U.S. patent application number 12/925843 was filed with the patent office on 2011-06-30 for method for detecting cytosine methylation in dna samples.
Invention is credited to Kurt Berlin, Alexander Olek.
Application Number | 20110159491 12/925843 |
Document ID | / |
Family ID | 7633313 |
Filed Date | 2011-06-30 |
United States Patent
Application |
20110159491 |
Kind Code |
A1 |
Olek; Alexander ; et
al. |
June 30, 2011 |
Method for detecting cytosine methylation in DNA samples
Abstract
Described is a method for detecting 5-methylcytosine in genomic
DNA samples. First, a genomic DNA from a DNA sample is chemically
converted with a reagent, 5-methylcytosine and cytosine reacting
differently, and the pretreated DNA is subsequently amplified using
a polymerase and at least one primer. In the next step, the
amplified genomic DNA is hybridized to at least one
oligonucleotide, forming a duplex, and said oligonucleotide is
elongated by at least one nucleotide, the nucleotide carrying a
detectable label, and the elongation depending on the methylation
status of the specific cytosine in the genomic DNA sample. In the
next step, the elongated oligonucleotides are analyzed for the
presence of the label.
Inventors: |
Olek; Alexander; (Berlin,
DE) ; Berlin; Kurt; (Stahnsdorf, DE) |
Family ID: |
7633313 |
Appl. No.: |
12/925843 |
Filed: |
October 29, 2010 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10220896 |
Mar 11, 2003 |
7824852 |
|
|
PCT/DE01/00747 |
Feb 23, 2001 |
|
|
|
12925843 |
|
|
|
|
Current U.S.
Class: |
435/6.11 |
Current CPC
Class: |
C12Q 1/6837 20130101;
C12Q 1/6816 20130101; C12Q 1/6827 20130101; C12Q 1/6872 20130101;
C12Q 1/686 20130101; C12Q 1/6827 20130101; C12Q 2523/125 20130101;
C12Q 2565/519 20130101; C12Q 2565/627 20130101 |
Class at
Publication: |
435/6.11 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68 |
Foreign Application Data
Date |
Code |
Application Number |
Feb 25, 2000 |
DE |
100 10 282.4 |
Claims
1. A method for detecting 5-methylcytosine in genomic DNA samples,
characterized in that the following steps are carried out: (a) a
genomic DNA from a DNA sample is chemically converted with a
reagent, 5-methylcytosine and cytosine reacting differently, thus
exhibiting different base pairing behaviors in the DNA duplex
subsequent to the reaction; (b) pretreated DNA is amplified using a
polymerase and at least one oligonucleotide (type A) as a primer;
(c) the amplified genomic DNA is hybridized to at least one
oligonucleotide (type B) having a known sequence of n nucleotides,
forming a duplex, said hybridized oligonucleotides of type B, with
their 3'-ends, partially or completely hybridizing to the positions
to be analyzed with regard to their methylation in the genomic DNA
sample; (d) the oligonucleotide (type B), provided that it has
previously hybridized with its 3'-terminus to the position to be
analyzed without mispairings, is elongated by at least one
nucleotide by means of a polymerase, at least one nucleotide
carrying a detectable label, and the elongation depending on the
methylation status of the specific cytosine in the genomic DNA
sample; (e) the elongated oligonucleotides are analyzed for the
presence of the label.
2. The method as recited in claim 1, characterized in that the
oligonucleotides (type B) are bonded to a solid phase at defined
locations.
3. The method as recited in claim 1, characterized in that the
amplificates are bonded to a solid phase at defined locations.
4. The method as recited in claim 2, characterized in that
different oligonucleotide sequences are arranged on a plane solid
phase in the form of a rectangular or hexagonal lattice.
5. The method as recited in claim 2, characterized in that solid
phase surface is composed of silicon, glass, polystyrene, aluminum,
steel, iron, copper, nickel, silver, or gold.
6. The method as recited in claim 2, characterized in that the
labels attached to the elongated oligonucleotides are identifiable
at each position of the solid phase at which an oligonucleotide
sequence is located.
7. The method as recited in claim 1, characterized in that at least
one primer (type A) is bonded to a solid phase during
amplification.
8. The method as recited in claim 1, characterized in that
different amplificates are arranged on the solid phase in the form
of a rectangular or hexagonal lattice.
9. The method as recited in claim 1, characterized in that, prior
to the amplification, the DNA is treated with a bisulfite solution
(=disulfite, hydrogen sulfite).
10. The method as recited in claim 1, characterized in that the
amplification is carried out by means of the polymerase chain
reaction (PCR).
11. The method as recited in claim 1, characterized in that the
oligonucleotides of type A used in claim 1 either contain only the
bases T, A and C or else the bases T, A and G.
12. The method as recited in claim 1, characterized in that the
labels of the nucleotides are fluorescence labels.
13. The method as recited in claim 1, characterized in that the
labels of the nucleotides are radionuclides.
14. The method as recited in claim 1, characterized in that the
labels of the nucleotides are detachable mass labels which are
detected in a mass spectrometer.
15. The method as recited in claim 1, characterized in that the
elongated oligonucleotides altogether are detected in the mass
spectrometer, thus being uniquely labeled by their masses.
16. The method as recited in claim 1, characterized in that in each
case one fragment of the elongated oligonucleotides is detected in
the mass spectrometer.
17. The method as recited in claim 16, characterized in that the
fragment of the elongated oligonucleotide is produced by digestion
with one or several exo- or endonucleases.
18. The method as recited in claim 17, characterized in that the
produced fragments have a single positive or negative net charge
for better detectability in the mass spectrometer.
19. The method as recited in claim 1, characterized in that the
detection of the elongated oligonucleotides is carried out and
visualized by means of matrix assisted laser desorption/ionization
mass spectrometry (MALDI) or using electron spray mass spectrometry
(ESI).
20. The method as recited in claim 1, wherein the polymerases are
heat-resistant DNA-polymerases.
21. The method as recited in claim 1, wherein SNPs are also
detected and visualized in addition to the DNA methylation.
22. The method as recited in claim 1, wherein the used nucleotides
are terminating (type C 2) and/or chain-elongating nucleotides
(type C 1).
23. The method as recited in claim 1, wherein the nucleotides (type
C 1 and C 2) are selected from a group comprising either the
nucleobases A, T and C or else the bases G and A and T.
24. The method as recited in claim 1, characterized in that the
amplification of several DNA segments is carried out in one
reaction vessel.
25. The method as recited in claim 1, step a, wherein the genomic
DNA is obtained from a DNA sample, sources of DNA comprising, e.g.,
cell lines, blood, sputum, stool, urine, cerebral-spinal fluid,
tissue embedded in paraffin, histologic object slides, and all
possible combinations thereof.
26. The method as recited in claim 1, characterized in that the
methylation analyses of the upper and lower DNA strands are carried
out in one experiment.
Description
[0001] The present invention relates to a method for detecting
5-methylcytosine in genomic DNA samples.
[0002] The levels of observation that have been well studied by the
methodological developments of recent years in molecular biology
are the genes themselves, the translation of genes into RNA, and
the resulting proteins. The question of which gene is switched on
at which point in the course of the development of an individual,
and how the activation and inhibition of specific genes in specific
cells and tissues are controlled is correlatable to the degree and
character of the methylation of the genes or of the genome.
[0003] The present invention describes a method for detecting the
methylation state of genomic DNA samples. The method can, at the
same time, also be used for detecting point mutations and single
nucleotide polymorphisms (SNPs).
[0004] 5-methylcytosine is the most frequent covalently modifiable
base in the DNA of eukaryotic cells. It plays a role, for example,
in the regulation of the transcription, in genetic imprinting, and
in tumorigenesis. Therefore, the identification of 5-methylcytosine
as a part of genetic information is of considerable interest.
However, 5-methylcytosine positions cannot be identified by
sequencing since 5-methylcytosine has the same base pairing
behavior as cytosine. Moreover, the epigenetic information carried
by the 5-methylcytosines is completely lost during a PCR
amplification.
[0005] A relatively new and now the most frequently used method for
analyzing DNA for 5-methylcytosine is based on the specific
reaction of bisulfite with cytosine which, upon subsequent alkaline
hydrolysis, is converted to uracil which corresponds to thymidine
in its base pairing behavior. However, 5-methylcytosine remains
unmodified under these conditions. Consequently, the original DNA
is converted in such a manner that methylcytosine, which originally
cannot be distinguished from cytosine in its hybridization
behavior, can now be detected as the only remaining cytosine using
"normal" molecular biological techniques, for example, by
amplification and hybridization or sequencing. All these techniques
are based on base pairing which is now taken full advantage of. The
Prior Art is defined in terms of sensitivity by a method which
encloses the DNA to be analyzed in an agarose matrix, thus
preventing the diffusion and renaturation of the DNA (bisulfite
reacts only on single-stranded DNA), and which replaces all
precipitation and purification steps with fast dialysis (Olek, A.
et al, Nucl. Acids. Res. 1996, 24, 5064-5066). Using this method,
it is possible to analyze individual cells, which illustrates the
potential of the method. Up to now, however, only individual
regions of a length of up to approximately 3000 base pairs are
analyzed; a global analysis of cells for thousands of possible
methylation analyses is not possible. However, this method cannot
reliably analyze very small fragments from small sample quantities
either. These are lost in spite of the diffusion protection by the
matrix.
[0006] An overview of the further known possibilities of detecting
5-methylcytosines can be gathered from the following survey
article: Rein, T., DePamphilis, M. L., Zorbas, H., Nucleic Acids
Res. 1998, 26, 2255.
[0007] Up to now, the bisulfite technology is only used in research
with few exceptions (e.g., Zeschnigk M. et al, Eur J Hum Genet.
1997, 5, 94-98). Always, however, short specific fragments of a
known gene are amplified subsequent to a bisulfite treatment and
either completely sequenced (Olek, A. and Walter, J., Nat. Genet.
1997, 17, 275-276) or individual cytosine positions are detected by
a primer extension reaction (Gonzalgo, M. L., and Jones, P. A.,
Nucl. Acids Res. 1997, 25, 2529-2531, WO 9500669) or by an
enzymatic digestion (Xiong, Z. and Laird, P. W., Nucl. Acids. Res.
1997, 25, 2532-2534). In addition, the detection by hybridization
has also been described (Olek et al., WO 99 28498).
[0008] Further publications dealing with the use of the bisulfite
technique for methylation detection in individual genes are: Xiong,
Z. and Laird, P. W. (1997), Nucl. Acids Res. 25, 2532; Gonzalgo, M.
L. and Jones, P. A. (1997), Nucl. Acids Res. 25, 2529; Grigg, S,
and Clark, S. (1994), Bioassays 16, 431; Zeschnik, M. et al.
(1997), Human Molecular Genetics 6, 387; Teil, R. et al. (1994),
Nucl. Acids Res. 22, 695; Martin, V. et al. (1995), Gene 157, 261;
WO 97 46705 and WO 95 15373.
[0009] An overview of the Prior Art in oligomer array manufacturing
can be gathered from a special edition of Nature Genetics (Nature
Genetics Supplement, Volume 21, January 1999), published in January
1999, and from the literature cited there.
[0010] There are different methods for immobilizing DNA. The
best-known method is the fixed binding of a DNA which is
functionalized with biotin to a streptavidin-coated surface (Uhlen,
M. et al. 1988, Nucleic Acids Res. 16, 3025-3038). The binding
strength of this system corresponds to that of a covalent chemical
bond without being one. To be able to covalently bind a target DNA
to a chemically prepared surface, a corresponding functionality of
the target DNA is required. DNA itself does not possess any
functionalization which is suitable. There are different variants
of introducing a suitable functionalization into a target DNA: two
functionalizations which are easy to handle are primary aliphatic
amines and thiols. Such amines are quantitatively converted with
N-hydroxysuccinimide esters, and thiols react quantitatively with
alkyl iodides under suitable conditions. A difficulty consists in
introducing such a functionalization into a DNA. The simplest
variant is the introduction via a primer of a PCR. Disclosed
variants use 5'-modified primers (NH.sub.2 and SH) and a
bifunctional linker.
[0011] An essential component of the immobilization on a surface is
its constitution. Systems described up to now are mainly composed
of silicon or metal. A further method of binding a target DNA is
based on the use of a short recognition sequence (e.g., 20 bases)
in the target DNA for hybridization to a surface-immobilized
oligonucleotide. Enzymatic variants for introducing chemically
activated positions in a target DNA have been described as well. In
this case, a 5'-NH.sub.2-functionalization is carried out
enzymatically on a target DNA.
[0012] For scanning an immobilized DNA array, fluorescently labeled
probes have often been used. Particularly suitable for fluorescence
labeling is the simple attachment of Cy3 and Cy5 dyes to the 5'-OH
of the specific probe. The detection of the fluorescence of the
hybridized probes is carried out, for example via a confocal
microscope. Cy3 and Cy5 dyes, besides many others, are commercially
available.
[0013] More recent methods for detecting mutations are specified in
the following:
[0014] Worth mentioning as a special case of sequencing is the
single-base primer extension (Genetic Bit Analysis) (Head, S R.,
Rogers, Y H., Parikh K., Lan, G., Anderson, S., Goelet, P.,
Boycejacino M T., Nucleic Acids Research. 25(24): 5065-5071, 1997;
Picoult-Newberg, L., Genome Res. 9(2): 167-174, 1999). A combined
amplification and sequencing is described in US-A15928906 where a
base-specific termination on matrix molecules is used. A further
method uses a ligase/polymerase reaction for identifying
nucleotides (U.S. Pat. No. 5,952,174).
[0015] Matrix Assisted Laser Desorption Ionization Mass
Spectrometry (MALDI) is a very efficient development for the
analysis of biomolecules (Karas, M. and Hillenkamp, F. (1988),
Laser desorption ionization of proteins with molecular masses
exceeding 10000 daltons. Anal. Chem. 60: 2299-2301). An analyte is
embedded in a light-absorbing matrix. By a short laser pulse, the
matrix is evaporated, thus transporting the analyte molecule into
the vapor phase in an unfragmented manner. The analyte is ionized
by collisions with matrix molecules. An applied voltage accelerates
the ions into a field-free flight tube. Due to their different
masses, the ions are accelerated at different rates. Smaller ions
reach the detector sooner than bigger ones.
[0016] MALDI is ideally suited to the analysis of peptides and
proteins. The analysis of nucleic acids is somewhat more difficult
(Gut, I. G. and Beck, S. (1995), DNA and Matrix Assisted Laser
Desorption Ionization Mass Spectrometry. Molecular Biology Current
Innovations and Future Trends 1: 147-157.). The sensitivity for
nucleic acids is approximately 100 times worse than for peptides
and decreases disproportionally with increasing fragment size. For
nucleic acids having a multiply negatively charged backbone, the
ionization process via the matrix is considerably less efficient.
For MALDI, the selection of the matrix plays an eminently important
role. For the desorption of peptides, several very efficient
matrixes have been found which produce a very fine crystallization.
For DNA, there are currently several matrixes in use, however, this
has not reduced the difference in sensitivity. The difference in
sensitivity can be reduced by chemically modifying the DNA in such
a manner that it becomes more similar to a peptide.
Phosphorothioate nucleic acids in which the usual phosphates of the
backbone are substituted by thiophosphates can be converted into a
charge-neutral DNA using simple alkylation chemistry (Gut, I. G.
and Beck, S. (1995), A procedure for selective DNA alkylation and
detection by mass spectrometry. Nucleic Acids Res. 23: 1367-1373).
The coupling of a charge tag to this modified DNA results in an
increase in sensitivity by the same amount as that found for
peptides. A further advantage of charge tagging is the increased
stability of the analysis against impurities which makes the
detection of unmodified substrates considerably more difficult.
[0017] Genomic DNA is obtained from DNA of cell, tissue or other
test samples using standard methods. This standard methodology is
found in references such as Fritsch and Maniatis eds., Molecular
Cloning: A Laboratory Manual, 1989.
[0018] Mutualities between promoters consist not only in the
occurrence of TATA- or GC-boxes but also for which transcription
factors they possess binding sites and at what distance these are
located from each other. The existing binding sites for a specific
protein do not match completely in their sequence but conserved
sequences of at least 4 bases are found which can still be
elongated by inserting wobbles, i.e., positions at which in each
case different bases are located. Moreover, these binding sites are
present at specific distances from each other.
[0019] However, the distribution of the DNA in the interphase
chromatin which occupies the largest portion of the nuclear volume
is subject to a very special arrangement. Thus, the DNA is attached
to the nuclear matrix, a filamentous pattern at the inner side of
the nuclear membrane, at several locations. These regions are
designated as matrix attachment regions (MAR) or scaffold
attachment regions (SAR). The attachment has an essential influence
on the transcription or the replication. These MAR fragments have
no conserved sequences but to 70% they consist of A or T, and are
located in the vicinity of cis-acting regions which regulate the
transcription in a general manner, and in the vicinity of
topoisomerase II recognition sites.
[0020] In addition to promoters and enhancers, further regulatory
elements, so-called "insulators", exist for different genes. These
insulators can, for example, inhibit the action of the enhancer on
the promotor if they are located between enhancer and promotor, or
else, if located between heterochromatin and a gene, can protect
the active gene from the influence of the heterochromatin. Examples
of such insulators include: firstly, so-called "LCR" (locus control
regions) consisting of several sites which are hypersensitive to
DNAase I; secondly, certain sequences such as SCS (specialized
chromatin structures) or SCS', 350 or 200 bp long, respectively,
and highly resistant to degradation by DNAase I, and flanked on
both sides with hypersensitive sites (distance in each case 100
bp). The protein BEAF-32 binds to scs'. These insulators can be
located on both sides of the gene.
[0021] It is the aim of the present invention to provide a method
particularly suitable for concurrently detecting cytosine
methylations and SNPs in genomic DNA samples. In the process, it
should preferably be possible for a plurality of fragments to be
analyzed concurrently.
[0022] The aim of the invention is reached by a method for
detecting 5-methylcytosine in genomic DNA samples, wherein the
following steps are carried out:
[0023] (a) a genomic DNA from a DNA sample is chemically converted
with a reagent, 5-methylcytosine and cytosine reacting differently,
thus exhibiting different base pairing behaviors in the DNA duplex
subsequent to the reaction;
[0024] (b) pretreated DNA is amplified using a polymerase and at
least one oligonucleotide (type A) as a primer;
[0025] (c) the amplified genomic DNA is hybridized to at least one
oligonucleotide (type B) having a known sequence of n nucleotides,
forming a duplex, said hybridized oligonucleotides of type B, with
their 3'-ends, partially or completely hybridizing to the positions
to be analyzed with regard to their methylation in the genomic DNA
sample;
[0026] (d) the oligonucleotide (type B), provided that it has
previously hybridized with its 3'-terminus to the position to be
analyzed without mispairings, is elongated by at least one
nucleotide by means of a polymerase, at least one nucleotide
carrying a detectable label, and the elongation depending on the
methylation status of the specific cytosine in the genomic DNA
sample;
[0027] (e) the elongated oligonucleotides are analyzed for the
presence of the label.
[0028] According to the invention it is preferred that the
oligonucleotides (type B) are bonded to a solid phase at defined
locations or that the amplificates are bonded to a solid phase at
defined locations.
[0029] It is further preferred that different oligonucleotide
sequences are arranged on a plane solid phase in the form of a
rectangular or hexagonal lattice.
[0030] According to the invention it is further preferred that the
solid phase surface is composed of silicon, glass, polystyrene,
aluminum, steel, iron, copper, nickel, silver, or gold.
[0031] It is also preferred that the labels attached to the
elongated oligonucleotides are identifiable at each position of the
solid phase at which an oligonucleotide sequence is located.
[0032] According to the invention it is preferred that at least one
primer (type A) is bonded to a solid phase during
amplification.
[0033] Moreover it can be preferred according to the invention that
different amplificates are arranged on the solid phase in the form
of a rectangular or hexagonal lattice.
[0034] It is particularly preferred that, prior to the
amplification, the DNA is treated with a bisulfite solution
(=disulfite, hydrogen sulfite).
[0035] According to the invention it is particularly preferred that
the amplification is carried out by means of the polymerase chain
reaction (PCR).
[0036] According to the invention it is furthermore preferred that
the oligonucleotides of type A either contain only the bases T, A
and C or else the bases T, A and G.
[0037] It is further preferred that the labels of the nucleotides
are fluorescence labels.
[0038] According to the invention it is further preferred that the
labels of the nucleotides are radionuclides.
[0039] It is especially preferred that the labels of the
nucleotides are detachable mass labels which are detected in a mass
spectrometer.
[0040] According to the invention it is furthermore preferred that
the elongated oligonucleotides altogether are detected in the mass
spectrometer, thus being uniquely labeled by their masses. It is
also particularly preferred that in each case one fragment of the
elongated oligonucleotides is detected in the mass
spectrometer.
[0041] According to the invention it is further preferred that the
fragment of the elongated oligonucleotide is produced by digestion
with one or several exo- or endonucleases.
[0042] According to the invention it is furthermore preferred that
the produced fragments have a single positive or negative net
charge for better detectability in the mass spectrometer.
[0043] According to the invention it is especially preferred that
the detection of the elongated oligonucleotides is carried out and
visualized by means of matrix assisted laser desorption/ionization
mass spectrometry (MALDI) or using electron spray mass spectrometry
(ESI).
[0044] According to the invention a method is preferred wherein the
polymerases are heat-resistant DNA-polymerases.
[0045] According to the invention a method is also preferred
wherein SNPs are also detected and visualized in addition to the
DNA methylation.
[0046] Furthermore a method is preferred wherein the used
nucleotides are terminating (type C 2) and/or chain-elongating
nucleotides (type C 1).
[0047] According to the invention a method is further preferred
wherein the nucleotides (type C 1 and C 2) are selected from a
group comprising either the nucleobases A, T and C or else the
bases G and A and T.
[0048] According to the invention it is further preferred that the
amplification of several DNA segments is carried out in one
reaction vessel.
[0049] Particularly preferred according to the invention is a
method wherein the genomic DNA is obtained from a DNA sample,
sources of DNA comprising, e.g., cell lines, blood, sputum, stool,
urine, cerebral-spinal fluid, tissue embedded in paraffin,
histologic object slides, and all possible combinations
thereof.
[0050] Finally it is preferred according to the invention that the
methylation analyses of the upper and lower DNA strand is carried
out in one experiment.
[0051] Described is a method for detecting methylcytosine in
genomic DNA samples:
[0052] The method includes the amplification, hybridization and
elongation reaction of an entire DNA or of a fragment thereof. The
method can be used for detecting methylcytosine and, at the same
time, also of single nucleotide polymorphisms (SNPs) and
mutations.
[0053] The genomic DNA to be analyzed is preferably obtained from
usual sources of DNA such as cell lines, blood, sputum, stool,
urine, cerebral-spinal fluid, tissue embedded in paraffin,
histologic object slides, and all possible combinations
thereof.
[0054] In the first step of the method, the used DNA is preferably
treated with bisulfite (=disulfite, hydrogen sulfite) or else with
another chemical in such a manner that all cytosine bases which are
not methylated at the 5-position of the base are changed in such a
manner that a different base results with regard to the base
pairing behavior while the cytosines methylated at the 5-position
remain unchanged. If bisulfite is used, then an addition takes
place at the non-methylated cytosine bases. The subsequent alkaline
hydrolysis then gives rise to the conversion of non-methylated
cytosine nucleobases to uracil.
[0055] In the second step of the method, the pretreated DNA is
preferably amplified using a heat-resistant polymerase and at least
one primer (type A).
[0056] In a particularly preferred variant of the method, the
amplification is carried out with primers of type A by means of the
polymerase chain reaction (PCR).
[0057] In a preferred variant of the method, the amplification of
several DNA fragments is carried out in one reaction vessel. This
can either be a so-called "multiplex PCR" in which different
primers each produce defined fragments. Different, defined
amplifications are carried out in one reaction vessel. In a
further, particularly preferred variant of the method, primers in
each case selectively and reproducibly amplify several fragments.
This is achieved, for example, in that they bind, for example, to
repetitive elements in the genome. In a particularly preferred
variant of the method, the primers bind to transcription factor
binding sites, to promoters or other regulatory elements in genes.
In a particularly preferred variant of the method, the
amplification is carried out by elongating primers which are bonded
to a solid phase. A multiplex PCR in the broader sense can be
carried out in that different primers are bonded at different,
defined locations of a solid phase.
[0058] In an, again, preferred variant of the second method step,
the solid phase is plane, the different oligonucleotide sequences
being arranged in the form of a rectangular or hexagonal lattice.
The result of this is that the different amplificates are arranged
on the solid phase in the form of a rectangular or hexagonal
lattice, as well. In this case, as already described above, several
amplificates are directly produced on the solid phase.
[0059] The solid phase surface is preferably composed of silicon,
glass, polystyrene, aluminum, steel, iron, copper, nickel, silver,
or gold.
[0060] In a particularly preferred variant of the method, the
oligonucleotides of type A either contain only bases T, A and C or
only bases T, A and G.
[0061] In the third method step, the amplified genomic DNA is
hybridized to at least one primer (type B), forming a duplex. The
hybridized oligonucleotides of type B each bind at their 3'-end to
the positions to be analyzed with regard to their methylation in
the genomic DNA sample. In this context, two cases can be
distinguished: the sequence to be analyzed is either completely
complementary to the primer even at its 3'-end; in this case, it is
possible to elongate the primer in a polymerase reaction in the
next step, or else, the sequence is not completely complementary to
that of the primer at the 3'-end; in this case, the primer cannot
be elongated. If a specific CpG-position is to be analyzed for
methylation, then there are two possible conditions. Subsequent to
the chemical pretreatment, preferably with bisulfite, a CG occurs
in the case of methylation; if an unmethylated cytosine is present,
a UG or, subsequent to amplification, a TG ensue. In this case, the
experiment is preferably carried out with two different primers
which give rise to complete complementarity for one of the
conditions, respectively, and, consequently, to the possibility of
a chain elongation in one of the two possible cases,
respectively.
[0062] Unless the amplificates are already bonded to the solid
phase, then the oligonucleotides which are hybridized to the
amplificates can be bonded to a solid phase with their 5'-end, or
with another base, or via their backbone but not via their 3'-end.
Preferably, the binding occurs via the 5'-end. In a preferred
variant, the solid phase is plane, the different oligonucleotide
sequences (type B) being arranged in the form of a rectangular or
hexagonal lattice.
[0063] The solid phase surface is preferably composed of silicon,
glass, polystyrene, aluminum, steel, iron, copper, nickel, silver,
or gold.
[0064] In the fourth method step, the resulting oligonucleotide is
elongated with a heat-resistant polymerase by at least one up to a
maximum of ten nucleotides, at least one nucleotide carrying a
detectable label. In this context, the type of elongation depends
on the methylation status of the specific cytosine in the genomic
DNA sample or else also on possibly existing SNPs, point mutations
or deletions, insertions and inversions.
[0065] In principle, only terminating oligonucleotides (type C 2)
are required. Depending on the sequence, however, chain-elongating
oligonucleotides can be used as well provided that it is possible
in the specific sequence context.
[0066] In a preferred variant of the method, the used nucleotides
are terminating (type C 2) and/or chain-elongating nucleotides
(type C 1). In a particularly preferred variant of the method, the
nucleobases of type C1 and/or of type C 2 are selected from a group
including bases T, A and C or else bases T, A and G.
[0067] The labeling of the elongated oligonucleotides of type B is
preferably carried out via absorbing dyes and/or via
chemiluminescence and/or via radioactive isotopes and/or via
fluorescence labels which are introduced via the nucleotides added
in the fourth method step. Also preferred is the labeling via the
molecular mass of the elongated oligonucleotide. The fluorescence
label is preferably inserted by a fluorescently labeled nucleotide
such as Cy5-dCTP.
[0068] In the fifth method step, the elongated oligonucleotides are
analyzed for the presence of a label. If a plane solid phase is
used, then an analysis takes place at each location on the solid
phase at which, originally, an oligonucleotide was immobilized.
[0069] In a particularly preferred variant of the method, the
detection of the elongated oligonucleotides is carried out via
their fluorescence.
[0070] In a preferred variant of the method, fragments of the
elongated oligonucleotide are produced by digestion with one or
several exo- or endonucleases.
[0071] In a particularly preferred variant of the method, the
labels of the nucleotides are detachable mass labels which are
detectable in a mass spectrometer.
[0072] In a particularly preferred variant of the method,
detachable mass labels, the elongated oligonucleotides altogether
or fragments thereof are detected and visualized on the basis of
their unique mass by means of matrix assisted laser
desorption/ionization mass spectrometry (MALDI-MS) or using
electron spray mass spectrometry (ESI).
[0073] The fragments detected in the mass spectrometer preferably
have a single positive or negative net charge.
[0074] In a particularly preferred variant of the method, SNPs
(single nucleotide polymorphisms) and cytosine methylations are
analyzed in one experiment.
[0075] In a particularly preferred variant of the method, the lower
and the upper strand of the DNA sample is analyzed in one
experiment subsequent to the chemical pretreatment to ensure an
internal experimental control.
[0076] A further subject matter of the present invention is a kit
containing chemicals and aids for carrying out the bisulfite
reaction and/or the amplification, the hybridization, the
elongation reaction and/or polymerases and/or the documentation for
carrying out the method.
[0077] The following examples illustrate the invention.
EXAMPLE 1
[0078] The following example relates to a fragment of exon 23 of
the factor VIII gene in which a specific CG-position is to be
analyzed for methylation.
[0079] In the first step, the fragment is amplified by primers of
type A, namely by ATTATGTTGGAGTAGTAGAGTTTAAATGGTT (SEQ.-ID No.: 1)
and ACTTAACACTTACTATTTAAATCACAACCCAT (SEQ.-ID No.: 2). The
amplified DNA is hybridized to an oligonucleotide of type B (for
example, GTTGGATGTTGTTGAGAAACG (SEQ.-ID No.: 3)) and elongated in a
polymerase reaction with a labeled 2',3'-didesoxythymidine
triphosphat (type C 2). This elongation can only take place if a
CG, that is, in the original genomic DNA sample, a methylated
cytosine was present since otherwise, a mispairing at the 3'-end of
the primer prevents the polymerase reaction. Thus, the methylation
status of the specific cytosine to be analyzed decides on the
elongation of the primer.
[0080] For control purposes, the reaction can be carried out with
the primer GTTGGATGTTGTTGAGAAATG (SEQ.-ID No.: 4). In this case,
the elongation takes place only if an non-methylated cytosine was
present at said position in the DNA sample to be analyzed. The
labels can, for example, be absorbing dyes such as Megaprime.TM.
for ddTTP or Rediprime II.TM..
EXAMPLE 2
[0081] The following example relates to a fragment of exon 23 of
the factor VIII gene in which a specific CG-position is to be
analyzed for methylation.
[0082] In the first step, the fragment is amplified by primers of
type A, namely by ATTATGTTGGAGTAGTAGAGTTTAAATGGTT (SEQ.-ID No.: 1)
and ACTTAACACTTACTATTTAAATCACAACCCAT (SEQ.-ID No.: 2). The
amplified DNA is hybridized to an oligonucleotide of type B (for
example, GTTGGATGTTGTTGAGAAACG (SEQ.-ID No.: 3)), which is
immobilized to a solid phase surface with its 5'-end, and elongated
in a polymerase reaction with a labeled 2',3'-didesoxythymidine
triphosphat (type C2). This elongation can only take place if a CG,
that is, in the original genomic DNA sample, a methylated cytosine
was present since otherwise, a mispairing at the 3'-end of the
primer prevents the polymerase reaction. Thus, the methylation
status of the specific cytosine to be analyzed decides on the
elongation of the primer.
[0083] For control purposes, the reaction can be carried out with
the primer GTTGGATGTTGTTGAGAAATG (SEQ.-ID No.: 4). In this case,
the elongation takes place only if an non-methylated cytosine was
present at said position in the DNA sample to be analyzed. The
labels can, for example, be absorbing dyes such as Megaprime.TM.
for ddTTP or Rediprime II.TM..
EXAMPLE 3
[0084] The following example relates to a fragment of exon 23 of
the factor VIII gene in which a specific CG-position is to be
analyzed for methylation.
[0085] In the first step, the fragment is amplified by primers of
type A, namely by ATTATGTTGGAGTAGTAGAGTTTAAATGGTT (SEQ.-ID No.: 1)
and ACTTAACACTTACTATTTAAATCACAACCCAT (SEQ.-ID No.: 2). For this
amplification, DNA treated with bisulphite was incubated for 5 min
at 96.degree. C., then denaturated by 40 cycles carried out for 55
sec at 96.degree. C. each, incubated for 75 sec at 61.7.degree. C.
(annealing) and incubated for 100 sec at 72.degree. C.
(elongation). In a subsequent reaction (final extension) the
reaction mixture is incubated for 15 min at 72.degree. C. The
amplified DNA is hybridized to the solid phase immobilized
oligonucleotides AAAAACTACAAAAACTCT (SEQ-ID No.: 5) (spot 1 in FIG.
1) and to AAAACTACGAAAACTCT (SEQ-ID No.: 6 (spot 2 in FIG. 1). The
elongation reaction affords 2'-desoxythymidine triphosphate (dTTP,
as type C 1), 2'-desoxyguanosine triphosphate (dGTP, as type C 1),
2'-desoxyadenosine triphosphat (dATP, as type C 1), and
2'-desoxycytidine triphosphate (dCTP, as type C 1), fluorescently
labeled 2'-desoxycytidine triphosphate beeing added additionally in
a 3:1 ratio (related to not-labeled 2'-desoxycytidine
triphosphate). The reaction mixture, consisting of the amplificate,
the desoxydinucleotide-mixture and 10.times. buffer is incubated
for 15 min at 96.degree. C. The Klenow fragment, used as a DNA
polymerase herein, is added for the subsequent extension reaction
and the reaction mixture is incubated at 37.degree. C. on the solid
phase overnight. As can be gathered from the following figure, the
primer extension carried out suggest on the methylation status of
the DNA. A comparison between spot 1 and spot 2, as illustrated in
FIG. 1, allows a statement about the methylation status: in this
case here the strength of the signal of spot 1 gives evidence to a
non-methylated CpG.
Sequence CWU 1
1
6131DNAArtificial Sequenceoligonucleotide 1attatgttgg agtagtagag
tttaaatggt t 31232DNAArtificial Sequenceoligonucleotide 2acttaacact
tactatttaa atcacaaccc at 32321DNAArtificial Sequenceoligonucleotide
3gttggatgtt gttgagaaac g 21421DNAArtificial Sequenceoligonucleotide
4gttggatgtt gttgagaaat g 21518DNAArtificial Sequenceoligonucleotide
5aaaaactaca aaaactct 18618DNAArtificial Sequenceoligonucleotide
6aaaaactacg aaaactct 18
* * * * *