Cyanobacteria Saxitoxin Gene Cluster And Detection Of Cyanotoxic Organisms

Abstract

The present invention relates to methods for the detection of cyanobacteria, dinoflagellates, and in particular, methods for the detection of cyanotoxic organisms. Kits for the detection of cyanobacteria, dinoflagellates, and cyanotoxic organisms are provided. The invention further relates to methods of screening for compounds that modulate the activity of polynucleotides and/or polypeptides of the saxitoxin and cylindrospermopsin biosynthetic pathways.

Description

RELATED APPLICATIONS

[0001] This application claims the benefit of PCT Application No. PCT/AU2008/001805 filed on Dec. 5, 2008, which claims the benefit of Australian Patent Application No. 2008902056 filed on Apr. 24, 2008 which is incorporated herein by reference in its entirety.

TECHNICAL FIELD

[0002] The present invention relates to methods for the detection of cyanobacteria, dinofiagellates, and in particular, methods for the detection of cyanotoxic organisms. Kits for the detection of cyanobacteria, dinofiagellates, and cyanotoxic organisms are provided. The invention further relates to methods of screening for compounds that modulate the activity of polynucleotides and/or polypeptides of the saxitoxin and cylindrospermopsin biosynthetic pathways.

BACKGROUND

[0003] Cyanobacteria, also known as blue-green algae, are photosynthetic bacteria widespread in marine and freshwater environments. Of particular significance for water quality and human and animal health are those cyanobacteria which produce toxic compounds. Under eutrophic conditions cyanobacteria tend to form large blooms which drastically promote elevated toxin concentrations. Cyanobacterial blooms may flourish and expand in coastal waters, streams, lakes, and in drinking water and recreational reservoirs. The toxins they produce can pose a serious health risk for humans and animals and this problem is internationally relevant since most toxic cyanobacteria have a global distribution.

[0004] A diverse range of cyanobacterial genera are well known for the formation of toxic blue-green algal blooms on water surfaces. Saxitoxin (SXT) and its analogues cause the paralytic shellfish poisoning (PSP) syndrome, which afflicts human health and impacts on coastal shellfish economies worldwide. PSP toxins are unique alkaloids, being produced by both prokaryotes and eukaryotes. PSP toxins are among the most potent and pervasive algal toxins and are considered a serious toxicological health-risk that may affect humans, animals and ecosystems worldwide. These toxins block voltage-gated sodium and calcium channels, and prolong the gating of potassium channels preventing the transduction of neuronal signals. It has been estimated that more than 2000 human cases of PSP occur globally every year. Moreover, coastal blooms of producing microorganisms result in millions of dollars of economic damage due to PSP toxin contamination of seafood and the continuous requirement for costly biotoxin monitoring programs. Early warning systems to anticipate paralytic shellfish toxin (PST)-producing algal blooms, such as PCR and ELISA-based screening, are as yet unavailable due to the lack of data on the genetic basis of PST production.

[0005] SXT is a tricyclic perhydropurine alkaloid which can be substituted at various positions leading to more than 30 naturally occurring SXT analogues. Although SXT biosynthesis seems complex and unique, organisms from two kingdoms, including certain species of marine dinoflagellates and freshwater cyanobacteria, are capable of producing these toxins, apparently by the same biosynthetic route. In spite of considerable efforts none of the enzymes or genes involved in the biosynthesis and modification of SXT have been previously identified.

[0006] The occurrence of the cyanobacterial genus Cylindrospermopsis has been documented on all continents and therefore poses a significant public health threat on a global scale. The major toxin produced by Cylindrospermopsis is cylindrospermopsin (CYR). Besides posing a threat to human health, cylindrospermopsin also causes significant economic losses for farmers due to the poisoning of livestock with cylindrospermopsin-contaminated drinking water. Cylindrospermopsin has hepatotoxic, general cytotoxic and neurotoxic effects and is a potential carcinogen. Its toxicity is due to the inhibition of glutathione and protein synthesis as well as inhibiting cytochrome P450. Six cyanobacterial species have so far been identified to produce cylindrospermopsin; Cylindrospermopsis raciborskii, Aphanizomenon ovalisporum, Aphanizomenon flos-aquae, Umezakia natans, Rhaphdiopsis curvata and Anabaena bergii. Incidents of human poisoning with cylindrospermopsin have only been reported in sub-tropical Australia to date, however C. raciborskii and A. flos-aquae have recently been detected in areas with more temperate climates. The tendency of C. raciborskii to form dense blooms and the invasiveness of the producer organisms gives rise to global concerns for drinking water quality and necessitates the monitoring of drinking water reserves for the presence of cylindrospermopsin producers.

[0007] There is a need for rapid and accurate methods detecting cyanobacteria, and in particular those strains which are capable of producing cyanotoxins such as saxitoxin and cylindrospermopsin. Rapid and accurate methods for detecting cyanotoxic organisms are needed for assessing the potential health hazard of cyanobacterial blooms and for the implementation of effective water management strategies to minimize the effects of toxic bloom outbreaks.

SUMMARY

[0008] In a first aspect, there is provided an isolated polynucleotide comprising a sequence according to SEQ ID NO: 1 or a variant or fragment thereof.

[0009] In one embodiment of the first aspect, the fragment comprises a sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, and variants and fragments thereof.

[0010] In a second aspect, there is provided an isolated ribonucleic acid or an isolated complementary DNA encoded by a sequence according to the first aspect.

[0011] In a third aspect, there is provided an isolated polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, and variants and fragments thereof.

[0012] In one embodiment, there is provided a probe or primer that hybridises specifically with one or more of: a polynucleotide according to the first aspect, a ribonucleic acid or complementary DNA according to the second aspect, or a polypeptide according the third aspect.

[0013] In another embodiment, there is provided a vector comprising a polynucleotide according to the first aspect, or a ribonucleic acid or complementary DNA according the second aspect. The vector may be an expression vector.

[0014] In another embodiment, a host cell is provided comprising the vector.

[0015] In another embodiment, there is provided an isolated antibody capable of binding specifically to a polypeptide according to the third aspect.

[0016] In a fourth aspect, there is provided a method for the detection of cyanobacteria, the method comprising the steps of obtaining a sample for use in the method and analyzing the sample for the presence of one or more of: [0017] (i) a polynucleotide comprising a sequence according to the first aspect [0018] (ii) a ribonucleic acid or complementary DNA according to the second aspect [0019] (iii) a polypeptide comprising a sequence according to third aspect wherein said presence is indicative of cyanobacteria in the sample.

[0020] In a fifth aspect, there is provided a method for detecting a cyanotoxic organism, the method comprising the steps of obtaining a sample for use in the method and analyzing the sample for the presence of one or more of: [0021] (i) a polynucleotide comprising a sequence selected from the group consisting of: SEQ ID NO: 14, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 36, and variants and fragments thereof [0022] (ii) a ribonucleic acid or complementary DNA encoded by a sequence according to (i) [0023] (iii) a polypeptide comprising a sequence selected from the group consisting of: SEQ ID NO: 15, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 37, and variants and fragments thereof, wherein said presence is indicative of cyanotoxic organisms in the sample.

[0024] In one embodiment of the fifth aspect, the cyanotoxic organism is a cyanobacteria or a dinoflagellate.

[0025] In one embodiment of the fourth and fifth aspects, analyzing the sample comprises amplification of DNA from the sample by polymerase chain reaction and detecting the amplified sequences. The polymerase chain reaction may utilise one or more primers comprising a sequence selected from the group consisting of SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 113, SEQ ID NO: 114, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 121, SEQ ID NO: 122, SEQ ID NO: 123, SEQ ID NO: 124, SEQ ID NO: 125, SEQ ID NO: 126, SEQ ID NO: 127, SEQ ID NO: 128, SEQ ID NO: 129, SEQ ID NO: 130, SEQ ID NO: 131, SEQ ID NO: 132, SEQ ID NO: 133, SEQ ID NO: 134, and variants and fragments thereof.

[0026] In another embodiment of the fourth and fifth aspects, the method comprises further analyzing the sample for the presence of one or more of: [0027] (i) a polynucleotide comprising a sequence selected from the group consisting of: SEQ ID NO: 80, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, and variants and fragments thereof, [0028] (ii) a ribonucleic acid or complementary DNA encoded by a sequence according to (i), [0029] (iii) a polypeptide comprising a sequence selected from the group consisting of: SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, and SEQ ID NO: 110, and variants and fragments thereof.

[0030] The further analysis of the sample may comprise amplification of DNA from the sample by polymerase chain reaction. The polymerase chain reaction may utilise one or more primers comprising a sequence selected from the group consisting of SEQ ID NO: 111, SEQ ID NO: 112, or variants or fragments thereof.

[0031] In a sixth aspect, there is provided a method for the detection of dinoflagellates, the method comprising the steps of obtaining a sample for use in the method and analyzing the sample for the presence of one or more of: [0032] (i) a polynucleotide comprising a sequence according to the first aspect, [0033] (ii) a ribonucleic acid or complementary DNA according to the second aspect, [0034] (iii) a polypeptide comprising a sequence according to the third aspect, wherein said presence is indicative of dinoflagellates in the sample.

[0035] In one embodiment of the sixth aspect, analysing the sample comprises amplification of DNA from the sample by polymerase chain reaction and detecting the amplified sequences.

[0036] In one embodiment of the fourth, fifth, and sixth aspects, the detection comprises one or both of gel electrophoresis and nucleic acid sequencing. The sample may comprise one or more isolated or cultured organisms. The sample may be an environmental sample. The environmental sample may be derived from salt water, fresh water or a blue-green algal bloom.

[0037] In a seventh aspect, there is provided a kit for the detection of cyanobacteria, the kit comprising at least one agent for detecting the presence of one or more of: [0038] (i) a polynucleotide comprising a sequence according to the first aspect, [0039] (ii) a ribonucleic acid or complementary DNA according to the second aspect, [0040] (iii) a polypeptide comprising a sequence according to the third aspect, wherein said presence is indicative of cyanobacteria in the sample.

[0041] In an eighth aspect, there is provided a kit for the detection of cyanotoxic organisms, the kit comprising at least one agent for detecting the presence of one or more of: [0042] (i) a polynucleotide comprising a sequence selected from the group consisting of: SEQ ID NO: 14, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 36, and variants and fragments thereof, [0043] (ii) a ribonucleic acid or complementary DNA encoded by a sequence according to (i), [0044] (iii) a polypeptide comprising a sequence selected from the group consisting of SEQ ID NO: 15, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 37, and variants and fragments thereof, wherein said presence is indicative of cyanotoxic organisms in the sample.

[0045] In one embodiment of the seventh and eighth aspects, the at least one agent is a primer, antibody or probe. The primer or probe may comprise a sequence selected from the group consisting of SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 113, SEQ ID NO: 114, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 121, SEQ ID NO: 122, SEQ ID NO: 123, SEQ ID NO: 124, SEQ ID NO: 125, SEQ ID NO: 126, SEQ ID NO: 127, SEQ ID NO: 128, SEQ ID NO: 129, SEQ ID NO: 130, SEQ ID NO: 131, SEQ ID NO: 132, SEQ ID NO: 133, SEQ ID NO: 134, and variants and fragments thereof.

[0046] In another embodiment of the seventh and eighth aspects, the kit further comprises at least one additional agent for detecting the presence of one or more of: [0047] (i) a polynucleotide comprising a sequence selected from the group consisting of: SEQ ID NO: 80, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, and variants and fragments thereof, [0048] (ii) a ribonucleic acid or complementary DNA encoded by a sequence according to (i), [0049] (iii) a polypeptide comprising a sequence selected from the group consisting of: SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, and SEQ ID NO: 110, and variants and fragments thereof.

[0050] The at least one additional agent may be a primer, antibody or probe. The primer or probe may comprise a sequence selected from the group consisting of SEQ ID NO: 109, SEQ ID NO: 110, and variants and fragments thereof.

[0051] In a ninth aspect, there is provided a kit for the detection of dinoflagellates, the kit comprising at least one agent for detecting the presence of one or more of: [0052] (i) polynucleotide comprising a sequence according to the first aspect, [0053] (ii) a ribonucleic acid or complementary DNA according to the second aspect, [0054] (iii) a polypeptide comprising a sequence according to the third aspect, wherein said presence is indicative of dinoflagellates in the sample.

[0055] In a tenth aspect, there is provided a method of screening for a compound that modulates the expression or activity of one or more polypeptides according to the third aspect, the method comprising contacting the polypeptide with a candidate compound under conditions suitable to enable interaction of the candidate compound and the polypeptide, and assaying for activity of the polypeptide.

[0056] In one embodiment of the tenth aspect, modulating the expression or activity of one or more polypeptides comprises inhibiting the expression or activity of said polypeptide.

[0057] In another embodiment of the tenth aspect, modulating the expression or activity of one or more polypeptides comprises enhancing the expression or activity of said polypeptide.

[0058] In an eleventh aspect, there is provided an isolated polynucleotide comprising a sequence according to SEQ ID NO: 80 or a variant or fragment thereof.

[0059] In one embodiment of the eleventh aspect, the fragment comprises a sequence selected from the group consisting of SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, and variants and fragments thereof.

[0060] In a twelfth aspect, there is provided a ribonucleic acid or complementary DNA encoded by a sequence according to the eleventh aspect.

[0061] In a thirteenth aspect, there is provided an isolated polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, and variants and fragments thereof.

[0062] In one embodiment, there is provided a probe or primer that hybridises specifically with one or more of a polynucleotide according to the eleventh aspect, a ribonucleic acid or complementary DNA according to the twelfth aspect, or a polypeptide according to the thirteenth aspect.

[0063] In another embodiment, there is provided a vector comprising a polynucleotide according to the eleventh aspect, or a ribonucleic acid or complementary DNA according to the twelfth aspect. The vector may be an expression vector. In one embodiment, a host cell is provided comprising the vector.

[0064] In another embodiment, there is provided an isolated antibody capable of binding specifically to a polypeptide according to the thirteenth aspect.

[0065] In a fourteenth aspect, there is provided a method for the detection of cyanobacteria, the method comprising the steps of obtaining a sample for use in the method and analyzing the sample for the presence of one or more of: [0066] (i) a polynucleotide comprising a sequence according to the eleventh aspect, [0067] (ii) a ribonucleic acid or complementary DNA according to the twelfth aspect, [0068] (iii) a polypeptide comprising a sequence according to thirteenth aspect, wherein said presence is indicative of cyanobacteria in the sample.

[0069] In a fifteenth aspect, there is provided a method for detecting a cyanotoxic organism, the method comprising the steps of obtaining a sample for use in the method and analyzing the sample for the presence of one or both of: [0070] (i) a polynucleotide comprising a sequence according to SEQ ID NO: 95 or a variant or fragment thereof, [0071] (ii) a ribonucleic acid or complementary DNA encoded by a sequence according to (i), [0072] (iii) a polypeptide comprising a sequence according to SEQ ID NO: 96, or a variant or fragment thereof, wherein said presence is indicative of a cyanotoxic organism in the sample.

[0073] In one embodiment of the fifteenth aspect, the cyanotoxic organism is a cyanobacteria.

[0074] In one embodiment of the fourteenth and fifteenth aspects, analyzing the sample comprises amplification of DNA from the sample by polymerase chain reaction and detecting the amplified sequences. The polymerase chain reaction may utilise one or more primers comprising a sequence selected from the group consisting of SEQ ID NO: 111, SEQ ID NO: 112 and variants and fragments thereof.

[0075] In another embodiment of the fourteenth and fifteenth aspects, the method comprises analyzing the sample for the presence of one or more of: [0076] (i) a polynucleotide comprising a sequence selected from the group consisting of: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, and variants and fragments thereof, [0077] (ii) a ribonucleic acid or complementary DNA encoded by a sequence according to (i), [0078] (iii) a polypeptide comprising a sequence selected from the group consisting of: SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19 SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, and variants and fragments thereof.

[0079] The further analysis of the sample may comprise amplification of DNA from the sample by polymerase chain reaction. The polymerase chain reaction may utilise one or more primers comprising a sequence selected from the group consisting of SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 113, SEQ ID NO: 114, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 121, SEQ ID NO: 122, SEQ ID NO: 123, SEQ ID NO: 124, SEQ ID NO: 125, SEQ ID NO: 126, SEQ ID NO: 127, SEQ ID NO: 128, SEQ ID NO: 129, SEQ ID NO: 130, SEQ ID NO: 131, SEQ ID NO: 132, SEQ ID NO: 133, SEQ ID NO: 134, and variants and fragments thereof.

[0080] In a sixteenth aspect, there is provided a method for detecting a cylindrospermopsin-producing organism, the method comprising the steps of obtaining a sample for use in the method and analyzing the sample for the presence of one or both of: [0081] (i) a polynucleotide comprising a sequence according to SEQ ID NO: 95 or a variant or fragments thereof, [0082] (ii) a ribonucleic acid or complementary DNA encoded by a sequence according to (i), [0083] (iii) a polypeptide comprising a sequence according to SEQ ID NO: 96, or a variant or fragments thereof, wherein said presence is indicative of a cylindrospermopsin-producing organism in the sample.

[0084] In one embodiment of the sixteenth aspect, the cyanotoxic organism is a cyanobacteria. In another embodiment of the sixteenth aspect, analyzing the sample comprises amplification of DNA from the sample by polymerase chain reaction and detecting the amplified sequences. The polymerase chain reaction may utilise one or more primers comprising a sequence selected from the group consisting of SEQ ID NO: 111, SEQ ID NO: 112 and variants and fragments thereof.

[0085] In one embodiment of the fourteenth, fifteenth, and sixteenth aspects, the detection comprises one or both of gel electrophoresis and nucleic acid sequencing. The sample may comprise one or more isolated or cultured organisms. The sample may be an environmental sample. The environmental sample may be derived from salt water, fresh water or a blue-green algal bloom.

[0086] In a seventeenth aspect, there is provided a kit for the detection of cyanobacteria, the kit comprising at least one agent for detecting the presence of one or more of: [0087] (i) a polynucleotide comprising a sequence according to the eleventh aspect, [0088] (ii) a ribonucleic acid or complementary DNA according to the twelfth aspect, [0089] (iii) a polypeptide comprising a sequence according to the thirteenth aspect, wherein said presence is indicative of cyanobacteria in the sample.

[0090] In an eighteenth aspect, there is provided a kit for the detection of cyanotoxic organisms, the kit comprising at least one agent for detecting the presence of one or more of: [0091] (i) a polynucleotide comprising a sequence according to SEQ ID NO: 95 or a variant or fragment thereof, [0092] (ii) a ribonucleic acid or complementary DNA encoded by a sequence according to (i), [0093] (iii) a polypeptide comprising a sequence according to SEQ ID NO: 96, or a variant or fragment thereof, wherein said presence is indicative of cyanotoxic organisms in the sample.

[0094] In one embodiment of the seventeenth and eighteenth aspects, the at least one agent is a primer, antibody or probe. The primer or probe may comprise a sequence selected from the group consisting of SEQ ID NO: 111, SEQ ID NO: 112 and variants and fragments thereof.

[0095] In another embodiment of the seventeenth and eighteenth aspects, the kit may further comprise at least one additional agent for detecting the presence of one or more nucleotide sequences selected from the group consisting of: [0096] (i) a polynucleotide comprising a sequence selected from the group consisting of: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, and variants and fragments thereof, [0097] (ii) a ribonucleic acid or complementary DNA encoded by a sequence according to (i), [0098] (iii) a polypeptide comprising a sequence selected from the group consisting of: SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19 SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, and variants and fragments thereof.

[0099] The at least one additional agent may be a primer, antibody or probe. The primer or probe may comprise a sequence selected from the group consisting of SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 113, SEQ ID NO: 114, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 121, SEQ ID NO: 122, SEQ ID NO: 123, SEQ ID NO: 124, SEQ ID NO: 125, SEQ ID NO: 126, SEQ ID NO: 127, SEQ ID NO: 128, SEQ ID NO: 129, SEQ ID NO: 130, SEQ ID NO: 131, SEQ ID NO: 132, SEQ ID NO: 133, SEQ ID NO: 134, and variants and fragments thereof.

[0100] In a nineteenth aspect, there is provided a kit for the detection of cylindrospermopsin-producing organisms, the kit comprising at least one agent for detecting the presence of one or more of: [0101] (i) a polynucleotide comprising a sequence according to SEQ ID NO: 95 or a variant or fragment thereof, [0102] (ii) a ribonucleic acid or complementary DNA encoded by a sequence according to (i), [0103] (iii) a polypeptide comprising a sequence according to SEQ ID NO: 96, or a variant or fragment thereof, wherein said presence is indicative of a cylindrospermopsin-producing organism in the sample.

[0104] In a twentieth aspect, there is provided a method of screening for a compound that modulates the expression or activity of one or more polypeptides according to the thirteenth aspect, the method comprising contacting the polypeptide with a candidate compound under conditions suitable to enable interaction of the candidate compound and the polypeptide, and assaying for activity of the polypeptide.

[0105] In one embodiment of the twentieth aspect, modulating the expression or activity of one or more polypeptides comprises inhibiting the expression or activity of said polypeptide.

[0106] In another embodiment of the twentieth aspect, modulating the expression or activity of one or more polypeptides comprises enhancing the expression or activity of said polypeptide.

DEFINITIONS

[0107] As used in this application, the singular form "a", "an" and "the" include plural references unless the context clearly dictates otherwise. For example, the term "a stem cell" also includes a plurality of stem cells.

[0108] As used herein, the term "comprising" means "including." Variations of the word "comprising", such as "comprise" and "comprises," have correspondingly varied meanings. Thus, for example, a polynucleotide "comprising" a sequence encoding a protein may consist exclusively of that sequence or may include one or more additional sequences.

[0109] As used herein, the terms "antibody" and "antibodies" include IgG (including IgG1, IgG2, IgG3, and IgG4), IgA (including IgA1 and IgA2), IgD, IgE, or IgM, and IgY, whole antibodies, including single-chain whole antibodies, and antigen-binding fragments thereof. Antigen-binding antibody fragments include, but are not limited to, Fab, Fab' and F(ab')2, Fd, single-chain Fvs (scFv), single-chain antibodies, disulfide-linked Fvs (sdFv) and fragments comprising either a VL or VH domain. The antibodies may be from any animal origin. Antigen-binding antibody fragments, including single-chain antibodies, may comprise the variable region(s) alone or in combination with the entire or partial of the following: hinge region, CH1, CH2, and CH3 domains. Also included are any combinations of variable region(s) and hinge region, CH1, CH2, and CH3 domains. Antibodies may be monoclonal, polyclonal, chimeric, multispecific, humanized, and human monoclonal and polyclonal antibodies which specifically bind the biological molecule.

[0110] As used herein, the terms "polypeptide" and "protein" are used interchangeably and are taken to have the same meaning.

[0111] As used herein, the terms "nucleotide sequence" and "polynucleotide sequence" are used interchangeably and are taken to have the same meaning.

[0112] As used herein, the term "kit" refers to any delivery system for delivering materials. In the context of the detection assays described herein, such delivery systems include systems that allow for the storage, transport, or delivery of reaction reagents (for example labels, reference samples, supporting material, etc. in the appropriate containers) and/or supporting materials (for example, buffers, written instructions for performing the assay etc.) from one location to another. For example, kits include one or more enclosures, such as boxes, containing the relevant reaction reagents and/or supporting materials.

[0113] Any discussion of documents, acts, materials, devices, articles or the like which has been included in the present specification is solely for the purpose of providing a context for the present invention. It is not to be taken as an admission that any or all of these matters form part of the prior art base or were common general knowledge in the field relevant to the present invention before the priority date of this application.

[0114] For the purposes of description all documents referred to herein are incorporated by reference unless otherwise stated.

BRIEF DESCRIPTION OF THE DRAWINGS

[0115] A preferred embodiment of the present invention will now be described, by way of an example only, with reference to the accompanying drawings wherein:

[0116] FIG. 1A is a table showing the distribution of the sxt genes in toxic and non-toxic cyanobacteria. PSP, saxitoxin; CYLN, cylindrospermopsin; +, gene fragment amplified; - no gene detected.

[0117] FIG. 1B is a table showing primer sequences used to amplify various SXT genes.

[0118] FIG. 2 is a table showing sxt genes from the saxitoxin gene cluster of C. raciborskii T3, their putative length, their BLAST similarity match with similar protein sequences from other organisms, and their predicted function.

[0119] FIG. 3 is a diagram showing the structural organisation of the sxt gene cluster from C. raciborskii T3. Abbreviations used are: IS4, insertion sequence 4; at, aminotransferase; dint, drug metabolite transporter; ompR, transcriptional regulator of ompR family; penP, penicillin binding; smf, gene predicted to be involved in DNA uptake. The scale indicates the gene cluster length in base pairs.

[0120] FIG. 4 is a flow diagram showing the pathway for SXT biosynthesis and the putative functions of sxt genes.

[0121] FIG. 5 shows MS/MS spectra of selected ions from cellular extracts of Cylindrospermopsis raciborskii T3. The predicted fragmentation of ions and the corresponding m/z values are indicated. FIG. 5A, arginine (m/z 175); FIG. 5B, saxitoxin (m/z 300); FIG. 5C, intermediate A' (m/z 187); FIG. 5D, intermediate C' (m/z 211); FIG. 5E, intermediate E' (m/z 225).

[0122] FIG. 6 is a table showing the cyr genes from the cylindrospermopsin gene cluster of C. raciborskii AWT205, their putative length, their BLAST similarity match with similar protein sequences from other organisms, and their predicted function.

[0123] FIG. 7 is a table showing the distribution of the sulfotransferase gene (cyrJ) in toxic and non-toxic cyanobacteria. 16S rRNA gene amplification is shown as a positive control. CYLN, cylindrospermopsin; SXT, saxitoxin; N.D., not detected; +, gene fragment amplified; -, no gene detected; NA, not available; AWQC, Australian Water Quality Center.

[0124] FIG. 8 is a flow diagram showing the biosynthetic pathway of cylindrospermopsin biosynthesis.

[0125] FIG. 9 is a diagram showing the structural organization of the cylindrospermopsin gene cluster from C. raciborskii AWT205. Scale indicates gene cluster length in base pairs.

DESCRIPTION

[0126] The inventors have identified a gene cluster responsible for saxitoxin biosynthesis (the SXT gene cluster) and a gene cluster responsible for cylindrospermopsin biosynthesis (the CYR gene cluster). The full sequence of each gene cluster has been determined and functional activities assigned to each of the genes identified therein. Based on this information, the inventors have elucidated the full saxitoxin and cylindrospermopsin biosynthetic pathways.

[0127] Accordingly, the invention provides polynucleotide and polypeptide sequences derived from each of the SXT and CYR gene clusters and in particular, sequences relating to the specific genes within each pathway. Methods and kits for the detection of cyanobacterial strains in a sample are provided based on the presence (or absence) in the sample of one or more of the sequences of the invention. The inventors have determined that certain open-reading frames present in the SXT gene cluster of saxitoxin-producing microorganisms are absent in the SXT gene cluster of microorganisms that do not produce saxitoxin. Similarly, it has been discovered that one open-reading frame present in the CYR gene cluster of cylindrospermopsin-producing microorganisms is absent in non-cylindrospermopsin-producing microorganisms. Accordingly, the invention provides methods and kits for the detection of toxin-producing microorganisms.

[0128] Also provided by the invention are screening methods for the identification of compounds capable of modulating the expression or activity of proteins in the saxitoxin and/or cylindrospermopsin biosynthetic pathways.

Polynucleotides and Polypeptides

[0129] The inventors have determined the full polynucleotide sequence of the saxitoxin (SXT) gene cluster and the cylindrospermopsin (CYR) gene cluster.

[0130] In accordance with aspects and embodiments of the invention, the SXT gene cluster may have, but is not limited to, the polynucleotide sequence as set forth SEQ ID NO: 1 (GenBank accession number DQ787200), or display sufficient sequence identity thereto to hybridise to the sequence of SEQ ID NO: 1.

[0131] The SXT gene cluster comprises 31 genes and 30 intergenic regions.

[0132] Gene 1 of the SXT gene cluster is a 759 base pair (bp) nucleotide sequence set forth in SEQ ID NO: 4. The nucleotide sequence of SXT Gene 1 ranges from the nucleotide in position 1625 up to the nucleotide in position 2383 of SEQ ID NO: 1. The polypeptide sequence encoded by Gene 1 (SXTD) is set forth in SEQ ID NO: 5.

[0133] Gene 2 of the SXT gene cluster is a 396 bp nucleotide sequence set forth in SEQ ID NO: 6. The nucleotide sequence of SXT Gene 2 ranges from the nucleotide in position 2621 up to the nucleotide in position 3016 of SEQ ID NO: 1. The polypeptide sequence encoded by Gene 2 (ORF3) is set forth in SEQ ID NO: 7.

[0134] Gene 3 of the SXT gene cluster is a 360 bp nucleotide sequence set forth in SEQ ID NO: 8. The nucleotide sequence of SXT Gene 3 ranges from the nucleotide in position 2955 up to the nucleotide in position 3314 of SEQ ID NO: 1. The polypeptide sequence encoded by Gene 3 (ORF4) is set forth in SEQ ID NO: 9.

[0135] Gene 4 of the SXT gene cluster is a 354 bp nucleotide sequence set forth in SEQ ID NO: 10. The nucleotide sequence of SXT Gene 4 ranges from the nucleotide in position 3647 up to the nucleotide in position 4000 of SEQ ID NO: 1. The polypeptide sequence encoded by Gene 4 (SXTC) is set forth in SEQ ID NO: 11.

[0136] Gene 5 of the SXT gene cluster is a 957 bp nucleotide sequence set forth in SEQ ID NO: 12. The nucleotide sequence of SXT Gene 5 ranges from the nucleotide in position 4030 up to the nucleotide in position 4986 of SEQ ID NO: 1. The polypeptide sequence encoded by Gene 5 (SXTB) is set forth in SEQ ID NO: 13.

[0137] Gene 6 of the SXT gene cluster is a 3738 bp nucleotide sequence set forth in SEQ ID NO: 14. The nucleotide sequence of SXT Gene 6 ranges from the nucleotide in position 5047 up to the nucleotide in position 8784 of SEQ ID NO: 1. The polypeptide sequence encoded by Gene 6 (SXTA) is set forth in SEQ ID NO: 15.

[0138] Gene 7 of the SXT gene cluster is a 387 bp nucleotide sequence set forth in SEQ ID NO: 16. The nucleotide sequence of SXT Gene 7 ranges from the nucleotide in position 9140 up to the nucleotide in position 9526 of SEQ ID NO: 1. The polypeptide sequence encoded by Gene 7 (SXTE) is set forth in SEQ ID NO: 17.

[0139] Gene 8 of the SXT gene cluster is a 1416 bp nucleotide sequence set forth in SEQ ID NO: 18. The nucleotide sequence of SXT Gene 8 ranges from the nucleotide in position 9686 up to the nucleotide in position 11101 of SEQ ID NO: 1. The polypeptide sequence encoded by Gene 8 (SXTF) is set forth in SEQ ID NO: 19.

[0140] Gene 9 of the SXT gene cluster is an 1134 bp nucleotide sequence set forth in SEQ ID NO: 20. The nucleotide sequence of SXT Gene 9 ranges from the nucleotide in position 11112 up to the nucleotide in position 12245 of SEQ ID NO: 1. The polypeptide sequence encoded by SXT Gene 9 (SXTG) is set forth in SEQ ID NO: 21.

[0141] Gene 10 of the SXT gene cluster is a 1005 bp nucleotide sequence set forth in SEQ ID NO: 22. The nucleotide sequence of SXT Gene 10 ranges from the nucleotide in position 12314 up to the nucleotide in position 13318 of SEQ ID NO: 1. The polypeptide sequence encoded by Gene 10 (SXTH) is set forth in SEQ ID NO: 23.

[0142] Gene 11 of the SXT gene cluster is an 1839 bp nucleotide sequence set forth in SEQ ID NO: 24. The nucleotide sequence of SXT Gene 11 ranges from the nucleotide in position 13476 up to the nucleotide in position 15314 of SEQ ID NO: 1. The polypeptide sequence encoded by Gene 11 (SXTI) is set forth in SEQ ID NO: 25.

[0143] Gene 12 of the SXT gene cluster is a 444 bp nucleotide sequence set forth in SEQ ID NO: 26. The nucleotide sequence of SXT Gene 12 ranges from the nucleotide in position 15318 up to the nucleotide in position 15761 of SEQ ID NO: 1. The polypeptide sequence encoded by Gene 12 (SXTJ) is set forth in SEQ ID NO: 27.

[0144] Gene 13 of the SXT gene cluster is a 165 bp nucleotide sequence set forth in SEQ ID NO: 28. The nucleotide sequence of SXT Gene 13 ranges from the nucleotide in position 15761 up to the nucleotide in position 15925 of SEQ ID NO: 1. The polypeptide sequence encoded by Gene 13 (SXTK) is set forth in SEQ ID NO: 29.

[0145] Gene 14 of the SXT gene cluster is a 1299 bp nucleotide sequence set forth in SEQ ID NO: 30. The nucleotide sequence of SXT Gene 14 ranges from the nucleotide in position 15937 up to the nucleotide in position 17235 of SEQ ID NO: 1. The polypeptide sequence encoded by Gene 14 (SXTL) is set forth in SEQ ID NO: 31.

[0146] Gene 15 of the SXT gene cluster is a 1449 bp nucleotide sequence set forth in SEQ ID NO: 32. The nucleotide sequence of SXT Gene 15 ranges from the nucleotide in position 17323 up to the nucleotide in position 18771 of SEQ ID NO: 1. The polypeptide sequence encoded by Gene 16 (SXTM) is set forth in SEQ ID NO: 33.

[0147] Gene 16 of the SXT gene cluster is an 831 bp nucleotide sequence set forth in SEQ ID NO: 34. The nucleotide sequence of SXT Gene 16 ranges from the nucleotide in position 19119 up to the nucleotide in position 19949 of SEQ ID NO: 1. The polypeptide sequence encoded by Gene 16 (SXTN) is set forth in SEQ ID NO: 35.

[0148] Gene 17 of the SXT gene cluster is a 774 bp nucleotide sequence set forth in SEQ ID NO: 36. The nucleotide sequence of SXT Gene 17 ranges from the nucleotide in position 20238 up to the nucleotide in position 21011 of SEQ ID NO: 1. The polypeptide sequence encoded by Gene 17 (SXTX) is set forth in SEQ ID NO: 37.

[0149] Gene 18 of the SXT gene cluster is a 327 bp nucleotide sequence set forth in SEQ ID NO: 38. The nucleotide sequence of SXT Gene 18 ranges from the nucleotide in position 21175 up to the nucleotide in position 21501 of SEQ ID NO: 1. The polypeptide sequence encoded by Gene 18 (SXTW) is set forth in SEQ ID NO: 39.

[0150] Gene 19 of the SXT gene cluster is a 1653 bp nucleotide sequence set forth in SEQ ID NO: 40. The nucleotide sequence of SXT Gene 219 ranges from the nucleotide in position 21542 up to the nucleotide in position 23194 of SEQ ID NO: 1. The polypeptide sequence encoded by Gene 19 (SXTV) is set forth in SEQ ID NO: 41.

[0151] Gene 20 of the SXT gene cluster is a 750 bp nucleotide sequence set forth in SEQ ID NO: 42. The nucleotide sequence of SXT Gene 20 ranges from the nucleotide in position 23199 up to the nucleotide in position 23948 of SEQ ID NO: 1. The polypeptide sequence encoded by Gene 20 (SXTU) is set forth in SEQ ID NO: 43.

[0152] Gene 21 of the SXT gene cluster is a 1005 bp nucleotide sequence set forth in SEQ ID NO: 44. The nucleotide sequence of SXT Gene 21 ranges from the nucleotide in position 24091 up to the nucleotide in position 25095 of SEQ ID NO: 1. The polypeptide sequence encoded by Gene 21 (SXTT) is set forth in SEQ ID NO: 45.

[0153] Gene 22 of the SXT gene cluster is a 726 bp nucleotide sequence set forth in SEQ ID NO: 46. The nucleotide sequence of SXT Gene 22 ranges from the nucleotide in position 25173 up to the nucleotide in position 25898 of SEQ ID NO: 1. The polypeptide sequence encoded by Gene 22 (SXTS) is set forth in SEQ ID NO: 47.

[0154] Gene 23 of the SXT gene cluster is a 576 bp nucleotide sequence set forth in SEQ ID NO: 48. The nucleotide sequence of SXT Gene 23 ranges from the nucleotide in position 25974 up to the nucleotide in position 26549 of SEQ ID NO: 1. The polypeptide sequence encoded by Gene 23 (ORF24) is set forth in SEQ ID NO: 49.

[0155] Gene 24 of the SXT gene cluster is a 777 bp nucleotide sequence set forth in SEQ ID NO: 50. The nucleotide sequence of SXT Gene 24 ranges from the nucleotide in position 26605 up to the nucleotide in position 27381 of SEQ ID NO: 1. The polypeptide sequence encoded by Gene 24 (SXTR) is set forth in SEQ ID NO: 51.

[0156] Gene 25 of the SXT gene cluster is a 777 bp nucleotide sequence set forth in SEQ ID NO: 52. The nucleotide sequence of SXT Gene 25 ranges from the nucleotide in position 27392 up to the nucleotide in position 28168 of SEQ ID NO: 1. The polypeptide sequence encoded by Gene 25 (SXTQ) is set forth in SEQ ID NO: 53.

[0157] Gene 26 of the SXT gene cluster is a 1227 bp nucleotide sequence set forth in SEQ ID NO: 54. The nucleotide sequence of SXT Gene 26 ranges from the nucleotide in position 28281 up to the nucleotide in position 29507 of SEQ ID NO: 1. The polypeptide sequence encoded by Gene 26 (SXTP) is set forth in SEQ ID NO: 55.

[0158] Gene 27 of the SXT gene cluster is a 603 bp nucleotide sequence set forth in SEQ ID NO: 56. The nucleotide sequence of SXT Gene 27 ranges from the nucleotide in position 29667 up to the nucleotide in position 30269 of SEQ ID NO: 1. The polypeptide sequence encoded by Gene 27 (SXTO) is set forth in SEQ ID NO: 57.

[0159] Gene 28 of the SXT gene cluster is a 1350 bp nucleotide sequence set forth in SEQ ID NO: 58. The nucleotide sequence of SXT Gene 28 ranges from the nucleotide in position 30612 up to the nucleotide in position 31961 of SEQ ID NO: 1. The polypeptide sequence encoded by Gene 28 (ORF29) is set forth in SEQ ID NO: 59.

[0160] Gene 29 of the SXT gene cluster is a 666 bp nucleotide sequence set forth in SEQ ID NO: 60. The nucleotide sequence of SXT Gene 29 ranges from the nucleotide in position 32612 up to the nucleotide in position 33277 of SEQ ID NO: 1. The polypeptide sequence encoded by Gene 29 (SXTY) is set forth in SEQ ID NO: 61.

[0161] Gene 30 of the SXT gene cluster is a 1353 bp nucleotide sequence set forth in SEQ ID NO: 62. The nucleotide sequence of SXT Gene 30 ranges from the nucleotide in position 33325 up to the nucleotide in position 34677 of SEQ ID NO: 1. The polypeptide sequence encoded by Gene 30 (SXTZ) is set forth in SEQ ID NO: 63.

[0162] Gene 31 of the SXT gene cluster is an 819 bp nucleotide sequence set forth in SEQ ID NO: 64. The nucleotide sequence of SXT Gene 31 ranges from the nucleotide in position 35029 up to the nucleotide in position 35847 of SEQ ID NO: 1. The polypeptide sequence encoded by Gene 31 (OMPR) is set forth in SEQ ID NO: 65.

[0163] The 5' border region of SXT gene cluster comprises a 1320 bp gene (orfl), the sequence of which is set forth in SEQ ID NO: 2. The nucleotide sequence of orfl ranges from the nucleotide in position 1 up to the nucleotide in position 1320 of SEQ ID NO: 1. The polypeptide sequence encoded by orfl is set forth in SEQ ID NO: 3.

[0164] The 3' border region of SXT gene cluster comprises a 774 bp gene (hisA), the sequence of which is set forth in SEQ ID NO: 66. The nucleotide sequence of hisA ranges from the nucleotide in position 35972 up to the nucleotide in position 36745 of SEQ ID NO: 1. The polypeptide sequence encoded by hisA is set forth in SEQ ID NO: 67.

[0165] The 3' border region of SXT gene cluster also comprises a 396 bp gene (orfA), the sequence of which is set forth in SEQ ID NO: 68. The nucleotide sequence of orfA ranges from the nucleotide in position 37060 up to the nucleotide in position 37455 of SEQ ID NO: 1. The polypeptide sequence encoded by orfA is set forth in SEQ ID NO: 69.

[0166] In accordance with other aspects and embodiments of the invention, the CYR gene cluster may have, but is not limited to, the nucleotide sequence as set forth SEQ ID NO: 80 (GenBank accession number EU140798), or display sufficient sequence identity thereto to hybridise to the sequence of SEQ ID NO: 80.

[0167] The CYR gene cluster comprises 15 genes and 14 intergenic regions.

[0168] Gene 1 of the CYR gene cluster is a 5631 bp nucleotide sequence set forth in SEQ ID NO: 81. The nucleotide sequence of CYR Gene 1 ranges from the nucleotide in position 444 up to the nucleotide in position 6074 of SEQ ID NO: 80. The polypeptide sequence encoded by Gene 1 (CYRD) is set forth in SEQ ID NO: 82.

[0169] Gene 2 of the CYR gene cluster is a 4074 bp nucleotide sequence set forth in SEQ ID NO: 83. The nucleotide sequence of CYR Gene 2 ranges from the nucleotide in position 6130 up to the nucleotide in position 10203 of SEQ ID NO: 80. The polypeptide sequence encoded by Gene 2 (CYRF) is set forth in SEQ ID NO: 84.

[0170] Gene 3 of the CYR gene cluster is a 1437 bp nucleotide sequence set forth in SEQ ID NO: 85. The nucleotide sequence of CYR Gene 3 ranges from the nucleotide in position 10251 up to the nucleotide in position 11687 of SEQ ID NO: 80. The polypeptide sequence encoded by Gene 3 (CYRG) is set forth in SEQ ID NO: 86.

[0171] Gene 4 of the CYR gene cluster is an 831 bp nucleotide sequence set forth in SEQ ID NO: 87. The nucleotide sequence of CYR Gene 4 ranges from the nucleotide in position 11741 up to the nucleotide in position 12571 of SEQ ID NO: 80. The polypeptide sequence encoded by Gene 4 (CYRI) is set forth in SEQ ID NO: 88.

[0172] Gene 5 of the CYR gene cluster is a 1398 bp nucleotide sequence set forth in SEQ ID NO: 89. The nucleotide sequence of CYR Gene 5 ranges from the nucleotide in position 12568 up to the nucleotide in position 13965 of SEQ ID NO: 80. The polypeptide sequence encoded by Gene 5 (CYRK) is set forth in SEQ ID NO: 90.

[0173] Gene 6 of the CYR gene cluster is a 750 bp nucleotide sequence set forth in SEQ ID NO: 91. The nucleotide sequence of CYR Gene 6 ranges from the nucleotide in position 14037 up to the nucleotide in position 14786 of SEQ ID NO: 80. The polypeptide sequence encoded by Gene 6 (CYRL) is set forth in SEQ ID NO: 92.

[0174] Gene 7 of the CYR gene cluster is a 1431 bp nucleotide sequence set forth in SEQ ID NO: 93. The nucleotide sequence of CYR Gene 7 ranges from the nucleotide in position 14886 up to the nucleotide in position 16316 of SEQ ID NO: 80. The polypeptide sequence encoded by Gene 7 (CYRH) is set forth in SEQ ID NO: 94.

[0175] Gene 8 of the CYR gene cluster is a 780 bp nucleotide sequence set forth in SEQ ID NO: 95. The nucleotide sequence of CYR Gene 8 ranges from the nucleotide in position 16893 up to the nucleotide in position 17672 of SEQ ID NO: 80. The polypeptide sequence encoded by Gene 8 (CYRJ) is set forth in SEQ ID NO: 96.

[0176] Gene 9 of the CYR gene cluster is an 1176 bp nucleotide sequence set forth in SEQ ID NO: 97. The nucleotide sequence of CYR Gene 9 ranges from the nucleotide in position 18113 up to the nucleotide in position 19288 of SEQ ID NO: 80. The polypeptide sequence encoded by Gene 9 (CYR) is set forth in SEQ ID NO: 98.

[0177] Gene 10 of the CYR gene cluster is an 8754 bp nucleotide sequence set forth in SEQ ID NO: 99. The nucleotide sequence of CYR Gene 10 ranges from the nucleotide in position 19303 up to the nucleotide in position 28056 of SEQ ID NO: 80. The polypeptide sequence encoded by Gene 10 (CYRB) is set forth in SEQ ID NO: 100.

[0178] Gene 11 of the CYR gene cluster is a 5667 bp nucleotide sequence set forth in SEQ ID NO: 101. The nucleotide sequence of CYR Gene 11 ranges from the nucleotide in position 28061 up to the nucleotide in position 33727 of SEQ ID NO: 80. The polypeptide sequence encoded by Gene 11 (CPRE) is set forth in SEQ ID NO: 102.

[0179] Gene 12 of the CYR gene cluster is a 5004 bp nucleotide sequence set forth in SEQ ID NO: 103. The nucleotide sequence of CYR Gene 12 ranges from the nucleotide in position 34299 up to the nucleotide in position 39302 of SEQ ID NO: 80. The polypeptide sequence encoded by Gene 12 (CYRC) is set forth in SEQ ID NO: 104.

[0180] Gene 13 of the CYR gene cluster is a 318 bp nucleotide sequence set forth in SEQ ID NO: 105. The nucleotide sequence of CYR Gene 13 ranges from the nucleotide in position 39366 up to the nucleotide in position 39683 of SEQ ID NO: 80. The polypeptide sequence encoded by Gene 13 (CYRM) is set forth in SEQ ID NO: 106.

[0181] Gene 14 of the CYR gene cluster is a 600 bp nucleotide sequence set forth in SEQ ID NO: 107. The nucleotide sequence of CYR Gene 14 ranges from the nucleotide in position 39793 up to the nucleotide in position 40392 of SEQ ID NO: 80. The polypeptide sequence encoded by Gene 14 (CYRN) is set forth in SEQ ID NO: 108.

[0182] Gene 15 of the CYR gene cluster is a 1548 bp nucleotide sequence set forth in SEQ ID NO: 109. The nucleotide sequence of CYR Gene 15 ranges from the nucleotide in position 40501 up to the nucleotide in position 42048 of SEQ ID NO: 80. The polypeptide sequence encoded by Gene 15 (GYRO) is set forth in SEQ ID NO: 110.

[0183] In general, the nucleic acids and polypeptides of the invention are of an isolated or purified form.

[0184] In addition to the SXT and CYR polynucleotides and polypeptide sequences set forth herein, also included within the scope of the present invention are variants and fragments thereof.

[0185] SXT and CYR polynucleotides disclosed herein may be deoxyribonucleic acids (DNA), ribonucleic acids (RNA) or complementary deoxyribonucleic acids (cDNA).

[0186] RNA may be derived from RNA polymerase-catalyzed transcription of a DNA sequence. The RNA may be a primary transcript derived transcription of a corresponding DNA sequence. RNA may also undergo post-transcriptional processing. For example, a primary RNA transcript may undergo post-transcriptional processing to form a mature RNA. Messenger RNA (mRNA) refers to RNA derived from a corresponding open reading frame that may be translated into protein by the cell. cDNA refers to a double-stranded DNA that is complementary to and derived from mRNA. Sense RNA refers to RNA transcript that includes the mRNA and so can be translated into protein by the cell. Antisense RNA refers to an RNA transcript that is complementary to all or part of a target primary transcript or mRNA and may be used to block the expression of a target gene.

[0187] The skilled addresse will recognise that RNA and cDNA sequences encoded by the SXT and CYR DNA sequences disclosed herein may be derived using the genetic code. An RNA sequence may be derived from a given DNA sequence by generating a sequence that is complementary the particular DNA sequence. The complementary sequence may be generated by converting each cytosine (`C`) base in the DNA sequence to a guanine (`G`) base, each guanine (`G`) base in the DNA sequence to a cytosine (`C`) base, each thymidine (`T`) base in the DNA sequence to an adenine (`A`) base, and each adenine (`A`) base in the DNA sequence to a uracil (`U`) base.

[0188] A complementary DNA (cDNA) sequence may be derived from a DNA sequence by deriving an RNA sequence from the DNA sequence as above, then converting the RNA sequence into a cDNA sequence. An RNA sequence can be converted into a Cdna sequence by converting each cytosine (`C`) base in the RNA sequence to a guanine (`G`) base, each guanine (`G`) base in the RNA sequence to a cytosine (`C`) base, each uracil (`U`) base in the RNA sequence to an adenine (`A`) base, and each adeneine (`A`) base in the RNA sequence to a thymidine (T`) base.

[0189] The term "variant" as used herein refers to a substantially similar sequence. In general, two sequences are "substantially similar" if the two sequences have a specified percentage of amino acid residues or nucleotides that are the same (percentage of "sequence identity"), over a specified region, or, when not specified, over the entire sequence. Accordingly, a "variant" of a polynucleotide and polypeptide sequence disclosed herein may share at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 83% 85%, 88%, 90%, 93%, 95%, 96%, 97%, 98% or 99% sequence identity with the reference sequence.

[0190] In general, polypeptide sequence variants possess qualitative biological activity in common. Polynucleotide sequence variants generally encode polypeptides which generally possess qualitative biological activity in common. Also included within the meaning of the term "variant" are homologues of polynucleotides and polypeptides of the invention. A polynucleotide homologue is typically from a different bacterial species but sharing substantially the same biological function or activity as the corresponding polynucleotide disclosed herein. A polypeptide homologue is typically from a different bacterial species but sharing substantially the same biological function or activity as the corresponding polypeptide disclosed herein. For example, homologues of the polynucleotides and polypeptides disclosed herein include, but are not limited to those from different species of cyanobacteria.

[0191] Further, the term "variant" also includes analogues of the polypeptides of the invention. A polypeptide "analogue" is a polypeptide which is a derivative of a polypeptide of the invention, which derivative comprises addition, deletion, substitution of one or more amino acids, such that the polypeptide retains substantially the same function. The term "conservative amino acid substitution" refers to a substitution or replacement of one amino acid for another amino acid with similar properties within a polypeptide chain (primary sequence of a protein). For example, the substitution of the charged amino acid glutamic acid (Glu) for the similarly charged amino acid aspartic acid (Asp) would be a conservative amino acid substitution.

[0192] In general, the percentage of sequence identity between two sequences may be determined by comparing two optimally aligned sequences over a comparison window.

[0193] The portion of the sequence in the comparison window may, for example, comprise deletions or additions (i.e. gaps) in comparison to the reference sequence (for example, a polynucleotide or polypeptide sequence disclosed herein), which does not comprise deletions or additions, in order to align the two sequences optimally. A percentage of sequence identity may then be calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison, and multiplying the result by 100 to yield the percentage of sequence identity.

[0194] In the context of two or more nucleic acid or polypeptide sequences, the percentage of sequence identity refers to the specified percentage of amino acid residues or nucleotides that are the same over a specified region, (or, when not specified, over the entire sequence), when compared and aligned for maximum correspondence over a comparison window, or designated region as measured using one of the following sequence comparison algorithms or by manual alignment and visual inspection.

[0195] For sequence comparison, typically one sequence acts as a reference sequence, to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. Default program parameters can be used, or alternative parameters can be designated. The sequence comparison algorithm then calculates the percent sequence identities for the test sequences relative to the reference sequence, based on the program parameters. Methods of alignment of sequences for comparison are well known in the art. Optimal alignment of sequences for comparison can be determined conventionally using known computer programs, including, but not limited to: CLUSTAL in the PC/Gene program (available from Intelligenetics, Mountain View, Calif.); the ALIGN program (Version 2.0) and GAP, BESTFIT, BLAST, FASTA, and TFASTA in the GCG Wisconsin Genetics Software Package, Version 10 (available from Accelrys Inc., 9685 Scranton Road, San Diego, Calif., USA).

[0196] The BESTFIT program (Wisconsin Sequence Analysis Package, for Unix, Genetics Computer Group, University Research Park, 575 Science Drive, Madison, Wis. 53711) uses the local homology algorithm of Smith and Waterman to find the best segment of homology between two sequences (Smith and Waterman, Advances in Applied Mathematics 2:482-489 (1981)). When using BESTFIT or any other sequence alignment program to determine the degree of homology between sequences, the parameters may be set such that the percentage of identity is calculated over the full length of the reference nucleotide sequence and that gaps in homology of up to 5% of the total number of nucleotides in the reference sequence are allowed.

[0197] GAP uses the algorithm described in Needleman and Wunsch (1970) J. Mol. Biol. 48:443-453, to find the alignment of two complete sequences that maximizes the number of matches and minimizes the number of gaps. GAP considers all possible alignments and gap positions and creates the alignment with the largest number of matched bases and the fewest gaps. It allows for the provision of a gap creation penalty and a gap extension penalty in units of matched bases. GAP presents one member of the family of best alignments.

[0198] Another method for determining the best overall match between a query sequence and a subject sequence, also referred to as a global sequence alignment, can be determined using the FASTDB computer program based on the algorithm of Brutlag and colleagues (Comp. App. Biosci. 6:237-245 (1990)). In a sequence alignment the query and subject sequences are both DNA sequences. An RNA sequence can be compared by converting U's to T's. The result of said global sequence alignment is in percent identity.

[0199] The BLAST and BLAST 2.0 algorithms, may be used for determining percent sequence identity and sequence similarity. These are described in Altschul et al. (1977) Nuc. Acids Res. 25:3389-3402, and Altschul et al (1990) J. Mol. Biol. 215:403-410, respectively. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information. This algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighborhood word score threshold (Altschul et al., supra). These initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them. The word hits are extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always >0) and N (penalty score for mismatching residues; always <0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score. Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences) uses as defaults a wordlength (W) of 11, an expectation (E) or 10, M=5, N=-4 and a comparison of both strands. For amino acid sequences, the BLASTP program uses as defaults a wordlength of 3, and expectation (E) of 10, and the BLOSUM62 scoring matrix (see Henikoff and Henikoff (1989) Proc. Natl. Acad. Sci USA 89:10915) alignments (B) of 50, expectation (E) of 10, M=5, N=-4, and a comparison of both strands. [0028] The BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873-5787). One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance. For example, a nucleic acid is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid to the reference nucleic acid is less than about 0.2, more preferably less than about 0.01, and most preferably less than about 0.001.

[0200] The invention also contemplates fragments of the polypeptides disclosed herein. A polypeptide "fragment" is a polypeptide molecule that encodes a constituent or is a constituent of a polypeptide of the invention or variant thereof. Typically the fragment possesses qualitative biological activity in common with the polypeptide of which it is a constituent. The peptide fragment may be between about 5 to about 3000 amino acids in length, between about 5 to about 2750 amino acids in length, between about 5 to about 2500 amino acids in length, between about 5 to about 2250 amino acids in length, between about 5 to about 2000 amino acids in length, between about 5 to about 1750 amino acids in length, between about 5 to about 1500 amino acids in length, between about 5 to about 1250 amino acids in length, between about 5 to about 1000 amino acids in length, between about 5 to about 900 amino acids in length, between about 5 to about 800 amino acids in length, between about 5 to about 700 amino acids in length, between about 5 to about 600 amino acids in length, between about 5 to about 500 amino acids in length, between about 5 to about 450 amino acids in length, between about 5 to about 400 amino acids in length, between about 5 to about 350 amino acids in length, between about 5 to about 300 amino acids in length, between about 5 to about 250 amino acids in length, between about 5 to about 200 amino acids in length, between about 5 to about 175 amino acids in length, between about 5 to about 150 amino acids in length, between about 5 to about 125 amino acids in length, between about 5 to about 100 amino acids in length, between about 5 to about 75 amino acids in length, between about 5 to about 50 amino acids in length, between about 5 to about 40 amino acids in length, between about 5 to about 30 amino acids in length, between about 5 to about 20 amino acids in length, and between about 5 to about 15 amino acids in length. Alternatively, the peptide fragment may be between about 5 to about 10 amino acids in length.

[0201] Also contemplated are fragments of the polynucleotides disclosed herein. A polynucleotide "fragment" is a polynucleotide molecule that encodes a constituent or is a constituent of a polynucleotide of the invention or variant thereof. Fragments of a polynucleotide do not necessarily need to encode polypeptides which retain biological activity. The fragment may, for example, be useful as a hybridization probe or PCR primer. The fragment may be derived from a polynucleotide of the invention or alternatively may be synthesized by some other means, for example by chemical synthesis.

[0202] Certain embodiments of the invention relate to fragments of SEQ ID NO: 1. A fragment of SEQ ID NO: 1 may comprise, for example, a constituent of SEQ ID NO: 1 in which the 5' gene border region gene orfl is absent. Alternatively, a fragment of SEQ ID NO: 1 may comprise, for example, a constituent of SEQ ID NO: 1 in which the 3' gene border region gene hisA is absent. Alternatively, a fragment of SEQ ID NO: 1 may comprise, for example, a constituent of SEQ ID NO: 1 in which the 3' gene border region gene orfA is absent. Alternatively, a fragment of SEQ ID NO: 1 may comprise, for example, a constituent of SEQ ID NO: 1 in which the 5' gene border region gene orfl is absent and the 3' border region gene orfA is absent. Alternatively, a fragment of SEQ ID NO: 1 may comprise, for example, a constituent of SEQ ID NO: 1 in which the 5' gene border region gene orfl is absent and the 3' border region genes hisA and orfA are absent.

[0203] In other embodiments, a fragment of SEQ ID NO: 1 may comprise one or more SXT open reading frames. The SXT open reading frame may be selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, and variants thereof.

[0204] Additional embodiments of the invention relate to fragments of SEQ ID NO: 80. The fragment of SEQ ID NO: 80 may comprise one or more CYR open reading frames. The CYR open reading frame may be selected from the group consisting of SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, and variants thereof.

[0205] In particular embodiments, the polynucleotides of the invention may be cloned into a vector. The vector may comprise, for example, a DNA, RNA or complementary DNA (cDNA) sequence. The vector may be a plasmid vector, a viral vector, or any other suitable vehicle adapted for the insertion of foreign sequences, their introduction into cells and the expression of the introduced sequences. Typically the vector is an expression vector and may include expression control and processing sequences such as a promoter, an enhancer, ribosome binding sites, polyadenylation signals and transcription termination sequences. The invention also contemplates host cells transformed by such vectors. For example, the polynucleotides of the invention may be cloned into a vector which is transformed into a bacterial host cell, for example E. coli. Methods for the construction of vectors and their transformation into host cells are generally known in the art, and described in, for example, Molecular Cloning: A Laboratory Manual (2nd ed., Cold Spring Harbor Laboratory Press, Plainview, N.Y., and, Ausubel F. M. et al. (Eds) Current Protocols in Molecular Biology (2007), John Wiley and Sons, Inc.

Nucleotide Probes, Primers and Antibodies

[0206] The invention contemplates nucleotides and fragments based on the sequences of the polynucleotides disclosed herein for use as primers and probes for the identification of homologous sequences.

[0207] The nucleotides and fragments may be in the form of oligonucleotides. Oligonucleotides are short stretches of nucleotide residues suitable for use in nucleic acid amplification reactions such as PCR, typically being at least about 5 nucleotides to about 80 nucleotides in length, more typically about 10 nucleotides in length to about 50 nucleotides in length, and even more typically about 15 nucleotides in length to about 30 nucleotides in length.

[0208] Probes are nucleotide sequences of variable length, for example between about 10 nucleotides and several thousand nucleotides, for use in detection of homologous sequences, typically by hybridization. Hybridization probes may be genomic DNA fragments, cDNA fragments, RNA fragments, or other oligonucleotides.

[0209] Methods for the design and/or production of nucleotide probes and/or primers are generally known in the art, and are described in Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual (2nd ed., Cold Spring Harbor Laboratory Press, Plainview, N.Y.; Itakura K. et al. (1984) Annu. Rev. Biochem. 53:323; Innis et al., (Eds) (1990) PCR Protocols: A Guide to Methods and Applications (Academic Press, New York); Innis and Gelfand, (Eds) (1995) PCR Strategies (Academic Press, New York); and Innis and Gelfand, (Eds) (1999) PCR Methods Manual (Academic Press, New York). Nucleotide primers and probes may be prepared, for example, by chemical synthesis techniques for example, the phosphodiester and phosphotriester methods (see for example Narang S. A. et al. (1979) Meth. Enzymol. 68:90; Brown, E. L. (1979) et al. Meth. Enzymol. 68:109; and U.S. Pat. No. 4,356,270), the diethylphosphoramidite method (see Beaucage S. L. et al. (1981) Tetrahedron Letters, 22:1859-1862). A method for synthesizing oligonucleotides on a modified solid support is described in U.S. Pat. No. 4,458,066.

[0210] The nucleic acids of the invention, including the above-mentioned probes and primers, may be labelled by incorporation of a marker to facilitate their detection. Techniques for labelling and detecting nucleic acids are described, for example, in Ausubel F. M. et al. (Eds) Current Protocols in Molecular Biology (2007), John Wiley and Sons, Inc.

[0211] Examples of suitable markers include fluorescent molecules (e.g. acetylaminofluorene, bromodeoxyuridine, digoxigenin, fluorescein) and radioactive isotopes (e.g. 32P, 35S, 3H, 33P). Detection of the marker may be achieved, for example, by chemical, photochemical, immunochemical, biochemical, or spectroscopic techniques.

[0212] The probes and primers of the invention may be used, for example, to detect or isolate cyanobacteria and/or dinoflagellates in a sample of interest. Additionally or alternatively, the probes and primers of the invention may be used to detect or isolate a cyanotoxic organism and/or a cylindrospermopisn-producing organism in a sample of interest. Additionally or alternatively, the probes or primers of the invention may be used to isolate corresponding sequences in other organisms including, for example, other bacterial species. Methods such as the polymerase chain reaction (PCR), hybridization, and the like can be used to identify such sequences based on their sequence homology to the sequences set forth herein. Sequences that are selected based on their sequence identity to the entire sequences set forth herein or to fragments thereof are encompassed by the embodiments. Such sequences include sequences that are orthologs of the disclosed sequences. The term "orthologs" refers to genes derived from a common ancestral gene and which are found in different species as a result of speciation. Genes found in different species are considered orthologs when their nucleotide sequences and/or their encoded protein sequences share substantial identity as defined elsewhere herein. Functions of orthologs are often highly conserved among species.

[0213] In hybridization techniques, all or part of a known nucleotide sequence is used to generate a probe that selectively hybridizes to other corresponding nucleic acid sequences present in a given sample. The hybridization probes may be genomic DNA fragments, cDNA fragments, RNA fragments, or other oligonucleotides, and may be labelled with a detectable marker. Thus, for example, probes for hybridization can be made by labelling synthetic oligonucleotides based on the sequences of the invention.

[0214] The level of homology (sequence identity) between probe and the target sequence will largely be determined by the stringency of hybridization conditions. In particular the nucleotide sequence used as a probe may hybridize to a homologue or other variant of a polynucleotide disclosed herein under conditions of low stringency, medium stringency or high stringency. There are numerous conditions and factors, well known to those skilled in the art, which may be employed to alter the stringency of hybridization. For instance, the length and nature (DNA, RNA, base composition) of the nucleic acid to be hybridized to a specified nucleic acid; concentration of salts and other components, such as the presence or absence of formamide, dextran sulfate, polyethylene glycol etc; and altering the temperature of the hybridization and/or washing steps.

[0215] Typically, stringent hybridization conditions will be those in which the salt concentration is less than about 1.5 M Na ion, typically about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30.degree. C. for short probes (e.g., 10 to 50 nucleotides) and at least about 60.degree. C. for long probes (e.g., greater than 50 nucleotides). Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide. Exemplary low stringency conditions include hybridization with a buffer solution of 30% to 35% formamide, 1 M NaCl, 1% SDS (sodium dodecyl sulfate) at 37.degree. C., and a wash in 1.times. to 2.times.SSC (20.times.SSC=3.0 M NaCl/0.3 M trisodium citrate) at 50.degree. C. to 55.degree. C. Exemplary moderate stringency conditions include hybridization in 40% to 45% formamide, 1.0 M NaCl, 1% SDS at 37.degree. C., and a wash in 0.5.times. to 1.times.SSC at 55.degree. C. to 60.degree. C. Exemplary high stringency conditions include hybridization in 50% formamide, 1 M NaCl, 1% SDS at 37.degree. C., and a final wash in 0.1.times.SSC at 60.degree. C. to 65.degree. C. for at least about 20 minutes. Optionally, wash buffers may comprise about 0.1% to about 1% SDS. The duration of hybridization is generally less than about 24 hours, usually about 4 to about 12 hours.

[0216] Under a PCR approach, oligonucleotide primers can be designed for use in PCR reactions to amplify corresponding DNA sequences from cDNA or genomic DNA extracted from any organism of interest. Methods for designing PCR primers and PCR cloning are generally known in the art and are disclosed in Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual (2nd ed., Cold Spring Harbor Laboratory Press, Plainview, N.Y.); Ausubel F. M. et al. (Eds) Current Protocols in Molecular Biology (2007), John Wiley and Sons, Inc; Maniatis et al. Molecular Cloning (1982), 280-281; Innis et al. (Eds) (1990) PCR Protocols: A Guide to Methods and Applications (Academic Press, New York); Innis and Gelfand, (Eds) (1995) PCR Strategies (Academic Press, New York); and Innis and Gelfand, (Eds) (1999) PCR Methods Manual (Academic Press, New York). Known methods of PCR include, but are not limited to, methods using paired primers, nested primers, single specific primers, degenerate primers, gene-specific primers, vector-specific primers, partially-mismatched primers, and the like.

[0217] The skilled addressee will recognise that the primers described herein for use in PCR or RT-PCR may also be used as probes for the detection of SXT or CYR sequences.

[0218] Also contemplated by the invention are antibodies which are capable of binding specifically to the polypeptides of the invention. The antibodies may be used to qualitatively or quantitatively detect and analyse one or more SXT or CYR polypeptides in a given sample. By "binding specifically" it will be understood that the antibody is capable of binding to the target polypeptide or fragment thereof with a higher affinity than it binds to an unrelated protein. For example, the antibody may bind to the polypeptide or fragment thereof with a binding constant in the range of at least about 10.sup.-4M to about 10.sup.-10M. Preferably the binding constant is at least about 10.sup.-5M, or at least about 10.sup.-6M, more preferably the binding constant of the antibody to the SXT or CYR polypeptide or fragment thereof is at least about 10.sup.-7M, at least about 10.sup.-8M, or at least about 10.sup.-9M or more.

[0219] Antibodies of the invention may exist in a variety of forms, including for example as a whole antibody, or as an antibody fragment, or other immunologically active fragment thereof, such as complementarity determining regions. Similarly, the antibody may exist as an antibody fragment having functional antigen-binding domains, that is, heavy and light chain variable domains. Also, the antibody fragment may exist in a form selected from the group consisting of, but not limited to: Fv, F.sub.ab, F(ab).sub.2, say (single chain Fv), dAb (single domain antibody), chimeric antibodies, bi-specific antibodies, diabodies and triabodies.

[0220] An antibody `fragment` may be produced by modification of a whole antibody or by synthesis of the desired antibody fragment. Methods of generating antibodies, including antibody fragments, are known in the art and include, for example, synthesis by recombinant DNA technology. The skilled addressee will be aware of methods of synthesising antibodies, such as those described in, for example, U.S. Pat. No. 5,296,348 and Ausubel F. M. et al. (Eds) Current Protocols in Molecular Biology (2007), John Wiley and Sons, Inc.

[0221] Preferably antibodies are prepared from discrete regions or fragments of the SXT or CYR polypeptide of interest. An antigenic portion of a polypeptide of interest may be of any appropriate length, such as from about 5 to about 15 amino acids. Preferably, an antigenic portion contains at least about 5, 6, 7, 8, 9, 10, 11, 12, 13 or 14 amino acid residues.

[0222] In the context of this specification reference to an antibody specific to a SXT or CYR polypeptide of the invention includes an antibody that is specific to a fragment of the polypeptide of interest.

[0223] Antibodies that specifically bind to a polypeptide of the invention can be prepared, for example, using the purified SXT or CYR polypeptides or their nucleic acid sequences using any suitable methods known in the art. For example, a monoclonal antibody, typically containing Fab portions, may be prepared using hybridoma technology described in Harlow and Lane (Eds) Antibodies--A Laboratory Manual, (1988), Cold Spring Harbor Laboratory, N.Y; Coligan, Current Protocols in Immunology (1991); Goding, Monoclonal Antibodies: Principles and Practice (1986) 2nd ed; and Kohler & Milstein, (1975) Nature 256: 495-497. Such techniques include, but are not limited to, antibody preparation by selection of antibodies from libraries of recombinant antibodies in phage or similar vectors, as well as preparation of polyclonal and monoclonal antibodies by immunizing rabbits or mice (see, for example, Huse et al. (1989) Science 246: 1275-1281; Ward et al. (1989) Nature 341: 544-546).

[0224] It will also be understood that antibodies of the invention include humanised antibodies, chimeric antibodies and fully human antibodies. An antibody of the invention may be a bi-specific antibody, having binding specificity to more than one antigen or epitope. For example, the antibody may have specificity for one or more SXT or CYR polypeptide or fragments thereof, and additionally have binding specificity for another antigen. Methods for the preparation of humanised antibodies, chimeric antibodies, fully human antibodies, and bispecific antibodies are known in the art and include, for example as described in U.S. Pat. No. 6,995,243 issued Feb. 7, 2006 to Garabedian, et al. and entitled "Antibodies that recognize and bind phosphorylated human glucocorticoid receptor and methods of using same".

[0225] Generally, a sample potentially comprising SXT or CYR polypeptides can be contacted with an antibody that specifically binds the SXT or CYR polypeptide or fragment thereof. Optionally, the antibody can be fixed to a solid support to facilitate washing and subsequent isolation of the complex, prior to contacting the antibody with a sample. Examples of solid supports include, for example, microlitre plates, beads, ticks, or microbeads. Antibodies can also be attached to a ProteinChip array or a probe substrate as described, above.

[0226] Detectable labels for the identification of antibodies bound to the SXT or CYR polypeptides of the invention include, but are not limited to fluorochromes, fluorescent dyes, radiolabels, enzymes such as horse radish peroxide, alkaline phosphatase and others commonly used in the art, and colorimetric labels including colloidal gold or coloured glass or plastic beads. Alternatively, the marker in the sample can be detected using an indirect assay, wherein, for example, a second, labelled antibody is used to detect bound marker-specific antibody.

[0227] Methods for detecting the presence of or measuring the amount of, an antibody-marker complex include, for example, detection of fluorescence, chemiluminescence, luminescence, absorbance, birefringence, transmittance, reflectance, or refractive index such as surface plasmon resonance, ellipsometry, a resonant mirror method, a grating coupler wave guide method or interferometry. Radio frequency methods include multipolar resonance spectroscopy. Electrochemical methods include amperometry and voltametry methods. Optical methods include imaging methods and non-imaging methods and microscopy.

[0228] Useful assays for detecting the presence of or measuring the amount of, an antibody-marker complex include, include, for example, enzyme-linked immunosorbent assay (ELISA), a radioimmune assay (RIA), or a Western blot assay. Such methods are described in, for example, Clinical Immunology (Stites & Terr, eds., 7th ed. 1991); Methods in Cell Biology: Antibodies in Cell Biology, volume 37 (Asai, ed. 1993); and Harlow & Lane, supra.

Methods and Kits for Detection

[0229] The invention provides methods and kits for the detection and/or isolation of SXT nucleic acids and polypeptides. Also provided are methods and kits for the detection and/or isolation CYR nucleic acids and polypeptides.

[0230] In one aspect, the invention provides a method for the detection of cyanobacteria. The skilled addressee will understand that the detection of "cyanobacteria" encompasses the detection of one or more cyanobacteria. The method comprises obtaining a sample for use in the method, and detecting the presence of one or more SXT polynucleotides or polypeptides as disclosed herein, or a variant or fragment thereof. The presence of SXT polynucleotides, polypeptides, or variants or fragments thereof, is indicative of cyanobacteria in the sample.

[0231] The SXT polynucleotide may comprise a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, and variants and fragments thereof.

[0232] Alternatively, the SXT polynucleotide may be an RNA or cDNA encoded by a sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, and variants and fragments thereof and/or polypeptides as disclosed herein, or a variant or fragment thereof.

[0233] The SXT polypeptide may comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, and variants and fragments thereof.

[0234] The inventors have determined that several genes of the SXT gene cluster exist in saxitoxin-producing organisms, and are absent in organisms with the SXT gene cluster that do not produce saxitoxin. Specifically, the inventors have identified that gene 6 (sxtA) (SEQ ID NO: 14), gene 9 (sxtG) (SEQ ID NO: 20), gene 10 (sxtH) (SEQ ID NO: 22), gene 11 (sxtI) (SEQ ID NO: 24) and gene 17 (sxtX) (SEQ ID NO: 36) of the SXT gene cluster are present only in organisms that produce saxitoxin.

[0235] Accordingly, in another aspect the invention provides a method of detecting a cyanotoxic organism. The method comprises obtaining a sample for use in the method, and detecting a cyanotoxic organism based on the detection of one or more SXT polynucleotides comprising a sequence set forth in SEQ ID NO: 14 (sxtA, gene 6), SEQ ID NO: 20 (sxtG, gene 9), SEQ ID NO: 22 (sxtH, gene 10), SEQ ID NO: 24 (sxtI, gene 11), SEQ ID NO: 36 (sxtX, gene 17), or variants or fragments thereof. Additionally or alternatively, a cyanotoxic organism may be detected based on the detection of an RNA or cDNA comprising a sequence encoded by SEQ ID NO: 14 (sxtA, gene 6), SEQ ID NO: 20 (sxtG, gene 9), SEQ ID NO: 22 (sxtH, gene 10), SEQ ID NO: 24 (sxtI, gene 11), SEQ ID NO: 36 (sxtX, gene 17), or variants or fragments thereof. Additionally or alternatively, a cyanotoxic organism may be detected based on the detection of one or more polypeptides comprising a sequence set forth in SEQ ID NO: 15 (SXTA), SEQ ID NO: 21 (SXTG), SEQ ID NO: 23 (SXTH), SEQ ID NO: (SXTI), SEQ ID NO: 37 (SXTX), or variants or fragments thereof, in a sample suspected of comprising one or more cyanotoxic organisms. The cyanotoxic organism may be any organism capable of producing saxitoxin. In a preferred embodiment of the invention, the cyanotoxic organism is a cyanobacteria or a dinoflagellate.

[0236] In certain embodiments of the invention, the methods for detecting cyanobacteria or the methods for detecting cyanotoxic organisms may further comprise the detection of one or more CYR polynucleotides or CYR polypeptides as disclosed herein, or a variant or fragment thereof. The CYR polynucleotide may comprise a sequence selected from the group consisting of SEQ ID NO: 80, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, and variants or fragments thereof.

[0237] Alternatively, the CYR polynucleotide may be an RNA or cDNA encoded by a polynucleotide sequence selected from the group consisting of SEQ ID NO: 80, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, and variants or fragments thereof.

[0238] The CYR polypeptide may comprise a sequence selected from the group consisting of SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, and SEQ ID NO: 110, and variants or fragments thereof.

[0239] The inventors have determined gene 8 (cyrJ) (SEQ ID NO: 95) of the CYR gene cluster exists in cylindrospermopsin-producing organisms, and is absent in organisms with the CYR gene cluster that do not produce cylindrospermopsin. Accordingly, the methods for detecting cyanobacteria or the methods for detecting cyanotoxic organisms may further comprise the detection of a cylindrospermopsin-producing organism based on the detection of a CYR polynucleotide comprising a sequence set forth in SEQ ID NO: 95, or a variant or fragment thereof. Additionally or alternatively, the methods for detecting cyanobacteria or the methods for detecting cyanotoxic organisms may further comprise the detection of a cylindrospermopsin-producing organism based on the detection of an RNA or cDNA comprising a sequence encoded by SEQ ID NO: 95, or a variant or fragment thereof. Additionally or alternatively, the methods for detecting cyanobacteria or the methods for detecting cyanotoxic organisms may further comprise the detection of a cylindrospermopsin-producing organism based on the detection of a CYR polypeptide comprising a sequence set forth in SEQ ID NO: 96, or a variant or fragment thereof.

[0240] In another aspect, the invention provides a method for the detection of cyanobacteria. The skilled addressee will understand that the detection of "cyanobacteria" encompasses the detection of one or more cyanobacteria. The method comprises obtaining a sample for use in the method, and detecting the presence of one or more CYR polynucleotides or polypeptides as disclosed herein, or a variant or fragment thereof. The presence of CYR polynucleotides, polypeptides, or variants or fragments thereof, is indicative of cyanobacteria in the sample.

[0241] The CYR polynucleotide may comprise a sequence selected from the group consisting of SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109 and variants and fragments thereof.

[0242] Alternatively, the CYR polynucleotide may be an RNA or cDNA encoded by a sequence selected from the group consisting of SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109 and variants and fragments thereof.

[0243] The CYR polypeptide may comprise a sequence selected from the group consisting of SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, and SEQ ID NO: 110, and variants or fragments thereof.

[0244] In another aspect of the invention there is provided a method of detecting a cylindrospermopsin-producing organism based on the detection of CYR gene 8 (cyrJ). The method comprises obtaining a sample for use in the method, and detecting the presence of a CYR polynucleotide comprising a sequence set forth in SEQ ID NO: 95, or a variant or fragment thereof. Additionally or alternatively, the method for detecting a cylindrospermopsin-producing organism based on the detection of CYR gene 8 (cyrJ) may comprise the detection of an RNA or cDNA comprising a sequence encoded by SEQ ID NO: 95, or a variant or fragment thereof. Additionally or alternatively, the method for detecting a cylindrospermopsin-producing organism based on the detection of CYR gene 8 (cyrJ) may comprise the detection of a CYR polypeptide comprising a sequence set forth in SEQ ID NO: 96, or a variant or fragment thereof.

[0245] In certain embodiments of the invention, the methods for detecting cyanobacteria comprising the detection of CYR sequences or variants or fragments thereof further comprise the detection of one or more SXT polynucleotides or SXT polypeptides as disclosed herein, or a variant or fragment thereof.

[0246] The SXT polynucleotide may comprise a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, and variants and fragments thereof.

[0247] Alternatively, the SXT polynucleotide may be an RNA or cDNA encoded by a sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, and variants and fragments thereof and/or polypeptides as disclosed herein, or a variant or fragment thereof.

[0248] The SXT polypeptide may comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, and variants and fragments thereof.

[0249] In another aspect, the invention provides a method for the detection of dinoflagellates. The skilled addressee will understand that the detection of "dinoflagellates" encompasses the detection of one or more dinoflagellates. The method comprises obtaining a sample for use in the method, and detecting the presence of one or more SXT polynucleotides or polypeptides as disclosed herein, or a variant or fragment thereof. The presence of SXT polynucleotides, polypeptides, or variants or fragments thereof, is indicative of dinoflagellates in the sample.

[0250] The SXT polynucleotide may comprise a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, and variants and fragments thereof.

[0251] Alternatively, the SXT polynucleotide may be an RNA or cDNA encoded by a sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ. ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, and variants and fragments thereof and/or polypeptides as disclosed herein, or a variant or fragment thereof.

[0252] The SXT polypeptide may comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, and variants and fragments thereof.

[0253] A sample for use in accordance with the methods described herein may be suspected of comprising one or more cyanotoxic organisms. The cyanotoxic organisms may be one or more cyanobacteria and/or one or more dinoflagellates. Additionally or alternatively, a sample for use in accordance with the methods described herein may be suspected of comprising one more cyanobacteria and/or one or more dinoflagellates. A sample for use in accordance with the methods described herein may be a comparative or control sample, for example, a sample comprising a known concentration or density of a cyanobacteria and/or dinoflagellates, or a sample comprising one or more known species or strains of cyanobacteria and/or dinoflagellates.

[0254] A sample for use in accordance with the methods described herein may be derived from any source. For example, a sample may be an environmental sample. The environmental sample may be derived, for example, from salt water, fresh water or a blue-green algal bloom. Alternatively, the sample may be derived from a laboratory source, such as a culture, or a commercial source.

[0255] It will be appreciated by those in the art that the methods and kits disclosed herein are generally suitable for detecting any organisms in which the SXT and/or CYR gene clusters are present. Suitable cyanobacteria to which the methods of the invention are applicable may be selected from the orders Oscillatoriales, Chroococcales, Nostocales and Stigonematales. For example, the cyanobacteria may be selected from the genera Anabaena, Nostoc, Microcystis, Planktothrix, Oscillatoria, Phormidium, and Nodularia. For example, the cyanobacteria may be selected from the species Cylindrospermopsis raciborskii T3, Cylindrospermopsis raciborskii AWT205, Aphanizomenon ovalisporum, Aphanizomenon flos-aquae, Aphanizomenon sp., Umezakia natans, Raphidiopsis curvata, Anabaena bergii, Lyngbya wollei, and Anabaena circinalis. Examples of suitable dinoflagellates to which the methods and kits of the invention are applicable may be selected from the genera Alexandrium, Pyrodinium and Gymnodinium. The methods and kits of the invention may also be employed for the discovery of novel hepatotoxic species or genera in culture collections or from environmental samples. The methods and kits of the invention may also be employed to detect cyanotoxins that accumulate in other animals, for example, fish and shellfish.

[0256] Detection of SXT and CYR polynucleotides and polypeptides disclosed herein may be performed using any suitable method. For example, methods for the detection of SXT and CYR polynucleotides and/or polypeptides disclosed herein may involve the use of a primer, probe or antibody specific for one or more SXT and CYR polynucleotides and polypeptides. Suitable techniques and assays in which the skilled addressee may utilise a primer, probe or antibody specific for one or more SXT and CYR polynucleotides and polypeptides include, for example, the polymerase chain reaction (and related variations of this technique), antibody based assays such as ELISA and flow cytometry, and fluorescent microscopy. Methods by which the SXT and CYR polypeptides disclosed herein may be identified are generally known in the art, and are described for example in Coligan J. E. et al. (Eds) Current Protocols in Protein Science (2007), John Wiley and Sons, Inc; Walker, J. M., (Ed) (1988) New Protein Techniques: Methods in Molecular Biology, Humana Press, Clifton, N.J. and Scopes, R. K. (1987) Protein Purification: Principles and Practice, 3rd. Ed., Springer-Verlag, New York, N.Y. For example, SXT and CYR polypeptides disclosed herein may be detected by western blot or spectrophotometric analysis. Other examples of suitable methods for the detection of SXT and CYR polypeptides are described, for example, in U.S. Pat. No. 4,683,195, U.S. Pat. No. 6,228,578, U.S. Pat. No. 7,282,355, U.S. Pat. No. 7,348,147 and PCT publication No. WO/2007/056723.

[0257] In a preferred embodiment of the invention, the detection of SXT and CYR polynucleotides and polypeptides is achieved by amplification of DNA from the sample of interest by polymerase chain reaction, using primers that hybridise specifically to the SXT and/or CYR sequence, or a variant or fragment thereof, and detecting the amplified sequence.

[0258] Nucleic acids and polypeptides for analysis using methods and kits disclosed herein may be extracted from organisms either in mixed culture or as individual species or genus isolates. Accordingly, the organisms may be cultured prior to nucleic acid and/or polypeptide isolation or alternatively nucleic acid and/or polypeptides may be extracted directly from environmental samples, such as water samples or blue-green algal blooms.

[0259] Suitable methods for the extraction and purification of nucleic acids for analysis using the methods and kits invention are generally known in the art and are described, for example, in Ausubel F. M. et al. (Eds) Current Protocols in Molecular Biology (2007), John Wiley and Sons, Inc; Neilan (1995) Appl. Environ. Microbiol. 61:2286-2291; and Neilan et al. (2002) Astrobiol. 2:271-280. The skilled addressee will readily appreciate that the invention is not limited to the specific methods for nucleic acid isolation described therein and other suitable methods are encompassed by the invention. The invention may be performed without nucleic acid isolation prior to analysis of the nucleic acid.

[0260] Suitable methods for the extraction and purification of polypeptides for the purposes of the invention are generally known in the art and are described, for example, in Coligan J. E. et al. (Eds) Current Protocols in Protein Science (2007), John Wiley and Sons, Inc; Walker, J. M., (Ed) (1988) New Protein Techniques: Methods in Molecular Biology, Humana Press, Clifton, N.J. and Scopes, R. K. (1987) Protein Purification: Principles and Practice, 3rd. Ed., Springer-Verlag, New York, N.Y. Examples of suitable techniques for protein extraction include, but are not limited to dialysis, ultrafiltration, and precipitation. Protein purification techniques suitable for use include, but are not limited to, reverse-phase chromatography, hydrophobic interaction chromatography, centrifugation, gel filtration, ammonium sulfate precipitation, and ion exchange.

[0261] In accordance with the methods and kits of the invention, SXT and CYR polynucleotides or variants or fragments thereof may be detected by any suitable means known in the art. In a preferred embodiment of the invention, SXT and CYR polynucleotides are detected by PCR amplification. Under the PCR approach, oligonucleotide primers can be designed for use in PCR reactions to amplify SXT and CYR polynucleotides of the invention. Also encompassed by the invention is the PCR amplification of complementary DNA (cDNA) amplified from messenger RNA (mRNA) derived from reverse-transcription of SXT and CYR sequences (RT-PCR). Known methods of PCR include, but are not limited to, methods using paired primers, nested primers, single specific primers, degenerate primers, gene-specific primers, vector-specific primers, partially-mismatched primers, and the like. Methods for designing PCR and RT-PCR primers are generally known in the art and are disclosed, for example, in Ausubel F. M. et al. (Eds) Current Protocols in Molecular Biology (2007), John Wiley and Sons, Inc; Maniatis et al. Molecular Cloning (1982), 280-281; Innis et al. (Eds) (1990) PCR Protocols: A Guide to Methods and Applications (Academic Press, New York); Innis and Gelfand, (Eds) (1995) PCR Strategies (Academic Press, New York); Innis and Gelfand, (Eds) (1999) PCR Methods Manual (Academic Press, New York); and Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual (2nd ed., Cold Spring Harbor Laboratory Press, Plainview, N.Y.

[0262] The skilled addressee will readily appreciate that various parameters of PCR and RT-PCR procedures may be altered without affecting the ability to achieve the desired product. For example, the salt concentration may be varied or the time and/or temperature of one or more of the denaturation, annealing and extension steps may be varied. Similarly, the amount of DNA, cDNA, or RNA template may also be varied depending on the amount of nucleic acid available or the optimal amount of template required for efficient amplification. The primers for use in the methods and kits of the present invention are typically oligonucleotides typically being at least about 5 nucleotides to about 80 nucleotides in length, more typically about 10 nucleotides in length to about 50 nucleotides in length, and even more typically about 15 nucleotides in length to about 30 nucleotides in length. The skilled addressee will recognise that the primers described herein may be useful for a number of different applications, including but not limited to PCR, RT-PCR, and use of probes for the detection of SXT or CYR sequences.

[0263] Such primers can be prepared by any suitable method, including, for example, direct chemical synthesis or cloning and restriction of appropriate sequences. Not all bases in the primer need reflect the sequence of the template molecule to which the primer will hybridize, the primer need only contain sufficient complementary bases to enable the primer to hybridize to the template. A primer may also include mismatch bases at one or more positions, being bases that are not complementary to bases in the template, but rather are designed to incorporate changes into the DNA upon base extension or amplification. A primer may include additional bases, for example in the form of a restriction enzyme recognition sequence at the 5' end, to facilitate cloning of the amplified DNA.

[0264] The invention provides a method of detecting a cyanotoxic organism based on the detection of one or more of SXT gene 6 (sxtA), SXT gene 9 (sxtG), SXT gene 10 (sxtH), SXT gene 11 (sxtI) and SXT gene 17 (sxtX) (SEQ ID NOS: 14, 20, 22, 24, and 36 respectively), or fragments or variants thereof. Additionally or alternatively, a cyanotoxic organism may be detected based on the detection of one or more of the following SXT polypeptides: SXTA (SEQ ID NO: 15), SXTG (SEQ ID NO: 21), SXTH (SEQ ID NO: 23), SXTI (SEQ ID NO: 25), SXTX (SEQ ID NO: 37), or fragments or variants thereof.

[0265] The skilled addressee will recognise that any primers capable of the amplifying the stated SXT and/or CYR sequences, or variants or fragments thereof, are suitable for use in the methods of the invention. For example, suitable oligonucleotide primer pairs for the PCR amplification of SXT gene 6 (sxtA) may comprise a first primer comprising the sequence of SEQ ID NO: 70 and a second primer comprising the sequence of SEQ ID NO: 71, a first primer comprising the sequence of SEQ ID NO: 72 and a second primer comprising the sequence of SEQ ID NO: 73, a first primer comprising the sequence of SEQ ID NO: 74 and a second primer comprising the sequence of SEQ ID NO: 75, a first primer comprising the sequence of SEQ ID NO: 76 and a second primer comprising the sequence of SEQ ID NO: 77, a first primer comprising the sequence of SEQ ID NO: 78 and a second primer comprising the sequence of SEQ ID NO: 79, a first primer comprising the sequence of SEQ ID NO: 113 and a second primer comprising the sequence of SEQ ID NO: 114, or a first primer comprising the sequence of SEQ ID NO: 115 or SEQ ID NO: 116 and a second primer comprising the sequence of SEQ ID NO: 117.

[0266] Suitable oligonucleotide primer pairs for the amplification of SXT gene 9 (sxtG) may comprise a first primer comprising the sequence of SEQ ID NO: 118 and a second primer comprising the sequence of SEQ ID NO: 119, or a first primer comprising the sequence of SEQ ID NO: 120 and a second primer comprising the sequence of SEQ ID NO: 121.

[0267] Suitable oligonucleotide primer pairs for the amplification of SXT gene 10 (sxtH) may comprise a first primer comprising the sequence of SEQ ID NO: 122 and a second primer comprising the sequence of SEQ ID NO: 123.

[0268] Suitable oligonucleotide primer pairs for the amplification of SXT gene 11 (sxtI) may comprise a first primer comprising the sequence of SEQ ID NO: 124 or SEQ ID NO: 125 and a second primer comprising the sequence of SEQ ID NO: 126, or a first primer comprising the sequence of SEQ ID NO: 127 and a second primer comprising the sequence of SEQ ID NO: 128.

[0269] Suitable oligonucleotide primer pairs for the amplification of SXT gene 17 (sxtX) may comprise a first primer comprising the sequence of SEQ ID NO: 129 and a second primer comprising the sequence of SEQ ID NO: 130, or a first primer comprising the sequence of SEQ ID NO: 131 and a second primer comprising the sequence of SEQ ID NO: 132.

[0270] The skilled addressee will recognise that fragments and variants of the above-mentioned primer pairs may also efficiently amplify SXT gene 6 (sxtA), SXT gene 9 (sxtG), SXT gene 10 (sxtH), SXT gene 11 (sxtI) or SXT gene 17 (sxtX) sequences.

[0271] In certain embodiments of the invention, polynucleotide sequences derived from the CYR gene are detected based on the detection of CYR gene 8 (cyrJ) (SEQ ID NO: 95). Suitable oligonucleotide primer pairs for the PCR amplification of CYR gene 8 (cyrJ) may comprise a first primer having the sequence of SEQ ID NO: 111 or a fragment or variant thereof and a second primer having the sequence of SEQ ID NO: 112 or a fragment thereof.

[0272] Also included within the scope of the present invention are variants and fragments of the exemplified oligonucleotide primers. The skilled addressee will also recognise that the invention is not limited to the use of the specific primers exemplified, and alternative primer sequences may also be used, provided the primers are designed appropriately so as to enable the amplification of SXT and/or CYR sequences. Suitable primer sequences can be determined by those skilled in the art using routine procedures without undue experimentation. The location of suitable primers for the amplification of SXT and/or CYR sequences may be determined by such factors as G+C content and the ability for a sequence to form unwanted secondary structures.

[0273] Suitable methods of analysis of the amplified nucleic acids are well known to those skilled in the art and are described for example, in, Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual (2nd ed., Cold Spring Harbor Laboratory Press, Plainview, N.Y.); Ausubel F. M. et al. (Eds) Current Protocols in Molecular Biology (2007), John Wiley and Sons, Inc; and Maniatis et al. Molecular Cloning (1982), 280-281. Suitable methods of analysis of the amplified nucleic acids include, for example, gel electrophoresis which may or may not be preceded by restriction enzyme digestion, and/or nucleic acid sequencing. Gel electrophoresis may comprise agarose gel electrophoresis or polyacrylamide gel electrophoresis, techniques commonly used by those skilled in the art for separation of DNA fragments on the basis of size. The concentration of agarose or polyacrylamide in the gel in large part determines the resolution ability of the gel and the appropriate concentration of agarose or polyacrylamide will therefore depend on the size of the DNA fragments to be distinguished.

[0274] In other embodiments of the invention, SXT and CYR polynucleotides and variants or fragments thereof may be detected by the use of suitable probes. The probes of the invention are based on the sequences of SXT and/or CYR polynucleotides disclosed herein. Probes are nucleotide sequences of variable length, for example between about 10 nucleotides and several thousand nucleotides, for use in detection of homologous sequences, typically by hybridization. Hybridization probes of the invention may be genomic DNA fragments, cDNA fragments, RNA fragments, or other oligonucleotides.

[0275] Methods for the design and/or production of nucleotide probes are generally known in the art, and are described, for example, in Robinson P. J., et al. (Eds) Current Protocols in Cytometry (2007), John Wiley and Sons, Inc; Ausubel F. M. et al. (Eds) Current Protocols in Molecular Biology (2007), John Wiley and Sons, Inc; Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual (2nd ed., Cold Spring Harbor Laboratory Press, Plainview, N.Y.; and Maniatis et al. Molecular Cloning (1982), 280-281. Nucleotide probes may be prepared, for example, by chemical synthesis techniques, for example, the phosphodiester and phosphotriester methods (see for example Narang S. A. et al. (1979) Meth. Enzymol. 68:90; Brown, E. L. (1979) et al. Meth. Enzymol. 68:109; and U.S. Pat. No. 4,356,270), the diethylphosphoramidite method (see Beaucage S. L et al. (1981) Tetrahedron Letters, 22:1859-1862). A method for synthesizing oligonucleotides on a modified solid support is described in U.S. Pat. No. 4,458,066.

[0276] The probes of the invention may be labelled by incorporation of a marker to facilitate their detection. Techniques for labelling and detecting nucleic acids are described, for example, in Ausubel F. M. et al. (Eds) Current Protocols in Molecular Biology (2007), John Wiley and Sons, Inc. Examples of suitable markers include fluorescent molecules (e.g. acetylaminofluorene, 5-bromodeoxyuridine, digoxigenin, fluorescein) and radioactive isotopes (e.g. 32P, 35S, 3H, 33P). Detection of the marker may be achieved, for example, by chemical, photochemical, immunochemical, biochemical, or spectroscopic techniques.

[0277] The methods and kits of the invention also encompass the use of antibodies which are capable of binding specifically to the polypeptides of the invention. The antibodies may be used to qualitatively or quantitatively detect and analyse one or more SXT or CYR polypeptides in a given sample. Methods for the generation and use of antibodies are generally known in the art and described in, for example, Harlow and Lane (Eds) Antibodies--A Laboratory Manual, (1988), Cold Spring Harbor Laboratory, N.Y., Coligan, Current Protocols in Immunology (1991); Goding, Monoclonal Antibodies: Principles and Practice (1986) 2nd ed; and Kohler & Milstein, (1975) Nature 256: 495-497. The antibodies may be conjugated to a fluorochrome allowing detection, for example, by flow cytometry, immunohistochemisty or other means known in the art. Alternatively, the antibody may be bound to a substrate allowing colorimetric or chemiluminescent detection. The invention also contemplates the use of secondary antibodies capable of binding to one or more antibodies capable of binding specifically to the polypeptides of the invention.

[0278] The invention also provides kits for the detection of cyanotoxic organisms and/or cyanobacteria, and/or dinoflagellates. In general, the kits of the invention comprise at least one agent for detecting the presence of one or more SXT and/or CYR polynucleotide or polypeptides disclosed herein, or a variant or fragment thereof. Any suitable agent capable of detecting SXT and/or CYR sequences of the invention may be included in the kit. Non-limiting examples include primers, probes and antibodies.

[0279] In one aspect, the invention provides a kit for the detection of cyanobacteria, the kit comprising at least one agent for detecting the presence the presence of one or more SXT polynucleotides or polypeptides as disclosed herein, or a variant or fragment thereof.

[0280] The SXT polynucleotide may comprise a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, and variants and fragments thereof.

[0281] Alternatively, the SXT polynucleotide may be an RNA or cDNA encoded by a sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, and variants and fragments thereof and/or polypeptides as disclosed herein, or a variant or fragment thereof.

[0282] The SXT polypeptide may comprise an amino acid sequence selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, and variants and fragments thereof.

[0283] Also provided is a kit for the detection of cyanotoxic organisms. The kit comprises at least one agent for detecting the presence of one or more SXT polynucleotides or polypeptides as disclosed herein, or a variant or fragment thereof.

[0284] The SXT polynucleotide may comprise a sequence selected from the group consisting of SEQ ID NO: 14, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 36, and variants and fragments thereof.

[0285] Alternatively, the SXT polynucleotide may be an RNA or cDNA encoded by a sequence selected from the group consisting of SEQ ID NO: 14, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 36, and variants and fragments thereof.

[0286] The SXT polypeptide may comprising an amino acid sequence selected from the group consisting of consisting of SEQ ID NO: 15, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 37, and variants and fragments thereof.

[0287] The at least one agent may be any suitable reagent for the detection of SXT polynucleotides and/or polypeptides disclosed herein. For example, the agent may be a primer, an antibody or a probe. By way of exemplification only, the primers or probes may comprise a sequence selected from the group consisting of SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 113, SEQ ID NO: 114, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 121, SEQ ID NO: 122, SEQ ID NO: 123, SEQ ID NO: 124, SEQ ID NO: 125, SEQ ID NO: 126, SEQ ID NO: 127, SEQ ID NO: 128, SEQ ID NO: 129, SEQ ID NO: 130, SEQ ID NO: 131, SEQ ID NO: 132, SEQ ID NO: 133, SEQ ID NO: 134, and variants and fragments thereof.

[0288] In certain embodiments of the invention, the kits for the detection of cyanobacteria or cyanotoxic organisms may further comprise at least one additional agent capable of detecting one or more CYR polynucleotide and/or CYR polypeptide sequences as disclosed herein, or a variant or fragment thereof.

[0289] The CYR polynucleotide may comprise a polynucleotide comprising a sequence selected from the group consisting of: SEQ ID NO: 80, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, and variants and fragments thereof.

[0290] Alternatively, the CYR polynucleotide may comprise a ribonucleic acid or complementary DNA encoded by a sequence selected from the group consisting of: SEQ ID NO: 80, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, and variants and fragments thereof.

[0291] The CYR polypeptide may comprise a polypeptide comprising a sequence selected from the group consisting of: SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, and SEQ ID NO: 110, and variants and fragments thereof.

[0292] The at least one additional agent may be selected, for example, from the group consisting of primers, antibodies and probes. A suitable primer or probe may comprise a sequence selected from the group consisting of SEQ ID NO: 111, SEQ ID NO: 112, and variants and fragments thereof.

[0293] In another aspect, the invention provides a kit for the detection of cyanobacteria, the kit comprising at least one agent for detecting the presence the presence of one or more CYR polynucleotides or polypeptides as disclosed herein, or a variant or fragment thereof.

[0294] The CYR polynucleotide may comprise a sequence selected from the group consisting of SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, and variants and fragments thereof.

[0295] Alternatively, the CYR polynucleotide may be an RNA or cDNA encoded by a sequence selected from the group consisting of SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, and variants and fragments thereof.

[0296] The CYR polypeptide may comprise a sequence selected from the group consisting of SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, and SEQ ID NO: 110, and variants or fragments thereof.

[0297] In certain embodiments of the invention, the kits for detecting cyanobacteria comprising one or more agents for the detection of CYR sequences or variants or fragments thereof, may further comprise at least one additional agent capable of detecting one or more of the SXT polynucleotides and/or SXT polypeptides disclosed herein, or variants or fragments thereof.

[0298] The SXT polynucleotide may comprise a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, and variants and fragments thereof.

[0299] Alternatively, the SXT polynucleotide may be an RNA or cDNA encoded by a sequence selected from the group consisting of SEQ ID NO: 2, SEQ. ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, and variants and fragments thereof and/or polypeptides as disclosed herein, or a variant or fragment thereof.

[0300] The at least one agent may be any suitable reagent for the detection of CYR polynucleotides and/or polypeptides disclosed herein. For example, the agent may be a primer, an antibody or a probe. By way of exemplification only, the primers or probes may comprise a sequence selected from the group consisting of SEQ ID NO: 111, SEQ ID NO: 112, and variants and fragments thereof.

[0301] Also provided is a kit for the detection of dinoflagellates, the kit comprising at least one agent for detecting the presence one or more SXT polynucleotides or polypeptides as disclosed herein, or a variant or fragment thereof.

[0302] The SXT polynucleotide may comprise a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, and variants and fragments thereof.

[0303] Alternatively, the SXT polynucleotide may be an RNA or cDNA encoded by a sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, and variants and fragments thereof and/or polypeptides as disclosed herein, or a variant or fragment thereof.

[0304] The SXT polypeptide may comprise an amino acid sequence selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, and variants and fragments thereof.

[0305] In general, the kits of the invention may comprise any number of additional components. By way of non-limiting examples the additional components may include, reagents for cell culture, reference samples, buffers, labels, and written instructions for performing the detection assay.

Methods of Screening

[0306] The polypeptides and polynucleotides of the present invention, and fragments and analogues thereof are useful for the screening and identification of compounds and agents that interact with these molecules. In particular, desirable compounds are those that modulate the activity of these polypeptides and polynucleotides. Such compounds may exert a modulatory effect by activating, stimulating, increasing, inhibiting or preventing expression or activity of the polypeptides and/or polynucleotides. Suitable compounds may exert their effect by virtue of either a direct (for example binding) or indirect interaction.

[0307] Compounds which bind, or otherwise interact with the polypeptides and polynucleotides of the invention, and specifically compounds which modulate their activity, may be identified by a variety of suitable methods. Non limiting methods include the two-hybrid method, co-immunoprecipitation, affinity purification, mass spectroscopy, tandem affinity purification, phage display, label transfer, DNA microarrays/gene coexpression and protein microarrays.

[0308] For example, a two-hybrid assay may be used to determine whether a candidate agent or plurality of candidate agents interacts or binds with a polypeptide of the invention or a variant or fragment thereof. The yeast two-hybrid assay system is a yeast-based genetic assay typically used for detecting protein-protein interactions (Fields and Song., Nature 340: 245-246 (1989)). The assay makes use of the multi-domain nature of transcriptional activators. For example, the DNA-binding domain of a known transcriptional activator may be fused to a polypeptide of the invention or a variant or fragment thereof, and the activation domain of the transcriptional activator fused to the candidate agent. Interaction between the candidate agent and the polypeptide of the invention or a variant or fragment thereof, will bring the DNA-binding and activation domains of the transcriptional activator into close proximity. Subsequent transcription of a specific reporter gene activated by the transcriptional activator allows the detection of an interaction.

[0309] In a modification of the technique above, a fusion protein may be constructed by fusing the polypeptide of the invention or a variant or fragment thereof to a detectable tag, for example alkaline phosphatase, and using a modified form of immunoprecipitation as described by Flanagan and Leder (Flanagan and Leder, Cell 63:185-194 (1990))

[0310] Alternatively, co-immunoprecipation may be used to determine whether a candidate agent or plurality of candidate agents interacts or binds with polypeptide of the invention or a variant or fragment thereof. Using this technique, cyanotoxic organisms, cyanobacteria and/or dinoflagellates may be lysed under nondenaturing conditions suitable for the preservation of protein-protein interactions. The resulting solution can then be incubated with an antibody specific for a polypeptide of the invention or a variant or fragment thereof and immunoprecipitated from the bulk solution, for example by capture with an antibody-binding protein attached to a solid support. Immunoprecipitation of the polypeptide of the invention or a variant or fragment thereof by this method facilitates the co-immunoprecipation of an agent associated with that protein. The identification an associated agent can be established using a number of methods known in the art, including but not limited to SDS-PAGE, western blotting, and mass spectrometry.

[0311] Alternatively, the phage display method may be used to determine whether a candidate agent or plurality of candidate agents interacts or binds with a polypeptide of the invention or a variant or fragment thereof. Phage display is a test to screen for protein interactions by integrating multiple genes from a gene bank into phage. Under this method, recombinant DNA techniques are used to express numerous genes as fusions with the coat protein of a bacteriophage such the peptide or protein product of each gene is displayed on the surface of the viral particle. A whole library of phage-displayed peptides or protein products of interest can be produced in this way. The resulting libraries of phage-displayed peptides or protein products may then be screened for the ability to bind a polypeptide of the invention or a variant or fragment thereof. DNA extracted from interacting phage contains the sequences of interacting proteins.

[0312] Alternatively, affinity chromatography may be used to determine whether a candidate agent or plurality of candidate agents interacts or binds with a polypeptide of the invention or a variant or fragment thereof. For example, a polypeptide of the invention or a variant or fragment thereof, may be immobilised on a support (such as sepharose) and cell lysates passed over the column. Proteins binding to the immobilised polypeptide of the invention or a variant or fragment thereof may then be eluted from the column and identified, for example by N-terminal amino acid sequencing.

[0313] Potential modulators of the activity of the polypeptides of the invention may be generated for screening by the above methods by a number of techniques known to those skilled in the art. For example, methods such as X-ray crystallography and nuclear magnetic resonance spectroscopy may be used to model the structure of polypeptide of the invention or a variant or fragment thereof, thus facilitating the design of potential modulating agents using computer-based modeling. Various forms of combinatorial chemistry may also be used to generate putative modulators.

[0314] Polypeptides of the invention and appropriate variants or fragments thereof can be used in high-throughput screens to assay candidate compounds for the ability to bind to, or otherwise interact therewith. These candidate compounds can be further screened against functional polypeptides to determine the effect of the compound on polypeptide activity.

[0315] The present invention also contemplates compounds which may exert their modulatory effect on polypeptides of the invention by altering expression of the polypeptide. In this case, such compounds may be identified by comparing the level of expression of the polypeptide in the presence of a candidate compound with the level of expression in the absence of the candidate compound.

[0316] It will be appreciated that the methods described above are merely examples of the types of methods that may be utilised to identify agents that are capable of interacting with, or modulating the activity of polypeptides of the invention or variants or fragments thereof. Other suitable methods will be known by persons skilled in the art and are within the scope of this invention.

[0317] Using the methods described above, an agent may be identified that is an agonist of a polypeptide of the invention or a variant or fragment thereof. Agents which are agonists enhance one or more of the biological activities of the polypeptide. Alternatively, the methods described above may identify an agent that is an antagonist of a polypeptide of the invention or a variant or fragment thereof. Agents which are antagonists retard one or more of the biological activities of the polypeptide.

[0318] Antibodies may act as agonists or antagonists of a polypeptide of the invention or a variant or fragment thereof. Preferably suitable antibodies are prepared from discrete regions or fragments of the polypeptides of the invention or variants or fragments thereof. An antigenic portion of a polynucleotide of interest may be of any appropriate length, such as from about 5 to about 15 amino acids. Preferably, an antigenic portion contains at least about 5, 6, 7, 8, 9, 10, 11, 12, 13 or 14 amino acid residues.

[0319] Methods for the generation of suitable antibodies will be readily appreciated by those skilled in the art. For example, monoclonal antibody specific for a polypeptide of the invention or a variant or fragment thereof typically containing Fab portions, may be prepared using hybridoma technology described in Antibodies-A Laboratory Manual, Harlow and Lane, eds., Cold Spring Harbor Laboratory, N.Y. (1988).

[0320] In essence, in the preparation of monoclonal antibodies directed toward polypeptide of the invention or a variant or fragment thereof, any technique that provides for the production of antibody molecules by continuous cell lines in culture may be used. These include the hybridoma technique originally developed by Kohler et al., Nature, 256:495-497 (1975), as well as the trioma technique, the human B-cell hybridoma technique (Kozbor et al., Immunology Today, 4:72 (1983)), and the EBV-hybridoma technique to produce human monoclonal antibodies (Cole et al., in Monoclonal Antibodies and Cancer Therapy, pp. 77-96, Alan R. Liss, Inc., (1985)). Immortal, antibody-producing cell lines can be created by techniques other than fusion, such as direct transformation of B lymphocytes with oncogenic DNA, or transfection with Epstein-Barr virus. See, for example, M. Schreier et al, "Hybridoma Techniques" Cold Spring Harbor Laboratory, (1980); Hammerling et al., "Monoclonal Antibodies and T-cell Hybridomas" Elsevier/North-Holland Biochemical Press, Amsterdam (1981); and Kennett et al., "Monoclonal Antibodies", Plenum Press (1980).

[0321] In brief, a means of producing a hybridoma from which the monoclonal antibody is produced, a myeloma or other self-perpetuating cell line is fused with lymphocytes obtained from the spleen of a mammal hyperimmunised with a recognition factor-binding portion thereof, or recognition factor, or an origin-specific DNA-binding portion thereof. Hybridomas producing a monoclonal antibody useful in practicing this invention are identified by their ability to immunoreact with the present recognition factors and their ability to inhibit specified transcriptional activity in target cells.

[0322] A monoclonal antibody useful in practicing the invention can be produced by initiating a monoclonal hybridoma culture comprising a nutrient medium containing a hybridoma that secretes antibody molecules of the appropriate antigen specificity. The culture is maintained under conditions and for a time period sufficient for the hybridoma to secrete the antibody molecules into the medium. The antibody-containing medium is then collected. The antibody molecules can then be further isolated by well-known techniques.

[0323] Similarly, there are various procedures known in the art which may be used for the production of polyclonal antibodies. For the production of polyclonal antibodies against a polypeptide of the invention or a variant or fragment thereof, various host animals can be immunized by injection with a polypeptide of the invention, or a variant or fragment thereof, including but not limited to rabbits, chickens, mice, rats, sheep, goats, etc. Further, the polypeptide variant or fragment thereof can be conjugated to an immunogenic carrier (e.g., bovine serum albumin (BSA) or keyhole limpet hemocyanin (KLH)). Also, various adjuvants may be used to increase the immunological response, including but not limited to Freund's (complete and incomplete), mineral gels such as aluminium hydroxide, surface active substances such as rysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanins, dinitrophenol, and potentially useful human adjuvants such as BCG (bacille Calmette-Guerin) and Corynebacterium parvum.

[0324] Screening for the desired antibody can also be accomplished by a variety of techniques known in the art. Assays for immunospecific binding of antibodies may include, but are not limited to, radioimmunoassays, ELISAs (enzyme-linked immunosorbent assay), sandwich immunoassays, immunoradiometric assays, gel diffusion precipitation reactions, immunodiffusion assays, in situ immunoassays, Western blots, precipitation reactions, agglutination assays, complement fixation assays, immunofluorescence assays, protein A assays, and Immunoelectrophoresis assays, and the like (see, for example, Ausubel et al., Current Protocols in Molecular Biology, Vol. 1, John Wiley & Sons, Inc., New York (1994)). Antibody binding may be detected by virtue of a detectable label on the primary antibody. Alternatively, the antibody may be detected by virtue of its binding with a secondary antibody or reagent which is appropriately labelled. A variety of methods are known in the art for detecting binding in an immunoassay and are included in the scope of the present invention.

[0325] The antibody (or fragment thereof) raised against a polypeptide of the invention or a variant or fragment thereof, has binding affinity for that protein. Preferably, the antibody (or fragment thereof) has binding affinity or avidity greater than about 10.sup.5M.sup.-1, more preferably greater than about 10.sup.6 M.sup.-1, more preferably still greater than about 10.sup.7 M.sup.-1 and most preferably greater than about 10.sup.8 M.sup.-1.

[0326] In terms of obtaining a suitable amount of an antibody according to the present invention, one may manufacture the antibody(s) using batch fermentation with serum free medium. After fermentation the antibody may be purified via a multistep procedure incorporating chromatography and viral inactivation/removal steps. For instance, the antibody may be first separated by Protein A affinity chromatography and then treated with solvent/detergent to inactivate any lipid enveloped viruses. Further purification, typically by anion and cation exchange chromatography may be used to remove residual proteins, solvents/detergents and nucleic acids. The purified antibody may be further purified and formulated into 0.9% saline using gel filtration columns. The formulated bulk preparation may then be sterilised and viral filtered and dispensed.

[0327] Embodiments of the invention may utilise antisense technology to inhibit the expression of a nucleic acid of the invention or a fragment or variant thereof by blocking translation of the encoded polypeptide. Antisense technology takes advantage of the fact that nucleic acids pair with complementary sequences. Suitable antisense molecules can be manufactured by chemical synthesis or, in the case of antisense RNA, by transcription in vitro or in vivo when linked to a promoter, by methods known to those skilled in the art.

[0328] For example, antisense oligonucleotides, typically of 18-30 nucleotides in length, may be generated which are at least substantially complementary across their length to a region of the nucleotide sequence of the polynucleotide of interest. Binding of the antisense oligonucleotide to their complementary cellular nucleotide sequences may interfere with transcription, RNA processing, transport, translation and/or mRNA stability. Suitable antisense oligonucleotides may be prepared by methods well known to those of skill in the art and may be designed to target and bind to regulatory regions of the nucleotide sequence or to coding (gene) or non-coding (intergenic region) sequences. Typically antisense oligonucleotides will be synthesized on automated synthesizers. Suitable antisense oligonucleotides may include modifications designed to improve their delivery into cells, their stability once inside a cell, and/or their binding to the appropriate target. For example, the antisense oligonucleotide may be modified by the addition of one or more phosphorothioate linkages, or the inclusion of one or morpholine rings into the backbone (so-called `morpholino` oligonucleotides).

[0329] An alternative antisense technology, known as RNA interference (RNAi), may be used, according to known methods in the art (see for example WO 99/49029 and WO 01/70949), to inhibit the expression of a polynucleotide. RNAi refers to a means of selective post-transcriptional gene silencing by destruction of specific mRNA by small interfering RNA molecules (siRNA). The siRNA is generated by cleavage of double stranded RNA, where one strand is identical to the message to be inactivated. Double-stranded RNA molecules may be synthesised in which one strand is identical to a specific region of the p53 mRNA transcript and introduced directly. Alternatively corresponding dsDNA can be employed, which, once presented intracellularly is converted into dsRNA. Methods for the synthesis of suitable molecule for use in RNAi and for achieving post-transcriptional gene silencing are known to those of skill in the art.

[0330] A further means of inhibiting expression may be achieved by introducing catalytic antisense nucleic acid constructs, such as ribozymes, which are capable of cleaving mRNA transcripts and thereby preventing the production of wild type protein. Ribozymes are targeted to and anneal with a particular sequence by virtue of two regions of sequence complementarity to the target flanking the ribozyme catalytic site. After binding the ribozyme cleaves the target in a site-specific manner. The design and testing of ribozymes which specifically recognise and cleave sequences of interest can be achieved by techniques well known to those in the art (see for example Lieber and Strauss, 1995, Molecular and Cellular Biology, 15:540-551.

[0331] The invention will now be described with reference to specific examples, which should not be construed as in any way limiting the scope of the invention.

EXAMPLES

[0332] The invention will now be described with reference to specific examples, which should not be construed as in any way limiting the scope of the invention.

Example 1

Cyanobacterial Cultures and Characterisation of the SXT Gene Cluster

[0333] Cyanobacterial strains used in the present study (FIG. 1) were grown in Jaworski medium in static batch culture at 26.degree. C. under continuous illumination (10 .mu.mol m.sup.-2 s.sup.-1). Total genomic DNA was extracted from cyanobacterial cells by lysozyme/SDS/proteinase K lysis following phenol-chloroform extraction as described in Neilan, B. A. 1995. Appl Environ Microbiol 61:2286-2291. DNA in the supernatant was precipitated with 2 volumes -20.degree. C. ethanol, washed with 70% ethanol, dissolved in TB-buffer (10:1), and stored at -20.degree. C. PCR primer sequences used for the amplification of sxt ORFs are shown in FIG. 1B).

[0334] PCR amplicons were separated by agarose gel electrophoresis in TAB buffer (40 mM Tris-acetate, 1 mM EDTA, pH 7.8), and visualised by UV translumination after staining in ethidium bromide (0.5 .mu.g/ml). Sequencing of unknown regions of DNA was performed by adaptor-mediated PCR as described in Moffitt et al. (2004) Appl. Environ. Microbial. 70:6353-6362. Automated DNA sequencing was performed using the PRISM Big Dye cycle sequencing system and a model 373 sequencer (Applied Biosystems). Sequence data were analysed using ABI Prisrn-Autoassembler software, and percentage similarity and identity to other translated sequences determined using BLAST in conjunction with the National Center for Biotechnology Information (NIH), Fugue blast (http://www-cryst.bioc.cam.ac.uk/fugue/) was used to identify distant homologs via sequence-structure comparisons. The sxt gene clusters were assembled using the software Phred, Phrap, and Consed (http://www.phrap.org/phredphrapconsed.html), and open reading frames manually identified. GenBank accession numbers for the sxt gene cluster from C. raciborskii T3 is DQ787200.

Example 2

Mass Spectrometric Analysis of SXT Intermediates

[0335] Bacterial extracts and SXT standards were analysed by HPLC (Thermo Finnigan Surveyor HPLC and autosampler) coupled to an ion trap mass spectrometer (Thermo Finnigan LCQ Deca XP Plus) fitted with an electrospray source. Separation of analytes was obtained on a 2.1 mm.times.150 mm Phenomenex Luna 3 micron C18 column at 100 mL/min. Analysis was performed using a gradient starting at 5% acetonitrile in 10 mM heptafluorobutyric acid (HFBA) This was maintained for 10 min, then ramped to 100% acetonitrile, over 30 min. Conditions were held at 100% acetonitrile for 10 min to wash the column and then returned to 5% acetonitrile in 10 mM HFBA and again held for 10 min to equilibrate the column for the next sample. This resulted in a runtime of 60 min per sample. Sample volumes of 10-100 mL were injected for each analysis. The HPLC eluate directly entered the electrospray source, which was programmed as follows: electrospray voltage 5 kV, sheath gas flow rate 30 arbitrary units, auxiliary gas flow rate 5 arbitrary units. The capillary temperature was 200.degree. C. and had a voltage of 47 V. Ion optics were optimised for maximum sensitivity before sample analysis using the instruments autotune function with a standard toxin solution. Mass spectra were acquired in the centroid mode over the m/z range 145-650. Mass range setting was `normal`, with 200 ms maximum ion injection time and automatic gain control (AGC) on. Tandem mass spectra were obtained over a m/z range relevant to the precursor ion. Collision energy was typically 20-30 ThermoFinnigan arbitrary units, and was optimised for maximal information using standards where available.

Example 3

Identification and Sequencing of the SXT Gene Cluster in Cylindrospermopsis raciborskii T3

[0336] O-carbamoyltransferase was initially detected in C. raciborskii T3 via degenerate PCR, and later named sxtI. Further investigation showed that homologues of sxtI were exclusively present in SXT toxin-producing strains of four cyanobacterial genera (Table 1), thus representing a good candidate gene in SXT toxin biosynthesis. The sequence of the complete putative SXT biosynthetic gene cluster (sxt) was then obtained by genome walking up- and downstream of sxtI in C. raciborskii T3 (FIG. 3). In C. raciborskii T3, this sxt, gene cluster spans approximately 35000 bp, encoding 31 open reading frames (FIG. 2). The cluster also included other genes encoding SXT-biosynthesis enzymes, including a methyltransferase (sxtA1), a class II aminotransferase (sxtA4), an amidinotransferase (sxtG), dioxygenases (sxtH), in addition to the Ocarbamoyltransferase (sxtI). PCR screening of selected sxt open reading frames in toxic and non-toxic cyanobacteria strains showed that they were exclusively present in SXT toxin-producing isolates (FIG. 1A), indicating the association of these genes with the toxic phenotype. In the following passages we describe the open reading frames in the putative sxt gene cluster and their predicted functions, based on bioinformatic analysis, LCMS/MS data on biosynthetic intermediates and in vitro biosynthesis, when applicable.

Example 4

Functional Prediction of the Parent Molecule SXT Biosynthetic Genes

[0337] Bioinformatic analysis of the sxt gene cluster revealed that it contains a previously undescribed example of a polyketide synthase (PKS) like structure, named sxtA. SxtA possesses four catalytic domains, SxtA1 to SxtA4. An iterated. PSI-blast search revealed low sequence homology of SxtA1 to S-adenosylmethionine (SAM)-dependent methyltransferases. Further analysis revealed the presence of three conserved sequence motifs in SxtA1 (278-ITDMGCGDG-286, 359-DPENLLHI-366, and 424-VVNKHGLMIL-433) that are specific for SAMdependent methyltransferases. SxtA2 is related to GCN5-related N-acetyl transferases (GNAT). GNAT catalyse the transfer of acetate from acetyl-CoA to various heteroatoms, and have been reported in association with other unconventional PKSs, such as PedI, where they load the acyl carrier protein (ACP) with acetate. SxtA3 is related to an ACP, and provides a phosphopantetheinyl-attachment site. SxtA4 is homologous to class II aminotransferases and was most similar to 8-amino-7-oxononanoate synthase (AONS). Class II aminotransferases are a monophyletic group of pyridoxal phosphate (PLP)-dependent enzymes, and the only enzymes that are known to perform Claisen-condensations of amino acids. We therefore reasoned that sxtA performs the first step in SXT biosynthesis, involving a Claisen-condensation.

[0338] The predicted reaction sequence of SxtA, based on its primary structure, is the loading of the ACP (SxtA3) with acetate from acetyl-CoA, followed by the SxtA1-catalysed methylation of acetyl-ACP, converting it to propionyl-ACP. The class II aminotransferase domain, SxtA4, would then perform a Claisen-condensation between propionyl-ACP and arginine (FIG. 4). The putative product of SxtA is thus 4-amino-3-oxoguanidinoheptane which is here designated as Compound A', (FIG. 4). To verify this pathway for SXT biosynthesis based on comparative gene sequence analysis, cell extracts of C. raciborskii T3 were screened by LC-MS/MS for the presence of compound A' (FIG. 5) as well as arginine and SXT as controls. Arginine and SXT were readily detected (FIG. 5) and produced the expected fragment ions. On the other hand, LC-MS/MS data obtained from m/z 187 was consistent with the presence of structure A from C. raciborskii T3 (FIG. 5). MS/MS spectra showed the expected fragment ion (m/z 170, m/z 128) after the loss of ammonia and guanidine from A'. LC-MS/MS data strongly supported the predicted function of SxtA and thus a revised initiating reaction in the SXT biosynthesis pathway.

[0339] sxtG encodes a putative amidinotransferase, which had the highest amino acid sequence similarity to L-arginine:lysine amidinotransferases. It is proposed that the product of SxtA is the substrate for the amidinotransferase SxtG, which transfers an amidino group from arginine to the a-amino group A' (FIG. 4), thus producing 4,7-diguanidino-3-oxoheptane designated compound B' (FIG. 3). This hypothetical sequence of reactions was also supported by the detection of C' by LC-MS/MS (FIG. 4). Cell extracts from C. raciborskii T3, however, did not contain any measurable levels of B' (4,7-diguanidino-3-oxoheptane). A likely explanation for the failure to detect the intermediate B' is its rapid cyclisation to form C' via the action of SxtB.

[0340] The sxt gene cluster encodes an enzyme, sxtB, similar to the cytidine deaminase-like enzymes from g-proteobacteria. The catalytic mechanism of cytidine deaminase is a retro-aldol cleavage of ammonia from cytidine, which is the same reaction mechanism in the reverse direction as the formation of the first heterocycle in the conversion from B' to C' (FIG. 4). It is therefore suggested that SxtB catalyses this retroaldol-like condensation (step 4, FIG. 4).

[0341] The incorporation of methionine methyl into SXT, and its hydroxylation was studied. Only one methionine methyl-derived hydrogen is retained in SXT, and a 1,2-H shift has been observed between acetate-derived C-5 and C-6 of SXT. Hydroxylation of the methyl side-chain of the SXT precursor proceeds via epoxidation of a double-bond between the SAM-derived methyl group and the acetate derived C-6. This incorporation pattern may result from an electrophilic attack of methionine methyl on the double bond between C-5 and C-6, which would have formed during the preceding cyclisation. Subsequently, the new methylene side-chain would be epoxidated, followed by opening to an aldehyde, and subsequent reduction to a hydroxyl. Retention of only one methionine methyl-derived hydrogen, the 1,2-H shift between C-5 and C-6, and the lacking 1,2-H shift between C-1 and C-5 is entirely consistent with the results of this study, whereby the introduction of methionine methyl precedes the formation of the three heterocycles.

[0342] sxtD encodes an enzyme with sequence similarity to sterol desaturase and is the only candidate desaturase present in the sxt gene cluster, SxtD is predicted to introduce a double bond between C-1 and C-5 of C', and cause a 1,2-H shift between C-5 and C-6 (compound D', FIG. 3). The gene product of sxtS has sequence homology to non-heme iron 2-oxoglutaratedependent (2OG) dioxygenases. These are multifunctional enzymes that can perform hydroxylation, epoxidation, desaturation, cyclisation, and expansion reactions. 2OG dioxygenases have been reported to catalyse the oxidative formation of heterocycles. SxtS could therefore perform the consecutive epoxidation of the new double bond, and opening of the epoxide to an aldehyde with concomitant bicyclisation. This explains the retention of only one methionine methyl-derived hydrogen, and the lack of a 1,2-H shift between C-1 and C-5 of SXT (steps 5 to 7, FIG. 4). SxtU has sequence similarity to short-chain alcohol dehydrogenases. The most similar enzyme with a known function is clavaldehyde dehydrogenase (AAF86624), which reduces the terminal aldehyde of clavulanate-9-aldehyde to an alcohol. SxtU is therefore predicted to reduce the terminal aldehyde group of the SXT precursor in step 8 (FIG. 4), forming compound E'.

[0343] The concerted action of SxtD, SxtS and SxtU is therefore the hydroxylation and bicyclisation of compound C' to E' (FIG. 4). In support for this proposed pathway of SXT biosynthesis, LC-MS/MS obtained from m/z 211 and m/z 225 allowed the detection of compounds C' and E' from C. raciborskii T3 (FIG. 5). On the other hand, no evidence could be found by LC-MS/MS for intermediates B (m/z 216), and C (m/z 198). MS/MS spectra showed the expected fragment ions after the loss of ammonia and guanidine from C', as well as the loss of water in the case of E'.

[0344] The detection of E' indicated that the final reactions leading to the complete SXT molecule are the O-carbamoylation of its free hydroxyl group and a oxidation of C-12. The actual sequence of these final reactions, however, remains uncertain. The gene product of sxtI is most similar to a predicted Ocarbamoyltransferase from Trichodesmium erythraeum (accession ABG50968) and other predicted O-carbamoyltransferases from cyanobacteria. O-carbamoyltransferases invariably transfer a carbamoyl group from carbamoylphosphate to a free hydroxyl group. Our data indicate that SxtI may catalyse the transfer of a carbamoyl group from carbamoylphosphate to the free hydroxy group of E'. Homologues of sxtJ and sxtK with a known function were not found in the databases, however it was noted that sxtJ and sxtK homologues were often encoded adjacent to O-carbamoyltransferase genes.

[0345] The sxt gene cluster contains two genes, sxtH and sxtT, each encoding a terminal oxygenase subunit of bacterial phenyl-propionate and related ring-hydroxylating dioxygenases. The closest homologue with a predicted function was capreomycidine hydroxylase from Streptomyces vinaceus, which hydroxylates a ringcarbon (C-6) of capreomycidine. SxtH and SxtT may therefore perform a similar function in SXT biosynthesis, that is, the oxidation or hydroxylation and oxidation of C-12, converting F' into SXT.

[0346] Members belonging to bacterial phenylpropionate and related ring-hydroxylating dioxygenases are multi-component enzymes, as they require an oxygenase reductase for their regeneration after each catalytic cycle. The sxt gene cluster provides a putative electron transport system, which would fulfill this function. sxtV encodes a 4Fe-4S ferredoxin with high sequence homology to a ferredoxin from Nostoc punctiforme. sxtW was most similar to fumarate reductase/succinate dehydrogenase-like enzymes from A. variabilis and Nostoc punctiforme, followed by AsfA from Pseudomonas putida. AsfA and AsfB are enzymes involved in the transport of electrons resulting from the catabolism of aryl sulfonates. SxtV could putatively extract an electron pair from succinate, converting it to fumarate, and then transfer the electrons via ferredoxin (SxtW) to SxtH and SxtT.

Example 5

Comparative Sequence Analysis and Functional Assignment of SXT Tailoring Genes

[0347] Following synthesis of the parent molecule SXT, modifying enzymes introduce various functional groups. In addition to SXT, C. raciborskii T3 produces N-1 hydroxylated (neoSXT), decarbamoylated (dcSXT), and N-sulfurylated (GTX-5) toxins, whereas A. circinalis AWQC131C produces decarbamoylated (dcSXT), O-sulfurylated (GTX-3/2, dcGTX-3/2), as well as both O- and N-sulfurylated toxins (C-1/2), but no N-1 hydroxylated toxins.

[0348] sxtX encodes an enzyme with homology to cephalosporin hydroxylase. sxtX was only detected in C. raciborskii T3, A. flos-aquae NH-5, and Lyngbya wollei, which produce N-1 hydroxylated analogues of SXT, such as neoSXT. This component of the gene cluster was not present in any strain of A. circinalis, and therefore probably the reason why this species does not produce N-1 hydroxylated PST toxins (FIG. 1A). The predicted function of SxtX is therefore the N-1 hydroxylation of SXT.

[0349] A. circinalis AWQC131C and C. raciborskii T3 also produces N- and O-sulfated analogues of SXT (GTX-5, C-213, (dc)GTX-3/4). The activity of two 3'-phosphate 5'-phosphosulfate (PAPS)-dependent sulfotransferases, which were specific for the N-21 of SXT and GTX-3/2, and O-22 of 11-hydroxy SXT, respectively, has been described from the SXT toxin-producing dinoflagellate Gymnodinium catenatum. The sxt gene cluster from C. raciborskii T3 encodes a putative sulfotransferase, SxtN. A PSI-BLAST search with SxtN identified only 25 hypothetical proteins of unknown function with an E value above the threshold (0.005). A profile library search, however, revealed significant structural relatedness of SxtN to estrogen sulfotransferase (1AQU) (Z-score=24.02) and other sulfotransferases. SxtN has a conserved N-terminal region, which corresponds to the adenosine 3'-phosphate 5'-phosphosulfate (PAPS) binding region in 1AQU. It is not known, however, whether SxtN transfers a sulfate group to N-21 or O-22. Interestingly, the sxt gene cluster encodes an adenylylsulfate kinase (APSK), SxtO, homologues of which are involved in the formation of PAPS (FIG. 2). APKS phosphorylates the product of ATPsulfurylase, adenylylsulfate, converting it to PAPS. Other biosynthetic gene clusters that result in sulfated secondary metabolites also contain genes required for the production of PAPS.

[0350] Decarbarnoylated analogues of SXT could be produced via either of two hypothetical scenarios. Enzymes that act downstream of the carbamoyltransferase, SxtI, in the biosynthesis of PSP toxins are proposed to have broad substrate specificity, processing both carbamoylated and decarbamoylated precursors of SXT. Alternatively, hydrolytic cleavage of the carbamoyl moiety from SXT or its precursors may occur. SxtL is related to GDSL-lipases, which are multifunctional enzymes with thioesterase, arylesterase, protease and lysophospholipase activities. The function of SxtL could therefore include the hydrolytic cleavage of the carbamoyl group from SXT analogues.

Example 6

Cluster-Associated SXT Genes Involved in Metabolite Transport

[0351] sxtF and sxtM encoded two proteins with high sequence similarity to sodium-driven multidrug and toxic compound extrusion (MATE) proteins of the NorM family. Members of the NorM family of MATE proteins are bacterial sodium-driven antiporters, that export cationic substances, All of the PSP toxins are cationic substances, except for the C-toxins which are zwitterionic. It is therefore probable that SxtF and SxtM are also involved in the export of PSP toxins. A mutational study of NorM from V. parahaematolyticus identified three conserved negatively charged residues (D32, E251, and D367) that confer substrate specificity, however the mechanism of substrate recognition remains unknown. In SxtF, the residue corresponding to E251 of NorM is conserved, whereas those corresponding to D32 and D367 are replaced by the neutral amino acids asparagine and tyrosine, respectively. Residues corresponding to D32 and E251 are conserved in SxtM, but D367 is replaced by histidine. The changes in substrate-binding residues may reflect the differences in PSP toxin substrates transported by these proteins.

Example 7

Putative Transcriptional Regulators of Saxitoxin Synthase

[0352] Environmental factors, such as nitrogen and phosphate availability have been reported to regulate the production of PSP toxins in dinoflagellates and cyanobacteria. Two transcriptional factors, sxtY and sxtZ, related to PhoU and OmpR, respectively, as well as a two component regulator histidine kinase were identified proximal to the 3'-end of the sxt gene cluster in C. raciborskii T3. PhoU-related proteins are negative regulators of phosphate uptake whereas OmpR-like proteins are involved in the regulation of a variety of metabolisms, including nitrogen and osmotic balance. It is therefore likely that PSP toxin production in C. raciborskii T3 is regulated at the transcriptional level in response to the availability of phosphate, as well as, other environmental factors.

Example 8

Phylogenetic Origins of the SXT Genes

[0353] The sxt gene cluster from C. raciborskii T3 has a true mosaic structure. Approximately half of the sxt genes of C. raciborskii T3 were most similar to counterparts from other cyanobacteria, however the remaining genes had their closest matches with homologues from proteobacteria, actinomycetes, sphingobacteria, and firmicutes. There is an increasing body of evidence that horizontal gene transfer (HGT) is a major driving force behind the evolution of prokaryotic genomes, and cyanobacterial genomes are known to be greatly affected by HGT, often involving transposases and phages. The fact that the majority of sxt genes are most closely related to homologues from other cyanobacteria, suggests that SXT biosynthesis may have evolved in an ancestral cyanobacterium that successively acquired the remaining genes from other bacteria via HGT. The structural organisation of the investigated sxt gene cluster, as well as the presence of several transposases related to the IS4-family, suggests that small cassettes of sxt genes are mobile.

Example 9

Cyanobacterial Cultures and Characterisation of the CYR Gene Cluster

[0354] Cyanobacterial strains were grown in Jaworski medium as described in Example 1 above. Total genomic DNA was extracted from cyanobacterial cells by lysozyme/SDS/proteinase K lysis following phenol-chloroform extraction as described previously Neilan, B. A. 1995. Appl Environ Microbiol 61:2286-2291. DNA in the supernatant was precipitated with 2 volumes -20.degree. C. ethanol, washed with 70% ethanol, dissolved in TE-buffer (10:1), and stored at -20.degree. C.

[0355] Characterization of unknown regions of DNA flanking the putative cylindrospermopsin biosynthesis genes was performed using an adaptor-mediated PCR as described in Moffitt et al. (2004) Appl. Environ. Microbiol. 70:6353-6362. PCRs were performed in 20 .mu.l reaction volumes containing 1.times.Taq polymerase buffer 2.5 mM MgCl.sub.2, 0.2 mM deoxynucleotide triphosphates, 10 .mu.mol each of the forward and reverse primers, between 10 and 100 ng genomic DNA and 0.2 U of Taq polymerase (Fischer Biotech, Australia). Thermal cycling was performed in a GeneAmp PCR System 2400 Thermal cycler (Perkin Elmer Corporation, Norwalk, Conn.). Cycling began with a denaturing step at 94.degree. C. for 3 min followed by 30 cycles of denaturation at 94.degree. C. for 10 s, primer annealing between 55.degree. and 65.degree. C. for 20 s and a DNA strand extension at 72.degree. C. for 1-3 min. Amplification was completed by a final extension step at 72.degree. C. for 7 min. Amplified DNA was separated by agarose gel electrophoresis in TAE buffer (40 mM Tris-acetate, 1 mM EDTA, pH 7.8), and visualized by UV transillumination after staining with ethidium bromide (0.5 .mu.g/ml).

[0356] Automated DNA sequencing was performed using the PRISM Big Dye cycle sequencing system and a model 373 sequencer (Applied Biosystems, Foster City, Calif.). Sequence data were analyzed using ABI Prism-Autoassembler software, while identity/similarity values to other translated sequences were determined using BLAST in conjunction with the National Center for Biotechnology Information (NIH, Bethesda, Md.). Fugue blast (http://www-cryst.bioc.cam.ac.uk/fugue/) was used to identify distant homologs via sequence-structure comparisons. The gene clusters were assembled using the software Phred, Phrap, and Consed (http://www.phrap.org/phredphrapconsed.html), open reading frames were manually identified. Polyketide synthase and non-ribosomal peptide synthetase domains were determined using the specialized databases based on crystal structures (http://www-ab.informatik.uni-tuebingen.de/software/NRPSpredictor; http://www.tigr.org/jravel/nrps/, http://www.nii.res.in/nrps-pks.html).

Example 10

Genetic Screening of Cylindrospermopsin-Producing and Non-Producing Cyanobacterial Strains

[0357] Cylindrospermopsin-producing and non-producing cyanobacterial strains were screened for the presence of the sulfotransferase gene cyrJ using the primer set cynsulfF (5' ACTTCTCTCCTTTCCCTATC 3') (SEQ ID NO: 111) and cylnamR (5' GAGTGAAAATGCGTAGAACTTG 3') (SEQ ID NO: 112). Genomic DNA was tested for positive amplification using the 16S rRNA gene primers 27F and 809 as described in Neilan et al. (1997) Int. J. Syst. Bacteriol. 47:693-697. Amplicons were sequenced, as described in Example 9 above, to verify the identity of the gene fragment.

[0358] The biosynthesis of cylindrospermopsin involves an amidinotransferase, a NRPS, and a PICS (AoaA, AoaB and AoaC, respectively). In order to obtain the entire sequence of the cylindrospermopsin biosynthesis gene cluster, we used adaptor-mediated `gene-walking` technology, initiating the process from a partial sequence of the amidinotransferase gene from C. raciborskii AWT205. Successive outward facing primers were designed and the entire gene cluster spanning 43 kb was sequenced, together with a further 3.5 kb on either side of the toxin gene cluster.

[0359] These flanking regions encode putative accessory genes (hyp genes), which include molecular chaperons involved in the maturation of hydrogenases. Due to the fact that these genes are flanking the cylindrospermopsin gene cluster at both ends, we postulate that the toxin gene cluster was inserted into this area of the genome thus interrupting the HYP gene cluster. This genetic rearrangement is mechanistically supported by the presence of transposase-like sequences within the cylindrospermopsin cluster.

[0360] Bioinformatic analysis of the toxin gene cluster was performed and based on gene function inference using sequence alignments (NCBI BLAST), predicted structural homologies (Fugue Blast), and analysis of PKS and NRPS domains using specialized blast servers based on crystal structures. The cylindrospermopsin biosynthesis cluster contains 15 ORFs, which encode all the functions required for the biosynthesis, regulation and export of the toxin cylindrospermopsin (FIG. 6).

Example 11

Formation of the CYR Carbon Skeleton

[0361] The first step in formation of the carbon skeleton of cylindrospermopsin involves the synthesis of guanidinoacetate via transamidination of glycine. CyrA, the AoaA homolog, which encodes an amidinotransferase similar to the human arginine:glycine amidinotransferase GATM, transfers a guanidino group from a donor molecule, most likely arginine, onto an acceptor molecule of glycine thus forming guanidinoacetate (FIG. 8, step 1).

[0362] The next step (FIG. 8, step 2) in the biosynthesis is carried out by CyrB (AoaB homolog), a mixed NRPS-PKS. CyrB spans 8.7 kb and encodes the following domains; adenylation domain (A domain) and a peptidyl carrier protein (PCP) of an NRPS followed by a {tilde over (.beta.)}ketosynthase domain (KS), acyltransferase domain (AT), dehydratase domain (DH), methyltransferase domain (MT), ketoreductase domain (KR), and an acyl carrier protein (ACP) of PKS origin. CyrB therefore must catalyse the second reaction since it is the only gene containing an A domain that could recruit a starter unit for subsequent PKS extensions. The specific amino acid activated by the CyrB A domain cannot be predicted as its substrate specificity conferring residues do not match any in the available databases (http://www-ab.informatik.uni-tuebingen.de/sofrware/NRPSpredictor; http://www.tigr.org/jravel/nrps/, http://www.nii.res.n/nrps-pks.html). So far, no other NRPS has been described that utilizes guanidinoacetate as a substrate. The A domain is thought to activate guanidinoacetate, which is then transferred via the swinging arm of the peptidyl carrier protein (PCP) to the KS domain. The AT domain activates malonyl-CoA and attaches it to the ACP. This is followed by a condensation reaction between the activated guanidinoacetate and malonyl-CoA in the KS domain. CyrB contains two reducing modules, KR and DH. Their concerted reaction reduces the keto group to a hydroxyl followed by elimination of H.sub.2O, resulting in a double bond between C13 and C14. The methyl transferase (MT) domain identified in CyrB via the NRPS/PKS databases (Example 9 above), is homologous to S-adenosylmethionine (SAM) dependent MT. It is therefore suggested that the MT methylates C13. It is proposed that a nucleophilic attack of the amidino group at N19 onto the newly formed double bond between C13 and C14 occurs via a `Michael addition`. The cyclization follows Baldwin's rules for ring closure (Baldwin et al. (1997) J. Org. Chem. 42; 3846-3852), resulting in the formation of the first ring in cylindrospermopsin. This reaction could be spontaneous and may not require enzymatic catalysis, as it is energetically favourable. This is the first of three ring formations.

[0363] The third step (FIG. 8, step 3) in the biosynthesis involves CyrC (AoaC homology, which encodes a PKS with KS, AT, KR, and ACP domains. The action of these domains results in the elongation of the growing chain by an acetate via activation of malonyl-CoA by the AT domain, its transfer to ACP and condensation at the KS domain with the product of CyrB. The elongated chain is bound to the ACP of CyrC and the KR domain reduces the keto group to a hydroxyl group on C12. The PKS module carrying out this step contains a KR domain and does not contain a DH domain, this corresponds only to CyrC.

[0364] Following the catalysis of enzyme CyrC is CyrD (FIG. 8, step 4), a PKS with five modules; KS, AT, DH, KR, and an ACP. The action of this PKS module on the product of CyrC results in the addition of one acetate and the reduction of the keto group on C10 to a hydroxyl and dehydration to a double bond between C9 and C10. This double bond is the site of a nucleophilic attack by the amidino group N19 via another Michael addition that again follows Baldwin's rules of ring closure, resulting in the formation of the second ring, the first 6-membered ring made in cylindrospermopsin.

[0365] The product of CyrD is the substrate for CyrE (step 5 in FIG. 8), a PKS containing a KS, AT, DH, KR domains and an ACP. Since this sequence of domains is identical to that of CyrD, it is not possible at this stage to ascertain which PKS acts first, but as their action is proposed to be identical it is immaterial at this point. CyrE catalyzes the addition of one acetate and the formation of a double bond between C7 and C8. This double bond is attacked by N18 via a Michael addition and the third cyclisation occurs, resulting in the second 6-member ring.

[0366] CyrF is the final PKS module (step 6 of FIG. 8) and is a minimal PKS containing only a KS, AT, and ACP. CyrF acts on the product of CyrE and elongates the chain by an acetate, leaving C4 and C6 unreduced.

[0367] Step 7 in the pathway (FIG. 8) involves the formation of the uracil ring, a reaction that is required for the toxicity of the final cylindrospermopsin compound. The cylindrospermopsin gene cluster encodes two enzymes with high sequence similarity (87%) that have been denoted CyrG and CyrH. A Psi-blast search (NCBI) followed by a Fugue profile library search (see materials and methods) revealed that CyrG and CyrH are most similar to the enzyme family of amidohydrolases/ureases/dihydroorotases, whose members catalyze the formation and cleavage of N--C bonds. It is proposed that these enzymes transfer a second guanidino group from a donor molecule, such as arginine or urea, onto C6 and C4 of cylindrospermopsin resulting in the formation of the uracil ring. These enzymes carry out two or three reactions depending on the guanidino donor. The first reaction consists of the formation of a covalent bond between the N of the guanidino donor and C6 of cylindrospermopsin followed by an elimination of H.sub.2O forming a double bond between C5 and C6. The second reaction catalyses the formation of a bond between the second N on the guanidino donor and C4 of cylindrospermopsin, co-committently with the breaking of the thioester bond between the acyl carrier protein of CyrE and cylindrospermopsin, causing the release of the molecule from the enzyme complex. Feeding experiments with labeled acetate have shown that the oxygen at C4 is of acetate origin and is not lost during biosynthesis, therefore requiring the de novo formation of the uracil ring. The third reaction--if required--would catalyze the cleavage of the guanidino group from a donor molecule other than urea. The action of CyrG and CyrH in the formation of the uracil ring in cylindrospermopsin describes a novel biosynthesis pathway of a pyrimidine.

[0368] One theory suggest a linear polyketide which readily assumes a favorable conformation for the formation of the rings. Cyclization may thus be spontaneous and not under enzymatic control. These analyses show that this may happen step-wise, with successive ring formation of the appropriate intermediate as it is synthesized. This mechanism also explains the lack of a thioesterase or cyclization domain, which are usually associated with NRPS/PKS modules and catalyze the release and cyclization of the final product from the enzyme complex.

Example 12

CYR Tailoring Reactions

[0369] Cylindrospermopsin biosynthesis requires the action of tailoring enzymes in order to complete the biosynthesis, catalyzing the sulfation at C12 and hydroxylation at C7. Analysis of the cylindrospermopsin gene cluster revealed three candidate enzymes for the tailoring reactions involved in the biosynthesis of cylindrospermopsin, namely CyrI, CyrJ, and CyrN. The sulfation of cylindrospermopsin at C12 is likely to be carried out by the action of a sulfotransferase. CyrJ encodes a protein that is most similar to human 3'-phosphoadenylyl sulfate (PAPS) dependent sulfotransferases. The cylindrospermopsin gene cluster also encodes an adenylsulfate kinase (ASK), namely CyrN. ASKs are enzymes that catalyze the formation of PAPS, which is the sulfate donor for sulfotransferases. It is proposed that CyrJ sulfates cylindrospermopsin at C12 while CyrN creates the pool of PAPS required for this reaction. Screening of cylindrospermopsin producing and non-producing strains revealed that the sulfotransferase genes were only present in cylindrospermopsin producing strains, further affirming the involvement of this entire cluster in the biosynthesis of cylindrospermopsin (FIG. 7). The cyrJ gene might therefore be a good candidate for a toxin probe, as it is more unique than NRPS and PKS genes and would presumably have less cross-reactivity with other gene clusters containing these genes, which are common in cyanobacteria. The final tailoring reaction is carried out by CyrI. A Fugue search and an iterated Psi-Blast revealed that CyrI is similar to a hydroxylase belonging to the 2-oxoglutarate and Fe(II)-dependent oxygenase superfamily, which includes the mammalian Prolyl 4-hydroxylase alpha subunit that catalyze the hydroxylation of collagen. It is proposed that CyrI catalyzes the hydroxylation of C7, a residue that, along with the uracil ring, seems to confer much of the toxicity of cylindrospermopsin. The hydroxylation at C7 bp CyrI is probably the final step in the biosynthesis of cylindrospermopsin.

Example 13

CYR Toxin Transport

[0370] Cylindrospermopsin and other cyanobacterial toxins appear to be exported out of the producing cells. The cylindrospermopsin gene cluster contains an ORF denoted CyrK, the product of which is most similar to sodium ion driven multi-drug and toxic compound extrusion proteins (MATE) of the NorM family. It is postulated that CyrK is a transporter for cylindrospermopsin, based on this homology and its central location in the cluster. Heterologous expression and characterization of the protein are currently being undertaken to verify its putative role in cylindrospermopsin export.

Example 14

Transcriptional Regulation of the Toxin Gene Cluster

[0371] Cylindrospermopsin production has been shown to be highest when fixed nitrogen is eliminated from the growth media (Saker et al. (1999) J. Phycol 35:599-606). Flanking the cylindrospermopsin gene cluster are "hyp" gene homologs involved in the maturation of hydrogenases. In the cyanobacterium Nostoc PCC73102 they are under the regulation of the global nitrogen regulator NtcA, that activates transcription of nitrogen assimilation genes. It is plausible that the cylindrospermopsin gene cluster is under the same regulation, as it is located wholly within the "hyp" gene cluster in C. raciborskii AWT205, and no obvious promoter region in the cylindrospermopsin gene cluster could be identified.

[0372] Finally, the cylindrospermopsin cluster also includes an ORF at its 3'-end designated CyrO. By homology, it encodes a hypothetical protein that appears to possess an ATP binding cassette, and is similar to WD repeat proteins, which have diverse regulatory and signal transduction roles. CyrO may also have a role in transcriptional regulation and DNA binding. It also shows homology to AAA family proteins that often perform chaperone-like functions and assist in the assembly, operation, or disassembly of protein complexes. Further insights into the role of CyrO are hindered due to low sequence homology with other proteins in databases.

[0373] The foregoing describes preferred forms of the present invention. It is to be understood that the present invention should not be restricted to the particular embodiment(s) shown above. Modifications and variations, obvious to those skilled in the art can be made thereto without departing from the scope of the present invention.

Sequence CWU 1

1

186137606DNACylindrospermopsis raciborskii T3 1atgatcccag ctaaaaaagt ttatttttta ttgagtttag caatagttat ttcacccttt 60ttatccatga ttgtgggtat ttacgaaaat attaaattta gggtattatt tgatttggtg 120gtcagggcac taatggtggt tgactgcttc aatatcaaaa aacatcgggt caaaattagt 180cgtcaattac ctctacgttt atctattgga cgtgagaatt tagtaatatt gaaggtagag 240tctgggaatg tcaatagtgc tattcaaatt cgtgattact atcccacaga atttcccgta 300tccacatcta acctgatagt taaccttccc cctaatcata ctcaggaagt aaagtacacc 360attcgaccta atcaacgggg agaattttgg tggggaaata ttcaagttcg acagctggga 420aattggtctc tagggtggga caattggcaa attccccaaa aaactgtggc taaggtgtat 480cctgatttgt taggactcag atccctcgct attcgtttaa ccctacaatc ttctggatct 540atcactaaat tgcgtcaacg gggaatggga acggaatttg ccgaactccg taattactgc 600atgggggatg atctacggtt aattgattgg aaagctacag ctagacgtgc ttatggaaat 660ctgagtcccc tagtaagagt tttagagcct caacaggaac aaactctgct tatattatta 720gatcgtggta gactaatgac agctaatgta caagggttaa aacgatatga ttggggttta 780aataccacct tgtctttggc attagcagga ttacataggg gcgatcgcgt aggagtaggg 840gtatttgact cccagctgca tacctggata cctccagagc gaggacaaaa tcatctcaat 900cggcttatag acagacttac acctattgaa ccagtgttag tggagtctga ttatttaaat 960gccattacct atgtagtaaa acaacagact cgtagatctc tagtagtgtt aattactgat 1020ttagtcgatg ttactgcttc ccatgaacta ctagtagcgc tgtgtaaatt agtgcctcga 1080tatctacctt tttgtgtaac actcagggat cctgggattg ataaaatagc tcataatttt 1140agtcaagact taacacaggc ttataatcga gcagtttctt tggacttgat atcacaaaga 1200gaaattgctt ttgctcagtt gaaacaacag ggagttttgg tgttggatgc accagcaaat 1260caaatttccg agcagttggt agaaaggtac ttacaaatca aagccaaaaa tcagatttga 1320ctccctgtcg agataattga gaacttctgg aaagaatagc ccaataaact cgacaaagaa 1380cgtggttaga agttctttaa agagtctatc atgccgaatc atattttaac agaagagcga 1440tcgctcttcc taagggatag agtctgaaag ccacttcaac ggacgataat gcaactcttg 1500ttccagctgg agtgcggaga attaccacat ccgaaataga caaaaagaaa taattggagt 1560taagaagata agtacataaa tagtgataat atacaaaact agtcagcacg gattaaattt 1620actaatgata gatacaatat cagtactatt aagagagtgg actgtaattt cccttacagg 1680tttagccttc tggctttggg aaattcgctc tcccttccat caaattgaat acaaagctaa 1740attcttcaag gaattgggat gggcgggaat atcattcgtc tttagaaatg tttatgcata 1800tgtttctgtg gcaattataa aactattgag ttctctattt atgggagagt cagcaaattt 1860tgcaggagta atgtatgtgc ccctctggct gaggatcatc actgcatata tattacagga 1920cttaactgac tatctattac acaggacaat gcatagtaat cagtttcttt ggttgacgca 1980caaatggcat cattcaacaa agcaatcatg gtggctgagt ggaaacaaag atagctttac 2040cggcggactt ttatatactg ttacagcttt gtggtttcca ctgctggaca ttccctcaga 2100ggttatgtct gtagtggcag tacatcaagt gattcataac aattggatac acctcaatgt 2160aaagtggaac tcctggttag gaataattga atggatttat gttacgcccc gtattcacac 2220tttgcatcat cttgatacag ggggaagaaa tttgagttct atgtttactt tcatcgaccg 2280attatttgga acctatgtgt ttccagaaaa ctttgatata gaaaaatcta aaaatagatt 2340ggatgatcaa tcagtaacgg tgaagacaat tttgggtttt taatagactt gggttctaag 2400tggaatggac ggaaaaaatg gcggttaccc gcatctttaa tatatcctct ttttggggtt 2460gagatttgga taaagcggct tgtactctgt cattattcaa atagccatgg cgttgcatat 2520ttgcgggatg atttaagatt ttctcctaat ttgaaaaatt tctcttgtag gacgattgcg 2580aagcactcgc gagattgcat tattaataaa accctgatag tcacccccaa cttattgcag 2640aaaaactttt ttctcttagg taataaatta gtagtttaat tgaaaagcat agcatctctt 2700ttgacttgga ataacaaaat gtcttacgat gtagtctagc taaatagtga cgcaaacgac 2760tgttttctcc ctcaactcta gtcattgatg ttttactaat aatttggtct ccatcgggaa 2820taaattttgg gtaaacttta tagccatccg taatccaaaa ataggatttc caatgctcta 2880tctttttcca taatttggca aatgttttgg cacttctatc tcccactaca tattgaataa 2940ttcccgaacg tttgttatct acaactgtcc agacccatat cttgtttttt tttaccaata 3000aatgtttcca actcatccag ttgacaaact tcaggtgttt gggaattatt attactatct 3060gataactgac gacctagctt tttgacccaa cgaatgactg tattgtgatt tactttagtc 3120attctttcaa ttgccctaaa tccattccca tttacataca tggttaaaca tgcttccttt 3180acttcttggg aataacctct aggagaataa gattcaataa attgacgacc acaattcttg 3240cattgataat tttgttttcc ccttctctgg ccattttttc taatattatt ggaatcacag 3300tttgaacagt tcatcttgat ttcttcctcg cggcgatcgc ctgctaaaaa ttcttcccct 3360tattatacat catcccgtgc aggtgcaacg cccaaatagc catagtttat gatcggtatc 3420gaattcgcta ttgttttttc tgccatatcc cttacctaag atgggacgat attcgctcat 3480aataccactg tcaattagat catcagcaac atggtgagtg tatcctgacg accatcgata 3540tggccaccaa gatcactagc taccccactg ggcaacaatt cgagtaaaag cgagtagccc 3600tactgtagca ttgaaaccat ccaagtttga agttaaatac ctaaaattat gacctcattt 3660tcatttctag acgttcagca acgggcatta actcacgtat cagatcaaag tttcctacgt 3720tccgtctcat ccagtctaat aagaattttt ctccttcatc tagcttacct ttatcatcaa 3780caaaaaccat ctgctcgcac caatctacaa atccggaatt agtcatctca tagactaaaa 3840tgatgggagg aaagtgtgcg aatcccattt tttcaatgac ttccatacaa accagcttaa 3900atacttgttc gtttgtcaat tcattagaca taaagaattt tcctttaatc aattctgttt 3960ctaatcctac cacagagtaa taactcttgg tctggaacat aaattattct gtttttatca 4020atgcgtaagt cataacttat tacttgacgg agttgcaggg gcatacctta acttgacctt 4080gggagcgata gaagaaagga aggcttcagt gacgggtctt tgactaatcc cagtttccac 4140ttcaactaaa acagcatcac aaatgtcgaa tagtgattga gaatatctat tcatattcat 4200gaaagtcaga gcagattcca tcggagacat ggatgaatta aaggcagcgt tttcagcgta 4260tcgacctgta aatatattcc cgtgggaatc ttttaacgct acccctgcaa aatttttcgt 4320gtagggagca taactttgat tggcagcgga tagagcagca agcacaacat catcggtaga 4380ataggtctcc agatcatgaa atactgtttg cattaatcca cctgtgagtc ctagatccgc 4440tggtccaaat ggctcgggta gaaaatgtgg gagtttattt gaggtataag tttgctcagg 4500ctgtgattca ttagacttca caagaagaac aaaattttga tttacagttg ccatctcgta 4560taaaaattgt cggcagtatc cacatggtgc ttcgtggatt gctaatgctt gtaaaccggt 4620ttctccgtgc aaccacgcat ttatggtggc ggattgttct gcgtgaactg agaaactaag 4680tgcctgtcct acaaattcca tgtcggcacc aaaataaaga gttccagaac ccagttgatt 4740cttagattgt ggtttaccaa gagcgatcgc ccctacataa aactgcgata ttggtaccct 4800agcataagtt gcggctacgg gtagtaattg aatcattaac gtactaatat tagtaccaag 4860tcgatcaatc caagatgcga caacacttga gtcaattaca gcatgttggg caagaattgt 4920ccttaactct gattgaatgg aacgtggaac cttggcaatc gcctgttcta atgctacatg 4980ggtcatttgg gttattcttg gacagagaga taaagatata ttagttttta tgaatcaatt 5040tcccacttaa tgcttgagta tgttttcctc ctgcttacaa ggcaaagctt tccttttttg 5100tagcaaatcc caaactgctt tgagagattt aattgcttgg tctatctcct cttcggtatt 5160ggcggctgta atcgaaaacc ttaaagcact tttatttaaa ggtacgattg gaaaaatagc 5220aggagtaatt aaaataccat attcccaaag gagttgacac acatcaatca tgtgttgagc 5280atctcccact aacacgccta cgatgggaac gtaaccatag ttatccactt cgaatccaat 5340ggctcttgct tgtgtaacca atttgtgagt taggtgataa atttgttttc ttaactgctc 5400cccctcctga cgattcacct gtaatccggc taaggcactt gccaaactcg caacaggaga 5460aggaccagaa aatatggcag tccaagcgtt gcggaagttg gttttgatcc ggcgatcgcc 5520acaagttaag aatgctgcgt aagaagaata ggctttggac aaaccagcta catagatgat 5580attatcctct gcaaaccgca ggtcaaaata attcaccatc ccgtttcctt tgtaaccgta 5640aggcatatcg ctgctgggat tttcgcccaa aatgccaaaa ccatgagcat catccatgta 5700aattaaggca ttgtactctt ttgccagatg cacgtaagct ggcagatcgg gaaaatctgc 5760cgacatggaa tacacgccat caatgacaat aatctttact tgttcaggcg gatattttgc 5820tagtttttcg gctaaatcgt tcaaatcatt atgtcgatat tggatgaact gggctccttt 5880gtgctgagcc agacagcacg cttcataaat acaacgatgt gcagctatgt caccaaagat 5940gacaccatta ttcccagtta atagtggtaa aattcctatc tgaagcagtg ttacagctgg 6000aaatactaaa acatcaggta cgcctaaaag tttggacaat tcttcctcca attcctcata 6060aattgctggg gaagcaacaa gccgagtcca gcttggatgt gtgccccatt tatccaaagc 6120tggtggaatt gcttccttaa cttttggatg caagtcaaga cctaaatagt tgcaagaagc 6180aaagtctatc acccaatgtc cgtcaattag caccttgcga ccttgttgtt ctgtgacgac 6240tcttgtgact tgaggaattt tttgttggtt aactacgttt tccagagtgt tgatttcgtt 6300ggctgagtca acaggtggag ctagatcaga ttgtttctct tgtaccactt ggttttggaa 6360ataagtgatg atggcagttg gagtgttctt ttgtaaaaag aacgttccag acagattgat 6420ccctaaacgt tcctctagga gcgtttgcag ttctaataaa tctaaagaat ctaatcccat 6480atccagcagt ttttgttgtg gagcgtaggc tgcctgacgt tgggaaccca ttacttttaa 6540gatgcattct ttaacgagat ccgctacagt tttgttttcc ttagttgcag atgttgcttt 6600tggtaccaat gaaccaattg ctgagttaat atacggtcct ttgcgatcac caggcgagtg 6660caaagcactg tcgcgcaggt tatattcaat caaaataccc atgccgagat tatctgtatc 6720ttccggacga taattagcaa taattcccct aatttcggct cctcccgaca catggaaacc 6780cacaattgga tccagaagct gtcgttgctc attgtgtagc tttaaatact ccatcatcgg 6840catttgggaa taattgacat aatttcgaca gcgagttaca cccaccacgc tctcaatgcc 6900gcctttcagg gtacagtagt aaagcataaa gtcccgcaat tcatttccta acccccgcgc 6960ctgaaactca ggtagaatat ttagtgcgag cagttgaata actgaccctt ggggagtatg 7020taacgtcggc acttgcgcat attttacatt ctctaatgcc tcagtgctgg taattgtttg 7080ggaataaatc gcaccaataa tttgatcttc tataatcagc actaaattac cttgcgggtt 7140tagctcaagt cttcgccgaa tttcatgagt agatgcccgt aaattttctg gccaacactt 7200gacctccaag tcaactaagg caggtaaatc tgacaaatag gcatgactaa ttttgtaagg 7260tcttttctcg aagtaattaa gcgtaatgcg agtaaaagga aatgtttttg ggtatctttt 7320agaaagctct agttttggaa atagacctac ttgtgcagca gacatgagaa aaacctcagc 7380ttccacaaga tactgctgag aaaatccctg aaacgcatcg aaatgtaagt tttcgctttt 7440gtctaaaaac tgatagacta cccttggttc caaacaatgg acctccaaaa tcattaaacc 7500gtgtttattg accacttgag accatctttc taagtgttcc accaaacttt gcaccataac 7560atgaggagga ataagctctc cttgatcatc gacacagact gattggtaag gtaagtgagc 7620acgttctttc aattcgtttc ttttctgagg aggaataaag agacgatcat ggtcgaggaa 7680cgaacggatg tgcaggatat tttcgggatc atgaatgcca tgagcttcta aagaacgcac 7740catttgttct gggttcccaa tatctccctg taaaactaag tggggaaggc tagcaagggt 7800gcgtgtggta gcttttaaag aagcttcgtt ataatctaca cctataagac gcaggggata 7860ctgttcgagt gcttttcccc tagcagactt aaattgaatg gtttcccaga ctcgtttcag 7920gagagttcca tcgccacacc ccatgtcagt aatgtatttg ggttgttctt ctaatggcaa 7980ctgattgaat actgagagga tactttcttc taaatcggca aaatatttct ggtgttgaaa 8040tccactcccg atcacgttaa gggtgcgatc aatgtgcctt tcgtgaccgg aagcatctct 8100ttggaatacg gagagacaat tgccaaacaa tacatcatga atgcgggaca acataggagt 8160gtaggacgcc actatggctg tattcaaggc tcgctctccc ataaatcgac caagttcggt 8220tatggtcaaa cgacctgctg taaggtcagc ccagccaagg tggagaaata acttacccaa 8280ctcttcttgc actgttgagc ttaatgagga gagcaaaggt ttgtcctccg aatctgcaag 8340caagttgtgt ttgtgcagtg ccagcaggag tgggatgacc agtaatccat ctaaaaaatc 8400tgccattagg ggattgtcca ggttccacaa ttggcaagaa cgctcaatcc atcttcccag 8460caaatttcct tgtttccctt ctaaataaga ctgaattggt aggttgtaca attgaagaat 8520gtcttccgaa attttgttgt gaatcgctgc ttctgcggtt agagagtatt taagctcctt 8580atttcgggaa agccaatgta aagactcgag catcctcaaa gcaacttgaa aatgtccgct 8640gttagctccc agatgttcca ccatttggtt taaagagaga ggactttcat cggcgagtaa 8700ttcaaaaaca cctttttctc gacacgcaag aataacggga accgccacaa agccgtgagt 8760ataacgatta atcttttgta acatttagac gattattgat taatttatga ggaatgcatt 8820tttagtgcat accacgagat tttgattgtc tcagaagttg tgtgaaaaag caagacaagt 8880agaccaaaaa aataagctaa ataagtgtag tagcaataaa aagacgaatc gcaattgtac 8940gtgtcttgac taacaagcca agtctctcta gataataatc gccctctacc agttgcgtaa 9000gtcccattgt tgttttaaac tttaattgct aattaaacag ttatcaaatc ctgttcataa 9060cggatattta cagcaatttt cggttatata aaattgcata tactgtaagt aatagcagaa 9120aattaattta ggtaggaaaa tgttgaaaga tttcaaccag tttttaatca gaacactagc 9180attcgtattc gcatttggta ttttcttaac cactggagtt ggcattgcta aagctgacta 9240cctagttaaa ggtggaaaga ttaccaatgt tcaaaatact tcttctaacg gtgataatta 9300tgccgttagt atcagcggtg ggtttggtcc ttgcgcagat agagtgatta tcctaccaac 9360ttcaggagtg ataaatcgag acattcatat gcgtggctat gaagccgcat taactgcact 9420atccaatggc tttttagtag atatttacga ctatactggc tcttcttgca gcaatggtgg 9480ccaactaact attaccaacc aattaggtaa gctaatcagc aattaggttg tatcatgata 9540agatgaagta gtttaaccat ggcaccacca gccaaaaact ttttaacgct agggtgtaac 9600agttatgggt gtggaatgta ggttgtatcc agtgcatgaa acagccataa ttttagtata 9660agcaaacact aagattggag aattcatgga aacaacctca aaaaaattta agtcagatct 9720gatattagaa gcacgagcaa gcctaaagtt gggaatcccc ttagtcattt cacaaatgtg 9780cgaaacgggt atttatacag cgaatgcagt catgatgggt ttacttggta cgcaagtttt 9840ggccgccggt gctttgggcg cgctcgcttt tttgacctta ttatttgcct gccatggtat 9900tctctcagta ggaggatcac tagcagccga agcttttggg gcaaataaaa tagatgaagt 9960tagtcgtatt gcttccgggc aaatatggct agcagttacc ttgtctttac ctgcaatgct 10020tctgctttgg catggcgata ctatcttgct gctattcggt caagaggaaa gcaatgtgtt 10080attgacaaaa acgtatttac actcaatttt atggggcttt cccgctgcgc ttagtatttt 10140gacattaaga ggcattgcct ctgctctcaa cgttccccga ttgataacta ttactatgct 10200cactcagctg atattgaata ccgccgccga ttatgtgtta atattcggta aatttggtct 10260tcctcaactt ggtttggctg gaataggctg ggcaactgct ctgggttttt gggttagttt 10320tacattgggg cttatcttgc tgattttctc cctgaaagtt agagattata aacttttccg 10380ctacttgcat cagtttgata aacagatctt tgtcaaaatt tttcaaactg gatggcccat 10440ggggtttcaa tggggggcgg aaacggcact atttaacgtc accgcttggg tagcagggta 10500tttaggaacg gtaacattag cagcccatga tattggcttc caaacggcag aactggcgat 10560ggttatacca ctcggagtcg gcaatgtcgc tatgacaaga gtaggtcaga gtataggaga 10620aaaaaaccct ttgggtgcaa gaagggtagc atcgattgga attacaatag ttggcattta 10680tgccagtatt gtagcacttg ttttctggtt gtttccatat caaattgccg gaatttattt 10740aaatataaac aatcccgaga atatcgaagc aattaagaaa gcaactactt ttatcccctt 10800ggcgggacta ttccaaatgt tttacagtat tcaaataatt attgttgggg ctttggtcgg 10860tctgcgggat acatttgttc cagtatcaat gaacttaatt gtctggggtc ttggattggc 10920aggaagctat ttcatggcaa tcattttagg atgggggggg atcgggattt ggttggctat 10980ggttttgagt ccactcctct cggcagttat tttaactgtt cgtttttatc gagtgattga 11040caatcttctt gccaacagtg atgatatgtt acagaatgcg tctgttacta ctctaggctg 11100agaaaagcta tatgaccaat caaaataacc aagaattaga gaacgattta ccaatcgcca 11160agcagccttg tccggtcaat tcttataatg agtgggacac acttgaggag gtcattgttg 11220gtagtgttga aggtgcaatg ttaccggccc tagaaccaat caacaaatgg acattccctt 11280ttgaagaatt ggaatctgcc caaaagatac tctctgagag gggaggagtt ccttatccac 11340cagagatgat tacattagca cacaaagaac taaatgaatt tattcacatt cttgaagcag 11400aaggggtcaa agttcgtcga gttaaacctg tagatttctc tgtccccttc tccacaccag 11460cttggcaagt aggaagtggt ttttgtgccg ccaatcctcg cgatgttttt ttggtgattg 11520ggaatgagat tattgaagca ccaatggcag atcgcaaccg ctattttgaa acttgggcgt 11580atcgagagat gctcaaggaa tattttcagg caggagctaa gtggactgca gcgccgaagc 11640cacaattatt cgacgcacag tatgacttca atttccagtt tcctcaactg ggggagccgc 11700cgcgtttcgt cgttacagag tttgaaccga cttttgatgc ggcagatttt gtgcgctgtg 11760gacgagatat ttttggtcaa aaaagtcatg tgactaatgg tttgggcata gaatggttac 11820aacgtcactt ggaagacgaa taccgtattc atattattga atcgcattgt ccggaagcac 11880tgcacatcga taccacctta atgcctcttg cacctggcaa aatactagta aatccagaat 11940ttgtagatgt taataaattg ccaaaaatcc tgaaaagctg ggacattttg gttgcacctt 12000accccaacca tatacctcaa aaccagctga gactggtcag tgaatgggca ggtttgaatg 12060tactgatgtt agatgaagag cgagtcattg tagaaaaaaa ccaggagcag atgattaaag 12120cactgaaaga ttggggattt aagcctattg tttgccattt tgaaagctac tatccatttt 12180taggatcatt tcactgtgca acattagacg ttcgccgacg cggaactctt cagtcctatt 12240tttaagattt atttcgatta tcctttatcc tgatcatcca gagtgataag agcattacaa 12300ctaggagaca attatgacaa ctgctgacct aatcttaatt aacaactggt acgtagtcgc 12360aaaggtggaa gattgtaaac caggaagtat caccacggct cttttattgg gagttaagtt 12420ggtactatgg cgcagtcgtg aacagaattc ccccatacag atatggcaag actactgccc 12480tcaccgaggt gtggctctgt ctatgggaga aattgttaat aatactttgg tttgtccgta 12540tcacggatgg agatataatc aagcaggtaa atgcgtacat atcccggctc accctgacat 12600gacaccccca gcaagtgccc aagccaagat ctatcattgc caggagcgat acggattagt 12660atgggtgtgc ttaggtgatc ctgtcaatga tataccttca ttacccgaat gggacgatcc 12720gaattatcat aatacttgta ctaaatctta ttttattcaa gctagtgcgt ttcgtgtaat 12780ggataatttc atagatgtat ctcattttcc ttttgtccac gacggtgggt taggtgatcg 12840caaccacgca caaattgaag aatttgaggt aaaagtagac aaagatggca ttagcatagg 12900taaccttaaa ctccagatgc caaggtttaa cagcagtaac gaagatgact catggactct 12960ttaccaaagg attagtcatc ccttgtgtca atactatatt actgaatcct ctgaaattcg 13020gactgcggat ttgatgctgg taacaccgat tgatgaagac aacagcttag tgcgaatgtt 13080agtaacgtgg aaccgctccg aaatattaga gtcaacggta ctagaggaat ttgacgaaac 13140aatagaacaa gatattccga ttatacactc tcaacagcca gcgcgtttac cactgttacc 13200ttcaaagcag ataaacatgc aatggttgtc acaggaaata catgtaccgt cagatcgatg 13260cacagttgcc tatcgtcgat ggctaaagga actgggcgtt acctatggtg tttgttaatt 13320tcagggttgt tggtatctgg ataggtatgg ttttgagtcc actgctatct ggagggattt 13380taatggttgg tttttatcaa cagcttgcca ataagtatta ctaatagtga tgatggggaa 13440gagaatcaaa ctatactcac caacaaggtg ttaaaatgca gatcttagga atttcagctt 13500actaccacga tagtgctgcc gcgatggtta tcgatggcga aattgttgct gcagctcagg 13560aagaacgttt ctcaagacga aagcacgatg ctgggtttcc gactggagcg attacttact 13620gtctaaaaca agtaggaacc aagttacaat atatcgatca aattgttttt tacgacaagc 13680cattagtcaa atttgagcgg ttgctagaaa catatttagc atatgcccca aagggatttg 13740gctcgtttat tactgctatg cccgtttggc tcaaagaaaa gctttaccta aaaacacttt 13800taaaaaaaga attggcgctt ttgggggagt gcaaagcttc tcaattgcct cctctactgt 13860ttacctcaca tcaccaagcc catgcggccg ctgctttttt tcccagtcct tttcagcgtg 13920ctgccgttct gtgcttagat ggtgtaggag agtgggcaac tacttctgtc tggttgggag 13980aaggaaataa actcacacca caatgggaaa ttgattttcc ccattccctc ggtttgcttt 14040actcagcgtt tacctactac actgggttca aagttaactc aggtgagtac aaactcatgg 14100gtttagcacc ctacggggaa cccaaatatg tggaccaaat tctcaagcat ttgttggatc 14160tcaaagaaga tggtactttt aggttgaata tggactactt caactacacg gtggggctaa 14220ccatgaccaa tcataagttc catagtatgt ttggaggacc accacgccag gcggaaggaa 14280aaatctccca aagagacatg gatctggcaa gttcgatcca aaaggtgact gaagaagtca 14340tactgcgtct ggctagaact atcaaaaaag aactgggtgt agagtatcta tgtttagcag 14400gtggtgtcgg tctcaattgc gtggctaacg gacgaattct ccgagaaagt gatttcaaag 14460atatttggat tcaacccgca gcaggagatg ccggtagtgc agtgggagca gctttagcga 14520tttggcatga ataccataag aaacctcgca cttcaacagc aggcgatcgc atgaaaggtt 14580cttatctggg acctagcttt agcgaggcgg agattctcca gtttcttaat tctgttaaca 14640taccctacca tcgatgcgtt gataacgaac ttatggctcg tcttgcagaa attttagacc 14700agggaaatgt tgtaggctgg ttttctggac gaatggagtt tggtccgcgt gctttgggtg 14760gccgttcgat tattggcgat tcacgcagtc caaaaatgca atcggtcatg aacctgaaaa 14820ttaaatatcg tgagtccttc cgtccatttg ctccttcagt cttggctgaa cgagtctccg 14880actacttcga tcttgatcgt cctagtcctt atatgctttt ggtagcacaa gtcaaagaga 14940atctgcacat tcctatgaca caagagcaac acgagctatt tgggatcgag aagctgaatg 15000ttcctcgttc ccaaattccc

gcagtcactc acgttgatta ctcagctcgt attcagacag 15060ttcacaaaga aacgaatcct cgttactacg agttaattcg tcattttgag gcacgaactg 15120gttgtgctgt cttggtcaat acttcgttta atgtccgcgg cgaaccaatt gtttgtactc 15180ccgaagacgc ttatcgatgc tttatgagaa ctgaaatgga ctatttggtt atggagaatt 15240tcttgttggt caaatctgaa cagccacggg gaaatagtga tgagtcatgg caaaaagaat 15300tcgagttaga ttaacttatg agtgaatttt tcccacaaaa aagtggtaaa ttaaagatgg 15360aacagataaa agaacttgac aaaaaaggat tgcgtgagtt tggactgatt ggcggttcta 15420tagtggcggt tttattcggc tttttactgc cagttatacg ccatcattcc ttatcagtta 15480tcccttgggt tgttgctgga tttctctgga tttgggcaat aatcgcacct acgactttaa 15540gttttattta ccaaatatgg atgaggattg gacttgtttt aggatggata caaacacgaa 15600ttattttggg agttttattt tatataatga tcacaccaat aggattcata agacggctgt 15660tgaatcaaga tccaatgacg cgaatcttcg agccagagtt gccaacttat cgccaattga 15720gtaagtcaag aactacacaa agtatggaga aaccattcta atgctaaaag acacttggga 15780ttttattaaa gacattgccg gatttattaa agaacaaaaa aactatttgt tgattcccct 15840aattatcacc ctggtatcct tgggggcgct gattgtcttt gctcaatctt ctgcgatcgc 15900acctttcatt tacactcttt tttaaattgc catattatga gtaacttcaa gggttcggta 15960aagatagcat tgatgggaat attgattttt tgtgggctaa tctttggcgt agcatttgtt 16020gaaattgggt tacgtattgc cgggatcgaa cacatagcat tccatagcat tgatgaacac 16080agggggtggg tagggcgacc tcatgtttcc gggtggtata gaaccgaagg tgaagctcac 16140atccaaatga atagtgatgg ctttcgagat cgagaacaca tcaaggtcaa accagaaaat 16200accttcagga tagcgctgtt gggagattcc tttgtagagt ccatgcaagt accgttggag 16260caaaatttgg cagcagttat agaaggagaa atcagtagtt gtatagcttt agctggacga 16320aaggcggaag tgattaattt tggagtgact ggttatggaa cagaccaaga actaattact 16380ctacgggaga aagtttggga ctattcacct gatatagtag tgctagattt ttatactggc 16440aacgacattg ttgataactc ccgtgcgctg agtcagaaat tctatcctaa tgaactaggt 16500tcactaaagc cgttttttat acttagagat ggtaatctgg tggttgatgc ttcgtttatc 16560aatacggata attatcgctc aaagctgaca tggtggggca aaacttatat gaaaataaaa 16620gaccactcac ggattttaca ggttttaaac atggtacggg atgctcttaa caactctagt 16680agagggtttt cttctcaagc tatagaggaa ccgttattta gtgatggaaa acaggataca 16740aaattgagcg ggttttttga tatctacaaa ccacctactg accctgaatg gcaacaggca 16800tggcaagtca cagagaaact gattagctca atgcaacacg aggtgactgc gaagaaagca 16860gattttttag ttgttacttt tggcggtccc tttcaacgag aacctttagt gcgtcaaaaa 16920gaaatgcaag aattgggtct gactgattgg ttttacccag agaagcgaat tacacgtttg 16980ggtgaggatg aggggttcag tgtactcaat ctcagcccaa atttgcaggt ttattctgag 17040cagaacaatg cttgcctata tgggtttgat gatactcaag gctgtgtagg gcattggaat 17100gctttaggac atcaggtagc aggaaaaatg attgcatcga agatttgtca acagcagatg 17160agagaaagta tattgcctca taagcacgac ccttcaagcc aaagctcacc tattacccaa 17220tcagtgatcc aataaagaac tgggcatcac ttatgatgtt tactaatttc agttccgttg 17280atgttaatgc gtaactttta ttactagttg taaagctgag atatgacaaa taccgaaaga 17340ggattagcag aaataacatc aacaggatat aagtcagagc ttagatcgga ggcacgagtt 17400agcctccaac tggcaattcc cttagtcctt gtcgaaatat gcggaacgag tattaatgtg 17460gtggatgtag tcatgatggg cttacttggt actcaagttt tggctgctgg tgccttgggt 17520gcgatcgctt ttttatctgt atcgaatact tgttataata tgcttttgtc gggggtagca 17580aaggcatctg aggcttttgg ggcaaacaaa atagatcagg ttagtcgtat tgcttctggg 17640caaatatggc tggcactcac cttgtctttg cctgcaatgc ttttgctttg gtatatggat 17700actatattgg tgctatttgg tcaagttgaa agcaacacat taattgcaaa aacgtattta 17760cactcaattg tgtggggatt tccggcggca gttggtattt tgatattaag aggcattgcc 17820tctgctgtga acgtccccca attggtaact gtgacgatgc tagtagggct ggtcttgaat 17880gccccggcca attatgtatt aatgttcggt aaatttggtc ttcctgaact tggtttagct 17940ggaataggct gggcaagtac tttggttttt tggattagtt ttctagtggg ggttgtcttg 18000ctgattttct ccccaaaagt tagagattat aaacttttcc gctacttgca tcagtttgat 18060cgacagacgg ttgtggaaat ttttcaaact ggatggccta tgggttttct actgggagtg 18120gaatcagtag tattgagcct caccgcttgg ttaacaggct atttgggaac agtaacatta 18180gcagctcatg agatcgcgat ccaaacagca gaactggcga tagtgatacc actcggaatc 18240gggaatgttg ccgtcacgag agtaggtcag actataggag aaaaaaaccc tttgggtgct 18300agaagggcag cattgattgg gattatgatt ggtggcattt atgccagtct tgtggcagtc 18360attttctggt tgtttccata tcagattgcg ggactttatt taaaaataaa cgatccagag 18420agtatggaag cagttaagac agcaactaat tttctcttct tggcgggatt attccaattt 18480tttcatagcg ttcaaataat tgttgttggg gttttaatag ggttgcagga tacgtttatc 18540ccattgttaa tgaatttggt aggctggggt cttggcttgg cagtaagcta ttacatggga 18600atcattttat gttggggagg tatgggtatc tggttaggtc tggttttgag tccactcctg 18660tccggactta ttttaatggt tcgtttttat caagagattg ccaataggat tgccaatagt 18720gatgatgggc aagagagtat atctattgac aacgttgaag aactctcctg acgaacagat 18780tgaattgcct tggtcttgac acttcgttaa cctaagcatg agagtatagg ctatactctg 18840ccgtggttaa ctgagtgttg tcctggatcg aggacgcagc ctggctgagc aacaaaaaag 18900actggaatct tgacctgtca atggttttaa ctgctagttt gcggctggtg tcagcagctt 18960cgccatttct gcgcctaaga cttgacctag ccataatatt ttagtattat gatgagcgat 19020cttaatcaaa ggcaaaaaat ttacaattaa tctattgtta cattaatttt gctcctcatt 19080ctgtttaaat tttcagtgac attgtaatct aactcaaaat gaaaacaaac aaacatatag 19140ctatgtgggc ttgtcctaga agtcgttcta ctgtaattac ccgtgctttt gagaacttag 19200atgggtgtgt tgtttatgat gagcctctag aggctccgaa tgtcttgatg acaacttaca 19260cgatgagtaa cagtcgtacg ttagcagaag aagacttaaa gcaattaata ctgcaaaata 19320atgtagaaac agacctcaag aaagttatag aacaattgac tggagattta ccggacggaa 19380aattattctc atttcaaaaa atgataacag gtgactatag atctgaattt ggaatagatt 19440gggcaaaaaa gctaactaac ttctttttaa taaggcatcc ccaagatatt attttttctt 19500tcgatatagc ggagagaaag acaggtatca cagaaccatt cacacaacaa aatcttggca 19560tgaaaacact ttatgaagtt ttccaacaaa ttgaagttat tacagggcaa acacctttag 19620ttattcactc agatgatata attaaaaacc ctccttctgc tttgaaatgg ctgtgtaaaa 19680acttagggct tgcatttgat gaaaagatgc tgacatggaa agcaaatcta gaagactcca 19740atttaaagta tacaaaatta tatgctaatt ctgcgtctgg cagttcagaa ccttggtttg 19800aaactttaag atcgaccaaa acatttctcg cctatgaaaa gaaggagaaa aaattaccag 19860ctcggttaat acctctacta gatgaatcta ttccttacta tgaaaaactc ttacagcatt 19920gtcatatttt tgaatggtca gaacactgag tttgatcgta accgttcaga ggggggatag 19980aagcgcgatt agggagatcc aaaaaataaa atatctagcc gtctaacctc tttattttca 20040tcgattcttc ttaccgttcc ctattccctc ccttcaccag ttcgtttttg ggtaggtgca 20100agatctgagc ctcccaccta gggccgatct ggcagtgcgc gatcgccact agcccatgga 20160aaactagcac tttttgggga acagccaaaa cctttattga gtaagaattt gaaaaagtgc 20220aagttaagag gcaatgacta aaaatttttt tctactcttt tcaggataga attccagttt 20280ctagagccgt tgtaaccgta catatcttga tagtacgtat cgatgaggta ctcattttcg 20340tggagcatta accagctttt taactccgct aatttctgct ctcctttttc tattaattct 20400tgctcatcca aatcatccct gtccaactcc tccctgtcca actcccacat agttttgttg 20460gtatcttcga caatcaagta gtctccactt tttagaccgt tttcgtgaaa atattcaact 20520actcccaccg cattagcatg ggcatcttct acgatcaacc agggatgagc aagcccagaa 20580agcagttccg acgacattat tgcacccata ttgttacaat ccccctctaa aaaatgaacg 20640cgagagtcag tttttgcttt ctcgtcgagt agggaaagat cgatatcgat acagtagaca 20700caaccttcta tttggaacag ttctaagtga tcggctagcc aaatcgcgct gccaccgctt 20760aatgctccta tttcgattat tgttttcggg cgaagctcat acaggagcat tgaataaaga 20820gctatttcgg tgcacccttt caggaagggt atccctttcc aagtgaacaa atcgcggttt 20880gccaagagcg ctctccaagc tggcactgga atagcacatt tatcttctct ttcagaaatt 20940ttggcaaacc gattaggttt gaaaggtgca actttatagg cggcttcttg aacaaatttt 21000tggaagctca tctaattttc ctcttaggtg ttagaacatt tgtaaaatct tggcgatttt 21060ttgttttctt tcttgaatat agcaaccgcc aaggcggttt gagcataaac tggatgtagt 21120ccccgtgttt tacggttgag acttaggtaa agcggctttg tttgtactct cccattattc 21180aaatagccgt agtttatgat cggtatccaa ttcgctattg ttttttctgc catatcccca 21240acctaagatg cgacgatatt cacccataat gccactgtca attaaatcat cctcgttgac 21300tgcaacattg gtatgagatt gcggcgcaac atagagcgca tccgcaggac aatatgcttc 21360acagatgaaa caagtttgac agtcttcctg tcgggcgatc gcaggcggtt ggttgggaac 21420tgcatcaaag acattggtag ggcatacttg gacgcaaaca ttacaattaa tacagagttt 21480atggctgaca agctcgatca tcatactgct cctgctacaa ctttaatact ggggctgtgg 21540tttaagtggt taatactggt ggtgtagcgc tcgcatcctt cacccaatcc cgtctcaccc 21600aaagcctttc taagccgccc gtggcttggt aataaagctg atttggatcg gtttcaggat 21660agtctatgcg aatatgttcg ctacgcgttt ccttgcgatg taaagcgcta aaatatgccc 21720atcgtgctac agacacaaga gcagccgctc gacgagaaaa ttccagatcg cgcactgtat 21780cttgtttcgg gttcccttgt acttgctgcc acagcatttc taatttggcg agggaatcca 21840aaagtccctg ctcacagcgc aagtaattct tctctaatgg gaacatctcg gcttgtacac 21900cgcggacaac tgcctcgcta tcgaatgttt cggaaccagg gtactgggaa cgtaatccgg 21960cttgacctgc tggacgcaca acccgttcat ggacatgagc gcccaaactc ttggcaaagg 22020cggctgcacc ttcccctgcc cattgtcctg tagagattgc ccaagcagca ttaggaccat 22080cacccccaga agctatccca gctaaaaact cccgcgatgc tgcatctccg gcggcataca 22140gtccaggaac ttttgtacca caactatcat tcacaatccg aattccacct gtaccacgga 22200ctgtaccttc taaaaccagt gttacaggta ctcgttctgt ataagggtca atgccagctt 22260ttttataggg tagaaaggcg atgaagtgag acttttcaac caatgcttgg atttcaggtg 22320tggctcgatc caaacgagca taaacgggac ctttcaggag ggcattgggc aggaacgatg 22380gatcgcgacg accattgata tagccaccaa gatcgttacc tgcctcatcg gtgtaactag 22440cccagtaaaa gggagcagcc cttgtcactg tggcattgaa agcggtcgag atggtatagt 22500gactggaagc ttccatactg gagagttcgc cgccagcttc caccgccatc agcagtccat 22560cgcctgtatt ggtattgcaa cctaaagctt tacttaggaa tgcacaaccg ccattcgcta 22620gaactactgc accagcgcga acggtatagg tgcgatgatt ttgcctctgt acacctctag 22680ctccagccac ggagccgtcc tgggctaata acagttctag agccggactt tggtcgaaaa 22740tttgcacacc cacacgcaac aggttcttgc gaagtacccg catatattcc ggaccataat 22800aactctggcg cacggattcc ccattttctt tggggaaacg atagccccaa tcttccacta 22860agggcaaact cagccaagct ttttcaatta cacgttcaat ccaacgtaag ttagcgaggt 22920tatttccttt gctgtaacat tcggatacat ctttctccca attctctgga gaaggtgcca 22980tgacgctatt gccactggca gcagctgcac cgctcgtacc tagaaaacct ttatcaacaa 23040tgatgacttt gacaccttgg gctccagccg cccatgctgc ccatgcggcg gcaggaccac 23100caccaattac cagcacgtca gcagttaatt gtagttcagt gccgctatag gctgtaagca 23160attgcttttc ctccttgttt aaagtcaagt tcatactttt aattatcttc tgcagtcggt 23220cgaatcaaaa tttcatttac atttacatga tcgggttgtg tcactgcata aattatagct 23280cttgcaatat cctcactttg taaaggtgtt attgtactaa gttgttcttt actaagctgt 23340ttcgtgatcg ggtcagaaat taagtcatta aatggcgtat cgactaaacc tggctcaatg 23400atggtaacgc gaatgttgtc taaagatacc tcctggcgta atgcttctga aagagcattg 23460acgcctgatt tggcagcact ataaacgacc gcaccggact gcgctatcct gccatcgaca 23520gaagatatat tgactatatg accggatttt tgggccttca gaagaggcaa aactgcgtgg 23580atagcatata aaactcccag aacattcaca tcgaatgctc gcctccagtc tgcgggattt 23640ccagtatcaa ttgcaccaaa cacaccaatt cctgcattat tcaccaaaat atctacatgt 23700cctagctcaa ccttggtctt ttggactaga tgatttactt gagattcgtc tgtaatatct 23760gtaacaatag gcaatgcttg accaccactg gcttcaatcc gttttgctag tgcatgcaaa 23820agctcagcac gtcttgcggc gatcgcaact tttgccccct ccgcagctaa agcaaatgct 23880gtagcctctc caatcccaga ggaagctcca gtaataatcg ccacttttcc atccaattta 23940cctgccatca gtcactcctt agttttcgtt ttgctggtgc aatatgtaat aagtgcgttt 24000tgtacttgat tttgttcttt ggtgattttt atataggagc gcataaagtg cttagtgatc 24060actttatttt ttagtgccat tcaacttaaa ttaacaaacc ccataagtaa cacctagttg 24120ctttagccat cgacgatagg caagtgtgca tctatctgat ggtacgtgga tttcgtgtga 24180aaacaattgt gtatttatct gctttggagt taacagtggt aaacgtaccg gctgttgtgc 24240atgtaagatc cgaatatctt gttctattgt ttcgtcatat tcagttagca tctttgactc 24300taacgtttca tacccgttcc acattatcaa catacgcaat acactatttt cctcatcaat 24360cggtgtgatc gtcattaaat ccacaatcct catttcaggg gattctgaaa cgcagtattg 24420acataaagga tgactaagcc tgaaccaatt aacccaagag tcatcttcga tatggctgac 24480aatccttgat gtctggaatt gatacttacc catagtaagg ccatctttat ctaatttcac 24540ctcaaattct tccacttttg tataattgcg atcacctaac caaccgtcat ggataaaagg 24600aaaatgagac acgtctaagg aattatccat cacacgaaac gcactagctt taatcaagta 24660agacttggta taagtcttgt gataattcgg atcatcccat tcaggaaatg aaggtatatc 24720attaacagga tcgcccaagc acacccacac taagccatag cgctcctggg agtgatatgt 24780cctggcttca gcacttgccg gtggtaccat gccagggtga gctgggatct gtatgcattt 24840accagcctca ttgtatctcc atccgtgata cggacaaact aaagtattat tcgtaatttc 24900tcccatagac agaggaacac ctcggtgggg gcagtagtca agccatacct gtatgggtga 24960attttgttca taactgcgcc ataataccaa cttcactccc aacaaacgag atctggtgat 25020acttccaggt ttacagtctt ctacattggc gactacgtgc cagttattga ttaagattgg 25080gtcggtagtt gtcataattg tctcctagtt ttgccagcca gcgaggcgta agtcagaatt 25140taagtttatg cttgtgtttg agcctgcgat cgctaaatta tccttttcaa ggcatccacc 25200aacagtggtt tgatgttgtt ttttgtaaaa atcagagtta gcatcctgta atcggtaatt 25260gaagtgttgg cagctgcggt atgccataca gttggtgtat aaaacattgc tgcccctcct 25320ggaagtgaaa gacatatttc tgcatttagt gaattggcag aagatgaatc taatgagtgt 25380tcccattggt ggctacttgg tataactcgc attgtaccca tagtattatc tgtatcctgt 25440aagtatatag ttatgaatac catggcttga ttggctactg gaaccaacaa ccgaagcgcg 25500tcgtcattta actcgttttt tgacatggat gcaagtgcgt tcaatacttc aactacatat 25560ccatggtctt gatgccaagc aatgtatcct gtacctgcac gaattatggc tagatcggtg 25620atcaatagga agatatcaga cccaattaga gcctgtactg gtcccatcac agttggaagc 25680tctaaaagcc tctgaattat cttttgatac ctaactggat ctgggatagt atgctcagac 25740caccactcat agtcacccgc caatactccc ccacgttttt gttcggtaat aagttctact 25800tcatgccgta tttcttcaat taacgctttt ggtacagctt cttcaactgt gaaataacca 25860tcatttgtgt aagcttgttt ttgttccgct gtgagcatct ctcttattct cttgcaattc 25920aaaggattta gtggatcgtc tggacataat taaggtcaat actgctgtaa ctatcaatgg 25980ttagtaggaa ttatcctata gctgttcttt ctctggatag aagaaaggtt gtgagaagct 26040cgctccgact tcatttcagc caatttttct gcagaccaat actgaaaata tcccaatctt 26100aataattcat cactagcctc ttgtaactgg ctgaatgact gtactgatgc taaaacatac 26160ttagggtgag ttatgattac gttattcaca ttctccgcgt catcaccaac atattgtttg 26220tctggatgcg atcctaaagc taccaaatcg tattctggta atacataatt cgccttggta 26280atgtaccttt ccaacctctg tgcatctagg ttttgagggt cgcagccaaa aatcaccatt 26340tcaaagtcat tattccatgt tcttatctgt tccattagaa gctctggcag ttcaggtcca 26400tgaaaccaac gaacactaac acggttattt aaccaagctg ccttcgcgta aggacagggt 26460ggaaaatttc ctgttagagg attgggaatg ctgacaacat tgataatcca atcctctatt 26520tcttggcgaa attgttcgat atttatcata actgttgatt tttcctcctt tgtagtaatt 26580agtagttaaa ggatttagtg gatattaatc taggtcatag tataaccata tattaggctc 26640gatgtatatt cccatattgt tgggatagtc aattttgaca ggtactaagc ctttgggaat 26700aatatagtca ccagtttctg gaaaacgcat cccaactcta tcttcccaac cgtcaatagt 26760atcattaatt gttgtggatt taaaacagat ccctgcaatt ttagccccat gtttgacatt 26820aactcgtaac caagggtcaa atataagacc atttttatct cgccaggtaa tataccgctc 26880tatgggtata agtgggtaaa gatattttag gcttggacgt gcagccatga tcaaagaatt 26940aagaccgtgg tattgagcaa gttctttcat gtatccaatc agatactgac tcaagttttt 27000gccttgatac tctggtagga ttgaaatcga tactacacat aacgcattag gcaggcggtt 27060ctgttctcgg tcttcaagcc acttggctaa agcccagtca caaccttcgt ccggtaactc 27120atcaaaacgg ctttcataag ttaaagggat acagtttcct tgcgctatca taagctgtgt 27180ggtagcttct actaacccaa actggaattc tggataaatt tcaaatagag ctaaggaagc 27240tggatctgcc cagacatcat gtatcaaaaa ttttgggtat gcttgatcaa agacactcat 27300cgtcctttcc acaaaatcag aagtttcttt tggggttaca aagctatact ctaaattatg 27360ctgtacaatt tgaatggtca ttggttattg gctaatcctt aaatttatac tggaagtcaa 27420atgagatctc actatcgtta ttatctggaa gtacttgcac tgtcaattca ttaccgactt 27480tcccattccc aggcataatt aataagttag ggtgaggtgg aatgccgtcg tactgtcgga 27540cgcggcgaaa aatgctcgaa ttctcgccac catgtttatt caagaggact tcaactggtg 27600tgatgacaaa agtcattcct gacccaaggt ggcgcgatcg ccgcttttga tttgctggag 27660tggaaacact aacaaataag gcacaccctc ctagagaata agaccagtta gcagactgcg 27720gatcggcaga ccaatggcag ggacaagaca ccgcatcaag gctatgtaac gcattcaaaa 27780aatcaaatgc ttgacctgca tattcctcta ctgtaagaac tgttggttca ggtgggaaaa 27840agatgacaag tgtcagaaga tccgcatttt cgtgctgaag caattcgttt tcattaactt 27900catcaatgta tttgtagata ccctcaagcg tatgctcaac caagatcggg tcagttaaag 27960atgagactat caggtatcta atcattccct tctgttcccc gatagttccc cagaagcaag 28020ggaaggcaga atcgctgatt gtttcaacaa atgttgagta gctagtgcgt acccaagcag 28080gaaggcactc ctctagaaga gaggattcca tctggctttt gttccagatt ggtgtaactc 28140cgtcaggaca taaattcttg attaccatag ctgagttgaa aagtgagctt atttatacaa 28200aaacgatgga agtgacacct gatggatggg acttcaaccc cctacacata attattatca 28260ttactatgtg gcaggtcctt ctatatctta ttttttggaa gtccctgaaa attattcaac 28320aagatcgaga cgttgttgtt gccagaattt gtgacagcca ggtcaagctt gctgtcgccg 28380ttgaaatccg caattgctat agattcagga ttagtaccga ctggaaagtt agtagctatg 28440ccaaaagacc cattaccatt tcctggtaag accgagacgt tattgctact ataatttgta 28500acagccaggt caagtttact gtcgccattc acatctctaa tcgctacaga gtagggatta 28560gtaccggctg gaaagttagt ggctgcgcca aaagacccat taccatttcc cagtaagacc 28620gagacgttat tgctgctagt atttgcaaca gccaggtcaa gcttgctgtc gccatttaca 28680tccccagttg ctacaaatat gggattagta ccgactggaa agttagtggc tgcgccaaaa 28740gacccattac catttcccag taagaccgag acgttattgc tgacccaatt tgtaatagca 28800aggtcgagct tactgtcgct attaaaatcc gcaatcgcta cggaaatcga ataagtatcg 28860acagggaagc tgctggctgc gccaaaagac ccattaccat ttcccagtaa aaccaagacc 28920ttattgtcga accaatttgt aaaagcaagg tcaagctcac tatcgttatt cacatctcca 28980atggctacag aataagggtt agtaccaact gaaaagttag tggctgcgcc aaaagaccca 29040ttaccatttc ctagtaagac cgagacgtta ttgctactaa aatttgcaac agccaggtca 29100agcttgctgt cgccatttac atccccagtc actacaaaga cgggattagt accgactgga 29160aagttagtgg ctgcgccaaa agacccatta ccatttccca gtaagaccga gacgttattg 29220tcgaaccaat ttgtaacagc caggtcgagc ttactatcgc tattgaaatc cccaactgct 29280acagagtcag catcaagacc agttgggaag ttaatagcag tagcataact actcctgtgg 29340gcaaatctca ctcctacgga caaattaacc ggaacactaa attgcccaga aagcttttca 29400ttcttcagat aatagtcagt tatatttgct aatgcaacag gagttataca taaaaatgta 29460ctaacagata atatccccgc tataattagt aaagtgagcc ttttcacgag ttgtatagtt 29520caaatgtatt aacaatgttt gtagccatac accatcgtgt atgaagaaag gtattgatcg 29580caaaatatct atccttgatc tagcctatca cctaagttaa gccatattga gttctattta 29640gattttcttt ataaatcagc tataatctat tgtttgaaaa ttgtgaattt gttttccacg 29700tatttgagta gttgttctag gctttcctcg acggtgagtt cggatgtttc cacccataaa 29760tctgggctat tgggtggttc ataaggggcg ctgattcccg taaatccatc tatttcccca 29820ctgcgtgctt ttagataaag acctttcgga tcacgctgct cacaaagttc cagtggagtt 29880gcaatgtata cttcatgaaa tagatctcca gctagtctac gcacctgttc tcggtcattc 29940ctgtagggtg agatgaaggc agtgatcact aggcatcctg actccgcaaa gagtttggca 30000acctcaccca aacgacggat attttctgag cgatcactag cagaaaatcc taaatcggaa 30060cacagtccat gacgaacact

atcaccatct aaaacaaagg tagaccatcc tttctcgaac 30120aaagtctgct ctaattttaa agccaatgtt gttttaccag ccccggacag tccagtaaac 30180catagaatcc cgcttttatg accattcttt agataacgat catatggaga tataagatgt 30240tttgtatagt gaatattagt tgatttcata ttgctggagt ttagactaaa cagaagagcg 30300atcgctccat gcctgagatt ttagtcagta tttccactcc tgtcaaacca ccaaaaacac 30360ggggtaacct ggaaaattcc cctggggatc agctgaaaac tgctgtttaa cctgcattat 30420tcatgaaggc aaaaacagga aaaacaaaac ctaacattta taccccaatt tatggcggaa 30480ctaacttaat aagtaaaaag taaattaaac ctaattaaaa tccctgattt taaccccaaa 30540atcaatattt taaacctcaa aacttctctt aatcccccat ttagacacac ctatcctatc 30600aaggcttaat tttaagaaaa aattatttca aactcgctcg ccaaacgctc cataatcaaa 30660ttaatttcag acgaaaaagg acagtaatat ggtagctcta ccaacaccct tcttgcggaa 30720actgtcacct tcgctgctat tttgataatc gtttccctta acctaggaac ctgggcttta 30780gccagttttg ttccctgtgc tgcttgccga attcccaaca ttaaaatgta agctgcttga 30840gataaaaata accgaaactg attgacaata aatttctcac agctgagtct atctgatttt 30900atccccagtt ttaattcctt aattctatgc tctgaagtag ctcctctttg aacataaaat 30960ttatcgtata aatcctgagc ttctgtttcc aagctagtaa ttataaatct aggattgggt 31020cctttttcta gccattctgc tttcataatt actcgccgag gttctgacca actccgagct 31080gcgtaataca catcatcaaa taaacgaact ttttctcctg tgcgacaata ttccagtctg 31140gctcggtcaa gaaggtaatt aatttttcgt tttaagacat cattattgct gaatccaaaa 31200acatatccaa ccccgctttt ttcacaaacc tcaatgattt ctggtaacga gaaacccccg 31260tctcccctca gaacaattct aatttcaggt aaggctcttt tgattcgcaa aaataaccat 31320tttagaatgc cagctactcc tttaccagag tgagaatttc ccgcccttag ttgtagaact 31380aatggataac cactggaagc ttcattaatc agaactggaa agtagatatc atgcctatgg 31440taaccattaa ataagctcag ttgttgatga ccatgagtta gagcatccca cgcatctatg 31500tccaggacaa tctcttttga ttcccgagga taggattcta ggaatttatc aacaaataac 31560cgacgaattt gtttgatatc tttttgagtc acctgatttt ctaaacgact catagttggt 31620tgactagcta ataagttttc tcctactgtg ggaacttgat tacaaactag cttaaaaatt 31680ggatcttggc gcaatttatt actatcgttg ctatcttcat agccagcaat tatttgataa 31740attcgttggc taattaattg agaaagagaa tgtttgactt tagtttggtc ccgattatcc 31800gtcaaacaat ctgccatatc ttgacaaatt tttacctttt cttctacttg tcgtgccaga 31860ataattccgc catcactact taaactcata tcagaaaaag tcagatctaa agttttttta 31920tcgaagaaat ttaaagataa tcttgaggaa gatttagtca tatatagtgg ataggtttaa 31980tttttaaaat cctgatttat tatagctgtt tttattcctt tttttcagtt tataactaaa 32040gttagttatt atttaatttg gtgacggata ggaattacag agtgttggga tgacaaaatt 32100gccgtagctg ttgcagtata accctttcag cgatttttat tctactctga tgaataatcc 32160aggataggct tgccatcact ttctgggtag acaatgtcag gcgcgattgt ctccccaccc 32220tgattaacgt tagattttat cacccccagt tgagtttttg gtgcaatttc cctcaccata 32280tctatacctc ccattcactt tggtattgac tcaatcggtt caatttacta taacatgact 32340tatgtggggg tgtgtgcata ccctcactta aaattaatgg atttgaatct cctcgcactg 32400ctgcaacttg aaaaactctg agagtcagtt gagagctaac tctaccagga ggagagtttt 32460taaaaacccc cttcccgagc gatcgcataa tttatggtat acaagaatag tgggtgaaaa 32520actaactggc gatcgctctt ttcatttaag agacacccct tagttttttt tgcagtctca 32580tgaatttaaa cgatatctaa ttattttcaa cctatctttg ccctgtaaca atgtatgcta 32640ccctttgacc aatattagta gcatgatctg ccattctctc taaacactga attgctaatg 32700ttaatagtaa aatgggctcc actaccccgg gaacatcttt ctgctgcgcc aaattacgat 32760ataacttttt gtaagcatca tctactgtat catctaataa tttaatcctt ctaccactaa 32820tctcgtctaa atccgctaaa gctactaggc tggtagccaa catagattgg gcatgatcgg 32880acataatggc aacctccccc aaagtaggat gggggggata gggaaatatt ttcattgcta 32940tttctgccaa atctttggca tagtccccaa tacgttccaa gtctctaact aattgcatga 33000atgagcttaa acaccgagat tcttggtctg tgggagcttg actgctcata attgtggcac 33060aatcgacttc tatttgtctg tagaagcgat caattttttt gtctaatctc cgtatttgct 33120cagctgctgt taaatcccga ttgaatagag cttggtgact cagacggaat gactgctcta 33180ctaaagcacc catacgcaaa acatctcgtt ccagtctttt aatggcacgt ataggttgag 33240gtttttcaaa aattgtatat ttcacaacag ctttcatatt tttaatctcg ggtttaatat 33300atttctagct attatagtct tgattcagaa atatccgcca tcatgttgaa ccacctgggg 33360aagatgaatt tgtatccaag caccaccggt atcaggatgg ttcatggccc tgattttgcc 33420accatgagct ataattattt ggcggacaat ggataaccct aaaccactac cagtaatttc 33480tactgtttca ttctcagagc gggactcgcg gtgtctagct ttgtcccccc gataaaatct 33540ttgaaagaca tggggtagat ccatgggagc aaatccaacc ccggaatcaa taatgttaat 33600ttctaaaatc tgatttgata cttggtttaa tattgtatct gcttctggat caaccccatt 33660aatagacttc tccccacaaa ctggattcat ttcaatgaaa atagtaccgt tcaggttgct 33720gtatttaata cagttatcta acagattaag aaacacttga taaattctgg acttatcagc 33780acatatatag accttttccg ggccggagta agaaatacta agatgctgat tagcggctag 33840gggctctaaa ttctcccaga ctgaaaaaat tagggagcgg acttctagca tttccaaatt 33900cagttgtatg gaggaggtta tttccatctg ggtcaggtct aaccaatttt ggactaaatt 33960aattagtctg tcaacctcct gcatcaagcg gatgacccaa cggtttagag ggggatctaa 34020gcgagtttgc agggtttctg cgaccagacg aatggaagtc agaggtgttc tcagttcatg 34080ggccaggtct gaaaaagagc ggtcacgttg ctgatgaatg tctacaaatt gttggtgact 34140ttctagaaac acacccactt gtccccccgg taggggaaaa ctgttagctg ctaaagacaa 34200tggctttaat cctaaaatac cctgaccatg atctcgggaa gggtgaaaaa tccactcttg 34260catttgcggt ttttgccaat cccgggtttg ctcaattaac tgatccagct cataggatct 34320cactaattcc agtagcaggc gcacttgacc cggttgccat ctttgtaaat acagcatttc 34380ccgcgcgcac tgattacacc atagtagttg gttttcttca tctacttgta aatatcccaa 34440aggcgcagca tccagcaact gttcataagc tttgagtgac aagcgtaagt tttgttgctc 34500atctctaacg gtagatattt tacgatgtaa tccagctaat aggggtaata atatcttttc 34560agcgtgaggg tttaagggtt gggttaactg ctccaaatga ctgttaagtt gaaattgttg 34620ccaaagccaa aaaccaaaac cgactgccaa acccagaaga aatcccaata agaacatttg 34680atcgtaagtg tgctatttga ccggaattaa agggggagga tccaagcacg gtctttacag 34740gacggctttt tctaattgtt aaattataat tataatcggt agggactgct ttgggaaaat 34800gcgatcgccc aggtatctgt aaccatttct gtaccacagg ttagactgga tcaggtaact 34860gatacacttc ttgctgaatt ttatgtccaa tcaaaatgac aactcccaaa atgataactc 34920ccgtgacaag agccaaaaac ccgaatccag cagatggttt aaaataaaaa gaccacgacc 34980acctaaagga ataggaaaac caaaaacaga atagcccaca tatagaaatc aaccaaatct 35040atagccaaaa cccctaactg tgacaatata ttctggatgg ctagggtcta actctaattt 35100ttccctcagc catcgaatgt gaacatccac cgttttactg tcaccaacaa aatcaggacc 35160ccaaacctgg tctaataact gttcccgtga ccacaccctg cgagcataac tcataaatag 35220ttctagtaac cggaattctt tcggtgacaa gctcacctcc ctccctctca ctaacacccg 35280acattcctga ggatttaaac tgatatcctt atattttaaa gtgggtatca agggcaaatt 35340agaaaaccgc tgacgacgta acagggcgcg acacctagcc accatttccc gtacgctaaa 35400aggcttagtt aggtaatcat ccgcccctac ctctaaaccc agcacccggt cagtttcact 35460acctttcgca ctcagaatta aaatcggtat ggaattaccc tggtgacgta acaaacgaca 35520aatatctaat ccgttgattt gtggcaacat caagtctagc acaagcaggt cgaaggataa 35580ctcaccaggt tgggtctcta aattcctgat taattccaca gcacaacgac catccttagc 35640agtcacaact tcataacctt caccctctaa ggctactaca agcatctctc ggatcagttc 35700ttcgtcttcc actattaaaa cgcgactaac tggttcaata tccgatttag tgaagtatct 35760agggtaattc agtagtatac attgataaca aaaatttgta agaatgtact ggtctgggtt 35820tcccactagt atatgatcct cactcattga tgccacatat tggggaacac ggaattcttg 35880tattcaatac aacaatttgc ttaaatttat aattcaaata ggtgttttat agaaaatttt 35940gtcgaatatt tccacatttg tggcttttag ttcaggcaaa acgagagaag tctaaagtgg 36000gtggaatatc ctgaattctt ccaggaccta tagcccgtag tgcttctggt aaactaatat 36060ccccagtata tagggcttta cccacaatta ctcctgtaac cccctgatgt tctaaagata 36120ataaggttaa taggtcagta acagaaccca cacccccaga ggcaatcacg ggtatggaaa 36180tagcagatac caagtctctt aatgctcgca agtttggtcc ctgaagcgta ccatcacggt 36240ttatatccgt ataaataata gctgccgcac ccaattcctg catttgggtt gctagttggg 36300gggccaaaat ttgagaagtt tctaaccaac ccctggtagc aactagacca ttccgcgcat 36360caatcccaat tataatttgc tgggggaatt gttcacacag tccttgaacc agatctggtt 36420gctctactgc tacagttccc agaattgccc actgtacccc aagattaaat aactgtataa 36480cgctggagct atcacgtatt cctccgccaa cttcaatagg tatggaaata gcattggtaa 36540tagcttctat agtagataaa ttaactattt taccagtttt tgctccatct aaatctacta 36600aatgtagtct tgttgctcct tggtctgccc acattttagc ggtttccaca gggttatggc 36660tgtaaacctg ggattgtgca tagtcacctt tgtagagtct tacacaacgc ccctctaata 36720gatctattgc tgggataact tccatgacta attagtgaat aggttaattt cagttgagct 36780aaatggagaa ggagggattc gaaccctcgg atggacctta cgattccatc aacagattag 36840caatctgccg ctttcgacca ctcagccacc tctccaggtt tgttataaat tatgatgggt 36900caatcctaac agacaatttt tggcttgtca agagattttt tgcaagtgga ggaggaaatc 36960cgtcagggat ttcaatcctg gtcaactttt ttttgatttt gaatataaag ttaagtttaa 37020caatttctag tggcgctcct ccaacagtag atataaaata tgagttggtc cacaatgaag 37080gacgtcttga ttttaatagt caaatccctc caaatccatt ataatcccat gaatgctctt 37140tcaattccta cctggattat ccatatttct agtgtcattg aatgggtagt tgccatttcc 37200ctcatctgga aatatggcga actgacccaa aaccatagtt ggaggggatt tgccttaggt 37260atgatacccg ccttaattag cgccctatcc gcttgtacct ggcattattt cgataatccc 37320cagtccctag aatggttagt caccctccag gctactacta cgttaatagg taattttact 37380ctttgggcag cagcagtctg ggtttggcgt tctactcgac cgaatgaggt tctcagtatc 37440tcaaataagg agtagaccgt tatgatgtca aaagaaactc tctttgctct ctccctgttc 37500ccctatttgg gaatgttgtg gtttctcagt cgcagtcccc aaatgccccc ttaagggctc 37560tatggattct atggcacttt agtatttgtt ggtgttacca ttccag 3760621320DNACylindrospermopsis raciborskii T3 2atgatcccag ctaaaaaagt ttatttttta ttgagtttag caatagttat ttcacccttt 60ttatccatga ttgtgggtat ttacgaaaat attaaattta gggtattatt tgatttggtg 120gtcagggcac taatggtggt tgactgcttc aatatcaaaa aacatcgggt caaaattagt 180cgtcaattac ctctacgttt atctattgga cgtgagaatt tagtaatatt gaaggtagag 240tctgggaatg tcaatagtgc tattcaaatt cgtgattact atcccacaga atttcccgta 300tccacatcta acctgatagt taaccttccc cctaatcata ctcaggaagt aaagtacacc 360attcgaccta atcaacgggg agaattttgg tggggaaata ttcaagttcg acagctggga 420aattggtctc tagggtggga caattggcaa attccccaaa aaactgtggc taaggtgtat 480cctgatttgt taggactcag atccctcgct attcgtttaa ccctacaatc ttctggatct 540atcactaaat tgcgtcaacg gggaatggga acggaatttg ccgaactccg taattactgc 600atgggggatg atctacggtt aattgattgg aaagctacag ctagacgtgc ttatggaaat 660ctgagtcccc tagtaagagt tttagagcct caacaggaac aaactctgct tatattatta 720gatcgtggta gactaatgac agctaatgta caagggttaa aacgatatga ttggggttta 780aataccacct tgtctttggc attagcagga ttacataggg gcgatcgcgt aggagtaggg 840gtatttgact cccagctgca tacctggata cctccagagc gaggacaaaa tcatctcaat 900cggcttatag acagacttac acctattgaa ccagtgttag tggagtctga ttatttaaat 960gccattacct atgtagtaaa acaacagact cgtagatctc tagtagtgtt aattactgat 1020ttagtcgatg ttactgcttc ccatgaacta ctagtagcgc tgtgtaaatt agtgcctcga 1080tatctacctt tttgtgtaac actcagggat cctgggattg ataaaatagc tcataatttt 1140agtcaagact taacacaggc ttataatcga gcagtttctt tggacttgat atcacaaaga 1200gaaattgctt ttgctcagtt gaaacaacag ggagttttgg tgttggatgc accagcaaat 1260caaatttccg agcagttggt agaaaggtac ttacaaatca aagccaaaaa tcagatttga 13203439PRTCylindrospermopsis raciborskii T3 3Met Ile Pro Ala Lys Lys Val Tyr Phe Leu Leu Ser Leu Ala Ile Val1 5 10 15Ile Ser Pro Phe Leu Ser Met Ile Val Gly Ile Tyr Glu Asn Ile Lys 20 25 30Phe Arg Val Leu Phe Asp Leu Val Val Arg Ala Leu Met Val Val Asp 35 40 45Cys Phe Asn Ile Lys Lys His Arg Val Lys Ile Ser Arg Gln Leu Pro 50 55 60Leu Arg Leu Ser Ile Gly Arg Glu Asn Leu Val Ile Leu Lys Val Glu65 70 75 80Ser Gly Asn Val Asn Ser Ala Ile Gln Ile Arg Asp Tyr Tyr Pro Thr 85 90 95Glu Phe Pro Val Ser Thr Ser Asn Leu Ile Val Asn Leu Pro Pro Asn 100 105 110His Thr Gln Glu Val Lys Tyr Thr Ile Arg Pro Asn Gln Arg Gly Glu 115 120 125Phe Trp Trp Gly Asn Ile Gln Val Arg Gln Leu Gly Asn Trp Ser Leu 130 135 140Gly Trp Asp Asn Trp Gln Ile Pro Gln Lys Thr Val Ala Lys Val Tyr145 150 155 160Pro Asp Leu Leu Gly Leu Arg Ser Leu Ala Ile Arg Leu Thr Leu Gln 165 170 175Ser Ser Gly Ser Ile Thr Lys Leu Arg Gln Arg Gly Met Gly Thr Glu 180 185 190Phe Ala Glu Leu Arg Asn Tyr Cys Met Gly Asp Asp Leu Arg Leu Ile 195 200 205Asp Trp Lys Ala Thr Ala Arg Arg Ala Tyr Gly Asn Leu Ser Pro Leu 210 215 220Val Arg Val Leu Glu Pro Gln Gln Glu Gln Thr Leu Leu Ile Leu Leu225 230 235 240Asp Arg Gly Arg Leu Met Thr Ala Asn Val Gln Gly Leu Lys Arg Tyr 245 250 255Asp Trp Gly Leu Asn Thr Thr Leu Ser Leu Ala Leu Ala Gly Leu His 260 265 270Arg Gly Asp Arg Val Gly Val Gly Val Phe Asp Ser Gln Leu His Thr 275 280 285Trp Ile Pro Pro Glu Arg Gly Gln Asn His Leu Asn Arg Leu Ile Asp 290 295 300Arg Leu Thr Pro Ile Glu Pro Val Leu Val Glu Ser Asp Tyr Leu Asn305 310 315 320Ala Ile Thr Tyr Val Val Lys Gln Gln Thr Arg Arg Ser Leu Val Val 325 330 335Leu Ile Thr Asp Leu Val Asp Val Thr Ala Ser His Glu Leu Leu Val 340 345 350Ala Leu Cys Lys Leu Val Pro Arg Tyr Leu Pro Phe Cys Val Thr Leu 355 360 365Arg Asp Pro Gly Ile Asp Lys Ile Ala His Asn Phe Ser Gln Asp Leu 370 375 380Thr Gln Ala Tyr Asn Arg Ala Val Ser Leu Asp Leu Ile Ser Gln Arg385 390 395 400Glu Ile Ala Phe Ala Gln Leu Lys Gln Gln Gly Val Leu Val Leu Asp 405 410 415Ala Pro Ala Asn Gln Ile Ser Glu Gln Leu Val Glu Arg Tyr Leu Gln 420 425 430Ile Lys Ala Lys Asn Gln Ile 4354759DNACylindrospermopsis raciborskii T3 4atgatagata caatatcagt actattaaga gagtggactg taatttccct tacaggttta 60gccttctggc tttgggaaat tcgctctccc ttccatcaaa ttgaatacaa agctaaattc 120ttcaaggaat tgggatgggc gggaatatca ttcgtcttta gaaatgttta tgcatatgtt 180tctgtggcaa ttataaaact attgagttct ctatttatgg gagagtcagc aaattttgca 240ggagtaatgt atgtgcccct ctggctgagg atcatcactg catatatatt acaggactta 300actgactatc tattacacag gacaatgcat agtaatcagt ttctttggtt gacgcacaaa 360tggcatcatt caacaaagca atcatggtgg ctgagtggaa acaaagatag ctttaccggc 420ggacttttat atactgttac agctttgtgg tttccactgc tggacattcc ctcagaggtt 480atgtctgtag tggcagtaca tcaagtgatt cataacaatt ggatacacct caatgtaaag 540tggaactcct ggttaggaat aattgaatgg atttatgtta cgccccgtat tcacactttg 600catcatcttg atacaggggg aagaaatttg agttctatgt ttactttcat cgaccgatta 660tttggaacct atgtgtttcc agaaaacttt gatatagaaa aatctaaaaa tagattggat 720gatcaatcag taacggtgaa gacaattttg ggtttttaa 7595252PRTCylindrospermopsis raciborskii T3 5Met Ile Asp Thr Ile Ser Val Leu Leu Arg Glu Trp Thr Val Ile Ser1 5 10 15Leu Thr Gly Leu Ala Phe Trp Leu Trp Glu Ile Arg Ser Pro Phe His 20 25 30Gln Ile Glu Tyr Lys Ala Lys Phe Phe Lys Glu Leu Gly Trp Ala Gly 35 40 45Ile Ser Phe Val Phe Arg Asn Val Tyr Ala Tyr Val Ser Val Ala Ile 50 55 60Ile Lys Leu Leu Ser Ser Leu Phe Met Gly Glu Ser Ala Asn Phe Ala65 70 75 80Gly Val Met Tyr Val Pro Leu Trp Leu Arg Ile Ile Thr Ala Tyr Ile 85 90 95Leu Gln Asp Leu Thr Asp Tyr Leu Leu His Arg Thr Met His Ser Asn 100 105 110Gln Phe Leu Trp Leu Thr His Lys Trp His His Ser Thr Lys Gln Ser 115 120 125Trp Trp Leu Ser Gly Asn Lys Asp Ser Phe Thr Gly Gly Leu Leu Tyr 130 135 140Thr Val Thr Ala Leu Trp Phe Pro Leu Leu Asp Ile Pro Ser Glu Val145 150 155 160Met Ser Val Val Ala Val His Gln Val Ile His Asn Asn Trp Ile His 165 170 175Leu Asn Val Lys Trp Asn Ser Trp Leu Gly Ile Ile Glu Trp Ile Tyr 180 185 190Val Thr Pro Arg Ile His Thr Leu His His Leu Asp Thr Gly Gly Arg 195 200 205Asn Leu Ser Ser Met Phe Thr Phe Ile Asp Arg Leu Phe Gly Thr Tyr 210 215 220Val Phe Pro Glu Asn Phe Asp Ile Glu Lys Ser Lys Asn Arg Leu Asp225 230 235 240Asp Gln Ser Val Thr Val Lys Thr Ile Leu Gly Phe 245 2506396DNACylindrospermopsis raciborskii T3 6tcacccccaa cttattgcag aaaaactttt ttctcttagg taataaatta gtagtttaat 60tgaaaagcat agcatctctt ttgacttgga ataacaaaat gtcttacgat gtagtctagc 120taaatagtga cgcaaacgac tgttttctcc ctcaactcta gtcattgatg ttttactaat 180aatttggtct ccatcgggaa taaattttgg gtaaacttta tagccatccg taatccaaaa 240ataggatttc caatgctcta tctttttcca taatttggca aatgttttgg cacttctatc 300tcccactaca tattgaataa ttcccgaacg tttgttatct acaactgtcc agacccatat 360cttgtttttt tttaccaata aatgtttcca actcat 3967131PRTCylindrospermopsis raciborskii T3 7Met Ser Trp Lys His Leu Leu Val Lys Lys Asn Lys Ile Trp Val Trp1 5 10 15Thr Val Val Asp Asn Lys Arg Ser Gly Ile Ile Gln Tyr Val Val Gly 20 25 30Asp Arg Ser Ala Lys Thr Phe Ala Lys Leu Trp Lys Lys Ile Glu His 35 40 45Trp Lys Ser Tyr Phe Trp Ile Thr Asp Gly Tyr Lys Val Tyr Pro Lys 50 55 60Phe Ile Pro Asp Gly Asp Gln Ile Ile Ser Lys Thr Ser Met Thr Arg65 70 75 80Val Glu Gly Glu Asn Ser

Arg Leu Arg His Tyr Leu Ala Arg Leu His 85 90 95Arg Lys Thr Phe Cys Tyr Ser Lys Ser Lys Glu Met Leu Cys Phe Ser 100 105 110Ile Lys Leu Leu Ile Tyr Tyr Leu Arg Glu Lys Ser Phe Ser Ala Ile 115 120 125Ser Trp Gly 1308360DNACylindrospermopsis raciborskii T3 8ttatctacaa ctgtccagac ccatatcttg ttttttttta ccaataaatg tttccaactc 60atccagttga caaacttcag gtgtttggga attattatta ctatctgata actgacgacc 120tagctttttg acccaacgaa tgactgtatt gtgatttact ttagtcattc tttcaattgc 180cctaaatcca ttcccattta catacatggt taaacatgct tcctttactt cttgggaata 240acctctagga gaataagatt caataaattg acgaccacaa ttcttgcatt gataattttg 300ttttcccctt ctctggccat tttttctaat attattggaa tcacagtttg aacagttcat 3609119PRTCylindrospermopsis raciborskii T3 9Met Asn Cys Ser Asn Cys Asp Ser Asn Asn Ile Arg Lys Asn Gly Gln1 5 10 15Arg Arg Gly Lys Gln Asn Tyr Gln Cys Lys Asn Cys Gly Arg Gln Phe 20 25 30Ile Glu Ser Tyr Ser Pro Arg Gly Tyr Ser Gln Glu Val Lys Glu Ala 35 40 45Cys Leu Thr Met Tyr Val Asn Gly Asn Gly Phe Arg Ala Ile Glu Arg 50 55 60Met Thr Lys Val Asn His Asn Thr Val Ile Arg Trp Val Lys Lys Leu65 70 75 80Gly Arg Gln Leu Ser Asp Ser Asn Asn Asn Ser Gln Thr Pro Glu Val 85 90 95Cys Gln Leu Asp Glu Leu Glu Thr Phe Ile Gly Lys Lys Lys Gln Asp 100 105 110Met Gly Leu Asp Ser Cys Arg 11510354DNACylindrospermopsis raciborskii T3 10ttatgacctc attttcattt ctagacgttc agcaacgggc attaactcac gtatcagatc 60aaagtttcct acgttccgtc tcatccagtc taataagaat ttttctcctt catctagctt 120acctttatca tcaacaaaaa ccatctgctc gcaccaatct acaaatccgg aattagtcat 180ctcatagact aaaatgatgg gaggaaagtg tgcgaatccc attttttcaa tgacttccat 240acaaaccagc ttaaatactt gttcgtttgt caattcatta gacataaaga attttccttt 300aatcaattct gtttctaatc ctaccacaga gtaataactc ttggtctgga acat 35411117PRTCylindrospermopsis raciborskii T3 11Met Phe Gln Thr Lys Ser Tyr Tyr Ser Val Val Gly Leu Glu Thr Glu1 5 10 15Leu Ile Lys Gly Lys Phe Phe Met Ser Asn Glu Leu Thr Asn Glu Gln 20 25 30Val Phe Lys Leu Val Cys Met Glu Val Ile Glu Lys Met Gly Phe Ala 35 40 45His Phe Pro Pro Ile Ile Leu Val Tyr Glu Met Thr Asn Ser Gly Phe 50 55 60Val Asp Trp Cys Glu Gln Met Val Phe Val Asp Asp Lys Gly Lys Leu65 70 75 80Asp Glu Gly Glu Lys Phe Leu Leu Asp Trp Met Arg Arg Asn Val Gly 85 90 95Asn Phe Asp Leu Ile Arg Glu Leu Met Pro Val Ala Glu Arg Leu Glu 100 105 110Met Lys Met Arg Ser 11512957DNACylindrospermopsis raciborskii T3 12tcataactta ttacttgacg gagttgcagg ggcatacctt aacttgacct tgggagcgat 60agaagaaagg aaggcttcag tgacgggtct ttgactaatc ccagtttcca cttcaactaa 120aacagcatca caaatgtcga atagtgattg agaatatcta ttcatattca tgaaagtcag 180agcagattcc atcggagaca tggatgaatt aaaggcagcg ttttcagcgt atcgacctgt 240aaatatattc ccgtgggaat cttttaacgc tacccctgca aaatttttcg tgtagggagc 300ataactttga ttggcagcgg atagagcagc aagcacaaca tcatcggtag aataggtctc 360cagatcatga aatactgttt gcattaatcc acctgtgagt cctagatccg ctggtccaaa 420tggctcgggt agaaaatgtg ggagtttatt tgaggtataa gtttgctcag gctgtgattc 480attagacttc acaagaagaa caaaattttg atttacagtt gccatctcgt ataaaaattg 540tcggcagtat ccacatggtg cttcgtggat tgctaatgct tgtaaaccgg tttctccgtg 600caaccacgca tttatggtgg cggattgttc tgcgtgaact gagaaactaa gtgcctgtcc 660tacaaattcc atgtcggcac caaaataaag agttccagaa cccagttgat tcttagattg 720tggtttacca agagcgatcg cccctacata aaactgcgat attggtaccc tagcataagt 780tgcggctacg ggtagtaatt gaatcattaa cgtactaata ttagtaccaa gtcgatcaat 840ccaagatgcg acaacacttg agtcaattac agcatgttgg gcaagaattg tccttaactc 900tgattgaatg gaacgtggaa ccttggcaat cgcctgttct aatgctacat gggtcat 95713318PRTCylindrospermopsis raciborskii T3 13Met Thr His Val Ala Leu Glu Gln Ala Ile Ala Lys Val Pro Arg Ser1 5 10 15Ile Gln Ser Glu Leu Arg Thr Ile Leu Ala Gln His Ala Val Ile Asp 20 25 30Ser Ser Val Val Ala Ser Trp Ile Asp Arg Leu Gly Thr Asn Ile Ser 35 40 45Thr Leu Met Ile Gln Leu Leu Pro Val Ala Ala Thr Tyr Ala Arg Val 50 55 60Pro Ile Ser Gln Phe Tyr Val Gly Ala Ile Ala Leu Gly Lys Pro Gln65 70 75 80Ser Lys Asn Gln Leu Gly Ser Gly Thr Leu Tyr Phe Gly Ala Asp Met 85 90 95Glu Phe Val Gly Gln Ala Leu Ser Phe Ser Val His Ala Glu Gln Ser 100 105 110Ala Thr Ile Asn Ala Trp Leu His Gly Glu Thr Gly Leu Gln Ala Leu 115 120 125Ala Ile His Glu Ala Pro Cys Gly Tyr Cys Arg Gln Phe Leu Tyr Glu 130 135 140Met Ala Thr Val Asn Gln Asn Phe Val Leu Leu Val Lys Ser Asn Glu145 150 155 160Ser Gln Pro Glu Gln Thr Tyr Thr Ser Asn Lys Leu Pro His Phe Leu 165 170 175Pro Glu Pro Phe Gly Pro Ala Asp Leu Gly Leu Thr Gly Gly Leu Met 180 185 190Gln Thr Val Phe His Asp Leu Glu Thr Tyr Ser Thr Asp Asp Val Val 195 200 205Leu Ala Ala Leu Ser Ala Ala Asn Gln Ser Tyr Ala Pro Tyr Thr Lys 210 215 220Asn Phe Ala Gly Val Ala Leu Lys Asp Ser His Gly Asn Ile Phe Thr225 230 235 240Gly Arg Tyr Ala Glu Asn Ala Ala Phe Asn Ser Ser Met Ser Pro Met 245 250 255Glu Ser Ala Leu Thr Phe Met Asn Met Asn Arg Tyr Ser Gln Ser Leu 260 265 270Phe Asp Ile Cys Asp Ala Val Leu Val Glu Val Glu Thr Gly Ile Ser 275 280 285Gln Arg Pro Val Thr Glu Ala Phe Leu Ser Ser Ile Ala Pro Lys Val 290 295 300Lys Leu Arg Tyr Ala Pro Ala Thr Pro Ser Ser Asn Lys Leu305 310 315143738DNACylindrospermopsis raciborskii T3 14ttaatgcttg agtatgtttt cctcctgctt acaaggcaaa gctttccttt tttgtagcaa 60atcccaaact gctttgagag atttaattgc ttggtctatc tcctcttcgg tattggcggc 120tgtaatcgaa aaccttaaag cacttttatt taaaggtacg attggaaaaa tagcaggagt 180aattaaaata ccatattccc aaaggagttg acacacatca atcatgtgtt gagcatctcc 240cactaacacg cctacgatgg gaacgtaacc atagttatcc acttcgaatc caatggctct 300tgcttgtgta accaatttgt gagttaggtg ataaatttgt tttcttaact gctccccctc 360ctgacgattc acctgtaatc cggctaaggc acttgccaaa ctcgcaacag gagaaggacc 420agaaaatatg gcagtccaag cgttgcggaa gttggttttg atccggcgat cgccacaagt 480taagaatgct gcgtaagaag aataggcttt ggacaaacca gctacataga tgatattatc 540ctctgcaaac cgcaggtcaa aataattcac catcccgttt cctttgtaac cgtaaggcat 600atcgctgctg ggattttcgc ccaaaatgcc aaaaccatga gcatcatcca tgtaaattaa 660ggcattgtac tcttttgcca gatgcacgta agctggcaga tcgggaaaat ctgccgacat 720ggaatacacg ccatcaatga caataatctt tacttgttca ggcggatatt ttgctagttt 780ttcggctaaa tcgttcaaat cattatgtcg atattggatg aactgggctc ctttgtgctg 840agccagacag cacgcttcat aaatacaacg atgtgcagct atgtcaccaa agatgacacc 900attattccca gttaatagtg gtaaaattcc tatctgaagc agtgttacag ctggaaatac 960taaaacatca ggtacgccta aaagtttgga caattcttcc tccaattcct cataaattgc 1020tggggaagca acaagccgag tccagcttgg atgtgtgccc catttatcca aagctggtgg 1080aattgcttcc ttaacttttg gatgcaagtc aagacctaaa tagttgcaag aagcaaagtc 1140tatcacccaa tgtccgtcaa ttagcacctt gcgaccttgt tgttctgtga cgactcttgt 1200gacttgagga attttttgtt ggttaactac gttttccaga gtgttgattt cgttggctga 1260gtcaacaggt ggagctagat cagattgttt ctcttgtacc acttggtttt ggaaataagt 1320gatgatggca gttggagtgt tcttttgtaa aaagaacgtt ccagacagat tgatccctaa 1380acgttcctct aggagcgttt gcagttctaa taaatctaaa gaatctaatc ccatatccag 1440cagtttttgt tgtggagcgt aggctgcctg acgttgggaa cccattactt ttaagatgca 1500ttctttaacg agatccgcta cagttttgtt ttccttagtt gcagatgttg cttttggtac 1560caatgaacca attgctgagt taatatacgg tcctttgcga tcaccaggcg agtgcaaagc 1620actgtcgcgc aggttatatt caatcaaaat acccatgccg agattatctg tatcttccgg 1680acgataatta gcaataattc ccctaatttc ggctcctccc gacacatgga aacccacaat 1740tggatccaga agctgtcgtt gctcattgtg tagctttaaa tactccatca tcggcatttg 1800ggaataattg acataatttc gacagcgagt tacacccacc acgctctcaa tgccgccttt 1860cagggtacag tagtaaagca taaagtcccg caattcattt cctaaccccc gcgcctgaaa 1920ctcaggtaga atatttagtg cgagcagttg aataactgac ccttggggag tatgtaacgt 1980cggcacttgc gcatatttta cattctctaa tgcctcagtg ctggtaattg tttgggaata 2040aatcgcacca ataatttgat cttctataat cagcactaaa ttaccttgcg ggtttagctc 2100aagtcttcgc cgaatttcat gagtagatgc ccgtaaattt tctggccaac acttgacctc 2160caagtcaact aaggcaggta aatctgacaa ataggcatga ctaattttgt aaggtctttt 2220ctcgaagtaa ttaagcgtaa tgcgagtaaa aggaaatgtt tttgggtatc ttttagaaag 2280ctctagtttt ggaaatagac ctacttgtgc agcagacatg agaaaaacct cagcttccac 2340aagatactgc tgagaaaatc cctgaaacgc atcgaaatgt aagttttcgc ttttgtctaa 2400aaactgatag actacccttg gttccaaaca atggacctcc aaaatcatta aaccgtgttt 2460attgaccact tgagaccatc tttctaagtg ttccaccaaa ctttgcacca taacatgagg 2520aggaataagc tctccttgat catcgacaca gactgattgg taaggtaagt gagcacgttc 2580tttcaattcg tttcttttct gaggaggaat aaagagacga tcatggtcga ggaacgaacg 2640gatgtgcagg atattttcgg gatcatgaat gccatgagct tctaaagaac gcaccatttg 2700ttctgggttc ccaatatctc cctgtaaaac taagtgggga aggctagcaa gggtgcgtgt 2760ggtagctttt aaagaagctt cgttataatc tacacctata agacgcaggg gatactgttc 2820gagtgctttt cccctagcag acttaaattg aatggtttcc cagactcgtt tcaggagagt 2880tccatcgcca caccccatgt cagtaatgta tttgggttgt tcttctaatg gcaactgatt 2940gaatactgag aggatacttt cttctaaatc ggcaaaatat ttctggtgtt gaaatccact 3000cccgatcacg ttaagggtgc gatcaatgtg cctttcgtga ccggaagcat ctctttggaa 3060tacggagaga caattgccaa acaatacatc atgaatgcgg gacaacatag gagtgtagga 3120cgccactatg gctgtattca aggctcgctc tcccataaat cgaccaagtt cggttatggt 3180caaacgacct gctgtaaggt cagcccagcc aaggtggaga aataacttac ccaactcttc 3240ttgcactgtt gagcttaatg aggagagcaa aggtttgtcc tccgaatctg caagcaagtt 3300gtgtttgtgc agtgccagca ggagtgggat gaccagtaat ccatctaaaa aatctgccat 3360taggggattg tccaggttcc acaattggca agaacgctca atccatcttc ccagcaaatt 3420tccttgtttc ccttctaaat aagactgaat tggtaggttg tacaattgaa gaatgtcttc 3480cgaaattttg ttgtgaatcg ctgcttctgc ggttagagag tatttaagct ccttatttcg 3540ggaaagccaa tgtaaagact cgagcatcct caaagcaact tgaaaatgtc cgctgttagc 3600tcccagatgt tccaccattt ggtttaaaga gagaggactt tcatcggcga gtaattcaaa 3660aacacctttt tctcgacacg caagaataac gggaaccgcc acaaagccgt gagtataacg 3720attaatcttt tgtaacat 3738151245PRTCylindrospermopsis raciborskii T3 15Met Leu Gln Lys Ile Asn Arg Tyr Thr His Gly Phe Val Ala Val Pro1 5 10 15Val Ile Leu Ala Cys Arg Glu Lys Gly Val Phe Glu Leu Leu Ala Asp 20 25 30Glu Ser Pro Leu Ser Leu Asn Gln Met Val Glu His Leu Gly Ala Asn 35 40 45Ser Gly His Phe Gln Val Ala Leu Arg Met Leu Glu Ser Leu His Trp 50 55 60Leu Ser Arg Asn Lys Glu Leu Lys Tyr Ser Leu Thr Ala Glu Ala Ala65 70 75 80Ile His Asn Lys Ile Ser Glu Asp Ile Leu Gln Leu Tyr Asn Leu Pro 85 90 95Ile Gln Ser Tyr Leu Glu Gly Lys Gln Gly Asn Leu Leu Gly Arg Trp 100 105 110Ile Glu Arg Ser Cys Gln Leu Trp Asn Leu Asp Asn Pro Leu Met Ala 115 120 125Asp Phe Leu Asp Gly Leu Leu Val Ile Pro Leu Leu Leu Ala Leu His 130 135 140Lys His Asn Leu Leu Ala Asp Ser Glu Asp Lys Pro Leu Leu Ser Ser145 150 155 160Leu Ser Ser Thr Val Gln Glu Glu Leu Gly Lys Leu Phe Leu His Leu 165 170 175Gly Trp Ala Asp Leu Thr Ala Gly Arg Leu Thr Ile Thr Glu Leu Gly 180 185 190Arg Phe Met Gly Glu Arg Ala Leu Asn Thr Ala Ile Val Ala Ser Tyr 195 200 205Thr Pro Met Leu Ser Arg Ile His Asp Val Leu Phe Gly Asn Cys Leu 210 215 220Ser Val Phe Gln Arg Asp Ala Ser Gly His Glu Arg His Ile Asp Arg225 230 235 240Thr Leu Asn Val Ile Gly Ser Gly Phe Gln His Gln Lys Tyr Phe Ala 245 250 255Asp Leu Glu Glu Ser Ile Leu Ser Val Phe Asn Gln Leu Pro Leu Glu 260 265 270Glu Gln Pro Lys Tyr Ile Thr Asp Met Gly Cys Gly Asp Gly Thr Leu 275 280 285Leu Lys Arg Val Trp Glu Thr Ile Gln Phe Lys Ser Ala Arg Gly Lys 290 295 300Ala Leu Glu Gln Tyr Pro Leu Arg Leu Ile Gly Val Asp Tyr Asn Glu305 310 315 320Ala Ser Leu Lys Ala Thr Thr Arg Thr Leu Ala Ser Leu Pro His Leu 325 330 335Val Leu Gln Gly Asp Ile Gly Asn Pro Glu Gln Met Val Arg Ser Leu 340 345 350Glu Ala His Gly Ile His Asp Pro Glu Asn Ile Leu His Ile Arg Ser 355 360 365Phe Leu Asp His Asp Arg Leu Phe Ile Pro Pro Gln Lys Arg Asn Glu 370 375 380Leu Lys Glu Arg Ala His Leu Pro Tyr Gln Ser Val Cys Val Asp Asp385 390 395 400Gln Gly Glu Leu Ile Pro Pro His Val Met Val Gln Ser Leu Val Glu 405 410 415His Leu Glu Arg Trp Ser Gln Val Val Asn Lys His Gly Leu Met Ile 420 425 430Leu Glu Val His Cys Leu Glu Pro Arg Val Val Tyr Gln Phe Leu Asp 435 440 445Lys Ser Glu Asn Leu His Phe Asp Ala Phe Gln Gly Phe Ser Gln Gln 450 455 460Tyr Leu Val Glu Ala Glu Val Phe Leu Met Ser Ala Ala Gln Val Gly465 470 475 480Leu Phe Pro Lys Leu Glu Leu Ser Lys Arg Tyr Pro Lys Thr Phe Pro 485 490 495Phe Thr Arg Ile Thr Leu Asn Tyr Phe Glu Lys Arg Pro Tyr Lys Ile 500 505 510Ser His Ala Tyr Leu Ser Asp Leu Pro Ala Leu Val Asp Leu Glu Val 515 520 525Lys Cys Trp Pro Glu Asn Leu Arg Ala Ser Thr His Glu Ile Arg Arg 530 535 540Arg Leu Glu Leu Asn Pro Gln Gly Asn Leu Val Leu Ile Ile Glu Asp545 550 555 560Gln Ile Ile Gly Ala Ile Tyr Ser Gln Thr Ile Thr Ser Thr Glu Ala 565 570 575Leu Glu Asn Val Lys Tyr Ala Gln Val Pro Thr Leu His Thr Pro Gln 580 585 590Gly Ser Val Ile Gln Leu Leu Ala Leu Asn Ile Leu Pro Glu Phe Gln 595 600 605Ala Arg Gly Leu Gly Asn Glu Leu Arg Asp Phe Met Leu Tyr Tyr Cys 610 615 620Thr Leu Lys Gly Gly Ile Glu Ser Val Val Gly Val Thr Arg Cys Arg625 630 635 640Asn Tyr Val Asn Tyr Ser Gln Met Pro Met Met Glu Tyr Leu Lys Leu 645 650 655His Asn Glu Gln Arg Gln Leu Leu Asp Pro Ile Val Gly Phe His Val 660 665 670Ser Gly Gly Ala Glu Ile Arg Gly Ile Ile Ala Asn Tyr Arg Pro Glu 675 680 685Asp Thr Asp Asn Leu Gly Met Gly Ile Leu Ile Glu Tyr Asn Leu Arg 690 695 700Asp Ser Ala Leu His Ser Pro Gly Asp Arg Lys Gly Pro Tyr Ile Asn705 710 715 720Ser Ala Ile Gly Ser Leu Val Pro Lys Ala Thr Ser Ala Thr Lys Glu 725 730 735Asn Lys Thr Val Ala Asp Leu Val Lys Glu Cys Ile Leu Lys Val Met 740 745 750Gly Ser Gln Arg Gln Ala Ala Tyr Ala Pro Gln Gln Lys Leu Leu Asp 755 760 765Met Gly Leu Asp Ser Leu Asp Leu Leu Glu Leu Gln Thr Leu Leu Glu 770 775 780Glu Arg Leu Gly Ile Asn Leu Ser Gly Thr Phe Phe Leu Gln Lys Asn785 790 795 800Thr Pro Thr Ala Ile Ile Thr Tyr Phe Gln Asn Gln Val Val Gln Glu 805 810 815Lys Gln Ser Asp Leu Ala Pro Pro Val Asp Ser Ala Asn Glu Ile Asn 820 825 830Thr Leu Glu Asn Val Val Asn Gln Gln Lys Ile Pro Gln Val Thr Arg 835 840 845Val Val Thr Glu Gln Gln Gly Arg Lys Val Leu Ile Asp Gly His Trp 850 855 860Val Ile Asp Phe Ala Ser Cys Asn Tyr Leu Gly Leu Asp Leu His Pro865 870 875 880Lys Val Lys Glu Ala Ile Pro Pro Ala Leu Asp Lys Trp Gly Thr His 885 890 895Pro Ser Trp Thr Arg Leu Val Ala Ser Pro Ala Ile Tyr Glu Glu Leu 900 905 910Glu Glu Glu Leu Ser Lys Leu Leu Gly Val Pro Asp

Val Leu Val Phe 915 920 925Pro Ala Val Thr Leu Leu Gln Ile Gly Ile Leu Pro Leu Leu Thr Gly 930 935 940Asn Asn Gly Val Ile Phe Gly Asp Ile Ala Ala His Arg Cys Ile Tyr945 950 955 960Glu Ala Cys Cys Leu Ala Gln His Lys Gly Ala Gln Phe Ile Gln Tyr 965 970 975Arg His Asn Asp Leu Asn Asp Leu Ala Glu Lys Leu Ala Lys Tyr Pro 980 985 990Pro Glu Gln Val Lys Ile Ile Val Ile Asp Gly Val Tyr Ser Met Ser 995 1000 1005Ala Asp Phe Pro Asp Leu Pro Ala Tyr Val His Leu Ala Lys Glu 1010 1015 1020Tyr Asn Ala Leu Ile Tyr Met Asp Asp Ala His Gly Phe Gly Ile 1025 1030 1035Leu Gly Glu Asn Pro Ser Ser Asp Met Pro Tyr Gly Tyr Lys Gly 1040 1045 1050Asn Gly Met Val Asn Tyr Phe Asp Leu Arg Phe Ala Glu Asp Asn 1055 1060 1065Ile Ile Tyr Val Ala Gly Leu Ser Lys Ala Tyr Ser Ser Tyr Ala 1070 1075 1080Ala Phe Leu Thr Cys Gly Asp Arg Arg Ile Lys Thr Asn Phe Arg 1085 1090 1095Asn Ala Trp Thr Ala Ile Phe Ser Gly Pro Ser Pro Val Ala Ser 1100 1105 1110Leu Ala Ser Ala Leu Ala Gly Leu Gln Val Asn Arg Gln Glu Gly 1115 1120 1125Glu Gln Leu Arg Lys Gln Ile Tyr His Leu Thr His Lys Leu Val 1130 1135 1140Thr Gln Ala Arg Ala Ile Gly Phe Glu Val Asp Asn Tyr Gly Tyr 1145 1150 1155Val Pro Ile Val Gly Val Leu Val Gly Asp Ala Gln His Met Ile 1160 1165 1170Asp Val Cys Gln Leu Leu Trp Glu Tyr Gly Ile Leu Ile Thr Pro 1175 1180 1185Ala Ile Phe Pro Ile Val Pro Leu Asn Lys Ser Ala Leu Arg Phe 1190 1195 1200Ser Ile Thr Ala Ala Asn Thr Glu Glu Glu Ile Asp Gln Ala Ile 1205 1210 1215Lys Ser Leu Lys Ala Val Trp Asp Leu Leu Gln Lys Arg Lys Ala 1220 1225 1230Leu Pro Cys Lys Gln Glu Glu Asn Ile Leu Lys His 1235 1240 124516387DNACylindrospermopsis raciborskii T3 16atgttgaaag atttcaacca gtttttaatc agaacactag cattcgtatt cgcatttggt 60attttcttaa ccactggagt tggcattgct aaagctgact acctagttaa aggtggaaag 120attaccaatg ttcaaaatac ttcttctaac ggtgataatt atgccgttag tatcagcggt 180gggtttggtc cttgcgcaga tagagtgatt atcctaccaa cttcaggagt gataaatcga 240gacattcata tgcgtggcta tgaagccgca ttaactgcac tatccaatgg ctttttagta 300gatatttacg actatactgg ctcttcttgc agcaatggtg gccaactaac tattaccaac 360caattaggta agctaatcag caattag 38717128PRTCylindrospermopsis raciborskii T3 17Met Leu Lys Asp Phe Asn Gln Phe Leu Ile Arg Thr Leu Ala Phe Val1 5 10 15Phe Ala Phe Gly Ile Phe Leu Thr Thr Gly Val Gly Ile Ala Lys Ala 20 25 30Asp Tyr Leu Val Lys Gly Gly Lys Ile Thr Asn Val Gln Asn Thr Ser 35 40 45Ser Asn Gly Asp Asn Tyr Ala Val Ser Ile Ser Gly Gly Phe Gly Pro 50 55 60Cys Ala Asp Arg Val Ile Ile Leu Pro Thr Ser Gly Val Ile Asn Arg65 70 75 80Asp Ile His Met Arg Gly Tyr Glu Ala Ala Leu Thr Ala Leu Ser Asn 85 90 95Gly Phe Leu Val Asp Ile Tyr Asp Tyr Thr Gly Ser Ser Cys Ser Asn 100 105 110Gly Gly Gln Leu Thr Ile Thr Asn Gln Leu Gly Lys Leu Ile Ser Asn 115 120 125181416DNACylindrospermopsis raciborskii T3 18atggaaacaa cctcaaaaaa atttaagtca gatctgatat tagaagcacg agcaagccta 60aagttgggaa tccccttagt catttcacaa atgtgcgaaa cgggtattta tacagcgaat 120gcagtcatga tgggtttact tggtacgcaa gttttggccg ccggtgcttt gggcgcgctc 180gcttttttga ccttattatt tgcctgccat ggtattctct cagtaggagg atcactagca 240gccgaagctt ttggggcaaa taaaatagat gaagttagtc gtattgcttc cgggcaaata 300tggctagcag ttaccttgtc tttacctgca atgcttctgc tttggcatgg cgatactatc 360ttgctgctat tcggtcaaga ggaaagcaat gtgttattga caaaaacgta tttacactca 420attttatggg gctttcccgc tgcgcttagt attttgacat taagaggcat tgcctctgct 480ctcaacgttc cccgattgat aactattact atgctcactc agctgatatt gaataccgcc 540gccgattatg tgttaatatt cggtaaattt ggtcttcctc aacttggttt ggctggaata 600ggctgggcaa ctgctctggg tttttgggtt agttttacat tggggcttat cttgctgatt 660ttctccctga aagttagaga ttataaactt ttccgctact tgcatcagtt tgataaacag 720atctttgtca aaatttttca aactggatgg cccatggggt ttcaatgggg ggcggaaacg 780gcactattta acgtcaccgc ttgggtagca gggtatttag gaacggtaac attagcagcc 840catgatattg gcttccaaac ggcagaactg gcgatggtta taccactcgg agtcggcaat 900gtcgctatga caagagtagg tcagagtata ggagaaaaaa accctttggg tgcaagaagg 960gtagcatcga ttggaattac aatagttggc atttatgcca gtattgtagc acttgttttc 1020tggttgtttc catatcaaat tgccggaatt tatttaaata taaacaatcc cgagaatatc 1080gaagcaatta agaaagcaac tacttttatc cccttggcgg gactattcca aatgttttac 1140agtattcaaa taattattgt tggggctttg gtcggtctgc gggatacatt tgttccagta 1200tcaatgaact taattgtctg gggtcttgga ttggcaggaa gctatttcat ggcaatcatt 1260ttaggatggg gggggatcgg gatttggttg gctatggttt tgagtccact cctctcggca 1320gttattttaa ctgttcgttt ttatcgagtg attgacaatc ttcttgccaa cagtgatgat 1380atgttacaga atgcgtctgt tactactcta ggctga 141619471PRTCylindrospermopsis raciborskii T3 19Met Glu Thr Thr Ser Lys Lys Phe Lys Ser Asp Leu Ile Leu Glu Ala1 5 10 15Arg Ala Ser Leu Lys Leu Gly Ile Pro Leu Val Ile Ser Gln Met Cys 20 25 30Glu Thr Gly Ile Tyr Thr Ala Asn Ala Val Met Met Gly Leu Leu Gly 35 40 45Thr Gln Val Leu Ala Ala Gly Ala Leu Gly Ala Leu Ala Phe Leu Thr 50 55 60Leu Leu Phe Ala Cys His Gly Ile Leu Ser Val Gly Gly Ser Leu Ala65 70 75 80Ala Glu Ala Phe Gly Ala Asn Lys Ile Asp Glu Val Ser Arg Ile Ala 85 90 95Ser Gly Gln Ile Trp Leu Ala Val Thr Leu Ser Leu Pro Ala Met Leu 100 105 110Leu Leu Trp His Gly Asp Thr Ile Leu Leu Leu Phe Gly Gln Glu Glu 115 120 125Ser Asn Val Leu Leu Thr Lys Thr Tyr Leu His Ser Ile Leu Trp Gly 130 135 140Phe Pro Ala Ala Leu Ser Ile Leu Thr Leu Arg Gly Ile Ala Ser Ala145 150 155 160Leu Asn Val Pro Arg Leu Ile Thr Ile Thr Met Leu Thr Gln Leu Ile 165 170 175Leu Asn Thr Ala Ala Asp Tyr Val Leu Ile Phe Gly Lys Phe Gly Leu 180 185 190Pro Gln Leu Gly Leu Ala Gly Ile Gly Trp Ala Thr Ala Leu Gly Phe 195 200 205Trp Val Ser Phe Thr Leu Gly Leu Ile Leu Leu Ile Phe Ser Leu Lys 210 215 220Val Arg Asp Tyr Lys Leu Phe Arg Tyr Leu His Gln Phe Asp Lys Gln225 230 235 240Ile Phe Val Lys Ile Phe Gln Thr Gly Trp Pro Met Gly Phe Gln Trp 245 250 255Gly Ala Glu Thr Ala Leu Phe Asn Val Thr Ala Trp Val Ala Gly Tyr 260 265 270Leu Gly Thr Val Thr Leu Ala Ala His Asp Ile Gly Phe Gln Thr Ala 275 280 285Glu Leu Ala Met Val Ile Pro Leu Gly Val Gly Asn Val Ala Met Thr 290 295 300Arg Val Gly Gln Ser Ile Gly Glu Lys Asn Pro Leu Gly Ala Arg Arg305 310 315 320Val Ala Ser Ile Gly Ile Thr Ile Val Gly Ile Tyr Ala Ser Ile Val 325 330 335Ala Leu Val Phe Trp Leu Phe Pro Tyr Gln Ile Ala Gly Ile Tyr Leu 340 345 350Asn Ile Asn Asn Pro Glu Asn Ile Glu Ala Ile Lys Lys Ala Thr Thr 355 360 365Phe Ile Pro Leu Ala Gly Leu Phe Gln Met Phe Tyr Ser Ile Gln Ile 370 375 380Ile Ile Val Gly Ala Leu Val Gly Leu Arg Asp Thr Phe Val Pro Val385 390 395 400Ser Met Asn Leu Ile Val Trp Gly Leu Gly Leu Ala Gly Ser Tyr Phe 405 410 415Met Ala Ile Ile Leu Gly Trp Gly Gly Ile Gly Ile Trp Leu Ala Met 420 425 430Val Leu Ser Pro Leu Leu Ser Ala Val Ile Leu Thr Val Arg Phe Tyr 435 440 445Arg Val Ile Asp Asn Leu Leu Ala Asn Ser Asp Asp Met Leu Gln Asn 450 455 460Ala Ser Val Thr Thr Leu Gly465 470201134DNACylindrospermopsis raciborskii T3 20atgaccaatc aaaataacca agaattagag aacgatttac caatcgccaa gcagccttgt 60ccggtcaatt cttataatga gtgggacaca cttgaggagg tcattgttgg tagtgttgaa 120ggtgcaatgt taccggccct agaaccaatc aacaaatgga cattcccttt tgaagaattg 180gaatctgccc aaaagatact ctctgagagg ggaggagttc cttatccacc agagatgatt 240acattagcac acaaagaact aaatgaattt attcacattc ttgaagcaga aggggtcaaa 300gttcgtcgag ttaaacctgt agatttctct gtccccttct ccacaccagc ttggcaagta 360ggaagtggtt tttgtgccgc caatcctcgc gatgtttttt tggtgattgg gaatgagatt 420attgaagcac caatggcaga tcgcaaccgc tattttgaaa cttgggcgta tcgagagatg 480ctcaaggaat attttcaggc aggagctaag tggactgcag cgccgaagcc acaattattc 540gacgcacagt atgacttcaa tttccagttt cctcaactgg gggagccgcc gcgtttcgtc 600gttacagagt ttgaaccgac ttttgatgcg gcagattttg tgcgctgtgg acgagatatt 660tttggtcaaa aaagtcatgt gactaatggt ttgggcatag aatggttaca acgtcacttg 720gaagacgaat accgtattca tattattgaa tcgcattgtc cggaagcact gcacatcgat 780accaccttaa tgcctcttgc acctggcaaa atactagtaa atccagaatt tgtagatgtt 840aataaattgc caaaaatcct gaaaagctgg gacattttgg ttgcacctta ccccaaccat 900atacctcaaa accagctgag actggtcagt gaatgggcag gtttgaatgt actgatgtta 960gatgaagagc gagtcattgt agaaaaaaac caggagcaga tgattaaagc actgaaagat 1020tggggattta agcctattgt ttgccatttt gaaagctact atccattttt aggatcattt 1080cactgtgcaa cattagacgt tcgccgacgc ggaactcttc agtcctattt ttaa 113421377PRTCylindrospermopsis raciborskii T3 21Met Thr Asn Gln Asn Asn Gln Glu Leu Glu Asn Asp Leu Pro Ile Ala1 5 10 15Lys Gln Pro Cys Pro Val Asn Ser Tyr Asn Glu Trp Asp Thr Leu Glu 20 25 30Glu Val Ile Val Gly Ser Val Glu Gly Ala Met Leu Pro Ala Leu Glu 35 40 45Pro Ile Asn Lys Trp Thr Phe Pro Phe Glu Glu Leu Glu Ser Ala Gln 50 55 60Lys Ile Leu Ser Glu Arg Gly Gly Val Pro Tyr Pro Pro Glu Met Ile65 70 75 80Thr Leu Ala His Lys Glu Leu Asn Glu Phe Ile His Ile Leu Glu Ala 85 90 95Glu Gly Val Lys Val Arg Arg Val Lys Pro Val Asp Phe Ser Val Pro 100 105 110Phe Ser Thr Pro Ala Trp Gln Val Gly Ser Gly Phe Cys Ala Ala Asn 115 120 125Pro Arg Asp Val Phe Leu Val Ile Gly Asn Glu Ile Ile Glu Ala Pro 130 135 140Met Ala Asp Arg Asn Arg Tyr Phe Glu Thr Trp Ala Tyr Arg Glu Met145 150 155 160Leu Lys Glu Tyr Phe Gln Ala Gly Ala Lys Trp Thr Ala Ala Pro Lys 165 170 175Pro Gln Leu Phe Asp Ala Gln Tyr Asp Phe Asn Phe Gln Phe Pro Gln 180 185 190Leu Gly Glu Pro Pro Arg Phe Val Val Thr Glu Phe Glu Pro Thr Phe 195 200 205Asp Ala Ala Asp Phe Val Arg Cys Gly Arg Asp Ile Phe Gly Gln Lys 210 215 220Ser His Val Thr Asn Gly Leu Gly Ile Glu Trp Leu Gln Arg His Leu225 230 235 240Glu Asp Glu Tyr Arg Ile His Ile Ile Glu Ser His Cys Pro Glu Ala 245 250 255Leu His Ile Asp Thr Thr Leu Met Pro Leu Ala Pro Gly Lys Ile Leu 260 265 270Val Asn Pro Glu Phe Val Asp Val Asn Lys Leu Pro Lys Ile Leu Lys 275 280 285Ser Trp Asp Ile Leu Val Ala Pro Tyr Pro Asn His Ile Pro Gln Asn 290 295 300Gln Leu Arg Leu Val Ser Glu Trp Ala Gly Leu Asn Val Leu Met Leu305 310 315 320Asp Glu Glu Arg Val Ile Val Glu Lys Asn Gln Glu Gln Met Ile Lys 325 330 335Ala Leu Lys Asp Trp Gly Phe Lys Pro Ile Val Cys His Phe Glu Ser 340 345 350Tyr Tyr Pro Phe Leu Gly Ser Phe His Cys Ala Thr Leu Asp Val Arg 355 360 365Arg Arg Gly Thr Leu Gln Ser Tyr Phe 370 375221005DNACylindrospermopsis raciborskii T3 22atgacaactg ctgacctaat cttaattaac aactggtacg tagtcgcaaa ggtggaagat 60tgtaaaccag gaagtatcac cacggctctt ttattgggag ttaagttggt actatggcgc 120agtcgtgaac agaattcccc catacagata tggcaagact actgccctca ccgaggtgtg 180gctctgtcta tgggagaaat tgttaataat actttggttt gtccgtatca cggatggaga 240tataatcaag caggtaaatg cgtacatatc ccggctcacc ctgacatgac acccccagca 300agtgcccaag ccaagatcta tcattgccag gagcgatacg gattagtatg ggtgtgctta 360ggtgatcctg tcaatgatat accttcatta cccgaatggg acgatccgaa ttatcataat 420acttgtacta aatcttattt tattcaagct agtgcgtttc gtgtaatgga taatttcata 480gatgtatctc attttccttt tgtccacgac ggtgggttag gtgatcgcaa ccacgcacaa 540attgaagaat ttgaggtaaa agtagacaaa gatggcatta gcataggtaa ccttaaactc 600cagatgccaa ggtttaacag cagtaacgaa gatgactcat ggactcttta ccaaaggatt 660agtcatccct tgtgtcaata ctatattact gaatcctctg aaattcggac tgcggatttg 720atgctggtaa caccgattga tgaagacaac agcttagtgc gaatgttagt aacgtggaac 780cgctccgaaa tattagagtc aacggtacta gaggaatttg acgaaacaat agaacaagat 840attccgatta tacactctca acagccagcg cgtttaccac tgttaccttc aaagcagata 900aacatgcaat ggttgtcaca ggaaatacat gtaccgtcag atcgatgcac agttgcctat 960cgtcgatggc taaaggaact gggcgttacc tatggtgttt gttaa 100523334PRTCylindrospermopsis raciborskii T3 23Met Thr Thr Ala Asp Leu Ile Leu Ile Asn Asn Trp Tyr Val Val Ala1 5 10 15Lys Val Glu Asp Cys Lys Pro Gly Ser Ile Thr Thr Ala Leu Leu Leu 20 25 30Gly Val Lys Leu Val Leu Trp Arg Ser Arg Glu Gln Asn Ser Pro Ile 35 40 45Gln Ile Trp Gln Asp Tyr Cys Pro His Arg Gly Val Ala Leu Ser Met 50 55 60Gly Glu Ile Val Asn Asn Thr Leu Val Cys Pro Tyr His Gly Trp Arg65 70 75 80Tyr Asn Gln Ala Gly Lys Cys Val His Ile Pro Ala His Pro Asp Met 85 90 95Thr Pro Pro Ala Ser Ala Gln Ala Lys Ile Tyr His Cys Gln Glu Arg 100 105 110Tyr Gly Leu Val Trp Val Cys Leu Gly Asp Pro Val Asn Asp Ile Pro 115 120 125Ser Leu Pro Glu Trp Asp Asp Pro Asn Tyr His Asn Thr Cys Thr Lys 130 135 140Ser Tyr Phe Ile Gln Ala Ser Ala Phe Arg Val Met Asp Asn Phe Ile145 150 155 160Asp Val Ser His Phe Pro Phe Val His Asp Gly Gly Leu Gly Asp Arg 165 170 175Asn His Ala Gln Ile Glu Glu Phe Glu Val Lys Val Asp Lys Asp Gly 180 185 190Ile Ser Ile Gly Asn Leu Lys Leu Gln Met Pro Arg Phe Asn Ser Ser 195 200 205Asn Glu Asp Asp Ser Trp Thr Leu Tyr Gln Arg Ile Ser His Pro Leu 210 215 220Cys Gln Tyr Tyr Ile Thr Glu Ser Ser Glu Ile Arg Thr Ala Asp Leu225 230 235 240Met Leu Val Thr Pro Ile Asp Glu Asp Asn Ser Leu Val Arg Met Leu 245 250 255Val Thr Trp Asn Arg Ser Glu Ile Leu Glu Ser Thr Val Leu Glu Glu 260 265 270Phe Asp Glu Thr Ile Glu Gln Asp Ile Pro Ile Ile His Ser Gln Gln 275 280 285Pro Ala Arg Leu Pro Leu Leu Pro Ser Lys Gln Ile Asn Met Gln Trp 290 295 300Leu Ser Gln Glu Ile His Val Pro Ser Asp Arg Cys Thr Val Ala Tyr305 310 315 320Arg Arg Trp Leu Lys Glu Leu Gly Val Thr Tyr Gly Val Cys 325 330241839DNACylindrospermopsis raciborskii T3 24atgcagatct taggaatttc agcttactac cacgatagtg ctgccgcgat ggttatcgat 60ggcgaaattg ttgctgcagc tcaggaagaa cgtttctcaa gacgaaagca cgatgctggg 120tttccgactg gagcgattac ttactgtcta aaacaagtag gaaccaagtt acaatatatc 180gatcaaattg ttttttacga caagccatta gtcaaatttg agcggttgct agaaacatat 240ttagcatatg ccccaaaggg atttggctcg tttattactg ctatgcccgt ttggctcaaa 300gaaaagcttt acctaaaaac acttttaaaa aaagaattgg cgcttttggg ggagtgcaaa 360gcttctcaat tgcctcctct actgtttacc tcacatcacc aagcccatgc ggccgctgct 420ttttttccca gtccttttca gcgtgctgcc gttctgtgct tagatggtgt aggagagtgg 480gcaactactt ctgtctggtt gggagaagga aataaactca caccacaatg ggaaattgat 540tttccccatt ccctcggttt gctttactca gcgtttacct actacactgg gttcaaagtt 600aactcaggtg agtacaaact catgggttta gcaccctacg gggaacccaa atatgtggac 660caaattctca agcatttgtt ggatctcaaa gaagatggta cttttaggtt gaatatggac

720tacttcaact acacggtggg gctaaccatg accaatcata agttccatag tatgtttgga 780ggaccaccac gccaggcgga aggaaaaatc tcccaaagag acatggatct ggcaagttcg 840atccaaaagg tgactgaaga agtcatactg cgtctggcta gaactatcaa aaaagaactg 900ggtgtagagt atctatgttt agcaggtggt gtcggtctca attgcgtggc taacggacga 960attctccgag aaagtgattt caaagatatt tggattcaac ccgcagcagg agatgccggt 1020agtgcagtgg gagcagcttt agcgatttgg catgaatacc ataagaaacc tcgcacttca 1080acagcaggcg atcgcatgaa aggttcttat ctgggaccta gctttagcga ggcggagatt 1140ctccagtttc ttaattctgt taacataccc taccatcgat gcgttgataa cgaacttatg 1200gctcgtcttg cagaaatttt agaccaggga aatgttgtag gctggttttc tggacgaatg 1260gagtttggtc cgcgtgcttt gggtggccgt tcgattattg gcgattcacg cagtccaaaa 1320atgcaatcgg tcatgaacct gaaaattaaa tatcgtgagt ccttccgtcc atttgctcct 1380tcagtcttgg ctgaacgagt ctccgactac ttcgatcttg atcgtcctag tccttatatg 1440cttttggtag cacaagtcaa agagaatctg cacattccta tgacacaaga gcaacacgag 1500ctatttggga tcgagaagct gaatgttcct cgttcccaaa ttcccgcagt cactcacgtt 1560gattactcag ctcgtattca gacagttcac aaagaaacga atcctcgtta ctacgagtta 1620attcgtcatt ttgaggcacg aactggttgt gctgtcttgg tcaatacttc gtttaatgtc 1680cgcggcgaac caattgtttg tactcccgaa gacgcttatc gatgctttat gagaactgaa 1740atggactatt tggttatgga gaatttcttg ttggtcaaat ctgaacagcc acggggaaat 1800agtgatgagt catggcaaaa agaattcgag ttagattaa 183925612PRTCylindrospermopsis raciborskii T3 25Met Gln Ile Leu Gly Ile Ser Ala Tyr Tyr His Asp Ser Ala Ala Ala1 5 10 15Met Val Ile Asp Gly Glu Ile Val Ala Ala Ala Gln Glu Glu Arg Phe 20 25 30Ser Arg Arg Lys His Asp Ala Gly Phe Pro Thr Gly Ala Ile Thr Tyr 35 40 45Cys Leu Lys Gln Val Gly Thr Lys Leu Gln Tyr Ile Asp Gln Ile Val 50 55 60Phe Tyr Asp Lys Pro Leu Val Lys Phe Glu Arg Leu Leu Glu Thr Tyr65 70 75 80Leu Ala Tyr Ala Pro Lys Gly Phe Gly Ser Phe Ile Thr Ala Met Pro 85 90 95Val Trp Leu Lys Glu Lys Leu Tyr Leu Lys Thr Leu Leu Lys Lys Glu 100 105 110Leu Ala Leu Leu Gly Glu Cys Lys Ala Ser Gln Leu Pro Pro Leu Leu 115 120 125Phe Thr Ser His His Gln Ala His Ala Ala Ala Ala Phe Phe Pro Ser 130 135 140Pro Phe Gln Arg Ala Ala Val Leu Cys Leu Asp Gly Val Gly Glu Trp145 150 155 160Ala Thr Thr Ser Val Trp Leu Gly Glu Gly Asn Lys Leu Thr Pro Gln 165 170 175Trp Glu Ile Asp Phe Pro His Ser Leu Gly Leu Leu Tyr Ser Ala Phe 180 185 190Thr Tyr Tyr Thr Gly Phe Lys Val Asn Ser Gly Glu Tyr Lys Leu Met 195 200 205Gly Leu Ala Pro Tyr Gly Glu Pro Lys Tyr Val Asp Gln Ile Leu Lys 210 215 220His Leu Leu Asp Leu Lys Glu Asp Gly Thr Phe Arg Leu Asn Met Asp225 230 235 240Tyr Phe Asn Tyr Thr Val Gly Leu Thr Met Thr Asn His Lys Phe His 245 250 255Ser Met Phe Gly Gly Pro Pro Arg Gln Ala Glu Gly Lys Ile Ser Gln 260 265 270Arg Asp Met Asp Leu Ala Ser Ser Ile Gln Lys Val Thr Glu Glu Val 275 280 285Ile Leu Arg Leu Ala Arg Thr Ile Lys Lys Glu Leu Gly Val Glu Tyr 290 295 300Leu Cys Leu Ala Gly Gly Val Gly Leu Asn Cys Val Ala Asn Gly Arg305 310 315 320Ile Leu Arg Glu Ser Asp Phe Lys Asp Ile Trp Ile Gln Pro Ala Ala 325 330 335Gly Asp Ala Gly Ser Ala Val Gly Ala Ala Leu Ala Ile Trp His Glu 340 345 350Tyr His Lys Lys Pro Arg Thr Ser Thr Ala Gly Asp Arg Met Lys Gly 355 360 365Ser Tyr Leu Gly Pro Ser Phe Ser Glu Ala Glu Ile Leu Gln Phe Leu 370 375 380Asn Ser Val Asn Ile Pro Tyr His Arg Cys Val Asp Asn Glu Leu Met385 390 395 400Ala Arg Leu Ala Glu Ile Leu Asp Gln Gly Asn Val Val Gly Trp Phe 405 410 415Ser Gly Arg Met Glu Phe Gly Pro Arg Ala Leu Gly Gly Arg Ser Ile 420 425 430Ile Gly Asp Ser Arg Ser Pro Lys Met Gln Ser Val Met Asn Leu Lys 435 440 445Ile Lys Tyr Arg Glu Ser Phe Arg Pro Phe Ala Pro Ser Val Leu Ala 450 455 460Glu Arg Val Ser Asp Tyr Phe Asp Leu Asp Arg Pro Ser Pro Tyr Met465 470 475 480Leu Leu Val Ala Gln Val Lys Glu Asn Leu His Ile Pro Met Thr Gln 485 490 495Glu Gln His Glu Leu Phe Gly Ile Glu Lys Leu Asn Val Pro Arg Ser 500 505 510Gln Ile Pro Ala Val Thr His Val Asp Tyr Ser Ala Arg Ile Gln Thr 515 520 525Val His Lys Glu Thr Asn Pro Arg Tyr Tyr Glu Leu Ile Arg His Phe 530 535 540Glu Ala Arg Thr Gly Cys Ala Val Leu Val Asn Thr Ser Phe Asn Val545 550 555 560Arg Gly Glu Pro Ile Val Cys Thr Pro Glu Asp Ala Tyr Arg Cys Phe 565 570 575Met Arg Thr Glu Met Asp Tyr Leu Val Met Glu Asn Phe Leu Leu Val 580 585 590Lys Ser Glu Gln Pro Arg Gly Asn Ser Asp Glu Ser Trp Gln Lys Glu 595 600 605Phe Glu Leu Asp 61026444DNACylindrospermopsis raciborskii T3 26atgagtgaat ttttcccaca aaaaagtggt aaattaaaga tggaacagat aaaagaactt 60gacaaaaaag gattgcgtga gtttggactg attggcggtt ctatagtggc ggttttattc 120ggctttttac tgccagttat acgccatcat tccttatcag ttatcccttg ggttgttgct 180ggatttctct ggatttgggc aataatcgca cctacgactt taagttttat ttaccaaata 240tggatgagga ttggacttgt tttaggatgg atacaaacac gaattatttt gggagtttta 300ttttatataa tgatcacacc aataggattc ataagacggc tgttgaatca agatccaatg 360acgcgaatct tcgagccaga gttgccaact tatcgccaat tgagtaagtc aagaactaca 420caaagtatgg agaaaccatt ctaa 44427147PRTCylindrospermopsis raciborskii T3 27Met Ser Glu Phe Phe Pro Gln Lys Ser Gly Lys Leu Lys Met Glu Gln1 5 10 15Ile Lys Glu Leu Asp Lys Lys Gly Leu Arg Glu Phe Gly Leu Ile Gly 20 25 30Gly Ser Ile Val Ala Val Leu Phe Gly Phe Leu Leu Pro Val Ile Arg 35 40 45His His Ser Leu Ser Val Ile Pro Trp Val Val Ala Gly Phe Leu Trp 50 55 60Ile Trp Ala Ile Ile Ala Pro Thr Thr Leu Ser Phe Ile Tyr Gln Ile65 70 75 80Trp Met Arg Ile Gly Leu Val Leu Gly Trp Ile Gln Thr Arg Ile Ile 85 90 95Leu Gly Val Leu Phe Tyr Ile Met Ile Thr Pro Ile Gly Phe Ile Arg 100 105 110Arg Leu Leu Asn Gln Asp Pro Met Thr Arg Ile Phe Glu Pro Glu Leu 115 120 125Pro Thr Tyr Arg Gln Leu Ser Lys Ser Arg Thr Thr Gln Ser Met Glu 130 135 140Lys Pro Phe14528165DNACylindrospermopsis raciborskii T3 28atgctaaaag acacttggga ttttattaaa gacattgccg gatttattaa agaacaaaaa 60aactatttgt tgattcccct aattatcacc ctggtatcct tgggggcgct gattgtcttt 120gctcaatctt ctgcgatcgc acctttcatt tacactcttt tttaa 1652954PRTCylindrospermopsis raciborskii T3 29Met Leu Lys Asp Thr Trp Asp Phe Ile Lys Asp Ile Ala Gly Phe Ile1 5 10 15Lys Glu Gln Lys Asn Tyr Leu Leu Ile Pro Leu Ile Ile Thr Leu Val 20 25 30Ser Leu Gly Ala Leu Ile Val Phe Ala Gln Ser Ser Ala Ile Ala Pro 35 40 45Phe Ile Tyr Thr Leu Phe 50301299DNACylindrospermopsis raciborskii T3 30atgagtaact tcaagggttc ggtaaagata gcattgatgg gaatattgat tttttgtggg 60ctaatctttg gcgtagcatt tgttgaaatt gggttacgta ttgccgggat cgaacacata 120gcattccata gcattgatga acacaggggg tgggtagggc gacctcatgt ttccgggtgg 180tatagaaccg aaggtgaagc tcacatccaa atgaatagtg atggctttcg agatcgagaa 240cacatcaagg tcaaaccaga aaataccttc aggatagcgc tgttgggaga ttcctttgta 300gagtccatgc aagtaccgtt ggagcaaaat ttggcagcag ttatagaagg agaaatcagt 360agttgtatag ctttagctgg acgaaaggcg gaagtgatta attttggagt gactggttat 420ggaacagacc aagaactaat tactctacgg gagaaagttt gggactattc acctgatata 480gtagtgctag atttttatac tggcaacgac attgttgata actcccgtgc gctgagtcag 540aaattctatc ctaatgaact aggttcacta aagccgtttt ttatacttag agatggtaat 600ctggtggttg atgcttcgtt tatcaatacg gataattatc gctcaaagct gacatggtgg 660ggcaaaactt atatgaaaat aaaagaccac tcacggattt tacaggtttt aaacatggta 720cgggatgctc ttaacaactc tagtagaggg ttttcttctc aagctataga ggaaccgtta 780tttagtgatg gaaaacagga tacaaaattg agcgggtttt ttgatatcta caaaccacct 840actgaccctg aatggcaaca ggcatggcaa gtcacagaga aactgattag ctcaatgcaa 900cacgaggtga ctgcgaagaa agcagatttt ttagttgtta cttttggcgg tccctttcaa 960cgagaacctt tagtgcgtca aaaagaaatg caagaattgg gtctgactga ttggttttac 1020ccagagaagc gaattacacg tttgggtgag gatgaggggt tcagtgtact caatctcagc 1080ccaaatttgc aggtttattc tgagcagaac aatgcttgcc tatatgggtt tgatgatact 1140caaggctgtg tagggcattg gaatgcttta ggacatcagg tagcaggaaa aatgattgca 1200tcgaagattt gtcaacagca gatgagagaa agtatattgc ctcataagca cgacccttca 1260agccaaagct cacctattac ccaatcagtg atccaataa 129931432PRTCylindrospermopsis raciborskii T3 31Met Ser Asn Phe Lys Gly Ser Val Lys Ile Ala Leu Met Gly Ile Leu1 5 10 15Ile Phe Cys Gly Leu Ile Phe Gly Val Ala Phe Val Glu Ile Gly Leu 20 25 30Arg Ile Ala Gly Ile Glu His Ile Ala Phe His Ser Ile Asp Glu His 35 40 45Arg Gly Trp Val Gly Arg Pro His Val Ser Gly Trp Tyr Arg Thr Glu 50 55 60Gly Glu Ala His Ile Gln Met Asn Ser Asp Gly Phe Arg Asp Arg Glu65 70 75 80His Ile Lys Val Lys Pro Glu Asn Thr Phe Arg Ile Ala Leu Leu Gly 85 90 95Asp Ser Phe Val Glu Ser Met Gln Val Pro Leu Glu Gln Asn Leu Ala 100 105 110Ala Val Ile Glu Gly Glu Ile Ser Ser Cys Ile Ala Leu Ala Gly Arg 115 120 125Lys Ala Glu Val Ile Asn Phe Gly Val Thr Gly Tyr Gly Thr Asp Gln 130 135 140Glu Leu Ile Thr Leu Arg Glu Lys Val Trp Asp Tyr Ser Pro Asp Ile145 150 155 160Val Val Leu Asp Phe Tyr Thr Gly Asn Asp Ile Val Asp Asn Ser Arg 165 170 175Ala Leu Ser Gln Lys Phe Tyr Pro Asn Glu Leu Gly Ser Leu Lys Pro 180 185 190Phe Phe Ile Leu Arg Asp Gly Asn Leu Val Val Asp Ala Ser Phe Ile 195 200 205Asn Thr Asp Asn Tyr Arg Ser Lys Leu Thr Trp Trp Gly Lys Thr Tyr 210 215 220Met Lys Ile Lys Asp His Ser Arg Ile Leu Gln Val Leu Asn Met Val225 230 235 240Arg Asp Ala Leu Asn Asn Ser Ser Arg Gly Phe Ser Ser Gln Ala Ile 245 250 255Glu Glu Pro Leu Phe Ser Asp Gly Lys Gln Asp Thr Lys Leu Ser Gly 260 265 270Phe Phe Asp Ile Tyr Lys Pro Pro Thr Asp Pro Glu Trp Gln Gln Ala 275 280 285Trp Gln Val Thr Glu Lys Leu Ile Ser Ser Met Gln His Glu Val Thr 290 295 300Ala Lys Lys Ala Asp Phe Leu Val Val Thr Phe Gly Gly Pro Phe Gln305 310 315 320Arg Glu Pro Leu Val Arg Gln Lys Glu Met Gln Glu Leu Gly Leu Thr 325 330 335Asp Trp Phe Tyr Pro Glu Lys Arg Ile Thr Arg Leu Gly Glu Asp Glu 340 345 350Gly Phe Ser Val Leu Asn Leu Ser Pro Asn Leu Gln Val Tyr Ser Glu 355 360 365Gln Asn Asn Ala Cys Leu Tyr Gly Phe Asp Asp Thr Gln Gly Cys Val 370 375 380Gly His Trp Asn Ala Leu Gly His Gln Val Ala Gly Lys Met Ile Ala385 390 395 400Ser Lys Ile Cys Gln Gln Gln Met Arg Glu Ser Ile Leu Pro His Lys 405 410 415His Asp Pro Ser Ser Gln Ser Ser Pro Ile Thr Gln Ser Val Ile Gln 420 425 430321449DNACylindrospermopsis raciborskii T3 32atgacaaata ccgaaagagg attagcagaa ataacatcaa caggatataa gtcagagctt 60agatcggagg cacgagttag cctccaactg gcaattccct tagtccttgt cgaaatatgc 120ggaacgagta ttaatgtggt ggatgtagtc atgatgggct tacttggtac tcaagttttg 180gctgctggtg ccttgggtgc gatcgctttt ttatctgtat cgaatacttg ttataatatg 240cttttgtcgg gggtagcaaa ggcatctgag gcttttgggg caaacaaaat agatcaggtt 300agtcgtattg cttctgggca aatatggctg gcactcacct tgtctttgcc tgcaatgctt 360ttgctttggt atatggatac tatattggtg ctatttggtc aagttgaaag caacacatta 420attgcaaaaa cgtatttaca ctcaattgtg tggggatttc cggcggcagt tggtattttg 480atattaagag gcattgcctc tgctgtgaac gtcccccaat tggtaactgt gacgatgcta 540gtagggctgg tcttgaatgc cccggccaat tatgtattaa tgttcggtaa atttggtctt 600cctgaacttg gtttagctgg aataggctgg gcaagtactt tggttttttg gattagtttt 660ctagtggggg ttgtcttgct gattttctcc ccaaaagtta gagattataa acttttccgc 720tacttgcatc agtttgatcg acagacggtt gtggaaattt ttcaaactgg atggcctatg 780ggttttctac tgggagtgga atcagtagta ttgagcctca ccgcttggtt aacaggctat 840ttgggaacag taacattagc agctcatgag atcgcgatcc aaacagcaga actggcgata 900gtgataccac tcggaatcgg gaatgttgcc gtcacgagag taggtcagac tataggagaa 960aaaaaccctt tgggtgctag aagggcagca ttgattggga ttatgattgg tggcatttat 1020gccagtcttg tggcagtcat tttctggttg tttccatatc agattgcggg actttattta 1080aaaataaacg atccagagag tatggaagca gttaagacag caactaattt tctcttcttg 1140gcgggattat tccaattttt tcatagcgtt caaataattg ttgttggggt tttaataggg 1200ttgcaggata cgtttatccc attgttaatg aatttggtag gctggggtct tggcttggca 1260gtaagctatt acatgggaat cattttatgt tggggaggta tgggtatctg gttaggtctg 1320gttttgagtc cactcctgtc cggacttatt ttaatggttc gtttttatca agagattgcc 1380aataggattg ccaatagtga tgatgggcaa gagagtatat ctattgacaa cgttgaagaa 1440ctctcctga 144933482PRTCylindrospermopsis raciborskii T3 33Met Thr Asn Thr Glu Arg Gly Leu Ala Glu Ile Thr Ser Thr Gly Tyr1 5 10 15Lys Ser Glu Leu Arg Ser Glu Ala Arg Val Ser Leu Gln Leu Ala Ile 20 25 30Pro Leu Val Leu Val Glu Ile Cys Gly Thr Ser Ile Asn Val Val Asp 35 40 45Val Val Met Met Gly Leu Leu Gly Thr Gln Val Leu Ala Ala Gly Ala 50 55 60Leu Gly Ala Ile Ala Phe Leu Ser Val Ser Asn Thr Cys Tyr Asn Met65 70 75 80Leu Leu Ser Gly Val Ala Lys Ala Ser Glu Ala Phe Gly Ala Asn Lys 85 90 95Ile Asp Gln Val Ser Arg Ile Ala Ser Gly Gln Ile Trp Leu Ala Leu 100 105 110Thr Leu Ser Leu Pro Ala Met Leu Leu Leu Trp Tyr Met Asp Thr Ile 115 120 125Leu Val Leu Phe Gly Gln Val Glu Ser Asn Thr Leu Ile Ala Lys Thr 130 135 140Tyr Leu His Ser Ile Val Trp Gly Phe Pro Ala Ala Val Gly Ile Leu145 150 155 160Ile Leu Arg Gly Ile Ala Ser Ala Val Asn Val Pro Gln Leu Val Thr 165 170 175Val Thr Met Leu Val Gly Leu Val Leu Asn Ala Pro Ala Asn Tyr Val 180 185 190Leu Met Phe Gly Lys Phe Gly Leu Pro Glu Leu Gly Leu Ala Gly Ile 195 200 205Gly Trp Ala Ser Thr Leu Val Phe Trp Ile Ser Phe Leu Val Gly Val 210 215 220Val Leu Leu Ile Phe Ser Pro Lys Val Arg Asp Tyr Lys Leu Phe Arg225 230 235 240Tyr Leu His Gln Phe Asp Arg Gln Thr Val Val Glu Ile Phe Gln Thr 245 250 255Gly Trp Pro Met Gly Phe Leu Leu Gly Val Glu Ser Val Val Leu Ser 260 265 270Leu Thr Ala Trp Leu Thr Gly Tyr Leu Gly Thr Val Thr Leu Ala Ala 275 280 285His Glu Ile Ala Ile Gln Thr Ala Glu Leu Ala Ile Val Ile Pro Leu 290 295 300Gly Ile Gly Asn Val Ala Val Thr Arg Val Gly Gln Thr Ile Gly Glu305 310 315 320Lys Asn Pro Leu Gly Ala Arg Arg Ala Ala Leu Ile Gly Ile Met Ile 325 330 335Gly Gly Ile Tyr Ala Ser Leu Val Ala Val Ile Phe Trp Leu Phe Pro 340 345 350Tyr Gln Ile Ala Gly Leu Tyr Leu Lys Ile Asn Asp Pro Glu Ser Met 355 360 365Glu Ala Val Lys Thr Ala Thr Asn Phe Leu Phe Leu Ala Gly Leu Phe 370 375 380Gln Phe Phe His Ser Val Gln Ile Ile Val Val Gly Val Leu Ile Gly385 390 395 400Leu Gln Asp Thr Phe Ile Pro Leu Leu Met Asn Leu Val Gly Trp Gly 405 410 415Leu Gly Leu

Ala Val Ser Tyr Tyr Met Gly Ile Ile Leu Cys Trp Gly 420 425 430Gly Met Gly Ile Trp Leu Gly Leu Val Leu Ser Pro Leu Leu Ser Gly 435 440 445Leu Ile Leu Met Val Arg Phe Tyr Gln Glu Ile Ala Asn Arg Ile Ala 450 455 460Asn Ser Asp Asp Gly Gln Glu Ser Ile Ser Ile Asp Asn Val Glu Glu465 470 475 480Leu Ser34831DNACylindrospermopsis raciborskii T3 34atgaaaacaa acaaacatat agctatgtgg gcttgtccta gaagtcgttc tactgtaatt 60acccgtgctt ttgagaactt agatgggtgt gttgtttatg atgagcctct agaggctccg 120aatgtcttga tgacaactta cacgatgagt aacagtcgta cgttagcaga agaagactta 180aagcaattaa tactgcaaaa taatgtagaa acagacctca agaaagttat agaacaattg 240actggagatt taccggacgg aaaattattc tcatttcaaa aaatgataac aggtgactat 300agatctgaat ttggaataga ttgggcaaaa aagctaacta acttcttttt aataaggcat 360ccccaagata ttattttttc tttcgatata gcggagagaa agacaggtat cacagaacca 420ttcacacaac aaaatcttgg catgaaaaca ctttatgaag ttttccaaca aattgaagtt 480attacagggc aaacaccttt agttattcac tcagatgata taattaaaaa ccctccttct 540gctttgaaat ggctgtgtaa aaacttaggg cttgcatttg atgaaaagat gctgacatgg 600aaagcaaatc tagaagactc caatttaaag tatacaaaat tatatgctaa ttctgcgtct 660ggcagttcag aaccttggtt tgaaacttta agatcgacca aaacatttct cgcctatgaa 720aagaaggaga aaaaattacc agctcggtta atacctctac tagatgaatc tattccttac 780tatgaaaaac tcttacagca ttgtcatatt tttgaatggt cagaacactg a 83135276PRTCylindrospermopsis raciborskii T3 35Met Lys Thr Asn Lys His Ile Ala Met Trp Ala Cys Pro Arg Ser Arg1 5 10 15Ser Thr Val Ile Thr Arg Ala Phe Glu Asn Leu Asp Gly Cys Val Val 20 25 30Tyr Asp Glu Pro Leu Glu Ala Pro Asn Val Leu Met Thr Thr Tyr Thr 35 40 45Met Ser Asn Ser Arg Thr Leu Ala Glu Glu Asp Leu Lys Gln Leu Ile 50 55 60Leu Gln Asn Asn Val Glu Thr Asp Leu Lys Lys Val Ile Glu Gln Leu65 70 75 80Thr Gly Asp Leu Pro Asp Gly Lys Leu Phe Ser Phe Gln Lys Met Ile 85 90 95Thr Gly Asp Tyr Arg Ser Glu Phe Gly Ile Asp Trp Ala Lys Lys Leu 100 105 110Thr Asn Phe Phe Leu Ile Arg His Pro Gln Asp Ile Ile Phe Ser Phe 115 120 125Asp Ile Ala Glu Arg Lys Thr Gly Ile Thr Glu Pro Phe Thr Gln Gln 130 135 140Asn Leu Gly Met Lys Thr Leu Tyr Glu Val Phe Gln Gln Ile Glu Val145 150 155 160Ile Thr Gly Gln Thr Pro Leu Val Ile His Ser Asp Asp Ile Ile Lys 165 170 175Asn Pro Pro Ser Ala Leu Lys Trp Leu Cys Lys Asn Leu Gly Leu Ala 180 185 190Phe Asp Glu Lys Met Leu Thr Trp Lys Ala Asn Leu Glu Asp Ser Asn 195 200 205Leu Lys Tyr Thr Lys Leu Tyr Ala Asn Ser Ala Ser Gly Ser Ser Glu 210 215 220Pro Trp Phe Glu Thr Leu Arg Ser Thr Lys Thr Phe Leu Ala Tyr Glu225 230 235 240Lys Lys Glu Lys Lys Leu Pro Ala Arg Leu Ile Pro Leu Leu Asp Glu 245 250 255Ser Ile Pro Tyr Tyr Glu Lys Leu Leu Gln His Cys His Ile Phe Glu 260 265 270Trp Ser Glu His 27536774DNACylindrospermopsis raciborskii T3 36ctaaaaattt ttttctactc ttttcaggat agaattccag tttctagagc cgttgtaacc 60gtacatatct tgatagtacg tatcgatgag gtactcattt tcgtggagca ttaaccagct 120ttttaactcc gctaatttct gctctccttt ttctattaat tcttgctcat ccaaatcatc 180cctgtccaac tcctccctgt ccaactccca catagttttg ttggtatctt cgacaatcaa 240gtagtctcca ctttttagac cgttttcgtg aaaatattca actactccca ccgcattagc 300atgggcatct tctacgatca accagggatg agcaagccca gaaagcagtt ccgacgacat 360tattgcaccc atattgttac aatccccctc taaaaaatga acgcgagagt cagtttttgc 420tttctcgtcg agtagggaaa gatcgatatc gatacagtag acacaacctt ctatttggaa 480cagttctaag tgatcggcta gccaaatcgc gctgccaccg cttaatgctc ctatttcgat 540tattgttttc gggcgaagct catacaggag cattgaataa agagctattt cggtgcaccc 600tttcaggaag ggtatccctt tccaagtgaa caaatcgcgg tttgccaaga gcgctctcca 660agctggcact ggaatagcac atttatcttc tctttcagaa attttggcaa accgattagg 720tttgaaaggt gcaactttat aggcggcttc ttgaacaaat ttttggaagc tcat 77437257PRTCylindrospermopsis raciborskii T3 37Met Ser Phe Gln Lys Phe Val Gln Glu Ala Ala Tyr Lys Val Ala Pro1 5 10 15Phe Lys Pro Asn Arg Phe Ala Lys Ile Ser Glu Arg Glu Asp Lys Cys 20 25 30Ala Ile Pro Val Pro Ala Trp Arg Ala Leu Leu Ala Asn Arg Asp Leu 35 40 45Phe Thr Trp Lys Gly Ile Pro Phe Leu Lys Gly Cys Thr Glu Ile Ala 50 55 60Leu Tyr Ser Met Leu Leu Tyr Glu Leu Arg Pro Lys Thr Ile Ile Glu65 70 75 80Ile Gly Ala Leu Ser Gly Gly Ser Ala Ile Trp Leu Ala Asp His Leu 85 90 95Glu Leu Phe Gln Ile Glu Gly Cys Val Tyr Cys Ile Asp Ile Asp Leu 100 105 110Ser Leu Leu Asp Glu Lys Ala Lys Thr Asp Ser Arg Val His Phe Leu 115 120 125Glu Gly Asp Cys Asn Asn Met Gly Ala Ile Met Ser Ser Glu Leu Leu 130 135 140Ser Gly Leu Ala His Pro Trp Leu Ile Val Glu Asp Ala His Ala Asn145 150 155 160Ala Val Gly Val Val Glu Tyr Phe His Glu Asn Gly Leu Lys Ser Gly 165 170 175Asp Tyr Leu Ile Val Glu Asp Thr Asn Lys Thr Met Trp Glu Leu Asp 180 185 190Arg Glu Glu Leu Asp Arg Asp Asp Leu Asp Glu Gln Glu Leu Ile Glu 195 200 205Lys Gly Glu Gln Lys Leu Ala Glu Leu Lys Ser Trp Leu Met Leu His 210 215 220Glu Asn Glu Tyr Leu Ile Asp Thr Tyr Tyr Gln Asp Met Tyr Gly Tyr225 230 235 240Asn Gly Ser Arg Asn Trp Asn Ser Ile Leu Lys Arg Val Glu Lys Asn 245 250 255Phe38327DNACylindrospermopsis raciborskii T3 38ttattcaaat agccgtagtt tatgatcggt atccaattcg ctattgtttt ttctgccata 60tccccaacct aagatgcgac gatattcacc cataatgcca ctgtcaatta aatcatcctc 120gttgactgca acattggtat gagattgcgg cgcaacatag agcgcatccg caggacaata 180tgcttcacag atgaaacaag tttgacagtc ttcctgtcgg gcgatcgcag gcggttggtt 240gggaactgca tcaaagacat tggtagggca tacttggacg caaacattac aattaataca 300gagtttatgg ctgacaagct cgatcat 32739108PRTCylindrospermopsis raciborskii T3 39Met Ile Glu Leu Val Ser His Lys Leu Cys Ile Asn Cys Asn Val Cys1 5 10 15Val Gln Val Cys Pro Thr Asn Val Phe Asp Ala Val Pro Asn Gln Pro 20 25 30Pro Ala Ile Ala Arg Gln Glu Asp Cys Gln Thr Cys Phe Ile Cys Glu 35 40 45Ala Tyr Cys Pro Ala Asp Ala Leu Tyr Val Ala Pro Gln Ser His Thr 50 55 60Asn Val Ala Val Asn Glu Asp Asp Leu Ile Asp Ser Gly Ile Met Gly65 70 75 80Glu Tyr Arg Arg Ile Leu Gly Trp Gly Tyr Gly Arg Lys Asn Asn Ser 85 90 95Glu Leu Asp Thr Asp His Lys Leu Arg Leu Phe Glu 100 105401653DNACylindrospermopsis raciborskii T3 40ttaagtggtt aatactggtg gtgtagcgct cgcatccttc acccaatccc gtctcaccca 60aagcctttct aagccgcccg tggcttggta ataaagctga tttggatcgg tttcaggata 120gtctatgcga atatgttcgc tacgcgtttc cttgcgatgt aaagcgctaa aatatgccca 180tcgtgctaca gacacaagag cagccgctcg acgagaaaat tccagatcgc gcactgtatc 240ttgtttcggg ttcccttgta cttgctgcca cagcatttct aatttggcga gggaatccaa 300aagtccctgc tcacagcgca agtaattctt ctctaatggg aacatctcgg cttgtacacc 360gcggacaact gcctcgctat cgaatgtttc ggaaccaggg tactgggaac gtaatccggc 420ttgacctgct ggacgcacaa cccgttcatg gacatgagcg cccaaactct tggcaaaggc 480ggctgcacct tcccctgccc attgtcctgt agagattgcc caagcagcat taggaccatc 540acccccagaa gctatcccag ctaaaaactc ccgcgatgct gcatctccgg cggcatacag 600tccaggaact tttgtaccac aactatcatt cacaatccga attccacctg taccacggac 660tgtaccttct aaaaccagtg ttacaggtac tcgttctgta taagggtcaa tgccagcttt 720tttatagggt agaaaggcga tgaagtgaga cttttcaacc aatgcttgga tttcaggtgt 780ggctcgatcc aaacgagcat aaacgggacc tttcaggagg gcattgggca ggaacgatgg 840atcgcgacga ccattgatat agccaccaag atcgttacct gcctcatcgg tgtaactagc 900ccagtaaaag ggagcagccc ttgtcactgt ggcattgaaa gcggtcgaga tggtatagtg 960actggaagct tccatactgg agagttcgcc gccagcttcc accgccatca gcagtccatc 1020gcctgtattg gtattgcaac ctaaagcttt acttaggaat gcacaaccgc cattcgctag 1080aactactgca ccagcgcgaa cggtataggt gcgatgattt tgcctctgta cacctctagc 1140tccagccacg gagccgtcct gggctaataa cagttctaga gccggacttt ggtcgaaaat 1200ttgcacaccc acacgcaaca ggttcttgcg aagtacccgc atatattccg gaccataata 1260actctggcgc acggattccc cattttcttt ggggaaacga tagccccaat cttccactaa 1320gggcaaactc agccaagctt tttcaattac acgttcaatc caacgtaagt tagcgaggtt 1380atttcctttg ctgtaacatt cggatacatc tttctcccaa ttctctggag aaggtgccat 1440gacgctattg ccactggcag cagctgcacc gctcgtacct agaaaacctt tatcaacaat 1500gatgactttg acaccttggg ctccagccgc ccatgctgcc catgcggcgg caggaccacc 1560accaattacc agcacgtcag cagttaattg tagttcagtg ccgctatagg ctgtaagcaa 1620ttgcttttcc tccttgttta aagtcaagtt cat 165341550PRTCylindrospermopsis raciborskii T3 41Met Asn Leu Thr Leu Asn Lys Glu Glu Lys Gln Leu Leu Thr Ala Tyr1 5 10 15Ser Gly Thr Glu Leu Gln Leu Thr Ala Asp Val Leu Val Ile Gly Gly 20 25 30Gly Pro Ala Ala Ala Trp Ala Ala Trp Ala Ala Gly Ala Gln Gly Val 35 40 45Lys Val Ile Ile Val Asp Lys Gly Phe Leu Gly Thr Ser Gly Ala Ala 50 55 60Ala Ala Ser Gly Asn Ser Val Met Ala Pro Ser Pro Glu Asn Trp Glu65 70 75 80Lys Asp Val Ser Glu Cys Tyr Ser Lys Gly Asn Asn Leu Ala Asn Leu 85 90 95Arg Trp Ile Glu Arg Val Ile Glu Lys Ala Trp Leu Ser Leu Pro Leu 100 105 110Val Glu Asp Trp Gly Tyr Arg Phe Pro Lys Glu Asn Gly Glu Ser Val 115 120 125Arg Gln Ser Tyr Tyr Gly Pro Glu Tyr Met Arg Val Leu Arg Lys Asn 130 135 140Leu Leu Arg Val Gly Val Gln Ile Phe Asp Gln Ser Pro Ala Leu Glu145 150 155 160Leu Leu Leu Ala Gln Asp Gly Ser Val Ala Gly Ala Arg Gly Val Gln 165 170 175Arg Gln Asn His Arg Thr Tyr Thr Val Arg Ala Gly Ala Val Val Leu 180 185 190Ala Asn Gly Gly Cys Ala Phe Leu Ser Lys Ala Leu Gly Cys Asn Thr 195 200 205Asn Thr Gly Asp Gly Leu Leu Met Ala Val Glu Ala Gly Gly Glu Leu 210 215 220Ser Ser Met Glu Ala Ser Ser His Tyr Thr Ile Ser Thr Ala Phe Asn225 230 235 240Ala Thr Val Thr Arg Ala Ala Pro Phe Tyr Trp Ala Ser Tyr Thr Asp 245 250 255Glu Ala Gly Asn Asp Leu Gly Gly Tyr Ile Asn Gly Arg Arg Asp Pro 260 265 270Ser Phe Leu Pro Asn Ala Leu Leu Lys Gly Pro Val Tyr Ala Arg Leu 275 280 285Asp Arg Ala Thr Pro Glu Ile Gln Ala Leu Val Glu Lys Ser His Phe 290 295 300Ile Ala Phe Leu Pro Tyr Lys Lys Ala Gly Ile Asp Pro Tyr Thr Glu305 310 315 320Arg Val Pro Val Thr Leu Val Leu Glu Gly Thr Val Arg Gly Thr Gly 325 330 335Gly Ile Arg Ile Val Asn Asp Ser Cys Gly Thr Lys Val Pro Gly Leu 340 345 350Tyr Ala Ala Gly Asp Ala Ala Ser Arg Glu Phe Leu Ala Gly Ile Ala 355 360 365Ser Gly Gly Asp Gly Pro Asn Ala Ala Trp Ala Ile Ser Thr Gly Gln 370 375 380Trp Ala Gly Glu Gly Ala Ala Ala Phe Ala Lys Ser Leu Gly Ala His385 390 395 400Val His Glu Arg Val Val Arg Pro Ala Gly Gln Ala Gly Leu Arg Ser 405 410 415Gln Tyr Pro Gly Ser Glu Thr Phe Asp Ser Glu Ala Val Val Arg Gly 420 425 430Val Gln Ala Glu Met Phe Pro Leu Glu Lys Asn Tyr Leu Arg Cys Glu 435 440 445Gln Gly Leu Leu Asp Ser Leu Ala Lys Leu Glu Met Leu Trp Gln Gln 450 455 460Val Gln Gly Asn Pro Lys Gln Asp Thr Val Arg Asp Leu Glu Phe Ser465 470 475 480Arg Arg Ala Ala Ala Leu Val Ser Val Ala Arg Trp Ala Tyr Phe Ser 485 490 495Ala Leu His Arg Lys Glu Thr Arg Ser Glu His Ile Arg Ile Asp Tyr 500 505 510Pro Glu Thr Asp Pro Asn Gln Leu Tyr Tyr Gln Ala Thr Gly Gly Leu 515 520 525Glu Arg Leu Trp Val Arg Arg Asp Trp Val Lys Asp Ala Ser Ala Thr 530 535 540Pro Pro Val Leu Thr Thr545 55042750DNACylindrospermopsis raciborskii T3 42ttaattatct tctgcagtcg gtcgaatcaa aatttcattt acatttacat gatcgggttg 60tgtcactgca taaattatag ctcttgcaat atcctcactt tgtaaaggtg ttattgtact 120aagttgttct ttactaagct gtttcgtgat cgggtcagaa attaagtcat taaatggcgt 180atcgactaaa cctggctcaa tgatggtaac gcgaatgttg tctaaagata cctcctggcg 240taatgcttct gaaagagcat tgacgcctga tttggcagca ctataaacga ccgcaccgga 300ctgcgctatc ctgccatcga cagaagatat attgactata tgaccggatt tttgggcctt 360cagaagaggc aaaactgcgt ggatagcata taaaactccc agaacattca catcgaatgc 420tcgcctccag tctgcgggat ttccagtatc aattgcacca aacacaccaa ttcctgcatt 480attcaccaaa atatctacat gtcctagctc aaccttggtc ttttggacta gatgatttac 540ttgagattcg tctgtaatat ctgtaacaat aggcaatgct tgaccaccac tggcttcaat 600ccgttttgct agtgcatgca aaagctcagc acgtcttgcg gcgatcgcaa cttttgcccc 660ctccgcagct aaagcaaatg ctgtagcctc tccaatccca gaggaagctc cagtaataat 720cgccactttt ccatccaatt tacctgccat 75043249PRTCylindrospermopsis raciborskii T3 43Met Ala Gly Lys Leu Asp Gly Lys Val Ala Ile Ile Thr Gly Ala Ser1 5 10 15Ser Gly Ile Gly Glu Ala Thr Ala Phe Ala Leu Ala Ala Glu Gly Ala 20 25 30Lys Val Ala Ile Ala Ala Arg Arg Ala Glu Leu Leu His Ala Leu Ala 35 40 45Lys Arg Ile Glu Ala Ser Gly Gly Gln Ala Leu Pro Ile Val Thr Asp 50 55 60Ile Thr Asp Glu Ser Gln Val Asn His Leu Val Gln Lys Thr Lys Val65 70 75 80Glu Leu Gly His Val Asp Ile Leu Val Asn Asn Ala Gly Ile Gly Val 85 90 95Phe Gly Ala Ile Asp Thr Gly Asn Pro Ala Asp Trp Arg Arg Ala Phe 100 105 110Asp Val Asn Val Leu Gly Val Leu Tyr Ala Ile His Ala Val Leu Pro 115 120 125Leu Leu Lys Ala Gln Lys Ser Gly His Ile Val Asn Ile Ser Ser Val 130 135 140Asp Gly Arg Ile Ala Gln Ser Gly Ala Val Val Tyr Ser Ala Ala Lys145 150 155 160Ser Gly Val Asn Ala Leu Ser Glu Ala Leu Arg Gln Glu Val Ser Leu 165 170 175Asp Asn Ile Arg Val Thr Ile Ile Glu Pro Gly Leu Val Asp Thr Pro 180 185 190Phe Asn Asp Leu Ile Ser Asp Pro Ile Thr Lys Gln Leu Ser Lys Glu 195 200 205Gln Leu Ser Thr Ile Thr Pro Leu Gln Ser Glu Asp Ile Ala Arg Ala 210 215 220Ile Ile Tyr Ala Val Thr Gln Pro Asp His Val Asn Val Asn Glu Ile225 230 235 240Leu Ile Arg Pro Thr Ala Glu Asp Asn 245441005DNACylindrospermopsis raciborskii T3 44ttaacaaacc ccataagtaa cacctagttg ctttagccat cgacgatagg caagtgtgca 60tctatctgat ggtacgtgga tttcgtgtga aaacaattgt gtatttatct gctttggagt 120taacagtggt aaacgtaccg gctgttgtgc atgtaagatc cgaatatctt gttctattgt 180ttcgtcatat tcagttagca tctttgactc taacgtttca tacccgttcc acattatcaa 240catacgcaat acactatttt cctcatcaat cggtgtgatc gtcattaaat ccacaatcct 300catttcaggg gattctgaaa cgcagtattg acataaagga tgactaagcc tgaaccaatt 360aacccaagag tcatcttcga tatggctgac aatccttgat gtctggaatt gatacttacc 420catagtaagg ccatctttat ctaatttcac ctcaaattct tccacttttg tataattgcg 480atcacctaac caaccgtcat ggataaaagg aaaatgagac acgtctaagg aattatccat 540cacacgaaac gcactagctt taatcaagta agacttggta taagtcttgt gataattcgg 600atcatcccat tcaggaaatg aaggtatatc attaacagga tcgcccaagc acacccacac 660taagccatag cgctcctggg agtgatatgt cctggcttca gcacttgccg gtggtaccat 720gccagggtga gctgggatct gtatgcattt accagcctca ttgtatctcc atccgtgata 780cggacaaact aaagtattat tcgtaatttc tcccatagac agaggaacac ctcggtgggg 840gcagtagtca agccatacct gtatgggtga attttgttca taactgcgcc ataataccaa 900cttcactccc aacaaacgag atctggtgat acttccaggt ttacagtctt ctacattggc 960gactacgtgc cagttattga

ttaagattgg gtcggtagtt gtcat 100545334PRTCylindrospermopsis raciborskii T3 45Met Thr Thr Thr Asp Pro Ile Leu Ile Asn Asn Trp His Val Val Ala1 5 10 15Asn Val Glu Asp Cys Lys Pro Gly Ser Ile Thr Arg Ser Arg Leu Leu 20 25 30Gly Val Lys Leu Val Leu Trp Arg Ser Tyr Glu Gln Asn Ser Pro Ile 35 40 45Gln Val Trp Leu Asp Tyr Cys Pro His Arg Gly Val Pro Leu Ser Met 50 55 60Gly Glu Ile Thr Asn Asn Thr Leu Val Cys Pro Tyr His Gly Trp Arg65 70 75 80Tyr Asn Glu Ala Gly Lys Cys Ile Gln Ile Pro Ala His Pro Gly Met 85 90 95Val Pro Pro Ala Ser Ala Glu Ala Arg Thr Tyr His Ser Gln Glu Arg 100 105 110Tyr Gly Leu Val Trp Val Cys Leu Gly Asp Pro Val Asn Asp Ile Pro 115 120 125Ser Phe Pro Glu Trp Asp Asp Pro Asn Tyr His Lys Thr Tyr Thr Lys 130 135 140Ser Tyr Leu Ile Lys Ala Ser Ala Phe Arg Val Met Asp Asn Ser Leu145 150 155 160Asp Val Ser His Phe Pro Phe Ile His Asp Gly Trp Leu Gly Asp Arg 165 170 175Asn Tyr Thr Lys Val Glu Glu Phe Glu Val Lys Leu Asp Lys Asp Gly 180 185 190Leu Thr Met Gly Lys Tyr Gln Phe Gln Thr Ser Arg Ile Val Ser His 195 200 205Ile Glu Asp Asp Ser Trp Val Asn Trp Phe Arg Leu Ser His Pro Leu 210 215 220Cys Gln Tyr Cys Val Ser Glu Ser Pro Glu Met Arg Ile Val Asp Leu225 230 235 240Met Thr Ile Thr Pro Ile Asp Glu Glu Asn Ser Val Leu Arg Met Leu 245 250 255Ile Met Trp Asn Gly Tyr Glu Thr Leu Glu Ser Lys Met Leu Thr Glu 260 265 270Tyr Asp Glu Thr Ile Glu Gln Asp Ile Arg Ile Leu His Ala Gln Gln 275 280 285Pro Val Arg Leu Pro Leu Leu Thr Pro Lys Gln Ile Asn Thr Gln Leu 290 295 300Phe Ser His Glu Ile His Val Pro Ser Asp Arg Cys Thr Leu Ala Tyr305 310 315 320Arg Arg Trp Leu Lys Gln Leu Gly Val Thr Tyr Gly Val Cys 325 33046726DNACylindrospermopsis raciborskii T3 46ctaaattatc cttttcaagg catccaccaa cagtggtttg atgttgtttt ttgtaaaaat 60cagagttagc atcctgtaat cggtaattga agtgttggca gctgcggtat gccatacagt 120tggtgtataa aacattgctg cccctcctgg aagtgaaaga catatttctg catttagtga 180attggcagaa gatgaatcta atgagtgttc ccattggtgg ctacttggta taactcgcat 240tgtacccata gtattatctg tatcctgtaa gtatatagtt atgaatacca tggcttgatt 300ggctactgga accaacaacc gaagcgcgtc gtcatttaac tcgttttttg acatggatgc 360aagtgcgttc aatacttcaa ctacatatcc atggtcttga tgccaagcaa tgtatcctgt 420acctgcacga attatggcta gatcggtgat caataggaag atatcagacc caattagagc 480ctgtactggt cccatcacag ttggaagctc taaaagcctc tgaattatct tttgatacct 540aactggatct gggatagtat gctcagacca ccactcatag tcacccgcca atactccccc 600acgtttttgt tcggtaataa gttctacttc atgccgtatt tcttcaatta acgcttttgg 660tacagcttct tcaactgtga aataaccatc atttgtgtaa gcttgttttt gttccgctgt 720gagcat 72647241PRTCylindrospermopsis raciborskii T3 47Met Leu Thr Ala Glu Gln Lys Gln Ala Tyr Thr Asn Asp Gly Tyr Phe1 5 10 15Thr Val Glu Glu Ala Val Pro Lys Ala Leu Ile Glu Glu Ile Arg His 20 25 30Glu Val Glu Leu Ile Thr Glu Gln Lys Arg Gly Gly Val Leu Ala Gly 35 40 45Asp Tyr Glu Trp Trp Ser Glu His Thr Ile Pro Asp Pro Val Arg Tyr 50 55 60Gln Lys Ile Ile Gln Arg Leu Leu Glu Leu Pro Thr Val Met Gly Pro65 70 75 80Val Gln Ala Leu Ile Gly Ser Asp Ile Phe Leu Leu Ile Thr Asp Leu 85 90 95Ala Ile Ile Arg Ala Gly Thr Gly Tyr Ile Ala Trp His Gln Asp His 100 105 110Gly Tyr Val Val Glu Val Leu Asn Ala Leu Ala Ser Met Ser Lys Asn 115 120 125Glu Leu Asn Asp Asp Ala Leu Arg Leu Leu Val Pro Val Ala Asn Gln 130 135 140Ala Met Val Phe Ile Thr Ile Tyr Leu Gln Asp Thr Asp Asn Thr Met145 150 155 160Gly Thr Met Arg Val Ile Pro Ser Ser His Gln Trp Glu His Ser Leu 165 170 175Asp Ser Ser Ser Ala Asn Ser Leu Asn Ala Glu Ile Cys Leu Ser Leu 180 185 190Pro Gly Gly Ala Ala Met Phe Tyr Thr Pro Thr Val Trp His Thr Ala 195 200 205Ala Ala Asn Thr Ser Ile Thr Asp Tyr Arg Met Leu Thr Leu Ile Phe 210 215 220Thr Lys Asn Asn Ile Lys Pro Leu Leu Val Asp Ala Leu Lys Arg Ile225 230 235 240Ile48576DNACylindrospermopsis raciborskii T3 48tcaatggtta gtaggaatta tcctatagct gttctttctc tggatagaag aaaggttgtg 60agaagctcgc tccgacttca tttcagccaa tttttctgca gaccaatact gaaaatatcc 120caatcttaat aattcatcac tagcctcttg taactggctg aatgactgta ctgatgctaa 180aacatactta gggtgagtta tgattacgtt attcacattc tccgcgtcat caccaacata 240ttgtttgtct ggatgcgatc ctaaagctac caaatcgtat tctggtaata cataattcgc 300cttggtaatg tacctttcca acctctgtgc atctaggttt tgagggtcgc agccaaaaat 360caccatttca aagtcattat tccatgttct tatctgttcc attagaagct ctggcagttc 420aggtccatga aaccaacgaa cactaacacg gttatttaac caagctgcct tcgcgtaagg 480acagggtgga aaatttcctg ttagaggatt gggaatgctg acaacattga taatccaatc 540ctctatttct tggcgaaatt gttcgatatt tatcat 57649191PRTCylindrospermopsis raciborskii T3 49Met Ile Asn Ile Glu Gln Phe Arg Gln Glu Ile Glu Asp Trp Ile Ile1 5 10 15Asn Val Val Ser Ile Pro Asn Pro Leu Thr Gly Asn Phe Pro Pro Cys 20 25 30Pro Tyr Ala Lys Ala Ala Trp Leu Asn Asn Arg Val Ser Val Arg Trp 35 40 45Phe His Gly Pro Glu Leu Pro Glu Leu Leu Met Glu Gln Ile Arg Thr 50 55 60Trp Asn Asn Asp Phe Glu Met Val Ile Phe Gly Cys Asp Pro Gln Asn65 70 75 80Leu Asp Ala Gln Arg Leu Glu Arg Tyr Ile Thr Lys Ala Asn Tyr Val 85 90 95Leu Pro Glu Tyr Asp Leu Val Ala Leu Gly Ser His Pro Asp Lys Gln 100 105 110Tyr Val Gly Asp Asp Ala Glu Asn Val Asn Asn Val Ile Ile Thr His 115 120 125Pro Lys Tyr Val Leu Ala Ser Val Gln Ser Phe Ser Gln Leu Gln Glu 130 135 140Ala Ser Asp Glu Leu Leu Arg Leu Gly Tyr Phe Gln Tyr Trp Ser Ala145 150 155 160Glu Lys Leu Ala Glu Met Lys Ser Glu Arg Ala Ser His Asn Leu Ser 165 170 175Ser Ile Gln Arg Lys Asn Ser Tyr Arg Ile Ile Pro Thr Asn His 180 185 19050777DNACylindrospermopsis raciborskii T3 50ttaatctagg tcatagtata accatatatt aggctcgatg tatattccca tattgttggg 60atagtcaatt ttgacaggta ctaagccttt gggaataata tagtcaccag tttctggaaa 120acgcatccca actctatctt cccaaccgtc aatagtatca ttaattgttg tggatttaaa 180acagatccct gcaattttag ccccatgttt gacattaact cgtaaccaag ggtcaaatat 240aagaccattt ttatctcgcc aggtaatata ccgctctatg ggtataagtg ggtaaagata 300ttttaggctt ggacgtgcag ccatgatcaa agaattaaga ccgtggtatt gagcaagttc 360tttcatgtat ccaatcagat actgactcaa gtttttgcct tgatactctg gtaggattga 420aatcgatact acacataacg cattaggcag gcggttctgt tctcggtctt caagccactt 480ggctaaagcc cagtcacaac cttcgtccgg taactcatca aaacggcttt cataagttaa 540agggatacag tttccttgcg ctatcataag ctgtgtggta gcttctacta acccaaactg 600gaattctgga taaatttcaa atagagctaa ggaagctgga tctgcccaga catcatgtat 660caaaaatttt gggtatgctt gatcaaagac actcatcgtc ctttccacaa aatcagaagt 720ttcttttggg gttacaaagc tatactctaa attatgctgt acaatttgaa tggtcat 77751258PRTCylindrospermopsis raciborskii T3 51Met Thr Ile Gln Ile Val Gln His Asn Leu Glu Tyr Ser Phe Val Thr1 5 10 15Pro Lys Glu Thr Ser Asp Phe Val Glu Arg Thr Met Ser Val Phe Asp 20 25 30Gln Ala Tyr Pro Lys Phe Leu Ile His Asp Val Trp Ala Asp Pro Ala 35 40 45Ser Leu Ala Leu Phe Glu Ile Tyr Pro Glu Phe Gln Phe Gly Leu Val 50 55 60Glu Ala Thr Thr Gln Leu Met Ile Ala Gln Gly Asn Cys Ile Pro Leu65 70 75 80Thr Tyr Glu Ser Arg Phe Asp Glu Leu Pro Asp Glu Gly Cys Asp Trp 85 90 95Ala Leu Ala Lys Trp Leu Glu Asp Arg Glu Gln Asn Arg Leu Pro Asn 100 105 110Ala Leu Cys Val Val Ser Ile Ser Ile Leu Pro Glu Tyr Gln Gly Lys 115 120 125Asn Leu Ser Gln Tyr Leu Ile Gly Tyr Met Lys Glu Leu Ala Gln Tyr 130 135 140His Gly Leu Asn Ser Leu Ile Met Ala Ala Arg Pro Ser Leu Lys Tyr145 150 155 160Leu Tyr Pro Leu Ile Pro Ile Glu Arg Tyr Ile Thr Trp Arg Asp Lys 165 170 175Asn Gly Leu Ile Phe Asp Pro Trp Leu Arg Val Asn Val Lys His Gly 180 185 190Ala Lys Ile Ala Gly Ile Cys Phe Lys Ser Thr Thr Ile Asn Asp Thr 195 200 205Ile Asp Gly Trp Glu Asp Arg Val Gly Met Arg Phe Pro Glu Thr Gly 210 215 220Asp Tyr Ile Ile Pro Lys Gly Leu Val Pro Val Lys Ile Asp Tyr Pro225 230 235 240Asn Asn Met Gly Ile Tyr Ile Glu Pro Asn Ile Trp Leu Tyr Tyr Asp 245 250 255Leu Asp52777DNACylindrospermopsis raciborskii T3 52ctaatcctta aatttatact ggaagtcaaa tgagatctca ctatcgttat tatctggaag 60tacttgcact gtcaattcat taccgacttt cccattccca ggcataatta ataagttagg 120gtgaggtgga atgccgtcgt actgtcggac gcggcgaaaa atgctcgaat tctcgccacc 180atgtttattc aagaggactt caactggtgt gatgacaaaa gtcattcctg acccaaggtg 240gcgcgatcgc cgcttttgat ttgctggagt ggaaacacta acaaataagg cacaccctcc 300tagagaataa gaccagttag cagactgcgg atcggcagac caatggcagg gacaagacac 360cgcatcaagg ctatgtaacg cattcaaaaa atcaaatgct tgacctgcat attcctctac 420tgtaagaact gttggttcag gtgggaaaaa gatgacaagt gtcagaagat ccgcattttc 480gtgctgaagc aattcgtttt cattaacttc atcaatgtat ttgtagatac cctcaagcgt 540atgctcaacc aagatcgggt cagttaaaga tgagactatc aggtatctaa tcattccctt 600ctgttccccg atagttcccc agaagcaagg gaaggcagaa tcgctgattg tttcaacaaa 660tgttgagtag ctagtgcgta cccaagcagg aaggcactcc tctagaagag aggattccat 720ctggcttttg ttccagattg gtgtaactcc gtcaggacat aaattcttga ttaccat 77753258PRTCylindrospermopsis raciborskii T3 53Met Val Ile Lys Asn Leu Cys Pro Asp Gly Val Thr Pro Ile Trp Asn1 5 10 15Lys Ser Gln Met Glu Ser Ser Leu Leu Glu Glu Cys Leu Pro Ala Trp 20 25 30Val Arg Thr Ser Tyr Ser Thr Phe Val Glu Thr Ile Ser Asp Ser Ala 35 40 45Phe Pro Cys Phe Trp Gly Thr Ile Gly Glu Gln Lys Gly Met Ile Arg 50 55 60Tyr Leu Ile Val Ser Ser Leu Thr Asp Pro Ile Leu Val Glu His Thr65 70 75 80Leu Glu Gly Ile Tyr Lys Tyr Ile Asp Glu Val Asn Glu Asn Glu Leu 85 90 95Leu Gln His Glu Asn Ala Asp Leu Leu Thr Leu Val Ile Phe Phe Pro 100 105 110Pro Glu Pro Thr Val Leu Thr Val Glu Glu Tyr Ala Gly Gln Ala Phe 115 120 125Asp Phe Leu Asn Ala Leu His Ser Leu Asp Ala Val Ser Cys Pro Cys 130 135 140His Trp Ser Ala Asp Pro Gln Ser Ala Asn Trp Ser Tyr Ser Leu Gly145 150 155 160Gly Cys Ala Leu Phe Val Ser Val Ser Thr Pro Ala Asn Gln Lys Arg 165 170 175Arg Ser Arg His Leu Gly Ser Gly Met Thr Phe Val Ile Thr Pro Val 180 185 190Glu Val Leu Leu Asn Lys His Gly Gly Glu Asn Ser Ser Ile Phe Arg 195 200 205Arg Val Arg Gln Tyr Asp Gly Ile Pro Pro His Pro Asn Leu Leu Ile 210 215 220Met Pro Gly Asn Gly Lys Val Gly Asn Glu Leu Thr Val Gln Val Leu225 230 235 240Pro Asp Asn Asn Asp Ser Glu Ile Ser Phe Asp Phe Gln Tyr Lys Phe 245 250 255Lys Asp541227DNACylindrospermopsis raciborskii T3 54ctatatctta ttttttggaa gtccctgaaa attattcaac aagatcgaga cgttgttgtt 60gccagaattt gtgacagcca ggtcaagctt gctgtcgccg ttgaaatccg caattgctat 120agattcagga ttagtaccga ctggaaagtt agtagctatg ccaaaagacc cattaccatt 180tcctggtaag accgagacgt tattgctact ataatttgta acagccaggt caagtttact 240gtcgccattc acatctctaa tcgctacaga gtagggatta gtaccggctg gaaagttagt 300ggctgcgcca aaagacccat taccatttcc cagtaagacc gagacgttat tgctgctagt 360atttgcaaca gccaggtcaa gcttgctgtc gccatttaca tccccagttg ctacaaatat 420gggattagta ccgactggaa agttagtggc tgcgccaaaa gacccattac catttcccag 480taagaccgag acgttattgc tgacccaatt tgtaatagca aggtcgagct tactgtcgct 540attaaaatcc gcaatcgcta cggaaatcga ataagtatcg acagggaagc tgctggctgc 600gccaaaagac ccattaccat ttcccagtaa aaccaagacc ttattgtcga accaatttgt 660aaaagcaagg tcaagctcac tatcgttatt cacatctcca atggctacag aataagggtt 720agtaccaact gaaaagttag tggctgcgcc aaaagaccca ttaccatttc ctagtaagac 780cgagacgtta ttgctactaa aatttgcaac agccaggtca agcttgctgt cgccatttac 840atccccagtc actacaaaga cgggattagt accgactgga aagttagtgg ctgcgccaaa 900agacccatta ccatttccca gtaagaccga gacgttattg tcgaaccaat ttgtaacagc 960caggtcgagc ttactatcgc tattgaaatc cccaactgct acagagtcag catcaagacc 1020agttgggaag ttaatagcag tagcataact actcctgtgg gcaaatctca ctcctacgga 1080caaattaacc ggaacactaa attgcccaga aagcttttca ttcttcagat aatagtcagt 1140tatatttgct aatgcaacag gagttataca taaaaatgta ctaacagata atatccccgc 1200tataattagt aaagtgagcc ttttcac 122755408PRTCylindrospermopsis raciborskii T3 55Met Lys Arg Leu Thr Leu Leu Ile Ile Ala Gly Ile Leu Ser Val Ser1 5 10 15Thr Phe Leu Cys Ile Thr Pro Val Ala Leu Ala Asn Ile Thr Asp Tyr 20 25 30Tyr Leu Lys Asn Glu Lys Leu Ser Gly Gln Phe Ser Val Pro Val Asn 35 40 45Leu Ser Val Gly Val Arg Phe Ala His Arg Ser Ser Tyr Ala Thr Ala 50 55 60Ile Asn Phe Pro Thr Gly Leu Asp Ala Asp Ser Val Ala Val Gly Asp65 70 75 80Phe Asn Ser Asp Ser Lys Leu Asp Leu Ala Val Thr Asn Trp Phe Asp 85 90 95Asn Asn Val Ser Val Leu Leu Gly Asn Gly Asn Gly Ser Phe Gly Ala 100 105 110Ala Thr Asn Phe Pro Val Gly Thr Asn Pro Val Phe Val Val Thr Gly 115 120 125Asp Val Asn Gly Asp Ser Lys Leu Asp Leu Ala Val Ala Asn Phe Ser 130 135 140Ser Asn Asn Val Ser Val Leu Leu Gly Asn Gly Asn Gly Ser Phe Gly145 150 155 160Ala Ala Thr Asn Phe Ser Val Gly Thr Asn Pro Tyr Ser Val Ala Ile 165 170 175Gly Asp Val Asn Asn Asp Ser Glu Leu Asp Leu Ala Phe Thr Asn Trp 180 185 190Phe Asp Asn Lys Val Leu Val Leu Leu Gly Asn Gly Asn Gly Ser Phe 195 200 205Gly Ala Ala Ser Ser Phe Pro Val Asp Thr Tyr Ser Ile Ser Val Ala 210 215 220Ile Ala Asp Phe Asn Ser Asp Ser Lys Leu Asp Leu Ala Ile Thr Asn225 230 235 240Trp Val Ser Asn Asn Val Ser Val Leu Leu Gly Asn Gly Asn Gly Ser 245 250 255Phe Gly Ala Ala Thr Asn Phe Pro Val Gly Thr Asn Pro Ile Phe Val 260 265 270Ala Thr Gly Asp Val Asn Gly Asp Ser Lys Leu Asp Leu Ala Val Ala 275 280 285Asn Thr Ser Ser Asn Asn Val Ser Val Leu Leu Gly Asn Gly Asn Gly 290 295 300Ser Phe Gly Ala Ala Thr Asn Phe Pro Ala Gly Thr Asn Pro Tyr Ser305 310 315 320Val Ala Ile Arg Asp Val Asn Gly Asp Ser Lys Leu Asp Leu Ala Val 325 330 335Thr Asn Tyr Ser Ser Asn Asn Val Ser Val Leu Pro Gly Asn Gly Asn 340 345 350Gly Ser Phe Gly Ile Ala Thr Asn Phe Pro Val Gly Thr Asn Pro Glu 355 360 365Ser Ile Ala Ile Ala Asp Phe Asn Gly Asp Ser Lys Leu Asp Leu Ala 370 375 380Val Thr Asn Ser Gly Asn Asn Asn Val Ser Ile Leu Leu Asn Asn Phe385 390 395 400Gln Gly Leu Pro Lys Asn Lys Ile

40556603DNACylindrospermopsis raciborskii T3 56ctattgtttg aaaattgtga atttgttttc cacgtatttg agtagttgtt ctaggctttc 60ctcgacggtg agttcggatg tttccaccca taaatctggg ctattgggtg gttcataagg 120ggcgctgatt cccgtaaatc catctatttc cccactgcgt gcttttagat aaagaccttt 180cggatcacgc tgctcacaaa gttccagtgg agttgcaatg tatacttcat gaaatagatc 240tccagctagt ctacgcacct gttctcggtc attcctgtag ggtgagatga aggcagtgat 300cactaggcat cctgactccg caaagagttt ggcaacctca cccaaacgac ggatattttc 360tgagcgatca ctagcagaaa atcctaaatc ggaacacagt ccatgacgaa cactatcacc 420atctaaaaca aaggtagacc atcctttctc gaacaaagtc tgctctaatt ttaaagccaa 480tgttgtttta ccagccccgg acagtccagt aaaccataga atcccgcttt tatgaccatt 540ctttagataa cgatcatatg gagatataag atgttttgta tagtgaatat tagttgattt 600cat 60357200PRTCylindrospermopsis raciborskii T3 57Met Lys Ser Thr Asn Ile His Tyr Thr Lys His Leu Ile Ser Pro Tyr1 5 10 15Asp Arg Tyr Leu Lys Asn Gly His Lys Ser Gly Ile Leu Trp Phe Thr 20 25 30Gly Leu Ser Gly Ala Gly Lys Thr Thr Leu Ala Leu Lys Leu Glu Gln 35 40 45Thr Leu Phe Glu Lys Gly Trp Ser Thr Phe Val Leu Asp Gly Asp Ser 50 55 60Val Arg His Gly Leu Cys Ser Asp Leu Gly Phe Ser Ala Ser Asp Arg65 70 75 80Ser Glu Asn Ile Arg Arg Leu Gly Glu Val Ala Lys Leu Phe Ala Glu 85 90 95Ser Gly Cys Leu Val Ile Thr Ala Phe Ile Ser Pro Tyr Arg Asn Asp 100 105 110Arg Glu Gln Val Arg Arg Leu Ala Gly Asp Leu Phe His Glu Val Tyr 115 120 125Ile Ala Thr Pro Leu Glu Leu Cys Glu Gln Arg Asp Pro Lys Gly Leu 130 135 140Tyr Leu Lys Ala Arg Ser Gly Glu Ile Asp Gly Phe Thr Gly Ile Ser145 150 155 160Ala Pro Tyr Glu Pro Pro Asn Ser Pro Asp Leu Trp Val Glu Thr Ser 165 170 175Glu Leu Thr Val Glu Glu Ser Leu Glu Gln Leu Leu Lys Tyr Val Glu 180 185 190Asn Lys Phe Thr Ile Phe Lys Gln 195 200581350DNACylindrospermopsis raciborskii T3 58ttaagaaaaa attatttcaa actcgctcgc caaacgctcc ataatcaaat taatttcaga 60cgaaaaagga cagtaatatg gtagctctac caacaccctt cttgcggaaa ctgtcacctt 120cgctgctatt ttgataatcg tttcccttaa cctaggaacc tgggctttag ccagttttgt 180tccctgtgct gcttgccgaa ttcccaacat taaaatgtaa gctgcttgag ataaaaataa 240ccgaaactga ttgacaataa atttctcaca gctgagtcta tctgatttta tccccagttt 300taattcctta attctatgct ctgaagtagc tcctctttga acataaaatt tatcgtataa 360atcctgagct tctgtttcca agctagtaat tataaatcta ggattgggtc ctttttctag 420ccattctgct ttcataatta ctcgccgagg ttctgaccaa ctccgagctg cgtaatacac 480atcatcaaat aaacgaactt tttctcctgt gcgacaatat tccagtctgg ctcggtcaag 540aaggtaatta atttttcgtt ttaagacatc attattgctg aatccaaaaa catatccaac 600cccgcttttt tcacaaacct caatgatttc tggtaacgag aaacccccgt ctcccctcag 660aacaattcta atttcaggta aggctctttt gattcgcaaa aataaccatt ttagaatgcc 720agctactcct ttaccagagt gagaatttcc cgcccttagt tgtagaacta atggataacc 780actggaagct tcattaatca gaactggaaa gtagatatca tgcctatggt aaccattaaa 840taagctcagt tgttgatgac catgagttag agcatcccac gcatctatgt ccaggacaat 900ctcttttgat tcccgaggat aggattctag gaatttatca acaaataacc gacgaatttg 960tttgatatct ttttgagtca cctgattttc taaacgactc atagttggtt gactagctaa 1020taagttttct cctactgtgg gaacttgatt acaaactagc ttaaaaattg gatcttggcg 1080caatttatta ctatcgttgc tatcttcata gccagcaatt atttgataaa ttcgttggct 1140aattaattga gaaagagaat gtttgacttt agtttggtcc cgattatccg tcaaacaatc 1200tgccatatct tgacaaattt ttaccttttc ttctacttgt cgtgccagaa taattccgcc 1260atcactactt aaactcatat cagaaaaagt cagatctaaa gtttttttat cgaagaaatt 1320taaagataat cttgaggaag atttagtcat 135059449PRTCylindrospermopsis raciborskii T3 59Met Thr Lys Ser Ser Ser Arg Leu Ser Leu Asn Phe Phe Asp Lys Lys1 5 10 15Thr Leu Asp Leu Thr Phe Ser Asp Met Ser Leu Ser Ser Asp Gly Gly 20 25 30Ile Ile Leu Ala Arg Gln Val Glu Glu Lys Val Lys Ile Cys Gln Asp 35 40 45Met Ala Asp Cys Leu Thr Asp Asn Arg Asp Gln Thr Lys Val Lys His 50 55 60Ser Leu Ser Gln Leu Ile Ser Gln Arg Ile Tyr Gln Ile Ile Ala Gly65 70 75 80Tyr Glu Asp Ser Asn Asp Ser Asn Lys Leu Arg Gln Asp Pro Ile Phe 85 90 95Lys Leu Val Cys Asn Gln Val Pro Thr Val Gly Glu Asn Leu Leu Ala 100 105 110Ser Gln Pro Thr Met Ser Arg Leu Glu Asn Gln Val Thr Gln Lys Asp 115 120 125Ile Lys Gln Ile Arg Arg Leu Phe Val Asp Lys Phe Leu Glu Ser Tyr 130 135 140Pro Arg Glu Ser Lys Glu Ile Val Leu Asp Ile Asp Ala Trp Asp Ala145 150 155 160Leu Thr His Gly His Gln Gln Leu Ser Leu Phe Asn Gly Tyr His Arg 165 170 175His Asp Ile Tyr Phe Pro Val Leu Ile Asn Glu Ala Ser Ser Gly Tyr 180 185 190Pro Leu Val Leu Gln Leu Arg Ala Gly Asn Ser His Ser Gly Lys Gly 195 200 205Val Ala Gly Ile Leu Lys Trp Leu Phe Leu Arg Ile Lys Arg Ala Leu 210 215 220Pro Glu Ile Arg Ile Val Leu Arg Gly Asp Gly Gly Phe Ser Leu Pro225 230 235 240Glu Ile Ile Glu Val Cys Glu Lys Ser Gly Val Gly Tyr Val Phe Gly 245 250 255Phe Ser Asn Asn Asp Val Leu Lys Arg Lys Ile Asn Tyr Leu Leu Asp 260 265 270Arg Ala Arg Leu Glu Tyr Cys Arg Thr Gly Glu Lys Val Arg Leu Phe 275 280 285Asp Asp Val Tyr Tyr Ala Ala Arg Ser Trp Ser Glu Pro Arg Arg Val 290 295 300Ile Met Lys Ala Glu Trp Leu Glu Lys Gly Pro Asn Pro Arg Phe Ile305 310 315 320Ile Thr Ser Leu Glu Thr Glu Ala Gln Asp Leu Tyr Asp Lys Phe Tyr 325 330 335Val Gln Arg Gly Ala Thr Ser Glu His Arg Ile Lys Glu Leu Lys Leu 340 345 350Gly Ile Lys Ser Asp Arg Leu Ser Cys Glu Lys Phe Ile Val Asn Gln 355 360 365Phe Arg Leu Phe Leu Ser Gln Ala Ala Tyr Ile Leu Met Leu Gly Ile 370 375 380Arg Gln Ala Ala Gln Gly Thr Lys Leu Ala Lys Ala Gln Val Pro Arg385 390 395 400Leu Arg Glu Thr Ile Ile Lys Ile Ala Ala Lys Val Thr Val Ser Ala 405 410 415Arg Arg Val Leu Val Glu Leu Pro Tyr Tyr Cys Pro Phe Ser Ser Glu 420 425 430Ile Asn Leu Ile Met Glu Arg Leu Ala Ser Glu Phe Glu Ile Ile Phe 435 440 445Ser60666DNACylindrospermopsis raciborskii T3 60ctatctttgc cctgtaacaa tgtatgctac cctttgacca atattagtag catgatctgc 60cattctctct aaacactgaa ttgctaatgt taatagtaaa atgggctcca ctaccccggg 120aacatctttc tgctgcgcca aattacgata taactttttg taagcatcat ctactgtatc 180atctaataat ttaatccttc taccactaat ctcgtctaaa tccgctaaag ctactaggct 240ggtagccaac atagattggg catgatcgga cataatggca acctccccca aagtaggatg 300ggggggatag ggaaatattt tcattgctat ttctgccaaa tctttggcat agtccccaat 360acgttccaag tctctaacta attgcatgaa tgagcttaaa caccgagatt cttggtctgt 420gggagcttga ctgctcataa ttgtggcaca atcgacttct atttgtctgt agaagcgatc 480aatttttttg tctaatctcc gtatttgctc agctgctgtt aaatcccgat tgaatagagc 540ttggtgactc agacggaatg actgctctac taaagcaccc atacgcaaaa catctcgttc 600cagtctttta atggcacgta taggttgagg tttttcaaaa attgtatatt tcacaacagc 660tttcat 66661221PRTCylindrospermopsis raciborskii T3 61Met Lys Ala Val Val Lys Tyr Thr Ile Phe Glu Lys Pro Gln Pro Ile1 5 10 15Arg Ala Ile Lys Arg Leu Glu Arg Asp Val Leu Arg Met Gly Ala Leu 20 25 30Val Glu Gln Ser Phe Arg Leu Ser His Gln Ala Leu Phe Asn Arg Asp 35 40 45Leu Thr Ala Ala Glu Gln Ile Arg Arg Leu Asp Lys Lys Ile Asp Arg 50 55 60Phe Tyr Arg Gln Ile Glu Val Asp Cys Ala Thr Ile Met Ser Ser Gln65 70 75 80Ala Pro Thr Asp Gln Glu Ser Arg Cys Leu Ser Ser Phe Met Gln Leu 85 90 95Val Arg Asp Leu Glu Arg Ile Gly Asp Tyr Ala Lys Asp Leu Ala Glu 100 105 110Ile Ala Met Lys Ile Phe Pro Tyr Pro Pro His Pro Thr Leu Gly Glu 115 120 125Val Ala Ile Met Ser Asp His Ala Gln Ser Met Leu Ala Thr Ser Leu 130 135 140Val Ala Leu Ala Asp Leu Asp Glu Ile Ser Gly Arg Arg Ile Lys Leu145 150 155 160Leu Asp Asp Thr Val Asp Asp Ala Tyr Lys Lys Leu Tyr Arg Asn Leu 165 170 175Ala Gln Gln Lys Asp Val Pro Gly Val Val Glu Pro Ile Leu Leu Leu 180 185 190Thr Leu Ala Ile Gln Cys Leu Glu Arg Met Ala Asp His Ala Thr Asn 195 200 205Ile Gly Gln Arg Val Ala Tyr Ile Val Thr Gly Gln Arg 210 215 220621353DNACylindrospermopsis raciborskii T3 62tcagaaatat ccgccatcat gttgaaccac ctggggaaga tgaatttgta tccaagcacc 60accggtatca ggatggttca tggccctgat tttgccacca tgagctataa ttatttggcg 120gacaatggat aaccctaaac cactaccagt aatttctact gtttcattct cagagcggga 180ctcgcggtgt ctagctttgt ccccccgata aaatctttga aagacatggg gtagatccat 240gggagcaaat ccaaccccgg aatcaataat gttaatttct aaaatctgat ttgatacttg 300gtttaatatt gtatctgctt ctggatcaac cccattaata gacttctccc cacaaactgg 360attcatttca atgaaaatag taccgttcag gttgctgtat ttaatacagt tatctaacag 420attaagaaac acttgataaa ttctggactt atcagcacat atatagacct tttccgggcc 480ggagtaagaa atactaagat gctgattagc ggctaggggc tctaaattct cccagactga 540aaaaattagg gagcggactt ctagcatttc caaattcagt tgtatggagg aggttatttc 600catctgggtc aggtctaacc aattttggac taaattaatt agtctgtcaa cctcctgcat 660caagcggatg acccaacggt ttagaggggg atctaagcga gtttgcaggg tttctgcgac 720cagacgaatg gaagtcagag gtgttctcag ttcatgggcc aggtctgaaa aagagcggtc 780acgttgctga tgaatgtcta caaattgttg gtgactttct agaaacacac ccacttgtcc 840ccccggtagg ggaaaactgt tagctgctaa agacaatggc tttaatccta aaataccctg 900accatgatct cgggaagggt gaaaaatcca ctcttgcatt tgcggttttt gccaatcccg 960ggtttgctca attaactgat ccagctcata ggatctcact aattccagta gcaggcgcac 1020ttgacccggt tgccatcttt gtaaatacag catttcccgc gcgcactgat tacaccatag 1080tagttggttt tcttcatcta cttgtaaata tcccaaaggc gcagcatcca gcaactgttc 1140ataagctttg agtgacaagc gtaagttttg ttgctcatct ctaacggtag atattttacg 1200atgtaatcca gctaataggg gtaataatat cttttcagcg tgagggttta agggttgggt 1260taactgctcc aaatgactgt taagttgaaa ttgttgccaa agccaaaaac caaaaccgac 1320tgccaaaccc agaagaaatc ccaataagaa cat 135363450PRTCylindrospermopsis raciborskii T3 63Met Phe Leu Leu Gly Phe Leu Leu Gly Leu Ala Val Gly Phe Gly Phe1 5 10 15Trp Leu Trp Gln Gln Phe Gln Leu Asn Ser His Leu Glu Gln Leu Thr 20 25 30Gln Pro Leu Asn Pro His Ala Glu Lys Ile Leu Leu Pro Leu Leu Ala 35 40 45Gly Leu His Arg Lys Ile Ser Thr Val Arg Asp Glu Gln Gln Asn Leu 50 55 60Arg Leu Ser Leu Lys Ala Tyr Glu Gln Leu Leu Asp Ala Ala Pro Leu65 70 75 80Gly Tyr Leu Gln Val Asp Glu Glu Asn Gln Leu Leu Trp Cys Asn Gln 85 90 95Cys Ala Arg Glu Met Leu Tyr Leu Gln Arg Trp Gln Pro Gly Gln Val 100 105 110Arg Leu Leu Leu Glu Leu Val Arg Ser Tyr Glu Leu Asp Gln Leu Ile 115 120 125Glu Gln Thr Arg Asp Trp Gln Lys Pro Gln Met Gln Glu Trp Ile Phe 130 135 140His Pro Ser Arg Asp His Gly Gln Gly Ile Leu Gly Leu Lys Pro Leu145 150 155 160Ser Leu Ala Ala Asn Ser Phe Pro Leu Pro Gly Gly Gln Val Gly Val 165 170 175Phe Leu Glu Ser His Gln Gln Phe Val Asp Ile His Gln Gln Arg Asp 180 185 190Arg Ser Phe Ser Asp Leu Ala His Glu Leu Arg Thr Pro Leu Thr Ser 195 200 205Ile Arg Leu Val Ala Glu Thr Leu Gln Thr Arg Leu Asp Pro Pro Leu 210 215 220Asn Arg Trp Val Ile Arg Leu Met Gln Glu Val Asp Arg Leu Ile Asn225 230 235 240Leu Val Gln Asn Trp Leu Asp Leu Thr Gln Met Glu Ile Thr Ser Ser 245 250 255Ile Gln Leu Asn Leu Glu Met Leu Glu Val Arg Ser Leu Ile Phe Ser 260 265 270Val Trp Glu Asn Leu Glu Pro Leu Ala Ala Asn Gln His Leu Ser Ile 275 280 285Ser Tyr Ser Gly Pro Glu Lys Val Tyr Ile Cys Ala Asp Lys Ser Arg 290 295 300Ile Tyr Gln Val Phe Leu Asn Leu Leu Asp Asn Cys Ile Lys Tyr Ser305 310 315 320Asn Leu Asn Gly Thr Ile Phe Ile Glu Met Asn Pro Val Cys Gly Glu 325 330 335Lys Ser Ile Asn Gly Val Asp Pro Glu Ala Asp Thr Ile Leu Asn Gln 340 345 350Val Ser Asn Gln Ile Leu Glu Ile Asn Ile Ile Asp Ser Gly Val Gly 355 360 365Phe Ala Pro Met Asp Leu Pro His Val Phe Gln Arg Phe Tyr Arg Gly 370 375 380Asp Lys Ala Arg His Arg Glu Ser Arg Ser Glu Asn Glu Thr Val Glu385 390 395 400Ile Thr Gly Ser Gly Leu Gly Leu Ser Ile Val Arg Gln Ile Ile Ile 405 410 415Ala His Gly Gly Lys Ile Arg Ala Met Asn His Pro Asp Thr Gly Gly 420 425 430Ala Trp Ile Gln Ile His Leu Pro Gln Val Val Gln His Asp Gly Gly 435 440 445Tyr Phe 45064819DNACylindrospermopsis raciborskii T3 64tcaaccaaat ctatagccaa aacccctaac tgtgacaata tattctggat ggctagggtc 60taactctaat ttttccctca gccatcgaat gtgaacatcc accgttttac tgtcaccaac 120aaaatcagga ccccaaacct ggtctaataa ctgttcccgt gaccacaccc tgcgagcata 180actcataaat agttctagta accggaattc tttcggtgac aagctcacct ccctccctct 240cactaacacc cgacattcct gaggatttaa actgatatcc ttatatttta aagtgggtat 300caagggcaaa ttagaaaacc gctgacgacg taacagggcg cgacacctag ccaccatttc 360ccgtacgcta aaaggcttag ttaggtaatc atccgcccct acctctaaac ccagcacccg 420gtcagtttca ctacctttcg cactcagaat taaaatcggt atggaattac cctggtgacg 480taacaaacga caaatatcta atccgttgat ttgtggcaac atcaagtcta gcacaagcag 540gtcgaaggat aactcaccag gttgggtctc taaattcctg attaattcca cagcacaacg 600accatcctta gcagtcacaa cttcataacc ttcaccctct aaggctacta caagcatctc 660tcggatcagt tcttcgtctt ccactattaa aacgcgacta actggttcaa tatccgattt 720agtgaagtat ctagggtaat tcagtagtat acattgataa caaaaatttg taagaatgta 780ctggtctggg tttcccacta gtatatgatc ctcactcat 81965272PRTCylindrospermopsis raciborskii T3 65Met Ser Glu Asp His Ile Leu Val Gly Asn Pro Asp Gln Tyr Ile Leu1 5 10 15Thr Asn Phe Cys Tyr Gln Cys Ile Leu Leu Asn Tyr Pro Arg Tyr Phe 20 25 30Thr Lys Ser Asp Ile Glu Pro Val Ser Arg Val Leu Ile Val Glu Asp 35 40 45Glu Glu Leu Ile Arg Glu Met Leu Val Val Ala Leu Glu Gly Glu Gly 50 55 60Tyr Glu Val Val Thr Ala Lys Asp Gly Arg Cys Ala Val Glu Leu Ile65 70 75 80Arg Asn Leu Glu Thr Gln Pro Gly Glu Leu Ser Phe Asp Leu Leu Val 85 90 95Leu Asp Leu Met Leu Pro Gln Ile Asn Gly Leu Asp Ile Cys Arg Leu 100 105 110Leu Arg His Gln Gly Asn Ser Ile Pro Ile Leu Ile Leu Ser Ala Lys 115 120 125Gly Ser Glu Thr Asp Arg Val Leu Gly Leu Glu Val Gly Ala Asp Asp 130 135 140Tyr Leu Thr Lys Pro Phe Ser Val Arg Glu Met Val Ala Arg Cys Arg145 150 155 160Ala Leu Leu Arg Arg Gln Arg Phe Ser Asn Leu Pro Leu Ile Pro Thr 165 170 175Leu Lys Tyr Lys Asp Ile Ser Leu Asn Pro Gln Glu Cys Arg Val Leu 180 185 190Val Arg Gly Arg Glu Val Ser Leu Ser Pro Lys Glu Phe Arg Leu Leu 195 200 205Glu Leu Phe Met Ser Tyr Ala Arg Arg Val Trp Ser Arg Glu Gln Leu 210 215 220Leu Asp Gln Val Trp Gly Pro Asp Phe Val Gly Asp Ser Lys Thr Val225 230 235 240Asp Val His Ile Arg Trp Leu Arg Glu Lys Leu Glu Leu Asp Pro Ser 245 250 255His Pro Glu Tyr Ile

Val Thr Val Arg Gly Phe Gly Tyr Arg Phe Gly 260 265 27066774DNACylindrospermopsis raciborskii T3 66tcaggcaaaa cgagagaagt ctaaagtggg tggaatatcc tgaattcttc caggacctat 60agcccgtagt gcttctggta aactaatatc cccagtatat agggctttac ccacaattac 120tcctgtaacc ccctgatgtt ctaaagataa taaggttaat aggtcagtaa cagaacccac 180acccccagag gcaatcacgg gtatggaaat agcagatacc aagtctctta atgctcgcaa 240gtttggtccc tgaagcgtac catcacggtt tatatccgta taaataatag ctgccgcacc 300caattcctgc atttgggttg ctagttgggg ggccaaaatt tgagaagttt ctaaccaacc 360cctggtagca actagaccat tccgcgcatc aatcccaatt ataatttgct gggggaattg 420ttcacacagt ccttgaacca gatctggttg ctctactgct acagttccca gaattgccca 480ctgtacccca agattaaata actgtataac gctggagcta tcacgtattc ctccgccaac 540ttcaataggt atggaaatag cattggtaat agcttctata gtagataaat taactatttt 600accagttttt gctccatcta aatctactaa atgtagtctt gttgctcctt ggtctgccca 660cattttagcg gtttccacag ggttatggct gtaaacctgg gattgtgcat agtcaccttt 720gtagagtctt acacaacgcc cctctaatag atctattgct gggataactt ccat 77467257PRTCylindrospermopsis raciborskii T3 67Met Glu Val Ile Pro Ala Ile Asp Leu Leu Glu Gly Arg Cys Val Arg1 5 10 15Leu Tyr Lys Gly Asp Tyr Ala Gln Ser Gln Val Tyr Ser His Asn Pro 20 25 30Val Glu Thr Ala Lys Met Trp Ala Asp Gln Gly Ala Thr Arg Leu His 35 40 45Leu Val Asp Leu Asp Gly Ala Lys Thr Gly Lys Ile Val Asn Leu Ser 50 55 60Thr Ile Glu Ala Ile Thr Asn Ala Ile Ser Ile Pro Ile Glu Val Gly65 70 75 80Gly Gly Ile Arg Asp Ser Ser Ser Val Ile Gln Leu Phe Asn Leu Gly 85 90 95Val Gln Trp Ala Ile Leu Gly Thr Val Ala Val Glu Gln Pro Asp Leu 100 105 110Val Gln Gly Leu Cys Glu Gln Phe Pro Gln Gln Ile Ile Ile Gly Ile 115 120 125Asp Ala Arg Asn Gly Leu Val Ala Thr Arg Gly Trp Leu Glu Thr Ser 130 135 140Gln Ile Leu Ala Pro Gln Leu Ala Thr Gln Met Gln Glu Leu Gly Ala145 150 155 160Ala Ala Ile Ile Tyr Thr Asp Ile Asn Arg Asp Gly Thr Leu Gln Gly 165 170 175Pro Asn Leu Arg Ala Leu Arg Asp Leu Val Ser Ala Ile Ser Ile Pro 180 185 190Val Ile Ala Ser Gly Gly Val Gly Ser Val Thr Asp Leu Leu Thr Leu 195 200 205Leu Ser Leu Glu His Gln Gly Val Thr Gly Val Ile Val Gly Lys Ala 210 215 220Leu Tyr Thr Gly Asp Ile Ser Leu Pro Glu Ala Leu Arg Ala Ile Gly225 230 235 240Pro Gly Arg Ile Gln Asp Ile Pro Pro Thr Leu Asp Phe Ser Arg Phe 245 250 255Ala68396DNACylindrospermopsis raciborskii T3 68atgagttggt ccacaatgaa ggacgtcttg attttaatag tcaaatccct ccaaatccat 60tataatccca tgaatgctct ttcaattcct acctggatta tccatatttc tagtgtcatt 120gaatgggtag ttgccatttc cctcatctgg aaatatggcg aactgaccca aaaccatagt 180tggaggggat ttgccttagg tatgataccc gccttaatta gcgccctatc cgcttgtacc 240tggcattatt tcgataatcc ccagtcccta gaatggttag tcaccctcca ggctactact 300acgttaatag gtaattttac tctttgggca gcagcagtct gggtttggcg ttctactcga 360ccgaatgagg ttctcagtat ctcaaataag gagtag 39669131PRTCylindrospermopsis raciborskii T3 69Met Ser Trp Ser Thr Met Lys Asp Val Leu Ile Leu Ile Val Lys Ser1 5 10 15Leu Gln Ile His Tyr Asn Pro Met Asn Ala Leu Ser Ile Pro Thr Trp 20 25 30Ile Ile His Ile Ser Ser Val Ile Glu Trp Val Val Ala Ile Ser Leu 35 40 45Ile Trp Lys Tyr Gly Glu Leu Thr Gln Asn His Ser Trp Arg Gly Phe 50 55 60Ala Leu Gly Met Ile Pro Ala Leu Ile Ser Ala Leu Ser Ala Cys Thr65 70 75 80Trp His Tyr Phe Asp Asn Pro Gln Ser Leu Glu Trp Leu Val Thr Leu 85 90 95Gln Ala Thr Thr Thr Leu Ile Gly Asn Phe Thr Leu Trp Ala Ala Ala 100 105 110Val Trp Val Trp Arg Ser Thr Arg Pro Asn Glu Val Leu Ser Ile Ser 115 120 125Asn Lys Glu 1307020DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 70ttaattgctt ggtctatctc 207120DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 71caataccgaa gaggagatag 207220DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 72taggcgtgtt agtgggagat 207320DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 73tgtgtaacca atttgtgagt 207420DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 74ttagccggat tacaggtgaa 207520DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 75ctggactcgg cttgttgctt 207620DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 76cagcgagtta cacccaccac 207720DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 77ctcgcactaa atattctacc 207819DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 78aaaacctcag cttccacaa 197922DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 79atgattttgg aggtccattg tt 228042156DNACylindrospermopsis raciborskii AWT205 80gtttttactg caaaagcata ttcatattat attctaatag ggttggtgga atattcaagg 60ggaggttaga aaatgcgatc gctcttatga atgaggttgt ctatccgaat atcaaatatt 120ggtggttgaa aaaagacctt atatgcggac acagattccc atgatgaaaa tatatcattg 180tcaagtcaat tagtcaaccc cccaatagac atctccgaaa aagaatcaaa gtgtgataaa 240atttgcagta cagcaggata taaaatagtt tttcctctat acttctgagt gtaggcttgc 300gtccgccccc gggcgcacgt ttgcggtttg ctaaggagtt aaacacggtg cgttaatatg 360tatcagcaac ctgagataac agctcgttga atgcttagcg gttaagtcca gtcattgctc 420gtagcagtcg ctcttgattc aggatgcggt ctaagttcaa cattaatgtc accctacttg 480tctgcttgat tattatccct tattttccaa caactctaat gaaagtacct ataacagcaa 540acgaagatgc agctacatta cttcagcgtg ttggactgtc cctaaaggaa gcacaccaac 600aacttgaggc aatgcaacgc cgagcgcacg aaccgatcgc aattgtgggg ctggggctgc 660ggtttccggg agctgattca ccacagacat tctggaaact acttcagaat ggtgttgata 720tggtcaccga aatccctagc gatcgctggg cagttgatga atactatgat ccccaacctg 780ggtgtccagg caaaatgtat attcgtgaag ccgcttttgt tgatgcagtg gataaattcg 840atgcctcgtt ttttgatatt tcgccacgtg aagcggccaa tatagatccc cagcatagaa 900tgttgctgga ggtagcttgg gaggcactcg aaagggctgg cattgctccc agccaattga 960tggatagcca aacgggggta tttgtcggga tgagcgaaaa tgactattat gctcacctag 1020aaaatacagg ggatcatcat aatgtctatg cggcaacggg caatagcaat tactatgctc 1080cggggcgttt atcctatcta ttggggcttc aaggacctaa catggtcgtt gatagtgcct 1140gttcctcctc cttagtggct gtacatcttg cctgtaatag tttgcggatg ggagaatgtg 1200atctggcact ggctggtggc gttcagctta tgttaatccc agaccctatg attgggactg 1260cccagttaaa tgcctttgcg accgatggtc gtagtaaaac atttgacgct gccgccgatg 1320gctatggacg cggcgaaggt tgtggcatga ttgtacttaa aagaataagt gacgcgatcg 1380tggcagacga tccaatttta gccgtaatcc ggggtagtgc agtcaatcat ggcgggcgta 1440gcagtggttt aactgcccct aataagctgt ctcaagaagc cttactgcgt caggcactac 1500aaaacgccaa ggttcagccg gaagcagtca gttatatcga agcccatggc acagggacac 1560aactgggcga cccgattgag gtgggagcat taacgaccgt ctttggatct tctcgttcag 1620aacccttgtg gattggctct gtcaaaacta atatcggaca cctagaacca gccgctggta 1680ttgcggggtt aataaaagtc attttatcat tacaagaaaa acagattcct cccagtctcc 1740attttcaaaa ccctaatccc ttcattgatt gggaatcttc gccagttcaa gtgccgacac 1800agtgtgtacc ctggactggg aaagagcgcg tcgctggagt tagctcgttt ggtatgagcg 1860gtacaaactg tcatctagtt gtcgcagaag cacctgtccg ccaaaacgaa aaatctgaaa 1920atgcaccgga gcgtccttgt cacattctga ccctttcagc caaaaccgaa gcggcactca 1980acgcattggt agcccgttac atggcatttc tcagggaagc gcccgccata tccctagctg 2040atctttgtta tagtgccaat gtcgggcgta atctttttgc ccatcgctta agttttatct 2100ccgagaacat cgcgcagtta tcagaacaat tagaacactg cccacagcag gctacaatgc 2160caacgcaaca taatgtgata ctagataatc aactcagccc tcaaatcgct tttctgttta 2220ctggacaagg ttcgcagtac atcaacatgg ggcgtgagct ttacgaaact cagcccacct 2280tccgtcggat tatggacgaa tgtgacgaca ttctgcatcc attgttgggt gaatcaattc 2340tgaacatact ctacacttcc cctagcaaac ttaatcaaac cgtttatacc caacctgccc 2400tttttgcttt tgaatatgcc ctagcaaaac tatggatatc atggggtatt gagcctgatg 2460tcgtactggg tcacagcgtg ggtgaatatg tagccgcttg tctggcgggt gtctttagtt 2520tagaagatgg gttaaaactc attgcatctc gtggatgttt gatgcaagcc ttaccgccgg 2580ggaaaatgct tagtatcaga agcaatgaga tcggagtgaa agcgctcatc gcgccttata 2640gtgcagaagt atcaattgca gcaatcaatg gacagcaaag cgtggtgatc tccggcaaag 2700ctgaaattat agataattta gcagcagagt ttgcatcgga aggcatcaaa acacacctaa 2760ttacagtctc ccacgctttc cactcgccaa tgatgacccc catgctgaaa gcattccgag 2820acgttgccag caccatcagc tataggtcac ccagtttatc actgatttct aacggtacag 2880ggcaattggc aacaaaggag gttgctacac ctgattattg ggtgcgtcat gtccattcta 2940ccgtccgttt tgccgatggt attgccacat tggcagaaca gaatactgac atcctcctag 3000aagtaggacc caaaccaata ttgttgggta tggcaaagca gatttatagt gaaaacggtt 3060cagctagtca tccgctcatg ctacccagtt tgcgtgaaga tggcaacgat tggcagcaga 3120tgctttctac ttgtggacaa cttgtagtta atggagtcaa gattgactgg gcgggttttg 3180acaaggatta ttcacgacac aaaatattgt tgcccaccta tccgtttcag agagaacgat 3240attggattga aagctccgtc aaaaagcccc aaaaacagga gctgcgccca atgttggata 3300agatgatccg gctaccatca gagaacaaag tggtgtttga aaccgagttt ggcgtgcgac 3360agatgcctca tatctccgat catcagatat acggtgaagt cattgtaccg ggggcagtat 3420tagcttcctt aatcttcaat gcagcgcagg ttttataccc agactatcag catgaattaa 3480ctgatattgc tttttatcag ccaattatct ttcatgacga cgatacggtg atcgtgcagg 3540cgattttcag ccctgataag tcacaggaga atcaaagcca tcaaacattt ccacccatga 3600gcttccagat tattagcttc atgccggatg gtcccttaga gaacaaaccg aaagtccatg 3660tcacagggtg tctgagaatg ttgcgcgatg cccaaccgcc aacactctcc ccgaccgaaa 3720tacgtcagcg ctgtccacat accgtaaatg gtcatgactg gtacaatagc ttagtcaaac 3780aaaaatttga aatgggtcct tcctttaggt gggtacagca actttggcat ggggaaaatg 3840aagcattgac ccgtcttcac ataccagatg tggtcggctc tgtatcagga catcaacttc 3900acggcatatt gctcgatggt tcactttcaa ccaccgctgt catggagtac gagtacggag 3960actccgcgac cagagttcct ttgtcatttg cttctctgca actgtacaaa cccgtcacgg 4020gaacagagtg gtggtgctac gcgaggaaga ttggggaatt caaatatgac ttccagatta 4080tgaatgaaat cggggaaacc ttggtgaaag caattggctt tgtacttcgt gaagcctctc 4140ccgaaaaatt cctcagaaca acatacgtac acaactggct tgtagacatt gaatggcaag 4200ctcaatcaac ttccctagtc ccttctgatg gcactatctc tggcagttgt ttggttttat 4260cagatcagca tggaacaggg gctgcattgg cacaaaggct agacaatgct ggagtgccag 4320tgaccatgat ctatgctgat ctgatactgg acaattacga attaatattc cgtactttgc 4380cagatttaca acaagtcgtc tatttatggg ggttggatca aaaagaggat tgtcacccca 4440tgaagcaagc agaggataac tgtacatcgg tgctatatct tgtgcaagca ttactcaata 4500cctactcaac cccgccatcc ctgcttattg tcacctgtga tgcacaagcg gtggttgaac 4560aagatcgagt aaatggcttc gcccaatcgt ctttgttggg acttgccaaa gttatcatgc 4620tagaacaccc agaattgtcc tgtgtttaca tggatgtgga agccggatat ttacagcaag 4680atgtggcgaa cacgatattt acacagctaa aaagaggcca tctatcaaag gacggagaag 4740agagtcagtt ggcttggcgc aatggacaag catacgtagc acgtcttagt caatataaac 4800ccaaatccga acaactggtt gagatccgca gcgatcgcag ctatttgatc actggtggac 4860ggggcggtgt cggcttacaa atcgcacggt ggttagtgga aaagggggct aaacatctcg 4920ttttgttggg gcgcagtcag accagttccg aagtcagtct ggtgttggat gagctagaat 4980cagccggggc gcaaatcatt gtggctcaag ctgatattag cgatgagaag gtattagcgc 5040agattctgac caatctaacc gtacctctgt gtggtgtaat ccacgccgca ggagtgcttg 5100atgatgcgag tctactccaa caaactccag ccaagctcaa aaaagttcta ttgccaaaag 5160cagagggggc ttggattctg cataatttga ccctggagca gcgactagac ttctttgttc 5220tcttttcttc tgccagttct ctattaggtg cgccagggca ggccaactat tcagcagcca 5280atgctttcct agatggttta gctgcctatc ggcgagggcg aggactcccc tgtttgtcta 5340tctgctgggg ggcatgggat caagtcggta tggctgcacg acaagggcta ctggacaagt 5400taccgcaaag aggtgaagag gccatcccgt tacagaaagg cttagacctc ttcggcgaat 5460tactgaacga gccagccgct caaattggtg tgatcccaat tcaatggact cgcttcttgg 5520atcatcaaaa aggtaatttg cctttttatg agaagttttc taagtctagc cggaaagcgc 5580agagttacga ttcgatggca gtcagtcaca cagaagatat tcagaggaaa ctgaagcaag 5640ctgctgtgca agatcgacca aaattattag aagtgcatct tcgctctcaa gtcgctcaac 5700tgttaggaat aaacgtggca gagctaccaa atgaagaagg aattggtttt gttacattag 5760gtcttgactc gctcacctct attgaactgc gtaacagttt acaacgcaca ttagattgtt 5820cattacctgt cacctttgct tttgactacc caactataga aatagcggtt aagtacctaa 5880cacaagttgt aattgcaccg atggaaagca cagcatcgca gcaaacagac tctttatcag 5940caatgttcac agatacttcg tccatcggga gaattcttga caacgaaaca gatgtgttag 6000acagcgaaat gcaaagtgat gaagatgaat ctttgtctac acttatacaa aaattatcaa 6060cacatttgga ttaggagtga tcaataatta tacattgcgg acgtgagcat acaagtaaag 6120gaaaaatgaa tgaacgcttt gtcagaaaat caggtaactt ctatagtcaa gaaggcattg 6180aacaaaatag aggagttaca agccgaactt gaccgtttaa aatacgcgca acgggaacca 6240atcgccatca ttggaatggg ctgtcgcttt cctggtgcag acacacctga agctttttgg 6300aaattattgc acaatggggt tgatgctatc caagagattc caaaaagccg ttgggatatt 6360gacgactatt atgatcccac accagcaaca cccggcaaaa tgtatacacg ttttggtggt 6420tttctcgacc aaatagcagc cttcgaccct gagttctttc gcatttctac tcgtgaggca 6480atcagcttag accctcaaca gagattgctt ctggaagtga gttgggaagc cttagaacgg 6540gctgggctga caggcaataa actgactaca caaacaggtg tctttgttgg catcagtgaa 6600agtgattatc gtgatttgat tatgcgtaat ggttctgacc tagatgtata ttctggttca 6660ggtaactgcc atagtacagc cagcgggcgt ttatcttatt atttgggact tactggaccc 6720aatttgtccc ttgataccgc ctgttcgtcc tctttggttt gtgtggcatt ggctgtcaag 6780agcctacgtc aacaggagtg tgatttggca ttggcgggtg gtgtacagat acaagtgata 6840ccagatggct ttatcaaagc ctgtcaatcc cgtatgttgt cgcctgatgg acggtgcaaa 6900acatttgatt tccaggcaga tggttatgcc cgtgctgagg ggtgtgggat ggtagttctc 6960aaacgcctat ccgatgcaat tgctgacaat gataatatcc tggccttgat tcgtggtgcc 7020gcagtcaatc atgatggcta cacgagtgga ttaaccgttc ccagtggtcc ctcacaacgg 7080gcggtgatcc aacaggcatt agcggatgct ggaatacacc cggatcaaat tagctatatt 7140gaggcacatg gcacaggtac atccttaggc gatcctattg aaatgggtgc gattgggcaa 7200gtctttggtc aacgctcaca gatgcttttc gtcggttcgg tcaagacgaa tattggtcat 7260actgaggctg ctgctggtat tgctggtctc atcaaggttg tactctcaat gcagcacggt 7320gaaatcccag caaacttaca cttcgaccag ccaagtcctt atattaactg ggatcaatta 7380ccagtcagta tcccaacaga aacaatacct tggtctacta gcgatcgctt tgcaggagtc 7440agtagctttg gctttagtgg cacaaactct catatcgtac tagaggcagc cccaaacata 7500gagcaaccta ctgatgatat taatcaaacg ccgcatattt tgaccttagc tgcaaaaaca 7560cccgcagccc tgcaagaact ggctcggcgt tatgcgactc agatagagac ctctcccgat 7620gttcctctgg cggacatttg tttcacagca cacatagggc gtaaacattt taaacatagg 7680tttgcggtag tcacggaatc taaagagcaa ctgcgtttgc aattggatgc atttgcacaa 7740tcagggggtg tggggcgaga agtcaaatcg ctaccaaaga tagcctttct ttttacaggt 7800caaggctcac agtatgtggg aatgggtcgt caactttacg aaaaccaacc taccttccga 7860aaagcactcg cccattgtga tgacatcttg cgtgctggtg catatttcga ccgatcacta 7920ctttcgattc tctacccaga gggaaaatca gaagccattc accaaaccgc ttatactcag 7980cccgcgcttt ttgctcttga gtatgcgatc gctcagttgt ggcactcctg gggtatcaaa 8040ccagatatcg tgatggggca tagtgtaggt gaatacgtcg ccgcttgtgt ggcgggcata 8100ttttctttag aggatgggct gaaactaatt gctactcgtg gtcgtctgat gcaatcccta 8160cctcaagacg gaacgatggt ttcttctttg gcaagtgaag ctcgtatcca ggaagctatt 8220acaccttacc gagatgatgt gtcaatcgca gcgataaatg ggacagaaag cgtggttatc 8280tctggcaaac gcacctctgt gatggcaatt gctgaacaac tcgccaccgt tggcatcaag 8340acacgccaac tgacggtttc ccatgccttc cattcaccac ttatgacacc catcttggat 8400gagttccgcc aggtggcagc cagtatcacc tatcaccagc ccaagttgct acttgtctcc 8460aacgtctccg ggaaagtggc cggccctgaa atcaccagac cagattactg ggtacgccat 8520gtccgtgagg cagtgcgctt tgccgatgga gtgaggacgc tgaatgaaca aggtgtcaat 8580atctttctgg aaatcggttc taccgctacc ctgttgggca tggcactgcg agtaaatgag 8640gaagattcaa atgcctcaaa aggaacttcg tcttgctacc tgcccagttt acgggaaagc 8700cagaaggatt gtcagcagat gttcactagt ctgggtgagt tgtacgtaca tggatatgat 8760attgattggg gtgcatttaa tcggggatat caaggacgca aggtgatatt gccaacctat 8820ccgtttcagc gacaacgtta ttggcttccc gaccctaagt tggcacaaag ttccgattta 8880gatacctttc aagctcagag cagcgcatca tcacaaaatc ctagcgctgt gtccacttta 8940ctgatggaat atttgcaagc aggtgatgtc caatctttag ttgggctttt ggatgatgaa 9000cggaaactct ctgctgctga acgaattgca ctacccagta ttttggagtt tttggtagag 9060gaacaacagc gacaaataag ctcaaccaca actcctcaaa cagttttaca aaaaataagt 9120caaacttccc atgaggacag atatgaaata ttgaagaacc tgatcaaatc tgaaatcgaa 9180acgattatca aaagtgttcc ctccgatgaa caaatgtttt ctgacttagg aattgattcc 9240ttgatggcga tcgaactgcg taataagctc cgttctgcta tagggttgga actgccagtg 9300gcaatagtat ttgaccatcc cacgattaag cagttaacta acttcgtact ggacagaatt 9360gtgccgcagg cagaccaaaa ggacgttccc accgaatcct tgtttgcttc taaacaggag 9420atatcagttg aggagcagtc ttttgcaatt accaagctgg gcttatcccc tgcttcccac 9480tccctgcatc ttcctccatg gacggttaga cctgcggtaa tggcagatgt aacaaaacta 9540agccaacttg aaagagaggc ctatggctgg atcggagaag gagcgatcgc cccgccccat 9600ctcattgccg atcgcatcaa tttactcaac agtggtgata tgccttggtt ctgggtaatg 9660gagcgatcag gagagttggg cgcgtggcag gtgctacaac cgacatctgt tgatccatat 9720acttatggaa gttgggatga agtaactgac caaggtaaac tgcaagcaac cttcgaccca 9780agtggacgca atgtgtatat tgtcgcgggt gggtctagca acctccccac ggtagccagc 9840cacctcatga cgcttcagac tttattgatg ctgcgggaaa ctggtcgtga cacaatcttt 9900gtctgtctgg caatgccagg ttatgccaaa taccacagtc aaacaggaaa atcgccggaa 9960gagtatattg

cgctgactga cgaggatggt atcccaatgg acgagtttat tgcactttct 10020gtctacgact ggcctgttac cccatcgttt cgtgttctgc gagacggtta tccacctgat 10080cgagattctg gtggtcacgc agttagtacg gttttccagc tcaatgattt cgatggagcg 10140atcgaagaaa catatcgtcg tattatccgc catgccgatg tccttggtct cgaaagaggc 10200taaatttcag gcgttggtga atagaaccca cattccgcag ataaggtctt atgaataaaa 10260aacaggtaga cacattgtta atacacgctc atctttttac catgcagggc aatggcctgg 10320gatatattgc cgatggggca attgcggttc agggtagcca gatcgtagca gtggattcga 10380cagaggcttt gctgagtcat tttgaaggaa ataaaacaat taatgcggta aattgtgcag 10440tgttgcctgg actaattgat gctcatatac atacgacttg tgctattctg cgtggagtgg 10500cacaggatgt aaccaattgg ctaatggacg cgacaattcc ttatgcactt cagatgacac 10560ccgcagtaaa tatagccgga acgcgcttga gtgtactcga agggctgaaa gcaggaacaa 10620ccacattcgg cgattctgag actccttacc cgctctgggg agagtttttc gatgaaattg 10680gggtacgtgc tattctatcc cctgccttta acgcctttcc actagaatgg tcggcatgga 10740aggagggaga cctctatccc ttcgatatga aggcaggacg acgtggtatg gaagaggctg 10800tggattttgc ttgtgcatgg aatggagccg cagagggacg tatcaccact atgttgggac 10860tacaggcggc ggatatgcta ccactggaga tcctacacgc agctaaagag attgcccaac 10920gggaaggctt aatgctgcat attcatgtgg cccagggaga tcgagaaaca aaacaaattg 10980tcaaacgata tggtaagcgt ccgatcgcat ttctagctga aattggctac ttggacgaac 11040agttgctggc agttcacctc accgatgcca cagatgaaga agtgatacaa gtagccaaaa 11100gtggtgctgg catggcactc tgttcgggcg ctattggcat cattgacggt cttgttccgc 11160ccgctcatgt ttttcgacaa gcaggcggtt ccgttgcact cggttctgat caagcctgtg 11220gcaacaactg ttgtaacatc ttcaatgaaa tgaagctgac cgccttattc aacaaaataa 11280aatatcatga tccaaccatt atgccggctt gggaagtcct gcgtatggct accatcgaag 11340gagcgcaggc gattggttta gatcacaaga ttggctctct tcaagtgggc aaagaagccg 11400acctgatctt aatagacctc agttccccta acctctcgcc caccctgctc aaccctattc 11460gtaaccttgt acctaacttg gtgtatgctg cttcaggaca tgaagttaaa agcgtcatgg 11520tggcgggaaa acttttagtg gaagactacc aagtcctcac ggtagatgag tccgctattc 11580tcgctgaagc gcaagtacaa gctcaacaac tctgccaacg tgtgaccgct gaccccattc 11640acaaaaagat ggtgttaatg gaagcgatgg ctaagggtaa attatagata caggcttatc 11700tgcaacaaca tttctgaatc aaacctggag gggcaaacca atgaccatat atgaaaataa 11760gttgagtagt tatcaaaaaa atcaagatgc cataatatct gcaaaagaac tcgaagaatg 11820gcatttaatt ggacttctag accattcaat agatgcggta atagtaccga attattttct 11880tgagcaagag tgtatgacaa tttcagagag aataaaaaag agtaaatatt ttagcgctta 11940tcccggtcat ccatcagtaa gtagcttggg acaagagttg tatgaatgcg aaagtgagct 12000tgaattagca aagtatcaag aagacgcacc cacattgatt aaagaaatgc ggaggctggt 12060acatccgtac ataagtccaa ttgatagact tagggttgaa gttgatgata tttggagtta 12120tggctgtaat ttagcaaaac ttggtgataa aaaactgttt gcgggtatcg ttagagagtt 12180taaagaagat aaccctggcg caccacattg tgacgtaatg gcatggggtt ttctcgaata 12240ttataaagat aaaccaaata tcataaatca aatcgcagca aatgtatatt taaaaacgtc 12300tgcatcagga ggagaaatag tgctttggga tgaatggcca actcaaagcg aatatatagc 12360atacaaaaca gatgatccag ctagtttcgg tcttgatagc aaaaagatcg cacaaccaaa 12420acttgagatc caaccgaacc agggagattt aattctattc aattccatga gaattcatgc 12480ggtgaaaaag atagaaactg gtgtacgtat gacatgggga tgtttgattg gatactctgg 12540aactgataaa ccgcttgtta tttggactta atgtagcgtt tccatttgag tcaaggcacg 12600agaagcttct aaagctggaa tagatacact atcattctca actacactct caaatgtcct 12660aggtaactgt gccccaaaca tcagcattcc aatggcgttg aacaaaaaga aagccaacca 12720caagatatgg ttactctcaa atttaacagc agctacatcc gcaggtaaaa atcctacacc 12780aaacgcgatt aagttaacat tgcggagagt atgcccttga gccaaaccca agaagtaccc 12840acatagtatg caacatactg aattgcatac taggacaagt accaaccagg gaataaaaat 12900atcaatattc tcaataattt ctgcgtggtt ggttaacaac ccaaaaacat catcgggaaa 12960tagccaacac gctccgccga aaaccagact cactagcaga gccattccca cagaaacttt 13020tgccagaggt gctaactgtt ctgtggctcc tttcccttta aaatttcctg ccagagtttc 13080tgtacagaat cccaatcctt caacaatgta gatgctcaaa gcccatatct gtaagagcaa 13140ggcattttga gcgtagataa ttgtccccat ttgtgcccct tcgtagttaa acgttaagtt 13200ggtaaacata caaactaaat tgctgacaaa gatgtttcca ttgagagtta aggtggagcg 13260tatagctttt atgtcccaaa tttttccagc taattctttt acctcttgcc acgggatttc 13320tttgcagaca aaaaacaatc ccaccaatag ggtgagatat tgacttgcag cagaagctac 13380tcctgccccc atgctcgacc agtctaagtg gataataaac aagtagtcga gtgcgatatt 13440ggcagcattg cccacaaccg acaacaacac aactaagcca tttttttccc gtcccagaaa 13500ccagccaagc aggacaaagt tgagcaaaat ggcaggcgct ccccaactct gggtgttaaa 13560atacgcttga gctgaagact tcacctctgg gccgacatct agtatagaaa accccaacac 13620ccctaacggg tactgtaaca gtatgatcgc cacccccagc accagagcaa ttaaaccatt 13680aagcagtccc gccaacagta cgccctctcg gtcatctcgt ccgactgctt gtgctgttaa 13740cgcagtggta cccattcgta aaaacgataa aacaaagtag agaaagttaa gcaggtttcc 13800agcaagggct actccagcta ggtagtggat ttccgagaga tgacctaaga acatgatact 13860gactaaatta ctcagtggta ctataatatt cgataggacg ttggtaaaag ctagtcggaa 13920gtagcggggt ataaagtcat actggcttgg aaatgtcagg ctcataagat taatttgaca 13980gtagagttgt tggaaaataa gggataataa tcaagcagac aagtagggtg acattaatgt 14040tgaacttaga ccgcatcctg aatcaagagc gactgctacg agaaatgact ggacttaacc 14100gccaagcatt caacgagctg ttatctcagt ttgctgatac ctatgaacgc accgtgttca 14160actccttagc aaaccgcaaa cgtgcgcccg ggggcggacg caagcctaca ctcagaagta 14220tagaggaaaa actattttat atcctgctgt actgcaaatg ttatccgacg tttgacttgc 14280tgagtgtgtt gttcaacttt gaccgctcct gtgctcatga ttgggtacat cgactactgt 14340ctgtgctaga aaccacttta ggagaaaagc aagttttgcc agcacgcaaa ctcaggagca 14400tggaggaatt caccaaaagg tttccagatg tgaaggaggt gattgtggat ggtacggagc 14460gtccagtcca gcgtcctcaa aaccgagaac gccaaaaaga gtattactct ggcaagaaaa 14520agcggcatac atgcaagcag attacagtca gcacaaggga gaaacgagtg attattcgga 14580cggaaaccag agcaggtaaa gtgcatgaca aacggctact ccatgaatca gagatagtgc 14640aatacattcc tgatgaagta gcaatagagg gagatttggg ttttcatggg ttggagaaag 14700aatttgtcaa tgtccattta ccacacaaga aaccgaaagg tatcgaagca aggaggcatg 14760gcggcgggat gggtcagttt ttataagaga gttttgacaa tataaataaa agacttttga 14820caaccagact tggcattact tagtttcagt ctttcatctc aagtttacgt tattctgagg 14880cgaacatgaa tcttataaca acaaaaaaac aggtagatac attagtgata cacgctcatc 14940tttttaccat gcagggaaat ggtgtgggat atattgcaga tggggcactt gcggttgagg 15000gtagccgtat tgtagcagtt gattcgacgg aggcgttgct gagtcatttt gagggcagaa 15060aggttattga gtccgcgaat tgtgccgtct tgcctgggct gattaatgct cacgtagaca 15120caagtttggt gctgatgcgt ggggcggcgc aagatgtaac taattggcta atggacgcga 15180ccatgcctta ttttgctcac atgacacccg tggcgagtat ggctgcaaca cgcttaaggg 15240tggtagaaga gttgaaagca ggcacaacaa cattctgtga caataaaatt attagccccc 15300tgtggggcga atttttcgat gaaattggtg tacgggctag tttagctcct atgttcgatg 15360cactcccact ggagatgcca ccgcttcaag acggggagct ttatcccttc gatatcaagg 15420cgggacggcg ggcgatggca gaggctgtgg attttgcctg tgggtggaat ggggcagcag 15480aggggcgtat cactaccatg ttaggaatgt attcgccaga tatgatgccg cttgagatgc 15540tacgcgcagc caaagagatt gctcaacggg aaggcttaat gctgcatttt catgtagcgc 15600agggagatcg ggaaacagag caaatcgtta aacgatatgg taagcgtccg atcgcatttc 15660tagctgagat tggctacttg gacgaacagt tgctggcagt tcacctcacc gatgccaccg 15720atgaagaggt gatacaagta gccaaaagtg gcgctggcat ggtactctgt tcgggaatga 15780ttggcactat tgacggtatc gtgccgcccg ctcatgtgtt tcggcaagca ggcggacccg 15840ttgcgctagg cagcagctac aataatattt tccatgagat gaagctgacc gccttattca 15900acaaaataaa atatcacgat ccaaccatta tgccggcttg ggaagtcctg cgtatggcta 15960ccatcgaagg agcgcgggcg attggtttag atcacaagat tggctctctt gaagttggca 16020aagaagccga cctgatctta atagacctca gcacccctaa cctctcaccc actctgctta 16080accccattcg taaccttgta cctaatttcg tgtacgctgc ttcaggacat gaagttaaaa 16140gtgtcatggt ggcgggaaaa ctgttattgg aagactacca agtcctcaca gtagatgagt 16200ctgctatcat tgctgaagca caattgcaag cccaacagat ttctcaatgc gtagcatctg 16260accctatcca caaaaaaatg gtgctgatgg cggcgatggc aaggggccaa ttgtaggaat 16320ggtcttgagt tatctagtaa gctaagttgc caactaacaa ttaaaaatac gaagcaggtg 16380ataaggcaga attacagcag gttgtctttc ggatcgctcg ttggatcttt gtaccttccc 16440tagtcatggc gatcgccctc atcgtcttcg cccaacccgt gatgagcctg ttcggtgcag 16500agtttgctgt ggctcattgg tagccgatac catccctcca actgacttgt catgatagtc 16560atggtgcgac tttcccttcg gtactgataa actgggattg aatccctttc agagtcatca 16620tgatagattt gggaagtcta aatgtggtcg agaagaaagt gcttttccca tgttgagaat 16680agtcacatta acatcagcat caaaacgcct aattctagat tttacctatg gtttcagcca 16740aggtaaagga actgagtcta aattacacgc cgtcatgaga taatatgatt attaattttc 16800tgtatagccc agttaattat acttgattgt aggctatttt tagcctcttc taatgaagaa 16860tccagactaa tccttatgta cgggaatatg ttatgcaaga aaaacgaatc gcaatgtggt 16920ctgtgccacg aagtttgggt acagtgctgc tacaagcctg gtcgagtcgg ccagataccg 16980tagtctttga tgaacttctc tcctttccct atctctttat caaagggaaa gatatgggct 17040ttacttggac agaccttgat tctagccaaa tgccccacgc agattggcga tccgtcatcg 17100atctgttaaa ggctcccctg cctgaaggga aatcaatcat cgatctgtta aaggctcccc 17160tgcctgaagg gaaatcaatt tgctatcaga agcatcaagc gtatcattta atcgaagaga 17220ccatggggat tgagtggata ttgcccttca gcaactgctt tctgattcgc caacccaaag 17280aaatgctctt atcttttcgt aagattgtgc cacattttac ctttgaagaa acaggctgga 17340tcgaattaaa acggctgttt gactatgtac atcaaacgag cggagtaatc ccgcctgtca 17400tagatgcaca cgacttgctg aacgatccgc ggagaatgct ctccaagctt tgtcaggttg 17460taggggttga gtttaccgag acaatgctca gttggccccc catggaggtc gagttgaacg 17520aaaaactagc cccttggtac agcaccgtag caagttctac gcattttcac tcgtatcaga 17580ataaaaatga gtcgttgccg ctatatcttg tcgatatttg taaacgctgc gatgaaatat 17640atcaggaatt atatcaattt cgactttatt agagagtatt ggtaatgaaa attttgaatt 17700agtgaagaaa tagaagttga gaatatagac catctaggga tagagactta tgctggacgg 17760attcaacaac atcaggacaa ttacccacgt cagagtgatt ttagctttgc tgtttacgga 17820caattatgga tttatggcat ggaactatag gctgatttag ctctaagctt aattagtctt 17880aaacctcata aacgcctctt tttcaagcgt ggctttcagg ctctatccct tatgaaacaa 17940gctgtttgac cactttgtca cccggtaagg agaaaaacct taaacccaag cagaaaaaat 18000tagcccgtaa aaaaaaggga agtaaatcaa ggaaatatag ggtaatatat ttttcacaag 18060tttatcaatt gtaatctact tgattcagta aattaattaa ggtgttgaag agatgcaaac 18120aagaattgta aatagctgga atgagtggga tgaactaaag gagatggttg tcgggattgc 18180agatggtgct tattttgaac caactgagcc aggtaaccgc cctgctttac gcgataagaa 18240cattgccaaa atgttctctt ttcccagggg tccgaaaaag caagaggtaa cagagaaagc 18300taatgaggag ttgaatgggc tggtagcgct tctagaatca cagggcgtaa ctgtacgccg 18360cccagagaaa cataactttg gcctgtctgt gaagacacca ttctttgagg tagagaatca 18420atattgtgcg gtctgcccac gtgatgttat gatcaccttt gggaacgaaa ttctcgaagc 18480aactatgtca cggcggtcac gcttctttga gtatttaccc tatcgcaaac tagtctatga 18540atattggcat aaagatccag atatgatctg gaatgctgcg cctaaaccga ctatgcaaaa 18600tgccatgtac cgcgaagatt tctgggagtg tccgatggaa gatcgatttg agagtatgca 18660tgattttgag ttctgcgtca cccaggatga ggtgattttt gacgcagcag actgtagccg 18720ctttggccgt gatatttttg tgcaggagtc aatgacgact aatcgtgcag ggattcgctg 18780gctcaaacgg catttagagc cgcgtcgctt ccgcgtgcat gatattcact tcccactaga 18840tattttccca tcccacattg attgtacttt tgtcccctta gcacctgggg ttgtgttagt 18900gaatccagat cgccccatca aagagggtga agagaaactc ttcatggata acggttggca 18960attcatcgaa gcacccctcc ccacttccac cgacgatgag atgcctatgt tctgccagtc 19020cagtaagtgg ttggcgatga atgtgttaag catttccccc aagaaggtca tctgtgaaga 19080gcaagagcat ccgcttcatg agttgctaga taaacacggc tttgaggtct atccaattcc 19140ctttcgcaat gtctttgagt ttggcggttc gctccattgt gccacctggg atatccatcg 19200cacgggaacc tgtgaggatt acttccctaa actaaactat acgccggtaa ctgcatcaac 19260caatggcgtt tctcgcttca tcatttagta ggttttatag ttatgcaaaa gagagaaagc 19320ccacagatac tatttgatgg gaatggaaca caatctgagt ttccagatag ttgcattcac 19380cacttgttcg aggatcaagc cgcaaagcga ccggatgcga tcgctctcat tgacggtgag 19440caatccctta cctacgggga actaaatgta cgcgctaacc acctagccca gcatctcttg 19500tccctaggct gtcaacccga tgacctcctc gccatctgca tcgagcgttc ggcagaactc 19560tttattggtt tgttgggtat cctaaaagcc ggatgtgctt atgtgccttt ggatgtaggc 19620tatcctggcg atcgcataga gtatatgttg cgggactcgg atgcgcgtat tttactaacc 19680tcaacggatg tcgctaagaa acttgcctta accatacctg cattgcaaga gtgccaaacc 19740gtctatttag atcaagagat atttgagtat gattttcatt ttttagcgat agctaaacta 19800ttacataacc aatacttgag attattacat ttttattttt ataccttgat tcagcaatgc 19860caggcaactt cggtttccca agggattcag acacaggttc tccccaataa tctcgcttac 19920tgcatttaca cctctggctc taccggaaat cccaaaggga tcttgatgga acatcgctca 19980ctggtgaata tgctttggtg gcatcagcaa acgcggcctt cggttcaggg tgttaggacg 20040ctgcaatttt gtgcagtcag ctttgacttt tcctgccatg aaattttttc taccctctgt 20100cttggcggga tattggtctt ggtgccagag gcagtgcgcc aaaatccctt tgcattggct 20160gagttcatca gtcaacagaa aattgaaaaa ttgtttcttc ccgttatagc attactacag 20220ttggccgaag ctgtaaatgg gaataaaagc acctccctcg cgctttgcga agttatcact 20280accggggagc agatgcagat cacacctgct gtcgccaacc tctttcagaa aaccggggcg 20340atgttgcata atcactacgg ggcaacagaa tttcaagatg ccaccactca taccctcaag 20400ggcaatccag agggctggcc aacactggtg ccagtgggtc gtccactgca caatgttcaa 20460gtgtatattc tggatgaggc acagcaacct gtacctcttg gtggagaggg tgaattctgt 20520attggtggta ttggactggc tcgtggctat cacaatttgc ctgacctaac gaatgaaaaa 20580tttattccca atccatttgg ggctaatgag aacgctaaaa aactctaccg cacaggggac 20640ttggcacgct acctacccga cggcacgatt gagcatttag gacggataga ccaccaggtt 20700aagatccgag gtttccgcgt ggaattgggg gaaattgagt ccgtgctggc aagtcaccaa 20760gctgtgcgtg aatgtgccgt tgtggcacgg gagattgcag gtcatacaca gttggtaggg 20820tatatcatag caaaggatac acttaatctc agtttcgaca aacttgaacc tatcctgcgt 20880caatattcgg aagcggtgct gccagaatac atgataccca ctcggttcat caatatcagt 20940aatatgccgt tgactcccag tggtaaactt gaccgcaggg cattacctga tcccaaaggc 21000gatcgccctg cattgtctac cccacttgtc aagcctcgta cccagacaga gaaacgttta 21060gcagagattt ggggcagtta tcttgctgta gatattgtgg gaacccacga caatttcttt 21120gatctaggcg gtacgtcact gctattgact caagcgcaca aattcctgtg cgagaccttt 21180aatattaatt tgtccgctgt ctcactcttt caatatccca caattcagac attggcacaa 21240tatattgatt gccaaggaga cacaacctca agcgatacag catccaggca caagaaagta 21300cgtaaaaagc agtccggtga cagcaacgat attgccatca tcagtgtggc aggtcgcttt 21360ccgggtgctg aaacgattga gcagttctgg cataatctct gtaatggtgt tgaatccatc 21420acccttttta gtgatgatga gctagagcag actttgcctg agttatttaa taatcccgct 21480tatgtcaaag caggtgcggt gctagaaggc gttgaattat ttgatgctac cttttttggc 21540tacagcccca aagaagctgc ggtgacagac cctcagcaac ggattttgct agagtgtgcc 21600tgggaagcat ttgaacgggc tggctacaac cccgaaacct atccagaacc agttggtgtt 21660tatgctggtt caagcctgag tacctatctg cttaacaata ttggctctgc tttaggcata 21720attaccgagc aaccctttat tgaaacggat atggagcagt ttcaggctaa aattggcaat 21780gaccggagct atcttgctac acgcatctct tacaagctga atctcaaggg tccaagcgtc 21840aatgtgcaga ccgcctgctc aacctcgtta gttgcggttc acatggcctg tcagagtctc 21900attagtggag agtgtcaaat ggctttagcc ggtggtattt ctgtggttgt accacagaag 21960gggggctatc tctacgaaga aggcatggtt cgttcccagg atggtcattg tcgcgccttt 22020gatgccgaag cccaagggac tatatttggc aatggcggcg gcttggtttt gcttaaacgg 22080ttgcaggatg cactggacga taacgacaac attatggcag tcatcaaagc cacagccatc 22140aacaacgacg gtgcgctcaa gatgggctac acagcaccga gcgtggatgg gcaagctgat 22200gtaattagcg aggcgattgc tatcgctgac atagatgcaa gcaccattgg ctatgtagaa 22260gctcatggca cagccaccca attgggtgat ccgattgaag tagcagggtt agcaagggca 22320tttcagcgta gtacggacag cgtccttggt aaacaacaat gcgctattgg atcagttaaa 22380actaatattg gccacttaga tgaggcggca ggcattgccg gactgataaa ggctgctcta 22440gctctacaat atggacagat tccaccgagc ttgcactatg ccaatcctaa tccacggatt 22500gattttgacg caaccccatt ttttgtcaac acagaactac gcgaatggtc aaggaatggt 22560tatcctcggc gggcgggggt gagttctttt ggtgtgggtg gaactaacag ccatattgtg 22620ctggaggagt cgcctgtaaa gcaacccaca ttgttctctt ctttgccaga acgcagtcat 22680catctgctga cgctttctgc ccatacacaa gaggctttgc atgagttggt gcaacgctac 22740atccaacata acgagacaca ccttgatatt aacttaggcg acctctgttt cacagccaat 22800acgggacgca agcattttga gcatcgccta gcggttgtag ccgaatcaat ccctggctta 22860caggcacaac tggaaactgc acagactgcg atttcagcac agaaaaaaaa tgccccgccg 22920acgatcgcat tcctgtttac aggtcaaggc tcacaataca ttaacatggg gcgcaccctc 22980tacgatactg aatcaacatt ccgtgcagcc cttgaccgat gtgaaaccat tctccaaaat 23040ttagggatcg agtccattct ctccgttatt tttggttcat ctgagcatgg actctcatta 23100gatgacacag cctataccca gcccgcactc tttgccatcg aatacgcgct ctatcaatta 23160tggaagtcgt ggggcatcca gccctcagtg gtgataggtc atagtgtagg tgaatatgtg 23220tccgcttgtg tggcgggagt ctttagctta gaggatgggt tgaaactgat tgcagaacga 23280ggacgactga tacaggcact tcctcgtgat gggagcatgg tttccgtgat ggcaagcgag 23340aagcgtattg cagatatcat tttaccttat gggggacagg tagggatcgc cgcgattaat 23400ggcccacaaa gtgttgtaat ttctgggcaa cagcaagcga ttgatgctat ttgtgccatc 23460ttggaaactg agggcatcaa aagcaagaag ctaaacgtct cccatgcctt ccactcgccg 23520ctagtggaag caatgttaga ctctttcttg caggttgcac aagaggtcac ttactcgcaa 23580cctcaaatca agcttatctc taatgtaacg ggaacattgg caagccatga atcttgtccc 23640gatgaacttc cgatcaccac cgcagagtat tgggtacgtc atgtgcgaca gcccgtccgg 23700tttgcggcgg gaatggagag ccttgagggt caaggggtaa acgtatttat agaaatcggt 23760cctaaacctg ttcttttagg catgggacgc gactgcttgc ctgaacaaga gggactttgg 23820ttgcctagtt tgcgcccaaa acaggatgat tggcaacagg tgttaagtag tttgcgtgat 23880ctatacttag caggtgtaac cgtagattgg agcagtttcg atcaggggta tgctcgtcgc 23940cgtgtgccac taccgactta tccttggcag cgagagcggc attgggtaga gccaattatt 24000cgtcaacggc aatcagtatt acaagccaca aataccacca agctaactcg taacgccagc 24060gtggcgcagc atcctctgct tggtcaacgg ctgcatttgt cgcggactca agagatttac 24120tttcaaacct tcatccactc cgacttccca atatgggttg ctgatcataa agtatttgga 24180aatgtcatca ttccgggtgt cgcctatttt gagatggcac tggcagcagg gaaggcactt 24240aaaccagaca gtatattttg gctcgaagat gtatccatcg cccaagcact gattattccc 24300gatgaagggc aaactgtgca aatagtatta agcccacagg aagagtcagc ttattttttt 24360gaaatcctct ctttagaaaa agaaaactct tgggtgcttc atgcctctgg taagctagtc 24420gcccaagagc aagtgctaga aaccgagcca attgacttga ttgcgttaca ggcacattgt 24480tccgaagaag tgtcagtaga tgtgctatat caggaagaaa tggcgcgccg gctggatatg 24540ggtccaatga tgcgtggggt gaagcagctt tggcgttatc cgctctcctt tgccaaaagt 24600catgatgcga tcgcactcgc caaggtcagc ttgccagaaa tcttgcttca tgagtccaat 24660gcctaccaat tccatcctgt aatcttggat gcggggctgc aaatgataac ggtctcttat 24720cctgaagcaa accaaggcca gacttatgta cctgttggta tagagggtct acaagtctat 24780ggtcgtccca gttcagaact ttggtgtcgc gcccaatatc ggcctccttt ggatacagat 24840caaaggcagg gtattgattt gctgccaaag aaattgattg cagacttgca tctatttgat 24900acccagggtc gtgtggttgc catcatgttt ggtgtgcaat ctgtccttgt gggacgggaa 24960gcaatgttgc gatcgcaaga tacttggcga aattggcttt atcaagtcct gtggaaacct 25020caagcctgtt

ttggactttt accgaattac ctgccaaccc cagataagat tcggaaacgc 25080ctggaaacaa agttagcgac attgatcatc gaagctaatt tggcgactta tgcgatcgcc 25140tatacccaac tggaaaggtt aagtctagct tacgttgtgg cggctttccg acaaatgggc 25200tggctgtttc aacccggtga gcgtttttcc accgcccaga aggtatcagc gttaggaatc 25260gttgatcaac atcggcaact attcgctcgt ttgctcgaca ttctagccga agcagacata 25320ctccgcagcg aaaacttgat gacgatatgg gaagtcattt catacccgga aacgattgat 25380atacaggtac ttcttgacga cctcgaagcc aaagaagcag aagccgaagt cacactggtt 25440tcccgttgca gtgcaaaatt ggccgaagta ttacaaggaa aatgtgaccc catacagttg 25500ctctttcccg caggggacac aacaacgtta agcaaactct atcgtgaagc cccagttttg 25560ggtgttacta atactctagt ccaagaagcg cttctttccg ccctggagca gttgccgccg 25620gaacgtggtt ggcgaatttt agagattggt gctggaacag gtggaaccac agcctacttg 25680ttaccgcatc tgcctgggga tcagacaaaa tatgtcttta ccgatattag tgcctttttt 25740cttgccaaag cggaagagcg ttttaaagat tacccgtttg tacgttatca ggtattagat 25800atcgaacaag caccacaggc gcaaggattt gaaccccaaa tatacgattt aatcgtagca 25860gcggatgtct tgcatgctac tagtgacctg cgtcaaactc ttgtacatat ccggcaatta 25920ttagcgccgg gcgggatgtt gatcctgatg gaagacagcg aacccgcacg ctgggctgat 25980ttaacctttg gcttaacaga aggctggtgg aagtttacag accatgactt acgccccaac 26040catccgctat tgtctcctga gcagtggcaa atcttgttgt cagaaatggg atttagtcaa 26100acaaccgcct tatggccaaa aatagatagc ccccataaat tgccacggga ggcggtgatt 26160gtggcgcgta atgaaccagc catcagaaaa ccccgaagat ggctgatctt ggctgacgag 26220gagattggtg gactactagc caaacagcta cgtgaagaag gagaagattg tatactcctc 26280ttgccagggg aaaagtacac agagagagat tcacaaacgt ttacaatcaa tcctggagat 26340attgaagagt ggcaacagtt attgaaccga gtaccgaaca tacaagaaat tgtacattgt 26400tggagtatgg tttccactga cttagataga gccactattt tcagttgcag cagtacgctg 26460catttagttc aagcattagc aaactatcca aaaaaccctc gcttgtcact tgtcacccta 26520ggcgcacaag ccgttaacga acatcatgtt caaaatgtag ttggagcagc cctctggggc 26580atgggaaagg taattgcact cgaacaccca gagctacaag tagcacaaat ggatttagac 26640ccgaatggga aggttaaggc gcaagtagaa gtgcttaggg atgaacttct cgccagaaaa 26700gaccctgcat cagcaatgtc tgtgcctgat ctgcaaacac gacctcatga aaagcaaata 26760gcctttcgtg agcaaacacg ttatgtggca agactttcgc ccttagaccg ccccaatcct 26820ggagagaaag gcacacaaga ggctcttacc ttccgtgatg atggcagcta tctgattgct 26880ggtggtttag gcggactggg gttagtggtg gctcgttttc tggttacaaa tggggctaaa 26940taccttgtgc tagtcggacg acgtggtgcg agggaggaac agcaagctca attaagcgaa 27000ctagagcaac tcggagcttc cgtgaaagtt ttacaagccg atattgctga tgcagaacaa 27060ctagcccaag cactttcagc agtaacctac ccaccattac ggggtgttat tcatgcggca 27120ggtacattga acgatgggat tctacagcag caaagttggc aagcctttaa agaagtgatg 27180aatcccaagg tagcaggtgc gtggaaccta catatactga caaaaaatca gcctttagac 27240ttctttgtcc tgttctcctc cgccacctct ttgttaggta acgctggaca agccaatcac 27300gccgccgcaa atgctttcct tgatgggtta gcctcctatc gtcgtcactt aggactaccg 27360agcctctcga ttaattgggg gacatggagc gaagtgggaa ttgcggctcg acttgaacta 27420gataagttgt ccagcaaaca gggagaggga accattacgc taggacaggg cttacaaatt 27480cttgagcagt tgctcaaaga cgagaatggg gtgtatcaag tgggtgtcat gcctatcaac 27540tggacacaat tcttagcaag gcaattgact ccgcagccgt tcttcagcga tgccatgaag 27600agtattgaca cctctgtagg taaactaacc ttgcaggagc gggactcttg cccccaaggt 27660tacgggcata atattcgaga gcaattagag aacgctccgc ccaaagaggg tctgactctc 27720ttgcaggctc atgttcggga gcaggtttcc caagttttgg ggatagacac gaagacatta 27780ttggcagaac aagacgtggg tttctttacc ctggggatgg attcgctgac ctctgtcgag 27840ttaagaaaca ggttacaagc cagtttgggc tgctctcttt cttccacttt ggcttttgac 27900tatccaacac aacaggctct tgtgaattat cttgccaatg aattgctggg aacccctgag 27960cagctacaag agcctgaatc tgatgaagaa gatcagatat cgtcaatgga tgacatcgtg 28020cagttgctgt ccgcgaaact agagatggaa atttaagccc atggatgaaa aactaagaac 28080atacgaacga ttaatcaagc aatcctatca caagatagag gctctggaag ctgaagttaa 28140caggttgaag caaacccaat gtgaacctat cgccatcgtc ggcatgggct gtcgttttcc 28200tggtgcgaat agtccagaag cgttttggca gttgttgtgt gatggggttg atgctattcg 28260tgagatacca aaaaatcgat gggttgttga tgcctacata gatgaaaatt tggaccgcgc 28320agacaagaca tcaatgcgat ttggcgggtt tgtcgagcaa cttgagaagt ttgatgccca 28380attctttggc atatcaccgc gagaagcggt ttctcttgac cctcagcaac gtttgttatt 28440agaagtaagt tgggaagcac tggaaaatgc agcggtgata ccaccttcgg caacgggcgt 28500attcgtcggt attagtaacc ttgattatcg tgaaacgctc ttgaagcaag gagcaattgg 28560tacttatttt gcttcgggta atgcccatag cacagccagt ggtcgcttgt cttactttct 28620cggtctgaca ggcccctgtc tctcgataga tacagcttgt tcttcgtcgt tggtcgctgt 28680acatcagtca ctgataagtc tgcgtcagcg agaatgtgac ttagcgttgg ttgggggagt 28740ccatcggctg atagccccag aggaaagtgt ctcgttagca aaagcccata tgttatctcc 28800cgatggtcgt tgcaaagtct ttgatgcgtc ggcaaacggg tatgtccgag ccgaaggatg 28860tggcatgata gtcctcaaac gattatcgga cgcgcaagct gatggggata aaatcttggc 28920gttgattcgc gggtcagcca taaatcaaga cggtcgcacg agtggcttga ccgttccaaa 28980tggtccccaa caagccgacg tgattcgcca agccctcgcc aatagtggca taagaccaga 29040acaagttaac tatgtagaag ctcatggcac agggacttcc ctaggagacc cgattgaggt 29100cggcgcgttg ggaacgatct ttaatcaacg ctcccaacct ttaattattg gttcagttaa 29160aacaaatatt gggcatctag aagcagcagc agggattgct ggactgatta aagtcgtcct 29220tgccatgcag catggagaaa ttccacctaa tttacacttt caccagccca atcctcgcat 29280taactgggat aaattgccaa tcaggatccc cacagaacga acagcttggc ctactggcga 29340tcgcatcgca gggataagtt ctttcggctt tagtggcact aattctcatg tcgtgttaga 29400ggaagcccca aaaatagagc cgtctacttt agagattcat tcaaagcagt atgtttttac 29460cttatcagca gcgacacctc aagcactaca agaacttact cagcgttatg taacttatct 29520cactgaacac ttacaagaga gtctggcgga tatttgcttt acagccaaca cagggcgcaa 29580acactttaga catcgctttg cagtagtagc agagtctaaa acccagttgc gccaacaatt 29640ggaaacgttt gcccaatcgg gagaggggca ggggaagagg acatctctct caaaaatagc 29700ttttctcttt acaggtcaag gctcacagta tgtggggatg gggcaagaac tttatgagag 29760ccaacccacc ttccggcaaa ccattgaccg atgtgatgag attcttcgtt cactgttggg 29820caaatcaatc ctctcaatac tctatcccag ccaacaaatg ggattggaaa cgccatccca 29880aattgatgaa accgcctata ctcaacccac tcttttttct cttgaatatg cactggcgca 29940gttgtggcgc tcctggggta ttgagcctga tgtggtgatg gggcatagtg tgggagaata 30000tgtggccgct tgtgtggcgg gtgtcttttc tttagaggat ggactcaaac taattgctga 30060aagaggccgt ctgatgcaag aattgcctcc cgatggggcg atggtttcag ttatggccaa 30120taaatcgcgc atagagcaag caattcaatc tgtcagccga gaggtttcta ttgcggccat 30180caatggacct gagagtgtgg ttatctctgg taaaagggag atattacaac agattaccga 30240acatctggtt gccgaaggca ttaagacacg ccaactgaag gtctctcatg cctttcactc 30300accattgatg gagccaatat taggtcagtt ccgccgagtt gccaatacca tcacctatcg 30360gccaccgcaa attaaccttg tctcaaatgt cacaggcgga caggtgtata aagaaatcgc 30420tactcccgat tattgggtga gacatctgca agagactgtc cgttttgcgg atggggttaa 30480ggtgttacat gaacagaatg tcaatttcat gctcgaaatt ggtcccaaac ccacactgct 30540gggcatggtt gagttacaaa gttctgagaa tccattttct atgccaatga tgatgcccag 30600tttgcgtcag aatcgtagcg actggcagca gatgttggag agcttgagtc aactctatgt 30660tcatggtgtt gagattgact ggatcggttt taataaagac tatgtgcgac ataaagttgt 30720cctgccgaca tacccatggc agaaggagcg ttactgggta gaattggatc aacagaagca 30780cgccgctaaa aatctacatc ctctactgga caggtgcatg aagctgcctc gtcataacga 30840aacaattttt gagaaagaat ttagtctaga gacattgccc tttcttgctg actatcgcat 30900ttatggttca gttgtgtcgc caggtgcaag ttatctatca atgatactaa gtattgccga 30960gtcgtatgca aatggtcatt tgaatggagg gaatagtgca aagcaaacca cttatttact 31020aaaggatgtc acattcccag tacctcttgt gatctctgat gaggcaaatt acatggtgca 31080agttgcttgt tctctctctt gtgctgcgcc acacaatcgt ggcgacgaga cgcagtttga 31140attgttcagt tttgctgaga atgtacctga aagtagcagt ataaatgctg attttcagac 31200acccattatt catgcaaaag ggcaatttaa gcttgaagat acagcacctc ctaaagtgga 31260gctagaagaa ctacaagcgg gttgtcccca agaaattgat ctcaaccttt tctatcaaac 31320attcacagac aaaggttttg tttttggatc tcgttttcgc tggttagaac aaatctgggt 31380gggcgatgga gaagcattgg cgcgtctgcg acaaccggaa agtattgaat cgtttaaagg 31440atatgtgatt catcccggtt tgttggatgc ctgtacacaa gtcccatttg caatttcgtc 31500tgacgatgaa aataggcaat cagaaacgac aatgcccttt gcgctgaatg aattacgttg 31560ttatcagcct gcaaacggac aaatgtggtg ggttcatgca acagaaaaag atagatatac 31620atgggatgtt tctctgtttg atgagagcgg gcaagttatt gcggaattta taggtttaga 31680agttcgtgct gctatgcccg aaggcttact aagggcagac ttttggcata actggctcta 31740tacagtgaat tggcgatcgc aacctctaca aatcccagag gtgctggata ttaataagac 31800aggtgcagaa acatggcttc tttttgcaca accagaggga ataggagcgg acttagccga 31860atatttgcag agccaaggaa agcactgtgt ttttgtagtg cctgggagtg agtatacagt 31920gaccgagcaa cacattggac gcactggaca tcttgatgtg acgaaactga caaaaattgt 31980cacgatcaat cctgcttctc ctcatgacta taaatatttt ttagaaactc tgacggacat 32040tagattacct tgtgaacata tactctattt atggaatcgt tatgatttaa caaatacttc 32100taatcatcgg acagaattga ctgtaccaga tatagtctta aacttatgta ctagtcttac 32160ttatttggta caagccctta gccacatggg tttttccccg aaattatggc taattacaca 32220aaatagtcaa gcggttggta gtgacttagc gaatttagaa atcgaacaat ccccattatg 32280ggcattgggt cgaagcatcc gcgccgaaca ccctgaattt gattgccgtt gtttagattt 32340tgacacgctc tcaaatatcg caccactctt gttgaaagag atgcaagcta tagactatga 32400atctcaaatt gcttaccgac aaggaacgcg ctatgttgca cgactaattc gtaatcaatc 32460agaatgtcac gcaccgattc aaacaggaat ccgtcctgat ggcagctatt tgattacagg 32520tggattaggc ggtctaggat tgcaggtagc actcgccctt gcggacgctg gagcaagaca 32580cttgatcctc aatagtcgcc gtggtacggt ctccaaagaa gcccagttaa ttattgaccg 32640actacgccaa gaggatgtta gggttgattt gattgcggca gatgtctctg atgcggcaga 32700tagcgaacga ctcttagtag aaagtcagcg caagacctct cttcgaggga ttgtccatgt 32760tgcgggagtc ttggatgatg gcatcctgct ccaacaaaat caagagcgtt ttgaaaaagt 32820gatggcggct aaggtacgcg gagcttggca tctggaccaa cagagccaaa ccctcgattt 32880agatttcttt gttgcgttct catctgttgc gtcgctcata gaagaaccag gacaagccaa 32940ttacgccgca gcgaatgcgt ttttggattc attaatgtat tatcgtcaca taaagggatc 33000taatagcttg agtatcaact ggggggcttg ggcagaagtc ggcatggcag ccaatttatc 33060atgggaacaa cggggaatcg cggcaatttc tccaaagcaa gggaggcata ttctcgtcca 33120acttattcaa aaacttaatc agcatacaat cccccaagtt gctgtacaac cgaccaattg 33180ggctgaatat ctatcccatg atggcgtgaa tatgccattc tatgaatatt ttacacacca 33240cttgcgtaac gaaaaagaag ccaaattgcg gcaaacagca ggcagcacct cagaggaagt 33300cagtctgcgg caacagcttc aaacactctc agagaaagac cgggatgccc ttttgatgga 33360acatcttcaa aaaactgcga tcagagttct cggtttggca tctaatcaaa aaattgatcc 33420ctatcaggga ttgatgaata tgggactaga ctctttgatg gcggttgaat ttcggaatca 33480cttgatacgt agtttagaac gccctctgcc agccactctg ctctttaatt gcccaacact 33540tgattcattg catgattacc tagtcgcaaa aatgtttgat gatgcccctc agaaggcaga 33600gcaaatggca caaccaacaa cactgacagc acacagcata tcaatagaat ccaaaataga 33660tgataacgaa agcgtggatg acattgcaca aatgctggca caagcactca atatcgcctt 33720tgagtagcaa tgggcagccc ttaacctttc aaggtgacta atcaatagac ctcttgcaca 33780attgtttctg tggtacaata agtggtttta ggttttatgt atatttgggt gttgttgcga 33840tagctacgct cgccgaaggc atcacaaatt caaagatagg cgtgtgattc taacttttag 33900cttaacgggt gacaaggcgg ctaaagagct tgtttcataa gggatagagc ctgaaagccc 33960cgttgaaaaa agaggcgttt atgaggcttg agattgatta aattcagagc taaatcagcc 34020cataattcca taccataaat ccatagttgt ccgtagagac caaagctaaa atcactttga 34080cgtgggtact tgtcctgatg ttgttgaatc ccacattcag catgagtaaa tatactcaaa 34140atatttttcc cagcaggtta agtgttctaa tcctaagtct gatatcttat ttttgataag 34200ggacttaccg cgtaatagtt aaatttttgt atagcctaat tttacttggt ttaaggctct 34260tttttgctct tttggtgaat tattcaggat aatcaaagat gagtcagccc aattatggca 34320ttttgatgaa aaatgcgttg aacgaaataa atagcctacg atcgcaacta gctgcggtag 34380aagcccaaaa aaatgagtct attgccattg ttggtatgag ttgccgtttt ccaggcggtg 34440caactactcc agagcgtttt tgggtattac tgcgcgaggg tatatcagcc attacagaaa 34500tccctgctga tcgctgggat gttgataaat attatgatgc tgaccccaca tcgtccggta 34560aaatgcatac tcgttacggc ggttttctga atgaagttga tacatttgag ccatcattct 34620ttaatattgc tgcccgtgaa gccgttagca tggatccaca gcaacgcttg ctacttgaag 34680tcagttggga agctctggaa tccggtaata ttgttcctgc aactcttttt gatagttcca 34740ctggtgtatt tatcggtatt ggtggtagca actacaaatc tttaatgatc gaaaacagga 34800gtcggatcgg gaaaaccgat ttgtatgagt taagtggcac tgatgtgagt gttgctgccg 34860gcaggatatc ctatgtcctg ggtttgatgg gtcccagttt tgtgattgat acagcttgtt 34920catcttcttt ggtctcagtt catcaagcct gtcagagtct gcgtcagaga gaatgtgatc 34980tagcactagc tggtggagtc ggtttactca ttgatccaga tgagatgatt ggtctttctc 35040aaggggggat gctggcacct gatggtagtt gtaaaacatt tgatgccaat gcaaatggct 35100atgtgcgagg cgaaggttgt gggatgattg ttctaaaacg tctctcggat gcaacagccg 35160atggggataa tattcttgcc atcattcgtg ggtctatggt taatcatgat ggtcatagca 35220gtggtttaac tgctccaaga ggccccgcac aagtctctgt cattaagcaa gccttagata 35280gagcaggtat tgcaccggat gccgtaagtt atttagaagc ccatggtaca ggcacacccc 35340ttggtgatcc tatcgagatg gattcattga acgaagtgtt tggtcggaga acagaaccac 35400tttgggtcgg ctcagttaag acaaatattg gtcatttaga agccgcgtcc ggtattgcag 35460ggctgattaa ggttgtcttg atgctaaaaa acaagcagat tcctcctcac ttgcatttca 35520agacaccaaa tccatatatt gattggaaaa atctcccggt cgaaattccg accacccttc 35580atgcttggga tgacaagaca ttgaaggaca gaaagcgaat tgcaggggtt agttctttta 35640gtttcagtgg tactaacgcc cacattgtat tatctgaagc cccatctagc gaactaatta 35700gtaatcatgc ggcagtggaa agaccatggc acttgttaac ccttagtgct aagaatgagg 35760aagcgttggc taacttggtt gggctttatc agtcatttat ttctactact gatgcaagtc 35820ttgccgatat atgctacact gctaatacgg cacgaaccca tttttctcat cgccttgctc 35880tatcggctac ttcacacatc caaatagagg ctcttttagc cgcttataag gaagggtcgg 35940tgagtttgag catcaatcaa ggttgtgtcc tttccaacag tcgtgcgccg aaggtcgctt 36000ttctctttac aggtcaaggt tcgcaatatg tgcaaatggc tggagaactt tatgagaccc 36060agcctacttt ccgtaattgc ttagatcgct gtgccgaaat cttgcaatcc atcttttcat 36120cgagaaacag cccttgggga aacccactgc tttcggtatt atatccaaac catgagtcaa 36180aggaaattga ccagacggct tatacccaac ctgccctttt tgctgtagaa tatgccctag 36240cacagatgtg gcggtcgtgg ggaatcgagc cagatatcgt aatgggtcat agcataggtg 36300aatatgtggc agcttgtgtg gcggggatct tttctctgga ggatggtctc aaacttgctg 36360ccgaaagagg ccgtttgatg caggcgctac cacaaaatgg cgagatggtt gctatatcgg 36420cctcccttga ggaagttaag ccggctattc aatctgacca gcgagttgtg atagcggcgg 36480taaatggacc acgaagtgtc gtcatttcgg gcgatcgcca agctgtgcaa gtcttcacca 36540acaccctaga agatcaagga atccggtgca agagactgtc tgtttcacac gctttccact 36600ctccattgat gaaaccaatg gagcaggagt tcgcacaggt ggccagggaa atcaactata 36660gtcctccaaa aatagctctt gtcagtaatc taaccggcga cttgatttca cctgagtctt 36720ccctggagga aggagtgatc gcttcccctg gttactgggt aaatcattta tgcaatcctg 36780tcttgttcgc tgatggtatt gcaactatgc aagcgcagga tgtccaagtc ttccttgaag 36840ttggaccaaa accgacctta tcaggactag tgcaacaata ttttgacgag gttgcccata 36900gcgatcgccc tgtcaccatt cccaccttgc gccccaagca acccaactgg cagacactat 36960tggagagttt gggacaactg tatgcgcttg gtgtccaggt aaattgggcg ggctttgata 37020gagattacac cagacgcaaa gtaagcctac ccacctatgc ttggaagcgt caacgttatt 37080ggctagagaa acagtccgct ccacgtttag aaacaacaca agttcgtccc gcaactgcca 37140ttgtagagca tcttgaacaa ggcaatgtgc cgaaaatcgt ggacttgtta gcggcgacgg 37200atgtactttc aggcgaagca cggaaattgc tacccagcat cattgaacta ttggttgcaa 37260aacatcgtga ggaagcgaca cagaagccca tctgcgattg gctttatgaa gtggtttggc 37320aaccccagtt gctgacccta tctaccttac ctgctgtgga aacagagggt agacaatggc 37380tcatcttcgc cgatgctagt ggacacggtg aagcacttgc ggctcaatta cgtcagcaag 37440gggatataat tacgcttgtc tatgctggtc taaaatatca ctcggctaat aataaacaaa 37500ataccggggg ggacatccca tattttcaga ttgatccgat ccaaagggag gattatgaaa 37560ggttgtttgc tgctttgcct ccactgtatg gtattgttca tctttggagt ttagatatac 37620ttagcttgga caaagtatct aacctaattg aaaatgtaca attaggtagt ggcacgctat 37680taaatttaat acagacagtc ttgcaacttg aaacgcccac ccctagcttg tggctcgtga 37740caaagaacgc gcaagctgtg cgtaaaaacg atagcctagt cggagtgctt cagtcaccct 37800tatggggtat gggtaaggtg atagccttag aacaccctga actcaactgt gtatcaatcg 37860accttgatgg tgaagggctt ccagatgaac aagccaagtt tctggcggct gaactccgcg 37920ccgcctccga gttcagacat accaccattc cccacgaaag tcaagttgct tggcgtaata 37980ggactcgcta tgtgtcacgg ttcaaaggtt atcagaagca tcccgcgacc tcatcaaaaa 38040tgcctattcg accagatgcc acttatttga tcacgggcgg ctttggtggt ttgggcttgc 38100ttgtggctcg ttggatggtt gaacaggggg ctacccatct atttctgatg ggacgcagcc 38160aacccaaacc agccgcccaa aaacaactgc aagagatagc cgcgctgggt gcaacagtga 38220cggtggtgca agccgatgtt ggcatccgct cccaagtagc caatgtgttg gcacagattg 38280ataaggcata tcctttggct ggtattattc atactgccgg tgtattagac gacggaatct 38340tattgcagca aaattgggcg cgttttagca aggtgttcgc ccccaaacta gagggagctt 38400ggcatctaca tacactgact gaagagatgc cgcttgattt ctttatttgt ttttcctcaa 38460cagcaggatt gctgggcagt ggtggacaag ctaactatgc tgctgccaat gcctttttag 38520atgcctttgc ccatcatcgg cgaatacaag gcttgccagc tctctcgatt aactgggacg 38580cttggtctca agtgggaatg acggtacgtc tccaacaagc ttcttcacaa agcaccacag 38640ttgggcaaga tattagcact ttggaaattt caccagaaca gggattgcaa atctttgcct 38700atcttctgca acaaccatcc gcccaaatag cggccatttc taccgatggg cttcgcaaga 38760tgtacgacac aagctcggcc ttttttgctt tacttgatct tgacaggtct tcctccacta 38820cccaggagca atctacactt tctcatgaag ttggccttac cttactcgaa caattgcagc 38880aagctcggcc aaaagagcga gagaaaatgt tactgcgcca tctacagacc caagttgctg 38940cggtcttgcg tagtcccgaa ctgcccgcag ttcatcaacc cttcactgac ttggggatgg 39000attcgttgat gtcacttgaa ttgatgcggc gtttggaaga aagtctgggg attcagatgc 39060ctgcaacgct tgcattcgat tatcctatgg tagaccgttt ggctaagttt atactgactc 39120aaatatgtat aaattctgag ccagatacct cagcagttct cacaccagat ggaaatgggg 39180aggaaaaaga cagtaataag gacagaagta ccagcacttc cgttgactca aatattactt 39240ccatggcaga agatttattc gcactcgaat ccttactaaa taaaataaaa agagatcaat 39300aatagagctg ttgggaaata aaagcatatt tccggatgac agaacttccc ccatcccgat 39360tgaatttatg ctgcatctaa atagaagttc catagccctg cactgaccaa catcaattga 39420tcatcaaaat cggtcacacg attcctatat gtgggataaa atttgcagta cagcaggata 39480taaaatagtt tttcctctat acttctgagt gtaggcttgc gtccgccccc gggcgcacgt 39540ttgcggtttg ctaaggagtt gaacacggtg cgttcatagg tatcagcaaa ctgagataac 39600agctcgttga atgcttggcg gttaagtcca gtcattgctc gtagcagtcg ctcttgattc 39660aggatgcggt ctaagttcaa cattaatgtc accctacttg tctgcttgat tattatccct 39720tattttccaa caactctatt atagcttatc ttattttgga gtttaactac atgaaaatcg 39780ctgtaaagac tcctactgag tgaaagtgaa cttctttccc acgtattcga gtagctgttg 39840taagctggcc tcgatggaaa gttccgaagt ttccaccagt aaatctggtg ttctcggtgg 39900ttcgtaggga gcgctaattc ccgtaaaaga ctcaatttct ccacggcgtg cttttgcata 39960gagacccttg gggtcacgtt gttcacaaat ttccatcgga gttgcaatat atacttcatg 40020aaacagatct ccggacagaa tacggatttg ctcccggtct ttcctgtaag gtgaaatgaa 40080agcagtaatc

actaaacaac ccgaatccgc aaaaagtttg gccacctcgc caatacgacg 40140aatattttcc gcacgatcag cagcagaaaa tcccaagtca gcacataatc catgacggat 40200attgtcacca tcaaggacaa aagtatacca acctttctgg aacaaaatcc gctctaattc 40260tagagccaat gttgttttac ctgatcctga taatccagtg aaccatagaa ttccatttcg 40320gtgaccattc tttaaacaac gatcaaatgg ggacacaaga tgttttgtat gttgaatatt 40380gcttgatttc atatctatga taaatatgat aaaagtgatt ggccaaacag aactgctcac 40440ccaataatat agttaaaggt tattttttca aaaactcctt ctaaattata gctcacaatt 40500atgcctaaat actttaatac tgctggaccc tgtaaatccg aaatccacta tatgctctct 40560cccacagctc gactaccgga tttgaaagca ctaattgacg gagaaaacta ctttataatt 40620cacgcgccgc gacaagtcgg caaaactaca gctatgatag ccttagcacg agaattgact 40680gatagtggaa aatataccgc agttattctt tccgttgaag tgggatcagt attctcccat 40740aatccccagc aagcggagca ggttatttta gaagaatgga aacaggcaat caaattttat 40800ttacccaaag aactacaacc atcctattgg ccagagcgtg aaacagactc aggaataggc 40860aaaactttaa gtgagtggtc cgcacaatct ccaagacctc ttgtaatctt tttacatgaa 40920atcgattccc taacagatga agctttaatc ctaattttaa gacaattacg ctcaggtttt 40980ccccgtcgtc ctcggggatt tccccattcg gtggggttaa ttggtatgcg ggatgtgcgg 41040gactataagg ttaaatctgg tggaagtgaa cgactgaata cgtcaagtcc tttcaatatc 41100aaagcggaat ccttgacttt aagtaatttc actctgtcag aggtggaaga actttactta 41160caacatacgc aagctacagg acaaattttt accccggaag caattaaaca agcattttat 41220ttaaccgatg ggcaaccatg gttagtaaac gccctagctc gtcaagccac tcaggtgtta 41280gtgaaagata ttactcaacc cattaccgct gaagtaatta accaagccaa agaagttctg 41340attcagcgcc aggataccca tttggatagt ttggcagagc gcttacggga agatcgggtc 41400aaagccatta ttcaacctat gttagctgga tcggacttac cagatacccc agaggatgat 41460cgccgtttct tgctagattt aggcttggta aagcgcagtc ccttgggagg actaaccatt 41520gccaatccca tttaccagga ggtgattcct cgtgttttgt cccagggtag tcaggatagt 41580ctaccccaga ttcaacctac ttggttaaat actgataata ctttaaatcc tgacaaactc 41640ttaaatgctt tcctagagtt ttggcgacaa catggggaac cattactcaa aagtgcgcct 41700tatcatgaaa ttgctcccca tttagttttg atggcgtttt tacatcgggt agtgaatggt 41760ggtggcactt tagaacggga atatgccgtt ggttctggaa gaatggatat ttgtttacgc 41820tatggcaagg tagtgatggg catagagtta aaggtttggg ggggaaaatc ggatccgtta 41880acgaagggtt tgacccaatt ggataaatat ctgggtgggt taggattaga tagaggttgg 41940ttagtaattt ttgatcaccg tccgggatta ccacccatgg gtgagaggat tagtatggaa 42000caggccatta gtccagaggg aagaaccatt acagtgattc gtagctagag cgttagatat 42060cagatgattg aacctcaatt attgtgcaac gccacatttt ctttccaaag atgtatgtta 42120aactctagta aactctaatt aggtcgagaa agagat 42156815631DNACylindrospermopsis raciborskii AWT205 81atgcggtcta agttcaacat taatgtcacc ctacttgtct gcttgattat tatcccttat 60tttccaacaa ctctaatgaa agtacctata acagcaaacg aagatgcagc tacattactt 120cagcgtgttg gactgtccct aaaggaagca caccaacaac ttgaggcaat gcaacgccga 180gcgcacgaac cgatcgcaat tgtggggctg gggctgcggt ttccgggagc tgattcacca 240cagacattct ggaaactact tcagaatggt gttgatatgg tcaccgaaat ccctagcgat 300cgctgggcag ttgatgaata ctatgatccc caacctgggt gtccaggcaa aatgtatatt 360cgtgaagccg cttttgttga tgcagtggat aaattcgatg cctcgttttt tgatatttcg 420ccacgtgaag cggccaatat agatccccag catagaatgt tgctggaggt agcttgggag 480gcactcgaaa gggctggcat tgctcccagc caattgatgg atagccaaac gggggtattt 540gtcgggatga gcgaaaatga ctattatgct cacctagaaa atacagggga tcatcataat 600gtctatgcgg caacgggcaa tagcaattac tatgctccgg ggcgtttatc ctatctattg 660gggcttcaag gacctaacat ggtcgttgat agtgcctgtt cctcctcctt agtggctgta 720catcttgcct gtaatagttt gcggatggga gaatgtgatc tggcactggc tggtggcgtt 780cagcttatgt taatcccaga ccctatgatt gggactgccc agttaaatgc ctttgcgacc 840gatggtcgta gtaaaacatt tgacgctgcc gccgatggct atggacgcgg cgaaggttgt 900ggcatgattg tacttaaaag aataagtgac gcgatcgtgg cagacgatcc aattttagcc 960gtaatccggg gtagtgcagt caatcatggc gggcgtagca gtggtttaac tgcccctaat 1020aagctgtctc aagaagcctt actgcgtcag gcactacaaa acgccaaggt tcagccggaa 1080gcagtcagtt atatcgaagc ccatggcaca gggacacaac tgggcgaccc gattgaggtg 1140ggagcattaa cgaccgtctt tggatcttct cgttcagaac ccttgtggat tggctctgtc 1200aaaactaata tcggacacct agaaccagcc gctggtattg cggggttaat aaaagtcatt 1260ttatcattac aagaaaaaca gattcctccc agtctccatt ttcaaaaccc taatcccttc 1320attgattggg aatcttcgcc agttcaagtg ccgacacagt gtgtaccctg gactgggaaa 1380gagcgcgtcg ctggagttag ctcgtttggt atgagcggta caaactgtca tctagttgtc 1440gcagaagcac ctgtccgcca aaacgaaaaa tctgaaaatg caccggagcg tccttgtcac 1500attctgaccc tttcagccaa aaccgaagcg gcactcaacg cattggtagc ccgttacatg 1560gcatttctca gggaagcgcc cgccatatcc ctagctgatc tttgttatag tgccaatgtc 1620gggcgtaatc tttttgccca tcgcttaagt tttatctccg agaacatcgc gcagttatca 1680gaacaattag aacactgccc acagcaggct acaatgccaa cgcaacataa tgtgatacta 1740gataatcaac tcagccctca aatcgctttt ctgtttactg gacaaggttc gcagtacatc 1800aacatggggc gtgagcttta cgaaactcag cccaccttcc gtcggattat ggacgaatgt 1860gacgacattc tgcatccatt gttgggtgaa tcaattctga acatactcta cacttcccct 1920agcaaactta atcaaaccgt ttatacccaa cctgcccttt ttgcttttga atatgcccta 1980gcaaaactat ggatatcatg gggtattgag cctgatgtcg tactgggtca cagcgtgggt 2040gaatatgtag ccgcttgtct ggcgggtgtc tttagtttag aagatgggtt aaaactcatt 2100gcatctcgtg gatgtttgat gcaagcctta ccgccgggga aaatgcttag tatcagaagc 2160aatgagatcg gagtgaaagc gctcatcgcg ccttatagtg cagaagtatc aattgcagca 2220atcaatggac agcaaagcgt ggtgatctcc ggcaaagctg aaattataga taatttagca 2280gcagagtttg catcggaagg catcaaaaca cacctaatta cagtctccca cgctttccac 2340tcgccaatga tgacccccat gctgaaagca ttccgagacg ttgccagcac catcagctat 2400aggtcaccca gtttatcact gatttctaac ggtacagggc aattggcaac aaaggaggtt 2460gctacacctg attattgggt gcgtcatgtc cattctaccg tccgttttgc cgatggtatt 2520gccacattgg cagaacagaa tactgacatc ctcctagaag taggacccaa accaatattg 2580ttgggtatgg caaagcagat ttatagtgaa aacggttcag ctagtcatcc gctcatgcta 2640cccagtttgc gtgaagatgg caacgattgg cagcagatgc tttctacttg tggacaactt 2700gtagttaatg gagtcaagat tgactgggcg ggttttgaca aggattattc acgacacaaa 2760atattgttgc ccacctatcc gtttcagaga gaacgatatt ggattgaaag ctccgtcaaa 2820aagccccaaa aacaggagct gcgcccaatg ttggataaga tgatccggct accatcagag 2880aacaaagtgg tgtttgaaac cgagtttggc gtgcgacaga tgcctcatat ctccgatcat 2940cagatatacg gtgaagtcat tgtaccgggg gcagtattag cttccttaat cttcaatgca 3000gcgcaggttt tatacccaga ctatcagcat gaattaactg atattgcttt ttatcagcca 3060attatctttc atgacgacga tacggtgatc gtgcaggcga ttttcagccc tgataagtca 3120caggagaatc aaagccatca aacatttcca cccatgagct tccagattat tagcttcatg 3180ccggatggtc ccttagagaa caaaccgaaa gtccatgtca cagggtgtct gagaatgttg 3240cgcgatgccc aaccgccaac actctccccg accgaaatac gtcagcgctg tccacatacc 3300gtaaatggtc atgactggta caatagctta gtcaaacaaa aatttgaaat gggtccttcc 3360tttaggtggg tacagcaact ttggcatggg gaaaatgaag cattgacccg tcttcacata 3420ccagatgtgg tcggctctgt atcaggacat caacttcacg gcatattgct cgatggttca 3480ctttcaacca ccgctgtcat ggagtacgag tacggagact ccgcgaccag agttcctttg 3540tcatttgctt ctctgcaact gtacaaaccc gtcacgggaa cagagtggtg gtgctacgcg 3600aggaagattg gggaattcaa atatgacttc cagattatga atgaaatcgg ggaaaccttg 3660gtgaaagcaa ttggctttgt acttcgtgaa gcctctcccg aaaaattcct cagaacaaca 3720tacgtacaca actggcttgt agacattgaa tggcaagctc aatcaacttc cctagtccct 3780tctgatggca ctatctctgg cagttgtttg gttttatcag atcagcatgg aacaggggct 3840gcattggcac aaaggctaga caatgctgga gtgccagtga ccatgatcta tgctgatctg 3900atactggaca attacgaatt aatattccgt actttgccag atttacaaca agtcgtctat 3960ttatgggggt tggatcaaaa agaggattgt caccccatga agcaagcaga ggataactgt 4020acatcggtgc tatatcttgt gcaagcatta ctcaatacct actcaacccc gccatccctg 4080cttattgtca cctgtgatgc acaagcggtg gttgaacaag atcgagtaaa tggcttcgcc 4140caatcgtctt tgttgggact tgccaaagtt atcatgctag aacacccaga attgtcctgt 4200gtttacatgg atgtggaagc cggatattta cagcaagatg tggcgaacac gatatttaca 4260cagctaaaaa gaggccatct atcaaaggac ggagaagaga gtcagttggc ttggcgcaat 4320ggacaagcat acgtagcacg tcttagtcaa tataaaccca aatccgaaca actggttgag 4380atccgcagcg atcgcagcta tttgatcact ggtggacggg gcggtgtcgg cttacaaatc 4440gcacggtggt tagtggaaaa gggggctaaa catctcgttt tgttggggcg cagtcagacc 4500agttccgaag tcagtctggt gttggatgag ctagaatcag ccggggcgca aatcattgtg 4560gctcaagctg atattagcga tgagaaggta ttagcgcaga ttctgaccaa tctaaccgta 4620cctctgtgtg gtgtaatcca cgccgcagga gtgcttgatg atgcgagtct actccaacaa 4680actccagcca agctcaaaaa agttctattg ccaaaagcag agggggcttg gattctgcat 4740aatttgaccc tggagcagcg actagacttc tttgttctct tttcttctgc cagttctcta 4800ttaggtgcgc cagggcaggc caactattca gcagccaatg ctttcctaga tggtttagct 4860gcctatcggc gagggcgagg actcccctgt ttgtctatct gctggggggc atgggatcaa 4920gtcggtatgg ctgcacgaca agggctactg gacaagttac cgcaaagagg tgaagaggcc 4980atcccgttac agaaaggctt agacctcttc ggcgaattac tgaacgagcc agccgctcaa 5040attggtgtga tcccaattca atggactcgc ttcttggatc atcaaaaagg taatttgcct 5100ttttatgaga agttttctaa gtctagccgg aaagcgcaga gttacgattc gatggcagtc 5160agtcacacag aagatattca gaggaaactg aagcaagctg ctgtgcaaga tcgaccaaaa 5220ttattagaag tgcatcttcg ctctcaagtc gctcaactgt taggaataaa cgtggcagag 5280ctaccaaatg aagaaggaat tggttttgtt acattaggtc ttgactcgct cacctctatt 5340gaactgcgta acagtttaca acgcacatta gattgttcat tacctgtcac ctttgctttt 5400gactacccaa ctatagaaat agcggttaag tacctaacac aagttgtaat tgcaccgatg 5460gaaagcacag catcgcagca aacagactct ttatcagcaa tgttcacaga tacttcgtcc 5520atcgggagaa ttcttgacaa cgaaacagat gtgttagaca gcgaaatgca aagtgatgaa 5580gatgaatctt tgtctacact tatacaaaaa ttatcaacac atttggatta g 5631821876PRTCylindrospermopsis raciborskii AWT205 82Met Arg Ser Lys Phe Asn Ile Asn Val Thr Leu Leu Val Cys Leu Ile1 5 10 15Ile Ile Pro Tyr Phe Pro Thr Thr Leu Met Lys Val Pro Ile Thr Ala 20 25 30Asn Glu Asp Ala Ala Thr Leu Leu Gln Arg Val Gly Leu Ser Leu Lys 35 40 45Glu Ala His Gln Gln Leu Glu Ala Met Gln Arg Arg Ala His Glu Pro 50 55 60Ile Ala Ile Val Gly Leu Gly Leu Arg Phe Pro Gly Ala Asp Ser Pro65 70 75 80Gln Thr Phe Trp Lys Leu Leu Gln Asn Gly Val Asp Met Val Thr Glu 85 90 95Ile Pro Ser Asp Arg Trp Ala Val Asp Glu Tyr Tyr Asp Pro Gln Pro 100 105 110Gly Cys Pro Gly Lys Met Tyr Ile Arg Glu Ala Ala Phe Val Asp Ala 115 120 125Val Asp Lys Phe Asp Ala Ser Phe Phe Asp Ile Ser Pro Arg Glu Ala 130 135 140Ala Asn Ile Asp Pro Gln His Arg Met Leu Leu Glu Val Ala Trp Glu145 150 155 160Ala Leu Glu Arg Ala Gly Ile Ala Pro Ser Gln Leu Met Asp Ser Gln 165 170 175Thr Gly Val Phe Val Gly Met Ser Glu Asn Asp Tyr Tyr Ala His Leu 180 185 190Glu Asn Thr Gly Asp His His Asn Val Tyr Ala Ala Thr Gly Asn Ser 195 200 205Asn Tyr Tyr Ala Pro Gly Arg Leu Ser Tyr Leu Leu Gly Leu Gln Gly 210 215 220Pro Asn Met Val Val Asp Ser Ala Cys Ser Ser Ser Leu Val Ala Val225 230 235 240His Leu Ala Cys Asn Ser Leu Arg Met Gly Glu Cys Asp Leu Ala Leu 245 250 255Ala Gly Gly Val Gln Leu Met Leu Ile Pro Asp Pro Met Ile Gly Thr 260 265 270Ala Gln Leu Asn Ala Phe Ala Thr Asp Gly Arg Ser Lys Thr Phe Asp 275 280 285Ala Ala Ala Asp Gly Tyr Gly Arg Gly Glu Gly Cys Gly Met Ile Val 290 295 300Leu Lys Arg Ile Ser Asp Ala Ile Val Ala Asp Asp Pro Ile Leu Ala305 310 315 320Val Ile Arg Gly Ser Ala Val Asn His Gly Gly Arg Ser Ser Gly Leu 325 330 335Thr Ala Pro Asn Lys Leu Ser Gln Glu Ala Leu Leu Arg Gln Ala Leu 340 345 350Gln Asn Ala Lys Val Gln Pro Glu Ala Val Ser Tyr Ile Glu Ala His 355 360 365Gly Thr Gly Thr Gln Leu Gly Asp Pro Ile Glu Val Gly Ala Leu Thr 370 375 380Thr Val Phe Gly Ser Ser Arg Ser Glu Pro Leu Trp Ile Gly Ser Val385 390 395 400Lys Thr Asn Ile Gly His Leu Glu Pro Ala Ala Gly Ile Ala Gly Leu 405 410 415Ile Lys Val Ile Leu Ser Leu Gln Glu Lys Gln Ile Pro Pro Ser Leu 420 425 430His Phe Gln Asn Pro Asn Pro Phe Ile Asp Trp Glu Ser Ser Pro Val 435 440 445Gln Val Pro Thr Gln Cys Val Pro Trp Thr Gly Lys Glu Arg Val Ala 450 455 460Gly Val Ser Ser Phe Gly Met Ser Gly Thr Asn Cys His Leu Val Val465 470 475 480Ala Glu Ala Pro Val Arg Gln Asn Glu Lys Ser Glu Asn Ala Pro Glu 485 490 495Arg Pro Cys His Ile Leu Thr Leu Ser Ala Lys Thr Glu Ala Ala Leu 500 505 510Asn Ala Leu Val Ala Arg Tyr Met Ala Phe Leu Arg Glu Ala Pro Ala 515 520 525Ile Ser Leu Ala Asp Leu Cys Tyr Ser Ala Asn Val Gly Arg Asn Leu 530 535 540Phe Ala His Arg Leu Ser Phe Ile Ser Glu Asn Ile Ala Gln Leu Ser545 550 555 560Glu Gln Leu Glu His Cys Pro Gln Gln Ala Thr Met Pro Thr Gln His 565 570 575Asn Val Ile Leu Asp Asn Gln Leu Ser Pro Gln Ile Ala Phe Leu Phe 580 585 590Thr Gly Gln Gly Ser Gln Tyr Ile Asn Met Gly Arg Glu Leu Tyr Glu 595 600 605Thr Gln Pro Thr Phe Arg Arg Ile Met Asp Glu Cys Asp Asp Ile Leu 610 615 620His Pro Leu Leu Gly Glu Ser Ile Leu Asn Ile Leu Tyr Thr Ser Pro625 630 635 640Ser Lys Leu Asn Gln Thr Val Tyr Thr Gln Pro Ala Leu Phe Ala Phe 645 650 655Glu Tyr Ala Leu Ala Lys Leu Trp Ile Ser Trp Gly Ile Glu Pro Asp 660 665 670Val Val Leu Gly His Ser Val Gly Glu Tyr Val Ala Ala Cys Leu Ala 675 680 685Gly Val Phe Ser Leu Glu Asp Gly Leu Lys Leu Ile Ala Ser Arg Gly 690 695 700Cys Leu Met Gln Ala Leu Pro Pro Gly Lys Met Leu Ser Ile Arg Ser705 710 715 720Asn Glu Ile Gly Val Lys Ala Leu Ile Ala Pro Tyr Ser Ala Glu Val 725 730 735Ser Ile Ala Ala Ile Asn Gly Gln Gln Ser Val Val Ile Ser Gly Lys 740 745 750Ala Glu Ile Ile Asp Asn Leu Ala Ala Glu Phe Ala Ser Glu Gly Ile 755 760 765Lys Thr His Leu Ile Thr Val Ser His Ala Phe His Ser Pro Met Met 770 775 780Thr Pro Met Leu Lys Ala Phe Arg Asp Val Ala Ser Thr Ile Ser Tyr785 790 795 800Arg Ser Pro Ser Leu Ser Leu Ile Ser Asn Gly Thr Gly Gln Leu Ala 805 810 815Thr Lys Glu Val Ala Thr Pro Asp Tyr Trp Val Arg His Val His Ser 820 825 830Thr Val Arg Phe Ala Asp Gly Ile Ala Thr Leu Ala Glu Gln Asn Thr 835 840 845Asp Ile Leu Leu Glu Val Gly Pro Lys Pro Ile Leu Leu Gly Met Ala 850 855 860Lys Gln Ile Tyr Ser Glu Asn Gly Ser Ala Ser His Pro Leu Met Leu865 870 875 880Pro Ser Leu Arg Glu Asp Gly Asn Asp Trp Gln Gln Met Leu Ser Thr 885 890 895Cys Gly Gln Leu Val Val Asn Gly Val Lys Ile Asp Trp Ala Gly Phe 900 905 910Asp Lys Asp Tyr Ser Arg His Lys Ile Leu Leu Pro Thr Tyr Pro Phe 915 920 925Gln Arg Glu Arg Tyr Trp Ile Glu Ser Ser Val Lys Lys Pro Gln Lys 930 935 940Gln Glu Leu Arg Pro Met Leu Asp Lys Met Ile Arg Leu Pro Ser Glu945 950 955 960Asn Lys Val Val Phe Glu Thr Glu Phe Gly Val Arg Gln Met Pro His 965 970 975Ile Ser Asp His Gln Ile Tyr Gly Glu Val Ile Val Pro Gly Ala Val 980 985 990Leu Ala Ser Leu Ile Phe Asn Ala Ala Gln Val Leu Tyr Pro Asp Tyr 995 1000 1005Gln His Glu Leu Thr Asp Ile Ala Phe Tyr Gln Pro Ile Ile Phe 1010 1015 1020His Asp Asp Asp Thr Val Ile Val Gln Ala Ile Phe Ser Pro Asp 1025 1030 1035Lys Ser Gln Glu Asn Gln Ser His Gln Thr Phe Pro Pro Met Ser 1040 1045 1050Phe Gln Ile Ile Ser Phe Met Pro Asp Gly Pro Leu Glu Asn Lys 1055 1060 1065Pro Lys Val His Val Thr Gly Cys Leu Arg Met Leu Arg Asp Ala 1070 1075 1080Gln Pro Pro Thr Leu Ser Pro Thr Glu Ile Arg Gln Arg Cys Pro 1085 1090 1095His Thr Val Asn Gly His Asp Trp Tyr Asn Ser Leu Val Lys Gln 1100 1105 1110Lys Phe Glu Met Gly Pro Ser Phe Arg Trp Val Gln Gln Leu Trp 1115 1120 1125His Gly Glu Asn Glu Ala Leu Thr Arg Leu His Ile Pro Asp Val 1130 1135 1140Val Gly Ser Val Ser Gly His Gln Leu His Gly Ile Leu Leu Asp 1145 1150 1155Gly Ser Leu Ser Thr Thr Ala Val Met Glu Tyr Glu Tyr Gly Asp 1160 1165 1170Ser Ala Thr Arg Val Pro Leu Ser Phe Ala Ser Leu Gln Leu Tyr

1175 1180 1185Lys Pro Val Thr Gly Thr Glu Trp Trp Cys Tyr Ala Arg Lys Ile 1190 1195 1200Gly Glu Phe Lys Tyr Asp Phe Gln Ile Met Asn Glu Ile Gly Glu 1205 1210 1215Thr Leu Val Lys Ala Ile Gly Phe Val Leu Arg Glu Ala Ser Pro 1220 1225 1230Glu Lys Phe Leu Arg Thr Thr Tyr Val His Asn Trp Leu Val Asp 1235 1240 1245Ile Glu Trp Gln Ala Gln Ser Thr Ser Leu Val Pro Ser Asp Gly 1250 1255 1260Thr Ile Ser Gly Ser Cys Leu Val Leu Ser Asp Gln His Gly Thr 1265 1270 1275Gly Ala Ala Leu Ala Gln Arg Leu Asp Asn Ala Gly Val Pro Val 1280 1285 1290Thr Met Ile Tyr Ala Asp Leu Ile Leu Asp Asn Tyr Glu Leu Ile 1295 1300 1305Phe Arg Thr Leu Pro Asp Leu Gln Gln Val Val Tyr Leu Trp Gly 1310 1315 1320Leu Asp Gln Lys Glu Asp Cys His Pro Met Lys Gln Ala Glu Asp 1325 1330 1335Asn Cys Thr Ser Val Leu Tyr Leu Val Gln Ala Leu Leu Asn Thr 1340 1345 1350Tyr Ser Thr Pro Pro Ser Leu Leu Ile Val Thr Cys Asp Ala Gln 1355 1360 1365Ala Val Val Glu Gln Asp Arg Val Asn Gly Phe Ala Gln Ser Ser 1370 1375 1380Leu Leu Gly Leu Ala Lys Val Ile Met Leu Glu His Pro Glu Leu 1385 1390 1395Ser Cys Val Tyr Met Asp Val Glu Ala Gly Tyr Leu Gln Gln Asp 1400 1405 1410Val Ala Asn Thr Ile Phe Thr Gln Leu Lys Arg Gly His Leu Ser 1415 1420 1425Lys Asp Gly Glu Glu Ser Gln Leu Ala Trp Arg Asn Gly Gln Ala 1430 1435 1440Tyr Val Ala Arg Leu Ser Gln Tyr Lys Pro Lys Ser Glu Gln Leu 1445 1450 1455Val Glu Ile Arg Ser Asp Arg Ser Tyr Leu Ile Thr Gly Gly Arg 1460 1465 1470Gly Gly Val Gly Leu Gln Ile Ala Arg Trp Leu Val Glu Lys Gly 1475 1480 1485Ala Lys His Leu Val Leu Leu Gly Arg Ser Gln Thr Ser Ser Glu 1490 1495 1500Val Ser Leu Val Leu Asp Glu Leu Glu Ser Ala Gly Ala Gln Ile 1505 1510 1515Ile Val Ala Gln Ala Asp Ile Ser Asp Glu Lys Val Leu Ala Gln 1520 1525 1530Ile Leu Thr Asn Leu Thr Val Pro Leu Cys Gly Val Ile His Ala 1535 1540 1545Ala Gly Val Leu Asp Asp Ala Ser Leu Leu Gln Gln Thr Pro Ala 1550 1555 1560Lys Leu Lys Lys Val Leu Leu Pro Lys Ala Glu Gly Ala Trp Ile 1565 1570 1575Leu His Asn Leu Thr Leu Glu Gln Arg Leu Asp Phe Phe Val Leu 1580 1585 1590Phe Ser Ser Ala Ser Ser Leu Leu Gly Ala Pro Gly Gln Ala Asn 1595 1600 1605Tyr Ser Ala Ala Asn Ala Phe Leu Asp Gly Leu Ala Ala Tyr Arg 1610 1615 1620Arg Gly Arg Gly Leu Pro Cys Leu Ser Ile Cys Trp Gly Ala Trp 1625 1630 1635Asp Gln Val Gly Met Ala Ala Arg Gln Gly Leu Leu Asp Lys Leu 1640 1645 1650Pro Gln Arg Gly Glu Glu Ala Ile Pro Leu Gln Lys Gly Leu Asp 1655 1660 1665Leu Phe Gly Glu Leu Leu Asn Glu Pro Ala Ala Gln Ile Gly Val 1670 1675 1680Ile Pro Ile Gln Trp Thr Arg Phe Leu Asp His Gln Lys Gly Asn 1685 1690 1695Leu Pro Phe Tyr Glu Lys Phe Ser Lys Ser Ser Arg Lys Ala Gln 1700 1705 1710Ser Tyr Asp Ser Met Ala Val Ser His Thr Glu Asp Ile Gln Arg 1715 1720 1725Lys Leu Lys Gln Ala Ala Val Gln Asp Arg Pro Lys Leu Leu Glu 1730 1735 1740Val His Leu Arg Ser Gln Val Ala Gln Leu Leu Gly Ile Asn Val 1745 1750 1755Ala Glu Leu Pro Asn Glu Glu Gly Ile Gly Phe Val Thr Leu Gly 1760 1765 1770Leu Asp Ser Leu Thr Ser Ile Glu Leu Arg Asn Ser Leu Gln Arg 1775 1780 1785Thr Leu Asp Cys Ser Leu Pro Val Thr Phe Ala Phe Asp Tyr Pro 1790 1795 1800Thr Ile Glu Ile Ala Val Lys Tyr Leu Thr Gln Val Val Ile Ala 1805 1810 1815Pro Met Glu Ser Thr Ala Ser Gln Gln Thr Asp Ser Leu Ser Ala 1820 1825 1830Met Phe Thr Asp Thr Ser Ser Ile Gly Arg Ile Leu Asp Asn Glu 1835 1840 1845Thr Asp Val Leu Asp Ser Glu Met Gln Ser Asp Glu Asp Glu Ser 1850 1855 1860Leu Ser Thr Leu Ile Gln Lys Leu Ser Thr His Leu Asp 1865 1870 1875834074DNACylindrospermopsis raciborskii AWT205 83atgaacgctt tgtcagaaaa tcaggtaact tctatagtca agaaggcatt gaacaaaata 60gaggagttac aagccgaact tgaccgttta aaatacgcgc aacgggaacc aatcgccatc 120attggaatgg gctgtcgctt tcctggtgca gacacacctg aagctttttg gaaattattg 180cacaatgggg ttgatgctat ccaagagatt ccaaaaagcc gttgggatat tgacgactat 240tatgatccca caccagcaac acccggcaaa atgtatacac gttttggtgg ttttctcgac 300caaatagcag ccttcgaccc tgagttcttt cgcatttcta ctcgtgaggc aatcagctta 360gaccctcaac agagattgct tctggaagtg agttgggaag ccttagaacg ggctgggctg 420acaggcaata aactgactac acaaacaggt gtctttgttg gcatcagtga aagtgattat 480cgtgatttga ttatgcgtaa tggttctgac ctagatgtat attctggttc aggtaactgc 540catagtacag ccagcgggcg tttatcttat tatttgggac ttactggacc caatttgtcc 600cttgataccg cctgttcgtc ctctttggtt tgtgtggcat tggctgtcaa gagcctacgt 660caacaggagt gtgatttggc attggcgggt ggtgtacaga tacaagtgat accagatggc 720tttatcaaag cctgtcaatc ccgtatgttg tcgcctgatg gacggtgcaa aacatttgat 780ttccaggcag atggttatgc ccgtgctgag gggtgtggga tggtagttct caaacgccta 840tccgatgcaa ttgctgacaa tgataatatc ctggccttga ttcgtggtgc cgcagtcaat 900catgatggct acacgagtgg attaaccgtt cccagtggtc cctcacaacg ggcggtgatc 960caacaggcat tagcggatgc tggaatacac ccggatcaaa ttagctatat tgaggcacat 1020ggcacaggta catccttagg cgatcctatt gaaatgggtg cgattgggca agtctttggt 1080caacgctcac agatgctttt cgtcggttcg gtcaagacga atattggtca tactgaggct 1140gctgctggta ttgctggtct catcaaggtt gtactctcaa tgcagcacgg tgaaatccca 1200gcaaacttac acttcgacca gccaagtcct tatattaact gggatcaatt accagtcagt 1260atcccaacag aaacaatacc ttggtctact agcgatcgct ttgcaggagt cagtagcttt 1320ggctttagtg gcacaaactc tcatatcgta ctagaggcag ccccaaacat agagcaacct 1380actgatgata ttaatcaaac gccgcatatt ttgaccttag ctgcaaaaac acccgcagcc 1440ctgcaagaac tggctcggcg ttatgcgact cagatagaga cctctcccga tgttcctctg 1500gcggacattt gtttcacagc acacataggg cgtaaacatt ttaaacatag gtttgcggta 1560gtcacggaat ctaaagagca actgcgtttg caattggatg catttgcaca atcagggggt 1620gtggggcgag aagtcaaatc gctaccaaag atagcctttc tttttacagg tcaaggctca 1680cagtatgtgg gaatgggtcg tcaactttac gaaaaccaac ctaccttccg aaaagcactc 1740gcccattgtg atgacatctt gcgtgctggt gcatatttcg accgatcact actttcgatt 1800ctctacccag agggaaaatc agaagccatt caccaaaccg cttatactca gcccgcgctt 1860tttgctcttg agtatgcgat cgctcagttg tggcactcct ggggtatcaa accagatatc 1920gtgatggggc atagtgtagg tgaatacgtc gccgcttgtg tggcgggcat attttcttta 1980gaggatgggc tgaaactaat tgctactcgt ggtcgtctga tgcaatccct acctcaagac 2040ggaacgatgg tttcttcttt ggcaagtgaa gctcgtatcc aggaagctat tacaccttac 2100cgagatgatg tgtcaatcgc agcgataaat gggacagaaa gcgtggttat ctctggcaaa 2160cgcacctctg tgatggcaat tgctgaacaa ctcgccaccg ttggcatcaa gacacgccaa 2220ctgacggttt cccatgcctt ccattcacca cttatgacac ccatcttgga tgagttccgc 2280caggtggcag ccagtatcac ctatcaccag cccaagttgc tacttgtctc caacgtctcc 2340gggaaagtgg ccggccctga aatcaccaga ccagattact gggtacgcca tgtccgtgag 2400gcagtgcgct ttgccgatgg agtgaggacg ctgaatgaac aaggtgtcaa tatctttctg 2460gaaatcggtt ctaccgctac cctgttgggc atggcactgc gagtaaatga ggaagattca 2520aatgcctcaa aaggaacttc gtcttgctac ctgcccagtt tacgggaaag ccagaaggat 2580tgtcagcaga tgttcactag tctgggtgag ttgtacgtac atggatatga tattgattgg 2640ggtgcattta atcggggata tcaaggacgc aaggtgatat tgccaaccta tccgtttcag 2700cgacaacgtt attggcttcc cgaccctaag ttggcacaaa gttccgattt agataccttt 2760caagctcaga gcagcgcatc atcacaaaat cctagcgctg tgtccacttt actgatggaa 2820tatttgcaag caggtgatgt ccaatcttta gttgggcttt tggatgatga acggaaactc 2880tctgctgctg aacgaattgc actacccagt attttggagt ttttggtaga ggaacaacag 2940cgacaaataa gctcaaccac aactcctcaa acagttttac aaaaaataag tcaaacttcc 3000catgaggaca gatatgaaat attgaagaac ctgatcaaat ctgaaatcga aacgattatc 3060aaaagtgttc cctccgatga acaaatgttt tctgacttag gaattgattc cttgatggcg 3120atcgaactgc gtaataagct ccgttctgct atagggttgg aactgccagt ggcaatagta 3180tttgaccatc ccacgattaa gcagttaact aacttcgtac tggacagaat tgtgccgcag 3240gcagaccaaa aggacgttcc caccgaatcc ttgtttgctt ctaaacagga gatatcagtt 3300gaggagcagt cttttgcaat taccaagctg ggcttatccc ctgcttccca ctccctgcat 3360cttcctccat ggacggttag acctgcggta atggcagatg taacaaaact aagccaactt 3420gaaagagagg cctatggctg gatcggagaa ggagcgatcg ccccgcccca tctcattgcc 3480gatcgcatca atttactcaa cagtggtgat atgccttggt tctgggtaat ggagcgatca 3540ggagagttgg gcgcgtggca ggtgctacaa ccgacatctg ttgatccata tacttatgga 3600agttgggatg aagtaactga ccaaggtaaa ctgcaagcaa ccttcgaccc aagtggacgc 3660aatgtgtata ttgtcgcggg tgggtctagc aacctcccca cggtagccag ccacctcatg 3720acgcttcaga ctttattgat gctgcgggaa actggtcgtg acacaatctt tgtctgtctg 3780gcaatgccag gttatgccaa ataccacagt caaacaggaa aatcgccgga agagtatatt 3840gcgctgactg acgaggatgg tatcccaatg gacgagttta ttgcactttc tgtctacgac 3900tggcctgtta ccccatcgtt tcgtgttctg cgagacggtt atccacctga tcgagattct 3960ggtggtcacg cagttagtac ggttttccag ctcaatgatt tcgatggagc gatcgaagaa 4020acatatcgtc gtattatccg ccatgccgat gtccttggtc tcgaaagagg ctaa 4074841357PRTCylindrospermopsis raciborskii AWT205 84Met Asn Ala Leu Ser Glu Asn Gln Val Thr Ser Ile Val Lys Lys Ala1 5 10 15Leu Asn Lys Ile Glu Glu Leu Gln Ala Glu Leu Asp Arg Leu Lys Tyr 20 25 30Ala Gln Arg Glu Pro Ile Ala Ile Ile Gly Met Gly Cys Arg Phe Pro 35 40 45Gly Ala Asp Thr Pro Glu Ala Phe Trp Lys Leu Leu His Asn Gly Val 50 55 60Asp Ala Ile Gln Glu Ile Pro Lys Ser Arg Trp Asp Ile Asp Asp Tyr65 70 75 80Tyr Asp Pro Thr Pro Ala Thr Pro Gly Lys Met Tyr Thr Arg Phe Gly 85 90 95Gly Phe Leu Asp Gln Ile Ala Ala Phe Asp Pro Glu Phe Phe Arg Ile 100 105 110Ser Thr Arg Glu Ala Ile Ser Leu Asp Pro Gln Gln Arg Leu Leu Leu 115 120 125Glu Val Ser Trp Glu Ala Leu Glu Arg Ala Gly Leu Thr Gly Asn Lys 130 135 140Leu Thr Thr Gln Thr Gly Val Phe Val Gly Ile Ser Glu Ser Asp Tyr145 150 155 160Arg Asp Leu Ile Met Arg Asn Gly Ser Asp Leu Asp Val Tyr Ser Gly 165 170 175Ser Gly Asn Cys His Ser Thr Ala Ser Gly Arg Leu Ser Tyr Tyr Leu 180 185 190Gly Leu Thr Gly Pro Asn Leu Ser Leu Asp Thr Ala Cys Ser Ser Ser 195 200 205Leu Val Cys Val Ala Leu Ala Val Lys Ser Leu Arg Gln Gln Glu Cys 210 215 220Asp Leu Ala Leu Ala Gly Gly Val Gln Ile Gln Val Ile Pro Asp Gly225 230 235 240Phe Ile Lys Ala Cys Gln Ser Arg Met Leu Ser Pro Asp Gly Arg Cys 245 250 255Lys Thr Phe Asp Phe Gln Ala Asp Gly Tyr Ala Arg Ala Glu Gly Cys 260 265 270Gly Met Val Val Leu Lys Arg Leu Ser Asp Ala Ile Ala Asp Asn Asp 275 280 285Asn Ile Leu Ala Leu Ile Arg Gly Ala Ala Val Asn His Asp Gly Tyr 290 295 300Thr Ser Gly Leu Thr Val Pro Ser Gly Pro Ser Gln Arg Ala Val Ile305 310 315 320Gln Gln Ala Leu Ala Asp Ala Gly Ile His Pro Asp Gln Ile Ser Tyr 325 330 335Ile Glu Ala His Gly Thr Gly Thr Ser Leu Gly Asp Pro Ile Glu Met 340 345 350Gly Ala Ile Gly Gln Val Phe Gly Gln Arg Ser Gln Met Leu Phe Val 355 360 365Gly Ser Val Lys Thr Asn Ile Gly His Thr Glu Ala Ala Ala Gly Ile 370 375 380Ala Gly Leu Ile Lys Val Val Leu Ser Met Gln His Gly Glu Ile Pro385 390 395 400Ala Asn Leu His Phe Asp Gln Pro Ser Pro Tyr Ile Asn Trp Asp Gln 405 410 415Leu Pro Val Ser Ile Pro Thr Glu Thr Ile Pro Trp Ser Thr Ser Asp 420 425 430Arg Phe Ala Gly Val Ser Ser Phe Gly Phe Ser Gly Thr Asn Ser His 435 440 445Ile Val Leu Glu Ala Ala Pro Asn Ile Glu Gln Pro Thr Asp Asp Ile 450 455 460Asn Gln Thr Pro His Ile Leu Thr Leu Ala Ala Lys Thr Pro Ala Ala465 470 475 480Leu Gln Glu Leu Ala Arg Arg Tyr Ala Thr Gln Ile Glu Thr Ser Pro 485 490 495Asp Val Pro Leu Ala Asp Ile Cys Phe Thr Ala His Ile Gly Arg Lys 500 505 510His Phe Lys His Arg Phe Ala Val Val Thr Glu Ser Lys Glu Gln Leu 515 520 525Arg Leu Gln Leu Asp Ala Phe Ala Gln Ser Gly Gly Val Gly Arg Glu 530 535 540Val Lys Ser Leu Pro Lys Ile Ala Phe Leu Phe Thr Gly Gln Gly Ser545 550 555 560Gln Tyr Val Gly Met Gly Arg Gln Leu Tyr Glu Asn Gln Pro Thr Phe 565 570 575Arg Lys Ala Leu Ala His Cys Asp Asp Ile Leu Arg Ala Gly Ala Tyr 580 585 590Phe Asp Arg Ser Leu Leu Ser Ile Leu Tyr Pro Glu Gly Lys Ser Glu 595 600 605Ala Ile His Gln Thr Ala Tyr Thr Gln Pro Ala Leu Phe Ala Leu Glu 610 615 620Tyr Ala Ile Ala Gln Leu Trp His Ser Trp Gly Ile Lys Pro Asp Ile625 630 635 640Val Met Gly His Ser Val Gly Glu Tyr Val Ala Ala Cys Val Ala Gly 645 650 655Ile Phe Ser Leu Glu Asp Gly Leu Lys Leu Ile Ala Thr Arg Gly Arg 660 665 670Leu Met Gln Ser Leu Pro Gln Asp Gly Thr Met Val Ser Ser Leu Ala 675 680 685Ser Glu Ala Arg Ile Gln Glu Ala Ile Thr Pro Tyr Arg Asp Asp Val 690 695 700Ser Ile Ala Ala Ile Asn Gly Thr Glu Ser Val Val Ile Ser Gly Lys705 710 715 720Arg Thr Ser Val Met Ala Ile Ala Glu Gln Leu Ala Thr Val Gly Ile 725 730 735Lys Thr Arg Gln Leu Thr Val Ser His Ala Phe His Ser Pro Leu Met 740 745 750Thr Pro Ile Leu Asp Glu Phe Arg Gln Val Ala Ala Ser Ile Thr Tyr 755 760 765His Gln Pro Lys Leu Leu Leu Val Ser Asn Val Ser Gly Lys Val Ala 770 775 780Gly Pro Glu Ile Thr Arg Pro Asp Tyr Trp Val Arg His Val Arg Glu785 790 795 800Ala Val Arg Phe Ala Asp Gly Val Arg Thr Leu Asn Glu Gln Gly Val 805 810 815Asn Ile Phe Leu Glu Ile Gly Ser Thr Ala Thr Leu Leu Gly Met Ala 820 825 830Leu Arg Val Asn Glu Glu Asp Ser Asn Ala Ser Lys Gly Thr Ser Ser 835 840 845Cys Tyr Leu Pro Ser Leu Arg Glu Ser Gln Lys Asp Cys Gln Gln Met 850 855 860Phe Thr Ser Leu Gly Glu Leu Tyr Val His Gly Tyr Asp Ile Asp Trp865 870 875 880Gly Ala Phe Asn Arg Gly Tyr Gln Gly Arg Lys Val Ile Leu Pro Thr 885 890 895Tyr Pro Phe Gln Arg Gln Arg Tyr Trp Leu Pro Asp Pro Lys Leu Ala 900 905 910Gln Ser Ser Asp Leu Asp Thr Phe Gln Ala Gln Ser Ser Ala Ser Ser 915 920 925Gln Asn Pro Ser Ala Val Ser Thr Leu Leu Met Glu Tyr Leu Gln Ala 930 935 940Gly Asp Val Gln Ser Leu Val Gly Leu Leu Asp Asp Glu Arg Lys Leu945 950 955 960Ser Ala Ala Glu Arg Ile Ala Leu Pro Ser Ile Leu Glu Phe Leu Val 965 970 975Glu Glu Gln Gln Arg Gln Ile Ser Ser Thr Thr Thr Pro Gln Thr Val 980 985 990Leu Gln Lys Ile Ser Gln Thr Ser His Glu Asp Arg Tyr Glu Ile Leu 995 1000 1005Lys Asn Leu Ile Lys Ser Glu Ile Glu Thr Ile Ile Lys Ser Val 1010 1015 1020Pro Ser Asp Glu Gln Met Phe Ser Asp Leu Gly Ile Asp Ser Leu 1025 1030 1035Met Ala Ile Glu Leu Arg Asn Lys Leu Arg Ser Ala Ile Gly Leu 1040 1045 1050Glu Leu Pro Val Ala Ile Val Phe Asp His Pro Thr Ile Lys Gln 1055 1060 1065Leu Thr Asn Phe Val Leu Asp Arg Ile Val Pro Gln Ala Asp Gln 1070 1075

1080Lys Asp Val Pro Thr Glu Ser Leu Phe Ala Ser Lys Gln Glu Ile 1085 1090 1095Ser Val Glu Glu Gln Ser Phe Ala Ile Thr Lys Leu Gly Leu Ser 1100 1105 1110Pro Ala Ser His Ser Leu His Leu Pro Pro Trp Thr Val Arg Pro 1115 1120 1125Ala Val Met Ala Asp Val Thr Lys Leu Ser Gln Leu Glu Arg Glu 1130 1135 1140Ala Tyr Gly Trp Ile Gly Glu Gly Ala Ile Ala Pro Pro His Leu 1145 1150 1155Ile Ala Asp Arg Ile Asn Leu Leu Asn Ser Gly Asp Met Pro Trp 1160 1165 1170Phe Trp Val Met Glu Arg Ser Gly Glu Leu Gly Ala Trp Gln Val 1175 1180 1185Leu Gln Pro Thr Ser Val Asp Pro Tyr Thr Tyr Gly Ser Trp Asp 1190 1195 1200Glu Val Thr Asp Gln Gly Lys Leu Gln Ala Thr Phe Asp Pro Ser 1205 1210 1215Gly Arg Asn Val Tyr Ile Val Ala Gly Gly Ser Ser Asn Leu Pro 1220 1225 1230Thr Val Ala Ser His Leu Met Thr Leu Gln Thr Leu Leu Met Leu 1235 1240 1245Arg Glu Thr Gly Arg Asp Thr Ile Phe Val Cys Leu Ala Met Pro 1250 1255 1260Gly Tyr Ala Lys Tyr His Ser Gln Thr Gly Lys Ser Pro Glu Glu 1265 1270 1275Tyr Ile Ala Leu Thr Asp Glu Asp Gly Ile Pro Met Asp Glu Phe 1280 1285 1290Ile Ala Leu Ser Val Tyr Asp Trp Pro Val Thr Pro Ser Phe Arg 1295 1300 1305Val Leu Arg Asp Gly Tyr Pro Pro Asp Arg Asp Ser Gly Gly His 1310 1315 1320Ala Val Ser Thr Val Phe Gln Leu Asn Asp Phe Asp Gly Ala Ile 1325 1330 1335Glu Glu Thr Tyr Arg Arg Ile Ile Arg His Ala Asp Val Leu Gly 1340 1345 1350Leu Glu Arg Gly 1355851437DNAcylindrospermopsis raciborskii awt205 85atgaataaaa aacaggtaga cacattgtta atacacgctc atctttttac catgcagggc 60aatggcctgg gatatattgc cgatggggca attgcggttc agggtagcca gatcgtagca 120gtggattcga cagaggcttt gctgagtcat tttgaaggaa ataaaacaat taatgcggta 180aattgtgcag tgttgcctgg actaattgat gctcatatac atacgacttg tgctattctg 240cgtggagtgg cacaggatgt aaccaattgg ctaatggacg cgacaattcc ttatgcactt 300cagatgacac ccgcagtaaa tatagccgga acgcgcttga gtgtactcga agggctgaaa 360gcaggaacaa ccacattcgg cgattctgag actccttacc cgctctgggg agagtttttc 420gatgaaattg gggtacgtgc tattctatcc cctgccttta acgcctttcc actagaatgg 480tcggcatgga aggagggaga cctctatccc ttcgatatga aggcaggacg acgtggtatg 540gaagaggctg tggattttgc ttgtgcatgg aatggagccg cagagggacg tatcaccact 600atgttgggac tacaggcggc ggatatgcta ccactggaga tcctacacgc agctaaagag 660attgcccaac gggaaggctt aatgctgcat attcatgtgg cccagggaga tcgagaaaca 720aaacaaattg tcaaacgata tggtaagcgt ccgatcgcat ttctagctga aattggctac 780ttggacgaac agttgctggc agttcacctc accgatgcca cagatgaaga agtgatacaa 840gtagccaaaa gtggtgctgg catggcactc tgttcgggcg ctattggcat cattgacggt 900cttgttccgc ccgctcatgt ttttcgacaa gcaggcggtt ccgttgcact cggttctgat 960caagcctgtg gcaacaactg ttgtaacatc ttcaatgaaa tgaagctgac cgccttattc 1020aacaaaataa aatatcatga tccaaccatt atgccggctt gggaagtcct gcgtatggct 1080accatcgaag gagcgcaggc gattggttta gatcacaaga ttggctctct tcaagtgggc 1140aaagaagccg acctgatctt aatagacctc agttccccta acctctcgcc caccctgctc 1200aaccctattc gtaaccttgt acctaacttg gtgtatgctg cttcaggaca tgaagttaaa 1260agcgtcatgg tggcgggaaa acttttagtg gaagactacc aagtcctcac ggtagatgag 1320tccgctattc tcgctgaagc gcaagtacaa gctcaacaac tctgccaacg tgtgaccgct 1380gaccccattc acaaaaagat ggtgttaatg gaagcgatgg ctaagggtaa attatag 143786478PRTCylindrospermopsis raciborskii AWT205 86Met Asn Lys Lys Gln Val Asp Thr Leu Leu Ile His Ala His Leu Phe1 5 10 15Thr Met Gln Gly Asn Gly Leu Gly Tyr Ile Ala Asp Gly Ala Ile Ala 20 25 30Val Gln Gly Ser Gln Ile Val Ala Val Asp Ser Thr Glu Ala Leu Leu 35 40 45Ser His Phe Glu Gly Asn Lys Thr Ile Asn Ala Val Asn Cys Ala Val 50 55 60Leu Pro Gly Leu Ile Asp Ala His Ile His Thr Thr Cys Ala Ile Leu65 70 75 80Arg Gly Val Ala Gln Asp Val Thr Asn Trp Leu Met Asp Ala Thr Ile 85 90 95Pro Tyr Ala Leu Gln Met Thr Pro Ala Val Asn Ile Ala Gly Thr Arg 100 105 110Leu Ser Val Leu Glu Gly Leu Lys Ala Gly Thr Thr Thr Phe Gly Asp 115 120 125Ser Glu Thr Pro Tyr Pro Leu Trp Gly Glu Phe Phe Asp Glu Ile Gly 130 135 140Val Arg Ala Ile Leu Ser Pro Ala Phe Asn Ala Phe Pro Leu Glu Trp145 150 155 160Ser Ala Trp Lys Glu Gly Asp Leu Tyr Pro Phe Asp Met Lys Ala Gly 165 170 175Arg Arg Gly Met Glu Glu Ala Val Asp Phe Ala Cys Ala Trp Asn Gly 180 185 190Ala Ala Glu Gly Arg Ile Thr Thr Met Leu Gly Leu Gln Ala Ala Asp 195 200 205Met Leu Pro Leu Glu Ile Leu His Ala Ala Lys Glu Ile Ala Gln Arg 210 215 220Glu Gly Leu Met Leu His Ile His Val Ala Gln Gly Asp Arg Glu Thr225 230 235 240Lys Gln Ile Val Lys Arg Tyr Gly Lys Arg Pro Ile Ala Phe Leu Ala 245 250 255Glu Ile Gly Tyr Leu Asp Glu Gln Leu Leu Ala Val His Leu Thr Asp 260 265 270Ala Thr Asp Glu Glu Val Ile Gln Val Ala Lys Ser Gly Ala Gly Met 275 280 285Ala Leu Cys Ser Gly Ala Ile Gly Ile Ile Asp Gly Leu Val Pro Pro 290 295 300Ala His Val Phe Arg Gln Ala Gly Gly Ser Val Ala Leu Gly Ser Asp305 310 315 320Gln Ala Cys Gly Asn Asn Cys Cys Asn Ile Phe Asn Glu Met Lys Leu 325 330 335Thr Ala Leu Phe Asn Lys Ile Lys Tyr His Asp Pro Thr Ile Met Pro 340 345 350Ala Trp Glu Val Leu Arg Met Ala Thr Ile Glu Gly Ala Gln Ala Ile 355 360 365Gly Leu Asp His Lys Ile Gly Ser Leu Gln Val Gly Lys Glu Ala Asp 370 375 380Leu Ile Leu Ile Asp Leu Ser Ser Pro Asn Leu Ser Pro Thr Leu Leu385 390 395 400Asn Pro Ile Arg Asn Leu Val Pro Asn Leu Val Tyr Ala Ala Ser Gly 405 410 415His Glu Val Lys Ser Val Met Val Ala Gly Lys Leu Leu Val Glu Asp 420 425 430Tyr Gln Val Leu Thr Val Asp Glu Ser Ala Ile Leu Ala Glu Ala Gln 435 440 445Val Gln Ala Gln Gln Leu Cys Gln Arg Val Thr Ala Asp Pro Ile His 450 455 460Lys Lys Met Val Leu Met Glu Ala Met Ala Lys Gly Lys Leu465 470 47587831DNACylindrospermopsis raciborskii AWT205 87atgaccatat atgaaaataa gttgagtagt tatcaaaaaa atcaagatgc cataatatct 60gcaaaagaac tcgaagaatg gcatttaatt ggacttctag accattcaat agatgcggta 120atagtaccga attattttct tgagcaagag tgtatgacaa tttcagagag aataaaaaag 180agtaaatatt ttagcgctta tcccggtcat ccatcagtaa gtagcttggg acaagagttg 240tatgaatgcg aaagtgagct tgaattagca aagtatcaag aagacgcacc cacattgatt 300aaagaaatgc ggaggctggt acatccgtac ataagtccaa ttgatagact tagggttgaa 360gttgatgata tttggagtta tggctgtaat ttagcaaaac ttggtgataa aaaactgttt 420gcgggtatcg ttagagagtt taaagaagat aaccctggcg caccacattg tgacgtaatg 480gcatggggtt ttctcgaata ttataaagat aaaccaaata tcataaatca aatcgcagca 540aatgtatatt taaaaacgtc tgcatcagga ggagaaatag tgctttggga tgaatggcca 600actcaaagcg aatatatagc atacaaaaca gatgatccag ctagtttcgg tcttgatagc 660aaaaagatcg cacaaccaaa acttgagatc caaccgaacc agggagattt aattctattc 720aattccatga gaattcatgc ggtgaaaaag atagaaactg gtgtacgtat gacatgggga 780tgtttgattg gatactctgg aactgataaa ccgcttgtta tttggactta a 83188276PRTCylindrospermopsis raciborskii AWT205 88Met Thr Ile Tyr Glu Asn Lys Leu Ser Ser Tyr Gln Lys Asn Gln Asp1 5 10 15Ala Ile Ile Ser Ala Lys Glu Leu Glu Glu Trp His Leu Ile Gly Leu 20 25 30Leu Asp His Ser Ile Asp Ala Val Ile Val Pro Asn Tyr Phe Leu Glu 35 40 45Gln Glu Cys Met Thr Ile Ser Glu Arg Ile Lys Lys Ser Lys Tyr Phe 50 55 60Ser Ala Tyr Pro Gly His Pro Ser Val Ser Ser Leu Gly Gln Glu Leu65 70 75 80Tyr Glu Cys Glu Ser Glu Leu Glu Leu Ala Lys Tyr Gln Glu Asp Ala 85 90 95Pro Thr Leu Ile Lys Glu Met Arg Arg Leu Val His Pro Tyr Ile Ser 100 105 110Pro Ile Asp Arg Leu Arg Val Glu Val Asp Asp Ile Trp Ser Tyr Gly 115 120 125Cys Asn Leu Ala Lys Leu Gly Asp Lys Lys Leu Phe Ala Gly Ile Val 130 135 140Arg Glu Phe Lys Glu Asp Asn Pro Gly Ala Pro His Cys Asp Val Met145 150 155 160Ala Trp Gly Phe Leu Glu Tyr Tyr Lys Asp Lys Pro Asn Ile Ile Asn 165 170 175Gln Ile Ala Ala Asn Val Tyr Leu Lys Thr Ser Ala Ser Gly Gly Glu 180 185 190Ile Val Leu Trp Asp Glu Trp Pro Thr Gln Ser Glu Tyr Ile Ala Tyr 195 200 205Lys Thr Asp Asp Pro Ala Ser Phe Gly Leu Asp Ser Lys Lys Ile Ala 210 215 220Gln Pro Lys Leu Glu Ile Gln Pro Asn Gln Gly Asp Leu Ile Leu Phe225 230 235 240Asn Ser Met Arg Ile His Ala Val Lys Lys Ile Glu Thr Gly Val Arg 245 250 255Met Thr Trp Gly Cys Leu Ile Gly Tyr Ser Gly Thr Asp Lys Pro Leu 260 265 270Val Ile Trp Thr 275891398DNACylindrospermopsis raciborskii AWT205 89ttaatgtagc gtttccattt gagtcaaggc acgagaagct tctaaagctg gaatagatac 60actatcattc tcaactacac tctcaaatgt cctaggtaac tgtgccccaa acatcagcat 120tccaatggcg ttgaacaaaa agaaagccaa ccacaagata tggttactct caaatttaac 180agcagctaca tccgcaggta aaaatcctac accaaacgcg attaagttaa cattgcggag 240agtatgccct tgagccaaac ccaagaagta cccacatagt atgcaacata ctgaattgca 300tactaggaca agtaccaacc agggaataaa aatatcaata ttctcaataa tttctgcgtg 360gttggttaac aacccaaaaa catcatcggg aaatagccaa cacgctccgc cgaaaaccag 420actcactagc agagccattc ccacagaaac ttttgccaga ggtgctaact gttctgtggc 480tcctttccct ttaaaatttc ctgccagagt ttctgtacag aatcccaatc cttcaacaat 540gtagatgctc aaagcccata tctgtaagag caaggcattt tgagcgtaga taattgtccc 600catttgtgcc ccttcgtagt taaacgttaa gttggtaaac atacaaacta aattgctgac 660aaagatgttt ccattgagag ttaaggtgga gcgtatagct tttatgtccc aaatttttcc 720agctaattct tttacctctt gccacgggat ttctttgcag acaaaaaaca atcccaccaa 780tagggtgaga tattgacttg cagcagaagc tactcctgcc cccatgctcg accagtctaa 840gtggataata aacaagtagt cgagtgcgat attggcagca ttgcccacaa ccgacaacaa 900cacaactaag ccattttttt cccgtcccag aaaccagcca agcaggacaa agttgagcaa 960aatggcaggc gctccccaac tctgggtgtt aaaatacgct tgagctgaag acttcacctc 1020tgggccgaca tctagtatag aaaaccccaa cacccctaac gggtactgta acagtatgat 1080cgccaccccc agcaccagag caattaaacc attaagcagt cccgccaaca gtacgccctc 1140tcggtcatct cgtccgactg cttgtgctgt taacgcagtg gtacccattc gtaaaaacga 1200taaaacaaag tagagaaagt taagcaggtt tccagcaagg gctactccag ctaggtagtg 1260gatttccgag agatgaccta agaacatgat actgactaaa ttactcagtg gtactataat 1320attcgatagg acgttggtaa aagctagtcg gaagtagcgg ggtataaagt catactggct 1380tggaaatgtc aggctcat 139890465PRTCylindrospermopsis raciborskii AWT205 90Met Ser Leu Thr Phe Pro Ser Gln Tyr Asp Phe Ile Pro Arg Tyr Phe1 5 10 15Arg Leu Ala Phe Thr Asn Val Leu Ser Asn Ile Ile Val Pro Leu Ser 20 25 30Asn Leu Val Ser Ile Met Phe Leu Gly His Leu Ser Glu Ile His Tyr 35 40 45Leu Ala Gly Val Ala Leu Ala Gly Asn Leu Leu Asn Phe Leu Tyr Phe 50 55 60Val Leu Ser Phe Leu Arg Met Gly Thr Thr Ala Leu Thr Ala Gln Ala65 70 75 80Val Gly Arg Asp Asp Arg Glu Gly Val Leu Leu Ala Gly Leu Leu Asn 85 90 95Gly Leu Ile Ala Leu Val Leu Gly Val Ala Ile Ile Leu Leu Gln Tyr 100 105 110Pro Leu Gly Val Leu Gly Phe Ser Ile Leu Asp Val Gly Pro Glu Val 115 120 125Lys Ser Ser Ala Gln Ala Tyr Phe Asn Thr Gln Ser Trp Gly Ala Pro 130 135 140Ala Ile Leu Leu Asn Phe Val Leu Leu Gly Trp Phe Leu Gly Arg Glu145 150 155 160Lys Asn Gly Leu Val Val Leu Leu Ser Val Val Gly Asn Ala Ala Asn 165 170 175Ile Ala Leu Asp Tyr Leu Phe Ile Ile His Leu Asp Trp Ser Ser Met 180 185 190Gly Ala Gly Val Ala Ser Ala Ala Ser Gln Tyr Leu Thr Leu Leu Val 195 200 205Gly Leu Phe Phe Val Cys Lys Glu Ile Pro Trp Gln Glu Val Lys Glu 210 215 220Leu Ala Gly Lys Ile Trp Asp Ile Lys Ala Ile Arg Ser Thr Leu Thr225 230 235 240Leu Asn Gly Asn Ile Phe Val Ser Asn Leu Val Cys Met Phe Thr Asn 245 250 255Leu Thr Phe Asn Tyr Glu Gly Ala Gln Met Gly Thr Ile Ile Tyr Ala 260 265 270Gln Asn Ala Leu Leu Leu Gln Ile Trp Ala Leu Ser Ile Tyr Ile Val 275 280 285Glu Gly Leu Gly Phe Cys Thr Glu Thr Leu Ala Gly Asn Phe Lys Gly 290 295 300Lys Gly Ala Thr Glu Gln Leu Ala Pro Leu Ala Lys Val Ser Val Gly305 310 315 320Met Ala Leu Leu Val Ser Leu Val Phe Gly Gly Ala Cys Trp Leu Phe 325 330 335Pro Asp Asp Val Phe Gly Leu Leu Thr Asn His Ala Glu Ile Ile Glu 340 345 350Asn Ile Asp Ile Phe Ile Pro Trp Leu Val Leu Val Leu Val Cys Asn 355 360 365Ser Val Cys Cys Ile Leu Cys Gly Tyr Phe Leu Gly Leu Ala Gln Gly 370 375 380His Thr Leu Arg Asn Val Asn Leu Ile Ala Phe Gly Val Gly Phe Leu385 390 395 400Pro Ala Asp Val Ala Ala Val Lys Phe Glu Ser Asn His Ile Leu Trp 405 410 415Leu Ala Phe Phe Leu Phe Asn Ala Ile Gly Met Leu Met Phe Gly Ala 420 425 430Gln Leu Pro Arg Thr Phe Glu Ser Val Val Glu Asn Asp Ser Val Ser 435 440 445Ile Pro Ala Leu Glu Ala Ser Arg Ala Leu Thr Gln Met Glu Thr Leu 450 455 460His46591750DNACylindrospermopsis raciborskii AWT205 91atgttgaact tagaccgcat cctgaatcaa gagcgactgc tacgagaaat gactggactt 60aaccgccaag cattcaacga gctgttatct cagtttgctg atacctatga acgcaccgtg 120ttcaactcct tagcaaaccg caaacgtgcg cccgggggcg gacgcaagcc tacactcaga 180agtatagagg aaaaactatt ttatatcctg ctgtactgca aatgttatcc gacgtttgac 240ttgctgagtg tgttgttcaa ctttgaccgc tcctgtgctc atgattgggt acatcgacta 300ctgtctgtgc tagaaaccac tttaggagaa aagcaagttt tgccagcacg caaactcagg 360agcatggagg aattcaccaa aaggtttcca gatgtgaagg aggtgattgt ggatggtacg 420gagcgtccag tccagcgtcc tcaaaaccga gaacgccaaa aagagtatta ctctggcaag 480aaaaagcggc atacatgcaa gcagattaca gtcagcacaa gggagaaacg agtgattatt 540cggacggaaa ccagagcagg taaagtgcat gacaaacggc tactccatga atcagagata 600gtgcaataca ttcctgatga agtagcaata gagggagatt tgggttttca tgggttggag 660aaagaatttg tcaatgtcca tttaccacac aagaaaccga aaggtatcga agcaaggagg 720catggcggcg ggatgggtca gtttttataa 75092249PRTCylindrospermopsis raciborskii AWT205 92Met Leu Asn Leu Asp Arg Ile Leu Asn Gln Glu Arg Leu Leu Arg Glu1 5 10 15Met Thr Gly Leu Asn Arg Gln Ala Phe Asn Glu Leu Leu Ser Gln Phe 20 25 30Ala Asp Thr Tyr Glu Arg Thr Val Phe Asn Ser Leu Ala Asn Arg Lys 35 40 45Arg Ala Pro Gly Gly Gly Arg Lys Pro Thr Leu Arg Ser Ile Glu Glu 50 55 60Lys Leu Phe Tyr Ile Leu Leu Tyr Cys Lys Cys Tyr Pro Thr Phe Asp65 70 75 80Leu Leu Ser Val Leu Phe Asn Phe Asp Arg Ser Cys Ala His Asp Trp 85 90 95Val His Arg Leu Leu Ser Val Leu Glu Thr Thr Leu Gly Glu Lys Gln 100 105 110Val Leu Pro Ala Arg Lys Leu Arg Ser Met Glu Glu Phe Thr Lys Arg 115 120 125Phe Pro Asp Val Lys Glu Val Ile Val Asp Gly Thr Glu Arg Pro Val 130 135 140Gln Arg Pro Gln Asn Arg Glu Arg Gln Lys Glu Tyr Tyr Ser Gly Lys145 150 155 160Lys Lys Arg His Thr Cys Lys Gln Ile Thr Val Ser Thr Arg Glu Lys 165 170 175Arg Val Ile Ile

Arg Thr Glu Thr Arg Ala Gly Lys Val His Asp Lys 180 185 190Arg Leu Leu His Glu Ser Glu Ile Val Gln Tyr Ile Pro Asp Glu Val 195 200 205Ala Ile Glu Gly Asp Leu Gly Phe His Gly Leu Glu Lys Glu Phe Val 210 215 220Asn Val His Leu Pro His Lys Lys Pro Lys Gly Ile Glu Ala Arg Arg225 230 235 240His Gly Gly Gly Met Gly Gln Phe Leu 245931431DNACylindrospermopsis raciborskii AWT205 93atgaatctta taacaacaaa aaaacaggta gatacattag tgatacacgc tcatcttttt 60accatgcagg gaaatggtgt gggatatatt gcagatgggg cacttgcggt tgagggtagc 120cgtattgtag cagttgattc gacggaggcg ttgctgagtc attttgaggg cagaaaggtt 180attgagtccg cgaattgtgc cgtcttgcct gggctgatta atgctcacgt agacacaagt 240ttggtgctga tgcgtggggc ggcgcaagat gtaactaatt ggctaatgga cgcgaccatg 300ccttattttg ctcacatgac acccgtggcg agtatggctg caacacgctt aagggtggta 360gaagagttga aagcaggcac aacaacattc tgtgacaata aaattattag ccccctgtgg 420ggcgaatttt tcgatgaaat tggtgtacgg gctagtttag ctcctatgtt cgatgcactc 480ccactggaga tgccaccgct tcaagacggg gagctttatc ccttcgatat caaggcggga 540cggcgggcga tggcagaggc tgtggatttt gcctgtgggt ggaatggggc agcagagggg 600cgtatcacta ccatgttagg aatgtattcg ccagatatga tgccgcttga gatgctacgc 660gcagccaaag agattgctca acgggaaggc ttaatgctgc attttcatgt agcgcaggga 720gatcgggaaa cagagcaaat cgttaaacga tatggtaagc gtccgatcgc atttctagct 780gagattggct acttggacga acagttgctg gcagttcacc tcaccgatgc caccgatgaa 840gaggtgatac aagtagccaa aagtggcgct ggcatggtac tctgttcggg aatgattggc 900actattgacg gtatcgtgcc gcccgctcat gtgtttcggc aagcaggcgg acccgttgcg 960ctaggcagca gctacaataa tattttccat gagatgaagc tgaccgcctt attcaacaaa 1020ataaaatatc acgatccaac cattatgccg gcttgggaag tcctgcgtat ggctaccatc 1080gaaggagcgc gggcgattgg tttagatcac aagattggct ctcttgaagt tggcaaagaa 1140gccgacctga tcttaataga cctcagcacc cctaacctct cacccactct gcttaacccc 1200attcgtaacc ttgtacctaa tttcgtgtac gctgcttcag gacatgaagt taaaagtgtc 1260atggtggcgg gaaaactgtt attggaagac taccaagtcc tcacagtaga tgagtctgct 1320atcattgctg aagcacaatt gcaagcccaa cagatttctc aatgcgtagc atctgaccct 1380atccacaaaa aaatggtgct gatggcggcg atggcaaggg gccaattgta g 143194476PRTCylindrospermopsis raciborskii AWT205 94Met Asn Leu Ile Thr Thr Lys Lys Gln Val Asp Thr Leu Val Ile His1 5 10 15Ala His Leu Phe Thr Met Gln Gly Asn Gly Val Gly Tyr Ile Ala Asp 20 25 30Gly Ala Leu Ala Val Glu Gly Ser Arg Ile Val Ala Val Asp Ser Thr 35 40 45Glu Ala Leu Leu Ser His Phe Glu Gly Arg Lys Val Ile Glu Ser Ala 50 55 60Asn Cys Ala Val Leu Pro Gly Leu Ile Asn Ala His Val Asp Thr Ser65 70 75 80Leu Val Leu Met Arg Gly Ala Ala Gln Asp Val Thr Asn Trp Leu Met 85 90 95Asp Ala Thr Met Pro Tyr Phe Ala His Met Thr Pro Val Ala Ser Met 100 105 110Ala Ala Thr Arg Leu Arg Val Val Glu Glu Leu Lys Ala Gly Thr Thr 115 120 125Thr Phe Cys Asp Asn Lys Ile Ile Ser Pro Leu Trp Gly Glu Phe Phe 130 135 140Asp Glu Ile Gly Val Arg Ala Ser Leu Ala Pro Met Phe Asp Ala Leu145 150 155 160Pro Leu Glu Met Pro Pro Leu Gln Asp Gly Glu Leu Tyr Pro Phe Asp 165 170 175Ile Lys Ala Gly Arg Arg Ala Met Ala Glu Ala Val Asp Phe Ala Cys 180 185 190Gly Trp Asn Gly Ala Ala Glu Gly Arg Ile Thr Thr Met Leu Gly Met 195 200 205Tyr Ser Pro Asp Met Met Pro Leu Glu Met Leu Arg Ala Ala Lys Glu 210 215 220Ile Ala Gln Arg Glu Gly Leu Met Leu His Phe His Val Ala Gln Gly225 230 235 240Asp Arg Glu Thr Glu Gln Ile Val Lys Arg Tyr Gly Lys Arg Pro Ile 245 250 255Ala Phe Leu Ala Glu Ile Gly Tyr Leu Asp Glu Gln Leu Leu Ala Val 260 265 270His Leu Thr Asp Ala Thr Asp Glu Glu Val Ile Gln Val Ala Lys Ser 275 280 285Gly Ala Gly Met Val Leu Cys Ser Gly Met Ile Gly Thr Ile Asp Gly 290 295 300Ile Val Pro Pro Ala His Val Phe Arg Gln Ala Gly Gly Pro Val Ala305 310 315 320Leu Gly Ser Ser Tyr Asn Asn Ile Phe His Glu Met Lys Leu Thr Ala 325 330 335Leu Phe Asn Lys Ile Lys Tyr His Asp Pro Thr Ile Met Pro Ala Trp 340 345 350Glu Val Leu Arg Met Ala Thr Ile Glu Gly Ala Arg Ala Ile Gly Leu 355 360 365Asp His Lys Ile Gly Ser Leu Glu Val Gly Lys Glu Ala Asp Leu Ile 370 375 380Leu Ile Asp Leu Ser Thr Pro Asn Leu Ser Pro Thr Leu Leu Asn Pro385 390 395 400Ile Arg Asn Leu Val Pro Asn Phe Val Tyr Ala Ala Ser Gly His Glu 405 410 415Val Lys Ser Val Met Val Ala Gly Lys Leu Leu Leu Glu Asp Tyr Gln 420 425 430Val Leu Thr Val Asp Glu Ser Ala Ile Ile Ala Glu Ala Gln Leu Gln 435 440 445Ala Gln Gln Ile Ser Gln Cys Val Ala Ser Asp Pro Ile His Lys Lys 450 455 460Met Val Leu Met Ala Ala Met Ala Arg Gly Gln Leu465 470 47595780DNACylindrospermopsis raciborskii AWT205 95atgcaagaaa aacgaatcgc aatgtggtct gtgccacgaa gtttgggtac agtgctgcta 60caagcctggt cgagtcggcc agataccgta gtctttgatg aacttctctc ctttccctat 120ctctttatca aagggaaaga tatgggcttt acttggacag accttgattc tagccaaatg 180ccccacgcag attggcgatc cgtcatcgat ctgttaaagg ctcccctgcc tgaagggaaa 240tcaatcatcg atctgttaaa ggctcccctg cctgaaggga aatcaatttg ctatcagaag 300catcaagcgt atcatttaat cgaagagacc atggggattg agtggatatt gcccttcagc 360aactgctttc tgattcgcca acccaaagaa atgctcttat cttttcgtaa gattgtgcca 420cattttacct ttgaagaaac aggctggatc gaattaaaac ggctgtttga ctatgtacat 480caaacgagcg gagtaatccc gcctgtcata gatgcacacg acttgctgaa cgatccgcgg 540agaatgctct ccaagctttg tcaggttgta ggggttgagt ttaccgagac aatgctcagt 600tggcccccca tggaggtcga gttgaacgaa aaactagccc cttggtacag caccgtagca 660agttctacgc attttcactc gtatcagaat aaaaatgagt cgttgccgct atatcttgtc 720gatatttgta aacgctgcga tgaaatatat caggaattat atcaatttcg actttattag 78096259PRTCylindrospermopsis raciborskii AWT205 96Met Gln Glu Lys Arg Ile Ala Met Trp Ser Val Pro Arg Ser Leu Gly1 5 10 15Thr Val Leu Leu Gln Ala Trp Ser Ser Arg Pro Asp Thr Val Val Phe 20 25 30Asp Glu Leu Leu Ser Phe Pro Tyr Leu Phe Ile Lys Gly Lys Asp Met 35 40 45Gly Phe Thr Trp Thr Asp Leu Asp Ser Ser Gln Met Pro His Ala Asp 50 55 60Trp Arg Ser Val Ile Asp Leu Leu Lys Ala Pro Leu Pro Glu Gly Lys65 70 75 80Ser Ile Ile Asp Leu Leu Lys Ala Pro Leu Pro Glu Gly Lys Ser Ile 85 90 95Cys Tyr Gln Lys His Gln Ala Tyr His Leu Ile Glu Glu Thr Met Gly 100 105 110Ile Glu Trp Ile Leu Pro Phe Ser Asn Cys Phe Leu Ile Arg Gln Pro 115 120 125Lys Glu Met Leu Leu Ser Phe Arg Lys Ile Val Pro His Phe Thr Phe 130 135 140Glu Glu Thr Gly Trp Ile Glu Leu Lys Arg Leu Phe Asp Tyr Val His145 150 155 160Gln Thr Ser Gly Val Ile Pro Pro Val Ile Asp Ala His Asp Leu Leu 165 170 175Asn Asp Pro Arg Arg Met Leu Ser Lys Leu Cys Gln Val Val Gly Val 180 185 190Glu Phe Thr Glu Thr Met Leu Ser Trp Pro Pro Met Glu Val Glu Leu 195 200 205Asn Glu Lys Leu Ala Pro Trp Tyr Ser Thr Val Ala Ser Ser Thr His 210 215 220Phe His Ser Tyr Gln Asn Lys Asn Glu Ser Leu Pro Leu Tyr Leu Val225 230 235 240Asp Ile Cys Lys Arg Cys Asp Glu Ile Tyr Gln Glu Leu Tyr Gln Phe 245 250 255Arg Leu Tyr971176DNACylindrospermopsis raciborskii AWT205 97atgcaaacaa gaattgtaaa tagctggaat gagtgggatg aactaaagga gatggttgtc 60gggattgcag atggtgctta ttttgaacca actgagccag gtaaccgccc tgctttacgc 120gataagaaca ttgccaaaat gttctctttt cccaggggtc cgaaaaagca agaggtaaca 180gagaaagcta atgaggagtt gaatgggctg gtagcgcttc tagaatcaca gggcgtaact 240gtacgccgcc cagagaaaca taactttggc ctgtctgtga agacaccatt ctttgaggta 300gagaatcaat attgtgcggt ctgcccacgt gatgttatga tcacctttgg gaacgaaatt 360ctcgaagcaa ctatgtcacg gcggtcacgc ttctttgagt atttacccta tcgcaaacta 420gtctatgaat attggcataa agatccagat atgatctgga atgctgcgcc taaaccgact 480atgcaaaatg ccatgtaccg cgaagatttc tgggagtgtc cgatggaaga tcgatttgag 540agtatgcatg attttgagtt ctgcgtcacc caggatgagg tgatttttga cgcagcagac 600tgtagccgct ttggccgtga tatttttgtg caggagtcaa tgacgactaa tcgtgcaggg 660attcgctggc tcaaacggca tttagagccg cgtcgcttcc gcgtgcatga tattcacttc 720ccactagata ttttcccatc ccacattgat tgtacttttg tccccttagc acctggggtt 780gtgttagtga atccagatcg ccccatcaaa gagggtgaag agaaactctt catggataac 840ggttggcaat tcatcgaagc acccctcccc acttccaccg acgatgagat gcctatgttc 900tgccagtcca gtaagtggtt ggcgatgaat gtgttaagca tttcccccaa gaaggtcatc 960tgtgaagagc aagagcatcc gcttcatgag ttgctagata aacacggctt tgaggtctat 1020ccaattccct ttcgcaatgt ctttgagttt ggcggttcgc tccattgtgc cacctgggat 1080atccatcgca cgggaacctg tgaggattac ttccctaaac taaactatac gccggtaact 1140gcatcaacca atggcgtttc tcgcttcatc atttag 117698391PRTCylindrospermopsis raciborskii AWT205 98Met Gln Thr Arg Ile Val Asn Ser Trp Asn Glu Trp Asp Glu Leu Lys1 5 10 15Glu Met Val Val Gly Ile Ala Asp Gly Ala Tyr Phe Glu Pro Thr Glu 20 25 30Pro Gly Asn Arg Pro Ala Leu Arg Asp Lys Asn Ile Ala Lys Met Phe 35 40 45Ser Phe Pro Arg Gly Pro Lys Lys Gln Glu Val Thr Glu Lys Ala Asn 50 55 60Glu Glu Leu Asn Gly Leu Val Ala Leu Leu Glu Ser Gln Gly Val Thr65 70 75 80Val Arg Arg Pro Glu Lys His Asn Phe Gly Leu Ser Val Lys Thr Pro 85 90 95Phe Phe Glu Val Glu Asn Gln Tyr Cys Ala Val Cys Pro Arg Asp Val 100 105 110Met Ile Thr Phe Gly Asn Glu Ile Leu Glu Ala Thr Met Ser Arg Arg 115 120 125Ser Arg Phe Phe Glu Tyr Leu Pro Tyr Arg Lys Leu Val Tyr Glu Tyr 130 135 140Trp His Lys Asp Pro Asp Met Ile Trp Asn Ala Ala Pro Lys Pro Thr145 150 155 160Met Gln Asn Ala Met Tyr Arg Glu Asp Phe Trp Glu Cys Pro Met Glu 165 170 175Asp Arg Phe Glu Ser Met His Asp Phe Glu Phe Cys Val Thr Gln Asp 180 185 190Glu Val Ile Phe Asp Ala Ala Asp Cys Ser Arg Phe Gly Arg Asp Ile 195 200 205Phe Val Gln Glu Ser Met Thr Thr Asn Arg Ala Gly Ile Arg Trp Leu 210 215 220Lys Arg His Leu Glu Pro Arg Arg Phe Arg Val His Asp Ile His Phe225 230 235 240Pro Leu Asp Ile Phe Pro Ser His Ile Asp Cys Thr Phe Val Pro Leu 245 250 255Ala Pro Gly Val Val Leu Val Asn Pro Asp Arg Pro Ile Lys Glu Gly 260 265 270Glu Glu Lys Leu Phe Met Asp Asn Gly Trp Gln Phe Ile Glu Ala Pro 275 280 285Leu Pro Thr Ser Thr Asp Asp Glu Met Pro Met Phe Cys Gln Ser Ser 290 295 300Lys Trp Leu Ala Met Asn Val Leu Ser Ile Ser Pro Lys Lys Val Ile305 310 315 320Cys Glu Glu Gln Glu His Pro Leu His Glu Leu Leu Asp Lys His Gly 325 330 335Phe Glu Val Tyr Pro Ile Pro Phe Arg Asn Val Phe Glu Phe Gly Gly 340 345 350Ser Leu His Cys Ala Thr Trp Asp Ile His Arg Thr Gly Thr Cys Glu 355 360 365Asp Tyr Phe Pro Lys Leu Asn Tyr Thr Pro Val Thr Ala Ser Thr Asn 370 375 380Gly Val Ser Arg Phe Ile Ile385 390998754DNACylindrospermopsis raciborskii AWT205 99atgcaaaaga gagaaagccc acagatacta tttgatggga atggaacaca atctgagttt 60ccagatagtt gcattcacca cttgttcgag gatcaagccg caaagcgacc ggatgcgatc 120gctctcattg acggtgagca atcccttacc tacggggaac taaatgtacg cgctaaccac 180ctagcccagc atctcttgtc cctaggctgt caacccgatg acctcctcgc catctgcatc 240gagcgttcgg cagaactctt tattggtttg ttgggtatcc taaaagccgg atgtgcttat 300gtgcctttgg atgtaggcta tcctggcgat cgcatagagt atatgttgcg ggactcggat 360gcgcgtattt tactaacctc aacggatgtc gctaagaaac ttgccttaac catacctgca 420ttgcaagagt gccaaaccgt ctatttagat caagagatat ttgagtatga ttttcatttt 480ttagcgatag ctaaactatt acataaccaa tacttgagat tattacattt ttatttttat 540accttgattc agcaatgcca ggcaacttcg gtttcccaag ggattcagac acaggttctc 600cccaataatc tcgcttactg catttacacc tctggctcta ccggaaatcc caaagggatc 660ttgatggaac atcgctcact ggtgaatatg ctttggtggc atcagcaaac gcggccttcg 720gttcagggtg ttaggacgct gcaattttgt gcagtcagct ttgacttttc ctgccatgaa 780attttttcta ccctctgtct tggcgggata ttggtcttgg tgccagaggc agtgcgccaa 840aatccctttg cattggctga gttcatcagt caacagaaaa ttgaaaaatt gtttcttccc 900gttatagcat tactacagtt ggccgaagct gtaaatggga ataaaagcac ctccctcgcg 960ctttgcgaag ttatcactac cggggagcag atgcagatca cacctgctgt cgccaacctc 1020tttcagaaaa ccggggcgat gttgcataat cactacgggg caacagaatt tcaagatgcc 1080accactcata ccctcaaggg caatccagag ggctggccaa cactggtgcc agtgggtcgt 1140ccactgcaca atgttcaagt gtatattctg gatgaggcac agcaacctgt acctcttggt 1200ggagagggtg aattctgtat tggtggtatt ggactggctc gtggctatca caatttgcct 1260gacctaacga atgaaaaatt tattcccaat ccatttgggg ctaatgagaa cgctaaaaaa 1320ctctaccgca caggggactt ggcacgctac ctacccgacg gcacgattga gcatttagga 1380cggatagacc accaggttaa gatccgaggt ttccgcgtgg aattggggga aattgagtcc 1440gtgctggcaa gtcaccaagc tgtgcgtgaa tgtgccgttg tggcacggga gattgcaggt 1500catacacagt tggtagggta tatcatagca aaggatacac ttaatctcag tttcgacaaa 1560cttgaaccta tcctgcgtca atattcggaa gcggtgctgc cagaatacat gatacccact 1620cggttcatca atatcagtaa tatgccgttg actcccagtg gtaaacttga ccgcagggca 1680ttacctgatc ccaaaggcga tcgccctgca ttgtctaccc cacttgtcaa gcctcgtacc 1740cagacagaga aacgtttagc agagatttgg ggcagttatc ttgctgtaga tattgtggga 1800acccacgaca atttctttga tctaggcggt acgtcactgc tattgactca agcgcacaaa 1860ttcctgtgcg agacctttaa tattaatttg tccgctgtct cactctttca atatcccaca 1920attcagacat tggcacaata tattgattgc caaggagaca caacctcaag cgatacagca 1980tccaggcaca agaaagtacg taaaaagcag tccggtgaca gcaacgatat tgccatcatc 2040agtgtggcag gtcgctttcc gggtgctgaa acgattgagc agttctggca taatctctgt 2100aatggtgttg aatccatcac cctttttagt gatgatgagc tagagcagac tttgcctgag 2160ttatttaata atcccgctta tgtcaaagca ggtgcggtgc tagaaggcgt tgaattattt 2220gatgctacct tttttggcta cagccccaaa gaagctgcgg tgacagaccc tcagcaacgg 2280attttgctag agtgtgcctg ggaagcattt gaacgggctg gctacaaccc cgaaacctat 2340ccagaaccag ttggtgttta tgctggttca agcctgagta cctatctgct taacaatatt 2400ggctctgctt taggcataat taccgagcaa ccctttattg aaacggatat ggagcagttt 2460caggctaaaa ttggcaatga ccggagctat cttgctacac gcatctctta caagctgaat 2520ctcaagggtc caagcgtcaa tgtgcagacc gcctgctcaa cctcgttagt tgcggttcac 2580atggcctgtc agagtctcat tagtggagag tgtcaaatgg ctttagccgg tggtatttct 2640gtggttgtac cacagaaggg gggctatctc tacgaagaag gcatggttcg ttcccaggat 2700ggtcattgtc gcgcctttga tgccgaagcc caagggacta tatttggcaa tggcggcggc 2760ttggttttgc ttaaacggtt gcaggatgca ctggacgata acgacaacat tatggcagtc 2820atcaaagcca cagccatcaa caacgacggt gcgctcaaga tgggctacac agcaccgagc 2880gtggatgggc aagctgatgt aattagcgag gcgattgcta tcgctgacat agatgcaagc 2940accattggct atgtagaagc tcatggcaca gccacccaat tgggtgatcc gattgaagta 3000gcagggttag caagggcatt tcagcgtagt acggacagcg tccttggtaa acaacaatgc 3060gctattggat cagttaaaac taatattggc cacttagatg aggcggcagg cattgccgga 3120ctgataaagg ctgctctagc tctacaatat ggacagattc caccgagctt gcactatgcc 3180aatcctaatc cacggattga ttttgacgca accccatttt ttgtcaacac agaactacgc 3240gaatggtcaa ggaatggtta tcctcggcgg gcgggggtga gttcttttgg tgtgggtgga 3300actaacagcc atattgtgct ggaggagtcg cctgtaaagc aacccacatt gttctcttct 3360ttgccagaac gcagtcatca tctgctgacg ctttctgccc atacacaaga ggctttgcat 3420gagttggtgc aacgctacat ccaacataac gagacacacc ttgatattaa cttaggcgac 3480ctctgtttca cagccaatac gggacgcaag cattttgagc atcgcctagc ggttgtagcc 3540gaatcaatcc ctggcttaca ggcacaactg gaaactgcac agactgcgat ttcagcacag 3600aaaaaaaatg ccccgccgac gatcgcattc ctgtttacag gtcaaggctc acaatacatt 3660aacatggggc gcaccctcta cgatactgaa tcaacattcc gtgcagccct tgaccgatgt 3720gaaaccattc tccaaaattt agggatcgag tccattctct ccgttatttt tggttcatct 3780gagcatggac tctcattaga tgacacagcc tatacccagc ccgcactctt tgccatcgaa 3840tacgcgctct atcaattatg gaagtcgtgg ggcatccagc cctcagtggt gataggtcat 3900agtgtaggtg aatatgtgtc cgcttgtgtg gcgggagtct ttagcttaga ggatgggttg 3960aaactgattg cagaacgagg acgactgata caggcacttc ctcgtgatgg gagcatggtt 4020tccgtgatgg

caagcgagaa gcgtattgca gatatcattt taccttatgg gggacaggta 4080gggatcgccg cgattaatgg cccacaaagt gttgtaattt ctgggcaaca gcaagcgatt 4140gatgctattt gtgccatctt ggaaactgag ggcatcaaaa gcaagaagct aaacgtctcc 4200catgccttcc actcgccgct agtggaagca atgttagact ctttcttgca ggttgcacaa 4260gaggtcactt actcgcaacc tcaaatcaag cttatctcta atgtaacggg aacattggca 4320agccatgaat cttgtcccga tgaacttccg atcaccaccg cagagtattg ggtacgtcat 4380gtgcgacagc ccgtccggtt tgcggcggga atggagagcc ttgagggtca aggggtaaac 4440gtatttatag aaatcggtcc taaacctgtt cttttaggca tgggacgcga ctgcttgcct 4500gaacaagagg gactttggtt gcctagtttg cgcccaaaac aggatgattg gcaacaggtg 4560ttaagtagtt tgcgtgatct atacttagca ggtgtaaccg tagattggag cagtttcgat 4620caggggtatg ctcgtcgccg tgtgccacta ccgacttatc cttggcagcg agagcggcat 4680tgggtagagc caattattcg tcaacggcaa tcagtattac aagccacaaa taccaccaag 4740ctaactcgta acgccagcgt ggcgcagcat cctctgcttg gtcaacggct gcatttgtcg 4800cggactcaag agatttactt tcaaaccttc atccactccg acttcccaat atgggttgct 4860gatcataaag tatttggaaa tgtcatcatt ccgggtgtcg cctattttga gatggcactg 4920gcagcaggga aggcacttaa accagacagt atattttggc tcgaagatgt atccatcgcc 4980caagcactga ttattcccga tgaagggcaa actgtgcaaa tagtattaag cccacaggaa 5040gagtcagctt atttttttga aatcctctct ttagaaaaag aaaactcttg ggtgcttcat 5100gcctctggta agctagtcgc ccaagagcaa gtgctagaaa ccgagccaat tgacttgatt 5160gcgttacagg cacattgttc cgaagaagtg tcagtagatg tgctatatca ggaagaaatg 5220gcgcgccggc tggatatggg tccaatgatg cgtggggtga agcagctttg gcgttatccg 5280ctctcctttg ccaaaagtca tgatgcgatc gcactcgcca aggtcagctt gccagaaatc 5340ttgcttcatg agtccaatgc ctaccaattc catcctgtaa tcttggatgc ggggctgcaa 5400atgataacgg tctcttatcc tgaagcaaac caaggccaga cttatgtacc tgttggtata 5460gagggtctac aagtctatgg tcgtcccagt tcagaacttt ggtgtcgcgc ccaatatcgg 5520cctcctttgg atacagatca aaggcagggt attgatttgc tgccaaagaa attgattgca 5580gacttgcatc tatttgatac ccagggtcgt gtggttgcca tcatgtttgg tgtgcaatct 5640gtccttgtgg gacgggaagc aatgttgcga tcgcaagata cttggcgaaa ttggctttat 5700caagtcctgt ggaaacctca agcctgtttt ggacttttac cgaattacct gccaacccca 5760gataagattc ggaaacgcct ggaaacaaag ttagcgacat tgatcatcga agctaatttg 5820gcgacttatg cgatcgccta tacccaactg gaaaggttaa gtctagctta cgttgtggcg 5880gctttccgac aaatgggctg gctgtttcaa cccggtgagc gtttttccac cgcccagaag 5940gtatcagcgt taggaatcgt tgatcaacat cggcaactat tcgctcgttt gctcgacatt 6000ctagccgaag cagacatact ccgcagcgaa aacttgatga cgatatggga agtcatttca 6060tacccggaaa cgattgatat acaggtactt cttgacgacc tcgaagccaa agaagcagaa 6120gccgaagtca cactggtttc ccgttgcagt gcaaaattgg ccgaagtatt acaaggaaaa 6180tgtgacccca tacagttgct ctttcccgca ggggacacaa caacgttaag caaactctat 6240cgtgaagccc cagttttggg tgttactaat actctagtcc aagaagcgct tctttccgcc 6300ctggagcagt tgccgccgga acgtggttgg cgaattttag agattggtgc tggaacaggt 6360ggaaccacag cctacttgtt accgcatctg cctggggatc agacaaaata tgtctttacc 6420gatattagtg ccttttttct tgccaaagcg gaagagcgtt ttaaagatta cccgtttgta 6480cgttatcagg tattagatat cgaacaagca ccacaggcgc aaggatttga accccaaata 6540tacgatttaa tcgtagcagc ggatgtcttg catgctacta gtgacctgcg tcaaactctt 6600gtacatatcc ggcaattatt agcgccgggc gggatgttga tcctgatgga agacagcgaa 6660cccgcacgct gggctgattt aacctttggc ttaacagaag gctggtggaa gtttacagac 6720catgacttac gccccaacca tccgctattg tctcctgagc agtggcaaat cttgttgtca 6780gaaatgggat ttagtcaaac aaccgcctta tggccaaaaa tagatagccc ccataaattg 6840ccacgggagg cggtgattgt ggcgcgtaat gaaccagcca tcagaaaacc ccgaagatgg 6900ctgatcttgg ctgacgagga gattggtgga ctactagcca aacagctacg tgaagaagga 6960gaagattgta tactcctctt gccaggggaa aagtacacag agagagattc acaaacgttt 7020acaatcaatc ctggagatat tgaagagtgg caacagttat tgaaccgagt accgaacata 7080caagaaattg tacattgttg gagtatggtt tccactgact tagatagagc cactattttc 7140agttgcagca gtacgctgca tttagttcaa gcattagcaa actatccaaa aaaccctcgc 7200ttgtcacttg tcaccctagg cgcacaagcc gttaacgaac atcatgttca aaatgtagtt 7260ggagcagccc tctggggcat gggaaaggta attgcactcg aacacccaga gctacaagta 7320gcacaaatgg atttagaccc gaatgggaag gttaaggcgc aagtagaagt gcttagggat 7380gaacttctcg ccagaaaaga ccctgcatca gcaatgtctg tgcctgatct gcaaacacga 7440cctcatgaaa agcaaatagc ctttcgtgag caaacacgtt atgtggcaag actttcgccc 7500ttagaccgcc ccaatcctgg agagaaaggc acacaagagg ctcttacctt ccgtgatgat 7560ggcagctatc tgattgctgg tggtttaggc ggactggggt tagtggtggc tcgttttctg 7620gttacaaatg gggctaaata ccttgtgcta gtcggacgac gtggtgcgag ggaggaacag 7680caagctcaat taagcgaact agagcaactc ggagcttccg tgaaagtttt acaagccgat 7740attgctgatg cagaacaact agcccaagca ctttcagcag taacctaccc accattacgg 7800ggtgttattc atgcggcagg tacattgaac gatgggattc tacagcagca aagttggcaa 7860gcctttaaag aagtgatgaa tcccaaggta gcaggtgcgt ggaacctaca tatactgaca 7920aaaaatcagc ctttagactt ctttgtcctg ttctcctccg ccacctcttt gttaggtaac 7980gctggacaag ccaatcacgc cgccgcaaat gctttccttg atgggttagc ctcctatcgt 8040cgtcacttag gactaccgag cctctcgatt aattggggga catggagcga agtgggaatt 8100gcggctcgac ttgaactaga taagttgtcc agcaaacagg gagagggaac cattacgcta 8160ggacagggct tacaaattct tgagcagttg ctcaaagacg agaatggggt gtatcaagtg 8220ggtgtcatgc ctatcaactg gacacaattc ttagcaaggc aattgactcc gcagccgttc 8280ttcagcgatg ccatgaagag tattgacacc tctgtaggta aactaacctt gcaggagcgg 8340gactcttgcc cccaaggtta cgggcataat attcgagagc aattagagaa cgctccgccc 8400aaagagggtc tgactctctt gcaggctcat gttcgggagc aggtttccca agttttgggg 8460atagacacga agacattatt ggcagaacaa gacgtgggtt tctttaccct ggggatggat 8520tcgctgacct ctgtcgagtt aagaaacagg ttacaagcca gtttgggctg ctctctttct 8580tccactttgg cttttgacta tccaacacaa caggctcttg tgaattatct tgccaatgaa 8640ttgctgggaa cccctgagca gctacaagag cctgaatctg atgaagaaga tcagatatcg 8700tcaatggatg acatcgtgca gttgctgtcc gcgaaactag agatggaaat ttaa 87541002917PRTCylindrospermopsis raciborskii AWT205 100Met Gln Lys Arg Glu Ser Pro Gln Ile Leu Phe Asp Gly Asn Gly Thr1 5 10 15Gln Ser Glu Phe Pro Asp Ser Cys Ile His His Leu Phe Glu Asp Gln 20 25 30Ala Ala Lys Arg Pro Asp Ala Ile Ala Leu Ile Asp Gly Glu Gln Ser 35 40 45Leu Thr Tyr Gly Glu Leu Asn Val Arg Ala Asn His Leu Ala Gln His 50 55 60Leu Leu Ser Leu Gly Cys Gln Pro Asp Asp Leu Leu Ala Ile Cys Ile65 70 75 80Glu Arg Ser Ala Glu Leu Phe Ile Gly Leu Leu Gly Ile Leu Lys Ala 85 90 95Gly Cys Ala Tyr Val Pro Leu Asp Val Gly Tyr Pro Gly Asp Arg Ile 100 105 110Glu Tyr Met Leu Arg Asp Ser Asp Ala Arg Ile Leu Leu Thr Ser Thr 115 120 125Asp Val Ala Lys Lys Leu Ala Leu Thr Ile Pro Ala Leu Gln Glu Cys 130 135 140Gln Thr Val Tyr Leu Asp Gln Glu Ile Phe Glu Tyr Asp Phe His Phe145 150 155 160Leu Ala Ile Ala Lys Leu Leu His Asn Gln Tyr Leu Arg Leu Leu His 165 170 175Phe Tyr Phe Tyr Thr Leu Ile Gln Gln Cys Gln Ala Thr Ser Val Ser 180 185 190Gln Gly Ile Gln Thr Gln Val Leu Pro Asn Asn Leu Ala Tyr Cys Ile 195 200 205Tyr Thr Ser Gly Ser Thr Gly Asn Pro Lys Gly Ile Leu Met Glu His 210 215 220Arg Ser Leu Val Asn Met Leu Trp Trp His Gln Gln Thr Arg Pro Ser225 230 235 240Val Gln Gly Val Arg Thr Leu Gln Phe Cys Ala Val Ser Phe Asp Phe 245 250 255Ser Cys His Glu Ile Phe Ser Thr Leu Cys Leu Gly Gly Ile Leu Val 260 265 270Leu Val Pro Glu Ala Val Arg Gln Asn Pro Phe Ala Leu Ala Glu Phe 275 280 285Ile Ser Gln Gln Lys Ile Glu Lys Leu Phe Leu Pro Val Ile Ala Leu 290 295 300Leu Gln Leu Ala Glu Ala Val Asn Gly Asn Lys Ser Thr Ser Leu Ala305 310 315 320Leu Cys Glu Val Ile Thr Thr Gly Glu Gln Met Gln Ile Thr Pro Ala 325 330 335Val Ala Asn Leu Phe Gln Lys Thr Gly Ala Met Leu His Asn His Tyr 340 345 350Gly Ala Thr Glu Phe Gln Asp Ala Thr Thr His Thr Leu Lys Gly Asn 355 360 365Pro Glu Gly Trp Pro Thr Leu Val Pro Val Gly Arg Pro Leu His Asn 370 375 380Val Gln Val Tyr Ile Leu Asp Glu Ala Gln Gln Pro Val Pro Leu Gly385 390 395 400Gly Glu Gly Glu Phe Cys Ile Gly Gly Ile Gly Leu Ala Arg Gly Tyr 405 410 415His Asn Leu Pro Asp Leu Thr Asn Glu Lys Phe Ile Pro Asn Pro Phe 420 425 430Gly Ala Asn Glu Asn Ala Lys Lys Leu Tyr Arg Thr Gly Asp Leu Ala 435 440 445Arg Tyr Leu Pro Asp Gly Thr Ile Glu His Leu Gly Arg Ile Asp His 450 455 460Gln Val Lys Ile Arg Gly Phe Arg Val Glu Leu Gly Glu Ile Glu Ser465 470 475 480Val Leu Ala Ser His Gln Ala Val Arg Glu Cys Ala Val Val Ala Arg 485 490 495Glu Ile Ala Gly His Thr Gln Leu Val Gly Tyr Ile Ile Ala Lys Asp 500 505 510Thr Leu Asn Leu Ser Phe Asp Lys Leu Glu Pro Ile Leu Arg Gln Tyr 515 520 525Ser Glu Ala Val Leu Pro Glu Tyr Met Ile Pro Thr Arg Phe Ile Asn 530 535 540Ile Ser Asn Met Pro Leu Thr Pro Ser Gly Lys Leu Asp Arg Arg Ala545 550 555 560Leu Pro Asp Pro Lys Gly Asp Arg Pro Ala Leu Ser Thr Pro Leu Val 565 570 575Lys Pro Arg Thr Gln Thr Glu Lys Arg Leu Ala Glu Ile Trp Gly Ser 580 585 590Tyr Leu Ala Val Asp Ile Val Gly Thr His Asp Asn Phe Phe Asp Leu 595 600 605Gly Gly Thr Ser Leu Leu Leu Thr Gln Ala His Lys Phe Leu Cys Glu 610 615 620Thr Phe Asn Ile Asn Leu Ser Ala Val Ser Leu Phe Gln Tyr Pro Thr625 630 635 640Ile Gln Thr Leu Ala Gln Tyr Ile Asp Cys Gln Gly Asp Thr Thr Ser 645 650 655Ser Asp Thr Ala Ser Arg His Lys Lys Val Arg Lys Lys Gln Ser Gly 660 665 670Asp Ser Asn Asp Ile Ala Ile Ile Ser Val Ala Gly Arg Phe Pro Gly 675 680 685Ala Glu Thr Ile Glu Gln Phe Trp His Asn Leu Cys Asn Gly Val Glu 690 695 700Ser Ile Thr Leu Phe Ser Asp Asp Glu Leu Glu Gln Thr Leu Pro Glu705 710 715 720Leu Phe Asn Asn Pro Ala Tyr Val Lys Ala Gly Ala Val Leu Glu Gly 725 730 735Val Glu Leu Phe Asp Ala Thr Phe Phe Gly Tyr Ser Pro Lys Glu Ala 740 745 750Ala Val Thr Asp Pro Gln Gln Arg Ile Leu Leu Glu Cys Ala Trp Glu 755 760 765Ala Phe Glu Arg Ala Gly Tyr Asn Pro Glu Thr Tyr Pro Glu Pro Val 770 775 780Gly Val Tyr Ala Gly Ser Ser Leu Ser Thr Tyr Leu Leu Asn Asn Ile785 790 795 800Gly Ser Ala Leu Gly Ile Ile Thr Glu Gln Pro Phe Ile Glu Thr Asp 805 810 815Met Glu Gln Phe Gln Ala Lys Ile Gly Asn Asp Arg Ser Tyr Leu Ala 820 825 830Thr Arg Ile Ser Tyr Lys Leu Asn Leu Lys Gly Pro Ser Val Asn Val 835 840 845Gln Thr Ala Cys Ser Thr Ser Leu Val Ala Val His Met Ala Cys Gln 850 855 860Ser Leu Ile Ser Gly Glu Cys Gln Met Ala Leu Ala Gly Gly Ile Ser865 870 875 880Val Val Val Pro Gln Lys Gly Gly Tyr Leu Tyr Glu Glu Gly Met Val 885 890 895Arg Ser Gln Asp Gly His Cys Arg Ala Phe Asp Ala Glu Ala Gln Gly 900 905 910Thr Ile Phe Gly Asn Gly Gly Gly Leu Val Leu Leu Lys Arg Leu Gln 915 920 925Asp Ala Leu Asp Asp Asn Asp Asn Ile Met Ala Val Ile Lys Ala Thr 930 935 940Ala Ile Asn Asn Asp Gly Ala Leu Lys Met Gly Tyr Thr Ala Pro Ser945 950 955 960Val Asp Gly Gln Ala Asp Val Ile Ser Glu Ala Ile Ala Ile Ala Asp 965 970 975Ile Asp Ala Ser Thr Ile Gly Tyr Val Glu Ala His Gly Thr Ala Thr 980 985 990Gln Leu Gly Asp Pro Ile Glu Val Ala Gly Leu Ala Arg Ala Phe Gln 995 1000 1005Arg Ser Thr Asp Ser Val Leu Gly Lys Gln Gln Cys Ala Ile Gly 1010 1015 1020Ser Val Lys Thr Asn Ile Gly His Leu Asp Glu Ala Ala Gly Ile 1025 1030 1035Ala Gly Leu Ile Lys Ala Ala Leu Ala Leu Gln Tyr Gly Gln Ile 1040 1045 1050Pro Pro Ser Leu His Tyr Ala Asn Pro Asn Pro Arg Ile Asp Phe 1055 1060 1065Asp Ala Thr Pro Phe Phe Val Asn Thr Glu Leu Arg Glu Trp Ser 1070 1075 1080Arg Asn Gly Tyr Pro Arg Arg Ala Gly Val Ser Ser Phe Gly Val 1085 1090 1095Gly Gly Thr Asn Ser His Ile Val Leu Glu Glu Ser Pro Val Lys 1100 1105 1110Gln Pro Thr Leu Phe Ser Ser Leu Pro Glu Arg Ser His His Leu 1115 1120 1125Leu Thr Leu Ser Ala His Thr Gln Glu Ala Leu His Glu Leu Val 1130 1135 1140Gln Arg Tyr Ile Gln His Asn Glu Thr His Leu Asp Ile Asn Leu 1145 1150 1155Gly Asp Leu Cys Phe Thr Ala Asn Thr Gly Arg Lys His Phe Glu 1160 1165 1170His Arg Leu Ala Val Val Ala Glu Ser Ile Pro Gly Leu Gln Ala 1175 1180 1185Gln Leu Glu Thr Ala Gln Thr Ala Ile Ser Ala Gln Lys Lys Asn 1190 1195 1200Ala Pro Pro Thr Ile Ala Phe Leu Phe Thr Gly Gln Gly Ser Gln 1205 1210 1215Tyr Ile Asn Met Gly Arg Thr Leu Tyr Asp Thr Glu Ser Thr Phe 1220 1225 1230Arg Ala Ala Leu Asp Arg Cys Glu Thr Ile Leu Gln Asn Leu Gly 1235 1240 1245Ile Glu Ser Ile Leu Ser Val Ile Phe Gly Ser Ser Glu His Gly 1250 1255 1260Leu Ser Leu Asp Asp Thr Ala Tyr Thr Gln Pro Ala Leu Phe Ala 1265 1270 1275Ile Glu Tyr Ala Leu Tyr Gln Leu Trp Lys Ser Trp Gly Ile Gln 1280 1285 1290Pro Ser Val Val Ile Gly His Ser Val Gly Glu Tyr Val Ser Ala 1295 1300 1305Cys Val Ala Gly Val Phe Ser Leu Glu Asp Gly Leu Lys Leu Ile 1310 1315 1320Ala Glu Arg Gly Arg Leu Ile Gln Ala Leu Pro Arg Asp Gly Ser 1325 1330 1335Met Val Ser Val Met Ala Ser Glu Lys Arg Ile Ala Asp Ile Ile 1340 1345 1350Leu Pro Tyr Gly Gly Gln Val Gly Ile Ala Ala Ile Asn Gly Pro 1355 1360 1365Gln Ser Val Val Ile Ser Gly Gln Gln Gln Ala Ile Asp Ala Ile 1370 1375 1380Cys Ala Ile Leu Glu Thr Glu Gly Ile Lys Ser Lys Lys Leu Asn 1385 1390 1395Val Ser His Ala Phe His Ser Pro Leu Val Glu Ala Met Leu Asp 1400 1405 1410Ser Phe Leu Gln Val Ala Gln Glu Val Thr Tyr Ser Gln Pro Gln 1415 1420 1425Ile Lys Leu Ile Ser Asn Val Thr Gly Thr Leu Ala Ser His Glu 1430 1435 1440Ser Cys Pro Asp Glu Leu Pro Ile Thr Thr Ala Glu Tyr Trp Val 1445 1450 1455Arg His Val Arg Gln Pro Val Arg Phe Ala Ala Gly Met Glu Ser 1460 1465 1470Leu Glu Gly Gln Gly Val Asn Val Phe Ile Glu Ile Gly Pro Lys 1475 1480 1485Pro Val Leu Leu Gly Met Gly Arg Asp Cys Leu Pro Glu Gln Glu 1490 1495 1500Gly Leu Trp Leu Pro Ser Leu Arg Pro Lys Gln Asp Asp Trp Gln 1505 1510 1515Gln Val Leu Ser Ser Leu Arg Asp Leu Tyr Leu Ala Gly Val Thr 1520 1525 1530Val Asp Trp Ser Ser Phe Asp Gln Gly Tyr Ala Arg Arg Arg Val 1535 1540 1545Pro Leu Pro Thr Tyr Pro Trp Gln Arg Glu Arg His Trp Val Glu 1550 1555 1560Pro Ile Ile Arg Gln Arg Gln Ser Val Leu Gln Ala Thr Asn Thr 1565 1570 1575Thr Lys Leu Thr Arg Asn Ala Ser Val Ala Gln His Pro Leu Leu 1580 1585 1590Gly Gln Arg Leu His Leu Ser Arg Thr Gln Glu Ile Tyr Phe Gln 1595 1600 1605Thr Phe Ile His Ser Asp Phe Pro Ile Trp Val Ala Asp His Lys 1610 1615 1620Val Phe Gly Asn Val Ile Ile Pro Gly Val Ala Tyr Phe Glu Met 1625 1630 1635Ala Leu Ala Ala Gly Lys Ala Leu Lys Pro Asp Ser Ile Phe Trp 1640 1645 1650Leu Glu Asp Val Ser Ile Ala Gln Ala Leu Ile Ile Pro Asp Glu 1655 1660 1665Gly Gln Thr Val Gln Ile Val Leu Ser Pro Gln Glu Glu Ser Ala

1670 1675 1680Tyr Phe Phe Glu Ile Leu Ser Leu Glu Lys Glu Asn Ser Trp Val 1685 1690 1695Leu His Ala Ser Gly Lys Leu Val Ala Gln Glu Gln Val Leu Glu 1700 1705 1710Thr Glu Pro Ile Asp Leu Ile Ala Leu Gln Ala His Cys Ser Glu 1715 1720 1725Glu Val Ser Val Asp Val Leu Tyr Gln Glu Glu Met Ala Arg Arg 1730 1735 1740Leu Asp Met Gly Pro Met Met Arg Gly Val Lys Gln Leu Trp Arg 1745 1750 1755Tyr Pro Leu Ser Phe Ala Lys Ser His Asp Ala Ile Ala Leu Ala 1760 1765 1770Lys Val Ser Leu Pro Glu Ile Leu Leu His Glu Ser Asn Ala Tyr 1775 1780 1785Gln Phe His Pro Val Ile Leu Asp Ala Gly Leu Gln Met Ile Thr 1790 1795 1800Val Ser Tyr Pro Glu Ala Asn Gln Gly Gln Thr Tyr Val Pro Val 1805 1810 1815Gly Ile Glu Gly Leu Gln Val Tyr Gly Arg Pro Ser Ser Glu Leu 1820 1825 1830Trp Cys Arg Ala Gln Tyr Arg Pro Pro Leu Asp Thr Asp Gln Arg 1835 1840 1845Gln Gly Ile Asp Leu Leu Pro Lys Lys Leu Ile Ala Asp Leu His 1850 1855 1860Leu Phe Asp Thr Gln Gly Arg Val Val Ala Ile Met Phe Gly Val 1865 1870 1875Gln Ser Val Leu Val Gly Arg Glu Ala Met Leu Arg Ser Gln Asp 1880 1885 1890Thr Trp Arg Asn Trp Leu Tyr Gln Val Leu Trp Lys Pro Gln Ala 1895 1900 1905Cys Phe Gly Leu Leu Pro Asn Tyr Leu Pro Thr Pro Asp Lys Ile 1910 1915 1920Arg Lys Arg Leu Glu Thr Lys Leu Ala Thr Leu Ile Ile Glu Ala 1925 1930 1935Asn Leu Ala Thr Tyr Ala Ile Ala Tyr Thr Gln Leu Glu Arg Leu 1940 1945 1950Ser Leu Ala Tyr Val Val Ala Ala Phe Arg Gln Met Gly Trp Leu 1955 1960 1965Phe Gln Pro Gly Glu Arg Phe Ser Thr Ala Gln Lys Val Ser Ala 1970 1975 1980Leu Gly Ile Val Asp Gln His Arg Gln Leu Phe Ala Arg Leu Leu 1985 1990 1995Asp Ile Leu Ala Glu Ala Asp Ile Leu Arg Ser Glu Asn Leu Met 2000 2005 2010Thr Ile Trp Glu Val Ile Ser Tyr Pro Glu Thr Ile Asp Ile Gln 2015 2020 2025Val Leu Leu Asp Asp Leu Glu Ala Lys Glu Ala Glu Ala Glu Val 2030 2035 2040Thr Leu Val Ser Arg Cys Ser Ala Lys Leu Ala Glu Val Leu Gln 2045 2050 2055Gly Lys Cys Asp Pro Ile Gln Leu Leu Phe Pro Ala Gly Asp Thr 2060 2065 2070Thr Thr Leu Ser Lys Leu Tyr Arg Glu Ala Pro Val Leu Gly Val 2075 2080 2085Thr Asn Thr Leu Val Gln Glu Ala Leu Leu Ser Ala Leu Glu Gln 2090 2095 2100Leu Pro Pro Glu Arg Gly Trp Arg Ile Leu Glu Ile Gly Ala Gly 2105 2110 2115Thr Gly Gly Thr Thr Ala Tyr Leu Leu Pro His Leu Pro Gly Asp 2120 2125 2130Gln Thr Lys Tyr Val Phe Thr Asp Ile Ser Ala Phe Phe Leu Ala 2135 2140 2145Lys Ala Glu Glu Arg Phe Lys Asp Tyr Pro Phe Val Arg Tyr Gln 2150 2155 2160Val Leu Asp Ile Glu Gln Ala Pro Gln Ala Gln Gly Phe Glu Pro 2165 2170 2175Gln Ile Tyr Asp Leu Ile Val Ala Ala Asp Val Leu His Ala Thr 2180 2185 2190Ser Asp Leu Arg Gln Thr Leu Val His Ile Arg Gln Leu Leu Ala 2195 2200 2205Pro Gly Gly Met Leu Ile Leu Met Glu Asp Ser Glu Pro Ala Arg 2210 2215 2220Trp Ala Asp Leu Thr Phe Gly Leu Thr Glu Gly Trp Trp Lys Phe 2225 2230 2235Thr Asp His Asp Leu Arg Pro Asn His Pro Leu Leu Ser Pro Glu 2240 2245 2250Gln Trp Gln Ile Leu Leu Ser Glu Met Gly Phe Ser Gln Thr Thr 2255 2260 2265Ala Leu Trp Pro Lys Ile Asp Ser Pro His Lys Leu Pro Arg Glu 2270 2275 2280Ala Val Ile Val Ala Arg Asn Glu Pro Ala Ile Arg Lys Pro Arg 2285 2290 2295Arg Trp Leu Ile Leu Ala Asp Glu Glu Ile Gly Gly Leu Leu Ala 2300 2305 2310Lys Gln Leu Arg Glu Glu Gly Glu Asp Cys Ile Leu Leu Leu Pro 2315 2320 2325Gly Glu Lys Tyr Thr Glu Arg Asp Ser Gln Thr Phe Thr Ile Asn 2330 2335 2340Pro Gly Asp Ile Glu Glu Trp Gln Gln Leu Leu Asn Arg Val Pro 2345 2350 2355Asn Ile Gln Glu Ile Val His Cys Trp Ser Met Val Ser Thr Asp 2360 2365 2370Leu Asp Arg Ala Thr Ile Phe Ser Cys Ser Ser Thr Leu His Leu 2375 2380 2385Val Gln Ala Leu Ala Asn Tyr Pro Lys Asn Pro Arg Leu Ser Leu 2390 2395 2400Val Thr Leu Gly Ala Gln Ala Val Asn Glu His His Val Gln Asn 2405 2410 2415Val Val Gly Ala Ala Leu Trp Gly Met Gly Lys Val Ile Ala Leu 2420 2425 2430Glu His Pro Glu Leu Gln Val Ala Gln Met Asp Leu Asp Pro Asn 2435 2440 2445Gly Lys Val Lys Ala Gln Val Glu Val Leu Arg Asp Glu Leu Leu 2450 2455 2460Ala Arg Lys Asp Pro Ala Ser Ala Met Ser Val Pro Asp Leu Gln 2465 2470 2475Thr Arg Pro His Glu Lys Gln Ile Ala Phe Arg Glu Gln Thr Arg 2480 2485 2490Tyr Val Ala Arg Leu Ser Pro Leu Asp Arg Pro Asn Pro Gly Glu 2495 2500 2505Lys Gly Thr Gln Glu Ala Leu Thr Phe Arg Asp Asp Gly Ser Tyr 2510 2515 2520Leu Ile Ala Gly Gly Leu Gly Gly Leu Gly Leu Val Val Ala Arg 2525 2530 2535Phe Leu Val Thr Asn Gly Ala Lys Tyr Leu Val Leu Val Gly Arg 2540 2545 2550Arg Gly Ala Arg Glu Glu Gln Gln Ala Gln Leu Ser Glu Leu Glu 2555 2560 2565Gln Leu Gly Ala Ser Val Lys Val Leu Gln Ala Asp Ile Ala Asp 2570 2575 2580Ala Glu Gln Leu Ala Gln Ala Leu Ser Ala Val Thr Tyr Pro Pro 2585 2590 2595Leu Arg Gly Val Ile His Ala Ala Gly Thr Leu Asn Asp Gly Ile 2600 2605 2610Leu Gln Gln Gln Ser Trp Gln Ala Phe Lys Glu Val Met Asn Pro 2615 2620 2625Lys Val Ala Gly Ala Trp Asn Leu His Ile Leu Thr Lys Asn Gln 2630 2635 2640Pro Leu Asp Phe Phe Val Leu Phe Ser Ser Ala Thr Ser Leu Leu 2645 2650 2655Gly Asn Ala Gly Gln Ala Asn His Ala Ala Ala Asn Ala Phe Leu 2660 2665 2670Asp Gly Leu Ala Ser Tyr Arg Arg His Leu Gly Leu Pro Ser Leu 2675 2680 2685Ser Ile Asn Trp Gly Thr Trp Ser Glu Val Gly Ile Ala Ala Arg 2690 2695 2700Leu Glu Leu Asp Lys Leu Ser Ser Lys Gln Gly Glu Gly Thr Ile 2705 2710 2715Thr Leu Gly Gln Gly Leu Gln Ile Leu Glu Gln Leu Leu Lys Asp 2720 2725 2730Glu Asn Gly Val Tyr Gln Val Gly Val Met Pro Ile Asn Trp Thr 2735 2740 2745Gln Phe Leu Ala Arg Gln Leu Thr Pro Gln Pro Phe Phe Ser Asp 2750 2755 2760Ala Met Lys Ser Ile Asp Thr Ser Val Gly Lys Leu Thr Leu Gln 2765 2770 2775Glu Arg Asp Ser Cys Pro Gln Gly Tyr Gly His Asn Ile Arg Glu 2780 2785 2790Gln Leu Glu Asn Ala Pro Pro Lys Glu Gly Leu Thr Leu Leu Gln 2795 2800 2805Ala His Val Arg Glu Gln Val Ser Gln Val Leu Gly Ile Asp Thr 2810 2815 2820Lys Thr Leu Leu Ala Glu Gln Asp Val Gly Phe Phe Thr Leu Gly 2825 2830 2835Met Asp Ser Leu Thr Ser Val Glu Leu Arg Asn Arg Leu Gln Ala 2840 2845 2850Ser Leu Gly Cys Ser Leu Ser Ser Thr Leu Ala Phe Asp Tyr Pro 2855 2860 2865Thr Gln Gln Ala Leu Val Asn Tyr Leu Ala Asn Glu Leu Leu Gly 2870 2875 2880Thr Pro Glu Gln Leu Gln Glu Pro Glu Ser Asp Glu Glu Asp Gln 2885 2890 2895Ile Ser Ser Met Asp Asp Ile Val Gln Leu Leu Ser Ala Lys Leu 2900 2905 2910Glu Met Glu Ile 29151015667DNACylindrospermopsis raciborskii AWT205 101atggatgaaa aactaagaac atacgaacga ttaatcaagc aatcctatca caagatagag 60gctctggaag ctgaagttaa caggttgaag caaacccaat gtgaacctat cgccatcgtc 120ggcatgggct gtcgttttcc tggtgcgaat agtccagaag cgttttggca gttgttgtgt 180gatggggttg atgctattcg tgagatacca aaaaatcgat gggttgttga tgcctacata 240gatgaaaatt tggaccgcgc agacaagaca tcaatgcgat ttggcgggtt tgtcgagcaa 300cttgagaagt ttgatgccca attctttggc atatcaccgc gagaagcggt ttctcttgac 360cctcagcaac gtttgttatt agaagtaagt tgggaagcac tggaaaatgc agcggtgata 420ccaccttcgg caacgggcgt attcgtcggt attagtaacc ttgattatcg tgaaacgctc 480ttgaagcaag gagcaattgg tacttatttt gcttcgggta atgcccatag cacagccagt 540ggtcgcttgt cttactttct cggtctgaca ggcccctgtc tctcgataga tacagcttgt 600tcttcgtcgt tggtcgctgt acatcagtca ctgataagtc tgcgtcagcg agaatgtgac 660ttagcgttgg ttgggggagt ccatcggctg atagccccag aggaaagtgt ctcgttagca 720aaagcccata tgttatctcc cgatggtcgt tgcaaagtct ttgatgcgtc ggcaaacggg 780tatgtccgag ccgaaggatg tggcatgata gtcctcaaac gattatcgga cgcgcaagct 840gatggggata aaatcttggc gttgattcgc gggtcagcca taaatcaaga cggtcgcacg 900agtggcttga ccgttccaaa tggtccccaa caagccgacg tgattcgcca agccctcgcc 960aatagtggca taagaccaga acaagttaac tatgtagaag ctcatggcac agggacttcc 1020ctaggagacc cgattgaggt cggcgcgttg ggaacgatct ttaatcaacg ctcccaacct 1080ttaattattg gttcagttaa aacaaatatt gggcatctag aagcagcagc agggattgct 1140ggactgatta aagtcgtcct tgccatgcag catggagaaa ttccacctaa tttacacttt 1200caccagccca atcctcgcat taactgggat aaattgccaa tcaggatccc cacagaacga 1260acagcttggc ctactggcga tcgcatcgca gggataagtt ctttcggctt tagtggcact 1320aattctcatg tcgtgttaga ggaagcccca aaaatagagc cgtctacttt agagattcat 1380tcaaagcagt atgtttttac cttatcagca gcgacacctc aagcactaca agaacttact 1440cagcgttatg taacttatct cactgaacac ttacaagaga gtctggcgga tatttgcttt 1500acagccaaca cagggcgcaa acactttaga catcgctttg cagtagtagc agagtctaaa 1560acccagttgc gccaacaatt ggaaacgttt gcccaatcgg gagaggggca ggggaagagg 1620acatctctct caaaaatagc ttttctcttt acaggtcaag gctcacagta tgtggggatg 1680gggcaagaac tttatgagag ccaacccacc ttccggcaaa ccattgaccg atgtgatgag 1740attcttcgtt cactgttggg caaatcaatc ctctcaatac tctatcccag ccaacaaatg 1800ggattggaaa cgccatccca aattgatgaa accgcctata ctcaacccac tcttttttct 1860cttgaatatg cactggcgca gttgtggcgc tcctggggta ttgagcctga tgtggtgatg 1920gggcatagtg tgggagaata tgtggccgct tgtgtggcgg gtgtcttttc tttagaggat 1980ggactcaaac taattgctga aagaggccgt ctgatgcaag aattgcctcc cgatggggcg 2040atggtttcag ttatggccaa taaatcgcgc atagagcaag caattcaatc tgtcagccga 2100gaggtttcta ttgcggccat caatggacct gagagtgtgg ttatctctgg taaaagggag 2160atattacaac agattaccga acatctggtt gccgaaggca ttaagacacg ccaactgaag 2220gtctctcatg cctttcactc accattgatg gagccaatat taggtcagtt ccgccgagtt 2280gccaatacca tcacctatcg gccaccgcaa attaaccttg tctcaaatgt cacaggcgga 2340caggtgtata aagaaatcgc tactcccgat tattgggtga gacatctgca agagactgtc 2400cgttttgcgg atggggttaa ggtgttacat gaacagaatg tcaatttcat gctcgaaatt 2460ggtcccaaac ccacactgct gggcatggtt gagttacaaa gttctgagaa tccattttct 2520atgccaatga tgatgcccag tttgcgtcag aatcgtagcg actggcagca gatgttggag 2580agcttgagtc aactctatgt tcatggtgtt gagattgact ggatcggttt taataaagac 2640tatgtgcgac ataaagttgt cctgccgaca tacccatggc agaaggagcg ttactgggta 2700gaattggatc aacagaagca cgccgctaaa aatctacatc ctctactgga caggtgcatg 2760aagctgcctc gtcataacga aacaattttt gagaaagaat ttagtctaga gacattgccc 2820tttcttgctg actatcgcat ttatggttca gttgtgtcgc caggtgcaag ttatctatca 2880atgatactaa gtattgccga gtcgtatgca aatggtcatt tgaatggagg gaatagtgca 2940aagcaaacca cttatttact aaaggatgtc acattcccag tacctcttgt gatctctgat 3000gaggcaaatt acatggtgca agttgcttgt tctctctctt gtgctgcgcc acacaatcgt 3060ggcgacgaga cgcagtttga attgttcagt tttgctgaga atgtacctga aagtagcagt 3120ataaatgctg attttcagac acccattatt catgcaaaag ggcaatttaa gcttgaagat 3180acagcacctc ctaaagtgga gctagaagaa ctacaagcgg gttgtcccca agaaattgat 3240ctcaaccttt tctatcaaac attcacagac aaaggttttg tttttggatc tcgttttcgc 3300tggttagaac aaatctgggt gggcgatgga gaagcattgg cgcgtctgcg acaaccggaa 3360agtattgaat cgtttaaagg atatgtgatt catcccggtt tgttggatgc ctgtacacaa 3420gtcccatttg caatttcgtc tgacgatgaa aataggcaat cagaaacgac aatgcccttt 3480gcgctgaatg aattacgttg ttatcagcct gcaaacggac aaatgtggtg ggttcatgca 3540acagaaaaag atagatatac atgggatgtt tctctgtttg atgagagcgg gcaagttatt 3600gcggaattta taggtttaga agttcgtgct gctatgcccg aaggcttact aagggcagac 3660ttttggcata actggctcta tacagtgaat tggcgatcgc aacctctaca aatcccagag 3720gtgctggata ttaataagac aggtgcagaa acatggcttc tttttgcaca accagaggga 3780ataggagcgg acttagccga atatttgcag agccaaggaa agcactgtgt ttttgtagtg 3840cctgggagtg agtatacagt gaccgagcaa cacattggac gcactggaca tcttgatgtg 3900acgaaactga caaaaattgt cacgatcaat cctgcttctc ctcatgacta taaatatttt 3960ttagaaactc tgacggacat tagattacct tgtgaacata tactctattt atggaatcgt 4020tatgatttaa caaatacttc taatcatcgg acagaattga ctgtaccaga tatagtctta 4080aacttatgta ctagtcttac ttatttggta caagccctta gccacatggg tttttccccg 4140aaattatggc taattacaca aaatagtcaa gcggttggta gtgacttagc gaatttagaa 4200atcgaacaat ccccattatg ggcattgggt cgaagcatcc gcgccgaaca ccctgaattt 4260gattgccgtt gtttagattt tgacacgctc tcaaatatcg caccactctt gttgaaagag 4320atgcaagcta tagactatga atctcaaatt gcttaccgac aaggaacgcg ctatgttgca 4380cgactaattc gtaatcaatc agaatgtcac gcaccgattc aaacaggaat ccgtcctgat 4440ggcagctatt tgattacagg tggattaggc ggtctaggat tgcaggtagc actcgccctt 4500gcggacgctg gagcaagaca cttgatcctc aatagtcgcc gtggtacggt ctccaaagaa 4560gcccagttaa ttattgaccg actacgccaa gaggatgtta gggttgattt gattgcggca 4620gatgtctctg atgcggcaga tagcgaacga ctcttagtag aaagtcagcg caagacctct 4680cttcgaggga ttgtccatgt tgcgggagtc ttggatgatg gcatcctgct ccaacaaaat 4740caagagcgtt ttgaaaaagt gatggcggct aaggtacgcg gagcttggca tctggaccaa 4800cagagccaaa ccctcgattt agatttcttt gttgcgttct catctgttgc gtcgctcata 4860gaagaaccag gacaagccaa ttacgccgca gcgaatgcgt ttttggattc attaatgtat 4920tatcgtcaca taaagggatc taatagcttg agtatcaact ggggggcttg ggcagaagtc 4980ggcatggcag ccaatttatc atgggaacaa cggggaatcg cggcaatttc tccaaagcaa 5040gggaggcata ttctcgtcca acttattcaa aaacttaatc agcatacaat cccccaagtt 5100gctgtacaac cgaccaattg ggctgaatat ctatcccatg atggcgtgaa tatgccattc 5160tatgaatatt ttacacacca cttgcgtaac gaaaaagaag ccaaattgcg gcaaacagca 5220ggcagcacct cagaggaagt cagtctgcgg caacagcttc aaacactctc agagaaagac 5280cgggatgccc ttttgatgga acatcttcaa aaaactgcga tcagagttct cggtttggca 5340tctaatcaaa aaattgatcc ctatcaggga ttgatgaata tgggactaga ctctttgatg 5400gcggttgaat ttcggaatca cttgatacgt agtttagaac gccctctgcc agccactctg 5460ctctttaatt gcccaacact tgattcattg catgattacc tagtcgcaaa aatgtttgat 5520gatgcccctc agaaggcaga gcaaatggca caaccaacaa cactgacagc acacagcata 5580tcaatagaat ccaaaataga tgataacgaa agcgtggatg acattgcaca aatgctggca 5640caagcactca atatcgcctt tgagtag 56671021888PRTCylindrospermopsis raciborskii AWT205 102Met Asp Glu Lys Leu Arg Thr Tyr Glu Arg Leu Ile Lys Gln Ser Tyr1 5 10 15His Lys Ile Glu Ala Leu Glu Ala Glu Val Asn Arg Leu Lys Gln Thr 20 25 30Gln Cys Glu Pro Ile Ala Ile Val Gly Met Gly Cys Arg Phe Pro Gly 35 40 45Ala Asn Ser Pro Glu Ala Phe Trp Gln Leu Leu Cys Asp Gly Val Asp 50 55 60Ala Ile Arg Glu Ile Pro Lys Asn Arg Trp Val Val Asp Ala Tyr Ile65 70 75 80Asp Glu Asn Leu Asp Arg Ala Asp Lys Thr Ser Met Arg Phe Gly Gly 85 90 95Phe Val Glu Gln Leu Glu Lys Phe Asp Ala Gln Phe Phe Gly Ile Ser 100 105 110Pro Arg Glu Ala Val Ser Leu Asp Pro Gln Gln Arg Leu Leu Leu Glu 115 120 125Val Ser Trp Glu Ala Leu Glu Asn Ala Ala Val Ile Pro Pro Ser Ala 130 135 140Thr Gly Val Phe Val Gly Ile Ser Asn Leu Asp Tyr Arg Glu Thr Leu145 150 155 160Leu Lys Gln Gly Ala Ile Gly Thr Tyr Phe Ala Ser Gly Asn Ala His 165 170 175Ser Thr Ala Ser Gly Arg Leu Ser Tyr Phe Leu Gly Leu Thr Gly Pro 180 185 190Cys Leu Ser Ile Asp Thr Ala Cys Ser Ser Ser Leu Val Ala Val His 195 200 205Gln Ser Leu Ile Ser Leu Arg Gln Arg Glu Cys Asp Leu Ala Leu Val 210 215 220Gly Gly Val His Arg Leu Ile Ala Pro Glu Glu Ser Val Ser Leu Ala225 230 235 240Lys Ala His Met Leu Ser Pro Asp Gly Arg Cys Lys Val Phe Asp Ala 245 250 255Ser Ala Asn Gly Tyr

Val Arg Ala Glu Gly Cys Gly Met Ile Val Leu 260 265 270Lys Arg Leu Ser Asp Ala Gln Ala Asp Gly Asp Lys Ile Leu Ala Leu 275 280 285Ile Arg Gly Ser Ala Ile Asn Gln Asp Gly Arg Thr Ser Gly Leu Thr 290 295 300Val Pro Asn Gly Pro Gln Gln Ala Asp Val Ile Arg Gln Ala Leu Ala305 310 315 320Asn Ser Gly Ile Arg Pro Glu Gln Val Asn Tyr Val Glu Ala His Gly 325 330 335Thr Gly Thr Ser Leu Gly Asp Pro Ile Glu Val Gly Ala Leu Gly Thr 340 345 350Ile Phe Asn Gln Arg Ser Gln Pro Leu Ile Ile Gly Ser Val Lys Thr 355 360 365Asn Ile Gly His Leu Glu Ala Ala Ala Gly Ile Ala Gly Leu Ile Lys 370 375 380Val Val Leu Ala Met Gln His Gly Glu Ile Pro Pro Asn Leu His Phe385 390 395 400His Gln Pro Asn Pro Arg Ile Asn Trp Asp Lys Leu Pro Ile Arg Ile 405 410 415Pro Thr Glu Arg Thr Ala Trp Pro Thr Gly Asp Arg Ile Ala Gly Ile 420 425 430Ser Ser Phe Gly Phe Ser Gly Thr Asn Ser His Val Val Leu Glu Glu 435 440 445Ala Pro Lys Ile Glu Pro Ser Thr Leu Glu Ile His Ser Lys Gln Tyr 450 455 460Val Phe Thr Leu Ser Ala Ala Thr Pro Gln Ala Leu Gln Glu Leu Thr465 470 475 480Gln Arg Tyr Val Thr Tyr Leu Thr Glu His Leu Gln Glu Ser Leu Ala 485 490 495Asp Ile Cys Phe Thr Ala Asn Thr Gly Arg Lys His Phe Arg His Arg 500 505 510Phe Ala Val Val Ala Glu Ser Lys Thr Gln Leu Arg Gln Gln Leu Glu 515 520 525Thr Phe Ala Gln Ser Gly Glu Gly Gln Gly Lys Arg Thr Ser Leu Ser 530 535 540Lys Ile Ala Phe Leu Phe Thr Gly Gln Gly Ser Gln Tyr Val Gly Met545 550 555 560Gly Gln Glu Leu Tyr Glu Ser Gln Pro Thr Phe Arg Gln Thr Ile Asp 565 570 575Arg Cys Asp Glu Ile Leu Arg Ser Leu Leu Gly Lys Ser Ile Leu Ser 580 585 590Ile Leu Tyr Pro Ser Gln Gln Met Gly Leu Glu Thr Pro Ser Gln Ile 595 600 605Asp Glu Thr Ala Tyr Thr Gln Pro Thr Leu Phe Ser Leu Glu Tyr Ala 610 615 620Leu Ala Gln Leu Trp Arg Ser Trp Gly Ile Glu Pro Asp Val Val Met625 630 635 640Gly His Ser Val Gly Glu Tyr Val Ala Ala Cys Val Ala Gly Val Phe 645 650 655Ser Leu Glu Asp Gly Leu Lys Leu Ile Ala Glu Arg Gly Arg Leu Met 660 665 670Gln Glu Leu Pro Pro Asp Gly Ala Met Val Ser Val Met Ala Asn Lys 675 680 685Ser Arg Ile Glu Gln Ala Ile Gln Ser Val Ser Arg Glu Val Ser Ile 690 695 700Ala Ala Ile Asn Gly Pro Glu Ser Val Val Ile Ser Gly Lys Arg Glu705 710 715 720Ile Leu Gln Gln Ile Thr Glu His Leu Val Ala Glu Gly Ile Lys Thr 725 730 735Arg Gln Leu Lys Val Ser His Ala Phe His Ser Pro Leu Met Glu Pro 740 745 750Ile Leu Gly Gln Phe Arg Arg Val Ala Asn Thr Ile Thr Tyr Arg Pro 755 760 765Pro Gln Ile Asn Leu Val Ser Asn Val Thr Gly Gly Gln Val Tyr Lys 770 775 780Glu Ile Ala Thr Pro Asp Tyr Trp Val Arg His Leu Gln Glu Thr Val785 790 795 800Arg Phe Ala Asp Gly Val Lys Val Leu His Glu Gln Asn Val Asn Phe 805 810 815Met Leu Glu Ile Gly Pro Lys Pro Thr Leu Leu Gly Met Val Glu Leu 820 825 830Gln Ser Ser Glu Asn Pro Phe Ser Met Pro Met Met Met Pro Ser Leu 835 840 845Arg Gln Asn Arg Ser Asp Trp Gln Gln Met Leu Glu Ser Leu Ser Gln 850 855 860Leu Tyr Val His Gly Val Glu Ile Asp Trp Ile Gly Phe Asn Lys Asp865 870 875 880Tyr Val Arg His Lys Val Val Leu Pro Thr Tyr Pro Trp Gln Lys Glu 885 890 895Arg Tyr Trp Val Glu Leu Asp Gln Gln Lys His Ala Ala Lys Asn Leu 900 905 910His Pro Leu Leu Asp Arg Cys Met Lys Leu Pro Arg His Asn Glu Thr 915 920 925Ile Phe Glu Lys Glu Phe Ser Leu Glu Thr Leu Pro Phe Leu Ala Asp 930 935 940Tyr Arg Ile Tyr Gly Ser Val Val Ser Pro Gly Ala Ser Tyr Leu Ser945 950 955 960Met Ile Leu Ser Ile Ala Glu Ser Tyr Ala Asn Gly His Leu Asn Gly 965 970 975Gly Asn Ser Ala Lys Gln Thr Thr Tyr Leu Leu Lys Asp Val Thr Phe 980 985 990Pro Val Pro Leu Val Ile Ser Asp Glu Ala Asn Tyr Met Val Gln Val 995 1000 1005Ala Cys Ser Leu Ser Cys Ala Ala Pro His Asn Arg Gly Asp Glu 1010 1015 1020Thr Gln Phe Glu Leu Phe Ser Phe Ala Glu Asn Val Pro Glu Ser 1025 1030 1035Ser Ser Ile Asn Ala Asp Phe Gln Thr Pro Ile Ile His Ala Lys 1040 1045 1050Gly Gln Phe Lys Leu Glu Asp Thr Ala Pro Pro Lys Val Glu Leu 1055 1060 1065Glu Glu Leu Gln Ala Gly Cys Pro Gln Glu Ile Asp Leu Asn Leu 1070 1075 1080Phe Tyr Gln Thr Phe Thr Asp Lys Gly Phe Val Phe Gly Ser Arg 1085 1090 1095Phe Arg Trp Leu Glu Gln Ile Trp Val Gly Asp Gly Glu Ala Leu 1100 1105 1110Ala Arg Leu Arg Gln Pro Glu Ser Ile Glu Ser Phe Lys Gly Tyr 1115 1120 1125Val Ile His Pro Gly Leu Leu Asp Ala Cys Thr Gln Val Pro Phe 1130 1135 1140Ala Ile Ser Ser Asp Asp Glu Asn Arg Gln Ser Glu Thr Thr Met 1145 1150 1155Pro Phe Ala Leu Asn Glu Leu Arg Cys Tyr Gln Pro Ala Asn Gly 1160 1165 1170Gln Met Trp Trp Val His Ala Thr Glu Lys Asp Arg Tyr Thr Trp 1175 1180 1185Asp Val Ser Leu Phe Asp Glu Ser Gly Gln Val Ile Ala Glu Phe 1190 1195 1200Ile Gly Leu Glu Val Arg Ala Ala Met Pro Glu Gly Leu Leu Arg 1205 1210 1215Ala Asp Phe Trp His Asn Trp Leu Tyr Thr Val Asn Trp Arg Ser 1220 1225 1230Gln Pro Leu Gln Ile Pro Glu Val Leu Asp Ile Asn Lys Thr Gly 1235 1240 1245Ala Glu Thr Trp Leu Leu Phe Ala Gln Pro Glu Gly Ile Gly Ala 1250 1255 1260Asp Leu Ala Glu Tyr Leu Gln Ser Gln Gly Lys His Cys Val Phe 1265 1270 1275Val Val Pro Gly Ser Glu Tyr Thr Val Thr Glu Gln His Ile Gly 1280 1285 1290Arg Thr Gly His Leu Asp Val Thr Lys Leu Thr Lys Ile Val Thr 1295 1300 1305Ile Asn Pro Ala Ser Pro His Asp Tyr Lys Tyr Phe Leu Glu Thr 1310 1315 1320Leu Thr Asp Ile Arg Leu Pro Cys Glu His Ile Leu Tyr Leu Trp 1325 1330 1335Asn Arg Tyr Asp Leu Thr Asn Thr Ser Asn His Arg Thr Glu Leu 1340 1345 1350Thr Val Pro Asp Ile Val Leu Asn Leu Cys Thr Ser Leu Thr Tyr 1355 1360 1365Leu Val Gln Ala Leu Ser His Met Gly Phe Ser Pro Lys Leu Trp 1370 1375 1380Leu Ile Thr Gln Asn Ser Gln Ala Val Gly Ser Asp Leu Ala Asn 1385 1390 1395Leu Glu Ile Glu Gln Ser Pro Leu Trp Ala Leu Gly Arg Ser Ile 1400 1405 1410Arg Ala Glu His Pro Glu Phe Asp Cys Arg Cys Leu Asp Phe Asp 1415 1420 1425Thr Leu Ser Asn Ile Ala Pro Leu Leu Leu Lys Glu Met Gln Ala 1430 1435 1440Ile Asp Tyr Glu Ser Gln Ile Ala Tyr Arg Gln Gly Thr Arg Tyr 1445 1450 1455Val Ala Arg Leu Ile Arg Asn Gln Ser Glu Cys His Ala Pro Ile 1460 1465 1470Gln Thr Gly Ile Arg Pro Asp Gly Ser Tyr Leu Ile Thr Gly Gly 1475 1480 1485Leu Gly Gly Leu Gly Leu Gln Val Ala Leu Ala Leu Ala Asp Ala 1490 1495 1500Gly Ala Arg His Leu Ile Leu Asn Ser Arg Arg Gly Thr Val Ser 1505 1510 1515Lys Glu Ala Gln Leu Ile Ile Asp Arg Leu Arg Gln Glu Asp Val 1520 1525 1530Arg Val Asp Leu Ile Ala Ala Asp Val Ser Asp Ala Ala Asp Ser 1535 1540 1545Glu Arg Leu Leu Val Glu Ser Gln Arg Lys Thr Ser Leu Arg Gly 1550 1555 1560Ile Val His Val Ala Gly Val Leu Asp Asp Gly Ile Leu Leu Gln 1565 1570 1575Gln Asn Gln Glu Arg Phe Glu Lys Val Met Ala Ala Lys Val Arg 1580 1585 1590Gly Ala Trp His Leu Asp Gln Gln Ser Gln Thr Leu Asp Leu Asp 1595 1600 1605Phe Phe Val Ala Phe Ser Ser Val Ala Ser Leu Ile Glu Glu Pro 1610 1615 1620Gly Gln Ala Asn Tyr Ala Ala Ala Asn Ala Phe Leu Asp Ser Leu 1625 1630 1635Met Tyr Tyr Arg His Ile Lys Gly Ser Asn Ser Leu Ser Ile Asn 1640 1645 1650Trp Gly Ala Trp Ala Glu Val Gly Met Ala Ala Asn Leu Ser Trp 1655 1660 1665Glu Gln Arg Gly Ile Ala Ala Ile Ser Pro Lys Gln Gly Arg His 1670 1675 1680Ile Leu Val Gln Leu Ile Gln Lys Leu Asn Gln His Thr Ile Pro 1685 1690 1695Gln Val Ala Val Gln Pro Thr Asn Trp Ala Glu Tyr Leu Ser His 1700 1705 1710Asp Gly Val Asn Met Pro Phe Tyr Glu Tyr Phe Thr His His Leu 1715 1720 1725Arg Asn Glu Lys Glu Ala Lys Leu Arg Gln Thr Ala Gly Ser Thr 1730 1735 1740Ser Glu Glu Val Ser Leu Arg Gln Gln Leu Gln Thr Leu Ser Glu 1745 1750 1755Lys Asp Arg Asp Ala Leu Leu Met Glu His Leu Gln Lys Thr Ala 1760 1765 1770Ile Arg Val Leu Gly Leu Ala Ser Asn Gln Lys Ile Asp Pro Tyr 1775 1780 1785Gln Gly Leu Met Asn Met Gly Leu Asp Ser Leu Met Ala Val Glu 1790 1795 1800Phe Arg Asn His Leu Ile Arg Ser Leu Glu Arg Pro Leu Pro Ala 1805 1810 1815Thr Leu Leu Phe Asn Cys Pro Thr Leu Asp Ser Leu His Asp Tyr 1820 1825 1830Leu Val Ala Lys Met Phe Asp Asp Ala Pro Gln Lys Ala Glu Gln 1835 1840 1845Met Ala Gln Pro Thr Thr Leu Thr Ala His Ser Ile Ser Ile Glu 1850 1855 1860Ser Lys Ile Asp Asp Asn Glu Ser Val Asp Asp Ile Ala Gln Met 1865 1870 1875Leu Ala Gln Ala Leu Asn Ile Ala Phe Glu 1880 18851035004DNACylindrospermopsis raciborskii AWT205 103atgagtcagc ccaattatgg cattttgatg aaaaatgcgt tgaacgaaat aaatagccta 60cgatcgcaac tagctgcggt agaagcccaa aaaaatgagt ctattgccat tgttggtatg 120agttgccgtt ttccaggcgg tgcaactact ccagagcgtt tttgggtatt actgcgcgag 180ggtatatcag ccattacaga aatccctgct gatcgctggg atgttgataa atattatgat 240gctgacccca catcgtccgg taaaatgcat actcgttacg gcggttttct gaatgaagtt 300gatacatttg agccatcatt ctttaatatt gctgcccgtg aagccgttag catggatcca 360cagcaacgct tgctacttga agtcagttgg gaagctctgg aatccggtaa tattgttcct 420gcaactcttt ttgatagttc cactggtgta tttatcggta ttggtggtag caactacaaa 480tctttaatga tcgaaaacag gagtcggatc gggaaaaccg atttgtatga gttaagtggc 540actgatgtga gtgttgctgc cggcaggata tcctatgtcc tgggtttgat gggtcccagt 600tttgtgattg atacagcttg ttcatcttct ttggtctcag ttcatcaagc ctgtcagagt 660ctgcgtcaga gagaatgtga tctagcacta gctggtggag tcggtttact cattgatcca 720gatgagatga ttggtctttc tcaagggggg atgctggcac ctgatggtag ttgtaaaaca 780tttgatgcca atgcaaatgg ctatgtgcga ggcgaaggtt gtgggatgat tgttctaaaa 840cgtctctcgg atgcaacagc cgatggggat aatattcttg ccatcattcg tgggtctatg 900gttaatcatg atggtcatag cagtggttta actgctccaa gaggccccgc acaagtctct 960gtcattaagc aagccttaga tagagcaggt attgcaccgg atgccgtaag ttatttagaa 1020gcccatggta caggcacacc ccttggtgat cctatcgaga tggattcatt gaacgaagtg 1080tttggtcgga gaacagaacc actttgggtc ggctcagtta agacaaatat tggtcattta 1140gaagccgcgt ccggtattgc agggctgatt aaggttgtct tgatgctaaa aaacaagcag 1200attcctcctc acttgcattt caagacacca aatccatata ttgattggaa aaatctcccg 1260gtcgaaattc cgaccaccct tcatgcttgg gatgacaaga cattgaagga cagaaagcga 1320attgcagggg ttagttcttt tagtttcagt ggtactaacg cccacattgt attatctgaa 1380gccccatcta gcgaactaat tagtaatcat gcggcagtgg aaagaccatg gcacttgtta 1440acccttagtg ctaagaatga ggaagcgttg gctaacttgg ttgggcttta tcagtcattt 1500atttctacta ctgatgcaag tcttgccgat atatgctaca ctgctaatac ggcacgaacc 1560catttttctc atcgccttgc tctatcggct acttcacaca tccaaataga ggctctttta 1620gccgcttata aggaagggtc ggtgagtttg agcatcaatc aaggttgtgt cctttccaac 1680agtcgtgcgc cgaaggtcgc ttttctcttt acaggtcaag gttcgcaata tgtgcaaatg 1740gctggagaac tttatgagac ccagcctact ttccgtaatt gcttagatcg ctgtgccgaa 1800atcttgcaat ccatcttttc atcgagaaac agcccttggg gaaacccact gctttcggta 1860ttatatccaa accatgagtc aaaggaaatt gaccagacgg cttataccca acctgccctt 1920tttgctgtag aatatgccct agcacagatg tggcggtcgt ggggaatcga gccagatatc 1980gtaatgggtc atagcatagg tgaatatgtg gcagcttgtg tggcggggat cttttctctg 2040gaggatggtc tcaaacttgc tgccgaaaga ggccgtttga tgcaggcgct accacaaaat 2100ggcgagatgg ttgctatatc ggcctccctt gaggaagtta agccggctat tcaatctgac 2160cagcgagttg tgatagcggc ggtaaatgga ccacgaagtg tcgtcatttc gggcgatcgc 2220caagctgtgc aagtcttcac caacacccta gaagatcaag gaatccggtg caagagactg 2280tctgtttcac acgctttcca ctctccattg atgaaaccaa tggagcagga gttcgcacag 2340gtggccaggg aaatcaacta tagtcctcca aaaatagctc ttgtcagtaa tctaaccggc 2400gacttgattt cacctgagtc ttccctggag gaaggagtga tcgcttcccc tggttactgg 2460gtaaatcatt tatgcaatcc tgtcttgttc gctgatggta ttgcaactat gcaagcgcag 2520gatgtccaag tcttccttga agttggacca aaaccgacct tatcaggact agtgcaacaa 2580tattttgacg aggttgccca tagcgatcgc cctgtcacca ttcccacctt gcgccccaag 2640caacccaact ggcagacact attggagagt ttgggacaac tgtatgcgct tggtgtccag 2700gtaaattggg cgggctttga tagagattac accagacgca aagtaagcct acccacctat 2760gcttggaagc gtcaacgtta ttggctagag aaacagtccg ctccacgttt agaaacaaca 2820caagttcgtc ccgcaactgc cattgtagag catcttgaac aaggcaatgt gccgaaaatc 2880gtggacttgt tagcggcgac ggatgtactt tcaggcgaag cacggaaatt gctacccagc 2940atcattgaac tattggttgc aaaacatcgt gaggaagcga cacagaagcc catctgcgat 3000tggctttatg aagtggtttg gcaaccccag ttgctgaccc tatctacctt acctgctgtg 3060gaaacagagg gtagacaatg gctcatcttc gccgatgcta gtggacacgg tgaagcactt 3120gcggctcaat tacgtcagca aggggatata attacgcttg tctatgctgg tctaaaatat 3180cactcggcta ataataaaca aaataccggg ggggacatcc catattttca gattgatccg 3240atccaaaggg aggattatga aaggttgttt gctgctttgc ctccactgta tggtattgtt 3300catctttgga gtttagatat acttagcttg gacaaagtat ctaacctaat tgaaaatgta 3360caattaggta gtggcacgct attaaattta atacagacag tcttgcaact tgaaacgccc 3420acccctagct tgtggctcgt gacaaagaac gcgcaagctg tgcgtaaaaa cgatagccta 3480gtcggagtgc ttcagtcacc cttatggggt atgggtaagg tgatagcctt agaacaccct 3540gaactcaact gtgtatcaat cgaccttgat ggtgaagggc ttccagatga acaagccaag 3600tttctggcgg ctgaactccg cgccgcctcc gagttcagac ataccaccat tccccacgaa 3660agtcaagttg cttggcgtaa taggactcgc tatgtgtcac ggttcaaagg ttatcagaag 3720catcccgcga cctcatcaaa aatgcctatt cgaccagatg ccacttattt gatcacgggc 3780ggctttggtg gtttgggctt gcttgtggct cgttggatgg ttgaacaggg ggctacccat 3840ctatttctga tgggacgcag ccaacccaaa ccagccgccc aaaaacaact gcaagagata 3900gccgcgctgg gtgcaacagt gacggtggtg caagccgatg ttggcatccg ctcccaagta 3960gccaatgtgt tggcacagat tgataaggca tatcctttgg ctggtattat tcatactgcc 4020ggtgtattag acgacggaat cttattgcag caaaattggg cgcgttttag caaggtgttc 4080gcccccaaac tagagggagc ttggcatcta catacactga ctgaagagat gccgcttgat 4140ttctttattt gtttttcctc aacagcagga ttgctgggca gtggtggaca agctaactat 4200gctgctgcca atgccttttt agatgccttt gcccatcatc ggcgaataca aggcttgcca 4260gctctctcga ttaactggga cgcttggtct caagtgggaa tgacggtacg tctccaacaa 4320gcttcttcac aaagcaccac agttgggcaa gatattagca ctttggaaat ttcaccagaa 4380cagggattgc aaatctttgc ctatcttctg caacaaccat ccgcccaaat agcggccatt 4440tctaccgatg ggcttcgcaa gatgtacgac acaagctcgg ccttttttgc tttacttgat 4500cttgacaggt cttcctccac tacccaggag caatctacac tttctcatga agttggcctt 4560accttactcg aacaattgca gcaagctcgg ccaaaagagc gagagaaaat gttactgcgc 4620catctacaga cccaagttgc tgcggtcttg cgtagtcccg aactgcccgc agttcatcaa 4680cccttcactg acttggggat ggattcgttg atgtcacttg aattgatgcg gcgtttggaa 4740gaaagtctgg ggattcagat gcctgcaacg cttgcattcg attatcctat ggtagaccgt 4800ttggctaagt ttatactgac tcaaatatgt ataaattctg agccagatac ctcagcagtt 4860ctcacaccag atggaaatgg ggaggaaaaa gacagtaata aggacagaag taccagcact 4920tccgttgact caaatattac ttccatggca gaagatttat tcgcactcga atccttacta 4980aataaaataa

aaagagatca ataa 50041041667PRTCylindrospermopsis raciborskii AWT205 104Met Ser Gln Pro Asn Tyr Gly Ile Leu Met Lys Asn Ala Leu Asn Glu1 5 10 15Ile Asn Ser Leu Arg Ser Gln Leu Ala Ala Val Glu Ala Gln Lys Asn 20 25 30Glu Ser Ile Ala Ile Val Gly Met Ser Cys Arg Phe Pro Gly Gly Ala 35 40 45Thr Thr Pro Glu Arg Phe Trp Val Leu Leu Arg Glu Gly Ile Ser Ala 50 55 60Ile Thr Glu Ile Pro Ala Asp Arg Trp Asp Val Asp Lys Tyr Tyr Asp65 70 75 80Ala Asp Pro Thr Ser Ser Gly Lys Met His Thr Arg Tyr Gly Gly Phe 85 90 95Leu Asn Glu Val Asp Thr Phe Glu Pro Ser Phe Phe Asn Ile Ala Ala 100 105 110Arg Glu Ala Val Ser Met Asp Pro Gln Gln Arg Leu Leu Leu Glu Val 115 120 125Ser Trp Glu Ala Leu Glu Ser Gly Asn Ile Val Pro Ala Thr Leu Phe 130 135 140Asp Ser Ser Thr Gly Val Phe Ile Gly Ile Gly Gly Ser Asn Tyr Lys145 150 155 160Ser Leu Met Ile Glu Asn Arg Ser Arg Ile Gly Lys Thr Asp Leu Tyr 165 170 175Glu Leu Ser Gly Thr Asp Val Ser Val Ala Ala Gly Arg Ile Ser Tyr 180 185 190Val Leu Gly Leu Met Gly Pro Ser Phe Val Ile Asp Thr Ala Cys Ser 195 200 205Ser Ser Leu Val Ser Val His Gln Ala Cys Gln Ser Leu Arg Gln Arg 210 215 220Glu Cys Asp Leu Ala Leu Ala Gly Gly Val Gly Leu Leu Ile Asp Pro225 230 235 240Asp Glu Met Ile Gly Leu Ser Gln Gly Gly Met Leu Ala Pro Asp Gly 245 250 255Ser Cys Lys Thr Phe Asp Ala Asn Ala Asn Gly Tyr Val Arg Gly Glu 260 265 270Gly Cys Gly Met Ile Val Leu Lys Arg Leu Ser Asp Ala Thr Ala Asp 275 280 285Gly Asp Asn Ile Leu Ala Ile Ile Arg Gly Ser Met Val Asn His Asp 290 295 300Gly His Ser Ser Gly Leu Thr Ala Pro Arg Gly Pro Ala Gln Val Ser305 310 315 320Val Ile Lys Gln Ala Leu Asp Arg Ala Gly Ile Ala Pro Asp Ala Val 325 330 335Ser Tyr Leu Glu Ala His Gly Thr Gly Thr Pro Leu Gly Asp Pro Ile 340 345 350Glu Met Asp Ser Leu Asn Glu Val Phe Gly Arg Arg Thr Glu Pro Leu 355 360 365Trp Val Gly Ser Val Lys Thr Asn Ile Gly His Leu Glu Ala Ala Ser 370 375 380Gly Ile Ala Gly Leu Ile Lys Val Val Leu Met Leu Lys Asn Lys Gln385 390 395 400Ile Pro Pro His Leu His Phe Lys Thr Pro Asn Pro Tyr Ile Asp Trp 405 410 415Lys Asn Leu Pro Val Glu Ile Pro Thr Thr Leu His Ala Trp Asp Asp 420 425 430Lys Thr Leu Lys Asp Arg Lys Arg Ile Ala Gly Val Ser Ser Phe Ser 435 440 445Phe Ser Gly Thr Asn Ala His Ile Val Leu Ser Glu Ala Pro Ser Ser 450 455 460Glu Leu Ile Ser Asn His Ala Ala Val Glu Arg Pro Trp His Leu Leu465 470 475 480Thr Leu Ser Ala Lys Asn Glu Glu Ala Leu Ala Asn Leu Val Gly Leu 485 490 495Tyr Gln Ser Phe Ile Ser Thr Thr Asp Ala Ser Leu Ala Asp Ile Cys 500 505 510Tyr Thr Ala Asn Thr Ala Arg Thr His Phe Ser His Arg Leu Ala Leu 515 520 525Ser Ala Thr Ser His Ile Gln Ile Glu Ala Leu Leu Ala Ala Tyr Lys 530 535 540Glu Gly Ser Val Ser Leu Ser Ile Asn Gln Gly Cys Val Leu Ser Asn545 550 555 560Ser Arg Ala Pro Lys Val Ala Phe Leu Phe Thr Gly Gln Gly Ser Gln 565 570 575Tyr Val Gln Met Ala Gly Glu Leu Tyr Glu Thr Gln Pro Thr Phe Arg 580 585 590Asn Cys Leu Asp Arg Cys Ala Glu Ile Leu Gln Ser Ile Phe Ser Ser 595 600 605Arg Asn Ser Pro Trp Gly Asn Pro Leu Leu Ser Val Leu Tyr Pro Asn 610 615 620His Glu Ser Lys Glu Ile Asp Gln Thr Ala Tyr Thr Gln Pro Ala Leu625 630 635 640Phe Ala Val Glu Tyr Ala Leu Ala Gln Met Trp Arg Ser Trp Gly Ile 645 650 655Glu Pro Asp Ile Val Met Gly His Ser Ile Gly Glu Tyr Val Ala Ala 660 665 670Cys Val Ala Gly Ile Phe Ser Leu Glu Asp Gly Leu Lys Leu Ala Ala 675 680 685Glu Arg Gly Arg Leu Met Gln Ala Leu Pro Gln Asn Gly Glu Met Val 690 695 700Ala Ile Ser Ala Ser Leu Glu Glu Val Lys Pro Ala Ile Gln Ser Asp705 710 715 720Gln Arg Val Val Ile Ala Ala Val Asn Gly Pro Arg Ser Val Val Ile 725 730 735Ser Gly Asp Arg Gln Ala Val Gln Val Phe Thr Asn Thr Leu Glu Asp 740 745 750Gln Gly Ile Arg Cys Lys Arg Leu Ser Val Ser His Ala Phe His Ser 755 760 765Pro Leu Met Lys Pro Met Glu Gln Glu Phe Ala Gln Val Ala Arg Glu 770 775 780Ile Asn Tyr Ser Pro Pro Lys Ile Ala Leu Val Ser Asn Leu Thr Gly785 790 795 800Asp Leu Ile Ser Pro Glu Ser Ser Leu Glu Glu Gly Val Ile Ala Ser 805 810 815Pro Gly Tyr Trp Val Asn His Leu Cys Asn Pro Val Leu Phe Ala Asp 820 825 830Gly Ile Ala Thr Met Gln Ala Gln Asp Val Gln Val Phe Leu Glu Val 835 840 845Gly Pro Lys Pro Thr Leu Ser Gly Leu Val Gln Gln Tyr Phe Asp Glu 850 855 860Val Ala His Ser Asp Arg Pro Val Thr Ile Pro Thr Leu Arg Pro Lys865 870 875 880Gln Pro Asn Trp Gln Thr Leu Leu Glu Ser Leu Gly Gln Leu Tyr Ala 885 890 895Leu Gly Val Gln Val Asn Trp Ala Gly Phe Asp Arg Asp Tyr Thr Arg 900 905 910Arg Lys Val Ser Leu Pro Thr Tyr Ala Trp Lys Arg Gln Arg Tyr Trp 915 920 925Leu Glu Lys Gln Ser Ala Pro Arg Leu Glu Thr Thr Gln Val Arg Pro 930 935 940Ala Thr Ala Ile Val Glu His Leu Glu Gln Gly Asn Val Pro Lys Ile945 950 955 960Val Asp Leu Leu Ala Ala Thr Asp Val Leu Ser Gly Glu Ala Arg Lys 965 970 975Leu Leu Pro Ser Ile Ile Glu Leu Leu Val Ala Lys His Arg Glu Glu 980 985 990Ala Thr Gln Lys Pro Ile Cys Asp Trp Leu Tyr Glu Val Val Trp Gln 995 1000 1005Pro Gln Leu Leu Thr Leu Ser Thr Leu Pro Ala Val Glu Thr Glu 1010 1015 1020Gly Arg Gln Trp Leu Ile Phe Ala Asp Ala Ser Gly His Gly Glu 1025 1030 1035Ala Leu Ala Ala Gln Leu Arg Gln Gln Gly Asp Ile Ile Thr Leu 1040 1045 1050Val Tyr Ala Gly Leu Lys Tyr His Ser Ala Asn Asn Lys Gln Asn 1055 1060 1065Thr Gly Gly Asp Ile Pro Tyr Phe Gln Ile Asp Pro Ile Gln Arg 1070 1075 1080Glu Asp Tyr Glu Arg Leu Phe Ala Ala Leu Pro Pro Leu Tyr Gly 1085 1090 1095Ile Val His Leu Trp Ser Leu Asp Ile Leu Ser Leu Asp Lys Val 1100 1105 1110Ser Asn Leu Ile Glu Asn Val Gln Leu Gly Ser Gly Thr Leu Leu 1115 1120 1125Asn Leu Ile Gln Thr Val Leu Gln Leu Glu Thr Pro Thr Pro Ser 1130 1135 1140Leu Trp Leu Val Thr Lys Asn Ala Gln Ala Val Arg Lys Asn Asp 1145 1150 1155Ser Leu Val Gly Val Leu Gln Ser Pro Leu Trp Gly Met Gly Lys 1160 1165 1170Val Ile Ala Leu Glu His Pro Glu Leu Asn Cys Val Ser Ile Asp 1175 1180 1185Leu Asp Gly Glu Gly Leu Pro Asp Glu Gln Ala Lys Phe Leu Ala 1190 1195 1200Ala Glu Leu Arg Ala Ala Ser Glu Phe Arg His Thr Thr Ile Pro 1205 1210 1215His Glu Ser Gln Val Ala Trp Arg Asn Arg Thr Arg Tyr Val Ser 1220 1225 1230Arg Phe Lys Gly Tyr Gln Lys His Pro Ala Thr Ser Ser Lys Met 1235 1240 1245Pro Ile Arg Pro Asp Ala Thr Tyr Leu Ile Thr Gly Gly Phe Gly 1250 1255 1260Gly Leu Gly Leu Leu Val Ala Arg Trp Met Val Glu Gln Gly Ala 1265 1270 1275Thr His Leu Phe Leu Met Gly Arg Ser Gln Pro Lys Pro Ala Ala 1280 1285 1290Gln Lys Gln Leu Gln Glu Ile Ala Ala Leu Gly Ala Thr Val Thr 1295 1300 1305Val Val Gln Ala Asp Val Gly Ile Arg Ser Gln Val Ala Asn Val 1310 1315 1320Leu Ala Gln Ile Asp Lys Ala Tyr Pro Leu Ala Gly Ile Ile His 1325 1330 1335Thr Ala Gly Val Leu Asp Asp Gly Ile Leu Leu Gln Gln Asn Trp 1340 1345 1350Ala Arg Phe Ser Lys Val Phe Ala Pro Lys Leu Glu Gly Ala Trp 1355 1360 1365His Leu His Thr Leu Thr Glu Glu Met Pro Leu Asp Phe Phe Ile 1370 1375 1380Cys Phe Ser Ser Thr Ala Gly Leu Leu Gly Ser Gly Gly Gln Ala 1385 1390 1395Asn Tyr Ala Ala Ala Asn Ala Phe Leu Asp Ala Phe Ala His His 1400 1405 1410Arg Arg Ile Gln Gly Leu Pro Ala Leu Ser Ile Asn Trp Asp Ala 1415 1420 1425Trp Ser Gln Val Gly Met Thr Val Arg Leu Gln Gln Ala Ser Ser 1430 1435 1440Gln Ser Thr Thr Val Gly Gln Asp Ile Ser Thr Leu Glu Ile Ser 1445 1450 1455Pro Glu Gln Gly Leu Gln Ile Phe Ala Tyr Leu Leu Gln Gln Pro 1460 1465 1470Ser Ala Gln Ile Ala Ala Ile Ser Thr Asp Gly Leu Arg Lys Met 1475 1480 1485Tyr Asp Thr Ser Ser Ala Phe Phe Ala Leu Leu Asp Leu Asp Arg 1490 1495 1500Ser Ser Ser Thr Thr Gln Glu Gln Ser Thr Leu Ser His Glu Val 1505 1510 1515Gly Leu Thr Leu Leu Glu Gln Leu Gln Gln Ala Arg Pro Lys Glu 1520 1525 1530Arg Glu Lys Met Leu Leu Arg His Leu Gln Thr Gln Val Ala Ala 1535 1540 1545Val Leu Arg Ser Pro Glu Leu Pro Ala Val His Gln Pro Phe Thr 1550 1555 1560Asp Leu Gly Met Asp Ser Leu Met Ser Leu Glu Leu Met Arg Arg 1565 1570 1575Leu Glu Glu Ser Leu Gly Ile Gln Met Pro Ala Thr Leu Ala Phe 1580 1585 1590Asp Tyr Pro Met Val Asp Arg Leu Ala Lys Phe Ile Leu Thr Gln 1595 1600 1605Ile Cys Ile Asn Ser Glu Pro Asp Thr Ser Ala Val Leu Thr Pro 1610 1615 1620Asp Gly Asn Gly Glu Glu Lys Asp Ser Asn Lys Asp Arg Ser Thr 1625 1630 1635Ser Thr Ser Val Asp Ser Asn Ile Thr Ser Met Ala Glu Asp Leu 1640 1645 1650Phe Ala Leu Glu Ser Leu Leu Asn Lys Ile Lys Arg Asp Gln 1655 1660 1665105318DNACylindrospermopsis raciborskii AWT205 105ttatgctgca tctaaataga agttccatag ccctgcactg accaacatca attgatcatc 60aaaatcggtc acacgattcc tatatgtggg ataaaatttg cagtacagca ggatataaaa 120tagtttttcc tctatacttc tgagtgtagg cttgcgtccg cccccgggcg cacgtttgcg 180gtttgctaag gagttgaaca cggtgcgttc ataggtatca gcaaactgag ataacagctc 240gttgaatgct tggcggttaa gtccagtcat tgctcgtagc agtcgctctt gattcaggat 300gcggtctaag ttcaacat 318106105PRTCylindrospermopsis raciborskii AWT205 106Met Leu Asn Leu Asp Arg Ile Leu Asn Gln Glu Arg Leu Leu Arg Ala1 5 10 15Met Thr Gly Leu Asn Arg Gln Ala Phe Asn Glu Leu Leu Ser Gln Phe 20 25 30Ala Asp Thr Tyr Glu Arg Thr Val Phe Asn Ser Leu Ala Asn Arg Lys 35 40 45Arg Ala Pro Gly Gly Gly Arg Lys Pro Thr Leu Arg Ser Ile Glu Glu 50 55 60Lys Leu Phe Tyr Ile Leu Leu Tyr Cys Lys Phe Tyr Pro Thr Tyr Arg65 70 75 80Asn Arg Val Thr Asp Phe Asp Asp Gln Leu Met Leu Val Ser Ala Gly 85 90 95Leu Trp Asn Phe Tyr Leu Asp Ala Ala 100 105107600DNACylindrospermopsis raciborskii AWT205 107ctactgagtg aaagtgaact tctttcccac gtattcgagt agctgttgta agctggcctc 60gatggaaagt tccgaagttt ccaccagtaa atctggtgtt ctcggtggtt cgtagggagc 120gctaattccc gtaaaagact caatttctcc acggcgtgct tttgcataga gacccttggg 180gtcacgttgt tcacaaattt ccatcggagt tgcaatatat acttcatgaa acagatctcc 240ggacagaata cggatttgct cccggtcttt cctgtaaggt gaaatgaaag cagtaatcac 300taaacaaccc gaatccgcaa aaagtttggc cacctcgcca atacgacgaa tattttccgc 360acgatcagca gcagaaaatc ccaagtcagc acataatcca tgacggatat tgtcaccatc 420aaggacaaaa gtataccaac ctttctggaa caaaatccgc tctaattcta gagccaatgt 480tgttttacct gatcctgata atccagtgaa ccatagaatt ccatttcggt gaccattctt 540taaacaacga tcaaatgggg acacaagatg ttttgtatgt tgaatattgc ttgatttcat 600108199PRTCylindrospermopsis raciborskii AWT205 108Met Lys Ser Ser Asn Ile Gln His Thr Lys His Leu Val Ser Pro Phe1 5 10 15Asp Arg Cys Leu Lys Asn Gly His Arg Asn Gly Ile Leu Trp Phe Thr 20 25 30Gly Leu Ser Gly Ser Gly Lys Thr Thr Leu Ala Leu Glu Leu Glu Arg 35 40 45Ile Leu Phe Gln Lys Gly Trp Tyr Thr Phe Val Leu Asp Gly Asp Asn 50 55 60Ile Arg His Gly Leu Cys Ala Asp Leu Gly Phe Ser Ala Ala Asp Arg65 70 75 80Ala Glu Asn Ile Arg Arg Ile Gly Glu Val Ala Lys Leu Phe Ala Asp 85 90 95Ser Gly Cys Leu Val Ile Thr Ala Phe Ile Ser Pro Tyr Arg Lys Asp 100 105 110Arg Glu Gln Ile Arg Ile Leu Ser Gly Asp Leu Phe His Glu Val Tyr 115 120 125Ile Ala Thr Pro Met Glu Ile Cys Glu Gln Arg Asp Pro Lys Gly Leu 130 135 140Tyr Ala Lys Ala Arg Arg Gly Glu Ile Glu Ser Phe Thr Gly Ile Ser145 150 155 160Ala Pro Tyr Glu Pro Pro Arg Thr Pro Asp Leu Leu Val Glu Thr Ser 165 170 175Glu Leu Ser Ile Glu Ala Ser Leu Gln Gln Leu Leu Glu Tyr Val Gly 180 185 190Lys Lys Phe Thr Phe Thr Gln 1951091548DNACylindrospermopsis raciborskii AWT205 109atgcctaaat actttaatac tgctggaccc tgtaaatccg aaatccacta tatgctctct 60cccacagctc gactaccgga tttgaaagca ctaattgacg gagaaaacta ctttataatt 120cacgcgccgc gacaagtcgg caaaactaca gctatgatag ccttagcacg agaattgact 180gatagtggaa aatataccgc agttattctt tccgttgaag tgggatcagt attctcccat 240aatccccagc aagcggagca ggttatttta gaagaatgga aacaggcaat caaattttat 300ttacccaaag aactacaacc atcctattgg ccagagcgtg aaacagactc aggaataggc 360aaaactttaa gtgagtggtc cgcacaatct ccaagacctc ttgtaatctt tttacatgaa 420atcgattccc taacagatga agctttaatc ctaattttaa gacaattacg ctcaggtttt 480ccccgtcgtc ctcggggatt tccccattcg gtggggttaa ttggtatgcg ggatgtgcgg 540gactataagg ttaaatctgg tggaagtgaa cgactgaata cgtcaagtcc tttcaatatc 600aaagcggaat ccttgacttt aagtaatttc actctgtcag aggtggaaga actttactta 660caacatacgc aagctacagg acaaattttt accccggaag caattaaaca agcattttat 720ttaaccgatg ggcaaccatg gttagtaaac gccctagctc gtcaagccac tcaggtgtta 780gtgaaagata ttactcaacc cattaccgct gaagtaatta accaagccaa agaagttctg 840attcagcgcc aggataccca tttggatagt ttggcagagc gcttacggga agatcgggtc 900aaagccatta ttcaacctat gttagctgga tcggacttac cagatacccc agaggatgat 960cgccgtttct tgctagattt aggcttggta aagcgcagtc ccttgggagg actaaccatt 1020gccaatccca tttaccagga ggtgattcct cgtgttttgt cccagggtag tcaggatagt 1080ctaccccaga ttcaacctac ttggttaaat actgataata ctttaaatcc tgacaaactc 1140ttaaatgctt tcctagagtt ttggcgacaa catggggaac cattactcaa aagtgcgcct 1200tatcatgaaa ttgctcccca tttagttttg atggcgtttt tacatcgggt agtgaatggt 1260ggtggcactt tagaacggga atatgccgtt ggttctggaa gaatggatat ttgtttacgc 1320tatggcaagg tagtgatggg catagagtta aaggtttggg ggggaaaatc ggatccgtta 1380acgaagggtt tgacccaatt ggataaatat ctgggtgggt taggattaga tagaggttgg 1440ttagtaattt ttgatcaccg tccgggatta ccacccatgg gtgagaggat tagtatggaa 1500caggccatta gtccagaggg aagaaccatt acagtgattc gtagctag 1548110515PRTCylindrospermopsis raciborskii AWT205 110Met Pro Lys Tyr Phe Asn Thr Ala Gly Pro Cys Lys Ser Glu Ile His1 5

10 15Tyr Met Leu Ser Pro Thr Ala Arg Leu Pro Asp Leu Lys Ala Leu Ile 20 25 30Asp Gly Glu Asn Tyr Phe Ile Ile His Ala Pro Arg Gln Val Gly Lys 35 40 45Thr Thr Ala Met Ile Ala Leu Ala Arg Glu Leu Thr Asp Ser Gly Lys 50 55 60Tyr Thr Ala Val Ile Leu Ser Val Glu Val Gly Ser Val Phe Ser His65 70 75 80Asn Pro Gln Gln Ala Glu Gln Val Ile Leu Glu Glu Trp Lys Gln Ala 85 90 95Ile Lys Phe Tyr Leu Pro Lys Glu Leu Gln Pro Ser Tyr Trp Pro Glu 100 105 110Arg Glu Thr Asp Ser Gly Ile Gly Lys Thr Leu Ser Glu Trp Ser Ala 115 120 125Gln Ser Pro Arg Pro Leu Val Ile Phe Leu His Glu Ile Asp Ser Leu 130 135 140Thr Asp Glu Ala Leu Ile Leu Ile Leu Arg Gln Leu Arg Ser Gly Phe145 150 155 160Pro Arg Arg Pro Arg Gly Phe Pro His Ser Val Gly Leu Ile Gly Met 165 170 175Arg Asp Val Arg Asp Tyr Lys Val Lys Ser Gly Gly Ser Glu Arg Leu 180 185 190Asn Thr Ser Ser Pro Phe Asn Ile Lys Ala Glu Ser Leu Thr Leu Ser 195 200 205Asn Phe Thr Leu Ser Glu Val Glu Glu Leu Tyr Leu Gln His Thr Gln 210 215 220Ala Thr Gly Gln Ile Phe Thr Pro Glu Ala Ile Lys Gln Ala Phe Tyr225 230 235 240Leu Thr Asp Gly Gln Pro Trp Leu Val Asn Ala Leu Ala Arg Gln Ala 245 250 255Thr Gln Val Leu Val Lys Asp Ile Thr Gln Pro Ile Thr Ala Glu Val 260 265 270Ile Asn Gln Ala Lys Glu Val Leu Ile Gln Arg Gln Asp Thr His Leu 275 280 285Asp Ser Leu Ala Glu Arg Leu Arg Glu Asp Arg Val Lys Ala Ile Ile 290 295 300Gln Pro Met Leu Ala Gly Ser Asp Leu Pro Asp Thr Pro Glu Asp Asp305 310 315 320Arg Arg Phe Leu Leu Asp Leu Gly Leu Val Lys Arg Ser Pro Leu Gly 325 330 335Gly Leu Thr Ile Ala Asn Pro Ile Tyr Gln Glu Val Ile Pro Arg Val 340 345 350Leu Ser Gln Gly Ser Gln Asp Ser Leu Pro Gln Ile Gln Pro Thr Trp 355 360 365Leu Asn Thr Asp Asn Thr Leu Asn Pro Asp Lys Leu Leu Asn Ala Phe 370 375 380Leu Glu Phe Trp Arg Gln His Gly Glu Pro Leu Leu Lys Ser Ala Pro385 390 395 400Tyr His Glu Ile Ala Pro His Leu Val Leu Met Ala Phe Leu His Arg 405 410 415Val Val Asn Gly Gly Gly Thr Leu Glu Arg Glu Tyr Ala Val Gly Ser 420 425 430Gly Arg Met Asp Ile Cys Leu Arg Tyr Gly Lys Val Val Met Gly Ile 435 440 445Glu Leu Lys Val Trp Gly Gly Lys Ser Asp Pro Leu Thr Lys Gly Leu 450 455 460Thr Gln Leu Asp Lys Tyr Leu Gly Gly Leu Gly Leu Asp Arg Gly Trp465 470 475 480Leu Val Ile Phe Asp His Arg Pro Gly Leu Pro Pro Met Gly Glu Arg 485 490 495Ile Ser Met Glu Gln Ala Ile Ser Pro Glu Gly Arg Thr Ile Thr Val 500 505 510Ile Arg Ser 51511120DNAArtificialBased on Cylindrospermopsis raciborskii AWT205 sequence 111acttctctcc tttccctatc 2011222DNAArtificialBased on Cylindrospermopsis raciborskii AWT205 sequence 112gagtgaaaat gcgtagaact tg 2211322DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 113cccaatatct ccctgtaaaa ct 2211420DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 114tggcaattgt ctctccgtat 2011520DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 115ctcgccgatg aaagtcctct 2011620DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 116gcgtgtcgag aaaaaggtgt 2011720DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 117ctcgacacgc aagaataacg 2011821DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 118atgcttctgc tttggcatgg c 2111921DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 119taactcgacg aactttgacc c 2112019DNAArtificialBased on Cylindrospermopsis raciborskii T3 120gccgccaatc ctcgcgatg 1912122DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 121gaacgtctaa tgttgcacag tg 2212223DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 122ctggtacgta gtcgcaaagg tgg 2312326DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 123ctgacggtac atgtatttcc tgtgac 2612430DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 124cgtctcatat gcagatctta ggaatttcag 3012525DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 125gcttactacc acgatagtgc tgccg 2512622DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 126tctatgttta gcaggtggtg tc 2212720DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 127ttctgcaaga cgagccataa 2012820DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 128ggttcgccgc ggacattaaa 2012920DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 129atgctaatgc ggtgggagta 2013020DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 130aaagcagttc cgacgacatt 2013123DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 131cctatttcga ttattgtttt cgg 2313220DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 132gataccgatc ataaactacg 2013321DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 133gcaaattttg caggagtaat g 2113421DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 134gcaaattttg caggagtaat g 2113523DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 135ttttgggtaa actttatagc cat 2313622DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 136tgggtctgga cagttgtaga ta 2213723DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 137aaggggaaaa caaaattatc aat 2313820DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 138ggcgatcgcc tgctaaaaat 2013923DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 139cctcattttc atttctagac gtt 2314020DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 140ccacttcaac taaaacagca 2014120DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 141aaaaattttg gaggggtagc 2014220DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 142atccaagatg cgacaacact 2014321DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 143ggtccttgcg cagatagagt g 2114421DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 144cactctatct gcgcaaggac c 2114521DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 145tgactgcatt cgctgtataa a 2114622DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 146ttcataagac ggctgttgaa tc 2214730DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 147ctcgagttaa aaaagagtgt aaatgaaagg 3014823DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 148ttctataact gctgccaaat ttt 2314923DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 149aattttggag tgactggtta tgg 2315023DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 150ccataaccag tcactccaaa att 2315121DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 151ttttagttgt tacttttggc g 2115220DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 152acagcagatg agagaaagta 2015320DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 153gggttgtctt gctgattttc 2015422DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 154cattaaaata agtccggaca gg 2215520DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 155ttaaacagaa tgaggagcaa 2015620DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 156aaacaacaca cccatctaag 2015720DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 157ttaataaggc atccccaaga 2015820DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 158gaaatggctg tgtaaaaact 2015920DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 159tctgccatat ccccaaccta 2016020DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 160gatcgcccga caggaagact 2016120DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 161tccggcttga cctgctggac 2016220DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 162tgcgatgatt ttgcctctgt 2016320DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 163aaaatttgca cacccacacg 2016427DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 164ttggattgaa cgtgtaattg aaaaagc 2716527DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 165gctttttcaa ttacacgttc aatccaa 2716619DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 166aaatggcgta tcgactaac 1916721DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 167atataggagc gcataaagtg c 2116820DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 168cttggtataa gtcttgtgat 2016920DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 169aacactcatt agattcatct 2017021DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 170tccactaaat cctttgaatt g 2117121DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 171tgtttgtctg gatgcgatcc t 2117220DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 172gcagttcagg tccatgaaac 2017320DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 173agcccagtca caaccttcgt 2017421DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 174tctggaagta cttgcactgt c 2117522DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 175tgtaactccg tcaggacata aa 2217623DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 176tgcaaatttt agtagcaata acg 2317727DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 177ctttactaat tatagcgggg atattat 2717820DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 178cagtggggaa atagatggat 2017920DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 179tggtcataaa agcgggattc 2018018DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 180ggatcttggc gcaattta 1818123DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 181gttagagact tggaacgtat tgg 2318219DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 182ccaaacccag aagaaatcc 1918322DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 183aatctatagc caaaacccct aa 2218419DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 184actgtgtgaa caattcccc 1918529DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 185gcaacaagac tacatttagt agatttaga 2918627DNAArtificialBased on Cylindrospermopsis raciborskii T3 sequence 186gctttttcaa ttacacgttc aatccaa 27

Claims

1. An isolated polynucleotide comprising a nucleotide sequence sharing at least 90% sequence homology with SEQ ID NO: 1 or a fragment thereof, wherein said fragment encodes a protein of a saxitoxin biosynthetic pathway.

2. The polynucleotide according to claim 1, wherein said fragment comprises a nucleotide sequence sharing at least 90% sequence homology with a sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, and SEQ ID NO: 68.

3. (canceled)

4. An isolated saxitoxin biosynthetic pathway polypeptide comprising an amino acid sequence sharing at least 90% sequence homology with a sequence selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, and SEQ ID NO: 69.

5. (canceled)

6. (canceled)

7. (canceled)

8. (canceled)

9. A method for detecting cyanotoxic organism, the method comprising the steps of obtaining a sample for use in the method and analyzing the sample for the presence of a saxitoxin (SXT) cluster gene present only in saxitoxin-producing organisms, wherein said analysing comprises detecting: (i) a polynucleotide comprising a sequence selected from the group consisting of: SEQ ID NO: 14, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 36, and variants and fragments thereof, (ii) a ribonucleic acid or complementary DNA encoded by a sequence according to (i), (iii) a polypeptide comprising a sequence selected from the group consisting of: SEQ ID NO: 15, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 37, and variants and fragments thereof, and wherein said presence is indicative of cyanotoxic organisms in the sample.

10. The method according to claim 9, wherein said cyanotoxic organisms are cyanobacteria.

11. The method according to claim 9, wherein said analyzing comprises amplification of DNA from the sample by polymerase chain reaction and detecting the amplified sequences.

12. The method according to claim 11, wherein said polymerase chain reaction utilises one or more primers comprising a sequence selected from the group consisting of SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 113, SEQ ID NO: 114, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 121, SEQ ID NO: 122, SEQ ID NO: 123, SEQ ID NO: 124, SEQ ID NO: 125, SEQ ID NO: 126, SEQ ID NO: 127, SEQ ID NO: 128, SEQ ID NO: 129, SEQ ID NO: 130, SEQ ID NO: 131, SEQ ID NO: 132, SEQ ID NO: 133, SEQ ID NO: 134, and variants and fragments thereof.

13. The method according to claim 9, further comprising analyzing the sample for the presence of one or more of: (i) a polynucleotide comprising a sequence selected from the group consisting of: SEQ ID NO: 80, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, and variants and fragments thereof, (ii) a ribonucleic acid or complementary DNA encoded by a sequence according to (i), (iii) a polypeptide comprising a sequence selected from the group consisting of: SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, and SEQ ID NO: 110, and variants and fragments thereof.

14. The method according to claim 13, wherein said analyzing comprises amplification of DNA from the sample by polymerase chain reaction utilizing one or more primers comprising a sequence selected from the group consisting of SEQ ID NO: 111, SEQ ID NO: 112, and variants and fragments thereof.

15. (canceled)

16. (canceled)

17. (canceled)

18. (canceled)

19. (canceled)

20. (canceled)

21. (canceled)

22. (canceled)

23. A kit for the detection of cyanotoxic organisms, the kit comprising at least one agent for detecting the presence an SXT cluster gene present only in saxitoxin-producing organisms, wherein said agent detects: (i) a polynucleotide comprising a sequence selected from the group consisting of: SEQ ID NO: 14, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 36, and variants and fragments thereof, (ii) a ribonucleic acid or complementary DNA encoded by a sequence according to (i), (iii) a polypeptide comprising a sequence selected from the group consisting of: SEQ ID NO: 15, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 37, and variants and fragments thereof, and wherein said presence is indicative of cyanotoxic organisms in the sample.

24. The kit according to claim 23, wherein said at least one agent is a primer, antibody or probe.

25. The kit according to claim 24, wherein said primer or probe comprises a sequence selected from the group consisting of SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 113, SEQ ID NO: 114, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 121, SEQ ID NO: 122, SEQ ID NO: 123, SEQ ID NO: 124, SEQ ID NO: 125, SEQ ID NO: 126, SEQ ID NO: 127, SEQ ID NO: 128, SEQ ID NO: 129, SEQ ID NO: 130, SEQ ID NO: 131, SEQ ID NO: 132, SEQ ID NO: 133, SEQ ID NO: 134, and variants and fragments thereof.

26. The kit according to claim 23, further comprising at least one additional agent for detecting the presence of one or more of: (i) a polynucleotide comprising a sequence selected from the group consisting of: SEQ ID NO: 80, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, and variants and fragments thereof, (ii) a ribonucleic acid or complementary DNA encoded by a sequence according to (i), (iii) a polypeptide comprising a sequence selected from the group consisting of: SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, and SEQ ID NO: 110, and variants and fragments thereof.

27. The kit according to claim 26, wherein said at least one additional agent is a primer, antibody or probe.

28. The kit according to claim 27, wherein said primer or probe comprises a sequence selected from the group consisting of SEQ ID NO: 109, SEQ ID NO: 110, and variants and fragments thereof.

29. (canceled)

30. (canceled)

31. (canceled)

32. (canceled)

33. The method according to claim 10, wherein said cyanotoxic organisms are dinoflagellates.

34. The kit according to claim 23, wherein said cyanotoxic organisms are cyanobacteria.

35. The kit according to claim 23, wherein said cyanotoxic organisms are dinoflagellates.