U.S. patent application number 12/860799 was filed with the patent office on 2011-05-26 for hyperphotosynthetic organisms.
This patent application is currently assigned to JOULE UNLIMITED, INC.. Invention is credited to Noubar Boghos Afeyan, David Arthur Berry, Eric James Devroe, Brian Green, Sriram Kosuri, Christian Perry Ridley, Dan Eric Robertson, Frank Anthony Skraly.
Application Number | 20110124073 12/860799 |
Document ID | / |
Family ID | 40433766 |
Filed Date | 2011-05-26 |
United States Patent
Application |
20110124073 |
Kind Code |
A1 |
Devroe; Eric James ; et
al. |
May 26, 2011 |
Hyperphotosynthetic Organisms
Abstract
The present disclosure identifies pathways and mechanisms to
confer improved industrial fitness on engineered organisms. It also
discloses engineered organisms having improved industrial fitness.
Synthetic biologic engineering modules are disclosed that provide
for light capture, carbon dioxide fixation, NADH production, NADPH
production, thermotolerance, pH tolerance, flue gas tolerance, salt
tolerance, nutrient independence and near infrared absorbance. The
disclosed engineered organisms can include one or more of these
modules. Also provided are methods of using the engineered organism
to produce carbon-based products of interest, biomass or
pharmaceutical agents.
Inventors: |
Devroe; Eric James; (Malden,
MA) ; Kosuri; Sriram; (Cambridge, MA) ; Berry;
David Arthur; (Brookline, MA) ; Afeyan; Noubar
Boghos; (Lexington, MA) ; Skraly; Frank Anthony;
(Watertown, MA) ; Robertson; Dan Eric; (Belmont,
MA) ; Green; Brian; (Watertown, MA) ; Ridley;
Christian Perry; (Acton, MA) |
Assignee: |
JOULE UNLIMITED, INC.
Cambridge
MA
|
Family ID: |
40433766 |
Appl. No.: |
12/860799 |
Filed: |
August 20, 2010 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12268406 |
Nov 10, 2008 |
7785861 |
|
|
12860799 |
|
|
|
|
60987046 |
Nov 10, 2007 |
|
|
|
61032169 |
Feb 28, 2008 |
|
|
|
61090933 |
Aug 22, 2008 |
|
|
|
Current U.S.
Class: |
435/170 ;
435/252.3; 435/471 |
Current CPC
Class: |
C12P 7/6409 20130101;
C12N 9/1007 20130101; Y02E 50/13 20130101; Y02E 50/10 20130101;
C12P 7/649 20130101; Y02P 60/247 20151101; Y02P 60/20 20151101;
C12P 7/6436 20130101; C12N 15/74 20130101; C12N 15/52 20130101;
C12Y 111/01006 20130101; C12P 7/6463 20130101 |
Class at
Publication: |
435/170 ;
435/252.3; 435/471 |
International
Class: |
C12P 1/04 20060101
C12P001/04; C12N 1/21 20060101 C12N001/21; C12N 15/74 20060101
C12N015/74 |
Claims
1.-55. (canceled)
56. An engineered cyanobacterial cell for fuel production, wherein
said cell comprises a recombinant nucleic acid encoding an enzyme
with fructose-1,6-bisphosphatase activity.
57. The engineered cyanobacterial cell of claim 56, wherein said
enzyme is Thermosynechoccocus elongatus BP-1
fructose-1,6-bisphosphatase.
58. The engineered cyanobacterial cell of claim 57, wherein said
cyanobacterial cell is a Synechococcus species.
59. The engineered cyanobacterial cell of claim 58, wherein said
Synechococcus species is Synechococcus sp. PCC 7002.
60. The engineered cyanobacterial cell of claim 56, wherein said
cyanobacterial cell is a Synechococcus species.
61. The engineered cyanobacterial cell of claim 60, wherein said
Synechococcus species is Synechococcus sp. PCC 7002.
62. A method for increasing flux through the Calvin cycle and
carbon-fixation in a cyanobacterial cell, comprising transforming
said cyanobacterial cell with a nucleic acid encoding an enzyme
with fructose-1,6-bisphosphatase activity.
63. The method of claim 62, wherein said enzyme is
Thermosynechoccocus elongatus BP-1 fructose-1,6-bisphosphatase.
64. The method of claim 63, wherein said cyanobacterial cell is a
Synechococcus species.
65. The method of claim 64, wherein said cyanobacterial cell is
Synechococcus sp. PCC 7002.
66. A method to produce a carbon-based product of interest,
comprising culturing an engineered cyanobacterial cell in the
presence of CO2 and light under conditions suitable to produce a
carbon-based product of interest, wherein said engineered
cyanobacterial cell comprises a recombinant nucleic acid encoding
an enzyme with fructose-1,6-bisphosphatase activity.
67. The method of claim 66, wherein said
fructose-1,6-bisphosphatase is Thermosynechoccocus elongatus BP-1
fructose-1,6-bisphosphatase.
68. The method of claim 66, wherein said cyanobacterial cell is a
Synechococcus species.
69. The method of claim 67, wherein said cyanobacterial cell is
Synechococcus sp. PCC 7002.
70. The method of claim 68, wherein said Synechococcus species is
Synechococcus sp. PCC 7002.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation application of U.S.
application Ser. No. 12/268,406, filed on Nov. 10, 2008, which
claims the benefit of U.S. Provisional Applications 60/987,046,
filed on Nov. 10, 2007; 61/032,169 filed on Feb. 28, 2008; and
61/090,933, filed on Aug. 22, 2008. The contents of each of these
priority applications are incorporated by reference herein for all
purposes.
SEQUENCE LISTING
[0002] This application includes a Sequence Listing submitted
electronically as a text file named "17190US_sequencelisting.txt,"
created on Aug. 20, 2010, with a size of 26,465 bytes. The sequence
listing consists of 22 sequences and is incorporated by
reference.
FIELD
[0003] The present invention relates to the field of synthetic
biology, and more particularly to industrialized photoautotrophic
organisms designed to efficiently convert carbon dioxide and light
into biomass and carbon-based products of interest.
BACKGROUND
[0004] Photosynthesis is a process by which biological entities
utilize sunlight and CO.sub.2 to produce sugars for energy.
Existing photoautotrophic organisms (i.e., plants, algae, and
photosynthetic bacteria) are poorly suited for industrial
bioprocessing. In particular, most organisms have slow doubling
times (10-72 hrs) compared to industrialized heterotrophic
organisms such as Escherichia coli (20 minutes). Additionally,
photoautotrophic organisms are often susceptible to moderate
variations in common environmental stresses including pH,
temperature and salt tolerance. Such susceptibilities make
industrial applications of photoautotrophs inefficient. Moreover,
increasingly toxic environmental factors (for example, toxic
pollutants including heavy metals, nitrogen and sulfer based
industrial by-products) can further limit applications of
photoautotrophs to particular industrial uses.
[0005] Desirable products which can potentially be produced in
microorganisms (for example ethanol and other branched chain higher
alcohols produced in engineered E. coli (Atsumi, et al. Nature
(2008) vol 451:86-90)) have been found difficult to process in
photoautotrophs because of incompatible or inefficient metabolic
pathways of production or the complete absence of necessary cell
based biocatalysts.
[0006] Thus, there is need in the art for improved photoautotrophic
organisms that are better suited for industrial bioprocessing.
SUMMARY
[0007] The present invention provides methods and compositions for
engineering pathways that stably utilize photosynthetic organisms
by, e.g., genetically improving their light capture and carbon
fixation efficiencies and by optimizing their growth properties for
propagation in photobioreactors. The present invention also
provides the resulting engineered "HyperPhotosynthetic" cells and
organisms that enable efficient conversion of carbon dioxide and
light into carbon-based products of interest.
[0008] Provided herein is an engineered photosynthetic cell
comprising: at least one engineered nucleic acid selected from the
group consisting of a light capture nucleic acid, a carbon dioxide
fixation pathway nucleic acid, an NADH pathway nucleic acid, an
NADPH pathway nucleic acid, a thermotolerance nucleic acid, a pH
tolerance nucleic acid, a flue gas tolerance nucleic acid, a salt
tolerance nucleic acid, a nutrient independence nucleic acid and a
near infrared absorbance nucleic acid wherein said engineered cell
expresses a heterologous protein encoded by said engineered nucleic
acid, overexpresses an endogenous protein as a result of the
presence of said engineered nucleic acid, downregulates an
endogenous protein as a result of the presence of said engineered
nucleic acid, or has a gene knocked-out as a result of the presence
of said engineered nucleic acid.
[0009] Also provided herein is an engineered cell comprising a
plurality of engineered light capture nucleic acids, carbon dioxide
fixation pathway nucleic acids, NADH pathway nucleic acids, NADPH
pathway nucleic acids, thermotolerance nucleic acids, pH tolerance
nucleic acids, flue gas tolerance nucleic acids, salt tolerance
nucleic acids, nutrient independence nucleic acids and near
infrared absorbance nucleic acids.
[0010] The invention also provides an engineered photosynthetic
cell comprising an engineered carbon fixation pathway nucleic acid
encoding one or more proteins selected from the group consisting of
3-hydroxypropionate cycle protein, Calvin cycle protein,
carbon-acetyl-CoA flux protein, gluconeogenesis pathway protein,
glyoxylate shunt pathway protein, pyruvate synthesis pathway
protein, reductive TCA cycle protein and Woods-Ljungdahl pathway
protein.
[0011] The invention also provides an engineered photosynthetic
cell comprising an engineered NADH pathway nucleic acid encoding
one or more proteins selected from the group consisting of
NAD.sup.+-dependent isocitrate dehydrogenase--idh1 protein;
NAD.sup.+-dependent isocitrate dehydrogenase--idh2 protein; malate
dehydrogenase protein; soluble pyridine nucleotide transhydrogenase
(sthA or udhA) protein; membrane-bound pyridine nucleotide
transhydrogenase, subunit alpha, pntA protein; membrane-bound
pyridine nucleotide transhydrogenase, subunit beta, pntB protein;
and NADH:ubiquinone oxidoreductase (nuo) operon protein.
[0012] The invention also provides an engineered photosynthetic
cell comprising an engineered NADPH pathway nucleic acid encoding
one or more proteins selected from the group consisting of a
glucose-6-phosphate dehydrogenase; zwf protein;
6-phosphogluconolactonase--pgl protein; 6-phosphogluconate
dehydrogenase, gnd protein; NADP-dependent isocitrate dehydrogenase
protein; NADP-dependent malic enzyme; soluble pyridine nucleotide
transhydrogenase (sthA or udhA) protein; membrane-bound pyridine
nucleotide transhydrogenase, subunit alpha, pntA protein; and
membrane-bound pyridine nucleotide transhydrogenase, subunit beta,
pntB protein.
[0013] The invention also provides an engineered photosynthetic
cell comprising an engineered thermotolerance nucleic acid encoding
one or more proteins selected from the group consisting of betaine
biosynthesis protein; photosystem stability and repair protein; and
protein folding protein.
[0014] The invention also provides an engineered photosynthetic
cell comprising an engineered pH tolerance nucleic acid encoding
one or more proteins selected from the group consisting of
glutamate decarboxylase A (GadA) protein; glutamate decarboxylase
beta (GadB) protein; glutamate:gamma-aminobutyric acid antiporter
(GadC) protein; biodegradative arginine decarboxylase (AdiA)
protein; arginine:agmatin antiporter (AdiC) protein; chaperone
protein dnaK2 (DnaK) protein; DNA-directed RNA polymerase, sigma
subunit (sll0306) protein; Zn-dependent protease (sll0528) protein;
metal-dependent phosphoesterase (sll0549) protein; acid-stress
related membrane protein (sll0939) protein; heat shock molecular
chaperone (sll1514) protein; mannose-1-phosphate guanyltransferase
(sll1558) protein; RNA polymerase sigma factor (sll2012) protein;
carboxyl-terminal processing protease (slr0008) protein; molecular
chaperone (slr0093) protein; geranylgeranyl pyrophosphate synthase
(slr0611) protein; CheY-like receiver (slr1214) protein; signal
transduction histidine kinase (slr1285) protein; superoxide
dismutase (slr1516) protein; hydrogenase expression/formation
protein (slr1675) protein; esterase (slr1916) protein; hydrogenase
component protein (ssl3044) protein; chloride channel protein; and
acid-stress tolerance protein.
[0015] In addition, the invention further provides an engineered
photosynthetic cell comprising an engineered flue gas tolerance
nucleic acid encoding one or more proteins selected from the group
consisting of NO.sub.x tolerance protein, SO.sub.x tolerance
protein, mercury tolerance protein, metal tolerance protein and
particulate aerosol tolerance protein.
[0016] In yet another embodiment, the invention provides an
engineered photosynthetic cell comprising an engineered salt
tolerance nucleic acid encoding one or more proteins selected from
the group comprising Na.sup.+/H.sup.+ antiporter protein (apnhaP),
catalase protein (katG), salt and cadmium stress related protein
(CW80Cd404), breast basic conserved protein (bbc1) and betaine
biosynthesis protein.
[0017] In still another embodiment, the invention provides an
engineered photosynthetic cell comprising an engineered near
infrared absorbance nucleic acid, wherein the nucleic acid
comprises a chlorophyll d biosynthetic nucleic acid.
[0018] In still another embodiment, the invention provides an
engineered photosynthetic cell comprising an engineered nutrient
independence nucleic acid encoding one or more a proteins selected
from the group consisting of an ammonia assimilation protein, a
nitrate/nitrite assimilation protein, a nitrate/nitrite
assimilation-nitrite tolerance protein, a nitrogen fixation
protein, an urea assimilation protein, a Vitamin B.sub.12
biosynthesis protein, a Vitamin B.sub.12 biosynthesis--Co.sup.2+
transport protein and a Vitamin B.sub.12 independence protein. In
certain related embodiments, the Vitamin B.sub.12 biosynthesis
protein comprises one or more proteins selected from the group
consisting of uroporphyrin-III C-methyltransferase cobaltochelatase
(cysG) protein; sirohydrochlorin cobaltochelatase (cbiK) protein;
precorrin-2 C20-methyltransferase (cbiL) protein; precorrin-3B
methylase (cbiH) protein; bifunctional CbiG/precorrin
methyltransferase (cbiG) protein; precorrin-4 C11-methyltransferase
(cbiF) protein; cobalamin biosynthesis protein (cbiD);
NADPH-dependent precorrin-6A reductase (cbiJ) protein; precorrin-6B
C5,15-methyltransferase (cbiE) protein; precorrin-6B C12
decarboxylase (cbiT) protein; precorrin-8X-methylmutase (cbiC)
protein; cobyrinic acid A,C-diamide synthase (cbiA) protein;
cob(I)yrinic acid a,c-diamide adenosyltransferase (btuR) protein;
cobyrinic acid synthase (cbiP) protein; cobyric acid decarboxylase
(cobD) protein; adenosylcobinamide-phosphate synthase (cbiB)
protein; alpha ribazole-5'-P phosphatase (cobC) protein;
cobalamin(5'-phosphate) synthase (cobS) protein; cobinamide
phosphate guanylyl transferase (cobU) protein; and
nicotinate-nucleotide dimethylbenzimidazole-P phosphoribosyl
transferase (cobT) protein. In yet another related embodiment, the
Vitamin B.sub.12 biosynthesis--Co.sup.2+ transport protein
comprises one or more proteins selected from the group consisting
of ABC-type Co.sup.2+ transport system, permease component protein;
ABC-type cobalt transport system, periplasmic component protein;
and ABC-type cobalt transport system, permease component protein.
In other related embodiments, the Vitamin B.sub.12 independence
protein comprises one or more proteins selected from the group
consisting of 5-methyltetrahydropteroyltriglutamate-homocysteine
methyltransferase (metE) protein; ribonucleoside-diphosphate
reductase, alpha subunit (nrdA) protein; and
ribonucleoside-diphosphate reductase, beta subunit (nrdB) protein.
In a related embodiment, the metE protein is from Escherichia coli
K12 (accession number NP.sub.--418273.1 (SEQ ID NO: 20)) or
Thermosynechococcus elongatus BP-1 (accession number
NP.sub.--681881 (SEQ ID NO: 21)).
[0019] In various embodiments of the invention, the engineered
nucleic acid encodes a heterologous protein that is expressed by
the engineered cell, causes overexpression of an endogenous protein
within the engineered cell, causes downregulation of an endogenous
protein in the engineered cell, or causes a gene knock-out in the
engineered cell.
[0020] In another embodiment of the invention, the engineered cell
is used to produce biomass, carbon-based products of interest or
pharmaceutical agents.
[0021] In yet other embodiments, the invention provides an
engineered carbon-fixing cell comprising at least one engineered
nucleic acid selected from the group consisting of thermotolerance
nucleic acid, pH tolerance nucleic acid, flue gas tolerance nucleic
acid, salt tolerance nucleic acid, nutrient independence nucleic
acid and near infrared absorbance nucleic acid, wherein said
engineered cell expresses heterologous protein encoded by said
engineered nucleic acid, overexpresses endogenous protein as a
result of the presence of said engineered nucleic acid,
downregulates endogenous protein as a result of the presence of
said engineered nucleic acid, or has a gene knocked-out as a result
of the presence of said engineered nucleic acid is provided.
[0022] In certain embodiments of the invention, the engineered cell
is an autotrophic cell. In certain other embodiments, the
engineered cell is a photoautotrophic cell. In various embodiments
of the invention, the engineered cell is selected from a group
consisting of plant, prokaryote, eukaryote, yeast, filamentous
fungi, protozoa, algae and synthetic cells.
[0023] Also disclosed is a method to produce carbon-based products
of interest, comprising the steps of: a) engineering a cell to
express at least one engineered nucleic acid selected from the
group consisting of light capture nucleic acid, carbon dioxide
fixation pathway nucleic acid, NADH pathway nucleic acid, NADPH
pathway nucleic acid, thermotolerance nucleic acid, pH tolerance
nucleic acid, flue gas tolerance nucleic acid, salt tolerance
nucleic acid, nutrient independence nucleic acid and near infrared
absorbance nucleic acid; b) said cell expressing a heterologous
protein encoded by said engineered nucleic acid, overexpressing
endogenous protein as a result of the presence of said engineered
nucleic acid, downregulating endogenous protein as a result of the
presence of said engineered nucleic acid, or having a gene
knocked-out as a result of the presence of said engineered nucleic
acid; and c) culturing said cell in the presence of CO.sub.2 and
light to produce the carbon-based products of interest.
FIGURES
[0024] FIG. 1 provides Table 1 which identifies genes that can be
expressed or upregulated in association with the engineering of
various modules of the invention.
[0025] FIG. 2 provides Table 2 which identifies genes that can be
downregulated or knocked out in association with the engineering of
various modules of the invention.
[0026] FIG. 3 depicts viability of wild-type and genetically
engineered Synechococcus sp. PCC 7002 on A.sup.+ media agarose
plates without B12.
[0027] FIG. 4 provides synthetic schemes for chlorophyll d (Chl d)
derivation from chlorophyll a (Chl a) with Chlorophyllide, a
precursor of Chl, shown here for simplicity.
[0028] FIG. 5 provides a query sequence (SEQ ID NO: 19) for an
epoxide hydrolase search.
[0029] FIG. 6 provides Table 3 which lists genes identified as
those encoding oxygenases in the A. marina genome.
[0030] FIG. 7 provides Table 4 which lists genes identified as
those encoding epoxide reductases in the A. marina genome.
[0031] FIG. 8 provides Table 5 which lists genes identified as
those encoding SAM-utilizing oxygenases in the A. marina
genome.
[0032] FIG. 9 provides Table 6 which lists genes identified as
those encoding photosystem proteins in the A. marina genome.
[0033] FIG. 10A is a photograph of an agarose gel showing PCR
confirmation of transgenic Synechococcus sp. PCC7002 strains:
JCC1-UdhA (lanes 2 and 3); JCC1-ZWF (lane 4); and JCC1-SAR86 (lane
5). FIG. 10B is a photograph of an agarose gel showing PCR products
from JCC136.
[0034] FIG. 11 depicts a graph of ethanol production (left) and
ethanol to OD ratio (right) as a function of time in Synechococcus
sp. PCC7002 strains JCC136 and JCC136-FbpI.
SEQUENCE LISTING
[0035] The amino acid sequences listed in the accompanying sequence
listing are shown using standard letter abbreviations for amino
acid residues, as defined in 37 C.F.R. 1.822. In the accompanying
amino acid sequence listing:
ABBREVIATIONS AND TERMS
[0036] The following explanations of terms and methods are provided
to better describe the present disclosure and to guide those of
ordinary skill in the art in the practice of the present
disclosure. As used herein, "comprising" means "including" and the
singular forms "a" or "an" or "the" include plural references
unless the context clearly dictates otherwise. For example,
reference to "comprising a cell" includes one or a plurality of
such cells, and reference to "comprising a thioesterase" includes
reference to one or more thioesterase peptides and equivalents
thereof known to those of ordinary skill in the art, and so forth.
The term "or" refers to a single element of stated alternative
elements or a combination of two or more elements, unless the
context clearly indicates otherwise.
[0037] Unless explained otherwise, all technical and scientific
terms used herein have the same meaning as commonly understood to
one of ordinary skill in the art to which this disclosure belongs.
Although methods and materials similar or equivalent to those
described herein can be used in the practice or testing of the
present disclosure, suitable methods and materials are described
below. The materials, methods, and examples are illustrative only
and not intended to be limiting. Other features of the disclosure
are apparent from the following detailed description and the
claims.
[0038] Accession Numbers: The accession numbers throughout this
description correspond to those found in the following databases:
NCBI (National Center for Biotechnology Information), TIGR (The
Institute for Genomic Research), and KEGG (Kyoto Encyclopedia of
Genes and Genomes). The accession numbers are as provided in the
databases on Nov. 10, 2007.
[0039] Enzyme Classification Numbers (EC): The EC numbers provided
throughout this description are derived from the KEGG Ligand
database, maintained by the Kyoto Encyclopedia of Genes and
Genomics, sponsored in part by the University of Tokyo. The EC
numbers are as provided in the database on Nov. 10, 2007.
[0040] DNA: Deoxyribonucleic acid. DNA is a long chain polymer
which includes the genetic material of most living organisms (some
viruses have genes including ribonucleic acid, RNA). The repeating
units in DNA polymers are four different nucleotides, each of which
includes one of the four bases, adenine, guanine, cytosine and
thymine bound to a deoxyribose sugar to which a phosphate group is
attached.
[0041] Codon: Triplets of nucleotides, referred to as codons, in
DNA molecules code for amino acids in a peptide. The term codon is
also used for the corresponding (and complementary) sequences of
three nucleotides in the mRNA into which the DNA sequence is
transcribed.
[0042] Endogenous: As used herein with reference to a nucleic acid
molecule and a particular cell or microorganism refers to a nucleic
acid sequence or peptide that is in the cell and was not introduced
into the cell using recombinant engineering techniques. For
example, a gene that was present in the cell when the cell was
originally isolated from nature is considered to be endogenous. A
gene is still considered endogenous if the control sequences, such
as a promoter or enhancer sequences that activate transcription or
translation have been altered through recombinant techniques.
[0043] Exogenous: As used herein with reference to a nucleic acid
molecule and a particular cell or microorganism refers to a nucleic
acid sequence or peptide that was not present in the cell when the
cell was originally isolated from nature. For example, a nucleic
acid that originated in a different microorganism and was
engineered into an alternate cell using recombinant DNA techniques
or other methods for delivering said nucleic acid is considered to
be exogenous.
[0044] Expression: The process by which a gene's coded information
is converted into the molecules that support the structures and
functions of a cell, such as a protein, transfer RNA, or ribosomal
RNA. Expressed genes include those that are transcribed into mRNA
and then translated into protein and those that are transcribed
into RNA but not translated into protein (for example, transfer and
ribosomal RNAs).
[0045] Overexpression: Overexpression refers to any state in which
a gene is caused to be transcribed at an elevated rate as compared
to the endogenous transcription rate for that gene. In some
examples, overexpression additionally includes an elevated rate of
translation of the gene compared to the endogenous translation rate
for that gene. Methods of testing for overexpression are well known
in the art, for example transcribed RNA levels can be assessed
using reverse transcriptase polymerase chain reaction (RT-PCR) and
protein levels can be assessed using sodium dodecyl sulfate
polyacrylamide gel electrophoresis (SDS-PAGE) analysis.
Furthermore, a gene is considered to be overexpressed when it
exhibits elevated activity compared to its endogenous activity,
which may occur, for example, through reduction in concentration or
activity of its inhibitor, or via expression of mutant version with
elevated activity. In preferred embodiments, when the host cell
encodes an endogenous gene with a desired biochemical activity, it
is useful to overexpress an exogenous gene, which allows for more
explicit regulatory control in the bioprocessing and a means to
potentially mitigate the effects of central metabolism regulation,
which is focused around the native genes explicitly.
[0046] Downregulation: Downregulation refers to any state in which
a gene is caused to be transcribed at a reduced rate compared to
the endogenous gene transcription rate for that gene. In certain
embodiments, gene expression is downregulated via expression of
nucleic acids, such as antisense oligonucleotides, double-stranded
RNA, small interfering RNA, small hairpin RNA, microRNAs,
ribozymes, and the like. In some examples, downregulation
additionally includes a reduced level of translation of the gene
compared to the endogenous translation rate for that gene.
Furthermore, a gene is considered to be downregulated when it
exhibits decreased activity compared to its endogenous activity,
which may occur, for example, through an increase in concentration
or activity of its inhibitor, or via expression of mutant version
with reduced activity. Methods of testing for downregulation are
well known to those in the art, for example the transcribed RNA
levels can be assessed using RT-PCR and proteins levels can be
assessed using SDS-PAGE analysis.
[0047] Knock-out: A gene whose level of expression or activity has
been reduced to zero. In some examples, a gene is knocked-out via
deletion or replacement of some or all of its coding sequence. In
other examples, a gene is knocked-out via introduction or removal
of one or more nucleotides into its open-reading frame, which
results in translation of a non-sense or otherwise non-functional
protein product.
[0048] Autotroph: Autotrophs (or autotrophic organisms) are
organisms that produce complex organic compounds from simple
inorganic molecules and an external source of energy, such as light
(photoautotroph) or chemical reactions of inorganic compounds.
[0049] Heterotroph: Heterotrophs (or heterotrophic organisms) are
organisms that, unlike autotrophs, cannot derive energy directly
from light or from inorganic chemicals, and so must feed on organic
carbon substrates. They obtain chemical energy by breaking down the
organic molecules they consume. Heterotrophs include animals,
fungi, and numerous types of bacteria.
[0050] Hyperphotosynthetic: a cell or organism expressing
photosynthetic proteins that through recombinant DNA techniques has
been specifically engineered to express endogenous and/or exogenous
nucleic acids that result in one or more functional improvements
related to industrial bioprocessing and the conversion of carbon
dioxide and light into reduced carbon products or cell mass. A
Hyperphotosynthetic cell also encompasses a cell or organism
engineered as described above that has been evolved or mutagenized
to achieve one or more functional improvements.
[0051] Hydrocarbon: generally refers to a chemical compound that
consists of the elements carbon (C), optionally oxygen (O), and
hydrogen (H).
[0052] Biosynthetic pathway: Also referred to as "metabolic
pathway," refers to a set of anabolic or catabolic biochemical
reactions for converting (transmuting) one chemical species into
another. For example, a hydrocarbon biosynthetic pathway refers to
the set of biochemical reactions that convert inputs and/or
metabolites to hydrocarbon product-like intermediates and then to
hydrocarbons or hydrocarbon products. Anabolic pathways involve
constructing a larger molecule from smaller molecules, a process
requiring energy. Catabolic pathways involve breaking down of
larger: molecules, often releasing energy.
[0053] Cellulose: Cellulose [(C.sub.6H.sub.10O.sub.5).sub.n] is a
long-chain polymer polysaccharide carbohydrate, of beta-glucose. It
forms the primary structural component of plants and is not
digestible by humans. Cellulose is a common material in plant cell
walls and was first noted as such in 1838. It occurs naturally in
almost pure form only in cotton fiber; in combination with lignin
and any hemicellulose, it is found in all plant material.
[0054] Surfactants: Surfactants are substances capable of reducing
the surface tension of a liquid in which they are dissolved. They
are typically composed of a water-soluble head and a hydrocarbon
chain or tail. The water soluble group is hydrophilic and can be
either ionic or nonionic, and the hydrocarbon chain is
hydrophobic.
[0055] Biofuel: A biofuel is any fuel that derives from a
biological source.
[0056] Engineered nucleic acid: An "engineered nucleic acid" is a
nucleic acid molecule that includes at least one difference from a
naturally-occurring nucleic acid molecule. An engineered nucleic
acid includes all exogenous modified and unmodified heterologous
sequences (i.e., sequences derived from an organism or cell other
than that harboring the engineered nucleic acid) as well as
endogenous genes, operons, coding sequences, or non-coding
sequences, that have been modified, mutated, or that include
deletions or insertions as compared to a naturally-occurring
sequence. Engineered nucleic acids also include all sequences,
regardless of origin, that are linked to an inducible promoter or
to another control sequence with which they are not naturally
associated. Engineered nucleic acids further include all sequences
that can be used to down-regulate or knock out expression of an
endogenous gene. These include anti-sense molecules, RNAi
molecules, constructs for producing homologous recombination,
cre-lox constructs, and the like.
[0057] Light capture nucleic acid: A "light capture nucleic acid"
refers to a nucleic acid that alone or in combination with another
nucleic acid encodes one or more proteins that convert light energy
(i.e., photons) into chemical energy such as a proton gradient,
reducing power, or a molecule containing at least one high-energy
phosphate bond such as ATP or GTP. Exemplary light capture nucleic
acids include those encoding light-activated proton pumps such as
rhodopsin, xanthorhodopsin, proteorhodopsin and bacteriorhodopsin,
as well as nucleic acids encoding proteins that directly (light
harvesting complexes, LHC I and LHC II) or indirectly (truncated
light harvesting antenna, tla1) modulate light harvesting capture
efficiencies. A light capture nucleic acids further includes a
nucleic acid used to reduce the expression of or knock out one or
more endogenous genes whose expression reduces light capture.
[0058] Carbon dioxide fixation pathway nucleic acid: A "carbon
dioxide fixation pathway nucleic acid" refers to a nucleic acid
that alone or in combination with another nucleic acid encodes a
protein that enables autotrophic carbon fixation. A carbon dioxide
fixation pathway nucleic acid also includes nucleic acids that
direct carbon flux to key cellular intermediates required for
efficient growth or carbon-based product formation, such as
acetyl-CoA. Exemplary carbon dioxide fixation pathway nucleic acids
includes those encoding propionyl-CoA carboxylase, pyruvate
synthase, formate dehydrogenase, and ribulose-1,5-bisphosphate
carboxylase/oxygenase (RuBisCO). A carbon dioxide fixation pathway
nucleic acids further includes a nucleic acid used to reduce the
expression of or knock out one or more endogenous genes whose
expression reduces carbon dioxide fixation.
[0059] NADH pathway nucleic acid: A "NADH pathway nucleic acid"
refers to a nucleic acid that alone or in combination with another
nucleic acid encodes a protein to maintain an appropriately
balanced supply of reduced NAD for carrying out carbon fixation.
Exemplary NADH pathway nucleic acids include those encoding an
NAD.sup.+-dependent isocitrate dehydrogenase and malate
dehydrogenase. A NADH pathway nucleic acid further includes a
nucleic acid used to reduce the expression of or knock out one or
more endogenous genes whose expression detracts from maintaining an
appropriately balanced supply of reduced NAD for carrying out
carbon fixation and other necessary biological processes.
[0060] NADPH pathway nucleic acid: A "NADPH pathway nucleic acid"
refers to a nucleic acid that alone or in combination with another
nucleic acid encodes a protein to maintain an appropriately
balanced supply of reduced NADPH for carrying out carbon fixation.
Exemplary NADPH pathway nucleic acids include those encoding
phosphogluconolactonase and soluble pyridine nucleotide
transhydrogenase. A NADPH pathway nucleic acid further includes a
nucleic acid used to reduce the expression of or knock out one or
more endogenous genes whose expression detracts from maintaining an
appropriately balanced supply of reduced NADP for carrying out
carbon fixation and other necessary biological processes.
[0061] Thermotolerance nucleic acid: A "thermotolerance nucleic
acid" refers to a nucleic acid that alone or in combination with
another nucleic acid encodes a protein whose overexpression,
downregulation, or inhibition results in an increase in
thermotolerance. Exemplary thermotolerance nucleic acids include
those encoding ClpC/Hsp100, groESL1, HspA, and PsbU. A
thermotolerance nucleic acid further includes a nucleic acid used
to reduce the expression of or knock out one or more endogenous
genes whose expression impairs thermotolerance
[0062] pH tolerance nucleic acid: A "pH tolerance nucleic acid"
refers to a nucleic acid that alone or in combination with another
nucleic acid encodes a protein whose overexpression,
downregulation, or inhibition enables growth at an elevated or
reduced pH. Exemplary pH tolerance nucleic acids include those
encoding glutamate decarboxylase and superoxide dismutase. A pH
tolerance nucleic acid further includes a nucleic acid used to
reduce the expression of or knock out one or more endogenous genes
whose expression impairs pH tolerance.
[0063] Flue gas tolerance: A "Flue gas tolerance nucleic acid"
refers to a nucleic acid that alone or in combination with another
nucleic acid encodes a protein whose overexpression,
downregulation, or inhibition enables growth in the presence flue
gas components including carbon dioxide, SO.sub.x, NO.sub.x, and
N.sub.2. Exemplary flue gas tolerance nucleic acids include those
encoding superoxide dismutase, catalase, cysteine synthase, and
NirK. A flue gas tolerance nucleic acid further includes a nucleic
acid used to reduce the expression of or knock out one or more
endogenous genes whose expression impairs flue gas tolerance.
[0064] Nutrient independence nucleic acid: A "nutrient independence
nucleic acid" refers to a nucleic acid that alone or in combination
with another nucleic acid encodes a protein whose overexpression,
downregulation, or inhibition enables propagation in the absence
of, or under reduced concentrations of, an exogenous nutrient.
Exemplary nutrient independence nucleic acids include those
encoding MetE and NrdB. A nutrient independence gene further
includes a nucleic acid used to reduce the expression of or knock
out one or more endogenous genes whose expression impairs
propagation in the absence of, or under reduced concentrations of,
an exogenous nutrient.
[0065] Salt-tolerance nucleic acid: A "salt tolerance nucleic acid"
refers to a nucleic acid that alone or in combination with another
nucleic acid encodes a protein whose overexpression,
downregulation, or inhibition enables propagation under conditions
of elevated salinity, such as sea water Exemplary salt tolerance
nucleic acids include those encoding Na+/H+ antiporter, and breast
basic conserved.
[0066] Acetyl-CoA flux nucleic acid: An "acetyl-CoA flux nucleic
acid" refers to a nucleic acid that alone or in combination with
another nucleic acid encodes a protein whose overexpression,
downregulation, or inhibition results in an increase in acetyl-CoA
produced over a unit of time. Example nucleic acids that may be
overexpressed include pantothenate kinase and pyruvate
dehydrogenase. Nucleic acids that may be downregulated, inhibited,
or knocked-out include acyl coenzyme A dehydrogenase, biosynthetic
glycerol 3-phosphate dehydrogenase, and lactate dehydrogenase.
[0067] Chlorophyll d nucleic acid: A "chlorophyll d nucleic acid"
refers to a nucleic acid that alone or in combination with another
nucleic acid encodes a protein whose overexpression,
downregulation, or inhibition results in the biosynthesis of
chlorophyll d and its incorporation in reaction centers,
photosystem (PS)I and PSII. A chlorophyll d nucleic acid enables
propagation under, e.g., conditions in which the photosynthetically
available radiation is likely completely used by organisms that
absorb light using chlorophyll a and/or chlorophyll b such that the
environment has low visible light intensity but high near infrared
intensity where no other photosynthetic organisms absorb strongly
so that an organism that uses chlorophyll d for light capture can
thrive. Alternatively, a chlorophyll d nucleic acid enables
propagation under conditions in which the wavelength of artificial
light used for illumination is selected to allow propagation of an
organism that uses chlorophyll d for light capture.
[0068] Sequence identity: The terms "identical" or percent
"identity," in the context of two or more nucleic acids or
polypeptide sequences, refer to two or more sequences or
subsequences that are the same or have a specified percentage of
amino acid residues or nucleotides that are the same (i.e., about
60% identity, preferably 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%,
93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher identity over a
specified region, when compared and aligned for maximum
correspondence over a comparison window or designated region) as
measured using a BLAST or BLAST 2.0 sequence comparison algorithms
with default parameters described below, or by manual alignment and
visual inspection (see, e.g., NCBI web site or the like). Such
sequences are then said to be "substantially identical." This
definition also refers to, or may be applied to, the compliment of
a test sequence. The definition also includes sequences that have
deletions and/or additions, as well as those that have
substitutions. As described below, the preferred algorithms can
account for gaps and the like. Preferably, identity exists over a
region that is at least about 25 amino acids or nucleotides in
length, or more preferably over a region that is 50-100 amino acids
or nucleotides in length.
[0069] For sequence comparison, typically one sequence acts as a
reference sequence, to which test sequences are compared. When
using a sequence comparison algorithm, test and reference sequences
are entered into a computer, subsequence coordinates are
designated, if necessary, and sequence algorithm program parameters
are designated. Preferably, default program parameters can be used,
or alternative parameters can be designated. The sequence
comparison algorithm then calculates the percent sequence
identities for the test sequences relative to the reference
sequence, based on the program parameters.
[0070] Comparison window: A "comparison window," as used herein,
includes reference to a segment of any one of the number of
contiguous positions selected from the group consisting of from 20
to 600, usually about 50 to about 200, more usually about 100 to
about 150 in which a sequence may be compared to a reference
sequence of the same number of contiguous positions after the two
sequences are optimally aligned. Methods of alignment of sequences
for comparison are well-known in the art. Optimal alignment of
sequences for comparison can be conducted, e.g., by the local
homology algorithm of Smith & Waterman, Adv. Appl. Math. 2:482
(1981), by the homology alignment algorithm of Needleman &
Wunsch, J. Mol. Biol. 48:443 (1970), by the search for similarity
method of Pearson & Lipman, Proc. Nat'l. Acad. Sci. USA 85:2444
(1988), by computerized implementations of these algorithms (GAP,
BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software
Package, Genetics Computer Group, 575 Science Dr., Madison, Wis.),
or by manual alignment and visual inspection (see, e.g., Current
Protocols in Molecular Biology (Ausubel et al., eds. 1995
supplement)).
[0071] A preferred example of algorithm that is suitable for
determining percent sequence identity and sequence similarity are
the BLAST and BLAST 2.0 algorithms, which are described in Altschul
et al., Nuc. Acids Res. 25:3389-3402 (1977) and Altschul et al., J.
Mol. Biol. 215:403-410 (1990), respectively. BLAST and BLAST 2.0
are used, with the parameters described herein, to determine
percent sequence identity for the nucleic acids and proteins of the
invention. Software for performing BLAST analyses is publicly
available through the National Center for Biotechnology Information
website. This algorithm involves first identifying high scoring
sequence pairs (HSPs) by identifying short words of length W in the
query sequence, which either match or satisfy some positive-valued
threshold score T when aligned with a word of the same length in a
database sequence. T is referred to as the neighborhood word score
threshold (Altschul et al., supra). These initial neighborhood word
hits act as seeds for initiating searches to find longer HSPs
containing them. The word hits are extended in both directions
along each sequence for as far as the cumulative alignment score
can be increased. Cumulative scores are calculated using, for
nucleotide sequences, the parameters M (reward score for a pair of
matching residues; always >0) and N (penalty score for
mismatching residues; always <0). For amino acid sequences, a
scoring matrix is used to calculate the cumulative score. Extension
of the word hits in each direction are halted when: the cumulative
alignment score falls off by the quantity X from its maximum
achieved value; the cumulative score goes to zero or below, due to
the accumulation of one or more negative-scoring residue
alignments; or the end of either sequence is reached. The BLAST
algorithm parameters W, T, and X determine the sensitivity and
speed of the alignment. The BLASTN program (for nucleotide
sequences) uses as defaults a wordlength (W) of 11, an expectation
(E) of 10, M=5, N=-4 and a comparison of both strands. For amino
acid sequences, the BLASTP program uses as defaults a wordlength of
3, and expectation (E) of 10, and the BLOSUM62 scoring matrix (see
Henikoff & Henikoff, Proc. Natl. Acad. Sci. USA 89:10915
(1989)) alignments (B) of 50, expectation (E) of 10, M=5, N=-4, and
a comparison of both strands.
DETAILED DESCRIPTION OF THE INVENTION
Organisms
[0072] The instant invention enables conversion of a
photoautotrophic organism into a Hyperphotosynthetic organism.
Photoautotrophic organisms include eukaryotic plants and algae, as
well as prokaryotic cyanobacteria, green-sulfur bacteria, green
non-sulfur bacteria, purple sulfur bacteria, and purple non-sulfur
bacteria.
[0073] Plants include but are not limited to the following genera:
Arabidopsis, Beta, Glycine, Jatropha, Miscanthus, Panicum,
Phalaris, Populus, Saccharum, Salix Simmondsia, and Zea.
[0074] Algae and cyanobacteria include but are not limited to the
following genera: Acanthoceras, Acanthococcus, Acaryochloris,
Achnanthes, Achnanthidium, Actinastrum, Actinochloris,
Actinocyclus, Actinotaenium, Amphichrysis, Amphidinium,
Amphikrikos, Amphipleura, Amphiprora, Amphithrix, Amphora,
Anabaena, Anabaenopsis, Aneumastus, Ankistrodesmus, Ankyra,
Anomoeoneis, Apatococcus, Aphanizomenon, Aphanocapsa, Aphanochaete,
Aphanothece, Apiocystis, Apistonema, Arthrodesmus, Artherospira,
Ascochloris, Asterionella, Asterococcus, Audouinella, Aulacoseira,
Bacillaria, Balbiania, Bambusina, Bangia, Basichlamys,
Batrachospermum, Binuclearia, Bitrichia, Blidingia, Botrdiopsis,
Botrydium, Botryococcus, Botryosphaerella, Brachiomonas,
Brachysira, Brachytrichia, Brebissonia, Bulbochaete, Bumilleria,
Bumilleriopsis, Caloneis, Calothrix, Campylodiscus, Capsosiphon,
Carteria, Catena, Cavinula, Centritractus, Centronella, Ceratium,
Chaetoceros, Chaetochloris, Chaetomorpha, Chaetonella, Chaetonema,
Chaetopeltis, Chaetophora, Chaetosphaeridium, Chamaesiphon, Chara,
Characiochloris, Characiopsis, Characium, Charales, Chilomonas,
Chlainomonas, Chlamydoblepharis, Chlamydocapsa, Chlamydomonas,
Chlamydomonopsis, Chlamydomyxa, Chlamydonephris, Chlorangiella,
Chlorangiopsis, Chlorella, Chlorobotrys, Chlorobrachis,
Chlorochytrium, Chlorococcum, Chlorogloea, Chlorogonium,
Chlorolobion, Chloromonas, Chlorophysema, Chlorophyta,
Chlorosaccus, Chlorosarcina, Choricystis, Chromophyton, Chromulina,
Chroococcidiopsis, Chroococcus, Chroodactylon, Chroomonas,
Chroothece, Chrysamoeba, Chrysapsis, Chrysidiastrum, Chrysocapsa,
Chrysocapsella, Chrysochaete, Chrysochromulina, Chrysococcus,
Chrysocrinus, Chrysolepidomonas, Chrysolykos, Chrysonebula,
Chrysophyta, Chrysopyxis, Chrysosaccus, Chrysophaerella,
Chrysostephanosphaera, Clodophora, Clastidium, Closteriopsis,
Closterium, Coccomyxa, Cocconeis, Coelastrella, Coelastrum,
Coelosphaerium, Coenochloris, Coenococcus, Coenocystis, Colacium,
Coleochaete, Collodictyon, Compsogonopsis, Compsopogon,
Conjugatophyta, Conochaete, Coronastrum, Cosmarium, Cosmioneis,
Cosmocladium, Crateriportula, Craticula, Crinalium, Crucigenia,
Crucigeniella, Cryptoaulax, Cryptomonas, Cryptophyta, Ctenophora,
Cyanodictyon, Cyanonephron, Cyanophora, Cyanophyta, Cyanothece,
Cyanothomonas, Cyclonexis, Cyclostephanos, Cyclotella,
Cylindrocapsa, Cylindrocystis, Cylindrospermum, Cylindrotheca,
Cymatopleura, Cymbella, Cymbellonitzschia, Cystodinium
Dactylococcopsis, Debarya, Denticula, Dermatochrysis, Dermocarpa,
Dermocarpella, Desmatractum, Desmidium, Desmococcus, Desmonema,
Desmosiphon, Diacanthos, Diacronema, Diadesmis, Diatoma,
Diatomella, Dicellula, Dichothrix, Dichotomococcus, Dicranochaete,
Dictyochloris, Dictyococcus, Dictyosphaerium, Didymocystis,
Didymogenes, Didymosphenia, Dilabifilum, Dimorphococcus, Dinobryon,
Dinococcus, Diplochloris, Diploneis, Diplostauron, Distrionella,
Docidium, Draparnaldia, Dunaliella, Dysmorphococcus, Ecballocystis,
Elakatothrix, Ellerbeckia, Encyonema, Enteromorpha, Entocladia,
Entomoneis, Entophysalis, Epichrysis, Epipyxis, Epithemia,
Eremosphaera, Euastropsis, Euastrum, Eucapsis, Eucocconeis,
Eudorina, Euglena, Euglenophyta, Eunotia, Eustigmatophyta,
Eutreptia, Fallacia, Fischerella, Fragilaria, Fragilariforma,
Franceia, Frustulia, Curcilla, Geminella, Genicularia,
Glaucocystis, Glaucophyta, Glenodiniopsis, Glenodinium, Gloeocapsa,
Gloeochaete, Gloeochrysis, Gloeococcus, Gloeocystis, Gloeodendron,
Gloeomonas, Gloeoplax, Gloeothece, Gloeotila, Gloeotrichia,
Gloiodictyon, Golenkinia, Golenkiniopsis, Gomontia, Gomphocymbella,
Gomphonema, Gomphosphaeria, Gonatozygon, Gongrosia, Gongrosira,
Goniochloris, Gonium, Gonyostomum, Granulochloris,
Granulocystopsis, Groenbladia, Gymnodinium, Gymnozyga, Gyrosigma,
Haematococcus, Hafniomonas, Hallassia, Hammatoidea, Hannaea,
Hantzschia, Hapalosiphon, Haplotaenium, Haptophyta, Haslea,
Hemidinium, Hemitoma, Heribaudiella, Heteromastix, Heterothrix,
Hibberdia, Hildenbrandia, Hillea, Holopedium, Homoeothrix,
Hormanthonema, Hormotila, Hyalobrachion, Hyalocardium, Hyalodiscus,
Hyalogonium, Hyalotheca, Hydrianum, Hydrococcus, Hydrocoleum,
Hydrocoryne, Hydrodictyon, Hydrosera, Hydrurus, Hyella,
Hymenomonas, Isthmochloron, Johannesbaptistia, Juranyiella,
Karayevia, Kathablepharis, Katodinium, Kephyrion, Keratococcus,
Kirchneriella, Klebsormidium, Kolbesia, Koliella, Komarekia,
Korshikoviella, Kraskella, Lagerheimia, Lagynion, Lamprothamnium,
Lemanea, Lepocinclis, Leptosira, Lobococcus, Lobocystis, Lobomonas,
Luticola, Lyngbya, Malleochloris, Mallomonas, Mantoniella,
Marssoniella, Martyana, Mastigocoleus, Gastogloia, Melosira,
Merismopedia, Mesostigma, Mesotaenium, Micractinium, Micrasterias,
Microchaete, Microcoleus, Microcystis, Microglena, Micromonas,
Microspora, Microthamnion, Mischococcus, Monochrysis, Monodus,
Monomastix, Monoraphidium, Monostroma, Mougeotia, Mougeotiopsis,
Myochloris, Myromecia, Myxosarcina, Naegeliella, Nannochloris,
Nautococcus, Navicula, Neglectella, Neidium, Nephroclamys,
Nephrocytium, Nephrodiella, Nephroselmis, Netrium, Nitella,
Nitellopsis, Nitzschia, Nodularia, Nostoc, Ochromonas, Oedogonium,
Oligochaetophora, Onychonema, Oocardium, Oocystis, Opephora,
Ophiocytium, Orthoseira, Oscillatoria, Oxyneis, Pachycladella,
Palmella, Palmodictyon, Pnadorina, Pannus, Paralia, Pascherina,
Paulschulzia, Pediastrum, Pedinella, Pedinomonas, Pedinopera,
Pelagodictyon, Penium, Peranema, Peridiniopsis, Peridinium,
Peronia, Petroneis, Phacotus, Phacus, Phaeaster, Phaeodermatium,
Phaeophyta, Phaeosphaera, Phaeothamnion, Phormidium, Phycopeltis,
Phyllariochloris, Phyllocardium, Phyllomitas, Pinnularia,
Pitophora, Placoneis, Planctonema, Planktosphaeria, Planothidium,
Plectonema, Pleodorina, Pleurastrum, Pleurocapsa, Pleurocladia,
Pleurodiscus, Pleurosigma, Pleurosira, Pleurotaenium, Pocillomonas,
Podohedra, Polyblepharides, Polychaetophora, Polyedriella,
Polyedriopsis, Polygoniochloris, Polyepidomonas, Polytaenia,
Polytoma, Polytomella, Porphyridium, Posteriochromonas,
Prasinochloris, Prasinocladus, Prasinophyta, Prasiola,
Prochlorphyta, Prochlorothrix, Protoderma, Protosiphon,
Provasoliella, Prymnesium, Psammodictyon, Psammothidium,
Pseudanabaena, Pseudenoclonium, Psuedocarteria, Pseudochate,
Pseudocharacium, Pseudococcomyxa, Pseudodictyosphaerium,
Pseudokephyrion, Pseudoncobyrsa, Pseudoquadrigula,
Pseudosphaerocystis, Pseudostaurastrum, Pseudostaurosira,
Pseudotetrastrum, Pteromonas, Punctastruata, Pyramichlamys,
Pyramimonas, Pyrrophyta, Quadrichloris, Quadricoccus, Quadrigula,
Radiococcus, Radiofilum, Raphidiopsis, Raphidocelis, Raphidonema,
Raphidophyta, Peimeria, Rhabdoderma, Rhabdomonas, Rhizoclonium,
Rhodomonas, Rhodophyta, Rhoicosphenia, Rhopalodia, Rivularia,
Rosenvingiella, Rossithidium, Roya, Scenedesmus, Scherffelia,
Schizochlamydella, Schizochlamys, Schizomeris, Schizothrix,
Schroederia, Scolioneis, Scotiella, Scotiellopsis, Scourfieldia,
Scytonema, Selenastrum, Selenochloris, Sellaphora, Semiorbis,
Siderocelis, Diderocystopsis, Dimonsenia, Siphononema, Sirocladium,
Sirogonium, Skeletonema, Sorastrum, Spermatozopsis,
Sphaerellocystis, Sphaerellopsis, Sphaerodinium, Sphaeroplea,
Sphaerozosma, Spiniferomonas, Spirogyra, Spirotaenia, Spirulina,
Spondylomorum, Spondylosium, Sporotetras, Spumella, Staurastrum,
Stauerodesmus, Stauroneis, Staurosira, Staurosirella,
Stenopterobia, Stephanocostis, Stephanodiscus, Stephanoporos,
Stephanosphaera, Stichococcus, Stichogloea, Stigeoclonium,
Stigonema, Stipitococcus, Stokesiella, Strombomonas,
Stylochrysalis, Stylodinium, Styloyxis, Stylosphaeridium,
Surirella, Sykidion, Symploca, Synechococcus, Synechocystis,
Synedra, Synochromonas, Synura, Tabellaria, Tabularia, Teilingia,
Temnogametum, Tetmemorus, Tetrachlorella, Tetracyclus, Tetradesmus,
Tetraedriella, Tetraedron, Tetraselmis, Tetraspora, Tetrastrum,
Thalassiosira, Thamniochaete, Thorakochloris, Thorea, Tolypella,
Tolypothrix, Trachelomonas, Trachydiscus, Trebouxia, Trentepholia,
Treubaria, Tribonema, Trichodesmium, Trichodiscus, Trochiscia,
Tryblionella, Ulothrix, Uroglena, Uronema, Urosolenia, Urospora,
Uva, Vacuolaria, Vaucheria, Volvox, Volvulina, Westella,
Woloszynskia, Xanthidium, Xanthophyta, Xenococcus, Zygnema,
Zygnemopsis, and Zygonium.
[0075] Green non-sulfur bacteria include but are not limited to the
following genera: Chloroflexus, Chloronema, Oscillochloris,
Heliothrix, Herpetosiphon, Roseiflexus, and Thermomicrobium.
[0076] Green sulfur bacteria include but are not limited to the
following genera: Chlorobium, Clathrochloris, and
Prosthecochloris,
[0077] Purple sulfur bacteria include but are not limited to the
following genera: Allochromatium, Chromatium, Halochromatium,
Isochromatium, Marichromatium, Rhodovulum, Thermochromatium,
Thiocapsa, Thiorhodococcus, and Thiocystis,
[0078] Purple non-sulfur bacteria include but are not limited to
the following genera: Phaeospirillum, Rhodobaca, Rhodobacter,
Rhodomicrobium, Rhodopila, Rhodopseudomonas, Rhodothalassium,
Rhodospirillum, Rodovibrio, and Roseospira.
[0079] HyperPhotosynthetic conversion requires extensive genetic
modification (Tables 1 and 2); thus, in preferred embodiments the
parental photoautotrophic organism can be transformed with
exogenous DNA.
[0080] Preferred organisms for HyperPhotosynthetic conversion
include: Arabidopsis thaliana, Panicum virgatum, Miscanthus
giganteus, and Zea mays (plants), Botryococcus braunii,
Chlamydomonas reinhardtii and Dunaliela salina (algae),
Synechococcus sp PCC 7002, Synechococcus sp. PCC 7942,
Synechocystis sp. PCC 6803, and Thermosynechococcus elongatus BP-1
(cyanobacteria), Chlorobium tepidum (green sulfur bacteria),
Chloroflexus auranticus (green non-sulfur bacteria), Chromatium
tepidum and Chromatium vinosum (purple sulfur bacteria),
Rhodospirillum rubrum, Rhodobacter capsulatus, and Rhodopseudomonas
palusris (purple non-sulfur bacteria).
[0081] Propagation
[0082] Methods for cultivation of photosynthetic organisms in
liquid media and on agarose-containing plates are well known to
those skilled in the art (see, e.g., websites associated with ATCC,
and with the Institute Pasteur). For example, Synechococcus sp. PCC
7002 cells (available from the Pasteur Culture Collection of
Cyanobacteria) are cultured in BG-11 medium (17.65 mM NaNO.sub.3,
0.18 mM K.sub.2HPO.sub.4, 0.3 mM MgSO.sub.4, 0.25 mM CaCl.sub.2,
0.03 mM citric acid, 0.03 mM ferric ammonium citrate, 0.003 mM
EDTA, 0.19 mM Na.sub.2CO.sub.3, 2.86 mg/L H.sub.3BO.sub.3, 1.81
mg/L MnCl.sub.2, 0.222 mg/L ZnSO.sub.4, 0.390 mg/L
Na.sub.2MoO.sub.4, 0.079 mg/L CuSO.sub.4, and 0.049 mg/L
Co(NO.sub.3).sub.2, pH 7.4) supplemented with 16 .mu.g/L biotin, 20
mM MgSO.sub.4, 8 mM KCl, and 300 mM NaCl (see, e.g., website
associated with the Institute Pasteur, and Price G D, Woodger F J,
Badger M R, Howitt S M, Tucker L. "Identification of a SulP-type
bicarbonate transporter in marine cyanobacteria. Proc Natl. Acad.
Sci USA (2004). 101(52):18228-33). Typically, cultures are
maintained at 28.degree. C. and bubbled continuously with 5%
CO.sub.2 under a light intensity of 120 .mu.mol
photons/m.sup.2/s.
[0083] Thermosynechococcus elongatus BP-1 (available from the
Kazusa DNA Research Institute, Japan) is propagated in BG11 medium
supplemented with 20 mM TES-KOH (pH 8.2) as described [Iwai M,
Katoh H, Katayama M, Ikeuchi M. "Improved genetic transformation of
the thermophilic cyanobacterium, Thermosynechococcus elongatus
BP-1." Plant Cell Physiol (2004). 45(2):171-175)]. Typically,
cultures are maintained at 50.degree. C. and bubbled continuously
with 5% CO.sub.2 under a light intensity of 38 .mu.mol
photons/m.sup.2/s.
[0084] Chlamydomonas reinhardtii (available from the Chlamydomonas
Center culture collection maintained by Duke University, Durham,
N.C.) are grown in minimal salt medium consisting of 143 mg/L
K.sub.2HPO.sub.4, 73 mg/L KH.sub.2PO.sub.4, 400 mg/L
NH.sub.4NO.sub.3, 100 mg/L MgSO.sub.4-7H2O, 50 mg/L CaCl.sub.2-2
H20, 1 mL/L trace elements stock, and 10 mL/L 2.0 M MOPS titrated
with Tris base to pH 7.6 as described (Geraghty A M, Anderson J C,
Spalding M H. "A 36 kilodalton limiting-CO2 induced polypeptide of
Chlamydomonas is distinct from the 37 kilodalton periplasmic
anhydrase." Plant Physiol (1990). 93:116-121). Typically, cultures
are maintained at 24.degree. C. and bubbled with 5% CO.sub.2 in
air, under a light intensity of 60 .mu.mol photons/m.sup.2/s.
[0085] The above define typical propagation conditions. As
appropriate, incubations are performed using alternate media or gas
compositions, alternate temperatures (5-75.degree. C.), and/or
light fluxes (0-5500 .mu.mol photons/m.sup.2/s).
[0086] Light is delivered through a variety of mechanisms,
including natural illumination (sunlight), standard incandescent,
fluorescent, or halogen bulbs, or via propagation in
specially-designed illuminated growth chambers (for example Model
LI15 Illuminated Growth Chamber (Sheldon Manufacturing, Inc.
Cornelius, Oreg.). For experiments requiring specific wavelengths
and/or intensities, light is distributed via light emitting diodes
(LEDs), in which wavelength spectra and intensity can be carefully
controlled (Philips).
[0087] Carbon dioxide is supplied via inclusion of solid media
supplements (i.e., sodium bicarbonate) or as a gas via its
distribution into the growth incubator or media. Most experiments
are performed using concentrated carbon dioxide gas, at
concentrations between 1 and 30%, which is directly bubbled into
the growth media at velocities sufficient to provide mixing for the
organisms. When concentrated carbon dioxide gas is utilized, the
gas originates in pure form from commercially-available cylinders,
or preferentially from concentrated sources including off-gas or
flue gas from coal plants, refineries, cement production
facilities, natural gas facilities, breweries, and the like.
Plasmids
[0088] Plasmids relevant to genetic engineering typically include
at least two functional elements 1) an origin of replication
enabling propagation of the DNA sequence in the host organism, and
2) a selective marker (for example an antibiotic resistance marker
conferring resistance to ampicillin, kanamycin, zeocin,
chloramphenicol, tetracycline, spectinomycin, and the like).
Plasmids are often referred to as "cloning vectors" when their
primary purpose is to enable propagation of a desired heterologous
DNA insert. Plasmids can also include cis-acting regulatory
sequences to direct transcription and translation of heterologous
DNA inserts (for example, promoters, transcription terminators,
ribosome binding sites); such plasmids are frequently referred to
as "expression vectors." When plasmids contain functional elements
that allow for propagation in more than one species, such plasmids
are referred to as "shuttle vectors." Shuttle vectors are well
known to those in the art. For example, pSE4 is a shuttle vector
that allows propagation in E. coli and Synechococcus [Maeda S,
Kawaguchi Y, Ohy T, and Omata T. J. Bacteriol. (1998).
180:4080-4088]. Shuttle vectors are particularly useful in the
present invention to allow for facile manipulation of genes and
regulatory sequences in E. coli prior to transformation into the
photoautotrophic organism of interest.
[0089] Transformation Techniques
[0090] Standard methods for transformation of prokaryotes are well
known to those skilled in the art [Berger and Kimmel, Guide to
Molecular Cloning Techniques, Methods in Enzymology volume 152
Academic Press, Inc., San Diego, Calif.; Sambrook et al. (1989)
Molecular Cloning--A Laboratory Manual (2nd ed.) Vol. 1-3, Cold
Spring Harbor Laboratory, Cold Spring Harbor Press, N.Y.; and
Current Protocols in Molecular Biology, F. M. Ausubel et al., eds.,
Current Protocols, a joint venture between Greene Publishing
Associates, Inc. and John Wiley & Sons, Inc., (through and
including the 1997 Supplement)].
[0091] Many prokaryotic organisms are naturally competent; others
can be rendered competent by chemical treatments. Non-limiting
examples of transformation techniques include direct incubation in
the presence of exogenous DNA, transformation by heat-shock,
transformation by electro-poration, transformation by biolistic
particle bombardment, transformation via addition of lipids or
fusogenic agents (i.e., polyethylene glycol), conjugation with a
heterologous microorganism, or transduction via viral
particles.
[0092] Synechococcus sp. PCC 7002 cells are transformed according
to the optimized protocol previously described [Essich E S, Stevens
Jr E, Porter R D "Chromosomal Transformation in the Cyanobacterium
Agmenellum quadruplicatum". J Bacteriol (1990). 172(4):1916-1922].
Cells are grown in Medium A (18 g/L NaCl, 5 g/L MgSO.sub.4. 7
H.sub.20, 30 mg/L Na.sub.2EDTA, 600 mg/L KCl, 370 mg/L CaCl.sub.2.2
H.sub.2O, 1 g/L NaNO.sub.3, 50 mg/L KH.sub.2PO.sub.4, 1 g/L Trizma
base pH 8.2, 4 .mu.g/L Vitamin B12, 3.89 mg/L FeCl.sub.3.6
H.sub.20, 34.3 mg/L H.sub.3BO.sub.3, 4.3 mg/L MnCl.sub.2.4
H.sub.20, 315 .mu.g/L ZnCl.sub.2, 30 .mu.g/L MoO.sub.3, 3 .mu.g/L
CuSO.sub.4.5 H.sub.20, 12.2 .mu.g/L CoCl.sub.2.6 H.sub.20) [Stevens
S E, Patterson C O P, and Myers J. "The production of hydrogen
peroxide by green algae: a survey." J. Phycology (1973). 9:427-430]
plus 5 g/L of NaNO.sub.3 to approximately 10.sup.8 cells/mL. Nine
volumes of cells are mixed with 1 volume of 1-10 .mu.g/mL DNA in
0.15 M NaCl/0.015 M Na.sub.3citrate and incubated at 27-30.degree.
C. for 3 hours before addition of 1 volume of DNaseI to a final
concentration of 10 .mu.g/mL. The cells are plated in 2.5 mL of
0.6% medium A overlay agar that was tempered at 45.degree. C. and
incubated. Cells are challenged with antibiotic by under-laying 2.0
mL of 0.6% medium A agar containing appropriate concentration of
antibiotic with a sterile Pasteur pipette. Transformants are picked
3-4 days later. Selections are typically performed using 200
.mu.g/ml kanamycin, 8 .mu.g/ml chloramphenicol, 10 .mu.g/ml
spectinomycin on solid media, whereas 150 .mu.g/ml kanamycin, 7
.mu.g/ml chloramphenicol, and 5 .mu.g/ml spectinomycin are employed
in liquid media.
[0093] Thermosynechococcus elongatus BP-1 cells are transformed
according to the optimized protocol previously described [Iwai M,
Katoh H, Katayama M, and Ikeuchi M. "Improved genetic
transformation of the thermophilic cyanobacterium
Thermosynechococcus elongatus BP-1. Plant Cell Physiol (2004).
45(2):171-175]. Mid-exponential phase cultures are incubated with
exogenous DNA (typically 3-20 .mu.g) and electroporated at a field
strength of 10 kV/cm using a BioRad Gene Pulsur Xcell (Bio-Rad
Laboratories, Hercules, Calif.). Following electroporation, the
cells are recovered in 1 ml BG11 medium for 24-hrs at 45.degree. C.
Cells are plated directly on BG11 plates containing the appropriate
antibiotic or optionally pre-mixed with BG11 medium containing
0.35% (w/v) melted agar (Difco, USA).
[0094] Transformation typically involves incubation of recipient
cells with purified plasmid DNA isolated from E. coli. In contrast,
bacterial conjugation provides an alternate means to directly
transfer DNA from one bacterial species to another. For example,
techniques enabling conjugation between E. coli and cyanobacteria
including Synechocystic PCC 6803 and PCC 6714 and Synechococcus PCC
7942 and PCC 6301, as well as thermophilic Synechococcus elongatus
have been described [Marraccini P, Bulteau S, Cassier-Chauvat C,
Mermet-Bouvier P, and Chauvat F. "A conjugative plasmid vector for
promoter analysis in several cyanobacteria of the genera
Synechococcus and Synechocystis." Plant Molecular Biology (1993).
23(4):905-909; Muhlenhoff U and Chauvat; "Gene transfer and
manipulation in the thermophilic cyanobacterium Synechococcus
elongatus." Molecular and General Genetics MGG (1996).
252(1-2):93-100
[0095] Techniques related to the transformation of eukaryotic
photoautotrophs are known to those skilled in the art. Such methods
have been described in textbooks related to molecular biology (see
Packer & Glaser, 1988, "Cyanobacteria", Meth. Enzymol., Vol.
167; Weissbach & Weissbach, 1988, "Methods for plant molecular
biology," Academic Press, New York, Sambrook, Fritsch &
Maniatis, 1989, "Molecular Cloning: A laboratory manual," 2nd
edition Cold Spring Harbor Laboratory Press, Cold Spring Harbor,
N.Y.; and Clark M S, 1997, Plant Molecular Biology, Springer, N.Y.)
and in "Methods and tools for transformation of eukaryotic algae"
U.S. Pat. No. 6,027,900.
[0096] A variety of approaches can be employed for transformation
of Chlamydomonas reinhardtii cells. Transformation of the
Chlamydomonas reinhardtii nuclear compartment is performed as
described [Kindle K L. "High-frequency nuclear transformation of
Chlamydomonas reinhardtii." Proc Natl Acad Sci (1990).
87:1228-1232]. In brief, cells are grown to a concentration of
1.5.times.10.sup.6 per ml, pelleted, and resuspended in 5% (v/v)
polyethylene glycol (PEG, M.sub.r 6000) from Sigma-Aldrich (St.
Louis, Mo.). Subsequently, the resuspended cells are incubated with
linear or circular plasmid DNA and agitated in the presence of 300
mg of 0.5-mm glass beads for 10-30 seconds at maximum speed using a
Genie Vortex II mixer (Thermo Fisher Scientific, Pittsburgh, Pa.).
Cells are immediately plated on agarose plates containing the
appropriate antibiotic or nutrient selection. Alternately,
Chlamydomonas reinhardtii cells are plated directly onto agarose
plates and bombarded with 500 .mu.g of tungsten microprojectiles
coated with 1 .mu.g of plasmid DNA using the Bio-Rad PDS-1000He
particle-delivery system (Bio-Rad Laboratories; Hercules, Calif.),
as previously described [Sodeinde O A and Kindle K L. "Homologous
recombination in the nuclear genome of Chlamydomonas reinhardtii."
Proc Natl Acad Sci (1993). 90:9199-9203].
[0097] Chlamydomonas reinhardtii chloroplasts are transformed as
described (Kindle K L, Richards K L, Stern D B. "Engineering the
chloroplast genome: Techniques and capabilities for chloroplast
transformation in Chlamydomonas reinhardtii. Proc Natl Acad Sci.
(2001). 88:1721-1725). In brief, cells are grown to mid log phase,
optionally in the presence of 0.5 mM 5-fluorodeoxyuridine, and
agitated with single or double-stranded plasmid DNA in the presence
of 300 mg of 0.5-mm glass beads for 15-30 seconds at maximum speed
using a Genie Vortex II mixer. Following agitation, cells are
immediately plated on selective agar plates containing the
appropriate concentration of antibiotics. Typically, 100 .mu.g/ml
of spectinomycin is used.
[0098] Chlamydomonas reinhardtii mitochondria are transformed as
described (Remade C, Cardol P, Coosemans N, Galsne M, and Bonnefoy
N. "High-efficiency biolistic transformation of Chlamydomonas
mitochondria can be used to insert mutations in complex I genes."
Proc Natl Acad Sci (2006). 103: 4771-4776.] Briefly, cells are
grown in liquid Tris Acetate Phosphate media (TAP)
[http://openwetware.org/wiki/Media_formula] to a concentration of
2-3.times.10.sup.6 cells/ml and 10.sup.8 cells are spread onto TAP
plates and bombarded with tungsten beads coated with DNA using the
Bio-Rad PDS-1000He apparatus under 1100 psi pressure and a partial
chamber vacuum of at least 29 inches Hg. Plates are positioned
approximately 7 cm from the macrocarrier assembly, optionally
employing stopping screens to increase transformation
efficiencies.
[0099] Tables 1 and 2 define preferred genes to convey
HyperPhotosynthetic properties to an existing photoautotrophic
organism.
[0100] Table 1 lists genes which are overexpressed to enhance
carbon fixation rates, thermotolerance, pH tolerance, flue gas
tolerance, salt tolerance, light harvesting efficiencies, reducing
power generation, and nutrient independence, together with
information on associated pathways, Enzyme Commission (EC) Numbers,
exemplary gene names, source organism, GenBank accession numbers,
and homologs from alternate sources. When the parental organism
encodes a gene with the indicated enzymatic activity, it is
nevertheless useful to overexpress these components to improve
CO.sub.2 fixation. In one embodiment, the native enzyme sequence is
overexpressed. In preferred embodiments, it is useful to
overexpress an exogenous gene, which allows for more explicit
regulatory control in the bioprocess and a means to potentially
mitigate the effects of central metabolism regulation, which is
focused around the native genes explicitly.
[0101] The nucleotide sequences for the indicated genes (or DNA
sequences that encode the identical or homologous polypeptides, but
encompassing nucleotide substitutions to 1) alter expression levels
based on the host organism's codon usage table; 2) add or remove
secondary structure; 3) add or remove restriction endonuclease
recognition sequences; and/or 4) facilitate gene synthesis and
assembly) are assembled by Codon Devices Inc (Cambridge, Mass.).
Alternate providers including DNA2.0 (Menlo Park, Calif.), Blue
Heron Biotechnology (Bothell, Wash.), and Geneart (Regensburg,
Germany), are used as noted. Sequences untenable by commercial
sources may be prepared using polymerase chain reaction (PCR) from
DNA or cDNA samples, or cDNA/BAC libraries. Inserts are initially
propagated and sequenced in a cloning vector, such as pUC19.
Importantly, primary synthesis and sequence verification of each
gene of interest in pUC19 provides flexibility to transfer each
unit in various combinations to alternate destination vectors to
drive transcription and translation of the desired enzymes.
Specific and/or unique cloning sites are included at the 5' and 3'
ends of the open reading frames (ORFs) to facilitate molecular
transfers.
[0102] The required metabolic pathways are initially encoded in
expression cassettes driven by constitutive promoters which are
always "on." Many such promoters are known, for example the spc
ribosomal protein operon (P.sub.spc), the beta-lactamase gene
promoter of pBR322 (P.sub.bla), the bacteriophage lambda P.sub.L
promoter, the replication control promoters of plasmid pBR322
(P.sub.RNAI or P.sub.RNAII), or the P1 or P2 promoters of the rrnB
ribosomal RNA operon [Liang S T, Bipatnath M, Xu Y C, Chen S L,
Dennis P, Ehrenber M, Bremer H. Activities of Constitutive
Promoters in Escherichia coli. J. Mol Biol (1999). Vol 292, Number
1, pgs 19-37], the Chlorella virus promoters described in U.S. Pat.
No. 5,846,744 ["Chlorella virus promoters"], the cauliflower mosaic
virus 35S promoter [Zheng X, Deng W, Luo K, Duan H, Chen Y, McAvoy
R, Song S, Pei Y, Li Y. "The cauliflower mosaic virus (CaMV) 35S
promoter sequence alters the level and patterns of activity of
adjacent tissue- and organ-specific gene promoters." Plant Cell Rep
(2007). 26(8):1195-1203], the constitutive petH promoter of
Anabaena [Valladares A, Muro-Pastor A M, Fillat M F, Herrero A,
Flores E. "Constitutive and nitrogen-regulated promoters of the
petH gene encoding ferredoxin:NADP+ reductase in the
heterocyst-forming cyanobacterium Anabaena sp." FEBS Lett (1999).
449(2-3):159-64], the RbcS2 promoter of Chlamydomonas [Leon R,
Couso I, Fernandez E. "Metabolic engineering of ketocarotenoids
biosynthesis in the unicellular microalgae Chlamydomonas
reinhardtii." J Biotechnol (2007). 130(2):143-152], and the core
promoter sequence of psbA from Microcystis aeruginosa K-81 [Shibato
J, Asayama M, Shirai M. "Specific recognition of the cyanobacterial
psbA promoter by RNA polymerases containing principal sigma
factors." Biochim. Biophys Acta (1998). 1442(2-3):296-303].
[0103] As necessary, after designing and testing pathways, the
strength of constitutive promoters are "tuned" to increase or
decrease levels of transcription to optimize a network, for
example, by modifying the conserved -35 and -10 elements or the
spacing between these elements [Alper H, Fischer C, Nevoigt E,
Stephanopoulus G. "Tuning genetic control through promoter
engineering." PNAS (2005). 102(36):12678-12783; Jensen P R and
Hammer K. "The sequence of spacers between the consensus sequences
modulates the strength of prokaryotic promoters." Appl Environ
Microbiol (1998). 64(I):82-87; Mijakovic I, Petranovic D, Jensen P
R. Tunable promoters in system biology. Curr Opin Biotechnol
(2005). 16:329-335; De Mey M, Maertens J, Lequeux G J, Soetaert W
K, Vandamme E J. "Construction and model-based analysis of a
promoter library from E. coli: an indispensable tool for metabolic
engineering." BMC Biotechnology (2007) 7:34].
[0104] When constitutive expression proves non-optimal (i.e., has
deleterious effects, is out of sync with the network, etc.)
inducible promoters are used. Inducible promoters are "off" (not
transcribed) prior to addition of an inducing agent, frequently a
small molecule or metabolite. Examples of suitable inducible
promoter systems include the arabinose inducible P.sub.bad
[Khlebnikov A, Datsenko K A, Skaug T, Wanner B L, Keasling J D.
"Homogeneous expression of the P(BAD) promoter in Escherichia coli
by constitutive expression of the low-affinity high-capacity AraE
transporter." Microbiology (2001). 147 (Pt 12): 3241-7], the
rhamnose inducible rhaP.sub.BAD promoter [Haldimann A, Daniels L,
Wanner B. J Bacteriol (1998). "Use of new methods for construction
of tightly regulated arabinose and rhamnose promoter fusions in
studies of the Escherichia coli phosphate regulon." 180:1277-1286],
the propionate inducible pPRO [Lee S K and Keasling J D. "A
propionate-inducible expression system for enteric bacteria." Appl
Environ Microbiol (2005). 71(11):6856-62)], the IPTG-inducible lac
promoter [Gronenborn. Mol Gen Genet (1976). "Overproduction of
phage lambda repressor under control of the lac promoter of
Escherichia coli." 148:243-250], the synthetic tac promoter [De
Boer H A, Comstock L J, Vasser M. "The tac promoter: a functional
hybrid derived from the trp and lac promoters." PNAS (1983).
80:21-25], the synthetic trc promoter [Brosius J, Erfle M, Storella
J. "Spacing of the -10 and -35 regions in the tac promoter. Effect
on its in vivo activity." J Biol Chem (1985). 260:3539-3541], or
the T7 RNA polymerase system [Studier F W and Moffatt B A. "Use of
bacteriophage T7 RNA polymerase to direct selective high-level
expression of cloned genes." J Mol Biol (1986]. 189:113-130, the
tetracycline or anhydrotetracycline-inducible tetA
promoter/operator system [Skerra A. "Use of the tetracycline
promoter for the tightly regulated production of a murine antibody
fragment in Escherichia coli" Gene (1994). 151:131-135], the nickel
inducible Cpx1 and Cyc6 promoters of Chlamydomonas reinhardtii
[Quinn J M, Kropat J, Merchant S. "Copper response element and
Crr1-dependent nickel-responsive promoter for induced, reversible
gene expression in Chlamydomonas reinhardtii." Eukaryotic Cell
(2003). 2(5):995-1002], the nitrite-inducible nirA promoter of
Synechococcus [Qi Q, Hao M, Ng W, Slater S C, Baszis S R, Weiss J
D, and Valentin H E. "Application of the Synechococcus nirA
promoter to establish an inducible expression system for
engineering the Synechocystis tocopherol pathway." Appl. Environ.
Microb (2005) 71(10):5678-5684], the sulfur-responsive
arylsulfatase promoter of Volvox [Hallman A and Sumper M. "Reporter
genes and highly regulated promoters as tools for transformation
experiments in Volvox carteri." Proc Natl Acad Sci (1994).
91(24):11562-11566]. These and other naturally-occurring or
synthetically-derived inducible promoters are employed (see, e.g.,
U.S. Pat. No. 7,235,385; Methods for enhancing expression of
recombinant proteins).
[0105] Alternate origins of replication are selected to provide
additional layers of expression control. The number of copies per
cell contributes to the "gene dosage effect." For example, the high
copy pMB1 or colE1 origins are used to generate 300-1000 copies of
each plasmid per cell, which contributes to a high level of gene
expression. In contrast, plasmids encoding low copy origins, such
as pSC101 or p15A, are leveraged to restrict copy number to about
1-20 copies per cell. Techniques and sequences to further modulate
plasmid copy number are known (see, e.g., U.S. Pat. No. 5,565,333,
Plasmid replication origin increasing the copy number of plasmid
containing said origin; U.S. Pat. No. 6,806,066, Expression vectors
with modified ColE1 origin of replication for control of plasmid
copy number). Certain organisms, including Synechococcus sp. PCC
7002, encode endogenous plasmids with varying copy numbers [Yano S,
Kawata Y, Kojima H. "Salinity-dependent copy number changes of
endogenous plasmids in Synechococcus sp. PCC 7002]; thus, gene
dosage can be modified by targeting expression cassettes to
distinct endogenous plasmids.
[0106] Expression levels are also optimized by modulation of
translation efficiency. In E. coli, a Shine-Dalgarno (SD) sequence
[Shine J and Dalgarno L. Nature (1975) "Determination of cistron
specificity in bacterial ribosomes." 254(5495):34-8] is a consensus
sequence that directs the ribosome to the mRNA and facilitates
translation initiation by aligning the ribosome with the start
codon. Modulation of the SD sequence is used to increase or
decrease translation efficiency as appropriate [de Boer H A,
Comstock L J, Hui A, Wong E, Vasser M. Gene Amplif Anal (1983).
"Portable Shine-Dalgarno regions; nucleotides between the
Shine-Dalgarno sequence and the start codon effect the translation
efficiency". 3: 103-16; Mattanovich D, Weik R, Thim S, Kramer W,
Bayer K, Katinger H. Ann NY Acad Sci (1996). "Optimization of
recombinant gene expression in Escherichia coli." 782:182-90.]. Of
note, a high level of translation can be observed in certain
contexts in the absence of an SD sequence [Mutsuda M and Sugiura M.
"Translation initiation of cyanobacterial rbcS mRNAs requires the
38-kDa ribosomal protein S1 but not the Shine-Dalgarno sequence." J
Biol Chem (2006). 281(50):38314-38321; Xu J, Mironova R, Ivanov I
G, Abouhaidar M G. J Basic Microbiol (1999). "A polylinker-derived
sequence, PL, highly increased translation efficiency in
Escherichia coli." 39(1):51-60]. Secondary mRNA structure is
engineered in or out of the genes of interest to modulate
expression levels [Klinkert B, Elles I, Nickelsen J. "Translation
of chloroplast psbD mRNA in Chlamydomonas is controlled by a
secondary structure blocking the AUG start codon." Nucleic Acids
Res (2006). 34(1):384-94; Cebe R and Geiser M. Protein Expr Purif
(2006). "Rapid and easy thermodynamic optimization of 5'-end of
mRNA dramatically increases the level of wild type protein
expression in Escherichia coli." 45(2):374-80; Zhang W, Xiao W, Wei
H, Zhang J, Tian Z. Biochem Biophys Res Commun (2006). "mRNA
secondary structure at start AUG codon is a key limiting factor for
human protein expression in Escherichia coli." 349(1):69-78; Voges
D, Watzele M, Nemetz C, Wizemann S, Buchberger B. Biochem Biophys
Res Commun (2004). "Analyzing and enhancing mRNA translational
efficiency in an Escherichia coli in vitro expression system."
318(2):601-14]. Codon usage is also manipulated to increase or
decrease levels of translation [Deng T. FEBS Lett (1997).
"Bacterial expression and purification of biologically active mouse
c-Fos proteins by selective codon optimization." 409(2):269-72;
Hale R Sand Thompson G. Protein Expr Purif (1998). "Codon
optimization of the gene encoding a domain from human type 1
neurofibromin protein results in a threefold improvement in
expression level in Escherichia coli." 12(2):185-8].
[0107] In some embodiments, each gene of interest is expressed on a
unique plasmid. In preferred embodiments, the desired biosynthetic
pathways are encoded on multi-cistronic plasmid vectors. Useful
expression vectors are designed internally and synthesized by
external gene synthesis providers.
Optimizations
[0108] The below biosynthetic pathways and modules are first tested
and optimized using episomal plasmids described above. Non-limiting
optimizations include promoter swapping and tuning, ribosome
binding site manipulation, alteration of gene order (e.g., gene ABC
versus BAC, CBA, CAB, BCA), co-expression of molecular chaperones,
random or targeted mutagenesis of gene sequences to increase or
decrease activity, folding, or allosteric regulation, expression of
gene sequences from alternate species, codon manipulation, addition
or removal of intracellular targeting sequences such as signal
sequences, and the like.
[0109] Each gene or module is optimized individually, or
alternately, in parallel. Functional promoter and gene sequences
are subsequently integrated into the photoautotrophic host's
chromosome to enable stable propagation in the absence of selective
pressure (i.e., inclusion of antibiotics) using standard techniques
known to those skilled in the art.
[0110] Table 2 lists genes which are downregulated or knocked-out
to enhance carbon fixation rates, thermotolerance, pH tolerance,
flue gas tolerance, salt tolerance, light harvesting efficiencies,
reducing power generation, and nutrient independence, together with
information on associated pathways, Enzyme Commission (EC) Numbers,
exemplary gene names, source organism, and GenBank accession
numbers.
Disruption of Endogenous DNA Sequences
[0111] In certain instances, chromosomal DNA sequence native (i.e.,
"endogenous") to the host organism are altered. Manipulations are
made to non-coding regions, including promoters, ribosome binding
sites, transcription terminators, and the like to increase or
decrease expression of specific gene product(s). In alternate
embodiments, the coding sequence of an endogenous gene is altered
to affect stability, folding, activity, or localization of the
intended protein. Alternately, specific genes can be entirely
deleted or "knocked-out." Techniques and methods for such
manipulations are known to those skilled in the art [Nelson J A,
and Lefebvre P A. "Targeted disruption of the NIT8 gene in
Chlamydomonas reinhardtii." Mol Cell Bio (1995). 15(10):5762-5769;
Hanson T E and Tabita F R. "A ribulose-1,5-bisphosphate
carboxylase/oxygenase (RubisCO)-like protein from Chlorobium
tepidum that is involved with sulfur metabolism and the response to
oxidative stress." Proc Natl Acad Sci (2001). 98(8):4397-4402;
Sugita C, Mutsuda M, Sugiura M, Sugita M. "Targeted deletion of
genes for eukaryotic RNA-binding proteins, Rbp1 and Rbp2, in the
cyanobacterium Synechococcus sp. Strain PCC7942: Rbp1 is
indispensable for cell growth at low temperatures." FEMS Microbiol
Letters (1999). 176(1): 155-161; Kirilovsky D, Roncel M, Boussac A,
Wilson A, Zurita J L, Ducruet J, Bottin H, Sugiura M, Ortega J M,
Rutherford A W. "Cytochrome c550 in the cyanobacterium
Thermosynechococcus elongatus. Study of Redox mutants." J Biol Chem
(2004). 279(51):52869-80; Datsenko K A, Wanner B L. PNAS (2000).
"One-step inactivation of chromosomal genes in E. coli K-12 using
PCR Products." 97: 6640-6645; Link A J et al. J Bacteriol (1997).
"Methods for generating precise deletions and insertions in the
genome of wild-type Escherichia coli: Application to open reading
frame characterization." 179:6228-6237; Baba T et al. Mol Syst Biol
(2006). Construction of Escherichia coli K-12 in-frame, single gene
knockout mutants: the Keio collection." 2:2006.0008; Tischer B K,
von Einem J, Kaufer B, Osterrieder N. Biotechniques (2006).
"Two-step red-mediated recombination for versatile high-efficiency
markerless DNA manipulation in Escherichia coli." 40(2):191-7;
McKenzie G J, Craig N L. BMC Microbiol (2006). Fast, easy and
efficient: site-specific insertion of transgenes into
enterobacterial chromosomes using Tn7 without need for selection of
the insertion event." 6:39].
[0112] In certain embodiments, post-transcriptional gene silencing
(PTGS) is employed to reduce the expression level of an endogenous
gene via expression of a heterologous RNA sequence, frequently
antisense to the gene requiring disruption [Lechtreck K, Rostmann
J, and Grunow A. "Analysis of Chlamydomonas SF-assemblin by GFP
tagging and expression of antisense constructs." J. Cell Sci
(2002). 115:1511-1522; Smith N A, Singh S P, Wang M, Stotjesdijk P
A, Green A G, and Waterhouse P M. "Total silencing by
intron-spliced hairpin RNAs." Nature (2000). 407:319-320; Furhmann
M, Stahlberg A, Govorunova E, Rank S, and Hegeman P. "The abundant
retinal protein of the Chlamydomonas eye is not the photoreceptor
for phototaxis and photophobic responses." J. Cell Sci (2001).
114:3857-3863; Rohr J, Sarkar N, Balenger S Jeong B R, Cerutti H.
"Tandem inverted repeat system for selection of effective
transgenic RNAi strains in Chlamydomonas" Plant J (2004).
40(4):611-21].]
[0113] In other embodiments, expression of naturally encoded or
exogenous small RNA or microRNA species is employed to downregulate
endogenous gene expression [Molnar A, Schwach F, Studholme D J,
Tgyenemann E C, and Baulcombe D C. "miRNAs control gene expression
in the single-cell alga Chlamydomonas reinhardtii." Nature (2007).
447(7148):1126-9; Zhao T, Li G, Mi S, Li S, Hannon G J, Wang X J,
Qi Y. "A complex system of small RNAs in the unicellular green alga
Chlamydomonas reinhardtii." Genes Dev (2007). 21(10):1190-203].
Selections and Assays
[0114] Selective pressure provides a valuable means for testing and
optimizing the HyperPhotosynthetic organisms. The ability to
survive under ever increasing temperatures provides evidence for
successful implementation of the improved thermotolerance module.
The ability to grow in media bubbled with flue gas (or an
artificial gas formulation that approximates flue gas composition)
confirms the successful implementation of the improved flue gas
tolerance module. The ability to replicate more rapidly than the
wild-type counterparts confirms the successful implementation of
the improved CO.sub.2 fixation module. The ability to survive and
replicate in media lacking Vitamin B.sub.12 as a media supplement
confirms the successful implementation of the Vitamin B.sub.12
module.
[0115] If desired, additional genetic variation can be introduced
prior to selective pressure by treatment with mutagens, such as
ultra-violet light, alkylators [e.g., ethyl methanesulfonate (EMS),
methyl methane sulfonate (MMS), diethylsulfate (DES), and
nitrosoguanidine (NTG, NG, MMG)], DNA intercalators (e.g., ethidium
bromide), nitrous acid, base analogs, bromouracil, transposons, and
the like.
[0116] Alternately or in addition to selective pressure, pathway
activity can be monitored following growth under permissive (i.e.,
non-selective) conditions by measuring specific product output via
various metabolic labeling studies (including radioactivity),
biochemical analyses (Michaelis-Menten), gas chromatography-mass
spectrometry (GC/MS), mass spectrometry, matrix assisted laser
desorption ionization time-of-flight mass spectrometry (MALDI-TOF),
capillary electrophoresis (CE), and high pressure liquid
chromatography (HPLC).
Fermentation Methods
[0117] The production and isolation of products from
HyperPhotosynthetic organisms can be enhanced by employing specific
fermentation techniques. An essential element to maximizing
production while reducing costs is increasing the percentage of the
carbon source that is converted to such products. Carbon atoms,
during normal cellular lifecycles, go to cellular functions
including producing lipids, saccharides, proteins, and nucleic
acids. Reducing the amount of carbon necessary for non-product
related activities can increase the efficiency of output
production. This is achieved by first growing microorganisms to a
desired density. A preferred density would be that achieved at the
peak of the log phase of growth. At such a point, replication
checkpoint genes can be harnessed to stop the growth of cells.
Specifically, quorum sensing mechanisms (reviewed in Camilli, A.
and Bassler, B. L Science 311:1113; Venturi, V. FEMS Microbio Rev
30: 274; and Reading, N. C. and Sperandio, V. FEMS Microbiol Lett
254:1) can be used to activate genes such as p53, p21, or other
checkpoint genes. Genes that can be activated to stop cell
replication and growth in E. coli include umuDC genes, the
overexpression of which stops the progression from exponential
phase to stationary growth (Murli, S., Opperman, T., Smith, B. T.,
and Walker, G. C. 2000 Journal of Bacteriology 182: 1127.). UmuC is
a DNA polymerase that can carry out translesion synthesis over
non-coding lesions--the mechanistic basis of most UV and chemical
mutagenesis. The umuDC gene products are required for the process
of translesion synthesis and also serve as a DNA damage checkpoint.
UmuDC gene products include UmuC, UmuD, umuD', UmuD'.sub.2C,
UmuD'.sub.2 and UmuD.sub.2. Simultaneously, the product synthesis
genes are activated, thus minimizing the need for critical
replication and maintenance pathways to be used while the product
is being made.
[0118] Alternatively, cell growth and product production can be
achieved simultaneously. In this method, cells are grown in
bioreactors with a continuous supply of inputs and continuous
removal of product. Batch, fed-batch, and continuous fermentations
are common and well known in the art and examples can be found in
Thomas D. Brock in Biotechnology: A Textbook of Industrial
Microbiology, Second Edition (1989) Sinauer Associates, Inc.,
Sunderland, Mass., or Deshpande, Mukund V., Appl. Biochem.
Biotechnol (1992), 36:227.
[0119] In all production methods, inputs include carbon dioxide,
water, and light. The carbon dioxide can be from the atmosphere or
from concentrated sources including offgas or flue gas from coal
plants, refineries, cement production facilities, natural gas
facilities, breweries, and the like. Water can be no-salt,
low-salt, marine, or high salt. Light can be solar or from
artificial sources including incandescent lights, LEDs, fiber
optics, and fluorescent lights.
[0120] Light-harvesting organisms are limited in their productivity
to times when the solar irradiance is sufficient to activate their
photosystems. In a preferred light-harvesting organism bioprocess,
cells are enabled to grow and produce product with light as the
energetic driver. When there is a lack of sufficient light, cells
can be induced to minimize their central metabolic rate. To this
end, the inducible promoters specific to product production can be
heavily stimulated to drive the cell to process its energetic
stores in the product of choice. With sufficient induction force,
the cell will minimize its growth efforts, and use its reserves
from light harvest specifically for product production.
Nonetheless, net productivity is expected to be minimal during
periods when sufficient light is lacking as no to few photons are
net captured.
[0121] In a preferred embodiment, the cell is engineered such that
the final product is released from the cell. In embodiments where
the final product is released from the cell, a continuous process
can be employed. In this approach, a reactor with organisms
producing desirable products can be assembled in multiple ways. In
one embodiment, the reactor is operated in bulk continuously, with
a portion of media removed and held in a less agitated environment
such that an aqueous product will self-separate out with the
product removed and the remainder returned to the fermentation
chamber. In embodiments where the product does not separate into an
aqueous phase, media is removed and appropriate separation
techniques (e.g., chromatography, distillation, etc.) are
employed.
[0122] In an alternate embodiment, the product is not secreted by
the cells. In this embodiment, a batch-fed fermentation approach is
employed. In such cases, cells are grown under continued exposure
to inputs (light, water, and carbon dioxide) as specified above
until the reaction chamber is saturated with cells and product. A
significant portion to the entirety of the culture is removed, the
cells are lysed, and the products are isolated by appropriate
separation techniques (e.g., chromatography, distillation,
filtration, centrifugation, etc.).
[0123] In a preferred embodiment, the fermentation chamber will
enclose a fermentation that is undergoing a continuous reductive
fermentation. In this instance, a stable reductive environment is
created. The electron balance is maintained by the release of
carbon dioxide (in gaseous form). Augmenting the NAD/H and NADP/H
balance, as described above, also can be helpful for stabilizing
the electron balance.
Detection and Analysis of Gene and Cell Products
[0124] Any of the standard analytical methods, such as gas
chromatography-mass spectrometry, and liquid chromatography-mass
spectrometry, HPLC, capillary electrophoresis, Matrix-Assisted
Laser Desorption Ionization time of flight-mass spectrometry, etc.,
can be used to analyze the levels and the identity of the product
produced by the modified organisms of the present invention.
[0125] The ability to detect formation of a new, functional
biochemical pathway in the HyperPhotosynthetic cell is important to
the practice of the subject methods. In general, the assays are
carried out to detect heterologous biochemical transformation
reactions of the host cell that produce, for example, small organic
molecules and the like as part of a de novo synthesis pathway, or
by chemical modification of molecules ectopically provided in the
host cell's environment. The generation of such molecules by the
host cell can be detected in "test extracts," which can be
conditioned media, cell lysates, cell membranes, or semi-purified
or purified fractionation products thereof. The latter can be, as
described above, prepared by classical fractionation/purification
techniques, including phase separation, chromatographic separation,
or solvent fractionation (e.g., methanol ethanol, acetone, ethyl
acetate, tetrahydrofuran (THF), acetonitrile, benzene, ether,
bicarbonate salts, dichloromethane, chloroform, petroleum ether,
hexane, cyclohexane, diethyl ether and the like). Where the assay
is set up with a responder cell to test the effect of an activity
produced by the host cell on a whole cell rather than a cell
fragment, the host cell and test cell can be co-cultured together
(optionally separated by a culture insert, e.g. Collaborative
Biomedical Products, Bedford, Mass., Catalog #40446).
[0126] In certain embodiments, the assay is set up to directly
detect, by chemical or photometric techniques, a molecular species
which is produced (or destroyed) by a biosynthetic pathway of the
recombinant host cell. Such a molecular species' production or
degradation must be dependent, at least in part, on expression of
the heterologous genomic DNA. In other embodiments, the detection
step of the subject method involves characterization of
fractionated media/cell lysates (the test extract), or application
of the test extract to a biochemical or biological detection
system. In other embodiments, the assay indirectly detects the
formation of products of a heterologous pathway by observing a
phenotypic change in the host cell, e.g. in an autocrine fashion,
which is dependent on the establishment of a heterologous
biosynthetic pathway in the host cell.
[0127] In certain embodiments, analogs related to a known class of
compounds are sought, as for example analogs of alkaloids,
aminoglycosides, ansamacrolides, beta-lactams (including
penicillins and cephalosporins), carbapenems, terpinoids,
prostanoid hormones, sugars, fatty acids, lincosaminides,
macrolides, nitrofurans, nucleosides, oligosaccharides,
oxazolidinones, peptides and polypeptides, phenazines, polyenes,
polyethers, quinolones, tetracyclines, streptogramins,
sulfonamides, steroids, vitamins and xanthines. In such
embodiments, if there is an available assay for directly
identifying and/or isolating the natural product, and it is
expected that the analogs would behave similarly under those
conditions, the detection step of the subject method can be as
straightforward as directly detecting analogs of interest in the
cell culture media or preparation of the cell. For instance,
chromatographic or other biochemical separation of a test extract
may be carried out, and the presence or absence of an analog
detected, e.g., spectrophotometrically, in the fraction in which
the known compounds would occur under similar conditions. In
certain embodiments, such compounds can have a characteristic
fluorescence or phosphorescence which can be detected without any
need to fractionate the media and/or recombinant cell.
[0128] In related embodiments, whole or fractionated culture media
or lysate from a recombinant host cell can be assayed by contacting
the test sample with a heterologous cell ("test cell") or
components thereof. For instance, a test cell, which can be
prokaryotic or eukaryotic, is contacted with conditioned media
(whole or fractionated) from a recombinant host cell, and the
ability of the conditioned media to induce a biological or
biochemical response from the test cell is assessed. For instance,
the assay can detect a phenotypic change in the test cell, as for
example a change in: the transcriptional or translational rate or
splicing pattern of a gene; the stability of a protein; the
phosphorylation, prenylation, methylation, glycosylation or other
post translational modification of a protein, nucleic acid or
lipid; the production of 2nd messengers, such as cAMP, inositol
phosphates and the like. Such effects can be measured directly,
e.g., by isolating and studying a particular component of the cell,
or indirectly such as by reporter gene expression, detection of
phenotypic markers, and cytotoxic or cytostatic activity on the
test cell.
[0129] When screening for bioactivity of test compounds produced by
the recombinant host cells, intracellular second messenger
generation can be measured directly. A variety of intracellular
effectors have been identified. For instance, for screens intended
to isolate compounds, or the genes which encode the compounds, as
being inhibitors or potentiators of receptor- or ion
channel-regulated events, the level of second messenger production
can be detected from downstream signaling proteins, such as
adenylyl cyclase, phosphodiesterases, phosphoinositidases,
phosphoinositol kinases, and phospholipases, as can the
intracellular levels of a variety of ions.
[0130] In still other embodiments, the detectable signal can be
produced by use of enzymes or chromogenic/fluorescent probes whose
activities are dependent on the concentration of a second
messenger, e.g., such as calcium, hydrolysis products of inositol
phosphate, cAMP, etc.
[0131] Many reporter genes and transcriptional regulatory elements
are known to those of skill in the art and others may be identified
or synthesized by methods known to those of skill in the art.
Examples of reporter genes include, but are not limited to CAT
(chloramphenicol acetyl transferase) (Alton and Vapnek (1979),
Nature 282: 864-869) luciferase, and other enzyme detection
systems, such as beta-galactosidase; firefly luciferase (deWet et
al. (1987), Mol. Cell. Biol. 7:725-737); bacterial luciferase
(Engebrecht and Silverman (1984), PNAS 1: 4154-4158; Baldwin et al.
(1984), Biochemistry 23: 3663-3667); alkaline phosphatase (Toh et
al. (1989) Eur. J. Biochem. 182: 231-238, Hall et al. (1983) J.
Mol. Appl. Gen. 2: 101), human placental secreted alkaline
phosphatase (Cullen and Malim (1992) Methods in Enzymol.
216:362-368); .beta.-lactamase or GST.
[0132] Transcriptional control elements for use in the reporter
gene constructs, or for modifying the genomic locus of an indicator
gene include, but are not limited to, promoters, enhancers, and
repressor and activator binding sites. Suitable transcriptional
regulatory elements may be derived from the transcriptional
regulatory regions of genes whose expression is rapidly induced,
generally within minutes, of contact between the cell surface
protein and the effector protein that modulates the activity of the
cell surface protein. Examples of such genes include, but are not
limited to, the immediate early genes (see, Sheng et al. (1990)
Neuron 4: 477-485), such as c-fos. Immediate early genes are genes
that are rapidly induced upon binding of a ligand to a cell surface
protein. The transcriptional control elements that are preferred
for use in the gene constructs include transcriptional control
elements from immediate early genes, elements derived from other
genes that exhibit some or all of the characteristics of the
immediate early genes, or synthetic elements that are constructed
such that genes in operative linkage therewith exhibit such
characteristics. The characteristics of preferred genes from which
the transcriptional control elements are derived include, but are
not limited to, low or undetectable expression in quiescent cells,
rapid induction at the transcriptional level within minutes of
extracellular simulation, induction that is transient and
independent of new protein synthesis, subsequent shut-off of
transcription requires new protein synthesis, and mRNAs transcribed
from these genes have a short half-life. It is not necessary for
all of these properties to be present.
[0133] In still other embodiments, the detection step is provided
in the form of a cell-free system, e.g., a cell-lysate or purified
or semi-purified protein or nucleic acid preparation. The samples
obtained from the recombinant host cells can be tested for such
activities as inhibiting or potentiating such pairwise complexes
(the "target complex") as involving protein-protein interactions,
protein-nucleic acid interactions, protein-ligand interactions,
nucleic acid-nucleic acid interactions, and the like. The assay can
detect the gain or loss of the target complexes, e.g. by endogenous
or heterologous activities associated with one or both molecules of
the complex.
[0134] Assays that are performed in cell-free systems, such as may
be derived with purified or semi-purified proteins, are often
preferred as "primary" screens in that they can be generated to
permit rapid development and relatively easy detection of an
alteration in a molecular target when contacted with a test sample.
Moreover, the effects of cellular toxicity and/or bioavailability
of the test sample can be generally ignored in the in vitro system,
the assay instead being focused primarily on the effect of the
sample on the molecular target as may be manifest in an alteration
of binding affinity with other molecules or changes in enzymatic
properties (if applicable) of the molecular target. Detection and
quantification of the pairwise complexes provides a means for
determining the test samples efficacy at inhibiting (or
potentiating) formation of complexes. The efficacy of the compound
can be assessed by generating dose response curves from data
obtained using various concentrations of the test sample. Moreover,
a control assay can also be performed to provide a baseline for
comparison. For instance, in the control assay conditioned media
from untransformed host cells can be added.
[0135] The amount of target complex may be detected by a variety of
techniques. For instance, modulation in the formation of complexes
can be quantitated using, for example, detectably labeled proteins
or the like (e.g., radiolabeled, fluorescently labeled, or
enzymatically labeled), by immunoassay, or by chromatographic
detection.
[0136] In still other embodiments, a purified or semi-purified
enzyme can be used to assay the test samples. The ability of a test
sample to inhibit or potentiate the activity of the enzyme can be
conveniently detected by following the rate of conversion of a
substrate for the enzyme.
[0137] In yet other embodiments, the detection step can be designed
to detect a phenotypic change in the host cell which is induced by
products of the expression of the heterologous genomic sequences.
Many of the above-mentioned cell-based assay formats can also be
used in the host cell, e.g., in an autocrine-like fashion.
[0138] In addition to providing a basis for isolating
biologically-active molecules produced by the recombinant host
cells, the detection step can also be used to identify genomic
clones which include genes encoding biosynthetic pathways of
interest. Moreover, by iterative and/or combinatorial sub-cloning
methods relying on such detection steps, the individual genes which
confer the detected pathway can be cloned from the larger genomic
fragment.
[0139] The subject screening methods can be carried in a
differential format, e.g. comparing the efficacy of a test sample
in a detection assay derived with human components with those
derived from, e.g., fungal or bacterial components. Thus,
selectivity as a bacteriocide or fungicide can be a criterion in
the selection protocol.
[0140] The host strain need not produce high levels of the novel
compounds for the method to be successful. Expression of the genes
may not be optimal, global regulatory factors may not be present,
or metabolite pools may not support maximum production of the
product. The ability to detect the metabolite will often not
require maximal levels of production, particularly when the
bioassay is sensitive to small amounts of natural products. Thus
initial submaximal production of compounds need not be a limitation
to the success of the subject method.
[0141] Finally, as indicated above, the test sample can be derived
from, for example, conditioned media or cell lysates. With regard
to the latter, it is anticipated that in certain instances there
may be heterologously-expressed compounds that may not be properly
exported from the host cell. There are a variety of techniques
available in the art for lysing cells. A preferred approach is
another aspect of the present invention, namely, the use of a host
cell-specific lysis agent. For instance phage (e.g., P1, .lamda.,
.phi.80) can be used to selectively lyse E coli. Similarly,
cyanophages can be used to selectively lyse cyanobacteria, such as
Synechococcus and Prochlorococcus. Addition of such phage to grown
cultures of host cells can maximize access to the heterologous
products of new biosynthetic pathways in the cell. Moreover, such
agents do not interfere with the growth of a tester organism, e.g.,
a human cell, that may be co-cultured with the host cell
library.
Metabolic Optimization
[0142] As part of the optimization process, the invention also
provides steps to eliminate undesirable side reactions, if any,
that may consume carbon and energy but do not produce useful
products (such as hydrocarbons, wax esters, surfactants and other
hydrocarbon products). These steps may be helpful in that they can
help to improve yields of the desired products.
[0143] A combination of different approaches may be used. Such
approaches include, for example, metabolomics (which may be used to
identify undesirable products and metabolic intermediates that
accumulate inside the cell), metabolic modeling and isotopic
labeling (for determining the flux through metabolic reactions
contributing to hydrocarbon production), and conventional genetic
techniques (for eliminating or substantially disabling unwanted
metabolic reactions). For example, metabolic modeling provides a
means to quantify fluxes through the cell's metabolic pathways and
determine the effect of elimination of key metabolic steps. In
addition, metabolomics and metabolic modeling enable better
understanding of the effect of eliminating key metabolic steps on
production of desired products.
[0144] To predict how a particular manipulation of metabolism
affects cellular metabolism and synthesis of the desired product, a
theoretical framework was developed to describe the molar fluxes
through all of the known metabolic pathways of the cell. Several
important aspects of this theoretical framework include: (i) a
relatively complete database of known pathways, (ii) incorporation
of the growth-rate dependence of cell composition and energy
requirements, (iii) experimental measurements of the amino acid
composition of proteins and the fatty acid composition of membranes
at different growth rates and dilution rates and (iv) experimental
measurements of side reactions which are known to occur as a result
of metabolism manipulation. These new developments allow
significantly more accurate prediction of fluxes in key metabolic
pathways and regulation of enzyme activity. (Keasling, J. D. et
al., "New tools for metabolic engineering of Escherichia coli," In
Metabolic Engineering, Publisher Marcel Dekker, New York, Nym 1999;
Keasling, J. D, "Gene-expression tools for the metabolic
engineering of bacteria," Trends in Biotechnology, 17, 452-460,
1999; Martin, V. J. J., et al., "Redesigning cells for production
of complex organic molecules," ASM News 68, 336-343 2002; Henry, C.
S., et al., "Genome-Scale Thermodynamic Analysis of Escherichia
coli Metabolism," Biophys. J., 90, 1453-1461, 2006.)
[0145] Such types of models have been applied, for example, to
analyze metabolic fluxes in organisms responsible for enhanced
biological phosphorus removal in wastewater treatment reactors and
in filamentous fungi producing polyketides. See, for example,
Pramanik, et al., "A stoichiometric model of Escherichia coli
metabolism: incorporation of growth-rate dependent biomass
composition and mechanistic energy requirements." Biotechnol.
Bioeng. 56, 398-421, 1997; Pramanik, et al., "Effect of carbon
source and growth rate on biomass composition and metabolic flux
predictions of a stoichiometric model." Biotechnol. Bioeng. 60,
230-238, 1998; Pramanik et al., "A flux-based stoichiometric model
of enhanced biological phosphorus removal metabolism." Wat. Sci.
Tech. 37, 609-613, 1998; Pramanik et al., "Development and
validation of a flux-based stoichiometric model for enhanced
biological phosphorus removal metabolism." Water Res. 33, 462-476,
1998.
Products
[0146] The HyperPhotosynthetic organisms in the present invention
may be engineered to yield product categories, including but not
limited to, biological sugars, hydrocarbon products, solid forms,
and pharmaceuticals.
[0147] Biological sugars include but are not limited to glucose,
starch, cellulose, hemicellulose, glycogen, xylose, dextrose,
fructose, lactose, fructose, galactose, uronic acid, maltose, and
polyketides. In preferred embodiments, the biological sugar may be
glycogen, starch, or cellulose.
[0148] Cellulose is the most abundant form of living terrestrial
biomass (Crawford, R. L. 1981. Lignin biodegradation and
transformation, John Wiley and Sons, New York.). Cellulose,
especially cotton linters, is used in the manufacture of
nitrocellulose. Cellulose is also the major constituent of paper.
Cellulose monomers (beta-glucose) are linked together through 1,4
glycosidic bonds. Cellulose is a straight chain (no coiling
occurs). In microfibrils, the multiple hydroxide groups
hydrogen-bond with each other, holding the chains firmly together
and contributing to their high tensile strength. Given a cellulose
material, the portion that does not dissolve in a 17.5% solution of
sodium hydroxide at 20.degree. C. is Alpha cellulose, which is true
cellulose; the portion that dissolves and then precipitates upon
acidification is Beta cellulose, and the proportion that dissolves
but does not precipitate is Gamma cellulose. Hemicellulose is a
class of plant cell-wall polysaccharide that can be any of several
heteropolymers. These include xylane, xyloglucan, arabinoxylan,
arabinogalactan, glucuronoxylan, glucomannan, and galactomannan.
This class of polysaccharides is found in almost all cell walls
along with cellulose. Hemicellulose is lower in weight than
cellulose, and cannot be extracted by hot water or chelating
agents, but can be extracted by aqueous alkali. Polymeric chains
bind pectin and cellulose, forming a network of cross-linked
fibers.
[0149] There are essentially three types of hydrocarbon products:
(1) aromatic hydrocarbon products, which have at least one aromatic
ring; (2) saturated hydrocarbon products, which lack double, triple
or aromatic bonds; and (3) unsaturated hydrocarbon products, which
have one or more double or triple bonds between carbon atoms. A
"hydrocarbon product" may be further defined as a chemical compound
that consists of C, H, and optionally O, with a carbon backbone and
atoms of hydrogen and oxygen, attached to it. Oxygen may be singly
or double bonded to the backbone and may be bound by hydrogen. In
the case of ethers and esters, oxygen may be incorporated into the
backbone, and linked by two single bonds, to carbon chains. A
single carbon atom may be attached to one or more oxygen atoms.
Hydrocarbon products may also include the above compounds attached
to biological agents including proteins, coenzyme A and acetyl
coenzyme A. Hydrocarbon products include, but are not limited to,
hydrocarbons, alcohols, aldehydes, carboxylic acids, ethers,
esters, carotenoids, and ketones.
[0150] Hydrocarbon products also include alkanes, alkenes, alkynes,
dienes, isoprenes, alcohols, aldehydes, carboxylic acids,
surfactants, wax esters, polymeric chemicals [polyphthalate
carbonate (PPC), polyester carbonate (PEC), polyethylene,
polypropylene, polystyrene, polyhydroxyalkanoates (PHAs),
poly-beta-hydroxybutryate (PHB), polylactide (PLA), and
polycaprolactone (PCL)], monomeric chemicals [propylene glycol,
ethylene glycol, and 1,3-propanediol, ethylene, acetic acid,
butyric acid, 3-hydroxypropanoic acid (3-HPA), acrylic acid, and
malonic acid], and combinations thereof. In some preferred
embodiments, the hydrocarbon products are alkanes, alcohols,
surfactants, wax esters and combinations thereof. Other hydrocarbon
products include fatty acids, acetyl-CoA bound hydrocarbons,
acetyl-CoA bound carbohydrates, and polyketide intermediates.
[0151] Recombinant organisms can be engineered to produce
hydrocarbon products and intermediates over a large range of sizes.
Specific alkanes that can be produced include, for example, ethane,
propane, butane, pentane, hexane, heptane, octane, nonane, decane,
undecane, dodecane, tridecane, tetradecane, pentadecane,
hexadecane, heptadecane, and octadecane. In preferred embodiments,
the hydrocarbon products are octane, decane, dodecane, tetradecane,
and hexadecane. Hydrocarbon precursors such as alcohols that can be
produced include, for example, ethanol, propanol, butanol,
pentanol, hexanol, heptanol, octanol, nonanol, decanol, undecanol,
dodecanol, tridecanol, tetradecanol, pentadecanol, hexadecanol,
heptadecanol, and octadecanol. In more preferred embodiments, the
alcohol is selected from ethanol, propanol, butanol, pentanol,
hexanol, heptanol, octanol, nonanol, and decanol.
[0152] Surfactants are used in a variety of products, including
detergents and cleaners, and are also used as auxiliaries for
textiles, leather and paper, in chemical processes, in cosmetics
and pharmaceuticals, in the food industry and in agriculture. In
addition, they may be used to aid in the extraction and isolation
of crude oils which are found hard to access environments or as
water emulsions. There are four types of surfactants characterized
by varying uses. Anionic surfactants have detergent-like activity
and are generally used for cleaning applications. Cationic
surfactants contain long chain hydrocarbons and are often used to
treat proteins and synthetic polymers or are components of fabric
softeners and hair conditioners. Amphoteric surfactants also
contain long chain hydrocarbons and are typically used in shampoos.
Non-ionic surfactants are generally used in cleaning products.
[0153] Hydrocarbons can additionally be produced as biofuels. A
biofuel is any fuel that derives from a biological source--recently
living organisms or their metabolic byproducts, such as manure from
cows. A biofuel may be further defined as a fuel derived from a
metabolic product of a living organism. Preferred biofuels include,
but are not limited to, biodiesel, biocrude, ethanol, "renewable
petroleum," butanol, and propane.
[0154] Solid forms of carbon including, for example, coal,
graphite, graphene, cement, carbon nanotubes, carbon black,
diamonds, and pearls. Pure carbon solids such as coal and diamond
are the preferred solid forms.
[0155] Pharmaceuticals can be produced including, for example,
isoprenoid-based taxol and artemisinin, or oseltamivir.
EXAMPLES
Plasmid Constructions
[0156] Construction of pJB5 Base Plasmid
[0157] The pJB5 base plasmid was designed as an empty expression
vector for recombination into Synechococcus sp. PCC 7002. Two
regions of homology, the Upstream Homology Region (UHR) and the
Downstream Homology Region (DHR) were designed to flank the cloned
gene(s) of interest. These 500 bp regions of homology correspond to
positions 3301-3800 and 3801-4300 on the natural plasmid pAQ1
(Genbank Accession NC.sub.--005025) for UHR and DHR respectively.
The aadA promoter, gene sequence, and terminator were designed to
confer spectinomycin and streptomycin resistance to the integrated
construct. For expression, pJB5 was designed with the aph2
kanamycin resistance cassette promoter and ribosome binding site
(RBS). Downstream of this promoter and RBS, we designed and
inserted the restriction endonuclease recognition site for NdeI and
EcoRI, as well as the sites for XhoI, BamHI, SpeI and PacI.
Following the EcoRI site, the natural terminator from the alcohol
dehydrogenase gene from Zymomonas mobilis (adhII) terminator was
included. Convenient XbaI restriction sites flank the UHR and the
DHR allowing cleavage of the DNA intended for recombination from
the rest of the vector. pJB5, pJB6 and pJB7 were constructed by
DNA2.0 (Menlo Park, Calif.).
Construction of pJB161 Base Plasmid
[0158] The pJB161 base plasmid was designed to complement the pJB5
base plasmid, but with different integration sites and resistance
markers to allow for integration of two genes simultaneously into
Synechococcus sp. PCC 7002. The UHR and the DHR from pJB5 were
replaced with regions flanking the lactate dehydrogenase gene of
Synechococcus sp. PCC 7002. The new ldh-UHR and ldh-DHR were
amplified by PCR and correspond to positions 185990-77 and
184333-184913 on the natural plasmid pAQ7 (Genbank Accession
NC.sub.--0104774) for lac-UHR and lac-DHR respectively. The primers
used for the PCR were as follows: Forward Primer for
lac-UHR--ttgctacctgcagggccaccacagccaaattcatcgtt (SEQ ID NO: 1),
Downstream Primer for lac-UHR--ggttgtgcggccgcagtattggctgtgatgttgg
(SEQ ID NO: 2); Upstream Primer for
lac-DHR--cgataaggcgcgccgaaactgcgccaagaatagc (SEQ ID NO: 3),
Downstream Primer for
lac-DHR--gtgtatggccggccatcgcctttatggtgctttatgtg (SEQ ID NO: 4). The
Upstream Primer for lac-UHR added a SbfI restriction endonuclease
site, the Downstream Primer for lac-UHR added a NotI restriction
site, the Upstream Primer for lac-DHR added an AscI restriction
site, and the Downstream Primer for lac-DHR added an FseI
restriction site. The homology regions were amplified from
Synechococcus sp. PCC 7002 genomic DNA using the high fidelity
Phusion DNA Polymerase Master Mix (New England Biolabs, Beverly,
Mass.). The amplified ldh-DHR region and the pJB5 plasmid were
digested individually with FseI and AscI (New England Biolabs)
restriction endonucleases using well known laboratory techniques.
The resulting DNA fragments were gel isolated on a 1% TAE agarose
gel, purified using a Gel Isolation Kit (Qiagen) and ligated with
the Quick Ligation Kit (New England Biolabs) with no deviation from
the published techniques. The ligated product was transformed into
EPI400 (EpiCentre.RTM.) chemically competent cells using standard
techniques, and confirmed by PCR. The resulting plasmid was
subjected to another round of cloning to integrate the ldh-UHR
region. The amplified ldh-UHR region and the newly constructed
plasmid were digested individually with SbfI and NotI (New England
Biolabs) restriction endonucleases using well known laboratory
techniques. Both digestions were gel isolated on a 1% TAE agarose
gel, purified using a Gel Isolation Kit (Qiagen) and ligated with
the Quick Ligation Kit (New England Biolabs) with no deviation from
the published techniques. The ligated product was transformed into
EPI400 chemically competent cells using standard techniques
(EpiCenter), and confirmed by PCR. The resulting plasmid, pJB165,
was confirmed by PCR and restriction digestion.
[0159] Finally, to change the resistance marker for the integrated
construct, a kanamycin resistance cassette, from the cloning vector
pMAKK76 (Accession Number: U08460) was designed with restriction
sites for PacI and AscI flanking the 5' and 3' end of the gene
respectively. The cassette was constructed by DNA2.0 (Menlo Park,
Calif.). This cassette, along with pJB165 were both individually
digested with PacI and AscI (New England Biolabs) restriction
endonucleases using well known laboratory techniques. Both
digestions were gel isolated on a 1% TAE agarose gel, purified
using a Gel Isolation Kit (Qiagen) and ligated with the Quick
Ligation Kit (New England Biolabs) with no deviation from the
published techniques. The ligated product was transformed into
EPI400 chemically competent cells using standard techniques
(EpiCentre). The resulting plasmid, pJB161, was confirmed by PCR
and by resistance of transformed colonies to the antibiotic
kanamycin.
[0160] Construction of pJB5-PdcAdhII and JCC136
[0161] The pyruvate decarboxylase (pdc) and alcohol dehydrogenase
(adhII) genes were cloned into the pJB5 plasmid with the following
procedure. The pdc-adhII genes from Zymomonas mobilis (Genbank:
DD161475, M15394) were designed with an NdeI site replacing the
start of the pdc coding region. Following the pdc gene, we designed
two restriction endonuclease sites (XhoI and BamHI). Next, the
adhII sequence was designed in whole subsequent to the restriction
sites, and finally, the natural adhII terminator was included as
well, downstream of an inserted EcoRI site. This construct was
constructed by DNA2.0 (Menlo Park, Calif.) and was inserted by
restriction digest with NdeI and EcoRI (New England Biolabs;
Ipswitch, Mass.) on both pJB5 and the insert followed by ligation
with a Quick Ligation Kit (New England Biolabs; Ipswitch, Mass.).
The ligated construct was transformed into The NEB 5-alpha F'Iq
Competent E. coli (High Efficiency) (New England Biolabs: Ipswitch,
Mass.).
Transformation of pJB5-PdcAdhII into Synechococcus sp. PCC 7002
Using Standard Procedures.
[0162] Briefly, Synechococcus sp. PCC 7002 was grown for 48 h from
colonies in an incubated shaker flask at 30.degree. C. with 1%
CO.sub.2 to an OD.sub.730 of 1.0 in A.sup.+ medium described in
Frigaard N U et al. (2004) "Gene inactivation in the cyanobacterium
Synechococcus sp. PCC 7002 and the green sulfur bacterium
Chlorobium tepidum using in vitro-made DNA constructs and natural
transformation" Methods Mol Biol 274:325-340. Five hundred .mu.L of
culture was added to a test-tube with 30 .mu.L of 1-5 .mu.g of DNA
prepped from a Qiagen Qiaprep Spin Miniprep Kit (Valencia, Calif.)
for each construct. Cells were incubated bubbling in 1% CO.sub.2 at
approximately 1 bubble every 2 seconds for 4 hours. 200 .mu.L of
cells were plated on A.sup.+ medium plates with 1.5% Bacto-agar and
grown at 30.degree. C. for two days in low light. Spectinomycin was
underlayed to give a final concentration of 10 .mu.g/mL. Resistant
colonies were visible in 7-10 days. Colonies were screened by PCR.
The resulting strain was named JCC136.
Construction of pJB263 Base Plasmid
[0163] The pJB263 base plasmid was constructed to be similar to
pJB5, but for integration and replacement of the glgA gene
(Accession Number: NP.sub.--441947) in Synechocystis sp. PCC 6803.
The glgA-UHR and glgA-DHR were designed to 750 bp upstream and
downstream of the glgA gene in Synechocystis sp. PCC 6803, which
corresponds to (-) strands of 2266647 to 22667396 and 2264463 to
2265212 respectively on the chromosome (Accession Number:
NC.sub.--000911). The glgA-UHR and glgA-DHR were designed with
flanking SbfI and NotI restriction endonuclease sites, as well as
PacI and AscI restriction endonuclease sites, with a sequence
spacer to ease later digest in between. This construct was
constructed by DNA2.0 (Menlo Park, Calif.). This cassette, along
with pJB5-PdcAdhII, was both individually digested with NotI and
AscI (New England Biolabs) restriction endonucleases using well
known laboratory techniques. Both digestions were gel isolated on a
1% TAE agarose gel, purified using a Gel Isolation Kit (Qiagen) and
ligated with the Quick Ligation Kit (New England Biolabs) with no
deviation from the published techniques. The ligated product was
transformed into EPI400 chemically competent cells using standard
techniques (EpiCentre). The resulting plasmid, pJB263, was
confirmed by PCR and by resistance of transformed colonies to the
antibiotic spectinomycin.
Examples
[0164] The examples provided herein illustrate the invention in
more detail. These examples are provided to enable those skilled
artisans to help understand and practice various aspects of the
invention and therefore should not be construed as limiting.
Various modifications and extensions of the invention in addition
to those described herein will become apparent to those skilled
artisans and therefore such modifications and extensions fall
within the scope of invention.
Example 1
Improved Light Capture
[0165] Photosynthetic organisms have evolved elaborate methods to
efficiently capture light, which is often times limiting in their
natural habitats. Eukaryotic photoautotrophic organisms encode a
superfamily of chlorophyll and carotenoid-binding proteins known as
the light-harvesting complexes (LHCs), which capture and transfer
light energy to the photosynthetic reaction centers [Green B R and
Durnford D G. "The chlorophyll-carotenoid proteins of oxygenic
photosynthesis." Ann Rev Plant Physiol Plant Mol Biol (1996).
47:685-714]. Chlorophyll molecules are specifically arranged in so
called "antenna" structures; the number of chlorophyll molecules
per reaction center can vary considerably encompassing upwards of
350 chlorophyll a and chlorophyll b molecules per reaction center
for photosystem II (PSII) and 300 chlorophyll a molecules for
photosystem I (PSI). Antennas provide a means to increase light
absorption spectra without having to build an entirely new
protein-based reaction center and accompanying electron transport
system. Large antenna provides survival advantages to organisms in
the wild; however, under conditions of high light intensity, they
absorb excess photons which must be wastefully dissipated as
fluorescence or heat. Failure to safely dissipate a singlet-state
excited chlorophyll molecule can result in formation of singlet
oxygen, which is an extremely damaging reactive oxygen species
[Muller P, Li X, Niyogi K K. "Non-photochemical quenching. A
response to excess light energy." Plant Physiology (2001).
125:1558-66].
[0166] Organisms naturally increase or decrease their chlorophyll
antenna size as an adaptive response to changing light conditions
[Falkowski P G and Owens T G. "Light-shade adaptation." Plant
Physiol (1980). 66:592-595; Ballottari M, Dall'Osto L, Morosinotto
T, and Bassi R. "Contrasting behavior of higher plant photosystem I
and II antenna systems during acclimation." J Biol Chem (2007).
282(12):8947-58].
[0167] Recently, it has been demonstrated that the normally dynamic
antenna size of microalgae can be permanently truncated genetically
via downregulation of tla1 [Polle J, Kanakagiri S, and Melis A.
"tla1, a DNA insertional transformant of the green alga
Chlamydomonas reinhardtii with a truncated light-harvesting
chlorophyll antenna size." Planta (2003). 217:49-59; Tetali S D,
Mitra M, and Melis A. "Development of the light-harvesting
chlorophyll antenna in the green alga Chlamydomonas reinhardtii is
regulated by the novel Tla1 gene." Planta (2007). 225:813-829] or
the entire family of LHC proteins [Mussgnug J H, Thomas-Hall S,
Rupprecht J, Foo A, Klassen V, McDowall A, Schenk P M, Kruse O, and
Hankamer B. "Engineering photosynthetic light capture: impacts on
improved solar energy to biomass conversion." (2007). 5(6):802-14].
Strains possessing smaller antenna exhibit reduced cell shading and
higher productivities specifically under high light fluxes.
[0168] Chlorosomes, the light-harvesting antenna of green sulfur
and green non-sulfur phototrophic bacteria, are specialized
lipoprotein compartments typically comprising bacteriochlorophyll
(BChl) c, BChl a, carotenoids, and quinones [Frigaard N U, Li H,
Milks K J, and Bryant D A. "Nine mutants of Chlorobium tepidum each
unable to synthesize a different chlorosome protein still assemble
functional chlorosomes. J Bacteriol (2004). 186(3):636-53]. In the
wild, chlorosomes provide green bacteria significant survival
advantages, as they enable growth under extremely low light
conditions. The antenna structure can be eliminated by inactivating
the BChl c synthase (bchK) [Friggard N U, Voigt G D, and Bryant D
A. "Chlorobium tepidum mutant lacking bacteriochlorophyll c made by
inactivation of the bchK gene, encoding bacteriochlorophyll c
synthase." J Bacteriol (2002). 184(12):3368-76]. Such mutants
replicate about 7-fold slower than their wild-type counterparts
under low-light conditions, but are only partially impaired
(.about.2.3-fold) under higher light intensities.
[0169] Phycobilisomes, the light harvesting antenna of
cyanobacteria and red algae, are primarily comprised of the
phycobiliproteins phycoerythrin, phycocyanin, and allophycocyanin
[Grossman A R, Schaefer M R, Chiang G G, and Collier J L. "The
phycobilisome, a light-harvesting complex responsive to
environmental conditions." Microbiol Rev (1993). 57(3):725-49] Like
the light harvesting antenna of plants, algae, and green bacteria,
the phycobilisomes are entirely dispensable in cyanobacteria [Ughy
B and Ajlani G. "Phycobilisome rod mutants in Synechocystis sp.
Strain PCC 6803." Microbiology (2004). 150:4147-4156; Ajlani G and
Vernotte C. Construction and characterization of
phycobiliprotein-less mutant of Synechocystis sp. PCC 6803." Plant
Mol Biol (1998). 37:577-580; Anderson A K and Toole C M. "A model
for early events in the assembly pathway of cyanobacterial
phycobilisomes." Mol. Microbiol (1998). 30(3):467-74].
[0170] While photoautotrophic organisms invariably utilize
photosynthetic reaction centers to convert photonic energy into
chemical energy (in the form of ATP, via proton motive force
(PMF)-driven ATP synthase) and reducing power (NADPH), no known
photoautotrophic organisms employ light-activated proton
translocation systems as exemplified by archaeal rhodopsin-like
proteins (bacteriorhodopsin) [Oesterhelt D and Stoeckenius W.
"Rhodopsin-like protein from the purple membrane of Halobacterium
halobium." Nature New Biol (1971). 233(39):149-52]. Nevertheless,
related sequences have definitively been shown to mediate
light-driven energy generation (photoheterotrophy) in bacteria
[Beja O, Aravind L, Koonin E V, Suzuki M, Hadd A, Nguyen L P,
Jovanovich S B, Gates C M, Feldman R A, Spudich J L, Spudich E N,
and DeLong E F. "Bacterial rhodopsin: evidence for a new type of
phototrophy in the sea." Science (2000). 289:1902-6; Beja O,
Spudich E N, Spudich J L, Leclerc M, DeLong E F. "Proterhodopsin
phototrophy in the ocean." Nature (2001). 411:786-9; de la Torre J
R, Christianson L M, Beja O, Suzuki M T, Karl D M, Heidelberg J,
and DeLong E F. "Proteorhodopsin genes are distributed among
divergent marine bacterial taxa." Proc Natl Acad. Sci (2003).
100(22):12830-5].
[0171] The present invention teaches that exogenous expression of
one or more forms of light-powered proton pumps in a photoautotroph
increases organism efficiency by providing a parallel means to
convert photonic energy into PMF, which can be used to power active
transport of molecules across membranes or generate ATP through an
endogenous or exogenous ATP synthase. It has been estimated that
transport consumes between 15-25% of all energy during cell growth
[Stouthamer A H. "A theoretical study on the amount of ATP required
for synthesis of microbial cell material." Antonie Van Leeuwenhoek
(1973). 39(3):545-65; Carruthers A. "Mechanisms for the facilitated
diffusion of substrates across cell membranes." Biochemistry
(1991). 30(16):3898-906]. Expression of light-powered proton pumps
thus provides photoautotrophic organisms with up to a 15-25% gain
in energetic efficiency, which is manifested by an improvement in
doubling-time, CO.sub.2-fixation rates, and/or carbon-based product
formation.
[0172] The proteorhodopsin (PR) gene is preferentially expressed in
organisms. An exemplary PR sequence is locus ABL60988 described in
Martinerz A, Bradley A S, Walbauer J R, Summons R E, DeLong E F.
PNAS (2007). "Proteorhodopsin photosystem gene expression enables
photophosphorylation in a heterologous host."
104(13):5590-5595.
[0173] In addition, or as an alternative, a bacteriorhodopsin gene
is expressed [Oesterhelt D, Stoeckenius W. Nature (1971)
"Rhodopsin-like protein from the purple membrane of Halobacterium
halobium." 233:149-152]. An exemplary bacteriorhodopsin sequence is
the NP.sub.--280292 locus described in Ng W V et al. PNAS (2000).
"Genome sequence of Halobacterium species NRC-1."
97(22):12176-22181. Bacteriorhodopsin has previously been
functionally expressed in yeast mitochondria [Hoffmann A,
Hildebrandt V, Heberle J, Buldt G. "Photoactive mitochondria: In
vivo transfer of a light-driven proton pump into the inner
mitochondrial membrane of Schizosaccharomyces pombe." Proc. Natl.
Acad. Sci (1994). 91: 9637-71].
[0174] Similarly, deltarhodopsin is expressed in addition to or as
an alternative [Ihara K et al. J Mol Biol (1999). "Evolution of the
archael rhodopsins: evolution rate changes by gene duplication and
functional differentiation." 285:163-174; Kamo N, Hashiba T,
Kikukawa T, Araiso T, Ihara K, Nara T. Biochem Biophys Res Commun
(2006). "A light-driven proton pump from Haloterrigena turkmenica:
functional expression in Escherichia coli membrane and coupling
with a H.sup.+ co-transporter." 342(2): 285-90). An exemplary
deltarhodopsin sequence is the AB009620 locus of Haloterrigena sp.
Arg-4 described in Ihara K et al. J Mol Biol (1999). "Evolution of
the archael rhodopsins: evolution rate changes by gene duplication
and functional differentiation." 285:163-174.
[0175] Similarly, the Leptosphaeria maculans opsin protein is
expressed as an addition to or as an alternative to other proton
pumps. An exemplary eukaryotic light-activated proton pump is
opsin, accession AAG01180 from Leptosphaeria maculans, described in
Waschuk S A, Benzerra A G, Shi L, and Brown L S. PNAS (2005).
"Leptosphaeria rhodopsin: Bacteriorhodopsin-like proton pump from a
eukaryote." 102(19):6879-83].
[0176] Finally a xanthorhodopsin proton pump with a carotenoid
antenna is expressed in addition to or as an alternative to other
proton pumps (Balashov S P, Imasheva E S, Boichenko V A, Anton J,
Wang J M, Lanyi J K. Science (2005) "Xanthorhodopsin: A proton pump
with a light harvesting cartenoid antenna." 309(5743): 2061-2064).
An exemplary xanthorhodopsin sequence is locus ABC44767 from
Salinibacter ruber DSM 13855 described in Mongodin E F et al. PNAS
(2005). "The genome of Salinibacter ruber: Convergence and gene
exchange among hyperhalophilic bacteria and archaea."
102(50):18147-18152.
[0177] The pumps are used alone or in combination, optimized to the
specific cell. The pumps can be directed to be incorporated into
one or more than one membrane locations, for example the
cytoplasmic, outer, mitochondrial, and/or chloroplast membranes.
Xanthorhodopsin and proteorhodopsin co-expression represents an
optimal combination.
[0178] In addition to the expression of one or more proton pumps
described above, a retinal biosynthesis pathway is expressed. When
PR and the retinal biosynthetic operon are functionally expressed
in E. coli, the pump is able to restore proton motive force to
azide-treated E. coli populations [Walter J M, Greenfield D,
Bustamante C, Liphardt J. PNAS (2007). "Light-powering Escherichia
coli with proteorhodopsin." 104(7):2408-2412]. A six gene retinal
biosynthesis operon, Accession number EF100190 is known (Martinerz
A, Bradley A S, Walbauer J R, Summons R E, DeLong E F. PNAS (2007).
"Proteorhodopsin photosystem gene expression enables
photophosphorylation in a heterologous host." 104(13):5590-5595)
and encodes amino acid sequences Isopentenyl-diphosphate
delta-isomerase (Idi), locus ABL60982; 15,15'-beta-carotene
dioxygenase (Blh), locus ABL60983; Lycopene cyclase (CrtY), locus
ABL60984; Phytoene synthase (CrtB), EC 2.5.1.32, locus ABL60985;
Phytoene dehydrogenase (CrtI), locus ABL60986; and Geranylgeranyl
pyrophosphate synthetase (CrtE), locus ABL60987.
[0179] The above 6 enzymes enable biosynthesis of retinal, which is
the essential chromophore common to all rhodopsin-related proton
pumps. In certain embodiments, additional spectral absorption is
provided by carotenoids, as exemplified by the xanthorhodopsin pump
and the C-40 salinixanthin antenna. In these embodiments, a
beta-carotene ketolase (CrtO) is expressed, such as the crtO gene
of the SRU.sub.--1502 locus in Salinibacter ruber, described in
Mongodin E F et al (2005). Other crtO genes include those from
Rhodococcus erythropolis (AY705709) and Deinococcus radiodurans R1
(NP.sub.--293819).
[0180] In certain embodiments, an endogenous or exogenous ATP
synthase (EC 3.6.3.14) is overexpressed to enable maximal
conversion of PMF into ATP. An exemplary ATP synthase is the
F.sub.1-F.sub.0 ATP synthase from Escherichia coli. The
membrane-bound F.sub.0 subunit is comprised of amino acid sequences
set forth in F0 sector of membrane-bound ATP synthase, subunit a
(AtpB), locus NP.sub.--418194; F0 sector of membrane-bound ATP
synthase, subunit c (AtpE), locus NP.sub.--418193; and F0 sector of
membrane-bound ATP synthase, subunit b (AtpF), locus
NP.sub.--418192. The catalytic F.sub.1 subunit is comprised of
amino acid sequences set forth in F1 sector of membrane-bound ATP
synthase, alpha subunit (AtpA), locus NP.sub.--418190; F1 sector of
membrane-bound ATP synthase, epsilon subunit (AtpC), locus
NP.sub.--418187; F1 sector of membrane-bound ATP synthase, beta
subunit (AtpD), locus NP.sub.--418188; F1 sector of membrane-bound
ATP synthase, gamma subunit (AtpG), locus NP.sub.--418189; and F1
sector of membrane-bound ATP synthase, delta subunit, (AtpH) locus
NP.sub.--418191.
[0181] In preferred embodiments, light-powered proton pumps are
expressed in the context of one or more cellular membranes within
an organism previously adapted, evolved, or engineered to contain
smaller light harvesting antenna than the wild-type organism prior
to adaptation, evolution, or engineering. Such organisms are
uniquely efficient at converting light energy into cellular energy,
biomass, and products, particularly when propagated under high
light fluxes.
Expression of SAR86 Gene Encoding Proteorhodopsin for the Light
Capture Module
[0182] The SAR86 proteorhodopsin gene (Beja, et al. (Science (2000)
vol. 289: 1902-1906; Genbank: AF279106) as used herein was obtained
from a plasmid previously constructed and provided by Jessica
Walters and Jan Liphardt (University of California, Berkeley). The
Walters-Liphardt host plasmid is a pBR322 plasmid derivative with a
beta-lactamase cassette bearing the SAR86 proteorhodopsin gene. The
proteorhodopsin gene was amplified from the Walters-Liphardt
plasmid using PCR primers with the forward primer
5'-TATACATCATATGGGTAAATTATTACTGATATTAGGTAGTGTTATTGC-3' (SEQ ID NO:
5) and the reverse primer
5'-GCTACAATTGTTAAGCATTAGAAGATTCTTTAACAGCAACATTCC-3' (SEQ ID NO: 6).
PCR amplifications were performed with the high fidelity Phusion
DNA Polymerase Master Mix (New England Biolabs, Beverly, Mass.).
The forward primer adds an NdeI restriction recognition site, and
the reverse primer adds a stop codon and an MfeI restriction
recognition site.
[0183] The amplified proteorhodpsin PCR gene product was cloned
into the pJB5 expression vector ("pJB5-PR") by digesting the insert
and vector individually with NdeI and MfeI (New England Biolabs)
restriction endonucleases with well known laboratory techniques.
Both digestions were gel isolated on 1% TAE agarose gel, purified
using a Gel Isolation Kit (Qiagen) and ligated with the Quick
Ligation Kit (New England Biolabs) with no deviation from the
published techniques. The ligated product was transformed into
EPI400 chemically competent cells using standard techniques
(EpiCenter), and confirmed by PCR.
[0184] pJB5-PR plasmid stocks were purified using Qiagen miniprep
kit for transformation into Synechococcus sp. PCC 7002. One to two
micrograms of pJB5-PR plasmid was added to Synechococcus sp PCC
7002 cells grown to an optical density of 1 and incubated at 37 C
for 4 hours using low intensity orbital shaking and low level light
source. Cells were then plated onto A.sup.+ solid media plates and
placed in a lighted incubator (100-250 uE/m2/s, 37 C) for 1 day.
Twenty-five micrograms/mL spectinomycin was underplayed on the
plates and incubated until colonies grew (.about.5 days).
Integration into target Synechococcus host cells is confirmed by
PCR of whole cell genomic DNA by a "colony PCR" protocol. Briefly,
.about.1 mm colonies were resuspended in 50 .mu.l deionized water,
and 5 .mu.l were used in 20 .mu.l standard PCR reactions using
Phusion DNA Polymerase Master Mix (New England Biolabs, Beverly,
Mass.) with the addition of a 2 minute 98 C degree denaturation
step at the very start of the standard PCR cycling conditions. The
PCR showed correct bands for colonies, and the strain was named
JCC1-SAR86 (FIG. 10, lane 5).
Example 2
Improving CO.sub.2 Fixation
[0185] There are four known pathways that enable autotrophic carbon
fixation: the 3-hydroxyproprionate (3-HPA) cycle (employed by
Chloroflexus aurantiacus and Crenarchaeota symbiosum), the
reductive TCA cycle (employed by Chlorobium tepidum), the reductive
acetyl coenzyme A pathway (also known as Woods-Ljungdahl pathway;
employed by chemolithoautotrophs such as Clostridium
thermoaceticum, Methanobacterium thermautotrophicum, and
Dusulfobacterium autotrophicum), and the reductive pentose
phosphate cycle (also known as the Calvin cycle, employed by
plants, algae, and all cyanobacteria). By definition, all
photoautotrophic organisms possess the ability to fix inorganic
CO.sub.2 into complex, reduced organic carbon molecules, such as
sugars.
[0186] The instant invention improves the rate and efficiency of
CO.sub.2 fixation by engineering functional improvements into the
host's endogenous CO.sub.2 fixation pathways, including
overexpression of wild-type and/or variant enzymes. Alternately or
in addition, functional improvements are engineered via
supplementing the host's endogenous CO.sub.2 fixation pathways with
one or more exogenous CO.sub.2 fixation enzymes or pathways.
[0187] The engineered organisms replicate more rapidly than their
wild-type counterparts. Overexpression of two enzymes of the Calvin
cycle in tobacco leaves has previously been shown to enhance growth
compared to the wild-type plants [Tamoi M, Nagaoka M, Yabuta Y, and
Shigeoka S. "Carbon metabolism in the Calvin cycle." Plant
Biotechnology (2005). 22:355-360]. While not wishing to be bound by
theory, improved endogenous and/or exogenous CO.sub.2 fixation
enzymes enables more rapid conversion of CO.sub.2 into biological
intermediates and carbon products, which appears to be a limiting
facet governing the doubling time of photoautotrophic
organisms.
[0188] Table 1 lists genes which are overexpressed to enhance
carbon fixation rates and efficiencies, together with information
on associated pathways, Enzyme Commission (EC) Numbers, exemplary
gene names, source organism, GenBank accession numbers, and
homologs from alternate sources. When the parental organism encodes
a gene with the indicated enzymatic activity, it is nevertheless
useful to overexpress these components to improve CO.sub.2
fixation. In one embodiment, the native enzyme sequence is
overexpressed. In preferred embodiments, it is useful to
overexpress an exogenous gene, which allows for more explicit
regulatory control in the bioprocess and a means to potentially
mitigate the effects of central metabolism regulation, which is
focused around the native genes explicitly.
I. Enzymes for a Functional 3-Hydroxypropionate Cycle
[0189] The following enzyme activities are expressed to establish a
functional 3-hydroxypropionate cycle. This pathway is natively
employed by Chloroflexus aurantiacus [Herter S, Farfsing J, Gad'On
N, Rieder C, Eisenreich W, Bacher A, and Fuchs G. J Bacteriol
(2001). "Autotrophic CO.sub.2 fixation by Chloroflexus aurantiacus:
study of glyoxylate formation and assimilation via the
3-hydroxypropionate cycle." 183(14):4305-16].
[0190] Acetyl-CoA carboxylase (ACCase), (EC 6.4.1.2), generates
malonyl-CoA, ADP, and Pi from Acetyl-CoA, CO.sub.2, and ATP. An
exemplary ACCase subunit alpha is accA from E. coli, locus
AAA70370. An exemplary ACCase subunit beta is accD from E. coli,
locus AAA23807. An exemplary biotin-carboxyl carrier protein is
accB from E. coli, locus ECOACOAC. An exemplary biotin carboxylase
is accC from E. coli, locus AAA23748.
[0191] Malonyl-CoA reductase (also known as 3-hydroxypropionate
dehydrogenase) (EC 1.1.1.59), generates 3-hydroxyproprionate, 2
NADP.sup.+, and CoA from malonyl-CoA and 2 NADPH. An exemplary
bifunctional enzyme with both alcohol and dehydrogenase activities
is mcr from Chloroflexus aurantiacus, locus AY530019.
[0192] 3-hydroxypriopionyl-CoA synthetase (also known as
3-hydroxypropionyl-CoA dehydratase, or acryloyl-CoA reductase)
generates propionyl-CoA, AMP, PPi (inorganic pyrophosphate),
H.sub.2O, and NADP.sup.+ from 3-hydroxypriopionate, ATP, CoA, and
NADPH. An exemplary gene is propionyl-CoA synthase (pcs) from
Chloroflexus aurantiacus, locus AF445079.
[0193] Propionyl-CoA carboxylase (EC 6.4.1.3) generates
S-methylmalonyl-CoA, ADP, and Pi (inorganic phosphate) from
Propionyl-CoA, ATP, and CO.sub.2. An exemplary two subunit enzyme
is propionyl-CoA carboxylase alpha subunit (pccA) from Roseobacter
denitrificans, locus RD1.sub.--2032 and propionyl-CoA carboxylase
beta subunit (pccB) from Roseobacter denitrificans, locus
RD1.sub.--2028.
[0194] Methylmalonyl-CoA epimerase (EC 5.1.99.1) generates
R-methylmalonyl-CoA from S-methylmalonyl-CoA. An exemplary enzyme
from Rhodobacter sphaeroides is locus CP000661.
[0195] Methylmalonyl-CoA mutase (EC 5.1.99.2) generates
succinyl-CoA from R-methylmalonyl-CoA. The yliK protein (locus
NC000913.2) is an example.
[0196] Succinyl-CoA:L-malate CoA transferase generates L-malyl-CoA
and succinate from succinyl-CoA and malate. An exemplary two
subunit enzyme is SmtA from Chloroflexus aurantiacus, locus
DQ472736.1 and SmtB from Chloroflexus aurantiacus, locus
DQ472737.1.
[0197] Fumarate reductase (EC 1.3.1.6) generates fumarate and NADH
from succinate and NAD.sup.+. An exemplary fumarate reductase is
the E. coli frd operon (locus J01611). The frdA fumarate reductase
flavoprotein subunit is known. It is important to note that some
species may favor one direction over the other. Moreover, many of
these proteins are present in organisms that express unidirectional
and bidirectional versions. Examples are the frdB, fumarate
reductase iron-sulfur subunit, and the g15 subunit the g13
subunit.
[0198] Fumarate hydratase (EC 4.2.1.2) generates malate from
fumarate and water. E. coli encodes three distinct exemplary
fumarate hydratases: the class I aerobic fumarate hydratase (fumA),
locus CAA25204; the class I anaerobic fumarate hydratase (fumB),
locus AAA23827; the class II fumarate hydratase (fumC), locus
CAA27698.
[0199] L-malyl-CoA lyase (EC 4.2.1.2) generates acetyl-CoA and
glyoxylate from L-malyl-CoA. An exemplary gene is mclA from
Roseobacter denitrificans, locus NC.sub.--008209.1.
[0200] The above enzyme activities, listed in this section, confer
the ability to synthesize an organic 2-carbon glyoxylate molecule
from 2 molecules of CO.sub.2. The stoichiometry of this reaction is
2 CO.sub.2+3 ATP+3 NADPH.fwdarw.Glyoxylate+2 ADP+2 Pi+AMP+PPi+3
NADP.sup.+.
II. Enzymes for a Functional Reductive TCA Cycle
[0201] The following enzyme activities are expressed to establish a
functional reductive TCA cycle. This pathway is natively employed
by Chlorobium tepidum.
[0202] ATP-citrate lyase (EC. 2.3.3.8) generates acetyl-CoA,
oxaloacetate, ADP, and Pi from citrate, ATP, and CoA. An exemplary
ATP citrate lyase is the two subunit enzyme from Chlorobium
tepidum, comprising ATP citrate lyase subunit 1, locus CY1089 and
ATP citrate lyase subunit 2, locus CT1088.
[0203] Hydrogenobacter thermophilus employs an alternate pathway to
generate oxaloacetate from citrate. In a first step, the 2 subunit
citryl-CoA synthetase generates citryl-CoA from citrate, ATP, and
CoA. The large subunit: ccsA, locus BAD17844; the small subunit:
ccsB, locus BAD17846.
[0204] The Hydrogenobacter thermophilus citryl-CoA ligase (ccl),
locus BAD17841, generates oxaloacetate and acetyl-CoA from
citryl-CoA.
[0205] Malate dehydrogenase (EC 1.1.1.37) generates malate and
NAD.sup.+ from oxaloacetate and NADH. An exemplary malate
dehydrogenase from Chlorobium tepidum is locus CAA56810.
[0206] Fumarase (also known as fumarate hydratase) (EC 4.2.1.2)
generates fumarate and water from malate. E. coli encodes 3
different fumarase genes, which can be overexpressed in
photoautotrophic organisms. An exemplary E. coli fumarase hydratase
class I, (aerobic isozyme) is fumA. An exemplary E. coli fumarate
hydratase class I (anaerobic isozyme) is fumB. An exemplary E. coli
fumarate hydratase class II is fumC.
[0207] Succinate dehydrogenase (EC 1.3.99.1) generates succinate
and FAD.sup.+ from fumarate and FADH.sub.2. E. coli encodes a
four-subunit succinate dehydrogenase complex (SdhCDAB). These
enzymes are also used in the 3-HPA pathway above, but in the
reverse direction. It is important to note that some species may
favor one direction or the other. Succinate dehydrogenase and
fumarate reductase are reverse directions of the same enzymatic
interconversion, succinate+FAD.sup.+.fwdarw.fumarate+FADH.sub.2. In
Escherichia coli, the forward and reverse reactions are catalyzed
by distinct complexes: fumarate reductase operates under anaerobic
conditions and succinate dehydrogenase operates under aerobic
conditions. This group also includes a region of the B subunit of a
cytosolic archaeal fumarate reductase, for example the SdhA
flavoprotein subunit, locus NP.sub.--415251; the SdhB iron-sulfur
subunit, locus NP.sub.--415252; the SdhC membrane anchor subunit,
locus NP.sub.--415249; and the SdhD membrane anchor subunit, locus
NP.sub.--415250.
[0208] Acetyl-CoA:succinate CoA transferase (also known as
succinyl-CoA synthetase) (EC 6.2.1.5) generates succinyl-CoA, ADP,
and Pi from succinate, CoA, and ATP. E. coli encodes a
heterotetramer of two alpha and beta subunits. An exemplary E. coli
succinyl-CoA synthetase subunit alpha is sucD, locus AAA23900. An
exemplary E. coli succinyl-CoA synthetase subunit beta is sucC,
locus AAA23899. Chlorobium tepidum sucC (AAM71626) and sucD
(AAM71515) may also be used.
[0209] 2-oxoketoglutarate synthase (also known as
alpha-ketoglutarate synthase) (EC 1.2.7.3) generates
alpha-ketoglutarate, CO.sub.2, and oxidized ferredoxin from
succinyl-CoA, CO.sub.2, and reduced ferredoxin. An exemplary enzyme
from Chlorobium limicola DSM 245 is a 4 subunit enzyme with
accession numbers EAM42575; EAM42574; EAM42853; and EAM42852. This
activity was functionally expressed in E. coli. Yun N R, Arai H,
Ishii M, Igarashi Y. Biochem Biophys Res Communic (2001). The Genes
for anabolic 2-oxoglutarate: Ferredoxin oxidoreductase from
Hydrogenobacter thermophilus TK6. 282 (2): 589-594. There is
another 5-subunit OGOR cluster in the same bacterium. Yun N R et
al. Biochem Biophys Res Communic (2002). A novel five-subunit-type
2-oxoglutalate:ferredoxin oxidoreductases from Hydrogenobacter
thermophilus TK-6. 292(1):280-6. The corresponding genes are
forDABGE. An exemplary alpha-ketoglutarate synthase from
Hydrogenobacter thermophilus is the heterodimeric enzyme that
includes korA, locus AB046568:46-1869 and the korB locus
AB046568:1883-2770.
[0210] Isocitrate dehydrogenase (EC 1.1.1.42) generates
D-isocitrate and NADP+ from alpha-ketoglutarate, CO.sub.2, and
NADPH. An exemplary gene is the monomeric type idh from Chlorobium
limicola, locus EAM42635. Another exemplary enzyme is that from
Synechococcus sp WH 8102, icd, accession CAE06681.
[0211] In another embodiment, the NAD-dependent isocitrate
dehydrogenase (EC 1.1.1.41) is expressed which generates isocitrate
and NAD.sup.+ from alpha-ketoglutarate, CO.sub.2, and NADH. An
exemplary NAD-dependent enzyme is the two-subunit mitochondrial
version from Saccharomyces cerevisiae. Subunit 1, idh1 locus
YNL037C. The second subunit is idh2, locus YOR136W.
[0212] Aconitase (also known as aconitate hydratase or citrate
hydrolyase) (EC 4.2.1.3) generates citrate from D-citrate via a
cis-aconitate intermediate. E. coli encodes aconitate hydratase 1
and 2 (acnA and acnB). An exemplary aconitate hydrase 1 is E. coli
acnA, locus b1276. An exemplary E. coli aconitate hydratase 2 is
acnB, locus b0118.
[0213] Pyruvate synthase (also known as pyruvate:ferredoxin
oxidoreductase) (EC 1.2.7.1) generates pyruvate, CoA, and an
oxidized ferrodoxin from acetyl-CoA, CO.sub.2, and a reduced
ferredoxin. An exemplary pyruvate synthase is the tetrameric enzyme
porABCD from Clostridium tetani E88, whereby subunit porA, locus
AA036986; subunit porB, locus AA036985; subunit porC, locus
AA036988; and subunit porD, locus AA036987.
[0214] Phosphoenolpyruvate synthase (also known as PEP synthase,
pyruvate, water dikinase) (EC 2.7.9.2) generates
phosphoenolpyruvate, AMP, and Pi from pyruvate, ATP, and water. E.
coli encodes an exemplary PEP synthase, ppsA. The E. coli ppsA
enzyme, locus AAA24319 and the corresponding enzyme from Aquifex
aeolicus VF5 ppsA, locus AAC07865, may also be used.
[0215] Phosphoenolpyruvate carboxylase (also known as PEP
carboxylase PEPCase, PEPC) (EC 4.1.1.31) generates oxaloacetate and
Pi from phosphoenolpyruvate, water, and CO.sub.2. E. coli encodes
an exemplary PEP carboxylase, ppC. The E. coli ppC enzyme, locus
CAA29332 may also be used.
[0216] The above enzymes, described in this section, confer the
ability to synthesize an organic 2-carbon acetyl-CoA molecule from
2 molecules of CO.sub.2. The stoichiometry of this reaction is 2
CO.sub.2+2 ATP+3 NADH+1 FADH.sub.2+CoASH.fwdarw.acetyl-CoA+2 ADP+2
Pi+AMP+PPi+FAD.sup.++3 NAD.sup.+.
III. Enzymes for a Functional Woods-Ljungdahl Cycle
[0217] The following enzyme activities are expressed in to
establish a functional Woods-Ljungdahl pathway. This pathway is
natively employed by Moorella thermoacetica (previously known as
Clostridium thermoaceticum), Methanobacterium thermoautrophicum,
and Desulfobacterium autotrophicum.
[0218] NADP-dependent formate dehydrogenase (EC 1.2.1.4.3)
generates formate and NADP.sup.+ from CO.sub.2 and NADPH. An
exemplary NADP-dependent formate dehydrogenase is the two-subunit
Mt-fdhA/B enzyme from Moorella thermoacetica (previously known as
Clostridium thermoaceticum) which contains Mt-fdhA, locus AAB18330
and the beta subunit, Mt-fdhB, locus AAB18329.
[0219] Formate tetrahydrofolate ligase (EC 6.3.4.3) generates
10-formyltetrahydrofolate, ADP, and Pi from formate, ATP, and
tetrahydrofolate. An exemplary formate tetrahydrofolate ligase is
from Clostridium acidi-urici, locus M21507. Alternate sources for
this enzyme activity include locus AAB49329 from Streptococcus
mutans (Swiss-Prot entry Q59925), or the protein with Swiss-Prot
entry Q8XHL4 from Clostridium perfringens encoded by the locus
BA000016.
[0220] Methenyltetrahydrofolate cyclohydrolase (also known as
5,10-methylenetetrahydrofolate dehydrogenase) (EC 3.5.4.9 and
1.5.1.5) generates 5,10-methylene-THF, water, and NADP.sup.+ from
10-formyltetrahydrofolate and NADPH via a
5,10-methyenyltetrahydrofolate intermediate. E. coli encodes a
bifunctional methenyltetrahydrofolate cyclohydrolase/dehydrogenase,
folD for example, the E. coli enzyme, locus AAA23803. Alternate
sources for this enzyme activity include locus ABC19825 (folD) from
Moorella thermoacetica, locus AA036126 from Clostridium tetani; and
locus BAB81529 from Clostridium perfringens. All are bifunctional
folD enzymes.
[0221] Methylene tetrahydrofolate reductase (EC 1.5.1.20) generates
5-methyltetrahydrofolate and NADP.sup.+ from
5,10-methylene-trahydrofolate and NADPH. E. coli encodes an
exemplary methylene tetrahydrofolate reductase, metF for example,
the E. coli enzyme, locus CAA24747. Alternative sources for this
enzyme activity include locus AAC23094 from Haemophilus influenzae
and locus CAA30531 from Salmonella typhimurium.
[0222] 5-methyltetrahydrofolate corrinoid/iron sulfur protein
methyltransferase generates tetrahydrofolate and a methylated
corrinoid Fe--S protein from 5-methyltetrahydrofolate and a
corrinoid Fe--S protein. An exemplary gene, acsE, is encoded by
locus AAA53548 in Moorella thermoacetica. This activity has been
functionally expressed in E. coli (Roberts D L, Zhao S, Doukov T,
and Ragsdale S. The reductive acetyl-CoA Pathway: Sequence and
heterologous expression of active
methyltetrahydrofolate:corrinoid/Urib-sulfur protein
methyltransferase from Clostridium thermoaceticum. J. Bacteriol
(1994). 176(19):6127-30). Another source for this activity is
encoded by the acsE gene from Carboxydothermus hydrogenoformas
locus CP000141.
[0223] Carbon monoxide dehydrogenase/acetyl-CoA synthase (EC
1.2.7.4/1.2.99.2 and 2.3.1.169) is a bifunctional two-subunit
enzyme which generates acetyl-CoA, water, oxidized ferredoxin, and
a corrinoid protein from CO.sub.2, reduced ferredoxin, and a
methylated corrinoid protein. An exemplary carbon monoxide
dehydrogenase enzyme, subunit beta, is encoded by locus AAA23228
from Moorella thermoacetica. Another exemplary source of this
activity is encoded by the acsB gene, locus CHY.sub.--1222 from
Carboxydothermus hydrogenoformase with protein accession
YP.sub.--360060. An exemplary acetyl-CoA synthase, subunit alpha,
is locus AAA23229 from Moorella thermoacetica.
[0224] The above enzymes, described in this section, confer the
ability to synthesize an organic 2-carbon acetyl-CoA molecule from
2 molecules of CO.sub.2. The stoichiometry of this reaction is 2
CO.sub.2+1 ATP+2 NADPH+2 reduced ferredoxins+coenzyme
A.fwdarw.acetyl-CoA+2 H.sub.2O+ADP+Pi+2 NADP.sup.++2 oxidized
ferredoxins.
[0225] Cells engineered to contain a functional CO.sub.2 fixation
pathway are selected for via growth in minimal media lacking an
organic carbon source. In addition to survival-based selections,
cells can be grown in minimal media in the presence of radiolabeled
CO.sub.2 (i.e., C.sup.14--CO.sub.2). Detailed incorporation studies
are employed to verify and characterize metabolic assimilation
using common techniques known to those skilled in the art.
IV. Enzymes for a Functional Reductive Pentose Phosphate Cycle
[0226] The following enzyme activities are expressed to establish a
functional reductive pentose phosphate (Calvin) cycle. This pathway
is natively employed by all plants, algae, and cyanobacteria.
[0227] Ribulose-1,5-bisphosphate carboxylase/oxygenase (RuBisCO)
(EC 4.1.1.39) which productively generates two molecules of
3-phosphoglycerate from ribulose-1,5-bisphosphate, CO.sub.2, and
H2.sub.O. As its name suggests, RuBisCO can also catalyze a
non-productive oxygenation reaction. Several classes of RuBisCO are
known, any and all of which can be over-expressed [Watson G M F,
Tabita F R. FEMS Microbiology Letters (1997) "Microbial ribulose
1,5-bisphosphate carboxylase/oxygenase: a molecule for phylogenetic
and enzymological investigation." 146(1):13-22]. An exemplary Type
I "Green-like" RuBisCO arising from the purple bacterial group
comes from Synechococcus sp WH7803 (Ribulose-1,5-bisphosphate
carboxylase/oxygenase--small subunit (CbbS), locus AAB48081) and
(Ribulose-1,5-bisphosphate carboxylase/oxygenase--large subunit
(CbbL), locus AAB8080). An exemplary Form I "Green-like" RuBisCO
arising from the cyanobacterial/plant group comes from
Synechococcus elongatus PCC 6301 (Ribulose-1,5-bisphosphate
carboxylase/oxygenase--small subunit (RbcS), locus YP.sub.--170839)
and (Ribulose-1,5-bisphosphate carboxylase/oxygenase--large subunit
(RbcL), locus YP.sub.--170840). An exemplary Form I "Red-like"
RuBisCO comes from Rhodobacter sphaeroides
(Ribulose-1,5-bisphosphate carboxylase/oxygenase--small subunit
(CbbS), locus P27998) and (Ribulose-1,5-bisphosphate
carboxylase/oxygenase--large subunit (CbbL), locus P27997). An
exemplary Form II RuBisCO comes from Rhodobacter sphaeroides as
well (Ribulose-1,5-bisphosphate carboxylase/oxygenase (CbbM), locus
P29278). Finally, an exemplary Form III RuBisCO comes from
Methanocaldococcus jannaschii (Ribulose-1,5-bisphosphate
carboxylase/oxygenase (RbcL), locus Q58632).
[0228] In some embodiments, rubisco activase is overexpressed to
improve the activation of RuBisCO and/or to release competitive
inhibitors of RuBisCO carbon fixation. An exemplary rubisco
activase is comes from Synechococcus sp. JA-3-3Ab (locus
ABC98646).
[0229] Phosphoglycerate kinase (PGK) (EC 2.7.2.3) generates
1,3-bisphosphoglycerate ADP from 3-phosphoglycerate and ATP. An
exemplary phosphoglycerate kinase is locus BAD78623 from
Synechococcus sp. PCC 6301.
[0230] Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (EC
1.2.1.13) generates glyceraldehyde 3-phosphate and NADP.sup.+ from
1,3-bisphosphoglycerate and NADPH. An exemplary GAPDH is encoded by
the cbbG gene, locus NP.sub.--875968 from Prochlorococcus
marinus.
[0231] Triosephosphate isomerase (EC 5.3.1.1) generates
dihydroxyacetone phosphate (DHAP) from glyceraldehyde 3-phosphate.
An exemplary triosephosphate isomerase is encoded by the tpiA gene,
locus Q59994 from Synechocystis sp. PCC 6803.
[0232] Fructose-1,6-bisphosphate aldolase (EC 4.1.2.13) generates
fructose-1,6-bisphosphate from DHAP and glyceraldehyde 3-phosphate.
An exemplary class I fructose 1,6-bisphosphate aldolase is encoded
by the fda gene, locus NP.sub.--441723 from Synechocystis sp. PCC
6803. An exemplary class II fructose 1,6-bisphosphate aldolase is
encoded by the fbaA gene, locus BAA10184 from Synechocystis sp. PCC
6803.
[0233] Fructose-1,6-bisphosphatase (EC 3.1.3.11) generates
fructose-6-phosphate and P, from fructose-1,6-bisphosphate and
H.sub.20. An exemplary fructose-1,6-bisphosphatase is encoded by
the fbp gene, locus NP.sub.--441738 from Synechocystis sp. PCC
6803.
[0234] Transketolase (EC 2.2.1.1) generates xylulose 5-phosphate
and erythrose 4-phosphate from fructose 6-phosphate and
glyceraldehyde 3-phosphate. An exemplary transketolase is encoded
by the tktA gene, locus YP.sub.--171693 from Synechococcus sp. PCC
6301.
[0235] Pentose-5-phosphate-3-epimerase (EC 5.1.3.1) generates
ribose-5-phosphate from xylulose-5-phosphate. An exemplary
Pentose-5-phosphate-3-epimerase is encoded by the rpe gene, locus
YP.sub.--171630 from Synechocystis sp. PCC 6301.
[0236] Sedoheptulose-1,7-bisphosphate aldolase (EC 4.1.2.13)
generates sedoheptulose-1,7-bisphosphate from erythrose-4-phosphate
and DHAP. An exemplary Sedoheptulose-1,7-bisphosphate aldolase is
encoded by the rpaA gene, locus NP.sub.--681166 from
Thermosynechococcus elongatus BP-1.
[0237] Sedoheptulose-1,7-bisphosphatase (SBPase) (EC 3.1.3.37)
generates sedoheptulose-7-phosphate and Pi from
sedoheptulose-1,7-bisphosphate and H.sub.2O. An exemplary SBPase is
encoded by the csbp gene, locus CAA52439 from Chlamydomonas
reinhardtii.
[0238] Transketolase (EC 2.2.1.1) generates ribose 5-phosphate and
xylulose 5-phosphate from sedoheptulose 7-phosphate and
glyceraldehyde 3-phosphate. An exemplary transketolase is encoded
by the tktA gene, locus YP.sub.--171693 from Synechococcus sp. PCC
6301.
[0239] Ribose 5-phosphate isomerase (EC 5.3.1.6) generates
ribulose-5-phosphate from xylulose-5-phosphate or
ribose-5-phosphate. An exemplary ribose-5-phosphate isomerase is
encoded by the rpiA gene, locus YP.sub.--171649 from Synechococcus
elongatus PCC 6301.
[0240] Phosphoribulokinase (EC 2.7.1.19) generates
ribulose-1,5-bisphosphate and ADP from ribulose-5-phosphate and
ATP. An exemplary phosphoribulokinase is the prkA gene, locus
AAA33090 from Chlamydomonas reinhardtii. In certain embodiments,
the small CP12 protein is overexpressed, which regulates the Calvin
cycle in via association/dissociation of PRK/CP12/GAPDH complexes
depending on the ratio of NADPH/NADH [Tamoi M, Miyazaki T, Fukamizo
T, Shigeoka S. "The calvin cycle in cyanobacteria is regulated by
CP12 via the NAD(H)/NADP(H) ratio under light/dark conditions." The
Plant Journal (2005). 42:504-12]. An exemplary CP12 gene is locus
BAC09372 from Thermosynechococcus elongatus BP-1.
[0241] In certain embodiments, carbon fixation rates and/or carbon
product efficiencies are enhanced by altering carbon flux to
specific key intermediates. In one embodiment, carbon flux is
directed towards acetyl-CoA via overexpression of pantothenate
kinase, such as locus YP.sub.--473820 from Syenchococcus sp
JA-3-3Ab and/or pyruvate dehydrogenase, such as pdhAB, locus
YP.sub.--1728660 (pdhA) and YP.sub.--172072 (pdhB) from
Synechococcus PCC 6301. In addition or as an alternative,
endogenous genes that effectively reduce carbon flux through
acetyl-CoA are downregulated or knocked-out. In these embodiments,
acyl coenzyme A dehydrogenase (EC 1.3.99.3, locus YP.sub.--171045),
glycerol-3-phosphate dehydrogenase (EC 1.1.1.94, locus
YP.sub.--401539), and/or lactate dehydrogenase (ldhA) (EC 1.1.1.28,
locus YP.sub.--170916) are downregulated or knocked-out.
[0242] Certain enzymes described above provide pathways to
assimilate CO.sub.2 into the 2-carbon acetyl-CoA (reductive TCA and
Woods-Ljungdahl pathways) or glyoxylate (3-HPA pathway).
Combinations of these (preferentially the 3-HPA cycle and the
reductive TCA cycle) are also engineered in special cases. In this
scenario, the outputs of the CO.sub.2 fixation reactions
(acetyl-CoA and glyoxylate) are utilized as inputs for the
glyoxylate cycle, which combines acetyl-CoA and glyoxylate into
4-carbon oxaloacetate (via a 4-carbon malate intermediate) [Chung
T, Klumpp D J, Laporte D C. J Bacteriol (1988). "Glyoxylate bypass
operon of Escherichia coli: cloning and determination of the
functional map." 170(1):386-92.] Three key enzymes are involved in
the glyoxylate shunt pathway. In preferred embodiments, all are
overexpressed to maximize CO.sub.2 fixation.
[0243] Malate synthase (EC 2.3.3.9) generates malate and coenzyme A
from acetyl-CoA, water, and glyoxylate. An exemplary enzyme is
encoded by E. coli locus JW3974 (aceB). Another exemplary activity
is provided by an alternate malate synthase enzyme E. coli encodes,
the JW2943 locus malate synthase G (glcB).
[0244] Isocitrate lyase (EC 4.1.3.1) generates glyoxylate and
succinate from isocitrate. An exemplary enzyme is that encoded by
E. coli locus JW3975 (aceA).
[0245] Malate dehydrogenase (EC 1.1.1.37) generates oxaloacetate
and NADH from malate and NAD.sup.+. An exemplary enzyme is that
encoded by E. coli locus JW3205 (mdh).
[0246] Gluconeogenesis is the process by which organisms generate
glucose from non-sugar carbon substrates, including pyruvate,
lactate, glycerol, and glucogenic amino acids. Most steps of
glycolysis are bidirectional, with three exceptions (reviewed in
Hers H G, Hue, L. Ann Rev. Biochem (1983). "Gluconeogenesis and
related aspects of glycolysis." 52:617-53). In certain embodiments,
these enzyme activities are expressed to improve gluconeogenesis
rates.
I. Conversion of Pyruvate to Phosphoenolpyruvate
[0247] Conversion of pyruvate to phosphoenolpyruvate requires two
enzymatic activities as follows.
[0248] Pyruvate carboxylase (EC 6.4.4.1) generates oxaloacetate,
ADP, and Pi from pyruvate, ATP, and CO.sub.2. An exemplary pyruvate
carboxylase is encoded by the YGL062W locus from Saccharomyces
cerevisiae, pyc1.
[0249] Phosphoenolpyruvate carboxykinase (EC 4.1.1.49) generates
phosphoenolpyurate, ADP, Pi, and CO.sub.2 from oxaloacetate and
ATP. An exemplary phosphoenolpyruvate carboxykinase is encoded by
E. coli locus JW3366, pckA.
II. Conversion of Fructose 1,6-Bisphosphate to
Fructose-6-Phosphate
[0250] Conversion of fructose 1,6-bisphosphate to
fructose-6-phosphate requires fructose-1,6-bisphosphatase (EC
3.1.3.11), which generates fructose-6-phosphate and Pi from
fructose-1,6-bisphosphate and water. An exemplary
fructose-1,6-bisphosphatase is encoded by E. coli locus JW4191,
fbp, (EC #4.1.2.13).
[0251] The Thermosynechoccocus elongates BP-1 genes fbpI (Accession
Number: NP.sub.--682066), fbpII (Accession Number: NP.sub.--681331)
and fbaA (Accession Number: NP.sub.--681166) encoding,
respectively, a fructose bisphosphatase I protein (E.C. 1.6.1.1), a
fructose bisphosphatase II protein (E.C. 1.6.1.1) and a fructose
bisphosphatase aldolase protein (E.C. XXX) were amplified directly
from Thermosynechoccocus elongates BP-1 strain genomic DNA using
the following primers: fbpI forward primer
5'-GAATACATATGACTGACTATGCAGCC-3' (SEQ ID NO: 7) and reverse fbpI
primer 5'-GAATAGAATTCTTACACCTGTGTCACGG-3' (SEQ ID NO: 8); fbpII
forward primer 5'-GAATAGTCTCATATGGATAACGTCATCGG-3' (SEQ ID NO: 9)
and reverse primer 5'-GAATAGAATTCTTAGTACAGCTGGAGTG-3' (SEQ ID NO:
10); fbaA forward primer 5'-GAATACATATGGCACTCGTACCCATG-3' (SEQ ID
NO: 11) and reverse primer 5'-GAATAGAATTCTATAACCACCACGG-3' (SEQ ID
NO: 12). PCR amplifications were performed with PCR SuperMix High
Fidelity (Invitrogen, Carlsbad, Calif.) and standard PCR
amplification conditions. The fbpI and fbpII forward primer adds an
NdeI restriction recognition site, the fbaA forward primer adds a
BsmAI restriction recognition site, and all reverse primers add a
stop codon and an EcoRI restriction recognition site.
[0252] The amplified fbpI, fbpII and fbaA PCR gene products were
cloned into the pJB5 expression vector ("pJB5-fbpI;" "pJB5-fbpII;"
"pJB5-fbaA") by digesting the insert and vector individually with
NdeI and EcoRI or BsmAI and EcoRI (New England Biolabs) restriction
endonucleases with well known laboratory techniques. Digestions
were gel isolated on 0.8% TAE agarose gel, purified using a Gel
Extraction Kit (Qiagen) and ligated with the T4 DNA Ligase (New
England Biolabs) with no deviation from the published techniques.
The ligated product was transformed into NEB 5-alpha chemically
competent E. coli cells using standard techniques (New England
Biolabs), and confirmed by PCR.
[0253] pJB5-fbpI, pJB5-fbpII and pJB5-fbaA plasmid stocks were
purified using Qiagen miniprep kit for individual transformation
into separate preparations of JCC136. One to two micrograms of the
aforementioned plasmid DNAs were added to individual JCC136 cell
preparations having an OD.sub.730nm of 1 and incubated at 37 C for
4 hours using low intensity orbital shaking and low level light
source. Cells were then plated onto A.sup.+ solid media plates and
placed in a lighted incubator (100-250 .mu.E/m2/s, 37 C) for 1 day.
Twenty-five micrograms/ml.sub.[final] spectinomycin was underlayed
on the plates and incubated until colonies grew (.about.5 days).
Integration into target Synechococcus host cells was confirmed by
PCR of whole cell genomic DNA by a "colony PCR" protocol for the
pJB5-fbpI transformation. Briefly, .about.1 mm colonies were
resuspended in 50 .mu.l deionized water, and 5 .mu.l were used in
20 .mu.l standard PCR reactions using Phusion DNA Polymerase Master
Mix (New England Biolabs, Beverly, Mass.) with the addition of a 2
minute 98 C denaturation step at the very start of the standard PCR
cycling conditions. The PCR showed correct bands for colonies, and
the strain was named JCC136-FbpI (FIG. 10, panel B, lane 2).
[0254] A single colony of both JCC136 and JCC136-FbpI was grown in
10 mL A+ with 100 .mu.g/ml.sub.[final] spectinomycin in a test tube
immersed in a 37 C bath with bubbled 1% CO2. Cultures were grown to
OD.sub.730nm 5.0 or higher (Molecular Devices Spectramax M2e;
previously determined that an OD.sub.730nm of 1 is equal to
.about.0.3 g CDW), and then spun down (21,000 RCF, 20 C, 5 min),
resuspended in fresh A+ media to original concentration, and then
appropriately back-diluted to OD.sub.730nm 0.2 in 25 mL A.sup.+ in
a baffled 125 mL shaker flask. Approximately 1 mL of culture was
taken for each time point (0, 24, 48, 72, and 96 hours
post-dilution, OD.sub.730nm was recorded (appropriately diluted to
give reading between 0.04 and 0.4, which was previously determined
to be most accurate range on the Spectramax M2e). Samples were
immediately spun down at 4 C for 10 min at 21,000 RCF. Supernatants
were placed in a new tube, and frozen at -80 C until ready for
analysis.
[0255] The supernatant from each time point was analyzed for
ethanol and acetaldehyde by use of an Agilent 7890 Gas
Chromatograph equipped with a headspace analyzer and a flame
ionization detector (Agilent) using a J&W Scientific DB-ALC1
(Catalog Number: 123-9134; length: 30 m, Inner Diamter, 0.320 mm,
Film Thickness: 1.80 .mu.m). One hundred .mu.l of each sample was
subjected to headspace analysis. Controls were measured for A+
alone, and as well as from serial dilution of standards for ethanol
and acetaldehyde obtained from Sigma to obtain a calibration curve.
The levels of ethanol, and ethanol normalized with respect to the
optical density are plotted in FIG. 11.
III. Conversion of Glucose-6-Phosphate to Glucose
[0256] Conversion of glucose-6-phosphate to glucose requires
glucose-6-phosphatase (EC 3.1.3.68), which generates glucose and Pi
from glucose-6-phosphate and water. An exemplary
glucose-6-phosphatase is encoded by the Saccharomyces cerevisiae
YHR044C locus, dog1. Another exemplary glucose-6-phosphatase
activity is encoded by Saccharomyces cerevisiae YHR043C locus,
dog2.
[0257] Oxaloacetate, the starting material for gluconeogenesis, is
generated either via the glyoxylate shunt (leveraging inputs from
the reductive TCA or Woods-Ljungdahl pathways and the 3-HPA
pathway) or via the carboxylation of pyruvate. In the absence of
the glyoxylate shunt, the pyruvate synthase activity of pyruvate
ferredoxin:oxidoreductase (EC 1.2.7.1) can generate pyruvate, CoA,
and oxidized ferredoxin from acetyl-CoA, CO.sub.2, and reduced
ferredoxin [Furdui C and Ragsdale S W. J. Biol. Chem (2000). "The
role of pyruvate ferredoxin oxidoreductase in pyruvate synthesis
during autotrophic growth by the Woods-Ljungdahl pathway." 275(37):
28494-99]. An exemplary pyruvate ferredoxin oxidoreductase with
pyruvate synthase activity is encoded by locus Moth.sub.--0064 from
Moorella thermoaceticum.
Example 3
Engineering Reducing Power
[0258] The above CO.sub.2-fixation pathways may require generating
reducing power, primarily in the form of NADH (nicotinamide adenine
dinucleotide, reduced form) and NADPH (nicotinamide adenine
dinucleotide phosphate, reduced form).
[0259] Maintaining an appropriately-balanced supply of reduced
NAD.sup.+ (NADH) and NADP.sup.+ (NADPH) is important to maximize
carbon assimilation, and thus growth rate, of engineered
photoautotrophic organisms.
[0260] Table 1 lists candidate genes for overexpression in the
reducing power module together with information on associated
pathways, Enzyme Commission (EC) Numbers, exemplary gene names,
source organism, GenBank accession numbers, and homologs from
alternate sources.
I. NADH
[0261] When NADH levels remain suboptimal, a plurality of methods
is employed to increase intracellular NADH concentrations,
including overexpression of the following genes.
[0262] NAD.sup.+-dependent isocitrate dehydrogenase (EC 1.1.1.41)
generates 2-oxoglutarate, CO.sub.2, and NADH from isocitrate and
NAD.sup.+. Of note, most bacterial isocitrate dehydrogenases are
NADP.sup.+-dependent (EC 1.1.1.42). An exemplary
NAD.sup.+-dependent isocitrate dehydrogenase is the octameric
Saccharomyces cerevisiae enzyme comprising locus YNL037C, idh1 and
locus YOR136W, idh2.
[0263] Malate dehydrogenase (EC 1.1.1.37) generates oxaloacetate
and NADH from malate and NAD.sup.+. Overexpression of NAD-dependent
malate dehydrogenase can be employed to increase NADH pools. An
exemplary enzyme is encoded by E. coli locus JW3205 (mdh).
[0264] The NADH:ubiquinone oxidoreductase from Rhodobacter
capsulatus, is unique in its ability to reverse electron flow
between the quinone pool and NAD.sup.+ [Dupuis A, Peinnequin A,
Darrouzet E, Lunardi J. FEMS Microbiol Lett (1997). "Genetic
disruption of the respiratory NADH-ubiquinone reductase of
Rhodobacter capsulatus leads to an unexpected
photosynthesis-negative phenotype." 149:107-114; Dupuis A,
Darrouzet E, Duborjal H, Pierrard B, Chevallet M, van Belzen R,
Albracht S P J, Lunardi J. Mol. Microbiol (1998). "Distal genes of
the nuo_operon of Rhodobacter capsulatus equivalent to the
mitochondrial ND subunits are all essential for the biogenesis of
the respiratory NADH-ubiquinone oxidoreductase. 28:531-541]. The
Rhodobacter Nuo operon, encoding the Nuo Complex I, can be
reconstituted to generate additional NADH by reverse electron
flow.
[0265] The Rhodobacter capsulatus nuo operon, locus AF029365,
consisting of the 14 nuo genes nuoA-N (and 7 ORFs of unknown
function) can be expressed to enable reverse electron flow and
NADH-generation in photoautotrophic cells. The operon encodes NuoA,
accession AAC24985.1; NuoB, accession AAC24986.1; NuoC, accession
AAC24987.1; NuoD, accession AAC24988.1; NuoE, accession AAC24989.1;
NuoF, accession AAC24991.1; NuoG, accession AAC24995.1; NuoH,
accession AAC24997.1; NuoI, accession AAC24999.1; NuoJ, accession
AAC25001.1; NuoK, accession AAC25002.1; NuoL, accession AAC25003.1;
NuoM, accession AAC25004.1; and NuoN, accession AAC25005.1.
[0266] Expression of pyridine nucleotide transhydrogenase (EC
1.6.1.1) generates NADH and NADP.sup.+ from NADPH and NAD.sup.+. An
exemplary enzyme is the E. coli soluble pyridine nucleotide
transhydrogenase, encoded by sthA (also known as udhA), locus
JW551. An alternate exemplary enzyme is the membrane bound E. coli
pyridine nucleotide transhydrogenase, encoded by the multisubunit
of NAD(P) transhydrogenase subunit alpha, encoded by pntA, locus
JW1595, and NADP transhydrogenase subunit beta, encoded by pntB,
locus JW1594.
[0267] Expression of udhA Gene Encoding Pyridine Nucleotide
Transhydrogenase for NADH Production
[0268] The Escherichia coli K12 udhA gene (Accession Number:
NP.sub.--418397) encoding a pyridine nucleotide transhydrogenase
(E.C.#1.6.1.1) was amplified directly from E. coli K12 strain
genomic DNA using the forward primer
5'-TATGCCACATTCCTACGATTACGATGCC-3' (SEQ ID NO: 13) and the reverse
primer 5'-AATTCTTAAAACAGGCGGTTTAAACCGTTTAACGC-3' (SEQ ID NO: 14).
PCR amplifications were performed with the high fidelity Phusion
DNA Polymerase Master Mix (New England Biolabs, Beverly, Mass.).
The forward primer adds an NdeI restriction recognition site, and
the reverse Primer adds a stop codon and an EcoRI restriction
recognition site.
[0269] The amplified udhA PCR gene product was cloned into the pJB5
expression vector ("pJB5-udhA") by digesting the insert and vector
individually with NdeI and EcoRI (New England Biolabs) restriction
endonucleases with well known laboratory techniques. Both
digestions were gel isolated on 1% TAE agarose gel, purified using
a Gel Isolation Kit (Qiagen) and ligated with the Quick Ligation
Kit (New England Biolabs) with no deviation from the published
techniques. The ligated product was transformed into EPI400
chemically competent cells using standard techniques (EpiCentre),
and confirmed by PCR.
[0270] pJB5-udhA plasmid stocks were purified using Qiagen miniprep
kit for transformation into Synechococcus sp. PCC 7002. One to two
micrograms of pJB5-udhA plasmid was added to Synechococcus sp PCC
7002 cells grown to an optical density of 1 and incubated at 37 C
for 4 hours using low intensity orbital shaking and low level light
source. Cells were then plated onto A.sup.+ solid media plates and
placed in a lighted incubator (100-250 .mu.E/m2/s, 37 C) for 1 day.
Twenty-five micrograms/mL spectinomycin was underplayed on the
plates and incubated until colonies grew (.about.5 days).
Integration into target Synechococcus host cells is confirmed by
PCR of whole cell genomic DNA by a "colony PCR" protocol. Briefly,
.about.1 mm colonies were resuspended in 50 .mu.l deionized water,
and 5 .mu.l were used in 20 .mu.l standard PCR reactions using
Phusion DNA Polymerase Master Mix (New England Biolabs, Beverly,
Mass.) with the addition of a 2 minute 98 C degree denaturation
step at the very start of the standard PCR cycling conditions. The
PCR showed correct bands for colonies, and the strain was named
JCC1-UdhA (FIG. 10, lane 2 and 3).
II. NADPH
[0271] NADPH serves as an electron donor in reductive (especially
fatty acid) biosynthesis. Three parallel methods are used, singly
or in combination, to maintain sufficient NADPH levels for
photoautotrophy. Methods 1 and 2 are described in WO2001/007626,
Methods for producing L-amino acids by increasing cellular NADPH.
Method 3 is described in U.S. Pub. No. 2005/0196866, Increasing
intracellular NADPH availability in E. coli.
[0272] Expression of the zwf Gene Encoding Glucose-6-Phosphate
Dehydrogenase for NADPH
[0273] The Escherichia coli K12 zwf gene (Accession Number:
AAC74922) encoding a glucose-6-phosphate dehydrogenase (E.C.
1.1.1.49) was amplified directly from E. coli K12 strain genomic
DNA using the forward primer 5'-TCGACATATGGCGGTAACGCAAACAGCCC-3'
(SEQ ID NO: 15) and the reverse primer
5'-TCGAGAATTCTTACTCAAACTCATTCCAGGAACGACCATC-3' (SEQ ID NO: 16). PCR
amplifications were performed with the high fidelity Phusion DNA
Polymerase Master Mix (New England Biolabs, Beverly, Mass.). The
forward primer adds an NdeI restriction recognition site, and the
reverse Primer adds a stop codon and an EcoRI restriction
recognition site.
[0274] The amplified zwf gene PCR product was cloned into the pJB5
expression vector ("pJB5-Zwf") by digesting the insert and vector
individually with NdeI and EcoRI (New England Biolabs) restriction
endonucleases with well known laboratory techniques. Both
digestions were gel isolated on 1% TAE agarose gel, purified using
a Gel Isolation Kit (Qiagen) and ligated with the Quick Ligation
Kit (New England Biolabs) with no deviation from the published
techniques. The ligated product was transformed into EPI400
chemically competent cells using standard techniques (EpiCentre),
and confirmed by PCR.
[0275] pJB5-Zwf plasmid stocks were purified using Qiagen miniprep
kit for transformation into Synechococcus sp. PCC 7002. One to two
micrograms of pJB5-Zwf plasmid was added to Synechococcus sp PCC
7002 cells grown to an optical density of 1 and incubated at 37 C
for 4 hours using low intensity orbital shaking and low level light
source. Cells were then plated onto A.sup.+ solid media plates and
placed in a lighted incubator (100-250 .mu.E/m2/s, 37 C) for 1 day.
Twenty-five micrograms/ml spectinomycin was underplayed on the
plates and incubated until colonies grew (.about.5 days).
Integration into target Synechococcus host cells is confirmed by
PCR of whole cell genomic DNA by a "colony PCR" protocol. Briefly,
.about.1 mm colonies were resuspended in 50 .mu.l deionized water,
and 5 .mu.l were used in 20 .mu.l standard PCR reactions using
Phusion DNA Polymerase Master Mix (New England Biolabs, Beverly,
Mass.) with the addition of a 2 minute 98 C degree denaturation
step at the very start of the standard PCR cycling conditions. The
PCR showed correct bands for colonies, and the strain was named
JCC1-Zwf (FIG. 10, lane 4).
A. Increasing the Flux Through the Pentose Phosphate Pathway
[0276] Increasing the flux through the Pentose Phosphate Pathway
generates 2 molecules of NADPH per molecule of glucose.
[0277] The downregulation or inactivation of the phosphoglucose
isomerase, such as pgi from Synechococcus sp. PCC 6301 (locus
YP.sub.--172776), is known to force glucose through the pentose
phosphate pathway. This therefore provides one approach for
increasing intracellular NADPH pools, as has been previously
applied in E. coli engineering [Kabir, M M. Shimizu, K. Appl.
Microbiol. Biotechnol. (2003):Fermentation characteristics and
protein expression patterns in a recombinant Escherichia coli
mutant lacking phosphoglucose isomerase for poly(3-hydroxybutyrate)
production." 62:244-255; Kabir M M, Shimizu K. J. Biotechnol
(2003). "Gene expression patterns for metabolic pathway in pgi
knockout Escherichia coli with and without phb genes based on
RT-PCR" 105(1-2):11-31.]
[0278] Overexpression of glucose-6-phosphate dehydrogenase (EC
1.1.1.49), which generates NADPH and 6-phospho-gluconolactone from
glucose-6-phosphate and NADP.sup.+, provides another way to
increase NADPH levels. An exemplary enzyme is that encoded by E.
coli glucose-6-phosphate dehydrogenase, zwf, locus JW1841.
[0279] Overexpression of 6-phosphogluconolactonase (EC 3.1.1.31),
which generates 6-phosphogluconate from 6-phosphoglucolactone and
water, provides another approach for increasing flux through the
pentose phosphate pathway. An exemplary enzyme is that encoded by
the E. coli 6-phosphogluconolactonase, pgl, locus JW0750.
[0280] Overexpression of 6-phosphogluconate dehydrogenase (EC
1.1.1.44) generates ribose-5-phosphate, CO.sub.2, and NADPH from
6-phosphogluconate and NADP.sup.+. This also can be used to
increase NADPH levels by increasing flux through the pentose
phosphate pathway. An exemplary enzyme is the encoded by E. coli
6-phosphogluconate dehydrogenase, gnd, locus JW2011.
B. Expression of NADP.sup.+-Dependent Enzymes
[0281] NADP.sup.+-dependent enzymes can be expressed in lieu of or
in addition to NAD-dependent enzymes.
[0282] Overexpression of isocitrate dehydrogenase (EC 1.1.1.42)
generates 2-oxoglutarate, CO.sub.2, and NADPH from isocitrate and
NADP.sup.+. An exemplary enzyme is encoded by the E. coli
isocitrate dehydrogenase, icd, locus JW1122.
[0283] Overexpression of malic enzyme (EC 1.1.1.40) generates
pyruvate, CO.sub.2, and NADPH from malate and NADP.sup.+. An
exemplary NADP-dependent enzyme is the E. coli malic enzyme,
encoded by maeB, locus JW2447.
C. Expression of Pyridine Nucleotide Transhydrogenase
[0284] Expression of pyridine nucleotide transhydrogenase (EC
1.6.1.1) generates NADPH and NAD.sup.+ from NADH and NADP.sup.+. An
exemplary enzyme is the E. coli soluble pyridine nucleotide
transhydrogenase, encoded by sthA (also known as udhA), locus
JW551. An alternate exemplary enzyme is the membrane bound E. coli
pyridine nucleotide transhydrogenase, encoded by the multisubunit
of NAD(P) transhydrogenase subunit alpha, encoded by pntA, locus
JW1595 and NADP transhydrogenase subunit beta, encoded by pntB,
locus JW1594.
Example 4
Improved Thermotolerance
[0285] In certain embodiments, photobioreactors are maintained at
high operating temperatures. Engineering photoautotrophic organisms
to withstand and thrive in high operating temperatures allows for
reduced cooling costs and faster kinetics of carbon-based product
output. Four significant ways to increase thermotolerance in
photoautotrophic organisms include stabilizing the photosynthetic
apparatus with accessory proteins, expressing chaperones to
stabilize other intracellular proteins in the cell, altering the
lipid profiles of cell membranes, and expressing osmoprotectants,
such as betaine.
[0286] Photosystem II is the most heat sensitive protein in the
photosynthetic apparatus [Berry J, Bjorkman O. Plant Physiol (1980)
"Photosynthetic response and adaptation to temperature in higher
plants." 31:491]. The damage to Photosystem II is primarily located
within the oxygen-evolving components of the complex, and
degradation of and replacement of D1 represents a key step in the
repair of damaged Photosystems [Nixon P J, Barker M, Boehm M, de
Vries R, Komenda J. "FtsH-mediated repair of the photosystem II
complex in response to light stress." J. Exp. Biol (2005).
56(410:357-63]. In one embodiment, three genes--psbO, psbU, and
psbV--that are known to protect these oxygen-evolving components in
Photosystem II of Synechocystis sp. PCC 6803 are overexpressed to
aid in thermotolerance [Kimura A, Eaton-Rye J J, Morita E H,
Nishiyama Y, Hayashi H. Plant Cell Physiol. (2002). "Protection of
the Oxygen-Evolving Machinery by the Extrinsic Proteins of
Photosystem II is Essential for Development of Cellular
Thermotolerance in Synechocystis sp. PCC 6803." Plant Cell Physiol.
43(8):932-938]. These three exemplary genes encode amino acid
sequences are Photosystem II manganese-stabilizing polypeptide
(PsbO), locus NP.sub.--441796; PS II complex 12 kDa extrinsic
protein (PsbU), locus NP.sub.--440167; and Cytochrome c550 (PsbV),
locus NP.sub.--441834.
[0287] A secondary source of thermal toxicity results from general
protein instability at high temperatures. Several chaperones
specifically confer thermotolerance by assisting protein folding
and degradation at high temperatures including as ClpB [Eriksson M,
Schelin J, Miskiewicz E, Clarke A K. J Bacteriol (2001) "Novel Form
of ClpB/HSP100 Protein in the Cyanobacterium Synechococcus."
183(24):7392-7396], GroESL [Rajaram H, Ballal A D, Apte S K,
Wiegert T, Schumann W. Biochimica et Biophysica Acta (2001)
"Cloning and characterization of the major groESL operon from a
nitrogen-fixing cyanobacterium Anabaena sp. strain L-31."
1519(1-2):143-146], and HspA [Roy S K, Hiyama T, Nakamoto H. Eur J
Biochem (1999). "Purification and characterization of the 16-kDa
heat-shock-responsive protein from the thermophilic cyanobacterium
Synechococcus vulcanus, which is an alpha-crystallin-related, small
heat shock protein." 262(2):406-416]. In the preferred embodiment,
the orthologues of these genes from the thermophile
Thermosynechococcus elongatus BP-1 are overexpressed to confer
increased thermotolerance to the photoautotrophic organisms. These
exemplary genes encode amino acid sequences are 16.6 kDa small heat
shock protein molecular chaperone (HspA), locus NP.sub.--681663; 60
kD chaperonin 1 (GroEL-1), locus NP.sub.--680976; 60 kD chaperonin
2 (GroEL-2), locus NP.sub.--682202; Co-chaperonin (GroES), locus
NP.sub.--680977; and Endopeptidase (ClpB), locus
NP.sub.--683242.
[0288] As an alternative or in addition, endogenous repressors of
proteins involved in thermotolerance are downregulated or deleted.
For example, exemplary regulatory genes that can be disrupted
include hrcA, such as locus NP.sub.--440130 of Synechocystis sp.
PCC 6803 [Nakamoto H, Suzuki M, Kojima K. "Targeted inactivation of
the hrcA repressor gene in cyanobacteria." FEBS Lett (2003).
549(1-3):57-62] and the histidine kinase hik34, such as locus
slr1285 of Synechocystis sp. PCC 6803, [Suzuki I, Kanesaki Y,
Hayashi H, Hall J, Simon W J, Slabas A R, Murata N. "The histidine
kinase Hik34 is involved in thermotolerance by regulating the
expression of heat shock genes in Synechocystis." Plant Physiol
(2005). 138(3):1409-21.]
[0289] In addition or as an alternative, the lipid profile of
cellular and intracellular membrane can be modified to increase
thermotolerance. Of note, most thermotolerant organisms have
evolved mechanisms to retain highly saturated fatty acids,
frequently with lengthy and/or cyclic fatty acid tails. If natively
expressed in the desired photoautotrophic organism, it is useful to
downregulate or knock-out fatty acid desaturases (EC 1.14.19) such
as delta-12-desaturase, for example the desA gene (locus
NP.sub.--441489) of Synechocystis sp. PCC 6803, delta-15
desaturase, for example the desB, locus NP.sub.--441622 of
Synechocystis sp. PCC 6803, stearoyl-CoA 9-desaturase (EC
1.14.19.1), for example the desC gene, locus NP.sub.--442430 of
Synechocystis sp. PCC 6803, and/or delta-6-desaturase (EC
1.14.19.3), for example the desD gene, locus NP.sub.--441824 of
Synechocystis sp. PCC 6803.
[0290] In addition or as an alternative, pathways to enable
biosynthesis of the osmoprotectant betaine are engineered to
improve thermotolerance of photoautotrophic organisms [Yang X, Wen
X, Gong H, Lu Q, Yang Z, Tang Y, Liang Z, Lu C. "Genetic
engineering of the biosynthesis of glycinebetaine enhances
thermotolerance of photosystem II in tobacco plants." Planta
(2007). 225(3):719-33]. In this embodiment, a glycine sarcosine
methyltransferase is expressed to convert glycine to sarcosine and
sarcosine to dimethylglycine, as well as a dimethylglycine
methyltransferase, to catalyze the methylation of dimethylglycine
to betaine [Waditee R, Bhuiyan N H, Rai V, Aoki K, Tanaka Y, Hibino
T, Suzuki S, Takano J, Jagendorf A T, Takabe T, and Takabe T.
"Genes for direct methylation of glycine provide high levels of
glycinebetaine and abiotic-stress tolerance in Synechococcus and
Arabidopsis. Proc Natl Acad Sci (2005). 102(5):1318-23]. An
exemplary glycine sarcosine methyltransferase gene is encoded by
ApGSMT, locus BAC56939, from Aphanothece halophytica. An exemplary
dimethylglycine methyltransferase is encoded by ApDMT, locus
BAC56940 from Aphanothece halophytica.
Example 5
Improved pH Tolerance
[0291] In certain embodiments, elevated CO.sub.2 levels are used to
increase bioproductivity. However, elevating CO.sub.2 levels in
photobioreactors can cause concomitant increases to the acidity of
the culture medium that can be toxic to the cell. Engineering cells
to be tolerant to higher acidity conditions increases productivity
and reduces costs associated with external pH control. In the
present invention, one or more mechanisms to confer acid tolerance
are engineered into the cell.
[0292] Two similar and complementary mechanisms of acid resistance
use amino acid based decarboxylation and export to increase
intracellular pH [Richard H, Foster J W. J Bacteriol (2004)
"Escherichia coli Glutamate- and Arginine-Dependent Acid Resistance
Systems Increase Internal pH and Reverse Transmembrane
Potential."186(18):6032-6041]. The genes required for the
glutamate-based acid resistance are the glutamate decarboxylase
isozymes GadA and GadB, as well as the glutamate/GABA antiporter
GadC. The arginine-based acid resistance requires the arginine
decarboxylase AdiA and the arginine/agmatine anti-porter AdiC. In
addition, both acid-tolerance mechanisms require at least one of
the Cl.sup.- channels EriC and MriT [Iyer R, Iverson T M, Accardi
A, Miller C. Nature (2002) "A biological role for prokaryotic ClC
chloride channels." 419(6908):715-718]. In the preferred
embodiment, the genes required for one or both of these amino-acid
based acid-resistance mechanisms from the enteric bacterium
Escherichia coli K12 are overexpressed to confer increased acid
tolerance. These exemplary genes encode amino acid sequences are
glutamate decarboxylase A (GadA), EC 4.1.1.15, locus
NP.sub.--417974; Glutamate decarboxylase beta (GadB), 4.1.1.15,
locus NP.sub.--416010; glutamate: gamma-aminobutyric acid
antiporter (GadC), locus NP.sub.--416009; biodegradative arginine
decarboxylase (AdiA), EC 4.1.1.19, locus NP.sub.--418541);
arginine:agmatin antiporter (AdiC), locus NP.sub.--418539);
Chloride channel protein (EriC), locus NP.sub.--414697; and
Chloride channel protein (MriT), locus NP.sub.--416109.
[0293] In addition, or as an alternative, genes known to be
involved in bacterial acid response mechanisms are overexpressed to
confer acid tolerance to engineered bacteria. Thirty-two genes have
been previously identified to be over-expressed in response to acid
stress in response to acid stress [Ohta H, Shibata Y, Haseyama Y,
Yoshino Y, Suzuki T, Kagasawa T, Kamei A, Ikeuchi M, Enami I.
Photosynth Res (2005) "Identification of genes expressed in
response to acid stress in Synechocystis sp. PCC 6803 using DNA
microarrays." 84(1-3):225-230]. In the preferred embodiment, the
one or more of the genes expressed in the bacterium Synechocystis
sp. PCC 6803 are overexpressed to confer increased acid tolerance.
These exemplary genes encode amino acid sequences are Chaperone
protein dnaK2 (DnaK), locus NP.sub.--441989; DNA-directed RNA
polymerase, sigma subunit (sll0306), locus NP.sub.--441950;
Zn-dependent protease (sll0528), locus NP.sub.--442805;
metal-dependent phosphoesterase (sll0549), locus NP.sub.--442414;
Acid-stress tolerance protein (sll0846), locus NP.sub.--441124;
Acid-stress related membrane protein (sll0939), locus
NP.sub.--440194; Acid-stress tolerance protein (sll1086), locus
NP.sub.--441667; Acid-stress tolerance protein (sll1483), locus
NP.sub.--442911; 16.6 kDa small heat shock protein, molecular
chaperone (sll1514), locus NP.sub.--440316; mannose-1-phosphate
guanyltransferase (sll1558), EC 2.7.7.13, locus NP.sub.--441699;
RNA polymerase sigma factor (sll2012), locus NP.sub.--441031;
carboxyl-terminal processing protease (slr0008), EC 3.4.21.102,
locus NP.sub.--442119; molecular chaperone (slr0093), locus
NP.sub.--442496; Acid-stress tolerance protein (slr0270), locus
NP.sub.--441273; Geranylgeranyl pyrophosphate synthase (slr0611),
locus NP.sub.--439899; Acid-stress tolerance protein (slr0967),
locus NP.sub.--440193; CheY-like receiver (slr1214), locus
NP.sub.--440716; Signal transduction histidine kinase (slr1285),
locus NP.sub.--441610; Acid-stress tolerance protein (slr1413),
locus NP.sub.--440062; superoxide dismutase (slr1516), EC 1.15.1.1,
locus NP.sub.--441347; Acid-stress tolerance protein (slr1544),
locus NP.sub.--440790; Acid-stress tolerance protein (slr1573),
locus NP.sub.--442902; Acid-stress tolerance protein (slr1674),
locus NP.sub.--441676; hydrogenase expression/formation protein
(slr1675), locus NP.sub.--441677; Acid-stress tolerance protein
(slr1676), locus NP.sub.--441678; Acid-stress tolerance protein
(slr1687), locus NP.sub.--441698; Acid-stress tolerance protein
(slr1915), locus NP.sub.--440459; Esterase (slr1916), locus
NP.sub.--440460; Hydrogenase component protein (ssl3044), locus
NP.sub.--441697; Acid-stress tolerance protein (ssl3769), locus
NP.sub.--441305; Acid-stress tolerance protein (ssr2016), locus
NP.sub.--440709; Acid-stress tolerance protein (ssr2595), locus
NP.sub.--440789).
Example 6
Flue Gas Tolerance
[0294] Flue gas typically consists of N.sub.2 (80%),
CO.sub.2(10-15%), O.sub.2 (2-3%), as well as trace amounts of CO
(70-110 ppm), NO.sub.x (most typically NO.sub.2) (50-70 ppm),
SO.sub.2 (180-250 ppm). Of the components of flue gas, only
NO.sub.x and SO.sub.2 are thought to adversely effect the growth of
photoautotrophic organisms [Negoro M, Shioji N, Miyamoto K, Miura
Y. "Growth of microalgae in high CO.sub.2 gas and effects of
SO.sub.x and NO.sub.x." Appl Biochem Biotechnol (1991). Spring
(28-29): 877-86.].
[0295] In preferred embodiments, photoautotrophic cells are
engineered to exhibit improved tolerance to NO.sub.x, including
NO.sub.2. One exemplary means for improving tolerance to NO.sub.2
is via overexpression of the ncgA (NP.sub.--841001), ncgB
(NP.sub.--841000), and ncgC (NP.sub.--840999) genes from
Nitrosomonas europaea, [Beaumont H J, Lens S I, Westerhoff H V, and
van Spanning R J. "Novel nirK cluster genes in Nitrosomonas
europaea are required for NirK-dependent tolerance to nitrite." J.
Bacteriol (2005). 187(19):6849-51].
[0296] In preferred embodiments, photoautotrophic cells are
engineered to exhibit improved tolerance to SO.sub.x, including
SO.sub.2. One exemplary means for improving tolerance to SO.sub.2
is via overexpression of cysteine synthase A, cysK, from
Synechococcus PCC 7942 (YP.sub.--398721)
[O-acetyl-L-Ser(thiol)-lyase] (EC 4.2.99.8 and 2.5.1.47) [Noji M,
Saito, M, Nakamura M, Aono M, Saji H, Saito K. "Cysteine synthase
overexpression in tobacco confers tolerance to sulfur-containing
environmental pollutants." Plant Physiology (2001). 126:973-980].
In addition or as an alternative, superoxide dismutase is
overexpressed, such as the exemplary sodA (NP.sub.--441347; EC
1.15.1.1) gene from Synechocystis sp. PCC 6803. In preferred
embodiments, catalase is also overexpressed, such as the katG
(NP.sub.--441295; EC 1.11.16) gene from Synechocystis sp. PCC 6803
[Tseng M J, Liu C W, Yiu J C. "Enhanced tolerance to sulfur dioxide
and stress of transgenic Chinese cabbage plants expressing both
superoxide dismutase and catalase in chloroplasts." Plant Physiol.
Biochem (2007). 45(10-11):822-33].
[0297] Heavy metals such as lead, chromium, copper mercury and the
like are byproducts of industrial combustive processes, commonly
released through exhaust flue gases and pose a toxic threat to
cyanobacteria. Genes have been identified that can be engineered
into cyanobacteria to confer resistance to these and other heavy
metals pollutants. For example, genes potentially relevant for
imparting resistance to heavy metals can be found on natural
plasmids pMOL28 (accession number NC.sub.--006525) and pMOL30
(accession number NC.sub.--006466). These plasmids were originally
identified in Ralstonia metallidurans, a bacterium colonizing soils
in industrial sediments, soils and wastes or in other regions
having high levels of heavy metal toxicity. The pMOL28 and pMOL30
plasmids confer heavy metal resistance for cobalt, nickel and
chromate (pMOL28) and cobalt, zinc, cadmium, copper, lead and
mercury (pMOL30). For example, pMOL28 genes and proteins known to
be involved with lead tolerance include pbrT (accession number
YP.sub.--145624), pbrR (accession number YP.sub.--145623),
Pb-efflux ATPase (accession number YO.sub.--145622) and pbrD
(accession number YP.sub.--145620). pMOL28 genes involved in nickel
and cobalt resistance include cnrC (accession number CAI30229),
cnrA (accession number CAI30227), putative nickel and cobalt
resistance genes (accession number CAI11305; CAI11304; CAI11303).
Multi-substrate recognition proteins (cobalt-zinc-cadmium) are
encoded by genes czcD (accession number YP.sub.--145593.1), czcC
(accession number YP.sub.--145593.1) and czcB (accession number
YP.sub.--145594.1). pMOL30 genes for copper resistance include copA
(accession number YP.sub.--145682.1), copK (accession number
Q58AD3; 2K0Q_A), copC (accession number YP.sub.--145680.1), copD
(accession number YP.sub.--145679.1) and copper resistance
transmembrane protein (accession number YP.sub.--14682). pMOL30
genes for chromate resistance genes include chrB (accession number
YP.sub.--16177) and a gene for chromate transport protein
(accession number YP.sub.--161712). Other heavy metal resistance
genes on pMOL30 can confer tolerance to mercury and include a gene
for mercuric transport protein (accession number YP.sub.--161729),
a gene for periplasmic mercuric ion-binding protein (accession
number YP.sub.--161728), a gene for putative mercuric reductase
(accession number YP.sub.--161727) and a gene for putative mercury
resistance protein (accession number YP.sub.--161725).
[0298] Other sources of genes conferring metal resistance are
identified in Sulfolobus solfataricus, comprising two genes for
mercury resistance, merI (accession number ABL96631) and merH
(accession number ABL96629) and a gene for mercuric reductase, merA
(accession number ABL96630). Alternatively, an operon conferring
mercury resistance has been identified in Streptomyces sp. CHR28,
comprising mercuric reductase merA (accession number AAF64138),
organomercurial lyase merB (accession number AAF64140), mercury
transport merT (accession number AAF64136), orfIV (accession number
AAF64134) and extracellular mercury binding protein merP (accession
number AAF64135).
[0299] These examples represent only some of the potential genetic
sources for conferring heavy metal resistance and are not to be
construed as inclusive and limiting. For example, recently a
Turkish group reported a plasmid mediated multiple heavy metal
resistance from bacteria isolated from a landfill (M N
Unaldi-Coral, et al., Annals Microbio. (2005) vol. 55(3):175-179).
Other sources of metal resistance genes include plants and yeasts
(S. Clemens, et al., EMBO (1999) vol. 18:3325-3333), Pseudomonas
species (D. Reneiro, et al., Gene (1995) vol. 166:77-82) bacterial
species such as Escherichia coli subjected to adaptive pressures
from toxic environments (K R Brocklehurst and A P Morby,
Microbiology (2000) vol. 146:2277-2282) and others.
[0300] Feasibility studies have shown that bacterial species can
successfully be transformed and express genes mediating heavy metal
tolerance. For example Escherichia species have been altered to
confer mercury tolerance from genes found in other bacteria such as
Bacillus (Y. Wang, et al., J. Bacteriology (1987) vol.
169:4848-4851) as well as higher organisms including mice (C C
Huang, et al. Gene (1999) vol. 239:361-366.
Example 7
Engineered Salt Tolerance
[0301] In many geographic locales, available water supplies are
affected by high salinity. As a result, in certain embodiments it
is advantageous to propagate photoautotrophic organisms in brackish
(8-500 mM NaCl) or sea water (.about.530 mM). When the
photoautotrophic cell of interest is unable to thrive under these
conditions, it is necessary to overexpress nucleic acids conferring
salt tolerance.
[0302] In one embodiment, a Na.sup.+/H.sup.+ antiporter is
overexpressed. An exemplary Na.sup.+/H.sup.+ antiporter is the
apnhaP gene (locus BAB69459) from the halotolerant cyanobacteria
Aphanothece halophytica [Waditee R, Hibino T, Nakamura T,
Incharoensakdi A, and Takabe T. "Overexpression of a
Na.sup.+/H.sup.+ antiporter confers salt tolerance on a freshwater
cyanobacterium, making it capable of growth in sea water." Proc
Natl Acad Sci (2002). 99(6):4109-4114]. In some instances, catalase
is also overexpressed, such as the katG (NP.sub.--441295; EC
1.11.16) gene from Synechocystis sp. PCC 6803 to improve growth
rates in sea water.
[0303] In addition or as an alternative, the novel salt and cadmium
stress related gene, scsr, locus BAE53693 of Chlamydomonas sp. W80
is expressed. [Tanaka S, Suda Y, Ikeda K, Ono M, Miyasaka H,
Watanabe M, Sasaki K, and Hirata K. "A novel gene with antisalt and
anticadmium stress activities from the halotolerant marine green
alga Chlamydomonas sp. W80." FEMS Microbiol Lett (2007).
271:48-52].
[0304] In addition or as an alternative the breast basic conserved
gene, bbc1, locus BAA23724 of Chlamydomonas sp. W80 is expressed.
[Tanaka S, Ikeda K, and Miyasaka H. "Enhanced tolerance against
salt-stress and freezing-stress of Escherichia coli cells
expressing algal bbc1 gene." Curr. Microbiol (2001).
42:173-177].
[0305] In addition or as an alternative, pathways to enable
biosynthesis of the osmoprotectant betaine are engineered to
improve salt tolerance properties of photoautotrophic organisms. In
this embodiment, a glycine sarcosine methyltransferase is expressed
to convert glycine to sarcosine and sarcosine to dimethylglycine,
as well as a dimethylglycine methyltransferase, to catalyze the
methylation of dimethylglycine to betaine [Waditee R, Bhuiyan N H,
Rai V, Aoki K, Tanaka Y, Hibino T, Suzuki S, Takano J, Jagendorf A
T, Takabe T, and Takabe T. "Genes for direct methylation of glycine
provide high levels of glycinebetaine and abiotic-stress tolerance
in Synechococcus and Arabidopsis. Proc Natl Acad Sci (2005).
102(5):1318-23]. An exemplary glycine sarcosine methyltransferase
gene is encoded by ApGSMT, locus BAC56839, from Aphanothece
halophytica. An exemplary dimethylglycine methyltransferase is
encoded by ApDMT, locus BAC56940 from Aphanothece halophytica.
Improved Salt-Tolerant Transgenic Cyanobacteria
[0306] A putative Na/H+ antiporter from Synechococcus sp. PCC 7002,
which was identified by homology to the Na/H+ antiporter from
Aphanothece halophytica (Accession Number: BAB69459), was amplified
by PCR using the following primers:
TABLE-US-00001 NaH Forward Primer- (SEQ ID NO: 17)
TCATCATATGCCTTTGGTCATGATTGTTTTAGCAGAAC, NaH Reverse Primer- (SEQ ID
NO: 18) ATATCAATTGTTAACTCTGAATTGTTTTTTCGGTGGCTTTG.
The Forward Primer adds an NdeI restriction endonuclease
recognition site, and the Reverse Primer adds an MfeI restriction
site.
[0307] The PCR product was cloned into pJB263 by digesting the
insert and vector individually with NdeI and EcoRI (New England
Biolabs). Both digestions were gel isolated on a 1% TAE agarose
gel, purified using a Gel Extraction Kit (Qiagen), and ligated
using the Quick Ligation Kit (New England Biolabs) using standard
techniques. The ligated product was transformed into EPI400
chemically competent E. coli cells using standard techniques
(EpiCenter), and confirmed by PCR. The resulting plasmid,
pJB263-NaH, was confirmed by PCR analysis.
[0308] Cells of Synechocystis sp. PCC 6803 are transformed with
pJB263-NaH using the following procedure. pJB263-NaH plasmid stocks
were purified using Qiagen miniprep kit for transformation into
Synechocystis sp. PCC 6803. One to two micrograms of pJB263-NaH
plasmid is added to Synechocystis sp PCC 6803 cells grown to an
optical density of 1 and incubated at 30 C for 4 hours using low
intensity orbital shaking and low level light source. Cells are
then plated onto A.sup.+ solid media plates and is placed in a
lighted incubator (100-250 uE/m2/s, 30 C) for 1 day. Twenty-five
micrograms/mL spectinomycin is underlayed on the plates and
incubated until colonies grew (.about.5 days). Integration into
target Synechocystis host cells is confirmed by PCR of whole cell
genomic DNA by a "colony PCR" protocol:
Example 8
Nutrient Independence
[0309] In addition to CO2 and light, photoautotrophic organisms
typically require inorganic nutrient sources and vitamins. Required
nutrients are generally supplemented to the growth media during
bench-scale propagation of such organisms. However, such nutrients
are prohibitively expensive in the context of industrial scale
bioprocessing.
[0310] Nitrogen is a key constituent of a variety of cellular
macromolecules, including amino acids and nucleotides. Engineering
photoautotrophs to efficiently utilize inexpensive sources provides
significant economic and practical advantages.
[0311] In one embodiment, photoautotrophs are engineered to fix
N.sub.2, which is found present in concentrations of nearly 80%
(v/v) in air and flue gas. In this embodiment, genes required for
nitrogen fixation are overexpressed, in addition to genes required
for synthesis of required cofactors and accessory protein [Herrero
A, Muro-Pastor A M, Flores E. J Bacteriol (2001) "Nitrogen Control
in Cyanobacteria". 183(2): 411-425]. Eighteen such exemplary genes
are found in Nostoc sp PCC 7120: FeMo cofactor biosynthesis protein
(NifB), locus NP.sub.--485557; [4Fe-4S] ferredoxin (FdxN), locus
BAB77882; L-Cysteine desulfurase (NifS), EC 2.8.1.7, locus
NP.sub.--485499; Fe cluster accessory protein (NifU), locus
NP.sub.--485498; Nitrogenase-Fe subunit (NifH), EC 1.18.6.1, locus
NP.sub.--485497; Nitrogenase-alpha subunit (NifD), EC 1.18.6.1,
locus NP.sub.--485484; Nitrogenase-beta subunit (NifK), EC
1.18.6.1, locus NP.sub.--485483; FeMo cofactor biosynthesis protein
(NifE), locus NP.sub.--485481; FeMo cofactor biosynthesis protein
(NifN), locus NP.sub.--485480; FeS cluster accessory protein
(NifX), locus NP.sub.--485479; FeMo cofactor accessory protein
(NifW), locus NP.sub.--485476; FeMo cofactor accessory protein
(HesA), locus NP.sub.--485475; FeS cofactor accessory protein
(HesB), locus NP.sub.--485474; Nitrogen-fixation specific
ferredoxin (FdxH), locus NP.sub.--485473; Pyruvate-flavodoxin
oxidoreductase (NifJ), EC 1.2.7.1, locus NP.sub.--486843;
homocitrate synthase (NifV), EC 2.3.3.14, locus NP.sub.--485450;
FeMo cofactor accessory protein (NifZ), locus NP.sub.--485451; and
FeMo cofactor accessory protein (NifT), locus NP.sub.--485452).
Overexpression of the above genes enables photoautotrophic
organisms to grow with N.sub.2 gas as the sole source of
nitrogen.
[0312] In addition or as an alternative, photoautotrophs are
engineered to assimilate nitrite, which is a trace component of
flue gas. In this embodiment, cells must be engineered to express a
nitrite/nitrate transporter and be conveyed with the ability to
convert nitrite into ammonia. Exemplary gene sequences encoding
active nitrate/nitrate transporters are found Synechococcus sp. PCC
6301 [Herrero A, Muro-Pastor A M, Flores E. J Bacteriol (2001)
"Nitrogen Control in Cyanobacteria". 183(2): 411-425] and are
overexpressed in cells to allow import of nitrates and nitrite, for
example: ABC-type nitrate/nitrite transport system
substrate-binding protein (NrtA), locus YP.sub.--171021; ABC-type
nitrate/nitrite transport system permease protein (NrtB), locus
YP.sub.--171022; ABC-type nitrate/nitrite transport system
ATP-binding protein (NrtC), locus YP.sub.--171023; ABC-type
nitrate/nitrite transport system ATP-binding protein (NrtD), locus
YP.sub.--171024). As an alternative, the single polypeptide
Nitrate/Nitrite transporter (NrtP) gene from Synechococcus sp. PCC
7002 is overexpressed [Sakamoto T, Inoue-Sakamoto K, Bryant D A. J
Bacteriol (1999). "A Novel Nitrate/Nitrite Permease in the Marine
Cyanobacterium Synechococcus sp. Strain PCC 7002."
181(23):7363-7372], Nitrite/Nitrate permease (NrtP), locus
AAD45941.
[0313] At elevated concentrations, nitrite is toxic to most cells.
To alleviate nitrite toxicity, photoautotrophic cells are
engineered to overexpress genes within the nitrite tolerance operon
found in Nitrosomonas europaea ATCC 19718 [Beaumont H J E, Lens S
I, Westerhoff H V, van Spanning R J M. "Novel nirK Cluster Genes in
Nitrosomonas europaea Are Required for NirK-Dependent Tolerance to
Nitrite." J Bacteriol (2005). 187(19):6849-6851], Multicopper
oxidase type 1 (NirK), locus NP.sub.--840998; Cytochrome c, class
IC (NcgA), locus NP.sub.--841001; Cytochrome c, class I (NcgB),
locus NP.sub.--841000; Cytochrome c, class IC (NcgC), locus
NP.sub.--840999.
[0314] In addition or as an alternative, photoautotrophic cells are
engineered to assimilate ammonia. In this embodiment, cells are
engineered to overexpress an ammonium permease. An exemplary
ammonium permease found in Synechocystis sp. PCC 6803 [Montesinos M
L, Muro-Pastor A M, Herrero A, Flores E. "Ammonium/Methylammonium
Permeases of a Cyanobacterium. Identification and analysis of three
nitrogen-regulated amt genes in Synechocystis sp. PCC 6803." J Biol
Chem (1998). 273(47):31463-31470] is overexpressed High affinity
ammonium/methylammonium permease (Amt1), locus NP.sub.--442561;
Ammonium/methylammonium permease (Amt2), locus NP.sub.--440272;
Ammonium/methylammonium permease (Amt3), locus NP.sub.--442793.
[0315] In addition or as an alternative, photoautotrophic cells are
engineered to assimilate urea. In this embodiment, cells must be
engineered to overexpress a urea transporter to enable efficient
uptake of urea into the cell. An exemplary urea transporter found
in Nostoc sp. PCC 7120 [Valladares A, Montesinos M L, Herrero A,
Flores E. "An ABC-type, high-affinity urea permease identified in
cyanobacteria." Molecular Microbiology (2002). 43(3):703-715] is
overexpressed comprising the five gene ABC-type transporter for
high affinity urea uptake for example ABC-type, high-affinity urea
permease, periplasmic domain (UrtA), locus CAB70948.1; ABC-type,
high-affinity urea permease, membrane domain (UrtB), locus
CAB70949.1; ABC-type, high-affinity urea permease, membrane domain
(UrtC), locus CAB70950.1; ABC-type, high-affinity urea permease,
ATP binding domain (UrtD), locus CAB70951.1 and ABC-type,
high-affinity urea permease, ATP binding domain (UrtE), locus
CAB70952.1.
[0316] In addition, urea amidohydrolase (EC 3.5.1.5) ("urease") and
its associated accessory proteins are overexpressed, which catalyze
conversion of urea to ammonia and carbon dioxide. An exemplary
urease found in Synechococcus sp. WH 7805 [Collier J, Brahamsha B,
Palenik B. "The marine cyanobacterium Synechococcus sp. WH7805
requires urease to utilize urea as a nitrogen source:
molecular-genetic and biochemical analysis of the enzyme"
Microbiology (1999). 145(2):447-459] is overexpressed comprising
the ureABC urease genes: Urea amidohydrolase, gamma subunit (UreA),
locus AAC61500; Urea amidohydrolase, beta subunit (UreB), locus
AAC61501; Urea amidohydrolase, alpha subunit (UreC), locus
AAC61502; and the ureDEFG genes encoding the accessory proteins
Urease accessory protein (UreD), locus AAC61499; Urease accessory
protein (UreE), locus AAC61498; Urease accessory protein (UreF),
locus AAC61497; and Urease accessory protein (UreG), locus
AAC61496.
[0317] Vitamin B12 is a vitamin cofactor that facilitates
radical-based reaction catalyzation. Many organisms, including at
least half of all microalgae surveyed, such as Synechococcus sp.
PCC 7002, require external sources of Vitamin B12 for growth, which
is prohibitively expensive in large-scale industrial bioprocessing
[Croft M T, Warren M J, Smith A G. "Algae Need Their Vitamins",
Eukaryotic Cell (2006) 5(8):1175-1183]. In one embodiment, the need
for Vitamin B12 is obviated by engineering photoautotrophic cells
to express the Vitamin B12 biosynthesis pathway. An exemplary
biosynthesis pathway found in Salmonella typhimurium is
overexpressed, including but not limited to the following 20 genes:
Uroporphyrin-III C-methyltransferase (CysG), EC 2.1.1.107, locus
NP.sub.--462380; Sirohydrochlorin cobaltochelatase (CbiK), EC
4.99.1.3, locus NP.sub.--460970; Precorrin-2 C20-methyltransferase
(CbiL), EC 2.1.1.130, locus NP.sub.--460969; Precorrin-3B methylase
(CbiH), EC 2.1.1.131, locus NP.sub.--460972; Bifunctional
CbiG/precorrin methyltransferase (CbiG), locus NP.sub.--460973;
Precorrin-4 C11-methyltransferase (CbiF), EC 2.1.1.133, locus
NP.sub.--460974; Cobalamin biosynthesis protein (CbiD), locus
NP.sub.--460977; NADPH-dependent precorrin-6A reductase (CbiJ), EC
1.3.1.54, locus NP.sub.--460971; Precorrin-6B
C5,15-methyltransferase (CbiE), EC 2.1.1.132, locus
NP.sub.--460976; Precorrin-6B C12 decarboxylase (CbiT), EC
2.1.1.132, locus NP.sub.--460975; Precorrin-8X-methylmutase (CbiC),
EC 5.4.1.2, locus NP.sub.--460978; Cobyrinic acid A,C-diamide
synthase (CbiA), EC 6.3.1.-, locus NP.sub.--460980; Cob(I)yrinic
acid a,c-diamide adenosyltransferase (BtuR), EC 2.5.1.17, locus
NP.sub.--460677; Cobyrinic acid synthase (CbiP), EC 6.3.5.10, locus
NP.sub.--460964; Cobyric acid decarboxylase (CobD), EC 4.1.1.81,
locus NP.sub.--459636; Adenosylcobinamide-phosphate synthase
(CbiB), EC 6.3.1.10, locus NP.sub.--460979; Alpha ribazole-5'-P
phosphatase (CobC), EC 3.1.3.73, locus NP.sub.--459635;
Cobalamin(5'-phosphate) synthase (CobS), EC 2.7.8.26, locus
NP.sub.--460962; Cobinamide phosphate guanylyl transferase (CobU),
EC 2.7.7.62, locus NP.sub.--460963; and Nicotinate-nucleotide
dimethylbenzimidazole-P phosphoribosyl transferase (CobT), EC
2.4.2.21, locus NP.sub.--460961).
[0318] In addition, to allow for cobalt uptake and incorporation
into Vitamin B12, the genes encoding the cobalt transporter are
overexpressed. The exemplary cobalt transporter protein found in
Salmonella typhimurium is overexpressed ABC-type Co2+ transport
system, permease component (CbiM), locus NP.sub.--460968; ABC-type
cobalt transport system, periplasmic component (CbiN), locus
NP.sub.--460967; and ABC-type cobalt transport system, permease
component (CbiQ), locus NP.sub.--461989).
[0319] In a preferred embodiment, photoautotrophic organisms are
engineered to overexpress Vitamin B12-independent enzymes to
obviate the need for this cofactor entirely. In most
photoautotrophic organisms, only methionine synthase (EC 2.1.1.13)
and class II ribonucleotide reductases require Vitamin B12. An
exemplary Vitamin B12-independent methionine synthase (EC 2.1.1.14)
from Thermotoga maritima is therefore overexpressed:
5-methyltetrahydropteroyltriglutamate-homocysteine
methyltransferase (MetE), locus NP.sub.--229090 (SEQ ID NO: 22). In
addition, an exemplary class I ribonucleotide reductase (nrdAB)
from Synechocystis sp. PCC 6803 is overexpressed:
Ribonucleoside-diphosphate reductase, alpha subunit (NrdA), locus
NP.sub.--441654; Ribonucleoside-diphosphate reductase, beta subunit
(NrdB), locus NP.sub.--443040.
[0320] It is furthermore contemplated that nutrient independence
(e.g., Vitamin B12) of host cells of the present invention can be
accomplished by expression of various proteins encoding
5-methyltetrahydropteroyltriglutamate-homocysteine
methyltransferase (metE), ribonucleoside-diphosphate reductase,
alpha subunit (nrdA), and ribonucleoside-diphosphate reductase,
beta subunit (nrdB) comprising sequences that are at least 80%,
85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%
identical to metE, nrdA or nrdB.
Strain Construction
[0321] The expression plasmid, pJB5, contains two 500 bp regions of
DNA homologous to sequences on the natural pAQ1 plasmid of
Synechococcus sp. PCC 7002. Between the two regions of homology is
a promoter and ribosome binding site, sites for DNA sequence
insertion, and a resistance cassette, aadA1, that confers
resistance to spectinomycin. The metE genes from E. coli
(NP.sub.--418273 (SEQ ID NO: 20)) and Thermosynechococcus elongatus
BP-1 (NP.sub.--681881 (SEQ ID NO: 21)) were encoded on pJB6 and
pJB7 respectively. All the plasmids were digested with NdeI (New
England Biolabs) and EcoRI (New England Biolabs), and the .about.1
kb fragment from pJB6 and pJB7, and the large fragment from pJB5,
were gel isolated and purified using standard techniques (Qiagen).
The fragments from pJB6 and pJB7 were ligated and transformed into
pJB5 using standard techniques to form pJB5-6 and pJB5-7.
[0322] Synechococcus sp. PCC 7002 was transformed with pJB5-6 and
pJB5-7 as follows. pJB5-6 and pJB5-7 were digested and inactivated
with SbfI (New England Biolabs) for 1 hour and heat inactivated.
DNA was incubated with fresh cells at OD730 of 1 for 4 hours in a
dark incubator at 37.degree. C. in A.sup.+. Cells were then allowed
diluted in 20 mL fresh A.sup.+ media with moderate light and
bubbled with air with 1% CO.sub.2 for 24 hours. Cells were then
diluted 1 in 20 into fresh A.sup.+ media containing 10 ug/mL
spectinomycin and allowed to grow for 5 days under the same
conditions. Cells were again diluted again 1 in 20 in 25 mL A.sup.+
media lacking Vitamin B12, and this was repeated a second time
after the cells grew to high density. After the second outgrowth
cells were plated onto A.sup.+ plates lacking Vitamin B12.
[0323] FIGS. 3A-D show wild-type Synechococcus sp. PCC 7002 and
cells transgenically expressing E. coli MetE and
Thermosynechococcus elongatus BP-1 MetE diluted and grown overnight
in A.sup.+ media lacking Vitamin B12. Cells were diluted, then
plated and allowed to grow 1 week at 37.degree. C. in a lighted
incubator on both Vitamin B12 sufficent and deficient plates. FIG.
3A illustrates wild-type Synechococcus on B12 sufficient plate
whereas FIG. 3B shows B12 deficient plate. FIG. 3C represents a
transgenic Synechococcus strain with the E. coli MetE on Vitamin
B12 deficient plate and FIG. 3D shows a Thermosynechococcus
elongatus MetE on Vitamin B12 deficient plate. The results show the
ability of transgenically expressed methionine synthase to rescue
the Vitamin B12 requirements of cyanobacteria.
Example 9
Near Infra Red Absorbance
[0324] Acaryochloris marina is the only known organism to have
chlorophyll (Chl) d as its main Chl constituent. Chl d absorbs
far-red/near it light in the range of 700 nm-750 nm and carries out
oxygenic photosynthesis. It also contains Chl a, found in many
organisms as the primary constituent. Chl a differs from Chl d only
in that it has a vinyl group in place of a formyl group. We
reasoned, then, that Chl d is derived from Chl a (or that a
precursor of Chl d is derived from the analogous precursor of Chl
a) by one or more of the mechanisms shown in FIG. 4.
[0325] The Acaryochloris marina genome has been sequenced and
annotated, making it possible to locate putative oxygenase- and
epoxide hydrolase-encoding genes contained within it. FIG. 6 lists
those genes explicitly identified in the annotation of the A.
marina as some form of "oxygenase". Because these identifications
were made by homology comparisons with other known oxygenases, a
further BLAST search was not conducted. FIG. 7 lists the genes from
A. marina with the most similarity to the Anabaena variabilis gene
encoding EC 3.2.2.3 (epoxide hydrolase), determined by Protein
BLAST. All genes with an expect value of less than 0.5 are shown.
The protein sequence used as the query is shown in FIG. 5.
[0326] It is noted in Swingley et al., PNAS 105:2005 (2008) that an
alternative method of oxygenation is that which transfers oxygen
from water using S-adenosylmethionine (SAM). The genes encoding
putative proteins of this type are given in FIG. 8.
[0327] The protein corresponding to locus tag AM1.sub.--5665
(protein id ABW30612.1) [Acaryochloris marina MBIC11017] (FIG. 6B)
was noted by Swingley et al., PNAS 105:2005 (2008) as being a
likely oxygenase but not having significant homology with known
examples. This could mean it is especially significant in Chl d
formation.
[0328] The protein corresponding to locus tag AM1.sub.--2935
(protein id ABW27932.1) [Acaryochloris marina MBIC11017], a likely
thioredoxin, was found in the GenBank annotation as the only gene
explicitly containing "epox" (see FIG. 7).
[0329] The protein corresponding to locus tag AM1.sub.--5023)
(protein id ABW29989.1) [Acaryochloris marina MBIC11017] and the
protein corresponding to locus tag AM1.sub.--5798) (protein id
ABW30743.1) [Acaryochloris marina MBIC11017] share little homology
with other sequenced cyanobacteria, according to Swingley et al.,
PNAS 105:2005 (2008) and thus may be important in Chl d
synthesis.
[0330] The Acaryochloris marina genes and the encoded protein
sequences for photosystem proteins that can use chlorophyll d as a
photoreceptor are provided in Japanese Kokai No. 2001-346585,
titled "Photosystem proteins that can use chlorophyll d as a
photoreceptor and the genes that code them," published Dec. 18,
2001, corresponding to Application number P2000-170696, filed June
7, 200 by Marine Biotechnology Institute Co., Ltd, 1-28-10 Hongo,
Bunkyo-ku, Tokyo, the entire disclosure of which is hereby
incorporated by reference in its entirety. Amino acid sequences of
six photosystem proteins corresponding to Acaryochloris marina
locus tags AM1.sub.--2457, AM1.sub.--2458, AM1.sub.--2166,
AM1.sub.--1083, AM1.sub.--2026, and AM1.sub.--1084 were retrieved
from the Japanese Kokai No. 2001-346585 application and used as
query sequences in BLASTP searches. The BLASTP searches identified
full-length amino acid sequences corresponding to the six
photosystem proteins set out in Table 6, which appears in FIG.
9.
[0331] The protein corresponding to Acaryochloris marina locus tag
AM1.sub.--2457 (protein id ABW27465.1) [Acaryochloris marina
MBIC11017] is the photosystem I core protein PsaA. The protein
corresponding to Acaryochloris marina locus tag AM1.sub.--2458
(protein id ABW27466.1) [Acaryochloris marina MBIC11017] is
photosystem I core protein PsaB. Together, these two subunit
proteins assemble to form the photosystem I protein that converts
light energy into redox power and reduces NADP using electrons
supplied by photosystem II.
[0332] The protein corresponding to Acaryochloris marina locus tag
AM1.sub.--2166) (protein id ABW27180.1) [Acaryochloris marina
MBIC11017] is photosystem II D1 protein PsbA. The protein
corresponding to Acaryochloris marina locus tag AM1.sub.--1083)
(protein id ABW26122.1) [Acaryochloris marina MBIC11017] is
photosystem II D2 protein PsbD. Together PsbA and PsbD assemble and
form the photosystem II protein. The photosystem II protein
converts light energy into redox power, decomposes water and takes
up electrons and supplies them to photosystem I.
[0333] The protein corresponding to Acaryochloris marina locus tag
AM1.sub.--2026 (protein id ABW27041.1) [Acaryochloris marina
MBIC11017] is photosystem II CP47 protein PsbB. The protein
corresponding to Acaryochloris marina locus tag AM1.sub.--1084)
(protein id ABW26123.1) [Acaryochloris marina MBIC11017] is
photosystem II CP43 protein PsbC. PsbB and PsbC assemble and form
the photosystem II core antenna proteins. Energy absorbed by the
antenna to capture light energy used to decompose water is
transmitted to the reaction center protein.
[0334] According to one embodiment of the invention a
photoautotroph is created to absorb far-red/near IR light (i.e., in
the neighborhood of 700 nm-750 nm). In this embodiment, genes
required for synthesis of chlorophyll d and photosystem proteins I
and II capable of binding chlorophyll d and using it as a
photoreceptor for transducing light energy into reducing power are
overexpressed. Exemplary genes include those encoding any of the
Acaryochloris marina proteins disclosed herein.
TABLE-US-00002 TABLE 7 Informal Sequence Listing (5'.fwdarw. 3')
(SEQ ID NOS 1-2 and 5-18) TTGCTACCTGCAGGGCCACCACAGCCAAATTCATCGTT
GGTTGTGCGGCCGCAGTATTGGCTGTGATGTTGG
TATACATCATATGGGTAAATTATTACTGATATTAGGTAGTGTTATTGC
GCTACAATTGTTAAGCATTAGAAGATTCTTTAACAGCAACATTCC
GAATACATATGACTGACTATGCAGCC GAATAGAATTCTTACACCTGTGTCACGG
GAATAGTCTCATATGGATAACGTCATCGG GAATAGAATTCTTAGTACAGCTGGAGTG
GAATACATATGGCACTCGTACCCATG GAATAGAATTCTATAACCACCACGG
TATGCCACATTCCTACGATTACGATGCC AATTCTTAAAACAGGCGGTTTAAACCGTTTAACGC
TCGACATATGGCGGTAACGCAAACAGCCC
TCGAGAATTCTTACTCAAACTCATTCCAGGAACGACCATC
TCATCATATGCCTTTGGTCATGATTGTTTTAGCAGAAC
ATATCAATTGTTAACTCTGAATTGTTTTTTCGGTGGCTTTG
[0335] All references to publications, including scientific
publications, treatises, pre-grant patent publications, and issued
patents are hereby incorporated by reference in their entirety for
all purposes. The teachings of the specification are intended to
exemplify but not limit the invention, the scope of which is
determined by the following claims.
Sequence CWU 1
1
22138DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 1ttgctacctg cagggccacc acagccaaat tcatcgtt
38234DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 2ggttgtgcgg ccgcagtatt ggctgtgatg ttgg
34334DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 3cgataaggcg cgccgaaact gcgccaagaa tagc
34438DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 4gtgtatggcc ggccatcgcc tttatggtgc tttatgtg
38548DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 5tatacatcat atgggtaaat tattactgat attaggtagt
gttattgc 48645DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 6gctacaattg ttaagcatta gaagattctt
taacagcaac attcc 45726DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 7gaatacatat gactgactat gcagcc
26828DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 8gaatagaatt cttacacctg tgtcacgg 28929DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
9gaatagtctc atatggataa cgtcatcgg 291028DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
10gaatagaatt cttagtacag ctggagtg 281126DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
11gaatacatat ggcactcgta cccatg 261225DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
12gaatagaatt ctataaccac cacgg 251328DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
13tatgccacat tcctacgatt acgatgcc 281435DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
14aattcttaaa acaggcggtt taaaccgttt aacgc 351529DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
15tcgacatatg gcggtaacgc aaacagccc 291640DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
16tcgagaattc ttactcaaac tcattccagg aacgaccatc 401738DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
17tcatcatatg cctttggtca tgattgtttt agcagaac 381841DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
18atatcaattg ttaactctga attgtttttt cggtggcttt g 4119295PRTAnabaena
variabilis 19Met Phe Pro Ser Phe Leu Pro Ala Ala Val Gly Gln Leu
Thr Glu Ser1 5 10 15Glu Ser Ile Ala Leu Ala Lys Thr Ile Gln Thr Gln
Ala Ile Ala Thr 20 25 30Pro Leu Ser Asn Gln Pro Ile Thr Thr Ala Tyr
Val Arg Gln Gly Ser 35 40 45Gly Gly Thr Pro Ile Leu Leu Ile His Gly
Phe Asp Ser Ser Val Leu 50 55 60Glu Phe Arg Arg Leu Leu Pro Leu Leu
Gly Lys Glu Asn Glu Thr Trp65 70 75 80Ala Val Asp Leu Leu Gly Phe
Gly Phe Thr Gln Arg Leu Ala Gly Ile 85 90 95Lys Phe Ser Pro Val Ala
Ile Arg Thr His Leu Tyr Ser Phe Trp Lys 100 105 110Thr Leu Ile Asn
Gln Pro Val Ile Leu Val Gly Ala Ser Met Gly Gly 115 120 125Ala Ala
Ala Ile Asp Phe Thr Leu Thr Tyr Pro Glu Ala Val Gln Lys 130 135
140Leu Val Leu Ile Asp Ser Ala Gly Leu Arg Gly Gly Ser Pro Leu
Ser145 150 155 160Lys Phe Met Phe Pro Pro Leu Asp Tyr Leu Ala Ala
Gln Phe Leu Arg 165 170 175Ser Pro Lys Val Arg Asp Arg Val Ser Arg
Ala Ala Tyr Lys Asn Pro 180 185 190Asn Leu Ala Thr Val Asp Ala Leu
Cys Cys Gly Ala Leu His Leu Glu 195 200 205Met Pro Ser Trp Pro Glu
Ala Leu Ile Ala Phe Thr Lys Ser Gly Gly 210 215 220Tyr Thr Ala Phe
Arg Phe Lys Gln Leu Ala Glu Ile Ile Ser Pro Thr225 230 235 240Leu
Ile Leu Trp Gly Asp Ala Asp Arg Ile Leu Gly Thr Glu Asp Gly 245 250
255Lys Arg Phe Lys Arg Ala Ile Pro His Ser Gln Leu Ile Trp Ile Gln
260 265 270Asp Cys Gly His Ile Pro His Leu Glu Gln Pro Gly Ile Thr
Ala Gln 275 280 285His Ile Leu Ser Phe Cys Ser 290
29520753PRTEscherichia coli 20Met Thr Ile Leu Asn His Thr Leu Gly
Phe Pro Arg Val Gly Leu Arg1 5 10 15Arg Glu Leu Lys Lys Ala Gln Glu
Ser Tyr Trp Ala Gly Asn Ser Thr 20 25 30Arg Glu Glu Leu Leu Ala Val
Gly Arg Glu Leu Arg Ala Arg His Trp 35 40 45Asp Gln Gln Lys Gln Ala
Gly Ile Asp Leu Leu Pro Val Gly Asp Phe 50 55 60Ala Trp Tyr Asp His
Val Leu Thr Thr Ser Leu Leu Leu Gly Asn Val65 70 75 80Pro Ala Arg
His Gln Asn Lys Asp Gly Ser Val Asp Ile Asp Thr Leu 85 90 95Phe Arg
Ile Gly Arg Gly Arg Ala Pro Thr Gly Glu Pro Ala Ala Ala 100 105
110Ala Glu Met Thr Lys Trp Phe Asn Thr Asn Tyr His Tyr Met Val Pro
115 120 125Glu Phe Val Lys Gly Gln Gln Phe Lys Leu Thr Trp Thr Gln
Leu Leu 130 135 140Asp Glu Val Asp Glu Ala Leu Ala Leu Gly His Lys
Val Lys Pro Val145 150 155 160Leu Leu Gly Pro Val Thr Trp Leu Trp
Leu Gly Lys Val Lys Gly Glu 165 170 175Gln Phe Asp Arg Leu Ser Leu
Leu Asn Asp Ile Leu Pro Val Tyr Gln 180 185 190Gln Val Leu Ala Glu
Leu Ala Lys Arg Gly Ile Glu Trp Val Gln Ile 195 200 205Asp Glu Pro
Ala Leu Val Leu Glu Leu Pro Gln Ala Trp Leu Asp Ala 210 215 220Tyr
Lys Pro Ala Tyr Asp Ala Leu Gln Gly Gln Val Lys Leu Leu Leu225 230
235 240Thr Thr Tyr Phe Glu Gly Val Thr Pro Asn Leu Asp Thr Ile Thr
Ala 245 250 255Leu Pro Val Gln Gly Leu His Val Asp Leu Val His Gly
Lys Asp Asp 260 265 270Val Ala Glu Leu His Lys Arg Leu Pro Ser Asp
Trp Leu Leu Ser Ala 275 280 285Gly Leu Ile Asn Gly Arg Asn Val Trp
Arg Ala Asp Leu Thr Glu Lys 290 295 300Tyr Ala Gln Ile Lys Asp Ile
Val Gly Lys Arg Asp Leu Trp Val Ala305 310 315 320Ser Ser Cys Ser
Leu Leu His Ser Pro Ile Asp Leu Ser Val Glu Thr 325 330 335Arg Leu
Asp Ala Glu Val Lys Ser Trp Phe Ala Phe Ala Leu Gln Lys 340 345
350Cys His Glu Leu Ala Leu Leu Arg Asp Ala Leu Asn Ser Gly Asp Thr
355 360 365Ala Ala Leu Ala Glu Trp Ser Ala Pro Ile Gln Ala Arg Arg
His Ser 370 375 380Thr Arg Val His Asn Pro Ala Val Glu Lys Arg Leu
Ala Ala Ile Thr385 390 395 400Ala Gln Asp Ser Gln Arg Ala Asn Val
Tyr Glu Val Arg Ala Glu Ala 405 410 415Gln Arg Ala Arg Phe Lys Leu
Pro Ala Trp Pro Thr Thr Thr Ile Gly 420 425 430Ser Phe Pro Gln Thr
Thr Glu Ile Arg Thr Leu Arg Leu Asp Phe Lys 435 440 445Lys Gly Asn
Leu Asp Ala Asn Asn Tyr Arg Thr Gly Ile Ala Glu His 450 455 460Ile
Lys Gln Ala Ile Val Glu Gln Glu Arg Leu Gly Leu Asp Val Leu465 470
475 480Val His Gly Glu Ala Glu Arg Asn Asp Met Val Glu Tyr Phe Gly
Glu 485 490 495His Leu Asp Gly Phe Val Phe Thr Gln Asn Gly Trp Val
Gln Ser Tyr 500 505 510Gly Ser Arg Cys Val Lys Pro Pro Ile Val Ile
Gly Asp Ile Ser Arg 515 520 525Pro Ala Pro Ile Thr Val Glu Trp Ala
Lys Tyr Ala Gln Ser Leu Thr 530 535 540Asp Lys Pro Val Lys Gly Met
Leu Thr Gly Pro Val Thr Ile Leu Cys545 550 555 560Trp Ser Phe Pro
Arg Glu Asp Val Ser Arg Glu Thr Ile Ala Lys Gln 565 570 575Ile Ala
Leu Ala Leu Arg Asp Glu Val Ala Asp Leu Glu Ala Ala Gly 580 585
590Ile Gly Ile Ile Gln Ile Asp Glu Pro Ala Leu Arg Glu Gly Leu Pro
595 600 605Leu Arg Arg Ser Asp Trp Asp Ala Tyr Leu Gln Trp Gly Val
Glu Ala 610 615 620Phe Arg Ile Asn Ala Ala Val Ala Lys Asp Asp Thr
Gln Ile His Thr625 630 635 640His Met Cys Tyr Cys Glu Phe Asn Asp
Ile Met Asp Ser Ile Ala Ala 645 650 655Leu Asp Ala Asp Val Ile Thr
Ile Glu Thr Ser Arg Ser Asp Met Glu 660 665 670Leu Leu Glu Ser Phe
Glu Glu Phe Asp Tyr Pro Asn Glu Ile Gly Pro 675 680 685Gly Val Tyr
Asp Ile His Ser Pro Asn Val Pro Ser Val Glu Trp Ile 690 695 700Glu
Ala Leu Leu Lys Lys Ala Ala Lys Arg Ile Pro Ala Glu Arg Leu705 710
715 720Trp Val Asn Pro Asp Cys Gly Leu Lys Thr Arg Gly Trp Pro Glu
Thr 725 730 735Arg Ala Ala Leu Ala Asn Met Val Gln Ala Ala Gln Asn
Leu Arg Arg 740 745 750Gly21758PRTThermosynechococcus elongatus
21Met Thr Ile Gln Thr Ala Thr Leu Gly Tyr Pro Arg Ile Gly Lys Asn1
5 10 15Arg Glu Leu Lys Lys Ala Leu Glu Ala Phe Trp Ser Asn Gln Leu
Asp 20 25 30Ala Glu Ala Leu Leu Lys Thr Ala Gln Asp Ile Glu Leu Gln
Asn Trp 35 40 45Gln Lys Gln Leu Glu Val Gly Ile Asp Arg Ile Gly Ile
Gly Asp Leu 50 55 60Ser Leu Tyr Asp Ser Val Leu Asp Trp Ser Ile Arg
Phe Gly Ile Ile65 70 75 80Pro Glu Arg Tyr Arg Ser Phe Thr Gly Leu
Glu Gln Tyr Phe Ala Met 85 90 95Ala Arg Gly Lys Asp Gly Ile Pro Ala
Leu Glu Met Thr Lys Trp Phe 100 105 110Asp Thr Asn Tyr His Tyr Leu
Val Pro Glu Ile Ser Glu Ala Phe Gln 115 120 125Pro Thr Asp Phe Ser
Asp Phe Leu Glu Thr Val Arg Arg Ala Gln Thr 130 135 140Leu Leu Gly
Asp Arg Ala Val Pro Ile Val Leu Gly Pro Leu Thr Leu145 150 155
160Leu Arg Leu Ser Arg Leu Glu Thr Asn Leu Glu Gln Ala Val Ser Tyr
165 170 175Leu Arg Asp Arg Tyr Leu Ile Leu Leu Arg Glu Leu Lys Asn
Leu Gly 180 185 190Val Val Glu Val Gln Ile His Glu Pro Ala Leu Val
Leu Glu Glu Ala 195 200 205Asp Ser Phe Lys Ser Phe Tyr Gln Ser Thr
Phe Asp Thr Leu Arg Gln 210 215 220Ala Asn Leu Pro Leu His Leu Val
Thr Tyr Phe Asp Asp Leu Gly Ala225 230 235 240Ala Trp Pro Trp Val
Met Glu Leu Pro Val Thr Cys Ile Ser Leu Asp 245 250 255Phe Thr Arg
Gly His Asn Leu Ala Leu Leu Lys Glu Tyr Gly Phe Pro 260 265 270Ala
Asp Lys Gln Leu Gly Val Gly Ile Ile Asp Gly Arg Asn Ile Trp 275 280
285Lys Ile Arg Pro Glu Ser Val Leu Ser Thr Leu Glu Thr Ile Gln Ser
290 295 300Ile Thr Ala Asn Ile Arg Leu His Pro Ser Ser Ser Leu Gln
Phe Val305 310 315 320Pro Tyr Asp Ala Lys Arg Glu Val Lys Leu Pro
Glu Pro Leu Arg Asp 325 330 335Val Leu Ser Phe Ala Glu Gln Lys Leu
Asp Glu Val Val Leu Leu Ala 340 345 350Arg Val Leu Asn Ser Asn Asp
Gly Thr Asn Arg Glu Ile Leu Met Lys 355 360 365Asn Pro Glu Leu Thr
Ala Ile Gln Ala Gln Trp Lys Ala Phe Glu Gln 370 375 380Phe Ser Pro
Val Asn Pro Thr Val Gln Ala Arg Leu Arg Asn Leu Ser385 390 395
400Val Arg Asp Leu Glu Arg Pro Leu Pro Tyr Glu Gln Arg Arg Thr Leu
405 410 415Gln Pro Thr Leu Pro Pro Leu Pro Thr Thr Thr Ile Gly Ser
Phe Pro 420 425 430Gln Thr Ala Glu Val Arg Gln Leu Arg Val Lys Leu
Lys Arg His Glu 435 440 445Ile Thr Gln Ala Glu Tyr Glu Ala Ala Ile
Asp Glu Glu Ile Ala Lys 450 455 460Cys Val Arg Leu Gln Glu Glu Val
Gly Leu Asp Val Leu Val His Gly465 470 475 480Glu Phe Glu Arg Ser
Asp Met Val Glu Phe Phe Gly Gln Gln Leu Ser 485 490 495Gly Phe Ala
Phe Thr Glu His Gly Trp Val Gln Ser Tyr Gly Ser Arg 500 505 510Cys
Val Arg Pro Pro Ile Ile Tyr Gly Asp Ile Ala Arg Pro Gln Pro 515 520
525Met Thr Val Arg Glu Phe Lys Val Ala Gln Ser Leu Thr Asp Lys Ile
530 535 540Val Lys Ala Met Leu Thr Gly Pro Val Thr Met Ile Asn Trp
Ser Phe545 550 555 560Thr Arg Thr Asp Ile Pro Arg Ser Glu Gln Ala
Met Gln Ile Ala Leu 565 570 575Ala Leu Arg Asp Glu Val Ala Asp Leu
Glu Ala Ala Gly Ala Lys Met 580 585 590Ile Gln Ile Asp Glu Pro Ala
Leu Arg Glu Gly Leu Pro Leu Lys Ala 595 600 605Glu Arg Trp Asn Glu
Tyr Leu Ser Trp Ala Val Asp Ala Phe Arg Leu 610 615 620Ala Ala Gly
Val Ala Lys Pro Glu Thr Gln Ile His Thr His Met Cys625 630 635
640Tyr Ser Glu Phe Gly Asp Ile Ile Glu His Ile Glu Arg Leu Asp Ala
645 650 655Asp Val Leu Ser Ile Glu Asn Ser Arg Ser Asn Asn Glu Thr
Leu Phe 660 665 670Gln Ile Thr Asp Ala Gly Tyr Arg His Gln Val Gly
Val Gly Val Tyr 675 680 685Asp Val His Ser Pro Ala Val Pro Ser Val
Glu Gln Leu Val Gln Gln 690 695 700Leu Arg Thr Ser Val Ala Asn Leu
Ala Pro Glu Gln Ile Trp Val Asn705 710 715 720Pro Asp Cys Gly Leu
Lys Thr Arg His Trp Glu Glu Val Ile Pro Ser 725 730 735Leu Lys Asn
Met Val Glu Ala Thr Lys Thr Ile Arg Gln Glu Val Met 740 745 750Gln
Ser Lys Asn Asn Ala 75522734PRTThermotoga maritima 22Met Lys Ala
Tyr Ala Phe Gly Phe Pro Lys Ile Gly Glu Lys Arg Glu1 5 10 15Phe Lys
Lys Ala Leu Glu Asp Phe Trp Lys Gly Lys Ile Thr Glu Glu 20 25 30Gln
Phe Glu Glu Glu Met Asn Lys Leu Arg Met Tyr Met Val Glu Asn 35 40
45Tyr Arg Lys Asn Val Asp Val Ile Pro Ser Asn Glu Leu Ser Tyr Tyr
50 55 60Asp Phe Val Leu Asp Thr Ala Val Met Val Gly Ala Val Pro Glu
Arg65 70 75 80Phe Gly Glu Tyr Arg Gly Leu Ser Thr Tyr Phe Asp Met
Ala Arg Gly 85 90 95Gly Lys Ala Leu Glu Met Thr Lys Phe Phe Asn Thr
Asn Tyr His Tyr 100 105 110Leu Val Pro Glu Ile Glu Thr Glu Glu Phe
Tyr Leu Leu Glu Asn Lys 115 120 125Pro Leu Glu Asp Tyr Leu Phe Phe
Lys Ser Lys Gly Ile Glu Thr Ala 130 135 140Pro Trp Val Ile Gly Pro
Phe Thr Phe Leu Tyr Leu Ser Lys Arg Asn145 150 155 160Gly Glu Trp
Ile Arg Arg Pro Asn Gln Met Glu Lys Leu Leu Glu Ser 165 170 175Leu
Val Ser Val Tyr Lys Glu Val Phe Glu Lys Leu Val Glu Asn Gly 180 185
190Cys Lys Glu Ile Leu Val Asn Glu Pro Ala Phe Val Cys Asp Leu Glu
195 200 205Lys Ala His Trp Asp Leu Ile Leu Asn Val Tyr Arg Glu Leu
Ser Glu 210 215 220Phe Pro Leu Thr Val Phe Thr Tyr Tyr Asp Ser Val
Ser Asp Tyr Glu225 230 235 240Ala Cys Val Ser Leu Pro Val Lys Arg
Leu His Phe Asp Phe Val Ser 245 250 255Asn Glu Glu Asn Leu
Lys Asn Leu Glu Lys His Gly Phe Pro Glu Asp 260 265 270Lys Lys Leu
Val Ala Gly Val Ile Asn Gly Arg Gln Pro Trp Lys Val 275 280 285Asp
Leu Arg Lys Val Ala Ser Leu Val Glu Lys Leu Gly Ala Ser Ala 290 295
300Ile Ser Asn Ser Cys Pro Leu Phe His Leu Pro Val Thr Leu Glu
Leu305 310 315 320Glu Asn Asn Leu Pro Gly Gly Leu Lys Glu Lys Leu
Ala Phe Ala Lys 325 330 335Glu Lys Leu Glu Glu Leu Lys Met Leu Lys
Asp Phe Leu Glu Gly Lys 340 345 350Thr Phe Asp Leu Pro Asn Val Ser
Phe Glu Asp Phe Ala Val Asp Leu 355 360 365Gln Ala Val Glu Arg Val
Arg Asn Leu Pro Glu Asp Ser Phe Arg Arg 370 375 380Glu Lys Glu Tyr
Thr Glu Arg Asp Arg Ile Gln Arg Glu Arg Leu Asn385 390 395 400Leu
Pro Leu Phe Pro Thr Thr Thr Ile Gly Ser Phe Pro Gln Thr Pro 405 410
415Glu Val Arg Lys Met Arg Ser Lys Tyr Arg Lys Gly Glu Ile Ser Lys
420 425 430Glu Glu Tyr Glu Ala Phe Ile Lys Glu Gln Ile Lys Lys Ala
Ile Glu 435 440 445Leu Gln Glu Glu Ile Gly Leu Asp Val Leu Val His
Gly Glu Phe Glu 450 455 460Arg Thr Asp Met Val Glu Phe Phe Ala Glu
Lys Leu Asn Gly Ile Ala465 470 475 480Thr Thr Gln Asn Gly Trp Val
Leu Ser Tyr Gly Ser Arg Cys Tyr Arg 485 490 495Pro Pro Ile Ile Tyr
Gly Thr Val Thr Arg Pro Glu Pro Met Thr Leu 500 505 510Lys Glu Ile
Thr Tyr Ala Gln Ser Leu Thr Glu Lys Pro Val Lys Gly 515 520 525Met
Leu Thr Gly Pro Val Thr Ile Met Ser Trp Ser Tyr Tyr Arg Glu 530 535
540Asp Ile Pro Glu Arg Glu Ile Ala Tyr Gln Ile Ala Leu Ala Ile
Asn545 550 555 560Glu Glu Val Lys Asp Leu Glu Glu Ala Gly Ile Lys
Ile Val Gln Ile 565 570 575Asp Glu Pro Ala Phe Arg Glu Lys Ala Pro
Ile Lys Lys Ser Lys Trp 580 585 590Pro Glu Tyr Phe Glu Trp Ala Ile
Asn Ala Phe Asn Leu Ala Ala Asn 595 600 605Ala Arg Pro Glu Thr Gln
Ile His Ala His Met Cys Tyr Ser Asp Phe 610 615 620Asn Glu Ile Ile
Glu Tyr Ile His Gln Leu Glu Phe Asp Val Ile Ser625 630 635 640Ile
Glu Ala Ser Arg Ser Lys Gly Glu Ile Ile Ser Ala Phe Glu Asn 645 650
655Phe Lys Gly Trp Ile Lys Gln Ile Gly Val Gly Val Trp Asp Ile His
660 665 670Ser Pro Ala Val Pro Ser Ile Asn Glu Met Arg Glu Ile Val
Glu Arg 675 680 685Val Leu Arg Val Leu Pro Lys Glu Leu Ile Trp Ile
Asn Pro Asp Cys 690 695 700Gly Leu Lys Thr Arg Asn Trp Asp Glu Val
Ile Pro Ser Leu Arg Asn705 710 715 720Met Val Ala Leu Ala Lys Glu
Met Arg Glu Lys Phe Glu Ser 725 730
* * * * *
References