MVA expressing modified HIV envelope, GAG, and POL genes

Abstract

The invention provides modified virus Ankara (MVA), a replication-deficient strain of vaccinia virus, expressing human immunodeficiency virus (HIV) env, gag, and pol genes.

Description

RELATED APPLICATIONS

[0001] This application is a divisional of U.S. patent application Ser. No. 11/238,155, filed Sep. 28, 2005, which is continuation of International Patent Application No. PCT/US2004/009906, filed Mar. 29, 2004 designating the U.S. and published in English on Oct. 14, 2004 as WO 2004/087201, which claims the benefit of U.S. Provisional Patent Application No. 60/459,175, filed Mar. 28, 2003, all of with are hereby expressly incorporated by reference in their entireties.

FIELD OF THE INVENTION

[0002] The invention provides modified vaccinia Ankara (MVA), a replication-deficient strain of vaccinia virus, expressing human immunodeficiency virus (HIV) env, gag, and pol genes.

BACKGROUND OF THE INVENTION

[0003] Cellular immunity plays an important role in the control of immunodeficiency virus infections (P. J. Goulder et al. 1999 AIDS 13:S121). Recently, a DNA vaccine designed to enhance cellular immunity by cytokine augmentation successfully contained a highly virulent immunodeficiency virus challenge (D. H. Barouch et al. 2000 Science 290:486). Another promising approach to raising cellular immunity is DNA priming followed by recombinant poxvirus boosters (H. L. Robinson et al. 2000 AIDS Rev 2:105). This heterologous prime/boost regimen induces 10- to 100-fold higher frequencies of T cells than priming and boosting with DNA or recombinant poxvirus vaccines alone. Previously, investigators showed that boosting a DNA-primed response with a poxvirus was superior to boosting with DNA or protein for the control of a non-pathogenic immunodeficiency virus (H. L. Robinson et al. 1999 Nat Med 5:526). There is a need for the control of a pathogenic immunodeficiency virus.

SUMMARY OF THE INVENTION

[0004] Here we report that DNA priming followed by a recombinant modified vaccinia Ankara (rMVA) booster has controlled a highly pathogenic immunodeficiency virus challenge in a rhesus macaque model. Both the DNA and rMVA components of the vaccine expressed multiple immunodeficiency virus proteins. Two DNA inoculations at 0 and 8 weeks and a single rMVA booster at 24 weeks effectively controlled an intrarectal challenge administered seven months after the booster. These findings are envisioned as indicating that a relatively simple multiprotein DNA/MVA vaccine can help to control the acquired immune deficiency syndrome (AIDS) epidemic. We also report that inoculations of rMVA induce good immune responses even without DNA priming.

BRIEF DESCRIPTION OF THE DRAWINGS

[0005] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.

[0006] FIG. 1. Phylogenetic relationships of HIV-1 and HIV-2 based on identity of pol gene sequences. SIV.sub.cpz, and SIV.sub.smm are subhuman primate lentiviruses recovered from a chimpanzee and sooty mangabey monkey, respectively.

[0007] FIG. 2. Phylogenetic relationships of HIV-1 groups M, N and O with four different SIV.sub.cpz, isolates based on full-length pol gene sequences. The bar indicates a genetic distance of 0.1 (10% nucleotide divergence) and the asterisk positions group N HIV-1 isolates based on env sequences.

[0008] FIG. 3. Tropic and biologic properties of HIV-1 isolates.

[0009] FIG. 4. HIV-encoded proteins. The location of the HIV genes, the sizes of primary translation products (in some cases polyproteins), and the processed mature viral proteins are indicated.

[0010] FIG. 5. Schematic representation of a mature HIV-1 virion.

[0011] FIG. 6. Linear representation of the HIV-1 Env glycoprotein. The arrow indicates the site of gp160 cleavage to gp120 and gp41. In gp120, cross-hatched areas represent variable domains (V.sub.1 to V.sub.5) and open boxes depict conserved sequences (C.sub.1 to C.sub.5). In the gp41 ectodomain, several domains are indicated: the N-terminal fusion peptide, and the two ectodomain helices (N- and C-helix). The membrane-spanning domain is represented by a black box. In the gp41 cytoplasmic domain, the Tyr-X-X-Leu (YXXL) endocytosis motif (SEQ ID NO: 9) and two predicted helical domains (helix-1 and -2) are shown. Amino acid numbers are indicated.

[0012] FIG. 7. Temporal frequencies of Gag-specific T cells. (A) Gag-specific CD8 T cell responses raised by DNA priming and rMVA booster immunizations. The schematic presents mean Gag-CM9-tetramer data generated in the high-dose i.d. DNA-immunized animals. (B) Gag-specific IFN-.gamma. ELISPOTs in A*01 (open bars) and non-A*01 (filled bars) macaques at various times before challenge and at two weeks after challenge. Three pools of 10 to 13 Gag peptides (22-mers overlapping by 12) were used for the analyses. The numbers above data bars represent the arithmetic mean.+-.SD for the ELISPOTs within each group. The numbers at the top of the graphs designate individual animals. *, data not available; #, <20 ELISPOTs per 1.times.10.sup.6 peripheral blood mononuclear cells (PBMC). Temporal data for Gag-CM9-Mamu-A*01 tetramer-specific T cells can be found in FIG. 12.

[0013] FIG. 8. Temporal viral loads, CD4 counts, and survival after challenge of vaccinated and control animals. (A) Geometric mean viral loads and (B) geometric mean CD4 counts. (C) Survival curve for vaccinated and control animals. The dotted line represents all 24 vaccinated animals. (D) Viral loads and (E) CD4 counts for individual animals in the vaccine and control groups. The key to animal numbers is presented in (E). Assays for the first 12 weeks after challenge had a detection level of 1000 copies of RNA per milliliter of plasma. Animals with loads below 1000 were scored with a load of 500. For weeks 16 and 20, the detection level was 300 copies of RNA per milliliter. Animals with levels of virus below 300 were scored at 300.

[0014] FIG. 9. Postchallenge T cell responses in vaccine and control groups. (A) Temporal tetramer.sup.+ cells (dashed line) and viral loads (solid line). (B) Intracellular cytokine assays for IFN-.gamma. production in response to stimulation with the Gag-CM9 peptide at two weeks after challenge. This ex vivo assay allows evaluation of the functional status of the peak postchallenge tetramer.sup.+ cells displayed in FIG. 7A. (C) Proliferation assay at 12 weeks after challenge. Gag-Pol-Env (open bars) and Gag-Pol (hatched bars) produced by transient transfections were used for stimulation. Supernatants from mock-transfected cultures served as control antigen. Stimulation indices are the growth of cultures in the presence of viral antigens divided by the growth of cultures in the presence of mock antigen.

[0015] FIG. 10. Lymph node histomorphology at 12 weeks after challenge. (A) Typical lymph node from a vaccinated macaque showing evidence of follicular hyperplasia characterized by the presence of numerous secondary follicles with expanded germinal centers and discrete dark and light zones. (B) Typical lymph node from an infected control animal showing follicular depletion and paracortical lymphocellular atrophy. (C) A representative lymph node from an age-matched, uninfected macaque displaying nonreactive germinal centers. (D) The percentage of the total lymph node area occupied by germinal centers was measured to give a non-specific indicator of follicular hyperplasia. Data for uninfected controls are for four age-matched rhesus macaques.

[0016] FIG. 11. Temporal antibody responses. Micrograms of total Gag (A) or Env (B) antibody were determined with ELISAs. The titers of neutralizing antibody for SHIV-89.6 (C) and SHIV-89.6P (D) were determined with MT-2 cell killing and neutral red staining (D. C. Montefiori et al. 1988 J Clin Microbiol 26:231). Titers are the reciprocal of the serum dilution giving 50% neutralization of the indicated viruses grown in human PBMC. Symbols for animals are the same as in FIG. 8.

[0017] FIG. 12. Gag-CM9-Mamu-A*01 tetramer-specific T cells in Mamu-A*01 vaccinated and control macaques at various times before challenge and at two weeks after challenge. The number at the upper right corner of each plot represents the frequency of tetramer-specific CD8 T cells as a % of total CD8 T cells. The numbers above each column of FACS data designate individual animals.

[0018] FIG. 13. Map of plasmid transfer vector pLW-48.

[0019] FIG. 14 A-I. Sequences of plasmid transfer vector pLW-48 (SEQ ID NO: 1), Psyn II promoter (which controls ADA envelope expression) (SEQ ID NO: 2), ADA envelope truncated (SEQ ID NO: 3), PmH5 promoter (which controls HXB2 gag pol expression) (SEQ ID NO: 4), and HXB2 gag pol (with safety mutations, .DELTA. integrase) (SEQ ID NO: 5).

[0020] FIG. 15. Plasmid transfer vector pLW-48 and making MVA recombinant virus MVA/HIV 48.

[0021] FIG. 16. A clade B gag pol.

[0022] FIG. 17. Sequence of new Psyn II promoter (SEQ ID NO: 2).

[0023] FIG. 18. pLAS-1 and pLAS-2.

[0024] FIG. 19. pLAS-1/UGDgag.

[0025] FIG. 20. pLAS-2/UGDenv.

[0026] FIG. 21. pLAS-2/UGDrev env.

[0027] FIG. 22. Schematic for recombinant MVA production.

[0028] FIG. 23. Overview of making recombinant MVA/UGD viruses.

[0029] FIG. 24. Immunoprecipitation analysis.

[0030] FIG. 25. Functional analysis of expressed proteins. A, Virus-like partikle assay. B. Env fusion assay.

[0031] FIG. 26. MVA/UGD induced HIV env- and gag-specific antibody responses. A. HIV p24-specofoc serum IgG responses. B. HIV env-specific serum IgG responses. C. MVA/UGD induced HIV env- and gag-specific antibody responses (study 1).

[0032] FIG. 27. MVA/UGD induced gag-specific intracellular IFN-.gamma. production.

[0033] FIG. 28A. MVA/UGD induced gag-specific IFN-.gamma. ELISPOT.

[0034] FIG. 28B. MVA/UGD induced pol-specific IFN-.gamma. ELISPOT.

[0035] FIG. 29. MVA/UGD induced gag-specific tetramer staining.

[0036] FIG. 30. MVA/UGD induced gag-specific antibody responses (study 2).

[0037] FIGS. 31A & B. MVA/UGD induced gag- and pol-specific intracellular IFN-.gamma. production (study 2).

[0038] FIGS. 32 A, B, & C. MVA/UGD induced gag- and pol-specific ELISPOT (study 2).

[0039] FIG. 33. MVA/UGD induced gag-specific tetramer staining (study 2).

[0040] FIG. 34. MVA/UGD induced gag-specific cytotoxic T cell killing.

[0041] FIG. 35. Immunoprecipitation analysis of cell lysates (MVA/KEA).

[0042] FIG. 36. Gag particle assay (MVA/KEA).

[0043] FIG. 37. Fusion assay (MVA/KEA).

[0044] FIG. 38. MVA/KEA induced HIV-1 env-specific antibody responses.

[0045] FIG. 39. MVA/KEA induced gag-specific intracellular production.

[0046] FIG. 40. MVA/KEA induced gag-specific tetramer staining.

[0047] FIG. 41. MVA/KEA induced gag-specific IFN-.gamma. ELISPOT.

[0048] FIG. 42. Immunoprecipitation analysis of cell lysates (MVA/TZC).

[0049] FIG. 43. Fusion assay (MVA/TZC).

BRIEF DESCRIPTION OF THE APPENDICES

[0050] Appendix 1. DNA sequences of gagpol and env genes from Ugandan HIV-1 clade D isolates (SEQ ID NOs: 51, 52, 53, 54, 55).

[0051] Appendix 2. DNA sequences of MVA shuttle plasmids, pLAS-1 and pLAS-2 (SEQ ID NOs: 56, 57).

[0052] Appendix 3. DNA sequences of gagpol and env genes from Kenyan HIV-1 clade A isolates (SEQ ID NOs: 58, 59, 60).

[0053] Appendix 4. DNA sequences of gagpol and env genes from Tanzanian HIV-1 clade C isolates (SEQ ID NOs: 61, 62).

[0054] Appendix 5. American Type Culture Collection, Budapest Treaty Deposit Form BP/1, questions 1-8, regarding MVA 1974/NIH Clone 1.

[0055] Appendix 6. American Tissue Type Collection, Additional Information Required When Depositing A Virus for Patent Purposes, regarding MVA 1974/NIH Clone 1.

Deposit of Microorganism

[0056] The following microorganism has been deposited in accordance with the terms of the Budapest Treaty with the American Type Culture Collection (ATCC), Manassas, Va., on the date indicated:

TABLE-US-00001 Microorganism Accession No. Date MVA 1974/NIH Clone 1 PTA-5095 Mar. 27, 2003

[0057] MVA 1974/NIH Clone 1 was deposited as ATCC Accession No. PTA-5095 on Mar. 27, 2003 with the American Type Culture Collection (ATCC), 10801 University Blvd., Manassas, Va. 20110-2209, USA. This deposit was made under the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure and the Regulations thereunder (Budapest Treaty). This assures maintenance of a viable culture of the deposit for 30 years from date of deposit. The deposit will be made available by ATCC under the terms of the Budapest Treaty, and subject to an agreement between Applicant and ATCC which assures permanent and unrestricted availability of the progeny of the culture of the deposit to the public upon issuance of the pertinent U.S. patent or upon laying open to the public of any U.S. or foreign patent application, whichever comes first, and assures availability of the progeny to one determined by the U.S. Commissioner of Patents and Trademarks to be entitled thereto according to 35 USC .sctn.122 and the Commissioner's rules pursuant thereto (including 37 CFR .sctn.1.14). Availability of the deposited strain is not to be construed as a license to practice the invention in contravention of the rights granted under the authority of any government in accordance with its patent laws.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENT

Recombinant MVA Virus

[0058] Vaccinia virus, a member of the genus Orthopoxvirus in the family of Poxyiridae, was used as live vaccine to immunize against the human smallpox disease. Successful worldwide vaccination with vaccinia virus culminated in the eradication of variola virus, the causative agent of the smallpox ("The global eradication of smallpox. Final report of the global commission for the certification of smallpox eradication". History of Public Health, No. 4, Geneva: World Health Organization, 1980). Since that WHO declaration, vaccination has been universally discontinued except for people at high risk of poxvirus infections (e.g. laboratory workers).

[0059] More recently, vaccinia viruses have also been used to engineer viral vectors for recombinant gene expression and for the potential use as recombinant live vaccines (Mackett, M. et al. 1982 PNAS USA 79:7415-7419; Smith, G. L. et al. 1984 Biotech Genet Engin Rev 2:383-407). This entails DNA sequences (genes) which code for foreign antigens being introduced, with the aid of DNA recombination techniques, into the genome of the vaccinia viruses. If the gene is integrated at a site in the viral DNA which is non-essential for the life cycle of the virus, it is possible for the newly produced recombinant vaccinia virus to be infectious, that is to say able to infect foreign cells and thus to express the integrated DNA sequence (EP Patent Applications No. 83,286 and No. 110,385). The recombinant vaccinia viruses prepared in this way can be used, on the one hand, as live vaccines for the prophylaxis of infectious diseases, on the other hand, for the preparation of heterologous proteins in eukaryotic cells.

[0060] For vector applications health risks would be lessened by the use of a highly attenuated vaccinia virus strain. Several such strains of vaccinia virus were especially developed to avoid undesired side effects of smallpox vaccination. Thus, the modified vaccinia Ankara (MVA) has been generated by long-term serial passages of the Ankara strain of vaccinia virus (CVA) on chicken embryo fibroblasts (for review see Mayr, A. et al. 1975 Infection 3:6-14; Swiss Patent No. 568,392). The MVA virus is publicly available from American Type Culture Collection as ATCC No. VR-1508. MVA is distinguished by its great attenuation, that is to say by diminished virulence and ability to replicate in primate cells while maintaining good immunogenicity. The MVA virus has been analyzed to determine alterations in the genome relative to the parental CVA strain. Six major deletions of genomic DNA (deletion I, II, III, IV, V, and VI) totaling 31,000 base pairs have been identified (Meyer, H. et al. 1991 J Gen Virol 72:1031-1038). The resulting MVA virus became severely host cell restricted to avian cells.

[0061] Furthermore, MVA is characterized by its extreme attenuation. When tested in a variety of animal models, MVA was proven to be avirulent even in immunosuppressed animals. More importantly, the excellent properties of the MVA strain have been demonstrated in extensive clinical trials (Mayr A. et al. 1978 Zentralbl Bakteriol [B] 167:375-390; Stickl et al. 1974 Dtsch Med Wschr 99:2386-2392). During these studies in over 120,000 humans, including high-risk patients, no side effects were associated with the use of MVA vaccine.

[0062] MVA replication in human cells was found to be blocked late in infection preventing the assembly to mature infectious virions. Nevertheless, MVA was able to express viral and recombinant genes at high levels even in non-permissive cells and was proposed to serve as an efficient and exceptionally safe gene expression vector (Sutter, G. and Moss, B. 1992 PNAS USA 89:10847-10851). Additionally, novel vaccinia vector vaccines were established on the basis of MVA having foreign DNA sequences inserted at the site of deletion III within the MVA genome (Sutter, G. et al. 1994 Vaccine 12:1032-1040).

[0063] The recombinant MVA vaccinia viruses can be prepared as set out hereinafter. A DNA-construct which contains a DNA-sequence which codes for a foreign polypeptide flanked by MVA DNA sequences adjacent to a naturally occurring deletion, e.g. deletion III, or other non-essential sites, within the MVA genome, is introduced into cells infected with MVA, to allow homologous recombination. Once the DNA-construct has been introduced into the eukaryotic cell and the foreign DNA has recombined with the viral DNA, it is possible to isolate the desired recombinant vaccinia virus in a manner known per se, preferably with the aid of a marker. The DNA-construct to be inserted can be linear or circular. A plasmid or polymerase chain reaction product is preferred. The DNA-construct contains sequences flanking the left and the right side of a naturally occurring deletion, e.g. deletion III, within the MVA genome. The foreign DNA sequence is inserted between the sequences flanking the naturally occurring deletion. For the expression of a DNA sequence or gene, it is necessary for regulatory sequences, which are required for the transcription of the gene, to be present on the DNA. Such regulatory sequences (called promoters) are known to those skilled in the art, and include for example those of the vaccinia 11 kDa gene as are described in EP-A-198,328, and those of the 7.5 kDa gene (EP-A-110,385). The DNA-construct can be introduced into the MVA infected cells by transfection, for example by means of calcium phosphate precipitation (Graham et al. 1973 Virol 52:456-467; Wigler et al. 1979 Cell 16:777-785), by means of electroporation (Neumann et al. 1982 EMBO J. 1:841-845), by microinjection (Graessmann et al. 1983 Meth Enzymol 101:482-492), by means of liposomes (Straubinger et al. 1983 Meth Enzymol 101:512-527), by means of spheroplasts (Schaffner 1980 PNAS USA 77:2163-2167) or by other methods known to those skilled in the art.

HIVs and Their Replication

[0064] The etiological agent of acquired immune deficiency syndrome (AIDS) is recognized to be a retrovirus exhibiting characteristics typical of the lentivirus genus, referred to as human immunodeficiency virus (HIV). The phylogenetic relationships of the human lentiviruses are shown in FIG. 1. HIV-2 is more closely related to SIV.sub.smm, a virus isolated from sooty mangabey monkeys in the wild, than to HIV-1. It is currently believed that HIV-2 represents a zoonotic transmission of SIV.sub.smm to man. A series of lentiviral isolates from captive chimpanzees, designated SIV.sub.cpz, are close genetic relatives of HIV-1.

[0065] The earliest phylogenetic analyses of HIV-1 isolates focused on samples from Europe/North America and Africa; discrete clusters of viruses were identified from these two areas of the world. Distinct genetic subtypes or clades of HIV-1 were subsequently defined and classified into three groups: M (major); O (outlier); and N (non-M or O) (FIG. 2). The M group of HIV-1, which includes over 95% of the global virus isolates, consists of at least eight discrete clades (A, B, C, D, F, G, H, and J), based on the sequence of complete viral genomes. Members of HIV-1 group O have been recovered from individuals living in Cameroon, Gabon, and Equatorial Guinea; their genomes share less than 50% identity in nucleotide sequence with group M viruses. The more recently discovered group N HIV-I strains have been identified in infected Cameroonians, fail to react serologically in standard whole-virus enzyme-linked immunosorbent assay (ELISA), yet are readily detectable by conventional Western blot analysis.

[0066] Most current knowledge about HIV-1 genetic variation comes from studies of group M viruses of diverse geographic origin. Data collected during the past decade indicate that the HIV-1 population present within an infected individual can vary from 6% to 10% in nucleotide sequence. HIV-1 isolates within a clade may exhibit nucleotide distances of 15% in gag and up to 30% in gp120 coding sequences. Interclade genetic variation may range between 30% and 40% depending on the gene analyzed.

[0067] All of the HIV-1 group M subtypes can be found in Africa. Clade A viruses are genetically the most divergent and were the most common HIV-1 subtype in Africa early in the epidemic. With the rapid spread of HIV-1 to southern Africa during the mid to late 1990s, clade C viruses have become the dominant subtype and now account for 48% of HIV-1 infections worldwide. Clade B viruses, the most intensively studied HIV-1 subtype, remain the most prevalent isolates in Europe and North America.

[0068] High rates of genetic recombination are a hallmark of retroviruses. It was initially believed that simultaneous infections by genetically diverse virus strains were not likely to be established in individuals at risk for HIV-1. By 1995, however, it became apparent that a significant fraction of the HIV-1 group M global diversity included interclade viral recombinants. It is now appreciated that HIV-1 recombinants will be found in geographic areas such as Africa, South America, and Southeast Asia, where multiple HIV-1 subtypes coexist and may account for more than 10% of circulating HIV-1 strains. Molecularly, the genomes of these recombinant viruses resemble patchwork mosaics, with juxtaposed diverse HIV-1 subtype segments, reflecting the multiple crossover events contributing to their generation. Most HIV-1 recombinants have arisen in Africa and a majority contains segments originally derived from clade A viruses. In Thailand, for example, the composition of the predominant circulating strain consists of a clade A gag plus pol gene segment and a clade E env gene. Because the clade E env gene in That HIV-1 strains is closely related to the clade E env present in virus isolates from the Central African Republic, it is believed that the original recombination event occurred in Africa, with the subsequent introduction of a descendent virus into Thailand. Interestingly, no full-length HIV-1 subtype E isolate (i.e., with subtype E gag, pol, and env genes) has been reported to date.

[0069] The discovery that .alpha. and .beta. chemokine receptors function as coreceptors for virus fusion and entry into susceptible CD4.sup.+ cells has led to a revised classification scheme for HIV-1 (FIG. 3). Isolates can now be grouped on the basis of chemokine receptor utilization in fusion assays in which HIV-1 gp120 and CD4.sup.+ coreceptor proteins are expressed in separate cells. As indicated in FIG. 3, HIV-1 isolates using the CXCR4 receptor (now designated X4 viruses) are usually T cell line (TCL)-tropic syncytium inducing (SI) strains, whereas those exclusively utilizing the CCR5 receptor (R5 viruses) are predominantly macrophage (M)-tropic and non-syncytium inducing (NSI). The dual-tropic R5/X4 strains, which may comprise the majority of patient isolates and exhibit a continuum of tropic phenotypes, are frequently SI.

[0070] As is the case for all replication-competent retroviruses, the three primary HIV-1 translation products, all encoding structural proteins, are initially synthesized as polyprotein precursors, which are subsequently processed by viral or cellular proteases into mature particle-associated proteins (FIG. 4). The 55-kd Gag precursor Pr55.sup.Gag is cleaved into the matrix (MA), capsid (CA), nucleocapsid (NC), and p6 proteins. Autocatalysis of the 160-kd Gag-Pol polyprotein, Pr160.sup.Gag-Pol, gives rise to the protease (PR), the heterodimeric reverse transcriptase (RT), and the integrase (IN) proteins, whereas proteolytic digestion by a cellular enzyme(s) converts the glycosylated 160-kd Env precursor gp160 to the gp120 surface (SU) and gp41 transmembrane (TM) cleavage products. The remaining six HIV-1-encoded proteins (Vif, Vpr, Tat, Rev, Vpu, and Nef) are the primary translation products of spliced mRNAs.

Gag

[0071] The Gag proteins of HIV, like those of other retroviruses, are necessary and sufficient for the formation of noninfectious, virus-like particles. Retroviral Gag proteins are generally synthesized as polyprotein precursors; the HIV-1 Gag precursor has been named, based on its apparent molecular mass, Pr55.sup.Gag. As noted previously, the mRNA for Pr55.sup.Gag is the unspliced 9.2-kb transcript (FIG. 4) that requires Rev for its expression in the cytoplasm. When the pol ORF is present, the viral protease (PR) cleaves Pr55.sup.Gag during or shortly after budding from the cell to generate the mature Gag proteins p17 (MA), p24 (CA), p7 (NC), and p6 (see FIG. 4). In the virion, MA is localized immediately inside the lipid bilayer of the viral envelope, CA forms the outer portion of the cone-shaped core structure in the center of the particle, and NC is present in the core in a ribonucleoprotein complex with the viral RNA genome (FIG. 5).

[0072] The HIV Pr55.sup.Gag precursor oligomerizes following its translation and is targeted to the plasma membrane, where particles of sufficient size and density to be visible by EM are assembled. Formation of virus-like particles by Pr55.sup.Gag is a self-assembly process, with critical Gag-Gag interactions taking place between multiple domains along the Gag precursor. The assembly of virus-like particles does not require the participation of genomic RNA (although the presence of nucleic acid appears to be essential), pol-encoded enzymes, or Env glycoproteins, but the production of infectious virions requires the encapsidation of the viral RNA genome and the incorporation of the Env glycoproteins and the Gag-Pol polyprotein precursor Pr160.sup.Gag-Pol.

Pol

[0073] Downstream of gag lies the most highly conserved region of the HIV genome, the pol gene, which encodes three enzymes: PR, RT, and IN (see FIG. 4). RT and IN are required, respectively, for reverse transcription of the viral RNA genome to a double-stranded DNA copy, and for the integration of the viral DNA into the host cell chromosome. PR plays a critical role late in the life cycle by mediating the production of mature, infectious virions. The pol gene products are derived by enzymatic cleavage of a 160-kd Gag-Pol fusion protein, referred to as Pr160.sup.Gag-Pol. This fusion protein is produced by ribosomal frameshifting during translation of Pr55.sup.Gag (see FIG. 4). The frame-shifting mechanism for Gag-Pol expression, also utilized by many other retroviruses, ensures that the poi-derived proteins are expressed at a low level, approximately 5% to 10% that of Gag. Like Pr55.sup.Gag, the N-terminus of Pr160.sup.Gag-Pol is myristylated and targeted to the plasma membrane.

Protease

[0074] Early pulse-chase studies performed with avian retroviruses clearly indicated that retroviral Gag proteins are initially synthesized as polyprotein precursors that are cleaved to generate smaller products. Subsequent studies demonstrated that the processing function is provided by a viral rather than a cellular enzyme, and that proteolytic digestion of the Gag and Gag-Pol precursors is essential for virus infectivity. Sequence analysis of retroviral PRs indicated that they are related to cellular "aspartic" proteases such as pepsin and renin. Like these cellular enzymes, retroviral PRs use two apposed Asp residues at the active site to coordinate a water molecule that catalyzes the hydrolysis of a peptide bond in the target protein. Unlike the cellular aspartic proteases, which function as pseudodimers (using two folds within the same molecule to generate the active site), retroviral PRs function as true dimers. X-ray crystallographic data from HIV-1 PR indicate that the two monomers are held together in part by a four-stranded antiparallel .beta.-sheet derived from both N- and C-terminal ends of each monomer. The substrate-binding site is located within a cleft formed between the two monomers. Like their cellular homologs, the HIV PR dimer contains flexible "flaps" that overhang the binding site and may stabilize the substrate within the cleft; the active-site Asp residues lie in the center of the dimer. Interestingly, although some limited amino acid homology is observed surrounding active-site residues, the primary sequences of retroviral PRs are highly divergent, yet their structures are remarkably similar.

Reverse Transcriptase

[0075] By definition, retroviruses possess the ability to convert their single-stranded RNA genomes into double-stranded DNA during the early stages of the infection, process. The enzyme that catalyzes this reaction is RT, in conjunction with its associated RNaseH activity. Retroviral RTs have three enzymatic activities: (a) RNA-directed DNA polymerization (for minus-strand DNA synthesis), (b) RNaseH activity (for the degradation of the tRNA primer and genomic RNA present in DNA-RNA hybrid intermediates), and (c) DNA-directed DNA polymerization (for second- or plus-strand DNA synthesis).

[0076] The mature HIV-1 RT holoenzyme is a heterodimer of 66 and 51 kd subunits. The 51-kd subunit (p51) is derived from the 66-kd (p66) subunit by proteolytic removal of the C-terminal 15-kd RNaseH domain of p66 by PR (see FIG. 4). The crystal structure of HIV-1 RT reveals a highly asymmetric folding in which the orientations of the p66 and p51 subunits differ substantially. The p66 subunit can be visualized as a right hand, with the polymerase active site within the palm, and a deep template-binding cleft formed by the palm, fingers, and thumb subdomains. The polymerase domain is linked to RNaseH by the connection subdomain. The active site, located in the palm, contains three critical Asp residues (110, 185, and 186) in close proximity, and two coordinated Mg.sup.2+ ions. Mutation of these Asp residues abolishes RT polymerizing activity. The orientation of the three active-site Asp residues is similar to that observed in other DNA polymerases (e.g., the Klenow fragment of E. coli DNA polI). The p51 subunit appears to be rigid and does not form a polymerizing cleft; Asp 110, 185, and 186 of this subunit are buried within the molecule. Approximately 18 base pairs of the primer-template duplex lie in the nucleic acid binding cleft, stretching from the polymerase active site to the RNaseH domain.

[0077] In the RT-primer-template-dNTP structure, the presence of a dideoxynucleotide at the 3' end of the primer allows visualization of the catalytic complex trapped just prior to attack on the incoming dNTP. Comparison with previously obtained structures suggests a model whereby the fingers close in to trap the template and dNTP prior to nucleophilic attack of the 3'-OH of the primer on the incoming dNTP. After the addition of the incoming dNTP to the growing chain, it has been proposed that the fingers adopt a more open configuration, thereby releasing the pyrophosphate and enabling RT to bind the next dNTP. The structure of the HIV-1 RNaseH has also been determined by x-ray crystallography; this domain displays a global folding similar to that of E. coli RNaseH.

Integrase

[0078] A distinguishing feature of retrovirus replication is the insertion of a DNA copy of the viral genome into the host cell chromosome following reverse transcription. The integrated viral DNA (the provirus) serves as the template for the synthesis of viral RNAs and is maintained as part of the host cell genome for the lifetime of the infected cell. Retroviral mutants deficient in the ability to integrate generally fail to establish a productive infection.

[0079] The integration of viral DNA is catalyzed by integrase, a 32-kd protein generated by PR-mediated cleavage of the C-terminal portion of the HIV-1 Gag-Pol polyprotein (see FIG. 4).

[0080] Retroviral IN proteins are composed of three structurally and functionally distinct domains: an N-terminal, zinc-finger-containing domain, a core domain, and a relatively nonconserved C-terminal domain. Because of its low solubility, it has not yet been possible to crystallize the entire 288-amino-acid HIV-1 IN protein. However, the structure of all three domains has been solved independently by x-ray crystallography or NMR methods. The crystal structure of the core domain of the avian sarcoma virus IN has also been determined. The N-terminal domain (residues 1 to 55), whose structure was solved by NMR spectroscopy, is composed of four helices with a zinc coordinated by amino acids His-12, His-16, Cys-40, and Cys-43. The structure of the N-terminal domain is reminiscent of helical DNA binding proteins that contain a so-called helix-turn-helix motif; however, in the HIV-1 structure this motif contributes to dimer formation. Initially, poor solubility hampered efforts to solve the structure of the core domain. However, attempts at crystallography were successful when it was observed that a Phe-to-Lys change at IN residue 185 greatly increased solubility without disrupting in vitro catalytic activity. Each monomer of the HIV-1 IN core domain (IN residues 50 to 212) is composed of a five-stranded .beta.-sheet flanked by helices; this structure bears striking resemblance to other polynucleotidyl transferases including RNaseH and the bacteriophage MuA transposase. Three highly conserved residues are found in analogous positions in other polynucleotidyl transferases; in HIV-1 IN these are Asp-64, Asp-116 and Glu-152, the so-called D,D-35-E motif. Mutations at these positions block HIV IN function both in vivo and in vitro. The close proximity of these three amino acids in the crystal structure of both avian sarcoma virus and HIV-1 core domains supports the hypothesis that these residues play a central role in catalysis of the polynucleotidyl transfer reaction that is at the heart of the integration process. The C-terminal domain, whose structure has been solved by NMR methods, adopts a five-stranded n-barrel folding topology reminiscent of a Src homology 3 (SH3) domain. Recently, the x-ray structures of SIV and Rous sarcoma virus IN protein fragments encompassing both the core and C-terminal domains have been solved.

Env

[0081] The HIV Env glycoproteins play a major role in the virus life cycle. They contain the determinants that interact with the CD4 receptor and coreceptor, and they catalyze the fusion reaction between the lipid bilayer of the viral envelope and the host cell plasma membrane. In addition, the HIV Env glycoproteins contain epitopes that elicit immune responses that are important from both diagnostic and vaccine development perspectives.

[0082] The HIV Env glycoprotein is synthesized from the singly spliced 4.3-kb Vpu/Env bicistronic mRNA (see FIG. 4); translation occurs on ribosomes associated with the rough endoplasmic reticulum (ER). The 160-kd polyprotein precursor (gp160) is an integral membrane protein that is anchored to cell membranes by a hydrophobic stop-transfer signal in the domain destined to be the mature TM Env glycoprotein, gp41 (FIG. 6). The gp160 is cotranslationally glycosylated, forms disulfide bonds, and undergoes oligomerization in the ER. The predominant oligomeric form appears to be a trimer, although dimers and tetramers are also observed. The gp160 is transported to the Golgi, where, like other retroviral envelope precursor proteins, it is proteolytically cleaved by cellular enzymes to the mature SU glycoprotein gp120 and TM glycoprotein gp41 (see FIG. 6). The cellular enzyme responsible for cleavage of retroviral Env precursors following a highly conserved Lys/Arg-X-Lys/Arg-Arg motif is furin or a furin-like protease, although other enzymes may also catalyze gp160 processing. Cleavage of gp160 is required for Env-induced fusion activity and virus infectivity. Subsequent to gp160 cleavage, gp120 and gp41 form a noncovalent association that is critical for transport of the Env complex from the Golgi to the cell surface. The gp120-gp41 interaction is fairly weak, and a substantial amount of gp120 is shed from the surface of Env-expressing cells.

[0083] The HIV Env glycoprotein complex, in particular the SU (gp120) domain, is very heavily glycosylated; approximately half the molecular mass of gp160 is composed of oligosaccharide side chains. During transport of Env from its site of synthesis in the ER to the plasma membrane, many of the side chains are modified by the addition of complex sugars. The numerous oligosaccharide side chains form what could be imagined as a sugar cloud obscuring much of gp120 from host immune recognition. As shown in FIG. 6, gp120 contains interspersed conserved (C.sub.1 to C.sub.5) and variable (V.sub.1 to V.sub.5) domains. The Cys residues present in the gp120s of different isolates are highly conserved and form disulfide bonds that link the first four variable regions in large loops.

[0084] A primary function of viral Env glycoproteins is to promote a membrane fusion reaction between the lipid bilayers of the viral envelope and host cell membranes. This membrane fusion event enables the viral core to gain entry into the host cell cytoplasm. A number of regions in both gp120 and gp41 have been implicated, directly or indirectly, in Env-mediated membrane fusion. Studies of the HA.sub.2 hemagglutinin protein of the orthomyxoviruses and the F protein of the paramyxoviruses indicated that a highly hydrophobic domain at the N-terminus of these proteins, referred to as the fusion peptide, plays a critical role in membrane fusion. Mutational analyses demonstrated that an analogous domain was located at the N-terminus of the HIV-1, HIV-2, and SIV TM glycoproteins (see FIG. 6). Nonhydrophobic substitutions within this region of gp41 greatly reduced or blocked syncytium formation and resulted in the production of noninfectious progeny virions.

[0085] C-terminal to the gp41 fusion peptide are two amphipathic helical domains (see FIG. 6) which play a central role in membrane fusion. Mutations in the N-terminal helix (referred to as the N-helix), which contains a Leu zipper-like heptad repeat motif, impair infectivity and membrane fusion activity, and peptides derived from these sequences exhibit potent antiviral activity in culture. The structure of the ectodomain of HIV-1 and SIV gp41, the two helical motifs in particular, has been the focus of structural analyses in recent years. Structures were determined by x-ray crystallography or NMR spectroscopy either for fusion proteins containing the helical domains, a mixture of peptides derived from the N- and C-helices, or in the case of the SIV structure, the intact gp41 ectodomain sequence from residue 27 to 149. These studies obtained fundamentally similar trimeric structures, in which the two helical domains pack in an antiparallel fashion to generate a six-helix bundle. The N-helices form a coiled-coil in the center of the bundle, with the C-helices packing into hydrophobic grooves on the outside.

[0086] In the steps leading to membrane fusion CD4 binding induces conformation changes in Env that facilitate coreceptor binding. Following the formation of a ternary gp120/CD4/coreceptor complex, gp41 adopts a hypothetical conformation that allows the fusion peptide to insert into the target lipid bilayer. The formation of the gp41 six-helix bundle (which involves antiparallel interactions between the gp41 N- and C-helices) brings the viral and cellular membranes together and membrane fusion takes place.

Use of Recombinant MVA Virus To Boost CD+8 Cell Immune Response

[0087] The present invention relates to generation of a CD8.sup.+ T cell immune response against an antigen and also eliciting an antibody response. More particularly, the present invention relates to "prime and boost" immunization regimes in which the immune response induced by administration of a priming composition is boosted by administration of a boosting composition. The present invention is based on inventors' experimental demonstration that effective boosting can be achieved using modified vaccinia Ankara (MVA) vectors, following priming with any of a variety of different types of priming compositions including recombinant MVA itself.

[0088] A major protective component of the immune response against a number of pathogens is mediated by T lymphocytes of the CD8.sup.+ type, also known as cytotoxic T lymphocytes (CTL). An important function of CD8.sup.+ cells is secretion of gamma interferon (IFN.gamma.), and this provides a measure of CD8.sup.+ T cell immune response. A second component of the immune response is antibody directed to the proteins of the pathogen.

[0089] The present invention employs MVA which, as the experiments described below show, has been found to be an effective means for providing a boost to a CD8.sup.+ T cell immune response primed to antigen using any of a variety of different priming compositions and also eliciting an antibody response.

[0090] Remarkably, the experimental work described below demonstrates that use of embodiments of the present invention allows for recombinant MVA virus expressing an HIV antigen to boost a CD8.sup.+ T cell immune response primed by a DNA vaccine and also eliciting an antibody response. The MVA was found to induce a CD8.sup.+ T cell response after intradermal, intramuscular or mucosal immunization. Recombinant MVA has also been shown to prime an immune response that is boosted by one or more inoculations of recombinant MVA.

[0091] Non-human primates immunized with plasmid DNA and boosted with the MVA were effectively protected against intramucosal challenge with live virus. Advantageously, the inventors found that a vaccination regime used intradermal, intramuscular or mucosal immunization for both prime and boost can be employed, constituting a general immunization regime suitable for inducing CD8.sup.+ T cells and also eliciting an antibody response, e.g. in humans.

[0092] The present invention in various aspects and embodiments employs an MVA vector encoding an HIV antigen for boosting a CD8.sup.+ T cell immune response to the antigen primed by previous administration of nucleic acid encoding the antigen and also eliciting an antibody response.

[0093] A general aspect of the present invention provides for the use of an MVA vector for boosting a CD8.sup.+ T cell immune response to an HIV antigen and also eliciting an antibody response.

[0094] One aspect of the present invention provides a method of boosting a CD8.sup.+ T cell immune response to an HIV antigen in an individual, and also eliciting an antibody response, the method including provision in the individual of an MVA vector including nucleic acid encoding the antigen operably linked to regulatory sequences for production of antigen in the individual by expression from the nucleic acid, whereby a CD8.sup.+ T cell immune response to the antigen previously primed in the individual is boosted.

[0095] An immune response to an HIV antigen may be primed by immunization with plasmid DNA or by infection with an infectious agent.

[0096] A further aspect of the invention provides a method of inducing a CD8.sup.+ T cell immune response to an HIV antigen in an individual, and also eliciting an antibody response, the method comprising administering to the individual a priming composition comprising nucleic acid encoding the antigen and then administering a boosting composition which comprises an MVA vector including nucleic acid encoding the antigen operably linked to regulatory sequences for production of antigen in the individual by expression from the nucleic acid.

[0097] A further aspect provides for use of an MVA vector, as disclosed, in the manufacture of a medicament for administration to a mammal to boost a CD8.sup.+ T cell immune response to an HIV antigen, and also eliciting an antibody response. Such a medicament is generally for administration following prior administration of a priming composition comprising nucleic acid encoding the antigen.

[0098] The priming composition may comprise any viral vector, such as a vaccinia virus vector such as a replication-deficient strain such as modified vaccinia Ankara (MVA) or NYVAC (Tartaglia et al. 1992 Virology 118:217-232), an avipox vector such as fowlpox or canarypox, e.g. the strain known as ALVAC (Paoletti et al. 1994 Dev Biol Stand 82:65-69), or an adenovirus vector or a vesicular stomatitis virus vector or an alphavirus vector.

[0099] The priming composition may comprise DNA encoding the antigen, such DNA preferably being in the form of a circular plasmid that is not capable of replicating in mammalian cells. Any selectable marker should not be resistance to an antibiotic used clinically, so for example Kanamycin resistance is preferred to Ampicillin resistance. Antigen expression should be driven by a promoter which is active in mammalian cells, for instance the cytomegalovirus immediate early (CMV IE) promoter.

[0100] In particular embodiments of the various aspects of the present invention, administration of a priming composition is followed by boosting with a boosting composition, or first and second boosting compositions, the first and second boosting compositions being the same or different from one another. Still further boosting compositions may be employed without departing from the present invention. In one embodiment, a triple immunization regime employs DNA, then adenovirus as a first boosting composition, then MVA as a second boosting composition, optionally followed by a further (third) boosting composition or subsequent boosting administration of one or other or both of the same or different vectors. Another option is DNA then MVA then adenovirus, optionally followed by subsequent boosting administration of one or other or both of the same or different vectors.

[0101] The antigen to be encoded in respective priming and boosting compositions (however many boosting compositions are employed) need not be identical, but should share at least one CD8.sup.+ T cell epitope. The antigen may correspond to a complete antigen, or a fragment thereof. Peptide epitopes or artificial strings of epitopes may be employed, more efficiently cutting out unnecessary protein sequence in the antigen and encoding sequence in the vector or vectors. One or more additional epitopes may be included, for instance epitopes which are recognized by T helper cells, especially epitopes recognized in individuals of different HLA types.

[0102] An HIV antigen of the invention to be encoded by a recombinant MVA virus includes polypeptides having immunogenic activity elicited by an amino acid sequence of an HIV Env, Gag, Pol, Vif, Vpr, Tat, Rev, Vpu, or Nef amino acid sequence as at least one CD8.sup.+ T cell epitope. This amino acid sequence substantially corresponds to at least one 10-900 amino acid fragment and/or consensus sequence of a known HIV Env or Pol; or at least one 10-450 amino acid fragment and/or consensus sequence of a known HIV Gag; or at least one 10-100 amino acid fragment and/or consensus sequence of a known HIV Vif, Vpr, Tat, Rev, Vpu, or Nef.

[0103] Although a full length Env precursor sequence is presented for use in the present invention, Env is optionally deleted of subsequences. For example, regions of the gp120 surface and gp41 transmembrane cleavage products can be deleted.

[0104] Although a full length Gag precursor sequence is presented for use in the present invention, Gag is optionally deleted of subsequences. For example, regions of the matrix protein (p17), regions of the capsid protein (p24), regions of the nucleocapsid protein (p7), and regions of p6 (the C-terminal peptide of the Gag polyprotein) can be deleted.

[0105] Although a full length Pol precursor sequence is presented for use in the present invention, Pol is optionally deleted of subsequences. For example, regions of the protease protein (p10), regions of the reverse transcriptase protein (p66/p51), and regions of the integrase protein (p32) can be deleted.

[0106] Such an HIV Env, Gag, or Pol can have overall identity of at least 50% to a known Env, Gag, or Pol protein amino acid sequence, such as 50-99% identity, or any range or value therein, while eliciting an immunogenic response against at least one strain of an HIV.

[0107] Percent identify can be determined, for example, by comparing sequence information using the GAP computer program, version 6.0, available from the University of Wisconsin Genetics Computer Group (UWGCG). The GAP program utilizes the alignment method of Needleman and Wunsch (J Mol Biol 1970 48:443), as revised by Smith and Waterman (Adv Appl Math 1981 2:482). Briefly, the GAP program defines identity as the number of aligned symbols (i.e., nucleotides or amino acids) which are identical, divided by the total number of symbols in the shorter of the two sequences. The preferred default parameters for the GAP program include: (1) a unitary comparison matrix (containing a value of 1 for identities and 0 for non-identities) and the weighted comparison matrix of Gribskov and Burgess (Nucl Acids Res 1986 14:6745), as described by Schwartz and Dayhoff (eds., Atlas of Protein Sequence and Structure, National Biomedical Research Foundation, Washington, D.C. 1979, pp. 353-358); (2) a penalty of 3.0 for each gap and an additional 0.10 penalty for each symbol in each gap; and (3) no penalty for end gaps.

[0108] In a preferred embodiment, an Env of the present invention is a variant form of at least one HIV envelope protein. Preferably, the Env is composed of gp120 and the membrane-spanning and ectodomain of gp41 but lacks part or all of the cytoplasmic domain of gp41.

[0109] Known HIV sequences are readily available from commercial and institutional HIV sequence databases, such as GENBANK, or as published compilations, such as Myers et al. eds., Human Retroviruses and AIDS, A Compilation and Analysis of Nucleic Acid and Amino Acid Sequences, Vol. I and II, Theoretical Biology and Biophysics, Los Alamos, N. Mex. (1993), or using http:// for hiv-web.lan1.gov/.

[0110] Substitutions or insertions of an HIV Env, Gag, or Pol to obtain an additional HIV Env, Gag, or Pol, encoded by a nucleic acid for use in a recombinant MVA virus of the present invention, can include substitutions or insertions of at least one amino acid residue (e.g., 1-25 amino acids). Alternatively, at least one amino acid (e.g., 1-25 amino acids) can be deleted from an HIV Env, Gag, or Pol sequence. Preferably, such substitutions, insertions or deletions are identified based on safety features, expression levels, immunogenicity and compatibility with high replication rates of MVA.

[0111] Amino acid sequence variations in an HIV Env, Gag, or Pol of the present invention can be prepared e.g., by mutations in the DNA. Such HIV Env, Gag, or Pol include, for example, deletions, insertions or substitutions of nucleotides coding for different amino acid residues within the amino acid sequence. Obviously, mutations that will be made in nucleic acid encoding an HIV Env, Gag, or Pol must not place the sequence out of reading frame and preferably will not create complementary domains that could produce secondary mRNA structures.

[0112] HIV Env, Gag, or Pol-encoding nucleic acid of the present invention can also be prepared by amplification or site-directed mutagenesis of nucleotides in DNA or RNA encoding an HIV Env, Gag, or Pol and thereafter synthesizing or reverse transcribing the encoding DNA to produce DNA or RNA encoding an HIV Env, Gag, or Pol, based on the teaching and guidance presented herein.

[0113] Recombinant MVA viruses expressing HIV Env, Gag, or Pol of the present invention, include a finite set of HIV Env, Gag, or Pol-encoding sequences as substitution nucleotides that can be routinely obtained by one of ordinary skill in the art, without undue experimentation, based on the teachings and guidance presented herein. For a detailed description of protein chemistry and structure, see Schulz, G. E. et al., 1978 Principles of Protein Structure, Springer-Verlag, New York, N.Y., and Creighton, T. E., 1983 Proteins: Structure and Molecular Properties, W. H. Freeman & Co., San Francisco, Calif. For a presentation of nucleotide sequence substitutions, such as codon preferences, see Ausubel et al. eds. Current Protocols in Molecular Biology, Greene Publishing Assoc., New York, N.Y. 1994 at .sctn..sctn. A.1.1-A.1.24, and Sambrook, J. et al. 1989 Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. at Appendices C and D.

[0114] Thus, one of ordinary skill in the art, given the teachings and guidance presented herein, will know how to substitute other amino acid residues in other positions of an HIV env, gag, or pol DNA or RNA to obtain alternative HIV Env, Gag, or Pol, including substitutional, deletional or insertional variants.

[0115] Within the MVA vector, regulatory sequences for expression of the encoded antigen will include a natural, modified or synthetic poxvirus promoter. By "promoter" is meant a sequence of nucleotides from which transcription may be initiated of DNA operably linked downstream (i.e. in the 3' direction on the sense strand of double-stranded DNA). "Operably linked" means joined as part of the same nucleic acid molecule, suitably positioned and oriented for transcription to be initiated from the promoter. DNA operably linked to a promoter is "under transcriptional initiation regulation" of the promoter. Other regulatory sequences including terminator fragments, polyadenylation sequences, marker genes and other sequences may be included as appropriate, in accordance with the knowledge and practice of the ordinary person skilled in the art: see, for example, Moss, B. (2001). Poxyiridae: the viruses and their replication. In Fields Virology, D. M. Knipe, and P. M. Howley, eds. (Philadelphia, Lippincott Williams & Wilkins), pp. 2849-2883. Many known techniques and protocols for manipulation of nucleic acid, for example in preparation of nucleic acid constructs, mutagenesis, sequencing, introduction of DNA into cells and gene expression, and analysis of proteins, are described in detail in Current Protocols in Molecular Biology, 1998 Ausubel et al. eds., John Wiley & Sons.

[0116] Promoters for use in aspects and embodiments of the present invention must be compatible with poxvirus expression systems and include natural, modified and synthetic sequences.

[0117] Either or both of the priming and boosting compositions may include an adjuvant, such as granulocyte macrophage-colony stimulating factor (GM-CSF) or encoding nucleic acid therefor.

[0118] Administration of the boosting composition is generally about 1 to 6 months after administration of the priming composition, preferably about 1 to 3 months.

[0119] Preferably, administration of priming composition, boosting composition, or both priming and boosting compositions, is intradermal, intramuscular or mucosal immunization.

[0120] Administration of MVA vaccines may be achieved by using a needle to inject a suspension of the virus. An alternative is the use of a needleless injection device to administer a virus suspension (using, e.g., BIOJECTOR.TM. needleless injector) or a resuspended freeze-dried powder containing the vaccine, providing for manufacturing individually prepared doses that do not need cold storage. This would be a great advantage for a vaccine that is needed in rural areas of Africa.

[0121] MVA is a virus with an excellent safety record in human immunizations. The generation of recombinant viruses can be accomplished simply, and they can be manufactured reproducibly in large quantities. Intradermal, intramuscular or mucosal administration of recombinant MVA virus is therefore highly suitable for prophylactic or therapeutic vaccination of humans against AIDS which can be controlled by a CD8.sup.+ T cell response.

[0122] The individual may have AIDS such that delivery of the antigen and generation of a CD8.sup.+ T cell immune response to the antigen is of benefit or has a therapeutically beneficial effect.

[0123] Most likely, administration will have prophylactic aim to generate an immune response against HIV or AIDS before infection or development of symptoms.

[0124] Components to be administered in accordance with the present invention may be formulated in pharmaceutical compositions. These compositions may comprise a pharmaceutically acceptable excipient, carrier, buffer, stabilizer or other materials well known to those skilled in the art. Such materials should be non-toxic and should not interfere with the efficacy of the active ingredient. The precise nature of the carrier or other material may depend on the route of administration, e.g. intravenous, cutaneous or subcutaneous, nasal, intramuscular, intraperitoneal routes.

[0125] As noted, administration is preferably intradermal, intramuscular or mucosal.

[0126] Physiological saline solution, dextrose or other saccharide solution or glycols such as ethylene glycol, propylene glycol or polyethylene glycol may be included.

[0127] For intravenous, cutaneous, subcutaneous, intramuscular or mucosal injection, or injection at the site of affliction, the active ingredient will be in the form of a parenterally acceptable aqueous solution which is pyrogen-free and has suitable pH, isotonicity and stability. Those of relevant skill in the art are well able to prepare suitable solutions using, for example, isotonic vehicles such as Sodium Chloride Injection, Ringer's Injection, Lactated Ringer's Injection. Preservatives, stabilizers, buffers, antioxidants and/or other additives may be included as required.

[0128] A slow-release formulation may be employed.

[0129] Following production of MVA particles and optional formulation of such particles into compositions, the particles may be administered to an individual, particularly human or other primate. Administration may be to another mammal, e.g. rodent such as mouse, rat or hamster, guinea pig, rabbit, sheep, goat, pig, horse, cow, donkey, dog or cat.

[0130] Administration is preferably in a "prophylactically effective amount" or a "therapeutically effective amount" (as the case may be, although prophylaxis may be considered therapy), this being sufficient to show benefit to the individual. The actual amount administered, and rate and time-course of administration, will depend on the nature and severity of what is being treated. Prescription of treatment, e.g. decisions on dosage etc, is within the responsibility of general practitioners and other medical doctors, or in a veterinary context a veterinarian, and typically takes account of the disorder to be treated, the condition of the individual patient, the site of delivery, the method of administration and other factors known to practitioners. Examples of the techniques and protocols mentioned above can be found in Remington's Pharmaceutical Sciences, 16th edition, 1980, Osol, A. (ed.).

[0131] In one preferred regimen, DNA is administered at a dose of 250 .mu.g to 2.5 mg/injection, followed by MVA at a dose of 10.sup.6 to 10.sup.9 infectious virus particles/injection.

[0132] A composition may be administered alone or in combination with other treatments, either simultaneously or sequentially dependent upon the condition to be treated.

[0133] Delivery to a non-human mammal need not be for a therapeutic purpose, but may be for use in an experimental context, for instance in investigation of mechanisms of immune responses to an antigen of interest, e.g. protection against HIV or AIDS.

[0134] Further aspects and embodiments of the present invention will be apparent to those of ordinary skill in the art, in view of the above disclosure and following experimental exemplification, included by way of illustration and not limitation, and with reference to the attached figures.

Example 1

Control of a Mucosal Challenge and Prevention of AIDS by a Multiprotein DNA/MVA Vaccine

[0135] Here we tested DNA priming and poxvirus boosting for the ability to protect against a highly pathogenic mucosal challenge. The 89.6 chimera of simian and human immunodeficiency viruses (SHIV-89.6) was used for the construction of immunogens and its highly pathogenic derivative, SHIV-89.6P, for challenge (G. B. Karlsson et al. 1997 J Virol 71:4218). SHIV-89.6 and SHIV-89.6P do not generate cross-neutralizing antibody (D. C. Montefiori et al. 1998 J Virol 72:3427) and allowed us to address the ability of vaccine-raised T cells and non-neutralizing antibodies to control an immunodeficiency virus challenge. Modified vaccinia Ankara (MVA) was used for the construction of the recombinant poxvirus. MVA has been highly effective at boosting DNA-primed CD8 T cells and enjoys the safety feature of not replicating efficiently in human or monkey cells (H. L. Robinson et al. 2000 AIDS Reviews 2:105).

[0136] To ensure a broad immune response both the DNA and recombinant MVA (rMVA) components of the vaccine expressed multiple immunodeficiency virus proteins. The DNA prime (DNA/89.6) expressed simian immunodeficiency virus (SIV) Gag, Pol, Vif, Vpx, and Vpr and human immunodeficiency virus-1 (HIV-1) Env, Tat, and Rev from a single transcript (R. J. Gorelick et al. 1999 Virology 253:259; M. M. Sauter et al. 1996 J Cell Biol 132:795).

[0137] Molecularly cloned SHIV-89.6 sequences were cloned into the vector pGA2, using ClaI and RsrII sites. This cloning deleted both long terminal repeats (LTRs) and nef. The SHIV-89.6 sequences also were internally mutated for a 12-base pair region encoding the first four amino acids of the second zinc finger in nucleocapsid. This mutation renders SHIV viruses noninfectious (R. J. Gorelick et al. 1999 Virology 253:259). A mutation in gp41 converted the tyrosine at position 710 to cysteine to achieve better expression of Env on the plasma membrane of DNA-expressing cells (M. M. Sauter et al. 1996 J Cell Biol 132:795). pGA2 uses the CMV immediate early promoter without intron A and the bovine growth hormone polyadenylation sequence to express vaccine inserts. Vaccine DNA was produced by Althea (San Diego, Calif.). In transient transfections of 293T cells, DNA/89.6 produced about 300 ng of Gag and 85 ng of Env per 1.times.10.sup.6 cells.

[0138] The rMVA booster (MVA/89.6) expressed SIV Gag, Pol, and HIV-1 Env under the control of vaccinia virus early/late promoters.

[0139] The MVA double recombinant virus expressed both the HIV 89.6 Env and the SIV 239 Gag-Pol, which were inserted into deletion II and deletion III of MVA, respectively. The 89.6 Env protein was truncated for the COOH-terminal 115 amino acids of gp41. The modified H5 promoter controlled the expression of both foreign genes.

[0140] Vaccination was accomplished by priming with DNA at 0 and 8 weeks and boosting with rMVA at 24 weeks (FIG. 7A).

[0141] I.d. and i.m. DNA immunizations were delivered in phosphate-buffered saline (PBS) with a needleless jet injector (Bioject, Portland, Oreg.) to deliver five i.d. 100-.mu.l injections to each outer thigh for the 2.5-mg dose of DNA or one i.d. 100-.mu.l injection to the right outer thigh for the 250-.mu..mu.g dose of plasmid. I.m. deliveries of DNA were done with one 0.5-ml injection of DNA in PBS to each outer thigh for the 2.5-mg dose and one 100-.mu.l injection to the right outer thigh for the 250-.mu.g dose. 1.times.10.sup.8 pfu of MVA/89.6 was administered both i.d. and i.m. with a needle. One 100-.mu.l dose was delivered to each outer thigh for the i.d. dose and one 500-.mu.l dose to each outer thigh for the i.m dose. Control animals received 2.5 mg of the pGA2 vector without vaccine insert with the Bioject device to deliver five 100-.mu.l doses i.d. to each outer thigh. The control MVA booster immunization consisted of 2.times.10.sup.8 pfu of MVA without an insert delivered i.d. and i.m. as described for MVA/89.6.

[0142] Four groups of six rhesus macaques each were primed with either 2.5 mg (high-dose) or 250 .mu.g (low-dose) of DNA by intradermal (i.d.) or intramuscular (i.m.) routes using a needleless jet injection device (Bioject, Portland, Oreg.) (T. M. Allen et al. 2000 J Immunol 164:4968).

[0143] Young adult rhesus macaques from the Yerkes breeding colony were cared for under guidelines established by the Animal Welfare Act and the NIH "Guide for the Care and Use of Laboratory Animals" with protocols approved by the Emory University Institutional Animal Care and Use Committee. Macaques were typed for the Mamu-A*01 allele with polymerase chain reaction (PCR) analyses (M. A. Egan et al. 2000 J Virol 74:7485; I. Ourmanov et al. 2000 J Virol 74:2740). Two or more animals containing at least one Mamu-A*01 allele were assigned to each group. Animal numbers are as follows: 1, RBr-5*; 2, RIm-5*; 3, RQf-5*; 4, RZe-5; 5, ROm-5; 6, RDm-5; 7, RAj-5*; 8, RJi-5*; 9, RAl-5*; 10, RDe-5*; 11, RAi-5; 12, RPr-5; 13, RKw-4*; 14, RWz-5*; 15, RGo-5; 16, RLp-4; 17, RWd-6; 18, RAt-5; 19, RPb-5*; 20, RIi-5*; 21, RIq-5; 22, RSp-4; 23, RSn-5; 24, RGd-6; 25, RMb-5*; 26, RGy-5*; 27, RUs-4; and 28, RPm-5. Animals with the A*01 allele are indicated with asterisks.

[0144] Gene gun deliveries of DNA were not used because these had primed non-protective immune responses in a 1996-98 trial (H. L. Robinson et al. 1999 Nat Med 5:526). The MVA/89.6 booster immunization (2.times.10.sup.8 plaque-forming units, pfu) was injected with a needle both i.d. and i.m. A control group included two mock immunized animals and two naive animals. The challenge was given at 7 months after the rMVA booster to test for the generation of long-term immunity. Because most HIV-1 infections are transmitted across mucosal surfaces, an intrarectal challenge was administered.

[0145] DNA priming followed by rMVA boosting generated high frequencies of virus-specific T cells that peaked at one week following the rMVA booster (FIG. 7). The frequencies of T cells recognizing the Gag-CM9 epitope were assessed by means of Mamu-A*01 tetramers, and the frequencies of T cells recognizing epitopes throughout Gag were assessed with pools of overlapping peptides and an enzyme-linked immunospot (ELISPOT) assay (C. A. Power et al. 1999 J Immunol Methods 227:99).

[0146] For tetramer analyses, about 1.times.10.sup.6 peripheral blood mononuclear cells (PBMC) were surface-stained with antibodies to CD3 conjugated to fluorescein isothiocyanate (FITC) (FN-18; Biosource International, Camarillo, Calif.), CD8 conjugated to peridinin chlorophyl protein (PerCP) (SK1; Becton Dickinson, San Jose, Calif.), and Gag-CM9 (CTPYDINQM)-Mamu-A*01 tetramer (SEQ ID NO: 6) conjugated to allophycocyanin (APC), in a volume of 100 .mu.l at 8.degree. to 10.degree. C. for 30 min. Cells were washed twice with cold PBS containing 2% fetal bovine serum (FBS), fixed with 1% paraformaldehyde in PBS, and analyzed within 24 hrs on a FACScaliber (Becton Dickinson, San Jose, Calif.). Cells were initially gated on lymphocyte populations with forward scatter and side scatter and then on CD3 cells. The CD3 cells were then analyzed for CD8 and tetramer-binding cells. About 150,000 lymphocytes were acquired for each sample. Data were analyzed using FloJo software (Tree Star, San Carlos, Calif.).

[0147] For interferon-.gamma. (IFN-.gamma.) ELISPOTs, MULTISCREEN 96 well filtration plates (Millipore Inc. Bedford, Mass.) were coated overnight with antibody to human IFN-.gamma. (Clone B27, Pharmingen, San Diego, Calif.) at a concentration of 2 .mu.g/ml in sodium bicarbonate buffer (pH 9.6) at 8.degree. to 10.degree. C. Plates were washed two times with RPMI medium and then blocked for 1 hour with complete medium (RPMI containing 10% FBS) at 37.degree. C. Plates were washed five more times with plain RPMI medium, and cells were seeded in duplicate in 100 .mu.l complete medium at numbers ranging from 2.times.10.sup.4 to 5.times.10.sup.5 cells per well. Peptide pools were added to each well to a final concentration of 2 .mu.g/ml of each peptide in a volume of 100 .mu.l in complete medium. Cells were cultured at 37.degree. C. for about 36 hrs under 5% CO.sub.2. Plates were washed six times with wash buffer (PBS with 0.05% TWEEN.RTM.-20) and then incubated with 1 .mu.g of biotinylated antibody to human IFN-.gamma. per milliliter (clone 7-86-1; Diapharma Group, West Chester, Ohio) diluted in wash buffer containing 2% FBS. Plates were incubated for 2 hrs at 37.degree. C. and washed six times with wash buffer. Avidin-horseradish peroxidase (Vector Laboratories, Burlingame, Calif.) was added to each well and incubated for 30 to 60 min at 37.degree. C. Plates were washed six times with wash buffer and spots were developed using stable DAB as substrate (Research Genetics, Huntsville, Ala.). Spots were counted with a stereo dissecting microscope. An ovalbumin peptide (SIINFEKL) (SEQ ID NO: 7) was included as a control in each analysis. Background spots for the ovalbumin peptide were generally <5 for 5.times.10.sup.5 PBMCs. This background when normalized for 1.times.10.sup.6 PBMC was <10. Only ELISPOT counts of twice the background (.gtoreq.20) were considered significant. The frequencies of ELISPOTs are approximate because different dilutions of cells have different efficiencies of spot formation in the absence of feeder cells (C. A. Power et al. 1999 J Immunol Methods 227: 99). The same dilution of cells was used for all animals at a given time point, but different dilutions were used to detect memory and acute responses.

[0148] Gag-CM9 tetramer analyses were restricted to macaques that expressed the Mamu-A*01 histocompatibility type, whereas ELISPOT responses did not depend on a specific histocompatibility type. As expected, the DNA immunizations raised low levels of memory cells that expanded to high frequencies within 1 week of the rMVA booster (FIGS. 7 and 12). In Mamu-A*01 macaques, CD8 cells specific to the Gag-CM9 epitope expanded to frequencies as high as 19% of total CD8 T cells (FIG. 12). This peak of specific cells underwent a 10- to 100-fold contraction into the DNA/MVA memory pool (FIGS. 7A and 12). ELISPOTs for three pools of Gag peptides also underwent a major expansion (frequencies up to 4000 spots for 1.times.10.sup.6 PBMC) before contracting from 5- to 20-fold into the DNA/MVA memory response (FIG. 7B). The frequencies of ELISPOTs were the same in macaques with and without the A*01 histocompatibility type (P>0.2).

[0149] Simple linear regression was used to estimate correlations between postbooster and postchallenge ELISPOT responses, between memory and postchallenge ELISPOT responses, and between logarithmically transformed viral loads and ELISPOT frequencies. Comparisons between vaccine and control groups and A*01 and non A*01 macaques were performed by means of two-sample t tests with logarithmically transformed viral load and ELISPOT responses. Two-way analyses of variance were used to examine the effects of dose and route of administration on peak DNA/MVA ELISPOTs, on memory DNA/MVA ELISPOTs, and on logarithmically transformed Gag antibody data.

[0150] At both peak and memory phases of the vaccine response, the rank order for the height of the ELISPOTs in the vaccine groups was 2.5 mg i.d.>2.5 mg i.m.>250 .mu.g i.d.>250 .mu.g i.m. (FIG. 7B). The IFN-.gamma. ELISPOTs included both CD4 and CD8 cells. Gag-CM9-specific CD8 cells had good lytic activity after restimulation with peptide.

[0151] The highly pathogenic SHIV-89.6P challenge was administered intrarectally at 7 months after the rMVA booster, when vaccine-raised T cells were in memory (FIG. 7).

[0152] The challenge stock (5.7.times.10.sup.9 copies of viral RNA per milliliter) was produced by one intravenous followed by one intrarectal passage in rhesus macaques of the original SHIV-89.6P stock (G. B. Karlsson et al. 1997 J Virol 71:4218). Lymphoid cells were harvested from the intrarectally infected animal at peak viremia, CD8-depleted, and mitogen-stimulated for stock production. Before intrarectal challenge, fasted animals were anesthetized (ketamine, 10 mg/kg) and placed on their stomach with the pelvic region slightly elevated. A feeding tube (8Fr (2.7 mm).times.16 inches (41 cm); Sherwood Medical, St. Louis, Mo.) was inserted into the rectum for a distance of 15 to 20 cm. Following insertion of the feeding tube, a syringe containing 20 intrarectal infectious doses in 2 ml of RPMI-1640 plus 10% FBS was attached to the tube and the inoculum was slowly injected into the rectum. After delivery of the inoculum, the feeding tube was flushed with 3.0 ml of RPMI without FBS and then slowly withdrawn. Animals were left in place, with pelvic regions slightly elevated, for a period of ten minutes after the challenge.

[0153] The challenge infected all of the vaccinated and control animals (FIG. 8). However, by 2 weeks after challenge, titers of plasma viral RNA were at least 10-fold lower in the vaccine groups (geometric means of 1.times.10.sup.7 to 5.times.10.sup.7) than in the control animals (geometric mean of 4.times.10.sup.8) (FIG. 8A) (S. Staprans et al. in: Viral Genome Methods K. Adolph, ed. CRC Press, Boca Raton, Fla., 1996 pp. 167-184; R. Hofmann-Lehmann et al. 2000 AIDS Res Hum Retroviruses 16:1247).

[0154] For the determination of SHIV copy number, viral RNA from 150 .mu.l of ACD anticoagulated plasma was directly extracted with the QIAamp Viral RNA kit (Qiagen), eluted in 60 .mu.l of AVE buffer, and frozen at -80.degree. C. until SHIV RNA quantitation was performed. Five microliters of purified plasma RNA was reverse-transcribed in a final 20-.mu.l volume containing 50 mM KCl, 10 mM Tris-HCl (pH 8.3), 4 mM MgCl.sub.2, 1 mM each deoxynucleotide triphosphate (dNTP), 2.5 .mu.M random hexamers, 20 units MultiScribe RT, and 8 units ribonuclease inhibitor. Reactions were incubated at 25.degree. C. for 10 min, followed by incubation at 42.degree. C. for 20 min, and inactivation of reverse transcriptase at 99.degree. C. for 5 min. The reaction mix was adjusted to a final volume of 50 .mu.l containing 50 mM KCl, 10 mM Tris-HCl (pH 8.3), 4 mM MgCl.sub.2, 0.4 mM each dNTP, 0.2 .mu.M forward primer, 0.2 .mu.M reverse primer, 0.1 .mu.M probe, and 5 units AmpliTaq Gold DNA polymerase (all reagents from PerkinElmer Applied Biosystems, Foster City, Calif.). The primer sequences within a conserved portion of the SIV gag gene are the same as those described previously (S. Staprans et al. in: Viral Genome Methods K. Adolph, ed. CRC Press, Boca Raton, Fla., 1996 pp. 167-184). A PerkinElmer Applied Biosystems 7700 Sequence Detection System was used with the PCR profile: 95.degree. C. for 10 min, followed by 40 cycles at 93.degree. C. for 30 s, and 59.5.degree. C. for 1 min. PCR product accumulation was monitored with the 7700 sequence detector and a probe to an internal conserved gag gene sequence: 6FAM-CTGTCTGCGTCATTTGGTGC-Tamra (SEQ ID NO: 8), where FAM and Tamra denote the reporter and quencher dyes. SHIV RNA copy number was determined by comparison with an external standard curve consisting of virion-derived SIVmac239 RNA quantified by the SIV bDNA method (Bayer Diagnostics, Emeryville, Calif.). All specimens were extracted and amplified in duplicate, with the mean result reported. With a 0.15-ml plasma input, the assay has a sensitivity of 10.sup.3 RNA copies per milliliter of plasma and a linear dynamic range of 10.sup.3 to 10.sup.8 RNA copies (R.sup.2=0.995). The intraassay coefficient of variation was <20% for samples containing >10.sup.4 SHIV RNA copies per milliliter, and <25% for samples containing 10.sup.3 to 10.sup.4 SHIV RNA copies per milliliter. To more accurately quantitate low SHIV RNA copy number in vaccinated animals at weeks 16 and 20, we made the following modifications to increase the sensitivity of the SHIV RNA assay: (i) Virions from <1 ml of plasma were concentrated by centrifugation at 23,000 g at 10.degree. C. for 150 min before viral RNA extraction, and (ii) a one-step reverse transcriptase PCR method was used (R. Hofmann-Lehmann et al. 2000 AIDS Res Hum Retroviruses 16:1247). These changes provided a reliable quantification limit of 300 SHIV RNA copies per milliliter, and gave SHIV RNA values that were highly correlated to those obtained by the first method used (r=0.91, P<0.0001).

[0155] By 8 weeks after challenge, both high-dose DNA-primed groups and the low-dose i.d. DNA-primed group had reduced their geometric mean loads to about 1000 copies of viral RNA per milliliter. At this time, the low-dose i.m. DNA-primed group had a geometric mean of 6.times.10.sup.3 copies of viral RNA and the nonvaccinated controls had a geometric mean of 2.times.10.sup.6. By 20 weeks after challenge, even the low-dose i.m. group had reduced its geometric mean copies of viral RNA to 1000. Among the 24 vaccinated animals, only one animal, animal number 22 in the low-dose i.m. group, had intermittent viral loads above 1.times.10.sup.4 copies per milliliter (FIG. 8D).

[0156] By 5 weeks after challenge, all of the nonvaccinated controls had undergone a profound depletion of CD4 cells (FIG. 8B). All of the vaccinated animals maintained their CD4 cells, with the exception of animal 22 in the low dose i.m. group (see above), which underwent a slow CD4 decline (FIG. 8E). By 23 weeks after challenge, three of the four control animals had succumbed to AIDS (FIG. 8C). These animals had variable degrees of enterocolitis with diarrhea, cryptosporidiosis, colicystitis, enteric campylobacter infection, splenomegaly, lymphadenopathy, and SIV-associated giant cell pneumonia. In contrast, all 24 vaccinated animals maintained their health.

[0157] Containment of the viral challenge was associated with a burst of antiviral T cells (FIGS. 7 and 9A). At one week after challenge, the frequency of tetramer.sup.+ cells in the peripheral blood had decreased, potentially reflecting the recruitment of specific T cells to the site of infection (FIG. 9A). However, by two weeks after challenge, tetramer.sup.+ cells in the peripheral blood had expanded to frequencies as high as, or higher than, after the rMVA booster (FIGS. 7 and 9A). The majority of the tetramer.sup.+ cells produced IFN-.gamma. in response to a 6-hour peptide stimulation (FIG. 9B) (S. L. Waldrop et al. 1997 J Clin Invest 99:1739) and did not have the "stunned" IFN-.gamma. negative phenotype sometimes observed in viral infections (F. Lechner et at 2000 J Exp Med 191:1499).

[0158] For intracellular cytokine assays, about 1.times.10.sup.6 PBMC were stimulated for 1 hour at 37.degree. C. in 5 ml polypropylene tubes with 100 .mu.g of Gag-CM9 peptide (CTPYDINQM) (SEQ ID NO: 6) per milliliter in a volume of 100 .mu.l RPMI containing 0.1% bovine serum albumin (BSA) and 1 .mu.g of antibody to human CD28 and 1 .mu.g of antibody to human CD49d (Pharmingen, San Diego, Calif.) per milliliter. Then, 900 .mu.l of RPMI containing 10% FBS and monensin (10 .mu.g/ml) was added, and the cells were cultured for an additional 5 hrs at 37.degree. C. at an angle of 5.degree. under 5% CO.sub.2. Cells were surface stained with antibodies to CD8 conjugated to PerCP (clone SK1, Becton Dickinson) at 8.degree. to 10.degree. C. for 30 min, washed twice with cold PBS containing 2% FBS, and fixed and permeabilized with CYTOFIX/CYTOPERM.TM. solution (Pharmingen). Cells were then incubated with antibodies to human CD3 (clone FN-18; Biosource International, Camarillo, Calif.) and IFN-.gamma. (Clone B27; Pharmingen) conjugated to FITC and phycoerythrin, respectively, in Perm wash solution (Pharmingen) for 30 min at 4.degree. C. Cells were washed twice with Perm wash, once with plain PBS, and resuspended in 1% paraformaldehyde in PBS. About 150,000 lymphocytes were acquired on the FACScaliber and analyzed with FloJo software.

[0159] The postchallenge burst of T cells contracted concomitant with the decline of the viral load. By 12 weeks after challenge, virus-specific T cells were present at about one-tenth of their peak height (FIGS. 7A and 9A). In contrast to the vigorous secondary response in the vaccinated animals, the naive animals mounted a modest primary response (FIGS. 7B and 9A). Tetramer.sup.+ cells peaked at less than 1% of total CD8 cells (FIG. 9A), and IFN-.gamma.-producing ELISPOTs were present at a mean frequency of about 300 as opposed to the much higher frequencies of 1000 to 6000 in the vaccine groups (FIG. 7B) (P<0.05).

[0160] The tetramer.sup.+ cells in the control group, like those in the vaccine group, produced IFN-.gamma. after peptide stimulation (FIG. 9B). By 12 weeks after challenge, three of the four controls had undetectable levels of IFN-.gamma.-producing ELISPOTs. This rapid loss of antiviral T cells in the presence of high viral loads may reflect the lack of CD4 help.

[0161] T cell proliferative responses demonstrated that virus-specific CD4 cells had survived the challenge and were available to support the antiviral immune response (FIG. 9C).

[0162] About 0.2 million PBMC were stimulated in triplicate for 5 days with the indicated antigen in 200 .mu.l of RPMI at 37.degree. C. under 5% CO.sub.2. Supernatants from 293T cells transfected with DNA expressing either SHIV-89.6 Gag and Pol or SHIV-89.6 Gag, Pol and Env were used directly as antigens (final concentration of .about.0.5 .mu.g of p27 Gag per milliliter). Supernatants from mock DNA (vector alone)-transfected cells served as negative controls. On day six, cells were pulsed with 1 .mu.Ci of tritiated thymidine per well for 16 to 20 hours. Cells were harvested with an automated cell harvester (TOMTEC, Harvester 96, Model 1010, Hamden, Conn.) and counted with a Wallac 1450 MICROBETA Scintillation counter (Gaithersburg, Md.). Stimulation indices are the counts of tritiated thymidine incorporated in PBMC stimulated with 89.6 antigens divided by the counts of tritiated thymidine incorporated by the same PBMC stimulated with mock antigen.

[0163] At 12 weeks after challenge, mean stimulation indices for Gag-Pol-Env or Gag-Pol proteins ranged from 35 to 14 in the vaccine groups but were undetectable in the control group. Consistent with the proliferation assays, intracellular cytokine assays demonstrated the presence of virus-specific CD4 cells in vaccinated but not control animals. The overall rank order of the vaccine groups for the magnitude of the proliferative response was 2.5 mg i.d.>2.5 mg i.m.>250 .mu.g i.d.>250 .mu.g i.m.

[0164] At 12 weeks after challenge, lymph nodes from the vaccinated animals were morphologically intact and responding to the infection, whereas those from the infected controls had been functionally destroyed (FIG. 10). Nodes from vaccinated animals contained large numbers of reactive secondary follicles with expanded germinal centers and discrete dark and light zones (FIG. 10A). By contrast, lymph nodes from the non-vaccinated control animals showed follicular and paracortical depletion (FIG. 10B), while those from unvaccinated and unchallenged animals displayed normal numbers of minimally reactive germinal centers (FIG. 10C). Germinal centers occupied <0.05% of total lymph node area in the infected controls, 2% of the lymph node area in the uninfected controls, and up to 18% of the lymph node area in the vaccinated groups (FIG. 10D). More vigorous immune reactivity in the low-dose than the high-dose DNA-primed animals was suggested by more extensive germinal centers in the low dose group (FIG. 10D). At 12 weeks after challenge, in situ hybridization for viral RNA revealed rare virus-expressing cells in lymph nodes from 3 of the 24 vaccinated macaques, whereas virus-expressing cells were readily detected in lymph nodes from each of the infected control animals. In the controls, which had undergone a profound depletion in CD4 T cells, the cytomorphology of infected lymph node cells was consistent with a macrophage phenotype.

[0165] The prime/boost strategy raised low levels of antibody to Gag and undetectable levels of antibody to Env (FIG. 11). Postchallenge, antibodies to both Env and Gag underwent anamnestic responses with total Gag antibody reaching heights approaching 1 mg/ml and total Env antibody reaching heights of up to 100 .mu.g/ml.

[0166] Enzyme-linked immunosorbent assays (ELISAs) for total antibody to Gag used bacterially produced SIV gag p27 to coat wells (2 .mu.g per milliliter in bicarbonate buffer). ELISAs for antibody to Env antibody used 89.6 Env produced in transiently transfected 293T cells and captured with sheep antibody against Env (catalog number 6205; International Enzymes, Fairbrook Calif.). Standard curves for Gag and Env ELISAs were produced with serum from a SHIV-89.6-infected macaque with known amounts of immunoglobulin G (IgG) specific for Gag or Env. Bound antibody was detected with peroxidase-conjugated goat antibody to macaque IgG (catalog #YNGMOIGGFCP; Accurate Chemical, Westbury, N.Y.) and TMB substrate (Catalog #T3405; Sigma, St. Louis, Mo.). Sera were assayed at threefold dilutions in duplicate wells. Dilutions of test sera were performed in whey buffer (4% whey and 0.1% TWEEN.RTM. 20 in 1.times.PBS). Blocking buffer consisted of whey buffer plus 0.5% nonfat dry milk. Reactions were stopped with 2M H.sub.2SO.sub.4 and the optical density read at 450 nm. Standard curves were fitted and sample concentrations were interpolated as .mu.g of antibody per ml of serum using SOFTmax 2.3 software (Molecular Devices, Sunnyvale, Calif.).

[0167] By 2 weeks after challenge, neutralizing antibodies for the 89.6 immunogen, but not the SHIV-89.6P challenge, were present in the high-dose DNA-primed groups (geometric mean titers of 352 in the i.d. and 303 in the i.m. groups) (FIG. 11C) (D. C. Montefiori et al. 1988 J Clin Microbiol 26:231). By 5 weeks after challenge, neutralizing antibody to 89.6P had been generated (geometric mean titers of 200 in the high-dose i.d. and 126 in the high-dose i.m. group) (FIG. 11D) and neutralizing antibody to 89.6 had started to decline. By 16 to 20 weeks after challenge, antibodies to Gag and Env had fallen in most animals.

[0168] Our results demonstrate that a multiprotein DNA/MVA vaccine can raise a memory immune response capable of controlling a highly virulent mucosal immunodeficiency virus challenge. Our levels of viral control were more favorable than have been achieved using only DNA (M. A. Egan et al. 2000 J Virol 74:7485) or rMVA vaccines (I. Ourmanov et al. 2000 J Virol 74:2740) and were comparable to those obtained for DNA immunizations adjuvanted with interleukin-2 (D. H. Barouch et al. 2000 Science 290:486). All of these previous studies have used more than three vaccine inoculations, none have used mucosal challenges, and most have challenged at peak effector responses and not allowed a prolonged post vaccination period to test for "long term" efficacy.

[0169] The dose of DNA had statistically significant effects on both cellular and humoral responses (P<0.05), whereas the route of DNA administration affected only humoral responses. Intradermal DNA delivery was about 10 times more effective than i.m. inoculations for generating antibody to Gag (P=0.02). Neither route nor dose of DNA appeared to have a significant effect on protection. At 20 weeks after challenge, the high-dose DNA-primed animals had slightly lower geometric mean levels of viral RNA (7.times.10.sup.2 and 5.times.10.sup.2) than the low-dose DNA-primed animals (9.times.10.sup.2 and 1.times.10.sup.3).

[0170] The DNA/MVA vaccine controlled the infection, rapidly reducing viral loads to near or below 1000 copies of viral RNA per milliliter of blood. Containment, rather than prevention of infection, affords the opportunity to establish a chronic infection (H. L. Robinson et al. 1999 Nat Med 5:526). By rapidly reducing viral loads, a multiprotein DNA/MVA vaccine will extend the prospect for long-term non-progression and limit HIV transmission (J. W. Mellors et al. 1996 Science 272:1167; T. C. Quinn et al. 2000 N Engl J Med 342:921).

Example 2

MVA Expressing Modified HIV Env, Gag, and Pol Genes

[0171] This disclosure describes the construction of a modified vaccinia Ankara (MVA) recombinant virus, MVA/HIV clade B recombinant virus expressing the HIV strain ADA env and the HXB2 gag pol (MVA/HIV ADA env+HXB2 gag pol). For amplification, the lab name of MVA/HIV 48 will be used, which denotes the plasmid from which the construct comes.

[0172] The HIV gag-pol genes were derived from the Clade B infectious HXB2 virus. The gag-pol gene was truncated so that most of the integrase coding sequences were removed and amino acids 185, 266, and 478 were mutated to inactivate reverse transcriptase, inhibit strand transfer activity, and inhibit the RNaseH activity, respectively. The Clade B CCR5 tropic envelope gene was derived from the primary ADA isolate; TTTTTNT (SEQ ID NO: 14) sequences were mutated without changing coding capacity to prevent premature transcription termination and the cytoplasmic tail was truncated in order to improve surface expression, immunogenicity, and stability of the MVA vector. The HIV genes were inserted into a plasmid transfer vector so that gag-pol gene was regulated by the modified H5 early/late vaccinia virus promoter and the env gene was regulated by the newly designed early/late Psyn II promoter to provide similar high levels of expression. A self-deleting GUS reporter gene was included to allow detection and isolation of the recombinant virus. The HIV genes were flanked by MVA sequences to allow homologous recombination into the deletion 3 site so that the recombinant MVA would remain TK positive for stability and high expression in resting cells. The recombinant MVA was isolated and shown to express abundant amounts of gag-pol-env and to process gag. Production of HIV-like particles was demonstrated by centrifugation and by electron microscopy. The presence of env in the HIV-like particles was demonstrated by immunoelectron microscopy.

TABLE-US-00002 Table of Sequences Description SEQ ID NO FIG. NO pLW-48 map N/A 13 pLW-48 sequence 1 14 Psyn II promoter 2 14 ADA envelope truncated 3 14 PmH5 promoter 4 14 HXB2 gag pol 5 14

Plasmid Transfer Vector

[0173] The plasmid transfer vector used to make the MVA recombinant virus, pLW-48, (FIG. 15) by homologous recombination was constructed as follows:

[0174] 1. From the commercially obtained plasmid, pGem-4Z (Promega), flanking areas on either side of deletion III, designated flank 1 and flank 2, containing 926 and 520 base pairs respectively, were amplified by PCR from the MVA stains of vaccinia virus. Within these flanks, a promoter, the mH5, which had been modified from the originally published sequence by changing two bases that had been shown by previously published work to increase the expression of the cloned gene, was added.

[0175] 2. A clade B gag pol (FIG. 16) was truncated so that the integrase was removed and was cloned into the plasmid so that it was controlled by the mH5 promoter. This gene contained the complete HXB2 sequence of the gag. The pol gene has reverse transcriptase safety mutations in amino acid 185 within the active site of RT, in amino acid 266 which inhibits strand transfer activity, and at amino acid 478 which inhibits the RNaseH activity. In addition, the integrase gene was deleted past EcoRI site.

[0176] 3. A direct repeat of 280 basepairs, corresponding to the last 280 base pairs of MVA flank 1, was added after flank 1.

[0177] 4. The p11 promoter and GUS reporter gene were added between the two direct repeats of flank 1 so that this screening marker could initially be used for obtaining the recombinant virus, yet deleted out in the final recombinant virus (Scheiflinger, F. et al. 1998 Arch Virol 143:467-474; Carroll, M. W. and B. Moss 1995 BioTechniques 19:352-355).

[0178] 5. A new promoter, Psyn II, was designed to allow for increased expression of the ADA env. The sequence of this new early/late promoter is given in FIG. 17.

[0179] 6. A truncated version of the ADA envelope with a silent 5TNT mutation was obtained by PCR and inserted in the plasmid under the control of the Psyn II promoter. The envelope was truncated in the cytoplasmic tail of the gp41 gene, deleting 115 amino acids of the cytoplasmic tail. This truncation was shown to increase the amount of envelope protein on the surface of infected cells and enhance immunogenicity of the envelope protein in mice, and stability of the recombinant virus in tissue culture.

Recombinant MVA Construction

[0180] 1. MVA virus, which may be obtained from ATCC Number VR-1508, was plaque purified three times by terminal dilutions in chicken embryo fibroblasts (CEF), which were made from 9 day old SPF Premium SPAFAS fertile chicken eggs, distributed by B and E Eggs, Stevens, Pa.

[0181] 2. Secondary CEF cells were infected at an MOI of 0.05 of MVA and transfected with 2 .mu.g of pLW-48, the plasmid described above. Following a two-day incubation at 37.degree. C., the virus was harvested, frozen and thawed 3.times., and plated out on CEF plates.

[0182] 3. At 4 days, those foci of infection that stained blue after addition of X-gluc substrate, indicating that recombination had occurred between the plasmid and the infecting virus, were picked and inoculated on CEF plates. Again, those foci that stained blue were picked.

[0183] 4. These GUS containing foci were plated out in triplicate and analyzed for GUS staining (which we wanted to now delete) and ADA envelope expression. Individual foci were picked from the 3rd replicate plates of those samples that had about equal numbers of mixed populations of GUS staining and nonstaining foci as well as mostly envelope staining foci.

[0184] 5. These foci were again plated out in triplicate, and analyzed the same way. After 5 passages, a virus was derived which expressed the envelope protein but which had deleted the GUS gene because of the double repeat. By immunostaining, this virus also expressed the gag pol protein.

Characterization of MVA Recombinant Virus, MVA/HIV 48

[0185] 1. Aliquots of MVA/HIV 48 infected cell lysates were analyzed by radioimmunoprecipitation and immunostaining with monoclonal antibodies for expression of both the envelope and gag pol protein. In both of these tests, each of these proteins was detected.

[0186] 2. The recombinant virus was shown to produce gag particles in the supernatant of infected cells by pelleting the .sup.35S-labeled particles on a 20% sucrose cushion.

[0187] 3. Gag particles were also visualized both outside and budding from cells as well as within vacuoles of cells in the electron microscope in thin sections. These gag particles had envelope protein on their surface.

[0188] Unless otherwise indicated, all nucleotide sequences determined by sequencing a DNA molecule herein were determined using an automated DNA sequencer, and all amino acid sequences of polypeptides encoded by DNA molecules determined herein were predicted by translation of a DNA sequence determined as above. Therefore, as is known in the art for any DNA sequence determined by this automated approach, any nucleotide sequence determined herein may contain some errors. Nucleotide sequences determined by automation are typically at least about 90% identical, more typically at least about 95% to at least about 99.9% identical to the actual nucleotide sequence of the sequenced DNA molecule. The actual sequence can be more precisely determined by other approaches including manual DNA sequencing methods well known in the art. As is also known in the art, a single insertion or deletion in a determined nucleotide sequence compared to the actual sequence will cause a frame shift in translation of the nucleotide sequence such that the predicted amino acid sequence encoded by a determined nucleotide sequence will be completely different from the amino acid sequence actually encoded by the sequenced DNA molecule, beginning at the point of such an insertion or deletion.

SUMMARY

[0189] In summary, we have made a recombinant MVA virus, MVA/HIV 48, which has high expression of the ADA truncated envelope and the HXB2 gag pol. The MVA recombinant virus is made using a transiently expressed GUS marker that is deleted in the final virus. High expression of the ADA envelope is possible because of a new hybrid early/late promoter, Psyn II. In addition, the envelope has been truncated because we have shown truncation of the envelope enhances the amount of protein on the surface of the infected cells, and hence enhances immunogenicity; stability of the recombinant is also enhanced. The MVA recombinant makes gag particles which have been shown by pelleting the particles through sucrose and analyzing by PAGE. Gag particles with envelope protein on the surface have also been visualized in the electron microscope.

Example 3

Additional Modified or Synthetic Promoters Designed for Gene Expression in MVA Or Other Poxviruses

[0190] Additional modified or synthetic promoters were designed for gene expression in MVA or other poxviruses. Promoters were modified to allow expression at early and late times after infection and to reduce possibility of homologous recombination between identical sequences when multiple promoters are used in same MVA vector. Promoters are placed upstream of protein coding sequence.

TABLE-US-00003 m7.5 promoter (SEQ ID NO: 10): CGCTTTTTATAGTAAGTTTTTCACCCATAAATAATAAATACAATAATTAA TTTCTCGTAAAAATTGAAAAACTATTCTAATTTATTGCACGGT Psyn II promoter (SEQ ID NO: 2): TAAAAAATGAAAAAATATTCTAATTTATAGGACGGTTTTGATTTTCTTT TTTTCTATGCTATAAATAATAAATA Psyn III promoter (SEQ ID NO: 11): TAAAAATTGAAAAAATATTCTAATTTATAGGACGGTTTTGATTTTCTTTT TTTCTATACTATAAATAATAAATA Psyn IV promoter (SEQ ID NO: 12): TAAAAATTGAAAAACTATTCTAATTTATAGGACGGTTTTGATTTTCTTTT TTTCTATACTATAAATAATAAATA Psyn V promoter (SEQ ID NO: 13): AAAAAATGATAAAGTAGGTTCAGTTTTATTGCTGGTTTAAAATCACGCT TTCGAGTAAAAACTACGAATATAAAT

Example 4

Tables A-F

[0191] Table A: MVA/48 Immunization--Guinea Pigs.

[0192] Groups of guinea pigs were immunized at days 0 and 30 with 1.times.10.sup.8 infectious units of MVA/48 by either the intramuscular (IM) or intradermal (ID) route. As a control another group was immunized IM with the same dose of non-recombinant MVA. Sera taken before as well as after each immunization were analyzed for neutralizing activity against HIV-1-MN. Titers are the reciprocal serum dilution at which 50% of MT-2 cells were protected from virus-induced killing. Significant neutralizing activity was observed in all animals after the second immunization with MVA/48 (day 49).

[0193] Table B: Frequencies of HIV-1 gag-Specific T Cells Following Immunization of Mice with MVA/48.

[0194] Groups of Balb/c mice were immunized at days 0 and 21 with 1.times.10.sup.7 infectious units of MVA/48 by one of three routes: intraperitoneal (IP), intradermal (ID), or intramuscular (IM). A control group was immunized with non-recombinant MVA. At 5 weeks after the last immunization, splenocytes were prepared and stimulated in vitro with an immunodominant peptide from HIV-1 p24 for 7 days. The cells were then mixed either with peptide-pulsed P815 cells or with soluble peptide. Gamma interferon-producing cells were enumerated in an ELISPOT assay. A value of >500 was assigned to wells containing too many spots to count. Strong T cell responses have been reported in mice immunized IP with other viruses. In this experiment, IP immunization of mice with MVA/48 elicited very strong HIV-1 gag-specific T cell responses.

[0195] Table C: DNA Prime and MVA/48 Boost--Total ELISPOTs Per Animal.

[0196] Ten rhesus macaques were primed (weeks 0 and 8) with a DNA vaccine expressing HIV-1 antigens including Ada envelope and HXB2 gagpol. At week 24 the animals were boosted intramuscularly with 1.times.10.sup.8 infectious units of MVA/48. Fresh peripheral blood mononuclear cells (PBMC) were analyzed for production of gamma interferon in an ELISPOT assay as follows: PBMC were incubated for 30-36 hours in the presence of pools of overlapping peptides corresponding to the individual HIV-1 antigens in the vaccines. The total number of gamma interferon-producing cells from each animal is shown in the table. T cell responses to DNA vaccination were limited (weeks 2-20). However, boosting with MVA/48 resulted in very strong HIV-1-specific T cell responses in all animals (week 25).

[0197] Table D: Antibody Response Following Immunization of Macaques with MVA/SHIV KB9.

[0198] Groups of rhesus macaques were immunized with 2.times.10.sup.8 infectious units of MVA/SHIV-KB9 at weeks 0 and 4 by one of several routes: Tonsilar, intradermal (ID), or intramuscular (IM). Another group was immunized with non-recombinant MVA using the same routes. Serum samples from 2 weeks after the second immunization were analyzed for binding to KB9 envelope protein by ELISA and for neutralization of SHIV-89.6P and SHIV-89.6. In the ELISA assay, soluble KB9 envelope protein was captured in 96 well plates using an antibody to the C-terminus of gp120. Serial dilutions of sera were analyzed and used to determine the endpoint titers. Neutralization of SHIV-89.6P and SHIV-89.6 was determined in an MT-2 cell assay. Titers are the reciprocal serum dilution at which 50% of the cells were protected from virus-induced killing. In in vitro neutralization assays, SHIV-89.6P and SHIV-89.6 are heterologous, i.e. sera from animals infected with one of the viruses do not neutralize the other virus. Thus, two immunizations with MVA/SHIV-KB9 elicited good ELISA binding antibodies in all animals and neutralizing antibodies to the homologous virus (SHIV-89.6P) in some animals. In addition, heterologous neutralizing antibodies were observed in a subset of animals.

[0199] Table E: Frequencies of Gag CM-9-Specific CD3/CD8 T Cells Following Immunization of Macaques with MVA/SHIV-KB9.

[0200] Groups of MamuA*01 positive rhesus macaques were immunized with 2.times.10.sup.8 infectious units of MVA/SHIV-KB9 at weeks 0 and 4 by one of several routes: tonsilar, intradermal (ID), or intramuscular IM). Another group was immunized with non-recombinant MVA. The frequencies of CD3+/CD8+ T cells that bound tetrameric complex containing the SIV gag-specific peptide CM9 were determined by flow cytometry at various times after each immunization. Time intervals were as follows: 1a, 1b, and 1d were one, two, and four weeks after the first immunization, respectively; 2a, 2b, 2c, and 2d were one, two, three, and twelve weeks after the second immunization, respectively. Values above background are shown in bold face. Strong SIV gag-specific responses were observed after a single immunization with MVA/SHIV-KB9 in all immunized animals. Boosting was observed in most animals following the second immunization. In addition, measurable tetramer binding was still found twelve weeks after the second immunization.

[0201] Table F: Frequencies of Specific T Cells Following Immunization of Macaques with MVA/SHIV KB9.

[0202] Groups of macaques were immunized with MVA/SHIV-KB9 as described above. MVA/SHIV-KB9 expresses 5 genes from the chimeric virus, SHIV-89.6P: envelope, gag, polymerase, tat, and nef. Thus, the frequencies of T cells specific for each of the 5 antigens were analyzed using pools of peptides corresponding to each individual protein. Fresh PBMC were stimulated with pools of peptides for 30-36 hours in vitro. Gamma interferon-producing cells were enumerated in an ELISPOT assay. The total number of cells specific for each antigen is given as "total # spots". In addition, the number of responding animals and average # of spots per group is shown. PBMC were analyzed at one week after the first immunization (1a) and one week after the second immunization (2a). Another group of 7 animals was immunized with non-recombinant MVA. In these animals, no spots above background levels were detected. Thus, a single immunization with MVA/SHIV-KB9 elicited strong SHIV-specific T cell responses in all animals. Gag and envelope responses were the strongest; most animals had responses to gag, all animals had responses to envelope. The Elispot responses were also observed after the second immunization with MVA/SHIV-KB9, albeit at lower levels. At both times, the rank order of responses was: tonsilar>ID>IM. We show good immune response to nef and some immune response to tat.

TABLE-US-00004 TABLE A MVA/48 immunization - guinea pigs HIV-MN neutralizing antibody - reciprocal titer Day 4 day 3 day MVA day MVA day Animal # Group Route 0 #1 30 #2 49 885 MVA I.M. <20 I.M. 31 I.M. 24 891 '' '' <20 '' 85 '' <20 882 MVA/48 I.M. <20 I.M. <20 I.M. 5,524 883 '' '' <20 '' 68 '' 691 886 '' '' <20 '' <20 '' 4,249 890 '' '' <20 '' 180 '' 89 879 MVA/48 I.D. <20 I.D. <20 I.D. 817 881 '' '' <20 '' <20 '' 234 888 '' '' <20 '' 24 '' 112 889 '' '' <20 '' 22 '' 376

TABLE-US-00005 TABLE B Frequencies of HIV-gag-specific T cells following immunization of mice with MVA/48 Group P815 cells + gag peptide gag peptide no stimulation MVA control 0 2 0 4 1 2 MVA/48 (IP) >500 >500 >500 >500 8 8 MVA/48 (ID) 12 5 49 33 4 2 MVA/48 (IM) 22 18 66 49 12 8

TABLE-US-00006 TABLE C DNA prime and MVA/48 boost. Total ELISPOTS per Animal WEEKS Animal # -2 2 6 10 .sup.2 14 .sup.2 20 .sup.2 25 .sup.2 I. RLW 4 731* < 47 43 50 3905 RVl 5 997* < < < 8 205 Roa .sup. < .sup.1 < 1 < < < 245 RHc < < < < < < 535 Ryl < < < < < < 4130 RQk < 46 < < < < 630 RDr < < < 14 < < 1965 RZc < 5 < 58 < < 925 RSf < 118 < < < 20 5570 Ras < 69 < < < < 1435 Total 9 1966 1 119 43 78 19545 Geo Mean 4.5 105.3 1.0 33.7 43.0 20.0 1147.7 DNA primes were at 0 and 8 weeks and MVA/48 boost was at 24 weeks .sup.1 < = Background (2x the number of ELISPOTs in the unstimulated control + 10) .sup.2 Costimulatory antibodies were added to the ELISPOT incubations *Animals from this bleed date exhibited higher than usual ELISPOTs.

TABLE-US-00007 TABLE D Antibody response following immunization of macaques with MVA/SHIV KB9 SHIV- KB9 env SHIV- SHIV-89.6 89.6P ELISA KB9 env elisa 89.6 SHIV-89.6P # pos # pos Animal # Route titer average std dev. Nab titer Nab titer animals animals 598 tonsil 25,600 31,086 20,383 <20 <20 3 2 601 '' 51,200 <20 <20 606 '' 25,600 <20 <20 642 '' 51,200 75 31 646 '' 51,200 61 48 653 '' 6,400 <20 <20 654 '' 6,400 22 <20 602 i.d. 25,600 18,800 15,341 38 <20 2 4 604 '' 12,800 <20 262 608 '' 3,200 20 66 637 '' 12,800 <20 35 638 '' 51,200 <20 <20 645 '' 25,600 <20 <20 647 '' 12,800 32 162 650 '' 6,400 <20 <20 599 i.m. 6,400 17,000 16,516 <20 <20 0 3 600 '' 6,400 <20 29 609 '' 6,400 <20 <20 639 '' 51,200 <20 85 640 '' 12,800 <20 <20 641 '' 25,600 <20 41 649 '' 1,600 <20 <20 651 '' 25,600 20 <20 603 Control <100 <100 <20 <20 0 0 605 '' <100 <20 <20 607 '' <100 <20 <20 643 '' <100 <20 <20 644 '' <100 <20 <20 648 '' <100 <20 <20 652 '' <100 <20 <20

TABLE-US-00008 TABLE E Frequencies of gag CM9-specific CD3/CD8 T cells following immunization of macaques with MVA/SHIV KB9 pre- Animal # Route Virus bleed 1a 1b 1d 2a 2b 2c 2d 598 Tonsil MVA/KB9 0.018 0.41 0.79 0.25 2.64 1.13 0.51 0.21 601 '' '' 0.071 0.34 0.38 0.27 0.83 0.7 0.36 0.039 646 '' '' 0.022 0.68 0.76 0.43 1.12 0.91 0.53 0.15 653 '' '' 0.041 0.69 0.85 0.53 0.68 0.49 0.47 0.3 648 '' MVA 0.033 0.039 0.022 0.058 0.033 0.013 602 i.d. MVA/KB9 0.019 0.17 0.92 0.5 0.95 0.59 0.5 0.2 604 '' '' 0.013 0.11 0.38 0.32 0.44 0.38 0.19 0.25 650 '' '' 0.095 0.17 0.6 0.23 2.87 1.12 0.9 0.16 647 '' '' 0.032 0.22 0.38 0.14 0.84 0.91 0.34 0.17 652 '' MVA 0.041 0.038 0.059 0.025 0.022 0.026 0.055 599 i.m. MVA/KB9 0.081 0.31 0.082 0.12 0.054 0.11 600 '' '' 0.034 0.15 0.41 0.17 0.29 0.27 0.16 0.049 649 '' '' 0.00486 0.35 1.34 0.56 2.42 0.77 0.69 0.22 651 '' '' 0.049 0.12 0.69 0.25 1.01 0.32 0.24 0.22 603 '' MVA 0.024 0.087 0.073 0.082 0.027 0.17

TABLE-US-00009 TABLE F Frequencies of specific T cells following immunization of macaques with MVA/SHIV KB9 Gag specific Tat specific Nef specific Env specific Total # Total average # total average # total average # Total Average # Study responding # # responding # # responding # # Responding # # Responding groups animals spots spots animals spots spots animals spots spots animals spots spots animals tonsil 4/6 1325 221 0/6 0 0 3/6 195 33 6/6 8760 1460 6/6 1a tonsil 5/6 1405 234 0/6 0 0 1/6 560 93 6/6 4485 748 6/6 2a i.d. 7/7 1335 191 0/7 0 0 2/7 215 31 7/7 7320 1046 7/7 1a i.d. 4/7 755 108 0/7 0 0 1/7 55 8 7/7 2700 386 7/7 2a i.m. 7/7 925 132 1/7 60 9 3/7 180 26 7/7 5490 784 7/7 1a i.m. 4/7 250 36 0/7 0 0 0/7 0 0 6/7 2205 315 6/7 2a

Example 5

Construction and Pre-clinical Immunogenicity of a Recombinant MVA Vaccine Expressing Subtype D HIV-1 Env, Gag and Pol for Use in Uganda

[0203] Recombinant MVA vaccines have been successful in generating SIV and SHIV specific humoral and CD8 T cell responses in non-human primates and, alone or in combination with DNA vaccines, have provided protection in rhesus macaques from disease after pathogenic SHIV challenge. An overall program goal is to conduct clinical vaccine trials in Africa using vaccines that induce both neutralizing antibody and CD8 T cell specific responses and that are based upon representative full-length HIV-1 sequences isolated from the target vaccine cohorts. The predominant incident and prevalent HIV-1 subtype in Uganda is subtype D. Several R5 subtype D HIV-1 strains were selected and used to prepare recombinant MVA vaccines expressing env, gag, protease and RT. Initially, multiple env and gag/pol clones from 3 pure Ugandan subtype D isolates were selected. These sequences were separately cloned into pCR2.1 and tested for expression levels in-vitro by immunoprecipitation, and for envelope function as assessed by envelope-mediated fusion with CD4 and CCR5 or CXCR4 expressing cells. Based on these in-vitro analyses, several R5 subtype D env and gag/pol sequences were selected and cloned into MVA shuttle plasmids containing GFP and the modified H5 promoter for sequential cloning into deletions II and III, respectively, of MVA. The parent MVA used was a 1974 stock chosen to eliminate FDA concerns regarding potential BSE contamination. Several recombinant MVA (rMVA-UGD) expressing subtype D env and gag/pol were prepared in primary CEF cells using gamma-irradiated FBS from a USDA approved source and selected using GFP expression. These rMVA-UGD were further plaque-purified and amplified to titers sufficient for in-vivo immunogenicity studies. Pre-clinical humoral and cellular immunogenicity of the various rMVA-UGD were then assessed in BALB/c mice.

MVA Expressing Altered HIV-1 Envelope, Gag, and Polymerase Genes from Ugandan Clade D

[0204] This example describes the construction of 5 recombinant Modified Vaccinia Virus Ankara (MVA) viruses expressing envelope (env) and gagpol genes from HIV-1 clade D isolates from Uganda.

Sequences from Ugandan Clade D

[0205] Env and gagpol genes from three Ugandan clade D HIV-1 isolates were used:

TABLE-US-00010 HIV-1 Isolate name GenBank Accession # Lab designation (LVD) 99UGA03349 AF484518 B 99UGA07412 AF484477 C 98UG57128 AF484502 D

[0206] Env and gagpol genes were PCR amplified from Ugandan HIV-1 clade D isolates by short term co-cultures on normal human PBMC (Harris et al. 2002 AIDS Research and Human Retroviruses 18:1281) using the oligonucleotides shown in Table G and cloned into pCR2.1-TOPO (Invitrogen). (HIV-I infected individuals contain a population or quasi-species of related but distinct viruses. Upon co-culture, multiple viruses can emerge such that the sequences of individual amplified genes from the co-culture may differ from the sequence of the full genome.) The resulting amplified env genes have a C-terminal deletion of 115 amino acids that was previously shown to enhance expression and yield a more stable recombinant virus. The resulting gagpol genes have a deletion of the entire integrase and Rnase H portions of the genes. Within both the env and gagpol genes, several mutations were made by site-directed mutagenesis (Quik Change from Stratagene). In the env genes, silent mutations were made to eliminate two naturally occurring vaccinia virus early transcription termination signals (TTTTTNT, SEQ ID NO: 14) (Earl et. al 1990 J. Virol 64:2451). In the pol genes, two mutations were made in separate locations in the active site of reverse transcriptase to abolish enzymatic activity (Larder et. al 1987 Nature 327:716)(see Tables H(i) & (ii) for details on changes made to env and gagpol genes).

[0207] PCR2.1-TOPO plasmids containing the amplified genes were first characterized with respect to the orientation of the gene. Clones in which the gene was oriented properly with respect to the T7 promoter were chosen and protein expression was analyzed as previously described (Earl et al. 1997 J Virol 71:2674). Briefly, BS-C-1 cells were infected with vTF7-3 (Fuerst et al. 1986 PNAS USA 83:8122), a recombinant vaccinia virus expressing T7 RNA polymerase, transfected with a plasmid, and metabolically labeled. Cell lysates were subjected to immunoprecipitation with serum pooled from several HIV-1 clade D-infected individuals. Proteins were analyzed by SDS-polyacrylamide gel electrophoresis and visualized by autoradiography. One env and one gagpol DNA clone from each clade D isolate was chosen for construction of recombinant MVA viruses. DNA sequencing was performed to confirm the integrity of each gene. Sequences are presented in Appendix 1.

Cloning into Shuttle Plasmids

[0208] Two MVA shuttle plasmids, pLAS-1 and pLAS-2 (FIG. 18), were used for construction of recombinant MVA viruses. DNA sequences of both plasmids are presented in Appendix 2. In both plasmids, the foreign gene is driven by the modified H5 promoter. In addition, both plasmids contain a cassette with the gene for green fluorescent protein (GFP) driven by the vaccinia p11 promoter. This cassette is flanked by direct repeats that will readily recombine to eliminate GFP during virus propagation. Thus, GFP is used as a positive screening marker in early rounds of plaque purification, and as a negative screening marker in final recombinant virus selection (FIG. 22). MVA flanking sequences in pLAS-1 and pLAS-2 direct recombination into deletion III (Del III) and deletion II (Del II) of MVA, respectively.

[0209] Gagpol genes from 2 isolates (99UGA03349 and 99UGA07412) were cloned separately into pLAS-1 for insertion into Del III of MVA. The plasmids were named pLAS-1/UGD/Bgag and pLAS-1/UGD/Cgag (FIG. 19 & Table I). When the env gene is cloned into the NotI restriction site, a short open reading frame precedes the env open reading frame. This open reading frame is out of frame with env and terminates at approximately nucleotide 75 in the env gene.

[0210] Env genes from three isolates (99UGA03349, 99UGA07412, 98UG57128) were cloned separately into MVA shuttle plasmid pLAS-2, for insertion into Del II of MVA. Plasmids were named pLAS-2/UGD/Benv, pLAS-2/UGD/Cenv, and pLAS-2/UGD/Denv (FIG. 20 & Table I). When the env gene is cloned into the NotI restriction site, a short open reading frame precedes the env open reading frame. This open reading frame is out of frame with env and terminates at approximately nucleotide 75 in the env gene.

[0211] Foreign genes in pLAS-1 and pLAS-2 recombine into the vaccinia genome in the same orientation as the surrounding vaccinia genes. To test the effect of reversing the orientation of the env gene on the level of gene expression and stability of viruses, two of the env genes and their promoters were excised from pLAS-2 with restriction endonucleases BspE1 and EcoRV; sticky ends were filled in with Klenow enzyme; and the fragments were then reinserted into pLAS-2 the opposite orientation (FIG. 21). Plasmids were named pLAS-2/UGD/revCenv and pLAS-2/UGD/revDenv (Table I).

Recombinant MVA Construction

[0212] Parent MVA: MVA 1974/NIH Clone 1 was used as the parent for all recombinant viruses. It was derived from a stock of MVA at passage 572, prepared on Feb. 22, 1974 in the laboratory of A.Mayr in Germany. After receipt in the Laboratory of Viral Diseases, this stock was passaged a total of 6 times in chicken embryo fibroblast (CEF) cells, including 3 clonal purifications. Amplification was performed on the final, clonally purified virus. All CEF cells were derived from specific pathogen-free (SPAFAS) eggs.

[0213] Recombinant viruses expressing gagpol: CEF cells were infected with MVA 1974/NIH Clone 1 and transfected with either pLAS-1/UGD/Bgag or pLAS-1/UGD/Cgag for insertion into Del III. Two to three rounds of plaque purification were performed based on GFP expression. Further rounds of plaque purification were performed by picking plaques based on lack of GFP expression and concomitant positive gag expression as measured by immunostaining using a monoclonal antibody to HIV-1 p24 (183-H12-5C; obtained from the NIH AIDS Research and Reference Reagent Program) (FIG. 22). Recombinant gagpol-expressing viruses were amplified and characterized for gag expression by immunoprecipitation as described above. The two viruses were named MVA/UGD/Bgag and MVA/UGD/Cgag. These viruses were then used as the parent in making gagpol/env recombinant viruses (see below).

[0214] Recombinant viruses expressing gagpol and env: Recombinant viruses, MVA/UGD/Bgag and MVA/UGD/Cgag were used as parent viruses for insertion of env genes. Thus, CEF cells were infected with either MVA/UGD/Bgag or MVA/UGD/Cgag and subsequently transfected with one of the pLAS-2-env-containing plasmids described above (FIG. 23 & Table I). As above, the first two rounds of plaque purification were performed based on GFP expression. In subsequent rounds of purification, plaques were selected based on loss of GFP expression and positive gag and env expression as measured by immunostaining in duplicate cultures (FIG. 22). A total of 5 gagpol/env-expressing viruses (MVA/UGD-1 through -5) were amplified and characterized (Table J).

Characterization of Recombinant MVA/UGD Viruses

[0215] The 5 MVA/UGD viruses have been characterized for gene expression and function. Immunoprecipitation of env and gag proteins is shown in FIG. 24. BS-C-1 cells were infected with individual recombinant viruses at a multiplicity of infection of 10, metabolically labeled, and lysates were subjected to immunoprecipitation with a pool of sera from HIV-1 clade D infected individuals. Viruses expressing gagpol only (MVA/UGD/Bgag and Cgag) were included, as was non-recombinant MVA as a negative control and MVA/CMDR as a positive control. The latter virus expresses gagpol/env from a Clade E HIV-1 isolate. All viruses produced high levels of gag protein and efficient processing into p24 was observed. In addition, all env-expressing viruses produced high levels of env protein (gp160).

[0216] FIG. 25 demonstrates that the gag and env proteins produced by the MVA/UGD viruses are functional. Virus-like particles were obtained by centrifugation of the supernatant of infected cells through a sucrose cushion (Karacostas et al. 1993 Virology 193:661). Pelleted material was then separated by SDS-polyacrylamide gel electrophoresis and analyzed by autoradiography (Panel A). As seen, p55 and p24 gag proteins were found in the pellet indicating that virus-like particles were formed. Panel B shows results of an assay in which env-expressing cells (infected with MVA/UGD virus) were mixed with cells expressing CD4 and co-receptor (X4 or R5) (Nussbaum, Broder, & Berger 1994 J Virol 68:5411). Fusion was measured by beta-galactosidase activity in cell lysates. As shown, all five MVA/UGD viruses induced fusion with CD4/R5-expressing cells.

Immunogenicity of Recombinant MVA/UGD Viruses (Study 1)

[0217] Groups of Balb/c mice were immunized with individual MVA/UGD viruses, non-recombinant MVA (negative control), or MVA/CMDR (positive control--expressing clade E gagpol/env) at weeks 0 and 3. The dose was 10.sup.7 infectious units per immunization and the route was intraperitoneal. Humoral and cell mediated responses were measured and are shown in FIGS. 26-28.

[0218] Antibody responses after 2 immunizations are shown in FIG. 26. Reciprocal endpoint ELISA titers to p24 at various times after immunization are shown in Panel A. All UGD viruses elicited gag-specific antibodies after 2 immunizations. Env-specific responses are shown in Panel B. In this experiment, pooled sera from groups of mice were used to immunoprecipitate metabolically labeled, autologous gp160 proteins. As seen, sera from mice immunized with MVA/UGD-1, -3, and -4 reacted with gp160 (the other viruses were not tested in this assay). Reciprocal endpoint titers to gp140 env at various times after immunization are shown in Panel C. All UGD viruses elicited env-specific antibodies after 2 immunizations.

[0219] T cell responses were measured with several assays. First, gag and pol peptide-specific intracellular interferon gamma (IFN-.gamma.) responses were measured by intracellular cytokine staining. Splenocytes were collected 3 weeks after immunization, stimulated in-vitro for 7 days, and then cultured overnight with peptide-pulsed P815 cells. Brefeldin A was added to prevent secretion of INF-.gamma.. CD3 positive, CD8 positive, IFN-.gamma. positive cells were enumerated by flow cytometry. Analyses were performed after one and two immunizations. Both gag- and pol-specific responses were observed after two immunizations (FIG. 27) (samples from animals immunized with MVA/UGD-2, and 5 were not assayed). Second, gag- and pol-specific INF-.gamma.responses were measured by ELISPOT (FIG. 28 A & B). Briefly, splenocytes from immunized mice were mixed with gag or pol peptide-pulsed P815 cells in 96-well nitrocellulose plates coated with anti-IFN-.gamma.antibody. After overnight incubation, spots were visualized by sequential incubation with anti-IFN-.gamma. biotin antibody, straptavidin-HRP, and AEC substrate. Spots were enumerated using a Zeiss ELISPOT reader. Gag peptide-specific responses were found after one immunization and were boosted in most groups after the second immunization. Pol peptide-specific responses were found in several groups after two immunizations. Third, gag peptide-specific responses were measured by tetramer staining (H-2Kd gag LAI tetramer: AMQMLKETI, SEQ ID NO: 63) (FIG. 29). Splenocytes were stimulated in vitro with either gag peptide or MVA/CM240gagpol, a recombinant virus expressing a clade E gagpol. CD3 positive, CD8 positive, tetramer positive cells were enumerated by flow cytometry. Positive tetramer staining was observed with cells from several groups of mice.

Immunogenicity of Recombinant MVA/UGD Viruses (Study 2)

[0220] A second mouse immunogenicity study was performed to confirm the humoral and cellular immunogenicity of MVA/UGD-3 and MVA/UGD-4. BALB/c mice (10 per group) were administered intraperitoneal immunizations of 10.sup.7 infectious units of MVA at weeks 0 and 3. Five mice per group were sacrificed two weeks after the 1.sup.st and 2.sup.nd immunizations and spleens were removed for assessment of cellular immunogenicity. Sera were collected from each mouse at weeks -1, 0, 1, 2, 3, 4 and 5. Splenocytes and sera were pooled together by group. HIV gag-specific serum IgG responses were detected from all MVA/UGD-immunized groups after the 2.sup.nd immunization (FIG. 30). These gag-specific responses were predominantly of subclass IgG2a for both MVA/UGD-3 and MVA/UGD-4 demonstrating a Th1-type response (Table Q).

[0221] HIV-specific cell-mediated immunity was assessed by four separate assays: (1) intracellular IFN-.gamma. staining by flow cytometry (ICS), (2) IFN-.gamma. secretion by ELISPOT, (3) gag-peptide specific tetramer staining and (4) cytotoxic T lymphocyte (CTL) killing. (1) ICS: Splenocytes were collected two weeks after the 1.sup.st immunization, stimulated for 7 days with MVA-infected P815 cells and then incubated overnight with P815 cells pulsed with a gag or pol peptide previously shown to be target of CD8 T cells in BALB/c mice (Casimiro et al. 2002 J Virol 76:185). Brefeldin A was included in the overnight incubation to prevent cytokine secretion. Both HIV gag- and pol-specific responses were detected for the MVA/UGD-immunized, but not control immunized, mice as evidenced by the production of intracellular INF-.gamma. after peptide stimulation (FIG. 31A). For example, 8.5% and 5% of splenocyte lymphocytes from MVA/UGD-4-immunized mice were positive for gag and pol, respectively. Similar results were obtained for the MVA/UGD immunized mice after the 2.sup.nd immunization (FIG. 31B). (2) IFN-.gamma. ELISPOT: HIV gag-specific IFN-.gamma. responses were detected by ELISPOT without prior in-vitro stimulation after both the 1.sup.st (FIG. 32A) and 2.sup.nd immunization (FIG. 32B) with a boost detected after the 2.sup.nd immunization. HIV gag-specific responses were stronger than the pol-specific responses. HIV pol-specific responses were detectable after a 7-day in-vitro stimulation with P815 cells pulsed with pol peptide (FIG. 32C). (3) Tetramer staining: HIV gag peptide-specific responses were measured by tetramer staining (H-2Kd gag LAI tetramer: AMQMLKETI, SEQ ID NO: 63) (FIG. 33). Splenocytes were stained pre or post a 7-day in-vitro stimulation with P815 cells either pulsed with gag peptide or infected with MVA/CM240gag/pol, a recombinant virus expressing a subtype E gagpol. CD3 positive/CD8 positive/tetramer positive cells were enumerated by flow cytometry. Positive tetramer staining was observed for all of the MVA/UGD immunized groups both pre-IVS and post-IVS with MVA-infected P815 cells. (4) CTL: Splenocytes removed 2 weeks after the 1.sup.st immunization were stimulated in-vitro with MVA/CME (a recombinant MVA expressing env and gagpol from a subtype E HIV-1 isolate) infected P815 cells for 7 days and tested for the ability to lyse P815 cells pulsed with gag peptide. Splenocytes from all MVA/UGD, but not MVA control, immunized mice efficiently lysed peptide-pulsed P815 cells at E:T ratios of 20:1 (FIG. 34).

Example 6

Construction and Pre-Clinical Immunogenicity of a Recombinant MVA Vaccine Expressing Subtype A HIV-1 Env, Gag and Pol for Use in Kenya

[0222] As part of the overall program goal to conduct clinical vaccine trials in Africa, HIV-1 sequences from Kenya were selected. The predominant incident and prevalent HIV-1 subtype in Kenya is subtype A. Several R5 subtype A HIV-1 strains were selected and used to prepare recombinant MVA vaccines expressing env and gagpol (gag, protease and RT). One gagpol and two env clones from pure Kenyan subtype A isolates were selected.

TABLE-US-00011 HIV-1 Isolate name GenBank Accession # Publication 00KE-KER2008 AF457052 AIDS 16: 1809 (2002) 00KE-KNH1144 AF457066 '' 00KE-KNH1207 AF457068 ''

[0223] All the steps described in EXAMPLE 5 for construction of subtype D recombinant MVA viruses were followed for the selected subtype A clones. These include:

[0224] PCR amplification of truncated genes and cloning into pCR2.1.

[0225] Testing for in vitro expression.

[0226] Testing for env and gag function.

[0227] Site directed mutagenesis in env to eliminate vaccinia virus early transcription termination sites.

[0228] Site directed mutagenesis in pol to inactivate enzymatic activity.

[0229] Cloning into MVA shuttle plasmids pLAS-1 (gagpol) and pLAS-2 (env).

[0230] Recombination of gagpol into MVA 1974/NIH Clone 1 using primary CEF cells.

[0231] Recombination of env into the recombinant virus expressing gag to produce a single virus expressing both gagpol and env.

[0232] Recombination of env into MVA 1974/NIH Clone 1 to produce a virus expressing env only.

[0233] In addition to the mutations described in EXAMPLE 5 and utilized with the Ugandan subtype D env genes, two other mutations were introduced into one of the Kenyan clade A env genes (KNH1144). First, the tyr at position 717 was mutated using site directed mutagenesis to either ala or ser. This mutation has been shown to increase cell surface expression of env proteins (Rowell et. al. 1995 J Immunol 155:473; LaBranche et al. 1995 J Virol 69:5217). Second, the env protein was further truncated at the C-terminus just prior to the transmembrane domain yielding a soluble, secreted form of the protein. Published studies have shown that immunization with this form of the env protein results in enhanced antibody production as compared to membrane bound env.

[0234] The specifics of deletions and mutations in env and gagpol genes for KEA isolates are given in Table K. Plasmids and viruses expressing KEA env and gagpol genes are given in Table L and M.

Characterization of Recombinant MVA/KEA Viruses

[0235] The MVA/KEA viruses were characterized for gene expression and function. Immunoprecipitation of env and gag proteins is shown in FIG. 35. BSC-1 cells were infected with individual recombinant viruses at a multiplicity of infection of 10, metabolically labeled, and lysates were subjected to immunoprecipitation with a pool of antibodies including: monoclonal antibody T24 (env), monoclonal antibody 183-H12-5C (gag), and pooled HIV-1+ sera. MVA/UGD and WR/vEJW-1 were included as positive controls for env and gag expression, respectively. All MVA/KEA viruses express high levels of env and/or gag, as expected.

[0236] Virus-like particles were obtained by centrifugation of the supernatant of infected cells through a sucrose cushion (Karacostas et al. 1993 Virology 193:661). Gag p24 protein was found in the pelleted material indicating the formation of virus-like particles (FIG. 36).

[0237] A cell-cell fusion assay was used to assess the function of expressed, membrane bound env. In this assay env-expressing cells (infected with MVA/KEA virus) were mixed with cells expressing CD4 and co-receptor (X4 or R5) (Nussbaum, et al. 1994 J Virol 68:5411). Fusion was measured by beta-galactosidase activity in cell lysates. All viruses expressing membrane bound env induced fusion with CD4/R5-expressing cells (FIG. 37).

Immunogenicity of Env and Gag in Mice

[0238] The 5 recombinant MVA viruses expressing env, gag and pol from Kenyan subtype A HIV-1 isolates (MVA/KEA-1 through MVA/KEA-5), the 3 viruses expressing subtype A env alone (MVA/KEA-6 through MVA/KEA-8) and the MVA expressing subtype A gag/pol (MVA/KEA-9) were evaluated in an in-vivo mouse immunogenicity study designed to measure the humoral and cellular immunogenicity of these vaccines. BALB/c mice (10 per group) were administered intraperitoneal immunizations of 10.sup.7 infectious units of individual MVA/KEA viruses at weeks 0 and 3. Five mice per group were sacrificed two weeks after the 1.sup.st and 2.sup.nd immunizations and spleens were removed for assessment of cellular immunogenicity. Sera were collected from each mouse at weeks -1, 0, 1, 2, 3, 4 and 5. Splenocytes and sera were pooled together by group. HIV env-specific serum IgG responses were detected from all MVA/KEA-immunized groups after the 2.sup.nd immunization (FIG. 38). While env-specific responses were detected in all groups except for the control group, they were strongest in MVA/KEA-3, 4, 5, 6 and 8.

[0239] HIV-specific cell-mediated immunity was assessed by three assays: (1) intracellular IFN-.gamma. staining by flow cytometry (ICS), (2) IFN-.gamma. secretion by ELISPOT, and (3) gag-peptide specific tetramer staining. (1) ICS: Splenocytes were collected two weeks after the 2.sup.nd immunization, stimulated for 7 days with MVA-infected P815 cells and then incubated overnight with P815 cells pulsed with a gag or pol peptide previously shown to be target of CD8 T cells in BALB/c mice (Casimiro et al. 2002 J Virol 76:185). Brefeldin A was included during the overnight incubation to prevent cytokine secretion. HIV gag-specific responses were detected for each of the groups immunized with MVA/KEA viruses expressing env, gag and pol or gag and pol, but not control immunized, mice as evidenced by the production of intracellular IFN-.gamma. after peptide stimulation (FIG. 39). Splenocytes positive for HIV gag ranged from 7% to 22% for the MVA/KEA-immunized mice. (2) IFN-.gamma. ELISPOT: HIV gag-specific IFN-.gamma. responses from splenocytes without prior in-vitro stimulation were detected in all groups receiving MVA/KEA viruses expressing gag after the 1.sup.st immunization (FIG. 40). (3) Tetramer staining: HIV gag peptide-specific responses were measured by tetramer staining (H-2Kd gag LAI tetramer: AMQMLKETI, SEQ ID NO: 63) (FIG. 41). Splenocytes were stained pre-IVS. CD3 positive CD8 positive, tetramer positive cells were enumerated by flow cytometry. Similar to the above ICS and IFN-.gamma. ELISPOT results, positive tetramer staining was observed for all of the groups immunized with MVA-KEA expressing gag.

II. EXAMPLE 7

Construction of a Recombinant MVA Vaccine Expressing Subtype C HIV-1 Env, Gag, and Pol for Use in Tanzania

[0240] As part of the overall program goal to conduct clinical vaccine trials in Africa, HIV-1 sequences from Tanzania were selected. The predominant incident and prevalent HIV-1 subtype in Tanzania is subtype C. Several R5 subtype C HIV-1 strains were selected and used to prepare recombinant MVA vaccines expressing env, gag, protease and RT. One gagpol and one env clone from pure Tanzanian subtype C isolates were selected.

TABLE-US-00012 HIV-1 Isolate name GenBank Accession # Publication 00TZA-125 AY253304 AIDS Res & Hum Retrov, in press 00TZA-246 AY253308 AIDS Res & Hum Retrov, in press

[0241] Steps described in EXAMPLE 5 were followed for the selected subtype C clones. These include:

[0242] PCR amplification of truncated genes and cloning into pCR2.1.

[0243] Testing for in vitro expression.

[0244] Testing for env and gag function.

[0245] Site directed mutagenesis in env to eliminate vaccinia virus early transcription termination sites.

[0246] Site directed mutagenesis in pol to inactivate enzymatic activity.

[0247] Cloning into MVA shuttle plasmids pLAS-1 (gagpol) and pLAS-2 (env).

[0248] Recombination of gagpol into MVA 1974/NIH Clone 1 using primary CEF cells.

[0249] Recombination of env into the recombinant virus expressing gag to produce a single virus expressing both gagpol and env.

[0250] Recombination of env into MVA 1974/NIH Clone 1 to produce a virus expressing env only.

[0251] The specifics of deletions and mutations in env and gagpol genes for TZC isolates is given in Table N. Plasmids and viruses expressing TZC env and gagpol genes are given in Table O and P.

Characterization of Recombinant MVA/TZA Viruses

[0252] The KEA viruses were characterized for gene expression. Immunoprecipitation of env and gag proteins is shown in FIG. 42. BSC-1 cells were infected with individual recombinant viruses at a multiplicity of infection of 10, metabolically labeled, and lysates were subjected to immunoprecipitation with a pool of sera from HIV-1 infected individuals. MVA/CMDR and MVA were included as positive and negative controls, respectively. The MVA/KEA virus expresses high levels of env and gag.

[0253] Virus-like particles were obtained by centrifugation of the supernatant of infected cells through a sucrose cushion (Karacostas et al. 1993 Virology 193:661). Gag p24 protein was found in the pelleted material indicating the formation of virus-like particles (FIG. 43).

Example 8

Stability of Expression of HIV-1 Genes in Recombinant MVA Viruses

[0254] The stability of the inserted env and gagpol genes in recombinant viruses from each of the subtypes was tested after serial passage in CEF cells. Viruses were grown in CEF cells using a procedure that mimics that used for expansion of virus for large scale vaccine production, i.e. infection at low multiplicity, growth for 3 days at 37 C, harvesting of virus from cell lysates. After repeated passage, the virus stocks were tested for stability of the inserts using a 3-day immunostaining protocol. In this protocol, CEF cell monolayers were infected at a low multiplicity allowing for visualization of individual viral foci. After 3 days, the monolayers were fixed and then stained with monoclonal antibodies specific for either env or gag. Staining and non-staining foci were enumerated and results are shown in Table R. Very few non-staining foci were detected after 10-11 passages of each virus indicating that the inserted genes are stable after repeated passage in culture.

TABLE-US-00013 TABLE G Oligonucleotides used for PCR amplification of env and gagpol genes Clade D Ugandan HIV- envelope 1 isolates 5' primer 3' primer 99UGA03349 GCGCCCCGGGTCGACGCGGCCGCGCCATGAG GCGCCCCGGGCGGCCGCAGAAAAATTAGCCTTG AGTGAGGGGGATACAGAGGAAC (SEQ ID NO: CTCTCCACCTTCTTCTTCTATTCC (SEQ ID NO: 15) 16) 99UGA07412 GCGCCCCGGGTCGACGCGGCCGCGCCATGAG GCGCCCCGGGCGGCCGCAGAAAAATTAGCCTTG AGTGAGGGAGACAGTGAGGAATTAT (SEQ ID CTCTCCACCTTCTTCTTCTATTCC (SEQ ID NO: NO: 17) 18) 98UG57128 GCGCCCCGGGTCGACGCGGCCGCGCCATGAG GCGCCCCGGGCGGCCGCAGAAAAATTAGCCTTG AGTGAGGGGGATAGAGAGGAATTAT (SEQ ID CTCTCCACCTTCTCCTTC (SEQ ID NO: 20) NO: 19) Clade D Ugandan HIV- gagpol 1 isolates 5' primer 3' primer 99UGA03349 GCGCCCCGGGGCCATGGGTGCGAGAGCGTCA GCGCCCCGGGAGAAAAATTAGAAGGTTTCTGCT GTATTAAGC (SEQ ID NO: 21) CCTACTATGGGTTCCT (SEQ ID NO: 22) 99UGA07412 GCGCCCCGGGGCCATGGGTGCGAGAGCGTCA GCGCCCCGGGAGAAAAATTAGAAAGTTTCTGCT GTGTTAAGT (SEQ ID NO: 23) CCTACTATGGGTTCCT (SEQ ID NO: 24)

TABLE-US-00014 TABLE H Deletions/mutations in env genes envelope C-terminal truncation Clade D # of Ugandan amino acid last TTTTTNT silent mutations HIV-1 DNA sequence at C- # of last sequence at C- amino amino acid amino acid isolates terminus nucleotide terminus acid nucleotide # nucleotide # 99UGA0334 GGAATAGAAGAAGAAG 2178 GIEEEGGEQG 726 phe to phe 168 phe to phe 374 GTGGAGAGCAAGGC (SEQ ID NO: 26) T to C 504 T to C 1122 (SEQ ID NO: 25) 99UGA07412 GGAATAGAAGAAGAAG 2211 GIEEEGGEQG 737 phe to phe 173 phe to phe 384 GTGGAGAGCAAGGC (SEQ ID NO: 28) T to C 519 T to C 1152 (SEQ ID NO: 27) 98UG57128 GGAACAGAAGGAGAA 2262 GTEGEGGEQG 754 phe to phe 182 phe to phe 391 GGTGGAGAGCAAGGC (SEQ ID NO: 30) T to C 546 T to C 1173 (SEQ ID NO: 29) Deletions/mutations in gagpol genes gagpol C-terminal truncation Clade D # of pol Ugandan amino acid last RT active site mutations HIV-1 DNA sequence at C- # of last sequence at C- amino amino acid amino acid isolates terminus nucleotide terminus acid nucleotide # nucleotide # 99UGA03349 AAGGAACCCATAG 3065 KEPIVGAETF 1022 asp to glu 692 asp to his 767 TAGGAGCAGAAAC (SEQ ID NO: T to G 2075 GAT to CAC 2298 & 2300 CTTC (SEQ ID NO: 32) 31) 99UGA07412 AAGGAACCCATAG 3077 KEPIVGAETF 1026 asp to glu 696 asp to his 771 TAGGAGCAGAAAC (SEQ ID NO: T to G 2087 GAT to CAC 2310 & 2312 TTTC (SEQ ID NO: 34) 33)

TABLE-US-00015 TABLE I UGD Plasmids Direction Insertion in rela- parent site tion to Plasmid plasmid HIV isolate in MVA vaccinia pLAS-1/UGD/Bgag pLAS-1 99UGA03349 Del III same pLAS-1/UGD/Cgag pLAS-1 99UGA07412 Del III same pLAS-2/UGD/Benv pLAS-2 99UGA03349 Del II same pLAS-2/UGD/Cenv pLAS-2 99UGA07412 Del II same pLAS-2/UGD/Denv pLAS-2 98UG57128 Del II same pLAS-2/UGD/revCenv pLAS-2 99UGA07412 Del II reverse pLAS-2/UGD/revDenv pLAS-2 98UG57128 Del II reverse

TABLE-US-00016 TABLE J UGD Viruses gagpol Env Direction Direction in rela- in rela- gag/pol tion to env tion to Virus HIV isolate vaccinia HIV isolate vaccinia MVA/UGD-1 99UGA07412 same 99UGA07412 Same MVA/UGD-2 99UGA03349 same 98UG57128 Reverse MVA/UGD-3 99UGA07412 same 99UGA03349 Same MVA/UGD-4 99UGA03349 same 99UGA07412 Reverse MVA/UGD-5 99UGA03349 same 98UG57128 Same MVA/UGD- 99UGA03349 same -- -- Bgag MVA/UGD- 99UGA07412 same -- -- Cgag

TABLE-US-00017 TABLE K Deletions/mutations in env genes (KEA) envelope C-terminal truncation TTTTTNT Clade A amino acid # of last mutations Tyrosine mutations Kenyan HIV-1 DNA sequence at # of last sequence at amino amino acid amino acid isolates C-terminus nucleotide C-terminus acid nucleotide # nucleotide # 00KE-KNH1207 AGAATCGAAGG 2209 GRIEGEGGE 736 phe to phe 378 AGAAGGTGGAG QD T to C 1134 AGCAAGAC (SEQ ID (SEQ ID NO: 35) NO: 36) 00KE-KNH1144 AGAATCGAAGG 2239 GRIEGEGGE 746 phe to phe 389 AGAAGGTGGAG QD T to C 1167 AGCAAGAC (SEQ ID (SEQ ID NO: 37) NO: 38) 00KE-KNH1144 AGAATCGAAGG 2239 GRIEGEGGE 746 tyr to ala 717 AGAAGGTGGAG QD TAC to GCG 2149 to 2151 AGCAAGAC (SEQ ID (SEQ ID NO: 39) NO: 40) 00KE-KNH1144 AGAATCGAAGG 2239 GRIEGEGGE 746 tyr to ser 717 AGAAGGTGGAG QD TAC to AGC 2149 to 2151 AGCAAGAC (SEQ ID (SEQ ID NO: 41) NO: 42) 00KE-KNH1144 GACATATCAAAT 2064 DISNWLWY 688 TGGCTGTGGTAT IR ATAAGA (SEQ ID (SEQ ID NO: 43) NO: 44) Mutations/deletions in gagpol genes (KEA) gagpol C-terminal truncation # of pol last RT active site mutations amino #amino acid #amino acid # Clade A DNA # of last amino acid acid # in pol in pol Kenyan HIV-1 sequence at nucleotide sequence at in amino acid nucleotide # amino acid nucleotide # isolates C-terminus in gagpol C-terminus pol nucleotide in gagpol nucleotide in gagpol# 00KE-KER2008 GACCCCATAG 3074 KDPIAGA 595 asp to glu 265 asp to his 340 CAGGAGCAGA ETF (SEQ T to G 2084 GAT to CAC 2307 to 2309 GACTTTC ID NO: 46) (SEQ ID NO: 45)

TABLE-US-00018 TABLE L KEA Plasmids Direction Insertion in rela- parent site tion to Plasmid plasmid HIV isolate in MVA vaccinia pLAS-l/KER2008gag pLAS-1 00KE-KER2008 Del III same pLAS-2/KNH1144env pLAS-2 00KE-KNH1144 Del II same pLAS-2/KNH1207env pLAS-2 00KE-KNH1207 Del II same pLAS-2/KNH1144gp140 pLAS-2 00KE-KNH1144 Del II same pLAS-2/KNH1144(Y/A) pLAS-2 00KE-KNH1144 Del II same pLAS-2/KNH1144(Y/S) pLAS-2 00KE-KNH1144 Del II same

TABLE-US-00019 TABLE M KEA Viruses gag/pol env Direction Direction in rela- in rela- gag/pol tion to env tion to Virus HIV isolate vaccinia HIV isolate vaccinia MVA/KEA-1 00KE-KER2008 same 00KE-KNH1144 same MVA/KEA-2 00KE-KER2008 same 00KE-KNH1207 same MVA/KEA-3 00KE-KER2008 same 00KE-KNH1144 same (gp140) MVA/KEA-4 00KE-KER2008 same 00KE-KNH1144 same (Y/A) MVA/KEA-5 00KE-KER2008 same 00KE-KNH1144 same (Y/S) MVA/KEA-6 -- 00KE-KNH1144 same MVA/KEA-7 -- 00KE-KNH1207 same MVA/KEA-8 -- 00KE-KNH1144 same (gp140) MVA/KEA-9 00KE-KER2008 same --

TABLE-US-00020 TABLE N Mutations/deletions in env genes (TZC) envelope Clade C TTTTTNT Tanzanian C-terminal truncation silent mutations HIV-1 # of last amino acid sequence # of last amino acid isolates DNA sequence at C-terminus nucleotide at C-terminus amino acid nucleotide # 00TZA-125 GGAATCGAAGAAGAAGGTGGA 2223 GIEEEGGEQD 741 phe to phe 396 GAGCAAGAC (SEQ ID NO: 47) (SEQ ID NO: 48) T to C 1161 Mutations/deletions in gagpol (TZC) gagpol C-terminal truncation pol # of RT active site mutations Clade C amino acid last amino acid amino acid Tanzanian # of last sequence at amino amino # in pol # in pol HIV-1 DNA sequence at nucleotide C-terminus acid in acid nucleotide amino acid nucleotide isolates C-terminus of gagpol of pol pol nucleotide # in gagpol nucleotide # in gagpol 00TZA-246 AAAGAACCCATA 3083 KEPIVGAETF 601 asp to glu 271 asp to his 346 GTAGGAGCAGAA (SEQ ID NO: T to G 2093 GAT to CAC 2316 & 2318 ACTTTCT (SEQ ID 50) NO: 49)

TABLE-US-00021 TABLE O TZC Plasmids Direction Insertion in rela- parent site tion to Plasmid plasmid HIV isolate in MVA vaccinia pLAS-1/ pLAS-1 00TZA-246 Del III same TZC246gag pLAS-2/ pLAS-2 00TZA-125 Del II same TZC125env

TABLE-US-00022 TABLE P TZC Viruses gag/pol env Direction Direction in rela- in rela- gag/pol tion to env tion to Virus HIV isolate vaccinia HIV isolate vaccinia MVA/TZC-1 00TZA-246 same 00TZA-125 same MVA/TZC-2 00TZA-246 same -- MVA/TZC-3 -- 00TZA-125 same

TABLE-US-00023 TABLE Q HIV-1 gag IgG2a/IgG1 ratios Ratio Ratio Ratio Group Week 1 G2a/G1 Week 2 G2a/G1 Week 3 G2a/G1 MVA/CMDR G1 34,100 2.5 34,100 2.5 29,900 2 G2a 85,300 85,300 59,700 MVA control G1 <100 -- <100 -- <100 -- G2a <100 <100 <100 MVA/UGD-4 G1 34,100 1.6 25,600 1.6 19,200 1.8 G2a 55,500 41,600 35,200 MVA/UGD-3 G1 3,200 3.3 3,200 5.3 3,200 5.3 G2a 10,600 17,100 17,100 MVA/UGD-1 G1 9,600 0.7 4,800 1.3 4,800 1.3 G2a 6,400 6,400 6,400 MVA/UGD G1 4,800 6.2 3,200 9.3 2,400 12.4 gag G2a 29,900 29,900 29,900

TABLE-US-00024 TABLE R Stability of inserts in rMVA viruses Gag Env non- non- total staining total staining Virus foci # foci # % foci # foci # % After 10 270 3 1.1 270 3 1.1 passages MVA/UGD-4 After 11 passages MVA/KEA-1 360 2 0.56 310 0 0 MVA/KEA-2 230 3 1.3 280 0 0 MVA/KEA-3 340 0 0 340 0 0 MVA/KEA-4 210 0 0 210 0 0 MVA/KEA-5 220 1 0.45 210 0 0 After 11 600 5 0.83 800 1 0.13 passages MVA/TZC

TABLE-US-00025 APPENDIX 1 DNA sequences of gagpol and env genes from Ugandan HIV-1 clade D isolates: 99UGA03349 gagpol (SEQ ID NO: 51): ATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAAAATTAGATGAATGGGAAAAAATTCGGTTACG GCCAGGGGGAAACAAAAAATATAGATTAAAACATTTAGTATGGGCAAGCAGGGAGCTAGAACGAT TTGCACTTAATCCTGGTCTTTTAGAAACATCAGAAGGCTGTAGACAAATAATAGAACAGCTACAAC CATCTATTCAGACAGGATCAGAGGAACTTAAATCATTACATAATACAGTAGTAACCCTCTATTGTG TACATGAAAGGATAAAGGTAGCAGATACCAAGGAAGCTTTAGATAAGATAAAGGAAGAACAAACC AAAAGTAAGAAAAAAGCACAGCAAGCAACAGCTGACAGCAGCCAGGTCAGCCAAAATTATCCTAT AGTACAAAACCTACAGGGGCAAATGGTACACCAGTCCTTATCACCTAGGACTTTGAATGCATGGGT AAAAGTAATAGAAGAGAAGGCTTTCAGCCCAGAAGTAATACCCATGTTTTCAGCATTATCAGAAG GAGCCACCCCAACAGATTTAAACACCATGCTAAACACAGTGGGGGGACATCAAGCAGCCATGCAA ATGTTAAAAGAGACTATCAATGAGGAAGCTGCAGAATGGGATAGGCTACATCCAGTGCCTGCAGG GCCTGTTGCACCAGGCCAAATGAGAGAACCAAGGGGAAGTGATATAGCAGGAACTACCAGTACCC TTCAGGAACAAATAGGATGGATGACAAGCAATCCACCTATCCCAGTAGGAGAAATCTATAAAAGA TGGATAATCCTAGGATTAAATAAAATAGTAAGAATGTATAGCCCTGTCAGCATTTTGGACATAAGA CAAGGACCAAAGGAACCCTTTAGAGACTATGTAGATCGGTTCTATAAAACTCTACGAGCCGAGCA AGCTTCACAGGATGTAAAAAATTGGATGACTGAAACCTTGTTAGTCCAAAATGCGAATCCAGATTG TAAAACTATCTTAAAAGCATTGGGACCAGCGGCTACATTAGAAGAAATGATGACAGCATGTCAGG GAGTGGGGGGACCCAGTCATAAAGCAAGAGTTTTGGCTGAGGCAATGAGCCAAGCATCAAACACA AATGCTGTTATAATGATGCAGAGGGGCAATTTCAAGGGCAAGAAAATCATTAAGTGTTTCAACTGT GGCAAAGAAGGACACCTAGCAAAAAATTGTAGGGCTCCTAGGAAAAGAGGCTGTTGGAAATGTGG AAAGGAAGGGCACCAAATGAAAGATTGTAATGAAAGACAGGCTAATTTTTTAGGGAGAATTTGGC CTTCCCACAAGGGGAGGCCAGGGAATTTCCTTCAGAGCAGACCAGAGCCAACAGCCCCACCAGCA GAGAGCTTCGGGTTTGGGGAAGAGATAACACCCTCCCAGAAACAGGAGGGGAAAGAGGAGCTGT ATCCTTCAGCCTCCCTCAAATCACTCTTTGGCAACGACCCCTAGTCACAATAAAAATAGGGGGACA GCTAAAGGAAGCTCTATTAGATACAGGAGCAGATGATACAGTAGTAGAAGAAATGAATTTGCCAG GAAAATGGAAACCAAAAATGATAGGGGGAATTGGGGGCTTTATCAAAGTAAGACAGTATGATCAA ATACTCGTAGAAATCTATGGATATAAGGCTACAGGTACAGTATTAGTAGGACCTACACCTGTCAAC ATAATTGGAAGAAATTTGTTGACTCAGATTGGTTGCACTTTAAATTTTCCAATTAGTCCTATTGAAA CTGTACCAGTAAAATTAAAGTCAGGGATGGATGGTCCAAGAGTTAAACAATGGCCATTGACAGAA GAGAAAATAAAAGCACTAATAGAAATTTGTACAGAAATGGAAAAGGAAGGAAAACTTTCAAGAAT TGGACCTGAAAATCCATACAATACTCCAATATTTGCCATAAAGAAAAAAGACAGTACTAAGTGGA GAAAATTAGTAGATTTCAGAGAACTTAATAAGAGAACTCAAGATTTCTGGGAAGTTCAACTAGGA ATACCACATCCTGCAGGGCTAAAAAAGAAAAAATCAGTAACAGTACTGGAGGTGGGTGATGCATA TTTTTCAGTTCCCTTATATGAAGACTTTAGAAAATACACTGCATTCACCATACCTAGTATAAACAAT GAGACACCAGGAATTAGATATCAGTACAATGTGCTTCCACAAGGATGGAAAGGATCACCGGCAAT ATTCCAAAGTAGCATGACAAAAATTTTAGAACCTTTTAGAAAACAAAATCCAGAAGTGGTTATCTA CCAATACATGCACGATTTGTATGTAGGATCTGACTTAGAAATAGGGCAGCATAGAATAAAAATAG AGGAATTAAGGGGACACCTATTGAAGTGGGGATTTACCACACCAGACAAAAATCATCAGAAGGAA CCTCCATTTCTTTGGATGGGTTATGAACTCCATCCTGATAAATGGACAGTACAGCCTATAAAACTG CCAGAAAAAGAAAGCTGGACTGTCAATGATCTGCAGAAGTTAGTGGGGAAATTAAATTGGGCAAG TCAAATTTATTCAGGAATTAAAGTAAGACAATTATGCAAATGCCTTAGGGGAACCAAAGCACTGAC AGAAGTAGTACCACTGACAGAAGAAGCAGAATTAGAACTGGCAGAAAACAGGGAACTTCTAAAAG AAACAGTACATGGAGTGTATTATGACCCATCAAAAGACTTAATAGCAGAAATACAGAAACAAGGG CAAGACCAATGGACATATCAAATTTATCAAGAACAATATAAAAATTTGAAAACAGGAAAGTATGC AAAGAGGAGGAGTACCCACACTAATGATGTAAAACAATTAACAGAGGCAGTGCAAAAAATAGCCC AAGAATGTATAGTGATATGGGGAAAGACTCCTAAATTCAGACTACCCATACAAAAGGAAACATGG GAAACATGGTGGACAGAGTATTGGCAGGCCACCTGGATTCCTGAGTGGGAGTTTGTCAATACCCCT CCCTTGGTTAAATTATGGTACCAGTTAGAGAAGGAACCCATAGTAGGAGCAGAAACCTTCTAA 99UGA07412 gagpol (SEQ ID NO: 52): ATGGGTGCGAGAGCGTCAGTGTTAAGTGGGGGAAAATTAGATGAATGGGAAAGAATTCGGTTACG GCCAGGGGGAAACAAAAGATATAAACTAAAACATATAGTATGGGCAAGCAGGGAGCTAGAGCGA TTTGCACTTAATCCTGGCCTTTTAGAAACATCAGAAGGCTGTAAACAAATATTGGGACAGCTACAA CCAGCTATTCAGACAGGATCAGAAGAACTTAAATCATTATATAATACAGTAGCAACCCTCTATTGT GTACATGAGAGGCTAAAGGTAACAGACACCAAGGAAGCTTTAGACAAAATAGAGGAAGAACAAA CCAAAAGTAAGAAAAAAGCACAGCAAGCAACAGCTGACACAAAAAACAGCAGCCAGGTCAGCCA AAATTATCCTATAGTACAAAACCTACAGGGGCAAATGGTACACCAGGCTATATCACCTAGAACGTT GAACGCATGGGTAAAAGTAATAGAGGAGAAGGCTTTCAGCCCAGAAGTAATACCCATGTTTTCAG CATTATCAGAAGGAGCCACCCCACAAGATTTAAACACCATGCTAAACACAGTGGGGGGACATCAG GCAGCCATGCAGATGTTAAAAGAGACCATCAATGAGGAAGCTGCAGAATGGGATAGGTTACATCC AGTACATGCAGGGCCTATTGCACCAGGACAAATGAGAGAACCAACAGGAAGTGATATAGCAGGAA CTACTAGTACCCTTCAGGAACAAATAGGATGGATGACCAGCAATCCACCTATCCCAGTAGGAGAA ATCTATAAAAGATGGATAATCCTAGGATTAAATAAAATAGTAAGGATGTATAGCCCTGTCAGTATT TTGGACATAAAACAAGGGCCAAAGGAACCCTTTAGAGACTATGTAGATCGGTTCTATAAAACTCTA AGGGCCGAGCAAGCTTCACAGGAGGTAAAAGGTTGGATGACCGAAACCTTGTTGGTCCAAAATGC AAACCCAGATTGTAAAACCATCTTAAAAGCATTGGGACCAGCGGCTACATTAGAAGAAATGATGA CAGCATGTCAGGGAGTGGGGGGACCCGGTCATAAAGCAAGAGTTTTGGCTGAGGCAATGAGTCAA GTCTCAACAAATACTGCTATAATGATGCAGAGAGGCAATTTTAAGGGCCCAAAGAAAAGCATTAA GTGTTTTAACTGTGGCAAAGAAGGTCACACAGCAAAAAACTGTAGAGCTCCTAGGAAAAGGGGCT GTTGGAAATGTGGAAGGGAAGGACATCAAATGAAAGATTGCACTGAAAGACAGGCTAATTTTTTA GGGAAAATTTGGCCTTCCCACAAGGGAAGGCCAGGGAATTTCCTTCAGAACAGACCAGAGCCAAC AGCCCCACCAGAAGAAAGCTTCGGGTTTGGGGAAGAGATAACACCCTCTCAGAAACAGGAGAAGA AGGACAAGGAGCTGTATCCTGTAGCTTCCCTCAAATCACTCTTTGGCAACGACCCCTTGTCACAAT AAAGATAGGGGGACAGCTAAAGGAAGCTCTACTAGATACAGGAGCAGATGATACAGTATTAGAAG AAATAAATTTGCCAGGAAAATGGAAACCAAAAATGATAGGGGGAATTGGAGGCTTTATCAAAGTA AGACAGTATGAGCAAATACTTGTAGAAATCTGTGGACAGAAAGCTATAGGTACAGTATTAGTAGG GCCTACACCTGTCAACATAATTGGAAGAAATTTGTTGACTCAGATTGGTTGCACTTTAAATTTTCC AATTAGCCCTATTGAAACTGTACCAGTAAAATTAAAGCCAGGGATGGACGGTCCAAAAGTTAAAC AATGGCCATTGACAGAAGAAAAGGTAAAAGCACTAATAGAAATTTGTACAGAAATGGAAAAGGAA GGAAAAATTTCAAGAATTGGACCTGAAAATCCATACAATACTCCAATATTTGCCATAAAGAAAAA GGACAGTACTAAGTGGAGAAAATTAGTAGATTTCAGGGAACTTAATAAGAGAACTCAAGACTTCT GGGAAGTTCAACTAGGAATACCACATCCTGCGGGGCTAAAAAAGAAAAAATCAGTAACAGTACTG GAGGTGGGTGATGCATATTTTTCAGTTCCCTTATATGAAGATTTTAGAAAATATACTGCATTCACC ATACCTAGTATAAACAATGAAACACCAGGAATTAGATATCAGTACAATGTGCTTCCACAAGGGTG GAAAGGATCACCAGCAATATTCCAAAGTAGCATGACAAAAATCTTAGAACCTTTTAGAAAACAAA ATCCAGAAATGGTTATCTATCAATACATGCACGATTTGTATGTAGGATCTGACTTAGAAATAGGGC AGCATAGAATAAAAATAGAAGAATTAAGGGGACACCTGTTGAAGTGGGGATTTACCACACCAGAC AAAAAGCATCAGAAAGAACCTCCATTTCTTTGGATGGGTTATGAACTCCATCCTGATAAATGGACA GTACAGTCTATAAAACTGCCAGAACAAGAAAGCTGGACTGTCAATGATATACAGAAGTTAGTGGG AAAATTAAATTGGGCAAGCCAGATTTATCCAGGAATTAAGGTAAGACAATTATGCAAATGCATTA GGGGTACCAAAGCACTGACAGAAGTAGTACCACTGACAGAAGAAGCAGAATTAGAACTGGCAGAA AACAGGGAAATTCTAAGAGAACCAGTACATGGAGTGTATTATGACCCATCAAAAGACTTAATAGC AGAGATACAGAAACAAGGGCAAGACCAGTGGACATACCAAATTTATCAAGAACAATATAAAAATC TGAAAACAGGAAAGTATGCAAAAGTGAGGGGTACCCACACTAATGATGTAAAACAATTAACAGAG GCAGTACAAAAAATAACCCAAGAATGTATAGTGATATGGGGAAAGCCTCCTAAATTTAGACTACC CATACAAAAAGAAACATGGGAAATATGGTGGACAGAGTATTGGCAGGCCACCTGGATTCCTGAGT GGGAGTTTGTCAATACCCCTCCTTTAGTTAAATTATGGTACCAATTAGAGAAGGAACCCATAGTAG GAGCAGAAACTTTCTAA 99UGA03349 envelope (SEQ ID NO: 53): ATGAGAGTGAGGGGGATACAGAGGAACTATCAAAACTTGTGGAGATGGGGCACCTTGCTCCTTGG GATGTTGATGATATGTAAGGCTACAGAACAGTTGTGGGTCACAGTTTACTATGGGGTACCTGTGTG GAAAGAAGCAACCACTACTCTATTTTGTGCATCAGATGCTAAATCATATAAAGAAGAAGCACATA ATATCTGGGCTACACATGCCTGTGTACCAACAGACCCCAACCCACGAGAATTAATAATAGAAAATG TCACAGAAAACTTTAACATGTGGAAAAATAACATGGTGGAGCAGATGCATGAGGATATAATCAGT TTATGGGATCAAAGCCTAAAACCATGTGTAAAATTAACCCCACTCTGTGTCACTTTAAACTGCACT GAATGGAGGAAGAATAACACTATCAATGCCACCAGAATAGAAATGAAAAACTGCTCTTTCAATCT AACCACAGAAATAAGAGATAGGAAAAAGCAAGTGCATGCACTTTTCTATAAACTTGATGTGGTAC CAATAGATGATAATAATAGTACTAATACCAGCTATAGGTTAATAAATTGTAATACCTCAGCCATTA CACAGGCGTGTCCAAAGGTAACCTTTGAGCCAATTCCCATACATTATTGTGCCCCAGCTGGATATG CGATTCTAAAATGTAACAATAAGAAGTTCAATGGGACAGGTCCATGCGATAATGTCAGTACAGTA CAGTGTACACATGGAATTAGGCCAGTAGTATCCACTCAATTGTTGTTGAATGGCAGTCTAGCAGAA GAAGACATAATAATTAGATCTGAGAATCTCACAAATAATGCTAAAATCATAATAGTACAGCTTAAT GAGTCTGTAACAATTAATTGCACAAGGCCCTACAACAATACAAGAAGAGGTGTACATATAGGACC AGGGCGAGCATACTATACAACAGACATAATAGGAGATATAAGACAAGCACATTGTAACATTAGTG GAGCAGAATGGAATAAGACTTTACATCGGGTAGCTAAAAAATTAAGAGACCTATTTAAAAAGACA ACAATAATTTTTAAACCGTCCTCCGGAGGGGACCCAGAAATTACAACACACAGCTTTAATTGTAGA GGGGAATTCTTCTACTGCAATACAACAAGACTGTTTAATAGCATATGGGGAAATAATAGTACAGG AGTTGATGAGAGTATAACACTCCCATGCAGAATAAAACAAATTATAAACATGTGGCAGGGAGTAG GAAAAGCAATGTATGCCCCTCCCATTGAAGGACTAATCAGCTGCTCATCAAATATTACAGGATTAC TGTTGACAAGAGATGGTGGTGGAAGTAACAGTAGTCAGAATGAGACCTTCAGACCTGGAGGGGGA GATATGAGAGACAATTGGAGAAGTGAATTATATAAATATAAAGTAGTAAGAATTGAACCATTAGG TCTAGCACCCTCCAAGGCAAAAAGAAGAGTAGTAGAAAGAGAGAAAAGAGCAATAGGACTAGGA GCTATGTTCCTTGGGTTCTTGGGAGCAGCAGGAAGCACGATGGGCGCAGCGTCACTGACGCTGAC GGTACAGGCCAGACAGCTATTGTCTGGTATAGTGCAACAGCAAAACAATTTGCTGAAGGCTATAG AGGCGCAACAGCACCTGTTGCAACTCACAGTCTGGGGCGTTAAACAGCTCCAGGCAAGAGTCCTG

GCTGTGGAAAGCTACCTAAGGGATCAACAGCTCCTAGGAATTTGGGGTTGCTCTGGAAAACACATT TGCACCACCAATGTGCCCTGGAACTCTAGCTGGAGTAATAAAACTCTAAAATCAATTTGGGATAAC ATGACCTGGATGGAGTGGGAAAGAGAAATTGACAATTACACAGGGATAATATACAATTTACTTGA AGAATCGCAAACCCAGCAAGAAAGAAATGAACAAGACCTATTGAAATTGGACCAATGGGCAAGTT TGTGGAATTGGTTTAGCATAACAAAATGGCTGTGGTATATAAAAATATTTATAATGATAGTAGGAG GCTTGATAGGCTTAAGGATAGTTTTTGCTGTGCTTTCTATAGTAAATAGAGTTAGGCAGGGATATT CACCTCTGTCGTTTCAGACCCTCCTCCCAGCCCCGCGGGGACCCGACAGGCCCGAAGGAATAGAAG AAGAAGGTGGAGAGCAAGGCTAA 99UGA07412 envelope (SEQ IS NO: 54): ATGAGAGTGAGGGAGACAGTGAGGAATTATCAGCACTTGTGGAGATGGGGCATCATGCTCCTTGG GATGTTAATGATATGTAGTGCTGCAGACCAGCTGTGGGTCACAGTGTATTATGGGGTACCTGTGTG GAAAGAAGCAACCACTACTCTATTTTGTGCATCAGATGCTAAAGCACATAAAGCAGAGGCACATA ATATCTGGGCTACACATGCCTGTGTACCAACAGACCCCAATCCACGAGAAATAATACTAGGAAATG TCACAGAAAACTTTAACATGTGGAAGAATAACATGGTAGAGCAGATGCATGAGGATATAATCAGT TTATGGGATCAAAGTCTAAAACCATGTGTAAAATTAACCCCACTCTGTGTTACTTTAAACTGCACT ACATATTGGAATGGAACTTTACAGGGGAATGAAACTAAAGGGAAGAATAGAAGTGACATAATGAC ATGCTCTTTCAATATAACCACAGAAATAAGAGGTAGAAAGAAGCAAGAAACTGCACTTTTCTATAA ACTTGATGTGGTACCACTAGAGGATAAGGATAGTAATAAGACTACCAACTATAGCAGCTATAGATT AATAAATTGCAATACCTCAGTCGTGACACAGGCGTGTCCAAAAGTAACCTTTGAGCCAATTCCCAT ACATTATTGTGCCCCAGCTGGATTTGCGATTCTGAAATGTAATAATAAGACGTTCAATGGAACGGG TCCATGCAAAAATGTCAGCACAGTACAGTGTACACATGGAATTAGGCCAGTAGTGTCAACTCAACT GTTGTTGAATGGCAGTCTAGCAGAAGAAGAGATAATAATTAGATCTGAAAATATCACAAATAATG CAAAAACCATAATAGTACAGCTTAATGAGTCTGTAACAATTGATTGCATAAGGCCCAACAACAATA CAAGAAAAAGTATACGCATAGGACCAGGGCAAGCACTCTATACAACAGACATAATAGGGAATATA AGACAAGCACATTGTAATGTTAGTAAAGTAAAATGGGGAAGAATGTTAAAAAGGGTAGCTGAAAA ATTAAAAGACCTTCTTAACCAGACAAAGAACATAACTTTTGAACCATCCTCAGGAGGGGACCCAGA AATTACAACACACAGCTTTAATTGTGGAGGGGAATTCTTCTACTGCAATACATCAGGACTATTTAA TGGGAGTCTGCTTAATGAGCAGTTTAATGAGACATCAAATGATACTCTCACACTCCAATGCAGAAT AAAACAAATTATAAACATGTGGCAAGGAGTAGGAAAAGCAATGTATGCCCCTCCCATTGCAGGAC CAATCAGCTGTTCATCAAATATTACAGGACTATTGTTGACAAGAGATGGTGGTAATACTGGTAATG ATTCAGAGATCTTCAGACCTGGAGGGGGAGATATGAGAGACAATTGGAGAAGTGAATTATACAAA TATAAAGTAGTAAGAATTGAACCAATGGGTCTAGCACCCACCAGGGCAAAAAGAAGAGTGGTGGA AAGAGAAAAAAGAGCAATAGGACTGGGAGCTATGTTCCTTGGGTTCTTGGGAGCGGCAGGAAGCA CGATGGGCGCAGCGTCACTGACGCTGACGGTACAGGCCAGACAGTTATTGTCTGGTATAGTGCAA CAGCAAAACAATTTGCTGAGAGCTATAGAGGCGCAACAGCATCTGTTGCAACTCACAGTCTGGGG CATTAAACAGCTCCAGGCAAGAGTCCTGGCTATGGAAAGCTACCTAAAGGATCAACAGCTCCTAG GAATTTGGGGTTGCTCTGGAAAACACATTTGCACCACTACTGTGCCCTGGAACTCTACCTGGAGTA ATAGATCTGTAGAGGAGATTTGGAATAATATGACCTGGATGCAGTGGGAAAGAGAAATTGAGAAT TACACAGGTTTAATATACACCTTAATTGAAGAATCGCAAACCCAGCAAGAAAAGAATGAACAAGA ACTATTGCAATTGGATAAATGGGCAAGTTTGTGGAATTGGTTTAGTATAACAAAATGGCTGTGGTA TATAAAAATATTCATAATGATAGTAGGAGGCTTAATAGGTTTAAGAATAGTTTTTGCTGTGCTTTC TTTAGTAAATAGAGTTAGGCAGGGATATTCACCTCTGTCTTTTCAGACCCTCCTCCCAGCCCCGAG GGGACCCGACAGGCCCGAAGGAATAGAAGAAGAAGGTGGAGAGCAAGGCTAA 98UG57128 envelope (SEQ ID NO: 55): ATGAGAGTGAGGGGGATAGAGAGGAATTATCAGCACTTATGGTGGAGATGGGGCACCATGCTCCT TGGGATATTGATGATATGTAGTGCTGCAGAACAATTGTGGGTCACAGTTTATTATGGGGTACCTGT GTGGAAAGAAGCAACCACTACTCTATTTTGTGCATCAGATGCTAAAGCATATAAAGCAGAGGCAC ACAATATCTGGGCTACACATGCCTGTGTACCAACAGACCCCAACCCACAAGAAATAGTACTAGAA AATGTCACAGAAAACTTTAACATGTGGAAAAATAGCATGGTGGAGCAGATGCATGAGGATGTAAT CAGTTTATGGGATCAAAGCCTAAAACCATGTGTAAAATTAACCCCACTCTGTGTCACTTTAAACTG CACTAATGCCACTGCCACTAATGCCACTGCCACTAGTCAAAATAGCACTGATGGTAGTAATAAAAC TGTTAACACAGACACAGGAATGAAAAACTGCTCTTTCAATGTAACCACAGATCTAAAAGATAAGA AGAGGCAAGACTATGCACTTTTCTATAAACTTGATGTGGTACGAATAGATGATAAGAATACCAATG GTACTAATACCAACTATAGATTAATAAATTGTAATACCTCAGCCATTACACAAGCGTGTCCAAAGA TAACCTTTGAGCCAATTCCCATACATTATTGTGCCCCAGCTGGATATGCGATTCTAAAATGTAATA ATAAGACATTCAATGGGACGGGTCCATGCAAAAACGTCAGCACAGTACAGTGTACACATGGGATT AGGCCAGTAGTGTCAACTCAACTGTTGTTGAATGGCAGTCTAGCAGAGGAAGAGATAGTAATTAG ATCTGAAAACCTCACAAATAATGCTAAAATTATAATAGTACAGCTTAATGAAGCTGTAACAATTAA TTGCACAAGACCCTCCAACAATACAAGACGAAGTGTACATATAGGACCAGGGCAAGCAATCTATT CAACAGGACAAATAATAGGAGATATAAGAAAAGCACATTGTAATATTAGTAGAAAAGAATGGAAT AGCACCTTACAACAGGTAACTAAAAAATTAGGAAGCCTGTTTAACACAACAAAAATAATTTTTAAT GCATCCTCGGGAGGGGACCCAGAAATTACAACACACAGCTTTAATTGTAACGGGGAATTCTTCTAC TGCAATACAGCAGGACTGTTTAATAGTACATGGAACAGGACAAATAGTGAATGGATAAATAGTAA ATGGACAAATAAGACAGAAGATGTAAATATCACACTTCAATGCAGAATAAAACAAATTATAAACA TGTGGCAGGGAGTAGGAAAAGCAATGTATGCCCCTCCCGTTAGTGGAATAATCCGATGTTCATCAA ATATTACAGGACTGTTGCTGACAAGAGATGGTGGTGGTGCAGATAATAATAGGCAGAATGAGACC TTCAGACCTGGGGGAGGAGATATGAGAGACAATTGGAGAAGTGAATTATACAAATATAAAGTAGT AAGAATTGAACCACTAGGTATAGCACCCACCAAGGCAAGGAGAAGAGTGGTGGAAAGAGAAAAA AGAGCAATAGGACTGGGAGCCTTGTTCCTTGGGTTCTTGGGAACAGCAGGAAGCACGATGGGCGC AGTGTCAATGACGCTGACGGTACAGGCCAGACAAGTATTGTCTGGTATAGTGCAACAGCAAAACA ATCTGCTGAGGGCTATAGAGGCGCAACAGCATCTGTTGCAACTCACAGTCTGGGGCATTAAACAGC TCCAGGCAAGAATCCTGGCTGTGGAAAGCTACCTAAAGGATCAACAGCTCCTAGGAATTTGGGGT TGCTCTGGAAAACACATTTGCACCACTAATGTGCCCTGGAACTCTAGCTGGAGTAATAAATCTCTA AATTATATTTGGAATAACATGACCTGGATGGAGTGGGAAAAGGAAATTGACAATTACACAGAATT AATATACAGCTTAATTGAAGTATCGCAAATCCAGCAAGAAAAGAATGAACAAGAACTATTGAAAT TGGACAGTTGGGCAAGTTTGTGGAATTGGTTTAGCATAACAAAATGGCTGTGGTATATAAAAATAT TCATAATGATAGTAGGAGGCTTGATAGGCTTAAGAATAGTTTTTGCTGTGCTTTCTTTAGTAAATA GAGTTAGGCAGGGATACTCACCTCTGTCGTTTCAGACCCTTATCCCAGCCTCGAGGGGACCCGACA GGCCCGAAGGAACAGAAGGAGAAGGTGGAGAGCAAGGCTAA

TABLE-US-00026 APPENDIX 2 DNA sequences of MVA shuttle plasmids: pLAS-1 (SEQ ID NO: 56): GAATTCGTTGGTGGTCGCCATGGATGGTGTTATTGTATACTGTCTAAACGCGTTAGTAAAACATGG CGAGGAAATAAATCATATAAAAAATGATTTCATGATTAAACCATGTTGTGAAAAAGTCAAGAACG TTCACATTGGCGGACAATCTAAAAACAATACAGTGATTGCAGATTTGCCATATATGGATAATGCGG TATCCGATGTATGCAATTCACTGTATAAAAAGAATGTATCAAGAATATCCAGATTTGCTAATTTGA TAAAGATAGATGACGATGACAAGACTCCTACTGGTGTATATAATTATTTTAAACCTAAAGATGCCA TTCCTGTTATTATATCCATAGGAAAGGATAGAGATGTTTGTGAACTATTAATCTCATCTGATAAAG CGTGTGCGTGTATAGAGTTAAATTCATATAAAGTAGCCATTCTTCCCATGGATGTTTCCTTTTTTAC CAAAGGAAATGCATCATTGATTATTCTCCTGTTTGATTTCTCTATCGATGCGGCACCTCTCTTAAGA AGTGTAACCGATAATAATGTTATTATATCTAGACACCAGCGTCTACATGACGAGCTTCCGAGTTCC AATTGGTTCAAGTTTTACATAAGTATAAAGTCCGACTATTGTTCTATATTATATATGGTTGTTGATG GATCTGTGATGCATGCAATAGCTGATAATAGAACTTACGCAAATATTAGCAAAAATATATTAGACA ATACTACAATTAACGATGAGTGTAGATGCTGTTATTTTGAACCACAGATTAGGATTCTTGATAGAG ATGAGATGCTCAATGGATCATCGTGTGATATGAACAGACATTGTATTATGATGAATTTACCTGATG TAGGCGAATTTGGATCTAGTATGTTGGGGAAATATGAACCTGACATGATTAAGATTGCTCTTTCGG TGGCTGGGTACCAGGCGCGCCTTTCATTTTGTTTTTTTCTATGCTATAAATGGTGAGCAAGGGCGA GGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGT TCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGC ACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGC TTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTAC GTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTT CGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACA TCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAG AAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGC CGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCT GAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGT TCGTGACCGCCGCCGGGATCACTCTCGGCATGCACGAGCTGTACAAGTAAGAGCTCGGTTGTTGAT GGATCTGTGATGCATGCAATAGCTGATAATAGAACTTACGCAAATATTAGCAAAAATATATTAGAC AATACTACAATTAACGATGAGTGTAGATGCTGTTATTTTGAACCACAGATTAGGATTCTTGATAGA GATGAGATGCTCAATGGATCATCGTGTGATATGAACAGACATTGTATTATGATGAATTTACCTGAT GTAGGCGAATTTGGATCTAGTATGTTGGGGAAATATGAACCTGACATGATTAAGATTGCTCTTTCG GTGGCTGGCGGCCCGCTCGAGGCCGCTGGTACCCAACCTAAAAATTGAAAATAAATACAAAGGTT CTTGAGGGTTGTGTTAAATTGAAAGCGAGAAATAATCATAAATAAGCCCGGGGATCCTCTAGAGT CGACCTGCAGGGAAAGTTTTATAGGTAGTTGATAGAACAAAATACATAATTTTGTAAAAATAAATC ACTTTTTATACTAATATGACACGATTACCAATACTTTTGTTACTAATATCATTAGTATACGCTACAC CTTTTCCTCAGACATCTAAAAAAATAGGTGATGATGCAACTTTATCATGTAATCGAAATAATACAA ATGACTACGTTGTTATGAGTGCTTGGTATAAGGAGCCCAATTCCATTATTCTTTTAGCTGCTAAAA GCGACGTCTTGTATTTTGATAATTATACCAAGGATAAAATATCTTACGACTCTCCATACGATGATCT AGTTACAACTATCACAATTAAATCATTGACTGCTAGAGATGCCGGTACTTATGTATGTGCATTCTTT ATGACATCGCCTACAAATGACACTGATAAAGTAGATTATGAAGAATACTCCACAGAGTTGATTGTA AATACAGATAGTGAATCGACTATAGACATAATACTATCTGGATCTACACATTCACCAGAAACTAGT TAAGCTTGTCTCCCTATAGTGAGTCGTATTAGAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGT GTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTG GGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCGAGTCGGG AAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTG GGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTAT CAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATG TGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCGATAG GCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAG GACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGC CGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTG TAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCA GCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATC GCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGT TCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGA AGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGC GGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTG ATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGA TTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGT ATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATC TGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGC TTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCA GCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCAT CCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGT TGTTGGCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGT TCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGT CCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCAT AATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCAT TCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGC CACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGA TCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTT TACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAA GGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGG GTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGC GCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATA AAAATAGGCGTATCACGAGGCCCTTTCGTCTCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGAC ACATGCAGCTCCCGGAGACGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGT CAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGCGGCATCAGAGCAGAT TGTACTGAGAGTGCACCATATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCA TCAGGCGCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGC TATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTT TCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAATTGGATTTAGGTGACACTATA pLAS-2 (SEQ ID NO: 57): CCTCCTGAAAAACTGGAATTTAATACACCATTTGTGTTCATCATCAGACATGATATTACTGGATTTA TATTGTTTATGGGTAAGGTAGAATCTCCTTAATATGGGTACGGTGTAAGGAATCATTATTTTATTT ATATTGATGGGTACGTGAAATCTGAATTTTCTTAATAAATATTATTTTTATTAAATGTGTATATGTT GTTTTGCGATAGCCATGTATCTACTAATCAGATCTATTAGAGATATTATTAATTCTGGTGCAATATG ACAAAAATTATACACTAATTAGCGTCTCGTTTCAGACATGGATCTGTCACGAATTAATACTTGGAA GTCTAAGCAGCTGAAAAGCTTTCTCTCTAGCAAAGATGCATTTAAGGCGGATGTCCATGGACATAG TGCCTTGTATTATGCAATAGCTGATAATAACGTGCGTCTAGTATGTACGTTGTTGAACGCTGGAGC ATTGAAAAATCTTCTAGAGAATGAATTTCCATTACATCAGGCAGCCACATTGGAAGATACCAAAAT AGTAAAGATTTTGCTATTCAGTGGACTGGATGATTCGAGGTACCAGGCGCGCCCTTTCATTTTGTT TTTTTCTATGCTATAAATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGT CGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCA CCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCC TCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACG ACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACG GCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTG AAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAG CCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCC ACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGAC GGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAAC GAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGCAC GAGCTGTACAAGTAAGAGCTCGCTTTCTCTCTAGCAAAGATGCATTTAAGGCGGATGTCCATGGAC ATAGTGCCTTGTATTATGCAATAGCTGATAATAACGTGCGTCTAGTATGTACGTTGTTGAACGCTG GAGCATTGAAAAATCTTCTAGAGAATGAATTTCCATTACATCAGGCAGCCACATTGGAAGATACCA AAATAGTAAAGATTTTGCTATTCAGTGGACTGGATGATTCTCCGGATGGTACCCAACCTAAAAATT GAAAATAAATACAAAGGTTCTTGAGGGTTGTGTTAAATTGAAAGCGAGAAATAATCATAAATAAG CCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCTCGAGCGGCCGCCAGTGTGATGGATATCTGC AGAATTCGGCTTGGGGGGCTGCAGGTGGATGCGATCATGACGTCCTCTGCAATGGATAACAATGA ACCTAAAGTACTAGAAATGGTATATGATGCTACAATTTTACCCGAAGGTAGTAGCATGGATTGTAT AAACAGACACATCAATATGTGTATACAACGCACCTATAGTTCTAGTATAATTGCCATATTGGATAG ATTCCTAATGATGAACAAGGATGAACTAAATAATACACAGTGTCATATAATTAAAGAATTTATGAC ATACGAACAAATGGCGATTGACCATTATGGAGAATATGTAAACGCTATTCTATATCAAATTCGTAA AAGACCTAATCAACATCACACCATTAATCTGTTTAAAAAAATAAAAAGAACCCGGTATGACACTTT TAAAGTGGATCCCGTAGAATTCGTAAAAAAAGTTATCGGATTTGTATCTATCTTGAACAAATATAA ACCGGTTTATAGTTACGTCCTGTACGAGAACGTCCTGTACGATGAGTTCAAATGTTTCATTGACTA CGTGGAAACTAAGTATTTCTAAAATTAATGATGCATTAATTTTTGTATTGATTCTCAATCCTAAAAA CTAAAATATGAATAAGTATTAAACATAGCGGTGTACTAATTGATTTAACATAAAAAATAGTTGTTA ACTAATCATGAGGACTCTACTTATTAGATATATTCTTTGGAGAAATGACAACGATCAAACCGGGCA TGCAAGCTTGTCTCCCTATAGTGAGTCGTATTAGAGCTTGGCGTAATCATGGTCATAGCTGTTTCCT GTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCC TGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCGAGTCG GGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTAT

TGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGT ATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACA TGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCGAT AGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGAC AGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCT GCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGC TGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTT CAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTA TCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGA GTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCT GAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTA GCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTT TGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGA GATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAA GTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGA TCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGG GCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTAT CAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCC ATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAAC GTTGTTGGCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCG GTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCG GTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGC ATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTC ATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGC GCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAG GATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCT TTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAAT AAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCA GGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCC GCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTA TAAAAATAGGCGTATCACGAGGCCCTTTCGTCTCGCGCGTTTCGGTGATGACGGTGAAAACCTCTG ACACATGCAGCTCCCGGAGACGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCC GTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGCGGCATCAGAGCAG ATTGTACTGAGAGTGCACCATATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCG CATCAGGCGCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTC GCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGT TTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAATTGGATTTAGGTGACACTATAGAATACG AATTC

TABLE-US-00027 APPENDIX 3 DNA sequences of gagpol and env genes from Kenyan HIV-1 clade A isolates: KER2008 gagpol (SEQ ID NO: 58): ATGGGTGCGAGAGCGTCAGTATTAAGTGGGGGAAAATTAGATGCATGGGAGAAAATTCGGTTAAG GCCAGGGGGAAAGAAAAAATATAGACTGAAACACTTAGTATGGGCAAGCAGGGAGCTGGAAAAA TTCGTACTTAACCCTAGCCTTTTAGAAACTTCAGAAGGATGTCAGCAAATAATGAACCAAATACAA CCAGCTCTTCAGACAGGAACAGAAGAACTTAGATCATTATTTAATGCAGTAGCAACCCTCTATTGT GTACATCAACGGATAGAGGTAAAAGACACCAAGGAAGCTTTAGATAAAGTAGAGGAAATACAAAA CAAGAGCAAGCAAAAGACACAACAGGCAGCAGCTGATACAGGAAACAACAGCAAGGTCAGCCAT AATTACCCTATAGTGCAAAATGCACAAGGGCAAATGATACATCAGTCCTTATCACCAAGGACTTTG AATGCATGGGTAAAGGTAATAGAAGAAAGGGGTTTCAGCCCAGAAGTAATACCCATGTTCTCAGC ATTATCAGAAGGAGCCATCCCACAAGATTTAAATATGATGCTGAACATAGTGGGGGGACACCAGG CAGCTATGCAAATGTTAAAAGAAACTATCAATGAGGAAGCTGCAGAATGGGACAGGTTACATCCA GCACAGGCAGGGCCTATTCCACCAGGCCAGATAAGAGACCCAAGGGGAAGTGACATAGCAGGAAC TACTAGTACCCCTCAGGAACAAATAACATGGATGACAAACAACCCACCTATCCCAGTGGGAGACA TCTATAAAAGATGGATAATCCTAGGATTAAATAAAATAGTAAGAATGTATAGCCCTGTTAGCATTT TAGATATAAAACAGGGGCCAAAAGAACCCTTCAGAGACTATGTAGATAGGTTCTTTAAAGTTCTCA GAGCCGAACAAGCTACACAGGAAGTAAAAGGCTGGATGACAGAGACCCTGCTGGTTCAAAATGCA AATCCAGATTGTAAGTCCATTTTAAGAGCATTAGGAACAGGGGCTACATTAGAAGAAATGATGAC AGCATGTCAGGGAGTGGGAGGACCCGGCCATAAAGCAAGGGTTTTAGCTGAGGCAATGAGTCAAG CACAACAGGCAAATGTAATGATGCAGAGGGGCAGCTTTAAGGGGCAGAAAAGAATTAAGTGCTTC AACTGTGGCAAAGAGGGACACCTAGCCAGAAATTGCAGAGCCCCTAGGAAAAAAGGCTGTTGGAA GTGTGGGAAAGAAGGACACCAAATGAAAGATTGCAATGAGAGACAGGCTAATTTTTTAGGGAAAA TTTGGCCTTCCAGCAAGGGGAGGCCAGGAAATTTTCCCCAGAGCAGACCGGAGCCAACAGCCCCA CCAGCAGAGATCTTTGGGATGGGGGAAGAGATAACCTCCCCTCCGAAGCAGGAGCAGAAAGAGAG GGAACAAACCCCACCCTTTGTTTCCCTCAAATCACTCTTTGGCAACGACCCGTTGTCACAGTAAAA GTAGGAGGAGAAATGAGAGAAGCTCTATTAGATACAGGAGCAGATGATACAGTATTAGAAGATAT AAATTTGCCAGGAAAATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAGGTAAAAC AATATGATCAGGTATCTATAGAAATTTGTGGAAAAAAGGCTATAGGTACGGTATTAGTAGGACCT ACACCTGTCAACATAATTGGAAGAAATATGTTGACTCAGATTGGTTGTACCTTAAATTTTCCAATT AGTCCTATTGAGACTGTACCAGTAACATTAAAGCCAGGAATGGATGGCCCAAGGGTTAAACAATG GCCATTGACAGAAGAGAAAATAAAAGCATTGACAGAAATTTGTAAAGAGATGGAAAAGGAAGGA AAAATTTCAAAAATTGGGCCTGAAAATCCATACAATACTCCAATATTTGCAATAAAGAAAAAAGAT AGCACTAAATGGAGGAAATTAGTAGATTTCAGAGAGCTCAATAAAAGAACACAAGACTTTTGGGA AGTTCAATTAGGGATACCGCATCCAGCGGGCCTAAAAAAGAAAAAATCAGTAACAGTACTAGAGG TGGGGGATGCATATTTTTCAGTTCCCCTAGATAAAAACTTTAGAAAGTATACTGCATTTACCATAC CTAGTTTAAATAATGAAACACCAGGAATCAGGTATCAGTACAATGTGCTTCCACAAGGATGGAAA GGATCACCAGCAATATTCCAGTGCAGTATGACAAAAATCTTAGAGCCCTTTAGATCAAAAAATCCA GAAATAATTATCTATCAATACATGCACGACTTGTATGTAGGATCAGATTTAGAAATAGGGCAGCAT AGAGCAAAAATAGAAGAATTAAGAGCTCATCTACTGAGCTGGGGATTTACTACACCAGACAAAAA GCATCAGAAAGAACCTCCATTCCTTTGGATGGGATATGAGCTCCATCCTGACAAGTGGACAGTCCA GCCTATAGAGCTGCCAGAAAAAGAAAGCTGGACTGTCAATGATATACAGAAATTAGTGGGAAAAC TAAATTGGGCCAGTCAAATTTATCCAGGAATTAAAGTAAAGCAATTGTGTAAACTTCTCAGGGGAG CCAAAGCCCTAACAGATATAGTAACACTGACTGAGGAAGCAGAATTAGAATTAGCAGAGAACAGG GAGATTCTAAAAGACCCTGTGCATGGGGTATATTATGACCCATCAAAAGACTTAATAGCAGAAAT ACAGAAACAAGGGCAAGACCAATGGACATACCAAATTTATCAGGAGCCATTTAAAAATCTAAAAA CAGGAAAATATGCAAGAAAAAGGTCTGCTCACACTAATGATGTAAGACAATTAGCAGAAGTAGTG CAGAAAGTGGTCATGGAAAGCATAGTAATATGGGGAAAGACTCCTAAATTTAAACTACCCATACA AAAAGAGACATGGGAGACATGGTGGATGGACTATTGGCAAGCTACCTGGATTCCTGAGTGGGAGT TTGTCAATACCCCTCCCCTAGTAAAATTATGGTACCAGTTAGAGAAAGACCCCATAGCAGGAGCAG AGACTTTCTAA KNH1144 envelope (SEQ ID NO: 59): ATGAGAGTGATGGGGATACAGATGAATTGTCAGCACTTATTGAGATGGGGAACTATGATCTTGGG ATTGATAATAATCTGTAATGCTGTAAACAGCAACTTGTGGGTTACTGTCTATTATGGGGTACCTGT GTGGAAAGATGCAGAGACCACCTTATTTTGTGCATCAGATGCTAAAGCATATAAAACAGAAAAGC ATAATGTCTGGGCTACACATGCCTGTGTGCCCACAGACCCCAACCCACAAGAAATACCTTTGGAAA ATGTGACAGAAGAGTTTAACATGTGGAAAAATAAAATGGTAGAACAAATGCATACAGATATAATC AGTCTATGGGACCAAAGCCTACAGCCATGTGTAAAGTTAACCCCTCTCTGCATTACTTTAAACTGT ACAGATGTTACTAATGTTACAGATGTTAGTGGTACGAGGGGCAACATCACCATCATGAAAGAGAT GGAGGGAGAAATAAAAAACTGTTCTTTCAATATGACCACAGAAATAAGGGATAAGAAACAGAAAG TATATTCACTCTTTTATAGACTTGATGTAGTACCAATAAATCAGGGTAATAGTAGTAGTAAAAACA GTAGTGAGTATAGATTAATAAGTTGTAATACCTCAGCCATTACACAAGCTTGCCCAAAGGTAAGCT TTGAGCCAATTCCCATACATTATTGTGCCCCAGCTGGTTTTGCGATCCTGAAGTGTAGGGATAAGG AGTTCAATGGAACAGGGGAATGCAAGAATGTCAGCACAGTCCAATGCACACATGGAATCAAGCCA GTAGTATCAACTCAACTACTGTTAAATGGCAGTCTAGCAGAAGAAAAGGTAAAAATCAGAACTGA AAATATCACAAACAATGCCAAAACTATAGTAGTACAACTTGTCGAGCCTGTGAGAATTAATTGTAC TAGACCTAATAACAATACAAGAGAGAGTGTGCGTATAGGGCCAGGACAAGCATTCTTTGCAACAG GTGACATAATAGGGGATATAAGACAAGCACATTGTAATGTCAGTAGATCACAATGGAATAAGACT TTACAACAGGTAGCTGAACAATTAAGAGAACACTTTAAAAACAAAACAATAATATTTAACAGTTCC TCAGGAGGGGATCTAGAAATCACAACACATAGTTTCAATTGTGGAGGAGAATTCTTCTATTGTAAT ACATCAGGTCTGTTCAATAGCACCTGGAATACCAGCATGTCAGGGTCAAGTAACACGGAGACAAA TGACACTATAACTCTCCAATGCAGAATAAAGCAAATTATAAATATGTGGCAGAGAACAGGACAAG CAATATATGCCCCTCCCATCCAGGGAGTGATAAGGTGTGAATCAAACATCACAGGACTACTGTTAA CAAGAGATGGTGGGGAGGAGAAGAACAGTACAAATGAAATCTTCAGACCTGGAGGAGGAGATAT GAGGGACAACTGGAGAAGTGAATTATATAAGTATAAAGTAGTAAAAATTGAACCACTAGGAGTAG CACCCACCAGGGCAAGGAGAAGAGTGGTGGGAAGAGAAAAAAGAGCAGTTGGAATAGGAGCTGT TTTCCTTGGGTTCTTAGGAGCAGCAGGAAGCACTATGGGCGCGGCGTCAATAACGCTGACGGTACA GGCCAGGCAATTATTGTCTGGCATAGTGCAGCAGCAGAGCAATTTGCTGAGGGCTATAGAGGCTC AACAACATATGTTGAAACTCACGGTCTGGGGCATTAAACAGCTCCAGGCAAGAGTCCTTGCTGTGG AAAGATACCTAAGGGATCAACAGCTCCTAGGAATTTGGGGCTGCTCTGGAAAACTCATCTGCACCA CTAATGTGCCCTGGAACTCTAGTTGGAGTAATAAATCTCAGGATGAAATATGGAACAACATGACCT GGCTGCAATGGGATAAAGAAATTAGCAATTACATAAACCTAATATATAGTCTAATTGAAGAATCG CAAAACCAGCAGGAAAAGAATGAACAAGACTTATTGGCATTGGGCAAGTGGGCAAATCTGTGGAC TTGGTTTGACATATCAAATTGGCTGTGGTATATAAGAATATTTATAATGATAGTAGGAGGCTTAAT AGGATTAAGAATAGTTTTTGCTGTGCTTGCTGTAATAAAGAGAGTTAGGCAGGGATACTCACCTGT GTCATTTCAGATCCATGCCCCAAACCCAGGGGGTCTCGACAGGCCCGGAAGAATCGAAGGAGAAG GTGGAGAGCAAGACTAA KNH1207 envelope (SEQ ID NO: 60) ATGAGAGTGATGGGGATACAGATGAATTGTCAAAGCTTGTGGAGATGGGGAACTATGATCTTGGG AATGTTAATGATTTGTAGTGTTGCAGGAAACTTGTGGGTTACTGTCTACTATGGGGTACCTGTGTG GAAAGAGGCAGACACCACCTTATTTTGTGTATCAAATGCTAGAGCATATGATACAGAAGTGCATA ATGTCTGGGCTACACATGCCTGTGTACCTACGGACCCCAACCCACAAGAAATAGATTTGGAGAATG TGACAGAAGAGTTTAACATGTGGAAAAATAACATGGTAGAGCAAATGCATACAGATATAATTAGT CTATGGGACCAAAGCCTAAAACCATGTGTAAAGTTAACCCCTCTCTGCGTTACTTTAGATTGTGGC TATAATGTAACCAACTTGAATTTCACCAGTAACATGAAAGGAGACATAACAAACTGCTCTTACAAT ATGACCACAGAAATAAGGGATAGGAAACAGAAAGTGTATTCACTTTTCTATAGGCTTGATATAGTA CCAATTAATGAAGAAAAGAATAATAGCAGGGAGACTAGTCCGTATAGATTAATAAATTGTAATAC CTCAGCCATTACACAAGCTTGTCCTAAGGTATCTTTTGAACCAATTCCCATACATTATTGTGCCCCA GCCGGTTTTGCGATTCTAAAATGTAAGGATGCAGAGTTCAATGGAACAGGGCCATGCAAGAATGT CAGCACAGTACAATGTACACATGGAATCAGGCCAGTAATATCAACTCAACTGCTGTTAAATGGCAG TTTAGCAGAGAATGGGACAAAGATTAGATCTGAAAATATCACAAACAATGCCAAAACCATAATAG TACAACTTAACGAGACCGTACAAATTAATTGTACCAGACCTAGCAACAATACAAGAAAAAGTGTA CGTATAGGACCAGGACAAGCATTCTATACAACAGGTGATATAACAGGGGATATAAGACAAGCATA TTGTAATGTCAGTAGACAAGAATGGGAACAAGCATTAAAAGGGGTAGTTATACAATTAAGAAAAC ACTTTAACAAAACAATAATCTTTAACAGTTCCTCAGGAGGGGATTTAGAAATTACAACACATAGTT TTAATTGTGGAGGAGAATTCTTCTATTGTGATACATCAGGCCTGTTTAATAGCACCTGGAACACGA ACACCACCGAGCCAAACAACACAACGTCAAATGGCACTATCATTCTCCAATGCAGAATAAAGCAA ATTATAAATCTGTGGCAGAGAACCGGACAAGCAATGTATGCCCCTCCCATCCAAGGGGTAATAAG GTGTGATTCCAACATTACAGGACTACTATTAACAAGAGATGGTGGAGTAGTTGATAGTATAAATGA AACCGAAATCTTCAGACCTGGAGGAGGAGATATGAGGGACAATTGGAGAAGTGAATTATATAAGT ATAAAGTAGTAAAAATTGAACCACTAGGAGTAGCACCCACCGGGGCAAAGAGAAGAGTGGTGGA GAGAGAAAAAAGAGCAGTTGGCATAGGAGCTGTATTCATTGGGTTCTTAGGAGCAGCAGGAAGCA CTATGGGCGCGGCGTCAATAACGCTGACGGTACAGGCCAGACAATTATTGTCTGGCATAGTGCAA CAGCAAAGCAATTTGCTGAGGGCTATAGAGGCTCAACAGCATATGTTGAGACTCACGGTCTGGGG CATTAAGCAGCTCCAGGCAAGAGTCCTGGCTGTGGAAAGATACCTAAGGGATCAACAGCTCCTAG GAATTTGGGGCTGCTCTGGAAAACTCATCTGCACCACTAATGTGCCCTGGAACTCTAGTTGGAGTA ATAAATCTCAGGAGGAAATATGGGGTAACATGACCTGGCTGCAATGGGATAAAGAAATTAGCAAT TACACACAAACAATATATAACCTACTTGAAGAATCGCAGAACCAGCAGGAAAAGAATGAACAAGA CTTATTGGCATTGGACAAGTGGGCAAATTTGCGGACTTGGTTTGACATAACAAATTGGCTGTGGTA TATAAAAATGTTTATAATGATAGTAGGAGGCTTAATAGGATTAAGAATAGTTTTTGCTGTGCTTTC TGTAATAAATAGAGTTAGGCAGGGATACTCACCTCTGTCGTTTCAGACCCATATCCCGAGCCCAAG GGGTCTCGATAGGCCCGGAAGAATCGAAGGAGAAGGTGGAGAGCAAGACTAA

TABLE-US-00028 APPENDIX 4 DNA sequences of gagpol and env genes from Tanzanian HIV-1 clade C isolates: TZA-246 gagpol (SEQ ID NO: 61): ATGGGTGCGAGAGCGTCAATATTAAGAGGGGGAAAATTAGATCGATGGGAAAAAATTAGGTTAAG GCCAGGGGGAAAGAAAAGCTATATGATAAAACACTTAGTATGGGCAAGCAGGGAGCTGGAAAGA TTTGCACTTAACCCTAGCCTTTTAGAGACATCAGAAGGCTGTAAACAAATAATGAAACAGCTACAA CCAGCTCTTCAGACAGGAACAGAAGAACTTAAATCATTATTCAATGCAATAGCAGTTCTCTATTGT GTACATGAAGGGATAGATGTAAAAGACACCAAGGAAGCCTTAGACAAGATAGAGGAAGAACAGA ACAAAAGTCAGCAAAAAACACAGCAGGCAGAAGCAGCTGGCGGAAAAGTCAGTCAAAATTATCCT ATAGTGCAGAATCTCCAAGGACAAATGGTACACCAGTCCATATCACCTAGAACTTTGAATGCATGG GTAAAAGTAATAGAGGAAAAGGCTTTTAGCCCAGAGGTAATACCCATGTTTACAGCATTATCAGA AGGAGCCACCCCACAAGATTTAAACACCATGCTAAATACAGTGGGGGGACATCAAGCAGCCATGC AAATGTTAAAAGATACCATCAATGAGGAGGCTGCAGAATGGGATAGGATACATCCAGTACATGCA GGGCCTACTGCACCAGGCCAAATGAGAGAACCAAGGGGAAGTGACATAGCAGGAACTACTAGTAC CCTTCAGGAACAAATAGCATGGATGACAGCTAACCCACCTGTTCCAGTGGGAGAAATCTACAAAA GATGGATAATACTGGGTTTAAATAAAATAGTAAGAATGTATAGCCCTGTCAGCATTTTGGACATAA AACAAGGGCCAAAGGAACCCTTTAGAGACTATGTAGATCGGTTCTTTAAAACTTTAAGAGCTGAAC AGGCTACACAAGATGTAAAAAATTGGATGACAGACACCTTGTTGGTCCAAAATGCGAACCCAGAT TGTAAGACCATTTTAAGAGCATTAGGACCAGGGGCTACATTAGAAGAAATGATGACAGCATGTCA AGGAGTGGGAGGACCTGGCCACAAAGCCAGAGTTTTGGCTGAGGCAATGAGCCAAGCAAACACAC ACATAATGATGCAGAGAAGCAATTTTAAAGGCTCTAAAAGAATTGTTAAATGTTTCAACTGTGGCA AGGAAGGGCACATAGCCAGAAATTGCAGGGCCCCTAGGAAAAAGGGCTGTTGGAAATGTGGAAA GGAAGGACACCAAATGAAAGACTGTACTGAGAGGCAGGCTAATTTTTTAGGGAAAATTTGGCCTT CCCACAAGGGGAGGCCAGGGAATTTCCTTCAGAACAGGTCAGAGCCAACAGCCCCACCAACGAAC AGGCCAGAGCCAACAGCTCCACCAGCAGAGAGCTTCAGGTTCGAGGAAGCAACCCCTGCTCCGAA GCAGGAGCTGAAAGACAGGGAACCTTTAATTTCCCTCAAATCACTCTTTGGCAGCGACCCCTCGTC TCAATAAAAGTAGGGGGTCAAACAAAGGAGGCTCTTTTAGACACAGGAGCAGATGATACAGTATT AGAAGAAATAAATTTGCCAGGAAAATGGAAACCCAAAATGATAGGAGGAATTGGAGGTTTTATCA AAGTAAGACAGTATGATCAGATAGTTATAGAAATTTGTGGAAAAAAGGCTATAGGTACAGTATTA GTAGGACCCACCCCTGTCAACATAATTGGAAGAAATATGTTGACTCAGCTTGGATGCACACTAAAT TTTCCAATTAGTCCTATTGAAACTGTACCAGTAAAGTTAAAGCCAGGAATGGATGGCCCAAAGGTT AAACAATGGCCATTGACAGAAGAAAAAATAAAGGCATTAACAGCAATTTGTGAAGAAATGGAGAA GGAAGGAAAAATTACAAAGATTGGGCCTGAAAATCCATATAACACTCCAGTATTTGCCATAAAAA AGAAGGACAGTACTAAGTGGAGAAAATTAGTAGATTTCAGGGAACGCAATAAAAGAACTCAAGAT TTTTGGGAAGTTCAATTAGGCATACCACACCCAGCAGGGTTAAAAAAGAAAAAATCAGTGACAGT ACTGGAGGTGGGGGATGCATACTTCTCAGTTCCTTTAGATGAAGGCTTCAGGAAATATACTGCATT CACCATACCTAGTATAAACAATGAAACACCAGGAATTAGATATCAATACAATGTGCTTCCACAGGG ATGGAAAGGATCACCAGCAATATTCCAGAGTAGCATGACAAAAATCTTAGAGCCCTTTAGAGCAC AAAATCCAGAAATAGTCATCTATCAATATATGCACGACTTATATGTAGGATCTGACTTAGAAATAG GGCAACATAGAGCAAAAATAGAGGAATTAAGAGAACATCTATTAAAGTGGGGATTTACCACACCA GACAAGAAACATCAGAAAGAACCCCCATTTCTTTGGATGGGGTATGAACTCCATCCTGACAAATGG ACAGTACAGCCTATAACGCTGCCAGAAAAGGAAAGCTGGACTGTCAATGATATACAGAAGTTAGT GGGAAAACTAAACTGGGCAAGTCAGATTTATGCAGGGATTAAAGTAAGGCAACTGTATAAACTCC TTAGGGGAGCCAAAGCACTAACAGACATAGTACCACTAACTGAAGAGGCAGAATTAGAATTGGCA GAGAACAGGGAAATTCTAAAAGAACCAGTACATGGGGTATATTATGACCCATCAAAAGACTTGAT AGCTGAAATACAGAAACAAGGGCATGACCAATGGACATATCAAATTTACCAAGAACCATTCAAAA ATCTGAAAACAGGGAAGTATGCAAAAATGAGGAGTGCCCACACTAATGATGTAAAACAATTAACA GAGGCAGTGCAAAAAATAGCCATGGAAGGCATAGTAATATGGGGAAAGACTCCTAAATTTAGACT GCCCATTCAAAAGGAAACATGGGAAACATGGTGGACAGACTATTGGCAAGCCACCTGGATTCCTG AGTGGGAGTTTGTTAATACCCCTCCCCTAGTAAAATTATGGTACCAGCTGGAGAAAGAACCCATAG TAGGAGCAGAAACTTTC TZA-125 envelope (SEQ ID NO: 62): ATGAGAGTGAAGGGGATATTGAGGAATTGGCAACACAGGTGGATATGGATCTGGATCATCTTAGG CTTTTGGATGCTAATGATTTGTAATGGGAACTTGTGGGTCACTGTCTACTATGGGGTACCTGTGTG GAAAGAAGCAAATGCTCCTCTATTTTGTGCATCAGATGCTAAAGCATATGAGAAAGAAGTGCATA ATGTCTGGGCTACACATGCCTGTGTACCCACAGACCCCAACCCACAAGAACTAGACTTGGTAAATG TAACAGAAAATTTTAACATGTGGAAAAATGACATGGTAGATCAGATGCATGAGGATATAATCAGT TTATGGGATGAAAGCCTAAAGCCATGTGTAAAGTTGACCCCACTCTGTGTCACTCTAAACTGTACT AATGCTAATATTAATAATGATACTGTTGCTAATAGTGGTACTTTTAAGGTTGATAATAGTAGTAAT GTAGTAAAAAATTGCTCTTTCAATATAACCACAGAAATAAGAGATAAGAAGAAAAAAGAATATTC ATTGTTTTATAGACTTGATATATTACCACTTGATAACTCTAGTGAGTCTAAGAACTATAGTGAGTAT GTATTAATAAATTGTAATGCCTCAACCGTAACACAAGCCTGTCCAAAGGTCTCTTTTGACCCAATT CCTATACATTATTGTGCTCCAGCTGGTTATGCGATTCTAAAGTGTAAAGATAAGACATTCAATGGA ACAGGACCATGCAGTAATGTCAGCACAGTACTATGTACACATGGAATTAAGCCAGTGGTATCAACT CAATTACTGTTAAATGGTAGCCTAGCAGAAGAAGGGATAGTAATTAGATCTGAAAATCTGACAAA CAATGCCAAAACAACAATAGTACAGCTTAATGAACCTGTAGAAATTATGTGTGTAAGACCCGGCA ATAATACAAGAAAAAGTGTGAGGATAGGACCAGGACAAACATTCTATGCAACAGGAGGCATAATA GGAGATATAAGACAAGCACATTGTAACATTAGTAGAAGTGATTGGAATAAAACTTTACAAGAGGT AGGTAAAAAATTACGAGAATACTTCCACAATAAAACAATAAGATTTAAACCGGCGGTCGTAGGAG GGGACCTGGAAATTACAACACATAGCTTTAATTGTAGAGGAGAATTCTTCTATTGCAATACATCAG AACTGTTTACAGGTGAATATAATGGTACTGAGTATAAGAATACTTCAAATTCAAATCCTAACATCA CACTCCCATGTAGAATAAAACAATTTGTAAACATGTGGCAGAGGGTAGGACGAGCAATGTATGCC CCTCCTATTGAAGGAAACATAACATGTAACTCAAGTATCACAGGACTACTATTGACATGGGATGGA GGAAACAATACTAATGGCACAGAGACATTTAGACCTGGAGGAGGAGATATGAGGGATAATTGGAG AAGTGAATTATATAAATATAAAGTGGTAGAAATTAAACCATTAGGAATAGCACCCACTAGTGCAA AAAGGAGAGTGGTGGAGAGAGAGAAAAGAGCAGTGGGAATAGGAGCTTTGTTCCTTGGGTTCTTA GGAGCAGCAGGAAGCACTATGGGCGCAGCATCAATAACGCTGACGGTACAGGCCAGACAATTATT GTCTGGTATAGTGCAACAGCAAAGCAATTTGCTGAGGGCCATAGAGGCGCAACAGCATATGTTGC AACTCACAGTCTGGGGCATTAAACAGCTCCAGACAAGAGTCCTGGCTATAGAAAGATACCTAAAG GATCAACAGCTCCTAGGGATTTGGGGCTGCTCTGGAAAACTCATCTGCACCACTGCTGTGCCTTGG AACACTAGTTGGAGTAATAAAACTGAACAGGACATTTGGAATCTAACCTGGATGCAGTGGGATAG AGAAGTTAGTAATTACACAGACATAATATACAGGTTGCTTGAAGACTCACAAATCCAGCAGGAAA ACAATGAAAAGGATTTACTAGCATTGGACAGTTGGAAAAATCTGTGGAATTGGTTTGACATAACA AATTGGTTGTGGTATATAAGAACATTCATAATGATAGTAGGAGGCTTGATAGGCTTAAGGATAATT TTTGCTGTAATTTCTATAGTGAATAGAGTTAGGCAGGGATACTCACCTTTGTCATTTCAGACCCTTA CCCCAACCCCGAGGGGACCAGAAAGGCTCGGAGGAATCGAAGAAGAAGGTGGAGAGCAAGACTAA

[0255] While the present invention has been described in some detail for purposes of clarity and understanding, one skilled in the art will appreciate that various changes in form and detail can be made without departing from the true scope of the invention. All figures, tables, and appendices, as well as patents, applications, and publications, referenced to above, are hereby incorporated by reference.

Sequence CWU 1

1

63112225DNAArtificial SequencePlasmid pLW-48 1gaattcgttg gtggtcgcca tggatggtgt tattgtatac tgtctaaacg cgttagtaaa 60acatggcgag gaaataaatc atataaaaaa tgatttcatg attaaaccat gttgtgaaaa 120agtcaagaac gttcacattg gcggacaatc taaaaacaat acagtgattg cagatttgcc 180atatatggat aatgcggtat ccgatgtatg caattcactg tataaaaaga atgtatcaag 240aatatccaga tttgctaatt tgataaagat agatgacgat gacaagactc ctactggtgt 300atataattat tttaaaccta aagatgccat tcctgttatt atatccatag gaaaggatag 360agatgtttgt gaactattaa tctcatctga taaagcgtgt gcgtgtatag agttaaattc 420atataaagta gccattcttc ccatggatgt ttcctttttt accaaaggaa atgcatcatt 480gattattctc ctgtttgatt tctctatcga tgcggcacct ctcttaagaa gtgtaaccga 540taataatgtt attatatcta gacaccagcg tctacatgac gagcttccga gttccaattg 600gttcaagttt tacataagta taaagtccga ctattgttct atattatata tggttgttga 660tggatctgtg atgcatgcaa tagctgataa tagaacttac gcaaatatta gcaaaaatat 720attagacaat actacaatta acgatgagtg tagatgctgt tattttgaac cacagattag 780gattcttgat agagatgaga tgctcaatgg atcatcgtgt gatatgaaca gacattgtat 840tatgatgaat ttacctgatg taggcgaatt tggatctagt atgttgggga aatatgaacc 900tgacatgatt aagattgctc tttcggtggc tgggtaccag gcgcgccttt cattttgttt 960ttttctatgc tataaatggt acgtcctgta gaaaccccaa cccgtgaaat caaaaaactc 1020gacggcctgt gggcattcag tctggatcgc gaaaactgtg gaattgatca gcgttggtgg 1080gaaagcgcgt tacaagaaag ccgggcaatt gctgtgccag gcagttttaa cgatcagttc 1140gccgatgcag atattcgtaa ttatgcgggc aacgtctggt atcagcgcga agtctttata 1200ccgaaaggtt gggcaggcca gcgtatcgtg ctgcgtttcg atgcggtcac tcattacggc 1260aaagtgtggg tcaataatca ggaagtgatg gagcatcagg gcggctatac gccatttgaa 1320gccgatgtca cgccgtatgt tattgccggg aaaagtgtac gtatcaccgt ttgtgtgaac 1380aacgaactga actggcagac tatcccgccg ggaatggtga ttaccgacga aaacggcaag 1440aaaaagcagt cttacttcca tgatttcttt aactatgccg gaatccatcg cagcgtaatg 1500ctctacacca cgccgaacac ctgggtggac gatatcaccg tggtgacgca tgtcgcgcaa 1560gactgtaacc acgcgtctgt tgactggcag gtggtggcca atggtgatgt cagcgttgaa 1620ctgcgtgatg cggatcaaca ggtggttgca actggacaag gcactagcgg gactttgcaa 1680gtggtgaatc cgcacctctg gcaaccgggt gaaggttatc tctatgaact gtgcgtcaca 1740gccaaaagcc agacagagtg tgatatctac ccgcttcgcg tcggcatccg gtcagtggca 1800gtgaagggcg aacagttcct gattaaccac aaaccgttct actttactgg ctttggtcgt 1860catgaagatg cggacttgcg tggcaaagga ttcgataacg tgctgatggt gcacgaccac 1920gcattaatgg actggattgg ggccaactcc taccgtacct cgcattaccc ttacgctgaa 1980gagatgctcg actgggcaga tgaacatggc atcgtggtga ttgatgaaac tgctgctgtc 2040ggctttaacc tctctttagg cattggtttc gaagcgggca acaagccgaa agaactgtac 2100agcgaagagg cagtcaacgg ggaaactcag caagcgcact tacaggcgat taaagagctg 2160atagcgcgtg acaaaaacca cccaagcgtg gtgatgtgga gtattgccaa cgaaccggat 2220acccgtccgc aaggtgcacg ggaatatttc gcgccactgg cggaagcaac gcgtaaactc 2280gacccgacgc gtccgatcac ctgcgtcaat gtaatgttct gcgacgctca caccgatacc 2340atcagcgatc tctttgatgt gctgtgcctg aaccgttatt acggatggta tgtccaaagc 2400ggcgatttgg aaacggcaga gaaggtactg gaaaaagaac ttctggcctg gcaggagaaa 2460ctgcatcagc cgattatcat caccgaatac ggcgtggata cgttagccgg gctgcactca 2520atgtacaccg acatgtggag tgaagagtat cagtgtgcat ggctggatat gtatcaccgc 2580gtctttgatc gcgtcagcgc cgtcgtcggt gaacaggtat ggaatttcgc cgattttgcg 2640acctcgcaag gcatattgcg cgttggcggt aacaagaaag ggatcttcac tcgcgaccgc 2700aaaccgaagt cggcggcttt tctgctgcaa aaacgctgga ctggcatgaa cttcggtgaa 2760aaaccgcagc agggaggcaa acaatgagag ctcggttgtt gatggatctg tgatgcatgc 2820aatagctgat aatagaactt acgcaaatat tagcaaaaat atattagaca atactacaat 2880taacgatgag tgtagatgct gttattttga accacagatt aggattcttg atagagatga 2940gatgctcaat ggatcatcgt gtgatatgaa cagacattgt attatgatga atttacctga 3000tgtaggcgaa tttggatcta gtatgttggg gaaatatgaa cctgacatga ttaagattgc 3060tctttcggtg gctggcggcc cgctcgagta aaaaatgaaa aaatattcta atttatagga 3120cggttttgat tttctttttt tctatgctat aaataataaa tagcggccgc accatgaaag 3180tgaaggggat caggaagaat tatcagcact tgtggaaatg gggcatcatg ctccttggga 3240tgttgatgat ctgtagtgct gtagaaaatt tgtgggtcac agtttattat ggggtacctg 3300tgtggaaaga agcaaccacc actctatttt gtgcatcaga tgctaaagca tatgatacag 3360aggtacataa tgtttgggcc acacatgcct gtgtacccac agaccccaac ccacaagaag 3420tagtattgga aaatgtgaca gaaaatttta acatgtggaa aaataacatg gtagaacaga 3480tgcatgagga tataatcagt ttatgggatc aaagcctaaa gccatgtgta aaattaaccc 3540cactctgtgt tactttaaat tgcactgatt tgaggaatgt tactaatatc aataatagta 3600gtgagggaat gagaggagaa ataaaaaact gctctttcaa tatcaccaca agcataagag 3660ataaggtgaa gaaagactat gcacttttct atagacttga tgtagtacca atagataatg 3720ataatactag ctataggttg ataaattgta atacctcaac cattacacag gcctgtccaa 3780aggtatcctt tgagccaatt cccatacatt attgtacccc ggctggtttt gcgattctaa 3840agtgtaaaga caagaagttc aatggaacag ggccatgtaa aaatgtcagc acagtacaat 3900gtacacatgg aattaggcca gtagtgtcaa ctcaactgct gttaaatggc agtctagcag 3960aagaagaggt agtaattaga tctagtaatt tcacagacaa tgcaaaaaac ataatagtac 4020agttgaaaga atctgtagaa attaattgta caagacccaa caacaataca aggaaaagta 4080tacatatagg accaggaaga gcattttata caacaggaga aataatagga gatataagac 4140aagcacattg caacattagt agaacaaaat ggaataacac tttaaatcaa atagctacaa 4200aattaaaaga acaatttggg aataataaaa caatagtctt taatcaatcc tcaggagggg 4260acccagaaat tgtaatgcac agttttaatt gtggagggga attcttctac tgtaattcaa 4320cacaactgtt taatagtact tggaatttta atggtacttg gaatttaaca caatcgaatg 4380gtactgaagg aaatgacact atcacactcc catgtagaat aaaacaaatt ataaatatgt 4440ggcaggaagt aggaaaagca atgtatgccc ctcccatcag aggacaaatt agatgctcat 4500caaatattac agggctaata ttaacaagag atggtggaac taacagtagt gggtccgaga 4560tcttcagacc tgggggagga gatatgaggg acaattggag aagtgaatta tataaatata 4620aagtagtaaa aattgaacca ttaggagtag cacccaccaa ggcaaaaaga agagtggtgc 4680agagagaaaa aagagcagtg ggaacgatag gagctatgtt ccttgggttc ttgggagcag 4740caggaagcac tatgggcgca gcgtcaataa cgctgacggt acaggccaga ctattattgt 4800ctggtatagt gcaacagcag aacaatttgc tgagggctat tgaggcgcaa cagcatctgt 4860tgcaactcac agtctggggc atcaagcagc tccaggcaag agtcctggct gtggaaagat 4920acctaaggga tcaacagctc ctagggattt ggggttgctc tggaaaactc atctgcacca 4980ctgctgtgcc ttggaatgct agttggagta ataaaactct ggatatgatt tgggataaca 5040tgacctggat ggagtgggaa agagaaatcg aaaattacac aggcttaata tacaccttaa 5100ttgaggaatc gcagaaccaa caagaaaaga atgaacaaga cttattagca ttagataagt 5160gggcaagttt gtggaattgg tttgacatat caaattggct gtggtatgta aaaatcttca 5220taatgatagt aggaggcttg ataggtttaa gaatagtttt tactgtactt tctatagtaa 5280atagagttag gcagggatac tcaccattgt catttcagac ccacctccca gccccgaggg 5340gacccgacag gcccgaagga atcgaagaag aaggtggaga cagagactaa tttttatgcg 5400gccgctggta cccaacctaa aaattgaaaa taaatacaaa ggttcttgag ggttgtgtta 5460aattgaaagc gagaaataat cataaataag cccggggatc ctctagagtc gacaccatgg 5520gtgcgagagc gtcagtatta agcgggggag aattagatcg atgggaaaaa attcggttaa 5580ggccaggggg aaagaaaaaa tataaattaa aacatatagt atgggcaagc agggagctag 5640aacgattcgc agttaatcct ggcctgttag aaacatcaga aggctgtaga caaatactgg 5700gacagctaca accatccctt cagacaggat cagaagaact tagatcatta tataatacag 5760tagcaaccct ctattgtgtg catcaaagga tagagataaa agacaccaag gaagctttag 5820acaagataga ggaagagcaa aacaaaagta agaaaaaagc acagcaagca gcagctgaca 5880caggacacag caatcaggtc agccaaaatt accctatagt gcagaacatc caggggcaaa 5940tggtacatca ggccatatca cctagaactt taaatgcatg ggtaaaagta gtagaagaga 6000aggctttcag cccagaagtg atacccatgt tttcagcatt atcagaagga gccaccccac 6060aagatttaaa caccatgcta aacacagtgg ggggacatca agcagccatg caaatgttaa 6120aagagaccat caatgaggaa gctgcagaat gggatagagt gcatccagtg catgcagggc 6180ctattgcacc aggccagatg agagaaccaa ggggaagtga catagcagga actactagta 6240cccttcagga acaaatagga tggatgacaa ataatccacc tatcccagta ggagaaattt 6300ataaaagatg gataatcctg ggattaaata aaatagtaag aatgtatagc cctaccagca 6360ttctggacat aagacaagga ccaaaagaac cctttagaga ctatgtagac cggttctata 6420aaactctaag agccgagcaa gcttcacagg aggtaaaaaa ttggatgaca gaaaccttgt 6480tggtccaaaa tgcgaaccca gattgtaaga ctattttaaa agcattggga ccagcggcta 6540cactagaaga aatgatgaca gcatgtcagg gagtaggagg acccggccat aaggcaagag 6600ttttggctga agcaatgagc caagtaacaa attcagctac cataatgatg cagagaggca 6660attttaggaa ccaaagaaag attgttaagt gtttcaattg tggcaaagaa gggcacacag 6720ccagaaattg cagggcccct aggaaaaagg gctgttggaa atgtggaaag gaaggacacc 6780aaatgaaaga ttgtactgag agacaggcta attttttagg gaagatctgg ccttcctaca 6840agggaaggcc agggaatttt cttcagagca gaccagagcc aacagcccca ccagaagaga 6900gcttcaggtc tggggtagag acaacaactc cccctcagaa gcaggagccg atagacaagg 6960aactgtatcc tttaacttcc ctcagatcac tctttggcaa cgacccctcg tcacaataaa 7020gatagggggg caactaaagg aagctctatt agatacagga gcagatgata cagtattaga 7080agaaatgagt ttgccaggaa gatggaaacc aaaaatgata gggggaattg gaggttttat 7140caaagtaaga cagtatgatc agatactcat agaaatctgt ggacataaag ctataggtac 7200agtattagta ggacctacac ctgtcaacat aattggaaga aatctgttga ctcagattgg 7260ttgcacttta aattttccca ttagccctat tgagactgta ccagtaaaat taaagccagg 7320aatggatggc ccaaaagtta aacaatggcc attgacagaa gaaaaaataa aagcattagt 7380agaaatttgt acagaaatgg aaaaggaagg gaaaatttca aaaattgggc ctgagaatcc 7440atacaatact ccagtatttg ccataaagaa aaaagacagt actaaatgga ggaaattagt 7500agatttcaga gaacttaata agagaactca agacttctgg gaagttcaat taggaatacc 7560acatcccgca gggttaaaaa agaaaaaatc agtaacagta ctggatgtgg gtgatgcata 7620tttttcagtt cccttagatg aagacttcag gaagtatact gcatttacca tacctagtat 7680aaacaatgag acaccaggga ttagatatca gtacaatgtg cttccacagg gatggaaagg 7740atcaccagca atattccaaa gtagcatgac aaaaatctta gagcctttta aaaaacaaaa 7800tccagacata gttatctatc aatacatgaa cgatttgtat gtaggatctg acttagaaat 7860agggcagcat agaacaaaaa tagaggagct gagacaacat ctgttgaggt ggggacttac 7920cacaccagac aaaaaacatc agaaagaacc tccattcctt tggatgggtt atgaactcca 7980tcctgataaa tggacagtac agcctatagt gctgccagaa aaagacagct ggactgtcaa 8040tgacatacag aagttagtgg ggaaattgaa taccgcaagt cagatttacc cagggattaa 8100agtaaggcaa ttatgtaaac tccttagagg aaccaaagca ctaacagaag taataccact 8160aacagaagaa gcagagctag aactggcaga aaacagagag attctaaaag aaccagtaca 8220tggagtgtat tatgacccat caaaagactt aatagcagaa atacagaagc aggggcaagg 8280ccaatggaca tatcaaattt atcaagagcc atttaaaaat ctgaaaacag gaaaatatgc 8340aagaatgagg ggtgcccaca ctaatgatgt aaaacaatta acagaggcag tgcaaaaaat 8400aaccacagaa agcatagtaa tatggggaaa gactcctaaa tttaaactac ccatacaaaa 8460ggaaacatgg gaaacatggt ggacagagta ttggcaagcc acctggattc ctgagtggga 8520gtttgttaat acccctcctt tagtgaaatt atggtaccag ttagagaaag aacccatagt 8580aggagcagaa accttctatg tagatggggc agctaacagg gagactaaat taggaaaagc 8640aggatatgtt actaacaaag gaagacaaaa ggttgtcccc ctaactaaca caacaaatca 8700gaaaactcag ttacaagcaa tttatctagc tttgcaggat tcaggattag aagtaaacat 8760agtaacagac tcacaatatg cattaggaat cattcaagca caaccagata aaagtgaatc 8820agagttagtc aatcaaataa tagagcagtt aataaaaaag gaaaaggtct atctggcatg 8880ggtaccagca cacaaaggaa ttggaggaaa tgaacaagta gataaattag tcagtgctgg 8940aatcaggaaa atactatttt tagatggaat agataaggcc caagatgaac attagttttt 9000atgtcgacct gcagggaaag ttttataggt agttgataga acaaaataca taattttgta 9060aaaataaatc actttttata ctaatatgac acgattacca atacttttgt tactaatatc 9120attagtatac gctacacctt ttcctcagac atctaaaaaa ataggtgatg atgcaacttt 9180atcatgtaat cgaaataata caaatgacta cgttgttatg agtgcttggt ataaggagcc 9240caattccatt attcttttag ctgctaaaag cgacgtcttg tattttgata attataccaa 9300ggataaaata tcttacgact ctccatacga tgatctagtt acaactatca caattaaatc 9360attgactgct agagatgccg gtacttatgt atgtgcattc tttatgacat cgcctacaaa 9420tgacactgat aaagtagatt atgaagaata ctccacagag ttgattgtaa atacagatag 9480tgaatcgact atagacataa tactatctgg atctacacat tcaccagaaa ctagttaagc 9540ttgtctccct atagtgagtc gtattagagc ttggcgtaat catggtcata gctgtttcct 9600gtgtgaaatt gttatccgct cacaattcca cacaacatac gagccggaag cataaagtgt 9660aaagcctggg gtgcctaatg agtgagctaa ctcacattaa ttgcgttgcg ctcactgccc 9720gctttcgagt cgggaaacct gtcgtgccag ctgcattaat gaatcggcca acgcgcgggg 9780agaggcggtt tgcgtattgg gcgctcttcc gcttcctcgc tcactgactc gctgcgctcg 9840gtcgttcggc tgcggcgagc ggtatcagct cactcaaagg cggtaatacg gttatccaca 9900gaatcagggg ataacgcagg aaagaacatg tgagcaaaag gccagcaaaa ggccaggaac 9960cgtaaaaagg ccgcgttgct ggcgtttttc gataggctcc gcccccctga cgagcatcac 10020aaaaatcgac gctcaagtca gaggtggcga aacccgacag gactataaag ataccaggcg 10080tttccccctg gaagctccct cgtgcgctct cctgttccga ccctgccgct taccggatac 10140ctgtccgcct ttctcccttc gggaagcgtg gcgctttctc atagctcacg ctgtaggtat 10200ctcagttcgg tgtaggtcgt tcgctccaag ctgggctgtg tgcacgaacc ccccgttcag 10260cccgaccgct gcgccttatc cggtaactat cgtcttgagt ccaacccggt aagacacgac 10320ttatcgccac tggcagcagc cactggtaac aggattagca gagcgaggta tgtaggcggt 10380gctacagagt tcttgaagtg gtggcctaac tacggctaca ctagaaggac agtatttggt 10440atctgcgctc tgctgaagcc agttaccttc ggaaaaagag ttggtagctc ttgatccggc 10500aaacaaacca ccgctggtag cggtggtttt tttgtttgca agcagcagat tacgcgcaga 10560aaaaaaggat ctcaagaaga tcctttgatc ttttctacgg ggtctgacgc tcagtggaac 10620gaaaactcac gttaagggat tttggtcatg agattatcaa aaaggatctt cacctagatc 10680cttttaaatt aaaaatgaag ttttaaatca atctaaagta tatatgagta aacttggtct 10740gacagttacc aatgcttaat cagtgaggca cctatctcag cgatctgtct atttcgttca 10800tccatagttg cctgactccc cgtcgtgtag ataactacga tacgggaggg cttaccatct 10860ggccccagtg ctgcaatgat accgcgagac ccacgctcac cggctccaga tttatcagca 10920ataaaccagc cagccggaag ggccgagcgc agaagtggtc ctgcaacttt atccgcctcc 10980atccagtcta ttaattgttg ccgggaagct agagtaagta gttcgccagt taatagtttg 11040cgcaacgttg ttggcattgc tacaggcatc gtggtgtcac gctcgtcgtt tggtatggct 11100tcattcagct ccggttccca acgatcaagg cgagttacat gatcccccat gttgtgcaaa 11160aaagcggtta gctccttcgg tcctccgatc gttgtcagaa gtaagttggc cgcagtgtta 11220tcactcatgg ttatggcagc actgcataat tctcttactg tcatgccatc cgtaagatgc 11280ttttctgtga ctggtgagta ctcaaccaag tcattctgag aatagtgtat gcggcgaccg 11340agttgctctt gcccggcgtc aatacgggat aataccgcgc cacatagcag aactttaaaa 11400gtgctcatca ttggaaaacg ttcttcgggg cgaaaactct caaggatctt accgctgttg 11460agatccagtt cgatgtaacc cactcgtgca cccaactgat cttcagcatc ttttactttc 11520accagcgttt ctgggtgagc aaaaacagga aggcaaaatg ccgcaaaaaa gggaataagg 11580gcgacacgga aatgttgaat actcatactc ttcctttttc aatattattg aagcatttat 11640cagggttatt gtctcatgag cggatacata tttgaatgta tttagaaaaa taaacaaata 11700ggggttccgc gcacatttcc ccgaaaagtg ccacctgacg tctaagaaac cattattatc 11760atgacattaa cctataaaaa taggcgtatc acgaggccct ttcgtctcgc gcgtttcggt 11820gatgacggtg aaaacctctg acacatgcag ctcccggaga cggtcacagc ttgtctgtaa 11880gcggatgccg ggagcagaca agcccgtcag ggcgcgtcag cgggtgttgg cgggtgtcgg 11940ggctggctta actatgcggc atcagagcag attgtactga gagtgcacca tatgcggtgt 12000gaaataccgc acagatgcgt aaggagaaaa taccgcatca ggcgccattc gccattcagg 12060ctgcgcaact gttgggaagg gcgatcggtg cgggcctctt cgctattacg ccagctggcg 12120aaagggggat gtgctgcaag gcgattaagt tgggtaacgc cagggttttc ccagtcacga 12180cgttgtaaaa cgacggccag tgaattggat ttaggtgaca ctata 12225274DNAArtificial SequencePsyn II promoter 2taaaaaatga aaaaatattc taatttatag gacggttttg attttctttt tttctatgct 60ataaataata aata 7432214DNAArtificial SequenceADA envelope truncated 3atgaaagtga aggggatcag gaagaattat cagcacttgt ggaaatgggg catcatgctc 60cttgggatgt tgatgatctg tagtgctgta gaaaatttgt gggtcacagt ttattatggg 120gtacctgtgt ggaaagaagc aaccaccact ctattttgtg catcagatgc taaagcatat 180gatacagagg tacataatgt ttgggccaca catgcctgtg tacccacaga ccccaaccca 240caagaagtag tattggaaaa tgtgacagaa aattttaaca tgtggaaaaa taacatggta 300gaacagatgc atgaggatat aatcagttta tgggatcaaa gcctaaagcc atgtgtaaaa 360ttaaccccac tctgtgttac tttaaattgc actgatttga ggaatgttac taatatcaat 420aatagtagtg agggaatgag aggagaaata aaaaactgct ctttcaatat caccacaagc 480ataagagata aggtgaagaa agactatgca cttttctata gacttgatgt agtaccaata 540gataatgata atactagcta taggttgata aattgtaata cctcaaccat tacacaggcc 600tgtccaaagg tatcctttga gccaattccc atacattatt gtaccccggc tggttttgcg 660attctaaagt gtaaagacaa gaagttcaat ggaacagggc catgtaaaaa tgtcagcaca 720gtacaatgta cacatggaat taggccagta gtgtcaactc aactgctgtt aaatggcagt 780ctagcagaag aagaggtagt aattagatct agtaatttca cagacaatgc aaaaaacata 840atagtacagt tgaaagaatc tgtagaaatt aattgtacaa gacccaacaa caatacaagg 900aaaagtatac atataggacc aggaagagca ttttatacaa caggagaaat aataggagat 960ataagacaag cacattgcaa cattagtaga acaaaatgga ataacacttt aaatcaaata 1020gctacaaaat taaaagaaca atttgggaat aataaaacaa tagtctttaa tcaatcctca 1080ggaggggacc cagaaattgt aatgcacagt tttaattgtg gaggggaatt cttctactgt 1140aattcaacac aactgtttaa tagtacttgg aattttaatg gtacttggaa tttaacacaa 1200tcgaatggta ctgaaggaaa tgacactatc acactcccat gtagaataaa acaaattata 1260aatatgtggc aggaagtagg aaaagcaatg tatgcccctc ccatcagagg acaaattaga 1320tgctcatcaa atattacagg gctaatatta acaagagatg gtggaactaa cagtagtggg 1380tccgagatct tcagacctgg gggaggagat atgagggaca attggagaag tgaattatat 1440aaatataaag tagtaaaaat tgaaccatta ggagtagcac ccaccaaggc aaaaagaaga 1500gtggtgcaga gagaaaaaag agcagtggga acgataggag ctatgttcct tgggttcttg 1560ggagcagcag gaagcactat gggcgcagcg tcaataacgc tgacggtaca ggccagacta 1620ttattgtctg gtatagtgca acagcagaac aatttgctga gggctattga ggcgcaacag 1680catctgttgc aactcacagt ctggggcatc aagcagctcc aggcaagagt cctggctgtg 1740gaaagatacc taagggatca acagctccta gggatttggg gttgctctgg aaaactcatc 1800tgcaccactg ctgtgccttg gaatgctagt tggagtaata aaactctgga tatgatttgg 1860gataacatga cctggatgga gtgggaaaga gaaatcgaaa attacacagg cttaatatac 1920accttaattg aggaatcgca gaaccaacaa gaaaagaatg aacaagactt attagcatta 1980gataagtggg caagtttgtg gaattggttt gacatatcaa attggctgtg gtatgtaaaa 2040atcttcataa tgatagtagg aggcttgata ggtttaagaa tagtttttac tgtactttct 2100atagtaaata gagttaggca gggatactca ccattgtcat ttcagaccca cctcccagcc 2160ccgaggggac ccgacaggcc cgaaggaatc gaagaagaag gtggagacag agac 2214470DNAArtificial SequencePmH5 promoter 4aaaaattgaa aataaataca aaggttcttg agggttgtgt taaattgaaa gcgagaaata 60atcataaata 7053479DNAArtificial SequenceHXB2 gag pol 5atgggtgcga gagcgtcagt attaagcggg ggagaattag atcgatggga aaaaattcgg 60ttaaggccag ggggaaagaa aaaatataaa ttaaaacata tagtatgggc aagcagggag 120ctagaacgat tcgcagttaa

tcctggcctg ttagaaacat cagaaggctg tagacaaata 180ctgggacagc tacaaccatc ccttcagaca ggatcagaag aacttagatc attatataat 240acagtagcaa ccctctattg tgtgcatcaa aggatagaga taaaagacac caaggaagct 300ttagacaaga tagaggaaga gcaaaacaaa agtaagaaaa aagcacagca agcagcagct 360gacacaggac acagcaatca ggtcagccaa aattacccta tagtgcagaa catccagggg 420caaatggtac atcaggccat atcacctaga actttaaatg catgggtaaa agtagtagaa 480gagaaggctt tcagcccaga agtgataccc atgttttcag cattatcaga aggagccacc 540ccacaagatt taaacaccat gctaaacaca gtggggggac atcaagcagc catgcaaatg 600ttaaaagaga ccatcaatga ggaagctgca gaatgggata gagtgcatcc agtgcatgca 660gggcctattg caccaggcca gatgagagaa ccaaggggaa gtgacatagc aggaactact 720agtacccttc aggaacaaat aggatggatg acaaataatc cacctatccc agtaggagaa 780atttataaaa gatggataat cctgggatta aataaaatag taagaatgta tagccctacc 840agcattctgg acataagaca aggaccaaaa gaacccttta gagactatgt agaccggttc 900tataaaactc taagagccga gcaagcttca caggaggtaa aaaattggat gacagaaacc 960ttgttggtcc aaaatgcgaa cccagattgt aagactattt taaaagcatt gggaccagcg 1020gctacactag aagaaatgat gacagcatgt cagggagtag gaggacccgg ccataaggca 1080agagttttgg ctgaagcaat gagccaagta acaaattcag ctaccataat gatgcagaga 1140ggcaatttta ggaaccaaag aaagattgtt aagtgtttca attgtggcaa agaagggcac 1200acagccagaa attgcagggc ccctaggaaa aagggctgtt ggaaatgtgg aaaggaagga 1260caccaaatga aagattgtac tgagagacag gctaattttt tagggaagat ctggccttcc 1320tacaagggaa ggccagggaa ttttcttcag agcagaccag agccaacagc cccaccagaa 1380gagagcttca ggtctggggt agagacaaca actccccctc agaagcagga gccgatagac 1440aaggaactgt atcctttaac ttccctcaga tcactctttg gcaacgaccc ctcgtcacaa 1500taaagatagg ggggcaacta aaggaagctc tattagatac aggagcagat gatacagtat 1560tagaagaaat gagtttgcca ggaagatgga aaccaaaaat gataggggga attggaggtt 1620ttatcaaagt aagacagtat gatcagatac tcatagaaat ctgtggacat aaagctatag 1680gtacagtatt agtaggacct acacctgtca acataattgg aagaaatctg ttgactcaga 1740ttggttgcac tttaaatttt cccattagcc ctattgagac tgtaccagta aaattaaagc 1800caggaatgga tggcccaaaa gttaaacaat ggccattgac agaagaaaaa ataaaagcat 1860tagtagaaat ttgtacagaa atggaaaagg aagggaaaat ttcaaaaatt gggcctgaga 1920atccatacaa tactccagta tttgccataa agaaaaaaga cagtactaaa tggaggaaat 1980tagtagattt cagagaactt aataagagaa ctcaagactt ctgggaagtt caattaggaa 2040taccacatcc cgcagggtta aaaaagaaaa aatcagtaac agtactggat gtgggtgatg 2100catatttttc agttccctta gatgaagact tcaggaagta tactgcattt accataccta 2160gtataaacaa tgagacacca gggattagat atcagtacaa tgtgcttcca cagggatgga 2220aaggatcacc agcaatattc caaagtagca tgacaaaaat cttagagcct tttaaaaaac 2280aaaatccaga catagttatc tatcaataca tgaacgattt gtatgtagga tctgacttag 2340aaatagggca gcatagaaca aaaatagagg agctgagaca acatctgttg aggtggggac 2400ttaccacacc agacaaaaaa catcagaaag aacctccatt cctttggatg ggttatgaac 2460tccatcctga taaatggaca gtacagccta tagtgctgcc agaaaaagac agctggactg 2520tcaatgacat acagaagtta gtggggaaat tgaataccgc aagtcagatt tacccaggga 2580ttaaagtaag gcaattatgt aaactcctta gaggaaccaa agcactaaca gaagtaatac 2640cactaacaga agaagcagag ctagaactgg cagaaaacag agagattcta aaagaaccag 2700tacatggagt gtattatgac ccatcaaaag acttaatagc agaaatacag aagcaggggc 2760aaggccaatg gacatatcaa atttatcaag agccatttaa aaatctgaaa acaggaaaat 2820atgcaagaat gaggggtgcc cacactaatg atgtaaaaca attaacagag gcagtgcaaa 2880aaataaccac agaaagcata gtaatatggg gaaagactcc taaatttaaa ctacccatac 2940aaaaggaaac atgggaaaca tggtggacag agtattggca agccacctgg attcctgagt 3000gggagtttgt taatacccct cctttagtga aattatggta ccagttagag aaagaaccca 3060tagtaggagc agaaaccttc tatgtagatg gggcagctaa cagggagact aaattaggaa 3120aagcaggata tgttactaac aaaggaagac aaaaggttgt ccccctaact aacacaacaa 3180atcagaaaac tcagttacaa gcaatttatc tagctttgca ggattcagga ttagaagtaa 3240acatagtaac agactcacaa tatgcattag gaatcattca agcacaacca gataaaagtg 3300aatcagagtt agtcaatcaa ataatagagc agttaataaa aaaggaaaag gtctatctgg 3360catgggtacc agcacacaaa ggaattggag gaaatgaaca agtagataaa ttagtcagtg 3420ctggaatcag gaaaatacta tttttagatg gaatagataa ggcccaagat gaacattag 347969PRTArtificial SequenceGag-CM9 peptide 6Cys Thr Pro Tyr Asp Ile Asn Gln Met1 578PRTArtificial Sequenceovalbumin peptide 7Ser Ile Ile Asn Phe Glu Lys Leu1 5820DNAArtificial Sequencesynthetic probe 8ctgtctgcgt catttggtgc 2094PRTArtificial Sequenceendocytosis motif 9Tyr Xaa Xaa Leu11093DNAArtificial Sequencem7.5 promoter 10cgctttttat agtaagtttt tcacccataa ataataaata caataattaa tttctcgtaa 60aaattgaaaa actattctaa tttattgcac ggt 931174DNAArtificial SequencePsyn III promoter 11taaaaattga aaaaatattc taatttatag gacggttttg attttctttt tttctatact 60ataaataata aata 741274DNAArtificial SequencePsyn IV promoter 12taaaaattga aaaactattc taatttatag gacggttttg attttctttt tttctatact 60ataaataata aata 741375DNAArtificial SequencePsyn V promoter 13aaaaaatgat aaagtaggtt cagttttatt gctggtttaa aatcacgctt tcgagtaaaa 60actacgaata taaat 75147DNAArtificial Sequenceearly transcription termination signal 14tttttnt 71553DNAArtificial Sequence5' primer 15gcgccccggg tcgacgcggc cgcgccatga gagtgagggg gatacagagg aac 531657DNAArtificial Sequence3' primer 16gcgccccggg cggccgcaga aaaattagcc ttgctctcca ccttcttctt ctattcc 571756DNAArtificial Sequence5' primer 17gcgccccggg tcgacgcggc cgcgccatga gagtgaggga gacagtgagg aattat 561857DNAArtificial Sequence3' primer 18gcgccccggg cggccgcaga aaaattagcc ttgctctcca ccttcttctt ctattcc 571956DNAArtificial Sequence5' primer 19gcgccccggg tcgacgcggc cgcgccatga gagtgagggg gatagagagg aattat 562051DNAArtificial Sequence3' primer 20gcgccccggg cggccgcaga aaaattagcc ttgctctcca ccttctcctt c 512140DNAArtificial Sequence5' primer 21gcgccccggg gccatgggtg cgagagcgtc agtattaagc 402249DNAArtificial Sequence3' primer 22gcgccccggg agaaaaatta gaaggtttct gctcctacta tgggttcct 492340DNAArtificial Sequence5' primer 23gcgccccggg gccatgggtg cgagagcgtc agtgttaagt 402449DNAArtificial Sequence3' primer 24gcgccccggg agaaaaatta gaaagtttct gctcctacta tgggttcct 492530DNAArtificial SequenceHIV env C-terminal truncation sequence 25ggaatagaag aagaaggtgg agagcaaggc 302610PRTArtificial SequenceHIV env C-terminal truncation sequence 26Gly Ile Glu Glu Glu Gly Gly Glu Gln Gly1 5 102730DNAArtificial SequenceHIV env C-terminal truncation sequence 27ggaatagaag aagaaggtgg agagcaaggc 302810PRTArtificial SequenceHIV env C-terminal truncation sequence 28Gly Ile Glu Glu Glu Gly Gly Glu Gln Gly1 5 102930DNAArtificial SequenceHIV env C-terminal truncation sequence 29ggaacagaag gagaaggtgg agagcaaggc 303010PRTArtificial SequenceHIV env C-terminal truncation sequence 30Gly Thr Glu Gly Glu Gly Gly Glu Gln Gly1 5 103130DNAArtificial SequenceHIV gagpol C-terminal truncation sequence 31aaggaaccca tagtaggagc agaaaccttc 303210PRTArtificial SequenceHIV gagpol C-terminal truncation sequence 32Lys Glu Pro Ile Val Gly Ala Glu Thr Phe1 5 103330DNAArtificial SequenceHIV gagpol C-terminal truncation sequence 33aaggaaccca tagtaggagc agaaactttc 303410PRTArtificial SequenceHIV gagpol C-terminal truncation sequence 34Lys Glu Pro Ile Val Gly Ala Glu Thr Phe1 5 103530DNAArtificial SequenceHIV envelope C-terminal truncation sequence 35agaatcgaag gagaaggtgg agagcaagac 303611PRTArtificial SequenceHIV envelope C-terminal truncation sequence 36Gly Arg Ile Glu Gly Glu Gly Gly Glu Gln Asp1 5 103730DNAArtificial SequenceHIV envelope C-terminal truncation sequence 37agaatcgaag gagaaggtgg agagcaagac 303811PRTArtificial SequenceHIV envelope C-terminal truncation sequence 38Gly Arg Ile Glu Gly Glu Gly Gly Glu Gln Asp1 5 103930DNAArtificial SequenceHIV envelope C-terminal truncation sequence 39agaatcgaag gagaaggtgg agagcaagac 304011PRTArtificial SequenceHIV envelope C-terminal truncation sequence 40Gly Arg Ile Glu Gly Glu Gly Gly Glu Gln Asp1 5 104130DNAArtificial SequenceHIV envelope C-terminal truncation sequence 41agaatcgaag gagaaggtgg agagcaagac 304211PRTArtificial SequenceHIV envelope C-terminal truncation sequence 42Gly Arg Ile Glu Gly Glu Gly Gly Glu Gln Asp1 5 104330DNAArtificial SequenceHIV envelope C-terminal truncation sequence 43gacatatcaa attggctgtg gtatataaga 304410PRTArtificial SequenceHIV envelope C-terminal truncation sequence 44Asp Ile Ser Asn Trp Leu Trp Tyr Ile Arg1 5 104527DNAArtificial SequenceHIV gagpol C-terminal truncation sequence 45gaccccatag caggagcaga gactttc 274610PRTArtificial SequenceHIV gagpol C-terminal truncation sequence 46Lys Asp Pro Ile Ala Gly Ala Glu Thr Phe1 5 104730DNAArtificial SequenceHIV envelope C-terminal truncation sequence 47ggaatcgaag aagaaggtgg agagcaagac 304810PRTArtificial SequenceHIV envelope C-terminal truncation sequence 48Gly Ile Glu Glu Glu Gly Gly Glu Gln Asp1 5 104931DNAArtificial SequenceHIV gagpol C-terminal truncation sequence 49aaagaaccca tagtaggagc agaaactttc t 315010PRTArtificial SequenceHIV gagpol C-terminal truncation sequence 50Lys Glu Pro Ile Val Gly Ala Glu Thr Phe1 5 10513068DNAHIV-1 51atgggtgcga gagcgtcagt attaagcggg ggaaaattag atgaatggga aaaaattcgg 60ttacggccag ggggaaacaa aaaatataga ttaaaacatt tagtatgggc aagcagggag 120ctagaacgat ttgcacttaa tcctggtctt ttagaaacat cagaaggctg tagacaaata 180atagaacagc tacaaccatc tattcagaca ggatcagagg aacttaaatc attacataat 240acagtagtaa ccctctattg tgtacatgaa aggataaagg tagcagatac caaggaagct 300ttagataaga taaaggaaga acaaaccaaa agtaagaaaa aagcacagca agcaacagct 360gacagcagcc aggtcagcca aaattatcct atagtacaaa acctacaggg gcaaatggta 420caccagtcct tatcacctag gactttgaat gcatgggtaa aagtaataga agagaaggct 480ttcagcccag aagtaatacc catgttttca gcattatcag aaggagccac cccaacagat 540ttaaacacca tgctaaacac agtgggggga catcaagcag ccatgcaaat gttaaaagag 600actatcaatg aggaagctgc agaatgggat aggctacatc cagtgcctgc agggcctgtt 660gcaccaggcc aaatgagaga accaagggga agtgatatag caggaactac cagtaccctt 720caggaacaaa taggatggat gacaagcaat ccacctatcc cagtaggaga aatctataaa 780agatggataa tcctaggatt aaataaaata gtaagaatgt atagccctgt cagcattttg 840gacataagac aaggaccaaa ggaacccttt agagactatg tagatcggtt ctataaaact 900ctacgagccg agcaagcttc acaggatgta aaaaattgga tgactgaaac cttgttagtc 960caaaatgcga atccagattg taaaactatc ttaaaagcat tgggaccagc ggctacatta 1020gaagaaatga tgacagcatg tcagggagtg gggggaccca gtcataaagc aagagttttg 1080gctgaggcaa tgagccaagc atcaaacaca aatgctgtta taatgatgca gaggggcaat 1140ttcaagggca agaaaatcat taagtgtttc aactgtggca aagaaggaca cctagcaaaa 1200aattgtaggg ctcctaggaa aagaggctgt tggaaatgtg gaaaggaagg gcaccaaatg 1260aaagattgta atgaaagaca ggctaatttt ttagggagaa tttggccttc ccacaagggg 1320aggccaggga atttccttca gagcagacca gagccaacag ccccaccagc agagagcttc 1380gggtttgggg aagagataac accctcccag aaacaggagg ggaaagagga gctgtatcct 1440tcagcctccc tcaaatcact ctttggcaac gacccctagt cacaataaaa atagggggac 1500agctaaagga agctctatta gatacaggag cagatgatac agtagtagaa gaaatgaatt 1560tgccaggaaa atggaaacca aaaatgatag ggggaattgg gggctttatc aaagtaagac 1620agtatgatca aatactcgta gaaatctatg gatataaggc tacaggtaca gtattagtag 1680gacctacacc tgtcaacata attggaagaa atttgttgac tcagattggt tgcactttaa 1740attttccaat tagtcctatt gaaactgtac cagtaaaatt aaagtcaggg atggatggtc 1800caagagttaa acaatggcca ttgacagaag agaaaataaa agcactaata gaaatttgta 1860cagaaatgga aaaggaagga aaactttcaa gaattggacc tgaaaatcca tacaatactc 1920caatatttgc cataaagaaa aaagacagta ctaagtggag aaaattagta gatttcagag 1980aacttaataa gagaactcaa gatttctggg aagttcaact aggaatacca catcctgcag 2040ggctaaaaaa gaaaaaatca gtaacagtac tggaggtggg tgatgcatat ttttcagttc 2100ccttatatga agactttaga aaatacactg cattcaccat acctagtata aacaatgaga 2160caccaggaat tagatatcag tacaatgtgc ttccacaagg atggaaagga tcaccggcaa 2220tattccaaag tagcatgaca aaaattttag aaccttttag aaaacaaaat ccagaagtgg 2280ttatctacca atacatgcac gatttgtatg taggatctga cttagaaata gggcagcata 2340gaataaaaat agaggaatta aggggacacc tattgaagtg gggatttacc acaccagaca 2400aaaatcatca gaaggaacct ccatttcttt ggatgggtta tgaactccat cctgataaat 2460ggacagtaca gcctataaaa ctgccagaaa aagaaagctg gactgtcaat gatctgcaga 2520agttagtggg gaaattaaat tgggcaagtc aaatttattc aggaattaaa gtaagacaat 2580tatgcaaatg ccttagggga accaaagcac tgacagaagt agtaccactg acagaagaag 2640cagaattaga actggcagaa aacagggaac ttctaaaaga aacagtacat ggagtgtatt 2700atgacccatc aaaagactta atagcagaaa tacagaaaca agggcaagac caatggacat 2760atcaaattta tcaagaacaa tataaaaatt tgaaaacagg aaagtatgca aagaggagga 2820gtacccacac taatgatgta aaacaattaa cagaggcagt gcaaaaaata gcccaagaat 2880gtatagtgat atggggaaag actcctaaat tcagactacc catacaaaag gaaacatggg 2940aaacatggtg gacagagtat tggcaggcca cctggattcc tgagtgggag tttgtcaata 3000cccctccctt ggttaaatta tggtaccagt tagagaagga acccatagta ggagcagaaa 3060ccttctaa 3068523080DNAHIV-1 52atgggtgcga gagcgtcagt gttaagtggg ggaaaattag atgaatggga aagaattcgg 60ttacggccag ggggaaacaa aagatataaa ctaaaacata tagtatgggc aagcagggag 120ctagagcgat ttgcacttaa tcctggcctt ttagaaacat cagaaggctg taaacaaata 180ttgggacagc tacaaccagc tattcagaca ggatcagaag aacttaaatc attatataat 240acagtagcaa ccctctattg tgtacatgag aggctaaagg taacagacac caaggaagct 300ttagacaaaa tagaggaaga acaaaccaaa agtaagaaaa aagcacagca agcaacagct 360gacacaaaaa acagcagcca ggtcagccaa aattatccta tagtacaaaa cctacagggg 420caaatggtac accaggctat atcacctaga acgttgaacg catgggtaaa agtaatagag 480gagaaggctt tcagcccaga agtaataccc atgttttcag cattatcaga aggagccacc 540ccacaagatt taaacaccat gctaaacaca gtggggggac atcaggcagc catgcagatg 600ttaaaagaga ccatcaatga ggaagctgca gaatgggata ggttacatcc agtacatgca 660gggcctattg caccaggaca aatgagagaa ccaacaggaa gtgatatagc aggaactact 720agtacccttc aggaacaaat aggatggatg accagcaatc cacctatccc agtaggagaa 780atctataaaa gatggataat cctaggatta aataaaatag taaggatgta tagccctgtc 840agtattttgg acataaaaca agggccaaag gaacccttta gagactatgt agatcggttc 900tataaaactc taagggccga gcaagcttca caggaggtaa aaggttggat gaccgaaacc 960ttgttggtcc aaaatgcaaa cccagattgt aaaaccatct taaaagcatt gggaccagcg 1020gctacattag aagaaatgat gacagcatgt cagggagtgg ggggacccgg tcataaagca 1080agagttttgg ctgaggcaat gagtcaagtc tcaacaaata ctgctataat gatgcagaga 1140ggcaatttta agggcccaaa gaaaagcatt aagtgtttta actgtggcaa agaaggtcac 1200acagcaaaaa actgtagagc tcctaggaaa aggggctgtt ggaaatgtgg aagggaagga 1260catcaaatga aagattgcac tgaaagacag gctaattttt tagggaaaat ttggccttcc 1320cacaagggaa ggccagggaa tttccttcag aacagaccag agccaacagc cccaccagaa 1380gaaagcttcg ggtttgggga agagataaca ccctctcaga aacaggagaa gaaggacaag 1440gagctgtatc ctgtagcttc cctcaaatca ctctttggca acgacccctt gtcacaataa 1500agataggggg acagctaaag gaagctctac tagatacagg agcagatgat acagtattag 1560aagaaataaa tttgccagga aaatggaaac caaaaatgat agggggaatt ggaggcttta 1620tcaaagtaag acagtatgag caaatacttg tagaaatctg tggacagaaa gctataggta 1680cagtattagt agggcctaca cctgtcaaca taattggaag aaatttgttg actcagattg 1740gttgcacttt aaattttcca attagcccta ttgaaactgt accagtaaaa ttaaagccag 1800ggatggacgg tccaaaagtt aaacaatggc cattgacaga agaaaaggta aaagcactaa 1860tagaaatttg tacagaaatg gaaaaggaag gaaaaatttc aagaattgga cctgaaaatc 1920catacaatac tccaatattt gccataaaga aaaaggacag tactaagtgg agaaaattag 1980tagatttcag ggaacttaat aagagaactc aagacttctg ggaagttcaa ctaggaatac 2040cacatcctgc ggggctaaaa aagaaaaaat cagtaacagt actggaggtg ggtgatgcat 2100atttttcagt tcccttatat gaagatttta gaaaatatac tgcattcacc atacctagta 2160taaacaatga aacaccagga attagatatc agtacaatgt gcttccacaa gggtggaaag 2220gatcaccagc aatattccaa agtagcatga caaaaatctt agaacctttt agaaaacaaa 2280atccagaaat ggttatctat caatacatgc acgatttgta tgtaggatct gacttagaaa 2340tagggcagca tagaataaaa atagaagaat taaggggaca cctgttgaag tggggattta 2400ccacaccaga caaaaagcat cagaaagaac ctccatttct ttggatgggt tatgaactcc 2460atcctgataa atggacagta cagtctataa aactgccaga acaagaaagc tggactgtca 2520atgatataca gaagttagtg ggaaaattaa attgggcaag ccagatttat ccaggaatta 2580aggtaagaca attatgcaaa tgcattaggg gtaccaaagc actgacagaa gtagtaccac 2640tgacagaaga agcagaatta gaactggcag aaaacaggga aattctaaga gaaccagtac 2700atggagtgta ttatgaccca tcaaaagact taatagcaga gatacagaaa caagggcaag 2760accagtggac ataccaaatt tatcaagaac aatataaaaa tctgaaaaca ggaaagtatg 2820caaaagtgag gggtacccac actaatgatg taaaacaatt aacagaggca gtacaaaaaa 2880taacccaaga atgtatagtg atatggggaa agcctcctaa atttagacta cccatacaaa 2940aagaaacatg ggaaatatgg tggacagagt attggcaggc cacctggatt cctgagtggg 3000agtttgtcaa tacccctcct ttagttaaat tatggtacca attagagaag gaacccatag 3060taggagcaga aactttctaa 3080532181DNAHIV-1 53atgagagtga gggggataca gaggaactat caaaacttgt ggagatgggg caccttgctc 60cttgggatgt tgatgatatg taaggctaca gaacagttgt gggtcacagt ttactatggg 120gtacctgtgt ggaaagaagc aaccactact ctattttgtg

catcagatgc taaatcatat 180aaagaagaag cacataatat ctgggctaca catgcctgtg taccaacaga ccccaaccca 240cgagaattaa taatagaaaa tgtcacagaa aactttaaca tgtggaaaaa taacatggtg 300gagcagatgc atgaggatat aatcagttta tgggatcaaa gcctaaaacc atgtgtaaaa 360ttaaccccac tctgtgtcac tttaaactgc actgaatgga ggaagaataa cactatcaat 420gccaccagaa tagaaatgaa aaactgctct ttcaatctaa ccacagaaat aagagatagg 480aaaaagcaag tgcatgcact tttctataaa cttgatgtgg taccaataga tgataataat 540agtactaata ccagctatag gttaataaat tgtaatacct cagccattac acaggcgtgt 600ccaaaggtaa cctttgagcc aattcccata cattattgtg ccccagctgg atatgcgatt 660ctaaaatgta acaataagaa gttcaatggg acaggtccat gcgataatgt cagtacagta 720cagtgtacac atggaattag gccagtagta tccactcaat tgttgttgaa tggcagtcta 780gcagaagaag acataataat tagatctgag aatctcacaa ataatgctaa aatcataata 840gtacagctta atgagtctgt aacaattaat tgcacaaggc cctacaacaa tacaagaaga 900ggtgtacata taggaccagg gcgagcatac tatacaacag acataatagg agatataaga 960caagcacatt gtaacattag tggagcagaa tggaataaga ctttacatcg ggtagctaaa 1020aaattaagag acctatttaa aaagacaaca ataattttta aaccgtcctc cggaggggac 1080ccagaaatta caacacacag ctttaattgt agaggggaat tcttctactg caatacaaca 1140agactgttta atagcatatg gggaaataat agtacaggag ttgatgagag tataacactc 1200ccatgcagaa taaaacaaat tataaacatg tggcagggag taggaaaagc aatgtatgcc 1260cctcccattg aaggactaat cagctgctca tcaaatatta caggattact gttgacaaga 1320gatggtggtg gaagtaacag tagtcagaat gagaccttca gacctggagg gggagatatg 1380agagacaatt ggagaagtga attatataaa tataaagtag taagaattga accattaggt 1440ctagcaccct ccaaggcaaa aagaagagta gtagaaagag agaaaagagc aataggacta 1500ggagctatgt tccttgggtt cttgggagca gcaggaagca cgatgggcgc agcgtcactg 1560acgctgacgg tacaggccag acagctattg tctggtatag tgcaacagca aaacaatttg 1620ctgaaggcta tagaggcgca acagcacctg ttgcaactca cagtctgggg cgttaaacag 1680ctccaggcaa gagtcctggc tgtggaaagc tacctaaggg atcaacagct cctaggaatt 1740tggggttgct ctggaaaaca catttgcacc accaatgtgc cctggaactc tagctggagt 1800aataaaactc taaaatcaat ttgggataac atgacctgga tggagtggga aagagaaatt 1860gacaattaca cagggataat atacaattta cttgaagaat cgcaaaccca gcaagaaaga 1920aatgaacaag acctattgaa attggaccaa tgggcaagtt tgtggaattg gtttagcata 1980acaaaatggc tgtggtatat aaaaatattt ataatgatag taggaggctt gataggctta 2040aggatagttt ttgctgtgct ttctatagta aatagagtta ggcagggata ttcacctctg 2100tcgtttcaga ccctcctccc agccccgcgg ggacccgaca ggcccgaagg aatagaagaa 2160gaaggtggag agcaaggcta a 2181542214DNAHIV-1 54atgagagtga gggagacagt gaggaattat cagcacttgt ggagatgggg catcatgctc 60cttgggatgt taatgatatg tagtgctgca gaccagctgt gggtcacagt gtattatggg 120gtacctgtgt ggaaagaagc aaccactact ctattttgtg catcagatgc taaagcacat 180aaagcagagg cacataatat ctgggctaca catgcctgtg taccaacaga ccccaatcca 240cgagaaataa tactaggaaa tgtcacagaa aactttaaca tgtggaagaa taacatggta 300gagcagatgc atgaggatat aatcagttta tgggatcaaa gtctaaaacc atgtgtaaaa 360ttaaccccac tctgtgttac tttaaactgc actacatatt ggaatggaac tttacagggg 420aatgaaacta aagggaagaa tagaagtgac ataatgacat gctctttcaa tataaccaca 480gaaataagag gtagaaagaa gcaagaaact gcacttttct ataaacttga tgtggtacca 540ctagaggata aggatagtaa taagactacc aactatagca gctatagatt aataaattgc 600aatacctcag tcgtgacaca ggcgtgtcca aaagtaacct ttgagccaat tcccatacat 660tattgtgccc cagctggatt tgcgattctg aaatgtaata ataagacgtt caatggaacg 720ggtccatgca aaaatgtcag cacagtacag tgtacacatg gaattaggcc agtagtgtca 780actcaactgt tgttgaatgg cagtctagca gaagaagaga taataattag atctgaaaat 840atcacaaata atgcaaaaac cataatagta cagcttaatg agtctgtaac aattgattgc 900ataaggccca acaacaatac aagaaaaagt atacgcatag gaccagggca agcactctat 960acaacagaca taatagggaa tataagacaa gcacattgta atgttagtaa agtaaaatgg 1020ggaagaatgt taaaaagggt agctgaaaaa ttaaaagacc ttcttaacca gacaaagaac 1080ataacttttg aaccatcctc aggaggggac ccagaaatta caacacacag ctttaattgt 1140ggaggggaat tcttctactg caatacatca ggactattta atgggagtct gcttaatgag 1200cagtttaatg agacatcaaa tgatactctc acactccaat gcagaataaa acaaattata 1260aacatgtggc aaggagtagg aaaagcaatg tatgcccctc ccattgcagg accaatcagc 1320tgttcatcaa atattacagg actattgttg acaagagatg gtggtaatac tggtaatgat 1380tcagagatct tcagacctgg agggggagat atgagagaca attggagaag tgaattatac 1440aaatataaag tagtaagaat tgaaccaatg ggtctagcac ccaccagggc aaaaagaaga 1500gtggtggaaa gagaaaaaag agcaatagga ctgggagcta tgttccttgg gttcttggga 1560gcggcaggaa gcacgatggg cgcagcgtca ctgacgctga cggtacaggc cagacagtta 1620ttgtctggta tagtgcaaca gcaaaacaat ttgctgagag ctatagaggc gcaacagcat 1680ctgttgcaac tcacagtctg gggcattaaa cagctccagg caagagtcct ggctatggaa 1740agctacctaa aggatcaaca gctcctagga atttggggtt gctctggaaa acacatttgc 1800accactactg tgccctggaa ctctacctgg agtaatagat ctgtagagga gatttggaat 1860aatatgacct ggatgcagtg ggaaagagaa attgagaatt acacaggttt aatatacacc 1920ttaattgaag aatcgcaaac ccagcaagaa aagaatgaac aagaactatt gcaattggat 1980aaatgggcaa gtttgtggaa ttggtttagt ataacaaaat ggctgtggta tataaaaata 2040ttcataatga tagtaggagg cttaataggt ttaagaatag tttttgctgt gctttcttta 2100gtaaatagag ttaggcaggg atattcacct ctgtcttttc agaccctcct cccagccccg 2160aggggacccg acaggcccga aggaatagaa gaagaaggtg gagagcaagg ctaa 2214552265DNAHIV-1 55atgagagtga gggggataga gaggaattat cagcacttat ggtggagatg gggcaccatg 60ctccttggga tattgatgat atgtagtgct gcagaacaat tgtgggtcac agtttattat 120ggggtacctg tgtggaaaga agcaaccact actctatttt gtgcatcaga tgctaaagca 180tataaagcag aggcacacaa tatctgggct acacatgcct gtgtaccaac agaccccaac 240ccacaagaaa tagtactaga aaatgtcaca gaaaacttta acatgtggaa aaatagcatg 300gtggagcaga tgcatgagga tgtaatcagt ttatgggatc aaagcctaaa accatgtgta 360aaattaaccc cactctgtgt cactttaaac tgcactaatg ccactgccac taatgccact 420gccactagtc aaaatagcac tgatggtagt aataaaactg ttaacacaga cacaggaatg 480aaaaactgct ctttcaatgt aaccacagat ctaaaagata agaagaggca agactatgca 540cttttctata aacttgatgt ggtacgaata gatgataaga ataccaatgg tactaatacc 600aactatagat taataaattg taatacctca gccattacac aagcgtgtcc aaagataacc 660tttgagccaa ttcccataca ttattgtgcc ccagctggat atgcgattct aaaatgtaat 720aataagacat tcaatgggac gggtccatgc aaaaacgtca gcacagtaca gtgtacacat 780gggattaggc cagtagtgtc aactcaactg ttgttgaatg gcagtctagc agaggaagag 840atagtaatta gatctgaaaa cctcacaaat aatgctaaaa ttataatagt acagcttaat 900gaagctgtaa caattaattg cacaagaccc tccaacaata caagacgaag tgtacatata 960ggaccagggc aagcaatcta ttcaacagga caaataatag gagatataag aaaagcacat 1020tgtaatatta gtagaaaaga atggaatagc accttacaac aggtaactaa aaaattagga 1080agcctgttta acacaacaaa aataattttt aatgcatcct cgggagggga cccagaaatt 1140acaacacaca gctttaattg taacggggaa ttcttctact gcaatacagc aggactgttt 1200aatagtacat ggaacaggac aaatagtgaa tggataaata gtaaatggac aaataagaca 1260gaagatgtaa atatcacact tcaatgcaga ataaaacaaa ttataaacat gtggcaggga 1320gtaggaaaag caatgtatgc ccctcccgtt agtggaataa tccgatgttc atcaaatatt 1380acaggactgt tgctgacaag agatggtggt ggtgcagata ataataggca gaatgagacc 1440ttcagacctg ggggaggaga tatgagagac aattggagaa gtgaattata caaatataaa 1500gtagtaagaa ttgaaccact aggtatagca cccaccaagg caaggagaag agtggtggaa 1560agagaaaaaa gagcaatagg actgggagcc ttgttccttg ggttcttggg aacagcagga 1620agcacgatgg gcgcagtgtc aatgacgctg acggtacagg ccagacaagt attgtctggt 1680atagtgcaac agcaaaacaa tctgctgagg gctatagagg cgcaacagca tctgttgcaa 1740ctcacagtct ggggcattaa acagctccag gcaagaatcc tggctgtgga aagctaccta 1800aaggatcaac agctcctagg aatttggggt tgctctggaa aacacatttg caccactaat 1860gtgccctgga actctagctg gagtaataaa tctctaaatt atatttggaa taacatgacc 1920tggatggagt gggaaaagga aattgacaat tacacagaat taatatacag cttaattgaa 1980gtatcgcaaa tccagcaaga aaagaatgaa caagaactat tgaaattgga cagttgggca 2040agtttgtgga attggtttag cataacaaaa tggctgtggt atataaaaat attcataatg 2100atagtaggag gcttgatagg cttaagaata gtttttgctg tgctttcttt agtaaataga 2160gttaggcagg gatactcacc tctgtcgttt cagaccctta tcccagcctc gaggggaccc 2220gacaggcccg aaggaacaga aggagaaggt ggagagcaag gctaa 2265565326DNAArtificial SequenceMVA shuttle plasmid pLAS-1 56gaattcgttg gtggtcgcca tggatggtgt tattgtatac tgtctaaacg cgttagtaaa 60acatggcgag gaaataaatc atataaaaaa tgatttcatg attaaaccat gttgtgaaaa 120agtcaagaac gttcacattg gcggacaatc taaaaacaat acagtgattg cagatttgcc 180atatatggat aatgcggtat ccgatgtatg caattcactg tataaaaaga atgtatcaag 240aatatccaga tttgctaatt tgataaagat agatgacgat gacaagactc ctactggtgt 300atataattat tttaaaccta aagatgccat tcctgttatt atatccatag gaaaggatag 360agatgtttgt gaactattaa tctcatctga taaagcgtgt gcgtgtatag agttaaattc 420atataaagta gccattcttc ccatggatgt ttcctttttt accaaaggaa atgcatcatt 480gattattctc ctgtttgatt tctctatcga tgcggcacct ctcttaagaa gtgtaaccga 540taataatgtt attatatcta gacaccagcg tctacatgac gagcttccga gttccaattg 600gttcaagttt tacataagta taaagtccga ctattgttct atattatata tggttgttga 660tggatctgtg atgcatgcaa tagctgataa tagaacttac gcaaatatta gcaaaaatat 720attagacaat actacaatta acgatgagtg tagatgctgt tattttgaac cacagattag 780gattcttgat agagatgaga tgctcaatgg atcatcgtgt gatatgaaca gacattgtat 840tatgatgaat ttacctgatg taggcgaatt tggatctagt atgttgggga aatatgaacc 900tgacatgatt aagattgctc tttcggtggc tgggtaccag gcgcgccttt cattttgttt 960ttttctatgc tataaatggt gagcaagggc gaggagctgt tcaccggggt ggtgcccatc 1020ctggtcgagc tggacggcga cgtaaacggc cacaagttca gcgtgtccgg cgagggcgag 1080ggcgatgcca cctacggcaa gctgaccctg aagttcatct gcaccaccgg caagctgccc 1140gtgccctggc ccaccctcgt gaccaccctg acctacggcg tgcagtgctt cagccgctac 1200cccgaccaca tgaagcagca cgacttcttc aagtccgcca tgcccgaagg ctacgtccag 1260gagcgcacca tcttcttcaa ggacgacggc aactacaaga cccgcgccga ggtgaagttc 1320gagggcgaca ccctggtgaa ccgcatcgag ctgaagggca tcgacttcaa ggaggacggc 1380aacatcctgg ggcacaagct ggagtacaac tacaacagcc acaacgtcta tatcatggcc 1440gacaagcaga agaacggcat caaggtgaac ttcaagatcc gccacaacat cgaggacggc 1500agcgtgcagc tcgccgacca ctaccagcag aacaccccca tcggcgacgg ccccgtgctg 1560ctgcccgaca accactacct gagcacccag tccgccctga gcaaagaccc caacgagaag 1620cgcgatcaca tggtcctgct ggagttcgtg accgccgccg ggatcactct cggcatgcac 1680gagctgtaca agtaagagct cggttgttga tggatctgtg atgcatgcaa tagctgataa 1740tagaacttac gcaaatatta gcaaaaatat attagacaat actacaatta acgatgagtg 1800tagatgctgt tattttgaac cacagattag gattcttgat agagatgaga tgctcaatgg 1860atcatcgtgt gatatgaaca gacattgtat tatgatgaat ttacctgatg taggcgaatt 1920tggatctagt atgttgggga aatatgaacc tgacatgatt aagattgctc tttcggtggc 1980tggcggcccg ctcgaggccg ctggtaccca acctaaaaat tgaaaataaa tacaaaggtt 2040cttgagggtt gtgttaaatt gaaagcgaga aataatcata aataagcccg gggatcctct 2100agagtcgacc tgcagggaaa gttttatagg tagttgatag aacaaaatac ataattttgt 2160aaaaataaat cactttttat actaatatga cacgattacc aatacttttg ttactaatat 2220cattagtata cgctacacct tttcctcaga catctaaaaa aataggtgat gatgcaactt 2280tatcatgtaa tcgaaataat acaaatgact acgttgttat gagtgcttgg tataaggagc 2340ccaattccat tattctttta gctgctaaaa gcgacgtctt gtattttgat aattatacca 2400aggataaaat atcttacgac tctccatacg atgatctagt tacaactatc acaattaaat 2460cattgactgc tagagatgcc ggtacttatg tatgtgcatt ctttatgaca tcgcctacaa 2520atgacactga taaagtagat tatgaagaat actccacaga gttgattgta aatacagata 2580gtgaatcgac tatagacata atactatctg gatctacaca ttcaccagaa actagttaag 2640cttgtctccc tatagtgagt cgtattagag cttggcgtaa tcatggtcat agctgtttcc 2700tgtgtgaaat tgttatccgc tcacaattcc acacaacata cgagccggaa gcataaagtg 2760taaagcctgg ggtgcctaat gagtgagcta actcacatta attgcgttgc gctcactgcc 2820cgctttcgag tcgggaaacc tgtcgtgcca gctgcattaa tgaatcggcc aacgcgcggg 2880gagaggcggt ttgcgtattg ggcgctcttc cgcttcctcg ctcactgact cgctgcgctc 2940ggtcgttcgg ctgcggcgag cggtatcagc tcactcaaag gcggtaatac ggttatccac 3000agaatcaggg gataacgcag gaaagaacat gtgagcaaaa ggccagcaaa aggccaggaa 3060ccgtaaaaag gccgcgttgc tggcgttttt cgataggctc cgcccccctg acgagcatca 3120caaaaatcga cgctcaagtc agaggtggcg aaacccgaca ggactataaa gataccaggc 3180gtttccccct ggaagctccc tcgtgcgctc tcctgttccg accctgccgc ttaccggata 3240cctgtccgcc tttctccctt cgggaagcgt ggcgctttct catagctcac gctgtaggta 3300tctcagttcg gtgtaggtcg ttcgctccaa gctgggctgt gtgcacgaac cccccgttca 3360gcccgaccgc tgcgccttat ccggtaacta tcgtcttgag tccaacccgg taagacacga 3420cttatcgcca ctggcagcag ccactggtaa caggattagc agagcgaggt atgtaggcgg 3480tgctacagag ttcttgaagt ggtggcctaa ctacggctac actagaagga cagtatttgg 3540tatctgcgct ctgctgaagc cagttacctt cggaaaaaga gttggtagct cttgatccgg 3600caaacaaacc accgctggta gcggtggttt ttttgtttgc aagcagcaga ttacgcgcag 3660aaaaaaagga tctcaagaag atcctttgat cttttctacg gggtctgacg ctcagtggaa 3720cgaaaactca cgttaaggga ttttggtcat gagattatca aaaaggatct tcacctagat 3780ccttttaaat taaaaatgaa gttttaaatc aatctaaagt atatatgagt aaacttggtc 3840tgacagttac caatgcttaa tcagtgaggc acctatctca gcgatctgtc tatttcgttc 3900atccatagtt gcctgactcc ccgtcgtgta gataactacg atacgggagg gcttaccatc 3960tggccccagt gctgcaatga taccgcgaga cccacgctca ccggctccag atttatcagc 4020aataaaccag ccagccggaa gggccgagcg cagaagtggt cctgcaactt tatccgcctc 4080catccagtct attaattgtt gccgggaagc tagagtaagt agttcgccag ttaatagttt 4140gcgcaacgtt gttggcattg ctacaggcat cgtggtgtca cgctcgtcgt ttggtatggc 4200ttcattcagc tccggttccc aacgatcaag gcgagttaca tgatccccca tgttgtgcaa 4260aaaagcggtt agctccttcg gtcctccgat cgttgtcaga agtaagttgg ccgcagtgtt 4320atcactcatg gttatggcag cactgcataa ttctcttact gtcatgccat ccgtaagatg 4380cttttctgtg actggtgagt actcaaccaa gtcattctga gaatagtgta tgcggcgacc 4440gagttgctct tgcccggcgt caatacggga taataccgcg ccacatagca gaactttaaa 4500agtgctcatc attggaaaac gttcttcggg gcgaaaactc tcaaggatct taccgctgtt 4560gagatccagt tcgatgtaac ccactcgtgc acccaactga tcttcagcat cttttacttt 4620caccagcgtt tctgggtgag caaaaacagg aaggcaaaat gccgcaaaaa agggaataag 4680ggcgacacgg aaatgttgaa tactcatact cttccttttt caatattatt gaagcattta 4740tcagggttat tgtctcatga gcggatacat atttgaatgt atttagaaaa ataaacaaat 4800aggggttccg cgcacatttc cccgaaaagt gccacctgac gtctaagaaa ccattattat 4860catgacatta acctataaaa ataggcgtat cacgaggccc tttcgtctcg cgcgtttcgg 4920tgatgacggt gaaaacctct gacacatgca gctcccggag acggtcacag cttgtctgta 4980agcggatgcc gggagcagac aagcccgtca gggcgcgtca gcgggtgttg gcgggtgtcg 5040gggctggctt aactatgcgg catcagagca gattgtactg agagtgcacc atatgcggtg 5100tgaaataccg cacagatgcg taaggagaaa ataccgcatc aggcgccatt cgccattcag 5160gctgcgcaac tgttgggaag ggcgatcggt gcgggcctct tcgctattac gccagctggc 5220gaaaggggga tgtgctgcaa ggcgattaag ttgggtaacg ccagggtttt cccagtcacg 5280acgttgtaaa acgacggcca gtgaattgga tttaggtgac actata 5326575143DNAMVA shuttle plasmid pLAS-2 57cctcctgaaa aactggaatt taatacacca tttgtgttca tcatcagaca tgatattact 60ggatttatat tgtttatggg taaggtagaa tctccttaat atgggtacgg tgtaaggaat 120cattatttta tttatattga tgggtacgtg aaatctgaat tttcttaata aatattattt 180ttattaaatg tgtatatgtt gttttgcgat agccatgtat ctactaatca gatctattag 240agatattatt aattctggtg caatatgaca aaaattatac actaattagc gtctcgtttc 300agacatggat ctgtcacgaa ttaatacttg gaagtctaag cagctgaaaa gctttctctc 360tagcaaagat gcatttaagg cggatgtcca tggacatagt gccttgtatt atgcaatagc 420tgataataac gtgcgtctag tatgtacgtt gttgaacgct ggagcattga aaaatcttct 480agagaatgaa tttccattac atcaggcagc cacattggaa gataccaaaa tagtaaagat 540tttgctattc agtggactgg atgattcgag gtaccaggcg cgccctttca ttttgttttt 600ttctatgcta taaatggtga gcaagggcga ggagctgttc accggggtgg tgcccatcct 660ggtcgagctg gacggcgacg taaacggcca caagttcagc gtgtccggcg agggcgaggg 720cgatgccacc tacggcaagc tgaccctgaa gttcatctgc accaccggca agctgcccgt 780gccctggccc accctcgtga ccaccctgac ctacggcgtg cagtgcttca gccgctaccc 840cgaccacatg aagcagcacg acttcttcaa gtccgccatg cccgaaggct acgtccagga 900gcgcaccatc ttcttcaagg acgacggcaa ctacaagacc cgcgccgagg tgaagttcga 960gggcgacacc ctggtgaacc gcatcgagct gaagggcatc gacttcaagg aggacggcaa 1020catcctgggg cacaagctgg agtacaacta caacagccac aacgtctata tcatggccga 1080caagcagaag aacggcatca aggtgaactt caagatccgc cacaacatcg aggacggcag 1140cgtgcagctc gccgaccact accagcagaa cacccccatc ggcgacggcc ccgtgctgct 1200gcccgacaac cactacctga gcacccagtc cgccctgagc aaagacccca acgagaagcg 1260cgatcacatg gtcctgctgg agttcgtgac cgccgccggg atcactctcg gcatgcacga 1320gctgtacaag taagagctcg ctttctctct agcaaagatg catttaaggc ggatgtccat 1380ggacatagtg ccttgtatta tgcaatagct gataataacg tgcgtctagt atgtacgttg 1440ttgaacgctg gagcattgaa aaatcttcta gagaatgaat ttccattaca tcaggcagcc 1500acattggaag ataccaaaat agtaaagatt ttgctattca gtggactgga tgattctccg 1560gatggtaccc aacctaaaaa ttgaaaataa atacaaaggt tcttgagggt tgtgttaaat 1620tgaaagcgag aaataatcat aaataagccc ggggatcctc tagagtcgac ctgcaggcat 1680gctcgagcgg ccgccagtgt gatggatatc tgcagaattc ggcttggggg gctgcaggtg 1740gatgcgatca tgacgtcctc tgcaatggat aacaatgaac ctaaagtact agaaatggta 1800tatgatgcta caattttacc cgaaggtagt agcatggatt gtataaacag acacatcaat 1860atgtgtatac aacgcaccta tagttctagt ataattgcca tattggatag attcctaatg 1920atgaacaagg atgaactaaa taatacacag tgtcatataa ttaaagaatt tatgacatac 1980gaacaaatgg cgattgacca ttatggagaa tatgtaaacg ctattctata tcaaattcgt 2040aaaagaccta atcaacatca caccattaat ctgtttaaaa aaataaaaag aacccggtat 2100gacactttta aagtggatcc cgtagaattc gtaaaaaaag ttatcggatt tgtatctatc 2160ttgaacaaat ataaaccggt ttatagttac gtcctgtacg agaacgtcct gtacgatgag 2220ttcaaatgtt tcattgacta cgtggaaact aagtatttct aaaattaatg atgcattaat 2280ttttgtattg attctcaatc ctaaaaacta aaatatgaat aagtattaaa catagcggtg 2340tactaattga tttaacataa aaaatagttg ttaactaatc atgaggactc tacttattag 2400atatattctt tggagaaatg acaacgatca aaccgggcat gcaagcttgt ctccctatag 2460tgagtcgtat tagagcttgg cgtaatcatg gtcatagctg tttcctgtgt gaaattgtta 2520tccgctcaca attccacaca acatacgagc cggaagcata aagtgtaaag cctggggtgc 2580ctaatgagtg agctaactca cattaattgc gttgcgctca ctgcccgctt tcgagtcggg 2640aaacctgtcg tgccagctgc attaatgaat cggccaacgc gcggggagag gcggtttgcg 2700tattgggcgc tcttccgctt cctcgctcac tgactcgctg cgctcggtcg ttcggctgcg 2760gcgagcggta tcagctcact caaaggcggt aatacggtta tccacagaat caggggataa 2820cgcaggaaag aacatgtgag caaaaggcca gcaaaaggcc aggaaccgta aaaaggccgc 2880gttgctggcg tttttcgata ggctccgccc ccctgacgag catcacaaaa atcgacgctc 2940aagtcagagg tggcgaaacc cgacaggact ataaagatac caggcgtttc cccctggaag 3000ctccctcgtg cgctctcctg ttccgaccct gccgcttacc

ggatacctgt ccgcctttct 3060cccttcggga agcgtggcgc tttctcatag ctcacgctgt aggtatctca gttcggtgta 3120ggtcgttcgc tccaagctgg gctgtgtgca cgaacccccc gttcagcccg accgctgcgc 3180cttatccggt aactatcgtc ttgagtccaa cccggtaaga cacgacttat cgccactggc 3240agcagccact ggtaacagga ttagcagagc gaggtatgta ggcggtgcta cagagttctt 3300gaagtggtgg cctaactacg gctacactag aaggacagta tttggtatct gcgctctgct 3360gaagccagtt accttcggaa aaagagttgg tagctcttga tccggcaaac aaaccaccgc 3420tggtagcggt ggtttttttg tttgcaagca gcagattacg cgcagaaaaa aaggatctca 3480agaagatcct ttgatctttt ctacggggtc tgacgctcag tggaacgaaa actcacgtta 3540agggattttg gtcatgagat tatcaaaaag gatcttcacc tagatccttt taaattaaaa 3600atgaagtttt aaatcaatct aaagtatata tgagtaaact tggtctgaca gttaccaatg 3660cttaatcagt gaggcaccta tctcagcgat ctgtctattt cgttcatcca tagttgcctg 3720actccccgtc gtgtagataa ctacgatacg ggagggctta ccatctggcc ccagtgctgc 3780aatgataccg cgagacccac gctcaccggc tccagattta tcagcaataa accagccagc 3840cggaagggcc gagcgcagaa gtggtcctgc aactttatcc gcctccatcc agtctattaa 3900ttgttgccgg gaagctagag taagtagttc gccagttaat agtttgcgca acgttgttgg 3960cattgctaca ggcatcgtgg tgtcacgctc gtcgtttggt atggcttcat tcagctccgg 4020ttcccaacga tcaaggcgag ttacatgatc ccccatgttg tgcaaaaaag cggttagctc 4080cttcggtcct ccgatcgttg tcagaagtaa gttggccgca gtgttatcac tcatggttat 4140ggcagcactg cataattctc ttactgtcat gccatccgta agatgctttt ctgtgactgg 4200tgagtactca accaagtcat tctgagaata gtgtatgcgg cgaccgagtt gctcttgccc 4260ggcgtcaata cgggataata ccgcgccaca tagcagaact ttaaaagtgc tcatcattgg 4320aaaacgttct tcggggcgaa aactctcaag gatcttaccg ctgttgagat ccagttcgat 4380gtaacccact cgtgcaccca actgatcttc agcatctttt actttcacca gcgtttctgg 4440gtgagcaaaa acaggaaggc aaaatgccgc aaaaaaggga ataagggcga cacggaaatg 4500ttgaatactc atactcttcc tttttcaata ttattgaagc atttatcagg gttattgtct 4560catgagcgga tacatatttg aatgtattta gaaaaataaa caaatagggg ttccgcgcac 4620atttccccga aaagtgccac ctgacgtcta agaaaccatt attatcatga cattaaccta 4680taaaaatagg cgtatcacga ggccctttcg tctcgcgcgt ttcggtgatg acggtgaaaa 4740cctctgacac atgcagctcc cggagacggt cacagcttgt ctgtaagcgg atgccgggag 4800cagacaagcc cgtcagggcg cgtcagcggg tgttggcggg tgtcggggct ggcttaacta 4860tgcggcatca gagcagattg tactgagagt gcaccatatg cggtgtgaaa taccgcacag 4920atgcgtaagg agaaaatacc gcatcaggcg ccattcgcca ttcaggctgc gcaactgttg 4980ggaagggcga tcggtgcggg cctcttcgct attacgccag ctggcgaaag ggggatgtgc 5040tgcaaggcga ttaagttggg taacgccagg gttttcccag tcacgacgtt gtaaaacgac 5100ggccagtgaa ttggatttag gtgacactat agaatacgaa ttc 5143583077DNAHIV-1 clade A 58atgggtgcga gagcgtcagt attaagtggg ggaaaattag atgcatggga gaaaattcgg 60ttaaggccag ggggaaagaa aaaatataga ctgaaacact tagtatgggc aagcagggag 120ctggaaaaat tcgtacttaa ccctagcctt ttagaaactt cagaaggatg tcagcaaata 180atgaaccaaa tacaaccagc tcttcagaca ggaacagaag aacttagatc attatttaat 240gcagtagcaa ccctctattg tgtacatcaa cggatagagg taaaagacac caaggaagct 300ttagataaag tagaggaaat acaaaacaag agcaagcaaa agacacaaca ggcagcagct 360gatacaggaa acaacagcaa ggtcagccat aattacccta tagtgcaaaa tgcacaaggg 420caaatgatac atcagtcctt atcaccaagg actttgaatg catgggtaaa ggtaatagaa 480gaaaggggtt tcagcccaga agtaataccc atgttctcag cattatcaga aggagccatc 540ccacaagatt taaatatgat gctgaacata gtggggggac accaggcagc tatgcaaatg 600ttaaaagaaa ctatcaatga ggaagctgca gaatgggaca ggttacatcc agcacaggca 660gggcctattc caccaggcca gataagagac ccaaggggaa gtgacatagc aggaactact 720agtacccctc aggaacaaat aacatggatg acaaacaacc cacctatccc agtgggagac 780atctataaaa gatggataat cctaggatta aataaaatag taagaatgta tagccctgtt 840agcattttag atataaaaca ggggccaaaa gaacccttca gagactatgt agataggttc 900tttaaagttc tcagagccga acaagctaca caggaagtaa aaggctggat gacagagacc 960ctgctggttc aaaatgcaaa tccagattgt aagtccattt taagagcatt aggaacaggg 1020gctacattag aagaaatgat gacagcatgt cagggagtgg gaggacccgg ccataaagca 1080agggttttag ctgaggcaat gagtcaagca caacaggcaa atgtaatgat gcagaggggc 1140agctttaagg ggcagaaaag aattaagtgc ttcaactgtg gcaaagaggg acacctagcc 1200agaaattgca gagcccctag gaaaaaaggc tgttggaagt gtgggaaaga aggacaccaa 1260atgaaagatt gcaatgagag acaggctaat tttttaggga aaatttggcc ttccagcaag 1320gggaggccag gaaattttcc ccagagcaga ccggagccaa cagccccacc agcagagatc 1380tttgggatgg gggaagagat aacctcccct ccgaagcagg agcagaaaga gagggaacaa 1440accccaccct ttgtttccct caaatcactc tttggcaacg acccgttgtc acagtaaaag 1500taggaggaga aatgagagaa gctctattag atacaggagc agatgataca gtattagaag 1560atataaattt gccaggaaaa tggaaaccaa aaatgatagg gggaattgga ggttttatca 1620aggtaaaaca atatgatcag gtatctatag aaatttgtgg aaaaaaggct ataggtacgg 1680tattagtagg acctacacct gtcaacataa ttggaagaaa tatgttgact cagattggtt 1740gtaccttaaa ttttccaatt agtcctattg agactgtacc agtaacatta aagccaggaa 1800tggatggccc aagggttaaa caatggccat tgacagaaga gaaaataaaa gcattgacag 1860aaatttgtaa agagatggaa aaggaaggaa aaatttcaaa aattgggcct gaaaatccat 1920acaatactcc aatatttgca ataaagaaaa aagatagcac taaatggagg aaattagtag 1980atttcagaga gctcaataaa agaacacaag acttttggga agttcaatta gggataccgc 2040atccagcggg cctaaaaaag aaaaaatcag taacagtact agaggtgggg gatgcatatt 2100tttcagttcc cctagataaa aactttagaa agtatactgc atttaccata cctagtttaa 2160ataatgaaac accaggaatc aggtatcagt acaatgtgct tccacaagga tggaaaggat 2220caccagcaat attccagtgc agtatgacaa aaatcttaga gccctttaga tcaaaaaatc 2280cagaaataat tatctatcaa tacatgcacg acttgtatgt aggatcagat ttagaaatag 2340ggcagcatag agcaaaaata gaagaattaa gagctcatct actgagctgg ggatttacta 2400caccagacaa aaagcatcag aaagaacctc cattcctttg gatgggatat gagctccatc 2460ctgacaagtg gacagtccag cctatagagc tgccagaaaa agaaagctgg actgtcaatg 2520atatacagaa attagtggga aaactaaatt gggccagtca aatttatcca ggaattaaag 2580taaagcaatt gtgtaaactt ctcaggggag ccaaagccct aacagatata gtaacactga 2640ctgaggaagc agaattagaa ttagcagaga acagggagat tctaaaagac cctgtgcatg 2700gggtatatta tgacccatca aaagacttaa tagcagaaat acagaaacaa gggcaagacc 2760aatggacata ccaaatttat caggagccat ttaaaaatct aaaaacagga aaatatgcaa 2820gaaaaaggtc tgctcacact aatgatgtaa gacaattagc agaagtagtg cagaaagtgg 2880tcatggaaag catagtaata tggggaaaga ctcctaaatt taaactaccc atacaaaaag 2940agacatggga gacatggtgg atggactatt ggcaagctac ctggattcct gagtgggagt 3000ttgtcaatac ccctccccta gtaaaattat ggtaccagtt agagaaagac cccatagcag 3060gagcagagac tttctaa 3077592241DNAHIV-1 Clade A 59atgagagtga tggggataca gatgaattgt cagcacttat tgagatgggg aactatgatc 60ttgggattga taataatctg taatgctgta aacagcaact tgtgggttac tgtctattat 120ggggtacctg tgtggaaaga tgcagagacc accttatttt gtgcatcaga tgctaaagca 180tataaaacag aaaagcataa tgtctgggct acacatgcct gtgtgcccac agaccccaac 240ccacaagaaa tacctttgga aaatgtgaca gaagagttta acatgtggaa aaataaaatg 300gtagaacaaa tgcatacaga tataatcagt ctatgggacc aaagcctaca gccatgtgta 360aagttaaccc ctctctgcat tactttaaac tgtacagatg ttactaatgt tacagatgtt 420agtggtacga ggggcaacat caccatcatg aaagagatgg agggagaaat aaaaaactgt 480tctttcaata tgaccacaga aataagggat aagaaacaga aagtatattc actcttttat 540agacttgatg tagtaccaat aaatcagggt aatagtagta gtaaaaacag tagtgagtat 600agattaataa gttgtaatac ctcagccatt acacaagctt gcccaaaggt aagctttgag 660ccaattccca tacattattg tgccccagct ggttttgcga tcctgaagtg tagggataag 720gagttcaatg gaacagggga atgcaagaat gtcagcacag tccaatgcac acatggaatc 780aagccagtag tatcaactca actactgtta aatggcagtc tagcagaaga aaaggtaaaa 840atcagaactg aaaatatcac aaacaatgcc aaaactatag tagtacaact tgtcgagcct 900gtgagaatta attgtactag acctaataac aatacaagag agagtgtgcg tatagggcca 960ggacaagcat tctttgcaac aggtgacata ataggggata taagacaagc acattgtaat 1020gtcagtagat cacaatggaa taagacttta caacaggtag ctgaacaatt aagagaacac 1080tttaaaaaca aaacaataat atttaacagt tcctcaggag gggatctaga aatcacaaca 1140catagtttca attgtggagg agaattcttc tattgtaata catcaggtct gttcaatagc 1200acctggaata ccagcatgtc agggtcaagt aacacggaga caaatgacac tataactctc 1260caatgcagaa taaagcaaat tataaatatg tggcagagaa caggacaagc aatatatgcc 1320cctcccatcc agggagtgat aaggtgtgaa tcaaacatca caggactact gttaacaaga 1380gatggtgggg aggagaagaa cagtacaaat gaaatcttca gacctggagg aggagatatg 1440agggacaact ggagaagtga attatataag tataaagtag taaaaattga accactagga 1500gtagcaccca ccagggcaag gagaagagtg gtgggaagag aaaaaagagc agttggaata 1560ggagctgttt tccttgggtt cttaggagca gcaggaagca ctatgggcgc ggcgtcaata 1620acgctgacgg tacaggccag gcaattattg tctggcatag tgcagcagca gagcaatttg 1680ctgagggcta tagaggctca acaacatatg ttgaaactca cggtctgggg cattaaacag 1740ctccaggcaa gagtccttgc tgtggaaaga tacctaaggg atcaacagct cctaggaatt 1800tggggctgct ctggaaaact catctgcacc actaatgtgc cctggaactc tagttggagt 1860aataaatctc aggatgaaat atggaacaac atgacctggc tgcaatggga taaagaaatt 1920agcaattaca taaacctaat atatagtcta attgaagaat cgcaaaacca gcaggaaaag 1980aatgaacaag acttattggc attgggcaag tgggcaaatc tgtggacttg gtttgacata 2040tcaaattggc tgtggtatat aagaatattt ataatgatag taggaggctt aataggatta 2100agaatagttt ttgctgtgct tgctgtaata aagagagtta ggcagggata ctcacctgtg 2160tcatttcaga tccatgcccc aaacccaggg ggtctcgaca ggcccggaag aatcgaagga 2220gaaggtggag agcaagacta a 2241602211DNAHIV-1 Clade A 60atgagagtga tggggataca gatgaattgt caaagcttgt ggagatgggg aactatgatc 60ttgggaatgt taatgatttg tagtgttgca ggaaacttgt gggttactgt ctactatggg 120gtacctgtgt ggaaagaggc agacaccacc ttattttgtg tatcaaatgc tagagcatat 180gatacagaag tgcataatgt ctgggctaca catgcctgtg tacctacgga ccccaaccca 240caagaaatag atttggagaa tgtgacagaa gagtttaaca tgtggaaaaa taacatggta 300gagcaaatgc atacagatat aattagtcta tgggaccaaa gcctaaaacc atgtgtaaag 360ttaacccctc tctgcgttac tttagattgt ggctataatg taaccaactt gaatttcacc 420agtaacatga aaggagacat aacaaactgc tcttacaata tgaccacaga aataagggat 480aggaaacaga aagtgtattc acttttctat aggcttgata tagtaccaat taatgaagaa 540aagaataata gcagggagac tagtccgtat agattaataa attgtaatac ctcagccatt 600acacaagctt gtcctaaggt atcttttgaa ccaattccca tacattattg tgccccagcc 660ggttttgcga ttctaaaatg taaggatgca gagttcaatg gaacagggcc atgcaagaat 720gtcagcacag tacaatgtac acatggaatc aggccagtaa tatcaactca actgctgtta 780aatggcagtt tagcagagaa tgggacaaag attagatctg aaaatatcac aaacaatgcc 840aaaaccataa tagtacaact taacgagacc gtacaaatta attgtaccag acctagcaac 900aatacaagaa aaagtgtacg tataggacca ggacaagcat tctatacaac aggtgatata 960acaggggata taagacaagc atattgtaat gtcagtagac aagaatggga acaagcatta 1020aaaggggtag ttatacaatt aagaaaacac tttaacaaaa caataatctt taacagttcc 1080tcaggagggg atttagaaat tacaacacat agttttaatt gtggaggaga attcttctat 1140tgtgatacat caggcctgtt taatagcacc tggaacacga acaccaccga gccaaacaac 1200acaacgtcaa atggcactat cattctccaa tgcagaataa agcaaattat aaatctgtgg 1260cagagaaccg gacaagcaat gtatgcccct cccatccaag gggtaataag gtgtgattcc 1320aacattacag gactactatt aacaagagat ggtggagtag ttgatagtat aaatgaaacc 1380gaaatcttca gacctggagg aggagatatg agggacaatt ggagaagtga attatataag 1440tataaagtag taaaaattga accactagga gtagcaccca ccggggcaaa gagaagagtg 1500gtggagagag aaaaaagagc agttggcata ggagctgtat tcattgggtt cttaggagca 1560gcaggaagca ctatgggcgc ggcgtcaata acgctgacgg tacaggccag acaattattg 1620tctggcatag tgcaacagca aagcaatttg ctgagggcta tagaggctca acagcatatg 1680ttgagactca cggtctgggg cattaagcag ctccaggcaa gagtcctggc tgtggaaaga 1740tacctaaggg atcaacagct cctaggaatt tggggctgct ctggaaaact catctgcacc 1800actaatgtgc cctggaactc tagttggagt aataaatctc aggaggaaat atggggtaac 1860atgacctggc tgcaatggga taaagaaatt agcaattaca cacaaacaat atataaccta 1920cttgaagaat cgcagaacca gcaggaaaag aatgaacaag acttattggc attggacaag 1980tgggcaaatt tgcggacttg gtttgacata acaaattggc tgtggtatat aaaaatgttt 2040ataatgatag taggaggctt aataggatta agaatagttt ttgctgtgct ttctgtaata 2100aatagagtta ggcagggata ctcacctctg tcgtttcaga cccatatccc gagcccaagg 2160ggtctcgata ggcccggaag aatcgaagga gaaggtggag agcaagacta a 2211613083DNAHIV-1 Clade C 61atgggtgcga gagcgtcaat attaagaggg ggaaaattag atcgatggga aaaaattagg 60ttaaggccag ggggaaagaa aagctatatg ataaaacact tagtatgggc aagcagggag 120ctggaaagat ttgcacttaa ccctagcctt ttagagacat cagaaggctg taaacaaata 180atgaaacagc tacaaccagc tcttcagaca ggaacagaag aacttaaatc attattcaat 240gcaatagcag ttctctattg tgtacatgaa gggatagatg taaaagacac caaggaagcc 300ttagacaaga tagaggaaga acagaacaaa agtcagcaaa aaacacagca ggcagaagca 360gctggcggaa aagtcagtca aaattatcct atagtgcaga atctccaagg acaaatggta 420caccagtcca tatcacctag aactttgaat gcatgggtaa aagtaataga ggaaaaggct 480tttagcccag aggtaatacc catgtttaca gcattatcag aaggagccac cccacaagat 540ttaaacacca tgctaaatac agtgggggga catcaagcag ccatgcaaat gttaaaagat 600accatcaatg aggaggctgc agaatgggat aggatacatc cagtacatgc agggcctact 660gcaccaggcc aaatgagaga accaagggga agtgacatag caggaactac tagtaccctt 720caggaacaaa tagcatggat gacagctaac ccacctgttc cagtgggaga aatctacaaa 780agatggataa tactgggttt aaataaaata gtaagaatgt atagccctgt cagcattttg 840gacataaaac aagggccaaa ggaacccttt agagactatg tagatcggtt ctttaaaact 900ttaagagctg aacaggctac acaagatgta aaaaattgga tgacagacac cttgttggtc 960caaaatgcga acccagattg taagaccatt ttaagagcat taggaccagg ggctacatta 1020gaagaaatga tgacagcatg tcaaggagtg ggaggacctg gccacaaagc cagagttttg 1080gctgaggcaa tgagccaagc aaacacacac ataatgatgc agagaagcaa ttttaaaggc 1140tctaaaagaa ttgttaaatg tttcaactgt ggcaaggaag ggcacatagc cagaaattgc 1200agggccccta ggaaaaaggg ctgttggaaa tgtggaaagg aaggacacca aatgaaagac 1260tgtactgaga ggcaggctaa ttttttaggg aaaatttggc cttcccacaa ggggaggcca 1320gggaatttcc ttcagaacag gtcagagcca acagccccac caacgaacag gccagagcca 1380acagctccac cagcagagag cttcaggttc gaggaagcaa cccctgctcc gaagcaggag 1440ctgaaagaca gggaaccttt aatttccctc aaatcactct ttggcagcga cccctcgtct 1500caataaaagt agggggtcaa acaaaggagg ctcttttaga cacaggagca gatgatacag 1560tattagaaga aataaatttg ccaggaaaat ggaaacccaa aatgatagga ggaattggag 1620gttttatcaa agtaagacag tatgatcaga tagttataga aatttgtgga aaaaaggcta 1680taggtacagt attagtagga cccacccctg tcaacataat tggaagaaat atgttgactc 1740agcttggatg cacactaaat tttccaatta gtcctattga aactgtacca gtaaagttaa 1800agccaggaat ggatggccca aaggttaaac aatggccatt gacagaagaa aaaataaagg 1860cattaacagc aatttgtgaa gaaatggaga aggaaggaaa aattacaaag attgggcctg 1920aaaatccata taacactcca gtatttgcca taaaaaagaa ggacagtact aagtggagaa 1980aattagtaga tttcagggaa cgcaataaaa gaactcaaga tttttgggaa gttcaattag 2040gcataccaca cccagcaggg ttaaaaaaga aaaaatcagt gacagtactg gaggtggggg 2100atgcatactt ctcagttcct ttagatgaag gcttcaggaa atatactgca ttcaccatac 2160ctagtataaa caatgaaaca ccaggaatta gatatcaata caatgtgctt ccacagggat 2220ggaaaggatc accagcaata ttccagagta gcatgacaaa aatcttagag ccctttagag 2280cacaaaatcc agaaatagtc atctatcaat atatgcacga cttatatgta ggatctgact 2340tagaaatagg gcaacataga gcaaaaatag aggaattaag agaacatcta ttaaagtggg 2400gatttaccac accagacaag aaacatcaga aagaaccccc atttctttgg atggggtatg 2460aactccatcc tgacaaatgg acagtacagc ctataacgct gccagaaaag gaaagctgga 2520ctgtcaatga tatacagaag ttagtgggaa aactaaactg ggcaagtcag atttatgcag 2580ggattaaagt aaggcaactg tataaactcc ttaggggagc caaagcacta acagacatag 2640taccactaac tgaagaggca gaattagaat tggcagagaa cagggaaatt ctaaaagaac 2700cagtacatgg ggtatattat gacccatcaa aagacttgat agctgaaata cagaaacaag 2760ggcatgacca atggacatat caaatttacc aagaaccatt caaaaatctg aaaacaggga 2820agtatgcaaa aatgaggagt gcccacacta atgatgtaaa acaattaaca gaggcagtgc 2880aaaaaatagc catggaaggc atagtaatat ggggaaagac tcctaaattt agactgccca 2940ttcaaaagga aacatgggaa acatggtgga cagactattg gcaagccacc tggattcctg 3000agtgggagtt tgttaatacc cctcccctag taaaattatg gtaccagctg gagaaagaac 3060ccatagtagg agcagaaact ttc 3083622226DNAHIV-1 Clade C 62atgagagtga aggggatatt gaggaattgg caacacaggt ggatatggat ctggatcatc 60ttaggctttt ggatgctaat gatttgtaat gggaacttgt gggtcactgt ctactatggg 120gtacctgtgt ggaaagaagc aaatgctcct ctattttgtg catcagatgc taaagcatat 180gagaaagaag tgcataatgt ctgggctaca catgcctgtg tacccacaga ccccaaccca 240caagaactag acttggtaaa tgtaacagaa aattttaaca tgtggaaaaa tgacatggta 300gatcagatgc atgaggatat aatcagttta tgggatgaaa gcctaaagcc atgtgtaaag 360ttgaccccac tctgtgtcac tctaaactgt actaatgcta atattaataa tgatactgtt 420gctaatagtg gtacttttaa ggttgataat agtagtaatg tagtaaaaaa ttgctctttc 480aatataacca cagaaataag agataagaag aaaaaagaat attcattgtt ttatagactt 540gatatattac cacttgataa ctctagtgag tctaagaact atagtgagta tgtattaata 600aattgtaatg cctcaaccgt aacacaagcc tgtccaaagg tctcttttga cccaattcct 660atacattatt gtgctccagc tggttatgcg attctaaagt gtaaagataa gacattcaat 720ggaacaggac catgcagtaa tgtcagcaca gtactatgta cacatggaat taagccagtg 780gtatcaactc aattactgtt aaatggtagc ctagcagaag aagggatagt aattagatct 840gaaaatctga caaacaatgc caaaacaaca atagtacagc ttaatgaacc tgtagaaatt 900atgtgtgtaa gacccggcaa taatacaaga aaaagtgtga ggataggacc aggacaaaca 960ttctatgcaa caggaggcat aataggagat ataagacaag cacattgtaa cattagtaga 1020agtgattgga ataaaacttt acaagaggta ggtaaaaaat tacgagaata cttccacaat 1080aaaacaataa gatttaaacc ggcggtcgta ggaggggacc tggaaattac aacacatagc 1140tttaattgta gaggagaatt cttctattgc aatacatcag aactgtttac aggtgaatat 1200aatggtactg agtataagaa tacttcaaat tcaaatccta acatcacact cccatgtaga 1260ataaaacaat ttgtaaacat gtggcagagg gtaggacgag caatgtatgc ccctcctatt 1320gaaggaaaca taacatgtaa ctcaagtatc acaggactac tattgacatg ggatggagga 1380aacaatacta atggcacaga gacatttaga cctggaggag gagatatgag ggataattgg 1440agaagtgaat tatataaata taaagtggta gaaattaaac cattaggaat agcacccact 1500agtgcaaaaa ggagagtggt ggagagagag aaaagagcag tgggaatagg agctttgttc 1560cttgggttct taggagcagc aggaagcact atgggcgcag catcaataac gctgacggta 1620caggccagac aattattgtc tggtatagtg caacagcaaa gcaatttgct gagggccata 1680gaggcgcaac agcatatgtt gcaactcaca gtctggggca ttaaacagct ccagacaaga 1740gtcctggcta tagaaagata cctaaaggat caacagctcc tagggatttg gggctgctct 1800ggaaaactca tctgcaccac tgctgtgcct tggaacacta gttggagtaa taaaactgaa 1860caggacattt ggaatctaac ctggatgcag tgggatagag aagttagtaa ttacacagac 1920ataatataca ggttgcttga agactcacaa atccagcagg aaaacaatga aaaggattta 1980ctagcattgg acagttggaa aaatctgtgg aattggtttg acataacaaa ttggttgtgg 2040tatataagaa cattcataat gatagtagga ggcttgatag

gcttaaggat aatttttgct 2100gtaatttcta tagtgaatag agttaggcag ggatactcac ctttgtcatt tcagaccctt 2160accccaaccc cgaggggacc agaaaggctc ggaggaatcg aagaagaagg tggagagcaa 2220gactaa 2226639PRTArtificial Sequencesynthetic peptide 63Ala Met Gln Met Leu Lys Glu Thr Ile1 5

Claims

1. A pharmaceutical composition comprising a recombinant MVA virus expressing an HIV env, gag, and pol gene or modified gene thereof for production of an HIV Env, Gag, and Pol antigen by expression from said recombinant MVA virus, wherein said HIV env gene is modified to encode an HIV Env protein composed of gp120 and the membrane-spanning and ectodomain of gp41 but lacking part or all of the cytoplasmic domain of gp41, and a pharmaceutically acceptable carrier, wherein said HIV env, gag, and pol genes are isolatable from an individual infected with Ugandan clade D isolate 99UGA03349, 99UGA07412, or 98UG57128.

2. The pharmaceutical composition of claim 1 comprising 99UGA03349 gagpol in Appendix 1 or sequence having at least about 90%, 95% or 99.9% identity thereto.

3. The pharmaceutical composition of claim 1 comprising 99UGA07412 gagpol in Appendix 1 or sequence having at least about 90%, 95% or 99.9% identity thereto.

4. The pharmaceutical composition of claim 1 comprising 99UGA03349 envelope in Appendix 1 or sequence having at least about 90%, 95% or 99.9% identity thereto.

5. The pharmaceutical composition of claim 1 comprising 99UGA07412 envelope in Appendix 1 or sequence having at least about 90%, 95% or 99.9% identity thereto.

6. The pharmaceutical composition of claim 1 comprising 98UG57128 envelope in Appendix 1 or sequence having at least about 90%, 95% or 99.9% identity thereto.

7. The pharmaceutical composition of claim 1, wherein said recombinant MVA virus is MVA/UGD-1 defined as comprising 99UGA07412 gagpol in Appendix 1 or sequence having at least about 90%, 95% or 99.9% identity thereto, and 99UGA07412 envelope in Appendix 1 or sequence having at least about 90%, 95% or 99.9% identity thereto.

8. The pharmaceutical composition of claim 1, wherein said recombinant MVA virus is MVA/UGD-2 defined as comprising 99UGA03349 gagpol in Appendix 1 or sequence having at least about 90%, 95% or 99.9% identity thereto, and 98UG57128 envelope in Appendix 1 or sequence having at least about 90%, 95% or 99.9% identity thereto.

9. The pharmaceutical composition of claim 1, wherein said recombinant MVA virus is MVA/UGD-3 defined as comprising 99UGA07412 gagpol in Appendix 1 or sequence having at least about 90%, 95% or 99.9% identity thereto, and 99UGA03349 envelope in Appendix 1 or sequence having at least about 90%, 95% or 99.9% identity thereto.

10. The pharmaceutical composition of claim 1, wherein said recombinant MVA virus is MVA/UGD-4 defined as comprising 99UGA03349 gagpol in Appendix 1 or sequence having at least about 90%, 95% or 99.9% identity thereto, and 99UGA07412 envelope in Appendix 1 or sequence having at least about 90%, 95% or 99.9% identity thereto.

11. The pharmaceutical composition of claim 1, wherein said recombinant MVA virus is MVA/UGD-5 defined as comprising 99UGA03349 gagpol in Appendix 1 or sequence having at least about 90%, 95% or 99.9% identity thereto, and 98UG57128 envelope in Appendix 1 or sequence having at least about 90%, 95% or 99.9% identity thereto.

12. The pharmaceutical composition of claim 1 wherein said recombinant MVA virus additionally expresses an additional HIV gene or modified gene thereof for production of an HIV antigen by expression from said recombinant MVA virus, wherein said additional HIV gene is a member selected from the group consisting of vif, vpr, tat, rev, vpu, and nef.

13. An MVA shuttle plasmid comprising pLAS-1 of Appendix 2 or sequence having at least about 90%, 95% or 99.9% identity thereto, or pLAS-2 of Appendix 2 or sequence having at least about 90%, 95% or 99.9% identity thereto.

14. A method of making a recombinant MVA virus comprising preparing the MVA shuttle plasmid of claim 13 and combining said MVA shuttle plasmid with a MVA virus to produce said recombinant MVA virus, and isolating said recombinant MVA virus.

15. A method of boosting a CD8.sup.+ T cell immune response to an HIV Env, Gag, or Pol antigen in a primate, the method comprising provision in the primate of a composition of claim 1, whereby a CD8.sup.+ T cell immune response to the antigen previously primed in the primate is boosted.

16. A method of inducing a CD8.sup.+ T cell immune response to an HIV Env, Gag, or Pol antigen in a primate, the method comprising provision in the primate of a composition of claim 1, whereby a CD8.sup.+ T cell immune response to the antigen in the primate is induced.

17. A method of inducing a CD8.sup.+ T cell immune response to an HIV Env, Gag, or Pol antigen in a primate, the method comprising provision in the primate of a priming composition comprising nucleic acid encoding said antigen and then provision in the primate of a boosting composition which comprises claim 1, whereby a CD8.sup.+ T cell immune response to the antigen is induced.

18. The method of claim 15, wherein the primate is a human.

19. The method of claim 15, wherein administration of the recombinant MVA virus is by needleless injection.

20. The method of claim 15, wherein the priming composition comprises plasmid DNA encoding said antigen.

21. MVA 1974/NIH Clone 1.

22. A pharmaceutical composition comprising a recombinant MVA virus expressing an HIV env, gag, and pol gene or modified gene thereof for production of an HIV Env, Gag, and Pol antigen by expression from said recombinant MVA virus, wherein said HIV env gene is modified to encode an HIV Env protein composed of gp120 and the membrane-spanning and ectodomain of gp41 but lacking part or all of the cytoplasmic domain of gp41, and a pharmaceutically acceptable carrier, wherein said HIV env, gag, and pol genes are isolatable from an individual infected with Kenyan clade A isolate 00KE-KER2008, 00KE-KNH1144, or 00KE-KNH1207.

23. The pharmaceutical composition of claim 22 comprising 00KE-KNH2008 gagpol in Appendix 3 or sequence having at least about 90%, 95% or 99.9% identity thereto.

24. The pharmaceutical composition of claim 22 comprising 00KE-KNH1144 envelope in Appendix 3 or sequence having at least about 90%, 95% or 99.9% identity thereto.

25. The pharmaceutical composition of claim 22 comprising 00KE-KNH1207 envelope in Appendix 3 or sequence having at least about 90%, 95% or 99.9% identity thereto.

26. The pharmaceutical composition of claim 22, wherein said recombinant MVA virus is MVA/KEA-1 defined as comprising 00KE-KNH2008 gagpol in Appendix 3 or sequence having at least about 90%, 95% or 99.9% identity thereto, and 00KE-KNH1144 envelope in Appendix 3 or sequence having at least about 90%, 95% or 99.9% identity thereto.

27. The pharmaceutical composition of claim 22, wherein said recombinant MVA virus is MVA/KEA-2 defined as comprising 00KE-KNH2008 gagpol in Appendix 3 or sequence having at least about 90%, 95% or 99.9% identity thereto, and 00KE-KNH1207 envelope in Appendix 3 or sequence having at least about 90%, 95% or 99.9% identity thereto.

28. The pharmaceutical composition of claim 22, wherein said recombinant MVA virus is MVA/KEA-3 defined as comprising 00KE-KNH2008 gagpol in Appendix 3 or sequence having at least about 90%, 95% or 99.9% identity thereto, and 00KE-KNH1144 envelope in Appendix 3 or sequence having at least about 90%, 95% or 99.9% identity thereto.

29. The pharmaceutical composition of claim 22, wherein said recombinant MVA virus is MVA/KEA-4 defined as comprising 00KE-KNH2008 gagpol in Appendix 3 or sequence having at least about 90%, 95% or 99.9% identity thereto, and 00KE-KNH1144 envelope in Appendix 3 or sequence having at least about 90%, 95% or 99.9% identity thereto.

30. The pharmaceutical composition of claim 22, wherein said recombinant MVA virus is MVA/KEA-5 defined as comprising 00KE-KNH2008 gagpol in Appendix 3 or sequence having at least about 90%, 95% or 99.9% identity thereto, and 00KE-KNH1144 envelope in Appendix 3 or sequence having at least about 90%, 95% or 99.9% identity thereto.

31. The pharmaceutical composition of claim 22 wherein said recombinant MVA virus additionally expresses an additional HIV gene or modified gene thereof for production of an HIV antigen by expression from said recombinant MVA virus, wherein said additional HIV gene is a member selected from the group consisting of vif, vpr, tat, rev, vpu, and nef.

32. A method of boosting a CD8.sup.+ T cell immune response to an HIV Env, Gag, or Pol antigen in a primate, the method comprising provision in the primate of a composition of claim 22, whereby a CD8.sup.+ T cell immune response to the antigen previously primed in the primate i2s boosted.

33. A method of inducing a CD8.sup.+ T cell immune response to an HIV Env, Gag, or Pol antigen in a primate, the method comprising provision in the primate of a composition of claim 22, whereby a CD8.sup.+ T cell immune response to the antigen in the primate is induced.

34. A method of inducing a CD8.sup.+ T cell immune response to an HIV Env, Gag, or Pol antigen in a primate, the method comprising provision in the primate of a priming composition comprising nucleic acid encoding said antigen and then provision in the primate of a boosting composition which comprises claim 22, whereby a CD8.sup.+ T cell immune response to the antigen is induced.

35. The method of claim 32, wherein the primate is a human.

36. The method of claim 32, wherein administration of the recombinant MVA virus is by needleless injection.

37. The method of claim 32, wherein the priming composition comprises plasmid DNA encoding said antigen.

38. A pharmaceutical composition comprising a recombinant MVA virus expressing an HIV env, gag, and pol gene or modified gene thereof for production of an HIV Env, Gag, and Pol antigen by expression from said recombinant MVA virus, wherein said HIV env gene is modified to encode an HIV Env protein composed of gp120 and the membrane-spanning and ectodomain of gp41 but lacking part or all of the cytoplasmic domain of gp41, and a pharmaceutically acceptable carrier, wherein said HIV env, gag, and pol genes are isolatable from an individual infected with Tanzanian clade C isolate 00TZA-246 or 00TZA-125.

39. The pharmaceutical composition of claim 38 comprising 00TZA-246 gagpol in Appendix 4 or sequence having at least about 90%, 95% or 99.9% identity thereto.

40. The pharmaceutical composition of claim 38 comprising 00TZA-125 envelope in Appendix 4 or sequence having at least about 90%, 95% or 99.9% identity thereto.

41. The pharmaceutical composition of claim 38, wherein said recombinant MVA virus is MVA/TZC-1 defined as comprising 00TZA-246 gagpol in Appendix 4 or sequence having at least about 90%, 95% or 99.9% identity thereto, and 00TZA-125 envelope in Appendix 4 or sequence having at least about 90%, 95% or 99.9% identity thereto.

42. The pharmaceutical composition of claim 38 wherein said recombinant MVA virus additionally expresses an additional HIV gene or modified gene thereof for production of an HIV antigen by expression from said recombinant MVA virus, wherein said additional HIV gene is a member selected from the group consisting of vif, vpr, tat, rev, vpu, and nef.

43. A method of boosting a CD8.sup.+ T cell immune response to an HIV Env, Gag, or Pol antigen in a primate, the method comprising provision in the primate of a composition of claim 38, whereby a CD8.sup.+ T cell immune response to the antigen previously primed in the primate is boosted.

44. A method of inducing a CD8.sup.+ T cell immune response to an HIV Env, Gag, or Pol antigen in a primate, the method comprising provision in the primate of a composition of claim 38, whereby a CD8.sup.+ T cell immune response to the antigen in the primate is induced.

45. A method of inducing a CD8.sup.+ T cell immune response to an HIV Env, Gag, or Pol antigen in a primate, the method comprising provision in the primate of a priming composition comprising nucleic acid encoding said antigen and then provision in the primate of a boosting composition which comprises claim 38, whereby a CD8.sup.+ T cell immune response to the antigen is induced.

46. The method of claim 43, wherein the primate is a human.

47. The method of claim 43, wherein administration of the recombinant MVA virus is by needleless injection.

48. The method of claim 43, wherein the priming composition comprises plasmid DNA encoding said antigen.