U.S. patent application number 13/018546 was filed with the patent office on 2011-06-02 for antibody recognizing g protein, and agent and kit using the same.
This patent application is currently assigned to SUMITOMO CHEMICAL COMPANY, LTD.. Invention is credited to Yasuo Matsumoto, Kenji Oeda, Yasuhiko Takahashi.
Application Number | 20110129848 13/018546 |
Document ID | / |
Family ID | 29783092 |
Filed Date | 2011-06-02 |
United States Patent
Application |
20110129848 |
Kind Code |
A1 |
Takahashi; Yasuhiko ; et
al. |
June 2, 2011 |
Antibody Recognizing G Protein, and Agent and Kit Using the
Same
Abstract
A novel protein (Gm1) includes an amino acid sequence part
having a high homology with a domain having a high homology with a
GTP binding site and a GTPase site conserved among G protein
.alpha. subunits and a trimer forming domain conserved among G
protein .alpha. subunits. The Gm1 protein is involved in signal
transduction via a G protein-coupled receptor (GPCR) stimulation.
The Gm1 protein is expressed intensively in human brain, thymus,
testes, spleen, small intestine, uterus and heart. A method for
screening for a substance capable of regulating a cellular signal
transduction employs a polynucleotide encoding the Gm1 protein
Inventors: |
Takahashi; Yasuhiko; (Osaka,
JP) ; Matsumoto; Yasuo; (Osaka, JP) ; Oeda;
Kenji; (Kyoto, JP) |
Assignee: |
SUMITOMO CHEMICAL COMPANY,
LTD.
Osaka
JP
|
Family ID: |
29783092 |
Appl. No.: |
13/018546 |
Filed: |
February 1, 2011 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12118247 |
May 9, 2008 |
7893203 |
|
|
13018546 |
|
|
|
|
10618320 |
Jul 11, 2003 |
7371541 |
|
|
12118247 |
|
|
|
|
Current U.S.
Class: |
435/7.1 ;
530/387.9 |
Current CPC
Class: |
A61P 43/00 20180101;
C07K 14/4722 20130101 |
Class at
Publication: |
435/7.1 ;
530/387.9 |
International
Class: |
G01N 33/68 20060101
G01N033/68; C07K 16/18 20060101 C07K016/18 |
Foreign Application Data
Date |
Code |
Application Number |
Jul 16, 2002 |
JP |
2002-206841 |
Dec 19, 2002 |
JP |
2002-367778 |
Mar 31, 2003 |
JP |
2003-095955 |
Claims
1. An antibody which recognizes specifically a protein comprising
any amino acid sequence selected from the group consisting of: (a)
the amino acid sequence represented by SEQ ID NO:1; (b) an amino
acid sequence of a protein involved in a G protein-coupled receptor
mediated signal transduction, the protein consisting of an amino
acid sequence having a homology of 85% or more with the amino acid
sequence represented by SEQ ID NO:1; (c) the amino acid sequence of
SEQ ID NO:25; (d) the amino acid sequence of SEQ ID NO:26; (e) an
amino acid sequence of a protein involved in a G protein-coupled
receptor mediated signal transduction, the protein comprising an
amino acid sequence of amino acid Nos. 96 to 126 of SEQ ID NO:1;
(f) an amino acid sequence of a protein involved in a G
protein-coupled receptor mediated signal transduction, the protein
comprising an amino acid sequence having a homology of 95% or more
with an amino acid sequence of amino acid Nos. 96 to 126 of SEQ ID
NO:1; (g) an amino acid sequence of a protein involved in a G
protein-coupled receptor mediated signal transduction, the protein
comprising at its N-terminal an amino acid sequence of amino acid
Nos. 1 to 126 of SEQ ID NO:1; and (h) an amino acid sequence of a
protein involved in a G protein-coupled receptor mediated signal
transduction, the protein comprising at its N-terminal an amino
acid sequence having a homology of 65% or more with an amino acid
sequence of amino acid Nos. 1 to 126 of SEQ ID NO:1.
2. An agent for regulating a G protein-coupled receptor mediated
signal transduction containing as an active ingredient an antibody
according to claim 1.
3. A therapeutic or prophylactic agent against a disease caused by
a G protein-coupled receptor mediated signal transduction
abnormality, wherein an active ingredient of the agent is an
antibody according to claim 1.
4. A kit for screening for a substance capable of regulating a
signal transduction mediated by a G protein-coupled receptor and a
protein that comprises: a cell capable of expressing a protein
comprising an amino acid sequence selected from SEQ ID NOs: 1, 25
and 26; and an antibody that specifically binds to the protein.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a division of U.S. patent application
Ser. No. 12/118,247, filed May 9, 2008, which in turn was a
division of U.S. patent application Ser. No. 10/618,320, filed Jul.
11, 2003, now U.S. Pat. No. 7,371,541, issued May 13, 2008, the
disclosures of which are hereby incorporated herein by reference in
their entireties.
BACKGROUND OF THE INVENTION
[0002] 1. Field of the Invention
[0003] The present invention relates to a novel G protein having an
ability of amplifying a signal transduction generated by a receptor
upon binding to a natural ligand such as amine, peptide, hormone,
autacoid, neurotransmitter and the like, as well as a
polynucleotide encoding the same. The invention also relates to a
method for screening for a substance which regulates the cellular
signal transduction mediated by this novel G protein, and the
like.
[0004] 2. Description of the Background Art
[0005] A G protein is an important mediator in a signal
transduction. Thus, the G protein serves as a transmitter which
transport, into a cell, a stimulation signal received by a G
protein-coupled receptor (hereinafter sometimes abbreviated as
GPCR) which is a seven transmembrane receptor. A GPCR is expressed
in a wide variety of tissues, and this signal transduction system
was proven to be involved in regulation of a wide variety of
cellular functions such as hormone reception, neurotransmission,
cell proliferation and differentiation and the like (GENDAI KAGAKU
ZOKAN 34, 61 to70, 1997).
[0006] More specifically, a G protein is a heterotrimer formed from
.alpha. subunit which binds to GTP, .beta. subunit and .gamma.
subunit. When a GPCR on a cell membrane surface binds to a ligand
such as a hormone or neurotransmitter, the GPCR is activated and
its signal is transmitted to a G protein. In the G protein to which
the signal has been transmitted, a GDP is released from the
inactive form in which a GDP was bound once to the .alpha. subunit,
and a GTP is then bound instead, whereby converting into an active
form.
[0007] The active G protein is released from the GPCR while
dissociating into a GTP-binding .alpha. subunit and .beta..gamma.
subunits. The active G protein promotes or inhibits its target
effector such as adenylate cyclase, Ca.sup.2+ channel, K.sup.+
channel, phospholipase C.beta. and the like, whereby regulating a
variety of the cellular functions. A mammalian G protein .alpha.
subunit may for example be Gi, Go, Gq, Gt and the like. Typically,
a G protein .alpha. subunit is classified into any of 4 types,
namely, the type which promotes the activity of an adenylate
cyclase, the type which inhibits the activity of an adenylate
cyclase, the type which promotes the activity of a phospholipase
and the type which transmits a signal to a Rho.
[0008] A GTP which has been bound to an .alpha. subunit of an
active G protein is converted into a GDP by the GTPase effect
possessed by the .alpha. subunit, resulting in the recovery of an
inactive form ("Signal Dentatsu", p. 17-30, Nov. 1, 2001, KYORITSU
SHUPPANSHA). GPCR genes and its gene products and GPCR signal
transduction pathway-related genes and its gene products are
potential causes for diseases (Spiegel et al., J. Clin. Invest. 92:
1119-1125 (1993); MuKusick et al., J. Med. Genet. 30: 1-26 (1993);
Lania et al., European J. Endocrinology 145:543-559(2001)). For
example, a certain defect in a V2 vasopressin receptor gene as a
GPCR has been proven to induce various forms of a nephrogenic
diabetes insipidus (Holtzman et al., Hum. Mol. Genet.
2:1201-1204(1993)). In addition, variation in G.alpha. subunits are
observed in a tumor of growth hormone secreting cells in a
pituitary gland which secrets a growth hormone, hyperthyroid tumor,
ovarian and renal tumors (Meij, JTA (1996), Mol. Cell. Biochem.
157:31-38; Aussel, C. et al., (1988), J. Immunol. 140: 215-220).
Accordingly, GPCR signal-related gene products are useful as a
target of a novel drug, and 50% of currently marketed
pharmaceuticals were reported to direct the GPCR as a target
(Nature Review Drug Discovery, 1, 7 (2002)).
[0009] Generally in screening natural ligands of GPCR, it is
important to know which G proteins are to be coupled with the GPCR
(Trends in Pharmacological Science, 22, 560-564 (2001)).
Accordingly, identification of a novel G protein and a gene
encoding the same is useful in treating or diagnosing a disease
caused by the abnormality in the cellular signal transduction in
which said G protein is involved. In addition, it can be used in
the screening for a pharmaceutical which is useful as a remedial,
therapeutic or prophylactic agent against a disease caused by the
abnormality in a cellular signal transduction. Furthermore, it can
be used in the screening for a pharmaceutical which is useful as a
remedial, therapeutic or prophylactic agent capable of ameliorating
or preventing a symptom by means of the activation or inhibition of
the cellular signal transduction.
SUMMARY OF THE INVENTION
[0010] A main object of the present invention is to provide a novel
G protein .alpha. subunit and a polynucleotide encoding the same, a
substance capable of activating or inhibiting the signal
transduction system mediated by a G protein-coupled receptor and
this G protein .alpha. subunit, a method for screening for such a
substance as well as a screening kit therefor.
[0011] For the purpose of accomplishing the objective described
above, we made an effort and finally discovered a human novel
protein comprising an amino acid sequence having a high homology
with the GTP binding site and the GTPase activation site conserved
among G protein .alpha. subunits and an amino acid sequence having
a high homology with the heterotrimer forming domain conserved
among the G protein .alpha. subunits, and designated this protein
as a Gm1 protein. We also discovered a mouse Gm1 protein and a rat
Gm1 protein having similar characteristics with regard to the amino
acid sequences.
[0012] Moreover, we discovered that in a cell having a Gm1
expression vector, the effector activity of the G protein is
elevated.
[0013] Furthermore, we discovered that Gm1 protein is expressed at
a high level in human brain, thymus, testes, spleen, small
intestine, uterus and heart.
[0014] Based on the findings described above, we believed that the
present protein (Gm1 protein) is a novel G protein .alpha. subunit
which is a molecule involved in the signal transduction mediated by
a GPCR stimulation which functions in human brain, thymus, testes,
spleen, small intestine, uterus and heart, thus establishing the
present invention.
[0015] Thus, the invention provides the proteins and
polynucleotides and the like, which are listed in the following
respective paragraphs:
[0016] 1. A protein comprising any amino acid sequence selected
from the group consisting of: [0017] (a) the amino acid sequence
represented by SEQ ID NO:1; [0018] (b) an amino acid sequence of a
protein involved in a G protein-coupled receptor mediated signal
transduction, said protein consists of an amino acid sequence
having a homology of 85% or more with the amino acid sequence
represented by SEQ ID NO:1; [0019] (c) the amino acid sequence
represented by SEQ ID NO:25; [0020] (d) the amino acid sequence
represented by SEQ ID NO:26; [0021] (e) an amino acid sequence of a
protein involved in a G protein-coupled receptor mediated signal
transduction, said protein comprises the amino acid sequence of the
amino acid Nos. 96 to 126 of SEQ ID NO:1; [0022] (f) an amino acid
sequence of a protein involved in a G protein-coupled receptor
mediated signal transduction, said protein comprises an amino acid
sequence having a homology of 95% or more with the amino acid
sequence of the amino acid Nos. 96 to 126 of SEQ ID NO:1; [0023]
(g) an amino acid sequence of a protein involved in a G
protein-coupled receptor mediated signal transduction, said protein
comprises at its N-terminal the amino acid sequence of the amino
acid Nos. 1 to 126 of SEQ ID NO:1; and [0024] (h) an amino acid
sequence of a protein involved in a G protein-coupled receptor
mediated signal transduction, said protein comprises at its
N-terminal an amino acid sequence having a homology of 65% or more
with the amino acid sequence of the amino acid Nos.1 to 126 of SEQ
ID NO:1.
[0025] 2. A protein (1) or (2): [0026] (1) the protein consisting
of the amino acid sequence represented by SEQ ID NO:1; [0027] (2) a
protein involved in a G protein-coupled receptor mediated signal
transduction which consists of an amino acid sequence having a
homology of 85% or more with the amino acid sequence represented by
SEQ ID NO:1.
[0028] 3. The protein consisting of the amino acid sequence
represented by SEQ ID NO:25.
[0029] 4. The protein consisting of the amino acid sequence
represented by SEQ ID NO:26.
[0030] 5. A protein (3) or (4): [0031] (3) a protein involved in a
G protein-coupled receptor mediated signal transduction which
comprises the amino acid sequence of the amino acid Nos. 96 to 126
of SEQ ID NO:1; [0032] (4) a protein involved in a G
protein-coupled receptor mediated signal transduction which
comprises an amino acid sequence having a homology of 95% or more
with the amino acid sequence of the amino acid Nos. 96 to 126 of
SEQ ID NO:1.
[0033] 6. A protein (5) or (6): [0034] (5) a protein involved in a
G protein-coupled receptor mediated signal transduction which
comprises at its N-terminal the amino acid sequence of the amino
acid Nos. 1 to 126 of SEQ ID NO:1; [0035] (6) a protein involved in
a G protein-coupled receptor mediated signal transduction which
comprises at its N-terminal an amino acid sequence having a
homology of 65% or more with the amino acid sequence of the amino
acid Nos. 1 to 126 of SEQ ID NO:1.
[0036] 7. A polynucleotide comprising a nucleotide sequence
selected from the group consisting of: [0037] (a) a nucleotide
sequence encoding the amino acid sequence represented by SEQ ID
NO:1; [0038] (b) a nucleotide sequence encoding an amino acid
sequence of a protein involved in a G protein-coupled receptor
mediated signal transduction, said protein consists of an amino
acid sequence having a homology of 85% or more with the amino acid
sequence represented by SEQ ID NO:1; [0039] (c) a nucleotide
sequence encoding the amino acid sequence represented by SEQ ID
NO:25; [0040] (d) a nucleotide sequence encoding the amino acid
sequence represented by SEQ ID NO:26;
[0041] (e) a nucleotide sequence encoding an amino acid sequence of
a protein involved in a G protein-coupled receptor mediated signal
transduction, said protein comprises the amino acid sequence of the
amino acid Nos. 96 to 126 of SEQ ID NO:1; [0042] (f) a nucleotide
sequence encoding an amino acid sequence of a protein involved in a
G protein-coupled receptor mediated signal transduction, said
protein comprises an amino acid sequence having a homology of 95%
or more with the amino acid sequence of the amino acid Nos. 96 to
126 of SEQ ID NO:1; [0043] (g) a nucleotide sequence encoding an
amino acid sequence of a protein involved in a G protein-coupled
receptor mediated signal transduction, said protein comprises at
its N-terminal the amino acid sequence of the amino acid Nos. 1 to
126 of SEQ ID NO:1; [0044] (h) a nucleotide sequence encoding an
amino acid sequence of a protein involved in a G protein-coupled
receptor mediated signal transduction, said protein comprises at
its N-terminal an amino acid sequence having a homology of 65% or
more with the amino acid sequence of the amino acid Nos. 1 to 126
of SEQ ID NO:1; [0045] (i) the nucleotide sequence represented by
SEQ ID NO:2; [0046] (j) a nucleotide sequence of a polynucleotide
encoding a protein involved in a G protein-coupled receptor
mediated signal transduction, said polynucleotide consists of a
nucleotide sequence having a homology of 85% or more with the
polynucleotide consisting of the nucleotide sequence represented by
SEQ ID NO:2; [0047] (k) the nucleotide sequence represented by SEQ
ID NO:27; [0048] (l) the nucleotide sequence represented by SEQ ID
NO:28; [0049] (m) a nucleotide sequence of a polynucleotide
encoding a protein involved in a G protein-coupled receptor
mediated signal transduction, said polynucleotide comprises the
nucleotide sequence of the nucleotide Nos. 289 to 378 of SEQ ID
NO:2; [0050] (n) a nucleotide sequence of a polynucleotide encoding
a protein involved in a G protein-coupled receptor mediated signal
transduction, said polynucleotide comprises a nucleotide sequence
having a homology of 90% or more with the polynucleotide consisting
of the nucleotide sequence of the nucleotide Nos. 289 to 378 of SEQ
ID NO:2; [0051] (o) a nucleotide sequence of a polynucleotide
encoding a protein involved in a G protein-coupled receptor
mediated signal transduction, said polynucleotide comprises at its
5' terminal the nucleotide sequence of the nucleotide Nos. 1 to 378
of SEQ ID NO:2; and [0052] (p) a nucleotide sequence of a
polynucleotide encoding a protein involved in a G protein-coupled
receptor mediated signal transduction, said polynucleotide
comprises at its 5' terminal a nucleotide sequence having a
homology of 70% or more with the polynucleotide consisting of the
nucleotide sequence of the nucleotide Nos. 1 to 378 of SEQ ID
NO:2.
[0053] 8. A polynucleotide of (7) or (8): [0054] (7) the
polynucleotide consisting of the nucleotide sequence represented by
SEQ ID NO:2; [0055] (8) a polynucleotide encoding a protein
involved in a G protein-coupled receptor mediated signal
transduction, said polynucleotide consists of a nucleotide sequence
having a homology of 85% or more with the polynucleotide consisting
of the nucleotide sequence represented by SEQ ID NO:2.
[0056] 9. The polynucleotide consisting of the nucleotide sequence
represented by SEQ ID NO:27.
[0057] 10. The polynucleotide consisting of the nucleotide sequence
represented by SEQ ID NO:28.
[0058] 11. A polynucleotide of (9) or (10): [0059] (9) a
polynucleotide encoding a protein involved in a G protein-coupled
receptor mediated signal transduction, said polynucleotide
comprises the nucleotide sequence of the nucleotide Nos. 289 to 378
of SEQ ID NO:2; [0060] (10) a polynucleotide encoding a protein
involved in a G protein-coupled receptor mediated signal
transduction, said polynucleotide comprises a nucleotide sequence
having a homology of 90% or more with the polynucleotide consisting
of the nucleotide sequence of the nucleotide Nos. 289 to 378 of SEQ
ID NO:2.
[0061] 12. A polynucleotide of (11) or (12): [0062] (11) a
polynucleotide encoding a protein involved in a G protein-coupled
receptor mediated signal transduction, said polynucleotide
comprises at its 5' terminal the nucleotide sequence of the
nucleotide Nos. 1 to 378 of SEQ ID NO:2; [0063] (12) a
polynucleotide encoding a protein involved in a G protein-coupled
receptor mediated signal transduction, said polynucleotide
comprises at its 5' terminal a nucleotide sequence having a
homology of 70% or more with the polynucleotide consisting of the
nucleotide sequence of the nucleotide Nos. 1 to 378 of SEQ ID
NO:2.
[0064] 13. A recombinant vector containing a polynucleotide
according to the above 7.
[0065] 14. A method for producing a recombinant vector comprising a
step for integrating a polynucleotide according to the above 7 into
a vector capable of being replicated in a host cell.
[0066] 15. A transformant having a recombinant vector according to
the above 13.
[0067] 16. A method for producing a transformant comprising a step
for transducing a recombinant vector according to the above 13 into
a host cell.
[0068] 17. A method for producing a G protein .alpha.-subunit
comprising steps for culturing a transformant having a recombinant
vector containing a polynucleotide according to the above 7 and
recovering from the culture a protein resulting from the
polynucleotide according to the above 7.
[0069] 18. An antisense polynucleotide consisting of a
polynucleotide of (13) or (14): [0070] (13) a polynucleotide which
inhibits the expression of a protein according to the above 1 which
comprises a nucleotide sequence complementary to at least 15
contiguous nucleotides in the nucleotide sequence represented by
SEQ ID NO:2; [0071] (14) a polynucleotide which inhibits the
expression of a protein according to the above 1 which hybridizes
under an intracellular condition with a polynucleotide consisting
of at least 15 contiguous nucleotides in the nucleotide sequence
represented by SEQ ID NO:2.
[0072] 19. A ribozyme (15) or (16):
[0073] (15) a ribozyme having an ability of cleaving a
polynucleotide according to the above 7 which comprises two
polynucleotide regions complementary to two regions respectively
consisting of at least 9 contiguous nucleotides which are two
regions in the nucleotide sequence represented by SEQ ID NO:2;
[0074] (16) a ribozyme having an ability of cleaving a
polynucleotide according to the above 7 which comprises two
polynucleotide regions which hybridizes under an intracellular
condition with two regions respectively consisting of at least 9
contiguous nucleotides which are two regions in the nucleotide
sequence represented by SEQ ID NO:2.
[0075] 20. An antibody which recognizes a protein according to the
above 1 specifically.
[0076] 21. An agent for regulating a G protein-coupled receptor
mediated signal transduction containing as an active ingredient a
protein according to the above 1.
[0077] 22. A therapeutic or prophylactic agent against a disease
caused by a G protein-coupled receptor mediated signal transduction
abnormality, wherein an active ingredient of the agent is a protein
according to the above 1.
[0078] 23. An agent for regulating a G protein-coupled receptor
mediated signal transduction containing as an active ingredient a
polynucleotide according to the above 7.
[0079] 24. A therapeutic or prophylactic agent against a disease
caused by a G protein-coupled receptor mediated signal transduction
abnormality, wherein an active ingredient of the agent is a
polynucleotide according to the above 7.
[0080] 25. An agent for regulating a G protein-coupled receptor
mediated signal transduction containing as an active ingredient an
antisense polynucleotide according to the above 18.
[0081] 26. A therapeutic or prophylactic agent against a disease
caused by a G protein-coupled receptor mediated signal transduction
abnormality, wherein an active ingredient of the agent is an
antisense polynucleotide according to the above 18.
[0082] 27. An agent for regulating a G protein-coupled receptor
mediated signal transduction containing as an active ingredient a
ribozyme according to the above 19.
[0083] 28. A therapeutic or prophylactic agent against a disease
caused by a G protein-coupled receptor mediated signal transduction
abnormality, wherein an active ingredient of the agent is a
ribozyme according to the above 19.
[0084] 29. An agent for regulating a G protein-coupled receptor
mediated signal transduction containing as an active ingredient an
antibody according to the above 20.
[0085] 30. A therapeutic or prophylactic agent against a disease
caused by a G protein-coupled receptor mediated signal transduction
abnormality, wherein an active ingredient of the agent is an
antibody according to the above 20.
[0086] 31. An oligonucleotide (17) or (18): [0087] (17) an
oligonucleotide capable of recognizing a polynucleotide represented
by SEQ ID NO:2 specifically which consists of at least 17
contiguous nucleotides in the nucleotide sequence represented by
SEQ ID NO:2; [0088] (18) an oligonucleotide capable of recognizing
a polynucleotide represented by SEQ ID NO:2 specifically which has
a homology of 80% or more with at least 17 contiguous nucleotides
in the nucleotide sequence represented by SEQ ID NO:2.
[0089] 32. An oligonucleotide according to the above 31 which is
used as a probe or a primer.
[0090] 33. A method for screening for a substance capable of
regulating a signal transduction mediated by a G protein-coupled
receptor and a G protein comprising: [0091] (a) a step for bringing
a test substance into contact with a test cell having a recombinant
vector according to the above 13 and a recombinant vector
containing a DNA encoding a G protein-coupled receptor protein;
[0092] (b) a step for measuring the G protein effector activity or
the index value correlating therewith in the test cell; and [0093]
(c) a step for comparing this effector activity or the index value
correlating therewith with the effector activity or the index value
correlating therewith in the test cell which has not been brought
into contact with the test substance, whereby selecting a test
substance capable of altering the effector activity or the index
value correlating therewith in the test cell.
[0094] 34. A method for screening for a substance capable of
regulating a signal transduction mediated by a G protein-coupled
receptor and a G protein comprising: [0095] (a) a step for bringing
a test substance into contact with a test cell having a recombinant
vector according to the above 13 and a recombinant vector
containing a DNA encoding a G protein-coupled receptor protein;
[0096] (b) a step for measuring the G protein effector activity or
the index value correlating therewith in the test cell; and [0097]
(c) a step for comparing this effector activity with the effector
activity or the index value correlating therewith when the said
test substance has been brought into contact with a control cell
having no recombinant vector according to the above 13 but having a
recombinant vector containing a DNA encoding a G protein-coupled
receptor protein, whereby selecting a test substance causing a
difference in the effector activity or the index value correlating
therewith between the test cell and the control cell. [0098] 35. A
method for screening for a substance capable of regulating a signal
transduction mediated by a G protein-coupled receptor and a G
protein comprising: [0099] (a) a step for bringing a test substance
into contact with a test cell having a recombinant vector according
to the above 13 and a recombinant vector containing a DNA encoding
a G protein-coupled receptor protein; [0100] (b) a step for
measuring the G protein effector activity or the index value
correlating therewith in the test cell; and [0101] (c) a step for
comparing this effector activity or the index value correlating
therewith with the effector activity or the index value correlating
therewith when the said test substance has been brought into
contact with a control cell having no recombinant vector containing
a DNA encoding a G protein-coupled receptor protein but having a
recombinant vector according to the above 13, whereby selecting a
test substance causing a difference in the effector activity or the
index value correlating therewith between the test cell and the
control cell.
[0102] 36. A method for screening for a substance capable of
regulating a signal transduction mediated by a G protein-coupled
receptor and a G protein comprising: [0103] (a) a step for bringing
a test substance and a G protein-coupled receptor ligand into
contact with a test cell having a recombinant vector according to
the above 13 and a recombinant vector containing a DNA encoding a G
protein-coupled receptor protein; [0104] (b) a step for measuring
the G protein effector activity or the index value correlating
therewith in the test cell; and [0105] (c) a step for comparing
this effector activity or the index value correlating therewith
with the effector activity or the index value correlating therewith
in the test cell which has not been brought into contact with the
test substance but has been brought into contact with the ligand,
whereby selecting a test substance capable of altering the effector
activity or the index value correlating therewith in the test
cell.
[0106] 37. A method for screening for a substance capable of
regulating a signal transduction mediated by a G protein-coupled
receptor and a G protein comprising: [0107] (a) a step for bringing
a test substance and a G protein-coupled receptor ligand into
contact with a test cell having a recombinant vector according to
the above 13 and a recombinant vector containing a DNA encoding a G
protein-coupled receptor protein; [0108] (b) a step for measuring
the G protein effector activity or the index value correlating
therewith in the test cell; [0109] (c) a step for comparing this
effector activity with the effector activity in the test cell which
has not been brought into contact with the test substance but has
been brought into contact with the ligand, whereby investigating
the change in the effector activity in the test cell; and [0110]
(d) a step for comparing the rate of change in this effector
activity or the index value correlating therewith with the rate of
change in the effector activity or the index value correlating
therewith when the said test substance and said ligand has been
brought into contact with a control cell having no recombinant
vector containing a DNA encoding a G protein-coupled receptor
protein but having a recombinant vector according to the above 13,
whereby selecting a test substance causing a difference in the rate
of change in the effector activity or the index value correlating
therewith between the test cell and the control cell.
[0111] 38. A method for screening for a substance capable of
regulating a signal transduction mediated by a G protein-coupled
receptor and a G protein comprising: [0112] (a) a step for bringing
a test substance into contact with a cell membrane fraction of a
cell having a recombinant vector according to the above 13 and a
cell membrane fraction of a cell having a recombinant vector
containing a DNA encoding a GPCR, or [0113] a cell membrane
fraction of a cell having the recombinant vector according to the
above 13 and the recombinant vector containing the DNA encoding the
GPCR; [0114] (b) a step for assaying the level of the binding of
GTP to the cell membrane fraction; and [0115] (c) a step for
comparing the assayed level of this GTP binding with the assayed
level of the GTP binding to the cell membrane fraction which has
not been brought into contact with the test substance, whereby
selecting a test substance capable of altering the assayed level of
the GTP binding to the cell membrane fraction.
[0116] 39. A method for screening for a substance capable of
regulating a signal transduction mediated by a G protein-coupled
receptor and a G protein comprising: [0117] (a) a step for bringing
a test substance and a G protein-coupled receptor ligand into
contact with [0118] a cell membrane fraction of a cell having a
recombinant vector according to the above 13 and a cell membrane
fraction of a cell having a recombinant vector containing a DNA
encoding a GPCR, or [0119] a cell membrane fraction of a cell
having the recombinant vector according to the above 13 and the
recombinant vector containing the DNA encoding the GPCR; [0120] (b)
a step for assaying the level of the binding of GTP to the cell
membrane fraction; and [0121] (c) a step for comparing the assayed
level of this GTP binding with the assayed level of the GTP binding
in the cell membrane fraction which has not been brought into
contact with the test substance but has been brought into contact
with said ligand, whereby selecting a test substance capable of
altering the assayed level of the GTP binding to the cell membrane
fraction.
[0122] 40. A method for screening for a substance capable of
regulating a signal transduction mediated by a G protein-coupled
receptor and a G protein comprising: [0123] (a) a step for bringing
a test substance into contact with a test cell capable of
expressing a protein according to the above 1; [0124] (b) a step
for measuring the expression level of the protein according to the
above 1 in the test cell; and [0125] (c) a step for comparing this
expression level with the expression level of said protein in the
test cell which has not been brought into contact with the test
substance, whereby selecting a test substance capable of altering
the expression level of said protein in the test cell.
[0126] 41. A substance capable of regulating a signal transduction
mediated by a G protein-coupled receptor and a G protein, said
substance is obtained by a screening method according to any of the
above 33 to 40.
[0127] 42. An agent for regulating a signal transduction mediated
by a G protein-coupled receptor and a G protein, said agent
contains as an active ingredient a substance according to the above
41. [0128] 43. A therapeutic or prophylactic agent against a
disease caused by the abnormality in a G protein-coupled receptor
and a G protein-mediated signal transduction containing as an
active ingredient a substance according to the above 41. [0129] 44.
A kit for screening for a substance capable of regulating a signal
transduction mediated by a G protein-coupled receptor and a protein
according to the above 1, which comprises a test cell having a
recombinant vector containing a polynucleotide encoding a protein
according to the above 1 and a reagent for measuring the G protein
effector activity or an index value correlating therewith.
[0130] 45. A screening kit according to the above 44 wherein the
test cell further has a recombinant vector having a DNA encoding a
G protein-coupled receptor.
[0131] 46. A screening kit according to the above 44 further
containing a G protein-coupled receptor ligand.
[0132] 47. A screening kit according to the above 44 further
containing a control cell having a recombinant vector having a DNA
encoding a G protein-coupled receptor.
[0133] 48. A screening kit according to the above 44 further
containing a control cell having a recombinant vector containing a
polynucleotide encoding a protein according to the above 1.
[0134] 49. A kit for screening for a substance capable of
regulating a signal transduction mediated by a G protein-coupled
receptor and a protein according to the above 1, which
comprises:
[0135] a cell having a recombinant vector containing a
polynucleotide encoding a protein according to the above 1;
and,
[0136] a GTP analogue which can bind to the protein according to
the above 1 but can not be cleaved by a GTPase.
[0137] 50. A screening kit according to the above 49 wherein the
cell further has a recombinant vector having a DNA encoding a G
protein-coupled receptor.
[0138] 51. A kit for screening for a substance capable of
regulating a signal transduction mediated by a G protein-coupled
receptor and a protein according to the above 1, which
comprises:
[0139] a cell having a recombinant vector containing a
polynucleotide encoding a protein according to the above 1;
[0140] a cell having a recombinant vector having a DNA encoding the
G protein-coupled receptor; and,
[0141] a GTP analogue which can bind to the protein according to
the above 1 but can not be cleaved by a GTPase.
[0142] 52. A screening kit according to the above 49 or 51 further
containing a G protein-coupled receptor ligand.
[0143] 53. A kit for screening for a substance capable of
regulating a signal transduction mediated by a G protein-coupled
receptor and a protein according to the above 1, which
comprises:
[0144] a cell capable of expressing a protein according to the
above 1; and
[0145] an oligonucleotide according to the above 31 or an antibody
according to the above 20.
BRIEF DESCRIPTION OF THE DRAWINGS
[0146] FIG. 1 is a drawing substitute showing the expression
profile of an inventive protein in human tissues;
[0147] FIG. 2 is a schematic view indicating the dopamine D1
receptor antagonistic effects of various test substance (Example
17);
[0148] FIG. 3 is a schematic view indicating the dopamine D1
receptor agonistic effects of various test substance (Example
18);
[0149] FIG. 4 is a schematic view indicating the adenosine A2a
receptor antagonistic effects of DMPX (Example 21);
[0150] FIG. 5 is a schematic view indicating the adenosine A2a
receptor agonistic effects of CGS-21680 (Example 22);
[0151] FIG. 6 is a schematic view indicating that dopamine caused a
signal transduction mediated by the dopamine D1 receptor and the
Gm1 (Example 24); and
[0152] FIG. 7 is a schematic view indicating that adenosine caused
a signal transduction mediated by the adenosine A2a receptor and
the Gm1 (Example 24).
DESCRIPTION OF THE PREFERRED EMBODIMENTS
<Inventive Proteins>
[0153] An inventive protein is a protein comprising any amino acid
sequence selected from the group consisting of: [0154] (a) The
amino acid sequence represented by SEQ ID NO:1; [0155] (b) An amino
acid sequence of a protein involved in a G protein-coupled receptor
mediated signal transduction which consists of an amino acid
sequence having a homology of 85% or more with the amino acid
sequence represented by SEQ ID NO:1; [0156] (c) The amino acid
sequence represented by SEQ ID NO:25; [0157] (d) The amino acid
sequence represented by SEQ ID NO:26; [0158] (e) An amino acid
sequence of a protein involved in a G protein-coupled receptor
mediated signal transduction which comprises the amino acid
sequence of the amino acid Nos. 96 to 126 of SEQ ID NO:1; [0159]
(f) An amino acid sequence of a protein involved in a G
protein-coupled receptor mediated signal transduction which
comprises an amino acid sequence having a homology of 95% or more
with the amino acid sequence of the amino acid Nos. 96 to 126 of
SEQ ID NO:1; [0160] (g) An amino acid sequence of a protein
involved in a G protein-coupled receptor mediated signal
transduction which comprises at its N-terminal the amino acid
sequence of the amino acid Nos. 1 to 126 of SEQ ID NO:1; and [0161]
(h) An amino acid sequence of a protein involved in a G
protein-coupled receptor mediated signal transduction which
comprises at its N-terminal an amino acid sequence having a
homology of 65% or more with the amino acid sequence of the amino
acid Nos. 1 to 126 of SEQ ID NO:1;
[0162] The inventive protein includes not only said protein but
also its salt or derivative as long as its biological functions are
not affected. A derivative is not limited particularly and may for
example be one whose C terminal or other carboxyl group is
converted into an amide, ester and the like, or one whose N
terminal or other amino group is protected for example by a formyl
group or acyl group. As a salt, an acid addition salt is
exemplified preferably. An acid addition salt may for example be a
salt with an inorganic acid such as hydrochloric acid, phosphoric
acid, sulfuric acid and the like, or a salt with an organic acid
such as formic acid, acetic acid, propionic acid and the like.
<First Protein>
[0163] The first protein according to the invention is a protein
(1) or (2) shown below.
[0164] (1) The protein consisting of the amino acid sequence
represented by SEQ ID NO:1.
[0165] (2) A protein involved in a G protein-coupled receptor
mediated signal transduction which consists of an amino acid
sequence having a homology of 85% or more with the amino acid
sequence represented by SEQ ID NO:1.
[0166] The amino acid sequence represented by SEQ ID NO:1 comprises
an amino acid sequence part having a high homology with the GTP
binding site and the GTPase activation site conserved among G
protein .alpha. subunits. Such parts are the regions of the amino
acid Nos. 126 to 133, 287 to 292, 353 to 359, 428 to 435 in the
amino acid sequence represented by SEQ ID NO:1. Any of these amino
acids is in agreement with the GTP binding site and the GTPase
activation site of Gs and Golf which has already been identified as
G protein .alpha. subunits (NATURE, 117-127, 1991, vol. 349).
[0167] Furthermore, the amino acid also comprises a sequence which
is identical to the characteristic sequence conserved highly in Gs
and Golf protein belonging especially to the Gs family among the G
protein .alpha. subunits (amino acid Nos. 119 to 126 in SEQ ID
NO:1), and can also form an a helix structure conserved among the G
protein .alpha. subunits.
[0168] Based on these findings, the protein comprising the amino
acid sequence represented by SEQ ID NO:1 is considered to be a G
protein .alpha. subunit.
[0169] The fact that a protein (2) functions as a molecule involved
in the intracellular signal transduction by a GPCR stimulation can
be verified by means of a screening method according to the
invention discussed below.
[0170] The amino acid sequence of a protein (2) preferably has a
homology of 90% or more, especially 95% or more with the amino acid
sequence represented by SEQ ID NO:1.
[0171] An index indicating which and how many amino acid residues
in a protein (2) can be substituted, deleted or added without
losing any biological functions can be identified for example by a
GTP binding level assay described below. A variation causing no
loss of the biological functions can be conducted for example in a
part having a low homology with the amino acid sequence of any of
various G protein .alpha. subunits which have already been
identified.
[0172] In the case for example of an amino acid substitution, the
amino acid can be substituted by an amino acid having the
characteristics similar to those of the former amino acid in terms
of polarity, electric charge, solubility,
hydrophilicity/hydrophobicity, polarity and the like, in view of
the maintenance of the protein structure. In this context, glycine,
alanine, valine, leucine, isoleucine and proline are classified
into non-polar amino acids; serine, threonine, cysteine,
methionine, asparagine and glutamine are classified into polar
amino acids; phenylalanine, tyrosine and triptophane are classified
into aromatic side chain-carrying amino acids; lysine, arginine and
histidine are classified into basic amino acids; aspartic acid and
glutamic acid are classified into acidic amino acids. Accordingly,
the substitution may be conducted using an amino acid selected from
the same group.
[0173] A protein (2) also includes proteins derived from other
species corresponding to the human protein. Such an other
species-derived corresponding protein can be deduced from a
nucleotide sequence identified by means for example of a screening
of a gene library of other species using a full length inventive
polynucleotide or a part thereof as well as a 5'-RACE. Otherwise, a
deductive identification is possible also from a corresponding gene
of other species screened by an NCBI Blast search described
below,
[0174] A protein (2) may for example be the protein consisting of
the amino acid sequence represented by SEQ ID NO:25 and the protein
consisting of the amino acid sequence represented by SEQ ID
NO:26.
<Second Protein>
[0175] The second protein according to the invention is a protein
(3) or (4) shown below. [0176] (3) A protein involved in a G
protein-coupled receptor mediated signal transduction which
comprises the amino acid sequence of the amino acid Nos. 96 to 126
of SEQ ID NO:1. [0177] (4) A protein involved in a G
protein-coupled receptor mediated signal transduction which
comprises an amino acid sequence having a homology of 95% or more
with the amino acid sequence of the amino acid Nos. 96 to 126 of
SEQ ID NO:1.
[0178] A protein (4) preferably has a homology of 96% or more,
especially 97% or more with the amino acid Nos. 96 to 126 in the
amino acid sequence represented by SEQ ID NO:1.
[0179] For the purpose of functioning as a molecule involved in an
intracellular signal transduction by a GPCR stimulation, for
example, as a G protein .alpha. subunit, each of the protein (3)
and (4) usually has an amino acid sequence of the amino acid Nos.
75 to 133, 287 to 292, 353 to 359 and 428 to 435 in the amino acid
sequence represented by SEQ ID NO:1, or preferably has an amino
acid sequence having a homology usually of 80% or more, especially
90% or more with the amino acid sequence of these regions. The
total amino acid number is usually about 320 to 489, preferably
about 350 to 460.
[0180] An index indicating which and how many amino acid residues
in a protein (4) can be substituted, deleted or added without
losing any biological functions of the protein (3) can be
identified for example by a GTP binding level assay described
below. A variation causing no loss of the biological functions can
be conducted for example in a part having a low homology with the
amino acid sequence of any of various G protein .alpha. subunits
which have already been identified. Also similarly to the first
protein described above, the substitution of a base can be
conducted so that the amino acid obtained after a translation can
possess the characteristics analogous to those of the amino acid
before the substitution, with regard to polarity, electric charge,
solubility, hydrophilicity/hydrophobicity, polarity and the
like.
<Third Protein>
[0181] The third protein of the invention is a protein (5) or (6)
shown below. [0182] (5) A protein involved in a G protein-coupled
receptor mediated signal transduction which comprises at its
N-terminal of the amino acid sequence of the amino acid Nos. 1 to
126 of SEQ ID NO:1. [0183] (6) A protein involved in a G
protein-coupled receptor mediated signal transduction which
comprises at its N-terminal of an amino acid sequence having a
homology of 65% or more with the amino acid sequence of the amino
acid Nos. 1 to 126 of SEQ ID NO:1.
[0184] In a protein (6), the amino acid sequence part corresponding
to the 126 amino acid sequence at the N terminal of the protein (5)
(hereinafter referred to as a "specific N terminal amino acid
sequence") preferably has a homology of 70% or more, especially 75%
or more with the specific N terminal amino acid sequence of the
protein (5).
[0185] For the purpose of functioning as a molecule involved in an
intracellular signal transduction by a GPCR stimulation, for
example, as a G protein .alpha. subunit, each of the protein (5)
and (6) usually has an amino acid sequence of the amino acid Nos.
75 to 133, 287 to 292, 353 to 359 and 428 to 435 in the amino acid
sequence represented by SEQ ID NO:1, or preferably has an amino
acid sequence having a homology usually of 80% or more, especially
90% or more with these regions. The total amino acid number is
usually about 320 to 480, preferably about 350 to 460.
[0186] An index indicating which and how many amino acid residues
in a protein (6) can be substituted, deleted or added without
losing any biological functions of the protein (5) can be
identified for example by a GTP binding level assay described
below. A variation causing no loss of the biological functions can
be conducted for example in a part having a low homology with the
amino acid sequence of any of various G protein .alpha. subunits
which have already been identified. Also similarly to the first
protein described above, the substitution of a base can be
conducted so that the amino acid obtained after a translation can
possess the characteristics analogous to those of the amino acid
before the substitution, with regard to polarity, electric charge,
solubility, hydrophilicity/hydrophobicity, polarity and the
like.
[0187] There is no known G protein .alpha. subunit having the amino
acid sequence of the amino acid Nos. 1 to 126 of the amino acid
sequence represented by SEQ ID NO:1 or a sequence analogous
thereto.
<Inventive Protein Production Method>
[0188] A protein of the invention can be produced by i) a method
for separating a membrane fraction containing said protein from a
cell or tissue of a human or other animal species followed by a
known protein purification process, ii) a method employing a
transformant of the invention described below or iii) a known
chemical synthesis of a protein and the like.
[0189] In a method i), a cell or tissue of a mammalian animal
including a human can be employed without limitation. It is
particularly preferred to use a human cell or tissue, especially, a
human brain-, uterus- or heart-derived cell or tissue.
[0190] A membrane fraction containing a protein of the invention
can be obtained by suspending a cell or tissue for example in a
HE/PI buffer (20 mM Hepes, 2 mM EDTA, 1.times. Proteinase inhibitor
cocktail (Nacalaitesque)), pulverizing or lysing the suspension by
means for example of an ultrasonic treatment, homogenization,
passage through a needle of about 26 gauge, centrifuging the
resultant pulverization or lysis solution at about 100 to
150.times.G for 5 to 10 minutes, centrifuging the resultant
supernatant at about 18,000 to 20,000 G for 20 to 30 minutes, and
then recovering the pellets.
[0191] The fact that the resultant cell membrane fraction contains
a protein of the invention can be verified for example by a Western
blotting using an antibody of the invention as described below.
[0192] A known protein purification method may for example be any
of various chromatographic procedure such as an ion exchange, gel
filtration, affinity chromatography. As a method iii), a method
described for example in "The Peptide", Academic Press, New York
(1966) or a method employing a commercial protein synthesis resin
may be exemplified.
[0193] It is also possible to obtain a protein (2) from a
transformant having a variant DNA which is formed by imparting a
DNA encoding the protein (1) with a variation using a known method
such as one described in Molecular Cloning: A Laboratory Manual,
2nd edition, Vol. 1 to 3, Cold Spring Harbor Laboratory
Press(1989), Methods in Enzymology p448 (1989), PCR A Practical
Approach IRL Press p200(1991) and the like, for example, a
site-specific mutation introduction, a PCR employing a variation
primer. This may analogously be applied to a method for obtaining
the protein (3) from a protein (4) and a method for obtaining the
protein (6) from a protein (5).
<Application of Inventive Proteins>
[0194] A protein of the invention can preferably be employed as a
regulator of a signal transduction mediated by a GPCR stimulation.
Specifically, it can preferably be employed for treating or
preventing a disease associated with an intracellular signal
transduction relating to the defect, reduced expression level or
reduced function of a protein of the invention.
<Inventive Polynucleotide>
[0195] A polynucleotide according to the invention is a
polynucleotide encoding a protein of the invention described above,
and comprises a nucleotide sequence selected from the group
consisting of: [0196] (a) A nucleotide sequence encoding the amino
acid sequence represented by SEQ ID NO:1; [0197] (b) A nucleotide
sequence encoding an amino acid sequence of a protein involved in a
G protein-coupled receptor mediated signal transduction which
consists of an amino acid sequence having a homology of 85% or more
with the amino acid sequence represented by SEQ ID NO:1; [0198] (c)
A nucleotide sequence encoding the amino acid sequence represented
by SEQ ID NO:25; [0199] (d) A nucleotide sequence encoding the
amino acid sequence represented by SEQ ID NO:26; [0200] (e) A
nucleotide sequence encoding an amino acid sequence of a protein
involved in a G protein-coupled receptor mediated signal
transduction which comprises the amino acid sequence of the amino
acid Nos. 96 to 126 of SEQ ID NO:1; [0201] (f) A nucleotide
sequence encoding an amino acid sequence of a protein involved in a
G protein-coupled receptor mediated signal transduction which
comprises an amino acid sequence having a homology of 95% or more
with the amino acid sequence of the amino acid Nos. 96 to 126 of
SEQ ID NO:1; [0202] (g) A nucleotide sequence encoding an amino
acid sequence of a protein involved in a G protein-coupled receptor
mediated signal transduction which comprises at its N-terminal the
amino acid sequence of the amino acid Nos. 1 to 126 of SEQ ID NO:1;
[0203] (h) A nucleotide sequence encoding an amino acid sequence of
a protein involved in a G protein-coupled receptor mediated signal
transduction which comprises at its N-terminal an amino acid
sequence having a homology of 65% or more with the amino acid
sequence of the amino acid Nos. 1 to 126 of SEQ ID NO:1; [0204] (i)
The nucleotide sequence represented by SEQ ID NO:2; [0205] (j) A
nucleotide sequence encoding a protein involved in a G
protein-coupled receptor mediated signal transduction which is a
nucleotide sequence having a homology of 85% or more with the
polynucleotide consisting of the nucleotide sequence represented by
SEQ ID NO:2; [0206] (k) The nucleotide sequence represented by SEQ
ID NO:27; [0207] (l) The nucleotide sequence represented by SEQ ID
NO:28; [0208] (m) A nucleotide sequence encoding a protein involved
in a G protein-coupled receptor mediated signal transduction which
comprises the nucleotide sequence of the nucleotide Nos. 289 to 378
of SEQ ID NO:2; [0209] (n) A nucleotide sequence encoding a protein
involved in a G protein-coupled receptor mediated signal
transduction which comprises a nucleotide sequence having a
homology of 90% or more with the polynucleotide consisting of the
nucleotide sequence of the nucleotide Nos. 289 to 378 of SEQ ID
NO:2; [0210] (o) A nucleotide sequence encoding a protein involved
in a G protein-coupled receptor mediated signal transduction which
comprises at its 5' terminal the nucleotide sequence of the
nucleotide Nos. 1 to 378 of SEQ ID NO:2; and [0211] (p) A
nucleotide sequence encoding a protein involved in a G
protein-coupled receptor mediated signal transduction which
comprises at its 5' terminal a nucleotide sequence having a
homology of 70% or more with the polynucleotide consisting of the
nucleotide sequence of the nucleotide Nos. 1 to 378 of SEQ ID
NO:2.
[0212] A polynucleotide of the invention (including an
oligonucleotide) includes a polynucleotide comprising a nucleotide
sequence described above and a polynucleotide complementary
thereto. Unless otherwise specified, a polynucleotide includes the
both of a DNA and an RNA. A DNA includes a single-stranded DNA
having its nucleotide sequence, and a single-stranded DNA
complementary thereto, and a double-stranded DNA. A DNA, unless
otherwise specified, includes a cDNA, genome DNA and synthetic DNA.
An RNA, unless otherwise specified, includes a total RNA, mRNA,
rRNA and synthetic RNA.
[0213] An inventive polynucleotide is detailed with referring to
the following first, second and third polynucleotide described
below.
<First Polynucleotide>
[0214] (7) The polynucleotide consisting of the nucleotide sequence
represented by SEQ ID NO:2. [0215] (8) A polynucleotide encoding a
protein involved in a G protein-coupled receptor mediated signal
transduction which consists of a nucleotide sequence having a
homology of 85% or more with the polynucleotide consisting of the
nucleotide sequence represented by SEQ ID NO:2.
[0216] A polynucleotide (8) preferably has a homology of 87% or
more, especially 90% or more with the polynucleotide (7).
[0217] A polynucleotide (8) is preferably one which hybridizes
under a stringent condition with the polynucleotide (7) consisting
of the nucleotide sequence represented by SEQ ID NO:2. In the
invention, a stringent condition may for example be a condition
involving 2.times.SSC, 1.times.Denhart's solution at about
60.degree. C.
[0218] An index indicating which and how many bases in a
polynucleotide (8) can be substituted, deleted or added without
losing any biological functions of the protein encoded by the
polynucleotide (7) can be identified for example by a cAMP assay or
a GTP binding level assay described below. A variation causing no
loss of the biological functions can be conducted for example in a
part having a low homology with the polynucleotide sequence of any
of various G protein .alpha. subunits which have already been
identified.
[0219] Also similarly to the first protein described above, the
substitution of a base can be conducted so that the amino acid
obtained after a translation can possess the characteristics
analogous to those of the amino acid before the substitution, with
regard to polarity, electric charge, solubility,
hydrophilicity/hydrophobicity, polarity and the like.
[0220] When a single amino acid has several translation codons, the
base substitution within these translation codons may also be
possible. For example, when alanine has 4 translation codons,
namely, GCA, GCC, GCG and GCT, the third base in each codon can be
substituted with each other among ATGC.
[0221] A polynucleotide (8) includes a polynucleotide of other
species corresponding for example to a human polynucleotide. Such a
polynucleotide can be screened for using NCBI blast search.
Typically, a nucleotide sequence containing the nucleotide residues
289 to 378 of SEQ ID NO:2 is subjected to an NCBI blast search to
thereby search the nucleotide sequence database of other species
and an EST database for a sequence having a high homology. By
screening the nucleotide sequences selected by the search for a
nucleotide sequence whose region corresponding to the nucleotide
residues 289 to 378 has a homology for example of 90% or more, a
corresponding gene of other species can be screened for.
[0222] A polynucleotide (8) is preferably one whose nucleotide
sequence corresponding to the nucleotide Nos. 1 to 222, 400 to 858,
877 to 1056, 1078 to 1281 and 1306 to 1377 in SEQ ID NO:2 in the
polynucleotide (7) has a homology usually of 75% or more,
especially 80% or more with the respective nucleotide sequence of
the polynucleotide (7).
[0223] A polynucleotide (8) may for example be a polynucleotide
consisting of the nucleotide sequence represented by SEQ ID NO:27
and a polynucleotide consisting of the nucleotide sequence
represented by SEQ ID NO:28.
<Second Polynucleotide>
[0224] (9) A polynucleotide encoding a protein involved in a G
protein-coupled receptor mediated signal transduction which
comprises the nucleotide sequence of the nucleotide Nos. 289 to 378
of SEQ ID NO:2. [0225] (10) A polynucleotide encoding a protein
involved in a G protein-coupled receptor mediated signal
transduction which comprises a nucleotide sequence having a
homology of 90% or more with the polynucleotide consisting of the
nucleotide sequence of the nucleotide Nos. 289 to 378 of SEQ ID
NO:2.
[0226] In a polynucleotide (10), the nucleotide sequence
corresponding to the nucleotide Nos. 289 to 378 in SEQ ID NO:2 of a
polynucleotide (9) has a homology of 93% or more, especially 95% or
more with the respective sequence of (9).
[0227] A polynucleotide (10) preferably has a polynucleotide
sequence which hybridizes under a stringent condition with a
polynucleotide consisting of the nucleotide sequence of the
nucleotide Nos. 289 to 378 in SEQ ID NO:2.
[0228] Each of the protein (9) and (10), for achieving the function
of the protein encoded thereby as a molecule involved in an
intracellular signal transduction by a GPCR stimulation, for
example, as a G protein .alpha. subunit, usually has a nucleotide
sequence of the nucleotide Nos. 223 to 399, 859 to 876, 1057 to
1077, 1282 to 1305 in the nucleotide sequence represented by SEQ ID
NO:2, or preferably has an nucleotide sequence having a homology
usually of 85% or more, especially 90% or more with these regions.
The total nucleotide number is usually about 963 to 1443,
especially 1053 to 1383.
[0229] An index indicating which and how many bases in a
polynucleotide (10) can be substituted, deleted or added without
losing any biological functions of the protein encoded by the
polynucleotide (9) is similar to that described above with regard
to the first polynucleotide.
<Third Polynucleotide>
[0230] (11) A polynucleotide encoding a protein involved in a G
protein-coupled receptor mediated signal transduction which
comprises at its 5' terminal the nucleotide sequence of the
nucleotide Nos. 1 to 378 of SEQ ID NO:2. [0231] (12) A
polynucleotide encoding a protein involved in a G protein-coupled
receptor mediated signal transduction which comprises at its 5'
terminal a nucleotide sequence having a homology of 70% or more
with the polynucleotide consisting of the nucleotide sequence of
the nucleotide Nos. 1 to 378 of SEQ ID NO:2.
[0232] In a polynucleotide (12), the nucleotide sequence part
corresponding to the 378 nucleotide sequence at the 5' terminal of
the protein (11) (hereinafter referred to as a "specific 5'
terminal nucleotide sequence") preferably has a homology of 75% or
more, especially 80% or more with the specific 5' terminal amino
acid sequence of (11).
[0233] A polynucleotide (12) preferably has at its 5' terminal a
polynucleotide sequence which hybridizes under a stringent
condition with the polynucleotide consisting of the nucleotide
sequence of the nucleotide Nos. 1 to 378 in SEQ ID NO:2.
[0234] Each of the protein (11) and (12), for achieving the
function of the protein encoded thereby as a molecule involved in
an intracellular signal transduction by a GPCR stimulation, for
example, as a G protein .alpha. subunit, usually has a nucleotide
sequence of the nucleotide Nos. 223 to 399, 859 to 876, 1057 to
1077, 1282 to 1305 in the nucleotide sequence represented by SEQ ID
NO:2, or preferably has an nucleotide sequence having a homology
usually of 85% or more, especially 90% or more with these regions.
The total nucleotide number is usually about 963 to 1443,
especially 1053 to 1383.
[0235] An index indicating which and how many bases in a
polynucleotide (12) can be substituted, deleted or added without
losing any biological functions of the protein encoded by the
polynucleotide (11) is similar to that described above with regard
to the first polynucleotide.
[0236] There is no polynucleotide encoding a G protein a subunit
having the nucleotide sequence of the nucleotide Nos. 1 to 378 in
SEQ ID NO:2 or a sequence analogous thereto.
<Inventive Polynucleotide Production Method>
[0237] Polynucleotides (7) to (12) can be obtained for example by a
screening a human DNA library by a hybridization using as a probe
an oligonucleotide (for example, an oligonucleotide of the
invention described below) synthesized based on the nucleotide
sequence represented by SEQ ID NO:2. They can be obtained also by a
PCR in a standard manner after preparing suitable primers (for
example, oligonucleotides of the invention described below) based
for example on the nucleotide sequence of SEQ ID NO:2 using as a
PCR template a cDNA library for example of a human, rat and mouse.
They can be obtained also by a chemical synthesis.
[0238] As a cDNA library, one derived from a brain, thymus, testes,
spleen, small intestine, uterus and heart is preferred.
[0239] A method for obtaining a polynucleotide (10) by introducing
a variation into a polynucleotide (9) and a method for obtaining a
polynucleotide (12) by introducing a variation into a
polynucleotide (11) are as described above.
<Application of Inventive Polynucleotide>
[0240] An inventive polynucleotide can be used preferably as a
regulator of an intracellular signal transduction mediated by a
GPCR stimulation. Typically, it can be used preferably for treating
or preventing a disease caused by an abnormality in this
intracellular signal transduction. It is useful especially in
treating or preventing a disease associated with an intracellular
signal transduction relating to the defect, reduced expression
level or reduced function of a protein of the invention.
[0241] An inventive polynucleotide can be used preferably also in
screening for a substance capable of regulating a signal
transduction mediated by a GPCR and a G protein of the
invention.
<Inventive Recombinant Vector and Transformant>
[0242] An inventive recombinant vector is a vector containing an
inventive polynucleotide (which herein is a DNA). For example, it
may be a vector capable of expressing a protein of the
invention.
[0243] A vector capable of expressing a protein of the invention
can be produced by ligating an inventive polynucleotide to an
expressible position downstream of a promoter of an expression
vector in accordance with a standard method.
[0244] An expression vector may be selected from known vectors
capable of replicating in host cells as appropriate depending on
the host cells. For example, a pBR322, pUC12, pUC119 and
pBluescript can be exemplified when an E. coli is employed as a
host cell, while a pUB110 and pC194 are exemplified when a Bacillus
organism is employed as a host cell. An Yip5 and Yep24 are
exemplified when using an yeast as a host cell. An AcNPV is
exemplified when using an insect cell as a host cell. A pUC18 and
pUC19 are exemplified when using an animal cell as a host cell.
[0245] A host cell may be any of those known in the art without
limitation. Those which may be exemplified are bacteria such as an
E. coli (for example, K12) and a Bacillus microorganism (for
example, MI114), yeasts (for example, AH22), insect cells (for
example, Sf cell), animal cells (for example, COS-7 cell, Vero
cell, CHO cell and the like).
[0246] A method for transforming a host cell with an inventive
recombinant vector may be a known method selected suitably
depending on the host cell. A known introduction method may for
example be a calcium phosphate method, electroporation,
lipofection, DEAE dextran method and the like. From transformants,
an inventive transformant is selected for example by means of a
drug resistance marker possessed by the vector as an index.
<Inventive Protein Production Method>
[0247] A method for producing a protein of the invention is a
method in which an inventive transformant is cultured and an
inventive protein is recovered from the resultant culture
product.
[0248] The conditions of culturing a transformant may be selected
appropriately depending on the type of the transformant.
[0249] When an inventive transformant is a microorganism, the
culture is conducted in a liquid medium or plate medium employed
usually for culturing a microorganism. The culture temperature may
be within the range allowing a microorganism to be grown, for
example from 15 to 40.degree. C. The culture medium pH may also be
within the range allowing a microorganism to be grown, for example
about pH6 to 8. The culture time period may vary depending on other
culturing conditions, and may usually be 1 to 5 days, especially 1
to 2 days. When using an inducible expression vector such as those
of the temperature shift type or IPTG inducible type, the induction
time period may be within a day, especially within several
hours.
[0250] Also when an inventive transformant is a mammalian cell, it
can be cultured under the condition suitable for said cell. For
example, an FBS-supplemented DMEM medium (NISSUI) may be employed
to conduct a culture in the presence of 5% CO.sub.2 at a
temperature of 36 to 38.degree. C. with replacing the medium with a
fresh one at an interval of several days. Upon confluent growth,
the cells were combined with a trypsin PBS solution to disperse
into individual cells and the resultant cell suspension was diluted
by several times and inoculated onto a new petri dish, which is
then subjected to a subculture. The culture time period is usually
2 to 5 days, especially 2 to 3 days.
[0251] Also when an insect cell is employed as a transformant, the
culture condition may be adjusted appropriately depending on the
type of the cell. For example, an insect cell culture medium such
as Grace's medium containing FBS and Yeastlate may be employed to
conduct the culture at 25 to 35.degree. C. The culture time period
is 1 to 5 days, especially 2 to 3 days. When using as a vector an
virus-containing transformant such as a Baculovirus, the culture is
continued preferably until the time before the cell death as a
result of the onset of the cytoplasmic effect (for example, 3 to 7
days, especially 4 to 6 days).
[0252] After completion of the culture, the transformant cells were
recovered by a centrifugation, suspended in a suitable buffer if
desired, and dispersed by means of a polytron, ultrasonic
treatment, homogenizer and the like. The resultant dispersion is
centrifuged at about 100 to 150G for about 5 to 10 minutes, and the
resultant supernatant is centrifuged at about 18,000 to 20,000 G
for about 20 to 30 seconds to recover the pellet, whereby obtaining
a cell membrane fraction.
[0253] The cell membrane fraction thus obtained is subjected to a
known protein purification method, such as any of chromatographic
methods including ion exchange, hydrophobic, gel filtration and
affinity chromatographies, whereby purifying the protein according
to the invention.
[0254] An inventive protein can be expressed for example as being
attached with a histidine tag, or as a glutathion S transferase
fusion protein. The former case employs a metal chelate affinity
column, while the latter case employs a glutathion S transferase
monoclonal antibody column, whereby accomplishing the purification
of an inventive protein in a further convenient manner.
<Inventive Antisense Polynucleotide>
<Aspect>
[0255] An inventive antisense polynucleotide is a polynucleotide
(13) or (14) shown below. [0256] (13) A polynucleotide which
inhibits expression of a protein of the invention which consists of
a nucleotide sequence complementary to at least 15 contiguous
nucleotides in the nucleotide sequence represented by SEQ ID NO:2.
[0257] (14) A polynucleotide which inhibits expression of a protein
of the invention which hybridizes under an intracellular condition
with a polynucleotide consisting of at least 15 contiguous
nucleotides in the nucleotide sequence represented by SEQ ID
NO:2.
[0258] An antisense oligonucleotide of the invention hybridizes
with a mRNA encoding an inventive protein to inhibit the
translation from the mRNA to the protein or cleaves the mRNA,
whereby inhibiting the expression of this protein.
[0259] While the upper limit of the number of the nucleotides in an
antisense polynucleotide is not limited particularly, it is usually
about 60 nucleotides for the purpose of achieving the
objective.
[0260] A polynucleotide (13) preferably has a nucleotide sequence
complementary to at least 30 nucleotides, especially at least 50
nucleotides in the polynucleotide represented by SEQ ID NO:2. An
antisense (14) is preferably one which hybridizes under an
intracellular condition also with a polynucleotide consisting of at
least 30 nucleotides, especially at least 50 nucleotides in the
polynucleotide represented by SEQ ID NO:2.
[0261] A polynucleotide which hybridizes under an intracellular
condition in the invention may for example be a polynucleotide
which hybridizes under a stringent condition described below. The
stringent condition may for example be a condition involving
2.times.SSC, 1.times.Denhart's solution at about 60.degree. C.
[0262] A polynucleotide (13) preferably has a nucleotide sequence
complementary to at least 15 contiguous nucleotides across the both
of the region of the nucleotide Nos. 1 to 378 and the region of the
nucleotide Nos. 379 to 1377 in SEQ ID NO:2.
[0263] Similarly, a polynucleotide (14) is preferably one which
hybridizes under an intracellular condition with a polynucleotide
consisting of at least 15 contiguous nucleotides across the both of
the region of the nucleotide Nos. 1 to 378 and the region of the
nucleotide Nos. 379 to 1377 in SEQ ID NO:2.
[0264] "At least 15 contiguous nucleotides in the nucleotide
sequence represented by SEQ ID NO:2" in polynucleotides (13) and
(14) which is closer to the 5' terminal of SEQ ID NO:2 is more
preferable.
[0265] An antisense polynucleotide of the invention may be a
single-stranded DNA, double-stranded DNA, single-stranded RNA,
double-stranded RNA or DNA.cndot.RNA hybrid. When a double-stranded
RNA is employed, it is generally called an RNAi. A derivative of
such a nucleotide may also be employed as long as it inhibits the
expression of an inventive protein. A derivative may for example be
a phosphorthioate DNA, H-phosphonate DNA and the like.
[0266] Inhibition of an inventive protein expression by an
inventive antisense polynucleotide can be verified for example by a
method described below. A human brain-derived cell is combined with
an antisense at about 5 nM to 10 .mu.M if necessary together with a
known intracellular introduction reagent such as a lipofection
reagent, lipofectamine reagent, liposome and the like. Then, from
this cell a cell extract is prepared by a known method and an
inventive antibody is used to measure expression level of the
inventive protein by a known method such as an ELISA or western
blotting. This expression level is compared with the level observed
in the absence of the antisense.
[0267] An inventive antisense polynucleotide may for example be one
which reduces the inventive protein expression level for example to
70% or less, preferably to 50% or less based on the level in the
absence of the antisense polynucleotide.
[0268] An inventive antisense polynucleotide can be produced by a
known chemical synthesis method.
<Application of Antisense Polynucleotide>
[0269] An inventive antisense polynucleotide can be used preferably
as a regulator of an intracellular signal transduction mediated by
a GPCR stimulation. Typically, it can be used preferably for
treating or preventing a disease caused by an abnormality in this
intracellular signal transduction. It is useful preferably for the
purpose especially of suppressing the increased abnormality in this
intracellular signal transduction.
<Ribozyme>
<Aspect>
[0270] An inventive ribozyme is a ribozyme (15) or (16) shown
below. [0271] (15) A ribozyme having an ability of cleaving a
polynucleotide of the invention which comprises two polynucleotide
regions complementary to two regions respectively consisting of at
least 9 contiguous nucleotides which are two regions in the
nucleotide sequence represented by SEQ ID NO:2. [0272] (16) A
ribozyme having an ability of cleaving a polynucleotide of the
invention which comprises two polynucleotide regions which
hybridizes under an intracellular condition with two regions
respectively consisting of at least 9 contiguous nucleotides which
are two regions in the nucleotide sequence represented by SEQ ID
NO:2.
[0273] A ribozyme (15) preferably comprises two polynucleotide
regions complementary to two regions respectively consisting of at
least 10, especially 11 contiguous nucleotides which are two
regions in the nucleotide sequence represented by SEQ ID NO:2.
[0274] A ribozyme (16) preferably comprises two polynucleotide
regions which hybridizes under an intracellular condition with two
regions respectively consisting of at least 10, especially 11
contiguous nucleotides which are two regions in the nucleotide
sequence represented by SEQ ID NO:2.
[0275] In the ribozymes (15) and (16), the two regions in the
nucleotide sequence represented by SEQ ID NO:2 may be adjacent to
each other, or but may preferably be interrupted by about 1 to 4
nucleotides present between them. For example, a hammer-head
ribozyme may contain a single interrupting nucleotide, while a
hairpin ribozyme may contain 4 interrupting nucleotides.
[0276] A ribozyme is an RNA molecule containing an antisense
sequence recognizing a specific site of an RNA, and has an RNA
cleavage enzyme activity. As a result, the ribozyme recognizes its
target RNA, and cleaves a certain site of the RNA specifically.
[0277] An inventive ribozyme may be of a hammer-head or hairpin
type. A hammer-head type usually recognize an NUX (N is G, U, C or
A, while X is C, U or A) and cleaves a mRNA at the 3'-position of
the X.
[0278] A hammer-head ribozyme according to the invention may for
example be a ribozyme comprising a nucleotide sequence listed
below. [0279] A ribozyme comprising the nucleotide sequence:
TABLE-US-00001 [0279] (SEQ ID NO: 3)
UCGCCUCCUUCUGAUGAGGCCGAAAGGCCGAAACCGCCTCGCGC.
The ribozyme having this nucleotide sequence once forms its
conformation and then recognizes the nucleotide sequence of the
nucleotide Nos. 273 to 295 in SEQ ID NO:2. [0280] A ribozyme
comprising the nucleotide sequence:
TABLE-US-00002 [0280] (SEQ ID NO: 4)
CGGCCGCCCGCUGAUGAGGCCGAAAGGCCGAAACUGGGGCCAGC.
The ribozyme having this nucleotide sequence once forms its
conformation and then recognizes the nucleotide sequence of the
nucleotide Nos. 111 to 133 in SEQ ID NO:2. [0281] A ribozyme
comprising the nucleotide sequence:
TABLE-US-00003 [0281] (SEQ ID NO: 5)
CAGCGGCCGCCUGAUGAGGCCGAAAGGCCGAAACUGUAGCACA.
The ribozyme having this nucleotide sequence once forms its
conformation and then recognizes the nucleotide sequence of the
nucleotide Nos. 8 to 30 in SEQ ID NO:2.
[0282] A hairpin type ribozyme usually recognizes an
NNNG/CN*GUCNNNNNNNN (N is G, U, C or A), and cleaves a mRNA between
N*G.
[0283] A hairpin ribozyme according to the invention may for
example be a ribozyme comprising a nucleotide sequence listed
below. [0284] A ribozyme comprising the nucleotide sequence:
TABLE-US-00004 [0284] (SEQ ID NO: 6)
UCGCCUCCUUAGAAGCCUACCAGAGAAACACACGUUGUGGUAUAUUACC UGGUA.
The ribozyme having this nucleotide sequence once forms its
conformation and then recognizes the nucleotide sequence of the
nucleotide Nos. 287 to 295 in SEQ ID NO:2. [0285] A ribozyme
comprising the nucleotide sequence:
TABLE-US-00005 [0285] (SEQ ID NO: 7)
CGGCCGCCCGAGAAGGGGACCAGAGAAACACACGUUGUGGUAU AUUACCUGGUA.
The ribozyme having this nucleotide sequence once forms its
conformation and then recognizes the nucleotide sequence of the
nucleotide Nos. 116 to 133 in SEQ ID NO:2. [0286] A ribozyme
comprising the nucleotide sequence:
TABLE-US-00006 [0286] (SEQ ID NO: 8)
CAGCGGCCGCAAGAAGUAGACCAGAGAAACACACGUUGUGGUAU AUUACCUGGUA.
The ribozyme having this nucleotide sequence once forms its
conformation and then recognizes the nucleotide sequence of the
nucleotide Nos. 12 to 30 in SEQ ID NO:2.
[0287] While an inventive ribozyme usually consists of an RNA, a
one which includes a deoxyribonucleotide or a derivative such as a
phosphorthioate DNA which is difficult to be decomposed in vivo are
also included in the inventive ribozyme.
[0288] An inventive ribozyme can be produced by a known chemical
synthesis method, in vitro or in vivo transcription and the like.
Typically, an in vitro transcription involves the ligation of a DNA
having a sequence complementary to the sequence of SEQ ID NO:3, 4,
5, 6, 7 or 8 to the downstream of the DNA encoding a promoter such
as T7, T3 or SP6. Using this DNA as a template, a transcription
reaction by an RNA polymerase is conducted. The resultant
transcription product can be used as an RNA for the ribozyme.
[0289] An in vivo transcription involves the integration of a DNA
having a sequence complementary to the sequence of SEQ ID NO:3, 4,
5, 6, 7 or 8 into an mammalian expression vector followed by the
transduction of this expression vector into a mammalian cell. As a
result of the cellular transcription mechanism, an RNA having the
sequence of SEQ ID NO:3, 4, 5, 6, 7 or 8 is synthesized.
<Application of Ribozyme>
[0290] An inventive ribozyme can be used preferably as a regulator
of an intracellular signal transduction mediated by a GPCR
stimulation. Typically, it can be used preferably for treating or
preventing a disease caused by an abnormality in this intracellular
signal transduction. It is useful preferably for the purpose
especially of suppressing the increased abnormality in this
intracellular signal transduction.
<Inventive Antibody>
<Aspect>
[0291] An inventive antibody is an antibody which recognizes an
inventive protein specifically. The inventive antibody may be a
polyclonal antibody or monoclonal antibody. The inventive antibody
includes an antibody having an antigen binding ability toward a
polypeptide consisting of 5 contiguous amino acids, preferably 10
amino acids in the amino acid sequence constituting an inventive
protein. In addition, a derivative of such an antibody (chimera
antibody and the like) or a one labeled with an enzyme such as a
peroxidase are also included in the inventive antibody.
<Method for Producing Inventive Antibody>
[0292] Any of the antibodies described above can be produced in
accordance with a known production method (for example, Current
protocols in Molecular Biology edit. Ausubel et al. (1987) Publish.
John Wiley and Sons. Section 11.12-11.13).
[0293] Typically, when an inventive antibody is a polyclonal
antibody, it can be obtained by immunizing a non-human animal such
as a rodent animal with an inventive protein followed by the
isolation from the serum of this immunized animal in accordance
with a standard method. When an inventive antibody is a monoclonal
antibody, it can be obtained from a hybridoma produced by
immunizing a non-human animal such as a mouse with a polypeptide
having an inventive protein or its partial sequence followed by
fusing the spleen cell of this immunized animal with a myeloma cell
(Current protocols in Molecular Biology edit. Ausubel et al. (1987)
Publish. John Wiley and Sons. Section 11.4-11.11).
<Application of Antibody>
[0294] An inventive antibody can be used preferably as a regulator
of an intracellular signal transduction mediated by a GPCR
stimulation. Typically, it can be used preferably for treating or
preventing a disease caused by an abnormality in this intracellular
signal transduction. It is useful preferably for the purpose
especially of suppressing the increased abnormality in this
intracellular signal transduction.
[0295] An inventive antibody can preferably be used also in the
affinity chromatography for purifying an inventive protein as well
as in the screening for a substance which may affect the expression
of an inventive protein.
<Inventive Oligonucleotide>
[0296] An inventive oligonucleotide is an oligonucleotide (17) or
(18) shown below. [0297] (17) An oligonucleotide capable of
recognizing a polynucleotide represented by SEQ ID NO:2
specifically which consists of at least 17 contiguous nucleotides
in the nucleotide sequence represented by SEQ ID NO:2. [0298] (18)
An oligonucleotide capable of recognizing a polynucleotide
represented by SEQ ID NO:2 specifically which has a homology of 80%
or more with at least 17 contiguous nucleotides in the nucleotide
sequence represented by SEQ ID NO:2.
[0299] The length of each of the oligonucleotides (17) and (18) can
be selected appropriately depending on the use. It may be the full
length of SEQ ID NO:2.
[0300] An oligonucleotide (18) preferably has a homology of 85% or
more, especially 90% or more with an oligonucleotide (17).
[0301] The expression "recognize specifically" in conjunction with
oligonucleotides (17) and (18) means that each oligonucleotide can
be employed to detect the nucleotide sequence represented by SEQ ID
NO:2 specifically or selectively by a known nucleotide sequencing
means such as a northern blotting or PCR.
[0302] An inventive oligonucleotide can be used as a probe or
primer which can detect or amplify an RNA generated as a result of
the expression of an inventive DNA or a polynucleotide derived
therefrom in a specific manner. Typically, it can be used as a
probe or primer in a known method for detecting a certain
nucleotide sequence, such as a Northern blotting, in situ
hybridization or PCR.
[0303] As a result, the absence or presence of the expression of,
or the expression level of an inventive polynucleotide can be
assessed. Accordingly, an inventive oligonucleotide can preferably
used for diagnosing a disease caused by a signal transduction
abnormality resulting from the defect of and the abnormal increase
or decrease in the expression level of the inventive protein. A
test sample may be a total RNA prepared by a standard method from a
sample taken from a tissue of a subject such as an uterus or any of
various polynucleotides prepared from such an RNA.
[0304] An inventive oligonucleotide may for example be ones having
the nucleotide sequences of 5'-ATGGGTCTGTGCTACAGTCTGCGG (SEQ ID
NO:9) and 5'-ACGATGGTGCTTTTCCCAGACTCACCAGCCCCGAGCA (SEQ ID NO:10).
This oligonucleotide set can preferably used as PCR primers for
amplifying a protein of the invention.
<Inventive Screening Method>
[0305] A polynucleotide of the invention can be used for screening
for a substance which activates or inhibits (or suppress) the
cellular signal transduction mediated by a GCPR and an inventive
protein.
[0306] A GPCR stimulating signal is transmitted to an effector via
the activation of a G protein as a result of the GDP/GTP exchange
reaction on a G protein .alpha. subunit. Accordingly, by using the
change in the activity of this effector as an index in screening
test substances, a substance capable of activating or inhibiting
the signal transduction mediated by a GPCR and a G protein .alpha.
subunit can be identified. In addition, also by using the change in
the level of the binding of a GTP to a membrane fraction of a cell
expressing a G protein as an index in screening test substances, a
substance capable of activating or inhibiting the signal
transduction mediated by a GPCR and a G protein .alpha. subunit can
be identified.
[0307] Otherwise, by screening test substances which alter the
level of the expression of an inventive protein, a substance
capable of activating or inhibiting the signal transduction
mediated by a GPCR and a G protein .alpha. subunit can be
identified.
<First Method>
[0308] A method for screening for a substance capable of regulating
a signal transduction mediated by a GPCR and an inventive protein
comprising: [0309] (a) a step for bringing a test substance into
contact with a test cell having a recombinant vector containing an
inventive polynucleotide (which herein is a DNA encoding an
inventive protein) and a recombinant vector containing a DNA
encoding a GPCR; [0310] (b) a step for measuring the G protein
effector activity or the index value correlating therewith in the
test cell (hereinafter abbreviated as "effector activity"); and
[0311] (c) a step for comparing this effector activity with the
effector activity in the test cell which has not been brought into
contact with the test substance, whereby selecting a test substance
capable of altering the effector activity in the test cell.
[0312] In the first method, an agonist of GPCR can be selected.
[0313] A cell in which a recombinant vector having a DNA encoding
an inventive protein and a recombinant vector having a DNA encoding
a GPCR are contained may for example be but not limited to a
mammalian cell or insect cell. A mammalian cell may be any known
cell such as a Vero cell, Hela cell, CV1 cell, COS1 cell, CHO cell
and the like, which may be employed without limitation. An insect
cell may be any known cell such as a Sf cell, MG1 cell, High
Five.TM. cell, and the like, which may be employed without
limitation. The type of the vector is not limited particularly, and
any known vector may be selected depending on the type of the
cell.
[0314] A DNA encoding a GPCR can be obtained by a method for
screening a human cDNA library using a probe designed based on the
nucleotide sequences described in a GPCR database
(www.cmbi.kun.nl/7tm/), by a method for conducting a PCR using as a
template a human cDNA library together with the primers designed
based on the nucleotide sequences described above, or by a chemical
synthesis method and the like.
[0315] An effector of a G protein may be an effector which is a
target of a G protein .alpha. subunit or may be an effector which
is a target of a G protein .beta..gamma. subunit. It is also
possible to measure an index value correlating with the effector
activity of a G protein.
[0316] An effector which is targeted by a G protein .alpha. subunit
may for example be an adenylate cyclase, Ca.sup.2+ channel, K.sup.+
channel, phospholipase C.beta. and the like. The adenylate cyclase
activity be assessed by measuring the intracellular cAMP level. The
Ca.sup.2+ channel activity can be assessed by measuring the cell
membrane electric potential. The K.sup.+ channel activity can be
assessed by measuring the cell membrane electric potential. The
phospholipase C.beta. activity can be assessed by measuring the
Ca.sup.2+ level.
[0317] An effector which is targeted by a G protein .beta..gamma.
subunit may for example be an adenylate cyclase, Ca.sup.2+ channel,
K.sup.+ channel, phospholipase C.beta., phosphatidyl inositol
3-kinase .beta. or .gamma. and the like. The phosphatidyl inositol
3-kinase .beta. or .gamma. activity can be assessed by measuring
the Ca.sup.2+ level.
[0318] An effector to be examined for its activity is preferably an
effector targeted by a G protein .alpha. subunit, with an adenylate
cyclase being more preferred. The intracellular cAMP level which
reflects the adenylate cyclase activity can be measured by a known
method such as an RIA employing an anti-cAMP antibody obtained by
immunizing a mouse, rat, rabbit, goat, cattle and the like together
with a .sup.125I-labeled cAMP, other EIA employing a combination of
an anti-cAMP antibody and a labeled cAMP, a SPA method employing a
scintillant obtained by immobilizing an anti-cAMP antibody using a
protein A or an antibody against an animal IgG used for producing
an anti-cAMP antibody together with a .sup.125I-labeled cAMP, an
EFC method employing a combination of an anti-cAMP antibody, enzyme
donor-binding cAMP and enzyme blank acceptor, and the like. Any of
these measurements can be accomplished using a commercial kit.
[0319] An intracellular cAMP level can be assessed also by a method
in which, for example, a CRE (cAMP response element, which reacts
with a cAMP)-containing DNA is inserted into the upstream of the
reporter gene of a reporter gene vector to form a CRE-reporter gene
vector, and this vector is also introduced into a test cell and
then the reporter gene expression level is measured. In a cell into
which a CRE-reporter gene vector has been introduced, a stimulation
accompanied with an elevation in the cAMP level induces a reporter
gene expression mediated by the CRE and the subsequent reporter
protein production. On the contrary, a reduction in the cAMP level
leads to a reduction in the CRE-mediated reporter protein
production. By using a CRE reporter gene vector, the cAMP level can
be measured conveniently at a high sensitivity.
[0320] As a reporter gene, any of known genes can be employed
without limitation, including a luciferase gene, secretor alkaline
phosphatase (SEAP) gene, chloramphenicol acetyltransferase (CAT)
gene, .beta.-galactosidase gene and the like. Any of these genes
can be examined for its expression level using a commercial
measurement kit described below. The luciferase gene expression
level can be measured by adding a luminescent substrate luciferrin
(manufactured for example by TOYO INK) to a cell solution followed
by measuring the luminescence resulting from the decomposition of
the substrate using a luminometer, liquid scintillation counter or
top counter. Expression level of the alkaline phosphatase gene can
be determined for example by using L.mu.Mi-Phos530 (WAKO PURE
CHEMICAL). Expression level of the chloramphenicol
acetyltransferase gene can be determined using a FAST CAT
Chloramphenicol Acetyltransferase Assay Kit (WAKO PURE CHEMICAL).
Expression level of the .beta.-galactosidase gene can be determined
using an AURORA Gal-XE (WAKO PURE CHEMICAL).
[0321] In the case for example where a luciferase gene is employed,
a CRE-containing DNA is inserted into a multiple cloning site in
the upstream of a luciferase gene such as a PICK-A-GENE Basic
Vector or a PICK-A-GENE Enhancer vector (TOYO INK) and the like,
which is then used as a CRE reporter gene vector.
[0322] The type of a test substance is not limited particularly.
Those which may be exemplified are proteins, peptides, non-peptide
compounds (nucleotides, amines, saccharides, lipids and the like),
organic low molecular compounds, inorganic low molecular compounds,
fermentation products, cell extracts, plant extracts, animal tissue
extracts and the like.
[0323] The contact of a cell with a test substance may be effected
under a condition avoiding the cell death and allowing an inventive
protein and a GPCR to be expressed from an introduced vector
(temperature, pH, medium composition). The concentration of a test
substance upon contact with a cell may for example be about 0.001
to 10 .mu.M, although it may vary depending on the type of the
substance.
[0324] A test substance which increase the effector activity of a
test cell brought into contact with the test substance for example
by about 25%, preferably about 50%, more preferably about 100%,
when compared with the effector activity in the test cell which was
not brought into contact with the test substance, can be selected
as a GPCR agonist.
<Second Method>
[0325] A method for screening for a substance capable of regulating
a signal transduction mediated by a GPCR and an inventive protein
comprising: [0326] (a) a step for bringing a test substance into
contact with a test cell having a recombinant vector containing an
inventive polynucleotide (which herein is a DNA encoding an
inventive protein) and a recombinant vector containing a DNA
encoding a GPCR; [0327] (b) a step for measuring the G protein
effector activity in the test cell; and [0328] (c) a step for
comparing this effector activity with the effector activity when
the said test substance has been brought into contact with a
control cell having no recombinant vector containing a DNA encoding
an inventive protein but having a recombinant vector containing a
DNA encoding a GPCR, whereby selecting a test substance causing a
difference in the effector activity between the test cell and the
control cell.
[0329] In the second method, a test substance which gives the
effector activity of a test cell having an inventive protein
expression vector which is higher than the effector activity in a
control cell having no such a vector may be searched for. As a
result, a substance which activates any stage of the signal
transduction mediated by a GPCR and the inventive protein can be
selected as a candidate compound.
[0330] A test substance which increase the effector activity of a
test cell for example by about 20%, preferably about 50%, more
preferably about 100%, when compared with a control cell can be
selected as a signal transduction activator.
[0331] Otherwise, the aspect is similar to that in of the first
method discussed above.
<Third Method>
[0332] A method for screening for a substance capable of regulating
a signal transduction mediated by a GPCR and an inventive protein
comprising: [0333] (a) a step for bringing a test substance into
contact with a test cell having a recombinant vector containing an
inventive polynucleotide (which herein is a DNA encoding an
inventive protein) and a recombinant vector containing a DNA
encoding a GPCR; [0334] (b) a step for measuring the G protein
effector activity in the test cell; and [0335] (c) a step for
comparing this effector activity with the effector activity when
the said test substance has been brought into contact with a
control cell having no recombinant vector containing a DNA encoding
a GPCR but having a recombinant vector having a DNA encoding an
inventive protein, whereby selecting a test substance causing a
difference in the effector activity between the test cell and the
control cell.
[0336] In the third method, a test substance which gives the
effector activity of a test cell having a GPCR expression vector
which is higher than the effector activity in a control cell having
no GPCR expression vector may be searched for. As a result, a GPCR
agonist can be selected as a candidate substance.
[0337] A test substance which increase the effector activity of a
test cell for example by about 20%, preferably about 50%, more
preferably about 100%, when compared with a control cell can be
selected as a signal transduction activator.
[0338] Otherwise, the aspect is similar to that in of the first
method discussed above.
<Fourth Method>
[0339] A method for screening for a substance capable of regulating
a signal transduction mediated by a GPCR and an inventive protein
comprising: [0340] (a) a step for bringing a test substance and a
GPCR ligand into contact with a test cell having a recombinant
vector containing an inventive polynucleotide (which herein is a
DNA encoding an inventive protein) and a recombinant vector
containing a DNA encoding a GPCR protein; [0341] (b) a step for
measuring the G protein effector activity in the test cell; and
[0342] (c) a step for comparing this effector activity with the
effector activity in the test cell which has not been brought into
contact with the test substance but has been brought into contact
with the ligand, whereby selecting a test substance capable of
altering the effector activity in the test cell.
[0343] In the fourth method, a test substance which gives increased
or reduced effector activity in the control cell which has not been
brought into contact with the test substances when compared with
the effector activity in the test cell which has been brought into
contact with the test substances may be searched for. As a result,
a substance which activates or inhibits any stage of the signal
transduction initiated from the binding of a GPCR ligand to a GPCR
can be selected, including a GPCR agonist or antagonist.
[0344] A GPCR ligand may for example be amine molecules. It is
preferable especially to use dopamine. The ratio between a ligand
to be brought into contact with a cell and a test substance, when
represented as the molar ratio of ligand:test substance, may for
example be about 1:0.1 to 1:100, preferably about 1:1 to 1:50.
[0345] The percentage effector activity in a test cell which has
been brought into contact with the both of a GPCR ligand and a test
substance is calculated, on the bases of the effector activity in
the test cell which has been brought into contact only with the
GPCR ligand being regarded as 100% and the effector activity in the
test cell which has been brought into contact with none of the GPCR
ligand or the test substance as 0%. A test substance which gives a
% effector activity in a test cell which has been brought into
contact with the both of a GPCR ligand and the test substance of
85% or less, preferably 70% or less, especially 50% or less can be
selected as a candidate of the cellular signal transduction
inhibitor or suppressor. On the other hand, a test substance which
raises this percentage to 125% or more, preferably 150% or more,
especially 200% or more can be selected as a candidate of the
cellular signal transduction activator.
[0346] Otherwise, the aspect is similar to that in of the first
method discussed above.
<Fifth Method>
[0347] A method for screening for a substance capable of regulating
a signal transduction mediated by a GPCR and an inventive protein
comprising: [0348] (a) a step for bringing a test substance and a
GPCR ligand into contact with a test cell having a recombinant
vector containing an inventive polynucleotide (which herein is a
DNA encoding an inventive protein) and a recombinant vector
containing a DNA encoding a GPCR protein; [0349] (b) a step for
measuring the G protein effector activity in the test cell; [0350]
(c) a step for comparing this effector activity with the effector
activity in the test cell which has not been brought into contact
with the test substance but has been brought into contact with the
ligand, whereby investigating the change in the effector activity
in the test cell; and [0351] (d) a step for comparing the rate of
change in this effector activity with the rate of change in the
effector activity when the said test substance and said ligand has
been brought into contact with a control cell having no recombinant
vector containing a DNA encoding a GPCR but having a recombinant
vector containing a DNA encoding an inventive protein, whereby
selecting a test substance causing a difference in the rate of
change in the effector activity between the test cell and the
control cell.
[0352] In the fifth method, a test substance which gives an
elevated rate of change in the effector activity in a test cell
having a recombinant vector containing a DNA encoding a GPCR
protein when compared with the rate of change in the effector
activity in a control cell having no such a vector may be searched
for. As a result, a substance which serves as an antagonist against
an exogenous GPCR can be selected. While in the fourth method
described above an antagonist against an endogenous GPCR is also
selected, by subjecting the substances obtained by the fourth
method to a screening by the fifth method, a substance serving as
an antagonist against the endogenous GPCR can selectively be
eliminated.
[0353] A test substance which increase the rate of change in the
effector activity of a test cell for example by about 15%,
preferably about 30%, more preferably about 50%, when compared with
a control cell can be selected as a candidate of an exogenous
GPCR-directed antagonist.
[0354] Otherwise, the aspect is similar to that in of the first
method discussed above.
<Sixth Method>
[0355] A method for screening for a substance capable of regulating
a signal transduction mediated by a GPCR and an inventive protein
comprising: [0356] (a) a step for bringing a test substance into
contact with a cell membrane fraction of a cell having a
recombinant vector containing an inventive polynucleotide (which
herein is a DNA encoding an inventive protein) and a cell membrane
fraction of a cell having a recombinant vector containing a DNA
encoding a GPCR, or [0357] a cell membrane fraction of a cell
having the recombinant vector containing a polynucleotide encoding
an inventive protein (which herein is a DNA encoding an inventive
protein) and the recombinant vector containing the DNA encoding the
GPCR; [0358] (b) a step for assaying the level of the binding of
GTP to the cell membrane fraction; and [0359] (c) a step for
comparing the assayed level of this GTP binding with the assayed
level of the GTP binding to the cell membrane fraction which has
not been brought into contact with the test substance, whereby
selecting a test substance capable of altering the assayed level of
the GTP binding to the cell membrane fraction.
[0360] When a cell expressing a GPCR and a G protein is stimulated
by a GPCR ligand, then a GTP is bound to a G protein .alpha.
subunit. This phenomenon is observed also in a membrane fraction of
a cell which expresses a GPCR and a G protein. Accordingly, in the
sixth method, a substance which increases the level of the binding
of a GTP to this cell membrane fraction can be selected as a GPCR
agonist.
[0361] Usually, a GTP bound to a G protein .alpha. subunit is
decomposed into a GDP. Accordingly, a GTP analogue which is capable
of binding to an inventive protein but is not decomposed by a
GTPase is used to measure the level of the binding of this GTP
analogue to an inventive protein, whereby assaying the level of the
binding of the GTP to the inventive protein. Such a GTP analogue
may for example be a GTP.gamma.S, G.sub.PPNH.sub.P and the
like.
[0362] For measuring the level of the binding of a GTP analogue to
a cell membrane fraction, the GTP analogue is labeled for example
with a radiolabel, and then the labeled GTP analogue is added to
the cell membrane fraction and incubated for a certain period, and
then the radioactivity in the cell membrane fraction is measured by
a scintillation counter and the like.
[0363] The methods for preparing and characterizing a cell membrane
fraction are as described above.
[0364] A test substance which increases a level of the binding of a
GTP to a cell membrane fraction in a test cell which has been
brought into contact with a test substance for example by about
25%, preferably about 50%, more preferably about 100%, when
compared with a test cell which has not been brought into contact
with a test substance can be selected as a candidate GPCR
agonist.
[0365] Otherwise, the aspect is similar to that in of the first
method discussed above.
<Seventh Method>
[0366] A method for screening for a substance capable of regulating
a signal transduction mediated by a GPCR and an inventive protein
comprising: [0367] (a) a step for bringing a test substance and a
GPCR ligand into contact with [0368] a cell membrane fraction of a
cell having a recombinant vector containing an inventive
polynucleotide (which herein is a DNA encoding an inventive
protein) and a cell membrane fraction of a cell having a
recombinant vector containing a DNA encoding a GPCR, or [0369] a
cell membrane fraction of a cell having the recombinant vector
containing a polynucleotide encoding an inventive protein (which
herein is a DNA encoding an inventive protein) and the recombinant
vector containing the DNA encoding the GPCR; [0370] (b) a step for
assaying the level of the binding of GTP to this cell membrane
fraction; and [0371] (c) a step for comparing the assayed level of
this GTP binding with the assayed level of the GTP binding in the
cell membrane fraction which has not been brought into contact with
the test substance but has been brought into contact with said
ligand, whereby selecting a test substance capable of altering the
assayed level of the GTP binding to the cell membrane fraction.
[0372] In the seventh method, a substance which activates or
inhibits (or suppresses) any stage (through the time of the binding
of a GTP to a G protein .alpha. subunit) in a cellular signal
transduction can be searched for, including GPCR receptor agonist
and antagonist.
[0373] The percentage radioactivity in a membrane fraction which
has been brought into contact with the both of a GPCR ligand and a
test substance is calculated, on the bases of the radioactivity in
the membrane fraction which has been brought into contact only with
the GPCR ligand being regarded as 100% and the radioactivity in the
membrane fraction which has been brought into contact with none of
the GPCR ligand or the test substance as 0%. A test substance which
gives a % radioactivity when brought into contact with the both of
a GPCR ligand and the test substance of 75% or less, preferably 50%
or less, especially 25% or less can be selected as a candidate of
the cellular signal transduction inhibitor or suppressor. On the
other hand, a test substance which raises the percentage
radioactivity when brought into contact with the both of a GPCR
ligand and the test substance to 125% or more, preferably 150% or
more, especially 200% or more can be selected as a candidate of the
cellular signal transduction activator.
[0374] Otherwise, the aspect is similar to that in of the sixth
method discussed above. A ligand which can be employed and the
ratio between the ligand and a test substance are similar to those
in the fourth method.
<Eighth Method>
[0375] A method for screening for a substance capable of regulating
a signal transduction mediated by a GPCR and an inventive protein
comprising: [0376] (a) a step for bringing a test substance into
contact with a test cell capable of expressing a protein of the
invention; [0377] (b) a step for measuring the expression level of
the protein of the invention in the test cell; and [0378] (c) a
step for comparing this expression level with the expression level
of said protein in the test cell which has not been brought into
contact with the test substance, whereby selecting a test substance
capable of altering the expression level of said protein in the
test cell.
[0379] In this method, a substance which activates or inhibits a
signal transduction mediated by an inventive protein by increasing
or reducing the expression of the inventive protein can be
selected.
[0380] The expression level of an inventive protein can be
determined by measuring the level of the corresponding mRNA. The
level of this mRNA can be determined by a known method such as a
Northern blotting using an inventive probe described above or a PCR
using inventive primers described above.
[0381] Specifically, a Northern blotting can be conducted in such a
manner that an RNA is prepared from a test cell by a standard
method, transferred onto a nylon membrane and the like, hybridized
with a probe labeled for example with a radioisotope or fluorescent
substance, and then a double strand of the probe with the RNA is
detected by a method suitable for the label. A PCR can be conducted
in such a manner that a cDNA is prepared from a mRNA of a test cell
and used as a template to perform a PCR by a standard method using
an inventive oligonucleotide set as primers.
[0382] The expression level of an inventive protein can be
determined by quantifying the protein directly. The level of this
protein can be determined by a known method such as a Western
blotting using an inventive antibody.
[0383] As a cell expressing an inventive protein, a mammalian cell,
preferably a human cell is employed. It is preferred particularly
to use a cell derived from a human brain, thymus, testes, spleen,
small intestine, uterus and heart.
<Inventive Screening Kit>
[0384] A first inventive kit for screening for a substance capable
of regulating a signal transduction mediated by a GPCR and a
protein according to the invention comprises a test cell having a
recombinant vector containing an inventive polynucleotide (which
herein is a DNA) and a reagent for measuring the G protein effector
activity.
[0385] This kit can be used in the first inventive screening method
described above. A test cell and the reagents for measuring a G
protein effector activity are as described above. For performing
the first screening method using this kit, the test cell is
transduced with a recombinant vector having a DNA encoding a GPCR
independently. Alternatively, the test cell may be one having a
GPCR expression vector in addition to a recombinant vector having
an inventive polynucleotide.
[0386] Furthermore, the first inventive screening kit may contain a
control cell which does not have a recombinant vector having an
inventive polynucleotide (which herein is a DNA) but has a control
cell having a recombinant vector having a DNA encoding a GPCR. In
such a case, it can be used in the second inventive screening
method.
[0387] Moreover, the first inventive screening kit may contain a
control cell which does not have a recombinant vector having a DNA
encoding a GPCR but has an inventive polynucleotide (which herein
is a DNA). In such a case, it can be used in the third inventive
screening method.
[0388] The first inventive screening kit may further contain a GPCR
ligand. In such a case, it can be used in the fourth inventive
screening method. A ligand is employed also as described above.
[0389] The first inventive screening kit may further contain a GPCR
ligand and a control cell having no recombinant vector having a DNA
encoding a GPCR but having a recombinant vector having an inventive
polynucleotide (which herein is a DNA). In such a case, it can be
used in the fifth inventive screening method.
[0390] The second inventive kit for screening for a substance
capable of regulating a signal transduction mediated by a GPCR and
a protein according to the invention comprises a cell having a
recombinant vector containing an inventive polynucleotide (which
herein is a DNA); and a GTP analogue which can bind to the protein
of the invention but can not be cleaved by a GTPase. This kit can
be employed in the sixth inventive screening method. A GTP analogue
is employed also as described above.
[0391] For performing the sixth screening method using this kit, a
cell is transduced with a recombinant vector having a DNA encoding
a GPCR independently. Alternatively, such a cell may be one having
a GPCR expression vector in addition to a recombinant vector having
an inventive DNA.
[0392] The third inventive kit for screening for a substance
capable of regulating a signal transduction mediated by a GPCR and
a protein according to the invention comprises a cell having a
recombinant vector containing an inventive polynucleotide (which
herein is a DNA) and a GPCR expression vector; and a GTP analogue
which can bind to the protein of the invention but can not be
cleaved by a GTPase. This kit can be employed in the sixth
inventive screening method.
[0393] Each of the second and third screening kits according to the
invention may further contain a GPCR ligand. In such a case, it can
used in the 7th inventive screening method.
[0394] The fourth inventive kit for screening for a substance
capable of regulating a signal transduction mediated by a GPCR and
a protein according to the invention comprises a cell capable of
expressing a protein of the invention; as well as an inventive
probe, inventive primers or inventive antibody. This kit can be
used in the 8th inventive screening method.
<Pharmaceuticals>
[0395] A protein and an antibody according to the invention can be
used as pharmaceuticals by being administered in an effective
amount to a mammal such as a human in the forms described
below.
[0396] A protein and an antibody according to the invention can be
formulated into pharmaceutical composition in a mixture with
inactive carriers, such as pharmaceutically acceptable carriers
(including excipient, extender, binder, lubricant and the like) as
well as customary additives. Such a pharmaceutical composition may
be given orally or parenterally depending on the dosage form (oral
formulation such as tablet, pill, capsule, powder, granule, syrup
and the like; parenteral formulation such as injection formulation,
drip infusion formulation, dermal formulation, suppository and the
like). The dose may vary depending on the type of the active
ingredient, administration route, subject and the age, body weight
and conditions of the patient, and may be about 0.01 to 100 mg a
day, which can be given all at once or in several portions.
[0397] A polynucleotide, antisense polynucleotide and ribozyme of
the invention can be administered in an effective amount to a
mammal such as a human as pharmaceuticals in the forms of the
pharmaceutical compositions described above. Otherwise, they can be
introduced into a cell of a subject utilizing a liposome delivery
system employing a liposome in which a drug to be delivered is
encapsulated, a microinjection method, a direct injection method,
an gene gun and the like. Also in such cases, the dose and the
administration mode can be selected appropriately by those skilled
in the art, although it may vary depending on the age, body weight
and conditions of the patient.
[0398] An inventive polynucleotide can be introduced into a target
cell also by integrating into a virus vector for a gene
therapy.
[0399] A substance capable of regulating a signal transduction
obtained by an inventive screening method can be administered in an
effective amount to a mammal such as a human in the forms of the
pharmaceutical compositions described above. When this substance is
one encoded by a DNA, it can be introduced into a target cell also
by integrating into a virus vector for a gene therapy.
EFFECT OF THE INVENTION
[0400] According to the invention, a protein which can be regarded
as a novel G protein involved in a cellular signal transduction and
a polynucleotide encoding the same are provided.
[0401] Moreover, an inventive protein can be regarded as a protein
involved in a signal transduction mediated by a GPCR and a G
protein involved in the differentiation and the proliferation of a
cell, since the G protein effector activity in a cell having
vectors expressing the GPCR and the inventive protein respectively
is higher than the relevant effector activity in a cell having no
vector expressing the inventive protein.
[0402] Furthermore, an inventive protein is considered to be one of
G proteins, since it has regions having a high homology with the
amino acid sequence conserved as a GTP binding site and a GTPase
activation site among G proteins and the amino acid sequence of a
trimer forming domain conserved among G proteins.
[0403] Accordingly, an inventive protein and a polynucleotide
encoding the same can preferably be employed as a regulator of an
intracellular signal transduction mediated by a GPCR and the
inventive protein. Moreover, it is useful in treating or preventing
a disease caused by the abnormality in this cellular signal
transduction. Specifically, it can preferably be employed for
treating or preventing a disease caused by an intracellular signal
transduction due to the defect, reduced expression level or reduced
function of a protein of the invention.
[0404] Moreover, an inventive polynucleotide can preferably used in
the screening for a substance capable of regulating a signal
transduction mediated by a GPCR stimulation.
[0405] Inventive antibody, antisense and ribozyme are employed
preferably as regulators of an intracellular signal transduction
mediated by a GPCR and an inventive protein. In addition, they can
be used preferably in treating or preventing a disease caused by an
abnormality in this intracellular signal transduction. They are
useful preferably for the purpose especially of suppressing the
increased abnormality in this intracellular signal
transduction.
[0406] Furthermore, an antibody of the invention can preferably be
used also in the affinity chromatography for purifying an inventive
protein as well as in the screening for a substance which may
affect the expression of an inventive protein.
[0407] A substance obtained by a screening method of the invention
can be used as a regulator of a signal transduction mediated by a
GPCR and an inventive protein.
[0408] In addition, it can be used preferably in treating or
preventing a disease caused by an abnormality in this intracellular
signal transduction.
[0409] An inventive oligonucleotide can preferably be used in
diagnosing of a disease caused by an intracellular signal
transduction due to the defect of, and abnormally increased or
reduced expression level of a protein of the invention.
[0410] Since an inventive protein is found to be expressed in the
tissue of a brain such as a cerebrum, the inventive protein,
polynucleotide, antibody, antisense, ribozyme and a substance
obtained by an inventive screening method are considered to be
useful in preventing or treating a neuropathy and the like. An
inventive oligonucleotide is also considered to be useful in
diagnosing a neuropathy.
[0411] Also since an inventive protein is found to be expressed in
a heart, the inventive protein, polynucleotide, antibody,
antisense, ribozyme and a substance obtained by an inventive
screening method are considered to be useful in preventing or
treating a cardiac disease and the like (Targets, 2002, vol.1,
p206-213).
[0412] Also since an inventive protein is found to be expressed in
a thymus and a spleen, the inventive protein, polynucleotide,
antibody, antisense, ribozyme and a substance obtained by an
inventive screening method are considered to be useful in
preventing or treating an immune disease and the like.
EXAMPLES
[0413] The present invention is further described in the following
Examples, which are not intended to restrict the invention.
[0414] In the following Examples, an inventive protein is sometimes
abbreviated as "Gm1".
Example 1
Cloning of cDNA Encoding Human Gm1 Protein
[0415] A pCR-Gm1 which is a plasmid comprising a DNA encoding a
full-length human Gm1 was prepared as described below.
[0416] 20 ng of a plasmid DNA from a human brain-derived cDNA
library (Takara) (pAP3neo) was employed as a template together with
10 .mu.M of a forward primer: prGm1ATG(5'-ATGGGTCTGTGCTACAGTCTGCGG;
SEQ ID NO:11) and 10 .mu.l of a reverse primer
prGNAL3'(5'-TCACAAGAGCTCATACTGCTT; SEQ ID NO:12) as well as TAKARA
LA Taq polymerase (TAKARA LA Taq with GC Buffer, Takara) to perform
a PCR to obtain an amplified DNA.
[0417] The PCR condition involved 35 cycles, each cycle involving
incubations at 95.degree. C. for 30 seconds followed by 60.degree.
C. for 30 seconds followed by 72.degree. C. for 2 minutes.
[0418] The resultant DNA was subjected to an agarose gel
electrophoresis followed by a purification with a QIAquick Gel
Extraction kit (QIAGEN), and then recovered. This purified and
recovered DNA was used as an insert DNA.
[0419] Subsequently, a TOPO TA Cloning Kit (Invitorogen) was used
and the attached protocol was followed to insert the insert DNA (50
ng) into a cloning site of a pCR2.1-TOPO vector (10 ng), whereby
obtaining a pCR-Gm1.
[0420] The DNA thus obtained was subjected to an ABI377 DNA
sequencer to determine the nucleotide sequence, and was revealed to
contain the nucleotide sequence of the nucleotide Nos. 1-1377 in
the nucleotide sequence represented by SEQ ID NO:2 and to encode
the full-length amino acid sequence represented by SEQ ID NO:1.
Example 2
Detection of Expression Profile of Nucleic Acid Encoding Gm1
[0421] In order to amplify a nucleic acid encoding Gm1
specifically, a forward primer prGm1rt-5'
(5'-ATGGGGTGTTTGGGCGGCAACA; SEQ ID NO:13) and a reverse primer
prGm1rt-3'(5'-ACGATGGTGCTTTTCCCAGACTCACCAGCCCCGAGCA; SEQ ID NO:14)
were produced. Each 1 .mu.g of human bone marrow-derived total RNA
(Ambion), human brain-derived total RNA (Ambion), human
spreen-derived total RNA (Ambion), human thymus-derived total RNA
(Ambion), human small intestine-derived total RNA (Ambion), human
liver-derived total RNA (Ambion), human placenta-derived total RNA
(Ambion), human cervix-derived total RNA (Ambion), human
uterus-derived total RNA (Ambion), human heart-derived total RNA
(Ambion), human skeletal muscle-derived total RNA (Ambion), human
testis-derived total RNA (Ambion) and human kidney-derived total
RNA (Ambion) were employed as templates together with each 10 .mu.M
of the primer set described above and a SuperScript One-Step RT-PCR
System (Invitrogen) and the attached protocol was followed to
conduct a RT-PCR to amplify a mRNA. The condition of the RT-PCR
involved an incubation at 55.degree. C. for 30 minutes for a
reverse transcription reaction, followed by 35 cycles, each cycle
involving incubations at 94.degree. C. for 20 seconds followed by
60.degree. C. for 30 seconds followed by 72.degree. C. for 1
minute.
[0422] Then, 20 .mu.l of the RT-PCR product was subjected to an
agarose gel electrophoresis, stained with ethidium bromide, and
irradiated with UV to identify the signals amplified specifically.
The gel photograph is shown in FIG. 1. As evident from FIG. 1, Gm1
is expressed highly in brain, thymus, testis, spleen, small
intestine, uterus and heart.
Example 3
In Situ Hybridization in Brain Tissue (Detailed Analysis of
Expression Profile of Nucleic Acid Encoding Inventive Protein in
Brain Tissue
[0423] The expression profile of a nucleic acid encoding the
inventive protein in brain tissue was investigated by the following
method.
[0424] For conducting an in situ hybridization in a mouse brain
tissue, the following procedure was employed to clone a cDNA in the
5' terminal region of a mouse Gm1 gene.
[0425] 20 ng of a mouse brain-derived cDNA (Clontech) was employed
as a template together with 10 .mu.M of a forward primer prmGm1-1
(5'-ATGGGCCTATGCTACAGCCTGCGGCCGCT; SEQ ID NO:15) and 10 .mu.M of a
reverse primer prmGm1-2 (5'-GCTGCAGGTCCCGCTTCTGCTCGCGCAGCATGCGGT;
SEQ ID NO:16) as well as TAKARA LA Taq polymerase (TAKARA LA Taq
with GC Buffer, Takara) to perform a PCR to obtain an amplified
DNA.
[0426] The PCR condition involved 35 cycles, each cycle involving
incubations at 95.degree. C. for 30 seconds followed by 60.degree.
C. for 30 seconds followed by 72.degree. C. for 2 minutes. The
resultant DNA was subjected to an agarose gel electrophoresis
followed by a purification with a QIAquick Gel Extraction kit
(QIAGEN), and then recovered. This purified and recovered DNA was
used as an insert DNA.
[0427] Then, a QIAGEN PCR Cloning kit (QIAGEN) was used following
to its attached protocol to insert the insert DNA (50 ng) into a
cloning site of a pDrive vector (10 ng), whereby producing a
pDrmGm1.
[0428] Similarly, a QIAGEN PCR Cloning kit (QIAGEN) was used
following to its attached protocol to insert the insert DNA (50 ng)
to a cloning site of a pDrive vector (10 ng), whereby obtaining a
pDrmGolf.
(Production of Probe for in situ Hybridization)
[0429] 1 .mu.g of a pDrmGm1 plasmid was cleaved with a restriction
enzyme HindIII or BamHI to obtain a linear plasmid pDrmGm1/HindIII
and pDrmGm1/BamHI. L .mu.g of a pDrmGm1/HindIII, 2 .mu.l of a
DlGRNALabelingMix (Roche, Diagnostic) and 1 .mu.l of a SP6RNA
polymerase (Roche, Diagnostic) were mixed and incubated at
37.degree. C. for 3 hours in the presence of the attached buffer.
Then, 1 .mu.l of a DNaseI (Roche, Diagnostic) was added and the
mixture was incubated at 37.degree. C. for 30 minutes to obtain a
cRNA. This cRNA was precipitated with ethanol, suspended in 20
.mu.l of a TE buffer, and used as an mGm1 sense cRNA.
[0430] Similarly, 1 .mu.g of a pDrmGm1/BamHI, 2 .mu.l of a
DIGRNALabelingMix (Roche, Diagnostic) and 1 .mu.l of SP6RNA
polymerase (Roche, Diagnostic) were mixed, and incubated at
37.degree. C. for 3 hours in the presence of the attached buffer.
Then, 1 .mu.l of a Dnasel (Roche, Diagnostic) was added and
incubated at 37.degree. C. for 30 minutes to obtain a cRNA. This
cRNA was precipitated with ethanol, suspended in a 20 .mu.l of TE
buffer, and used as an mGm1 antisense cRNA.
(Detection by in Situ Hybridization)
[0431] A detailed analysis of the expression profile of mRNA of the
Gm1 in a brain is conducted by an in situ hybridization using a
labeled cRNA [Simmons et al., J. Histotechnol. 12:169-181(1989)].
Thus, from a mouse brain fixed using paraformaldehyde and
glutaraldehyde by a known method, a brain section whose thickness
is 50 .mu.m is prepared using a brain section producing device
(sliding microtome), and then adsorbed on a glass slide and dried.
The brain section is made free from the paraffin, autoclaved in a
target solution (Daco) (105.degree. C., 10 minutes), dehydrated,
and dried in the air. The hybridization with a probe (100 ng cRNA)
is conducted in a hybridization buffer (40% formamide, 4.times.SSC,
1 mMEDTA, 250 .mu.g/ml yeast tRNA, 1.times.Denhardt's solution, 10%
dextran sulfate) at 60.degree. C. overnight. Thereafter, the brain
section is washed at 65.degree. C. with 2.times.SSC, 0.1% SDS
solution, treated with an RNaseA (10 .mu.g/ml, 37.degree. C., 30
minutes), washed with 2.times.SSC, 50% formamide solution,
dehydrated, dried in the air, and subjected to a mRNA detection
using a DlG labeled antibody detection kit (Daco).
Example 4
Construction of Expression Plasmid for Expression of Human Gm1
Protein in E. Coli
[0432] In order to express a large amount of a human Gm1 protein in
E. coli, a human Gm1 protein is first expressed as a fusion protein
with a glutathion S transferase, and then only the part of the
human Gm1 protein is cut out from the fusion protein.
[0433] Thus, the human Gm1 cDNA fragment-containing plasmid pCR-Gm1
obtained in Example 1 is double-digested with EcoRV and SpeI, and
imparted with a blunt end with a Blunting Kit (Takara). The
resultant DNA is subjected to an agarose gel electrophoresis and
then purified using a QIAquick Gel Extraction Kit (QIAGEN) and then
recovered. The recovered DNA is used as an insert DNA. The
pGEX-5X-1 which had been cleaved with EcoRV and then BAP-treated is
employed as a vector, and 50 ng of this vector and 10 ng of the
insert
[0434] DNA are ligated using a T4 ligase, whereby producing an
expression plasmid pGEX-Gm1.
Example 5
Purification of Recombinant Human Gm1 Protein from E. Coli
Expressing Glutathion S Transferase--human Gm1 Fusion Protein
[0435] The glutathion S transferase--human Gm1 fusion
protein-expressing plasmid pGEX-Gm1 obtained in Example 4 is used
to transform an E. coli (Escherichia coli) JM109 strain by a
calcium method. The resultant transformant is cultured in a 50
.mu.g/ml ampicillin (Sigma)-supplemented LB medium at 37.degree.
C., and, once the O.D..sub.600 becomes about 0.6 reached, 1 mM
(final concentration) of isopropyl-.beta.-D-thiogalactopyranoside
(IPTG) is added to induce the protein expression, and incubated for
further 6 hours, prior to the recovery of the cells.
[0436] The cells are disrupted with ultrasonic treatment,
centrifuged at 10,000 g for 5 minutes to obtain a soluble fraction.
The resultant soluble fraction is applied onto an anti-glutathion S
transferase monoclonal antibody column (Amersham Bioscience) to
purify a glutathion S transferase--human Gm1 fusion protein. Then,
the purified glutathion S transferase--human Gm1 fusion protein is
treated with an active blood coagulation factor X (New England
Biolabo) to cut a human Gm1 protein out.
[0437] The human Gm1 protein thus cut out is subjected sequentially
to a cation exchange column (S-sepharose FF; Pharmacia),
hydrophobic column (Phenyl-superose; Pharmacia), hydroxyapatite
column (MITSUI TOATSU CHEMICALS), cation exchange column (MONOS;
Pharmacia) to purify the human Gm1 protein until it shows an almost
single band in an SDS-PAGE analysis with Coomassie brilliant blue
staining.
Example 6
Production of Human Gm1 Protein Partial Peptide and Production of
Anti-Human Gm1 Peptide Antibody Using this Peptide
[0438] An antibody specific to a human Gm1 protein was prepared by
the procedure shown below. A peptide consisting of 14 amino acids
of the amino acid Nos. 7 to 20 in the amino acid sequence
represented by SEQ ID NO:1 was synthesized.
[0439] This peptide was bound to a carrier protein KML and used as
an immunogen. The resultant KML fusion peptide ptGm1 was used to
immunize a New Zealand white rabbit to produce an anti-human Gm1
peptide serum. The immunization was repeated 5 times. From this
rabbit, an antiserum was collected, and the antiserum was purified
using a protein G column (Amersham Bioscience) to isolate an
antigen-specific anti-human Gm1 protein antibody.
Example 7
Construction of Expression Vector for Expression of Human Gm1
Protein in Animal Cell
[0440] An expression vector for transient expression of a human Gm1
protein in an animal cell is constructed. Thus, first, the human
Gm1 cDNA fragment-containing pCR-Gm1 obtained in Example 1 is
double-digested with restriction enzymes XbaI and KpnI, and the
resultant DNA fragment is introduced into a pcDNA3.1 at XbaI site
and KpnI site whereby obtaining an expression vector pcDNA-Gm1 for
a transient expression of human Gm1 protein in an animal cell.
Example 8
Construction of Expression Vectors for Expression of Human Dopamine
Receptor Proteins in Animal Cell
[0441] Expression vectors for transient expression in an animal
cell of a human dopamine D1 receptor protein and a human dopamine
D2 receptor protein respectively were constructed by the following
procedure.
[0442] In order to amplify a DNA encoding a human dopamine D1
receptor, 20 ng of a plasmid DNA from a human brain-derived cDNA
library (Takara) (pAP3neo) was employed as a template together with
10 .mu.M of a forward primer prDopaminD1-5'
(5'-agctcggatccATGAGGACTCTGAACACCTCTGCCA; (SEQ ID NO:17) and 10
.mu.M of a reverse primer prDopaminD1-3'
(5'-gtgcagaattcTCATCTGCGAGTTCAGGTTGGGT; SEQ ID NO:18) as well as a
TAKARA LA Taq polymerase (TAKARA LA Taq with GC Buffer, Takara) to
perform a PCR.
[0443] In order to amplify a DNA encoding a human dopamine D2
receptor, 20 ng of a plasmid DNA from a human brain-derived cDNA
library (Takara) (pAP3neo) was used as a template together with 10
.mu.M of a forward primer prDopaminD2-5'
(5'-agctcggatccATGGATCCACTGAATCTGTCCTGGTATGA; SEQ ID NO:19) and 10
.mu.M of a reverse primer prDopaminD2-3'
(5'-gtgcagaattcTCAGCAGTGAAGGATCTTCTGGAAGGCCTT; SEQ ID NO:20) as
well as a TAKARA LA Taq polymerase (TAKARA LA Taq with GC Buffer,
Takara) to perform a PCR.
[0444] The PCR condition involved 35 cycles, each cycle involving
incubations at 95.degree. C. for 30 seconds followed by 60.degree.
C. for 30 seconds followed by 72.degree. C. for 2 minutes. The
resultant DNA was subjected to an agarose gel electrophoresis
followed by a purification with a QIAquick Gel Extraction kit
(QIAGEN), and then recovered. This purified and recovered DNA was
used as an insert DNA.
[0445] Each insert DNA was double-digested with BamHI and EcoRI,
introduced into a pcDNA3.1(+) at BamHI and EcoRI sites, whereby
obtaining animal cell expression vectors pcDNA-D1R and
pcDNA-D2R.
Example 9
Construction of Baculovirus Vector Encoding Human Gm1 Protein
[0446] First, a transfer vector for overexpressing a human Gm1
protein in an insect cell was constructed. The human Gm1 cDNA
fragment-containing pCR-Gm1 obtained in Example 1 was
double-digested with restriction enzyme XbaI and SpeI, and the
resultant DNA fragment was introduced into a pAcMP2 (Pharmingen) at
XbaI site to obtain a transfer vector pAcMP-Gm1. Then 5 .mu.g of
this transfer vector and 1 .mu.g of a Baculovirus DNA, BaculoGold
DNA (Pharmingen) were cotransfected to 2.times.10.sup.6 cells of
Sf21, which were cultured at 27.degree. C. for 5 days, and then the
culture supernatant was recovered to obtain a virus solution.
Example 10
Construction of Baculovirus Vector Encoding Human G.beta.
Protein
[0447] A transfer vector for overexpressing a human G.beta. protein
in an insect cell was constructed by the procedure described
below.
[0448] In order to amplify a DNA encoding human G.beta. protein, 20
ng of a plasmid DNA from a human brain-derived cDNA library
(Takara) (pAP3neo) was employed as a template together with 10
.mu.M of a forward primer prGb1-5' (5'-ATGAGTGAGCTTGACCAGTTACGGCA;
SEQ ID NO:21), 10 .mu.M of a reverse primer prGb1-3'
(5'-TTAGTTCCAGATCTTGAGGAAGCTAT; SEQ ID NO:22) as well as a TAKARA
LA Taq polymerase (TAKARA LA Taq with GC Buffer, Takara) to perform
a PCR. The PCR condition involved 35 cycles, each cycle involving
incubations at 95.degree. C. for 30 seconds followed by 60.degree.
C. for 30 seconds followed by 72.degree. C. for 2 minutes. The
resultant DNA was subjected to an agarose gel electrophoresis
followed by a purification with a QIAquick Gel Extraction kit
(QIAGEN), and then recovered. This purified and recovered DNA was
used as an insert DNA. Then, a TOPO TA Cloning Kit (Invitorogen)
was used in accordance with its attached protocol to insert the
resultant insert DNA (50 ng) into a pCR2.1-TOPO vector (10 ng) at a
cloning site whereby obtaining a pCR-G.beta..
[0449] Then, the pCR-G.beta. was double-digested with restriction
enzyme BamHI and NotI, and the resultant DNA fragment was
introduced into a pAcMP3 (Pharmingen) at BamHI and NotI sites,
whereby obtaining a transfer vector animal cell expression vector
pAcMP-G.beta..
[0450] Then, 5 .mu.g of this transfer vector and 1 .mu.g of a
Baculovirus DNA, BaculoGold DNA (Pharmingen) were cotransfected to
2.times.10.sup.6 cells of Sf21 cell, which are cultured at 27.mu.
for 5 days, and then the culture supernatant was recovered to
obtain a virus solution.
Example 11
Construction of Baculovirus Vector Encoding Human G.gamma.
Protein
[0451] A transfer vector for overexpressing a human G.gamma.
protein in an animal cell was constructed by the procedure
described below.
[0452] In order to amplify a DNA encoding human G.gamma. protein,
20 ng of a plasmid DNA from a human brain-derived cDNA library
(Takara) (pAP3neo) was employed as a template together with 10
.mu.M of a forward primer prGg3-5' (5'-ATGAAAGGTGAGACCCCGGTGAACA;
SEQ ID NO:23), 10 .mu.M a reverse primer prGg3-3'
(5'-TCAGAGGAGAGCACAGAAGAACTT; SEQ ID NO:24) as well as a TAKARA LA
Tag polymerase (TAKARA LA Tag with GC Buffer, Takara) to perform a
PCR. The PCR condition involved 35 cycles, each cycle involving
incubations at 95.degree. C. for 30 seconds followed by 60.degree.
C. for 30 seconds followed by 72.degree. C. for 2 minutes. The
resultant DNA was subjected to an agarose gel electrophoresis
followed by a purification with a QIAquick Gel Extraction kit
(QIAGEN), and then recovered. This purified and recovered DNA was
used as an insert DNA. Then, a TOPO TA Cloning Kit (Invitorogen)
was used in accordance with its attached protocol to insert each
resultant insert DNA (50 ng) into a pCR2.1-TOPO vector (10 ng) at a
cloning site whereby obtaining a pCR-G.gamma..
[0453] Then, the pCR-G.gamma. was double-digested with restriction
enzyme XbaI and PstI, and the resultant DNA fragment was introduced
into a pAcMP3 (Pharmingen) at XbaI and PstI sites, whereby
obtaining a transfer vector pAcMP-G.gamma.. Then, 5 .mu.g of this
transfer vector and 1 .mu.g of a Baculovirus DNA, BaculoGold DNA
(Pharmingen) were cotransfected to 2.times.10.sup.6 cells of Sf21
cell, which are cultured at 27.degree. C. for 5 days, and then the
culture supernatant was recovered to obtain a virus solution.
Example 12
Construction of Baculovirus Vectors Encoding Human Dopamine D1
Receptor and Human Dopamine D2 Receptor
[0454] Transfer vectors for overexpressing a human dopamine D1
receptor protein and a human dopamine D2 receptor protein
respectively in an insect cell were constructed by the procedure
described below.
[0455] The human dopamine D1 receptor expression vector pcDNA-D1R
and the human dopamine D2 receptor expression vector pcDNA-D2R
obtained in Example 8 were each double-digested with BamHI and
EcoRI, and the resultant DNA fragments are each introduced into a
pAcMP3 at BamHI and EcoRI sites, whereby obtaining transfer vectors
pAcMP-D1R and pAcMP-D2R.
[0456] Then, each 5 .mu.g of the either transfer vectors and 1
.mu.g of a Baculovirus DNA, BaculoGold DNA (Pharmingen) were
cotransfected to 2.times.10.sup.6 cells of Sf21 cell, which are
cultured at 27.mu. for 5 days, and then the culture supernatants
were recovered to obtain virus solutions.
Example 13
High Expression of Human Gm1 Protein Using Baculovirus Vector and
Purification of the Protein
[0457] A virus solution containing human Gm1 protein expression
Baculovirus obtained in Example 9 was infected at MOI5 to
2.times.10.sup.7 cells of SF21 cell, which were cultured at
27.degree. C. Five days after the infection, the cells were
recovered and suspended in an HE/PI buffer (20 mM HEPSE, 2 mM EDTA
supplemented with 1.times. protenase inhibitor cocktail
(NACALAITESQUE). The cell suspension was passed through a 26G
needle 15 times to disrupt the cell membrane. The suspension was
then centrifuged at 4.degree. C. and 100.times.g for 5 minutes, and
the supernatant obtained was centrifuged at 4.degree. C. and
20,000.times.g for 30 minutes, whereby recovering a human Gm1
protein-containing cell membrane fraction.
Example 14
High Expression of Human G.beta. Protein and Human G.gamma. Protein
Using Baculovirus Vector and Purification of the Proteins
[0458] A virus solution containing human G.beta. protein expression
Baculovirus obtained in Example 10 and human G.gamma. protein
expression Baculovirus obtained in Example 11 was infected at MOI5
to 2.times.10.sup.7 cells of SF21 cell, which were cultured at
27.degree. C. Five days after the infection, the cells were
recovered and suspended in an HE/PI buffer (20 mM HEPSE, 2 mM EDTA
supplemented with 1.times. Protenase inhibitor cocktail
(NACALAITESQUE). The cell suspension was passed through a 26G
needle 15 times to disrupt the cell membrane. The cell suspension
was then centrifuged at 4.degree. C. and 110.times.g for 5 minutes,
and the supernatant obtained was centrifuged at 4.degree. C. and
20,000.times.g for 30 minutes, whereby recovering a cell membrane
fraction containing the human G.beta. protein and the human
G.gamma. protein.
Example 15
High Expression of Human Dopamine D1 Receptor Protein and Human
Dopamine D2 Receptor G.gamma. Protein Using Baculovirus Vector and
Purification of the Proteins
[0459] A virus solution containing either human dopamine D1
receptor protein expression Baculovirus or human dopamine D2
receptor protein expression Baculovirus obtained in Example 12 was
infected at MOIS to 2.times.10.sup.7 cells of SF21 cell, which were
cultured at 27.degree. C. Five days after the infection, the cells
were recovered and suspended in an HE/PI buffer (20 mM HEPSE, 2 mM
EDTA supplemented with 1.times. Protenase inhibitor cocktail
(NACALAITESQUE). The cell suspensions were passed through a 26G
needle 15 times to disrupt the cell membrane. This cell suspensions
were then centrifuged at 4.degree. C. and 110.times.g for 5
minutes, and the supernatants obtained were centrifuged at
4.degree. C. and 20,000.times.g for 30 minutes, whereby recovering
a cell membrane fraction containing the human dopamine D1 receptor
protein or the human dopamine D2 receptor protein.
Example 16
GTP Binding Assay Using Human Gm1 Protein Expressed by Baculovirus
Vector
[0460] The Gm1 protein-containing membrane fraction purified in
Example 13 is employed to conduct a GTP binding assay.
[0461] The cell membrane fraction containing 2 .mu.g of the Gm1
protein prepared in Example 13, the cell membrane fraction
containing 2 .mu.g of the G.beta. protein and the G.gamma. protein
prepared in Example 14 and the cell membrane fraction containing 2
.mu.g of the dopamine D1 receptor protein prepared in Example 15
are suspended in 55 .mu.l of a binding buffer (59 mM Tris, 4.8 mM
MgCl.sub.2, 2 mM EDTA, 100 mM NaCl, 1 .mu.M GDP). One .mu.M of
dopamine is added and the mixture is incubated at 30.degree. C. for
10 minutes. Thereafter, 200 pM of [35S]GTP.gamma.S is added and the
mixture is incubated at 30.degree. C. for 30 minutes.
[0462] Then 1.5 ml of a washing buffer (ice-cooled 50 mM Tris, 5 mM
MgCl.sub.2, 150 mM NaCl, 0.1% BSA, 0.05% CHAPS (pH7.4)) is added
and the mixture is filtered through a glass fiber filter paper
GF/F. Then this filter paper is washed three times with 1 ml of
Tris (pH7.4), incubated at 65.degree. C. for 30 minutes, subjected
to a liquid scintillation counter to measure the radioactivity of
the [35S]GTP.gamma.S which is bound to the membrane fraction
depositing on the filter paper.
Example 17
Screening for Dopamine D1 Receptor Antagonist Using Change in cAMP
Level as Index
[0463] 2.times.10.sup.5 Cells of CHO cell were transfected with 1
.mu.g of the dopamine D1 receptor expression vector obtained in
Example 8 and the Gm1 expression vector obtained in Example 7
(pcDNA-Gm1; 3 .mu.g) by a lipofection method to prepare a test
cell.
[0464] Then, the cells were inoculated to each well of a 96-well
plate at 3.times.10.sup.4 cells/well, and cultured for about 24
hours. Then, the culture medium was, removed, and 80 .mu.l of 1 mM
IBMX-supplemented OPTI-MEN (Invitrogen) was added to the cells,
which were then incubated at 37.degree. C. for 10 minutes.
[0465] Then, 10 .mu.M of dopamine as a GPCR ligand and 10 .mu.M of
each test substance (butaclamol, chlorpromazine, fluphenazine,
haloperidol, SCH-23390) were added and incubated at 37.degree. C.
for 30 minutes.
[0466] Then, the reaction buffer was removed, and the cAMP level
was determined using a HitHunter ECF cyclic AMP chemiluminescent
assay kit (Applied Biosystems). As controls, a test cell which had
been brought into contact only with the GPCR ligand at the same
concentration and a test cell which had been brought into contact
with nothing were examined for their cAMP levels in the similar
manner.
[0467] A substance which gave a cAMP level percentage of 85% or
less upon contact with the ligand and the test substance was
selected as a signal transduction inhibitor (antagonist), on the
basis of the cAMP level with no contact being 0% and the cAMP level
with the contact only with the ligand being 100% (FIG. 2).
Example 18
Screening of Dopamine D1 Receptor Using Change in cAMP Level as
Index
[0468] 2.times.10.sup.5 Cells of CHO cell were transfected with the
dopamine D1 receptor expression vector (1 .mu.g) obtained in
Example 8 and the Gm1 expression vector obtained in Example 7
(pcDNA-Gm1; 3 .mu.g) by a lipofection method to prepare a test
cell.
[0469] Then, the cells were inoculated to each well of a 96-well
plate at 3.times.10.sup.4 cells/well, and cultured for about 24
hours. Then, the culture medium was removed, and 80 .mu.l of 1 mM
IBMX-supplemented OPTI-MEN (Invitrogen) was added to the cells,
which were then incubated at 37.degree. C. for 10 minutes.
[0470] Then, 10 .mu.M of dopamine as a GPCR ligand or 10 .mu.M of a
test substance (apomorphine, CY208-248, SKF-38393, SKF-81297) was
added and incubated at 37.degree. C. for 30 minutes.
[0471] Then, the reaction buffer was removed, and the cAMP level
was determined using a HitHunter ECF cyclic AMP chemiluminescent
assay kit (Applied Biosystems). As a control, a test cell which had
been brought into contact with nothing were examined for their cAMP
levels in the similar manner.
[0472] A substance which gave a cAMP level percentage of 125% or
more upon contact of the test cell with the test substance was
selected as a signal transduction activator (agonist), on the basis
of the cAMP level when the test cell has not been brought into
contact with anything being 100% (FIG. 3).
Example 19
Screening Using Change in cAMP Level as Index
[0473] 1.times.10.sup.6 Cells of CHO cell are transfected with the
dopamine D1 receptor expression vector obtained in Example 8 (100
ng), CRE- reporter plasmid (pCRE-luc; 20 ng; Stratagene) and the
Gm1 expression vector obtained in Example 7 (pcDNA-Gm1; 30 ng) by a
lipofection method to prepare a test cell.
[0474] Then the cells are inoculated to each well of a 24-well
plate at 5.times.10.sup.3 cells/well, and then cultured for about
48 hours. Then, the cells are washed with 0.2 mM buffer
(3-isobutyl-methylxanthine, 0.05% BSA, 20 mM HEPES-supplemented
Hunk's buffer (pH7.4); hereinafter referred to as "reaction
buffer"). Then the reaction buffer is added to the cells, which are
incubated at 37.degree. C. for 30 minutes.
[0475] Then, the reaction buffer is removed, and 0.25 ml of a fresh
reaction buffer is added to the cells, and then 1 nM dopamine as a
GPCR ligand and 0.1 nM to 10 nM test substance are added and the
mixture is incubated at 37.degree. C. for 30 minutes. Then the
cells are dissolved in a cell lysis solution (PICK-A-GENE
luciferase kit, TOYO INK), and combined with a luminescent
substrate (PICK-A-GENE luciferase kit, TOYO INK), and examined for
the fluorescent intensity using a luminometer. As controls, a test
cell which had been brought into contact only with the GPCR ligand
at the same concentration and a test cell which had been brought
into contact with nothing are examined for their fluorescent
intensities in the similar manner.
[0476] A substance which gave a fluorescence intensity of
percentage of 50% or less, or 150% or more upon contact with the
ligand and the test substance is selected as a signal transduction
regulating substance, on the basis of the fluorescent intensity
with no contact being 0% and the fluorescent intensity with the
contact only with the ligand being 100%.
Example 20
Construction of Expression Vector for Expression of Human Adenosine
A2a Receptor Protein in Animal Cell
[0477] An expression vector for transient expression of a human
adenosine A2a receptor protein in an animal cell was constructed by
the procedure described below.
[0478] In order to amplify a DNA encoding a human adenosine A2a
receptor, 20 ng of a plasmid DNA from a human brain-derived cDNA
library (Takara) (pAP3neo) was employed as a template together with
10 .mu.M of a forward primer
prAdenosineA2A-5'(5'-agctcggatccATGCCCATCATGGGCTCCTCGGTGTA; SEQ ID
NO:33) and 10 .mu.M of a reverse primer
prAdenosineA2A-3'(5'-gtgcagaattcTCAGGACACTCCTGCTCCATCCT; SEQ ID
NO:34) as well as a TAKARA LA Taq polymerase (TAKARA LA Taq with GC
Buffer, Takara) to perform a PCR.
[0479] The PCR condition involved 35 cycles, each cycle involving
incubations at 95.degree. C. for 30 seconds followed by 60.degree.
C. for 30 seconds followed by 72.degree. C. for 2 minutes. The
resultant DNA was subjected to an agarose gel electrophoresis
followed by a purification with a QIAquick Gel Extraction kit
(QIAGEN), and then recovered. This purified and recovered DNA was
used as an insert DNA.
[0480] Each insert DNA was double-digested with BamHI and EcoRI,
introduced into a pcDNA3.1(+) at BamHI and EcoRI sites, whereby
obtaining an animal cell expression vector pcDNA-A2a.
Example 21
Screening of Adenosine A2a Receptor Antagonist Using Change in cAMP
Level as Index
[0481] 2.times.10.sup.5 Cells of CHO cell were transfected with the
adenosine A2a receptor expression vector (1 .mu.g) obtained in
Example 20 and the Gm1 expression vector obtained in Example 7
(pcDNA-Gm1; 3 .mu.g) by a lipofection method to prepare a test
cell.
[0482] Then, the cells were inoculated to each well of a 96-well
plate at 3.times.10.sup.4 cells/well, and cultured for about 24
hours. Then, the culture medium was removed, and 80 .mu.l of 1 mM
IBMX-supplemented OPTI-MEN (Invitrogen) was added to the cells,
which were then incubated at 37.degree. C. for 10 minutes.
[0483] Then, 10 .mu.M of adenosine as a GPCR ligand and 10 .mu.M of
a test substance (DMPX) were added and incubated at 37.degree. C.
for 30 minutes.
[0484] Then, the reaction buffer was removed, and the cAMP level
was determined using a HitHunter ECF cyclic AMP chemiluminescent
assay kit (Applied Biosystems). As controls, a test cell which had
been brought into contact only with the GPCR ligand at the same
concentration and a test cell which had been brought into contact
with nothing were examined for their cAMP levels in the similar
manner.
[0485] A substance which gave a cAMP level percentage of 85% or
less upon contact of the cell with the ligand and the test
substance was selected as a signal transduction inhibitor
(antagonist), on the basis of the cAMP level with no contact being
0% and the cAMP level with the contact of the cell only with the
ligand being 100% (FIG. 4).
Example 22
Screening of Adenosine A2a Receptor Agonist Using Change in cAMP
Level as Index
[0486] 2.times.10.sup.5 Cells of CHO cell were transfected with the
adenosine A2a receptor expression vector (1 .mu.g) obtained in
Example 20 and the Gm1 expression vector obtained in Example 7
(pcDNA-Gm1; 3 .mu.g) by a lipofection method to prepare a test
cell.
[0487] Then, the cells were inoculated to each well of a 96-well
plate at 3.times.10.sup.4 cells/well, and cultured for about 24
hours. Then, the culture medium was removed, and 80 .mu.l of 1 mM
IBMX-supplemented OPTI-MEN (Invitrogen) was added to the cells,
which were then incubated at 37.degree. C. for 10 minutes.
[0488] Then, 10 .mu.M of adenosine as a GPCR ligand or 10 .mu.M of
a test substance (CGS-21680) was added and incubated at 37.degree.
C. for 30 minutes.
[0489] Then, the reaction buffer was removed, and the cAMP level
was determined using a HitHunter ECF cyclic AMP chemiluminescent
assay kit (Applied Biosystems). As a control, a test cell which had
been brought into contact with nothing were examined for their cAMP
levels in the similar manner.
[0490] A substance which gave a cAMP level percentage of 125% or
more upon contact with the test substance was selected as a signal
transduction activator (agonist), on the basis of the cAMP level
when the test cell has not been brought into contact with anything
being 100% (FIG. 5).
Example 23
Screening by GTP Binding Assay
[0491] The cell membrane fraction containing 2 .mu.g of the Gm1
protein prepared in Example 13, the cell membrane fraction
containing 2 .mu.g of the G.beta. protein and G.gamma. protein
prepared in Example 14 and the cell membrane fraction containing 2
.mu.g of the dopamine D1 receptor protein prepared in Example 15
are suspended in 55 .mu.l of a binding buffer (59 mM Tris, 4.8 mM
MgCl.sub.2, 2 mM EDTA, 100 mM NaCl, 1 .mu.M GDP). 1 .mu.M of
dopamine and 0.1 nM-10 nM of a test substance (for example, 1 nM
SCH-23390) are added and the mixture is incubated at 30.degree. C.
for 10 minutes. Thereafter, 200 pM of [35S]GTP.gamma.S is added and
the mixture is incubated at 30.degree. C. for 30 minutes.
[0492] Then 1.5 ml of a washing buffer (ice-cooled 50 mM Tris, 5 mM
MgCl.sub.2, 150 mM NaCl, 0.1% BSA, 0.05% CHAPS (pH7.4)) is added
and the mixture is filtered through a glass fiber filter paper
GF/F. Then this filter paper is washed three times with 1 ml of
Tris (pH7.4), incubated at 65.degree. C. for 30 minutes, subjected
to a liquid scintillation counter to measure the radioactivity of
the [35S]GTP.gamma.S which is bound to the membrane fraction
depositing on the filter paper.
[0493] A substance whose radioactivity percentage is calculated to
be 50% or less, or 150% or more upon contact with the both of the
ligand and the test substance is selected as a substance capable of
regulating the signal transduction, on the basis of the
radioactivity with the addition only of the ligand being 100% and
the radioactivity without the addition of the ligand or the test
substance being 0%.
Example 24
Assay of Activation of Signal Transduction Pathway Mediated by Gm1
Using Change in cAMP Level as Index
[0494] 2.times.10.sup.5 Cells of CHO cell were transfected with the
dopamine D1 receptor expression vector (1 .mu.g) obtained in
Example 8 and the Gm1 expression vector obtained in Example 7
(pcDNA-Gm1; 3 .mu.g) by a lipofection method to prepare a test
cell.
[0495] Then, the cells were inoculated to each well of a 96-well
plate at 3.times.10.sup.4 cells/well, and cultured for about 24
hours. Then, the culture medium was removed, and 80 .mu.l of 1 mM
IBMX-supplemented OPTI-MEN (Invitrogen) was added to the cells,
which were then incubated at 37.degree. C. for 10 minutes.
[0496] Then, 10 .mu.M of dopamine as a GPCR ligand was added and
incubated at 37.degree. C. for 30 minutes.
[0497] Then, the reaction buffer was removed, and the cAMP level
was determined using a HitHunter ECF cyclic AMP chemiluminescent
assay kit (Applied Biosystems). As a control, a test cell which had
been brought into contact with nothing were examined for their cAMP
levels in the similar manner.
[0498] The cAMP level of the test cell expressing the Gm1 and the
dopamine D1 receptor was determined on the basis of the cAMP level
upon no contact being regarded to be 0% while the cAMP level of the
control cell expressing only the dopamine D1 receptor being
regarded to be 100%, and was revealed to be 127%. Therefore, it was
proven that the Gm1-mediated signal transduction system do exist
(FIG. 6).
Example 25
Assay of Activation of Signal Transduction Pathway Mediated by Gm1
Using Change in cAMP Level as Index
[0499] 2.times.10.sup.5 Cells of CHO cell were transfected with the
adenosine A2a receptor expression vector (1 .mu.g) obtained in
Example 8 and the Gm1 expression vector obtained in Example 7
(pcDNA-Gm1; 3 .mu.g) by a lipofection method to prepare a test
cell.
[0500] Then, the cells were inoculated to each well of a 96-well
plate at 3.times.10.sup.4 cells/well, and cultured for about 24
hours. Then, the culture medium was removed, and 80 .mu.l of 1 mM
IBMX-supplemented OPTI-MEN (Invitrogen) was added to the cells,
which were then incubated at 37.degree. C. for 10 minutes.
[0501] Then, 10 .mu.M of adenosine as a GPCR ligand was added and
incubated at 37.degree. C. for 30 minutes.
[0502] Then, the reaction buffer was removed, and the cAMP level
was determined using a HitHunter ECF cyclic AMP chemiluminescent
assay kit (Applied Biosystems). As a control, a test cell which had
been brought into contact with nothing were examined for their cAMP
levels in the similar manner.
[0503] The cAMP level when allowing the Gm1 and the adenosine A2a
receptor to be expressed was determined on the basis of the cAMP
level upon no contact being regarded to be 0% while the cAMP level
of the cell allowed to express only the adenosine A2a receptor
being regarded to be 100%, and was revealed to be 134%. Therefore,
it was proven that the Gm1-mediated signal transduction system do
exist (FIG. 7).
Example 26
Cloning of Mouse Gm1 Protein-Encoding cDNA
[0504] A pDr-mGm1 which is a plasmid having a DNA encoding the
full-length mouse Gm1 was produced as described below.
[0505] 20 ng of a mouse brain-derived cDNA library (Clontech) was
employed as a template together with 10 .mu.M of a forward primer
(5'-ATGGGCCTATGCTACAGCCTGCGGCCGCT; SEQ ID NO:29) and 10 .mu.M of a
reverse primer prmGm1STOP (5'-TCACAAGAGTTCGTACTGCTTGAGATGCATTCT;
SEQ ID NO:30) as well as a TAKARA LA Taq polymerase (TAKARA LA Taq
with GC Buffer, Takara) to conduct a PCR to obtain an amplified
DNA.
[0506] The PCR condition involved 35 cycles, each cycle involving
incubations at 95.degree. C. for 30 seconds followed by 60.degree.
C. for 30 seconds followed by 72.degree. C. for 2 minutes. The
resultant DNA was subjected to an agarose gel electrophoresis
followed by a purification with a QIAquick Gel Extraction kit
(QIAGEN), and then recovered. This purified and recovered DNA was
used as an insert DNA.
[0507] Then, a QIAGEN PCR Cloning kit (QIAGEN) was used following
to its attached protocol to insert the insert DNA (50 ng) into a
cloning site of a pDrive vector (25 ng), whereby producing a
pDr-mGm1.
[0508] The DNA thus obtained was subjected to an ABI377DNA
sequencer to determine the nucleotide sequence, which was revealed
to contain the nucleotide Nos. 1 to 1347 in the nucleotide sequence
represented by SEQ ID NO:27 and to encode the full-length amino
acid sequence represented by SEQ ID NO:25.
Example 27
Cloning of Rat Gm1 Protein-Encoding cDNA
[0509] A pDr-rGm1 which is a plasmid having a DNA encoding the
full-length rat Gm1 was produced as described below.
[0510] 20 ng of a rat brain-derived cDNA library (Clontech) was
employed as a template together with 10 .mu.M of a forward primer
prrGm1ATG (5'-ATGGGCCTGTGCTACAGCCTACGGCCGCTG; SEQ ID NO:31) and 10
.mu.M of a reverse primer prrGm1'STOP
(5'-TCACAAGAGTTCGTACTGCTTGAGGTGCATTCT; SEQ ID NO:32) as well as a
TAKARA LA Taq polymerase (TAKARA LA Taq with GC Buffer, Takara) to
conduct a PCR to obtain an amplified DNA.
[0511] The PCR condition involved 35 cycles, each cycle involving
incubations at 95.degree. C. for 30 seconds followed by 60.degree.
C. for 30 seconds followed by 72.degree. C. for 2 minutes. The
resultant DNA was subjected to an agarose gel electrophoresis
followed by a purification with a QIAquick Gel Extraction kit
(QIAGEN), and then recovered. This purified and recovered DNA was
used as an insert DNA.
[0512] Then, a QIAGEN PCR Cloning kit (QIAGEN) was used following
to its attached protocol to insert the insert DNA (50 ng) into a
cloning site of a pDrive vector (25 ng), whereby producing a
pDr-rGm1.
[0513] The DNA thus obtained was subjected to an ABI377DNA
sequencer to determine the nucleotide sequence, which was revealed
to contain the nucleotide Nos. 1 to 1353 in the nucleotide sequence
represented by SEQ ID NO:28 and to encode the full-length amino
acid sequence represented by SEQ ID NO:26.
Free Text in Sequence Listing
[0514] SEQ ID NO:3
[0515] an example of the ribozyme of the present invention [0516]
SEQ ID NO:4
[0517] an example of the ribozyme of the present invention [0518]
SEQ ID NO:5
[0519] an example of the ribozyme of the present invention [0520]
SEQ ID NO:6
[0521] an example of the ribozyme of the present invention [0522]
SEQ ID NO:7
[0523] an example of the ribozyme of the present invention [0524]
SEQ ID NO:8
[0525] an example of the ribozyme of the present invention [0526]
SEQ ID NO:9
[0527] an example of the oligonucleotide of the present invention
[0528] SEQ ID NO:10
[0529] an example of the oligonucleotide of the present invention
[0530] SEQ ID NO:11
[0531] a primer used in an example of the present invention [0532]
SEQ ID NO:12
[0533] a primer used in an example of the present invention [0534]
SEQ ID NO:13
[0535] a primer used in an example of the present invention [0536]
SEQ ID NO:14
[0537] a primer used in an example of the present invention [0538]
SEQ ID NO:15
[0539] a primer used in an example of the present invention [0540]
SEQ ID NO:16
[0541] a primer used in an example of the present invention [0542]
SEQ ID NO:17
[0543] a primer used in an example of the present invention [0544]
SEQ ID NO:18
[0545] a primer used in an example of the present invention [0546]
SEQ ID NO:19
[0547] a primer used in an example of the present invention [0548]
SEQ ID NO:20
[0549] a primer used in an example of the present invention [0550]
SEQ ID NO:21
[0551] a primer used in an example of the present invention [0552]
SEQ ID NO:22
[0553] a primer used in an example of the present invention [0554]
SEQ ID NO:23
[0555] a primer used in an example of the present invention [0556]
SEQ ID NO:24
[0557] a primer used in an example of the present invention [0558]
SEQ ID NO:29
[0559] a primer used in an example of the present invention [0560]
SEQ ID NO:30
[0561] a primer used in an example of the present invention [0562]
SEQ ID NO:31
[0563] a primer used in an example of the present invention [0564]
SEQ ID NO:32
[0565] a primer used in an example of the present invention [0566]
SEQ ID NO:33
[0567] a primer used in an example of the present invention [0568]
SEQ ID NO:34
[0569] a primer used in an example of the present invention
Sequence CWU 1
1
341458PRTHomo sapiens 1Met Gly Leu Cys Tyr Ser Leu Arg Pro Leu Leu
Phe Gly Gly Pro Gly1 5 10 15Asp Asp Pro Cys Ala Ala Ser Glu Pro Pro
Val Glu Asp Ala Gln Pro 20 25 30Ala Pro Ala Pro Ala Leu Ala Pro Val
Arg Ala Ala Ala Arg Asp Thr 35 40 45Ala Arg Thr Leu Leu Pro Arg Gly
Gly Glu Gly Ser Pro Ala Cys Ala 50 55 60Arg Pro Lys Ala Asp Lys Pro
Lys Glu Lys Arg Gln Arg Thr Glu Gln65 70 75 80Leu Ser Ala Glu Glu
Arg Glu Ala Ala Lys Glu Arg Glu Ala Val Lys 85 90 95Glu Ala Arg Lys
Val Ser Arg Gly Ile Asp Arg Met Leu Arg Asp Gln 100 105 110Lys Arg
Asp Leu Gln Gln Thr His Arg Leu Leu Leu Leu Gly Ala Gly 115 120
125Glu Ser Gly Lys Ser Thr Ile Val Lys Gln Met Arg Ile Leu His Val
130 135 140Asn Gly Phe Asn Pro Glu Glu Lys Lys Gln Lys Ile Leu Asp
Ile Arg145 150 155 160Lys Asn Val Lys Asp Ala Ile Val Thr Ile Val
Ser Ala Met Ser Thr 165 170 175Ile Ile Pro Pro Val Pro Leu Ala Asn
Pro Glu Asn Gln Phe Arg Ser 180 185 190Asp Tyr Ile Lys Ser Ile Ala
Pro Ile Thr Asp Phe Glu Tyr Ser Gln 195 200 205Glu Phe Phe Asp His
Val Lys Lys Leu Trp Asp Asp Glu Gly Val Lys 210 215 220Ala Cys Phe
Glu Arg Ser Asn Glu Tyr Gln Leu Ile Asp Cys Ala Gln225 230 235
240Tyr Phe Leu Glu Arg Ile Asp Ser Val Ser Leu Val Asp Tyr Thr Pro
245 250 255Thr Asp Gln Asp Leu Leu Arg Cys Arg Val Leu Thr Ser Gly
Ile Phe 260 265 270Glu Thr Arg Phe Gln Val Asp Lys Val Asn Phe His
Met Phe Asp Val 275 280 285Gly Gly Gln Arg Asp Glu Arg Arg Lys Trp
Ile Gln Cys Phe Asn Asp 290 295 300Val Thr Ala Ile Ile Tyr Val Ala
Ala Cys Ser Ser Tyr Asn Met Val305 310 315 320Ile Arg Glu Asp Asn
Asn Thr Asn Arg Leu Arg Glu Ser Leu Asp Leu 325 330 335Phe Glu Ser
Ile Trp Asn Asn Arg Trp Leu Arg Thr Ile Ser Ile Ile 340 345 350Leu
Phe Leu Asn Lys Gln Asp Met Leu Ala Glu Lys Val Leu Ala Gly 355 360
365Lys Ser Lys Ile Glu Asp Tyr Phe Pro Glu Tyr Ala Asn Tyr Thr Val
370 375 380Pro Glu Asp Ala Thr Pro Asp Ala Gly Glu Asp Pro Lys Val
Thr Arg385 390 395 400Ala Lys Phe Phe Ile Arg Asp Leu Phe Leu Arg
Ile Ser Thr Ala Thr 405 410 415Gly Asp Gly Lys His Tyr Cys Tyr Pro
His Phe Thr Cys Ala Val Asp 420 425 430Thr Glu Asn Ile Arg Arg Val
Phe Asn Asp Cys Arg Asp Ile Ile Gln 435 440 445Arg Met His Leu Lys
Gln Tyr Glu Leu Leu 450 45521377DNAHomo sapiensCDS(1)..(1377) 2atg
ggt ctg tgc tac agt ctg cgg ccg ctg ctt ttc ggg ggc cca ggg 48Met
Gly Leu Cys Tyr Ser Leu Arg Pro Leu Leu Phe Gly Gly Pro Gly1 5 10
15gac gac ccc tgc gcg gcc tcg gag ccg ccg gtg gag gac gcg cag ccc
96Asp Asp Pro Cys Ala Ala Ser Glu Pro Pro Val Glu Asp Ala Gln Pro
20 25 30gcc ccg gcc ccg gcc ctg gcc cca gtc cgg gcg gcc gca agg gac
acg 144Ala Pro Ala Pro Ala Leu Ala Pro Val Arg Ala Ala Ala Arg Asp
Thr 35 40 45gcc cgg acc ctg ctc cct cgg ggc ggc gaa ggg agc ccg gca
tgc gct 192Ala Arg Thr Leu Leu Pro Arg Gly Gly Glu Gly Ser Pro Ala
Cys Ala 50 55 60cgg ccc aaa gca gac aag ccg aag gag aag cgg cag cgc
acc gag cag 240Arg Pro Lys Ala Asp Lys Pro Lys Glu Lys Arg Gln Arg
Thr Glu Gln65 70 75 80ctg agt gcc gag gag cgc gag gcg gcc aag gag
cgc gag gcg gtc aag 288Leu Ser Ala Glu Glu Arg Glu Ala Ala Lys Glu
Arg Glu Ala Val Lys 85 90 95gag gcg agg aaa gtg agc cgg ggc atc gac
cgc atg ctg cgc gac cag 336Glu Ala Arg Lys Val Ser Arg Gly Ile Asp
Arg Met Leu Arg Asp Gln 100 105 110aag cgc gac ctg cag cag acg cac
cgg ctc ctg ctg ctc ggg gct ggt 384Lys Arg Asp Leu Gln Gln Thr His
Arg Leu Leu Leu Leu Gly Ala Gly 115 120 125gag tct ggg aaa agc acc
atc gtc aaa cag atg agg atc ctg cac gtc 432Glu Ser Gly Lys Ser Thr
Ile Val Lys Gln Met Arg Ile Leu His Val 130 135 140aat ggg ttt aat
ccc gag gaa aag aaa cag aaa att ctg gac atc cgg 480Asn Gly Phe Asn
Pro Glu Glu Lys Lys Gln Lys Ile Leu Asp Ile Arg145 150 155 160aaa
aat gtt aaa gat gct atc gtg aca att gtt tca gca atg agt act 528Lys
Asn Val Lys Asp Ala Ile Val Thr Ile Val Ser Ala Met Ser Thr 165 170
175ata ata cct cca gtt ccg ctg gcc aac cct gaa aac caa ttt cga tca
576Ile Ile Pro Pro Val Pro Leu Ala Asn Pro Glu Asn Gln Phe Arg Ser
180 185 190gac tac atc aag agc ata gcc cct atc act gac ttt gaa tat
tcc cag 624Asp Tyr Ile Lys Ser Ile Ala Pro Ile Thr Asp Phe Glu Tyr
Ser Gln 195 200 205gaa ttc ttt gac cat gtg aaa aaa ctt tgg gac gat
gaa ggc gtg aag 672Glu Phe Phe Asp His Val Lys Lys Leu Trp Asp Asp
Glu Gly Val Lys 210 215 220gca tgc ttt gag aga tcc aac gaa tac cag
ctg att gac tgt gca caa 720Ala Cys Phe Glu Arg Ser Asn Glu Tyr Gln
Leu Ile Asp Cys Ala Gln225 230 235 240tac ttc ctg gaa aga atc gac
agc gtc agc ttg gtt gac tac aca ccc 768Tyr Phe Leu Glu Arg Ile Asp
Ser Val Ser Leu Val Asp Tyr Thr Pro 245 250 255aca gac cag gac ctc
ctc aga tgc aga gtt ctg aca tct ggg att ttt 816Thr Asp Gln Asp Leu
Leu Arg Cys Arg Val Leu Thr Ser Gly Ile Phe 260 265 270gag aca cga
ttc caa gtg gac aaa gta aac ttc cac atg ttt gat gtt 864Glu Thr Arg
Phe Gln Val Asp Lys Val Asn Phe His Met Phe Asp Val 275 280 285ggt
ggc cag agg gat gag agg aga aaa tgg atc cag tgc ttt aac gat 912Gly
Gly Gln Arg Asp Glu Arg Arg Lys Trp Ile Gln Cys Phe Asn Asp 290 295
300gtc aca gct atc att tac gtc gca gcc tgc agt agc tac aac atg gtg
960Val Thr Ala Ile Ile Tyr Val Ala Ala Cys Ser Ser Tyr Asn Met
Val305 310 315 320att cga gaa gat aac aac acc aac agg ctg aga gag
tcc ctg gat ctt 1008Ile Arg Glu Asp Asn Asn Thr Asn Arg Leu Arg Glu
Ser Leu Asp Leu 325 330 335ttt gaa agc atc tgg aac aac agg tgg tta
cgg acc att tct atc atc 1056Phe Glu Ser Ile Trp Asn Asn Arg Trp Leu
Arg Thr Ile Ser Ile Ile 340 345 350ttg ttc ttg aac aaa caa gat atg
ctg gca gaa aaa gtc ttg gca ggg 1104Leu Phe Leu Asn Lys Gln Asp Met
Leu Ala Glu Lys Val Leu Ala Gly 355 360 365aaa tca aaa att gaa gac
tat ttc cca gaa tat gca aat tat act gtt 1152Lys Ser Lys Ile Glu Asp
Tyr Phe Pro Glu Tyr Ala Asn Tyr Thr Val 370 375 380cct gaa gac gca
aca cca gat gca gga gaa gat ccc aaa gtt aca aga 1200Pro Glu Asp Ala
Thr Pro Asp Ala Gly Glu Asp Pro Lys Val Thr Arg385 390 395 400gcc
aag ttc ttt atc cgg gac ctg ttt ttg agg atc agc acg gcc acc 1248Ala
Lys Phe Phe Ile Arg Asp Leu Phe Leu Arg Ile Ser Thr Ala Thr 405 410
415ggt gac ggc aaa cat tac tgc tac ccg cac ttc acc tgc gcc gtg gac
1296Gly Asp Gly Lys His Tyr Cys Tyr Pro His Phe Thr Cys Ala Val Asp
420 425 430aca gag aac atc cgc agg gtg ttc aac gac tgc cgc gac atc
atc cag 1344Thr Glu Asn Ile Arg Arg Val Phe Asn Asp Cys Arg Asp Ile
Ile Gln 435 440 445cgg atg cac ctc aag cag tat gag ctc ttg tga
1377Arg Met His Leu Lys Gln Tyr Glu Leu Leu 450 455344RNAartificial
sequencean example of the ribozyme of the present invention
3ucgccuccuu cugaugaggc cgaaaggccg aaaccgccuc gcgc
44444RNAartificial sequencean example of the ribozyme of the
present invention 4cggccgcccg cugaugaggc cgaaaggccg aaacuggggc cagc
44543RNAartificial sequencean example of the ribozyme of the
present invention 5cagcggccgc cugaugaggc cgaaaggccg aaacuguagc aca
43654RNAartificial sequencean example of the ribozyme of the
present invention 6ucgccuccuu agaagccuac cagagaaaca cacguugugg
uauauuaccu ggua 54754RNAartificial sequencean example of the
ribozyme of the present invention 7cggccgcccg agaaggggac cagagaaaca
cacguugugg uauauuaccu ggua 54855RNAartificial sequencean example of
the ribozyme of the present invention 8cagcggccgc aagaaguaga
ccagagaaac acacguugug guauauuacc uggua 55924DNAartificial
sequencean example of the oligonucleotide of the present invention
9atgggtctgt gctacagtct gcgg 241037DNAartificial sequencean example
of the oligonucleotide of the present invention 10acgatggtgc
ttttcccaga ctcaccagcc ccgagca 371124DNAartificial sequencea primer
used in an example of the present invention 11atgggtctgt gctacagtct
gcgg 241221DNAartificial sequencea primer used in an example of the
present invention 12tcacaagagc tcatactgct t 211322DNAartificial
sequencea primer used in an example of the present invention
13atggggtgtt tgggcggcaa ca 221437DNAartificial sequencea primer
used in an example of the present invention 14acgatggtgc ttttcccaga
ctcaccagcc ccgagca 371529DNAartificial sequencea primer used in an
example of the present invention 15atgggcctat gctacagcct gcggccgct
291636DNAartificial sequencea primer used in an example of the
present invention 16gctgcaggtc ccgcttctgc tcgcgcagca tgcggt
361736DNAartificial sequencea primer used in an example of the
present invention 17agctcggatc catgaggact ctgaacacct ctgcca
361834DNAartificial sequencea primer used in an example of the
present invention 18gtgcagaatt ctcatctgcg agttcaggtt gggt
341940DNAartificial sequencea primer used in an example of the
present invention 19agctcggatc catggatcca ctgaatctgt cctggtatga
402041DNAartificial sequencea primer used in an example of the
present invention 20gtgcagaatt ctcagcagtg aaggatcttc tggaaggcct t
412126DNAartificial sequencea primer used in an example of the
present invention 21atgagtgagc ttgaccagtt acggca
262226DNAartificial sequencea primer used in an example of the
present invention 22ttagttccag atcttgagga agctat
262325DNAartificial sequencea primer used in an example of the
present invention 23atgaaaggtg agaccccggt gaaca 252424DNAartificial
sequencea primer used in an example of the present invention
24tcagaggaga gcacagaaga actt 2425448PRTMus musculus 25Met Gly Leu
Cys Tyr Ser Leu Arg Pro Leu Leu Phe Gly Ser Pro Glu1 5 10 15Asp Thr
Pro Cys Ala Ala Ser Glu Pro Cys Ala Glu Asp Ala Gln Pro 20 25 30Ser
Ala Ala Pro Ala Pro Ala Ser Ile Pro Ala Pro Ala Pro Val Gly 35 40
45Thr Leu Leu Arg Arg Gly Gly Gly Arg Ile Val Ala Asn Ala Arg Pro
50 55 60Pro Gly Glu Leu Gln Ser Arg Arg Arg Gln Glu Gln Leu Arg Ala
Glu65 70 75 80Glu Arg Glu Ala Ala Lys Glu Ala Arg Lys Val Ser Arg
Gly Ile Asp 85 90 95Arg Met Leu Arg Glu Gln Lys Arg Asp Leu Gln Gln
Thr His Arg Leu 100 105 110Leu Leu Leu Gly Ala Gly Glu Ser Gly Lys
Ser Thr Ile Val Lys Gln 115 120 125Met Arg Ile Leu His Val Asn Gly
Phe Asn Pro Glu Glu Lys Lys Gln 130 135 140Lys Ile Leu Asp Ile Arg
Lys Asn Val Lys Asp Ala Ile Val Thr Ile145 150 155 160Val Ser Ala
Met Ser Thr Ile Ile Pro Pro Val Pro Leu Ala Asn Pro 165 170 175Glu
Asn Gln Phe Arg Ser Asp Tyr Ile Lys Ser Ile Ala Pro Ile Thr 180 185
190Asp Phe Glu Tyr Ser Gln Glu Phe Phe Asp His Val Lys Lys Leu Trp
195 200 205Asp Asp Glu Gly Val Lys Ala Cys Phe Glu Arg Ser Asn Glu
Tyr Gln 210 215 220Leu Ile Asp Cys Ala Gln Tyr Phe Leu Glu Arg Ile
Asp Ser Val Ser225 230 235 240Leu Val Asp Tyr Thr Pro Thr Asp Gln
Asp Leu Leu Arg Cys Arg Val 245 250 255Leu Thr Ser Gly Ile Phe Glu
Thr Arg Phe Gln Val Asp Lys Val Asn 260 265 270Phe His Met Phe Asp
Val Gly Gly Gln Arg Asp Glu Arg Arg Lys Trp 275 280 285Ile Gln Cys
Phe Asn Asp Val Thr Ala Ile Ile Tyr Val Ala Ala Cys 290 295 300Ser
Ser Tyr Asn Met Val Ile Arg Glu Asp Asn Asn Thr Asn Arg Leu305 310
315 320Arg Glu Ser Leu Asp Leu Phe Glu Ser Ile Trp Asn Asn Arg Trp
Leu 325 330 335Arg Thr Ile Ser Ile Ile Leu Phe Leu Asn Lys Gln Asp
Met Leu Ala 340 345 350Glu Lys Val Leu Ala Gly Lys Ser Lys Ile Glu
Asp Tyr Phe Pro Glu 355 360 365Tyr Ala Asn Tyr Thr Val Pro Glu Asp
Ala Thr Pro Asp Ala Gly Glu 370 375 380Asp Pro Lys Val Thr Arg Ala
Lys Phe Phe Ile Arg Asp Leu Phe Leu385 390 395 400Arg Ile Ser Thr
Ala Thr Gly Asp Gly Lys His Tyr Cys Tyr Pro His 405 410 415Phe Thr
Cys Ala Val Asp Thr Glu Asn Ile Arg Arg Val Phe Asn Asp 420 425
430Cys Arg Asp Ile Ile Gln Arg Met His Leu Lys Gln Tyr Glu Leu Leu
435 440 44526450PRTRattus norvegicus 26Met Gly Leu Cys Tyr Ser Leu
Arg Pro Leu Leu Phe Gly Ser Ser Gly1 5 10 15Asp Ala Pro Cys Glu Asp
Ser Glu Pro Cys Ala Glu Asp Ala Gln Pro 20 25 30Ser Ala Ala Pro Ala
Pro Ala Pro Ala Pro Ile Pro Ala Pro Ala Pro 35 40 45Val Gly Thr Leu
Leu Arg Arg Gly Asp Gly Arg Ile Pro Ala Ser Ala 50 55 60Arg Ser Pro
Val Glu Leu Gln Asn Arg Arg Arg Gln Glu Gln Leu Arg65 70 75 80Ala
Glu Glu Arg Glu Ala Ala Lys Glu Ala Arg Lys Val Ser Arg Gly 85 90
95Ile Asp Arg Met Leu Arg Glu Gln Lys Arg Asp Leu Gln Gln Thr His
100 105 110Arg Leu Leu Leu Leu Gly Ala Gly Glu Ser Gly Lys Ser Thr
Ile Val 115 120 125Lys Gln Met Arg Ile Leu His Val Asn Gly Phe Asn
Pro Glu Glu Lys 130 135 140Lys Gln Lys Ile Leu Asp Ile Arg Lys Asn
Val Lys Asp Ala Leu Val145 150 155 160Thr Ile Ile Ser Ala Met Ser
Thr Ile Ile Pro Pro Val Pro Leu Ala 165 170 175Asn Pro Glu Asn Gln
Phe Arg Ser Asp Tyr Ile Lys Ser Ile Ala Pro 180 185 190Ile Thr Asp
Phe Glu Tyr Ser Gln Glu Phe Phe Asp His Val Lys Lys 195 200 205Leu
Trp Asp Asp Glu Gly Val Lys Ala Cys Phe Glu Arg Ser Asn Glu 210 215
220Tyr Gln Leu Ile Asp Cys Ala Gln Tyr Phe Leu Glu Arg Ile Asp
Ser225 230 235 240Val Ser Leu Val Asp Tyr Thr Pro Thr Asp Gln Asp
Leu Leu Arg Cys 245 250 255Arg Val Leu Thr Ser Gly Ile Phe Glu Thr
Arg Phe Gln Val Asp Lys 260 265 270Val Asn Phe His Met Phe Asp Val
Gly Gly Gln Arg Asp Glu Arg Arg 275 280 285Lys Trp Ile Gln Cys Phe
Asn Asp Val Thr Ala Ile Ile Tyr Val Ala 290 295 300Ala Cys Ser Ser
Tyr Asn Met Val Ile Arg Glu Asp Asn Asn Thr Asn305 310 315 320Arg
Leu Arg Glu Ser Leu Asp Leu Phe Glu Ser Ile Trp Asn Asn Arg 325 330
335Trp Leu Arg Thr
Ile Ser Ile Ile Leu Phe Leu Asn Lys Gln Asp Met 340 345 350Leu Ala
Glu Lys Val Leu Ala Gly Lys Ser Lys Ile Glu Asp Tyr Phe 355 360
365Pro Glu Tyr Ala Asn Tyr Thr Val Pro Glu Asp Ala Thr Pro Asp Ala
370 375 380Gly Glu Asp Pro Lys Val Thr Arg Ala Lys Phe Phe Ile Arg
Asp Leu385 390 395 400Phe Leu Arg Ile Ser Thr Ala Thr Gly Asp Gly
Lys His Tyr Cys Tyr 405 410 415Pro His Phe Thr Cys Ala Val Asp Thr
Glu Asn Ile Arg Arg Val Phe 420 425 430Asn Asp Cys Arg Asp Ile Ile
Gln Arg Met His Leu Lys Gln Tyr Glu 435 440 445Leu Leu
450271347DNAMus musculusCDS(1)..(1347) 27atg ggc cta tgc tac agc
ctg cgg ccg ctg ctc ttc ggg agc cca gag 48Met Gly Leu Cys Tyr Ser
Leu Arg Pro Leu Leu Phe Gly Ser Pro Glu1 5 10 15gac acc ccg tgt gcg
gcc tcg gaa ccc tgc gca gag gat gct cag ccc 96Asp Thr Pro Cys Ala
Ala Ser Glu Pro Cys Ala Glu Asp Ala Gln Pro 20 25 30agc gcc gcc ccg
gcc cct gcc tcg atc cca gcc ccg gct ccc gta ggg 144Ser Ala Ala Pro
Ala Pro Ala Ser Ile Pro Ala Pro Ala Pro Val Gly 35 40 45acc ctg ctc
cgg cgt ggc ggc ggc cgg atc gtc gcg aac gcg cgg ccg 192Thr Leu Leu
Arg Arg Gly Gly Gly Arg Ile Val Ala Asn Ala Arg Pro 50 55 60cca ggc
gag ctg cag agc cgc cgg cga cag gag cag cta cga gcc gag 240Pro Gly
Glu Leu Gln Ser Arg Arg Arg Gln Glu Gln Leu Arg Ala Glu65 70 75
80gag cgc gag gcg gct aaa gag gcg agg aaa gtc agc cgg ggc atc gac
288Glu Arg Glu Ala Ala Lys Glu Ala Arg Lys Val Ser Arg Gly Ile Asp
85 90 95cgc atg ctg cgc gag cag aag cgg gac ctg cag cag acg cac cgg
ctc 336Arg Met Leu Arg Glu Gln Lys Arg Asp Leu Gln Gln Thr His Arg
Leu 100 105 110ctg ctg ctg ggg gct ggt gag tcc ggg aaa agc act atc
gtc aaa cag 384Leu Leu Leu Gly Ala Gly Glu Ser Gly Lys Ser Thr Ile
Val Lys Gln 115 120 125atg agg atc ctg cac gtc aat ggc ttc aac ccc
gag gaa aag aag cag 432Met Arg Ile Leu His Val Asn Gly Phe Asn Pro
Glu Glu Lys Lys Gln 130 135 140aaa att ctg gac atc agg aaa aat gtc
aaa gat gcg atc gtg aca atc 480Lys Ile Leu Asp Ile Arg Lys Asn Val
Lys Asp Ala Ile Val Thr Ile145 150 155 160gtt tca gca atg agt act
atc ata cct cca gtt cca ctg gcc aac cct 528Val Ser Ala Met Ser Thr
Ile Ile Pro Pro Val Pro Leu Ala Asn Pro 165 170 175gag aac cag ttc
cgg tca gat tat atc aag agc ata gcc cct atc act 576Glu Asn Gln Phe
Arg Ser Asp Tyr Ile Lys Ser Ile Ala Pro Ile Thr 180 185 190gac ttt
gaa tat tcc cag gag ttc ttt gac cat gtg aag aag ctg tgg 624Asp Phe
Glu Tyr Ser Gln Glu Phe Phe Asp His Val Lys Lys Leu Trp 195 200
205gac gat gaa gga gtg aag gcc tgc ttt gag aga tcc aac gag tac cag
672Asp Asp Glu Gly Val Lys Ala Cys Phe Glu Arg Ser Asn Glu Tyr Gln
210 215 220ctg atc gac tgt gca caa tac ttc ctg gaa agg att gac agt
gtc agt 720Leu Ile Asp Cys Ala Gln Tyr Phe Leu Glu Arg Ile Asp Ser
Val Ser225 230 235 240ctg gtt gac tac aca ccc aca gac cag gac ctg
ctc aga tgc aga gtg 768Leu Val Asp Tyr Thr Pro Thr Asp Gln Asp Leu
Leu Arg Cys Arg Val 245 250 255ctg aca tca gga atc ttt gag aca cga
ttc caa gtg gac aaa gtg aac 816Leu Thr Ser Gly Ile Phe Glu Thr Arg
Phe Gln Val Asp Lys Val Asn 260 265 270ttt cac atg ttt gat gtt gga
ggc cag aga gat gag aga aga aaa tgg 864Phe His Met Phe Asp Val Gly
Gly Gln Arg Asp Glu Arg Arg Lys Trp 275 280 285atc cag tgt ttt aat
gat gtc act gcg atc att tac gtg gcg gcc tgt 912Ile Gln Cys Phe Asn
Asp Val Thr Ala Ile Ile Tyr Val Ala Ala Cys 290 295 300agt agc tac
aac atg gtg atc cgg gaa gat aac aat acc aac aga ctt 960Ser Ser Tyr
Asn Met Val Ile Arg Glu Asp Asn Asn Thr Asn Arg Leu305 310 315
320cgg gaa tca ctg gac ctg ttt gaa agc atc tgg aat aac agg tgg ttg
1008Arg Glu Ser Leu Asp Leu Phe Glu Ser Ile Trp Asn Asn Arg Trp Leu
325 330 335cga acc att tct atc atc cta ttc ttg aac aaa caa gac atg
ctg gca 1056Arg Thr Ile Ser Ile Ile Leu Phe Leu Asn Lys Gln Asp Met
Leu Ala 340 345 350gaa aaa gtc ttg gca ggg aag tca aaa atc gaa gac
tat ttc ccg gag 1104Glu Lys Val Leu Ala Gly Lys Ser Lys Ile Glu Asp
Tyr Phe Pro Glu 355 360 365tat gcc aat tat act gtc cct gaa gat gca
aca cca gat gcg gga gaa 1152Tyr Ala Asn Tyr Thr Val Pro Glu Asp Ala
Thr Pro Asp Ala Gly Glu 370 375 380gat ccc aaa gtt aca aga gca aag
ttc ttt atc cgg gat ctg ttc ttg 1200Asp Pro Lys Val Thr Arg Ala Lys
Phe Phe Ile Arg Asp Leu Phe Leu385 390 395 400agg atc agc aca gcc
acg ggt gat ggc aaa cat tac tgc tac cct cac 1248Arg Ile Ser Thr Ala
Thr Gly Asp Gly Lys His Tyr Cys Tyr Pro His 405 410 415ttc acc tgc
gcc gtg gac aca gag aac atc cgc aga gtg ttc aac gat 1296Phe Thr Cys
Ala Val Asp Thr Glu Asn Ile Arg Arg Val Phe Asn Asp 420 425 430tgc
cgt gac atc atc cag aga atg cat ctc aag cag tac gaa ctc ttg 1344Cys
Arg Asp Ile Ile Gln Arg Met His Leu Lys Gln Tyr Glu Leu Leu 435 440
445tga 1347 281353DNARattus norvegicusCDS(1)..(1353) 28atg ggc ctg
tgc tac agc cta cgg ccg ctg ctc ttc ggg agc tcg ggg 48Met Gly Leu
Cys Tyr Ser Leu Arg Pro Leu Leu Phe Gly Ser Ser Gly1 5 10 15gac gcc
ccc tgt gag gac tct gag ccg tgc gct gag gat gct cag ccc 96Asp Ala
Pro Cys Glu Asp Ser Glu Pro Cys Ala Glu Asp Ala Gln Pro 20 25 30agc
gcc gcc ccg gcc ccg gcc ccg gcc ccg atc cca gcc ccg gct ccg 144Ser
Ala Ala Pro Ala Pro Ala Pro Ala Pro Ile Pro Ala Pro Ala Pro 35 40
45gtg ggg acc ctg ctc cgg cga ggc gac ggc cgg atc ccc gca agc gcg
192Val Gly Thr Leu Leu Arg Arg Gly Asp Gly Arg Ile Pro Ala Ser Ala
50 55 60agg tcg cca gtc gag ctg cag aac cgc cgg cga cag gag cag ctg
cga 240Arg Ser Pro Val Glu Leu Gln Asn Arg Arg Arg Gln Glu Gln Leu
Arg65 70 75 80gcc gag gag cgc gag gca gct aag gag gcg agg aaa gta
agc cgg ggt 288Ala Glu Glu Arg Glu Ala Ala Lys Glu Ala Arg Lys Val
Ser Arg Gly 85 90 95atc gac cgc atg ctg cgc gaa cag aag cgc gac ctg
cag cag acg cac 336Ile Asp Arg Met Leu Arg Glu Gln Lys Arg Asp Leu
Gln Gln Thr His 100 105 110cgg ctc ctg ctc ttg ggg gct ggt gag tcc
ggg aaa agc act ata gtc 384Arg Leu Leu Leu Leu Gly Ala Gly Glu Ser
Gly Lys Ser Thr Ile Val 115 120 125aaa cag atg agg atc cta cac gtc
aat ggc ttc aac ccc gag gaa aag 432Lys Gln Met Arg Ile Leu His Val
Asn Gly Phe Asn Pro Glu Glu Lys 130 135 140aag cag aaa att ctg gac
atc agg aaa aat gtc aaa gat gct tta gtg 480Lys Gln Lys Ile Leu Asp
Ile Arg Lys Asn Val Lys Asp Ala Leu Val145 150 155 160aca atc att
tca gca atg agt acc ata ata cct cca gtt cca ctg gcc 528Thr Ile Ile
Ser Ala Met Ser Thr Ile Ile Pro Pro Val Pro Leu Ala 165 170 175aac
cct gag aac cag ttt cgg tca gat tac atc aag agc ata gcc cct 576Asn
Pro Glu Asn Gln Phe Arg Ser Asp Tyr Ile Lys Ser Ile Ala Pro 180 185
190atc act gac ttt gaa tat tcc cag gag ttc ttt gac cac gtg aag aag
624Ile Thr Asp Phe Glu Tyr Ser Gln Glu Phe Phe Asp His Val Lys Lys
195 200 205ctg tgg gat gat gag gga gtg aag gcc tgc ttt gag aga tcc
aac gag 672Leu Trp Asp Asp Glu Gly Val Lys Ala Cys Phe Glu Arg Ser
Asn Glu 210 215 220tac cag ctg atc gac tgt gca caa tac ttc ctg gaa
agg att gac agc 720Tyr Gln Leu Ile Asp Cys Ala Gln Tyr Phe Leu Glu
Arg Ile Asp Ser225 230 235 240gtg agt ctg gtt gac tac aca ccc aca
gac cag gac cta ctc aga tgc 768Val Ser Leu Val Asp Tyr Thr Pro Thr
Asp Gln Asp Leu Leu Arg Cys 245 250 255aga gtg ctg aca tca ggg atc
ttt gag aca cga ttc caa gtg gac aaa 816Arg Val Leu Thr Ser Gly Ile
Phe Glu Thr Arg Phe Gln Val Asp Lys 260 265 270gtg aac ttt cac atg
ttt gac gtt gga ggc cag agg gat gag aga aga 864Val Asn Phe His Met
Phe Asp Val Gly Gly Gln Arg Asp Glu Arg Arg 275 280 285aaa tgg atc
cag tgt ttt aac gat gtc act gcc atc atc tat gtg gca 912Lys Trp Ile
Gln Cys Phe Asn Asp Val Thr Ala Ile Ile Tyr Val Ala 290 295 300gcc
tgc agc agc tac aac atg gtg atc cgg gaa gat aac aac acc aac 960Ala
Cys Ser Ser Tyr Asn Met Val Ile Arg Glu Asp Asn Asn Thr Asn305 310
315 320aga ctc cgg gag tcg ctg gac ctg ttt gaa agc atc tgg aat aac
agg 1008Arg Leu Arg Glu Ser Leu Asp Leu Phe Glu Ser Ile Trp Asn Asn
Arg 325 330 335tgg tta cga acc att tcc atc atc ctg ttc ttg aac aaa
caa gat atg 1056Trp Leu Arg Thr Ile Ser Ile Ile Leu Phe Leu Asn Lys
Gln Asp Met 340 345 350ctg gca gaa aaa gtc ttg gcc ggg aag tca aaa
att gaa gac tat ttc 1104Leu Ala Glu Lys Val Leu Ala Gly Lys Ser Lys
Ile Glu Asp Tyr Phe 355 360 365ccg gag tat gcc aac tat act gtc cct
gaa gat gca aca cca gat gca 1152Pro Glu Tyr Ala Asn Tyr Thr Val Pro
Glu Asp Ala Thr Pro Asp Ala 370 375 380gga gaa gat ccc aaa gtt aca
aga gcc aag ttc ttt atc cgg gat ctg 1200Gly Glu Asp Pro Lys Val Thr
Arg Ala Lys Phe Phe Ile Arg Asp Leu385 390 395 400ttc ttg agg atc
agc aca gcc acg ggt gat ggc aaa cat tac tgc tac 1248Phe Leu Arg Ile
Ser Thr Ala Thr Gly Asp Gly Lys His Tyr Cys Tyr 405 410 415cct cac
ttc acc tgc gcc gtg gac aca gag aac atc cgc aga gtg ttc 1296Pro His
Phe Thr Cys Ala Val Asp Thr Glu Asn Ile Arg Arg Val Phe 420 425
430aac gat tgt cgt gac atc atc cag aga atg cac ctc aag cag tac gaa
1344Asn Asp Cys Arg Asp Ile Ile Gln Arg Met His Leu Lys Gln Tyr Glu
435 440 445ctc ttg tga 1353Leu Leu 4502929DNAArtificial Sequencea
primer used in an example of the present invention 29atgggcctat
gctacagcct gcggccgct 293033DNAArtificial Sequencea primer used in
an example of the present invention 30tcacaagagt tcgtactgct
tgagatgcat tct 333130DNAArtificial Sequencea primer used in an
example of the present invention 31atgggcctgt gctacagcct acggccgctg
303233DNAArtificial Sequencea primer used in an example of the
present invention 32tcacaagagt tcgtactgct tgaggtgcat tct
333337DNAArtificial Sequencea primer used in an example of the
present invention 33agctcggatc catgcccatc atgggctcct cggtgta
373434DNAArtificial Sequencea primer used in an example of the
present invention 34gtgcagaatt ctcaggacac tcctgctcca tcct 34
* * * * *