U.S. patent application number 12/880001 was filed with the patent office on 2011-06-02 for polymorphisms in the human gene for cytochrome p450 polypeptide 2c8 and their use in diagnostic and therapeutic applications.
Invention is credited to Ulrich Brinkmann, Anja Penger, Reimund Sprenger.
Application Number | 20110131671 12/880001 |
Document ID | / |
Family ID | 8177562 |
Filed Date | 2011-06-02 |
United States Patent
Application |
20110131671 |
Kind Code |
A1 |
Penger; Anja ; et
al. |
June 2, 2011 |
POLYMORPHISMS IN THE HUMAN GENE FOR CYTOCHROME P450 POLYPEPTIDE 2C8
AND THEIR USE IN DIAGNOSTIC AND THERAPEUTIC APPLICATIONS
Abstract
The present invention relates to a polymorphic
CYP2C8-polynucleotide. Moreover, the invention relates to genes or
vectors comprising the polynucleotides of the invention and to a
host cell genetically engineered with the polynucleotide or gene of
the invention. Further, the invention relates to methods for
producing molecular variant polypeptides or fragments thereof,
methods for producing cells capable of expressing a molecular
variant polypeptide and to a polypeptide or fragment thereof
encoded by the polynucleotide or the gene of the invention or which
is obtainable by the method or from the cells produced by the
method of the invention. Furthermore, the invention relates to an
antibody which binds specifically the polypeptide of the invention.
Moreover, the invention relates to a transgenic non-human animal.
The invention also relates to a solid support comprising one or a
plurality of the above mentioned polynucleotides, genes, vectors,
polypeptides, antibodies or host cells. Furthermore, methods of
identifying a polymorphism, identifying and obtaining a prodrug or
drug or an inhibitor are also encompassed by the present invention.
In addition, the invention relates to methods for producing of a
pharmaceutical composition and to methods of diagnosing a disease.
Further, the invention relates to a method of detection of the
polynucleotide of the invention. Furthermore, comprised by the
present invention are a diagnostic and a pharmaceutical
composition. Even more, the invention relates to uses of the
polynucleotides, genes, vectors, polypeptides or antibodies of the
invention. Finally, the invention relates to a diagnostic kit.
Inventors: |
Penger; Anja; (Tutzing,
DE) ; Sprenger; Reimund; (Weilheim, DE) ;
Brinkmann; Ulrich; (Weilheim, DE) |
Family ID: |
8177562 |
Appl. No.: |
12/880001 |
Filed: |
September 10, 2010 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10479225 |
Apr 8, 2004 |
7871767 |
|
|
PCT/EP02/06000 |
May 31, 2002 |
|
|
|
12880001 |
|
|
|
|
Current U.S.
Class: |
800/13 ; 435/189;
435/25; 435/6.11; 435/6.18; 435/7.8; 530/389.1; 536/23.1;
536/23.2 |
Current CPC
Class: |
C12Q 1/6883 20130101;
A01K 2217/05 20130101; C12Q 2600/156 20130101; C12N 9/0077
20130101 |
Class at
Publication: |
800/13 ;
536/23.1; 536/23.2; 435/189; 530/389.1; 435/6.11; 435/25; 435/7.8;
435/6.18 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68; C07H 21/00 20060101 C07H021/00; C12N 15/53 20060101
C12N015/53; C12N 9/02 20060101 C12N009/02; C07K 16/00 20060101
C07K016/00; A01K 67/00 20060101 A01K067/00; C12Q 1/26 20060101
C12Q001/26 |
Foreign Application Data
Date |
Code |
Application Number |
Jun 1, 2001 |
EP |
01112899.8 |
Claims
1. A polynucleotide comprising a polynucleotide selected from the
group consisting of: (a) a polynucleotide having the nucleic acid
sequence of SEQ ID NO: 54, 57, 60, 63, 66, 69, 72, 75, 78, 81, 84,
87, 90, 93, 96, 99, 102, 105, 108, 111, 114, 117, 120, 123, 126,
129, 132, 135, 138, 141, 144, 147, 150, 153, 156, 159, 162, 165,
168, 171, 174, 177, 180, 183, 183, 189, 192, 195, 198, 201, 210,
213, 216, 219, 222, 225, 228, 231, 234, 237, 240, 243, 246, 249,
252, 255, 258, 261, 264, 267, 270, 273, 276, 279, 282, 285, 288,
291, 306, 309, 318, 321, 324, 327, 330, 333, 342, 345, 348, 351,
354, 357, 360, 363, 366, 369, 384, 387, 390, 393, 396 or 399; (b) a
polynucleotide encoding a polypeptide having the amino acid
sequence of SEQ ID NO: 6, 8, 10, 12, 18, 377, 379 or 381; (c) a
polynucleotide capable of hybridizing to a CYP2C8 gene, wherein
said polynucleotide is having at a position corresponding to
position 411, 560, 713, 817, 824, 831, 879, 886, 1058, 1627, 1668,
1767, 1887, 1905 or 1952 (GenBank accession No: AF136830.1), at a
position corresponding to position 171 or 258 (GenBank accession
No: AF136832.1), at a position corresponding to position 122, 150,
182, 334, 339 or 378 (GenBank accession No: AF136833.1), at a
position corresponding to position 162, 163, 243 (GenBank accession
No: AF136834.2) or at position 583 (GenBank accession No:
NM.sub.--000770.1), at a position corresponding to position 13 or
180 (GenBank accession No: AF136835.1), at a position corresponding
to position 116, 132, 172 or 189 (GenBank accession No:
AF136836.1), at a position corresponding to position 42 or 101
(GenBank accession No: AF136837.1), at a position corresponding to
position 309 (GenBank accession No: AF136838.1), at a position
corresponding to position 1135 (GenBank accession No:
NM.sub.--000770.1), at a position corresponding to position 232
(GenBank accession No: AF136840.1), at a position corresponding to
position 206 (GenBank accession No: AF136842.1), at a position
corresponding to position 30, 87, 167, 197, 212, 221, 255 or 271
(GenBank accession No: AF136843.1), at a position corresponding to
position 118 (GenBank accession No: AF136844.1), at a position
corresponding to position 44 (GenBank accession No: AF136845.1) of
the cytochrome 2C8 gene (GenBank accession No: GI: 13787189) a
nucleotide substitution, at a position corresponding to position
306 to 307, 1271 to 1273 or 1397 to 1398 of the CYP2C8 gene
(GenBank accession No: AF136830.1), at a position corresponding to
position 329 of the CYP2C8 gene (GenBank accession No: AF136833.1),
at a position corresponding to position 87 of the CYP2C8 gene
(GenBank accession No: AF136834.2) a deletion of one or more
nucleotides or at a position corresponding to position 1785/1786 of
the CYP2C8 gene (GenBank accession No: AF136830.1) or at a position
corresponding to position 180/181 of the CYP2C8 gene (GenBank
accession No: AF36833.1) an insertion of one or more nucleotides;
(d) a polynucleotide capable of hybridizing to a CYP2C8 gene,
wherein said polynucleotide is having at a position corresponding
to position 411, 817, 824, 831, 879, 1058, 1767 or 1887 of the
CYP2C8 gene (GenBank accession No: AF136830.1) an A, at a position
corresponding to position 560 or 1668 of the CYP2C8 gene (GenBank
accession No: AF136830.1) a G, at a position corresponding to
position 713 or 886 of the CYP2C8 gene (GenBank accession No:
AF36830.1) a T, at a position corresponding to position 1627, 1905
or 1952 of the CYP2C8 gene (GenBank accession No: AF136830.1) a C,
at a position corresponding to position 258 of the CYP2C8 gene
(GenBank accession No: AF136832.1) a T, at a position corresponding
to position 171 of the CYP2C8 gene (GenBank accession No:
AF136832.1) a C, at a position corresponding to position 122, 150
or 334 of the CYP2C8 gene (GenBank accession No: AF136833.1) an A,
at a position corresponding to position 182 or 378 of the CYP2C8
gene (GenBank accession No: AF136833.1) a C, at a position
corresponding to position 162, 163, 243 [identical to position
corresponding to position 583 of the CYP2C8 gene (GenBank accession
No: NM.sub.--000770.1) of the CYP2C8 gene (GenBank accession No:
AF136834.2) an A, at a position corresponding to position 180 of
the CYP2C8 gene (GenBank accession No: AF136835.1) an A, at a
position corresponding to position 13 of the CYP2C8 gene (GenBank
accession No: AF136835.1) a G, at a position corresponding to
position 116 or 132 of the CYP2C8 gene (GenBank accession No:
AF136836.1) a G, at a position corresponding to position 172 of the
CYP2C8 gene (GenBank accession No: AF136836.1) a G, at a position
corresponding to position 189 of the CYP2C8 gene (GenBank accession
No: AF136836.1) a C, at a position corresponding to position 42 or
101 of the CYP2C8 gene (GenBank accession No: AF136837.1) a G, at a
position corresponding to position 1135 of the CYP2C8 gene (GenBank
accession No: GI: 13787189) an A, at a position corresponding to
position 309 of the CYP2C8 gene (GenBank accession No: AF136838.1)
a T, at a position corresponding to position 232 (GenBank accession
No: 136840.1) a T, at a position corresponding to position 30 or
212 of the CYP2C8 gene (GenBank accession No: AF136843.1) a T, at a
position corresponding to position 87 of the CYP2C8 gene (GenBank
accession No: AF136843.1) a G, at a position corresponding to
position 167 or 197 of the CYP2C8 gene (GenBank accession No:
AF136843.1) an A, at a position corresponding to position 221, 255
or 271 of the CYP2C8 gene (GenBank accession No: AF136843.1) a C,
at a position corresponding to position 118 of the CYP2C8 gene
(GenBank accession No AF136844.1) an A, at a position corresponding
to position 44 of the CYP2C8 gene (GenBank accession No:
AF136845.1) a T; (e) a polynucleotide encoding a molecular CYP2C8
variant polypeptide or fragment thereof, wherein said polypeptide
comprises an ammo acid substitution at a position corresponding to
any one of position 159, 181, 209, 244, 263, 274, 343 or 365 of the
CYP2C8 polypeptide (GI: 13787189); and (f) a polynucleotide
encoding a molecular CYP2C8 variant polypeptide or fragment
thereof, wherein said polypeptide comprises an amino acid
substitution of T to P at position corresponding to position 159
(frameshift), V to I at a position corresponding to position 181, N
to S at a position corresponding to position 209, I to V at a
position corresponding to position 244, F to L at a position
corresponding to position 263, E to Stop at a position
corresponding to position 274, G to S at a position corresponding
to position 365 or S to I at a position corresponding to position
343 of the CYP2C8 polypeptide (GenBank accession No: GI:
13787189).
2. (canceled)
3. (canceled)
4. (canceled)
5. (canceled)
6. (canceled)
7. (canceled)
8. (canceled)
9. (canceled)
10. (canceled)
11. A polypeptide or fragment thereof encoded by the polynucleotide
of claim 1.
12. An antibody which binds specifically to the polypeptide of
claim 11.
13. (canceled)
14. (canceled)
15. A transgenic non-human animal comprising the polynucleotide of
claim 1.
16. (canceled)
17. A solid support comprising the polynucleotide of claim 1 the
polypeptide of claim 11, or the antibody of claim 12 in immobilized
form.
18. (canceled)
19. An in vitro method for identifying a single nucleotide
polymorphism said method comprising the steps of: (a) isolating the
polynucleotide of claim 1 from a plurality of subgroups of
individuals, wherein one subgroup has no prevalence for a CYP2C8
associated disease and at least one or more further subgroup(s) do
have prevalence for a CYP2C8 associated disease; and (b)
identifying a single nucleotide polymorphism by comparing the
nucleic acid sequence of said polynucleotide or said gene of said
one subgroup having no prevalence for a CYP2C8 associated disease
with said at least one or more further subgroup(s) having a
prevalence for a CYP2C8 associated disease.
20. A method for identifying and obtaining a pro-drug or a drug
capable of modulating the activity of a molecular variant of a
CYP2C8 polypeptide comprising the steps of: (a) contacting the
polypeptide of claim 11 in the presence of components capable of
providing a detectable signal in response to drug activity with a
compound to be screened for pro-drug or drug activity; and (b)
detecting the presence or absence of a signal or increase or
decrease of a signal generated from the pro-drug or the drug
activity, wherein the absence, presence, increase or decrease of
the signal is indicative for a putative pro-drug or drug.
21. A method for identifying and obtaining an inhibitor of the
activity of a molecular variant of a CYP2C8 polypeptide comprising
the steps of: (a) contacting the protein of claim 11 in the
presence of components capable of providing a detectable signal in
response to drug activity with a compound to be screened for
inhibiting activity; and (b) detecting the presence or absence of a
signal or increase or decrease of a signal generated from the
inhibiting activity, wherein the absence or decrease of the signal
is indicative for a putative inhibitor.
22. (canceled)
23. A method of identifying and obtaining a pro-drug or drug
capable of modulating the activity of a molecular variant of a
CYP2C8 polypeptide comprising the steps of: (a) contacting the
polypeptide of claim 11 with the first molecule known to be bound
by a CYP2C8 polypeptide to form a first complex of said polypeptide
and said first molecule; (b) contacting said first complex with a
compound to be screened, and (c) measuring whether said compound
displaces said first molecule from said first complex.
24. A method of identifying and obtaining an inhibitor capable of
modulating the activity of a molecular variant of a CYP2C8
polypeptide or its gene product comprising the steps of: (a)
contacting the protein of claim 11 with the first molecule known to
be bound by a CYP2C8 polypeptide to form a first complex of said
polypeptide and said first molecule; (b) contacting said first
complex with a compound to be screened, and (c) measuring whether
said compound displaces said first molecule from said first
complex.
25. (canceled)
26. (canceled)
27. (canceled)
28. A method for the production of a pharmaceutical composition
comprising the steps of the method of claim 20 and the further step
of formulating the compound identified and obtained or a derivative
thereof in a pharmaceutical acceptable form.
29. A method of diagnosing a disorder related to the presence of a
molecular variant of a CYP2C8 gene or susceptibility to such a
disorder comprising determining the presence of a polynucleotide of
claim 1 in a sample from a subject.
30. (canceled)
31. A method of diagnosing a disorder related to the presence of a
molecular variant of a CYP2C8 gene or susceptibility to such a
disorder comprising determining the presence of a polypeptide of
claim 11 in a sample from a subject.
32. (canceled)
33. (canceled)
34. A method of detection of the polynucleotide of claim 1 in a
sample comprising the steps of (a) contacting the solid support
comprising the polynucleotide with the sample under conditions
allowing interaction of the polynucleotide with the immobilized
targets on a solid support and (b) determining the binding of said
polynucleotide or said gene to said immobilized targets on a solid
support.
35. An in vitro method for diagnosing a disease comprising the
steps of the method of claim 34, wherein binding of said
polynucleotide or gene to said immobilized targets on said solid
support is indicative for the presence or the absence of said
disease or a prevalence for said disease.
36. A diagnostic composition comprising the polynucleotide of claim
1, the polypeptide of claim 11 or the antibody of claim 12.
37. A pharmaceutical composition comprising the polynucleotide of
claim 1, the polypeptide of claim 11 or the antibody of claim
12.
38. (canceled)
39. (canceled)
40. (canceled)
41. A diagnostic kit for detection of a single nucleotide
polymorphism comprising the polynucleotide of claim 1, the
polypeptide of claim 11, the antibody of claim 12.
Description
[0001] The present invention relates to a polymorphic CYP2C8
polynucleotide. Moreover, the invention relates to genes or vectors
comprising the polynucleotides of the invention and to a host cell
genetically engineered with the polynucleotide or gene of the
invention. Further, the invention relates to methods for producing
molecular variant polypeptides or fragments thereof, methods for
producing cells capable of expressing a molecular variant
polypeptide and to a polypeptide or fragment thereof encoded by the
polynucleotide or the gene of the invention or which is obtainable
by the method or from the cells produced by the method of the
invention. Furthermore, the invention relates to an antibody which
binds specifically the polypeptide of the invention. Moreover, the
invention relates to a transgenic non-human animal. The invention
also relates to a solid support comprising one or a plurality of
the above mentioned polynucleotides, genes, vectors, polypeptides,
antibodies or host cells. Furthermore, methods of identifying a
polymorphism, identifying and obtaining a pro-drug or drug or an
inhibitor are also encompassed by the present invention. In
addition, the invention relates to methods for producing of a
pharmaceutical composition and to methods of diagnosing a disease.
Further, the invention relates to a method of detection of the
polynucleotide of the invention. Furthermore, comprised by the
present invention are a diagnostic and a pharmaceutical
composition. Even more, the invention relates to uses of the
polynucleotides, genes, vectors, polypeptides or antibodies of the
invention. Finally, the invention relates to a diagnostic kit.
[0002] Cytochrome P450 enzymes are metabolic enzymes differentially
expressed in several tissues. Cytochrome P450 2C mRNA was detected
in abundance in hepatic tissue, to a lesser extend in extrahepatic
tissues, e.g. kidney, adrenal gland, brain, uterus, mammary gland,
ovary and duodenum, but neither in testes nor ovary (Klose, J
Biochem Mol Toxicol 13 (1999), 289-95). Of the CYP2C subfamily,
clustered on chromosome 10q24.1 (Gray, Genomics 28 (1995), 328-32),
CYP2C9 and 2C19 are those which gained major interest due to their
prominent role in metabolizing therapeutic drugs. Differential
breakdown of their substrates led to the identification of alleles
for poor (PM) or extensive metabolizers (EM). Nevertheless, the
existence of minor CYP2C8 genes was known and characterized to
display about 90% amino acid homology (Goldstein, Pharmacogenetics
4 (1994), 285-99). Only recently, the genomic sequence of CYP2C8,
spanning a 31 kb region, was published. Interestingly, the gene is
involved in intergenic splicing with CYP2C18 composed of 9 exons
(Finta, Genomics 63 (2000), 433-8).
[0003] Arachidonic acid is one major endogenous substrate for
CYP2C8 and specificially epoxidated to equivalent forms of 11, 12-
and 14, 15-epoxides. Concerning xenobiotical substrates CYP2C8
represents the isoform with the narrowest substrate specificity.
The anticancer drug taxol (paclitaxel), also well known to be a
substrate for MDR-1 (Mechetner, Clin Cancer Res. 4 (1998),
389-398), is known to be the prototype. Several other drugs, e.g.
verapamil (Tracy, Br J Clin Pharmacol. 47 (1999), 545-52) and
rosiglitazone (Malinowski, Clin Ther. 22 (2000), 1151-68) are
preferable substrates for CYP2C8 in comparison to other CYP2Cs or
CYP3As. Drugs like benzphetamine, retinoic acid, tolbutamide,
benzo(a)pyrene, carbamazepine and R-ibuprofen represent a minor
contribution of CYP2C8 (Wrighton, J Clin Invest. 80 (1987),
1017-22; Relling, J Pharmacol Exp Ther. 252 (1990), 442-7; Hamman,
Biochem Pharmacol. 54 (1997), 33-41; Kerr, Biochem Pharmacol. 47
(1994), 1969-79; Yun, Cancer Res. 52 (1992), 1868-74; Leo, Arch
Biochem Biophys 259 (1987), 241-9). So far, the enzymatic induction
has only be observed by phenobarbital and rifampicin (Morel, Eur J.
Biochem. 191 (1990), 437-44). Thum and Borlak (Thum and Borlak, Br
J Pharmacol 130 (2000), 1745-52) found a strong correlation between
tissue specific gene expression and enzyme activity. Increased
CYP2C8 mRNA expression within the right heart ventricle might
explain for the lack of efficacy of cardioselective drugs like
verapamil. In a porcine system, Fisslthaler (Fisslthaler, Nature
401(1999), 493-7; Fisslthaler, Semin Perinatol 24 (2000), 15-9;
Fisslthaler, Circ Res. 88 (2001), 44-51) could show that CYP2C8
meets all criteria for the coronary endothelium-derived
hyperpolarisation factor synthase acting on vascular smooth muscle
cells prior to dilation.
[0004] Since the mRNA has been published, first single nucleotide
polymorphisms (SNPs) in exons 3, 5 and 8 were reported in an
abstract (Goldstein, Microsomes and Oxidation, Stresa (2000),
Italy): an exchange in position 139 of Arg to Lys (exon 3) could be
linked to a SNP in exon 8 (Lys399Arg), occurring primarily in
Caucasians, and correlated to poor metabolizing phenotype (PM).
Exon 5 displays a mutation (Iso269Phe) that is associated with poor
metabolizing enzyme restricted to African-Americans. The regulation
of the 2Cs is supposed to be modified by polymorphisms in the
untranslated region. Regarding CYP2C8, two previously unidentified
transcription regulatory factor sites for C/EBP and HPF-1, but no
relevant SNPs were identified by Goldstein and coworkers
(Goldstein, Microsomes and Oxidation, Stresa Italy (2000), Italy)
in that region.
[0005] However, means and methods for reliable and improved
diagnosing and treating a variety of diseases and disorders or for
predicting and overcoming undesired drug effects or interactions
based on dysfunctions or dysregulations of cytochrome 2C8 variants
were not available yet but are nevertheless highly desirable. Thus,
the technical problem underlying the present invention is to comply
with the above specified needs.
[0006] The solution to this technical problem is achieved by
providing the embodiments characterized in the claims.
[0007] Accordingly, the present invention relates to a
polynucleotide comprising a polynucleotide selected from the group
consisting of: [0008] (a) a polynucleotide having the nucleic acid
sequence of SEQ ID NO: 54, 57, 60, 63, 66, 69, 72, 75, 78, 81, 84,
87, 90, 93, 96, 99, 102, 105, 108, 111, 114, 117, 120, 123, 126,
129, 132, 135, 138, 141, 144, 147, 150, 153, 156, 159, 162, 165,
168, 171, 174, 177, 180, 183, 186, 189, 192, 195, 198, 201, 210,
213, 216, 219, 222, 225, 228, 231, 234, 237, 240, 243, 246, 249,
252, 255, 258, 261, 264, 267, 270, 273, 276, 279, 282, 285, 288,
291, 306, 309, 318, 321, 324, 327, 330, 333, 342, 345, 348, 351,
354, 357, 360, 363, 366, 369, 384, 387, 390, 393, 396 or 399;
[0009] (b) a polynucleotide encoding a polypeptide having the amino
acid sequence of SEQ ID NO: 6, 8, 10, 12, 18, 377, 379 or 381;
[0010] (c) a polynucleotide capable of hybridizing to a CYP2C8
gene, wherein said polynucleotide is having at a position
corresponding to position 411, 560, 713, 817, 824, 831, 879, 886,
1058, 1627, 1668, 1767, 1887, 1905 or 1952 (GenBank accession No:
AF136830.1), at a position corresponding to position 171 or 258
(GenBank accession No: AF136832.1), at a position corresponding to
position 122, 150, 182, 334, 339 or 378 (GenBank accession No:
AF136833.1), at a position corresponding to position 162, 163, 243
(GenBank accession No: AF136834.2) or at position 583 (GenBank
accession No: NM.sub.--000770.1), at a position corresponding to
position 13 or 180 (GenBank accession No: AF136835.1), at a
position corresponding to position 116, 132, 172 or 189 (GenBank
accession No: AF136836.1), at a position corresponding to position
42 or 101 (GenBank accession No: AF136837.1), at a position
corresponding to position 309 (GenBank accession No: AF136838.1),
at a position corresponding to position 1135 (GenBank accession No:
NM.sub.--000770.1), at a position corresponding to position 232
(GenBank accession No: AF136840.1), at a position corresponding to
position 206 (GenBank accession No: AF136842.1), at a position
corresponding to position 30, 87, 167, 197, 212, 221, 255 or 271
(GenBank accession No: AF136843.1), at a position corresponding to
position 118 (GenBank accession No: AF136844.1), at a position
corresponding to position 44 (GenBank accession No: AF136845.1) of
the cytochrome 2C8 gene (GenBank accession No: GI: 13787189) a
nucleotide substitution, at a position corresponding to position
306 to 307, 1271 to 1273 or 1397 to 1398 of the CYP2C8 gene
(GenBank accession No: AF136830.1), at a position corresponding to
position 329 of the CYP2C8 gene (GenBank accession No: AF136833.1),
at a position corresponding to position 87 of the CYP2C8 gene
(GenBank accession No: AF136834.2) a deletion of one or more
nucleotides or at a position corresponding to position 1785/1786 of
the CYP2C8 gene (GenBank accession No: AF136830.1) or at a position
corresponding to position 180/181 of the CYP2C8 gene (GenBank
accession No: AF136833.1) an insertion of one or more nucleotides;
[0011] (d) a polynucleotide capable of hybridizing to a CYP2C8
gene, wherein said polynucleotide is having at a position
corresponding to position 411, 817, 824, 831, 879, 1058, 1767 or
1887 of the CYP2C8 gene (GenBank accession No: AF136830.1) an A, at
a position corresponding to position 560 or 1668 of the CYP2C8 gene
(GenBank accession No: AF136830.1) a G, at a position corresponding
to position 713 or 886 of the CYP2C8 gene (GenBank accession No:
AF136830.1) a T, at a position corresponding to position 1627, 1905
or 1952 of the CYP2C8 gene (GenBank accession No: AF136830.1) a C,
at a position corresponding to position 258 of the CYP2C8 gene
(GenBank accession No: AF136832.1) a T, at a position corresponding
to position 171 of the CYP2C8 gene (GenBank accession No:
AF136832.1) a C, at a position corresponding to position 122, 150
or 334 of the CYP2C8 gene (GenBank accession No: AF136833.1) an A,
at a position corresponding to position 182 or 378 of the CYP2C8
gene (GenBank accession No: AF136833.1) a C, at a position
corresponding to position 162, 163, 243 [identical to position
corresponding to position 583 of the CYP2C8 gene (GenBank accession
No: NM.sub.--000770.1) of the CYP2C8 gene (GenBank accession No:
AF136834.2) an A, at a position corresponding to position 180 of
the CYP2C8 gene (GenBank accession No: AF136835.1) an A, at a
position corresponding to position 13 of the CYP2C8 gene (GenBank
accession No: AF136835.1) a G, at a position corresponding to
position 116 or 132 of the CYP2C8 gene (GenBank accession No:
AF136836.1) a G, at a position corresponding to position 172 of the
CYP2C8 gene (GenBank accession No: AF136836.1) a G, at a position
corresponding to position 189 of the CYP2C8 gene (GenBank accession
No: AF136836.1) a C, at a position corresponding to position 42 or
101 of the CYP2C8 gene (GenBank accession No: AF136837.1) a G, at a
position corresponding to position 1135 of the CYP2C8 gene (GenBank
accession No: GI: 13787189) an A, at a position corresponding to
position 309 of the CYP2C8 gene (GenBank accession No: AF136838.1)
a T, at a position corresponding to position 232 (GenBank accession
No: 136840.1) a T, at a position corresponding to position 30 or
212 of the CYP2C8 gene (GenBank accession No: AF136843.1) a T, at a
position corresponding to position 87 of the CYP2C8 gene (GenBank
accession No: AF136843.1) a G, at a position corresponding to
position 167 or 197 of the CYP2C8 gene (GenBank accession No:
AF136843.1) an A, at a position corresponding to position 221, 255
or 271 of the CYP2C8 gene (GenBank accession No: AF136843.1) a C,
at a position corresponding to position 118 of the CYP2C8 gene
(GenBank accession No: AF136844.1) an A, at a position
corresponding to position 44 of the CYP2C8 gene (GenBank accession
No: AF136845.1) a T; [0012] (e) a polynucleotide encoding a
molecular CYP2C8 variant polypeptide or fragment thereof, wherein
said polypeptide comprises an amino acid substitution at a position
corresponding to any one of position 159, 181, 209, 244, 263, 274,
343 or 365 of the CYP2C8 polypeptide (GI: 13787189); and [0013] (f)
a polynucleotide encoding a molecular CYP2C8 variant polypeptide or
fragment thereof, wherein said polypeptide comprises an amino acid
substitution of T to P at position corresponding to position 159
(frameshift), V to I at a position corresponding to position 181, N
to S at a position corresponding to position 209, I to V at a
position corresponding to position 244, F to L at a position
corresponding to position 263, E to Stop at a position
corresponding to position 274, G to S at a position corresponding
to position 365 or S to I at a position corresponding to position
343 of the CYP2C8 polypeptide (GenBank accession No: GI:
13787189).
[0014] In the context of the present invention the term
"polynucleotides" or the term "polypeptides" refers to different
variants of a polynucleotide or polypeptide. Said variants comprise
a reference or wild type sequence of the polynucleotides or
polypeptides of the invention as well as variants which differ
therefrom in structure or composition. Reference or wild type
sequences for the polynucleotides are GenBank accession No:
NM.sub.--000770.1 for mRNA. Reference or wild type sequence for the
polynucleotide of the invention is for the 5'UTR: GenBank accession
No: AF136830.1; for exon 1: GenBank accession No: AF136831.1; for
exon 2: GenBank accession No: AF136832.1 and AF136833.1; for exon
3: GenBank accession No: AF136833.1; for exon 4: GenBank accession
No: AF136834.2 and AF136835.1; for exon 5: GenBank accession No:
AF136836.1 and AF136837.1; for exon 6: GenBank accession No:
AF136838.1 and AF136839.1; for exon 7: GenBank accession No:
AF136840.1 and AF136841.1; for exon 8: GenBank accession No:
AF136842.1 and AF136843.1; for exon9/3'UTR: GenBank accession No:
AF136844.1 and AF136845.1; partly in combination with
NM.sub.--000770.1 (mRNA). Reference or wild type sequence for the
polypeptide of the CYP2C8 gene is GenBank accession No: GI:
13787189. In the context of the present invention the term "5'UTR"
refers to the untranslated region 5' to the ATG start codon
including the 5' upstream region encompassing the promoter. The
term "3'UTR" refers to the untranslated region 3' to the Stop
codon.
[0015] The differences in structure or composition usually occur by
way of nucleotide or amino acid substitution(s), addition(s) and/or
deletion(s). Preferred substitution in accordance with the present
invention are a T to G substitution at a position corresponding to
position 1668 (GenBank accession No: AF136830.1), a G to A
substitution at a position corresponding to position 831 (GenBank
accession No: AF136830.1), a G to T substitution at a position
corresponding to position 309 (GenBank accession No: AF136838.1)
and 232 (GenBank accession No: AF136840.1) of the CYP2C8 gene.
Preferred deletions in accordance with the invention are an AT
deletion at a position corresponding to position 1397 to 1398
(GenBank accession No: AF136830.1) and a deletion of at least one A
at a position corresponding to position 329 (GenBank accession No:
AF136833.1) of the CYP2C8 gene.
[0016] In accordance with the present invention it has also been
found that a deletion of the nucleotide A at a position
corresponding to position 329 (GenBank accession No: AF136833.1) of
the CYP2C8 gene leads to an altered C-terminus of the protein
encoding a CYP2C8 polypeptide wherein said polypeptide comprises an
amino acid substitution of T to P at a position corresponding to
position 159 of the CYP2C8 polypeptide (GenBank accession No: GI:
13787189). In accordance with the present invention it has also
been found that a substitution of a G to a T at a position
corresponding to position 309 (GenBank accession No: AF136838.1) of
the CYP2C8 gene leads to a polypeptide wherein said polypeptide
comprises an amino acid substitution of E to a premature
termination (stop) at a position corresponding to position 274 of
the CYP2C8 polypeptide (Gen Bank accession No: GI: 13787189) and a
substitution of the nucleotide G to an A at a position
corresponding to position 1135 (GenBank accession No:
NM.sub.--000770.1) of the CYP2C8 gene leads to a polypeptide
wherein said polypeptide comprises an amino acid substitution of G
to S at a position corresponding to position 365 of the CYP2C8
polypeptide (GenBank accession No: GI: 13787189). This will alter
the structure or confirmation of the protein and will abolish the
activity of the drug metabolizing enzyme.
[0017] Preferably, said nucleotide substitution(s), addition(s) or
deletion(s) comprised by the present invention result(s) in one or
more changes of the corresponding amino acid(s) of the polypeptides
of the invention.
[0018] The variant polynucleotides and polypeptides also comprise
fragments of said polynucleotides or polypeptides of the invention.
The polynucleotides and polypeptides as well as the aforementioned
fragments thereof of the present invention are characterized as
being associated with a CYP2C8 dysfunction or dysregulation
comprising, e.g., insufficient and/or altered metabolism. Said
dysfunctions or dysregulations referred to in the present invention
cause a disease or disorder or a prevalence for said disease or
disorder. Preferably, as will be discussed below in detail, said
disease is a deficiency in the metabolism of certain drugs which
are metabolized by CYP2C8, e.g. Taxol, Verapamil, or any other
disease caused by a dysfunction or dysregulation due to a
polynucleotide or polypeptides of the invention, also referred to
as CYP2C8 gene associated diseases in the following.
[0019] The term "hybridizing" as used herein refers to
polynucleotides which are capable of hybridizing to the
polynucleotides of the invention or parts thereof which are
associated with a CYP2C8 dysfunction or dysregulation. Thus, said
hybridizing polynucleotides are also associated with said
dysfunctions and dysregulations. Preferably, said polynucleotides
capable of hybridizing to the polynucleotides of the invention or
parts thereof which are associated with CYP2C8 dysfunctions or
dysregulations are at least 70%, at least 80%, at least 95% or at
least 100% identical to the polynucleotides of the invention or
parts thereof which are associated with CYP2C8 dysfunctions or
dysregulations. Therefore, said polynucleotides may be useful as
probes in Northern or Southern Blot analysis of RNA or DNA
preparations, respectively, or can be used as oligonucleotide
primers in PCR analysis dependent on their respective size. Also
comprised by the invention are hybridizing polynucleotides which
are useful for analyzing DNA-Protein interactions via, e.g.,
electrophoretic mobility shift analysis (EMSA). Preferably, said
hybridizing polynucleotides comprise at least 10, more preferably
at least 15 nucleotides in length while a hybridizing
polynucleotide of the present invention to be used as a probe
preferably comprises at least 100, more preferably at least 200, or
most preferably at least 500 nucleotides in length.
[0020] It is well known in the art how to perform hybridization
experiments with nucleic acid molecules, i.e. the person skilled in
the art knows what hybridization conditions s/he has to use in
accordance with the present invention. Such hybridization
conditions are referred to in standard text books such as Molecular
Cloning A Laboratory Manual, Cold Spring Harbor Laboratory (1989)
N.Y. Preferred in accordance with the present inventions are
polynucleotides which are capable of hybridizing to the
polynucleotides of the invention or parts thereof which are
associated with a CYP2C8 dysfunction or dysregulation under
stringent hybridization conditions, i.e. which do not cross
hybridize to unrelated polynucleotides such as polynucleotides
encoding a polypeptide different from the CYP2C8 polypeptides of
the invention.
[0021] The term "corresponding" as used herein means that a
position is not only determined by the number of the preceding
nucleotides and amino acids, respectively. The position of a given
nucleotide or amino acid in accordance with the present invention
which may be deleted, substituted or comprise one or more
additional nucleotide(s) may vary due to deletions or additional
nucleotides or amino acids elsewhere in the gene or the
polypeptide. Thus, under a "corresponding position" in accordance
with the present invention it is to be understood that nucleotides
or amino acids may differ in the indicated number but may still
have similar neighboring nucleotides or amino acids. Said
nucleotides or amino acids which may be exchanged, deleted or
comprise additional nucleotides or amino acids are also comprised
by the term "corresponding position". Said nucleotides or amino
acids may for instance together with their neighbors form sequences
which may be involved in the regulation of gene expression,
stability of the corresponding RNA or RNA editing, as well as
encode functional domains or motifs of the protein of the
invention.
[0022] By, e.g., "position 1271 to 1273" it is meant that said
polynucleotide comprises one or more deleted nucleotides which are
deleted between positions 1271 and position 1273 of the
corresponding wild type version of said polynucleotide. The same
applies mutatis mutandis to all other position numbers referred to
in the above embodiment which are drafted in the same format.
[0023] By, e.g., "position 180/181" it is meant that said
polynucleotide comprises one or more additional nucleotide(s) which
are inserted between positions 180 and position 181 of the
corresponding wild type version of said polynucleotide. The same
applies mutatis mutandis to all other position numbers referred to
in the above embodiment which are drafted in the same format, i.e.
two consecutive position numbers separated by a slash (/).
[0024] In accordance with the present invention, the mode and
population distribution of genetic variations in the CYP2C8 gene
has been analyzed by sequence analysis of relevant regions of the
human said gene from many different individuals. It is a well known
fact that genomic DNA of individuals, which harbor the individual
genetic makeup of all genes, including the CYP2C8 gene, can easily
be purified from individual blood samples. These individual DNA
samples are then used for the analysis of the sequence composition
of the alleles of the CYP2C8 gene that are present in the
individual which provided the blood sample. The sequence analysis
was carried out by PCR amplification of relevant regions of said
genes, subsequent purification of the PCR products, followed by
automated DNA sequencing with established methods (e.g. ABI dye
terminator cycle sequencing).
[0025] One important parameter that had to be considered in the
attempt to determine the individual genotypes and identify novel
variants of the CYP2C8 gene by direct DNA-sequencing of
PCR-products from human blood genomic DNA is the fact that each
human harbors (usually, with very few abnormal exceptions) two gene
copies of each autosomal gene (diploidy). Because of that, great
care had to be taken in the evaluation of the sequences to be able
to identify unambiguously not only homozygous sequence variations
but also heterozygous variations. The details of the different
steps in the identification and characterization of novel
polymorphisms in the CYP2C8 gene (homozygous and heterozygous) are
described in the examples below.
[0026] Over the past 20 years, genetic heterogeneity has been
increasingly recognized as a significant source of variation in
drug response. Many scientific communications (Meyer, Ann. Rev.
Pharmacol. Toxicol. 37 (1997), 269-296 and West, J. Clin.
Pharmacol. 37 (1997), 635-648) have clearly shown that some drugs
work better or may even be highly toxic in some patients than in
others and that these variations in patient's responses to drugs
can be related to molecular basis. This "pharmacogenomic" concept
spots correlations between responses to drugs and genetic profiles
of patient's (Marshall, Nature Biotechnology, 15 (1997), 954-957;
Marshall, Nature Biotechnology, 15 (1997), 1249-1252). In this
context of population variability with regard to drug therapy,
pharmacogenomics has been proposed as a tool useful in the
identification and selection of patients which can respond to a
particular drug without side effects. This identification/selection
can be based upon molecular diagnosis of genetic polymorphisms by
genotyping DNA from leukocytes in the blood of patient, for
example, and characterization of disease (Bertz, Clin.
Pharmacokinet. 32 (1997), 210-256; Engel, J. Chromatogra. B.
Biomed. Appl. 678 (1996), 93-103). For the founders of health care,
such as health maintenance organizations in the US and government
public health services in many European countries, this
pharmacogenomics approach can represent a way of both improving
health care and reducing overheads because there is a large cost to
unnecessary drugs, ineffective drugs and drugs with side
effects.
[0027] The mutations in the variant genes of the invention sometime
result in amino acid deletion(s), insertion(s) and in particular in
substitution(s) either alone or in combination. It is of course
also possible to genetically engineer such mutations in wild type
genes or other mutant forms. Methods for introducing such
modifications in the DNA sequence of said genes are well known to
the person skilled in the art; see, e.g., Sambrook, Molecular
Cloning A Laboratory Manual, Cold Spring Harbor Laboratory (1989)
N.Y.
[0028] For the investigation of the nature of the alterations in
the amino acid sequence of the polypeptides of the invention may be
used such as BRASMOL that are obtainable from the Internet.
Furthermore, folding simulations and computer redesign of
structural motifs can be performed using other appropriate computer
programs (Olszewski, Proteins 25 (1996), 286-299; Hoffman, Comput.
Appl. Biosci. 11 (1995), 675-679). Computers can be used for the
conformational and energetic analysis of detailed protein models
(Monge, J. Mol. Biol. 247 (1995), 995-1012; Renouf, Adv. Exp. Med.
Biol. 376 (1995), 37-45). These analysis can be used for the
identification of the influence of a particular mutation on
metabolizing, binding and/or transport of drugs.
[0029] Usually, said amino acid deletion, addition or substitution
in the amino acid sequence of the protein encoded by the
polynucleotide of the invention is due to one or more nucleotide
substitution, insertion or deletion, or any combinations thereof.
Preferably said nucleotide substitution, insertion or deletion may
result in an amino acid substitution of F to L at position
corresponding to position 263 of the CYP2C8 polypeptide (GenBank
accession No: GI: 13787189). The polypeptides encoded by the
polynucleotides of the invention have altered biological or
immunological properties due to the mutations referred to in
accordance with the present invention. Examples for said altered
properties are stability of the polypeptides which may be effected
or an altered substrate specificity or even a complete loss of the
capability of metabolizing certain drugs.
[0030] The mutations in the CYP2C8 gene detected in accordance with
the present invention are listed in Table 2. The methods of the
mutation analysis followed standard protocols and are described in
detail in the Examples. In general such methods are to be used in
accordance with the present invention for evaluating the phenotypic
spectrum as well as the overlapping clinical characteristics of
diseases or conditions related to dysfunctions or dysregulations
and diseases related to the poor or extensive metabolism (PM or EM)
certain drugs. Advantageously, the characterization of said mutants
may form the basis of the development of a diagnostic assay that is
able to predict a patients efficacy to metabolize a drug for
instance in anticancer treatment (taxol) or cardiovascular
deficiencies (verapamil). Said methods encompass for example
haplotype analysis, single-strand conformation polymorphism
analysis (SSCA), PCR and direct sequencing. On the basis of
thorough clinical characterization of many patients the phenotypes
can then be correlated to these mutations.
[0031] Also comprised by the polynucleotides referred to in the
present invention are polynucleotides which comprise at least two
of the polynucleotides specified herein above, i.e. polynucleotides
having a nucleotide sequence which contains all four mutations
comprised by the above polynucleotides or listed in Table 2 below
(haplotype: positions 831, 1397 to 1398 of GenBank accession No:
AF136830.1, position 270 of GenBank accession No: AF136833.1, and
position 206 of (GenBank accession No: AF136842.1). In accordance
with the present invention it is also preferred to detect only one
of the above mentioned polymorphisms of the haplotype, said one
polymorphism being indicative for the presence of the other
polymorphisms of the haplotype. Thus, in order to detect the
presence of the above mentioned haplotype it is sufficient to
determine the presence of any one of the polymorphisms comprised by
said haplotype. Moreover, the polynucleotides referred to above
allow the study of synergistic effects of said mutations in the
CYP2C8 gene and/or a polypeptide encoded by said polynucleotide on
the pharmacological profile of drugs in patients who bear such
mutant forms of the gene or similar mutant forms that can be
mimicked by the above described proteins. It is expected that the
analysis of said synergistic effects provides deeper insights into
the onset of CYP2C8 dysfunctions or dysregulations or diseases
related to altered drug transport as described supra. From said
deeper insight the development of diagnostic and pharmaceutical
compositions related to CYP2C8 dysfunctions or dysregulations or
diseases related to impaired drug metabolism will greatly
benefit.
[0032] As is evident to the person skilled in the art, the genetic
knowledge deduced from the present invention can now be used to
exactly and reliably characterize the genotype of a patient.
Advantageously, diseases or a prevalence for a disease which are
associated with CYP2C8 dysfunction or dysregulation, e.g. diseases
associated with arachidonic acid metabolism referred to herein can
be predicted and preventive or therapeutical measures can be
applied accordingly. Moreover in accordance with the foregoing, in
cases where a given drug takes an unusual effect, a suitable
individual therapy can be designed based on the knowledge of the
individual genetic makeup of a subject with respect to the
polynucleotides of the invention and improved therapeutics can be
developed as will be further discussed below.
[0033] In general, the CYP2C8 "status", defined by the expression
level and activity of the CYP2C8 protein, can be variable in normal
tissue, due to genetic variations/polymorphisms. The identification
of polymorphisms associated with altered CYP2C8 expression and/or
activity is important for the prediction of drug metabolism and
subsequently for the prediction of therapy outcome, including side
effects of medications. Therefore, analysis of CYP2C8 variations
indicative of CYP2C8 function, is a valuable tool for therapy with
drugs, which are substrates of CYP2C8 and has, thanks to the
present invention, now become possible.
[0034] In line with the foregoing, preferably, the polynucleotide
of the present invention is associated with an incompatibility or a
disease related to arachidonic acid metabolism, cancer or
cardiovascular diseases.
[0035] The term "cancer" used herein is very well known and
characterized in the art. Several variants of cancer exist and are
comprised by said term as meant in accordance with the invention.
For a detailed list of symptoms which are indicative for cancer it
is referred to text book knowledge, e.g. Pschyrembel. The term
"cardiovascular disease" as used herein refers to those diseases
known in the art and described in detail in standard text books,
such as Pschyrembel or Stadman. Examples for cardiovascular
diseases are hypertension or atherosclerosis. The inefficacy or
complete loss to epoxidate arachidonoic acid is referred to as
disease of the arachidonic acid metabolism.
[0036] In a further embodiment the present invention relates to a
polynucleotide which is DNA or RNA.
[0037] The polynucleotide of the invention may be, e.g., DNA, cDNA,
genomic DNA, RNA or synthetically produced DNA or RNA or a
recombinantly produced chimeric nucleic acid molecule comprising
any of those polynucleotides either alone or in combination.
Preferably said polynucleotide is part of a vector, particularly
plasmids, cosmids, viruses and bacteriophages used conventionally
in genetic engineering that comprise a polynucleotide of the
invention. Such vectors may comprise further genes such as marker
genes which allow for the selection of said vector in a suitable
host cell and under suitable conditions.
[0038] The invention furthermore relates to a gene comprising the
polynucleotide of the invention.
[0039] It is well known in the art that genes comprise structural
elements which encode an amino acid sequence as well as regulatory
elements which are involved in the regulation of the expression of
said genes. Structural elements are represented by exons which may
either encode an amino acid sequence or which may encode for RNA
which is not encoding an amino acid sequence but is nevertheless
involved in RNA function, e.g. by regulating the stability of the
RNA or the nuclear export of the RNA.
[0040] Regulatory elements of a gene may comprise promoter elements
or enhancer elements both of which could be involved in
transcriptional control of gene expression. It is very well known
in the art that a promoter is to be found upstream of the
structural elements of a gene. Regulatory elements such as enhancer
elements, however, can be found distributed over the entire locus
of a gene. Said elements could be reside, e.g., in introns, regions
of genomic DNA which separate the exons of a gene. Promoter or
enhancer elements correspond to polynucleotide fragments which are
capable of attracting or binding polypeptides involved in the
regulation of the gene comprising said promoter or enhancer
elements. For example, polypeptides involved in regulation of said
gene comprise the so called transcription factors.
[0041] Said introns may comprise further regulatory elements which
are required for proper gene expression. Introns are usually
transcribed together with the exons of a gene resulting in a
nascent RNA transcript which contains both, exon and intron
sequences. The intron encoded RNA sequences are usually removed by
a process known as RNA splicing. However, said process also
requires regulatory sequences present on a RNA transcript said
regulatory sequences may be encoded by the introns.
[0042] In addition, besides their function in transcriptional
control and control of proper RNA processing and/or stability,
regulatory elements of a gene could be also involved in the control
of genetic stability of a gene locus. Said elements control, e.g.,
recombination events or serve to maintain a certain structure of
the DNA or the arrangement of DNA in a chromosome.
[0043] Therefore, single nucleotide polymorphisms can occur in
exons of a gene which encode an amino acid sequence as discussed
supra as well as in regulatory regions which are involved in the
above discussed process. The analysis of the nucleotide sequence of
a gene locus in its entirety including, e.g., introns is in light
of the above desirable. The polymorphisms comprised by the
polynucleotides of the present invention can influence the
expression level of CYP2C8 protein via mechanisms involving
enhanced or reduced transcription of the CYP2C8 gene, stabilization
of the gene's RNA transcripts and alteration of the processing of
the primary RNA transcripts.
[0044] Therefore, in a furthermore preferred embodiment of the gene
of the invention a nucleotide deletion, addition and/or
substitution results in altered expression of the variant gene
compared to the corresponding wild type gene.
[0045] In another embodiment the present invention relates to a
vector comprising the polynucleotide of the invention or the gene
of the invention.
[0046] Said vector may be, for example, a phage, plasmid, viral or
retroviral vector. Retroviral vectors may be replication competent
or replication defective. In the latter case, viral propagation
generally will occur only in complementing host/cells.
[0047] The polynucleotides or genes of the invention may be joined
to a vector containing selectable markers for propagation in a
host. Generally, a plasmid vector is introduced in a precipitate
such as a calcium phosphate precipitate, or in a complex with a
charged lipid or in carbon-based clusters. Should the vector be a
virus, it may be packaged in vitro using an appropriate packaging
cell line prior to application to host cells.
[0048] In a more preferred embodiment of the vector of the
invention the polynucleotide is operatively linked to expression
control sequences allowing expression in prokaryotic or eukaryotic
cells or isolated fractions thereof.
[0049] Expression of said polynucleotide comprises transcription of
the polynucleotide, preferably into a translatable mRNA. Regulatory
elements ensuring expression in eukaryotic cells, preferably
mammalian cells, are well known to those skilled in the art. They
usually comprise regulatory sequences ensuring initiation of
transcription and optionally poly-A signals ensuring termination of
transcription and stabilization of the transcript. Additional
regulatory elements may include transcriptional as well as
translational enhancers. Possible regulatory elements permitting
expression in prokaryotic host cells comprise, e.g., the lac, trp
or tac promoter in E. coli, and examples for regulatory elements
permitting expression in eukaryotic host cells are the AOX1 or GAL1
promoter in yeast or the CMV-, SV40-, RSV-promoter (Rous sarcoma
virus), CMV-enhancer, SV40-enhancer or a globin intron in mammalian
and other animal cells. Beside elements which are responsible for
the initiation of transcription such regulatory elements may also
comprise transcription termination signals, such as the SV40-poly-A
site or the tk-poly-A site, downstream of the polynucleotide. In
this context, suitable expression vectors are known in the art such
as Okayama-Berg cDNA expression vector pcDV1 (Pharmacia), pCDM8,
pRc/CMV, pcDNA1, pcDNA3 (In-vitrogene), pSPORT1 (GIBCO BRL).
Preferably, said vector is an expression vector and/or a gene
transfer or targeting vector. Expression vectors derived from
viruses such as retroviruses, vaccinia virus, adeno-associated
virus, herpes viruses, or bovine papilloma virus, may be used for
delivery of the polynucleotides or vector of the invention into
targeted cell population. Methods which are well known to those
skilled in the art can be used to construct recombinant viral
vectors; see, for example, the techniques described in Sambrook,
Molecular Cloning A Laboratory Manual, Cold Spring Harbor
Laboratory (1989) N.Y. and Ausubel, Current Protocols in Molecular
Biology, Green Publishing Associates and Wiley Interscience, N.Y.
(1994). Alternatively, the polynucleotides and vectors of the
invention can be reconstituted into liposomes for delivery to
target cells.
[0050] The term "isolated fractions thereof" refers to fractions of
eukaryotic or prokaryotic cells or tissues which are capable of
transcribing or transcribing and translating RNA from the vector of
the invention. Said fractions comprise proteins which are required
for transcription of RNA or transcription of RNA and translation of
said RNA into a polypeptide. Said isolated fractions may be, e.g.,
nuclear and cytoplasmic fractions of eukaryotic cells such as of
reticulocytes.
[0051] The present invention furthermore relates to a host cell
genetically engineered with the polynucleotide of the invention,
the gene of the invention or the vector of the invention.
[0052] Said host cell may be a prokaryotic or eukaryotic cell; see
supra. The polynucleotide or vector of the invention which is
present in the host cell may either be integrated into the genome
of the host cell or it may be maintained extrachromosomally. In
this respect, it is also to be understood that the recombinant DNA
molecule of the invention can be used for "gene targeting" and/or
"gene replacement", for restoring a mutant gene or for creating a
mutant gene via homologous recombination; see for example Mouellic,
Proc. Natl. Acad. Sci. USA, 87 (1990), 4712-4716; Joyner, Gene
Targeting, A Practical Approach, Oxford University Press.
[0053] The host cell can be any prokaryotic or eukaryotic cell,
such as a bacterial, insect, fungal, plant, animal, mammalian or,
preferably, human cell. Preferred fungal cells are, for example,
those of the genus Saccharomyces, in particular those of the
species S. cerevisiae. The term "prokaryotic" is meant to include
all bacteria which can be transformed or transfected with a
polynucleotide for the expression of a variant polypeptide of the
invention. Prokaryotic hosts may include gram negative as well as
gram positive bacteria such as, for example, E. coli, S.
typhimurium, Serratia marcescens and Bacillus subtilis. A
polynucleotide coding for a mutant form of variant polypeptides of
the invention can be used to transform or transfect the host using
any of the techniques commonly known to those of ordinary skill in
the art. Methods for preparing fused, operably linked genes and
expressing them in bacteria or animal cells are well-known in the
art (Sambrook, supra). The genetic constructs and methods described
therein can be utilized for expression of variant polypeptides of
the invention in, e.g., prokaryotic hosts. In general, expression
vectors containing promoter sequences which facilitate the
efficient transcription of the inserted polynucleotide are used in
connection with the host. The expression vector typically contains
an origin of replication, a promoter, and a terminator, as well as
specific genes which are capable of providing phenotypic selection
of the transformed cells. The transformed prokaryotic hosts can be
grown in fermentors and cultured according to techniques known in
the art to achieve optimal cell growth. The proteins of the
invention can then be isolated from the grown medium, cellular
lysates, or cellular membrane fractions. The isolation and
purification of the microbially or otherwise expressed polypeptides
of the invention may be by any conventional means such as, for
example, preparative chromatographic separations and immunological
separations such as those involving the use of monoclonal or
polyclonal antibodies.
[0054] Thus, in a further embodiment the invention relates to a
method for producing a molecular variant CYP2C8 polypeptide or
fragment thereof comprising culturing the above described host
cell; and recovering said protein or fragment from the culture.
[0055] In another embodiment the present invention relates to a
method for producing cells capable of expressing a molecular
variant CYP2C8 polypeptide comprising genetically engineering cells
with the polynucleotide of the invention, the gene of the invention
or the vector of the invention.
[0056] The cells obtainable by the method of the invention can be
used, for example, to test drugs according to the methods described
in D. L. Spector, R. D. Goldman, L. A. Leinwand, Cells, a Lab
manual, CSH Press 1998. Furthermore, the cells can be used to study
known drugs and unknown derivatives thereof for their ability to
complement the deficiency caused by mutations in the CYP2C8 gene.
For these embodiments the host cells preferably lack a wild type
allele, preferably both alleles of the CYP2C8 gene and/or have at
least one mutated from thereof. Ideally, the gene comprising an
allele as comprised by the polynucleotides of the invention could
be introduced into the wild type locus by homologous replacement.
Alternatively, strong overexpression of a mutated allele over the
normal allele and comparison with a recombinant cell line
overexpressing the normal allele at a similar level may be used as
a screening and analysis system. The cells obtainable by the
above-described method may also be used for the screening methods
referred to herein below.
[0057] Furthermore, the invention relates to a polypeptide or
fragment thereof encoded by the polynucleotide of the invention,
the gene of the invention or obtainable by the method described
above or from cells produced by the method described above.
[0058] In this context it is also understood that the variant
polypeptide of the invention can be further modified by
conventional methods known in the art. By providing said variant
proteins according to the present invention it is also possible to
determine the portions relevant for their biological activity or
inhibition of the same. The terms "polypeptide" and "protein" as
used herein are exchangeable. Moreover, what is comprised by said
terms is standard textbook knowledge.
[0059] The present invention furthermore relates to an antibody
which binds specifically to the polypeptide of the invention.
[0060] Advantageously, the antibody specifically recognizes or
binds an epitope containing one or more amino acid substitution(s)
as defined above. Antibodies against the variant polypeptides of
the invention can be prepared by well known methods using a
purified protein according to the invention or a (synthetic)
fragment derived therefrom as an antigen. Monoclonal antibodies can
be prepared, for example, by the techniques as originally described
in Kohler and Milstein, Nature 256 (1975), 495, and Galfre, Meth.
Enzymol. 73 (1981), 3, which comprise the fusion of mouse myeloma
cells to spleen cells derived from immunized mammals. In a
preferred embodiment of the invention, said antibody is a
monoclonal antibody, a polyclonal antibody, a single chain
antibody, human or humanized antibody, primatized, chimerized or
fragment thereof that specifically binds said peptide or
polypeptide also including bispecific antibody, synthetic antibody,
antibody fragment, such as Fab, Fv or scFv fragments etc., or a
chemically modified derivative of any of these. Furthermore,
antibodies or fragments thereof to the aforementioned polypeptides
can be obtained by using methods which are described, e.g., in
Harlow and Lane "Antibodies, A Laboratory Manual", CSH Press, Cold
Spring Harbor, 1988. These antibodies can be used, for example, for
the immunoprecipitation and immunolocalization of the variant
polypeptides of the invention as well as for the monitoring of the
presence of said variant polypeptides, for example, in recombinant
organisms, and for the identification of compounds interacting with
the proteins according to the invention. For example, surface
plasmon resonance as employed in the BIAcore system can be used to
increase the efficiency of phage antibodies which bind to an
epitope of the protein of the invention (Schier, Human Antibodies
Hybridomas 7 (1996), 97-105; Malmborg, J. Immunol. Methods 183
(1995), 7-13).
[0061] In a preferred embodiment the antibody of the present
invention specifically recognizes an epitope containing one or more
amino acid substitution(s) resulting from a nucleotide exchange as
defined supra.
[0062] Antibodies which specifically recognize modified amino acids
such as phospho-Tyrosine residues are well known in the art.
Similarly, in accordance with the present invention antibodies
which specifically recognize even a single amino acid exchange in
an epitope may be generated by the well known methods described
supra.
[0063] In light of the foregoing, in a more preferred embodiment
the antibody of the present invention is monoclonal or
polyclonal.
[0064] The invention also relates to a transgenic non-human animal
comprising at least one polynucleotide of the invention, the gene
of the invention or the vector of the invention as described
supra.
[0065] The present invention also encompasses a method for the
production of a transgenic non-human animal comprising introduction
of a polynucleotide or vector of the invention into a germ cell, an
embryonic cell, stem cell or an egg or a cell derived therefrom.
The non-human animal can be used in accordance with the method of
the invention described below and may be a non-transgenic healthy
animal, or may have a disease or disorder, preferably a disease
caused by at least one mutation in the gene of the invention. Such
transgenic animals are well suited for, e.g., pharmacological
studies of drugs in connection with variant forms of the above
described variant polypeptides since these polypeptides or at least
their functional domains are conserved between species in higher
eukaryotes, particularly in mammals. Production of transgenic
embryos and screening of those can be performed, e.g., as described
by A. L. Joyner Ed., Gene Targeting, A Practical Approach (1993),
Oxford University Press. The DNA of the embryos can be analyzed
using, e.g., Southern blots with an appropriate probe or based on
PCR techniques.
[0066] A transgenic non-human animal in accordance with the
invention may be a transgenic mouse, rat, hamster, dog, monkey,
rabbit, pig, frog, nematode such as Caenorhabditis elegans,
fruitfly such as Drosophila melanogaster or fish such as torpedo
fish or zebrafish comprising a polynucleotide or vector of the
invention or obtained by the method described above, preferably
wherein said polynucleotide or vector is stably integrated into the
genome of said non-human animal, preferably such that the presence
of said polynucleotide or vector leads to the expression of the
variant polypeptide of the invention. It may comprise one or
several copies of the same or different polynucleotides or genes of
the invention. This animal has numerous utilities, including as a
research model for cardiovascular research and therefore, presents
a novel and valuable animal in the development of therapies,
treatment, etc. for diseases caused by cardiovascular diseases.
Accordingly, in this instance, the mammal is preferably a
laboratory animal such as a mouse or rat.
[0067] Thus, in a preferred embodiment the transgenic non-human
animal of the invention is a mouse, a rat or a zebrafish.
[0068] Numerous reports revealed that said animals are particularly
well suited as model organisms for the investigation of the drug
metabolism and its deficiencies or cancer. Advantageously,
transgenic animals can be easily created using said model
organisms, due to the availability of various suitable techniques
well known in the art.
[0069] The invention also relates to a solid support comprising one
or a plurality of the polynucleotide, the gene, the vector, the
polypeptide, the antibody or the host cell of the invention in
immobilized form.
[0070] The term "solid support" as used herein refers to a flexible
or non-flexible support that is suitable for carrying said
immobilized targets. Said solid support may be homogenous or
inhomogeneous. For example, said solid support may consist of
different materials having the same or different properties with
respect to flexibility and immobilization, for instance, or said
solid support may consist of one material exhibiting a plurality of
properties also comprising flexibility and immobilization
properties. Said solid support may comprise glass-, polypropylene-
or silicon-chips, membranes oligonucleotide-conjugated beads or
bead arrays.
[0071] The term "immobilized" means that the molecular species of
interest is fixed to a solid support, preferably covalently linked
thereto. This covalent linkage can be achieved by different means
depending on the molecular nature of the molecular species.
Moreover, the molecular species may be also fixed on the solid
support by electrostatic forces, hydrophobic or hydrophilic
interactions or Van-der-Waals forces. The above described
physico-chemical interactions typically occur in interactions
between molecules. For example, biotinylated polypeptides may be
fixed on a avidin-coated solid support due to interactions of the
above described types. Further, polypeptides such as antibodies,
may be fixed on an antibody coated solid support. Moreover, the
immobilization is dependent on the chemical properties of the solid
support. For example, the nucleic acid molecules can be immobilized
on a membrane by standard techniques such as UV-crosslinking or
heat.
[0072] In a preferred embodiment of the invention said solid
support is a membrane, a glass- or polypropylene- or silicon-chip,
are oligonucleotide-conjugated beads or a bead array, which is
assembled on an optical filter substrate.
[0073] Moreover, the present invention relates to an in vitro
method for identifying a polymorphism said method comprising the
steps of: [0074] (a) isolating a polynucleotide or the gene of the
invention from a plurality of subgroups of individuals, wherein one
subgroup has no prevalence for a CYP2C8 associated disease and at
least one or more further subgroup(s) do have prevalence for a
CYP2C8 associated disease; and [0075] (b) identifying a
polymorphism by comparing the nucleic acid sequence of said
polynucleotide or said gene of said one subgroup having no
prevalence for a CYP2C8 associated disease with said at least one
or more further subgroup(s) having a prevalence for a CYP2C8
associated disease.
[0076] The term "prevalence" as used herein means that individuals
are be susceptible for one or more disease(s) which are associated
with CYP2C8 dysfunction or dysregulation or could already have one
or more of said disease(s). Thereby, one CYP2C8 associated disease
can be used to determine the susceptibility for another CYP2C8
associated disease. Moreover, symptoms which are indicative for a
prevalence for developing of a disease are very well known in the
art and have been sufficiently described in standard textbooks such
as Pschyrembel.
[0077] Advantageously, polymorphisms according to the present
invention which are associated with CYP2C8 dysfunction or
dysregulation or one or more disease(s) based thereon should be
enriched in subgroups of individuals which have a prevalence for
said diseases versus subgroups which have no prevalence for said
diseases. Thus, the above described method allows the rapid and
reliable detection of polymorphism which are indicative for one or
more CYP2C8 associated disease(s) or a susceptibility therefor.
Advantageously, due to the phenotypic preselection a large number
of individuals having no prevalence might be screened for
polymorphisms in general. Thereby, a reference sequences comprising
polymorphisms which do not correlate to one or more CYP2C8
associated disease(s) can be obtained. Based on said reference
sequences it is possible to efficiently and reliably determine the
relevant polymorphisms.
[0078] In a further embodiment the present invention relates to a
method for identifying and obtaining a pro-drug or a drug capable
of modulating the activity of a molecular variant of a CYP2C8
polypeptide comprising the steps of: [0079] (a) contacting the
polypeptide, the solid support of the invention, a cell expressing
a molecular variant gene comprising a polynucleotide of the
invention, the gene or the vector of the invention in the presence
of components capable of providing a detectable signal in response
to drug activity with a compound to be screened for pro-drug or
drug activity; and [0080] (b) detecting the presence or absence of
a signal or increase or decrease of a signal generated from the
pro-drug or the drug activity, wherein the absence, presence,
increase or decrease of the signal is indicative for a putative
pro-drug or drug.
[0081] The term "compound" in a method of the invention includes a
single substance or a plurality of substances which may or may not
be identical.
[0082] Said compound(s) may be chemically synthesized or produced
via microbial fermentation but can also be comprised in, for
example, samples, e.g., cell extracts from, e.g., plants, animals
or microorganisms. Furthermore, said compounds may be known in the
art but hitherto not known to be useful as an inhibitor,
respectively. The plurality of compounds may be, e.g., added to the
culture medium or injected into a cell or non-human animal of the
invention.
[0083] If a sample containing (a) compound(s) is identified in the
method of the invention, then it is either possible to isolate the
compound from the original sample identified as containing the
compound, in question or one can further subdivide the original
sample, for example, if it consists of a plurality of different
compounds, so as to reduce the number of different substances per
sample and repeat the method with the subdivisions of the original
sample. It can then be determined whether said sample or compound
displays the desired properties, for example, by the methods
described herein or in the literature (Spector et al., Cells
manual; see supra). Depending on the complexity of the samples, the
steps described above can be performed several times, preferably
until the sample identified according to the method of the
invention only comprises a limited number of or only one
substance(s). Preferably said sample comprises substances of
similar chemical and/or physical properties, and most preferably
said substances are identical. The methods of the present invention
can be easily performed and designed by the person skilled in the
art, for example in accordance with other cell based assays
described in the prior art or by using and modifying the methods as
described herein. Furthermore, the person skilled in the art will
readily recognize which further compounds may be used in order to
perform the methods of the invention, for example, enzymes, if
necessary, that convert a certain compound into a precursor. Such
adaptation of the method of the invention is well within the skill
of the person skilled in the art and can be performed without undue
experimentation.
[0084] Compounds which can be used in accordance with the present
invention include peptides, proteins, nucleic acids, antibodies,
small organic compounds, ligands, peptidomimetics, PNAs and the
like. Said compounds may act as agonists or antagonists of the
invention. Said compounds can also be functional derivatives or
analogues of known drugs. Methods for the preparation of chemical
derivatives and analogues are well known to those skilled in the
art and are described in, for example, Beilstein, Handbook of
Organic Chemistry, Springer edition New York Inc., 175 Fifth
Avenue, New York, N.Y. 10010 U.S.A. and Organic Synthesis, Wiley,
New York, USA. Furthermore, said derivatives and analogues can be
tested for their effects according to methods known in the art or
as described. Furthermore, peptide mimetics and/or computer aided
design of appropriate drug derivatives and analogues can be used,
for example, according to the methods described below. Such analogs
comprise molecules that may have the basis structure of known
CYP2C8 substrates, inhibitors and/or modulators.
[0085] Appropriate computer programs can be used for the
identification of interactive sites of a putative inhibitor and the
polypeptides of the invention by computer assistant searches for
complementary structural motifs (Fassina, Immunomethods 5 (1994),
114-120). Further appropriate computer systems for the computer
aided design of protein and peptides are described in the prior
art, for example, in Berry, Biochem. Soc. Trans. 22 (1994),
1033-1036; Wodak, Ann. N.Y. Acad. Sci. 501 (1987), 1-13; Pabo,
Biochemistry 25 (1986), 5987-5991. The results obtained from the
above-described computer analysis can be used in combination with
the method of the invention for, e.g., optimizing known inhibitors,
analogs, antagonists or agonists. Appropriate peptidomimetics and
other inhibitors can also be identified by the synthesis of
peptidomimetic combinatorial libraries through successive chemical
modification and testing the resulting compounds, e.g., according
to the methods described herein. Methods for the generation and use
of peptidomimetic combinatorial libraries are described in the
prior art, for example in Ostresh, Methods in Enzymology 267
(1996), 220-234 and Dorner, Bioorg. Med. Chem. 4 (1996), 709-715.
Furthermore, the three-dimensional and/or crystallographic
structure of said compounds and the polypeptides of the invention
can be used for the design of peptidomimetic drugs (Rose,
Biochemistry 35 (1996), 12933-12944; Rutenber, Bioorg. Med. Chem. 4
(1996), 1545-1558). It is very well known how to obtain said
compounds, e.g. by chemical or biochemical standard techniques.
Thus, also comprised by the method of the invention are means of
making or producing said compounds. In summary, the present
invention provides methods for identifying and obtaining compounds
which can be used in specific doses for the treatment of specific
forms of CYP2C8 associated diseases.
[0086] The above definitions apply mutatis mutandis to all of the
methods described in the following.
[0087] In a further embodiment the present invention relates to a
method for identifying and obtaining an inhibitor of the activity
of a molecular variant of a CYP2C8 polypeptide comprising the steps
of: [0088] (a) contacting the protein, the solid support of the
invention or a cell expressing a molecular variant gene comprising
a polynucleotide or the gene or the vector of the invention in the
presence of components capable of providing a detectable signal in
response to drug activity with a compound to be screened for
inhibiting activity; and [0089] (b) detecting the presence or
absence of a signal or increase or decrease of a signal generated
from the inhibiting activity, wherein the absence or decrease of
the signal is indicative for a putative inhibitor.
[0090] In a preferred embodiment of the method of the invention
said cell is a cell, obtained by the method of the invention or can
be obtained from the transgenic non-human animal as described
supra.
[0091] In a still further embodiment the present invention relates
to a method of identifying and obtaining a pro-drug or drug capable
of modulating the activity of a molecular variant of a CYP2C8
polypeptide comprising the steps of: [0092] (a) contacting the host
cell, the cell obtained by the method of the invention, the
polypeptide or the solid support of the invention with the first
molecule known to be bound by a CYP2C8 polypeptide to form a first
complex of said polypeptide and said first molecule; [0093] (b)
contacting said first complex with a compound to be screened, and
[0094] (c) measuring whether said compound displaces said first
molecule from said first complex.
[0095] Advantageously, in said method said measuring step comprises
measuring the formation of a second complex of said protein and
said inhibitor candidate. Preferably, said measuring step comprises
measuring the amount of said first molecule that is not bound to
said protein.
[0096] In a particularly preferred embodiment of the
above-described method of said first molecule is a agonist or
antagonist or a substrate and/or a inhibitor and/or a modulator of
the polypeptide of the invention, e.g., with a radioactive or
fluorescent label.
[0097] In a still another embodiment the present invention relates
to a method of identifying and obtaining an inhibitor capable of
modulating the activity of a molecular variant of a CYP2C8
polypeptide comprising the steps of: [0098] (a) contacting the host
cell or the cell obtained by the method of the invention, the
protein or the solid support of the invention with the first
molecule known to be bound by the CYP2C8 polypeptide to form a
first complex of said protein and said first molecule; [0099] (b)
contacting said first complex with a compound to be screened, and
[0100] (c) measuring whether said compound displaces said first
molecule from said first complex.
[0101] In a preferred embodiment of the method of the invention
said measuring step comprises measuring the formation of a second
complex of said protein and said compound.
[0102] In another preferred embodiment of the method of the
invention said measuring step comprises measuring the amount of
said first molecule that is not bound to said protein.
[0103] In a more preferred embodiment of the method of the
invention said first molecule is labeled.
[0104] The invention furthermore relates to a method for the
production of a pharmaceutical composition comprising the steps of
the method as described supra; and the further step of formulating
the compound identified and obtained or a derivative thereof in a
pharmaceutically acceptable form.
[0105] The therapeutically useful compounds identified according to
the methods of the invention can be formulated and administered to
a patient as discussed above. For uses and therapeutic doses
determined to be appropriate by one skilled in the art and for
definitions of the term "pharmaceutical composition" see infra.
[0106] Furthermore, the present invention encompasses a method for
the preparation of a pharmaceutical composition comprising the
steps of the above-described methods; and formulating a drug or
pro-drug in the form suitable for therapeutic application and
preventing or ameliorating the disorder of the subject diagnosed in
the method of the invention.
[0107] Drugs or pro-drugs after their in vivo administration are
metabolized in order to be eliminated either by excretion or by
metabolism to one or more active or inactive metabolites (Meyer, J.
Pharmacokinet. Biopharm. 24 (1996), 449-459). Thus, rather than
using the actual compound or inhibitor identified and obtained in
accordance with the methods of the present invention a
corresponding formulation as a pro-drug can be used which is
converted into its active in the patient. Precautionary measures
that may be taken for the application of pro-drugs and drugs are
described in the literature; see, for review, Ozama, J. Toxicol.
Sci. 21 (1996), 323-329).
[0108] In a preferred embodiment of the method of the present
invention said drug or prodrug is a derivative of a medicament as
defined hereinafter.
[0109] The present invention also relates to a method of diagnosing
a disorder related to the presence of a molecular variant of the
CYP2C8 gene or susceptibility to such a disorder comprising
determining the presence of a polynucleotide or the gene of the
invention in a sample from a subject.
[0110] In accordance with this embodiment of the present invention,
the method of testing the status of a disorder or susceptibility to
such a disorder can be effected by using a polynucleotide gene or
nucleic acid of the invention, e.g., in the form of a Southern or
Northern blot or in situ analysis. Said nucleic acid sequence may
hybridize to a coding region of either of the genes or to a
non-coding region, e.g. intron. In the case that a complementary
sequence is employed in the method of the invention, said nucleic
acid molecule can again be used in Northern blots. Additionally,
said testing can be done in conjunction with an actual blocking,
e.g., of the transcription of the gene and thus is expected to have
therapeutic relevance. Furthermore, a primer or oligonucleotide can
also be used for hybridizing to one of the above mentioned CYP2C8
gene or corresponding mRNAs. The nucleic acids used for
hybridization can, of course, be conveniently labeled by
incorporating or attaching, e.g., a radioactive or other marker.
Such markers are well known in the art. The labeling of said
nucleic acid molecules can be effected by conventional methods.
[0111] Additionally, the presence or expression of variant CYP2C8
gene can be monitored by using a primer pair that specifically
hybridizes to either of the corresponding nucleic acid sequences
and by carrying out a PCR reaction according to standard
procedures. Specific hybridization of the above mentioned probes or
primers preferably occurs at stringent hybridization conditions.
The term "stringent hybridization conditions" is well known in the
art; see, for example, Sambrook et al., "Molecular Cloning, A
Laboratory Manual" second ed., CSH Press, Cold Spring Harbor, 1989;
"Nucleic Acid Hybridisation, A Practical Approach", Hames and
Higgins eds., IRL Press, Oxford, 1985. Furthermore, the mRNA, cRNA,
cDNA or genomic DNA obtained from the subject may be sequenced to
identify mutations which may be characteristic fingerprints of
mutations in the polynucleotide or the gene of the invention. The
present invention further comprises methods wherein such a
fingerprint may be generated by RFLPs of DNA or RNA obtained from
the subject, optionally the DNA or RNA may be amplified prior to
analysis, the methods of which are well known in the art. RNA
fingerprints may be performed by, for example, digesting an RNA
sample obtained from the subject with a suitable RNA-Enzyme, for
example RNase T.sub.1, RNase T.sub.2 or the like or a ribozyme and,
for example, electrophoretically separating and detecting the RNA
fragments as described above. Further modifications of the
above-mentioned embodiment of the invention can be easily devised
by the person skilled in the art, without any undue experimentation
from this disclosure; see, e.g., the examples. An additional
embodiment of the present invention relates to a method wherein
said determination is effected by employing an antibody of the
invention or fragment thereof. The antibody used in the method of
the invention may be labeled with detectable tags such as a
histidine flags or a biotin molecule.
[0112] The invention relates to a method of diagnosing a disorder
related to the presence of a molecular variant of a CYP2C8 gene or
susceptibility to such a disorder comprising determining the
presence of a polypeptide or the antibody of the invention in a
sample from a subject.
[0113] In a preferred embodiment of the above described method said
disorder is a cancer or cardiovascular disease.
[0114] In a preferred embodiment of the present invention, the
above described method is comprising PCR, ligase chain reaction,
restriction digestion, direct sequencing, nucleic acid
amplification techniques, hybridization techniques or immunoassays.
Said techniques are very well known in the art.
[0115] Moreover, the invention relates to a method of detection of
the polynucleotide or the gene of the invention in a sample
comprising the steps of [0116] (a) contacting the solid support
described supra with the sample under conditions allowing
interaction of the polynucleotide or the gene of the invention with
the immobilized targets on a solid support and; [0117] (b)
determining the binding of said polynucleotide or said gene to said
immobilized targets on a solid support.
[0118] The invention also relates to an in vitro method for
diagnosing a disease comprising the steps of the method described
supra, wherein binding of said polynucleotide or gene to said
immobilized targets on said solid support is indicative for the
presence or the absence of said disease or a prevalence for said
disease.
[0119] The invention furthermore relates to a diagnostic
composition comprising the polynucleotide, the gene, the vector,
the polypeptide or the antibody of the invention.
[0120] In addition, the invention relates to a pharmaceutical
composition comprising the polynucleotide, the gene, the vector,
the polypeptide or the antibody of the invention. These
pharmaceutical compositions comprising, e.g., the antibody may
conveniently be administered by any of the routes conventionally
used for drug administration, for instance, orally, topically,
parenterally or by inhalation. Acceptable salts comprise acetate,
methylester, HCl, sulfate, chloride and the like. The compounds may
be administered in conventional dosage forms prepared by combining
the drugs with standard pharmaceutical carriers according to
conventional procedures. These procedures may involve mixing,
granulating and compressing or dissolving the ingredients as
appropriate to the desired preparation. It will be appreciated that
the form and character of the pharmaceutically acceptable character
or diluent is dictated by the amount of active ingredient with
which it is to be combined, the route of administration and other
well-known variables. The carrier(s) must be "acceptable" in the
sense of being compatible with the other ingredients of the
formulation and not deleterious to the recipient thereof. The
pharmaceutical carrier employed may be, for example, either a solid
or liquid. Exemplary of solid carriers are lactose, terra alba,
sucrose, talc, gelatin, agar, pectin, acacia, magnesium stearate,
stearic acid and the like. Exemplary of liquid carriers are
phosphate buffered saline solution, syrup, oil such as peanut oil
and olive oil, water, emulsions, various types of wetting agents,
sterile solutions and the like. Similarly, the carrier or diluent
may include time delay material well known to the art, such as
glyceryl mono-stearate or glyceryl distearate alone or with a
wax.
[0121] The dosage regimen will be determined by the attending
physician and other clinical factors; preferably in accordance with
any one of the above described methods. As is well known in the
medical arts, dosages for any one patient depends upon many
factors, including the patient's size, body surface area, age, the
particular compound to be administered, sex, time and route of
administration, general health, and other drugs being administered
concurrently. Progress can be monitored by periodic assessment.
[0122] Furthermore, the use of pharmaceutical compositions which
comprise antisense-oligonucleotides which specifically hybridize to
RNA encoding mutated versions of the polynucleotide or gene
according to the invention or which comprise antibodies
specifically recognizing a mutated polypeptide of the invention but
not or not substantially the functional wild-type form is
conceivable in cases in which the concentration of the mutated form
in the cells should be reduced.
[0123] In another embodiment the present invention relates to the
use of the polynucleotide, the gene, the vector, the polypeptide,
the polynucleotides having at a position corresponding to position
270 (exon 3) and 206 (exon 8) (GenBank accession No: AF136833.1 and
AF136842.1, respectively) of the CYP2C8 gene (GenBank accession No:
GI: 13787189) an A instead of a G in position 270 and a G instead
of an A in position 206, or the antibody of the invention for the
preparation of a diagnostic composition for diagnosing a
disease.
[0124] Thanks to the present invention the particular drug
selection, dosage regimen and corresponding patients to be treated
can be determined in accordance with the present invention. The
dosing recommendations will be indicated in product labeling by
allowing the prescriber to anticipate dose adjustments depending on
the considered patient group, with information that avoids
prescribing the wrong drug to the wrong patients or at the wrong
dose.
[0125] In a further embodiment the present invention relates to the
use of the polynucleotide, the gene, the vector, the polypeptide,
the polynucleotides having at a position corresponding to position
117 in exon 5 (GenBank accession No: AF136837.1) of the CYP2C8 gene
(GenBank accession No: GI: 13787189) a T instead of an A, or the
antibody of the invention for the preparation of a pharmaceutical
composition for treating a disease.
[0126] In a more preferred embodiment of the use of the present
invention said disease is an incompatibility or disease related to
arachidonic acid metabolism, cancer or cardiovascular disease.
[0127] Finally, the present invention relates to a diagnostic kit
for detection of a single nucleotide polymorphism comprising the
polynucleotide, the gene, the vector, the polypeptide, the
antibody, the host cell, the transgenic non-human animal or the
solid support of the invention.
[0128] The kit of the invention may contain further ingredients
such as selection markers and components for selective media
suitable for the generation of transgenic cells and animals. The
kit of the invention can be used for carrying out a method of the
invention and could be, inter alia, employed in a variety of
applications, e.g., in the diagnostic field or as research tool.
The parts of the kit of the invention can be packaged individually
in vials or other appropriate means depending on the respective
ingredient or in combination in suitable containers or
multicontainer units. Manufacture of the kit follows preferably
standard procedures which are known to the person skilled in the
art. The kit may be used for methods for detecting expression of a
mutant form of the polypeptides, genes or polynucleotides in
accordance with any one of the above-described methods of the
invention, employing, for example, immunoassay techniques such as
radio-immunoassay or enzyme-immunoassay or preferably nucleic acid
hybridization and/or amplification techniques such as those
described herein before and in the Examples as well as
pharmacokinetic studies when using non-human transgenic animals of
the invention.
[0129] The figures illustrate the invention:
[0130] FIG. 1
[0131] Correlation of the SNP C104G (Exon 5, 1264M) with reduced
protein levels of CYP2C8. Expression levels of 14 individuals were
determined by Western Blot analysis and LC-MS using verapamil as
specific substrate. The boxplots show the distribution of samples
according to the genotype at amino acid position 264. The
genotype-phenotype correlation is significant (p=0.037, N=14).
[0132] FIG. 2
[0133] Correlation of the SNP -370 relative to the start codon ATG
with increased expression levels as detected by western blotting,
using the drug taxol (paclitaxel) as specific substrate. As shown
in the boxplots the genotype-phenotype correlation is significant
between homozygous wild type and heterozygous mutant samples
(p=0.044, N=20). (One homozygous sample was analyzed and yielded
expression levels >400).
[0134] FIG. 3
[0135] Correlation of the SNP at position -370 in the untranslated
region based on deviates from mean values of CYP2C8 expression
levels from two independent sample collectives (N=62). The
phenotype of the patients was determined by LC/MS and Western Blot.
The phenotype-genotype correlation is significant as shown in the
boxplots (p=0.017 for homozygous vs wildtype and p=0.071 for
heterozygous vs wildtype).
[0136] FIG. 4
[0137] Correlation of the allele including the linked SNPs G-1207A,
delAT-640/41 (both in the promoter), G270A (exon 3), and A206G
(exon 8) with a poor metabolizer phenotype (PM). However, no
homozygous individuals for this allele could yet be phenotyped. The
data shown in the box plot do only show a trend (p=0.071; N=18) but
no significance.
[0138] FIG. 5
[0139] Transfection of LS174T cells with either a CYP2C8 wild type
promoter construct or two SNP(s) containing promoter fragments
(G-1207A and -640 to 641delAT or T-370G). Using the eukaryotic pGL3
expression vector mean values of six independent transfection
assays were analysed following normalisation of 2C8 wild type
activity to 100%.
[0140] FIG. 6
[0141] Computer modeled CYP2C8 enzyme structure of the protein
variants Thr 159 Pro (frameshift), Glu 274 Stop and Gly 365 Ser.
Dark grey represents the unchanged structure of the variant
protein, the light grey prepresents the missing amino acids of the
CYP2C8 variant structure. The circle indicates the active site of
the enzyme with the altered amino acid Gly 365 Ser in dark.
[0142] FIG. 7
[0143] Reference or wild type GenBank sequences for the
polynucleotides, polypeptide and mRNA according to the present
invention
[0144] The invention will now be described by reference to the
following biological Examples which are merely illustrative and are
not constructed as a limitation of the scope of the present
invention.
EXAMPLES
Example 1
Isolation of Genomic DNA from Human Blood, Generation and
Purification of CYP2C8 Gene Fragments
[0145] Genomic DNA was obtained by standard ion exchange
chromatography techniques (Qiagen kits for isolation of genomic DNA
from blood). Blood from all the individuals tested (volunteers from
Parexel, Berlin and the Institute for Clinical Pharmacology,
Stuttgart) was obtained under consideration of all legal, medical
and bureaucratical requirements. Further samples from other ethnic
populations (e.g. Caucasian, Japanese, African-American) were
purchased from commercial sources.
[0146] By using polymerase chain reaction (PCR) with specific
oligonucleotide primers, two for each fragment, defined
DNA-fragments containing specific parts of the human CYP2C8 gene
were obtained. These specific oligonucleotide primers were designed
to bind to sequences upstream and downstream of the various exons
as well as in the 5 prime region of the CYP2C8 gene. The resulting
DNA fragments did not contain codogenic parts alone but also
sequences covering the intronic parts located at the exon-intron
boundaries. These sites are known to be important for correct
processing and subsequent expression of the protein encoding mRNA,
a process called "splicing". Commercially synthesized
oligonucleotide primer pairs that were purified by affinity
chromatography were optimized for each of the 9 exon and 4 promoter
fragments of the human CYP2C8 gene. The sequences for each primer
are listed in table 1.
[0147] Polymerase chain reactions were performed under conditions
that were optimized for each of the nine fragments and a promoter
region covering about 2 kb upstream of the initiation codon for
mRNA translation. PCRs were carried out for all exons in a volume
of 50 .mu.l. 10-50 ng of template DNA were added to standard
PCR-buffer containing 1.5 mM MgCl.sub.2, 200 .mu.M dNTPs and 1 U
Taq-polymerase (all from Qiagen, Hilden) as well as 10-40 pMol of
primers (MWG Biotech, Munich). All PCR reactions were performed on
identical conditions at a Perkin Elmer thermocycler (Modell 9700)
with an initial denaturation step of 94.degree. C. for 2 min,
followed by 34 cycles for PCR-fragment generation with 45 s
denaturation at 94.degree. C., 45 s of annealing at 62.degree. C.
and 1 min at 72.degree. C. for elongation. The exact location of
the primers and size of the desired fragments are also listed in
table 1.
[0148] The defined DNA fragments containing specific parts of the
CYP2C8 gene, exon as well as some intron sequences at the
inton-exon boundaries were processed to remove nonincorporated
nucleotides and buffer components that might otherwise interfere
with the subsequent determination of the individual CYP2C8 genotype
by direct cycle sequencing. For this purification, standard ion
exchange chromatography techniques were used (Qiagen kits for
PCR-fragment purification). For all fragments sufficient yields of
purified fragments, suitable for direct DNA sequencing analysis
were obtained. Aliquots of purified fragments were subjected to
direct sequence analysis of the CYP2C8 gene in an ABI 3700
capillary sequencer.
Example 2
Identification of Different CYP2C8 Alleles by Sequence
Determination in Various Individuals
[0149] For sequence analysis of relevant regions of the human
CYP2C8 gene from many different individuals, PCR amplifications of
the relevant regions of the gene were carried out (pimers see table
1) following purification of the PCR products and sequencing with
established methods (ABI dye terminator cycle sequencing). Since
the individual genetic makeup is represented by two copies of any
gene (diploidy), great care has to be taken in the evaluation of
the sequences not to unambiguously identify homozygous, but also
heterozygous sequence variation. Therefore, in cases where no clear
discrimination could be detected, forward and reverse sequencing
was performed. Moreover, for the discovery of complete and defined
alleles, e.g. in linkage equilibrium, it is necessary to cover all
exons as well as the promoter region to provide a comprehensive
basis for the phenotype prediction of individual SNPs.
[0150] For the evaluation of CYP2C8 variations in the human
population, sequence analyses of the relevant regions, including a
2 kb promoter fragment and all exons of the gene were carried out
from genomic DNA of each 48 Caucasian, Japanese and
African-American individuals. The sequences were subjected to a
computer analysis programme (Phredphrap.TM., Perkin Elmer) and
inspected manually for the occurrence of DNA sequences deviating
from recently published CYP2C8 sequences that were considered to
represent the "wild type" sequences in this work.
[0151] Because population genetics enables a calculation of the
expected frequency of homozygous vs. heterozygous alleles of a
defined gene (Hardy Weinberg formula: 2p e2+2pq+2q e2=1), it was
possible to confirm predicted distributions of homozygous vs.
heterozygous alleles and deviations from the experimental findings.
This serves as experimental control that a detected sequence
variation indeed represents a novel allele.
[0152] Several new CYP2C8 sequence variations were discovered and
experimentally confirmed using this approach which are shown in
table 2. 18 polymorphisms are located in the 5' untranslated
region/promoter of the gene (GenBank accession No: AF136830.1). 22
new polymorphisms could be found in sequences of introns 1, 2, 3, 4
and 8 (GenBank accession Nos: AF136832.1, AF136833.1, AF136835.1
AF136843.1 and AF136844.1) and one in the 3' untranslated region of
the gene (GenBank accession No: AF136845.1).
[0153] Furthermore, three particular nucleotide changes in exon 3
(position 334 at exon/intron boundary, GenBank accession No:
163833.1) and exon 8 (position 30 and 87, GenBank accession No:
AF136843.1) were detected that do not change the amino acid
sequence. In exon 3 (position 329, GenBank accession No:
AF136833.1), exon 4 (position 243, GenBank accession No: AF136842.2
and position 13 of GenBank accession No: AF136835.1), exon 5
(position 42, 101 and 104, GenBank accession No: AF136837.1), exon
6 (position 309, GenBank accession No: AF136838.1) and 7 (position
1135, GenBank accession No: NM.sub.--000770.1 and position 232,
GenBank accession No: AF136840.1) nine SNPs could be identified
that change the protein sequence as shown in table 4, where the
deviative amino acid is typed in a bold style. These novel, and
already published CYP2C8 SNPs serve as markers for the
characterization of the CYP2C8 status in patients.
[0154] The positions of the novel CYP2C8 SNPs, including the exact
novel sequence context are listed in table 2. The deviative base in
the sequence is typed underlined and in a bold style.
Example 3
Determination of the CYP2C8 Promoter Allele Containing G-1207A,
delAT-640 to -641 as a Pharmacogenetic Factor Influencing Drug
Levels
[0155] The anticancer drug taxol (paclitaxel) can be considered to
be the prototype for CYP2C8 and it's isoform 6-hydroxypaclitaxel as
diagnostic substrate. Furthermore, verapamil represents another
specific substrate for CYP2C8 that is methylated to different
metabolites, e.g D-702 and D-703 or desalkylated to D-617 (i.e. a
substrate of CYP3A4). The generation of a specific metabolite used
to selectively proof the functional activity of CYP2C8 (LC-MS) is
shown in FIG. 4. In parallel, the amount of enzyme is determined by
western blotting (see example 9).
[0156] To validate a possible correlation of the single nucleotide
polymorphisms G-1207A, delAT-640 to -641, and/or T-370G (all
5'UTR/Promoter) and/or C104G (exon 5) with a certain phenotype,
biopsies from patients of two different studies were analyzed. The
functional characterization of the CYP2C8 gene had been determined
from enterocyte preparations of the duodenum and the liver.
[0157] Using these analytical tools, phenotypically characterized
samples that have been treated with taxol (N=22) or verapamil
(N=15, 44) were subjected to genotyping. Either of the collectives
showed that two SNPs G-1207A, delAT-640 to -641 of the 5'
untranslated region are in linkage disequilibrium and, in
combination with SNPs G270A (exon 3) and A206G (exon 8), represent
a new allele (haplotype) that is mainly defined by the presence of
the two novel promoter SNPs G-1207A and delAT-640 to -641. FIG. 4
shows that this allele is responsible for the reduced level of
metabolized substrate.
Example 4
Functional Consequences of the Identification of CYP2C8 Promoter
Polymorphisms
[0158] The eukaryotic promoter region of a gene is composed of
several regulatory elements, e.g enhancer, silencer and other
responsive elements. Here, single nucleotide polymorphisms exhibit
significant influence. Regarding cytochrome P450-enzymes induction
mechanisms, e.g. transcription factors like C/EBP, HPFs or
barbiebox-sites identified in CYP2C9 (Klose, J Biochem Mol Toxicol
13 (1999), 289-95) are important since temporary expression is
required. SNPs change or interfere with such elements and can alter
promoter action and/or transcription activity. The novel SNP
identified at position -1207 most probably abolishes transcription
factor binding that has selectively been shown for the binding of
tissue specific sterol regulatory element binding protein 1
(SREBP-1, Vallett, J Biol. Chem. 271 (1996), 12247-53). Reduced
expression has been shown if position -1207 does not correspond to
the wild type. The correlation of this new allele with CYP2C8
enzyme activity is displayed in FIG. 4. The linkage with another
unidentified SNPs further downstream in the promoter region of
CYP2C8 (delAT-640 to -641) confers new value to the allele in
respect to diagnostic applications.
Example 5
Determination of the CYP2C8 Promoter Polymorphism T-370G as a
Pharmacogenetic Factor Influencing Drug Levels
[0159] Another polymorphism located further downstream at position
1668 in the 5-prime untranslated region (position -370 relative to
the ATG-start codon) could be identified to significantly increase
the expression level as shown in FIG. 3. This allele refers to as
an extensive metabolizing phenotype (EM) that was confirmed by
investigation of phenotypically characterized samples. In several
cases, single nucleotide polymorphisms G-1207A, delAT-640 to -641
occur in combination with T-370G. LC-MS results from these samples
show that individuals carrying the T-370G alone have an increased
CYP2C8-activity as compared to those heterozygous for the
polymorphisms G-1207A, delAT-640 to -641 allele. Concerning the
application in a diagnostic assay these data clearly show the
influence of position T-370G on the expression levels of CYP2C8,
i.e. the latter SNP is responsible for a change from poor (PM) to
intermediate/extensive metabolism (IM/EM) as demonstrated in
example 9/table 6.
[0160] Independently, a further validation was carried out by
genotyping 22 samples corresponding to individual liver extracts,
in which the metabolism of taxol was assessed. The data confirm
results as presented in examples 8 and 9. FIG. 2 shows the
significant correlation between a heterogeneous polymorphism at
position -370G and the increase of CYP2C8 protein levels. The liver
extract from a sample homogeneous for position -370 displayed the
highest CYP2C8-protein level (>400 pmol/mg protein). This is an
additional independent result that supports the significant
correlation in FIG. 2.
Example 6
Determination of the CYP2C8 Polymorphism at Amino Acid Position 264
(exon 5) as a Pharmacogenetic Factor Influencing Drug Levels
[0161] In another embodiment the present invention relates to a
polymorphism in exon 5 at position C104G (GenBank accession No:
AF136837.1). This change correlates with a reduced protein
concentration analyzed from genotyped samples (FIG. 1) that could
be due to less stable mRNA or protein. The polypeptides encoded by
the polynucleotides of the invention may have altered biological or
immunological properties due to the polymorphisms referred to in
accordance with the present invention. Examples for said altered
properties are stability of the polypeptides which may be effected
or the incapability to effectively metabolize certain drugs.
Example 7
Using Restriction Fragment Length Polymorphism (RFLP) Analysis to
Detect SNPs Relevant in Phenotypic Prediction
[0162] CYP2C8-polymorphisms can be detected not only by sequencing
but also by various other means. As one alternative to the
sequencing methodology, genotyping can be performed with PCR
fragments to be processed by one restriction endonuclease
specificially cutting at a region, composed of a unique sequence of
4-6 nucleotides. Due to the limited length of a PCR-fragment
sometimes advantage can be taken of this specificity if it
discriminates mutant and wild type, i.e. resulting in digested or
un digested fragments (Table 5). Regarding the present invention
this was the case for fragments of the promoter region 4 (position
-370, double cutter AcsI for wild type and single cutter in the
mutant), that indicates the respective allele, exon 3 (position
275, single cutter Sapl for CYP2C8-mutant), and exon 5 (position
104, single cutter ClaI for wild type). Depending of the fragments'
specific SNP-region the restriction pattern unambiguously reflects
either the wild type, the heterozygous or homozygous mutant. As
defined by the primers listed in table 1, the exons screened for
result in the following RFLP-fragments:
TABLE-US-00001 TABLE 5 Length SNP position (bp) Genotype
(PCR-fragment) Enzyme uncut wt/wt (bp) wt/mut (bp) mut/mut (bp) #
-370, (5'UTR) Acs1 483 33/150/300 33/150/183/300 183/300 # 270,
(exon 3) SapI 328 328 149/179/328 149/179 # 104, (exon 5) ClaI 584
192/392 192/392/584 584
Example 7
Identification of New CYP2C8 Polymorphisms by Sequence Analysis of
a Collection of Various Individuals from Different Ethnic
Groups
[0163] The screen for SNPs in the CYP2C8 gene in the genomes of
different ethnic groups yielded a number of polymorphisms listed in
table 2. 48 samples were analyzed from each of the ethnic
populations Caucasian, Japanese and African-American, respectively.
Within this collection, the large number of SNPs in the
untranslated region could be considered to potentially influence
the protein level.
[0164] Furthermore, several polymorphisms show extensive inter
ethnical discrepancies (Table 3) between various ethnical groups.
The 57 new polymorphisms identified in the CYP2C8 gene will
complement the existing knowledge and contribute to a more
comprehensive understanding of the gene, avoiding problems in drug
response and, concerning other ethnical groups, thus facilitating
"bridging studies" that could be of interest when projecting data
from these embodiment.
Example 8
Characterization of Promoter SNPs by Transfection of
Promoter-Reporter Plasmids into Human Cells
[0165] Three promoter SNPs were tested for their contribution to
different expression levels by transfection assays using the LS174T
cell line. Promoter fragments containing the wild type or the SNPs
at positions corresponding to positions G-1207A and delAT-640 to
-641 (GenBank accession No: AF136830.1) or at position
corresponding to position T-370G (GenBank accession No: AF136830.1)
were introduced into a commercial mammalian expression vector. The
plasmid harbours standard sequences for the propagation in
eukaryotic cells including the reporter gene luciferase that is
controlled by the integrated promoter sequence. Following sequence
verification of each DNA-insert, cells were cotransfected with
.beta.-galactosidase, harvested after 48 h and analysed for
luciferase activity. Promoter activities (%) are shown in FIG. 5
following normalization to the transfection efficacy as determined
by .beta.-galactosidase detection. The data are in full agreement
with the observations from phenotypically characterized samples. A
DNA-construct that contains the 1207G>A and -640 to -641 delAT
polymorphisms (FIG. 5) showed decreased transcription for the
CYP2C8-promoter levels compared to the wild type. In contast, the
reporter plasmid revealed increasing levels of luciferase protein
under control of a CYP2C8-promoter containing a polymorphism
corresponding to position -370.
Example 9
Protein Quantification of Samples Containing SNPs at Promoter
Position G-1207A, delAT-640 to -641, T-370G and C104G (Exon 5,
Amino Acid Position 264) of CYP2C8
[0166] Protein extracts have been prepared from human liver
samples. The protein levels of CYP2C8 were analysed by western blot
using samples genotyped for SNPs G-1207A, delAT-640 to -641, T-370G
(all GenBank accession No: AF136830.1) and C104G (GenBank accession
No: AF136837.1). Table 5 shows the effects of different genotypes
on the expression levels of CYP2C8 (pmol/mg) normalized for the
wild type (=100%). Results are in total agreement with the
functional data described by the promoter-reporter assays in
example 8. The promoter SNP in position T-370G confers to increased
levels of the CYP2C8 protein (150%), whereas polymorphisms G-1207A
and delAT-640 to -641 in contrast show a reduced protein expression
(72%). In combination with SNPs G-1207A and delAT-640 to -641, or
C104G alone the polymorphism T-370G differentially influences
protein levels as indicated by arrow. Here, the presence of two
SNPs with significant frequency leads to combined effects.
Therefore, considerations for reliable phenotype prediction as a
result from genotyping must depend on multiple SNP-analyses. The
data indicate that the SNP in position -370, which by itsself is
responsible for up regulation of the CYP2C8-protein level, shows no
significant CYP2C8 increase if it is combined with SNPs G-1207A and
delAT-640 to -641 (5'UTR), which by themselves reduce the
expression. The combined expression level of 119% is barely higher
than in the homozygous wildtype situation. Vice versa, in
combination with the C104G allele (exon 5) the increased expression
due to the SNP at position -370 is compensated by the SNP C104G to
normal expression levels (97%) compared to the wild type. This
reflects the strong impact of SNP C104G alone on the protein level
(see FIG. 1). The SNP C104G therefore represents an allele for down
regulation.
TABLE-US-00002 TABLE 6 Genotype (by detection of listed SNPs) CYP
2C8-levels (%) Effects Wild type 100 No G-1207A, delAT -640 to -641
(5'UTR) 72 .dwnarw. T-370G (5'UTR) 150 .uparw. G-1207A, delAT -640
to -641 and 119 .uparw. .dwnarw. T-370G (5'UTR) T-370G (5'UTR) and
aa I264M (exon 5) 97 .uparw. .dwnarw. No sample with aa change
I264M or G-1207A, delAT -640 to -641 (5'UTR) and I264M was
detected.
Example 10
Pharmacogenetic Relevance of the CYP2C8 Polymorphisms at Position
329 (Exon 3, Thr 159 Pro), 309 (Exon 6, Glu 274 Stop) and 1135
(Exon 7, Gly 365 Ser)
[0167] In another embodiment the present invention relates to a
polymorphisms in exon 3, exon 6 and 7 at positions 329 (GenBank
accession No: AF136833.1), 309 (GenBank accession No: AF136838.1)
rand 1135 (GenBank accession No: NM.sub.--000770.1) respectively.
The delA change in position 329 causes a frameshift abolishing the
C-terminal part of the protein. The G309T change in position 309
results in a premature termination at amino acid position 274 of
the protein. Both variant transcripts encode for polypeptides that
will loose their function and are therefore most likely poor
metabolizer alleles (FIG. 6). In another embodiment the present
invention relates to a polymorphism at position G1135A in exon 7
(GenBank accession No: NM.sub.--000770.1). This substitution
results in a change from Glycin to Serin at position 365 within the
active site of the CYP2C8 enzyme (FIG. 6). Because the active site
of wildtype CYP2C8 contains hydrophobic amino acids to enable the
hydrophilic substrate to efficiently enter the substrate pocket,
this amino acid exchange to a hydrophilic residue will severely
interfere with substrate binding and subsequent metabolism.
TABLE-US-00003 TABLE 1 Primer sequences for the generation of
CYP2C8 PCR-fragments All primer locations refer to different
contigs of HTGS-Database, GenBank Acc. No. AL359672.10
PCR-fragments at the 5'UTR are overlapping. PCR- PCR-fragment
fragm. Contig spec. name size (bp) exon location Primer position
Primer Sequence (5'-3') Contig 115244-120972 (5629 bp) 5'UTR Fragm.
1 537 534 120439-120416 forward: ATT TTA GTC AAT CTT GGT GGC CCG
119902-119926 reverse: TTC AAC AGA AGA TGG AAC ACA GGG A 5'UTR
Fragm. 2 545 120004-119980 forward: TCA TGA CCA TTG ACT ATC AGT TCC
C 119460-119483 reverse: TGA TAC CCA TTG GGG TTC ATT ACC 5'UTR
Fragm. 3 751 119576-119552 forward: AAC AGA GTC AAG GTG GCG TAT CTT
C 118826-118854 reverse: CAA TAT TCT CAG ATT AAT GAC CAG TTG GG
Sequencing primer 118938-118963 AGA CTT AGC CCT TGA TAA CAA AAG CC
5'UTR Fragm. 4 483 -2486 119008-118982 forward: GTT TAG GCA GCT GTA
TTT TAA GTG AAC 118526-118550 reverse: ACT CCA AAG TTT TTA TAA CAC
TCC C Exon 1 472 2487-2654 118687-118664 forward: GGC ACT GGA AAG
AAG GAG TAG GAC 118216-118242 reverse: GAT CTA TTA TAA TAG TGT GCT
TCC AGG Exon 2 457 4198-4360 116999-116978 forward: TTG TGT ACC AAT
TGC CTG GGT C 116543-116566 reverse: TTT TTA GGG CTC TGT TTT CCA
TCC Exon 3 328 4532-4681 116531-116508 forward: GAG CTT AGC CTA TCT
GCA TGG CTG 116204-116223 reverse: ACC TGG CCA CCC CTG AAA TG
Contig 78619-85206 (6588 bp) Exon 4 541 1378-1538 83947-83970
forward: TCC ATG CTG ATT TTT TTT GGA CAC Alternative AF136834.2
44-67 83429-83450 reverse: CTG ACC CCT TGC ACT TCT GAT G Contig
138518-143654 (5137 bp) Exon 5 583 1319-1495 139593-139617 forward:
TGA CGA GTT ATT GGG TGC AGT ACA C 140176-140154 reverse: TTC CAT
GAT GTT TAG TGC AGG CC Contig 85307-115243 (29937 bp) Exon 6 519
8875-9016 93884-93903 forward: TTG AAG TAA GAC AGG GCA TCG G
94402-93379 reverse: AGA AAC AAG GTG GAG GAT ACT GGC Exon 7 328
11749-11936 96986-97009 forward: GGC CAT GAA TTG CTA TGA CAA ATG
97313-97290 reverse: GGT TGG AAC CAA ACC AGC ACT ATG Exon 8 462
15788-15929 100976-100997 forward: CTG GCT GGA CCT GAG TTT CCT C
101437-101418 reverse: TTA ACT CCT GCA AGC CCC GC Exon 9/3'UTR 543
17526-17707 102630-102652 forward: GTA CAT TTG TTT GTC CCA CCA TCC
103172-103149 reverse: TGC AGT GAC CTG AAC AAC TCT CCT
TABLE-US-00004 TABLE 2 SNPs identified in the CYP2C8 gene variant
PCR- position fragm GenBank (relative wild type/mutant (f)
mutant/mutant (f) Location Acc.No to ATG) wild type (f) and (r) and
(r) and (r) 5' UTR- AF136830.1 #306 f: GATGTGATGAGTGTGAAAAT f:
GATGTGATG(AG)TGTGAAAAT f: GATGTGATGTGTGAAAAT fragm 1 to 307 (=
-1731 r: ATTTTCACACTCATCACATC r: ATTTTCACA(CT)CATCACATC r:
ATTTTCACACATCACATC to -1732) 5'UTR- AF136830.1 #411 f:
GGAAATAACTGTACTGGTC f: GGAAATAACT/AGTACTGGTC f: GGAAATAACAGTACTGGTC
fragm 1 (= -1627) r: GACCAGTACAGTTATTTCC r: GACCAGTACA/TGTTATTTCC
r: GACCAGTACTGTTATTTCC 5'UTR- AF136830.1 #560 f:
GGTCTGCACATTGCAGTGG f: GGTCTGCACA/GTTGCAGTGG f: GGTCTGCACGTTGCAGTGG
fragm 1 (= -1478) r: CCACTGCAATGTGCAGACC r: CCACTGCAAC/TGTGCAGACC
r: CCACTGCAACGTGCAGACC 5'UTR- AF136830.1 #713 f:
AAAACAATAGAAGCAGCCA f: AAAACAATAG/TAAGCAGCCA f: AAAACAATATAAGCAGCCA
fragm 2 (= -1325) r: TGGCTGCTTCTATTGTTTT r: TGGCTGCTTA/CTATTGTTTT
r: TGGCTGCTTATATTGTTTT 5'UTR- AF136830.1 #817 f:
AGTGCTGAACAACTTTCAC f: AGTGCTGAAC/AAACTTTCAC f: AGTGCTGAAAAACTTTCAC
fragm 2 (= -1221) r: GTGAAAGTTGTTCAGCACT r: GTGAAAGTTT/GTTCAGCACT
r: GTGAAAGTTTTTCAGCACT 5'UTR- AF136830.1 #824 f:
AACAACTTTCACTTGTGAG f: AACAACTTTC/AACTTGTGAG f: AACAACTTTAACTTGTGAG
fragm 2 (= -1214) r: CTCACAAGTGAAAGTTGTT r: CTCACAAGTT/GAAAGTTGTT
r: CTCACAAGTTAAAGTTGTT 5'UTR- AF136830.1 #831 f:
TTCACTTGTGAGGTGATGC f: TTCACTTGTG/AAGGTGATGC f: TTCACTTGTAAGGTGATGC
fragm 2 (= -1207) r: GCATCACCTCACAAGTGAA r: GCATCACCTT/CACAAGTGAA
r: GCATCACCTTACAAGTGAA 5'UTR- AF136830.1 #879 f:
CTTTTGAGCGTCTCCGGTC f: CTTTTGAGCG/ATCTCCGGTC f: CTTTTGAGCATCTCCGGTC
fragm 2 (= -1159) r: GACCGGAGACGCTCAAAAG r: GACCGGAGAT/CGCTCAAAAG
r: GACCGGAGATGCTCAAAAG 5'UTR- AF136830.1 886 f: GCGTCTCCGGTCCTCTTAT
f: GCGTCTCCGG/TTCCTCTTAT f: GCGTCTCCGTTCCTCTTAT fragm 2 (= -1152)
r: ATAAGAGGACCGGAGACGC r: ATAAGAGGAA/CCGGAGACGC r:
ATAAGAGGAACGGAGACGC 5'UTR- AF136830.1 #1058 f: ACCCCAATGGGTATCAGAA
f: ACCCCAATGG/AGTATCAGAA f: ACCCCAATGAGTATCAGAA fragm 3 (= -980) r:
TTCTGATACCCATTGGGGT r: TTCTGATACT/CCATTGGGGT r: TTCTGATACTCATTGGGGT
5'UTR- AF136830.1 #1271 to f: GTATTTATGTTATTATTATGT f:
GTATTTATG(TTA)TTATTATGT f: GTATTTATGTTATTATGT fragm 3 1273 (= -765)
r: ACATAATAATAACATAAATAC r: ACATAATAA(TAA)CATAAATAC r:
ACATAATAACATAAATAC to (-767) 5'UTR- AF136830.1 #1397 to f:
TGTAATAACATATATATTTA f: TGTAATAAC(AT)ATATATTTA f:
TGTAATAACATATATTTA fragm 3 1398 (= -640) r: TAAATATATATGTTATTACA r:
TAAATATAT(AT)GTTATTACA r: TAAATATATGTTATTACA to (-641) 5'UTR-
AF136830.1 #1627 f: TTTTTTATATACAAAATAT f: TTTTTTATAT/CACAAAATAT f:
TTTTTTATACACAAAATAT fragm 4 (= -411) r: ATATTTTGTATATAAAAAA r:
ATATTTTGTG/ATATAAAAAA r: ATATTTTGTGTATAAAAAA 5'UTR- AF136830.1
#1668 f: GGTCATAAATTCCCAACTG f: GGTCATAAAT/GTCCCAACTG f:
GGTCATAAAGTCCCAACTG fragm 4 (= -370) r: CAGTTGGGAATTTATGACC r:
CAGTTGGGAC/ATTTATGACC r: CAGTTGGGACTTTATGACC 5'UTR- AF136830.1
#1767 f: ACATTGGAACAACCAGGGA f: ACATTGGAAC/AAACCAGGGA f:
ACATTGGAAAAACCAGGGA fragm 4 (= -271) r: TCCCTGGTTGTTCCAATGT r:
TCCCTGGTTT/GTTCCAATGT r: TCCCTGGTTTTTCCAATGT 5'UTR- AF136830.1
#1785/ f: AATTAAAAATACCTGGGC f: AATTAAAAA(A)TACCTGGGC f:
AATTAAAAAATACCTGGGC fragm 4 1786 r: GCCCAGGTATTTTTAATT r:
GCCCAGGTA(T)TTTTTAATT r: GCCCAGGTATTTTTTAATT (= -252) 5'UTR-
AF136830.1 #1887 f: CTATCCATGGGCCAAAGTC f: CTATCCATGG/AGCCAAAGTC f:
CTATCCATGAGCCAAAGTC fragm 4 (= -151) r: GACTTTGGCCCATGGATAG r:
GACTTTGGCT/CCATGGATAG r: GACTTTGGCTCATGGATAG 5'UTR- AF136830.1
#1905 f: CCACTCAGAAAAAAAGTAT f: CCACTCAGAA/CAAAAAGTAT f:
CCACTCAGACAAAAAGTAT fragm 4 (= -133) r: ATACTTTTTTTCTGAGTGG r:
ATACTTTTTG/TTCTGAGTGG r: ATACTTTTTGTCTGAGTGG 5' UTR- AF136830.1
#1952 f: ACATGTCAAAGAGACACAC f: ACATGTCAAA/CGAGACACAC f:
ACATGTCAACGAGACACAC fragm 4 (= -86) r: GTGTGTCTCTTTGACATGT r:
GTGTGTCTCG/TTTGACATGT r: GTGTGTCTCGTTGACATGT Intron 1 AF136832.1
#171 f: ATTCAGAAATATCGAATCT f: ATTCAGAAAT/CATCGAATCT f:
ATTCAGAAACATCGAATCT r: AGATTCGATATTTCTGAAT r: AGATTCGATG/ATTTCTGAAT
r: AGATTCGATGTTTCTGAAT Intron 1 AF136832.1 #258 f:
AGCAAATAGCGACTTATTT f: AGCAAATAGC/TGACTTATTT f: AGCAAATAGTGACTTATTT
r: AAATAAGTCGCTATTTGCT r: AAATAAGTCA/GCTATTTGCT r:
AAATAAGTCACTATTTGCT Intron 2 AF136833.1 #122 f: ATGGCTGCCGAGTGTTGCA
f: ATGGCTGCCG/AAGTGTTGCA f: ATGGCTGCCAAGTGTTGCA r:
TGCAACACTCGGCAGCCAT r: TGCAACACTT/CGGCAGCCAT r: TGCAACACTTGGCAGCCAT
Intron 2 AF136833.1 #150 f: TCCTTGGCTGTGAATTCTC f:
TCCTTGGCTG/ATGAATTCTC f: TCCTTGGCTATGAATTCTC r: GAGAATTCACAGCCAAGGA
r: GAGAATTCAT/CAGCCAAGGA r: GAGAATTCATAGCCAAGGA Intron 2 AF136833.1
#180/181 f: CCTTTTTTTATTAGGAAT f: CCTTTTTTT(T)ATTAGGAAT f:
CCTTTTTTTTATTAGGAAT r: ATTCCTAATAAAAAAAGG r: ATTCCTAAT(A)AAAAAAAGG
r: ATTCCTAATAAAAAAAAGG Intron 2 AF136833.1 #182 f:
CTTTTTTTATTAGGAATCA f: CTTTTTTTAT/CTAGGAATCA f: CTTTTTTTACTAGGAATCA
r: TGATTCCTAATAAAAAAAG r: TGATTCCTAG/ATAAAAAAAG r:
TGATTCCTAGTAAAAAAAG Exon 3 AF136833.1 #270 f: TGGGGAAGAGGAGCATTGA
f: TGGGGAAGAG/AGAGCATTGA f: TGGGGAAGAAGAGCATTGA r:
TCAATGCTCCTCTTCCCCA r: TCAATGCTCT/CTCTTCCCCA r: TCAATGCTCTTCTTCCCCA
Exon 3 AF136833.1 #334 f: AAAAACCAAGGGTGGGTGA f:
AAAAACCAAG/AGGTGGGTGA f: AAAAACCAAAGGTGGGTGA r: TCACCCACCCTTGGTTTTT
r: TCACCCACCT/CTTGGTTTTT r: TCACCCACCTTTGGTTTTT Exon 3 AF136833.1
#329 f: TTGAGAAAAACCAAGGGTG f: TTGAGAAAA(A)CCAAGGGTG f:
TTGAGAAAACCAAGGGTG r: CACCCTTGGTTTTTCTCAA r: CACCCTTGG(T)TTTTCTCAA
r: CACCCTTGGTTTTCTCAA Intron 3 AF136833.1 #378 f:
CAGTTACCTGTCTTCACTA f: CAGTTACCTG/CTCTTCACTA f: CAGTTACCTCTCTTCACTA
r: TAGTGAAGACAGGTAACTG r: TAGTGAAGAG/CAGGTAACTG r:
TAGTGAAGAGAGGTAACTG Intron 3 AF136834.2 #87 f: TGTAAGATATGTTTAAAAT
f: TGTAAGATA(T)GTTTAAAAT f: TGTAAGATAGTTTAAAAT r:
ATTTTAAACATATCTTACA r: ATTTTAAAC(A)TATCTTACA r: ATTTTAAACTATCTTACA
Intron 3 AF136834.2 #162 f: ATAATTTTTTTAAAAATTT f:
ATAATTTTTT/ATAAAAATTT f: ATAATTTTTATAAAAATTT r: AAATTTTTAAAAAAATTAT
r: AAATTTTTAT/AAAAAATTAT r: AAATTTTTATAAAAATTAT Intron 3 AF136834.2
#163 f: TAATTTTTTTAAAAATTTT f: TAATTTTTTT/AAAAAATTTT f:
TAATTTTTTAAAAAATTTT r: AAAATTTTTAAAAAAATTA r: AAAATTTTTT/AAAAAAATTA
r: AAAATTTTTTAAAAAATTA Exon 4 AF136834.2 #243 f:
ATCTGCTCCGTTGTTTTCC f: ATCTGCTCCG/ATTGTTTTCC f: ATCTGCTCCATTGTTTTCC
NM_000770.1 #583 r: GGAAAACAACGGAGCAGAT r: GGAAAACAAT/CGGAGCAGAT r:
GGAAAACAATGGAGCAGAT Exon 4 AF136835.1 #13 f: GGATTCTGAACTCCCCATG f:
GGATTCTGAA/GCTCCCCATG f: GGATTCTGAGCTCCCCATG r: CATGGGGAGTTCAGAATCC
r: CATGGGGAGC/TTCAGAATCC r: CATGGGGAGCTCAGAATCC Intron 4 AF136835.1
#180 f: TGATTTCCTGTTCAAAATT f: TGATTTCCTG/ATTCAAAATT f:
TGATTTCCTATTCAAAATT r: AATTTTGAACAGGAAATCA r: AATTTTGAAT/CAGGAAATCA
r: AATTTTGAATAGGAAATCA Intron 4 AF136836.1 #116 f:
ACTTAAAGTATAATAAAAA f: ACTTAAAGTA/GTAATAAAAA f: ACTTAAAGTGTAATAAAAA
r: TTTTTATTATACTTTAAGT r: TTTTTATTAC/TACTTTAAGT r:
TTTTTATTACACTTTAAGT Intron 4 AF136836.1 #132 f: AAAATGTATATATGTATAA
f: AAAATGTATA/GTATGTATAA f: AAAATGTATGTATGTATAA r:
TTATACATATATACATTTT r: TTATACATAC/TATACATTTT r: TTATACATACATACATTTT
Intron 4 AF136836.1 #172 f: ATGATGTCTTATTCATATT f:
ATGATGTCTT/CATTCATATT f: ATGATGTCTCATTCATATT r: AATATGAATAAGACATCAT
r: AATATGAATG/AAGACATCAT r: AATATGAATGAGACATCAT Intron 4 AF136836.1
#189 f: TTTATAGTTATAATTTCAA f: TTTATAGTTA/GTAATTTCAA f:
TTTATAGTTGTAATTTCAA r: TTGAAATTATAACTATAAA r: TTGAAATTAC/TAACTATAAA
r: TTGAAATTACAACTATAAA Exon 5 AF136837.1 #42 f: CGAAGTTACATTAGGGAGA
f: CGAAGTTACA/GTTAGGGAGA f: CGAAGTTACGTTAGGGAGA r:
TCTCCCTAATGTAACTTCG r: TCTCCCTAAC/TGTAACTTCG r: TCTCCCTAACGTAACTTCG
Exon 5 AF136837.1 #101 f: TCGGGACTTTATCGATTGC f:
TCGGGACTTT/GATCGATTGC f: TCGGGACTTGATCGATTGC r: GCAATCGATAAAGTCCCGA
r: GCAATCGATC/AAAGTCCCGA r: GCAATCGATCAAGTCCCGA Exon 5 AF136837.1
#104 f: GGACTTTATCGATTGCTTC f: GGACTTTATC/GGATTGCTTC f:
GGACTTTATGGATTGCTTC r: GAAGCAATCGATAAAGTCC r: GAAGCAATCC/GATAAAGTCC
r: GAAGCAATCCATAAAGTCC Exon 5 AF136837.1 #117 f:
TGCTTCCTGATCAAAATGG f: TGCTTCCTGA/TTCAAAATGG f: TGCTTCCTGTTCAAAATGG
r: CCATTTTGATCAGGAAGCA r: CCATTTTGAA/TCAGGAAGCA r:
CCATTTTGAACAGGAAGCA Exon6 AF136838.1 #309 f: CACTTCTAGGAAAAGGACA f:
CACTTCTAGG/TAAAAGGACA f: CACTTCTAGTAAAAGGACA r: TGTCCTTTTCCTAGTTGTG
r: TGTCCTTTTC/ACTAGTTGTG r: TGTCCTTTTACTAGTTGTG Exon 7 NM_000770.1
#1135 f: GTCCCCACCGCTGTGCCCC f: GTCCCCACCG/AGTGTGCCCC f:
GTCCCCACCAGTGTGCCCC r: GGGGCACACCGGTGGGGAC r: GGGGCACACT/CGGTGGGGAC
r: GGGGCACACTGGTGGGGAC Exon 7 AF136840.1 #232 f:
AGGATAGGAGCCACATGCC f: AGGATAGGAG/TCCACATGCC f: AGGATAGGATCCACATGCC
r: GGCATGTGGCTCCTATCCT r: GGCATGTGGA/CTCCTATCCT f:
GGCATGTGGATCCTATCCT Exon 8 AF136842.1 #206 f: ATGATGACAAAGAATTTCC
f: ATGATGACAA/GAGAATTTCC f: ATGATGACAGAGAATTTCC r:
GGAAATTCTTTGTCATCAT r: GGAAATTCTC/TTGTCATCAT r: GGAAATTCTCTGTCATCAT
Exon 8 AF136843.1 #30 f: TGACCCTGGCCACTTTCTA f:
TGACCCTGGC/TCACTTTCTA f: TGACCCTGGTCACTTTCTA r: TAGAAAGTGGCCAGGGTCA
r: TAGAAAGTGA/GCCAGGGTCA r: TAGAAAGTGACCAGGGTCA Exon 8 AF136843.1
#87 f: GCCTTTCTCAGCAGGTAAT f: GCCTTTCTCA/GGCAGGTAAT f:
GCCTTTCTCGGCAGGTAAT r: ATTACCTGCTGAGAAAGGC r: ATTACCTGCC/TGAGAAAGGC
r: ATTACCTGCCGAGAAAGGC Intron 8 AF136843.1 #167 f:
TACATGGCACCTCCTCTGG f: TACATGGCAC/ACTCCTCTGG f: TACATGGCAACTCCTCTGG
r: CCAGAGGAGGTGCCATGTA r: CCAGAGGAGT/GTGCCATGTA r:
CCAGAGGAGTTGCCATGTA Intron 8 AF136843.1 #197 f: TTGCTATTTGTCCATGATC
f: TTGCTATTTG/ATCCATGATC f: TTGCTATTTATCCATGATC r:
GATCATGGACAAATAGCAA r: GATCATGGAT/CAAATAGCAA r: GATCATGGATAAATAGCAA
Intron 8 AF136843.1 #212 f: GATCAAGAGCACCACTCTT f:
GATCAAGAGC/TACCACTCTT f: GATCAAGAGTACCACTCTT r: AAGAGTGGTGCTCTTGATC
r: AAGAGTGGTA/GCTCTTGATC r: AAGAGTGGTACTCTTGATC Intron 8 AF136843.1
#221 f: CACCACTCTTAACACCCAT f: CACCACTCTT/CAACACCCAT f:
CACCACTCTCAACACCCAT r: ATGGGTGTTAAGAGTGGTG r: ATGGGTGTTG/AAGAGTGGTG
r: ATGGGTGTTGAGAGTGGTG Intron 8 AF136843.1 #255 f:
AATACACCATCATTATTGG f: AATACACCAT/CCATTATTGG
f: AATACACCACCATTATTGG r: CCAATAATGATGGTGTATT r:
CCAATAATGG/ATGGTGTATT r: CCAATAATGGTGGTGTATT Intron 8 AF136843.1
#271 f: TGGGCCAGATAGCGGGGCT f: TGGGCCAGAT/CAGCGGGGCT f:
TGGGCCAGACAGCGGGGCT r: AGCCCCGCTATCTGGCCCA r: AGCCCCGCTG/ATCTGGCCCA
r: AGCCCCGCTGTCTGGCCCA Intron 8 AF136844.1 #118 f:
TTATTTACTGCATATTCTG f: TTATTTACTG/ACATATTCTG f: TTATTTACTACATATTCTG
r: CAGAATATGCAGTAAATAA r: CAGAATATGT/CAGTAAATAA r:
CAGAATATGTAGTAAATAA 3' UTR AF136845.1 #44 f: TCTGGCTGCCGATCTGCTA f:
TCTGGCTGCC/TGATCTGCTA f: TCTGGCTGCTGATCTGCTA r: TAGCAGATCGGCAGCCAGA
r: TAGCAGATCA/GGCAGCCAGA r: TAGCAGATCAGCAGCCAGA
TABLE-US-00005 TABLE 3 Comparison of allelic frequencies (%) from
the populations analyzed (calculation based on Hardy-Weinberg law).
SNP (- : rel. to ATG) (GenBank Acc. No African- ref. to, s. text)
Caucasian Japanese American Location (-1731)-(-1732) 1.3 n.d. 11.7
5'UTR -1627 n.d. n.d. 16.6 5'UTR -1478 n.d. n.d. 2 5'UTR -1325 n.d.
n.d. 1.4 5'UTR -1221 n.d. 1.6 n.d. 5'UTR -1214 4.3 n.d. n.d. 5'UTR
-1207 13.5 n.d. 3.75 5'UTR -1159 n.d. n.d. 1.1 5'UTR -1152 3.05
n.d. n.d. 5'UTR -980 n.d. n.d. 1.2 5'UTR (-765)-(-767) n.d. n.d.
n.d. 5'UTR (-640)-(-641) 10.35 n.d. 4.5 5'UTR -411 14 37.8 17.4
5'UTR -370 19.2 29.7 3.2 5'UTR -271 23.3 5.7 3.2 5'UTR -248 n.d.
n.d. 3.2 5'UTR -151 n.d. n.d. 1.6 5'UTR -133 n.d. n.d. 2.2 5'UTR
-86 n.d. n.d. 1.2 5'UTR 171 1.4 n.d. n.d. Intron 1 258 n.d. n.d.
1.6 Intron 1 122* Intron 2 150 n.d. n.d. 11.6 Intron 2 180-181 30.8
51.1 47.8 Intron 2 182 n.d. n.d. 2.3 Intron 2 270 12 n.d. 4.5 Exon
3 334 n.d. n.d. 15.9 Exon 3 378 14.6 n.d. 4.5 Intron 3 87 6.1 1.3
3.2 Intron 3 162 1.2 n.d. n.d. Intron 3 163 24.2 2.6 25.8 Intron 3
243.sup..sctn. Exon 4 13 n.d. n.d. 1.6 Exon 4 180 24.4 1.2 26.4
Intron 4 116 29.6 46.4 7.4 Intron 4 132 4.7 n.d. 7.4 Intron 4 172
24.6 51.2 24.1 Intron 4 189 2.6 n.d. n.d. Intron 4 42 n.d. n.d. 1.9
Exon 5 101 n.d. 1.1 n.d. Exon 5 104 5 n.d. 1.7 Exon 5 117 n.d. n.d.
14.2 Exon 5 1135 n.d. n.d. 1.2 Exon 7 206 11.4 n.d. 3.2 Exon 8 30
n.d. 7.3 n.d. Exon 8 87 n.d. n.d. 2.17 Exon 8 167 6.3 n.d. 5.6
Intron 8 197 23 51.2 41.1 Intron 8 212 1.3 n.d. n.d. Intron 8 221
n.d. 3.7 n.d. Intron 8 255 n.d. n.d. 1.1 Intron 8 271 2.1 n.d. 1.7
Intron 8 118 26.4 n.d. 44.4 Intron 8 44 22.3 53 n.d. 3'UTR *has
been detected in a sample of a pre-screen (Caucasian sample).
.sup..sctn.has been detected in a phenotyped sample (Caucasian
sample). n.d.--not detect in the samples analyzed.
TABLE-US-00006 TABLE 4 Listing of all amino acid changes in the
coding regions Met Gly Lys Arg Ser Ile Glu s001.txt Exon 3 Met Gly
Lys Lys Ser Ile Glu s002.txt Glu Leu Arg Lys Thr Lys Ala s376.txt
Exon 3/4 Glu Leu Arg Lys Pro Arg Leu s377.txt Arg Lys Thr Lys Ala
Ser Pro s003.txt Exon 3/4 Arg Lys Thr Lys Ala Ser Pro s004.txt Ile
Cys Ser Val Val Phe Gln s005.txt Exon 3 Ile Cys Ser Ile Val Phe Gln
s006.txt Ala Ile Leu Asn Ser Pro Trp s007.txt Exon 4 Ala Ile Leu
Ser Ser Pro Trp s008.txt Arg Ser Tyr Ile Arg Glu Lys s009.txt Exon
5 Arg Ser Tyr Val Arg Glu Lys s010.txt Pro Arg Asp Phe Ile Asp Cys
s011.txt Exon 5 Pro Arg Asp Leu Ile Asp Cys s012.txt Arg Asp Phe
Ile Asp Cys Phe s013.txt Exon 5 Arg Asp Phe Met Asp Cys Phe
s014.txt Cys Phe Leu Ile Lys Met Glu s015.txt Exon 5 Cys Phe Leu
Phe Lys Met Glu s016.txt Met Glu Gln Glu Lys Asp Asn s378.txt Exon
6 Met Glu Gln STOP s379.txt Val Pro Thr Gly Val Pro His s017.txt
Exon 7 Val Pro Thr Ser Val Pro His s018.txt Gln Asp Arg Ser His Met
Pro s380.txt Exon 7 Gin Asp Arg Ile His Met Pro s381.bct His Asp
Asp Lys Glu Phe Pro s019.txt Exon 8 His Asp Asp Arg Glu Phe Pro
s020.txt Phe Asp Pro Gly His Phe Leu s021.txt Exon 8 Phe Asp Pro
Gly His Phe Leu s022.txt Met Pro Phe Ser Ala Gly Lys s023.txt Exon
8 Met Pro Phe Ser Ala Gly Lys s024.txt
Sequence CWU 1
1
41717PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 1Met Gly Lys Arg Ser Ile Glu1 527PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 2Met
Gly Lys Lys Ser Ile Glu1 537PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 3Arg Lys Thr Lys Ala Ser Pro1
547PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 4Arg Lys Thr Lys Ala Ser Pro1 557PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 5Ile
Cys Ser Val Val Phe Gln1 567PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 6Ile Cys Ser Ile Val Phe Gln1
577PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 7Ala Ile Leu Asn Ser Pro Trp1 587PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 8Ala
Ile Leu Ser Ser Pro Trp1 597PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 9Arg Ser Tyr Ile Arg Glu Lys1
5107PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 10Arg Ser Tyr Val Arg Glu Lys1 5117PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 11Pro
Arg Asp Phe Ile Asp Cys1 5127PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 12Pro Arg Asp Leu Ile Asp
Cys1 5137PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 13Arg Asp Phe Ile Asp Cys Phe1 5147PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 14Arg
Asp Phe Met Asp Cys Phe1 5157PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 15Cys Phe Leu Ile Lys Met
Glu1 5167PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 16Cys Phe Leu Phe Lys Met Glu1 5177PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 17Val
Pro Thr Gly Val Pro His1 5187PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 18Val Pro Thr Ser Val Pro
His1 5197PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 19His Asp Asp Lys Glu Phe Pro1 5207PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 20His
Asp Asp Arg Glu Phe Pro1 5217PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 21Phe Asp Pro Gly His Phe
Leu1 5227PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 22Phe Asp Pro Gly His Phe Leu1 5237PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 23Met
Pro Phe Ser Ala Gly Lys1 5247PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 24Met Pro Phe Ser Ala Gly
Lys1 52524DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 25attttagtca atcttggtgg cccg 242625DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
26ttcaacagaa gatggaacac aggga 252725DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
27tcatgaccat tgactatcag ttccc 252824DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
28tgatacccat tggggttcat tacc 242925DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
29aacagagtca aggtggcgta tcttc 253029DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
30caatattctc agattaatga ccagttggg 293126DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
31agacttagcc cttgataaca aaagcc 263227DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
32gtttaggcag ctgtatttta agtgaac 273325DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
33actccaaagt ttttataaca ctccc 253424DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
34ggcactggaa agaaggagta ggac 243527DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
35gatctattat aatagtgtgc ttccagg 273622DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
36ttgtgtacca attgcctggg tc 223724DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 37tttttagggc tctgttttcc
atcc 243824DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 38gagcttagcc tatctgcatg gctg 243920DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
39acctggccac ccctgaaatg 204024DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 40tccatgctga ttttttttgg acac
244122DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 41ctgacccctt gcacttctga tg 224225DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
42tgacgagtta ttgggtgcag tacac 254323DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
43ttccatgatg tttagtgcag gcc 234422DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 44ttgaagtaag acagggcatc gg
224524DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 45agaaacaagg tggaggatac tggc 244624DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
46ggccatgaat tgctatgaca aatg 244724DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
47ggttggaacc aaaccagcac tatg 244822DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
48ctggctggac ctgagtttcc tc 224920DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 49ttaactcctg caagccccgc
205024DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 50gtacatttgt ttgtcccacc atcc 245124DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
51tgcagtgacc tgaacaactc tcct 245220DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 52gatgtgatga gtgtgaaaat 205320DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 53gatgtgatga gtgtgaaaat 205418DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 54gatgtgatgt gtgaaaat 185520DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 55attttcacac tcatcacatc 205620DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 56attttcacac tcatcacatc 205718DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 57attttcaca catcacatc 185819DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 58ggaaataact gtactggtc 195919DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 59ggaaataacw gtactggtc 196019DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 60ggaaataaca gtactggtc 196119DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 61gaccagtaca gttatttcc 196219DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 62gaccagtacw gttatttcc 196319DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 63gaccagtact gttatttcc 196419DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 64ggtctgcaca ttgcagtgg 196519DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 65ggtctgcacr ttgcagtgg 196619DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 66ggtctgcacg ttgcagtgg 196719DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 67ccactgcaat gtgcagacc 196819DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 68ccactgcaay gtgcagacc 196919DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 69ccactgcaac gtgcagacc 197019DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 70aaaacaatag aagcagcca 197119DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 71aaaacaatak aagcagcca 197219DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 72aaaacaatat aagcagcca 197319DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 73tggctgcttc tattgtttt 197419DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 74tggctgcttm tattgtttt 197519DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 75tggctgctta tattgtttt 197619DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 76agtgctgaac aactttcac 197719DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 77agtgctgaam aactttcac 197819DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 78agtgctgaaa aactttcac 197919DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 79gtgaaagttg ttcagcact 198019DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 80gtgaaagttk ttcagcact 198119DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 81gtgaaagttt ttcagcact 198219DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 82aacaactttc acttgtgag 198319DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 83aacaactttm acttgtgag 198419DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 84aacaacttta acttgtgag 198519DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 85ctcacaagtg aaagttgtt 198619DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 86ctcacaagtk aaagttgtt 198719DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 87ctcacaagtt aaagttgtt 198819DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 88ttcacttgtg aggtgatgc 198919DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 89ttcacttgtr aggtgatgc 199019DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 90ttcacttgta aggtgatgc 199119DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 91gcatcacctc acaagtgaa 199219DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 92gcatcaccty acaagtgaa 199319DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 93gcatcacctt acaagtgaa 199419DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 94cttttgagcg tctccggtc 199519DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 95cttttgagcr tctccggtc 199619DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 96cttttgagca tctccggtc 199719DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 97gaccggagac gctcaaaag 199819DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 98gaccggagay gctcaaaag 199919DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 99gaccggagat gctcaaaag 1910019DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 100gcgtctccgg tcctcttat 1910119DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 101gcgtctccgk tcctcttat 1910219DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 102gcgtctccgt tcctcttat 1910319DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 103ataagaggac cggagacgc 1910419DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 104ataagaggam cggagacgc 1910519DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 105ataagaggaa cggagacgc 1910619DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 106accccaatgg gtatcagaa 1910719DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 107accccaatgr gtatcagaa 1910819DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 108accccaatga gtatcagaa 1910919DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 109ttctgatacc cattggggt 1911019DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 110ttctgatacy cattggggt 1911119DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 111ttctgatact cattggggt 1911221DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 112gtatttatgt tattattatg t
2111321DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 113gtatttatgt tattattatg t
2111418DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 114gtatttatgt tattatgt
1811521DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 115acataataat aacataaata c
2111621DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 116acataataat aacataaata c
2111718DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 117acataataac ataaatac
1811820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 118tgtaataaca tatatattta
2011920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 119tgtaataaca tatatattta
2012018DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 120tgtaataaca tatattta
1812120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 121taaatatata tgttattaca
2012220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 122taaatatata tgttattaca
2012318DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 123taaatatatg ttattaca
1812419DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 124ttttttatat acaaaatat
1912519DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 125ttttttatay acaaaatat
1912619DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 126ttttttatac acaaaatat
1912719DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 127atattttgta tataaaaaa
1912819DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 128atattttgtr tataaaaaa
1912919DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 129atattttgtg tataaaaaa
1913019DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 130ggtcataaat tcccaactg
1913119DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 131ggtcataaak tcccaactg
1913219DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 132ggtcataaag tcccaactg
1913319DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 133cagttgggaa tttatgacc
1913419DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 134cagttgggam tttatgacc
1913519DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 135cagttgggac tttatgacc
1913619DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 136acattggaac aaccaggga
1913719DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 137acattggaay aaccaggga
1913819DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 138acattggaaa aaccaggga
1913919DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 139tccctggttg ttccaatgt
1914019DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 140tccctggttr ttccaatgt
1914119DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 141tccctggttt ttccaatgt
1914218DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 142aattaaaaat acctgggc
1814319DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 143aattaaaaaa tacctgggc
1914419DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 144aattaaaaaa tacctgggc
1914518DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 145gcccaggtat ttttaatt
1814619DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 146gcccaggtat tttttaatt
1914719DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 147gcccaggtat tttttaatt
1914819DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 148ctatccatgg gccaaagtc
1914919DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 149ctatccatgr gccaaagtc
1915019DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 150ctatccatga gccaaagtc
1915119DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 151gactttggcc catggatag
1915219DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 152gactttggcy catggatag
1915319DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 153gactttggct catggatag
1915419DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 154ccactcagaa aaaaagtat
1915519DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 155ccactcagam aaaaagtat
1915619DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 156ccactcagac aaaaagtat
1915719DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 157atactttttt tctgagtgg
1915819DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 158atactttttk tctgagtgg
1915919DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 159atactttttg tctgagtgg
1916019DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 160acatgtcaaa gagacacac
1916119DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 161acatgtcaam gagacacac
1916219DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 162acatgtcaac gagacacac
1916319DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 163gtgtgtctct ttgacatgt
1916419DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 164gtgtgtctck ttgacatgt
1916519DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 165gtgtgtctcg ttgacatgt
1916619DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 166attcagaaat atcgaatct
1916719DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 167attcagaaay atcgaatct
1916819DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 168attcagaaac atcgaatct
1916919DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 169agattcgata tttctgaat
1917019DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 170agattcgatr tttctgaat
1917119DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 171agattcgatg tttctgaat
1917219DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 172agcaaatagc gacttattt
1917319DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 173agcaaatagy gacttattt
1917419DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 174agcaaatagt gacttattt
1917519DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 175aaataagtcg ctatttgct
1917619DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 176aaataagtcr ctatttgct
1917719DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 177aaataagtca ctatttgct
1917819DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 178atggctgccg agtgttgca
1917919DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 179atggctgccr agtgttgca
1918019DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 180atggctgcca agtgttgca
1918119DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 181tgcaacactc ggcagccat
1918219DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 182tgcaacacty ggcagccat
1918319DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 183tgcaacactt ggcagccat
1918419DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 184tccttggctg tgaattctc
1918519DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 185tccttggctr tgaattctc
1918619DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 186tccttggcta tgaattctc
1918719DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 187gagaattcac agccaagga
1918819DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 188gagaattcay agccaagga
1918919DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 189gagaattcat agccaagga
1919018DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 190ccttttttta ttaggaat
1819119DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 191cctttttttt attaggaat
1919219DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 192cctttttttt attaggaat
1919318DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 193attcctaata aaaaaagg
1819419DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 194attcctaata aaaaaaagg
1919519DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 195attcctaata aaaaaaagg
1919619DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 196ctttttttat taggaatca
1919719DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 197ctttttttay taggaatca
1919819DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 198ctttttttac taggaatca
1919919DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 199tgattcctaa taaaaaaag
1920019DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 200tgattcctar taaaaaaag
1920119DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 201tgattcctag taaaaaaag
1920219DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 202tggggaagag gagcattga
1920319DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 203tggggaagar gagcattga
1920419DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 204tggggaagaa gagcattga
1920519DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 205tcaatgctcc tcttcccca
1920619DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 206tcaatgctcy tcttcccca
1920719DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 207tcaatgctct tcttcccca
1920819DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 208aaaaaccaag ggtgggtga
1920919DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 209aaaaaccaar ggtgggtga
1921019DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 210aaaaaccaaa ggtgggtga
1921119DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 211tcacccaccc ttggttttt
1921219DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 212tcacccaccy ttggttttt
1921319DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 213tcacccacct ttggttttt
1921419DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 214cagttacctg
tcttcacta 1921519DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 215cagttaccts tcttcacta
1921619DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 216cagttacctc tcttcacta
1921719DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 217tagtgaagac aggtaactg
1921819DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 218tagtgaagas aggtaactg
1921919DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 219tagtgaagag aggtaactg
1922019DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 220tgtaagatat gtttaaaat
1922119DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 221tgtaagatat gtttaaaat
1922218DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 222tgtaagatag tttaaaat
1822319DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 223attttaaaca tatcttaca
1922419DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 224attttaaaca tatcttaca
1922518DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 225attttaaact atcttaca
1822619DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 226ataatttttt taaaaattt
1922719DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 227ataatttttw taaaaattt
1922819DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 228ataattttta taaaaattt
1922919DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 229aaatttttaa aaaaattat
1923019DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 230aaatttttaw aaaaattat
1923119DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 231aaatttttat aaaaattat
1923219DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 232taattttttt aaaaatttt
1923319DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 233taattttttw aaaaatttt
1923419DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 234taatttttta aaaaatttt
1923519DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 235aaaattttta aaaaaatta
1923619DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 236aaaatttttw aaaaaatta
1923719DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 237aaaatttttt aaaaaatta
1923819DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 238atctgctccg ttgttttcc
1923919DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 239atctgctccr ttgttttcc
1924019DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 240atctgctcca ttgttttcc
1924119DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 241ggaaaacaac ggagcagat
1924219DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 242ggaaaacaay ggagcagat
1924319DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 243ggaaaacaat ggagcagat
1924419DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 244ggattctgaa ctccccatg
1924519DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 245ggattctgar ctccccatg
1924619DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 246ggattctgag ctccccatg
1924719DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 247catggggagt tcagaatcc
1924819DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 248catggggagy tcagaatcc
1924919DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 249catggggagc tcagaatcc
1925019DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 250tgatttcctg ttcaaaatt
1925119DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 251tgatttcctr ttcaaaatt
1925219DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 252tgatttccta ttcaaaatt
1925319DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 253aattttgaac aggaaatca
1925419DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 254aattttgaay aggaaatca
1925519DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 255aattttgaat aggaaatca
1925619DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 256acttaaagta taataaaaa
1925719DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 257acttaaagtr taataaaaa
1925819DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 258acttaaagtg taataaaaa
1925919DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 259tttttattat actttaagt
1926019DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 260tttttattay actttaagt
1926119DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 261tttttattac actttaagt
1926219DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 262aaaatgtata tatgtataa
1926319DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 263aaaatgtatr tatgtataa
1926419DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 264aaaatgtatg tatgtataa
1926519DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 265ttatacatat atacatttt
1926619DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 266ttatacatay atacatttt
1926719DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 267ttatacatac atacatttt
1926819DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 268atgatgtctt attcatatt
1926919DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 269atgatgtcty attcatatt
1927019DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 270atgatgtctc attcatatt
1927119DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 271aatatgaata agacatcat
1927219DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 272aatatgaatr agacatcat
1927319DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 273aatatgaatg agacatcat
1927419DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 274tttatagtta taatttcaa
1927519DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 275tttatagttr taatttcaa
1927619DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 276tttatagttg taatttcaa
1927719DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 277ttgaaattat aactataaa
1927819DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 278ttgaaattay aactataaa
1927919DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 279ttgaaattac aactataaa
1928019DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 280cgaagttaca ttagggaga
1928119DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 281cgaagttacr ttagggaga
1928219DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 282cgaagttacg ttagggaga
1928319DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 283tctccctaat gtaacttcg
1928419DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 284tctccctaay gtaacttcg
1928519DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 285tctccctaac gtaacttcg
1928619DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 286tcgggacttt atcgattgc
1928719DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 287tcgggacttk atcgattgc
1928819DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 288tcgggacttg atcgattgc
1928919DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 289gcaatcgata aagtcccga
1929019DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 290gcaatcgatm aagtcccga
1929119DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 291gcaatcgatc aagtcccga
1929219DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 292ggactttatc gattgcttc
1929319DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 293ggactttats gattgcttc
1929419DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 294ggactttatg gattgcttc
1929519DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 295gaagcaatcg ataaagtcc
1929619DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 296gaagcaatcs ataaagtcc
1929719DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 297gaagcaatcc ataaagtcc
1929819DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 298tgcttcctga tcaaaatgg
1929919DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 299tgcttcctgw tcaaaatgg
1930019DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 300tgcttcctgt tcaaaatgg
1930119DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 301ccattttgat caggaagca
1930219DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 302ccattttgaw caggaagca
1930319DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 303ccattttgaa caggaagca
1930419DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 304gtccccaccg gtgtgcccc
1930519DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 305gtccccaccr gtgtgcccc
1930619DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 306gtccccacca gtgtgcccc
1930719DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 307ggggcacacc ggtggggac
1930819DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 308ggggcacacy ggtggggac
1930919DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 309ggggcacact ggtggggac
1931019DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 310atgatgacaa agaatttcc
1931119DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 311atgatgacar agaatttcc
1931219DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 312atgatgacag agaatttcc
1931319DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 313ggaaattctt tgtcatcat
1931419DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 314ggaaattcty tgtcatcat
1931519DNAArtificial SequenceDescription of Artificial Sequence
Synthetic
oligonucleotide 315ggaaattctc tgtcatcat 1931619DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 316tgaccctggc cactttcta 1931719DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 317tgaccctggy cactttcta 1931819DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 318tgaccctggt cactttcta 1931919DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 319tagaaagtgg ccagggtca 1932019DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 320tagaaagtgr ccagggtca 1932119DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 321tagaaagtga ccagggtca 1932219DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 322gcctttctca gcaggtaat 1932319DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 323gcctttctcr gcaggtaat 1932419DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 324gcctttctcg gcaggtaat 1932519DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 325attacctgct gagaaaggc 1932619DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 326attacctgcy gagaaaggc 1932719DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 327attacctgcc gagaaaggc 1932819DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 328tacatggcac ctcctctgg 1932919DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 329tacatggcam ctcctctgg 1933019DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 330tacatggcaa ctcctctgg 1933119DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 331ccagaggagg tgccatgta 1933219DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 332ccagaggagk tgccatgta 1933319DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 333ccagaggagt tgccatgta 1933419DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 334ttgctatttg tccatgatc 1933519DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 335ttgctatttr tccatgatc 1933619DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 336ttgctattta tccatgatc 1933719DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 337gatcatggac aaatagcaa 1933819DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 338gatcatggay aaatagcaa 1933919DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 339gatcatggat aaatagcaa 1934019DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 340gatcaagagc accactctt 1934119DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 341gatcaagagy accactctt 1934219DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 342gatcaagagt accactctt 1934319DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 343aagagtggtg ctcttgatc 1934419DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 344aagagtggtr ctcttgatc 1934519DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 345aagagtggta ctcttgatc 1934619DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 346caccactctt aacacccat 1934719DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 347caccactcty aacacccat 1934819DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 348caccactctc aacacccat 1934919DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 349atgggtgtta agagtggtg 1935019DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 350atgggtgttr agagtggtg 1935119DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 351atgggtgttg agagtggtg 1935219DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 352aatacaccat cattattgg 1935319DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 353aatacaccay cattattgg 1935419DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 354aatacaccac cattattgg 1935519DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 355ccaataatga tggtgtatt 1935619DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 356ccaataatgr tggtgtatt 1935719DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 357ccaataatgg tggtgtatt 1935819DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 358tgggccagat agcggggct 1935919DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 359tgggccagay agcggggct 1936019DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 360tgggccagac agcggggct 1936119DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 361agccccgcta tctggccca 1936219DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 362agccccgctr tctggccca 1936319DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 363agccccgctg tctggccca 1936419DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 364ttatttactg catattctg 1936519DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 365ttatttactr catattctg 1936619DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 366ttatttacta catattctg 1936719DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 367cagaatatgc agtaaataa 1936819DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 368cagaatatgy agtaaataa 1936919DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 369cagaatatgt agtaaataa 1937019DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 370tctggctgcc gatctgcta 1937119DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 371tctggctgcy gatctgcta 1937219DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 372tctggctgct gatctgcta 1937319DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 373tagcagatcg gcagccaga 1937419DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 374tagcagatcr gcagccaga 1937519DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 375tagcagatca gcagccaga 193767PRTHomo sapiens
376Glu Leu Arg Lys Thr Lys Ala1 53777PRTHomo sapiens 377Glu Leu Arg
Lys Pro Arg Leu1 53787PRTHomo sapiens 378Met Glu Gln Glu Lys Asp
Asn1 53793PRTHomo sapiens 379Met Glu Gln13807PRTHomo sapiens 380Gln
Asp Arg Ser His Met Pro1 53817PRTHomo sapiens 381Gln Asp Arg Ile
His Met Pro1 538219DNAHomo sapiens 382ttgagaaaaa ccaagggtg
1938319DNAHomo sapiensmodified_base(10)This base may or may not be
present 383ttgagaaaaa ccaagggtg 1938418DNAHomo sapiens
384ttgagaaaac caagggtg 1838519DNAHomo sapiens 385cacccttggt
ttttctcaa 1938619DNAHomo sapiensmodified_base(10)This base may or
may not be present 386cacccttggt ttttctcaa 1938718DNAHomo sapiens
387cacccttggt tttctcaa 1838819DNAHomo sapiens 388cacttctagg
aaaaggaca 1938919DNAHomo sapiens 389cacttctagk aaaaggaca
1939019DNAHomo sapiens 390cacttctagt aaaaggaca 1939119DNAHomo
sapiens 391tgtccttttc ctagttgtg 1939219DNAHomo sapiens
392tgtccttttm ctagttgtg 1939319DNAHomo sapiens 393tgtcctttta
ctagttgtg 1939419DNAHomo sapiens 394aggataggag ccacatgcc
1939519DNAHomo sapiens 395aggataggak ccacatgcc 1939619DNAHomo
sapiens 396aggataggat ccacatgcc 1939719DNAHomo sapiens
397ggcatgtggc tcctatcct 1939819DNAHomo sapiens 398ggcatgtggm
tcctatcct 1939919DNAHomo sapiens 399ggcatgtgga tcctatcct
194002097DNAHomo sapiens 400cattttaatc cactggtgct agaattatta
actaaattaa tgtttatttt gaaagtcact 60gattagatta atccacaagt attgaatttt
agtcaatctt ggtggcccgg tttaactgga 120tgttttgctt aaaaggaagg
cagcaagatg caggggttat ggtttccagc cccagcttgg 180tcacttgcat
tctgtgtgtc cttagctaaa gtactgaatc tccatggtct aactttctcc
240tctctaaact gggaataatt ttacagtggg caaagataat tgagagaata
aaaagagatg 300tgatgagtgt gaaaattctc tgtaaatttg tcataatgtc
tataaacata atcgataaaa 360cattgtataa ctgggtctaa tattttctta
atgaaagagc tggaaataac tgtactggtc 420aatttagaat aaaggtaatc
ttttcagagc atgcctttgt atacacactt tgttattagt 480gatctagtaa
tgttcataaa tccagttgta tttagatctt catgaccatt gactatcagt
540tcccatttca ggtctgcaca ttgcagtggt tctgtgccct gggtccattc
agtgatttcc 600ctgtgttcca tcttctgttg aatccacaac tgttgttctg
tgtataattt ctcttccttg 660ctgtgtatga ttacattcta ttatttgtaa
caataacaga ccaaaaacaa tagaagcagc 720catgtctgga ggtgactgga
aggtggagaa gccatagatt ttcaagccct gtgccataaa 780ttatgtgaga
ttggcccttt ccttaatagt gctgaacaac tttcacttgt gaggtgatgc
840agaggggaga actctaattt ttatttcttc ttttgagcgt ctccggtcct
cttatcctta 900taaacaaata acggacttct atttaatgtg aagcctgttg
ctttctgaac agagtcaagg 960tggcgtatct tcagagtaac taatgtctgg
ggtttgtttt gtttttctaa aattgttctt 1020gagccagctg tggtgtaagt
ggtaatgaac cccaatgggt atcagaagat ctctgctcaa 1080atcccggttt
taccggcaat gagctgtgtg gcactgacag gtgtcctgtt ctcccagagt
1140ttctttccca atttgaaaaa taaaaaatga taatctttat actccagtct
cttttaatga 1200tgaatataca tttatatata tacttttata tatttaatat
aatatttaat agtataaata 1260tgtatttatg ttattattat gtaataatgt
atgtaacact ccctgctaat tcagtttgtc 1320tctttgacat gtaaagtaaa
taatcaccta ttattataat aatgtaataa taacacaaat 1380attattatgt
aataacatat atatttatgt atattgttta tatacattta aatatatata
1440aatatacatt tattagctaa taatttgata tatgtatggt aattcaacat
gtatgagtta 1500tattcactat ttcatgttta ggcagctgta ttttaagtga
actatactaa atatttgaaa 1560ggcttttgtt atcaagggct aagtctccta
ttttttgata tagcattaca atgtacattt 1620tttatacaca aaatatagaa
tacactgatt tccctcaagg tcataaattc ccaactggtc 1680attaatctga
gaatattgaa ttttgagtat attctaacat agaatcattt acttcagtgt
1740ttctccatca tcacagcaca ttggaacaac cagggacttt taattaaaaa
tacctgggct 1800ccaatccaat acaattaaac cagaatctcc tagattggca
ctggaaagaa ggagtaggac 1860aaaagaacat tttatttcta tccatgggcc
aaagtccact cagaaaaaaa gtataaattg 1920gatctaggtg attgtttact
ttacatgtca aagagacaca cactaaatta gcagggagtg 1980ttataaaaac
tttggagtgc aagctcacag ctgtcttaat aagaagagaa ggcttcaatg
2040gaaccttttg tggtcctggt gctgtgtctc tcttttatgc ttctcttttc actctgg
2097401440DNAHomo sapiens 401cagagctgta ggagaaggaa gctccctcct
ggccccactc ctcttcctat tattggaaat 60atgctacaga tagatgttaa ggacatctgc
aaatctttca ccaatgtaag tctgccttat 120gttcctccag ccaattgcaa
agggtaagtt atttgactgc tatttttaga caaaatatat 180tcctggaagc
acactattat aatagatcat tgtaaagcaa aatactccct ctgaacttct
240ttgatgtttc ttttgtcttc ctattttttt ttttttttga gacggagtct
cgctctattg 300cccaggctgg agtgcagtgg cactatctcc actcactgca
agctctgcct cccaggttca 360caccattctc ctgcctcagc ctcccccgag
taactgggac tacaggtgcc ctccaccatg 420cccggctaat tttttgtatg
440402383DNAHomo sapiens 402agtttcttca tttttaaaac aggtcaaatg
aatgtgctga atgtgttgaa gtgaggatga 60actgtgtgat ttgtgtacca attgcctggg
tcattgcgtg gcacatcaca ggccatctat 120aagtggcagc tataacaatc
accatcacat ttatgtacaa aattcagaaa tatcgaatct 180atgtgtggca
aatatgaaca ttaaaaaata caatgaaaat gtcagtctga atcatacata
240gtatttggag caaatagcga cttattttgc tgctatttgc atttcctttc
ccagttctca 300aaagtctatg gtcctgtgtt caccgtgtat tttggcatga
atcccatagt ggtgtttcat 360ggatatgagg cagtgaagga agc 383403463DNAHomo
sapiens 403tactaaagga cttggtaggt gcacatattt ctgtgtcagc tttggtaact
ggggtgaggg 60ggatggaaaa cagagcccta aaaagcttct cagcagagct tagcctatct
gcatggctgc 120cgagtgttgc agcactttct tccttggctg tgaattctcc
cagtttctgc cccttttttt 180attaggaatc atttccagca atggaaagag
atggaaggag atccggcgtt tctccctcac 240aaccttgcgg aattttggga
tggggaagag gagcattgag gaccgtgttc aagaggaagc 300tcactgcctt
gtggaggagt tgagaaaaac caagggtggg tgactctact ctgcgtcatt
360gaccttaaca gttacctgtc ttcactagtg acgtccttgg aaacatttca
ggggtggcca 420ggtcttcatt gcgcatcctg gttgtcagcc ctcaggtggt gga
463404243DNAHomo sapiens 404atgctcaact catatttaag gtaaaagtaa
tgtgtttatt tcatccatgc tgattttttt 60tggacacatg gggaatttgt aagatatgtt
taaaatttct aaatttcctt tatgtcttaa 120cagatgcaaa tcttttaaat
atttattttt taataatttt tttaaaaatt tttaaatctt 180tagcttcacc
ctgtgatccc actttcatcc tgggctgtgc tccctgcaat gtgatctgct 240ccg
243405370DNAHomo sapiens 405tcaggattct gaactcccca tggatccagg
taaggccaag attttatttt ccttggaaac 60catttattca aggttgtagg gaagacttgg
tttaaaaatg agaaaattga tactaaaatg 120cttttataca ataaaaatga
tgtatgagtg aagaaaataa ttaccacctt tgatttcctg 180ttcaaaattt
tcagcctcca atctttaggt acagaaaatt
gctatatgtg cacaataaaa 240atttccccat cagaagtgca aggggtcagg
gaattccctt tcctagccaa gcaaagctgt 300gaacagatgg cacctggaaa
attgggtcac tcccacccta atactgtgct tttctagtgg 360tcttagtaaa
370406294DNAHomo sapiens 406tgggagatat acctaatgta tatgacgagt
tattgggtgc agtacaccaa cctggcacat 60gtatacatat gtgacaaacc tgcactttgt
gcacatatac cctagaactt aaagtataat 120aaaaaatgta tatatgtata
aaaatttccc ttcaaaatgg acatgatgtc ttattcatat 180ttatagttat
aatttcaatc agggcttggt gtaagataca tatatcttat gacatgttta
240tatttaatat tcttttctct tttaggtctg caataatttc cctctactca ttga
294407327DNAHomo sapiens 407acaacaaagt gcttaaaaat gttgctctta
cacgaagtta cattagggag aaagtaaaag 60aacaccaagc atcactggat gttaacaatc
ctcgggactt tatcgattgc ttcctgatca 120aaatggagca ggtaagatat
tagcaacaga tcagtatttt gatttcttgt ccattttgtg 180attcatcgaa
tccttctgta atttactaag gatgtttaaa tgatcaggcc agtaatgctt
240gacaagcatc ttaattactt attgtattta tgggcctgca ctaaacatca
tggaaaatac 300aaaattgtcc aatggctaga atgcata 327408346DNAHomo
sapiens 408ataacacaaa ttgaagtaag acagggcatc ggtatacttc tgcttttatt
tctggggaaa 60gaaatattct gtgtgactaa cctaagcagc gaatgatttc atgaatggaa
cttgtaggtc 120tgtcaggaaa taaagtttga gtcaactgat ctgcagtttc
tgccatacca cacagttgct 180ttttctaata ctgtactgtc cagtatctct
tttggctaac tttaaaaaat agtatgtttt 240ttaaaattta gtgtatttag
atatactggc acataatttg tcagataatt gcatgaaatc 300acttctagga
aaaggacaac caaaagtcag aattcaatat tgaaaa 346409199DNAHomo sapiens
409tcctgctcct gctgaagcac ccagaggtca caggtaggac cacagatgat
gaacaaagtg 60aatttcagaa caatgctgag aagatggtgc cagtatcctc caccttgttt
ctctcagaga 120aggctcattc tttaaatttc tgtgtcatca gctgtaatct
gtctaaattt gatgacacaa 180tttaaaatga catctttgt 199410247DNAHomo
sapiens 410tatattatgg taattctttt tatatggctg gttgtacttc tggacatgta
actcatgttt 60gtaatgttgc tgggattttt atatcatgtt aatgtggcca tgaattgcta
tgacaaatgt 120tccatatatc ttcgtttcca tcagttcttt cttgtgtctt
gtcagctaaa gtccaggaag 180agattgatca tgtaattggc agacacagga
gcccctgcat gcaggatagg agccacatgc 240cttacac 247411175DNAHomo
sapiens 411gccccatgca gtgaccactg atactaagtt cagaaactac ctcatcccca
aggtaagctt 60gtttctctta cactatattt ctgtacttct gaaatttcca tagtgctggt
ttggttccaa 120ccctctaaca acacaagatg agagaagtgc aaaactcata
catgtggcag cttga 175412226DNAHomo sapiens 412ccaccactgg ccttaagctg
atccatgtaa attactgtgt ctggctggac ctgagtttcc 60tcatctatag atcaacgtta
tggcgctacg tgatgtccac tacttctcct cacttctgga 120cttctttata
aatcagatta tctgttttgt tacttccagg gcacaaccat aatggcatta
180ctgacttccg tgctacatga tgacaaagaa tttcctaatc caaata
226413300DNAHomo sapiens 413tttcctaatc caaatatctt tgaccctggc
cactttctag ataagaatgg caactttaag 60aaaagtgact acttcatgcc tttctcagca
ggtaatagaa actcgtttcc atttgtattt 120aaaggaaaga gagaactttt
tggaattagt tggaatttac atggcacctc ctctggggct 180ggtagaattg
ctatttgtcc atgatcaaga gcaccactct taacacccat gtgctccacc
240ctcacaatac accatcatta ttgggccaga tagcggggct tgcaggagtt
aactctgttg 300414248DNAHomo sapiens 414aatatgtctc tttttgtaca
tttgtttgtc ccaccatcca ttaatcaatc catcatgtca 60tccatccatt catccacatg
ttcattcatc tacccaatca ttaatcaatt atttactgca 120tattctgttt
gtgcaagtca caaatgactg tttgtcacag tcacagttaa acacaaggag
180taactacttc ctttctttgt tatcttcagg aaaacgaatt tgtgcaggag
aaggacttgc 240ccgcatgg 248415300DNAHomo sapiens 415tctgcttcat
ccctgtctga agaatgctag cccatctggc tgccgatctg ctatcacctg 60caactctttt
tttatcaagg acattcccac tattatgtct tctctgacct ctcatcaaat
120cttcccattc actcaatatc ccataagcat ccaaactcca ttaaggagag
ttgttcaggt 180cactgcacaa atatatctgc aattattcat actctgtaac
acttgtatta attgctgcat 240atgctaatac ttttctaatg ctgacttttt
aatatgttat cactgtaaaa cacagaaaag 3004161866DNAHomo sapiens
416agtgcaagct cacagctgtc ttaataagaa gagaaggctt caatggaacc
ttttgtggtc 60ctggtgctgt gtctctcttt tatgcttctc ttttcactct ggagacagag
ctgtaggaga 120aggaagctcc ctcctggccc cactcctctt cctattattg
gaaatatgct acagatagat 180gttaaggaca tctgcaaatc tttcaccaat
ttctcaaaag tctatggtcc tgtgttcacc 240gtgtattttg gcatgaatcc
catagtggtg tttcatggat atgaggcagt gaaggaagcc 300ctgattgata
atggagagga gttttctgga agaggcaatt ccccaatatc tcaaagaatt
360actaaaggac ttggaatcat ttccagcaat ggaaagagat ggaaggagat
ccggcgtttc 420tccctcacaa ccttgcggaa ttttgggatg gggaagagga
gcattgagga ccgtgttcaa 480gaggaagctc actgccttgt ggaggagttg
agaaaaacca aggcttcacc ctgtgatccc 540actttcatcc tgggctgtgc
tccctgcaat gtgatctgct ccgttgtttt ccagaaacga 600tttgattata
aagatcagaa ttttctcacc ctgatgaaaa gattcaatga aaacttcagg
660attctgaact ccccatggat ccaggtctgc aataatttcc ctctactcat
tgattgtttc 720ccaggaactc acaacaaagt gcttaaaaat gttgctctta
cacgaagtta cattagggag 780aaagtaaaag aacaccaagc atcactggat
gttaacaatc ctcgggactt tatcgattgc 840ttcctgatca aaatggagca
ggaaaaggac aaccaaaagt cagaattcaa tattgaaaac 900ttggttggca
ctgtagctga tctatttgtt gctggaacag agacaacaag caccactctg
960agatatggac tcctgctcct gctgaagcac ccagaggtca cagctaaagt
ccaggaagag 1020attgatcatg taattggcag acacaggagc ccctgcatgc
aggataggag ccacatgcct 1080tacactgatg ctgtagtgca cgagatccag
agatacagtg accttgtccc caccggtgtg 1140ccccatgcag tgaccactga
tactaagttc agaaactacc tcatccccaa gggcacaacc 1200ataatggcat
tactgacttc cgtgctacat gatgacaaag aatttcctaa tccaaatatc
1260tttgaccctg gccactttct agataagaat ggcaacttta agaaaagtga
ctacttcatg 1320cctttctcag caggaaaacg aatttgtgca ggagaaggac
ttgcccgcat ggagctattt 1380ttatttctaa ccacaatttt acagaacttt
aacctgaaat ctgttgatga tttaaagaac 1440ctcaatacta ctgcagttac
caaagggatt gtttctctgc caccctcata ccagatctgc 1500ttcatccctg
tctgaagaat gctagcccat ctggctgctg atctgctatc acctgcaact
1560ctttttttat caaggacatt cccactatta tgtcttctct gacctctcat
caaatcttcc 1620cattcactca atatcccata agcatccaaa ctccattaag
gagagttgtt caggtcactg 1680cacaaatata tctgcaatta ttcatactct
gtaacacttg tattaattgc tgcatatgct 1740aatacttttc taatgctgac
tttttaatat gttatcactg taaaacacag aaaagtgatt 1800aatgaatgat
aatttagatc catttctttt gtgaatgtgc taaataaaaa gtgttattaa 1860ttgcta
1866417490PRTHomo sapiens 417Met Glu Pro Phe Val Val Leu Val Leu
Cys Leu Ser Phe Met Leu Leu1 5 10 15Phe Ser Leu Trp Arg Gln Ser Cys
Arg Arg Arg Lys Leu Pro Pro Gly 20 25 30Pro Thr Pro Leu Pro Ile Ile
Gly Asn Met Leu Gln Ile Asp Val Lys 35 40 45Asp Ile Cys Lys Ser Phe
Thr Asn Phe Ser Lys Val Tyr Gly Pro Val 50 55 60Phe Thr Val Tyr Phe
Gly Met Asn Pro Ile Val Val Phe His Gly Tyr65 70 75 80Glu Ala Val
Lys Glu Ala Leu Ile Asp Asn Gly Glu Glu Phe Ser Gly 85 90 95Arg Gly
Asn Ser Pro Ile Ser Gln Arg Ile Thr Lys Gly Leu Gly Ile 100 105
110Ile Ser Ser Asn Gly Lys Arg Trp Lys Glu Ile Arg Arg Phe Ser Leu
115 120 125Thr Asn Leu Arg Asn Phe Gly Met Gly Lys Arg Ser Ile Glu
Asp Arg 130 135 140Val Gln Glu Glu Ala His Cys Leu Val Glu Glu Leu
Arg Lys Thr Lys145 150 155 160Ala Ser Pro Cys Asp Pro Thr Phe Ile
Leu Gly Cys Ala Pro Cys Asn 165 170 175Val Ile Cys Ser Val Val Phe
Gln Lys Arg Phe Asp Tyr Lys Asp Gln 180 185 190Asn Phe Leu Thr Leu
Met Lys Arg Phe Asn Glu Asn Phe Arg Ile Leu 195 200 205Asn Ser Pro
Trp Ile Gln Val Cys Asn Asn Phe Pro Leu Leu Ile Asp 210 215 220Cys
Phe Pro Gly Thr His Asn Lys Val Leu Lys Asn Val Ala Leu Thr225 230
235 240Arg Ser Tyr Ile Arg Glu Lys Val Lys Glu His Gln Ala Ser Leu
Asp 245 250 255Val Asn Asn Pro Arg Asp Phe Met Asp Cys Phe Leu Ile
Lys Met Glu 260 265 270Gln Glu Lys Asp Asn Gln Lys Ser Glu Phe Asn
Ile Glu Asn Leu Val 275 280 285Gly Thr Val Ala Asp Leu Phe Val Ala
Gly Thr Glu Thr Thr Ser Thr 290 295 300Thr Leu Arg Tyr Gly Leu Leu
Leu Leu Leu Lys His Pro Glu Val Thr305 310 315 320Ala Lys Val Gln
Glu Glu Ile Asp His Val Ile Gly Arg His Arg Ser 325 330 335Pro Cys
Met Gln Asp Arg Ser His Met Pro Tyr Thr Asp Ala Val Val 340 345
350His Glu Ile Gln Arg Tyr Ser Asp Leu Val Pro Thr Gly Val Pro His
355 360 365Ala Val Thr Thr Asp Thr Lys Phe Arg Asn Tyr Leu Ile Pro
Lys Gly 370 375 380Thr Thr Ile Met Ala Leu Leu Thr Ser Val Leu His
Asp Asp Lys Glu385 390 395 400Phe Pro Asn Pro Asn Ile Phe Asp Pro
Gly His Phe Leu Asp Lys Asn 405 410 415Gly Asn Phe Lys Lys Ser Asp
Tyr Phe Met Pro Phe Ser Ala Gly Lys 420 425 430Arg Ile Cys Ala Gly
Glu Gly Leu Ala Arg Met Glu Leu Phe Leu Phe 435 440 445Leu Thr Thr
Ile Leu Gln Asn Phe Asn Leu Lys Ser Val Asp Asp Leu 450 455 460Lys
Asn Leu Asn Thr Thr Ala Val Thr Lys Gly Ile Val Ser Leu Pro465 470
475 480Pro Ser Tyr Gln Ile Cys Phe Ile Pro Val 485 490
* * * * *