U.S. patent application number 12/910265 was filed with the patent office on 2011-06-30 for methods for chemically synthesizing immunoglobulin chimeric proteins.
Invention is credited to Adam R. MEZO, Robert T. Peters.
Application Number | 20110159540 12/910265 |
Document ID | / |
Family ID | 33458764 |
Filed Date | 2011-06-30 |
United States Patent
Application |
20110159540 |
Kind Code |
A1 |
MEZO; Adam R. ; et
al. |
June 30, 2011 |
Methods for Chemically Synthesizing Immunoglobulin Chimeric
Proteins
Abstract
The invention provides methods of chemically synthesizing
chimeric proteins comprising at least a portion of an
immunoglobulin constant region and a biologically active
molecule.
Inventors: |
MEZO; Adam R.; (Waltham,
MA) ; Peters; Robert T.; (West Roxbury, MA) |
Family ID: |
33458764 |
Appl. No.: |
12/910265 |
Filed: |
October 22, 2010 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12100183 |
Apr 9, 2008 |
7820162 |
|
|
12910265 |
|
|
|
|
10842054 |
May 6, 2004 |
7381408 |
|
|
12100183 |
|
|
|
|
60469600 |
May 6, 2003 |
|
|
|
60487964 |
Jul 17, 2003 |
|
|
|
60539207 |
Jan 26, 2004 |
|
|
|
Current U.S.
Class: |
435/69.6 ;
530/351; 530/358; 530/387.3; 530/391.9 |
Current CPC
Class: |
A61K 47/6803 20170801;
C07K 14/755 20130101; C12Y 304/21021 20130101; A61K 47/6835
20170801; A61P 31/00 20180101; A61K 47/6811 20170801; A61P 31/12
20180101; C12N 9/6437 20130101; C12N 9/644 20130101; C07K 14/70503
20130101; C12N 9/647 20130101; C07K 2319/30 20130101; A61P 7/00
20180101; A61P 31/18 20180101; C07K 14/61 20130101; A61K 47/60
20170801; C07K 16/00 20130101; A61P 43/00 20180101; A61K 47/68
20170801; C07K 14/555 20130101; C07K 2317/52 20130101; C12Y
304/21022 20130101; C07K 14/56 20130101; C07K 14/565 20130101; C07K
2319/00 20130101; A61K 47/642 20170801; C12N 9/96 20130101; A61P
7/06 20180101; C07K 14/59 20130101; A61P 9/00 20180101; A61P 7/04
20180101; A61K 38/00 20130101; C07K 14/745 20130101; A61K 47/6813
20170801; C07K 14/475 20130101; C07K 14/505 20130101 |
Class at
Publication: |
435/69.6 ;
530/387.3; 530/391.9; 530/358; 530/351 |
International
Class: |
C12P 21/00 20060101
C12P021/00; C07K 19/00 20060101 C07K019/00; C07K 16/00 20060101
C07K016/00 |
Claims
1. A method of producing a chimeric protein comprising combining at
least one biologically active molecule and at least a portion of an
immunoglobulin constant region, wherein a) the portion of an
immunoglobulin constant region comprises an N terminus cysteine and
b) the biologically active molecule comprises a functional group
capable of reacting with an N terminus cysteine to form a bond.
2. The method of claim 1, wherein the chimeric protein is chosen
from a dimer and a monomer-dimer hybrid.
3. The method of claim 2, wherein the monomer-dimer hybrid is a
dimerically linked monomer-dimer hybrid.
4. The method of claim 1, wherein the at least one biologically
active molecule is chosen from a polypeptide, a nucleic acid
molecule, a small organic molecule, a small inorganic molecule.
5. (canceled)
6. (canceled)
7. The method of claim 1, wherein the functional group is
thioester.
8. (canceled)
9. The method of claim 1, wherein the functional group is an
aldehyde.
10. The method of claim 1, wherein both the biologically active
molecule and the portion of an immunoglobulin are produced
recombinantly.
11. The method of claim 1, wherein at least one of the biologically
active molecule and the portion of an immunoglobulin is produced by
chemical synthesis.
12. The method of claim 1, wherein the portion of an immunoglobulin
is an FcRn binding partner.
13. The method of claim 12, the FcRn binding partner is an Fc or a
fragment thereof.
14. (canceled)
15. (canceled)
16. (canceled)
17. The method of claim 1, wherein the biologically active molecule
is chosen from EPO, interferon, a viral fusion inhibitor, and a
clotting factor.
18. A method of synthesizing a chimeric protein comprising a)
recombinantly expressing a fusion protein comprising at least a
portion of an immunoglobulin constant region and a splicing protein
capable of forming a C terminus thioester on the portion of an
immunoglobulin constant region; b) adding a thiol cofactor to the
fusion protein of a); c) adding at least one biologically active
molecule having an N terminal cysteine, thereby synthesizing the
chimeric protein.
19. The method of claim 18, wherein the splicing protein is
intein.
20. The method of claim 18, wherein the thiol cofactor is
MESNA.
21. The method of claim 18, wherein the chimeric protein is chosen
from a dimer and a monomer-dimer hybrid.
22. The method of claim 21, wherein the monomer-dimer hybrid is a
dimerically linked monomer-dimer hybrid.
23. The method of claim 18, wherein the at least one biologically
active molecule is chosen from a polypeptide, a nucleic acid
molecule, a small organic molecule, a small inorganic molecule.
24. (canceled)
25. (canceled)
26. The method of claim 18, wherein both the biologically active
molecule and the portion of an immunoglobulin are produced
recombinantly.
27. The method of claim 18, wherein at least one of the
biologically active molecule and the portion of an immunoglobulin
is produced by chemical synthesis.
28. The method of claim 18, wherein the portion of an
immunoglobulin is an FcRn binding partner.
29. The method of claim 28, the FcRn binding partner is an Fc or a
fragment thereof.
30. (canceled)
31. (canceled)
32. (canceled)
33. (canceled)
34. The method of claim 18, wherein the biologically active
molecule is chosen from EPO, interferon, a viral fusion inhibitor,
and a clotting factor.
Description
DESCRIPTION OF THE INVENTION
[0001] This application claims priority to U.S. Provisional
Application No. 60/469,600 filed May 6, 2003; U.S. Provisional
Application No. 60/487,964 filed Jul. 17, 2003, and U.S.
Provisional Application No. 60/539,207 filed Jan. 26, 2004, all of
which are incorporated by reference in their entirety.
FIELD OF THE INVENTION
[0002] The invention relates to the field of chimeric proteins,
e.g., proteins comprising at least a portion of an immunoglobulin
constant region and a biologically active molecule. In certain
specific embodiments, the invention relates to methods of
chemically synthesizing chimeric proteins comprising at least a
portion of an immunoglobulin constant region and a biologically
active molecule.
BACKGROUND OF THE INVENTION
[0003] Chimeric proteins, e.g., proteins comprising biologically
active molecules and at least a portion of an immunoglobulin
constant region, possess a number of desirable attributes. These
include stability, which results in longer in vivo half life, ease
of purification and ease of administration to a subject. The
expression of chimeric proteins comprised of immunoglobulin
constant regions linked to a protein of interest, or fragment
thereof, has been described (see e.g. U.S. Pat. Nos. 5,480,981 and
5,808,029; Gascoigne et al. 1987, Proc. Natl. Acad. Sci. USA
84:2936; Capon et al. 1989, Nature 337:525; Traunecker et al. 1989,
Nature 339:68; Zettmeissl et al. 1990, DNA Cell Biol. USA 9:347;
Byrn et al. 1990, Nature 344:667; Watson et al. 1990, J. Cell.
Biol. 110:2221; Watson et al. 1991, Nature 349:164; Aruffo et al.
1990, Cell 61:1303; Linsley et al. 1991, J. Exp. Med. 173:721;
Linsley et al. 1991, J. Exp. Med. 174:561; Stamenkovic et al.,
1991, Cell 66:1133; Ashkenazi et al. 1991, Proc. Natl. Acad. Sci.
USA 88:10535; Lesslauer et al. 1991, Eur. J. Immunol. 27:2883;
Peppel et al. 1991, J. Exp. Med. 174:1483; Bennett et al. 1991, J.
Biol. Chem. 266:23060; Kurschner et al. 1992, J. Biol. Chem.
267:9354; Chalupny et al. 1992, Proc. Natl. Acad. Sci. USA
89:10360; Ridgway and Gorman, 1991, J. Cell. Biol. 115, Abstract
No. 1448; Zheng et al. 1995, J. Immun. 154:5590). These proteins
were all produced using recombinant technology (see, e.g., Sambrook
et al. Molecular Cloning: A Laboratory Manual, 2 ed., Cold Spring
Harbor Laboratory Press (1989); Ausubel et al. 1989, Current
Protocols in Molecular Biology, Greene Publishing Associates and
Wiley Interscience, N.Y.sub.:).
[0004] Recombinant technology provides a fast and relatively
inexpensive way to produce large quantities of chimeric proteins,
however the technology is not without its limitations. For example
large multi-domain proteins can be difficult to express
recombinantly. Recombinant expression of chimeric proteins often
results in a heterogenous product requiring extensive purification.
Some chimeric proteins may be toxic to cells making their
expression, difficult, if not impossible. Moreover, recombinantly
expressed proteins can only be comprised of the naturally occurring
20 amino acids. Thus, only L-configuration amino acids are possible
using recombinant methods. Expressing chimeric proteins comprised
of non-naturally occurring amino acids, provides a way to generate
analogs useful in studying protein function and inhibiting
undesirable metabolic pathways. Alternatively, analogs comprising
non-naturally occurring amino acids may be used in some cases to
enhance the activity of desirable metabolic pathways. Lastly,
chimeric proteins comprising both amino acids and another
biologically active molecules, e.g., nucleic acids, small
molecules, are impossible to express using recombinant technology
alone.
[0005] Many of the limitations described above may be overcome
using chemical synthesis alone or a combination of recombinant
techniques and chemical synthesis. A number of traditional
techniques for chemically synthesizing proteins, such as solid
phase synthesis are known in the art, see, e.g., Merrifield, 1973,
Chemical Polypeptides, (Katsoyannis and Panayotis eds.) pp. 335-61;
Merrifield 1963, J. Am. Chem. Soc. 85:2149; Davis et al. 1985,
Biochem. Intl. 10:394; Finn et al. 1976, The Proteins (3d ed.)
2:105; Erikson et al. 1976, The Proteins (3d ed.) 2:257; U.S. Pat.
No. 3,941,763.
[0006] Recent improvements in the chemical synthesis of proteins
include the advent of native chemical ligation. As initially
described, native ligation provides for the rapid synthesis of
large polypeptides with a natural peptide backbone via the native
chemical ligation of two or more unprotected peptide segments. In
native ligation none of the reactive functionalities on the peptide
segments need to be temporarily masked by a protecting group.
Native ligation also allows for the solid phase sequential chemical
ligation of peptide segments in an N-terminus to C-terminus
direction, with the first solid phase-bound unprotected peptide
segment bearing a C-terminal alpha-thioester that reacts with
another unprotected peptide segment containing an N-terminal
cysteine. Native chemical ligation also permits the solid-phase
ligation in the C- to N-terminus direction, with temporary
protection of N-terminal cysteine residues on an incoming (second)
peptide segment (see, e.g., U.S. Pat. No. 6,326,468; WO 02/18417).
Native ligation may also be combined with recombinant technology
using intein linked to a chitin binding domain (Muir et al., 1998,
Proc. Natl. Acad. Sci. USA, 95:6705).
[0007] Because chimeric proteins comprised of a biologically active
molecule and at least a portion of an immunoglobulin constant
region possess the desirable attributes described above, there
remains a continual need for methods of synthesizing these chimeric
proteins that is rapid and offers greater flexibility in the types
of chimeric proteins produced. These needs, at least, are satisfied
by certain embodiments of the invention.
SUMMARY OF THE INVENTION
[0008] The invention provides a method of chemically synthesizing
chimeric proteins comprising combining at least one biologically
active molecule and a portion of an immunoglobulin constant region
such that a bond forms between the biologically active molecule and
the portion of an immunoglobulin constant region where the
biologically active molecule comprises a first functional group or
moiety and the portion of an immunoglobulin constant region
comprises a second functional group or moiety, and where the first
and second functional group or moiety are capable of reacting with
each other to form a chemical bond. In certain embodiments, the
invention provides a method of chemically synthesizing chimeric
proteins by performing native ligation (U.S. Pat. No. 6,184,344)
such that a bond forms between at least one biologically active
molecule and a portion of an immunoglobulin constant region.
[0009] In certain embodiments, the invention provides a method of
synthesizing chimeric proteins comprising combining at least one
biologically active molecule and at least a portion of an
immunoglobulin constant region, wherein a) the portion of an
immunoglobulin constant region comprises an amino (N) terminus
cysteine and b) the biologically active molecule comprises a
functional group capable of reacting with an N terminus cysteine to
form a bond. In certain embodiments, the functional group is a
thioester. In certain embodiments, e.g., where the biologically
active molecule is a polypeptide, the thioester may be a carboxy
(C) terminus thioester. In other embodiments, the thioester is not
a carboxy thioester. In certain embodiments, the functional group
is an aldehyde. In certain embodiments, e.g., where the
biologically active molecule is a polypeptide, the aldehyde may be
a carboxy (C) terminus aldehyde. In other embodiments, the aldehyde
is not a C terminus aldehyde.
[0010] In certain embodiments, the invention provides a method of
synthesizing chimeric proteins comprising the steps of a)
recombinantly expressing a fusion protein comprising at least a
portion of an immunoglobulin constant region and a splicing protein
capable of forming a C terminus thioester on the portion of an
immunoglobulin constant region; b) adding a thiol cofactor to the
fusion protein of a); c) adding at least one biologically active
molecule having an N terminal cysteine, thereby synthesizing the
chimeric protein. In some embodiments, the splicing protein is
intein or a mutant form of intein which is defective in completion
of the splicing reaction, but is still capable of thioester
intermediate formation. In some embodiments, the fusion protein is
further comprised of a chitin binding domain.
[0011] In certain embodiments, the chemical synthesis is performed
in solution. In some embodiments, at least one of the reactants is
linked to a solid support. The biologically active molecule may be
linked to the solid support. The portion of an immunoglobulin
constant region may be linked to a solid support. The fusion
protein comprising the portion of an immunoglobulin and the
splicing protein may be linked to a solid support.
[0012] It is to be understood that both the foregoing general
description and the following detailed description are exemplary
and explanatory only and are not restrictive of the invention, as
claimed.
BRIEF DESCRIPTION OF THE DRAWINGS
[0013] FIG. 1 is a schematic diagram comparing the structure of an
EPO-Fc homodimer, or dimer, and the structure of an Epo-FC
monomer-dimer hybrid.
[0014] FIG. 2 is the amino acid sequence of the chimeric protein
Cys-Fc. Included in the sequence is the signal peptide
(underlined), which is cleaved by the cell resulting in the mature
Cys-Fc. When this sequence is produced in CHO cells a percentage of
the molecules are incorrectly cleaved by the signal peptidase such
that two extra amino acids are left on the N terminus, thus
preventing the linkage of a biologically active molecule with a C
terminal thioester (e.g., via native ligation). When these
improperly cleaved species dimerize with the properly cleaved
Cys-Fc and are subsequently reacted with biologically active
molecules with C terminal thioesters, monomer-dimer hybrids
form.
[0015] FIG. 3 is the nucleic acid sequence of the chimeric protein
Cys-Fc. Included in the sequence is the signal peptide
(underlined), which is cleaved by the cell after translation
resulting in the mature Cys-Fc.
[0016] FIG. 4 demonstrates ways to form monomer-dimer hybrids
through native ligation.
[0017] FIG. 5A shows the amino acid sequence of Fc MESNA (SEQ ID
NO:4).
[0018] FIG. 5B shows the DNA sequence of Fc MESNA (SEQ ID
NO:5).
[0019] FIG. 6 shows a reaction scheme for linking a VLA antagonist
to a linker molecule.
[0020] FIG. 7 shows CysFc dimer nucleotide sequence (mouse K.sub.b
signal peptide underlined).
[0021] FIG. 8 shows CysFc dimer amino acid sequence (mouse K.sub.b
signal sequence underlined).
[0022] FIG. 9 shows HisXaCysFc nucleotide sequence (mouse K.sub.b
signal sequence underlined, His tag in bold, Factor X.sub.a
cleavage site in bold underlined.
[0023] FIG. 10 shows HisXaCysFc amino acid sequence (mouse K.sub.b
signal sequence underlined, His tag in bold, Factor X.sub.a
cleavage site in bold underlined).
DESCRIPTION OF THE EMBODIMENTS
A. Definitions
[0024] Affinity tag, as used herein, means a molecule attached to a
second molecule of interest, capable of interacting with a specific
binding partner for the purpose of isolating or identifying said
second molecule of interest.
[0025] Analogs of chimeric proteins of the invention, or proteins
or peptides substantially identical to the chimeric proteins of the
invention, as used herein, means that a relevant amino acid
sequence of a protein or a peptide is at least 70%, 75%, 80%, 85%,
90%, 95%, 97%, 98%, 99%, or 100% identical to a given sequence. By
way of example, such sequences may be variants derived from various
species, or they may be derived from the given sequence by
truncation, deletion, amino acid substitution or addition. Percent
identity between two amino acid sequences is determined by standard
alignment algorithms such as, for example, Basic Local Alignment
Tool (BLAST) described in Altschul et al. 1990, J. Mol. Biol.,
215:403-410, the algorithm of Needleman et al. 1970, J. Mol. Biol.,
48:444-453; the algorithm of Meyers et al. 1988, Comput. Appl.
Biosci., 4:11-17; or Tatusova et al. 1999, FEMS Microbiol. Lett.,
174:247-250, etc. Such algorithms are incorporated into the BLASTN,
BLASTP and "BLAST 2 Sequences" programs (see
www.ncbi.nlm.nih.gov/BLAST). When utilizing such programs, the
default parameters can be used. For example, for nucleotide
sequences the following settings can be used for "BLAST 2
Sequences": program BLASTN, reward for match 2, penalty for
mismatch -2, open gap and extension gap penalties 5 and 2
respectively, gap x_dropoff 50, expect 10, word size 11, filter ON.
For amino acid sequences the following settings can be used for
"BLAST 2 Sequences": program BLASTP, matrix BLOSUM62, open gap and
extension gap penalties 11 and 1 respectively, gap x_dropoff 50,
expect 10, word size 3, filter ON.
[0026] Bioavailability, as used herein, means the extent and rate
at which a substance is absorbed into a living system or is made
available at the site of physiological activity.
[0027] Biologically active molecule, as used herein, means a
non-immunoglobulin molecule or fragment thereof, capable of
treating a disease or condition or localizing or targeting a
molecule to a site of a disease or condition in the body by
performing a function or an action, or stimulating or responding to
a function, an action or a reaction, in a biological context (e.g.
in an organism, a cell, or an in vitro model thereof). Biologically
active molecules may comprise at least one of polypeptides, nucleic
acids, small molecules such as small organic or inorganic
molecules.
[0028] A chimeric protein, as used herein, refers to any protein
comprised of a first amino acid sequence derived from a first
source, bonded, covalently or non-covalently, to a second amino
acid sequence derived from a second source, wherein the first and
second source are not the same. A first source and a second source
that are not the same can include two different biological
entities, or two different proteins from the same biological
entity, or a biological entity and a non-biological entity. A
chimeric protein can include for example, a protein derived from at
least 2 different biological sources. A biological source can
include any non-synthetically produced nucleic acid or amino acid
sequence (e.g. a genomic or cDNA sequence, a plasmid or viral
vector, a native virion or a mutant or analog, as further described
herein, of any of the above). A synthetic source can include a
protein or nucleic acid sequence produced chemically and not by a
biological system (e.g. solid phase synthesis of amino acid
sequences). A chimeric protein can also include a protein derived
from at least 2 different synthetic sources or a protein derived
from at least one biological source and at least one synthetic
source. A chimeric protein may also comprise a first amino acid
sequence derived from a first source, covalently or non-covalently
linked to a nucleic acid, derived from any source or a small
organic or inorganic molecule derived from any source. The chimeric
protein may comprise a linker molecule between the first and second
amino acid sequence or between the first amino acid sequence and
the nucleic acid, or between the first amino acid sequence and the
small organic or inorganic molecule.
[0029] Clotting factor, as used herein, means any molecule, or
analog thereof, naturally occurring or recombinantly produced which
prevents or decreases the duration of a bleeding episode in a
subject with a hemostatic disorder. In other words, it means any
molecule having clotting activity.
[0030] Clotting activity, as used herein, means the ability to
participate in a cascade of biochemical reactions that culminates
in the formation of a fibrin clot and/or reduces the severity,
duration or frequency of hemorrhage or bleeding episode.
[0031] Dimer, as used herein, refers to a chimeric protein
comprising a first and second polypeptide chain, wherein the first
and second chains both comprise a biologically active molecule, and
at least a portion of an immunoglobulin constant region. A
homodimer refers to a dimer where both biologically active
molecules are the same.
[0032] Dimerically linked monomer-dimer hybrid refers to a chimeric
protein comprised of at least a portion of an immunloglobulin
constant region, e.g. an Fc fragment of an immunoglobulin, a
biologically active molecule and a linker which links the two
together such that one biologically active molecule is bound to 2
polypeptide chains, each comprising a portion of an immunoglobulin
constant region. FIG. 4 shows an example of a dimerically linked
monomer-dimer hybrid.
[0033] DNA construct, as used herein, means a DNA molecule, or a
clone of such a molecule, either single- or double-stranded that
has been modified through human intervention to contain segments of
DNA combined in a manner that as a whole would not otherwise exist
in nature. DNA constructs contain the information necessary to
direct the expression of polypeptides of interest. DNA constructs
can include promoters, enhancers and transcription terminators. DNA
constructs containing the information necessary to direct the
secretion of a polypeptide will also contain at least one secretory
signal sequence.
[0034] Domain, as used herein, means a region of a polypeptide
(including proteins as that term is defined) having some
distinctive physical feature or role including for example an
independently folded structure composed of one section of a
polypeptide chain. A domain may contain the sequence of the
distinctive physical feature of the polypeptide or it may contain a
fragment of the physical feature which retains its binding
characteristics (i.e. it can bind to a second domain). A domain may
be associated with another domain. In other words, a first domain
may naturally bind to a second domain.
[0035] A fragment, as used herein, refers to a peptide or
polypeptide comprising an amino acid sequence of at least 2
contiguous amino acid residues, of at least 5 contiguous amino acid
residues, of at least 10 contiguous amino acid residues, of at
least 15 contiguous amino acid residues, of at least 20 contiguous
amino acid residues, of at least 25 contiguous amino acid residues,
of at least 40 contiguous amino acid residues, of at least 50
contiguous amino acid residues, of at least 100 contiguous amino
acid residues, or of at least 200 contiguous amino acid residues or
any deletion or truncation of a protein, peptide, or
polypeptide.
[0036] Hemostasis, as used herein, means the stoppage of bleeding
or hemorrhage; or the stoppage of blood flow through a blood vessel
or body part.
[0037] Hemostatic disorder, as used herein, means a genetically
inherited or acquired condition characterized by a tendency to
hemorrhage, either spontaneously or as a result of trauma, due to
an impaired ability or inability to form a fibrin clot.
[0038] Linked, as used herein, refers to a first nucleic acid
sequence covalently joined to a second nucleic acid sequence. The
first nucleic acid sequence can be directly joined or juxtaposed to
the second nucleic acid sequence or alternatively an intervening
sequence can covalently join the first sequence to the second
sequence. Linked, as used herein, can also refer to a first amino
acid sequence covalently, or non-covalently, joined to a second
amino acid sequence. The first amino acid sequence can be directly
joined or juxtaposed to the second amino acid sequence or
alternatively an intervening sequence can covalently join the first
amino acid sequence to the second amino acid sequence. Linked as
used herein can also refer to a first amino acid sequence
covalently joined to a nucleic acid sequence or a small organic or
inorganic molecule.
[0039] Native ligation, as used herein, refers to the
chemoselective reaction of unprotected or N-terminal cysteine
protected peptide segments with another unprotected peptide segment
resulting in the formation of a ligated polypeptide with an amide
bond at the ligation site. A polypeptide assembled by native
ligation may comprise one, two or more native ligation sites.
[0040] Operatively linked, as used herein, means a first nucleic
acid sequence linked to a second nucleic acid sequence such that
both sequences are capable of being expressed as a biologically
active protein or peptide.
[0041] Polypeptide, as used herein, refers to a polymer of amino
acids and does not refer to a specific length of the product; thus,
peptides, oligopeptides, and proteins are included within the
definition of polypeptide. This term does not exclude
post-expression modifications of the polypeptide, for example,
glycosylation, acetylation, phosphorylation, pegylation, addition
of a lipid moiety, or the addition of any organic or inorganic
molecule. Included within the definition, are for example,
polypeptides containing one or more analogs of an amino acid
(including, for example, unnatural amino acids) and polypeptides
with substituted linkages, as well as other modifications known in
the art, both naturally occurring and non-naturally occurring.
[0042] High stringency, as used herein, includes conditions readily
determined by the skilled artisan based on, for example, the length
of the DNA. Generally, such conditions are defined in Sambrook et
al. Molecular Cloning: A Laboratory Manual, 2 ed. Vol. 1, pp.
1.101-104, Cold Spring Harbor Laboratory Press (1989), and include
use of a prewashing solution for the nitrocellulose filters
5.times.SSC, 0.5% SDS, 1.0 mM EDTA (PH 8.0), hybridization
conditions of 50% formamide, 6.times.SSC at 42.degree. C. (or other
similar hybridization solution, such as Stark's solution, in 50%
formamide at 42.degree. C., and with washing at approximately
68.degree. C., 0.2.times.SSC, 0.1% SDS. The skilled artisan will
recognize that the temperature and wash solution salt concentration
can be adjusted as necessary according to factors such as the
length of the probe.
[0043] Moderate stringency, as used herein, include conditions that
can be readily determined by those having ordinary skill in the art
based on, for example, the length of the DNA. The basic conditions
are set forth by Sambrook et al. Molecular Cloning: A Laboratory
Manual, 2d ed. Vol. 1, pp. 1.101-104, Cold Spring Harbor Laboratory
Press (1989), and include use of a prewashing solution for the
nitrocellulose filters 5.times.SSC, 0.5% SDS, 1.0 mM EDTA (pH 8.0),
hybridization conditions of 50% formamide, 6.times.SSC at
42.degree. C. (or other similar hybridization solution, such as
Stark's solution, in 50% formamide at 42.degree. C.), and washing
conditions of 60.degree. C., 0.5.times.SSC, 0.1% SDS.
[0044] A small inorganic molecule, as used herein means a molecule
containing no carbon atoms and being no larger than 50 kD.
[0045] A small organic molecule, as used herein means a molecule
containing at least one carbon atom and being no larger than 50
kD.
[0046] Thioester, as use herein, refers to a moiety represented by
--COSR. The R group may be any number of groups, including 1-15 C
functionalized alkyl, straight or branched, 1-15 C aromatic
structures, 1-100 amino acids. Thioester is intended to be
interchangeable with the IUPAC term thioloester.
[0047] Treat, treatment, treating, as used herein, means any of the
following: the reduction in severity of a disease or condition; the
reduction in the duration of a disease course; the amelioration of
one or more symptoms associated with a disease or condition; the
provision of beneficial effects to a subject with a disease or
condition, without necessarily curing the disease or condition, the
prophylaxis of one or more symptoms associated with a disease or
condition.
B. Synthesis of Chimeric Proteins
[0048] Chimeric proteins comprising at least a portion of an
immunoglobulin constant region and a biologically active molecule
can be synthesized using techniques well known in the art. For
example, the chimeric proteins of the invention may be synthesized
recombinantly in cells (see e.g. Sambrook et al. 1989, Molecular
Cloning A Laboratory Manual, Cold Spring Harbor Laboratory, N.Y.
and Ausubel et al. 1989, Current Protocols in Molecular Biology,
Greene Publishing Associates and Wiley Interscience, N.Y.).
Alternatively, the chimeric proteins of the invention may be
synthesized using known synthetic methods such as native ligation
(U.S. Pat. No. 6,326,468) or solid phase synthesis (see e.g.
Merrifield, 1973, Chemical Polypeptides, (Katsoyannis and Panayotis
eds.) pp. 335-61; Merrifield 1963, J. Am. Chem. Soc. 85:2149; Davis
et al. 1985, Biochem. Intl. 10:394; Finn et al. 1976, The Proteins
(3d ed.) 2:105; Erikson et al. 1976, The Proteins (3d ed.) 2:257;
U.S. Pat. No. 3,941,763. Alternatively, the chimeric proteins of
the invention may be synthesized using a combination of recombinant
and synthetic methods. In certain applications, it may be
beneficial to use either a recombinant method or a combination of
recombinant and synthetic methods.
[0049] Combining recombinant and chemical synthesis allows for the
rapid screening of biologically active molecules and linkers to
optimize desired properties of the chimeric protein of the
invention, e.g., viral inhibition, hemostasis, production of red
blood cells, biological half-life, stability, binding to serum
proteins or some other property of the chimeric protein. The method
also allows for the incorporation of non-natural amino acids into
the chimeric protein of the invention which may be useful for
optimizing a desired property of the chimeric protein of the
invention.
[0050] 1. Chemical Synthesis
[0051] In certain embodiments, the invention provides a method of
synthesizing a chimeric protein of the invention comprising at
least one biologically active molecule and at least a portion of an
immunoglobulin constant region, or fragment thereof, where one of
either the biologically active molecule or the portion of an
immunoglobulin constant region may. comprise an N terminus cysteine
and the other comprises a functional group capable of reacting
specifically with the N terminal cysteine. The biologically active
molecule may include a polypeptide. The biologically active
molecule may include a small organic molecule or a small inorganic
molecule. The biologically active molecule include a nucleic
acid.
[0052] In one embodiment, the N terminal cysteine is on the portion
of an immunoglobulin constant region. In one embodiment, the
portion of an immunoglobulin constant region is an Fc fragment. The
Fc fragment can be recombinantly produced to form cysteine-Fc
(Cys-Fc) and reacted with at least one biologically active molecule
expressing a thioester to make a chimeric protein of the invention,
e.g., monomer-dimer hybrid (FIG. 4). In another embodiment, an
Fc-thioester is made and reacted with at least one biologically
active molecule expressing an N terminus cysteine.
[0053] In one embodiment, the N-terminal cysteine may be on the
portion of an immunoglobulin constant region, e.g., an Fc fragment.
An Fc fragment can be generated with an N-terminal cysteine by
taking advantage of the fact that a native Fc has a cysteine at
positions 220, 226 and 229 (see Kabat et al. 1991, Sequences of
Proteins of Immunological Interest, U.S. Department of Public
Health, Bethesda, Md.). Any of these cysteines may be used to
generate an Fc fragment for use in the methods described herein.
Additionally, recombinant techniques can be used to generate Fc
fragments having at least one non-native (i.e. engineered by
humans) N terminus cysteine. For example, cysteines can be added on
at positions higher than 226, or lower than 220, of the EU
numbering system.
[0054] In a specific embodiment, an Fc fragment is expressed with
the human a interferon signal peptide adjacent to the Cys at
position 226. When a construct encoding this polypeptide is
expressed in CHO cells, the CHO cells cleave the signal peptide at
two distinct positions (at Cys 226 and at Val within the signal
peptide 2 amino acids upstream in the N terminus direction). This
generates a mixture of two species of Fc fragments (one with an
N-terminal Val and one with an N-terminal Cys). This in turn
results in a mixture of dimeric species (homodimers with terminal
Val, homodimers with terminal Cys and heterodimers where one chain
has a terminal Cys and the other chain has a terminal Val) (FIG.
4A). The Fc fragments can be reacted with at least one biologically
active molecule having a C terminal thioester and the resulting
monomer-dimer hybrid or dimer can be isolated from the mixture
(e.g. by size exclusion chromatography). It is contemplated that
when other signal peptide sequences are used for expression of Fc
fragments in CHO cells a mixture of species of Fc fragments with at
least two different N termini will be generated.
[0055] Cys-Fc may be recombinantly expressed. In one embodiment,
the Fc fragment is expressed in a prokaryotic cell, e.g., E. coli.
The sequence encoding the Fc portion beginning with Cys 226 (EU
numbering) can be placed immediately following a sequence encoding
a signal peptide, e.g., OmpA, PhoA, STII. The prokaryotic cell can
be osmotically shocked to release the recombinant Fc fragment. In
another embodiment, the Fc fragment is produced in a eukaryotic
cell, e.g., a CHO cell, a BHK cell. The sequence encoding the Fc
portion fragment can be placed directly following a sequence
encoding a signal peptide, e.g., mouse Ig.kappa. light chain or MHC
class I Kb signal sequence, such that when the recombinant chimeric
protein is synthesized by a eukaryotic cell, the signal sequence
will be cleaved, leaving an N terminal cysteine which can than be
isolated and chemically reacted with a molecule bearing a thioester
(e.g. a C terminal thioester if the molecule is comprised of amino
acids).
[0056] The N terminal cysteine on an Fc fragment can also be
generated using an enzyme that cleaves its substrate at its N
terminus, e.g., Factor X.sup.a, enterokinase, and the product
isolated and reacted with a molecule with a thioester.
[0057] In some embodiments, a recombinantly produced Cys-Fc can
form a homodimer. The homodimer may be reacted with peptide that
has a branched linker on the C terminus, wherein the branched
linker has two C terminal thioesters that can be reacted with the
Cys-Fc, thus forming a dimerically linked monomer dimer hybrid
(FIG. 4). In another embodiment, the biologically active molecule
may have a single non-terminal thioester that can be reacted with
Cys-Fc.
[0058] In some embodiments, the branched linker can have two C
terminal cysteines that can be reacted with an Fc thioester. In
another embodiment, the branched linker has two functional groups
that can be reacted with the Fc thioester, e.g.,
2-mercaptoamine.
[0059] Where the portion of the immunoglobulin constant region has
an N terminus cysteine, the functional group on the biologically
active molecule may be an aldehyde. If necessary, the aldehyde
functionality can be chemically synthesized for example by
oxidation of an N-terminal serine with periodate (see, e.g.,
Georghagen et al., 1992, Bioconjugate Chem. 3:138). Alternatively,
where the biologically active molecule is a DNA molecule, it may
labeled with an aldehyde group by first coupling the DNA, during
the last round of synthesis, with phosphoramidite thus generating a
protected amine. After deprotection, the DNA molecule labeled with
a free amine may be generated. The amine could be coupled to
succinimidyl 4-formylbenzoate (as shown below) to generate the
aldehyde. This could be done on either its 3' or 5' end.
##STR00001##
[0060] Another way of introducing an aldehyde into an
oligonucleotide is described in Zatsepin et al., 2002, Bioconjugate
Chem, 13:822. A protected 1,2-diol may be incorporated in the 2'
position. After the synthesis of the oligo, the protecting groups
can be removed to reveal the free 1,2-diol, which can then be
oxidized with periodate to give an aldehyde.
[0061] Aldehydes are known to react with N-terminal cysteines (in
effect, a 1,2-amino thiol moiety) to form thiazolidines. (See
Botti, 1996, J. Am Chem. Soc., 118:10018; Zhang et al., 1998, Proc.
Nat. Acad. Sci. USA, 95:9184). In one embodiment, the portion of an
immunoglobulin constant region is an Fc fragment with an N terminus
cysteine (CysFc). CysFc can thus react selectively with any
aldehyde to form this linkage site-specifically at the
N-terminus.
[0062] In another embodiment, where the immunoglobulin constant
region has an N terminus cysteine, the functional group on the
biologically active molecule may be a thioester. In certain
embodiments, the thioester may be a C terminus thioester. When the
biologically active molecule comprising the thioester is combined
with the portion of an immunoglobulin comprising an N terminus
cysteine nucleophilic substitution occurs and yields a
thioester-linked intermediate which spontaneously undergoes
rearrangement to form a native amide bond at the ligation site.
[0063] Nucleic acids, e.g., DNA, RNA may be chemically synthesized
to provide one thioester, see McPherson et al. 1999, Synlett.
S1:978. The nucleic acid can be coupled with a thiophosphate at the
5' end and then reacted with bromo-acetylated thioester to generate
a 5' thioester. The 5' thioester could in turn be reacted with a
portion of an immunoglobulin constant region comprising an N
terminus cysteine, e.g., Cys-Fc.
[0064] In certain embodiments, the invention provides a method of
synthesizing chimeric proteins which combines chemical synthesis
with recombinant synthesis (described below). Thus, the
biologically active molecule may be synthesized chemically or
recombinantly. Similarly, the portion of the immunoglobulin may be
synthesized chemically or recombinantly. Once both individual
components are synthesized they may be combined chemically to
synthesize the chimeric protein of the invention.
[0065] A combination of chemical and recombinant synthesis may be
used where it is desirable to link a biologically active molecule
to the C terminus of a portion of an immunoglobulin. In this
embodiment, the portion of an immunoglobulin constant region, e.g.,
the Fc region, is expressed as a fusion protein comprising a
protein splicer which forms a thioester intermediate, e.g., intein,
linked to the C terminus of the portion of an immunoglobulin
constant region. Commercially available vectors (PCYB2-IMPACT) (New
England Biolabs, Beverly, Mass.) provide a cloning cite adjacent to
a nnutant form of intein which is upstream of a chitin binding
domain. The mutant intein does not splice the fusion protein, but
does form the thioester intermediate. In one embodiment, the
portion of the immunoglobulin with the intein linked to its C
terminus can be expressed in a prokaryotic cell. In another
embodiment, the portion of the immunoglobulin with the intein
linked to its C terminus can be expressed in a eukaryotic cell. The
fusion protein may be isolated using chitin linked to a solid
support. Addition of a thiol co-factor, such as thiophenol or
MESNA, and a biologically active molecule with a N-terminus
cysteine allows for the linkage of a biologically active molecule
to the C terminus thioester of the portion of an immunoglobulin.
The biologically active molecule and portion of an immunoglobulin
may be reacted together such that nucleophilic rearrangement occurs
and the biologically active molecule is covalently linked to the
portion of an immunoglobulin via an amide bond. (Dawsen et al.
2000, Annu. Rev. Biochem. 69:923).
[0066] Where the biological molecule of interest is a nucleic acid
molecule, e.g., a DNA molecule, phosphoramidite can be used to
introduce a terminal cysteine residue to the DNA. The DNA can then
be linked to the Fc-thioester generated as described above.
[0067] Chemical synthesis may be used to synthesize any of the
chimeric proteins of the invention, including monomer-dimer
hybrids, dimers and dimerically linked monomer-dimer hybrids.
Chemical synthesis may be used to synthesize a chimeric protein of
the invention comprising any biologically active molecule including
a polypeptide, a nucleic acid, or a small molecule. In some
embodiments, chemical synthesis may be used to synthesize a
chimeric protein comprising an Fc fragment of an
immunoglobulin.
[0068] In one embodiment, the portion of an immunoglobulin constant
region ligated to the biologically active molecule will form
homodimers. The homodimers may be isolated. Alternatively, the
homodimers can be disrupted by exposing the homodimers to
denaturing and reducing conditions (e.g. beta-mercaptoethanol and 8
M urea) and then subsequently combined with a portion of an
immunoglobulin constant region not linked to a biologically active
molecule to form monomer-dimer hybrids. The monomer-dimer hybrids
are then renatured and refolded by dialyzing into PBS and isolated,
e.g., by size exclusion or affinity chromatography.
[0069] In another embodiment, the portion of an immunoglobulin
constant region will form homodimers before being linked to a
biologically active molecule. In this embodiment, reaction
conditions for linking the biologically active molecule to the
homodimer can be adjusted such that linkage of the biologically
active molecule to only one chain of the homodimer is favored (e.g.
by adjusting the molar equivalents of each reactant).
[0070] The chimeric protein chemically synthesized can optionally
include a linker peptide between the portion of an immunoglobulin
and the biologically active molecule. Any linker known in the art
may be used. The linker may for example be linked to the N terminus
of the biologically active molecule, where the biologically active
molecule is a polypeptide. Linkers can include peptides and/or
organic molecules (e.g. polyethylene glycol and/or short amino acid
sequences). The linker may be a branching molecule that facilitates
the bonding of multiple copies of the biologically active molecule
to the portion of an immunoglobulin constant region. Alternatively,
the linker may be a branching molecule that facilitates the bonding
of one biologically active molecule to more than one portion of an
immunoglobulin constant region.
[0071] Any of the chemical synthesis techniques described herein
can be performed by linking at least one of the biologically active
molecule and the portion of an immunoglobulin constant region to a
solid support. As an example an amino-Spherilose.TM. (Isco,
Lincoln, Nebr.) may be derivatized with Boc-aminooxyacetic acid.
Other resins which may be used as the solid support include EAH
Sepharose (Pharmacia, NY, N.Y.), Amino PEGA (Novabiochem, San
Diego, Calif.), CLEAR base resin (Peptides International,
Louisville, Ky.), long chain alkylamine controlled pore glass
(Sigma, St. Louis, Mo.), HCI.PEG polystyrene (PerSeptive
Biosystems, Waltham, Mass.), Lysine Hyper D resin (Biosepra,
Freemont, Calif.), ArgoGel Base resin (Argonaut Technologies,
Foster City, Calif.). These resins are available in
amino-derivatized form or are readily converted to an
amino-derivatized form to facilitate coupling.
[0072] 2. Recombinant Synthesis
[0073] Nucleic acids encoding a biologically active molecule can be
readily synthesized using recombinant techniques well known in the
art. Alternatively, the peptides themselves can be chemically
synthesized. Nucleic acids of the invention may be synthesized by
standard methods known in the art, e.g., by use of an automated DNA
synthesizer (such as are commercially available from Biosearch,
Applied Biosystems, etc.). As examples, phosphorothioate
oligonucleotides may be synthesized by the method of Stein et al.
1988, Nucl. Acids Res. 16:3209, methylphosphonate oligonucleotides
can be prepared by use of controlled pore glass polymer supports as
described in Sarin et al. 1988, Proc. Natl. Acad. Sci. USA 85:7448.
Additional methods of nucleic acid synthesis are known in the art.
(see e.g. U.S. Pat. Nos. 6,015,881; 6,281,331; 6,469,136).
[0074] DNA sequences encoding immunoglobulin constant regions, or
fragments thereof, may be cloned from a variety of genomic or cDNA
libraries known in the art. The techniques for isolating such DNA
sequences using probe-based methods are conventional techniques and
are well known to those skilled in the art. Probes for isolating
such DNA sequences may be based on published DNA sequences (see,
e.g., Hieter et al. 1980, Cell 22:197-207). The polymerase chain
reaction (PCR) method disclosed by Mullis et al. (U.S. Pat. No.
4,683,195) and Mullis (U.S. Pat. No. 4,683,202) may be used. The
choice of library and selection of probes for the isolation of such
DNA sequences is within the level of ordinary skill in the art.
Alternatively, DNA sequences encoding immunoglobulins or fragments
thereof can be obtained from vectors known in the art to contain
immunoglobulins or fragments thereof.
[0075] For recombinant production, a first polynucleotide sequence
encoding a portion of the chimeric protein of the invention (e.g. a
portion of an immunoglobulin constant region) and a second
polynucleotide sequence encoding a portion of the chimeric protein
of the invention (e.g. a portion of an immunoglobulin constant
region and a biologically active molecule) are inserted into
appropriate expression vehicles, i.e. vectors which contains the
necessary elements for the transcription and translation of the
inserted coding sequence, or in the case of an RNA viral vector,
the necessary elements for replication and translation. The nucleic
acids encoding the chimeric protein are inserted into the vector in
proper reading frame.
[0076] The expression vehicles are then transfected or
co-transfected into a suitable target cell, which will express the
polypeptides. Transfection techniques known in the art include, but
are not limited to, calcium phosphate precipitation (Wigler et al.
1978, Cell 14:725) and electroporation (Neumann et al. 1982, EMBO,
J. 1:841), and liposome based reagents. A variety of
host-expression vector systems may be utilized to express the
chimeric proteins described herein including both prokaryotic or
eukaryotic cells. These include, but are not limited to,
microorganisms such as bacteria (e.g. E. coli) transformed with
recombinant bacteriophage DNA or plasmid DNA expression vectors
containing an appropriate coding sequence; yeast or filamentous
fungi transformed with recombinant yeast or fungi expression
vectors containing an appropriate coding sequence; insect cell
systems infected with recombinant virus expression vectors (e.g.
baculovirus) containing an appropriate coding sequence; plant cell
systems infected with recombinant virus expression vectors (e.g.
cauliflower mosaic virus or tobacco mosaic virus) or transformed
with recombinant plasmid expression vectors (e.g. Ti plasmid)
containing an appropriate coding sequence; or animal cell systems,
including mammalian cells (e.g. CHO, Cos, HeLa cells).
[0077] When the chimeric protein of the invention is recombinantly
synthesized in a prokaryotic cell it may be desirable to refold the
chimeric protein. The chimeric protein produced by this method can
be refolded to a biologically active conformation using conditions
known in the art, e.g., reducing conditions and then dialyzed
slowly into PBS.
[0078] Depending on the expression system used, the expressed
chimeric protein is then isolated by procedures well-established in
the art (e.g. affinity chromatography, size exclusion
chromatography, ion exchange chromatography).
[0079] The expression vectors can encode for tags that permit for
easy purification of the recombinantly produced chimeric protein.
Examples include, but are not limited to vector pUR278 (Ruther et
al. 1983, EMBO J. 2:1791) in which the chimeric protein described
herein coding sequences may be ligated into the vector in frame
with the lac z coding region so that a hybrid protein is produced;
pGEX vectors may be used to express chimeric proteins of the
invention with a glutathione S-transferase (GST) tag. These
proteins are usually soluble and can easily be purified from cells
by adsorption to glutathione-agarose beads followed by elution in
the presence of free glutathione. The vectors include cleavage
sites (thrombin or Factor Xa protease or PreScission Protease.TM.
(Pharmacia, Peapack, N.J.)) for easy removal of the tag after
purification.
[0080] To increase efficiency of production, the polynucleotides
can be designed to encode multiple units of the chimeric protein of
the invention separated by enzymatic cleavage sites. The resulting
polypeptide can be cleaved (e.g. by treatment with the appropriate
enzyme) in order to recover the polypeptide units. This can
increase the yield of polypeptides driven by a single promoter.
When used in appropriate viral expression systems, the translation
of each polypeptide encoded by the mRNA is directed internally in
the transcript; e.g., by an internal ribosome entry site, IRES.
Thus, the polycistronic construct directs the transcription of a
single, large polycistronic mRNA which, in turn, directs the
translation of multiple, individual polypeptides. This approach
eliminates the production and enzymatic processing of polypeptides
and may significantly increase yield of polypeptide driven by a
single promoter.
[0081] Vectors used in transformation will usually contain a
selectable marker used to identify transformants. In bacterial
systems, this can include an antibiotic resistance gene such as
ampicillin or kanamycin. Selectable markers for use in cultured
mammalian cells include genes that confer resistance to drugs, such
as neomycin, hygromycin, and methotrexate. The selectable marker
may be an amplifiable selectable marker. One amplifiable selectable
marker is the DHFR gene. Another amplifiable marker is the DHFR
cDNA (Simonsen and Levinson 1983, Proc. Natl. Acad. Sci. USA
80:2495). Selectable markers are reviewed by Thilly (Mammalian Cell
Technology, Butterworth Publishers, Stoneham, Mass.) and the choice
of selectable markers is well within the level of ordinary skill in
the art.
[0082] Selectable markers may be introduced into the cell on a
separate plasmid at the same time as the gene of interest, or they
may be introduced on the same plasmid. If on the same plasmid, the
selectable marker and the gene of interest may be under the control
of different promoters or the same promoter, the latter arrangement
producing a dicistronic message. Constructs of this type are known
in the art (for example, U.S. Pat. No. 4,713,339).
[0083] The expression elements of the expression systems vary in
their strength and specificities. Depending on the host/vector
system utilized, any of a number of suitable transcription and
translation elements, including constitutive and inducible
promoters, may be used in the expression vector. For example, when
cloning in bacterial systems, inducible promoters such as pL of
bacteriophage .lamda., plac, ptrp, ptac (ptrp-lac hybrid promoter)
and the like may be used; when cloning in insect cell systems,
promoters such as the baculovirus polyhedron promoter may be used;
when cloning in plant cell systems, promoters derived from the
genome of plant cells (e.g. heat shock promoters; the promoter for
the small subunit of RUBISCO; the promoter for the chlorophyll a/b
binding protein) or from plant viruses (e.g. the 35S RNA promoter
of CaMV; the coat protein promoter of TMV) may be used; when
cloning in mammalian cell systems, promoters derived from the
genome of mammalian cells (e.g. metallothionein promoter) or from
mammalian viruses (e.g. the adenovirus late promoter; the vaccinia
virus 7.5 K promoter) may be used; when generating cell lines that
contain multiple copies of expression product, SV40-, BPV- and
EBV-based vectors may be used with an appropriate selectable
marker.
[0084] In cases where plant expression vectors are used, the
expression of sequences encoding linear or non-cyclized forms of
the chimeric proteins of the invention may be driven by any of a
number of promoters. For example, viral promoters such as the 35S
RNA and 19S RNA promoters of CaMV (Brisson et al. 1984, Nature
310:511-514), or the coat protein promoter of TMV (Takamatsu et al.
1987, EMBO J. 6:307-311) may be used; alternatively, plant
promoters such as the small subunit of RUBISCO (Coruzzi et al.
1984, EMBO J. 3:1671-1680; Broglie et al. 1984, Science
224:838-843) or heat shock promoters, e.g., soybean hsp17.5-E or
hsp17.3-B (Gurley et al. 1986, Mol. Cell. Biol. 6:559-565) may be
used. These constructs can be introduced into plant cells using Ti
plasmids, Ri plasmids, plant virus vectors, direct DNA
transformation, microinjection, electroporation, etc. For reviews
of such techniques see e.g. Weissbach & Weissbach 1988, Methods
for Plant Molecular Biology, Academic Press, NY, Section VIII, pp.
421-463; and Grierson & Corey 1988, Plant Molecular Biology, 2d
Ed., Blackie, London, Ch. 7-9.
[0085] In one insect expression system that may be used to produce
the chimeric proteins of the invention, Autographa californica
nuclear polyhidrosis virus (AcNPV) is used as a vector to express
the foreign genes. The virus grows in Spodoptera frugiperda cells.
A coding sequence may be cloned into non-essential regions (for
example, the polyhedron gene) of the virus and placed under control
of an AcNPV promoter (for example, the polyhedron promoter).
Successful insertion of a coding sequence will result in
inactivation of the polyhedron gene and production of non-occluded
recombinant virus (i.e. virus lacking the proteinaceous coat coded
for by the polyhedron gene). These recombinant viruses are then
used to infect Spodoptera frugiperda cells in which the inserted
gene is expressed. (see e.g. Smith et al. 1983, J. Virol. 46:584;
U.S. Pat. No. 4,215,051). Further examples of this expression
system may be found in Ausubel et al., eds. 1989, Current Protocols
in Molecular Biology, Vol. 2, Greene Publish. Assoc. & Wiley
Interscience.
[0086] Another system which can be used to express the chimeric
proteins of the invention is the glutamine synthetase gene
expression system, also referred to as the "GS expression system"
(Lonza Biologics PLC, Berkshire UK). This expression system is
described in detail in U.S. Pat. No. 5,981,216.
[0087] In mammalian host cells, a number of viral based expression
systems may be utilized. In cases where an adenovirus is used as an
expression vector, a coding sequence may be ligated to an
adenovirus transcription/translation control complex, e.g., the
late promoter and tripartite leader sequence. This chimeric gene
may then be inserted in the adenovirus genome by in vitro or in
vivo recombination. Insertion in a non-essential region of the
viral genome (e.g. region E1 or E3) will result in a recombinant
virus that is viable and capable of expressing peptide in infected
hosts (see e.g. Logan & Shenk 1984, Proc. Natl. Acad. Sci. USA
81:3655). Alternatively, the vaccinia 7.5 K promoter may be used
(see e.g. Mackett et al. 1982, Proc. Natl. Acad. Sci. USA 79:7415;
Mackett et al. 1984, J. Virol. 49:857; Panicali et al. 1982, Proc.
Natl. Acad. Sci. USA 79:4927).
[0088] In cases where an adenovirus is used as an expression
vector, a coding sequence may be ligated to an adenovirus
transcription/translation control complex, e.g., the late promoter
and tripartite leader sequence. This chimeric gene may then be
inserted in the adenovirus genome by in vitro or in vivo
recombination. Insertion in a non-essential region of the viral
genome (e.g. region E1 or E3) will result in a recombinant virus
that is viable and capable of expressing peptide in infected hosts
(see e.g. Logan & Shenk 1984, Proc. Nat(Acad. Sci. USA
81:3655). Alternative)y, the vaccinia 7.5 K promoter may be used
(see e.g. Mackett et al. 1982, Proc. Natl. Acad. Sci. USA 79:7415;
Mackett et al. 1984, J. Virol. 49:857; Panicali et al. 1982, Proc.
Natl. Acad. Sci. USA 79:4927).
[0089] Host cells containing DNA constructs of the chimeric protein
are grown in an appropriate growth medium. As used herein, the term
"appropriate growth medium" means a medium containing nutrients
required for the growth of cells. Nutrients required for cell
growth may include a carbon source, a nitrogen source, essential
amino acids, vitamins, minerals and growth factors. Optionally the
media can contain bovine calf serum or fetal calf serum. In one
embodiment, the media contains substantially no IgG. The growth
medium will generally select for cells containing the DNA construct
by, for example, drug selection or deficiency in an essential
nutrient which is complemented by the selectable marker on the DNA
construct or co-transfected with the DNA construct. Cultured
mammalian cells are generally grown in commercially available
serum-containing or serum-free media (e.g. MEM, DMEM). Selection of
a medium appropriate for the particular cell line used is within
the level of ordinary skill in the art.
[0090] The recombinantly produced chimeric protein of the invention
can be isolated from the culture media. The culture medium from
appropriately grown transformed or transfected host cells is
separated from the cell material, and the presence of chimeric
proteins is demonstrated. One method of detecting the chimeric
proteins, for example, is by the binding of the chimeric proteins
or portions of the chimeric proteins to a specific antibody
recognizing the chimeric protein of the invention. An anti-chimeric
protein antibody may be a monoclonal or polyclonal antibody raised
against the chimeric protein in question. For example, the chimeric
protein contains at least a portion of an immunoglobulin constant
region. Antibodies recognizing the constant region of many
immunoglobulins are known in the art and are commercially
available. An antibody can be used to perform an ELISA or a western
blot to detect the presence of the chimeric protein of the
invention.
[0091] The chimeric protein of the invention can be synthesized in
a transgenic animal, such as a rodent, cow, pig, sheep, or goat.
The term "transgenic animals" refers to non-human animals that have
incorporated a foreign gene into their genome. Because this gene is
present in germline tissues, it is passed from parent to offspring.
Exogenous genes are introduced into single-celled embryos (Brinster
et al. 1985, Proc. Natl. Acad. Sci. USA 82:4438). Methods of
producing transgenic animals are known in the art, including
transgenics that produce immunoglobulin molecules (Wagner et al.
1981, Proc. Natl. Acad. Sci. USA 78:6376; McKnight et al. 1983,
Cell 34:335; Brinster et al. 1983, Nature 306:332; Ritchie et al.
1984, Nature 312:517; Baldassarre et al. 2003, Theriogenology
59:831; Robl et al. 2003, Theriogenology 59:107; Malassagne et al.
2003, Xenotransplantation 10(3):267).
D. Improvements Offered by Certain Embodiments of the Invention
[0092] Recombinant technology provides a fast and relatively
inexpensive way to produce large quantities of chimeric proteins,
however the technology is not without its limitations. For example
large multi-domain proteins can be difficult to express
recombinantly. Recombinant expression of chimeric proteins often
results in a heterogenous product requiring extensive purification.
Some chimeric proteins may be toxic to cells making their
expression, difficult, if not impossible. Moreover, recombinantly
expressed proteins can only be comprised of the naturally occurring
20 amino acids. Thus, only L-configuration amino acids are possible
using recombinant methods. Expressing chimeric proteins comprised
of non-naturally occurring amino acids, provides a way to generate
analogs useful in studying protein function and inhibiting
undesirable metabolic pathways. Alternatively, analogs comprising
non-naturally occurring amino acids may be used in some cases to
enhance the activity of desirable metabolic pathways. Lastly,
chimeric proteins comprising both amino acids and another
biologically active molecules, e.g., nucleic acids, small
molecules, are impossible to express using recombinant technology
alone.
[0093] Many of the limitations described above may be overcome
using chemical synthesis alone or a combination of recombinant
techniques and chemical synthesis. A number of traditional
techniques for chemically synthesizing proteins, such as solid
phase synthesis are known in the art, see, e.g., Merrifield, 1973,
Chemical Polypeptides, (Katsoyannis and Panayotis eds.) pp. 335-61;
Merrifield 1963, J. Am. Chem. Soc. 85:2149; Davis et al. 1985,
Biochem. Intl. 10:394; Finn et al. 1976, The Proteins (3d ed.)
2:105; Erikson et al. 1976, The Proteins (3d ed.) 2:257; U.S. Pat.
No. 3,941,763.
[0094] Recent improvements in the chemical synthesis of proteins
include the advent of native chemical ligation. As initially
described, native ligation provides for the rapid synthesis of
large polypeptides with a natural peptide backbone via the native
chemical ligation of two or more unprotected peptide segments. In
native ligation none of the reactive functionalities on the peptide
segments need to be temporarily masked by a protecting group.
Native ligation also allows for the solid phase sequential chemical
ligation of peptide segments in an N-terminus to C-terminus
direction, with the first solid phase-bound unprotected peptide
segment bearing a C-terminal alpha-thioester that reacts with
another unprotected peptide segment containing an N-terminal
cysteine. Native chemical ligation also permits the solid-phase
ligation in the C- to N-terminus direction, with temporary
protection of N-terminal cysteine residues on an incoming (second)
peptide segment (see, e.g., U.S. Pat. No.: 6,326,468; WO 02/18417).
Native ligation may also be combined with recombinant technology
using intein linked to a chitin binding domain (Muir et al., 1998,
Proc. Natl. Acad. Sci. USA, 95:6705).
[0095] The invention provides for chimeric proteins (monomer-dimer
hybrids) comprising a first and a second polypeptide chain, wherein
said first chain comprises a biologically active molecule and at
least a portion of an immunoglobulin constant region, and said
second chain comprises at least a portion of an immunoglobulin
constant region without any biologically active molecule or
variable region of an immunoglobulin. FIG. 1 contrasts traditional
fusion protein dimers with one example of the monomer-dimer hybrid
of the invention. In this example, the biologically active molecule
is EPO and the portion of an immunoglobulin is IgG Fc region.
[0096] Like other chimeric proteins comprised of at least a portion
of an immunoglobulin constant region, the invention provides for
chimeric proteins which afford enhanced stability and increased
bioavailability of the chimeric protein compared to the
biologically active molecule alone. Additionally, however, because
only one of the two chains comprises the biologically active
molecule, the chimeric protein has a lower molecular weight than a
chimeric protein wherein all chains comprise a biologically active
molecule and while not wishing to be bound by any theory, this may
result in the chimeric protein being more readily transcytosed
across the epithelium barrier, e.g., by binding to the FcRn
receptor thereby increasing the half-life of the chimeric protein.
In one embodiment, the invention thus provides for an improved
non-invasive method (e.g. via any mucosal surface, such as, orally,
buccally, sublingually, nasally, rectally, vaginally, or via
pulmonary or occular route) of administering a therapeutic chimeric
protein of the invention. The invention thus provides methods of
attaining therapeutic levels of the chimeric proteins of the
invention using less frequent and lower doses compared to
previously described chimeric proteins (e.g. chimeric proteins
comprised of at least a portion of an immunoglobulin constant
region and a biologically active molecule, wherein all chains of
the chimeric protein comprise a biologically active molecule).
[0097] In another embodiment, the invention provides an invasive
method, e.g., subcutaneously, intravenously, of administering a
therapeutic chimeric protein of the invention. Invasive
administration of the therapeutic chimeric protein of the invention
provides for an increased half life of the therapeutic chimeric
protein which results in using less frequent and lower doses
compared to previously described chimeric proteins (e.g. chimeric
proteins comprised of at least a portion of an immunoglobulin
constant region and a biologically active molecule, wherein all
chains of the chimeric protein comprise a biologically active
molecule).
[0098] Yet another advantage of a chimeric protein wherein only one
of the chains comprises a biologically active molecule is the
enhanced accessibility of the biologically active molecule for its
target cell or molecule resulting from decreased steric hindrance,
decreased hydrophobic interactions, decreased ionic interactions,
or decreased molecular weight compared to a chimeric protein
wherein all chains are comprised of a biologically active
molecule.
E. Chimeric Proteins
[0099] The invention relates to chimeric proteins comprising one
biologically active molecule, at least a portion of an
immunoglobulin constant region, and optionally at least one linker.
The portion of an immunoglobulin will have both an N, or an amino
terminus, and a C, or carboxy terminus. The chimeric protein may
have the biologically active molecule linked to the N terminus of
the portion of an immunoglobulin. Alternatively, the biologically
active molecule may be linked to the C terminus of the portion of
an immunoglobulin. In one embodiment, the linkage is a covalent
bond. In another embodiment, the linkage is a non-covalent
bond.
[0100] The chimeric protein can optionally comprise at least one
linker; thus, the biologically active molecule does not have to be
directly linked to the portion of an immunoglobulin constant
region. The linker can intervene in between the biologically active
molecule and the portion of an immunoglobulin constant region. The
linker can be linked to the N terminus of the portion of an
immunoglobulin constant region, or the C terminus of the portion of
an immunoglobulin constant region. If the biologically active
molecule is comprised of at least one amino acid the biologically
active molecule will have an N terminus and a C terminus and the
linker can be linked to the N terminus of the biologically active
molecule, or the C terminus the biologically active molecule.
[0101] The invention relates to a chimeric protein of the formula
X-L.sub.a-F:F or F:F-L.sub.a-X, wherein X is a biologically active
molecule, L is an optional linker, F is at least a portion of an
immunoglobulin constant region and, a is any integer or zero. The
invention also relates to a chimeric protein of the formula
T.sub.a-X-L.sub.a-F:F or T.sub.a-F:F-L.sub.a-X, wherein X is a
biologically active molecule, L is an optional linker, F is at
least a portion of an immunoglobulin constant region, a is any
integer or zero, T is a second linker or alternatively a tag that
can be used to facilitate purification of the chimeric protein,
e.g., a FLAG tag, a histidine tag, a GST tag, a maltose binding
protein tag and (:) represents a chemical association, e.g. at
least one non-peptide bond. In certain embodiments, the chemical
association, i.e., (:) is a covalent bond. In other embodiments,
the chemical association, i.e., (:) is a non-covalent interaction,
e.g., an ionic interaction, a hydrophobic interaction, a
hydrophilic interaction, a Van der Waals interaction, a hydrogen
bond. It will be understood by the skilled artisan that when a
equals zero X will be directly linked to F. Thus, for example, a
may be 0, 1, 2, 3, 4, 5, or more than 5.
[0102] 1. Chimeric Protein Variants
[0103] Derivatives of the chimeric proteins of the invention,
antibodies against the chimeric proteins of the invention and
antibodies against binding partners of the chimeric proteins of the
invention are all contemplated, and can be made by altering their
amino acids sequences by substitutions, additions, and/or
deletions/truncations or by introducing chemical modification that
result in functionally equivalent molecules. It will be understood
by one of ordinary skill in the art that certain amino acids in a
sequence of any protein may be substituted for other amino acids
without adversely affecting the activity of the protein.
[0104] Various changes may be made in the amino acid sequences of
the chimeric proteins of the invention or DNA sequences encoding
therefore without appreciable loss of their biological activity,
function, or utility. Derivatives, analogs, or mutants resulting
from such changes and the use of such derivatives is within the
scope of the present invention. In a specific embodiment, the
derivative is functionally active, i.e., capable of exhibiting one
or more activities associated with the chimeric proteins of the
invention, e.g., FcRn binding, viral inhibition, hemostasis,
production of red blood cells. Many assays capable of testing the
activity of a chimeric protein comprising a biologically active
molecule are known in the art. Where the biologically active
molecule is an HIV inhibitor, activity can be tested by measuring
reverse transcriptase activity using known methods (see e.g.
Barre-Sinoussi et al. 1983, Science 220:868; Gallo et al. 1984,
Science 224:500). Alternatively, activity can be measured by
measuring fusogenic activity (see e.g. Nussbaum et al. 1994, J.
Virol. 68(9):5411). Where the biological activity is hemostasis, a
StaCLot FVIIa-rTF assay can be performed to assess activity of
Factor VIIa derivatives (Johannessen et al. 2000, Blood Coagulation
and Fibrinolysis 11:S159).
[0105] Substitutes for an amino acid within the sequence may be
selected from other members of the class to which the amino acid
belongs (see Table 1). Furthermore, various amino acids are
commonly substituted with neutral amino acids, e.g., alanine,
leucine, isoleucine, valine, proline, phenylalanine, tryptophan,
and methionine (see e.g. MacLennan et al. 1998, Acta Physiol.
Scand. Suppl. 643:55-67; Sasaki et al. 1998, Adv. Biophys.
35:1-24).
TABLE-US-00001 TABLE 1 Original Exemplary Typical Residues
Substitutions Substitutions Ala (A) Val, Leu, Ile Val Arg (R) Lys,
Gln, Asn Lys Asn (N) Gln Gln Asp (D) Glu Glu Cys (C) Ser, Ala Ser
Gln (Q) Asn Asn Gly (G) Pro, Ala Ala His (H) Asn, Gln, Lys, Arg Arg
Ile (I) Leu, Val, Met, Ala, Leu Phe, Norleucine Leu (L) Norleucine,
Ile, Val, Ile Met, Ala, Phe Lys (K) Arg, Arg 1,4-Diamino-butyric
Acid, Gln, Asn Met (M) Leu, Phe, Ile Leu Phe (F) Leu, Val, Ile,
Ala, Tyr Leu Pro (P) Ala Gly Ser (S) Thr, Ala, Cys Thr Thr (T) Ser
Ser Trp (W) Tyr, Phe Tyr Tyr (Y) Trp, Phe, Thr, Ser Phe Val (V)
Ile, Met, Leu, Phe, Ala, Leu Norleucine
[0106] 2. Biologically Active Molecules
[0107] The invention contemplates the use of any biologically
active molecule as the therapeutic molecule of the invention. The
biologically active molecule can be a polypeptide. The biologically
active molecule can be a single amino acid. The biologically active
molecule can include a modified polypeptide.
[0108] The biologically active molecule can include a lipid
molecule (e.g. a steroid or cholesterol, a fatty acid, a
triacylglycerol, glycerophospholipid, or sphingolipid). The
biologically active molecule can include a sugar molecule (e.g.
glucose, sucrose, mannose). The biologically active molecule can
include a nucleic acid molecule (e.g. DNA, RNA). The biologically
active molecule can include a small organic molecule or a small
inorganic molecule.
[0109] a. Cytokines and Growth Factors
[0110] In one embodiment, the biologically active molecule is a
growth factor, hormone or cytokine or analog or fragment thereof.
The biologically active molecule can be any agent capable of
inducing cell growth and proliferation. In a specific embodiment,
the biologically active molecule is any agent which can induce
erythrocytes to proliferate. Thus, one example of a biologically
active molecule contemplated by the invention is EPO. The
biologically active molecule can also include, but is not limited
to, RANTES, MIP1.alpha., MIP1.beta., IL-2, IL-3, GM-CSF, growth
hormone, tumor necrosis factor (e.g. TNF.alpha. or .beta.).
[0111] The biologically active molecule can include interferon
.alpha., whether synthetically or recombinantly produced, including
but not limited to, any one of the about twenty-five structurally
related subtypes, as for example interferon-.alpha.2a, now
commercially available for clinical use (ROFERON.RTM., Roche) and
interferon-.alpha.2b also approved for clinical use (INTRON.RTM.,
Schering) as well as genetically engineered versions of various
subtypes, including, but not limited to, commercially available
consensus interferon .alpha. (INFERGEN.RTM., Intermune, developed
by Amgen) and consensus human leukocyte interferon see, e.g., U.S.
Pat. Nos. 4,695,623; 4,897,471, interferon .beta., epidermal growth
factor, gonadotropin releasing hormone (GnRH), leuprolide, follicle
stimulating hormone, progesterone, estrogen, or testosterone.
[0112] A list of cytokines and growth factors which may be used in
the chimeric protein of the invention has been previously described
(see e.g. U.S. Pat. Nos. 6,086,875, 6,485,726, 6,030,613; WO
03/077834; US 2003-0235536A1).
[0113] b. Antiviral Agents
[0114] In one embodiment, the biologically active molecule is an
antiviral agent, including fragments and analogs thereof. An
antiviral agent can include any molecule that inhibits or prevents
viral replication, or inhibits or prevents viral entry into a cell,
or inhibits or prevents viral egress from a cell. In one
embodiment, the antiviral agent is a fusion inhibitor. In one
embodiment, the antiviral agent is a cytokine which inhibits viral
replication. In another embodiment, the antiviral agent is
interferon a.
[0115] The viral fusion inhibitor for use in the chimeric protein
can be any molecule which decreases or prevents viral penetration
of a cellular membrane of a target cell. The viral fusion inhibitor
can be any molecule that decreases or prevents the formation of
syncytia between at least two susceptible cells. The viral fusion
inhibitor can be any molecule that decreases or prevents the
joining of a lipid bilayer membrane of a eukaryotic cell and a
lipid bilayer of an enveloped virus. Examples of enveloped virus
include, but are not limited to HIV-1, HIV-2, SIV, influenza,
parainfluenza, Epstein-Barr virus, CMV, herpes simplex 1, herpes
simplex 2 and respiratory syncytia virus.
[0116] The viral fusion inhibitor can be any molecule that
decreases or prevents viral fusion including, but not limited to, a
polypeptide, a small organic molecule or a small inorganic
molecule. In one embodiment, the fusion inhibitor is a polypeptide.
In one embodiment, the viral fusion inhibitor is a polypeptide of
3-36 amino acids. In another embodiment, the viral fusion inhibitor
is a polypeptide of 3-50 amino acids, 10-65 amino acids, 10-75
amino acids. The polypeptide can be comprised of a naturally
occurring amino acid sequence (e.g. a fragment of gp41) including
analogs and mutants thereof or the polypeptide can be comprised of
an amino acid sequence not found in nature, so long as the
polypeptide exhibits viral fusion inhibitory activity.
[0117] In one embodiment, the viral fusion inhibitor is a
polypeptide, identified as being a viral fusion inhibitor using at
least one computer algorithm, e.g., ALLMOTI5, 107.times.178.times.4
and PLZIP (see e.g. U.S. Pat. Nos. 6,013,263; 6,015,881; 6,017,536;
6,020,459; 6,060,065; 6,068,973; 6,093,799; and 6,228,983).
[0118] In one embodiment, the viral fusion inhibitor is an HIV
fusion inhibitor. In one embodiment. HIV is HIV-1. In another
embodiment. HIV is HIV-2. In one embodiment, the HIV fusion
inhibitor is a polypeptide comprised of a fragment of the gp41
envelope protein of HIV-1. The HIV fusion inhibitor can comprise,
e.g., T20 (SEC) ID NO:1) or an analog thereof, T21 (SEQ ID NO:2) or
an analog thereof, T1249 (SEQ ID NO:3) or an analog thereof,
N.sub.CCGgp41 (Louis et al. 2001, J. Biol. Chem. 276:(31)29485) or
an analog thereof, or 5 helix (Root et al. 2001, Science 291:884)
or an analog thereof.
[0119] Assays known in the art can be used to test for viral fusion
inhibiting activity of a polypeptide, a small organic molecule, or
a small inorganic molecule. These assays include a reverse
transcriptase assay, a p24 assay, or syncytia formation assay (see
e.g. U.S. Pat. No. 5,464,933).
[0120] A list of antiviral agents which may be used in the chimeric
protein of the invention has been previously described (see e.g.
U.S. Pat. Nos. 6,086,875, 6,485,726, 6,030,613; WO 03/077834; US
2003-0235536A1).
[0121] c. Hemostatic Agents
[0122] In one embodiment, the biologically active molecule is a
clotting factor or other agent that promotes hemostasis, including
fragments and analogs thereof. The clotting factor can include any
molecule that has clotting activity or activates a molecule with
clotting activity. The clotting factor can be comprised of a
polypeptide. The clotting factor can be, as an example, but not
limited to Factor VIII, Factor IX, Factor XI, Factor XII,
fibrinogen, prothrombin, Factor V, Factor VII, Factor X, Factor
XIII or von Willebrand Factor. In one embodiment, the clotting
factor is Factor VII or Factor VIIa. The clotting factor can be a
factor that participates in the extrinsic pathway. The clotting
factor can be a factor that participates in the intrinsic pathway.
Alternatively, the clotting factor can be a factor that
participates in both the extrinsic and intrinsic pathway.
[0123] The clotting factor can be a human clotting factor or a
non-human clotting factor, e.g., derived from a non-human primate,
a pig or any mammal. The clotting factor can be chimeric clotting
factor, e.g., the clotting factor can comprise a portion of a human
clotting factor and a portion of a porcine clotting factor or a
portion of a first non-human clotting factor and a portion of a
second non-human clotting factor.
[0124] The clotting factor can be an activated clotting factor.
Alternatively, the clotting factor can be an inactive form of a
clotting factor, e.g., a zymogen. The inactive clotting factor can
undergo activation subsequent to being linked to at least a portion
of an immunoglobulin constant region. The inactive clotting factor
can be activated subsequent to administration to a subject.
Alternatively, the inactive clotting factor can be activated prior
to administration.
[0125] d. Other Proteinaceous Biologically Active Molecules
[0126] In one embodiment, the biologically active molecule is a
receptor or a fragment or analog thereof. The receptor can be
expressed on a cell surface, or alternatively the receptor can be
expressed on the interior of the cell. The receptor can be a viral
receptor, e.g., CD4, CCR5, CXCR4, CD21, CD46. The biologically
active molecule can be a bacterial receptor. The biologically
active molecule can be an extra-cellular matrix protein or fragment
or analog thereof, important in bacterial colonization and
infection (see e.g. U.S. Pat. Nos. 5,648,240; 5,189,015; 5,175,096)
or a bacterial surface protein important in adhesion and infection
(see e.g. U.S. Pat. No. 5,648,240). The biologically active
molecule can be a growth factor, hormone or cytokine receptor, or a
fragment or analog thereof, e.g., TNF.alpha. receptor, the
erythropoietin receptor, CD25. CD122, or CD132.
[0127] A list of other proteinaceous molecules which may be used in
the chimeric protein of the invention has been previously described
(see e.g. U.S. Pat. Nos. 6,086,875; 6,485,726; 6,030,613; WO
03/077834; US 2003-0235536A1).
[0128] e. Nucleic Acids
[0129] In one embodiment, the biologically active molecule is a
nucleic acid, e.g., DNA, RNA. In one specific embodiment, the
biologically active molecule is a nucleic acid that can be used in
RNA interference (RNAi). The nucleic acid molecule can be as an
example, but not as a limitation, an anti-sense molecule or a
ribozyme.
[0130] Antisense RNA and DNA molecules act to directly block the
translation of mRNA by hybridizing to targeted mRNA and preventing
protein translation. Antisense approaches involve the design of
oligonucleotides that are complementary to a target gene mRNA. The
antisense oligonucleotides will bind to the complementary target
gene mRNA transcripts and prevent translation. Absolute
complementarily, is not required.
[0131] A sequence "complementary" to a portion of an RNA, as
referred to herein, means a sequence having sufficient
complementarity to be able to hybridize with the RNA, forming a
stable duplex; in the case of double-stranded antisense nucleic
acids, a single strand of the duplex DNA may thus be tested, or
triplex formation may be assayed. The ability to hybridize will
depend on both the degree of complementarity and the length of the
antisense nucleic acid. Generally, the longer the hybridizing
nucleic acid, the more base mismatches with an RNA it may contain
and still form a stable duplex (or triplex, as the case may be).
One skilled in the art can ascertain a tolerable degree of mismatch
by use of standard procedures to determine the melting point of the
hybridized complex.
[0132] Antisense nucleic acids should be at least six nucleotides
in length, and are preferably oligonucleotides ranging from 6 to
about 50 nucleotides in length. In specific aspects, the
oligonucleotide is at least 10 nucleotides, at least 17
nucleotides, at least 25 nucleotides or at least 50
nucleotides.
[0133] The oligonucleotides can be DNA or RNA or chimeric mixtures
or derivatives or modified versions thereof, single-stranded or
double-stranded. The oligonucleotide can be modified at the base
moiety, sugar moiety, or phosphate backbone, for example, to
improve stability of the molecule, hybridization, etc. The
oligonucleotide may include other appended groups such as
polypeptides (e.g. for targeting host cell receptors in vivo), or
agents facilitating transport across the cell membrane (see e.g.
Letsinger et al. 1989, Proc. Natl. Acad. Sci. USA 86:6553; Lemaitre
et al. 1987, Proc. Natl. Acad. Sci. USA 84:648; WO 88/09810,) or
the blood-brain barrier (see e.g. WO 89/10134),
hybridization-triggered cleavage agents (see e.g. Krol et al. 1988,
Bio Techniques 6:958) or intercalating agents (see e.g. Zon 1988,
Pharm. Res. 5:539). To this end, the oligonucleotide may be
conjugated to another molecule, e.g., a polypeptide, hybridization
triggered cross-linking agent, transport agent, or
hybridization-triggered cleavage agent.
[0134] Ribozyme molecules designed to catalytically cleave target
gene mRNA transcripts can also be used to prevent translation of
target gene mRNA and, therefore, expression of target gene product.
(See e.g. WO 90/11364; Sarver et al. 1990, Science 247,
1222-1225).
[0135] Ribozymes are enzymatic RNA molecules capable of catalyzing
the specific cleavage of RNA. (see Rossi 1994, Current Biology
4:469). The mechanism of ribozyme action involves sequence specific
hybridization of the ribozyme molecule to complementary target RNA,
followed by an endonucleolytic cleavage event. The composition of
ribozyme molecules must include one or more sequences complementary
to the target gene mRNA, and must include the well known catalytic
sequence responsible for mRNA cleavage. For this sequence, see,
e.g., U.S. Pat. No. 5,093,246.
[0136] In one embodiment, ribozymes that cleave mRNA at site
specific recognition sequences can be used to destroy target gene
mRNAs. In another embodiment, the use of hammerhead ribozymes is
contemplated. Hammerhead ribozymes cleave mRNAs at locations
dictated by flanking regions that form complementary base pairs
with the target mRNA. The sole requirement is that the target mRNA
have the following sequence of two bases; 5'-UG-3'. The
construction and production of hammerhead ribozymes is well known
in the art and is described more fully in Myers 1995, Molecular
Biology and Biotechnology: A Comprehensive Desk Reference, VCH
Publishers, New York, and in Heseloff and Gerlach 1988, Nature,
334:585.
[0137] f. Small Molecules
[0138] The invention also contemplates the use of any therapeutic
small molecule or drug as the biologically active molecule in the
chimeric protein of the invention. A list of small molecules and
drugs which may be used in the chimeric protein of the invention
has been previously described (see e.g. U.S. Pat. Nos. 6,086,875;
6,485,726; 6,030,613; WO 03/077834; US 2003-0235536A1).
[0139] 2. Immunoglobulins
[0140] The chimeric proteins of the invention comprise at least a
portion of an immunoglobulin constant region. Immunoglobulins are
comprised of four protein chains that associate covalently--two
heavy chains and two light chains. Each chain is further comprised
of one variable region and one constant region. Depending upon the
immunoglobulin isotype, the heavy chain constant region is
comprised of 3 or 4 constant region domains (e.g. CH1, CH2, CH3,
CH4). Some isotypes are further comprised of a hinge region.
[0141] The portion of an immunoglobulin constant region can be
obtained from any mammal. The portion of an immunoglobulin constant
region can include a portion of a human immunoglobulin constant
region, a non-human primate immunoglobulin constant region, a
bovine immunoglobulin constant region, a porcine immunoglobulin
constant region, a murine immunoglobulin constant region, an ovine
immunoglobulin constant region or a rat immunoglobulin constant
region.
[0142] The portion of an immunoglobulin constant region can be
produced recombinantly or synthetically. The immunoglobulin can be
isolated from a cDNA library. The portion of an immunoglobulin
constant region can be isolated from a phage library (See e.g.
McCafferty et al. 1990, Nature 348:552, Kang et al. 1991, Proc.
Natl. Acad. Sci. USA 88:4363; EP 0 589 877 B1). The portion of an
immunoglobulin constant region can be obtained by gene shuffling of
known sequences (Mark et al. 1992, Bio/Technol. 10:779). The
portion of an immunoglobulin constant region can be isolated by in
vivo recombination (Waterhouse et al. 1993, Nucl. Acid Res.
21:2265). The immunoglobulin can be a humanized immunoglobulin
(U.S. Pat. No. 5,585,089, Jones et al. 1986. Nature 332:323).
[0143] The portion of an immunoglobulin constant region can include
a portion of an IgG, an IgA, an IgM, an IgD, or an IgE. In one
embodiment, the immunoglobulin is an IgG. In another embodiment,
the immunoglobulin is IgG1. In another embodiment, the
immunoglobulin is IgG2.
[0144] The portion of an immunoglobulin constant region can include
the entire heavy chain constant region, or a fragment or analog
thereof. In one embodiment, a heavy chain constant region can
comprise a CH1 domain, a CH2 domain, a CH3 domain, and/or a hinge
region. In another embodiment, a heavy chain constant region can
comprise a CH1 domain, a CH2 domain, a CH3 domain, and/oro CH4
domain.
[0145] The portion of an immunoglobulin constant region can include
an Fc fragment. An Fc fragment can be comprised of the CH2 and CH3
domains of an immunoglobulin and the hinge region of the
immunoglobulin. The Fc fragment can be the Fc fragment of an IgG1,
an IgG2, an IgG3 or an IgG4. In one specific embodiment, the
portion of an immunoglobulin constant region is an Fc fragment of
an IgG1. In another embodiment, the portion of an immunoglobulin
constant region is an Fc fragment of an IgG2.
[0146] In another embodiment, the portion of an immunoglobulin
constant region is an Fc neonatal receptor (FcRn) binding partner.
An FcRn binding partner is any molecule that can be specifically
bound by the FcRn receptor with consequent active transport by the
FcRn receptor of the FcRn binding partner. Specifically bound
refers to two molecules forming a complex that is relatively stable
under physiologic conditions. Specific binding is characterized by
a high affinity and a low to moderate capacity as distinguished
from nonspecific binding which usually has a low affinity with a
moderate to high capacity. Typically, binding is considered
specific when the affinity constant K.sub.A is higher than 10.sup.6
M.sup.-1, or more preferably higher than 10.sup.8 M.sup.-1. If
necessary, non-specific binding can be reduced without
substantially affecting specific binding by varying the binding
conditions. The appropriate binding conditions such as
concentration of the molecules, ionic strength of the solution,
temperature, time allowed for binding, concentration of a blocking
agent (e.g. serum albumin, milk casein), etc., may be optimized by
a skilled artisan using routine techniques.
[0147] The FcRn receptor has been isolated from several mammalian
species including humans. The sequences of the human FcRn, monkey
FcRn rat FcRn, and mouse FcRn are known (Story et al. 1994, J. Exp.
Med. 180:2377). The FcRn receptor binds IgG (but not other
immunoglobulin classes such as IgA, IgM, IgD, and IgE) at
relatively low pH, actively transports the IgG transcellularly in a
luminal to serosal direction, and then releases the IgG at
relatively higher pH found in the interstitial fluids. It is
expressed in adult epithelial tissue (U.S. Pat. Nos. 6,485,726,
6,030,613, 6,086,875; WO 03/077834; US 2003-0235536A1) including
lung and intestinal epithelium (Israel et al. 1997, Immunology
92:69) renal proximal tubular epithelium (Kobayashi et al. 2002,
Am. J. Physiol. Renal Physiol. 282:F358) as well as nasal
epithelium, vaginal surfaces, and biliary tree surfaces.
[0148] FcRn binding partners of the present invention encompass any
molecule that can be specifically bound by the FcRn receptor
including whole IgG, the Fc fragment of IgG, and other fragments
that include the complete binding region of the FcRn receptor. The
region of the Fc portion of IgG that binds to the FcRn receptor has
been described based on X-ray crystallography (Burmeister et al.
1994, Nature 372:379). The major contact area of the Fc with the
FcRn is near the junction of the CH2 and CH3 domains. Fc-FcRn
contacts are all within a single Ig heavy chain. The FcRn binding
partners include whole IgG, the Fc fragment of IgG, and other
fragments of IgG that include the complete binding region of FcRn.
The major contact sites include amino acid residues 248, 250-257,
272, 285, 288, 290-291, 308-311, and 314 of the CH2 domain and
amino acid residues 385-387, 428, and 433-436 of the CH3 domain.
References made to amino acid numbering of immunoglobulins or
immunoglobulin fragments, or regions, are all based on Kabat et al.
1991, Sequences of Proteins of Immunological Interest, U.S.
Department of Public Health, Bethesda, Md.
[0149] The Fc region of IgG can be modified according to well
recognized procedures such as site directed mutagenesis and the
like to yield modified IgG or Fc fragments or portions thereof that
will be bound by FcRn. Such modifications include modifications
remote from the FcRn contact sites as well as modifications within
the contact sites that preserve or even enhance binding to the
FcRn. For example, the following single amino acid residues in
human IgG1 Fc (Fc.gamma.1) can be substituted without significant
loss of Fc binding affinity for FcRn: P238A, S239A, K246A, K248A,
D249A, M252A, T256A, E258A, T260A, D265A, S267A, H268A, E269A,
D270A, E272A, L274A, N276A, Y278A, D280A, V282A, E283A, H285A,
N286A, T289A, K290A, R292A, E293A, E294A, Q295A, Y296F, N297A,
S298A, Y300F, R301A, V303A, V305A, T307A, L309A, Q311A, D312A,
N315A, K317A, E318A, K320A, K322A, S324A, K326A, A327Q, P329A,
A330Q, P331A, E333A, K334A, T335A, S337A, K338A, K340A, Q342A,
R344A, E345A, Q347A, R355A, E356A, M358A, T359A, K360A, N361A,
Q362A, Y373A, S375A, D376A, A378Q, E380A, E382A, S383A ,N384A,
Q386A, E388A, N389A, N390A, Y391F, K392A, L398A, S400A, D401A,
D413A, K414A, R416A, Q418A, Q419A, N421A, V422A, S424A, E430A,
N434A, T437A, Q438A, K439A, S440A, S444A, and K447A, where for
example P238A represents wildtype proline substituted by alanine at
position number 238. In addition to alanine other amino acids may
be substituted for the wildtype amino acids at the positions
specified above. Mutations may be introduced singly into Fc giving
rise to more than one hundred FcRn binding partners distinct from
native Fc. Additionally, combinations of two, three, or more of
these individual mutations may be introduced together, giving rise
to hundreds more FcRn binding partners. Moreover, one of the FcRn
binding partners may be mutated and the other not, or they both may
different mutations.
[0150] Certain of the above mutations may confer new functionality
upon the FcRn binding partner. For example, one embodiment
incorporates N297A, removing a highly conserved N-glycosylation
site. The effect of this mutation is to reduce immunogenicity,
thereby enhancing circulating half life of the FcRn binding
partner, and to render the FcRn binding partner incapable of
binding to Fc.gamma.RI, Fc.gamma.RIIA, Fc.gamma.RIIB, and
Fc.gamma.RIIIA, without compromising affinity for FcRn (Routledge
et al. 1995, Transplantation 60:847; Friend et al. 1999.
Transplantation 68:1632; Shields et al. 1995, J. Biol. Chem.
276:6591). As a further example of new functionality arising from
mutations described above affinity for FcRn may be increased beyond
that of wild type in some instances. This increased affinity may
reflect an increased "on" rate, a decreased "off" rate or both an
increased "on" rate and a decreased "off" rate. Mutations believed
to impart an increased affinity for FcRn include T256A, T307A,
E380A, and N434A (Shields et al. 2001, J. Biol. Chem. 276:6591).
Any of the described mutations, including N597A, can be used to
modify Fc, regardless of the biologically active molecule.
[0151] Additionally, at least three human Fe gamma receptors appear
to recognize a binding site on IgG within the lower hinge region,
generally amino acids 234-237. Therefore, another example of new
functionality and potential decreased immunogenicity may arise from
mutations of this region, as for example by replacing amino acids
233-236 of human IgG1 "ELLG" to the corresponding sequence from
IgG2 "PVA" (with one amino acid deletion). It has been shown that
Fc.gamma.RI. Fc.gamma.RII, and Fc.gamma.RIII, which mediate various
effector functions will not bind to IgG1 when such mutations have
been introduced. Ward and Ghetie 1995, Therapeutic Immunology 2:77
and Armour et al.1999, Eur. J. lmmunol. 29:2613.
[0152] In one embodiment, the FcRn binding partner is a polypeptide
including the sequence PKNSSMISNTP (SEQ ID NO:26) and optionally
further including a sequence selected from HQSLGTQ (SEQ ID NO:27),
HQNLSDGK (SEQ ID NO:28), HQNISDGK (SEQ ID NO:29), or VISSHLGQ (SEQ
ID NO:30) (U.S. Pat. No. 5,739,277).
[0153] Two FcRn receptors can bind a single Fc molecule.
Crystallographic data suggest that each FcRn molecule binds a
single polypeptide of the Fc homodimer. In one embodiment, linking
the FcRn binding partner, e.g., an Fc fragment of an IgG, to a
biologically active molecule provides a means of delivering the
biologically active molecule orally, buccally, sublingually,
rectally, vaginally, as an aerosol administered nasally or via a
pulmonary route, or via an ocular route. In another embodiment, the
chimeric protein can be administered invasively, e.g.,
subcutaneously, intravenously.
[0154] The skilled artisan will understand that portions of an
immunoglobulin constant region for use in the chimeric protein of
the invention can include mutants or analogs thereof, or can
include chemically modified immunoglobulin constant regions (e.g.
pegylated), or fragments thereof (see e.g. Aslam and Dent 1998,
Bioconjugation: Protein Coupling Techniques For the Biomedical
Sciences Macmilan Reference, London). In one instance, a mutant can
provide for enhanced binding of an FcRn binding partner for the
FcRn. Also contemplated for use in the chimeric protein of the
invention are peptide mimetics of at least a portion of an
immunoglobulin constant region, e.g., a peptide mimetic of an Fc
fragment or a peptide mimetic of an FcRn binding partner. In one
embodiment, the peptide mimetic is identified using phage display
or via chemical library screening (see e.g. McCafferty et al. 1990,
Nature 348:552, Kang et al. 1991, Proc. Natl. Acad. Sci. USA
88:4363; EP 0 589 877 B1).
[0155] 3. Optional Linkers
[0156] The chimeric protein of the invention can optionally
comprise at least one linker molecule. The linker can be comprised
of any organic molecule. In one embodiment, the linker is
polyethylene glycol (PEG). In another embodiment, the linker is
comprised of amino acids. The linker can comprise 1-5 amino acids,
1-10 amino acids, 1-20 amino acids, 10-50 amino acids, 50-100 amino
acids, 100-200 amino acids. In one embodiment, the linker is the
eight amino acid linker EFAGAAAV (SEQ ID NO:31). Any of the linkers
including EFAGAAV, can be used regardless of the biologically
active molecule.
[0157] The linker can comprise the sequence G.sub.n. The linker can
comprise the sequence (GA).sub.n (SEC) ID NO:32). The linker can
comprise the sequence (GGS).sub.n (SEQ ID NO:33). The linker can
comprise the sequence (GGS).sub.n(GGGGS).sub.n (SEQ ID NO:34). In
these instances, n may be an integer from 1-10, i.e., 1.2. 3.4. 5,
6, 7, 8, 9, 10. Examples of linkers include, but are not limited
to, GGG (SEQ ID NO:35), SGGSGGS (SEQ ID NO:36), GGSGGSGGSGGSGGG
(SEQ ID NO:37), GGSGGSGGGGSGGGGS (SEQ ID NO:38), GGSGGSGGSGGSGGSGGS
(SEQ ID NO:39). The linker does not eliminate or diminish the
biological activity of the chimeric protein. Optionally, the linker
enhances the biological activity of the chimeric protein, e.g., by
further diminishing the effects of steric hindrance and making the
biologically active molecule more accessible to its target binding
site.
[0158] In one specific embodiment, the linker for interferon
.alpha. is 15-25 amino acids long. In another specific embodiment,
the linker for interferon .alpha. is 15-20 amino acids long. In
another specific embodiment, the linker for interferon .alpha. is
10-25 amino acids long. In another specific embodiment, the linker
for interferon .alpha. is 15 amino acids long. In one embodiment,
the linker for interferon .alpha. is (GGGGS).sub.n (SEQ ID NO:40)
where G represents glycine, S represents serine and n is an integer
from 1-10. In a specific embodiment, n is 3.
[0159] The linker may also incorporate a moiety capable of being
cleaved either chemically (e.g. hydrolysis of an ester bond),
enzymatically (i.e. incorporation of a protease cleavage sequence)
or photolytically (e.g., a chromophore such as
3-amino-3-(2-nitrophenyl)proprionic acid (ANP)) in order to release
the biologically active molecule from the Fc protein.
[0160] In certain embodiments, the linker is a branching molecule.
A branching molecule can be used to link a plurality of
biologically active molecules to a portion of an immunoglobulin
constant region, e.g. an Fc fragment. Alternatively, a branching
molecule could be used to link more than one portion of an
immunoglobulin constant region to a single biologically active
molecule, i.e. a dimerically linked monomer dimer hybrid. Branching
molecules may be comprised of at least two different functional
groups. The first functional group may bind to the portion of the
immunoglobulin constant region. The second functional group may
bind to the biological molecule of interest. The number of each
type of functional group will vary depending on the number of
biologically active molecules or portions of an immunoglobulin
constant region desired. Thus, in one example, a branching molecule
which may be used for a dimerically linked monomer dimer hybrid
will have two copies of a first functional group which will bind to
the 2 Fc fragments for example, and a single copy of the second
functional group which will bind to the biologically active
molecule.
[0161] The linker attached to the N-terminus of CysFc may also
contain both a thioester and a protected hydrazine as shown
below.
##STR00002##
[0162] Attachment of the linker to CysFc via the thioester (native
ligation), followed by a 4 hour treatment of the protein-linker
conjugate at pH 4.6, can reveal the free hydrazine. This
effectively generates Fc labeled with a hydrazine specifically at
the N-terminus which can then react specifically with aldehydes to
form hydrazones. This technique may be advantageous when the
synthesis of a thioester on an bioactive molecule is not easily
accessible (e.g., a phosphorothioate oligonucloetide
thioester).
[0163] The skilled artisan will appreciate that a vast number of
linkers which are branching molecules are possible. Two examples of
linkers which are branching molecules are shown below. The first
molecule is 4-aminoglycine-3-methylaminoglycine-benzoic acid. The
amines can be converted into thioesters for attachment to the two
N-terminal Cys of Fc. The carboxylic acid can be used to attach any
biological molecule of interest, including polypeptides and small
molecules.
##STR00003##
[0164] The dipeptide Gly-Glu is shown below. Here the
functionalities include two carboxylic acids and one amine. The
carboxylic acids may be converted to thioesters and the amine is
used to attach a biological molecule of interest.
##STR00004##
[0165] Two more examples of branching molecules which can used as
linkers in synthesizing the chimeric proteins of the invention are
shown below. Linker 1 is N,N-bis(3-aminopropyl)glycine. Linker 2 is
a .beta.-alanine-lysine dipeptide.
##STR00005##
[0166] Each molecule has three functionalities for further
derivatization where two of the functionalities are the same. In
the case of these linkers, the two amino groups (NH.sub.2) in each
molecule can be derivatized to thioesters for eventual reaction
with the two N-terminal cysteines on Cys-Fc. The carboxylic acid
group (COOH) group can be functionalized with any sort of molecule.
As an example a small molecule derivatized with linker 1 at its
carboxylic acid and derivatized with two thioesters at its amino
groups could be synthesized.
[0167] 4. Chimeric Protein Dimerization Using Specific Binding
Partners
[0168] In one embodiment, the chimeric protein of the invention
comprises a first polypeptide chain comprising at least a first
domain, said first domain having at least one specific binding
partner, and a second polypeptide chain comprising at least a
second domain, wherein said second domain, is a specific binding
partner of said first domain. The chimeric protein thus comprises a
polypeptide capable of dimerizing with another polypeptide due to
the interaction of the first domain and the second domain. Methods
of dimerizing antibodies using heterologous domains are known in
the art (U.S. Pat. Nos.: 5,807,706 and 5,910,573; Kostelny et al.
1992, J. Immunol. 148(5):1547).
[0169] Dimerization can occur by formation of a covalent bond, or
alternatively a non-covalent bond, e.g., hydrophobic interaction,
Van der Waal's forces, interdigitation of amphiphilic peptides such
as, but not limited to, alpha helices, charge-charge interactions
of amino acids bearing opposite charges, such as, but not limited
to, lysine and aspartic acid, arginine and glutamic acid. In one
embodiment, the domain is a helix bundle comprising a helix, a turn
and another helix. In another embodiment, the domain is a leucine
zipper comprising a peptide having several repeating amino acids in
which every seventh amino acid is a leucine residue. In one
embodiment, the specific binding partners are fos/jun. (see Branden
et al. 1991, Introduction To Protein Structure, Garland Publishing,
New York).
[0170] In another embodiment, binding is mediated by a chemical
linkage (see e.g. Brennan et al. 1985, Science 229:81). In this
embodiment, intact immunoglobulins, or chimeric proteins comprised
of at least a portion of an immunoglobulin constant region are
cleaved to generate heavy chain fragments. These fragments are
reduced in the presence of the dithiol complexing agent sodium
arsenite to stabilize vicinal dithiols and prevent intermolecular
disulfide formation. The fragments generated are then converted to
thionitrobenzoate (TNB) derivatives. One of the TNB derivatives is
then reconverted to the heavy chain fragment thiol by reduction
with mercaptoethylamine and is then mixed with an equimolar amount
of the other TNB derivative to form a chimeric dimer.
E. Nucleic Acids
[0171] The invention relates to a first nucleic acid construct and
a second nucleic acid construct each comprising a nucleic acid
sequence encoding at least a portion of the chimeric protein of the
invention. In one embodiment, the first nucleic acid construct
comprises a nucleic acid sequence encoding a portion of an
immunoglobulin constant region operatively linked to a second DNA
sequence encoding a biologically active molecule, and said second
DNA construct comprises a DNA sequence encoding an immunoglobulin
constant region without the second DNA sequence encoding a
biologically active molecule.
[0172] The biologically active molecule can include, for example,
but not as a limitation, a viral fusion inhibitor, a clotting
factor, a growth factor or hormone, or a receptor, or analog, or
fragment of any of the preceding. The nucleic acid sequences can
also include additional sequences or elements known in the art
(e.g., promoters, enhancers, poly A sequences, affinity tags). In
one embodiment, the nucleic acid sequence of the second construct
can optionally include a nucleic acid sequence encoding a linker
placed between the nucleic acid sequence encoding the biologically
active molecule and the portion of the immunoglobulin constant
region. The nucleic acid sequence of the second DNA construct can
optionally include a linker sequence placed before or after the
nucleic acid sequence encoding the biologically active molecule
and/or the portion of the immunoglobulin constant region.
[0173] In one embodiment, the nucleic acid construct is comprised
of DNA. In another embodiment, the nucleic acid construct is
comprised of RNA. The nucleic acid construct can be a vector, e.g.,
a viral vector or a plasmid. Examples of viral vectors include, but
are not limited to adeno virus vector, an adeno associated virus
vector or a murine leukemia virus vector. Examples of plasmids
include but are not limited to pUC, pGEM and pGEX.
[0174] Due to the known degeneracy of the genetic code, wherein
more than one codon can encode the same amino acid, a DNA sequence
can vary from the native sequence and still encode a polypeptide
corresponding to th enaturally occurring amino acid sequence of SEQ
ID NOS:6, 8, 10, 12, 14, 16, 18, 20, 22 or 24, respectively. Such
variant DNA sequences can result from silent mutations (e.g.
occurring during PCR amplification), or can be the product of
deliberate mutagenesis of a native sequence. Of course,
polypeptides encoded by such DNA sequences are encompassed by the
invention.
[0175] In another embodiment, the nucleic acid molecules comprising
a sequence encoding the chimeric protein of the invention can also
comprise nucleotide sequences that are at least 80% identical to a
native sequence. Also contemplated are embodiments in which a
nucleic acid molecules comprising a sequence encoding the chimeric
protein of the invention comprises a sequence that is at least 90%
identical, at least 95% identical, at least 98% identical, at least
99% identical, or at least 99.9% identical to a native sequence. A
native sequence can include any DNA sequence not altered by the
human hand. The percent identity may be determined by visual
inspection and mathematical calculation. Alternatively, the percent
identity of two nucleic acid sequences can be determined by
comparing sequence information using the GAP computer program,
version 6.0 described by Devereux et al. 1984, Nucl. Acids Res.
12:387, and available from the University of Wisconsin Genetics
Computer Group (UWGCG). The preferred default parameters for the
GAP program include: (1) a unary comparison matrix (containing a
value of 1 for identities and 0 for nonidentities) for nucleotides,
and the weighted comparison matrix of Gribskov and Burgess 1986,
Nucl. Acids Res. 14:6745, as described by Schwartz and Dayhoff,
eds. 1979. Atlas of Protein Sequence and Structure, National
Biomedical Research Foundation, pp. 353-358; (2) a penalty of 3.0
for each gap and an additional 0.10 penalty for each symbol in each
gap; and (3) no penalty for end gaps. Other programs used by one
skilled in the art of sequence comparison may also be used.
F. Methods of Using Chimeric Proteins
[0176] The chimeric proteins of the invention have many uses as
will be recognized by one skilled in the art, including, but not
limited to methods of treating a subject with a disease or
condition. The disease or condition can include, but is not limited
to, a viral infection, a hemostatic disorder, anemia, cancer,
leukemia, an inflammatory condition or an autoimmune disease (e.g.
arthritis, psoriasis, lupus erythematosus, multiple sclerosis), or
a bacterial infection (see e.g. U.S. Pat. Nos. 6,086,875,
6,030,613, 6,485,726; WO 03/077834; US 2003-0235536A1).
[0177] 1. Methods of Treating a Subject with a Red Blood Cell
Deficiency
[0178] The invention relates to a method of treating a subject
having a deficiency of red blood cells, e.g., anemia, comprising
administering a therapeutically effective amount of at least one
chimeric protein, wherein the chimeric protein comprises a first
and a second polypeptide chain, wherein the first chain comprises
at least a portion of an immunoglobulin constant region and at
least one agent capable of inducing proliferation of red blood
cells, e.g., EPO, and the second polypeptide chain comprises at
least a portion of an immunoglobulin without the agent capable of
inducing red blood cell proliferation of the first chain.
[0179] 2. Methods of Treating a Subject with a Viral Infection
[0180] The invention relates to a method of treating a subject
having a viral infection or exposed to a virus comprising
administering a therapeutically effective amount of at least one
chimeric protein, wherein the chimeric protein comprises a first
and a second polypeptide chain, wherein the first chain comprises
at least a portion of an immunoglobulin constant region and at
least one antiviral agent, e.g., a fusion inhibitor or interferon
.alpha. and the second polypeptide chain comprises at least a
portion of an immunoglobulin without the antiviral agent of the
first chain. In one embodiment, the subject is infected with a
virus which can be treated with IFN.alpha., e.g., hepatitis C
virus. In one embodiment, the subject is infected with HIV, such as
HIV-1 or HIV-2.
[0181] In one embodiment, the chimeric protein of the invention
inhibits viral replication. In one embodiment, the chimeric protein
of the invention prevents or inhibits viral entry into target
cells, thereby stopping, preventing, or limiting the spread of a
viral infection in a subject and decreasing the viral burden in an
infected subject. By linking a portion of an immunoglobulin to a
viral fusion inhibitor the invention provides a chimeric protein
with viral fusion inhibitory activity with greater stability and
greater bioavailability compared to viral fusion inhibitors alone,
e.g., T20, T21, T1249. Thus, in one embodiment, the viral fusion
inhibitor decreases or prevents HIV infection of a target cell,
e.g., HIV-1.
[0182] a. Conditions that may be Treated
[0183] The chimeric protein of the invention can be used to inhibit
or prevent the infection of a target cell by a hepatitis virus,
e.g., hepatitis virus C. The chimeric protein may comprise an
anti-viral agent which inhibits viral replication.
[0184] In one embodiment, the chimeric protein of the invention
comprises a fusion inhibitor. The chimeric protein of the invention
can be used to inhibit or prevent the infection of any target cell
by any virus (see e.g. U.S. Pat. Nos. 6,086,875, 6,030,613,
6,485,726; WO 03/077834; US 2003-0235536A1). In one embodiment, the
virus is an enveloped virus such as, but not limited to HIV, SIV,
measles, influenza, Epstein-Barr virus, respiratory syncytia virus,
or parainfluenza virus. In another embodiment, the virus is a
non-enveloped virus such as rhino virus or polio virus
[0185] The chimeric protein of the invention can be used to treat a
subject already infected with a virus. The subject can be acutely
infected with a virus. Alternatively, the subject can be
chronically infected with a virus. The chimeric protein of the
invention can also be used to prophylactically treat a subject at
risk for contracting a viral infection, e.g., a subject known or
believed to in close contact with a virus or subject believed to be
infected or carrying a virus. The chimeric protein of the invention
can be used to treat a subject who may have been exposed to a
virus, but who has not yet been positively diagnosed.
[0186] In one embodiment, the invention relates to a method of
treating a subject infected with HCV comprising administering to
the subject a therapeutically effective amount of a chimeric
protein, wherein the chimeric protein comprises an Fc fragment of
an IgG and a cytokine, e.g., IFN.alpha..
[0187] In one embodiment, the invention relates to a method of
treating a subject infected with HIV comprising administering to
the subject a therapeutically effective amount of a chimeric
protein wherein the chimeric protein comprises an Fc fragment of an
IgG and the viral fusion inhibitor comprises T20.
[0188] 3. Methods of Treating a Subject Having a Hemostatic
Disorder
[0189] The invention relates to a method of treating a subject
having a hemostatic disorder comprising administering a
therapeutically effective amount of at least one chimeric protein,
wherein the chimeric protein comprises a first and a second chain,
wherein the first chain comprises at least one clotting factor and
at least a portion of an immunoglobulin constant region, and the
second chain comprises at least a portion of an immunoglobulin
constant region.
[0190] The chimeric protein of the invention treats or prevents a
hemostatic disorder by promoting the formation of a fibrin clot.
The chimeric protein of the invention can activate any member of a
coagulation cascade. The clotting factor can be a participant in
the extrinsic pathway, the intrinsic pathway or both. In one
embodiment, the clotting factor is Factor VII or Factor VIIa.
Factor VIIa can activate Factor X which interacts with Factor Va to
cleave prothrombin to thrombin, which in turn cleaves fibrinogen to
fibrin. In another embodiment, the clotting factor is Factor IX or
Factor IXa. In yet another embodiment, the clotting factor is
Factor VIII or Factor VIIIa. In yet another embodiment, the
clotting factor is von Willebrand Factor, Factor XI, Factor XII,
Factor V, Factor X or Factor XIII.
[0191] a. Conditions that may be Treated
[0192] The chimeric protein of the invention can be used to treat
any hemostatic disorder. The hemostatic disorders that may be
treated by administration of the chimeric protein of the invention
include, but are not limited to, hemophilia A, hemophilia B, von
Willebrand's disease, Factor XI deficiency (PTA deficiency), Factor
XII deficiency, as well as deficiencies or structural abnormalities
in fibrinogen, prothrombin, Factor V, Factor VII, Factor X, or
Factor XIII.
[0193] In one embodiment, the hemostatic disorder is an inherited
disorder. In one embodiment, the subject has hemophilia A, and the
chimeric protein comprises Factor VIII or Factor VIIIa. In another
embodiment, the subject has hemophilia A and the chimeric protein
comprises Factor VII or Factor VIIa. In another embodiment, the
subject has hemophilia B and the chimeric protein comprises Factor
IX or Factor IXa. In another embodiment, the subject has hemophilia
B and the chimeric protein comprises Factor VII or Factor VIIa. In
another embodiment, the subject has inhibitory antibodies to Factor
VIII or Factor VIIIa and the chimeric protein comprises Factor VII
or Factor VIIa. In yet another embodiment, the subject has
inhibitory antibodies against Factor IX or Factor IXa and the
chimeric protein comprises Factor VII or Factor VIIa.
[0194] The chimeric protein of the invention can be used to
prophylactically treat a subject with a hemostatic disorder. The
chimeric protein of the invention can be used to treat an acute
bleeding episode in a subject with a hemostatic disorder
[0195] In one embodiment, the hemostatic disorder is the result of
a deficiency in a clotting factor, e.g., Factor IX, Factor VIII. In
another embodiment, the hemostatic disorder can be the result of a
defective clotting factor, e.g., von Willebrand's Factor.
[0196] In another embodiment, the hemostatic disorder can be an
acquired disorder. The acquired disorder can result from an
underlying secondary disease or condition. The unrelated condition
can be, as an example, but not as a limitation, cancer, an
autoimmune disease, or pregnancy. The acquired disorder can result
from old age or from medication to treat an underlying secondary
disorder (e.g. cancer chemotherapy).
[0197] 4. Methods of Treating a Subject in Need of a General
Hemostatic Agent
[0198] The invention also relates to methods of treating a subject
that does not have a hemostatic disorder or a secondary disease or
condition resulting in acquisition of a hemostatic disorder. The
invention thus relates to a method of treating a subject in need of
a general hemostatic agent comprising administering a
therapeutically effective amount of at least one chimeric protein,
wherein the chimeric protein comprises a first and a second
polypeptide chain wherein the first polypeptide chain comprises at
least a portion of an immunoglobulin constant region and at least
one clotting factor and the second chain comprises at least a
portion of an immunoglobulin constant region without the clotting
factor of the first polypeptide chain.
[0199] a. Conditions that may be Treated
[0200] In one embodiment, the subject in need of a general
hemostatic agent is undergoing, or is about to undergo, surgery.
The chimeric protein of the invention can be administered prior to
or after surgery as a prophylactic. The chimeric protein of the
invention can be administered during or after surgery to control an
acute bleeding episode. The surgery can include, but is not limited
to, liver transplantation, liver resection, or stem cell
transplantation.
[0201] The chimeric protein of the invention can be used to treat a
subject having an acute bleeding episode who does not have a
hemostatic disorder. The acute bleeding episode can result from
severe trauma, e.g., surgery, an automobile accident, wound,
laceration gun shot, or any other traumatic event resulting in
uncontrolled bleeding.
[0202] 5. Treatment Modalities
[0203] The chimeric protein of the invention can be administered
intravenously, subcutaneously, intra-muscularly, or via any mucosal
surface, e.g., orally, sublingually, buccally, sublingually,
nasally, rectally, vaginally or via pulmonary route. The chimeric
protein can be implanted within or linked to a biopolymer solid
support that allows for the slow release of the chimeric protein to
the desired site.
[0204] The dose of the chimeric protein of the invention will vary
depending on the subject and upon the particular route of
administration used. Dosages can range from 0.1 to 100,000 .mu.g/kg
body weight. In one embodiment, the dosing range is 0.1-1,000
.mu.g/kg. The protein can be administered continuously or at
specific timed intervals. In vitro assays may be employed to
determine optimal dose ranges and/or schedules for administration.
Many in vitro assays that measure viral infectivity are known in
the art. For example, a reverse transcriptase assay, or an it PCR
assay or branched DNA assay can be used to measure HIV
concentrations. A StaClot assay can be used to measure clotting
activity. Additionally, effective doses may be extrapolated from
dose-response curves obtained from animal models.
[0205] The invention also relates to a pharmaceutical composition
comprising a viral fusion inhibitor, at least a portion of an
immunoglobulin and a pharmaceutically acceptable carrier or
excipient. Examples of suitable pharmaceutical carriers are
described in Remington's Pharmaceutical Sciences by E. W. Martin.
Examples of excipients can include starch, glucose, lactose,
sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium
stearate, glycerol monostearate, talc, sodium chloride, dried skim
milk, glycerol, propylene, glycol, water, ethanol, and the like.
The composition can also contain pH buffering reagents, and wetting
or emulsifying agents.
[0206] For oral administration, the pharmaceutical composition can
take the form of tablets or capsules prepared by conventional
means. The composition can also be prepared as a liquid for example
a syrup or a suspension. The liquid can include suspending agents
(e.g. sorbitol syrup, cellulose derivatives or hydrogenated edible
fats), emulsifying agents (lecithin or acacia), non-aqueous
vehicles (e.g. almond oil, oily esters, ethyl alcohol, or
fractionated vegetable oils), and preservatives (e.g. methyl or
propyl-p-hydroxybenzoates or sorbic acid). The preparations can
also include flavoring, coloring and sweetening agents.
Alternatively, the composition can be presented as a dry product
for constitution with water or another suitable vehicle.
[0207] For buccal and sublingual administration the composition may
take the form of tablets, lozenges or fast dissolving films
according to conventional protocols.
[0208] For administration by inhalation, the compounds for use
according to the present invention are conveniently delivered in
the form of an aerosol spray from a pressurized pack or nebulizer
(e.g. in PBS), with a suitable propellant, e.g.,
dichlorodifluoromethane, trichlorofluoromethane,
dichlorotetrafluoromethane, carbon dioxide or other suitable gas.
In the case of a pressurized aerosol the dosage unit can be
determined by providing a valve to deliver a metered amount.
Capsules and cartridges of, e.g., gelatin for use in an inhaler or
insufflator can be formulated containing a powder mix of the
compound and a suitable powder base such as lactose or starch.
[0209] The pharmaceutical composition can be formulated for
parenteral administration (i.e. intravenous or intramuscular) by
bolus injection. Formulations for injection can be presented in
unit dosage form, e.g., in ampoules or in multidose containers with
an added preservative. The compositions can take such forms as
suspensions, solutions, or emulsions in oily or aqueous vehicles,
and contain formulatory agents such as suspending, stabilizing
and/or dispersing agents. Alternatively, the active ingredient can
be in powder form for constitution with a suitable vehicle, e.g.,
pyrogen free water.
[0210] The pharmaceutical composition can also be formulated for
rectal administration as a suppository or retention enema, e.g.,
containing conventional suppository bases such as cocoa butter or
other glycerides.
[0211] 6. Combination Therapy
[0212] The chimeric protein of the invention can be used to treat a
subject with a disease or condition in combination with at least
one other known agent to treat said disease or condition.
[0213] In one embodiment, the invention relates to a method of
treating a subject infected with HIV comprising administering a
therapeutically effective amount of at least one chimeric protein
comprising a first and a second chain, wherein the first chain
comprises an HIV fusion inhibitor and at least a portion of an
immunoglobulin constant region and the second chain comprises at
least a portion of an immunoglobulin without an HIV fusion
inhibitor of the first chain, in combination with at least one
other anti-HIV agent. Said other anti-HIV agent can be any
therapeutic with demonstrated anti-HIV activity. Said other
anti-HIV agent can include, as an example, but not as a limitation,
a protease inhibitor (e.g. Amprenavir.RTM., Crixivan.RTM.,
Ritonivir.RTM.), a reverse transcriptase nucleoside analog (e.g.
AZT, DDI, D4T, 3TC, Ziagen.RTM.), a nonnucleoside analog reverse
transcriptase inhibitor (e.g. Sustiva.RTM.), another HIV fusion
inhibitor, a neutralizing antibody specific to HIV, an antibody
specific to CD4, a CD4 mimic, e.g., CD4-IgG2 fusion protein (U.S.
patent application Ser. No. 09/912,824) or an antibody specific to
CCR5, or CXCR4, or a specific binding partner of CCR5, or
CXCR4.
[0214] In another embodiment, the invention relates to a method of
treating a subject with a hemostatic disorder comprising
administering a therapeutically effective amount of at least one
chimeric protein comprising a first and a second chain, wherein the
first chain comprises at least one clotting factor and at least a
portion of an immunoglobulin constant region and the second chain
comprises at least a portion of an immunoglobulin constant region
without the clotting factor of the first chain, in combination with
at least one other clotting factor or agent that promotes
hemostasis. Said other clotting factor or agent that promotes
hemostasis can be any therapeutic with demonstrated clotting
activity. As an example, but not as a limitation, the clotting
factor or hemostatic agent can include Factor V, Factor VII, Factor
VIII, Factor IX, Factor X, Factor XI, Factor XII, Factor XIII,
prothrombin, or fibrinogen or activated forms of any of the
preceding. The clotting factor of hemostatic agent can also include
anti-fibrinolytic drugs, e.g., epsilon-amino-caproic acid,
tranexamic acid.
[0215] 7. Methods of Inhibiting Viral Fusion with a Target Cell
[0216] The invention also relates to an in vitro method of
inhibiting HIV fusion with a mammalian cell comprising combining
the mammalian cell with at least one chimeric protein, wherein the
chimeric protein comprises a first and a second chain, wherein the
first chain comprises at least a portion of an immunoglobulin
constant region and an HIV inhibitor and the second chain comprises
at least a portion of an immunoglobulin constant region without the
HIV inhibitor of the first chain. The mammalian cell can include
any cell or cell line susceptible to infection by HIV including but
not limited to primary human CD4.sup.+ T cells or macrophages,
MOLT-4 cells, CEM cells, AA5 cells or HeLa cells which express CD4
on the cell surface.
G. Methods of Isolating Chimeric Proteins
[0217] Typically, when chimeric proteins of the invention are
produced they are contained in a mixture of other molecules such as
other proteins or protein fragments. The invention thus provides
for methods of isolating any of the chimeric proteins described
supra from a mixture containing the chimeric proteins. It has been
determined that the chimeric proteins of the invention bind to dye
ligands under suitable conditions and that altering those
conditions subsequent to binding can disrupt the bond between the
dye ligand and the chimeric protein, thereby providing a method of
isolating the chimeric protein. In some embodiments, the mixture
may comprise a monomer-dimer hybrid, a dimer and at least a portion
of an immunoglobulin constant region, e.g., an Fc. Thus, in one
embodiment, the invention provides a method of isolating a
monomer-dimer hybrid. In another embodiment, the invention provides
a method of isolating a dimer.
[0218] Accordingly, in one embodiment, the invention provides a
method of isolating a monomer-dimer hybrid from a mixture, where
the mixture comprises
[0219] a) the monomer-dimer hybrid comprising a first and second
polypeptide chain, wherein the first chain comprises a biologically
active molecule, and at least a portion of an immunoglobulin
constant region and wherein the second chain comprises at least a
portion of an immunoglobulin constant region without a biologically
active molecule or immunoglobulin variable region;
[0220] b) a dimer comprising a first and second polypeptide chain,
wherein the first and second chains both comprise a biologically
active molecule, and at least a portion of an immunoglobulin
constant region; and
[0221] c) a portion of an immunoglobulin constant region; said
method comprising [0222] 1) contacting the mixture with a dye
ligand linked to a solid support under suitable conditions such
that both the monomer-dimer hybrid and the dimer bind to the dye
ligand; [0223] 2) removing the unbound portion of an immunoglobulin
constant region; [0224] 3) altering the suitable conditions of 1)
such that the binding between the monomer-dimer hybrid and the dye
ligand linked to the solid support is disrupted; [0225] 4)
isolating the monomer-dimer hybrid.
[0226] In some embodiments, prior to contacting the mixture with a
dye ligand, the mixture may be contacted with a chromatographic
substance such as protein A sepharose or the like. The mixture is
eluted from the chromatographic substance using an appropriate
elution buffer (e.g. a low pH buffer) and the eluate containing the
mixture is then contacted with the dye ligand.
[0227] Suitable conditions for contacting the mixture with the dye
ligand may include a buffer to maintain the mixture at an
appropriate pH. An appropriate pH may include a pH of from 3-10,
4-9, 5-8. In one embodiment, the appropriate pH is 8.0. Any
buffering agent known in the art may be used so long as it
maintains the pH in the appropriate range, e.g., tris, HEPES,
PIPES, MOPS. Suitable conditions may also include a wash buffer to
elute unbound species from the dye ligand. The wash buffer may be
any buffer which does not disrupt binding of a bound species. For
example, the wash buffer can be the same buffer used in the
contacting step.
[0228] Once the chimeric protein is bound to the dye ligand, the
chimeric protein is isolated by altering the suitable conditions.
Altering the suitable conditions may include the addition of a salt
to the buffer. Any salt may be used, e.g., NaCl, KCl. The salt
should be added at a concentration that is high enough to disrupt
the binding between the dye ligand and the desired species, e.g., a
monomer-dimer hybrid.
[0229] In some embodiments, where the mixture is comprised of an
Fc, a monomer-dimer hybrid, and a dimer, it has been found that the
Fc does not bind to the dye ligand and thus elutes with the flow
through. The dimer binds more tightly to the dye ligand than the
monomer-dimer hybrid. Thus a higher concentration of salt is
required to disrupt the bond (e.g. elute) between the dimer and the
dye ligand compared to the salt concentration required to disrupt
the bond between the dye ligand and the monomer-dimer hybrid.
[0230] In some embodiments, NaCl may be used to isolate the
monomer-dimer hybrid from the mixture. In some embodiments, the
appropriate concentration of salt which disrupts the bond between
the dye ligand and the monomer-dimer hybrid is from 200-700 mM,
300-600 mM, 400-500 mM. In one embodiment, the concentration of
NaCl required to disrupt the binding between the dye ligand the
monomer-dimer hybrid is 400 mM.
[0231] NaCl may also be used to isolate the dimer from the mixture.
Typically, the monomer-dimer hybrid is isolated from the mixture
before the dimer. The dimer is isolated by adding an appropriate
concentration of salt to the buffer, thereby disrupting the binding
between the dye ligand and the dimer. In some embodiments, the
appropriate concentration of salt which disrupts the bond between
the dye ligand and the dimer is from 800 mM to 2M, 900 mM to 1.5 M,
950 mM to 1.2 M. In one specific embodiment, 1M NaCl is used to
disrupt the binding between the dye ligand and the dimer.
[0232] The dye ligand may be a bio-mimetic. A bio-mimetic is a
human-made substance, device, or system that imitates nature. Thus,
in some embodiments, the dye ligand imitates a molecule's naturally
occurring ligand. The dye ligand may be chosen from Mimetic Red
1.TM., Mimetic Red 2.TM., Mimetic Orange 1.TM., Mimetic Orange
2.TM., Mimetic Orange 3.TM., Mimetic Yellow 1.TM., Mimetic Yellow
2.TM., Mimetic Green 1.TM., Mimetic Blue 1.TM., and Mimetic Blue
2.TM. (Prometic Biosciences (USA) Inc., Wayne, N.J.). In one
specific embodiment, the dye ligand is Mimetic Red 2.TM. (Prometic
Biosciences (USA) Inc., Wayne, N.J.). In certain embodiments, the
dye ligand is linked to a solid support, e.g., from Mimetic Red
1A6XL.TM., Mimetic Red 2 A6XL.TM., Mimetic Orange 1 A6XL.TM.,
Mimetic Orange 2 A6XL.TM., Mimetic Orange 3 A6XL.TM., Mimetic
Yellow 1 A6XL.TM., Mimetic Yellow 2 A6XL.TM., Mimetic Green 1
A6XL.TM., Mimetic Blue 1 A6XL.TM., and Mimetic Blue 2 A6XL.TM.
(Prometic Biosciences (USA) Inc., Wayne, N.J.).
[0233] The dye ligand may be linked to a solid support. The solid
support may be any solid support known in the art (see, e.g.,
www.seperationsNOW.conn). Examples of solid supports may include a
bead, a gel, a membrane, a nanoparticle, or a miorosphere. The
solid support may comprise any material which can be linked to a
dye ligand (e.g. agarose, polystyrene, sepharose, sephadex). Solid
supports may comprise any synthetic organic polymer such as
polyacrylic, vinyl polymers, acrylate, polymethacrylate, and
polyacrylamide. Solid supports may also comprise a carbohydrate
polymer, e.g., agarose, cellulose, or dextran. Solid supports may
comprise inorganic oxides, such as silica, zirconia, titania,
eerie, alumina, magnesia (i.e., magnesium oxide), or calcium oxide.
Solid supports may also comprise combinations of some of the
above-mentioned supports including, but not limited to,
dextran-acrylamide.
EXAMPLES
Example 1
Molecular Weight Affects FcRn Mediated Trancytosis
[0234] Chimeric proteins comprised of various proteins of interest
and IgG Fc were recombinantly produced (Sambrook et al. Molecular
Cloning: A Laboratory Manual, 2 ed., Cold Spring Harbor Laboratory
Press, (1989)) or in the case of contactin-Fc, MAB-.beta.-gal, (a
complex of a monoclonal antibody bound to .beta.-gal) (Biodesign
International, Saco, Me.) and MAB-GH (a complex of monoclonal
antibody and growth hormone)(Research Diagnostics, Inc. Flanders,
N.J.) were purchased commercially. Briefly, the genes encoding the
protein of interest were cloned by PCR, and than sub-cloned into an
Fc fusion expression plasmid. The plasmids were transfected into
DG44 CHO cells and stable transfectants were selected and amplified
with methotrexate. The chimeric protein homodimers were purified
over a protein A column. The proteins tested included interferon
.alpha., growth hormone, erythropoietin, follicle stimulating
hormone, Factor IX, beta-galactosidase, contactin, and Factor VIII.
Linking the proteins to immunoglobulin portions, including the FcRn
receptor binding partner, or using commercially available whole
antibody (including the FcRn binding region)-antigen complexes
permitted the investigation of transcytosis as a function of
molecular weight (see U.S. Pat. No. 6,030,613). The chimeric
proteins were administered to rats orally and serum levels were
measured 2-4 hours post administration using an ELISA for
recombinantly produced chimeric proteins and both a western blot
and ELISA for commercially obtained antibody complexes and chimeric
proteins. Additionally, all of the commercially obtained proteins
or complexes as well as Factor VIII-Fc, Factor IX-Fc and Epo-Fc
controls were iodinated using IODO beads (Pierce, Pittsburgh, Pa.).
The results indicated serum levels of Fc and monoclonal antibody
chimeric proteins orally administered to rats are directly related
to the size of the protein. The apparent cutoff point for orally
administered Fc chimeric proteins is between 200-285 kD. (Table
2).
TABLE-US-00002 TABLE 2 Protein Size (kD) Transcytosis IFN.alpha.-Fc
92 ++++ GH-Fc 96 +++ Epo-Fc 120 +++ FSH-Fc 170 +++ MAB:GH 172-194
+++ FIX-Fc 200 + MAB:.beta.Gal 285-420 - Contactin-Fc 300 -
FVIII.DELTA.-Fc 380 -
Example 2
Protein Expression and Preparation of Fc-MESNA
[0235] The coding sequence for Fc (the constant region of human
IgG1) was obtained by PCR amplification from an Fc-containing
plasmid using standard conditions and reagents, following the
manufacturer's recommended procedure to subclone the Fc coding
sequence NdeI/SapI. Briefly, the primers 5'-GTGGTCATA
TGGGCATTGAAGGCAGAGGCGCCGCTGCGGTCG-3'(SEQ ID NO:73) and 5'-GGTGGTTGC
TCTTCCGCAAAAACCCGGAGACAGGGAGAGACTCTTCTGCG-3' (SEQ ID NO:74)were
used to amplify the Fc sequence from 500 ng of the plasmid
pED.dC.Epo-Fc using Expand High Fidelity System (Boehringer
Mannheim, Basel Switzerland) in a RapidCylcler thermocycler (Idaho
Technology Salt Lake City, Utah), denaturing at 95.degree. C. for 2
minutes followed by 18 cycles of 95.degree. C. for 0 sec,
55.degree. C. for 0 sec, and 72.degree. C. for 1 minute with a
slope of 4, followed by 72.degree. C. extension for 10 minutes. The
PCR product was subcloned into an intermediate cloning vector and
sequenced fully, and then subcloned using the NdeI and SapI sites
in the pTWIN1 vector following standard procedures. Sambrook, J.,
Fritsch, E. F. and Maniatis, T. 1989, Molecular Cloning: A
Laboratory Manual, 2d ed.; Cold Spring Harbor, N.Y.: Cold Spring
Harbor Laboratory Press. This plasmid was then transformed into
BL21(DE3) pLysS cells using standard methods. Id. A 1 liter culture
of cells was grown to an absorbance reading of 0.8 AU at 37.degree.
C., induced with 1 mM isopropyl beta-D-1-thlogalactopyranoside, and
grown overnight at 25.degree. C. Cells were pelleted by
centrifugation, lysed in 20 mM Tris 8.8/1% NP40/0.1 mM
phenylmethanesulfonyl fluoride/1 .mu.g/ml Benzonase (Novagen
Madison, Wis.), and bound to chitin beads (New England Biolabs;
Beverly, Mass.) overnight at 4.degree. C. Beads were then washed
with several column volumes of 20 mM Tris 8.5/500 mM NaCl/1 mM
EDTA, and then stored at -80.degree. C. Purified Fc-MESNA was
generated by eluting the protein from the beads in 20 mM Tris
8.5/500 mM NaCl/1 mM EDTA/500 mM 2-mercapto ethane sulfonic acid
(MESNA), and the eluate was used directly in the coupling reaction,
below (FIG. 5).
Example 3
Synthesis of a Small Molecule Linked to Cys-Fc
[0236] A VLA4 anatagonist described in Lin et al., 1999 J. Med.
Chem., 42:920 was linked to CysFc.
##STR00006##
[0237] In this case, the carboxy-protected version 1 was used and
reacted the free amine with 6-aminoheptanoic acid using standard
amide bond coupling conditions.
[0238] Removal of the Fmoc groups with DBU in DMF with the
polystyrene-bound mercaptoethylamine gave compound 2. Coupling of
N,N-bis(N-Fmoc-3-amino-propyl) glycine 3 to compound 2 in the
presence of PyBOP and DIEA gave compound 4. Deprotection of the
Fmoc groups again with DBU in DMF with the polystyrene-bound
mercaptoethylamine, followed by coupling of thioester 5 gave
compound 6. Removal of the t-butyl protecting groups gave double
thioester 7 which included the active small molecule (FIG. 6). The
double thioester 7 was coupled to CysFc and was shown to be
attached to both N-terminal Cys residues by running a reducing SDS
page gel and observing that the Fc was running at the molecular
weight of a dimer (even though the disulfides between the Fc halves
were reduced, the Fc still ran as a dimer due to the irreversible
linkage between the two halves as a result of compound 7).
Example 4
Cloning of Cys-Fc Construct (Monomer-Dimer Mixture)
[0239] Using PCR and standard molecular biology techniques
(Sambrook et al. 1989, Molecular Cloning: A Laboratory Manual,
2ed., Cold Spring Harbor Laboratory Press), a mammalian expression
construct was generated such that the coding sequence for the human
IFN.alpha. signal peptide was directly abutted against the coding
sequence of Fc beginning at the first cysteine residue (Cys 226, EU
Numbering). Upon signal peptidase cleavage and secretion from
mammalian cells, an Fc protein with an N-terminal cysteine residue
was thus generated. Briefly, the primers IFNa+Sig-F (IFNa+Sig-F:
5'-GCTACTGCAGCCACCATGGCCTTGACCTT TGCTTTAC-3') and Cys-Fc-R
(5'-CAGTTCCGGAGCTGGGCACGGCGGA GAGCCCACAGAGCAGCTTG-3') were used in
a PCR reaction to create a fragment linking the IFN.alpha. signal
sequence with the N terminus of Fc, beginning with Cys 226. 500 ng
of pED.dC.native hIFN.alpha. .DELTA.linker was added to 25 pmol of
each primer in a PCR reaction with Expand High Fidelity System
(Boehringer Mannheim,) Indianapolis, Ind.) according to
manufacturer's standard protocol. The reaction was carried out in a
MJ Thermocycler using the following cycles: 94.degree. C. 2
minutes; 30 cycles of (94.degree. C. 30 seconds, 50.degree. C. 30
seconds, 72.degree. C. 45 seconds), and finally 72.degree. C. 10
minutes. The expected sized band (.about.112 bp) was gel purified
with a Gel Extraction kit (Qiagen, Valencia Calif.), digested with
the PstI and BspEI restriction enzymes, gel purified, and subcloned
into the corresponding sites pED.dC.native hIFN.alpha.
.DELTA.linker to generate pED.dC.hIFN.alpha. sig seq-Cys-Fc.
Example 5
Cloning of CysFc Construct (Dimer)
[0240] Similar to above, standard molecular biology techniques were
used to generate a mammalian expression construct such that the
coding sequence for the mouse Ig.kappa. signal peptide was directly
abutted against the coding sequence of Fc beginning at the first
cysteine residue (Cys 226, EU Numbering). Briefly, the following
primers were used:
TABLE-US-00003 mlgk-F: 5'- CCAACTGCAGCCACCATGGAGACAGACACAC -3'
mlgk-R: 5'- GGGCACGGCGGGCAACCAGTGGAACCTGGAAC -3' CysFc-F: 5'-
TGCCCGCCGTGCCCGGCA -3' fcclv-R: 5'- ATAGAAGCCTTTGACCAGGC -3'
[0241] Two 25 .mu.l PCR reactions were carried out with either
mIgk-F and mIgk-R or CysFc-F and fccIv-R using Expand High Fidelity
System (Boehringer Mannheim, Indianapolis, Ind.) according to
manufacturer's standard protocol in a MJ Thermocycler. Both
reactions used a template plasmid containing the mouse Ig.kappa.
signal sequence followed by the Fc coding sequence. The expected
sized bands (.about.88 and 444 bp, respectively) were gel purified
with a Gel Extraction kit (Qiagen, Valencia Calif.), then combined
in a PCR reaction with mIgk-F and fccIv-R primers and run as
before. The expected sized band (.about.519 bp) was gel purified
with a Gel Extraction kit (Qiagen, Valencia Calif.) and cloned into
pED.dC.IFN.beta.-Fc (vector pED.dC containing the full length human
IFN.beta. sequence followed by the human Fc sequence, amino acids
221-447, EU numbering) using the PstI/RsrII sites to generate
pED.dC.Ig.kappa. sig seq-CysFc (FIGS. 7 and 8)
Example 6
Cloning of HisXaCysFc Construct
[0242] Similar to above, standard molecular biology techniques were
used to generate a mammalian expression construct such that the
coding sequence for the mouse Ig.kappa. signal peptide is followed
by a 6 His tag, an 8 amino acid Gly-Ser linker, and a Factor Xa
cleavage site (IEGR) directly abutted against the coding sequence
of Fc beginning at the first cysteine residue (Cys 226, EU
Numbering). In addition to mIgk-F and fccIv-R, the following
primers were used:
TABLE-US-00004 SP-His-GS8-R:
5'GGAACCAGATCCAGAGCCAGATCCGTGATGGTGATGGTGATGGTCA CCAGTGGAACCTGGAAC
-3' GS8-Xa-Fc-F: 5' GGATCTGGCTCTGGATCTGGTTCCATCGAAGGTCGTTGCCCGCCG
TGCCCAGCTCCGG -3'
[0243] Two 25 .mu.l PCR reactions were carried out with either
mIgk-F and SP-His-GS8-R or GS8-Xa-Fc-F and fccIv-R using Expand
High Fidelity System (Boehringer Mannheim, Indianapolis, Ind)
according to manufacturer's standard protocol in a MJ Thermocycler.
Both reactions used a template plasmid containing the mouse
Ig.kappa. signal sequence followed by the Fc coding sequence. The
expected sized bands (.about.120 and 480 bp, respectively) were gel
purified with a Gel Extraction kit (Qiagen, Valencia Calif.), then
combined in a PCR reaction with mIgk-F and fccIv-R primers and run
as before. The expected sized band (.about.576 bp) was gel purified
with a Gel Extraction kit (Qiagen, Valencia Calif.) and cloned into
pED.dC.IFN.beta.-Fc (vector pED.dC containing the full length human
IFN.beta. sequence followed by the human Fc sequence, amino acids
221-447, EU numbering; IFN.beta. sequence removed in the digest)
using the PstI/RsrII sites to generate pED.dC.HisXaCysFc (FIGS. 9
and 10).
Example 7
Cys-Fc Expression and Purification
[0244] CHO DG-44 cells expressing Cys-Fc were established. The
pED.dC.Cys-Fc expression plasmids, and the pED.dC.HisXaCysFc
expression plasmid, which all contain the mouse dihydrofolate
reductase (dhfr) gene, were transfected into CHO DG44 (dhfr
deficient) cells using Superfect reagent (Qiagen; Valencia, Calif.)
according to manufacturer's protocol, followed by selection for
stable transfectants in .alpha.MEM (without nucleosides) tissue
culture media supplemented with 5% dialyzed FBS and
penicillin/streptomycin antibiotics (lnvitrogen; Carlsbad, Calif.)
for 10 days. The resulting pools of stably transfected cells were
then amplified with various levels of methotrexate (i.e. 25 nM-100
nM) to increase expression, and the highest expressing pools were
identified. Approximately 2.times.10.sup.7 cells were used to
inoculate 300 ml of growth medium in a 1700 cm.sup.2 roller bottle
(Corning, Corning, N.Y.). The roller bottles were incubated in a 5%
CO.sub.2 at 37.degree. C. for approximately 72 hours. The growth
medium was exchanged with 300 ml serum-free production medium
(DMEM/F12 with 5 .mu.g/ml bovine insulin and 10 .mu.g/ml
Gentamicin). The production medium (conditioned medium) was
collected every day for 10 days and stored at 4.degree. C. Fresh
production medium was added to the roller bottles after each
collection and the bottles were returned to the incubator. Prior to
chromatography, the medium was clarified using a SuporCap-100
(0.8/0.2 .mu.m) filter from Pall Gelman Sciences (Ann Arbor,
Mich.). All of the following steps were performed at 4.degree. C.
The clarified medium was applied to Protein A Sepharose, washed
with 5 column volumes of 1.times.PBS (10 mM phosphate, pH 7.4, 2.7
mM KCl, and 137 mM NaCl), eluted with 0.1 M glycine, pH 2.7, and
then neutralized with 1/10 volume of 1 M Tris-HCl, pH 9.0. Protein
was dialyzed into PBS and used directly in conjugation reactions
for the CysFc proteins, while the HisXaCysFc protein was processed
further.
Example 8
Processing of HisXaCysFc Protein
[0245] In order for the Factor X.sub.a enzyme to cleave its
recognition site in this protein, it was found that the interchain
disulfide bonds must first be reduced, presumably because the
intact disulfide adjacent to the recognition site prevented the
enzyme from binding. The Factor X.sub.a activity, however, is
sensitive to reducing agents, and therefore after breaking the
disulfide bond of the HisXaCysFc protein, all reducing agent must
be removed before adding the enzyme. One efficient way to
accomplish this goal was to first bind the HisXaCysFc to a solid
support, which allows one to quickly and efficiently wash in and
out the desired buffers and enzymes.
[0246] HisXaCysFc protein (5 mg) in PBS was loaded on a 1 ml
protein A HiTrap column (Pharmacia?), washed with 10 column volumes
of 1.times.PBS/DTT solution (10 mM phosphate, pH 7.4, 2.7 mM KCl,
137 mM NaCl, and 25 mM DTT), then the column was allowed to
incubate in this solution for 1 hour at room temperature. The
column was then washed with 10 column volumes of Factor X.sub.a
digestion buffer (50 mM Tris pH 8.0, 100 mM NaCl, 5 mM CaCl.sub.2,
degassed extensively with bubbled N.sub.2 while stirring), followed
by 1.1 column volumes of FX.sub.a digestion buffer supplemented
with FX.sub.a enzyme (80 U for 5 mg), and the column was incubated
at 37.degree. C. for 18 hrs. The column was washed with 10 column
volumes of 1.times.PBS (10 mM phosphate, pH 7.4, 2.7 mM KCl, and
137 mM NaCl), eluted with 0.1 M glycine, pH 2.7, and then
neutralized with 1/10 volume of 1 M Tris-HCl, pH 8.0, and analyzed
by reducing SDS-PAGE to determine the efficiency of the cleavage,
as can be seen by a decrease in the size of the protein band. If
the protein was fully processed, the sample was dialyzed into
1.times.PBS and used directly in conjugation reactions.
[0247] If the protein was not fully cleaved, the fully processed
HisXaCysFc was separated from the uncut protein on a Nickel column.
Five column volumes of a Nickel sulfate solution (100 mM) was
loaded on to a HiTrap Chelating HP column, washed with 10 column
volumes of water, then equilibrated with 10 column volumes of wash
buffer (20 mM phosphate pH 6.5, 500 mM NaCl). The sample containing
a mixture of processed and unprocessed HisXaCysFc protein was
loaded on to the column washed with 5 column volumes of wash
buffer, then eluted with a gradient of 0 mM to 500 mM imidazole
over 10 column volumes. Fractions were analyzed by reducing
SDS-PAGE, and the fractions containing the processed HisXaCysFc
protein were pooled, dialyzed into 1.times.PBS, and used directly
in conjugation reactions.
Example 9
Coupling of T20-Thioesters to Monomer-Dimer Hybrids of Cys-Fc for
T20 Monomer-Dimer Hybrids
[0248] Cys-Fc (from hIFN.alpha. sig seq-CysFc; 4 mg, 3.2 mg/ml
final concentration) and either T20-thioester or T20-PEG-thioester
(2 mg, approximately 5 molar equivalents) were incubated for 16
hours at room temperature in 0.1 M Tris 8/10 mM MESNA. Analysis by
SDS-PAGE (Tris-Gly gel) using reducing sample buffer indicated the
presence of a new band approximately 5 kDa larger than the Fc
control (>40-50% conversion to the conjugate). Previous
N-terminal sequencing of Cys-Fc and unreacted Cys-Fc indicated that
the signal peptide is incorrectly processed in a fraction of the
molecules, leaving a mixture of (Cys)-Fc, which will react through
native ligation with peptide-thioesters, and (Val)-(Gly)-(Cys)-Fc,
which will not. As the reaction conditions are insufficient to
disrupt the dimerization of the Cys-Fc molecules, this reaction
generated a mixture of T20-Cys-Fc:T20-Cys-Fc homodimers,
T20-Cys-Fc: Fc monomer-dimer hybrids, and Cys-Fc:Cys-Fc homodimers.
This protein was purified using size exclusion chromatography as
indicated above and was able to separate the three species, which
was confirmed by SDS-PAGE analysis under nonreducing
conditions.
Example 10
Coupling of T20-Thioesters to Cys-Fc for Dimers
[0249] Alternatively, this same reaction indicated above was
carried out with CysFc from Ig.kappa. sig seq-CysFc or processed
HisXaCysFc with other peptide-thioesters, and produced a homogenous
population of peptide-CysFc dimers.
Example 11
Coupling of Peptide-Thioesters to Cys-Fc for Monomer-Dimer
Generation
[0250] In order to produce monomer-dimer hybrids by native ligation
with dimeric CysFc (produced from either Ig.kappa. signal sequence
CysFc or processed HisXaCysFc), the reaction conditions of native
ligation could be adjusted. One way would be to incubate only one
equivalent of peptide-thioester with one equivalent of dimeric
CysFc protein, such that only half of the total free Cys residues
could react, thereby generating a mixture of peptide-CysFc dimers,
peptide CysFc/Fc monomer-dimer hybrids, and unreacted CysFc dimers.
Alternatively, an excess of peptide-thioester could be added with
varying amounts of DTT or other reducing agent, which could compete
for reacting with the available N-terminal Cys residues, and
produce the same mixture. Note that some peptide-thioesters react
more or less efficiently than others, and may need to be determined
empirically what levels are required for the optimum amount of
monomer-dimer hybrids. In all cases, peptide-thioesters could be
substituted with small molecule thioesters for native ligation
reactions, and other active groups could be used to react with the
N-terminal Cys residues to generate other types of bonds.
Example 12
Generation of Monomer-Dimer Hybrids Through Complete Reactions and
Refolding with Unreacted CysFc
[0251] An alternative method to generate monomer-dimer hybrids is
to first use homogneous CysFc (from sig seq-CysFc or processed
H)sXaCysFc) to produce pure, dimeric peptide-Fc, then denature and
refold with equivalent amounts of unreacted CysFc. Equal amounts of
these proteins could be added together in 1.times.PBS, and
supplemented with 8 M urea and 100 mM DTT to completely denature
and reduce the proteins, in a total volume of 25-50 ml. The protein
mixture could then be dialyzed into 2 liters of denaturing buffer
consisting of 8 M urea, 50 mM Tris pH 8, 1 mM EDTA, 5 mM reduced
glutathione (GSH) for 2 hours. The sample could then be changed
into fresh denaturing buffer (2 liters) and dialyzed for 16 hours.
The sample could then changed one more time into fresh denaturing
buffer (2 liters) and oxidized gluathione (GSSG) added to the
dialysis denaturing buffer for a final concentration of 2.5 mM
GSSG. The protein could then be slowly refolded following modified
literature procedures. Maeda et al. 1996, Protein Eng. 9:95; Ueda
at al. 1997, Cell Mol. Life Sci. 53:929. With the protein still
suspended in dialysis tubing in 1 liter of redox denaturing
dialysis buffer, a new buffer of 50 mM Tris pH 8, 1 mM EDTA, 5 mM
GSH and 2.5 mM GSSG could be prepared (4 liters) and pumped into
the 1 liter denaturing buffer at a rate of 1 mL/min for 16 hours
using a peristaltic pump. Excess buffer could be displaced such
that the volume of denaturing buffer remained 1 liter. After 16
hours, the rate of addition could be increased to 3 mL/min until
all of the 4 liters of renaturation buffer were consumed. The
protein could then be placed into 2 liters of 50 mM Tris pH 8, 5 mM
GSH, 2.5 mM GSSG, 1 mM EDTA for 2 hours and replaced with fresh
identical buffer and dialyzed for 2 hours. The protein could then
be dialyzed into 4 liters of PBS for 2 hours, and then into 4
liters of fresh PBS for 16 hours at 4.degree. C. This procedure
would generate a refolded mixture of peptide-Fc dimers,
peptide-Fc/CysFc monomer-dimer hybrids, and CysFc dimers.
[0252] This mixture could then be purified by size exclusion
chromatography using a Superdex 200 column in PBS as indicated
previously.
Example 13
Cloning of the Fc Coding Sequence and Introducing the N297A
Mutation
[0253] The coding sequence for the constant region of IgG1 (EU
#221-447; the Fc region) was obtained by PCR amplification from a
leukocyte cDNA library (Clontech, CA) using the following
primers:
TABLE-US-00005 rcFc-F (SEQ ID NO: )
5'-GCTGCGGTCGACAAAACTCACACATGCCCACCGTGCCCAGCTCC
GGAACTCCTGGGCGGACCGTCAGTC -3' rcFc-R (SEQ ID NO: ) 5'-
ATTGGAATTCTCATTTACCCGGAGACAGGGAGAGGC -3'
[0254] The forward primer adds a SaII cloning site before the
beginning of the Fc region, as well as incorporates a BspEI
restriction site at amino acids 231-233 and an RsrII restriction
site at amino acids 236-238 using the degeneracy of the genetic
code to preserve the correct amino acid sequence (EU numbering).
The reverse primer adds an EcoRI cloning site after the stop codon
of the Fc. A 25 .mu.l PCR reaction was carried out with 25 pmol of
each primer using Expand High Fidelity System (Boehringer Mannheim,
Indianapolis, Ind.) according to manufacturer's standard protocol
in a MJ Thermocycler using the following cycles: 94.degree. C. 2
minutes; 30 cycles of (94.degree. C. 30 seconds, 58.degree. C. 30
seconds, 72.degree. C. 45 seconds), 72.degree. C. 10 minutes. The
expected sized band (.about.696 bp) was gel purified with a Gel
Extraction kit (Qiagen, Valencia Calif.), and cloned into pGEM
T-Easy (Promega, Madison, Wis.) to produce an intermediate plasmid
pSYN-Fc-001 (pGEM T-Easy/Fc).
[0255] In order to mutate Asn 297 (EU numbering) of the Fc to an
Ala residue, the following primers were used:
TABLE-US-00006 N297A-F 5'- GAGCAGTACGCTAGCACGTACCG -3' (SEQ ID NO:
) N297A-R 5'- GGTACGTGCTAGCGTACTGCTCC -3' (SEQ ID NO: )
[0256] Two PCR reactions were carried out with 25 pmol of either
rcFc-F and N297A-R or N297A-F and rcFc-R using Expand High Fidelity
System (Boehringer Mannheim, Indianapolis, Ind.) according to
manufacturer's standard protocol in a MJ Thermocycler. Both
reactions were carried out using 500 ng of pSYN-Fc-001 as a
template using the following cycles: 94.degree. C. 2 minutes; 16
cycles of (94.degree. C. 30 seconds, 48.degree. C. 30 seconds,
72.degree. C. 45 seconds), 72.degree. C. 10 minutes. The expected
sized bands were gel purified with a Gel Extraction kit (Qiagen,
Valencia Calif.), then combined in a PCR reaction with 25 pmol of
rcFc-F and rcFc-R primers and run as before, annealing at
58.degree. C. and continuing for 16 cycles. The expected sized band
was gel purified with a Gel Extraction kit (Qiagen, Valencia
Calif.) and cloned into pGEM T-Easy (Promega, Madison, Wis.) to
produce an intermediate plasmid pSYN-Fc-002 (pGEM T Easy/Fc N297A).
The N297A mutation could then be added to any Fc-containing plasmid
by subcloning the BspEI/XmaI or RsrII/XmaI fragment from
pSYN-Fc-002 into the corresponding sites in the plasmid of
interest.
Example 14
Introducing the Mouse Igk Signal Sequence into an Fc-Containing
Plasmid
[0257] The mouse Ig.kappa. signal sequence was added to the Fc CDS
using the following primers:
TABLE-US-00007 rc-lgk sig seq-F: (SEQ ID NO: )
5'-TTTAAGCTTGCCGCCACCATGGAGACAGACACACTCCTGCTATG
GGTACTGCTGCTCTGGGTTCCAGGTTCCACTGGTGACAAAACT CACA CATGCCCACCG -3'
Fc-noXma-GS-R: (SEQ ID NO: ) 5'- GGTCAGCTCATCGCGGGATGGG -3'
Fc-noXma-GS-F: (SEQ ID NO: ) 5'- CCCATCCCGCGATGAGCTGACC -3'
[0258] The rc-Igk sig seq-F primer adds a HindIII restriction site
to the 5' end of the molecule, followed by a Kozak sequence
(GCCGCCACC) (SEQ ID NO:) followed by the signal sequence from the
mouse Ig.kappa. light chain, directly abutted to the beginning of
the Fc sequence (EU#221). The Fc-noXma-GS-F and -R primers remove
the internal XmaI site from the Fc coding sequence, using the
degeneracy of the genetic code to preserve the correct amino acid
sequence. Two 25 .mu.l PCR reactions were carried out with 25 pmol
of either rc-Igk sig seq-F and Fc-noXma-GS-R or Fc-noXma-GS-F and
rcFc-R using Expand High Fidelity System (Boehringer Mannheim,
Indianapolis, Ind.) according to manufacturer's standard protocol
in a MJ Thermocycler. The first reaction was carried out with 500
ng of leukocyte cDNA library (BD Biosciences Clontech, Palo Alto,
Calif.) as a template using the following cycles: 94.degree. C. 2
minutes; 30 cycles of (94.degree. C. 30 seconds, 55.degree. C. 30
seconds, 72.degree. C. 45 seconds), 72.degree. C. 10 minutes. The
second reaction was carried out with 500 ng of pSYN-Fc-001 as a
template (above) using the following cycles: 94.degree. C. 2
minutes; 16 cycles of (94.degree. C. 30 seconds, 58.degree. C. 30
seconds, 72.degree. C. 45 seconds), 72.degree. C. 10 minutes. The
expected sized bands (.about.495 and 299 bp, respectively) were gel
purified with a Gel Extraction kit (Qiagen, Valencia Calif.), then
combined in a PCR reaction with 25 pmol of rc-Igk sig seq-F and
rcFc-R primers and run as before, annealing at 58.degree. C. and
continuing for 16 cycles. The expected sized band (.about.772 bp)
was gel purified with a Gel Extraction kit (Qiagen, Valencia
Calif.) and cloned into pGEM T-Easy (Promega, Madison, Wis.) to
produce the plasmid pSYN-Fc-007 (pGEM T-Easy/Ig.kappa. sig
seq-Fc).
[0259] All numbers expressing quantities of ingredients, reaction
conditions, and so forth used in the specification and claims are
to be understood as being modified in all instances by the term
"about." Accordingly, unless indicated to the contrary, the
numerical parameters net forth in the specification and attached
claims are approximations that may vary depending upon the desired
properties sought to be obtained by the present invention. At the
very least, and not as an attempt to limit the application of the
doctrine of equivalents to the scope of the claims, each numerical
parameter should be construed in light of the number of significant
digits and ordinary rounding approaches.
[0260] All references cited herein are incorporated herein by
reference in their entirety and for all purposes to the same extent
as if each individual publication or patent or patent application
was specifically and individually indicated to be incorporated by
reference in its entirety for all purposes. To the extent
publications and patents or patent applications incorporated by
reference contradict the disclosure contained in the specification,
the specification is intended to supercede and/or take precedence
over any such contradictory material.
[0261] Many modifications and variations of this invention can be
made without departing from its spirit and scope, as will be
apparent to those skilled in the art. The specific embodiments
described herein are offered by way of example only and are not
meant to be limiting in any way. It is intended that the
specification and examples be considered as exemplary only, with a
true scope and spirit of the invention being indicated by the
following claims.
Sequence CWU 1
1
42111PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 1Pro Lys Asn Ser Ser Met Ile Ser Asn Thr Pro1 5
1027PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 2His Gln Ser Leu Gly Thr Gln1 538PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 3His
Gln Asn Leu Ser Asp Gly Lys1 548PRTArtificial SequenceDescription
of Artificial Sequence Synthetic peptide 4His Gln Asn Ile Ser Asp
Gly Lys1 558PRTArtificial SequenceDescription of Artificial
Sequence Synthetic peptide 5Val Ile Ser Ser His Leu Gly Gln1
568PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 6Glu Phe Ala Gly Ala Ala Ala Val1
577PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 7Glu Phe Ala Gly Ala Ala Val1 5820PRTArtificial
SequenceDescription of Artificial Sequence Synthetic linker 8Gly
Ala Gly Ala Gly Ala Gly Ala Gly Ala Gly Ala Gly Ala Gly Ala1 5 10
15Gly Ala Gly Ala 20930PRTArtificial SequenceDescription of
Artificial Sequence Synthetic linker 9Gly Gly Ser Gly Gly Ser Gly
Gly Ser Gly Gly Ser Gly Gly Ser Gly1 5 10 15Gly Ser Gly Gly Ser Gly
Gly Ser Gly Gly Ser Gly Gly Ser 20 25 301080PRTArtificial
SequenceDescription of Artificial Sequence Synthetic linker 10Gly
Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly1 5 10
15Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly
20 25 30Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly
Gly 35 40 45Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly
Gly Gly 50 55 60Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly
Gly Gly Ser65 70 75 80117PRTArtificial SequenceDescription of
Artificial Sequence Synthetic linker 11Ser Gly Gly Ser Gly Gly Ser1
51215PRTArtificial SequenceDescription of Artificial Sequence
Synthetic linker 12Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly Ser
Gly Gly Gly1 5 10 151316PRTArtificial SequenceDescription of
Artificial Sequence Synthetic linker 13Gly Gly Ser Gly Gly Ser Gly
Gly Gly Gly Ser Gly Gly Gly Gly Ser1 5 10 151418PRTArtificial
SequenceDescription of Artificial Sequence Synthetic linker 14Gly
Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly1 5 10
15Gly Ser1550PRTArtificial SequenceDescription of Artificial
Sequence Synthetic linker 15Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser
Gly Gly Gly Gly Ser Gly1 5 10 15Gly Gly Gly Ser Gly Gly Gly Gly Ser
Gly Gly Gly Gly Ser Gly Gly 20 25 30Gly Gly Ser Gly Gly Gly Gly Ser
Gly Gly Gly Gly Ser Gly Gly Gly 35 40 45Gly Ser 501642DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
16gtggtcatat gggcattgaa ggcagaggcg ccgctgcggt cg
421750DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 17ggtggttgct cttccgcaaa aacccggaga cagggagaga
ctcttctgcg 501837DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 18gctactgcag ccaccatggc cttgaccttt
gctttac 371944DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 19cagttccgga gctgggcacg gcggagagcc
cacagagcag cttg 442031DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 20ccaactgcag ccaccatgga
gacagacaca c 312132DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 21gggcacggcg ggcaaccagt ggaacctgga ac
322218DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 22tgcccgccgt gcccggca 182320DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
23atagaagcct ttgaccaggc 20246PRTArtificial SequenceDescription of
Artificial Sequence Synthetic 6xHis tag 24His His His His His His1
52563DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 25ggaaccagat ccagagccag atccgtgatg gtgatggtga
tggtcaccag tggaacctgg 60aac 632658DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 26ggatctggct ctggatctgg
ttccatcgaa ggtcgttgcc cgccgtgccc agctccgg 582769DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
27gctgcggtcg acaaaactca cacatgccca ccgtgcccag ctccggaact cctgggcgga
60ccgtcagtc 692836DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 28attggaattc tcatttaccc ggagacaggg agaggc
362923DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 29gagcagtacg ctagcacgta ccg 233023DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
30ggtacgtgct agcgtactgc tcc 2331102DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
31tttaagcttg ccgccaccat ggagacagac acactcctgc tatgggtact gctgctctgg
60gttccaggtt ccactggtga caaaactcac acatgcccac cg
1023222DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 32ggtcagctca tcgcgggatg gg 223322DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
33cccatcccgc gatgagctga cc 2234245PRTArtificial SequenceDescription
of Artificial Sequence Synthetic CysFc amino acid sequence 34Met
Ala Leu Thr Phe Ala Leu Leu Val Ala Leu Leu Val Leu Ser Cys1 5 10
15Lys Ser Ser Cys Ser Val Gly Cys Pro Pro Cys Pro Ala Pro Glu Leu
20 25 30Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp
Thr 35 40 45Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val
Asp Val 50 55 60Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val
Asp Gly Val65 70 75 80Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu
Glu Gln Tyr Asn Ser 85 90 95Thr Tyr Arg Val Val Ser Val Leu Thr Val
Leu His Gln Asp Trp Leu 100 105 110Asn Gly Lys Glu Tyr Lys Cys Lys
Val Ser Asn Lys Ala Leu Pro Ala 115 120 125Pro Ile Glu Lys Thr Ile
Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro 130 135 140Gln Val Tyr Thr
Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln145 150 155 160Val
Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala 165 170
175Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr
180 185 190Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser
Lys Leu 195 200 205Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val
Phe Ser Cys Ser 210 215 220Val Met His Glu Ala Leu His Asn His Tyr
Thr Gln Lys Ser Leu Ser225 230 235 240Leu Ser Pro Gly Lys
24535738DNAArtificial SequenceDescription of Artificial Sequence
Synthetic CysFc nucleotide sequence 35atggccttga cctttgcttt
actggtggcc ctcctggtgc tcagctgcaa gtcaagctgc 60tctgtgggct gcccgccgtg
cccagctccg gaactgctgg gcggaccgtc agtcttcctc 120ttccccccaa
aacccaagga caccctcatg atctcccgga cccctgaggt cacatgcgtg
180gtggtggacg tgagccacga agaccctgag gtcaagttca actggtacgt
ggacggcgtg 240gaggtgcata atgccaagac aaagccgcgg gaggagcagt
acaacagcac gtaccgtgtg 300gtcagcgtcc tcaccgtcct gcaccaggac
tggctgaatg gcaaggagta caagtgcaag 360gtctccaaca aagccctccc
agcccccatc gagaaaacca tctccaaagc caaagggcag 420ccccgagaac
cacaggtgta caccctgccc ccatcccggg atgagctgac caagaaccag
480gtcagcctga cctgcctggt caaaggcttc tatcccagcg acatcgccgt
ggagtgggag 540agcaatgggc agccggagaa caactacaag accacgcctc
ccgtgttgga ctccgacggc 600tccttcttcc tctacagcaa gctcaccgtg
gacaagagca ggtggcagca ggggaacgtc 660ttctcatgct ccgtgatgca
tgaggctctg cacaaccact acacgcagaa gagcctctcc 720ctgtctccgg gtaaatga
73836238PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Fc-MESNA amino acid sequence 36Met Gly Ile Glu Gly Arg
Gly Ala Ala Ala Val Asp Thr Ser His Thr1 5 10 15Cys Pro Pro Cys Pro
Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe 20 25 30Leu Phe Pro Pro
Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro 35 40 45Glu Val Thr
Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu Val 50 55 60Lys Phe
Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr65 70 75
80Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val
85 90 95Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys
Cys 100 105 110Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys
Thr Ile Ser 115 120 125Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val
Tyr Thr Leu Pro Pro 130 135 140Ser Arg Asp Glu Leu Thr Lys Asn Gln
Val Ser Leu Thr Cys Leu Val145 150 155 160Lys Gly Phe Tyr Pro Ser
Asp Ile Ala Val Glu Trp Glu Ser Asn Gly 165 170 175Gln Pro Glu Asn
Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp 180 185 190Gly Ser
Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp 195 200
205Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His
210 215 220Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly
Phe225 230 23537714DNAArtificial SequenceDescription of Artificial
Sequence Synthetic nucleotide sequence 37atgggcattg aaggcagagg
cgccgctgcg gtcgatacta gtcacacatg cccaccgtgc 60ccagcacctg aactcctggg
gggaccgtca gtcttcctct tccccccaaa acccaaggac 120accctcatga
tctcccggac ccctgaggtc acatgcgtgg tggtggacgt gagccacgaa
180gaccctgagg tcaagttcaa ctggtacgtg gacggcgtgg aggtgcataa
tgccaagaca 240aagccgcggg aggagcagta caacagcacg taccgtgtgg
tcagcgtcct caccgtcctg 300caccaggact ggctgaatgg caaggagtac
aagtgcaagg tctccaacaa agccctccca 360gcccccatcg agaaaaccat
ctccaaagcc aaagggcagc cccgagaacc acaggtgtac 420accctgcccc
catcccggga tgagctgacc aagaaccagg tcagcctgac ctgcctggtc
480aaaggcttct atcccagcga catcgccgtg gagtgggaga gcaatgggca
gccggagaac 540aactacaaga ccacgcctcc cgtgttggac tccgacggct
ccttcttcct ctacagcaag 600ctcaccgtgg acaagagcag gtggcagcag
gggaacgtct tctcatgctc cgtgatgcat 660gaggctctgc acaaccacta
cacgcagaag agtctctccc tgtctccggg tttt 71438729DNAArtificial
SequenceDescription of Artificial Sequence Synthetic nucleotide
sequence 38atggagacag acacactcct gctatgggta ctgctgctct gggttccagg
ttccactggt 60tgcccgccgt gcccagctcc ggaactgctg ggcggaccgt cagtcttcct
cttcccccca 120aaacccaagg acaccctcat gatctcccgg acccctgagg
tcacatgcgt ggtggtggac 180gtgagccacg aagaccctga ggtcaagttc
aactggtacg tggacggcgt ggaggtgcat 240aatgccaaga caaagccgcg
ggaggagcag tacaacagca cgtaccgtgt ggtcagcgtc 300ctcaccgtcc
tgcaccagga ctggctgaat ggcaaggagt acaagtgcaa ggtctccaac
360aaagccctcc cagcccccat cgagaaaacc atctccaaag ccaaagggca
gccccgagaa 420ccacaggtgt acaccctgcc cccatcccgg gatgagctga
ccaagaacca ggtcagcctg 480acctgcctgg tcaaaggctt ctatcccagc
gacatcgccg tggagtggga gagcaatggg 540cagccggaga acaactacaa
gaccacgcct cccgtgttgg actccgacgg ctccttcttc 600ctctacagca
agctcaccgt ggacaagagc aggtggcagc aggggaacgt cttctcatgc
660tccgtgatgc atgaggctct gcacaaccac tacacgcaga agagcctctc
cctgtctccg 720ggtaaatga 72939242PRTArtificial SequenceDescription
of Artificial Sequence Synthetic amino acid sequence 39Met Glu Thr
Asp Thr Leu Leu Leu Trp Val Leu Leu Leu Trp Val Pro1 5 10 15Gly Ser
Thr Gly Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly 20 25 30Pro
Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile 35 40
45Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His Glu
50 55 60Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val
His65 70 75 80Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser
Thr Tyr Arg 85 90 95Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp
Leu Asn Gly Lys 100 105 110Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala
Leu Pro Ala Pro Ile Glu 115 120 125Lys Thr Ile Ser Lys Ala Lys Gly
Gln Pro Arg Glu Pro Gln Val Tyr 130 135 140Thr Leu Pro Pro Ser Arg
Asp Glu Leu Thr Lys Asn Gln Val Ser Leu145 150 155 160Thr Cys Leu
Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp 165 170 175Glu
Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val 180 185
190Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp
195 200 205Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val
Met His 210 215 220Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu
Ser Leu Ser Pro225 230 235 240Gly Lys40786DNAArtificial
SequenceDescription of Artificial Sequence Synthetic nucleotide
sequence 40atggagacag acacactcct gctatgggta ctgctgctct gggttccagg
ttccactggt 60gaccatcacc atcaccatca cggatctggc tctggatctg gttccatcga
aggtcgttgc 120ccgccgtgcc cagctccgga actgctgggc ggaccgtcag
tcttcctctt ccccccaaaa 180cccaaggaca ccctcatgat ctcccggacc
cctgaggtca catgcgtggt ggtggacgtg 240agccacgaag accctgaggt
caagttcaac tggtacgtgg acggcgtgga ggtgcataat 300gccaagacaa
agccgcggga ggagcagtac aacagcacgt accgtgtggt cagcgtcctc
360accgtcctgc accaggactg gctgaatggc aaggagtaca agtgcaaggt
ctccaacaaa 420gccctcccag cccccatcga gaaaaccatc tccaaagcca
aagggcagcc ccgagaacca 480caggtgtaca ccctgccccc atcccgggat
gagctgacca agaaccaggt cagcctgacc 540tgcctggtca aaggcttcta
tcccagcgac atcgccgtgg agtgggagag caatgggcag 600ccggagaaca
actacaagac cacgcctccc gtgttggact ccgacggctc cttcttcctc
660tacagcaagc tcaccgtgga caagagcagg tggcagcagg ggaacgtctt
ctcatgctcc 720gtgatgcatg aggctctgca caaccactac acgcagaaga
gcctctccct gtctccgggt 780aaatga 78641261PRTArtificial
SequenceDescription of Artificial Sequence Synthetic amino acid
sequence 41Met Glu Thr Asp Thr Leu Leu Leu Trp Val Leu Leu Leu Trp
Val Pro1 5 10 15Gly Ser Thr Gly Asp His His His His His His Gly Ser
Gly Ser Gly 20 25 30Ser Gly Ser Ile Glu Gly Arg Cys Pro Pro Cys Pro
Ala Pro Glu Leu 35 40 45Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro
Lys Pro Lys Asp Thr 50 55 60Leu Met Ile Ser Arg Thr Pro Glu Val Thr
Cys Val Val Val Asp Val65 70 75 80Ser His Glu Asp Pro Glu Val Lys
Phe Asn Trp Tyr Val Asp Gly Val 85 90 95Glu Val His Asn Ala Lys Thr
Lys Pro Arg Glu Glu Gln Tyr Asn Ser 100 105 110Thr Tyr Arg Val Val
Ser Val Leu Thr Val Leu His Gln Asp Trp Leu 115 120 125Asn Gly Lys
Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala 130 135 140Pro
Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro145 150
155 160Gln Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn
Gln 165 170 175Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser
Asp Ile Ala 180 185 190Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn
Asn Tyr Lys Thr Thr 195 200 205Pro Pro Val Leu Asp Ser Asp Gly Ser
Phe Phe Leu Tyr Ser Lys Leu 210 215 220Thr Val Asp Lys Ser
Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser225 230 235 240Val Met
His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser 245 250
255Leu Ser Pro Gly Lys 260424PRTHomo sapiens 42Glu Leu Leu Gly1
* * * * *
References