U.S. patent application number 12/961444 was filed with the patent office on 2011-07-07 for response element regions.
This patent application is currently assigned to Amgen Inc.. Invention is credited to Jill A. Crouse, Sharon X. Mu, Christiaan J.M. Saris, Shamin Summer.
Application Number | 20110165580 12/961444 |
Document ID | / |
Family ID | 43597090 |
Filed Date | 2011-07-07 |
United States Patent
Application |
20110165580 |
Kind Code |
A1 |
Saris; Christiaan J.M. ; et
al. |
July 7, 2011 |
Response Element Regions
Abstract
Response element regions, DNA constructs comprising response
element regions, host cells comprising response element regions,
and methods of using response element regions are provided.
Inventors: |
Saris; Christiaan J.M.;
(Newbury Park, CA) ; Summer; Shamin; (Oak Park,
CA) ; Mu; Sharon X.; (Thousand Oaks, CA) ;
Crouse; Jill A.; (Newbury Park, CA) |
Assignee: |
Amgen Inc.
|
Family ID: |
43597090 |
Appl. No.: |
12/961444 |
Filed: |
December 6, 2010 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11112973 |
Apr 22, 2005 |
7892733 |
|
|
12961444 |
|
|
|
|
60564724 |
Apr 22, 2004 |
|
|
|
60565135 |
Apr 23, 2004 |
|
|
|
Current U.S.
Class: |
435/6.13 ;
435/320.1; 435/325; 435/69.1; 536/23.1 |
Current CPC
Class: |
G01N 33/6863 20130101;
G01N 33/5041 20130101; G01N 33/5023 20130101 |
Class at
Publication: |
435/6.13 ;
536/23.1; 435/320.1; 435/325; 435/69.1 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68; C07H 21/04 20060101 C07H021/04; C12N 15/63 20060101
C12N015/63; C12N 5/10 20060101 C12N005/10; C12P 21/02 20060101
C12P021/02 |
Claims
1. An isolated nucleic acid comprising a response element region
comprising: (i) the sequence GTCATTTCCAGGAAATCACC or (ii) a
sequence complementary to the sequence in (i).
2. An isolated nucleic acid comprising a response element region
comprising: (a) (i) the sequence
GTCATTTCCAGGAAATCACCGTCATTTCCAGGAAA TCACCGTCATTTCCAGGAAATCACC or
(ii) a sequence complementary to the sequence in (i); (b) (i) the
sequence GTCATTTCCAGGAAATCACCGTCATTTCCAGGAAA
TCACCGTCATTTCCAGGAAATCACC-Y-GTCATTTCCAGGAAATCACCG
TCATTTCCAGGAAATCACCGTCATTTCCAGGAAATCACC or (ii) a sequence
complementary to the sequence in (i); (c) (i) the sequence
GTCATTTCCAGGAAATCACCGTCATTTCCAGGAAA
TCACCGTCATTTCCAGGAAATCACC-Y-GTCATTTCCAGGAAATCACCG
TCATTTCCAGGAAATCACCGTCATTTCCAGGAAATCACC-X-GTCATTT
CCAGGAAATCACCGTCATTTCCAGGAAATCACCGTCATTTCCAGGAAATC ACC or (ii) a
sequence complementary to the sequence in (i); or (d) (i) the
sequence GTCATTTCCAGGAAATCACCGTCATTTCCAGGAAA
TCACCGTCATTTCCAGGAAATCACC-Y-GTCATTTCCAGGAAATCACCG
TCATTTCCAGGAAATCACCGTCATTTCCAGGAAATCACC-X-GTCATTT
CCAGGAAATCACCGTCATTTCCAGGAAATCACCGTCATTTCCAGGAAATC
ACC-Z-GTCATTTCCAGGAAATCACCGTCATTTCCAGGAAATCACCG TCATTTCCAGGAAATCACC
or (ii) a sequence complementary to the sequence in (i); wherein Y,
X, and Z are each independently selected from a nucleic acid
sequence of 0 to 23 nucleotides.
3. The isolated nucleic acid of claim 2, comprising the sequence:
TABLE-US-00016 GTCATTTCCAGGAAATCACCGTCATTTCCAGGAAATCACCGT
CATTTCCAGGAAATCACC-Y-GTCATTTCCAGGAAATCACCGTCATTT
CCAGGAAATCACCGTCATTTCCAGGAAATCACC-X-GTCATTTCCAGG
AAATCACCGTCATTTCCAGGAAATCACCGTCATTTCCAGGAAATCACC-
Z-GTCATTTCCAGGAAATCACCGTCATTTCCAGGAAATCACCGTCATTT CCAGGAAATCACC
wherein Y, X, and Z are each a nucleic acid sequence of 0
nucleotides.
4. The isolated nucleic acid of claim 2, comprising the sequence:
TABLE-US-00017 GTCATTTCCAGGAAATCACCGTCATTTCCAGGAAATCACCGT
CATTTCCAGGAAATCACC-Y-GTCATTTCCAGGAAATCACCGTCATTT
CCAGGAAATCACCGTCATTTCCAGGAAATCACC-X-GTCATTTCCAGG
AAATCACCGTCATTTCCAGGAAATCACCGTCATTTCCAGGAAATCACC-
Z-GTCATTTCCAGGAAATCACCGTCATTTCCAGGAAATCACCGTCATTT CCAGGAAATCACC
wherein Y, X, and Z are each a nucleic acid sequence of 8
nucleotides.
5. The isolated nucleic acid of claim 4, wherein Y, X, and Z are
each the nucleic acid sequence GCCGTACC.
6. The isolated nucleic acid of claim 2, comprising the sequence:
TABLE-US-00018 GTCATTTCCAGGAAATCACCGTCATTTCCAGGAAATCACCGT
CATTTCCAGGAAATCACC-Y-GTCATTTCCAGGAAATCACCGTCATTT
CCAGGAAATCACCGTCATTTCCAGGAAATCACC-X-GTCATTTCCAGG
AAATCACCGTCATTTCCAGGAAATCACCGTCATTTCCAGGAAATCACC-
Z-GTCATTTCCAGGAAATCACCGTCATTTCCAGGAAATCACCGTCATTT CCAGGAAATCACC
wherein Y is a nucleic acid sequence of 8 nucleotides, X is a
nucleic acid sequence of 10 nucleotides, and Z is a nucleic acid
sequence of 16 nucleotides.
7. The isolated nucleic acid of claim 6, wherein Y is the nucleic
acid sequence GCCGTACC, X is the nucleic acid sequence TACCGGTCTG,
and Z is the nucleic acid sequence ACCGGCCTAGTGCGTC.
8. The isolated nucleic acid of claim 2, comprising the sequence:
TABLE-US-00019 GTCATTTCCAGGAAATCACCGTCATTTCCAGGAAATCACCGT
CATTTCCAGGAAATCACC-Y-GTCATTTCCAGGAAATCACCGTCATTT
CCAGGAAATCACCGTCATTTCCAGGAAATCACC-X-GTCATTTCCAGG
AAATCACCGTCATTTCCAGGAAATCACCGTCATTTCCAGGAAATCACC
wherein Y and X are each a nucleic acid sequence of 0
nucleotides.
9. The isolated nucleic acid of claim 2, comprising the sequence:
TABLE-US-00020 GTCATTTCCAGGAAATCACCGTCATTTCCAGGAAATCACCGT
CATTTCCAGGAAATCACC-Y-GTCATTTCCAGGAAATCACCGTCATTT
CCAGGAAATCACCGTCATTTCCAGGAAATCACC-X-GTCATTTCCAGG
AAATCACCGTCATTTCCAGGAAATCACCGTCATTTCCAGGAAATCACC
wherein Y and X are each a nucleic acid sequence of 8
nucleotides.
10. The isolated nucleic acid of claim 9, wherein Y and X are each
the nucleic acid sequence GCCGTACC.
11. The isolated nucleic acid of claim 2, comprising the sequence:
TABLE-US-00021 GTCATTTCCAGGAAATCACCGTCATTTCCAGGAAATCACCGT
CATTTCCAGGAAATCACC-Y-GTCATTTCCAGGAAATCACCGTCATTT
CCAGGAAATCACCGTCATTTCCAGGAAATCACC-X-GTCATTTCCAGG
AAATCACCGTCATTTCCAGGAAATCACCGTCATTTCCAGGAAATCACC
wherein Y is a nucleic acid sequence of 8 nucleotides and X is a
nucleic acid sequence of 10 nucleotides.
12. The isolated nucleic acid of claim 11, wherein Y is the nucleic
acid sequence GCCGTACC and X is the nucleic acid sequence
TACCGGTCTG.
13. A vector comprising a promoter and nucleic acid comprising a
response element region comprising: (i) the sequence
GTCATTTCCAGGAAATCACC or (ii) a sequence complementary to the
sequence in (i).
14. A vector comprising a promoter and nucleic acid comprising a
response element region comprising: (a) (i) the sequence
GTCATTTCCAGGAAATCACCGTCATTTCCAGGAAA TCACCGTCATTTCCAGGAAATCACC or
(ii) a sequence complementary to the sequence in (i); (b) (i) the
sequence GTCATTTCCAGGAAATCACCGTCATTTCCAGGAAA
TCACCGTCATTTCCAGGAAATCACC-Y-GTCATTTCCAGGAAATCACCG
TCATTTCCAGGAAATCACCGTCATTTCCAGGAAATCACC or (ii) a sequence
complementary to the sequence in (i); (c) (i) the sequence
GTCATTTCCAGGAAATCACCGTCATTTCCAGGAAA
TCACCGTCATTTCCAGGAAATCACC-Y-GTCATTTCCAGGAAATCACCG
TCATTTCCAGGAAATCACCGTCATTTCCAGGAAATCACC-X-GTCATTT
CCAGGAAATCACCGTCATTTCCAGGAAATCACCGTCATTTCCAGGAAATC ACC or (ii) a
sequence complementary to the sequence in (i); or (d) (i) the
sequence GTCATTTCCAGGAAATCACCGTCATTTCCAGGAAA
TCACCGTCATTTCCAGGAAATCACC-Y-GTCATTTCCAGGAAATCACCG
TCATTTCCAGGAAATCACCGTCATTTCCAGGAAATCACC-X-GTCATTT
CCAGGAAATCACCGTCATTTCCAGGAAATCACCGTCATTTCCAGGAAATC
ACC-Z-GTCATTTCCAGGAAATCACCGTCATTTCCAGGAAATCACCG TCATTTCCAGGAAATCACC
or (ii) a sequence complementary to the sequence in (i); wherein Y,
X, and Z are each independently selected from a nucleic acid
sequence of 0 to 23 nucleotides.
15. The vector of claim 14, further comprising a reporter nucleic
acid, wherein the response element region is operably linked to the
promoter and the promoter is operably linked to the reporter
nucleic acid.
16. The vector of claim 15, wherein the promoter is a TK promoter
and the reporter nucleic acid is a nucleic acid that encodes
luciferase.
17. The vector of claim 15, wherein the promoter is a SV40 promoter
and the reporter nucleic acid is a nucleic acid that encodes
luciferase.
18. A host cell comprising a vector of any one of claims 13 to
17.
19. The host cell of claim 18, wherein the host cell is a signaling
molecule-responsive host cell.
20. The host cell of claim 18, wherein host cell is responsive to
at least one signaling molecule selected from G-CSF, EPO, and
IL-3.
21. The host cell of claim 20, wherein host cell is responsive to
at least one signaling molecule selected from recombinant methionyl
human granulocyte colony-stimulting factor, epoetin alfa, and
darbepoetin alfa.
22. A method for determining the activity of a test composition
comprising a signaling molecule, comprising a) contacting the test
composition with a signaling molecule-responsive host cell
comprising the vector of claim 15 under conditions in which the
reporter nucleic acid expresses a reporter protein in response to
the signaling molecule; and b) detecting the reporter protein to
determine the activity of the test composition.
23. The method of claim 22, further comprising comparing the level
of detected reporter protein expression in (b) with the level of
reporter protein expressed by a signaling molecule-responsive host
cell comprising the vector of claim 15 in the absence of the
signaling molecule.
24. The method of claim 22, further comprising comparing the level
of detected reporter protein expression in (b) with the level of
reporter protein expressed by a signaling molecule-responsive host
cell comprising the vector of claim 15 in the presence of a
standard composition comprising the signaling molecule.
25. The method of claim 24, further comprising calculating the
relative potency of the test composition, wherein the relative
potency is calculated by dividing the signaling molecule
concentration of the standard composition that gives a level of
reporter protein expression of U by the signaling molecule
concentration of the test composition that gives a level of
reporter protein expression of U.
26. The method of any of claims 22 to 25, wherein the promoter is a
TK promoter and the reporter nucleic acid encodes luciferase.
27. The method of any of claims 22 to 25, wherein the promoter is a
SV40 promoter and the reporter nucleic acid encodes luciferase.
28. The method of any of claims 22 to 25, wherein host cell is
responsive to at least one signaling molecule selected from
G-CSF-like molecule, erythropoietic product, and IL-3.
29. The method of claim 28, wherein host cell is responsive to at
least one signaling molecule selected from recombinant methionyl
human granulocyte colony-stimulting factor, epoetin alfa, and
darbepoetin alfa.
30. A method for determining whether a test compound has activity
of a given signaling molecule, comprising a) contacting the test
compound with a signaling molecule-responsive host cell comprising
the vector of claim 15 under conditions in which the reporter
nucleic acid expresses a reporter protein in response to compounds
that have the activity of the given signaling molecule; b)
detecting the reporter protein; c) comparing the level of detected
reporter protein expression in (b) with the level of detected
reporter protein expressed by a signaling molecule-reponsive host
cell comprising the vector of claim 15 in the absence of the test
compound to determine whether the test compound has the activity of
the given signaling molecule.
31. The method of claim 30, wherein the promoter is a TK promoter
and the reporter nucleic acid encodes luciferase.
32. The method of claim 30, wherein the promoter is a SV40 promoter
and the reporter nucleic acid encodes luciferase.
33. The method of claim 30, wherein the given signaling molecule is
selected from G-CSF-like molecule, erythropoietic product, and
IL-3.
34. The method of claim 33, wherein the given signaling molecule is
selected from recombinant methionyl human granulocyte
colony-stimulting factor, epoetin alfa, and darbepoetin alfa.
35. A method for determining whether a test compound has activity
of a given signaling molecule, comprising a) contacting the test
compound with a signaling molecule-responsive host cell comprising
the vector of claim 15 under conditions in which the reporter
nucleic acid expresses a reporter protein in response to compounds
that have the activity of the given signaling molecule; b)
detecting the reporter protein; c) comparing the level of detected
reporter protein expression in (b) with the level of detected
reporter protein expressed by a signaling molecule-responsive host
cell comprising the vector of claim 15 in the presence of the given
signaling molecule, but in the absence of the test compound, to
determine whether the test compound has the activity of the given
signaling molecule.
36. The method of claim 35, wherein the promoter is a TK promoter
and the reporter nucleic acid encodes luciferase.
37. The method of claim 35, wherein the promoter is a SV40 promoter
and the reporter nucleic acid encodes luciferase.
38. The method of claim 35, wherein the given signaling molecule is
selected from G-CSF-like molecule, erythropoietic product, and
IL-3.
39. The method of claim 38, wherein the given signaling molecule is
selected from recombinant methionyl human granulocyte
colony-stimulting factor, epoetin alfa, and darbepoetin alfa.
40. A method for determining whether a test compound impacts the
activity of a signaling molecule, comprising a) contacting the test
compound with a signaling molecule-responsive host cell comprising
the vector of claim 15 in the presence of the signaling molecule
under conditions in which the reporter nucleic acid expresses a
reporter protein in response to the signaling molecule; b)
detecting the reporter protein; c) comparing the level of detected
reporter protein expression in (b) with the level of detected
reporter protein expressed by a signaling molecule-reponsive host
cell comprising the vector of claim 15 in the presence of the
signaling molecule, but in the absence of the test compound, to
determine whether the test compound impacts the activity of the
signaling molecule.
41. The method of claim 40, wherein the promoter is a TK promoter
and the reporter nucleic acid encodes luciferase.
42. The method of claim 40, wherein the promoter is a SV40 promoter
and the reporter nucleic acid encodes luciferase.
43. The method of claim 40, wherein host cell is responsive to at
least one signaling molecule selected from G-CSF, EPO, and
IL-3.
44. The method of claim 43, wherein host cell is responsive to at
least one signaling molecule selected from G-CSF, epoetin alfa, and
darbepoetin alfa.
45. A method of producing a polypeptide from an ex vivo mammalian
system, comprising producing the polypeptide, testing the
polypeptide with the host cell of claim 18, and determining the
amount of protein produced and/or activity of the protein produced
by the ex vivo system.
46. A response element region comprising more than one response
element sequences comprising the sequence GTCATTTCCAGGAAATCACC
wherein the center region of at least two response element
sequences are spatially oriented to be in the same location (on the
y and z axis) plus or minus 36 degrees, relative to the center axis
of the double-helical DNA (x-axis), wherein the center region is
the tenth and eleventh nucleotides AG of the sequence
GTCATTTCCAGGAAATCACC.
47. A response element region comprising more than one response
element sequence core regions comprising the sequence TTCCAGGAA
wherein the center region of at least two response element sequence
core regions are spatially oriented to be in the same location (on
the y and z axis) plus or minus 36 degrees, relative to the center
axis of the double-helical DNA (x-axis), wherein the center region
is the fifth and sixth nucleotides AG of the sequence
TTCCAGGAA.
48. A response element region comprising at least two series of
more than one response element sequences comprising the sequence
GTCATTTCCAGGAAATCACC; wherein each series of more than response
element sequences are linked together by a sequence of
approximately eight nucleotides, wherein, within a first series of
the response element sequences, each center region of the response
element sequences are spatially oriented to be in approximately the
same location (on the y and z axis) plus or minus 36 degrees,
relative to the center axis of the double-helical DNA (x-axis),
wherein the center region is the tenth and eleventh nucleotides AG
of the sequence GTCATTTCCAGGAAATCACC; wherein, within a second
series of the response element sequences, each center region of the
response element sequences are spatially oriented to be in
approximately the same location (on the y and z axis) plus or minus
36 degrees, relative to the center axis of the double-helical DNA
(x-axis), wherein the center region is the tenth and eleventh
nucleotides AG of the sequence GTCATTTCCAGGAAATCACC; and wherein
the center region of the response element sequences of the second
series of the response element sequences are spatially oriented to
be approximately 72 to 86 degrees from the center region of the
first series of the response element sequences as determined from
the y and z axis relative to the center axis of the double-helical
DNA as the x axis.
49. A response element region comprising at least two series of
more than one response element sequences comprising the sequence
GTCATTTCCAGGAAATCACC; wherein each series of more than one response
element sequences are linked together by a sequence of
approximately eight nucleotides, wherein, within a first series of
the response element sequences, each center region of the response
element sequences are spatially oriented to be in approximately the
same location (on the y and z axis) plus or minus 36 degrees,
relative to the center axis of the double-helical DNA (x-axis),
wherein the center region is the tenth and eleventh nucleotides AG
of the sequence GTCATTTCCAGGAAATCACC; wherein, within a second
series of the response element sequences, each center region of the
response element sequences are spatially oriented to be in
approximately the same location (on the y and z axis) plus or minus
36 degrees, relative to the center axis of the double-helical DNA
(x-axis), wherein the center region is the tenth and eleventh
nucleotides AG of the sequence GTCATTTCCAGGAAATCACC; and wherein
the center region of the response element sequences of the second
series of the response element sequences are spatially oriented to
be approximately 144 to 180 degrees from the center region of the
first series of the response element sequences as determined from
the y and z axis relative to the center axis of the double-helical
DNA as the x axis.
50. The isolated nucleic acid of claim 2, wherein Y, X, and/or Z
are independently selected from a sequence that is capable of
binding to at least one transcription factor selected from _NFAT,
AP-1, CRE, NF.kappa.B, and a member of the STAT protein family.
Description
[0001] This application is a continuation of and claims priority to
U.S. Ser. No. 11/112,973, filed Apr. 22, 2005, currently pending,
which claims the benefit of U.S. Provisional Application No.
60/564,724, filed Apr. 22, 2004; and U.S. Provisional Application
No. 60/565,135, filed Apr. 23, 2004, all of which are incorporated
by reference herein for any purpose.
FIELD
[0002] Response element regions, DNA constructs comprising response
element regions, host cells comprising response element regions,
and methods of using response element regions are provided.
BACKGROUND
[0003] In certain cellular systems, certain molecules, such as
cytokines and growth factors, can interact with a receptor of a
cell, which triggers a process that affects the activity of one or
more transcription factor. In certain instances, the process
activates one or more transcription factors, which then bind to a
response element region of a gene to induce transcription. In
certain instances, the transcription factor is a Signal Transducer
and Activator of Transcription (STAT).
SUMMARY OF THE INVENTION
[0004] In certain embodiments, an isolated nucleic acid comprising
a response element region is provided. In certain embodiments, a
vector comprising a promoter and nucleic acid comprising a response
element region is provided. In certain embodiments, a host cell
comprising a vector is provided.
[0005] In certain embodiments, a response element region comprises
(i) the sequence GTCATTTCCAGGAAATCACC or (ii) a sequence
complementary to the sequence in (i).
[0006] In certain embodiments, a response element region comprises
(i) the sequence GTCATTTCCAGGAAATCACCGTCATTTCCAG
GAAATCACCGTCATTTCCAGGAAATCACC or (ii) a sequence complementary to
the sequence in (i). In certain embodiments, a response element
region comprises (i) the sequence GTCATTTCCAGGAAATCACCGTCATTTCCAGG
AAATCACCGTCATTTCCAGGAAATCACC-Y-GTCATTTCCAGGAAATCACCG
TCATTTCCAGGAAATCACCGTCATTTCCAGGAAATCACC or (ii) a sequence
complementary to the sequence in (i). In certain embodiments, a
response element region comprises (i) the sequence
GTCATTTCCAGGAAATCACCGTC
ATTTCCAGGAAATCACCGTCATTTCCAGGAAATCACC-Y-GTCATTTCC
AGGAAATCACCGTCATTTCCAGGAAATCACCGTCATTTCCAGGAAATCACC-X-GTCATTTCCAGGAAATCAC-
CGTCATTTCCAGGAAATCACCGTCATT TCCAGGAAATCACC or (ii) a sequence
complementary to the sequence in (i). In certain embodiments, a
response element region comprises (i) the sequence
GTCATTTCCAGGAAATCACCGTCATTTCCAGGAAATCACCGTCATTTCCAGG
AAATCACC-Y-GTCATTTCCAGGAAATCACCGTCATTTCCAGGAAATCACCGT
CATTTCCAGGAAATCACC-X-GTCATTTCCAGGAAATCACCGTCATTTCCA
GGAAATCACCGTCATTTCCAGGAAATCACC-Z-GTCATTTCCAGGAAA
TCACCGTCATTTCCAGGAAATCACCG TCATTTCCAGGAAATCACC or (ii) a sequence
complementary to the sequence in (i). In certain embodiments, Y, X,
and Z are each independently selected from a nucleic acid sequence
of 0 to 23 nucleotides.
[0007] In certain embodiments, a method for determining the
activity of a test composition comprising a signaling molecule is
provided. In certain embodiments, the method comprises contacting
the test composition with a signaling molecule-responsive host cell
comprising a vector that comprises a promoter and nucleic acid
comprising a response element region. In certain embodiments, the
method further comprises incubating the test composition comprising
a signaling molecule and the signaling-responsive host cell under
conditions in which the reporter nucleic acid expresses a reporter
protein in response to the signaling molecule. In certain
embodiments, the method further comprises detecting the reporter
protein to determine the activity of the test composition.
[0008] In certain embodiments, a method for determining whether a
test compound has activity of a given signaling molecule is
provided. In certain embodiments, the method comprises contacting
the test compound with a signaling molecule-responsive host cell
comprising a vector that comprises a promoter and nucleic acid
comprising a response element region. In certain embodiments, the
method further comprises incubating the test compound and the
signaling-responsive host cell under conditions in which the
reporter nucleic acid expresses a reporter protein in response to
the signaling molecule. In certain embodiments, the method further
comprises detecting the reporter protein to determine the activity
of the test composition. In certain embodiments, the method further
comprises comparing the level of detected reporter protein
expression with the level of detected reporter protein expressed by
a signaling molecule-responsive host cell comprising the vector in
the absence of the test compound to determine whether the test
compound has the activity of the given signaling molecule. In
certain embodiments, the method further comprises comparing the
level of detected reporter protein expression with the level of
detected reporter protein expressed by a signaling
molecule-responsive host cell comprising the vector in the presence
of the given signaling molecule, but in the absence of the test
compound to determine whether the test compound has the activity of
the given signaling molecule.
[0009] In certain embodiments, a method for determining whether a
test compound impacts the activity of a signaling molecule is
provided. In certain embodiments, the method comprises contacting
the test compound with a signaling molecule-responsive host cell
comprising a vector that comprises a promoter and nucleic acid
comprising a response element region in the presence of the
signaling molecule under conditions in which the reporter nucleic
acid expresses a reporter protein in response to the signaling
molecule. In certain embodiments, the method further comprises
detecting the reporter protein. In certain embodiments, the method
further comprises comparing the level of detected reporter protein
expression with the level of detected reporter protein expressed by
a signaling molecule-responsive host cell comprising the vector in
the presence of the signaling molecule, but in the absence of the
test compound, to determine whether the test compound impacts the
activity of the signaling molecule.
[0010] In certain embodiments, a method of producing a polypeptide
from an ex vivo mammalian system is provided. In certain
embodiments, the method comprises producing the polypeptide. In
certain embodiments, the method further comprises testing the
polypeptide with a signaling molecule-responsive host cell
comprising a vector that comprises a promoter and nucleic acid
comprising a response element region. In certain embodiments, the
method further comprises determining the amount of protein produced
and/or activity of the protein produced by the ex vivo system.
[0011] In certain embodiments, a response element region comprising
more than one response element sequences is provided. In certain
embodiments, a response element sequence comprises the sequence
GTCATTTCCAGGAAATCACC. In certain embodiments, the center region of
at least two response element sequences are spatially oriented to
be in the same location (on the y and z axis) plus or minus 36
degrees, relative to the center axis of the double-helical DNA
(x-axis). In certain embodiments, the center region is the tenth
and eleventh nucleotides AG of the sequence
GTCATTTCCAGGAAATCACC.
[0012] In certain embodiments, a response element region comprising
more than one response element sequence core regions is provided.
In certain embodiments, a response element sequence core region
comprises the sequence TTCCAGGAA. In certain embodiments, the
center region of at least two response element sequence core
regions are spatially oriented to be in the same location (on the y
and z axis) plus or minus 36 degrees, relative to the center axis
of the double-helical DNA (x-axis). In certain embodiments, the
center region is the fifth and sixth nucleotides AG of the sequence
TTCCAGGAA. In certain embodiments, a response element region
comprising at least two series of more than one response element
sequences is provided. In certain embodiments, a response element
sequence comprises the sequence GTCATTTCCAGGAAATCACC. In certain
embodiments, each series of more than one response element
sequences are linked together by a sequence of approximately eight
nucleotides. In certain embodiments, within a first series of the
response element sequences, each center region of the response
element sequences are spatially oriented to be in approximately the
same location (on the y and z axis) plus or minus 36 degrees,
relative to the center axis of the double-helical DNA (x-axis). In
certain embodiments, the center region is the tenth and eleventh
nucleotides AG of the sequence GTCATTTCCAGGAAATCACC. In certain
embodiments, within a second series of the response element
sequences, each center region of the response element sequences are
spatially oriented to be in approximately the same location (on the
y and z axis) plus or minus 36 degrees, relative to the center axis
of the double-helical DNA (x-axis). In certain embodiments, the
center region is the tenth and eleventh nucleotides AG of the
sequence GTCATTTCCAGGAAATCACC. In certain embodiments, the center
region of the response element sequences of the second series of
the response element sequences are spatially oriented to be
approximately 72 to 86 degrees from the center region of the first
series of the response element sequences as determined from the y
and z axis relative to the center axis of the double-helical DNA as
the x axis.
[0013] In certain embodiments, a response element region comprising
at least two series of more than one response element sequences is
provided. In certain embodiments, a response element sequence
comprises the sequence GTCATTTCCAGGAAATCACC. In certain
embodiments, each series of more than one response element
sequences are linked together by a sequence of approximately eight
nucleotides. In certain embodiments, within a first series of the
response element sequences, each center region of the response
element sequences are spatially oriented to be in approximately the
same location (on the y and z axis) plus or minus 36 degrees,
relative to the center axis of the double-helical DNA (x-axis). In
certain embodiments, the center region is the tenth and eleventh
nucleotides AG of the sequence GTCATTTCCAGGAAATCACC. In certain
embodiments, within a second series of the response element
sequences, each center region of the response element sequences are
spatially oriented to be in approximately the same location (on the
y and z axis) plus or minus 36 degrees, relative to the center axis
of the double-helical DNA (x-axis). In certain embodiments, the
center region is the tenth and eleventh nucleotides AG of the
sequence GTCATTTCCAGGAAATCACC. In certain embodiments, the center
region of the response element sequences of the second series of
the response element sequences are spatially oriented to be
approximately 144 to 180 degrees (in certain embodiments, from 144
to 172 degrees) from the center region of the first series of the
response element sequences as determined from the y and z axis
relative to the center axis of the double-helical DNA as the x
axis.
BRIEF DESCRIPTION OF THE FIGURES
[0014] FIG. 1 is an exemplary representation of the sequence
GTCATTTCCAGGAAATCACC on a double helix DNA. FIG. 1 also depicts the
x, y, and z axis.
DETAILED DESCRIPTION OF CERTAIN PREFERRED EMBODIMENTS
[0015] In this application, the use of the singular includes the
plural unless specifically stated otherwise. In this application,
the use of "or" means "and/or" unless stated otherwise.
Furthermore, the use of the term "including", as well as other
forms, such as "includes" and "included", is not limiting. Also,
terms such as "element" or "component" encompass both elements and
components comprising one unit and elements and components that
comprise more than one subunit unless specifically stated
otherwise.
[0016] The section headings used herein are for organizational
purposes only, and are not to be construed as limiting the subject
matter described. All documents cited in this application,
including, but not limited to patents, patent applications,
articles, books, and treatises, are expressly incorporated by
reference in their entirety for any purpose.
[0017] Standard techniques may be used for recombinant DNA,
oligonucleotide synthesis, and tissue culture and transfection
(e.g., electroporation, lipofection). Enzymatic reactions and
purification techniques may be performed according to
manufacturer's specifications or as commonly accomplished in the
art or as described herein. The foregoing techniques and procedures
may be generally performed according to conventional methods well
known in the art and as described in various general and more
specific references that are cited and discussed throughout the
present specification. See e.g., Sambrook et al. Molecular Cloning:
A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory Press,
Cold Spring Harbor, N.Y. (1989)). Unless specific definitions are
provided, the nomenclatures utilized in connection with, and the
laboratory procedures and techniques of, analytical chemistry,
synthetic organic chemistry, and medicinal and pharmaceutical
chemistry described herein are those well known and commonly used
in the art. Standard techniques may be used for chemical syntheses,
chemical analyses, pharmaceutical preparation, formulation, and
delivery, and treatment of patients.
[0018] As utilized in accordance with the present disclosure, the
following terms, unless otherwise indicated, shall be understood to
have the following meanings:
[0019] A response element region refers to a region of a
double-stranded nucleic acid that is capable of being bound by one
or more activated response element transcription factors, or one or
more complexes of activated response element transcription factors,
to modulate expression of one or more genes. A response element
region also refers to a region of a single-stranded nucleic acid
that, if it were double-stranded DNA, would be capable of being
bound by one or more activated response element transcription
factors, or one or more complexes of activated response element
transcription factors, to modulate expression of one or more
genes.
[0020] The term response element transcription factors refers to
factors that bind to a response element region to modulate
expression of one or more genes. In certain embodiments, multiple
response element transcription factors may bind to a response
element region. In certain embodiments, one or more complexes of
response element transcription factors may bind to a response
element region.
[0021] The term "operably linked" refers to components that are in
a relationship permitting them to function in their intended
manner. For example, a control sequence "operably linked" to a
coding sequence permits expression of the coding sequence under
conditions compatible with the operation of the control
sequence.
[0022] The term "control sequence" refers to a nucleic acid
sequence which may effect the expression and processing of coding
sequences. According to certain embodiments, control sequences may
include response element regions and promoters.
[0023] A signaling molecule refers to an extracellular molecule, in
either a free or bound form, that interacts with a of a cell, which
triggers a process that affects the activity of one or more
response element transcription factor.
[0024] A signaling molecule-responsive host cell refers to a host
cell that comprises a signaling molecule receptor capable of
interacting with a signaling molecule.
[0025] The term "reporter nucleic acid" refers to a nucleic acid
that encodes a polypeptide that can be used to detect expression of
the reporter nucleic acid.
[0026] The term "isolated nucleic acid" or "isolated
polynucleotide" as used herein shall mean a nucleic acid of
genomic, cDNA, or synthetic origin or some combination thereof,
which by virtue of its origin the "isolated nucleic acid" (1) is
not associated with all or a portion of a polynucleotide in which
the "isolated nucleic acid" is found in nature, (2) is linked to a
nucleic acid which it is not linked to in nature, or (3) does not
occur in nature as part of a larger sequence.
[0027] The term "nucleic acid" or "polynucleotide" as referred to
herein means a polymeric form of nucleotides. In certain
embodiments, the bases may comprise at least one of
ribonucleotides, deoxyribonucleotides, and a modified form of
either type of nucleotide. The term includes single and double
stranded forms of DNA.
[0028] The term "naturally occurring nucleotides" includes
deoxyribonucleotides and ribonucleotides. Deoxyribonucleotides
include, but are
[0029] not limited to, adenosine, guanine, cytosine, and thymidine.
Ribonucleotides include, but are not limited to, adenosine,
cytosine, thymidine, and uricil. The term "modified nucleotides"
includes nucleotides with modified or substituted sugar groups and
the like. The term "oligonucleotide linkages" includes
oligonucleotides linkages such as phosphorothioate,
phosphorodithioate, phosphoroselenoate, phosphorodiselenoate,
phosphoroanilothioate, phoshoraniladate, phosphoroamidate, and the
like. See, e.g., LaPlanche et al. Nucl. Acids Res. 14:9081 (1986);
Stec et al. J. Am. Chem. Soc. 106:6077 (1984); Stein et al. Nucl.
Acids Res. 16:3209 (1988); Zon et al. Anti-Cancer Drug Design 6:539
(1991); Zon et al. Oligonucleotides and Analogues: A Practical
Approach, pp. 87-108 (F. Eckstein, Ed., Oxford University Press,
Oxford England (1991)); Stec et al. U.S. Pat. No. 5,151,510;
Uhlmann and Peyman Chemical Reviews 90:543 (1990). In certain
instances, an oligonucleotide can include a label for
detection.
[0030] The term "polypeptide" is used herein as a generic term to
refer to any polypeptide comprising two or more amino acids joined
to each other by peptide bonds or modified peptide bonds, i.e.,
peptide isosteres. "Polypeptide" refers to both short chains,
commonly referred to as peptides, oligopeptides or oligomers, and
to longer chains, generally referred to as proteins. Polypeptides
may contain amino acids other than those normally encoded by a
codon.
[0031] Polypeptides include amino acid sequences modified either by
natural processes, such as post-translational processing, or by
chemical modification techniques that are well known in the art.
Such modifications are well described in basic texts and in more
detailed monographs, as well as in a voluminous research
literature. Modifications may occur anywhere in a polypeptide,
including the peptide backbone, the amino acid side-chains and the
amino or carboxyl termini. Such modifications may be present to the
same or varying degrees at several sites in a given polypeptide.
Also, in certain embodiments, a given polypeptide may contain many
types of modifications such as deletions, additions, and/or
substitutions of one or more amino acids of a native sequence. In
certain embodiments, polypeptides may be branched as a result of
ubiquitination, and, in certain embodiments, they may be cyclic,
with or without branching. Cyclic, branched and branched cyclic
polypeptides may result from post-translation natural processes or
may be made by synthetic methods. Modifications include, but are
not limited to, acetylation, acylation, ADP-ribosylation,
amidation, biotinylation, covalent attachment of flavin, covalent
attachment of a heme moiety, covalent attachment of a nucleotide or
nucleotide derivative, covalent attachment of a lipid or lipid
derivative, covalent attachment of phosphotidylinositol,
cross-linking, cyclization, disulfide bond formation,
demethylation, formation of covalent cross-links, formation of
cystine, formation of pyroglutamate, formylation,
gamma-carboxylation, glycosylation, GPI anchor formation,
hydroxylation, iodination, methylation, myristoylation, oxidation,
proteolytic processing, phosphorylation, prenylation, racemization,
selenoylation, sulfation, transfer-RNA mediated addition of amino
acids to proteins such as arginylation, and ubiquitination.
[0032] The term "naturally-occurring" as used herein as applied to
an object refers to the fact that an object can be found in nature.
For example, a polypeptide or polynucleotide sequence that is
present in an organism (including viruses) that can be isolated
from a source in nature and which has not been intentionally
modified by man in the laboratory or otherwise is
naturally-occurring.
[0033] Identity and similarity of related polypeptides can be
readily calculated by known methods. Such methods include, but are
not limited to, those described in Computational Molecular Biology,
Lesk, A. M., ed., Oxford University Press, New York (1988);
Biocomputing: Informatics and Genome Projects, Smith, D. W., ed.,
Academic Press, New York (1993); Computer Analysis of Sequence
Data, Part 1, Griffin, A. M., and Griffin, H. G., eds., Humana
Press, New Jersey (1994); Sequence Analysis in Molecular Biology,
von Heinje, G., Academic Press (1987); Sequence Analysis Primer,
Gribskov, M. and Devereux, J., eds., M. Stockton Press, New York
(1991); and Carillo et al., SIAM J. Applied Math., 48:1073 (1988).
A protein is "substantially similar" to another protein, as it is
meant herein, when it is at least 90% identical to the other
protein in amino acid sequence and maintains or alters in a
desirable manner the biological activity of the unaltered
polypeptide. Biological activity can be measured by an in vivo
assay such as that described by Cotes and Bangham ((1961), Nature
191: 1065-67).
[0034] Certain methods to determine identity are designed to give
the largest match between the sequences tested. Certain, methods to
determine identity are described in publicly available computer
programs. Certain computer program methods to determine identity
between two sequences include, but are not limited to, the GCG
program package, including GAP (Devereux et al., Nucl. Acid. Res.,
12:387 (1984); Genetics Computer Group, University of Wisconsin,
Madison, Wis., BLASTP, BLASTN, and FASTA (Altschul et al., J. Mol.
Biol., 215:403-410 (1990)). The BLASTX program is publicly
available from the National Center for Biotechnology Information
(NCBI) and other sources (BLAST Manual, Altschul et al. NCB/NLM/NIH
Bethesda, Md. 20894; Altschul et al., supra (1990)). The well-known
Smith Waterman algorithm may also be used to determine
identity.
[0035] Certain alignment schemes for aligning two amino acid
sequences may result in the matching of only a short region of the
two sequences, and this small aligned region may have very high
sequence identity even though there is no significant relationship
between the two full-length sequences. Accordingly, in certain
embodiments, the selected alignment method (GAP program) will
result in an alignment that spans at least 50 contiguous amino
acids of the target polypeptide.
[0036] For example, using the computer algorithm GAP (Genetics
Computer Group, University of Wisconsin, Madison, Wis.), two
polypeptides for which the percent sequence identity is to be
determined are aligned for optimal matching of their respective
amino acids (the "matched span", as determined by the algorithm).
In certain embodiments, a gap opening penalty (which is calculated
as 3.times. the average diagonal; the "average diagonal" is the
average of the diagonal of the comparison matrix being used; the
"diagonal" is the score or number assigned to each perfect amino
acid match by the particular comparison matrix) and a gap extension
penalty (which is usually 1/10 times the gap opening penalty), as
well as a comparison matrix such as PAM 250 or BLOSUM 62 are used
in conjunction with the algorithm. In certain embodiments, a
standard comparison matrix (see Dayhoff et al., Atlas of Protein
Sequence and Structure, 5(3)(1978) for the PAM 250 comparison
matrix; Henikoff et al., Proc. Natl. Acad. Sci USA, 89:10915-10919
(1992) for the BLOSUM 62 comparison matrix) is also used by the
algorithm.
[0037] In certain embodiments, the parameters for a polypeptide
sequence comparison include the following:
[0038] Algorithm: Needleman et al., J. Mol. Biol., 48:443-453
(1970);
[0039] Comparison matrix: BLOSUM 62 from Henikoff et al., supra
(1992);
[0040] Gap Penalty: 12
[0041] Gap Length Penalty: 4
[0042] Threshold of Similarity: 0
[0043] The GAP program may be useful with the above parameters.
[0044] In certain embodiments, the aforementioned parameters are
the default parameters for polypeptide comparisons (along with no
penalty for end gaps) using the GAP algorithm.
[0045] As used herein, the twenty conventional amino acids and
their abbreviations follow conventional usage. See Immunology--A
Synthesis (2nd Edition, E. S. Golub and D. R. Gren, Eds., Sinauer
Associates, Sunderland, Mass. (1991)). Stereoisomers (e.g., D-amino
acids) of the twenty conventional amino acids, unnatural amino
acids such as .alpha.-, .alpha.-disubstituted amino acids, N-alkyl
amino acids, lactic acid, and other unconventional amino acids may
also be suitable components for polypeptides of the present
invention. Examples of unconventional amino acids include, but are
not limited to: 4-hydroxyproline, .gamma.-carboxyglutamate,
.epsilon.-N,N,N-trimethyllysine, .epsilon.-N-acetyllysine,
O-phosphoserine, N-acetylserine, N-formylmethionine,
3-methylhistidine, 5-hydroxylysine, .sigma.-N-methylarginine, and
other similar amino acids and imino acids (e.g., 4-hydroxyproline).
In the polypeptide notation used herein, the left-hand direction is
the amino terminal direction and the right-hand direction is the
carboxy-terminal direction, in accordance with standard usage and
convention.
[0046] Similarly, unless specified otherwise, the left-hand end of
single-stranded nucleic acid sequences is the 5' end; the left-hand
direction of double-stranded nucleic acid sequences is referred to
as the 5' direction. The direction of 5' to 3' addition of nascent
RNA transcripts is referred to as the transcription direction;
sequence regions on the DNA strand having the same sequence as the
RNA and which are 5' to the 5' end of the RNA transcript are
referred to as "upstream sequences"; sequence regions on the DNA
strand having the same sequence as the RNA and which are 3' to the
3' end of the RNA transcript are referred to as "downstream
sequences."
[0047] Conservative amino acid substitutions may encompass
non-naturally occurring amino acid residues, which are typically
incorporated by chemical peptide synthesis rather than by synthesis
in biological systems. These include peptidomimetics and other
reversed or inverted forms of amino acid moieties.
[0048] Naturally occurring residues may be divided into classes
based on common side chain properties:
[0049] 1) hydrophobic: norleucine, Met, Ala, Val, Leu, Ile;
[0050] 2) neutral hydrophilic: Cys, Ser, Thr, Asn, Gln;
[0051] 3) acidic: Asp, Glu;
[0052] 4) basic: His, Lys, Arg;
[0053] 5) residues that influence chain orientation: Gly, Pro;
and
[0054] 6) aromatic: Trp, Tyr, Phe.
[0055] For example, non-conservative substitutions may involve the
exchange of a member of one of these classes for a member from
another class.
[0056] In making such changes, according to certain embodiments,
the hydropathic index of amino acids may be considered. Each amino
acid has been assigned a hydropathic index on the basis of its
hydrophobicity and charge characteristics. They are: isoleucine
(+4.5); valine (+4.2); leucine (+3.8); phenylalanine (+2.8);
cysteine/cystine (+2.5); methionine (+1.9); alanine (+1.8); glycine
(-0.4); threonine (-0.7); serine (-0.8); tryptophan (-0.9);
tyrosine (-1.3); proline (-1.6); histidine (-3.2); glutamate
(-3.5); glutamine (-3.5); aspartate (-3.5); asparagine (-3.5);
lysine (-3.9); and arginine (-4.5).
[0057] The importance of the hydropathic amino acid index in
conferring interactive biological function on a protein is
understood in the art. Kyte et al., J. Mol. Biol., 157:105-131
(1982). It is known that certain amino acids may be substituted for
other amino acids having a similar hydropathic index or score and
still retain a similar biological activity. In making changes based
upon the hydropathic index, in certain embodiments, the
substitution of amino acids whose hydropathic indices are within
.+-.2 is included. In certain embodiments, those which are within
.+-.1 are included, and in certain embodiments, those within
.+-.0.5 are included.
[0058] It is also understood in the art that the substitution of
like amino acids can be made effectively on the basis of
hydrophilicity, particularly where the biologically functional
protein or peptide thereby created is intended for use in
immunological embodiments, as in the present case. In certain
embodiments, the greatest local average hydrophilicity of a
protein, as governed by the hydrophilicity of its adjacent amino
acids, correlates with its immunogenicity and antigenicity, i.e.,
with a biological property of the protein.
[0059] The following hydrophilicity values have been assigned to
these amino acid residues: arginine (+3.0); lysine (+3.0);
aspartate (+3.0.+-.1); glutamate (+3.0.+-.1); serine (+0.3);
asparagine (+0.2); glutamine (+0.2); glycine (0); threonine (-0.4);
proline (-0.5.+-.1); alanine (-0.5); histidine (-0.5); cysteine
(-1.0); methionine (-1.3); valine (-1.5); leucine (-1.8);
isoleucine (-1.8); tyrosine (-2.3); phenylalanine (-2.5) and
tryptophan (-3.4). In making changes based upon similar
hydrophilicity values, in certain embodiments, the substitution of
amino acids whose hydrophilicity values are within .+-.2 is
included, in certain embodiments, those which are within .+-.1 are
included, and in certain embodiments, those within .+-.0.5 are
included. One may also identify epitopes from primary amino acid
sequences on the basis of hydrophilicity. These regions are also
referred to as "epitopic core regions."
[0060] Exemplary amino acid substitutions are set forth in Table
1.
TABLE-US-00001 TABLE 1 Amino Acid Substitutions More specific
Original Exemplary exemplary Residues Substitutions Substitutions
Ala Val, Leu, Ile Val Arg Lys, Gln, Asn Lys Asn Gln Gln Asp Glu Glu
Cys Ser, Ala Ser Gln Asn Asn Glu Asp Asp Gly Pro, Ala Ala His Asn,
Gln, Lys, Arg Arg Ile Leu, Val, Met, Ala, Leu Phe, Norleucine Leu
Norleucine, Ile, Ile Val, Met, Ala, Phe Lys Arg, 1,4
Diamino-butyric Arg Acid, Gln, Asn Met Leu, Phe, Ile Leu Phe Leu,
Val, Ile, Ala, Leu Tyr Pro Ala Gly Ser Thr, Ala, Cys Thr Thr Ser
Ser Trp Tyr, Phe Tyr Tyr Trp, Phe, Thr, Ser Phe Val Ile, Met, Leu,
Phe, Leu Ala, Norleucine
[0061] A skilled artisan will be able to determine suitable
variants of the polypeptide as set forth herein using well-known
techniques. In certain embodiments, one skilled in the art may
identify suitable areas of the molecule that may be changed without
destroying activity by targeting regions not believed to be
important for activity. In certain embodiments, one can identify
residues and portions of the molecules that are conserved among
similar polypeptides. In certain embodiments, even areas that may
be important for biological activity, including but not limited to
the CDRs of an antibody, or that may be important for structure may
be subject to conservative amino acid substitutions without
destroying the biological activity or without adversely affecting
the polypeptide structure.
[0062] Additionally, one skilled in the art can review
structure-function studies identifying residues in similar
polypeptides that are important for activity or structure. In view
of such a comparison, one can predict the importance of amino acid
residues in a polypeptide that correspond to amino acid residues
which are important for activity or structure in similar
polypeptides. One skilled in the art may opt for chemically similar
amino acid substitutions for such predicted important amino acid
residues.
[0063] One skilled in the art can also analyze the
three-dimensional structure and amino acid sequence in relation to
that structure in similar polypeptides. In view of such
information, one skilled in the art may predict the alignment of
amino acid residues of a polypeptide with respect to its three
dimensional structure. In certain embodiments, one skilled in the
art may choose not to make radical changes to amino acid residues
predicted to be on the surface of the polypeptide, since such
residues may be involved in important interactions with other
molecules. Moreover, one skilled in the art may generate test
variants containing a single amino acid substitution at each
desired amino acid residue. The variants can then be screened using
activity assays known to those skilled in the art. Such variants
could be used to gather information about suitable variants. For
example, if one discovered that a change to a particular amino acid
residue resulted in destroyed, undesirably reduced, or unsuitable
activity, variants with such a change may be avoided. In other
words, based on information gathered from such routine experiments,
one skilled in the art can readily determine the amino acids where
further substitutions should be avoided either alone or in
combination with other mutations.
[0064] A number of scientific publications have been devoted to the
prediction of secondary structure. See Moult J., Curr. Op. in
Biotech., 7(4):422-427 (1996), Chou et al., Biochemistry,
13(2):222-245 (1974); Chou et al., Biochemistry, 113(2):211-222
(1974); Chou et al., Adv. Enzymol. Relat. Areas Mol. Biol.,
47:45-148 (1978); Chou et al., Ann. Rev. Biochem., 47:251-276 and
Chou et al., Biophys. J., 26:367-384 (1979). Moreover, computer
programs are currently available to assist with predicting
secondary structure. One method of predicting secondary structure
is based upon homology modeling. For example, two polypeptides or
proteins which have a sequence identity of greater than 30%, or
similarity greater than 40% often have similar structural
topologies. The recent growth of the protein structural database
(PDB) has provided enhanced predictability of secondary structure,
including the potential number of folds within a polypeptide's or
protein's structure. See Holm et al., Nucl. Acid. Res.,
27(1):244-247 (1999). It has been suggested (Brenner et al., Curr.
Op. Struct. Biol., 7(3):369-376 (1997)) that there are a limited
number of folds in a given polypeptide or protein and that once a
critical number of structures have been resolved, structural
prediction will become dramatically more accurate.
[0065] Additional methods of predicting secondary structure include
"threading" (Jones, D., Curr. Opin. Struct. Biol., 7(3):377-87
(1997); Sippl et al., Structure, 4(1):15-19 (1996)), "profile
analysis" (Bowie et al., Science, 253:164-170 (1991); Gribskov et
al., Meth. Enzym., 183:146-159 (1990); Gribskov et al., Proc. Nat.
Acad. Sci., 84(13):4355-4358 (1987)), and "evolutionary linkage"
(See Holm, supra (1999), and Brenner, supra (1997)).
[0066] In certain embodiments, antibody variants include
glycosylation variants wherein the number and/or type of
glycosylation site has been altered compared to the amino acid
sequences of the parent polypeptide. In certain embodiments,
polypeptide variants comprise a greater or a lesser number of
N-linked glycosylation sites than the native polypeptide. An
N-linked glycosylation site is characterized by the sequence:
Asn-X-Ser or Asn-X-Thr, wherein the amino acid residue designated
as X may be any amino acid residue except proline. The substitution
of amino acid residues to create this sequence provides a potential
new site for the addition of an N-linked carbohydrate chain.
Alternatively, substitutions which eliminate this sequence will
remove an existing N-linked carbohydrate chain. Also provided is a
rearrangement of N-linked carbohydrate chains wherein one or more
N-linked glycosylation sites (typically those that are naturally
occurring) are eliminated and one or more new N-linked sites are
created.
[0067] In certain embodiments, polypeptide variants include
cysteine variants. In certain embodiments, cysteine variants have
one or more cysteine residues that are deleted from or that are
replaced by another amino acid (e.g., serine) as compared to the
parent amino acid sequence. In certain embodiments, cysteine
variants have one or more cysteine residues that are added to or
that replace another amino acid (e.g., serine) as compared to the
parent amino acid sequence. In certain embodiments, cysteine
variants may be useful when polypeptides are refolded into a
biologically active conformation such as after the isolation of
insoluble inclusion bodies. In certain embodiments, cysteine
variants have fewer cysteine residues than the native polypeptide.
In certain embodiments, cysteine variants have more cysteine
residues than the native polypeptide. In certain embodiments,
cysteine variants have an even number of cysteine residues to
minimize interactions resulting from unpaired cysteines.
[0068] According to certain embodiments, amino acid substitutions
are those which: (1) reduce susceptibility to proteolysis, (2)
reduce susceptibility to oxidation, (3) alter binding affinity for
forming protein complexes, (4) alter binding affinities, and/or (4)
confer or modify other physicochemical or functional properties on
such polypeptides. According to certain embodiments, single or
multiple amino acid substitutions (in certain embodiments,
conservative amino acid substitutions) may be made in the
naturally-occurring sequence (in certain embodiments, in the
portion of the polypeptide outside the domain(s) forming
intermolecular contacts). In certain embodiments, a conservative
amino acid substitution typically may not substantially change the
structural characteristics of the parent sequence (e.g., a
replacement amino acid should not tend to break a helix that occurs
in the parent sequence, or disrupt other types of secondary
structure that characterizes the parent sequence). Examples of
art-recognized polypeptide secondary and tertiary structures are
described in Proteins, Structures and Molecular Principles
(Creighton, Ed., W. H. Freeman and Company, New York (1984));
Introduction to Protein Structure (C. Branden and J. Tooze, eds.,
Garland Publishing, New York, N.Y. (1991)); and Thornton et al.
Nature 354:105 (1991).
[0069] The term "polypeptide fragment" as used herein refers to a
polypeptide that has an amino-terminal and/or carboxy-terminal
deletion. In certain embodiments, fragments are at least 5 to 467
amino acids long. It will be appreciated that in certain
embodiments, fragments are at least 5, 6, 8, 10, 14, 20, 50, 70,
100, 150, 200, 250, 300, 350, 400, or 450 amino acids long.
[0070] Peptide analogs are commonly used in the pharmaceutical
industry as non-peptide drugs with properties analogous to those of
the template peptide. These types of non-peptide compound are
termed "peptide mimetics" or "peptidomimetics". Fauchere, J. Adv.
Drug Res. 15:29 (1986); Veber and Freidinger TINS p. 392 (1985);
and Evans et al. J. Med. Chem. 30:1229 (1987). Such compounds are
often developed with the aid of computerized molecular modeling.
Peptide mimetics that are structurally similar to therapeutically
useful peptides may be used to produce a similar therapeutic or
prophylactic effect. Generally, peptidomimetics are structurally
similar to a paradigm polypeptide (i.e., a polypeptide that has a
biochemical property or pharmacological activity), such as human
antibody, but have one or more peptide linkages optionally replaced
by a linkage selected from: --CH.sub.2 NH--, --CH.sub.2S--,
--CH.sub.2--CH.sub.2--, --CH.dbd.CH-(cis and trans),
--COCH.sub.2--, --CH(OH)CH.sub.2--, and --CH.sub.2 SO--, by methods
well known in the art. Systematic substitution of one or more amino
acids of a consensus sequence with a D-amino acid of the same type
(e.g., D-lysine in place of L-lysine) may be used in certain
embodiments to generate more stable peptides. In addition,
constrained peptides comprising a consensus sequence or a
substantially identical consensus sequence variation may be
generated by methods known in the art (Rizo and Gierasch Ann. Rev.
Biochem. 61:387 (1992)); for example, by adding internal cysteine
residues capable of forming intramolecular disulfide bridges which
cyclize the peptide.
[0071] "Antibody" or "antibody peptide(s)" both refer to an intact
antibody, or a fragment thereof. In certain embodiments, the
antibody fragment may be a binding fragment that competes with the
intact antibody for specific binding. The term "antibody" also
encompasses polyclonal antibodies and monoclonal antibodies. In
certain embodiments, binding fragments are produced by recombinant
DNA techniques. In certain embodiments, binding fragments are
produced by enzymatic or chemical cleavage of intact antibodies. In
certain embodiments, binding fragments are produced by recombinant
DNA techniques. Binding fragments include, but are not limited to,
Fab, Fab', F(ab')2, Fv, Facb, and single-chain antibodies.
Non-antigen binding fragments include, but are not limited to, Fc
fragments.
[0072] "Chimeric antibody" refers to an antibody that has an
antibody variable region of a first species fused to another
molecule, for example, an antibody constant region of another
second species. In certain embodiments, the first species may be
different from the second species. In certain embodiments, the
first species may be the same as the second species. In certain
embodiments, chimeric antibodies may be made through mutagenesis or
CDR grafting to match a portion of the known sequence of an
antibody variable region. CDR grafting typically involves grafting
the CDRs from an antibody with desired specificity onto the
framework regions (FRs) of another antibody.
[0073] A bivalent antibody other than a "multispecific" or
"multifunctional" antibody, in certain embodiments, typically is
understood to have each of its binding sites identical.
[0074] An antibody substantially inhibits adhesion of a ligand to a
receptor when an excess of antibody reduces the quantity of
receptor bound to the ligand by at least about 20%, 40%, 60%, 80%,
85%, or more (as measured in an in vitro competitive binding
assay).
[0075] The term "epitope" includes any polypeptide determinant
capable of specific binding to an immunoglobulin or T-cell
receptor. In certain embodiments, epitope determinants include
chemically active surface groupings of molecules such as amino
acids, sugar side chains, phosphoryl, or sulfonyl, and, in certain
embodiments, may have specific three dimensional structural
characteristics, and/or specific charge characteristics. An epitope
is a region of an antigen that is bound by an antibody. An antibody
specifically binds an antigen when it preferentially recognizes its
target antigen in a complex mixture of proteins and/or
macromolecules. In certain embodiments, an antibody specifically
binds an antigen when the dissociation constant is .ltoreq.1M, in
certain embodiments, when the dissociation constant is .ltoreq.100
nM, and in certain embodiments, when the dissociation constant is
.ltoreq.10 nM.
[0076] As used herein, the term "label" refers to any molecule that
can be detected. In a certain embodiment, a polypeptide may be
labeled by incorporation of a radiolabeled amino acid. In a certain
embodiment, biotin moieties that can be detected by marked avidin
(e.g., streptavidin containing a fluorescent marker or enzymatic
activity that can be detected by optical or colorimetric methods)
may be attached to the polypeptide. In certain embodiments, a label
may be incorporated into or attached to another reagent which in
turn binds to the antibody of interest. For example, a label may be
incorporated into or attached to a polypeptide that in turn
specifically binds the polypeptide of interest. In certain
embodiments, the label or marker can also be therapeutic. Various
methods of labeling polypeptides and glycoproteins are known in the
art and may be used. Certain general classes of labels include, but
are not limited to, enzymatic, fluorescent, chemiluminescent, and
radioactive labels. Examples of labels for polypeptides include,
but are not limited to, the following: radioisotopes or
radionucleoides (e.g., .sup.3H, .sup.14C, .sup.15N, .sup.35S,
.sup.90Y, .sup.99Tc, .sup.111In, .sup.125I, .sup.131I), fluorescent
labels (e.g., fluorescein isothocyanate (FITC), rhodamine,
lanthanide phosphors, phycoerythrin (PE)), enzymatic labels (e.g.,
horseradish peroxidase, .beta.-galactosidase, luciferase, alkaline
phosphatase, glucose oxidase, glucose-6-phosphate dehydrogenase,
alcohol dehyrogenase, malate dehyrogenase, penicillinase),
chemiluminescent, biotinyl groups, predetermined polypeptide
epitopes recognized by a secondary reporter (e.g., leucine zipper
pair sequences, binding sites for secondary antibodies, metal
binding domains, epitope tags). In certain embodiments, labels are
attached by spacer arms of various lengths to reduce potential
steric hindrance.
[0077] The term "sample", as used herein, includes, but is not
limited to, any quantity of a substance. In certain embodiments, a
sample may be from a chemical reaction, including, but not limited
to, a protein synthesis reaction.
[0078] The term "pharmaceutical agent or drug" as used herein
refers to a chemical compound or composition capable of inducing a
desired therapeutic effect when properly administered to a
patient.
[0079] The term "modulator," as used herein, is a compound that
changes or alters the activity or function of a molecule. For
example, a modulator may cause an increase or decrease in the
magnitude of a certain activity or function of a molecule compared
to the magnitude of the activity or function of the molecule in the
absence of the modulator. In certain embodiments, a modulator is an
inhibitor, which decreases the magnitude of at least one activity
or function of a molecule. Certain exemplary activities and
functions of a molecule include, but are not limited to, binding
affinity, enzymatic activity, and signal transduction. Certain
exemplary inhibitors include, but are not limited to, proteins,
peptides, antibodies, peptibodies, carbohydrates or small organic
molecules. Peptibodies are described, e.g., in WO 01/83525.
[0080] As used herein, "substantially pure" means an object species
is the predominant species present (i.e., on a molar basis it is
more
[0081] abundant than any other individual species in the
composition). In certain embodiments, a substantially purified
fraction is a composition wherein the object species comprises at
least about 50 percent (on a molar basis) of all macromolecular
species present. In certain embodiments, a substantially pure
composition will comprise more than about 80%, 85%, 90%, 95%, or
99% of all macromolar species present in the composition. In
certain embodiments, the object species is purified to essential
homogeneity (contaminant species cannot be detected in the
composition by conventional detection methods) wherein the
composition consists essentially of a single macromolecular
species.
[0082] The term "patient" includes human and animal subjects.
Certain Exemplary Response Element Regions and Reporter Nucleic
Acid Constructs
[0083] As discussed above, a response element region refers to a
region of a double-stranded nucleic acid that is capable of being
bound by one or more activated response element transcription
factors, or one or more complexes of activated response element
transcription factors, to modulate expression of one or more genes.
A response element region also refers to a region of a
single-stranded nucleic acid that, if it were double-stranded DNA,
would be capable of being bound by one or more activated response
element transcription factors, or one or more complexes of
activated response element transcription factors, to modulate
expression of one or more genes. In this patent application,
discussion of one or more transcription factor binding to a
response element region encompasses binding by one or more
transcription factor and/or binding by one or more complexes of
activated transcription factors. In certain embodiments, a response
element region is provided.
[0084] In certain embodiments, a response element region is
included in a reporter nucleic acid construct, which is transfected
into a signaling molecule-responsive host cell. In certain
embodiments, a reporter nucleic acid construct comprises at least a
response element region, a promoter, and a reporter nucleic acid in
operable combination. In certain embodiments, when a signaling
molecule interacts with a signaling molecule receptor of the host
cell, a process is triggered that results in activation of one or
more response element transcription factor. In certain embodiments,
the activated one or more response element transcription factor
binds to the response element region of the reporter nucleic acid
construct, which results in expression of the reporter nucleic
acid. In certain embodiments, one can then detect the production of
the reporter polypeptide to determine the activity of the signaling
molecule.
[0085] Certain embodiments involve response element transcription
factors that are known as Signal Transducers and Activators of
Transcription (STAT). At least seven members of the STAT family of
proteins have been identified in mammals, including Stat1, Stat2,
Stat3, Stat4, Stat5a, Stat5b, and Stat6. The term STAT5 encompasses
both STAT5a or STAT5. Cytokine or growth factor binding to certain
cell surface receptors results in tyrosine phosphorylation and
activation of STATs in the cytoplasm. Phosphorylated STATs form
dimers through reciprocal phosphotyrosine-SH2 interactions. The
activated STAT dimers translocate to the nucleus, where they
activate transcription of STAT-responsive genes by binding to
STAT-specific DNA response elements. See, e.g., Turkson et al.
(2000) Oncogene, 19: 6613 and references cited therein.
[0086] STAT proteins serve a diverse array of biological functions,
including, but not limited to, roles in differentiation,
proliferation, development, apoptosis, and inflammation. The
important physiological role of certain STATs has been demonstrated
through various mouse knock-out experiments. For example, Stat2
null mice and Stat3 null mice are both embryonic lethal, while
Stat1 null mice show high susceptibility to certain infections,
reduced interferon responses, and higher incidence of certain
tumors. Stat5a and/or Stat5b knockout mice are viable but show a
variety of tissue-specific defects. See, e.g., Turkson et al.
(2000) Oncogene, 19: 6613 and references cited therein.
[0087] In certain embodiments, a response element region that can
be bound by STAT5 is provided. In certain embodiments, a response
element region comprises (i) the sequence GTCATTTCCAGGAAATCACC or
(ii) a sequence complementary to the sequence in (i).
[0088] In certain embodiments, the response element region
comprises:
[0089] (a) (i) the sequence
GTCATTTCCAGGAAATCACCGTCATTTCCAGGAAATCACCGTCATTTCCAGGAAATCACC or
(ii) a sequence complementary to the sequence in (i);
[0090] (b) (i) the sequence
GTCATTTCCAGGAAATCACCGTCATTTCCAGGAAATCACCGTCATTTCCAGG
AAATCACC-Y-GTCATTTCCAGGAAATCACCGTCATTTCCAGGAAATCACCG
TCATTTCCAGGAAATCACC or (ii) a sequence complementary to the
sequence in (i);
[0091] (c) (i) the sequence
GTCATTTCCAGGAAATCACCGTCATTTCCAGGAAATCACCGTCATTTCCAGG
AAATCACC-Y-GTCATTTCCAGGAAATCACCGTCATTTCCAGGAAATCACCGT
CATTTCCAGGAAATCACC-X-GTCATTTCCAGGAAATCACCGTCATTTCCAGG
AAATCACCGTCATTTCCAGGAAATCACC or (ii) a sequence complementary to
the sequence in (i); or
[0092] (d) (i) the sequence
GTCATTTCCAGGAAATCACCGTCATTTCCAGGAAATCACCGTCATTTCCAGG
AAATCACC-Y-GTCATTTCCAGGAAATCACCGTCATTTCCAGGAAATCACCGT
CATTTCCAGGAAATCACC-X-GTCATTTCCAGGAAATCACCGTCATTTCCAGG
AAATCACCGTCATTTCCAGGAAATCACC-Z-GTCATTTCCAGGAAATCACCGT
CATTTCCAGGAAATCACCGTCATTTCCAGGAAATCACC or (ii) a sequence
complementary to the sequence in (i);
wherein Y, X, and Z are each independently selected from a nucleic
acid sequence of 0 to 48 (including any integer within that range)
nucleotides. In certain embodiments, Y, X, and Z are each
independently selected from a nucleic acid sequence of 0 to 23
nucleotides.
[0093] In certain embodiments, Y, X, and/or Z may serve as spacer
elements to provide space between multiple triple repeat sequences.
In certain embodiments, a spacer element is a multiple of 10 to 12
nucleotides long, which results in the center regions of the
sequences GTCATTTCCAGGAAATCACC being spatially oriented to be in
approximately the same location (on the y and z axis) plus or minus
36 degrees, relative to the center axis of the double-helical DNA
(x-axis), wherein the center region is the tenth and eleventh
nucleotides AG of the sequence GTCATTTCCAGGAAATCACC. FIG. 1 is an
exemplary representation of the sequence GTCATTTCCAGGAAATCACC on a
double helix DNA. FIG. 1 also depicts the x, y, and z axis.
[0094] In certain embodiments, a spacer element is 10 to 12
nucleotides long. In certain embodiments, a spacer element is 20 to
24 nucleotides long. In certain embodiments, a spacer element is 23
nucleotides long. In certain embodiments, a spacer element is 30 to
36 nucleotides long. In certain embodiments, a spacer element is 8
to 12 nucleotides long. In certain embodiments, a spacer element is
16 to 24 nucleotides long. In certain embodiments, a spacer element
is 24 to 36 nucleotides long.
[0095] In certain embodiments, Y, X, and/or Z may serve a
functional role in transcription. For example, in certain
embodiments,
[0096] transcription factors may bind to Y, X, and/or Z. Exemplary
transcription factors that may bind may bind to Y, X, and/or Z,
include, but are not limited to, --NFAT, AP-1, CRE, NF.kappa.B, and
members of the STAT protein family.
[0097] In certain embodiments, an isolated nucleic acid comprises
the sequence: GTCATTTCCAGGAAATCACCGTCATTTCCAGGAAATCACCGT
CATTTCCAGGAAATCACC-Y-GTCATTTCCAGGAAATCACCGTCATTT
CCAGGAAATCACCGTCATTTCCAGGAAATCACC-X-GTCATTTCCAGG
AAATCACCGTCATTTCCAGGAAATCACCGTCATTTCCAGGAAATCACC-Z-GTCATTTCCAGGAAATCACCGT-
CATTTCCAGGAAATCACCGTCATTTCCAGG AAATCACC, wherein Y, X, and Z are
each a nucleic acid sequence of 0 nucleotides.
[0098] In certain embodiments, an isolated nucleic acid comprises
the sequence: GTCATTTCCAGGAAATCACCGTCATTTCCAGGAAATCACCGT
CATTTCCAGGAAATCACC-Y-GTCATTTCCAGGAAATCACCGTCATTT
CCAGGAAATCACCGTCATTTCCAGGAAATCACC-X-GTCATTTCCAGG
AAATCACCGTCATTTCCAGGAAATCACCGTCATTTCCAGGAAATCACC-Z-GTCATTTCCAGGAAATCACCGT-
CATTTCCAGGAAATCACCGTCATTTCCAGG AAATCACC, wherein Y, X, and Z are
each a nucleic acid sequence of 8 nucleotides. In certain
embodiments, Y, X, and Z are each the nucleic acid sequence
GCCGTACC.
[0099] In certain embodiments, an isolated nucleic acid comprises
the sequence: GTCATTTCCAGGAAATCACCGTCATTTCCAGGAAATCACCGTCATTTCCAGG
AAATCACC-Y-GTCATTTCCAGGAAATCACCGTCATTT
CCAGGAAATCACCGTCATTTCCAGGAAATCACC-X-GTCATTTCCAGG
AAATCACCGTCATTTCCAGGAAATCACCGTCATTTCCAGGAAATCACC-Z-GTCATTTCCAGGAAATCACCGT-
CATTTCCAGGAAATCACCGTCATTTCCAGG AAATCACC, wherein Y is a nucleic
acid sequence of 8 nucleotides, X is a nucleic acid sequence of 10
nucleotides, and Z is a nucleic acid sequence of 16 nucleotides. In
certain embodiments, Y is the nucleic acid sequence GCCGTACC, X is
the nucleic acid sequence TACCGGTCTG, and Z is the nucleic acid
sequence ACCGGCCTAGTGCGTC.
[0100] In certain embodiments, an isolated nucleic acid comprises
the sequence:
TABLE-US-00002 GTCATTTCCAGGAAATCACCGTCATTTCCAGGAAATCACCGT
CATTTCCAGGAAATCACC-Y-GTCATTTCCAGGAAATCACCGTCATTT
CCAGGAAATCACCGTCATTTCCAGGAAATCACC-X-GTCATTTCCAGG
AAATCACCGTCATTTCCAGGAAATCACCGTCATTTCCAGGAAATCACC,
wherein Y and X are each a nucleic acid sequence of 0
nucleotides.
[0101] In certain embodiments, an isolated nucleic acid comprises
the sequence:
TABLE-US-00003 GTCATTTCCAGGAAATCACCGTCATTTCCAGGAAATCACCGT
CATTTCCAGGAAATCACC-Y-GTCATTTCCAGGAAATCACCGTCATTT
CCAGGAAATCACCGTCATTTCCAGGAAATCACC-X-GTCATTTCCAGG
AAATCACCGTCATTTCCAGGAAATCACCGTCATTTCCAGGAAATCACC,
wherein Y and X are each a nucleic acid sequence of 8 nucleotides.
In certain embodiments, Y and X are each the nucleic acid sequence
GCCGTACC.
[0102] In certain embodiments, an isolated nucleic acid comprises
the sequence:
TABLE-US-00004 GTCATTTCCAGGAAATCACCGTCATTTCCAGGAAATCACCGT
CATTTCCAGGAAATCACC-Y-GTCATTTCCAGGAAATCACCGTCATTT
CCAGGAAATCACCGTCATTTCCAGGAAATCACC-X-GTCATTTCCAGG
AAATCACCGTCATTTCCAGGAAATCACCGTCATTTCCAGGAAATCACC,
wherein Y is a nucleic acid sequence of 8 nucleotides and X is a
nucleic acid sequence of 10 nucleotides. In certain embodiments, Y
is the nucleic acid sequence GCCGTACC and X is the nucleic acid
sequence TACCGGTCTG.
[0103] In certain embodiments, a response element region
comprises:
[0104] (i) the sequence N.sub.5TTCCQGGAAN.sub.6; wherein N.sub.5 is
a sequence of five nucleotides independently selected from A, T, C,
or G; N.sub.6 is a sequence of six nucleotides independently
selected from A, T, C, or G; and Q is nucleotide A, C, or T; or
[0105] (ii) a sequence complementary to the sequence in (i). In
certain embodiments, Q is the nucleotide A. In certain embodiments,
Q is the nucleotide C. In certain embodiments, Q is the nucleotide
T.
[0106] In certain embodiments, a response element region
comprises:
[0107] (i) the sequence N.sub.4TTTCCQGGAAAN.sub.5; wherein N.sub.4
is a sequence of four nucleotides independently selected from A, T,
C, or G; N.sub.5 is a sequence of five nucleotides independently
selected from A, T, C, or G; and Q is nucleotide A, C, or T; or
[0108] (ii) a sequence complementary to the sequence in (i). In
certain embodiments, Q is the nucleotide A. In certain embodiments,
Q is the nucleotide C. In certain embodiments, Q is the nucleotide
T.
[0109] In certain embodiments, a response element region
comprises:
[0110] (i) the sequence N.sub.4TTTCCCCGAAAN.sub.5; wherein N.sub.4
is a sequence of four nucleotides independently selected from A, T,
C, or G and N.sub.5 is a sequence of five nucleotides independently
selected from A, T, C, or G; or
[0111] (ii) a sequence complementary to the sequence in (i).
[0112] In certain embodiments, a response element region
comprises:
[0113] (i) the sequence N.sub.4ATTCTCAGAAAN.sub.5; wherein N.sub.4
is a sequence of four nucleotides independently selected from A, T,
C, or G and N.sub.5 is a sequence of five nucleotides independently
selected from A, T, C, or G; or
[0114] (ii) a sequence complementary to the sequence in (i).
[0115] In certain embodiments, a response element region
comprises:
[0116] (i) the sequence N.sub.4TTTCTAGGAATN.sub.5; wherein N.sub.4
is a sequence of four nucleotides independently selected from A, T,
C, or G and N.sub.5 is a sequence of five nucleotides independently
selected from A, T, C, or G; or
[0117] (ii) a sequence complementary to the sequence in (i).
[0118] In certain embodiments, a response element region
comprises:
[0119] (a) the sequence E.sub.3 or a sequence complementary to the
sequence E.sub.3;
[0120] (b) the sequence E.sub.3-X-E.sub.3 or a sequence
complementary to the sequence E.sub.3-X-E.sub.3;
[0121] (c) the sequence E.sub.3-X-E.sub.3-Y-E.sub.3 or a sequence
complementary to the sequence E.sub.3-X-E.sub.3-Y-E.sub.3; or
[0122] (d) the sequence E.sub.3-X-E.sub.3-Y-E.sub.3-Z-E.sub.3 or a
sequence complementary to the sequence
E.sub.3-X-E.sub.3-Y-E.sub.3-Z-E.sub.3;
[0123] wherein Y, X, and Z are each independently selected from a
nucleic acid sequence of 0 to 48 (including any integer within that
range) nucleotides, and wherein E.sub.3 is
[N.sub.5TTCCQGGAAN.sub.6].sub.3; [N.sub.4TTTCCQGGAAAN.sub.5].sub.3;
[N.sub.4TTTCCCCGAAAN.sub.5].sub.3;
[N.sub.4ATTCTCAGAAAN.sub.5].sub.3; or
[N.sub.4TTTCTAGGAATN.sub.5].sub.3; wherein Q is the nucleotide A,
C, or T; N.sub.4 is a sequence of four nucleotides independently
selected from A, T, C, or G; N.sub.5 is a sequence of five
nucleotides independently selected from A, T, C, or G; and N.sub.6
is a sequence of six nucleotides independently selected from A, T,
C, or G.
[0124] In certain embodiments, Y, X, and/or Z may serve as spacer
elements to provide space between multiple triple repeat sequences.
In certain embodiments, a spacer element is a multiple of 10 to 12
nucleotides long, which results in the center regions of each
repeat sequence being spatially oriented to be in approximately the
same location (on the y and z axis) plus or minus 36 degrees,
relative to the center axis of the double-helical DNA (x-axis),
wherein the center region is the middle two nucleotides of the
particularly recited sequence. In certain embodiments, a spacer
element is 10 to 12 nucleotides long. In certain embodiments, a
spacer element is 20 to 24 nucleotides long. In certain
embodiments, a spacer element is 23 nucleotides long. In certain
embodiments, a spacer element is 30 to 36 nucleotides long. In
certain embodiments, a spacer element is 8 to 12 nucleotides long.
In certain embodiments, a spacer element is 16 to 24 nucleotides
long. In certain embodiments, a spacer element is 24 to 36
nucleotides long.
[0125] In certain embodiments, Y, X, and/or Z may serve a
functional role in transcription. For example, in certain
embodiments, transcription factors may bind to Y, X, and/or Z.
Exemplary transcription factors that may bind may bind to Y, X,
and/or Z, include, but are not limited to, --NFAT, AP-1, CRE,
NF.kappa.B, and members of the STAT protein family.
[0126] In certain embodiments, a response element region contains
more than one set of sequences that bind at least one STAT protein.
In certain such embodiments, each set of sequences that bind at
least one STAT protein is embedded in the center of a twenty
(20)-mer, where the sequences flanking the set of sequences that
bind at least one STAT protein can be any nucleotides A, T, C, or G
to complete the twenty-mer. Certain STAT protein binding sites are
disclosed in PCT Publication No. WO 95/28482.
[0127] In certain embodiments, a reporter nucleic acid construct is
provided. Various reporter nucleic acid constructs comprise various
components in addition to a response element region.
[0128] In certain embodiments, a response element region is
operably linked to a promoter. In certain embodiments, a promoter
is capable of being bound directly or indirectly by a polymerase,
which results in transcription of a downstream encoding sequence.
Many different promoters may be used according to various
embodiments. In various embodiments, promoters may be eukaryotic,
prokaryotic, or viral promoters that are capable of driving
transcription of an encoding sequence when transfected into a host
cell.
[0129] One skilled in the art will be able to determine suitable
promoters for use in a given reporter nucleic acid construct and a
given host cell. Nonlimiting exemplary promoters include, but are
not limited to, SV40 promoter, thymidine kinase (TK) promoter, PGK
promoter, beta actin promoter, CMV promoter, RSV promoter, MSCV
promoter, MuLV promoter, HIV promoter, and polyhedron promoter, and
fragments and minimal promoters based on any of these promoters.
Nonlimiting exemplary promoters are described, e.g., in PCT
Publication No. WO 95/28482.
[0130] In certain embodiments, a reporter nucleic acid construct
comprises a reporter nucleic acid, which encodes a polypeptide that
can be used to detect expression of the reporter nucleic acid. Many
different reporter nucleic acids may be used according to various
embodiments. The polypeptide expressed by a reporter nucleic acid
(reporter polypeptide) may be detected directly or indirectly.
[0131] In certain embodiments, a reporter polypeptide may be
detected by using a molecule that binds to the reporter
polypeptide. In various
[0132] embodiments, the molecule that binds the reporter
polypeptide may be any molecule that has affinity for the reporter
polypeptide. In certain embodiments, the molecule that binds the
reporter polypeptide is labeled. In certain embodiments, the
molecule that binds to the reporter polypeptide is an antibody. In
certain embodiments, a reporter polypeptide may be detected by its
interaction with another molecule. In certain embodiments, the
reporter polypeptide is an enzyme that interacts with another
molecule to provide a signal.
[0133] Nonlimiting exemplary reporter polypeptides include, but are
not limited to, fluorescent molecules, chemilluminescent molecules,
electrochemillunescent molecules, luciferase (LUC), phosphatase,
alkaline phosphatase, placental alkaline phosphatase,
beta-galactosidase, green fluorescent protein, beta-lactamase.
Nonlimiting exemplary reporter polypeptides are described, e.g., in
PCT Publication No. WO 95/28482.
[0134] In certain embodiments, a reporter nucleic acid construct is
used to test the activity of a signaling molecule and/or the
ability of a test compound to affect the activity of a signaling
molecule. As discussed above, a signaling molecule refers to an
extracellular molecule, in either a free or bound form, that
interacts with a receptor of a cell, which triggers a process that
affects the activity of one or more response element transcription
factor. Many different signaling molecules may be used according to
various embodiments. In certain embodiments, a signaling molecule
interacts with a receptor of a cell, which triggers a process that
activates one or more response element transcription factor. In
certain embodiments, a signaling molecule interacts with a receptor
of a cell, which triggers a process that deactivates one or more
response element transcription factor. In certain embodiments,
activation of one or more response element transcription factor
results in binding of the one or more activated response element
transcription factor to a response element region, which results in
expression of a reporter nucleic acid.
[0135] Exemplary signaling molecules include, but are not limited
to, polypeptides, oligosaccarides, small organic molecules,
antibodies, peptibodies, carbohydrates, peptide mimetics, fusion
proteins, complex organic molecules (including, but not limited to,
steroids), and lipids (including, but not limited to,
phospholipids). In certain embodiments, a signaling molecule is a
cytokine. In certain embodiments, a signaling molecule is a growth
factor. Nonlimiting exemplary signaling molecules are described,
e.g., in PCT Publication No. WO 95/28482. In certain embodiments,
more than one signaling molecule may be involved in a process of
modulating response element transcription factor activity.
[0136] In certain embodiments, a signaling molecule interacts with
a receptor of a cell, which triggers a process that results in
activation of STATS. Exemplary signaling molecules that have been
shown to be involved in triggering such a process in certain
instances include, but are not limited to, Interleukin (IL)-1,
IL-2, IL-3, IL-4, IL-5, IL-7, IL-9, IL-10, IL-12, IL-13, IL-15,
IL-15, IL-27, erythropoietin, tPO, G-CSF, GM-CSF, growth hormone,
TSLP, cKit, erythropoeitic products, GCSF-like molecules, and
prolactin. Exemplary signaling molecules include, but are not
limited to: naturally occurring polypeptides; polypeptides that
have a naturally occurring amino acid sequence; polypeptides that
have an amino acid sequence that is 70%, 80%, 85%, 90%, 95%, 96%,
97%, 98%, or 99% identical to a naturally occurring amino acid
sequence; fusion proteins that comprise at least one naturally
occurring amino acid sequence; chemically modified polypeptides;
polypeptides with a polymer attached, e.g., polyethylene glycol
(PEG); and molecules that have the signaling molecule activity of a
naturally occurring polypeptide.
[0137] The term "G-CSF" as used herein is defined as naturally
occurring human and heterologous species granulocyte
colony-stimulating factor, recombinantly produced granulocyte
colony-stimulating factor that is the expression product consisting
of either 174 or 177 amino acids, or fragments, analogs, variants,
or derivatives thereof as reported, for example in Kuga et al.,
Biochem. Biophys. Res. Comm. 159: 103-111 (1989); Lu et al., Arch.
Biochem. Biophys. 268: 81-92 (1989); U.S. Pat. Nos. 4,810,643,
4,904,584, 5,104,651, 5,214,132, 5,218,092, 5,362,853, 5,606,024,
5,824,778, 5,824,784, 6,017,876, 6,166,183, and 6,261,550; U.S.
Pat. Appl. No. US 2003/0064922; EP 0335423; EP 0 272703; EP 0
459630; EP 0 256843; EP 0 243153; WO 9102874; Australian
Application document Nos. AU-A-10948/92 and AU-A-76380/91. Included
are chemically modified granulocyte colony-stimulating factors,
see, e.g., those reported in WO 9012874, EP 0401384 and EP 0335423.
See also, WO 03006501; WO 03030821; WO 0151510; WO 9611953; WO
9521629; WO 9420069; WO 9315211; WO 9305169; JP 04164098; WO
9206116; WO 9204455; EP 0473268; EP 0456200; WO 9111520; WO
9105798; WO 9006952; WO 8910932; WO 8905824; WO 9118911; and EP 0
370205. Also encompassed herein are all forms of granulocyte
colony-stimulating factor, such as Albugranin.TM., Neulasta.TM.,
Neupogen.RTM., and Granocyte.RTM..
[0138] Derivatives of G-CSF include molecules modified by one or
more water soluble polymer molecules, such as polyethylene glycol,
or by the addition of polyamino acids, including fusion proteins
(procedures for which are well-known in the art). Such
derivatization may occur singularly at the N- or C-terminus or
there may be multiple sites of derivatization. Substitution of one
or more amino acids with lysine may provide additional sites for
derivatization. (See U.S. Pat. No. 5,824,784 and U.S. Pat. No.
5,824,778, incorporated by reference herein).
[0139] The term "G-CSF-like molecules" means a molecule that can
activate the STAT protein through the granulocyte
colony-stimulating factor receptor or portions thereof.
[0140] As meant herein, the term "erythropoietic product" means a
product that can activate the STAT protein through the
erythropoietin receptor or portions thereof. An erythropoietic
product comprises an "erythropoietic glycoprotein" (as defined
herein), which glycoprotein can be conjugated to a non-protein
molecule. An erythropoietic product as used herein includes
naturally occurring human and hereologous species erythropoietin,
recombinantly-produced erythropoietin, such as Epogen.RTM.
(epoietin alfa), Aranesp.RTM. (darbepoetin alfa), biologically
active precursors, mimetics, analogs, variants, or derivatives
thereof as reported, for example in U.S. Pat. Nos. 6,586,398,
6,319,499, 5,955,422, 5,856,298, 5,441,868, 4,703,308, WO 91/05867,
WO 95/05465, and WO 96/40749 (all incorporated by reference
herein).
[0141] An erythropoietic glycoprotein is preferably a secreted,
recombinant protein. Included among these erythropoietic products
are erythropoietic glycoproteins that have been chemically
modified, for example an erythropoietin glycoprotein conjugated to
polyethylene glycol, such as those disclosed in International
Application Nos. WO 01/02017 and WO 01/76640, U.S. Pat. Nos.
6,077,939, 5,643,575, 6,340,742, US Patent Application No.
2002/0115833, and European Patent No. 1 064 951 (all included by
reference herein). Further, an erythropoietic product can be a
composition that comprises an erythropoietic glycoprotein and,
optionally, one or more additional components such as a
physiologically acceptable carrier, excipient, or diluent. For
example, a composition may comprise an erythropoietic glycoprotein
as described herein plus a buffer, an antioxidant such as ascorbic
acid, a low molecular weight polypeptide (such as those having less
than 10 amino acids), a protein, amino acids, carbohydrates such as
glucose, sucrose, or dextrins, chelating agent such as EDTA,
glutathione, and/or other stabilizers, excipients, and/or
preservatives. The composition may be formulated as a liquid or a
lyophilizate. Further examples of components that may be employed
in pharmaceutical formulations are presented in Remington's
Pharmaceutical Sciences, 16.sup.th Ed., Mack Publishing Company,
Easton, Pa., (1980). Further, the term "erythropoietic products"
includes solutions or formulations comprising the erythropoietic
glycoproteins described below, which may have enhanced stability
and/or activity, such as those described in U.S. Pat. Nos.
4,806,524, 6,333,306, and 6,277,367 (all incorporated by reference
herein).
[0142] As meant herein, the term "erythropoietic glycoprotein"
encompasses glycoproteins that have the same amino acid sequence as
any mammalian erythropoietin glycoprotein, including human
erythropoietin, as well as analogs and variants of each, i.e.,
erythropoietic glycoprotein analogs and erythropoietic glycoprotein
variants. Human erythropoietin sequences are disclosed in U.S. Pat.
Nos. 4,703,008 and 5,688,679, European Patent No. 0 205 564, and
International Application No. WO 02/085940 (all incorporated herein
by reference). Primate erythropoietin sequences are disclosed in,
e.g., U.S. Pat. Nos. 4,703,008 and 6,555,343 and National Center
for Biotechnology Information (NCBI) accession no. AAA36842, and
other mammalian erythropoietins are disclosed in, for example,
International Application No WO 99/54486 (canine erythropoietin),
NCBI accession nos. AAA37570 (mouse erythropoietin), AAA30842
(canine erythropoietin), AAA30807 (cat erythropoietin), and
AAA31029 (pig erythropoietin), among many other published mammalian
erythropoietin sequences (all incorporated herein by reference).
Erythropoietic glycoproteins produced and/or purified by methods
described in U.S. Pat. Nos. 4,667,016, 6,399,333, 6,391,633, and
6,355,241 (all incorporated herein by reference) are erythropoietic
glycoproteins as meant herein.
[0143] Specifically included within "erythropoietic glycoprotein
analogs" are glycoproteins that are substantially similar to a
mammalian erythropoietin and that can stimulate erythropoiesis as
demonstrated in an in vivo bioassay, for example, the exhypoxic
polycythemic mouse assay. See e.g. Cotes and Bangham (1961), Nature
191: 1065. Examples of erythropoietic glycoprotein analogs include
the analogs described in International Application Nos. WO 95/05465
and WO 01/81405 (incorporated herein by reference) which provide
analogs of human erythropoietin comprising more N-glycan sites than
are present in unaltered human erythropoietin. For example, the
analog designated N47 in WO 95/05465 comprises five N-glycan sites,
and the analog designated N66 in WO 01/81405 comprises seven
N-glycan sites rather than the three present in unaltered human
erythropoietin. Other erythropoietic glycoprotein analogs include
those comprising any single alteration described in International
Application Nos. WO 95/05465 and/or WO 01/81405 or any combination
of such alterations, provided that the resulting protein is still
substantially similar to human erythropoietin. Other examples
include the erythropoietic glycoprotein analogs disclosed in U.S.
Pat. Nos. 5,856,298 and 6,153,407, International Application Nos.
WO 00/24893, WO 91/05867, and WO 00/24893, and WO 03/029291, and
European Patent Application 0 902 085 (all herein incorporated by
reference). One such erythropoietic glycoprotein analog has been
given the United States Adopted Name (USAN) darbepoetin alfa and is
marketed under the tradename ARANESP.RTM. by Amgen Corporation of
Thousand Oaks, Calif., USA. Still other erythropoietic glycoprotein
analogs include human erythropoietin with an additional amino acid
at the carboxy-terminus, for example arginine.
[0144] Included among "erythropoietic glycoprotein variants" are
molecules comprising an erythropoietic glycoprotein analog, as
defined above, a mammalian erythropoietin, or a fragment either of
these that can stimulate erythropoiesis fused to a different
protein, polypeptide, or fragment thereof. Erythropoietin variants
include the fusion proteins described in, e.g., U.S. Pat. No.
6,548,653, among many others such as variants including the Fc
region of an antibody or a dimerization or trimerization domain,
for example a leucine zipper.
[0145] Human erythropoietin is 165 amino acids long and has three
N-glycan sites that allow attachment of N-glycans at amino acids
24, 38, and 83 and one O-glycan site that allows attachment of an
O-glycan at amino acid 126. This protein is described in U.S. Pat.
No. 4,703,008, where it is described by amino acids 1 to 165 in
FIG. 6. An analog of human erythropoietin, N47, which is produced
by cells used in Examples 1, 2, and 4, is also 165 amino acids long
and has five N-glycan sites that allow attachment of N-glycans at
amino acids 24, 30, 38, 83, and 88 and one O-glycan site that
allows attachment of an O-glycan at amino acid 126. This protein is
described in International Application No. WO 95/05465, where it is
designated analog "N47."
[0146] In certain embodiments, a signaling molecule interacts with
a receptor of a cell, which triggers a process that results in
activation of one or more STAT protein other than STATS. In certain
embodiments, a signaling molecule interacts with a receptor of a
cell, which triggers a process that results in activation of one or
more response element transcription factor other than a STAT
protein.
[0147] In certain embodiments, a signaling molecule-responsive host
cell is provided. Many different signaling molecule-responsive host
cells may be used according to various embodiments. As discussed
above, a signaling molecule-responsive host cell refers to a host
cell that comprises a signaling molecule receptor cabable of
interacting with a signaling molecule. In certain embodiments, a
signaling molecule receptor is capable of interacting with a
signaling molecule described above. In certain embodiments, a
signaling molecule receptor is a cytokine receptor. In certain
embodiments, a signaling molecule receptor is a growth factor
receptor. Nonlimiting exemplary signaling molecule receptors are
described, e.g., in PCT Publication No. WO 95/28482.
[0148] In certain embodiments, a signaling molecule receptor is
capable of interacting with a signaling molecule, which triggers a
process that results in activation of STATS. Exemplary signaling
molecule receptors involved in triggering such a process in certain
instances include, but are not limited to, Interleukin (IL)-1
receptor, IL-2 receptor, IL-3 receptor, IL-4 receptor, IL-5
receptor, IL-7 receptor, IL-9 receptor, IL-10 receptor, IL-12
receptor, IL-13 receptor, IL-15 receptor, IL-15 receptor, IL-27
receptor, Epo receptor, tPO receptor, G-CSF receptor, GM-CSF
receptor, growth hormone receptor, TSLP receptor, cKit receptor,
and prolactin receptor.
[0149] In certain embodiments, a signaling molecule receptor is
capable of interacting with a signaling molecule, which triggers a
process that results in activation of one or more STAT protein
other than STAT5. In certain embodiments, a signaling molecule
receptor is capable of interacting with a signaling molecule, which
triggers a process that results in activation of one or more
response element transcription factor other than a STAT
protein.
[0150] In certain embodiments, a signaling molecule receptor is a
chimeric signaling molecule receptor. In certain embodiments, a
chimeric signaling molecule receptor comprises a molecule
comprising at least two portions from different receptor molecules.
A nonlimiting exemplary chimeric signaling molecule receptor
molecule is a molecule comprising at least a portion of the
extracellular domain of the Epo receptor and at least a portion of
the cytoplasmic domain of prolactin receptor. See, e.g., Socolovsky
et al., Journal of Biological Chemistry, 272(22):14009-14012
(1997).
[0151] In certain embodiments, a signaling molecule-responsive host
cell expresses a signally molecule receptor from an endogenous
gene. In certain embodiments, a signaling molecule-responsive host
cell expresses from an endogenous gene one or more response element
transcription factor, whose activity is affected by the interaction
of a signaling molecule receptor and a signaling molecule. In
certain embodiments, a signaling molecule-responsive host cell
expresses a signaling molecule receptor from an endogenous gene,
and expresses from an endogenous gene one or more response element
transcription factor, whose activity is affected by the interaction
of the signaling molecule receptor and a signaling molecule. This
discussion of expressing a signaling molecule receptor encompasses
host cells that express more than one type of signaling molecule
receptor.
[0152] In certain embodiments, a signaling molecule-responsive host
cell expresses one or more signaling molecule receptors from one or
more exogenous nucleic acids. In certain embodiments, the signaling
molecule-responsive host cell expresses one or more response
element transcription factors from one or more exogenous nucleic
acids. In certain embodiments, one or more exogenous nucleic acids
have been transiently introduced into the host cell. In certain
embodiments, one or more exogenous nucleic acids have been stably
introduced into the host cell. In various embodiments, a nucleic
acid that can express a signaling molecule receptor and can express
one or more response element transcription factor has been
introduced into a signaling molecule-responsive host cell by any
method known in the art. In certain embodiments, a nucleic acid
that can express a signaling molecule receptor and a separate
nucleic acid that can express one or more response element
transcription factor have been introduced into a signaling
molecule-responsive host cell.
[0153] In certain embodiments, a signaling molecule-responsive host
cell may express a signaling molecule receptor from an endogenous
gene, but to increase the amount of receptor, the host cell also
expresses the signaling molecule receptor from an exogenous nucleic
acid. In certain embodiments, a host cell may not express a
signaling molecule receptor from an endogenous gene, and the host
cell expresses the signaling molecule receptor from an exogenous
nucleic acid. This discussion of a host cell that expresses a
signaling molecule receptor encompasses host cells that express
more than one type of signaling molecule receptor from an exogenous
nucleic acid.
[0154] In certain embodiments, a host cell may express one or more
response element transcription factors from an endogenous gene, but
to increase the amount one or more response element transcription
factor, the host cell also expresses one or more response element
transcription factor from an exogenous nucleic acid. In certain
embodiments, a host cell may not express one or more response
element transcription factor from an endogenous gene, and the host
cell expresses one or more response element transcription factor
from an exogenous nucleic acid. This discussion of a host cell that
expresses one or more response element transcription factor
encompasses host cells that express one or more response element
transcription factor from more than one exogenous nucleic acid.
[0155] Exemplary host cells that may transfected with a reporter
nucleic acid construct include, but are not limited to, NIH-3T3
fibroblast cells, UT7 cells, BaF3 cells, 32D clone 3 cells, 32D
clone 23 cells, DA-1 cells, DA-3 cells, A431 cells, C3H10T1/2
cells, CaCo 2 cells, CHO cells, COS-7 cells, CV-1 cells, Daudi
cells, Jurkat cells, EL-4 cells, Hela cells, HEK293 cells, HUVEC
cells, HL-60 cells, U937 cells, HepG2 cells, HT1080 cells, HUT78
cells, L cells, MC/9 cells, RBL-1 cells, MO7e cells, Neuro 2A
cells, PC-12 cells, RAJI cells, Ramos cells, Rat-1 cells, Saos-2
cells, ST-2 cells, THP-1 cells, TF1 cells, Wehi-3 cells, bone
marrow cells, CD34 positive cells, embryonic stem cells, and germ
cells. Nonlimiting exemplary host cells are described, e.g., in PCT
Publication No. WO 95/28482.
[0156] UT7/Epo cells naturally comprise Epo receptors. Accordingly,
in certain embodiments, UT7/Epo cells transfected with a reporter
nucleic acid construct may be used to test Epo activity. BaF3 cells
naturally comprise IL-3 receptors. Accordingly, in certain
embodiments, BaF3 cells transfected with a reporter nucleic acid
construct may be used to test IL-3 activity.
[0157] In certain embodiments, 32D clone 3 cells are transfected
with a nucleic acid that expresses human G-CSF receptor and with a
reporter nucleic acid construct. Accordingly, in certain
embodiments, such transfected cells can be used to test G-CSF
activity. In certain embodiments, NIH-3T3 cells are transfected
with a nucleic acid that expresses Epo receptor and with a reporter
nucleic acid construct. Accordingly, in certain embodiments, such
transfected cells can be used to test Epo activity.
Certain Exemplary Methods
[0158] In certain embodiments, a signaling molecule-responsive host
cell comprising a reporter nucleic acid construct may be used to
determine the activity of a test composition comprising a signaling
molecule. In certain embodiments, the signaling molecule-responsive
host cell comprising a reporter nucleic acid construct is contacted
with the test composition under conditions in which the reporter
nucleic acid construct expresses a reporter polypeptide in response
to the signaling molecule. If the test composition contains a
sufficient amount of the active signaling molecule, reporter
polypeptide will be produced at a level that can be detected.
[0159] As a non-limiting example, a signaling molecule-responsive
host cell may be transformed or transfected, either stably or
transiently, with a reporter nucleic acid construct that comprises
at least a response element region, a promoter, and a reporter
nucleic acid in operable combination. If the reporter nucleic acid
is a luciferase gene, for example, then contacting the signaling
molecule-responsive host cell comprising the reporter nucleic acid
construct with a test composition comprising the signaling molecule
will result in expression of luciferase, which may be detected
using an appropriate assay and a luminometer. The amount of light
produced may be directly related to the amount of luciferase
protein expressed from the reporter nucleic acid construct, which
in turn may be related to the amount of signaling molecule activity
present in the test composition.
[0160] In certain embodiments, the test composition comprising a
signaling molecule is a particular production batch of the
signaling molecule. In certain embodiments, a production batch of
the signaling molecule is produced by expressing a recombinant gene
for the signaling molecule in prokaryotic or eukaryotic cells. In
certain embodiments, the signaling molecule is further purified to
produce a production batch. In certain embodiments, a production
batch of the signaling molecule is produced by purifying the
signaling molecule from cells that express the signaling molecule
from an endogenous gene. A production batch includes batches
suitable for experimental purposes as well as batches suitable for
large-scale production of pharmaceutical molecules. Thus, a
production batch may be of any size.
[0161] In certain embodiments, the test composition may be a
composition comprising a sample suspected of containing the
signaling molecule. Non-limiting exemplary samples include
mammalian tissues and mammalian samples, including, but not limited
to, blood, urine, serum, saliva, muscle, bone bone marrow, thymus,
spleen, kidney, liver, adrenal gland, brain, spinal fluid,
peritoneal fluid, and bronchial lavage. Non-limiting exemplary
samples also include, but are not limited to, plant tissues and
cells, non-mammalian eukaryotic tissues and cells, prokaryotic
cells, medium that has been in contact with cells, and any of the
above sources upon introduction of specific conditions, e.g.,
varying nutrients and/or stress levels. In certain embodiments, the
sample is from a nonbiological origin, for example from a chemical
synthesis. Samples may be manipulated as appropriate, e.g., by
extraction, solubilization, filtration, dilution, etc., in order to
form a test composition. One skilled in the art can form an
appropriate test composition from a particular sample.
[0162] The activity of the test composition comprising a signaling
molecule may, in certain embodiments, be compared to the activity
of a standard composition comprising the signaling molecule
subjected to the same assay. A standard composition comprising the
signaling molecule may, in certain embodiments, comprise a known
concentration of the signaling molecule (e.g., the standard
composition may comprise x mg/mL or y mmol/mL of the signaling
molecule). In certain embodiments, a standard composition
comprising the signaling molecule may comprise a known
concentration of signaling molecule activity (e.g., the standard
composition may comprise z units of activity/mL). In certain
embodiments, a standard composition comprising the signaling
molecule may comprise a known concentration of the signaling
molecule and a known concentration of signaling molecule activity
(e.g., the standard composition may comprise x mg/mL of signaling
molecule and z units of activity/mL of signaling molecule activity,
which means that the signaling molecule in the standard composition
has z units of activity per x mg of signaling molecule).
[0163] In certain embodiments, by comparing the activity of a test
composition comprising a signaling molecule to a standard
composition comprising the signaling molecule, one skilled in the
art may adjust the concentration of the signaling molecule in the
test composition or the concentration of signaling molecule
activity in the test composition as desired. In certain
embodiments, the concentration of the signaling molecule in the
test composition or the concentration of the signaling molecule
activity in the test composition is adjusted to be the same as that
of the standard composition.
[0164] In certain embodiments, the activity of the test composition
comprising a signaling molecule may be compared to the activity of
a blank composition that lacks the signaling molecule subjected to
the same assay. The activity of the test composition comprising the
signaling molecule may, in certain embodiments, be expressed as a
"fold-stimulation" over the activity of the blank composition.
Fold-stimulation may be calculated, in certain embodiments, by
dividing the signal of the test composition by the signal of the
blank composition in the same assay. In certain embodiments, a
background signal is subtracted from the signal of each test
composition before calculating the fold-stimulation. In various
embodiments, the background signal may be, e.g., the signal
produced by the assay reagents without any cells, the signal
produced by the signaling molecule-responsive cells lacking the
reporter nucleic acid construct, or any other appropriate
background measure.
[0165] In certain embodiments, a signaling molecule-responsive host
cell comprising a reporter nucleic acid construct may be used to
determine whether a test compound has the activity of a particular
signaling molecule. In certain embodiments, the signaling
molecule-responsive host cell comprising a reporter nucleic acid
construct is contacted with the test compound, in the absence of
the signaling molecule, under conditions in which the reporter
nucleic acid construct expresses a reporter protein in response to
the signaling molecule. If the test compound has the activity of
the signaling molecule, reporter protein will be produced at a
level that can be detected.
[0166] In certain embodiments, a test compound that has the
activity of a particular signaling molecule is referred to as an
"agonist." Agonists include any molecule that results in the
specific downstream effects that are characteristic of a particular
signaling molecule. Thus, as used herein, an agonist is any
molecule that, when contacted with a certain signaling
molecule-responsive host cell comprising a certain reporter nucleic
acid construct, results in expression of the reporter polypeptide.
An agonist need not function by the same mechanism as the signaling
molecule. Thus, as a non-limiting example, an agonist need not bind
the signaling molecule's cognate receptor in the same location or
manner as the signaling molecule, and indeed, the agonist need not
bind the receptor at all.
[0167] In certain embodiments, the activity of a test compound that
may have the activity of a particular signaling molecule is
compared to the activity of a standard composition comprising the
signaling molecule. One skilled in the art can select a test
compound that has the desired level of activity relative to a
standard composition.
[0168] In certain embodiments, the activity of a test compound that
may have the activity of a particular signaling molecule is
compared to the activity of a blank composition that lacks the
signaling molecule. In certain embodiments, the activity of the
test compound may be expressed as a fold-stimulation over the blank
composition, substantially as discussed above.
[0169] In certain embodiments, a library of test compounds may be
tested to select compounds having the activity of a particular
signaling molecule. In certain embodiments, the assays discussed
herein may be adapted by methods known in the art for
high-throughput screening of a library comprising a large number of
such test compounds.
[0170] In certain embodiments, a signaling molecule-responsive host
cell comprising a reporter nucleic acid construct may be used to
determine whether a test compound impacts the activity of a
signaling molecule. In certain embodiments, the signaling
molecule-responsive host cell comprising a reporter nucleic acid
construct is contacted with the signaling molecule and the test
compound under conditions in which the reporter nucleic acid
construct expresses a reporter protein in response to the signaling
molecule. In certain embodiments, the activity of the signaling
molecule alone is compared to the activity of the signaling
molecule in the presence of the test compound under the same assay
conditions. If the test compound impacts the activity of the
signaling molecule, the level of reporter protein produced will be
different from the level of reporter protein produced in the
presence of the signaling molecule alone.
[0171] In certain embodiments, a test compound that specifically
inhibits the activity of a signaling molecule is referred to as an
"inhibitor." Thus, an inhibitor includes any molecule that
specifically reduces the level of reporter protein expressed in
response to the signaling molecule. The inhibitor's mechanism of
action is not limited. Thus, an inhibitor may reduce the activity
of a signaling molecule by any mechanism, including, but not
limited to, preventing or reducing signaling molecule binding to
its cognate receptor, preventing or reducing phosphorylation of any
protein or proteins in the signaling pathway, and/or preventing or
reducing activated response element transcription factor binding to
the reporter nucleic acid construct.
[0172] In certain embodiments, a test compound may specifically
increase the activity of a signaling molecule. The mechanism of
such an increase is not limited. Thus, a test compound that
specifically increases the activity of a signaling molecule may
function by any mechanism, including, but not limited to, mimicking
the binding of the signaling molecule to its cognate receptor,
increasing and/or stabilizing the binding of the signaling molecule
to its cognate receptor, increasing the extent and/or rate of
phosphorylation of any protein or proteins in the signaling
pathway, and/or increasing the level and/or stability of activated
response element transcription factor binding to the reporter
nucleic acid construct.
[0173] In certain embodiments, a response element region may be
operably linked to a promoter, which is operably linked to a gene
of interest. A nucleic acid comprising the response element region
operably linked to a promoter, which is operably linked to a gene
of interest is referred to herein as an inducible nucleic acid
construct. In certain embodiments, incubation of a host cell
comprising an inducible nucleic acid construct with a signaling
molecule results in expression of the gene of interest. In that
manner, in certain embodiments, expression of the gene of interest
may be controlled by varying the concentration of signaling
molecule in contact with the host cell. In certain embodiments,
cells comprising the inducible nucleic acid construct may be grown
to a desired density in the absence of the signaling molecule, and
then signaling molecule may be added to induce expression of the
gene of interest. Such a system may be useful, in certain
embodiments, for producing a polypeptide product of a gene of
interest, where that polypeptide product reduces the growth and/or
is toxic to the host cells. Such a system may also be useful, in
certain embodiments, when the gene of interest is be activated,
e.g., at a certain time point, at a certain cell density, or after
certain other events have occurred.
[0174] Methods of producing proteins or polypeptides are known to
one of skill in the art. One example is the production of
erythropoietin as described in U.S. Pat. No. 5,441,868. One of
skill in the art would know how to produce proteins from bacterial,
mammalian systems in vivo, ex vivo, or in vitro.
EXAMPLES
Example 1
Making pGLGTPLAP
[0175] A double-stranded nucleic acid having the following nucleic
acid sequence was cloned into pBlueScript (Stratagene) cut with
Asp718+SacII to yield pBlue NS:
TABLE-US-00005 5' CGTCATTTCCAGGAAATCA CCGTCATTTCCAGGAAATCA 3' CAT
GGCAGTCCCGGTCCTTTAGT GGCAGTAAAGGTCCTTTAGT CCGTCATTTCCAG GAAATCA
CCGC 3' GGCAGTAAAGGTC CTTTAGT GG 5'
Both strands are shown, including the overhangs generated for
cloning. Bold indicates a response element repeat sequence. A
double-stranded nucleic acid having the following nucleic acid
sequence was cloned into pBlueScript cut with SacII+HindIII to
yield pBlue H/S:
TABLE-US-00006 5'
GGTCCCAGGTCCACTTCGCATATTAAGGTGACGCGTGTGGCCTCGAACACC A 3' 3' C
GCCAGGGTCCAGGTGAAGCGTATAATTCCACTGCGCACACCGGAGCTTGTGG TTCGA 5'
Both strands are shown. including the overhangs generated for
cloning. Underlining indicates a TK promoter sequence.
[0176] The Asp718-Sacll and SacII-HindIII fragments were released
from pBlue A/S and pBlue H/S, respectively, and were cloned into
Asp718+HindIII cut pGL3Basic (Promega) in a three-part ligation to
yield pGTbasic, which comprised the following sequence:
TABLE-US-00007 GTA CCGTCATTTCCAGGAAATCA CCGTCATTTCCAGGAAATCA
CCGTCATTTCCAGGAAATCA CCG
CGGTCCCAGGTCCACTTCGCATATTAAGGTGACGCGTGTGGCCTCGAACA CC AAGCT
(Only one strand is shown. Itallicized sequences indicate parts of
the restriction sites used for cloning. Bold indicates a response
element repeat sequence and underlining indicates a TK promoter
sequence).
[0177] Construct pGLGFP was made by ligating the 250 base-pair NotI
(filled in)-NcoI fragment from pGL3Basic into BglII cut (filled in)
pEGFP (Clontech).
[0178] The 120 base-pair Asp718-HindIII (1.times.GAS-TKpromoter)
fragment was released from pGTbasic (discussed above) and ligated
into Asp718-HindIII cut pGLGFP to yield pGLGTGFP.
[0179] PLAP-76-SEQSIG comprises a human placental alkaline
phosphatase (PLAP) cDNA with an artificially constructed
N-terminus, including a secretion signal sequence, and lacking the
C-terminal glycosylphosphatidyl inositol (GPI) anchor sequence.
Specifically, the PLAP sequence in PLAP-76-SEQSIG comprises the
following 5' nucleotide sequence, which includes the artificially
constructed N-terminus fused to nucleotides 102 to 1571 of the PLAP
sequence shown in Genbank #M13077:
TABLE-US-00008 5' T CTAGACTCGA CATGCTGGGG CCCTGCATGC TGCTGCTGCT
GCTGCTGCTG GGCCTGAGGC TACAGCTCTC CCTGGGCATC ATCGCGGCCG CAGGCATCAT
3'
Only one strand is shown. The XbaI sequence at the 5' end of the
region shown is underlined. The nucleotide sequence encoding the
artificially-constructed N-terminus, including a secretion signal
sequence, is in bold. Part of the native PLAP sequence beginning at
nucleotide 102 of Genbank #M13077 is shown in italics. At the 3'
end of the PLAP insert in PLAP-76-SEQSIG is the following
sequence:
TABLE-US-00009 5' GCGCACCCGG GGGCTAGCTA AGGTACC 3'
Only one strand is shown. The italicized portion is part of the
native PLAP sequence to nucleotide 1571 of Genbank #M13077. The
stop codon is shown in bold and the Asp718 site is underlined.
[0180] Blunt-ended 1.5 Kb XbaI-Asp718 fragment from PLAP-76-SEQSIG,
which includes the artificially constructed N-terminal signal
sequence, nucleotides 102-1571 of human PLAP (Genbank #M13077), and
the stop codon, was ligated into blunt-ended HindIII-NotI cut
pGLGTGFP to yield pGLGTPLAP. Self-annealed double stranded nucleic
acid 1596-13 (CGTACGGC) was ligated into SacII-cut pGTbasic to
create a BsiWI site and yield p1596-13/GTbasic comprising the
following sequence:
TABLE-US-00010 GTA CCGTCATTTCCAGGAAATCA CCGTCATTTCCAGGAAATCA
CCGTCATTTCCAGGAAATCA CCG ccgtacgg
CGGTCCCAGGTCCACTTCGCATATTAAGGTGACGCGTGTGGCCTCG AACACC AAGCT
(Only one strand is shown. Bold indicates a response element repeat
sequence, underlining indicates a TK promoter sequence, and the
lower case sequence indicates nucleotides added by nucleic acid
1596-13).
[0181] The Asp718-BsiWI fragment from p1596-13/GTbasic was released
and ligated into Asp718 cut pGLGTPLAP to generate a multi-GT-PLAP
mixture (3X response element repeat sequence; 6X response element
repeat sequence, 9X response element repeat sequence, 12X response
element repeat sequence, >12X response element repeat
sequence).
[0182] For example, a 9X Multi-GT-PLAP, comprises the following
sequence:
TABLE-US-00011 1 GCAAGTGCAGGTGCCAGAACATTTCTCTATCGATAG GTA
CCGTCATTTCCAGGAAATCA CCGTCATTTCCAGGAAATCA CCGTCATTTCCAGGAAATCA CCG
ccgta CCGTCATTTCCAGGAAATC A CCGTCATTTCCAGGAAATCA
CCGTCATTTCCAGGAAATCA CCG ccgta CCGTCATTTCCAGGAAATCA
CCGTCATTTCCAGGAAATCA CCGTC ATTTCCAGGAAATCA CCG
CGGTCCCAGGTCCACTTCGCATAT TAAGGTGACGCGTGTGGCCTCGAACACC AAGCT
CTAGACTCGACATGCTGGGGCCCTGCATG
Example 2
Testing with EPO
[0183] pGTPLAP DNAs with three (9X response element repeat
sequence) or four (12X response element repeat sequence) copies of
the response element triple repeat sequence were individually
purified and linearized with ApaL1 for transient transfection into
NIH-3T3 fibroblasts (3.times.10e5 cells/well) following standard
procedures using Superfect (Qiagen) as transfection reagent and
DMEM basal medium. The pGTPLAP constructs were transfected into
NIH-3T3 fibroblast cells alone or in various combinations with an
expression plasmid for the Epo Receptor and/or an expression
plasmid for STAT5b (Azam et al, EMBO J, 14(7), 1402-1411, 1995).
The expression plasmid for the Epo Receptor was an MSCV retroviral
expression vector into which human full length Epo Receptor had
been cloned. See Hawley et al., Gene Therapy, 1:136-138 (1994) for
the MSCV retroviral expression vecor and GenBank Accession No.
60459 for human Epo Receptor. Also, NIH-3T3 fibroblast cells were
transfected with only the expression plasmid for the Epo Receptor.
Also, NIH-3T3 fibroblast cells were transfected with only the
expression plasmid for STAT5b. Also, nontransfected NIH-3T3
fibroblast cells were used. Table 1 below shows the various
combinations that were tested. After a 2-3 hour incubation with the
DNA-transfection mix, cells were washed with PBS and placed in
fresh 3T3 growth medium (phenol red-free DMEM, 10% FBS, 1X
Glutamine).
[0184] After overnight recovery, medium was replaced with fresh 3T3
growth medium with or without addition of 19 Units/ml of
recombinant human erythropoietin (rHuEpo) and left overnight again.
Culture medium supernatants were collected and cleared of cells and
debris either by centrifugation at 15K rpm for 10 minutes (without
filtration) or by filtration (0.45 micron spin filter, 10 minutes,
15K rpm). Cleared supernatants were heated at 65.degree. C. for 1
hour and mixed with an equal volume of 2.times. phosphatase
reaction buffer containing 2M diethanolamine, 1 mM MgCl.sub.2, 20
mM homoarginine, 1 mg/ml BSA (pre-heated by itself for 1 hour at
65.degree. C. and then added), and 0.2 mM 4-methylumbelliferyl
phosphate dicyclohexylammonium trihydrate in water. Reactions were
allowed to proceed overnight at 37.degree. C. and production of
4-methylumbelliferyl as a measure of phosphatase activity was
measured at 360 nm/460 nm (excitation/emission wavelength). Results
are shown in Table 1 below.
TABLE-US-00012 TABLE 1 fold -EPO +EPO stimulati average - average -
(avg +EPO -filtration +filtration baseline.sup.1 -filtration
+filtration baseline avg -EP 1 9X-RS-pGTPLAP 30 24 12 30 26 13 1.0
2 9X-RS-pGTPLAP/EPOR 24 23 9 33 35 19 2.0 3 9X-RS- 69 62 51 169 154
147 2.9 pGTPLAP/EPOR/STAT5b 4 12X-RS-Pgtplap 34 34 19 47 46 32 1.7
5 12X-RS-pGTPLAP/EPOR 32 32 17 45 42 29 1.7 6 12X-RS- 110 102 91
200 183 177 2.0 pGTPLAP/EPOR/STAT5b 7 EPOR 15 16 16 14 8 STAT5b 17
16 14 14 9 nontransfected NIH3T3 13 14 17 17 .sup.1"average -
baseline" equals the average (-filtration and +filtration) in the
presence of a pGTPLAP less the approximate average of all samples
in the absence of a pGTPLAP. Thus, the baseline used for both +EPO
and -EPO was 15. RS = response element repeat sequence indicates
data missing or illegible when filed
Example 3
Testing with IL-3
[0185] pGTPLAP DNAs with increasing copy numbers of response
element triple repeat sequence were individually purified and
linearized with ApaL1 for electroporation (263-269 V/12.8-17.6
microF pulse; BTX Electro Cell Manipulator 600) into BaF3 cells
which express endogenous IL-3 receptors. Stable transfectants were
selected for the presence of the Neomycin resistance gene (present
in pGTPLAP) by a 2-week culture in standard culture medium (IMDM,
10% FetalClonell, 5.times.10e-5M beta-mercaptoethanol, 1X
Glutamine, 2.5 ng/ml rMuIL-3 (Biosource)) supplemented with G418
(750 microgram/ml).
[0186] To measure cytokine-induced PLAP expression, cells were
washed and re-plated in phenolred-free RPMI containing 0.2% BSA,
5.times.10e-5M beta-mercaptoethanol, 1X Glutamine at 10e6 cells/0.5
ml/well and incubated overnight at 37.degree. C. Also,
nontransfected BaF3 cells were used. One of every two wells per
construct was supplemented with 25 ng/ml recombinant murine
interleukin-3 (rMuIL-3) during the overnight incubation. Cell
viability was assessed by Trypan Blue exclusion and culture medium
supernatants were collected and cleared of cells and debris either
by centrifugation at 15K rpm for 10 minutes (without filtration) or
by filtration (0.45 micron spin filter, 10 minutes, 15K rpm).
Cleared supernatants were heated at 65.degree. C. for 1 hour and
mixed with an equal volume of 2.times. phosphatase reaction buffer
containing 2M diethanolamine, 1 mM MgCL2, 20 mM homoarginine, 1
mg/ml BSA (pre-heated by itself for 1 hour at 65.degree. C. and
then added), and 0.2 mM 4-methylumbelliferyl
[0187] phosphate dicyclohexylammonium trihydrate (4-MUP) in water.
Reactions were allowed to proceed overnight at 37.degree. C. and
production of 4-MU as a measure of phosphatase activity was
measured at 360 nM/460 nM (excitation/emission wavelength). The
results are shown in Table 2 below.
TABLE-US-00013 TABLE 2 fold -IL-3 +IL-3 stimulation average -
average - (avg +IL-3/ -filtration +Filtration baseline.sup.1
-filtration +Filtration baseline avg -IL-3) nontransfected 16 14 17
15 BaF3 cells 3X-RS- 35 33 20 85 82 70 3.5 pGTPLAP 6X-RS- 44 45 30
175 177 160 5.4 pGTPLAP 9X-RS- 53 54 40 276 257 250 6.2 pGTPLAP
12X-RS- 59 63 45 402 384 375 8.4 pGTPLAP Greater than 48 48 33 384
389 370 11.2 12X-RS- pGTPLAP .sup.1"average - baseline" equals the
average (-filtration and +filtration) in the presence of a pGTPLAP
less the approximate average (-filtration and +filtration) for all
untransfected BaF3 cell samples. Thus, the baseline used for both
+IL-3 and -IL-3 was 15. (The average baseline numbers in this table
are rounded.) RS = response element triple repeat sequence
Example 4
Making HuG-CSFR-Iuc Cell Line
[0188] To generate the reporter nucleic acid construct, a DNA
fragment containing the 9X response element repeat sequence and the
thymidine kinase promoter was removed from pGTPLAP by digesting
with KpnI and XbaI. After removal, a fragment with the following
sequence (the complementary strand will have both 5' and 3'
overhangs resulting from the digestion):
TABLE-US-00014 CGTCATTTCCAGGAAATCA CCGTCATTTCCAGGAAATCA
CCGTCATTTCCAGGAAATCA CCG CCGTA CCGTCATTTCCAGGAAATCA
CCGTCATTTCCAGGAAATCA CCGTCATTTCCAGGAAATCA CCGCCGTA
CCGTCATTTCCAGGAAATCA CCGTCATTTCCAGGAAATCA CCGTCATTTCCAGGAAATCA CCG
CGGTCCCAGGTCCACTTCGCATATTAAGGTGACGCGTGTGGCCTCGAACA CC AAGCT
was cloned into plasmid pGL3 basic (Promega) cut with KpnI and NheI
(XbaI and NheI have compatible ends) to produce pGL3 basic
containing a 9X response element repeat sequence and the TK
promoter.
[0189] pGL3 hygro was produced by cloning a hygromycin B resistance
gene into the BamHI site of the pGL3-promoter vector (Promega). A
DNA fragment containing the 9X response element repeat sequence and
TK promoter was released from the pGL basic3 vector by digestion
with KpnI and HindIII. The DNA fragment was then ligated into pGL3
hygro cut with KpnI and HindIII to produce the reporter nucleic
acid construct.
[0190] To generate the pool population of HuG-CSFR-luc cells, a
clonal population of 32D HuG-CSFR ck3 cells was used. This cell
line expresses the full-length human G-CSF receptor. The parental
cell line 32D cl3 is now available at ATCC (ATCC No. CRL-11346,
ATCC Name "32D clone 3"). The parental 32D cl3 cells were
transfected with the cDNA for the human GCSF receptor. The sequence
for human GCSF receptor is M59818.GB_PR1 (GenBank). The vector used
to express this cDNA is called pLJ, see Korman, Alan J., Frantz, J.
Daniel, Strominger, Jack L., and Mulligan, Richard C., PNAS,
84:2150-2154 (1987). These cells were grown in RPMI 1640,
supplemented with 10% Fetal Bovine Serum, 10 ng/mL murine IL-3
(mIL-3). A commercial source of mIL-3 is available from
Biosource.
[0191] To transfect the 32D HuG-CSFR ck3 cells with the reporter
nucleic acid construct, 30 .mu.g of reporter nucleic acid construct
was electroporated into 1.times.10.sup.7 32D HuG-CSFR ck3 cells in
a 4 mm cuvette at capacitance 500 .mu.F, 300V using an Electro Cell
Manipulator EDM 600 (BTX). Cells were incubated in nonselective
medium overnight, then transferred into selective medium (RPMI
1640, 10% Fetal Bovine Serum, 10 ng/mL mIL-3, and 900 .mu.g/mL
Hygromycin B. Cells were plated at a density of approximately 4.1
E5/well/mL in each well of a 24 well plate and left undisturbed for
2 weeks. Actively growing colonies were pooled and divided into the
wells of a six-well dish and then passaged in selective medium for
two weeks.
[0192] Single cell clones were established by limiting dilution in
selective medium and clonal populations were individually tested
for G-CSF responsiveness. Specifically, clonal populations were
incubated for four hours with 0.8 ng/mL and 5.0 ng/mL GCSF. Best
responders were identified based on luminescence output-fold
stimulation over background (assay medium alone). One such
population of cells, which showed a three-fold stimulation over
background, was chosen and designated as HuG-CSFR-luc (clone 40)
cells. This is a cloned, stably transfected cell line.
Example 5
[0193] Making UT7/9X Cell Line
[0194] To generate the reporter gene construct, a DNA fragment
containing the 9X response element repeat sequence was removed from
pGTPLAP by digestion with KpnI and SacII. The DNA fragment had the
sequence (both the strand shown and the complementary strand will
have 3' overhangs resulting from the digestion):
TABLE-US-00015 CGTCATTTCCAGGAAATCA CCGTCATTTCCAGGAAATCA
CCGTCATTTCCAGGAAATCA CCG CCGTA CCGTCATTTCCAGGAAATCA
CCGTCATTTCCAGGAAATCA CCGTCATTTCCAGGAAATCA CCGCCGTA
CCGTCATTTCCAGGAAATCA CCGTCATTTCCAGGAAATCA CCGTCATTTCCAGGAAATCA
CCGC.
[0195] A linker comprising SacII, NheI, SmaI, XhoI, and BglII sites
was synthesized. A three-way ligation reaction was performed,
comprised of the linker, the fragment containing the 9X response
element repeat sequence, and pGL3 hygro that was cut with KpnI and
BglII. This reaction served to ligate the linker and the fragment
containing the 9X response element repeat sequence into the pGL3
hygro. pGL3 hygro, which contains the SV40 promoter, is described
in Example 4 above. The resulting reporter nucleic acid construct
was named pGL3 hygro 9X only #1.
[0196] To generate the pool population of UT7/9X cells,
1.times.10.sup.7 UT7/EPO cells (Komatsu, N. et al. (1993) Blood 82:
456-464) grown in IMDM supplemented with 10% Fetal Bovine Serum
(heat inactivated) and 1 U/mL of rHuEPO were transfected by
electroporation with 30 pg of pGL3 hygro 9X only #1 in a 4 mm
cuvette at capacitance 500 .mu.F, 300V using an Electro Cell
Manipulator ECM 600 (BTX). Cells were incubated in nonselective
medium overnight, then passaged into selection medium (IMDM, 10%
Fetal Bovine Serum, 1 U/mL rHuEPO, and 500 .mu.g/mL Hygromycin B).
Cells were plated and left undisturbed for 2 weeks. Actively
growing colonies were then pooled and passaged into plates. Single
cell clones were established by limiting dilutions. Clonal
populations were individually tested for EPO responsiveness.
Specifically, clonal populations were incubated with three
different concentrations of rHuEPO (0.1, 1, and 3 U/mL). In the
initial evaluation, best responders were selected based on a
.gtoreq.4 fold luminescence output fold stimulation over background
(assay medium alone). For the final selection of the clonal cell
line, a full dose response curve was performed using Aranesp.TM.
(range 200-0.01 ng/mL).
[0197] One such population of cells was chosen and designated as
UT7/9X#6 cells. UT7/9X#6 was selected based on demonstrating the
highest fold stimulation over the linear range of sensitivity of
Aranesp.TM. (5 fold) and the lowest background. This is a cloned,
stably transfected cell line.
Example 6
Determining In Vitro Potency of Recombinant Human Erythropoietin
(rHuEPO)
[0198] Wash UT7/9X cells with PBS twice. Resuspend cells in Assay
Medium (247.5 mL RPMI 1640 1X liquid with GlutaMAX.TM. and HEPES
buffer, with phenol red, 247.5 mL RPMI 1640 1X liquid without
phenol red, 5 mL Fetal Bovine Serum, filter through a 0.22 .mu.M
filter unit) to a concentration of approximately 4.0E+05 cells/mL
and transfer to a horizontally positioned flask in a humidified
incubator. Incubate at 37.+-.2.degree. C. and 5.+-.1% for 17-24
hours. Following this incubation, determine cell concentration and
percent cell viability. Viability should be 75%. In a 50 mL conical
tube, prepare a cell suspension from this cell preparation in Assay
Medium to a final concentration of 2E+05 cells/mL. Mix well.
[0199] Dilute recombinant human Epo (rHuEPO) standard to
approximately 40 ng/mL (4.8 U/mL) in Assay Medium (final
concentration in wells will be 20 ng/mL, 2.4 U/mL). Make 9 serial
dilutions (1:2 is suggested) in Assay Medium to create a 10 point
dose response curve. It is suggested to perform replicates of three
for each dilution tested.
[0200] Add 25 .mu.L of UT7/9XGAS cells that are prepared as
described in the first paragraph of Example 6 above to wells
containing either 25 .mu.L of standard or test sample. Wells to
determine background contain 25 .mu.L of UT7/9XGAS cells with 25
.mu.L of Assay Media. Cells are mixed frequently in reagent
reservoir to ensure uniformity when adding to assay plates. Final
cell concentration is approximately 5,000 cells/well.
[0201] Media Only wells are also created that contained only 50
.mu.L of Assay Media, containing neither rHuEPO nor cells. Plates
are shaken and then incubated for 4.+-.0.5 hours in the humidified
incubator at 37.+-.2.degree. C. and 5.+-.1% CO.sub.2. Plates are
removed and are allowed to come to room temperature without the lid
for a minimum of ten minutes, not to exceed twenty minutes.
[0202] Steady-Glo.TM. Luciferase Assay System (Promega #E2520) is
used in accordance with instructions. Add 50 .mu.L of
Steady-Glo.TM. to each well of assay plates, including Media Only
wells. Plates are covered to minimize light exposure. Plates are
shaken on plate shaker for a minimum of 5 minutes. Plates are then
incubated at room temperature for 10 minutes to 2 hours.
Alternatively, the plates may be left on the shaker for this
incubation period.
[0203] Plates are read in a Luminometer TopCount NXT Microplate
Scintillation and Luminescence Counter (Packard/Perkin Elmer).
Allow the plates to adapt in the dark for at least 1 minute before
reading. Read luminescence for a minimum of 1 second per well.
Import luminescence values into Excel or similar software package.
Plot relative luminescence units versus log dose concentration.
Calculate effective concentration 50 (EC.sub.50) for standard and
test samples.
[0204] Other embodiments of the invention will be apparent to those
skilled in the art from consideration of the specification and
practice of the invention disclosed herein.
Sequence CWU 1
1
41120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1gtcatttcca ggaaatcacc 20260DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 2gtcatttcca ggaaatcacc gtcatttcca ggaaatcacc
gtcatttcca ggaaatcacc 603143DNAArtificial SequenceDescription of
Artificial Sequence Synthetic nucleotide construct 3gtcatttcca
ggaaatcacc gtcatttcca ggaaatcacc gtcatttcca ggaaatcacc 60nnnnnnnnnn
nnnnnnnnnn nnngtcattt ccaggaaatc accgtcattt ccaggaaatc
120accgtcattt ccaggaaatc acc 1434226DNAArtificial
SequenceDescription of Artificial Sequence Synthetic nucleotide
construct 4gtcatttcca ggaaatcacc gtcatttcca ggaaatcacc gtcatttcca
ggaaatcacc 60nnnnnnnnnn nnnnnnnnnn nnngtcattt ccaggaaatc accgtcattt
ccaggaaatc 120accgtcattt ccaggaaatc accnnnnnnn nnnnnnnnnn
nnnnnngtca tttccaggaa 180atcaccgtca tttccaggaa atcaccgtca
tttccaggaa atcacc 2265309DNAArtificial SequenceDescription of
Artificial Sequence Synthetic nucleotide construct 5gtcatttcca
ggaaatcacc gtcatttcca ggaaatcacc gtcatttcca ggaaatcacc 60nnnnnnnnnn
nnnnnnnnnn nnngtcattt ccaggaaatc accgtcattt ccaggaaatc
120accgtcattt ccaggaaatc accnnnnnnn nnnnnnnnnn nnnnnngtca
tttccaggaa 180atcaccgtca tttccaggaa atcaccgtca tttccaggaa
atcaccnnnn nnnnnnnnnn 240nnnnnnnnng tcatttccag gaaatcaccg
tcatttccag gaaatcaccg tcatttccag 300gaaatcacc 3096168DNAArtificial
SequenceDescription of Artificial Sequence Synthetic nucleotide
construct 6gtcatttcca ggaaatcacc gtcatttcca ggaaatcacc gtcatttcca
ggaaatcacc 60nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnngt
catttccagg 120aaatcaccgt catttccagg aaatcaccgt catttccagg aaatcacc
1687276DNAArtificial SequenceDescription of Artificial Sequence
Synthetic nucleotide construct 7gtcatttcca ggaaatcacc gtcatttcca
ggaaatcacc gtcatttcca ggaaatcacc 60nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn
nnnnnnnnnn nnnnnnnngt catttccagg 120aaatcaccgt catttccagg
aaatcaccgt catttccagg aaatcaccnn nnnnnnnnnn 180nnnnnnnnnn
nnnnnnnnnn nnnnnnnnnn nnnnnngtca tttccaggaa atcaccgtca
240tttccaggaa atcaccgtca tttccaggaa atcacc 2768384DNAArtificial
SequenceDescription of Artificial Sequence Synthetic nucleotide
construct 8gtcatttcca ggaaatcacc gtcatttcca ggaaatcacc gtcatttcca
ggaaatcacc 60nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnngt
catttccagg 120aaatcaccgt catttccagg aaatcaccgt catttccagg
aaatcaccnn nnnnnnnnnn 180nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn
nnnnnngtca tttccaggaa atcaccgtca 240tttccaggaa atcaccgtca
tttccaggaa atcaccnnnn nnnnnnnnnn nnnnnnnnnn 300nnnnnnnnnn
nnnnnnnnnn nnnngtcatt tccaggaaat caccgtcatt tccaggaaat
360caccgtcatt tccaggaaat cacc 3849240DNAArtificial
SequenceDescription of Artificial Sequence Synthetic nucleotide
construct 9gtcatttcca ggaaatcacc gtcatttcca ggaaatcacc gtcatttcca
ggaaatcacc 60gtcatttcca ggaaatcacc gtcatttcca ggaaatcacc gtcatttcca
ggaaatcacc 120gtcatttcca ggaaatcacc gtcatttcca ggaaatcacc
gtcatttcca ggaaatcacc 180gtcatttcca ggaaatcacc gtcatttcca
ggaaatcacc gtcatttcca ggaaatcacc 24010264DNAArtificial
SequenceDescription of Artificial Sequence Synthetic nucleotide
construct 10gtcatttcca ggaaatcacc gtcatttcca ggaaatcacc gtcatttcca
ggaaatcacc 60nnnnnnnngt catttccagg aaatcaccgt catttccagg aaatcaccgt
catttccagg 120aaatcaccnn nnnnnngtca tttccaggaa atcaccgtca
tttccaggaa atcaccgtca 180tttccaggaa atcaccnnnn nnnngtcatt
tccaggaaat caccgtcatt tccaggaaat 240caccgtcatt tccaggaaat cacc
26411264DNAArtificial SequenceDescription of Artificial Sequence
Synthetic nucleotide construct 11gtcatttcca ggaaatcacc gtcatttcca
ggaaatcacc gtcatttcca ggaaatcacc 60gccgtaccgt catttccagg aaatcaccgt
catttccagg aaatcaccgt catttccagg 120aaatcaccgc cgtaccgtca
tttccaggaa atcaccgtca tttccaggaa atcaccgtca 180tttccaggaa
atcaccgccg taccgtcatt tccaggaaat caccgtcatt tccaggaaat
240caccgtcatt tccaggaaat cacc 26412274DNAArtificial
SequenceDescription of Artificial Sequence Synthetic nucleotide
construct 12gtcatttcca ggaaatcacc gtcatttcca ggaaatcacc gtcatttcca
ggaaatcacc 60nnnnnnnngt catttccagg aaatcaccgt catttccagg aaatcaccgt
catttccagg 120aaatcaccnn nnnnnnnngt catttccagg aaatcaccgt
catttccagg aaatcaccgt 180catttccagg aaatcaccnn nnnnnnnnnn
nnnngtcatt tccaggaaat caccgtcatt 240tccaggaaat caccgtcatt
tccaggaaat cacc 27413274DNAArtificial SequenceDescription of
Artificial Sequence Synthetic nucleotide construct 13gtcatttcca
ggaaatcacc gtcatttcca ggaaatcacc gtcatttcca ggaaatcacc 60gccgtaccgt
catttccagg aaatcaccgt catttccagg aaatcaccgt catttccagg
120aaatcaccta ccggtctggt catttccagg aaatcaccgt catttccagg
aaatcaccgt 180catttccagg aaatcaccac cggcctagtg cgtcgtcatt
tccaggaaat caccgtcatt 240tccaggaaat caccgtcatt tccaggaaat cacc
2741410DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 14taccggtctg 101516DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 15accggcctag tgcgtc 1616180DNAArtificial
SequenceDescription of Artificial Sequence Synthetic nucleotide
construct 16gtcatttcca ggaaatcacc gtcatttcca ggaaatcacc gtcatttcca
ggaaatcacc 60gtcatttcca ggaaatcacc gtcatttcca ggaaatcacc gtcatttcca
ggaaatcacc 120gtcatttcca ggaaatcacc gtcatttcca ggaaatcacc
gtcatttcca ggaaatcacc 18017196DNAArtificial SequenceDescription of
Artificial Sequence Synthetic nucleotide construct 17gtcatttcca
ggaaatcacc gtcatttcca ggaaatcacc gtcatttcca ggaaatcacc 60nnnnnnnngt
catttccagg aaatcaccgt catttccagg aaatcaccgt catttccagg
120aaatcaccnn nnnnnngtca tttccaggaa atcaccgtca tttccaggaa
atcaccgtca 180tttccaggaa atcacc 19618196DNAArtificial
SequenceDescription of Artificial Sequence Synthetic nucleotide
construct 18gtcatttcca ggaaatcacc gtcatttcca ggaaatcacc gtcatttcca
ggaaatcacc 60gccgtaccgt catttccagg aaatcaccgt catttccagg aaatcaccgt
catttccagg 120aaatcaccgc cgtaccgtca tttccaggaa atcaccgtca
tttccaggaa atcaccgtca 180tttccaggaa atcacc 19619198DNAArtificial
SequenceDescription of Artificial Sequence Synthetic nucleotide
construct 19gtcatttcca ggaaatcacc gtcatttcca ggaaatcacc gtcatttcca
ggaaatcacc 60nnnnnnnngt catttccagg aaatcaccgt catttccagg aaatcaccgt
catttccagg 120aaatcaccnn nnnnnnnngt catttccagg aaatcaccgt
catttccagg aaatcaccgt 180catttccagg aaatcacc 19820198DNAArtificial
SequenceDescription of Artificial Sequence Synthetic nucleotide
construct 20gtcatttcca ggaaatcacc gtcatttcca ggaaatcacc gtcatttcca
ggaaatcacc 60gccgtaccgt catttccagg aaatcaccgt catttccagg aaatcaccgt
catttccagg 120aaatcaccta ccggtctggt catttccagg aaatcaccgt
catttccagg aaatcaccgt 180catttccagg aaatcacc 1982120DNAArtificial
SequenceDescription of Artificial Sequence Synthetic nucleotide
construct 21nnnnnttcch ggaannnnnn 202220DNAArtificial
SequenceDescription of Artificial Sequence Synthetic nucleotide
construct 22nnnntttcch ggaaannnnn 202320DNAArtificial
SequenceDescription of Artificial Sequence Synthetic nucleotide
construct 23nnnntttccc cgaaannnnn 202420DNAArtificial
SequenceDescription of Artificial Sequence Synthetic nucleotide
construct 24nnnnattctc agaaannnnn 202520DNAArtificial
SequenceDescription of Artificial Sequence Synthetic nucleotide
construct 25nnnntttcta ggaatnnnnn 202660DNAArtificial
SequenceDescription of Artificial Sequence Synthetic nucleotide
construct 26nnnnnttcch ggaannnnnn nnnnnttcch ggaannnnnn nnnnnttcch
ggaannnnnn 602760DNAArtificial SequenceDescription of Artificial
Sequence Synthetic nucleotide construct 27nnnntttcch ggaaannnnn
nnnntttcch ggaaannnnn nnnntttcch ggaaannnnn 602860DNAArtificial
SequenceDescription of Artificial Sequence Synthetic nucleotide
construct 28nnnntttccc cgaaannnnn nnnntttccc cgaaannnnn nnnntttccc
cgaaannnnn 602960DNAArtificial SequenceDescription of Artificial
Sequence Synthetic nucleotide construct 29nnnnattctc agaaannnnn
nnnnattctc agaaannnnn nnnnattctc agaaannnnn 603060DNAArtificial
SequenceDescription of Artificial Sequence Synthetic nucleotide
construct 30nnnntttcta ggaatnnnnn nnnntttcta ggaatnnnnn nnnntttcta
ggaatnnnnn 603163DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 31cgtcatttcc aggaaatcac
cgtcatttcc aggaaatcac cgtcatttcc aggaaatcac 60cgc
633265DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 32ggtgatttcc tggaaatgac ggtgatttcc
tggaaatgac ggtgatttcc tggccctgac 60ggtac 653352DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 33ggtcccaggt ccacttcgca tattaaggtg acgcgtgtgg
cctcgaacac ca 523458DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 34agcttggtgt tcgaggccac
acgcgtcacc ttaatatgcg aagtggacct gggaccgc 5835123DNAArtificial
SequenceDescription of Artificial Sequence Synthetic nucleotide
construct 35gtaccgtcat ttccaggaaa tcaccgtcat ttccaggaaa tcaccgtcat
ttccaggaaa 60tcaccgcggt cccaggtcca cttcgcatat taaggtgacg cgtgtggcct
cgaacaccaa 120gct 12336101DNAArtificial SequenceDescription of
Artificial Sequence Synthetic nucleotide construct 36tctagactcg
acatgctggg gccctgcatg ctgctgctgc tgctgctgct gggcctgagg 60ctacagctct
ccctgggcat catcgcggcc gcaggcatca t 1013727DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 37gcgcacccgg gggctagcta aggtacc
2738131DNAArtificial SequenceDescription of Artificial Sequence
Synthetic nucleotide construct 38gtaccgtcat ttccaggaaa tcaccgtcat
ttccaggaaa tcaccgtcat ttccaggaaa 60tcaccgccgt acggcggtcc caggtccact
tcgcatatta aggtgacgcg tgtggcctcg 120aacaccaagc t
13139324DNAArtificial SequenceDescription of Artificial Sequence
Synthetic nucleotide construct 39gcaagtgcag gtgccagaac atttctctat
cgataggtac cgtcatttcc aggaaatcac 60cgtcatttcc aggaaatcac cgtcatttcc
aggaaatcac cgccgtaccg tcatttccag 120gaaatcaccg tcatttccag
gaaatcaccg tcatttccag gaaatcaccg ccgtaccgtc 180atttccagga
aatcaccgtc atttccagga aatcaccgtc atttccagga aatcaccgcg
240gtcccaggtc cacttcgcat attaaggtga cgcgtgtggc ctcgaacacc
aagctctaga 300ctcgacatgc tggggccctg catg 32440255DNAArtificial
SequenceDescription of Artificial Sequence Synthetic nucleotide
construct 40cgtcatttcc aggaaatcac cgtcatttcc aggaaatcac cgtcatttcc
aggaaatcac 60cgccgtaccg tcatttccag gaaatcaccg tcatttccag gaaatcaccg
tcatttccag 120gaaatcaccg ccgtaccgtc atttccagga aatcaccgtc
atttccagga aatcaccgtc 180atttccagga aatcaccgcg gtcccaggtc
cacttcgcat attaaggtga cgcgtgtggc 240ctcgaacacc aagct
25541199DNAArtificial SequenceDescription of Artificial Sequence
Synthetic nucleotide construct 41cgtcatttcc aggaaatcac cgtcatttcc
aggaaatcac cgtcatttcc aggaaatcac 60cgccgtaccg tcatttccag gaaatcaccg
tcatttccag gaaatcaccg tcatttccag 120gaaatcaccg ccgtaccgtc
atttccagga aatcaccgtc atttccagga aatcaccgtc 180atttccagga aatcaccgc
199
* * * * *