U.S. patent application number 12/851478 was filed with the patent office on 2011-05-26 for semi-synthetic terephthalic acid via microorganisms that produce muconic acid.
Invention is credited to Mark J. Burk, Robin E. Osterhout, Jun Sun.
Application Number | 20110124911 12/851478 |
Document ID | / |
Family ID | 43544673 |
Filed Date | 2011-05-26 |
United States Patent
Application |
20110124911 |
Kind Code |
A1 |
Burk; Mark J. ; et
al. |
May 26, 2011 |
SEMI-SYNTHETIC TEREPHTHALIC ACID VIA MICROORGANISMS THAT PRODUCE
MUCONIC ACID
Abstract
The invention provides a non-naturally occurring microbial
organism having a muconate pathway having at least one exogenous
nucleic acid encoding a muconate pathway enzyme expressed in a
sufficient amount to produce muconate. The muconate pathway
including an enzyme selected from the group consisting of a
beta-ketothiolase, a beta-ketoadipyl-CoA hydrolase, a
beta-ketoadipyl-CoA transferase, a beta-ketoadipyl-CoA ligase, a
2-fumarylacetate reductase, a 2-fumarylacetate dehydrogenase, a
trans-3-hydroxy-4-hexendioate dehydratase, a 2-fumarylacetate
aminotransferase, a 2-fumarylacetate aminating oxidoreductase, a
trans-3-amino-4-hexenoate deaminase, a beta-ketoadipate
enol-lactone hydrolase, a muconolactone isomerase, a muconate
cycloisomerase, a beta-ketoadipyl-CoA dehydrogenase, a
3-hydroxyadipyl-CoA dehydratase, a 2,3-dehydroadipyl-CoA
transferase, a 2,3-dehydroadipyl-CoA hydrolase, a
2,3-dehydroadipyl-CoA ligase, a muconate reductase, a
2-maleylacetate reductase, a 2-maleylacetate dehydrogenase, a
cis-3-hydroxy-4-hexendioate dehydratase, a 2-maleylacetate
aminoatransferase, a 2-maleylacetate aminating oxidoreductase, a
cis-3-amino-4-hexendioate deaminase, and a muconate cis/trans
isomerase. Other muconate pathway enzymes also are provided.
Additionally provided are methods of producing muconate.
Inventors: |
Burk; Mark J.; (San Diego,
CA) ; Osterhout; Robin E.; (San Diego, CA) ;
Sun; Jun; (San Diego, CA) |
Family ID: |
43544673 |
Appl. No.: |
12/851478 |
Filed: |
August 5, 2010 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
61231637 |
Aug 5, 2009 |
|
|
|
Current U.S.
Class: |
562/480 ;
435/142; 435/252.33 |
Current CPC
Class: |
C12Y 402/01002 20130101;
C12N 9/88 20130101; C12P 7/44 20130101 |
Class at
Publication: |
562/480 ;
435/252.33; 435/142 |
International
Class: |
C07C 63/26 20060101
C07C063/26; C12N 1/21 20060101 C12N001/21; C12P 7/44 20060101
C12P007/44 |
Claims
1. A non-naturally occurring microbial organism, comprising a
microbial organism having a muconate pathway comprising at least
one exogenous nucleic acid encoding a muconate pathway enzyme
expressed in a sufficient amount to produce muconate, said muconate
pathway comprising an enzyme selected from the group consisting of
a beta-ketothiolase, a beta-ketoadipyl-CoA hydrolase, a
beta-ketoadipyl-CoA transferase, a beta-ketoadipyl-CoA ligase, a
2-fumarylacetate reductase, a 2-fumarylacetate dehydrogenase, a
trans-3-hydroxy-4-hexendioate dehydratase, a 2-fumarylacetate
aminotransferase, a 2-fumarylacetate aminating oxidoreductase, a
trans-3-amino-4-hexenoate deaminase, a beta-ketoadipate
enol-lactone hydrolase, a muconolactone isomerase, a muconate
cycloisomerase, a beta-ketoadipyl-CoA dehydrogenase, a
3-hydroxyadipyl-CoA dehydratase, a 2,3-dehydroadipyl-CoA
transferase, a 2,3-dehydroadipyl-CoA hydrolase, a
2,3-dehydroadipyl-CoA ligase, a muconate reductase, a
2-maleylacetate reductase, a 2-maleylacetate dehydrogenase, a
cis-3-hydroxy-4-hexendioate dehydratase, a 2-maleylacetate
aminoatransferase, a 2-maleylacetate aminating oxidoreductase, a
cis-3-amino-4-hexendioate deaminase, and a muconate cis/trans
isomerase.
2. The non-naturally occurring microbial organism of claim 1,
wherein said muconate pathway comprises a set of muconate pathway
enzymes, said set of muconate pathway enzymes selected from the
group consisting of: A) (1) beta-ketothiolase, (2) an enzyme
selected from beta-ketoadipyl-CoA hydrolase, beta-ketoadipyl-CoA
transferase, and beta-ketoadipyl-CoA ligase, (3) beta-ketoadipate
enol-lactone hydrolase, (4) muconolactone isomerase, (5) muconate
cycloisomerase, and (6) a muconate cis/trans isomerase; B) (1)
beta-ketothiolase, (2) an enzyme selected from beta-ketoadipyl-CoA
hydrolase, beta-ketoadipyl-CoA transferase and beta-ketoadipyl-CoA
ligase, (3) 2-maleylacetate reductase, (4) 2-maleylacetate
dehydrogenase, (5) cis-3-hydroxy-4-hexendioate dehydratase, and (6)
muconate cis/trans isomerase; C) (1) beta-ketothiolase, (2) an
enzyme selected from beta-ketoadipyl-CoA hydrolase,
beta-ketoadipyl-CoA transferase and beta-ketoadipyl-CoA ligase, (3)
2-maleylacetate reductase, (4) an enzyme selected from
2-maleylacetate aminotransferase and 2-maleylacetate aminating
oxidoreductase, (5) cis-3-amino-4-hexenoate deaminase, and (6)
muconate cis/trans isomerase; D) (1) beta-ketothiolase, (2)
beta-ketoadipyl-CoA dehydrogenase, (3) 3-hydroxyadipyl-CoA
dehydratase, (4) an enzyme selected from 2,3-dehydroadipyl-CoA
transferase, 2,3-dehydroadipyl-CoA hydrolase and
2,3-dehydroadipyl-CoA ligase, and (5) muconate reductase; E) (1)
beta-ketothiolase, (2) an enzyme selected from beta-ketoadipyl-CoA
hydrolase, beta-ketoadipyl-CoA transferase and beta-ketoadipyl-CoA
ligase, (3) 2-fumarylacetate reductase, (4) 2-fumarylacetate
dehydrogenase, and (5) trans-3-hydroxy-4-hexendioate dehydratase;
F) (1) beta-ketothiolase, (2) an enzyme selected from
beta-ketoadipyl-CoA hydrolase, beta-ketoadipyl-CoA transferase and
beta-ketoadipyl-CoA ligase, (3) 2-fumarylacetate reductase, (4) an
enzyme selected from 2-fumarylacetate aminotransferase and
2-fumarylacetate aminating oxidoreductase, and (5)
trans-3-amino-4-hexenoate deaminase.
3. The non-naturally occurring microbial organism of claim 2,
wherein said microbial organism comprises two exogenous nucleic
acids each encoding a muconate pathway enzyme.
4. The non-naturally occurring microbial organism of claim 2,
wherein said microbial organism comprises three exogenous nucleic
acids each encoding a muconate pathway enzyme.
5. The non-naturally occurring microbial organism of claim 2,
wherein said microbial organism comprises four exogenous nucleic
acids each encoding a muconate pathway enzyme.
6. The non-naturally occurring microbial organism of claim 2,
wherein said microbial organism comprises five exogenous nucleic
acids each encoding a muconate pathway enzyme.
7. The non-naturally occurring microbial organism of claim 2,
wherein said microbial organism comprises six exogenous nucleic
acids each encoding a muconate pathway enzyme.
8. The non-naturally occurring microbial organism of claim 1,
wherein said at least one exogenous nucleic acid is a heterologous
nucleic acid.
9. The non-naturally occurring microbial organism of claim 1,
wherein said non-naturally occurring microbial organism is in a
substantially anaerobic culture medium.
10. A method for producing muconate, comprising culturing the
non-naturally occurring microbial organism according to claim 1,
under conditions and for a sufficient period of time to produce
muconate according to claim 1.
11.-18. (canceled)
19. A non-naturally occurring microbial organism, comprising a
microbial organism having a muconate pathway comprising at least
one exogenous nucleic acid encoding a muconate pathway enzyme
expressed in a sufficient amount to produce muconate, said muconate
pathway comprising an enzyme selected from the group consisting of
a 4-hydroxy-2-ketovalerate aldolase, a 2-oxopentenoate hydratase, a
4-oxalocrotonate dehydrogenase, a 2-hydroxy-4-hexenedioate
dehydratase, a 4-hydroxy-2-oxohexanedioate oxidoreductase, a
2,4-dihydroxyadipate dehydratase (acting on 2-hydroxy), a
2,4-dihydroxyadipate dehydratase (acting on 4-hydroxyl group) and a
3-hydroxy-4-hexenedioate dehydratase.
20. The non-naturally occurring microbial organism of claim 19,
wherein said muconate pathway comprises a set of muconate pathway
enzymes, said set of muconate pathway enzymes selected from the
group consisting of: A) (1) 4-hydroxy-2-ketovalerate aldolase, (2)
2-oxopentenoate hydratase, (3) 4-oxalocrotonate dehydrogenase, (4)
2-hydroxy-4-hexenedioate dehydratase; B) (1)
4-hydroxy-2-ketovalerate aldolase, (2) 4-hydroxy-2-oxohexanedioate
oxidoreductase, (3) 2,4-dihydroxyadipate dehydratase (acting on
2-hydroxy), (4) 3-hydroxy-4-hexenedioate dehydratase; and C) (1)
4-hydroxy-2-ketovalerate aldolase, (2) 4-hydroxy-2-oxohexanedioate
oxidoreductase, (3) 2,4-dihydroxyadipate dehydratase (acting on
4-hydroxyl group), (4) 2-hydroxy-4-hexenedioate dehydratase.
21. The non-naturally occurring microbial organism of claim 20,
wherein said microbial organism comprises two exogenous nucleic
acids each encoding a muconate pathway enzyme.
22. The non-naturally occurring microbial organism of claim 20,
wherein said microbial organism comprises three exogenous nucleic
acids each encoding a muconate pathway enzyme.
23. The non-naturally occurring microbial organism of claim 20,
wherein said microbial organism comprises four exogenous nucleic
acids each encoding a muconate pathway enzyme.
24. The non-naturally occurring microbial organism of claim 19,
wherein said at least one exogenous nucleic acid is a heterologous
nucleic acid.
25. The non-naturally occurring microbial organism of claim 19,
wherein said non-naturally occurring microbial organism is in a
substantially anaerobic culture medium.
26. A method for producing muconate, comprising culturing the
non-naturally occurring microbial organism according to claim 19,
under conditions and for a sufficient period of time to produce
muconate.
27.-32. (canceled)
33. A non-naturally occurring microbial organism, comprising a
microbial organism having a muconate pathway comprising at least
one exogenous nucleic acid encoding a muconate pathway enzyme
expressed in a sufficient amount to produce muconate, said muconate
pathway comprising an enzyme selected from the group consisting of
an HODH aldolase, an OHED hydratase, an OHED decarboxylase, an HODH
formate-lyase, an HODH dehydrogenase, an OHED formate-lyase, an
OHED dehydrogenase, a 6-OHE dehydrogenase, a 3-hydroxyadipyl-CoA
dehydratase, a 2,3-dehydroadipyl-CoA hydrolase, a
2,3-dehydroadipyl-CoA transferase, a 2,3-dehydroadipyl-CoA ligase,
and a muconate reductase.
34. The non-naturally occurring microbial organism of claim 33,
wherein said muconate pathway comprises a set of muconate pathway
enzymes, set of muconate pathway enzymes selected from the group
consisting of: A) (1) HODH aldolase, (2) OHED hydratase, (3) OHED
decarboxylase, (4) 6-OHE dehydrogenase, and (5) muconate reductase;
B) (1) HODH aldolase, (2) OHED hydratase, (3) an enzyme selected
from OHED formate-lyase and OHED dehydrogenase, (4) an enzyme
selected from 2,3-dehydroadipyl-CoA hydrolase,
2,3-dehydroadipyl-CoA transferase and 2,3-dehydroadipyl-CoA ligase,
and (5) muconate reductase; and C) (1) HODH aldolase, (2) an enzyme
selected from HODH formate-lyase and HODH dehydrogenase, (3)
3-hydroxyadipyl-CoA dehydratase, (4) an enzyme selected from
2,3-dehydroadipyl-CoA hydrolase, 2,3-dehydroadipyl-CoA transferase
and 2,3-dehydroadipyl-CoA ligase, and (5) muconate reductase
35. The non-naturally occurring microbial organism of claim 34,
wherein said microbial organism comprises two exogenous nucleic
acids each encoding a muconate pathway enzyme.
36. The non-naturally occurring microbial organism of claim 34,
wherein said microbial organism comprises three exogenous nucleic
acids each encoding a muconate pathway enzyme.
37. The non-naturally occurring microbial organism of claim 34,
wherein said microbial organism comprises four exogenous nucleic
acids each encoding a muconate pathway enzyme.
38. The non-naturally occurring microbial organism of claim 34,
wherein said microbial organism comprises five exogenous nucleic
acids each encoding a muconate pathway enzyme.
39. The non-naturally occurring microbial organism of claim 33,
wherein said at least one exogenous nucleic acid is a heterologous
nucleic acid.
40. The non-naturally occurring microbial organism of claim 33,
wherein said non-naturally occurring microbial organism is in a
substantially anaerobic culture medium.
41. A method for producing muconate, comprising culturing the
non-naturally occurring microbial organism according to claim 33,
under conditions and for a sufficient period of time to produce
muconate.
42.-47. (canceled)
48. A non-naturally occurring microbial organism, comprising a
microbial organism having a muconate pathway comprising at least
one exogenous nucleic acid encoding a muconate pathway enzyme
expressed in a sufficient amount to produce muconate, said muconate
pathway comprising an enzyme selected from the group consisting of
a lysine aminotransferase, a lysine aminating oxidoreductase, a
2-aminoadipate semialdehyde dehydrogenase, a 2-aminoadipate
deaminase, a muconate reductase, a lysine-2,3-aminomutase, a
3,6-diaminohexanoate aminotransferase, a 3,6-diaminohexanoate
aminating oxidoreductase, a 3-aminoadipate semialdehyde
dehydrogenase, and a 3-aminoadipate deaminase.
49. The non-naturally occurring microbial organism of claim 48,
wherein said muconate pathway comprises a set of muconate pathway
enzymes, set of muconate pathway enzymes selected from the group
consisting of: A) (1) lysine aminotransferase, (2) lysine aminating
oxidoreductase, (3) 2-aminoadipate semialdehyde dehydrogenase, (4)
2-aminoadipate deaminase, and (5) muconate reductase B) (1)
lysine-2,3-aminomutase, (2) 3,6-diaminohexanoate aminotransferase,
(3) 3,6-diaminohexanoate aminating oxidoreductase, (4)
3-aminoadipate semialdehyde dehydrogenase, (5) 3-aminoadipate
deaminase, and (6) muconate reductase.
50. The non-naturally occurring microbial organism of claim 49,
wherein said microbial organism comprises two exogenous nucleic
acids each encoding a muconate pathway enzyme.
51. The non-naturally occurring microbial organism of claim 49,
wherein said microbial organism comprises three exogenous nucleic
acids each encoding a muconate pathway enzyme.
52. The non-naturally occurring microbial organism of claim 49,
wherein said microbial organism comprises four exogenous nucleic
acids each encoding a muconate pathway enzyme.
53. The non-naturally occurring microbial organism of claim 49,
wherein said microbial organism comprises five exogenous nucleic
acids each encoding a muconate pathway enzyme.
54. The non-naturally occurring microbial organism of claim 49,
wherein said microbial organism comprises six exogenous nucleic
acids each encoding a muconate pathway enzyme.
55. The non-naturally occurring microbial organism of claim 48,
wherein said at least one exogenous nucleic acid is a heterologous
nucleic acid.
56. The non-naturally occurring microbial organism of claim 48,
wherein said non-naturally occurring microbial organism is in a
substantially anaerobic culture medium.
57. A method for producing muconate, comprising culturing the
non-naturally occurring microbial organism according to claim 48,
under conditions and for a sufficient period of time to produce
muconate.
58.-65. (canceled)
66. A semi-synthetic method for synthesizing terephthalate (PTA)
comprising preparing muconic acid by culturing an organism of any
one of claims, 2, 20, 34, or 49, reacting said muconic acid with
acetylene to form a cyclohexadiene adduct, and oxidizing said
cyclohexadiene adduct to form PTA.
67. The method of claim 66, further comprising isolating muconic
acid prior to reacting with acetylene.
68. The method of claim 66, wherein the step of reacting said
muconic acid with acetylene comprises adding acetylene to the
culture broth.
69. The method of claim 68, wherein the culture broth is filtered
prior to adding acetylene.
70. The method of claim 68, wherein said step of oxidizing said
cyclohexadiene adduct comprises adding air or oxygen to the culture
broth.
Description
[0001] This application claims the benefit of priority of U.S.
Provisional Application No. 61/231,637, filed Aug. 5, 2009, the
entire contents of which are incorporated herein by this
reference.
BACKGROUND OF THE INVENTION
[0002] The present disclosure relates generally to the design of
engineered organisms and, more specifically to organisms having
selected genotypes for the production of muconic acid.
[0003] Terephthalate (also known as terephthalic acid and PTA) is
the immediate precursor of polyethylene terephthalate (PET), used
to make clothing, resins, plastic bottles and even as a poultry
feed additive. Nearly all PTA is produced from para-xylene by the
oxidation in air in a process known as the Mid Century Process
(Roffia et al., Ind. Eng. Chem. Prod. Res. Dev. 23:629-634 (1984)).
This oxidation is conducted at high temperature in an acetic acid
solvent with a catalyst composed of cobalt and/or manganese salts.
Para-xylene is derived from petrochemical sources, and is formed by
high severity catalytic reforming of naphtha. Xylene is also
obtained from the pyrolysis gasoline stream in a naphtha steam
cracker and by toluene disproportion.
[0004] PTA, toluene and other aromatic precursors are naturally
degraded by some bacteria. However, these degradation pathways
typically involve monooxygenases that operate irreversibly in the
degradative direction. Hence, biosynthetic pathways for PTA are
severely limited by the properties of known enzymes to date.
[0005] Muconate (also known as muconic acid, MA) is an unsaturated
dicarboxylic acid used as a raw material for resins,
pharmaceuticals and agrochemicals. Muconate can be converted to
adipic acid, a precursor of Nylon-6,6, via hydrogenation (Draths
and Frost, J. Am. Chem. Soc. 116; 399-400 (1994)). Alternately,
muconate can be hydrogenated using biometallic nanocatalysts
(Thomas et al., Chem. Commun. 10:1126-1127 (2003)).
[0006] Muconate is a common degradation product of diverse aromatic
compounds in microbes. Several biocatalytic strategies for making
cis,cis-muconate have been developed. Engineered E. coli strains
producing muconate from glucose via shikimate pathway enzymes have
been developed in the Frost lab (U.S. Pat. No. 5,487,987 (1996);
Niu et al., Biotechnol Prog., 18:201-211 (2002)). These strains are
able to produce 36.8 g/L of cis,cis-muconate after 48 hours of
culturing under fed-batch fermenter conditions (22% of the maximum
theoretical yield from glucose). Muconate has also been produced
biocatalytically from aromatic starting materials such as toluene,
benzoic acid and catechol. Strains producing muconate from benzoate
achieved titers of 13.5 g/L and productivity of 5.5 g/L/hr (Choi et
al., J. Ferment. Bioeng. 84:70-76 (1997)). Muconate has also been
generated from the effluents of a styrene monomer production plant
(Wu et al., Enzyme and Microbiology Technology 35:598-604
(2004)).
[0007] All biocatalytic pathways identified to date proceed through
enzymes in the shikimate pathway, or degradation enzymes from
catechol. Consequently, they are limited to producing the cis, cis
isomer of muconate, since these pathways involve ring-opening
chemistry. The development of pathways for producing
trans,trans-muconate and cis,trans-muconate would be useful because
these isomers can serve as direct synthetic intermediates for
producing renewable PTA via the inverse electron demand Diels-Alder
reaction with acetylene. The present invention satisfies this need
and provides related advantages as well.
SUMMARY OF INVENTION
[0008] The invention provides a non-naturally occurring microbial
organism having a muconate pathway having at least one exogenous
nucleic acid encoding a muconate pathway enzyme expressed in a
sufficient amount to produce muconate. The muconate pathway
including an enzyme selected from the group consisting of a
beta-ketothiolase, a beta-ketoadipyl-CoA hydrolase, a
beta-ketoadipyl-CoA transferase, a beta-ketoadipyl-CoA ligase, a
2-fumarylacetate reductase, a 2-fumarylacetate dehydrogenase, a
trans-3-hydroxy-4-hexendioate dehydratase, a 2-fumarylacetate
aminotransferase, a 2-fumarylacetate aminating oxidoreductase, a
trans-3-amino-4-hexenoate deaminase, a beta-ketoadipate
enol-lactone hydrolase, a muconolactone isomerase, a muconate
cycloisomerase, a beta-ketoadipyl-CoA dehydrogenase, a
3-hydroxyadipyl-CoA dehydratase, a 2,3-dehydroadipyl-CoA
transferase, a 2,3-dehydroadipyl-CoA hydrolase, a
2,3-dehydroadipyl-CoA ligase, a muconate reductase, a
2-maleylacetate reductase, a 2-maleylacetate dehydrogenase, a
cis-3-hydroxy-4-hexendioate dehydratase, a 2-maleylacetate
aminoatransferase, a 2-maleylacetate aminating oxidoreductase, a
cis-3-amino-4-hexendioate deaminase, and a muconate cis/trans
isomerase. Other muconate pathway enzymes also are provided.
Additionally provided are methods of producing muconate.
BRIEF DESCRIPTION OF THE DRAWINGS
[0009] FIG. 1 shows the synthesis of terepthalate from muconate and
acetylene via Diels-Alder chemistry. P1 is
cyclohexa-2,5-diene-1,4-dicarboxylate.
[0010] FIG. 2 shows pathways to trans-trans muconate from succinyl
CoA. Enzymes are A) beta-ketothiolase, B) beta-ketoadipyl-CoA
hydrolase, transferase and/or ligase, C) 2-fumarylacetate
reductase, D) 2-fumarylacetate dehydrogenase, E)
trans-3-hydroxy-4-hexendioate dehydratase, F) 2-fumarylacetate
aminotransferase and/or 2-fumarylacetate aminating oxidoreductase,
G) trans-3-amino-4-hexenoate deaminase, H) beta-ketoadipate
enol-lactone hydrolase, I) muconolactone isomerase, J) muconate
cycloisomerase, K) beta-ketoadipyl-CoA dehydrogenase, L)
3-hydroxyadipyl-CoA dehydratase, M) 2,3-dehydroadipyl-CoA
transferase, hydrolase or ligase, N) muconate reductase, O)
2-maleylacetate reductase, P) 2-maleylacetate dehydrogenase, Q)
cis-3-hydroxy-4-hexendioate dehydratase, R) 2-maleylacetate
aminotransferase and/or 2-maleylacetate aminating oxidoreductase,
S) cis-3-amino-4-hexendioate deaminase, T) muconate cis/trans
isomerase, W) muconate cis/trans isomerase.
[0011] FIG. 3 shows pathways to muconate from pyruvate and malonate
semialdehyde. Enzymes are A) 4-hydroxy-2-ketovalerate aldolase, B)
2-oxopentenoate hydratase, C) 4-oxalocrotonate dehydrogenase, D)
2-hydroxy-4-hexenedioate dehydratase, E)
4-hydroxy-2-oxohexanedioate oxidoreductase, F) 2,4-dihydroxyadipate
dehydratase (acting on 2-hydroxy), G) 2,4-dihydroxyadipate
dehydratase (acting on 4-hydroxyl group) and H)
3-hydroxy-4-hexenedioate dehydratase.
[0012] FIG. 4 shows pathways to muconate from pyruvate and succinic
semialdehyde. Enzymes are A) HODH aldolase, B) OHED hydratase, C)
OHED decarboxylase, D) HODH formate-lyase and/or HODH
dehydrogenase, E) OHED formate-lyase and/or OHED dehydrogenase, F)
6-OHE dehydrogenase, G) 3-hydroxyadipyl-CoA dehydratase, H)
2,3-dehydroadipyl-CoA hydrolase, transferase or ligase, I) muconate
reductase. Abbreviations are:
HODH=4-hydroxy-2-oxoheptane-1,7-dioate,
OHED=2-oxohept-4-ene-1,7-dioate,
6-OHE=6-oxo-2,3-dehydrohexanoate.
[0013] FIG. 5 shows pathways to muconate from lysine. Enzymes are
A) lysine aminotransferase and/or aminating oxidoreductase, B)
2-aminoadipate semialdehyde dehydrogenase, C) 2-aminoadipate
deaminase, D) muconate reductase, E) lysine-2,3-aminomutase, F)
3,6-diaminohexanoate aminotransferase and/or aminating
oxidoreductase, G) 3-aminoadipate semialdehyde dehydrogenase, H)
3-aminoadipate deaminase.
[0014] FIG. 6 shows 3 thiolases with demonstrated thiolase activity
resulting in acetoacetyl-CoA formation (left panel). FIG. 6 also
shows that several enzymes demonstrated selective condensation of
succinyl-CoA and acetyl-CoA to form .beta.-ketoadipyl-CoA as the
sole product (right panel).
DETAILED DESCRIPTION OF THE INVENTION
[0015] The present invention is directed, in part, to a
biosynthetic pathway for synthesizing muconate from simple
carbohydrate feedstocks, which in turn provides a viable synthetic
route to PTA. In particular, pathways disclosed herein provide
trans,trans-muconate or cis,trans-muconate biocatalytically from
simple sugars. The all trans or cis,trans isomer of muconate is
then converted to PTA in a two step process via inverse electron
demand Diels-Alder reaction with acetylene followed by oxidation in
air or oxygen. The Diels-Alder reaction between muconate and
acetylene proceeds to form cyclohexa-2,5-diene-1,4-dicarboxylate
(P1), as shown in FIG. 1. Subsequent exposure to air or oxygen
rapidly converts P1 to PTA.
[0016] This invention is also directed, in part, to non-naturally
occurring microorganisms that express genes encoding enzymes that
catalyze muconate production. Pathways for the production of
muconate disclosed herein are derived from central metabolic
precursors. Successfully engineering these pathways entails
identifying an appropriate set of enzymes with sufficient activity
and specificity, cloning their corresponding genes into a
production host, optimizing the expression of these genes in the
production host, optimizing fermentation conditions, and assaying
for product formation following fermentation.
[0017] The maximum theoretical yield of muconic acid is 1.09 moles
per mole glucose utilized. Achieving this yield involves
assimilation of CO.sub.2 as shown in equation 1 below:
11C.sub.6H.sub.12O.sub.6+6CO.sub.2.fwdarw.12C.sub.6H.sub.6O.sub.4+30H.su-
b.2O (equation 1)
[0018] As used herein, the term "muconate" is used interchangeably
with muconic acid. Muconate is also used to refer to any of the
possible isomeric forms: trans,trans, cis,trans, and cis,cis.
However, the present invention provides pathways to the useful
trans,trans and cis,trans forms, in particular.
[0019] As used herein, the term "non-naturally occurring" when used
in reference to a microbial organism or microorganism of the
invention is intended to mean that the microbial organism has at
least one genetic alteration not normally found in a naturally
occurring strain of the referenced species, including wild-type
strains of the referenced species. Genetic alterations include, for
example, modifications introducing expressible nucleic acids
encoding metabolic polypeptides, other nucleic acid additions,
nucleic acid deletions and/or other functional disruption of the
microbial genetic material. Such modifications include, for
example, coding regions and functional fragments thereof, for
heterologous, homologous or both heterologous and homologous
polypeptides for the referenced species. Additional modifications
include, for example, non-coding regulatory regions in which the
modifications alter expression of a gene or operon. Exemplary
metabolic polypeptides include enzymes or proteins within a
muconate biosynthetic pathway.
[0020] A metabolic modification refers to a biochemical reaction
that is altered from its naturally occurring state. Therefore,
non-naturally occurring microorganisms can have genetic
modifications to nucleic acids encoding metabolic polypeptides or,
functional fragments thereof. Exemplary metabolic modifications are
disclosed herein.
[0021] As used herein, the term "isolated" when used in reference
to a microbial organism is intended to mean an organism that is
substantially free of at least one component as the referenced
microbial organism is found in nature. The term includes a
microbial organism that is removed from some or all components as
it is found in its natural environment. The term also includes a
microbial organism that is removed from some or all components as
the microbial organism is found in non-naturally occurring
environments. Therefore, an isolated microbial organism is partly
or completely separated from other substances as it is found in
nature or as it is grown, stored or subsisted in non-naturally
occurring environments. Specific examples of isolated microbial
organisms include partially pure microbes, substantially pure
microbes and microbes cultured in a medium that is non-naturally
occurring.
[0022] As used herein, the terms "microbial," "microbial organism"
or "microorganism" is intended to mean any organism that exists as
a microscopic cell that is included within the domains of archaea,
bacteria or eukarya. Therefore, the term is intended to encompass
prokaryotic or eukaryotic cells or organisms having a microscopic
size and includes bacteria, archaea and eubacteria of all species
as well as eukaryotic microorganisms such as yeast and fungi. The
term also includes cell cultures of any species that can be
cultured for the production of a biochemical.
[0023] As used herein, the term "CoA" or "coenzyme A" is intended
to mean an organic cofactor or prosthetic group (nonprotein portion
of an enzyme) whose presence is required for the activity of many
enzymes (the apoenzyme) to form an active enzyme system. Coenzyme A
functions in certain condensing enzymes, acts in acetyl or other
acyl group transfer and in fatty acid synthesis and oxidation,
pyruvate oxidation and in other acetylation.
[0024] As used herein, the term "substantially anaerobic" when used
in reference to a culture or growth condition is intended to mean
that the amount of oxygen is less than about 10% of saturation for
dissolved oxygen in liquid media. The term also is intended to
include sealed chambers of liquid or solid medium maintained with
an atmosphere of less than about 1% oxygen.
[0025] "Exogenous" as it is used herein is intended to mean that
the referenced molecule or the referenced activity is introduced
into the host microbial organism. The molecule can be introduced,
for example, by introduction of an encoding nucleic acid into the
host genetic material such as by integration into a host chromosome
or as non-chromosomal genetic material such as a plasmid.
Therefore, the term as it is used in reference to expression of an
encoding nucleic acid refers to introduction of the encoding
nucleic acid in an expressible form into the microbial organism.
When used in reference to a biosynthetic activity, the term refers
to an activity that is introduced into the host reference organism.
The source can be, for example, a homologous or heterologous
encoding nucleic acid that expresses the referenced activity
following introduction into the host microbial organism. Therefore,
the term "endogenous" refers to a referenced molecule or activity
that is present in the host. Similarly, the term when used in
reference to expression of an encoding nucleic acid refers to
expression of an encoding nucleic acid contained within the
microbial organism. The term "heterologous" refers to a molecule or
activity derived from a source other than the referenced species
whereas "homologous" refers to a molecule or activity derived from
the host microbial organism. Accordingly, exogenous expression of
an encoding nucleic acid of the invention can utilize either or
both a heterologous or homologous encoding nucleic acid.
[0026] The non-naturally occurring microbal organisms of the
invention can contain stable genetic alterations, which refers to
microorganisms that can be cultured for greater than five
generations without loss of the alteration. Generally, stable
genetic alterations include modifications that persist greater than
10 generations, particularly stable modifications will persist more
than about 25 generations, and more particularly, stable genetic
modifications will be greater than 50 generations, including
indefinitely.
[0027] Those skilled in the art will understand that the genetic
alterations, including metabolic modifications exemplified herein,
are described with reference to a suitable host organism such as E.
coli and their corresponding metabolic reactions or a suitable
source organism for desired genetic material such as genes for a
desired metabolic pathway. However, given the complete genome
sequencing of a wide variety of organisms and the high level of
skill in the area of genomics, those skilled in the art will
readily be able to apply the teachings and guidance provided herein
to essentially all other organisms. For example, the E. coli
metabolic alterations exemplified herein can readily be applied to
other species by incorporating the same or analogous encoding
nucleic acid from species other than the referenced species. Such
genetic alterations include, for example, genetic alterations of
species homologs, in general, and in particular, orthologs,
paralogs or nonorthologous gene displacements.
[0028] An ortholog is a gene or genes that are related by vertical
descent and are responsible for substantially the same or identical
functions in different organisms. For example, mouse epoxide
hydrolase and human epoxide hydrolase can be considered orthologs
for the biological function of hydrolysis of epoxides. Genes are
related by vertical descent when, for example, they share sequence
similarity of sufficient amount to indicate they are homologous, or
related by evolution from a common ancestor. Genes can also be
considered orthologs if they share three-dimensional structure but
not necessarily sequence similarity, of a sufficient amount to
indicate that they have evolved from a common ancestor to the
extent that the primary sequence similarity is not identifiable.
Genes that are orthologous can encode proteins with sequence
similarity of about 25% to 100% amino acid sequence identity. Genes
encoding proteins sharing an amino acid similarity less that 25%
can also be considered to have arisen by vertical descent if their
three-dimensional structure also shows similarities. Members of the
serine protease family of enzymes, including tissue plasminogen
activator and elastase, are considered to have arisen by vertical
descent from a common ancestor.
[0029] Orthologs include genes or their encoded gene products that
through, for example, evolution, have diverged in structure or
overall activity. For example, where one species encodes a gene
product exhibiting two functions and where such functions have been
separated into distinct genes in a second species, the three genes
and their corresponding products are considered to be orthologs.
For the production of a biochemical product, those skilled in the
art will understand that the orthologous gene harboring the
metabolic activity to be introduced or disrupted is to be chosen
for construction of the non-naturally occurring microorganism. An
example of orthologs exhibiting separable activities is where
distinct activities have been separated into distinct gene products
between two or more species or within a single species. A specific
example is the separation of elastase proteolysis and plasminogen
proteolysis, two types of serine protease activity, into distinct
molecules as plasminogen activator and elastase. A second example
is the separation of mycoplasma 5'-3' exonuclease and Drosophila
DNA polymerase III activity. The DNA polymerase from the first
species can be considered an ortholog to either or both of the
exonuclease or the polymerase from the second species and vice
versa.
[0030] In contrast, paralogs are homologs related by, for example,
duplication followed by evolutionary divergence and have similar or
common, but not identical functions. Paralogs can originate or
derive from, for example, the same species or from a different
species. For example, microsomal epoxide hydrolase (epoxide
hydrolase I) and soluble epoxide hydrolase (epoxide hydrolase II)
can be considered paralogs because they represent two distinct
enzymes, co-evolved from a common ancestor, that catalyze distinct
reactions and have distinct functions in the same species. Paralogs
are proteins from the same species with significant sequence
similarity to each other suggesting that they are homologous, or
related through co-evolution from a common ancestor. Groups of
paralogous protein families include HipA homologs, luciferase
genes, peptidases, and others.
[0031] A nonorthologous gene displacement is a nonorthologous gene
from one species that can substitute for a referenced gene function
in a different species. Substitution includes, for example, being
able to perform substantially the same or a similar function in the
species of origin compared to the referenced function in the
different species. Although generally, a nonorthologous gene
displacement will be identifiable as structurally related to a
known gene encoding the referenced function, less structurally
related but functionally similar genes and their corresponding gene
products nevertheless will still fall within the meaning of the
term as it is used herein. Functional similarity requires, for
example, at least some structural similarity in the active site or
binding region of a nonorthologous gene product compared to a gene
encoding the function sought to be substituted. Therefore, a
nonorthologous gene includes, for example, a paralog or an
unrelated gene.
[0032] Therefore, in identifying and constructing the non-naturally
occurring microbial organisms of the invention having muconate
biosynthetic capability, those skilled in the art will understand
with applying the teaching and guidance provided herein to a
particular species that the identification of metabolic
modifications can include identification and inclusion or
inactivation of orthologs. To the extent that paralogs and/or
nonorthologous gene displacements are present in the referenced
microorganism that encode an enzyme catalyzing a similar or
substantially similar metabolic reaction, those skilled in the art
also can utilize these evolutionally related genes.
[0033] Orthologs, paralogs and nonorthologous gene displacements
can be determined by methods well known to those skilled in the
art. For example, inspection of nucleic acid or amino acid
sequences for two polypeptides will reveal sequence identity and
similarities between the compared sequences. Based on such
similarities, one skilled in the art can determine if the
similarity is sufficiently high to indicate the proteins are
related through evolution from a common ancestor. Algorithms well
known to those skilled in the art, such as Align, BLAST, Clustal W
and others compare and determine a raw sequence similarity or
identity, and also determine the presence or significance of gaps
in the sequence which can be assigned a weight or score. Such
algorithms also are known in the art and are similarly applicable
for determining nucleotide sequence similarity or identity.
Parameters for sufficient similarity to determine relatedness are
computed based on well known methods for calculating statistical
similarity, or the chance of finding a similar match in a random
polypeptide, and the significance of the match determined. A
computer comparison of two or more sequences can, if desired, also
be optimized visually by those skilled in the art. Related gene
products or proteins can be expected to have a high similarity, for
example, 25% to 100% sequence identity. Proteins that are unrelated
can have an identity which is essentially the same as would be
expected to occur by chance, if a database of sufficient size is
scanned (about 5%). Sequences between 5% and 24% may or may not
represent sufficient homology to conclude that the compared
sequences are related. Additional statistical analysis to determine
the significance of such matches given the size of the data set can
be carried out to determine the relevance of these sequences.
[0034] Exemplary parameters for determining relatedness of two or
more sequences using the BLAST algorithm, for example, can be as
set forth below. Briefly, amino acid sequence alignments can be
performed using BLASTP version 2.0.8 (Jan. 5, 1999) and the
following parameters: Matrix: 0 BLOSUM62; gap open: 11; gap
extension: 1; x_dropoff: 50; expect: 10.0; wordsize: 3; filter: on.
Nucleic acid sequence alignments can be performed using BLASTN
version 2.0.6 (Sep. 16, 1998) and the following parameters: Match:
1; mismatch: -2; gap open: 5; gap extension: 2; x_dropoff: 50;
expect: 10.0; wordsize: 11; filter: off. Those skilled in the art
will know what modifications can be made to the above parameters to
either increase or decrease the stringency of the comparison, for
example, and determine the relatedness of two or more
sequences.
[0035] In some embodiments, the invention provides a non-naturally
occurring microbial organism having a muconate pathway that
includes at least one exogenous nucleic acid encoding a muconate
pathway enzyme expressed in a sufficient amount to produce
muconate. The muconate pathway includes an enzyme selected from the
group consisting of a beta-ketothiolase, a beta-ketoadipyl-CoA
hydrolase, a beta-ketoadipyl-CoA transferase, a beta-ketoadipyl-CoA
ligase, a 2-fumarylacetate reductase, a 2-fumarylacetate
dehydrogenase, a trans-3-hydroxy-4-hexendioate dehydratase, a
2-fumarylacetate aminotransferase, a 2-fumarylacetate aminating
oxidoreductase, a trans-3-amino-4-hexenoate deaminase, a
beta-ketoadipate enol-lactone hydrolase, a muconolactone isomerase,
a muconate cycloisomerase, a beta-ketoadipyl-CoA dehydrogenase, a
3-hydroxyadipyl-CoA dehydratase, a 2,3-dehydroadipyl-CoA
transferase, a 2,3-dehydroadipyl-CoA hydrolase, a
2,3-dehydroadipyl-CoA ligase, a muconate reductase, a
2-maleylacetate reductase, a 2-maleylacetate dehydrogenase, a
cis-3-hydroxy-4-hexendioate dehydratase, a 2-maleylacetate
aminotransferase, a 2-maleylacetate aminating oxidoreductase, a
cis-3-amino-4-hexendioate deaminase, and a muconate cis/trans
isomerase.
[0036] In particular embodiments, the muconate pathway includes a
set of muconate pathway enzymes shown in FIG. 2 and selected from
the group consisting of:
[0037] A) (1) beta-ketothiolase, (2) an enzyme selected from
beta-ketoadipyl-CoA hydrolase, beta-ketoadipyl-CoA transferase, and
beta-ketoadipyl-CoA ligase, (3) beta-ketoadipate enol-lactone
hydrolase, (4) muconolactone isomerase, (5) muconate
cycloisomerase, and (6) a muconate cis/trans isomerase;
[0038] B) (1) beta-ketothiolase, (2) an enzyme selected from
beta-ketoadipyl-CoA hydrolase, beta-ketoadipyl-CoA transferase and
beta-ketoadipyl-CoA ligase, (3) 2-maleylacetate reductase, (4)
2-maleylacetate dehydrogenase, (5) cis-3-hydroxy-4-hexendioate
dehydratase, and (6) muconate cis/trans isomerase;
[0039] C) (1) beta-ketothiolase, (2) an enzyme selected from
beta-ketoadipyl-CoA hydrolase, beta-ketoadipyl-CoA transferase and
beta-ketoadipyl-CoA ligase, (3) 2-maleylacetate reductase, (4) an
enzyme selected from 2-maleylacetate aminotransferase and
2-maleylacetate aminating oxidoreductase, (5)
cis-3-amino-4-hexenoate deaminase, and (6) muconate cis/trans
isomerase;
[0040] D) (1) beta-ketothiolase, (2) beta-ketoadipyl-CoA
dehydrogenase, (3) 3-hydroxyadipyl-CoA dehydratase, (4) an enzyme
selected from 2,3-dehydroadipyl-CoA transferase,
2,3-dehydroadipyl-CoA hydrolase and 2,3-dehydroadipyl-CoA ligase,
and (5) muconate reductase;
[0041] E) (1) beta-ketothiolase, (2) an enzyme selected from
beta-ketoadipyl-CoA hydrolase, beta-ketoadipyl-CoA transferase and
beta-ketoadipyl-CoA ligase, (3) 2-fumarylacetate reductase, (4)
2-fumarylacetate dehydrogenase, and (5)
trans-3-hydroxy-4-hexendioate dehydratase;
[0042] F) (1) beta-ketothiolase, (2) an enzyme selected from
beta-ketoadipyl-CoA hydrolase, beta-ketoadipyl-CoA transferase and
beta-ketoadipyl-CoA ligase, (3) 2-fumarylacetate reductase, (4) an
enzyme selected from 2-fumarylacetate aminotransferase and
2-fumarylacetate aminating oxidoreductase, and (5)
trans-3-amino-4-hexenoate deaminase.
[0043] In some embodiments, a microbial organism having a pathway
exemplified by those shown in FIG. 2 can include two or more
exogenous nucleic acids each encoding a muconate pathway enzyme,
including three, four, five, six, that is up to all of the of
enzymes in a muconate pathway. The non-naturally occurring
microbial organism having at least one exogenous nucleic acid can
include a heterologous nucleic acid. A non-naturally occurring
microbial organism having a pathway exemplified by those shown in
FIG. 2 can be cultured in a substantially anaerobic culture
medium.
[0044] In some embodiments, the invention provides a non-naturally
occurring microbial organism having a muconate pathway that
includes at least one exogenous nucleic acid encoding a muconate
pathway enzyme expressed in a sufficient amount to produce
muconate. The muconate pathway includes an enzyme selected from the
group consisting of a 4-hydroxy-2-ketovalerate aldolase, a
2-oxopentenoate hydratase, a 4-oxalocrotonate dehydrogenase, a
2-hydroxy-4-hexenedioate dehydratase, a 4-hydroxy-2-oxohexanedioate
oxidoreductase, a 2,4-dihydroxyadipate dehydratase (acting on
2-hydroxy), a 2,4-dihydroxyadipate dehydratase (acting on
4-hydroxyl group) and a 3-hydroxy-4-hexenedioate dehydratase.
[0045] In particular embodiments, the muconate pathway includes a
set of muconate pathway enzymes shown in FIG. 3 and selected from
the group consisting of:
[0046] A) (1) 4-hydroxy-2-ketovalerate aldolase, (2)
2-oxopentenoate hydratase, (3) 4-oxalocrotonate dehydrogenase, (4)
2-hydroxy-4-hexenedioate dehydratase;
[0047] B) (1) 4-hydroxy-2-ketovalerate aldolase, (2)
4-hydroxy-2-oxohexanedioate oxidoreductase, (3)
2,4-dihydroxyadipate dehydratase (acting on 2-hydroxy), (4)
3-hydroxy-4-hexenedioate dehydratase; and
[0048] C) (1) 4-hydroxy-2-ketovalerate aldolase, (2)
4-hydroxy-2-oxohexanedioate oxidoreductase, (3)
2,4-dihydroxyadipate dehydratase (acting on 4-hydroxyl group), (4)
2-hydroxy-4-hexenedioate dehydratase.
[0049] In some embodiments, a microbial organism having a pathway
exemplified by those shown in FIG. 3 can include two or more
exogenous nucleic acids each encoding a muconate pathway enzyme,
including three, four, that is up to all of the of enzymes in a
muconate pathway. The non-naturally occurring microbial organism
having at least one exogenous nucleic acid can include a
heterologous nucleic acid. A non-naturally occurring microbial
organism having a pathway exemplified by those shown in FIG. 3 can
be cultured in a substantially anaerobic culture medium.
[0050] In some embodiments, the invention provides a non-naturally
occurring microbial organism having a muconate pathway that
includes at least one exogenous nucleic acid encoding a muconate
pathway enzyme expressed in a sufficient amount to produce
muconate. The muconate pathway includes an enzyme selected from the
group consisting of an HODH aldolase, an OHED hydratase, an OHED
decarboxylase, an HODH formate-lyase, an HODH dehydrogenase, an
OHED formate-lyase, an OHED dehydrogenase, a 6-OHE dehydrogenase, a
3-hydroxyadipyl-CoA dehydratase, a 2,3-dehydroadipyl-CoA hydrolase,
a 2,3-dehydroadipyl-CoA transferase, a 2,3-dehydroadipyl-CoA
ligase, and a muconate reductase.
[0051] In particular embodiments, the muconate pathway includes a
set of muconate pathway enzymes shown in FIG. 4 and selected from
the group consisting of:
[0052] A) (1) HODH aldolase, (2) OHED hydratase, (3) OHED
decarboxylase, (4) 6-OHE dehydrogenase, and (5) muconate
reductase;
[0053] B) (1) HODH aldolase, (2) OHED hydratase, (3) an enzyme
selected from OHED formate-lyase and OHED dehydrogenase, (4) an
enzyme selected from 2,3-dehydroadipyl-CoA hydrolase,
2,3-dehydroadipyl-CoA transferase and 2,3-dehydroadipyl-CoA ligase,
and (5) muconate reductase; and
[0054] C) (1) HODH aldolase, (2) an enzyme selected from HODH
formate-lyase and HODH dehydrogenase, (3) 3-hydroxyadipyl-CoA
dehydratase, (4) an enzyme selected from 2,3-dehydroadipyl-CoA
hydrolase, 2,3-dehydroadipyl-CoA transferase and
2,3-dehydroadipyl-CoA ligase, and (5) muconate reductase
[0055] In some embodiments, a microbial organism having a pathway
exemplified by those shown in FIG. 4 can include two or more
exogenous nucleic acids each encoding a muconate pathway enzyme,
including three, four, five, that is up to all of the of enzymes in
a muconate pathway. The non-naturally occurring microbial organism
having at least one exogenous nucleic acid can include a
heterologous nucleic acid. A non-naturally occurring microbial
organism having a pathway exemplified by those shown in FIG. 4 can
be cultured in a substantially anaerobic culture medium.
[0056] In some embodiments, the invention provides a non-naturally
occurring microbial organism having a muconate pathway that
includes at least one exogenous nucleic acid encoding a muconate
pathway enzyme expressed in a sufficient amount to produce
muconate. The muconate pathway includes an enzyme selected from the
group consisting of a lysine aminotransferase, a lysine aminating
oxidoreductase, a 2-aminoadipate semialdehyde dehydrogenase, a
2-aminoadipate deaminase, a muconate reductase, a
lysine-2,3-aminomutase, a 3,6-diaminohexanoate aminotransferase, a
3,6-diaminohexanoate aminating oxidoreductase, a 3-aminoadipate
semialdehyde dehydrogenase, and a 3-aminoadipate deaminase.
[0057] In particular embodiments, the muconate pathway includes a
set of muconate pathway enzymes shown in FIG. 5 and selected from
the group consisting of:
[0058] A) (1) lysine aminotransferase, (2) lysine aminating
oxidoreductase, (3) 2-aminoadipate semialdehyde dehydrogenase, (4)
2-aminoadipate deaminase, and (5) muconate reductase
[0059] B) (1) lysine-2,3-aminomutase, (2) 3,6-diaminohexanoate
aminotransferase, (3) 3,6-diaminohexanoate aminating
oxidoreductase, (4) 3-aminoadipate semialdehyde dehydrogenase, (5)
3-aminoadipate deaminase, and (6) muconate reductase.
[0060] In some embodiments, a microbial organism having a pathway
exemplified by those shown in FIG. 5 can include two or more
exogenous nucleic acids each encoding a muconate pathway enzyme,
including three, four, five, six, that is up to all of the of
enzymes in a muconate pathway. The non-naturally occurring
microbial organism having at least one exogenous nucleic acid can
include a heterologous nucleic acid. A non-naturally occurring
microbial organism having a pathway exemplified by those shown in
FIG. 2 can be cultured in a substantially anaerobic culture
medium.
[0061] In an additional embodiment, the invention provides a
non-naturally occurring microbial organism having a muconate
pathway, wherein the non-naturally occurring microbial organism
comprises at least one exogenous nucleic acid encoding an enzyme or
protein that converts a substrate to a product selected from the
group consisting of succinyl-CoA to beta-ketoadipyl-CoA,
beta-ketoadipyl-CoA to 3-hydroxyadipyl-CoA, 3-hydroxyadipyl-CoA to
2,3-dehydroadipyl-CoA, 2,3-dehydroadipyl-CoA to 2,3-dehydroadipate,
and 2,3-dehydroadipate to trans,trans-muconate. Alternatively, the
non-naturally occurring microbial organism comprises at least one
exogenous nucleic acid encoding an enzyme or protein that converts
a substrate to a product selected from the group consisting of
succinyl-CoA to beta-ketoadipyl-CoA, beta-ketoadipyl-CoA to
beta-ketoadipate, beta-ketoadipate to 2-maleylacetate,
2-maleylacetate to cis-3-hydroxy-4-hexendioate,
cis-3-hydroxy-4-hexendioate to cis,trans-muconate, and
cis,trans-muconate to trans,trans-muconate. Alternatively, the
non-naturally occurring microbial organism comprises at least one
exogenous nucleic acid encoding an enzyme or protein that converts
a substrate to a product selected from the group consisting of
succinyl-CoA to beta-ketoadipyl-CoA, beta-ketoadipyl-CoA to
beta-ketoadipate, beta-ketoadipate to 2-maleylacetate,
2-maleylacetate to cis-3-amino-4-hexendioate,
cis-3-amino-4-hexendioate to cis,trans-muconate, and
cis,trans-muconate to trans,trans-muconate. Alternatively, the
non-naturally occurring microbial organism comprises at least one
exogenous nucleic acid encoding an enzyme or protein that converts
a substrate to a product selected from the group consisting of
succinyl-CoA to beta-ketoadipyl-CoA, beta-ketoadipyl-CoA to
beta-ketoadipate, beta-ketoadipate to 2-fumarylacetate,
2-fumarylacetate to trans-3-hydroxy-4-hexendioate, and
trans-3-hydroxy-4-dienoate to trans,trans-muconate. Alternatively,
the non-naturally occurring microbial organism comprises at least
one exogenous nucleic acid encoding an enzyme or protein that
converts a substrate to a product selected from the group
consisting of succinyl-CoA to beta-ketoadipyl-CoA,
beta-ketoadipyl-CoA to beta-ketoadipate, beta-ketoadipate to
2-fumarylacetate, 2-fumarylacetate to trans-3-amino-4-hexendioate,
trans-3-amino-4-hexendioate to trans,trans-muconate. Alternatively,
the non-naturally occurring microbial organism comprises at least
one exogenous nucleic acid encoding an enzyme or protein that
converts a substrate to a product selected from the group
consisting of succinyl-CoA to beta-ketoadipyl-CoA,
beta-ketoadipyl-CoA to beta-ketoadipate, beta-ketoadipate to
beta-ketoadipate enol-lactone, beta-ketoadipate enol-lactone to
muconolactone, muconolactone to cis,cis-muconate, cis,cis-muconate
to cis,trans-muconate, and cis,trans muconate to
trans,trans-muconate. Thus, the invention provides a non-naturally
occurring microbial organism containing at least one exogenous
nucleic acid encoding an enzyme or protein, where the enzyme or
protein converts the substrates and products of a muconate pathway,
such as those shown in FIG. 2.
[0062] In an additional embodiment, the invention provides a
non-naturally occurring microbial organism having a muconate
pathway, wherein the non-naturally occurring microbial organism
comprises at least one exogenous nucleic acid encoding an enzyme or
protein that converts a substrate to a product selected from the
group consisting of pyruvate and malonate semialdehyde to
4-hydroxy-2-oxohexandioate, 4-hydroxy-2-oxohexandioate to
4-oxalocrotonate, 4-oxalocrotonate to 2-hydroxy-4-hexendioate, and
2-hydroxy-4-hexendioate to muconate. Alternatively, the
non-naturally occurring microbial organism comprises at least one
exogenous nucleic acid encoding an enzyme or protein that converts
a substrate to a product selected from the group consisting of
pyruvate and malonate semialdehyde to 4-hydroxy-2-oxohexandioate,
4-hydroxy-2-oxohexandioate, 4-hydroxy-2-oxohexandioate to
2,4-dihydroxyadipate, 2,4-dihydroxyadipate to
2-hydroxy-4-hexendioate, and 2-hydroxy-4-hexendioate to muconate.
Alternatively, the non-naturally occurring microbial organism
comprises at least one exogenous nucleic acid encoding an enzyme or
protein that converts a substrate to a product selected from the
group consisting of pyruvate and malonate semialdehyde to
4-hydroxy-2-oxohexandioate, 4-hydroxy-2-oxohexandioate,
4-hydroxy-2-oxohexandioate to 2,4-dihydroxyadipate,
2,4-dihydroxyadipate to 3-hydroxy-4-hexendioate, and
3-hydroxy-4-hexendioate to muconate. Thus, the invention provides a
non-naturally occurring microbial organism containing at least one
exogenous nucleic acid encoding an enzyme or protein, where the
enzyme or protein converts the substrates and products of a
muconate pathway, such as those shown in FIG. 3.
[0063] In an additional embodiment, the invention provides a
non-naturally occurring microbial organism having a muconate
pathway, wherein the non-naturally occurring microbial organism
comprises at least one exogenous nucleic acid encoding an enzyme or
protein that converts a substrate to a product selected from the
group consisting of pyruvate and succinic semialdehyde to HODH,
HODH to 3-hydroxyadipyl-CoA, 3-hydroxy adipyl-CoA to
2,3-dehydroadipyl-CoA, 2,3-dehydroadipyl-CoA to 2,3-dehydroadipate,
and 2,3-dehydroadipate to muconate. Alternatively, the
non-naturally occurring microbial organism comprises at least one
exogenous nucleic acid encoding an enzyme or protein that converts
a substrate to a product selected from the group consisting of
pyruvate and succinic semialdehyde to HODH, HODH to OHED, OHED to
2,3-dehydroadipyl-CoA, 2,3-dehydroadipyl-CoA to 2,3-dehydroadipate,
and 2,3-dehydroadipate to muconate. Alternatively, the
non-naturally occurring microbial organism comprises at least one
exogenous nucleic acid encoding an enzyme or protein that converts
a substrate to a product selected from the group consisting of
pyruvate and succinic semialdehyde to HODH, HODH to OHED, OHED to
6-OHE, 6-OHE to 2,3-dehydroadipate, and 2,3-dehydroadipate to
muconate. Thus, the invention provides a non-naturally occurring
microbial organism containing at least one exogenous nucleic acid
encoding an enzyme or protein, where the enzyme or protein converts
the substrates and products of a muconate pathway, such as those
shown in FIG. 4.
[0064] In an additional embodiment, the invention provides a
non-naturally occurring microbial organism having a muconate
pathway, wherein the non-naturally occurring microbial organism
comprises at least one exogenous nucleic acid encoding an enzyme or
protein that converts a substrate to a product selected from the
group consisting of lysine to 2-aminoadipate semialdehyde,
2-aminoadipate semialdehyde to 2-aminoadipate, 2-aminoadipate to
2,3-dehydroadipate, and 2,3-dehydroadipate to muconate.
Alternatively, the non-naturally occurring microbial organism
comprises at least one exogenous nucleic acid encoding an enzyme or
protein that converts a substrate to a product selected from the
group consisting of lysine to 3,6-diaminohexanoate,
3,6-diaminohexanoate to 3-aminoadipate semialdehyde, 3-aminoadipate
semialdehyde to 3-aminoadipate, 3-aminoadipate to
2,3-dehydroadipate, and 2,3-dehydroadipate to muconate. Thus, the
invention provides a non-naturally occurring microbial organism
containing at least one exogenous nucleic acid encoding an enzyme
or protein, where the enzyme or protein converts the substrates and
products of a muconate pathway, such as those shown in FIG. 5.
[0065] The invention is described herein with general reference to
the metabolic reaction, reactant or product thereof, or with
specific reference to one or more nucleic acids or genes encoding
an enzyme associated with or catalyzing, or a protein associated
with, the referenced metabolic reaction, reactant or product.
Unless otherwise expressly stated herein, those skilled in the art
will understand that reference to a reaction also constitutes
reference to the reactants and products of the reaction. Similarly,
unless otherwise expressly stated herein, reference to a reactant
or product also references the reaction, and reference to any of
these metabolic constituents also references the gene or genes
encoding the enzymes that catalyze or proteins involved in the
referenced reaction, reactant or product. Likewise, given the well
known fields of metabolic biochemistry, enzymology and genomics,
reference herein to a gene or encoding nucleic acid also
constitutes a reference to the corresponding encoded enzyme and the
reaction it catalyzes or a protein associated with the reaction as
well as the reactants and products of the reaction.
[0066] Muconate can be produced from succinyl-CoA via
beta-ketoadipate in a minimum of five enzymatic steps, shown in
FIG. 2. In the first step of all pathways, succinyl-CoA is joined
to acetyl-CoA by a beta-ketothiolase to form beta-ketoadipyl-CoA
(Step A). In one embodiment, the beta-keto functional group is
reduced and dehydrated to form 2,3-dehydroadipyl-CoA (Steps K and
L). The CoA moiety is then removed by a CoA hydrolase, transferase
or ligase to form 2,3-dehydroadipate (Step M). Finally,
2,3-dehydroadipate is oxidized to form the conjugated diene
muconate by an enoate oxidoreductase (Step N).
[0067] In other embodiments, beta-ketoadipyl-CoA is converted to
beta-ketoadipate by a CoA hydrolase, transferase or ligase (Step
B). Beta-ketoadipate is then converted to 2-maleylacetate by
maleylacetate reductase (Step O). The beta-ketone of
2-maleylacetate is then reduced to form cis-3-hydroxy-4-hexenoate
(Step P). This product is further dehydrated to cis,trans-muconate
in Step Q. Step W provides a muconate cis/trans-isomerase to
provide trans,trans-muconate.
[0068] A similar route entails the conversion of 2-maleylacetate to
cis-3-amino-4-hexenoate by an aminotransferase or aminating
oxidoreductase (Step R). Deamination of cis-3-amino-4-hexenoate is
subsequently carried out to form cis,trans-muconate (Step S).
[0069] Alternatively, beta-ketoadipate can be converted to
2-fumarylacetate by action of a fumarylacetate reductase (Step C).
Such a reductase can be engineered by directed evolution, for
example, of the corresponding maleylacetate reductase. Reduction of
the keto group and dehydration provides trans,trans-muconate (Steps
D and E). Alternatively, reductive amination, followed by
deamination also affords the trans,trans-muconate product (Steps F
and G)
[0070] In yet another route, beta-ketoadipate can be cyclized to an
enol-lactone by beta-ketoadipyl enol-lactone hydrolase (Step H).
The double bond in the lactone ring is then shifted by
muconolactone isomerase (Step I). Finally, muconolactone is
converted to cis,cis-muconate by muconate cycloisomerase (Step J).
Muconate cycloisomerase may selectively form the cis,cis isomer of
muconate. Further addition of a cis/trans isomerase converts the
cis,cis isomer to the favored trans, trans or trans, cis
configurations (Steps T and W, which can be incorporated into a
single isomerization step).
[0071] The pathways detailed in FIG. 2 can achieve a maximum
theoretical yield of 1.09 moles muconate per mole glucose utilized
under anaerobic and aerobic conditions. With and without aeration,
the maximum ATP yield is 1 mole of ATP per glucose utilized at the
maximum muconate yield. The first step of this pathway, the
condensation of succinyl-CoA and acetyl-CoA by beta-ketothiolase,
has been demonstrated by Applicants is shown below in Example
I.
[0072] Another pathway for muconate synthesis involves the
condensation of pyruvate and malonate semialdehyde, as shown in
FIG. 3. Malonate semialdehyde can be formed in the cell by several
different pathways. Two example pathways are: 1) decarboxylation of
oxaloacetate, and 2) conversion of 2-phosphoglycerate to glycerol
which can then be dehydrated to malonate semialdehyde by a diol
dehydratase. In one pathway, malonate semialdehyde and pyruvate are
condensed to form 4-hydroxy-2-oxohexanedioate (Step A). This
product is dehydrated to form 4-oxalocrotonate (Step B).
4-Oxalocrotonate is converted to muconate by reduction and
dehydration of the 2-keto group (Steps C and D).
[0073] Alternately, the 2-keto group of 4-hydroxy-2-oxohexanedioate
is reduced by an alcohol-forming oxidoreductase (Step E). The
product, 2,4-dihydroxyadipate is then dehydrated at the 2- or
4-hydroxy position to form 2-hydroxy-4-hexenedioate (Step G) or
3-hydroxy-4-hexenedioate (Step F). Subsequent dehydration yields
the diene, muconate (Steps D or H). This pathway is energetically
favorable and is useful because it does not require carboxylation
steps. Also, the pathway is driven by the stability of the muconate
end product.
[0074] Several pathways for producing muconate from pyruvate and
succinic semialdehyde are detailed in FIG. 4. Such pathways entail
aldol condensation of pyruvate with succinic semialdehyde to
4-hydroxy-2-oxoheptane-1,7-dioate (HODH) by HODH aldolase (Step A).
In one route, HODH is dehydrated to form 2-oxohept-4-ene-1,7-dioate
(OHED) by OHED hydratase (Step B). OHED is then decarboxylated to
form 6-oxo-2,3-dehydrohexanoate (6-OHE) (Step C). This product is
subsequently oxidized to the diacid and then further oxidized to
muconate (Steps F, I).
[0075] Alternately, HODH is converted to 3-hydroxyadipyl-CoA by a
formate-lyase or an acylating decarboxylating dehydrogenase (Step
D). The 3-hydroxy group of 3-hydroxyadipyl-CoA is then dehydrated
to form the enoyl-CoA (Step G). The CoA moiety of
2,3-dehydroadipyl-CoA is removed by a CoA hydrolase, ligase or
transferase (Step H). Finally, 2,3-dehydroadipate is oxidized to
muconate by muconate reductase (Step 1).
[0076] In yet another route, OHED is converted to
2,3-dehydroadipyl-CoA by a formate-lyase or acylating
decarboxylating dehydrogenase (Step E). 2,3-Dehydroadipyl-CoA is
then transformed to muconate.
[0077] Pathways for producing muconate from lysine are detailed in
FIG. 5. In one embodiment, lysine is converted to 2-aminoadipate
semialdehyde by an aminotransferase or aminating oxidoreductase
(Step A). 2-Aminoadipate semialdehyde is then oxidized to form
2-aminoadipate (Step B). The 2-amino group is then deaminated by a
2-aminoadipate deaminase (Step C). The product, 2,3-dehydroadipate
is further oxidized to muconate by muconate reductase (Step D).
[0078] In an alternate route, the 2-amino group of lysine is
shifted to the 3-position by lysine-2,3-aminomutase (Step E). The
product, 3,6-diaminohexanoate, is converted to 3-aminoadipate
semialdehyde by an aminotransferase or aminating oxidoreductase
(Step F). Oxidation of the aldehyde (Step G) and deamination (Step
H) yields 2,3-dehydroadipate, which is then converted to muconate
(Step D).
[0079] All transformations depicted in FIGS. 2-5 fall into the
general categories of transformations shown in Table 1. Below is
described a number of biochemically characterized genes in each
category. Specifically listed are genes that can be applied to
catalyze the appropriate transformations in FIGS. 2-5 when properly
cloned and expressed.
[0080] Table 1 shows the enzyme types useful to convert common
central metabolic intermediates into muconate. The first three
digits of each label correspond to the first three Enzyme
Commission number digits which denote the general type of
transformation independent of substrate specificity.
TABLE-US-00001 TABLE 1 Label Function 1.1.1a Oxidoreductase (oxo to
alcohol, and reverse) 1.2.1.a Oxidoreductase (acid to oxo) 1.2.1.c
Oxidoreductase (2-ketoacid to acyl-CoA) 1.3.1.a Oxidoreductase
(alkene to alkane, and reverse) 1.4.1.a Oxidoreductase (aminating)
2.3.1.b Acyltransferase (beta-ketothiolase) 2.3.1.d Acyltransferase
(formate C-acyltransferase) 2.6.1.a Aminotransferase 2.8.3.a CoA
transferase 3.1.1.a Enol-lactone hydrolase 3.1.2.a CoA hydrolase
4.1.1.a Carboxy-lyase 4.1.2.a Aldehyde-lyase 4.2.1.a Hydro-lyase
4.3.1.a Ammonia-lyase 5.2.1.a Cis/trans isomerase 5.3.3.a Lactone
isomerase 5.4.3.a Aminomutase 5.5.1.a Lactone cycloisomerase
6.2.1.a CoA synthetase
[0081] Several transformations depicted in FIGS. 2-5 require
oxidoreductases that convert a ketone functionality to a hydroxyl
group. The conversion of beta-ketoadipyl-CoA to 3-hydroxyadipyl-CoA
(FIG. 2, Step K) is catalyzed by a 3-oxoacyl-CoA dehydrogenase. The
reduction of 2-fumarylacetate to trans-3-hydroxy-4-hexendioate
(FIG. 2, Step D) or 2-maleylacetate to cis-3-hydroxy-4-hexendioate
(FIG. 2, Step P), is catalyzed by an oxidoreductase that converts a
3-oxoacid to a 3-hydroxyacid. Reduction of the ketone group of
4-oxalocrotonate and 4-hydroxy-2-oxohexanedioate to their
corresponding hydroxyl group is also catalyzed by enzymes in this
family (FIG. 3, Steps C and E).
[0082] Exemplary enzymes for converting beta-ketoadipyl-CoA to
3-hydroxyadipyl-CoA (FIG. 2, Step K) include 3-hydroxyacyl-CoA
dehydrogenases. Such enzymes convert 3-oxoacyl-CoA molecules into
3-hydroxyacyl-CoA molecules and are often involved in fatty acid
beta-oxidation or phenylacetate catabolism. For example, subunits
of two fatty acid oxidation complexes in E. coli, encoded by fadB
and fadJ, function as 3-hydroxyacyl-CoA dehydrogenases (Binstock
and Schultz, Methods Enzymol. 71Pt C:403-411 (1981)). Furthermore,
the gene products encoded by phaC in Pseudomonas putida U (Olivera
et al., Proc. Natl. Acad. Sci. U.S.A. 95:6419-6424 (1998)) and paaC
in Pseudomonas fluorescens ST (Di et al., Arch. Microbiol.
188:117-125 (2007)) catalyze the reverse reaction of step B in FIG.
10, that is, the oxidation of 3-hydroxyadipyl-CoA to form
3-oxoadipyl-CoA, during the catabolism of phenylacetate or styrene.
Note that the reactions catalyzed by such enzymes are reversible.
In addition, given the proximity in E. coli of paaH to other genes
in the phenylacetate degradation operon (Nogales et al.,
Microbiology 153:357-365 (2007)) and the fact that paaH mutants
cannot grow on phenylacetate (Ismail et al., Eur. J. Biochem.
270:3047-3054 (2003)), it is expected that the E. coli paaH gene
encodes a 3-hydroxyacyl-CoA dehydrogenase. Genbank information
related to these genes is summarized in Table 2 below.
TABLE-US-00002 TABLE 2 Gene GI # Accession No. Organism fadB 119811
P21177.2 Escherichia coli fadJ 3334437 P77399.1 Escherichia coli
paaH 16129356 NP_415913.1 Escherichia coli phaC 26990000
NP_745425.1 Pseudomonas putida paaC 106636095 ABF82235.1
Pseudomonas fluorescens
[0083] Additional exemplary oxidoreductases capable of converting
3-oxoacyl-CoA molecules to their corresponding 3-hydroxyacyl-CoA
molecules include 3-hydroxybutyryl-CoA dehydrogenases. The enzyme
from Clostridium acetobutylicum, encoded by hbd, has been cloned
and functionally expressed in E. coli (Youngleson et al., J.
Bacteriol. 171:6800-6807 (1989)). Additional genes include Hbd1
(C-terminal domain) and Hbd2 (N-terminal domain) in Clostridium
kluyveri (Hillmer and Gottschalk, FEBS Lett. 21:351-354 (1972)) and
HSD17B10 in Bos taurus (Wakil et al., J. Biol. Chem. 207:631-638
(1954)). Yet other genes demonstrated to reduce acetoacetyl-CoA to
3-hydroxybutyryl-CoA are phbB from Zoogloea ramigera (Ploux et al.,
Eur. J. Biochem. 174:177-182 (1988)) and phaB from Rhodobacter
sphaeroides (Alber et al., Mol. Microbiol. 61:297-309 (2006)). The
former gene is NADPH-dependent, its nucleotide sequence has been
determined (Peoples and Sinskey, Mol. Microbiol. 3:349-357 (1989))
and the gene has been expressed in E. coli. Substrate specificity
studies on the gene led to the conclusion that it could accept
3-oxopropionyl-CoA as an alternate substrate (Ploux et al., Eur. J.
Biochem. 174:177-182 (1988)). Genbank information related to these
genes is summarized in Table 3 below.
TABLE-US-00003 TABLE 3 Gene GI # Accession No. Organism hbd
18266893 P52041.2 Clostridium acetobutylicum Hbd2 146348271
EDK34807.1 Clostridium kluyveri Hbd1 146345976 EDK32512.1
Clostridium kluyveri HSD17B10 3183024 O02691.3 Bos taurus phaB
Rhodobacter sphaeroides phbB Zoogloea ramigera
[0084] A number of similar enzymes have been found in other species
of Clostridia and in Metallosphaera sedula (Berg et al., Science
318:1782-1786 (2007)) as shown in Table 4.
TABLE-US-00004 TABLE 4 Gene GI# Accession No. Organism hbd 15895965
NP_349314.1 Clostridium acetobutylicum hbd 20162442 AAM14586.1
Clostridium beijerinckii Msed_1423 146304189 YP_001191505
Metallosphaera sedula Msed_0399 146303184 YP_001190500
Metallosphaera sedula Msed_0389 146303174 YP_001190490
Metallosphaera sedula Msed_1993 146304741 YP_001192057
Metallosphaera sedula
[0085] There are various alcohol dehydrogenases for converting
2-maleylacetate to cis-3-hydroxy-4-hexenoate (FIG. 2, Step P),
2-fumarylacetate to trans-3-hydroxy-4-hexenoate (FIG. 2, Step D),
4-oxalocrotonate to 5-hydroxyhex-2-enedioate (FIG. 3, Step C) and
4-hydroxy-2-oxohexanedioate to 2,4-dihydroxyadipate (FIG. 3, Step
E). Two enzymes capable of converting an oxoacid to a hydroxyacid
are encoded by the malate dehydrogenase (mdh) and lactate
dehydrogenase (ldhA) genes in E. coli. In addition, lactate
dehydrogenase from Ralstonia eutropha has been shown to demonstrate
high activities on substrates of various chain lengths such as
lactate, 2-oxobutyrate, 2-oxopentanoate and 2-oxoglutarate
(Steinbuchel and Schlegel, Eur. J. Biochem. 130:329-334 (1983)).
Conversion of alpha-ketoadipate into alpha-hydroxyadipate can be
catalyzed by 2-ketoadipate reductase, an enzyme reported to be
found in rat and in human placenta (Suda et al., Arch. Biochem.
Biophys. 176:610-620 (1976); Suda et al., Biochem. Biophys. Res.
Commun. 77:586-591 (1977)). An additional gene for these steps is
the mitochondrial 3-hydroxybutyrate dehydrogenase (bdh) from the
human heart which has been cloned and characterized (Marks et al.,
J. Biol. Chem. 267:15459-15463 (1992)). This enzyme is a
dehydrogenase that operates on a 3-hydroxyacid. Another exemplary
alcohol dehydrogenase converts acetone to isopropanol as was shown
in C. beijerinckii (Ismail et al., Eur. J. Biochem. 270:3047-3054
(2003)) and T. brockii (Lamed and Zeikus, Biochem. J. 195:183-190
(1981); Peretz and Burstein, Biochemistry 28:6549-6555 (1989)).
Genbank information related to these genes is summarized in Table 5
below.
TABLE-US-00005 TABLE 5 Gene GI # Accession No. Organism mdh 1789632
AAC76268.1 Escherichia coli ldhA 16129341 NP_415898.1 Escherichia
coli bdh 177198 AAA58352.1 Homo sapiens adh 60592974 AAA23199.2
Clostridium beijerinckii adh 113443 P14941.1 Thermoanaerobacter
brockii
[0086] Enzymes in the 1.2.1 family are NAD(P)+-dependent
oxidoreductases that convert aldehydes to acids. Reactions
catalyzed by enzymes in this family include the oxidation of 6-OHE
(FIG. 4, Step F), 2-aminoadipate semialdehyde (FIG. 5, Step B) and
3-aminoadipate semialdehyde (FIG. 5, Step G) to their corresponding
acids. An exemplary enzyme is the NAD+-dependent aldehyde
dehydrogenases (EC 1.2.1.3). Two aldehyde dehydrogenases found in
human liver, ALDH-1 and ALDH-2, have broad substrate ranges for a
variety of aliphatic, aromatic and polycyclic aldehydes (Klyosov,
A. A., Biochemistry 35:4457-4467 (1996)). Active ALDH-2 has been
efficiently expressed in E. coli using the GroEL proteins as
chaperonins (Lee et al., Biochem. Biophys. Res. Commun. 298:216-224
(2002)). The rat mitochondrial aldehyde dehydrogenase also has a
broad substrate range that includes the enoyl-aldehyde
crotonaldehyde (Siew et al., Arch. Biochem. Biophys. 176:638-649
(1976)). The E. coli gene astD also encodes an NAD+-dependent
aldehyde dehydrogenase active on succinic semialdehyde (Kuznetsova
et al., FEMS Microbiol. Rev. 29:263-279 (2005)). Genbank
information related to these genes is summarized in Table 5
below.
TABLE-US-00006 TABLE 6 Gene GI # Accession No. Organism ALDH-2
118504 P05091.2 Homo sapiens ALDH-2 14192933 NP_115792.1 Rattus
norvegicus astD 3913108 P76217.1 Escherichia coli
[0087] Two transformations in FIG. 4 require conversion of a
2-ketoacid to an acyl-CoA (FIG. 4, Steps D and E) by an enzyme in
the EC class 1.2.1. Such reactions are catalyzed by multi-enzyme
complexes that catalyze a series of partial reactions which result
in acylating oxidative decarboxylation of 2-keto-acids. Exemplary
enzymes that can be used include 1) branched-chain 2-keto-acid
dehydrogenase, 2) alpha-ketoglutarate dehydrogenase, and 3) the
pyruvate dehydrogenase multienzyme complex (PDHC). Each of the
2-keto-acid dehydrogenase complexes occupies positions in
intermediary metabolism, and enzyme activity is typically tightly
regulated (Fries et al., Biochemistry 42:6996-7002 (2003)). The
enzymes share a complex but common structure composed of multiple
copies of three catalytic components: alpha-ketoacid decarboxylase
(E1), dihydrolipoamide acyltransferase (E2) and dihydrolipoamide
dehydrogenase (E3). The E3 component is shared among all
2-keto-acid dehydrogenase complexes in an organism, while the E1
and E2 components are encoded by different genes. The enzyme
components are present in numerous copies in the complex and
utilize multiple cofactors to catalyze a directed sequence of
reactions via substrate channeling. The overall size of these
dehydrogenase complexes is very large, with molecular masses
between 4 and 10 million Da (i.e., larger than a ribosome).
[0088] Activity of enzymes in the 2-keto-acid dehydrogenase family
is normally low or limited under anaerobic conditions in E. coli.
Increased production of NADH (or NADPH) could lead to a
redox-imbalance, and NADH itself serves as an inhibitor to enzyme
function. Engineering efforts have increased the anaerobic activity
of the E. coli pyruvate dehydrogenase complex (Kim et al., Appl.
Environ. Microbiol. 73:1766-1771 (2001); Kim et al., J. Bacteriol.
190:3851-3858 (2008); Zhou et al., Biotechnol. Lett. 30:335-342
(2008)). For example, the inhibitory effect of NADH can be overcome
by engineering an H322Y mutation in the E3 component (Kim et al.,
J. Bacteriol. 190:3851-3858 (2008)). Structural studies of
individual components and how they work together in complex provide
insight into the catalytic mechanisms and architecture of enzymes
in this family (Aevarsson et al., Nat. Struct. Biol. 6:785-792
(1999); Zhou et al., Proc. Natl. Acad. Sci. U.S.A. 98:14802-14807
(2001)). The substrate specificity of the dehydrogenase complexes
varies in different organisms, but generally branched-chain
keto-acid dehydrogenases have the broadest substrate range.
[0089] Alpha-ketoglutarate dehydrogenase (AKGD) converts
alpha-ketoglutarate to succinyl-CoA and is the primary site of
control of metabolic flux through the TCA cycle (Hansford, R. G.,
Curr. Top. Bioenerg. 10:217-278 (1980)). Encoded by genes sucA,
sucB and lpd in E. coli, AKGD gene expression is downregulated
under anaerobic conditions and during growth on glucose (Park et
al., Mol. Microbiol. 15:473-482 (1993)). Although the substrate
range of AKGD is narrow, structural studies of the catalytic core
of the E2 component pinpoint specific residues responsible for
substrate specificity (Knapp et al., J. Mol. Biol. 280:655-668
(1998)). The Bacillus subtilis AKGD, encoded by odhAB (E1 and E2)
and pdhD (E3, shared domain), is regulated at the transcriptional
level and is dependent on the carbon source and growth phase of the
organism (Resnekov et al., Mol. Gen. Genet. 234:285-296 (1992)). In
yeast, the LPD1 gene encoding the E3 component is regulated at the
transcriptional level by glucose (Roy and Dawes, J. Gen. Microbiol.
133:925-933 (1987)). The E1 component, encoded by KGD1, is also
regulated by glucose and activated by the products of HAP2 and HAP3
(Repetto and Tzagoloff, Moll. Cell. Biol. 9:2695-2705 (1989)). The
AKGD enzyme complex, inhibited by products NADH and succinyl-CoA,
is known in mammalian systems, as impaired function of has been
linked to several neurological diseases (Tretter and dam-Vizi,
Philos. Trans. R. Soc. Lond B Biol. Sci. 360:2335-2345 (2005)).
Genbank information related to these genes is summarized in Table 7
below.
TABLE-US-00007 TABLE 7 Gene GI # Accession No. Organism sucA
16128701 NP_415254.1 Escherichia coli sucB 16128702 NP_415255.1
Escherichia coli lpd 16128109 NP_414658.1 Escherichia coli odhA
51704265 P23129.2 Bacillus subtilis odhB 129041 P16263.1 Bacillus
subtilis pdhD 118672 P21880.1 Bacillus subtilis KGD1 6322066
NP_012141.1 Saccharomyces cerevisiae KGD2 6320352 NP_010432.1
Saccharomyces cerevisiae LPD1 14318501 NP_116635.1 Saccharomyces
cerevisiae
[0090] Branched-chain 2-keto-acid dehydrogenase complex (BCKAD),
also known as 2-oxoisovalerate dehydrogenase, participates in
branched-chain amino acid degradation pathways, converting 2-keto
acids derivatives of valine, leucine and isoleucine to their
acyl-CoA derivatives and CO.sub.2. The complex has been studied in
many organisms including Bacillus subtilis (Wang et al., Eur. J.
Biochem. 213:1091-1099 (1993)), Rattus norvegicus (Namba et al., J.
Biol. Chem. 244:4437-4447 (1969)) and Pseudomonas putida (Sokatch
et al., J. Bacteriol. 148:647-652 (1981)). In Bacillus subtilis the
enzyme is encoded by genes pdhD (E3 component), bfmBB (E2
component), bfmBAA and bfmBAB (E1 component) (Wang et al., Eur. J.
Biochem. 213:1091-1099 (1993)). In mammals, the complex is
regulated by phosphorylation by specific phosphatases and protein
kinases. The complex has been studied in rat hepatocites (Chicco et
al., J. Biol. Chem. 269:19427-19434 (1994)) and is encoded by genes
Bckdha (E1 alpha), Bckdhb (E1 beta), Dbt (E2), and Dld (E3). The E1
and E3 components of the Pseudomonas putida BCKAD complex have been
crystallized (Aevarsson et al., Nat. Struct. Biol. 6:785-792
(1999); Mattevi et al., Science 255:1544-1550 (1992)) and the
enzyme complex has been studied (Sokatch et al., J. Bacteriol.
148:647-652 (1981)). Transcription of the P. putida BCKAD genes is
activated by the gene product of bkdR (Hesslinger et al., Mol.
Microbiol. 27:477-492 (1998)). In some organisms including Rattus
norvegicus (Paxton et al., Biochem. J. 234:295-303 (1986)) and
Saccharomyces cerevisiae (Sinclair et al., Biochem. Mol. Biol. Int.
31:911-9122 (1993)), this complex has been shown to have a broad
substrate range that includes linear oxo-acids such as
2-oxobutanoate and alpha-ketoglutarate, in addition to the
branched-chain amino acid precursors. The active site of the bovine
BCKAD was engineered to favor alternate substrate acetyl-CoA (Meng
and Chuang, Biochemistry 33:12879-12885 (1994)). Genbank
information related to these genes is summarized in Table 8
below.
TABLE-US-00008 TABLE 8 Gene GI # Accession No. Organism bfmBB
16079459 NP_390283.1 Bacillus subtilis bfmBAA 16079461 NP_390285.1
Bacillus subtilis bfmBAB 16079460 NP_390284.1 Bacillus subtilis
pdhD 118672 P21880.1 Bacillus subtilis lpdV 118677 P09063.1
Pseudomonas putida bkdB 129044 P09062.1 Pseudomonas putida bkdA1
26991090 NP_746515.1 Pseudomonas putida bkdA2 26991091 NP_746516.1
Pseudomonas putida Bckdha 77736548 NP_036914.1 Rattus norvegicus
Bckdhb 158749538 NP_062140.1 Rattus norvegicus Dbt 158749632
NP_445764.1 Rattus norvegicus Dld 40786469 NP_955417.1 Rattus
norvegicus
[0091] The pyruvate dehydrogenase complex, catalyzing the
conversion of pyruvate to acetyl-CoA, has also been studied. In the
E. coli enzyme, specific residues in the E1 component are
responsible for substrate specificity (Bisswanger, H., J. Biol.
Chem. 256:815-822 (1981); Bremer, J., Eur. J. Biochem. 8:535-540
(1969); Gong et al., J. Biol. Chem. 275:13645-13653 (2000)). As
mentioned previously, enzyme engineering efforts have improved the
E. coli PDH enzyme activity under anaerobic conditions (Kim et al.,
Appl. Environ. Microbiol. 73:1766-1771 (2007); Kim et al., J.
Bacteriol. 190:3851-3858 (2008); Zhou et al., Biotechnol. Letter.
30:335-342 (2008)). In contrast to the E. coli PDH, the B. subtilis
complex is active and required for growth under anaerobic
conditions (Nakano et al., J. Bacteriol. 179:6749-6755 (1997)). The
Klebsiella pneumoniae PDH, characterized during growth on glycerol,
is also active under anaerobic conditions (Menzel et al., J.
Biotechnol. 56:135-142 (1997)). Crystal structures of the enzyme
complex from bovine kidney (Zhou et al., Proc. Natl. Acad. Sci.
U.S.A. 98:14802-14807 (2001)) and the E2 catalytic domain from
Azotobacter vinelandii are available (Mattevi et al., Science
255:1544-1550 (1992)). Some mammalian PDH enzymes complexes can
react on alternate substrates such as 2-oxobutanoate, although
comparative kinetics of Rattus norvegicus PDH and BCKAD indicate
that BCKAD has higher activity on 2-oxobutanoate as a substrate
(Paxton et al., Biochem. J. 234:295-303 (1986)). Genbank
information related to these genes is summarized in Table 9
below.
TABLE-US-00009 TABLE 9 Gene GI # Accession No. Organism aceE
16128107 NP_414656.1 Escherichia coli aceF 16128108 NP_414657.1
Escherichia coli lpd 16128109 NP_414658.1 Escherichia coli pdhA
3123238 P21881.1 Bacillus subtilis pdhB 129068 P21882.1 Bacillus
subtilis pdhC 129054 P21883.2 Bacillus subtilis pdhD 118672
P21880.1 Bacillus subtilis aceE 152968699 YP_001333808.1 Klebsiella
pneumonia aceF 152968700 YP_001333809.1 Klebsiella pneumonia lpdA
152968701 YP_001333810.1 Klebsiella pneumonia Pdha1 124430510
NP_001004072.2 Rattus norvegicus Pdha2 16758900 NP_446446.1 Rattus
norvegicus Dlat 78365255 NP_112287.1 Rattus norvegicus Dld 40786469
NP_955417.1 Rattus norvegicus
[0092] As an alternative to the large multienzyme 2-keto-acid
dehydrogenase complexes described above, some anaerobic organisms
utilize enzymes in the 2-ketoacid oxidoreductase family (OFOR) to
catalyze acylating oxidative decarboxylation of 2-keto-acids.
Unlike the dehydrogenase complexes, these enzymes contain
iron-sulfur clusters, utilize different cofactors, and use
ferredoxin or flavodoxin as electron acceptors in lieu of NAD(P)H.
While most enzymes in this family are specific to pyruvate as a
substrate (POR) some 2-keto-acid:ferredoxin oxidoreductases have
been shown to accept a broad range of 2-ketoacids as substrates
including alpha-ketoglutarate and 2-oxobutanoate (Fukuda and
Wakagi, Biochim. Biophys. Acta. 1597.sub.--74-80 (2002); Zhang et
al., J. Biochem. 120:587-599 (1996)). One such enzyme is the OFOR
from the thermoacidophilic archaeon Sulfolobus tokodaii 7, which
contains an alpha and beta subunit encoded by gene ST2300 (Fukuda
and Wakagi, supra; Zhang et al., supra). A plasmid-based expression
system has been developed for efficiently expressing this protein
in E. coli (Fukuda et al., Eur. J. Biochem. 268:5639-5646 (2001))
and residues involved in substrate specificity were determined
(Fukuda and Wakagi, supra). Two OFORs from Aeropyrum pernix str. K1
have also been recently cloned into E. coli, characterized, and
found to react with a broad range of 2-oxoacids (Nishizawa et al.,
FEBS Lett. 579.sub.--2319-2322 (2005)). The gene sequences of these
OFOR enzymes are available, although they do not have GenBank
identifiers assigned to date. There is bioinformatic evidence that
similar enzymes are present in all archaea, some anaerobic bacteria
and amitochondrial eukarya (Fukuda and Wakagi, supra). This class
of enzyme is also interesting from an energetic standpoint, as
reduced ferredoxin could be used to generate NADH by ferredoxin-NAD
reductase (Petitdemange et al., Biochim. Biophys. Acta 421:334-337
(1976)). Also, since most of the enzymes are designed to operate
under anaerobic conditions, less enzyme engineering may be required
relative to enzymes in the 2-keto-acid dehydrogenase complex family
for activity in an anaerobic environment. Genbank information
related to these genes is summarized in Table 10 below.
TABLE-US-00010 TABLE 10 Gene GI # Accession No. Organism ST2300
15922633 NP_378302.1 Sulfolobus tokodaii 7
[0093] Three transformations fall into the category of
oxidoreductases that reduce an alkene to an alkane (EC 1.3.1.-).
The conversion of beta-ketoadipate to 2-maleylacetate (FIG. 2, Step
O) is also catalyzed by the 2-enoate oxidoreductase maleylacetate
reductase (MAR). A similar enzyme converts beta-ketoadipate to
2-fumarylacetate (FIG. 2, Step C). The oxidization of
2,3-dehydroadipate to muconate (FIG. 2, Step N) is catalyzed by a
2-enoate oxidoreductase with muconate reductase functionality.
[0094] 2-Enoate oxidoreductase enzymes are known to catalyze the
NAD(P)H-dependent reduction and oxidation of a wide variety of
.alpha., .beta.-unsaturated carboxylic acids and aldehydes (Rohdich
et al., J. Biol. Chem. 276:5779-5787 (2001)). In the recently
published genome sequence of C. kluyveri, 9 coding sequences for
enoate reductases were reported, out of which one has been
characterized (Seedorf et al., Proc. Natl. Acad. Sci. U.S.A.
105:2128-2133 (2008)). The enr genes from both C. tyrobutyricum and
M. thermoaceticum have been cloned and sequenced and show 59%
identity to each other. The former gene is also found to have
approximately 75% similarity to the characterized gene in C.
kluyveri (Giesel and Simon, Arch. Microbiol. 135:51-57 (1983)). It
has been reported based on these sequence results that enr is very
similar to the dienoyl CoA reductase in E. coli (fadH) (Rohdich et
al., J. Biol. Chem. 276:5779-5787 (2001)). The C. thermoaceticum
enr gene has also been expressed in a catalytically active form in
E. coli (Rohdich et al., supra). Genbank information related to
these genes is summarized in Table 11 below.
TABLE-US-00011 TABLE 11 Gene GI # Accession No. Organism enr
169405742 ACA54153.1 Clostridium botulinum A3 str enr 2765041
CAA71086.1 Clostridium tyrobutyricum enr 3402834 CAA76083.1
Clostridium kluyveri enr 83590886 YP_430895.1 Moorella
thermoacetica fadH 16130976 NP_417552.1 Escherichia coli
[0095] MAR is a 2-enoate oxidoreductase catalyzing the reversible
reduction of 2-maleylacetate (cis-4-oxohex-2-enedioate) to
3-oxoadipate (FIG. 2, Step O). MAR enzymes naturally participate in
aromatic degradation pathways (Camara et al., J. Bacteriol.
191:4905-4915 (2009); Huang et al., Appl. Environ. Microbiol.
72:7238-7245 (2006); Kaschabek and Reineke, J. Bacteriol.
177:320-325 (1995); Kaschabek and Reineke, J. Bacteriol.
175:6075-6081 (1993)). The enzyme activity was identified and
characterized in Pseudomonas sp. strain B13 (Kaschabek and Reineke,
(1995) supra; Kaschabek and Reineke, (1993) supra), and the coding
gene was cloned and sequenced (Kasberg et al., J. Bacteriol.
179:3801-3803 (1997)). Additional MAR genes include clcE gene from
Pseudomonas sp. strain B13 (Kasberg et al., supra), macA gene from
Rhodococcus opacus (Seibert et al., J. Bacteriol. 175:6745-6754
(1993)), the macA gene from Ralstonia eutropha (also known as
Cupriavidus necator) (Seibert et al., Microbiology 150:463-472
(2004)), tfdFII from Ralstonia eutropha (Seibert et al., (1993)
supra) and NCgl1112 in Corynebacterium glutamicum (Huang et al.,
Appl. Environ Microbiol. 72:7238-7245 (2006)). A MAR in Pseudomonas
reinekei MT1, encoded by ccaD, was recently identified and the
nucleotide sequence is available under the DBJ/EMBL GenBank
accession number EF159980 (Camara et al., J. Bacteriol.
191:4905-4915 (2009). Genbank information related to these genes is
summarized in Table 12 below.
TABLE-US-00012 TABLE 12 Gene GI # Accession No. Organism clcE
3913241 O30847.1 Pseudomonas sp. strain B13 macA 7387876 O84992.1
Rhodococcus opacus macA 5916089 AAD55886 Cupriavidus necator tfdFII
1747424 AC44727.1 Ralstonia eutropha JMP134 NCgl1112 19552383
NP_600385 Corynebacterium glutamicum ccaD Pseudomonas reinekei
MT1
[0096] In Step R of FIG. 2, 2-maleylacetate is transaminated to
form 3-amino-4-hexanoate. The conversion of 2-fumarylacetate to
trans-3-amino-4-hexenedioate is a similar transformation (FIG. 2,
Step F). These reactions are performed by aminating oxidoreductases
in the EC class 1.4.1. Enzymes in this EC class catalyze the
oxidative deamination of alpha-amino acids with NAD+ or NADP+ as
acceptor, and the reactions are typically reversible. Exemplary
enzymes include glutamate dehydrogenase (deaminating), encoded by
gdhA, leucine dehydrogenase (deaminating), encoded by ldh, and
aspartate dehydrogenase (deaminating), encoded by nadX. The gdhA
gene product from Escherichia coli (Korber et al., J. Mol. Biol.
234:1270-1273 (1993); McPherson and Wootton, Nucleic Acids Res.
11:5257-5266 (1983)), gdh from Thermotoga maritime (Kort et al.,
Extremophiles 1:52-60-1997); Lebbink et al., J. Mol. Biol.
280:287-296 (1998); Lebbink et al., J. Mol. Biol. 289:357-369
(1999)), and gdhA1 from Halobacterium salinarum (Ingoldsby et al.,
Gene 349:237-244 (2005)) catalyze the reversible conversion of
glutamate to 2-oxoglutarate and ammonia, while favoring NADP(H),
NAD(H), or both, respectively. The ldh gene of Bacillus cereus
encodes the LeuDH protein that has a wide of range of substrates
including leucine, isoleucine, valine, and 2-aminobutanoate
(Ansorge and Kula, Biotechnol. Bioeng. 68:557-562 (2000); Stoyan et
al., J. Biotechnol. 54:77-80 (1997)). The nadX gene from Thermotoga
maritima encoding for the aspartate dehydrogenase is involved in
the biosynthesis of NAD (Yang et al., J. Biol. Chem. 278:8804-8808
(2003)). Genbank information related to these genes is summarized
in Table 13 below.
TABLE-US-00013 TABLE 13 Gene GI # Accession No. Organism gdhA
118547 P00370 Escherichia coli gdh 6226595 P96110.4 Thermotoga
maritima gdhA1 15789827 NP_279651.1 Halobacterium salinarum ldh
61222614 P0A393 Bacillus cereus nadX 15644391 NP_229443.1
Thermotoga maritima
[0097] The conversions of lysine to 2-aminoadipate semialdehyde
(FIG. 5, Step A) and 3,6-diaminohexanoate to 3-aminoadipate
semialdehyde (FIG. 5, Step F) are catalyzed by aminating
oxidoreductases that transform primary amines to their
corresponding aldehydes. The lysine 6-dehydrogenase (deaminating),
encoded by the lysDH genes, catalyze the oxidative deamination of
the 6-amino group of L-lysine to form
2-aminoadipate-6-semialdehyde, which can spontaneously and
reversibly cyclize to form .DELTA..sup.1-piperideine-6-carboxylate
(Misono and Nagasaki, J. Bacteriol. 150:398-401 (1982)). Exemplary
enzymes are found in Geobacillus stearothermophilus (Heydari et
al., Appl. Environ. Microbiol. 70:937-942 (2004)), Agrobacterium
tumefaciens (Hashimoto et al., J. Biochem. 106:76-80 (1989), Misono
and Nagasaki, supra), and Achromobacter denitrificans
(Ruldeekulthamrong et al., BMB. Rep. 41:790-795 (2008)). Such
enzymes can convert 3,6-diaminohexanoate to 3-aminoadipate
semialdehyde given the structural similarity between
3,6-diaminohexanoate and lysine. Genbank information related to
these genes is summarized in Table 14 below.
TABLE-US-00014 TABLE 14 Gene GI # Accession No. Organism lysDH
13429872 BAB39707 Geobacillus stearothermophilus lysDH 15888285
NP_353966 Agrobacterium tumefaciens lysDH 74026644 AAZ94428
Achromobacter denitrificans
[0098] FIG. 2, step A uses a 3-oxoadipyl-CoA thiolase, or
equivalently, succinyl CoA:acetyl CoA acyl transferase
(.beta.-ketothiolase). The gene products encoded by pcaF in
Pseudomonas strain B13 (Kaschabek et al., J. Bacteriol. 184:207-215
(2002)), phaD in Pseudomonas putida U (Olivera et al., Proc. Natl.
Acad. Sci. U.S.A. 95:6419-6424 (1998)), paaE in Pseudomonas
fluorescens ST (Di et al., Arch. Micbrobiol. 188:117-125 (2007)),
and paaJ from E. coli (Nogales et al., Microbiology 153:357-365
(2007)) catalyze the conversion of 3-oxoadipyl-CoA into
succinyl-CoA and acetyl-CoA during the degradation of aromatic
compounds such as phenylacetate or styrene. Since beta-ketothiolase
enzymes catalyze reversible transformations, these enzymes can also
be employed for the synthesis of 3-oxoadipyl-CoA. Several
beta-ketothiolases were shown to have significant and selective
activities in the oxoadipyl-CoA forming direction as shown in
Example I below including bkt from Pseudomonas putida, pcaF and bkt
from Pseudomonas aeruginosa PAO1, bkt from Burkholderia ambifaria
AMMD, paaJ from E. coli, and phaD from P. putida. Genbank
information related to these genes is summarized in Table 15
below.
TABLE-US-00015 TABLE 15 Gene GI # Accession No. Organism paaJ
16129358 NP_415915.1 Escherichia coli pcaF 17736947 AAL02407
Pseudomonas knackmussii (B13) phaD 3253200 AAC24332.1 Pseudomonas
putida pcaF 506695 AAA85138.1 Pseudomonas putida paaE 106636097
ABF82237.1 Pseudomonas fluorescens bkt Burkholderia ambifaria AMMD
bkt Pseudomonas aeruginosa PAO1 pcaF Pseudomonas aeruginosa
PAO1
[0099] The acylation of ketoacids HODH and OHED to their
corresponding CoA derivatives (FIG. 4, Steps D and E) and
concurrent release of formate, is catalyzed by formate
C-acyltransferase enzymes in the EC class 2.3.1. Enzymes in this
class include pyruvate formate-lyase and ketoacid formate-lyase.
Pyruvate formate-lyase (PFL, EC 2.3.1.54), encoded by pflB in E.
coli, converts pyruvate into acetyl-CoA and formate. The active
site of PFL contains a catalytically essential glycyl radical that
is posttranslationally activated under anaerobic conditions by
PFL-activating enzyme (PFL-AE, EC 1.97.1.4) encoded by pflA (Knappe
et al., Proc. Natl. Acad. Sci. U.S.A. 81:1332-1335 (1984); Wong et
al., Biochemistry 32:14102-14110 (1993)). A pyruvate formate-lyase
from Archaeglubus fulgidus encoded by pflD has been cloned,
expressed in E. coli and characterized (Lehtio and Goldman, Protein
Eng Des Sel 17:545-552 (2004)). The crystal structures of the A.
fulgidus and E. coli enzymes have been resolved (Lehtio et al., J.
Mol. Biol. 357:221-235 (2006); Leppanen et al., Structure 7:733-744
(1999)). Additional PFL and PFL-AE enzymes are found in Clostridium
pasteurianum (Weidner and Sawyers, J. Bacteriol. 178:2440-2444
(1996)) and the eukaryotic alga Chlamydomonas reinhardtii
(Hemschemeier et al., Eukaryot. Cell 7:518.sub.--526 (2008)).
Keto-acid formate-lyase (EC 2.3.1.-), also known as 2-ketobutyrate
formate-lyase (KFL) and pyruvate formate-lyase 4, is the gene
product of tdcE in E. coli. This enzyme catalyzes the conversion of
2-ketobutyrate to propionyl-CoA and formate during anaerobic
threonine degradation, and can also substitute for pyruvate
formate-lyase in anaerobic catabolism (Simanshu et al., J. Biosci.
32:1195-1206 (2007)). The enzyme is oxygen-sensitive and, like
PflB, requires post-translational modification by PFL-AE to
activate a glycyl radical in the active site (Hesslinger et al.,
Mol. Microbiol. 27:477-492 (1998)). Genbank information related to
these genes is summarized in Table 16 below.
TABLE-US-00016 TABLE 16 Gene GI # Accession No. Organism pflB
16128870 NP_415423.1 Escherichia coli pflA 16128869 NP_415422.1
Escherichia coli tdcE 48994926 AAT48170.1 Escherichia coli pflD
11499044 NP_070278.1 Archaeglubus fulgidus pfl 2500058 Q46266.1
Clostridium pasteurianum act 1072362 CAA63749.1 Clostridium
pasteurianum pfl1 159462978 XP_001689719.1 Chlamydomonas
reinhardtii pflA1 159485246 XP_001700657.1 Chlamydomonas
reinhardtii
[0100] Several reactions in FIGS. 2 and 5 are catalyzed by
aminotransferases in the EC class 2.6.1 (FIG. 2, Steps F and R and
FIG. 5, Steps A and F). Such enzymes reversibly transfer amino
groups from aminated donors to acceptors such as pyruvate and
alpha-ketoglutarate. The conversion of lysine to 2-aminoadipate
(FIG. 5, Step A) is naturally catalyzed by
lysine-6-aminotransferase (EC 2.6.1.36). This enzyme function has
been demonstrated in yeast and bacteria. Enzymes from Candida wills
(Hammer et al J. Basic Microbiol. 32:21-27 (1992)), Flavobacterium
lutescens (Fuji et al. J. Biochem. 128:391-397 (2000)) and
Streptomyces clavuligenus (Romero et al. J. Ind. Microbiol.
Biotechnol. 18:241-246 (1997)) have been characterized. A
recombinant lysine-6-aminotransferase from S. clavuligenus was
functionally expressed in E. coli (Tobin et al J. Bacteriol.
173:6223-6229 (1991)). The F. lutescens enzyme is specific to
alpha-ketoglutarate as the amino acceptor (Soda et al. Biochemistry
7:4110-4119 (1968)). Lysine-6-aminotransferase is also an enzyme
that can catalyze the transamination of 3,6-diaminohexanoate (FIG.
5, Step F), as this substrate is structurally similar to lysine.
Genbank information related to these genes is summarized in Table
17 below.
TABLE-US-00017 TABLE 17 Gene GI # Accession No. Organism lat
10336502 BAB13756.1 Flavobacterium lutescens lat 153343 AAA26777.1
Streptomyces clavuligenus
[0101] In Steps R and F of FIG. 2 the beta-ketones of
2-maleylacetate and 2-fumarylacetate, respectively, are converted
to secondary amines. Beta-alanine/alpha-ketoglutarate
aminotransferase (WO08027742) reacts with beta-alanine to form
malonic semialdehyde, a 3-oxoacid similar in structure to
2-maleylacetate. The gene product of SkPYD4 in Saccharomyces
kluyveri was shown to preferentially use beta-alanine as the amino
group donor (Andersen and Hansen, Gene 124:105-109 (1993)). SkUGA1
encodes a homologue of Saccharomyces cerevisiae GABA
aminotransferase, UGA1 (Ramos et al., Eur. J. Biochem. 149:401-404
(1985)), whereas SkPYD4 encodes an enzyme involved in both -alanine
and GABA transamination (Andersen and Hansen, supra).
3-Amino-2-methylpropionate transaminase catalyzes the
transformation from methylmalonate semialdehyde to
3-amino-2-methylpropionate. The enzyme has been characterized in
Rattus norvegicus and Sus scrofa and is encoded by Abat (Kakimoto
et al., Biochim. Biophys. Acta 156:374-380 (1968); Tamaki et al.,
Methods Enzymol. 324:376-389 (2000)). Genbank information related
to these genes is summarized in Table 18 below.
TABLE-US-00018 TABLE 18 Gene GI # Accession No. Organism SkyPYD4
98626772 ABF58893.1 Lachancea kluyveri SkUGA1 98626792 ABF58894.1
Lachancea kluyveri UGA1 6321456 NP_011533.1 Saccharomyces
cerevisiae Abat 122065191 P50554.3 Rattus norvegicus Abat 120968
P80147.2 Sus scrofa
[0102] Another enzyme that can catalyze the aminotransferase
reactions in FIGS. 2 and 5 is gamma-aminobutyrate transaminase
(GABA transaminase), which naturally interconverts succinic
semialdehyde and glutamate to 4-aminobutyrate and
alpha-ketoglutarate and is known to have a broad substrate range
(Liu et al., Biochemistry 43:10896-10905 (2004); Shigeoka and
Nakano, Arch. Biochem. Biophys. 288:22-28 (1991); Schulz et al.,
Appl. Environ. Microbiol. 56:1-6 (1990)). E. coli has two GABA
transaminases, encoded by gabT (Bartsch and Schulz, J. Bacteriol.
172:7035-7042 (1990)) and puuE (Kurihara et al., J. Biol. Chem.
280:4602-4608 (2005)). GABA transaminases in Mus musculus,
Pseudomonas fluorescens, and Sus scrofa have been shown to react
with alternate substrates (Cooper, A. J., Methods Enzymol.
113:80-82 (1985); Scott and Jakoby, J. Biol. Chem. 234:932-936
(1959). Genbank information related to these genes is summarized in
Table 19 below.
TABLE-US-00019 TABLE 19 Gene GI # Accession No. Organism gabT
16130576 NP_417148.1 Escherichia coli puuE 16129263 P_415818.1
Escherichia coli aba 37202121 NP_766549.2 Mus musculus gabT
70733692 YP_257332.1 Pseudomonas fluorescens aba 47523600
NP_999428.1 Sus scrofa
[0103] CoA transferases catalyze the reversible transfer of a CoA
moiety from one molecule to another. Conversion of
beta-ketoadipyl-CoA to beta-ketoadipate (FIG. 2, Step B) is
accompanied by the acylation of succinate by beta-ketoadipyl-CoA
transferase. The de-acylation of 2,3-dehydroadipyl-CoA (FIG. 2,
Step M and FIG. 4, Step H) can also be catalyzed by an enzyme in
the 2.8.3 family.
[0104] Beta-ketoadipyl-CoA transferase (EC 2.8.3.6), also known as
succinyl-CoA:3:oxoacid-CoA transferase, is encoded by pcaI and pcaJ
in Pseudomonas putida (Kaschabek et al., J. Bacteriol. 184:207-215
(2002)). Similar enzymes based on homology exist in Acinetobacter
sp. ADP1 (Kowalchuk et al., Gene 146:23-30 (1994)). Additional
exemplary succinyl-CoA:3:oxoacid-CoA transferases are present in
Helicobacter pylori (Corthesy-Theulaz et al., J. Biol. Chem.
272:25659-25667 (1997)) and Bacillus subtilis (Stols et al.,
Protein Expr. Purif. 53:396-403 (2007)). Genbank information
related to these genes is summarized in Table 20 below.
TABLE-US-00020 TABLE 20 Gene GI # Accession No. Organism pcaI
24985644 AAN69545.1 Pseudomonas putida pcaJ 26990657 NP_746082.1
Pseudomonas putida pcaI 50084858 YP_046368.1 Acinetobacter sp. ADP1
pcaJ 141776 AAC37147.1 Acinetobacter sp. ADP1 pcaI 21224997
NP_630776.1 Streptomyces coelicolor pcaJ 21224996 NP_630775.1
Streptomyces coelicolor HPAG1_0676 108563101 YP_627417 Helicobacter
pylori HPAG1_0677 108563102 YP_627418 Helicobacter pylori ScoA
16080950 NP_391778 Bacillus subtilis ScoB 16080949 NP_391777
Bacillus subtilis
[0105] The glutaconyl-CoA-transferase (EC 2.8.3.12) enzyme from
anaerobic bacterium Acidaminococcus fermentans reacts with
glutaconyl-CoA and 3-butenoyl-CoA (Mack et al., Eur. J. Biochem.
226:41-51 (1994)), substrates similar in structure to
2,3-dehydroadipyl-CoA. The genes encoding this enzyme are gctA and
gctB. This enzyme has reduced but detectable activity with other
CoA derivatives including glutaryl-CoA, 2-hydroxyglutaryl-CoA,
adipyl-CoA and acrylyl-CoA (Buckel et al., Eur. J. Biochem.
118:315-321 (1981)). The enzyme has been cloned and expressed in E.
coli (Mack, supra). Genbank information related to these genes is
summarized in Table 21 below.
TABLE-US-00021 TABLE 21 Gene GI # Accession No. Organism gctA
559392 CAA57199.1 Acidaminococcus fermentans gctB 559393 CAA57200.1
Acidaminococcus fermentans
[0106] Other exemplary CoA transferases are catalyzed by the gene
products of cat1, cat2, and cat3 of Clostridium kluyveri which have
been shown to exhibit succinyl-CoA, 4-hydroxybutyryl-CoA, and
butyryl-CoA transferase activity, respectively (Seedorf et al.,
Proc. Natl. Acad. Sci. U.S.A. 105:2128-2133 (2008); Sohling and
Gottschalk, J. Bacteriol. 178:871-880 (1996)). Similar CoA
transferase activities are also present in Trichomonas vaginalis
(van Grinsven et al., J. Biol. Chem. 283:1411-1418 (2008)) and
Trypanosoma brucei (Riviere et al., J. Biol. Chem. 279:45337-45346
(2004)). Genbank information related to these genes is summarized
in Table 22 below.
TABLE-US-00022 TABLE 22 Gene GI # Accession No. Organism cat1
729048 P38946.1 Clostridium kluyveri cat2 172046066 P38942.2
Clostridium kluyveri cat3 146349050 EDK35586.1 Clostridium kluyveri
TVAG_395550 123975034 XP_001330176 Trichomonas vaginalis G3
Tb11.02.0290 71754875 XP_828352 Trypanosoma brucei
[0107] A CoA transferase that can utilize acetyl-CoA as the CoA
donor is acetoacetyl-CoA transferase, encoded by the E. coli atoA
(alpha subunit) and atoD (beta subunit) genes (Korolev et al., Acta
Crystallagr. D. Biol. Crystallagr. 58:2116-2121 (2002);
Vanderwinkel et al., Biochem. Biophys. Res. Commun. 33:902-908
(1968)). This enzyme has a broad substrate range (Sramek and
Frerman, Arch. Biochem. Biophys. 171:14-26 (1975)) and has been
shown to transfer the CoA moiety to acetate from a variety of
branched and linear acyl-CoA substrates, including isobutyrate
(Matthies and Schink, Appl. Environ. Microbiol. 58:1435-1439
(1992)), valerate (Vanderwinkel et al, supra) and butanoate
(Vanderwinkel et al, supra). This enzyme is induced at the
transcriptional level by acetoacetate, so modification of
regulatory control may be necessary for engineering this enzyme
into a pathway (Pauli and Overath, Eur. J. Biochem. 29:553-562
(1972)). Similar enzymes exist in Corynebacterium glutamicum ATCC
13032 (Duncan et al., Appl. Environ. Microbiol. 68:5186-5190
(2002)), Clostridium acetobutylicum (Cary et al., Appl. Environ.
Microbiol. 56:1576-1583 (1990); Weisenborn et al., Appl. Environ.
Microbiol. 55:323-329 (1989)), and Clostridium
saccharoperbutylacetonicum (Kosaka et al., Biosci. Biotechnol.
Biochem. 71:58-58 (2007)). Genbank information related to these
genes is summarized in Table 23 below.
TABLE-US-00023 TABLE 23 Gene GI # Accession No. Organism atoA
2492994 P76459.1 Escherichia coli atoD 2492990 P76458.1 Escherichia
coli actA 62391407 YP_226809.1 Corynebacterium glutamicum cg0592
62389399 YP_224801.1 Corynebacterium glutamicum ctfA 15004866
NP_149326.1 Clostridium acetobutylicum ctfB 15004867 NP_149327.1
Clostridium acetobutylicum ctfA 31075384 AAP42564.1 Clostridium
saccharoperbutylacetonicum ctfB 31075385 AAP42565.1 Clostridium
saccharoperbutylacetonicum
[0108] In Step H of FIG. 2, the lactonization of beta-ketoadipate
to form .beta.-ketoadipate-enol-lactone is be catalyzed by the
beta-ketoadipate enol-lactonase (EC-3.1.1.24). Beta-ketoadipate
enol-lactonase also participates in the catechol branch of the
beta-ketoadipate pathway to degrade aromatic compounds, in the
reverse direction of that required in Step H of FIG. 2. This enzyme
is encoded by the pcaD gene in Pseudomonas putida (Hughes et al.,
J. Gen Microbiol. 134:2877-2887 (1988)), Rhodococcus opacus
(Eulberg et al., J. Bacteriol. 180:1072-1081 (1998)) and Ralstonia
eutropha. In Acinetobacter calcoaceticus, genes encoding two
.beta.-ketoadipate enol-lactone hydrolases were identified (Patel
et al., J. Biol. Chem. 250:6567 (1975)). Genbank information
related to these genes is summarized in Table 24 below.
TABLE-US-00024 TABLE 24 Gene GI # Accession No. Organism ELH
6015088 Q59093 Acinetobacter calcoaceticus ELH2 6166146 P00632
Acinetobacter calcoaceticus pcaD 24982842 AAN67003 Pseudomonas
putida pcaD 75426718 O67982 Rhodococcus opacus pcaD 75411823
javascript: Ralstonia eutropha Blast2(`Q9EV41`)Q9EV45
[0109] The hydrolysis of acyl-CoA molecules to their corresponding
acids is carried out by acyl CoA hydrolase enzymes in the 3.1.2
family, also called thioesterases. Several eukaryotic acetyl-CoA
hydrolases (EC 3.1.2.1) have broad substrate specificity and thus
represent suitable enzymes for hydrolyzing beta-ketoadipyl-CoA and
2,3-dehydroadipyl-CoA (FIG. 2, Steps B and M and FIG. 4, Step H).
For example, the enzyme from Rattus norvegicus brain (Robinson et
al., Biochem. Biophys. Res. Commun. 71:959-965 (1976)) can react
with butyryl-CoA, hexanoyl-CoA and malonyl-CoA. The enzyme from the
mitochondrion of the pea leaf also has a broad substrate
specificity, with demonstrated activity on acetyl-CoA,
propionyl-CoA, butyryl-CoA, palmitoyl-CoA, oleoyl-CoA,
succinyl-CoA, and crotonyl-CoA (Zeiher and Randall, Plant Physiol.
94:20-27 (1990)). The acetyl-CoA hydrolase, ACH1, from S.
cerevisiae represents another hydrolase (Buu et al., J. Biol. Chem.
278:17203-17209 (2003)). Genbank information related to these genes
is summarized in Table 25 below.
TABLE-US-00025 TABLE 25 Gene GI # Accession No. Organism acot12
18543355 NP_570103.1 Rattus norvegicus ACH1 6319456 NP_009538
Saccharomyces cerevisiae
[0110] Another hydrolase is the human dicarboxylic acid
thioesterase, acot8, which exhibits activity on glutaryl-CoA,
adipyl-CoA, suberyl-CoA, sebacyl-CoA, and dodecanedioyl-CoA (Westin
et al., J. Biol. Chem. 280:38125-28132 (2005)) and the closest E.
coli homolog, tesB, which can also hydrolyze a broad range of CoA
thioesters (Naggert et al., J. Biol. Chem. 266:11044-11050 (1991)).
A similar enzyme has also been characterized in the rat liver
(Deana, R., Biochem. Int. 26:767-773 (1992)). Genbank information
related to these genes is summarized in Table 26 below.
TABLE-US-00026 TABLE 26 Gene GI # Accession No. Organism tesB
16128437 NP_414986 Escherichia coli acot8 3191970 CAA15502 Homo
sapiens acot8 51036669 NP_570112 Rattus norvegicus
[0111] Other potential E. coli thioester hydrolases include the
gene products of tesA (Bonner and Bloch, J. Biol. Chem.
247:3123-3133 (1972)), ybgC (Kuznetsova et al., FEBS Microbiol.
Rev. 29:263-279 (2005); Zhuang et al., FEBS Lett. 516:161-163
(2002)), paaI (Song et al., J. Biol. Chem. 281:11028-11038 (2006)),
and ybdB (Leduc et al., J. Bacteriol. 1889:7112-7126 (2007)).
Genbank information related to these genes is summarized in Table
27 below.
TABLE-US-00027 TABLE 27 Gene GI # Accession No. Organism teas
16128478 NP_415027 Escherichia coli ybgC 16128711 NP_415264
Escherichia coli paaI 16129357 NP_415914 Escherichia coli ybdB
16128580 NP_415129 Escherichia coli
[0112] Yet another hydrolase is the glutaconate CoA-transferase
from Acidaminococcus fermentans. This enzyme was transformed by
site-directed mutagenesis into an acyl-CoA hydrolase with activity
on glutaryl-CoA, acetyl-CoA and 3-butenoyl-CoA (Mack and Buckel,
FEBS Lett. 405:209-212 (1997)), compounds similar in structure to
2,3-dehydroadipyl-CoA. This indicates that the enzymes encoding
succinyl-CoA:3-ketoacid-CoA transferases and
acetoacetyl-CoA:acetyl-CoA transferases can also serve as enzymes
for this reaction step but would require certain mutations to
change their function. Genbank information related to these genes
is summarized in Table 28 below.
TABLE-US-00028 TABLE 28 Gene GI # Accession No. Organism gctA
559392 CAA57199 Acidaminococcus fermentans gctB 559393 CAA57200
Acidaminococcus fermentans
[0113] Step C of FIG. 4 is catalyzed by a 2-ketoacid decarboxylase
that generates 6-oxo-2,3-dehydrohexanoate (6-OHE) from
2-oxohept-4-ene-1,7-dioate (OHED). The decarboxylation of
keto-acids is catalyzed by a variety of enzymes with varied
substrate specificities, including pyruvate decarboxylase (EC
4.1.1.1), benzoylformate decarboxylase (EC 4.1.1.7),
alpha-ketoglutarate decarboxylase and branched-chain alpha-ketoacid
decarboxylase. Pyruvate decarboxylase (PDC), also termed keto-acid
decarboxylase, is a key enzyme in alcoholic fermentation,
catalyzing the decarboxylation of pyruvate to acetaldehyde. The
enzyme from Saccharomyces cerevisiae has a broad substrate range
for aliphatic 2-keto acids including 2-ketobutyrate,
2-ketovalerate, 3-hydroxypyruvate and 2-phenylpyruvate (22). This
enzyme has been extensively studied, engineered for altered
activity, and functionally expressed in E. coli (Killenberg-Jabs et
al., Eur. J. Biochem. 268:1698-1704 (2001); Li and Jordan,
Biochemistry 38:10004-10012 (1999); ter Schure et al., Appl.
Environ. Microbiol. 64:1303-1307 (1998)). The PDC from Zymomonas
mobilus, encoded by pdc, also has a broad substrate range and has
been a subject of directed engineering studies to alter the
affinity for different substrates (Siegert et al., Protein Eng Des
Sel 18:345-357 (2005)). The crystal structure of this enzyme is
available (Killenberg-Jabs, et al., supra). Other
well-characterized PDC enzymes include the enzymes from Acetobacter
pasteurians (Chandra et al., Arch. Microbiol. 176:443-451 (2001))
and Kluyveromyces lactis (Krieger et al., Eur. J. Biochem.
269:3256-3263 (2002)). Genbank information related to these genes
is summarized in Table 29 below.
TABLE-US-00029 TABLE 29 Gene GI # Accession No. Organism pdc 118391
P06672.1 Zymomonas mobilus pdc1 30923172 P06169 Saccharomyces
cerevisiae pdc 20385191 AM21208 Acetobacter pasteurians pdc1
52788279 Q12629 Kluyveromyces lactis
[0114] Like PDC, benzoylformate decarboxylase (EC 4.1.1.7) has a
broad substrate range and has been the target of enzyme engineering
studies. The enzyme from Pseudomonas putida has been extensively
studied and crystal structures of this enzyme are available (Hasson
et al., Biochemistry 37:9918-9930 (1998); Polovnikova et al.,
Biochemistry 42:1820-1830 (2003)). Site-directed mutagenesis of two
residues in the active site of the Pseudomonas putida enzyme
altered the affinity (Km) of naturally and non-naturally occurring
substrates (Siegert et al., Protein Eng Des Sel 18:345-357 (2005)).
The properties of this enzyme have been further modified by
directed engineering (Lingen et al., Protein Eng. 15:585-593
(2002); Lingen et al., Chembiochem. 4:721-726 (2003)). The enzyme
from Pseudomonas aeruginosa, encoded by mdlC, has also been
characterized experimentally (Barrowman et al., FEMS Microbiology
Letters 34:57-60 (1986)). Additional genes from Pseudomonas
stutzeri, Pseudomonas fluorescens and other organisms can be
inferred by sequence homology or identified using a growth
selection system developed in Pseudomonas putida (Henning et al.,
Appl. Environ. Microbiol. 72:7510-7517 (2006)). Genbank information
related to these genes is summarized in Table 30 below.
TABLE-US-00030 TABLE 30 Gene GI # Accession No. Organism mdlC
3915757 P20906.2 Pseudomonas putida mdlC 81539678 Q9HUR2.1
Pseudomonas aeruginosa dpgB 126202187 ABN80423.1 Pseudomonas
stutzeri ilvB-1 70730840 YP_260581.1 Pseudomonas fluorescens
[0115] A third enzyme capable of decarboxylating 2-oxoacids is
alpha-ketoglutarate decarboxylase (KGD). The substrate range of
this class of enzymes has not been studied to date. The KDC from
Mycobacterium tuberculosis (Tian et al., Proc. Natl. Acad. Sci.
U.S.A. 102:10670-10675 (2005)) has been cloned and functionally
expressed, although it is large (.about.130 kD) and GC-rich. KDC
enzyme activity has been detected in several species of rhizobia
including Bradyrhizobium japonicum and Mesorhizobium loti (Green et
al., J. Bacteriol. 182:2838-2844 (2000)). Although the KDC-encoding
gene(s) have not been isolated in these organisms, the genome
sequences are available and several genes in each genome are
annotated as putative KDCs. A KDC from Euglena gracilis has also
been characterized but the gene associated with this activity has
not been identified to date (Shigeoka and Nakano, Arch. Biochem.
Biophys. 288:22-28 (1991)). The first twenty amino acids starting
from the N-terminus were sequenced MTYKAPVKDVKFLLDKVFKV (Shigeoka
and Nakano, supra). The gene could be identified by testing genes
containing this N-terminal sequence for KDC activity. Genbank
information related to these genes is summarized in Table 31
below.
TABLE-US-00031 TABLE 31 Gene GI # Accession No. Organism kgd
160395583 O50463.4 Mycobacterium tuberculosis kgd 27375563
NP_767092.1 Bradyrhizobium japonicum kgd 13473636 NP_105204.1
Mesorhizobium loti
[0116] A fourth enzyme for catalyzing this reaction is branched
chain alpha-ketoacid decarboxylase (BCKA). This class of enzyme has
been shown to act on a variety of compounds varying in chain length
from 3 to 6 carbons (Oku and Kaneda, J. Bio. Chem. 263:18386-18396
(1988); Smit et al., App. Environ. Microbiol. 71:303-311 (2005)).
The enzyme in Lactococcus lactis has been characterized on a
variety of branched and linear substrates including 2-oxobutanoate,
2-oxohexanoate, 2-oxopentanoate, 3-methyl-2-oxobutanoate,
4-methyl-2-oxobutanoate and isocaproate (Smit et al., supra). The
enzyme has been structurally characterized (Berg et al., Science
318:1782-1786 (2007)). Sequence alignments between the Lactococcus
lactis enzyme and the pyruvate decarboxylase of Zymomonas mobilus
indicate that the catalytic and substrate recognition residues are
nearly identical (Siegert et al., Protein Eng Des Sel 18:345-357
(2005)), so this enzyme can be subjected to directed engineering.
Decarboxylation of alpha-ketoglutarate by a BCKA was detected in
Bacillus subtilis; however, this activity was low (5%) relative to
activity on other branched-chain substrates (Oku and Kaneda, supra)
and the gene encoding this enzyme has not been identified to date.
Additional BCKA genes can be identified by homology to the
Lactococcus lactis protein sequence. Many of the high-scoring
BLASTp hits to this enzyme are annotated as indolepyruvate
decarboxylases (EC 4.1.1.74). Indolepyruvate decarboxylase (IPDA)
is an enzyme that catalyzes the decarboxylation of indolepyruvate
to indoleacetaldehyde in plants and plant bacteria. Genbank
information related to these genes is summarized in Table 32
below.
TABLE-US-00032 TABLE 32 Gene GI # Accession No. Organism kdcA
44921617 AAS49166.1 Lactococcus lactis
[0117] Recombinant branched chain alpha-keto acid decarboxylase
enzymes derived from the E1 subunits of the mitochondrial
branched-chain keto acid dehydrogenase complex from Homo sapiens
and Bos taurus have been cloned and functionally expressed in E.
coli (Davie et al., J. Biol. Chem. 267:16601-16606 (1992); Wynn et
al., J. Biol. Chem. 267:1881-1887 (1992); Wynn et al., J. Biol.
Chem. 267:12400-12403 (1992)). It was indicated that co-expression
of chaperonins GroEL and GroES enhanced the specific activity of
the decarboxylase by 500-fold (Wynn (1992) supra). These enzymes
are composed of two alpha and two beta subunits. Genbank
information related to these genes is summarized in Table 33
below.
TABLE-US-00033 TABLE 33 Gene GI # Accession No. Organism BCKDHB
34101272 NP_898871.1 Homo sapiens BCKDHA 11386135 NP_000700.1 Homo
sapiens BCKDHB 115502434 P21839 Bos taurus BCKDHA 129030 P11178 Bos
taurus
[0118] Aldehyde lyases in EC class 4.1.2 catalyze two key reactions
in the disclosed pathways to muconate (FIG. 3, Step A and FIG. 4,
Step A). HOHD aldolase, also known as HHED aldolase, catalyzes the
conversion of 4-hydroxy-2-oxo-heptane-1,7-dioate (HOHD) into
pyruvate and succinic semialdehyde (FIG. 4, Step A). HODH aldolase
is a divalent metal ion-dependent class II aldolase, catalyzing the
final step of 4-hydroxyphenylacetic acid degradation in E. coli C,
E. coli W, and other organisms. In the native context, the enzyme
functions in the degradative direction. The reverse (condensation)
reaction is thermodynamically unfavorable; however the equilibrium
can be shifted through coupling HOHD aldolase with downstream
pathway enzymes that work efficiently on reaction products. Such
strategies have been effective for shifting the equilibrium of
other aldolases in the condensation direction (Nagata et al., Appl.
Microbiol. Biotechnol. 44:432-438 (1995); Pollard et al., App.
Environ. Microbiol. 64:4093-4094 (1998)). The E. coli C enzyme,
encoded by hpcH, has been extensively studied and has recently been
crystallized (Rea et al., J. Mol. Biol. 373:866-876 (2007);
Stringfellow et al., Gene 166:73-76 (1995)). The E. coli W enzyme
is encoded by hpaI (Prieto et al., J. Bacteriol. 178:111-120
(1996)). Genbank information related to these genes is summarized
in Table 34 below.
TABLE-US-00034 TABLE 34 Gene GI # Accession No. Organism hpcH
633197 CAA87759.1 Escherichia coli C hpaI 38112625 AAR11360.1
Escherichia coli W
[0119] In Step A of FIG. 3, pyruvate and malonate semialdehyde are
joined by an aldehyde lyase to form 4-hydroxy-2-oxohexanedioate. An
enzyme catalyzing this exact reaction has not been characterized to
date. A similar reaction is catalyzed by 2-dehydro-3-deoxyglucarate
aldolase (DDGA, EC 4.1.2.20), a type II aldolase that participates
in the catabolic pathway for D-glucarate/galactarate utilization in
E. coli. Tartronate semialdehyde, the natural substrate of DDGA, is
similar in size and structure to malonate semialdehyde. This enzyme
has a broad substrate specificity and has been shown to reversibly
condense a wide range of aldehydes with pyruvate (Fish and
Blumenthal, Methods Enzymol. 9:529-534 (1966)). The crystal
structure of this enzyme has been determined and a catalytic
mechanism indicated (Izard and Blackwell, EMBO J. 19:3849-3856
(2000)). Other DDGA enzymes are found in Leptospira interrogans (Li
et al., Acta Crystallogr. Sect. F. Struct. Biol. Cryst. Commun.
62:1269-1270 (2006)) and Sulfolobus solfataricus (Buchanan et al.,
Biochem. J. 343 Pt 3:563-570 (1999)). The S. solfataricus enzyme is
highly thermostable and was cloned and expressed in E. coli
(Buchanan et al., supra). Genbank information related to these
genes is summarized in Table 35 below.
TABLE-US-00035 TABLE 35 Gene GI # Accession No. Organism garL
1176153 P23522.2 Escherichia coli LA_1624 24195249 AAN48823.1
Leptospira interrogans AJ224174.1:1 . . . 885 2879782 CAA11866.1
Sulfolobus solfataricus
[0120] The pathways in FIGS. 2-4 employ numerous enzymes in the
dehydratase class of enzymes (EC 4.1.2). Several reactions in FIGS.
2 and 3 undergo dehydration reactions similar to the dehydration of
malate to fumarate, catalyzed by fumarate hydratase (EC 4.2.1.2).
These transformations include the dehydration of
3-hydroxy-4-hexenedioate (FIG. 2, Steps E and Q and FIG. 3, Step
H), 4-hydroxy-2-oxohexanedioate (FIG. 3, Step B),
2-hydroxy-4-hexenedioate (FIG. 3, Step D) and 2,4-dihydroxyadipate
(FIG. 3, Steps F and G). Fumarate hydratase enzymes are exemplary
enzymes for catalyzing these reactions. The E. coli fumarase
encoded by fumC dehydrates a variety of alternate substrates
including tartrate and threo-hydroxyaspartate (Teipel et al., J.
Biol. Chem. 243:5684-5694 (1968)). A wealth of structural
information is available for the E. coli enzyme and researchers
have successfully engineered the enzyme to alter activity,
inhibition and localization (Weaver, T., Acta Crystallogr. D Biol.
Crystallagr. 61:1395-1401 (2005)). Exemplary fumarate hydratase
enzymes are found in Escherichia coli (Estevez et al., Protein Sci.
11:1552-1557 (2002); Hong and Lee, Biotechnol. Bioprocess Eng.
9:252-255 (2006); Rose and Weaver, Proc. Natl. Acad. Sci. U.S.A.
101:3393-3397 (2004)); Agnihotri and Liu, Bioorg. Med. Chem.
11:9-20 (2003)), Corynebacterium glutamicum (Genda et al., Biosci.
Biotechnol. Biochem. 71:1102-1109 (2006)), Campylobacter jejuni
(Smith and Gray, Catalysis Letters 6:195-199 (1990)), Therms
thermophilus (Mizobata et al., Arch. Biochem. Biophys. 355:49-55
(1998)), and Rattus norvegicus (Kobayashi et al., J. Biochem.
89:1923-1931 (1981)). Genbank information related to these genes is
summarized in Table 36 below.
TABLE-US-00036 TABLE 36 Gene GI # Accession No. Organism fumC
120601 P05042.1 Escherichia coli K12 fumC 39931596 Q8NRN8.1
Corynebacterium glutamicum fumC 9789756 O69294.1 Campylobacter
jejuni fumC 75427690 P84127 Thermus thermophilus fumH 120605
P14408.1 Rattus norvegicus
[0121] Another enzyme for catalyzing these reactions is citramalate
hydrolyase (EC 4.2.1.34), an enzyme that naturally dehydrates
2-methylmalate to mesaconate. This enzyme has been studied in
Methanocaldococcus jannaschii in the context of the pyruvate
pathway to 2-oxobutanoate, where it has been shown to have a broad
substrate specificity (Drevland et al., J. Bacteriol. 189:4391-4400
(2007)). This enzyme activity was also detected in Clostridium
tetanomorphum, Morganella morganii, Citrobacter amalonaticus where
it is thought to participate in glutamate degradation (Kato and
Asano Arch. Microbiol. 168:457-463 (1997)). The M. jannaschii
protein sequence does not bear significant homology to genes in
these organisms. Genbank information related to these genes is
summarized in Table 37 below.
TABLE-US-00037 TABLE 37 Gene GI # Accession No. Organism leuD
3122345 Q58673.1 Methanocaldococcus jannaschii
[0122] The enzyme OHED hydratase (FIG. 4, Step B) participates in
4-hydroxyphenylacetic acid degradation, where it converts
2-oxo-hept-4-ene-1,7-dioate (OHED) to
2-oxo-4-hydroxy-hepta-1,7-dioate (HODH) using magnesium as a
cofactor (Burks et al., J. Am. Chem. Soc. 120 (1998). OHED
hydratase enzymes have been identified and characterized in E. coli
C (Izumi et al., J. Mol. Biol. 370:899-911 (2007); Roper et al.,
Gene 156:47-51 (1995)) and E. coli W (Prieto et al., J. Bacteriol.
178:111-120 (1996)). Sequence comparison reveals homologs in a
range of bacteria, plants and animals. Enzymes with highly similar
sequences are contained in Klebsiella pneumonia (91% identity,
evalue=2e-138) and Salmonella enterica (91% identity,
evalue=4e-138), among others. Genbank information related to these
genes is summarized in Table 38 below.
TABLE-US-00038 TABLE 38 Gene GI # Accession No. Organism hpcG
556840 CAA57202.1 Escherichia coli C hpaH757830 CAA86044.1
Escherichia coli W hpaH 150958100 ABR80130.1 Klebsiella pneumoniae
Sari_01896 160865156 ABX21779.1 Salmonella enterica
[0123] Dehydration of 3-hydroxyadipyl-CoA to 2,3-dehydroadipyl-CoA
(FIG. 2, Step L and FIG. 4, Step G) is catalyzed by an enzyme with
enoyl-CoA hydratase activity. 3-Hydroxybutyryl-CoA dehydratase (EC
4.2.1.55), also called crotonase, is an enoyl-CoA hydratase that
dehydrates 3-hydroxyisobutyryl-CoA to form crotonyl-CoA (FIG. 3,
step 2). Crotonase enzymes are required for n-butanol formation in
some organisms, particularly Clostridial species, and also comprise
one step of the 3-hydroxypropionate/4-hydroxybutyrate cycle in
thermoacidophilic Archaea of the genera Sulfolobus, Acidianus, and
Metallosphaera. Exemplary genes encoding crotonase enzymes can be
found in C. acetobutylicum (Atsumi et al., Metab. Eng. 10:305-211
(2008); Boynton et al., J. Bacteriol. 178:3015-3024 (1996)), C.
kluyveri (Hillmer and Gottschalk, FEBS Lett. 21:351-354 (1972)),
and Metallosphaera sedula (Berg et al., Science 318:1782-1786
(2007)) though the sequence of the latter gene is not known.
Genbank information related to these genes is summarized in Table
39 below.
TABLE-US-00039 TABLE 39 Gene GI # Accession No. Organism crt
15895969 NP_349318.1 Clostridium acetobutylicum crt1 153953091
YP_001393856.1 Clostridium kluyveri
[0124] Additional enoyl-CoA hydratases (EC 4.2.1.17) catalyze the
dehydration of a range of 3-hydroxyacyl-CoA substrates (Agnihotri
and Liu, Bioorg. Med. Chem. 11:9-20 (2003); Conrad et al., J.
Bacteriol. 118:103-111 (1974); Roberts et al., Arch. Microbiol.
117:99-108 (1978)). The enoyl-CoA hydratase of Pseudomonas putida,
encoded by ech, catalyzes the conversion of 3-hydroxybutyryl-CoA to
crotonyl-CoA (Roberts et al., supra). Additional enoyl-CoA
hydratase enzymes are phaA and phaB, of P. putida, and paaA and
paaB from P. fluorescens (Olivera et al., Proc. Natl. Acad. Sci.
U.S.A. 95:6419-6424 (1998)). The gene product of pimF in
Rhodopseudomonas palustris is predicted to encode an enoyl-CoA
hydratase that participates in pimeloyl-CoA degradation (Harrison
and Harwood, Microbiology 151:727-736 (2005)). Lastly, a number of
Escherichia coli genes have been shown to demonstrate enoyl-CoA
hydratase functionality including maoC (Park and Lee, Appl.
Biochem. Biotechnol. 113-116:335-346 (2004)), paaF (Ismail et al.,
Eur. J. Biochem. 270:3047-3054 (2003); Park and Lee, supra; Park
and Yup, Biotechnol. Bioeg 86:681-686 (2004)) and paaG (Ismail et
al., Eur. J. Biochem. 270:3047-3054 (2003); Park and Lee, supra;
Park and Yup, Biotechnol. Bioeg 86:681-686 (2004)). Genbank
information related to these genes is summarized in Table 40
below.
TABLE-US-00040 TABLE 40 Gene GI # Accession No. Organism ech
26990073 NP_745498.1 Pseudomonas putida paaA 26990002 NP_745427.1
Pseudomonas putida paaB 26990001 NP_745426.1 Pseudomonas putida
phaA 106636093 ABF82233.1 Pseudomonas fluorescens phaB 106636094
ABF82234.1 Pseudomonas fluorescens pimF 39650635 CAE29158
Rhodopseudomonas palustris maoC 16129348 NP_415905.1 Escherichia
coli paaF 16129354 NP_415911.1 Escherichia coli paaG 16129355
NP_415912.1 Escherichia coli
[0125] Alternatively, the E. coli gene products of fadA and fadB
encode a multienzyme complex involved in fatty acid oxidation that
exhibits enoyl-CoA hydratase activity (Nakahigashi and Inokuchi,
Nucleic Acids Res. 18:4937 (1990); Yang, S. Y. J. Bacteriol.
173:7405-7406 (1991); Yang et al., Biochemistry 30:6788-6795
(1991)). Knocking out a negative regulator encoded by fadR can be
utilized to activate the fadB gene product (Sato et al., J. Biosci.
Bioeng. 103:38-44 (2007)). The fadI and fadJ genes encode similar
functions and are naturally expressed under anaerobic conditions
(Campbell et al., Mol. Microbiol. 47:793-805 (2003)). Genbank
information related to these genes is summarized in Table 41
below.
TABLE-US-00041 TABLE 41 Gene GI # Accession No. Organism fadA
49176430 YP_026272.1 Escherichia coli fadB 16131692 NP_418288.1
Escherichia coli fadI 16130275 NP_416844.1 Escherichia coli fadJ
16130274 NP_416843.1 Escherichia coli fadR 16129150 NP_415705.1
Escherichia coli
[0126] An enzyme in the ammonia-lyase family is required to
deaminate 3-amino-4-hexenedioate (FIG. 2, Steps G and S),
2-aminoadipate (FIG. 5, Step C) and 3-aminoadipate (FIG. 5, Step
H). Enzymes catalyzing this exact transformation has not been
identified. However the three substrates bear structural similarity
to aspartate, the native substrate of aspartase (EC 4.3.1.1.).
Aspartase is a widespread enzyme in microorganisms, and has been
characterized extensively (Wakil et al., J. Biol. Chem. 207:631-638
(1954)). The E. coli enzyme has been shown to react with a variety
of alternate substrates including aspartatephenylmethylester,
asparagine, benzyl-aspartate and malate (Ma et al., Ann N.Y. Acad.
Sci. 672:60-65 (1992)). In addition, directed evolution was been
employed on this enzyme to alter substrate specificity (Asano et
al., Biomol. Eng. 22:95-101 (2005)). The crystal structure of the
E. coli aspartase, encoded by aspA, has been solved (Shi et al.,
Biochemistry 36:9136-9144 (1997)). Enzymes with aspartase
functionality have also been characterized in Haemophilus
influenzae (Sjostrom et al., Biochim. Biophys. Acta 1324:182-190
(1997)), Pseudomonas fluorescens (Takagi and Kisumi, J. Bacteriol.
161:1-6 (1985)), Bacillus subtilis (Sjostrom et al., supra) and
Serratia marcescens (Takagi and Kisumi supra). Genbank information
related to these genes is summarized in Table 42 below.
TABLE-US-00042 TABLE 42 Gene GI # Accession No. Organism aspA
90111690 NP_418562 Escherichia coli aspA 1168534 P44324.1
Haemophilus influenzae aspA 114273 P07346.1 Pseudomonas fluorescens
ansB 251757243 P26899.1 Bacillus subtilis aspA 416661 P33109.1
Serratia marcescens
[0127] Another deaminase enzyme is 3-methylaspartase (EC 4.3.1.2).
This enzyme, also known as beta-methylaspartase and
3-methylaspartate ammonia-lyase, naturally catalyzes the
deamination of threo-3-methylasparatate to mesaconate. The
3-methylaspartase from Clostridium tetanomorphum has been cloned,
functionally expressed in E. coli, and crystallized (Asuncion et
al., Acta Crystallogr. D. Biol Crystallogr. 57:731-733 (2001);
Asuncion et al., J. Biol. Chem. 277:8306-8311 (2002); Botting et
al. Biochemistry 27:2953-2955 (1988); Goda et al., Biochemistry
31:10747-10756 (1992)). In Citrobacter amalonaticus, this enzyme is
encoded by BAA28709 (Kato and Asano, Arch. Microbiol. 168:457-463
(1997)). 3-methylaspartase has also been crystallized from E. coli
YG1002 (Asano and Kato, FEBS Microbiol. Lett. 118:255-258 (1994))
although the protein sequence is not listed in public databases
such as GenBank. Sequence homology can be used to identify
additional genes, including CTC.sub.--02563 in C. tetani and
ECs0761 in Escherichia coli O157:H7. Genbank information related to
these genes is summarized in Table 43 below.
TABLE-US-00043 TABLE 43 Gene GI # Accession No. Organism mal 259429
AAB24070.1 Clostridium tetanomorphum BAA28709 3184397 BAA28709.1
Citrobacter amalonaticus CTC_02563 28212141 NP_783085.1 Clostridium
tetani ECs0761 13360220 BAB34184.1 Escherichia coli O157:H7
[0128] In FIG. 2 Step J, muconolactone is converted to muconate by
muconate cycloisomerase. However, muconate cycloisomerase usually
results in the formation of cis,cis-muconate, which may be
difficult for the subsequent Diels-Alder chemistry. The cis, trans-
or trans, trans-isomers are preferred. Therefore, the addition of a
cis, trans isomerase may help to improve the yield of terepthalic
acid. Enzymes for similar isomeric conversions include maleate
cis,trans-isomerase (EC 5.2.1.1), maleylacetone cis-trans-isomerase
(EC 5.2.1.2), and cis,trans-isomerase of unsaturated fatty acids
(Cti).
[0129] Maleate cis, trans-isomerase (EC 5.2.1.1) catalyzes the
conversion of maleic acid in cis formation to fumarate in trans
formation (Scher and Jakoby, J. Biol. Chem. 244:1878-1882 (1969)).
The Alcalidgenes faecalis maiA gene product has been cloned and
characterized (Hatakeyeama et al., Biochem. Biophys. Res. Commun.
239:74-79 (1997)). Other maleate cis,trans-isomerases are available
in Serratia marcescens (Hatakeyama et al., Biosci. Biotechnol.
Biochem. 64:1477-1485 (2000)), Ralstonia eutropha and Geobacillus
stearothermophilus. Genbank information related to these genes is
summarized in Table 44 below.
TABLE-US-00044 TABLE 44 Gene GI # Accession No. Organism maiA
2575787 BAA23002 Alcaligenes faecalis maiA 113866948 YP_725437
Ralstonia eutropha H16 maiA 4760466 BAA77296 Geobacillus
stearothermophilus maiA 8570038 BAA96747.1 Serratia marcescens
[0130] Maleylacetone cis,trans-isomerase (EC 5.2.1.2) catalyzes the
conversion of 4-maleyl-acetoacetate to 4-fumaryl-acetyacetate, a
cis to trans conversion. This enzyme is encoded by maiA in
Pseudomonas aeruginosa Fernandez-Canon and Penalva, J. Biol. Chem.
273:329-337 (1998)) and Vibrio cholera (Seltzer, S., J. Biol. Chem.
248:215-222 (1973)). A similar enzyme was identified by sequence
homology in E. coli O157. Genbank information related to these
genes is summarized in Table 45 below.
TABLE-US-00045 TABLE 45 Gene GI # Accession No. Organism maiA
15597203 NP_250697 Pseudomonas aeruginosa maiA 15641359 NP_230991
Vibrio cholerae maiA 189355347 EDU73766 Escherichia coli O157
[0131] The cti gene product catalyzes the conversion of
cis-unsaturated fatty acids (UFA) to trans-UFA. The enzyme has been
characterized in P. putida (Junker and Ramos, J. Bacteriol.
181:5693-5700 (1999)). Similar enzymes are found in Shewanella sp.
MR-4 and Vibrio cholerae. Genbank information related to these
genes is summarized in Table 46 below.
TABLE-US-00046 TABLE 46 Gene GI # Accession No. Organism ct
i5257178 AAD41252 Pseudomonas putida cti 113968844 YP_732637
Shewanella sp. MR-4 cti 229506276 ZP_04395785 Vibrio cholerae
[0132] The endocyclic migration of the double bond in the structure
of .beta.-ketoadipate-enol-lactone to form muconolactone (FIG. 2,
Step 1) is catalyzed by muconolactone isomerase (EC 5.3.3.4).
Muconolactone isomerase also participates in the catechol branch of
the .beta.-ketoadipate pathway to degrade aromatic compounds, at
the reverse direction of Step G. Muconolactone isomerase is encoded
by the catC gene. The Pseudomonas putida muconolactone isomerase
was purified and partial amino acid sequences of cyanogen bromide
fragments were determined (Meagher, R. B., Biochim. Biophys. Acta
494:33-47 (1997)). A DNA fragment carrying the catBCDE genes from
Acinetobacter calcoaceticus was isolated by complementing P. putida
mutants and the complemented activities were expressed
constitutively in the recombinant P. putida strains (Shanley et,
al., J. Bacteriol. 165:557-563 (1986). The A. calcoaceticus catBCDE
genes were also expressed at high levels in Escherichia coli under
the control of a lac promoter (Shanley et al., supra). The
aniline-assimilating bacterium Rhodococcus sp. AN-22 CatC was
purified to homogeneity and characterized as a homo-octamer with a
molecular mass of 100 kDa (Matsumura et al., Biochem. J.
393:219-226 (2006)). The crystal structure of P. putida
muconolactone isomerase was solved (Kattie et al., J. Mol. Biol.
205:557-571 (1989)). Genbank information related to these genes is
summarized in Table 47 below.
TABLE-US-00047 TABLE 47 Gene GI # Accession No. Organism Q3LHT1
122612792 catC Rhodococcus sp. AN-22 Q43932 5915883 catC
Acinetobacter calcoaceticus Q9EV41 75464174 catC Ralstonia eutropha
P00948 5921199 catC Pseudomonas putida Q9Z9Y5 75475019 catC
Frateuria species ANA-18
[0133] Lysine 2,3-aminomutase (EC 5.4.3.2) converts lysine to
(3S)-3,6-diaminohexanoate (FIG. 5, Step E), shifting an amine group
from the 2- to the 3-position. The enzyme is found in bacteria that
ferment lysine to acetate and butyrate, including as Fusobacterium
nuleatum (kamA) (Barker et al., J. Bacteriol. 152:201-207 (1982))
and Clostridium subterminale (kamA) (Chirpich et al., J. Biol.
Chem. 245:1778-1789 (1970)). The enzyme from Clostridium
subterminale has been crystallized (Lepore et al., Proc. Natl.
Acad. Sci. U.S.A. 102:13819-13824 (2005)). An enzyme encoding this
function is also encoded by yodO in Bacillus subtilus (Chen et al.,
Biochem. J. 348 Pt 3:539-549 (2000)). The enzyme utilizes pyridoxal
5'-phosphate as a cofactor, requires activation by
S-Adenosylmethoionine, and is stereoselective, reacting with the
only with L-lysine. Genbank information related to these genes is
summarized in Table 48 below.
TABLE-US-00048 TABLE 48 Gene GI # Accession No. Organism yodO
4033499 O34676.1 Bacillus subtilus kamA 75423266 Q9XBQ8.1
Clostridium subterminale kamA 81485301 Q8RHX4 Fusobacterium
nuleatum subsp. nuleatum
[0134] In Step H of FIG. 2, the ring opening reaction of
muconolactone to form muconate is catalyzed by muconate
cycloisomerase (EC 5.5.1.1). Muconate cycloisomerase naturally
converts cis,cis-muconate to muconolactone in the catechol branch
of the .beta.-ketoadipate pathway to degrade aromatic compounds.
This enzyme has not been shown to react with the trans,trans
isomer. The muconate cycloisomerase reaction is reversible and is
encoded by the catB gene. The Pseudomonas putida catB gene was
cloned and sequenced (Aldrich et al., Gene 52:185-195 (1987)), the
catB gene product was studied (Neidhart et al., Nature 347:692-694
(1990)) and its crystal structures were resolved (Helin et al., J.
Mol. Biol. 254:918-941 (1995)). A DNA fragment carrying the catBCDE
genes from Acinetobacter calcoaceticus was isolated by
complementing P. putida mutants and the complemented activities
were expressed constitutively in the recombinant P. putida strains
(Shanley et al., J. Bacteriol. 165:557-563 (1986)). The A.
calcoaceticus catBCDE genes were also expressed at high levels in
Escherichia coli under the control of a lac promoter (Shanley et
al., supra). The Rhodococcus sp. AN-22 CatB was purified to
homogeneity and characterized as a monomer with a molecular mass of
44 kDa. The enzyme was activated by Mn.sup.2+, Co.sup.2+ and
Mg.sup.2+ (Matsumura et al., Biochem. J. 393:219-226 (2006)).
Muconate cycloisomerases from other species, such as Rhodococcus
rhodochrous N75, Frateuria species ANA-18, and Trichosporon
cutaneum were also purified and studied (Cha and Bruce, FEMS
Microbiol. Lett. 224:29-34 2003); Mazur et al., Biochemistry
33:1961-1970 (1994); Murakami et al., Biosci Biotechnol. Biochem.
62:1129-1133 (1998)). Genbank information related to these genes is
summarized in Table 49 below.
TABLE-US-00049 TABLE 49 Gene GI # Accession No. Organism catB
P08310 115713 Pseudomonas putida catB Q43931 51704317 Acinetobacter
calcoaceticus catB Q3LHT2 122612793 Rhodococcus sp. AN-22 catB
Q9Z9Y1 75424020 Frateuria species ANA-18 catB P46057 1170967
Trichosporon cutaneum
[0135] The conversion of beta-ketoadipyl-CoA to beta-ketoadipate
(FIG. 2, Step B) and 2,3-dehydroadipyl-CoA to 2,3-dehydroadipate
(FIG. 2, Step M and FIG. 4, Step H) can be catalyzed by a CoA
acid-thiol ligase or CoA synthetase in the 6.2.1 family of enzymes.
Enzymes catalyzing these exact transformations have not been
characterized to date; however, several enzymes with broad
substrate specificities have been described in the literature.
ADP-forming acetyl-CoA synthetase (ACD, EC 6.2.1.13) is an enzyme
that couples the conversion of acyl-CoA esters to their
corresponding acids with the concomitant synthesis of ATP. ACD I
from Archaeoglobus fulgidus, encoded by AF1211, was shown to
operate on a variety of linear and branched-chain substrates
including isobutyrate, isopentanoate, and fumarate (Musfeldt and
Schonheit, J. Bacteriol. 184:636-644 (2002)). A second reversible
ACD in Archaeoglobus fulgidus, encoded by AF1983, was also shown to
have a broad substrate range with high activity on cyclic compounds
phenylacetate and indoleacetate (Musfeldt and Shonheit, supra). The
enzyme from Haloarcula marismortui (annotated as a succinyl-CoA
synthetase) accepts propionate, butyrate, and branched-chain acids
(isovalerate and isobutyrate) as substrates, and was shown to
operate in the forward and reverse directions (Brasen and
Schonheit, Arch. Microbiol. 182:277-287 (2004)). The ACD encoded by
PAE3250 from hyperthermophilic crenarchaeon Pyrobaculum aerophilum
showed the broadest substrate range of all characterized ACDs,
reacting with acetyl-CoA, isobutyryl-CoA (preferred substrate) and
phenylacetyl-CoA (Brasen and Schonheit, supra). Directed evolution
or engineering can be used to modify this enzyme to operate at the
physiological temperature of the host organism. The enzymes from A.
fulgidus, H. marismortui and P. aerophilum have all been cloned,
functionally expressed, and characterized in E. coli (Brasen and
Shonheit, supra; Musfeldt and Schonheit, supra). An additional
enzyme is encoded by sucCD in E. coli, which naturally catalyzes
the formation of succinyl-CoA from succinate with the concomitant
consumption of one ATP, a reaction which is reversible in vivo
(Buck et al., Biochemistry 24:6245-6252 (1985)). Genbank
information related to these genes is summarized in Table 50
below.
TABLE-US-00050 TABLE 50 Gene GI # Accession No. Organism AF1211
11498810 NP_070039.1 Archaeoglobus fulgidus DSM 4304 AF1983
11499565 NP_070807.1 Archaeoglobus fulgidus DSM 4304 scs 55377722
YP_135572.1 Haloarcula marismortui PAE3250 18313937 NP_560604.1
Pyrobaculum aerophilum str. IM2 sucC 16128703 NP_415256.1
Escherichia coli sucD 1786949 AAC73823.1 Escherichia coli
[0136] Another enzyme for this step is 6-carboxyhexanoate-CoA
ligase, also known as pimeloyl-CoA ligase (EC 6.2.1.14), which
naturally activates pimelate to pimeloyl-CoA during biotin
biosynthesis in gram-positive bacteria. The enzyme from Pseudomonas
mendocina, cloned into E. coli, was shown to accept the alternate
substrates hexanedioate and nonanedioate (Binieda et al, Biochem.
J. 340 Pt 3:793-801 (1999)). Other enzymes are found in Bacillus
subtilis (Bower et al., J. Bacteriol. 178:4122-4130 (1996)) and
Lysinibacillus sphaericus (formerly Bacillus sphaericus) (Ploux et
al., Biochem. J. 287 Pt 3:685-690 (1992)). Genbank information
related to these genes is summarized in Table 51 below.
TABLE-US-00051 TABLE 51 Gene GI # Accession No. Organism pauA
15596214 NP_249708.1 Pseudomonas mendocina bioW 50812281
NP_390902.2 Bacillus subtilis bioW 115012 P22822.1 Lysinibacillus
sphaericus
[0137] Additional CoA-ligases include the rat dicarboxylate-CoA
ligase for which the sequence is yet uncharacterized (Vamecq et
al., Biochem. J. 230:683-693 (1985)), either of the two
characterized phenylacetate-CoA ligases from P. chrysogenum
(Lamas-Maceiras et al., Biochem. J. 395:147-155 (2006); Wang et
al., Biochem. Biophys. Res. Commun. 360:453-458 (2007)) and the
phenylacetate-CoA ligase from Pseudomonas putida (Martinez-Blanco
et al., J. Biol. Chem. 265:7084-7090 (1990)). Acetoacetyl-CoA
synthetases from Mus musculus (Hasegawa et al., Biochim. Biophys.
Acta 1779:414-419 (2008)) and Homo sapiens (Ohgami et al., Biochem.
Pharmacol. 65:989-994 (2003)) naturally catalyze the ATP-dependant
conversion of acetoacetate into acetoacetyl-CoA. Genbank
information related to these genes is summarized in Table 52
below.
TABLE-US-00052 TABLE 52 Gene GI # Accession No. Organism phl
77019264 CAJ15517.1 Penicillium chrysogenum phlB 152002983
ABS19624.1 Penicillium chrysogenum paaF 22711873 AAC24333.2
Pseudomonas putida AACS 21313520 NP_084486.1 Mus musculus AACS
31982927 NP_076417.2 Homo sapiens
[0138] In some embodiments, the present invention provides a
semi-synthetic method for synthesizing terephthalate (PTA) that
includes preparing muconic acid by culturing the above-described
organisms, reacting the resultant muconic acid with acetylene to
form a cyclohexadiene adduct (P1, FIG. 1), and oxidizing the
cyclohexadiene adduct to form PTA. Semi-synthetic methods combine
the biosynthetic preparation of advanced intermediates with
conventional organic chemical reactions.
[0139] While the culturing of muconic acid is discussed further
below, the Diels-Alder reaction conditions are detailed here.
Diels-Alder reactions are widespread in the chemical industry and
are known to those skilled in the art (Carruthers, W., Some Modern
Methods of Organic Synthesis, Cambridge University Press (1986);
Norton, J., Chem. Review 31:319-523 (1942); Sauer, J., Angewandte
Chemie 6:16-33 (1967)). This class of pericyclic reactions is
well-studied for its ability to generate cyclic compounds at low
energetic cost. Diels-Alder reactions are thus an attractive and
low-cost way of making a variety of pharmaceuticals and natural
products.
[0140] In a Diels-Alder reaction, a conjugated diene or heterodiene
reacts with an alkene, alkyne, or other unsaturated functional
group, known as a dienophile, to form a six-membered ring. One
aspect of the Diels-Alder reaction is that the two components
usually have complementary electronic character, as determined by
the energies of the highest occupied molecular orbital (HOMO) and
lowest unoccupied molecular orbital (LUMO) of the diene and
dienophile (Carruthers, W., Some Modern Methods of Organic
Synthesis, Cambridge University Press (1986). In normal mode, the
diene is electron-rich and the dienophile is electron-poor,
although this is not always the case. The method of the present
invention provides the opposite electronic configuration with an
electron poor diene and a relatively electron rich dienophile, in
what is termed an inverse electron demand Diels-Alder reaction. The
main physical constraint for this type of reaction is that the
conjugated diene must be able to adopt a cisoid conformation for
the reaction to proceed. A wide variety of substituted conjugated
dienes and dienophiles are able to undergo this chemistry.
[0141] In the disclosed reaction of FIG. 1, muconate is the
conjugated diene, and is beneficially in the trans,trans or
cis,trans isomeric configuration for the reaction to proceed. The
cis, cis isomer of muconate, prevalent in biological systems as a
degradation product of catechol, is unlikely to adopt the required
cisoid conformation due to steric hindrance of the carboxylic acid
groups. The trans,trans isomer of muconate (shown in FIG. 1) is
able to react in Diels-Alder reactions with a variety of dienes
(Deno, N. C., J. Am. Chem. Soc. 72:4057-4059 (1950); Sauer, J.,
Angewandte Chemie 6:16-33 (1967)).
[0142] Acetylene serves as the dienophile in the production of PTA.
Acetylene and substituted acetylene derivatives are well-known
dienophiles ((Carruthers, W., Some Modern Methods of Organic
Synthesis, Cambridge University Press (1986); U.S. Pat. No.
3,513,209, Clement, R. A.; Dai et al., J. Am. Chem. Soc.
129:645-657 (2007)). The addition of electron-withdrawing
substituents increases reactivity in normal mode Diels Alder
reactions; likewise, in the inverse electron demand, electron
donating groups are employed to increase reactivity. At elevated
temperatures, unsubstituted acetylene has been shown to react with
butadiene and other substituted linear and cyclic dienes (U.S. Pat.
No. 3,513,209, Clement, R. A.; Norton, J., Chem. Review 31:319-523
(1942); Vijaya et al., J. Mol. Struct. 589-590:291-299 (2002)).
[0143] Increased temperature can be used to perform the Diels-Alder
reaction in FIG. 1. For example, the Diels-Alder reaction of
acetylene with 1,3-butadiene to form 1,4-cyclohexadiene is
performed in the range of 80-300.degree. C. (U.S. Pat. No.
3,513,209, Clement, R. A. supra).
[0144] Other reaction conditions that have been shown to enhance
the rate of Diels-Alder reactions include elevated pressure, the
addition of a Lewis acid, and stoichiometric excess of acetylene.
Elevated pressure up to 1000 atmospheres was shown to enhance the
rate of 1,4-cyclohexadiene formation from butadiene and acetylene
(U.S. Pat. No. 3,513,209, Clement, R. A.). Catalytic amounts of
Lewis acids can also improve reaction rate (Nicolaou et al.,
Angewandte Chemie 41:1668-1698 (2002)). Some suitable Lewis acids
include magnesium halides such as magnesium chloride, magnesium
bromide or magnesium iodide or zinc halides such as zinc chloride,
zinc bromide or zinc iodide. Stoichiometric excess of acetylene
will aid in reducing formation of homopolymerization
byproducts.
[0145] Oxidation of the Diels-Alder product,
cyclohexa-2,5-diene-1,4-dicarboxylate (P1), to PTA can be
accomplished in the presence or absence of catalyst under mild
reaction conditions. The driving force for P1 oxidation is the
formation of the aromatic ring of PTA. Precedence for the
conversion of P1 to PTA in the absence of catalyst is the
conversion of 1,4-cyclohexadiene to benzene in air (U.S. Pat. No.
3,513,209, Clement, R. A.). 1,4-Cyclohexadiene is also converted to
benzene by catalysis, for example using transition metal complexes
such as bis(arene)molybdenum(0) and bis(arene)chromium(0) (Fochi,
G., Organometallics 7:225-2256 (1988)) or electroactive binuclear
rhodium complexes (Smith and Gray, Catalysis Letters 6:195-199
(1990)).
[0146] In some embodiments, the method for synthesizing PTA
includes isolating muconic acid from the culture broth prior to
reacting with acetylene in the Diels-Alder reaction. This is
particularly helpful since the Diels-Alder reaction, is frequently
done in the absence of a solvent, especially under thermal
conditions. Isolation of muconic acid can involve various
filtration and centrifugation techniques. Cells of the culture and
other insoluble materials can be filtered via ultrafiltration and
certain salts can be removed by nanofiltration. Because muconic
acid is a diacid, standard extraction techniques can be employed
that involve adjusting the pH. After removal of substantially all
solids and salts, the muconic acid can be separated from water by
removal of water with heating in vacuo, or by extraction at low pH.
For example, following the addition of sulfuric acid or phosphoric
acid to the fermentation broth in sufficient amounts (pH 3 or
lower), the free carboxylate acid form of muconic acid precipitates
out of solution (U.S. Pat. No. 4,608,338). In this form, muconic
acid is readily separated from the aqueous solution by filtration
or other conventional means.
[0147] In some embodiments, the muconic acid need not be isolated.
Instead, the Diels-Alder reaction between muconic acid and
acetylene can be performed in the culture broth. In such a case,
the culture broth can be optionally filtered prior to adding
acetylene.
[0148] The non-naturally occurring microbial organisms of the
invention can be produced by introducing expressible nucleic acids
encoding one or more of the enzymes or proteins participating in
one or more muconate biosynthetic pathways. Depending on the host
microbial organism chosen for biosynthesis, nucleic acids for some
or all of a particular muconate biosynthetic pathway can be
expressed. For example, if a chosen host is deficient in one or
more enzymes or proteins for a desired biosynthetic pathway, then
expressible nucleic acids for the deficient enzyme(s) or protein(s)
are introduced into the host for subsequent exogenous expression.
Alternatively, if the chosen host exhibits endogenous expression of
some pathway genes, but is deficient in others, then an encoding
nucleic acid is needed for the deficient enzyme(s) or protein(s) to
achieve muconate biosynthesis. Thus, a non-naturally occurring
microbial organism of the invention can be produced by introducing
exogenous enzyme or protein activities to obtain a desired
biosynthetic pathway or a desired biosynthetic pathway can be
obtained by introducing one or more exogenous enzyme or protein
activities that, together with one or more endogenous enzymes or
proteins, produces a desired product such as muconate.
[0149] Depending on the muconate biosynthetic pathway constituents
of a selected host microbial organism, the non-naturally occurring
microbial organisms of the invention will include at least one
exogenously expressed muconate pathway-encoding nucleic acid and up
to all encoding nucleic acids for one or more muconate biosynthetic
pathways. For example, muconate biosynthesis can be established in
a host deficient in a pathway enzyme or protein through exogenous
expression of the corresponding encoding nucleic acid. In a host
deficient in all enzymes or proteins of a muconate pathway,
exogenous expression of all enzyme or proteins in the pathway can
be included, although it is understood that all enzymes or proteins
of a pathway can be expressed even if the host contains at least
one of the pathway enzymes or proteins. For example, exogenous
expression of all enzymes or proteins in a pathway for production
of muconate can be included, such as those shown in FIGS. 2-5.
[0150] Given the teachings and guidance provided herein, those
skilled in the art will understand that the number of encoding
nucleic acids to introduce in an expressible form will, at least,
parallel the muconate pathway deficiencies of the selected host
microbial organism. Therefore, a non-naturally occurring microbial
organism of the invention can have one, two, three, four, six, etc.
up to all nucleic acids encoding the enzymes or proteins
constituting a muconate biosynthetic pathway disclosed herein. In
some embodiments, the non-naturally occurring microbial organisms
also can include other genetic modifications that facilitate or
optimize muconate biosynthesis or that confer other useful
functions onto the host microbial organism. One such other
functionality can include, for example, augmentation of the
synthesis of one or more of the muconate pathway precursors such as
succinyl-CoA.
[0151] Generally, a host microbial organism is selected such that
it produces the precursor of a muconate pathway, either as a
naturally produced molecule or as an engineered product that either
provides de novo production of a desired precursor or increased
production of a precursor naturally produced by the host microbial
organism. For example, succinyl-CoA is produced naturally in a host
organism such as E. coli. A host organism can be engineered to
increase production of a precursor, as disclosed herein. In
addition, a microbial organism that has been engineered to produce
a desired precursor can be used as a host organism and further
engineered to express enzymes or proteins of a muconate
pathway.
[0152] In some embodiments, a non-naturally occurring microbial
organism of the invention is generated from a host that contains
the enzymatic capability to synthesize muconate. In this specific
embodiment it can be useful to increase the synthesis or
accumulation of a muconate pathway product to, for example, drive
muconate pathway reactions toward muconate production. Increased
synthesis or accumulation can be accomplished by, for example,
overexpression of nucleic acids encoding one or more of the
above-described muconate pathway enzymes or proteins.
Overexpression of the enzyme or enzymes and/or protein or proteins
of the muconate pathway can occur, for example, through exogenous
expression of the endogenous gene or genes, or through exogenous
expression of the heterologous gene or genes. Therefore, naturally
occurring organisms can be readily generated to be non-naturally
occurring microbial organisms of the invention, for example,
producing muconate, through overexpression of one, two, three,
four, five, six, that is, up to all nucleic acids encoding muconate
biosynthetic pathway enzymes or proteins. In addition, a
non-naturally occurring organism can be generated by mutagenesis of
an endogenous gene that results in an increase in activity of an
enzyme in the muconate biosynthetic pathway.
[0153] In particularly useful embodiments, exogenous expression of
the encoding nucleic acids is employed. Exogenous expression
confers the ability to custom tailor the expression and/or
regulatory elements to the host and application to achieve a
desired expression level that is controlled by the user. However,
endogenous expression also can be utilized in other embodiments
such as by removing a negative regulatory effector or induction of
the gene's promoter when linked to an inducible promoter or other
regulatory element. Thus, an endogenous gene having a naturally
occurring inducible promoter can be up-regulated by providing the
appropriate inducing agent, or the regulatory region of an
endogenous gene can be engineered to incorporate an inducible
regulatory element, thereby allowing the regulation of increased
expression of an endogenous gene at a desired time. Similarly, an
inducible promoter can be included as a regulatory element for an
exogenous gene introduced into a non-naturally occurring microbial
organism.
[0154] It is understood that, in methods of the invention, any of
the one or more exogenous nucleic acids can be introduced into a
microbial organism to produce a non-naturally occurring microbial
organism of the invention. The nucleic acids can be introduced so
as to confer, for example, a muconate biosynthetic pathway onto the
microbial organism. Alternatively, encoding nucleic acids can be
introduced to produce an intermediate microbial organism having the
biosynthetic capability to catalyze some of the required reactions
to confer muconate biosynthetic capability. For example, a
non-naturally occurring microbial organism having a muconate
biosynthetic pathway can comprise at least two exogenous nucleic
acids encoding desired enzymes or proteins. Thus, it is understood
that any combination of two or more enzymes or proteins of a
biosynthetic pathway can be included in a non-naturally occurring
microbial organism of the invention. Similarly, it is understood
that any combination of three or more enzymes or proteins of a
biosynthetic pathway can be included in a non-naturally occurring
microbial organism of the invention and so forth, as desired, so
long as the combination of enzymes and/or proteins of the desired
biosynthetic pathway results in production of the corresponding
desired product. Similarly, any combination of four, or more
enzymes or proteins of a biosynthetic pathway as disclosed herein
can be included in a non-naturally occurring microbial organism of
the invention, as desired, so long as the combination of enzymes
and/or proteins of the desired biosynthetic pathway results in
production of the corresponding desired product.
[0155] In addition to the biosynthesis of muconate as described
herein, the non-naturally occurring microbial organisms and methods
of the invention also can be utilized in various combinations with
each other and with other microbial organisms and methods well
known in the art to achieve product biosynthesis by other routes.
For example, one alternative to produce muconate other than use of
the muconate producers is through addition of another microbial
organism capable of converting a muconate pathway intermediate to
muconate. One such procedure includes, for example, the
fermentation of a microbial organism that produces a muconate
pathway intermediate. The muconate pathway intermediate can then be
used as a substrate for a second microbial organism that converts
the muconate pathway intermediate to muconate. The muconate pathway
intermediate can be added directly to another culture of the second
organism or the original culture of the muconate pathway
intermediate producers can be depleted of these microbial organisms
by, for example, cell separation, and then subsequent addition of
the second organism to the fermentation broth can be utilized to
produce the final product without intermediate purification
steps.
[0156] In other embodiments, the non-naturally occurring microbial
organisms and methods of the invention can be assembled in a wide
variety of subpathways to achieve biosynthesis of, for example,
muconate. In these embodiments, biosynthetic pathways for a desired
product of the invention can be segregated into different microbial
organisms, and the different microbial organisms can be co-cultured
to produce the final product. In such a biosynthetic scheme, the
product of one microbial organism is the substrate for a second
microbial organism until the final product is synthesized. For
example, the biosynthesis of muconate can be accomplished by
constructing a microbial organism that contains biosynthetic
pathways for conversion of one pathway intermediate to another
pathway intermediate or the product. Alternatively, muconate also
can be biosynthetically produced from microbial organisms through
co-culture or co-fermentation using two organisms in the same
vessel, where the first microbial organism produces a muconate
intermediate and the second microbial organism converts the
intermediate to muconate.
[0157] Given the teachings and guidance provided herein, those
skilled in the art will understand that a wide variety of
combinations and permutations exist for the non-naturally occurring
microbial organisms and methods of the invention together with
other microbial organisms, with the co-culture of other
non-naturally occurring microbial organisms having subpathways and
with combinations of other chemical and/or biochemical procedures
well known in the art to produce muconate.
[0158] Sources of encoding nucleic acids for a muconate pathway
enzyme or protein can include, for example, any species where the
encoded gene product is capable of catalyzing the referenced
reaction. Such species include both prokaryotic and eukaryotic
organisms including, but not limited to, bacteria, including
archaea and eubacteria, and eukaryotes, including yeast, plant,
insect, animal, and mammal, including human. Exemplary species for
such sources include, for example, Escherichia coli, as well as
other exemplary species disclosed herein or available as source
organisms for corresponding genes. However, with the complete
genome sequence available for now more than 550 species (with more
than half of these available on public databases such as the NCBI),
including 395 microorganism genomes and a variety of yeast, fungi,
plant, and mammalian genomes, the identification of genes encoding
the requisite muconate biosynthetic activity for one or more genes
in related or distant species, including for example, homologues,
orthologs, paralogs and nonorthologous gene displacements of known
genes, and the interchange of genetic alterations between organisms
is routine and well known in the art. Accordingly, the metabolic
alterations enabling biosynthesis of muconate described herein with
reference to a particular organism such as E. coli can be readily
applied to other microorganisms, including prokaryotic and
eukaryotic organisms alike. Given the teachings and guidance
provided herein, those skilled in the art will know that a
metabolic alteration exemplified in one organism can be applied
equally to other organisms.
[0159] In some instances, such as when an alternative muconate
biosynthetic pathway exists in an unrelated species, muconate
biosynthesis can be conferred onto the host species by, for
example, exogenous expression of a paralog or paralogs from the
unrelated species that catalyzes a similar, yet non-identical
metabolic reaction to replace the referenced reaction. Because
certain differences among metabolic networks exist between
different organisms, those skilled in the art will understand that
the actual gene usage between different organisms may differ.
However, given the teachings and guidance provided herein, those
skilled in the art also will understand that the teachings and
methods of the invention can be applied to all microbial organisms
using the cognate metabolic alterations to those exemplified herein
to construct a microbial organism in a species of interest that
will synthesize muconate.
[0160] Host microbial organisms can be selected from, and the
non-naturally occurring microbial organisms generated in, for
example, bacteria, yeast, fungus or any of a variety of other
microorganisms applicable to fermentation processes. Exemplary
bacteria include species selected from Escherichia coli, Klebsiella
oxytoca, Anaerobiospirillum succiniciproducens, Actinobacillus
succinogenes, Mannheimia succiniciproducens, Rhizobium etli,
Bacillus subtilis, Corynebacterium glutamicum, Gluconobacter
oxydans, Zymomonas mobilis, Lactococcus lactis, Lactobacillus
plantarum, Streptomyces coelicolor, Clostridium acetobutylicum,
Pseudomonas fluorescens, and Pseudomonas putida. Exemplary yeasts
or fungi include species selected from Saccharomyces cerevisiae,
Schizosaccharomyces pombe, Kluyveromyces lactis, Kluyveromyces
marxianus, Aspergillus terreus, Aspergillus niger and Pichia
pastoris. E. coli is a particularly useful host organisms since it
is a well characterized microbial organism suitable for genetic
engineering. Other particularly useful host organisms include yeast
such as Saccharomyces cerevisiae.
[0161] Methods for constructing and testing the expression levels
of a non-naturally occurring muconate-producing host can be
performed, for example, by recombinant and detection methods well
known in the art. Such methods can be found described in, for
example, Sambrook et al., Molecular Cloning: A Laboratory Manual,
Third Ed., Cold Spring Harbor Laboratory, New York (2001); and
Ausubel et al., Current Protocols in Molecular Biology, John Wiley
and Sons, Baltimore, Md. (1999).
[0162] Exogenous nucleic acid sequences involved in a pathway for
production of muconate can be introduced stably or transiently into
a host cell using techniques well known in the art including, but
not limited to, conjugation, electroporation, chemical
transformation, transduction, transfection, and ultrasound
transformation. For exogenous expression in E. coli or other
prokaryotic cells, some nucleic acid sequences in the genes or
cDNAs of eukaryotic nucleic acids can encode targeting signals such
as an N-terminal mitochondrial or other targeting signal, which can
be removed before transformation into prokaryotic host cells, if
desired. For example, removal of a mitochondrial leader sequence
led to increased expression in E. coli (Hoffmeister et al., J.
Biol. Chem. 280:4329-4338 (2005)). For exogenous expression in
yeast or other eukaryotic cells, genes can be expressed in the
cytosol without the addition of leader sequence, or can be targeted
to mitochondrion or other organelles, or targeted for secretion, by
the addition of a suitable targeting sequence such as a
mitochondrial targeting or secretion signal suitable for the host
cells. Thus, it is understood that appropriate modifications to a
nucleic acid sequence to remove or include a targeting sequence can
be incorporated into an exogenous nucleic acid sequence to impart
desirable properties. Furthermore, genes can be subjected to codon
optimization with techniques well known in the art to achieve
optimized expression of the proteins.
[0163] An expression vector or vectors can be constructed to
include one or more muconate biosynthetic pathway encoding nucleic
acids as exemplified herein operably linked to expression control
sequences functional in the host organism. Expression vectors
applicable for use in the microbial host organisms of the invention
include, for example, plasmids, phage vectors, viral vectors,
episomes and artificial chromosomes, including vectors and
selection sequences or markers operable for stable integration into
a host chromosome. Additionally, the expression vectors can include
one or more selectable marker genes and appropriate expression
control sequences. Selectable marker genes also can be included
that, for example, provide resistance to antibiotics or toxins,
complement auxotrophic deficiencies, or supply critical nutrients
not in the culture media. Expression control sequences can include
constitutive and inducible promoters, transcription enhancers,
transcription terminators, and the like which are well known in the
art. When two or more exogenous encoding nucleic acids are to be
co-expressed, both nucleic acids can be inserted, for example, into
a single expression vector or in separate expression vectors. For
single vector expression, the encoding nucleic acids can be
operationally linked to one common expression control sequence or
linked to different expression control sequences, such as one
inducible promoter and one constitutive promoter. The
transformation of exogenous nucleic acid sequences involved in a
metabolic or synthetic pathway can be confirmed using methods well
known in the art. Such methods include, for example, nucleic acid
analysis such as Northern blots or polymerase chain reaction (PCR)
amplification of mRNA, or immunoblotting for expression of gene
products, or other suitable analytical methods to test the
expression of an introduced nucleic acid sequence or its
corresponding gene product. It is understood by those skilled in
the art that the exogenous nucleic acid is expressed in a
sufficient amount to produce the desired product, and it is further
understood that expression levels can be optimized to obtain
sufficient expression using methods well known in the art and as
disclosed herein.
[0164] Directed evolution is a powerful approach that involves the
introduction of mutations targeted to a specific gene in order to
improve and/or alter the properties of an enzyme. Improved and/or
altered enzymes can be identified through the development and
implementation of sensitive high-throughput screening assays that
allow the automated screening of many enzyme variants (e.g.,
>10.sup.4). Iterative rounds of mutagenesis and screening
typically are performed to afford an enzyme with optimized
properties. Computational algorithms that can help to identify
areas of the gene for mutagenesis also have been developed and can
significantly reduce the number of enzyme variants that need to be
generated and screened.
[0165] Numerous directed evolution technologies have been developed
(for reviews, see Hibbert et al., Biomol. Eng 22:11-19 (2005);
Huisman and Lalonde, In Biocatalysis in the pharmaceutical and
biotechnology industries pgs. 717-742 (2007), Patel (ed.), CRC
Press; Otten and Quax, Biomol. Eng 22:1-9 (2005); and Sen et al.,
Appl Biochem. Biotechnol 143:212-223 (2007)) to be effective at
creating diverse variant libraries and these methods have been
successfully applied to the improvement of a wide range of
properties across many enzyme classes.
[0166] Enzyme characteristics that have been improved and/or
altered by directed evolution technologies include, for example,
selectivity/specificity--for conversion of non-natural substrates;
temperature stability--for robust high temperature processing; pH
stability--for bioprocessing under lower or higher pH conditions;
substrate or product tolerance--so that high product titers can be
achieved; binding (K.sub.m)--broadens substrate binding to include
non-natural substrates; inhibition (K.sub.i)--to remove inhibition
by products, substrates, or key intermediates; activity
(kcat)--increases enzymatic reaction rates to achieve desired flux;
expression levels--increases protein yields and overall pathway
flux; oxygen stability--for operation of air sensitive enzymes
under aerobic conditions; and anaerobic activity--for operation of
an aerobic enzyme in the absence of oxygen.
[0167] The following exemplary methods have been developed for the
mutagenesis and diversification of genes to target desired
properties of specific enzymes. Any of these can be used to
alter/optimize activity of a decarboxylase enzyme.
[0168] EpPCR (Pritchard et al., J Theor. Biol 234:497-509 (2005))
introduces random point mutations by reducing the fidelity of DNA
polymerase in PCR reactions by the addition of Mn.sup.2+ ions, by
biasing dNTP concentrations, or by other conditional variations.
The five step cloning process to confine the mutagenesis to the
target gene of interest involves: 1) error-prone PCR amplification
of the gene of interest; 2) restriction enzyme digestion; 3) gel
purification of the desired DNA fragment; 4) ligation into a
vector; 5) transformation of the gene variants into a suitable host
and screening of the library for improved performance. This method
can generate multiple mutations in a single gene simultaneously,
which can be useful. A high number of mutants can be generated by
EpPCR, so a high-throughput screening assay or a selection method
(especially using robotics) is useful to identify those with
desirable characteristics.
[0169] Error-prone Rolling Circle Amplification (epRCA) (Fujii et
al., Nucleic Acids Res 32:e145 (2004); and Fujii et al., Nat.
Protoc. 1:2493-2497 (2006)) has many of the same elements as epPCR
except a whole circular plasmid is used as the template and random
6-mers with exonuclease resistant thiophosphate linkages on the
last 2 nucleotides are used to amplify the plasmid followed by
transformation into cells in which the plasmid is re-circularized
at tandem repeats. Adjusting the Mn.sup.2+ concentration can vary
the mutation rate somewhat. This technique uses a simple
error-prone, single-step method to create a full copy of the
plasmid with 3-4 mutations/kbp. No restriction enzyme digestion or
specific primers are required. Additionally, this method is
typically available as a kit.
[0170] DNA or Family Shuffling (Stemmer, Proc. Natl. Acad. Sci.
U.S.A. 91:10747-10751 (1994); and Stemmer, Nature 370:389-391
(1994)) typically involves digestion of two or more variant genes
with nucleases such as Dnase I or EndoV to generate a pool of
random fragments that are reassembled by cycles of annealing and
extension in the presence of DNA polymerase to create a library of
chimeric genes. Fragments prime each other and recombination occurs
when one copy primes another copy (template switch). This method
can be used with >1 kbp DNA sequences. In addition to mutational
recombinants created by fragment reassembly, this method introduces
point mutations in the extension steps at a rate similar to
error-prone PCR. The method can be used to remove deleterious,
random and neutral mutations that might confer antigenicity.
[0171] Staggered Extension (StEP) (Zhao et al., Nat. Biotechnol
16:258-261 (1998)) entails template priming followed by repeated
cycles of 2 step PCR with denaturation and very short duration of
annealing/extension (as short as 5 sec). Growing fragments anneal
to different templates and extend further, which is repeated until
full-length sequences are made. Template switching means most
resulting fragments have multiple parents. Combinations of
low-fidelity polymerases (Taq and Mutazyme) reduce error-prone
biases because of opposite mutational spectra.
[0172] In Random Priming Recombination (RPR) random sequence
primers are used to generate many short DNA fragments complementary
to different segments of the template. (Shao et al., Nucleic Acids
Res 26:681-683 (1998)) Base misincorporation and mispriming via
epPCR give point mutations. Short DNA fragments prime one another
based on homology and are recombined and reassembled into
full-length by repeated thermocycling. Removal of templates prior
to this step assures low parental recombinants. This method, like
most others, can be performed over multiple iterations to evolve
distinct properties. This technology avoids sequence bias, is
independent of gene length, and requires very little parent DNA for
the application.
[0173] In Heteroduplex Recombination linearized plasmid DNA is used
to form heteroduplexes that are repaired by mismatch repair.
(Volkov et al, Nucleic Acids Res 27:e18 (1999); and Volkov et al.,
Methods Enzymol. 328:456-463 (2000)) The mismatch repair step is at
least somewhat mutagenic. Heteroduplexes transform more efficiently
than linear homoduplexes. This method is suitable for large genes
and whole operons.
[0174] Random Chimeragenesis on Transient Templates (RACHITT) (Coco
et al., Nat. Biotechnol 19:354-359 (2001)) employs Dnase I
fragmentation and size fractionation of ssDNA. Homologous fragments
are hybridized in the absence of polymerase to a complementary
ssDNA scaffold. Any overlapping unhybridized fragment ends are
trimmed down by an exonuclease. Gaps between fragments are filled
in, and then ligated to give a pool of full-length diverse strands
hybridized to the scaffold (that contains U to preclude
amplification). The scaffold then is destroyed and is replaced by a
new strand complementary to the diverse strand by PCR
amplification. The method involves one strand (scaffold) that is
from only one parent while the priming fragments derive from other
genes; the parent scaffold is selected against. Thus, no
reannealing with parental fragments occurs. Overlapping fragments
are trimmed with an exonuclease. Otherwise, this is conceptually
similar to DNA shuffling and StEP. Therefore, there should be no
siblings, few inactives, and no unshuffled parentals. This
technique has advantages in that few or no parental genes are
created and many more crossovers can result relative to standard
DNA shuffling.
[0175] Recombined Extension on Truncated templates (RETT) entails
template switching of unidirectionally growing strands from primers
in the presence of unidirectional ssDNA fragments used as a pool of
templates. (Lee et al., J. Molec. Catalysis 26:119-129 (2003)) No
DNA endonucleases are used. Unidirectional ssDNA is made by DNA
polymerase with random primers or serial deletion with exonuclease.
Unidirectional ssDNA are only templates and not primers. Random
priming and exonucleases don't introduce sequence bias as true of
enzymatic cleavage of DNA shuffling/RACHITT. RETT can be easier to
optimize than StEP because it uses normal PCR conditions instead of
very short extensions. Recombination occurs as a component of the
PCR steps--no direct shuffling. This method can also be more random
than StEP due to the absence of pauses.
[0176] In Degenerate Oligonucleotide Gene Shuffling (DOGS)
degenerate primers are used to control recombination between
molecules; (Bergquist and Gibbs, Methods Mol. Biol. 352:191-204
(2007); Bergquist et al., Biomol. Eng 22:63-72 (2005); Gibbs et
al., Gene 271:13-20 (2001)) this can be used to control the
tendency of other methods such as DNA shuffling to regenerate
parental genes. This method can be combined with random mutagenesis
(epPCR) of selected gene segments. This can be a good method to
block the reformation of parental sequences. No endonucleases are
needed. By adjusting input concentrations of segments made, one can
bias towards a desired backbone. This method allows DNA shuffling
from unrelated parents without restriction enzyme digests and
allows a choice of random mutagenesis methods.
[0177] Incremental Truncation for the Creation of Hybrid Enzymes
(ITCHY) creates a combinatorial library with 1 base pair deletions
of a gene or gene fragment of interest. (Ostermeier et al., Proc.
Natl. Acad. Sci. U.S.A. 96:3562-3567 (1999); and Ostermeier et al.,
Nat. Biotechnol 17:1205-1209 (1999)) Truncations are introduced in
opposite direction on pieces of 2 different genes. These are
ligated together and the fusions are cloned. This technique does
not require homology between the 2 parental genes. When ITCHY is
combined with DNA shuffling, the system is called SCRATCHY (see
below). A major advantage of both is no need for homology between
parental genes; for example, functional fusions between an E. coli
and a human gene were created via ITCHY. When ITCHY libraries are
made, all possible crossovers are captured.
[0178] Thio-Incremental Truncation for the Creation of Hybrid
Enzymes (THIO-ITCHY) is similar to ITCHY except that phosphothioate
dNTPs are used to generate truncations. (Lutz et al., Nucleic Acids
Res 29:E16 (2001)) Relative to ITCHY, THIO-ITCHY can be easier to
optimize, provide more reproducibility, and adjustability.
[0179] SCRATCHY combines two methods for recombining genes, ITCHY
and DNA shuffling. (Lutz et al., Proc. Natl. Acad. Sci. U.S.A.
98:11248-11253 (2001)) SCRATCHY combines the best features of ITCHY
and DNA shuffling. First, ITCHY is used to create a comprehensive
set of fusions between fragments of genes in a DNA
homology-independent fashion. This artificial family is then
subjected to a DNA-shuffling step to augment the number of
crossovers. Computational predictions can be used in optimization.
SCRATCHY is more effective than DNA shuffling when sequence
identity is below 80%.
[0180] In Random Drift Mutagenesis (RNDM) mutations made via epPCR
followed by screening/selection for those retaining usable
activity. (Bergquist et al., Biomol. Eng 22:63-72 (2005)) Then,
these are used in DOGS to generate recombinants with fusions
between multiple active mutants or between active mutants and some
other desirable parent. Designed to promote isolation of neutral
mutations; its purpose is to screen for retained catalytic activity
whether or not this activity is higher or lower than in the
original gene. RNDM is usable in high throughput assays when
screening is capable of detecting activity above background. RNDM
has been used as a front end to DOGS in generating diversity. The
technique imposes a requirement for activity prior to shuffling or
other subsequent steps; neutral drift libraries are indicated to
result in higher/quicker improvements in activity from smaller
libraries. Though published using epPCR, this could be applied to
other large-scale mutagenesis methods.
[0181] Sequence Saturation Mutagenesis (SeSaM) is a random
mutagenesis method that: 1) generates pool of random length
fragments using random incorporation of a phosphothioate nucleotide
and cleavage; this pool is used as a template to 2) extend in the
presence of "universal" bases such as inosine; 3) replication of a
inosine-containing complement gives random base incorporation and,
consequently, mutagenesis. (Wong et al., Biotechnol J. 3:74-82
(2008); Wong et al., Nucleic Acids Res 32:e26 (2004); and Wong et
al., Anal. Biochem. 341:187-189 (2005)) Using this technique it can
be possible to generate a large library of mutants within 2-3 days
using simple methods. This technique is non-directed in comparison
to the mutational bias of DNA polymerases. Differences in this
approach makes this technique complementary (or an alternative) to
epPCR.
[0182] In Synthetic Shuffling, overlapping oligonucleotides are
designed to encode "all genetic diversity in targets" and allow a
very high diversity for the shuffled progeny. (Ness et al., Nat.
Biotechnol 20:1251-1255 (2002)) In this technique, one can design
the fragments to be shuffled. This aids in increasing the resulting
diversity of the progeny. One can design sequence/codon biases to
make more distantly related sequences recombine at rates
approaching those observed with more closely related sequences.
Additionally, the technique does not require physically possessing
the template genes.
[0183] Nucleotide Exchange and Excision Technology NexT exploits a
combination of dUTP incorporation followed by treatment with uracil
DNA glycosylase and then piperidine to perform endpoint DNA
fragmentation. (Muller et al., Nucleic Acids Res 33:e117 (2005))
The gene is reassembled using internal PCR primer extension with
proofreading polymerase. The sizes for shuffling are directly
controllable using varying dUPT::dTTP ratios. This is an end point
reaction using simple methods for uracil incorporation and
cleavage. Other nucleotide analogs, such as 8-oxo-guanine, can be
used with this method. Additionally, the technique works well with
very short fragments (86 bp) and has a low error rate. The chemical
cleavage of DNA used in this technique results in very few
unshuffled clones.
[0184] In Sequence Homology-Independent Protein Recombination
(SHIPREC) a linker is used to facilitate fusion between two
distantly/unrelated genes. Nuclease treatment is used to generate a
range of chimeras between the two genes. These fusions result in
libraries of single-crossover hybrids. (Sieber et al., Nat.
Biotechnol 19:456-460 (2001)) This produces a limited type of
shuffling and a separate process is required for mutagenesis. In
addition, since no homology is needed this technique can create a
library of chimeras with varying fractions of each of the two
unrelated parent genes. SHIPREC was tested with a heme-binding
domain of a bacterial CP450 fused to N-terminal regions of a
mammalian CP450; this produced mammalian activity in a more soluble
enzyme.
[0185] In Gene Site Saturation Mutagenesis.TM. (GSSM.TM.) the
starting materials are a supercoiled dsDNA plasmid containing an
insert and two primers which are degenerate at the desired site of
mutations. (Kretz et al., Methods Enzymol. 388:3-11 (2004)) Primers
carrying the mutation of interest, anneal to the same sequence on
opposite strands of DNA. The mutation is typically in the middle of
the primer and flanked on each side by .about.20 nucleotides of
correct sequence. The sequence in the primer is NNN or NNK (coding)
and MNN (noncoding) (N=all 4, K=G, T, M=A, C). After extension,
DpnI is used to digest dam-methylated DNA to eliminate the
wild-type template. This technique explores all possible amino acid
substitutions at a given locus (i.e., one codon). The technique
facilitates the generation of all possible replacements at a
single-site with no nonsense codons and results in equal to
near-equal representation of most possible alleles. This technique
does not require prior knowledge of the structure, mechanism, or
domains of the target enzyme. If followed by shuffling or Gene
Reassembly, this technology creates a diverse library of
recombinants containing all possible combinations of single-site
up-mutations. The utility of this technology combination has been
demonstrated for the successful evolution of over 50 different
enzymes, and also for more than one property in a given enzyme.
[0186] Combinatorial Cassette Mutagenesis (CCM) involves the use of
short oligonucleotide cassettes to replace limited regions with a
large number of possible amino acid sequence alterations.
(Reidhaar-Olson et al. Methods Enzymol. 208:564-586 (1991); and
Reidhaar-Olson et al. Science 241:53-57 (1988)) Simultaneous
substitutions at two or three sites are possible using this
technique. Additionally, the method tests a large multiplicity of
possible sequence changes at a limited range of sites. This
technique has been used to explore the information content of the
lambda repressor DNA-binding domain.
[0187] Combinatorial Multiple Cassette Mutagenesis (CMCM) is
essentially similar to CCM except it is employed as part of a
larger program: 1) Use of epPCR at high mutation rate to 2) ID hot
spots and hot regions and then 3) extension by CMCM to cover a
defined region of protein sequence space. (Reetz et al., Angew.
Chem. Int. Ed Engl. 40:3589-3591 (2001).) As with CCM, this method
can test virtually all possible alterations over a target region.
If used along with methods to create random mutations and shuffled
genes, it provides an excellent means of generating diverse,
shuffled proteins. This approach was successful in increasing, by
51-fold, the enantioselectivity of an enzyme.
[0188] In the Mutator Strains technique conditional ts mutator
plasmids allow increases of 20- to 4000-X in random and natural
mutation frequency during selection and block accumulation of
deleterious mutations when selection is not required. (Selifonova
et al., Appl Environ Microbiol 67:3645-3649 (2001)) This technology
is based on a plasmid-derived mutD5 gene, which encodes a mutant
subunit of DNA polymerase III. This subunit binds to endogenous DNA
polymerase III and compromises the proofreading ability of
polymerase III in any strain that harbors the plasmid. A
broad-spectrum of base substitutions and frameshift mutations
occur. In order for effective use, the mutator plasmid should be
removed once the desired phenotype is achieved; this is
accomplished through a temperature sensitive origin of replication,
which allows for plasmid curing at 41.degree. C. It should be noted
that mutator strains have been explored for quite some time (e.g.,
see Low et al., J. Mol. Biol. 260:359-3680 (1996)). In this
technique very high spontaneous mutation rates are observed. The
conditional property minimizes non-desired background mutations.
This technology could be combined with adaptive evolution to
enhance mutagenesis rates and more rapidly achieve desired
phenotypes.
[0189] "Look-Through Mutagenesis (LTM) is a multidimensional
mutagenesis method that assesses and optimizes combinatorial
mutations of selected amino acids." (Rajpal et al., Proc Natl Acad
Sci U.S.A. 102:8466-8471 (2005)) Rather than saturating each site
with all possible amino acid changes, a set of nine is chosen to
cover the range of amino acid R-group chemistry. Fewer changes per
site allows multiple sites to be subjected to this type of
mutagenesis. A >800-fold increase in binding affinity for an
antibody from low nanomolar to picomolar has been achieved through
this method. This is a rational approach to minimize the number of
random combinations and can increase the ability to find improved
traits by greatly decreasing the numbers of clones to be screened.
This has been applied to antibody engineering, specifically to
increase the binding affinity and/or reduce dissociation. The
technique can be combined with either screens or selections.
[0190] Gene Reassembly is a DNA shuffling method that can be
applied to multiple genes at one time or to creating a large
library of chimeras (multiple mutations) of a single gene. (Tunable
GeneReassembly.TM. (TGR.TM.) Technology supplied by Verenium
Corporation) Typically this technology is used in combination with
ultra-high-throughput screening to query the represented sequence
space for desired improvements. This technique allows multiple gene
recombination independent of homology. The exact number and
position of cross-over events can be pre-determined using fragments
designed via bioinformatic analysis. This technology leads to a
very high level of diversity with virtually no parental gene
reformation and a low level of inactive genes. Combined with
GSSM.TM., a large range of mutations can be tested for improved
activity. The method allows "blending" and "fine tuning" of DNA
shuffling, e.g. codon usage can be optimized.
[0191] In Silico Protein Design Automation (PDA) is an optimization
algorithm that anchors the structurally defined protein backbone
possessing a particular fold, and searches sequence space for amino
acid substitutions that can stabilize the fold and overall protein
energetics. (Hayes et al., Proc Natl Acad Sci U.S.A. 99:15926-15931
(2002)) This technology uses in silico structure-based entropy
predictions in order to search for structural tolerance toward
protein amino acid variations. Statistical mechanics is applied to
calculate coupling interactions at each position. Structural
tolerance toward amino acid substitution is a measure of coupling.
Ultimately, this technology is designed to yield desired
modifications of protein properties while maintaining the integrity
of structural characteristics. The method computationally assesses
and allows filtering of a very large number of possible sequence
variants (10.sup.50). The choice of sequence variants to test is
related to predictions based on the most favorable thermodynamics.
Ostensibly only stability or properties that are linked to
stability can be effectively addressed with this technology. The
method has been successfully used in some therapeutic proteins,
especially in engineering immunoglobulins. In silico predictions
avoid testing extraordinarily large numbers of potential variants.
Predictions based on existing three-dimensional structures are more
likely to succeed than predictions based on hypothetical
structures. This technology can readily predict and allow targeted
screening of multiple simultaneous mutations, something not
possible with purely experimental technologies due to exponential
increases in numbers.
[0192] Iterative Saturation Mutagenesis (ISM) involves: 1) use
knowledge of structure/function to choose a likely site for enzyme
improvement; 2) saturation mutagenesis at chosen site using
Stratagene QuikChange (or other suitable means); 3) screen/select
for desired properties; and 4) with improved clone(s), start over
at another site and continue repeating. (Reetz et al., Nat. Protoc.
2:891-903 (2007); and Reetz et al., Angew. Chem. Int. Ed Engl.
45:7745-7751 (2006)) This is a proven methodology, which assures
all possible replacements at a given position are made for
screening/selection.
[0193] Any of the aforementioned methods for mutagenesis can be
used alone or in any combination. Additionally, any one or
combination of the directed evolution methods can be used in
conjunction with adaptive evolution techniques.
[0194] The present invention provides a method for producing
muconate that includes culturing a non-naturally occurring
microbial organism having a muconate pathway. The pathway includes
at least one exogenous nucleic acid encoding a muconate pathway
enzyme expressed in a sufficient amount to produce muconate, under
conditions and for a sufficient period of time to produce muconate.
The muconate pathway includes an enzyme selected from the group
consisting of a beta-ketothiolase, a beta-ketoadipyl-CoA hydrolase,
a beta-ketoadipyl-CoA transferase, a beta-ketoadipyl-CoA ligase, a
2-fumarylacetate reductase, a 2-fumarylacetate dehydrogenase, a
trans-3-hydroxy-4-hexendioate dehydratase, a 2-fumarylacetate
aminotransferase, a 2-fumarylacetate aminating oxidoreductase, a
trans-3-amino-4-hexenoate deaminase, a beta-ketoadipate
enol-lactone hydrolase, a muconolactone isomerase, a muconate
cycloisomerase, a beta-ketoadipyl-CoA dehydrogenase, a
3-hydroxyadipyl-CoA dehydratase, a 2,3-dehydroadipyl-CoA
transferase, a 2,3-dehydroadipyl-CoA hydrolase, a
2,3-dehydroadipyl-CoA ligase, a muconate reductase, a
2-maleylacetate reductase, a 2-maleylacetate dehydrogenase, a
cis-3-hydroxy-4-hexendioate dehydratase, a 2-maleylacetate
aminoatransferase, a 2-maleylacetate aminating oxidoreductase, a
cis-3-amino-4-hexendioate deaminase, and a muconate cis/trans
isomerase.
[0195] In some embodiments, the muconate pathway includes, a set of
muconate pathway enzymes such as those exemplified in FIG. 2; the
set of muconate pathway enzymes are selected from the group
consisting of:
[0196] A) (1) beta-ketothiolase, (2) an enzyme selected from
beta-ketoadipyl-CoA hydrolase, beta-ketoadipyl-CoA transferase, and
beta-ketoadipyl-CoA ligase, (3) beta-ketoadipate enol-lactone
hydrolase, (4) muconolactone isomerase, (5) muconate
cycloisomerase, and (6) muconate cis/trans isomerase;
[0197] B) (1) beta-ketothiolase, (2) an enzyme selected from
beta-ketoadipyl-CoA hydrolase, beta-ketoadipyl-CoA transferase and
beta-ketoadipyl-CoA ligase, (3) 2-maleylacetate reductase, (4)
2-maleylacetate dehydrogenase, (5) cis-3-hydroxy-4-hexendioate
dehydratase, and (6) muconate cis/trans isomerase;
[0198] C) (1) beta-ketothiolase, (2) an enzyme selected from
beta-ketoadipyl-CoA hydrolase, beta-ketoadipyl-CoA transferase and
beta-ketoadipyl-CoA ligase, (3) 2-maleylacetate reductase, (4) an
enzyme selected from 2-maleylacetate aminotransferase and
2-maleylacetate aminating oxidoreductase, (5)
cis-3-amino-4-hexenoate deaminase, and (6) muconate cis/trans
isomerase;
[0199] D) (1) beta-ketothiolase, (2) beta-ketoadipyl-CoA
dehydrogenase, (3) 3-hydroxyadipyl-CoA dehydratase, (4) an enzyme
selected from 2,3-dehydroadipyl-CoA transferase,
2,3-dehydroadipyl-CoA hydrolase and 2,3-dehydroadipyl-CoA ligase,
and (5) muconate reductase;
[0200] E) (1) beta-ketothiolase, (2) an enzyme selected from
beta-ketoadipyl-CoA hydrolase, beta-ketoadipyl-CoA transferase and
beta-ketoadipyl-CoA ligase, (3) 2-fumarylacetate reductase, (4)
2-fumarylacetate dehydrogenase, and (5)
trans-3-hydroxy-4-hexendioate dehydratase;
[0201] F) (1) beta-ketothiolase, (2) an enzyme selected from
beta-ketoadipyl-CoA hydrolase, beta-ketoadipyl-CoA transferase and
beta-ketoadipyl-CoA ligase, (3) 2-fumarylacetate reductase, (4) an
enzyme selected from 2-fumarylacetate aminotransferase and
2-fumarylacetate aminating oxidoreductase, and (5)
trans-3-amino-4-hexenoate deaminase.
[0202] In some embodiments, the present invention provides a method
for producing muconate that includes culturing a non-naturally
occurring microbial organism having a muconate pathway. The pathway
comprising at least one exogenous nucleic acid encoding a muconate
pathway enzyme expressed in a sufficient amount to produce
muconate, under conditions and for a sufficient period of time to
produce muconate. The muconate pathway includes a
4-hydroxy-2-ketovalerate aldolase, a 2-oxopentenoate hydratase, a
4-oxalocrotonate dehydrogenase, a 2-hydroxy-4-hexenedioate
dehydratase, a 4-hydroxy-2-oxohexanedioate oxidoreductase, a
2,4-dihydroxyadipate dehydratase (acting on 2-hydroxy), a
2,4-dihydroxyadipate dehydratase (acting on 4-hydroxyl group) and a
3-hydroxy-4-hexenedioate dehydratase.
[0203] In some embodiments, the muconate pathway includes, a set of
muconate pathway enzymes such as those exemplified in FIG. 3; the
set of muconate pathway enzymes are selected from the group
consisting of:
[0204] A) (1) 4-hydroxy-2-ketovalerate aldolase, (2)
2-oxopentenoate hydratase, (3) 4-oxalocrotonate dehydrogenase, (4)
2-hydroxy-4-hexenedioate dehydratase;
[0205] B) (1) 4-hydroxy-2-ketovalerate aldolase, (2)
4-hydroxy-2-oxohexanedioate oxidoreductase, (3)
2,4-dihydroxyadipate dehydratase (acting on 2-hydroxy), (4)
3-hydroxy-4-hexenedioate dehydratase; and
[0206] C) (1) 4-hydroxy-2-ketovalerate aldolase, (2)
4-hydroxy-2-oxohexanedioate oxidoreductase, (3)
2,4-dihydroxyadipate dehydratase (acting on 4-hydroxyl group), (4)
2-hydroxy-4-hexenedioate dehydratase.
[0207] In some embodiments, the present invention provides a method
for producing muconate that includes culturing a non-naturally
occurring microbial organism having a muconate pathway. The pathway
includes at least one exogenous nucleic acid encoding a muconate
pathway enzyme expressed in a sufficient amount to produce
muconate, under conditions and for a sufficient period of time to
produce muconate. The muconate pathway includes an enzyme selected
from the group consisting of an HODH aldolase, an OHED hydratase,
an OHED decarboxylase, an HODH formate-lyase, an HODH
dehydrogenase, an OHED formate-lyase, an OHED dehydrogenase, a
6-OHE dehydrogenase, a 3-hydroxyadipyl-CoA dehydratase, a
2,3-dehydroadipyl-CoA hydrolase, a 2,3-dehydroadipyl-CoA
transferase, a 2,3-dehydroadipyl-CoA ligase, and a muconate
reductase.
[0208] In some embodiments, the muconate pathway includes, a set of
muconate pathway enzymes such as those exemplified in FIG. 4; the
set of muconate pathway enzymes are selected from the group
consisting of:
[0209] A) (1) HODH aldolase, (2) OHED hydratase, (3) OHED
decarboxylase, (4) 6-OHE dehydrogenase, and (5) muconate
reductase;
[0210] B) (1) HODH aldolase, (2) OHED hydratase, (3) an enzyme
selected from OHED formate-lyase and OHED dehydrogenase, (4) an
enzyme selected from 2,3-dehydroadipyl-CoA hydrolase,
2,3-dehydroadipyl-CoA transferase and 2,3-dehydroadipyl-CoA ligase,
and (5) muconate reductase; and
[0211] C) (1) HODH aldolase, (2) an enzyme selected from HODH
formate-lyase and HODH dehydrogenase, (3) 3-hydroxyadipyl-CoA
dehydratase, (4) an enzyme selected from 2,3-dehydroadipyl-CoA
hydrolase, 2,3-dehydroadipyl-CoA transferase and
2,3-dehydroadipyl-CoA ligase, and (5) muconate reductase.
[0212] In some embodiments, the present invention provides a method
for producing muconate that includes culturing a non-naturally
occurring microbial organism having a muconate pathway. The pathway
includes at least one exogenous nucleic acid encoding a muconate
pathway enzyme expressed in a sufficient amount to produce
muconate, under conditions and for a sufficient period of time to
produce muconate. The muconate pathway includes an enzyme selected
from the group consisting of a lysine aminotransferase, a lysine
aminating oxidoreductase, a 2-aminoadipate semialdehyde
dehydrogenase, a 2-aminoadipate deaminase, a muconate reductase, a
lysine-2,3-aminomutase, a 3,6-diaminohexanoate aminotransferase, a
3,6-diaminohexanoate aminating oxidoreductase, a 3-aminoadipate
semialdehyde dehydrogenase, and a 3-aminoadipate deaminase.
[0213] In some embodiments, the muconate pathway includes, a set of
muconate pathway enzymes such as those exemplified in FIG. 5; the
set of muconate pathway enzymes are selected from the group
consisting of:
[0214] A) (1) lysine aminotransferase, (2) lysine aminating
oxidoreductase, (3) 2-aminoadipate semialdehyde dehydrogenase, (4)
2-aminoadipate deaminase, and (5) muconate reductase
[0215] B) (1) lysine-2,3-aminomutase, (2) 3,6-diaminohexanoate
aminotransferase, (3) 3,6-diaminohexanoate aminating
oxidoreductase, (4) 3-aminoadipate semialdehyde dehydrogenase, (5)
3-aminoadipate deaminase, and (6) muconate reductase.
[0216] In some embodiments, the foregoing non-naturally occurring
microbial organism can be cultured in a substantially anaerobic
culture medium.
[0217] Suitable purification and/or assays to test for the
production of muconate can be performed using well known methods.
Suitable replicates such as triplicate cultures can be grown for
each engineered strain to be tested. For example, product and
byproduct formation in the engineered production host can be
monitored. The final product and intermediates, and other organic
compounds, can be analyzed by methods such as HPLC (High
Performance Liquid Chromatography), GC-MS (Gas Chromatography-Mass
Spectroscopy) and LC-MS (Liquid Chromatography-Mass Spectroscopy)
or other suitable analytical methods using routine procedures well
known in the art. The release of product in the fermentation broth
can also be tested with the culture supernatant. Byproducts and
residual glucose can be quantified by HPLC using, for example, a
refractive index detector for glucose and alcohols, and a UV
detector for organic acids (Lin et al., Biotechnol. Bioeng.
90:775-779 (2005)), or other suitable assay and detection methods
well known in the art. The individual enzyme or protein activities
from the exogenous DNA sequences can also be assayed using methods
well known in the art. For example, a spectrophotometric assay for
succinyl-CoA:3-ketoacid-CoA transferase (FIG. 2, Step B) entails
measuring the change in the absorbance corresponding to the product
CoA molecule (i.e., succinyl-CoA) in the presence of the enzyme
extract when supplied with succinate and .beta.-ketoadipyl-CoA
(Corthesy-Theulaz et al., J Biol. Chem., 272(41) (1997)).
Succinyl-CoA can alternatively be measured in the presence of
excess hydroxylamine by complexing the succinohydroxamic acid
formed to ferric salts as referred to in (Corthesy-Theulaz et al.,
J. Biol. Chem. 272(41) (1997)). The specific activity of muconate
reductase can be assayed in the reductive direction using a
colorimetric assay adapted from the literature (Durre et al., FEMS
Microbiol. Rev. 17:251-262 (1995); Palosaari et al., J. Bacteriol.
170:2971-2976 (1988); Welch et al., Arch. Biochem. Biophys.
273:309-318 (1989)). In this assay, the substrates muconate and
NADH are added to cell extracts in a buffered solution, and the
oxidation of NADH is followed by reading absorbance at 340 nM at
regular intervals. The resulting slope of the reduction in
absorbance at 340 nM per minute, along with the molar extinction
coefficient of NADH at 340 nM (6000) and the protein concentration
of the extract, can be used to determine the specific activity of
muconate reducatse.
[0218] The muconate can be separated from other components in the
culture using a variety of methods well known in the art, as
briefly described above Such separation methods include, for
example, extraction procedures as well as methods that include
continuous liquid-liquid extraction, pervaporation, membrane
filtration, membrane separation, reverse osmosis, electrodialysis,
distillation, crystallization, centrifugation, extractive
filtration, ion exchange chromatography, size exclusion
chromatography, adsorption chromatography, and ultrafiltration. All
of the above methods are well known in the art.
[0219] Any of the non-naturally occurring microbial organisms
described herein can be cultured to produce and/or secrete the
biosynthetic products of the invention. For example, the muconate
producers can be cultured for the biosynthetic production of
muconate.
[0220] For the production of muconate, the recombinant strains are
cultured in a medium with carbon source and other essential
nutrients. It is highly desirable to maintain anaerobic conditions
in the fermenter to reduce the cost of the overall process. Such
conditions can be obtained, for example, by first sparging the
medium with nitrogen and then sealing the flasks with a septum and
crimp-cap. For strains where growth is not observed anaerobically,
microaerobic conditions can be applied by perforating the septum
with a small hole for limited aeration. Exemplary anaerobic
conditions have been described previously and are well-known in the
art. Exemplary aerobic and anaerobic conditions are described, for
example, in U.S. patent application Ser. No. 11/891,602, filed Aug.
10, 2007. Fermentations can be performed in a batch, fed-batch or
continuous manner, as disclosed herein.
[0221] If desired, the pH of the medium can be maintained at a
desired pH, in particular neutral pH, such as a pH of around 7 by
addition of a base, such as NaOH or other bases, or acid, as needed
to maintain the culture medium at a desirable pH. The growth rate
can be determined by measuring optical density using a
spectrophotometer (600 nm), and the glucose uptake rate by
monitoring carbon source depletion over time. NOTE--Ideally this
process would operate at low pH using an organisms that tolerates
pH levels in the range 2-4.
[0222] The growth medium can include, for example, any carbohydrate
source which can supply a source of carbon to the non-naturally
occurring microorganism. Such sources include, for example, sugars
such as glucose, xylose, arabinose, galactose, mannose, fructose,
sucrose and starch. Other sources of carbohydrate include, for
example, renewable feedstocks and biomass. Exemplary types of
biomasses that can be used as feedstocks in the methods of the
invention include cellulosic biomass, hemicellulosic biomass and
lignin feedstocks or portions of feedstocks. Such biomass
feedstocks contain, for example, carbohydrate substrates useful as
carbon sources such as glucose, xylose, arabinose, galactose,
mannose, fructose and starch. Given the teachings and guidance
provided herein, those skilled in the art will understand that
renewable feedstocks and biomass other than those exemplified above
also can be used for culturing the microbial organisms of the
invention for the production of muconate.
[0223] In addition to renewable feedstocks such as those
exemplified above, the muconate microbial organisms of the
invention also can be modified for growth on syngas as its source
of carbon. In this specific embodiment, one or more proteins or
enzymes are expressed in the muconate producing organisms to
provide a metabolic pathway for utilization of syngas or other
gaseous carbon source.
[0224] Synthesis gas, also known as syngas or producer gas, is the
major product of gasification of coal and of carbonaceous materials
such as biomass materials, including agricultural crops and
residues. Syngas is a mixture primarily of H.sub.2 and CO and can
be obtained from the gasification of any organic feedstock,
including but not limited to coal, coal oil, natural gas, biomass,
and waste organic matter. Gasification is generally carried out
under a high fuel to oxygen ratio. Although largely H.sub.2 and CO,
syngas can also include CO.sub.2 and other gases in smaller
quantities. Thus, synthesis gas provides a cost effective source of
gaseous carbon such as CO and, additionally, CO.sub.2.
[0225] The Wood-Ljungdahl pathway catalyzes the conversion of CO
and H.sub.2 to acetyl-CoA and other products such as acetate.
Organisms capable of utilizing CO and syngas also generally have
the capability of utilizing CO.sub.2 and CO.sub.2/H.sub.2 mixtures
through the same basic set of enzymes and transformations
encompassed by the Wood-Ljungdahl pathway. H.sub.2-dependent
conversion of CO.sub.2 to acetate by microorganisms was recognized
long before it was revealed that CO also could be used by the same
organisms and that the same pathways were involved. Many acetogens
have been shown to grow in the presence of CO.sub.2 and produce
compounds such as acetate as long as hydrogen is present to supply
the necessary reducing equivalents (see for example, Drake,
Acetogenesis, pp. 3-60 Chapman and Hall, New York, (1994)). This
can be summarized by the following equation:
2CO.sub.2+4H.sub.2+nADP+nPi.fwdarw.CH.sub.3COOH+2H.sub.2O+nATP
[0226] Hence, non-naturally occurring microorganisms possessing the
Wood-Ljungdahl pathway can utilize CO.sub.2 and H.sub.2 mixtures as
well for the production of acetyl-CoA and other desired
products.
[0227] The Wood-Ljungdahl pathway is well known in the art and
consists of 12 reactions which can be separated into two branches:
(1) methyl branch and (2) carbonyl branch. The methyl branch
converts syngas to methyl-tetrahydrofolate (methyl-THF) whereas the
carbonyl branch converts methyl-THF to acetyl-CoA. The reactions in
the methyl branch are catalyzed in order by the following enzymes
or proteins: ferredoxin oxidoreductase, formate dehydrogenase,
formyltetrahydrofolate synthetase, methenyltetrahydrofolate
cyclodehydratase, methylenetetrahydrofolate dehydrogenase and
methylenetetrahydrofolate reductase. The reactions in the carbonyl
branch are catalyzed in order by the following enzymes or proteins:
methyltetrahydrofolate:corrinoid protein methyltransferase (for
example, AcsE), corrinoid iron-sulfur protein, nickel-protein
assembly protein (for example, AcsF), ferredoxin, acetyl-CoA
synthase, carbon monoxide dehydrogenase and nickel-protein assembly
protein (for example, CooC). Following the teachings and guidance
provided herein for introducing a sufficient number of encoding
nucleic acids to generate a muconate pathway, those skilled in the
art will understand that the same engineering design also can be
performed with respect to introducing at least the nucleic acids
encoding the Wood-Ljungdahl enzymes or proteins absent in the host
organism. Therefore, introduction of one or more encoding nucleic
acids into the microbial organisms of the invention such that the
modified organism contains the complete Wood-Ljungdahl pathway will
confer syngas utilization ability.
[0228] Accordingly, given the teachings and guidance provided
herein, those skilled in the art will understand that a
non-naturally occurring microbial organism can be produced that
secretes the biosynthesized compounds of the invention when grown
on a carbon source such as a carbohydrate. Such compounds include,
for example, muconate and any of the intermediate metabolites in
the muconate pathway. All that is required is to engineer in one or
more of the required enzyme or protein activities to achieve
biosynthesis of the desired compound or intermediate including, for
example, inclusion of some or all of the muconate biosynthetic
pathways. Accordingly, the invention provides a non-naturally
occurring microbial organism that produces and/or secretes muconate
when grown on a carbohydrate or other carbon source and produces
and/or secretes any of the intermediate metabolites shown in the
muconate pathway when grown on a carbohydrate or other carbon
source. The muconate producing microbial organisms of the invention
can initiate synthesis from an intermediate, such as any of the
intermediates shown in FIGS. 2-5.
[0229] The non-naturally occurring microbial organisms of the
invention are constructed using methods well known in the art as
exemplified herein to exogenously express at least one nucleic acid
encoding a muconate pathway enzyme or protein in sufficient amounts
to produce muconate. It is understood that the microbial organisms
of the invention are cultured under conditions sufficient to
produce muconate. Following the teachings and guidance provided
herein, the non-naturally occurring microbial organisms of the
invention can achieve biosynthesis of muconate resulting in
intracellular concentrations between about 0.1-200 mM or more.
Generally, the intracellular concentration of muconate is between
about 3-150 mM, particularly between about 5-200 mM and more
particularly between about 8-150 mM, including about 10 mM, 50 mM,
75 mM, 100 mM, or more. Intracellular concentrations between and
above each of these exemplary ranges also can be achieved from the
non-naturally occurring microbial organisms of the invention.
[0230] In some embodiments, culture conditions include anaerobic or
substantially anaerobic growth or maintenance conditions. Exemplary
anaerobic conditions have been described previously and are well
known in the art. Exemplary anaerobic conditions for fermentation
processes are described herein and are described, for example, in
U.S. patent application Ser. No. 11/891,602, filed Aug. 10, 2007.
Any of these conditions can be employed with the non-naturally
occurring microbial organisms as well as other anaerobic conditions
well known in the art. Under such anaerobic conditions, the
muconate producers can synthesize muconate at intracellular
concentrations of 5-10 mM or more as well as all other
concentrations exemplified herein. It is understood that, even
though the above description refers to intracellular
concentrations, muconate producing microbial organisms can produce
muconate intracellularly and/or secrete the product into the
culture medium.
[0231] The culture conditions can include, for example, liquid
culture procedures as well as fermentation and other large scale
culture procedures. As described herein, particularly useful yields
of the biosynthetic products of the invention can be obtained under
anaerobic or substantially anaerobic culture conditions.
[0232] As described herein, one exemplary growth condition for
achieving biosynthesis of muconate includes anaerobic culture or
fermentation conditions. In certain embodiments, the non-naturally
occurring microbial organisms of the invention can be sustained,
cultured or fermented under anaerobic or substantially anaerobic
conditions. Briefly, anaerobic conditions refers to an environment
devoid of oxygen. Substantially anaerobic conditions include, for
example, a culture, batch fermentation or continuous fermentation
such that the dissolved oxygen concentration in the medium remains
between 0 and 10% of saturation. Substantially anaerobic conditions
also includes growing or resting cells in liquid medium or on solid
agar inside a sealed chamber maintained with an atmosphere of less
than 1% oxygen. The percent of oxygen can be maintained by, for
example, sparging the culture with an N.sub.2/CO.sub.2 mixture or
other suitable non-oxygen gas or gases.
[0233] The culture conditions described herein can be scaled up and
grown continuously for manufacturing of muconate. Exemplary growth
procedures include, for example, fed-batch fermentation and batch
separation; fed-batch fermentation and continuous separation, or
continuous fermentation and continuous separation. All of these
processes are well known in the art. Fermentation procedures are
particularly useful for the biosynthetic production of commercial
quantities of muconate. Generally, and as with non-continuous
culture procedures, the continuous and/or near-continuous
production of muconate will include culturing a non-naturally
occurring muconate producing organism of the invention in
sufficient nutrients and medium to sustain and/or nearly sustain
growth in an exponential phase. Continuous culture under such
conditions can be include, for example, 1 day, 2, 3, 4, 5, 6 or 7
days or more. Additionally, continuous culture can include 1 week,
2, 3, 4 or 5 or more weeks and up to several months. Alternatively,
organisms of the invention can be cultured for hours, if suitable
for a particular application. It is to be understood that the
continuous and/or near-continuous culture conditions also can
include all time intervals in between these exemplary periods. It
is further understood that the time of culturing the microbial
organism of the invention is for a sufficient period of time to
produce a sufficient amount of product for a desired purpose.
[0234] Fermentation procedures are well known in the art. Briefly,
fermentation for the biosynthetic production of muconate can be
utilized in, for example, fed-batch fermentation and batch
separation; fed-batch fermentation and continuous separation, or
continuous fermentation and continuous separation. Examples of
batch and continuous fermentation procedures are well known in the
art.
[0235] In addition to the above fermentation procedures using the
muconate producers of the invention for continuous production of
substantial quantities of muconate, the muconate producers also can
be, for example, simultaneously subjected to chemical synthesis
procedures to convert the product to other compounds or the product
can be separated from the fermentation culture and sequentially
subjected to chemical conversion to convert the product to other
compounds, if desired.
[0236] In addition to the above procedures, growth condition for
achieving biosynthesis of muconate can include the addition of an
osmoprotectant to the culturing conditions. In certain embodiments,
the non-naturally occurring microbial organisms of the invention
can be sustained, cultured or fermented as described above in the
presence of an osmoprotectant. Briefly, an osmoprotectant means a
compound that acts as an osmolyte and helps a microbial organism as
described herein survive osmotic stress. Osmoprotectants include,
but are not limited to, betaines, amino acids, and the sugar
trehalose. Non-limiting examples of such are glycine betaine,
praline betaine, dimethylthetin, dimethylslfonioproprionate,
3-dimethylsulfonio-2-methylproprionate, pipecolic acid,
dimethylsulfonioacetate, choline, L-carnitine and ectoine. In one
aspect, the osmoprotectant is glycine betaine. It is understood to
one of ordinary skill in the art that the amount and type of
osmoprotectant suitable for protecting a microbial organism
described herein from osmotic stress will depend on the microbial
organism used. The amount of osmoprotectant in the culturing
conditions can be, for example, no more than about 0.1 mM, no more
than about 0.5 mM, no more than about 1.0 mM, no more than about
1.5 mM, no more than about 2.0 mM, no more than about 2.5 mM, no
more than about 3.0 mM, no more than about 5.0 mM, no more than
about 7.0 mM, no more than about 10 mM, no more than about 50 mM,
no more than about 100 mM or no more than about 500 mM.
[0237] To generate better producers, metabolic modeling can be
utilized to optimize growth conditions. Modeling can also be used
to design gene knockouts that additionally optimize utilization of
the pathway (see, for example, U.S. patent publications US
2002/0012939, US 2003/0224363, US 2004/0029149, US 2004/0072723, US
2003/0059792, US 2002/0168654 and US 2004/0009466, and U.S. Pat.
No. 7,127,379). Modeling analysis allows reliable predictions of
the effects on cell growth of shifting the metabolism towards more
efficient production of muconate.
[0238] One computational method for identifying and designing
metabolic alterations favoring biosynthesis of a desired product is
the OptKnock computational framework (Burgard et al., Biotechnol.
Bioeng. 84:647-657 (2003)). OptKnock is a metabolic modeling and
simulation program that suggests gene deletion or disruption
strategies that result in genetically stable microorganisms which
overproduce the target product. Specifically, the framework
examines the complete metabolic and/or biochemical network of a
microorganism in order to suggest genetic manipulations that force
the desired biochemical to become an obligatory byproduct of cell
growth. By coupling biochemical production with cell growth through
strategically placed gene deletions or other functional gene
disruption, the growth selection pressures imposed on the
engineered strains after long periods of time in a bioreactor lead
to improvements in performance as a result of the compulsory
growth-coupled biochemical production. Lastly, when gene deletions
are constructed there is a negligible possibility of the designed
strains reverting to their wild-type states because the genes
selected by OptKnock are to be completely removed from the genome.
Therefore, this computational methodology can be used to either
identify alternative pathways that lead to biosynthesis of a
desired product or used in connection with the non-naturally
occurring microbial organisms for further optimization of
biosynthesis of a desired product.
[0239] Briefly, OptKnock is a term used herein to refer to a
computational method and system for modeling cellular metabolism.
The OptKnock program relates to a framework of models and methods
that incorporate particular constraints into flux balance analysis
(FBA) models. These constraints include, for example, qualitative
kinetic information, qualitative regulatory information, and/or DNA
microarray experimental data. OptKnock also computes solutions to
various metabolic problems by, for example, tightening the flux
boundaries derived through flux balance models and subsequently
probing the performance limits of metabolic networks in the
presence of gene additions or deletions. OptKnock computational
framework allows the construction of model formulations that enable
an effective query of the performance limits of metabolic networks
and provides methods for solving the resulting mixed-integer linear
programming problems. The metabolic modeling and simulation methods
referred to herein as OptKnock are described in, for example, U.S.
publication 2002/0168654, filed Jan. 10, 2002, in International
Patent No. PCT/US02/00660, filed Jan. 10, 2002, and U.S.
publication 2009/0047719, filed Aug. 10, 2007.
[0240] Another computational method for identifying and designing
metabolic alterations favoring biosynthetic production of a product
is a metabolic modeling and simulation system termed SimPheny.RTM..
This computational method and system is described in, for example,
U.S. publication 2003/0233218, filed Jun. 14, 2002, and in
International Patent Application No. PCT/US03/18838, filed Jun. 13,
2003. SimPheny.RTM. is a computational system that can be used to
produce a network model in silico and to simulate the flux of mass,
energy or charge through the chemical reactions of a biological
system to define a solution space that contains any and all
possible functionalities of the chemical reactions in the system,
thereby determining a range of allowed activities for the
biological system. This approach is referred to as
constraints-based modeling because the solution space is defined by
constraints such as the known stoichiometry of the included
reactions as well as reaction thermodynamic and capacity
constraints associated with maximum fluxes through reactions. The
space defined by these constraints can be interrogated to determine
the phenotypic capabilities and behavior of the biological system
or of its biochemical components.
[0241] These computational approaches are consistent with
biological realities because biological systems are flexible and
can reach the same result in many different ways. Biological
systems are designed through evolutionary mechanisms that have been
restricted by fundamental constraints that all living systems must
face. Therefore, constraints-based modeling strategy embraces these
general realities. Further, the ability to continuously impose
further restrictions on a network model via the tightening of
constraints results in a reduction in the size of the solution
space, thereby enhancing the precision with which physiological
performance or phenotype can be predicted.
[0242] Given the teachings and guidance provided herein, those
skilled in the art will be able to apply various computational
frameworks for metabolic modeling and simulation to design and
implement biosynthesis of a desired compound in host microbial
organisms. Such metabolic modeling and simulation methods include,
for example, the computational systems exemplified above as
SimPheny.RTM. and OptKnock. For illustration of the invention, some
methods are described herein with reference to the OptKnock
computation framework for modeling and simulation. Those skilled in
the art will know how to apply the identification, design and
implementation of the metabolic alterations using OptKnock to any
of such other metabolic modeling and simulation computational
frameworks and methods well known in the art.
[0243] The methods described above will provide one set of
metabolic reactions to disrupt. Elimination of each reaction within
the set or metabolic modification can result in a desired product
as an obligatory product during the growth phase of the organism.
Because the reactions are known, a solution to the bilevel OptKnock
problem also will provide the associated gene or genes encoding one
or more enzymes that catalyze each reaction within the set of
reactions. Identification of a set of reactions and their
corresponding genes encoding the enzymes participating in each
reaction is generally an automated process, accomplished through
correlation of the reactions with a reaction database having a
relationship between enzymes and encoding genes.
[0244] Once identified, the set of reactions that are to be
disrupted in order to achieve production of a desired product are
implemented in the target cell or organism by functional disruption
of at least one gene encoding each metabolic reaction within the
set. One particularly useful means to achieve functional disruption
of the reaction set is by deletion of each encoding gene. However,
in some instances, it can be beneficial to disrupt the reaction by
other genetic aberrations including, for example, mutation,
deletion of regulatory regions such as promoters or cis binding
sites for regulatory factors, or by truncation of the coding
sequence at any of a number of locations. These latter aberrations,
resulting in less than total deletion of the gene set can be
useful, for example, when rapid assessments of the coupling of a
product are desired or when genetic reversion is less likely to
occur.
[0245] To identify additional productive solutions to the above
described bilevel OptKnock problem which lead to further sets of
reactions to disrupt or metabolic modifications that can result in
the biosynthesis, including growth-coupled biosynthesis of a
desired product, an optimization method, termed integer cuts, can
be implemented. This method proceeds by iteratively solving the
OptKnock problem exemplified above with the incorporation of an
additional constraint referred to as an integer cut at each
iteration. Integer cut constraints effectively prevent the solution
procedure from choosing the exact same set of reactions identified
in any previous iteration that obligatorily couples product
biosynthesis to growth. For example, if a previously identified
growth-coupled metabolic modification specifies reactions 1, 2, and
3 for disruption, then the following constraint prevents the same
reactions from being simultaneously considered in subsequent
solutions. The integer cut method is well known in the art and can
be found described in, for example, Burgard et al., Biotechnol.
Prog. 17:791-797 (2001). As with all methods described herein with
reference to their use in combination with the OptKnock
computational framework for metabolic modeling and simulation, the
integer cut method of reducing redundancy in iterative
computational analysis also can be applied with other computational
frameworks well known in the art including, for example,
SimPheny.RTM..
[0246] The methods exemplified herein allow the construction of
cells and organisms that biosynthetically produce a desired
product, including the obligatory coupling of production of a
target biochemical product to growth of the cell or organism
engineered to harbor the identified genetic alterations. Therefore,
the computational methods described herein allow the identification
and implementation of metabolic modifications that are identified
by an in silico method selected from OptKnock or SimPheny.RTM.. The
set of metabolic modifications can include, for example, addition
of one or more biosynthetic pathway enzymes and/or functional
disruption of one or more metabolic reactions including, for
example, disruption by gene deletion.
[0247] As discussed above, the OptKnock methodology was developed
on the premise that mutant microbial networks can be evolved
towards their computationally predicted maximum-growth phenotypes
when subjected to long periods of growth selection. In other words,
the approach leverages an organism's ability to self-optimize under
selective pressures. The OptKnock framework allows for the
exhaustive enumeration of gene deletion combinations that force a
coupling between biochemical production and cell growth based on
network stoichiometry. The identification of optimal gene/reaction
knockouts requires the solution of a bilevel optimization problem
that chooses the set of active reactions such that an optimal
growth solution for the resulting network overproduces the
biochemical of interest (Burgard et al., Biotechnol. Bioeng.
84:647-657 (2003)).
[0248] An in silico stoichiometric model of E. coli metabolism can
be employed to identify essential genes for metabolic pathways as
exemplified previously and described in, for example, U.S. patent
publications US 2002/0012939, US 2003/0224363, US 2004/0029149, US
2004/0072723, US 2003/0059792, US 2002/0168654 and US 2004/0009466,
and in U.S. Pat. No. 7,127,379. As disclosed herein, the OptKnock
mathematical framework can be applied to pinpoint gene deletions
leading to the growth-coupled production of a desired product.
Further, the solution of the bilevel OptKnock problem provides only
one set of deletions. To enumerate all meaningful solutions, that
is, all sets of knockouts leading to growth-coupled production
formation, an optimization technique, termed integer cuts, can be
implemented. This entails iteratively solving the OptKnock problem
with the incorporation of an additional constraint referred to as
an integer cut at each iteration, as discussed above.
[0249] It is understood that modifications which do not
substantially affect the activity of the various embodiments of
this invention are also provided within the definition of the
invention provided herein. Accordingly, the following examples are
intended to illustrate but not limit the present invention.
Example I
Demonstration of Enzyme Activity for Condensing Succinyl-CoA and
Acetyl-CoA to Form .beta.-ketoadipyl-CoA
[0250] This Example shows the identification of enzymes for the
formation of beta-ketoadipyl-CoA from succinyl-CoA and
acetyl-CoA.
[0251] Several .beta.-ketothiolase enzymes have been shown to break
.beta.-ketoadipyl-CoA into acetyl-CoA and succinyl-CoA. For
example, the gene products encoded by pcaF in Pseudomonas strain
B13 (Kaschabek et al., J. Bacteriol. 184(1): 207-15 (2002)), phaD
in Pseudomonas putida U (Olivera et al., Proc Natl Acad Sci USA,
95(11), 6419-24 (1998)), paaE in Pseudomonas fluorescens ST (Di
Gennaro et al., Arch Microbiol, 188(2), 117-25 (2007)), and paaJ
from E. coli (Nogales et al., Microbiology 153(Pt 2), 357-65
(2007)) catalyze the conversion of 3-oxoadipyl-CoA into
succinyl-CoA and acetyl-CoA during the degradation of aromatic
compounds such as phenylacetate or styrene. To confirm that
.beta.-ketothiolase enzymes exhibit condensation activity, several
thiolases (Table 53) were cloned into a derivative of pZE13(Lutz et
al., Nucleic Acids Res, 29(18), 3873-81 (2001)), which results in
the clones having a carboxy-terminal 6.times.His tag.
TABLE-US-00053 TABLE 53 Cloned Thiolases Species Enzyme template
Gene Length 5' PRIMER 3' PRIMER ORF SEQ beta- Ralstonia bktB 1185
ATGACGCGTG GATACGCTCGA atgacgcgtgaagtggtagtggtaagcggtgtccg
ketothiolase eutropha AAGTGGTAGT AGATGGCGG
taccgcgatcgggacctttggcggcagcctgaagg H16 GGTAAG
atgtggcaccggcggagctgggcgcactggtggtg
cgcgaggcgctggcgcgcgcgcaggtgtcgggcga
cgatgtcggccacgtggtattcggcaacgtgatcc
agaccgagccgcgcgacatgtatctgggccgcgtc
gcggccgtcaacggcggggtgacgatcaacgcccc
cgcgctgaccgtgaaccgcctgtgcggctcgggcc
tgcaggccattgtcagcgccgcgcagaccatcctg
ctgggcgataccgacgtcgccatcggcggcggcgc
ggaaagcatgagccgcgcaccgtacctggcgccgg
cagcgcgctggggcgcacgcatgggcgacgccggc
ctggtcgacatgatgctgggtgcgctgcacgatcc
cttccatcgcatccacatgggcgtgaccgccgaga
atgtcgccaaggaatacgacatctcgcgcgcgcag
caggacgaggccgcgctggaatcgcaccgccgcgc
ttcggcagcgatcaaggccggctacttcaaggacc
agatcgtcccggtggtgagcaagggccgcaagggc
gacgtgaccttcgacaccgacgagcacgtgcgcca
tgacgccaccatcgacgacatgaccaagctcaggc
cggtcttcgtcaaggaaaacggcacggtcacggcc
ggcaatgcctcgggcctgaacgacgccgccgccgc
ggtggtgatgatggagcgcgcgaagccgagcgccg
cggcctgaagccgctggcccgcctggtgtcgtacg
gccatgccggcgtggacccgaaggccatgggcatc
ggcccggtgccggcgacgaagatcgcgctggagcg
cgccggcctgcaggtgtcggacctggacgtgatcg
aagccaacgaagcctttgccgcacaggcgtgcgcc
gtgaccaaggcgctcggtctggacccggccaaggt
taacccgaacggctcgggcatctcgctgggccacc
cgatcggcgccaccggtgccctgatcacggtgaag
gcgctgcatgagctgaaccgcgtgcagggccgcta
cgcgctggtgacgatgtgcatcggcggcgggcagg gcattgccgccatcttcgagcgtatctga
2- Mus ACA 1215 ATGGAAGTAA CAGCTTCTCAAT
atggaagtaagatgcctggaacgaagttatgcatc Methylacetoa musculus T1
GATGCCTGGA CAGCAGGGC caaacccactttgaatgaagtggttatagtaagtg cetyl-CoA
ACGAAG ctataagaactcccattggatccttcctgggcagc Thiolase
cttgcctctcagccggccactaaacttggtactgc (branched
tgcaattcagggagccattgagaaggcagggattc chain?)
caaaagaagaagtgaaggaagtctacatgggcaat
gtcatccaagggggtgaaggacaggcccctaccag
gcaagcaacactgggcgcaggtttacctatttcca
ctccatgcaccacagtaaacaaggtttgtgcttca
ggaatgaaagccatcatgatggcctctcaaagtct
tatgtgtggacatcaggatgtgatggtggcaggcg
ggatggagagcatgtccaatgtcccatacgtaatg
agcagaggagcaacaccatatggtggggtaaaact
tgaagacctgattgtaaaagacgggctaactgatg
tctacaataaaattcatatgggtaactgtgctgag
aatactgcaaagaagatgaatatctcacggcagga
acaggatacgtacgctctcagctcttacaccagaa
gtaaagaagcgtgggacgcagggaagtttgccagt
gagattactcccatcaccatctcagtgaaaggtaa
accagatgtggtggtgaaagaagatgaagaataca
agcgtgttgactttagtaaagtgccaaagctcaag
accgtgttccagaaagaaaatggcacaataacagc
tgccaatgccagcacactgaacgatggagcagctg
ctctggttctcatgactgcagaggcagcccagagg
ctcaatgttaagccattggcacgaattgcagcatt
tgctgatgctgccgtagaccccattgattttccac
ttgcgcctgcatatgccgtacctaaggttcttaaa
tatgcaggactgaaaaaagaagacattgccatgtg
ggaagtaaatgaagcattcagtgtggttgtgctag
ccaacattaaaatgctggagattgacccccaaaaa
gtaaatatccacggaggagctgtttctctgggcca
tccaattgggatgtctggagcccggattgttgttc
atatggctcatgccctgaagccaggagagttcggt
ctggctagtatttgcaacggaggaggaggtgcttc cgccctgctgattgagaagctgtag 2-
Pseudomonas fadAx 1194 ATGACCCTCG GTACAGGCATTC
atgaccctcgccaatgaccccatcgttatcgtcag Methylacetoa putida CCAATGACCC
AACAGCCATGG cgccgtgcgcacgcccatgggcgggttgcagggcg cetyl-CoA (KT2440)
acctcaagagcctgactgcgccgcaactgggcagc Thiolase
gccgccattcgtgctgccgtggaacgggccggcat (branched
cgatgccgccggtgtcgagcaggtactgttcggct chain?)
gcgtgctgccggccggccagggccaggcaccggca
cgccaggccgcgctgggcgccgggctggacaagca
caccacctgcaccaccctgaacaagatgtgcggct
cgggtatgcaagccgcgatcatggcccatgacctg
ctgctggccggcaccgcagacgtggtagtggcggg
tggcatggaaagcatgaccaacgcgccgtacctgc
tggacaaagcccgtggcggctaccgcatgggccac
ggcaagatcatcgaccacatgttcatggacggtct
cgaagacgcctacgacaaaggccgcctgatgggta
cctttgccgaggactgtgcccaggccaatgccttc
agccgcgaggcccaggaccagttcgccatcgcctc
gctgacccgagcgcaggaagccatcagcagcggcc
gttttgccgccgagatcgtgccggtggaagtcacc
gagggcaaggaaaagcgcgtcatcaaggatgacga
gcagccgcccaaggcgcgtctggacaagattgcgc
agctcaaaccggcgtttcgtgaaggcggcaccgtg
acggcggccaacgccagttcgatttccgacggcgc
tgcggcgctggtactgatgcgccgctccgaggccg
acaaacgtggcctcaagccattggccgtcatccac
ggccacgccgcctttgccgacaccccggcgctgtt
cccgaccgccccgatcggcgcgatcgacaaactga
tgaaacgcaccggctggaacctggccgaagtcgac
ctgttcgagatcaacgaggccttcgccgtggtcac
cctggcggccatgaaacacctcgacctgccacacg
acaaggtcaatatccacggcggcgcctgcgccctc
ggtcacccgatcggcgcttctggcgcacgtattct
ggtcaccctgttgtcggccttgcgccagaacaatc
tgcgtcggggtgtggcggccatctgcatcggcggt
ggcgaggccacggccatggctgttgaatgcctgta ctga beta- Caenorhabditis kat-1
1167 ATGAACAAAC TAATTTCTGGAT atgaacaaacatgctttcatcgtcggagccgcccg
ketothiolase elegans ATGCTTTCATC AACCATTCCACT
tacacctattggatcatttcgttcttctctctctt GTCG TGAGC
cggtaactgctccagagctcgcctcggttgccatc
aaagcagcattggagcgtggagcagtgaagccgag
ttcaattcaggaggtgttccttggtcaagtctgtc
aagcaaatgctggtcaagctcccgctcgtcaagca
gctcttggagccggactcgatctttcggttgctgt
taccaccgtcaataaagtgtgctcttctgggctga
aagcaatcattcttgctgcccagcaaattcaaacc
ggtcatcaagattttgccattggcggaggaatgga
gagcatgtcacaagtaccattttatgttcaaagag
gagagatcccatatggtggatttcaagtgattgat
ggaatcgtcaaagacggactgaccgatgcttatga
taaagttcacatgggaaactgcggagagaagactt
caaaagaaatgggaattacacgtaaagaccaagac
gaatatgctatcaacagctacaaaaagtcagctaa
agcatgggagaatggaaatatcggaccagaagtgg
tgccagtgaacgtcaaatcaaagaagggagtcacg
attgttgataaagatgaagagttcacaaaagtcaa
tttcgacaagttcacctcgctgagaactgttttcc
agaaagacggaactatcactgctgctaatgcttca
acattgaacgacggtgcagctgctgtcattgttgc
ctcacaggaagcagtttccgagcaaagcttaaagc
ctctggcccgaattttggcttatggagatgccgcc
acgcacccactcgatttcgctgtagcaccaacttt
gatgttcccaaaaattcttgaaagagcaggagtga
agcaatcagatgttgctcaatgggaagttaatgaa
gccttctcatgtgttccccttgctttcatcaaaaa
actaggagtcgatccatcccttgtgaacccacatg
gaggagctgtttcaattggtcaccccatcggaatg
tccggagcccgcctcatcactcatcttgtgcacac
actcaaaagtggccaaatcggagttgctgccattt
gcaatggaggtggtggctcaagtggaatggttatc cagaaattataa beta- Escherichia
paaJ 1206 ATGCGTGAAG AACACGCTCCA
atgcgtgaagcctttatttgtgacggaattcgtac ketothiolase coli CCTTTATTTGT
GAATCATGGCG gccaattggtcgctacggcggggcattatcaagtg NP_415915.1 GACG
ttcgggctgatgatctggctgctatccctttgcgg
gaactgctggtgcgaaacccgcgtctcgatgcgga
gtgtatcgatgatgtgatcctcggctgtgctaatc
aggcgggagaagataaccgtaacgtagcccggatg
gcgactttactggcggggctgccgcagagtgtttc
cggcacaaccattaaccgcttgtgtggttccgggc
tggacgcactggggtttgccgcacgggcgattaaa
gcgggcgatggcgatttgctgatcgccggtggcgt
ggagtcaatgtcacgggcaccgtttgttatgggca
aggcagccagtgcattttctcgtcaggctgagatg
ttcgataccactattggctggcgatttgtgaaccc
gctcatggctcagcaatttggaactgacagcatgc
cggaaacggcagagaatgtagctgaactgttaaaa
atctcacgagaagatcaagatagttttgcgctacg
cagtcagcaacgtacggcaaaagcgcaatcctcag
gcattctggctgaggagattgttccggttgtgttg
aaaaacaagaaaggtgttgtaacagaaatacaaca
tgatgagcatctgcgcccggaaacgacgctggaac
agttacgtgggttaaaagcaccatttcgtgccaat
ggggtgattaccgcaggcaatgcttccggggtgaa
tgacggagccgctgcgttgattattgccagtgaac
agatggcagcagcgcaaggactgacaccgcgggcg
cgtatcgtagccatggcaaccgccggggtggaacc
gcgcctgatggggcttggtccggtgcctgcaactc
gccgggtgctggaacgcgcagggctgagtattcac
gatatggacgtgattgaactgaacgaagcgttcgc
ggcccaggcgttgggtgtactacgcgaattggggc
tgcctgatgatgccccacatgttaaccccaacgga
ggcgctatcgccttaggccatccgttgggaatgag
tggtgcccgcctggcactggctgccagccatgagc
tgcatcggcgtaacggtcgttacgcattgtgcacc
atgtgcatcggtgtcggtcagggcatcgccatgat tctggagcgtgtttga beta-
Pseudomonas phaD 1221 ATGAATGAAC GAGGCGCTCGA
atgaatgaaccgacccacgccgatgccttgatcat ketothiolase putida CGACCCACGC
TGATCATGG cgacgccgtgcgcacgcccattggccgctatgccg AAN68887.1 (KT2440) C
gggccctgagcagcgtgcgcgccgacgacctggcg
gccatcccgctcaaagccttgatccagcgtcaccc
cgaactggactggaaagccattgatgacgttatct
tcggctgtgccaaccaggctggcgaagacaaccgc
aacgtggcccacatggcgagcctgctggccgggct
gccactcgaagtaccagggaccacgatcaaccgcc
tgtgcggttccggtctggatgccatcggtaatgcg
gcacgtgccctgcgctgcggtgaagcggggctcat
gctggccggtggtgtggagtccatgtcgcgtgcac
cgtttgtgatgggtaagtcggagcaggcattcggg
cgtgcggccgagctgttcgacaccaccatcggctg
gcgtttcgtcaacccgctgatgaaggccgcctacg
gcatcgattcgatgccggaaacggctgaaaacgtg
gccgaacagttcggcatctcgcgcgccgaccagga
tgcctttgccctgcgcagccagcacaaagccgcag
cagctcaggcccgcggccgcctggcgcgggaaatc
gtgccggtcgaaatcccgcaacgcaaaggcccagc
caaagtggtcgagcatgacgagcacccgcgcggcg
acacgaccctggagcagctggctcggctcgggacg
ccgtttcgtgaaggcggcagcgtaacggcgggtaa
tgcctccggcgtgaatgacggcgcttgcgccctgc
tgctggccagcagcgccgcggcccgccgccatggg
ttgaaggcccgcggccgcatcgtcggcatggcggt
ggccggggttgagcccaggctgatgggcattggtc
cggtgcctgcgacccgcaaggtgctggcgctcacc
ggcctggcactggctgacctggatgtcatcgaact
caatgaggcctttgccgcccaagggctggccgtgt
tgcgcgagctgggcctggccgacgacgacccgcga
gtcaaccgcaacggcggcgccatcgccctgggcca
tcccctgggcatgagcggtgcccggttggtgacca
ctgccttgcacgagcttgaagaaacggccggccgc
tacgccctgtgcaccatgtgcatcggcgtaggcca aggcattgccatgatcatcgagcgcctctga
beta- Clostridium thiA 1179 ATGAAAGAAG GCACTTTTCTAG
atgaaagaagttgtaatagctagtgcagtaagaac ketothiolase acetobutylicum
TTGTAATAGCT CAATATTGCTGT agcgattggatcttatggaaagtctcttaaggatg
NP_349476.1 ATCC 824 AGTGCAGTAA TCC
taccagcagtagatttaggagctacagctataaag GAAC
gaagcagttaaaaaagcaggaataaaaccagagga
tgttaatgaagtcattttaggaaatgttcttcaag
caggtttaggacagaatccagcaagacaggcatct
tttaaagcaggattaccagttgaaattccagctat
gactattaataaggtttgtggttcaggacttagaa
cagttagcttagcagcacaaattataaaagcagga
gatgctgacgtaataatagcaggtggtatggaaaa
tatgtctagagctccttacttagcgaataacgcta
gatggggatatagaatgggaaacgctaaatttgtt
gatgaaatgatcactgacggattgtgggatgcatt
taatgattaccacatgggaataacagcagaaaaca
tagctgagagatggaacatttcaagagaagaacaa
gatgagtttgctcttgcatcacaaaaaaaagctga
agaagctataaaatcaggtcaatttaaagatgaaa
tagttcctgtagtaattaaaggcagaaagggagaa
actgtagttgatacagatgagcaccctagatttgg
atcaactatagaaggacttgcaaaattaaaacctg
ccttcaaaaaagatggaacagttacagctggtaat
gcatcaggattaaatgactgtgcagcagtacttgt
aatcatgagtgcagaaaaagctaaagagcttggag
taaaaccacttgctaagatagtttcttatggttca
gcaggagttgacccagcaataatgggatatggacc
tttctatgcaacaaaagcagctattgaaaaagcag
gttggacagttgatgaattagatttaatagaatca
aatgaagcttttgcagctcaaagtttagcagtagc
aaaagatttaaaatttgatatgaataaagtaaatg
taaatggaggagctattgcccttggtcatccaatt
ggagcatcaggtgcaagaatactcgttactcttgt
acacgcaatgcaaaaaagagatgcaaaaaaaggct
tagcaactttatgtataggtggcggacaaggaaca gcaatattgctagaaaagtgctag beta-
Clostridium thiB 1179 ATGAGAGATG GTCTCTTTCAAC
atgagagatgtagtaatagtaagtgctgtaagaac ketothiolase acetobutylicum
TAGTAATAGT TACGAGAGCTGT tgcaataggagcatatggaaaaacattaaaggatg
NP_149242.1 ATCC 824 AAGTGCTGTA TCCC
tacctgcaacagagttaggagctatagtaataaag AGAACTG
gaagctgtaagaagagctaatataaatccaaatga
gattaatgaagttatttttggaaatgtacttcaag
ctggattaggccaaaacccagcaagacaagcagca
gtaaaagcaggattacctttagaaacacctgcgtt
tacaatcaataaggtttgtggttcaggtttaagat
ctataagtttagcagctcaaattataaaagctgga
gatgctgataccattgtagtaggtggtatggaaaa
tatgtctagatcaccatatttgattaacaatcaga
gatggggtcaaagaatgggagatagtgaattagtt
gatgaaatgataaaggatggtttgtgggatgcatt
taatggatatcatatgggagtaactgcagaaaata
ttgcagaacaatggaatataacaagagaagagcaa
gatgaattttcacttatgtcacaacaaaaagctga
aaaagccattaaaaatggagaatttaaggatgaaa
tagttcctgtattaataaagactaaaaaaggtgaa
atagtctttgatcaagatgaatttcctagattcgg
aaacactattgaagcattaagaaaacttaaaccta
ttttcaaggaaaatggtactgttacagcaggtaat
gcatccggattaaatgatggagctgcagcactagt
aataatgagcgctgataaagctaacgctctcggaa
taaaaccacttgctaagattacttcttacggatca
tatggggtagatccatcaataatgggatatggagc
tttttatgcaactaaagctgccttagataaaatta
atttaaaacctgaagacttagatttaattgaagct
aacgaggcatatgcttctcaaagtatagcagtaac
tagagatttaaatttagatatgagtaaagttaatg
ttaatggtggagctatagcacttggacatccaata
ggtgcatctggtgcacgtattttagtaacattact
atacgctatgcaaaaaagagattcaaaaaaaggtc
ttgctactctatgtattggtggaggtcagggaaca gctctcgtagttgaaagagactaa
3-oxoadipyl- Candida POT9 1182 ATGTTCAAGA CTCGTTAGCAAA
atgttcaagaaatcagctaatgatattgttgttat CoA thiolase albicans 8
AATCAGCTAA CAAGGCAGCG tgcagcaaagagaactccaatcaccaagtcaatta SC5314
TGATATTGTTG aaggtgggttgagtagattatttcctgaggaaata
ttatatcaagtggttaagggtactgtatcagattc
acaagttgatttaaacttgattgatgatgtgttag
tcggtacggtcttgcaaactttagggggacagaaa
gctagtgccttggccattaaaaagattggattccc
aattaagaccacggttaatacggtcaatcgtcaat
gtgctagttctgctcaagcgattacttatcaagca
ggtagtttgcgtagtggggagaatcaatttgctat
tgctgctggagtagaaagtatgactcatgattatt
ttcctcatcgtgggattcccacaagaatttctgaa
tcatttttagctgatgcatccgatgaagctaaaaa
cgtcttgatgccaatggggataaccagtgaaaatg
ttgccactaaatatggaatttctcgtaaacaacaa
gatgagtttgcccttaattctcatttgaaagcaga
caaggctacaaaactgggtcattttgcaaaagaaa
tcattcctattcaaacaacggatgaaaacaaccaa
cacgtttcaataaccaaagatgatggtataagggg
aagttcaacaattgaaaagttgggtggcttaaaac
ctgtgttcaaggatgatgggactactactgctggt
aattcctcgcaaatttcagatggagggtctgctgt
gattttaactactcgtcaaaatgctgagaaatcgg
gagtaaagccaatagctagatttattggttcgtca
gtagctggtgttccttcgggacttatgggaattgg
tccatcggctgctattcctcaattgttgtcgagat
taaatgttgacacgaaagacattgatatttttgaa
ttgaacgaggcatttgcatcccaactgatttattg
tattgaaaaattgggtcttgattatgataaagtca
atccatatggtggagctatagccttgggacatcca
ttaggagccactggcgcaagagttacggcaacgtt
gcttaatggattaaaagatcagaataaagagttgg
gtgtcatctcaatgtgcacatccacaggtcaagga tacgctgccttgtttgctaacgagtag
3-oxoadipyl- Candida POT1 1227 ATGGATAGAT TTCCTTAATCAA
atggatagattaaatcaattaagtggtcaattaaa CoA thiolase albicans
TAAATCAATT TATGGAGGCAG accaacttcaaaacaatcccttactcaaaagaacc SC5314
AAGTGGTCAA CAC cagacgatgttgtcatcgttgcagcatacagaact TTAAAACC
gccatcggtaaaggtttcaaagggtctttcaaatc
tgtgcaatctgaattcatcttgactgaattcttga
aagaatttattaaaaagactggagtcgatgcatct
ttgattgaagatgttgctattggtaacgttttgaa
ccaagctgctggtgccaccgaacacagaggtgcta
gtttggctgcaggtattccttacactgcagctttc
cttgccatcaacagattgtgttcctcagggttaat
ggccatttctgacattgccaacaaaatcaaaaccg
gtgaaatcgaatgtggtcttgctggtggtattgaa
tccatgtctaaaaactatggtagtccaaaagttat
tccaaagattgacccacacttggctgatgacgaac
aaatgagtaaatgtttgattccaatgggtatcacc
aacgaaaatgttgctaatgaattcaacattccaag
agaaaaacaagatgcctttgctgctaaatcttata
gtaaagccgaaaaagccatctcctctggagctttc
aaagatgaaatcttaccaatcagatccattatcag
atccccagacggttctgaaaaagaaatcattgtcg
ataccgacgaaggtccaagaaagggtgttgacgct
gcttccttgagcaaattgaaaccagcatttggtgg
tactaccactgccggtaacgcttctcaaatttcag
atggtgctgctggtgttttattgatgaagagaagt
ttggctgaagccaaaggttacccaattgttgctaa
atacattgcttgttcaactgttggtgttccgccag
aaatcatgggtgttggtccagcttacgccattcca
gaagtgttgaagagaactggattgactgtggatga
cgttgatgtgtttgaaatcaacgaagcttttgctg
ctcaatgtctttactcagctgaacaatgtaatgtt
ccagaagaaaaattgaacataaacggtggtgccat
cgctttaggtcatcctcttggttgtactggtgcca
gacaatatgccactatcttgagattgttgaaacca
ggtgaaattggtttgacttctatgtgtatcggtag
tggtatgggtgctgcctccatattgattaaggaat ag 3-oxoadipyl- Candida POT2
1233 ATGTCATCCA TTCTCTAACCAA atgtcatccaaacaacaatacttgaagaagaatcc
CoA thiolase albicans AACAACAATA AACAGAAGCAG
tgacgatgtcgttgtcgttgcagcatacagaactg SC5314 CTTGAAGAAG CACC
ctttaaccaaaggtggaagaggtggattcaaagat
gttggatctgatttccttttgaaaaaattgactga
agaatttgttaaaaaaactggtgttgaccctaaaa
tcattcaagatgctgccattggtaatgtcttgaac
agaagagctggtgatttcgaacatagaggtgcatt
attatctgctggattaccttattcagttccatttg
ttgcccttaacagacaatgttcatctgggttaatg
gccatttctcaagtggccaacaagatcaagactgg
tgaaattgaatgtggtttagctggtggtgttgaaa
gtatgacaaaaaactatggtccagaagcattgatt
gctattgaccctgcttatgaaaaagacccagaatt
tgttaaaaacggtattccaatgggtattactaatg
aaaatgtttgtgccaaattcaatatttcaagagat
gttcaagatcaatttgctgctgaatcttatcaaaa
agctgaaaaggcacaaaaagaaggtaaatttgatg
atgaaattttaccaattgaagttttccaagaagat
gaagatgctgaagatgaagacgaagatgaagatga
agatgctgaaccaaaagaaaaattggttgttatta
gtaaagatgaaggtattagaccaggtgttactaaa
gaaaaattggctaaaattaaaccagctttcaaatc
tgatggtgtatcttcagctggtaactcttcacaag
tttccgatggtgctgccttggtgttattgatgaaa
cgttcatttgctgaaaagaatggattcaaaccatt
ggctaaatacatttcttgtggtgttgctggtgtcc
caccagaaattatgggtattggtccagctgttgcc
attccaaaagttttgaaacaaactggattatcagt
cagtgatattgatatttatgaaatcaatgaagcat
ttgccggtcaatgtttgtactcaattgaaagttgt
aatattccaagagaaaaagtcaatcttaatggggg
tgctattgccttgggtcaccctcttggttgtactg
gtgctagacaatacgctactattttaagattgtta
aaaccaggtgaatttggtgtgacttctatgtgtat
tggtactggtatgggtgctgcttctgttttggtta gagaataa beta- Pseudomonas pcaF
1206 ATGAGCCGCG GACCCGCTCGAT atgagccgcgaggtattcatctgcgatgccgtgcg
ketoadipyl aeruginosa AGGTATTCAT GGCCAG
cacgccgatcggccgtttcggcggcagtctttccg CoA thiolase PAO1 CTG
cggtgcgcgccgacgacctcgcggcggtgccgctg pcaF
aaggccctggtcgagcgcaacccgggggtcgactg
gtcggcgttggacgaggtgttcctcggctgcgcca
accaggccggcgaggacaaccgtaacgtggcgcgc
atggcgctgctgctggccggtttgccggagagcgt
gcccggcgtcaccctcaaccgcctctgcgcctcgg
ggatggacgccatcggcacggcgttccgcgccatc
gcctgcggcgagatggagctggccatcgccggcgg
cgtcgagtcgatgtcgcgcgcgccgtacgtgatgg
gcaaggccgatagcgccttcggtcgcggccagaag
atcgaggacaccaccatcggctggcgcttcgtcaa
tccgctgatgaaggagcagtacggcatcgacccga
tgccgcagaccgccgacaacgtcgccgacgactat
cgcgtgtcgcgtgccgaccaggatgccttcgccct
gcgcagccagcagcgcgccggcagggcgcaggagg
ccggtttcttcgccgaggaaatcgtcccggtgacg
attcgcgggcgcaagggcgacaccctggtcgagca
cgacgagcatccgcgtcccgacaccaccctggagg
cgctggcccggctcaagccggtcaacgggccggag
aagaccgtcaccgccggcaacgcgtccggggtcaa
cgacggcgccgccgcgctggtcctggcctccgccg
aggcagtggagaagcacggcctgactccgcgcgcg
cgggtgctgggcatggccagcgccggcgtcgcccc
acggatcatgggcatcggcccggtgccggcggtgc
gcaagctgctgcggcgcctggacctggcgatcgac
gccttcgacgtgatcgaactcaacgaagccttcgc
cagccagggcctggcctgcctgcgcgaactgggcg
tggccgacgacagtgagaaggtcaacccgaacggc
ggtgccatcgccctcggccacccgctggggatgag
cggtgcgcggctggtcctcaccgcgctccatcaac
ttgagaagagcggcggccggcgcggcctggcgacc
atgtgcgtaggcgtcggccaaggcctggcgctggc catcgagcgggtctga acyl-CoA
Pseudomonas bkt 1206 ATGCTCGATG TCGGCAGCGCTC
atgctcgatgcctatatctacgccggcctgcgtac thiolase aeruginosa CCTATATCTAC
GATCAC gcctttcggccggcatgccggtgcactctcgacgg PAO1 GCC
tgcgtccggacgacctggccggcctgctgctggcg
cgtctcgcggaaacctccgggttcgccgtcgacga
cctggaggatgtgatcctcggttgcaccaaccagg
ccggcgaagacagccgcaacctggcgcgcaacgcg
ctgctcgcagccggcctgccggcgcggctgcccgg
gcagacggtcaaccgcttgtgtgccagcggactgt
cggcggtgatcgacgcggcgcgcgcgatcagttgc
ggtgagggccggctgtacctggccggcggcgccga
aagcatgtcccgggcgccgttcgtcatgggcaagg
cggagagcgccttcagccgcacgctggaggtcttc
gacagcaccatcggcgcgcgcttcgccaaccccag
gctggtcgagcgctatggcaacgacagcatgccgg
agaccggcgacaacgtggcccgcgccttcggcatc
gcccgcgaagacgccgaccgtttcgccgcttcttc
ccaggcgcgctaccaggctgcgctggaggagggct
ttttcctcggcgagatccttccggtggaggtgcgt
gccggacgcaagggcgagacgcggctggtggagcg
cgacgagcatccgcgaccgcaggccgacctggcgg
ccctggcgcgcttgccggcgttgttcgccggtggg
gtagtgaccgccggtaatgcgtctgggatcaacga
cggggcggcggtagtgctgctgggcgatcgcgcga
tcggcgagcgcgagggcatccggccgttggcgcgg
atcctcgccagcgccagcgtcggcgtcgagccccg
gttgatgggcatcggcccgcagcaggcgatcctcc
gcgcgctgcaacgcgccggcatcgacctggacgag
gtcggcctgatcgagatcaacgaagccttcgcgcc
gcaggtcctggcctgcctgaagttgctcggcctgg
actacgaggacccgcgggtcaatccccatggcggc
gccattgccctcggccatccgctcggcgcctccgg
tgcgcgcctggtgctcaccgccgcccgcgggctgc
aacgcatcgagcggcgctacgcggtggtcagcctg
tgcgtcgggctcggccagggcgtggcgatggtgat cgagcgctgccgatga 3-oxoadipyl-
Pseudomonas pcaF 1203 ATGCACGACG AACCCGCTCGAT
atgcacgacgtattcatctgtgacgccatccgtac CoA thiolase putida TATTCATCTGT
GGCCAAC
cccgatcggccgcttcggcggcgccctggccagcg (KT2440) GACG
tgcgggccgacgacctggccgccgtgccgctgaag
gcgctgatcgagcgcaaccctggcgtgcagtggga
ccaggtagacgaagtgttcttcggctgcgccaacc
aggccggtgaagacaaccgcaacgtggcccgcatg
gcactgctgctggccggcctgccggaaagcatccc
gggcgtcaccctgaaccgtctgtgcgcgtcgggca
tggatgccgtcggcaccgcgttccgcgccatcgcc
agcggcgagatggagctggtgattgccggtggcgt
cgagtcgatgtcgcgcgccccgttcgtcatgggca
aggctgaaagcgcctattcgcgcaacatgaagctg
gaagacaccaccattggctggcgtttcatcaaccc
gctgatgaagagccagtacggtgtggattccatgc
cggaaaccgccgacaacgtggccgacgactatcag
gtttcgcgtgctgatcaggacgctttcgccctgcg
cagccagcagaaggctgccgctgcgcaggctgccg
gcttctttgccgaagaaatcgtgccggtgcgtatc
gctcacaagaagggcgaaatcatcgtcgaacgtga
cgaacacctgcgcccggaaaccacgctggaggcgc
tgaccaagctcaaaccggtcaacggcccggacaag
acggtcaccgccggcaacgcctcgggcgtgaacga
cggtgctgcggcgatgatcctggcctcggccgcag
cggtgaagaaacacggcctgactccgcgtgcccgc
gttctgggcatggccagcggcggcgttgcgccacg
tgtcatgggcattggcccggtgccggcggtgcgca
aactgaccgagcgtctggggatagcggtaagtgat
ttcgacgtgatcgagcttaacgaagcgtttgccag
ccaaggcctggcggtgctgcgtgagctgggtgtgg
ctgacgatgcgccccaggtaaaccctaatggcggt
gccattgccctgggccaccccctgggcatgagcgg
tgcacgcctggtactgactgcgttgcaccagctgg
agaagagtggcggtcgcaagggcctggcgaccatg
tgtgtgggtgtcggccaaggtctggcgttggccat cgagcgggtttga 3-oxoadipyl-
Burkholderia bkt 1203 ATGACCGACG CACGCGTTCGAT
atgaccgacgcctacatctgcgatgcgattcgcac CoA thiolase ambifaria
CCTACATCTGC CGCGATC acccatcggccgctacggcggcgccctgaaagacg AMMD G
ttcgtgccgacgatctcggcgcggtgccgctcaag
gcgctgatcgaacgcaaccggaacgtcgactggtc
ggcgatcgacgacgtgatctatggctgcgcgaacc
aggccggcgaagacaaccgcaacgtcgcgcgcatg
tccgcgctgctcgcgggcttgccgaccgccgtgcc
gggcacgacgctgaaccggttatgcggctcgggca
tggacgccgtcggcacggccgcgcgcgcgatcaag
gcgggcgaggcacgcttgatgatcgcgggcggcgt
cgaaagcatgacgcgcgcgccgttcgtgatgggca
aggccgccagcgcattcgcgcgccaggctgcgatt
ttcgacacgacgatcggctggcgtttcattaatcc
gctgatgaaacagcaatacggcgtcgattcgatgc
ccgagacggccgagaacgtcgcggtcgactacaac
atcagccgcgccgaccaggatctattcgcgctgcg
cagccagcagaaggccgcgcgtgcgcagcaggacg
gcacgctcgccgccgaaatcgtccccgtcacgatt
gcgcagaaaaaaggcgacgcgctcgtcgtatcgct
cgacgagcatccgcgcgaaacatcgctcgaagcgc
tcgcgaagctgaagggcgtcgtgcgtcccgacggc
tcggtcacggccggcaacgcgtcaggcgtcaacga
cggcgcatgcgcactgctgctcgccaacgcggaag
ccgccgatcaatatgggctgcgccgccgcgcgcgt
gtcgtcggcatggcgagcgccggcgtcgagccgcg
cgtgatgggtatcggcccggcgccggccacgcaga
aactgttgcgccagctcggcatgacgatcgaccag
ttcgacgtgatcgagctgaacgaagcgttcgcgtc
gcagggtctcgcggtgctgcgcatgctcggtgtcg
ccgacgacgatccgcgcgtgaaccccaacggcggt
gcgatcgcgctcggccatccgctcggcgcatcggg
tgcgcggctcgtgaccacggcgcttcaccaactcg
agcgtacgggcggccgctttgcgctctgtacgatg
tgcatcggcgtcggccagggcatcgcgatcgcgat cgaacgcgtgtaa beta- Ascaris bkt
1242 ATGGCCACCT CAATTTCTCGAT gtgatggccacctcaagacttgtctgcagcaattt
ketothiolase suum CAAGACTTGT GACCATTCCACC
aacgaagcaatgctttacgatctcgtcacgtgctg CTGC
ctagccaatttaccgatgtggtattcgtgggtgcc
gcacgaacaccggtcggatcgtttcgctcttcgct
ttccactgttccagccactgtcctcggagctgagg
ctattaagggtgcacttaaacatgccaatctaaaa
ccctcacaagtgcaagaggtgttctttggctgtgt
cgttccatccaactgtggacaagttcctgcccgtc
aagcgacacttggagctggatgcgatccttcgaca
atcgttacaactctcaataaattgtgcgcctcggg
aatgaagtcgattgcttgtgccgcctcacttttgc
aacttggtcttcaagaggttaccgttggtggcggt
atggagagcatgagcttagtgccgtactatcttga
acgtggtgaaactacttatggtggaatgaagctca
tcgacggtatcccaagagatggtccgactgatgca
tatagtaatcaacttatgggtgcatgcgctgataa
tgtggctaaacgattcaacatcacccgtgaggaac
aggataaattcgctattgaaagctataaacgatct
gctgctgcatgggagagtggagcatgcaaagctga
agtagttcctattgaagtgacaaagggcaagaaaa
catacattgtcaacaaggatgaggaatacatcaaa
gtcaacttcgagaagcttcccaaactgaaacccgc
cttcttgaaagacggaaccatcacggctggcaatg
cttcaacactgaacgatggtgctgcggcagttgtg
atgacgactgtcgaaggagcgaaaaaatacggtgt
gaaaccattggcccgattgctctcatatggtgatg
cggcaacaaatccagtcgattttgctattgcacca
tcaatggttatcccaaaggtacttaaattggctaa
tctcgagatcaaggatattgatttgtgggaaatca
acgaggctttcgccgttgttccccttcattcaatg
aagacactcggtatcgatcactcgaaagtgaacat
tcatggtggtggcgtatctcttggacatcctattg
gaatgtctggagctcgaattatcgttcatctgatt
catgcgttgaaacctggccagaaaggctgcgctgc
aatctgcaatggtggcggtggcgctggtggaatgg tcatcgagaaattgtaa
[0252] The genes were expressed in E. coli and the proteins
purified using Ni-NTA spin columns and quantified. To assay enzyme
activity in vitro, a 5.times.CoA:DTNB (Ellman's reagent or
5,5'-dithiobis-(2-nitrobenzoic acid)) mixture was prepared. The
mixture consisted of 10 mM succinyl-CoA, 5 mM acetyl-CoA, 30 mM
DTNB in 100 mM Tris buffer, pH 7.4. Five .mu.L of the CoA:DTNB
mixture was added to 0.5 .mu.M purified thiolase enzyme in 100 mM
Tris buffer, pH 7.8 in a final volume of 50 .mu.L. The reaction was
incubated at 30.degree. C. for 30 minutes, then quenched with 2.5
.mu.L 10% formic acid and samples frozen at -20.degree. C. until
ready for analysis by LC/MS. Because many thiolases can condense
two acetyl-CoA molecules into acetoaceytl-CoA, production of
acetoacetyl-CoA was examined. FIG. 6 shows that 3 thiolases
demonstrated thiolase activity which resulted in acetoacetyl-CoA
formation. These were fadAx from Pseudomonas putida, thiA from
Clostridium acetobutylicum and thiB also from Clostridium
acetobutylicum. When enzyme assays were examined for condensation
of succinyl-CoA and acetyl-CoA into .beta.-ketoadipyl-CoA, several
enzymes demonstrated the desired activity; paaJ from Escherichia
coli (Nogales et al., Microbiol. 153:357-365 (2007)), phaD from
Pseudomonas putida (Olivera et al., Proc. Natl. Acad. Sci. USA
95:6419-6424 (1998)), bkt from Burkholderia ambifaria AMMD, pcaF
from Pseudomonas putida KT2440 (Harwood et al., J. Bacteriol.
176:6479-6488 (1994)), and pcaF from Pseudomonas aeruginosa PAO1.
There was excellent specificity between the thiolases. Those that
generated significant amounts of .beta.-ketoadipyl-CoA did not
produce significant amounts of acetoacetyl-CoA and likewise those
that made acetoacetyl-CoA did not make detectable amounts of
.beta.-ketoadipyl-CoA.
Example II
Preparation of Terepthalate from Acetylene and Muconate
[0253] This Example provides conditions for the thermal inverse
electron demand Diels-Alder reaction for the preparation of PTA
from acetylene and muconate.
[0254] A lab-scale Parr reactor is flushed with nitrogen gas,
evacuated and charged with (1 equivalent) trans, trans-muconic acid
and (10 equivalents) acetylene. The reactor is then heated to
200.degree. C. and held at this temperature for 12 hours. An
initial pressure of 500 p.s.i.g. is applied. The reactor is then
vented, exposed to air and cooled. The contents of the reactor are
distilled at room temperature and pressure to yield volatile and
nonvolatile fractions. The contents of each fraction are evaluated
qualitatively by gas chromatographic analysis (GC-MS).
[0255] For quantitative analysis, standards of the starting
materials and the expected products,
cyclohexa-2,5-diene-1,4-dicarboxylate and terepthalate, are
prepared. A known amount of cyclohexane is mixed with a known
amount of the volatile fraction and the mixture is subjected to gas
chromatography. The cyclohexane and terepthalate components are
condensed from the effluent of the chromatogram into a single trap,
the contents of which are diluted with carbon tetrachloride or
CDCl.sub.3 and then examined by NMR spectroscopy. Comparison of the
appropriate areas of the NMR spectrum permits calculation of
yields.
Example III
Preparation of a Muconate Producing Microbial Organism, in which
the Muconate is Derived from succinyl-CoA
[0256] This example describes the generation of a microbial
organism that has been engineered to produce muconate from
succinyl-CoA and acetyl-CoA via beta-ketoadipate, as shown in FIG.
2. This example also provides a method for engineering a strain
that overproduces muconate.
[0257] Escherichia coli is used as a target organism to engineer a
muconate-producing pathway as shown in FIG. 5. E. coli provides a
good host for generating a non-naturally occurring microorganism
capable of producing muconate. E. coli is amenable to genetic
manipulation and is known to be capable of producing various
products, like ethanol, acetic acid, formic acid, lactic acid, and
succinic acid, effectively under anaerobic, microaerobic or aerobic
conditions.
[0258] First, an E. coli strain is engineered to produce muconate
from succinyl-CoA via the route outlined in FIG. 2. For the first
stage of pathway construction, genes encoding enzymes to transform
central metabolites succinyl-CoA and acetyl-CoA to 2-maleylacetate
(FIG. 2, Step A) is assembled onto vectors. In particular, the
genes pcaF (AAA85138), pcaIf (AAN69545 and NP.sub.--746082) and
clcE (O30847) genes encoding beta-ketothiolase, beta-ketoadipyl-CoA
transferase and 2-maleylacetate reductase, respectively, are cloned
into the pZE13 vector (Expressys, Ruelzheim, Germany), under the
control of the PA1/lacO promoter. The genes bdh (AAA58352.1) and
fumC (P05042.1), encoding 2-maleylacetate dehydrogenase and
3-hydroxy-4-hexenedioate dehydratase, respectively, are cloned into
the pZA33 vector (Expressys, Ruelzheim, Germany) under the PA1/lacO
promoter. The two sets of plasmids are transformed into E. coli
strain MG1655 to express the proteins and enzymes required for
muconate synthesis from succinyl-CoA.
[0259] The resulting genetically engineered organism is cultured in
glucose containing medium following procedures well known in the
art (see, for example, Sambrook et al., supra, 2001). The
expression of muconate pathway genes is corroborated using methods
well known in the art for determining polypeptide expression or
enzymatic activity, including for example, Northern blots, PCR
amplification of mRNA and immunoblotting. Enzymatic activities of
the expressed enzymes are confirmed using assays specific for the
individually activities. The ability of the engineered E. coli
strain to produce muconate through this pathway is confirmed using
HPLC, gas chromatography-mass spectrometry (GCMS) or liquid
chromatography-mass spectrometry (LCMS).
[0260] Microbial strains engineered to have a functional muconate
synthesis pathway from succinyl-CoA are further augmented by
optimization for efficient utilization of the pathway. Briefly, the
engineered strain is assessed to determine whether any of the
exogenous genes are expressed at a rate limiting level. Expression
is increased for any enzymes expressed at low levels that can limit
the flux through the pathway by, for example, introduction of
additional gene copy numbers.
[0261] After successful demonstration of enhanced muconate
production via the activities of the exogenous enzymes, the genes
encoding these enzymes are inserted into the chromosome of a wild
type E. coli host using methods known in the art. Such methods
include, for example, sequential single crossover (Gay et al., J.
Bacteriol. 153:1424-1431 (1983)) and Red/ET methods from
GeneBridges (Zhang et al., Improved RecT or RecET cloning and
subcloning method (WO/2003/010322)). Chromosomal insertion provides
several advantages over a plasmid-based system, including greater
stability and the ability to co-localize expression of pathway
genes.
[0262] To generate better producers, metabolic modeling is utilized
to optimize growth conditions. Modeling is also used to design gene
knockouts that additionally optimize utilization of the pathway
(see, for example, U.S. patent publications US 2002/0012939, US
2003/0224363, US 2004/0029149, US 2004/0072723, US 2003/0059792, US
2002/0168654 and US 2004/0009466, and in U.S. Pat. No. 7,127,379).
Modeling analysis allows reliable predictions of the effects on
cell growth of shifting the metabolism towards more efficient
production of muconate. One modeling method is the bilevel
optimization approach, OptKnock (Burgard et al., Biotechnol.
Bioengineer. 84:647-657 (2003)), which is applied to select gene
knockouts that collectively result in better production of
muconate. Adaptive evolution also can be used to generate better
producers of, for example, the 4-acetylbutyrate intermediate or the
muconate product. Adaptive evolution is performed to improve both
growth and production characteristics (Fong and Palsson, Nat.
Genet. 36:1056-1058 (2004); Alper et al., Science 314:1565-1568
(2006)). Based on the results, subsequent rounds of modeling,
genetic engineering and adaptive evolution can be applied to the
muconate producer to further increase production.
[0263] For large-scale production of muconate, the above muconate
pathway-containing organism is cultured in a fermenter using a
medium known in the art to support growth of the organism under
anaerobic conditions. Fermentations are performed in either a
batch, fed-batch or continuous manner. Anaerobic conditions are
maintained by first sparging the medium with nitrogen and then
sealing culture vessel (e.g., flasks can be sealed with a septum
and crimp-cap). Microaerobic conditions also can be utilized by
providing a small hole for limited aeration. The pH of the medium
is maintained at a pH of 7 by addition of an acid, such as
H.sub.2SO.sub.4. The growth rate is determined by measuring optical
density using a spectrophotometer (600 nm), and the glucose uptake
rate by monitoring carbon source depletion over time. Byproducts
such as undesirable alcohols, organic acids, and residual glucose
can be quantified by HPLC (Shimadzu) with an HPX-087 column
(BioRad), using a refractive index detector for glucose and
alcohols, and a UV detector for organic acids, Lin et al.,
Biotechnol. Bioeng., 775-779 (2005).
[0264] Throughout this application various publications have been
referenced. The disclosures of these publications in their
entireties are hereby incorporated by reference in this application
in order to more fully describe the state of the art to which this
invention pertains. Although the invention has been described with
reference to the examples provided above, it should be understood
that various modifications can be made without departing from the
spirit of the invention.
Sequence CWU 1
1
50120PRTEuglena gracilis 1Met Thr Tyr Lys Ala Pro Val Lys Asp Val
Lys Phe Leu Leu Asp Lys1 5 10 15Val Phe Lys Val 2026PRTArtificial
SequenceDescription of Artificial Sequence Synthetic 6xHis tag 2His
His His His His His1 5326DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 3atgacgcgtg aagtggtagt ggtaag
26420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 4gatacgctcg aagatggcgg 2051185DNARalstonia
eutropha 5atgacgcgtg aagtggtagt ggtaagcggt gtccgtaccg cgatcgggac
ctttggcggc 60agcctgaagg atgtggcacc ggcggagctg ggcgcactgg tggtgcgcga
ggcgctggcg 120cgcgcgcagg tgtcgggcga cgatgtcggc cacgtggtat
tcggcaacgt gatccagacc 180gagccgcgcg acatgtatct gggccgcgtc
gcggccgtca acggcggggt gacgatcaac 240gcccccgcgc tgaccgtgaa
ccgcctgtgc ggctcgggcc tgcaggccat tgtcagcgcc 300gcgcagacca
tcctgctggg cgataccgac gtcgccatcg gcggcggcgc ggaaagcatg
360agccgcgcac cgtacctggc gccggcagcg cgctggggcg cacgcatggg
cgacgccggc 420ctggtcgaca tgatgctggg tgcgctgcac gatcccttcc
atcgcatcca catgggcgtg 480accgccgaga atgtcgccaa ggaatacgac
atctcgcgcg cgcagcagga cgaggccgcg 540ctggaatcgc accgccgcgc
ttcggcagcg atcaaggccg gctacttcaa ggaccagatc 600gtcccggtgg
tgagcaaggg ccgcaagggc gacgtgacct tcgacaccga cgagcacgtg
660cgccatgacg ccaccatcga cgacatgacc aagctcaggc cggtcttcgt
caaggaaaac 720ggcacggtca cggccggcaa tgcctcgggc ctgaacgacg
ccgccgccgc ggtggtgatg 780atggagcgcg ccgaagccga gcgccgcggc
ctgaagccgc tggcccgcct ggtgtcgtac 840ggccatgccg gcgtggaccc
gaaggccatg ggcatcggcc cggtgccggc gacgaagatc 900gcgctggagc
gcgccggcct gcaggtgtcg gacctggacg tgatcgaagc caacgaagcc
960tttgccgcac aggcgtgcgc cgtgaccaag gcgctcggtc tggacccggc
caaggttaac 1020ccgaacggct cgggcatctc gctgggccac ccgatcggcg
ccaccggtgc cctgatcacg 1080gtgaaggcgc tgcatgagct gaaccgcgtg
cagggccgct acgcgctggt gacgatgtgc 1140atcggcggcg ggcagggcat
tgccgccatc ttcgagcgta tctga 1185626DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
6atggaagtaa gatgcctgga acgaag 26721DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
7cagcttctca atcagcaggg c 2181215DNAMus musculus 8atggaagtaa
gatgcctgga acgaagttat gcatccaaac ccactttgaa tgaagtggtt 60atagtaagtg
ctataagaac tcccattgga tccttcctgg gcagccttgc ctctcagccg
120gccactaaac ttggtactgc tgcaattcag ggagccattg agaaggcagg
gattccaaaa 180gaagaagtga aggaagtcta catgggcaat gtcatccaag
ggggtgaagg acaggcccct 240accaggcaag caacactggg cgcaggttta
cctatttcca ctccatgcac cacagtaaac 300aaggtttgtg cttcaggaat
gaaagccatc atgatggcct ctcaaagtct tatgtgtgga 360catcaggatg
tgatggtggc aggcgggatg gagagcatgt ccaatgtccc atacgtaatg
420agcagaggag caacaccata tggtggggta aaacttgaag acctgattgt
aaaagacggg 480ctaactgatg tctacaataa aattcatatg ggtaactgtg
ctgagaatac tgcaaagaag 540atgaatatct cacggcagga acaggatacg
tacgctctca gctcttacac cagaagtaaa 600gaagcgtggg acgcagggaa
gtttgccagt gagattactc ccatcaccat ctcagtgaaa 660ggtaaaccag
atgtggtggt gaaagaagat gaagaataca agcgtgttga ctttagtaaa
720gtgccaaagc tcaagaccgt gttccagaaa gaaaatggca caataacagc
tgccaatgcc 780agcacactga acgatggagc agctgctctg gttctcatga
ctgcagaggc agcccagagg 840ctcaatgtta agccattggc acgaattgca
gcatttgctg atgctgccgt agaccccatt 900gattttccac ttgcgcctgc
atatgccgta cctaaggttc ttaaatatgc aggactgaaa 960aaagaagaca
ttgccatgtg ggaagtaaat gaagcattca gtgtggttgt gctagccaac
1020attaaaatgc tggagattga cccccaaaaa gtaaatatcc acggaggagc
tgtttctctg 1080ggccatccaa ttgggatgtc tggagcccgg attgttgttc
atatggctca tgccctgaag 1140ccaggagagt tcggtctggc tagtatttgc
aacggaggag gaggtgcttc cgccctgctg 1200attgagaagc tgtag
1215920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 9atgaccctcg ccaatgaccc 201023DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
10gtacaggcat tcaacagcca tgg 23111194DNAPseudomonas putida
11atgaccctcg ccaatgaccc catcgttatc gtcagcgccg tgcgcacgcc catgggcggg
60ttgcagggcg acctcaagag cctgactgcg ccgcaactgg gcagcgccgc cattcgtgct
120gccgtggaac gggccggcat cgatgccgcc ggtgtcgagc aggtactgtt
cggctgcgtg 180ctgccggccg gccagggcca ggcaccggca cgccaggccg
cgctgggcgc cgggctggac 240aagcacacca cctgcaccac cctgaacaag
atgtgcggct cgggtatgca agccgcgatc 300atggcccatg acctgctgct
ggccggcacc gcagacgtgg tagtggcggg tggcatggaa 360agcatgacca
acgcgccgta cctgctggac aaagcccgtg gcggctaccg catgggccac
420ggcaagatca tcgaccacat gttcatggac ggtctcgaag acgcctacga
caaaggccgc 480ctgatgggta cctttgccga ggactgtgcc caggccaatg
ccttcagccg cgaggcccag 540gaccagttcg ccatcgcctc gctgacccga
gcgcaggaag ccatcagcag cggccgtttt 600gccgccgaga tcgtgccggt
ggaagtcacc gagggcaagg aaaagcgcgt catcaaggat 660gacgagcagc
cgcccaaggc gcgtctggac aagattgcgc agctcaaacc ggcgtttcgt
720gaaggcggca ccgtgacggc ggccaacgcc agttcgattt ccgacggcgc
tgcggcgctg 780gtactgatgc gccgctccga ggccgacaaa cgtggcctca
agccattggc cgtcatccac 840ggccacgccg cctttgccga caccccggcg
ctgttcccga ccgccccgat cggcgcgatc 900gacaaactga tgaaacgcac
cggctggaac ctggccgaag tcgacctgtt cgagatcaac 960gaggccttcg
ccgtggtcac cctggcggcc atgaaacacc tcgacctgcc acacgacaag
1020gtcaatatcc acggcggcgc ctgcgccctc ggtcacccga tcggcgcttc
tggcgcacgt 1080attctggtca ccctgttgtc ggccttgcgc cagaacaatc
tgcgtcgggg tgtggcggcc 1140atctgcatcg gcggtggcga ggccacggcc
atggctgttg aatgcctgta ctga 11941225DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
12atgaacaaac atgctttcat cgtcg 251329DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
13taatttctgg ataaccattc cacttgagc 29141167DNACaenorhabditis elegans
14atgaacaaac atgctttcat cgtcggagcc gcccgtacac ctattggatc atttcgttct
60tctctctctt cggtaactgc tccagagctc gcctcggttg ccatcaaagc agcattggag
120cgtggagcag tgaagccgag ttcaattcag gaggtgttcc ttggtcaagt
ctgtcaagca 180aatgctggtc aagctcccgc tcgtcaagca gctcttggag
ccggactcga tctttcggtt 240gctgttacca ccgtcaataa agtgtgctct
tctgggctga aagcaatcat tcttgctgcc 300cagcaaattc aaaccggtca
tcaagatttt gccattggcg gaggaatgga gagcatgtca 360caagtaccat
tttatgttca aagaggagag atcccatatg gtggatttca agtgattgat
420ggaatcgtca aagacggact gaccgatgct tatgataaag ttcacatggg
aaactgcgga 480gagaagactt caaaagaaat gggaattaca cgtaaagacc
aagacgaata tgctatcaac 540agctacaaaa agtcagctaa agcatgggag
aatggaaata tcggaccaga agtggtgcca 600gtgaacgtca aatcaaagaa
gggagtcacg attgttgata aagatgaaga gttcacaaaa 660gtcaatttcg
acaagttcac ctcgctgaga actgttttcc agaaagacgg aactatcact
720gctgctaatg cttcaacatt gaacgacggt gcagctgctg tcattgttgc
ctcacaggaa 780gcagtttccg agcaaagctt aaagcctctg gcccgaattt
tggcttatgg agatgccgcc 840acgcacccac tcgatttcgc tgtagcacca
actttgatgt tcccaaaaat tcttgaaaga 900gcaggagtga agcaatcaga
tgttgctcaa tgggaagtta atgaagcctt ctcatgtgtt 960ccccttgctt
tcatcaaaaa actaggagtc gatccatccc ttgtgaaccc acatggagga
1020gctgtttcaa ttggtcaccc catcggaatg tccggagccc gcctcatcac
tcatcttgtg 1080cacacactca aaagtggcca aatcggagtt gctgccattt
gcaatggagg tggtggctca 1140agtggaatgg ttatccagaa attataa
11671525DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 15atgcgtgaag cctttatttg tgacg 251622DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
16aacacgctcc agaatcatgg cg 22171206DNAEscherichia coli 17atgcgtgaag
cctttatttg tgacggaatt cgtacgccaa ttggtcgcta cggcggggca 60ttatcaagtg
ttcgggctga tgatctggct gctatccctt tgcgggaact gctggtgcga
120aacccgcgtc tcgatgcgga gtgtatcgat gatgtgatcc tcggctgtgc
taatcaggcg 180ggagaagata accgtaacgt agcccggatg gcgactttac
tggcggggct gccgcagagt 240gtttccggca caaccattaa ccgcttgtgt
ggttccgggc tggacgcact ggggtttgcc 300gcacgggcga ttaaagcggg
cgatggcgat ttgctgatcg ccggtggcgt ggagtcaatg 360tcacgggcac
cgtttgttat gggcaaggca gccagtgcat tttctcgtca ggctgagatg
420ttcgatacca ctattggctg gcgatttgtg aacccgctca tggctcagca
atttggaact 480gacagcatgc cggaaacggc agagaatgta gctgaactgt
taaaaatctc acgagaagat 540caagatagtt ttgcgctacg cagtcagcaa
cgtacggcaa aagcgcaatc ctcaggcatt 600ctggctgagg agattgttcc
ggttgtgttg aaaaacaaga aaggtgttgt aacagaaata 660caacatgatg
agcatctgcg cccggaaacg acgctggaac agttacgtgg gttaaaagca
720ccatttcgtg ccaatggggt gattaccgca ggcaatgctt ccggggtgaa
tgacggagcc 780gctgcgttga ttattgccag tgaacagatg gcagcagcgc
aaggactgac accgcgggcg 840cgtatcgtag ccatggcaac cgccggggtg
gaaccgcgcc tgatggggct tggtccggtg 900cctgcaactc gccgggtgct
ggaacgcgca gggctgagta ttcacgatat ggacgtgatt 960gaactgaacg
aagcgttcgc ggcccaggcg ttgggtgtac tacgcgaatt ggggctgcct
1020gatgatgccc cacatgttaa ccccaacgga ggcgctatcg ccttaggcca
tccgttggga 1080atgagtggtg cccgcctggc actggctgcc agccatgagc
tgcatcggcg taacggtcgt 1140tacgcattgt gcaccatgtg catcggtgtc
ggtcagggca tcgccatgat tctggagcgt 1200gtttga 12061821DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
18atgaatgaac cgacccacgc c 211920DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 19gaggcgctcg atgatcatgg
20201221DNAPseudomonas putida 20atgaatgaac cgacccacgc cgatgccttg
atcatcgacg ccgtgcgcac gcccattggc 60cgctatgccg gggccctgag cagcgtgcgc
gccgacgacc tggcggccat cccgctcaaa 120gccttgatcc agcgtcaccc
cgaactggac tggaaagcca ttgatgacgt tatcttcggc 180tgtgccaacc
aggctggcga agacaaccgc aacgtggccc acatggcgag cctgctggcc
240gggctgccac tcgaagtacc agggaccacg atcaaccgcc tgtgcggttc
cggtctggat 300gccatcggta atgcggcacg tgccctgcgc tgcggtgaag
cggggctcat gctggccggt 360ggtgtggagt ccatgtcgcg tgcaccgttt
gtgatgggta agtcggagca ggcattcggg 420cgtgcggccg agctgttcga
caccaccatc ggctggcgtt tcgtcaaccc gctgatgaag 480gccgcctacg
gcatcgattc gatgccggaa acggctgaaa acgtggccga acagttcggc
540atctcgcgcg ccgaccagga tgcctttgcc ctgcgcagcc agcacaaagc
cgcagcagct 600caggcccgcg gccgcctggc gcgggaaatc gtgccggtcg
aaatcccgca acgcaaaggc 660ccagccaaag tggtcgagca tgacgagcac
ccgcgcggcg acacgaccct ggagcagctg 720gctcggctcg ggacgccgtt
tcgtgaaggc ggcagcgtaa cggcgggtaa tgcctccggc 780gtgaatgacg
gcgcttgcgc cctgctgctg gccagcagcg ccgcggcccg ccgccatggg
840ttgaaggccc gcggccgcat cgtcggcatg gcggtggccg gggttgagcc
caggctgatg 900ggcattggtc cggtgcctgc gacccgcaag gtgctggcgc
tcaccggcct ggcactggct 960gacctggatg tcatcgaact caatgaggcc
tttgccgccc aagggctggc cgtgttgcgc 1020gagctgggcc tggccgacga
cgacccgcga gtcaaccgca acggcggcgc catcgccctg 1080ggccatcccc
tgggcatgag cggtgcccgg ttggtgacca ctgccttgca cgagcttgaa
1140gaaacggccg gccgctacgc cctgtgcacc atgtgcatcg gcgtaggcca
aggcattgcc 1200atgatcatcg agcgcctctg a 12212135DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
21atgaaagaag ttgtaatagc tagtgcagta agaac 352227DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
22gcacttttct agcaatattg ctgttcc 27231179DNAClostridium
acetobutylicum 23atgaaagaag ttgtaatagc tagtgcagta agaacagcga
ttggatctta tggaaagtct 60cttaaggatg taccagcagt agatttagga gctacagcta
taaaggaagc agttaaaaaa 120gcaggaataa aaccagagga tgttaatgaa
gtcattttag gaaatgttct tcaagcaggt 180ttaggacaga atccagcaag
acaggcatct tttaaagcag gattaccagt tgaaattcca 240gctatgacta
ttaataaggt ttgtggttca ggacttagaa cagttagctt agcagcacaa
300attataaaag caggagatgc tgacgtaata atagcaggtg gtatggaaaa
tatgtctaga 360gctccttact tagcgaataa cgctagatgg ggatatagaa
tgggaaacgc taaatttgtt 420gatgaaatga tcactgacgg attgtgggat
gcatttaatg attaccacat gggaataaca 480gcagaaaaca tagctgagag
atggaacatt tcaagagaag aacaagatga gtttgctctt 540gcatcacaaa
aaaaagctga agaagctata aaatcaggtc aatttaaaga tgaaatagtt
600cctgtagtaa ttaaaggcag aaagggagaa actgtagttg atacagatga
gcaccctaga 660tttggatcaa ctatagaagg acttgcaaaa ttaaaacctg
ccttcaaaaa agatggaaca 720gttacagctg gtaatgcatc aggattaaat
gactgtgcag cagtacttgt aatcatgagt 780gcagaaaaag ctaaagagct
tggagtaaaa ccacttgcta agatagtttc ttatggttca 840gcaggagttg
acccagcaat aatgggatat ggacctttct atgcaacaaa agcagctatt
900gaaaaagcag gttggacagt tgatgaatta gatttaatag aatcaaatga
agcttttgca 960gctcaaagtt tagcagtagc aaaagattta aaatttgata
tgaataaagt aaatgtaaat 1020ggaggagcta ttgcccttgg tcatccaatt
ggagcatcag gtgcaagaat actcgttact 1080cttgtacacg caatgcaaaa
aagagatgca aaaaaaggct tagcaacttt atgtataggt 1140ggcggacaag
gaacagcaat attgctagaa aagtgctag 11792437DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
24atgagagatg tagtaatagt aagtgctgta agaactg 372528DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
25gtctctttca actacgagag ctgttccc 28261179DNAClostridium
acetobutylicum 26atgagagatg tagtaatagt aagtgctgta agaactgcaa
taggagcata tggaaaaaca 60ttaaaggatg tacctgcaac agagttagga gctatagtaa
taaaggaagc tgtaagaaga 120gctaatataa atccaaatga gattaatgaa
gttatttttg gaaatgtact tcaagctgga 180ttaggccaaa acccagcaag
acaagcagca gtaaaagcag gattaccttt agaaacacct 240gcgtttacaa
tcaataaggt ttgtggttca ggtttaagat ctataagttt agcagctcaa
300attataaaag ctggagatgc tgataccatt gtagtaggtg gtatggaaaa
tatgtctaga 360tcaccatatt tgattaacaa tcagagatgg ggtcaaagaa
tgggagatag tgaattagtt 420gatgaaatga taaaggatgg tttgtgggat
gcatttaatg gatatcatat gggagtaact 480gcagaaaata ttgcagaaca
atggaatata acaagagaag agcaagatga attttcactt 540atgtcacaac
aaaaagctga aaaagccatt aaaaatggag aatttaagga tgaaatagtt
600cctgtattaa taaagactaa aaaaggtgaa atagtctttg atcaagatga
atttcctaga 660ttcggaaaca ctattgaagc attaagaaaa cttaaaccta
ttttcaagga aaatggtact 720gttacagcag gtaatgcatc cggattaaat
gatggagctg cagcactagt aataatgagc 780gctgataaag ctaacgctct
cggaataaaa ccacttgcta agattacttc ttacggatca 840tatggggtag
atccatcaat aatgggatat ggagcttttt atgcaactaa agctgcctta
900gataaaatta atttaaaacc tgaagactta gatttaattg aagctaacga
ggcatatgct 960tctcaaagta tagcagtaac tagagattta aatttagata
tgagtaaagt taatgttaat 1020ggtggagcta tagcacttgg acatccaata
ggtgcatctg gtgcacgtat tttagtaaca 1080ttactatacg ctatgcaaaa
aagagattca aaaaaaggtc ttgctactct atgtattggt 1140ggaggtcagg
gaacagctct cgtagttgaa agagactaa 11792731DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
27atgttcaaga aatcagctaa tgatattgtt g 312822DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
28ctcgttagca aacaaggcag cg 22291182DNACandida albicans 29atgttcaaga
aatcagctaa tgatattgtt gttattgcag caaagagaac tccaatcacc 60aagtcaatta
aaggtgggtt gagtagatta tttcctgagg aaatattata tcaagtggtt
120aagggtactg tatcagattc acaagttgat ttaaacttga ttgatgatgt
gttagtcggt 180acggtcttgc aaactttagg gggacagaaa gctagtgcct
tggccattaa aaagattgga 240ttcccaatta agaccacggt taatacggtc
aatcgtcaat gtgctagttc tgctcaagcg 300attacttatc aagcaggtag
tttgcgtagt ggggagaatc aatttgctat tgctgctgga 360gtagaaagta
tgactcatga ttattttcct catcgtggga ttcccacaag aatttctgaa
420tcatttttag ctgatgcatc cgatgaagct aaaaacgtct tgatgccaat
ggggataacc 480agtgaaaatg ttgccactaa atatggaatt tctcgtaaac
aacaagatga gtttgccctt 540aattctcatt tgaaagcaga caaggctaca
aaactgggtc attttgcaaa agaaatcatt 600cctattcaaa caacggatga
aaacaaccaa cacgtttcaa taaccaaaga tgatggtata 660aggggaagtt
caacaattga aaagttgggt ggcttaaaac ctgtgttcaa ggatgatggg
720actactactg ctggtaattc ctcgcaaatt tcagatggag ggtctgctgt
gattttaact 780actcgtcaaa atgctgagaa atcgggagta aagccaatag
ctagatttat tggttcgtca 840gtagctggtg ttccttcggg acttatggga
attggtccat cggctgctat tcctcaattg 900ttgtcgagat taaatgttga
cacgaaagac attgatattt ttgaattgaa cgaggcattt 960gcatcccaac
tgatttattg tattgaaaaa ttgggtcttg attatgataa agtcaatcca
1020tatggtggag ctatagcctt gggacatcca ttaggagcca ctggcgcaag
agttacggca 1080acgttgctta atggattaaa agatcagaat aaagagttgg
gtgtcatctc aatgtgcaca 1140tccacaggtc aaggatacgc tgccttgttt
gctaacgagt ag 11823038DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 30atggatagat taaatcaatt
aagtggtcaa ttaaaacc 383126DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 31ttccttaatc aatatggagg cagcac
26321227DNACandida albicans 32atggatagat taaatcaatt aagtggtcaa
ttaaaaccaa cttcaaaaca atcccttact 60caaaagaacc cagacgatgt tgtcatcgtt
gcagcataca gaactgccat cggtaaaggt 120ttcaaagggt ctttcaaatc
tgtgcaatct gaattcatct tgactgaatt cttgaaagaa 180tttattaaaa
agactggagt cgatgcatct ttgattgaag atgttgctat tggtaacgtt
240ttgaaccaag ctgctggtgc caccgaacac agaggtgcta gtttggctgc
aggtattcct 300tacactgcag ctttccttgc catcaacaga ttgtgttcct
cagggttaat ggccatttct 360gacattgcca acaaaatcaa aaccggtgaa
atcgaatgtg gtcttgctgg tggtattgaa 420tccatgtcta aaaactatgg
tagtccaaaa gttattccaa agattgaccc acacttggct 480gatgacgaac
aaatgagtaa atgtttgatt ccaatgggta tcaccaacga aaatgttgct
540aatgaattca acattccaag agaaaaacaa gatgcctttg ctgctaaatc
ttatagtaaa 600gccgaaaaag ccatctcctc tggagctttc aaagatgaaa
tcttaccaat cagatccatt 660atcagatccc cagacggttc tgaaaaagaa
atcattgtcg ataccgacga aggtccaaga 720aagggtgttg acgctgcttc
cttgagcaaa ttgaaaccag catttggtgg tactaccact 780gccggtaacg
cttctcaaat ttcagatggt gctgctggtg ttttattgat gaagagaagt
840ttggctgaag ccaaaggtta cccaattgtt
gctaaataca ttgcttgttc aactgttggt 900gttccgccag aaatcatggg
tgttggtcca gcttacgcca ttccagaagt gttgaagaga 960actggattga
ctgtggatga cgttgatgtg tttgaaatca acgaagcttt tgctgctcaa
1020tgtctttact cagctgaaca atgtaatgtt ccagaagaaa aattgaacat
aaacggtggt 1080gccatcgctt taggtcatcc tcttggttgt actggtgcca
gacaatatgc cactatcttg 1140agattgttga aaccaggtga aattggtttg
acttctatgt gtatcggtag tggtatgggt 1200gctgcctcca tattgattaa ggaatag
12273330DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 33atgtcatcca aacaacaata cttgaagaag
303427DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 34ttctctaacc aaaacagaag cagcacc 27351233DNACandida
albicans 35atgtcatcca aacaacaata cttgaagaag aatcctgacg atgtcgttgt
cgttgcagca 60tacagaactg ctttaaccaa aggtggaaga ggtggattca aagatgttgg
atctgatttc 120cttttgaaaa aattgactga agaatttgtt aaaaaaactg
gtgttgaccc taaaatcatt 180caagatgctg ccattggtaa tgtcttgaac
agaagagctg gtgatttcga acatagaggt 240gcattattat ctgctggatt
accttattca gttccatttg ttgcccttaa cagacaatgt 300tcatctgggt
taatggccat ttctcaagtg gccaacaaga tcaagactgg tgaaattgaa
360tgtggtttag ctggtggtgt tgaaagtatg acaaaaaact atggtccaga
agcattgatt 420gctattgacc ctgcttatga aaaagaccca gaatttgtta
aaaacggtat tccaatgggt 480attactaatg aaaatgtttg tgccaaattc
aatatttcaa gagatgttca agatcaattt 540gctgctgaat cttatcaaaa
agctgaaaag gcacaaaaag aaggtaaatt tgatgatgaa 600attttaccaa
ttgaagtttt ccaagaagat gaagatgctg aagatgaaga cgaagatgaa
660gatgaagatg ctgaaccaaa agaaaaattg gttgttatta gtaaagatga
aggtattaga 720ccaggtgtta ctaaagaaaa attggctaaa attaaaccag
ctttcaaatc tgatggtgta 780tcttcagctg gtaactcttc acaagtttcc
gatggtgctg ccttggtgtt attgatgaaa 840cgttcatttg ctgaaaagaa
tggattcaaa ccattggcta aatacatttc ttgtggtgtt 900gctggtgtcc
caccagaaat tatgggtatt ggtccagctg ttgccattcc aaaagttttg
960aaacaaactg gattatcagt cagtgatatt gatatttatg aaatcaatga
agcatttgcc 1020ggtcaatgtt tgtactcaat tgaaagttgt aatattccaa
gagaaaaagt caatcttaat 1080gggggtgcta ttgccttggg tcaccctctt
ggttgtactg gtgctagaca atacgctact 1140attttaagat tgttaaaacc
aggtgaattt ggtgtgactt ctatgtgtat tggtactggt 1200atgggtgctg
cttctgtttt ggttagagaa taa 12333623DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 36atgagccgcg aggtattcat ctg
233718DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 37gacccgctcg atggccag 18381206DNAPseudomonas
aeruginosa 38atgagccgcg aggtattcat ctgcgatgcc gtgcgcacgc cgatcggccg
tttcggcggc 60agtctttccg cggtgcgcgc cgacgacctc gcggcggtgc cgctgaaggc
cctggtcgag 120cgcaacccgg gggtcgactg gtcggcgttg gacgaggtgt
tcctcggctg cgccaaccag 180gccggcgagg acaaccgtaa cgtggcgcgc
atggcgctgc tgctggccgg tttgccggag 240agcgtgcccg gcgtcaccct
caaccgcctc tgcgcctcgg ggatggacgc catcggcacg 300gcgttccgcg
ccatcgcctg cggcgagatg gagctggcca tcgccggcgg cgtcgagtcg
360atgtcgcgcg cgccgtacgt gatgggcaag gccgatagcg ccttcggtcg
cggccagaag 420atcgaggaca ccaccatcgg ctggcgcttc gtcaatccgc
tgatgaagga gcagtacggc 480atcgacccga tgccgcagac cgccgacaac
gtcgccgacg actatcgcgt gtcgcgtgcc 540gaccaggatg ccttcgccct
gcgcagccag cagcgcgccg gcagggcgca ggaggccggt 600ttcttcgccg
aggaaatcgt cccggtgacg attcgcgggc gcaagggcga caccctggtc
660gagcacgacg agcatccgcg tcccgacacc accctggagg cgctggcccg
gctcaagccg 720gtcaacgggc cggagaagac cgtcaccgcc ggcaacgcgt
ccggggtcaa cgacggcgcc 780gccgcgctgg tcctggcctc cgccgaggca
gtggagaagc acggcctgac tccgcgcgcg 840cgggtgctgg gcatggccag
cgccggcgtc gccccacgga tcatgggcat cggcccggtg 900ccggcggtgc
gcaagctgct gcggcgcctg gacctggcga tcgacgcctt cgacgtgatc
960gaactcaacg aagccttcgc cagccagggc ctggcctgcc tgcgcgaact
gggcgtggcc 1020gacgacagtg agaaggtcaa cccgaacggc ggtgccatcg
ccctcggcca cccgctgggg 1080atgagcggtg cgcggctggt cctcaccgcg
ctccatcaac ttgagaagag cggcggccgg 1140cgcggcctgg cgaccatgtg
cgtaggcgtc ggccaaggcc tggcgctggc catcgagcgg 1200gtctga
12063924DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 39atgctcgatg cctatatcta cgcc 244018DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
40tcggcagcgc tcgatcac 18411206DNAPseudomonas aeruginosa
41atgctcgatg cctatatcta cgccggcctg cgtacgcctt tcggccggca tgccggtgca
60ctctcgacgg tgcgtccgga cgacctggcc ggcctgctgc tggcgcgtct cgcggaaacc
120tccgggttcg ccgtcgacga cctggaggat gtgatcctcg gttgcaccaa
ccaggccggc 180gaagacagcc gcaacctggc gcgcaacgcg ctgctcgcag
ccggcctgcc ggcgcggctg 240cccgggcaga cggtcaaccg cttgtgtgcc
agcggactgt cggcggtgat cgacgcggcg 300cgcgcgatca gttgcggtga
gggccggctg tacctggccg gcggcgccga aagcatgtcc 360cgggcgccgt
tcgtcatggg caaggcggag agcgccttca gccgcacgct ggaggtcttc
420gacagcacca tcggcgcgcg cttcgccaac cccaggctgg tcgagcgcta
tggcaacgac 480agcatgccgg agaccggcga caacgtggcc cgcgccttcg
gcatcgcccg cgaagacgcc 540gaccgtttcg ccgcttcttc ccaggcgcgc
taccaggctg cgctggagga gggctttttc 600ctcggcgaga tccttccggt
ggaggtgcgt gccggacgca agggcgagac gcggctggtg 660gagcgcgacg
agcatccgcg accgcaggcc gacctggcgg ccctggcgcg cttgccggcg
720ttgttcgccg gtggggtagt gaccgccggt aatgcgtctg ggatcaacga
cggggcggcg 780gtagtgctgc tgggcgatcg cgcgatcggc gagcgcgagg
gcatccggcc gttggcgcgg 840atcctcgcca gcgccagcgt cggcgtcgag
ccccggttga tgggcatcgg cccgcagcag 900gcgatcctcc gcgcgctgca
acgcgccggc atcgacctgg acgaggtcgg cctgatcgag 960atcaacgaag
ccttcgcgcc gcaggtcctg gcctgcctga agttgctcgg cctggactac
1020gaggacccgc gggtcaatcc ccatggcggc gccattgccc tcggccatcc
gctcggcgcc 1080tccggtgcgc gcctggtgct caccgccgcc cgcgggctgc
aacgcatcga gcggcgctac 1140gcggtggtca gcctgtgcgt cgggctcggc
cagggcgtgg cgatggtgat cgagcgctgc 1200cgatga 12064225DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
42atgcacgacg tattcatctg tgacg 254319DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
43aacccgctcg atggccaac 19441203DNAPseudomonas putida 44atgcacgacg
tattcatctg tgacgccatc cgtaccccga tcggccgctt cggcggcgcc 60ctggccagcg
tgcgggccga cgacctggcc gccgtgccgc tgaaggcgct gatcgagcgc
120aaccctggcg tgcagtggga ccaggtagac gaagtgttct tcggctgcgc
caaccaggcc 180ggtgaagaca accgcaacgt ggcccgcatg gcactgctgc
tggccggcct gccggaaagc 240atcccgggcg tcaccctgaa ccgtctgtgc
gcgtcgggca tggatgccgt cggcaccgcg 300ttccgcgcca tcgccagcgg
cgagatggag ctggtgattg ccggtggcgt cgagtcgatg 360tcgcgcgccc
cgttcgtcat gggcaaggct gaaagcgcct attcgcgcaa catgaagctg
420gaagacacca ccattggctg gcgtttcatc aacccgctga tgaagagcca
gtacggtgtg 480gattccatgc cggaaaccgc cgacaacgtg gccgacgact
atcaggtttc gcgtgctgat 540caggacgctt tcgccctgcg cagccagcag
aaggctgccg ctgcgcaggc tgccggcttc 600tttgccgaag aaatcgtgcc
ggtgcgtatc gctcacaaga agggcgaaat catcgtcgaa 660cgtgacgaac
acctgcgccc ggaaaccacg ctggaggcgc tgaccaagct caaaccggtc
720aacggcccgg acaagacggt caccgccggc aacgcctcgg gcgtgaacga
cggtgctgcg 780gcgatgatcc tggcctcggc cgcagcggtg aagaaacacg
gcctgactcc gcgtgcccgc 840gttctgggca tggccagcgg cggcgttgcg
ccacgtgtca tgggcattgg cccggtgccg 900gcggtgcgca aactgaccga
gcgtctgggg atagcggtaa gtgatttcga cgtgatcgag 960cttaacgaag
cgtttgccag ccaaggcctg gcggtgctgc gtgagctggg tgtggctgac
1020gatgcgcccc aggtaaaccc taatggcggt gccattgccc tgggccaccc
cctgggcatg 1080agcggtgcac gcctggtact gactgcgttg caccagctgg
agaagagtgg cggtcgcaag 1140ggcctggcga ccatgtgtgt gggtgtcggc
caaggtctgg cgttggccat cgagcgggtt 1200tga 12034522DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
45atgaccgacg cctacatctg cg 224619DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 46cacgcgttcg atcgcgatc
19471203DNABurkholderia ambifaria 47atgaccgacg cctacatctg
cgatgcgatt cgcacaccca tcggccgcta cggcggcgcc 60ctgaaagacg ttcgtgccga
cgatctcggc gcggtgccgc tcaaggcgct gatcgaacgc 120aaccggaacg
tcgactggtc ggcgatcgac gacgtgatct atggctgcgc gaaccaggcc
180ggcgaagaca accgcaacgt cgcgcgcatg tccgcgctgc tcgcgggctt
gccgaccgcc 240gtgccgggca cgacgctgaa ccggttatgc ggctcgggca
tggacgccgt cggcacggcc 300gcgcgcgcga tcaaggcggg cgaggcacgc
ttgatgatcg cgggcggcgt cgaaagcatg 360acgcgcgcgc cgttcgtgat
gggcaaggcc gccagcgcat tcgcgcgcca ggctgcgatt 420ttcgacacga
cgatcggctg gcgtttcatt aatccgctga tgaaacagca atacggcgtc
480gattcgatgc ccgagacggc cgagaacgtc gcggtcgact acaacatcag
ccgcgccgac 540caggatctat tcgcgctgcg cagccagcag aaggccgcgc
gtgcgcagca ggacggcacg 600ctcgccgccg aaatcgtccc cgtcacgatt
gcgcagaaaa aaggcgacgc gctcgtcgta 660tcgctcgacg agcatccgcg
cgaaacatcg ctcgaagcgc tcgcgaagct gaagggcgtc 720gtgcgtcccg
acggctcggt cacggccggc aacgcgtcag gcgtcaacga cggcgcatgc
780gcactgctgc tcgccaacgc ggaagccgcc gatcaatatg ggctgcgccg
ccgcgcgcgt 840gtcgtcggca tggcgagcgc cggcgtcgag ccgcgcgtga
tgggtatcgg cccggcgccg 900gccacgcaga aactgttgcg ccagctcggc
atgacgatcg accagttcga cgtgatcgag 960ctgaacgaag cgttcgcgtc
gcagggtctc gcggtgctgc gcatgctcgg tgtcgccgac 1020gacgatccgc
gcgtgaaccc caacggcggt gcgatcgcgc tcggccatcc gctcggcgca
1080tcgggtgcgc ggctcgtgac cacggcgctt caccaactcg agcgtacggg
cggccgcttt 1140gcgctctgta cgatgtgcat cggcgtcggc cagggcatcg
cgatcgcgat cgaacgcgtg 1200taa 12034824DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
48atggccacct caagacttgt ctgc 244924DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
49caatttctcg atgaccattc cacc 24501242DNAAscaris suum 50gtgatggcca
cctcaagact tgtctgcagc aatttaacga agcaatgctt tacgatctcg 60tcacgtgctg
ctagccaatt taccgatgtg gtattcgtgg gtgccgcacg aacaccggtc
120ggatcgtttc gctcttcgct ttccactgtt ccagccactg tcctcggagc
tgaggctatt 180aagggtgcac ttaaacatgc caatctaaaa ccctcacaag
tgcaagaggt gttctttggc 240tgtgtcgttc catccaactg tggacaagtt
cctgcccgtc aagcgacact tggagctgga 300tgcgatcctt cgacaatcgt
tacaactctc aataaattgt gcgcctcggg aatgaagtcg 360attgcttgtg
ccgcctcact tttgcaactt ggtcttcaag aggttaccgt tggtggcggt
420atggagagca tgagcttagt gccgtactat cttgaacgtg gtgaaactac
ttatggtgga 480atgaagctca tcgacggtat cccaagagat ggtccgactg
atgcatatag taatcaactt 540atgggtgcat gcgctgataa tgtggctaaa
cgattcaaca tcacccgtga ggaacaggat 600aaattcgcta ttgaaagcta
taaacgatct gctgctgcat gggagagtgg agcatgcaaa 660gctgaagtag
ttcctattga agtgacaaag ggcaagaaaa catacattgt caacaaggat
720gaggaataca tcaaagtcaa cttcgagaag cttcccaaac tgaaacccgc
cttcttgaaa 780gacggaacca tcacggctgg caatgcttca acactgaacg
atggtgctgc ggcagttgtg 840atgacgactg tcgaaggagc gaaaaaatac
ggtgtgaaac cattggcccg attgctctca 900tatggtgatg cggcaacaaa
tccagtcgat tttgctattg caccatcaat ggttatccca 960aaggtactta
aattggctaa tctcgagatc aaggatattg atttgtggga aatcaacgag
1020gctttcgccg ttgttcccct tcattcaatg aagacactcg gtatcgatca
ctcgaaagtg 1080aacattcatg gtggtggcgt atctcttgga catcctattg
gaatgtctgg agctcgaatt 1140atcgttcatc tgattcatgc gttgaaacct
ggccagaaag gctgcgctgc aatctgcaat 1200ggtggcggtg gcgctggtgg
aatggtcatc gagaaattgt aa 1242
* * * * *