.+=379.2 and 381.2 (3:1 ratio).
[5-(4-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(4-chloro--
benzyl)-amine P-0009
##STR00069##
[0521] was prepared following the protocol of Scheme 12,
substituting 4-trifluoro-benzylamine with 4-chloro-benzylamine in
Step 1 and 4-methoxy-7-azaindole with 4-chloro-7-azaindole (24,
prepared as described in Example 11) in Step 4. MS (ESI)
[M+H.sup.+].sup.+=381.1 and 383.0.
Example 11
Synthesis of 4-chloro-7-azaindole (24)
[0522] 4-chloro-7-azaindole 24 was synthesized in two Steps from
7-azaindole according to the protocol of Scheme 13.
##STR00070##
Step-1--Synthesis of 1H-Pyrrolo[2,3-b]pyridine 7-oxide (23)
[0523] 1H-Pyrrolo[2,3-b]pyridine 7-oxide 23 was synthesized by
reacting commercially available 7-azaindole 1 with an oxidizing
agent (e.g. m-CPBA) in a non-reactive solvent (e.g.
dimethoxyethane) as described by Schneller, S. W.; Luo, Jiann-Kuan.
J. Org. Chem. 1980, 45:4045-4048. The compound was isolated by
filtration of the resulting solid that forms upon standing at
5.degree. C. for typically 1-3 h.
Step-2--Synthesis of 4-chloro-7-azaindole (24)
[0524] 4-chloro-7-azaindole 24 was synthesized by reacting
1H-Pyrrolo[2,3-b]pyridine 7-oxide 23 with a chlorinating agent
(e.g. POCl.sub.3) neat as described by Schneller, S. W.; Luo,
Jiann-Kuan. J. Org. Chem. 1980, 45:4045-4048. The resulting
solution after heating for 3-5 h at elevated temperatures
(100-150.degree. C.) was neutralized with a base (e.g. NH.sub.4OH)
until a solid precipitated. The solid was isolated by
filtration.
Example 12
Synthesis of 4-methoxy-7-azaindole (20)
[0525] 4-methoxy-7-azaindole 20 was synthesized in one Step from
4-chloro-7-azaindole according to the protocol of Scheme 14.
##STR00071##
[0526] 4-methoxy-7-azaindole 20 was prepared by reacting
4-chloro-7-azaindole 24 (prepared as described in Example 9) with
sodium hydroxide in methanol as described by Girgis, N. et. al., J.
Heterocyclic. Chem. 1989, 26:317-325.
Example 13
Synthesis of Compounds of Formula I where n is 1, P is CR.sup.30,
Q, T, X.sub.1, X.sub.2, Y.sub.1 and Y.sub.2 are CH, L.sup.1 is
--CH2-, L.sup.2 is --NHCH.sub.2--, and R.sup.1 is substituted
phenyl (Formula Id)
[0527] Compounds of Formula Id, where R.sup.30 is a substituent as
defined for optionally substituted heteroarylene (further defined
in Scheme 13 below) and R.sup.31 is a substituent as defined for
optionally substituted aryl, can be synthesized in six Steps from
appropriately substituted 2-halopyridines as shown in the following
general Scheme 15.
##STR00072##
Step 1--Preparation of Compounds of Formula XI
[0528] To an appropriately substituted 2-halopyridine X (e.g.
2-chloro-6-methoxypyridine), where Y is a halogen, preferably
chlorine or bromine, and R.sup.30 is a group appropriate to direct
the following lithiation to the 5-position (e.g. R.sup.30=methoxy),
in a non-reactive solvent (e.g. tetrahydrofuran) typically cooled
in a -78.degree. C. acetone/dry ice bath is added a solution of
organolithium reagent (e.g. tert-butyllithium). The reaction is
allowed to stir for a period, typically 1 hour. An appropriate
formylating agent (e.g. dimethylformamide) is added and the
reaction is allowed to stir cooled for a period and then warmed to
room temperature for a period, typically 30 minutes. The reaction
can be placed back in the dry-ice bath and quenched with 6 N HCl
(1.5 mL) followed by water and allowed to warm to room temperature.
Isolation by conventional means (e.g. extraction) provides
compounds of Formula XI.
Step 2--Preparation of Compounds of Formula XII
[0529] To 1H-pyrrolo[2,3-b]pyridine 1 and a compound of Formula XI
is added an appropriate polar solvent (e.g. methanol) followed by
an appropriate base (e.g. potassium hydroxide). The reaction is
typically allowed to stir at room temperature overnight. Isolation
by convention means (e.g. extraction, washing and filtering)
affords compounds of Formula XII.
Step 3--Preparation of Compounds of Formula XIII
[0530] To a compound of Formula XII in an appropriate polar solvent
(e.g. acetonitrile) is added a reducing agent (e.g. trifluoroacetic
acid and triethylsilane). Typically, the reaction is allowed to
stir at room temperature overnight. Isolation by conventional means
(e.g. extraction and silica gel chromatography) affords compounds
of Formula XIII.
Step 4--Preparation of Compounds of Formula XIV
[0531] To a solution of compound of Formula XIII in an appropriate
polar solvent (e.g. dimethylformamide) is added a base (e.g. sodium
hydride). Typically, the reaction is stirred at room temperature
for 30 minutes, and then an appropriate reagent to introduce a
protecting group ("P") is added (e.g. triisopropylsilyl chloride).
The reaction typically is stirred at room temperature for several
hours. Isolation by conventional means (e.g. extraction and silica
gel chromatography) affords compounds of Formula XIV.
Step 5--Preparation of Compounds of Formula XVI
[0532] To a compound of Formula XIV, an appropriately substituted
benzylamine XV (e.g. 4-(trifluoromethyl)benzylamine), a base (e.g.
sodium tert-butoxide), a catalyst (e.g.
tris(dibenzylideneacetone)dipalladium(0)), and ligand (e.g.
2,2'-Bis(diphenylphosphino)-1,1'-binaphthyl) are added a
non-reactive solvent (e.g. toluene) under an inert atmosphere.
Typically, the reaction is heated (e.g. 80.degree. C.) for several
hours. Isolation by conventional means (e.g. extraction and silica
gel chromatography) affords compounds of Formula XVI.
Step 6--Preparation of Compounds of Formula Id
[0533] To compound of Formula XVI is added an appropriate polar
solvent (e.g. tetrahydrofuran) followed by an appropriate reagent
to remove the protecting group (e.g. tetra-n-butylammonium
fluoride). Typically, the reaction is allowed to stir at room
temperature for several hours. Isolation by conventional means
(e.g. extraction and silica gel chromatography) affords compounds
of Formula Id.
Example 14
Synthesis of Compounds of Formula I where n is 1, P is CR.sup.32,
Q, T, X.sub.1, X.sub.2, Y.sub.1 and Y.sub.2 are CH, L.sup.1 is
--CH2-, L.sup.2 is --NHCH.sub.2--, and R.sup.1 is Substituted
Phenyl (Formula Ie)
[0534] Compounds of Formula Id, where R.sup.32 is a substituent as
defined for optionally substituted heteroarylene and R.sup.33 is a
substituent as defined for optionally substituted aryl, can be
synthesized in five Steps from appropriately substituted
2-amino-5-bromopyridines as shown in the following general Scheme
16.
##STR00073## ##STR00074##
Step-1--Preparation of Compounds of Formula XIX
[0535] To a solution of an appropriately substituted benzaldehyde
XVIII (e.g. p-trifluoromethyl benzaldehyde) in a non-reactive
solvent (e.g. tetrahydrofuran) can be added an appropriate
2-amino-5-bromo-pyridine XVII (e.g.
2-amino-5-bromo-6-methylpyridine), followed by appropriate reagents
to effect the reduction (e.g. dibutyltin dichloride and
phenylsilane). Typically the reaction is heated (e.g. 50.degree.
C.) overnight. Isolation by conventional means (e.g. extraction)
affords compounds of Formula XIX.
Step-2--Preparation of Compounds of Formula XX
[0536] Compound of Formula XIX is dissolved in a non-reactive
solvent (e.g. tetrahydrofuran) and typically cooled at -78.degree.
C. under an inert atmosphere. To this mixture is added an
organolithium reagent (e.g. methyllithium). The reaction mixture is
typically stirred at -78.degree. C. for several hours. To this
mixture is added an organolithium reagent (e.g. tert-butyllithium)
and the mixture is stirred for several hours. The reaction mixture
is maintained at -78.degree. C., and an appropriate formylating
reagent (e.g. 1-piperidine carboxaldehyde) is added. Typically, the
reaction is allowed to stir at -78.degree. C. for an additional
several hours and slowly warmed to room temperature. Isolation by
conventional means (e.g. extraction) affords compounds of Formula
XX.
Step-3--Preparation of Compounds of Formula XXI
[0537] Compound of Formula XX is dissolved in a non-reactive
solvent (e.g. tetrahydrofuran) and stirred under an inert
atmosphere. To this solution is added a base (e.g. triethylamine)
and typically a catalyst (e.g. 4-dimethylaminopyridine). Typically,
the mixture is stirred for a few minutes, and then a reagent
appropriate for the introduction of a protecting group (e.g.
di-tert-butyldicarbonate) is added. Typically, the reaction is
stirred overnight. Isolation by conventional means (e.g.
extraction) affords compounds of Formula XXI.
Step-4--Preparation of Compounds of Formula XXII and XXIII
[0538] 1H-Pyrrolo[2,3-b]pyridine 1 is added to a stirred solution
of base (e.g. potassium hydroxide) in an appropriate polar solvent
(e.g. methanol). Compound of Formula XXI is added, and the mixture
is typically stirred at room temperature for several days. The
solvent is evaporated and 1 M HCl is added to the residue.
Isolation by conventional means (e.g. extraction, silica gel
chromatography) affords compounds of Formula XXII and XXIII.
Step-5--Preparation of Compounds of Formula XIV of Scheme 14
[0539] Typically, compounds of Formula XII and XIII are combined
and dissolved in an appropriate polar aprotic solvent (e.g.
acetonitrile). Reagents appropriate to effect the reduction (e.g.
triethylsilane and trifluoroacetic acid) are added. Typically, the
reaction is stirred at room temperature for several days. Isolation
by conventional means (e.g. extraction, silica gel chromatography)
affords compounds of Formula Ie.
Example 15
Synthesis of
[6-Methoxy-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(4-trifl-
uoromethyl-benzyl)-amine (P-0012)
[0540]
[6-Methoxy-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(4-
-trifluoromethyl-benzyl)-amine P-0012 was synthesized in five steps
from commercially available 2-chloro-6-methoxypyridine and
7-azaindole as shown in Scheme 17.
##STR00075##
Step 1--Preparation of 6-chloro-2-methoxypyridine-3-carbaldehyde
(26)
[0541] To 2-Chloro-6-methoxypyridine (25, 0.511 g, 3.56 mmol) in
tetrahydrofuran (10 mL) cooled in a -78.degree. C. acetone/dry ice
bath was added tert-butyllithium (1.7 M in pentane, 5.0 mL, 7.66
mmol). The reaction was allowed to stir for 1 hour.
Dimethylformamide (0.673 mL, 17.4 mmol) was added and the reaction
was allowed to continue for an additional 30 minutes at -78.degree.
C., then stirred for 30 minutes outside of the dry-ice bath. The
reaction was placed back in the dry-ice bath and quenched with 6 N
HCl (1.5 mL) followed by water and allowed to warm to room
temperature. The reaction was extracted with diethyl ether and
aqueous (1M) sodium bicarbonate. The organic layer was separated,
dried with anhydrous magnesium sulfate, filtered and volatiles
removed by rotary evaporation, and the resulting yellow solid was
dried under vacuum to provide 561 mg of compound 26 (3.27 mmol, 92%
yield). MS (ESI) [M+H.sup.+].sup.+=172.0.
Step 2--Preparation of
(6-chloro-2-methoxypyridin-3-yl)(1H-pyrrolo[2,3-b]pyridin-3-yl)methanol
(27)
[0542] To 1H-Pyrrolo[2,3-b]pyridine (1, 0.455 g, 3.85 mmol) and
6-chloro-2-methoxypyridine-3-carbaldehyde (26, 0.661 g, 3.85 mmol)
was added methanol (10 mL) followed by potassium hydroxide (0.310
g, 5.52 mmol). The reaction was allowed to stir at room temperature
overnight. The reaction was extracted with diethyl ether/ethyl
acetate and water. The organic layer was separated, dried over
anhydrous magnesium sulfate, filtered and volatiles were removed by
rotary evaporation to provide a solid that was treated with
dichloromethane and stored in a freezer overnight. The white solid
was collected by vacuum filtration and dried in vacuo to give 613
mg of compound 27 (2.12 mmol, 55%). MS (ESI)
[M+H.sup.+].sup.+=290.1.
Step 3--Preparation
3-(6-chloro-2-methoxypyridin-3-ylmethyl)-1H-pyrrolo[2,3-b]pyridine
(28)
[0543] To (6-chloro-2-methoxypyridin-3-yl)
(1H-pyrrolo[2,3-b]pyridin-3-yl)methanol (27, 0.613 g, 2.12 mmol) in
acetonitrile (10 mL) was added trifluoroacetic acid (0.82 mL, 10.0
mmol) followed by triethylsilane (1.69 mL, 10.6 mmol). The reaction
was allowed to stir at room temperature for 2 days, then 60.degree.
C. for 4 hours. The reaction was extracted with diethyl ether and
aqueous sodium bicarbonate. The organic layer was dried over
anhydrous magnesium sulfate and filtered. The desired material was
isolated from the filtrate by silica gel column chromatography
eluting with 1% methanol in dichloromethane to give 516 mg of a
white solid compound 28 (1.88 mmol, 89%). MS (ESI)
[M+H.sup.+].sup.+=274.1.
Step 4--Preparation
3-(6-chloro-2-methoxypyridin-3-ylmethyl)-1-(triisopropylsilyl)-1H-pyrrolo-
[2,3-b]pyridine (29)
[0544] To a clear solution of
3-(6-chloro-2-methoxypyridin-3-ylmethyl)-1H-pyrrolo[2,3-b]pyridine
(28, 0.516 g, 1.88 mmol) in dimethylformamide (10 mL) was added
sodium hydride (60% dispersion, 0.113 g, 2.82 mmol). After stirring
at room temperature for 30 minutes, triisopropylsilyl chloride (600
.mu.L, 2.83 mmol) was added. The reaction was stirred at room
temperature for 2 hours, then poured into aqueous (1M) sodium
bicarbonate and extracted with ethyl acetate. The organic layer was
separated, dried (magnesium sulfate), filtered and volatiles were
removed by rotary evaporation to give a crude solid. The compound
was purified by silica gel column chromatography eluting with 2%
ethyl acetate in hexanes. This provided 732 mg of the desired
compound as a white, crystalline solid (29, 1.70 mmol, 90%). MS
(ESI) [M+H.sup.+].sup.+=430.2.
Step 5--Preparation of
[6-Methoxy-5-(1-triisopropylsilanyl-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)--
pyridin-2-yl]-(4-trifluoromethyl-benzyl)-amine (31)
[0545]
3-(6-chloro-2-methoxypyridin-3-ylmethyl)-1-(triisopropylsilyl)-1H-p-
yrrolo[2,3-b]pyridine (29, 0.104 g, 0.242 mmol),
4-(Trifluoromethyl)benzylamine (30, 0.047 g, 0.266 mmol), sodium
tert-butoxide (0.0325 g, 0.338 mmol),
Tris(dibenzylideneacetone)-dipalladium (0) (0.00062 g, 0.0006
mmol), and 2,2'-Bis(diphenylphosphino)-1,1'-binaphthyl (0.0011 g,
0.0018 mmol) were added to toluene (2 mL) under nitrogen. The
reaction vial was placed in an oil bath at 80.degree. C. for 3
hours. The reaction was poured into water and extracted with ethyl
acetate. The organic layer was dried (magnesium sulfate), filtered,
and volatiles were removed by rotary evaporation. The residue was
purified by silica gel column chromatography eluting with 2% ethyl
acetate in hexanes. This provided 34 mg of the desired compound 31
(0.060 mmol, 25%). MS (ESI) [M+H.sup.+].sup.+=569.3.
Step 6--Preparation of
[6-Methoxy-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(4-trifl-
uoromethyl-benzyl)-amine (P-0012)
[0546] To
[6-Methoxy-5-(1-triisopropylsilanyl-1H-pyrrolo[2,3-b]pyridin-3-y-
lmethyl)-pyridin-2-yl]-(4-trifluoromethyl-benzyl)-amine (31, 0.0340
g, 0.0598 mmol) was added tetrahydrofuran (5 mL) followed by
tetra-n-butylammonium fluoride (1M solution in tetrahydrofuran, 66
.mu.L, 0.0658 mmol). The reaction was allowed to stir at room
temperature for 2 hours, then poured into 1:1 water:saturated
sodium bicarbonate and extracted with ethyl acetate. The organic
layer was separated, dried over magnesium sulfate, filtered and the
volatiles were removed by rotary evaporation. The resulting residue
was purified by silica gel column chromatography, eluting with
dichloromethane followed by 1% methanol in dichloromethane and
finally 3% methanol in dichloromethane. This provided 20 mg of the
desired compound as a white solid (P-0012, 0.048 mmol, 81%). MS
(ESI) [M+H.sup.+].sup.+=413.2.
Example 16
Synthesis of
[6-Methyl-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(4-triflu-
oromethyl-benzyl)-amine (P-0013)
[0547]
[6-Methyl-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(4--
trifluoromethyl-benzyl)-amine (P-0013) was synthesized in five
steps from commercially available 2-amino-5-bromo-6-methylpyridine
and 7-azaindole as shown in Scheme 18.
##STR00076##
Step-1--Preparation of
(5-Bromo-6-methyl-pyridin-2-yl)-(4-trifluoromethyl-benzyl)-amine
(34)
[0548] To a solution of p-trifluoromethylbenzaldehyde (16, 1.00 g,
5.74 mmol) in tetrahydrofuran (9 mL) was added
2-amino-5-bromo-6-methylpyridine (33, 1.08 g, 5.77 mmol), followed
by dibutyltin dichloride (40 mg, 0.13 mmol). The mixture was
stirred for 5 minutes at 25.degree. C. and phenylsilane (0.69 g,
6.4 mmol) was added. The reaction was heated at 50.degree. C.
overnight, then the solvent was removed at reduced pressure. Ethyl
acetate was added to the resulting solid which was washed with
saturated sodium carbonate, dried over magnesium sulfate and
filtered. Concentration under reduced pressure afforded a light
yellow solid (34, 1.7 g, 4.93 mmol). MS (ESI)
[M+H.sup.+].sup.+=345.1.
Step-2--Preparation of
2-Methyl-6-(4-trifluoromethyl-benzylamino)-pyridine-3-carbaldehyde
(35)
[0549]
(5-Bromo-6-methyl-pyridin-2-yl)-(4-trifluoromethyl-benzyl)-amine
(34, 1.7 g, 4.93 mmol) was dissolved in tetrahydrofuran (40 mL) and
cooled at -78.degree. C. under a nitrogen atmosphere. To this
mixture was added methyllithium (1.6 M in diethyl ether, 5.91 mmol)
dropwise over 20 minutes. After the addition of methyllithium was
completed, the reaction mixture was stirred at -78.degree. C. for 2
hours. To this mixture was added tert-butyllithium (1.7 M in
pentane, 10.85 mmol) and the mixture was stirred for 4 hours. The
reaction mixture was maintained at -78.degree. C., and
1-piperidinecarboxaldehyde (0.60 mL, 5.42 mmol) was added dropwise.
The reaction was allowed to stir at -78.degree. C. for an
additional 2 hours and warming to 25.degree. C. was achieved from
the slow evaporation of the dry ice/acetone cooling bath. The
reaction was quenched with ice cold saturated sodium chloride and
the resulting mixture was extracted with ethyl acetate. The organic
layer was dried over magnesium sulfate and filtered. Concentration
under reduced pressure afforded an orange oil (35, 1.4 g, 4.93
mmol).
[0550] MS (ESI) [M+H.sup.+].sup.+=295.1.
Step-3--Preparation of
(5-Formyl-6-methyl-pyridin-2-yl)-(4-trifluoromethyl-benzyl)-carbamic
acid tert-butyl ester (36)
[0551]
2-Methyl-6-(4-trifluoromethyl-benzylamino)-pyridine-3-carbaldehyde
(35, 1.4 g, 4.9 mmol) was dissolved in tetrahydrofuran (22 mL) and
was stirred under an atmosphere of nitrogen. To this solution was
added 4-dimethylaminopyridine (150 mg, 1.23 mmol) and triethylamine
(0.66 mL, 4.9 mmol). The mixture was stirred for 5 minutes before
solid di-tert-butyldicarbonate (1.0 g, 4.9 mmol) was added directly
to the reaction mixture. The mixture was stirred overnight at
25.degree. C. and was diluted with ethyl acetate and washed with
sodium bicarbonate, followed by washing with saturated sodium
chloride. The resulting organic layer was dried over magnesium
sulfate, filtered and evaporated to give a beige solid (36, 1.8 g,
4.6 mmol). MS (ESI) [M+H.sup.+].sup.+=395.2.
Step-4--Preparation of
{5-[Hydroxy-(1H-pyrrolo[2,3-b]pyridin-3-yl)-methyl]-6-methyl-pyridin-2-yl-
}-(4-trifluoromethyl-benzyl)-carbamic acid tert-butyl ester (37)
and
{5-[Methoxy-(1H-pyrrolo[2,3-b]pyridin-3-yl)-methyl]-6-methyl-pyridin-2-yl-
}-(4-trifluoromethyl-benzyl)-carbamic acid tert-butyl ester
(38)
[0552] 1H-Pyrrolo[2,3-b]pyridine (1, 540 mg, 4.57 mmol) was added
to a stirring solution of potassium hydroxide (868 mg, 10.08 mmol)
in methanol (33 mL). Once the mixture was homogeneous,
(5-formyl-6-methyl-pyridin-2-yl)-(4-trifluoromethyl-benzyl)-carbamic
acid tert-butyl ester (36, 1.8 g, 4.6 mmol) was added and the
mixture was stirred at 25.degree. C. for 72 hours. The solvent was
evaporated and 1 M HCl was added to the residue. The organic
material was extracted with ethyl acetate and washed with 10%
sodium bicarbonate, followed by washing with saturated sodium
chloride. The organic layer was dried over magnesium sulfate.
Concentration under reduced pressure afforded the crude material,
which was purified by silica gel column chromatography (0-5%
methanol in dichloromethane) to yield the desired compounds as a
light yellow solid (37 and 38 as a mixture, 294 mg; 13% yield). MS
(ESI) [M+H.sup.+].sup.+=511.2 for 37 and MS (ESI)
[M+H.sup.+].sup.+=525.2 for 38.
Step-5 Preparation of
[6-Methyl-5-(1H-pyrrolo[2,3-b]bipyridin-3-ylmethyl)-pyridin-2-yl]-(4-trif-
luoromethyl-benzyl)-amine (P-0013)
[0553] The combined materials of
{5-[Hydroxy-(1H-pyrrolo[2,3-b]pyridin-3-yl)-methyl]-6-methyl-pyridin-2-yl-
}-(4-trifluoromethyl-benzyl)-carbamic acid tert-butyl ester (37)
and
{5-[Methoxy-(1H-pyrrolo[2,3-b]pyridin-3-yl)-methyl]-6-methyl-pyridin-2-yl-
}-(4-trifluoromethyl-benzyl)-carbamic acid tert-butyl ester (38)
(194 mg, 0.378 mmol) were dissolved in acetonitrile (3 mL) and
triethylsilane (0.30 mL, 1.9 mmol) and trifluoroacetic acid (0.17
mL, 2.3 mmol) were added. After stirring at 25.degree. C. for
overnight, TLC analysis indicated that the reaction was about 50%
complete. To the reaction mixture was added triethylsilane (0.30
mL, 1.9 mmol), and trifluoroacetic acid (0.17 mL, 2.3 mmol). The
mixture was allowed to stir for another 48 hours at 25.degree. C.
and the solvent, excess triethylsilane and trifluoroacetic acid
were removed by evaporation. Ethyl acetate was added and washed
with saturated sodium bicarbonate. The organic layer was dried over
magnesium sulfate, filtered and concentrated at reduced pressure to
afford a brown oil. Purification of 80 mg of the crude material was
carried out using preparatory chromatography (50% ethyl acetate in
hexanes) to afford the compound as an off-white solid (P-0013, 10
mg, 0.025 mmol).
[0554] MS (ESI) [M+H.sup.+].sup.+=397.2.
(4-Chloro-benzyl)-[6-methyl-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridi-
n-2-yl]-amine P-0014
##STR00077##
[0555] was prepared following the protocol of Scheme 18,
substituting 4-trifluoromethyl benzaldehyde with
4-chlorobenzaldehyde (40) in Step 1. MS (ESI)
[M+H.sup.+].sup.+=363.1.
Example 17
Synthesis of
[5-(5-Bromo-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(4-chloro--
benzyl)-amine (P-0038)
[0556]
[5-(5-Bromo-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(4-c-
hloro-benzyl)-amine P-0038 was synthesized in 5 steps from
commercially available 2-Amino-5-bromopyridine 15 as shown in
Scheme 19.
##STR00078## ##STR00079##
Step 1--Synthesis of (5-Bromo-pyridin-2-yl)-(4-chloro-benzyl)-amine
(41)
[0557] To 2-Amino-5-bromopyridine (15, 6.10 g, 0.0352 mol) in
toluene (90.0 mL) were added 4-chlorobenzaldehyde (40, 5.00 g,
0.0356 mol), trifluoroacetic acid (8.0 mL, 0.10 mol) and
triethylsilane (16.5 mL, 0.103 mol). The reaction was heated to
reflux for 48 hours. The reaction was concentrated, poured into
aqueous potassium carbonate and extracted with ethyl acetate. The
organic layer was washed with brine, dried over sodium sulfate and
concentrated. The crude residue was crystallized with ethyl acetate
to give compound (41, 6.8 g, 65.4%).
Step 2--Synthesis of
6-(4-Chloro-benzylamino)-pyridine-3-carbaldehyde (42)
[0558] To (5-Bromo-pyridin-2-yl)-(4-chloro-benzyl)-amine (41, 10.00
g, 0.03360 mol) in tetrahydrofuran (400.0 mL) under an atmosphere
of nitrogen at -78.degree. C. was added n-butyllithium (17.5 mL,
2.00 M in cyclohexane). After 90 minutes, tert-butyllithium (42.00
mL, 1.70 M in hexane) was added to the reaction. After 80 minutes,
N,N-dimethylformamide (6.9 mL, 0.089 mol) was added to the
reaction. The reaction mixture was stirred at -78.degree. C. for 2
hours, then allowed to warm to room temperature for 1 hour. The
reaction mixture was poured into water and extracted with ethyl
acetate. The organic layer was washed with brine, dried over sodium
sulfate and concentrated to give the crude compound, which was
crystallized from tert-butoxyl methyl ether to provide compound
(42, 7.66 g, 92.2%).
Step 3--Synthesis of
(4-Chloro-benzyl)-(5-formyl-pyridin-2-yl)-carbamic acid tert-butyl
ester (43)
[0559] To 6-(4-Chloro-benzylamino)-pyridine-3-carbaldehyde (42,
2.00 g, 8.11 mmol) in dichloromethane (20.0 mL) were added
triethylamine (1.70 mL, 12.2 mmol), di-tert-butyldicarbonate (2.00
g, 9.16 mmol) and 4-dimethylaminopyridine (52.3 mg, 0.43 mmol). The
reaction was stirred at room temperature for 48 hours. The reaction
was concentrated and purified by silica gel column chromatography
eluting with 20% ethyl acetate in hexane to give compound (43, 2.50
g, 89.3%).
Step 4--Synthesis of
{5-[(5-Bromo-1H-pyrrolo[2,3-b]pyridin-3-yl)-hydroxy-methyl]-pyridin-2-yl}-
-(4-chloro-benzyl)-carbamic acid tert-butyl ester (45)
[0560] To 5-bromo-7-azaindole (44, 198.0 mg, 1.01 mmol) in methanol
(30.0 mL, 0.741 mol) were added
(4-Chloro-benzyl)-(5-formyl-pyridin-2-yl)-carbamic acid tert-butyl
ester (43, 355.0 mg, 1.02 mmol) and potassium hydroxide (80.0 mg,
1.42 mmol). The reaction was stirred at room temperature 48 hours.
The reaction mixture was poured into water and extracted with ethyl
acetate. The organic layer was washed with brine, dried over sodium
sulfate, concentrated and purified by silica gel column
chromatography eluting with 8% methanol in dichloromethane to give
compound (45, 200.0 mg, 36.8%).
Step 5--Synthesis of
[5-(5-Bromo-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(4-chloro--
benzyl)-amine (P-0038)
[0561] To
{5-[(5-Bromo-1H-pyrrolo[2,3-b]pyridin-3-yl)-hydroxy-methyl]-pyri-
din-2-yl}-(4-chloro-benzyl)-carbamic acid tert-butyl ester (45,
180.0 mg, 0.33 mmol) in acetonitrile (30.0 mL) were added
trifluoroacetic acid (2.0 mL, 0.026 mol) and triethylsilane (4.0
mL, 0.025 mol). The reaction was heated to reflux for 4 hours. The
reaction mixture was poured into water and extracted with ethyl
acetate. The organic layer was washed with brine, dried over sodium
sulfate, concentrated and purified by silica gel column
chromatography eluting with 10% methanol in dichloromethane to give
compound (P-0038, 120 mg, 85.2%).
[0562] MS (ESI)[M+H.sup.+].sup.+=427.2, 429.2.
Example 18
Synthesis of
1-triisopropylsilanyl-1H-pyrrolo[2,3-b]pyridine-3-carbaldehyde
47
[0563] Compound 47 was synthesized in 2 steps from 7-azaindole 1 as
described in Scheme 20.
##STR00080##
Step 1--Preparation of 1H-pyrrolo[2,3-b]pyridine-3-carbaldehyde
(46)
[0564] To 1H-Pyrrolo[2,3-b]pyridine (1, 16.0 g, 135 mmol) in water
(110 mL), were added hexamethylenetetramine (26.0 g, 185 mmol), and
acetic acid (55.0 mL, 967 mmol). The reaction was refluxed for 12
hours. Water (329 mL) was added and the reaction was cooled to room
temperature. The reaction was filtrated and washed with water to
give compound (46, 15.0 g, 76%). MS (ESI)[M+H.sup.+].sup.+=147.
Step 2--Preparation of
1-triisopropylsilanyl-1H-pyrrolo[2,3-b]pyridine-3-carbaldehyde
(47)
[0565] To 1H-Pyrrolo[2,3-b]pyridine-3-carbaldehyde (46, 4.05 g,
27.71 mmol) in tetrahydrofuran (30.0 mL) were added sodium hydride
(60% in mineral oil, 1.5 g, 38 mmol) and triisopropylsilyl chloride
(8.0 mL, 38 mmol) under an atmosphere of nitrogen. The reaction was
stirred for 2 hours at room temperature. The reaction was poured
into water and extracted with ethyl acetate. The organic layer was
washed with brine, dried over anhydrous sodium sulfate and
filtered. The filtrate was concentrated and purified by silica gel
column chromatography eluting with 10% ethyl acetate in hexane to
give compound (47, 3.0 g, 36%). MS (ESI)[M+H.sup.+].sup.+=303.
1-(tert-Butyl-dimethyl-silanyl)-3-iodo-1H-pyrrolo[2,3-b]pyridine
66
##STR00081##
[0566] was prepared following the protocol of Scheme 20 Step 2,
substituting 1H-Pyrrolo[2,3-b]pyridine-3-carb aldehyde 46 with
3-iodo-1H-pyrrolo[2,3-b]pyridine and triisopropylsilyl chloride
with tert-Butyl-dimethyl-silyl chloride.
1-benzenesulfonyl-1H-pyrrolo[2,3-b]pyridine-3-carbaldehyde 55
##STR00082##
[0567] was prepared following the protocol of Scheme 20,
substituting triisopropylsilyl chloride with benzenesulfonyl
chloride in Step 2.
Example 19
Synthesis of
N-[5-(1H-Pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-4-trifluoromethy-
l-benzenesulfonamide (P-0071)
[0568] N-[5-(1H-Pyrrolo[2,
3-1)]pyridin-3-ylmethyl)-pyridin-2-yl]-4-trifluoromethyl-benzenesulfonami-
de P-0071 was synthesized in 3 steps from 2-Amino-5-bromopyridine
15 as shown in Scheme 21.
##STR00083##
Step 1--Synthesis of
N-(5-Bromo-pyridin-2-yl)-4-trifluoromethyl-benzenesulfonamide
(49)
[0569] To 2-Amino-5-bromopyridine (15, 1.50 g, 8.67 mmol) in
acetonitrile (20.0 mL) were added pyridine (6.0 mL, 0.074 mol),
4-dimethylaminopyridine (0.10 g, 0.82 mmol) and
4-trifluoromethyl-benzenesulfonyl chloride (48, 2.14 g, 8.75 mmol).
The reaction mixture was stirred at room temperature overnight. The
reaction was concentrated, poured into water, acidified with 1N HCl
to pH=2, and extracted with ethyl acetate. The organic layer was
washed with brine, dried over anhydrous sodium sulfate and
concentrated. The residue was washed with ethyl acetate to give a
white solid as desired compound (49, 2.80 g, 84.8%). MS (ESI)
[M+H.sup.+].sup.+=381.0, 383.0.
Step 2--Synthesis of
N-5-[Hydroxy-(1-triisopropylsilanyl-1H-pyrrolo[2,3-b]pyridin-3-yl)-methyl-
]-pyridin-2-yl-4-trifluoromethyl-benzenesulfonamide (50)
[0570] To
N-(5-Bromo-pyridin-2-yl)-4-trifluoromethyl-benzenesulfonamide (49,
0.96 g, 2.5 mmol) in tetrahydrofuran (50.0 mL) under an atmosphere
of nitrogen at -78.degree. C., tert-butyllithium (4.62 mL, 1.70 M
in hexane) was added slowly. After 15 minutes,
1-triisopropylsilanyl-1H-pyrrolo[2,3-b]pyridine-3-carbaldehyde (47,
0.30 g, 0.99 mmol, prepared as described in Example 18) in
tetrahydrofuran (15.0 mL) was added to the reaction. After 30
minutes, the reaction was allowed to come to room temperature for
10 minutes. The reaction was poured into water, acidified with 1N
HCl to pH around 2, and extracted with ethyl acetate. The organic
layer was dried over anhydrous sodium sulfate and filtered. The
filtrate was concentrated and purified by silica gel column
chromatography eluting with 20% ethyl acetate in hexane to give a
white solid compound (50, 0.55 g, 90.1%). MS (ESI)
[M+H.sup.+].sup.+=605.3.
Step 3--Synthesis of
N-[5-(1H-Pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-4-trifluoromethy-
l-benzenesulfonamide (P-0071
[0571] To
N-5-[Hydroxy-(1-triisopropylsilanyl-1H-pyrrolo[2,3-b]pyridin-3-y-
l)-methyl]-pyridin-2-yl-4-trifluoromethyl-benzenesulfonamide (50,
0.27 g, 0.45 mmol) in acetonitrile (15.0 mL) were added
trifluoroacetic acid (1.0 mL, 0.013 mol) and triethylsilane (2.0
mL, 0.012 mol). The reaction was heated to 85.degree. C. for 1
hour. The reaction was concentrated, poured into water and
extracted with ethyl acetate. The organic layer was purified with
silica gel column chromatography eluting with 50% ethyl acetate in
hexane to give a white solid compound (P-0071, 28.5 mg, 14.7%). MS
(ESI) [M+H.sup.+].sup.+=433.2.
4-Chloro-N-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-benzamid-
e P-0074
##STR00084##
[0572] was prepared following the protocol of Scheme 21,
substituting 4-trifluoromethyl-benzenesulfonyl chloride 48 with
4-chloro-benzoyl chloride in step 1. MS (ESI)
[M+H.sup.+].sup.+=363.2.
Example 20
Synthesis of
N-[5-(1H-Pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-4-trifluoromethy-
l-benzamide (P-0072)
[0573]
N-[5-(1H-Pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-4-trifluor-
omethyl-benzamide P-0072 was synthesized in one step from
(3-(6-Bromo-pyridin-3-ylmethyl)-1-triisopropylsilanyl-1H-pyrrolo[2,3-b]py-
ridine 6a as shown in Scheme 22.
##STR00085##
Step 1--Synthesis of
N-[5-(1H-Pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-4-trifluoromethy-
l-benzamide (P-0072
[0574] To 3-(6-Bromo-pyridin-3-ylmethyl)-1H-pyrrolo[2,3-b]pyridine
(6a, 50.0 mg, 0.000174 mol, prepared as described in Example 2) in
1,4-dioxane (4.0 mL) were added 4-trifluoromethyl-benzamide (51,
70.0 mg, 0.37 mmol), Xanthphos (15.0 mg, 0.026 mmol), cesium
carbonate (130.0 mg, 0.40 mmol) and
Tris(dibenzylideneacetone)-dipalladium(0) (25.0 mg, 0.024 mmol)
under an atmosphere of nitrogen. The reaction was heated to
120.degree. C. for 10 minutes in a CEM Discover microwave
instrument. The reaction was poured into water and extracted with
ethyl acetate. The organic layer was dried over anhydrous sodium
sulfate and filtered. The filtrate was concentrated and purified by
silica gel column chromatography eluting with 50% ethyl acetate in
hexane to give a white solid (P-0072, 4.7 mg, 6.8%). MS (ESI)
[M+H.sup.+].sup.+=397.2.
4-Fluoro-N-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-benzamid-
e P-0073
##STR00086##
[0575] was prepared following the protocol of Scheme 22,
substituting 4-trifluoromethyl-benzamide with
4-fluoromethyl-benzamide. MS (ESI) [M+H.sup.+].sup.+=347.2.
Example 21
Synthesis of
(4-Chloro-phenyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-ylme-
thyl]-amine (P-0078)
[0576]
(4-Chloro-phenyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin--
2-ylmethyl]-amine P-0078 was synthesized in 3 steps from
5-Bromo-pyridine-2-carbaldehyde 52 as shown in Scheme 23.
##STR00087##
Step 1--Synthesis of
(5-Bromo-pyridin-2-ylmethyl)-(4-chloro-phenyl)-amine (54)
[0577] To 5-Bromo-pyridine-2-carbaldehyde (52, 1.00 g, 5.38 mmol)
in acetonitrile (50.0 mL) were added p-chloroaniline (53, 0.686 g,
5.38 mmol), triethylsilane (6.00 mL, 0.0376 mol) and
trifluoroacetic acid (3.00 mL, 0.0389 mol). The reaction was heated
to reflux for 3 hours. The reaction was concentrated, poured into
water and then extracted with ethyl acetate. The organic layer was
dried over anhydrous sodium sulfate and filtered. The filtrate was
concentrated and purified by silica gel column chromatography
eluting with 20% ethyl acetate in hexane to give a white solid (54,
0.75 g, 47.0%).
Step 2--Synthesis of
(1-Benzenesulfonyl-1H-pyrrolo[2,3-b]pyridin-3-yl)-6-[(4-chloro-phenylamin-
o)-methyl]-pyridin-3-yl-methanol (56)
[0578] To (5-Bromo-pyridin-2-ylmethyl)-(4-chloro-phenyl)-amine (54,
0.380 g, 1.28 mmol) in tetrahydrofuran (15.0 mL) under an
atmosphere of nitrogen at -78.degree. C. was added n-butyllithium
(0.850 mL, 1.60 M in hexane). After 10 minutes,
1,2-bis-(chloro-dimethyl-silanyl)-ethane (0.135 g, 0.627 mmol) in
tetrahydrofuran (5.0 mL) was added to the reaction. The reaction
was allowed to warm to room temperature for 40 minutes. The
reaction was cooled to -78.degree. C., followed by addition of 1.70
M tert-butyllithium in hexane (1.58 mL). After 30 minutes,
1-benzenesulfonyl-1H-pyrrolo[2,3-b]pyridine-3-carbaldehyde (55,
0.380 g, 1.33 mmol, prepared as described in Example 18) in
tetrahydrofuran (10.0 mL) was added to the reaction. After 20
minutes, the reaction was allowed to warm to room temperature. The
reaction was poured into water and extracted with ethyl acetate.
The organic layer was dried over anhydrous sodium sulfate and
filtered. The filtrate was concentrated and purified by silica gel
column chromatography eluting with 50% ethyl acetate in hexane to
give compound (56, 0.30 g, 46.0%). MS (ESI)
[M+H.sup.+].sup.+=505.3.
Step
3-(4-Chloro-phenyl)-5-[methoxy-(1H-pyrrolo[2,3-b]pyridin-3-yl)-methyl-
]-pyridin-2-ylmethyl-amine (57)
[0579] To
(1-Benzenesulfonyl-1H-pyrrolo[2,3-b]pyridin-3-yl)-6-[(4-chloro-p-
henylamino)-methyl]-pyridin-3-yl-methanol (56, 120.0 mg, 0.24 mmol)
in methanol (20.0 mL) were added potassium hydroxide (0.400 g, 7.13
mmol) and water (5.0 mL, 0.28 mol). The reaction was heated to
50.degree. C. for 10 hours. The reaction was poured into water and
extracted with ethyl acetate. The organic layer was dried over
anhydrous sodium sulfate and filtered. The filtrate was
concentrated and purified by silica gel column chromatography
eluting with 20% ethyl acetate in hexane to give compound (57, 30
mg, 33.0%). MS (ESI) [M+H.sup.+].sup.+=379.4.
Step 4--Synthesis of
(4-Chloro-phenyl)-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-ylme-
thyl]-amine (P-0078)
[0580] To
(4-Chloro-phenyl)-5-[methoxy-(1H-pyrrolo[2,3-b]pyridin-3-yl)-met-
hyl]-pyridin-2-ylmethyl-amine (57, 20.8 mg, 0.055 mmol) in
acetonitrile (10.0 mL) were added trifluoroacetic acid (0.50 mL,
6.5 mmol) and triethylsilane (1.00 mL, 6.26 mmol). The reaction was
heated to reflux for 3 hours, then poured into water and extracted
with ethyl acetate. The organic layer was dried over anhydrous
sodium sulfate and filtered. The filtrate was concentrated and
purified by silica gel column chromatography eluting with 10%
methanol in dichloromethane to give compound (P-0078, 6.1 mg,
32.0%).
[0581] MS (ESI) [M+H.sup.+].sup.+=349.4.
Example 22
Synthesis of
(4-Chloro-benzyl)-[6-fluoro-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrid-
in-2-yl]-amine (P-0082)
[0582] (4-Chloro-benzyl)-[6-fluoro-5-(1H-pyrrolo[2,
3-1)]pyridin-3-ylmethyl)-pyridin-2-yl]-amine P-0082 was synthesized
in 8 steps from 2,6-Difluoropyridine 58 as shown in Scheme 24.
##STR00088## ##STR00089##
Step 1--Synthesis of 2,6-Difluoro-nicotinic acid (59)
[0583] To 2,6-difluoropyridine (58, 7.10 g, 0.0617 mol) in
tetrahydrofuran (150.0 mL) under an atmosphere of nitrogen at
-78.degree. C., n-butyllithium (26.0 mL, 2.50 M in hexane) was
added slowly. After 30 minutes, dry ice (3.0 g) was added to the
reaction. After 1 hour, the reaction was allowed to warm to room
temperature, then poured into water and extracted with ethyl
acetate. The aqueous layer was acidified with 1 N HCl to pH=4-5 and
extracted with ethyl acetate. The organic layer was dried over
anhydrous sodium sulfate, filtered and concentrated to give the
crude compound as a light yellow solid (59, 5.6 g, 57.0%).
Step 2--Synthesis of 2,6-Difluoro-nicotinic acid methyl ester
(60)
[0584] To 2,6-difluoro-nicotinic acid (59, 5.60 g, 0.0352 mol) in
methanol (60.0 mL) was added concentrated sulfuric acid (1.0 mL,
0.019 mol). The reaction was heated to reflux overnight, then
poured into water, basified with 1M potassium carbonate to pH
around 9, and extracted with ethyl acetate. The organic layer was
dried over anhydrous sodium sulfate and concentrated to give a
yellow oil (60, 3.5 g, 57.0%).
Step 3--Synthesis of 6-(4-Chloro-benzylamino)-2-fluoro-nicotinic
acid methyl ester (62)
[0585] To 2,6-difluoro-nicotinic acid methyl ester (60, 2.00 g,
0.0116 mol) in N,N-dimethylformamide (20.0 mL), under an atmosphere
of nitrogen at -40.degree. C., was added p-chlorobenzylamine (61,
2.60 mL, 0.0214 mol). The reaction was stirred at -40.degree. C. to
-20.degree. C. for 2 hours, then poured into water and extracted
with ethyl acetate. The organic layer was dried over anhydrous
sodium sulfate and filtered. The filtrate was concentrated and
purified by silica gel column chromatography eluting with 25% ethyl
acetate in hexane to give compound (62, 2.0 g, 58.7%).
Step 4--Synthesis of
[6-(4-Chloro-benzylamino)-2-fluoro-pyridin-3-yl]-methanol (63)
[0586] To 6-(4-Chloro-benzylamino)-2-fluoro-nicotinic acid methyl
ester (62, 2.00 g, 6.79 mmol) in tetrahydrofuran (100.0 mL) was
added lithium tetrahydroaluminate (13.6 mL, 1.00 M in
Tetrahydrofuran) under an atmosphere of nitrogen. The reaction was
stirred at room temperature overnight. To the reaction was added an
excessive amount of NaSO.sub.4.10H.sub.2O, and then stirred for 1
hour. Filtration, concentration and purification with silica gel
column chromatography eluting with 30% ethyl acetate in hexane
provided compound 63 (1.0 g, 55.0%).
Step 5--Synthesis of
6-(4-Chloro-benzylamino)-2-fluoro-pyridine-3-carbaldehyde (64)
[0587] To [6-(4-Chloro-benzylamino)-2-fluoro-pyridin-3-yl]-methanol
(63, 1.0 g, 3.7 mmol) in tetrahydrofuran (50.0 mL) was added
Dess-Martin periodinane (1.75 g, 4.12 mmol). The reaction was
stirred at room temperature for 10 minutes, then poured into water
and extracted with ethyl acetate. The organic layer was dried over
anhydrous sodium sulfate and filtered. The filtrate was
concentrated and purified by silica gel column chromatography
eluting with 20% ethyl acetate in hexane to give a white solid (64,
0.67 g, 68.0%).
Step 6--Synthesis of
(4-Chloro-benzyl)-(6-fluoro-5-formyl-pyridin-2-yl)-carbamic acid
tert-butyl ester (65)
[0588] To 6-(4-Chloro-benzylamino)-2-fluoro-pyridine-3-carbaldehyde
(64, 670.0 mg, 2.53 mmol) in dichloromethane (16.2 mL) were added
di-tert-butyldicarbonate (1.23 g, 5.65 mmol) and
4-dimethylaminopyridine (16.2 mg, 0.133 mmol). The reaction was
stirred at room temperature overnight. The reaction was
concentrated and purified by silica gel column chromatography
eluting with 30% ethyl acetate in hexane to give a white solid (65,
0.63 g, 68.0%).
Step 7--Synthesis of
(5-[1-(tert-Butyl-dimethyl-silanyl)-1H-pyrrolo[2,3-b]pyridin-3-yl]-hydrox-
y-methyl-6-fluoro-pyridin-2-yl)-(4-chloro-benzyl)-carbamic acid
tert-butyl ester (67)
[0589] To
1-(tert-butyl-dimethyl-silanyl)-3-iodo-1H-pyrrolo[2,3-b]pyridine
(66, 0.53 g, 0.0015 mol) and tetrahydrofuran (15.0 mL), under an
atmosphere of nitrogen at -20.degree. C., was added
isopropylmagnesium chloride (0.78 mL, 2.0 M in tetrahydrofuran).
The reaction was allowed to warm to 0.degree. C. (around 80
minutes), then cooled to -20.degree. C., followed by addition of
(4-Chloro-benzyl)-(6-fluoro-5-formyl-pyridin-2-yl)-carbamic acid
tert-butyl ester (65, 0.200 g, 0.55 mmol) in tetrahydrofuran (6.0
mL). The reaction was allowed to warm to room temperature in 1
hour, then poured into water and extracted with ethyl acetate. The
organic layer was dried over anhydrous sodium sulfate, and
filtered. The filtrate was concentrated and purified by silica gel
column chromatography eluting with 20% ethyl acetate in hexane to
give a yellow solid (67, 0.20 g, 61.1%).
[0590] MS (ESI) [M+H.sup.+].sup.+=597.4.
Step 8--Synthesis of
(4-Chloro-benzyl)-[6-fluoro-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrid-
in-2-yl]-amine (P-0082)
[0591] To
(5-[1-(tert-Butyl-dimethyl-silanyl)-1H-pyrrolo[2,3-b]pyridin-3-y-
l]-hydroxy-methyl-6-fluoro-pyridin-2-yl)-(4-chloro-benzyl)-carbamic
acid tert-butyl ester (67, 0.10 g, 0.17 mmol) in acetonitrile (10.0
mL) were added triethylsilane (1.00 mL, 6.26 mmol) and
trifluoroacetic acid (0.50 mL, 6.5 mmol). The reaction was heated
to reflux for 2 hours, then poured into aqueous potassium
carbonate, and extracted with ethyl acetate. The organic layer was
dried over anhydrous sodium sulfate, and filtered. The filtrate was
concentrated and purified by silica gel column chromatography
eluting with 30% ethyl acetate in hexane to give a white solid
(P-0082, 43.2 mg, 70.0%).
[0592] MS (ESI) [M+H.sup.+].sup.+=367.4.
Example 23
Synthesis of
(4-Chloro-benzyl)-[6-methoxy-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyri-
din-2-yl]-amine (P-0081)
[0593]
(4-Chloro-benzyl)-[6-methoxy-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl-
)-pyridin-2-yl]-amine P-0081 was synthesized in 2 steps from
(4-Chloro-benzyl)-(6-fluoro-5-formyl-pyridin-2-yl)-carbamic acid
tert-butyl ester 65 as shown in Scheme 25.
##STR00090##
Step 1--Synthesis of
(4-Chloro-benzyl)-5-[hydroxy-(1H-pyrrolo[2,3-b]pyridin-3-yl)-methyl]-6-me-
thoxy-pyridin-2-yl-carbamic acid tert-butyl ester (68)
[0594] To 1H-Pyrrolo[2,3-b]pyridine (1, 90.0 mg, 0.76 mmol) in
methanol (30.0 mL) were added
(4-chloro-benzyl)-(6-fluoro-5-formyl-pyridin-2-yl)-carbamic acid
tert-butyl ester (65, 300.0 mg, 0.82 mmol) and potassium hydroxide
(720.0 mg, 12.83 mmol) under an atmosphere of nitrogen. The
reaction was stirred at room temperature for 2 hours, then poured
into water and extracted with ethyl acetate. The organic layer was
dried over anhydrous sodium sulfate and filtered. The filtrate was
concentrated and purified by silica gel column chromatography
eluting with 20% ethyl acetate in hexane to give the compound (68,
60 mg, 15.9%). MS (ESI) [M+H.sup.+].sup.+=495.3.
Step 2--Synthesis of
(4-Chloro-benzyl)-[6-methoxy-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyri-
din-2-yl]-amine (P-0081)
[0595] To
(4-Chloro-benzyl)-5-[hydroxy-(1H-pyrrolo[2,3-b]pyridin-3-yl)-met-
hyl]-6-methoxy-pyridin-2-yl-carbamic acid tert-butyl ester (68,
40.0 mg, 0.081 mmol) in acetonitrile (10.0 mL) were added
trifluoroacetic acid (0.30 mL, 0.0039 mol) and triethylsilane (0.60
mL, 0.0038 mol). The reaction was heated to reflux for 3 hours. The
reaction was concentrated to remove the solvents, then purified
with silica gel column chromatography eluting with 40% ethyl
acetate in hexane to give compound (P-0081, 10 mg, 32.7%). MS (ESI)
[M+H.sup.+].sup.+=379.4.
Example 24
Synthesis of
5-(1H-Pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridine-2-carboxylic acid
(4-chloro-phenyl)-amide (P-0076)
[0596]
5-(1H-Pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridine-2-carboxylic acid
(4-chloro-phenyl)-amide P-0076 was synthesized in 3 Steps from
5-Bromo-pyridine-2-carbonyl chloride 69 as shown in Scheme 26.
##STR00091##
Step 1--Synthesis of 5-Bromo-pyridine-2-carboxylic acid
(4-chloro-phenyl)-amide (70)
[0597] To 5-Bromo-pyridine-2-carbonyl chloride (69, 0.76 g, 3.4
mmol) in acetonitrile (29.0 mL) were added p-chloroaniline (53,
0.702 g, 5.50 mmol), 4-dimethylamino-pyridine (0.12 g, 0.96 mmol)
and pyridine (2.9 mL, 0.036 mol). The reaction was stirred at
68.degree. C. overnight, then poured into water, acidified with 1 N
HCl to pH around 1 and extracted with ethyl acetate. The organic
layer was dried over anhydrous sodium sulfate and filtered. The
filtrate was concentrated and purified by silica gel column
chromatography eluting with dichloromethane to give a white solid
(70, 0.75 g, 70.0%).
Step 2--Synthesis of
5-[Hydroxy-(1-triisopropylsilanyl-1H-pyrrolo[2,3-b]pyridin-3-yl)-methyl]--
pyridine-2-carboxylic acid (4-chloro-phenyl)-amide (71)
[0598] To 5-Bromo-pyridine-2-carboxylic acid
(4-chloro-phenyl)-amide (70, 0.50 g, 1.60 mmol) in tetrahydrofuran
(20.0 mL), under an atmosphere of nitrogen at -78.degree. C.,
tert-butyllithium (3.02 mL, 1.70 M in Hexane) was added. After 20
minutes,
1-triisopropylsilanyl-1H-pyrrolo[2,3-b]pyridine-3-carbaldehyde (47,
0.39 g, 1.3 mmol, prepared as described in Example 18) in
tetrahydrofuran (10.0 mL) was added to the reaction. The reaction
was stirred at -78.degree. C. for 1 hour, then allowed to warm to
room temperature for 10 minutes. The reaction was poured into water
and extracted with ethyl acetate. The organic layer was dried over
anhydrous sodium sulfate and filtered. The filtrate was
concentrated and purified by silica gel column chromatography
eluting with 20% ethyl acetate in hexane to give the compound as
colorless oil (71, 100 mg, 14%). MS (ESI)
[M+H.sup.+].sup.+=535.3.
Step 3--Synthesis of
5-(1H-Pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridine-2-carboxylic acid
(4-chloro-phenyl)-amide (P-0076)
[0599] To
5-[Hydroxy-(1-triisopropylsilanyl-1H-pyrrolo[2,3-b]pyridin-3-yl)-
-methyl]-pyridine-2-carboxylic acid (4-chloro-phenyl)-amide (71,
100.0 mg, 0.19 mmol) in acetonitrile (10.0 mL) were added
trifluoroacetic acid (0.20 mL, 2.6 mmol) and triethylsilane (0.40
mL, 2.5 mmol). The reaction was stirred at 80.degree. C. for 2
hours. The reaction was concentrated and purified by silica gel
column chromatography eluting with 20% ethyl acetate in hexane to
give a yellow solid compound (P-0076, 5.5 mg, 8.1%).
[0600] MS (ESI) [M-H.sup.+].sup.-=361.1.
Example 25
Synthesis of
[6-(3-Hydroxy-phenylamino)-pyridin-3-yl]-(1H-pyrrolo[2,3-b]pyridin-3-yl)--
methanone (P-0027)
[0601]
[6-(3-Hydroxy-phenylamino)-pyridin-3-yl]-(1H-pyrrolo[2,3-b]pyridin--
3-yl)-methanone P-0027 was synthesized in 1 Step from
[6-(3-Benzyloxy-phenylamino)-pyridin-3-yl]-(1H-pyrrolo[2,3-b]pyridin-3-yl-
)-methanone P-0026 as shown in Scheme 27.
##STR00092##
[0602] To
[6-(3-Benzyloxy-phenylamino)-pyridin-3-yl]-(1H-pyrrolo[2,3-b]pyr-
idin-3-yl)-methanone (P-0026, 12.0 mg, 0.0285 mmol) in methanol
(5.0 mL) was added 20% palladium hydroxide on carbon (10.0 mg)
under an atmosphere of hydrogen. The reaction was stirred at room
temperature for 5 hours. Filtration and concentration gave compound
(P-0027, 3.5 mg, 37%). MS (ESI) [M+H.sup.+].sup.+=331.
Example 26
Synthesis of
3-[6-(3-Trifluoromethyl-benzyloxy)-pyridin-3-ylmethyl]-1H-pyrrolo[2,3-b]p-
yridine P-0057
[0603]
3-[6-(3-Trifluoromethyl-benzyloxy)-pyridin-3-ylmethyl]-1H-pyrrolo[2-
,3-b]pyridine P-0057 was synthesized in 4 steps from commercially
available 7-azaindole as shown in Scheme 28.
##STR00093##
Step 1--Preparation of
(6-Chloro-pyridin-3-yl)-(1H-pyrrolo[2,3-b]pyridin-3-yl)-methanone
(7)
[0604] To 7-azaindole 1 in dichloromethane was added
6-chloronicotinoyl chloride 8, followed by aluminum chloride, under
an atmosphere of nitrogen at -10.degree. C. The reaction was
stirred and allowed to warm to room temperature overnight. The
reaction was quenched with 3 N hydrochloric acid and concentrated
hydrochloric acid was added until all solids dissolved. The mixture
was extracted with dichloromethane and the combined organic
portions were dried with magnesium sulfate, filtered, and the
filtrate was concentrated. The resulting solid material was
recrystallized from chloroform/hexane to provide
(6-Chloro-pyridin-3-yl)-(1H-pyrrolo[2,3-b]pyridin-3-yl)-methanone 7
and used in the next step without further purification.
Step 2--Preparation of
(1H-pyrrolo[2,3-b]pyridin-3-yl)-[6-(3-trifluoromethyl-benzyloxy)-pyridin--
3-yl]-methanone (73)
[0605] To
(6-Chloro-pyridin-3-yl)-(1H-pyrrolo[2,3-b]pyridin-3-yl)-methanon- e
7 in DMSO was added (3-trifluoromethyl-phenyl)-methanol 72. Sodium
hydride was added and the reaction was heated to 60.degree. C. for
two hours. The reaction was quenched with water and extracted with
ethyl acetate. The organic portion was dried with magnesium sulfate
and concentrated to provide
(1H-pyrrolo[2,3-b]pyridin-3-yl)-[6-(3-trifluoromethyl-benzyloxy)-pyridin--
3-yl]-methanone 73, which was used in the next step without
additional purification.
Step 3--Preparation
(1H-Pyrrolo[2,3-b]pyridin-3-yl)-[6-(3-trifluoromethyl-benzyloxy)-pyridin--
3-yl]-methanol (74)
[0606] To
(1H-pyrrolo[2,3-b]pyridin-3-yl)-[6-(3-trifluoromethyl-benzyloxy)-
-pyridin-3-yl]-methanone 73 in ethanol was added sodium
borohydride. After one hour, the reaction was quenched with water
and extracted with ethyl acetate. The organic portion was dried
with magnesium sulfate and concentrated to provide
(1H-Pyrrolo[2,3-b]pyridin-3-yl)-[6-(3-trifluoromethyl-benzyloxy)-pyridin--
3-yl]-methanol 74, which was used in the next step without
additional purification.
Step 4--Preparation of
3-[6-(3-Trifluoromethyl-benzyloxy)-pyridin-3-ylmethyl]-1H-pyrrolo[2,3-b]p-
yridine, P-0057
[0607]
(1H-Pyrrolo[2,3-b]pyridin-3-yl)-[6-(3-trifluoromethyl-benzyloxy)-py-
ridin-3-yl]-methanol 74 was dissolved in 9:1 trifluoroacetic
acid:triethylsilane. The reaction was stirred at room temperature
for 15 hours. The reaction was diluted with water and extracted
with ethyl acetate and concentrated. The crude material was
purified by reverse phase HPLC to provide
3-[6-(3-Trifluoromethyl-benzyloxy)-pyridin-3-ylmethyl]-1H-pyrrolo[2,3-b]p-
yridine P-0057. MS (ESI) [M+H.sup.+].sup.+=384.3.
[0608] Additional compounds may be prepared using steps 2-4 of
Scheme 28, replacing (3-trifluoromethyl-phenyl)-methanol with an
appropriate benzyl alcohol. The following compounds were made
following this procedure: [0609]
3-[6-(4-Chloro-benzyloxy)-pyridin-3-ylmethyl]-1H-pyrrolo[2,3-b]pyr-
idine (P-0056) [0610]
3-[6-(3-Chloro-benzyloxy)-pyridin-3-ylmethyl]-1H-pyrrolo[2,3-b]pyridine
(P-0055) The benzyl alcohols used in step 2 of this procedure are
indicated in column 2 of the following table, with the compound
structure indicated in column 3. Column 1 provides the compound
number and Column for the measured mass spectrometry result.
TABLE-US-00003 [0610] MS(ESI) [M + H.sup.+].sup.+ Benzyl alcohol
Compound observed P-0056 ##STR00094## ##STR00095## 350.3 P-0055
##STR00096## ##STR00097## 350.3
Example 27
Synthesis of
[2-Chloro-6-(4-chloro-benzylamino)-pyridin-3-yl]-(1H-pyrrolo[2,3-b]pyridi-
n-3-yl)-methanone P-0048
[0611]
[2-Chloro-6-(4-chloro-benzylamino)-pyridin-3-yl]-(1H-pyrrolo[2,3-b]-
pyridin-3-yl)-methanone P-0048 was synthesized in 3 steps from
commercially available 2,6-dichloropyridine-3-carboxylic acid 75 as
shown in Scheme 29.
##STR00098##
Step 1--Preparation of 2,6-dichloropyridine-3-carbonyl chloride
(76)
[0612] To 2,6-dichloropyridine-3-carboxylic acid (75, 1.00 g,
0.00521 mol) in dichloromethane (75 mL) was added 2 M Oxalyl
chloride (2.61 mL, 0.727 g, 0.00573 mol). The solution began to
show vigorous gas evolution, which slowed but continued for about 2
hours. The reaction was allowed to continue at room temperature for
an additional 3 hours. The reaction was concentrated to give the
compound as a brown oil that crystallized on standing (76, 1.09 g,
99%).
Step 2--Preparation of (2,6-dichloropyridin-3-yl)
(1H-pyrrolo[2,3-b]pyridin-3-yl)methanone (77)
[0613] To Aluminum trichloride (4.18 g, 0.0314 mol) and
dichloromethane (97.5 mL, 1.52 mol) under an atmosphere of nitrogen
was added 1H-Pyrrolo[2,3-b]pyridine (1, 828.5 mg, 0.0070 mol) in
dichloromethane (5.0 mL). The reaction was stirred at room
temperature for 60 minutes, then added
2,6-dichloropyridine-3-carbonyl chloride (76, 1.09 g, 0.00523 mol)
in dichloromethane (6.0 mL). The reaction was stirred at room
temperature for 2 hours. A precipitate formed, and nitromethane was
added in .about.1 mL portions until almost all solid dissolved (8
mL). After an additional 60 minutes at room temperature, the
reaction was slowly poured into water and extracted with ethyl
acetate. The organic layer was dried over anhydrous magnesium
sulfate and filtered. The filtrate was concentrated to give 1.54 g
of solid, which turned dark purple on sitting overnight. The solid
was treated with dichloromethane, and the insoluble material was
collected by vacuum filtration to give compound (77, 863 mg, 57%).
MS (ESI) [M+H.sup.+].sup.+=292.2.
Step 3--Preparation of
[2-Chloro-6-(4-chloro-benzylamino)-pyridin-3-yl]-(1H-pyrrolo[2,3-b]pyridi-
n-3-yl)-methanone (P-0048)
[0614] To (2,6-dichloropyridin-3-yl)
(1H-pyrrolo[2,3-b]pyridin-3-yl)methanone (77, 0.0570 g, 0.195 mmol)
was added 2-propanol (1.5 mL) followed by p-chlorobenzylamine (61,
49.8 .mu.L, 0.410 mmol). The reaction was microwaved at 300 watts,
100.degree. C. for 10 minutes, at 120.degree. C. for 10 minutes,
and finally at 150.degree. C. for 10 minutes. Additional
p-chlorobenzylamine (50 .mu.L, 0.410 mmol) was added and the
reaction continued at 150.degree. C. for 20 minutes. The reaction
was extracted with ethyl acetate and 1 M sodium bicarbonate. The
organic layer was dried over anhydrous magnesium sulfate and
filtered. The filtrate was concentrated and purified by silica gel
column chromatography eluting with dichloromethane followed by 1%
methanol to give compound (P-0048, 47 mg, 61%). MS (ESI)
[M+H.sup.+].sup.+=397.3.
[0615] Additional compounds may be prepared according to Scheme 29,
replacing 2,6-dichloropyridine-3-carboxylic acid with an
appropriate carboxylic acid.
(6-(4-chlorobenzylamino)-2-(trifluoromethyl)pyridin-3-yl)
(1H-pyrrolo[2,3-b]pyridin-3-yl)methanone P-0070
##STR00099##
was made following this protocol, using
6-Chloro-2-trifluoromethyl-nicotinic acid as the carboxylic acid
(prepared in two steps from commercially available
2-chloro-6-(trifluoromethyl)pyridine according to Cottet, F. and
Schlosser, M. Eur. J. Org. Chem. 2004, 3793-3798). MS (ESI)
[M+H.sup.+].sup.+=431.2.
Example 28
Synthesis of
3-((1H-pyrrolo[2,3-b]pyridin-3-yl)methyl)-6-(4-chlorobenzylamino)pyridin--
2-ol P-0051
[0616]
3-((1H-pyrrolo[2,3-b]pyridin-3-yl)methyl)-6-(4-chlorobenzylamino)py-
ridin-2-ol P-0051 was synthesized in 2 steps from
[2-Chloro-6-(4-chloro-benzylamino)-pyridin-3-yl]-(1H-pyrrolo[2,3-b]pyridi-
n-3-yl)-methanone P-0048 as shown in Scheme 30.
##STR00100##
Step 1--Preparation of
(6-(4-chlorobenzylamino)-2-chloropyridin-3-yl)(1H-pyrrolo[2,3-b]pyridin-3-
-yl)methanol (P-0050)
[0617] To
[2-Chloro-6-(4-chloro-benzylamino)-pyridin-3-yl]-(1H-pyrrolo[2,3-
-b]pyridin-3-yl)-methanone (P-0048, 0.045 g, 0.00011 mol, prepared
as described in Example 27) was added methanol (10 mL) and sodium
borohydride (0.00428 g, 0.000113 mol). The reaction was allowed to
stir at 50.degree. C. overnight. The volatiles were removed from
the reaction, and the resulting material was extracted with ethyl
acetate and 1M aqueous sodium bicarbonate. The organic layer was
dried over magnesium sulfate and filtered. The filtrate was
concentrated and purified by silica gel column chromatography
eluting with dichloromethane followed by 1% methanol in
dichloromethane to give the compound (P-0050, 31 mg, 68%). MS (ESI)
[M+H.sup.+].sup.+=399.2.
Step 2--Preparation of
3-((1H-pyrrolo[2,3-b]pyridin-3-yl)methyl)-6-(4-chlorobenzylamino)pyridin--
2-ol (P-0051)
[0618] To (6-(4-chlorobenzylamino)-2-chloropyridin-3-yl)
(1H-pyrrolo[2,3-b]pyridin-3-yl)methanol (P-0050, 0.028 g, 0.000070
mol) dissolved in acetonitrile (1 mL) was added triethylsilane
(42.6 uL, 0.000266 mol) and trifluoroacetic acid (28.4 uL, 0.000368
mol). The reaction was heated at 85.degree. C. overnight. The
reaction was extracted with ethyl acetate and saturated sodium
bicarbonate. The organic layer was separated, dried over magnesium
sulfate and filtered. The filtrate was concentrated and purified by
silica gel column chromatography eluting with dichloromethane, 3%,
5% and finally 10% methanol in dichloromethane to give the compound
as a white solid (P-0051, 20 mg, 78%). MS (ESI)
[M+H.sup.+].sup.+=365.3.
Example 29
Synthesis of 5 substituted 7-azaindole intermediates
[0619] 5-(2-Morpholin-4-yl-ethoxy)-1H-pyrrolo[2,3-b]pyridine 79 was
synthesized in 1 Step from commercially available 5-bromo-azaindole
as shown in Scheme 31.
##STR00101##
Step 1-5--(2-Morpholin-4-yl-ethoxy)-1H-pyrrolo[2,3-b]pyridine
(79)
[0620] To 4-morpholineethanol (30 mL, 0.2 mol) in
N,N-dimethylformamide (30 mL) was slowly added sodium hydride (7 g,
60% dispersion in mineral oil, 0.2 mol). After the solution turned
clear, a solution of 5-bromo-7-azaindole (44, 1.0 g, 0.0051 mol) in
N,N-dimethylformamide (5 mL) and copper(I) bromide (1.4 g, 0.0098
mol) were added. The reaction mixture was stirred at 120.degree. C.
under nitrogen for 2 hours. The reaction mixture was concentrated
and the residue was dissolved in ethyl acetate and water. The
organic layer was collected, washed with a solution of ammonium
chloride and ammonium hydroxide (4:1), brine, and dried over
magnesium sulfate. After removal of solvent, the residue was
purified by silica gel column chromatography eluting with ethyl
acetate in hexane to provide the compound as an off-white solid
(79, 0.62 g, 50%). MS (ESI) [M+H.sup.+].sup.+=248.25.
[0621] Additional 5-substituted 7-azaindoles were prepared
following the protocol of Scheme 31, replacing 4-morpholineethanol
with either 2-diethylamino-ethanol, 3-diethylamino-propan-1-ol,
2-piperidin-1-yl-ethanol, or 2-pyrrolidin-1-yl-ethanol to provide
diethyl-[2-(1H-pyrrolo[2,3-b]pyridin-5-yloxy)-ethyl]-amine,
Diethyl-[3-(1H-pyrrolo[2,3-b]pyridin-5-yloxy)-propyl]-amine,
5-(2-piperidin-1-yl-ethoxy)-1H-pyrrolo[2,3-b]pyridine, and
5-(2-pyrrolidin-1-yl-ethoxy)-1H-pyrrolo[2,3-b]pyridine,
respectively.
Example 30
Synthesis of
{5-[5-(2-Morpholin-4-yl-ethoxy)-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl]pyrid-
in-2-yl}-(4-trifluoromethyl-benzyl)-amine P-0065
[0622]
{5-[5-(2-Morpholin-4-yl-ethoxy)-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl-
]-pyridin-2-yl}-(4-trifluoromethyl-benzyl)-amine P-0065 was
synthesized in 4 Steps from
(5-bromo-pyridin-2-yl)-(4-trifluoromethylbenzyl)-amine 17 as shown
in Scheme 32.
##STR00102##
Step 1--Preparation of
6-(4-Trifluoromethyl-benzylamino)-pyridine-3-carbaldehyde (18)
[0623] To a solution of
(5-bromo-pyridin-2-yl)-(4-trifluoromethyl-benzyl)-amine (17, 3.55
g, 0.0107 mol, commercially available, or prepared as described in
Example 10) in tetrahydrofuran (150 mL) was added tert-butyllithium
(13.2 mL, 1.70 M in pentane, 0.0224 mol) slowly under an atmosphere
of nitrogen at -78.degree. C. over 10 minutes. The reaction mixture
was stirred at -78.degree. C. for 90 minutes. N,N-Dimethylformamide
(2.2 mL, 0.028 mol) was added slowly into the reaction mixture. The
reaction mixture was stirred at -78.degree. C. for 2 hours, then
allowed to warm to room temperature. After stirring at room
temperature for 2 hours, the reaction mixture was poured into ice
water and extracted with ethyl acetate. The organic phase was
washed with saturated sodium bicarbonate, brine, and dried over
magnesium sulfate. After removal of solvent, the residue was
purified by silica gel column chromatography eluting with ethyl
acetate in hexane to provide the compound as a light yellow solid
(18, 1.67 g, 56%).
Step 2--Preparation of
(5-Formyl-pyridin-2-yl)-(4-trifluoromethyl-benzyl)-carbamic acid
tert-butyl ester (19)
[0624] To a solution of
6-(4-trifluoromethyl-benzylamino)-pyridine-3-carbaldehyde (18, 3.7
g, 0.013 mol) and di-tert-butyldicarbonate (3.4 g, 0.016 mol) in
dichloromethane (100 mL) was added N,N-diisopropylethylamine (4.6
mL, 0.026 mol) and 4-diethylaminopyridine (0.2 g, 0.002 mol). The
reaction mixture was stirred at room temperature overnight. The
reaction mixture was concentrated and then dissolved in ethyl
acetate. The solution was washed with hydrochloric acid (10%),
saturated sodium bicarbonate, brine, and dried over magnesium
sulfate. After removal of solvent, the residue was purified by
silica gel column chromatography eluting with ethyl acetate in
hexane to provide the compound as a white solid (19, 4.38 g,
87%).
Step 4--Preparation of
(5-{Hydroxy-[5-(2-morpholin-4-yl-ethoxy)-1H-pyrrolo[2,3-b]pyridin-3-yl]-m-
ethyl}-pyridin-2-yl)-(4-trifluoromethyl-benzyl)-carbamic acid
tert-butyl ester (80)
[0625] A mixture of
(5-Formyl-pyridin-2-yl)-(4-trifluoromethyl-benzyl)-carbamic acid
tert-butyl ester (19, 315 mg, 0.828 mmol),
5-(2-morpholin-4-yl-ethoxy)-1H-pyrrolo[2,3-b]pyridine (79, 205 mg,
0.829 mmol, prepared as described in Example 29), and potassium
hydroxide (70 mg, 1 mmol) in methanol (25 mL) was stirred at room
temperature overnight. The reaction mixture was poured into ice
water, extracted with ethyl acetate, washed with brine, and dried
over sodium sulfate. After removal of solvent, the residue was
purified by silica gel column chromatography eluting with methanol
in dichloromethane to provide the compound as a yellow solid (80,
0.2 g, 40%). MS (ESI) [M+H.sup.+].sup.+=628.42.
Step 5--Preparation of
{5-[5-(2-Morpholin-4-yl-ethoxy)-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl]-pyri-
din-2-yl}-(4-trifluorom ethyl-benzyl)-amine (P-0065)
[0626] A mixture of
(5-{Hydroxy-[5-(2-morpholin-4-yl-ethoxy)-1H-pyrrolo[2,3-b]pyridin-3-yl]-m-
ethyl}-pyridin-2-yl)-(4-trifluoromethyl-benzyl)-carbamic acid
tert-butyl ester (80, 0.2 g, 0.3 mmol), triethylsilane (4 mL, 0.02
mol), and trifluoroacetic acid (2 mL, 0.02 mol) in acetonitrile (30
mL) was refluxed for 2 hours. After removal of solvent, the residue
was dissolved in ethyl acetate, washed with saturated sodium
bicarbonate, brine, and dried over magnesium sulfate. After removal
of solvent, the residue was purified by silica gel column
chromatography eluting with methanol in dichloromethane to provide
the compound as a light yellow solid (P-0065, 17 mg, 10%). MS (ESI)
[M+H.sup.+].sup.+=512.42.
[0627] Additional compounds may be prepared using steps 3 and 4 of
Scheme 32, using
(5-Formyl-pyridin-2-yl)-(4-trifluoromethyl-benzyl)-carbamic acid
tert-butyl ester 19 or replacing it with
(5-Formyl-pyridin-2-yl)-(4-chloro-benzyl)-carbamic acid tert-butyl
ester (43, prepared as described in Example 17) and replacing
5-(2-Morpholin-4-yl-ethoxy)-1H-pyrrolo[2,3-b]pyridine 79 with an
appropriate azaindole, prepared as in Example 29 or
5-methoxy-7-azaindole (prepared as described in Example 31) or with
commercially available 5-chloro-7-azaindole. The following
compounds were made following this procedure: [0628]
[5-(5-Methoxy-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(4-trifl-
uoromethyl-benzyl)-amine (P-0053), [0629]
[5-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(4-triflu-
oromethyl-benzyl)-amine (P-0054), [0630]
(4-Chloro-benzyl)-[5-(5-methoxy-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyri-
din-2-yl]-amine (P-0058), [0631]
(4-Chloro-benzyl)-[5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrid-
in-2-yl]-amine (P-0059), [0632]
{5-[5-(2-Diethylamino-ethoxy)-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl]-pyridi-
n-2-yl}-(4-trifluoromethyl-benzyl)-amine (P-0060), [0633]
(4-Chloro-benzyl)-{5-[5-(2-morpholin-4-yl-ethoxy)-1H-pyrrolo[2,3-b]pyridi-
n-3-ylmethyl]-pyridin-2-yl}-amine (P-0063), [0634]
{5-[5-(2-Pyrrolidin-1-yl-ethoxy)-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl]-pyr-
idin-2-yl}-(4-trifluoromethyl-benzyl)-amine (P-0064), [0635]
{5-[5-(3-Diethylamino-propoxy)-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl]-pyrid-
in-2-yl}-(4-trifluoromethyl-benzyl)-amine (P-0066), [0636]
(4-Chloro-benzyl)-{5-[5-(3-diethylamino-propoxy)-1H-pyrrolo[2,3-b]pyridin-
-3-ylmethyl]-pyridin-2-yl}-amine (P-0069), The aldehyde and
azaindole used in step 4 of this procedure are indicated in columns
2 and 3 of the following table, respectively, with the compound
structure indicated in column 4. Column 1 provides the compound
reference number and Column 5 the experimental mass spectrometry
result.
TABLE-US-00004 [0636] MS(ESI) [M + H.sup.+].sup.+ Aldehyde
Azaindole Compound observed P-0053 ##STR00103## ##STR00104##
##STR00105## 413.2 P-0054 ##STR00106## ##STR00107## ##STR00108##
417.2 P-0058 ##STR00109## ##STR00110## ##STR00111## 379.2 P-0059
##STR00112## ##STR00113## ##STR00114## 383.2 P-0060 ##STR00115##
##STR00116## ##STR00117## 498.4 P-0063 ##STR00118## ##STR00119##
##STR00120## 478.3 P-0064 ##STR00121## ##STR00122## ##STR00123##
496.3 P-0066 ##STR00124## ##STR00125## ##STR00126## 512.3 P-0069
##STR00127## ##STR00128## ##STR00129## 478.3
Example 31
Synthesis of
3-[6-(4-Trifluoromethyl-benzylamino)-pyridin-3-ylmethyl]-1H-pyrrolo[2,3-b-
]pyridin-5-ol P-0061
[0637]
3-[6-(4-Trifluoromethyl-benzylamino)-pyridin-3-ylmethyl]-1H-pyrrolo-
[2,3-b]pyridin-5-ol P-0061 was synthesized in 6 Steps from
5-bromo-7-azaindole 44 as described in Scheme 33.
##STR00130## ##STR00131##
Step 1--Preparation of 5-Methoxy-1H-pyrrolo[2,3-b]pyridine (81)
[0638] To a mixture of 5-bromo-7-azaindole (1 g, 0.005 mol) in
N,N-Dimethylformamide (20 mL) and methanol (20 mL) were added
sodium methoxide (13 g, 0.24 mol) and Copper (I) bromide (0.7 g,
0.0048 mol) at room temperature. The reaction mixture was stirred
at 120.degree. C. under nitrogen for 3 hours. The reaction mixture
was concentrated and the residue was dissolved in ethyl acetate and
water. The organic layer was collected, washed with a solution of
ammonium chloride and ammonium hydroxide (4:1), brine, and dried
over magnesium sulfate. After removal of solvent, the residue was
purified by silica gel column chromatography eluting with ethyl
acetate in hexane to provide the compound as a white solid (81, 0.4
g, 50%). MS (ESI) [M+.sup.+].sup.+=149.09.
Step 2--Preparation of 1H-Pyrrolo[2,3-b]pyridin-5-ol (82)
[0639] To a solution of 5-methoxy-1H-pyrrolo[2,3-b]pyridine (81,
0.5 g, 3 mmol) in tetrahydrofuran (20 mL) was added boron
tribromide (1.5 g, 6.0 mmol) at 0.degree. C. The reaction mixture
was allowed to warm to room temperature, then stirred at room
temperature for 3 hours. The reaction mixture was quenched by
methanol. After repeated addition of methanol and removal of
solvent, the concentrated reaction mixture was dissolved in ethyl
acetate and water. The organic layer was collected, washed with
brine, and dried over magnesium sulfate. After removal of solvent,
the residue was purified by silica gel column chromatography
eluting with ethyl acetate in hexane to provide the compound as an
off-white solid (82, 0.18 g, 40%).
Step 3--Preparation of
5-Triisopropylsilanyloxy-1H-pyrrolo[2,3-b]pyridine (83)
[0640] To a solution of 1H-Pyrrolo[2,3-b]pyridin-5-ol (0.5 g, 0.004
mol) and 1H-imidazole (0.98 g, 0.014 mol) in N,N-dimethylformamide
(5 mL) was added triisopropylsilyl chloride (1 mL, 0.005 mol). The
reaction mixture was stirred at room temperature overnight.
Dichloromethane (10 mL) was added and the solution was washed with
brine and dried over sodium sulfate. After removal of solvent, the
residue was purified by silica gel column chromatography eluting
with ethyl acetate in hexane to provide the compound as a viscous
liquid (83, 0.4 g, 40%).
Step 4--Preparation of
{5-[Hydroxy-(5-triisopropylsilanyloxy-1H-pyrrolo[2,3-b]pyridin-3-yl)-meth-
yl]-pyridin-2-yl}-(4-trifluoromethyl-benzyl)-carbamic acid
tert-butyl ester (84)
[0641] A mixture of
(5-Formyl-pyridin-2-yl)-(4-trifluoromethyl-benzyl)-carbamic acid
tert-butyl ester (19, 41 mg, 0.11 mmol, prepared as described in
Example 30), 5-triisopropylsilanyloxy-1H-pyrrolo[2,3-b]pyridine
(83, 34 mg, 0.12 mmol) and potassium hydroxide (9.8 mg, 0.17 mmol)
in methanol (10 mL) was stirred at room temperature overnight. The
reaction mixture was poured into water, extracted with ethyl
acetate, washed with brine and dried over sodium sulfate. After
removal of solvent, the residue was purified by silica gel column
chromatography eluting with ethyl acetate in hexane to provide the
compound as a viscous liquid (84, 0.05 g, 70%). MS (ESI)
[M+H.sup.+].sup.+=671.38.
Step 5--Preparation of
(4-Trifluoromethyl-benzyl)-[5-(5-triisopropylsilanyloxy-1H-pyrrolo[2,3-b]-
pyridin-3-ylmethyl)-pyridin-2-yl]-amine (85)
[0642] A mixture of
{5-[hydroxy-(5-triisopropylsilanyloxy-1H-pyrrolo[2,3-b]pyridin-3-yl)-meth-
yl]-pyridin-2-yl}-(4-trifluoromethyl-benzyl)-carbamic acid
tert-butyl ester (84, 0.05 g, 0.07 mmol), trifluoroacetic acid (0.5
mL, 0.006 mol), and triethylsilane (1 mL, 0.006 mol) in
acetonitrile (10 mL) was refluxed for 2 hours. The reaction mixture
was poured into ice water, extracted with ethyl acetate, washed
with saturated sodium bicarbonate, brine, and dried over sodium
sulfate. After removal of solvent, the residue was purified by
silica gel column chromatography eluting with ethyl acetate in
hexane to provide the compound as a viscous liquid (85, 0.04 g,
97%). MS (ESI) [M+H.sup.+].sup.+=555.38.
Step 6--Preparation of
3-[6-(4-Trifluoromethyl-benzylamino)-pyridin-3-ylmethyl]-1H-pyrrolo[2,3-b-
]pyridin-5-ol (P-0061)
[0643] To
(4-Trifluoromethyl-benzyl)-[5-(5-triisopropylsilanyloxy-1H-pyrro-
lo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-amine (85, 0.13 g, 0.23
mmol) in tetrahydrofuran (10 mL) was added tetrabutylammonium
fluoride (3 mL, 1.0 M in tetrahydrofuran, 3 mmol). The reaction
mixture was stirred at room temperature overnight, and then was
stirred at 65.degree. C. for 48 hours. The reaction mixture was
concentrated and purified by silica gel column chromatography
eluting with ethyl acetate in hexane to provide the compound as a
viscous liquid (P-0061, 0.062 g, 66%). MS (ESI)
[M+H.sup.+].sup.+=399.19.
3-[6-(4-Chloro-benzylamino)-pyridin-3-ylmethyl]-1H-pyrrolo[2,3-b]pyridin-5-
-ol P-0062
##STR00132##
[0644] was prepared following the protocol of Scheme 33, replacing
(5-Formyl-pyridin-2-yl)-(4-trifluoromethyl-benzyl)-carbamic acid
tert-butyl ester 19 with
(5-Formyl-pyridin-2-yl)-(4-chloro-benzyl)-carbamic acid tert-butyl
ester (43, prepared as described in Example 17). MS (ESI)
[M+H.sup.+].sup.+=365.2.
Example 32
Synthesis of
N-[5-(1H-Pyrrolo[2,3-b]pyridine-3-carbonyl)-pyridin-2-yl]-4-trifluorometh-
yl-benzamide P-0067
[0645]
N-[5-(1H-Pyrrolo[2,3-b]pyridine-3-carbonyl)-pyridin-2-yl]-4-trifluo-
romethyl-benzamide P-0067 was synthesized in 2 Steps from
7-azaindole 1 as described in Scheme 34.
##STR00133##
Step 1--Preparation of
(6-Bromo-pyridin-3-yl)-(1H-pyrrolo[2,3-b]pyridin-3-yl)-methanone
(87)
[0646] To a solution of 1H-Pyrrolo[2,3-b]pyridine (1, 1.2 g, 0.010
mol) in dichloromethane (50 mL) was added 6-bromo-nicotinoyl
chloride (86, 2.6 g, 0.012 mol) at -10.degree. C. After the
solution turned clear, aluminum trichloride (10.2 g, 0.0765 mol)
was added in one portion with vigorous stirring. The reaction
mixture was stirred at -10.degree. C. for 30 minutes, then was
allowed to warm to room temperature and stirred at room temperature
overnight. The reaction was quenched with ice water and neutralized
with sodium bicarbonate. The solution was extracted with
dichloromethane, washed with brine, and dried over sodium sulfate.
After removal of solvent, the residue was purified by silica gel
column chromatography eluting with methanol in dichloromethane to
provide the compound as a white solid (87, 0.35 g, 11%).
Step 2--Preparation of
N-[5-(1H-Pyrrolo[2,3-b]pyridine-3-carbonyl)-pyridin-2-yl]-4-trifluorometh-
yl-benzamide (P-0067)
[0647] A mixture of
(6-bromo-pyridin-3-yl)-(1H-pyrrolo[2,3-b]pyridin-3-yl)-methanone
(87, 160 mg, 0.53 mmol), 4-trifluoromethyl benzamide (51, 130 mg,
0.69 mmol), xanthphos (9 mg, 0.02 mmol), cesium carbonate (245 mg,
0.752 mmol), and tris(dibenzylideneacetone)dipalladium (0) (5 mg,
0.005 mmol) in toluene (2 mL) in a sealed tube was stirred at
110.degree. C. for 1 hour. The reaction was quenched with water and
extracted with dichloromethane. The organic layer was collected,
washed with brine and dried over sodium sulfate. After removal of
the solvent, the residue was purified with silica gel column
chromatography eluting with ethyl acetate in hexane to provide the
compound as an off-white solid (P-0067, 0.42 mg, 19%). MS (ESI)
[M+H.sup.+].sup.+=411.17.
N-[5-(1H-Pyrrolo[2,3-b]pyridine-3-carbonyl)-pyridin-2-yl]-4-trifluoromethy-
l-benzenesulfonamide P-0068
##STR00134##
[0648] was prepared following the protocol of Scheme 34, replacing
4-trifluoromethyl benzamide 51 with
4-trifluoromethyl-benzenesulfonamide in Step 2. MS (ESI)
[M+H.sup.+].sup.+=445.1.
Example 33
Synthesis of
[(S)-1-(4-Chloro-phenyl)-ethyl]-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)--
pyridin-2-yl]-amine P-0075
[0649]
[(S)-1-(4-Chloro-phenyl)-ethyl]-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylme-
thyl)-pyridin-2-yl]-amine P-0075 was synthesized in 3 Steps from
7-azaindole 1 as described in Scheme 35.
##STR00135##
Step 1--Preparation of
(6-Bromo-pyridin-3-yl)-(1H-pyrrolo[2,3-b]pyridin-3-yl)-methanol
(89)
[0650] A mixture of 1H-Pyrrolo[2,3-b]pyridine (1, 1.2 g, 0.010
mol), 6-bromo-pyridine-3-carbaldehyde (88, 1.8 g, 0.0097 mol), and
potassium hydroxide (1.8 g, 0.032 mol) in methanol (25 mL) was
stirred at room temperature overnight. The reaction mixture was
poured into ice water, extracted with ethyl acetate, washed with
brine, and dried over sodium sulfate. After removal of solvent, the
residue was purified by silica gel column chromatography eluting
with methanol in dichloromethane to provide the compound as a white
solid (89, 1.4 g, 45%), or may be used as mixture of 89 and 90 in
Step 2.
Step 2--Preparation of
3-(6-Bromo-pyridin-3-ylmethyl)-1H-pyrrolo[2,3-b]pyridine (91)
[0651] A mixture of
(6-bromo-pyridin-3-yl)-(1H-pyrrolo[2,3-b]pyridin-3-yl)-methanol
(89, 1 g, 0.003 mol) and
3-[(6-bromo-pyridin-3-yl)-methoxy-methyl]-1H-pyrrolo[2,3-b]pyridine
(90, 2 g, 0.006 mol), triethylsilane (1 mL, 0.006 mol), and
trifluoroacetic acid (0.5 mL, 0.006 mol) in acetonitrile (25 mL)
was refluxed for 2 hours. The reaction mixture was concentrated and
the residue was dissolved in ethyl acetate and water. The organic
layer was collected, washed with saturated sodium bicarbonate,
brine, and dried over sodium sulfate. After removal of the solvent,
the residue was purified with silica gel column chromatography
eluting with ethyl acetate in hexane to provide the compound as an
off-white solid (91, 0.75 g, 60%). MS (ESI)
[M+H.sup.+].sup.+=288.06, 290.00.
Step 3--Preparation of [(S)-1-(4-Chloro
phenyl)-ethyl]-[5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]amin-
e P-0075
[0652] A mixture of
3-(6-bromo-pyridin-3-ylmethyl)-1H-pyrrolo[2,3-b]pyridine (91, 100
mg, 0.0003 mol) and (S)-1-(4-chloro-phenyl)-ethylamine (92, 0.5 g,
0.003 mol) in N-methylpyrrolidine (3 mL) was stirred at 150.degree.
C. in microwave for 100 minutes. The reaction mixture was
concentrated under vacuum and the residue was purified with silica
gel column chromatography eluting with ethyl acetate in hexane to
provide the compound as a white solid (P-0075, 0.03 g, 20%). MS
(ESI) [M+H.sup.+].sup.+=363.18.
Example 34
Synthesis of
(4-Chloro-benzyl)-[4-chloro-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiaz-
ol-2-yl]-amine P-0083
[0653]
(4-Chloro-benzyl)-[4-chloro-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-
-thiazol-2-yl]-amine P-0083 was synthesized in 4 steps from
2,4-Dichloro-thiazole-5-carbaldehyde 93 as described in Scheme
36.
##STR00136##
Step 1--Preparation of
4-Chloro-2-(4-chloro-benzylamino)-thiazole-5-carbaldehyde (94)
[0654] To a solution of p-chlorobenzylamine (61, 283 mg, 2.00 mmol)
and N,N-Diisopropylethylamine (0.697 mL) in tetrahydrofuran (20 mL)
was slowly added 2,4-Dichloro-thiazole-5-carbaldehyde (93, 364 mg,
2.00 mmol) in tetrahydrofuran (10 mL) at room temperature. The
reaction was stirred at room temperature overnight. The reaction
mixture was poured into iced water, extracted with ethyl acetate,
washed with brine, and dried over sodium sulfate. After removal of
solvent, the residue was purified by silica gel column
chromatography eluting with ethyl acetate in hexane to provide the
compound as a yellow solid (94, 0.3 g, 50%). MS (ESI)
[M-H+]=286.97.
Step 2--Preparation of
(4-Chloro-benzyl)-(4-chloro-5-formyl-thiazol-2-yl)-carbamic acid
tert-butyl ester (95)
[0655] To a solution of
4-Chloro-2-(4-chloro-benzylamino)-thiazole-5-carbaldehyde (94, 0.32
g, 0.0011 mol) in dichloromethane (20 mL) was slowly added
N,N-diisopropylethylamine (0.4 mL, 0.002 mol),
4-dimethylaminopyridine (27 mg, 0.22 mmol), and a solution of
di-tert-Butyldicarbonate (290 mg, 0.0013 mol) in dichloromethane (5
mL) at room temperature. The reaction mixture was stirred at room
temperature overnight, then poured into iced water, extracted with
dichloromethane, washed with brine, and dried over sodium sulfate.
After removal of solvent, the residue was purified by silica gel
column chromatography eluting with ethyl acetate in hexane to
provide the compound as a light brown solid (95, 0.32 g, 74%). MS
(ESI) [M+H.sup.+]=387.26.
Step 3--Preparation of
(4-Chloro-benzyl)-{4-chloro-5-[hydroxy-(1-triisopropylsilanyl-1H-pyrrolo[-
2,3-b]pyridin-3-yl)-methyl]-thiazol-2-yl}-carbamic acid tert-butyl
ester (97)
[0656] To a solution of
3-Iodo-1-triisopropylsilanyl-1H-pyrrolo[2,3-b]pyridine (96, 99 mg,
0.25 mmol) in tetrahydrofuran (5 ml) at -20.degree. C. under
nitrogen was added 2.0 M solution isopropylmagnesium chloride in
tetrahydrofuran (0.2 ml, 0.31 mmol). The reaction mixture was
stirred for 1.5 hours, then allowed to warm to 5.degree. C. After
the reaction mixture was cooled down to -20.degree. C., a solution
of (4-Chloro-benzyl)-(4-chloro-5-formyl-thiazol-2-yl)-carbamic acid
tert-butyl ester (95, 80 mg, 0.2 mmol) in tetrahydrofuran (5 mL)
was slowly added. The reaction mixture was stirred for 2.5 hrs,
then allowed to warm to 5.degree. C. The reaction mixture was
poured into iced water, extracted with ethyl acetate, washed with
brine, and dried over magnesium sulfate. After removal of solvent,
the residue was purified by silica gel column chromatography
eluting with ethyl acetate in hexane to provide the compound as an
off-white solid (97, 76 mg, 50%). MS (ESI) [M+H+]=661.32,
663.32.
Step 4--Preparation of
(4-Chloro-benzyl)-[4-chloro-5-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-thiaz-
ol-2-yl]-amine (P-0083)
[0657] A mixture of
(4-Chloro-benzyl)-{4-chloro-5-[hydroxy-(1-triisopropylsilanyl-1H-pyrrolo[-
2,3-b]pyridin-3-yl)-methyl]-thiazol-2-yl}-carbamic acid tert-butyl
ester (97, 76 mg, 0.11 mmol), triethylsilane (0.5 mL, 3 mmol), and
trifluoroacetic acid (0.25 mL, 3.2 mmol) in acetonitrile (5 mL) was
refluxed for 3 hours. The reaction mixture was poured into iced
water, extracted with ethyl acetate, washed with sodium
bicarbonate, brine, and dried over sodium sulfate. After removal of
solvent, the residue was purified by silica gel column
chromatography eluting with ethyl acetate in hexane to provide the
compound as a yellow solid (P-0083, 5.6 mg, 14%). MS (ESI)
[M+H+]=389.35, 390.36.
Example 35
Synthesis of
[2-(4-Chloro-benzylamino)-thiazol-5-yl]-(1H-pyrrolo[2,3-b]pyridin-3-yl)-m-
ethanone P-0077
[0658]
[2-(4-Chloro-benzylamino)-thiazol-5-yl]-(1H-pyrrolo[2,3-b]pyridin-3-
-yl)-methanone P-0077 was synthesized in 2 steps from
2-Bromo-thiazole-5-carboxylic acid 98 and 1H-pyrrolo[2,3-b]pyridine
1 as shown in Scheme 37.
##STR00137##
Step 1--Preparation of
(2-Bromo-thiazol-5-yl)-(1H-pyrrolo[2,3-b]pyridin-3-yl)-methanone
(99)
[0659] A suspension of 2-Bromo-thiazole-5-carboxylic acid (98, 0.5
g, 0.002 mol) in oxalyl chloride (3 mL) was stirred at room
temperature until it turned into a clear solution. Solvent was
removed and the residue was dried over vacuum. A light yellow solid
was obtained and was dissolved in dichloromethane (10 mL) and
slowly added to a solution of 1H-Pyrrolo[2,3-b]pyridine (1, 0.34 g,
0.0029 mol) in dichloromethane (30 mL) at -10.degree. C. To the
mixture was then added aluminum trichloride (2.6 g, 0.019 mol) in
one portion with vigorous stirring. The reaction was held at
-10.degree. C. for 30 minutes, then allowed to warm to room
temperature. The reaction mixture was stirred at ambient
temperature overnight. The reaction was quenched with ice-water and
acidified with hydrochloric acid (10%) to pH 4. The solution was
then extracted with dichloromethane. The organic layer was
collected, washed with brine, and dried over magnesium sulfate.
After removal of solvent, the residue was purified by silica gel
column chromatography eluting with ethyl acetate in hexane to
provide the compound as a white solid (99, 12 mg, 2%). MS (ESI)
[M-H+]=369.09.
Step 2--Preparation of
[2-(4-Chloro-benzylamino)-thiazol-5-yl]-(1H-pyrrolo[2,3-b]pyridin-3-yl)-m-
ethanone (P-0077)
[0660] A mixture of
(2-Bromo-thiazol-5-yl)-(1H-pyrrolo[2,3-b]pyridin-3-yl)-methanone
(99, 5 mg, 0.02 mmol), p-chlorobenzylamine (61, 10 mg, 0.08 mmol),
and N,N-Diisopropylethylamine (10 .mu.L, 0.08 mmol) in
tetrahydrofuran (10 mL), in a sealed reaction vessel, was stirred
room temperature overnight. The reaction mixture was poured into
iced water, extracted with ethyl acetate, washed with brine, and
dried over magnesium sulfate. After removal of solvent, the residue
was purified by silica gel column chromatography eluting with ethyl
acetate in hexane to provide the compound as a light yellow solid
(P-0077, 2 mg, 30%). MS (ESI) [M+H+]=305.90, 307.88.
Example 36
Synthesis of
3-((5-chloro-3-methyl-1-phenyl-1H-pyrazol-4-yl)methyl)-1H-pyrrolo[2,3-b]p-
yridine P-0080
[0661]
3-((5-chloro-3-methyl-1-phenyl-1H-pyrazol-4-yl)methyl)-1H-pyrrolo[2-
,3-b]pyridine P-0080 was synthesized in 2 steps from
5-chloro-3-methyl-1-phenyl-1H-pyrazole-4-carbaldehyde 100 and
7-azaindole 1 as shown in Scheme 38.
##STR00138##
Step 1--Preparation of
3-((5-chloro-3-methyl-1-phenyl-1H-pyrazol-4-yl)(methoxy)methyl)-1H-pyrrol-
o[2,3-b]pyridine (P-0079)
[0662] To 1H-Pyrrolo[2,3-b]pyridine (1, 0.100 g, 0.846 mmol) and
5-chloro-3-methyl-1-phenyl-1H-pyrazole-4-carbaldehyde (100, 0.205
g, 0.931 mmol) was added 2 mL of methanol to give a solution.
Potassium hydroxide (0.0475 g, 0.846 mmol) was added and the
reaction was allowed to stir at room temperature for 48 hours. The
reaction was extracted with ethyl acetate and water. The organic
layer was dried over anhydrous magnesium sulfate and filtered. The
filtrate was concentrated and purified by silica gel column
chromatography eluting with a gradient of 0-5% methanol in
dichloromethane to give the compound (P-0079, 32 mg, 11%). MS (ESI)
[M+H.sup.+].sup.+=353.2.
Step 2--Preparation of
3-((5-chloro-3-methyl-1-phenyl-1H-pyrazol-4-yl)methyl)-1H-pyrrolo[2,3-b]p-
yridine (P-0080)
[0663] To 3-((5-chloro-3-methyl-1-phenyl-1H-pyrazol-4-yl)
(methoxy)methyl)-1H-pyrrolo[2,3-b]pyridine (P-0079, 0.030 g, 0.085
mmol) was added acetonitrile (10 mL, 0.2 mol). Trifluoroacetic acid
(500 uL, 0.006 mol) and triethylsilane (500 uL, 0.003 mol) were
added and the reaction allowed to stir at room temperature for 16
hours. The reaction was extracted with ethyl acetate and water. The
organic layer was dried over anhydrous magnesium sulfate and
filtered. The filtrate was concentrated and purified by silica gel
column chromatography eluting with dichloromethane followed 5%
methanol in dichloromethane to give the compound as a yellowish
foam (P-0080, 29 mg, 98%).
[0664] MS (ESI) [M+H.sup.+].sup.+=323.2.
Example 37
cKit Kinase Domain and Construction of c-Kit Sequences
[0665] c-Kit cDNA sequence is available from NCBI, e.g., as GenBank
accession number NM.sub.--000222. Using this sequence, c-kit DNA
sequences can be cloned from commercially available libraries (e.g.
cDNA libraries) or can be synthesized by conventional cloning
methods.
[0666] Using conventional cloning methods, constructs encoding
three c-kit polypeptides were prepared, and used to express c-kit
kinase domain polypeptides. One such active c-kit kinase domain
sequence included residues P551-S948, with the deletion of residues
Q694-T753.
Example 38
Expression and Purification of c-Kit Kinase Domain
[0667] Purified c-kit kinase domain can be obtained using
conventional expression and purification methods. Exemplary methods
are described, for example, in Lipson et al., U.S. 20040002534
(U.S. application Ser. No. 10/600,868, filed Jun. 23, 2003), which
is incorporated herein by reference in its entirety.
Example 39
Binding Assays
[0668] Binding assays can be performed in a variety of ways,
including a variety of ways known in the art. For example, as
indicated above, binding assays can be performed using fluorescence
resonance energy transfer (FRET) format, or using an
AlphaScreen
[0669] Alternatively, any method which can measure binding of a
ligand to the ATP-binding site can be used. For example, a
fluorescent ligand can be used. When bound to c-kit, the emitted
fluorescence is polarized. Once displaced by inhibitor binding, the
polarization decreases.
[0670] Determination of IC.sub.50 for compounds by competitive
binding assays. (Note that K.sub.1 is the dissociation constant for
inhibitor binding; K.sub.D is the dissociation constant for
substrate binding.) For this system, the 1050, inhibitor binding
constant and substrate binding constant can be interrelated
according to the following Formula:
[0671] When using radiolabeled substrate
K I = IC 50 1 + [ L * ] / K D , ##EQU00002##
[0672] the IC.sub.50.about.K.sub.I when there is a small amount of
labeled substrate.
Example 40
Cell-Based Assays of c-fms Kinase Activity or c-Kit Kinase
Activity
[0673] M-CSF dependent RAW264.7 cells were seeded on a 12 well
plate, 2.5.times.10.sup.5 cells/well and the cells were allowed to
attach overnight at 37.degree. C., 5% CO.sub.2. The cells were then
starved in serum-free medium overnight at 37.degree. C., 5%
CO.sub.2. The cells were treated with compound for 1 hour in
serum-free media (1% DMSO final concentration); and then stimulated
with 20 ng/ml M-CSF for 5 minutes. After stimulation, the cells
were lysed on ice, and the lysates were centrifuged at 13,000 rpm
for 1 minute. The amount of protein in the sample was quantitated,
sample buffer was added, and the samples were boiled at 95.degree.
C. for 10 minutes. The samples were then centrifuged at 13,000 rpm
for 1 minute. The samples (15-20 .mu.g/lane) were loaded and run on
4-12% tris-glycine gel at 75V, and then transferred onto a PVDF
membrane. The membrane was blocked for 1 hour with 5% BSA in PBS/1%
Tween-20 (PBST); or 5% milk, depending on the primary antibody
used. Then the blots were incubated with primary antibody overnight
at 4 degrees with gentle shaking After incubation with the capture
antibody, the membranes were washed 3.times.10 minutes with PBST;
then incubated with detection antibody Goat Anti-Rabbit-HRP for 1
hour, with gentle shaking. The membranes were washed again
3.times.10 minutes with PBST. ECL Plus substrate was then added to
the blots, the image captured with chemiluminescence camera, and
the bands quantitated for pFMS and FMS levels.
[0674] The Fms inhibitors may also be assessed using M-NFS-60 mouse
myelogenous leukemia cell line (ATCC catalog #CRL-1838). This cell
line proliferation is stimulated by M-CSF, which binds and
activates the fms tyrosine kinase receptor Inhibitors of fms kinase
activity reduce or eliminate the M-CSF stimulated kinase activity,
resulting in reduced cell proliferation. This inhibition is
measured as a function of compound concentration to assess
IC.sub.50 values. M-NFS-60 cells were seeded at 5.times.10.sup.4
cells per well of a 96 well cell culture plate in 50 .mu.l of cell
culture medium of RPMI 1640 (CellGro Mediatech catalog #10-040-CV)
supplemented with 10% FBS (HyClone catalog #SH30071.03). Compounds
were dissolved in DMSO at a concentration of 1 mM and were serially
diluted 1:3 for a total of eight points and added to the cells to
final concentrations of 10, 3.3, 1.1, 0.37, 0.12, 0.041, 0.014 and
0.0046 .mu.M in 100 .mu.l cell culture medium (final concentration
0.2% DMSO). Cells were also treated with staurosporine as a
positive control. The cells were stimulated by adding 20 .mu.l of
372 ng/ml M-CSF to a final concentration of 62 ng/ml (R&D
Systems catalog #216-MC). The cells were incubated at 37.degree.
C., 5% CO.sub.2 for three days. CellTiter-Glo Buffer (Promega Cell
Viability Assay catalog #G7573) and substrate were equilibrated to
room temperature, and enzyme/substrate Recombinant Firefly
Luciferase/Beetle Luciferin was reconstituted. The cell plates were
equilibrated to room temperature for 30 minutes, then lysed by
addition of an equivalent volume of the Celltiter-Glo Reagent. The
plate was mixed for 2 minutes on a plate shaker to lyse the cells,
then incubated for 10 minutes at room temperature. The plates were
read on a Victor Wallac II using Luminescence protocol modified to
read 0.1 s per well. The luminescence reading assesses the ATP
content, which correlates directly with cell number such that the
reading as a function of compound concentration was used to
determine the IC.sub.50 value.
[0675] The c-Kit inhibitors were assessed using M-07e cell line
(DSMZ catalog #ACC 104). The M-07e proliferation is stimulated by
SCF (Stem Cell Factor), which binds and activates c-Kit tyrosine
kinase receptor. Inhibitors of c-Kit kinase reduce or eliminate the
SCF mediated kinase activation, resulting in reduced cell
proliferation of SCF stimulated cells. This inhibition is measured
by the effect of compound concentration on cell growth to assess
IC.sub.50 values. M-07e cells were seeded at 5.times.10.sup.4 cells
per well of a 96 well cell culture plate in 50 .mu.l of cell
culture medium of Iscove's Medium 1.times. (MOD, CellGro Mediatech
catalog #15-016-CV) supplemented with 10% FBS (HyClone catalog
#SH30071.03). Compounds were dissolved in DMSO at a concentration
of 0.1 mM and were serially diluted 1:3 for a total of eight points
and added to the cells to final concentrations of 1, 0.33, 0.11,
0.037, 0.012, 0.0041, 0.0014 and 0.00046 .mu.M in 100 .mu.l cell
culture medium (final concentration 0.2% DMSO). Cells were also
treated with staurosporine as a positive control. Cells were
stimulated by adding 20 .mu.l of 600 ng/ml SCF to a final
concentration of 100 ng/ml (Biosource International SCF kit ligand
catalog #PHC2115) in cell culture medium. The cells were incubated
at 37.degree. C., 5% CO.sub.2 for three days. CellTiter-Glo Buffer
(Promega Cell Viability Assay catalog #G7573) and substrate were
equilibrated to room temperature, and enzyme/substrate Recombinant
Firefly Luciferase/Beetle Luciferin was reconstituted. The cell
plates were equilibrated to room temperature for 30 minutes, then
lysed by addition of an equivalent volume of the Celltiter-Glo
Reagent. The plate was mixed for 2 minutes on a plate shaker to
lyse the cells, then incubated for 10 minutes at room temperature.
The plates were read on a Victor Wallac II using Luminescence
protocol modified to read 0.1 s per well. The luminescence reading
assesses the ATP content, which correlates directly with cell
number such that the reading as a function of compound
concentration is used to determine the IC.sub.50 value.
[0676] This cell based assay was also used to assess
phosphorylation. Samples were prepared with compounds as described
for the growth inhibition assay only M-07e cells were seeded at
2.times.10.sup.5 cells per well in a 96 well filter plate. Cells
were incubated for 1 hour at 37.degree. C. with the compounds as
described above, and then stimulated by adding SCF to a final
concentration of 50 ng/ml and incubated for 10 minutes at
37.degree. C. The culture medium was removed by centrifugation and
the cells were lysed by addition of 30 .mu.l lysis buffer (25 mM
Tris HCl pH 7.5, 150 mM NaCl, 5 mM EDTA, 1% Triton X100, 5 mM NaF,
1 mM NaVanadate, 10 mM Beta-glycerophosphate, no EDTA
(Boehringer-Roche catalog #1873580) and placed on ice for 30
minutes. A 15 .mu.l aliquot of the lysate was taken and assayed
according to Biosource Immunoassay Kit: Human c-Kit [pY823]
(Catalog #KHO0401) by diluting the aliquot with 85 .mu.l dilution
buffer in the assay plate, incubating for 2 hours at room
temperature and washing the plate 4 times with wash buffer.
Detection antibody (100 .mu.l) was added to the plate and samples
incubated for 1 hour at room temperature, then washed 4 times with
wash buffer. HRP anti-rabbit antibody (100 .mu.l) was added and
samples incubated for 30 minutes at room temperature, then washed 4
times with wash buffer. Stabilized chromogen (100 .mu.l) was added
and samples incubated for 15-25 minutes at room temperature, then
washed 4 times with wash buffer. Stop solution (100 .mu.l) was
added and the samples read on a Wallac Victor reader at 450 nm. The
absorbance was plotted against the compound concentration and the
IC.sub.50 concentration was determined.
Example 41
c-Kit and c-Fms Activity Assays
[0677] The effect of potential modulators of kinase activity of
c-kit and other kinases can be measured in a variety of different
assays known in the art, e.g., biochemical assays, cell-based
assays, and in vivo testing (e.g. model system testing). Such in
vitro and/or in vivo assays and tests can be used in the present
invention. As an exemplary kinase assay, the kinase activity of
c-kit or Fms is measured in AlphaScreening (Packard
BioScience).
[0678] Exemplary c-kit Biochemical Assay
[0679] The c-kit (or kinase domain thereof) is an active kinase in
AlphaScreen. IC.sub.50 values are determined with respect to
inhibition of c-Kit kinase activity, where inhibition of
phosphorylation of a peptide substrate is measured as a function of
compound concentration. Compounds to be tested were dissolved in
DMSO to a concentration of 20 mM. These were diluted 30 .mu.l into
120 .mu.l of DMSO (4 mM) and 1 .mu.l was added to an assay plate.
These were then serially diluted 1:3 (50 .mu.l to 100 .mu.l DMSO)
for a total of 8 points. Plates were prepared such that each kinase
reaction is 20 .mu.l in 1.times. kinase buffer (50 mM HEPES, pH
7.2, 5 mM MgCl.sub.2, 5 mM MnCl.sub.2, 0.01% NP-40, 0.2% BSA), 5%
DMSO and 10 .mu.M ATP. Substrate was 100 nM biotin-(E4Y)3 (Open
Source Biotech, Inc.). C-kit kinase was at 0.1 ng per sample. After
incubation of the kinase reaction for 1 hour at room temperature, 5
.mu.l of donor beads (Streptavidin coated beads (Perkin Elmer Life
Science) final concentration 1 .mu.g/ml) in stop buffer (50 mM EDTA
in 1.times. kinase buffer) was added, the sample was mixed and
incubated for 20 minutes at room temperature before adding 5 .mu.l
of acceptor beads (PY20 coated beads (Perkin Elmer Life Science)
final concentration 1 .mu.g/ml) in stop buffer. The samples were
incubated for 60 minutes at room temperature and the signal per
well was read on AlphaQuest reader. Phosphorylated substrate
results in binding of the PY20 antibody and association of the
donor and acceptor beads such that signal correlates with kinase
activity. The signal vs. compound concentration was used to
determine the IC.sub.50.
[0680] Compounds were also tested using a similar assay with a
10-fold higher ATP concentration. For these samples, compounds to
be tested were dissolved in DMSO to a concentration of 20 mM. These
were diluted 30 .mu.l into 120 .mu.l of DMSO (4 mM) and 1 .mu.l was
added to an assay plate. These were then serially diluted 1:3 (50
.mu.l to 100 .mu.l DMSO) for a total of 8 points. Plates were
prepared such that each kinase reaction is 20 .mu.l in 1.times.
kinase buffer (8 mM MOPS pH 7.0, 1 mM MgCl.sub.2, 2 mM MnCl.sub.2,
0.01% Tween-20, 1 mM DTT, and 0.001% BSA), 5% DMSO and 100 .mu.M
ATP. Substrate was 30 nM biotin-(E4Y)10 (Upstate Biotech, Cat#
12-440). C-kit kinase was at 1 ng per sample. After incubation of
the kinase reaction for 1 hour at room temperature, 5 .mu.l of
donor beads (Streptavidin coated beads (Perkin Elmer Life Science)
final concentration 10 .mu.g/ml) in stop buffer (8 mM MOPS pH 7.0,
100 mM EDTA, 0.3% BSA) was added, the sample was mixed and
incubated for 20 minutes at room temperature before adding 5 .mu.l
of acceptor beads (PY20 coated beads (Perkin Elmer Life Science)
final concentration 10 .mu.g/ml) in stop buffer. The samples were
incubated for 60 minutes at room temperature and the signal per
well was read on AlphaQuest reader. Phosphorylated substrate
results in binding of the PY20 antibody and association of the
donor and acceptor beads such that signal correlates with kinase
activity. The signal vs. compound concentration was used to
determine the IC.sub.50.
[0681] The c-kit enzyme used in the above assay was either obtained
from Cell Signaling Technology (Cat. #7754) or was prepared as
follows: A plasmid encoding kit (DNA and encoded protein sequences
shown below) was engineered using common polymerase chain reaction
(PCR) methods. Complementary DNA cloned from various human tissues
were purchased from Invitrogen, and these were used as substrates
in the PCR reactions. Specific custom synthetic oligonucleotide
primers were designed to initiate the PCR product, and also to
provide the appropriate restriction enzyme cleavage sites for
ligation with the plasmids. The entire sequence encoding the enzyme
was made through a gene synthesis procedure, using custom synthetic
oligonucleotides covering the entire coding sequence (Invitrogen,
see below).
[0682] The plasmid used for ligation with the kinase-encoding
inserts was derivative of pET (Novagen) for expression using E.
coli. The Kit kinase was engineered to include a Histidine tag for
purification using metal affinity chromatography. The
kinase-encoding plasmid was engineered as bicistronic mRNA to
co-express a second protein that modifies the kinase protein during
its expression in the host cell. Protein tyrosine phosphatase 1B
(PTP), was co-expressed for dephosphorylation of the
phospho-Tyrosines.
[0683] For protein expression, the plasmid containing the Kit gene
was transformed into E. coli strains BL21(DE3)RIL and transformants
selected for growth on LB agar plates containing appropriate
antibiotics. Single colonies were grown overnight at 37.degree. C.
in 200 ml TB (Terrific broth) media. 16.times.1 L of fresh TB media
in 2.8 L flasks were inoculated with 10 ml of overnight culture and
grown with constant shaking at 37.degree. C. Once cultures reached
an absorbance of 1.0 at 600 nm, IPTG was added and cultures were
allowed to grow for a further 12 to 18 hrs at temperatures ranging
from 12-30.degree. C. Cells were harvested by centrifugation and
pellets frozen at -80.degree. C. until ready for lysis.
[0684] For protein Purification; frozen E. coli cell pellets were
resuspended in lysis buffer and lysed using standard mechanical
methods. Protein was purified via poly-Histidine tags using
immobilized metal affinity purification IMAC. The Kit kinase was
purified using a 3 step purification process utilizing; IMAC, size
exclusion chromatography and ion exchange chromatography. The
poly-Histidine tag was removed using Thrombin (Calbiochem).
[0685] Compounds were assayed using a similar assay to that
described above, using in a final reaction volume of 25 .mu.l:
c-Kit (h) (5-10 mU) in 8 mM MOPS pH 7.0, 0.2 mM EDTA, 10 mM
MnCl.sub.2, 0.1 mg/ml poly (Glu, Tyr) 4:1, 10 mM MgAcetate and
.gamma.-.sup.33P-ATP (approximately 500 cpm/pmol), with appropriate
concentrations of compound. Incubated for 40 minutes at room
temperature and stopped by addition of 5 .mu.l of 3% phosphoric
acid. Spotted 10 .mu.l of each sample onto Filtermat A and washed
3.times. with 75 mM phosphoric acid, once with methanol, dried and
measured on scintillation counter (performed at Upstate USA,
Charlottesville, Va.).
[0686] Compounds P-0001, P-0002, P-0003, P-0004, P-0005, P-0006,
P-0007, P-0008, P-0009, P-0010, P-0011, P-0012, P-0013, P-0014,
P-0015, P-0016, P-0017, P-0018, P-0020, P-0022, P-0024, P-0025,
P-0026, P-0027, P-0028, P-0030, P-0031, P-0032, P-0033, P-0038,
P-0053, P-0054, P-0055, P-0056, P-0057, P-0058, P-0059, P-0060,
P-0061, P-0062, P-0063, P-0064, P-0065, P-0066, P-0069, P-0071,
P-0072, P-0073, P-0074, P-0075, P-0078, and P-0082 had IC.sub.50 of
less than 1 .mu.M in at least one of the c-kit assays described
above in Examples 40 and 41.
TABLE-US-00005 Kit PCR primers KIT 8K1A
ATGTACGAAGTTCAGTGGAAAGTTGTTGAAGAAATCAACGG 1776 (SEQ ID NO: 5) 8K1B
GGTCGATGTAAACGTAGTTGTTACCGTTGATTTCTTCAACAACTTT 1777 (SEQ ID NO: 6)
8K2A AACAACTACGTTTACATCGACCCGACCCAGCTGCCGTACGAC 1779 (SEQ ID NO: 7)
8K2B GTTACGCGGGAACTCCCATTTGTGGTCGTACGGCAGCTGGGTC 1781 (SEQ ID NO:
8) 8K3A AAATGGGAGTTCCCGCGTAACCGTCTGTCTTTCGGTAAAACCC 1782 (SEQ ID
NO: 9) 8K3B ACCGAACGCACCCGCACCCAGGGTTTTACCGAAAGACAGAC 1783 (SEQ ID
NO: 10) 8K4A GGTGCGGGTGCGTTCGGTAAAGTTGTTGAAGCGACCGCGTACG 1784 (SEQ
ID NO: 11) 8K4B GCCGCGTCAGATTTGATCAGACCGTACGCGGTCGCTTCAAC 1785 (SEQ
ID NO: 12) 8K5A CTGATCAAATCTGACGCGGCGATGACCGTTGCGGTTAAAATGC 1786
(SEQ ID NO: 13) 8K5B GTCAGGTGCGCAGACGGTTTCAGCATTTTAACCGCAACGGTCA
1787 (SEQ ID NO: 14) 8K6A
AAACCGTCTGCGCACCTGACCGAACGTGAAGCGCTGATGTCTG 1788 (SEQ ID NO: 15)
8K6B CCAGGTAAGACAGAACTTTCAGTTCAGACATCAGCGCTTCACGT 1789 (SEQ ID NO:
16) 8K7A CTGAAAGTTCTGTCTTACCTGGGTAACCACATGAACATCGTTAA 1791 (SEQ ID
NO: 17) 8K7B GGTGCACGCACCCAGCAGGTTAACGATGTTCATGTGGTTAC 1792 (SEQ ID
NO: 18) 8K8A CTGCTGGGTGCGTGCACCATCGGTGGTCCGACCCTGGTTATCA 1793 (SEQ
ID NO: 19) 8K8B GTCACCGTAGCAGCAGTATTCGGTGATAACCAGGGTCGGACCA 1794
(SEQ ID NO: 20) 8K9A GAATACTGCTGCTACGGTGACCTGCTGAACTTCCTGCGTCGTA
1795 (SEQ ID NO: 21) 8K9B
AGAGCAGATGAAAGAGTCACGTTTACGACGCAGGAAGTTCAGC 1796 (SEQ ID NO: 22)
8K10A CGTGACTCTTTCATCTGCTCTAAACAGGAAGACCACGCGGAAG 1797 (SEQ ID NO:
23) 8K10B CAGCAGGTTTTTGTACAGCGCCGCTTCCGCGTGGTCTTCCTGT 1798 (SEQ ID
NO: 24) 8K11A GCGCTGTACAAAAACCTGCTGCACTCTAAAGAATCTTCTTGCTC 1799
(SEQ ID NO: 25) 8K11B CCATGTATTCGTTGGTAGAGTCAGAGCAAGAAGATTCTTTAGAGT
1811 (SEQ ID NO: 26) 8K11A
GACTCTACCAACGAATACATGGACATGAAACCGGGTGTTTCTTA 1812 (SEQ ID NO: 27)
8K11B TCCGCTTTGGTCGGAACAACGTAAGAAACACCCGGTTTCATGT 1813 (SEQ ID NO:
28) 8K12A GTTGTTCCGACCAAAGCGGACAAACGTCGTTCTGTTCGTATCG 1814 (SEQ ID
NO: 29) 8K12B TAACGTCACGTTCGATGTAAGAACCGATACGAACAGAACGACGTTT 1815
(SEQ ID NO: 30) 8K13A TCTTACATCGAACGTGACGTTACCCCGGCGATCATGGAAGACG
1816 (SEQ ID NO: 31) 8K13B CCAGGTCCAGCGCCAGTTCGTCGTCTTCCATGATCGCCGG
1817 (SEQ ID NO: 32) 8K14A
GAACTGGCGCTGGACCTGGAAGACCTGCTGTCTTTCTCTTACC 1818 (SEQ ID NO: 33)
8K14B GAACGCCATACCTTTCGCAACCTGGTAAGAGAAAGACAGCAGGT 1819 (SEQ ID NO:
34) 8K15A GTTGCGAAAGGTATGGCGTTCCTGGCGTCTAAAAACTGCATCCA 1821 (SEQ ID
NO: 35) 8K15B CGCGCCGCCAGGTCACGGTGGATGCAGTTTTTAGACGCC 1822 (SEQ ID
NO: 36) 8K16A CGTGACCTGGCGGCGCGTAACATCCTGCTGACCCACGGTCG 1823 (SEQ
ID NO: 37) 8K16B ACCGAAGTCGCAGATTTTGGTGATACGACCGTGGGTCAGCAGG 1824
(SEQ ID NO: 38) 8K17A ACCAAAATCTGCGACTTCGGTCTGGCGCGTGACATCAAAAACG
1825 (SEQ ID NO: 39) 8K17B
GTTACCTTTAACAACGTAGTTAGAGTCGTTTTTGATGTCACGCGCC 1826 (SEQ ID NO: 40)
8K18A TCTAACTACGTTGTTAAAGGTAACGCGCGTCTGCCGGTTAAATG 1827 (SEQ ID NO:
41) 8K18B GAAGATAGATTCCGGCGCCATCCATTTAACCGGCAGACGCGC 1829 (SEQ ID
NO: 42) 8K19A ATGGCGCCGGAATCTATCTTCAACTGCGTTTACACCTTCGAATC 1831
(SEQ ID NO: 43) 8K19B GATACCGTAAGACCAAACGTCAGATTCGAAGGTGTAAACGCAG
1832 (SEQ ID NO: 44) 8K20A
GACGTTTGGTCTTACGGTATCTTCCTGTGGGAACTGTTCTCTC 1833 (SEQ ID NO: 45)
8K20B CCTGTGGGAACTGTTCTCTCTGGGTTCTTCTCCGTACCCGG 1834 (SEQ ID NO:
46) 8K21A GGTTCTTCTCCGTACCCGGGTATGCCGGTTGACTCTAAATTCTAT 1835 (SEQ
ID NO: 47) 8K21B CGGAAACCTTCTTTGATCATTTTGTAGAATTTAGAGTCAACCGGC 1836
(SEQ ID NO: 48) 8K22A AAAATGATCAAAGAAGGTTTCCGTATGCTGTCTCCGGAACACG
1837 (SEQ ID NO: 49) 8K22B
ATGTCGTACATTTCCGCCGGCGCGTGTTCCGGAGACAGCATA 1838 (SEQ ID NO: 50)
8K23A CCGGCGGAAATGTACGACATCATGAAAACCTGCTGGGACGCG 1839 (SEQ ID NO:
51) 8K23B AAGGTCGGACGTTTCAGCGGGTCCGCGTCCCAGCAGGTTTTC 1841 (SEQ ID
NO: 52) 8K24A CCGCTGAAACGTCCGACCTTCAAACAGATCGTTCAGCTGATCG 1842 (SEQ
ID NO: 53) 8K24B TTGGTAGATTCAGAGATCTGTTTTTCGATCAGCTGAACGATCTGTT
1843 (SEQ ID NO: 54) 8K25A
AAACAGATCTCTGAATCTACCAACCACATCTACTCTAACCTGGC 1844 (SEQ ID NO: 55)
8K25B TGACGGTTCGGAGAGCAGTTCGCCAGGTTAGAGTAGATGTGG 1845 (SEQ ID NO:
56) 8K26A AACTGCTCTCCGAACCGTCAGAAACCGGTTGTTGACCACTCTG 1846 (SEQ ID
NO: 57) 8K26B GTAGAACCAACAGAGTTGATACGAACAGAGTGGTCAACAACCGGT 1847
(SEQ ID NO: 58) 8K27A CGTATCAACTCTGTTGGTTCTACCGCGTCTTCTTCTCAGCCG
1848 (SEQ ID NO: 59) 8K27B AACGTCGTCGTGAACCAGCAGCGGCTGAGAAGAAGACGCG
1849 (SEQ ID NO: 60) 8K-F GTTGTTTCATATGTACGAAGTTCAGTGGAAAG 1851
(SEQ ID NO: 61) 8K-R GTTGTTTGTCGACTAAACGTCGTCGTGAACCAGCAG 1852 (SEQ
ID NO: 62) KIT COD-K948X GTTCTTGTCGACTAtttctgacggttcggagagc 3411
(SEQ ID NO: 63)
TABLE-US-00006 P1332.N6 BI PTP KIT M552-K948-X COD (Nucleic Acid
SEQ ID NO: 64) (Protein SEQ ID NO: 65)
taatacgactcactataggggaattgtgagcggataacaattcccc
tctagaaataattttgtttaactttaagaaggagatataccatggg M G
tcaccaccatcaccatcatatgtacgaagttcagtggaaagttgtt H H H H H H M Y E V
Q W K V V gaagaaatcaacggtaacaactacgtttacatcgacccgacccagc E E I N G
N N Y V Y I D P T Q tgccgtacgaccacaaatgggagttcccgcgtaaccgtctgtcttt
L P Y D H K W E F P R N R L S F
cggtaaaaccctgggtgcgggtgcgttcggtaaagttgttgaagcg G K T L G A G A F G
K V V E A accgcgtacggtctgatcaaatctgacgcggcgatgaccgttgcgg T A Y G L
I K S D A A M T V A ttaaaatgctgaaaccgtctgcgcacctgaccgaacgtgaagcgct
V K M L K P S A H L T E R E A L
gatgtctgaactgaaagttctgtcttacctgggtaaccacatgaac M S E L K V L S Y L
G N H M N atcgttaacctgctgggtgcgtgcaccatcggtggtccgaccctgg I V N L L
G A C T I G G P T L ttatcaccgaatactgctgctacggtgacctgctgaacttcctgcgt
V I T E Y C C Y G D L L N F L R
cgtaaacgtgactctttcatctgctctaaacaggaagaccacgcgga R K R D S F I C S K
Q E D H A E agcggcgctgtacaaaaacctgctgcactctaaagaatcttcttgct A A L Y
K N L L H S K E S S C
ctgactctaccaacgaatacatggacatgaaaccgggtgtttcttac S D S T N E Y M D M
K P G V S Y gttgttccgaccaaagcggacaaacgtcgttctgttcgtatcggttc V V P T
K A D K R R S V R I G S
ttacatcgaacgtgacgttaccccggcgatcatggaagacgacgaact Y I E R D V T P A
I M E D D E L ggcgctggacctggaagacctgctgtctttctcttaccaggttgcgaa A L
D L E D L L S F S Y Q V A K
aggtatggcgttcctggcgtctaaaaactgcatccaccgtgacctggc G M A F L A S K N
C I H R D L A ggcgcgtaacatcctgctgacccacggtcgtatcaccaaaatctgcga A R
N I L L T H G R I T K I C D
cttcggtctggcgcgtgacatcaaaaacgactctaactacgttgttaa F G L A R D I K N
D S N Y V V K aggtaacgcgcgtctgccggttaaatggatggcgccggaatctatctt G N
A R L P V K W M A P E S I F
caactgcgtttacaccttcgaatctgacgtttggtcttacggtatctt N C V Y T F E S D
V W S Y G I F cctgtgggaactgttctctctgggttcttctccgtacccgggtatgcc L W
E L F S L G S S P Y P G M P
ggttgactctaaattctacaaaatgatcaaagaaggtttccgtatgct V D S K F Y K M I
K E G F R M L gtctccggaacacgcgccggcggaaatgtacgacatcatgaaaacctg S P
E H A P A E M Y D I M K T C
ctgggacgcggacccgctgaaacgtccgaccttcaaacagatcgttca W D A D P L K R P
T F K Q I V Q gctgatcgaaaaacagatctctgaatctaccaaccacatctactctaa L I
E K Q I S E S T N H I Y S N
cctggcgaactgctctccgaaccgtcagaaatagtcgactgaaaaagg L A N C S P N R Q
K - aagagt
[0687] Additional Biochemical and Cell-Based Assays
[0688] In general, any protein kinase assay can be adapted for use
with c-kit. For example, assays (e.g. biochemical and cell-based
assays) as described in Lipson et al., U.S. Patent Publ.
20040002534 (incorporated herein by reference in its entirety) can
be used in the present invention.
[0689] In Vivo Model System Testing
[0690] For in vivo testing, a suitable animal model system can be
selected for use. For example, for multiple sclerosis, the rodent
experimental allergic encephalomyelitis (EAE) is commonly used.
This system is well-known, and is described, for example, in
Steinman, 1996, Cell 85:299-302 and Secor et al., 2000, J. Exp. Med
5:813-821, which are incorporated herein by reference in their
entireties.
[0691] Similarly, other model systems can be selected and used in
the present invention.
[0692] Exemplary Fms Biochemical Assay
[0693] IC.sub.50 values were determined with respect to inhibition
of Fms kinase activity, where inhibition of phosphorylation of a
peptide substrate is measured as a function of compound
concentration. Compounds to be tested, dissolved in DMSO (1 .mu.L),
were added to a white 384-well plate (Costar #3705). Working stocks
of Fms kinase (Upstate Biotech, #14-551), biotin-(E4Y).sub.10
substrate (Upstate Biotech, Cat# 12-440), and ATP (Sigma,
Cat#A-3377) were prepared in 8 mM MOPS pH 7.4, 2 mM MgCl.sub.2, 8
mM MnCl.sub.2, 2 mM DTT, and 0.01% Tween-20. All components were
added to the 384-well plate for a final concentration of 0.5
ng/well Fms, 30 nM biotin-(E4Y).sub.10 (Upstate Biotechnology) and
10 .mu.M ATP in a volume of 20 .mu.L. Each sample was at 5% DMSO.
The plate was then incubated for 60 minutes at room temperature.
Just before use, working stocks of donor and acceptor beads from
the AlphaScreen PY20 Detection Kit (PerkinElmer, Cat#676601M) were
prepared in 8 mM MOPS, pH 7.4, 100 mM EDTA, 0.3% BSA. To stop the
reaction, the plate was uncovered in the dark and 5 .mu.l of Donor
Beads solution (Streptavidin beads) was added to each well. The
plate was incubated at room temperature for 20 minutes. Five
microliters of Acceptor Beads solution (PY20 coated beads) were
then added to each well. The final concentration of each bead was
20 .mu.g/mL. The plates were incubated at room temperature for 60
minutes. Fluorescence signal was recorded on the Fusion Alpha
reader or AlphaQuest reader. Phosphorylated substrate results in
binding of the PY20 antibody and association of the donor and
acceptor beads such that signal correlates with kinase activity.
The signal vs. compound concentration was used to determine the
IC.sub.50.
[0694] Compounds were also tested using a similar assay with a
10-fold higher ATP concentration. Compounds to be tested, dissolved
in DMSO (1 .mu.L), were added to a white 384-well plate (Costar
#3705). Working stocks of Fms kinase (Upstate Biotech, #14-551),
biotin-(E4Y).sub.10 substrate (Upstate Biotech, Cat# 12-440), and
ATP (Sigma, Cat#A-3377) were prepared in 8 mM MOPS pH 7.0, 2 mM
MgCl.sub.2, 8 mM MnCl.sub.2, 2 mM DTT, 50 mM NaCl, 0.01% BSA, and
0.01% Tween-20. All components were added to the 384-well plate for
a final concentration of 0.5 ng/well Fms, 30 nM biotin-(E4Y).sub.10
(Upstate Biotechnology) and 100 .mu.M ATP in a volume of 20 .mu.L.
Each sample was at 5% DMSO. The plate was then incubated for 20
minutes at 30.degree. C. Just before use, working stocks of donor
and acceptor beads from the AlphaScreen PY20 Detection Kit
(PerkinElmer, Cat#676601M) were prepared in 8 mM MOPS, pH 7.0, 100
mM EDTA, 0.01% BSA. To stop the reaction, the plate was uncovered
in the dark and 5 .mu.l of Donor Beads solution (Streptavidin
beads) was added to each well. The plate was incubated at room
temperature for 20 minutes. Five microliters of Acceptor Beads
solution (PY20 coated beads) were then added to each well. The
final concentration of each bead was 10 .mu.g/mL. The plates were
incubated at room temperature for 60 minutes. Fluorescence signal
was recorded on the Fusion Alpha reader or AlphaQuest reader.
Phosphorylated substrate results in binding of the PY20 antibody
and association of the donor and acceptor beads such that signal
correlates with kinase activity. The signal vs. compound
concentration was used to determine the IC.sub.50.
[0695] Compounds were assayed using a similar assay to that
described above, using in a final reaction volume of 25 .mu.l: Fms
(h) (5-10 mU) in 8 mM MOPS pH 7.0, 0.2 mM EDTA, 250 mM
KKKSPGEYVNIEFG (SEQ ID NO:66), 10 mM MgAcetate and
.gamma.-.sup.33P-ATP (approximately 500 cpm/pmol), with appropriate
concentrations of compound. Samples were incubated for 40 minutes
at room temperature and stopped by addition of 5 .mu.l of 3%
phosphoric acid. 10 .mu.l of each sample is spotted onto a P30
filtermat and washed 3.times. with 75 mM phosphoric acid, once with
methanol, dried and measured on scintillation counter (Upstate USA,
Charlottesville, Va.).
[0696] Compounds P-0001, P-0002, P-0003, P-0004, P-0005, P-0006,
P-0007, P-0008, P-0009, P-0010, P-0011, P-0013, P-0014, P-0015,
P-0016, P-0028, P-0032, P-0033, P-0038, P-0053, P-0054, P-0055,
P-0056, P-0057, P-0058, P-0059, P-0060, P-0061, P-0062, P-0063,
P-0064, P-0065, P-0066, P-0069, P-0072, P-0073, P-0074, P-0075,
P-0076, P-0078, P-0081, and P-0082 had IC.sub.50 of less than 1
.mu.M in at least one of the Fms assays described above in Examples
40 or 41.
Example 42
Site-Directed Mutagenesis of c-Kit, c-Fms and Other Kinases
[0697] Mutagenesis of c-kit and other kinases (as well as other
sequences of interest) can be carried out according to the
following procedure as described in Molecular Biology: Current
Innovations and Future Trends. Eds. A. M. Griffin and H. G.
Griffin. (1995) ISBN 1-898486-01-8, Horizon Scientific Press, PO
Box 1, Wymondham, Norfolk, U.K., among others.
[0698] In vitro site-directed mutagenesis is an invaluable
technique for studying protein structure-function relationships,
gene expression and vector modification. Several methods have
appeared in the literature, but many of these methods require
single-stranded DNA as the template. The reason for this,
historically, has been the need for separating the complementary
strands to prevent reannealing. Use of PCR in site-directed
mutagenesis accomplishes strand separation by using a denaturing
step to separate the complementing strands and allowing efficient
polymerization of the PCR primers. PCR site-directed methods thus
allow site-specific mutations to be incorporated in virtually any
double-stranded plasmid; eliminating the need for M13-based vectors
or single-stranded rescue.
[0699] It is often desirable to reduce the number of cycles during
PCR when performing PCR-based site-directed mutagenesis to prevent
clonal expansion of any (undesired) second-site mutations. Limited
cycling which would result in reduced product yield, is offset by
increasing the starting template concentration. A selection is used
to reduce the number of parental molecules coming through the
reaction. Also, in order to use a single PCR primer set, it is
desirable to optimize the long PCR method. Further, because of the
extendase activity of some thermostable polymerases it is often
necessary to incorporate an end-polishing step into the procedure
prior to end-to-end ligation of the PCR-generated product
containing the incorporated mutations in one or both PCR
primers.
[0700] The following protocol provides a facile method for
site-directed mutagenesis and accomplishes the above desired
features by the incorporation of the following steps: (i)
increasing template concentration approximately 1000-fold over
conventional PCR conditions; (ii) reducing the number of cycles
from 25-30 to 5-10; (iii) adding the restriction endonuclease DpnI
(recognition target sequence: 5-Gm6ATC-3, where the A residue is
methylated) to select against parental DNA (note: DNA isolated from
almost all common strains of E. coli is Dam-methylated at the
sequence 5-GATC-3); (iv) using Taq Extender in the PCR mix for
increased reliability for PCR to 10 kb; (v) using Pfu DNA
polymerase to polish the ends of the PCR product, and (vi)
efficient intramolecular ligation in the presence of T4 DNA
ligase.
[0701] Plasmid template DNA (approximately 0.5 pmole) is added to a
PCR cocktail containing, in 25 ul of 1.times. mutagenesis buffer:
(20 mM Tris HCl, pH 7.5; 8 mM MgCl.sub.2; 40 ug/ml BSA); 12-20
pmole of each primer (one of which must contain a 5-prime
phosphate), 250 uM each dNTP, 2.5 U Taq DNA polymerase, 2.5 U of
Taq Extender (Stratagene).
[0702] The PCR cycling parameters are 1 cycle of: 4 min at 94 C, 2
min at 50 C and 2 min at 72.degree. C.; followed by 5-10 cycles of
1 min at 94.degree. C., 2 min at 54 C and 1 min at 72.degree. C.
(step 1).
[0703] The parental template DNA and the linear, mutagenesis-primer
incorporating newly synthesized DNA are treated with DpnI (10 U)
and Pfu DNA polymerase (2.5 U). This results in the DpnI digestion
of the in vivo methylated parental template and hybrid DNA and the
removal, by Pfu DNA polymerase, of the Taq DNA polymerase-extended
base(s) on the linear PCR product.
[0704] The reaction is incubated at 37.degree. C. for 30 min and
then transferred to 72.degree. C. for an additional 30 min (step
2).
[0705] Mutagenesis buffer (1.times., 115 ul, containing 0.5 mM ATP)
is added to the DpnI-digested, Pfu DNA polymerase-polished PCR
products.
[0706] The solution is mixed and 10 .mu.l is removed to a new
microfuge tube and T4 DNA ligase (2-4 U) added.
[0707] The ligation is incubated for greater than 60 min at
37.degree. C. (step 3).
[0708] The treated solution is transformed into competent E. coli
(step 4).
[0709] In addition to the PCR-based site-directed mutagenesis
described above, other methods are available. Examples include
those described in Kunkel (1985) Proc. Natl. Acad. Sci. 82:488-492;
Eckstein et al. (1985) Nucl. Acids Res. 13:8764-8785; and using the
GeneEditor.TM. Site-Directed Mutageneis System from Promega.
[0710] In the following Examples, as well as in Examples 1-36
above, it is understood that the solvents and reagents used or
suggested are not limiting, and can be substituted appropriately
with solvents and reagents known to those of skill in the art.
Reaction products may be isolated by means known in the art, such
as extraction with a suitable solvent, precipitation from a
suitable solvent, chromatography using a suitable solvent system,
including silica gel column chromatography, HPLC, preparative TLC,
and the like.
[0711] Synthetic routes available to Formula I
##STR00139##
wherein X.sub.1, X.sub.2, Y.sub.1, Y.sub.2, L.sub.1, Ar.sub.1,
L.sup.2 and R.sup.1 are as defined in Formula I of [0012] or
Formula Ib
##STR00140##
wherein U, V, W, Z, R.sup.1, R.sup.15, R.sup.16, R.sup.17, A, M, E,
G, J, K, F and n are as defined in Formula Ib of [0026] are
described in the schemes and examples below. While the methods
described below are shown in terms of Formula Ib, it would be clear
to one skilled in the art that the methods may be used to prepare
compounds of either Formula I or Formula Ib. With reference to the
schemes and examples below, unless clearly specified to the
contrary, Formula and compound enumeration are defined for each
scheme or example independently of such enumeration in the
specification above, although general reference to Formula I and Ib
indicate the Formulae above described in [0012] and [0026],
respectively.
[0712] Compounds of Formula Ib can be prepared from compounds of
Formula III and Formula X as described in Scheme 39.
##STR00141##
[0713] Compound of Formula III, where R.sup.41 is either hydrogen
or a protecting group P (e.g. phenylsulfone, t-butyloxycarbonyl,
triisopropylsilyl) and R.sup.41 is either hydrogen or a functional
group appropriate for the coupling (e.g. Br, SH, OH, CHO etc.) is
reacted with compound of Formula X where R.sup.42 is a functional
group appropriately chosen, based on R.sup.40, to form the linkage
A using standard coupling conditions known to one skilled in the
art to provide a compound of Formula Ib.
[0714] Compounds of Formula Ib can be prepared from compounds of
Formula III and Formula Xa, where R.sup.43 is a functional group
appropriate for introduction of M-R.sup.1, is described in Scheme
40.
##STR00142##
[0715] Compound of Formula III, where R.sup.41 is either hydrogen
or a protecting group P (e.g. phenylsulfone, t-butyloxycarbonyl,
triisopropylsilyl) and R.sup.40 is either hydrogen or a functional
group appropriate for the coupling (e.g. Br, SH, OH, CHO etc.,) is
reacted with compound of Formula Xa where R.sup.42 is a functional
group appropriately chosen, based on R.sup.40, and R.sup.43 is a
functional group appropriate to introduce M-R.sup.1, to form the
linkage A using standard coupling conditions known to one skilled
in the art to provide compound of Formula II. Compound of Formula
II is further functionalized to introduce M-R.sup.1 using
conditions known to one skilled in the art to provide compound of
Formula Ib.
[0716] Steps 1 and 2 of Scheme 40 may be reversed such that
compounds of Formula X are prepared from compounds of Formula Xa by
methods of Step 2, followed by coupling of the resulting compounds
of Formula X with compounds of Formula III following the methods of
Step 1.
[0717] Many compounds of Formula X or Xa of Scheme 39 or 40 are
commercially available or may be prepared in many different routes
known in the literature, depending upon the specific ring system
and substitution pattern that is desired, including substitution of
nitrogen containing heterocycles, as well as de novo synthesis of
the aromatic heterocycle.
[0718] General synthesis of compound of Formula III of Scheme 39 or
40 where R.sup.40 is H or a functional group appropriate for
coupling to compounds of Formula X or Xa (e.g. aldehyde, carboxylic
acid, amine) is described in Scheme 41.
##STR00143##
[0719] Compounds of Formula IIIa, where U or Z is C--Br, C--Cl,
C--NO.sub.2 or C--NH.sub.2, can be generally prepared from
commercially available appropriate single heterocyclic ring or
fused two ring heterocyclic compounds using methods known to one
skilled in the art. Compound of Formula IIIa is further subjected
to modification to provide appropriately substituted compounds of
Formula III, where U or Z is C--Br, C--Cl, C--NO.sub.2 or
C--NH.sub.2, and R.sup.41 is H or protecting group P, using methods
known to one skilled in the art.
[0720] General synthesis of compound of Formula III of Scheme 39 or
40 from compound of Formula Mb, where R.sup.40 is H, is described
in Scheme 42.
##STR00144##
[0721] Compounds of Formula III, where R.sup.41 is either hydrogen
or a protecting group P and R.sup.40 is appropriate for coupling to
compounds of Formula X or Xa of Scheme 39 or 40 (e.g. aldehyde,
carboxylic acid, amine) or appropriate for modification to such
substituents (e.g. ester, nitro) may also be prepared from
compounds of Formula Mb (here R.sup.40 is H) using synthetic
methods known to one skilled in the art, for example as described
by Merour and Joseph in Curr. Org. Chem. 2001, 5:471-506.
[0722] In addition to these schemes, the reactions shown in the
following Examples may be combined in different sequences to
provide compounds of Formula Ib. The transformations shown in
Schemes 39-42 and the following Schemes and Examples as a single
step should be considered to represent the general overall
transformation, as some specific cases may require more than one
reaction step to realize the desired compound.
[0723] In the preparation of compounds of Formula Ib, Formula II
and Formula III it may frequently be advantageous to substitute the
hydrogen of the N--H in the 7-azaindole or its analog with a
protecting group as exemplified in Scheme 43, Step 1. The
protecting group can then be removed when appropriate to reveal the
N--H according to Step 2.
##STR00145##
Step 1--Preparation of Formula IIIc where R.sup.41 is a Protecting
Group P
[0724] Compound of Formula IIIc where R.sup.41 is a protecting
group P may be prepared by dissolving compound of Formula IIIa
where R.sup.41 is hydrogen in a non-reactive solvent (e.g.
dimethylformamide, tetrahydrofuran) and adding a base (e.g. aqueous
sodium hydroxide, sodium hydride) and possibly a catalyst (e.g.
tetrabutylammonium hydrogen sulfate). A reagent appropriate for the
introduction of the protecting group (e.g. phenylsulfonyl chloride,
triisopropylsilyl chloride, Boc anhydride) is then added and the
reaction is allowed to stir for one to several hours. Isolation and
purification by conventional means (e.g. extraction, silica gel
chromatography) provides compounds of Formula IIIc where R.sup.43
is a protecting group.
Step 2--Preparation of Formula IIIa where R.sup.41 is Hydrogen
[0725] Compound of Formula IIIa where R.sup.41 is hydrogen may be
prepared by dissolving compound of Formula IIIc where R.sup.41 is a
protecting group P in a suitable solvent (e.g. ethanol,
tetrahydrofuran, dichloromethane) and adding a reagent appropriate
for the removal of the protecting group (e.g. potassium hydroxide,
tetrabutylammonium fluoride, trifluoroeacetic acid). The reaction
is allowed to stir for 30 minutes to several hours with heating.
Isolation and purification by conventional means (e.g. extraction,
silica gel chromatography) provides compounds of Formula IIIa where
R.sup.43 is hydrogen.
[0726] Compounds of Formula II above are similar to compounds of
Formula Ib as shown, where R.sup.43 is defined as M-R.sup.1 or a
substituent appropriate for further substitution to provide
M-R.sup.1, and R.sup.41 is hydrogen or a protecting group P.
##STR00146##
[0727] Compounds of Formula II where U, V, W, Z, J, E, F, G, K are
C and n is 1 form compounds of Formula IIa below.
##STR00147##
[0728] The examples provided for the synthesis of compounds of
Formula IIa are also applicable to many compounds meeting other
definitions of Formula Ib and Formula II. For example, 7-azaindole,
Compound 1, may be replaced in these syntheses by compounds where
U, V, W, and Z are other than C--H.
Example 43
Synthesis of Compounds of Formula IIa, where A is CH.sub.2 or
C(O)
[0729] Compounds of Formula IIa, where A is CH.sub.2 or C(O) may be
synthesized from compounds of Formula Xb (Formula Xa wherein
R.sup.42 is C(O)H, J, E, F, G and K are C and n is 1) and compound
1 in two Steps according to Scheme 100.
##STR00148##
Step 1--Preparation of Formula XI where R.sup.44 is Hydrogen or
Methyl
[0730] To 7-azaindole 1 and a compound of Formula Xb is added an
appropriate solvent (e.g. polar solvents such as methanol,
tetrahydrofuran, and acetonitrile, or apolar solvents such as
toluene) followed by an appropriate hydroxide or alkoxide base
(e.g. potassium hydroxide, sodium methoxide). The reaction is
typically allowed to stir at room temperature overnight. Isolation
by conventional means (e.g. extraction and silica gel
chromatography) provides compounds of Formula XI where R.sup.44 is
hydrogen or compounds of Formula XI where R.sup.44 is methyl when
methanol is used as a solvent, or a mixture of compounds of Formula
XI where R.sup.44 is hydrogen or methyl when methanol is used as a
solvent. A resulting mixture may be separated by chromatography or
used as a mixture in Step 2.
Step 2a --Preparation of Formula IIa where A is CH.sub.2
[0731] To a compound of Formula XI where R.sup.44 is hydrogen or
methyl, in an appropriate polar solvent, (e.g. acetonitrile) is
added a reducing agent (e.g. trifluoroacetic acid and
triethylsilane). Typically, the reaction is allowed to stir at room
temperature overnight. Isolation by conventional means (e.g.
extraction and silica gel chromatography) provides compounds of
Formula IIa where A is CH.sub.2 and R.sup.41 is H.
Step 2b--Preparation of Formula IIa where A is C(O)
[0732] Compound of Formula IIa where A is C(O) is prepared by
oxidizing a compound of Formula XI where R.sup.44 is hydrogen with
an appropriate oxidizing agent (e.g. Dess-Martin reagent, TEMPO) in
a non-reactive solvent (e.g. tetrahydrofuran). Isolation by
conventional means (e.g. extraction and silica gel chromatography)
provides compound of Formula IIa where A is C(O) and R.sup.41 is
H.
[0733] The reaction of Scheme 100 may be applied generally to
compounds of Formula Xa, and also by replacing 7-azaindole 1, with
7-azaindoles substituted at the 4, 5, or 6 positions, preferable
the 4 or 5 positions, to provide compounds of Formula I wherein
X.sub.1 is CH and X.sub.2, Y.sub.1 and Y.sub.2 are CR.sup.6,
CR.sup.4 and CR.sup.5, respectively, or Formula Ib wherein V and W
are CH and U and Z are independently CR.sup.18. The compound of
Formula Xa may be commercially available, or may be synthesized
following the protocols of Examples herein. As such, a compound of
Formula IIa where A is CH.sub.2 (or analogous Formula I, Formula
Ib) is prepared by reacting a 7-azaindole compound, optionally
substituted at the 4, 5 or 6 position, with a suitable heteroaryl
aldehyde (Formula Xa wherein R.sup.42 is C(O)H) in an appropriate
solvent (e.g. methanol, tetrahydrofuran, acetonitrile, toluene)
with a hydroxide or alkoxide base (e.g. potassium hydroxide, sodium
methoxide). The resulting compound is reacted in a polar solvent
(e.g. acetonitrile) under reducing conditions to provide the
desired compound. A compound of Formula IIa where A is C(O) (or
analogous Formula I, Formula Ib) is prepared by reacting a
7-azaindole compound, optionally substituted at the 4, 5 or 6
position, with a suitable heteroaryl aldehyde (Formula Xa wherein
R.sup.42 is C(O)H) in an appropriate solvent (e.g. methanol,
tetrahydrofuran, acetonitrile, toluene) with a hydroxide or
alkoxide base (e.g. potassium hydroxide, sodium methoxide). From
the resulting compound, the alcohol intermediate (e.g. Formula XI
where R.sup.44 is OH) is isolated and reacted in a non-reactive
solvent (e.g. tetrahydrofuran) under oxidizing conditions to
provide the desired compound.
Example 44
Synthesis of Compounds of Formula IIa, where A is CH.sub.2 or
C(O)
[0734] Compounds of Formula IIa, where A is CH.sub.2 or C(O) may
also be synthesized from compounds of Formula Xc (Formula Xa
wherein J, E, F, G and K are C, n is 1, and R.sup.42 is an
organometallic substituent T) and compound IIId (Formula III
wherein U, V, W and Z are CH, R.sup.40 is C(O)H and R.sup.41 is P)
in four Steps according to Scheme 101.
##STR00149##
Step 1--Preparation of Formula IIId
[0735] 7-azaindole 1 is treated with hexamethyltetramine and acetic
acid in water with heating to reflux for a few hours to introduce
an aldehyde at the 3-position. This intermediate is isolated by
concentration and extraction. A protecting group P is added to the
N-1 position of the intermediate as described in Scheme 43, Step 1
to provide compound of Formula Md.
Step 2--Preparation of Formula Xc where R.sup.42 is T
[0736] Compound of Formula Xc where R.sup.42 is an organometallic
substituent T (e.g. lithium, MgBr) is obtained by treating compound
of Formula Xc, where R.sup.42 is bromine, with an organolithium
reagent (e.g. butyllithium) or magnesium, or via ortholithiation
with an organolithium reagent (e.g. butyllithium) when R.sup.42 is
hydrogen, in a non-reactive solvent (e.g. tetrahydrofuran),
typically at reduced temperature (e.g. -78.degree. C.) and used in
Step 3 without isolation.
Step 3--Preparation of Formula XIa
[0737] Compound of Formula Xc where R.sup.42 is T is added to
compound of Formula IIIc in a non-reactive solvent (e.g.
tetrahydrofuran) at reduced temperature (e.g. -78.degree. C.) and
stirred for several hours. After warming to room temperature,
isolation by conventional means (e.g. extraction and silica gel
chromatography) provides compound of Formula XIa.
Step 4a--Preparation of Formula IIa where A is CH.sub.2
[0738] To a compound of Formula XIa, in an appropriate polar
solvent, (e.g. acetonitrile) is added a reducing agent (e.g.
trifluoroacetic acid and triethylsilane). Typically, the reaction
is allowed to stir at room temperature overnight. Isolation by
conventional means (e.g. extraction and silica gel chromatography),
followed by deprotection of the N--P according to Scheme 43, Step 2
provides compounds of Formula IIa where A is CH.sub.2 and R.sup.41
is H.
Step 4b--Preparation of Formula IIa where A is C(O)
[0739] Compound of Formula IIa where A is C(O) is prepared from
compound of Formula XIa following the protocol of Example 43, Step
2b, followed by deprotection according to Scheme 43, Step 2 to
provide compound where R.sup.41 is H.
Example 45
Synthesis of Compounds of Formula IIa, where A is C(O) or
CH.sub.2
[0740] Compounds of Formula IIa, where A is C(O) or CH.sub.2, may
be synthesized from compounds of Formula Xd (Formula Xa wherein J,
E, F, G and K are C, n is 1, and R.sup.42 is C(O)Cl) and compound 1
in one and two Steps, respectively, according to Scheme 102.
##STR00150##
Step 1--Preparation of Formula IIa where A is C.dbd.O
[0741] Compound of Formula IIa where A is a carbonyl is prepared by
reacting compound 1 with an acid chloride of Formula Xd in the
presence of a Lewis acid (e.g. aluminum trichloride) in a
non-reactive solvent (e.g. dichloromethane) with stirring at room
temperature for several hours. The reaction may be quenched with
methanol and isolation by conventional means (e.g. extraction and
silica gel chromatography) provides compound of Formula IIa where A
is C.dbd.O and R.sup.41 is H.
Step 2--Preparation of Formula IIa where A is CH.sub.2
[0742] Compound of Formula IIa where A is CH.sub.2 may be prepared
by reacting compound IIa where A is C(O) with a reducing agent
(e.g. lithium aluminum hydride) in a non-reactive solvent (e.g.
tetrahydrofuran) for several hours. Isolation by conventional means
(e.g. extraction and silica gel chromatography) provides compound
of Formula IIa where A is CH.sub.2 and R.sup.41 is H.
Example 46
Synthesis of Compounds of Formula IIa, where A is CH.sub.2
[0743] Compounds of Formula IIa, where A is CH.sub.2 may be
synthesized from compound 1 in two Steps according to Scheme
103.
##STR00151##
Step 1--Preparation of Formula IIIe
[0744] Compound of Formula Me (Formula III where U, V, W and Z are
CH, R.sup.41 is P and R.sup.40 is CH.sub.2N(CH.sub.3).sub.2) is
synthesized from compound 1 following the literature procedure
(Robinson, J. Am. Chem. Soc., 1955, 77, p. 457), followed by
protection of the N--H according to Scheme 43, Step 1.
Step 2--Preparation of Formula IIa where A is CH.sub.2
[0745] Compounds of Formula IIa where A is CH.sub.2 is synthesized
through the reaction of compounds of Formula IIIe with isopropyl
chloroformate (or ethyl chloroformate) at room temperature in
toluene to give a 3-chloromethyl intermediate. This intermediate,
cooled to -78.degree. C., is reacted with an organocopper reagent
of Formula Xc where R.sup.42 is the metal (prepared as described in
Example 44, step 2) and a solution of copper cyanide and lithium
chloride. The reaction may be stirred at -78.degree. C. for one
hour then allowed to warm to room temperature and quenched with a
solution of 4:1 ammonium chloride:ammonium hydroxide. Isolation by
conventional means (e.g. extraction and silica gel chromatography)
provides compound of Formula IIa where A is CH.sub.2 and R.sup.41
is P, which can be removed according to Scheme 43 Step 2 to provide
the compound where R.sup.41 is H.
Example 47
Synthesis of Compounds of Formula IIa, where A is O
[0746] Compounds of Formula IIa, where A is O may be synthesized
from compound 1 in two Steps according to Scheme 104.
##STR00152##
Step 1--Preparation of Compound 400
[0747] 3-bromo-7-azaindole 400 may be prepared by dissolving
7-azaindole 1 in chloroform and slowly adding Br.sub.2 in carbon
tetrachloride at 0.degree. C. After stirring for 1-2 hours, the
reaction may be quenched in aqueous hydrochloric acid. Isolation by
conventional means (e.g. extraction and silica gel chromatography)
provides compound 400.
Step 2--Preparation of Formula IIa where A is O
[0748] Compound of Formula IIa where A is O is prepared by reacting
3-bromo-7-azaindole 400, protected at N--H according to Scheme 43,
Step 1, with compound of Formula Xe (Formula Xa wherein J, E, F, G
and K are C, n is 1, and R.sup.42 is OH) in the presence of a base
(e.g. sodium hydride) and a copper catalyst (e.g. copper bromide)
in a non-reactive solvent (e.g. dimethylformamide) with heating
(e.g. 120.degree. C.) for several hours. Isolation by conventional
means (e.g. extraction and silica gel chromatography), followed by
removal of the protecting group according to Scheme 43, Step 2
provides compounds of Formula IIa where A is O and R.sup.41 is
H.
Example 48
Synthesis of Intermediate
1-(3-Hydroxy-pyrrolo[2,3-b]pyridin-1-yl)-ethanone (503)
[0749] 1-(3-Hydroxy-pyrrolo[2,3-b]pyridin-1-yl)-ethanone 503 may be
synthesized in three Steps from 2-Amino-nicotinic acid 500 as
described in Scheme 105. The compound is an exemplary compound of
Formula III wherein U, V, W and Z are CH, R.sup.40 is OH and
R.sup.41 is P (e.g. acetyl).
##STR00153##
Step 1--Preparation of 2-(Carboxymethyl-amino)-nicotinic acid
(501)
[0750] 2-(Carboxymethyl-amino)-nicotinic acid 501 is prepared by
reacting commercially available 2-Amino-nicotinic acid 500 with
2-chloroacetic acid in the presence of base (e.g. sodium carbonate)
typically at room temperature for 1-4 hours followed by
purification and isolation by conventional means (e.g. acid base
extraction and recrystallization).
Step 2--Preparation of Acetic acid
1-acetyl-1H-pyrrolo[2,3-b]pyridin-3-yl ester (502)
[0751] Acetic acid 1-acetyl-1H-pyrrolo[2,3-b]pyridin-3-yl ester 502
is prepared by reacting 2-(Carboxymethyl-amino)-nicotinic acid 501
with sodium acetate in refluxing acetic anhydride for several
hours, followed by purification and isolation by conventional means
(e.g. recrystallization) (Su & Tsou; J. Am. Chem. Soc., 82,
1960, 1187).
Step 3--Preparation of
1-(3-Hydroxy-pyrrolo[2,3-b]pyridin-1-yl)-ethanone (503)
[0752] 1-(3-Hydroxy-pyrrolo[2,3-b]pyridin-1-yl)-ethanone 503 is
prepared from acetic acid 1-acetyl-1H-pyrrolo[2,3-b]pyridin-3-yl
ester 502 by selective removal of the acetate at the 3-position by
reaction with sodium in methanol at room temperature typically for
30 minutes to one hour, followed by purification and isolation by
conventional means (e.g. extraction and recrystallization).
Example 49
Synthesis of Compounds of Formula IIa, where A is O
[0753] Compounds of Formula IIa, where A is O may be synthesized
from compound of Formula IIIf (Formula III where U, V, W and Z are
CH, R.sup.41 is P and R.sup.40 is OH) and compound of Formula Xf
(Formula Xa wherein J, E, F, G and K are C, n is 1, and R.sup.42 is
leaving group L) in one Step according to Scheme 106.
##STR00154##
Step 1--Preparation of Formula IIa where A is O
[0754] Formula IIa where A is O is prepared by dissolving compound
of Formula Xf, where L is a leaving group (e.g. halogen or
triflate), in a non-reactive solvent (e.g. dimethylformamide) in
the presence of a base (e.g. sodium hydride). Compound of Formula
IIIf is added in the presence of a copper catalyst (e.g. copper
bromide) with heating for several hours. Removal of the protecting
group according to Scheme 43, Step 2 followed by isolation by
conventional means (e.g. extraction and silica gel chromatography)
provides compounds of Formula IIa where A is O and R.sup.41 is
H.
Example 50
Synthesis of Compounds of Formula IIa, when A is NH or
N--R.sup.45
[0755] Compounds of Formula IIa, where A is NH or NR.sup.45
(R.sup.45 consistent with definition of A for compounds of Formula
Ib or L.sup.1 for compounds of Formula I) may be synthesized from
3-bromo-7-azaindole 400 and a compound of Formula Xg (Formula Xa
wherein J, E, F, G and K are C, n is 1, and R.sup.42 is NH.sub.2)
in two Steps according to Scheme 107.
##STR00155##
Step 1--Preparation of Formula IIa where A is NH
[0756] Compound of Formula IIa where A is NH is prepared by
reacting 3-bromo-7-azaindole 400 with neat compound of Formula Xg
with heating for several hours (e.g. 150.degree. C.).
Alternatively, 400 may be reacted with compound of Formula Xg using
palladium catalyzed Buchwald-Hartwig conditions (i.e. a palladium
catalyst (e.g. Tris(dibenzylideneacetone)dipalladium(0)), a ligand
(e.g. tri-t-butylphosphine), and a base (e.g. sodium t-butoxide) in
a non-reactive solvent (e.g. toluene) with heating (e.g. 80.degree.
C.) for several hours). Isolation by conventional means (e.g.
extraction and silica gel chromatography) provides compound of
Formula IIa where A is NH and R.sup.41 is P. Removal of the
protecting group according to Scheme 43, Step 2 provides compounds
of Formula IIa where A is NH and R.sup.41 is H.
Step 2--Preparation of Formula IIa where A is N--R.sup.45
[0757] Compound of Formula IIa where A is N--R.sup.45 is prepared
by reacting compound of Formula IIa, where R.sup.41 is P and A is
NH, with an appropriate reagent with a leaving group (e.g. methyl
iodide, acetyl chloride) in the presence of a base (e.g. potassium
carbonate, diisopropylethylamine) in a non-reactive solvent (e.g.
dimethylformamide) for several hours at room temperature. Removal
of the protecting group according to Scheme 43, Step 2 and
isolation by conventional means (e.g. extraction and silica gel
chromatography) provides compound of Formula IIa where A is
N--R.sup.45 and R.sup.41 is H.
Example 51
Synthesis of intermediate of Formula IIIh where R.sup.40 is
NH.sub.2
[0758] Compounds of Formula IIIh (Formula III where U, V, W and Z
are CH, R.sup.41 is H and R.sup.40 is NH.sub.2) may be synthesized
from 7-azaindole 1 in three Steps according to Scheme 108.
##STR00156##
Step 1--Preparation of 3-nitro-7-azaindole (504)
[0759] 3-nitro-7-azaindole 504 is prepared by adding 7-azaindole 1
to fuming nitric acid while cooling (e.g. 0.degree. C.). After
stirring for one to several hours, water is carefully added and the
mixture neutralized with saturated sodium bicarbonate. The solids
are collected by filtration and dried to provide
3-nitro-7-azaindole 504.
Step 2--Preparation of Formula IIIg
[0760] Compound of IIIg (Formula III where U, V, W and Z are CH,
R.sup.41 is H and R.sup.40 is NH.sub.2) is prepared from
3-nitro-7-azaindole 504 according to Scheme 43, Step 1.
Step 3--Preparation of Formula IIIh
[0761] Compound of Formula IIIh is prepared from compound of
Formula IIIg by reduction of the nitro group (e.g. hydrogen gas and
palladium on carbon in methanol). The mixture is filtered and
concentrated to provide compound of Formula IIIh.
Example 52
Synthesis of Compounds of Formula IIa where A is NH or
NR.sup.45
[0762] Compounds of Formula IIa where A is NH or NR.sup.45
(R.sup.45 consistent with definition of A for compounds of Formula
Ib or L.sup.1 for compounds of Formula I) may be synthesized from a
compound of Formula IIIh and a compound of Formula Xh (Formula Xa
wherein J, E, F, G and K are C, n is 1, and R.sup.42 is Br) in two
Steps as described in Scheme 109.
##STR00157##
Step 1--Preparation of Formula IIa where A is NH
[0763] Compound of Formula IIa where A is NH is prepared by
reacting compound of Formula Xh with compound of Formula IIIh
(prepared as described in Example 51) with heating for several
hours (e.g. 100.degree. C.). Alternatively, compound of Formula
IIIh is reacted with compound of Formula Xh using palladium
catalyzed Buchwald-Hartwig conditions (i.e. a palladium catalyst
(e.g. Tris(dibenzylideneacetone)dipalladium(0)), a ligand (e.g.
tri-t-butylphosphine), and a base (e.g. sodium t-butoxide) in a
non-reactive solvent (e.g. toluene) with heating (e.g. 80.degree.
C.) for several hours). Isolation by conventional means (e.g.
extraction and silica gel chromatography) provides compound of
Formula IIa where A is NH and R.sup.41 is P. Removal of the
protecting group according to Scheme 43, Step 2 provides compounds
of Formula IIa where A is NH and R.sup.41 is H.
Step 2--Preparation of Formula IIa where A is N--R.sup.45
[0764] Compound of Formula IIa where A is N--R.sup.45 is prepared
as described in Example 50, Step 2.
Example 53
Synthesis of Compounds of Formula IIa where A is S
[0765] Compounds of Formula IIa where A is S may be synthesized
from 7-azaindole 1 and a compound of Formula XI (Formula Xa wherein
J, E, F, G and K are C, n is 1, and R.sup.42 is an aryl disulfide)
in one Step as described in Scheme 110.
##STR00158##
Step 1--Preparation of Formula IIa where A is S
[0766] Compound of Formula IIa where A is S is prepared by
dissolving 7-azaindole 1 in an appropriate solvent (e.g.
dimethylformamide) with a base (e.g. sodium hydride), followed by
the addition of a symmetrical aryl disulfide of Formula XI. After
stirring at room temperature for several hours, the reaction is
quenched with water, followed by isolation by conventional means
(e.g. extraction and silica gel chromatography) to provide
compounds of Formula IIa where A is S and R.sup.41 is H.
Example 54
Synthesis of Compounds of Formula IIa where A is S
[0767] Compounds of Formula IIa where A is S may be synthesized
from 3-bromo-7-azaindole 400 and a compound of Formula Xj (Formula
Xa wherein J, E, F, G and K are C, n is 1, and R.sup.42 is an SH)
in one Step as described in Scheme 111.
##STR00159##
Step 1--Preparation of Formula IIa where A is S
[0768] Compound of Formula IIa where A is S is prepared by reacting
3-bromo-7-azaindole 400 with compound of Formula Xj in the presence
of a base (e.g. sodium hydride) in an appropriate solvent (e.g.
dimethylformamide) with heating for several hours (e.g. 100.degree.
C.). Isolation by conventional means (e.g. extraction and silica
gel chromatography) provides compound of Formula IIa where A is S
and R.sup.41 is H.
Example 55
Synthesis of Compounds of Formula IIa, where A is S(O).sub.2
[0769] Compounds of Formula IIa where A is S(O).sub.2 may be
synthesized from a compound of Formula IIa where A is S and
R.sup.41 is H in one Step as described in Scheme 112.
##STR00160##
Step 1--Preparation of Formula IIa where A is S(O).sub.2
[0770] Compound of Formula IIa where A is S(O).sub.2 is prepared by
reacting a compound of Formula IIa where A is S (prepared as
described in Example 53 or 54) with an oxidizing agent (e.g.
meta-chloro-peroxybenzoic acid, hydrogen peroxide) in an
appropriate aprotic solvent (e.g. dichloromethane). Isolation by
conventional means (e.g. extraction and silica gel chromatography)
provides compound of Formula IIa where A is S(O).sub.2 and R.sup.41
is H.
Example 56
Synthesis of Compounds of Formula IIa where A is S(O).sub.2
[0771] Compounds of Formula IIa where A is S(O).sub.2 may be
synthesized from 7-azaindole 1 and a compound of Formula Xk
(Formula Xa wherein J, E, F, G and K are C, n is 1, and R.sup.42 is
an S(O).sub.2Cl) in one Step as described in Scheme 113.
##STR00161##
Step 1--Preparation of Formula IIa where A is S(O).sub.2
[0772] Compound of Formula IIa where A is S(O).sub.2 is prepared by
reacting 7-azaindole 1 with a sulfonyl chloride of Formula Xk
dissolved in trifluoroacetic acid, in the presence of a catalyst
(e.g. indium trichloride) and trifluorosulfonic acid with heating
(e.g. 70.degree. C.) for a few hours. Neutralization with sodium
hydroxide and isolation by conventional means (e.g. extraction and
silica gel chromatography) provides compound of Formula IIa where A
is S(O).sub.2 and R.sup.41 is H (Garzya et al., Tetrahedron Lett.
2004, 45:1499-1501).
Example 57
Synthesis of Compounds of Formula IIa where A is CF.sub.2
[0773] Compounds of Formula IIa where A is CF.sub.2 may be
synthesized from a compound of Formula IIa where A is C(O) and
R.sup.41 is P in one Step as described in Scheme 114.
##STR00162##
Step 1--Preparation of Formula IIa where A is CF.sub.2
[0774] Compound of Formula IIa where A is CF.sub.2 is prepared by
reacting a compound of Formula IIa where A is C(O) and R.sup.41 is
P (prepared as described in Example 44) with a fluorinating agent
(e.g. (diethylamino)sulfur trifluoride) with heating for several
hours. Isolation by conventional means (e.g. extraction and silica
gel chromatography) provides compound of Formula IIa where A is
CF.sub.2 and R.sup.41 is H.
Example 58
Synthesis of Compounds of Formula IIa where A is C(S)
[0775] Compounds of Formula IIa where A is C(S) may be synthesized
from a compound of Formula IIa where A is C(O) and R.sup.41 is H in
one Step as described in Scheme 115.
##STR00163##
Step 1--Preparation of Formula IIa where A is C(S)
[0776] Compound of Formula IIa where A is C(S) is prepared by
reacting a compound of Formula IIa where A is C(O) and R.sup.41 is
H (prepared as described in Example 43, 44 or 45) with Lawesson's
reagent, (1,3,2,4-dithiadiphosphetane-2,3-disulfide), in an
appropriate solvent (e.g. tetrahydrofuran) with heating for several
hours. Isolation by conventional means (e.g. extraction and silica
gel chromatography) provides compound of Formula IIa where A is
C(S) and R.sup.41 is H.
Example 59
Synthesis of Compounds of Formula IIa where A is S(O)
[0777] Compounds of Formula IIa where A is S(O) may be synthesized
from a compound of Formula IIa where A is S and R.sup.41 is H in
one Step as described in Scheme 116.
##STR00164##
Step 1--Preparation of Formula IIa where A is S(O)
[0778] Compound of Formula IIa where A is S(O) is prepared by
reacting compound of Formula IIa where A is S and R.sup.41 is H
(prepared as described in Example 53 or 54) with one equivalent of
an oxidizing agent (e.g. meta-chloro-peroxybenzoic acid, hydrogen
peroxide, oxone) in an appropriate aprotic solvent (e.g.
dichloromethane). Isolation by conventional means (e.g. extraction
and silica gel chromatography) provides compound of Formula IIa
where A is S(O) and R.sup.41 is H.
[0779] Compounds of Formula III may be used in the preparation of
compounds of Formula Ib or IIa as described in Examples 43-59 by
substituting the 7-azaindole or analog shown in the example with a
compound of Formula III. R.sup.40 is the substituent at the
3-position used in the example appropriate for coupling to
compounds of Formula X (e.g. hydrogen, C(O)H,
CH.sub.2N(CH.sub.3).sub.2, C(O)Cl, bromo, amino, hydroxy, thio) and
R.sup.41 is hydrogen or protecting group P.
##STR00165##
[0780] Compounds of Formula IIIi, i.e. Formula III where V and W
are CH, at least one of U and Z are CR.sup.46, preferably one of U
and Z is CR.sup.46 and the other of U and Z is CH, where R.sup.46
is as defined for R.sup.18, excluding hydrogen, in Formula Ib of
[0026], may be used in the synthesis of compounds of Formula Ib and
IIa as described for compounds for Formula III.
##STR00166##
[0781] The examples provided for the synthesis of compounds of
Formula IIIi are also applicable to many compounds meeting other
definitions of Formula III or compounds of Formula IIIi can be
further substituted, particularly at the 3-position, to provide
compounds of Formula III, or related compounds that may be used to
synthesize compounds of Formula I.
[0782] Additionally, the techniques used for preparation of
compounds of Formula III and IIIi may be applied to compounds of
Formula Ib where R.sup.5 is bromo, chloro, or amino, to provide
other compounds of Formula Ib.
Example 60
Synthesis of Intermediate of Formula IVa
[0783] Compounds of Formula IVa may be synthesized from
3-methyl-5-nitro-pyridin-2-ylamine 505 in three Steps as described
in Scheme 117.
##STR00167##
Step 1--Preparation of 5-Nitro-1H-pyrrolo[2,3-b]pyridine (506)
[0784] 5-Nitro-1H-pyrrolo[2,3-b]pyridine 506 of is prepared by
reacting 3-methyl-5-nitro-pyridin-2-ylamine 505 with
t-butyloxycarbonyl anhydride in an appropriate solvent (e.g. ethyl
acetate and hexanes). Concentration and extraction provides a
Boc-protected intermediate that is then reacted with 2 equivalents
of butyllithium in an appropriate polar solvent (e.g.
tetrahydrofuran) with cooling (e.g. 0.degree. C.), followed by the
addition of dimethylformamide and stirring for 30 minutes to one
hour, followed by addition of 5.5 M HCl. Isolation by conventional
means (e.g. extraction and silica gel chromatography) provides 506.
(Hands et. al., Synthesis 1996, 877-882.)
Step 2--Preparation of Formula XIII
[0785] Compound of Formula XIII is prepared by reacting
5-Nitro-1H-pyrrolo[2,3-b]pyridine 506 as described in Scheme 43,
Step 1.
Step 3--Preparation of Formula IVa
[0786] Compound of Formula IVa is prepared from compound of Formula
XIII by reduction of the nitro group (e.g. hydrogen gas and
palladium on carbon in methanol). The mixture is filtered and
concentrated to provide compound of Formula IVa.
Example 61
Synthesis of Intermediate of Formula IVb
[0787] Compounds of Formula IVa may be synthesized from 7-azaindole
1 in four Steps as described in Scheme 118.
##STR00168##
Step 1--Preparation of 1H-Pyrrolo[2,3-b]pyridine 7-oxide (507)
[0788] 1H-Pyrrolo[2,3-b]pyridine 7-oxide 507 is prepared by
reacting 7-azaindole 1 with an oxidizing agent (e.g.
m-chloro-peroxybenzoic acid) in an appropriate solvent (e.g.
dichloromethane). After stirring at room temperature for 30 minutes
to one hour, compound 507 is collected by filtration.
Step 2--Preparation of 4-Nitro-1H-pyrrolo[2,3-b]pyridine 7-oxide
(508)
[0789] 4-Nitro-1H-pyrrolo[2,3-b]pyridine 7-oxide 508 is prepared by
dissolving 1H-Pyrrolo[2,3-b]pyridine 7-oxide 507 in nitric acid,
followed by the addition of sulfuric acid. Heating (e.g. 70.degree.
C.) for one hour, followed by pouring into water provides compound
508, which is isolated by filtration. (Schneller et. al., J. Org.
Chem. 1980, 45:4045)
Step 3--Preparation of Compound of Formula XIV
[0790] Compound of Formula XIV is prepared from
4-Nitro-1H-pyrrolo[2,3-b]pyridine 7-oxide 508 by addition of
phosphorous trichloride in an appropriate solvent (e.g. ethyl
acetate) and heating (e.g. 80.degree. C.) for several minutes.
Neutralization with base (e.g. potassium carbonate) followed by
extraction affords the intermediate that can then be protected at
the N-1 hydrogen according to Scheme 43, Step 1, to provide
compound of Formula XIV.
Step 4--Preparation of Formula IVb
[0791] Compound of IVb is prepared from compound of Formula XIV by
reduction of the nitro group (e.g. hydrogen gas and palladium on
carbon in methanol). The mixture can be filtered and concentrated
to provide compound of Formula IVb.
Example 62
Synthesis of Compounds of Formula IIIi where R.sup.46 is NHR.sup.47
and R.sup.40 is H
[0792] Compounds of Formula IIIi where R.sup.46 is NHR.sup.47 and
R.sup.40 is H may be synthesized from a compound of Formula IVa or
IVb in one Step as described in Scheme 119.
##STR00169##
Step 1--Preparation of Compound of Formula IIIi where R.sup.46 is
NHR.sup.47 and R.sup.40 is H
[0793] Compound of Formula IIIi where R.sup.46 is NHR.sup.47 and
R.sup.40 is H (R.sup.47 is optionally substituted lower alkyl,
optionally substituted lower alkenyl, optionally substituted lower
alkynyl, optionally substituted cycloalkyl, optionally substituted
heterocycloalkyl, optionally substituted aryl or optionally
substituted heteroaryl) is prepared from intermediate Formula IVa
(Example 60) or IVb (Example 61) by reaction with R.sup.47--X,
where X is a leaving group, (e.g. alkylating agent such as
methyliodide) in the presence of a base (e.g. potassium carbonate)
in an appropriate solvent (e.g. dimethylformamide) for several
hours at room temperature. Isolation by conventional means (e.g.
extraction and silica gel chromatography) provides compounds of
Formula IIIi where R.sup.46 is NHR.sup.47, R.sup.40 is H and
R.sup.41 is P.
Example 63
Synthesis of Compounds of Formula IIIi where R.sup.46 is
NHCH.sub.2R.sup.48 and R.sup.40 is H
[0794] Compounds of Formula IIIi where R.sup.46 is
NHCH.sub.2R.sup.48 and R.sup.40 is H may be synthesized from a
compound of Formula IVa or IVb in one Step as described in Scheme
120.
##STR00170##
Step 1--Preparation of Compound of Formula IIIc where R.sup.46 is
NHCH.sub.2R.sup.48 and R.sup.40 is H
[0795] Compound of Formula IIIi where R.sup.46 is
NHCH.sub.2R.sup.48 and R.sup.40 is H (R.sup.48 is consistent with
optionally substituted lower alkyl) is prepared from intermediate
Formula IVa (Example 60) or IVb (Example 61) by reductive amination
using an aldehyde of the formula R.sup.48--C(O)H in the presence of
a catalytic amount of acid (e.g. acetic acid) and a reducing agent
(e.g. sodium triacetoxyborohydride) in a non-reactive solvent (e.g.
dichloroethane). After stirring for several hours, isolation by
conventional means (e.g. extraction and silica gel chromatography)
provides compounds of Formula IIIi where R.sup.46 is
NHCH.sub.2R.sup.48, R.sup.40 is H and R.sup.41 is P.
Example 64
Synthesis of Compounds of Formula IIIi where R.sup.46 is
NHC(O)R.sup.49 and R.sup.40 is H
[0796] Compounds of Formula IIIi where R.sup.46 is NHC(O)R.sup.49
and R.sup.40 is H may be synthesized from a compound of Formula IVa
or IVb in one Step as described in Scheme 121.
##STR00171##
Step 1--Preparation of Compound of Formula IIIi where R.sup.46 is
NHC(O)R.sup.49 and R.sup.40 is H
[0797] Compound of Formula IIIi where R.sup.46 is NHC(O)R.sup.49
and R.sup.40 is H (R.sup.49 is optionally substituted lower alkyl,
optionally substituted lower alkenyl, optionally substituted lower
alkynyl, optionally substituted cycloalkyl, optionally substituted
heterocycloalkyl, optionally substituted aryl or optionally
substituted heteroaryl) is prepared from intermediate Formula IVa
(Example 60) or IVb (Example 61) by reaction with an activated
carboxylic acid of the formula R.sup.49--C(O)X where X is a leaving
group such as chloro (e.g. benzoyl chloride) in the presence of a
base (e.g. N,N-diisopropylethylamine (DIEA)) in a non-reactive
solvent (e.g. dichloromethane). After stirring for several hours,
isolation by conventional means (e.g. extraction and silica gel
chromatography) provides compounds of Formula IIIi where R.sup.46
is NHC(O)R.sup.49, R.sup.40 is H and R.sup.41 is P.
Example 65
Synthesis of Compounds of Formula IIIi where R.sup.46 is
NHC(O)NHR.sup.50 and R.sup.40 is H
[0798] Compounds of Formula IIIi where R.sup.46 is NHC(O)NHR.sup.50
and R.sup.40 is H may be synthesized from a compound of Formula IVa
or IVb in one Step as described in Scheme 122.
##STR00172##
Step 1--Preparation of Compound of Formula IIIi where R.sup.46 is
NHC(O)NHR.sup.50 and R.sup.40 is H
[0799] Compound of Formula IIIi where R.sup.46 is NHC(O)NHR.sup.50
and R.sup.40 is H (R.sup.50 is optionally substituted lower alkyl,
optionally substituted lower alkenyl, optionally substituted lower
alkynyl, optionally substituted cycloalkyl, optionally substituted
heterocycloalkyl, optionally substituted aryl or optionally
substituted heteroaryl) is prepared from intermediate Formula IVa
(Example 60) or IVb (Example 61) by reaction with an isocyanate of
the formula R.sup.50--NCO (e.g. propylisocyanate) in the presence
of a base (e.g. DIEA) in a non-reactive solvent (e.g.
dichloromethane). After stirring for several hours, isolation by
conventional means (e.g. extraction and silica gel chromatography)
provides compounds of Formula IIIi where R.sup.46 is
NHC(O)NHR.sup.50, R.sup.40 is H and R.sup.41 is P.
Example 66
Synthesis of Compounds of Formula IIIi where R.sup.46 is
NHC(S)NHR.sup.51 and R.sup.40 is H
[0800] Compounds of Formula IIIi where R.sup.46 is NHC(S)NHR.sup.51
and R.sup.40 is H may be synthesized from a compound of Formula IVa
or IVb in one Step as described in Scheme 123.
##STR00173##
Step 1--Preparation of Compound of Formula IIIi where R.sup.46 is
NHC(S)NHR.sup.51 and R.sup.40 is H
[0801] Compound of IIIi where R.sup.46 is NHC(S)NHR.sup.51 and
R.sup.40 is H (R.sup.51 is optionally substituted lower alkyl,
optionally substituted lower alkenyl, optionally substituted lower
alkynyl, optionally substituted cycloalkyl, optionally substituted
heterocycloalkyl, optionally substituted aryl or optionally
substituted heteroaryl) is prepared from intermediate Formula IVa
(Example 60) or IVb (Example 61) by reaction with an isothiocyanate
of the formula R.sup.51--NCS (e.g. propylisothiocyanate) in the
presence of a base (e.g. DIEA) in a non-reactive solvent (e.g.
dichloromethane). After stirring for several hours, isolation by
conventional means (e.g. extraction and silica gel chromatography)
provides compounds of Formula IIIi where R.sup.46 is
NHC(S)NHR.sup.51, R.sup.40 is H and R.sup.41 is P.
Example 67
Synthesis of Compounds of Formula IIIi where R.sup.46 is
NHS(O).sub.2R.sup.52 and R.sup.40 is H
[0802] Compounds of Formula IIIi where R.sup.46 is
NHS(O).sub.2R.sup.52 and R.sup.40 is H may be synthesized from a
compound of Formula IVa or IVb in one Step as described in Scheme
124.
##STR00174##
Step 1--Preparation of Compound of Formula IIIi where R.sup.46 is
NHS(O).sub.2R.sup.52 and R.sup.40 is H
[0803] Compound Formula IIIi where R.sup.46 is NHS(O).sub.2R.sup.52
and R.sup.40 is H (R.sup.52 is optionally substituted lower alkyl,
optionally substituted lower alkenyl, optionally substituted lower
alkynyl, optionally substituted cycloalkyl, optionally substituted
heterocycloalkyl, optionally substituted aryl or optionally
substituted heteroaryl) is prepared from intermediate Formula IVa
(Example 60) or IVb (Example 61) by reaction with a sulfonyl
chloride of the formula R.sup.52--S(O).sub.2Cl (e.g. propylsulfonyl
chloride) in the presence of a base (e.g. DIEA, pyridine) in a
non-reactive solvent (e.g. dichloromethane). After stirring for
several hours, isolation by conventional means (e.g. extraction and
silica gel chromatography) provides compounds of Formula IIIi where
R.sup.46 is NHS(O).sub.2R.sup.52, R.sup.40 is H and R.sup.41 is
P.
Example 68
Synthesis of Intermediate of Formula Va
[0804] Compounds of Formula Va may be synthesized from 7-azaindole
1 in two Steps as described in Scheme 125.
##STR00175##
Step 1--Preparation of 5-bromo-7-azaindole (44)
[0805] 5-bromo-7-azaindol 44 is prepared from 7-azaindole 1 as
described in Mazeas et. al., Heterocycles 1999, 50:1065-1080.
Step 2--Preparation of Intermediate of Formula Va
[0806] Intermediate of Formula Va is prepared by protecting
5-bromo-7-azaindol 44 as described in Scheme 43, Step 1.
Example 69
Synthesis of Intermediate of Formula Vb
[0807] Compounds of Formula Vb may be synthesized from
1H-Pyrrolo[2,3-b]pyridine 7-oxide 507 in two Steps as described in
Scheme 126.
##STR00176##
Step 1--Preparation of 4-bromo-7-azaindole (509)
[0808] 4-bromo-7-azaindole 509 is prepared from
1H-Pyrrolo[2,3-b]pyridine 7-oxide 507 (prepared as described in
Example 61) as described in Thibault et. al., Org. Lett. 2003,
5:5023-5025.
Step 2--Preparation of Intermediate of Formula Vb
[0809] Intermediate of Formula Vb is prepared by protecting
4-bromo-7-azaindole 509 as described in Scheme 43, Step 1.
Example 70
Synthesis of Compounds of Formula IIIi where R.sup.46 is a halogen
and R.sup.40 is H
[0810] Compounds of Formula IIIi where R.sup.46 is a halogen and
R.sup.40 is H may be synthesized from a compound of Formula Va or
Vb in one Step as described in Scheme 127.
##STR00177##
Step 1--Preparation of Compound of Formula IIIi where R.sup.46 is F
or Cl and R.sup.40 is H
[0811] Compound of Formula IIIi where R.sup.46 is halogen R.sup.53
(preferably fluoro or chloro) and R.sup.40 is hydrogen is prepared
by dissolving the corresponding bromo intermediates of Formula Va
(Example 68) or Vb (Example 69) in an appropriate solvent (e.g.
tetrahydrofuran) with cooling (e.g. -78.degree. C.) and reacting
with an organolithium reagent to effect the lithium-halogen
exchange of the bromo (e.g. t-butyllithium), followed by addition
of a source of flourine (e.g. N-fluorobenzenesulfimide) or chlorine
(e.g. hexachloroethane), similar to that described by Thibault et.
al., Org. Lett. 2003, 5:5023-5025. Isolation by conventional means
(e.g. extraction and silica gel chromatography) provides compounds
of Formula IIIi where R.sup.46 is F or Cl, R.sup.40 is H and
R.sup.41 is P.
Example 71
Synthesis of Compounds of Formula IIIi where R.sup.46 is NHR.sup.47
and R.sup.40 is H
[0812] Compounds of Formula IIIi where R.sup.46 is NHR.sup.47 and
R.sup.40 is H may be synthesized from a compound of Formula Va or
Vb in one Step as described in Scheme 128.
##STR00178##
Step 1--Preparation of Compound of Formula IIIi where R.sup.46 is
NHR.sup.47 and R.sup.40 is H
[0813] Compound of Formula IIIi where R.sup.46 is NHR.sup.47 and
R.sup.40 is H (R.sup.47 as defined in Example 62) is prepared by
reacting intermediate Formula Va (Example 68) or Vb (Example 69)
with an amine of Formula R.sup.47--NH.sub.2 using palladium
catalyzed Buchwald-Hartwig conditions (i.e. a palladium catalyst
(e.g. palladium(II) acetate), a ligand (e.g.
dicyclohexyl(o-biphenyl)phosphine), and a base (e.g. sodium
t-butoxide) in a non-reactive solvent (e.g. 1,4-dioxane) with
heating (e.g. 100.degree. C.) for several hours). Isolation by
conventional means (e.g. extraction and silica gel chromatography)
provides compound of Formula IIIi where R.sup.46 is NHR.sup.47,
R.sup.40 is H and R.sup.41 is P.
Example 72
Synthesis of Compounds of Formula IIIi where R.sup.46 is OR.sup.54
and R.sup.40 is H
[0814] Compounds of Formula IIIi where R.sup.46 is OR.sup.54 and
R.sup.40 is H may be synthesized from a compound of Formula Va or
Vb in one Step as described in Scheme 129.
##STR00179##
Step 1--Preparation of Compound of Formula IIIi where R.sup.46 is
OR.sup.54 and R.sup.40 is H
[0815] Compound of Formula IIIi where R.sup.46 is OR.sup.54 and
R.sup.40 is H (R.sup.54 is optionally substituted lower alkyl,
optionally substituted lower alkenyl, optionally substituted lower
alkynyl, optionally substituted cycloalkyl, optionally substituted
heterocycloalkyl, optionally substituted aryl or optionally
substituted heteroaryl) is prepared by reacting intermediate
Formula Va (Example 68) or Vb (Example 69) with an alcohol of
Formula R.sup.54--OH in the presence of a base (e.g. sodium
hydride) and a copper catalyst (e.g. copper bromide) in a
non-reactive solvent (e.g. dimethylformamide) with heating (e.g.
120.degree. C.) for several hours. Isolation by conventional means
(e.g. extraction and silica gel chromatography), provides compounds
of Formula IIIi where R.sup.46 is OR.sup.54, R.sup.40 is H and
R.sup.41 is P.
Example 73
Synthesis of Compounds of Formula IIIi where R.sup.46 is optionally
substituted lower alkyl and R.sup.40 is H
[0816] Compounds of Formula IIIi where R.sup.46 is optionally
substituted lower alkyl and R.sup.40 is H may be synthesized from a
compound of Formula Va or Vb in one Step as described in Scheme
130.
##STR00180##
Step 1--Preparation of Compound of Formula IIIi where R.sup.46 is
Optionally Substituted Lower Alkyl and R.sup.40 is H
[0817] Compound of Formula IIIi where R.sup.46 is optionally
substituted lower alkyl R.sup.55 and R.sup.40 is H is prepared by
dissolving intermediate Formula Va (Example 68) or Vb (Example 69)
in an appropriate solvent (e.g. toluene) followed by the addition
of a palladium catalyst (e.g.
[1,1'-Bis(diphenylphosphino)ferrocene]dichloropalladium(II),
complex with dichloromethane (1:1)). After several minutes, a
Grignard reagent of the Formula R.sup.55--MgBr may be added and the
reaction heated (e.g. 90.degree. C.) for one to several hours.
After filtration through Celite, isolation by conventional means
(e.g. extraction and silica gel chromatography), provides compounds
of Formula IIIc where R.sup.46 is optionally substituted lower
alkyl, R.sup.40 is H and R.sup.41 is P.
Example 74
Synthesis of Compounds of Formula IIIi where R.sup.46 is Optionally
Substituted Aryl or Optionally Substituted Heteroaryl and R.sup.40
is H
[0818] Compound of Formula IIIi where R.sup.46 is optionally
substituted aryl or optionally substituted heteroaryl and R.sup.40
is H may be synthesized from a compound of Formula Va or Vb in one
Step as described in Scheme 131.
##STR00181##
Step 1--Preparation of Compound of Formula IIIi where R.sup.46 is
Optionally Substituted Aryl or Optionally Substituted Heteroaryl
and R.sup.40 is H
[0819] Compound of Formula IIIi where R.sup.46 is optionally
substituted aryl or optionally substituted heteroaryl R.sup.56 and
R.sup.40 is H is prepared by reacting intermediate Formula Va
(Example 68) or Vb (Example 69) with a boronic acid of the Formula
R.sup.56--B(OH).sub.2 or boronic ester of the Formula
R.sup.56--B(OR).sub.2 under Suzuki coupling conditions (Muyaura and
Suzuki, Chem. Rev. 1995, 95:2457), such as in the presence of a
palladium catalyst (e.g. Tetrakis(triphenylphosphine)palladium(0))
and a base (e.g. aqueous potassium carbonate) in an appropriate
solvent (e.g. tetrahydrofuran, acetonitrile) with heating thermally
(e.g. 80.degree. C.) for one to several hours or heating with a
microwave instrument (e.g. 120.degree. C. for 10 minutes).
Isolation by conventional means (e.g. extraction and silica gel
chromatography) provides compounds of Formula IIIi where R.sup.46
is optionally substituted aryl or optionally substituted
heteroaryl, R.sup.40 is H and R.sup.41 is P.
[0820] Compounds of Formula Ib where V, W, U, and Z are CH, J, E,
F, G, and K are C, n is 1, and R.sup.15, R.sup.16, and R.sup.17 are
hydrogen form compounds of Formula VI.
##STR00182##
[0821] The examples provided for the synthesis of compounds of
Formula VI are also applicable to many compounds meeting other
definitions of Formula I or Formula Ib.
Example 75
Synthesis of Compounds of Formula VI where M is NR.sup.57 or O and
R.sup.1 is Optionally Substituted Aryl or Optionally Substituted
Heteroaryl
[0822] Compound of Formula VIa (Formula VI where M is NR.sup.57 or
O (R.sup.57 consistent with definition of M for compounds of
Formula Ib or L.sup.2 for compounds of Formula I) and R.sup.1 is
optionally substituted aryl or optionally substituted heteroaryl)
may be synthesized from a compound of Formula IIb in two Steps as
described in Scheme 132.
##STR00183##
Step 1--Preparation of Compound of Formula IIc
[0823] Compound of Formula IIc (Formula IIa where R.sup.15,
R.sup.16 and R.sup.17 are H, R.sup.41 is P, R.sup.43 is
M.sup.1R.sup.58, where M.sup.1 is O or NR.sup.57 and R.sup.58 is
optionally substituted aryl or optionally substituted heteroaryl)
is prepared by reacting compound of Formula IIb (Formula IIa where
R.sup.15, R.sup.16 and R.sup.17 are H, R.sup.41 is P, R.sup.43 is
M.sup.1H, where M.sup.1 is O or NR.sup.57) with a compound of
Formula R.sup.58--X, where X is an appropriate leaving group such
as a halogen or triflate, in the presence of a base (e.g. sodium
hydride) in an appropriate solvent (e.g. dimethylformamide) with
heating (e.g. 80.degree. C.) for several hours. Alternatively, the
reaction may be catalyzed by a metal (e.g. palladium acetate and
tri-t-butylphosphine when M.sup.1 is NR.sup.57, copper bromide when
M.sup.1 is O). Isolation by conventional means (e.g. extraction and
silica gel chromatography) provides compounds of Formula IIc.
Step 2--Preparation of Compound of Formula VI where M is NR.sup.57
or O and R.sup.1 is Optionally Substituted Aryl or Optionally
Substituted Heteroaryl
[0824] Compound of Formula VIa (Formula VI where M is NR.sup.57 or
O (M.sup.1), R.sup.1 is optionally substituted aryl or optionally
substituted heteroaryl (R.sup.58)) is prepared from compound of
Formula IIc by removal of the N-1 protecting group according to
Scheme 43, Step 2.
Example 76
Synthesis of Compounds of Formula VI where M is NR.sup.57 or O and
R.sup.1 is Optionally Substituted Aryl or Optionally Substituted
Heteroaryl
[0825] Compound of Formula VIa (Formula VI where M is NR.sup.57 or
O (R.sup.57 consistent with definition of M for compounds of
Formula Ib or L.sup.2 for compounds of Formula I) and R.sup.1 is
optionally substituted aryl or optionally substituted heteroaryl)
may be synthesized from a compound of Formula IId in two Steps as
described in Scheme 133.
##STR00184##
Step 1--Preparation of Compound of Formula IIc
[0826] Compound of Formula IIc (Formula IIa where R.sup.15,
R.sup.16 and R.sup.17 are H, R.sup.41 is P, R.sup.43 is
M.sup.1R.sup.58, where M.sup.1 is O or NR.sup.57 and R.sup.58 is
optionally substituted aryl or optionally substituted heteroaryl)
is prepared by reacting compound of Formula IId (Formula IIa where
R.sup.15, R.sup.16 and R.sup.17 are H, R.sup.41 is P, and R.sup.43
is a halogen, R.sup.59, e.g. chloro) with a compound of Formula
R.sup.58--OH or of Formula R.sup.58--NR.sup.57 in the presence of a
base (e.g. sodium hydride) in an appropriate solvent (e.g.
dimethylformamide) with heating (e.g. 80.degree. C.) for several
hours. Alternatively, the reaction may be catalyzed by a metal
(e.g. palladium acetate and tri-t-butylphosphine when M.sup.1 is
NR.sup.57, copper bromide when M.sup.1 is O). Isolation by
conventional means (e.g. extraction and silica gel chromatography)
provides compounds of Formula IIc.
Step 2--Preparation of Compound of Formula VI where M is NR.sup.57
or O and R.sup.1 is Optionally Substituted Aryl or Optionally
Substituted Heteroaryl
[0827] Compound of Formula VIa (Formula VI where M is NR.sup.57 or
O (M.sup.1), R.sup.1 is optionally substituted aryl or optionally
substituted heteroaryl (R.sup.58)) is prepared from compound of
Formula IIc by removal of the N-1 protecting group according to
Scheme 43, Step 2.
Example 77
Synthesis of Compounds of Formula VI where M is --O-alk- or
--NR.sup.57-alk-
[0828] Compound of Formula VIb (Formula VI where M is --O-alk- or
--NR.sup.57-alk- (R.sup.57 consistent with definition of M for
compounds of Formula Ib or L.sup.2 for compounds of Formula I)) may
be synthesized from a compound of Formula IIb in two Steps as
described in Scheme 134.
##STR00185##
Step 1--Preparation of Compound of Formula IIe
[0829] Compound of Formula IIe (Formula IIa where R.sup.15,
R.sup.16 and R.sup.17 are H, R.sup.41 is P, R.sup.43 is
M.sup.1(CH.sub.2).sub.1-3R.sup.1 where M.sup.1 is O or NR.sup.57)
is prepared by reacting compound of Formula IIb (Formula IIa where
R.sup.15, R.sup.16 and R.sup.17 are H, R.sup.41 is P, R.sup.43 is
M.sup.1H, where M.sup.1 is O or NR.sup.57) with a compound of
Formula R.sup.1--(CH.sub.2).sub.1-3--X where X is a leaving group
(e.g. halogen, mesylate) in the presence of a base (e.g. sodium
hydride, potassium carbonate) in an appropriate solvent (e.g.
dimethylformamide, acetonitrile) with heating (e.g. 80.degree. C.)
for one to several hours. Isolation by conventional means (e.g.
extraction and silica gel chromatography), provides compounds of
Formula IIe.
Step 2--Preparation of Compound of Formula VI where M is M.sup.1
(CH.sub.2).sub.1-3 and M.sup.1 is O or NR.sup.57
[0830] Compound of Formula VIb (Formula VI where M is
O(CH.sub.2).sub.1-3 or NR.sup.57(CH.sub.2).sub.1-3) is prepared
from compound of Formula IIe by removal of the N-1 protecting group
according to Scheme 43, Step 2.
Example 78
Synthesis of Compounds of Formula VI where M is --O-alk- or
--NR.sup.57-alk-
[0831] Compound of Formula VIb (Formula VI where M is --O-alk- or
--NR.sup.57-alk- (R.sup.57 consistent with definition of M for
compounds of Formula Ib or L.sup.2 for compounds of Formula I)) may
be synthesized from a compound of Formula IId in two Steps as
described in Scheme 135.
##STR00186##
Step 1--Preparation of Compound of Formula IIe
[0832] Compound of Formula IIe (Formula IIa where R.sup.15,
R.sup.16 and R.sup.17 are H, R.sup.41 is P, R.sup.43 is
M.sup.1(CH.sub.2).sub.1-3R.sup.1 where M.sup.1 is O or NR.sup.57)
is prepared by reacting compound of Formula IId (Formula IIa where
R.sup.15, R.sup.16 and R.sup.17 are H, R.sup.41 is P, and R.sup.43
is a halogen, R.sup.59, e.g. chloro) with a compound of Formula
R.sup.1--(CH.sub.2).sub.1-3--OH or
R.sup.1--(CH.sub.2).sub.1-3--NR.sup.57 in the presence of a base
(e.g. sodium hydride, potassium carbonate) in an appropriate
solvent (e.g. dimethylformamide, acetonitrile) with heating (e.g.
80.degree. C.) for one to several hours. Isolation by conventional
means (e.g. extraction and silica gel chromatography), provides
compound of Formula IIe.
Step 2--Preparation of Compound of Formula VI where M is M.sup.1
(CH.sub.2).sub.1-3 and M.sup.1 is O or NR.sup.57
[0833] Compound of Formula VIb (Formula VI where M is
O(CH.sub.2).sub.1-3 or NR.sup.57(CH.sub.2).sub.1-3) is prepared
from compound of Formula IIe by removal of the N-1 protecting group
according to Scheme 43, Step 2.
Example 79
Synthesis of Compounds of Formula VI where M is NH-alk-
[0834] Compound of Formula VIc (Formula VI where M is --NH-alk-)
may be synthesized from a compound of Formula IIf in two Steps as
described in Scheme 136.
##STR00187##
Step 1--Preparation of Compound of Formula IIg
[0835] Compound of Formula IIg (Formula IIa where R.sup.15,
R.sup.16 and R.sup.17 are H, R.sup.41 is P, R.sup.43 is
NH(CH.sub.2).sub.1-3R.sup.1) is prepared from compound of Formula
IIf (Formula IIa where R.sup.15, R.sup.16 and R.sup.17 are H,
R.sup.41 is P, R.sup.43 is NH.sub.2) by reductive amination using
an aldehyde of the formula R.sup.1--(CH.sub.2).sub.0-2--CHO in the
presence of a catalytic amount of acid (e.g. acetic acid) and a
reducing agent (e.g. sodium triacetoxyborohydride) in a
non-reactive solvent (e.g. dichloroethane). After stirring for
several hours, isolation by conventional means (e.g. extraction and
silica gel chromatography) provides compounds of Formula IIg.
Step 2--Preparation of Compound of Formula VI where M is
NH(CH.sub.2).sub.1-3
[0836] Compound of Formula Vic (Formula VI where M is
NH(CH.sub.2).sub.1-3) is prepared from compound of Formula IIg by
removal of the N-1 protecting group according to Scheme 43, Step
2.
Example 80
Synthesis of Compounds of Formula VI where M is NR.sup.57C(O) or
OC(O)
[0837] Compound of Formula VId (Formula VI where M is NR.sup.57C(O)
or OC(O) where R.sup.57 is consistent with definition of M for
compounds of Formula Ib or L.sup.2 for compounds of Formula I) may
be synthesized from a compound of Formula IIb in two Steps as
described in Scheme 137.
##STR00188##
Step 1--Preparation of Compound of Formula IIh
[0838] Compound of Formula IIh (Formula IIa where R.sup.15,
R.sup.16 and R.sup.17 are H, R.sup.41 is P, R.sup.43 is
M.sup.1C(O)R.sup.1 where M.sup.1 is O or NR.sup.57) is prepared by
reacting compound of Formula IIb (Formula IIa where R.sup.15,
R.sup.16 and R.sup.17 are H, R.sup.41 is P, R.sup.43 is M.sup.1H,
where M.sup.1 is O or NR.sup.57) with an activated carboxylic acid
of Formula R.sup.1--COX where X is a leaving group such as chloro
(e.g. benzoyl chloride) in the presence of a base (e.g. DIEA) in a
non-reactive solvent (e.g. dichloromethane). After stirring for
several hours, isolation by conventional means (e.g. extraction and
silica gel chromatography) provides compound of Formula IIh.
Step 2--Preparation of Compound of Formula VI where M is OC(O) or
NR.sup.57C(O)
[0839] Compounds of Formula VId (Formula VI where M is OC(O) or
NR.sup.57C(O)) is prepared from compound of Formula IIh by removal
of the N-1 protecting group according to Scheme 43, Step 2.
Example 81
Synthesis of Compounds of Formula VI where M is
NR.sup.57S(O).sub.2
[0840] Compound of Formula VIe (Formula VI where M is
NR.sup.57S(O).sub.2 where R.sup.57 is consistent with definition of
M for compounds of Formula Ib or L.sup.2 for compounds of Formula
I) may be synthesized from a compound of Formula IIh in two Steps
as described in Scheme 138.
##STR00189##
Step 1--Preparation of Compound of Formula IIi
[0841] Compound of Formula IIi (Formula IIa where R.sup.15,
R.sup.16 and R.sup.17 are H, R.sup.41 is P, R.sup.43 is
NR.sup.57S(O).sub.2R.sup.1) is prepared by reacting compound of
Formula IIh (Formula IIa where R.sup.15, R.sup.16 and R.sup.17 are
H, R.sup.41 is P, and R.sup.43 is NR.sup.57H) by reaction with a
sulfonyl chloride of the formula R.sup.1--SO.sub.2Cl (e.g.
phenylsulfonyl chloride) in the presence of a base (e.g. DIEA,
pyridine) in a non-reactive solvent (e.g. dichloromethane). After
stirring for several hours, isolation by conventional means (e.g.
extraction and silica gel chromatography) provides compounds of
Formula IIi.
Step 2--Preparation of Compound of Formula VI where M is
NR.sup.57S(O)2
[0842] Compound of Formula VIe (Formula VI where M is
NR.sup.57S(O).sub.2) is prepared from compound of Formula III by
removal of the N-1 protecting group according to Scheme 43, Step
2.
Example 82
Synthesis of Compounds of Formula VI where M is
NR.sup.57C(O)NH(CH.sub.2).sub.1-3 or
NR.sup.57C(S)NH(CH.sub.2).sub.1-3
[0843] Compound of Formula VIf (Formula VI where M is
NR.sup.57C(O)NH(CH.sub.2).sub.1-3 or
NR.sup.57C(S)NH(CH.sub.2).sub.1-3, where R.sup.57 is consistent
with definition of M for compounds of Formula Ib or L.sup.2 for
compounds of Formula I) may be synthesized from a compound of
Formula IIh in two Steps as described in Scheme 139.
##STR00190##
Step 1--Preparation of Compound of Formula IIj
[0844] Compound of Formula IIj (Formula IIa where R.sup.15,
R.sup.16 and R.sup.17 are H, R.sup.41 is P, R.sup.43 is
NR.sup.57C(L)NH(CH.sub.2).sub.1-3R.sup.1, where L is O or S) is
prepared by reacting compound of Formula IIh (Formula IIa where
R.sup.15, R.sup.16 and R.sup.17 are H, R.sup.41 is P, and R.sup.43
is NR.sup.57H) with a compound of the formula
R.sup.1--(CH.sub.2).sub.1-3NCL where L is either 0 to form an
isocyanate (e.g. phenyl isocyanate) or L is S to form a
thioisocyanate (e.g. phenyl isothiocyanate) in the presence of a
base (e.g. DIEA) in a non-reactive solvent (e.g. dichloromethane).
After stirring for several hours, isolation by conventional means
(e.g. extraction and silica gel chromatography) provides compounds
of Formula IIj.
Step 2--Preparation of Compound of Formula VI where B is NR and D
is C(=L)NH(CH.sub.2).sub.q
[0845] Compound of Formula VIf (Formula VI where M is
NR.sup.57C(O)NH(CH.sub.2).sub.1-3 or
NR.sup.57C(S)NH(CH.sub.2).sub.1-3) is prepared from compound of
Formula IIj by removal of the N-1 protecting group according to
Scheme 43, Step 2.
Example 83
Synthesis of Compounds of Formula VI where M is
NR.sup.57S(O).sub.2NH(CH.sub.2).sub.1-3
[0846] Compound of Formula VIg (Formula VI where M is
NR.sup.57S(O).sub.2NH(CH.sub.2).sub.1-3, where R.sup.57 is
consistent with definition of M for compounds of Formula Ib or
L.sup.2 for compounds of Formula I) may be synthesized from a
compound of Formula IIh in three Steps as described in Scheme
140.
##STR00191##
Step 1--Preparation of Compound of Formula IIk
[0847] Compound of Formula IIk (Formula IIa where R.sup.15,
R.sup.16 and R.sup.17 are H, R.sup.41 is P, R.sup.43 is
NR.sup.57S(O).sub.2Cl) is prepared by reacting compound of Formula
IIh (Formula IIa where R.sup.15, R.sup.16 and R.sup.17 are H,
R.sup.41 is P, and R.sup.43 is NR.sup.57H) with sulfuryl chloride
in a non-reactive solvent (e.g. dichloromethane) possibly with
heating (e.g. 60.degree. C.). After stirring for several hours, the
reaction can be concentrated to provide compound of Formula IIk
that is used without further purification.
Step 2--Preparation of Compound of Formula IIm
[0848] Compound of Formula IIm (Formula IIa where R.sup.15,
R.sup.16 and R.sup.17 are H, R.sup.41 is P, R.sup.43 is
NR.sup.57S(O).sub.2NH(CH.sub.2).sub.1-3R.sup.1) is prepared from
compound of Formula IIk by reaction with an amine of the formula
NH.sub.2(CH.sub.2).sub.1-3R.sup.1 in the presence of a base (e.g.
DIEA) in a non-reactive solvent (e.g. dichloromethane). After
stirring for several hours, isolation by conventional means (e.g.
extraction and silica gel chromatography) provides compounds of
Formula IIm.
Step 3--Preparation of Compound of Formula VI where M is
NR.sup.57S(O).sub.2NH(CH.sub.2).sub.1-3
[0849] Compound of Formula VIg (Formula VI where M is
NR.sup.57S(O).sub.2NH(CH.sub.2).sub.1-3) is prepared from compound
of Formula IIm by removal of the N-1 protecting group according to
Scheme 43, Step 2.
Example 84
Synthesis of Compounds of Formula VI where M is
S(O).sub.2(CH.sub.2).sub.0-3 or S(CH.sub.2).sub.0-3
[0850] Compound of Formula VIh (Formula VI where M is
S(O).sub.2(CH.sub.2).sub.0-3 or S(CH.sub.2).sub.0-3) may be
synthesized from a compound of Formula IId in two Steps as
described in Scheme 141.
##STR00192##
Step 1--Preparation of Compound of Formula IIn
[0851] Compound of Formula IIn (Formula IIa where R.sup.15,
R.sup.16 and R.sup.17 are H, R.sup.41 is P, R.sup.43 is
S(CH.sub.2).sub.0-3R.sup.1) is prepared by reacting compound of
Formula IId (Formula IIa where R.sup.15, R.sup.16 and R.sup.17 are
H, R.sup.41 is P, and R.sup.43 is a halogen, R.sup.59, e.g. chloro)
with a compound of Formula R.sup.1--(CH.sub.2).sub.0-3--SH in the
presence of a base (e.g. sodium hydride, potassium carbonate) in an
appropriate solvent (e.g. dimethylformamide, acetonitrile) with
heating (e.g. 80.degree. C.) for one to several hours. Isolation by
conventional means (e.g. extraction and silica gel chromatography)
provides compound of Formula IIn. This can be taken to the next
step, or the N-1 protecting group P can be removed according to
Scheme 43, Step 2 to provide compound of Formula VI where M is
S(CH.sub.2).sub.0-3.
Step 2--Preparation of Compound of Formula VI where M is
SO.sub.2(CH.sub.2).sub.0-3
[0852] Compounds of Formula VIh (Formula VI where M is
S(O).sub.2(CH.sub.2).sub.0-3) is prepared from compound of Formula
IIn by reacting with an oxidizing agent (e.g.
meta-chloro-peroxybenzoic acid, hydrogen peroxide) in an
appropriate aprotic solvent (e.g. dichloromethane). Isolation by
conventional means (e.g. extraction and silica gel chromatography)
followed by removal of the N-1 protecting group according to Scheme
43, Step 2 provides compound of Formula VIh.
Example 85
Synthesis of Compounds of Formula VI where M is
C(O)(CH.sub.2).sub.0-3
[0853] Compound of Formula VIi (Formula VI where M is
C(O)(CH.sub.2).sub.0-3) may be synthesized from a compound of
Formula IId in three Steps as described in Scheme 142.
##STR00193##
Step 1--Preparation of Compound of Formula IIo
[0854] Compound of Formula IIo (Formula IIa where R.sup.15,
R.sup.16 and R.sup.17 are H, R.sup.41 is P, R.sup.43 is
C(OH)(CH.sub.2).sub.0-3R.sup.1) is prepared by reacting compound of
Formula IId (Formula IIa where R.sup.15, R.sup.16 and R.sup.17 are
H, R.sup.41 is P, and R.sup.43 is a halogen, R.sup.59, e.g. chloro)
with an organolithium reagent (e.g. butyllithium) to effect the
lithium-halogen exchange at reduced temperature (e.g. -78.degree.
C.) in an appropriate solvent (e.g. tetrahydrofuran) followed by
addition of an aldehyde of Formula
R.sup.1--(CH.sub.2).sub.0-3--C(O)H. After stirring for several
hours and warming to room temperature, isolation by conventional
means (e.g. extraction and silica gel chromatography) provides
compound of Formula IIo.
Step 2--Preparation of Compound of Formula IIp
[0855] Compound of Formula IIp (Formula IIa where R.sup.15,
R.sup.16 and R.sup.17 are H, R.sup.41 is P, R.sup.43 is
C(O)(CH.sub.2).sub.0-3R.sup.1) is prepared by reacting compound of
Formula IIo with an oxidizing agent (e.g. Dess-Martin periodinane),
in an appropriate solvent (e.g. tetrahydrofuran). After stirring
for one to several hours, isolation by conventional means (e.g.
extraction and silica gel chromatography) provides compound of
Formula IIp.
Step 3--Preparation of Compound of Formula VI where B is C.dbd.O
and D is (CH.sub.2).sub.w
[0856] Compound of Formula VIi (Formula VI where M is
C(O)(CH.sub.2).sub.0-3) is prepared from compound of Formula IIp by
removal of the N-1 protecting group according to Scheme 43, Step
2.
Example 86
Synthesis of Compounds of Formula IIr
[0857] Compound of Formula IIr ((Formula IIa where R.sup.15,
R.sup.16 and R.sup.17 are H, R.sup.41 is P, and R.sup.43 is
S(O).sub.2Cl) may be synthesized from a compound of Formula IIf in
two Steps as described in Scheme 143.
##STR00194##
Step 1--Preparation of Compound of Formula IIq
[0858] Compound of Formula IIq ((Formula IIa where R.sup.15,
R.sup.16 and R.sup.17 are H, R.sup.41 is P, and R.sup.43 is
N.sub.2.sup.+) is prepared by reacting compound of Formula IIf
(Formula IIa where R.sup.15, R.sup.16 and R.sup.17 are H, R.sup.41
is P, and R.sup.43 is NH.sub.2) with aqueous hydrochloric acid and
aqueous sodium nitrite. Addition of water and salt results in
precipitation of the compound and filtration affords the chloride
salt of the diazonium of Formula IIq.
Step 2--Preparation of Compound of Formula IIr
[0859] Compound of Formula IIr (Formula IIa where R.sup.15,
R.sup.16 and R.sup.17 are H, R.sup.41 is P, and R.sup.43 is
S(O).sub.2Cl) is prepared by reacting compound of Formula IIq
(Formula IIa where R.sup.15, R.sup.16 and R.sup.17 are H, R.sup.41
is P, and R.sup.43 is N.sub.2.sup.+) with a mixture of cuprous
chloride in acetic acid saturated with sulfur dioxide, while
cooling (e.g. 10.degree. C.). After stirring for 30 minutes to one
hour, the mixture is poured into water and the compound is isolated
by extraction and concentration of the dried organic portions to
provide compound of Formula IIr. (Organic Syntheses, Coll. Vol. 7,
p. 508; Vol. 60, p. 121).
Example 87
Synthesis of Compounds of Formula IIt
[0860] Compound of Formula IIt ((Formula IIa where R.sup.15,
R.sup.16 and R.sup.17 are H, R.sup.41 is P, and R.sup.43 is COOH)
may be synthesized from a compound of Formula IIs in one Step as
described in Scheme 144.
##STR00195##
Step 1--Preparation of Compound of Formula IIt
[0861] Compound of Formula IIt (Formula IIa where R.sup.15,
R.sup.16 and R.sup.17 are H, R.sup.41 is P, and R.sup.43 is COOH)
is prepared by reacting compound of Formula IIs (Formula IIa where
R.sup.15, R.sup.16 and R.sup.17 are H, R.sup.41 is P, and R.sup.43
is MgBr) dissolved in an appropriate solvent (e.g. tetrahydrofuran)
with dry ice. Addition of water and acid-base extraction of the
compound provides compound of Formula IIt.
Example 88
Synthesis of Compounds of Formula VI where M is
C(O)NR.sup.57(CH.sub.2).sub.0-3 or
S(O).sub.2NR.sup.57(CH.sub.2).sub.0-3
[0862] Compound of Formula VIj (Formula VI where M is
C(O)NR.sup.57(CH.sub.2).sub.0-3 or
S(O).sub.2NR.sup.57(CH.sub.2).sub.0-3), where R.sup.57 is
consistent with definition of M for compounds of Formula Ib or
L.sup.2 for compounds of Formula I) may be synthesized from a
compound of Formula IIu in three Steps as described in Scheme
145.
##STR00196##
Step 1--Preparation of Compound of Formula IIv
[0863] Compound of Formula IIv (Formula IIa where R.sup.15,
R.sup.16 and R.sup.17 are H, R.sup.41 is P, and R.sup.43 is
M.sup.2Cl, where M.sup.2 is C(O) or S(O).sub.2) is prepared by
reacting compound of Formula IIu (Formula IIa where R.sup.15,
R.sup.16 and R.sup.17 are H, R.sup.41 is P, and R.sup.43 is
M.sup.2OH, where M.sup.2 is C(O) or S(O).sub.2) with an appropriate
reagent to effect the formation of the acid chloride or sulfonyl
chloride (e.g. thionyl chloride) with heating (e.g. 80.degree. C.)
for several hours, possibly in a solvent (e.g. toluene).
Concentration of the reaction mixture provides compound of Formula
IIv that is used without further purification.
Step 2--Preparation of Compound of Formula IIw
[0864] Compound of Formula IIw (Formula IIa where R.sup.15,
R.sup.16 and R.sup.17 are H, R.sup.41 is P, and R.sup.43 is
M.sup.2NR.sup.57(CH.sub.2).sub.0-3R.sup.1, where M.sup.2 is C(O) or
S(O).sub.2) is prepared by reacting compound of Formula IIv with an
amine of the formula NR.sup.57H(CH.sub.2).sub.0-3R.sup.1 in the
presence of a base (e.g. DIEA) in an appropriate aprotic solvent
(e.g. dimethylformamide, dichloromethane). After stirring for one
to several hours, isolation by conventional means (e.g. extraction
and silica gel chromatography) provides compounds of Formula
IIw.
Step 3--Preparation of Compound of Formula VI where M is
C(O)NR.sup.57 (CH.sub.2).sub.0-3 or S(O).sub.2NR.sup.57
(CH.sub.2).sub.0-3
[0865] Compounds of Formula VIj (Formula VI where M is
C(O)NR.sup.57(CH.sub.2).sub.0-3 or
S(O).sub.2NR.sup.57(CH.sub.2).sub.0-3) is prepared from compound of
Formula IIw by removal of the N-1 protecting group according to
Scheme 43, Step 2.
[0866] Compounds of Formula X or Xa, where R.sup.43 is a
substituent appropriate for further substitution to provide
M-R.sup.1 (e.g. chloro, NH.sub.2, NHR.sup.57, OH, MgBr, C(O)OH,
S(O).sub.2OH; as described in Examples 78-88), and R.sup.42 is a
functionality appropriate for coupling to the 7-azaindole ring or
its analog to form A or L.sup.1, are useful in the synthesis of
compounds of Formula I or Ib or compounds of Formula II as
described in Examples 43-59.
##STR00197##
[0867] Many compounds of Formula X or Xa are commercially
available; for example, many 5- and 6-membered nitrogen-containing
heterocycles where R.sup.43 is chloro or amino and R.sup.42 is a
carboxylic acid or aldehyde are commercially available or may be
prepared using known methods.
[0868] Compounds of Formula Xa where E, F, G, K, L are C and n is 1
form compounds of Formula X.sub.10. Examples for the synthesis of
compounds of Formula X.sub.10 and their use in the synthesis of
compounds of Formula I, Ib, and II may also be applied to other
compounds fitting the definition of Formula X.
##STR00198##
[0869] Compounds of Formula Xa, where R.sup.42 is a hydrogen or
halogen (R.sup.60), and R.sup.15, R.sup.16 and R.sup.17 are either
as defined for Formula Xa or are appropriate substituents for
further modification to provide compounds of Formula X.sub.10, form
compounds of Formula X.sub.20, which are useful in the synthesis of
compounds of Formula Xa.
##STR00199##
[0870] Use of compounds of Formula X.sub.10 or X.sub.20 are
exemplified in the following examples as representative examples of
reactions that may also be useful in the analogous reactions using
compounds of Formula X or Xa.
Example 89
Synthesis of Compounds of Formula X.sub.10 where R.sup.42 is
C(O)H
[0871] Compound of Formula X.sub.10a (Formula X.sub.10 where
R.sup.42 is C(O)H) may be synthesized from a compound of Formula
X.sub.20a in one Step as described in Scheme 146.
##STR00200##
Step 1--Preparation of Compound of Formula X.sub.20b
[0872] Compound of Formula X.sub.10a (Formula X.sub.10 where
R.sup.42 is C(O)H) is prepared by reacting compound of Formula
X.sub.20a (Formula X.sub.20 where R.sup.60 is Br) with an
organolithium reagent (e.g. butyllithium) to effect the
lithium-halogen exchange at reduced temperature (e.g. -78.degree.
C.) in an appropriate solvent (e.g. tetrahydrofuran) followed by
addition of a formylating reagent (e.g. dimethylformamide). After
stirring for several hours and warming to room temperature,
isolation by conventional means (e.g. extraction and silica gel
chromatography), provides compounds of Formula X.sub.10a. Preferred
compounds of X.sub.20a for this reaction have R.sup.15 as
optionally substituted lower alkyl, trifluoromethyl,
CH.sub.2CF.sub.3, OR, or SR, wherein R is optionally substituted
lower alkyl.
Example 90
Synthesis of Compounds of Formula X.sub.10 where R.sup.42 is
C(O)OH
[0873] Compound of Formula X.sub.10b (Formula X.sub.10 where
R.sup.42 is C(O)OH) may be synthesized from a compound of Formula
X.sub.20a in one Step as described in Scheme 147.
##STR00201##
Step 1--Preparation of Compound of Formula X.sub.10b
[0874] Compound of Formula X.sub.10b (Formula X.sub.10 where
R.sup.42 is C(O)OH) is prepared by reacting compound of Formula
X.sub.20a (Formula X.sub.20 where R.sup.60 is Br) with solid
magnesium in an appropriate solvent (e.g. tetrahydrofuran) possibly
with a catalyst (e.g. iodine) and with heating (e.g. 80.degree. C.)
to afford the corresponding Grignard reagent. Dry ice is then added
to the reaction to quench the Grignard and form the carboxylic acid
at R.sup.42. Isolation by evaporation and acid-base extraction
provides compound of Formula X.sub.10b.
Example 91
Synthesis of Compounds of Formula X.sub.10 where R.sup.15 is
Optionally Substituted Lower Alkyl and R.sup.42 is C(O)H
[0875] Compound of Formula X.sub.10c (Formula X.sub.10 where
R.sup.42 is C(O)H and R.sup.15 is optionally substituted lower
alkyl) may be synthesized from a compound of Formula X.sub.20b in
two Steps as described in Scheme 148.
##STR00202##
Step 1--Preparation of Compound of Formula X.sub.20c
[0876] Compound of Formula X.sub.20c (Formula X.sub.20 where
R.sup.60 is H and R.sup.15 is optionally substituted lower alkyl
R.sup.61) is prepared by dissolving compound of Formula X.sub.20b
(Formula X.sub.20 where R.sup.60 is H and R.sup.15 is Br) in an
appropriate solvent (e.g. toluene), followed by the addition of a
palladium catalyst (e.g.
[1,1'-Bis(diphenylphosphino)-ferrocene]dichloropalladium(II),
complex with dichloromethane (1:1)). After several minutes, a
Grignard reagent of the formula R.sup.61--MgBr (where R.sup.61 is
optionally substituted lower alkyl) may be added and the reaction
heated (e.g. 90.degree. C.) for one to several hours. After
filtration through Celite, isolation by conventional means (e.g.
extraction and silica gel chromatography) provides compound of
Formula X.sub.20c.
Step 2--Preparation of Compound of Formula X.sub.10c
[0877] Compound of Formula X.sub.10c (Formula X.sub.10 where
R.sup.42 is C(O)H and R.sup.15 is optionally substituted lower
alkyl) is prepared by reacting compound of Formula X.sub.20c with
an organolithium reagent (e.g. lithium diisopropylamine) to effect
the lithiation at the R.sup.42 position at reduced temperature
(e.g. -78.degree. C.) in an appropriate solvent (e.g.
tetrahydrofuran) followed by addition of a formylating reagent
(e.g. dimethylformamide). After stirring for several hours and
warming to room temperature, isolation by conventional means (e.g.
extraction and silica gel chromatography) provides compound of
Formula X.sub.10c.
Example 92
Synthesis of Compounds of Formula X.sub.10 where R.sup.15 is
OR.sup.62 or SR.sup.62 and R.sup.42 is C(O)H
[0878] Compound of Formula X.sub.10d (Formula X.sub.10 where
R.sup.42 is C(O)H and R.sup.15 is OR.sup.62 or SR.sup.62, where
R.sup.62 is optionally substituted lower alkyl) may be synthesized
from a compound of Formula X.sub.20d in two Steps as described in
Scheme 149.
##STR00203##
Step 1--Preparation of Compound of Formula X.sub.20e
[0879] Compound of Formula X.sub.20e (Formula X.sub.20 where
R.sup.60 is H and R.sup.15 is LR.sup.62, where L is O or S and
R.sup.62 is optionally substituted lower alkyl) is prepared by
reacting compound of Formula X.sub.20d (Formula X.sub.20 where
R.sup.60 is H and R.sup.15 is Cl) with a compound of Formula
R.sup.62--OH or R.sup.62--SH in the presence of a base (e.g. sodium
hydride) in an appropriate solvent (e.g. dimethylformamide,
tetrahydrofuran) with heating (e.g. 80.degree. C.). After stirring
for several hours, isolation by conventional means (e.g. extraction
and silica gel chromatography) provides compound of Formula
X.sub.20e.
Step 2--Preparation of Compound of Formula X.sub.10d
[0880] Compound of Formula X.sub.10d (Formula X.sub.10 where
R.sup.42 is C(O)H and R.sup.15 is LR.sup.62, where L is O or S and
R.sup.62 is optionally substituted lower alkyl) is prepared by
reacting compound of Formula X.sub.20e with an organolithium
reagent (e.g. lithium diisopropylamine) to effect the
ortholithiation at the R.sup.42 position at reduced temperature
(e.g. -78.degree. C.) in an appropriate solvent (e.g.
tetrahydrofuran) followed by addition of a formylating reagent
(e.g. dimethylformamide). After stirring for several hours and
warming to room temperature, isolation by conventional means (e.g.
extraction and silica gel chromatography) provides compound of
Formula X.sub.10d.
Example 93
Synthesis of Compounds of Formula X.sub.10 where R.sup.15 is
Halogen and R.sup.42 is C(O)H
[0881] Compound of Formula X.sub.10e (Formula X.sub.10 where
R.sup.42 is C(O)H and R.sup.15 is halogen) may be synthesized from
a compound of Formula X.sub.20f in two Steps as described in Scheme
150.
##STR00204##
Step 1--Preparation of Compound of Formula X.sub.20g
[0882] Compound of Formula X.sub.20g (Formula X.sub.20 where
R.sup.60 is H and R.sup.15 is chloro or bromo (halogen R.sup.63))
is prepared by reacting compound of Formula X.sub.20f (Formula
X.sub.20 where R.sup.60 is H and R.sup.15 is NH.sub.2) in glacial
acetic acid with sodium nitrite in acid (e.g. hydrochloric acid,
sulfuric acid) to afford the diazonium intermediate. To form the
compounds where R.sup.63 is chloro or bromo, the diazonium salt is
added to cuprous chloride or cuprous bromide, respectively, in
hydrochloric acid with heating (e.g. 80.degree. C.) for 30 minutes
to one hour. Upon addition of the reaction to water, followed by
isolation by conventional means (e.g. extraction and silica gel
chromatography), compound of Formula X.sub.20g where R.sup.63 is
chloro or bromo are obtained.
[0883] Compound of Formula X.sub.20g (Formula X.sub.20 where
R.sup.60 is H and R.sup.15 is fluoro (halogen R.sup.63)) is
prepared by reacting compound of Formula X.sub.20f in an
appropriate aprotic solvent (e.g. tetrahydrofuran or
dichloromethane) with boron trifluoride etherate. Subsequently,
tert-butyl nitrite is added while the reaction is cooled (e.g.
-15.degree. C.) to afford the diazonium tetrafluoroborate
intermediate as a precipitate that can be collected by filtration.
To form the compound where R.sup.63 is fluoro, the diazonium salt
is heated dry with a burner to initiate the evolution
borontrifluoride which subsequently proceeds spontaneously. After
isolation by conventional means (e.g. extraction and silica gel
chromatography) compound of Formula X.sub.20g where R.sup.63 is
fluoro are obtained. (Doyle and Bryker, J. Org. Chem. 1979,
44:1572; Schiemann and Winkelmuller, Org. Syn. Coll. Vol.
2:299).
Step 2--Preparation of Compound of Formula X.sub.10e
[0884] Compound of Formula X.sub.10e (Formula X.sub.10 where
R.sup.42 is C(O)H and R.sup.15 is halogen R.sup.63) is prepared by
reacting compound of Formula X.sub.20g with an organolithium
reagent (e.g. lithium diisopropylamine) to effect the
ortholithiation at the R.sup.42 position at reduced temperature
(e.g. -78.degree. C.) in an appropriate solvent (e.g.
tetrahydrofuran) followed by addition of a formylating reagent
(e.g. dimethylformamide). After stirring for several hours and
warming to room temperature, isolation by conventional means (e.g.
extraction and silica gel chromatography) provides compound of
Formula X.sub.10e.
Example 94
Synthesis of Compounds of Formula X.sub.10 where R.sup.16 is
Optionally Substituted Lower Alkyl and R.sup.42 is C(O)H
[0885] Compound of Formula X.sub.10f (Formula X.sub.10 where
R.sup.42 is C(O)H and R.sup.16 is optionally substituted lower
alkyl) may be synthesized from a compound of Formula X.sub.20h in
two Steps as described in Scheme 151.
##STR00205##
Step 1--Preparation of Compound of Formula X.sub.20i
[0886] Compound of Formula X.sub.20i (Formula X.sub.20 where
R.sup.60 is H and R.sup.16 is optionally substituted lower alkyl
R.sup.64) is prepared by dissolving compound of Formula X.sub.20h
(Formula X.sub.20 where R.sup.60 is H and R.sup.16 is Br) in an
appropriate solvent (e.g. toluene), followed by the addition of a
palladium catalyst (e.g.
[1,1'-Bis(diphenylphosphino)-ferrocene]dichloropalladium(II)
complex with dichloromethane (1:1)). After several minutes, a
Grignard reagent of the Formula R.sup.64--MgBr (R.sup.64 is
optionally substituted lower alkyl) is added and the reaction
heated (e.g. 90.degree. C.) for one to several hours. After
filtration through Celite, isolation by conventional means (e.g.
extraction and silica gel chromatography) provides compound of
Formula X.sub.20i.
Step 2--Preparation of Compound of Formula X.sub.10f
[0887] Compound of Formula X.sub.10f (Formula X.sub.10 where
R.sup.42 is C(O)H and R.sup.16 is optionally substituted lower
alkyl R.sup.64) is prepared by reacting compound of Formula
X.sub.20i with an organolithium reagent (e.g. lithium
diisopropylamine) to effect the lithiation at the R.sup.42 position
at reduced temperature (e.g. -78.degree. C.) in an appropriate
solvent (e.g. tetrahydrofuran) followed by addition of a
formylating reagent (e.g. dimethylformamide). After stirring for
several hours and warming to room temperature, isolation by
conventional means (e.g. extraction and silica gel chromatography)
provides compound of Formula X.sub.10f.
Example 95
Synthesis of Compounds of Formula X.sub.10 where R.sup.16 is
halogen and R.sup.42 is C(O)H
[0888] Compound of Formula X.sub.10g (Formula X.sub.10 where
R.sup.42 is C(O)H and R.sup.16 is halogen) may be synthesized from
a compound of Formula X.sub.20j in two Steps as described in Scheme
152.
##STR00206##
Step 1--Preparation of Compound of Formula X.sub.20k
[0889] Compound of Formula X.sub.20k (Formula X.sub.20 where
R.sup.60 is H and R.sup.16 is chloro or bromo (halogen R.sup.65))
is prepared by reacting compound of Formula X.sub.20j (Formula
X.sub.20 where R.sup.60 is H and R.sup.16 is NH.sub.2) in glacial
acetic acid with sodium nitrite in acid (e.g. hydrochloric acid,
sulfuric acid) to afford the diazonium intermediate. To form the
compound where R.sup.65 is chloro or bromo, the diazonium salt is
added to cuprous chloride or cuprous bromide, respectively, in
hydrochloric acid with heating (e.g. 80.degree. C.) for 30 minutes
to one hour. Upon addition of the reaction to water, followed by
isolation by conventional means (e.g. extraction and silica gel
chromatography) compound of Formula X.sub.20k where R.sup.65 is
bromo or chloro are obtained.
[0890] Compound of Formula X.sub.20k (Formula X.sub.20 where
R.sup.6 is H and R.sup.16 is fluoro (halogen R.sup.65)) is prepared
by reacting compound of Formula X.sub.20j in an appropriate aprotic
solvent (e.g. tetrahydrofuran or dichloromethane) with boron
trifluoride etherate. Subsequently, tert-butyl nitrite may be added
while the reaction is cooled (e.g. -15.degree. C.) to afford the
diazonium tetrafluoroborate intermediate as a precipitate that may
be collected by filtration. To form the compounds where R.sup.65 is
fluoro, the diazonium salt is heated dry with a burner to initiate
the evolution borontrifluoride which subsequently proceeds
spontaneously. After isolation by conventional means (e.g.
extraction and silica gel chromatography), compound of Formula
X.sub.20k where R.sup.15 is H and R.sup.65 is fluoro are obtained.
(Doyle and Bryker, J. Org. Chem. 1979, 44:157; Schiemann and
Winkelmuller, Org. Syn. Coll. Vol. 2:299.)
Step 2--Preparation of Compound of Formula X.sub.10g
[0891] Compound of Formula X.sub.10g (Formula X.sub.10 where
R.sup.42 is C(O)H and R.sup.16 is halogen R.sup.65) is prepared by
reacting compound of Formula X.sub.20k Formula Xa with an
organolithium reagent (e.g. lithium diisopropylamine) to effect the
lithiation at the R.sup.42 position at reduced temperature (e.g.
-78.degree. C.) in an appropriate solvent (e.g. tetrahydrofuran)
followed by addition of a formylating reagent (e.g.
dimethylformamide). After stirring for several hours and warming to
room temperature, isolation by conventional means (e.g. extraction
and silica gel chromatography) provides compounds of Formula
X.sub.10g.
Example 96
Synthesis of Compounds of Formula X.sub.10 where R.sup.16 is
OR.sup.66 and R.sup.42 is C(O)H
[0892] Compound of Formula X.sub.10h (Formula X.sub.10 where
R.sup.42 is C(O)H and R.sup.16 is OR.sup.66, where R.sup.66 is
optionally substituted lower alkyl) may be synthesized from a
compound of Formula X.sub.20h in two Steps as described in Scheme
153.
##STR00207##
Step 1--Preparation of Compound of Formula X.sub.20m
[0893] Compound of Formula X.sub.20m (Formula X.sub.20 where
R.sup.60 is H and R.sup.16 is OR.sup.66, where R.sup.66 is
optionally substituted lower alkyl) is prepared by reacting
compound of Formula X.sub.20h (Formula X.sub.20 where R.sup.60 is H
and R.sup.16 is Br) with compound of the Formula R.sup.66--OH
(R.sup.66 is optionally substituted lower alkyl) in the presence of
a base (e.g. sodium hydride) and a copper catalyst (e.g. copper
bromide) in a non-reactive solvent (e.g. dimethylformamide) with
heating (e.g. 120.degree. C.) for several hours. Isolation by
conventional means (e.g. extraction and silica gel chromatography)
provides compound of Formula X.sub.20m.
Step 2--Preparation of Compound of Formula X.sub.10h
[0894] Compound of Formula X.sub.10h (Formula X.sub.10 where
R.sup.42 is C(O)H and R.sup.16 is OR.sup.66, where R.sup.66 is
optionally substituted lower alkyl) is prepared by reacting
compound of Formula X.sub.20m with an organolithium reagent (e.g.
lithium diisopropylamine) to effect the ortholithiation at the
R.sup.42 position at reduced temperature (e.g. -78.degree. C.) in
an appropriate solvent (e.g. tetrahydrofuran) followed by addition
of a formylating reagent (e.g. dimethylformamide). After stirring
for several hours and warming to room temperature, isolation by
conventional means (e.g. extraction and silica gel chromatography)
provides compound of Formula X.sub.10h.
Example 97
Synthesis of Compounds of Formula X.sub.10 where R.sup.17 is
halogen and R.sup.42 is C(O)H
[0895] Compound of Formula X.sub.10i (Formula X.sub.10 where
R.sup.42 is C(O)H and R.sup.17 is halogen) may be synthesized from
a compound of Formula X.sub.20n in two Steps as described in Scheme
154.
##STR00208##
Step 1--Preparation of Compound of Formula X.sub.20o
[0896] Compound of Formula X.sub.20o (Formula X.sub.20 where
R.sup.60 is H and R.sup.17 is chloro or bromo (halogen R.sup.67))
is prepared by reacting compound of Formula X.sub.20n (Formula
X.sub.20 where R.sup.60 is H and R.sup.17 is NH.sub.2) in glacial
acetic acid with sodium nitrite in acid (e.g. hydrochloric acid,
sulfuric acid) to afford the diazonium intermediate. To form the
compounds where R.sup.67 is chloro or bromo, the diazonium salt is
added to cuprous chloride or cuprous bromide, respectively, in
hydrochloric acid with heating (e.g. 80.degree. C.) for 30 minutes
to one hour. Upon addition of the reaction to water, followed by
isolation by conventional means (e.g. extraction and silica gel
chromatography) compound of Formula X.sub.20o where R.sup.67 is
bromo or chloro are obtained.
[0897] Compound of Formula X.sub.20o (Formula X.sub.20 where
R.sup.60 is H and R.sup.17 is fluoro (halogen R.sup.67)) is
prepared by reacting compound of Formula X.sub.20n in an
appropriate aprotic solvent (e.g. tetrahydrofuran or
dichloromethane) with boron trifluoride etherate. Subsequently,
tert-butyl nitrite may be added while the reaction is cooled (e.g.
-15.degree. C.) to afford the diazonium tetrafluoroborate
intermediate as a precipitate that can be collected by filtration.
To form the compounds where R.sup.67 is fluoro, the diazonium salt
is heated dry with a burner to initiate the evolution
borontrifluoride which subsequently proceeds spontaneously. After
isolation by conventional means (e.g. extraction and silica gel
chromatography) compounds of Formula X.sub.20o where R.sup.67 is
fluoro are obtained. (Doyle and Bryker, J. Org. Chem. 1979,
44:1572. Schiemann and Winkelmuller, Org. Syn. Coll. Vol.
2:299).
Step 2--Preparation of Compound of Formula X.sub.10i
[0898] ] Compound of Formula X.sub.10i (Formula X.sub.10 where
R.sup.42 is C(O)H and R.sup.17 is halogen R.sup.67) is prepared by
reacting compound of Formula X.sub.20o with an organolithium
reagent (e.g. lithium diisopropylamine) to effect the lithiation at
the R.sup.42 position at reduced temperature (e.g. -78.degree. C.)
in an appropriate solvent (e.g. tetrahydrofuran) followed by
addition of a formylating reagent (e.g. dimethylformamide). After
stirring for several hours and warming to room temperature,
isolation by conventional means (e.g. extraction and silica gel
chromatography) provides compounds of Formula X.sub.10i.
Example 98
Synthesis of Compounds of Formula X.sub.10 where R.sup.17 is
OR.sup.68 and R.sup.42 is C(O)H
[0899] Compound of Formula X.sub.10j (Formula X.sub.10 where
R.sup.42 is C(O)H and R.sup.17 is OR.sup.68, where R.sup.68 is
optionally substituted lower alkyl) may be synthesized from a
compound of Formula X.sub.20p in two Steps as described in Scheme
155.
##STR00209##
Step 1--Preparation of Compound of Formula X.sub.20q
[0900] Compound of Formula X.sub.20q (Formula X.sub.20 where
R.sup.60 is H and R.sup.17 is OR.sup.68, where R.sup.68 is
optionally substituted lower alkyl) is prepared by reacting
compound of Formula X.sub.20p (Formula X.sub.20 where R.sup.60 is H
and R.sup.17 is Br) with compound of the Formula R.sup.68--OH
(R.sup.68 is optionally substituted lower alkyl) in the presence of
a base (e.g. sodium hydride) and a copper catalyst (e.g. copper
bromide) in a non-reactive solvent (e.g. dimethylformamide) with
heating (e.g. 120.degree. C.) for several hours. Isolation by
conventional means (e.g. extraction and silica gel chromatography)
provides compound of Formula X.sub.20q.
Step 2--Preparation of Compound of Formula X.sub.10j
[0901] Compound of Formula X.sub.10j (Formula X.sub.10 where
R.sup.42 is C(O)H and R.sup.17 is OR.sup.68, where R.sup.68 is
optionally substituted lower alkyl) is prepared by reacting
compound of Formula X.sub.20q with an organolithium reagent (e.g.
lithium diisopropylamine) to effect the lithiation at the R.sup.42
position at reduced temperature (e.g. -78.degree. C.) in an
appropriate solvent (e.g. tetrahydrofuran) followed by addition of
a formylating reagent (e.g. dimethylformamide). After stirring for
several hours and warming to room temperature, isolation by
conventional means (e.g. extraction and silica gel chromatography)
provides compounds of Formula X.sub.10j.
Example 99
Synthesis of Compounds of Formula X where n=1; G is N; K, J, F and
E are C; R.sup.15 and R.sup.16 are Optionally Substituted Lower
Alkyl; M is NH-D- and R.sup.42 is C(O)H
[0902] Compounds of Formula X where n=1 and G is N are pyrimidine
derivatives that may be prepared through many routes known in the
literature and used in reactions analogous to those described for
compounds of Formula Xa, such as in Examples 89-98. M is NH-D,
where D is consistent with the definition of M. The synthesis of
one such compound is exemplified in Scheme 156 as follows.
##STR00210##
Step 1--Preparation of Compound of Formula X.sub.30
[0903] Compound of Formula X.sub.30 (Formula Xa where n=1, G is N,
K, J, F and E are C, R.sup.15 and R.sup.16 are optionally
substituted lower alkyl (R.sup.69 and R.sup.70, respectively),
R.sup.43 is S-Me and R.sup.42 is H) is prepared by reacting
thiourea 510 with compound of Formula XVII (R.sup.69 and R.sup.70
are independently optionally substituted lower alkyl) in the
presence of a base (e.g. sodium hydroxide) in a non-reactive
solvent (e.g. ethanol) for several hours. Subsequently, the
addition of methyl iodide with heating (e.g. 60.degree. C.) for
several hours, followed by isolation by conventional means (e.g.
extraction and silica gel chromatography) provides compound of
Formula X.sub.30.
Step 2--Preparation of Compound of Formula X.sub.40
[0904] Compounds of Formula X.sub.40 (Formula X where n=1, G is N,
K, J, F and E are C, R.sup.15 and R.sup.16 are optionally
substituted lower alkyl (R.sup.69 and R.sup.70, respectively), M is
NH-D- (D is consistent with definition of M of Formula Ib or
L.sup.2 or Formula I) and R.sup.42 is H) is prepared by reacting
compound of Formula X.sub.30 with compound of Formula
NH.sub.2-D-R.sup.1 (e.g. benzyl amine or other suitable
nucleophile) in the presence of a base (e.g. sodium hydride) in a
non-reactive solvent (e.g. dimethylformamide) for several hours.
Isolation by conventional means (e.g. extraction and silica gel
chromatography) provides compounds of Formula X.sub.40.
Step 3--Preparation of Compound of Formula X.sub.50
[0905] Compounds of Formula X.sub.50 (Formula X where n=1, G is N,
K, J, F and E are C, R.sup.15 and R.sup.16 are optionally
substituted lower alkyl (R.sup.69 and R.sup.70, respectively), M is
NH-D- (D is consistent with definition of M of Formula Ib or
L.sup.2 or Formula I) and R.sup.42 is C(O)H) is prepared by
reacting compound of Formula X.sub.40 with an organolithium reagent
(e.g. lithium diisopropylamine) to effect the lithiation at the
R.sup.42 position at reduced temperature (e.g. -78.degree. C.) in
an appropriate solvent (e.g. tetrahydrofuran) followed by addition
of a formylating reagent (e.g. dimethylformamide). After stirring
for several hours and warming to room temperature, isolation by
conventional means (e.g. extraction and silica gel chromatography)
provides compounds of Formula X.sub.50, which may be used in the
synthesis of compound of Formula II, which may be used in the
synthesis of compound of Formula Ib.
Example 100
Synthesis of Compounds of Formula Xa where n=0; K is S; J, E, and F
are C; R.sup.43 is NHP; R.sup.15 is Optionally Substituted Lower
Alkyl or Optionally Substituted Lower Alkoxy and R.sup.42 is
COOH
[0906] Compounds of Formula X where n=0 are 5-membered heterocycles
that may be prepared through many routes known in the literature
and used in reactions analogous to those described for compounds of
Formula Xa, such as in Examples 89-98. The synthesis of one such
compound is exemplified in Scheme 157 as follows.
##STR00211##
Step 1--Preparation of Compound of Formula X.sub.60
[0907] Compound of Formula X.sub.60 (Formula Xa where n=0, K is S,
J, E, and F are C, R.sup.43 is NH.sub.2, R.sup.15 is R.sup.71
(R.sup.71 is optionally substituted lower alkyl or O--R.sup.72,
where R.sup.72 is optionally substituted lower alkyl) and R.sup.42
is CO.sub.2R, where R is lower alkyl) is prepared by reacting
thiourea 510 with compound of Formula XVI where R.sup.71 is
optionally substituted lower alkyl or O--R.sup.72 (R.sup.72 is
optionally substituted lower alkyl) and R is lower alkyl in a
non-reactive solvent (e.g. dimethylformamide, ethanol) with heating
(e.g. 60.degree. C.) for several hours. Isolation by conventional
means (e.g. extraction and silica gel chromatography) provides
compound of Formula X.sub.60.
Step 2--Preparation of Compound of Formula X.sub.70
[0908] Compound of Formula X.sub.70 (Formula Xa where n=0, K is S,
J, E, and F are C, R.sup.43 is NHP, where P is a protecting group
[e.g. triisopropylsilyl, t-butyloxycarbonyl]), R.sup.15 is R.sup.71
and R.sup.42 is CO.sub.2R, where R is lower alkyl) is prepared by
reacting compound of Formula X.sub.60 with a reagent appropriate to
introduce the protecting group (e.g. triisopropylsilyl chloride,
Boc anhydride) in the presence of a base (e.g. sodium hydride,
diisopropylethylamine) in a non-reactive solvent (e.g.
dimethylformamide) for several hours. Isolation by conventional
means (e.g. extraction and silica gel chromatography) provides
compound of Formula X.sub.70.
Step 3--Preparation of Compound of Formula X.sub.80
[0909] Compound of Formula X.sub.80 (Formula Xa where n=0, K is S,
J, E, and F are C, R.sup.43 is NHP, R.sup.15 is R.sup.71 and
R.sup.42 is CO.sub.2H) is prepared by reacting compound of Formula
X.sub.70 with a base (e.g. lithium hydroxide) in an appropriate
solvent (e.g. tetrahydrofuran and water) for several hours.
Isolation by conventional means (e.g. acid-base extraction)
provides compound of X.sub.80, which may be used in the synthesis
of compound of Formula II where R.sup.43 is NHP, which may be used
to make compound of Formula Ib.
Example 101
Synthesis of
3,5-Dimethyl-4-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrazole-1-carboxyli-
c acid benzylamide P-0084
[0910]
3,5-Dimethyl-4-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrazole-1-car-
boxylic acid benzylamide P-0084 was synthesized in 6 steps from
dimethyl-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-amine 2 as shown in
scheme 158.
##STR00212## ##STR00213##
Step 1: Preparation of
3-Dimethylaminomethyl-pyrrolo[2,3-b]pyridine-1-carboxylic acid
tert-butyl ester (511)
[0911] To dimethyl-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-amine (2,
2.50 g, 14.3 mmol, prepared as described in Example 2, Scheme 4,
Step 1) in tetrahydrofuran (200.0 mL) was added sodium hydride
(0.685 g, 60% in mineral oil, 17.1 mmol). After 10 minutes,
di-tert-butyldicarbonate (3.74 g, 17.1 mmol) was added to the
reaction. The reaction was stirred at room temperature overnight.
The reaction was poured into water and extracted with ethyl
acetate. The organic layer was dried over anhydrous sodium sulfate
and filtered. The filtrate was concentrated and purified by silica
gel column chromatography eluting with 30% ethyl acetate in hexane
to give as a white solid (511, 3.80 g, 96.7%).
Step 2: Preparation of
3-Chloromethyl-pyrrolo[2,3-b]pyridine-1-carboxylic acid tert-butyl
ester (512)
[0912] To 3-dimethylaminomethyl-pyrrolo[2,3-b]pyridine-1-carboxylic
acid tert-butyl ester (511, 2.60 g, 9.44 mmol) in toluene (50.00
mL) was added isopropyl chloroformate (11.3 mL, 1.0 M in toluene)
under an atmosphere of nitrogen. The reaction was stirred at room
temperature for 3 hours. The reaction was poured into water and
extracted with ethyl acetate. The organic layer was dried over
anhydrous sodium sulfate and filtered. The filtrate was
concentrated and purified by silica gel column chromatography
eluting with 20% ethyl acetate in hexane to give a white solid
(512, 2.0 g, 79.4%).
Step 3--Preparation of
3-(2-Acetyl-3-oxo-butyl)-pyrrolo[2,3-b]pyridine-1-carboxylic acid
tert-butyl ester (513)
[0913] To acetylacetone (0.563 g, 5.62 mmol) in dimethyl sulfoxide
(29.0 mL) was added sodium hydride (0.225 g, 60% in mineral oil,
5.62 mmol). After 20 minutes,
3-chloromethyl-pyrrolo[2,3-b]pyridine-1-carboxylic acid tert-butyl
ester (512, 1.00 g, 3.75 mmol) was added to the reaction. The
reaction was stirred at room temperature for 2 hours. The reaction
was poured into water and extracted with ethyl acetate. The organic
layer was dried over anhydrous sodium sulfate and filtered. The
filtrate was concentrated and purified by silica gel column
chromatography eluting with 40% ethyl acetate in hexane to give a
colorless oil (513, 0.59 g, 48.0%). MS (ESI)
[M+.sup.+].sup.+=331.4.
Step 4--Preparation of
3-(3,5-Dimethyl-1H-pyrazol-4-ylmethyl)-pyrrolo[2,3-b]pyridine-1-carboxyli-
c acid tert-butyl ester (514)
[0914] To
3-(2-acetyl-3-oxo-butyl)-pyrrolo[2,3-b]pyridine-1-carboxylic acid
tert-butyl ester (513, 1.20 g, 3.63 mmol) in methanol (15.0 mL),
cooled to -20.degree. C. under an atmosphere of nitrogen, was added
hydrazine (0.128 g, 4.00 mmol) in dichloromethane (6.0 mL). The
reaction was stirred for 2 hours. The reaction was concentrated to
remove the solvents, and the residue was poured into water and
extracted with ethyl acetate. The organic layer was dried over
anhydrous sodium sulfate and filtered. The filtrate was
concentrated and purified by silica gel column chromatography
eluting with 60% ethyl acetate in hexane to give a white solid
(514, 1.0 g, 84.4%). MS (ESI) [M+H.sup.+].sup.+=327.4.
Step 5--Preparation of
3-(1-Benzylcarbamoyl-3,5-dimethyl-1H-pyrazol-4-ylmethyl)-pyrrolo[2,3-b]py-
ridine-1-carboxylic acid tert-butyl ester (515)
[0915] To
3-(3,5-dimethyl-1H-pyrazol-4-ylmethyl)-pyrrolo[2,3-b]pyridine-1--
carboxylic acid tert-butyl ester (514, 60.0 mg, 0.18 mmol) in
dichloromethane (6.0 mL) were added
1,8-diazabicyclo[5.4.0]undec-7-ene (0.033 mL, 0.220 mmol) and
benzyl isocyanate (29.4 mg, 0.220 mmol) under an atmosphere of
nitrogen. The reaction was stirred at room temperature for 2 hours.
The reaction was concentrated and purified by silica gel column
chromatography eluting with 30% ethyl acetate in hexane to give
crude compound (515, approx. 50 mg) that was used in the next step
directly. MS (ESI) [M+H.sup.+].sup.+=460.5.
Step
6--3,5-Dimethyl-4-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrazole-1-ca-
rboxylic acid benzylamide (P-0084)
[0916] To
3-(1-benzylcarbamoyl-3,5-dimethyl-1H-pyrazol-4-ylmethyl)-pyrrolo-
[2,3-b]pyridine-1-carboxylic acid tert-butyl ester (515, 50.0 mg,
0.11 mmol) in dichloromethane (6.0 mL) was added trifluoroacetic
acid (0.20 mL, 2.6 mmol) under an atmosphere of nitrogen. The
reaction was stirred at room temperature for 20 minutes. The
reaction was poured into aqueous potassium carbonate and extracted
with ethyl acetate. The organic layer was dried over anhydrous
sodium sulfate and filtered. The filtrate was concentrated and
purified by silica gel column chromatography eluting with 30% ethyl
acetate in hexane to give a white solid (P-0084, 11.0 mg, 28.1%).
MS (ESI) [M+H.sup.+].sup.+=360.5.
[0917] Additional compounds were prepared following the protocol of
Scheme 158, replacing benzyl isocyanate with an appropriate
electrophile in Step 5. The following compounds were made following
this procedure: [0918]
3,5-Dimethyl-4-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrazole-1-carboxyli-
c acid phenylamide (P-0085),
[3,5-Dimethyl-4-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrazol-1-yl]-pheny-
l-methanone (P-0086), [0919]
1-[3,5-Dimethyl-4-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrazol-1-yl]-3-p-
henyl-propan-1-one (P-0087), [0920]
3-(3,5-Dimethyl-1-phenylmethanesulfonyl-1H-pyrazol-4-ylmethyl)-1H-pyrrolo-
[2,3-b]pyridine (P-0088), [0921]
3-[1-(Butane-1-sulfonyl)-3,5-dimethyl-1H-pyrazol-4-ylmethyl]-1H-pyrrolo[2-
,3-b]pyridine (P-0089), [0922]
3,5-Dimethyl-4-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrazole-1-carboxyli-
c acid butylamide (P-0090), and [0923]
3,5-Dimethyl-4-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyrazole-1-carboxyli-
c acid phenethyl-amide (P-0091).
[0924] The electrophile used in place of benzyl isocyanate in Step
5 is indicated in Column 2 of the following table, with the
compound structure given in Column 3. Column 1 provides the
compound number and Column 4 the experimental mass spectrometry
result.
TABLE-US-00007 MS(ESI) [M + H.sup.+].sup.+ Electrophile Compound
observed P-0085 ##STR00214## ##STR00215## 346.4 P-0086 ##STR00216##
##STR00217## 331.2 P-0087 ##STR00218## ##STR00219## 359.2 P-0088
##STR00220## ##STR00221## 381.2 P-0089 ##STR00222## ##STR00223##
347.2 P-0090 ##STR00224## ##STR00225## 326.2 P-0091 ##STR00226##
##STR00227##
[0925] All patents and other references cited in the specification
are indicative of the level of skill of those skilled in the art to
which the invention pertains, and are incorporated by reference in
their entireties, including any tables and figures, to the same
extent as if each reference had been incorporated by reference in
its entirety individually.
[0926] One skilled in the art would readily appreciate that the
present invention is well adapted to obtain the ends and advantages
mentioned, as well as those inherent therein. The methods,
variances, and compositions described herein as presently
representative of preferred embodiments are exemplary and are not
intended as limitations on the scope of the invention. Changes
therein and other uses will occur to those skilled in the art,
which are encompassed within the spirit of the invention, are
defined by the scope of the claims.
[0927] It will be readily apparent to one skilled in the art that
varying substitutions and modifications may be made to the
invention disclosed herein without departing from the scope and
spirit of the invention. For example, variations can be made to
provide additional compounds of Formula I and/or various methods of
administration can be used. Thus, such additional embodiments are
within the scope of the present invention and the following
claims.
[0928] The invention illustratively described herein suitably may
be practiced in the absence of any element or elements, limitation
or limitations which is not specifically disclosed herein. The
terms and expressions which have been employed are used as terms of
description and not of limitation, and there is no intention that
in the use of such terms and expressions of excluding any
equivalents of the features shown and described or portions
thereof, but it is recognized that various modifications are
possible within the scope of the invention claimed. Thus, it should
be understood that although the present invention has been
specifically disclosed by preferred embodiments and optional
features, modification and variation of the concepts herein
disclosed may be resorted to by those skilled in the art, and that
such modifications and variations are considered to be within the
scope of this invention as defined by the appended claims.
[0929] In addition, where features or aspects of the invention are
described in terms of Markush groups or other grouping of
alternatives, those skilled in the art will recognize that the
invention is also thereby described in terms of any individual
member or subgroup of members of the Markush group or other
group.
[0930] Also, unless indicated to the contrary, where various
numerical values are provided for embodiments, additional
embodiments are described by taking any 2 different values as the
endpoints of a range. Such ranges are also within the scope of the
described invention.
[0931] Thus, additional embodiments are within the scope of the
invention and within the following claims.
TABLE-US-00008 SEQUENCE LISTING SEQ ID NO: 1 Sequence NP_000213 Met
Arg Gly Ala Arg Gly Ala Trp Asp Phe Leu Cys Val Leu Leu Leu Leu Leu
Arg Val Gln Thr Gly Ser Ser Gln Pro Ser Val Ser Pro Gly Glu Pro Ser
Pro Pro Ser Ile His Pro Gly Lys Ser Asp Leu Ile Val Arg Val Gly Asp
Glu Ile Arg Leu Leu Cys Thr Asp Pro Gly Phe Val Lys Trp Thr Phe Glu
Ile Leu Asp Glu Thr Asn Glu Asn Lys Gln Asn Glu Trp Ile Thr Glu Lys
Ala Glu Ala Thr Asn Thr Gly Lys Tyr Thr Cys Thr Asn Lys His Gly Leu
Ser Asn Ser Ile Tyr Val Phe Val Arg Asp Pro Ala Lys Leu Phe Leu Val
Asp Arg Ser Leu Tyr Gly Lys Glu Asp Asn Asp Thr Leu Val Arg Cys Pro
Leu Thr Asp Pro Glu Val Thr Asn Tyr Ser Leu Lys Gly Cys Gln Gly Lys
Pro Leu Pro Lys Asp Leu Arg Phe Ile Pro Asp Pro Lys Ala Gly Ile Met
Ile Lys Ser Val Lys Arg Ala Tyr His Arg Leu Cys Leu His Cys Ser Val
Asp Gln Glu Gly Lys Ser Val Leu Ser Glu Lys Phe Ile Leu Lys Val Arg
Pro Ala Phe Lys Ala Val Pro Val Val Ser Val Ser Lys Ala Ser Tyr Leu
Leu Arg Glu Gly Glu Glu Phe Thr Val Thr Cys Thr Ile Lys Asp Val Ser
Ser Ser Val Tyr Ser Thr Trp Lys Arg Glu Asn Ser Gln Thr Lys Leu Gln
Glu Lys Tyr Asn Ser Trp His His Gly Asp Phe Asn Tyr Glu Arg Gln Ala
Thr Leu Thr Ile Ser Ser Ala Arg Val Asn Asp Ser Gly Val Phe Met Cys
Tyr Ala Asn Asn Thr Phe Gly Ser Ala Asn Val Thr Thr Thr Leu Glu Val
Val Asp Lys Gly Phe Ile Asn Ile Phe Pro Met Ile Asn Thr Thr Val Phe
Val Asn Asp Gly Glu Asn Val Asp Leu Ile Val Glu Tyr Glu Ala Phe Pro
Lys Pro Glu His Gln Gln Trp Ile Tyr Met Asn Arg Thr Phe Thr Asp Lys
Trp Glu Asp Tyr Pro Lys Ser Glu Asn Glu Ser Asn Ile Arg Tyr Val Ser
Glu Leu His Leu Thr Arg Leu Lys Gly Thr Glu Gly Gly Thr Tyr Thr Phe
Leu Val Ser Asn Ser Asp Val Asn Ala Ala Ile Ala Phe Asn Val Tyr Val
Asn Thr Lys Pro Glu Ile Leu Thr Tyr Asp Arg Leu Val Asn Gly Met Leu
Gln Cys Val Ala Ala Gly Phe Pro Glu Pro Thr Ile Asp Trp Tyr Phe Cys
Pro Gly Thr Glu Gln Arg Cys Ser Ala Ser Val Leu Pro Val Asp Val Gln
Thr Leu Asn Ser Ser Gly Pro Pro Phe Gly Lys Leu Val Val Gln Ser Ser
Ile Asp Ser Ser Ala Phe Lys His Asn Gly Thr Val Glu Cys Lys Ala Tyr
Asn Asp Val Gly Lys Thr Ser Ala Tyr Phe Asn Phe Ala Phe Lys Gly Asn
Asn Lys Glu Gln Ile His Pro His Thr Leu Phe Thr Pro Leu Leu Ile Gly
Phe Val Ile Val Ala Gly Met Met Cys Ile Ile Val Met Ile Leu Thr Tyr
Lys Tyr Leu Gln Lys Pro Met Tyr Glu Val Gln Trp Lys Val Val Glu Glu
Ile Asn Gly Asn Asn Tyr Val Tyr Ile Asp Pro Thr Gln Leu Pro Tyr Asp
His Lys Trp Glu Phe Pro Arg Asn Arg Leu Ser Phe Gly Lys Thr Leu Gly
Ala Gly Ala Phe Gly Lys Val Val Glu Ala Thr Ala Tyr Gly Leu Ile Lys
Ser Asp Ala Ala Met Thr Val Ala Val Lys Met Leu Lys Pro Ser Ala His
Leu Thr Glu Arg Glu Ala Leu Met Ser Glu Leu Lys Val Leu Ser Tyr Leu
Gly Asn His Met Asn Ile Val Asn Leu Leu Gly Ala Cys Thr Ile Gly Gly
Pro Thr Leu Val Ile Thr Glu Tyr Cys Cys Tyr Gly Asp Leu Leu Asn Phe
Leu Arg Arg Lys Arg Asp Ser Phe Ile Cys Ser Lys Gln Glu Asp His Ala
Glu Ala Ala Leu Tyr Lys Asn Leu Leu His Ser Lys Glu Ser Ser Cys Ser
Asp Ser Thr Asn Glu Tyr Met Asp Met Lys Pro Gly Val Ser Tyr Val Val
Pro Thr Lys Ala Asp Lys Arg Arg Ser Val Arg Ile Gly Ser Tyr Ile Glu
Arg Asp Val Thr Pro Ala Ile Met Glu Asp Asp Glu Leu Ala Leu Asp Leu
Glu Asp Leu Leu Ser Phe Ser Tyr Gln Val Ala Lys Gly Met Ala Phe Leu
Ala Ser Lys Asn Cys Ile His Arg Asp Leu Ala Ala Arg Asn Ile Leu Leu
Thr His Gly Arg Ile Thr Lys Ile Cys Asp Phe Gly Leu Ala Arg Asp Ile
Lys Asn Asp Ser Asn Tyr Val Val Lys Gly Asn Ala Arg Leu Pro Val Lys
Trp Met Ala Pro Glu Ser Ile Phe Asn Cys Val Tyr Thr Phe Glu Ser Asp
Val Trp Ser Tyr Gly Ile Phe Leu Trp Glu Leu Phe Ser Leu Gly Ser Ser
Pro Tyr Pro Gly Met Pro Val Asp Ser Lys Phe Tyr Lys Met Ile Lys Glu
Gly Phe Arg Met Leu Ser Pro Glu His Ala Pro Ala Glu Met Tyr Asp Ile
Met Lys Thr Cys Trp Asp Ala Asp Pro Leu Lys Arg Pro Thr Phe Lys Gln
Ile Val Gln Leu Ile Glu Lys Gln Ile Ser Glu Ser Thr Asn His Ile Tyr
Ser Asn Leu Ala Asn Cys Ser Pro Asn Arg Gln Lys Pro Val Val Asp His
Ser Val Arg Ile Asn Ser Val Gly Ser Thr Ala Ser Ser Ser Gln Pro Leu
Leu Val His Asp Asp Val SEQ ID NO: 2 Sequence NM_000222 1
gatcccatcg cagctaccgc gatgagaggc gctcgcggcg cctgggattt tctctgcgtt
61 ctgctcctac tgcttcgcgt ccagacaggc tcttctcaac catctgtgag
tccaggggaa 121 ccgtctccac catccatcca tccaggaaaa tcagacttaa
tagtccgcgt gggcgacgag 181 attaggctgt tatgcactga tccgggcttt
gtcaaatgga cttttgagat cctggatgaa 241 acgaatgaga ataagcagaa
tgaatggatc acggaaaagg cagaagccac caacaccggc 301 aaatacacgt
gcaccaacaa acacggctta agcaattcca tttatgtgtt tgttagagat 361
cctgccaagc ttttccttgt tgaccgctcc ttgtatggga aagaagacaa cgacacgctg
421 gtccgctgtc ctctcacaga cccagaagtg accaattatt ccctcaaggg
gtgccagggg 481 aagcctcttc ccaaggactt gaggtttatt cctgacccca
aggcgggcat catgatcaaa 541 agtgtgaaac gcgcctacca tcggctctgt
ctgcattgtt ctgtggacca ggagggcaag 601 tcagtgctgt cggaaaaatt
catcctgaaa gtgaggccag ccttcaaagc tgtgcctgtt 661 gtgtctgtgt
ccaaagcaag ctatcttctt agggaagggg aagaattcac agtgacgtgc 721
acaataaaag atgtgtctag ttctgtgtac tcaacgtgga aaagagaaaa cagtcagact
781 aaactacagg agaaatataa tagctggcat cacggtgact tcaattatga
acgtcaggca 841 acgttgacta tcagttcagc gagagttaat gattctggag
tgttcatgtg ttatgccaat 901 aatacttttg gatcagcaaa tgtcacaaca
accttggaag tagtagataa aggattcatt 961 aatatcttcc ccatgataaa
cactacagta tttgtaaacg atggagaaaa tgtagatttg 1021 attgttgaat
atgaagcatt ccccaaacct gaacaccagc agtggatcta tatgaacaga 1081
accttcactg ataaatggga agattatccc aagtctgaga atgaaagtaa tatcagatac
1141 gtaagtgaac ttcatctaac gagattaaaa ggcaccgaag gaggcactta
cacattccta 1201 gtgtccaatt ctgacgtcaa tgctgccata gcatttaatg
tttatgtgaa tacaaaacca 1261 gaaatcctga cttacgacag gctcgtgaat
ggcatgctcc aatgtgtggc agcaggattc 1321 ccagagccca caatagattg
gtatttttgt ccaggaactg agcagagatg ctctgcttct 1381 gtactgccag
tggatgtgca gacactaaac tcatctgggc caccgtttgg aaagctagtg 1441
gttcagagtt ctatagattc tagtgcattc aagcacaatg gcacggttga atgtaaggct
1501 tacaacgatg tgggcaagac ttctgcctat tttaactttg catttaaagg
taacaacaaa 1561 gagcaaatcc atccccacac cctgttcact cctttgctga
ttggtttcgt aatcgtagct 1621 ggcatgatgt gcattattgt gatgattctg
acctacaaat atttacagaa acccatgtat 1681 gaagtacagt ggaaggttgt
tgaggagata aatggaaaca attatgttta catagaccca 1741 acacaacttc
cttatgatca caaatgggag tttcccagaa acaggctgag ttttgggaaa 1801
accctgggtg ctggagcttt cgggaaggtt gttgaggcaa ctgcttatgg cttaattaag
1861 tcagatgcgg ccatgactgt cgctgtaaag atgctcaagc cgagtgccca
tttgacagaa 1921 cgggaagccc tcatgtctga actcaaagtc ctgagttacc
ttggtaatca catgaatatt 1981 gtgaatctac ttggagcctg caccattgga
gggcccaccc tggtcattac agaatattgt 2041 tgctatggtg atcttttgaa
ttttttgaga agaaaacgtg attcatttat ttgttcaaag 2101 caggaagatc
atgcagaagc tgcactttat aagaatcttc tgcattcaaa ggagtcttcc 2161
tgcagcgata gtactaatga gtacatggac atgaaacctg gagtttctta tgttgtccca
2221 accaaggccg acaaaaggag atctgtgaga ataggctcat acatagaaag
agatgtgact 2281 cccgccatca tggaggatga cgagttggcc ctagacttag
aagacttgct gagcttttct 2341 taccaggtgg caaagggcat ggctttcctc
gcctccaaga attgtattca cagagacttg 2401 gcagccagaa atatcctcct
tactcatggt cggatcacaa agatttgtga ttttggtcta 2461 gccagagaca
tcaagaatga ttctaattat gtggttaaag gaaacgctcg actacctgtg 2521
aagtggatgg cacctgaaag cattttcaac tgtgtataca cgtttgaaag tgacgtctgg
2581 tcctatggga tttttctttg ggagctgttc tctttaggaa gcagccccta
tcctggaatg 2641 ccggtcgatt ctaagttcta caagatgatc aaggaaggct
tccggatgct cagccctgaa 2701 cacgcacctg ctgaaatgta tgacataatg
aagacttgct gggatgcaga tcccctaaaa 2761 agaccaacat tcaagcaaat
tgttcagcta attgagaagc agatttcaga gagcaccaat 2821 catatttact
ccaacttagc aaactgcagc cccaaccgac agaagcccgt ggtagaccat 2881
tctgtgcgga tcaattctgt cggcagcacc gcttcctcct cccagcctct gcttgtgcac
2941 gacgatgtct gagcagaatc agtgtttggg tcacccctcc aggaatgatc
tcttcttttg 3001 gcttccatga tggttatttt cttttctttc aacttgcatc
caactccagg atagtgggca 3061 ccccactgca atcctgtctt tctgagcaca
ctttagtggc cgatgatttt tgtcatcagc 3121 caccatccta ttgcaaaggt
tccaactgta tatattccca atagcaacgt agcttctacc 3181 atgaacagaa
aacattctga tttggaaaaa gagagggagg tatggactgg gggccagagt 3241
cctttccaag gcttctccaa ttctgcccaa aaatatggtt gatagtttac ctgaataaat
3301 ggtagtaatc acagttggcc ttcagaacca tccatagtag tatgatgata
caagattaga 3361 agctgaaaac ctaagtcctt tatgtggaaa acagaacatc
attagaacaa aggacagagt 3421 atgaacacct gggcttaaga aatctagtat
ttcatgctgg gaatgagaca taggccatga 3481 aaaaaatgat ccccaagtgt
gaacaaaaga tgctcttctg tggaccactg catgagcttt 3541 tatactaccg
acctggtttt taaatagagt ttgctattag agcattgaat tggagagaag 3601
gcctccctag ccagcacttg tatatacgca tctataaatt gtccgtgttc atacatttga
3661 ggggaaaaca ccataaggtt tcgtttctgt atacaaccct ggcattatgt
ccactgtgta 3721 tagaagtaga ttaagagcca tataagtttg aaggaaacag
ttaataccat tttttaagga 3781 aacaatataa ccacaaagca cagtttgaac
aaaatctcct cttttagctg atgaacttat 3841 tctgtagatt ctgtggaaca
agcctatcag cttcagaatg gcattgtact caatggattt 3901 gatgctgttt
gacaaagtta ctgattcact gcatggctcc cacaggagtg ggaaaacact 3961
gccatcttag tttggattct tatgtagcag gaaataaagt ataggtttag cctccttcgc
4021 aggcatgtcc tggacaccgg gccagtatct atatatgtgt atgtacgttt
gtatgtgtgt 4081 agacaaatat ttggaggggt atttttgccc tgagtccaag
agggtccttt agtacctgaa 4141 aagtaacttg gctttcatta ttagtactgc
tcttgtttct tttcacatag ctgtctagag 4201 tagcttacca gaagcttcca
tagtggtgca gaggaagtgg aaggcatcag tccctatgta 4261 tttgcagttc
acctgcactt aaggcactct gttatttaga ctcatcttac tgtacctgtt 4321
ccttagacct tccataatgc tactgtctca ctgaaacatt taaattttac cctttagact
4381 gtagcctgga tattattctt gtagtttacc tctttaaaaa caaaacaaaa
caaaacaaaa 4441 aactcccctt cctcactgcc caatataaaa ggcaaatgtg
tacatggcag agtttgtgtg 4501 ttgtcttgaa agattcaggt atgttgcctt
tatggtttcc cccttctaca tttcttagac 4561 tacatttaga gaactgtggc
cgttatctgg aagtaaccat ttgcactgga gttctatgct 4621 ctcgcacctt
tccaaagtta acagattttg gggttgtgtt gtcacccaag agattgttgt 4681
ttgccatact ttgtctgaaa aattcctttg tgtttctatt gacttcaatg atagtaagaa
4741 aagtggttgt tagttataga tgtctaggta cttcaggggc acttcattga
gagttttgtc 4801 ttgccatact ttgtctgaaa aattcctttg tgtttctatt
gacttcaatg atagtaagaa 4861 aagtggttgt tagttataga tgtctaggta
cttcaggggc acttcattga gagttttgtc 4921 aatgtctttt gaatattccc
aagcccatga gtccttgaaa atatttttta tatatacagt 4981 aactttatgt
gtaaatacat aagcggcgta agtttaaagg atgttggtgt tccacgtgtt 5041
ttattcctgt atgttgtcca attgttgaca gttctgaaga attc SEQ ID NO: 3
Sequence NP_5202 Met Gly Pro Gly Val Leu Leu Leu Leu Leu Val Ala
Thr Ala Trp His Gly Gln Gly Ile Pro Val Ile Glu Pro Ser Val Pro Glu
Leu Val Val Lys Pro Gly Ala Thr Val Thr Leu Arg Cys Val Gly Asn Gly
Ser Val Glu Trp Asp Gly Pro Pro Ser Pro His Trp Thr Leu Tyr Ser Asp
Gly Ser Ser Ser Ile Leu Ser Thr Asn Asn Ala Thr Phe Gln Asn Thr Gly
Thr Tyr Arg Cys Thr Glu Pro Gly Asp Pro Leu Gly Gly Ser Ala Ala Ile
His Leu Tyr Val Lys Asp Pro Ala Arg Pro Trp Asn Val Leu Ala Gln Glu
Val Val Val Phe Glu Asp Gln Asp Ala Leu Leu Pro Cys Leu Leu Thr Asp
Pro Val Leu Glu Ala Gly Val Ser Leu Val Arg Val Arg Gly Arg Pro Leu
Met Arg His Thr Asn Tyr Ser Phe Ser Pro Trp His Gly Phe Thr Ile His
Arg Ala Lys Phe Ile Gln Ser Gln Asp Tyr Gln Cys Ser Ala Leu Met Gly
Gly Arg Lys Val Met Ser Ile Ser Ile Arg Leu Lys Val Gln Lys Val Ile
Pro Gly Pro Pro Ala Leu Thr Leu Val Pro Ala Glu Leu Val Arg Ile Arg
Gly Glu Ala Ala Gln Ile Val Cys Ser Ala Ser Ser Val Asp Val Asn Phe
Asp Val Phe Leu Gln His Asn Asn Thr Lys Leu Ala Ile Pro Gln Gln Ser
Asp Phe His Asn Asn Arg Tyr Gln Lys Val Leu Thr Leu Asn Leu Asp Gln
Val Asp Phe Gln His Ala Gly Asn Tyr Ser Cys Val Ala Ser Asn Val Gln
Gly Lys His Ser Thr Ser Met Phe Phe Arg Val Val Glu Ser Ala Tyr Leu
Asn Leu Ser Ser Glu Gln Asn Leu Ile Gln Glu Val Thr Val Gly Glu Gly
Leu Asn Leu Lys Val Met Val Glu Ala Tyr Pro Gly Leu Gln Gly Phe Asn
Trp Thr Tyr Leu Gly Pro Phe Ser Asp His Gln Pro Glu Pro Lys Leu Ala
Asn Ala Thr Thr Lys Asp Thr Tyr Arg His Thr Phe Thr Leu Ser Leu Pro
Arg Leu Lys Pro Ser Glu Ala Gly Arg Tyr Ser Phe Leu Ala Arg Asn Pro
Gly Gly Trp Arg Ala Leu Thr Phe Glu Leu Thr Leu Arg Tyr Pro Pro Glu
Val Ser Val Ile Trp Thr Phe Ile Asn Gly Ser Gly Thr Leu Leu Cys Ala
Ala Ser Gly Tyr Pro Gln Pro Asn Val Thr Trp Leu Gln Cys Ser Gly His
Thr Asp Arg Cys Asp Glu Ala Gln Val Leu Gln Val Trp Asp Asp Pro Tyr
Pro Glu Val Leu Ser Gln Glu Pro Phe His Lys Val Thr Val Gln Ser Leu
Leu Thr Val Glu Thr Leu Glu His Asn Gln Thr Tyr Glu Cys Arg Ala His
Asn Ser Val Gly Ser Gly Ser Trp Ala Phe Ile Pro Ile Ser Ala Gly Ala
His Thr His Pro Pro Asp Glu
Phe Leu Phe Thr Pro Val Val Val Ala Cys Met Ser Ile Met Ala Leu Leu
Leu Leu Leu Leu Leu Leu Leu Leu Tyr Lys Tyr Lys Gln Lys Pro Lys Tyr
Gln Val Arg Trp Lys Ile Ile Glu Ser Tyr Glu Gly Asn Ser Tyr Thr Phe
Ile Asp Pro Thr Gln Leu Pro Tyr Asn Glu Lys Trp Glu Phe Pro Arg Asn
Asn Leu Gln Phe Gly Lys Thr Leu Gly Ala Gly Ala Phe Gly Lys Val Val
Glu Ala Thr Ala Phe Gly Leu Gly Lys Glu Asp Ala Val Leu Lys Val Ala
Val Lys Met Leu Lys Ser Thr Ala His Ala Asp Glu Lys Glu Ala Leu Met
Ser Glu Leu Lys Ile Met Ser His Leu Gly Gln His Glu Asn Ile Val Asn
Leu Leu Gly Ala Cys Thr His Gly Gly Pro Val Leu Val Ile Thr Glu Tyr
Cys Cys Tyr Gly Asp Leu Leu Asn Phe Leu Arg Arg Lys Ala Glu Ala Met
Leu Gly Pro Ser Leu Ser Pro Gly Gln Asp Pro Glu Gly Gly Val Asp Tyr
Lys Asn Ile His Leu Glu Lys Lys Tyr Val Arg Arg Asp Ser Gly Phe Ser
Ser Gln Gly Val Asp Thr Tyr Val Glu Met Arg Pro Val Ser Thr Ser Ser
Asn Asp Ser Phe Ser Glu Gln Asp Leu Asp Lys Glu Asp Gly Arg Pro Leu
Glu Leu Arg Asp Leu Leu His Phe Ser Ser Gln Val Ala Gln Gly Met Ala
Phe Leu Ala Ser Lys Asn Cys Ile His Arg Asp Val Ala Ala Arg Asn Val
Leu Leu Thr Asn Gly His Val Ala Lys Ile Gly Asp Phe Gly Leu Ala Arg
Asp Ile Met Asn Asp Ser Asn Tyr Ile Val Lys Gly Asn Ala Arg Leu Pro
Val Lys Trp Met Ala Pro Glu Ser Ile Phe Asp Cys Val Tyr Thr Val Gln
Ser Asp Val Trp Ser Tyr Gly Ile Leu Leu Trp Glu Ile Phe Ser Leu Gly
Leu Asn Pro Tyr Pro Gly Ile Leu Val Asn Ser Lys Phe Tyr Lys Leu Val
Lys Asp Gly Tyr Gln Met Ala Gln Pro Ala Phe Ala Pro Lys Asn Ile Tyr
Ser Ile Met Gln Ala Cys Trp Ala Leu Glu Pro Thr His Arg Pro Thr Phe
Gln Gln Ile Cys Ser Phe Leu Gln Glu Gln Ala Gln Glu Asp Arg Arg Glu
Arg Asp Tyr Thr Asn Leu Pro Ser Ser Ser Arg Ser Gly Gly Ser Gly Ser
Ser Ser Ser Glu Leu Glu Glu Glu Ser Ser Ser Glu His Leu Thr Cys Cys
Glu Gln Gly Asp Ile Ala Gln Pro Leu Leu Gln Pro Asn Asn Tyr Gln Phe
Cys SEQ ID NO: 4 Sequence NM_005211 1 gaagggcaga cagagtgtcc
aaaagcgtga gagcacgaag tgaggagaag gtggagaaga 61 gagaagagga
agaggaagag gaagagagga agcggaggga actgcggcca ggctaaaagg 121
ggaagaagag gatcagccca aggaggagga agaggaaaac aagacaaaca gccagtgcag
181 aggagaggaa cgtgtgtcca gtgtcccgat ccctgcggag ctagtagctg
agagctctgt 241 gccctgggca ccttgcagcc ctgcacctgc ctgccacttc
cccaccgagg ccatgggccc 301 aggagttctg ctgctcctgc tggtggccac
agcttggcat ggtcagggaa tcccagtgat 361 agagcccagt gtccctgagc
tggtcgtgaa gccaggagca acggtgacct tgcgatgtgt 421 gggcaatggc
agcgtggaat gggatggccc cccatcacct cactggaccc tgtactctga 481
tggctccagc agcatcctca gcaccaacaa cgctaccttc caaaacacgg ggacctatcg
541 ctgcactgag cctggagacc ccctgggagg cagcgccgcc atccacctct
atgtcaaaga 601 ccctgcccgg ccctggaacg tgctagcaca ggaggtggtc
gtgttcgagg accaggacgc 661 actactgccc tgtctgctca cagacccggt
gctggaagca ggcgtctcgc tggtgcgtgt 721 gcgtggccgg cccctcatgc
gccacaccaa ctactccttc tcgccctggc atggcttcac 781 catccacagg
gccaagttca ttcagagcca ggactatcaa tgcagtgccc tgatgggtgg 841
caggaaggtg atgtccatca gcatccggct gaaagtgcag aaagtcatcc cagggccccc
901 agccttgaca ctggtgcctg cagagctggt gcggattcga ggggaggctg
cccagatcgt 961 gtgctcagcc agcagcgttg atgttaactt tgatgtcttc
ctccaacaca acaacaccaa 1021 gctcgcaatc cctcaacaat ctgactttca
taataaccgt taccaaaaag tcctgaccct 1081 caacctcgat caagtagatt
tccaacatgc cggcaactac tcctgcgtgg ccagcaacgt 1141 gcagggcaag
cactccacct ccatgttctt ccgggtggta gagagtgcct acttgaactt 1201
gagctctgag cagaacctca tccaggaggt gaccgtgggg gaggggctca acctcaaagt
1261 catggtggag gcctacccag gcctgcaagg ttttaactgg acctacctgg
gacccttttc 1321 tgaccaccag cctgagccca agcttgctaa tgctaccacc
aaggacacat acaggcacac 1381 cttcaccctc tctctgcccc gcctgaagcc
ctctgaggct ggccgctact ccttcctggc 1441 cagaaaccca ggaggctgga
gagctctgac gtttgagctc acccttcgat accccccaga 1501 ggtaagcgtc
atatggacat tcatcaacgg ctctggcacc cttttgtgtg ctgcctctgg 1561
gtacccccag cccaacgtga catggctgca gtgcagtggc cacactgata ggtgtgatga
1621 ggcccaagtg ctgcaggtct gggatgaccc ataccctgag gtcctgagcc
aggagccctt 1681 ccacaaggtg acggtgcaga gcctgctgac tgttgagacc
ttagagcaca accaaaccta 1741 cgagtgcagg gcccacaaca gcgtggggag
tggctcctgg gccttcatac ccatctctgc 1801 aggagcccac acgcatcccc
cggatgagtt cctcttcaca ccagtggtgg tcgcctgcat 1861 gtccatcatg
gccttgctgc tgctgctgct cctgctgcta ttgtacaagt ataagcagaa 1921
gcccaagtac caggtccgct ggaagatcat cgagagctat gagggcaaca gttatacttt
1981 catcgacccc acgcagctgc cttacaacga gaagtgggag ttcccccgga
acaacctgca 2041 gtttggtaag accctcggag ctggagcctt tgggaaggtg
gtggaggcca cggcctttgg 2101 tctgggcaag gaggatgctg tcctgaaggt
ggctgtgaag atgctgaagt ccacggccca 2161 tgctgatgag aaggaggccc
tcatgtccga gctgaagatc atgagccacc tgggccagca 2221 cgagaacatc
gtcaaccttc tgggagcctg tacccatgga ggccctgtac tggtcatcac 2281
ggagtactgt tgctatggcg acctgctcaa ctttctgcga aggaaggctg aggccatgct
2341 gggacccagc ctgagccccg gccaggaccc cgagggaggc gtcgactata
agaacatcca 2401 cctcgagaag aaatatgtcc gcagggacag tggcttctcc
agccagggtg tggacaccta 2461 tgtggagatg aggcctgtct ccacttcttc
aaatgactcc ttctctgagc aagacctgga 2521 caaggaggat ggacggcccc
tggagctccg ggacctgctt cacttctcca gccaagtagc 2581 ccagggcatg
gccttcctcg cttccaagaa ttgcatccac cgggacgtgg cagcgcgtaa 2641
cgtgctgttg accaatggtc atgtggccaa gattggggac ttcgggctgg ctagggacat
2701 catgaatgac tccaactaca ttgtcaaggg caatgcccgc ctgcctgtga
agtggatggc 2761 cccagagagc atctttgact gtgtctacac ggttcagagc
gacgtctggt cctatggcat 2821 cctcctctgg gagatcttct cacttgggct
gaatccctac cctggcatcc tggtgaacag 2881 caagttctat aaactggtga
aggatggata ccaaatggcc cagcctgcat ttgccccaaa 2941 gaatatatac
agcatcatgc aggcctgctg ggccttggag cccacccaca gacccacctt 3001
ccagcagatc tgctccttcc ttcaggagca ggcccaagag gacaggagag agcgggacta
3061 taccaatctg ccgagcagca gcagaagcgg tggcagcggc agcagcagca
gtgagctgga 3121 ggaggagagc tctagtgagc acctgacctg ctgcgagcaa
ggggatatcg cccagccctt 3181 gctgcagccc aacaactatc agttctgctg
aggagttgac gacagggagt accactctcc 3241 cctcctccaa acttcaactc
ctccatggat ggggcgacac ggggagaaca tacaaactct 3301 gccttcggtc
atttcactca acagctcggc ccagctctga aacttgggaa ggtgagggat 3361
tcaggggagg tcagaggatc ccacttcctg agcatgggcc atcactgcca gtcaggggct
3421 gggggctgag ccctcacccc cccctcccct actgttctca tggtgttggc
ctcgtgtttg 3481 ctatgccaac tagtagaacc ttctttccta atccccttat
cttcatggaa atggactgac 3541 tttatgccta tgaagtcccc aggagctaca
ctgatactga gaaaaccagg ctctttgggg 3601 ctagacagac tggcagagag
tgagatctcc ctctctgaga ggagcagcag atgctcacag 3661 accacactca
gctcaggccc cttggagcag gatggctcct ctaagaatct cacaggacct 3721
cttagtctct gccctatacg ccgccttcac tccacagcct cacccctccc acccccatac
3781 tggtactgct gtaatgagcc aagtggcagc taaaagttgg gggtgttctg
cccagtcccg 3841 tcattctggg ctagaaggca ggggaccttg gcatgtggct
ggccacacca agcaggaagc 3901 acaaactccc ccaagctgac tcatcctaac
taacagtcac gccgtgggat gtctctgtcc 3961 acattaaact aacagcatta atgca
Sequence CWU 1
1
661976PRTHomo sapiens 1Met Arg Gly Ala Arg Gly Ala Trp Asp Phe Leu
Cys Val Leu Leu Leu1 5 10 15Leu Leu Arg Val Gln Thr Gly Ser Ser Gln
Pro Ser Val Ser Pro Gly 20 25 30Glu Pro Ser Pro Pro Ser Ile His Pro
Gly Lys Ser Asp Leu Ile Val 35 40 45Arg Val Gly Asp Glu Ile Arg Leu
Leu Cys Thr Asp Pro Gly Phe Val 50 55 60Lys Trp Thr Phe Glu Ile Leu
Asp Glu Thr Asn Glu Asn Lys Gln Asn65 70 75 80Glu Trp Ile Thr Glu
Lys Ala Glu Ala Thr Asn Thr Gly Lys Tyr Thr 85 90 95Cys Thr Asn Lys
His Gly Leu Ser Asn Ser Ile Tyr Val Phe Val Arg 100 105 110Asp Pro
Ala Lys Leu Phe Leu Val Asp Arg Ser Leu Tyr Gly Lys Glu 115 120
125Asp Asn Asp Thr Leu Val Arg Cys Pro Leu Thr Asp Pro Glu Val Thr
130 135 140Asn Tyr Ser Leu Lys Gly Cys Gln Gly Lys Pro Leu Pro Lys
Asp Leu145 150 155 160Arg Phe Ile Pro Asp Pro Lys Ala Gly Ile Met
Ile Lys Ser Val Lys 165 170 175Arg Ala Tyr His Arg Leu Cys Leu His
Cys Ser Val Asp Gln Glu Gly 180 185 190Lys Ser Val Leu Ser Glu Lys
Phe Ile Leu Lys Val Arg Pro Ala Phe 195 200 205Lys Ala Val Pro Val
Val Ser Val Ser Lys Ala Ser Tyr Leu Leu Arg 210 215 220Glu Gly Glu
Glu Phe Thr Val Thr Cys Thr Ile Lys Asp Val Ser Ser225 230 235
240Ser Val Tyr Ser Thr Trp Lys Arg Glu Asn Ser Gln Thr Lys Leu Gln
245 250 255Glu Lys Tyr Asn Ser Trp His His Gly Asp Phe Asn Tyr Glu
Arg Gln 260 265 270Ala Thr Leu Thr Ile Ser Ser Ala Arg Val Asn Asp
Ser Gly Val Phe 275 280 285Met Cys Tyr Ala Asn Asn Thr Phe Gly Ser
Ala Asn Val Thr Thr Thr 290 295 300Leu Glu Val Val Asp Lys Gly Phe
Ile Asn Ile Phe Pro Met Ile Asn305 310 315 320Thr Thr Val Phe Val
Asn Asp Gly Glu Asn Val Asp Leu Ile Val Glu 325 330 335Tyr Glu Ala
Phe Pro Lys Pro Glu His Gln Gln Trp Ile Tyr Met Asn 340 345 350Arg
Thr Phe Thr Asp Lys Trp Glu Asp Tyr Pro Lys Ser Glu Asn Glu 355 360
365Ser Asn Ile Arg Tyr Val Ser Glu Leu His Leu Thr Arg Leu Lys Gly
370 375 380Thr Glu Gly Gly Thr Tyr Thr Phe Leu Val Ser Asn Ser Asp
Val Asn385 390 395 400Ala Ala Ile Ala Phe Asn Val Tyr Val Asn Thr
Lys Pro Glu Ile Leu 405 410 415Thr Tyr Asp Arg Leu Val Asn Gly Met
Leu Gln Cys Val Ala Ala Gly 420 425 430Phe Pro Glu Pro Thr Ile Asp
Trp Tyr Phe Cys Pro Gly Thr Glu Gln 435 440 445Arg Cys Ser Ala Ser
Val Leu Pro Val Asp Val Gln Thr Leu Asn Ser 450 455 460Ser Gly Pro
Pro Phe Gly Lys Leu Val Val Gln Ser Ser Ile Asp Ser465 470 475
480Ser Ala Phe Lys His Asn Gly Thr Val Glu Cys Lys Ala Tyr Asn Asp
485 490 495Val Gly Lys Thr Ser Ala Tyr Phe Asn Phe Ala Phe Lys Gly
Asn Asn 500 505 510Lys Glu Gln Ile His Pro His Thr Leu Phe Thr Pro
Leu Leu Ile Gly 515 520 525Phe Val Ile Val Ala Gly Met Met Cys Ile
Ile Val Met Ile Leu Thr 530 535 540Tyr Lys Tyr Leu Gln Lys Pro Met
Tyr Glu Val Gln Trp Lys Val Val545 550 555 560Glu Glu Ile Asn Gly
Asn Asn Tyr Val Tyr Ile Asp Pro Thr Gln Leu 565 570 575Pro Tyr Asp
His Lys Trp Glu Phe Pro Arg Asn Arg Leu Ser Phe Gly 580 585 590Lys
Thr Leu Gly Ala Gly Ala Phe Gly Lys Val Val Glu Ala Thr Ala 595 600
605Tyr Gly Leu Ile Lys Ser Asp Ala Ala Met Thr Val Ala Val Lys Met
610 615 620Leu Lys Pro Ser Ala His Leu Thr Glu Arg Glu Ala Leu Met
Ser Glu625 630 635 640Leu Lys Val Leu Ser Tyr Leu Gly Asn His Met
Asn Ile Val Asn Leu 645 650 655Leu Gly Ala Cys Thr Ile Gly Gly Pro
Thr Leu Val Ile Thr Glu Tyr 660 665 670Cys Cys Tyr Gly Asp Leu Leu
Asn Phe Leu Arg Arg Lys Arg Asp Ser 675 680 685Phe Ile Cys Ser Lys
Gln Glu Asp His Ala Glu Ala Ala Leu Tyr Lys 690 695 700Asn Leu Leu
His Ser Lys Glu Ser Ser Cys Ser Asp Ser Thr Asn Glu705 710 715
720Tyr Met Asp Met Lys Pro Gly Val Ser Tyr Val Val Pro Thr Lys Ala
725 730 735Asp Lys Arg Arg Ser Val Arg Ile Gly Ser Tyr Ile Glu Arg
Asp Val 740 745 750Thr Pro Ala Ile Met Glu Asp Asp Glu Leu Ala Leu
Asp Leu Glu Asp 755 760 765Leu Leu Ser Phe Ser Tyr Gln Val Ala Lys
Gly Met Ala Phe Leu Ala 770 775 780Ser Lys Asn Cys Ile His Arg Asp
Leu Ala Ala Arg Asn Ile Leu Leu785 790 795 800Thr His Gly Arg Ile
Thr Lys Ile Cys Asp Phe Gly Leu Ala Arg Asp 805 810 815Ile Lys Asn
Asp Ser Asn Tyr Val Val Lys Gly Asn Ala Arg Leu Pro 820 825 830Val
Lys Trp Met Ala Pro Glu Ser Ile Phe Asn Cys Val Tyr Thr Phe 835 840
845Glu Ser Asp Val Trp Ser Tyr Gly Ile Phe Leu Trp Glu Leu Phe Ser
850 855 860Leu Gly Ser Ser Pro Tyr Pro Gly Met Pro Val Asp Ser Lys
Phe Tyr865 870 875 880Lys Met Ile Lys Glu Gly Phe Arg Met Leu Ser
Pro Glu His Ala Pro 885 890 895Ala Glu Met Tyr Asp Ile Met Lys Thr
Cys Trp Asp Ala Asp Pro Leu 900 905 910Lys Arg Pro Thr Phe Lys Gln
Ile Val Gln Leu Ile Glu Lys Gln Ile 915 920 925Ser Glu Ser Thr Asn
His Ile Tyr Ser Asn Leu Ala Asn Cys Ser Pro 930 935 940Asn Arg Gln
Lys Pro Val Val Asp His Ser Val Arg Ile Asn Ser Val945 950 955
960Gly Ser Thr Ala Ser Ser Ser Gln Pro Leu Leu Val His Asp Asp Val
965 970 97525084DNAHomo sapiens 2gatcccatcg cagctaccgc gatgagaggc
gctcgcggcg cctgggattt tctctgcgtt 60ctgctcctac tgcttcgcgt ccagacaggc
tcttctcaac catctgtgag tccaggggaa 120ccgtctccac catccatcca
tccaggaaaa tcagacttaa tagtccgcgt gggcgacgag 180attaggctgt
tatgcactga tccgggcttt gtcaaatgga cttttgagat cctggatgaa
240acgaatgaga ataagcagaa tgaatggatc acggaaaagg cagaagccac
caacaccggc 300aaatacacgt gcaccaacaa acacggctta agcaattcca
tttatgtgtt tgttagagat 360cctgccaagc ttttccttgt tgaccgctcc
ttgtatggga aagaagacaa cgacacgctg 420gtccgctgtc ctctcacaga
cccagaagtg accaattatt ccctcaaggg gtgccagggg 480aagcctcttc
ccaaggactt gaggtttatt cctgacccca aggcgggcat catgatcaaa
540agtgtgaaac gcgcctacca tcggctctgt ctgcattgtt ctgtggacca
ggagggcaag 600tcagtgctgt cggaaaaatt catcctgaaa gtgaggccag
ccttcaaagc tgtgcctgtt 660gtgtctgtgt ccaaagcaag ctatcttctt
agggaagggg aagaattcac agtgacgtgc 720acaataaaag atgtgtctag
ttctgtgtac tcaacgtgga aaagagaaaa cagtcagact 780aaactacagg
agaaatataa tagctggcat cacggtgact tcaattatga acgtcaggca
840acgttgacta tcagttcagc gagagttaat gattctggag tgttcatgtg
ttatgccaat 900aatacttttg gatcagcaaa tgtcacaaca accttggaag
tagtagataa aggattcatt 960aatatcttcc ccatgataaa cactacagta
tttgtaaacg atggagaaaa tgtagatttg 1020attgttgaat atgaagcatt
ccccaaacct gaacaccagc agtggatcta tatgaacaga 1080accttcactg
ataaatggga agattatccc aagtctgaga atgaaagtaa tatcagatac
1140gtaagtgaac ttcatctaac gagattaaaa ggcaccgaag gaggcactta
cacattccta 1200gtgtccaatt ctgacgtcaa tgctgccata gcatttaatg
tttatgtgaa tacaaaacca 1260gaaatcctga cttacgacag gctcgtgaat
ggcatgctcc aatgtgtggc agcaggattc 1320ccagagccca caatagattg
gtatttttgt ccaggaactg agcagagatg ctctgcttct 1380gtactgccag
tggatgtgca gacactaaac tcatctgggc caccgtttgg aaagctagtg
1440gttcagagtt ctatagattc tagtgcattc aagcacaatg gcacggttga
atgtaaggct 1500tacaacgatg tgggcaagac ttctgcctat tttaactttg
catttaaagg taacaacaaa 1560gagcaaatcc atccccacac cctgttcact
cctttgctga ttggtttcgt aatcgtagct 1620ggcatgatgt gcattattgt
gatgattctg acctacaaat atttacagaa acccatgtat 1680gaagtacagt
ggaaggttgt tgaggagata aatggaaaca attatgttta catagaccca
1740acacaacttc cttatgatca caaatgggag tttcccagaa acaggctgag
ttttgggaaa 1800accctgggtg ctggagcttt cgggaaggtt gttgaggcaa
ctgcttatgg cttaattaag 1860tcagatgcgg ccatgactgt cgctgtaaag
atgctcaagc cgagtgccca tttgacagaa 1920cgggaagccc tcatgtctga
actcaaagtc ctgagttacc ttggtaatca catgaatatt 1980gtgaatctac
ttggagcctg caccattgga gggcccaccc tggtcattac agaatattgt
2040tgctatggtg atcttttgaa ttttttgaga agaaaacgtg attcatttat
ttgttcaaag 2100caggaagatc atgcagaagc tgcactttat aagaatcttc
tgcattcaaa ggagtcttcc 2160tgcagcgata gtactaatga gtacatggac
atgaaacctg gagtttctta tgttgtccca 2220accaaggccg acaaaaggag
atctgtgaga ataggctcat acatagaaag agatgtgact 2280cccgccatca
tggaggatga cgagttggcc ctagacttag aagacttgct gagcttttct
2340taccaggtgg caaagggcat ggctttcctc gcctccaaga attgtattca
cagagacttg 2400gcagccagaa atatcctcct tactcatggt cggatcacaa
agatttgtga ttttggtcta 2460gccagagaca tcaagaatga ttctaattat
gtggttaaag gaaacgctcg actacctgtg 2520aagtggatgg cacctgaaag
cattttcaac tgtgtataca cgtttgaaag tgacgtctgg 2580tcctatggga
tttttctttg ggagctgttc tctttaggaa gcagccccta tcctggaatg
2640ccggtcgatt ctaagttcta caagatgatc aaggaaggct tccggatgct
cagccctgaa 2700cacgcacctg ctgaaatgta tgacataatg aagacttgct
gggatgcaga tcccctaaaa 2760agaccaacat tcaagcaaat tgttcagcta
attgagaagc agatttcaga gagcaccaat 2820catatttact ccaacttagc
aaactgcagc cccaaccgac agaagcccgt ggtagaccat 2880tctgtgcgga
tcaattctgt cggcagcacc gcttcctcct cccagcctct gcttgtgcac
2940gacgatgtct gagcagaatc agtgtttggg tcacccctcc aggaatgatc
tcttcttttg 3000gcttccatga tggttatttt cttttctttc aacttgcatc
caactccagg atagtgggca 3060ccccactgca atcctgtctt tctgagcaca
ctttagtggc cgatgatttt tgtcatcagc 3120caccatccta ttgcaaaggt
tccaactgta tatattccca atagcaacgt agcttctacc 3180atgaacagaa
aacattctga tttggaaaaa gagagggagg tatggactgg gggccagagt
3240cctttccaag gcttctccaa ttctgcccaa aaatatggtt gatagtttac
ctgaataaat 3300ggtagtaatc acagttggcc ttcagaacca tccatagtag
tatgatgata caagattaga 3360agctgaaaac ctaagtcctt tatgtggaaa
acagaacatc attagaacaa aggacagagt 3420atgaacacct gggcttaaga
aatctagtat ttcatgctgg gaatgagaca taggccatga 3480aaaaaatgat
ccccaagtgt gaacaaaaga tgctcttctg tggaccactg catgagcttt
3540tatactaccg acctggtttt taaatagagt ttgctattag agcattgaat
tggagagaag 3600gcctccctag ccagcacttg tatatacgca tctataaatt
gtccgtgttc atacatttga 3660ggggaaaaca ccataaggtt tcgtttctgt
atacaaccct ggcattatgt ccactgtgta 3720tagaagtaga ttaagagcca
tataagtttg aaggaaacag ttaataccat tttttaagga 3780aacaatataa
ccacaaagca cagtttgaac aaaatctcct cttttagctg atgaacttat
3840tctgtagatt ctgtggaaca agcctatcag cttcagaatg gcattgtact
caatggattt 3900gatgctgttt gacaaagtta ctgattcact gcatggctcc
cacaggagtg ggaaaacact 3960gccatcttag tttggattct tatgtagcag
gaaataaagt ataggtttag cctccttcgc 4020aggcatgtcc tggacaccgg
gccagtatct atatatgtgt atgtacgttt gtatgtgtgt 4080agacaaatat
ttggaggggt atttttgccc tgagtccaag agggtccttt agtacctgaa
4140aagtaacttg gctttcatta ttagtactgc tcttgtttct tttcacatag
ctgtctagag 4200tagcttacca gaagcttcca tagtggtgca gaggaagtgg
aaggcatcag tccctatgta 4260tttgcagttc acctgcactt aaggcactct
gttatttaga ctcatcttac tgtacctgtt 4320ccttagacct tccataatgc
tactgtctca ctgaaacatt taaattttac cctttagact 4380gtagcctgga
tattattctt gtagtttacc tctttaaaaa caaaacaaaa caaaacaaaa
4440aactcccctt cctcactgcc caatataaaa ggcaaatgtg tacatggcag
agtttgtgtg 4500ttgtcttgaa agattcaggt atgttgcctt tatggtttcc
cccttctaca tttcttagac 4560tacatttaga gaactgtggc cgttatctgg
aagtaaccat ttgcactgga gttctatgct 4620ctcgcacctt tccaaagtta
acagattttg gggttgtgtt gtcacccaag agattgttgt 4680ttgccatact
ttgtctgaaa aattcctttg tgtttctatt gacttcaatg atagtaagaa
4740aagtggttgt tagttataga tgtctaggta cttcaggggc acttcattga
gagttttgtc 4800ttgccatact ttgtctgaaa aattcctttg tgtttctatt
gacttcaatg atagtaagaa 4860aagtggttgt tagttataga tgtctaggta
cttcaggggc acttcattga gagttttgtc 4920aatgtctttt gaatattccc
aagcccatga gtccttgaaa atatttttta tatatacagt 4980aactttatgt
gtaaatacat aagcggcgta agtttaaagg atgttggtgt tccacgtgtt
5040ttattcctgt atgttgtcca attgttgaca gttctgaaga attc
50843972PRTHomo sapiens 3Met Gly Pro Gly Val Leu Leu Leu Leu Leu
Val Ala Thr Ala Trp His1 5 10 15Gly Gln Gly Ile Pro Val Ile Glu Pro
Ser Val Pro Glu Leu Val Val 20 25 30Lys Pro Gly Ala Thr Val Thr Leu
Arg Cys Val Gly Asn Gly Ser Val 35 40 45Glu Trp Asp Gly Pro Pro Ser
Pro His Trp Thr Leu Tyr Ser Asp Gly 50 55 60Ser Ser Ser Ile Leu Ser
Thr Asn Asn Ala Thr Phe Gln Asn Thr Gly65 70 75 80Thr Tyr Arg Cys
Thr Glu Pro Gly Asp Pro Leu Gly Gly Ser Ala Ala 85 90 95Ile His Leu
Tyr Val Lys Asp Pro Ala Arg Pro Trp Asn Val Leu Ala 100 105 110Gln
Glu Val Val Val Phe Glu Asp Gln Asp Ala Leu Leu Pro Cys Leu 115 120
125Leu Thr Asp Pro Val Leu Glu Ala Gly Val Ser Leu Val Arg Val Arg
130 135 140Gly Arg Pro Leu Met Arg His Thr Asn Tyr Ser Phe Ser Pro
Trp His145 150 155 160Gly Phe Thr Ile His Arg Ala Lys Phe Ile Gln
Ser Gln Asp Tyr Gln 165 170 175Cys Ser Ala Leu Met Gly Gly Arg Lys
Val Met Ser Ile Ser Ile Arg 180 185 190Leu Lys Val Gln Lys Val Ile
Pro Gly Pro Pro Ala Leu Thr Leu Val 195 200 205Pro Ala Glu Leu Val
Arg Ile Arg Gly Glu Ala Ala Gln Ile Val Cys 210 215 220Ser Ala Ser
Ser Val Asp Val Asn Phe Asp Val Phe Leu Gln His Asn225 230 235
240Asn Thr Lys Leu Ala Ile Pro Gln Gln Ser Asp Phe His Asn Asn Arg
245 250 255Tyr Gln Lys Val Leu Thr Leu Asn Leu Asp Gln Val Asp Phe
Gln His 260 265 270Ala Gly Asn Tyr Ser Cys Val Ala Ser Asn Val Gln
Gly Lys His Ser 275 280 285Thr Ser Met Phe Phe Arg Val Val Glu Ser
Ala Tyr Leu Asn Leu Ser 290 295 300Ser Glu Gln Asn Leu Ile Gln Glu
Val Thr Val Gly Glu Gly Leu Asn305 310 315 320Leu Lys Val Met Val
Glu Ala Tyr Pro Gly Leu Gln Gly Phe Asn Trp 325 330 335Thr Tyr Leu
Gly Pro Phe Ser Asp His Gln Pro Glu Pro Lys Leu Ala 340 345 350Asn
Ala Thr Thr Lys Asp Thr Tyr Arg His Thr Phe Thr Leu Ser Leu 355 360
365Pro Arg Leu Lys Pro Ser Glu Ala Gly Arg Tyr Ser Phe Leu Ala Arg
370 375 380Asn Pro Gly Gly Trp Arg Ala Leu Thr Phe Glu Leu Thr Leu
Arg Tyr385 390 395 400Pro Pro Glu Val Ser Val Ile Trp Thr Phe Ile
Asn Gly Ser Gly Thr 405 410 415Leu Leu Cys Ala Ala Ser Gly Tyr Pro
Gln Pro Asn Val Thr Trp Leu 420 425 430Gln Cys Ser Gly His Thr Asp
Arg Cys Asp Glu Ala Gln Val Leu Gln 435 440 445Val Trp Asp Asp Pro
Tyr Pro Glu Val Leu Ser Gln Glu Pro Phe His 450 455 460Lys Val Thr
Val Gln Ser Leu Leu Thr Val Glu Thr Leu Glu His Asn465 470 475
480Gln Thr Tyr Glu Cys Arg Ala His Asn Ser Val Gly Ser Gly Ser Trp
485 490 495Ala Phe Ile Pro Ile Ser Ala Gly Ala His Thr His Pro Pro
Asp Glu 500 505 510Phe Leu Phe Thr Pro Val Val Val Ala Cys Met Ser
Ile Met Ala Leu 515 520 525Leu Leu Leu Leu Leu Leu Leu Leu Leu Tyr
Lys Tyr Lys Gln Lys Pro 530 535 540Lys Tyr Gln Val Arg Trp Lys Ile
Ile Glu Ser Tyr Glu Gly Asn Ser545 550 555 560Tyr Thr Phe Ile Asp
Pro Thr Gln Leu Pro Tyr Asn Glu Lys Trp Glu 565 570 575Phe Pro Arg
Asn Asn Leu Gln Phe Gly Lys Thr Leu Gly Ala Gly Ala 580 585 590Phe
Gly Lys Val Val Glu Ala Thr Ala Phe Gly Leu Gly Lys Glu Asp 595 600
605Ala Val Leu Lys Val Ala Val Lys Met Leu Lys Ser Thr Ala His Ala
610 615 620Asp Glu Lys Glu Ala Leu Met Ser Glu Leu Lys Ile Met Ser
His Leu625 630 635 640Gly Gln His Glu Asn Ile Val Asn Leu Leu Gly
Ala Cys Thr His Gly
645 650 655Gly Pro Val Leu Val Ile Thr Glu Tyr Cys Cys Tyr Gly Asp
Leu Leu 660 665 670Asn Phe Leu Arg Arg Lys Ala Glu Ala Met Leu Gly
Pro Ser Leu Ser 675 680 685Pro Gly Gln Asp Pro Glu Gly Gly Val Asp
Tyr Lys Asn Ile His Leu 690 695 700Glu Lys Lys Tyr Val Arg Arg Asp
Ser Gly Phe Ser Ser Gln Gly Val705 710 715 720Asp Thr Tyr Val Glu
Met Arg Pro Val Ser Thr Ser Ser Asn Asp Ser 725 730 735Phe Ser Glu
Gln Asp Leu Asp Lys Glu Asp Gly Arg Pro Leu Glu Leu 740 745 750Arg
Asp Leu Leu His Phe Ser Ser Gln Val Ala Gln Gly Met Ala Phe 755 760
765Leu Ala Ser Lys Asn Cys Ile His Arg Asp Val Ala Ala Arg Asn Val
770 775 780Leu Leu Thr Asn Gly His Val Ala Lys Ile Gly Asp Phe Gly
Leu Ala785 790 795 800Arg Asp Ile Met Asn Asp Ser Asn Tyr Ile Val
Lys Gly Asn Ala Arg 805 810 815Leu Pro Val Lys Trp Met Ala Pro Glu
Ser Ile Phe Asp Cys Val Tyr 820 825 830Thr Val Gln Ser Asp Val Trp
Ser Tyr Gly Ile Leu Leu Trp Glu Ile 835 840 845Phe Ser Leu Gly Leu
Asn Pro Tyr Pro Gly Ile Leu Val Asn Ser Lys 850 855 860Phe Tyr Lys
Leu Val Lys Asp Gly Tyr Gln Met Ala Gln Pro Ala Phe865 870 875
880Ala Pro Lys Asn Ile Tyr Ser Ile Met Gln Ala Cys Trp Ala Leu Glu
885 890 895Pro Thr His Arg Pro Thr Phe Gln Gln Ile Cys Ser Phe Leu
Gln Glu 900 905 910Gln Ala Gln Glu Asp Arg Arg Glu Arg Asp Tyr Thr
Asn Leu Pro Ser 915 920 925Ser Ser Arg Ser Gly Gly Ser Gly Ser Ser
Ser Ser Glu Leu Glu Glu 930 935 940Glu Ser Ser Ser Glu His Leu Thr
Cys Cys Glu Gln Gly Asp Ile Ala945 950 955 960Gln Pro Leu Leu Gln
Pro Asn Asn Tyr Gln Phe Cys 965 97043985DNAHomo sapiens 4gaagggcaga
cagagtgtcc aaaagcgtga gagcacgaag tgaggagaag gtggagaaga 60gagaagagga
agaggaagag gaagagagga agcggaggga actgcggcca ggctaaaagg
120ggaagaagag gatcagccca aggaggagga agaggaaaac aagacaaaca
gccagtgcag 180aggagaggaa cgtgtgtcca gtgtcccgat ccctgcggag
ctagtagctg agagctctgt 240gccctgggca ccttgcagcc ctgcacctgc
ctgccacttc cccaccgagg ccatgggccc 300aggagttctg ctgctcctgc
tggtggccac agcttggcat ggtcagggaa tcccagtgat 360agagcccagt
gtccctgagc tggtcgtgaa gccaggagca acggtgacct tgcgatgtgt
420gggcaatggc agcgtggaat gggatggccc cccatcacct cactggaccc
tgtactctga 480tggctccagc agcatcctca gcaccaacaa cgctaccttc
caaaacacgg ggacctatcg 540ctgcactgag cctggagacc ccctgggagg
cagcgccgcc atccacctct atgtcaaaga 600ccctgcccgg ccctggaacg
tgctagcaca ggaggtggtc gtgttcgagg accaggacgc 660actactgccc
tgtctgctca cagacccggt gctggaagca ggcgtctcgc tggtgcgtgt
720gcgtggccgg cccctcatgc gccacaccaa ctactccttc tcgccctggc
atggcttcac 780catccacagg gccaagttca ttcagagcca ggactatcaa
tgcagtgccc tgatgggtgg 840caggaaggtg atgtccatca gcatccggct
gaaagtgcag aaagtcatcc cagggccccc 900agccttgaca ctggtgcctg
cagagctggt gcggattcga ggggaggctg cccagatcgt 960gtgctcagcc
agcagcgttg atgttaactt tgatgtcttc ctccaacaca acaacaccaa
1020gctcgcaatc cctcaacaat ctgactttca taataaccgt taccaaaaag
tcctgaccct 1080caacctcgat caagtagatt tccaacatgc cggcaactac
tcctgcgtgg ccagcaacgt 1140gcagggcaag cactccacct ccatgttctt
ccgggtggta gagagtgcct acttgaactt 1200gagctctgag cagaacctca
tccaggaggt gaccgtgggg gaggggctca acctcaaagt 1260catggtggag
gcctacccag gcctgcaagg ttttaactgg acctacctgg gacccttttc
1320tgaccaccag cctgagccca agcttgctaa tgctaccacc aaggacacat
acaggcacac 1380cttcaccctc tctctgcccc gcctgaagcc ctctgaggct
ggccgctact ccttcctggc 1440cagaaaccca ggaggctgga gagctctgac
gtttgagctc acccttcgat accccccaga 1500ggtaagcgtc atatggacat
tcatcaacgg ctctggcacc cttttgtgtg ctgcctctgg 1560gtacccccag
cccaacgtga catggctgca gtgcagtggc cacactgata ggtgtgatga
1620ggcccaagtg ctgcaggtct gggatgaccc ataccctgag gtcctgagcc
aggagccctt 1680ccacaaggtg acggtgcaga gcctgctgac tgttgagacc
ttagagcaca accaaaccta 1740cgagtgcagg gcccacaaca gcgtggggag
tggctcctgg gccttcatac ccatctctgc 1800aggagcccac acgcatcccc
cggatgagtt cctcttcaca ccagtggtgg tcgcctgcat 1860gtccatcatg
gccttgctgc tgctgctgct cctgctgcta ttgtacaagt ataagcagaa
1920gcccaagtac caggtccgct ggaagatcat cgagagctat gagggcaaca
gttatacttt 1980catcgacccc acgcagctgc cttacaacga gaagtgggag
ttcccccgga acaacctgca 2040gtttggtaag accctcggag ctggagcctt
tgggaaggtg gtggaggcca cggcctttgg 2100tctgggcaag gaggatgctg
tcctgaaggt ggctgtgaag atgctgaagt ccacggccca 2160tgctgatgag
aaggaggccc tcatgtccga gctgaagatc atgagccacc tgggccagca
2220cgagaacatc gtcaaccttc tgggagcctg tacccatgga ggccctgtac
tggtcatcac 2280ggagtactgt tgctatggcg acctgctcaa ctttctgcga
aggaaggctg aggccatgct 2340gggacccagc ctgagccccg gccaggaccc
cgagggaggc gtcgactata agaacatcca 2400cctcgagaag aaatatgtcc
gcagggacag tggcttctcc agccagggtg tggacaccta 2460tgtggagatg
aggcctgtct ccacttcttc aaatgactcc ttctctgagc aagacctgga
2520caaggaggat ggacggcccc tggagctccg ggacctgctt cacttctcca
gccaagtagc 2580ccagggcatg gccttcctcg cttccaagaa ttgcatccac
cgggacgtgg cagcgcgtaa 2640cgtgctgttg accaatggtc atgtggccaa
gattggggac ttcgggctgg ctagggacat 2700catgaatgac tccaactaca
ttgtcaaggg caatgcccgc ctgcctgtga agtggatggc 2760cccagagagc
atctttgact gtgtctacac ggttcagagc gacgtctggt cctatggcat
2820cctcctctgg gagatcttct cacttgggct gaatccctac cctggcatcc
tggtgaacag 2880caagttctat aaactggtga aggatggata ccaaatggcc
cagcctgcat ttgccccaaa 2940gaatatatac agcatcatgc aggcctgctg
ggccttggag cccacccaca gacccacctt 3000ccagcagatc tgctccttcc
ttcaggagca ggcccaagag gacaggagag agcgggacta 3060taccaatctg
ccgagcagca gcagaagcgg tggcagcggc agcagcagca gtgagctgga
3120ggaggagagc tctagtgagc acctgacctg ctgcgagcaa ggggatatcg
cccagccctt 3180gctgcagccc aacaactatc agttctgctg aggagttgac
gacagggagt accactctcc 3240cctcctccaa acttcaactc ctccatggat
ggggcgacac ggggagaaca tacaaactct 3300gccttcggtc atttcactca
acagctcggc ccagctctga aacttgggaa ggtgagggat 3360tcaggggagg
tcagaggatc ccacttcctg agcatgggcc atcactgcca gtcaggggct
3420gggggctgag ccctcacccc cccctcccct actgttctca tggtgttggc
ctcgtgtttg 3480ctatgccaac tagtagaacc ttctttccta atccccttat
cttcatggaa atggactgac 3540tttatgccta tgaagtcccc aggagctaca
ctgatactga gaaaaccagg ctctttgggg 3600ctagacagac tggcagagag
tgagatctcc ctctctgaga ggagcagcag atgctcacag 3660accacactca
gctcaggccc cttggagcag gatggctcct ctaagaatct cacaggacct
3720cttagtctct gccctatacg ccgccttcac tccacagcct cacccctccc
acccccatac 3780tggtactgct gtaatgagcc aagtggcagc taaaagttgg
gggtgttctg cccagtcccg 3840tcattctggg ctagaaggca ggggaccttg
gcatgtggct ggccacacca agcaggaagc 3900acaaactccc ccaagctgac
tcatcctaac taacagtcac gccgtgggat gtctctgtcc 3960acattaaact
aacagcatta atgca 3985541DNAArtificial SequenceDescription of
Artificial Sequence Synthetic Primer 5atgtacgaag ttcagtggaa
agttgttgaa gaaatcaacg g 41646DNAArtificial SequenceDescription of
Artificial Sequence Synthetic Primer 6ggtcgatgta aacgtagttg
ttaccgttga tttcttcaac aacttt 46742DNAArtificial SequenceDescription
of Artificial Sequence Synthetic Primer 7aacaactacg tttacatcga
cccgacccag ctgccgtacg ac 42843DNAArtificial SequenceDescription of
Artificial Sequence Synthetic Primer 8gttacgcggg aactcccatt
tgtggtcgta cggcagctgg gtc 43943DNAArtificial SequenceDescription of
Artificial Sequence Synthetic Primer 9aaatgggagt tcccgcgtaa
ccgtctgtct ttcggtaaaa ccc 431041DNAArtificial SequenceDescription
of Artificial Sequence Synthetic Primer 10accgaacgca cccgcaccca
gggttttacc gaaagacaga c 411143DNAArtificial SequenceDescription of
Artificial Sequence Synthetic Primer 11ggtgcgggtg cgttcggtaa
agttgttgaa gcgaccgcgt acg 431241DNAArtificial SequenceDescription
of Artificial Sequence Synthetic Primer 12gccgcgtcag atttgatcag
accgtacgcg gtcgcttcaa c 411343DNAArtificial SequenceDescription of
Artificial Sequence Synthetic Primer 13ctgatcaaat ctgacgcggc
gatgaccgtt gcggttaaaa tgc 431443DNAArtificial SequenceDescription
of Artificial Sequence Synthetic Primer 14gtcaggtgcg cagacggttt
cagcatttta accgcaacgg tca 431543DNAArtificial SequenceDescription
of Artificial Sequence Synthetic Primer 15aaaccgtctg cgcacctgac
cgaacgtgaa gcgctgatgt ctg 431644DNAArtificial SequenceDescription
of Artificial Sequence Synthetic Primer 16ccaggtaaga cagaactttc
agttcagaca tcagcgcttc acgt 441744DNAArtificial SequenceDescription
of Artificial Sequence Synthetic Primer 17ctgaaagttc tgtcttacct
gggtaaccac atgaacatcg ttaa 441841DNAArtificial SequenceDescription
of Artificial Sequence Synthetic Primer 18ggtgcacgca cccagcaggt
taacgatgtt catgtggtta c 411943DNAArtificial SequenceDescription of
Artificial Sequence Synthetic Primer 19ctgctgggtg cgtgcaccat
cggtggtccg accctggtta tca 432043DNAArtificial SequenceDescription
of Artificial Sequence Synthetic Primer 20gtcaccgtag cagcagtatt
cggtgataac cagggtcgga cca 432143DNAArtificial SequenceDescription
of Artificial Sequence Synthetic Primer 21gaatactgct gctacggtga
cctgctgaac ttcctgcgtc gta 432243DNAArtificial SequenceDescription
of Artificial Sequence Synthetic Primer 22agagcagatg aaagagtcac
gtttacgacg caggaagttc agc 432343DNAArtificial SequenceDescription
of Artificial Sequence Synthetic Primer 23cgtgactctt tcatctgctc
taaacaggaa gaccacgcgg aag 432443DNAArtificial SequenceDescription
of Artificial Sequence Synthetic Primer 24cagcaggttt ttgtacagcg
ccgcttccgc gtggtcttcc tgt 432544DNAArtificial SequenceDescription
of Artificial Sequence Synthetic Primer 25gcgctgtaca aaaacctgct
gcactctaaa gaatcttctt gctc 442645DNAArtificial SequenceDescription
of Artificial Sequence Synthetic Primer 26ccatgtattc gttggtagag
tcagagcaag aagattcttt agagt 452744DNAArtificial SequenceDescription
of Artificial Sequence Synthetic Primer 27gactctacca acgaatacat
ggacatgaaa ccgggtgttt ctta 442843DNAArtificial SequenceDescription
of Artificial Sequence Synthetic Primer 28tccgctttgg tcggaacaac
gtaagaaaca cccggtttca tgt 432943DNAArtificial SequenceDescription
of Artificial Sequence Synthetic Primer 29gttgttccga ccaaagcgga
caaacgtcgt tctgttcgta tcg 433046DNAArtificial SequenceDescription
of Artificial Sequence Synthetic Primer 30taacgtcacg ttcgatgtaa
gaaccgatac gaacagaacg acgttt 463143DNAArtificial
SequenceDescription of Artificial Sequence Synthetic Primer
31tcttacatcg aacgtgacgt taccccggcg atcatggaag acg
433240DNAArtificial SequenceDescription of Artificial Sequence
Synthetic Primer 32ccaggtccag cgccagttcg tcgtcttcca tgatcgccgg
403343DNAArtificial SequenceDescription of Artificial Sequence
Synthetic Primer 33gaactggcgc tggacctgga agacctgctg tctttctctt acc
433444DNAArtificial SequenceDescription of Artificial Sequence
Synthetic Primer 34gaacgccata cctttcgcaa cctggtaaga gaaagacagc aggt
443544DNAArtificial SequenceDescription of Artificial Sequence
Synthetic Primer 35gttgcgaaag gtatggcgtt cctggcgtct aaaaactgca tcca
443639DNAArtificial SequenceDescription of Artificial Sequence
Synthetic Primer 36cgcgccgcca ggtcacggtg gatgcagttt ttagacgcc
393741DNAArtificial SequenceDescription of Artificial Sequence
Synthetic Primer 37cgtgacctgg cggcgcgtaa catcctgctg acccacggtc g
413843DNAArtificial SequenceDescription of Artificial Sequence
Synthetic Primer 38accgaagtcg cagattttgg tgatacgacc gtgggtcagc agg
433943DNAArtificial SequenceDescription of Artificial Sequence
Synthetic Primer 39accaaaatct gcgacttcgg tctggcgcgt gacatcaaaa acg
434046DNAArtificial SequenceDescription of Artificial Sequence
Synthetic Primer 40gttaccttta acaacgtagt tagagtcgtt tttgatgtca
cgcgcc 464144DNAArtificial SequenceDescription of Artificial
Sequence Synthetic Primer 41tctaactacg ttgttaaagg taacgcgcgt
ctgccggtta aatg 444242DNAArtificial SequenceDescription of
Artificial Sequence Synthetic Primer 42gaagatagat tccggcgcca
tccatttaac cggcagacgc gc 424344DNAArtificial SequenceDescription of
Artificial Sequence Synthetic Primer 43atggcgccgg aatctatctt
caactgcgtt tacaccttcg aatc 444443DNAArtificial SequenceDescription
of Artificial Sequence Synthetic Primer 44gataccgtaa gaccaaacgt
cagattcgaa ggtgtaaacg cag 434543DNAArtificial SequenceDescription
of Artificial Sequence Synthetic Primer 45gacgtttggt cttacggtat
cttcctgtgg gaactgttct ctc 434641DNAArtificial SequenceDescription
of Artificial Sequence Synthetic Primer 46cctgtgggaa ctgttctctc
tgggttcttc tccgtacccg g 414745DNAArtificial SequenceDescription of
Artificial Sequence Synthetic Primer 47ggttcttctc cgtacccggg
tatgccggtt gactctaaat tctat 454845DNAArtificial SequenceDescription
of Artificial Sequence Synthetic Primer 48cggaaacctt ctttgatcat
tttgtagaat ttagagtcaa ccggc 454943DNAArtificial SequenceDescription
of Artificial Sequence Synthetic Primer 49aaaatgatca aagaaggttt
ccgtatgctg tctccggaac acg 435042DNAArtificial SequenceDescription
of Artificial Sequence Synthetic Primer 50atgtcgtaca tttccgccgg
cgcgtgttcc ggagacagca ta 425142DNAArtificial SequenceDescription of
Artificial Sequence Synthetic Primer 51ccggcggaaa tgtacgacat
catgaaaacc tgctgggacg cg 425242DNAArtificial SequenceDescription of
Artificial Sequence Synthetic Primer 52aaggtcggac gtttcagcgg
gtccgcgtcc cagcaggttt tc 425343DNAArtificial SequenceDescription of
Artificial Sequence Synthetic Primer 53ccgctgaaac gtccgacctt
caaacagatc gttcagctga tcg 435446DNAArtificial SequenceDescription
of Artificial Sequence Synthetic Primer 54ttggtagatt cagagatctg
tttttcgatc agctgaacga tctgtt 465544DNAArtificial
SequenceDescription of Artificial Sequence Synthetic Primer
55aaacagatct ctgaatctac caaccacatc tactctaacc tggc
445642DNAArtificial SequenceDescription of Artificial Sequence
Synthetic Primer 56tgacggttcg gagagcagtt cgccaggtta gagtagatgt gg
425743DNAArtificial SequenceDescription of Artificial Sequence
Synthetic Primer 57aactgctctc cgaaccgtca gaaaccggtt gttgaccact ctg
435845DNAArtificial SequenceDescription of Artificial Sequence
Synthetic Primer 58gtagaaccaa cagagttgat acgaacagag tggtcaacaa
ccggt 455942DNAArtificial SequenceDescription of Artificial
Sequence Synthetic Primer 59cgtatcaact ctgttggttc taccgcgtct
tcttctcagc cg 426040DNAArtificial SequenceDescription of Artificial
Sequence Synthetic Primer 60aacgtcgtcg tgaaccagca gcggctgaga
agaagacgcg 406132DNAArtificial SequenceDescription of Artificial
Sequence Synthetic Primer 61gttgtttcat atgtacgaag ttcagtggaa ag
326236DNAArtificial SequenceDescription of Artificial Sequence
Synthetic Primer 62gttgtttgtc gactaaacgt cgtcgtgaac cagcag
366334DNAArtificial SequenceDescription of Artificial Sequence
Synthetic Primer 63gttcttgtcg actatttctg acggttcgga gagc
34641325DNAArtificial SequenceCDS(88)..(1302)Description of
Artificial Sequence Synthetic DNA Construct 64taatacgact cactataggg
gaattgtgag cggataacaa ttcccctcta gaaataattt 60tgtttaactt taagaaggag
atatacc atg ggt cac cac cat cac cat cat atg 114 Met Gly His His His
His His His Met 1 5tac gaa gtt cag tgg aaa gtt gtt gaa gaa atc aac
ggt aac aac tac 162Tyr Glu Val Gln Trp Lys Val Val Glu Glu Ile Asn
Gly Asn Asn Tyr10 15 20 25gtt tac atc gac ccg acc cag ctg ccg tac
gac cac aaa tgg gag ttc 210Val Tyr Ile Asp Pro Thr Gln Leu Pro Tyr
Asp His Lys Trp Glu Phe 30 35 40ccg cgt aac cgt ctg tct ttc ggt aaa
acc ctg ggt gcg ggt gcg ttc 258Pro Arg Asn Arg Leu Ser Phe Gly Lys
Thr Leu Gly Ala Gly Ala Phe 45 50 55ggt aaa gtt gtt gaa gcg acc gcg
tac ggt ctg atc aaa tct gac gcg 306Gly Lys Val Val Glu Ala Thr Ala
Tyr Gly Leu Ile Lys Ser Asp Ala 60 65 70gcg atg acc gtt gcg gtt aaa
atg ctg aaa ccg tct gcg cac ctg acc 354Ala Met Thr Val Ala Val Lys
Met Leu Lys Pro Ser Ala His Leu Thr 75 80 85gaa cgt gaa
gcg ctg atg tct gaa ctg aaa gtt ctg tct tac ctg ggt 402Glu Arg Glu
Ala Leu Met Ser Glu Leu Lys Val Leu Ser Tyr Leu Gly90 95 100 105aac
cac atg aac atc gtt aac ctg ctg ggt gcg tgc acc atc ggt ggt 450Asn
His Met Asn Ile Val Asn Leu Leu Gly Ala Cys Thr Ile Gly Gly 110 115
120ccg acc ctg gtt atc acc gaa tac tgc tgc tac ggt gac ctg ctg aac
498Pro Thr Leu Val Ile Thr Glu Tyr Cys Cys Tyr Gly Asp Leu Leu Asn
125 130 135ttc ctg cgt cgt aaa cgt gac tct ttc atc tgc tct aaa cag
gaa gac 546Phe Leu Arg Arg Lys Arg Asp Ser Phe Ile Cys Ser Lys Gln
Glu Asp 140 145 150cac gcg gaa gcg gcg ctg tac aaa aac ctg ctg cac
tct aaa gaa tct 594His Ala Glu Ala Ala Leu Tyr Lys Asn Leu Leu His
Ser Lys Glu Ser 155 160 165tct tgc tct gac tct acc aac gaa tac atg
gac atg aaa ccg ggt gtt 642Ser Cys Ser Asp Ser Thr Asn Glu Tyr Met
Asp Met Lys Pro Gly Val170 175 180 185tct tac gtt gtt ccg acc aaa
gcg gac aaa cgt cgt tct gtt cgt atc 690Ser Tyr Val Val Pro Thr Lys
Ala Asp Lys Arg Arg Ser Val Arg Ile 190 195 200ggt tct tac atc gaa
cgt gac gtt acc ccg gcg atc atg gaa gac gac 738Gly Ser Tyr Ile Glu
Arg Asp Val Thr Pro Ala Ile Met Glu Asp Asp 205 210 215gaa ctg gcg
ctg gac ctg gaa gac ctg ctg tct ttc tct tac cag gtt 786Glu Leu Ala
Leu Asp Leu Glu Asp Leu Leu Ser Phe Ser Tyr Gln Val 220 225 230gcg
aaa ggt atg gcg ttc ctg gcg tct aaa aac tgc atc cac cgt gac 834Ala
Lys Gly Met Ala Phe Leu Ala Ser Lys Asn Cys Ile His Arg Asp 235 240
245ctg gcg gcg cgt aac atc ctg ctg acc cac ggt cgt atc acc aaa atc
882Leu Ala Ala Arg Asn Ile Leu Leu Thr His Gly Arg Ile Thr Lys
Ile250 255 260 265tgc gac ttc ggt ctg gcg cgt gac atc aaa aac gac
tct aac tac gtt 930Cys Asp Phe Gly Leu Ala Arg Asp Ile Lys Asn Asp
Ser Asn Tyr Val 270 275 280gtt aaa ggt aac gcg cgt ctg ccg gtt aaa
tgg atg gcg ccg gaa tct 978Val Lys Gly Asn Ala Arg Leu Pro Val Lys
Trp Met Ala Pro Glu Ser 285 290 295atc ttc aac tgc gtt tac acc ttc
gaa tct gac gtt tgg tct tac ggt 1026Ile Phe Asn Cys Val Tyr Thr Phe
Glu Ser Asp Val Trp Ser Tyr Gly 300 305 310atc ttc ctg tgg gaa ctg
ttc tct ctg ggt tct tct ccg tac ccg ggt 1074Ile Phe Leu Trp Glu Leu
Phe Ser Leu Gly Ser Ser Pro Tyr Pro Gly 315 320 325atg ccg gtt gac
tct aaa ttc tac aaa atg atc aaa gaa ggt ttc cgt 1122Met Pro Val Asp
Ser Lys Phe Tyr Lys Met Ile Lys Glu Gly Phe Arg330 335 340 345atg
ctg tct ccg gaa cac gcg ccg gcg gaa atg tac gac atc atg aaa 1170Met
Leu Ser Pro Glu His Ala Pro Ala Glu Met Tyr Asp Ile Met Lys 350 355
360acc tgc tgg gac gcg gac ccg ctg aaa cgt ccg acc ttc aaa cag atc
1218Thr Cys Trp Asp Ala Asp Pro Leu Lys Arg Pro Thr Phe Lys Gln Ile
365 370 375gtt cag ctg atc gaa aaa cag atc tct gaa tct acc aac cac
atc tac 1266Val Gln Leu Ile Glu Lys Gln Ile Ser Glu Ser Thr Asn His
Ile Tyr 380 385 390tct aac ctg gcg aac tgc tct ccg aac cgt cag aaa
tagtcgactg 1312Ser Asn Leu Ala Asn Cys Ser Pro Asn Arg Gln Lys 395
400 405aaaaaggaag agt 132565405PRTArtificial SequenceDescription of
Artificial Sequence Synthetic Protein Construct 65Met Gly His His
His His His His Met Tyr Glu Val Gln Trp Lys Val1 5 10 15Val Glu Glu
Ile Asn Gly Asn Asn Tyr Val Tyr Ile Asp Pro Thr Gln 20 25 30Leu Pro
Tyr Asp His Lys Trp Glu Phe Pro Arg Asn Arg Leu Ser Phe 35 40 45Gly
Lys Thr Leu Gly Ala Gly Ala Phe Gly Lys Val Val Glu Ala Thr 50 55
60Ala Tyr Gly Leu Ile Lys Ser Asp Ala Ala Met Thr Val Ala Val Lys65
70 75 80Met Leu Lys Pro Ser Ala His Leu Thr Glu Arg Glu Ala Leu Met
Ser 85 90 95Glu Leu Lys Val Leu Ser Tyr Leu Gly Asn His Met Asn Ile
Val Asn 100 105 110Leu Leu Gly Ala Cys Thr Ile Gly Gly Pro Thr Leu
Val Ile Thr Glu 115 120 125Tyr Cys Cys Tyr Gly Asp Leu Leu Asn Phe
Leu Arg Arg Lys Arg Asp 130 135 140Ser Phe Ile Cys Ser Lys Gln Glu
Asp His Ala Glu Ala Ala Leu Tyr145 150 155 160Lys Asn Leu Leu His
Ser Lys Glu Ser Ser Cys Ser Asp Ser Thr Asn 165 170 175Glu Tyr Met
Asp Met Lys Pro Gly Val Ser Tyr Val Val Pro Thr Lys 180 185 190Ala
Asp Lys Arg Arg Ser Val Arg Ile Gly Ser Tyr Ile Glu Arg Asp 195 200
205Val Thr Pro Ala Ile Met Glu Asp Asp Glu Leu Ala Leu Asp Leu Glu
210 215 220Asp Leu Leu Ser Phe Ser Tyr Gln Val Ala Lys Gly Met Ala
Phe Leu225 230 235 240Ala Ser Lys Asn Cys Ile His Arg Asp Leu Ala
Ala Arg Asn Ile Leu 245 250 255Leu Thr His Gly Arg Ile Thr Lys Ile
Cys Asp Phe Gly Leu Ala Arg 260 265 270Asp Ile Lys Asn Asp Ser Asn
Tyr Val Val Lys Gly Asn Ala Arg Leu 275 280 285Pro Val Lys Trp Met
Ala Pro Glu Ser Ile Phe Asn Cys Val Tyr Thr 290 295 300Phe Glu Ser
Asp Val Trp Ser Tyr Gly Ile Phe Leu Trp Glu Leu Phe305 310 315
320Ser Leu Gly Ser Ser Pro Tyr Pro Gly Met Pro Val Asp Ser Lys Phe
325 330 335Tyr Lys Met Ile Lys Glu Gly Phe Arg Met Leu Ser Pro Glu
His Ala 340 345 350Pro Ala Glu Met Tyr Asp Ile Met Lys Thr Cys Trp
Asp Ala Asp Pro 355 360 365Leu Lys Arg Pro Thr Phe Lys Gln Ile Val
Gln Leu Ile Glu Lys Gln 370 375 380Ile Ser Glu Ser Thr Asn His Ile
Tyr Ser Asn Leu Ala Asn Cys Ser385 390 395 400Pro Asn Arg Gln Lys
4056614PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 66Lys Lys Lys Ser Pro Gly Glu Tyr Val Asn Ile Glu
Phe Gly1 5 10
* * * * *