U.S. patent application number 12/854520 was filed with the patent office on 2011-06-09 for herbicide-resistant sunflower plants, polynucleotides encoding herbicide-resistant acetohydroxy acid synthase large subunit proteins, and methods of use.
This patent application is currently assigned to BASF Agrochemical Products B.V.. Invention is credited to Alberto Javier Leon, Monica Mariel Morata, Andres D. Zambellim.
Application Number | 20110138503 12/854520 |
Document ID | / |
Family ID | 35447401 |
Filed Date | 2011-06-09 |
United States Patent
Application |
20110138503 |
Kind Code |
A1 |
Leon; Alberto Javier ; et
al. |
June 9, 2011 |
HERBICIDE-RESISTANT SUNFLOWER PLANTS, POLYNUCLEOTIDES ENCODING
HERBICIDE-RESISTANT ACETOHYDROXY ACID SYNTHASE LARGE SUBUNIT
PROTEINS, AND METHODS OF USE
Abstract
Herbicide-resistant sunflower plants, isolated polynucleotides
that encode herbicide resistant and wild type acetohydroxyacid
synthase large subunit (AHASL) polypeptides, and the amino acid
sequences of these polypeptides, are described. Expression
cassettes and transformation vectors comprising the polynucleotides
of the invention, as well as plants and host cells transformed with
the polynucleotides, are described. Methods of using the
polynucleotides to enhance the resistance of plants to herbicides,
and methods for controlling weeds in the vicinity of
herbicide-resistant plants are also described.
Inventors: |
Leon; Alberto Javier; (Mar
del Plata, AR) ; Morata; Monica Mariel; (Mar del
Plata, AR) ; Zambellim; Andres D.; (Mar del Plata,
AR) |
Assignee: |
BASF Agrochemical Products
B.V.
Arnhem
NL
Advanta Seeds B.V.
Kapelle
NL
|
Family ID: |
35447401 |
Appl. No.: |
12/854520 |
Filed: |
August 11, 2010 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11659007 |
Jun 29, 2007 |
7807882 |
|
|
PCT/EP2005/008265 |
Jul 29, 2005 |
|
|
|
12854520 |
|
|
|
|
60592471 |
Jul 30, 2004 |
|
|
|
Current U.S.
Class: |
800/300 |
Current CPC
Class: |
C12N 15/8274 20130101;
C12N 9/88 20130101; C12N 15/8278 20130101 |
Class at
Publication: |
800/300 |
International
Class: |
A01H 5/00 20060101
A01H005/00 |
Claims
1-82. (canceled)
83. An isolated, recombinant, mutagenized, or synthetic
polynucleotide, or a complement thereof, said polynucleotide
comprising a nucleotide sequence encoding an AHASL1 polypeptide
comprising the amino acid sequence set forth in SEQ ID NO:2 or
6.
84. The polynucleotide of claim 83, wherein the nucleotide sequence
is as set forth in SEQ ID NO:1 or 5.
85. A vector comprising the polynucleotide of claim 83 operably
linked to a promoter.
86. A host cell transformed with the polynucleotide of claim
83.
87. The host cell of claim 86, wherein the host cell is a plant
cell capable of growing into a plant.
88. A method for selecting for the plant cell of claim 87, wherein
the method comprises: (a) exposing the plant cell to an herbicide
at a concentration that inhibits the growth of an untransformed
plant cell; and (b) identifying the plant cell by its ability to
grow in the presence of the herbicide.
89. A plant comprising plant cells having the polynucleotide of
claim 83.
90. The plant of claim 89, wherein the plant is a descendant of
line MUT28, a representative sample of seed of line MUT28 having
been deposited under ATCC Patent Deposit Number PTA-6084, wherein
the descendant comprises plant cells having the polynucleotide.
91. The plant of claim 90, wherein the plant comprises the
herbicide-tolerance characteristics of line MUT28.
92. The plant of claim 91, wherein the herbicide-tolerance
characteristics is non-transgenic.
93. A seed of the plant of claim 90.
94. The seed of claim 93, wherein the seed is treated with an
herbicide.
95. The seed of claim 94, wherein the herbicide is an imidazolinone
herbicide.
96. The seed of claim 94, wherein the herbicide is:
2-(4-isopropyl-4-methyl-5-oxo-2-imidiazolin-2-yl)-nicotinic acid;
2-(4-isopropyl-4-methyl-5-oxo-2-imidazolin-2-yl)-3-quinolinecarboxylic
acid;
5-ethyl-2-(4-isopropyl-4-methyl-5-oxo-2-imidazolin-2-yl)-nicotinic
acid;
2-(4-isopropyl-4-methyl-5-oxo-2-imidazolin-2-yl)-5-(methoxymethyl)--
nicotinic acid;
2-(4-isopropyl-4-methyl-5-oxo-2-imidazolin-2-yl)-5-methylnicotinic
acid; mixtures of methyl
6-(4-isopropyl-4-methyl-5-oxo-2-imidazolin-2-yl)-m-toluate and
methyl 2-(4-isopropyl-4-methyl-5-oxo-2-imidazolin-2-yl)-p-toluate;
or combinations thereof.
97. The seed of claim 94, wherein the herbicide is: chlorsulfuron,
metsulfuron methyl, sulfometuron methyl, chlorimuron ethyl,
thifensulfuron methyl, tribenuron methyl, bensulfuron methyl,
nicosulfuron, ethametsulfuron methyl, rimsulfuron, triflusulfuron
methyl, triasulfuron, primisulfuron methyl, cinosulfuron,
amidosulfuron, flazasulfuron, imazosulfuron, pyrazosulfuron ethyl,
halosulfuron, or mixtures thereof.
98. The seed of claim 94, wherein the herbicide is selected from
the group consisting of imidazolinone herbicides, sulfonylurea
herbicides, triazolopyrimidine herbicides, pyrimidinyloxybenzoate
herbicides, sulfonylamino-carbonyltriazolinone herbicides, and
mixtures thereof.
99. A method for controlling weeds in the vicinity of a plant, the
method comprising: applying an effective amount of an herbicide to
the weeds and to the plant, wherein the plant is the plant of claim
90.
100. The method of claim 99, wherein the herbicide is:
2-(4-isopropyl-4-methyl-5-oxo-2-imidiazolin-2-yl)-nicotinic acid;
2-(4-isopropyl-4-methyl-5-oxo-2-imidazolin-2-yl)-3-quinolinecarboxylic
acid;
5-ethyl-2-(4-isopropyl-4-methyl-5-oxo-2-imidazolin-2-yl)-nicotinic
acid;
2-(4-isopropyl-4-methyl-5-oxo-2-imidazolin-2-yl)-5-(methoxymethyl)--
nicotinic acid;
2-(4-isopropyl-4-methyl-5-oxo-2-imidazolin-2-yl)-5-methylnicotinic
acid; mixtures of methyl
6-(4-isopropyl-4-methyl-5-oxo-2-imidazolin-2-yl)-m-toluate and
methyl 2-(4-isopropyl-4-methyl-5-oxo-2-imidazolin-2-yl)-p-toluate;
or combinations thereof.
101. The method of claim 99, wherein the herbicide is:
chlorsulfuron, metsulfuron methyl, sulfometuron methyl, chlorimuron
ethyl, thifensulfuron methyl, tribenuron methyl, bensulfuron
methyl, nicosulfuron, ethametsulfuron methyl, rimsulfuron,
triflusulfuron methyl, triasulfuron, primisulfuron methyl,
cinosulfuron, amidosulfuron, flazasulfuron, imazosulfuron,
pyrazosulfuron ethyl, halosulfuron, or mixtures thereof.
102. The method of claim 99, wherein the herbicide is selected from
the group consisting of imidazolinone herbicides, sulfonylurea
herbicides, triazolopyrimidine herbicides, pyrimidinyloxybenzoate
herbicides, sulfonylamino-carbonyltriazolinone herbicides, and
mixtures thereof.
Description
FIELD OF THE INVENTION
[0001] This invention relates to the field of agricultural
biotechnology, particularly to herbicide-resistant sunflower plants
and novel polynucleotide sequences that encode wild-type and
imidazolinone-resistant sunflower acetohydroxyacid synthase large
subunit proteins.
BACKGROUND OF THE INVENTION
[0002] Acetohydroxyacid synthase (AHAS; EC 4.1.3.18, also known as
acetolactate synthase or ALS), is the first enzyme that catalyzes
the biochemical synthesis of the branched chain amino acids valine,
leucine and isoleucine (Singh (1999) "Biosynthesis of valine,
leucine and isoleucine," in Plant Amino Acid, Singh, B. K., ed.,
Marcel Dekker Inc. New York, N.Y., pp. 227-247). AHAS is the site
of action of five structurally diverse herbicide families including
the sulfonylureas (Tan et al. (2005) Pest Manag. Sci. 61:246-57;
Mallory-Smith and Retzinger (2003) Weed Technology 17:620-626;
'LaRossa and Falco (1984) Trends Biotechnol. 2:158-161), the
imidazolinones (Shaner et al. (1984) Plant Physiol. 76:545-546),
the triazolopyrimidines (Subramanian and Gerwick (1989) "Inhibition
of acetolactate synthase by triazolopyrimidines," in Biocatalysis
in Agricultural Biotechnology, Whitaker, J. R. and Sonnet, P. E.
eds., ACS Symposium Series, American Chemical Society, Washington,
D.C., pp. 277-288), t Tan et al. (2005) Pest Manag. Sci. 61:246-57;
Mallory-Smith and Retzinger (2003) Weed Technology 17:620-626, the
sulfonylamino-carbonyltriazolinones (Tan et al. (2005) Pest Manag.
Sci. 61:246-57; Mallory-Smith and Retzinger (2003) Weed Technology
17:620-626). Imidazolinone and sulfonylurea herbicides are widely
used in modern agriculture due to their effectiveness at very low
application rates and relative non-toxicity in animals. By
inhibiting AHAS activity, these families of herbicides prevent
further growth and development of susceptible plants including many
weed species. Several examples of commercially available
imidazolinone herbicides are PURSUIT.RTM. (imazethapyr),
SCEPTER.RTM. (imazaquin) and ARSENAL.RTM. (imazapyr). Examples of
sulfonylurea herbicides are chlorsulfuron, metsulfuron methyl,
sulfometuron methyl, chlorimuron ethyl, thifensulfuron methyl,
tribenuron methyl, bensulfuron methyl, nicosulfuron,
ethametsulfuron methyl, rimsulfuron, triflusulfuron methyl,
triasulfuron, primisulfuron methyl, cinosulfuron, amidosulfiuon,
fluzasulfuron, imazosulfuron, pyrazosulfuron ethyl and halo
sulfuron.
[0003] Due to their high effectiveness and low-toxicity,
imidazolinone herbicides are favored for application by spraying
over the top of a wide area of vegetation. The ability to spray a
herbicide over the top of a wide range of vegetation decreases the
costs associated with plantation establishment and maintenance, and
decreases the need for site preparation prior to use of such
chemicals. Spraying over the top of a desired tolerant species also
results in the ability to achieve maximum yield potential of the
desired species due to the absence of competitive species. However,
the ability to use such spray-over techniques is dependent upon the
presence of imidazolinone-resistant species of the desired
vegetation in the spray over area.
[0004] Among the major agricultural crops, some leguminous species
such as soybean are naturally resistant to imidazolinone herbicides
due to their ability to rapidly metabolize the herbicide compounds
(Shaner and Robinson (1985) Weed Sci. 33:469-471). Other crops such
as corn (Newhouse et al. (1992) Plant Physiol. 100:882886) and rice
(Barrett et al. (1989) Crop Safeners for Herbicides, Academic
Press, New York, pp. 195-220) are somewhat susceptible to
imidazolinone herbicides. The differential sensitivity to the
imidazolinone herbicides is dependent on the chemical nature of the
particular herbicide and differential metabolism of the compound
from a toxic to a non-toxic form in each plant (Shaner et al.
(1984) Plant Physiol. 76:545-546; Brown et al., (1987) Pestic.
Biochem. Physiol. 27:24-29). Other plant physiological differences
such as absorption and translocation also play an important role in
sensitivity (Shatter and Robinson (1985) Weed Sci. 33:469-471).
[0005] Plants resistant to imidazolinones, sulfonylureas and
triazolopyrimidines have been successfully produced using seed,
microspore, pollen, and callus mutagenesis in Zea mays, Arabidopsis
thaliana, Brassica napus (i.e., canola) Glycine max, Nicotiana
tabacum, and Oryza sativa (Sebastian et al. (1989) Crop Sci.
29:1403-1408; Swanson et al., 1989 Theor. Appl. Genet. 78:525-530;
Newhouse et al. (1991) Theor. Appl. Genet. 83:65-70; Sathasivan et
al. (1991) Plant Physiol. 97:1044-1050; Mourand et al. (1993) J.
Heredity 84:91-96; U.S. Pat. No. 5,545,822). In all cases, a
single, partially dominant nuclear gene conferred resistance. Four
imidazolinone resistant wheat plants were also previously isolated
following seed mutagenesis of Triticum aestivum L. cv. Fidel
(Newhouse et al. (1992) Plant Physiol. 100:882-886). Inheritance
studies confirmed that a single, partially dominant gene conferred
resistance. Based on allelic studies, the authors concluded that
the mutations in the four identified lines were located at the same
locus. One of the Fidel cultivar resistance genes was designated
FS-4 (Newhouse et al. (1992) Plant Physiol. 100:882-886).
[0006] Naturally occurring plant populations that were discovered
to be resistant to imidazolinone and/or sulfonylurea herbicides
have also been used to develop herbicide-resistant sunflower
breeding lines. Recently, two sunflower lines that are resistant to
a sulfonylurea herbicide were developed using germplasm originating
from a wild population of common sunflower (Helianthus annuus) as
the source of the herbicide-resistance trait (Miller and Al-Khatib
(2004) Crop Sci. 44:1037-1038). Previously, White et al. ((2002)
Weed Sci. 50:432-437) had reported that individuals from a wild
population of common sunflower from South Dakota, U.S.A. were
cross-resistant to an imidazolinone and a sulfonylurea herbicide.
Analysis of a portion of the coding region of the acetohydroxyacid
synthase large subunit (AHASL) genes of individuals from this
population revealed a point mutation that results in an Ala-to-Val
amino acid substitution in the sunflower AHASL protein that
corresponds to Ala.sub.205 in the wild-type Arabidopsis thaliana
AHASL protein (White et al. (2003) Weed Sci. 51:845-853).
[0007] Computer-based modeling of the three dimensional
conformation of the AHAS-inhibitor complex predicts several amino
acids in the proposed inhibitor binding pocket as sites where
induced mutations would likely confer selective resistance to
imidazolinones (Ott et al. (1996) J. Mol. Biol. 263:359-368). Wheat
plants produced with some of these rationally designed mutations in
the proposed binding sites of the AHAS enzyme have in fact
exhibited specific resistance to a single class of herbicides (Ott
et al. (1996) J. Mol. Biol. 263:359-368).
[0008] Plant resistance to imidazolinone herbicides has also been
reported in a number of patents. U.S. Pat. Nos. 4,761,373,
5,331,107, 5,304,732, 6,211,438, 6,211,439 and 6,222,100 generally
describe the use of an altered AHAS gene to elicit herbicide
resistance in plants, and specifically discloses certain
imidazolinone resistant corn lines. U.S. Pat. No. 5,013,659
discloses plants exhibiting herbicide resistance due to mutations
in at least one amino acid in one or more conserved regions. The
mutations described therein encode either cross-resistance for
imidazolinones and sulfonylureas or sulfonylurea-specific
resistance, but imidazolinone-specific resistance is not described.
U.S. Pat. No. 5,731,180 and U.S. Pat. No. 5,767,361 discuss an
isolated gene having a single amino acid substitution in a
wild-type monocot AHAS amino acid sequence that results in
imidazolinone-specific resistance. In addition, rice plants that
are resistant to herbicides that interfere with AHAS have been
developed by mutation breeding and also by the selection of
herbicide resistant plants from a pool of rice plants produced by
anther culture. See, U.S. Pat. Nos. 5,545,822, 5,736,629,
5,773,703, 5,773,704, 5,952,553 and 6,274,796.
[0009] In plants, as in all other organisms examined, the AHAS
enzyme is comprised of two subunits: a large subunit (catalytic
role) and a small subunit (regulatory role) (Duggleby and Pang
(2000) J. Biochem. Mol. Biol. 33:1-36). The AHAS large subunit
(also referred to herein as AHASL) may be encoded by a single gene
as in the case of Arabidopsis and rice or by multiple gene family
members as in maize, canola, and cotton. Specific,
single-nucleotide substitutions in the large subunit confer upon
the enzyme a degree of insensitivity to one or more classes of
herbicides (Chang and Duggleby (1998) Biochem J. 333:765-777).
[0010] For example, bread wheat, Triticum aestivum L., contains
three homoeologous acetohydroxyacid synthase large subunit genes.
Each of the genes exhibit significant expression based on herbicide
response and biochemical data from mutants in each of the three
genes (Ascenzi et al. (2003) International Society of Plant
Molecular Biologists Congress, Barcelona, Spain, Ref. No. S10-17).
The coding sequences of all three genes share extensive homology at
the nucleotide level (WO 03/014357). Through sequencing the AHASL
genes from several varieties of Triticum aestivum, the molecular
basis of herbicide tolerance in most IMI-tolerant
(imidazolinone-tolerant) lines was found to be the mutation
S653(At)N, indicating a serine to asparagine substitution at a
position equivalent to the serine at amino acid 653 in Arabidopsis
thaliana (WO 03/01436; WO 03/014357). This mutation is due to a
single nucleotide polymorphism (SNP) in the DNA sequence encoding
the AHASL protein.
[0011] Given their high effectiveness and low-toxicity,
imidazolinone herbicides are favored for agricultural use. However,
the ability to use imidazolinone herbicides in a particular crop
production system depends upon the availability of
imidazolinone-resistant varieties of the crop plant of interest. To
produce such imidazolinone-resistant varieties, plant breeders need
to develop breeding lines with the imidazolinone-resistance trait.
Thus, additional imidazolinone-resistant breeding lines and
varieties of crop plants, as well as methods and compositions for
the production and use of imidazolinone-resistant breeding lines
and varieties, are needed.
SUMMARY OF THE INVENTION
[0012] The present invention provides sunflower plants having
increased resistance to herbicides when compared to a wild-type
sunflower plant. In particular, the sunflower plants of the
invention have increased resistance to at least one herbicide that
interferes with the activity of the AHAS enzyme when compared to a
wild-type sunflower plant. The herbicide resistant sunflower plants
of the invention comprise at least one copy of a gene or
polynucleotide that encodes a herbicide-resistant acetohydroxyacid
synthase large subunit 1 (AHASL1). Such a herbicide-resistant
AHASL1 protein comprises a leucine, alanine, threonine, histidine,
arginine, or isoleucine at amino acid position 182 or equivalent
position. The herbicide-resistant sunflower plant of the invention
can contain one, two, three, four, or more copies of a gene or
polynucleotide encoding a herbicide-resistant AHASL1 protein of the
invention. The sunflower plants of the invention also include seeds
and progeny plants that comprise at least one copy of a gene or
polynucleotide encoding a herbicide-resistant AHASL1 protein of the
invention.
[0013] In one embodiment, the present invention provides
herbicide-resistant sunflower plants that are from the sunflower
line that has been designated as MUT28. A sample of seeds of the
MUT28 line has been deposited with the American Type Culture
Collection (ATCC) as ATCC Patent Deposit No. PTA-6084. Such MUT28
sunflower plants comprise in their genomes an AHASL1 gene that
comprises the nucleotide sequence set forth in SEQ ID NO: 1 and
that encodes the AHASL1 protein comprising, the amino acid sequence
set forth in SEQ ID NO: 2. When compared to the amino acid sequence
of the AHASL1 protein (SEQ ID NO: 4) that is encoded by an AHASL1
gene (SEQ ID NO: 3) from a wild-type sunflower plant, the amino
acid sequence set forth in SEQ ID NO: 2 has a single amino acid
difference from the wild-type amino acid sequence. In the amino
acid sequence set forth in SEQ ID NO: 2, there is a leucine at
amino acid position 182. In the wild-type amino acid sequence set
forth in SEQ ID NO: 4, this same amino acid position has a
proline.
[0014] The present invention further provides isolated
polynucleotides and isolated polypeptides for sunflower (Helianthus
annuus) AHASL1 proteins. The polynucleotides of the invention
encompass nucleotide sequences that encode herbicide-resistant and
wild-type AHASL1 proteins. The herbicide-resistant AHASL1 proteins
of the invention are herbicide-resistant AHASL1 proteins that
possess a proline-to-leucine substitution at position 182 in their
respective amino acid sequences, when compared to the corresponding
wild-type amino acid sequence. The polynucleotides of the invention
encompass the nucleotide sequences set forth in SEQ ID NOS: 1 and
3, nucleotide sequences encoding the amino acid sequences set forth
in SEQ ID NOS: 2 and 4, and fragments and variants of said
nucleotide sequences that encode proteins comprising AHAS activity.
The polynucleotides of the invention further encompass nucleotide
sequences that encode mature forms of the AHASL1 proteins described
above particularly the nucleotides sequences SEQ ID NOS: 5 and 7,
nucleotide sequences encoding the amino acid sequences set forth in
SEQ ID NOS: 6 and 8, and fragments and variants of said nucleotide
sequences that encode proteins comprising AHAS activity. Such
mature forms of AHASL1 proteins lack the chloroplast transit
peptide that is part of the full-length AHASL1 proteins.
[0015] The present invention provides expression cassettes for
expressing the polynucleotides of the invention in plants, plant
cells, and other, non-human host cells. The expression cassettes
comprise a promoter expressible in the plant, plant cell, or other
host cells of interest operably linked to a polynucleotide of the
invention that encodes either a wild-type or herbicide-resistant
AHASL1 protein. If necessary for targeting expression to the
chloroplast, the expression cassette can also comprise an operably
linked chloroplast-targeting sequence that encodes of a chloroplast
transit peptide to direct an expressed AHASL1 protein to the
chloroplast. The expression cassettes of the invention find use in
a method for enhancing the herbicide tolerance of a plant and a
host cell. The method involves transforming the plant or host cell
with an expression cassette of the invention, wherein the
expression cassette comprises a promoter that is expressible in the
plant or host cell of interest and the promoter is operably linked
to a polynucleotide of the invention that encodes an
herbicide-resistant AHASL1 protein of the invention. The method
further comprises regenerating a transformed plant from the
transformed plant cell.
[0016] The present invention provides a method for increasing AHAS
activity in a plant comprising transforming a plant cell with a
polynucleotide construct comprising a nucleotide sequence operably
linked to a promoter that drives expression in a plant cell and
regenerating a transformed plant from the transformed plant cell.
The nucleotide sequence is selected from those nucleotide sequences
that encode the herbicide-resistant or wild-type AHASL1 proteins of
the invention, particularly the nucleotide sequences set forth in
SEQ ID NOS: 1, 3, 5, and 7, nucleotide sequences encoding the amino
acid sequences set forth in SEQ ID NOS: 2, 4, 6, and 8, and
fragments and variants thereof. A plant produced by this method
comprises increased AHAS activity, when compared to an
untransformed plant.
[0017] The present invention provides a method for producing a
herbicide-resistant plant comprising transforming a plant cell with
a polynucleotide construct comprising a nucleotide sequence
operably linked to a promoter that drives expression in a plant
cell and regenerating a transformed plant from said transformed
plant cell. The nucleotide sequence is selected from those
nucleotide sequences that encode the herbicide-resistant AHASL1
proteins of the invention, particularly the nucleotide sequences
set forth in SEQ ID NOS: 1 and 5, nucleotide sequences encoding the
amino acid sequences set forth in SEQ ID NOS: 2 and 6, and
fragments and variants thereof, including, but not limited to, the
mature forms of the herbicide-resistant AHASL1 proteins of the
invention. A herbicide-resistant plant produced by this method
comprises enhanced resistance, compared to an untransformed plant,
to at least one herbicide, particularly a herbicide that interferes
with the activity of the AHAS enzyme such as, for example, an
imidazolinone herbicide or a sulfonylurea herbicide.
[0018] The present invention provides a method for enhancing
herbicide-tolerance in a herbicide-tolerant plant. The method finds
use in enhancing the resistance of a plant that already is
resistant to a level of a herbicide that would kill or
significantly injure a wild-type plant. Such a herbicide-tolerant
plant can be a herbicide-tolerant plant that has been genetically
engineered for herbicide-tolerance or a herbicide-tolerant plant
that was developed by means that do not involve recombinant DNA
such as, for example, the MUT28 sunflower plants of the present
invention. The method comprises transforming a herbicide-tolerant
plant with a polynucleotide construct comprising a nucleotide
sequence operably linked to a promoter that drives expression in a
plant cell and regenerating a transformed plant from the
transformed plant cell. The nucleotide sequence is selected from
those nucleotide sequences that encode the herbicide-resistant
AHASL1 proteins of the invention, particularly the nucleotide
sequences set forth in SEQ ID NO: 1 and 5, nucleotide sequences
encoding the amino acid sequences set forth in SEQ ID NO: 2 and 6,
and fragments and variants thereof.
[0019] The present invention provides transformation vectors
comprising a selectable marker gene of the invention. The
selectable marker gene comprises a promoter that drives expression
in a host cell operably linked to a polynucleotide comprising a
nucleotide sequence that encodes an herbicide-resistant AHASL1
protein of the invention. The transformation vector can
additionally comprise a gene of interest to be expressed in the
host cell and can also, if desired, include a chloroplast-targeting
sequence that is operably linked to the polynucleotide of the
invention.
[0020] The present invention further provides methods for using the
transformation vectors of the invention to select for cells
transformed with the gene of interest. Such methods involve the
transformation of a host cell with the transformation vector,
exposing the cell to a level of an imidazolinone or sulfonylurea
herbicide that would kill or inhibit the growth of a
non-transformed host cell, and identifying the transformed host
cell by its ability to grow in the presence of the herbicide. In
one embodiment of the invention, the host cell is a plant cell and
the selectable marker gene comprises a promoter that drives
expression in a plant cell.
[0021] The present invention provides a method for controlling
weeds in the vicinity of the herbicide-resistant plants of the
invention, including the herbicide-resistant sunflower plants
described above and plants transformed with the herbicide-resistant
AHASL1 polynucleotides of the invention. Such transformed plants
comprise in their genomes at least one expression cassette
comprising a promoter that drives gene expression in a plant cell,
wherein the promoter is operably linked to an AHASL1 polynucleotide
of the invention. The method comprises applying an effective amount
of an herbicide to the weeds and to the herbicide-resistant plant,
wherein the herbicide-resistant plant, plant has increased
resistance to at least one herbicide, particularly an imidazolinone
or sulfonylurea herbicide, when compared to a wild-type or
untransformed plant.
[0022] The plants of the present invention can be transgenic or
non-transgenic. An example of a non-transgenic sunflower plant
having increased resistance to imidazolinone and/or sulfonylurea
herbicides includes the sunflower plant (MUT28) having ATCC Patent
Deposit No. PTA-6084; or mutant, recombinant, or a genetically
engineered derivative of the plant having ATCC Patent Deposit No.
PTA-6084; or of any progeny of the plant having ATCC Patent Deposit
No. PTA-6084; or a plant that is a progeny of any of these plants;
or a plant that comprises the herbicide resistance characteristics
of the plant having ATCC Patent Deposit No. PTA-6084.
[0023] The present invention also provides plants, plant organs,
plant tissues, plant cells, seeds, and non-human host cells that
are transformed with the at least one polynucleotide, expression
cassette, or transformation vector of the invention. Such
transformed plants, plant organs, plant tissues, plant cells,
seeds, and non-human host cells have enhanced tolerance or
resistance to at least one herbicide, at levels of the herbicide
that kill or inhibit the growth of an untransformed plant, plant
tissue, plant cell, or non-human host cell, respectively.
Preferably, the transformed plants, plant tissues, plant cells, and
seeds of the invention are Arabidopsis thaliana and crop
plants.
[0024] The present invention further provides isolated polypeptides
comprising imidazolinone-resistant and wild-type sunflower AHASL1
proteins. The isolated polypeptides comprise the amino acid
sequences set forth in SEQ ID NOS: 2 and 4, the amino acid
sequences encoded by nucleotide sequences set forth in SEQ ID NOS:
1 and 3, and fragments and variants of said amino acid sequences
that encode proteins comprising AHAS activity, including, but not
limited to, the mature forms of the AHASL1 proteins of the
invention that are set forth in SEQ ID NOS: 6 and 8 and those
encoded by the nucleotide sequences set forth in SEQ ID NOS: 5 and
7.
BRIEF DESCRIPTION THE DRAWINGS
[0025] FIG. 1 is a nucleotide sequence alignment of the complete
coding sequences of the herbicide-resistant sunflower AHASL1 gene
(SEQ ID NO: 1), the wild-type sunflower AHASL1 gene (SEQ ID NO: 3)
and a herbicide-resistant AHASL1 gene from Xanthium sp. (SEQ ID NO:
9, GenBank Accession No. U16280). In the figure, 1248-3, HA89, and
Xanthium refer to SEQ ID NOS: 1, 3, and 9, respectively. The
asterisk indicates the site of the single mutation found in the
herbicide-resistant sunflower AHASL1 coding sequence. The mutation
is a C-to-T transition in nucleotide 545 (codon 182) of SEQ ID NO:
1. Light-shaded regions indicate that the nucleotide at that
position is conserved across the three aligned sequences.
Dark-shaded regions indicate that the nucleotide at that position
is conserved in two of the three sequences.
[0026] FIG. 2 is an amino acid sequence alignment of the
herbicide-resistant sunflower AHASL1 protein (SEQ ID NO: 2), the
wild-type sunflower AHASL1 protein (SEQ ID NO: 4) and a
herbicide-resistant AHASL1 protein from Xanthium sp. (SEQ ID NO:
10, GenBank Accession No U16280). In the figure, 1248-3, HA89, and
Xanthium refer to SEQ ID NOS: 2, 4, and 10, respectively. The
asterisk indicates the site of the single amino acid substitution
found in the herbicide-resistant sunflower AHASL1 protein. In the
herbicide resistant protein (SEQ ID NO: 2) the proline at amino
acid number 182 of the wild-type protein (SEQ ID NO: 4) is
substituted with a leucine. Light-shaded regions indicate that the
amino acid at that position is conserved across the three aligned
sequences. Dark-shaded regions indicate that the amino acid at that
position is conserved in two of the three sequences. Amino acids
represented by bold-face type indicate conservative amino acid
substitutions.
SEQUENCE LISTING
[0027] The nucleotide and amino acid sequences listed in the
accompanying sequence listing are shown using standard letter
abbreviations for nucleotide bases, and three-letter code for amino
acids. The nucleotide sequences follow the standard convention of
beginning at the 5' end of the sequence and proceeding forward
(i.e., from left to right in each line) to the 3' end. Only one
strand of each nucleic acid sequence is shown, but the
complementary strand is understood to be included by any reference
to the displayed strand. The amino acid sequences follow the
standard convention of beginning at the amino terminus of the
sequence and proceeding forward (i.e., from left to right in each
line) to the carboxy terminus.
[0028] SEQ ID NO: 1 sets forth the nucleotide sequence encoding the
herbicide-resistant AHASL1 protein from sunflower. By comparison to
GenBank Accession No. U16280, the mature form of the AHASL1 protein
is encoded by the nucleotide sequence corresponds to nucleotides
253 to 1965 of SEQ ID NO: 1, and the transit peptide is encoded by
nucleotides 1 to 252.
[0029] SEQ ID NO: 2 sets forth the amino acid sequence of the
herbicide-resistant AHASL1 protein from sunflower. By comparison to
GenBank Accession No. U16280, the amino acid sequence of the mature
form of the AHASL1 protein corresponds to amino acids 85 to 655 of
SEQ ID NO: 2, and the transit peptide corresponds to amino acids 1
to 84.
[0030] SEQ ID NO: 3 sets forth the nucleotide sequence encoding the
AHASL1 protein from sunflower. By comparison to GenBank Accession
No. U16280, the mature form of the AHASL1 protein is encoded by the
nucleotide sequence corresponds to nucleotides 253 to 1965 of SEQ
ID NO: 3, and the transit peptide is encoded by nucleotides 1 to
252.
[0031] SEQ ID NO: 4 sets forth the amino acid sequence of the
AHASL1 protein from sunflower. By comparison to GenBank Accession
No. U16280, the amino acid sequence of the mature form of the
AHASL1 protein corresponds to amino acids 85 to 655 of SEQ ID NO:
4, and the transit peptide corresponds to amino acids 1 to 84.
[0032] SEQ ID NO: 5 sets forth the nucleotide sequence encoding the
mature, herbicide-resistant AHASL1 protein from sunflower. This
nucleotide sequence corresponds to nucleotides 253 to 1965 of SEQ
ID NO: 1.
[0033] SEQ ID NO: 6 sets forth the amino acid sequence of the
mature, herbicide-resistant AHASL1 protein from sunflower. This
amino acid sequence corresponds to amino acids 85 to 655 of SEQ ID
NO: 2.
[0034] SEQ ID NO: 7 sets forth the nucleotide sequence encoding the
mature AHASL1 protein from sunflower. This nucleotide sequence
corresponds to nucleotides 253 to 1965 of SEQ ID NO: 3.
[0035] SEQ ID NO: 8 sets forth the amino acid sequence of the
mature AHASL1 protein from sunflower. This amino acid sequence
corresponds to amino acids 85 to 655 of SEQ ID NO: 4.
[0036] SEQ ID NO: 9 sets forth the nucleotide sequence of GenBank
Accession No. U16280.
[0037] SEQ ID NO: 10 sets forth the amino acid sequence of GenBank
Accession No. U16280.
[0038] SEQ ID NO: 11 sets forth the nucleotide sequence of the
ALS1-1F primer that is described in Example 2.
[0039] SEQ ID NO: 12 sets forth the nucleotide sequence of the
ALS1-1R primer that is described in Example 2.
[0040] SEQ ID NO: 13 sets forth the nucleotide sequence of the
ALS1-2F primer that is described in Example 2.
[0041] SEQ ID NO: 14 sets forth the nucleotide sequence of the
ALS1-2R primer that is described in Example 2.
[0042] SEQ ID NO: 15 sets forth the nucleotide sequence of the
ALS1-3F primer that is described in Example 2.
[0043] SEQ ID NO: 16 sets forth the nucleotide sequence of the
ALS1-3R primer that is described in Example 2.
[0044] SEQ ID NO: 17 sets forth the nucleotide sequence of the
ALS-3F primer that is described in Example 2.
[0045] SEQ ID NO: 18 sets forth the nucleotide sequence of the
SUNALS1F primer that is described in Example 2.
[0046] SEQ ID NO: 19 sets forth the nucleotide sequence of the
ALS-6R primer that is described in Example 2.
DETAILED DESCRIPTION OF THE INVENTION
[0047] The present invention relates to sunflower plants having
increased resistance to herbicides when compared to a wild-type
sunflower plant. Herbicide resistant sunflower plants were produced
as described hereinbelow by exposing wild-type (with respect to
herbicide resistance) sunflower plants to a mutagen, allowing the
plants to mature and reproduce, and selecting progeny plants that
displayed enhanced resistance to an imidazolinone herbicide,
relative to the resistance of a wild-type sunflower plant. The
invention provides a herbicide resistant sunflower line that is
referred to herein as MUT28.
[0048] From the MUT28 herbicide-resistant sunflower plants and
wild-type sunflower plants, the coding region of an
acetohydroxyacid synthase large subunit gene (designated as AHASL1)
was isolated by polymerase chain reaction (PCR) amplification and
sequenced. By comparing the polynucleotide sequences of the
herbicide resistant and wild-type sunflower plants, it was
discovered that the coding region of the AHASL1 polynucleotide
sequence from the herbicide resistant sunflower plant differed from
the AHASL1 polynucleotide sequence of the wild type plant by a
single nucleotide, a C-to-T transition at nucleotide 545 (FIG. 1).
This C-to-T transition in the AHASL1 polynucleotide sequence
results in a Pro-to-Leu substitution at amino acid 182 in a
conserved region of the predicted amino acid sequence of the AHASL1
protein, relative to the amino acid sequence of the wild-type
AHASL1 protein (FIG. 2). A variety of amino acid substitutions for
the proline in this conserved region of the plant AHASL proteins,
including the Pro-to-Leu substitution, are known to confer on a
plant, which comprises such an AHASL protein, resistance to
imidazolinone and/or sulfonylurea herbicides. See, Boutsalis et al.
(1999) Pestic. Sci. 55:507-516; Guttieri et al. (1992) Weed Sci.
40:670-678; Guttieri et al. (1995) Weed Sci. 43:143-178; and U.S.
Pat. No. 5,141,870; all of which are herein incorporated by
reference. See also, Example 3, below.
[0049] As used herein, unless indicated otherwise or apparent from
the context, the term "plant" includes, but is not limited to,
plant cells, plant protoplasts, plant cell tissue cultures from
which plants can be regenerated, plant calli, plant clumps, plant
cells that are intact in plants, or parts of plants such as, for
example, embryos, pollen, ovules, seeds, cotyledons, leaves, stems,
flowers, branches, petioles, fruit, roots, root tips, anthers, and
the like.
[0050] The invention further relates to isolated polynucleotide
molecules comprising nucleotide sequences that encode
acetohydroxyacid synthase large subunit (AHASL) proteins and to
such AHASL proteins. The invention discloses the isolation and
nucleotide sequence of a polynucleotide encoding a
herbicide-resistant sunflower AHASL1 protein from an
herbicide-resistant sunflower plant that was produced by chemical
mutagenesis of wild-type sunflower plants. The herbicide-resistant
AHASL1 proteins of the invention possess a proline-to-leucine
substitution at position 182 in their respective amino acid
sequences, when compared to the corresponding wild-type amino acid
sequence. The invention further discloses the isolation and
nucleotide sequence of a polynucleotide molecule encoding a
wild-type sunflower AHASL1 protein.
[0051] The present invention provides isolated polynucleotide
molecules that encode AHASL1 proteins from sunflower (Helianthus
annuus L.). Specifically, the invention provides isolated
polynucleotide molecules comprising: the nucleotide sequences set
forth in SEQ ID NOS: 1 and 3, nucleotide sequences encoding AHASL1
proteins comprising the amino acid sequences set forth in SEQ ID
NOS: 2 and 4, and fragments and variants of such nucleotide
sequences that encode functional AHASL1 proteins.
[0052] In addition, the present invention provides isolated
polynucleotides encoding the mature AHASL1 proteins. The mature
AHASL1 proteins of the invention lack the chloroplast transit
peptide that is found at the N-terminal end of each of the AHASL1
proteins but retain AHAS activity. In particular, the
polynucleotides of the invention comprise a nucleotide sequence
selected from the group consisting of the nucleotide sequences set
forth in SEQ ID NOS: 5 and 7, nucleotide sequences encoding the
amino acid sequences set forth in SEQ ID NOS: 6 and 8, and
fragments and variants of these nucleotide sequences that encode a
mature AHASL1 polypeptide comprising AHAS activity.
[0053] The isolated herbicide-resistant AHASL1 polynucleotide
molecules of the invention comprise nucleotide sequences that
encode herbicide-resistant AHASL1 proteins. Such polynucleotide
molecules can be used in polynucleotide constructs for the
transformation of plants, particularly crop plants, to enhance the
resistance of the plants to herbicides, particularly herbicides
that are known to inhibit AHAS activity, more particularly
imidazolinone herbicides. Such polynucleotide constructs can be
used in expression cassettes, expression vectors, transformation
vectors, plasmids and the like. The transgenic plants obtained
following transformation with such polynucleotide constructs show
increased resistance to AHAS-inhibiting herbicides such as, for
example, imidazolinone and sulfonylurea herbicides.
[0054] Compositions of the invention include nucleotide sequences
that encode AHASL1 proteins. In particular, the present invention
provides for isolated polynucleotide molecules comprising
nucleotide sequences encoding the amino acid sequences shown in SEQ
ID NOS: 2, 4, 6, and 8, and fragments and variants thereof that
encode polypeptides comprising AHAS activity. Further provided are
polypeptides having an amino acid sequence encoded by a
polynucleotide molecule described herein, for example those set
forth in SEQ ID NOS: 1, 3, 5, and 7, and fragments and variants
thereof that encode polypeptides comprising AHAS activity.
[0055] The invention encompasses isolated or substantially purified
nucleic acid or protein compositions. An "isolated" or "purified"
polynucleotide molecule or protein, or biologically active portion
thereof, is substantially or essentially free from components that
normally accompany or interact with the polynucleotide molecule or
protein as found in its naturally occurring environment. Thus, an
isolated or purified polynucleotide molecule or protein is
substantially free of other cellular material, or culture medium
when produced by recombinant techniques, or substantially free of
chemical precursors or other chemicals when chemically synthesized.
Preferably, an "isolated" nucleic acid is free of sequences
(preferably protein encoding sequences) that naturally flank the
nucleic acid (i.e., sequences located at the 5' and 3' ends of the
nucleic acid) in the genomic DNA of the organism from which the
nucleic acid is derived. For example, in various embodiments, the
isolated polynucleotide molecule can contain less than about 5 kb,
4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb, or 0.1 kb of nucleotide sequences
that naturally flank the polynucleotide molecule in genomic DNA of
the cell from which the nucleic acid is derived. A protein that is
substantially free of cellular material includes preparations of
protein having less than about 30%, 20%, 10%, 5%, or 1% (by dry
weight) of contaminating protein. When the protein of the invention
or biologically active portion thereof is recombinantly produced,
preferably culture medium represents less than about 30%, 20%, 10%,
5%, or 1% (by dry weight) of chemical precursors or
non-protein-of-interest chemicals.
[0056] The present invention provides isolated polypeptides
comprising AHASL1 proteins. The isolated polypeptides comprise an
amino acid sequence selected from the group consisting of the amino
acid sequences set forth in SEQ ID NOS: 2 and 4, the amino acid
sequences encoded by nucleotide sequences set forth in SEQ ID NOS:
1 and 3, and functional fragments and variants of said amino acid
sequences that encode an AHASL1 polypeptide comprising AHAS
activity. By "functional fragments and variants" is intended
fragments and variants of the exemplified polypeptides that
comprise AHAS activity.
[0057] Additionally provided are isolated polypeptides comprising
the mature forms of the AHASL1 proteins of the invention. Such
isolated polypeptides comprise an amino acid sequence selected from
the group consisting of the amino acid sequences set forth in SEQ
ID NOS: 6 and 8, the amino acid sequences encoded by the nucleotide
sequences set forth in SEQ ID NOS: 5 and 7, and functional
fragments and variants of said amino acid sequences that encode
polypeptides comprising AHAS activity.
[0058] In certain embodiments of the invention, the methods involve
the use of herbicide-tolerant or herbicide-resistant plants. By an
"herbicide-tolerant" or "herbicide-resistant" plant, it is intended
that a plant that is tolerant or resistant to at least one
herbicide at a level that would normally kill, or inhibit the
growth of, a normal or wild-type plant. In one embodiment of the
invention, the herbicide-tolerant plants of the invention comprise
a herbicide-tolerant or herbicide-resistant AHASL protein. By
"herbicide-tolerant AHASL protein" or "herbicide-resistant AHASL
protein", it is intended that such an AHASL protein displays higher
AHAS activity, relative to the AHAS activity of a wild-type AHASL
protein, when in the presence of at least one herbicide that is
known to interfere with AHAS activity and at a concentration or
level of the herbicide that is to known to inhibit the AHAS
activity of the wild-type AHASL protein. Furthermore, the AHAS
activity of such a herbicide-tolerant or herbicide-resistant AHASL
protein may be referred to herein as "herbicide-tolerant" or
"herbicide-resistant" AHAS activity.
[0059] For the present invention, the terms "herbicide-tolerant"
and "herbicide-resistant" are used interchangeable and are intended
to have an equivalent meaning and an equivalent scope. Similarly,
the terms "herbicide-tolerance" and "herbicide-resistance" are used
interchangeable and are intended to have an equivalent meaning and
an equivalent scope. Likewise, the terms "imidazolinone-resistant"
and "imidazolinone-resistance" are used interchangeable and are
intended to be of an equivalent meaning and an equivalent scope as
the terms "imidazolinone-tolerant" and "imidazolinone-tolerance",
respectively.
[0060] The invention encompasses herbicide-resistant AHASL1
polynucleotides and herbicide-resistant AHASL1 proteins. By
"herbicide-resistant AHASL1 polynucleotide" is intended a
polynucleotide that encodes a protein comprising
herbicide-resistant AHAS activity. By "herbicide-resistant AHASL1
protein" is intended a protein or polypeptide that comprises
herbicide-resistant AHAS activity.
[0061] Further, it is recognized that a herbicide-tolerant or
herbicide-resistant AHASL protein can be introduced into a plant by
transforming a plant or ancestor thereof with a nucleotide sequence
encoding a herbicide-tolerant or herbicide-resistant AHASL protein.
Such herbicide-tolerant or herbicide-resistant AHASL proteins are
encoded by the herbicide-tolerant or herbicide-resistant AHASL
polynucleotides. Alternatively, a herbicide-tolerant or
herbicide-resistant AHASL protein may occur in a plant as a result
of a naturally occurring or induced mutation in an endogenous AHASL
gene in the genome of a plant or progenitor thereof.
[0062] The present invention provides plants, plant tissues, plant
cells, and host cells with increased resistance or tolerance to at
least one herbicide, particularly a herbicide that interferes with
the activity of the AHAS enzyme, more particularly an imidazolinone
or sulfonylurea herbicide. The preferred amount or concentration of
the herbicide is an "effective amount" or "effective
concentration." By "effective amount" and "effective concentration"
is intended an amount and concentration, respectively, that is
sufficient to kill or inhibit the growth of a similar, wild-type,
plant, plant tissue, plant cell, or host cell, but that said amount
does not kill or inhibit as severely the growth of the
herbicide-resistant plants, plant tissues, plant cells, and host
cells of the present invention. Typically, the effective amount of
a herbicide is an amount that is routinely used in agricultural
production systems to kill weeds of interest. Such an amount is
known to those of ordinary skill in the art.
[0063] The herbicides of the present invention are those that
interfere with the activity of the AHAS enzyme such that AHAS
activity is reduced in the presence of the herbicide. Such
herbicides may also referred to herein as "AHAS-inhibiting
herbicides" or simply "AHAS inhibitors." As used herein, an
"AHAS-inhibiting herbicide" or an "AHAS inhibitor" is not meant to
be limited to single herbicide that interferes with the activity of
the AHAS enzyme. Thus, unless otherwise stated or evident from the
context, an "AHAS-inhibiting herbicide" or an "AHAS inhibitor" can
be a one herbicide or a mixture of two, three, four, or more
herbicides, each of which interferes with the activity of the AHAS
enzyme.
[0064] By "similar, wild-type, plant, plant tissue, plant cell or
host cell" is intended a plant, plant tissue, plant cell, or host
cell, respectively, that lacks the herbicide-resistance
characteristics and/or particular polynucleotide of the invention
that are disclosed herein. The use of the term "wild-type" is not,
therefore, intended to imply that a plant, plant tissue, plant
cell, or other host cell lacks recombinant DNA in its genome,
and/or does not possess herbicide resistant characteristics that
are different from those disclosed herein.
[0065] As used herein unless clearly indicated otherwise, the term
"plant" intended to mean a plant any developmental stage, as well
as any part or parts of a plant that may be attached to or separate
from a whole intact plant. Such parts of a plant include, but are
not limited to, organs, tissues, and cells of a plant. Examples of
particular plant parts include a stem, a leaf, a root, an
inflorescence, a flower, a floret, a fruit, a pedicle, a peduncle,
a stamen, an anther, a stigma, a style, an ovary, a petal, a sepal,
a carpel, a root tip, a root cap, a root hair, a leaf hair, a seed
hair, a pollen grain, a microspore, a cotyledon, a hypocotyl, an
epicotyl, xylem, phloem, parenchyma, endosperm, a companion cell, a
guard cell, and any other known organs, tissues, and cells of a
plant. Furthermore, it is recognized that a seed is a plant.
[0066] The plants of the present invention include both
non-transgenic plants and transgenic plants. By "non-transgenic
plant" is intended mean a plant lacking recombinant DNA in its
genome. By "transgenic plant" is intended to mean a plant
comprising recombinant DNA in its genome. Such a transgenic plant
can be produced by introducing recombinant DNA into the genome of
the plant. When such recombinant DNA is incorporated into the
genome of the transgenic plant, progeny of the plant can also
comprise the recombinant DNA. A progeny plant that comprises at
least a portion of the recombinant DNA of at least one progenitor
transgenic plant is also a transgenic plant.
[0067] The present invention provides the herbicide-resistant
sunflower line that is referred to herein as MUT28. A deposit of at
least 650 seeds from sunflower line MUT28 with the Patent
Depository of the American Type Culture Collection (ATCC),
Mansassas, Va. 20110 USA was made on Jun. 18, 2004 and assigned
ATCC Patent Deposit Number PTA-6084. On Jul. 15, 2005, additional
seeds of the MUT28 line were deposited with the ATCC to reach a
total of more than 2500 seeds for ATCC Patent Deposit Number
PTA-6084. The deposit will be maintained under the terms of the
Budapest Treaty on the International Recognition of the Deposit of
Microorganisms for the Purposes of Patent Procedure. The deposit of
sunflower line MUT28 was made for a term of at least 30 years and
at least 5 years after the most recent request for the furnishing
of a sample of the deposit is received by the ATCC. Additionally,
Applicants have satisfied all the requirements of 37 C.F.R.
.sctn..sctn.1.801-1.809, including providing an indication of the
viability of the sample.
[0068] The present invention provides herbicide-resistant sunflower
plants of the MUT28 line that were produced by a mutation breeding.
Wild-type sunflower plants were mutagenized by exposing the plants
to a mutagen, particularly a chemical mutagen, more particularly
ethyl methanesulfonate (EMS). However, the present invention is not
limited to herbicide-resistant sunflower plants that are produced
by a mutagenesis method involving the chemical mutagen EMS. Any
mutagenesis method known in the art may be used to produce the
herbicide-resistant sunflower plants of the present invention. Such
mutagenesis methods can involve, for example, the use of any one or
more of the following mutagens: radiation, such as X-rays, Gamma
rays (e.g., cobalt 60 or cesium 137), neutrons, (e.g., product of
nuclear fission by uranium 235 in an atomic reactor), Beta
radiation (e.g., emitted from radioisotopes such as phosphorus 32
or carbon 14), and ultraviolet radiation (preferably from 2500 to
2900 nm), and chemical mutagens such as base analogues (e.g.,
5-bromo-uracil), related compounds (e.g., 8-ethoxy caffeine),
antibiotics (e.g., streptonigrin), alkylating agents (e.g., sulfur
mustards, nitrogen mustards, epoxides, ethylenamines, sulfates,
sulfonates, sulfones, lactones), azide, hydroxylamine, nitrous
acid, or acridines. Herbicide-resistant plants can also be produced
by using tissue culture methods to select for plant cells
comprising herbicide-resistance mutations and then regenerating
herbicide-resistant plants therefrom. See, for example, U.S. Pat.
Nos. 5,773,702 and 5,859,348, both of which are herein incorporated
in their entirety by reference. Further details of mutation
breeding can be found in "Principals of Cultivar Development" Fehr,
1993 Macmillan Publishing Company the disclosure of which is
incorporated herein by reference.
[0069] Analysis of the AHASL1 gene of the sunflower plant of the
MUT28 line revealed that mutation that results in the substitution
of a leucine for the proline that is found at amino acid position
182 in the wild-type AHASL1 amino acid sequence for SEQ ID NO: 4.
Thus, the present invention discloses that substituting another
amino acid for the proline at position 182 can cause a sunflower
plant to have enhanced resistance to a herbicide, particularly an
imidazolinone and/or sulfonylurea herbicide. As disclosed in
Example 3 below, proline 182 is found in a conserved region of
AHASL proteins and other amino acid substitutions have been
disclosed that are known to confer herbicide resistance on a plant
that comprises such an AHASL protein. Accordingly, the
herbicide-resistant sunflower plants of the invention include, but
are not limited to those sunflower plants which comprise in their
genomes at least one copy of an AHASL1 polynucleotide that encodes
a herbicide-resistant AHASL1 protein that comprises a leucine,
alanine, threonine, histidine, arginine, or isoleucine at amino
acid position 182 or equivalent position.
[0070] The sunflower plants of the invention further include plants
that comprise, relative to the wild-type AHASL1 protein, a leucine,
alanine, threonine, histidine, arginine, or isoleucine at amino
acid position 182 or equivalent position and one or more additional
amino acid substitutions in the AHASL1 protein relative to the
wild-type AHASL1 protein, wherein such a sunflower plant has
increased resistance to at least one herbicide when compared to a
wild-type sunflower plant. Such sunflower plants comprise AHASL1
proteins that comprise at least one member selected from the group
consisting of: a threonine at amino acid position 107 or equivalent
position; an aspartate or valine at amino acid position 190 or
equivalent position; a leucine at amino acid position 559 or
equivalent position; and an asparagine, threonine, phenylalanine,
or valine at amino acid position 638 or equivalent position.
[0071] The present invention provides AHASL1 proteins with amino
acid substitutions at particular amino acid positions within
conserved regions of the sunflower AHASL1 proteins disclosed
herein. Unless otherwise indicated herein, particular amino acid
positions refer to the position of that amino acid in the
full-length sunflower AHASL1 amino acid sequences set forth in SEQ
ID NOS: 2 and 4. Furthermore, those of ordinary skill will
recognize that such amino acid positions can vary depending on
whether amino acids are added or removed from, for example, the
N-terminal end of an amino acid sequence. Thus, the invention
encompasses the amino substitutions at the recited position or
equivalent position (e.g., "amino acid position 182 or equivalent
position"). By "equivalent position" is intended to mean a position
that is within the same conserved region as the exemplified amino
acid position, For example, the equivalent position in SEQ ID NO: 8
is amino acid 98 for the proline that occurs at amino acid position
182 in SEQ ID NO: 4.
[0072] In addition, the present invention provides AHASL1
polypeptides comprising amino acid substitutions that are known to
confer resistance on a plant to at least one herbicide,
particularly an AHAS-inhibiting herbicide, more particularly an
imidazolinone herbicide and/or a sulfonylurea herbicide. Such
AHASL1 polypeptides include, for example, those that comprise at
least one member selected from the group consisting of: a leucine,
alanine, threonine, histidine, arginine, or isoleucine at amino
acid position 182 or equivalent position; a threonine at amino acid
position 107 or equivalent position; an aspartate or valine at
amino acid position 190 or equivalent position; a leucine at amino
acid position 559 or equivalent position; and an asparagine,
threonine, phenylalanine, or valine at amino acid position 638 or
equivalent position. The invention further provides isolated
polynucleotides encoding such AHASL1 polypeptides, as well as
expression cassettes, transformation vectors, transformed host
cells, transformed plants, and methods comprising such
polynucleotides.
[0073] The present invention provides methods for enhancing the
tolerance or resistance of a plant, plant tissue, plant cell, or
other host cell to at least one herbicide that interferes with the
activity of the AHAS enzyme. Preferably, such an AHAS-inhibiting
herbicide is an imidazolinone herbicide, a sulfonylurea herbicide,
a triazolopyrimidine herbicide, a pyrimidinyloxybenzoate herbicide,
a sulfonylamino-carbonyltriazolinone herbicide, or mixture thereof.
More preferably, such a herbicide is an imidazolinone herbicide, a
sulfonylurea herbicide, or mixture thereof. For the present
invention, the imidazolinone herbicides include, but are not
limited to, PURSUIT.RTM. (imazethapyr), CADRES (imazapic),
RAPTOR.RTM. (imazamox), SCEPTER.RTM. (imazaquin), ASSERT.RTM.
(imazethabenz), ARSENAL.RTM. (imazapyr), a derivative of any of the
aforementioned herbicides, and a mixture of two or more of the
aforementioned herbicides, for example, imazapyr/imazamox
(ODYSSEY.RTM.). More specifically, the imidazolinone herbicide can
be selected from, but is not limited to,
2-(4-isopropyl-4-methyl-5-oxo-2-imidiazolin-2-yl)-nicotinic acid,
[2-(4-isopropyl)-4-][methyl-5-oxo-2-imidazolin-2-yl)-3-quinolinecarboxyli-
c] acid,
[5-ethyl-2-(4-isopropyl-]-4-methyl-5-oxo-2-imidazolin-2-yl)-nicot-
inic acid,
2-(4-isopropyl-4-methyl-5-oxo-2-(methoxymethyl)-nicotinic acid,
[2-(4-isopropyl-4-methyl-5-oxo-2-]imidazolin-2-yl)-5-methylnicotinic
acid, and a mixture of methyl
[6-(4-isopropyl-4-]methyl-5-oxo-2-imidazolin-2-yl)-m-toluate and
methyl
[2-(4-isopropyl-4-methyl-5-]oxo-2-imidazolin-2-yl)-p-toluate. The
use of
5-ethyl-2-(4-isopropyl-4-methyl-5-oxo-2-imidazolin-2-yl)-nicotinic
acid and
[2-(4-isopropyl-4-methyl-5-oxo-2-imidazolin-2-]yl)-5-(methoxymethyl)--
nicotinic acid is preferred. The use of
[2-(4-isopropyl-4-]methyl-5-oxo-2-imidazolin-2-yl)-5-(methoxymethyl)-nico-
tinic acid is particularly preferred.
[0074] For the present invention, the sulfonylurea herbicides
include, but are not limited to, chlorsulfuron, metsulfuron methyl,
sulfometuron methyl, chlorimuron ethyl, thifensulfuron methyl,
tribenuron methyl, bensulfuron methyl, nicosulfuron,
ethametsulfuron methyl, rimsulfuron, triflusulfuron methyl,
triasulfuron, primisulfuron methyl, cinosulfuron, amidosuffluon,
fluzasulfuron, imazosulfuron, pyrazosulfuron ethyl, halosulfuron,
azimsulfuron, cyclosulfuron, ethoxysulfuron, flazasulfuron,
flupyrsulfuron methyl, foramsulfuron, iodosulfuron, oxasulfuron,
mesosulfuron, prosulfuron, sulfosulfuron, trifloxysulfuron,
tritosulfuron, a derivative of any of the aforementioned
herbicides, and a mixture of two or more of the aforementioned
herbicides. The triazolopyrimidine herbicides of the invention
include, but are not limited to, cloransulam, diclosulam,
florasulam, flumetsulam, metosulam, and penoxsulam. The
pyrimidinyloxybenzoate herbicides of the invention include, but are
not limited to, bispyribac, pyrithiobac, pyriminobac, pyribenzoxim
and pyriftalid. The sulfonylamino-carbonyltriazolinone herbicides
include, but are not limited to, flucarbazone and
propoxycarbazone.
[0075] It is recognized that pyrimidinyloxybenzoate herbicides are
closely related to the pyrimidinylthiobenzoate herbicides and are
generalized under the heading of the latter name by the Weed
Science Society of America. Accordingly, the herbicides of the
present invention further include pyrimidinylthiobenzoate
herbicides, including, but not limited to, the
pyrimidinyloxybenzoate herbicides described above.
[0076] The present invention provides methods for enhancing AHAS
activity in a plant comprising transforming a plant with a
polynucleotide construct comprising a promoter operably linked to
an AHASL1 nucleotide sequence of the invention. The methods involve
introducing a polynucleotide construct of the invention into at
least one plant cell and regenerating a transformed plant
therefrom. The methods involve the use of a promoter that is
capable of driving gene expression in a plant cell. Preferably,
such a promoter is a constitutive promoter or a tissue-preferred
promoter. The methods find use in enhancing or increasing the
resistance of a plant to at least one herbicide that interferes
with the catalytic activity of the AHAS enzyme, particularly an
imidazolinone herbicide.
[0077] The present invention provides expression cassettes for
expressing the polynucleotides of the invention in plants, plant
tissues, plant cells, and other host cells. The expression
cassettes comprise a promoter expressible in the plant, plant
tissue, plant cell, or other host cells of interest operably linked
to a polynucleotide of the invention that comprises a nucleotide
sequence encoding either a full-length (i.e. including the
chloroplast transit peptide) or mature AHASL1 protein (i.e. without
the chloroplast transit peptide). If expression is desired in the
plastids or chloroplasts of plants or plant cells, the expression
cassette may also comprise an operably linked chloroplast-targeting
sequence that encodes a chloroplast transit peptide.
[0078] The expression cassettes of the invention find use in a
method for enhancing the herbicide tolerance of a plant or a host
cell. The method involves transforming the plant or host cell with
an expression cassette of the invention, wherein the expression
cassette comprises a promoter that is expressible in the plant or
host cell of interest and the promoter is operably linked to a
polynucleotide of the invention that comprises a nucleotide
sequence encoding an imidazolinone-resistant AHASL1 protein of the
invention.
[0079] The use of the term "polynucleotide constructs" herein is
not intended to limit the present invention to polynucleotide
constructs comprising DNA. Those of ordinary skill in the art will
recognize that polynucleotide constructs, particularly
polynucleotides and oligonucleotides, comprised of ribonucleotides
and combinations of ribonucleotides and deoxyribonucleotides may
also be employed in the methods disclosed herein. Thus, the
polynucleotide constructs of the present invention encompass all
polynucleotide constructs that can be employed in the methods of
the present invention for transforming plants including, but not
limited to, those comprised of deoxyribonucleotides,
ribonucleotides, and combinations thereof. Such
deoxyribonucleotides and ribonucleotides include both naturally
occurring molecules and synthetic analogues. The polynucleotide
constructs of the invention also encompass all forms of
polynucleotide constructs including, but not limited to,
single-stranded forms, double-stranded forms, hairpins,
stem-and-loop structures, and the like. Furthermore, it is
understood by those of ordinary skill the art that each nucleotide
sequences disclosed herein also encompasses the complement of that
exemplified nucleotide sequence.
[0080] Furthermore, it is recognized that the methods of the
invention may employ a polynucleotide construct that is capable of
directing, in a transformed plant, the expression of at least one
protein, or at least one RNA, such as, for example, an antisense
RNA that is complementary to at least a portion of an mRNA.
Typically such a polynucleotide construct is comprised of a coding
sequence for a protein or an RNA operably linked to 5' and 3'
transcriptional regulatory regions. Alternatively, it is also
recognized that the methods of the invention may employ a
polynucleotide construct that is not capable of directing, in a
transformed plant, the expression of a protein or an RNA.
[0081] Further, it is recognized that, for expression of a
polynucleotides of the invention in a host cell of interest, the
polynucleotide is typically operably linked to a promoter that is
capable of driving gene expression in the host cell of interest.
The methods of the invention for expressing the polynucleotides in
host cells do not depend on particular promoter. The methods
encompass the use of any promoter that is known in the art and that
is capable of driving gene expression in the host cell of
interest.
[0082] The present invention encompasses AHASL1 polynucleotide
molecules and fragments and variants thereof. Polynucleotide
molecules that are fragments of these nucleotide sequences are also
encompassed by the present invention. By "fragment" is intended a
portion of the nucleotide sequence encoding an AHASL1 protein of
the invention. A fragment of an AHASL1 nucleotide sequence of the
invention may encode a biologically active portion of an AHASL1
protein, or it may be a fragment that can be used as a
hybridization probe or PCR primer using methods disclosed below. A
biologically active portion of an AHASL1 protein can be prepared by
isolating a portion of one of the AHASL1 nucleotide sequences of
the invention, expressing the encoded portion of the AHASL1 protein
(e.g., by recombinant expression in vitro), and assessing the
activity of the encoded portion of the AHASL1 protein.
Polynucleotide molecules that are fragments of an AHASL1 nucleotide
sequence comprise at least about 15, 20, 50, 75, 100, 200, 300,
350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950,
1000, 1050, 1100, 1150, 1200, 1250, 1300, 1350, 1400, 1500, 1600,
1700, 1800, 1900, or 1950 nucleotides, or up to the number of
nucleotides present in a full-length nucleotide sequence disclosed
herein (for example, 1968, 1968, 1716, and 1716 nucleotides for SEQ
ID NOS: 1, 3, 5, and 7, respectively) depending upon the intended
use.
[0083] A fragment of an AHASL1 nucleotide sequence that encodes a
biologically active portion of an AHASL1 protein of the invention
will encode at least about 15, 25, 30, 50, 75, 100, 125, 150, 175,
200, 250, 300, 350, 400, 450, 500, 550, 600, or 650 contiguous
amino acids, or up to the total number of amino acids present in a
full-length AHASL1 protein of the invention (for example, 655, 655,
571, and 571 amino acids for SEQ ID NOS: 2, 4, 6, and 8,
respectively). Fragments of an AHASL1 nucleotide sequence that are
useful as hybridization probes for PCR primers generally need not
encode a biologically active portion of an AHASL1 protein.
[0084] Polynucleotide molecules that are variants of the nucleotide
sequences disclosed herein are also encompassed by the present
invention. "Variants" of the AHASL1 nucleotide sequences of the
invention include those sequences that encode the AHASL1 proteins
disclosed herein but that differ conservatively because of the
degeneracy of the genetic code. These naturally occurring allelic
variants can be identified with the use of well-known molecular
biology techniques, such as polymerase chain reaction (PCR) and
hybridization techniques as outlined below. Variant nucleotide
sequences also include synthetically derived nucleotide sequences
that have been generated, for example, by using site-directed
mutagenesis but which still encode the AHASL1 protein disclosed in
the present invention as discussed below. Generally, nucleotide
sequence variants of the invention will have at least about 75%,
80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%
identity to a particular nucleotide sequence disclosed herein. A
variant AHASL1 nucleotide sequence will encode an AHASL1 protein,
respectively, that has an amino acid sequence having at least about
75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%
identity to the amino acid sequence of an AHASL1 protein disclosed
herein.
[0085] In addition, the skilled artisan will further appreciate
that changes can be introduced by mutation into the nucleotide
sequences of the invention thereby leading to changes in the amino
acid sequence of the encoded AHASL1 proteins without altering the
biological activity of the AHASL1 proteins. Thus, an isolated
polynucleotide molecule encoding an AHASL1 protein having a
sequence that differs from that of SEQ ID NOS: 1, 3, 5, or 7,
respectively, can be created by introducing one or more nucleotide
substitutions, additions, or deletions into the corresponding
nucleotide sequence disclosed herein, such that one or more amino
acid substitutions, additions or deletions are introduced into the
encoded protein. Mutations can be introduced by standard
techniques, such as site-directed mutagenesis and PCR-mediated
mutagenesis. Such variant nucleotide sequences are also encompassed
by the present invention.
[0086] For example, preferably, conservative amino acid
substitutions may be made at one or more predicted, preferably
nonessential amino acid residues. A "nonessential" amino acid
residue is a residue that can be altered from the wild-type
sequence of an AHASL1 protein (e.g., the sequence of SEQ ID NOS: 2,
4, 6, and 8, respectively) without altering the biological
activity, whereas an "essential" amino acid residue is required for
biological activity. A "conservative amino acid substitution" is
one in which the amino acid residue is replaced with an amino acid
residue having a similar side chain. Families of amino acid
residues having similar side chains have been defined in the art.
These families include amino acids with basic side chains (e.g.,
lysine, arginine, histidine), acidic side chains (e.g., aspartic
acid, glutamic acid), uncharged polar side chains (e.g., glycine,
asparagine, glutamine, serine, threonine, tyrosine, cysteine),
nonpolar side chains (e.g., alanine, valine, leucine, isoleucine,
proline, phenylalanine, methionine, tryptophan), beta-branched side
chains (e.g., threonine, valine, isoleucine) and aromatic side
chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Such
substitutions would not be made for conserved amino acid residues,
or for amino acid residues residing within a conserved motif.
[0087] The proteins of the invention may be altered in various ways
including amino acid substitutions, deletions, truncations, and
insertions. Methods for such manipulations are generally known in
the art. For example, amino acid sequence variants of the AHASL1
proteins can be prepared by mutations in the DNA. Methods for
mutagenesis and nucleotide sequence alterations are well known in
the art. See, for example, Kunkel (1985) Proc. Natl. Acad. Sci. USA
82:488-492; Kunkel et al. (1987) Methods in Enzymol. 154:367-382;
U.S. Pat. No. 4,873,192; Walker and Gaastra, eds. (1983) Techniques
in Molecular Biology (MacMillan Publishing Company, New York) and
the references cited therein. Guidance as to appropriate amino acid
substitutions that do not affect biological activity of the protein
of interest may be found in the model of Dayhoff et al. (1978)
Atlas of Protein Sequence and Structure (Natl. Biomed. Res. Found.,
Washington, D.C.), herein incorporated by reference. Conservative
substitutions, such as exchanging one amino acid with another
having similar properties, may be preferable.
[0088] Alternatively, variant AHASL1 nucleotide sequences can be
made by introducing mutations randomly along all or part of an
AHASL1 coding sequence, such as by saturation mutagenesis, and the
resultant mutants can be screened for AHAS activity to identify
mutants that retain AHAS activity, including herbicide-resistant
AHAS activity. Following mutagenesis, the encoded protein can be
expressed recombinantly, and the activity of the protein can be
determined using standard assay techniques.
[0089] Thus, the nucleotide sequences of the invention include the
sequences disclosed herein as well as fragments and variants
thereof. The AHASL1 nucleotide sequences of the invention, and
fragments and variants thereof, can be used as probes and/or
primers to identify and/or clone AHASL homologues in other plants.
Such probes can be used to detect transcripts or genomic sequences
encoding the same or identical proteins.
[0090] In this manner, methods such as PCR, hybridization, and the
like can be used to identify such sequences having substantial
identity to the sequences of the invention. See, for example,
Sambrook et al. (1989) Molecular Cloning: Laboratory Manual (2d
ed., Cold Spring Harbor Laboratory Press, Plainview, N.Y.) and
Innis, et al. (1990) PCR Protocols: A Guide to Methods and
Applications (Academic Press, NY). AHASL nucleotide sequences
isolated based on their sequence identity to the AHASL1 nucleotide
sequences set forth herein or to fragments and variants thereof are
encompassed by the present invention.
[0091] In a hybridization method, all or part of a known AHASL1
nucleotide sequence can be used to screen cDNA or genomic
libraries. Methods for construction of such cDNA and genomic
libraries are generally known in the art and are disclosed in
Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual (2d
ed., Cold Spring Harbor Laboratory Press, Plainview, N.Y.). The
so-called hybridization probes may be genomic DNA fragments, cDNA
fragments, RNA fragments, or other oligonucleotides, and may be
labeled with a detectable group such as .sup.32P, or any other
detectable marker, such as other radioisotopes, a fluorescent
compound, an enzyme, or an enzyme co-factor. Probes for
hybridization can be made by labeling synthetic oligonucleotides
based on the known AHASL1 nucleotide sequence disclosed herein.
Degenerate primers designed on the basis of conserved nucleotides
or amino acid residues in a known AHASL1 nucleotide sequence or
encoded amino acid sequence can additionally be used. The probe
typically comprises a region of nucleotide sequence that hybridizes
under stringent conditions to at least about 12, preferably about
25, more preferably about 50, 75, 100, 125, 150, 175, 200, 250,
300, 350, 400, 500, 600, 700, 800, 900, 1000, 1200, 1400, 1600, or
1800 consecutive nucleotides of an AHASL1 nucleotide sequence of
the invention or a fragment or variant thereof. Preparation of
Probes for Hybridization is Generally Known in the Art and is
Disclosed in Sambrook et al. (1989) Molecular Cloning: A Laboratory
Manual (2d ed., Cold Spring Harbor Laboratory Press, Plainview,
N.Y.), herein incorporated by reference.
[0092] For example, the entire AHASL1 sequence disclosed herein, or
one or more portions thereof, may be used as a probe capable of
specifically hybridizing to corresponding AHASL1 sequences and
messenger RNAs. Hybridization techniques include hybridization
screening of plated DNA libraries (either plaques or colonies; see,
for example, Sambrook et al, (1989) Molecular Cloning: A Laboratory
Manual (2d ed., Cold Spring Harbor Laboratory Press, Plainview,
N.Y.).
[0093] Hybridization of such sequences may be carried out under
stringent conditions. By "stringent conditions" or "stringent
hybridization conditions" is intended conditions under which a
probe will hybridize to its target sequence to a detectably greater
degree than to other sequences (e.g., at least 2-fold over
background). Stringent conditions are sequence-dependent and will
be different in different circumstances.
[0094] Typically, stringent conditions will be those in which the
salt concentration is less than about 1.5 M Na ion, typically about
0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to
8.3 and the temperature is at least about 30.degree. C. for short
probes (e.g., 10 to 50 nucleotides) and at least about 60.degree.
C. for long probes (e.g., greater than 50 nucleotides). Stringent
conditions may also be achieved with the addition of destabilizing
agents such as formamide. Exemplary low stringency conditions
include hybridization with a buffer solution of 30 to 35%
formamide, 1 M NaCl, 1% SDS (sodium dodecyl sulphate) at 37.degree.
C., and a wash in 1.times. to 2.times.SSC (20.times.SSC=3.0 M
NaCl/0.3 M trisodium citrate) at 50 to 55.degree. C. Exemplary
moderate stringency conditions include hybridization in 40 to 45%
formamide, 1.0 M NaCl, 1% SDS at 37.degree. C., and a wash in
0.5.times. to 1.times.SSC at 55 to 60.degree. C. Exemplary high
stringency conditions include hybridization in 50% formamide, 1 M
NaCl, 1% SDS at 37.degree. C., and a wash in 0.1.times.SSC at 60 to
65.degree. C. Optionally, wash buffers may comprise about 0.1% to
about 1% SDS. The duration of hybridization is generally less than
about 24 hours, usually about 4 to about 12 hours.
[0095] Specificity is typically the function of post-hybridization
washes, the critical factors being the ionic strength and
temperature of the final wash solution. For DNA-DNA hybrids, the
T.sub.m can be approximated from the equation of Meinkoth and Wahl
(1984) Anal. Biochem. 138:267-284: T.sub.m=81.5.degree. C.+16.6
(log M)+0.41 (% GC)-0.61 (% form)-500/L; where M is the molarity of
monovalent cations, % GC is the percentage of guanosine and
cytosine nucleotides in the DNA, % form is the percentage of
formamide in the hybridization solution, and L is the length of the
hybrid in base pairs. The T.sub.m is the temperature (under defined
ionic strength and pH) at which 50% of a complementary target
sequence hybridizes to a perfectly matched probe. T.sub.m is
reduced by about 1.degree. C. for each 1% of mismatching; thus,
T.sub.m, hybridization, and/or wash conditions can be adjusted to
hybridize to sequences of the desired identity. For example, if
sequences with >90% identity are sought, the T.sub.m can be
decreased 10.degree. C. Generally, stringent conditions are
selected to be about 5.degree. C. lower than the thermal melting
point (T.sub.m) for the specific sequence and its complement at a
defined ionic strength and pH. However, severely stringent
conditions can utilize a hybridization and/or wash at 1, 2, 3, or
4.degree. C. lower than the thermal melting point (T.sub.m);
moderately stringent conditions can utilize a hybridization and/or
wash at 6, 7, 8, 9, or 10.degree. C. lower than the thermal melting
point (T.sub.m); low stringency conditions can utilize a
hybridization and/or wash at 11, 12, 13, 14, 15, or 20.degree. C.
lower than the thermal melting point (T.sub.m). Using the equation,
hybridization and wash compositions, and desired T.sub.m, those of
ordinary skill will understand that variations in the stringency of
hybridization and/or wash solutions are inherently described. If
the desired degree of mismatching results in a T.sub.m of less than
45.degree. C. (aqueous solution) or 32.degree. C. (formamide
solution), it is preferred to increase the SSC concentration so
that a higher temperature can be used. An extensive guide to the
hybridization of nucleic acids is found in Tijssen (1993)
Laboratory Techniques in Biochemistry and Molecular
Biology--Hybridization with Nucleic Acid Probes, Part I, Chapter 2
(Elsevier, New York); and Ausubel et al., eds. (1995) Current
Protocols in Molecular Biology, Chapter 2 (Greene Publishing and
Wiley-Interscience, New York). See Sambrook et al. (1989) Molecular
Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory
Press, Plainview, N.Y.).
[0096] It is recognized that the polynucleotide molecules and
proteins of the invention encompass polynucleotide molecules and
proteins comprising a nucleotide or an amino acid sequence that is
sufficiently identical to the nucleotide sequence of SEQ ID NOS: 1,
3, 5, and/or 7, or to the amino acid sequence of SEQ ID NOS: 2, 4,
5, and/or 8. The term "sufficiently identical" is used herein to
refer to a first amino acid or nucleotide sequence that contains a
sufficient or minimum number of identical or equivalent (e.g., with
a similar side chain) amino acid residues or nucleotides to a
second amino acid or nucleotide sequence such that the first and
second amino acid or nucleotide sequences have a common structural
domain and/or common functional activity. For example, amino acid
or nucleotide sequences that contain a common structural domain
having at least about 45%, 55%, or 65% identity, preferably 75%
identity, more preferably 85%, 95%, or 98% identity are defined
herein as sufficiently identical.
[0097] To determine the percent identity of two amino acid
sequences or of two nucleic acids, the sequences are aligned for
optimal comparison purposes. The percent identity between the two
sequences is a function of the number of identical positions shared
by the sequences (i.e., percent identity=number of identical
positions/total number of positions (e.g., overlapping
positions).times.100). In one embodiment, the two sequences are the
same length. The percent identity between two sequences can be
determined using techniques similar to those described below, with
or without allowing gaps. In calculating percent identity,
typically exact matches are counted.
[0098] The determination of percent identity between two sequences
can be accomplished using a mathematical algorithm. A preferred,
nonlimiting example of a mathematical algorithm utilized for the
comparison of two sequences is the algorithm of Karlin and Altschul
(1990) Proc. Natl. Acad. Sci. USA 87:2264, modified as in Karlin
and Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873-5877. Such
an algorithm is incorporated into the NBLAST and XBLAST programs of
Altschul et al. (1990) J. Mol. Biol. 215:403. BLAST nucleotide
searches can be performed with the NBLAST program, score=100,
wordlength=12, to obtain nucleotide sequences homologous to the
polynucleotide molecules of the invention. BLAST protein searches
can be performed with the XBLAST program, score=50, wordlength=3,
to obtain amino acid sequences homologous to protein molecules of
the invention. To obtain gapped alignments for comparison purposes,
Gapped BLAST can be utilized as described in Altschul et al. (1997)
Nucleic Acids Res. 25:3389. Alternatively, PSI-Blast can be used to
perform an iterated search that detects distant relationships
between molecules. See Altschul et al. (1997) supra. When utilizing
BLAST, Gapped BLAST, and PSI-Blast programs, the default parameters
of the respective programs (e.g., XBLAST and NBLAST) can be used.
See http://www.ncbi.nlm.nih.gov. Another preferred, non-limiting
example of a mathematical algorithm utilized for the comparison of
sequences is the algorithm of Myers and Miller (1988) CABIOS
4:11-17. Such an algorithm is incorporated into the ALIGN program
(version 2.0), which is part of the GCG sequence alignment software
package. When utilizing the ALIGN program for comparing amino acid
sequences, a PAM120 weight residue table, a gap length penalty of
12, and a gap penalty of 4 can be used. Alignment may also be
performed manually by inspection.
[0099] Unless otherwise stated, sequence identity/similarity values
provided herein refer to the value obtained using the full-length
sequences of the invention and using multiple alignment by mean of
the algorithm Clustal W (Nucleic Acid Research, 22(22):4673-4680,
1994) using the program AlignX included in the software package
Vector NTI Suite Version 7 (InforMax, Inc., Bethesda, Md., USA)
using the default parameters; or any equivalent program thereof. By
"equivalent program" is intended any sequence comparison program
that, for any two sequences in question, generates an alignment
having identical nucleotide or amino acid residue matches and an
identical percent sequence identity when compared to the
corresponding alignment generated by AlignX in the software package
Vector NTI Suite Version 7.
[0100] The AHASL1 nucleotide sequences of the invention include
both the naturally occurring sequences as well as mutant forms,
particularly mutant forms that encode AHASL1 proteins comprising
herbicide-resistant AHAS activity. Likewise, the proteins of the
invention encompass both naturally occurring proteins as well as
variations and modified forms thereof. Such variants will continue
to possess the desired AHAS activity. Obviously, the mutations that
will be made in the DNA encoding the variant must not place the
sequence out of reading frame and preferably will not create
complementary regions that could produce secondary mRNA structure.
See, EP Patent Application Publication No. 75,444.
[0101] The deletions, insertions, and substitutions of the protein
sequences encompassed herein are not expected to produce radical
changes in the characteristics of the protein. However, when it is
difficult to predict the exact effect of the substitution,
deletion, or insertion in advance of doing so, one skilled in the
art will appreciate that the effect will be evaluated by routine
screening assays. That is, the activity can be evaluated by AHAS
activity assays. See, for example, Singh et al. (1988) Anal.
Biochem. 171:173-179, herein incorporated by reference.
[0102] Variant nucleotide sequences and proteins also encompass
sequences and proteins derived from a mutagenic and recombinogenic
procedure such as DNA shuffling. With such a procedure, one or more
different AHASL coding sequences can be manipulated to create a new
AHASL protein possessing the desired properties. In this manner,
libraries of recombinant polynucleotides are generated from a
population of related sequence polynucleotides comprising sequence
regions that have substantial sequence identity and can be
homologously recombined in vitro or in vivo. For example, using
this approach, sequence motifs encoding a domain of interest may be
shuffled between the AHASL1 gene of the invention and other known
AHASL genes to obtain a new gene coding for a protein with an
improved property of interest, such as an increased K.sub.m in the
case of an enzyme. Strategies for such DNA shuffling are known in
the art. See, for example, Stemmer (1994) Proc. Natl. Acad. Sci.
USA 91:10747-10751; Stemmer (1994) Nature 370:389-391; Crameri et
al. (1997) Nature Biotech. 15:436-438; Moore et al. (1997) J. Mol.
Biol. 272:336-347; Zhang et al. (1997) Proc. Natl. Acad. Sci. USA
94:4504-4509; Crameri et al. (1998) Nature 391:288-291; and U.S.
Pat. Nos. 5,605,793 and 5,837,458.
[0103] The nucleotide sequences of the invention can be used to
isolate corresponding sequences from other organisms, particularly
other plants, more particularly other dicots. In this manner,
methods such as PCR, hybridization, and the like can be used to
identify such sequences based on their sequence homology to the
sequences set forth herein. Sequences isolated based on their
sequence identity to the entire AHASL1 sequences set forth herein
or to fragments thereof are encompassed by the present invention.
Thus, isolated sequences that encode for an AHASL protein and which
hybridize under stringent conditions to the sequence disclosed
herein, or to fragments thereof, are encompassed by the present
invention.
[0104] In a PCR approach, oligonucleotide primers can be designed
for use in PCR reactions to amplify corresponding DNA sequences
from cDNA or genomic DNA extracted from any plant of interest.
Methods for designing PCR primers and PCR cloning are generally
known in the art and are disclosed in Sambrook et al. (1989)
Molecular Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor
Laboratory Press, Plainview, N.Y.). See also Innis et al., eds.
(1990) PCR Protocols: A Guide to Methods and Applications (Academic
Press, New York); Innis and Gelfand, eds. (1995) PCR Strategies
(Academic Press, New York); and Innis and Gelfand, eds. (1999) PCR
Methods Manual (Academic Press, New York). Known methods of PCR
include, but are not limited to, methods using paired primers,
nested primers, single specific primers, degenerate primers,
gene-specific primers, vector-specific primers,
partially-mismatched primers, and the like.
[0105] The AHASL1 polynucleotide sequences of the invention are
provided in expression cassettes for expression in the plant of
interest. The cassette will include 5' and 3' regulatory sequences
operably linked to an AHASL1 polynucleotide sequence of the
invention. By "operably linked" is intended a functional linkage
between a promoter and a second sequence, wherein the promoter
sequence initiates and mediates transcription of the DNA sequence
corresponding to the second sequence. Generally, operably linked
means that the nucleic acid sequences being linked are contiguous
and, where necessary to join two protein coding regions, contiguous
and in the same reading frame. The cassette may additionally
contain at least one additional gene to be cotransformed into the
organism. Alternatively, the additional gene(s) can be provided on
multiple expression cassettes.
[0106] Such an expression cassette is provided with a plurality of
restriction sites for insertion of the AHASL1 polynucleotide
sequence to be under the transcriptional regulation of the
regulatory regions. The expression cassette may additionally
contain selectable marker genes.
[0107] The expression cassette will include in the 5'-3' direction
of transcription, a transcriptional and translational initiation
region (i.e., a promoter), an AHASL1 polynucleotide sequence of the
invention, and a transcriptional and translational termination
region (i.e., termination region) functional in plants. The
promoter may be native or analogous, or foreign or heterologous, to
the plant host and/or to the AHASL1 polynucleotide sequence of the
invention. Additionally, the promoter may be the natural sequence
or alternatively a synthetic sequence. Where the promoter is
"foreign" or "heterologous" to the plant host, it is intended that
the promoter is not found in the native plant into which the
promoter is introduced. Where the promoter is "foreign" or
"heterologous" to the AHASL1 polynucleotide sequence of the
invention, it is intended that the promoter is not the native or
naturally occurring promoter for the operably linked AHASL1
polynucleotide sequence of the invention. As used herein, a
chimeric gene comprises a coding sequence operably linked to a
transcription initiation region that is heterologous to the coding
sequence.
[0108] While it may be preferable to express the AHASL1
polynucleotides of the invention using heterologous promoters, the
native promoter sequences may be used. Such constructs would change
expression levels of the AHASL1 protein in the plant or plant cell.
Thus, the phenotype of the plant or plant cell is altered.
[0109] The termination region may be native with the
transcriptional initiation region, may be native with the operably
linked AHASL1 sequence of interest, may be native with the plant
host, or may be derived from another source.(i.e., foreign or
heterologous to the promoter, the AHASL1 polynucleotide sequence of
interest, the plant host, or any combination thereof). Convenient
termination regions are available from the Ti-plasmid of A.
tumefaciens, such as the octopine synthase and nopaline synthase
termination regions. See also Guerineau et al. (1991) Mol. Gen.
Genet. 262:141-144; Proudfoot (1991) Cell 64:671-674; Sanfacon et
al. (1991) Genes Dev. 5:141-149; Mogen et al. (1990) Plant Cell
2:1261-1272; Munroe et al. (1990) Gene 91:151-158; Balla et al.
(1989) Nucleic Acids Res. 17:7891-7903; and Joshi et al. (1987)
Nucleic Acid Res. 15:9627-9639.
[0110] Where appropriate, the gene(s) may be optimized for
increased expression in the transformed plant. That is, the genes
can be synthesized using plant-preferred codons for improved
expression. See, for example, Campbell and Gowri (1990) Plant
Physiol. 92:1-11 for a discussion of host-preferred codon usage.
Methods are available in the art for synthesizing plant-preferred
genes. See, for example, U.S. Pat. Nos. 5,380,831, and 5,436,391,
and Murray et al. (1989) Nucleic Acids Res. 17:477-498, herein
incorporated by reference.
[0111] Additional sequence modifications are known to enhance gene
expression in a cellular host. These include elimination of
sequences encoding spurious polyadenylation signals, exon-intron
splice site signals, transposon-like repeats, and other such
well-characterized sequences that may be deleterious to gene
expression. The G-C content of the sequence may be adjusted to
levels average for a given cellular host, as calculated by
reference to known genes expressed in the host cell. When possible,
the sequence is modified to avoid predicted hairpin secondary mRNA
structures.
[0112] Nucleotide sequences for enhancing gene expression can also
be used in the plant expression vectors. These include the introns
of the maize AdhI, intron1 gene (Callis et al. Genes and
Development 1:1183-1200, 1987), and leader sequences, (W-sequence)
from the Tobacco Mosaic virus (TMV), Maize Chlorotic Mottle Virus
and Alfalfa Mosaic Virus (Gallie et al. Nucleic Acid Res.
15:8693-8711, 1987 and Skuzeski et al. Plant Mol. Biol. 15:65-79,
1990). The first intron from the shrunkent-1 locus of maize, has
been shown to increase expression of genes in chimeric gene
constructs. U.S. Pat. Nos. 5,424,412 and 5,593,874 disclose the use
of specific introns in gene expression constructs, and Gallie et
al. (Plant Physiol. 106:929-939, 1994) also have shown that introns
are useful for regulating gene expression on a tissue specific
basis. To further enhance or to optimize AHAS small subunit gene
expression, the plant expression vectors of the invention may also
contain DNA sequences containing matrix attachment regions (MARs).
Plant cells transformed with such modified expression systems,
then, may exhibit overexpression or constitutive expression of a
nucleotide sequence of the invention.
[0113] The expression cassettes may additionally contain 5' leader
sequences in the expression cassette construct. Such leader
sequences can act to enhance translation. Translation leaders are
known in the art and include: picornavirus leaders, for example,
EMCV leader (Encephalomyocarditis 5' noncoding region) (Elroy-Stein
et al. (1989) Proc. Natl. Acad. Sci. USA 86:6126-6130); potyvirus
leaders, for example, TEV leader (Tobacco Etch Virus) (Gallie et
al. (1995) Gene 165(2):233-238), MDMV leader (Maize Dwarf Mosaic
Virus) (Virology 154:9-20), and human immunoglobulin heavy-chain
binding protein (BiP) (Macejak et al. (1991) Nature 353:90-94);
untranslated leader from the coat protein mRNA of alfalfa mosaic
virus (AMV RNA 4) (Jobling et al. (1987) Nature 325:622-625);
tobacco mosaic virus leader (TMV) (Gallie et al. (1989) in
Molecular Biology of RNA, ed. Cech (Liss, New York), pp. 237-256);
and maize chlorotic mottle virus leader (MCMV) (Lommel et al.
(1991) Virology 81:382-385). See also, Della-Cioppa et al. (1987)
Plant Physiol. 84:965-968. Other methods known to enhance
translation can also be utilized, for example, introns, and the
like.
[0114] In preparing the expression cassette, the various DNA
fragments may be manipulated, so as to provide for the DNA
sequences in the proper orientation and, as appropriate, in the
proper reading frame. Toward this end, adapters or linkers may be
employed to join the DNA fragments or other manipulations may be
involved to provide for convenient restriction sites, removal of
superfluous DNA, removal of restriction sites, or the like. For
this purpose, in vitro mutagenesis, primer repair, restriction,
annealing, resubstitutions, e.g., transitions and transversions,
may be involved.
[0115] A number of promoters can be used in the practice of the
invention. The promoters can be selected based on the desired
outcome. The nucleic acids can be combined with constitutive,
tissue-preferred, or other promoters for expression in plants.
[0116] Such constitutive promoters include, for example, the core
promoter of the Rsyn7 promoter and other constitutive promoters
disclosed in WO 99/43838 and U.S. Pat. No. 6,072,050; the core CaMV
35S promoter (Odell et al. (1985) Nature 313:810-812); rice actin
(McElroy et al. (1990) Plant Cell 2:163-171); ubiquitin
(Christensen et al. (1989) Plant Mol. Biol. 12:619-632 and
Christensen et al. (1992) Plant Mol. Biol. 18:675-689); pEMU (Last
et al. (1991) Theor. Appl. Genet. 81:581-588); MAS (Velten et al.
(1984) EMBO J. 3:2723-2730); ALS promoter (U.S. Pat. No.
5,659,026), and the like. Other constitutive promoters include, for
example, U.S. Pat. Nos. 5,608,149; 5,608,144; 5,604,121; 5,569,597;
5,466,785; 5,399,680; 5,268,463; 5,608,142; and 6,177,611.
[0117] Tissue-preferred promoters can be utilized to target
enhanced AHASL1 expression within a particular plant tissue. Such
tissue-preferred promoters include, but are not limited to,
leaf-preferred promoters, root-preferred promoters, seed-preferred
promoters, and stem-preferred promoters. Tissue-preferred promoters
include Yamamoto et al. (1997) Plant J. 12(2):255-265; Kawamata et
al. (1997) Plant Cell Physiol. 38(7):792-803; Hansen et al. (1997)
Mol. Gen. Genet. 254(3):337-343; Russell et al. (1997) Transgenic
Res. 6(2):157-168; Rinehart et al. (1996) Plant Physiol.
112(3):1331-1341; Van Camp et al. (1996) Plant Physiol.
112(2):525-535; Canevascini et al. (1996) Plant Physiol.
112(2):513-524; Yamamoto et al. (1994) Plant Cell Physiol
35(5):773-778; Lam (1994) Results Probl. Cell Differ. 20:181-196;
Orozco et al. (1993) Plant Mol Biol. 23(6):1129-1138; Matsuoka et
al. (1993) Proc Natl. Acad. Sci. USA 90(20):9586-9590; and
Guevara-Garcia et al. (1993) Plant J. 4(3):495-505. Such promoters
can be modified, if necessary, for weak expression.
[0118] In one embodiment, the nucleic acids of interest are
targeted to the chloroplast for expression. In this manner, where
the nucleic acid of interest is not directly inserted into the
chloroplast, the expression cassette will additionally contain a
chloroplast-targeting sequence comprising a nucleotide sequence
that encodes a chloroplast transit peptide to direct the gene
product of interest to the chloroplasts. Such transit peptides are
known in the art. With respect to chloroplast-targeting sequences,
"operably linked" means that the nucleic acid sequence encoding a
transit peptide (i.e., the chloroplast-targeting sequence) is
linked to the AHASL polynucleotide of the invention such that the
two sequences are contiguous and in the same reading frame. See,
for example, Von Heijne et al. (1991) Plant Mol. Biol. Rep.
9:104-126; Clark et al. (1989) J. Biol. Chem. 264:17544-17550;
Della-Cioppa et al. (1987) Plant Physiol. 84:965-968; Romer et al.
(1993) Biochem. Biophys. Res. Commun. 196:1414-1421; and Shah et
al. (1986) Science 233:478-481. While the AHASL1 proteins of the
invention include a native chloroplast transit peptide, any
chloroplast transit peptide known in art can be fused to the amino
acid sequence of a mature AHASL1 protein of the invention by
operably linking a choloroplast-targeting sequence to the 5'-end of
a nucleotide sequence encoding a mature AHASL1 protein of the
invention.
[0119] Chloroplast targeting sequences are known in the art and
include the chloroplast small subunit of ribulose-1,5-bisphosphate
carboxylase (Rubisco) (de Castro Silva Filho et al. (1996) Plant
Mol. Biol. 30:769-780; Schnell et al. (1991) J. Biol. Chem.
266(5):3335-3342); 5-(enolpyruvyl)shikimate-3-phosphate synthase
(EPSPS) (Archer et al. (1990) J. Bioenerg. Biomemb. 22(6):789-810);
tryptophan synthase (Zhao et al. (1995) J. Biol. Chem.
270(11):6081-6087); plastocyanin (Lawrence et al. (1997) J. Biol.
Chem. 272(33):20357-20363); chorismate synthase (Schmidt et al.
(1993) J. Biol. Chem. 268(36):27447-27457); and the light
harvesting chlorophyll a/b binding protein (LHBP) (Lamppa et al.
(1988) J. Biol. Chem. 263:14996-14999). See also Von Heijne et al.
(1991) Plant Mol. Biol. Rep. 9:104-126; Clark et al. (1989) J.
Biol. Chem. 264:17544-17550; Della-Cioppa et al. (1987) Plant
Physiol. 84:965-968; Romer et al. (1993) Biochem. Biophys. Res.
Commun. 196:1414-1421; and Shah et al. (1986) Science
233:478-481.
[0120] Methods for transformation of chloroplasts are known in the
art. See, for example, Svab et al. (1990) Proc. Natl. Acad. Sci.
USA 87:8526-8530; Svab and Maliga (1993) Proc. Natl. Acad. Sci. USA
90:913-917; Svab and Maliga (1993) EMBO J. 12:601-606. The method
relies on particle gun delivery of DNA containing a selectable
marker and targeting of the DNA to the plastid genome through
homologous recombination. Additionally, plastid transformation can
be accomplished by transactivation of a silent plastid-borne
transgene by tissue-preferred expression of a nuclear-encoded and
plastid-directed RNA polymerase. Such a system has been reported in
McBride et al. (1994) Proc. Natl. Acad. Sci. USA 91:7301-7305.
[0121] The nucleic acids of interest to be targeted to the
chloroplast may be optimized for expression in the chloroplast to
account for differences in codon usage between the plant nucleus
and this organelle. In this manner, the nucleic acids of interest
may be synthesized using chloroplast-preferred codons. See, for
example, U.S. Pat. No. 5,380,831, herein incorporated by
reference.
[0122] As disclosed herein, the AHASL1 nucleotide sequences of the
invention find use in enhancing the herbicide tolerance of plants
that comprise in their genomes a gene encoding a herbicide-tolerant
AHASL1 protein. Such a gene may be an endogenous gene or a
transgene. Additionally, in certain embodiments, the nucleic acid
sequences of the present invention can be stacked with any
combination of polynucleotide sequences of interest in order to
create plants with a desired phenotype. For example, the
polynucleotides of the present invention may be stacked with any
other polynucleotides encoding polypeptides having pesticidal
and/or insecticidal activity, such as, for example, the Bacillus
thuringiensis toxin proteins (described in U.S. Pat. Nos.
5,366,892; 5,747,450; 5,737,514; 5,723,756; 5,593,881; and Geiser
et al. (1986) Gene 48:109). The combinations generated can also
include multiple copies of any one of the polynucleotides of
interest.
[0123] It is recognized that with these nucleotide sequences,
antisense constructions, complementary to at least a portion of the
messenger RNA (mRNA) for the AHASL1 polynucleotide sequences can be
constructed. Antisense nucleotides are constructed to hybridize
with the corresponding mRNA. Modifications of the antisense
sequences may be made as long as the sequences hybridize to and
interfere with expression of the corresponding mRNA. In this
manner, antisense constructions having 70%, preferably 80%, more
preferably 85% sequence identity to the corresponding antisensed
sequences may be used. Furthermore, portions of the antisense
nucleotides may be used to disrupt the expression of the target
gene. Generally, sequences of at least 50 nucleotides, 100
nucleotides, 200 nucleotides, or greater may be used.
[0124] The nucleotide sequences of the present invention may also
be used in the sense orientation to suppress the expression of
endogenous genes in plants. Methods for suppressing gene expression
in plants using nucleotide sequences in the sense orientation are
known in the art. The methods generally involve transforming plants
with a DNA construct comprising a promoter that drives expression
in a plant operably linked to at least a portion of a nucleotide
sequence that corresponds to the transcript of the endogenous gene.
Typically, such a nucleotide sequence has substantial sequence
identity to the sequence of the transcript of the endogenous gene,
preferably greater than about 65% sequence identity, more
preferably greater than about 85% sequence identity, most
preferably greater than about 95% sequence identity. See, U.S. Pat.
Nos. 5,283,184 and 5,034,323; herein incorporated by reference.
[0125] While the herbicide-resistant AHASL1 polynucleotides of the
invention find use as selectable marker genes for plant
transformation, the expression cassettes of the invention can
include another selectable marker gene for the selection of
transformed cells. Selectable marker genes, including those of the
present invention, are utilized for the selection of transformed
cells or tissues. Marker genes include, but are not limited to,
genes encoding antibiotic resistance, such as those encoding
neomycin phosphotransferase II (NEO) and hygromycin
phosphotransferase (HPT), as well as genes conferring resistance to
herbicidal compounds, such as glufosinate ammonium, bromoxynil,
imidazolinones, and 2,4-dichlorophenoxyacetate (2,4-D). See
generally, Yarranton (1992) Curr. Opin. Biotech. 3:506-511;
Christopherson et al. (1992)Proc. Natl. Acad. Sci. USA
89:6314-6318; Yao et al. (1992) Cell 71:63-72; Reznikoff (1992)
Mol. Microbiol. 6:2419-2422; Barkley et al. (1980) in The Operon,
pp. 177-220; Hu et al. (1987) Cell 48:555-566; Brown et al. (1987)
Cell 49:603-612; Figge et al. (1988) Cell 52:713-722; Deuschle et
al. (1989) Proc. Natl. Acad. Act USA 86:5400-5404; Fuerst et al.
(1989) Proc. Natl. Acad. Sci. USA 86:2549-2553; Deuschle et al.
(1990) Science 248:480-483; Gossen (1993) Ph.D. Thesis, University
of Heidelberg; Reines et al. (1993) Proc. Natl. Acad. Sci. USA
90:1917-1921; Labow et al. (1990) Mol. Cell. Biol. 10:3343-3356;
Zambretti et al. (1992) Proc. Natl. Acad. Sci. USA 89:3952-3956;
Baim et al. (1991) Proc. Natl. Acad. Sci. USA 88:5072-5076;
Wyborski et al (1991) Nucleic Acids Res. 19:4647-4653;
Hillenand-Wissman (1989) Topics Mol. Struc. Biol. 10:143-162;
Degenkolb et al. (1991) Antimicrob. Agents Chemother. 35:1591-1595;
Kleinschnidt et al. (1988) Biochemistry 27:1094-1104; Bonin (1993)
Ph.D. Thesis, University of Heidelberg; Gossen et al. (1992) Proc.
Natl. Acad. Sci. USA 89:5547-5551; Oliva et al. (1992) Antimicrob.
Agents Chemother. 36:913-919; Hlavka et al. (1985) Handbook of
Experimental Pharmacology, Vol. 78 (Springer-Verlag, Berlin); Gill
et al. (1988) Nature 334:721-724, Such disclosures are herein
incorporated by reference.
[0126] The above list of selectable marker genes is not meant to be
limiting. Any selectable marker gene can be used in the present
invention.
[0127] The isolated polynucleotide molecules comprising nucleotide
sequence that encode the AHASL1 proteins of the invention can be
used in vectors to transform plants so that the plants created have
enhanced resistant to herbicides, particularly imidazolinone
herbicides. The isolated AHASL1 polynucleotide molecules of the
invention can be used in vectors alone or in combination with a
nucleotide sequence encoding the small subunit of the AHAS (AHASS)
enzyme in conferring herbicide resistance in plants. See, U.S. Pat.
No. 6,348,643; which is herein incorporated by reference.
[0128] The invention also relates to a plant expression vector
comprising a promoter that drives expression in a plant operably
linked to an isolated polynucleotide molecule of the invention. The
isolated polynucleotide molecule comprises a nucleotide sequence
encoding an AHASL1 protein, particularly an AHASL1 protein
comprising an amino sequence that is set forth in SEQ ID NO: 2, 4,
6, or 8, or a functional fragment and variant thereof. The plant
expression vector of the invention does not depend on a particular
promoter, only that such a promoter is capable of driving gene
expression in a plant cell. Preferred promoters include
constitutive promoters and tissue-preferred promoters.
[0129] The transformation vectors of the invention can be used to
produce plants transformed with a gene of interest. The
transformation vector will comprise a selectable marker gene of the
invention and a gene of interest to be introduced and typically
expressed in the transformed plant. Such a selectable marker gene
comprises a herbicide-resistant AHASL1 polynucleotide of the
invention operably linked to a promoter that drives expression in a
host cell. For use in plants and plant cells, the transformation
vector comprises a selectable marker gene comprising a
herbicide-resistant AHASL1 polynucleotide of the invention operably
linked to a promoter that drives expression in a plant cell.
[0130] The genes of interest of the invention vary depending on the
desired outcome. For example, various changes in phenotype can be
of interest including modifying the fatty acid composition in a
plant, altering the amino acid content of a plant, altering a
plant's insect and/or pathogen defense mechanisms, and the like.
These results can be achieved by providing expression of
heterologous products or increased expression of endogenous
products in plants. Alternatively, the results can be achieved by
providing for a reduction of expression of one or more endogenous
products, particularly enzymes or cofactors in the plant. These
changes result in a change in phenotype of the transformed
plant.
[0131] In one embodiment of the invention, the genes of interest
include insect resistance genes such as, for example, Bacillus
thuringiensis toxin protein genes (U.S. Pat. Nos. 5,366,892;
5,747,450; 5,736,514; 5,723,756; 5,593,881; and Geiser et al.
(1986) Gene 48:109).
[0132] The AHASL1 proteins or polypeptides of the invention can be
purified from, for example, sunflower plants and can be used in
compositions. Also, an isolated polynucleotide molecule encoding an
AHASL1 protein of the invention can be used to express an AHASL1
protein of the invention in a microbe such as E. coli or a yeast.
The expressed AHASL1 protein can be purified from extracts of E.
coli or yeast by any method known to those or ordinary skill in the
art.
[0133] The invention also relates to a method for creating a
transgenic plant that is resistant to herbicides, comprising
transforming a plant with a plant expression vector comprising a
promoter that drives expression in a plant operably linked to an
isolated polynucleotide molecule of the invention. The isolated
polynucleotide molecule comprises a nucleotide sequence encoding an
AHASL1 protein of the invention, particularly an AHASL1 protein
comprising: an amino sequence that is set forth in SEQ ID NO: 2 or
6, an amino acid sequence encoded by SEQ ID NO: 1 or 5, or a
functional fragment and variant of said amino acid sequences.
[0134] The invention also relates to the non-transgenic sunflower
plants, transgenic plants produced by the methods of the invention,
and progeny and other descendants of such non-transgenic and
transgenic plants, which plants exhibit enhanced or increased
resistance to herbicides that interfere with the AHAS enzyme,
particularly imidazolinone and sulfonylurea herbicides.
[0135] The AHASL1 polynucleotides of the invention, particularly
those encoding herbicide-resistant AHASL1 proteins, find use in
methods for enhancing the resistance of herbicide-tolerant plants.
In one embodiment of the invention, the herbicide-tolerant plants
comprise a herbicide-tolerant or herbicide resistant AHASL protein.
The herbicide-tolerant plants include both plants transformed with
a herbicide-tolerant AHASL nucleotide sequences and plants that
comprise in their genomes an endogenous gene that encodes a
herbicide-tolerant AHASL protein. Nucleotide sequences encoding
herbicide-tolerant AHASL proteins and herbicide-tolerant plants
comprising an endogenous gene that encodes a herbicide-tolerant
AHASL protein include the polynucleotides and plants of the present
invention and those that are known in the art. See, for example,
U.S. Pat. Nos. 5,013,659, 5,731,180, 5,767,361, 5,545,822,
5,736,629, 5,773,703, 5,773,704, 5,952,553 and 6,274,796; all of
which are herein incorporated by reference. Such methods for
enhancing the resistance of herbicide-tolerant plants comprise
transforming a herbicide-tolerant plant with at least one
polynucleotide construction comprising a promoter that drives
expression in a plant cell that is operably linked to a herbicide
resistant AHASL1 polynucleotide of the invention, particularly the
polynucleotide encoding a herbicide-resistant AHASL1 protein set
forth in SEQ ID NO: 1 or 5, polynucleotides encoding the amino acid
sequence set forth in SEQ ID NO: 2 or 6, and fragments and variants
said polynucleotides that encode polypeptides comprising
herbicide-resistant AHAS activity.
[0136] Numerous plant transformation vectors and methods for
transforming plants are available. See, for example, An, G. et al.
(1986) Plant Pysiol., 81:301-305; Fry, J., et al. (1987) Plant Cell
Rep. 6:321-325; Block, M. (1988) Theor. Appl Genet. 76:767-774;
Hinchee, et al. (1990) Stadler. Genet. Symp. 203212.203-212;
Cousins, et al. (1991) Aust. J. Plant Physiol. 18:481-494; Chee, P.
P. and Slightom, J. L. (1992) Gene. 118:255-260; Christou, et al.
(1992) Trends. Biotechnol. 10:239-246; D'Halluin, et al. (1992)
Bio/Technol. 10:309-314; Dhir, et al. (1992) Plant Physiol.
99:81-88; Casas et al. (1993) Proc. Nat. Acad. Sci. USA
90:11212-11216; Christou, P. (1993) In Vitro Cell. Dev.
Biol.-Plant; 29P:119-124; Davies, et al. (1993) Plant Cell Rep.
12:180-183; Dong, J. A. and Mchughen, A. (1993) Plant Sci.
91:139-148; Franklin, C. I. and Trieu, T. N. (1993) Plant. Physiol.
102:167; Golovkin, et al. (1993) Plant Sci. 90:41-52; Guo Chin Sci.
Bull. 38:2072-2078; Asano, et al. (1994) Plant Cell Rep. 13; Ayeres
N. M. and Park, W. D. (1994) Crit. Rev. Plant. Sci. 13:219-239;
Barcelo, et al. (1994) Plant. J. 5:583-592; Becker, et al. (1994)
Plant. J. 5:299-307; Borkowska et al. (1994) Acta. Physiol Plant.
16:225-230; Christou, P. (1994) Agro. Food. Ind. Hi Tech. 5: 17-27;
Eapen et al. (1994) Plant Cell Rep. 13:582-586; Hartman, et al.
(1994) Bio-Technology 12: 919923; Ritala, et al. (1994) Plant. Mol.
Biol. 24:317-325; and Wan, Y. C. and Lemaux, P. G. (1994) Plant
Physiol. 104:3748.
[0137] The methods of the invention involve introducing a
polynucleotide construct into a plant. By "introducing" is intended
presenting to the plant the polynucleotide construct in such a
manner that the construct gains access to the interior of a cell of
the plant. The methods of the invention do not depend on a
particular method for introducing a polynucleotide construct to a
plant, only that the polynucleotide construct gains access to the
interior of at least one cell of the plant. Methods for introducing
polynucleotide constructs into plants are known in the art
including, but not limited to, stable transformation methods,
transient transformation methods, and virus-mediated methods.
[0138] By "stable transformation" is intended that the
polynucleotide construct introduced into a plant integrates into
the genome of the plant and is capable of being inherited by
progeny thereof. By "transient transformation" is intended that a
polynucleotide construct introduced into a plant does not integrate
into the genome of the plant.
[0139] For the transformation of plants and plant cells, the
nucleotide sequences of the invention are inserted using standard
techniques into any vector known in the art that is suitable for
expression of the nucleotide sequences in a plant or plant cell.
The selection of the vector depends on the preferred transformation
technique and the target plant species to be transformed. In an
embodiment of the invention, an AHASL1 nucleotide sequence is
operably linked to a plant promoter that is known for high-level
expression in a plant cell, and this construct is then introduced
into a plant that that is susceptible to an imidazolinone herbicide
and a transformed plant it regenerated. The transformed plant is
tolerant to exposure to a level of an imidazolinone herbicide that
would kill or significantly injure an untransformed plant. This
method can be applied to any plant species; however, it is most
beneficial when applied to crop plants, particularly crop plants
that are typically grown in the presence of at least one herbicide,
particularly an imidazolinone herbicide.
[0140] Methodologies for constructing plant expression cassettes
and introducing foreign nucleic acids into plants are generally
known in the art and have been previously described. For example,
foreign DNA can be introduced into plants, using tumor-inducing
(Ti) plasmid vectors. Other methods utilized for foreign DNA
delivery involve the use of PEG mediated protoplast transformation,
electroporation, microinjection whiskers, and biolistics or
microprojectile bombardment for direct DNA uptake. Such methods are
known in the art. (U.S. Pat. No. 5,405,765 to Vasil et al.; Bilang
et al. (1991) Gene 100: 247-250; Scheid et al., (1991) Mol. Gen.
Genet., 228: 104-112; Guerche et al., (1987) Plant Science 52:
111-116; Neuhause et al., (1987) Theor. Appl Genet. 75: 30-36;
Klein et al., (1987) Nature 327: 70-73; Howell et al., (1980)
Science 208:1265; Horsch et al., (1985) Science 227: 1229-1231;
DeBlock et al., (1989) Plant Physiology 91: 694-701; Methods for
Plant Molecular Biology (Weissbach and Weissbach, eds.) Academic
Press, Inc. (1988) and Methods in Plant Molecular Biology (Schuler
and Zielinski, eds.) Academic Press, Inc. (1989). The method of
transformation depends upon the plant cell to be transformed,
stability of vectors used, expression level of gene products and
other parameters.
[0141] Other suitable methods of introducing nucleotide sequences
into plant cells and subsequent insertion into the plant genome
include microinjection as Crossway et al. (1986) Biotechniques
4:320-334, electroporation as described by Riggs et al. (1986)
Proc. Natl. Acad. Sci. USA 83:5602-5606, Agrobacterium-mediated
transformation as described by Townsend et al., U.S. Pat. No.
5,563,055, Zhao et al., U.S. Pat. No. 5,981,840, direct gene
transfer as described by Paszkowski et al. (1984) EMBO J.
3:2717-2722, and ballistic particle acceleration as described in,
for example, Sanford et al., U.S. Pat. No. 4,945,050; Tomes et al.,
U.S. Pat. No. 5,879,918; Tomes et al., U.S. Pat. No. 5,886,244;
Bidney et al., U.S. Pat. No. 5,932,782; Tomes et al. (1995) "Direct
DNA Transfer into Intact Plant Cells via Microprojectile
Bombardment," in Plant Cell, Tissue, and Organ Culture: Fundamental
Methods, ed. Gamborg and Phillips (Springer-Verlag, Berlin); McCabe
et al. (1988) Biotechnology 6:923-926); and Lec1 transformation (WO
00/28058). Also see, Weissinger et al. (1988) Ann. Rev. Genet.
22:421-477; Sanford et al. (1987) Particulate Science and
Technology 5:27-37 (onion); Christou et al. (1988) Plant Physiol.
87:671-674 (soybean); McCabe et al. (1988) Bio/Technology 6:923-926
(soybean); Finer and McMullen (1991) In Vitro Cell Dev. Biol.
27P:175-182 (soybean); Singh et al. (1998) Theor. Appl. Genet.
96:319-324 (soybean); Datta et al. (1990) Biotechnology 8:736-740
(rice); Klein et al. (1988) Proc. Natl. Acad. Sci. USA 85:4305-4309
(maize); Klein et al. (1988) Biotechnology 6:559-563 (maize);
Tomes, U.S. Pat. No. 5,240,855; Buising et al., U.S. Pat. Nos.
5,322,783 and 5,324,646; Tomes et al. (1995) "Direct DNA Transfer
into Intact Plant Cells via Microprojectile Bombardment," in Plant
Cell, Tissue, and Organ Culture: Fundamental Methods, ed. Gamborg
(Springer-Verlag, Berlin) (maize); Klein et al. (1988) Plant
Physiol. 91:440-444 (maize); Fromm et al. (1990) Biotechnology
8:833-839 (maize); Hooykaas-Van Slogteren et al. (1984) Nature
(London) 311:763-764; Bowen et al., U.S. Pat. No. 5,736,369
(cereals); Bytebier et al. (1987) Proc. Natl. Acad. Sci. USA
84:5345-5349 (Liliaceae); De Wet et al. (1985) in The Experimental
Manipulation of Ovule Tissues, ed. Chapman et al. (Longman, New
York), pp. 197-209 (pollen); Kaeppler et al. (1990) Plant Cell
Reports 9:415-418 and Kaeppler et al. (1992) Theor. Appl. Genet.
84:560-566 (whisker-mediated transformation); D'Halluin et al.
(1992) Plant Cell 4:1495-1505 (electroporation); Li et al. (1993)
Plant Cell Reports 12:250-255 and Christou and Ford (1995) Annals
of Botany 75:407-413 (rice); Osjoda et al. (1996) Nature
Biotechnology 14:745-750 (maize via Agrobacterium tumefaciens); all
of which are herein incorporated by reference.
[0142] The polynucleotides of the invention may be introduced into
plants by contacting plants with a virus or viral nucleic acids.
Generally, such methods involve incorporating a polynucleotide
construct of the invention within a viral DNA or RNA molecule. It
is recognized that the an AHASL1 protein of the invention may be
initially synthesized as part of a viral polyprotein, which later
may be processed by proteolysis in vivo or in vitro to produce the
desired recombinant protein. Further, it is recognized that
promoters of the invention also encompass promoters utilized for
transcription by viral RNA polymerases. Methods for introducing
polynucleotide constructs into plants and expressing a protein
encoded therein, involving viral DNA or RNA molecules, are known in
the art. See, for example, U.S. Pat. Nos. 5,889,191, 5,889,190,
5,866,785, 5,589,367 and 5,316,931; herein incorporated by
reference.
[0143] The cells that have been transformed may be grown into
plants in accordance with conventional ways. See, for example,
McCormick et al. (1986) Plant Cell Reports 5:81-84. These plants
may then be grown, and either pollinated with the same transformed
strain or different strains, and the resulting hybrid having
constitutive expression of the desired phenotypic characteristic
identified. Two or more generations may be grown to ensure that
expression of the desired phenotypic characteristic is stably
maintained and inherited and then seeds harvested to ensure
expression of the desired phenotypic characteristic has been
achieved. In this manner, the present invention provides
transformed seed (also referred to as "transgenic seed") having a
polynucleotide construct of the invention, for example, an
expression cassette of the invention, stably incorporated into
their genome.
[0144] The present invention may be used for transformation of any
plant species, including, but not limited to, monocots and dicots.
Examples of plant species of interest include, but are not limited
to, corn or maize (Zea mays), Brassica sp. (e.g., B. napus, B.
rapa, B. juncea), particularly those Brassica species useful as
sources of seed oil, alfalfa (Medicago sativa), rice (Oryza
sativa), rye (Secale cereale), sorghum (Sorghum bicolor, Sorghum
vulgare), millet (e.g., pearl millet (Pennisetum glaucum), proso
millet (Panicum miliaceum), foxtail millet (Setaria italica),
finger millet (Eleusine coracana)), sunflower (Helianthus annuus),
safflower (Carthamus tinctorius), wheat (Triticum aestivum, T.
Turgidum ssp. durum), soybean (Glycine max), tobacco (Nicotiana
tabacum), potato (Solanum tuberosum), peanuts (Arachis hypogaea),
cotton (Gossypium barbadense, Gossypium hirsutum), sweet potato
(Ipomoea batatus), cassava (Manihot esculenta), coffee (Coffea
spp.), coconut (Cocos nucifera), pineapple (Ananas comosus), citrus
trees (Citrus spp.), cocoa (Theobroma cacao), tea (Camellia
sinensis), banana (Musa spp.), avocado (Persea americana), fig
(Ficus casica), guava (Psidium guajava), mango (Mangifera indica),
olive (Olea europaea), papaya (Carica papaya), cashew (Anacardium
occidentale), macadamia (Macadamia integrifolia), almond (Prunus
amygdalus), sugar beets (Beta vulgaris), sugarcane (Saccharum
spp.), oats, barley, vegetables, ornamentals, and conifers.
Preferably, plants of the present invention are crop plants (for
example, sunflower, Brassica sp., cotton, sugar, beet, soybean,
peanut, alfalfa, safflower, tobacco, corn, rice, wheat, rye, barley
triticale, sorghum, millet, etc.).
[0145] The herbicide resistant plants of the invention find use in
methods for controlling weeds. Thus, the present invention further
provides a method for controlling weeds in the vicinity of a
herbicide-resistant plant of the invention. The method comprises
applying an effective amount of a herbicide to the weeds and to the
herbicide-resistant plant, wherein the plant has increased
resistance to at least one herbicide, particularly an imidazolinone
or sulfonylurea herbicide, when compared to a wild-type plant. In
such a method for controlling weeds, the herbicide-resistant plants
of the invention are preferably crop plants, including, but not
limited to, sunflower, alfalfa, Brassica sp., soybean, cotton,
safflower, peanut, tobacco, tomato, potato, wheat, rice, maize,
sorghum, barley, rye, millet, and sorghum.
[0146] By providing plants having increased resistance to
herbicides, particularly imidazolinone and sulfonylurea herbicides,
a wide variety of formulations can be employed for protecting
plants from weeds, so as to enhance plant growth and reduce
competition for nutrients. A herbicide can be used by itself for
pre-emergence, post-emergence, pre-planting and at planting control
of weeds in areas surrounding the plants described herein or an
imidazolinone herbicide formulation can be used that contains other
additives. The herbicide can also be used as a seed treatment. That
is an effective concentration or an effective amount of the
herbicide, or a composition comprising an effective concentration
or an effective amount of the herbicide can be applied directly to
the seeds prior to or during the sowing of the seeds. Additives
found in an imidazolinone or sulfonylurea herbicide formulation or
composition include other herbicides, detergents, adjuvants,
spreading agents, sticking agents, stabilizing agents, or the like.
The herbicide formulation can be a wet or dry preparation and can
include, but is not limited to, flowable powders, emulsifiable
concentrates and liquid concentrates. The herbicide and herbicide
formulations can be applied in accordance with conventional
methods, for example, by spraying, irrigation, dusting, coating,
and the like.
[0147] The present invention provides non-transgenic and transgenic
seeds with increased resistance to at least one herbicide,
particularly an AHAS-inhibiting herbicide. Such seeds include, for
example, non-transgenic sunflower seeds comprising the
herbicide-resistance characteristics of the plant with ATCC Patent
Deposit Number PTA-6084, and transgenic seeds comprising a
polynucleotide molecule of the invention that encodes a
herbicide-resistant AHASL1 protein.
[0148] The present invention provides methods for producing a
herbicide-resistant plant, particularly a herbicide-resistant
sunflower plant, through conventional plant breeding involving
sexual reproduction. The methods comprise crossing a first plant
that is resistant to a herbicide to a second plant that is not
resistant to the herbicide. The first plant can be any of the
herbicide resistant plants of the present invention including, for
example, transgenic plants comprising at least one of the
polynucleotides of the present invention that encode a herbicide
resistant AHASL and non-transgenic sunflower plants that comprise
the herbicide-resistance characteristics of the sunflower plant
with ATCC Patent Deposit Number PTA-6084. The second plant can be
any plant that is capable of producing viable progeny plants (i.e.,
seeds) when crossed with the first plant. Typically, but not
necessarily, the first and second plants are of the same species.
The methods of the invention can further involve one or more
generations of backcrossing the progeny plants of the first cross
to a plant of the same line or genotype as either the first or
second plant. Alternatively, the progeny of the first cross or any
subsequent cross can be crossed to a third plant that is of a
different line or genotype than either the first or second plant.
The methods of the invention can additionally involve selecting
plants that comprise the herbicide resistance characteristics of
the first plant.
[0149] The present invention further provides methods for
increasing the herbicide-resistance of a plant, particularly a
herbicide-resistant sunflower plant, through conventional plant
breeding involving sexual reproduction. The methods comprise
crossing a first plant that is resistant to a herbicide to a second
plant that may or may not be resistant to the herbicide or may be
resistant to different herbicide or herbicides than the first
plant. The first plant can be any of the herbicide resistant plants
of the present invention including, for example, transgenic plants
comprising at least one of the polynucleotides of the present
invention that encode a herbicide resistant AHASL and
non-transgenic sunflower plants that comprise the
herbicide-resistance characteristics of the sunflower plant with
ATCC Patent Deposit Number PTA-6084. The second plant can be any
plant that is capable of producing viable progeny plants (i.e.,
seeds) when crossed with the first plant. Typically, but not
necessarily, the first and second plants are of the same species.
The progeny plants produced by this method of the present invention
have increased resistance to a herbicide when compared to either
the first or second plant or both. When the first and second plants
are resistant to different herbicides, the progeny plants will have
the combined herbicide resistance characteristics of the first and
second plants. The methods of the invention can further involve one
or more generations of backcrossing the progeny plants of the first
cross to a plant of the same line or genotype as either the first
or second plant. Alternatively, the progeny of the first cross or
any subsequent cross can be crossed to a third plant that is of a
different line or genotype than either the first or second plant.
The methods of the invention can additionally involve selecting
plants that comprise the herbicide resistance characteristics of
the first plant, the second plant, or both the first and the second
plant.
[0150] The present invention provides methods that involve the use
of an AHAS-inhibiting herbicide. In these methods, the
AHAS-inhibiting herbicide can be applied by any method known in the
art including, but not limited to, seed treatment, soil treatment,
and foliar treatment.
[0151] Prior to application, the AHAS-inhibiting herbicide can be
converted into the customary formulations, for example solutions,
emulsions, suspensions, dusts, powders, pastes and granules. The
use form depends on the particular intended purpose; in each case,
it should ensure a fine and even distribution of the compound
according to the invention.
[0152] The formulations are prepared in a known manner (see e.g.
for review U.S. Pat. No. 3,060,084, EP-A 707 445 (for liquid
concentrates), Browning, "Agglomeration", Chemical Engineering,
Dec. 4, 1967, 147-48, Perry's Chemical Engineer's Handbook, 4th
Ed., McGraw-Hill, New York, 1963, pages 8-57 and et seq. WO
91/13546, U.S. Pat. No. 4,172,714, U.S. Pat. No. 4,144,050, U.S.
Pat. No. 3,920,442, U.S. Pat. No. 5,180,587, U.S. Pat. No.
5,232,701, U.S. Pat. No. 5,208,030, GB 2,095,558, U.S. Pat. No.
3,299,566, Klingman, Weed Control as a Science, John Wiley and
Sons, Inc., New York, 1961, Hance et al., Weed Control Handbook,
8th Ed., Blackwell Scientific Publications, Oxford, 1989 and
Mollet, H., Grubemann, A., Formulation technology, Wiley VCH Verlag
GmbH, Weinheim (Germany), 2001, 2. D. A. Knowles, Chemistry and
Technology of Agrochemical Formulations, Kluwer Academic
Publishers, Dordrecht, 1998 (ISBN 0-7514-0443-8), for example by
extending the active compound with auxiliaries suitable for the
formulation of agrochemicals, such as solvents and/or carriers, if
desired emulsifiers, surfactants and dispersants, preservatives,
antifoaming agents, anti-freezing agents, for seed treatment
formulation also optionally colorants and/or binders and/or gelling
agents.
[0153] Examples of suitable solvents are water, aromatic solvents
(for example Solvesso products, xylene), paraffins (for example
mineral oil fractions), alcohols (for example methanol, butanol,
pentanol, benzyl alcohol), ketones (for example cyclohexanone,
gamma-butyrolactone), pyrrolidones (NMP, NOP), acetates (glycol
diacetate), glycols, fatty acid dimethylamides, fatty acids and
fatty acid esters. In principle, solvent mixtures may also be
used.
[0154] Examples of suitable carriers are ground natural minerals
(for example kaolins, clays, talc, chalk) and ground synthetic
minerals (for example highly disperse silica, silicates).
[0155] Suitable emulsifiers are nonionic and anionic emulsifiers
(for example polyoxyethylene fatty alcohol ethers, alkylsulfonates
and arylsulfonates).
[0156] Examples of dispersants are lignin-sulfite waste liquors and
methylcellulose.
[0157] Suitable surfactants used are alkali metal, alkaline earth
metal and ammonium salts of lignosulfonic acid, naphthalenesulfonic
acid, phenolsulfonic acid, dibutylnaphthalenesulfonic acid,
alkylarylsulfonates, alkyl sulfates, alkylsulfonates, fatty alcohol
sulfates, fatty acids and sulfated fatty alcohol glycol ethers,
furthermore condensates of sulfonated naphthalene and naphthalene
derivatives with formaldehyde, condensates of naphthalene or of
naphthalenesulfonic acid with phenol and formaldehyde,
polyoxyethylene octylphenol ether, ethoxylated isooctylphenol,
octylphenol, nonylphenol, alkylphenol polyglycol ethers,
tributylphenyl polyglycol ether, tristearylphenyl polyglycol ether,
alkylaryl polyether alcohols, alcohol and fatty alcohol ethylene
oxide condensates, ethoxylated castor oil, polyoxyethylene alkyl
ethers, ethoxylated polyoxypropylene, lauryl alcohol polyglycol
ether acetal, sorbitol esters, lignosulfite waste liquors and
methylcellulose.
[0158] Substances which are suitable for the preparation of
directly sprayable solutions, emulsions, pastes or oil dispersions
are mineral oil fractions of medium to high boiling point, such as
kerosene or diesel oil, furthermore coal tar oils and oils of
vegetable or animal origin, aliphatic, cyclic and aromatic
hydrocarbons, for example toluene, xylene, paraffin,
tetrahydronaphthalene, alkylated naphthalenes or their derivatives,
methanol, ethanol, propanol, butanol, cyclohexanol, cyclohexanone,
isophorone, highly polar solvents, for example dimethyl sulfoxide,
N-methylpyrrolidone or water.
[0159] Also anti-freezing agents such as glycerin, ethylene glycol,
propylene glycol and bactericides such as can be added to the
formulation.
[0160] Suitable antifoaming agents are for example antifoaming
agents based on silicon or magnesium stearate.
[0161] Suitable preservatives are for example Dichlorophen and
enzylalkoholhemiformal.
[0162] Seed Treatment formulations may additionally comprise
binders and optionally colorants.
[0163] Binders can be added to improve the adhesion of the active
materials on the seeds after treatment. Suitable binders are block
copolymers EO/PO surfactants but also polyvinylalcoholsl,
polyvinylpyrrolidones, polyacrylates, polymethacrylates,
polybutenes, polyisobutylenes, polystyrene, polyethyleneamines,
polyethyleneamides, polyethyleneimines (Lupasol.RTM.,
Polymin.RTM.), polyethers, polyurethans, polyvinylacetate, tylose
and copolymers derived from these polymers.
[0164] Optionally, also colorants can be included in the
formulation. Suitable colorants or dyes for seed treatment
formulations are Rhodamin B, C.I. Pigment Red 112, C.I. Solvent Red
1, pigment blue 15:4, pigment blue 15:3, pigment blue 15:2, pigment
blue 15:1, pigment blue 80, pigment yellow 1, pigment yellow 13,
pigment red 112, pigment red 48:2, pigment red 48:1, pigment red
57:1, pigment red 53:1, pigment orange 43, pigment orange 34,
pigment orange 5, pigment green 36, pigment green 7, pigment white
6, pigment brown 25, basic violet 10, basic violet 49, acid red 51,
acid red 52, acid red 14, acid blue 9, acid yellow 23, basic red
10, basic red 108.
[0165] An examples of a suitable gelling agent is carrageen
(Satiagel.RTM.)
[0166] Powders, materials for spreading, and dustable products can
be prepared by mixing or concomitantly grinding the active
substances with a solid carrier.
[0167] Granules, for example coated granules, impregnated granules
and homogeneous granules, can be prepared by binding the active
compounds to solid carriers. Examples of solid carriers are mineral
earths such as silica gels, silicates, talc, kaolin, attaclay,
limestone, lime, chalk, bole, loess, clay, dolomite, diatomaceous
earth, calcium sulfate, magnesium sulfate, magnesium oxide, ground
synthetic materials, fertilizers, such as, for example, ammonium
sulfate, ammonium phosphate, ammonium nitrate, ureas, and products
of vegetable origin, such as cereal meal, tree bark meal, wood meal
and nutshell meal, cellulose powders and other solid carriers.
[0168] In general, the formulations comprise from 0.01 to 95% by
weight, preferably from 0.1 to 90% by weight, of the
AHAS-inhibiting herbicide. In this case, the AHAS-inhibiting
herbicides are employed in a purity of from 90% to 100% by weight,
preferably 95% to 100% by weight (according to NMR spectrum). For
seed treatment purposes, respective formulations can be diluted
2-10 fold leading to concentrations in the ready to use
preparations of 0.01 to 60% by weight active compound by weight,
preferably 0.1 to 40% by weight.
[0169] The AHAS-inhibiting herbicide can be used as such, in the
form of their formulations or the use forms prepared therefrom, for
example in the form of directly sprayable solutions, powders,
suspensions or dispersions, emulsions, oil dispersions, pastes,
dustable products, materials for spreading, or granules, by means
of spraying, atomizing, dusting, spreading or pouring. The use
forms depend entirely on the intended purposes; they are intended
to ensure in each case the finest possible distribution of the
AHAS-inhibiting herbicide according to the invention.
[0170] Aqueous use forms can be prepared from emulsion
concentrates, pastes or wettable powders (sprayable powders, oil
dispersions) by adding water. To prepare emulsions, pastes or oil
dispersions, the substances, as such or dissolved in an oil or
solvent, can be homogenized in water by means of a wetter,
tackifier, dispersant or emulsifier. However, it is also possible
to prepare concentrates composed of active substance, wetter,
tackifier, dispersant or emulsifier and, if appropriate, solvent or
oil, and such concentrates are suitable for dilution with
water.
[0171] The active compound concentrations in the ready-to-use
preparations can be varied within relatively wide ranges. In
general, they are from 0.0001 to 10%, preferably from 0.01 to 1%
per weight.
[0172] The AHAS-inhibiting herbicide may also be used successfully
in the ultra-low-volume process (ULV), it being possible to apply
formulations comprising over 95% by weight of active compound, or
even to apply the active compound without additives.
[0173] The following are examples of formulations:
[0174] 1. Products for dilution with water for foliar applications.
For seed treatment purposes, such products may be applied to the
seed diluted or undiluted. [0175] A) Water-soluble concentrates
(SL, LS) [0176] Ten parts by weight of the AHAS-inhibiting
herbicide are dissolved in 90 parts by weight of water or a
water-soluble solvent. As an alternative, wetters or other
auxiliaries are added. The AHAS-inhibiting herbicide dissolves upon
dilution with water, whereby a formulation with 10% (w/w) of
AHAS-inhibiting herbicide is obtained. [0177] B) Dispersible
concentrates (DC) [0178] Twenty parts by weight of the
AHAS-inhibiting herbicide are dissolved in 70 parts by weight of
cyclohexanone with addition of 10 parts by weight of a dispersant,
for example polyvinylpyrrolidone. Dilution with water gives a
dispersion, whereby a formulation with 20% (w/w) of AHAS-inhibiting
herbicide is obtained. [0179] C) Emulsifiable concentrates (EC)
[0180] Fifteen parts by weight of the AHAS-inhibiting herbicide are
dissolved in 7 parts by weight of xylene with addition of calcium
dodecylbenzenesulfonate and castor oil ethoxylate (in each case 5
parts by weight). Dilution with water gives an emulsion, whereby a
formulation with 15% (w/w) of AHAS-inhibiting herbicide is
obtained. [0181] D) Emulsions (EW, EO, ES) [0182] Twenty-five parts
by weight of the AHAS-inhibiting herbicide are dissolved in 35
parts by weight of xylene with addition of calcium
dodecylbenzenesulfonate and castor oil ethoxylate (in each case 5
parts by weight). This mixture is introduced into 30 parts by
weight of water by means of an emulsifier machine (e.g.
Ultraturrax) and made into a homogeneous emulsion. Dilution with
water gives an emulsion, whereby a formulation with 25% (w/w) of
AHAS-inhibiting herbicide is obtained. [0183] E) Suspensions (SC,
OD, FS) [0184] In an agitated ball mill, 20 parts by weight of the
AHAS-inhibiting herbicide are comminuted with addition of 10 parts
by weight of dispersants, wetters and 70 parts by weight of water
or of an organic solvent to give a fine AHAS-inhibiting herbicide
suspension. Dilution with water gives a stable suspension of the
AHAS-inhibiting herbicide, whereby a formulation with 20% (w/w) of
AHAS-inhibiting herbicide is obtained. [0185] F) Water-dispersible
granules and water-soluble granules (WG, SG) [0186] Fifty parts by
weight of the AHAS-inhibiting herbicide are ground finely with
addition of 50 parts by weight of dispersants and wetters and made
as water-dispersible or water-soluble granules by means of
technical appliances (for example extrusion, spray tower, fluidized
bed). Dilution with water gives a stable dispersion or solution of
the AHAS-inhibiting herbicide, whereby a formulation with 50% (w/w)
of AHAS-inhibiting herbicide is obtained. [0187] G)
Water-dispersible powders and water-soluble powders (WP, SP, SS,
WS) [0188] Seventy-Five Parts by Weight of the Ahas-Inhibiting
herbicide are ground in a rotor-stator mill with addition of 25
parts by weight of dispersants, wetters and silica gel. Dilution
with water gives a stable dispersion or solution of the
AHAS-inhibiting herbicide, whereby a formulation with 75% (w/w) of
AHAS-inhibiting herbicide is obtained. [0189] I) Gel-Formulation
(GF) [0190] In an agitated ball mill, 20 parts by weight of the
AHAS-inhibiting herbicide are comminuted with addition of 10 parts
by weight of dispersants, 1 part by weight of a gelling agent
wetters and 70 parts by weight of water or of an organic solvent to
give a fine AHAS-inhibiting herbicide suspension. Dilution with
water gives a stable suspension of the AHAS-inhibiting herbicide,
whereby a formulation with 20% (w/w) of AHAS-inhibiting herbicide
is obtained. This gel formulation is suitable for us as a seed
treatment. [0191] 2. Products to be applied undiluted for foliar
applications. For seed treatment purposes, such products may be
applied to the seed diluted. [0192] A) Dustable powders (DP, DS)
[0193] Five parts by weight of the AHAS-inhibiting herbicide are
ground finely and mixed intimately with 95 parts by weight of
finely divided kaolin. This gives a dustable product having 5%
(w/w) of AHAS-inhibiting herbicide. [0194] B) Granules (GR, FG, GG,
MG) [0195] One-half part by weight of the AHAS-inhibiting herbicide
is ground finely and associated with 95.5 parts by weight of
carriers, whereby a formulation with 0.5% (w/w) of AHAS-inhibiting
herbicide is obtained. Current methods are extrusion, spray-drying
or the fluidized bed. This gives granules to be applied undiluted
for foliar use.
[0196] Conventional seed treatment formulations include for example
flowable concentrates FS, solutions LS, powders for dry treatment
DS, water dispersible powders for slurry treatment WS,
water-soluble powders SS and emulsion ES and EC and gel formulation
GF. These formulations can be applied to the seed diluted or
undiluted. Application to the seeds is carried out before sowing,
either directly on the seeds.
[0197] In a preferred embodiment a FS formulation is used for seed
treatment. Typically, a FS formulation may comprise 1-800 g/l of
active ingredient, 1-200 g/l Surfactant, 0 to 200 g/l antifreezing
agent, 0 to 400 g/l of binder, 0 to 200 g/l of a pigment and up to
1 liter of a solvent, preferably water.
[0198] The present invention non-transgenic and transgenic seeds of
the herbicide-resistant plants of the present invention. Such seeds
include, for example, non-transgenic sunflower seeds comprising the
herbicide-resistance characteristics of the plant with ATCC Patent
Deposit Number PTA-6084, and transgenic seeds comprising a
polynucleotide molecule of the invention that encodes a
herbicide-resistant AHASL1 protein.
[0199] For seed treatment, seeds of the herbicide resistant plants
according of the present invention are treated with herbicides,
preferably herbicides selected from the group consisting of
AHAS-inhibiting herbicides such as amidosulfuron, azimsulfuron,
bensulfuron, chlorimuron, chlorsulfuron, cinosulfuron,
cyclosulfamuron, ethametsulfuron, ethoxysulfuron, flazasulfuron,
flupyrsulfuron, foramsulfuron, halosulfuron, imazosulfuron,
iodosulfuron, mesosulfuron, metsulfuron, nicosulfuron, oxasulfuron,
primisulfuron, prosulfuron, pyrazosulfuron, rimsulfuron,
sulfometuron, sulfosulfuron, thifensulfuron, triasulfuron,
tribenuron, trifloxysulfuron, triflusulfuron, tritosulfuron,
imazamethabenz, imazamox, imazapic, imazapyr, imazaquin,
imazethapyr, cloransulam, diclosulam, florasulam, flumetsulam,
metosulam, penoxsulam, bispyribac, pyriminobac, propoxycarbazone,
flucarbazone, pyribenzoxim, pyziftalid, pyrithiobac, and mixtures
thereof, or with a formulation comprising a AHAS-inhibiting
herbicide.
[0200] The term seed treatment comprises all suitable seed
treatment techniques known in the art, such as seed dressing, seed
coating, seed dusting, seed soaking, and seed pelleting.
[0201] In accordance with one variant of the present invention, a
further subject of the invention is a method of treating soil by
the application, in particular into the seed drill: either of a
granular formulation containing the AHAS-inhibiting herbicide as a
composition/formulation (e.g. a granular formulation, with
optionally one or more solid or liquid, agriculturally acceptable
carriers and/or optionally with one or more agriculturally
acceptable surfactants. This method is advantageously employed, for
example, in seedbeds of cereals, maize, cotton, and sunflower.
[0202] The present invention also comprises seeds coated with or
containing with a seed treatment formulation comprising at least
one ALS inhibitor selected from the group consisting of
amidosulfuron, azimsulfuron, bensulfuron, chlorimuron,
chlorsulfuron, cinosulfuron, cyclosulfamuron, ethametsulfuron,
ethoxysulfuron, flazasulfuron, flupyrsulfuron, foramsulfuron,
halosulfuron, imazosulfuron, iodosulfuron, mesosulfuron,
metsulfuron, nicosulfuron, oxasulfuron, primisulfuron, prosulfuron,
pyrazosulfuron, rimsulfuron, sulfometuron, sulfosulfuron,
thifensulfuron, triasulfuron, tribenuron, trifloxysulfuron,
triflusulfuron, tritosulfuron, imazamethabenz, imazamox, imazapic,
imazapyr, imazaquin, imazethapyr, cloransulam, diclosulam,
florasulam, flumetsulam, metosulam, penoxsulam, bispyribac,
pyriminobac, propoxycarbazone, flucarbazone, pyribenzoxim,
pyriftalid and pyrithiobac.
[0203] The term seed embraces seeds and plant propagules of all
kinds including but not limited to true seeds, seed pieces,
suckers, corms, bulbs, fruit, tubers, grains, cuttings, cut shoots
and the like and means in a preferred embodiment true seeds.
[0204] The term "coated with and/or containing" generally signifies
that the active ingredient is for the most part on the surface of
the propagation product at the time of application, although a
greater or lesser part of the ingredient may penetrate into the
propagation product, depending on the method of application. When
the said propagation product is (re)planted, it may absorb the
active ingredient.
[0205] The seed treatment application with the AHAS-inhibiting
herbicide or with a formulation comprising the AHAS-inhibiting
herbicide is carried out by spraying or dusting the seeds before
sowing of the plants and before emergence of the plants.
[0206] In the treatment of seeds, the corresponding formulations
are applied by treating the seeds with an effective amount of the
AHAS-inhibiting herbicide or a formulation comprising the
AHAS-inhibiting herbicide. Herein, the application rates are
generally from 0.1 g to 10 kg of the a.i. (or of the mixture of ad.
or of the formulation) per 100 kg of seed, preferably from 1 g to 5
kg per 100 kg of seed, in particular from 1 g to 2.5 kg per 100 kg
of seed. For specific crops such as lettuce the rate can be
higher.
[0207] The present invention provides a method for combating
undesired vegetation or controlling weeds comprising contacting the
seeds of the resistant plants according to the present invention
before sowing and/or after pregermination with an AHAS-inhibiting
herbicide. The method can further comprise sowing the seeds, for
example, in soil in a field or in a potting medium in greenhouse.
The method finds particular use in combating undesired vegetation
or controlling weeds in the immediate vicinity of the seed.
[0208] The control of undesired vegetation is understood as meaning
the killing of weeds and/or otherwise retarding or inhibiting the
normal growth of the weeds. Weeds, in the broadest sense, are
understood as meaning all those plants which grow in locations
where they are undesired.
[0209] The weeds of the present invention include, for example,
dicotyledonous and monocotyledonous weeds. Dicotyledonous weeds
include, but are not limited to, weeds of the genera: Sinapis,
Lepidium, Galium, Stellaria, Matricaria, Anthemis, Galinsoga,
Chenopodium, Urtica, Senecio, Amaranthus, Portulaca, Xanthium,
Convolvulus, Ipomoea, Polygonum, Sesbania, Ambrosia, Cirsium,
Carduus, Sonchus, Solanum, Rorippa, Rotala, Lindemia, Lamium,
Veronica, Abutilon, Emex, Datura, Viola, Galeopsis, Papaver,
Centaurea, Trifolium, Ranunculus, and Taraxacum. Monocotyledonous
weeds include, but are not limited to, weeds of the genera:
Echinochloa, Setaria, Panicum, Digitaria, Phleum, Poa, Festuca,
Eleusine, Brachiaria, Lolium, Bromus, Avena, Cyperus, Sorghum,
Agropyron, Cynodon, Monochoria, Fimbristyslis, Sagittaria,
Eleocharis, Scirpus, Paspalum, Ischaemum, Sphenoclea,
Dactyloctenium, Agrostis, Alopecurus, Apera.
[0210] In addition, the weeds of the present invention can include,
for example, crop plants that are growing in an undesired location.
For example, a volunteer maize plant that is in a field that
predominantly comprises soybean plants can be considered as a weed,
if the maize plant is undesired in the field of soybean plants.
[0211] The articles "a" and "an" are used herein to refer to one or
more than one (i.e., to at least one) of the grammatical object of
the article. By way of example, "an element" means one or more
elements.
[0212] As used herein, the word "comprising," or variations such as
"comprises" or "comprising," will be understood to imply the
inclusion of a stated element, integer or step, or group of
elements, integers or steps, but not the exclusion of any other
element, integer or step, or group of elements, integers or
steps.
[0213] The following examples are offered by way of illustration
and not by way of limitation.
Example 1
Mutagenesis of Helianthus annuus Line HA89 and Selection of
Imidazolinone-Resistant Plants
[0214] In the fall of growing season 1, sunflower plants
(Helianthus annuus) of the maintainer line HA89 were treated with
ethyl methanesulfonate (EMS, also referred to as methanesulfonic
acid ethyl ester). EMS is a known mutagen that typically induces
G.cndot.C-to-A.cndot.T transitions in DNA (Jander et al. (2003)
Plant Physiol. 131:139-146). Two separate experiments were
conducted. In the first experiment, three concentrations of EMS
were used. Plants were treated with a solution comprising 0.1%, 1%,
or 10% (w/v) EMS. For each EMS treatment, 14 rows of seeds were
sown outdoors at the Advanta Semillas Biotech Research Station in
Balcarce, BsAs, Argentina.
[0215] In the second experiment, 25 rows of line HA89 sunflower
seeds were sown outdoors at the Advanta Winter Nursery in Oran,
Salta, Argentina. Of these 25 rows, 8 rows were treated with 5% EMS
as described above. The remaining 17 rows were untreated.
[0216] For each of the experiments, all M.sub.0 plants were bagged
prior to flowering in order to ensure that the resulting M1 seeds
were the product of self-pollination. The seed heads from each EMS
treatment were harvested and threshed in bulk. The following
growing season, the mutated M.sub.1 seeds from plants that were
treated with 0.1%, 1.0%, 5.0% or 10.0% EMS were sown outdoors with
each treatment in a separate plot. Twenty days later, when the
plants were at the 2-4 leaf pair developmental stage, all of the
EMS-treated plants were sprayed with 2.times. of Sweeper 70DG (100
g a.i./ha). The active ingredient in Sweeper is imazamox. After the
herbicide spraying, a total of 53 plants survived and were selected
as putative resistant. The distribution of resistant plants per EMS
treatment is indicated in Table 1.
TABLE-US-00001 TABLE 1 Number of M.sub.1 Imidazolinone-Resistant
Sunflower Plants Recovered from Each EMS Treatment EMS
Concentration (%) No. of Resistant Plants Recovered 0.1 14 1 18 5 5
10 16
[0217] Tissue samples were taken from each individual surviving
M.sub.1 plant and DNA from each sample was extracted for PCR
amplification and sequencing studies described below in Example
2.
[0218] The 53 putative resistant plants (Table 1) were allowed to
mature in the field. Of these 53 plants, 29 produced M.sub.2 seeds,
and these seeds were harvested. Shortly thereafter each of these
M.sub.1:2 families was sown in a separate plot 29 plots, of 1 to 3
rows each in Fargo, North Dakota, USA. These M.sub.1:2 families,
and susceptible (wild-type) HA89 control plants, were sprayed with
0.5.times. of Sweeper (25 g a.i./ha). Eleven days after the
herbicide treatment, three families were identified for which
greater than 50% of the plants survived the herbicide treatment.
Before flowering, the surviving plants in each these three
M.sub.1:2 families were bagged in order to produce self-pollinated
M.sub.3 seed. Individual heads from each M.sub.1:2 plant were
harvested and threshed. Individual M.sub.2 plant tissue from
selected families was harvested.
Example 2
PCR Amplification and Sequencing of Sunflower Polynucleotides
Encoding Imidazolinone-Resistant and Wild-Type AHASL1 Proteins
[0219] DNA was extracted from M.sub.1 tissue of one of the three
the M.sub.1:2 families that were described above in Example 1. The
DNA from this M.sub.1 plant was subjected to amplification by
polymerase chain reaction (PCR) and sequenced to determine the
origin of the imidazolinone tolerance described in detail
below.
[0220] The M.sub.1 plant from this family was designated as MUT28.
Genomic DNA was isolated from MUT28 tissue and also from tissue of
a wild-type HA89 plant. The isolated DNA samples from MUT28 and
HA89 were each diluted to a stock concentration of 100 ng/.mu.L for
use as template DNA for PCR amplifications. The entire coding
region of the sunflower AHASL1 gene was amplified from the MUT28
and HA89 DNA samples. The specific primers used to obtain each
amplicon are set forth in Table 2.
TABLE-US-00002 TABLE 2 PCR Primers for Amplifying the Coding Region
of the Sunflower AHASL1 Gene Region of AHAS1 Primer Name Primer
Sequence 1.sup.st amplicon ALS1-1F CATCATCATTAAATAACCAGAC (843 bp)
(SEQ ID NO: 11) ALS1-1R AACCCGGTAACCTCATCGGTTC (SEQ ID NO: 12)
2.sup.nd amplicon ALS1-2F CCCGGTTTTGATAGATGTACCG (739 bp) (SEQ ID
NO: 13) ALS1-2R CTGAGCAGCCCACATCTGATGT (SEQ ID NO: 14) 3.sup.rd
amplicon ALS1-3F CTGAGCAGCCCACATCTGATGT (674 bp) (SEQ ID NO: 15)
ALS1-3R AATTACACAACAAAACATTAAC (SEQ ID NO: 16)
[0221] From comparisons of the nucleotide sequences of known
AHASL1, AHASL2, and AHASL3 genes, PCR primers were designed to
specifically amplify the AHASL1 gene from sunflower. The following
PCR conditions were used in a total reaction volume of 25 .mu.l:
1.times. buffer (Invitrogen Corp., Carlsbad, Calif., USA), 0.2 mM
dNTPs (Invitrogen), 2.5 mM MgCl.sub.2 (Invitrogen), 0.2 .mu.M of
each primer, 0.5 .mu.L of Platinium Taq (5 U/.mu.L) (Invitrogen)
and 100 ng of genomic DNA. PCR reactions were carried out in a
GeneAmp PCR System 9700 (PerkinElmer, Inc., Boston, Mass., USA).
Cycling conditions were: an initial denaturation step at 94.degree.
C. for 1 minute followed by 35 cycles consisting of 94.degree. C.
for 45 seconds, 52.degree. C. for 45 seconds and 72.degree. C. for
70 seconds, and a final elongation step of 72.degree. C. for 10
minutes. Two microliters of each resulting PCR product were then
analyzed by agarose gel electrophoresis and concentration of DNA
estimated by comparison to Low DNA Mass Ladder (Invitrogen Corp.,
Carlsbad, Calif., USA). The remaining PCR product was purified
using Wizard.RTM. SV Gel and PCR Clean-Up System (Promega Corp.,
Madison, Wis., USA). The purified PCR products were then
cycle-sequenced using a BigDye.RTM. Terminator v3.1 Cycle
Sequencing Kit (Applied Biosystems, Foster City, Calif., USA)
following the manufacturer's instructions. In addition to the
primers used for the PCR amplifications (Table 2), additional
primers set forth in Table 3 were used to complete the sequencing
of the entire coding region of the sunflower AHASL1 gene.
TABLE-US-00003 TABLE 3 Additional Primers for Sequencing the Coding
Region of the Sunflower AHASL1 gene Region of AHAS1 Primer Name
Primer Sequence 1.sup.st amplicon ALS-3F GCGCTGTTAGACAGTGTCC (SEQ
ID NO: 17) 2.sup.nd amplicon SUNALS1F1 ACTAATCTTGATTTTTCG (SEQ ID
NO: 18) 3.sup.rd amplicon ALS-6R CGGCAGATTTTCAACACGGA (SEQ ID NO:
19)
[0222] Fluorescent-labeled products from sequencing reactions were
resolved by capillary electrophoresis on an ABI Prism 310 Genetic
Analyzer (Applied Biosystems) and analyzed using the ABI Prism DNA
Sequencing Analysis Software, version 3.7. The sunflower AHASL1
sequencing files obtained from each amplicon were assembled using
the Vector NTI Suite-Contig Express software, version 7M (InforMax,
Frederick, Md., USA). The resulting DNA sequences were aligned with
AHASL1 polynucleotide sequences of the HA89 sunflower line and
Xanthium sp. (FIG. 1). The predicted amino acid sequence from the
new mutant sunflower AHASL1 gene was aligned with the AHASL1 amino
acid sequences of HA89 and Xanthium sp. (FIG. 2) using Vector NTI
Suite-AlignX software, version 7.0 (InforMax) was used with default
parameters. Single nucleotide polymorphisms and amino acid changes
were then identified.
Example 3
The Herbicide-Resistance of MUT28 Sunflower Plants
[0223] To evaluate the resistance of MUT28 sunflower plants to an
imidazolinone herbicides, HA89 (wild-type), MUT28 (homozygous), and
HA89/MUT28 (heterozygous) sunflower plants were planted outdoors in
Balcarce, Argentina during the growing season in a randomized
complete block design (RCBD) field trial with two replications to
evaluate the tolerance of the MUT28 and HA89/MUT28 plants to three
rates of Sweeper 70DG: 1.times., 2.times., and 3.times.. The active
ingredient in Sweeper is imazamox and the 1.times. dose is 50 g
a.i./ha. The results are presented in Table 4.
TABLE-US-00004 TABLE 4 Imidazolinone Tolerance of MUT28 Sunflower
Plants (Herbicide Injury Ratings) RATE LINE 0X 1X 2X HA89 0* 75 75
MUT28 across families 0 33 -- HA89/MUT28 0 28 45 IMISUN-1 0 4 9 *No
injury = 0
[0224] Compared to wild-type HA89, the MUT28 sunflower lines had
less injury at the 1.times. rate of Sweeper. The HA89/MUT28 line
also had less injury in this trial than HA89 at both the 1.times.
and 2.times. rates of Sweeper. The results of this trial
demonstrate that both the MUT28 (homozygous) and HA89/MUT28
(heterozygous) lines have increased tolerance to an imidazolinone
herbicide, particularly imazamox. However, neither MUT28 nor
HA89/MUT28 displayed the level of tolerance of the IMISUN-1
sunflower lines which is known to be homozygous for an AHASL1 gene
encoding an AHASL1 protein having an Ala.sub.190-to-Val
substitution.
[0225] In a separate trial in Balcarce that was similar to the one
described immediately above, the MUT28 line did not display any
increased tolerance to Sweeper relative to HA89. However, in
another separate trial conducted in Fargo, N. Dak., USA, 52% of M2
MUT28 plants were tolerant but displayed a lower level of tolerance
than the SURES-1 line. SURES-1 is an sulfonylura-resistant,
F3-derived F4 oilseed maintainer that was developed from plants of
a wild Helianthus annuus population collected in Kansas, USA
(Al-Khatib et al. (1999) "Survey of common sunflower (Helianthus
annuus) resistance to ALS-inhibiting herbicides in northeast
Kansas," In: Proceedings of 21th Sunflower Research Workshop,
National Sunflower Association, Bismarck, N. Dak., pp 210-215).
[0226] To evaluate the tolerance of MUT28 sunflower plants to
sulfonylurea herbicides, HA89 (wild-type), MUT28, IMISUN-1, and
SURES-1 sunflower lines were planted outdoors in Balcarce,
Argentina during the growing season in an RCBD field trial with two
replications to evaluate the tolerance of MUT28 plants to the
sulfonylurea herbicide thifensulfuron (TFS) at 1.times. and
2.times. rates. The 1.times. rates for TFS is 4.4 g a.i./ha. The
results are presented in Table 5.
TABLE-US-00005 TABLE 5 Sulfonylurea Tolerance of MUT28 Sunflower
Plants (Herbicide Injury Ratings) RATE LINE 0X 1X 2X HA89 0* 75 75
MUT28 0 30 42 IMISUN-1 0 20 75 SURES-1 0 5 3 *No injury = 0
[0227] The MUT28 line displayed better tolerance to TFS at both the
1.times. and 2.times. rates than HA89 demonstrating that the MUT28
plants have increased tolerance to a sulfonylurea herbicide when
compared to a wild-type sunflower plants.
Example 4
Herbicide-Resistant Sunflower AHASL1 Proteins
[0228] The present invention discloses both the nucleotide and
amino acid sequences for wild-type and herbicide resistant
sunflower AHASL1 polypeptides. Plants comprising
herbicide-resistant AHASL1 polypeptides have been previously
identified, and a number of conserved regions of AHASL1
polypeptides that are the sites of amino acids substitutions that
confer herbicide resistance have been described. See, Devine and
Eberlein (1997) "Physiological, biochemical and molecular aspects
of herbicide resistance based on altered target sites". In:
Herbicide Activity: Toxicology, Biochemistry and Molecular Biology,
Roe et al. (eds.), pp. 159-185, IOS Press, Amsterdam; and Devine
and Shukla, (2000) Crop Protection 19:881-889.
[0229] Using the AHASL1 sequences of the invention and methods
known to those of ordinary skill in art, one can produce additional
polynucleotides encoding herbicide resistant AHASL1 polypeptides
having one, two, three, or more amino acid substitutions at the
identified sites in these conserved regions. Table 6 provides the
conserved regions of AHASL1 proteins, the amino acid substitutions
known to confer herbicide resistance within these conserved
regions, and the corresponding amino acids in the sunflower AHASL1
protein set forth in SEQ ID NO: 4.
TABLE-US-00006 TABLE 6 Mutations in conserved regions of AHASL1
polypeptides known to confer herbicide-resistance and their
equivalent position in sunflower AHASL1 Amino acid position in
Conserved region.sup.1 Mutation.sup.2 Reference sunflower
VFAYPGGASMEIHQALTRS.sup.3 Ala.sub.122 to Thr Bernasconi et
al..sup.4 Ala.sub.107 Wright & Penner.sup.14
AITGQVPRRMIGT.sup.3 Pro.sub.197 to Ala Boutsalis et al..sup.6
Pro.sub.182.sup.13 Pro.sub.197 to Thr Guttieri et al..sup.7
Pro.sub.197 to His Guttieri et al..sup.8 Pro.sub.197 to Leu
Guttieri et al..sup.7 Kolkman et al..sup.15 Pro.sub.197 to Arg
Guttieri et al..sup.7 Pro.sub.197 to Ile Boutsalis et al..sup.6
Pro.sub.197 to Gln Guttieri et al..sup.7 Pro.sub.197 to Ser
Guttieri et al..sup.7 AFQETP.sup.3 Ala.sub.205 to Asp Hartnett et
al..sup.9 Ala.sub.190 Ala.sub.205 to Val Simpson.sup.10 Kolkman et
al..sup.15 White et al..sup.16 QWED.sup.3 Trp.sub.574 to Leu
Bruniard.sup.11 Trp.sub.559 Boutsalis et al..sup.6 IPSGG.sup.4
Ser.sub.653 to Asn Devine & Ala.sub.638 Eberlein.sup.12 Lee et
al..sup.17 Ser.sub.653 to Thr Chang & Ser.sub.653 to Phe
Duggleby.sup.18 .sup.1Conserved regions from Devine and Eberlein
(1997) "Physiological, biochemical and molecular aspects of
herbicide resistance based on altered target sites". In: Herbicide
Activity: Toxicology, Biochemistry and Molecular Biology, Roe et
al. (eds.), pp. 159-185, IOS Press, Amsterdam and Devine and
Shukla, (2000) Crop Protection 19:881-889. .sup.2Amino acid
numbering corresponds to the amino acid sequence of the Arabidopsis
thaliana AHASL1 polypeptide. .sup.3Sunflower AHASL1 (SEQ ID NO: 4)
has the same conserved region. .sup.4The reqion of the sunflower
AHASL1 (SEQ ID NO: 4) corresponding to this conserved region has
the sequence IPAGG. .sup.5Bernasconi et al. (1995) J. Biol. Chem.
270(29): 17381-17385. .sup.6Boutsalis et al. (1999) Pestic. Sci.
55:507-516. .sup.7Guttieri et al. (1995)Weed Sci. 43:143-178.
.sup.8Guttieri et al. (1992) Weed Sci. 40:670-678. .sup.9Hartnett
et al. (1990) "Herbicide-resistant plants carrying mutated
acetolactate synthase genes," In: Managing Resistance to
Agrochemicals: Fundamental Research to Practical Strategies, Green
et al. (eds.), American Chemical Soc. Symp., Series No. 421,
Washington, DC, USA .sup.10Simpson (1998) Down to Earth
53(1):26-35. .sup.11Bruniard (2001) Inheritance of imidazolinone
resistance, characterization of cross-resistance pattern, and
identification of molecular markers in sunflower (Helianthus annuus
L.). Ph. D. Thesis, North Dakota State University, Fargo, ND, USA,
pp 1-78. .sup.12Devine and Eberlein (1997) "Physiological,
biochemical and molecular aspects of herbicide resistance based on
altered target sites". In: Herbicide Activity: Toxicology,
Biochemistry and Molecular Biology, Roe et al. (eds.), pp. 159-185,
IOS Press, Amsterdam .sup.13The present invention discloses the
amino acid sequence of a herbicide-resistant AHASL1 with the
Pro.sub.182 to Leu substitution (SEQ ID NO: 2) and a polynucleotide
sequence encoding this herbicide resistant AHASL1 (SEQ ID NO: 1).
.sup.14Wright and Penner (1998) Theor. Appl. Genet. 96-612-620.
.sup.15Kolkman et al. (2004) Theor. Appl. Genet. 109:1147-1159.
.sup.16White et al. (2003) Weed Sci. 51:845-853. .sup.17Lee et al.
(1999) FEBS Lett. 452:341-345. .sup.18Chang and Duggleby (1998)
Biochem J. 333:765-777.
[0230] All publications and patent applications mentioned in the
specification are indicative of the level of those skilled in the
art to which this invention pertains. All publications and patent
applications are herein incorporated by reference to the same
extent as if each individual publication or patent application was
specifically and individually indicated to be incorporated by
reference.
[0231] Although the foregoing invention has been described in some
detail by way of illustration and example for purposes of clarity
of understanding, it will be obvious that certain changes and
modifications may be practiced within the scope of the appended
claims.
Sequence CWU 1
1
1911968DNAHelianthus annuus 1atggcggctc ctcccaaccc ttccatctcc
ttcaaaccac cgtcacccgc cgccgcactg 60ccaccacgct ccgccttcct cccccgtttc
gcattaccca tcacttccac tacccaaaaa 120cgacaccgtc ttcacatctc
caatgttctc tccgactcca aatccaccac caccaccacc 180accaccactc
aacgaccgtt accggtgcag ccttttgtct cccgttacgc gccagatcaa
240ccgagaaaag gcgcagacgt gttggtggaa gctctggaac gggaaggtgt
caccgacgtc 300ttcgcctacc ccggcggcgc gtcaatggag atccaccaag
ctctcacgcg ctcaagcact 360atccgcaatg tgctcccccg tcacgaacag
ggcggcgtgt tcgccgccga aggctacgcg 420cgcgcctccg gtcttcccgg
cgtgtgtatc gccacttccg gtcccggagc tacgaaccta 480gttagtggtc
ttgctgacgc gctgttagac agtgtcccca tggtggcaat caccggtcaa
540gttctccgga gaatgatcgg aaccgatgcg tttcaagaaa ccccaattgt
tgaggtaaca 600cgttcgatca ctaaacataa ttatcttgtg ttggatgttg
aggatattcc cagaattgtt 660cgtgaggctt tttatcttgc gagttcgggt
cgacccggcc cggttttgat agatgtaccg 720aaagatatac agcaacagtt
agtggtgccg aaatgggatg aaccgatgag gttaccgggt 780tatttgtcta
gaatgccgaa gcctcaatat gatgggcatt tggaacagat tgttaggttg
840gtgggggaag cgaagaggcc ggttttgtat gtgggtggtg ggtgtttgaa
ttcggatgat 900gagttgaggc ggtttgtgga gcttacgggg attccggttg
cgagtacttt gatggggctc 960ggagcgtacc ctgcttcgag tgatttgtcg
cttcatatgc ttgggatgca tggtacggtt 1020tatgcgaatt atgcggttga
taagagtgat ttgttgcttg cgtttggggt gcggtttgat 1080gatcgtgtga
cggggaagct tgaggcgttt gctagtaggg cgaagattgt tcatattgat
1140attgatcctg ctgaaattgg gaagaataag cagcctcatg tgtcgatttg
tggtgatatt 1200aaggtcgcgt tacagggttt gaacaagatt ttggaggaaa
agaattcggt gactaatctt 1260gatttttcga cctggagaaa ggaattggat
gaacaaaaaa tgaagttccc gttgagcttt 1320aaaacgtttg gcgaagcgat
tcctccacag tatgctattc aagttcttga tgagttaacg 1380ggcgggaatg
caattattag caccggtgtc gggcaacatc agatgtgggc tgctcagttt
1440tacaaataca acaaacctag acaatggctg acgtcgggcg ggctaggggc
aatgggtttc 1500ggcctgcccg ctgctatcgg ggcggccgtt gcaagacctg
atgcggtagt agttgacatc 1560gacggtgacg gaagctttat gatgaatgtt
caagagttag ccacaatccg tgttgaaaat 1620ctgccggtta agattttatt
acttaacaac cagcatttgg gtatggtggt tcagtgggag 1680gatcggtttt
acaaggcgaa tcgggctcat acctacttag gaaacccgtc aaaagagtcg
1740gaaatattcc ctaacatggt gaagtttgct gaagcctgtg atatcccggc
tgctcgagtg 1800acccaaaagg cggatctacg agcagctatt cagaagatgt
tggatacacc cgggccttac 1860ttgttggatg tgattgtgcc gcatcaagaa
cacgtgttgc ccatgatccc ggctggcgga 1920ggtttctcgg atgtgatcac
cgagggtgat ggcagaacga aatattga 19682655PRTHelianthus annuus 2Met
Ala Ala Pro Pro Asn Pro Ser Ile Ser Phe Lys Pro Pro Ser Pro1 5 10
15Ala Ala Ala Leu Pro Pro Arg Ser Ala Phe Leu Pro Arg Phe Ala Leu
20 25 30Pro Ile Thr Ser Thr Thr Gln Lys Arg His Arg Leu His Ile Ser
Asn 35 40 45Val Leu Ser Asp Ser Lys Ser Thr Thr Thr Thr Thr Thr Thr
Thr Gln 50 55 60Arg Pro Leu Pro Val Gln Pro Phe Val Ser Arg Tyr Ala
Pro Asp Gln65 70 75 80Pro Arg Lys Gly Ala Asp Val Leu Val Glu Ala
Leu Glu Arg Glu Gly 85 90 95Val Thr Asp Val Phe Ala Tyr Pro Gly Gly
Ala Ser Met Glu Ile His 100 105 110Gln Ala Leu Thr Arg Ser Ser Thr
Ile Arg Asn Val Leu Pro Arg His 115 120 125Glu Gln Gly Gly Val Phe
Ala Ala Glu Gly Tyr Ala Arg Ala Ser Gly 130 135 140Leu Pro Gly Val
Cys Ile Ala Thr Ser Gly Pro Gly Ala Thr Asn Leu145 150 155 160Val
Ser Gly Leu Ala Asp Ala Leu Leu Asp Ser Val Pro Met Val Ala 165 170
175Ile Thr Gly Gln Val Leu Arg Arg Met Ile Gly Thr Asp Ala Phe Gln
180 185 190Glu Thr Pro Ile Val Glu Val Thr Arg Ser Ile Thr Lys His
Asn Tyr 195 200 205Leu Val Leu Asp Val Glu Asp Ile Pro Arg Ile Val
Arg Glu Ala Phe 210 215 220Tyr Leu Ala Ser Ser Gly Arg Pro Gly Pro
Val Leu Ile Asp Val Pro225 230 235 240Lys Asp Ile Gln Gln Gln Leu
Val Val Pro Lys Trp Asp Glu Pro Met 245 250 255Arg Leu Pro Gly Tyr
Leu Ser Arg Met Pro Lys Pro Gln Tyr Asp Gly 260 265 270His Leu Glu
Gln Ile Val Arg Leu Val Gly Glu Ala Lys Arg Pro Val 275 280 285Leu
Tyr Val Gly Gly Gly Cys Leu Asn Ser Asp Asp Glu Leu Arg Arg 290 295
300Phe Val Glu Leu Thr Gly Ile Pro Val Ala Ser Thr Leu Met Gly
Leu305 310 315 320Gly Ala Tyr Pro Ala Ser Ser Asp Leu Ser Leu His
Met Leu Gly Met 325 330 335His Gly Thr Val Tyr Ala Asn Tyr Ala Val
Asp Lys Ser Asp Leu Leu 340 345 350Leu Ala Phe Gly Val Arg Phe Asp
Asp Arg Val Thr Gly Lys Leu Glu 355 360 365Ala Phe Ala Ser Arg Ala
Lys Ile Val His Ile Asp Ile Asp Pro Ala 370 375 380Glu Ile Gly Lys
Asn Lys Gln Pro His Val Ser Ile Cys Gly Asp Ile385 390 395 400Lys
Val Ala Leu Gln Gly Leu Asn Lys Ile Leu Glu Glu Lys Asn Ser 405 410
415Val Thr Asn Leu Asp Phe Ser Thr Trp Arg Lys Glu Leu Asp Glu Gln
420 425 430Lys Met Lys Phe Pro Leu Ser Phe Lys Thr Phe Gly Glu Ala
Ile Pro 435 440 445Pro Gln Tyr Ala Ile Gln Val Leu Asp Glu Leu Thr
Gly Gly Asn Ala 450 455 460Ile Ile Ser Thr Gly Val Gly Gln His Gln
Met Trp Ala Ala Gln Phe465 470 475 480Tyr Lys Tyr Asn Lys Pro Arg
Gln Trp Leu Thr Ser Gly Gly Leu Gly 485 490 495Ala Met Gly Phe Gly
Leu Pro Ala Ala Ile Gly Ala Ala Val Ala Arg 500 505 510Pro Asp Ala
Val Val Val Asp Ile Asp Gly Asp Gly Ser Phe Met Met 515 520 525Asn
Val Gln Glu Leu Ala Thr Ile Arg Val Glu Asn Leu Pro Val Lys 530 535
540Ile Leu Leu Leu Asn Asn Gln His Leu Gly Met Val Val Gln Trp
Glu545 550 555 560Asp Arg Phe Tyr Lys Ala Asn Arg Ala His Thr Tyr
Leu Gly Asn Pro 565 570 575Ser Lys Glu Ser Glu Ile Phe Pro Asn Met
Val Lys Phe Ala Glu Ala 580 585 590Cys Asp Ile Pro Ala Ala Arg Val
Thr Gln Lys Ala Asp Leu Arg Ala 595 600 605Ala Ile Gln Lys Met Leu
Asp Thr Pro Gly Pro Tyr Leu Leu Asp Val 610 615 620Ile Val Pro His
Gln Glu His Val Leu Pro Met Ile Pro Ala Gly Gly625 630 635 640Gly
Phe Ser Asp Val Ile Thr Glu Gly Asp Gly Arg Thr Lys Tyr 645 650
65531968DNAHelianthus annuus 3atggcggctc ctcccaaccc ttccatctcc
ttcaaaccac cgtcacccgc cgccgcactg 60ccaccacgct ccgccttcct cccccgtttc
gcattaccca tcacttccac tacccaaaaa 120cgacaccgtc ttcacatctc
caatgttctc tccgactcca aatccaccac caccaccacc 180accaccactc
aacgaccgtt accggtgcag ccttttgtct cccgttacgc gccagatcaa
240ccgagaaaag gcgcagacgt gttggtggaa gctctggaac gggaaggtgt
caccgacgtc 300ttcgcctacc ccggcggcgc gtcaatggag atccaccaag
ctctcacgcg ctcaagcact 360atccgcaatg tgctcccccg tcacgaacag
ggcggcgtgt tcgccgccga aggctacgcg 420cgcgcctccg gtcttcccgg
cgtgtgtatc gccacttccg gtcccggagc tacgaaccta 480gttagtggtc
ttgctgacgc gctgttagac agtgtcccca tggtggcaat caccggtcaa
540gttccccgga gaatgatcgg aaccgatgcg tttcaagaaa ccccaattgt
tgaggtaaca 600cgttcgatca ctaaacataa ttatcttgtg ttggatgttg
aggatattcc cagaattgtt 660cgtgaggctt tttatcttgc gagttcgggt
cgacccggcc cggttttgat agatgtaccg 720aaagatatac agcaacagtt
agtggtgccg aaatgggatg aaccgatgag gttaccgggt 780tatttgtcta
gaatgccgaa gcctcaatat gatgggcatt tggaacagat tgttaggttg
840gtgggggaag cgaagaggcc ggttttgtat gtgggtggtg ggtgtttgaa
ttcggatgat 900gagttgaggc ggtttgtgga gcttacgggg attccggttg
cgagtacttt gatggggctc 960ggagcgtacc ctgcttcgag tgatttgtcg
cttcatatgc ttgggatgca tggtacggtt 1020tatgcgaatt atgcggttga
taagagtgat ttgttgcttg cgtttggggt gcggtttgat 1080gatcgtgtga
cggggaagct tgaggcgttt gctagtaggg cgaagattgt tcatattgat
1140attgatcctg ctgaaattgg gaagaataag cagcctcatg tgtcgatttg
tggtgatatt 1200aaggtcgcgt tacagggttt gaacaagatt ttggaggaaa
agaattcggt gactaatctt 1260gatttttcga cctggagaaa ggaattggat
gaacaaaaaa tgaagttccc gttgagcttt 1320aaaacgtttg gcgaagcgat
tcctccacag tatgctattc aagttcttga tgagttaacg 1380ggcgggaatg
caattattag caccggtgtc gggcaacatc agatgtgggc tgctcagttt
1440tacaaataca acaaacctag acaatggctg acgtcgggcg ggctaggggc
aatgggtttc 1500ggcctgcccg ctgctatcgg ggcggccgtt gcaagacctg
atgcggtagt agttgacatc 1560gacggtgacg gaagctttat gatgaatgtt
caagagttag ccacaatccg tgttgaaaat 1620ctgccggtta agattttatt
acttaacaac cagcatttgg gtatggtggt tcagtgggag 1680gatcggtttt
acaaggcgaa tcgggctcat acctacttag gaaacccgtc aaaagagtcg
1740gaaatattcc ctaacatggt gaagtttgct gaagcctgtg atatcccggc
tgctcgagtg 1800acccaaaagg cggatctacg agcagctatt cagaagatgt
tggatacacc cgggccttac 1860ttgttggatg tgattgtgcc gcatcaagaa
cacgtgttgc ccatgatccc ggctggcgga 1920ggtttctcgg atgtgatcac
cgagggtgat ggcagaacga aatattga 19684655PRTHelianthus annuus 4Met
Ala Ala Pro Pro Asn Pro Ser Ile Ser Phe Lys Pro Pro Ser Pro1 5 10
15Ala Ala Ala Leu Pro Pro Arg Ser Ala Phe Leu Pro Arg Phe Ala Leu
20 25 30Pro Ile Thr Ser Thr Thr Gln Lys Arg His Arg Leu His Ile Ser
Asn 35 40 45Val Leu Ser Asp Ser Lys Ser Thr Thr Thr Thr Thr Thr Thr
Thr Gln 50 55 60Arg Pro Leu Pro Val Gln Pro Phe Val Ser Arg Tyr Ala
Pro Asp Gln65 70 75 80Pro Arg Lys Gly Ala Asp Val Leu Val Glu Ala
Leu Glu Arg Glu Gly 85 90 95Val Thr Asp Val Phe Ala Tyr Pro Gly Gly
Ala Ser Met Glu Ile His 100 105 110Gln Ala Leu Thr Arg Ser Ser Thr
Ile Arg Asn Val Leu Pro Arg His 115 120 125Glu Gln Gly Gly Val Phe
Ala Ala Glu Gly Tyr Ala Arg Ala Ser Gly 130 135 140Leu Pro Gly Val
Cys Ile Ala Thr Ser Gly Pro Gly Ala Thr Asn Leu145 150 155 160Val
Ser Gly Leu Ala Asp Ala Leu Leu Asp Ser Val Pro Met Val Ala 165 170
175Ile Thr Gly Gln Val Pro Arg Arg Met Ile Gly Thr Asp Ala Phe Gln
180 185 190Glu Thr Pro Ile Val Glu Val Thr Arg Ser Ile Thr Lys His
Asn Tyr 195 200 205Leu Val Leu Asp Val Glu Asp Ile Pro Arg Ile Val
Arg Glu Ala Phe 210 215 220Tyr Leu Ala Ser Ser Gly Arg Pro Gly Pro
Val Leu Ile Asp Val Pro225 230 235 240Lys Asp Ile Gln Gln Gln Leu
Val Val Pro Lys Trp Asp Glu Pro Met 245 250 255Arg Leu Pro Gly Tyr
Leu Ser Arg Met Pro Lys Pro Gln Tyr Asp Gly 260 265 270His Leu Glu
Gln Ile Val Arg Leu Val Gly Glu Ala Lys Arg Pro Val 275 280 285Leu
Tyr Val Gly Gly Gly Cys Leu Asn Ser Asp Asp Glu Leu Arg Arg 290 295
300Phe Val Glu Leu Thr Gly Ile Pro Val Ala Ser Thr Leu Met Gly
Leu305 310 315 320Gly Ala Tyr Pro Ala Ser Ser Asp Leu Ser Leu His
Met Leu Gly Met 325 330 335His Gly Thr Val Tyr Ala Asn Tyr Ala Val
Asp Lys Ser Asp Leu Leu 340 345 350Leu Ala Phe Gly Val Arg Phe Asp
Asp Arg Val Thr Gly Lys Leu Glu 355 360 365Ala Phe Ala Ser Arg Ala
Lys Ile Val His Ile Asp Ile Asp Pro Ala 370 375 380Glu Ile Gly Lys
Asn Lys Gln Pro His Val Ser Ile Cys Gly Asp Ile385 390 395 400Lys
Val Ala Leu Gln Gly Leu Asn Lys Ile Leu Glu Glu Lys Asn Ser 405 410
415Val Thr Asn Leu Asp Phe Ser Thr Trp Arg Lys Glu Leu Asp Glu Gln
420 425 430Lys Met Lys Phe Pro Leu Ser Phe Lys Thr Phe Gly Glu Ala
Ile Pro 435 440 445Pro Gln Tyr Ala Ile Gln Val Leu Asp Glu Leu Thr
Gly Gly Asn Ala 450 455 460Ile Ile Ser Thr Gly Val Gly Gln His Gln
Met Trp Ala Ala Gln Phe465 470 475 480Tyr Lys Tyr Asn Lys Pro Arg
Gln Trp Leu Thr Ser Gly Gly Leu Gly 485 490 495Ala Met Gly Phe Gly
Leu Pro Ala Ala Ile Gly Ala Ala Val Ala Arg 500 505 510Pro Asp Ala
Val Val Val Asp Ile Asp Gly Asp Gly Ser Phe Met Met 515 520 525Asn
Val Gln Glu Leu Ala Thr Ile Arg Val Glu Asn Leu Pro Val Lys 530 535
540Ile Leu Leu Leu Asn Asn Gln His Leu Gly Met Val Val Gln Trp
Glu545 550 555 560Asp Arg Phe Tyr Lys Ala Asn Arg Ala His Thr Tyr
Leu Gly Asn Pro 565 570 575Ser Lys Glu Ser Glu Ile Phe Pro Asn Met
Val Lys Phe Ala Glu Ala 580 585 590Cys Asp Ile Pro Ala Ala Arg Val
Thr Gln Lys Ala Asp Leu Arg Ala 595 600 605Ala Ile Gln Lys Met Leu
Asp Thr Pro Gly Pro Tyr Leu Leu Asp Val 610 615 620Ile Val Pro His
Gln Glu His Val Leu Pro Met Ile Pro Ala Gly Gly625 630 635 640Gly
Phe Ser Asp Val Ile Thr Glu Gly Asp Gly Arg Thr Lys Tyr 645 650
65551716DNAHelianthus annuus 5gcagacgtgt tggtggaagc tctggaacgg
gaaggtgtca ccgacgtctt cgcctacccc 60ggcggcgcgt caatggagat ccaccaagct
ctcacgcgct caagcactat ccgcaatgtg 120ctcccccgtc acgaacaggg
cggcgtgttc gccgccgaag gctacgcgcg cgcctccggt 180cttcccggcg
tgtgtatcgc cacttccggt cccggagcta cgaacctagt tagtggtctt
240gctgacgcgc tgttagacag tgtccccatg gtggcaatca ccggtcaagt
tctccggaga 300atgatcggaa ccgatgcgtt tcaagaaacc ccaattgttg
aggtaacacg ttcgatcact 360aaacataatt atcttgtgtt ggatgttgag
gatattccca gaattgttcg tgaggctttt 420tatcttgcga gttcgggtcg
acccggcccg gttttgatag atgtaccgaa agatatacag 480caacagttag
tggtgccgaa atgggatgaa ccgatgaggt taccgggtta tttgtctaga
540atgccgaagc ctcaatatga tgggcatttg gaacagattg ttaggttggt
gggggaagcg 600aagaggccgg ttttgtatgt gggtggtggg tgtttgaatt
cggatgatga gttgaggcgg 660tttgtggagc ttacggggat tccggttgcg
agtactttga tggggctcgg agcgtaccct 720gcttcgagtg atttgtcgct
tcatatgctt gggatgcatg gtacggttta tgcgaattat 780gcggttgata
agagtgattt gttgcttgcg tttggggtgc ggtttgatga tcgtgtgacg
840gggaagcttg aggcgtttgc tagtagggcg aagattgttc atattgatat
tgatcctgct 900gaaattggga agaataagca gcctcatgtg tcgatttgtg
gtgatattaa ggtcgcgtta 960cagggtttga acaagatttt ggaggaaaag
aattcggtga ctaatcttga tttttcgacc 1020tggagaaagg aattggatga
acaaaaaatg aagttcccgt tgagctttaa aacgtttggc 1080gaagcgattc
ctccacagta tgctattcaa gttcttgatg agttaacggg cgggaatgca
1140attattagca ccggtgtcgg gcaacatcag atgtgggctg ctcagtttta
caaatacaac 1200aaacctagac aatggctgac gtcgggcggg ctaggggcaa
tgggtttcgg cctgcccgct 1260gctatcgggg cggccgttgc aagacctgat
gcggtagtag ttgacatcga cggtgacgga 1320agctttatga tgaatgttca
agagttagcc acaatccgtg ttgaaaatct gccggttaag 1380attttattac
ttaacaacca gcatttgggt atggtggttc agtgggagga tcggttttac
1440aaggcgaatc gggctcatac ctacttagga aacccgtcaa aagagtcgga
aatattccct 1500aacatggtga agtttgctga agcctgtgat atcccggctg
ctcgagtgac ccaaaaggcg 1560gatctacgag cagctattca gaagatgttg
gatacacccg ggccttactt gttggatgtg 1620attgtgccgc atcaagaaca
cgtgttgccc atgatcccgg ctggcggagg tttctcggat 1680gtgatcaccg
agggtgatgg cagaacgaaa tattga 17166571PRTHelianthus annuus 6Ala Asp
Val Leu Val Glu Ala Leu Glu Arg Glu Gly Val Thr Asp Val1 5 10 15Phe
Ala Tyr Pro Gly Gly Ala Ser Met Glu Ile His Gln Ala Leu Thr 20 25
30Arg Ser Ser Thr Ile Arg Asn Val Leu Pro Arg His Glu Gln Gly Gly
35 40 45Val Phe Ala Ala Glu Gly Tyr Ala Arg Ala Ser Gly Leu Pro Gly
Val 50 55 60Cys Ile Ala Thr Ser Gly Pro Gly Ala Thr Asn Leu Val Ser
Gly Leu65 70 75 80Ala Asp Ala Leu Leu Asp Ser Val Pro Met Val Ala
Ile Thr Gly Gln 85 90 95Val Leu Arg Arg Met Ile Gly Thr Asp Ala Phe
Gln Glu Thr Pro Ile 100 105 110Val Glu Val Thr Arg Ser Ile Thr Lys
His Asn Tyr Leu Val Leu Asp 115 120 125Val Glu Asp Ile Pro Arg Ile
Val Arg Glu Ala Phe Tyr Leu Ala Ser 130 135 140Ser Gly Arg Pro Gly
Pro Val Leu Ile Asp Val Pro Lys Asp Ile Gln145 150 155 160Gln Gln
Leu Val Val Pro Lys Trp Asp Glu Pro Met Arg Leu Pro Gly 165 170
175Tyr Leu Ser Arg Met Pro Lys Pro Gln Tyr Asp Gly His Leu Glu Gln
180 185 190Ile Val Arg Leu Val Gly Glu Ala Lys Arg Pro Val Leu Tyr
Val Gly 195
200 205Gly Gly Cys Leu Asn Ser Asp Asp Glu Leu Arg Arg Phe Val Glu
Leu 210 215 220Thr Gly Ile Pro Val Ala Ser Thr Leu Met Gly Leu Gly
Ala Tyr Pro225 230 235 240Ala Ser Ser Asp Leu Ser Leu His Met Leu
Gly Met His Gly Thr Val 245 250 255Tyr Ala Asn Tyr Ala Val Asp Lys
Ser Asp Leu Leu Leu Ala Phe Gly 260 265 270Val Arg Phe Asp Asp Arg
Val Thr Gly Lys Leu Glu Ala Phe Ala Ser 275 280 285Arg Ala Lys Ile
Val His Ile Asp Ile Asp Pro Ala Glu Ile Gly Lys 290 295 300Asn Lys
Gln Pro His Val Ser Ile Cys Gly Asp Ile Lys Val Ala Leu305 310 315
320Gln Gly Leu Asn Lys Ile Leu Glu Glu Lys Asn Ser Val Thr Asn Leu
325 330 335Asp Phe Ser Thr Trp Arg Lys Glu Leu Asp Glu Gln Lys Met
Lys Phe 340 345 350Pro Leu Ser Phe Lys Thr Phe Gly Glu Ala Ile Pro
Pro Gln Tyr Ala 355 360 365Ile Gln Val Leu Asp Glu Leu Thr Gly Gly
Asn Ala Ile Ile Ser Thr 370 375 380Gly Val Gly Gln His Gln Met Trp
Ala Ala Gln Phe Tyr Lys Tyr Asn385 390 395 400Lys Pro Arg Gln Trp
Leu Thr Ser Gly Gly Leu Gly Ala Met Gly Phe 405 410 415Gly Leu Pro
Ala Ala Ile Gly Ala Ala Val Ala Arg Pro Asp Ala Val 420 425 430Val
Val Asp Ile Asp Gly Asp Gly Ser Phe Met Met Asn Val Gln Glu 435 440
445Leu Ala Thr Ile Arg Val Glu Asn Leu Pro Val Lys Ile Leu Leu Leu
450 455 460Asn Asn Gln His Leu Gly Met Val Val Gln Trp Glu Asp Arg
Phe Tyr465 470 475 480Lys Ala Asn Arg Ala His Thr Tyr Leu Gly Asn
Pro Ser Lys Glu Ser 485 490 495Glu Ile Phe Pro Asn Met Val Lys Phe
Ala Glu Ala Cys Asp Ile Pro 500 505 510Ala Ala Arg Val Thr Gln Lys
Ala Asp Leu Arg Ala Ala Ile Gln Lys 515 520 525Met Leu Asp Thr Pro
Gly Pro Tyr Leu Leu Asp Val Ile Val Pro His 530 535 540Gln Glu His
Val Leu Pro Met Ile Pro Ala Gly Gly Gly Phe Ser Asp545 550 555
560Val Ile Thr Glu Gly Asp Gly Arg Thr Lys Tyr 565
57071716DNAHelianthus annuus 7gcagacgtgt tggtggaagc tctggaacgg
gaaggtgtca ccgacgtctt cgcctacccc 60ggcggcgcgt caatggagat ccaccaagct
ctcacgcgct caagcactat ccgcaatgtg 120ctcccccgtc acgaacaggg
cggcgtgttc gccgccgaag gctacgcgcg cgcctccggt 180cttcccggcg
tgtgtatcgc cacttccggt cccggagcta cgaacctagt tagtggtctt
240gctgacgcgc tgttagacag tgtccccatg gtggcaatca ccggtcaagt
tccccggaga 300atgatcggaa ccgatgcgtt tcaagaaacc ccaattgttg
aggtaacacg ttcgatcact 360aaacataatt atcttgtgtt ggatgttgag
gatattccca gaattgttcg tgaggctttt 420tatcttgcga gttcgggtcg
acccggcccg gttttgatag atgtaccgaa agatatacag 480caacagttag
tggtgccgaa atgggatgaa ccgatgaggt taccgggtta tttgtctaga
540atgccgaagc ctcaatatga tgggcatttg gaacagattg ttaggttggt
gggggaagcg 600aagaggccgg ttttgtatgt gggtggtggg tgtttgaatt
cggatgatga gttgaggcgg 660tttgtggagc ttacggggat tccggttgcg
agtactttga tggggctcgg agcgtaccct 720gcttcgagtg atttgtcgct
tcatatgctt gggatgcatg gtacggttta tgcgaattat 780gcggttgata
agagtgattt gttgcttgcg tttggggtgc ggtttgatga tcgtgtgacg
840gggaagcttg aggcgtttgc tagtagggcg aagattgttc atattgatat
tgatcctgct 900gaaattggga agaataagca gcctcatgtg tcgatttgtg
gtgatattaa ggtcgcgtta 960cagggtttga acaagatttt ggaggaaaag
aattcggtga ctaatcttga tttttcgacc 1020tggagaaagg aattggatga
acaaaaaatg aagttcccgt tgagctttaa aacgtttggc 1080gaagcgattc
ctccacagta tgctattcaa gttcttgatg agttaacggg cgggaatgca
1140attattagca ccggtgtcgg gcaacatcag atgtgggctg ctcagtttta
caaatacaac 1200aaacctagac aatggctgac gtcgggcggg ctaggggcaa
tgggtttcgg cctgcccgct 1260gctatcgggg cggccgttgc aagacctgat
gcggtagtag ttgacatcga cggtgacgga 1320agctttatga tgaatgttca
agagttagcc acaatccgtg ttgaaaatct gccggttaag 1380attttattac
ttaacaacca gcatttgggt atggtggttc agtgggagga tcggttttac
1440aaggcgaatc gggctcatac ctacttagga aacccgtcaa aagagtcgga
aatattccct 1500aacatggtga agtttgctga agcctgtgat atcccggctg
ctcgagtgac ccaaaaggcg 1560gatctacgag cagctattca gaagatgttg
gatacacccg ggccttactt gttggatgtg 1620attgtgccgc atcaagaaca
cgtgttgccc atgatcccgg ctggcggagg tttctcggat 1680gtgatcaccg
agggtgatgg cagaacgaaa tattga 17168571PRTHelianthus annuus 8Ala Asp
Val Leu Val Glu Ala Leu Glu Arg Glu Gly Val Thr Asp Val1 5 10 15Phe
Ala Tyr Pro Gly Gly Ala Ser Met Glu Ile His Gln Ala Leu Thr 20 25
30Arg Ser Ser Thr Ile Arg Asn Val Leu Pro Arg His Glu Gln Gly Gly
35 40 45Val Phe Ala Ala Glu Gly Tyr Ala Arg Ala Ser Gly Leu Pro Gly
Val 50 55 60Cys Ile Ala Thr Ser Gly Pro Gly Ala Thr Asn Leu Val Ser
Gly Leu65 70 75 80Ala Asp Ala Leu Leu Asp Ser Val Pro Met Val Ala
Ile Thr Gly Gln 85 90 95Val Pro Arg Arg Met Ile Gly Thr Asp Ala Phe
Gln Glu Thr Pro Ile 100 105 110Val Glu Val Thr Arg Ser Ile Thr Lys
His Asn Tyr Leu Val Leu Asp 115 120 125Val Glu Asp Ile Pro Arg Ile
Val Arg Glu Ala Phe Tyr Leu Ala Ser 130 135 140Ser Gly Arg Pro Gly
Pro Val Leu Ile Asp Val Pro Lys Asp Ile Gln145 150 155 160Gln Gln
Leu Val Val Pro Lys Trp Asp Glu Pro Met Arg Leu Pro Gly 165 170
175Tyr Leu Ser Arg Met Pro Lys Pro Gln Tyr Asp Gly His Leu Glu Gln
180 185 190Ile Val Arg Leu Val Gly Glu Ala Lys Arg Pro Val Leu Tyr
Val Gly 195 200 205Gly Gly Cys Leu Asn Ser Asp Asp Glu Leu Arg Arg
Phe Val Glu Leu 210 215 220Thr Gly Ile Pro Val Ala Ser Thr Leu Met
Gly Leu Gly Ala Tyr Pro225 230 235 240Ala Ser Ser Asp Leu Ser Leu
His Met Leu Gly Met His Gly Thr Val 245 250 255Tyr Ala Asn Tyr Ala
Val Asp Lys Ser Asp Leu Leu Leu Ala Phe Gly 260 265 270Val Arg Phe
Asp Asp Arg Val Thr Gly Lys Leu Glu Ala Phe Ala Ser 275 280 285Arg
Ala Lys Ile Val His Ile Asp Ile Asp Pro Ala Glu Ile Gly Lys 290 295
300Asn Lys Gln Pro His Val Ser Ile Cys Gly Asp Ile Lys Val Ala
Leu305 310 315 320Gln Gly Leu Asn Lys Ile Leu Glu Glu Lys Asn Ser
Val Thr Asn Leu 325 330 335Asp Phe Ser Thr Trp Arg Lys Glu Leu Asp
Glu Gln Lys Met Lys Phe 340 345 350Pro Leu Ser Phe Lys Thr Phe Gly
Glu Ala Ile Pro Pro Gln Tyr Ala 355 360 365Ile Gln Val Leu Asp Glu
Leu Thr Gly Gly Asn Ala Ile Ile Ser Thr 370 375 380Gly Val Gly Gln
His Gln Met Trp Ala Ala Gln Phe Tyr Lys Tyr Asn385 390 395 400Lys
Pro Arg Gln Trp Leu Thr Ser Gly Gly Leu Gly Ala Met Gly Phe 405 410
415Gly Leu Pro Ala Ala Ile Gly Ala Ala Val Ala Arg Pro Asp Ala Val
420 425 430Val Val Asp Ile Asp Gly Asp Gly Ser Phe Met Met Asn Val
Gln Glu 435 440 445Leu Ala Thr Ile Arg Val Glu Asn Leu Pro Val Lys
Ile Leu Leu Leu 450 455 460Asn Asn Gln His Leu Gly Met Val Val Gln
Trp Glu Asp Arg Phe Tyr465 470 475 480Lys Ala Asn Arg Ala His Thr
Tyr Leu Gly Asn Pro Ser Lys Glu Ser 485 490 495Glu Ile Phe Pro Asn
Met Val Lys Phe Ala Glu Ala Cys Asp Ile Pro 500 505 510Ala Ala Arg
Val Thr Gln Lys Ala Asp Leu Arg Ala Ala Ile Gln Lys 515 520 525Met
Leu Asp Thr Pro Gly Pro Tyr Leu Leu Asp Val Ile Val Pro His 530 535
540Gln Glu His Val Leu Pro Met Ile Pro Ala Gly Gly Gly Phe Ser
Asp545 550 555 560Val Ile Thr Glu Gly Asp Gly Arg Thr Lys Tyr 565
57091947DNAXanthium sp. 9atggcggcca tccctcatac aaacccttcc
atcaccacca aaccaccctc atctccacca 60cgtcccacct tcctcgcccg tttcacattc
ccaataacct ccacttccca taaacgacac 120cgtctccaca tctccaacgt
cctctccgac tccaaaccca ccatcaccca ttcaccatta 180ccaaccgaat
catttatctc ccgttacgct ccagaccaac caagaaaagg cgctgatgtt
240ctcgtcgaag ctctggaacg tgaaggcgtt acagacgtct tcgcttaccc
aggtggtgcc 300tccatggaga tccaccaagc tctcacgcgc tcaaccacca
tccgcaacgt tctcccacgt 360cacgaacagg gcggcgtctt tgctgccgaa
ggctacgcac gtgcctccgg tcttcccggc 420gtctgtattg caacctctgg
tcctggagct acgaacctag taagtggtct tgctgatgct 480ttattagaca
gtgttccaat ggttgctatt actggtcaag ttcccaggag aatgattgga
540acagatgcgt ttcaagaaac ccctattgtt gaggtaacac gttccattac
taagcataat 600tatttagttt tggatgtcga ggatattccc aggattgtta
gggaagcttt ttatcttgcg 660tcttctggtc gacccggacc ggttttaatt
gatgtaccta aggatataca gcagcagttg 720gtagtgccta aatgggatga
gcctattagg ttacctgggt atttgtctag gttgcctaaa 780acggagaata
atgggcagtt ggaacacatt gttaggttgg tgagtgaggc caagaggccg
840gttttgtatg tggggggtgg gtgtttgaat tcgggagatg agttgaggcg
gtttgtggag 900cttacgggga taccggttgc gagtacgttg atggggcttg
gagcgtaccc tgcttctagt 960gatttgtcgc tgcatatgct tgggatgcat
gggacggttt atgcgaatta tgcggttgat 1020aagagtgatt tgttgcttgc
gtttggggta aggtttgatg accgtgtgac ggggaagctt 1080gaggcttttg
ctagcagagc taagattgtt catattgata ttgattctgc ggaaattggg
1140aagaataagc agcctcatgt gtcgatttgt ggtgatatca aggtcgcgtt
acagggtctg 1200aacaagattt tggaggtaaa gaattcggtg actaatcttg
atttctcgaa ctggaggaag 1260gaattggatg agcaaaaggt taagtatccg
ttgagtttta aaacatttgg cgaagctatt 1320cctccgcagt atgccattca
agtgcttgat gagttaacgg gtgggaatgc gattattagc 1380actggggtcg
ggcagcatca gatgtgggct gctcagtttt acaaatacaa caagcctaga
1440caatggctga cgtcaggtgg actaggcgcg atgggttttg ggttgcccgc
tgctatcggg 1500gcggctgttg caagacctga tgcggtagta gttgatatcg
atggtgatgg aagctttata 1560atgagcgttc aagagttagc cacaatccgt
gttgaaaatc ttcctgttaa gattttgtta 1620cttaacaatc agcatttggg
tatggtggtt cagttggagg atcggtttta caaggcgaat 1680cgggctcata
cctacttagg aaatccgtca aaagagtctg aaatattccc taacatgttg
1740aagtttgctg aagcgtgtga tatcccagct gcccgagtga cccggaaggc
agatctacga 1800gcagctattc agaagatgtt ggatacaccg gggccttact
tgttggatgt gatcgtgccc 1860catcaagaac atgtgttgcc catgatcccg
gctggtggag gtttcatgga tgtgatcacc 1920gaaggcgacg gcagaatgaa atattga
194710648PRTXanthium sp. 10Met Ala Ala Ile Pro His Thr Asn Pro Ser
Ile Thr Thr Lys Pro Pro1 5 10 15Ser Ser Pro Pro Arg Pro Thr Phe Leu
Ala Arg Phe Thr Phe Pro Ile 20 25 30Thr Ser Thr Ser His Lys Arg His
Arg Leu His Ile Ser Asn Val Leu 35 40 45Ser Asp Ser Lys Pro Thr Ile
Thr His Ser Pro Leu Pro Thr Glu Ser 50 55 60Phe Ile Ser Arg Tyr Ala
Pro Asp Gln Pro Arg Lys Gly Ala Asp Val65 70 75 80Leu Val Glu Ala
Leu Glu Arg Glu Gly Val Thr Asp Val Phe Ala Tyr 85 90 95Pro Gly Gly
Ala Ser Met Glu Ile His Gln Ala Leu Thr Arg Ser Thr 100 105 110Thr
Ile Arg Asn Val Leu Pro Arg His Glu Gln Gly Gly Val Phe Ala 115 120
125Ala Glu Gly Tyr Ala Arg Ala Ser Gly Leu Pro Gly Val Cys Ile Ala
130 135 140Thr Ser Gly Pro Gly Ala Thr Asn Leu Val Ser Gly Leu Ala
Asp Ala145 150 155 160Leu Leu Asp Ser Val Pro Met Val Ala Ile Thr
Gly Gln Val Pro Arg 165 170 175Arg Met Ile Gly Thr Asp Ala Phe Gln
Glu Thr Pro Ile Val Glu Val 180 185 190Thr Arg Ser Ile Thr Lys His
Asn Tyr Leu Val Leu Asp Val Glu Asp 195 200 205Ile Pro Arg Ile Val
Arg Glu Ala Phe Tyr Leu Ala Ser Ser Gly Arg 210 215 220Pro Gly Pro
Val Leu Ile Asp Val Pro Lys Asp Ile Gln Gln Gln Leu225 230 235
240Val Val Pro Lys Trp Asp Glu Pro Ile Arg Leu Pro Gly Tyr Leu Ser
245 250 255Arg Leu Pro Lys Thr Glu Asn Asn Gly Gln Leu Glu His Ile
Val Arg 260 265 270Leu Val Ser Glu Ala Lys Arg Pro Val Leu Tyr Val
Gly Gly Gly Cys 275 280 285Leu Asn Ser Gly Asp Glu Leu Arg Arg Phe
Val Glu Leu Thr Gly Ile 290 295 300Pro Val Ala Ser Thr Leu Met Gly
Leu Gly Ala Tyr Pro Ala Ser Ser305 310 315 320Asp Leu Ser Leu His
Met Leu Gly Met His Gly Thr Val Tyr Ala Asn 325 330 335Tyr Ala Val
Asp Lys Ser Asp Leu Leu Leu Ala Phe Gly Val Arg Phe 340 345 350Asp
Asp Arg Val Thr Gly Lys Leu Glu Ala Phe Ala Ser Arg Ala Lys 355 360
365Ile Val His Ile Asp Ile Asp Ser Ala Glu Ile Gly Lys Asn Lys Gln
370 375 380Pro His Val Ser Ile Cys Gly Asp Ile Lys Val Ala Leu Gln
Gly Leu385 390 395 400Asn Lys Ile Leu Glu Val Lys Asn Ser Val Thr
Asn Leu Asp Phe Ser 405 410 415Asn Trp Arg Lys Glu Leu Asp Glu Gln
Lys Val Lys Tyr Pro Leu Ser 420 425 430Phe Lys Thr Phe Gly Glu Ala
Ile Pro Pro Gln Tyr Ala Ile Gln Val 435 440 445Leu Asp Glu Leu Thr
Gly Gly Asn Ala Ile Ile Ser Thr Gly Val Gly 450 455 460Gln His Gln
Met Trp Ala Ala Gln Phe Tyr Lys Tyr Asn Lys Pro Arg465 470 475
480Gln Trp Leu Thr Ser Gly Gly Leu Gly Ala Met Gly Phe Gly Leu Pro
485 490 495Ala Ala Ile Gly Ala Ala Val Ala Arg Pro Asp Ala Val Val
Val Asp 500 505 510Ile Asp Gly Asp Gly Ser Phe Ile Met Ser Val Gln
Glu Leu Ala Thr 515 520 525Ile Arg Val Glu Asn Leu Pro Val Lys Ile
Leu Leu Leu Asn Asn Gln 530 535 540His Leu Gly Met Val Val Gln Leu
Glu Asp Arg Phe Tyr Lys Ala Asn545 550 555 560Arg Ala His Thr Tyr
Leu Gly Asn Pro Ser Lys Glu Ser Glu Ile Phe 565 570 575Pro Asn Met
Leu Lys Phe Ala Glu Ala Cys Asp Ile Pro Ala Ala Arg 580 585 590Val
Thr Arg Lys Ala Asp Leu Arg Ala Ala Ile Gln Lys Met Leu Asp 595 600
605Thr Pro Gly Pro Tyr Leu Leu Asp Val Ile Val Pro His Gln Glu His
610 615 620Val Leu Pro Met Ile Pro Ala Gly Gly Gly Phe Met Asp Val
Ile Thr625 630 635 640Glu Gly Asp Gly Arg Met Lys Tyr
6451122DNAArtificial SequenceSynthesized; Primer ALS1-1F
11catcatcatt aaataaccag ac 221222DNAArtificial SequenceSynthesized;
Primer ALS1-1R 12aacccggtaa cctcatcggt tc 221322DNAArtificial
SequenceSynthesized; Primer ALS1-2F 13cccggttttg atagatgtac cg
221422DNAArtificial SequenceSynthesized; Primer ALS1-2R
14ctgagcagcc cacatctgat gt 221522DNAArtificial SequenceSynthesized;
Primer ALS1-3F 15ctgagcagcc cacatctgat gt 221622DNAArtificial
SequenceSynthesized; Primer ALS1-3R 16aattacacaa caaaacatta ac
221719DNAArtificial SequenceSynthesized; Primer ALS-3F 17gcgctgttag
acagtgtcc 191818DNAArtificial SequenceSynthesized; Primer SUNALS1F1
18actaatcttg atttttcg 181920DNAArtificial SequenceSynthesized;
Primer ALS-6R 19cggcagattt tcaacacgga 20
* * * * *
References