U.S. patent application number 12/834628 was filed with the patent office on 2011-06-02 for organic compounds.
Invention is credited to Christophe Barthe, Pascale Cony-Makhoul, Amie Corbin, Brian Jay Druker, Harald Gschaidmeier, Michael Hallek, Andreas Hochhaus, Dieter Hoelzer, Wolf-Karsten Hofmann, Phillip Koeffler, Sebastian Kreil, Francois-Xavier Mahon, Martin Muller, Oliver Gerhard Ottmann, Sven De Vos, Markus Warmuth.
Application Number | 20110129852 12/834628 |
Document ID | / |
Family ID | 29552935 |
Filed Date | 2011-06-02 |
United States Patent
Application |
20110129852 |
Kind Code |
A1 |
Barthe; Christophe ; et
al. |
June 2, 2011 |
ORGANIC COMPOUNDS
Abstract
The present invention relates to isolated polypeptides which
comprise an amino acid sequence consisting of a mutated functional
Abl kinase domain, said mutated functional kinase domain being
resistant to inhibition of its tyrosine kinase activity by
N-[4-methyl-3-(4-pyridin-3-yl-pyrimidin-2-ylamino)-phenyl]-4-(4-methyl-pi-
perazin-1-ylmethyl)-benzamide or a salt thereof, to the use of such
polypeptides to screen for compounds which inhibit the tyrosine
kinase activity of such polypeptides, to nucleic acid molecules
encoding such polypeptides, to recombinant vectors and host cells
comprising such nucleic acid molecules and to the use of such
nucleic acid molecules in the production of such polypeptides for
use in screening for compounds which inhibit the tyrosine kinase
activity of such polypeptides.
Inventors: |
Barthe; Christophe;
(Merignac, FR) ; Cony-Makhoul; Pascale; (Annecy,
FR) ; Corbin; Amie; (Portland, OR) ; Vos; Sven
De; (Santa Monica, CA) ; Druker; Brian Jay;
(Portland, OR) ; Gschaidmeier; Harald; (Numberg,
DE) ; Hallek; Michael; (Schondorf, DE) ;
Hochhaus; Andreas; (Mannheim, DE) ; Hoelzer;
Dieter; (Frankfurt/Main, DE) ; Hofmann;
Wolf-Karsten; (Goldbach, DE) ; Koeffler; Phillip;
(Los Angeles, CA) ; Kreil; Sebastian; (Mannheim,
DE) ; Mahon; Francois-Xavier; (Bordeaux, FR) ;
Muller; Martin; (Heidelberg, DE) ; Ottmann; Oliver
Gerhard; (Frankfurt/Main, DE) ; Warmuth; Markus;
(Starnberg, DE) |
Family ID: |
29552935 |
Appl. No.: |
12/834628 |
Filed: |
July 12, 2010 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12337322 |
Dec 17, 2008 |
|
|
|
12834628 |
|
|
|
|
11343891 |
Jan 31, 2006 |
|
|
|
12337322 |
|
|
|
|
10263480 |
Oct 3, 2002 |
|
|
|
11343891 |
|
|
|
|
60327387 |
Oct 5, 2001 |
|
|
|
Current U.S.
Class: |
435/7.8 ;
435/194; 435/320.1; 435/325; 536/23.2 |
Current CPC
Class: |
C12Q 1/485 20130101;
C07K 14/82 20130101; C12Q 1/6886 20130101; G01N 33/57426 20130101;
G01N 2333/82 20130101; C12Q 2600/106 20130101; C12N 9/12
20130101 |
Class at
Publication: |
435/7.8 ;
536/23.2; 435/194; 435/320.1; 435/325 |
International
Class: |
C12N 9/12 20060101
C12N009/12; C07H 21/04 20060101 C07H021/04; G01N 33/53 20060101
G01N033/53; C12N 15/63 20060101 C12N015/63; C12N 5/10 20060101
C12N005/10 |
Claims
1. An isolated polypeptide which comprises a mutated functional Abl
kinase domain that is resistant to inhibition of its tyrosine
kinase activity by
N-[4-methyl-3-(4-pyridin-3-yl-pyrimidin-2-ylamino)-phenyl]-4-(4-methyl-pi-
perazin-1-ylmethyl)-benzamide or a salt thereof.
2. An isolated polypeptide according to claim 1, wherein the
mutated functional Abl kinase domain comprises the amino acid
sequence of the native human Abl kinase domain or an essentially
similar sequence thereof in which at least one amino acid is
replaced by another amino acid.
3. An isolated polypeptide according to claim 2, wherein in the
amino acid sequence of the native human Abl kinase domain or an
essentially similar sequence thereof at least one amino acid
selected from Leu248, Glu255, Lys271, Glu286, Met290, Thr315,
Tyr320, Asn322, Glu373, His375 and Ala380 is replaced by another
amino acid.
4. An isolated polypeptide according to claim 3, wherein in the
amino acid sequence of the native human Abl kinase domain or an
essentially similar sequence thereof at least one amino acid
selected from Leu248, Glu255, Lys271, Glu286, Met290, Tyr320,
Asn322, Glu373, His375 and Ala380 is replaced by another amino
acid.
5. An isolated polypeptide according to claim 4, wherein in the
amino acid sequence of the native human Abl kinase domain or an
essentially similar sequence thereof at least one amino acid
selected from Leu248, Lys271, Glu286, Met290, Tyr320, Asn322,
Glu373, His375 and Ala380 is replaced by another amino acid.
6. An isolated polypeptide according to claim 3, wherein in the
amino acid sequence of the native human Abl kinase domain or an
essentially similar sequence thereof at least one amino acid
selected from Glu255, Thr315 and Ala380 is replaced by another
amino acid.
7. An isolated polypeptide according to claim 6, wherein in the
amino acid sequence of the native human Abl kinase domain or an
essentially similar sequence thereof at least one amino acid
selected from Glu255 and Ala380 is replaced by another amino
acid.
8. An isolated polypeptide according to claim 2, wherein in the
amino acid sequence of the native human Abl kinase domain or an
essentially similar sequence thereof a single amino acid is
replaced by another amino acid.
9. An isolated polypeptide according to claim 7, wherein in the
amino acid sequence of the native human Abl kinase domain or an
essentially similar sequence thereof Glu255 is replaced by another
amino acid.
10. An isolated polypeptide according to claim 3, wherein the amino
acid sequence of the native human Abl kinase domain or an
essentially similar sequence thereof contains at least one amino
acid mutation selected from Glu255Val, Glu255Lys, Thr315Val,
Thr315Leu, Thr315Met, Thr315Gln, Thr315Phe and Ala380Thr.
11. An isolated polypeptide according to claim 10, wherein the
amino acid sequence of the native human Abl kinase domain or an
essentially similar sequence thereof contains at least one amino
acid mutation selected from Glu255Val, Thr315Val, Thr315Leu,
Thr315Met, Thr315Gln, Thr315Phe and Ala380Thr.
12. An isolated polypeptide according to claim 11, wherein the
amino acid sequence of the native human Abl kinase domain or an
essentially similar sequence thereof contains at least one amino
acid mutation selected from Thr315Leu, Thr315Met, Thr315Gln and
Thr315Phe.
13. An isolated polypeptide according to claim 10, wherein the
amino acid sequence of the native human Abl kinase domain or an
essentially similar sequence thereof contains a single amino acid
mutation.
14. An isolated polypeptide according to claim 11, wherein the
amino acid sequence of the native human Abl kinase domain or an
essentially similar sequence thereof contains the amino acid
mutation Glu255Val.
15. An isolated polypeptide according to claim 2, wherein the amino
acid sequence of the native human Abl kinase domain consists of
amino acids 229-500 of SEQ ID NO:2.
16. An isolated polypeptide according to claim 2, which is a
Bcr-Abl tyrosine kinase.
17. Use of a polypeptide according to claim 2 to screen for
compounds which inhibit the tyrosine kinase activity of said
polypeptide.
18. An isolated nucleic acid molecule comprising a nucleotide
sequence that encodes a polypeptide according to claim 2.
19. Use of a nucleic acid molecule according to claim 18 in the
production of a polypeptide according to claim 2 for use in
screening for compounds which inhibit the tyrosine kinase activity
of said polypeptide.
20. A recombinant vector comprising a nucleic acid molecule
according to claim 18.
21. A recombinant vector according to claim 20, which is a
recombinant expression vector.
22. A host cell comprising a recombinant vector according to claim
20.
Description
[0001] This application is a Continuation Application of Ser. No.
11/343,891, filed Jan. 31, 2006, which is a Continuation
Application of Ser. No. 10/263,480, filed Oct. 3, 2002, which
claims benefit of Provisional Application No. 60/327,387, filed
Oct. 5, 2001.
FIELD OF THE INVENTION
[0002] This invention relates to isolated polypeptides which
comprise an amino acid sequence consisting of a mutated functional
Abl kinase domain, said mutated functional kinase domain being
resistant to inhibition of its tyrosine kinase activity by
N-[4-methyl-3-(4-pyridin-3-yl-pyrimidin-2-ylamino)-phenyl]-4-(4-methyl-pi-
perazin-1-ylmethyl)-benzamide or a salt thereof, to the use of such
polypeptides to screen for compounds which inhibit the tyrosine
kinase activity of such polypeptides, to nucleic acid molecules
encoding such polypeptides, to recombinant vectors and host cells
comprising such nucleic acid molecules and to the use of such
nucleic acid molecules in the production of such polypeptides for
use in screening for compounds which inhibit the tyrosine kinase
activity of such polypeptides.
BACKGROUND OF THE INVENTION
[0003] Bcr-Abl, a constitutively activated tyrosine kinase
resulting from the formation of the Philadelphia chromosome [Nowell
P. C. and Hungerford D. A., Science 132, 1497 (1960)] by reciprocal
translocation between the long arms of chromosomes 9 and 22 [Rowley
J. D., Nature 243, 290-293 (1973)], has been established as the
characteristic molecular abnormality present in virtually all cases
of chronic myeloid leukemia (CML) and up to 20 percent of adult
acute lymphoblastic leukemia (ALL) [Faderl S. et al., N Engl J Med
341, 164-172 (1999); Sawyers C. L., N Engl J Med 340, 1330-1340
(1999)]. Bcr-Abl is sufficient to cause CML in mice [Daley G. Q. et
al., Science 247, 824-830 (1990)] and its transforming capacity is
absolutely dependent on tyrosine kinase activity [Lugo T. G. et
al., Science 247, 1079 (1990)]. The compound
N-[4-methyl-3-(4-pyridin-3-yl-pyrimidin-2-ylamino)-phenyl]-4-(4-methyl-pi-
perazin-1-ylmethyl)-benzamide (hereinafter also referred to as
"STI571"; STI571 is described in EP 0 564 409 and, in the form of
the methane sulfonate salt, in WO 99/03854), a competitive
inhibitor at the ATP-binding site of Bcr-Abl, as well as of the
receptor for platelet-derived growth factor, and c-kit tyrosine
kinase [Lugo T. G. et al., Science 247, 1079 (1990)], has been
shown to be capable of very rapidly reversing the clinical and
hematological abnormalities of CML in chronic phase and in blast
crisis as well as of Ph-chromosome-positive (Ph+) acute
lymphoblastic leukemia (Ph+ALL) [Druker B. J. et al., N Engl J Med
344, 1031-1037 (2001); Druker B. J. et al., N Engl J Med 344,
1038-1042 (2001)]. Whereas almost all chronic phase CML patients
durably respond, remissions in CML blast crisis and Ph+ ALL are
transient, and most patients relapse after several months, despite
continued therapy with STI571 [Druker B. J. et al., N Engl J Med
344, 1038-1042 (2001)]. The mechanism of resistance to STI571 is
subject of intense research. I was now surprisingly found that
mutations present in the kinase domain of the Bcr-Abl gene of
patients suffering from CML or Ph+ ALL account for the biological
resistance of these patients towards STI571 treatment in that said
mutations lead to resistance of the Bcr-Abl tyrosine kinase towards
inhibition by STI571.
[0004] These findings are extremely valuable in e.g. finding new
compounds or combinations of compounds which are capable to
overcome resistance towards treatment with STI571. Moreover,
knowledge of such mutations is also very useful in the diagnosis of
Ph+ leukemias in that it allows e.g. the detection of
drug-resistant clones before clinical relapse of the patient.
DEFINITIONS
[0005] Within the context of this disclosure the following
expressions, terms and abbreviations have the meanings as defined
below: [0006] In the expression "a mutated functional Abl kinase
domain", the part "mutated Abl kinase domain" refers to the native
human Abl kinase domain containing mutations including amino acid
exchanges, amino acid deletions and/or amino acid additions. [0007]
In the expression "a mutated functional Abl kinase domain", the
term "functional" indicates that the respective kinase domain
possesses tyrosine kinase activity. Preferably, the kinase activity
of the mutated functional Abl kinase domain is in the range of that
of the native human Abl kinase domain. [0008] In the expression "a
mutated functional Abl kinase domain being resistant to inhibition
of its tyrosine kinase activity by STI571 or a salt thereof", the
term "resistant" means that STI571 inhibits the respective mutated
functional Abl kinase domain with an IC.sub.50 that is higher than
that of the native human Abl kinase domain, i.e. higher than about
0.025 .mu.M, preferably higher than about 0.15 .mu.M, more
preferably higher than about 0.25 .mu.M, most preferably higher
than about 5 .mu.M. [0009] In the expression "amino acid sequence
of the native human Abl kinase domain or an essentially similar
sequence thereof", the part "or an essentially similar sequence
thereof" refers to the amino acid sequence of the native human Abl
kinase domain containing mutations, including amino acid exchanges,
amino acid deletions and/or amino acid additions, that are not
essential for the functionality of the kinase and its resistance to
inhibition by STI571 or a salt thereof within the meaning of the
term "functional" and "resistant" as defined hereinabove. [0010]
The expression "replaced by another amino acid" refers to the
replacement of a certain natural amino acid by another natural
amino acid. [0011] The names of the amino acids are either written
out or the one letter or three letter codes are used. Mutations are
referred to by accepted nomenclature, e.g. "Ala380Thr" or "380
Ala.fwdarw.Thr" both indicating that alanine at position 380 is
replaced by threonine. [0012] SEQ ID NO:1 represents the cDNA
coding for the native human Abl protein (human c-abl mRNA; GenBank
Accession No.: X16416). [0013] SEQ ID NO:2 represents the amino
acid sequence of the native human Abl protein (human c-Abl;
SwissProt Acc. No.: P00519). [0014] Unless indicated otherwise, the
number given for a certain amino acid refers to the numbering of
the amino acids in SEQ ID NO:2. In an amino acid sequence that is
essentially similar to the amino acid sequence of the native human
Abl kinase domain within the meaning as defined above, the amino
acids are numbered in accordance with the numbering of the amino
acids in SEQ ID NO:2. [0015] The term "isolated" means that the
material is removed from its original environment (e.g., the
natural environment if it is naturally occurring). [0016] A "host
cell", refers to a prokaryotic or eukaryotic cell that contains
heterologous DNA that has been introduced into the cell by any
means, e.g., electroporation, calcium phosphate precipitation,
microinjection, transformation, viral infection, and the like.
DESCRIPTION OF THE INVENTION
[0017] In practicing the present invention, many conventional
techniques in molecular biology, microbiology, and recombinant DNA
are used. These techniques are well known and are explained in, for
example, Current Protocols in Molecular Biology, Volumes I, II, and
III, 1997 (F. M. Ausubel ed.); Sambrook et al., 1989, Molecular
Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y.; DNA Cloning: A
Practical Approach, Volumes I and II, 1985 (D. N. Glover ed.);
Oligonucleotide Synthesis, 1984 (M. L. Gait ed.); Nucleic Acid
Hybridization, 1985, (Hames and Higgins); Transcription and
Translation, 1984 (Hames and Higgins eds.); Animal Cell Culture,
1986 (R. I. Freshney ed.); Immobilized Cells and Enzymes, 1986 (IRL
Press); Perbal, 1984, A Practical Guide to Molecular Cloning; the
series, Methods in Enzymology (Academic Press, Inc.); Gene Transfer
Vectors for Mammalian Cells, 1987 (J. H. Miller and M. P. Calos
eds., Cold Spring Harbor Laboratory); and Methods in Enzymology
Vol. 154 and Vol. 155 (Wu and Grossman, and Wu, eds.,
respectively).
[0018] In particular, the polypeptides of the present invention can
be produced by recombinant DNA technology using techniques
well-known in the art. Methods which are well known to those
skilled in the art can be used to construct expression vectors
containing the sequences encoding the polypeptides of the invention
and appropriate transcriptional/translational control signals. A
variety of host-expression vector systems can be utilized to
express the polypeptides of the invention.
(1) The invention relates to an isolated polypeptide which
comprises a mutated functional Abl kinase domain that is resistant
to inhibition of its tyrosine kinase activity by
N-[4-methyl-3-(4-pyridin-3-yl-pyrimidin-2-ylamino)-phenyl]-4-(4-methyl-pi-
perazin-1-ylmethyl)-benzamide or a salt thereof. (2) The invention
further relates in particular to an isolated polypeptide which
comprises a mutated functional Abl kinase domain comprising the
amino acid sequence of the native human Abl kinase domain or an
essentially similar sequence thereof in which at least one amino
acid is replaced by another amino acid, said mutated functional Abl
kinase domain being resistant to inhibition of its tyrosine kinase
activity by
N-[4-methyl-3-(4-pyridin-3-yl-pyrimidin-2-ylamino)-phenyl]-4-(4-methyl-pi-
perazin-1-ylmethyl)-benzamide or a salt thereof. (3) The invention
especially relates to an isolated polypeptide which comprises a
mutated functional Abl kinase domain comprising the amino acid
sequence of the native human Abl kinase domain or an essentially
similar sequence thereof in which at least one amino acid selected
from Leu248, Glu255, Lys271, Glu286, Met290, Thr315, Tyr320,
Asn322, Glu373, His 375 and Ala380 is replaced by another amino
acid, said mutated functional Abl kinase domain being resistant to
inhibition of its tyrosine kinase activity by
N-[4-methyl-3-(4-pyridin-3-yl-pyrimidin-2-ylamino)-phenyl]-4-(4-methyl-pi-
perazin-1-ylmethyl)-benzamide or a salt thereof. (4) A preferred
embodiment of the invention relates to an isolated polypeptide
which comprises a mutated functional Abl kinase domain comprising
the amino acid sequence of the native human Abl kinase domain or an
essentially similar sequence thereof in which at least one amino
acid selected from Leu248, Glu255, Lys271, Glu286, Met290, Tyr320,
Asn322, Glu373, His 375 and Ala380 is replaced by another amino
acid, said mutated functional Abl kinase domain being resistant to
inhibition of its tyrosine kinase activity by
N-[4-methyl-3-(4-pyridin-3-yl-pyrimidin-2-ylamino)-phenyl]-4-(4-methyl-pi-
perazin-1-ylmethyl)-benzamide or a salt thereof. (5) Another
preferred embodiment of the invention relates to an isolated
polypeptide which comprises a mutated functional Abl kinase domain
comprising the amino acid sequence of the native human Abl kinase
domain or an essentially similar sequence thereof in which at least
one amino acid selected from Leu248, Lys271, Glu286, Met290,
Tyr320, Asn322, Glu373, His 375 and Ala380 is replaced by another
amino acid, said mutated functional Abl kinase domain being
resistant to inhibition of its tyrosine kinase activity by
N-[4-methyl-3-(4-pyridin-3-yl-pyrimidin-2-ylamino)-phenyl]-4-(4-methyl-pi-
perazin-1-ylmethyl)-benzamide or a salt thereof. (6) Another
especially preferred embodiment of the invention relates to an
isolated polypeptide which comprises a mutated functional Abl
kinase domain comprising the amino acid sequence of the native
human Abl kinase domain or an essentially similar sequence thereof
in which at least one amino acid selected from Glu255, Thr315 and
Ala380 is replaced by another amino acid, said mutated functional
Abl kinase domain being resistant to inhibition of its tyrosine
kinase activity by
N-[4-methyl-3-(4-pyridin-3-yl-pyrimidin-2-ylamino)-phenyl]-4-(4-methyl-pi-
perazin-1-ylmethyl)-benzamide or a salt thereof. (7) Another very
preferred embodiment of the invention relates to an isolated
polypeptide which comprises a mutated functional Abl kinase domain
comprising the amino acid sequence of the native human Abl kinase
domain or an essentially similar sequence thereof in which at least
one amino acid selected from Glu255 and Ala380 is replaced by
another amino acid, said mutated functional Abl kinase domain being
resistant to inhibition of its tyrosine kinase activity by
N-[4-methyl-3-(4-pyridin-3-yl-pyrimidin-2-ylamino)-phenyl]-4-(4-methyl-pi-
perazin-1-ylmethyl)-benzamide or a salt thereof. (8) Most
preferably the invention relates to an isolated polypeptide
according to any one of the preceding paragraphs (2)-(7), wherein
in the amino acid sequence of the native human Abl kinase domain or
an essentially similar sequence thereof a single amino acid is
replaced by another amino acid. (9) The invention relates very
especially preferred to an isolated polypeptide which comprises a
mutated functional Abl kinase domain comprising the amino acid
sequence of the native human Abl kinase domain or an essentially
similar sequence thereof in which Glu255 is replaced by another
amino acid, said mutated functional Abl kinase domain being
resistant to inhibition of its tyrosine kinase activity by
N-[4-methyl-3-(4-pyridin-3-yl-pyrimidin-2-ylamino)-phenyl]-4-(4-methyl-pi-
perazin-1-ylmethyl)-benzamide or a salt thereof. (10) Most
especially preferred the invention relates to an isolated
polypeptide which comprises a mutated functional Abl kinase domain
comprising the amino acid sequence of the native human Abl kinase
domain or an essentially similar sequence thereof that contains at
least one amino acid mutation selected from Glu255Val, Glu255Lys,
Thr315Val, Thr315Leu, Thr315Met, Thr315Gln, Thr315Phe and
Ala380Thr, said mutated functional Abl kinase domain being
resistant to inhibition of its tyrosine kinase activity by
N-[4-methyl-3-(4-pyridin-3-yl-pyrimidin-2-ylamino)-phenyl]-4-(4-methyl-pi-
perazin-1-ylmethyl)-benzamide or a salt thereof. (11) In a further
very preferred embodiment the invention relates to an isolated
polypeptide which comprises a mutated functional Abl kinase domain
comprising the amino acid sequence of the native human Abl kinase
domain or an essentially similar sequence thereof that contains at
least one amino acid mutation selected from Glu255Val, Thr315Val,
Thr315Leu, Thr315Met, Thr315Gln, Thr315Phe and Ala380Thr, said
mutated functional Abl kinase domain being resistant to inhibition
of its tyrosine kinase activity by
N-[4-methyl-3-(4-pyridin-3-yl-pyrimidin-2-ylamino)-phenyl]-4-(4-methyl-pi-
perazin-1-ylmethyl)-benzamide or a salt thereof. (12) In another
especially preferred embodiment the invention relates to an
isolated polypeptide which comprises a mutated functional Abl
kinase domain comprising the amino acid sequence of the native
human Abl kinase domain or an essentially similar sequence thereof
that contains at least one amino acid mutation selected from
Thr315Leu, Thr315Met, Thr315Gln and Thr315Phe, said mutated
functional Abl kinase domain being resistant to inhibition of its
tyrosine kinase activity by
N-[4-methyl-3-(4-pyridin-3-yl-pyrimidin-2-ylamino)-phenyl]-4-(4-methyl-pi-
perazin-1-ylmethyl)-benzamide or a salt thereof. (13) Most
preferably the invention relates to an isolated polypeptide
according to any one of the preceding paragraphs (10)-(12), wherein
the amino acid sequence of the native human Abl kinase domain or an
essentially similar sequence thereof contains a single amino acid
mutation. (14) Preferred above all the invention relates to an
isolated polypeptide which comprises a mutated functional Abl
kinase domain comprising the amino acid sequence of the native
human Abl kinase domain or an essentially similar sequence thereof
that contains the amino acid mutation Glu255Val, said mutated
functional Abl kinase domain being resistant to inhibition of its
tyrosine kinase activity by
N-[4-methyl-3-(4-pyridin-3-yl-pyrimidin-2-ylamino)-phenyl]-4-(4-methyl-pi-
perazin-1-ylmethyl)-benzamide or a salt thereof. (15) In a
preferred embodiment the invention relates to an isolated
polypeptide according to any one of the preceding paragraphs
(2)-(14), wherein the amino acid sequence of the native human Abl
kinase domain consists of amino acids 229-500 of SEQ ID NO:2. (16)
In another preferred embodiment the invention relates to an
isolated polypeptide according to any one of the preceding
paragraphs (2)-(15), said isolated polypeptide being a Bcr-Abl
tyrosine kinase. (17) In yet another preferred embodiment the
invention relates to the use of an isolated polypeptide of any one
of the preceding paragraphs (2) to (16) to screen for compounds
which inhibit the tyrosine kinase activity of said polypeptide.
(18) The invention also relates to an isolated nucleic acid
molecule comprising a nucleotide sequence that encodes a
polypeptide according to any one of the preceding paragraphs
(2)-(16). (19) The invention further relates to the use of a
nucleic acid molecule of the preceding paragraph (18) in the
production of a polypeptide of any one of the preceding paragraphs
(2) to (16) for use in screening for compounds which inhibit the
tyrosine kinase activity of said polypeptide. (20) The invention
also relates to a recombinant vector comprising a nucleic acid
molecule according to the preceding paragraph (18). (21) The
invention further relates especially to a recombinant vector
according to the preceding paragraph (20), which is a recombinant
expression vector. (22) The invention also relates to a host cell
comprising a recombinant vector according to the preceding
paragraph (20) or (21).
[0019] Preferably the invention relates to an isolated polypeptide
which comprises a mutated functional Abl kinase domain comprising
the amino acid sequence of the native human Abl kinase domain in
which at least one amino acid is replaced by another amino acid,
said mutated functional Abl kinase domain being resistant to
inhibition of its tyrosine kinase activity by
N-[4-methyl-3-(4-pyridin-3-yl-pyrimidin-2-ylamino)-phenyl]-4-(4-methyl-pi-
perazin-1-ylmethyl)-benzamide or a salt thereof.
[0020] Most preferred are the mutations described herein, which are
present in patients who suffer from Philadelphia
chromosome-positive leukemia and are resistant against treatment
with STI571.
[0021] A preferred salt of STI571 is the methane sulfonate salt
described in WO 99/03854.
[0022] Screening for compounds which inhibit the tyrosine kinase
activity of the polypeptides of the invention may be done for
example by using an isolated polypeptide of the invention in any in
vitro tyrosine kinase phosphorylation assay known in the art and
determining the potential of a compound to inhibit the tyrosine
kinase activity of a polypeptide of the invention in such an
assay.
[0023] High-throughput screening assays known in the art may be
used to screen large compound libraries for compounds which inhibit
the tyrosine kinase activity of the polypeptides of the
invention.
[0024] Besides the random screening of large compound libraries,
the polypeptides of the present invention may also be used in the
following screening approach: The 3-dimensional structure of a
polypeptide of the invention is determined by e.g. X-ray
crystallography. The atomic coordinates of a polypeptide of the
invention are then used to design a potential inhibitor. Said
potential inhibitor is then synthesized and tested for its ability
to inhibit the tyrosine kinase activity of the polypeptide of the
invention in any in vitro tyrosine kinase phosphorylation
assay.
EXAMPLES
[0025] The following Examples serve to illustrate the invention
without limiting its scope.
Example 1
Methods
Plasmids and Site Directed Mutagenesis:
[0026] The hybrid cDNA coding for HckAblSH1 was cloned by
amplifying the respective DNA fragments from pUC.DELTA.NdeI/XbaIHck
[Warmuth M. et al., J. Biol. Chem. 272, 33260-70 (1997)] and
pcDNA3bcr-abl. These fragments were ligated blunt end to yield
pUC.DELTA.NdeI/XbaIhckablSH1. Because of its relatively small size
when compared to Bcr-Abl or c-Abl, this construct, hckAblSH1,
allowed to introduce point mutations into the kinase domain of Abl
by a one step cloning procedure. Point mutations were introduced
into hckablSH1 using the QuickChange site directed mutagenesis
protocol from Stratagene (La Jolla, Calif.). In order to introduce
point mutations into Bcr-Abl, a KpnI/Eco47III-subfragment of
Bcr-Abl containing the sequence coding for Bcr-Abl's kinase domain
was cloned into pUC.DELTA.NdeI/XbaI engineered by site directed
mutagenesis to contain an Eco47III site in the polylinker. After
introduction of point mutations, this fragment was first recloned
into pcDNA3abl. Thereafter, the 5' part of abl up to the KpnI site
was substituted by Bcr coding sequences using a KpnI-fragment from
pcDNA3bcr-abl. All mutations were confirmed by sequencing. For
expression in Cos7 and 32D cells cDNAs were cloned into pApuro.
Cell Lines:
[0027] Parental 32D cells as well as 32D cells expressing Bcr-Abl
and mutants thereof (32Dp210) were grown in Iscove's modified
dulbeccos media (IMDM) supplemented with 10% FBS. COS7 cells were
cultured in Dulbecco's modified eagle medium (DMEM) containing 4.5
g/l glucose) and supplemented with 10% FBS. All media and FBS were
purchased from Gibco Life Technologies, Inc, Karlsruhe,
Germany.
Transfection of Cells:
[0028] Cos7 cells were transfected using Effecten.RTM. transfection
reagent as to the guidelines of the manufacturer (Quiagen, Hilden,
Germany). 32D cells were transfected by electroporation. Puromycin
was used for selection at a concentration of 1 .mu.g/ml.
Cell Lysis:
[0029] Cos7 cells were lysed as described recently [Warmuth M. et
al., J. Biol. Chem. 272, 33260-70 (1997)]. For lysis, exponentially
growing 32D cells were harvested and washed twice in cold PBS. For
experiments evaluating the activity profile of STI571, cells were
incubated with the indicated concentrations of inhibitor or with
DMSO at a density of 5.times.10.sup.6 cells/ml for 1.5-2 h.
10.sup.7 cells were lysed in 100 .mu.l of lysis buffer containing
1% NP-40, 20 mM Tris (pH 8.0), 50 mM NaCl, and 10 mM EDTA, 1 mM
phenylmethylsulfonylfluorid, 10 .mu.g/ml aprotinin, 10 .mu.g/ml
leupeptin, and 2 mM sodium orthovanadate. After resuspension in
lysis buffer, cells were incubated for 25 min on ice. Finally,
unsoluble material was removed by centrifugation at 15,000 g.
Clarified lysates were checked for protein concentrations using a
BioRad protein assay.
Immunoprecipitation:
[0030] For immunoprecipitation 150 .mu.l of standardized 32D cell
lysate was diluted by addition of 450 .mu.l of incubation buffer
containing 20 mM Tris (pH 8.0), 50 mM NaCl, and 10 mM EDTA, 1 mM
phenylmethylsulfonylfluorid, 10 .mu.g/ml aprotinin, 10 .mu.g/ml
leupeptin, and 2 mM sodium orthovanadate and incubated with 5 .mu.g
of the indicated antibodies for 2 hours on a overhead rotor at
4.degree. C. Sepharose A beads (Pharmacia Biotech Inc., Freiburg,
Germany) were prepared by washing twice in IP buffer [0.1% NP-40,
20 mM Tris (pH 8.0), 50 mM NaCl, and 10 mM EDTA, 1 mM
phenylmethylsulfonylfluorid, 10 .mu.g/ml aprotinin, 10 .mu.g/ml
leupeptin, and 2 mM sodium orthovanadate] and added to each sample
for 2 additional hours. Finally, the immunoprepicitates were washed
three times in IP buffer, subsequently boiled in 2.times. sample
buffer and prepared for SDS-PAGE.
Gel Electrophoresis and Immunoblotting:
[0031] Gel electrophoresis and immunoblotting were performed as
described [Danhauser-Riedl S. et al., Cancer Res. 56, 3589-96
(1996); Warmuth M. et al., J. Biol. Chem. 272, 33260-70 (1997)]
with some minor modifications. Proteins were routinely blotted on
nitrocellulose membranes (Schleicher & Schuell, Dassel,
Germany). Membranes were blocked in 5% milk powder for 1 h. Primary
and secondary antibodies were diluted 1:500 to 1:5000 in TBS
containing 1% milk powder. Proteins were detected using the ECL or
ECL Plus detection system as recommended by the manufacturer
(Amersham, Braunschweig, Germany).
Detection of Apoptosis by Flow Cytometry:
[0032] For assessing apoptosis induced by the various kinase
inhibitors, cells were incubated with the indicated concentrations
of STI571 at a density of 5.times.10.sup.4 per ml. Apoptosis was
routinely assessed by measuring the binding of FITC-conjugated
Annexin V to the membranes of apoptosing cells. About
5.times.10.sup.4 cells were taken at the indicated time points and
washed once in PBS. Thereafter, cells were resuspended in 195 .mu.l
of Annexin V binding buffer and 5 .mu.l of Annexin V-FITC (Bender
MedSystems Diagnostics, Vienna, Austria) were added. Cells were
mixed and incubated at room temperature for 10-20 min. Afterwards,
cells were pelleted again, washed once and resuspended in 190 .mu.l
of Annexin V binding buffer. 10 .mu.l of a 20 .mu.g/ml propidium
iodide stock solution were added and the ratio of Annexin
V-positive to negative cells was determined by FACS-analysis using
a Coulter EPICS XL 4-color cytometer.
Results:
[0033] Mutations to either Valine (V), Leucine (L), Isoleucine (I),
Methionine (M), Glutamine (Q) or Phenylalanine (F) at position 315
and to either Serine (S), Cysteine (C) or Threonine (T) at position
380 were generated in a hybrid kinase, HckAblSH1, consisting of the
SH2 and SH3 domain of Hck and the SH1/kinase domain of Abl. When
expressed in Cos7 cells, these hybrid kinases and all mutants at
position 315 and 380 showed a high spontaneous kinase activity,
proving that these positions are not critical for ATP binding
(Table 1). In marked contrast, when tested for inhibition by
STI571, no inhibition was seen with up to 10 .mu.M of compound for
the mutants T315L, T3151, T315M, T315Q and T315F (Table 1), whereas
HckAblSH1 wild-type (wt) could be inhibited with similar kinetics
by STI571 as were found for Bcr-Abl (IC50 cellular tyrosine
phosphorylation (IC50.sub.CTP) approx. 0.5 .mu.M). The mutants
T315V and A380T retained some partial sensitivity but IC50.sub.CTP
values were still higher than 10 .mu.M. In contrast, the mutants
A380S and A380C displayed sensitivity to STI571, which was
comparable to HckAblSH1 wt (see Table 1 for summary).
TABLE-US-00001 TABLE 1 Influence of mutations of T315 and A380 of
HckAbISH1 on kinase activity and inhibiton by STI571 kinase
activity Inhibition by STI571 T315V +++ IC50 > 10 T315L +++ CR
T315I +++ CR T315M ++++ CR T315Q ++ CR T315F ++ CR A380C +++ NS
A380S +++ NS A380T + IC50 > 10 All data based on inhibiton of
cellular tyrosine phosphorylation of transiently transfected Cos7
cells determined by Western blot analysis using the monoclonal
.alpha.-phosphotyrosine antibody PY99. IC50 values were determined
using scion image software. Complete remission (CR) was defined as
no detectable reduction of cellular tyrosine phosphrylation by 10
.mu.M STI571. NS (normal sensitivity) = inhibtion with similar
kinetics as HckAbISH1 wt.
[0034] Our data identify positions 315 and 380 as critical
gatekeepers for the binding pocket of STI571, which contribute to
define the sensitivity of individual protein kinases towards
STI571. For example, the STI571-insensitive receptor tyrosine
kinase Flt-3, which has high homology to the c-Kit and the PDGF-R
kinases, has a phenylalanine at the position homologous to T315,
which would, based on our data, not be in accordance with STI571
binding. In a similar way, the resistance of most other kinases
tested with STI571 could be explained. In order to investigate
whether and to what degree some of the above described point
mutations of the gatekeeper position T315 are able to induce
biological resistance towards STI571 we introduced into full length
Bcr-Abl the mutations T315V, T315L, T315I, T315M, T315Q and T315F.
When expressed in Cos7 cells all mutants displayed kinase activity
close to or similar to wild-type Bcr-Abl (Bcr-ABLwt). If tested for
inhibition by STI571, identical results were obtained as described
for the corresponding mutations in HckAblSH1 (Table 2). Similar to
Bcr-Ablwt, expression of these mutants in 32D, an IL-3-dependent,
hematopoietic cell line of murine origin, gave rise to cell lines
growing IL-3 independently. Exposure of 32 DBcr-Ablwt cells to 1 or
10 .mu.M STI571 lead to a rapid stop of proliferation and induction
of apoptotic cell death in more than 90% of cells. On the contrary,
if T315 mutant Bcr-Abl kinases, for example T315I, were expressed
the block in proliferation and the induction of apoptosis caused by
1 WI STI571 were completely abolished (Table 2) and the effects of
STI571 seen at 10 .mu.M were reduced to levels found in control
experiments using parental 32D cells grown in the presence of IL-3.
Phosphotyrosine blots of samples of cells expressing either wt or
mutant Bcr-Abl proteins confirmed that mutations at position 315
completely abolished the effect of STI571 on Abl auto- and
substrate phosphorylation, with the exception of T315V which was
still to some degree inhibited by STI571 but displayed a similar
biological phenotype as the other mutants (Table 2). This suggests
that the reminder biological activity of STI571 at 10 .mu.M was
rather due to cytotoxicity than to a reminder sensitivity of the
mutants or cross-reaction of STI571 with another tyrosine kinase.
In summary, all mutations lifted the IC50 for inhibition of
proliferation (IC50.sub.IOP) from 0.09 to approximately 7.5 .mu.M
and for inhibition of survival (IC50.sub.IOS) from 0.5 to more than
10 .mu.M (Table 2). Taken together, these data show that mutations
of "molecular gatekeeper" positions as described above are able to
confer complete biological resistance towards STI571 in a cell
culture model.
TABLE-US-00002 TABLE 2 Biochemical and biological characterization
of mutations of T315 in Bcr-Abl to amino acids with longer side
chains IC50 (.mu.M) cellular tyrosine Induction of factor- IC50
(.mu.M) IC50 (.mu.M) kinase phosphorylation independent growth
apoptosis proliferation mutant activity Cos7 32D in 32D 32D 32D
(32D) >10 7.5 wt +++ 0.25 0.25 yes 0.5 0.09 T315V +++ >10
>10 yes >10 7.5 T315L ++++ c.r. c.r. yes >10 7.5 T315I +++
c.r. c.r. yes >10 7.5 T315M ++++ c.r. c.r. yes >10 7.5 T315Q
+++ c.r. c.r. yes >10 7.5 T315F +++ c.r. c.r. yes >10 7.5
c.r.: complete remission (no detectable reduction of cellular
tyrosine phosphrylation by 10 .mu.M STI571)
Example 2
[0035] STI571 inhibits the Abl tyrosine kinase with an IC.sub.50 of
0.025 .mu.M for purified Bcr-Abl and c-Abl but not the fms or the
Src family kinases. The mechanism of inhibition is through
competitive inhibition of ATP binding. To better understand the
mechanism of specificity of the tyrosine kinase inhibitor the Abl
kinase was compared to a model of the Lck kinase domain. This model
predicts the following sites are critical for STI571 association:
L248, Y320, N322, E373, H375 and A380. Each of these residues were
changed to the corresponding residue in Src or fms and IC.sub.50
values for STI571 with each mutant were determined. L248A and H375L
yielded kinase inactive mutants, Y320K, N322S, E373N and A380G had
IC.sub.50 values identical to wild type Abl. A380T, however,
demonstrated an IC.sub.50 of 0.34 .mu.M suggesting that STI571
bound less efficiently when a larger residue replaced the alanine.
Recent crystallization of the Abl kinase domain with a related
inhibitor shows that the configuration of the activation loop of
the Abl kinase domain differs significantly from that of the Src
family kinases. This structure identifies K271, E286, M290, T315,
M318 and D381 as critical contacts of STI571. All of these residues
are conserved between Src and Abl. The last two of these bind
STI571 via their peptide backbone, thus mutants in these residues
cannot be created. The remainder of the residues were mutated to
residues lacking the potential for hydrogen bonding and IC.sub.50
values were determined. K271R, E286L and M290A were kinase
inactive. T315V had an IC.sub.50 value of 0.35 .mu.M, which is
consistent with the crystal structure of the Abl kinase domain
which predicts that the side chain of T315 forms a critical
hydrogen bond with STI571.
Example 3
[0036] A group of 32 patients who are either refractory to
treatment with STI571 or who relapsed whilst being treated were
investigated. The median duration of therapy was 95 days; prior to
STI571 treatment, two patients were in chronic phase, nine in
accelerated phase, 20 in myeloid and, and one in lymphoid blast
crisis of the disease. Reverse transcriptase-polymerase chain
reaction (RT-PCR) products specific for the Bcr-Abl tyrosine kinase
domain were sequenced (Heminested RT-PCR was performed to amplify
the sequence specifically coding for the Bcr-Abl tyrosine kinase:
1.sup.st step B2B ACAGAATTCCGCTGACCATCAATAAG and A7-
AGACGTCGGACTTGATGGAGAACT; 2.sup.nd step FA4+
AAGCGCAACAAGCCCACTGTCTAT and A7-).
[0037] An acquired A.fwdarw.T point mutation at position 58802
(GeneBank accession number U07563, locus HSABLGR3)--which results
in a Glu255Val substitution--was detected in one patient.
Restriction analysis of cDNA and genomic DNA (RT-PCR and genomic
PCR were performed using primers A4+ TCACCACGCTCCATTATCCA, A4-
CTTCCACACGCTCTCGTACA; Mnl I restriction digest of PCR products;
removal of an Mnl I restriction site as the result of the point
mutation A58802T) was used to confirm the presence of the mutation
and to track it during the course of treatment. Only wild-type Abl
sequence was present before the STI571 therapy. The patient was
treated with STI571 in late chronic phase, went into complete
hematologic remission, but progressed to blast crisis after five
months. Reactivation of Bcr-Abl was confirmed by Crkl
immunoblotting [K. Senechal, Mol. Cell. Biol. 18, 5082 (1998)]. The
relative proportion of phosphorylated Crkl (reflecting active
Bcr-Abl) was 49% before STI571 therapy, 24% at day 27, 28% at day
83, and 77% at the time of clinical resistance at day 166. The
biological significance of the Glu255Val change is determined by an
Abl autophosphorylation assay. STI571 inhibits wild-type Abl with
an IC.sub.50 of 0.025 .mu.M. The mutation leads to a virtual
insensitivity to STI571, with an IC.sub.50 of >5 .mu.M.
Example 4
[0038] The Bcr-Abl kinase domain from cells obtained from 12 CML
and Ph+ acute leukemia patients who relapsed while receiving STI571
was sequenced. A functional point-mutation in the kinase domain in
one case was identified. This was a G.fwdarw.A change that results
in a Glu.fwdarw.Lys substitution at position 255 of Abl.
Example 5
Patients and Sample Preparation
[0039] Thirty bone marrow samples from 21 patients with Ph+ ALL who
were enrolled into consecutive "Phase II study to determine the
safety and anti-leukemic effect of STI571 in adult patients with
Ph+acute leukemias" were analyzed. According to the study protocol,
these patients had relapsed ALL or were refractory after at least 2
cycles of standard chemotherapy. From all of the patients, samples
were obtained before beginning STI571 treatment: 13 of these
samples were from individuals who later were classified as good
responders to STI571 (Nos. 1-13, sensitive, S) including 12
patients with hematological complete remission (CR) and one patient
with partial remission (PR) but complete peripheral hematological
recovery (No. 1). Eight samples were collected from individuals who
later were found not to respond to STI571 (Nos. 14-21, primarily
resistant, R) including 6 patients without any hematological
response, one with cytoreduction in the bone marrow but persistent
peripheral leukemic cells (No. 20) and another with PR but
incomplete peripheral hematological recovery (No. 16). Matched bone
marrow samples from 9 patients (Nos. 1-5 and Nos. 14-17) were also
obtained while they were on treatment with STI571. Mononuclear
cells were separated by density gradient centrifugation through
Ficoll-Hypaque (Biochrom, Berlin, Germany). Total RNA was extracted
using the acid guanidium/phenol/chloroform method with minor
modifications [Puissant C. and Houdebine L. M., Biotechniques 8,
148-149 (1990)]. Only samples with leukemic blast cell infiltration
of more than 80% were included into the analysis.
Reverse Transcription Polymerase Chain Reaction and Sequencing
Analysis:
[0040] One microgram of total RNA was used for reverse
transcription (RT) by Superscript II RT (Life Technologies, Grand
Island, N.Y.) according to standard protocols. Primers specific for
the ATP binding site of ABL including the "loop" were designed
using gene bank information GI6382056: ATP-F 5'-GCG CM CM GCC CAC
TGT CT-3'; ATP-R 5'-GCA CTC CCT CAG GTA GTC CA-3' and LOOP-F 5'-TGG
ACT ACC TGA GGG AGT GC-3'; LOOP-R 5'-CGG TAG TCC TTC TCT AGC
AGC-3'. Oligonucleotides were synthesized by Life Technologies.
Polymerase chain reaction (PCR) was performed as described
previously [Hofmann W. K. et al., Leuk. Res. 25, 333-338 (2001)]
using an annealing temperature of 58.degree. C. PCR-products were
separated on a 2% agarose gel containing 0.3 mg/ml ethidium bromide
and purified using the QIAquick purification system (Qiagen,
Valencia, Calif.) according to the manufacturers protocol. The
purified DNA was directly sequenced in both directions (sense and
antisense) by the ABI PRISM dye terminator cycle sequencing
reaction (Perkin-Elmer, Foster, Calif.).
Results:
[0041] Analysis of the sequence of the ATP binding site revealed a
single point mutation at nucleotide 1127 (GI6382056) changing a G
to an A resulting in a substitution at codon 255 of Lys (mutant)
for a Glu (wild-type). This mutation was found in 6 samples from
patients after they were treated with STI571 (Nos. 1, 2, 4, 5, 15,
16) but mutations were not found in any other sample including the
matched samples from the patients before beginning treatment with
STI571 (Table 3). The change was verified by sequencing from both
the sense and antisense directions. In addition, one sample (No.
17) from a patient with an aberrant cALL had a single point
mutation at nucleotide 1308 changing a C to T resulting in a
substitution at codon 315 of isoleucine (mutant) for a threonine
(wild-type). This sample was unusual because the cells also
expressed CD33, a cell surface protein expressed on myeloid
cells.
[0042] Our data strongly suggest that E255K developed during
treatment with STI571. Our analysis of matched samples found, that
none of the samples from untreated patients (including sensitive
patients and those with primary resistance) had this mutation. In
contrast, six of 9 samples (67%) from these patients undergoing
treatment with STI571 had this substitution at E255. The overall
frequency of mutations in the ATP binding site was 7 of 9 (78%) in
our paired bone marrow samples from patients undergoing therapy
with STI571.
TABLE-US-00003 TABLE 3 Matched bone marrow samples: Development of
mutations in the region coding for the ATP binding site of ABL
during treatment of Ph+ ALL with STI571. ABS status ABS status
prior to treatment Response after treatment No. Diagnosis with
STI571 to STI571 with STI571 1 Ph+ cALL Wild type PR E255K 2 Ph+
cALL Wild type CR E255K 3 Ph+ cALL Wild type CR Wild type 4 Ph+
cALL Wild type CR E255K 5 Ph+ cALL Wild type CR E255K 14 Ph+ cALL
Wild type no Wild type 15 Ph+ cALL Wild type no E255K 16 Ph+ pre
B-ALL Wild type PR E255K 17 Ph+ cALL, Wild type no T315I CD33+ ABS,
ATP binding site; PR, partial remission; CR, complete remission;
Ph+ cALL, Philadelphia chromosome positive common ALL (CD10+).
Sequence CWU 1
1
213393DNAHomo sapiensCDS(1)..(3393) 1atg ttg gag atc tgc ctg aag
ctg gtg ggc tgc aaa tcc aag aag ggg 48Met Leu Glu Ile Cys Leu Lys
Leu Val Gly Cys Lys Ser Lys Lys Gly1 5 10 15ctg tcc tcg tcc tcc agc
tgt tat ctg gaa gaa gcc ctt cag cgg cca 96Leu Ser Ser Ser Ser Ser
Cys Tyr Leu Glu Glu Ala Leu Gln Arg Pro 20 25 30gta gca tct gac ttt
gag cct cag ggt ctg agt gaa gcc gct cgt tgg 144Val Ala Ser Asp Phe
Glu Pro Gln Gly Leu Ser Glu Ala Ala Arg Trp 35 40 45aac tcc aag gaa
aac ctt ctc gct gga ccc agt gaa aat gac ccc aac 192Asn Ser Lys Glu
Asn Leu Leu Ala Gly Pro Ser Glu Asn Asp Pro Asn 50 55 60ctt ttc gtt
gca ctg tat gat ttt gtg gcc agt gga gat aac act cta 240Leu Phe Val
Ala Leu Tyr Asp Phe Val Ala Ser Gly Asp Asn Thr Leu65 70 75 80agc
ata act aaa ggt gaa aag ctc cgg gtc tta ggc tat aat cac aat 288Ser
Ile Thr Lys Gly Glu Lys Leu Arg Val Leu Gly Tyr Asn His Asn 85 90
95ggg gaa tgg tgt gaa gcc caa acc aaa aat ggc caa ggc tgg gtc cca
336Gly Glu Trp Cys Glu Ala Gln Thr Lys Asn Gly Gln Gly Trp Val Pro
100 105 110agc aac tac atc acg cca gtc aac agt ctg gag aaa cac tcc
tgg tac 384Ser Asn Tyr Ile Thr Pro Val Asn Ser Leu Glu Lys His Ser
Trp Tyr 115 120 125cat ggg cct gtg tcc cgc aat gcc gct gag tat ctg
ctg agc agc ggg 432His Gly Pro Val Ser Arg Asn Ala Ala Glu Tyr Leu
Leu Ser Ser Gly 130 135 140atc aat ggc agc ttc ttg gtg cgt gag agt
gag agc agt cct ggc cag 480Ile Asn Gly Ser Phe Leu Val Arg Glu Ser
Glu Ser Ser Pro Gly Gln145 150 155 160agg tcc atc tcg ctg aga tac
gaa ggg agg gtg tac cat tac agg atc 528Arg Ser Ile Ser Leu Arg Tyr
Glu Gly Arg Val Tyr His Tyr Arg Ile 165 170 175aac act gct tct gat
ggc aag ctc tac gtc tcc tcc gag agc cgc ttc 576Asn Thr Ala Ser Asp
Gly Lys Leu Tyr Val Ser Ser Glu Ser Arg Phe 180 185 190aac acc ctg
gcc gag ttg gtt cat cat cat tca acg gtg gcc gac ggg 624Asn Thr Leu
Ala Glu Leu Val His His His Ser Thr Val Ala Asp Gly 195 200 205ctc
atc acc acg ctc cat tat cca gcc cca aag cgc aac aag ccc act 672Leu
Ile Thr Thr Leu His Tyr Pro Ala Pro Lys Arg Asn Lys Pro Thr 210 215
220gtc tat ggt gtg tcc ccc aac tac gac aag tgg gag atg gaa cgc acg
720Val Tyr Gly Val Ser Pro Asn Tyr Asp Lys Trp Glu Met Glu Arg
Thr225 230 235 240gac atc acc atg aag cac aag ctg ggc ggg ggc cag
tac ggg gag gtg 768Asp Ile Thr Met Lys His Lys Leu Gly Gly Gly Gln
Tyr Gly Glu Val 245 250 255tac gag ggc gtg tgg aag aaa tac agc ctg
acg gtg gcc gtg aag acc 816Tyr Glu Gly Val Trp Lys Lys Tyr Ser Leu
Thr Val Ala Val Lys Thr 260 265 270ttg aag gag gac acc atg gag gtg
gaa gag ttc ttg aaa gaa gct gca 864Leu Lys Glu Asp Thr Met Glu Val
Glu Glu Phe Leu Lys Glu Ala Ala 275 280 285gtc atg aaa gag atc aaa
cac cct aac ctg gtg cag ctc ctt ggg gtc 912Val Met Lys Glu Ile Lys
His Pro Asn Leu Val Gln Leu Leu Gly Val 290 295 300tgc acc cgg gag
ccc ccg ttc tat atc atc act gag ttc atg acc tac 960Cys Thr Arg Glu
Pro Pro Phe Tyr Ile Ile Thr Glu Phe Met Thr Tyr305 310 315 320ggg
aac ctc ctg gac tac ctg agg gag tgc aac cgg cag gag gtg aac 1008Gly
Asn Leu Leu Asp Tyr Leu Arg Glu Cys Asn Arg Gln Glu Val Asn 325 330
335gcc gtg gtg ctg ctg tac atg gcc act cag atc tcg tca gcc atg gag
1056Ala Val Val Leu Leu Tyr Met Ala Thr Gln Ile Ser Ser Ala Met Glu
340 345 350tac ctg gag aag aaa aac ttc atc cac aga gat ctt gct gcc
cga aac 1104Tyr Leu Glu Lys Lys Asn Phe Ile His Arg Asp Leu Ala Ala
Arg Asn 355 360 365tgc ctg gta ggg gag aac cac ttg gtg aag gta gct
gat ttt ggc ctg 1152Cys Leu Val Gly Glu Asn His Leu Val Lys Val Ala
Asp Phe Gly Leu 370 375 380agc agg ttg atg aca ggg gac acc tac aca
gcc cat gct gga gcc aag 1200Ser Arg Leu Met Thr Gly Asp Thr Tyr Thr
Ala His Ala Gly Ala Lys385 390 395 400ttc ccc atc aaa tgg act gca
ccc gag agc ctg gcc tac aac aag ttc 1248Phe Pro Ile Lys Trp Thr Ala
Pro Glu Ser Leu Ala Tyr Asn Lys Phe 405 410 415tcc atc aag tcc gac
gtc tgg gca ttt gga gta ttg ctt tgg gaa att 1296Ser Ile Lys Ser Asp
Val Trp Ala Phe Gly Val Leu Leu Trp Glu Ile 420 425 430gct acc tat
ggc atg tcc cct tac ccg gga att gac ctg tcc cag gtg 1344Ala Thr Tyr
Gly Met Ser Pro Tyr Pro Gly Ile Asp Leu Ser Gln Val 435 440 445tat
gag ctg cta gag aag gac tac cgc atg gag cgc cca gaa ggc tgc 1392Tyr
Glu Leu Leu Glu Lys Asp Tyr Arg Met Glu Arg Pro Glu Gly Cys 450 455
460cca gag aag gtc tat gaa ctc atg cga gca tgt tgg cag tgg aat ccc
1440Pro Glu Lys Val Tyr Glu Leu Met Arg Ala Cys Trp Gln Trp Asn
Pro465 470 475 480tct gac cgg ccc tcc ttt gct gaa atc cac caa gcc
ttt gaa aca atg 1488Ser Asp Arg Pro Ser Phe Ala Glu Ile His Gln Ala
Phe Glu Thr Met 485 490 495ttc cag gaa tcc agt atc tca gac gaa gtg
gaa aag gag ctg ggg aaa 1536Phe Gln Glu Ser Ser Ile Ser Asp Glu Val
Glu Lys Glu Leu Gly Lys 500 505 510caa ggc gtc cgt ggg gct gtg agt
acc ttg ctg cag gcc cca gag ctg 1584Gln Gly Val Arg Gly Ala Val Ser
Thr Leu Leu Gln Ala Pro Glu Leu 515 520 525ccc acc aag acg agg acc
tcc agg aga gct gca gag cac aga gac acc 1632Pro Thr Lys Thr Arg Thr
Ser Arg Arg Ala Ala Glu His Arg Asp Thr 530 535 540act gac gtg cct
gag atg cct cac tcc aag ggc cag gga gag agc gat 1680Thr Asp Val Pro
Glu Met Pro His Ser Lys Gly Gln Gly Glu Ser Asp545 550 555 560cct
ctg gac cat gag cct gcc gtg tct cca ttg ctc cct cga aaa gag 1728Pro
Leu Asp His Glu Pro Ala Val Ser Pro Leu Leu Pro Arg Lys Glu 565 570
575cga ggt ccc ccg gag ggc ggc ctg aat gaa gat gag cgc ctt ctc ccc
1776Arg Gly Pro Pro Glu Gly Gly Leu Asn Glu Asp Glu Arg Leu Leu Pro
580 585 590aaa gac aaa aag acc aac ttg ttc agc gcc ttg atc aag aag
aag aag 1824Lys Asp Lys Lys Thr Asn Leu Phe Ser Ala Leu Ile Lys Lys
Lys Lys 595 600 605aag aca gcc cca acc cct ccc aaa cgc agc agc tcc
ttc cgg gag atg 1872Lys Thr Ala Pro Thr Pro Pro Lys Arg Ser Ser Ser
Phe Arg Glu Met 610 615 620gac ggc cag ccg gag cgc aga ggg gcc ggc
gag gaa gag ggc cga gac 1920Asp Gly Gln Pro Glu Arg Arg Gly Ala Gly
Glu Glu Glu Gly Arg Asp625 630 635 640atc agc aac ggg gca ctg gct
ttc acc ccc ttg gac aca gct gac cca 1968Ile Ser Asn Gly Ala Leu Ala
Phe Thr Pro Leu Asp Thr Ala Asp Pro 645 650 655gcc aag tcc cca aag
ccc agc aat ggg gct ggg gtc ccc aat gga gcc 2016Ala Lys Ser Pro Lys
Pro Ser Asn Gly Ala Gly Val Pro Asn Gly Ala 660 665 670ctc cgg gag
tcc ggg ggc tca ggc ttc cgg tct ccc cac ctg tgg aag 2064Leu Arg Glu
Ser Gly Gly Ser Gly Phe Arg Ser Pro His Leu Trp Lys 675 680 685aag
tcc agc acg ctg acc agc agc cgc cta gcc acc ggc gag gag gag 2112Lys
Ser Ser Thr Leu Thr Ser Ser Arg Leu Ala Thr Gly Glu Glu Glu 690 695
700ggc ggt ggc agc tcc agc aag cgc ttc ctg cgc tct tgc tcc gcc tcc
2160Gly Gly Gly Ser Ser Ser Lys Arg Phe Leu Arg Ser Cys Ser Ala
Ser705 710 715 720tgc gtt ccc cat ggg gcc aag gac acg gag tgg agg
tca gtc acg ctg 2208Cys Val Pro His Gly Ala Lys Asp Thr Glu Trp Arg
Ser Val Thr Leu 725 730 735cct cgg gac ttg cag tcc acg gga aga cag
ttt gac tcg tcc aca ttt 2256Pro Arg Asp Leu Gln Ser Thr Gly Arg Gln
Phe Asp Ser Ser Thr Phe 740 745 750gga ggg cac aaa agt gag aag ccg
gct ctg cct cgg aag agg gca ggg 2304Gly Gly His Lys Ser Glu Lys Pro
Ala Leu Pro Arg Lys Arg Ala Gly 755 760 765gag aac agg tct gac cag
gtg acc cga ggc aca gta acg cct ccc ccc 2352Glu Asn Arg Ser Asp Gln
Val Thr Arg Gly Thr Val Thr Pro Pro Pro 770 775 780agg ctg gtg aaa
aag aat gag gaa gct gct gat gag gtc ttc aaa gac 2400Arg Leu Val Lys
Lys Asn Glu Glu Ala Ala Asp Glu Val Phe Lys Asp785 790 795 800atc
atg gag tcc agc ccg ggc tcc agc ccg ccc aac ctg act cca aaa 2448Ile
Met Glu Ser Ser Pro Gly Ser Ser Pro Pro Asn Leu Thr Pro Lys 805 810
815ccc ctc cgg cgg cag gtc acc gtg gcc cct gcc tcg ggc ctc ccc cac
2496Pro Leu Arg Arg Gln Val Thr Val Ala Pro Ala Ser Gly Leu Pro His
820 825 830aag gaa gaa gct gaa aag ggc agt gcc tta ggg acc cct gct
gca gct 2544Lys Glu Glu Ala Glu Lys Gly Ser Ala Leu Gly Thr Pro Ala
Ala Ala 835 840 845gag cca gtg acc ccc acc agc aaa gca ggc tca ggt
gca cca ggg ggc 2592Glu Pro Val Thr Pro Thr Ser Lys Ala Gly Ser Gly
Ala Pro Gly Gly 850 855 860acc agc aag ggc ccc gcc gag gag tcc aga
gtg agg agg cac aag cac 2640Thr Ser Lys Gly Pro Ala Glu Glu Ser Arg
Val Arg Arg His Lys His865 870 875 880tcc tct gag tcg cca ggg agg
gac aag ggg aaa ttg tcc agg ctc aaa 2688Ser Ser Glu Ser Pro Gly Arg
Asp Lys Gly Lys Leu Ser Arg Leu Lys 885 890 895cct gcc ccg ccg ccc
cca cca gca gcc tct gca ggg aag gct gga gga 2736Pro Ala Pro Pro Pro
Pro Pro Ala Ala Ser Ala Gly Lys Ala Gly Gly 900 905 910aag ccc tcg
cag agc ccg agc cag gag gcg gcc ggg gag gca gtc ctg 2784Lys Pro Ser
Gln Ser Pro Ser Gln Glu Ala Ala Gly Glu Ala Val Leu 915 920 925ggc
gca aag aca aaa gcc acg agt ctg gtt gat gct gtg aac agt gac 2832Gly
Ala Lys Thr Lys Ala Thr Ser Leu Val Asp Ala Val Asn Ser Asp 930 935
940gct gcc aag ccc agc cag ccg gga gag ggc ctc aaa aag ccc gtg ctc
2880Ala Ala Lys Pro Ser Gln Pro Gly Glu Gly Leu Lys Lys Pro Val
Leu945 950 955 960ccg gcc act cca aag cca cag tcc gcc aag ccg tcg
ggg acc ccc atc 2928Pro Ala Thr Pro Lys Pro Gln Ser Ala Lys Pro Ser
Gly Thr Pro Ile 965 970 975agc cca gcc ccc gtt ccc tcc acg ttg cca
tca gca tcc tcg gcc ctg 2976Ser Pro Ala Pro Val Pro Ser Thr Leu Pro
Ser Ala Ser Ser Ala Leu 980 985 990gca ggg gac cag ccg tct tcc act
gcc ttc atc cct ctc ata tca acc 3024Ala Gly Asp Gln Pro Ser Ser Thr
Ala Phe Ile Pro Leu Ile Ser Thr 995 1000 1005cga gtg tct ctt cgg
aaa acc cgc cag cct cca gag cgg atc gcc 3069Arg Val Ser Leu Arg Lys
Thr Arg Gln Pro Pro Glu Arg Ile Ala 1010 1015 1020agc ggc gcc atc
acc aag ggc gtg gtc ctg gac agc acc gag gcg 3114Ser Gly Ala Ile Thr
Lys Gly Val Val Leu Asp Ser Thr Glu Ala 1025 1030 1035ctg tgc ctc
gcc atc tct agg aac tcc gag cag atg gcc agc cac 3159Leu Cys Leu Ala
Ile Ser Arg Asn Ser Glu Gln Met Ala Ser His 1040 1045 1050agc gca
gtg ctg gag gcc ggc aaa aac ctc tac acg ttc tgc gtg 3204Ser Ala Val
Leu Glu Ala Gly Lys Asn Leu Tyr Thr Phe Cys Val 1055 1060 1065agc
tat gtg gat tcc atc cag caa atg agg aac aag ttt gcc ttc 3249Ser Tyr
Val Asp Ser Ile Gln Gln Met Arg Asn Lys Phe Ala Phe 1070 1075
1080cga gag gcc atc aac aaa ctg gag aat aat ctc cgg gag ctt cag
3294Arg Glu Ala Ile Asn Lys Leu Glu Asn Asn Leu Arg Glu Leu Gln
1085 1090 1095atc tgc ccg gcg aca gca ggc agt ggt ccg gcg gcc act
cag gac 3339Ile Cys Pro Ala Thr Ala Gly Ser Gly Pro Ala Ala Thr Gln
Asp 1100 1105 1110ttc agc aag ctc ctc agt tcg gtg aag gaa atc agt
gac ata gtg 3384Phe Ser Lys Leu Leu Ser Ser Val Lys Glu Ile Ser Asp
Ile Val 1115 1120 1125cag agg tag 3393Gln Arg 1130 21130PRTHomo
sapiens 2Met Leu Glu Ile Cys Leu Lys Leu Val Gly Cys Lys Ser Lys
Lys Gly1 5 10 15Leu Ser Ser Ser Ser Ser Cys Tyr Leu Glu Glu Ala Leu
Gln Arg Pro 20 25 30Val Ala Ser Asp Phe Glu Pro Gln Gly Leu Ser Glu
Ala Ala Arg Trp 35 40 45Asn Ser Lys Glu Asn Leu Leu Ala Gly Pro Ser
Glu Asn Asp Pro Asn 50 55 60Leu Phe Val Ala Leu Tyr Asp Phe Val Ala
Ser Gly Asp Asn Thr Leu65 70 75 80Ser Ile Thr Lys Gly Glu Lys Leu
Arg Val Leu Gly Tyr Asn His Asn 85 90 95Gly Glu Trp Cys Glu Ala Gln
Thr Lys Asn Gly Gln Gly Trp Val Pro 100 105 110Ser Asn Tyr Ile Thr
Pro Val Asn Ser Leu Glu Lys His Ser Trp Tyr 115 120 125His Gly Pro
Val Ser Arg Asn Ala Ala Glu Tyr Leu Leu Ser Ser Gly 130 135 140Ile
Asn Gly Ser Phe Leu Val Arg Glu Ser Glu Ser Ser Pro Gly Gln145 150
155 160Arg Ser Ile Ser Leu Arg Tyr Glu Gly Arg Val Tyr His Tyr Arg
Ile 165 170 175Asn Thr Ala Ser Asp Gly Lys Leu Tyr Val Ser Ser Glu
Ser Arg Phe 180 185 190Asn Thr Leu Ala Glu Leu Val His His His Ser
Thr Val Ala Asp Gly 195 200 205Leu Ile Thr Thr Leu His Tyr Pro Ala
Pro Lys Arg Asn Lys Pro Thr 210 215 220Val Tyr Gly Val Ser Pro Asn
Tyr Asp Lys Trp Glu Met Glu Arg Thr225 230 235 240Asp Ile Thr Met
Lys His Lys Leu Gly Gly Gly Gln Tyr Gly Glu Val 245 250 255Tyr Glu
Gly Val Trp Lys Lys Tyr Ser Leu Thr Val Ala Val Lys Thr 260 265
270Leu Lys Glu Asp Thr Met Glu Val Glu Glu Phe Leu Lys Glu Ala Ala
275 280 285Val Met Lys Glu Ile Lys His Pro Asn Leu Val Gln Leu Leu
Gly Val 290 295 300Cys Thr Arg Glu Pro Pro Phe Tyr Ile Ile Thr Glu
Phe Met Thr Tyr305 310 315 320Gly Asn Leu Leu Asp Tyr Leu Arg Glu
Cys Asn Arg Gln Glu Val Asn 325 330 335Ala Val Val Leu Leu Tyr Met
Ala Thr Gln Ile Ser Ser Ala Met Glu 340 345 350Tyr Leu Glu Lys Lys
Asn Phe Ile His Arg Asp Leu Ala Ala Arg Asn 355 360 365Cys Leu Val
Gly Glu Asn His Leu Val Lys Val Ala Asp Phe Gly Leu 370 375 380Ser
Arg Leu Met Thr Gly Asp Thr Tyr Thr Ala His Ala Gly Ala Lys385 390
395 400Phe Pro Ile Lys Trp Thr Ala Pro Glu Ser Leu Ala Tyr Asn Lys
Phe 405 410 415Ser Ile Lys Ser Asp Val Trp Ala Phe Gly Val Leu Leu
Trp Glu Ile 420 425 430Ala Thr Tyr Gly Met Ser Pro Tyr Pro Gly Ile
Asp Leu Ser Gln Val 435 440 445Tyr Glu Leu Leu Glu Lys Asp Tyr Arg
Met Glu Arg Pro Glu Gly Cys 450 455 460Pro Glu Lys Val Tyr Glu Leu
Met Arg Ala Cys Trp Gln Trp Asn Pro465 470 475 480Ser Asp Arg Pro
Ser Phe Ala Glu Ile His Gln Ala Phe Glu Thr Met 485 490 495Phe Gln
Glu Ser Ser Ile Ser Asp Glu Val Glu Lys Glu Leu Gly Lys 500 505
510Gln Gly Val Arg Gly Ala Val Ser Thr Leu Leu Gln Ala Pro Glu Leu
515 520 525Pro Thr Lys Thr Arg Thr Ser Arg Arg Ala Ala Glu His Arg
Asp Thr 530 535 540Thr Asp Val Pro Glu Met Pro His Ser Lys Gly Gln
Gly Glu Ser Asp545 550 555 560Pro Leu Asp His Glu Pro Ala Val Ser
Pro Leu Leu Pro Arg Lys Glu 565 570 575Arg Gly Pro Pro Glu Gly Gly
Leu Asn Glu Asp Glu Arg Leu Leu Pro 580 585 590Lys Asp Lys Lys Thr
Asn Leu Phe Ser Ala Leu Ile Lys Lys Lys Lys 595 600 605Lys Thr Ala
Pro Thr Pro Pro Lys Arg Ser Ser Ser Phe Arg Glu Met 610 615 620Asp
Gly Gln Pro Glu Arg Arg Gly Ala Gly Glu Glu Glu Gly Arg Asp625
630
635 640Ile Ser Asn Gly Ala Leu Ala Phe Thr Pro Leu Asp Thr Ala Asp
Pro 645 650 655Ala Lys Ser Pro Lys Pro Ser Asn Gly Ala Gly Val Pro
Asn Gly Ala 660 665 670Leu Arg Glu Ser Gly Gly Ser Gly Phe Arg Ser
Pro His Leu Trp Lys 675 680 685Lys Ser Ser Thr Leu Thr Ser Ser Arg
Leu Ala Thr Gly Glu Glu Glu 690 695 700Gly Gly Gly Ser Ser Ser Lys
Arg Phe Leu Arg Ser Cys Ser Ala Ser705 710 715 720Cys Val Pro His
Gly Ala Lys Asp Thr Glu Trp Arg Ser Val Thr Leu 725 730 735Pro Arg
Asp Leu Gln Ser Thr Gly Arg Gln Phe Asp Ser Ser Thr Phe 740 745
750Gly Gly His Lys Ser Glu Lys Pro Ala Leu Pro Arg Lys Arg Ala Gly
755 760 765Glu Asn Arg Ser Asp Gln Val Thr Arg Gly Thr Val Thr Pro
Pro Pro 770 775 780Arg Leu Val Lys Lys Asn Glu Glu Ala Ala Asp Glu
Val Phe Lys Asp785 790 795 800Ile Met Glu Ser Ser Pro Gly Ser Ser
Pro Pro Asn Leu Thr Pro Lys 805 810 815Pro Leu Arg Arg Gln Val Thr
Val Ala Pro Ala Ser Gly Leu Pro His 820 825 830Lys Glu Glu Ala Glu
Lys Gly Ser Ala Leu Gly Thr Pro Ala Ala Ala 835 840 845Glu Pro Val
Thr Pro Thr Ser Lys Ala Gly Ser Gly Ala Pro Gly Gly 850 855 860Thr
Ser Lys Gly Pro Ala Glu Glu Ser Arg Val Arg Arg His Lys His865 870
875 880Ser Ser Glu Ser Pro Gly Arg Asp Lys Gly Lys Leu Ser Arg Leu
Lys 885 890 895Pro Ala Pro Pro Pro Pro Pro Ala Ala Ser Ala Gly Lys
Ala Gly Gly 900 905 910Lys Pro Ser Gln Ser Pro Ser Gln Glu Ala Ala
Gly Glu Ala Val Leu 915 920 925Gly Ala Lys Thr Lys Ala Thr Ser Leu
Val Asp Ala Val Asn Ser Asp 930 935 940Ala Ala Lys Pro Ser Gln Pro
Gly Glu Gly Leu Lys Lys Pro Val Leu945 950 955 960Pro Ala Thr Pro
Lys Pro Gln Ser Ala Lys Pro Ser Gly Thr Pro Ile 965 970 975Ser Pro
Ala Pro Val Pro Ser Thr Leu Pro Ser Ala Ser Ser Ala Leu 980 985
990Ala Gly Asp Gln Pro Ser Ser Thr Ala Phe Ile Pro Leu Ile Ser Thr
995 1000 1005Arg Val Ser Leu Arg Lys Thr Arg Gln Pro Pro Glu Arg
Ile Ala 1010 1015 1020Ser Gly Ala Ile Thr Lys Gly Val Val Leu Asp
Ser Thr Glu Ala 1025 1030 1035Leu Cys Leu Ala Ile Ser Arg Asn Ser
Glu Gln Met Ala Ser His 1040 1045 1050Ser Ala Val Leu Glu Ala Gly
Lys Asn Leu Tyr Thr Phe Cys Val 1055 1060 1065Ser Tyr Val Asp Ser
Ile Gln Gln Met Arg Asn Lys Phe Ala Phe 1070 1075 1080Arg Glu Ala
Ile Asn Lys Leu Glu Asn Asn Leu Arg Glu Leu Gln 1085 1090 1095Ile
Cys Pro Ala Thr Ala Gly Ser Gly Pro Ala Ala Thr Gln Asp 1100 1105
1110Phe Ser Lys Leu Leu Ser Ser Val Lys Glu Ile Ser Asp Ile Val
1115 1120 1125Gln Arg 1130
* * * * *