Preparation Of 7-dehydrocholesterol And/or The Biosynthetic Intermediates And/or Secondary Products Thereof In Transgenic Organisms

Abstract

The present invention relates to a method for preparing 7-dehydrocholesterol and/or the biosynthetic intermediates and/or secondary products thereof by culturing organisms, in particular yeasts. Furthermore, the invention relates to the preparation of the nucleic acid constructs required for preparing the genetically modified organisms and to said genetically modified organisms, in particular yeasts, themselves.

Description

[0001] The present invention relates to a method for preparing 7-dehydrocholesterol and/or the biosynthetic intermediates and/or secondary products thereof by culturing organisms, in particular yeasts. Furthermore, the invention relates to the preparation of the nucleic acid constructs required for preparing the genetically modified organisms and to said genetically modified organisms, in particular yeasts, themselves.

[0002] 7-Dehydrocholesterol, also referred to as cholesta-5,7-dienol or provitamin D3, its biosynthetic intermediates of the sterol metabolism, such as, for example, zymosterol, farnesol, geraniol, squalene, lanosterol, cholesta-5,7,24-trienol and cholesta-5,7,22,24-tetraenol and its biosynthetic secondary products of the sterol metabolism, such as vitamin D.sub.3 and cholesterol, are compounds of high economic value.

[0003] 7-Dehydrocholesterol is economically important especially for obtaining vitamin D.sub.3 from 7-dehydrocholesterol via UV irradiation.

[0004] Squalene is used as building block for the synthesis of terpenes. It is used in hydrogenated form as squalane in dermatology and cosmetics and also in various derivatives as an ingredient of skin and haircare products.

[0005] Furthermore, sterols such as zymosterol and lanosterol can be utilized economically, lanosterol being pivotal as crude and synthesis material for the chemical synthesis of saponins and steroid hormones. Due to its good skin penetration and spreading properties, lanosterol serves as emulsifier and active substance in skin creams.

[0006] An economic method for preparing 7-dehydrocholesterol and/or the biosynthetic intermediates and/or secondary products thereof is therefore of great importance.

[0007] Particularly economic methods are biotechnological methods utilizing organisms which have been optimized by genetic modification and which produce 7-dehydrocholesterol and/or the biosynthetic intermediates and/or secondary products thereof.

[0008] While the sterol metabolism in bacteria, fungi, yeasts and some insects essentially goes from zymosterol via fecosterol, episterol, ergosta-5,7-dienol and ergosta-5,7,22,24-tetraen-3.beta.-ol to ergosterol (provitamin D.sub.2), the sterol metabolism in mammals essentially goes from zymosterol via cholesta-7,24-dienol, lathosterol to 7-dehydrocholesterol (provitamin D.sub.3).

[0009] 7-Dehydrocholesterol (provitamin D.sub.3) is converted to cholesterol by 7-dehydrocholesterol reductase and cholesterol is converted to steroid hormones, corticoids and bile acids, such as progesterone, testosterone, estradiol, aldosterone, cortisone and cholate.

[0010] Some genes of the 7-dehydrocholesterol metabolism in mammals are known and have been cloned, such as, for example,

nucleic acids encoding a human .DELTA.8-.DELTA.7-isomerase (also referred to as emopamil-binding protein (EBP)), ACCESSION NM.sub.--006579, and a murine .DELTA.8-.DELTA.7-isomerase (Braverman, N. et al., (1999): Mutations in the gene encoding 3.beta.-hydroxysteroid-.DELTA.8,.DELTA.7-isomerase cause X-linked dominant Conradi-Hunermann syndrome. Nat. Genet. 22(3), 291-294), nucleic acids encoding a human .DELTA.5-desaturase (also referred to as sterol C5-desaturase), ACCESSION AB016247 and a murine .DELTA.5-desaturase (Nishi, S. et al., (2000): cDNA cloning of the mammalian sterol C5-desaturase and the expression in yeast mutant. Biochim. Biophys. Acta 1490(1-2), 106-108), nucleic acids encoding a human .DELTA.24-reductase (also referred to as 24-dehydrocholesterol reductase (DHCR24)), ACCESSION NM.sub.--014762 and a murine .DELTA.24-reductase (Waterham, H. R. et al. (2001): Mutations in the 3.beta.-hydroxysterol .DELTA.24-reductase gene cause desmosterolosis, an autosomal recessive disorder of cholesterol biosynthesis. Am. J. Hum. Genet. 69(4), 685-694) and nucleic acids encoding a human sterol acyltransferase (Chang, C. C. et al., Molecular cloning and functional expression of human acyl-coenzyme A:cholesterol acyltransferase cDNA in mutant Chinese hamster ovary cells, J. Biol. Chem. 1993, Oct. 5; 268(28):20747-55) and a murine sterol acyltransferase (Uelmen, P. J.: Tissue-specific expression and cholesterol regulation of acylcoenzyme A:cholesterol acyltransferase (ACAT) in mice. Molecular cloning of mouse ACAT cDNA, chromosomal localization, and regulation of ACAT in vivo and in vitro, J. Biol. Chem. 1995 Nov. 3; 270(44):26192-201).

[0011] The genes of the ergosterol metabolism in yeast are essentially known and have been cloned, such as, for example,

nucleic acids encoding a .DELTA.8-.DELTA.7-isomerase (ERG2) (Ashman, W. H. et al. (1991): Cloning and disruption of the yeast C-8 sterol isomerase gene. Lipids. August; 26(8):628-32), Nucleic acids encoding a .DELTA.5-desaturase (ERG3) (Arthington, B. A. et al. (1991): Cloning, disruption and sequence of the gene encoding yeast C-5 sterol desaturase. Gene. June 15; 102(1):39-44), nucleic acids encoding a .DELTA.24-reductase (ERG 4) (Lai, M. H. et al., (1994): The identification of a gene family in the Saccharomyces cerevisiae ergosterol biosynthesis pathway. Gene. March 11; 140(1):41-9), nucleic acids encoding an HMG-CoA reductase (HMG) (Bason M. E. et al, (1988) Structural and functional conservation between yeast and human 3-hydroxy-3-methylglutaryl coenzyme A reductases, the rate-limiting enzyme of sterol biosynthesis. Mol Cell Biol 8:3797-3808, nucleic acids encoding a truncated HMG-CoA reductase (t-HMG) (Polakowski T, Stahl U, Lang C. (1998) Overexpression of a cytosolic hydroxymethylglutaryl-CoA reductase leads to squalene accumulation in yeast. Appl Microbiol Biotechnol. January; 49(1):66-71, nucleic acids encoding a lanosterol C14-demethylase (ERG11) (Kalb V F, Loper J C, Dey C R, Woods C W, Sutter T R (1986) Isolation of a cytochrome P-450 structural gene from Saccharomyces cerevisiae. Gene 45(3):237-45, nucleic acids encoding a squalene synthetase (ERG9) (Jennings, S. M., (1991): Molecular cloning and characterization of the yeast gene for squalene synthetase. Proc Natl Acad Sci USA. July 15; 88(14):6038-42), nucleic acids encoding a sterol acyltransferase (SAT1) and (SAT2) (Yang, H.: Sterol esterification in yeast: a two-gene process. Science. 1996 May 31; 272(5266):1353-6) and a further sterol acyltransferase (J. Biol. Chem. 1996, Sep. 27; 271(39):24157-63), nucleic acids encoding a squalene epoxidase (ERG1) (Jandrositz, A., et al (1991) The gene encoding squalene epoxidase from Saccharomyces cerevisiae: cloning and characterization. Gene 107:155-160), nucleic acids encoding a C24-methyltransferase (ERG6) (Hardwick, K. G. et al.: SED6 is identical to ERG6, and encodes a putative methyltransferase required for ergosterol synthesis. Yeast. February; 10(2):265-9) and nucleic acids encoding a .DELTA.22-desaturase (ERG5) (Skaggs, B. A. et al: Cloning and characterization of the Saccharomyces cerevisiae C-22 sterol desaturase gene, encoding a second cytochrome P-450 involved in ergosterol biosynthesis, Gene. 1996 Feb. 22; 169(1):105-9).

[0012] Furthermore, methods are known whose aim is an increase in the content of specific intermediates and final products of the sterol metabolism in yeasts and fungi.

[0013] EP 486 290 discloses that the content of squalene and other specific sterols such as, for example, zymosterol, in yeasts can be increased by increasing the rate of expression of HMG-CoA reductase and simultaneously interrupting the metabolic pathway of zymosterol C24-methyltransferase (ERG6) and ergosta-5,7,24(28)-trienol 22-dehydrogenase (ERG9).

[0014] From T. Polakowski, Molekularbiologische Beeinflussung des Ergosterolstoffwechsels der Hefe Saccharomyces cerevisiae [Influencing the ergosterol metabolism of the yeast Saccharomyces cerevisiae by molecular biological means], Shaker Verlag Aachen, 1999, pages 59 to 66, it is known that increasing the rate of expression of HMG-CoA reductase alone, without interrupting the downstream metabolic flow as in EP 486 290, merely leads to a slight increase in the content of early sterols and of squalene, while the content of later sterols such as ergosterol does not change substantially and, in the case of ergosterol, even tendentially decreases.

[0015] WO 99/16886 describes a method for preparing ergosterol in yeasts which overexpress a combination of genes tHMG, ERG9, SAT1 and ERG1.

[0016] Tainaka et al., J, Ferment. Bioeng. 1995, 79, 64-66, further describe that overexpression of ERG11 (lanosterol C14-demethylase) leads to accumulation of 4,4-dimethylzymosterol but not of ergosterol. Compared to the wild type, the transformant showed an increase in the zymosterol content by a factor of from 1.1 to 1.47, depending on fermentation conditions.

[0017] Avruch et al, Can. J. Biochem 1976, 54(7), 657-665 and Xu et al, Biochem. Biophys. Res. Commun. 1988, 155(1), 509-517 describe that it is possible to detect, apart from zymosterol, also traces of cholesterol by specifically inhibiting C24-methyltransferase and also by a mutation in the gene locus erg6 in S. cerevisiae.

BRIEF DESCRIPTION OF THE DRAWINGS

[0018] FIG. 1 illustrates the vector denoted pUG6-tHMG.

[0019] FIG. 2 illustrates the vector denoted pUG6-ERG1.

[0020] FIG. 3 illustrates the vector denoted pUG6-ERG11.

[0021] FIG. 4 illustrates the vectors denoted pFlat3 and pFlat1.

[0022] FIG. 5a illustrates the vectors denoted pFlat1-EBP and pFlat3-EBP.

[0023] FIG. 5b illustrates the vector denoted pFlat3-SC5D.

[0024] FIG. 5c illustrates the vector denoted pFlat1-Ebp.

[0025] FIG. 5d illustrates the vector denoted pFlat4-D24R.

[0026] FIG. 6 illustrates the vector denoted pFlat4.

[0027] FIG. 7 illustrates the vector denoted pFlat4-ERG4.

[0028] It is an object of the present invention to provide a method for preparing 7-dehydrocholesterol and/or the biosynthetic intermediates and/or secondary products thereof, which method has advantageous properties such as a higher product yield.

[0029] We have found that this object is achieved by a method for preparing 7-dehydrocholesterol and/or the biosynthetic intermediates and/or secondary products thereof, in which organisms are cultured which have, compared to the wild type, an increased activity of at least one of the activities selected from the group consisting of .DELTA.8-.DELTA.7-isomerase activity, .DELTA.5-desaturase activity and .DELTA.24-reductase activity.

[0030] An increased activity compared to the wild type means, in the case of the starting organism not having said activity, that said activity is caused. In the case of the starting organism already having said activity, an increased activity compared to the wild type means an activity increased by a percentage.

[0031] .DELTA.8-.DELTA.7-Isomerase activity means the enzyme activity of a .DELTA.8-.DELTA.7-isomerase, also referred to as .DELTA.8-.DELTA.7-sterol isomerase.

[0032] A .DELTA.8-.DELTA.7-isomerase means a protein which has the enzyme activity of converting zymosterol to cholesta-7,24-dienol.

[0033] Accordingly, .DELTA.8-.DELTA.7-isomerase activity means the amount of zymosterol converted or the amount of cholesta-7,24-dienol formed by the protein .DELTA.8-.DELTA.7-isomerase in a particular time.

[0034] In the case of an increased .DELTA.8-.DELTA.7-isomerase activity compared to the wild type, thus the amount of zymosterol converted or the amount of cholesta-7,24-dienol formed by the protein .DELTA.8-.DELTA.7-isomerase in a particular time is increased in comparison with the wild type.

[0035] This increase in .DELTA.8-.DELTA.7-isomerase activity is preferably at least 5%, further preferably at least 20%, further preferably at least 50%, further preferably at least 100%, more preferably at least 300%, still more preferably at least 500%, in particular at least 600%, of the .DELTA.8-.DELTA.7-isomerase activity of the wild type.

[0036] .DELTA.5-Desaturase activity means the enzyme activity of a .DELTA.5-desaturase, also referred to as lathosterol 5-desaturase or sterol C5-desaturase.

[0037] A .DELTA.5-desaturase means a protein which has the enzyme activity of converting cholesta-7,24-dienol to cholesta-5,7,24-trienol.

[0038] Accordingly, .DELTA.5-desaturase activity means the amount of cholesta-7,24-dienol converted or the amount of cholesta-5,7,24-trienol formed by the protein .DELTA.5-desaturase in a particular time.

[0039] In the case of an increased .DELTA.5-desaturase activity compared to the wild type, thus the amount of cholesta-7,24-dienol converted or the amount of cholesta-5,7,24-trienol formed by the protein .DELTA.5-desaturase in a particular time is increased in comparison with the wild type.

[0040] This increase in .DELTA.5-desaturase activity is preferably at least 5%, further preferably at least 20%, further preferably at least 50%, further preferably at least 100%, more preferably at least 300%, still more preferably at least 500%, in particular at least 600%, of the .DELTA.5-desaturase activity of the wild type.

[0041] .DELTA.24-Reductase activity means the enzyme activity of a .DELTA.24-reductase, also referred to as 24-dehydrocholesterol reductase.

[0042] A .DELTA.24-reductase means a protein which has the enzyme activity of converting the double bond between C24 and C25 of cholesterol compounds to a single bond, for example converting cholesta-5,7,24-trienol to 7-dehydrocholesterol or zymosterol to lathosterol or cholesta-7,24-dienol to cholesta-7-enol.

[0043] Accordingly, .DELTA.24-reductase activity means preferably the amount of cholesta-5,7,24-trienol converted or the amount of 7-dehydrocholesterol formed by the protein .DELTA.24-reductase in a particular time.

[0044] In the case of an increased .DELTA.24-reductase activity compared to the wild type, thus the amount of cholesta-5,7,24-trienol converted or the amount of 7-dehydrocholesterol formed by the protein .DELTA.24-reductase in a particular time is increased in comparison with the wild type.

[0045] This increase in .DELTA.24-reductase activity is preferably at least 5%, further preferably at least 20%, further preferably at least 50%, further preferably at least 100%, more preferably at least 300%, still more preferably at least 500%, in particular at least 600%, of the .DELTA.24-reductase activity of the wild type.

[0046] A wild type means the corresponding not genetically modified starting organism. Preferably and, in particular in those cases in which the organism or the wild type cannot be classified unambiguously, wild type means a reference organism for increasing the .DELTA.8-.DELTA.7-isomerase activity, increasing the .DELTA.5-desaturase activity, increasing the .DELTA.24-reductase activity, reducing the C24-methyltransferase activity described below, reducing the .DELTA.22-desaturase activity described below, increasing the HMG-CoA-reductase activity described below, increasing the lanosterol C14-demethylase activity described below, increasing the squalene-epoxidase activity described below, increasing the squalene-synthetase activity described below and increasing the sterol-acyltransferase activity described below and also for increasing the content of 7-dehydrocholesterol and/or of the biosynthetic intermediates and/or secondary products thereof. This reference organism is preferably the yeast strain Saccharomyces cerevisiae AH22.

[0047] In the method of the invention, organisms are cultured which, compared to the wild type, have an increased activity of at least one of the activities selected from the group consisting of .DELTA.8-.DELTA.7-isomerase activity, .DELTA.5-desaturase activity and .DELTA.24-reductase activity.

[0048] In a preferred embodiment, organisms are cultured which, compared to the wild type, have an increased .DELTA.8-.DELTA.7-isomerase activity, .DELTA.5-desaturase activity or .DELTA.24-reductase activity.

[0049] In a particularly preferred embodiment of the method of the invention, the organisms have, compared to the wild type, an increased activity of at least two of the activities selected from the group consisting of .DELTA.8-.DELTA.7-isomerase activity, .DELTA.5-desaturase activity and .DELTA.24-reductase activity.

[0050] Particularly preferred combinations are .DELTA.8-.DELTA.7-isomerase activity and .DELTA.5-desaturase activity, increased in comparison to the wild type, .DELTA.8-.DELTA.7-isomerase activity and .DELTA.24-reductase activity, increased in comparison to the wild type, and .DELTA.5-desaturase activity and .DELTA.24-reductase activity, increased in comparison with the wild type.

[0051] In a very particularly preferred embodiment of the method of the invention, the organisms have, compared to the wild type, an increased .DELTA.8-.DELTA.7-isomerase activity, .DELTA.5-desaturase activity and .DELTA.24-reductase activity.

[0052] The .DELTA.8-.DELTA.7-isomerase activity, .DELTA.5-desaturase activity and .DELTA.24-reductase activity and also the HMG-CoA-reductase activity, lanosterol C14-demethylase activity, squalene-epoxidase activity, squalene-synthetase activity and sterol-acyltransferase activity, which are described below, may be increased independently of one another in various ways, for example by eliminating inhibiting regulatory mechanisms at the expression and protein level or by increasing, compared to the wild type, gene expression of the corresponding nucleic acids, i.e. nucleic acids encoding a .DELTA.8-.DELTA.7-isomerase, .DELTA.5-desaturase, .DELTA.24-reductase, HMG-CoA reductase, lanosterol C14-demethylase, squalene epoxidase, squalene synthetase or sterol acyltransferase.

[0053] Likewise, gene expression of the corresponding nucleic acid may be increased compared to the wild type in various ways, for example by inducing the appropriate genes by activators, i.e. by inducing the .DELTA.8-.DELTA.7-isomerase gene, the .DELTA.5-desaturase gene, the .DELTA.24-reductase gene, the HMG-CoA-reductase gene, the lanosterol C14-demethylase gene, the squalene-epoxidase gene, the squalene-synthetase gene or the sterol-acyltransferase gene by activators, or by introducing one or more gene copies of the appropriate nucleic acids, i.e. by introducing one or more nucleic acids encoding a .DELTA.8-.DELTA.7-isomerase, .DELTA.5-desaturase, .DELTA.24-reductase, HMG-CoA reductase, lanosterol C14-demethylase, squalene epoxidase, squalene synthetase or sterol acyltransferase into the organism.

[0054] Increasing the gene expression of a nucleic acid encoding a .DELTA.8-.DELTA.7-isomerase, .DELTA.5-desaturase, .DELTA.24-reductase, HMG-CoA reductase, lanosterol C14-demethylase, squalene epoxidase, squalene synthetase or sterol acyltransferase means according to the invention also manipulation of the expression of endogenous .DELTA.8-.DELTA.7-isomerases, .DELTA.5-desaturases, .DELTA.24-reductases, HMG-CoA reductases, lanosterol C14-demethylases, squalene epoxidases, squalene synthetases or sterol acyltransferases, which are intrinsic to the organism, in particular to the yeasts.

[0055] This may be achieved, for example, by modifying the promoter DNA sequence of genes coding for .DELTA.8-.DELTA.7-isomerase, .DELTA.5-desaturase, .DELTA.24-reductase, HMG-CoA reductase, lanosterol C14-demethylase, squalene epoxidase, squalene synthetase or sterol acyltransferase. Such a modification which causes an increased rate of expression of the relevant gene may be carried out, for example, by deleting or inserting DNA sequences.

[0056] As described above, it is possible to modify expression of the endogenous .DELTA.8-.DELTA.7-isomerase, .DELTA.5-desaturase, .DELTA.24-reductase, HMG-CoA reductase, lanosterol C14-demethylase, squalene epoxidase, squalene synthetase or sterol acyltransferase by applying exogenous stimuli. This may be carried out using particular physiological conditions, i.e. by applying foreign substances.

[0057] Furthermore, a modified or increased expression of endogenous .DELTA.8-.DELTA.7-isomerase, .DELTA.5-desaturase, .DELTA.24-reductase, HMG-CoA reductase, lanosterol C14-demethylase, squalene epoxidase, squalene synthetase or sterol acyltransferase genes may be achieved by interaction of a regulatory protein which is not present in the untransformed organism with the promoter of said genes.

[0058] A regulator of this type may be a chimeric protein which consists of a DNA-binding domain and a transcriptional activator domain, as described, for example, in WO 96/06166.

[0059] In a preferred embodiment, the .DELTA.8-.DELTA.7-isomerase activity is increased compared to the wild type by increasing the gene expression of a nucleic acid encoding a .DELTA.8-.DELTA.7-isomerase.

[0060] In a further preferred embodiment, gene expression of a nucleic acid encoding a .DELTA.8-.DELTA.7-isomerase is increased by introducing into the organism one or more nucleic acids encoding a .DELTA.8-.DELTA.7-isomerase.

[0061] For this purpose, it is possible to use in principle any .DELTA.8-.DELTA.7-isomerase gene, i.e. any nucleic acid encoding a .DELTA.8-.DELTA.7-isomerase.

[0062] In the case of genomic .DELTA.8-.DELTA.7-isomerase nucleic acid sequences from eukaryotic sources, which contain introns, preferably already processed nucleic acid sequences such as the corresponding cDNAs are to be used, if the host organism is unable to or cannot be enabled to express the appropriate .DELTA.8-.DELTA.7-isomerase.

[0063] Examples of .DELTA.8-.DELTA.7-isomerase genes are nucleic acids encoding a murine .DELTA.8-.DELTA.7-isomerase (nucleic acid: Seq. ID. No. 1, protein: Seq. ID. No. 2) or a human .DELTA.8-.DELTA.7-isomerase (nucleic acid: Seq. ID. No. 3, protein: Seq. ID. No. 4) (Braverman, N. et al., (1999): Mutations in the gene encoding

[0064] 3.beta.-hydroxysteroid-.DELTA.8,.DELTA.7-isomerase cause X-linked dominant Conradi-Hunermann syndrome, Nat. Genet. 22(3), 291-294), or else nucleic acids encoding proteins which have the activity of a .DELTA.8-.DELTA.7-isomerase, for example due to a broad substrate specificity, such as, for example, nucleic acids encoding a C8-isomerase Saccharomyces cerevisiae (ERG2) (Nucleic acid: Seq. ID. No. 5, protein: Seq. ID. No. 6) (Ashman, W. H. et al. (1991): Cloning and disruption of the yeast C-8 sterol isomerase gene. Lipids. August; 26(8):628-32).

[0065] In this preferred embodiment, thus at least one further .DELTA.8-.DELTA.7-isomerase gene is present in the transgenic organisms of the invention, compared to the wild type.

[0066] The number of .DELTA.8-.DELTA.7-isomerase genes in the transgenic organisms of the invention is at least two, preferably more than two, particularly preferably more than three and very particularly preferably more than five.

[0067] All of the nucleic acids mentioned in the description may be, for example, an RNA sequence, DNA sequence or cDNA sequence.

[0068] Preferred .DELTA.8-.DELTA.7-isomerase genes are nucleic acids encoding proteins which have a high substrate specificity for zymosterol. Therefore, preference is given in particular to .DELTA.8-.DELTA.7-isomerase genes and to the corresponding .DELTA.8-.DELTA.7-isomerases of mammals and to the functional equivalents thereof.

[0069] Accordingly, preference is given to using in the above-described method nucleic acids which encode proteins comprising the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which is at least 30%, preferably at least 50%, more preferably at least 70%, still more preferably at least 90%, most preferably at least 95%, identical at the amino acid level with the sequence SEQ. ID. NO. 2, and having the enzyme property of a .DELTA.8-.DELTA.7-isomerase.

[0070] The sequence SEQ. ID. NO. 2 represents the amino acid sequence of Mus musculus .DELTA.8-.DELTA.7-isomerase.

[0071] Further examples of .DELTA.8-.DELTA.7-isomerases and .DELTA.8-.DELTA.7-isomerase genes can readily be found, for example, for various organisms whose genomic sequence is known by comparing the homology of the amino acid sequences or the corresponding backtranslated nucleic acid sequences from databases with the SeQ ID. NO. 2.

[0072] The Homo sapiens .DELTA.8-.DELTA.7-isomerase (Seq. ID. No. 4), for example, is 74% identical to the Mus musculus .DELTA.8-.DELTA.7-isomerase (Seq. ID. No. 2).

[0073] Further examples of .DELTA.8-.DELTA.7-isomerases and .DELTA.8-.DELTA.7-isomerase genes can furthermore readily be found for various organisms whose genomic sequence is unknown, for example starting from the sequence SEQ. ID. No. 1, by hybridization techniques and PCR techniques in a manner known per se.

[0074] The term "substitution" means in the description the replacement of one or more amino acids by one or more amino acids. Preference is given to carrying out "conservative" replacements in which the replacing amino acid has a similar property to that of the original amino acid, for example replacement of Glu by Asp, Gln by Asn, Val by Ile, Leu by Ile, Ser by Thr.

[0075] A deletion is the replacement of an amino acid by a direct bond. Preferred positions for deletions are the polypeptide termini and the linkages between the individual protein domains.

[0076] Insertions are introductions of amino acids into the polypeptide chain, with a direct bond formally being replaced by one or more amino acids.

[0077] Identity between two proteins means identity of the amino acids over the in each case entire length of the protein, in particular the identity which is calculated by comparison with the aid of the Lasergene software from DNASTAR Inc., Madison, Wis. (USA), using the Clustal method (Higgins D G, Sharp P M. Fast and sensitive multiple sequence alignments on a microcomputer. Comput Appl. Biosci. 1989 April; 5(2):151-1) and setting the following parameters: TABLE-US-00001 Multiple alignment parameter: Gap penalty 10 Gap length penalty 10 Pairwise alignment parameter: K-tuple 1 Gap penalty 3 Window 5 Diagonals saved 5

[0078] Accordingly, a protein which is at least 30% identical at the amino acid level with the sequence SEQ. ID. NO. 2 means a protein which is at least 30% identical when comparing its sequence with the sequence SEQ. ID. NO. 2, in particular according to the above program algorithm with the above set of parameters.

[0079] In a further, particularly preferred embodiment, the .DELTA.8-.DELTA.7-isomerase activity is increased by introducing into organisms nucleic acids which encode proteins comprising the amino acid sequence of Mus musculus .DELTA.8-.DELTA.7-isomerase (SEQ. ID. NO. 2).

[0080] Suitable nucleic acid sequences can be obtained, for example, by backtranslating the polypeptide sequence according to the genetic code.

[0081] Preference is given to using for this those codons which are frequently used according to the organism-specific codon usage. Said codon usage can readily be determined on the basis of computer analyses of other known genes of the organisms in question.

[0082] If the protein is to be expressed in yeast, for example, it is often advantageous to use the codon usage of yeast for backtranslation.

[0083] In a particularly preferred embodiment, a nucleic acid comprising the sequence SEQ. ID. NO. 1 is introduced into the organism.

[0084] The sequence SEQ. ID. NO. 1 represents the Mus musculus cDNA which encodes the .DELTA.8-.DELTA.7-isomerase of the sequence SEQ ID NO. 2.

[0085] Furthermore, all of the .DELTA.8-.DELTA.7-isomerase genes mentioned above can be prepared in a manner known per se by chemical synthesis from the nucleotide building blocks, for example by fragment condensation of individual overlapping complementary nucleic acid building blocks of the double helix. The chemical synthesis of oligonucleotides may be carried out, for example, in a known manner according to the phosphoramidite method (Voet, Voet, 2nd edition, Wiley Press New York, pages 896-897). Annealing of synthetic oligonucleotides and filling-in of gaps with the aid of the Klenow fragment of DNA polymerase and the ligation reactions and also general cloning methods are described in Sambrook et al. (1989), Molecular cloning: A laboratory manual, Cold Spring Harbor Laboratory Press.

[0086] In a preferred embodiment, the .DELTA.5-desaturase activity is increased compared to the wild type by increasing the gene expression of a nucleic acid encoding a .DELTA.5-desaturase.

[0087] In a further preferred embodiment, gene expression of a nucleic acid encoding a .DELTA.5-desaturase is increased by introducing into the organism one or more nucleic acids encoding a .DELTA.5-desaturase.

[0088] For this purpose, it is possible to use in principle any .DELTA.5-desaturase gene, i.e. any nucleic acid encoding a .DELTA.5-desaturase.

[0089] In the case of genomic .DELTA.5-desaturase nucleic acid sequences from eukaryotic sources, which contain introns, preferably already processed nucleic acid sequences such as the corresponding cDNAs are to be used, if the host organism is unable to or cannot be enabled to express the appropriate .DELTA.5-desaturase.

[0090] Examples of .DELTA.5-desaturase genes are nucleic acids encoding a murine .DELTA.5-desaturase (nucleic acid: Seq. ID. No. 7, protein: Seq. ID. No. 8) or a human .DELTA.5-desaturase (nucleic acid: Seq. ID. No. 9, protein: Seq. ID. No. 10) (Nishi, S. et al., (2000): cDNA cloning of the mammalian sterol C5-desaturase and the expression in yeast mutant. Biochim. Biophys. Acta, 1490, (1-2), 106-108), or else nucleic acids encoding proteins which have the activity of a .DELTA.5-desaturase, for example due to a broad substrate specificity, such as, for example, nucleic acids encoding a Saccharomyces cerevisiae C5-desaturase (ERG3) (nucleic acid: Seq. ID. No. 11, protein: Seq. ID. No. 12), (Arthington, B. A. et al. (1991): Cloning, disruption and sequence of the gene encoding yeast C-5 sterol desaturase. Gene. June 15; 102(1):39-44).

[0091] In this preferred embodiment, thus at least one further .DELTA.5-desaturase gene is present in the transgenic organisms of the invention, compared to the wild type.

[0092] The number of .DELTA.5-desaturase genes in the transgenic organisms of the invention is at least two, preferably more than two, particularly preferably more than three and very particularly preferably more than five.

[0093] Preferred .DELTA.5-desaturase genes are nucleic acids encoding proteins which have a high substrate specificity for cholesta-7,24-dienol. Therefore, preference is given in particular to .DELTA.5-desaturase genes and to the corresponding .DELTA.5-desaturases of mammals and to the functional equivalents thereof.

[0094] Accordingly, preference is given to using in the above-described method nucleic acids which encode proteins comprising the amino acid sequence SEQ. ID. NO. 8 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which is at least 30%, preferably at least 50%, more preferably at least 70%, still more preferably at least 90%, most preferably at least 95%, identical at the amino acid level with the sequence SEQ. ID. NO. 8, and having the enzyme property of a .DELTA.5-desaturase.

[0095] The sequence SEQ. ID. NO. 8 represents the amino acid sequence of Mus musculus .DELTA.5-desaturase.

[0096] Further examples of .DELTA.5-desaturase and .DELTA.5-desaturase genes can readily be found, for example, for various organisms whose genomic sequence is known by comparing the homology of the amino acid sequences or the corresponding backtranslated nucleic acid sequences from databases with the SeQ ID. NO. 2.

[0097] The Homo sapiens .DELTA.5-desaturase (Seq. ID. No. 10), for example, is 84% identical to Mus musculus .DELTA.5-desaturase (Seq. ID. No. 8).

[0098] Further examples of .DELTA.5-desaturases and .DELTA.5-desaturase genes can furthermore readily be found for various organisms whose genomic sequence is unknown, for example starting from the sequence SEQ. ID. No. 7, by hybridization techniques and PCR techniques in a manner known per se.

[0099] Accordingly, a protein which is at least 30% identical at the amino acid level with the sequence SEQ. ID. NO. 8 means a protein which is at least 30% identical when comparing its sequence with the sequence SEQ. ID. NO. 8, in particular according to the above program algorithm with the above set of parameters.

[0100] In a further, particularly preferred embodiment, the .DELTA.5-desaturase activity is increased by introducing into organisms nucleic acids which encode proteins comprising the amino acid sequence of Mus musculus .DELTA.5-desaturase (SEQ. ID. NO. 8).

[0101] Suitable nucleic acid sequences can be obtained, for example, by backtranslating the polypeptide sequence according to the genetic code.

[0102] Preference is given to using for this those codons which are frequently used according to the organism-specific codon usage. Said codon usage can readily be determined on the basis of computer analyses of other known genes of the organisms in question.

[0103] If the protein is to be expressed in yeast, for example, it is often advantageous to use the codon usage of yeast for backtranslation.

[0104] In a particularly preferred embodiment, a nucleic acid comprising the sequence SEQ. ID. NO. 7 is introduced into the organism.

[0105] The sequence SEQ. ID. NO. 7 represents the Mus musculus cDNA which encodes the .DELTA.5-desaturase of the sequence SEQ ID NO. 8.

[0106] Furthermore, all of the .DELTA.5-desaturase genes mentioned above can be prepared in a manner known per se by chemical synthesis from the nucleotide building blocks, for example by fragment condensation of individual overlapping complementary nucleic acid building blocks of the double helix. The chemical synthesis of oligonucleotides may be carried out, for example, in a known manner according to the phosphoramidite method (Voet, Voet, 2nd edition, Wiley Press New York, pages 896-897). Annealing of synthetic oligonucleotides and filling-in of gaps with the aid of the Klenow fragment of DNA polymerase and the ligation reactions and also general cloning methods are described in Sambrook et al. (1989), Molecular cloning: A laboratory manual, Cold Spring Harbor Laboratory Press.

[0107] In a preferred embodiment, the .DELTA.24-reductase activity is increased compared to the wild type by increasing the gene expression of a nucleic acid encoding a .DELTA.24-reductase.

[0108] In a further preferred embodiment, gene expression of a nucleic acid encoding a .DELTA.24-reductase is increased by introducing into the organism one or more nucleic acids encoding a .DELTA.24-reductase.

[0109] For this purpose, it is possible to use in principle any .DELTA.24-reductase gene, i.e. any nucleic acid encoding a .DELTA.24-reductase.

[0110] In the case of genomic .DELTA.24-reductase nucleic acid sequences from eukaryotic sources, which contain introns, preferably already processed nucleic acid sequences such as the corresponding cDNAs are to be used, if the host organism is unable to or cannot be enabled to express the appropriate .DELTA.24-reductase.

[0111] Examples of .DELTA.24-reductase genes are nucleic acids encoding a murine .DELTA.24-reductase (nucleic acid: Seq. ID. No. 13, protein: Seq. ID. No. 14) or a human .DELTA.24-reductase (nucleic acid: Seq. ID. No. 15, protein: Seq. ID. No. 16) (Waterham, H. R. et al.: Mutations in the 3.beta.-Hydroxysterol .DELTA.24-Reductase Gene Cause Desmosterolosis, an Autosomal Recessive Disorder of Cholesterol Biosynthesis, Am. J. Hum. Genet. 69 (4), 685-694 (2001)), or else nucleic acids encoding proteins which have the activity of a .DELTA.24-reductase, for example due to a broad substrate specificity, such as, for example, nucleic acids encoding a Saccharomyces cerevisiae .DELTA.24-reductase (ERG4) (nucleic acid: Seq. ID. No. 17, protein: Seq. ID. No. 18) (Lai, M. H. et al., (1994): The identification of a gene family in the Saccharomyces cerevisiae ergosterol biosynthesis pathway. Gene. March 11; 140(1):41-9).

[0112] In this preferred embodiment, thus at least one further .DELTA.24-reductase gene is present in the transgenic organisms of the invention, compared to the wild type.

[0113] The number of .DELTA.24-reductase genes in the transgenic organisms of the invention is at least two, preferably more than two, particularly preferably more than three and very particularly preferably more than five.

[0114] Preferred .DELTA.24-reductase genes are nucleic acids encoding proteins which have a high substrate specificity for cholesta-5,7,24-trienol. Therefore, preference is given in particular to .DELTA.24-reductase genes and to the corresponding .DELTA.24-reductase of mammals and to the functional equivalents thereof.

[0115] Accordingly, preference is given to using in the above-described method nucleic acids which encode proteins comprising the amino acid sequence SEQ. ID. NO. 14 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which is at least 30%, preferably at least 50%, more preferably at least 70%, still more preferably at least 90%, most preferably at least 95%, identical at the amino acid level with the sequence SEQ. ID. NO. 14, and having the enzyme property of a .DELTA.24-reductase.

[0116] The sequence SEQ. ID. NO. 14 represents the amino acid sequence of Mus musculus .DELTA.24-reductase.

[0117] Further examples of .DELTA.24-reductases and .DELTA.24-reductase genes can readily be found, for example, for various organisms whose genomic sequence is known by comparing the homology of the amino acid sequences or the corresponding backtranslated nucleic acid sequences from databases with the SeQ ID. NO. 14.

[0118] The Homo sapiens .DELTA.24-reductase (Seq. ID. No. 16), for example, is 96% identical to Mus musculus .DELTA.24-reductase (Seq. ID. No. 14).

[0119] Further examples of .DELTA.24-reductases and .DELTA.24-reductase genes can furthermore readily be found for various organisms whose genomic sequence is unknown, for example starting from the sequence SEQ. ID. No. 13, by hybridization techniques and PCR techniques in a manner known per se.

[0120] Accordingly, a protein which is at least 30% identical at the amino acid level with the sequence SEQ. ID. NO. 14 means a protein which is at least 30% identical when comparing its sequence with the sequence SEQ. ID. NO. 14, in particular according to the above program algorithm with the above set of parameters.

[0121] In a further, particularly preferred embodiment, the .DELTA.24-reductase activity is increased by introducing into organisms nucleic acids which encode proteins comprising the amino acid sequence of Mus musculus .DELTA.24-reductase (SEQ. ID. NO. 14).

[0122] Suitable nucleic acid sequences can be obtained, for example, by backtranslating the polypeptide sequence according to the genetic code.

[0123] Preference is given to using for this those codons which are frequently used according to the organism-specific codon usage. Said codon usage can readily be determined on the basis of computer analyses of other known genes of the organisms in question.

[0124] If the protein is to be expressed in yeast, for example, it is often advantageous to use the codon usage of yeast for backtranslation.

[0125] In a particularly preferred embodiment, a nucleic acid comprising the sequence SEQ. ID. NO. 13 is introduced into the organism.

[0126] The sequence SEQ. ID. NO. 13 represents the Mus musculus genomic DNA which encodes the .DELTA.24-reductase of the sequence SEQ ID NO. 14.

[0127] Furthermore, all of the .DELTA.24-reductase genes mentioned above can be prepared in a manner known per se by chemical synthesis from the nucleotide building blocks, for example by fragment condensation of individual overlapping complementary nucleic acid building blocks of the double helix. The chemical synthesis of oligonucleotides may be carried out, for example, in a known manner according to the phosphoramidite method (Voet, Voet, 2nd edition, Wiley Press New York, pages 896-897). Annealing of synthetic oligonucleotides and filling-in of gaps with the aid of the Klenow fragment of DNA polymerase and the ligation reactions and also general cloning methods are described in Sambrook et al. (1989), Molecular cloning: A laboratory manual, Cold Spring Harbor Laboratory Press.

[0128] In a further preferred embodiment of the method of the invention, organisms are cultured which have, compared to the wild type, a reduced activity of at least one of the activities selected from the group consisting of C24-methyltransferase activity and .DELTA.22-desaturase activity in addition to the above-described genetic modifications.

[0129] In a further particularly preferred embodiment, organisms are cultured which have, compared to the wild type, a reduced C24-methyltransferase activity and a reduced .DELTA.22-desaturase activity in addition to the above-described genetic modifications.

[0130] A reduced activity means both the reduced and the complete elimination of said activity. Reducing an activity therefore also comprises a reduction in the amount of the corresponding protein in the organism up to a complete absence of the corresponding protein, which can be tested, for example, via missing detectability of the corresponding enzyme activity or missing immunological detectability of the corresponding proteins.

[0131] A C24-methyltransferase activity means the enzyme activity of a C24-methyltransferase.

[0132] A C24-methyltransferase means a protein which has the enzyme activity of converting zymosterol to fecosterol (ergosta-8,24(28)dienol).

[0133] Accordingly, C24-methyltransferase activity means the amount of zymosterol converted or the amount of fecosterol formed by the protein C24-methyltransferase in a particular time.

[0134] In the case of a reduced C24-methyltransferase activity compared to the wild type, thus the amount of zymosterol converted or the amount of fecosterol formed by the protein C24-methyltransferase in a particular time is reduced in comparison with the wild type.

[0135] The C24-methyltransferase activity is reduced preferably to at least 90%, further preferably to at least 70%, further preferably to at least 50%, further preferably to at least 30%, more preferably to at least 10%, still more preferably to at least 5%, in particular to 0%, of the C24-methyltransferase activity of the wild type. Therefore, particular preference is given to eliminating the C24-methyltransferase activity in the organism.

[0136] .DELTA.22-desaturase activity means the enzyme activity of a .DELTA.22-desaturase.

[0137] A .DELTA.22-desaturase means a protein which has the enzyme activity of converting ergosta-5,7-dienol to ergosta-5,7,22,24-tetraen-3.beta.-ol.

[0138] Accordingly, .DELTA.22-desaturase activity means the amount of ergosta-5,7-dienol converted or the amount of ergosta-5,7,22,24-tetraen-3.beta.-ol formed by the protein .DELTA.22-desaturase in a particular time.

[0139] In the case of a reduced .DELTA.22-desaturase activity compared to the wild type, thus the amount of ergosta-5,7-dienol converted or the amount of ergosta-5,7,22,24-tetraen-3.beta.-ol formed by the protein .DELTA.22-desaturase in a particular time is reduced in comparison with the wild type.

[0140] The .DELTA.22-desaturase activity is reduced preferably to at least 90%, further preferably to at least 70%, further preferably to at least 50%, further preferably to at least 30%, more preferably to at least 10%, still more preferably to at least 5%, in particular to 0%, of the .DELTA.22-desaturase activity of the wild type. Therefore, particular preference is given to eliminating the .DELTA.22-desaturase activity in the organism.

[0141] The reduction in C24-methyltransferase activity and/or .DELTA.22-desaturase activity may be carried out independently of one another by different cell-biological mechanisms, for example by inhibiting the corresponding activity at the protein level, for example by adding inhibitors of the corresponding enzymes or by reducing gene expression of the corresponding nucleic acids encoding a C24-methyltransferase or .DELTA.22-desaturase, compared to the wild type.

[0142] In a particularly preferred embodiment of the method of the invention, the C24-methyltransferase activity and/or the .DELTA.22-desaturase activity are reduced compared to the wild type by reducing the gene expression of the corresponding nucleic acids encoding a C24-methyltransferase or .DELTA.22-desaturase.

[0143] Likewise, gene expression of the nucleic acids encoding a C24-methyltransferase or .DELTA.22-desaturase may be reduced compared to the wild type in various ways, for example by

a) introducing nucleic acid sequences which can be transcribed to an antisense nucleic acid sequence which is capable of inhibiting the C24-methyltransferase activity and/or .DELTA.22-desaturase activity, for example by inhibiting the expression of endogenous C24-methyltransferase and/or .DELTA.22-desaturase activity, b) overexpression of homologous C24-methyltransferase nucleic acid sequences and/or .DELTA.22-desaturase nucleic acid sequences, which leads to cosuppression, c) introducing nonsense mutations into the endogene by means of introducing RNA/DNA oligonucleotides into the organism, d) introducing specific DNA-binding factors, for example factors of the zinc finger transcription factor type, which cause a reduction in gene expression or e) generating knockout mutants, for example with the aid of T-DNA mutagenesis or homologous recombination.

[0144] In a preferred embodiment of the method of the invention, gene expression of the nucleic acids encoding a C24-methyltransferase or .DELTA.22-desaturase is reduced by generating knockout mutants, particularly preferably by homologous recombination.

[0145] Therefore, preference is given to using an organism which has no functional C24-methyltransferase gene and/or .DELTA.22-desaturase gene.

[0146] In a preferred embodiment, knockout mutants are generated, i.e. the C24-methyltransferase-gene target locus and/or the .DELTA.22-desaturase-gene target locus are deleted with simultaneous integration of an expression cassette containing at least one of the nucleic acids described above or below, which encode a protein whose activity is increased in comparison with the wild type, by homologous recombination.

[0147] For this purpose, it is possible to use nucleic acid constructs which, in addition to the expression cassettes described below which contain promoter, coding sequence and, where appropriate, terminator and in addition to a selection marker at the 3' and 5' ends, described below, contain nucleic acid sequences which are identical to nucleic acid sequences at the start and the end of the gene to be deleted.

[0148] After selection by recombinase systems, the selection marker may preferably be removed again, for example via loxP signals at the 3' and 5' ends of the selection marker, using a Cre recombinase (Cre-loxP system).

[0149] In the preferred organism Saccharomyces cerevisiae, the C24-methyltransferase gene is the gene ERG6 (SEQ. ID. NO. 19). SEQ. ID. NO. 20 represents the corresponding Saccharomyces cerevisiae C24-methyltransferase (Hardwick, K. G. et al.: SED6 is identical to ERG6, and encodes a putative methyltransferase required for ergosterol synthesis. Yeast. February; 10(2):265-9).

[0150] In the preferred organism Saccharomyces cerevisiae, the .DELTA.22-desaturase gene is the gene ERG5 (SEQ. ID. NO. 21). SEQ. ID. NO. 22 represents the corresponding Saccharomyces cerevisiae .DELTA.22-desaturase (Skaggs, B. A. et al: Cloning and characterization of the Saccharomyces cerevisiae C-22 sterol desaturase gene, encoding a second cytochrome P-450 involved in ergosterol biosynthesis, Gene. 1996 Feb. 22; 169(1):105-9).

[0151] In a further preferred embodiment of the method of the invention, organisms are cultured which have, in addition to the above-described modifications, an increased activity of at least one of the activities selected from the group consisting of HMG-CoA-reductase activity, lanosterol-C14-demethylase activity, squalene-epoxidase activity, squalene-synthetase activity and sterol-acyltransferase activity, compared to the wild type.

[0152] HMG-CoA-reductase activity means the enzyme activity of an HMG-CoA reductase (3-hydroxy-3-methylglutaryl-coenzyme-A reductase).

[0153] HMG-CoA reductase means a protein which has the enzyme activity of converting 3-hydroxy-3-methylglutaryl-coenzyme A to mevalonate.

[0154] Accordingly, HMG-CoA-reductase activity means the amount of 3-hydroxy-3-methylglutaryl-coenzyme A converted or the amount of mevalonate formed by the protein HMG-CoA reductase in a particular time.

[0155] In the case of an increased HMG-CoA-reductase activity compared to the wild type, thus the amount of 3-hydroxy-3-methylglutaryl-coenzyme A converted or the amount of mevalonate formed by the protein HMG-CoA reductase in a particular time is increased in comparison with the wild type.

[0156] This increase in HMG-CoA-reductase activity is preferably at least 5%, further preferably at least 20%, further preferably at least 50%, further preferably at least 100%, more preferably at least 300%, still more preferably at least 500%, in particular at least 600%, of the HMG-CoA-reductase activity of the wild type.

[0157] Lanosterol C14-demethylase activity means the enzyme activity of a lanosterol C14-demethylase.

[0158] Lanosterol C14-demethylase means a protein which has the enzyme activity of converting lanosterol to 4,4-dimethylcholesta-8,14,24-trienol.

[0159] Accordingly, lanosterol C14-demethylase activity means the amount of lanosterol converted or the amount of 4,4-dimethylcholesta-8,14,24-trienol formed by the protein lanosterol C14-demethylase in a particular time.

[0160] In the case of an increased lanosterol C14-demethylase activity compared to the wild type, thus the amount of lanosterol converted or the amount of 4,4-dimethylcholesta-8,14,24-trienol formed by the protein lanosterol C14-demethylase in a particular time is increased in comparison with the wild type.

[0161] This increase in lanosterol C14-demethylase activity is preferably at least 5%, further preferably at least 20%, further preferably at least 50%, further preferably at least 100%, more preferably at least 300%, still more preferably at least 500%, in particular at least 600%, of the lanosterol C14-demethylase activity of the wild type.

[0162] Squalene-epoxidase activity means the enzyme activity of a squalene epoxidase.

[0163] Squalene epoxidase means a protein which has the enzyme activity of converting squalene to squalene epoxide.

[0164] Accordingly, squalene-epoxidase activity means the amount of squalene converted or the amount of squalene epoxide formed by the protein squalene epoxidase in a particular time.

[0165] In the case of an increased squalene-epoxidase activity compared to the wild type, thus the amount of squalene converted or the amount of squalene epoxide formed by the protein squalene epoxidase in a particular time is increased in comparison with the wild type.

[0166] This increase in squalene-epoxidase activity is preferably at least 5%, further preferably at least 20%, further preferably at least 50%, further preferably at least 100%, more preferably at least 300%, still more preferably at least 500%, in particular at least 600%, of the squalene-epoxidase activity of the wild type.

[0167] Squalene-synthetase activity means the enzyme activity of a squalene synthetase.

[0168] Squalene synthetase means a protein which has the enzyme activity of converting farnesyl-pyrophosphate to squalene.

[0169] Accordingly, squalene-synthetase activity means the amount of farnesyl-pyrophosphate converted or the amount of squalene formed by the protein squalene synthetase in a particular time.

[0170] In the case of an increased squalene-synthetase activity compared to the wild type, thus the amount of farnesyl-pyrophosphate converted or the amount of squalene formed by the protein squalene synthetase in a particular time is increased in comparison with the wild type.

[0171] This increase in squalene-synthetase activity is preferably at least 5%, further preferably at least 20%, further preferably at least 50%, further preferably at least 100%, more preferably at least 300%, still more preferably at least 500%, in particular at least 600%, of the squalene-synthetase activity of the wild type.

[0172] Sterol-acyltransferase activity means the enzyme activity of a sterol acyltransferase.

[0173] Sterol acyltransferase means a protein which has the enzyme activity of converting 7-dehydrocholesterol to corresponding acetylated 7-dehydrocholesterol.

[0174] Accordingly, sterol-acyltransferase activity means the amount of 7-dehydrocholesterol converted or the amount of acetylated 7-dehydrocholesterol formed by the protein sterol acyltransferase in a particular time.

[0175] In the case of an increased sterol-acyltransferase activity compared to the wild type, thus the amount of 7-dehydrocholesterol converted or the amount of acetylated 7-dehydrocholesterol formed by the protein sterol acyltransferase in a particular time is increased in comparison with the wild type.

[0176] This increase in sterol-acyltransferase activity is preferably at least 5%, further preferably at least 20%, further preferably at least 50%, further preferably at least 100%, more preferably at least 300%, still more preferably at least 500%, in particular at least 600%, of the sterol-acyltransferase activity of the wild type.

[0177] In a preferred embodiment, the HMG-CoA-reductase activity is increased compared to the wild type by increasing the gene expression of a nucleic acid encoding an HMG-CoA reductase.

[0178] In a particularly preferred embodiment of the method of the invention, gene expression of a nucleic acid encoding an HMG-CoA reductase is increased by introducing into the organism a nucleic acid construct comprising an HMG-CoA reductase-encoding nucleic acid whose expression in said organism is subject to a reduced regulation, in comparison with the wild type.

[0179] A reduced regulation in comparison with the wild type means a reduced regulation and, preferably, no regulation at the expression or protein level, in comparison with the above-defined wild type.

[0180] The reduced regulation may be achieved preferably by a promoter which is functionally linked with the coding sequence in the nucleic acid construct and which is subject to a reduced regulation in the organism, in comparison with the wild-type promoter.

[0181] For example, the medium ADH promoter in yeast is subject only to a reduced regulation and is therefore particularly preferred as promoter in the above-described nucleic acid construct.

[0182] This promoter fragment of the ADH12s promoter, also referred to as ADH1 hereinbelow, exhibits nearly constitutive expression (Ruohonen L, Penttila M, Keranen S. (1991) Optimization of Bacillus .alpha.-amylase production by Saccharomyces cerevisiae. Yeast. May-June; 7(4):337-462; Lang C, Looman A C. (1995) Efficient expression and secretion of Aspergillus niger RH5344 polygalacturonase in Saccharomyces cerevisiae. Appl Microbiol Biotechnol. December; 44(1-2):147-56) so that transcriptional regulation no longer proceeds via intermediates of ergosterol biosynthesis.

[0183] Other preferred promoters with reduced regulation are constitutive promoters such as, for example, the yeast TEF1 promoter, the yeast GPD promoter or the yeast PGK promoter (Mumberg D, Muller R, Funk M. (1995) Yeast vectors for the controlled expression of heterologous proteins in different genetic backgrounds. Gene. 1995 Apr. 14; 156(1):119-22; Chen C Y, Oppermann H, Hitzeman R A. (1984) Homologous versus heterologous gene expression in the yeast, Saccharomyces cerevisiae. Nucleic Acids Res. December 11; 12(23):8951-70).

[0184] In a further preferred embodiment, reduced regulation can be achieved by using as an HMG-CoA reductase-encoding nucleic acid a nucleic acid whose expression in the organism is subject to a reduced regulation, in comparison with the orthologous nucleic acid intrinsic to said organism.

[0185] Particular preference is given to using as an HMG-CoA reductase-encoding nucleic acid a nucleic acid which encodes only the catalytic region of HMG-CoA reductase (truncated (t-) HMG-CoA reductase). This nucleic acid (t-HMG), described in EP 486 290 and WO 99/16886 encodes only the catalytically active part of HMG-CoA reductase, with the membrane domain responsible for regulation at the protein level missing. This nucleic acid is thus subject to a reduced regulation, in particular in yeast, and leads to an increase in gene expression of HMG-CoA reductase.

[0186] In a particularly preferred embodiment, nucleic acids are introduced, preferably via the above-described nucleic acid construct, which encode proteins comprising the amino acid sequence SEQ. ID. NO. 24 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which is at least 30% identical at the amino acid level to the sequence SEQ ID. NO. 24, and having the enzyme property of an HMG-CoA reductase.

[0187] The sequence SEQ ID NO. 24 is the amino acid sequence of the truncated HMG-CoA reductase (t-HMG).

[0188] Further examples of HMG-CoA reductases and thus also of the t-HMG-CoA reductases reduced to the catalytic region or of the coding genes can readily be found, for example, for various organisms whose genomic sequence is known by comparing the homology of the amino acid sequences or of the corresponding backtranslated nucleic acid sequences from databases with the sequence SEQ ID. No. 24.

[0189] Further examples of HMG-CoA reductases and thus also of the t-HMG-CoA reductases reduced to the catalytic region and of the coding genes can furthermore readily be found for various organisms whose genomic sequence is unknown by hybridization techniques and PCR techniques in a manner known per se, for example starting from the sequence SEQ ID NO. 23.

[0190] Particular preference is given to using as a truncated HMG-CoA reductase-encoding nucleic acid a nucleic acid comprising the sequence SEQ ID NO. 23.

[0191] In a particularly preferred embodiment, the reduced regulation is achieved by using as an HMG-CoA reductase-encoding nucleic acid a nucleic acid whose expression in the organism is subject to a reduced regulation, in comparison with the orthologous nucleic acid intrinsic to said organism, and by using a promoter which is subject to a reduced regulation in said organism, in comparison with the wild-type promoter.

[0192] In a preferred embodiment, the lanosterol C14-demethylase activity is increased compared to the wild type by increasing the gene expression of a nucleic acid encoding a lanosterol C14-demethylase.

[0193] In a further preferred embodiment, gene expression of a nucleic acid encoding a lanosterol C14-demethylase is increased by introducing into the organism one or more nucleic acids encoding a lanosterol C14-demthylase.

[0194] For this purpose, it is possible to use in principle any lanosterol C14-demethylase gene (ERG11), i.e. any nucleic acids encoding a lanosterol C14-demethylase. In the case of genomic lanosterol C14-demethylase nucleic acid sequences from eukaryotic sources, which contain introns, already processed nucleic acid sequences such as the corresponding cDNAs are to be used preferably, if the host organism is unable to or cannot be enabled to express the appropriate lanosterol C14-demethylase.

[0195] Examples of lanosterol C14-demethylase genes are nucleic acids encoding a lanosterol C14-demethylase of Saccharomyces cerevisiae (Kalb V F, Loper J C, Dey C R, Woods C W, Sutter T R (1986) Isolation of a cytochrome P-450 structural gene from Saccharomyces cerevisiae. Gene 45(3):237-45), Candida albicans (Lamb D C, Kelly D E, Baldwin B C, Gozzo F, Boscott P, Richards W G, Kelly S L (1997) Differential inhibition of Candida albicans CYP51 with azole antifungal stereoisomers. FEMS Microbiol Lett 149(1):25-30), Homo sapiens (Stromstedt M, Rozman D, Waterman M R. (1996) The ubiquitously expressed human CYP51 encodes lanosterol 14 .alpha.-demethylase, a cytochrome P450 whose expression is regulated by oxysterols. Arch Biochem Biophys 1996 May 1; 329(1):73-81c) or Rattus norvegicus, Aoyama Y, Funae Y, Noshiro M, Horiuchi T, Yoshida Y. (1994) Occurrence of a P450 showing high homology to yeast lanosterol 14-demethylase (P450(14DM)) in the rat liver. Biochem Biophys Res Commun. June 30; 201(3):1320-6).

[0196] In this preferred embodiment, thus at least one further lanosterol C14-demethylase gene is present in the transgenic organisms of the invention, compared to the wild type.

[0197] The number of C14-demethylase genes in the transgenic organisms of the invention is at least two, preferably more than two, particularly preferably more than three and very particularly preferably more than five.

[0198] Preference is given to using in the above-described method nucleic acids which encode proteins comprising the amino acid sequence SEQ. ID. NO. 26 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which is at least 30%, preferably at least 50%, more preferably at least 70%, still more preferably at least 90%, most preferably at least 95%, identical at the amino acid level with the sequence SEQ. ID. NO. 26, and having the enzyme property of a lanosterol C14-demethylase.

[0199] The sequence SEQ. ID. NO. 26 represents the amino acid sequence of Saccharomyces cerevisiae lanosterol C14-demethylase.

[0200] Further examples of lanosterol C14-demethylases and lanosterol C14-demethylase genes can readily be found, for example, for various organisms whose genomic sequence is known by comparing the homology of the amino acid sequences or the corresponding backtranslated nucleic acid sequences from databases with the SeQ ID. NO. 26.

[0201] Further examples of lanosterol C14-demethylases and lanosterol C14-demethylase genes can furthermore readily be found for various organisms whose genomic sequence is unknown, for example starting from the sequence SEQ. ID. No. 25, by hybridization techniques and PCR techniques in a manner known per se.

[0202] Accordingly, a protein which is at least 30% identical at the amino acid level with the sequence SEQ. ID. NO. 26 means a protein which is at least 30% identical when comparing its sequence with the sequence SEQ. ID. NO. 26, in particular according to the above program algorithm with the above set of parameters.

[0203] In another preferred embodiment, nucleic acids are introduced into organisms, which encode proteins comprising the amino acid sequence of Saccharomyces cerevisiae lanosterol C14-demethylase (SEQ. ID. NO. 26).

[0204] Suitable nucleic acid sequences can be obtained, for example, by backtranslating the polypeptide sequence according to the genetic code.

[0205] Preference is given to using for this those codons which are frequently used according to the organism-specific codon usage. Said codon usage can readily be determined on the basis of computer analyses of other known genes of the organisms in question.

[0206] If the protein is to be expressed in yeast, for example, it is often advantageous to use the codon usage of yeast for the backtranslation.

[0207] In a particularly preferred embodiment, a nucleic acid comprising the sequence SEQ. ID. NO. 25 is introduced into the organism.

[0208] The sequence SEQ. ID. NO. 25 represents the genomic DNA of Saccharomyces cerevisiae (ORF S0001049), which encodes the lanosterol C14-demethylase of the sequence SEQ ID NO. 26.

[0209] Furthermore, all of the lanosterol C14-demethylase genes mentioned above can be prepared in a manner known per se by chemical synthesis from the nucleotide building blocks, for example by fragment condensation of individual overlapping complementary nucleic acid building blocks of the double helix. The chemical synthesis of oligonucleotides may be carried out, for example, in a known manner according to the phosphoramidite method (Voet, Voet, 2nd edition, Wiley Press New York, pages 896-897). Annealing of synthetic oligonucleotides and filling-in of gaps with the aid of the Klenow fragment of DNA polymerase and the ligation reactions and also general cloning methods are described in Sambrook et al. (1989), Molecular cloning: A laboratory manual, Cold Spring Harbor Laboratory Press.

[0210] In a preferred embodiment, the squalene-epoxidase activity is increased compared to the wild type by increasing the gene expression of a nucleic acid encoding a squalene epoxidase.

[0211] In a further preferred embodiment, gene expression of a nucleic acid encoding a squalene epoxidase is increased by introducing into the organism one or more nucleic acids encoding a squalene epoxidase.

[0212] For this purpose, it is possible to use in principle any squalene-epoxidase gene (ERG1), i.e. any nucleic acids encoding a squalene epoxidase. In the case of genomic squalene epoxidase nucleic acid sequences from eukaryotic sources, which contain introns, already processed nucleic acid sequences such as the corresponding cDNAs are to be used preferably, if the host organism is unable to or cannot be enabled to express the appropriate squalene epoxidase.

[0213] Examples of nucleic acids encoding a squalene epoxidase are nucleic acids encoding a squalene epoxidase of Saccharomyces cerevisiae (Jandrositz, A., et al (1991) The gene encoding squalene epoxidase from Saccharomyces cerevisiae: cloning and characterization. Gene 107:155-160, of Mus musculus (Kosuga K, Hata S, Osumi T, Sakakibara J, Ono T. (1995) Nucleotide sequence of a cDNA for mouse squalene epoxidase, Biochim Biophys Acta, February 21; 1260(3):345-8b), of Rattus norvegicus (Sakakibara J, Watanabe R, Kanai Y, Ono T. (1995) Molecular cloning and expression of rat squalene epoxidase. J Biol Chem January 6; 270(1):17-20c) or of Homo sapiens (Nakamura Y, Sakakibara J, Izumi T, Shibata A, Ono T. (1996) Transcriptional regulation of squalene epoxidase by sterols and inhibitors in HeLa cells, J. Biol. Chem. 1996, Apr. 5; 271(14):8053-6).

[0214] In this preferred embodiment, thus at least one further squalene epoxidase is present in the transgenic organisms of the invention, compared to the wild type.

[0215] The number of squalene-epoxidase genes in the transgenic organisms of the invention is at least two, preferably more than two, particularly preferably more than three and very particularly preferably more than five.

[0216] Preference is given to using in the above-described method nucleic acids which encode proteins comprising the amino acid sequence SEQ. ID. NO. 28 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which is at least 30%, preferably at least 50%, more preferably at least 70%, still more preferably at least 90%, most preferably at least 95%, identical at the amino acid level with the sequence SEQ. ID. NO. 28, and having the enzyme property of a squalene epoxidase.

[0217] The sequence SEQ. ID. NO. 28 represents the amino acid sequence of Saccharomyces cerevisiae squalene epoxidase.

[0218] Further examples of squalene epoxidases and squalene-epoxidase genes can readily be found, for example, for various organisms whose genomic sequence is known by comparing the homology of the amino acid sequences or the corresponding backtranslated nucleic acid sequences from databases with the SeQ ID. NO. 28.

[0219] Further examples of squalene epoxidases and squalene-epoxidase genes can furthermore readily be found for various organisms whose genomic sequence is unknown, for example starting from the sequence SEQ. ID. No. 27, by hybridization techniques and PCR techniques in a manner known per se.

[0220] In another preferred embodiment, nucleic acids are introduced into organisms, which encode proteins comprising the amino acid sequence of Saccharomyces cerevisiae squalene epoxidase (SEQ. ID. NO. 28).

[0221] Suitable nucleic acid sequences can be obtained, for example, by backtranslating the polypeptide sequence according to the genetic code.

[0222] Preference is given to using for this those codons which are frequently used according to the organism-specific codon usage. Said codon usage can readily be determined on the basis of computer analyses of other known genes of the organisms in question.

[0223] If the protein is to be expressed in yeast, for example, it is often advantageous to use the codon usage of yeast for backtranslation.

[0224] In a particularly preferred embodiment, a nucleic acid comprising the sequence SEQ. ID. NO. 27 is introduced into the organism.

[0225] The sequence SEQ. ID. NO. 27 represents the genomic DNA of Saccharomyces cerevisiae (ORF YGR175C), which encodes the squalene epoxidase of the sequence SEQ ID NO. 28.

[0226] Furthermore, all of the squalene-epoxidase genes mentioned above can be prepared in a manner known per se by chemical synthesis from the nucleotide building blocks, for example by fragment condensation of individual overlapping complementary nucleic acid building blocks of the double helix. The chemical synthesis of oligonucleotides may be carried out, for example, in a known manner according to the phosphoramidite method (Voet, Voet, 2nd edition, Wiley Press New York, pages 896-897). Annealing of synthetic oligonucleotides and filling-in of gaps with the aid of the Klenow fragment of DNA polymerase and the ligation reactions and also general cloning methods are described in Sambrook et al. (1989), Molecular cloning: A laboratory manual, Cold Spring Harbor Laboratory Press.

[0227] In a preferred embodiment, the squalene-synthetase activity is increased compared to the wild type by increasing the gene expression of a nucleic acid encoding a squalene synthetase.

[0228] In a further preferred embodiment, gene expression of a nucleic acid encoding a squalene synthetase is increased by introducing into the organism one or more nucleic acids encoding a squalene synthetase.

[0229] For this purpose, it is possible to use in principle any squalene-synthetase gene (ERG9), i.e. any nucleic acids encoding a squalene synthetase. In the case of genomic squalene synthetase nucleic acid sequences from eukaryotic sources, which contain introns, already processed nucleic acid sequences such as the corresponding cDNAs are to be used preferably, if the host organism is unable to or cannot be enabled to express the appropriate squalene synthetase.

[0230] Examples of nucleic acids encoding a squalene synthetase are nucleic acids encoding a Saccharomyces cerevisiae squalene synthetase (ERG9) (Jennings, S. M., (1991): Molecular cloning and characterization of the yeast gene for squalene synthetase. Proc Natl Acad Sci USA. July 15; 88(14):6038-42), nucleic acids encoding a Botryococcus braunii Okada squalene synthetase (Devarenne, T. P. et al.: Molecular characterization of squalene synthetase from the green microalga Botryococcus braunii, raceB, Arch. Biochem. Biophys. 2000, Jan. 15, 373(2):307-17), nucleic acids encoding a Potato tuber squalene synthetase (Yoshioka H. et al.: cDNA cloning of sesquiter penecyclase and squalene synthase, and expression of the genes in potato tuber infected with Phytophthora infestans, Plant. Cell. Physiol. 1999, September; 40(9):993-8) and nucleic acids encoding a Glycyrrhiza glabra squalene synthetase (Hayashi, H. et al.: Molecular cloning and characterization of two cDNAs for Glycyrrhiza glabra squalene synthase, Biol. Pharm. Bull. 1999, September; 22(9):947-50).

[0231] In this preferred embodiment, thus at least one further squalene-synthetase gene is present in the transgenic organisms of the invention, compared to the wild type.

[0232] The number of squalene-synthetase genes in the transgenic organisms of the invention is at least two, preferably more than two, particularly preferably more than three and very particularly preferably more than five.

[0233] Preference is given to using in the above-described method nucleic acids which encode proteins comprising the amino acid sequence SEQ. ID. NO. 30 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which is at least 30%, preferably at least 50%, more preferably at least 70%, still more preferably at least 90%, most preferably at least 95%, identical at the amino acid level with the sequence SEQ. ID. NO. 30, and having the enzyme property of a squalene synthetase.

[0234] The sequence SEQ. ID. NO. 30 represents the amino acid sequence of Saccharomyces cerevisiae squalene synthetase (ERG9).

[0235] Further examples of squalene synthetases and squalene-synthetase genes can readily be found, for example, for various organisms hose genomic sequence is known by comparing the homology of the amino acid sequences or the corresponding backtranslated nucleic acid sequences from databases with the SeQ ID. NO. 30.

[0236] Further examples of squalene synthetases and squalene-synthetase genes can furthermore readily be found for various organisms whose genomic sequence is unknown, for example starting from the sequence SEQ. ID. No. 29, by hybridization techniques and PCR techniques in a manner known per se.

[0237] In another preferred embodiment, nucleic acids are introduced into organisms, which encode proteins comprising the amino acid sequence of Saccharomyces cerevisiae squalene synthetase (SEQ. ID. NO. 30).

[0238] Suitable nucleic acid sequences can be obtained, for example, by backtranslating the polypeptide sequence according to the genetic code.

[0239] Preference is given to using for this those codons which are frequently used according to the organism-specific codon usage. Said codon usage can readily be determined on the basis of computer analyses of other known genes of the organisms in question.

[0240] If the protein is to be expressed in yeast, for example, it is often advantageous to use the codon usage of yeast for the backtranslation.

[0241] In a particularly preferred embodiment, a nucleic acid comprising the sequence SEQ. ID. NO. 29 is introduced into the organism.

[0242] The sequence SEQ. ID. NO. 29 represents the genomic DNA of Saccharomyces cerevisiae (ORF YHR190W), which encodes the squalene synthetase of the sequence SEQ ID NO. 30.

[0243] Furthermore, all of the squalene-synthetase genes mentioned above can be prepared in a manner known per se by chemical synthesis from the nucleotide building blocks, for example by fragment condensation of individual overlapping complementary nucleic acid building blocks of the double helix. The chemical synthesis of oligonucleotides may be carried out, for example, in a known manner according to the phosphoramidite method (Voet, Voet, 2nd edition, Wiley Press New York, pages 896-897). Annealing of synthetic oligonucleotides and filling-in of gaps with the aid of the Klenow fragment of DNA polymerase and the ligation reactions and also general cloning methods are described in Sambrook et al. (1989), Molecular cloning: A laboratory manual, Cold Spring Harbor Laboratory Press.

[0244] In a preferred embodiment, the sterol-acyltransferase activity is increased compared to the wild type by increasing the gene expression of a nucleic acid encoding a sterol acyltransferase.

[0245] In a further preferred embodiment, gene expression of a nucleic acid encoding a sterol acyltransferase is increased by introducing into the organism one or more nucleic acids encoding a sterol acyltransferase.

[0246] For this purpose, it is possible to use in principle any sterol-acyltransferase gene (SAT1 or SAT2), i.e. any nucleic acids encoding a sterol acyltransferase.

[0247] In the case of genomic sterol acyltransferase nucleic acid sequences from eukaryotic sources, which contain introns, already processed nucleic acid sequences such as the corresponding cDNAs are to be used preferably, if the host organism is unable to or cannot be enabled to express the appropriate sterol acyltransferase.

[0248] Examples of nucleic acids encoding a sterol acyltransferase are nucleic acids encoding a Saccharomyces cerevisiae sterol acyltransferase (SAT1) or (SAT2) (Yang, H.: Sterol esterification in yeast: a two-gene process. Science. 1996 May 31; 272(5266):1353-6), a further nucleic acid encoding a further Saccharomyces cerevisiae sterol acyltransferase (J. Biol. Chem. 1996, Sep. 27; 271(39):24157-63), nucleic acids encoding a human sterol acyltransferase (Chang, C. C. et al., Molecular cloning and functional expression of human acyl-coenzyme A:cholesterol acyltransferase cDNA in mutant Chinese hamster ovary cells, J. Biol. Chem. 1993, Oct. 5; 268(28):20747-55) and nucleic acids encoding a murine sterol acyltransferase (Uelmen, P. J.: Tissue-specific expression and cholesterol regulation of acylcoenzyme A:cholesterol acyltransferase (ACAT) in mice. Molecular cloning of mouse ACAT cDNA, chromosomal localization, and regulation of ACAT in vivo and in vitro, J. Biol. Chem. 1995 Nov. 3; 270(44):26192-201).

[0249] In this preferred embodiment, thus at least one further sterol-acyltransferase gene is present in the transgenic organisms of the invention, compared to the wild type.

[0250] The number of sterol-acyltransferase genes in the transgenic organisms of the invention is at least two, preferably more than two, particularly preferably more than three and very particularly preferably more than five.

[0251] Preference is given to using in the above-described method nucleic acids which encode proteins comprising the amino acid sequence SEQ. ID. NO. 32 or SEQ ID NO. 50 or a sequence derived from these sequences by substitution, insertion or deletion of amino acids, which is at least 30%, preferably at least 50%, more preferably at least 70%, still more preferably at least 90%, most preferably at least 95%, identical at the amino acid level with the sequence SEQ. ID. NO. 32 or SEQ. ID. NO. 50, and having the enzyme property of a sterol acyltransferase.

[0252] The sequence SEQ. ID. NO. 32 represents the amino acid sequence of Saccharomyces cerevisiae sterol acyltransferase SAT1.

[0253] The sequence SEQ. ID. NO. 50 represents the amino acid sequence Saccharomyces cerevisiae sterol acyltransferase SAT2.

[0254] SAT 1 and SAT2 differ from one another by a different substrate specificity.

[0255] Further examples of sterol acyltransferases and sterol-acyltransferase genes can readily be found, for example, for various organisms whose genomic sequence is known by comparing the homology of the amino acid sequences or the corresponding backtranslated nucleic acid sequences from databases with the SeQ ID. NO. 32 or 50.

[0256] Further examples of sterol acyltransferase and sterol-acyltransferase genes can furthermore readily be found for various organisms whose genomic sequence is unknown, for example starting from the sequence SEQ. ID. No. 31 or 49, by hybridization techniques and PCR techniques in a manner known per se.

[0257] In another preferred embodiment, nucleic acids are introduced into organisms, which encode proteins comprising the amino acid sequence of Saccharomyces cerevisiae sterol acyltransferase SAT1 (SEQ. ID. NO. 32) or Saccharomyces cerevisiae sterol acyltransferase SAT2 (SEQ. ID. NO. 50).

[0258] Suitable nucleic acid sequences can be obtained, for example, by backtranslating the polypeptide sequence according to the genetic code.

[0259] Preference is given to using for this those codons which are frequently used according to the organism-specific codon usage. Said codon usage can readily be determined on the basis of computer analyses of other known genes of the organisms in question.

[0260] If the protein is to be expressed in yeast, for example, it is often advantageous to use the codon usage of yeast for the backtranslation.

[0261] In a particularly preferred embodiment, a nucleic acid comprising the sequence SEQ. ID. NO. 31 or 49 is introduced into the organism.

[0262] The sequence SEQ. ID. NO. 31 represents the genomic DNA of Saccharomyces cerevisiae (ORF YNR019W), which encodes the sterol acyltransferase SAT1 of the sequence SEQ ID NO. 32.

[0263] The sequence SEQ. ID. NO. 49 represents the genomic DNA of Saccharomyces cerevisiae (ORF YCR048W), which encodes the sterol acyltransferase SAT2 of the sequence SEQ ID NO. 50.

[0264] Furthermore, all of the sterol-acyltransferase genes mentioned above can be prepared in a manner known per se by chemical synthesis from the nucleotide building blocks, for example by fragment condensation of individual overlapping complementary nucleic acid building blocks of the double helix. The chemical synthesis of oligonucleotides may be carried out, for example, in a known manner according to the phosphoramidite method (Voet, Voet, 2nd edition, Wiley Press New York, pages 896-897). Annealing of synthetic oligonucleotides and filling-in of gaps with the aid of the Klenow fragment of DNA polymerase and the ligation reactions and also general cloning methods are described in Sambrook et al. (1989), Molecular cloning: A laboratory manual, Cold Spring Harbor Laboratory Press.

[0265] According to the invention, organisms mean, for example, bacteria, in particular bacteria of the genus Bacillus, Escherichia coli, Lactobacillus spec. or Streptomyces spec.,

for example yeasts, in particular yeasts of the genus Saccharomyces cerecisiae, Pichia pastoris or Klyveromyces spec. for example fungi, in particular fungi of the genus Aspergillus spec., Penicillium spec. or Dictyostelium spec. and also, for example, insect cell lines, which are capable, either as wild type or owing to previous genetic modification, of producing zymosterol and/or the biosynthetic intermediates and/or secondary products thereof.

[0266] Particularly preferred organisms are yeasts, in particular those of the species Saccharomyces cerevisiae, in particular the yeast strains Saccharomyces cerevisiae AH22, Saccharomyces cerevisiae GRF, Saccharomyces cerevisiae DBY747 and Saccharomyces cerevisiae BY4741.

[0267] In the case of yeasts as organisms or genetically modified organisms, it is possible, as mentioned above, to increase at least one of the activities selected from the group consisting of .DELTA.8-.DELTA.7-isomerase activity, .DELTA.5-desaturase activity and .DELTA.24-reductase activity by overexpressing the corresponding nucleic acids.

[0268] The overexpression may be carried out both homologously by introducing nucleic acids intrinsic to yeast and heterologously by introducing nucleic acids from other organisms, in particular mammals, or natural or artificial variants derived therefrom into the yeast. Preference is given to using mammalian genes in yeasts, since these genes have a better substrate specificity with respect to 7-dehydrocholesterol.

[0269] The .DELTA.8-.DELTA.7-isomerase activity, .DELTA.5-desaturase activity, .DELTA.24-reductase activity, C24-methyltransferase activity, .DELTA.22-desaturase activity, HMG-CoA-reductase activity, lanosterol-C14-demethylase activity, squalene-epoxidase activity, squalene-synthetase activity and sterol-acyltransferase activity of the genetically modified organism of the invention and of the reference organism is determined under the following conditions:

[0270] The activity of HMG-CoA reductase is determined as described in Th. Polakowski, Molekularbiologische Beeinflussung des Ergosterolstoffwechsels der Hefe Saccharomyces cerevisiae [influencing the ergosterol metabolism of the yeast Saccharomyces cerevisiae by molecular biological means], Shaker-Verlag, Aachen 1999, ISBN 3-8265-6211-9, beschrieben.

[0271] According to this, 10.sup.9 yeast cells of a 48 h culture are harvested by centrifugation (3500.times.g, 5 min) and washed in 2 ml of buffer I (100 mM potassium phosphate buffer, pH 7.0). The cell pellet is taken up in 500 .mu.l of buffer 1 (cytosolic proteins) or 2 (100 mM potassium phosphate buffer pH 7.0; 1% Triton X-100) (total proteins), and 1 .mu.l of 500 mM PMSF in isopropanol is added. 500 .mu.l of glass beads (d=0.5 mm) are added to the cells and the cells are disrupted by vortexing 5.times. for one minute each. The liquid between the glass beads is transferred to a new Eppendorf vessel. Cell debris and membrane components are removed by centrifugation (14000.times.g; 15 min).

[0272] The supernatant is transferred to a new Eppendorf vessel and represents the protein fraction.

[0273] The activity of HMG-CoA reductase is determined by measuring NADPH+H.sup.+ consumption during the reduction of 3-hydroxy-3-methylglutaryl-CoA which is added as substrate.

[0274] In a 1000 .mu.l assay mixture, 20 .mu.l of yeast protein isolate are combined with 910 .mu.l of buffer I; 50 .mu.l of 0.1 M DTT and 10 .mu.l of 16 mM NADPH+H.sup.+. The mixture is adjusted to 30.degree. C. and measured in a spectrophotometer at 340 nm for 7.5 min. The decrease in NADPH, which is measured over this period, is the rate of degradation without addition of substrate and is taken into account as background.

[0275] Subsequently, substrate (10 .mu.l of 30 mM HMG-CoA) is added, and measurement continues for another 7.5 min. The HMG-CoA-reductase activity is calculated by determining the specific rate of NADPH degradation.

[0276] The activity of lanosterol C14-demethylase is determined as described in Omura, T. and Sato, R. (1964) The carbon monoxide binding pigment in liver microsomes. J. Biol. Chem. 239, 2370-2378. In this assay, the amount of P450 enzyme as holoenzyme with bound heme can be semi-quantified. The (active) holoenzyme (with heme) can be reduced by CO and only the CO-reduced enzyme has an absorption maximum at 450 nm. Thus the absorption maximum at 450 nm is a measure for lanosterol C14-demethylase activity.

[0277] The activity is determined by diluting a microsomal fraction (4-10 mg/ml protein in 100 mM potassium phosphate buffer) 1:4 so that the protein concentration used in the assay is 2 mg/ml. The assay is carried out directly in a cuvette.

[0278] A spatula tipful of dithionite (S.sub.2O.sub.4Na.sub.2) is added to the microsomes. The baseline is recorded in the 380-500 nm region in a spectrophotometer.

[0279] Subsequently, approx. 20-30 CO bubbles are passed through the sample. The absorption is then measured in the same region. The absorption level at 450 nm corresponds to the amount of P450 enzyme in the assay mixture.

[0280] The activity of squalene epoxidase is determined as described in Leber R, Landl K, Zinser E, Ahorn H, Spok A, Kohlwein S D, Turnowsky F, Daum G. (1998) Dual localization of squalene epoxidase, Erg1p, in yeast reflects a relationship between the endoplasmic reticulum and lipid particles, Mol. Biol. Cell. 1998, February; 9(2):375-86.

[0281] In this method, a total volume of 500 .mu.l contains from 0.35 to 0.7 mg of microsomal protein or from 3.5 to 75 .mu.g of lipid-particle protein in 100 mM Tris-HCl, pH 7.5, 1 mM EDTA, 0.1 mM FAD, 3 mM NADPH, 0.1 mM squalene 2,3-epoxidase cyclase inhibitor U18666A, 32 .mu.M [.sup.3H]squalene dispersed in 0.005% Tween 80.

[0282] The assay is carried out at 30.degree. C. After 10 minutes of pretreatment, the reaction is started by adding squalene and stopped after 15, 30 or 45 min by lipid extraction with 3 ml of chloroform/methanol (2:1 vol/vol) and 750 .mu.l of 0.035% MgCl.sub.2.

[0283] The lipids are dried under nitrogen and redissolved in 0.5 ml of chloroform/methanol (2:1 vol/vol). For thin layer chromatography, portions are applied to a Silica Gel 60 plate (0.2 mm) and fractionated using chloroform as eluent. The positions containing [.sup.3H]2,3-oxidosqualene and [.sup.3H]squalene were scraped off and quantified in a scintillation counter.

[0284] The .DELTA.8-.DELTA.7-isomerase activity is determined, with a slight modification, as described in Silve S. et al.: Emopamil-binding Protein, a Mammalian Protein That Binds a Series of Structurally Diverse Neuroprotective Agents, Exhibits 8-7 Sterol Isomerase Activity in Yeast. J Biol Chem 1996 Sep. 13; 271(37):22434-40:

[0285] Microsomes prepared from a culture volume of 10 ml are incubated in the presence of 75 .mu.M cholesta-8-en-3-ol at 30.degree. C. for 3 h. The sterols are then extracted with 4 times 5 ml of hexane and purified. Aliquots are analyzed by means of GC/MS.

[0286] The .DELTA.5-desaturase activity is determined, with slight modification, as described in Nishi, S. et al. (2000): cDNA cloning of the mammalian sterol C5-desaturase and the expression in yeast mutant. Biochim. Biophys. Acta1490(1-2),106-108:

[0287] Microsomes prepared from a culture volume of 10 ml are incubated in the presence of 75 .mu.M lathosterol and 2 mM NADH at 30.degree. C. for 3 h. The sterols are then extracted with 4 times 5 ml of hexane and purified. Aliquots are analyzed by means of GC/MS.

[0288] The .DELTA.24-reductase activity can be determined as described below:

[0289] Microsomes prepared from a culture volume of 10 ml are incubated in the presence of 75 .mu.M cholesta-5,7,24-trienol at 30.degree. C. for 3 h. The sterols are then extracted with 4 times 5 ml of hexane and purified. Aliquots are analyzed by means of GC/MS.

[0290] The C24-methyltransferase activity can be determined as described below:

80% of the protein Erg6p (C24-methyltransferase) are detectable in lipid particles in the yeast (Athenstaedt K, Zweytick D, Jandrositz A, Kohlwein S D, Daum G: Identification and characterization of major lipid particle proteins of the yeast Saccharomyces cerevisiae. J. Bacteriol. 1999 October; 181(20):6441-8). The enzyme activity is determined by preparing lipid particles from a culture volume (48 h) of 100 ml (according to a method described in Athenstaedt K, Zweytick D, Jandrositz A, Kohlwein S D, Daum G: Identification and characterization of major lipid particle proteins of the yeast Saccharomyces cerevisiae. J. Bacteriol. 1999 October; 181(20):6441-8).

[0291] The protein content is determined by a Biorad enzyme assay and 3 mg of protein are used in a volume of 500 .mu.l for each assay mixture. 50 .mu.M [methyl-.sup.3H.sub.3]-S-adenosylmethionine and 50 .mu.M zymosterol are added to the assay mixture which is then incubated at 35.degree. C. for 10 min. Subsequently, the same volume (500 .mu.l) of chloroform/methanol (4:1) is added and the sterols are then extracted.

[0292] The proportion of zymosterol with incorporated [methyl-.sup.3H.sub.3]-S-adenosylmethionine can be determined by means of scintillation measurement, since chloroform/methanol extraction extracts only lipid-soluble substances. For quantification, the radioactive decays are likewise determined for 50 .mu.M [methyl-.sup.3H.sub.3]-S-adenosylmethionine by means of scintillation measurement.

[0293] This method is a modification of the method described in Nes W D, Guo D, Zhou W.: Substrate-based inhibitors of the (S)-adenosyl-L-methionine:.DELTA.24(25)- to .DELTA.24(28)-sterol methyl transferase from Saccharomyces cerevisiae, Arch. Biochem. Biophys. 1997 Jun. 1; 342(1):68-81.

[0294] The activity of .DELTA.22-desaturase (ERG5p) can be determined as described below:

[0295] Various concentrations of Ergosta-5,7-dienol, purified from S. cerevisiae erg5 mutants (Parks et al, 1985. Yeast sterols.yeast mutants as tools for the study of sterol metabolism. Methods Enzymol. 111:333-346) and 50 .mu.g of dilauroylphosphatidylcholine are mixed and treated with ultrasound until a white suspension is formed. Prepared microsomes are added (1 ml) (3 mg/ml protein). NADPH (1 mM final concentration) is added to the assay mixture to start the enzyme reaction. The mixture is incubated at 37.degree. C. for 20 min. The reaction is stopped by adding 3 ml of methanol and sterols are hydrolyzed by adding 2 ml of 60% (wt/vol) KOH in water. The mixture is incubated at 90.degree. C. for 2 h. After cooling, the mixture is extracted three times with 5 ml of hexane and concentrated in a rotary evaporator. Subsequently, the sterols are silylated with bis(trimethylsilyl)trifluoroacetamide (50 .mu.l in 50 .mu.l toluene) at 60.degree. C. for 1 h. The sterols are analyzed by gas chromatography-mass spectrometry (GC-MS) (for example Model VG 12-250 gas chromatograph-mass spectrometer; VG Biotech, Manchester, United Kingdom). The resultant .DELTA.22-desaturated intermediate can be identified depending on the amount of substrate used. Microsomes which are not incubated with substrate serve as reference.

[0296] This method is a modification of the method described in Lamb et al: Purification, reconstitution, and inhibition of cytochrome P-450 sterol .DELTA.22-desaturase from the pathogenic fungus Candida glabrata. Antimicrob Agents Chemother. 1999 July; 43(7):1725-8.

[0297] The squalene-synthetase activity can be determined as described below:

[0298] The assays contain 50 mM MOPS, pH 7.2, 10 mM MgCl.sub.2, 1% (v/v) Tween-80, 10% (v/v) 2-propanol, 1 mM DTT, 1 mg/mL BSA, NADPH, FPP (or PSPP) and microsomes (protein content 3 mg) in a total volume of 200 .mu.l in glass tubes. The reaction mixtures containing the radioactive substrate [1-.sup.3H]FPP (15-30 mCi/.mu.mol) are incubated at 30.degree. C. for 30 min and one volume of 1:1 (v/v) 40% aqueous KOH:methanol is added to the suspension mixture. Liquid NaCl is added to saturate the solution and 2 ml of naphtha containing 0.5% (v/v) squalene are likewise added.

[0299] The suspension is vortexed for 30 s. In each case 1 ml of the naphtha layer is applied to a packed 0.5.times.6 cm aluminum column (80-200 mesh, Fisher) using a Pasteur pipette. The column has been pre-equilibrated with 2 ml of naphtha containing 0.5% (v/v) squalene. The column is then eluted with 5.times.1 ml of toluene containing 0.5% (v/v) squalene. Squalene radioactivity is measured in Cytoscint (ICN) scintillation cocktail in a scintillation counter (Beckman).

[0300] This method is a modification of the method described in Radisky et al., Biochemistry. 2000 Feb. 22; 39(7):1748-60, Zhang et al. (1993) Arch. Biochem. Biophys. 304, 133-143 and Poulter, C. D. et al. (1989) J. Am. Chem. Soc. 111, 3734-3739.

[0301] The sterol-acyltransferase activity can be determined as described below:

[0302] A 200 ml main culture is inoculated at 1% strength from a 20 ml preculture which has been incubated for two days and is incubated in complete medium overnight. The cells are harvested and then washed in two volumes of HP buffer (100 mM potassium phosphate buffer, pH 7.4; 0.5 mM EDTA; 1 mM glutathione; 20 .mu.M leupeptin; 64 .mu.M benzamidine; 2 mM PMSF) and resuspended in HP buffer.

[0303] After adding 1 g of glass beads, the cells are disrupted by vortexing 8 times for one minute each. The supernatant is ultracentrifuged at 105000.times.g. The pellet is taken up in 1 ml of ACAT buffer (100 mM potassium phosphate buffer pH7.4; 1 mM glutathione).

[0304] The enzyme assay is carried out in a volume of 500 .mu.l. The substrate ergosterol is taken up in 62.5 ml of 0.5.times.ACAT buffer with vigorous vortexing. 250 .mu.l of this solution are used as substrate in the assay. To this, 20 .mu.l of protein extract, 50 .mu.l of water and 130 .mu.l of 0.5.times.ACAT buffer are added.

[0305] The mixture is incubated at 37.degree. C. for 15 min. Subsequently, 50 .mu.l of 14C-oleoyl-CoA (600000 dpm) are added and the reaction is stopped after one minute by adding 4 ml of chloroform/methanol (2:1). To this, 500 .mu.l of H.sub.2O are added. The phases are separated by briefly centrifuging the suspension at 2000.times.g. The lower phase is evaporated to dryness in a pear-shaped flask and redissolved in 100 .mu.l of chloroform/methanol (4:1) and applied to a TLC plate (silica gel 60 F254). The TLC is carried out using petroleum ether/diethyl ether/acetic acid 90:10:1 as eluent. The spots of the steryl ester fractions are cut out and the number of radioactive decays is determined in a scintillation column. The enzyme activity can be determined via the amount of sterile ester-bound 14C-oleoyl-CoA molecules.

[0306] In a preferred embodiment of the method of the invention 7-dehydrocholesterol and/or the biosynthetic intermediates and/or intermediates thereof are prepared by culturing organisms, in particular yeasts, which have, compared to the wild type, an increased activity of at least one of the activities selected from the group consisting of .DELTA.8-.DELTA.7-isomerase activity, .DELTA.5-desaturase activity and .DELTA.24-reductase activity and which have additionally a reduced activity of at least one of the activities selected from the group consisting of C24-methyltransferase activity and .DELTA.22-desaturase activity and which have additionally an increased HMG-CoA-reductase activity, an increased lanosterol-C14-demethylase activity and an increased squalene-epoxidase activity.

[0307] In other preferred embodiments of the method of the invention, 7-dehydrocholesterol and/or the biosynthetic intermediates and/or secondary products thereof are prepared by culturing organisms, in particular yeasts, which have, compared to the wild type,

an increased .DELTA.8-.DELTA.7-isomerase activity, an increased .DELTA.5-desaturase activity, an increased .DELTA.24-reductase activity, an increased .DELTA.8-.DELTA.7-isomerase activity and an increased .DELTA.5-desaturase activity, an increased .DELTA.8-.DELTA.7-isomerase activity and an increased .DELTA.24-reductase activity, an increased .DELTA.5-desaturase activity and an increased .DELTA.24-reductase activity, an increased .DELTA.8-.DELTA.7-isomerase activity, an increased .DELTA.5-desaturase activity and an increased .DELTA.24-reductase activity, an increased .DELTA.8-.DELTA.7-isomerase activity and a reduced C24-methyltransferase activity, an increased .DELTA.5-desaturase activity and a reduced C24-methyltransferase activity, an increased .DELTA.24-reductase activity and a reduced C24-methyltransferase activity, an increased .DELTA.8-.DELTA.7-isomerase activity, an increased .DELTA.5-desaturase activity and a reduced C24-methyltransferase activity, increased .DELTA.8-.DELTA.7-isomerase activity, an increased .DELTA.24-reductase activity and a reduced C24-methyltransferase activity, an increased .DELTA.5-desaturase activity, an increased .DELTA.24-reductase activity and a reduced C24-methyltransferase activity, an increased .DELTA.8-.DELTA.7-isomerase activity, an increased .DELTA.5-desaturase activity, an increased .DELTA.24-reductase activity and a reduced C24-methyltransferase activity, an increased .DELTA.8-.DELTA.7-isomerase activity and a reduced .DELTA.22-desaturase activity, an increased .DELTA.5-desaturase activity and a reduced .DELTA.22-desaturase activity, an increased .DELTA.24-reductase activity and a reduced .DELTA.22-desaturase activity, an increased .DELTA.8-.DELTA.7-isomerase activity, an increased .DELTA.5-desaturase activity and a reduced .DELTA.22-desaturase activity, an increased .DELTA.8-.DELTA.7-isomerase activity, an increased .DELTA.24-reductase activity and a reduced .DELTA.22-desaturase activity, an increased .DELTA.5-desaturase activity, an increased .DELTA.24-reductase activity and a reduced .DELTA.22-desaturase activity, an increased .DELTA.8-.DELTA.7-isomerase activity, an increased .DELTA.5-desaturase activity, an increased .DELTA.24-reductase activity and a reduced .DELTA.22-desaturase activity, an increased .DELTA.8-.DELTA.7-isomerase activity, a reduced .DELTA.22-desaturase activity and a reduced C24-ethyltransferase activity, an increased .DELTA.5-desaturase activity, a reduced .DELTA.22-desaturase activity and a reduced C24-methyltransferase activity, an increased .DELTA.24-reductase activity, a reduced .DELTA.22-desaturase activity and a reduced C24-methyltransferase activity, an increased .DELTA.8-.DELTA.7-isomerase activity, an increased .DELTA.5-desaturase activity, a reduced .DELTA.22-desaturase activity and a reduced C24-methyltransferase activity, an increased .DELTA.8-.DELTA.7-isomerase activity, an increased .DELTA.24-reductase activity, a reduced .DELTA.22-desaturase activity and a reduced C24-methyltransferase activity, an increased .DELTA.5-desaturase activity, an increased .DELTA.24-reductase activity, a reduced .DELTA.22-desaturase activity and a reduced C24-methyltransferase activity, an increased .DELTA.8-.DELTA.7-isomerase activity, an increased .DELTA.5-desaturase activity, an increased .DELTA.24-reductase activity, a reduced .DELTA.22-desaturase activity and a reduced C24-methyltransferase activity, an increased .DELTA.8-.DELTA.7-isomerase activity and an increased HMG-CoA-reductase activity, an increased .DELTA.5-desaturase activity and an increased HMG-CoA-reductase activity, an increased .DELTA.24-reductase activity and an increased HMG-CoA-reductase activity, an increased .DELTA.8-.DELTA.7-isomerase activity, an increased HMG-CoA-reductase activity and an increased .DELTA.5-desaturase activity, an increased .DELTA.8-.DELTA.7-isomerase activity, an increased HMG-CoA-reductase activity and an increased .DELTA.24-reductase activity, an increased .DELTA.5-desaturase activity, an increased HMG-CoA-reductase activity and an increased .DELTA.24-reductase activity, an increased .DELTA.8-.DELTA.7-isomerase activity, an increased .DELTA.5-desaturase activity, an increased HMG-CoA-reductase activity and an increased .DELTA.24-reductase activity, an increased .DELTA.8-.DELTA.7-isomerase activity, an increased HMG-CoA-reductase activity and a reduced C24-methyltransferase activity, an increased .DELTA.5-desaturase activity, an increased HMG-CoA-reductase activity and a reduced C24-methyltransferase activity, an increased .DELTA.24-reductase activity, an increased HMG-CoA-reductase activity and a reduced C24-methyltransferase activity, an increased .DELTA.8-.DELTA.7-isomerase activity, an increased .DELTA.5-desaturase activity, an increased HMG-CoA-reductase activity and a reduced C24-methyltransferase activity, an increased .DELTA.8-.DELTA.7-isomerase activity, an increased .DELTA.24-reductase activity, an increased HMG-CoA-reductase activity and a reduced C24-methyltransferase activity, an increased .DELTA.5-desaturase activity, an increased .DELTA.24-reductase activity and a reduced C24-methyltransferase activity, an increased .DELTA.8-.DELTA.7-isomerase activity, an increased .DELTA.5-desaturase activity, an increased .DELTA.24-reductase activity, an increased HMG-CoA-reductase activity and a reduced C24-methyltransferase activity, an increased .DELTA.8-.DELTA.7-isomerase activity, an increased HMG-CoA-reductase activity and a reduced .DELTA.22-desaturase activity, an increased .DELTA.5-desaturase activity, an increased HMG-CoA-reductase activity and a reduced .DELTA.22-desaturase activity, an increased .DELTA.24-reductase activity, an increased HMG-CoA-reductase activity and a reduced .DELTA.22-desaturase activity, an increased .DELTA.8-.DELTA.7-isomerase activity, an increased .DELTA.5-desaturase activity, an increased HMG-CoA-reductase activity and a reduced .DELTA.22-desaturase activity, an increased .DELTA.8-.DELTA.7-isomerase activity, an increased .DELTA.24-reductase activity, an increased HMG-CoA-reductase activity and a reduced .DELTA.22-desaturase activity, an increased .DELTA.5-desaturase activity, an increased .DELTA.24-reductase activity, an increased HMG-CoA-reductase activity and a reduced .DELTA.22-desaturase activity, an increased .DELTA.8-.DELTA.7-isomerase activity, an increased .DELTA.5-desaturase activity, an increased .DELTA.24-reductase activity, an increased HMG-CoA-reductase activity and a reduced .DELTA.22-desaturase activity, an increased .DELTA.8-.DELTA.7-isomerase activity, a reduced .DELTA.22-desaturase activity, an increased HMG-CoA-reductase activity and a reduced C24-methyltransferase activity, an increased .DELTA.5-desaturase activity, a reduced .DELTA.22-desaturase activity, an increased HMG-CoA-reductase activity and a reduced C24-methyltransferase activity, an increased .DELTA.24-reductase activity, a reduced .DELTA.22-desaturase activity, an increased HMG-CoA-reductase activity and a reduced C24-methyltransferase activity, an increased .DELTA.8-.DELTA.7-isomerase activity, an increased .DELTA.5-desaturase activity, a reduced .DELTA.22-desaturase activity, an increased HMG-CoA-reductase activity and a reduced C24-methyltransferase activity, an increased .DELTA.8-.DELTA.7-isomerase activity, an increased .DELTA.24-reductase activity, a reduced .DELTA.22-desaturase activity, an increased HMG-CoA-reductase activity and a reduced C24-methyltransferase activity, an increased .DELTA.5-desaturase activity, an increased .DELTA.24-reductase activity, a reduced .DELTA.22-desaturase activity, an increased HMG-CoA-reductase activity and a reduced C24-methyltransferase activity, an increased .DELTA.8-.DELTA.7-isomerase activity, an increased .DELTA.5-desaturase activity, an increased .DELTA.24-reductase activity, a reduced .DELTA.22-desaturase activity, an increased HMG-CoA-reductase activity and a reduced C24-methyltransferase activity, an increased .DELTA.8-.DELTA.7-isomerase activity and an increased lanosterol-C14-demethylase activity, an increased .DELTA.5-desaturase activity and an increased lanosterol-C14-demethylase activity, an increased .DELTA.24-reductase activity and an increased lanosterol-C14-demethylase activity, an increased .DELTA.8-.DELTA.7-isomerase activity, an increased lanosterol-C14-demethylase activity and an increased .DELTA.5-desaturase activity, an increased .DELTA.8-.DELTA.7-isomerase activity, an increased lanosterol-C14-demethylase activity and an increased .DELTA.24-reductase activity, an increased .DELTA.5-desaturase activity, an increased lanosterol-C14-demethylase activity and an increased .DELTA.24-reductase activity, an increased .DELTA.8-.DELTA.7-isomerase activity, an increased .DELTA.5-desaturase activity, an increased lanosterol-C14-demethylase activity and an increased .DELTA.24-reductase activity, an increased .DELTA.8-.DELTA.7-isomerase activity, an increased lanosterol-C14-demethylase activity and a reduced C24-methyltransferase activity, an increased .DELTA.5-desaturase activity and a reduced C24-methyltransferase activity, an increased .DELTA.24-reductase activity, an increased lanosterol-C14-demethylase activity and a reduced C24-methyltransferase activity, an increased .DELTA.8-.DELTA.7-isomerase activity, an increased .DELTA.5-desaturase activity, an increased lanosterol-C14-demethylase activity and a reduced C24-methyltransferase activity, an increased .DELTA.8-.DELTA.7-isomerase activity, an increased .DELTA.24-reductase activity, an increased lanosterol-C14-demethylase activity and a reduced C24-methyltransferase activity, an increased .DELTA.5-desaturase activity, an increased .DELTA.24-reductase activity, an increased lanosterol-C14-demethylase activity and a reduced C24-methyltransferase activity, an increased .DELTA.8-.DELTA.7-isomerase activity, an increased .DELTA.5-desaturase activity, an increased .DELTA.24-reductase activity, an increased lanosterol-C14-demethylase activity and a reduced C24-methyltransferase activity, an increased .DELTA.8-.DELTA.7-isomerase activity, an increased lanosterol-C14-demethylase activity and a reduced .DELTA.22-desaturase activity, an increased .DELTA.5-desaturase activity, an increased lanosterol-C14-demethylase activity and a reduced .DELTA.22-desaturase activity, an increased .DELTA.24-reductase activity, an increased lanosterol-C14-demethylase activity and a reduced .DELTA.22-desaturase activity, an increased .DELTA.8-.DELTA.7-isomerase activity, an increased .DELTA.5-desaturase activity, an increased lanosterol-C14-demethylase activity and a reduced .DELTA.22-desaturase activity, an increased .DELTA.8-.DELTA.7-isomerase activity, an increased .DELTA.24-reductase activity, an increased lanosterol-C14-demethylase activity and a reduced .DELTA.22-desaturase activity, an increased .DELTA.5-desaturase activity, an increased .DELTA.24-reductase activity, an increased lanosterol-C14-demethylase activity and a reduced .DELTA.22-desaturase activity, an increased .DELTA.8-.DELTA.7-isomerase activity, an increased .DELTA.5-desaturase activity, an increased .DELTA.24-reductase activity, an increased lanosterol-C14-demethylase activity and a reduced .DELTA.22-desaturase activity, an increased .DELTA.8-.DELTA.7-isomerase activity, a reduced .DELTA.22-desaturase activity, an increased lanosterol-C14-demethylase activity and a reduced C24-methyltransferase activity, an increased .DELTA.5-desaturase activity, a reduced .DELTA.22-desaturase activity, an increased lanosterol-C14-demethylase activity and a reduced C24-methyltransferase activity, an increased .DELTA.24-reductase activity, a reduced .DELTA.22-desaturase activity, an increased lanosterol-C14-demethylase activity and a reduced C24-methyltransferase activity, an increased .DELTA.8-.DELTA.7-isomerase activity, an increased .DELTA.5-desaturase activity, a reduced .DELTA.22-desaturase activity, an increased lanosterol-C14-demethylase activity and a reduced C24-methyltransferase activity, an increased .DELTA.8-.DELTA.7-isomerase activity, an increased .DELTA.24-reductase activity, a reduced .DELTA.22-desaturase activity, an increased lanosterol-C14-demethylase activity and a reduced C24-methyltransferase activity, an increased .DELTA.5-desaturase activity, an increased .DELTA.24-reductase activity, a reduced .DELTA.22-desaturase activity, an increased lanosterol-C14-demethylase activity and a reduced C24-methyltransferase activity, an increased .DELTA.8-.DELTA.7-isomerase activity, an increased .DELTA.5-desaturase activity, an increased .DELTA.24-reductase activity, a reduced .DELTA.22-desaturase activity, an increased lanosterol-C14-demethylase activity and a reduced C24-methyltransferase activity, an increased .DELTA.8-.DELTA.7-isomerase activity, an increased lanosterol-C14-demethylase activity and an increased HMG-CoA-reductase activity, an increased .DELTA.5-desaturase activity, an increased lanosterol-C14-demethylase activity and an increased HMG-CoA-reductase activity, an increased .DELTA.24-reductase activity, an increased lanosterol-C14-demethylase activity and an increased HMG-CoA-reductase activity, an increased AB-A7-isomerase activity, an increased HMG-CoA-reductase activity, an increased lanosterol-C14-demethylase activity and an increased .DELTA.5-desaturase activity, an increased .DELTA.8-.DELTA.7-isomerase activity, an increased HMG-CoA-reductase activity, an increased lanosterol-C14-demethylase activity and an increased .DELTA.24-reductase activity, an increased .DELTA.5-desaturase activity, an increased HMG-CoA-reductase activity, an increased lanosterol-C14-demethylase activity and an increased .DELTA.24-reductase activity, an increased .DELTA.8-.DELTA.7-isomerase activity, an increased .DELTA.5-desaturase activity, an increased HMG-CoA-reductase activity, an increased lanosterol-C14-demethylase activity and an increased .DELTA.24-reductase activity, an increased .DELTA.8-.DELTA.7-isomerase activity, an increased HMG-CoA-reductase activity, an increased lanosterol-C14-demethylase activity and a reduced C24-methyltransferase activity, an increased .DELTA.5-desaturase activity, an increased HMG-CoA-reductase activity, an increased lanosterol-C14-demethylase activity and a reduced C24-methyltransferase activity, an increased .DELTA.24-reductase activity, an increased HMG-CoA-reductase activity, an increased lanosterol-C14-demethylase activity and a reduced C24-methyltransferase activity, an increased .DELTA.8-.DELTA.7-isomerase activity, an increased .DELTA.5-desaturase activity, an increased HMG-CoA-reductase activity, an increased lanosterol-C14-demethylase activity and a reduced C24-methyltransferase activity, an increased .DELTA.8-.DELTA.7-isomerase activity, an increased .DELTA.24-reductase activity, an increased HMG-CoA-reductase activity, an increased lanosterol-C14-demethylase activity and a reduced C24-methyltransferase activity, an increased .DELTA.5-desaturase activity, an increased .DELTA.24-reductase activity, an increased lanosterol-C14-demethylase activity and a reduced C24-methyltransferase activity, an increased .DELTA.8-.DELTA.7-isomerase activity, an increased .DELTA.5-desaturase activity, an increased .DELTA.24-reductase activity, an increased HMG-CoA-reductase activity, an increased lanosterol-C14-demethylase activity and a reduced C24-methyltransferase activity, an increased .DELTA.8-.DELTA.7-isomerase activity, an increased HMG-CoA-reductase activity, an increased lanosterol-C14-demethylase activity and a reduced .DELTA.22-desaturase activity, an increased .DELTA.5-desaturase activity, an increased HMG-CoA-reductase activity, an increased lanosterol-C14-demethylase activity and a reduced .DELTA.22-desaturase activity, an increased .DELTA.24-reductase activity, an increased HMG-CoA-reductase activity, an increased lanosterol-C14-demethylase activity and a reduced .DELTA.22-desaturase activity, an increased .DELTA.8-.DELTA.7-isomerase activity, an increased .DELTA.5-desaturase activity, an increased HMG-CoA-reductase activity, an increased lanosterol-C14-demethylase activity and a reduced .DELTA.22-desaturase activity, an increased .DELTA.8-.DELTA.7-isomerase activity, an increased .DELTA.24-reductase activity, an increased HMG-CoA-reductase activity, an increased lanosterol-C14-demethylase activity and a reduced .DELTA.22-desaturase activity, an increased .DELTA.5-desaturase activity, an increased .DELTA.24-reductase activity, an increased HMG-CoA-reductase activity and a reduced .DELTA.22-desaturase activity, an increased .DELTA.8-.DELTA.7-isomerase activity, an increased .DELTA.5-desaturase activity, an increased .DELTA.24-reductase activity, an increased HMG-CoA-reductase activity, an increased lanosterol-C14-demethylase activity and a reduced .DELTA.22-desaturase activity, an increased .DELTA.8-.DELTA.7-isomerase activity, a reduced .DELTA.22-desaturase activity, an increased HMG-CoA-reductase activity, an increased lanosterol-C14-demethylase

activity and a reduced C24-methyltransferase activity, an increased .DELTA.5-desaturase activity, a reduced .DELTA.22-desaturase activity, an increased HMG-CoA-reductase activity, an increased lanosterol-C14-demethylase activity and a reduced C24-methyltransferase activity, an increased .DELTA.24-reductase activity, a reduced .DELTA.22-desaturase activity, an increased HMG-CoA-reductase activity, an increased lanosterol-C14-demethylase activity and a reduced C24-methyltransferase activity, an increased .DELTA.8-.DELTA.7-isomerase activity, an increased .DELTA.5-desaturase activity, a reduced .DELTA.22-desaturase activity, an increased HMG-CoA-reductase activity, an increased lanosterol-C14-demethylase activity and a reduced C24-methyltransferase activity, an increased .DELTA.8-.DELTA.7-isomerase activity, an increased .DELTA.24-reductase activity, a reduced .DELTA.22-desaturase activity, an increased HMG-CoA-reductase activity, an increased lanosterol-C14-demethylase activity and a reduced C24-methyltransferase activity, an increased .DELTA.5-desaturase activity, an increased .DELTA.24-reductase activity, a reduced .DELTA.22-desaturase activity, an increased HMG-CoA-reductase activity, an increased lanosterol-C14-demethylase activity and a reduced C24-methyltransferase activity, an increased .DELTA.8-.DELTA.7-isomerase activity, an increased .DELTA.5-desaturase activity, an increased .DELTA.24-reductase activity, a reduced .DELTA.22-desaturase activity, an increased HMG-CoA-reductase activity, an increased lanosterol-C14-demethylase activity and a reduced C24-methyltransferase activity, an increased .DELTA.8-.DELTA.7-isomerase activity, an increased .DELTA.5-desaturase activity, an increased .DELTA.24-reductase activity, a reduced .DELTA.22-desaturase activity, an increased HMG-CoA-reductase activity, an increased lanosterol-C14-demethylase activity and a reduced C24-methyltransferase activity, an increased .DELTA.8-.DELTA.7-isomerase activity, an increased .DELTA.5-desaturase activity, an increased .DELTA.24-reductase activity, a reduced .DELTA.22-desaturase activity, an increased HMG-CoA-reductase activity, an increased lanosterol-C14-demethylase activity, an increased squalene-epoxidase activity and a reduced C24-methyltransferase activity, or an increased .DELTA.8-.DELTA.7-isomerase activity, an increased .DELTA.5-desaturase activity, an increased .DELTA.24-reductase activity, a reduced .DELTA.22-desaturase activity, an increased HMG-CoA-reductase activity, an increased lanosterol-C14-demethylase activity, an increased squalene-epoxidase activity and a reduced C24-methyltransferase activity.

[0308] In further particularly preferred embodiments of the method of the invention, 7-dehydrocholesterol and/or the biosynthetic intermediates and/or secondary products thereof are prepared by culturing organisms, in particular yeasts, which have, compared to the wild type, an increased .DELTA.8-.DELTA.7-isomerase activity, an increased .DELTA.5-desaturase activity, an increased .DELTA.24-reductase activity, a reduced .DELTA.22-desaturase activity, an increased HMG-CoA-reductase activity, an increased lanosterol-C14-demethylase activity and an increased squalene-epoxidase activity,

[0309] an increased .DELTA.8-.DELTA.7-isomerase activity, an increased .DELTA.5-desaturase activity, an increased .DELTA.24-reductase activity, an increased HMG-CoA-reductase activity, an increased lanosterol-C14-demethylase activity, an increased squalene-epoxidase activity and a reduced C24-methyltransferase activity,

an increased .DELTA.8-.DELTA.7-isomerase activity, an increased .DELTA.5-desaturase activity, an increased .DELTA.24-reductase activity, a reduced .DELTA.22-desaturase activity, an increased HMG-CoA-reductase activity, an increased lanosterol-C14-demethylase activity, an increased squalene-epoxidase activity and a reduced C24-methyltransferase activity, an increased .DELTA.8-.DELTA.7-isomerase activity, an increased .DELTA.5-desaturase activity, an increased .DELTA.24-reductase activity, a reduced .DELTA.22-desaturase activity, an increased HMG-CoA-reductase activity, an increased lanosterol-C14-demethylase activity, an increased squalene-epoxidase activity, an increased squalene-synthetase activity and a reduced C24-methyltransferase activity, an increased .DELTA.8-.DELTA.7-isomerase activity, an increased .DELTA.5-desaturase activity, an increased .DELTA.24-reductase activity, a reduced .DELTA.22-desaturase activity, an increased HMG-CoA-reductase activity, an increased lanosterol-C14-demethylase activity, an increased squalene-epoxidase activity, an increased sterol-acyltransferase activity and a reduced C24-methyltransferase activity, an increased .DELTA.8-.DELTA.7-isomerase activity, an increased .DELTA.5-desaturase activity, an increased .DELTA.24-reductase activity, a reduced .DELTA.22-desaturase activity, an increased HMG-CoA-reductase activity, an increased lanosterol-C14-demethylase activity, an increased squalene-epoxidase activity, an increased squalene-synthetase activity, an increased sterol-acyltransferase activity and a reduced C24-methyltransferase activity.

[0310] Biosynthetic 7-dehydrocholesterol intermediates mean all compounds which appear as intermediates during 7-dehydrocholesterol biosynthesis in the organism used, preferably the compounds mevalonate, farnesyl pyrophosphate, geraniol pyrophosphate, squalene epoxide, 4-dimethylcholesta-8,14,24-trienol, 4,4-dimethylzymosterol, squalene, farnesol, geraniol, lanosterol, zymosterol, lathosterol, cholesta-7,24-dienol and cholesta-5,7,24-trienol.

[0311] Biosynthetic secondary products of zymosterol mean all compounds which can be derived biosynthetically from 7-dehydrocholesterol in the organism used, i.e. for which 7-dehydrocholesterol appears as an intermediate. These may be compounds which the organism used produces naturally from 7-dehydrocholesterol, such as, for example, cholesterol or vitamin D3 in mammals. However, they also mean compounds which can be produced in the organism from 7-dehydrocholesterol only by introducing genes and enzyme activities of other organisms for which the starting organism has no orthologous gene.

[0312] It is possible, for example, to prepare secondary products from 7-dehydrocholesterol, which are naturally present only in mammals, by introducing mammalian genes into yeast:

[0313] Introducing a human or murine nucleic acid encoding a human or murine .DELTA.-7-reductase enables the yeast to produce cholesterol.

[0314] Under UV irradiation, vitamin D.sub.3 (cholecalciferol) is produced from 7-dehydrocholesterol via provitamin D.sub.3 by rearrangement.

[0315] Therefore, the biosynthetic secondary products of 7-dehydrocholesterol mean in particular provitamin D3, vitamin D.sub.3 (cholecalciferol) and/or cholesterol.

[0316] Preferred biosynthetic secondary products are provitamin D.sub.3 and in particular vitamin D.sub.3.

[0317] The compounds prepared in the method of the invention may be used in biotransformations, chemical reactions and for therapeutic purposes, for example for producing vitamin D.sub.3 from 7-dehydrocholesterol via UV irradiation, or for producing steroid hormones via biotransformation starting from cholesta-7,24-dienol or cholesta-5,7,24-trienol.

[0318] In the inventive method for preparing 7-dehydrocholesterol and/or the biosynthetic intermediates and/or secondary products thereof, the step of culturing the genetically modified organisms, also referred to as transgenic organisms hereinbelow, is preferably followed by harvesting said organisms and isolating 7-dehydrocholesterol and/or the biosynthetic intermediates and/or secondary products thereof from said organisms.

[0319] The organisms are harvested in a manner known per se and appropriate for the particular organism. Microorganisms such as bacteria, mosses, yeasts and fungi or plant cells which are cultured in liquid media by fermentation may be removed, for example, by centrifugation, decanting or filtration.

[0320] 7-Dehydrocholesterol and/or the biosynthetic intermediates and/or secondary products thereof are isolated from the harvested biomass together or each compound is harvested separately in a manner known per se, for example by extraction and, where appropriate, further chemical or physical purification processes such as, for example, precipitation methods, crystallography, thermal separation methods such as rectification methods or physical separation methods such as, for example, chromatography.

[0321] The transgenic organisms, in particular yeasts, are preferably prepared either by transforming the starting organisms, in particular yeasts, with a nucleic acid construct containing at least one nucleic acid selected from the group consisting of nucleic acids encoding a .DELTA.8-.DELTA.7-isomerase, nucleic acids encoding a .DELTA.5-desaturase and nucleic acids encoding a .DELTA.24-reductase which are functionally linked with one or more regulatory signals ensuring transcription and translation in organisms. In this embodiment, the transgenic organisms are prepared using a nucleic acid construct.

[0322] In a particularly preferred embodiment, the above-described nucleic acid construct additionally contains at least one nucleic acid selected from the group consisting of nucleic acids encoding an HMG-CoA-reductase activity, nucleic acids encoding a lanosterol-C14-demethylase, nucleic acids encoding a squalene epoxidase, nucleic acids encoding a squalene synthetase and nucleic acids encoding a sterol acyltransferase which are functionally linked to one or more regulatory signals ensuring transcription and translation in organisms.

[0323] However, the transgenic organisms may also preferably be prepared by transforming the starting organisms, in particular yeasts, with at least one nucleic acid construct selected from the group consisting of nucleic acid constructs containing nucleic acids encoding a .DELTA.8-.DELTA.7-isomerase, nucleic acid construct containing nucleic acids encoding a .DELTA.5-desaturase and nucleic acid construct containing nucleic acids encoding a .DELTA.24-reductase which nucleic acids are in each case functionally linked to one or more regulatory signals ensuring transcription and translation in organisms. In this embodiment, the transgenic organisms are prepared using individual nucleic acid constructs or a combination of nucleic acid constructs.

[0324] In a particularly preferred embodiment, the above-described combination of nucleic acid constructs additionally comprises at least one nucleic acid construct selected from the group consisting of nucleic acid construct containing nucleic acids encoding an HMG-CoA-reductase activity, nucleic acid construct containing nucleic acids encoding a lanosterol-C14-demethylase, nucleic acid construct containing nucleic acids encoding a squalene epoxidase, nucleic acid construct containing nucleic acids encoding a squalene synthetase and nucleic acid construct containing nucleic acids encoding a sterol acyltransferase which nucleic acids are in each case functionally linked to one or more regulatory signals ensuring transcription and translation in organisms.

[0325] Nucleic acid constructs in which the encoding nucleic acid sequence is functionally linked to one or more regulatory signals ensuring transcription and translation in organisms, in particular in yeasts, are also referred to as expression cassettes hereinbelow.

[0326] Examples of nucleic acid constructs containing said expression cassette are vectors and plasmids.

[0327] Accordingly, the invention further relates to nucleic acid constructs, in particular nucleic acid constructs functioning as expression cassettes, which contain at least one nucleic acid selected from the group consisting of nucleic acids encoding a .DELTA.8-.DELTA.7-isomerase, nucleic acids encoding a .DELTA.5-desaturase and nucleic acids encoding a .DELTA.24-reductase which are functionally linked to one or more regulatory signals ensuring transcription and translation in organisms.

[0328] In a preferred embodiment, said nucleic acid construct additionally comprises at least one nucleic acid selected from the group consisting of nucleic acids encoding an HMG-CoA-reductase activity, nucleic acids encoding a lanosterol-C14-demethylase, nucleic acids encoding a squalene epoxidase, nucleic acids encoding a squalene synthetase and nucleic acids encoding a sterol acyltransferase which are functionally linked to one or more regulatory signals ensuring transcription and translation in organisms.

[0329] As an alternative, it is also possible to prepare the transgenic organisms of the invention by transformation with individual nucleic acid constructs or with a combination of nucleic acid constructs, said combination comprising at least one nucleic acid construct selected from the groups A to C

A nucleic acid construct comprising nucleic acids encoding a .DELTA.8-.DELTA.7-isomerase, which are functionally linked to one or more regulatory signals ensuring transcription and translation in organisms, B nucleic acid construct comprising nucleic acids encoding a .DELTA.5-desaturase, which are functionally linked to one or more regulatory signals ensuring transcription and translation in organisms and C nucleic acid construct comprising nucleic acids encoding a .DELTA.24-reductase, which are functionally linked to one or more regulatory signals ensuring transcription and translation in organisms, and at least one nucleic acid construct selected from the groups D to H D nucleic acid construct comprising nucleic acids encoding an HMG-CoA reductase, which are functionally linked to one or more regulatory signals ensuring transcription and translation in organisms, E nucleic acid construct comprising nucleic acids encoding a lanosterol C14-demethylase, which are functionally linked to one or more regulatory signals ensuring transcription and translation in organisms, F nucleic acid construct comprising nucleic acids encoding a squalene epoxidase, which are functionally linked to one or more regulatory signals ensuring transcription and translation in organisms, G nucleic acid construct comprising nucleic acids encoding a squalene synthetase, which are functionally linked to one or more regulatory signals ensuring transcription and translation in organisms, H nucleic acid construct comprising nucleic acids encoding a sterol acyltransferase, which are functionally linked to one or more regulatory signals ensuring transcription and translation in organisms.

[0330] The regulatory signals preferably contain one or more promoters which ensure transcription and translation in organisms, in particular in yeasts.

[0331] The expression cassettes include regulatory signals, i.e. regulatory nucleic acid sequences, which control expression of the coding sequence in the host cell. According to a preferred embodiment, an expression cassette comprises upstream, i.e. at the 5' end of the coding sequence, a promoter and downstream, i.e. at the 3' end, a terminator and, where appropriate, further regulatory elements which are operatively linked to the coding sequence for at least one of the above-described genes located in between.

[0332] Operative linkage means the sequential arrangement of promoter, coding sequence, where appropriate, terminator and, where appropriate, further regulatory elements in such a way that each of the regulatory elements can properly carry out its function in the expression of the coding sequence.

[0333] The preferred nucleic acid constructs, expression cassettes and plasmids for yeasts and fungi and methods for preparing transgenic yeasts and also the transgenic yeasts themselves are described by way of example below.

[0334] A suitable promoter of the expression cassette is in principle any promoter which is able to control the expression of foreign genes in organisms, in particular in yeasts.

[0335] Preference is given to using in particular a promoter which is subject to reduced regulation in yeast, such as, for example, the medium ADH promoter.

[0336] This promoter fragment of the ADH12s promoter, also referred to as ADH1 hereinbelow, exhibits nearly constitutive expression (Ruohonen L, Penttila M, Keranen S. (1991) Optimization of Bacillus .alpha.-amylase production by Saccharomyces cerevisiae. Yeast. May-June; 7(4):337-462; Lang C, Looman A C. (1995) Efficient expression and secretion of Aspergillus niger RH5344 polygalacturonase in Saccharomyces cerevisiae. Appl Microbiol Biotechnol. December; 44(1-2):147-56) so that transcriptional regulation no longer proceeds via intermediates of ergosterol biosynthesis.

[0337] Other preferred promoters with reduced regulation are constitutive promoters such as, for example, the yeast TEF1 promoter, the yeast GPD promoter or the yeast PGK promoter (Mumberg D, Muller R, Funk M. (1995) Yeast vectors for the controlled expression of heterologous proteins in different genetic backgrounds. Gene. 1995 Apr. 14; 156(1):119-22; Chen C Y, Oppermann H, Hitzeman R A. (1984) Homologous versus heterologous gene expression in the yeast, Saccharomyces cerevisiae. Nucleic Acids Res. December 11; 12(23):8951-70).

[0338] The expression cassette may also contain inducible promoters, in articular a chemically inducible promoter which can be used to control expression of the nucleic acids encoding a .DELTA.8-.DELTA.7-isomerase, .DELTA.5-desaturase, .DELTA.24-reductase, HMG-CoA-reductase, lanosterol-C14-demethylase, squalene epoxidase, squalene synthetase or sterol acyltransferase in the organism at a particular time.

[0339] Promoters of this kind, such as, for example, the yeast Cupl promoter (Etcheverry T. (1990) Induced expression using yeast copper metallothionein promoter. Methods Enzymol. 1990; 185:319-29), the yeast Gall-10 promoter (Ronicke V, Graulich W, Mumberg D, Muller R, Funk M. (1997) Use of conditional promoters for expression of heterologous proteins in Saccharomyces cerevisiae, Methods Enzymol. 283:313-22) or the yeast Pho5 promoter (Bajwa W, Rudolph H, Hinnen A. (1987) PHO5 upstream sequences confer phosphate control on the constitutive PHO3 gene. Yeast. 1987 March; 3(1):33-42), may be used, for example.

[0340] A suitable terminator of the expression cassette is in principle any terminator which is able to control the expression of foreign genes in organisms, in particular in yeasts.

[0341] Preference is given to the tryptophan terminator of yeasts (TRP1 terminator).

[0342] An expression cassette is preferably prepared by fusing a suitable promoter with the above-described nucleic acids encoding a .DELTA.8-.DELTA.7-isomerase, .DELTA.5-desaturase, .DELTA.24-reductase, HMG-CoA-reductase, lanosterol-C14-demethylase, squalene epoxidase, squalene synthetase or sterol acyltransferase and, where appropriate, a terminator according to common recombination and cloning techniques as described, for example, in T. Maniatis, E. F. Fritsch and J. Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. (1989) and in T. J. Silhavy, M. L. Berman and L. W. Enquist, Experiments with Gene Fusions, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. (1984) and in Ausubel, F. M. et al., Current Protocols in Molecular Biology, Greene Publishing Assoc. and Wiley-Interscience (1987).

[0343] The nucleic acids of the invention may be prepared synthetically or obtained naturally or may contain a mixture of synthetic and natural nucleic acid components and may also comprise various heterologous gene sections of various organisms.

[0344] As described above, preference is given to synthetic nucleotide sequences with codons which are preferred by yeasts. These codons which are preferred by yeasts may be determined from codons which have the highest frequency in proteins and which are expressed in most of the interesting yeast species.

[0345] When preparing an expression cassette, it is possible to manipulate various DNA fragments in order to obtain a nucleotide sequence which expediently can be read in the correct direction and is provided with a correct reading frame. The DNA fragments may be linked to one another by attaching adaptors or linkers to said fragments.

[0346] Expediently, the promoter and terminator regions may be provided in the direction of transcription with a linker or polylinker which contains one or more restriction sites for inserting this sequence. Normally, the linker has from 1 to 10, mostly from 1 to 8, preferably from 2 to 6, restriction sites. Generally, the linker is, within the regulatory regions, less than 100 bp, frequently less than 60 bp, but at least 5 bp, in length. The promoter may be both native or homologous and non-native or heterologous to the host organism. The expression cassette preferably includes in the 5'-3' direction of transcription the promoter, a coding nucleic acid sequence or a nucleic acid construct and a region for transcriptional termination. Various termination regions can be exchanged with one another randomly.

[0347] It is furthermore possible to use manipulations which provide appropriate restriction cleavage sites or which remove excess DNA or restriction cleavage sites. In those cases for which insertions, deletions or substitutions such as, for example, transitions and transversions are suitable, in vitro mutagenesis, primer repair, restriction or ligation can be used.

[0348] In suitable manipulations such as, for example, restriction, "chewing-back" or filling-in of protruding ends to form "blunt ends", complementary fragment ends may be provided for ligation.

[0349] The invention further relates to the use of the above-described nucleic acids, the above-described nucleic acid constructs or the above-described proteins for preparing transgenic organisms, in particular yeasts.

[0350] Preferably, said transgenic organisms, in particular yeasts, have an increased content of 7-dehydrocholesterol and/or of the biosynthetic intermediates and/or secondary products thereof compared to the wild type.

[0351] Therefore, the invention further relates to the use of the above-described nucleic acids or the nucleic acid constructs of the invention for increasing the content of 7-dehydrocholesterol and/or of the biosynthetic intermediates and/or secondary products thereof in organisms.

[0352] The above-described proteins and nucleic acids may be used for producing 7-dehydrocholesterol and/or the biosynthetic intermediates and/or secondary products thereof in transgenic organisms.

[0353] The transfer of foreign genes into the genome of an organism, in particular of yeast, is referred to as transformation.

[0354] For this purpose, methods known per se can be used for transformation, in particular in yeasts.

[0355] Examples of suitable methods for transforming yeasts are the LiAC method as described in Schiestl R H, Gietz R D. (1989) High efficiency transformation of intact yeast cells using single stranded nucleic acids as a carrier, Curr Genet. December; 16 (5-6):339-46, electroporation as described in Manivasakam P, Schiestl R H. (1993) High efficiency transformation of Saccharomyces cerevisiae by electroporation. Nucleic Acids Res. September 11; 21(18):4414-5, and the preparation of protoplasts, as described in Morgan A J. (1983) Yeast strain improvement by protoplast fusion and transformation, Experientia Suppl. 46:155-66

[0356] The construct to be expressed is preferably cloned into a vector, in particular into plasmids which are suitable for transforming yeasts, such as, for example, the vector systems Yep24 (Naumovski L, Friedberg E C (1982) Molecular cloning of eucaryotic genes required for excision repair of UV-irradiated DNA: isolation and partial characterization of the RAD3 gene of Saccharomyces cerevisiae. J Bacteriol October; 152(1):323-31), Yep13 (Broach J R, Strathern J N, Hicks J B. (1979) Transformation in yeast: development of a hybrid cloning vector and isolation of the CAN1 gene. Gene. 1979 December; 8(1):121-33), the pRS series of vectors (Centromer and Episomal) (Sikorski R S, Hieter P. (1989) A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics. May; 122(1):19-27) and the vector systems YCp19 or pYEXBX.

[0357] Accordingly, the invention furthermore relates to vectors, in particular plasmids, which comprise the above-described nucleic acids, nucleic acid constructs or expression cassettes.

[0358] The invention further relates to a method for preparing genetically modified organisms by functionally introducing an above-described nucleic acid or an above-described nucleic acid construct into the starting organism.

[0359] The invention further relates to said genetically modified organisms, the genetic modification increasing at least one of the activities selected from the group consisting of .DELTA.8-.DELTA.7-isomerase activity, .DELTA.5-desaturase activity and .DELTA.24-reductase activity, compared to a wild type.

[0360] Preferably, at least one of the activities is increased by increasing the gene expression of at least one nucleic acid selected from the group consisting of nucleic acids encoding a .DELTA.8-.DELTA.7-isomerase, nucleic acids encoding a .DELTA.5-desaturase and nucleic acids encoding a .DELTA.24-reductase.

[0361] Preferably, gene expression of the above-described nucleic acids is increased by increasing in the organism the copy number of the nucleic acids encoding a .DELTA.8-.DELTA.7-isomerase, encoding a .DELTA.5-desaturase and/or encoding a .DELTA.24-reductase.

[0362] Accordingly, the invention preferably relates to an above-described genetically modified organism which contains two or more nucleic acids encoding a .DELTA.8-.DELTA.7-isomerase and/or two or more nucleic acids encoding a .DELTA.5-desaturase and/or two or more nucleic acids encoding a .DELTA.24-reductase.

[0363] In a preferred embodiment, the genetically modified organism has, compared to the wild type, in addition to the above-described genetic modifications a reduced activity of at least one of the activities selected from the group consisting of C24-methyltransferase activity and .DELTA.22-desaturase activity.

[0364] The reduction of at least one of the activities is preferably caused by reducing, compared to the wild type, gene expression of at least one nucleic acid selected from the group consisting of nucleic acids encoding a C24-methyltransferase and nucleic acids encoding a .DELTA.22-desaturase.

[0365] A particularly preferred genetically modified organism has, apart from the above-described genetic modifications, no functional C24-methyltransferase gene and/or .DELTA.22-desaturase gene.

[0366] Particular preference is given to above-mentioned genetically modified organisms in which the genetic modification additionally increases at least one of the activities selected from the group consisting of HMG-CoA-reductase activity, lanosterol-C14-demethylase activity, squalene-epoxidase activity, squalene-synthetase activity and sterol-acyltransferase activity compared to a wild type.

[0367] Preferably, at least one of these activities is increased, as mentioned above, by increasing, compared to the wild type, gene expression of at least one nucleic acid selected from the group consisting of nucleic acids encoding an HMG-CoA-reductase activity, nucleic acids encoding a lanosterol-C14-demethylase, nucleic acids encoding a squalene epoxidase, nucleic acids encoding a squalene synthetase and nucleic acids encoding a sterol acyltransferase.

[0368] Preferably, gene expression of at least one nucleic acid selected from the group consisting of nucleic acids encoding an HMG-CoA-reductase activity, nucleic acids encoding a lanosterol-C14-demethylase, nucleic acids encoding a squalene epoxidase, nucleic acids encoding a squalene synthetase and nucleic acids encoding a sterol acyltransferase is increased compared to the wild type by increasing in the organism the copy number of at least one nucleic acid selected from the group consisting of nucleic acids encoding an HMG-CoA-reductase activity, nucleic acids encoding a lanosterol-C14-demethylase, nucleic acids encoding a squalene epoxidase, nucleic acids encoding a squalene synthetase and nucleic acids encoding a sterol acyltransferase.

[0369] Accordingly, the invention preferably relates to an above-described genetically modified organism which contains two or more of at least one nucleic acid selected from the group consisting of nucleic acids encoding an HMG-CoA-reductase activity, nucleic acids encoding a lanosterol-C14-demethylase, nucleic acids encoding a squalene epoxidase, nucleic acids encoding a squalene synthetase and nucleic acids encoding a sterol acyltransferase.

[0370] In particular, the invention preferably relates to a genetically modified organism which contains, in addition to the above-described genetic modifications, two or more nucleic acids encoding an HMG-CoA-reductase and/or two or more nucleic acids encoding a lanosterol-C14-demethylase and/or two or more nucleic acids encoding a squalene epoxidase and/or two or more nucleic acids encoding a squalene synthetase and/or two or more nucleic acids encoding a sterol acyltransferase.

[0371] The above-described genetically modified organisms have, compared to the wild type, an increased content of 7-dehydrocholesterol and/or of the biosynthetic intermediates and/or secondary products thereof.

[0372] Accordingly, the invention relates to an above-described genetically modified organism which, compared to the wild type, has an increased content of 7-dehydrocholesterol and/or of the biosynthetic intermediates and/or secondary products thereof.

[0373] Preferred genetically modified organisms are yeasts or fungi which have been genetically modified according to the invention, in particular yeasts which have been genetically modified according to the invention, in particular the yeast species Saccharomyces cerevisiae which has been genetically modified according to the invention, in particular the genetically modified yeast strains Saccharomyces cerevisiae AH22, Saccharomyces cerevisiae GRF, Saccharomyces cerevisiae DBY747 and Saccharomyces cerevisiae BY4741.

[0374] In the scope of the present invention, increasing the content of 7-dehydrocholesterol and/or of the biosynthetic intermediates and/or secondary products thereof preferably means the artificially acquired ability to produce biosynthetically an increased amount of at least one of these compounds mentioned above in the genetically modified organism compared to the genetically unmodified organism.

[0375] Accordingly, as mentioned at the beginning, wild type preferably means the genetically unmodified organism, but in particular the reference organism mentioned above.

[0376] An increased content of 7-dehydrocholesterol and/or of the biosynthetic intermediates and/or secondary products thereof in comparison with the wild type means in particular the increase in the content of at least one of the abovementioned compounds in the organism by at least 50%, preferably 100%, more preferably 200%, particularly preferably 400%, in comparison with the wild type.

[0377] The content of at least one of the mentioned compounds is preferably determined according to analytical methods known per se and preferably refers to those compartments of the organism, in which sterols are produced.

[0378] The invention is illustrated by the following examples but is not limited to them:

I. GENERAL EXPERIMENTAL CONDITIONS

1. Restriction

[0379] Restriction of the plasmids (1 to 10 .mu.g) was carried out in 30 .mu.l reaction mixtures. For this purpose, the DNA was taken up in 24 .mu.l of H.sub.20 and admixed with 3 .mu.l of the appropriate buffer, 1 ml of BSA (bovine serum albumin) and 2 .mu.l of enzyme. The enzyme concentration was 1 unit/.mu.l or 5 units/.mu.l, depending on the amount of DNA. In some cases, 1 .mu.l of RNase was added to the reaction mixture in order to degrade the tRNA. The restriction mixture was incubated at 37.degree. C. for 2 hours. The restriction was monitored using a minigel.

2. Gel Electrophoreses

[0380] The gel electrophoreses were carried out in minigel or wide minigel apparatuses. The minigels (approx. 20 ml, 8 pockets) and the wide minigels (50 ml, 15 or 30 pockets) consisted of 1% strength agarose in TAE. The running buffer used was 1.times.TAE.

[0381] After adding 3 .mu.l of stop solution, the samples (10 .mu.l) were applied. A-DNA cut with HindIII (bands at: 23.1 kb; 9.4 kb; 6.6 kb; 4.4 kb; 2.3 kb; 2.0 kb; 0.6 kb) served as standard. For fractionation, a voltage of 80 V was applied for 45 to 60 min. Thereafter, the gel was stained in ethidium bromide solution and documented under UV light using the INTAS video documentation system or photographed using an orange filter.

3. Gel Elution

[0382] The desired fragments were isolated by means of gel elution. The restriction mixture was applied to several pockets of a minigel and fractionated. Only .lamda.-HindIII and a "sacrifice lane" were stained in ethidium bromide solution, examined under UV light, and the desired fragment was marked. This prevented the DNA of the remaining pockets from being damaged by ethidium bromide and UV light. Putting the stained and unstained gel slices side by side made it possible to excise the desired fragment from the unstained gel slice on the basis of the marking. The agarose slice with the fragment to be isolated was introduced into a dialysis tube, sealed in air-bubble-free together with a small amount of TAE buffer and introduced into the BioRad minigel apparatus. The running buffer was 1.times.TAE and the voltage was 100 V for 40 min. Afterward, the polarity was switched for 2 min in order to redissolve DNA sticking to the dialysis tube. The buffer in the dialysis tube, which contained the DNA fragments, was transferred to reaction vessels and subjected to ethanol precipitation. For this purpose, 1/10 volume of 3M sodium acetate, tRNA (1 .mu.l per 50 .mu.l of solution) and 2.5 volumes of ice-cold 96% strength ethanol were added to the DNA solution. The mixture was incubated at -20.degree. C. for 30 min and then removed by centrifugation at 12 000 rpm, 4.degree. C., 30 min. The DNA pellet was dried and taken up in 10 to 50 .mu.l of H.sub.20 (depending on the amount of DNA).

4. Klenow Treatment

[0383] The Klenow treatment fills in protruding ends of DNA fragments, resulting in blunt ends. Per 1 .mu.g of DNA, the following reaction mixture was pipetted: DNA.times..times.pellet+.times.11.times..mu..times..times.1.times..times.- H2.times.0+.times.1.5.times..times.10.times.Klenow.times..times.buffer+.ti- mes.1.times..mu..times..times.I.times..times.0.1.times..times.M.times..tim- es.DTT+.times.1.times..mu..times..times.I.times..times.nucleotide.times..t- imes.(dNTP.times..times.2.times..times.mM)+.times.1.times..mu..times..time- s.I.times..times.Klenow.times..times.polymerase.times..times.(1.times..tim- es.unit/.mu..times..times.I) 25

[0384] The DNA should be from an ethanol precipitation, in order to prevent contaminations from inhibiting the Klenow polymerase. The reaction mixture was incubated at 37.degree. C. for 30 min, and the reaction was stopped by incubating for another 5 min at 70.degree. C. The DNA was recovered from the reaction mixture by ethanol precipitation and taken up in 10 .mu.l of H.sub.20.

5. Ligation

[0385] The DNA fragments to be ligated were combined. The final volume of 13.1 .mu.l contained approx. 0.5 .mu.l of DNA with a vector/insert ratio of 1:5. The sample was incubated at 70.degree. C. for 45 seconds, cooled to room temperature (approx. 3 min) and then incubated on ice for 10 min. The ligation buffers were then added: 2.6 .mu.l of 500 mM Tris-HCl pH 7.5 and 1.3 .mu.l of 100 mM MgCl.sub.2, followed by incubation on ice for a further 10 min. After adding 1 .mu.l of 500 mM DTT and 1 .mu.l of 10 mM ATP and another 10 min on ice, 1 .mu.l of ligase (1 unit/pl) was added. The whole treatment should be carried out as free from vibrations as possible so that adjoining DNA ends are not separated again. The ligation was carried out at 14.degree. C. over night.

6. Transformation of E. coli

[0386] Competent Escherichia coli (E. coli) NM522 cells were transformed with the DNA of the ligation mixture. A reaction mixture containing 50 .mu.g of the pScL3 plasmids and a reaction mixture without DNA were run as positive control and zero control, respectively. For each transformation mixture, 100 .mu.l of 8% PEG solution, 10 .mu.l of DNA and 200 .mu.l of competent cells (E. coli NM522) were pipetted into a benchtop-centrifuge tube. The reaction mixtures were put on ice for 30 min and agitated occasionally.

[0387] Then the heat shock was carried out: 1 min at 42.degree. C. For regeneration, 1 ml of LB medium was added to the cells and the suspension was incubated on a shaker at 37.degree. C. for 90 min. In each case, 100 .mu.l of the undiluted reaction mixtures, a 1:10 dilution and a 1:100 dilution were plated on LB+ampicillin plates and incubated at 37.degree. C. over night.

7. Plasmid Isolation from E. coli (Miniprep)

[0388] E. coli colonies were grown in 1.5 ml of LB+ampicillin medium in benchtop-centrifuge tubes at 37.degree. C. and 120 rpm over night. On the next day, the cells were removed by centrifugation at 5000 rpm and 4.degree. C. for 5 min and the pellet was taken up in 50 .mu.l of TE buffer. 100 .mu.l of 0.2 N NaOH, 1% SDS solution were added to and mixed with each reaction mixture, and the mixture was put on ice for 5 min (lysis of the cells). Then, 400 .mu.l of Na acetate/NaCl solution (230 .mu.l of H.sub.20, 130 .mu.l of 3 M sodium acetate, 40 .mu.l of 5M NaCl) were added, the reaction mixture was mixed and put on ice for a further 15 min (protein precipitation). After centrifugation at 11 000 rpm for 15 minutes, the supernatant containing the plasmid DNA was transferred to an Eppendorf vessel. If the supernatant was not completely clear, centrifugation was repeated. 360 .mu.l of ice-cold isopropanol were added to the supernatant and the reaction mixture was incubated at -20.degree. C. for 30 min (DNA precipitation). The DNA was removed by centrifugation (15 min, 12 000 rpm, 4.degree. C.), the supernatant was discarded, the pellet was washed in 100 .mu.l of ice-cold 96% strength ethanol, incubated at -20.degree. C. for 15 min and again removed by centrifugation (15 min, 12 000 rpm, 4.degree. C.). The pellet was dried in a Speed Vac and then taken up in 100 .mu.l of H.sub.20. The plasmid DNA was characterized by restriction analysis. For this purpose, 10 .mu.l of each reaction mixture were restriction-digested and fractionated gel-electrophoretically in a wide minigel (see above).

8. Plasmid Preparation from E. coli (Maxiprep)

[0389] In order to isolate larger amounts of plasmid DNA, the maxiprep method was carried out. Two flasks with 100 ml of LB+ampicillin medium were inoculated with a colony or with 100 .mu.l of a frozen culture which carries the plasmid to be isolated and incubated at 37.degree. C. and 120 rpm over night. On the next day, the culture (200 ml) was transferred to a GSA beaker and centrifuged at 4000 rpm (2600.times.g) for 10 min. The cell pellet was taken up in 6 ml of TE buffer. The cell wall was digested by adding 1.2 ml of lysozyme solution (20 mg/ml of TE buffer) and incubated at room temperature for 10 min. Subsequently, the cells were lysed with 12 ml of a 0.2 N NaOH, 1% SDS solution, followed by incubation at room temperature for another 5 min. The proteins were precipitated by adding 9 ml of a cooled 3 M sodium acetate solution (pH 4.8) and incubation on ice for 15 minutes. After centrifugation (GSA: 13 000 rpm (27 500.times.g), 20 min, 4.degree. C.), the supernatant containing the DNA was transferred to a new GSA beaker and the DNA was precipitated with 15 ml of ice-cold isopropanol and incubation at -20.degree. C. for 30 min. The DNA pellet was washed in 5 ml of ice-cold ethanol and dried in air (approx. 30-60 min). Thereafter, it was taken up in 1 ml of H.sub.2O. The plasmid was checked by restriction analysis. The concentration was determined by applying dilutions to a minigel. The salt content was reduced by microdialysis (pore size 0.025 .mu.m) for 30-60 minutes.

9. Transformation of Yeast

[0390] For the transformation of yeast, a preculture of the strain Saccharomyces cerevisiae AH22 was prepared. A flask containing 20 ml of YE medium was inoculated with 100 .mu.l of the frozen culture and incubated at 28.degree. C. and 120 rpm over night. The main culture was carried out under the same conditions in flasks containing 100 ml of YE medium which was inoculated with 10 .mu.l, 20 .mu.l or 50 .mu.l of the preculture.

9.1 Preparation of Competent Cells

[0391] On the next day, the cells in the flasks were counted by means of a Thoma chamber and the flask containing from 3-5.times.10.sup.7 cells/ml was chosen for the subsequent procedure. The cells were harvested by centrifugation (GSA: 5000 rpm (4000.times.g) 10 min). The cell pellet was taken up in 10 ml of TE buffer and distributed into two benchtop-centrifuged tubes (5 ml each). The cells were removed by centrifugation at 6000 rpm for 3 min and then washed twice with in each case 5 ml of TE buffer. The cell pellet was then taken up in 330 .mu.l of lithium acetate buffer per 10.sup.9 cells, transferred to a sterile 50 ml Erlenmeyer flask and agitated at 28.degree. C. for one hour. As a result, the cells were competent for transformation.

9.2 Transformation

[0392] For each transformation mixture, 15 .mu.l of herring sperm DNA (10 mg/ml), 10 .mu.l of the DNA to be transformed (approx. 0.5 .mu.g) and 330 .mu.l of competent cells were pipetted into a benchtop-centrifuged tube and incubated at 28.degree. C. for 30 min (without agitation). Then, 700 .mu.l of 50% PEG 6000 were added and the suspension was incubated at 28.degree. C. for another hour, without agitation. This was followed by a heat shock at 42.degree. C. for 5 min. 100 .mu.l of the suspension were plated on selection medium (YNB, Difco) in order to select for leucine prototrophy. In the case of selection for G418 resistance, the cells are regenerated after the heat shock (see under 9.3 Regeneration phase).

9.3 Regeneration Phase

[0393] Since the selection marker is the resistance to G418, the cells needed time to express the resistance gene. 4 ml of YE medium were added to the transformation mixtures which were then incubated on the shaker (120 rpm) at 28.degree. C. over night. On the next day, the cells were removed by centrifugation (6000 rpm, 3 min), taken up in 1 ml YE medium, and 100 .mu.l or 200 .mu.l thereof were plated on YE+G418 plates. The plates were incubated at 28.degree. C. for several days.

10. PCR Reaction Conditions

[0394] The reaction conditions for the polymerase chain reaction must be optimized in each individual case and do not apply absolutely to each reaction mixture. Thus it is possible, inter alia, to vary the amount of DNA used, the salt concentrations and the melting temperature. For our task, it proved advantageous to combine in an Eppendorf vessel which was suitable for use in a thermocycler the following substances: 5 .mu.l of Super buffer, 811 of dNTPs (0.625 .mu.M each), 5' primer, 3' primer and 0.2 .mu.g of template DNA, dissolved in enough water so as to result in a total volume of 50 .mu.l for the PCR reaction mixture, were added to 2 .mu.l of (=0.1 U) Super Taq polymerase. The reaction mixture was briefly centrifuged and overlaid with a drop of oil. Between 37 and 40 cycles were chosen for amplification.

II. EXAMPLES

Example 1

[0395] Expression and overexpression of a truncated HMG-CoA reductase, a squalene epoxidase (ERG1) and/or a lanosterol-C14-demethylase (ERG11), partially with deletion of ERG5 and ERG6 in S. cerevisiae GRF18 and GRFura3, respectively.

1.1 Preparation of the Plasmids pFlat1 and pFlat3 and pFlat4

[0396] The expression vector pFlat3 was prepared by linearizing the plasmid YEp24 (Naumovski L, Friedberg E C (1982) Molecular cloning of eucaryotic genes required for excision repair of UV-irradiated DNA: isolation and partial characterization of the RAD3 gene of Saccharomyces cerevisiae. J Bacteriol October; 152(1):323-31) via restriction with SphI and a 900 by SphI fragment of the vector pPT2B (Lang C, Looman A C. (1995) Efficient expression and secretion of Aspergillus niger RH5344 polygalacturonase in Saccharomyces cerevisiae. Appl Microbiol Biotechnol. December; 44(1-2): 147-56) which contains the ADH1 promoter and the TRP1 terminator of the yeast Saccharomyces cerevisiae and a multiple-cloning site of the vector pUC19 (Yanisch-Perron C, Vieira J, Messing J. (1985) Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13 mp18 and pUC19 vectors. Gene. 1985; 33(1): 103-19) was integrated.

[0397] The multiple-cloning site was extended by a polylinker containing the restriction sites NotI and XhoI. The polylinker was integrated via the SalI cleavage site of the vector. The resulting plasmid is denoted pFlat1.

[0398] The vector pFlat3 was prepared by linearizing the vector pFlat1 by the enzyme NcoI and blunt-ending it by means of Klenow treatment. This was followed by integrating a BamHI fragment which had been blunt-ended by means of Klenow-polymerase treatment and which contains the yeast LEU2 gene and originates from the plasmid YDpL (Berben, G., Dumont, J., Gilliquet, V., Bolle, P. A. and Hilger F. (1991) The YDp Plasmids: a Uniform Set of Vectors Bearing Versatile Disruption Cassettes for Saccharomyces cerevisiae. Yeast 7: 475-477).

[0399] The vector pFlat4 was prepared by linearizing the vector pFlat1 by the enzyme NcoI and blunt-ending it by means of Klenow treatment. This was followed by integrating a BamHI fragment which had been blunt-ended by means of Klenow-polymerase treatment and which contains the yeast HIS3 gene and originates from plasmid YDpH (Berben et al., 1991).

1.2 Integration of ERG1, ERG11, ERG4, ERG2 or ERG3 or of the .DELTA.24-Reductase Gene into the Vectors pFLat1, pFlat3 and pFlat4

[0400] First, a NotI restriction cleavage site was inserted at the 5'-coding side of the genes ERG1, ERG11, ERG4, .DELTA.24-reductase, ERG2 or ERG3 and an XhoI restriction cleavage site was inserted at the 3'-coding side of said genes by means of PCR and the corresponding coding regions were amplified. Subsequently, the amplicons were treated with the restriction enzymes NotI and XhoI. The plasmids pFlat1, pFlat3 and pFlat4 were treated in parallel with enzymes NotI and XhoI. The cleaved amplicons were then integrated into the cleaved plasmids via ligation using T4 ligase. FIG. 7 depicts as an example the plasmid pFLAT-3-ERG4.

[0401] Primer sequences for cloning ERG1, ERG11, ERG2, ERG3, ERG4, .DELTA.24-reductase: TABLE-US-00002 Primer ERG1-5' (SEQ. ID. No. 51):

CTGCGGCCGC ATCATGTCTG CTGTTAACGT TGC Primer ERG1-3' (SEQ. ID. No. 52): TTCTCGAGTT AACCAATCAA CTCACCAAAC Primer ERG11-5' (SEQ. ID. No. 53): CTGCGGCCGCAGGATGTCTGCTACCAAGTCAATCG Primer ERG11-3' (SEQ. ID. No. 54):

ATCTCGAGCTTAGATCTTTTGTTCTGGATTTCTC Primer ERG2-5' (SEQ. ID. No. 55): CTGCGGCCGCACCATGAAGTTTTT000ACT CC Primer ERG2-3' (SEQ. ID. No. 56): TTCTCGAGTTAGAACTTTTTGTTTTGCAACAAG Primer ERG3-5' (SEQ. ID. No. 57):

CTGCGGCCGCAATATGGATTTGGTCTTAGAAGTCG Primer E RG3-3' (SEQ. ID. No. 58): AACTCGAGTCAGTTGTTCTTCTTGGTATTTG Primer ERG4-5' (SEQ. ID. No. 59): CTGCGGCCGCACTATGGCAAAGGATAATAGTGAG Primer ERG4-3' (SEQ. ID. No. 60):

[0402] TTCTCGAGCTAGAAAACATAAGGAATAAAGAC Primer ti24R-5' (SEQ. ID. No. 47): CTGCGGCCGCAAGATGGAG000GCCGTGTCGC Primer .DELTA.24R-3' (SEQ. ID. No. 48) AACTCGAGTCAGTGCCTTGCCGCCTTGC 1.3 Preparation of the Integration Vectors pUG6-tHMG, pUG6-ERG1, pUG6-ERG11 1.3.1 pUG6-tHMG

[0403] The DNA sequence for the expression cassette composed of ADH1-promoter-tHMG-tryptophan-terminator was isolated from the vector YepH2 (Polakowski, T., Stahl, U., Lang, C. (1998): Overexpression of a cytosolic HMG-CoA reductase in yeast leads to squalene accumulation. Appl. Microbiol. Biotechnol. 49: 66-71) by restriction with the enzymes EcoRV and Bsp68I (NruI) by using standard methods. The DNA fragment obtained was cloned with blunt ends into the EcoRV cleavage site of the vector pUG6 (Guldener, U et al. (1996): A new efficient gene disruption cassette for repeated use in budding yeast, Nucleic Acids Res. July 1; 24(13):2519-24), resulting in the vector denoted pUG6-tHMG (FIG. 1).

1.3.2 pUG6-ERG1

[0404] The DNA sequence for the expression cassette composed of ADH1-promoter-ERG1-tryptophan-terminator was isolated from the vector pFlat3-ERG1 by restriction with the enzymes NheI and Bsp68I (NruI), using standard methods. After Klenow treatment, the DNA fragment obtained was cloned with blunt ends into the EcoRV cleavage site of the vector pUG6 (Guldener, U et al. (1996): A new efficient gene disruption cassette for repeated use in budding yeast, Nucleic Acids Res. July 1; 24(13):2519-24), resulting in the vector denoted pUG6-ERG1 (FIG. 2).

1.3.3 pUG6-ERG11

[0405] The DNA sequence for the expression cassette composed of ADH1-promotor-ERG11-tryptophan-terminator was isolated from the vector pFlat3-ERG11 by restriction with the enzymes EcoRV and Bsp68I (NruI) using standard methods. The DNA fragment obtained was cloned with blunt ends into the EcoRV cleavage site of the vector pUG6 (Guldener, U et al. (1996): A new efficient gene disruption cassette for repeated use in budding yeast, Nucleic Acids Res. July 1; 24(13):2519-24), resulting in the vector denoted pUG6-ERG11 (FIG. 3).

1.4. Integrative Transformation of the Expression Cassettes into the Yeast Strains GRF or GRFura3

[0406] After plasmid isolation, fragments of the vectors pUG6-tHMG, pUG6-ERG1 and pUG6-ERG11 were amplified by means of PCR in such a way that the resulting fragments consist of the following components: loxP-kanMX-loxP-ADH1 promoter-target gene-tryptophan terminator, with target gene meaning tHMG, ERG1 and, ERG11 and kanMX respectively, meaning a kanamycin-resistance gene.

[0407] The selected primers were oligonucleotide sequences which contain in the annealing region the sequences beyond the cassettes to be amplified of the vector pUG6-target gene and which contain at the 5' and 3' protruding ends in each case 40 base pairs of the 5' or 3' sequence of the integration locus. This ensures that on the one hand the entire fragment, including KanMX and target gene, is amplified and, on the other hand, this fragment can then be transformed into yeast and be integrated by homologous recombination into the target gene locus of the yeast. Depending on the target gene locus in the yeast, the following oligonucleotide sequences were used as primers:

[0408] For integration at the URA3 gene locus: TABLE-US-00003 For integration at the URA3 gene locus: URA3-Crelox-5' (SEQ. ID. No. 33): 5'-ATGTCGAAAG CTACATATAA GGAACGTGCT GCATCTCATC CCAGCTGAAG CTTCGTACGC-3' URA3-Crelox-3' (SEQ. ID. No. 34): 5'-TTAGTTTTGC TGGCCGCATC TTCTCAAATA TGCTTCCCAG GCATAGGCCA CTAGTGGATC TG-3' For integration at the LEU2 gene locus: LEU2-Crelox-5' (SEQ. ID. No. 35): 5'-GAATACTCAG GTATCGTAAG ATGCAAGAGT TCGAATCTCT CCAGCTGAAG CTTCGTACGC-3' LEU2-Crelox-3' (SEQ. ID. No. 36): 5'-TCTACCCTAT GAACATATTC CATTTTGTAA TTTCGTGTCG GCATAGGCCA CTAGTGGATC TG-3'

[0409] For integration at the HIS3 gene locus: TABLE-US-00004 HIS3-Crelox-5' (SEQ. ID. No. 37): 5'-ATGACAGAGC AGAAACCCCT AGTAAAGCGT ATTACAAATG CCAGCTGAAG CTTCGTACGC-3' HIS3-Crelox-3' (SEQ. ID. No. 38): 5'-CTACATAAGA ACACCTTTGG TGGAGGGAAC ATCGTTGGTA GCATAGGCCA CTAGTGGATC TG-3'

[0410] For integration at the ERG6 gene locus: TABLE-US-00005 ERG6-Crelox-5' (SEQ. ID. No. 39): 5'-ATGAGTGAAA CAGAATTGAG AAAAAGACAG GCCCAATTCA CCAGCTGAAG CTTCGTACGC-3' ERG6-Crelox-3' (SEQ. ID. No. 40): 5'-TTATTGAGTT GCTTCTTGGG AAGTTTGGGA GGGGGTTTCG GCATAGGCCA CTAGTGGATC TG-3'

[0411] For integration at the ERG5 gene locus: TABLE-US-00006 ERG5-Crelox-5' (SEQ. ID. No. 41): 5'-ATGAGTTCTG TCGCAGAAAA TATAATACAA CATGCCACTC CCAGCTGAAG CTTCGTACGC-3' ERG5-Crelox-3' (SEQ. ID. No. 42): 5'-TTATTCGAAG ACTTCTCCAG TAATTGGGTC TCTCTTTTTG GCATAGGCCA CTAGTGGATC TG-3'

[0412] The resistance to Geneticin (G418) served as selection marker. The resulting strains contained a copy of the particular target gene (tHMG, ERG1 or ERG11) under the control of the ADH promoter and the tryptophan terminator. At the same time, it was possible to delete the particular gene of the target locus by integrating the expression cassette. In order to subsequently remove again the gene for G418 resistance, the resultant yeast strain was transformed with the cre recombinase-containing vector pSH47 (Guldener U, Heck S, Fielder T, Beinhauer J, Hegemann J H. (1996) A new efficient gene disruption cassette for repeated use in budding yeast. Nucleic Acids Res. July 1; 24(13):2519-24). This vector caused the expression of cre recombinase in the yeast, and, as a consequence, the sequence region within the two loxP sequences was removed by recombination, and this in turn resulted in only one of the two loxP sequences and the ADH1 promoter-target gene-tryptophan terminator expression cassette remaining in the target gene locus.

[0413] As a consequence, the yeast strain loses its G418 resistance again and is therefore suitable for integrating or removing further genes by means of this "cre-lox" system into or from said yeast strain. The vector pSH47 can then be removed selectively by cultivation on FOA medium.

[0414] Thus it is possible to integrate a plurality of target genes successively into the yeast strain under the control of the ADH1 promoter and tryptophan terminator at various target loci.

[0415] First, a target gene is integrated at the URA3 locus or a ura3 strain is used in order to render the yeast strain uracil-auxotrophic, since the vector pSH47 contains a URA3 gene for selection of uracil-prototrophic strains. FIG. 4 shows an example of the method.

[0416] This method produced the yeast integration and deletion strains listed in Table 1, with, in a manner known per se, the gene in lower-case letters representing a deletion and the gene in capital letters representing an integration.

TABLE-US-00001 TABLE 1 Modification No. Strain name No. Strain name compared to GRF yeast strain I GRFtH1 ura3, tHMG:leu2 II GRFth1e1 ERG1:ura3, tHMG:leu2 III GRFtH1E11 ura3, tHMG:leu2, ERG11:his3 IV GRFtH1E1E11 ERG1:ura3, tHMG:leu2, ERG11:his3 V GRFtH1E1E11erg5erg6 ura3, tHMG:leu2, ERG1:erg6, ERG11:erg5 VI GRFtH1erg5erg6 ura3, tHMG:leu2, erg5, erg6

[0417] The yeast strains were cultured in a culture volume of 20 ml in WMVIII medium at 28.degree. C. and 160 rpm for 48 hours. Subsequently, 500 .mu.l of this preculture were transferred to a 50 ml main culture of the same medium and cultured in a baffled flask at 28.degree. C. and 160 rpm for 3 days.

[0418] After 3 days, the sterols and squalene were extracted (Parks L W, Bottema C D, Rodriguez R J, Lewis T A. (1985) Yeast sterols: yeast mutants as tools for the study of sterol metabolism. Methods Enzymol. 1985; 111:333-46) and analyzed by means of gas chromatography. The following values were obtained (see Table 2).

TABLE-US-00002 Content of sterols 1 to 11 in [peak area/gTS] No. Strain name 1 2 3 4 5 6 7 8 9 10 11 I GRFtH1 9.9 0.8 0.3 1.2 1.1 1.0 0.0 0.0 0.0 0.0 4.7 II GRFtH1E1 6.8 1.9 0.4 1.5 2.2 2.1 0.0 0.0 0.0 0.0 6.9 III GRFtH1E11 9.9 0.4 0.7 2.3 1.9 1.9 0.0 0.0 0.0 0.0 5.0 IV GRFtH1E1E11 6.0 1.2 0.9 3.0 2.3 2.2 0.0 0.0 0.0 0.0 7.2 V GRFtH1E1E11 5.8 0.8 0.4 23.1 0.0 0.0 0.0 0.0 11.8 0.0 0.0 erg5erg6 VI GRFtH1erg5erg6 9.9 0.8 0.3 12.6 0.0 0.0 0.0 0.0 7.1 0.0 0.0 1 = Squalene 2 = Lanosterol 3 = Dimethylzymosterol 4 = Zymosterol 5 = Fecosterol 6 = Episterol 7 = Cholesta-7,24-dienol 8 = Cholesta-8-enol 9 = Cholesta-5,7,24 trienol 10 = 7-Dehydrocholesterol 11 = Ergosterol

Example 2

Expression of the Heterologous Gene Encoding a .DELTA.8-.DELTA.7-Isomerase (Ebp) from Mice (Mus musculus) in Yeast

[0419] The cDNA sequence of Mus musculus .DELTA.8-.DELTA.7-isomerase (Moebius, F. F., Soellner, K. E. M., Fiechter, B., Huck, C. W., Bonn, G., Glossmann, H. (1999): Histidine-77, Glutamic Acid123, Threonine126, Asparagine194, and Tryptophan197 of Human Emopamil Protein Are Required for in Vivo Sterol .DELTA.8-.DELTA.7 Isomerisation. Biochem. 38, 1119-1127) was amplified by PCR from the cDNA clone IMAGp998A22757 (Host: E. coli DH10B) of the Deutsches Resourcenzentrum fur Genomforschung [German resource center for genome research] GmbH (Berlin).

[0420] The primers used here are the DNA oligomers Ebp-5' (SEQ. ID. No. 43) and Ebp-3' (SEQ. ID. No. 44). The DNA fragment obtained was treated with restriction enzymes NotI and XhoI and then integrated into the vectors pFlat3 and pFlat1 (FIG. 4) which likewise been treated with the enzymes NotI and XhoI beforehand by means of a ligase reaction. The resulting vectors pFlat1-EBP and pFlat3-EBP (FIG. 5a) contain the EBP gene under the control of the ADH promoter and the tryptophan terminator.

[0421] The expression vector pFlat3-EBP was then transformed into the yeast strains I to VI of Table 1 from Example 1 and also into the GRFura3 strain. The yeast strains obtained in this way were then cultured in a culture volume of 20 ml in WMVIII medium at 28.degree. C. and 160 rpm for 48 hours. Subsequently, 500 .mu.l of this preculture were transferred to a 50 ml main culture of the same medium and cultured in a baffled flask at 28.degree. C. and 160 rpm for 3 days.

[0422] The sterols were extracted after 3 days and analyzed by means of gas chromatography, as described in Example 1. The influence of the expression of a Mus musculus .DELTA.8-.DELTA.7-isomerase in combination with the expression of the transcriptionally deregulated intrinsic yeast genes tHMG and/or ERG1 and/or ERG11 and/or deletion of the intrinsic yeast genes ERG6 and ERG5 is listed in Table 3. The abbreviations have the following meanings: -=decrease; 0=no change; /=not present; +, ++, +++, ++++=concentrated to highly concentrated.

TABLE-US-00003 Influence of the genetic modifications on the sterol content compared to the GRF yeast strain No. Strain name 1 2 3 4 5 6 7 8 9 10 11 VII GRFtH1 0 0 0 0 0 0 / / / / 0 pFlat3-Ebp VIIII GRFtH1E1 0 0 0 - 0 0 + / / / 0 pFlat3-Ebp IX GRFtH1E11pFlat3- 0 0 0 - 0 0 + / / / 0 Ebp X GRFtH1E1E11 pFlat3- 0 0 0 - 0 0 + / / / 0 Ebp XI GRFtH1E1E11erg5erg6 0 0 0 - / / + / ++ / / pFlat3-Ebp XII GRFtH1erg5erg6 0 0 0 - / / + / + / / pFlat3-Ebp 1 = Squalene 2 = Lanosterol 3 = Dimethylzymosterol 4 = Zymosterol 5 = Fecosterol 6 = Episterol 7 = Cholesta-7,24-dienol 8 = Cholesta-8-enol 9 = Cholesta-5,7,24 trienol 10 = 7-Dehydrocholesterol 11 = Ergosterol

Example 3

Expression of the Heterologous Gene Encoding a .DELTA.5-Desaturase (Sc5d) from Mice (Mus musculus) in Yeast

[0423] The cDNA sequence of Mus musculus .DELTA.5-desaturase (Nishi, S., Hideaki, N., Ishibashi, T. (2000): cDNA cloning of the mammalian sterol C5-desaturase and the expression in yeast mutant. Biochim. Biophys. A 1490, 106-108) was amplified by PCR from the cDNA clone IMAGp998K144618 (Host: E. coli DH10B) of the Deutsches Resourcenzentrum fur Genomforschung [German resource center for genome research] GmbH (Berlin). The primers used here are the DNA oligomers Sc5d-5' (SEQ. ID. No. 45) and Sc5d-3' (SEQ. ID. No. 46). The DNA fragment obtained was treated with restriction enzymes NotI and XhoI and then integrated into the vector pFlat3 (FIG. 4) which likewise had been treated with the enzymes NotI and XhoI beforehand, by means of a ligase reaction. The resulting vector pFlat3-SC5D (FIG. 5b) contains the SC5D gene under the control of the ADH promoter and the tryptophan terminator.

[0424] The expression vector pFlat3-SC5D was then transformed into the yeast strains I to VI of Table 1 from Example 1 and also into the GRFura3 strain. The yeast strains obtained in this way were then cultured in a culture volume of 20 ml in WMVIII medium at 28.degree. C. and 160 rpm for 48 hours. Subsequently, 500 .mu.l of this preculture were transferred to a 50 ml main culture of the same medium and cultured in a baffled flask at 28.degree. C. and 160 rpm for 3 days.

[0425] The sterols were extracted after 3 days and analyzed by means of gas chromatography, as described in Example 1. The influence of the expression of a Mus musculus .DELTA.5-desaturase in combination with the expression of the transcriptionally deregulated intrinsic yeast genes tHMG and/or ERG1 and/or ERG11 and/or deletion of the intrinsic yeast genes ERG6 and ERG5 is listed in Table 4. The abbreviations have the following meanings: -=decrease; 0=no change; /=not present; +, ++, +++, ++++=concentrated to highly concentrated.

TABLE-US-00004 TABLE 4 Influence of the genetic modifications on the sterol content compared to the GRF yeast strain No. Strain name 1 2 3 4 5 6 7 8 9 10 11 XIII GRFtH1 pFlat3-Sc5d 0 0 0 0 0 0 / / / / 0 XIV GRFtH1E1 pFlat3-Sc5d 0 0 0 - 0 0 / / + / 0 XV GRFtH1E11 0 0 0 - 0 0 / / + / 0 pFlat3-Sc5d XVI GRFtH1E1E11 0 0 0 - 0 0 / / + / 0 pFlat3-Sc5d XVII GRFtH1E1E11erg5erg6 0 - 0 -- / / / / +++ + / pFlat3-Sc5d XVIII GRFtH1erg5erg6 0 0 0 -- / / / / ++ / / pFlat3-Sc5d 1 = Squalene 2 = Lanosterol 3 = Dimethylzymosterol 4 = Zymosterol 5 = Fecosterol 6 = Episterol 7 = Cholesta-7,24-dienol 8 = Cholesta-8-enol 9 = Cholesta-5,7,24 trienol 10 = 7-Dehydrocholesterol 11 = Ergosterol

Example 4

Expression of the Heterologous Gene Encoding a .DELTA.24-Reductase (D24R) from Mice (Mus musculus) in Yeast

[0426] The cDNA sequence of Mus musculus .DELTA.24-reductase (Waterham, H. R., Koster, J., Romeijn, G. J., Hennekam, R. C., Vreken, P., Andersson, H. C., FitzPatrick, D. R., Kelley, R. I. and Wanders, R. J., Mutations in the 3.beta.-Hydroxysterol .DELTA.24-Reductase Gene Cause Desmosterolosis, an Autosomal Recessive Disorder of Cholesterol Biosynthesis, Am. J. Hum. Genet. 69 (4), 685-694 (2001)) was amplified by PCR from the cDNA clone IMAGp998K179532 (Host: E. coli DH10B) of the Deutsches Resourcenzentrum fur Genomforschung [German resource center for genome research] GmbH (Berlin).

[0427] The primers used here are the DNA oligomers D24R-5' (SEQ. ID. No. 47) and D24R-3' (SEQ. ID. No. 48). The DNA fragment obtained was treated with restriction enzymes NotI and XhoI and then integrated into the vector pFlat4 (FIG. 6) which likewise had been treated with the enzymes NotI and XhoI beforehand, by means of a ligase reaction. The resulting vector pFlat4-D24R (FIG. 5d) contains the D24R gene under the control of the ADH1 promoter and the tryptophan terminator.

[0428] The expression vector pFlat4-D24R was then transformed into the yeast strains I to VI of Table 1 from Example 1 and also into the GRFura3 strain. The yeast strains obtained in this way were then cultured in a culture volume of 20 ml in WMVIII medium at 28.degree. C. and 160 rpm for 48 hours. Subsequently, 500 .mu.l of this preculture were transferred to a 50 ml main culture of the same medium and cultured in a baffled flask at 28.degree. C. and 160 rpm for 3 days.

[0429] The sterols were extracted after 3 days and analyzed by means of gas chromatography, as described in Example 1. The influence of the expression of a Mus musculus .DELTA.24-reductase in combination with the expression of the transcriptionally deregulated intrinsic yeast genes tHMG and/or ERG1 and/or ERG11 and/or deletion of the intrinsic yeast genes ERG6 and ERG5 is listed in Table 5. The abbreviations have the following meanings: -=decrease; 0=no change; /=not present; +, ++, +++, ++++=concentrated to highly concentrated.

TABLE-US-00005 TABLE 5 Influence of the genetic modifications on the sterol content compared to the GRF yeast strain No. Strain name 1 2 3 4 5 6 7 8 9 10 11 XIX GRFtH1 0 0 0 0 0 0 / / / / 0 pFlat4-D24R XX GRFtH1E1 0 - - - 0 0 / / / + 0 pFlat4-D24R XXI GRFtH1E11 pFlat4- 0 0 0 - 0 0 / + / + 0 D24R XXII GRFtH1E1E11 pFlat4- 0 0 0 - 0 0 / + / + 0 D24R XXIII GRFtH1E1E11erg5erg6 0 - - -- / / 0 + + +++ / pFlat4-D24R XXIV GRFtH1erg5erg6 0 - - - / / 0 + + ++ / pFlat4-D24R 1 = Squalene 2 = Lanosterol 3 = Dimethylzymosterol 4 = Zymosterol 5 = Fecosterol 6 = Episterol 7 = Cholesta-7,24-dienol 8 = Cholesta-8-enol 9 = Cholesta-5,7,24 trienol 10 = 7-Dehydrocholesterol 11 = Ergosterol

Example 5

Coexpression of the Heterologous Genes Encoding a .DELTA.8-.DELTA.7-Isomerase (Ebp) from Mice (Mus musculus) and a C5-Desaturase (Sc5d) from Mice (Mus musculus) in Yeast

[0430] The expression vectors pFlat1-EBP (from Example 2) and pFlat3-SC5D (from Example 3) were transformed into the yeast strains I to VI of Table 1 of Example 1 and also into the GRFura3 strain. The yeast strains obtained in this way were then cultured in a culture volume of 20 ml in WMVIII medium at 28.degree. C. and 160 rpm for 48 hours. Subsequently, 500 .mu.l of this preculture were transferred to a 50 ml main culture of the same medium and cultured in a baffled flask at 28.degree. C. and 160 rpm for 3 days.

[0431] The sterols were extracted after 3 days and analyzed by means of gas chromatography, as described in Example 1. The influence of the expression of a .DELTA.8-.DELTA.7-isomerase and a Mus musculus C5-desaturase in combination with the expression of the transcriptionally deregulated intrinsic yeast genes tHMG and/or ERG1 and/or ERG11 and/or deletion of the intrinsic yeast genes ERG6 and ERG5 is listed in Table 6. The abbreviations have the following meanings: -=decrease; 0=no change; /=not present; +, ++, +++, ++++=concentrated to highly concentrated.

TABLE-US-00006 TABLE 6 Influence of the genetic modifications on the sterol content compared to the GRF yeast strain No. Strain name 1 2 3 4 5 6 7 8 9 10 11 VVX GRFtH1 pFlat3-Ebp/ 0 0 0 - 0 0 / / + / 0 pFlat1-Sc5d XXVI GRFtH1E1 pFlat3-Ebp/ 0 - 0 -- 0 0 / / + / 0 pFlat1-Sc5d XXVII GRFtH1E11 pFlat3- 0 0 0 -- 0 0 / / + / 0 Ebp/pFlat1-Sc5d XXVIII GRFtH1E1E11 pFlat3- 0 - - -- 0 0 / / ++ / 0 Ebp/pFlat1-Sc5d XXIX GRFtH1E1E11erg5erg6 0 - 0 -- / / / / +++ + / pFlat3-Ebp/pFlat1- Sc5d XXX GRFtH1erg5erg6 0 0 0 - / / / / ++ + / pFlat3-Ebp/pFlat1- Sc5d 1 = Squalene 2 = Lanosterol 3 = Dimethylzymosterol 4 = Zymosterol 5 = Fecosterol 6 = Episterol 7 = Cholesta-7,24-dienol 8 = Cholesta-8-enol 9 = Cholesta-5,7,24 trienol 10 = 7-Dehydrocholesterol 11 = Ergosterol

Example 6

Coexpression of the Heterologous Genes Encoding a .DELTA.8-.DELTA.7-Isomerase (Ebp) from Mice (Mus musculus) Encoding a C5-Desaturase (Sc5d) from Mice (Mus musculus) and a .DELTA.24-Reductase from Mice (Mus musculus) in Yeast

[0432] The expression vectors pFlat1-EBP (from Example 2) and pFlat3-SC5D (from Example 3) and pFlat4-D24R (from Example 4) were transformed into the yeast strains I to VI of Table 1 of Example 1 and also into the GRFura3 strain. The yeast strains obtained in this way were then cultured in a culture volume of 20 ml in WMVIII medium at 28.degree. C. and 160 rpm for 48 hours. Subsequently, 500 .mu.l of this preculture were transferred to a 50 ml main culture of the same medium and cultured in a baffled flask at 28.degree. C. and 160 rpm for 3 days.

[0433] The sterols were extracted after 3 days and analyzed by means of gas chromatography, as described in Example 1. The influence of the expression of a .DELTA.8-.DELTA.7-isomerase, a Mus musculus C5-desaturase and a Mus musculus .DELTA.24-reductase in combination with the expression of the transcriptionally deregulated intrinsic yeast genes tHMG and/or ERG1 and/or ERG11 and/or deletion of the intrinsic yeast genes ERG6 and ERG5 is listed in Table 7. The abbreviations have the following meanings: -=decrease; 0=no change; /=not present; ++, +++, ++++=concentrated to highly concentrated.

TABLE-US-00007 TABLE 7 Influence of the genetic modifications on the sterol content compared to the GRF yeast strain No. Strain name 1 2 3 4 5 6 7 8 9 10 11 XXXI GRFtH1 pFlat3-Ebp/ 0 0 0 - 0 0 / / / + 0 pFlat1-Sc5d/pFlat4- D24R XXXII GRFtH1E1 pFlat3-Ebp/ 0 - 0 -- 0 0 / / / + 0 pFlat1-Sc5d/pFlat4- D24R XXXIII GRFtH1E11 pFlat3- 0 0 0 -- 0 0 / / / + 0 Ebp/pFlat1-Sc5d/ pFlat4-D24R XXXIV GRFtH1E1E11 pFlat3- 0 - - -- 0 0 / / / + 0 Ebp/pFlat1-Sc5d/ pFlat4-D24R XXXV GRFtH1E1E11erg5erg6 0 - 0 --- / / / / + ++++ / pFlat3-Ebp/pFlat1- Sc5d/pFlat4-D24R XXXVI GRFtH1erg5erg6 0 0 0 - / / / / ++ +++ / pFlat3-Ebp/pFlat1- Sc5d/pFlat4-D24R 1 = Squalene 2 = Lanosterol 3 = Dimethylzymosterol 4 = Zymosterol 5 = Fecosterol 6 = Episterol 7 = Cholesta-7,24-dienol 8 = Cholesta-8-enol 9 = Cholesta-5,7,24 trienol 10 = 7-Dehydrocholesterol 11 = Ergosterol

Sequence CWU 1

1

601693DNAMus musculusCDS(1)..(693) 1atg acc acc aat acg gtc ccc ttg cac ccg tac tgg ccc agg cac ctg 48Met Thr Thr Asn Thr Val Pro Leu His Pro Tyr Trp Pro Arg His Leu1 5 10 15aag ctg gac aac ttc gtg cct aat gac ctc ccg act tcg cat atc ctg 96Lys Leu Asp Asn Phe Val Pro Asn Asp Leu Pro Thr Ser His Ile Leu 20 25 30gtt ggc ctc ttc tcc atc tct ggg ggc cta att gtg atc acg tgg ctg 144Val Gly Leu Phe Ser Ile Ser Gly Gly Leu Ile Val Ile Thr Trp Leu 35 40 45ttg tct agc cga gct tcc gtc gtc cca ctt gga gct ggg cgg cga ctg 192Leu Ser Ser Arg Ala Ser Val Val Pro Leu Gly Ala Gly Arg Arg Leu 50 55 60gcc ttg tgc tgg ttt gct gtg tgt acc ttc att cac ctt gtg atc gag 240Ala Leu Cys Trp Phe Ala Val Cys Thr Phe Ile His Leu Val Ile Glu65 70 75 80ggc tgg ttc tct ctc tac aat ggc atc ctt tta gaa gac caa gcc ttc 288Gly Trp Phe Ser Leu Tyr Asn Gly Ile Leu Leu Glu Asp Gln Ala Phe 85 90 95tta tcc caa ctc tgg aaa gag tat tcc aag gga gat agc cga tat atc 336Leu Ser Gln Leu Trp Lys Glu Tyr Ser Lys Gly Asp Ser Arg Tyr Ile 100 105 110ctt agt gac agc ttc gtc gtc tgt atg gag act gtc aca gct tgt ctc 384Leu Ser Asp Ser Phe Val Val Cys Met Glu Thr Val Thr Ala Cys Leu 115 120 125tgg gga cca ctc agc cta tgg gta gtg att gcc ttt ctc cgc caa cag 432Trp Gly Pro Leu Ser Leu Trp Val Val Ile Ala Phe Leu Arg Gln Gln 130 135 140ccc ttc cgc ttt gtc cta cag ctt gtg gtg tct atg ggc cag ata tac 480Pro Phe Arg Phe Val Leu Gln Leu Val Val Ser Met Gly Gln Ile Tyr145 150 155 160ggg gat gtg ctg tac ttc ctg aca gag cta cac gaa gga ctc cag cat 528Gly Asp Val Leu Tyr Phe Leu Thr Glu Leu His Glu Gly Leu Gln His 165 170 175ggg gag ata ggc cac ccc gtt tat ttc tgg ttc tat ttt gtt ttc ctg 576Gly Glu Ile Gly His Pro Val Tyr Phe Trp Phe Tyr Phe Val Phe Leu 180 185 190aat gct gta tgg ttg gtg ata cca agc atc ctt gtg ctt gat gcc ata 624Asn Ala Val Trp Leu Val Ile Pro Ser Ile Leu Val Leu Asp Ala Ile 195 200 205aag cat ctc act agt gcc cag agc gtg ctg gac agc aaa gtc atg aaa 672Lys His Leu Thr Ser Ala Gln Ser Val Leu Asp Ser Lys Val Met Lys 210 215 220att aag agc aag cat aac taa 693Ile Lys Ser Lys His Asn225 2302230PRTMus musculus 2Met Thr Thr Asn Thr Val Pro Leu His Pro Tyr Trp Pro Arg His Leu1 5 10 15Lys Leu Asp Asn Phe Val Pro Asn Asp Leu Pro Thr Ser His Ile Leu 20 25 30Val Gly Leu Phe Ser Ile Ser Gly Gly Leu Ile Val Ile Thr Trp Leu 35 40 45Leu Ser Ser Arg Ala Ser Val Val Pro Leu Gly Ala Gly Arg Arg Leu 50 55 60Ala Leu Cys Trp Phe Ala Val Cys Thr Phe Ile His Leu Val Ile Glu65 70 75 80Gly Trp Phe Ser Leu Tyr Asn Gly Ile Leu Leu Glu Asp Gln Ala Phe 85 90 95Leu Ser Gln Leu Trp Lys Glu Tyr Ser Lys Gly Asp Ser Arg Tyr Ile 100 105 110Leu Ser Asp Ser Phe Val Val Cys Met Glu Thr Val Thr Ala Cys Leu 115 120 125Trp Gly Pro Leu Ser Leu Trp Val Val Ile Ala Phe Leu Arg Gln Gln 130 135 140Pro Phe Arg Phe Val Leu Gln Leu Val Val Ser Met Gly Gln Ile Tyr145 150 155 160Gly Asp Val Leu Tyr Phe Leu Thr Glu Leu His Glu Gly Leu Gln His 165 170 175Gly Glu Ile Gly His Pro Val Tyr Phe Trp Phe Tyr Phe Val Phe Leu 180 185 190Asn Ala Val Trp Leu Val Ile Pro Ser Ile Leu Val Leu Asp Ala Ile 195 200 205Lys His Leu Thr Ser Ala Gln Ser Val Leu Asp Ser Lys Val Met Lys 210 215 220Ile Lys Ser Lys His Asn225 2303693DNAHomo sapiensCDS(1)..(693) 3atg act acc aac gcg ggc ccc ttg cac cca tac tgg cct cag cac cta 48Met Thr Thr Asn Ala Gly Pro Leu His Pro Tyr Trp Pro Gln His Leu1 5 10 15aga ctg gac aac ttt gta cct aat gac cgc ccc acc tgg cat ata ctg 96Arg Leu Asp Asn Phe Val Pro Asn Asp Arg Pro Thr Trp His Ile Leu 20 25 30gct ggc ctc ttc tct gtc aca ggg gtc tta gtc gtg acc aca tgg ctg 144Ala Gly Leu Phe Ser Val Thr Gly Val Leu Val Val Thr Thr Trp Leu 35 40 45ttg tca ggt cgt gct gcg gtt gtc cca ttg ggg act tgg cgg cga ctg 192Leu Ser Gly Arg Ala Ala Val Val Pro Leu Gly Thr Trp Arg Arg Leu 50 55 60tcc ctg tgc tgg ttt gca gtg tgt ggg ttc att cac ctg gtg atc gag 240Ser Leu Cys Trp Phe Ala Val Cys Gly Phe Ile His Leu Val Ile Glu65 70 75 80ggc tgg ttc gtt ctc tac tac gaa gac ctg ctt gga gac caa gcc ttc 288Gly Trp Phe Val Leu Tyr Tyr Glu Asp Leu Leu Gly Asp Gln Ala Phe 85 90 95tta tct caa ctc tgg aaa gag tat gcc aag gga gac agc cga tac atc 336Leu Ser Gln Leu Trp Lys Glu Tyr Ala Lys Gly Asp Ser Arg Tyr Ile 100 105 110ctg ggt gac aac ttc aca gtg tgc atg gaa acc atc aca gct tgc ctg 384Leu Gly Asp Asn Phe Thr Val Cys Met Glu Thr Ile Thr Ala Cys Leu 115 120 125tgg gga cca ctc agc ctg tgg gtg gtg atc gcc ttt ctc cgc cag cat 432Trp Gly Pro Leu Ser Leu Trp Val Val Ile Ala Phe Leu Arg Gln His 130 135 140ccc ctc cgc ttc att cta cag ctt gtg gtc tct gtg ggc cag atc tat 480Pro Leu Arg Phe Ile Leu Gln Leu Val Val Ser Val Gly Gln Ile Tyr145 150 155 160ggg gat gtg ctc tac ttc ctg aca gag cac cgc gac gga ttc cag cac 528Gly Asp Val Leu Tyr Phe Leu Thr Glu His Arg Asp Gly Phe Gln His 165 170 175gga gag ctg ggc cac cct ctc tac ttc tgg ttt tac ttt gtc ttc atg 576Gly Glu Leu Gly His Pro Leu Tyr Phe Trp Phe Tyr Phe Val Phe Met 180 185 190aat gcc ctg tgg ctg gtg ctg cct gga gtc ctt gtg ctt gat gct gtg 624Asn Ala Leu Trp Leu Val Leu Pro Gly Val Leu Val Leu Asp Ala Val 195 200 205aag cac ctc act cat gcc cag agc acg ctg gat gcc aag gcc aca aaa 672Lys His Leu Thr His Ala Gln Ser Thr Leu Asp Ala Lys Ala Thr Lys 210 215 220gcc aag agc aag aag aac tga 693Ala Lys Ser Lys Lys Asn225 2304230PRTHomo sapiens 4Met Thr Thr Asn Ala Gly Pro Leu His Pro Tyr Trp Pro Gln His Leu1 5 10 15Arg Leu Asp Asn Phe Val Pro Asn Asp Arg Pro Thr Trp His Ile Leu 20 25 30Ala Gly Leu Phe Ser Val Thr Gly Val Leu Val Val Thr Thr Trp Leu 35 40 45Leu Ser Gly Arg Ala Ala Val Val Pro Leu Gly Thr Trp Arg Arg Leu 50 55 60Ser Leu Cys Trp Phe Ala Val Cys Gly Phe Ile His Leu Val Ile Glu65 70 75 80Gly Trp Phe Val Leu Tyr Tyr Glu Asp Leu Leu Gly Asp Gln Ala Phe 85 90 95Leu Ser Gln Leu Trp Lys Glu Tyr Ala Lys Gly Asp Ser Arg Tyr Ile 100 105 110Leu Gly Asp Asn Phe Thr Val Cys Met Glu Thr Ile Thr Ala Cys Leu 115 120 125Trp Gly Pro Leu Ser Leu Trp Val Val Ile Ala Phe Leu Arg Gln His 130 135 140Pro Leu Arg Phe Ile Leu Gln Leu Val Val Ser Val Gly Gln Ile Tyr145 150 155 160Gly Asp Val Leu Tyr Phe Leu Thr Glu His Arg Asp Gly Phe Gln His 165 170 175Gly Glu Leu Gly His Pro Leu Tyr Phe Trp Phe Tyr Phe Val Phe Met 180 185 190Asn Ala Leu Trp Leu Val Leu Pro Gly Val Leu Val Leu Asp Ala Val 195 200 205Lys His Leu Thr His Ala Gln Ser Thr Leu Asp Ala Lys Ala Thr Lys 210 215 220Ala Lys Ser Lys Lys Asn225 2305669DNASaccharomyces cerevisiaeCDS(1)..(669) 5atg aag ttt ttc cca ctc ctt ttg ttg att ggt gtt gta ggc tac att 48Met Lys Phe Phe Pro Leu Leu Leu Leu Ile Gly Val Val Gly Tyr Ile1 5 10 15atg aac gta ttg ttc act acc tgg ttg cca acc aat tac atg ttc gat 96Met Asn Val Leu Phe Thr Thr Trp Leu Pro Thr Asn Tyr Met Phe Asp 20 25 30cca aaa act ttg aac gaa ata tgt aac tcg gtg att agc aaa cac aac 144Pro Lys Thr Leu Asn Glu Ile Cys Asn Ser Val Ile Ser Lys His Asn 35 40 45gca gca gaa ggt tta tcc act gaa gac ctg tta cag gat gtc aga gac 192Ala Ala Glu Gly Leu Ser Thr Glu Asp Leu Leu Gln Asp Val Arg Asp 50 55 60gca ctt gcc tct cat tac ggg gac gaa tac atc aac agg tac gtc aaa 240Ala Leu Ala Ser His Tyr Gly Asp Glu Tyr Ile Asn Arg Tyr Val Lys65 70 75 80gaa gaa tgg gtc ttc aac aat gct ggt ggt gcg atg ggc caa atg atc 288Glu Glu Trp Val Phe Asn Asn Ala Gly Gly Ala Met Gly Gln Met Ile 85 90 95atc cta cac gct tcc gta tcc gag tac tta att cta ttc gga acc gct 336Ile Leu His Ala Ser Val Ser Glu Tyr Leu Ile Leu Phe Gly Thr Ala 100 105 110gtt ggt act gaa ggg cac aca ggt gtt cac ttt gct gac gac tat ttt 384Val Gly Thr Glu Gly His Thr Gly Val His Phe Ala Asp Asp Tyr Phe 115 120 125acc atc tta cat ggt acg caa atc gca gca ttg cca tat gcc act gaa 432Thr Ile Leu His Gly Thr Gln Ile Ala Ala Leu Pro Tyr Ala Thr Glu 130 135 140gcc gaa gtt tac act cct ggt atg act cat cac ttg aag aag gga tac 480Ala Glu Val Tyr Thr Pro Gly Met Thr His His Leu Lys Lys Gly Tyr145 150 155 160gcc aag caa tac agc atg cca ggt ggt tcc ttt gcc ctt gaa ttg gct 528Ala Lys Gln Tyr Ser Met Pro Gly Gly Ser Phe Ala Leu Glu Leu Ala 165 170 175caa ggc tgg att cca tgt atg ttg cca ttc ggg ttt ttg gac act ttc 576Gln Gly Trp Ile Pro Cys Met Leu Pro Phe Gly Phe Leu Asp Thr Phe 180 185 190tcc agt act ctt gat tta tac act cta tat aga act gtc tac ctg act 624Ser Ser Thr Leu Asp Leu Tyr Thr Leu Tyr Arg Thr Val Tyr Leu Thr 195 200 205gcc agg gac atg ggt aag aac ttg ttg caa aac aaa aag ttc taa 669Ala Arg Asp Met Gly Lys Asn Leu Leu Gln Asn Lys Lys Phe 210 215 2206222PRTSaccharomyces cerevisiae 6Met Lys Phe Phe Pro Leu Leu Leu Leu Ile Gly Val Val Gly Tyr Ile1 5 10 15Met Asn Val Leu Phe Thr Thr Trp Leu Pro Thr Asn Tyr Met Phe Asp 20 25 30Pro Lys Thr Leu Asn Glu Ile Cys Asn Ser Val Ile Ser Lys His Asn 35 40 45Ala Ala Glu Gly Leu Ser Thr Glu Asp Leu Leu Gln Asp Val Arg Asp 50 55 60Ala Leu Ala Ser His Tyr Gly Asp Glu Tyr Ile Asn Arg Tyr Val Lys65 70 75 80Glu Glu Trp Val Phe Asn Asn Ala Gly Gly Ala Met Gly Gln Met Ile 85 90 95Ile Leu His Ala Ser Val Ser Glu Tyr Leu Ile Leu Phe Gly Thr Ala 100 105 110Val Gly Thr Glu Gly His Thr Gly Val His Phe Ala Asp Asp Tyr Phe 115 120 125Thr Ile Leu His Gly Thr Gln Ile Ala Ala Leu Pro Tyr Ala Thr Glu 130 135 140Ala Glu Val Tyr Thr Pro Gly Met Thr His His Leu Lys Lys Gly Tyr145 150 155 160Ala Lys Gln Tyr Ser Met Pro Gly Gly Ser Phe Ala Leu Glu Leu Ala 165 170 175Gln Gly Trp Ile Pro Cys Met Leu Pro Phe Gly Phe Leu Asp Thr Phe 180 185 190Ser Ser Thr Leu Asp Leu Tyr Thr Leu Tyr Arg Thr Val Tyr Leu Thr 195 200 205Ala Arg Asp Met Gly Lys Asn Leu Leu Gln Asn Lys Lys Phe 210 215 2207900DNAMus musculusCDS(1)..(900) 7atg gac ctg gtt ctc agt gcc gcc gat tac tac ttc ttc act ccg tat 48Met Asp Leu Val Leu Ser Ala Ala Asp Tyr Tyr Phe Phe Thr Pro Tyr1 5 10 15gta tat cca gcc acg tgg ccc gag gac aac atc atc cga caa act att 96Val Tyr Pro Ala Thr Trp Pro Glu Asp Asn Ile Ile Arg Gln Thr Ile 20 25 30agc ctc ctg att gtc aca aac ctg ggt gct tac att ctc tac ttc ttc 144Ser Leu Leu Ile Val Thr Asn Leu Gly Ala Tyr Ile Leu Tyr Phe Phe 35 40 45tgt gca acc ctc agc tat tat ttt gtc tat gat cat tcc tta atg aaa 192Cys Ala Thr Leu Ser Tyr Tyr Phe Val Tyr Asp His Ser Leu Met Lys 50 55 60cac cca cag ttt tta aag aac caa gtc tcg cgt gag atc gtg ttc act 240His Pro Gln Phe Leu Lys Asn Gln Val Ser Arg Glu Ile Val Phe Thr65 70 75 80gtc aag tct ttg cct tgg atc agc atc ccc acc gtc tca cta ttc ctg 288Val Lys Ser Leu Pro Trp Ile Ser Ile Pro Thr Val Ser Leu Phe Leu 85 90 95ctg gag ctg agg ggt tac agc aaa ctc tac gat gac atc gga gac ttt 336Leu Glu Leu Arg Gly Tyr Ser Lys Leu Tyr Asp Asp Ile Gly Asp Phe 100 105 110cca aat ggc tgg att cat ctc atg gtt agc gtc gta tcc ttc ctc ttt 384Pro Asn Gly Trp Ile His Leu Met Val Ser Val Val Ser Phe Leu Phe 115 120 125ttc aca gac atg ttg atc tac agg att cat agg ggc ctg cac cac aga 432Phe Thr Asp Met Leu Ile Tyr Arg Ile His Arg Gly Leu His His Arg 130 135 140ctg gtc tac aag cgc ata cat aaa cca cat cat att tgg aag atc ccc 480Leu Val Tyr Lys Arg Ile His Lys Pro His His Ile Trp Lys Ile Pro145 150 155 160acg ccg ttt gca agt cat gct ttt cac cct gtg gac ggc ttc ctt cag 528Thr Pro Phe Ala Ser His Ala Phe His Pro Val Asp Gly Phe Leu Gln 165 170 175agt ctg cct tac cat ata tac ccc ttt gtc ttt cca ctg cac aag gtg 576Ser Leu Pro Tyr His Ile Tyr Pro Phe Val Phe Pro Leu His Lys Val 180 185 190gtc tac tta ggt tta tat gtc ttg gtt aat gtc tgg aca att tct att 624Val Tyr Leu Gly Leu Tyr Val Leu Val Asn Val Trp Thr Ile Ser Ile 195 200 205cat gat ggt gat ttt cgg gtt ccc cag atc tta agg cca ttt att aac 672His Asp Gly Asp Phe Arg Val Pro Gln Ile Leu Arg Pro Phe Ile Asn 210 215 220ggg tca gct cac cac aca gac cac cac atg ttc ttt gac tat aac tat 720Gly Ser Ala His His Thr Asp His His Met Phe Phe Asp Tyr Asn Tyr225 230 235 240gga cag tat ttc aca ttg tgg gat aga att gga ggc tct ttt aaa cat 768Gly Gln Tyr Phe Thr Leu Trp Asp Arg Ile Gly Gly Ser Phe Lys His 245 250 255cct tcc tct ttt gaa ggg aaa gga cca cat agt tac gtg aag aac atg 816Pro Ser Ser Phe Glu Gly Lys Gly Pro His Ser Tyr Val Lys Asn Met 260 265 270aca gaa aaa gaa tct aac agc ttt gca gaa aac ggc tgt aaa ggc aaa 864Thr Glu Lys Glu Ser Asn Ser Phe Ala Glu Asn Gly Cys Lys Gly Lys 275 280 285aaa gta agc aat gga gag ttt aca aag aat aag tag 900Lys Val Ser Asn Gly Glu Phe Thr Lys Asn Lys 290 2958299PRTMus musculus 8Met Asp Leu Val Leu Ser Ala Ala Asp Tyr Tyr Phe Phe Thr Pro Tyr1 5 10 15Val Tyr Pro Ala Thr Trp Pro Glu Asp Asn Ile Ile Arg Gln Thr Ile 20 25 30Ser Leu Leu Ile Val Thr Asn Leu Gly Ala Tyr Ile Leu Tyr Phe Phe 35 40 45Cys Ala Thr Leu Ser Tyr Tyr Phe Val Tyr Asp His Ser Leu Met Lys 50 55 60His Pro Gln Phe Leu Lys Asn Gln Val Ser Arg Glu Ile Val Phe Thr65 70 75 80Val Lys Ser Leu Pro Trp Ile Ser Ile Pro Thr Val Ser Leu Phe Leu 85 90 95Leu Glu Leu Arg Gly Tyr Ser Lys Leu Tyr Asp Asp Ile Gly Asp Phe 100 105 110Pro Asn Gly Trp Ile His Leu Met Val Ser Val Val Ser Phe Leu Phe 115 120 125Phe Thr Asp Met Leu Ile Tyr Arg Ile His Arg Gly Leu His His Arg 130 135 140Leu Val Tyr Lys Arg Ile His Lys Pro His His Ile Trp Lys Ile Pro145 150 155 160Thr Pro Phe Ala Ser His Ala Phe His Pro Val Asp Gly Phe Leu Gln

165 170 175Ser Leu Pro Tyr His Ile Tyr Pro Phe Val Phe Pro Leu His Lys Val 180 185 190Val Tyr Leu Gly Leu Tyr Val Leu Val Asn Val Trp Thr Ile Ser Ile 195 200 205His Asp Gly Asp Phe Arg Val Pro Gln Ile Leu Arg Pro Phe Ile Asn 210 215 220Gly Ser Ala His His Thr Asp His His Met Phe Phe Asp Tyr Asn Tyr225 230 235 240Gly Gln Tyr Phe Thr Leu Trp Asp Arg Ile Gly Gly Ser Phe Lys His 245 250 255Pro Ser Ser Phe Glu Gly Lys Gly Pro His Ser Tyr Val Lys Asn Met 260 265 270Thr Glu Lys Glu Ser Asn Ser Phe Ala Glu Asn Gly Cys Lys Gly Lys 275 280 285Lys Val Ser Asn Gly Glu Phe Thr Lys Asn Lys 290 2959900DNAHomo sapiensCDS(1)..(900) 9atg gat ctt gta ctc cgt gtt gca gat tac tat ttt ttt aca cca tac 48Met Asp Leu Val Leu Arg Val Ala Asp Tyr Tyr Phe Phe Thr Pro Tyr1 5 10 15gtg tat cca gcc aca tgg cca gaa gat gac atc ttc cga caa gct att 96Val Tyr Pro Ala Thr Trp Pro Glu Asp Asp Ile Phe Arg Gln Ala Ile 20 25 30agt ctt ctg att gta aca aat gtt ggt gct tac atc ctt tat ttc ttc 144Ser Leu Leu Ile Val Thr Asn Val Gly Ala Tyr Ile Leu Tyr Phe Phe 35 40 45tgt gca aca ctg agc tat tat ttt gtc ttc gat cat gca tta atg aaa 192Cys Ala Thr Leu Ser Tyr Tyr Phe Val Phe Asp His Ala Leu Met Lys 50 55 60cat cca caa ttt tta aag aat caa gtc cgt cga gag att aag ttt act 240His Pro Gln Phe Leu Lys Asn Gln Val Arg Arg Glu Ile Lys Phe Thr65 70 75 80gtc cag gca ttg cca tgg ata agt att ctt act gtt gca ctg ttc ttg 288Val Gln Ala Leu Pro Trp Ile Ser Ile Leu Thr Val Ala Leu Phe Leu 85 90 95ctg gag ata aga ggt tac agc aaa tta cat gat gac cta gga gag ttt 336Leu Glu Ile Arg Gly Tyr Ser Lys Leu His Asp Asp Leu Gly Glu Phe 100 105 110cca tat gga ttg ttt gaa ctt gtc gtt agt ata ata tct ttc ctc ttt 384Pro Tyr Gly Leu Phe Glu Leu Val Val Ser Ile Ile Ser Phe Leu Phe 115 120 125ttc act gac atg ttc atc tac tgg att cac aga ggc ctt cat cat aga 432Phe Thr Asp Met Phe Ile Tyr Trp Ile His Arg Gly Leu His His Arg 130 135 140ctg gta tat aag cgc cta cat aaa cct cac cat att tgg aag att cct 480Leu Val Tyr Lys Arg Leu His Lys Pro His His Ile Trp Lys Ile Pro145 150 155 160act cca ttt gca agt cat gct ttt cac cct att gat ggc ttt ctt cag 528Thr Pro Phe Ala Ser His Ala Phe His Pro Ile Asp Gly Phe Leu Gln 165 170 175agt cta cct tac cat ata tac cct ttt atc ttt cca tta cac aag gtg 576Ser Leu Pro Tyr His Ile Tyr Pro Phe Ile Phe Pro Leu His Lys Val 180 185 190gtt tat tta agt ctg tac atc ttg gtt aat atc tgg aca att tcc att 624Val Tyr Leu Ser Leu Tyr Ile Leu Val Asn Ile Trp Thr Ile Ser Ile 195 200 205cat gac ggt gat ttt cgt gtc ccc caa atc tta cag cca ttt att aat 672His Asp Gly Asp Phe Arg Val Pro Gln Ile Leu Gln Pro Phe Ile Asn 210 215 220ggc tca gct cat cat aca gac cac cat atg ttc ttt gac tat aat tat 720Gly Ser Ala His His Thr Asp His His Met Phe Phe Asp Tyr Asn Tyr225 230 235 240gga caa tat ttc act ttg tgg gat agg att ggc ggc tca ttc aaa aat 768Gly Gln Tyr Phe Thr Leu Trp Asp Arg Ile Gly Gly Ser Phe Lys Asn 245 250 255cct tca tcc ttt gag ggg aag gga ccg ctc agt tat gtg aag gag atg 816Pro Ser Ser Phe Glu Gly Lys Gly Pro Leu Ser Tyr Val Lys Glu Met 260 265 270aca gag gga aag cgc agc agc cct tca gga aat ggc tgt aag aat gaa 864Thr Glu Gly Lys Arg Ser Ser Pro Ser Gly Asn Gly Cys Lys Asn Glu 275 280 285aaa tta ttc aat gga gag ttt aca aag act gaa tag 900Lys Leu Phe Asn Gly Glu Phe Thr Lys Thr Glu 290 29510299PRTHomo sapiens 10Met Asp Leu Val Leu Arg Val Ala Asp Tyr Tyr Phe Phe Thr Pro Tyr1 5 10 15Val Tyr Pro Ala Thr Trp Pro Glu Asp Asp Ile Phe Arg Gln Ala Ile 20 25 30Ser Leu Leu Ile Val Thr Asn Val Gly Ala Tyr Ile Leu Tyr Phe Phe 35 40 45Cys Ala Thr Leu Ser Tyr Tyr Phe Val Phe Asp His Ala Leu Met Lys 50 55 60His Pro Gln Phe Leu Lys Asn Gln Val Arg Arg Glu Ile Lys Phe Thr65 70 75 80Val Gln Ala Leu Pro Trp Ile Ser Ile Leu Thr Val Ala Leu Phe Leu 85 90 95Leu Glu Ile Arg Gly Tyr Ser Lys Leu His Asp Asp Leu Gly Glu Phe 100 105 110Pro Tyr Gly Leu Phe Glu Leu Val Val Ser Ile Ile Ser Phe Leu Phe 115 120 125Phe Thr Asp Met Phe Ile Tyr Trp Ile His Arg Gly Leu His His Arg 130 135 140Leu Val Tyr Lys Arg Leu His Lys Pro His His Ile Trp Lys Ile Pro145 150 155 160Thr Pro Phe Ala Ser His Ala Phe His Pro Ile Asp Gly Phe Leu Gln 165 170 175Ser Leu Pro Tyr His Ile Tyr Pro Phe Ile Phe Pro Leu His Lys Val 180 185 190Val Tyr Leu Ser Leu Tyr Ile Leu Val Asn Ile Trp Thr Ile Ser Ile 195 200 205His Asp Gly Asp Phe Arg Val Pro Gln Ile Leu Gln Pro Phe Ile Asn 210 215 220Gly Ser Ala His His Thr Asp His His Met Phe Phe Asp Tyr Asn Tyr225 230 235 240Gly Gln Tyr Phe Thr Leu Trp Asp Arg Ile Gly Gly Ser Phe Lys Asn 245 250 255Pro Ser Ser Phe Glu Gly Lys Gly Pro Leu Ser Tyr Val Lys Glu Met 260 265 270Thr Glu Gly Lys Arg Ser Ser Pro Ser Gly Asn Gly Cys Lys Asn Glu 275 280 285Lys Leu Phe Asn Gly Glu Phe Thr Lys Thr Glu 290 295111098DNASaccharomyces cerevisiaeCDS(1)..(1098) 11atg gat ttg gtc tta gaa gtc gct gac cat tat gtc tta gac gac ttg 48Met Asp Leu Val Leu Glu Val Ala Asp His Tyr Val Leu Asp Asp Leu1 5 10 15tac gct aaa gtt ctg ccc gct tcg ttg gca gct aat att cct gtc aag 96Tyr Ala Lys Val Leu Pro Ala Ser Leu Ala Ala Asn Ile Pro Val Lys 20 25 30tgg cag aaa ttg cta ggg ttg aac agt ggg ttc agc aat tct acg att 144Trp Gln Lys Leu Leu Gly Leu Asn Ser Gly Phe Ser Asn Ser Thr Ile 35 40 45ttg cag gag act ttg aac tcc aag aat gcc gtc aaa gaa tgt aga agg 192Leu Gln Glu Thr Leu Asn Ser Lys Asn Ala Val Lys Glu Cys Arg Arg 50 55 60ttc tac ggg cag gtg cca ttc ctg ttt gat atg tcg acg acg tct ttt 240Phe Tyr Gly Gln Val Pro Phe Leu Phe Asp Met Ser Thr Thr Ser Phe65 70 75 80gca tcg cta ttg cct cgt tcc agc atc ttg aga gaa ttc ctc tca cta 288Ala Ser Leu Leu Pro Arg Ser Ser Ile Leu Arg Glu Phe Leu Ser Leu 85 90 95tgg gtt att gtt acg atc ttt ggt tta cta ctt tac tta ttc acg gct 336Trp Val Ile Val Thr Ile Phe Gly Leu Leu Leu Tyr Leu Phe Thr Ala 100 105 110agt ctc agc tac gtg ttt gtg ttt gac aag tcg att ttc aac cat cct 384Ser Leu Ser Tyr Val Phe Val Phe Asp Lys Ser Ile Phe Asn His Pro 115 120 125cgt tac ttg aaa aac caa atg gca atg gaa atc aag ttg gca gtc agt 432Arg Tyr Leu Lys Asn Gln Met Ala Met Glu Ile Lys Leu Ala Val Ser 130 135 140gct atc cca tgg atg tcg atg ttg acc gtt cca tgg ttt gtt atg gaa 480Ala Ile Pro Trp Met Ser Met Leu Thr Val Pro Trp Phe Val Met Glu145 150 155 160ttg aac ggc cat tct aaa cta tac atg aag att gat tat gaa aac cac 528Leu Asn Gly His Ser Lys Leu Tyr Met Lys Ile Asp Tyr Glu Asn His 165 170 175ggt gta agg aag ctc att atc gag tac ttc act ttc atc ttt ttc act 576Gly Val Arg Lys Leu Ile Ile Glu Tyr Phe Thr Phe Ile Phe Phe Thr 180 185 190gat tgc ggt gtg tat tta gcg cac aga tgg ttg cat tgg cca agg gtc 624Asp Cys Gly Val Tyr Leu Ala His Arg Trp Leu His Trp Pro Arg Val 195 200 205tac cgt gct ctg cac aag cct cat cac aag tgg ctg gtc tgc aca cct 672Tyr Arg Ala Leu His Lys Pro His His Lys Trp Leu Val Cys Thr Pro 210 215 220ttc gca tct cat tct ttc cat cct gta gac ggg ttt ttg caa tcc atc 720Phe Ala Ser His Ser Phe His Pro Val Asp Gly Phe Leu Gln Ser Ile225 230 235 240tcg tac cac atc tac cca ttg att ctg cca tta cac aag gtt tct tat 768Ser Tyr His Ile Tyr Pro Leu Ile Leu Pro Leu His Lys Val Ser Tyr 245 250 255ttg att ctg ttc act ttt gtt aac ttt tgg act gtt atg att cat gac 816Leu Ile Leu Phe Thr Phe Val Asn Phe Trp Thr Val Met Ile His Asp 260 265 270ggt caa tac cta tca aac aat cct gcc gtc aac ggt act gcc tgc cac 864Gly Gln Tyr Leu Ser Asn Asn Pro Ala Val Asn Gly Thr Ala Cys His 275 280 285acg gtt cac cat cta tat ttc aac tac aac tac ggt caa ttc acc act 912Thr Val His His Leu Tyr Phe Asn Tyr Asn Tyr Gly Gln Phe Thr Thr 290 295 300ctg tgg gac aga cta ggg ggt tct tac cgt aga cca gat gac tca ttg 960Leu Trp Asp Arg Leu Gly Gly Ser Tyr Arg Arg Pro Asp Asp Ser Leu305 310 315 320ttt gat cct aag tta aga gat gct aag gag acc tgg gac gct caa gtt 1008Phe Asp Pro Lys Leu Arg Asp Ala Lys Glu Thr Trp Asp Ala Gln Val 325 330 335aag gaa gtt gaa cat ttc atc aag gag gtc gaa ggt gat gat aat gat 1056Lys Glu Val Glu His Phe Ile Lys Glu Val Glu Gly Asp Asp Asn Asp 340 345 350aga atc tat gaa aac gac cca aat acc aag aag aac aac tga 1098Arg Ile Tyr Glu Asn Asp Pro Asn Thr Lys Lys Asn Asn 355 360 36512365PRTSaccharomyces cerevisiae 12Met Asp Leu Val Leu Glu Val Ala Asp His Tyr Val Leu Asp Asp Leu1 5 10 15Tyr Ala Lys Val Leu Pro Ala Ser Leu Ala Ala Asn Ile Pro Val Lys 20 25 30Trp Gln Lys Leu Leu Gly Leu Asn Ser Gly Phe Ser Asn Ser Thr Ile 35 40 45Leu Gln Glu Thr Leu Asn Ser Lys Asn Ala Val Lys Glu Cys Arg Arg 50 55 60Phe Tyr Gly Gln Val Pro Phe Leu Phe Asp Met Ser Thr Thr Ser Phe65 70 75 80Ala Ser Leu Leu Pro Arg Ser Ser Ile Leu Arg Glu Phe Leu Ser Leu 85 90 95Trp Val Ile Val Thr Ile Phe Gly Leu Leu Leu Tyr Leu Phe Thr Ala 100 105 110Ser Leu Ser Tyr Val Phe Val Phe Asp Lys Ser Ile Phe Asn His Pro 115 120 125Arg Tyr Leu Lys Asn Gln Met Ala Met Glu Ile Lys Leu Ala Val Ser 130 135 140Ala Ile Pro Trp Met Ser Met Leu Thr Val Pro Trp Phe Val Met Glu145 150 155 160Leu Asn Gly His Ser Lys Leu Tyr Met Lys Ile Asp Tyr Glu Asn His 165 170 175Gly Val Arg Lys Leu Ile Ile Glu Tyr Phe Thr Phe Ile Phe Phe Thr 180 185 190Asp Cys Gly Val Tyr Leu Ala His Arg Trp Leu His Trp Pro Arg Val 195 200 205Tyr Arg Ala Leu His Lys Pro His His Lys Trp Leu Val Cys Thr Pro 210 215 220Phe Ala Ser His Ser Phe His Pro Val Asp Gly Phe Leu Gln Ser Ile225 230 235 240Ser Tyr His Ile Tyr Pro Leu Ile Leu Pro Leu His Lys Val Ser Tyr 245 250 255Leu Ile Leu Phe Thr Phe Val Asn Phe Trp Thr Val Met Ile His Asp 260 265 270Gly Gln Tyr Leu Ser Asn Asn Pro Ala Val Asn Gly Thr Ala Cys His 275 280 285Thr Val His His Leu Tyr Phe Asn Tyr Asn Tyr Gly Gln Phe Thr Thr 290 295 300Leu Trp Asp Arg Leu Gly Gly Ser Tyr Arg Arg Pro Asp Asp Ser Leu305 310 315 320Phe Asp Pro Lys Leu Arg Asp Ala Lys Glu Thr Trp Asp Ala Gln Val 325 330 335Lys Glu Val Glu His Phe Ile Lys Glu Val Glu Gly Asp Asp Asn Asp 340 345 350Arg Ile Tyr Glu Asn Asp Pro Asn Thr Lys Lys Asn Asn 355 360 365131557DNAMus musculusCDS(1)..(1557) 13atg gag ccc gcc gtg tcg ctg gcc gtg tgc gcg ctg ctc ttt ctg ctc 48Met Glu Pro Ala Val Ser Leu Ala Val Cys Ala Leu Leu Phe Leu Leu1 5 10 15tgg gtg cga gtg aag ggg ttg gag ttc gtt ctc atc cac cag cgc tgg 96Trp Val Arg Val Lys Gly Leu Glu Phe Val Leu Ile His Gln Arg Trp 20 25 30gtg ttc gtg tgc ctc ttc ttg ctg ccg ctc tcg ctc atc ttc gat atc 144Val Phe Val Cys Leu Phe Leu Leu Pro Leu Ser Leu Ile Phe Asp Ile 35 40 45tac tac tac gtg cgc gcc tgg gtg gtg ttc aag ctg agc agt gcg ccg 192Tyr Tyr Tyr Val Arg Ala Trp Val Val Phe Lys Leu Ser Ser Ala Pro 50 55 60cgc ctg cac gag cag cgc gtg cgg gac atc cag aaa cag gtc cgg gaa 240Arg Leu His Glu Gln Arg Val Arg Asp Ile Gln Lys Gln Val Arg Glu65 70 75 80tgg aag gaa cag ggc agt aag acc ttc atg tgc acg ggg cgc cca ggc 288Trp Lys Glu Gln Gly Ser Lys Thr Phe Met Cys Thr Gly Arg Pro Gly 85 90 95tgg ctc act gtc tcg ctg cga gtc gga aag tac aag aag acc cat aag 336Trp Leu Thr Val Ser Leu Arg Val Gly Lys Tyr Lys Lys Thr His Lys 100 105 110aac atc atg atc aac ctg atg gac atc ctg gag gtg gac acc aag aaa 384Asn Ile Met Ile Asn Leu Met Asp Ile Leu Glu Val Asp Thr Lys Lys 115 120 125cag att gtt cga gtg gag ccc ttg gtg tct atg ggt cag gtg aca gct 432Gln Ile Val Arg Val Glu Pro Leu Val Ser Met Gly Gln Val Thr Ala 130 135 140ttg ctg aac tcc att ggc tgg acc ctg cct gtg ttg cct gag ctt gat 480Leu Leu Asn Ser Ile Gly Trp Thr Leu Pro Val Leu Pro Glu Leu Asp145 150 155 160gac ctc aca gtg ggg ggc ctg atc atg ggc aca ggc atc gag tca tcg 528Asp Leu Thr Val Gly Gly Leu Ile Met Gly Thr Gly Ile Glu Ser Ser 165 170 175tcc cac aag tat ggc ctg ttc caa cac att tgc act gcc tac gag ctg 576Ser His Lys Tyr Gly Leu Phe Gln His Ile Cys Thr Ala Tyr Glu Leu 180 185 190atc ctg gca gac ggc agc ttt gtg cgc tgc aca ccg tct gaa aac tca 624Ile Leu Ala Asp Gly Ser Phe Val Arg Cys Thr Pro Ser Glu Asn Ser 195 200 205gac ctg ttc tat gcc gtg ccc tgg tcc tgt ggg acc ctg ggc ttc ctg 672Asp Leu Phe Tyr Ala Val Pro Trp Ser Cys Gly Thr Leu Gly Phe Leu 210 215 220gtg gct gcc gag atc cgg atc atc ccg gcc aag aag tat gtc aag ctg 720Val Ala Ala Glu Ile Arg Ile Ile Pro Ala Lys Lys Tyr Val Lys Leu225 230 235 240cgg ttt gag cct gtt cgg ggc ctg gag gcc atc tgt gaa aaa ttc acc 768Arg Phe Glu Pro Val Arg Gly Leu Glu Ala Ile Cys Glu Lys Phe Thr 245 250 255cgc gag tcc cag cgg ctg gag aac cac ttc gtg gaa ggg ttg ctg tac 816Arg Glu Ser Gln Arg Leu Glu Asn His Phe Val Glu Gly Leu Leu Tyr 260 265 270tcc ctg gat gag gct gtg gct gtc atc atg aca ggg gtc atg acg gac 864Ser Leu Asp Glu Ala Val Ala Val Ile Met Thr Gly Val Met Thr Asp 275 280 285gac gta gag tcc agc aag ctg aat agc att ggc agt tac tac aag ccc 912Asp Val Glu Ser Ser Lys Leu Asn Ser Ile Gly Ser Tyr Tyr Lys Pro 290 295 300tgg ttc ttc aag cat gtg gag aac tac ctg aag aca aac cgg gag ggc 960Trp Phe Phe Lys His Val Glu Asn Tyr Leu Lys Thr Asn Arg Glu Gly305 310 315 320ctc gaa tac att ccc ctg aga cac tac tac cac cga cac acg cgc agc 1008Leu Glu Tyr Ile Pro Leu Arg His Tyr Tyr His Arg His Thr Arg Ser 325 330 335atc ttc tgg gag ctc cag gac atc atc cct ttc ggc aac aac ccc atc 1056Ile Phe Trp Glu Leu Gln Asp Ile Ile Pro Phe Gly Asn Asn Pro Ile 340 345 350ttc cgc tac ctc ttc ggc tgg atg gtg cct ccc aag atc tcc ctc ctg 1104Phe Arg Tyr Leu Phe Gly Trp Met Val Pro Pro Lys Ile Ser Leu Leu

355 360 365aag ctg acc cag ggc gag acg cta cgc aag ctg tac gag cag cac cac 1152Lys Leu Thr Gln Gly Glu Thr Leu Arg Lys Leu Tyr Glu Gln His His 370 375 380gtg gtg cag gac atg ctg gtg ccc atg aag tgc atg tca cag gcc ctg 1200Val Val Gln Asp Met Leu Val Pro Met Lys Cys Met Ser Gln Ala Leu385 390 395 400cat acc ttc caa aat gac atc cac gtc tac ccc atc tgg ctg tgc cca 1248His Thr Phe Gln Asn Asp Ile His Val Tyr Pro Ile Trp Leu Cys Pro 405 410 415ttc atc ctg ccc agc cag cca gga cta gtg cat ccc aag gga gat gaa 1296Phe Ile Leu Pro Ser Gln Pro Gly Leu Val His Pro Lys Gly Asp Glu 420 425 430gca gag ctc tac gtg gac atc ggg gca tac ggg gag cca cgt gtg aag 1344Ala Glu Leu Tyr Val Asp Ile Gly Ala Tyr Gly Glu Pro Arg Val Lys 435 440 445cac ttc gag gcc agg tcc tgc atg agg cag ctg gag aag ttt gtg cgg 1392His Phe Glu Ala Arg Ser Cys Met Arg Gln Leu Glu Lys Phe Val Arg 450 455 460agt gtg cac ggg ttc caa atg tta tac gcc gat tgc tat atg aac cgc 1440Ser Val His Gly Phe Gln Met Leu Tyr Ala Asp Cys Tyr Met Asn Arg465 470 475 480gag gaa ttc tgg gag atg ttc gat ggc tcc ttg tac cac aag ctg cgc 1488Glu Glu Phe Trp Glu Met Phe Asp Gly Ser Leu Tyr His Lys Leu Arg 485 490 495aag cag ctg ggc tgc cag gac gcc ttc cct gag gtg tac gac aag atc 1536Lys Gln Leu Gly Cys Gln Asp Ala Phe Pro Glu Val Tyr Asp Lys Ile 500 505 510tgc aag gcg gca agg cac tga 1557Cys Lys Ala Ala Arg His 51514518PRTMus musculus 14Met Glu Pro Ala Val Ser Leu Ala Val Cys Ala Leu Leu Phe Leu Leu1 5 10 15Trp Val Arg Val Lys Gly Leu Glu Phe Val Leu Ile His Gln Arg Trp 20 25 30Val Phe Val Cys Leu Phe Leu Leu Pro Leu Ser Leu Ile Phe Asp Ile 35 40 45Tyr Tyr Tyr Val Arg Ala Trp Val Val Phe Lys Leu Ser Ser Ala Pro 50 55 60Arg Leu His Glu Gln Arg Val Arg Asp Ile Gln Lys Gln Val Arg Glu65 70 75 80Trp Lys Glu Gln Gly Ser Lys Thr Phe Met Cys Thr Gly Arg Pro Gly 85 90 95Trp Leu Thr Val Ser Leu Arg Val Gly Lys Tyr Lys Lys Thr His Lys 100 105 110Asn Ile Met Ile Asn Leu Met Asp Ile Leu Glu Val Asp Thr Lys Lys 115 120 125Gln Ile Val Arg Val Glu Pro Leu Val Ser Met Gly Gln Val Thr Ala 130 135 140Leu Leu Asn Ser Ile Gly Trp Thr Leu Pro Val Leu Pro Glu Leu Asp145 150 155 160Asp Leu Thr Val Gly Gly Leu Ile Met Gly Thr Gly Ile Glu Ser Ser 165 170 175Ser His Lys Tyr Gly Leu Phe Gln His Ile Cys Thr Ala Tyr Glu Leu 180 185 190Ile Leu Ala Asp Gly Ser Phe Val Arg Cys Thr Pro Ser Glu Asn Ser 195 200 205Asp Leu Phe Tyr Ala Val Pro Trp Ser Cys Gly Thr Leu Gly Phe Leu 210 215 220Val Ala Ala Glu Ile Arg Ile Ile Pro Ala Lys Lys Tyr Val Lys Leu225 230 235 240Arg Phe Glu Pro Val Arg Gly Leu Glu Ala Ile Cys Glu Lys Phe Thr 245 250 255Arg Glu Ser Gln Arg Leu Glu Asn His Phe Val Glu Gly Leu Leu Tyr 260 265 270Ser Leu Asp Glu Ala Val Ala Val Ile Met Thr Gly Val Met Thr Asp 275 280 285Asp Val Glu Ser Ser Lys Leu Asn Ser Ile Gly Ser Tyr Tyr Lys Pro 290 295 300Trp Phe Phe Lys His Val Glu Asn Tyr Leu Lys Thr Asn Arg Glu Gly305 310 315 320Leu Glu Tyr Ile Pro Leu Arg His Tyr Tyr His Arg His Thr Arg Ser 325 330 335Ile Phe Trp Glu Leu Gln Asp Ile Ile Pro Phe Gly Asn Asn Pro Ile 340 345 350Phe Arg Tyr Leu Phe Gly Trp Met Val Pro Pro Lys Ile Ser Leu Leu 355 360 365Lys Leu Thr Gln Gly Glu Thr Leu Arg Lys Leu Tyr Glu Gln His His 370 375 380Val Val Gln Asp Met Leu Val Pro Met Lys Cys Met Ser Gln Ala Leu385 390 395 400His Thr Phe Gln Asn Asp Ile His Val Tyr Pro Ile Trp Leu Cys Pro 405 410 415Phe Ile Leu Pro Ser Gln Pro Gly Leu Val His Pro Lys Gly Asp Glu 420 425 430Ala Glu Leu Tyr Val Asp Ile Gly Ala Tyr Gly Glu Pro Arg Val Lys 435 440 445His Phe Glu Ala Arg Ser Cys Met Arg Gln Leu Glu Lys Phe Val Arg 450 455 460Ser Val His Gly Phe Gln Met Leu Tyr Ala Asp Cys Tyr Met Asn Arg465 470 475 480Glu Glu Phe Trp Glu Met Phe Asp Gly Ser Leu Tyr His Lys Leu Arg 485 490 495Lys Gln Leu Gly Cys Gln Asp Ala Phe Pro Glu Val Tyr Asp Lys Ile 500 505 510Cys Lys Ala Ala Arg His 515151551DNAHomo sapiensCDS(1)..(1551) 15atg gag ccc gcc gtg tcg ctg gcc gtg tgc gcg ctg ctc ttc ctg ctg 48Met Glu Pro Ala Val Ser Leu Ala Val Cys Ala Leu Leu Phe Leu Leu1 5 10 15tgg gtg cgc ctg aag ggg ctg gag ttc gtg ctc atc cac cag cgc tgg 96Trp Val Arg Leu Lys Gly Leu Glu Phe Val Leu Ile His Gln Arg Trp 20 25 30gtg ttc gtg tgc ctc ttc ctc ctg ccg ctc tcg ctt atc ttc gat atc 144Val Phe Val Cys Leu Phe Leu Leu Pro Leu Ser Leu Ile Phe Asp Ile 35 40 45tac tac tac gtg cgc gcc tgg gtg gtg ttc aag ctc agc agc gct ccg 192Tyr Tyr Tyr Val Arg Ala Trp Val Val Phe Lys Leu Ser Ser Ala Pro 50 55 60cgc ctg cac gag cag cgc gtg cgg gac atc cag aag cag gtg cgg gaa 240Arg Leu His Glu Gln Arg Val Arg Asp Ile Gln Lys Gln Val Arg Glu65 70 75 80tgg aag gag cag ggt agc aag acc ttc atg tgc acg ggg cgc cct ggc 288Trp Lys Glu Gln Gly Ser Lys Thr Phe Met Cys Thr Gly Arg Pro Gly 85 90 95tgg ctc act gtc tca cta cgt gtc ggg aag tac aag aag aca cac aaa 336Trp Leu Thr Val Ser Leu Arg Val Gly Lys Tyr Lys Lys Thr His Lys 100 105 110aac atc atg atc aac ctg atg gac att ctg gaa gtg gac acc aag aaa 384Asn Ile Met Ile Asn Leu Met Asp Ile Leu Glu Val Asp Thr Lys Lys 115 120 125cag att gtc cgt gtg gag ccc ttg gtg acc atg ggc cag gtg act gcc 432Gln Ile Val Arg Val Glu Pro Leu Val Thr Met Gly Gln Val Thr Ala 130 135 140ctg ctg acc tcc att ggc tgg act ctc ccc gtg ttg cct gag ctt gat 480Leu Leu Thr Ser Ile Gly Trp Thr Leu Pro Val Leu Pro Glu Leu Asp145 150 155 160gac ctc aca gtg ggg ggc ttg atc atg ggc aca ggc atc gag tca tca 528Asp Leu Thr Val Gly Gly Leu Ile Met Gly Thr Gly Ile Glu Ser Ser 165 170 175tcc cac aag tac ggc ctg ttc caa cac atc tgc act gct tac gag ctg 576Ser His Lys Tyr Gly Leu Phe Gln His Ile Cys Thr Ala Tyr Glu Leu 180 185 190gtc ctg gct gat ggc agc ttt gtg cga tgc act ccg tcc gaa aac tca 624Val Leu Ala Asp Gly Ser Phe Val Arg Cys Thr Pro Ser Glu Asn Ser 195 200 205gac ctg ttc tat gcc gta ccc tgg tcc tgt ggg acg ctg ggt ttc ctg 672Asp Leu Phe Tyr Ala Val Pro Trp Ser Cys Gly Thr Leu Gly Phe Leu 210 215 220gtg gcc gct gag atc cgc atc atc cct gcc aag aag tac gtc aag ctg 720Val Ala Ala Glu Ile Arg Ile Ile Pro Ala Lys Lys Tyr Val Lys Leu225 230 235 240cgt ttc gag cca gtg cgg ggc ctg gag gct atc tgt gcc aag ttc acc 768Arg Phe Glu Pro Val Arg Gly Leu Glu Ala Ile Cys Ala Lys Phe Thr 245 250 255cac gag tcc cag cgg cag gag aac cac ttc gtg gaa ggg ctg ctc tac 816His Glu Ser Gln Arg Gln Glu Asn His Phe Val Glu Gly Leu Leu Tyr 260 265 270tcc ctg gat gag gct gtc att atg aca ggg gtc atg aca gat gag gca 864Ser Leu Asp Glu Ala Val Ile Met Thr Gly Val Met Thr Asp Glu Ala 275 280 285gag ccc agc aag ctg aat agc att ggc aat tac tac aag ccg tgg ttc 912Glu Pro Ser Lys Leu Asn Ser Ile Gly Asn Tyr Tyr Lys Pro Trp Phe 290 295 300ttt aag cat gtg gag aac tat ctg aag aca aac cga gag ggc ctg gag 960Phe Lys His Val Glu Asn Tyr Leu Lys Thr Asn Arg Glu Gly Leu Glu305 310 315 320tac att ccc ttg aga cac tac tac cac cgc cac acg cgc agc atc ttc 1008Tyr Ile Pro Leu Arg His Tyr Tyr His Arg His Thr Arg Ser Ile Phe 325 330 335tgg gag ctc cag gac atc atc ccc ttt ggc aac aac ccc atc ttc cgc 1056Trp Glu Leu Gln Asp Ile Ile Pro Phe Gly Asn Asn Pro Ile Phe Arg 340 345 350tac ctc ttt ggc tgg atg gtg cct ccc aag atc tcc ctc ctg aag ctg 1104Tyr Leu Phe Gly Trp Met Val Pro Pro Lys Ile Ser Leu Leu Lys Leu 355 360 365acc cag ggt gag acc ctg cgc aag ctg tac gag cag cac cac gtg gtg 1152Thr Gln Gly Glu Thr Leu Arg Lys Leu Tyr Glu Gln His His Val Val 370 375 380cag gac atg ctg gtg ccc atg aag tgc ctg cag cag gcc ctg cac acc 1200Gln Asp Met Leu Val Pro Met Lys Cys Leu Gln Gln Ala Leu His Thr385 390 395 400ttc caa aac gac atc cac gtc tac ccc atc tgg ctg tgt ccg ttc atc 1248Phe Gln Asn Asp Ile His Val Tyr Pro Ile Trp Leu Cys Pro Phe Ile 405 410 415ctg ccc agc cag cca ggc cta gtg cac ccc aaa gga aat gag gca gag 1296Leu Pro Ser Gln Pro Gly Leu Val His Pro Lys Gly Asn Glu Ala Glu 420 425 430ctc tac atc gac att gga gca tat ggg gag ccg cgt gtg aaa cac ttt 1344Leu Tyr Ile Asp Ile Gly Ala Tyr Gly Glu Pro Arg Val Lys His Phe 435 440 445gaa gcc agg tcc tgc atg agg cag ctg gag aag ttt gtc cgc agc gtg 1392Glu Ala Arg Ser Cys Met Arg Gln Leu Glu Lys Phe Val Arg Ser Val 450 455 460cat ggc ttc cag atg ctg tat gcc gac tgc tac atg aac cgg gag gag 1440His Gly Phe Gln Met Leu Tyr Ala Asp Cys Tyr Met Asn Arg Glu Glu465 470 475 480ttc tgg gag atg ttt gat ggc tcc ttg tac cac aag ctg cga gag aag 1488Phe Trp Glu Met Phe Asp Gly Ser Leu Tyr His Lys Leu Arg Glu Lys 485 490 495ctg ggt tgc cag gac gcc ttc ccc gag gtg tac gac aag atc tgc aag 1536Leu Gly Cys Gln Asp Ala Phe Pro Glu Val Tyr Asp Lys Ile Cys Lys 500 505 510gcc gcc agg cac tga 1551Ala Ala Arg His 51516516PRTHomo sapiens 16Met Glu Pro Ala Val Ser Leu Ala Val Cys Ala Leu Leu Phe Leu Leu1 5 10 15Trp Val Arg Leu Lys Gly Leu Glu Phe Val Leu Ile His Gln Arg Trp 20 25 30Val Phe Val Cys Leu Phe Leu Leu Pro Leu Ser Leu Ile Phe Asp Ile 35 40 45Tyr Tyr Tyr Val Arg Ala Trp Val Val Phe Lys Leu Ser Ser Ala Pro 50 55 60Arg Leu His Glu Gln Arg Val Arg Asp Ile Gln Lys Gln Val Arg Glu65 70 75 80Trp Lys Glu Gln Gly Ser Lys Thr Phe Met Cys Thr Gly Arg Pro Gly 85 90 95Trp Leu Thr Val Ser Leu Arg Val Gly Lys Tyr Lys Lys Thr His Lys 100 105 110Asn Ile Met Ile Asn Leu Met Asp Ile Leu Glu Val Asp Thr Lys Lys 115 120 125Gln Ile Val Arg Val Glu Pro Leu Val Thr Met Gly Gln Val Thr Ala 130 135 140Leu Leu Thr Ser Ile Gly Trp Thr Leu Pro Val Leu Pro Glu Leu Asp145 150 155 160Asp Leu Thr Val Gly Gly Leu Ile Met Gly Thr Gly Ile Glu Ser Ser 165 170 175Ser His Lys Tyr Gly Leu Phe Gln His Ile Cys Thr Ala Tyr Glu Leu 180 185 190Val Leu Ala Asp Gly Ser Phe Val Arg Cys Thr Pro Ser Glu Asn Ser 195 200 205Asp Leu Phe Tyr Ala Val Pro Trp Ser Cys Gly Thr Leu Gly Phe Leu 210 215 220Val Ala Ala Glu Ile Arg Ile Ile Pro Ala Lys Lys Tyr Val Lys Leu225 230 235 240Arg Phe Glu Pro Val Arg Gly Leu Glu Ala Ile Cys Ala Lys Phe Thr 245 250 255His Glu Ser Gln Arg Gln Glu Asn His Phe Val Glu Gly Leu Leu Tyr 260 265 270Ser Leu Asp Glu Ala Val Ile Met Thr Gly Val Met Thr Asp Glu Ala 275 280 285Glu Pro Ser Lys Leu Asn Ser Ile Gly Asn Tyr Tyr Lys Pro Trp Phe 290 295 300Phe Lys His Val Glu Asn Tyr Leu Lys Thr Asn Arg Glu Gly Leu Glu305 310 315 320Tyr Ile Pro Leu Arg His Tyr Tyr His Arg His Thr Arg Ser Ile Phe 325 330 335Trp Glu Leu Gln Asp Ile Ile Pro Phe Gly Asn Asn Pro Ile Phe Arg 340 345 350Tyr Leu Phe Gly Trp Met Val Pro Pro Lys Ile Ser Leu Leu Lys Leu 355 360 365Thr Gln Gly Glu Thr Leu Arg Lys Leu Tyr Glu Gln His His Val Val 370 375 380Gln Asp Met Leu Val Pro Met Lys Cys Leu Gln Gln Ala Leu His Thr385 390 395 400Phe Gln Asn Asp Ile His Val Tyr Pro Ile Trp Leu Cys Pro Phe Ile 405 410 415Leu Pro Ser Gln Pro Gly Leu Val His Pro Lys Gly Asn Glu Ala Glu 420 425 430Leu Tyr Ile Asp Ile Gly Ala Tyr Gly Glu Pro Arg Val Lys His Phe 435 440 445Glu Ala Arg Ser Cys Met Arg Gln Leu Glu Lys Phe Val Arg Ser Val 450 455 460His Gly Phe Gln Met Leu Tyr Ala Asp Cys Tyr Met Asn Arg Glu Glu465 470 475 480Phe Trp Glu Met Phe Asp Gly Ser Leu Tyr His Lys Leu Arg Glu Lys 485 490 495Leu Gly Cys Gln Asp Ala Phe Pro Glu Val Tyr Asp Lys Ile Cys Lys 500 505 510Ala Ala Arg His 515171422DNASaccharomyces cerevisiaeCDS(1)..(1422) 17atg gca aag gat aat agt gag aag ctg cag gtg cag gga gag gag aaa 48Met Ala Lys Asp Asn Ser Glu Lys Leu Gln Val Gln Gly Glu Glu Lys1 5 10 15aag tcc aag caa ccg gtt aat ttc ctg cct cag ggt aaa tgg ctg aag 96Lys Ser Lys Gln Pro Val Asn Phe Leu Pro Gln Gly Lys Trp Leu Lys 20 25 30cca aat gaa atc gaa tat gag ttt ggt ggg act act ggt gtt att ggt 144Pro Asn Glu Ile Glu Tyr Glu Phe Gly Gly Thr Thr Gly Val Ile Gly 35 40 45atg ctg atc ggg ttt cca ctg cta atg tac tat atg tgg att tgt gcg 192Met Leu Ile Gly Phe Pro Leu Leu Met Tyr Tyr Met Trp Ile Cys Ala 50 55 60gaa ttt tat cac ggt aag gtt gcc cta ccc aag gct ggt gaa tcg tgg 240Glu Phe Tyr His Gly Lys Val Ala Leu Pro Lys Ala Gly Glu Ser Trp65 70 75 80atg cac ttt atc aag cac cta tac cag tta gtc ttg gag aac ggt atc 288Met His Phe Ile Lys His Leu Tyr Gln Leu Val Leu Glu Asn Gly Ile 85 90 95cca gaa aag tat gac tgg act att ttc tta aca ttt tgg gtg ttt cag 336Pro Glu Lys Tyr Asp Trp Thr Ile Phe Leu Thr Phe Trp Val Phe Gln 100 105 110atc att ttc tac tat acg ttg ccc ggg att tgg aca aaa ggt caa cca 384Ile Ile Phe Tyr Tyr Thr Leu Pro Gly Ile Trp Thr Lys Gly Gln Pro 115 120 125ttg tct cat ttg aag gga aaa caa ttg cct tac ttt tgt aat gcc atg 432Leu Ser His Leu Lys Gly Lys Gln Leu Pro Tyr Phe Cys Asn Ala Met 130 135 140tgg acc ttg tat gta act acc act ttg gtc ttg gtt ttg cac ttt acc 480Trp Thr Leu Tyr Val Thr Thr Thr Leu Val Leu Val Leu His Phe Thr145 150 155 160aat ctt ttt aga ttg tat gtc att att gac cgt ttt ggg agg atc atg 528Asn Leu Phe Arg Leu Tyr Val Ile Ile Asp Arg Phe Gly Arg Ile Met 165 170 175aca tgt gcc att att tca ggg ttt gcc ttc tcc atc ata ttg tac tta 576Thr Cys Ala Ile Ile Ser Gly Phe Ala Phe Ser Ile Ile Leu Tyr Leu 180 185 190tgg act tta ttt atc tca cat gac tat cat aga atg aca gga aac cat 624Trp Thr Leu Phe Ile Ser His Asp Tyr His Arg Met Thr Gly Asn His 195 200 205cta tat gat ttc ttc atg gga

gct cca cta aac cct agg tgg ggg att 672Leu Tyr Asp Phe Phe Met Gly Ala Pro Leu Asn Pro Arg Trp Gly Ile 210 215 220ttg gac ttg aag atg ttt ttc gag gtt aga tta cct tgg ttc acc ctt 720Leu Asp Leu Lys Met Phe Phe Glu Val Arg Leu Pro Trp Phe Thr Leu225 230 235 240tac ttt atc act ttg ggt gcc tgt ttg aag cag tgg gag act tac ggc 768Tyr Phe Ile Thr Leu Gly Ala Cys Leu Lys Gln Trp Glu Thr Tyr Gly 245 250 255tat gtg aca cca caa ttg ggg gtt gtc atg tta gct cat tgg ttg tac 816Tyr Val Thr Pro Gln Leu Gly Val Val Met Leu Ala His Trp Leu Tyr 260 265 270gcg aac gca tgt gct aaa ggt gaa gaa ttg att gtt cca acc tgg gac 864Ala Asn Ala Cys Ala Lys Gly Glu Glu Leu Ile Val Pro Thr Trp Asp 275 280 285atg gct tac gaa aag ttt gga ttt atg ctg atc ttc tgg aat att gcc 912Met Ala Tyr Glu Lys Phe Gly Phe Met Leu Ile Phe Trp Asn Ile Ala 290 295 300ggt gtc cca tac act tac tgt cat tgt acg ttg tat ttg tac tac cat 960Gly Val Pro Tyr Thr Tyr Cys His Cys Thr Leu Tyr Leu Tyr Tyr His305 310 315 320gac cca tct gaa tat cac tgg tct aca ctg tac aat gtt tcg ctg tac 1008Asp Pro Ser Glu Tyr His Trp Ser Thr Leu Tyr Asn Val Ser Leu Tyr 325 330 335gtt gtt cta tta tgc gcc tac tac ttc ttt gac acg gca aat gct cag 1056Val Val Leu Leu Cys Ala Tyr Tyr Phe Phe Asp Thr Ala Asn Ala Gln 340 345 350aaa aat gcc ttc aga aag caa atg tct ggt gac aag aca ggt agg aag 1104Lys Asn Ala Phe Arg Lys Gln Met Ser Gly Asp Lys Thr Gly Arg Lys 355 360 365act ttc cca ttt ttg cca tac caa att ttg aag aat cca aag tat atg 1152Thr Phe Pro Phe Leu Pro Tyr Gln Ile Leu Lys Asn Pro Lys Tyr Met 370 375 380gtt acc tcc aat gga tcg tac cta ttg att gat ggt tgg tac act ttg 1200Val Thr Ser Asn Gly Ser Tyr Leu Leu Ile Asp Gly Trp Tyr Thr Leu385 390 395 400gct aga aaa att cac tac act gcc gat tgg act caa tct ctc gtt tgg 1248Ala Arg Lys Ile His Tyr Thr Ala Asp Trp Thr Gln Ser Leu Val Trp 405 410 415gcc ttg tct tgc ggg ttc aac tcg gtg ttc cca tgg ttt ttc cca gta 1296Ala Leu Ser Cys Gly Phe Asn Ser Val Phe Pro Trp Phe Phe Pro Val 420 425 430ttc ttc ctt gtt gtc ctg att cac aga gcc ttc aga gac caa gca aaa 1344Phe Phe Leu Val Val Leu Ile His Arg Ala Phe Arg Asp Gln Ala Lys 435 440 445tgt aag aga aag tac gga aaa gat tgg gat gag tat tgt aaa cat tgc 1392Cys Lys Arg Lys Tyr Gly Lys Asp Trp Asp Glu Tyr Cys Lys His Cys 450 455 460cct tac gtc ttt att cct tat gtt ttc tag 1422Pro Tyr Val Phe Ile Pro Tyr Val Phe465 47018473PRTSaccharomyces cerevisiae 18Met Ala Lys Asp Asn Ser Glu Lys Leu Gln Val Gln Gly Glu Glu Lys1 5 10 15Lys Ser Lys Gln Pro Val Asn Phe Leu Pro Gln Gly Lys Trp Leu Lys 20 25 30Pro Asn Glu Ile Glu Tyr Glu Phe Gly Gly Thr Thr Gly Val Ile Gly 35 40 45Met Leu Ile Gly Phe Pro Leu Leu Met Tyr Tyr Met Trp Ile Cys Ala 50 55 60Glu Phe Tyr His Gly Lys Val Ala Leu Pro Lys Ala Gly Glu Ser Trp65 70 75 80Met His Phe Ile Lys His Leu Tyr Gln Leu Val Leu Glu Asn Gly Ile 85 90 95Pro Glu Lys Tyr Asp Trp Thr Ile Phe Leu Thr Phe Trp Val Phe Gln 100 105 110Ile Ile Phe Tyr Tyr Thr Leu Pro Gly Ile Trp Thr Lys Gly Gln Pro 115 120 125Leu Ser His Leu Lys Gly Lys Gln Leu Pro Tyr Phe Cys Asn Ala Met 130 135 140Trp Thr Leu Tyr Val Thr Thr Thr Leu Val Leu Val Leu His Phe Thr145 150 155 160Asn Leu Phe Arg Leu Tyr Val Ile Ile Asp Arg Phe Gly Arg Ile Met 165 170 175Thr Cys Ala Ile Ile Ser Gly Phe Ala Phe Ser Ile Ile Leu Tyr Leu 180 185 190Trp Thr Leu Phe Ile Ser His Asp Tyr His Arg Met Thr Gly Asn His 195 200 205Leu Tyr Asp Phe Phe Met Gly Ala Pro Leu Asn Pro Arg Trp Gly Ile 210 215 220Leu Asp Leu Lys Met Phe Phe Glu Val Arg Leu Pro Trp Phe Thr Leu225 230 235 240Tyr Phe Ile Thr Leu Gly Ala Cys Leu Lys Gln Trp Glu Thr Tyr Gly 245 250 255Tyr Val Thr Pro Gln Leu Gly Val Val Met Leu Ala His Trp Leu Tyr 260 265 270Ala Asn Ala Cys Ala Lys Gly Glu Glu Leu Ile Val Pro Thr Trp Asp 275 280 285Met Ala Tyr Glu Lys Phe Gly Phe Met Leu Ile Phe Trp Asn Ile Ala 290 295 300Gly Val Pro Tyr Thr Tyr Cys His Cys Thr Leu Tyr Leu Tyr Tyr His305 310 315 320Asp Pro Ser Glu Tyr His Trp Ser Thr Leu Tyr Asn Val Ser Leu Tyr 325 330 335Val Val Leu Leu Cys Ala Tyr Tyr Phe Phe Asp Thr Ala Asn Ala Gln 340 345 350Lys Asn Ala Phe Arg Lys Gln Met Ser Gly Asp Lys Thr Gly Arg Lys 355 360 365Thr Phe Pro Phe Leu Pro Tyr Gln Ile Leu Lys Asn Pro Lys Tyr Met 370 375 380Val Thr Ser Asn Gly Ser Tyr Leu Leu Ile Asp Gly Trp Tyr Thr Leu385 390 395 400Ala Arg Lys Ile His Tyr Thr Ala Asp Trp Thr Gln Ser Leu Val Trp 405 410 415Ala Leu Ser Cys Gly Phe Asn Ser Val Phe Pro Trp Phe Phe Pro Val 420 425 430Phe Phe Leu Val Val Leu Ile His Arg Ala Phe Arg Asp Gln Ala Lys 435 440 445Cys Lys Arg Lys Tyr Gly Lys Asp Trp Asp Glu Tyr Cys Lys His Cys 450 455 460Pro Tyr Val Phe Ile Pro Tyr Val Phe465 470191152DNASaccharomyces cerevisiaeCDS(1)..(1152) 19atg agt gaa aca gaa ttg aga aaa aga cag gcc caa ttc act agg gag 48Met Ser Glu Thr Glu Leu Arg Lys Arg Gln Ala Gln Phe Thr Arg Glu1 5 10 15tta cat ggt gat gat att ggt aaa aag aca ggt ttg agt gca ttg atg 96Leu His Gly Asp Asp Ile Gly Lys Lys Thr Gly Leu Ser Ala Leu Met 20 25 30tcg aag aac aac tct gcc caa aag gaa gcc gtt cag aag tac ttg aga 144Ser Lys Asn Asn Ser Ala Gln Lys Glu Ala Val Gln Lys Tyr Leu Arg 35 40 45aat tgg gat ggt aga acc gat aaa gat gcc gaa gaa cgt cgt ctt gag 192Asn Trp Asp Gly Arg Thr Asp Lys Asp Ala Glu Glu Arg Arg Leu Glu 50 55 60gat tat aat gaa gcc aca cat tcc tac tat aac gtc gtt aca gat ttc 240Asp Tyr Asn Glu Ala Thr His Ser Tyr Tyr Asn Val Val Thr Asp Phe65 70 75 80tat gaa tat ggt tgg ggt tcc tct ttc cat ttc agc aga ttt tat aaa 288Tyr Glu Tyr Gly Trp Gly Ser Ser Phe His Phe Ser Arg Phe Tyr Lys 85 90 95ggt gag agt ttc gct gcc tcg ata gca aga cat gaa cat tat tta gct 336Gly Glu Ser Phe Ala Ala Ser Ile Ala Arg His Glu His Tyr Leu Ala 100 105 110tac aag gct ggt att caa aga ggc gat tta gtt ctc gac gtt ggt tgt 384Tyr Lys Ala Gly Ile Gln Arg Gly Asp Leu Val Leu Asp Val Gly Cys 115 120 125ggt gtt ggg ggc cca gca aga gag att gca aga ttt acc ggt tgt aac 432Gly Val Gly Gly Pro Ala Arg Glu Ile Ala Arg Phe Thr Gly Cys Asn 130 135 140gtc atc ggt cta aac aat aac gat tac caa att gcc aag gca aaa tat 480Val Ile Gly Leu Asn Asn Asn Asp Tyr Gln Ile Ala Lys Ala Lys Tyr145 150 155 160tac gct aaa aaa tac aat ttg agt gac caa atg gac ttt gta aag ggt 528Tyr Ala Lys Lys Tyr Asn Leu Ser Asp Gln Met Asp Phe Val Lys Gly 165 170 175gat ttc atg aaa atg gat ttc gaa gaa aac act ttc gac aaa gtt tat 576Asp Phe Met Lys Met Asp Phe Glu Glu Asn Thr Phe Asp Lys Val Tyr 180 185 190gca att gag gcc aca tgt cac gct cca aaa tta gaa ggt gta tac agc 624Ala Ile Glu Ala Thr Cys His Ala Pro Lys Leu Glu Gly Val Tyr Ser 195 200 205gaa atc tac aag gtt ttg aaa ccg ggt ggt acc ttt gct gtt tac gaa 672Glu Ile Tyr Lys Val Leu Lys Pro Gly Gly Thr Phe Ala Val Tyr Glu 210 215 220tgg gta atg act gat aaa tat gac gaa aac aat cct gaa cat aga aag 720Trp Val Met Thr Asp Lys Tyr Asp Glu Asn Asn Pro Glu His Arg Lys225 230 235 240atc gct tat gaa att gaa cta ggt gat ggt atc cca aag atg ttc cat 768Ile Ala Tyr Glu Ile Glu Leu Gly Asp Gly Ile Pro Lys Met Phe His 245 250 255gtc gac gtg gct agg aaa gca ttg aag aac tgt ggt ttc gaa gtc ctc 816Val Asp Val Ala Arg Lys Ala Leu Lys Asn Cys Gly Phe Glu Val Leu 260 265 270gtt agc gaa gac ctg gcg gac aat gat gat gaa atc cct tgg tat tac 864Val Ser Glu Asp Leu Ala Asp Asn Asp Asp Glu Ile Pro Trp Tyr Tyr 275 280 285cca tta act ggt gag tgg aag tac gtt caa aac tta gct aat ttg gcc 912Pro Leu Thr Gly Glu Trp Lys Tyr Val Gln Asn Leu Ala Asn Leu Ala 290 295 300aca ttt ttc aga act tct tac ttg ggt aga caa ttt act aca gca atg 960Thr Phe Phe Arg Thr Ser Tyr Leu Gly Arg Gln Phe Thr Thr Ala Met305 310 315 320gtt act gta atg gaa aaa tta ggt cta gcc cca gaa ggt tcc aag gaa 1008Val Thr Val Met Glu Lys Leu Gly Leu Ala Pro Glu Gly Ser Lys Glu 325 330 335gtt act gct gct cta gaa aat gct gcg gtt ggt tta gtt gcc ggt ggt 1056Val Thr Ala Ala Leu Glu Asn Ala Ala Val Gly Leu Val Ala Gly Gly 340 345 350aag tcc aag tta ttc act cca atg atg ctt ttc gtc gct agg aag cca 1104Lys Ser Lys Leu Phe Thr Pro Met Met Leu Phe Val Ala Arg Lys Pro 355 360 365gaa aac gcc gaa acc ccc tcc caa act tcc caa gaa gca act caa taa 1152Glu Asn Ala Glu Thr Pro Ser Gln Thr Ser Gln Glu Ala Thr Gln 370 375 38020383PRTSaccharomyces cerevisiae 20Met Ser Glu Thr Glu Leu Arg Lys Arg Gln Ala Gln Phe Thr Arg Glu1 5 10 15Leu His Gly Asp Asp Ile Gly Lys Lys Thr Gly Leu Ser Ala Leu Met 20 25 30Ser Lys Asn Asn Ser Ala Gln Lys Glu Ala Val Gln Lys Tyr Leu Arg 35 40 45Asn Trp Asp Gly Arg Thr Asp Lys Asp Ala Glu Glu Arg Arg Leu Glu 50 55 60Asp Tyr Asn Glu Ala Thr His Ser Tyr Tyr Asn Val Val Thr Asp Phe65 70 75 80Tyr Glu Tyr Gly Trp Gly Ser Ser Phe His Phe Ser Arg Phe Tyr Lys 85 90 95Gly Glu Ser Phe Ala Ala Ser Ile Ala Arg His Glu His Tyr Leu Ala 100 105 110Tyr Lys Ala Gly Ile Gln Arg Gly Asp Leu Val Leu Asp Val Gly Cys 115 120 125Gly Val Gly Gly Pro Ala Arg Glu Ile Ala Arg Phe Thr Gly Cys Asn 130 135 140Val Ile Gly Leu Asn Asn Asn Asp Tyr Gln Ile Ala Lys Ala Lys Tyr145 150 155 160Tyr Ala Lys Lys Tyr Asn Leu Ser Asp Gln Met Asp Phe Val Lys Gly 165 170 175Asp Phe Met Lys Met Asp Phe Glu Glu Asn Thr Phe Asp Lys Val Tyr 180 185 190Ala Ile Glu Ala Thr Cys His Ala Pro Lys Leu Glu Gly Val Tyr Ser 195 200 205Glu Ile Tyr Lys Val Leu Lys Pro Gly Gly Thr Phe Ala Val Tyr Glu 210 215 220Trp Val Met Thr Asp Lys Tyr Asp Glu Asn Asn Pro Glu His Arg Lys225 230 235 240Ile Ala Tyr Glu Ile Glu Leu Gly Asp Gly Ile Pro Lys Met Phe His 245 250 255Val Asp Val Ala Arg Lys Ala Leu Lys Asn Cys Gly Phe Glu Val Leu 260 265 270Val Ser Glu Asp Leu Ala Asp Asn Asp Asp Glu Ile Pro Trp Tyr Tyr 275 280 285Pro Leu Thr Gly Glu Trp Lys Tyr Val Gln Asn Leu Ala Asn Leu Ala 290 295 300Thr Phe Phe Arg Thr Ser Tyr Leu Gly Arg Gln Phe Thr Thr Ala Met305 310 315 320Val Thr Val Met Glu Lys Leu Gly Leu Ala Pro Glu Gly Ser Lys Glu 325 330 335Val Thr Ala Ala Leu Glu Asn Ala Ala Val Gly Leu Val Ala Gly Gly 340 345 350Lys Ser Lys Leu Phe Thr Pro Met Met Leu Phe Val Ala Arg Lys Pro 355 360 365Glu Asn Ala Glu Thr Pro Ser Gln Thr Ser Gln Glu Ala Thr Gln 370 375 380211617DNASaccharomyces cerevisiaeCDS(1)..(1617) 21atg agt tct gtc gca gaa aat ata ata caa cat gcc act cat aat tct 48Met Ser Ser Val Ala Glu Asn Ile Ile Gln His Ala Thr His Asn Ser1 5 10 15acg cta cac caa ttg gct aaa gac cag ccc tct gta ggc gtc act act 96Thr Leu His Gln Leu Ala Lys Asp Gln Pro Ser Val Gly Val Thr Thr 20 25 30gcc ttc agt atc ctg gat aca ctt aag tct atg tca tat ttg aaa ata 144Ala Phe Ser Ile Leu Asp Thr Leu Lys Ser Met Ser Tyr Leu Lys Ile 35 40 45ttt gct act tta atc tgt att ctt ttg gtt tgg gac caa gtt gca tat 192Phe Ala Thr Leu Ile Cys Ile Leu Leu Val Trp Asp Gln Val Ala Tyr 50 55 60caa atc aag aaa ggt tcc atc gca ggt cca aag ttt aag ttc tgg ccc 240Gln Ile Lys Lys Gly Ser Ile Ala Gly Pro Lys Phe Lys Phe Trp Pro65 70 75 80atc atc ggt cca ttt ttg gaa tcc tta gat cca aag ttt gaa gaa tat 288Ile Ile Gly Pro Phe Leu Glu Ser Leu Asp Pro Lys Phe Glu Glu Tyr 85 90 95aag gct aag tgg gca tcc ggt cca ctt tca tgt gtt tct att ttc cat 336Lys Ala Lys Trp Ala Ser Gly Pro Leu Ser Cys Val Ser Ile Phe His 100 105 110aaa ttt gtt gtt atc gca tct act aga gac ttg gca aga aag atc ttg 384Lys Phe Val Val Ile Ala Ser Thr Arg Asp Leu Ala Arg Lys Ile Leu 115 120 125caa tct tcc aaa ttc gtc aaa cct tgc gtt gtc gat gtt gct gtg aag 432Gln Ser Ser Lys Phe Val Lys Pro Cys Val Val Asp Val Ala Val Lys 130 135 140atc tta aga cct tgc aat tgg gtt ttt ttg gac ggt aaa gct cat act 480Ile Leu Arg Pro Cys Asn Trp Val Phe Leu Asp Gly Lys Ala His Thr145 150 155 160gat tac aga aaa tca tta aac ggt ctt ttc act aaa caa gct ttg gct 528Asp Tyr Arg Lys Ser Leu Asn Gly Leu Phe Thr Lys Gln Ala Leu Ala 165 170 175caa tac tta cct tca ttg gaa caa atc atg gat aag tac atg gat aag 576Gln Tyr Leu Pro Ser Leu Glu Gln Ile Met Asp Lys Tyr Met Asp Lys 180 185 190ttt gtt cgt tta tct aag gag aat aac tac gag ccc cag gtc ttt ttc 624Phe Val Arg Leu Ser Lys Glu Asn Asn Tyr Glu Pro Gln Val Phe Phe 195 200 205cat gaa atg aga gaa att ctt tgc gcc tta tca ttg aac tct ttc tgt 672His Glu Met Arg Glu Ile Leu Cys Ala Leu Ser Leu Asn Ser Phe Cys 210 215 220ggt aac tat att acc gaa gat caa gtc aga aag att gct gat gat tac 720Gly Asn Tyr Ile Thr Glu Asp Gln Val Arg Lys Ile Ala Asp Asp Tyr225 230 235 240tat ttg gtt aca gca gca ttg gaa tta gtc aac ttc cca att att atc 768Tyr Leu Val Thr Ala Ala Leu Glu Leu Val Asn Phe Pro Ile Ile Ile 245 250 255cct tac act aaa aca tgg tat ggt aag aaa act gca gac atg gcc atg 816Pro Tyr Thr Lys Thr Trp Tyr Gly Lys Lys Thr Ala Asp Met Ala Met 260 265 270aag att ttc gaa aac tgt gct caa atg gct aag gat cat att gct gca 864Lys Ile Phe Glu Asn Cys Ala Gln Met Ala Lys Asp His Ile Ala Ala 275 280 285ggt ggt aag cca gtt tgt gtt atg gat gct tgg tgt aag ttg atg cac 912Gly Gly Lys Pro Val Cys Val Met Asp Ala Trp Cys Lys Leu Met His 290 295 300gat gca aag aat agt aac gat gat gat tct aga atc tac cac aga gag 960Asp Ala Lys Asn Ser Asn Asp Asp Asp Ser Arg Ile Tyr His Arg Glu305 310 315 320ttt act aac aag gaa atc tcc gaa gct gtt ttc act ttc tta ttt gct 1008Phe Thr Asn Lys Glu Ile Ser Glu Ala Val Phe Thr Phe Leu Phe Ala 325 330 335tct caa gat gcc tct tct tct tta gct tgt tgg ttg ttc caa att gtt 1056Ser Gln Asp Ala Ser Ser Ser Leu Ala Cys Trp Leu Phe Gln Ile Val 340

345 350gct gac cgt cca gat gtc tta gct aag atc aga gaa gaa caa ttg gct 1104Ala Asp Arg Pro Asp Val Leu Ala Lys Ile Arg Glu Glu Gln Leu Ala 355 360 365gtt cgt aac aat gac atg tct acc gaa ttg aac ttg gat ttg att gag 1152Val Arg Asn Asn Asp Met Ser Thr Glu Leu Asn Leu Asp Leu Ile Glu 370 375 380aaa atg aag tac acc aat atg gtc ata aaa gaa act ttg cgt tac aga 1200Lys Met Lys Tyr Thr Asn Met Val Ile Lys Glu Thr Leu Arg Tyr Arg385 390 395 400cct cct gtc ttg atg gtt cca tat gtt gtt aag aag aat ttc cca gtt 1248Pro Pro Val Leu Met Val Pro Tyr Val Val Lys Lys Asn Phe Pro Val 405 410 415tcc cct aac tat acc gca cca aag ggc gct atg tta att cca acc tta 1296Ser Pro Asn Tyr Thr Ala Pro Lys Gly Ala Met Leu Ile Pro Thr Leu 420 425 430tac cca gct tta cat gat cct gaa gtt tac gaa aat cct gat gag ttc 1344Tyr Pro Ala Leu His Asp Pro Glu Val Tyr Glu Asn Pro Asp Glu Phe 435 440 445atc cct gaa aga tgg gta gaa ggc tct aag gct agt gaa gca aag aag 1392Ile Pro Glu Arg Trp Val Glu Gly Ser Lys Ala Ser Glu Ala Lys Lys 450 455 460aat tgg ttg gtt ttt ggt tgt ggt cca cac gtt tgc tta ggt caa aca 1440Asn Trp Leu Val Phe Gly Cys Gly Pro His Val Cys Leu Gly Gln Thr465 470 475 480tat gtc atg att acc ttc gcc gct ttg ttg ggt aaa ttt gca cta tat 1488Tyr Val Met Ile Thr Phe Ala Ala Leu Leu Gly Lys Phe Ala Leu Tyr 485 490 495act gat ttc cat cat aca gtg act cca tta agt gaa aaa atc aag gtt 1536Thr Asp Phe His His Thr Val Thr Pro Leu Ser Glu Lys Ile Lys Val 500 505 510ttc gct aca att ttc cca aaa gat gat ttg tta ctg act ttc aaa aag 1584Phe Ala Thr Ile Phe Pro Lys Asp Asp Leu Leu Leu Thr Phe Lys Lys 515 520 525aga gac cca att act gga gaa gtc ttc gaa taa 1617Arg Asp Pro Ile Thr Gly Glu Val Phe Glu 530 53522538PRTSaccharomyces cerevisiae 22Met Ser Ser Val Ala Glu Asn Ile Ile Gln His Ala Thr His Asn Ser1 5 10 15Thr Leu His Gln Leu Ala Lys Asp Gln Pro Ser Val Gly Val Thr Thr 20 25 30Ala Phe Ser Ile Leu Asp Thr Leu Lys Ser Met Ser Tyr Leu Lys Ile 35 40 45Phe Ala Thr Leu Ile Cys Ile Leu Leu Val Trp Asp Gln Val Ala Tyr 50 55 60Gln Ile Lys Lys Gly Ser Ile Ala Gly Pro Lys Phe Lys Phe Trp Pro65 70 75 80Ile Ile Gly Pro Phe Leu Glu Ser Leu Asp Pro Lys Phe Glu Glu Tyr 85 90 95Lys Ala Lys Trp Ala Ser Gly Pro Leu Ser Cys Val Ser Ile Phe His 100 105 110Lys Phe Val Val Ile Ala Ser Thr Arg Asp Leu Ala Arg Lys Ile Leu 115 120 125Gln Ser Ser Lys Phe Val Lys Pro Cys Val Val Asp Val Ala Val Lys 130 135 140Ile Leu Arg Pro Cys Asn Trp Val Phe Leu Asp Gly Lys Ala His Thr145 150 155 160Asp Tyr Arg Lys Ser Leu Asn Gly Leu Phe Thr Lys Gln Ala Leu Ala 165 170 175Gln Tyr Leu Pro Ser Leu Glu Gln Ile Met Asp Lys Tyr Met Asp Lys 180 185 190Phe Val Arg Leu Ser Lys Glu Asn Asn Tyr Glu Pro Gln Val Phe Phe 195 200 205His Glu Met Arg Glu Ile Leu Cys Ala Leu Ser Leu Asn Ser Phe Cys 210 215 220Gly Asn Tyr Ile Thr Glu Asp Gln Val Arg Lys Ile Ala Asp Asp Tyr225 230 235 240Tyr Leu Val Thr Ala Ala Leu Glu Leu Val Asn Phe Pro Ile Ile Ile 245 250 255Pro Tyr Thr Lys Thr Trp Tyr Gly Lys Lys Thr Ala Asp Met Ala Met 260 265 270Lys Ile Phe Glu Asn Cys Ala Gln Met Ala Lys Asp His Ile Ala Ala 275 280 285Gly Gly Lys Pro Val Cys Val Met Asp Ala Trp Cys Lys Leu Met His 290 295 300Asp Ala Lys Asn Ser Asn Asp Asp Asp Ser Arg Ile Tyr His Arg Glu305 310 315 320Phe Thr Asn Lys Glu Ile Ser Glu Ala Val Phe Thr Phe Leu Phe Ala 325 330 335Ser Gln Asp Ala Ser Ser Ser Leu Ala Cys Trp Leu Phe Gln Ile Val 340 345 350Ala Asp Arg Pro Asp Val Leu Ala Lys Ile Arg Glu Glu Gln Leu Ala 355 360 365Val Arg Asn Asn Asp Met Ser Thr Glu Leu Asn Leu Asp Leu Ile Glu 370 375 380Lys Met Lys Tyr Thr Asn Met Val Ile Lys Glu Thr Leu Arg Tyr Arg385 390 395 400Pro Pro Val Leu Met Val Pro Tyr Val Val Lys Lys Asn Phe Pro Val 405 410 415Ser Pro Asn Tyr Thr Ala Pro Lys Gly Ala Met Leu Ile Pro Thr Leu 420 425 430Tyr Pro Ala Leu His Asp Pro Glu Val Tyr Glu Asn Pro Asp Glu Phe 435 440 445Ile Pro Glu Arg Trp Val Glu Gly Ser Lys Ala Ser Glu Ala Lys Lys 450 455 460Asn Trp Leu Val Phe Gly Cys Gly Pro His Val Cys Leu Gly Gln Thr465 470 475 480Tyr Val Met Ile Thr Phe Ala Ala Leu Leu Gly Lys Phe Ala Leu Tyr 485 490 495Thr Asp Phe His His Thr Val Thr Pro Leu Ser Glu Lys Ile Lys Val 500 505 510Phe Ala Thr Ile Phe Pro Lys Asp Asp Leu Leu Leu Thr Phe Lys Lys 515 520 525Arg Asp Pro Ile Thr Gly Glu Val Phe Glu 530 535231578DNAArtificial SequenceDescription of Artificial Sequence Truncated HMG construct 23atg gac caa ttg gtg aaa act gaa gtc acc aag aag tct ttt act gct 48Met Asp Gln Leu Val Lys Thr Glu Val Thr Lys Lys Ser Phe Thr Ala1 5 10 15cct gta caa aag gct tct aca cca gtt tta acc aat aaa aca gtc att 96Pro Val Gln Lys Ala Ser Thr Pro Val Leu Thr Asn Lys Thr Val Ile 20 25 30tct gga tcg aaa gtc aaa agt tta tca tct gcg caa tcg agc tca tca 144Ser Gly Ser Lys Val Lys Ser Leu Ser Ser Ala Gln Ser Ser Ser Ser 35 40 45gga cct tca tca tct agt gag gaa gat gat tcc cgc gat att gaa agc 192Gly Pro Ser Ser Ser Ser Glu Glu Asp Asp Ser Arg Asp Ile Glu Ser 50 55 60ttg gat aag aaa ata cgt cct tta gaa gaa tta gaa gca tta tta agt 240Leu Asp Lys Lys Ile Arg Pro Leu Glu Glu Leu Glu Ala Leu Leu Ser65 70 75 80agt gga aat aca aaa caa ttg aag aac aaa gag gtc gct gcc ttg gtt 288Ser Gly Asn Thr Lys Gln Leu Lys Asn Lys Glu Val Ala Ala Leu Val 85 90 95att cac ggt aag tta cct ttg tac gct ttg gag aaa aaa tta ggt gat 336Ile His Gly Lys Leu Pro Leu Tyr Ala Leu Glu Lys Lys Leu Gly Asp 100 105 110act acg aga gcg gtt gcg gta cgt agg aag gct ctt tca att ttg gca 384Thr Thr Arg Ala Val Ala Val Arg Arg Lys Ala Leu Ser Ile Leu Ala 115 120 125gaa gct cct gta tta gca tct gat cgt tta cca tat aaa aat tat gac 432Glu Ala Pro Val Leu Ala Ser Asp Arg Leu Pro Tyr Lys Asn Tyr Asp 130 135 140tac gac cgc gta ttt ggc gct tgt tgt gaa aat gtt ata ggt tac atg 480Tyr Asp Arg Val Phe Gly Ala Cys Cys Glu Asn Val Ile Gly Tyr Met145 150 155 160cct ttg ccc gtt ggt gtt ata ggc ccc ttg gtt atc gat ggt aca tct 528Pro Leu Pro Val Gly Val Ile Gly Pro Leu Val Ile Asp Gly Thr Ser 165 170 175tat cat ata cca atg gca act aca gag ggt tgt ttg gta gct tct gcc 576Tyr His Ile Pro Met Ala Thr Thr Glu Gly Cys Leu Val Ala Ser Ala 180 185 190atg cgt ggc tgt aag gca atc aat gct ggc ggt ggt gca aca act gtt 624Met Arg Gly Cys Lys Ala Ile Asn Ala Gly Gly Gly Ala Thr Thr Val 195 200 205tta act aag gat ggt atg aca aga ggc cca gta gtc cgt ttc cca act 672Leu Thr Lys Asp Gly Met Thr Arg Gly Pro Val Val Arg Phe Pro Thr 210 215 220ttg aaa aga tct ggt gcc tgt aag ata tgg tta gac tca gaa gag gga 720Leu Lys Arg Ser Gly Ala Cys Lys Ile Trp Leu Asp Ser Glu Glu Gly225 230 235 240caa aac gca att aaa aaa gct ttt aac tct aca tca aga ttt gca cgt 768Gln Asn Ala Ile Lys Lys Ala Phe Asn Ser Thr Ser Arg Phe Ala Arg 245 250 255ctg caa cat att caa act tgt cta gca gga gat tta ctc ttc atg aga 816Leu Gln His Ile Gln Thr Cys Leu Ala Gly Asp Leu Leu Phe Met Arg 260 265 270ttt aga aca act act ggt gac gca atg ggt atg aat atg att tct aaa 864Phe Arg Thr Thr Thr Gly Asp Ala Met Gly Met Asn Met Ile Ser Lys 275 280 285ggt gtc gaa tac tca tta aag caa atg gta gaa gag tat ggc tgg gaa 912Gly Val Glu Tyr Ser Leu Lys Gln Met Val Glu Glu Tyr Gly Trp Glu 290 295 300gat atg gag gtt gtc tcc gtt tct ggt aac tac tgt acc gac aaa aaa 960Asp Met Glu Val Val Ser Val Ser Gly Asn Tyr Cys Thr Asp Lys Lys305 310 315 320cca gct gcc atc aac tgg atc gaa ggt cgt ggt aag agt gtc gtc gca 1008Pro Ala Ala Ile Asn Trp Ile Glu Gly Arg Gly Lys Ser Val Val Ala 325 330 335gaa gct act att cct ggt gat gtt gtc aga aaa gtg tta aaa agt gat 1056Glu Ala Thr Ile Pro Gly Asp Val Val Arg Lys Val Leu Lys Ser Asp 340 345 350gtt tcc gca ttg gtt gag ttg aac att gct aag aat ttg gtt gga tct 1104Val Ser Ala Leu Val Glu Leu Asn Ile Ala Lys Asn Leu Val Gly Ser 355 360 365gca atg gct ggg tct gtt ggt gga ttt aac gca cat gca gct aat tta 1152Ala Met Ala Gly Ser Val Gly Gly Phe Asn Ala His Ala Ala Asn Leu 370 375 380gtg aca gct gtt ttc ttg gca tta gga caa gat cct gca caa aat gtt 1200Val Thr Ala Val Phe Leu Ala Leu Gly Gln Asp Pro Ala Gln Asn Val385 390 395 400gaa agt tcc aac tgt ata aca ttg atg aaa gaa gtg gac ggt gat ttg 1248Glu Ser Ser Asn Cys Ile Thr Leu Met Lys Glu Val Asp Gly Asp Leu 405 410 415aga att tcc gta tcc atg cca tcc atc gaa gta ggt acc atc ggt ggt 1296Arg Ile Ser Val Ser Met Pro Ser Ile Glu Val Gly Thr Ile Gly Gly 420 425 430ggt act gtt cta gaa cca caa ggt gcc atg ttg gac tta tta ggt gta 1344Gly Thr Val Leu Glu Pro Gln Gly Ala Met Leu Asp Leu Leu Gly Val 435 440 445aga ggc ccg cat gct acc gct cct ggt acc aac gca cgt caa tta gca 1392Arg Gly Pro His Ala Thr Ala Pro Gly Thr Asn Ala Arg Gln Leu Ala 450 455 460aga ata gtt gcc tgt gcc gtc ttg gca ggt gaa tta tcc tta tgt gct 1440Arg Ile Val Ala Cys Ala Val Leu Ala Gly Glu Leu Ser Leu Cys Ala465 470 475 480gcc cta gca gcc ggc cat ttg gtt caa agt cat atg acc cac aac agg 1488Ala Leu Ala Ala Gly His Leu Val Gln Ser His Met Thr His Asn Arg 485 490 495aaa cct gct gaa cca aca aaa cct aac aat ttg gac gcc act gat ata 1536Lys Pro Ala Glu Pro Thr Lys Pro Asn Asn Leu Asp Ala Thr Asp Ile 500 505 510aat cgt ttg aaa gat ggg tcc gtc acc tgc att aaa tcc taa 1578Asn Arg Leu Lys Asp Gly Ser Val Thr Cys Ile Lys Ser 515 520 52524525PRTArtificial SequenceDescription of Artificial Sequence Synthetic protein construct 24Met Asp Gln Leu Val Lys Thr Glu Val Thr Lys Lys Ser Phe Thr Ala1 5 10 15Pro Val Gln Lys Ala Ser Thr Pro Val Leu Thr Asn Lys Thr Val Ile 20 25 30Ser Gly Ser Lys Val Lys Ser Leu Ser Ser Ala Gln Ser Ser Ser Ser 35 40 45Gly Pro Ser Ser Ser Ser Glu Glu Asp Asp Ser Arg Asp Ile Glu Ser 50 55 60Leu Asp Lys Lys Ile Arg Pro Leu Glu Glu Leu Glu Ala Leu Leu Ser65 70 75 80Ser Gly Asn Thr Lys Gln Leu Lys Asn Lys Glu Val Ala Ala Leu Val 85 90 95Ile His Gly Lys Leu Pro Leu Tyr Ala Leu Glu Lys Lys Leu Gly Asp 100 105 110Thr Thr Arg Ala Val Ala Val Arg Arg Lys Ala Leu Ser Ile Leu Ala 115 120 125Glu Ala Pro Val Leu Ala Ser Asp Arg Leu Pro Tyr Lys Asn Tyr Asp 130 135 140Tyr Asp Arg Val Phe Gly Ala Cys Cys Glu Asn Val Ile Gly Tyr Met145 150 155 160Pro Leu Pro Val Gly Val Ile Gly Pro Leu Val Ile Asp Gly Thr Ser 165 170 175Tyr His Ile Pro Met Ala Thr Thr Glu Gly Cys Leu Val Ala Ser Ala 180 185 190Met Arg Gly Cys Lys Ala Ile Asn Ala Gly Gly Gly Ala Thr Thr Val 195 200 205Leu Thr Lys Asp Gly Met Thr Arg Gly Pro Val Val Arg Phe Pro Thr 210 215 220Leu Lys Arg Ser Gly Ala Cys Lys Ile Trp Leu Asp Ser Glu Glu Gly225 230 235 240Gln Asn Ala Ile Lys Lys Ala Phe Asn Ser Thr Ser Arg Phe Ala Arg 245 250 255Leu Gln His Ile Gln Thr Cys Leu Ala Gly Asp Leu Leu Phe Met Arg 260 265 270Phe Arg Thr Thr Thr Gly Asp Ala Met Gly Met Asn Met Ile Ser Lys 275 280 285Gly Val Glu Tyr Ser Leu Lys Gln Met Val Glu Glu Tyr Gly Trp Glu 290 295 300Asp Met Glu Val Val Ser Val Ser Gly Asn Tyr Cys Thr Asp Lys Lys305 310 315 320Pro Ala Ala Ile Asn Trp Ile Glu Gly Arg Gly Lys Ser Val Val Ala 325 330 335Glu Ala Thr Ile Pro Gly Asp Val Val Arg Lys Val Leu Lys Ser Asp 340 345 350Val Ser Ala Leu Val Glu Leu Asn Ile Ala Lys Asn Leu Val Gly Ser 355 360 365Ala Met Ala Gly Ser Val Gly Gly Phe Asn Ala His Ala Ala Asn Leu 370 375 380Val Thr Ala Val Phe Leu Ala Leu Gly Gln Asp Pro Ala Gln Asn Val385 390 395 400Glu Ser Ser Asn Cys Ile Thr Leu Met Lys Glu Val Asp Gly Asp Leu 405 410 415Arg Ile Ser Val Ser Met Pro Ser Ile Glu Val Gly Thr Ile Gly Gly 420 425 430Gly Thr Val Leu Glu Pro Gln Gly Ala Met Leu Asp Leu Leu Gly Val 435 440 445Arg Gly Pro His Ala Thr Ala Pro Gly Thr Asn Ala Arg Gln Leu Ala 450 455 460Arg Ile Val Ala Cys Ala Val Leu Ala Gly Glu Leu Ser Leu Cys Ala465 470 475 480Ala Leu Ala Ala Gly His Leu Val Gln Ser His Met Thr His Asn Arg 485 490 495Lys Pro Ala Glu Pro Thr Lys Pro Asn Asn Leu Asp Ala Thr Asp Ile 500 505 510Asn Arg Leu Lys Asp Gly Ser Val Thr Cys Ile Lys Ser 515 520 525251593DNASaccharomyces cerevisiaeCDS(1)..(1593) 25atg tct gct acc aag tca atc gtt gga gag gca ttg gaa tac gta aac 48Met Ser Ala Thr Lys Ser Ile Val Gly Glu Ala Leu Glu Tyr Val Asn1 5 10 15att ggt tta agt cat ttc ttg gct tta cca ttg gcc caa aga atc tct 96Ile Gly Leu Ser His Phe Leu Ala Leu Pro Leu Ala Gln Arg Ile Ser 20 25 30ttg atc ata ata att cct ttc att tac aat att gta tgg caa tta cta 144Leu Ile Ile Ile Ile Pro Phe Ile Tyr Asn Ile Val Trp Gln Leu Leu 35 40 45tat tct ttg aga aag gac cgt cca cct cta gtg ttt tac tgg att cca 192Tyr Ser Leu Arg Lys Asp Arg Pro Pro Leu Val Phe Tyr Trp Ile Pro 50 55 60tgg gtc ggt agt gct gtt gtg tac ggt atg aag cca tac gag ttt ttc 240Trp Val Gly Ser Ala Val Val Tyr Gly Met Lys Pro Tyr Glu Phe Phe65 70 75 80gaa gaa tgt caa aag aaa tac ggt gat att ttt tca ttc gtt ttg tta 288Glu Glu Cys Gln Lys Lys Tyr Gly Asp Ile Phe Ser Phe Val Leu Leu 85 90 95gga aga gtc atg act gtg tat tta gga cca aag ggt cac gaa ttt gtc 336Gly Arg Val Met Thr Val Tyr Leu Gly Pro Lys Gly His Glu Phe Val 100 105 110ttc aac gct aag ttg gca gat gtt tca gca gaa gct gct tac gct cat 384Phe Asn Ala Lys Leu Ala Asp Val Ser Ala Glu Ala Ala Tyr Ala His 115 120 125ttg act act cca gtt ttc ggt aaa ggt gtt att tac gat tgt cca aat 432Leu Thr Thr Pro Val Phe Gly

Lys Gly Val Ile Tyr Asp Cys Pro Asn 130 135 140tct aga ttg atg gag caa aag aag ttt gtt aag ggt gct cta acc aaa 480Ser Arg Leu Met Glu Gln Lys Lys Phe Val Lys Gly Ala Leu Thr Lys145 150 155 160gaa gcc ttc aag agc tac gtt cca ttg att gct gaa gaa gtg tac aag 528Glu Ala Phe Lys Ser Tyr Val Pro Leu Ile Ala Glu Glu Val Tyr Lys 165 170 175tac ttc aga gac tcc aaa aac ttc cgt ttg aat gaa aga act act ggt 576Tyr Phe Arg Asp Ser Lys Asn Phe Arg Leu Asn Glu Arg Thr Thr Gly 180 185 190act att gac gtg atg gtt act caa cct gaa atg act att ttc acc gct 624Thr Ile Asp Val Met Val Thr Gln Pro Glu Met Thr Ile Phe Thr Ala 195 200 205tca aga tca tta ttg ggt aag gaa atg aga gca aaa ttg gat acc gat 672Ser Arg Ser Leu Leu Gly Lys Glu Met Arg Ala Lys Leu Asp Thr Asp 210 215 220ttt gct tac ttg tac agt gat ttg gat aag ggt ttc act cca atc aac 720Phe Ala Tyr Leu Tyr Ser Asp Leu Asp Lys Gly Phe Thr Pro Ile Asn225 230 235 240ttc gtc ttc cct aac tta cca ttg gaa cac tat aga aag aga gat cac 768Phe Val Phe Pro Asn Leu Pro Leu Glu His Tyr Arg Lys Arg Asp His 245 250 255gct caa aag gct atc tcc ggt act tac atg tct ttg att aag gaa aga 816Ala Gln Lys Ala Ile Ser Gly Thr Tyr Met Ser Leu Ile Lys Glu Arg 260 265 270aga aag aac aac gac att caa gac aga gat ttg atc gat tcc ttg atg 864Arg Lys Asn Asn Asp Ile Gln Asp Arg Asp Leu Ile Asp Ser Leu Met 275 280 285aag aac tct acc tac aag gat ggt gtg aag atg act gat caa gaa atc 912Lys Asn Ser Thr Tyr Lys Asp Gly Val Lys Met Thr Asp Gln Glu Ile 290 295 300gct aac ttg tta att ggt gtc tta atg ggt ggt caa cat act tct gct 960Ala Asn Leu Leu Ile Gly Val Leu Met Gly Gly Gln His Thr Ser Ala305 310 315 320gcc act tct gct tgg att ttg ttg cac ttg gct gaa aga cca gat gtc 1008Ala Thr Ser Ala Trp Ile Leu Leu His Leu Ala Glu Arg Pro Asp Val 325 330 335caa caa gaa ttg tac gaa gaa caa atg cgt gtt ttg gat ggt ggt aag 1056Gln Gln Glu Leu Tyr Glu Glu Gln Met Arg Val Leu Asp Gly Gly Lys 340 345 350aag gaa ttg acc tac gat tta tta caa gaa atg cca ttg ttg aac caa 1104Lys Glu Leu Thr Tyr Asp Leu Leu Gln Glu Met Pro Leu Leu Asn Gln 355 360 365act att aag gaa act cta aga atg cac cat cca ttg cac tct ttg ttc 1152Thr Ile Lys Glu Thr Leu Arg Met His His Pro Leu His Ser Leu Phe 370 375 380cgt aag gtt atg aaa gat atg cac gtt cca aac act tct tat gtc atc 1200Arg Lys Val Met Lys Asp Met His Val Pro Asn Thr Ser Tyr Val Ile385 390 395 400cca gca ggt tat cac gtt ttg gtt tct cca ggt tac act cat tta aga 1248Pro Ala Gly Tyr His Val Leu Val Ser Pro Gly Tyr Thr His Leu Arg 405 410 415gac gaa tac ttc cct aat gct cac caa ttc aac att cac cgt tgg aac 1296Asp Glu Tyr Phe Pro Asn Ala His Gln Phe Asn Ile His Arg Trp Asn 420 425 430aaa gat tct gcc tcc tct tat tcc gtc ggt gaa gaa gtc gat tac ggt 1344Lys Asp Ser Ala Ser Ser Tyr Ser Val Gly Glu Glu Val Asp Tyr Gly 435 440 445ttc ggt gcc att tct aag ggt gtc agc tct cca tac tta cct ttc ggt 1392Phe Gly Ala Ile Ser Lys Gly Val Ser Ser Pro Tyr Leu Pro Phe Gly 450 455 460ggt ggt aga cac aga tgt atc ggt gaa cac ttt gct tac tgt cag cta 1440Gly Gly Arg His Arg Cys Ile Gly Glu His Phe Ala Tyr Cys Gln Leu465 470 475 480ggt gtt cta atg tcc att ttt atc aga aca tta aaa tgg cat tac cca 1488Gly Val Leu Met Ser Ile Phe Ile Arg Thr Leu Lys Trp His Tyr Pro 485 490 495gag ggt aag acc gtt cca cct cct gac ttt aca tct atg gtt act ctt 1536Glu Gly Lys Thr Val Pro Pro Pro Asp Phe Thr Ser Met Val Thr Leu 500 505 510cca acc ggt cca gcc aag atc atc tgg gaa aag aga aat cca gaa caa 1584Pro Thr Gly Pro Ala Lys Ile Ile Trp Glu Lys Arg Asn Pro Glu Gln 515 520 525aag atc taa 1593Lys Ile 53026530PRTSaccharomyces cerevisiae 26Met Ser Ala Thr Lys Ser Ile Val Gly Glu Ala Leu Glu Tyr Val Asn1 5 10 15Ile Gly Leu Ser His Phe Leu Ala Leu Pro Leu Ala Gln Arg Ile Ser 20 25 30Leu Ile Ile Ile Ile Pro Phe Ile Tyr Asn Ile Val Trp Gln Leu Leu 35 40 45Tyr Ser Leu Arg Lys Asp Arg Pro Pro Leu Val Phe Tyr Trp Ile Pro 50 55 60Trp Val Gly Ser Ala Val Val Tyr Gly Met Lys Pro Tyr Glu Phe Phe65 70 75 80Glu Glu Cys Gln Lys Lys Tyr Gly Asp Ile Phe Ser Phe Val Leu Leu 85 90 95Gly Arg Val Met Thr Val Tyr Leu Gly Pro Lys Gly His Glu Phe Val 100 105 110Phe Asn Ala Lys Leu Ala Asp Val Ser Ala Glu Ala Ala Tyr Ala His 115 120 125Leu Thr Thr Pro Val Phe Gly Lys Gly Val Ile Tyr Asp Cys Pro Asn 130 135 140Ser Arg Leu Met Glu Gln Lys Lys Phe Val Lys Gly Ala Leu Thr Lys145 150 155 160Glu Ala Phe Lys Ser Tyr Val Pro Leu Ile Ala Glu Glu Val Tyr Lys 165 170 175Tyr Phe Arg Asp Ser Lys Asn Phe Arg Leu Asn Glu Arg Thr Thr Gly 180 185 190Thr Ile Asp Val Met Val Thr Gln Pro Glu Met Thr Ile Phe Thr Ala 195 200 205Ser Arg Ser Leu Leu Gly Lys Glu Met Arg Ala Lys Leu Asp Thr Asp 210 215 220Phe Ala Tyr Leu Tyr Ser Asp Leu Asp Lys Gly Phe Thr Pro Ile Asn225 230 235 240Phe Val Phe Pro Asn Leu Pro Leu Glu His Tyr Arg Lys Arg Asp His 245 250 255Ala Gln Lys Ala Ile Ser Gly Thr Tyr Met Ser Leu Ile Lys Glu Arg 260 265 270Arg Lys Asn Asn Asp Ile Gln Asp Arg Asp Leu Ile Asp Ser Leu Met 275 280 285Lys Asn Ser Thr Tyr Lys Asp Gly Val Lys Met Thr Asp Gln Glu Ile 290 295 300Ala Asn Leu Leu Ile Gly Val Leu Met Gly Gly Gln His Thr Ser Ala305 310 315 320Ala Thr Ser Ala Trp Ile Leu Leu His Leu Ala Glu Arg Pro Asp Val 325 330 335Gln Gln Glu Leu Tyr Glu Glu Gln Met Arg Val Leu Asp Gly Gly Lys 340 345 350Lys Glu Leu Thr Tyr Asp Leu Leu Gln Glu Met Pro Leu Leu Asn Gln 355 360 365Thr Ile Lys Glu Thr Leu Arg Met His His Pro Leu His Ser Leu Phe 370 375 380Arg Lys Val Met Lys Asp Met His Val Pro Asn Thr Ser Tyr Val Ile385 390 395 400Pro Ala Gly Tyr His Val Leu Val Ser Pro Gly Tyr Thr His Leu Arg 405 410 415Asp Glu Tyr Phe Pro Asn Ala His Gln Phe Asn Ile His Arg Trp Asn 420 425 430Lys Asp Ser Ala Ser Ser Tyr Ser Val Gly Glu Glu Val Asp Tyr Gly 435 440 445Phe Gly Ala Ile Ser Lys Gly Val Ser Ser Pro Tyr Leu Pro Phe Gly 450 455 460Gly Gly Arg His Arg Cys Ile Gly Glu His Phe Ala Tyr Cys Gln Leu465 470 475 480Gly Val Leu Met Ser Ile Phe Ile Arg Thr Leu Lys Trp His Tyr Pro 485 490 495Glu Gly Lys Thr Val Pro Pro Pro Asp Phe Thr Ser Met Val Thr Leu 500 505 510Pro Thr Gly Pro Ala Lys Ile Ile Trp Glu Lys Arg Asn Pro Glu Gln 515 520 525Lys Ile 530271491DNASaccharomyces cerevisiaeCDS(1)..(1491) 27atg tct gct gtt aac gtt gca cct gaa ttg att aat gcc gac aac aca 48Met Ser Ala Val Asn Val Ala Pro Glu Leu Ile Asn Ala Asp Asn Thr1 5 10 15att acc tac gat gcg att gtc atc ggt gct ggt gtt atc ggt cca tgt 96Ile Thr Tyr Asp Ala Ile Val Ile Gly Ala Gly Val Ile Gly Pro Cys 20 25 30gtt gct act ggt cta gca aga aag ggt aag aaa gtt ctt atc gta gaa 144Val Ala Thr Gly Leu Ala Arg Lys Gly Lys Lys Val Leu Ile Val Glu 35 40 45cgt gac tgg gct atg cct gat aga att gtt ggt gaa ttg atg caa cca 192Arg Asp Trp Ala Met Pro Asp Arg Ile Val Gly Glu Leu Met Gln Pro 50 55 60ggt ggt gtt aga gca ttg aga agt ctg ggt atg att caa tct atc aac 240Gly Gly Val Arg Ala Leu Arg Ser Leu Gly Met Ile Gln Ser Ile Asn65 70 75 80aac atc gaa gca tat cct gtt acc ggt tat acc gtc ttt ttc aac ggc 288Asn Ile Glu Ala Tyr Pro Val Thr Gly Tyr Thr Val Phe Phe Asn Gly 85 90 95gaa caa gtt gat att cca tac cct tac aag gcc gat atc cct aaa gtt 336Glu Gln Val Asp Ile Pro Tyr Pro Tyr Lys Ala Asp Ile Pro Lys Val 100 105 110gaa aaa ttg aag gac ttg gtc aaa gat ggt aat gac aag gtc ttg gaa 384Glu Lys Leu Lys Asp Leu Val Lys Asp Gly Asn Asp Lys Val Leu Glu 115 120 125gac agc act att cac atc aag gat tac gaa gat gat gaa aga gaa agg 432Asp Ser Thr Ile His Ile Lys Asp Tyr Glu Asp Asp Glu Arg Glu Arg 130 135 140ggt gtt gct ttt gtt cat ggt aga ttc ttg aac aac ttg aga aac att 480Gly Val Ala Phe Val His Gly Arg Phe Leu Asn Asn Leu Arg Asn Ile145 150 155 160act gct caa gag cca aat gtt act aga gtg caa ggt aac tgt att gag 528Thr Ala Gln Glu Pro Asn Val Thr Arg Val Gln Gly Asn Cys Ile Glu 165 170 175ata ttg aag gat gaa aag aat gag gtt gtt ggt gcc aag gtt gac att 576Ile Leu Lys Asp Glu Lys Asn Glu Val Val Gly Ala Lys Val Asp Ile 180 185 190gat ggc cgt ggc aag gtg gaa ttc aaa gcc cac ttg aca ttt atc tgt 624Asp Gly Arg Gly Lys Val Glu Phe Lys Ala His Leu Thr Phe Ile Cys 195 200 205gac ggt atc ttt tca cgt ttc aga aag gaa ttg cac cca gac cat gtt 672Asp Gly Ile Phe Ser Arg Phe Arg Lys Glu Leu His Pro Asp His Val 210 215 220cca act gtc ggt tct tcg ttt gtc ggt atg tct ttg ttc aat gct aag 720Pro Thr Val Gly Ser Ser Phe Val Gly Met Ser Leu Phe Asn Ala Lys225 230 235 240aat cct gct cct atg cac ggt cac gtt att ctt ggt agt gat cat atg 768Asn Pro Ala Pro Met His Gly His Val Ile Leu Gly Ser Asp His Met 245 250 255cca atc ttg gtt tac caa atc agt cca gaa gaa aca aga atc ctt tgt 816Pro Ile Leu Val Tyr Gln Ile Ser Pro Glu Glu Thr Arg Ile Leu Cys 260 265 270gct tac aac tct cca aag gtc cca gct gat atc aag agt tgg atg att 864Ala Tyr Asn Ser Pro Lys Val Pro Ala Asp Ile Lys Ser Trp Met Ile 275 280 285aag gat gtc caa cct ttc att cca aag agt cta cgt cct tca ttt gat 912Lys Asp Val Gln Pro Phe Ile Pro Lys Ser Leu Arg Pro Ser Phe Asp 290 295 300gaa gcc gtc agc caa ggt aaa ttt aga gct atg cca aac tcc tac ttg 960Glu Ala Val Ser Gln Gly Lys Phe Arg Ala Met Pro Asn Ser Tyr Leu305 310 315 320cca gct aga caa aac gac gtc act ggt atg tgt gtt atc ggt gac gct 1008Pro Ala Arg Gln Asn Asp Val Thr Gly Met Cys Val Ile Gly Asp Ala 325 330 335cta aat atg aga cat cca ttg act ggt ggt ggt atg act gtc ggt ttg 1056Leu Asn Met Arg His Pro Leu Thr Gly Gly Gly Met Thr Val Gly Leu 340 345 350cat gat gtt gtc ttg ttg att aag aaa ata ggt gac cta gac ttc agc 1104His Asp Val Val Leu Leu Ile Lys Lys Ile Gly Asp Leu Asp Phe Ser 355 360 365gac cgt gaa aag gtt ttg gat gaa tta cta gac tac cat ttc gaa aga 1152Asp Arg Glu Lys Val Leu Asp Glu Leu Leu Asp Tyr His Phe Glu Arg 370 375 380aag agt tac gat tcc gtt att aac gtt ttg tca gtg gct ttg tat tct 1200Lys Ser Tyr Asp Ser Val Ile Asn Val Leu Ser Val Ala Leu Tyr Ser385 390 395 400ttg ttc gct gct gac agc gat aac ttg aag gca tta caa aaa ggt tgt 1248Leu Phe Ala Ala Asp Ser Asp Asn Leu Lys Ala Leu Gln Lys Gly Cys 405 410 415ttc aaa tat ttc caa aga ggt ggc gat tgt gtc aac aaa ccc gtt gaa 1296Phe Lys Tyr Phe Gln Arg Gly Gly Asp Cys Val Asn Lys Pro Val Glu 420 425 430ttt ctg tct ggt gtc ttg cca aag cct ttg caa ttg acc agg gtt ttc 1344Phe Leu Ser Gly Val Leu Pro Lys Pro Leu Gln Leu Thr Arg Val Phe 435 440 445ttc gct gtc gct ttt tac acc att tac ttg aac atg gaa gaa cgt ggt 1392Phe Ala Val Ala Phe Tyr Thr Ile Tyr Leu Asn Met Glu Glu Arg Gly 450 455 460ttc ttg gga tta cca atg gct tta ttg gaa ggt att atg att ttg atc 1440Phe Leu Gly Leu Pro Met Ala Leu Leu Glu Gly Ile Met Ile Leu Ile465 470 475 480aca gct att aga gta ttc acc cca ttt ttg ttt ggt gag ttg att ggt 1488Thr Ala Ile Arg Val Phe Thr Pro Phe Leu Phe Gly Glu Leu Ile Gly 485 490 495taa 149128496PRTSaccharomyces cerevisiae 28Met Ser Ala Val Asn Val Ala Pro Glu Leu Ile Asn Ala Asp Asn Thr1 5 10 15Ile Thr Tyr Asp Ala Ile Val Ile Gly Ala Gly Val Ile Gly Pro Cys 20 25 30Val Ala Thr Gly Leu Ala Arg Lys Gly Lys Lys Val Leu Ile Val Glu 35 40 45Arg Asp Trp Ala Met Pro Asp Arg Ile Val Gly Glu Leu Met Gln Pro 50 55 60Gly Gly Val Arg Ala Leu Arg Ser Leu Gly Met Ile Gln Ser Ile Asn65 70 75 80Asn Ile Glu Ala Tyr Pro Val Thr Gly Tyr Thr Val Phe Phe Asn Gly 85 90 95Glu Gln Val Asp Ile Pro Tyr Pro Tyr Lys Ala Asp Ile Pro Lys Val 100 105 110Glu Lys Leu Lys Asp Leu Val Lys Asp Gly Asn Asp Lys Val Leu Glu 115 120 125Asp Ser Thr Ile His Ile Lys Asp Tyr Glu Asp Asp Glu Arg Glu Arg 130 135 140Gly Val Ala Phe Val His Gly Arg Phe Leu Asn Asn Leu Arg Asn Ile145 150 155 160Thr Ala Gln Glu Pro Asn Val Thr Arg Val Gln Gly Asn Cys Ile Glu 165 170 175Ile Leu Lys Asp Glu Lys Asn Glu Val Val Gly Ala Lys Val Asp Ile 180 185 190Asp Gly Arg Gly Lys Val Glu Phe Lys Ala His Leu Thr Phe Ile Cys 195 200 205Asp Gly Ile Phe Ser Arg Phe Arg Lys Glu Leu His Pro Asp His Val 210 215 220Pro Thr Val Gly Ser Ser Phe Val Gly Met Ser Leu Phe Asn Ala Lys225 230 235 240Asn Pro Ala Pro Met His Gly His Val Ile Leu Gly Ser Asp His Met 245 250 255Pro Ile Leu Val Tyr Gln Ile Ser Pro Glu Glu Thr Arg Ile Leu Cys 260 265 270Ala Tyr Asn Ser Pro Lys Val Pro Ala Asp Ile Lys Ser Trp Met Ile 275 280 285Lys Asp Val Gln Pro Phe Ile Pro Lys Ser Leu Arg Pro Ser Phe Asp 290 295 300Glu Ala Val Ser Gln Gly Lys Phe Arg Ala Met Pro Asn Ser Tyr Leu305 310 315 320Pro Ala Arg Gln Asn Asp Val Thr Gly Met Cys Val Ile Gly Asp Ala 325 330 335Leu Asn Met Arg His Pro Leu Thr Gly Gly Gly Met Thr Val Gly Leu 340 345 350His Asp Val Val Leu Leu Ile Lys Lys Ile Gly Asp Leu Asp Phe Ser 355 360 365Asp Arg Glu Lys Val Leu Asp Glu Leu Leu Asp Tyr His Phe Glu Arg 370 375 380Lys Ser Tyr Asp Ser Val Ile Asn Val Leu Ser Val Ala Leu Tyr Ser385 390 395 400Leu Phe Ala Ala Asp Ser Asp Asn Leu Lys Ala Leu Gln Lys Gly Cys 405 410 415Phe Lys Tyr Phe Gln Arg Gly Gly Asp Cys Val Asn Lys Pro Val Glu 420 425 430Phe Leu Ser Gly Val Leu Pro Lys Pro Leu Gln Leu Thr Arg Val Phe 435 440 445Phe Ala Val Ala Phe Tyr Thr Ile Tyr Leu Asn Met Glu Glu Arg Gly 450 455 460Phe Leu Gly Leu Pro Met Ala Leu Leu Glu Gly Ile Met Ile Leu Ile465 470 475 480Thr Ala Ile Arg Val Phe Thr Pro Phe Leu

Phe Gly Glu Leu Ile Gly 485 490 495291335DNASaccharomyces cerevisiaeCDS(1)..(1335) 29atg gga aag cta tta caa ttg gca ttg cat ccg gtc gag atg aag gca 48Met Gly Lys Leu Leu Gln Leu Ala Leu His Pro Val Glu Met Lys Ala1 5 10 15gct ttg aag ctg aag ttt tgc aga aca ccg cta ttc tcc atc tat gat 96Ala Leu Lys Leu Lys Phe Cys Arg Thr Pro Leu Phe Ser Ile Tyr Asp 20 25 30cag tcc acg tct cca tat ctc ttg cac tgt ttc gaa ctg ttg aac ttg 144Gln Ser Thr Ser Pro Tyr Leu Leu His Cys Phe Glu Leu Leu Asn Leu 35 40 45acc tcc aga tcg ttt gct gct gtg atc aga gag ctg cat cca gaa ttg 192Thr Ser Arg Ser Phe Ala Ala Val Ile Arg Glu Leu His Pro Glu Leu 50 55 60aga aac tgt gtt act ctc ttt tat ttg att tta agg gct ttg gat acc 240Arg Asn Cys Val Thr Leu Phe Tyr Leu Ile Leu Arg Ala Leu Asp Thr65 70 75 80atc gaa gac gat atg tcc atc gaa cac gat ttg aaa att gac ttg ttg 288Ile Glu Asp Asp Met Ser Ile Glu His Asp Leu Lys Ile Asp Leu Leu 85 90 95cgt cac ttc cac gag aaa ttg ttg tta act aaa tgg agt ttc gac gga 336Arg His Phe His Glu Lys Leu Leu Leu Thr Lys Trp Ser Phe Asp Gly 100 105 110aat gcc ccc gat gtg aag gac aga gcc gtt ttg aca gat ttc gaa tcg 384Asn Ala Pro Asp Val Lys Asp Arg Ala Val Leu Thr Asp Phe Glu Ser 115 120 125att ctt att gaa ttc cac aaa ttg aaa cca gaa tat caa gaa gtc atc 432Ile Leu Ile Glu Phe His Lys Leu Lys Pro Glu Tyr Gln Glu Val Ile 130 135 140aag gag atc acc gag aaa atg ggt aat ggt atg gcc gac tac atc tta 480Lys Glu Ile Thr Glu Lys Met Gly Asn Gly Met Ala Asp Tyr Ile Leu145 150 155 160gat gaa aat tac aac ttg aat ggg ttg caa acc gtc cac gac tac gac 528Asp Glu Asn Tyr Asn Leu Asn Gly Leu Gln Thr Val His Asp Tyr Asp 165 170 175gtg tac tgt cac tac gta gct ggt ttg gtc ggt gat ggt ttg acc cgt 576Val Tyr Cys His Tyr Val Ala Gly Leu Val Gly Asp Gly Leu Thr Arg 180 185 190ttg att gtc att gcc aag ttt gcc aac gaa tct ttg tat tct aat gag 624Leu Ile Val Ile Ala Lys Phe Ala Asn Glu Ser Leu Tyr Ser Asn Glu 195 200 205caa ttg tat gaa agc atg ggt ctt ttc cta caa aaa acc aac atc atc 672Gln Leu Tyr Glu Ser Met Gly Leu Phe Leu Gln Lys Thr Asn Ile Ile 210 215 220aga gat tac aat gaa gat ttg gtc gat ggt aga tcc ttc tgg ccc aag 720Arg Asp Tyr Asn Glu Asp Leu Val Asp Gly Arg Ser Phe Trp Pro Lys225 230 235 240gaa atc tgg tca caa tac gct cct cag ttg aag gac ttc atg aaa cct 768Glu Ile Trp Ser Gln Tyr Ala Pro Gln Leu Lys Asp Phe Met Lys Pro 245 250 255gaa aac gaa caa ctg ggg ttg gac tgt ata aac cac ctc gtc tta aac 816Glu Asn Glu Gln Leu Gly Leu Asp Cys Ile Asn His Leu Val Leu Asn 260 265 270gca ttg agt cat gtt atc gat gtg ttg act tat ttg gcc ggt atc cac 864Ala Leu Ser His Val Ile Asp Val Leu Thr Tyr Leu Ala Gly Ile His 275 280 285gag caa tcc act ttc caa ttt tgt gcc att ccc caa gtt atg gcc att 912Glu Gln Ser Thr Phe Gln Phe Cys Ala Ile Pro Gln Val Met Ala Ile 290 295 300gca acc ttg gct ttg gta ttc aac aac cgt gaa gtg cta cat ggc aat 960Ala Thr Leu Ala Leu Val Phe Asn Asn Arg Glu Val Leu His Gly Asn305 310 315 320gta aag att cgt aag ggt act acc tgc tat tta att ttg aaa tca agg 1008Val Lys Ile Arg Lys Gly Thr Thr Cys Tyr Leu Ile Leu Lys Ser Arg 325 330 335act ttg cgt ggc tgt gtc gag att ttt gac tat tac tta cgt gat atc 1056Thr Leu Arg Gly Cys Val Glu Ile Phe Asp Tyr Tyr Leu Arg Asp Ile 340 345 350aaa tct aaa ttg gct gtg caa gat cca aat ttc tta aaa ttg aac att 1104Lys Ser Lys Leu Ala Val Gln Asp Pro Asn Phe Leu Lys Leu Asn Ile 355 360 365caa atc tcc aag atc gaa cag ttt atg gaa gaa atg tac cag gat aaa 1152Gln Ile Ser Lys Ile Glu Gln Phe Met Glu Glu Met Tyr Gln Asp Lys 370 375 380tta cct cct aac gtg aag cca aat gaa act cca att ttc ttg aaa gtt 1200Leu Pro Pro Asn Val Lys Pro Asn Glu Thr Pro Ile Phe Leu Lys Val385 390 395 400aaa gaa aga tcc aga tac gat gat gaa ttg gtt cca acc caa caa gaa 1248Lys Glu Arg Ser Arg Tyr Asp Asp Glu Leu Val Pro Thr Gln Gln Glu 405 410 415gaa gag tac aag ttc aat atg gtt tta tct atc atc ttg tcc gtt ctt 1296Glu Glu Tyr Lys Phe Asn Met Val Leu Ser Ile Ile Leu Ser Val Leu 420 425 430ctt ggg ttt tat tat ata tac act tta cac aga gcg tga 1335Leu Gly Phe Tyr Tyr Ile Tyr Thr Leu His Arg Ala 435 44030444PRTSaccharomyces cerevisiae 30Met Gly Lys Leu Leu Gln Leu Ala Leu His Pro Val Glu Met Lys Ala1 5 10 15Ala Leu Lys Leu Lys Phe Cys Arg Thr Pro Leu Phe Ser Ile Tyr Asp 20 25 30Gln Ser Thr Ser Pro Tyr Leu Leu His Cys Phe Glu Leu Leu Asn Leu 35 40 45Thr Ser Arg Ser Phe Ala Ala Val Ile Arg Glu Leu His Pro Glu Leu 50 55 60Arg Asn Cys Val Thr Leu Phe Tyr Leu Ile Leu Arg Ala Leu Asp Thr65 70 75 80Ile Glu Asp Asp Met Ser Ile Glu His Asp Leu Lys Ile Asp Leu Leu 85 90 95Arg His Phe His Glu Lys Leu Leu Leu Thr Lys Trp Ser Phe Asp Gly 100 105 110Asn Ala Pro Asp Val Lys Asp Arg Ala Val Leu Thr Asp Phe Glu Ser 115 120 125Ile Leu Ile Glu Phe His Lys Leu Lys Pro Glu Tyr Gln Glu Val Ile 130 135 140Lys Glu Ile Thr Glu Lys Met Gly Asn Gly Met Ala Asp Tyr Ile Leu145 150 155 160Asp Glu Asn Tyr Asn Leu Asn Gly Leu Gln Thr Val His Asp Tyr Asp 165 170 175Val Tyr Cys His Tyr Val Ala Gly Leu Val Gly Asp Gly Leu Thr Arg 180 185 190Leu Ile Val Ile Ala Lys Phe Ala Asn Glu Ser Leu Tyr Ser Asn Glu 195 200 205Gln Leu Tyr Glu Ser Met Gly Leu Phe Leu Gln Lys Thr Asn Ile Ile 210 215 220Arg Asp Tyr Asn Glu Asp Leu Val Asp Gly Arg Ser Phe Trp Pro Lys225 230 235 240Glu Ile Trp Ser Gln Tyr Ala Pro Gln Leu Lys Asp Phe Met Lys Pro 245 250 255Glu Asn Glu Gln Leu Gly Leu Asp Cys Ile Asn His Leu Val Leu Asn 260 265 270Ala Leu Ser His Val Ile Asp Val Leu Thr Tyr Leu Ala Gly Ile His 275 280 285Glu Gln Ser Thr Phe Gln Phe Cys Ala Ile Pro Gln Val Met Ala Ile 290 295 300Ala Thr Leu Ala Leu Val Phe Asn Asn Arg Glu Val Leu His Gly Asn305 310 315 320Val Lys Ile Arg Lys Gly Thr Thr Cys Tyr Leu Ile Leu Lys Ser Arg 325 330 335Thr Leu Arg Gly Cys Val Glu Ile Phe Asp Tyr Tyr Leu Arg Asp Ile 340 345 350Lys Ser Lys Leu Ala Val Gln Asp Pro Asn Phe Leu Lys Leu Asn Ile 355 360 365Gln Ile Ser Lys Ile Glu Gln Phe Met Glu Glu Met Tyr Gln Asp Lys 370 375 380Leu Pro Pro Asn Val Lys Pro Asn Glu Thr Pro Ile Phe Leu Lys Val385 390 395 400Lys Glu Arg Ser Arg Tyr Asp Asp Glu Leu Val Pro Thr Gln Gln Glu 405 410 415Glu Glu Tyr Lys Phe Asn Met Val Leu Ser Ile Ile Leu Ser Val Leu 420 425 430Leu Gly Phe Tyr Tyr Ile Tyr Thr Leu His Arg Ala 435 440311929DNASaccharomyces cerevisiaeCDS(1)..(1929) 31atg gac aag aag aag gat cta ctg gag aac gaa caa ttt ctc cgc atc 48Met Asp Lys Lys Lys Asp Leu Leu Glu Asn Glu Gln Phe Leu Arg Ile1 5 10 15caa aag ctc aac gct gcc gat gcg ggc aaa aga caa tct ata aca gtg 96Gln Lys Leu Asn Ala Ala Asp Ala Gly Lys Arg Gln Ser Ile Thr Val 20 25 30gac gac gag ggc gaa cta tat ggg tta gac acc tcc ggc aac tca cca 144Asp Asp Glu Gly Glu Leu Tyr Gly Leu Asp Thr Ser Gly Asn Ser Pro 35 40 45gcc aat gaa cac aca gct acc aca att aca cag aat cac agc gtg gtg 192Ala Asn Glu His Thr Ala Thr Thr Ile Thr Gln Asn His Ser Val Val 50 55 60gcc tca aac gga gac gtc gca ttc atc cca gga act gct acc gaa ggc 240Ala Ser Asn Gly Asp Val Ala Phe Ile Pro Gly Thr Ala Thr Glu Gly65 70 75 80aat aca gag att gta act gaa gaa gtg att gag acc gat gat aac atg 288Asn Thr Glu Ile Val Thr Glu Glu Val Ile Glu Thr Asp Asp Asn Met 85 90 95ttc aag acc cat gtg aag act tta agc tcc aaa gag aag gca cgg tat 336Phe Lys Thr His Val Lys Thr Leu Ser Ser Lys Glu Lys Ala Arg Tyr 100 105 110agg caa ggg tcc tct aac ttt ata tcg tat ttc gat gat atg tca ttt 384Arg Gln Gly Ser Ser Asn Phe Ile Ser Tyr Phe Asp Asp Met Ser Phe 115 120 125gaa cac agg ccc agt ata tta gat ggg tca gtt aac gag ccc ttc aag 432Glu His Arg Pro Ser Ile Leu Asp Gly Ser Val Asn Glu Pro Phe Lys 130 135 140acc aaa ttc gtg gga cct act tta gaa aag gag atc aga aga agg gag 480Thr Lys Phe Val Gly Pro Thr Leu Glu Lys Glu Ile Arg Arg Arg Glu145 150 155 160aaa gag cta atg gcc atg cgc aaa aat tta cac cac cgc aag tcc tcc 528Lys Glu Leu Met Ala Met Arg Lys Asn Leu His His Arg Lys Ser Ser 165 170 175cca gat gct gtc gac tca gta ggg aaa aat gat ggc gcc gcc cca act 576Pro Asp Ala Val Asp Ser Val Gly Lys Asn Asp Gly Ala Ala Pro Thr 180 185 190act gtt cca act gcc gcc acc tca gaa acg gtg gtc acc gtt gaa acc 624Thr Val Pro Thr Ala Ala Thr Ser Glu Thr Val Val Thr Val Glu Thr 195 200 205acc ata att tca tcc aat ttc tcc ggg ttg tac gtg gcg ttt tgg atg 672Thr Ile Ile Ser Ser Asn Phe Ser Gly Leu Tyr Val Ala Phe Trp Met 210 215 220gct att gca ttt ggt gct gtc aag gct tta ata gac tat tat tac cag 720Ala Ile Ala Phe Gly Ala Val Lys Ala Leu Ile Asp Tyr Tyr Tyr Gln225 230 235 240cat aat ggt agc ttc aag gat tcg gag atc ttg aaa ttt atg act acg 768His Asn Gly Ser Phe Lys Asp Ser Glu Ile Leu Lys Phe Met Thr Thr 245 250 255aat ttg ttc act gtg gca tcc gta gat ctt ttg atg tat ttg agc act 816Asn Leu Phe Thr Val Ala Ser Val Asp Leu Leu Met Tyr Leu Ser Thr 260 265 270tat ttt gtc gtt gga ata caa tac tta tgc aag tgg ggg gtc ttg aaa 864Tyr Phe Val Val Gly Ile Gln Tyr Leu Cys Lys Trp Gly Val Leu Lys 275 280 285tgg ggc act acc ggc tgg atc ttc acc tca att tac gag ttt ttg ttt 912Trp Gly Thr Thr Gly Trp Ile Phe Thr Ser Ile Tyr Glu Phe Leu Phe 290 295 300gtt atc ttc tac atg tat tta aca gaa aac atc cta aaa cta cac tgg 960Val Ile Phe Tyr Met Tyr Leu Thr Glu Asn Ile Leu Lys Leu His Trp305 310 315 320ctg tcc aag atc ttc ctt ttt ttg cat tct tta gtt tta ttg atg aaa 1008Leu Ser Lys Ile Phe Leu Phe Leu His Ser Leu Val Leu Leu Met Lys 325 330 335atg cat tct ttc gcc ttc tac aat ggc tat cta tgg ggt ata aag gaa 1056Met His Ser Phe Ala Phe Tyr Asn Gly Tyr Leu Trp Gly Ile Lys Glu 340 345 350gaa cta caa ttt tcc aaa agc gct ctt gcc aaa tac aag gat tct ata 1104Glu Leu Gln Phe Ser Lys Ser Ala Leu Ala Lys Tyr Lys Asp Ser Ile 355 360 365aat gat cca aaa gtt att ggt gct ctt gag aaa agc tgt gag ttt tgt 1152Asn Asp Pro Lys Val Ile Gly Ala Leu Glu Lys Ser Cys Glu Phe Cys 370 375 380agt ttt gaa ttg agc tct cag tct tta agc gac caa act caa aaa ttc 1200Ser Phe Glu Leu Ser Ser Gln Ser Leu Ser Asp Gln Thr Gln Lys Phe385 390 395 400ccc aac aat atc agt gca aaa agc ttt ttt tgg ttc acc atg ttt cca 1248Pro Asn Asn Ile Ser Ala Lys Ser Phe Phe Trp Phe Thr Met Phe Pro 405 410 415acc cta att tac caa att gaa tat cca aga act aag gaa atc aga tgg 1296Thr Leu Ile Tyr Gln Ile Glu Tyr Pro Arg Thr Lys Glu Ile Arg Trp 420 425 430agc tac gta tta gaa aag atc tgc gcc atc ttc ggt acc att ttc tta 1344Ser Tyr Val Leu Glu Lys Ile Cys Ala Ile Phe Gly Thr Ile Phe Leu 435 440 445atg atg ata gat gct caa atc ttg atg tat cct gta gca atg aga gca 1392Met Met Ile Asp Ala Gln Ile Leu Met Tyr Pro Val Ala Met Arg Ala 450 455 460ttg gct gtg cgc aat tct gaa tgg act ggt ata ttg gat aga tta ttg 1440Leu Ala Val Arg Asn Ser Glu Trp Thr Gly Ile Leu Asp Arg Leu Leu465 470 475 480aaa tgg gtt gga ttg ctc gtt gat atc gtc cca ggg ttt atc gtg atg 1488Lys Trp Val Gly Leu Leu Val Asp Ile Val Pro Gly Phe Ile Val Met 485 490 495tac atc ttg gac ttc tat ttg att tgg gat gcc att ttg aac tgt gtg 1536Tyr Ile Leu Asp Phe Tyr Leu Ile Trp Asp Ala Ile Leu Asn Cys Val 500 505 510gct gaa ttg aca aga ttt ggc gac aga tat ttc tac ggt gac tgg tgg 1584Ala Glu Leu Thr Arg Phe Gly Asp Arg Tyr Phe Tyr Gly Asp Trp Trp 515 520 525aat tgt gtt agt tgg gca gac ttc agt aga att tgg aac atc cca gtg 1632Asn Cys Val Ser Trp Ala Asp Phe Ser Arg Ile Trp Asn Ile Pro Val 530 535 540cat aag ttt ttg tta aga cat gtt tac cat agt tca atg agt tca ttc 1680His Lys Phe Leu Leu Arg His Val Tyr His Ser Ser Met Ser Ser Phe545 550 555 560aaa ttg aac aag agt caa gca act ttg atg acc ttt ttc tta agt tcc 1728Lys Leu Asn Lys Ser Gln Ala Thr Leu Met Thr Phe Phe Leu Ser Ser 565 570 575gtc gtt cat gaa tta gca atg tac gtt atc ttc aag aaa ttg agg ttt 1776Val Val His Glu Leu Ala Met Tyr Val Ile Phe Lys Lys Leu Arg Phe 580 585 590tac ttg ttc ttc ttc caa atg ctg caa atg cca tta gta gct tta aca 1824Tyr Leu Phe Phe Phe Gln Met Leu Gln Met Pro Leu Val Ala Leu Thr 595 600 605aat act aaa ttc atg agg aac aga acc ata atc gga aat gtt att ttc 1872Asn Thr Lys Phe Met Arg Asn Arg Thr Ile Ile Gly Asn Val Ile Phe 610 615 620tgg ctc ggt atc tgc atg gga cca agt gtc atg tgt acg ttg tac ttg 1920Trp Leu Gly Ile Cys Met Gly Pro Ser Val Met Cys Thr Leu Tyr Leu625 630 635 640aca ttc taa 1929Thr Phe32642PRTSaccharomyces cerevisiae 32Met Asp Lys Lys Lys Asp Leu Leu Glu Asn Glu Gln Phe Leu Arg Ile1 5 10 15Gln Lys Leu Asn Ala Ala Asp Ala Gly Lys Arg Gln Ser Ile Thr Val 20 25 30Asp Asp Glu Gly Glu Leu Tyr Gly Leu Asp Thr Ser Gly Asn Ser Pro 35 40 45Ala Asn Glu His Thr Ala Thr Thr Ile Thr Gln Asn His Ser Val Val 50 55 60Ala Ser Asn Gly Asp Val Ala Phe Ile Pro Gly Thr Ala Thr Glu Gly65 70 75 80Asn Thr Glu Ile Val Thr Glu Glu Val Ile Glu Thr Asp Asp Asn Met 85 90 95Phe Lys Thr His Val Lys Thr Leu Ser Ser Lys Glu Lys Ala Arg Tyr 100 105 110Arg Gln Gly Ser Ser Asn Phe Ile Ser Tyr Phe Asp Asp Met Ser Phe 115 120 125Glu His Arg Pro Ser Ile Leu Asp Gly Ser Val Asn Glu Pro Phe Lys 130 135 140Thr Lys Phe Val Gly Pro Thr Leu Glu Lys Glu Ile Arg Arg Arg Glu145 150 155 160Lys Glu Leu Met Ala Met Arg Lys Asn Leu His His Arg Lys Ser Ser 165 170 175Pro Asp Ala Val Asp Ser Val Gly Lys Asn Asp Gly Ala Ala Pro Thr 180 185 190Thr Val Pro Thr Ala Ala Thr Ser Glu Thr Val Val Thr Val Glu Thr 195 200 205Thr Ile Ile Ser Ser Asn Phe Ser Gly Leu Tyr Val Ala Phe Trp Met 210 215 220Ala Ile Ala Phe Gly Ala Val Lys Ala Leu Ile Asp Tyr Tyr Tyr Gln225 230 235 240His Asn Gly Ser Phe Lys Asp Ser Glu Ile Leu Lys Phe Met Thr

Thr 245 250 255Asn Leu Phe Thr Val Ala Ser Val Asp Leu Leu Met Tyr Leu Ser Thr 260 265 270Tyr Phe Val Val Gly Ile Gln Tyr Leu Cys Lys Trp Gly Val Leu Lys 275 280 285Trp Gly Thr Thr Gly Trp Ile Phe Thr Ser Ile Tyr Glu Phe Leu Phe 290 295 300Val Ile Phe Tyr Met Tyr Leu Thr Glu Asn Ile Leu Lys Leu His Trp305 310 315 320Leu Ser Lys Ile Phe Leu Phe Leu His Ser Leu Val Leu Leu Met Lys 325 330 335Met His Ser Phe Ala Phe Tyr Asn Gly Tyr Leu Trp Gly Ile Lys Glu 340 345 350Glu Leu Gln Phe Ser Lys Ser Ala Leu Ala Lys Tyr Lys Asp Ser Ile 355 360 365Asn Asp Pro Lys Val Ile Gly Ala Leu Glu Lys Ser Cys Glu Phe Cys 370 375 380Ser Phe Glu Leu Ser Ser Gln Ser Leu Ser Asp Gln Thr Gln Lys Phe385 390 395 400Pro Asn Asn Ile Ser Ala Lys Ser Phe Phe Trp Phe Thr Met Phe Pro 405 410 415Thr Leu Ile Tyr Gln Ile Glu Tyr Pro Arg Thr Lys Glu Ile Arg Trp 420 425 430Ser Tyr Val Leu Glu Lys Ile Cys Ala Ile Phe Gly Thr Ile Phe Leu 435 440 445Met Met Ile Asp Ala Gln Ile Leu Met Tyr Pro Val Ala Met Arg Ala 450 455 460Leu Ala Val Arg Asn Ser Glu Trp Thr Gly Ile Leu Asp Arg Leu Leu465 470 475 480Lys Trp Val Gly Leu Leu Val Asp Ile Val Pro Gly Phe Ile Val Met 485 490 495Tyr Ile Leu Asp Phe Tyr Leu Ile Trp Asp Ala Ile Leu Asn Cys Val 500 505 510Ala Glu Leu Thr Arg Phe Gly Asp Arg Tyr Phe Tyr Gly Asp Trp Trp 515 520 525Asn Cys Val Ser Trp Ala Asp Phe Ser Arg Ile Trp Asn Ile Pro Val 530 535 540His Lys Phe Leu Leu Arg His Val Tyr His Ser Ser Met Ser Ser Phe545 550 555 560Lys Leu Asn Lys Ser Gln Ala Thr Leu Met Thr Phe Phe Leu Ser Ser 565 570 575Val Val His Glu Leu Ala Met Tyr Val Ile Phe Lys Lys Leu Arg Phe 580 585 590Tyr Leu Phe Phe Phe Gln Met Leu Gln Met Pro Leu Val Ala Leu Thr 595 600 605Asn Thr Lys Phe Met Arg Asn Arg Thr Ile Ile Gly Asn Val Ile Phe 610 615 620Trp Leu Gly Ile Cys Met Gly Pro Ser Val Met Cys Thr Leu Tyr Leu625 630 635 640Thr Phe3360DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 33atgtcgaaag ctacatataa ggaacgtgct gcatctcatc ccagctgaag cttcgtacgc 603462DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 34ttagttttgc tggccgcatc ttctcaaata tgcttcccag gcataggcca ctagtggatc 60tg 623560DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 35gaatactcag gtatcgtaag atgcaagagt tcgaatctct ccagctgaag cttcgtacgc 603662DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 36tctaccctat gaacatattc cattttgtaa tttcgtgtcg gcataggcca ctagtggatc 60tg 623760DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 37atgacagagc agaaagccct agtaaagcgt attacaaatg ccagctgaag cttcgtacgc 603862DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 38ctacataaga acacctttgg tggagggaac atcgttggta gcataggcca ctagtggatc 60tg 623960DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 39atgagtgaaa cagaattgag aaaaagacag gcccaattca ccagctgaag cttcgtacgc 604062DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 40ttattgagtt gcttcttggg aagtttggga gggggtttcg gcataggcca ctagtggatc 60tg 624160DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 41atgagttctg tcgcagaaaa tataatacaa catgccactc ccagctgaag cttcgtacgc 604262DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 42ttattcgaag acttctccag taattgggtc tctctttttg gcataggcca ctagtggatc 60tg 624333DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 43ctgcggccgc aacatgacca ccaatacggt ccc 334427DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 44ttctcgagtc tttagttatg cttgctc 274533DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 45ctgcggccgc aagatggacc tggttctcag tgc 334629DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 46ttctcgagct acttattctt tgtaaactc 294732DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 47ctgcggccgc aagatggagc ccgccgtgtc gc 324828DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 48aactcgagtc agtgccttgc cgccttgc 28491833DNASaccharomyces cerevisiaeCDS(1)..(1833) 49atg acg gag act aag gat ttg ttg caa gac gaa gag ttt ctt aag atc 48Met Thr Glu Thr Lys Asp Leu Leu Gln Asp Glu Glu Phe Leu Lys Ile1 5 10 15cgc aga ctc aat tcc gca gaa gcc aac aaa cgg cat tcg gtc acg tac 96Arg Arg Leu Asn Ser Ala Glu Ala Asn Lys Arg His Ser Val Thr Tyr 20 25 30gat aac gtg atc ctg cca cag gag tcc atg gag gtt tcg cca cgg tcg 144Asp Asn Val Ile Leu Pro Gln Glu Ser Met Glu Val Ser Pro Arg Ser 35 40 45tct acc acg tcg ctg gtg gag cca gtg gag tcg act gaa gga gtg gag 192Ser Thr Thr Ser Leu Val Glu Pro Val Glu Ser Thr Glu Gly Val Glu 50 55 60tcg act gag gcg gaa cgt gtg gca ggg aag cag gag cag gag gag gag 240Ser Thr Glu Ala Glu Arg Val Ala Gly Lys Gln Glu Gln Glu Glu Glu65 70 75 80tac cct gtg gac gcc cac atg caa aag tac ctt tca cac ctg aag agc 288Tyr Pro Val Asp Ala His Met Gln Lys Tyr Leu Ser His Leu Lys Ser 85 90 95aag tct cgg tcg agg ttc cac cga aag gat gct agc aag tat gtg tcg 336Lys Ser Arg Ser Arg Phe His Arg Lys Asp Ala Ser Lys Tyr Val Ser 100 105 110ttt ttt ggg gac gtg agt ttt gat cct cgc ccc acg ctc ctg gac agc 384Phe Phe Gly Asp Val Ser Phe Asp Pro Arg Pro Thr Leu Leu Asp Ser 115 120 125gcc atc aac gtg ccc ttc cag acg act ttc aaa ggt ccg gtg ctg gag 432Ala Ile Asn Val Pro Phe Gln Thr Thr Phe Lys Gly Pro Val Leu Glu 130 135 140aaa cag ctc aaa aat tta cag ttg aca aag acc aag acc aag gcc acg 480Lys Gln Leu Lys Asn Leu Gln Leu Thr Lys Thr Lys Thr Lys Ala Thr145 150 155 160gtg aag act acg gtg aag act acg gag aaa acg gac aag gca gat gcc 528Val Lys Thr Thr Val Lys Thr Thr Glu Lys Thr Asp Lys Ala Asp Ala 165 170 175ccc cca gga gaa aaa ctg gag tcg aac ttt tca ggg atc tac gtg ttc 576Pro Pro Gly Glu Lys Leu Glu Ser Asn Phe Ser Gly Ile Tyr Val Phe 180 185 190gca tgg atg ttc ttg ggc tgg ata gcc atc agg tgc tgc aca gat tac 624Ala Trp Met Phe Leu Gly Trp Ile Ala Ile Arg Cys Cys Thr Asp Tyr 195 200 205tat gcg tcg tac ggc agt gca tgg aat aag ctg gaa atc gtg cag tac 672Tyr Ala Ser Tyr Gly Ser Ala Trp Asn Lys Leu Glu Ile Val Gln Tyr 210 215 220atg aca acg gac ttg ttc acg atc gca atg ttg gac ttg gca atg ttc 720Met Thr Thr Asp Leu Phe Thr Ile Ala Met Leu Asp Leu Ala Met Phe225 230 235 240ctg tgc act ttc ttc gtg gtt ttc gtg cac tgg ctg gtg aaa aag cgg 768Leu Cys Thr Phe Phe Val Val Phe Val His Trp Leu Val Lys Lys Arg 245 250 255atc atc aac tgg aag tgg act ggg ttc gtt gca gtg agc atc ttc gag 816Ile Ile Asn Trp Lys Trp Thr Gly Phe Val Ala Val Ser Ile Phe Glu 260 265 270ttg gct ttc atc ccc gtg acg ttc ccc att tac gtc tac tac ttt gat 864Leu Ala Phe Ile Pro Val Thr Phe Pro Ile Tyr Val Tyr Tyr Phe Asp 275 280 285ttc aac tgg gtc acg aga atc ttc ctg ttc ctg cac tcc gtg gtg ttt 912Phe Asn Trp Val Thr Arg Ile Phe Leu Phe Leu His Ser Val Val Phe 290 295 300gtt atg aag agc cac tcg ttt gcc ttt tac aac ggg tat ctt tgg gac 960Val Met Lys Ser His Ser Phe Ala Phe Tyr Asn Gly Tyr Leu Trp Asp305 310 315 320ata aag cag gaa ctc gag tac tct tcc aaa cag ttg caa aaa tac aag 1008Ile Lys Gln Glu Leu Glu Tyr Ser Ser Lys Gln Leu Gln Lys Tyr Lys 325 330 335gaa tct ttg tcc cca gag acc cgc gag att ctg caa aaa agt tgc gac 1056Glu Ser Leu Ser Pro Glu Thr Arg Glu Ile Leu Gln Lys Ser Cys Asp 340 345 350ttt tgc ctt ttc gaa ttg aac tac cag acc aag gat aac gac ttc ccc 1104Phe Cys Leu Phe Glu Leu Asn Tyr Gln Thr Lys Asp Asn Asp Phe Pro 355 360 365aac aac atc agt tgc agc aat ttc ttc atg ttc tgt ttg ttc ccc gtc 1152Asn Asn Ile Ser Cys Ser Asn Phe Phe Met Phe Cys Leu Phe Pro Val 370 375 380ctc gtg tac cag atc aac tac cca aga acg tcg cgc atc aga tgg agg 1200Leu Val Tyr Gln Ile Asn Tyr Pro Arg Thr Ser Arg Ile Arg Trp Arg385 390 395 400tat gtg ttg gag aag gtg tgc gcc atc att ggc acc atc ttc ctc atg 1248Tyr Val Leu Glu Lys Val Cys Ala Ile Ile Gly Thr Ile Phe Leu Met 405 410 415atg gtc acg gca cag ttc ttc atg cac ccg gtg gcc atg cgc tgt atc 1296Met Val Thr Ala Gln Phe Phe Met His Pro Val Ala Met Arg Cys Ile 420 425 430cag ttc cac aac acg ccc acc ttc ggc ggc tgg atc ccc gcc acg caa 1344Gln Phe His Asn Thr Pro Thr Phe Gly Gly Trp Ile Pro Ala Thr Gln 435 440 445gag tgg ttc cac ctg ctc ttc gac atg att ccg ggc ttc act gtt ctg 1392Glu Trp Phe His Leu Leu Phe Asp Met Ile Pro Gly Phe Thr Val Leu 450 455 460tac atg ctc acg ttt tac atg ata tgg gac gct tta ttg aat tgc gtg 1440Tyr Met Leu Thr Phe Tyr Met Ile Trp Asp Ala Leu Leu Asn Cys Val465 470 475 480gcg gag ttg acc agg ttt gcg gac aga tat ttc tac ggc gac tgg tgg 1488Ala Glu Leu Thr Arg Phe Ala Asp Arg Tyr Phe Tyr Gly Asp Trp Trp 485 490 495aat tgc gtt tcg ttt gaa gag ttt agc aga atc tgg aac gtc ccc gtt 1536Asn Cys Val Ser Phe Glu Glu Phe Ser Arg Ile Trp Asn Val Pro Val 500 505 510cac aaa ttt tta cta aga cac gtg tac cac agc tcc atg ggc gca ttg 1584His Lys Phe Leu Leu Arg His Val Tyr His Ser Ser Met Gly Ala Leu 515 520 525cat ttg agc aag agc caa gct aca tta ttt act ttt ttc ttg agt gcc 1632His Leu Ser Lys Ser Gln Ala Thr Leu Phe Thr Phe Phe Leu Ser Ala 530 535 540gtg ttc cac gaa atg gcc atg ttc gcc att ttc aga agg gtt aga gga 1680Val Phe His Glu Met Ala Met Phe Ala Ile Phe Arg Arg Val Arg Gly545 550 555 560tat ctg ttc atg ttc caa ctg tcg cag ttt gtg tgg act gct ttg agc 1728Tyr Leu Phe Met Phe Gln Leu Ser Gln Phe Val Trp Thr Ala Leu Ser 565 570 575aac acc aag ttt cta cgg gca aga ccg cag ttg tcc aac gtt gtc ttt 1776Asn Thr Lys Phe Leu Arg Ala Arg Pro Gln Leu Ser Asn Val Val Phe 580 585 590tcg ttt ggt gtc tgt tca ggg ccc agt atc att atg acg ttg tac ctg 1824Ser Phe Gly Val Cys Ser Gly Pro Ser Ile Ile Met Thr Leu Tyr Leu 595 600 605acc tta tga 1833Thr Leu 61050610PRTSaccharomyces cerevisiae 50Met Thr Glu Thr Lys Asp Leu Leu Gln Asp Glu Glu Phe Leu Lys Ile1 5 10 15Arg Arg Leu Asn Ser Ala Glu Ala Asn Lys Arg His Ser Val Thr Tyr 20 25 30Asp Asn Val Ile Leu Pro Gln Glu Ser Met Glu Val Ser Pro Arg Ser 35 40 45Ser Thr Thr Ser Leu Val Glu Pro Val Glu Ser Thr Glu Gly Val Glu 50 55 60Ser Thr Glu Ala Glu Arg Val Ala Gly Lys Gln Glu Gln Glu Glu Glu65 70 75 80Tyr Pro Val Asp Ala His Met Gln Lys Tyr Leu Ser His Leu Lys Ser 85 90 95Lys Ser Arg Ser Arg Phe His Arg Lys Asp Ala Ser Lys Tyr Val Ser 100 105 110Phe Phe Gly Asp Val Ser Phe Asp Pro Arg Pro Thr Leu Leu Asp Ser 115 120 125Ala Ile Asn Val Pro Phe Gln Thr Thr Phe Lys Gly Pro Val Leu Glu 130 135 140Lys Gln Leu Lys Asn Leu Gln Leu Thr Lys Thr Lys Thr Lys Ala Thr145 150 155 160Val Lys Thr Thr Val Lys Thr Thr Glu Lys Thr Asp Lys Ala Asp Ala 165 170 175Pro Pro Gly Glu Lys Leu Glu Ser Asn Phe Ser Gly Ile Tyr Val Phe 180 185 190Ala Trp Met Phe Leu Gly Trp Ile Ala Ile Arg Cys Cys Thr Asp Tyr 195 200 205Tyr Ala Ser Tyr Gly Ser Ala Trp Asn Lys Leu Glu Ile Val Gln Tyr 210 215 220Met Thr Thr Asp Leu Phe Thr Ile Ala Met Leu Asp Leu Ala Met Phe225 230 235 240Leu Cys Thr Phe Phe Val Val Phe Val His Trp Leu Val Lys Lys Arg 245 250 255Ile Ile Asn Trp Lys Trp Thr Gly Phe Val Ala Val Ser Ile Phe Glu 260 265 270Leu Ala Phe Ile Pro Val Thr Phe Pro Ile Tyr Val Tyr Tyr Phe Asp 275 280 285Phe Asn Trp Val Thr Arg Ile Phe Leu Phe Leu His Ser Val Val Phe 290 295 300Val Met Lys Ser His Ser Phe Ala Phe Tyr Asn Gly Tyr Leu Trp Asp305 310 315 320Ile Lys Gln Glu Leu Glu Tyr Ser Ser Lys Gln Leu Gln Lys Tyr Lys 325 330 335Glu Ser Leu Ser Pro Glu Thr Arg Glu Ile Leu Gln Lys Ser Cys Asp 340 345 350Phe Cys Leu Phe Glu Leu Asn Tyr Gln Thr Lys Asp Asn Asp Phe Pro 355 360 365Asn Asn Ile Ser Cys Ser Asn Phe Phe Met Phe Cys Leu Phe Pro Val 370 375 380Leu Val Tyr Gln Ile Asn Tyr Pro Arg Thr Ser Arg Ile Arg Trp Arg385 390 395 400Tyr Val Leu Glu Lys Val Cys Ala Ile Ile Gly Thr Ile Phe Leu Met 405 410 415Met Val Thr Ala Gln Phe Phe Met His Pro Val Ala Met Arg Cys Ile 420 425 430Gln Phe His Asn Thr Pro Thr Phe Gly Gly Trp Ile Pro Ala Thr Gln 435 440 445Glu Trp Phe His Leu Leu Phe Asp Met Ile Pro Gly Phe Thr Val Leu 450 455 460Tyr Met Leu Thr Phe Tyr Met Ile Trp Asp Ala Leu Leu Asn Cys Val465 470 475 480Ala Glu Leu Thr Arg Phe Ala Asp Arg Tyr Phe Tyr Gly Asp Trp Trp 485 490 495Asn Cys Val Ser Phe Glu Glu Phe Ser Arg Ile Trp Asn Val Pro Val 500 505 510His Lys Phe Leu Leu Arg His Val Tyr His Ser Ser Met Gly Ala Leu 515 520 525His Leu Ser Lys Ser Gln Ala Thr Leu Phe Thr Phe Phe Leu Ser Ala 530 535 540Val Phe His Glu Met Ala Met Phe Ala Ile Phe Arg Arg Val Arg Gly545 550 555 560Tyr Leu Phe Met Phe Gln Leu Ser Gln Phe Val Trp Thr Ala Leu Ser 565 570 575Asn Thr Lys Phe Leu Arg Ala Arg Pro Gln Leu Ser Asn Val Val Phe 580 585 590Ser Phe Gly Val Cys Ser Gly Pro Ser Ile Ile Met Thr Leu Tyr Leu 595 600 605Thr Leu 6105133DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 51ctgcggccgc atcatgtctg ctgttaacgt tgc 335230DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 52ttctcgagtt aaccaatcaa ctcaccaaac 305335DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 53ctgcggccgc aggatgtctg ctaccaagtc aatcg

355434DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 54atctcgagct tagatctttt gttctggatt tctc 345532DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 55ctgcggccgc accatgaagt ttttcccact cc 325633DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 56ttctcgagtt agaacttttt gttttgcaac aag 335735DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 57ctgcggccgc aatatggatt tggtcttaga agtcg 355831DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 58aactcgagtc agttgttctt cttggtattt g 315934DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 59ctgcggccgc actatggcaa aggataatag tgag 346032DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 60ttctcgagct agaaaacata aggaataaag ac 32

Claims

1. A method for preparing 7-dehydrocholesterol and/or the biosynthetic intermediates and/or secondary products thereof by culturing organisms which, compared to the wild type, have an increased activity of at least one of the activities selected from the group consisting of .DELTA.8-.DELTA.7-isomerase activity, .DELTA.5-desaturase activity and .DELTA.24-reductase activity.

2. The method of claim 1, wherein the organisms, compared to the wild type, have an increased activity of at least two of the activities selected from the group consisting of .DELTA.8-.DELTA.7-isomerase activity, .DELTA.5-desaturase activity and .DELTA.24-reductase activity.

3. The method of claim 1, wherein the organisms, compared to the wild type, have an increased .DELTA.8-.DELTA.7-isomerase activity, .DELTA.5-desaturase activity and .DELTA.24-reductase activity.

4. The method of claim 1, wherein the .DELTA.8-.DELTA.7-isomerase activity is increased by increasing, compared to the wild type, gene expression of a nucleic acid encoding a .DELTA.8-.DELTA.7-isomerase.

5. The method of claim 4, wherein gene expression is increased by introducing into the organism one or more nucleic acids encoding a .DELTA.8-.DELTA.7-isomerase.

6. The method of claim 5, wherein nucleic acids are introduced, which encode proteins comprising the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which is at least 30% identical at the amino acid level with the sequence SEQ. ID. NO. 2, and having the enzyme property of a .DELTA.8-.DELTA.7-isomerase.

7. The method of claim 6, which comprises introducing a nucleic acid comprising the sequence SEQ. ID. NO. 1.

8. The method of claim 1, wherein the .DELTA.5-desaturase activity is increased by increasing, compared to the wild type, gene expression of a nucleic acid encoding a .DELTA.5-desaturase.

9. The method of claim 8, wherein gene expression is increased by introducing into the organism one or more nucleic acids encoding a .DELTA.5-desaturase.

10. The method of claim 9, wherein nucleic acids are introduced, which encode proteins comprising the amino acid sequence SEQ. ID. NO. 4 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which is at least 30% identical at the amino acid level with the sequence SEQ. ID. NO. 4, and having the enzyme property of a .DELTA.5-desaturase.

11. The method of claim 10, which comprises introducing a nucleic acid comprising the sequence SEQ. ID. NO. 3.

12. The method of claim 1, wherein the .DELTA.24-reductase activity is increased by increasing, compared to the wild type, gene expression of a nucleic acid encoding a .DELTA.24-reductase.

13. The method of claim 12, wherein gene expression is increased by introducing into the organism one or more nucleic acids encoding a .DELTA.24-reductase.

14. The method of claim 13, wherein nucleic acids are introduced, which encode proteins comprising the amino acid sequence SEQ. ID. NO. 6 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which is at least 30% identical at the amino acid level with the sequence SEQ. ID. NO. 6, and having the enzymic property of a .DELTA.24-reductase.

15. The method of claim 14, which comprises introducing a nucleic acid comprising the sequence SEQ. ID. NO. 5.

16. The method of claim 1, wherein the organisms, compared to the wild type, additionally have a reduced activity of at least one of the activities selected from the group consisting of C24-methyltransferase activity and .DELTA.22-desaturase activity.

17. The method of claim 16, wherein the organisms, compared to the wild type, have a reduced C24-methyltransferase activity and a reduced .DELTA.22-desaturase activity.

18. The method of claim 16, wherein the C24-methyltransferase activity is reduced by reducing, compared to the wild type, gene expression of a nucleic acid encoding a C24-methyltransferase.

19. The method of claim 18, wherein an organism is used, which has no functional C24-methyltransferase gene.

20. The method of claim 16, wherein the .DELTA.22-desaturase activity is reduced by reducing, compared to the wild type, gene expression of a nucleic acid encoding a .DELTA.22-desaturase.

21. The method of claim 20, wherein an organism is used, which has no functional .DELTA.22-desaturase gene.

22. The method of claim 1, wherein the organisms additionally have, compared to the wild type, an increased activity of at least one of the activities selected from the group consisting of HMG-CoA-reductase activity, lanosterol C14-demethylase activity, squalene-epoxidase activity, squalene-synthetase activity and sterol-acyltransferase activity.

23. The method of claim 22, wherein the organisms additionally have, compared to the wild type, an increased lanosterol C14-demethylase activity and an increased HMG-CoA-reductase activity.

24. The method of claim 22, wherein the lanosterol C14-demethylase activity is increased by increasing, compared to the wild type, gene expression of a nucleic acid encoding a lanosterol C14-demethylase.

25. The method of claim 24, wherein gene expression is increased by introducing into the organism one or more nucleic acids encoding a lanosterol C14-demethylase.

26. The method of claim 25, wherein nucleic acids are introduced, which encode proteins comprising the amino acid sequence SEQ. ID. NO. 8 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which is at least 30% identical at the amino acid level with the sequence SEQ. ID. NO. 8, and having the enzymic property of a lanosterol C14-demethylase.

27. The method of claim 26, which comprises introducing a nucleic acid comprising the sequence SEQ. ID. NO. 7.

28. The method of claim 22, wherein the HMG-CoA-reductase activity is increased by increasing, compared to the wild type, gene expression of a nucleic acid encoding an HMG-CoA reductase.

29. The method of claim 28, wherein gene expression is increased by introducing into the organism a nucleic acid construct comprising a nucleic acid which encodes an HMG-CoA reductase and whose expression in said organism, in comparison with the wild type, is subject to a reduced regulation.

30. The method of claim 29, wherein the nucleic acid construct contains a promoter which, in comparison with the wild-type promoter, is subjected to a reduced regulation in the organism.

31. The method of claim 29, wherein the HMG-CoA reductase-encoding nucleic acid used is a nucleic acid whose expression in the organism, in comparison with the orthologous nucleic acid intrinsic to said organism, is subject to a reduced regulation.

32. The method of claim 31, wherein the HMG-CoA reductase-encoding nucleic acid used is a nucleic acid which encodes the catalytic region of said HMG-CoA reductase.

33. The method of claim 32, wherein nucleic acids are introduced, which encode proteins comprising the amino acid sequence SEQ. ID. NO. 10 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which is at least 30% identical at the amino acid level with the sequence SEQ. ID. NO. 10, and having the enzyme property of a HMG-CoA reductase.

34. The method of claim 33, which comprises introducing a nucleic acid comprising the sequence SEQ. ID. NO. 9.

35. The method of claim 22, wherein an organism is used which, compared to the wild type, additionally has an increased squalene-epoxidase activity.

36. The method of claim 35, wherein the squalene-epoxidase activity is increased by increasing, compared to the wild type, gene expression of a nucleic acid encoding a squalene epoxidase.

37. The method of claim 36, wherein gene expression is increased by introducing into the organism one or more nucleic acids encoding a squalene epoxidase.

38. The method of claim 37, wherein nucleic acids are introduced, which encode proteins comprising the amino acid sequence SEQ. ID. NO. 12 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which is at least 30% identical at the amino acid level with the sequence SEQ. ID. NO. 12, and having the enzyme property of a squalene epoxidase.

39. The method of claim 38, which comprises introducing a nucleic acid comprising the sequence SEQ. ID. NO. 11.

40. The method of claim 1, wherein the organism used is yeast.

41. The method of claim 1, which comprises harvesting the organism, after culturing, and then isolating 7-dehydrocholesterol and/or the biosynthetic intermediates and/or secondary products thereof from said organism.

42. A nucleic acid construct, comprising at least one nucleic acid selected from the group consisting of nucleic acids encoding a .DELTA.8-.DELTA.7-isomerase, nucleic acids encoding a .DELTA.5-desaturase and nucleic acids encoding a .DELTA.24-reductase, which are functionally linked with one or more regulatory signals ensuring transcription and translation in organisms.

43. A nucleic acid construct of claim 42, additionally comprising at least one nucleic acid selected from the group consisting of nucleic acids encoding an HMG-CoA reductase, nucleic acids encoding a lanosterol C14-demethylase, nucleic acids encoding a squalene epoxidase, nucleic acids encoding a squalene synthetase and nucleic acids encoding a sterol acyltransferase, which are functionally linked with one or more regulatory signals ensuring transcription and translation in organisms.

44. A combination of nucleic acid constructs, which comprises at least one nucleic acid construct selected from the groups A to C A nucleic acid construct comprising nucleic acids encoding a .DELTA.8-.DELTA.7-isomerase, which are functionally linked to one or more regulatory signals ensuring transcription and translation in organisms, B nucleic acid construct comprising nucleic acids encoding a .DELTA.5-desaturase, which are functionally linked to one or more regulatory signals ensuring transcription and translation in organisms and C nucleic acid construct comprising nucleic acids encoding a .DELTA.24-reductase, which are functionally linked to one or more regulatory signals ensuring transcription and translation in organisms, and at least one nucleic acid construct selected from the groups D to H D nucleic acid construct comprising nucleic acids encoding an HMG-CoA reductase, which are functionally linked to one or more regulatory signals ensuring transcription and translation in organisms, E nucleic acid construct comprising nucleic acids encoding a lanosterol C14-demethylase, which are functionally linked to one or more regulatory signals ensuring transcription and translation in organisms, F nucleic acid construct comprising nucleic acids encoding a squalene epoxidase, which are functionally linked to one or more regulatory signals ensuring transcription and translation in organisms, G nucleic acid construct comprising nucleic acids encoding a squalene synthetase, which are functionally linked to one or more regulatory signals ensuring transcription and translation in organisms, H nucleic acid construct comprising nucleic acids encoding a sterol acyltransferase, which are functionally linked to one or more regulatory signals ensuring transcription and translation in organisms.

45. The nucleic acid construct of claim 42, wherein the regulatory signals comprise one or more promoters and one or more terminators, which ensure transcription and translation in organisms.

46. The nucleic acid construct of claim 42, wherein regulatory signals ensuring transcription and translation in yeasts are used.

47. A genetically modified organism, wherein the genetic modification increases at least one of the activities selected from the group consisting of .DELTA.8-.DELTA.7-isomerase activity, .DELTA.5-desaturase activity and .DELTA.24-reductase activity, compared to a wild type.

48. The genetically modified organism of claim 47, wherein the increase of at least one of the activities is caused by an increase in gene expression of at least one nucleic acid selected from the group consisting of nucleic acids encoding a .DELTA.8-.DELTA.7-isomerase, nucleic acids encoding a .DELTA.5-desaturase and nucleic acids encoding a .DELTA.24-reductase, compared to the wild type.

49. The genetically modified organism of claim 48, which contains two or more nucleic acids encoding a .DELTA.8-.DELTA.7-isomerase and/or two or more nucleic acids encoding a .DELTA.5-desaturase and/or two or more nucleic acids encoding a .DELTA.24-reductase.

50. The genetically modified organism of claim 47, wherein the genetic modification additionally reduces at least one of the activities selected from the group consisting of C24-methyltransferase activity and .DELTA.22-desaturase activity compared to a wild type.

51. The genetically modified organism of claim 50, wherein the reduction in at least one of the activities is caused by a reduction in gene expression of at least one nucleic acid selected from the group consisting of nucleic acids encoding a C24-methyltransferase and nucleic acids encoding a .DELTA.22-desaturase, compared to the wild type.

52. The genetically modified organism of claim 51, which has no functional C24-methyltransferase gene and/or .DELTA.22-desaturase gene.

53. The genetically modified organism of claim 47, wherein the genetic modification additionally increases at least one of the activities selected from the group consisting of HMG-CoA-reductase activity, lanosterol C14-demethylase activity, squalene-epoxidase activity, squalene-synthetase activity and sterol-acyltransferase activity, compared to a wild type.

54. The genetically modified organism of claim 53, wherein the increase in at least one of the activities is caused by an increase in gene expression of at least one nucleic acid selected from the group consisting of nucleic acids encoding an HMG-CoA-reductase activity, nucleic acids encoding a lanosterol C14-demethylase, nucleic acids encoding a squalene epoxidase, nucleic acids encoding a squalene synthetase and nucleic acids encoding a sterol acyltransferase, compared to the wild type.

55. The genetically modified organism of claim 54, which contains two or more nucleic acids encoding an HMG-CoA reductase and/or two or more nucleic acids encoding a lanosterol C14-demethylase and/or two or more nucleic acids encoding a squalene epoxidase and/or two or more nucleic acids encoding a squalene synthetase and/or two or more nucleic acids encoding a sterol acyltransferase.

56. The genetically modified organism of claim 47, which, compared to the wild type, has an increased content of 7-dehydrocholesterol and/or the biosynthetic intermediates and/or secondary products thereof.

57. The genetically modified organism of claim 47, wherein the organism used is yeast.

58. The use of a genetically modified organism as claimed in claim 47 for preparing 7-dehydrocholesterol and/or the biosynthetic intermediates and/or secondary products thereof.

59. The combination of nucleic acid constructs of claim 44, wherein the regulatory signals comprise one or more promoters and one or more terminators, which ensure transcription and translation in organisms.

60. The combination of nucleic acid constructs of claim 44, wherein regulatory signals ensuring transcription and translation in yeasts are used.