Diagnosis Of Hereditary Spastic Paraplegias (hsp) By Identification Of A Mutation In The Zfyve26 Gene Or Protein

Abstract

The Invention relates to an ex vivo method of diagnosing or predicting a hereditary spastic paraplegias (HSP), in a subject, which method comprises detecting a mutation in the ZFYVE26 gene or protein (spastizin), wherein said mutation is indicative of a hereditary spastic paraplegias (HSP).

Description

FIELD OF THE INVENTION

[0001] The invention relates to the identification of mutations in the ZFYVE26 gene or protein, associated with a hereditary spastic paraplegias (HSP), and to diagnostic applications that benefit from this identification.

BACKGROUND OF THE INVENTION

[0002] Hereditary spastic paraplegias (HSP) are genetically heterogeneous Mendelian disorders characterized by weakness, spasticity and loss of vibratory sense in the lower limbs (Harding et al. 1983; Tallaksen et al. 2001; Fink et al, 2006; Depienne et al, 2007; Stevanin et al, 2008). They reveal themselves clinically through difficulties in walking possibly evolving into total paralysis of both legs. The physiopathology of this set of diseases is, to date, relatively undocumented; however, anatomopathological data make it possible to conclude that the attack in pure forms of the disease is limited to the pyramidal tracts responsible for voluntary motricity in the spinal cord. The incidence of HSPs, which remains difficult to estimate because of rare epidemiological studies and the considerable clinical variability, varies from 0.9:100000 in Denmark, 3 to 9.6:100000 in certain regions of Spain (Polo et al., 1991) 5:100000 in South-Tunisia (Boukrhis et al, 2009) or 14:100000 in Norway (Skre, 1974) (approximately 3:100000 in France). Various clinical and genetic forms of HSP exist. The so-called "pure" HSPs, which correspond to isolated spasticity of the lower limbs, are clinically distinguished from the "complex" HSPs, for which the spasticity of the legs is associated with other clinical signs of neurological or non-neurological type.

[0003] Although forms of HSP have been recognized for over a century, new phenotypes are regularly described, demonstrating wide clinical heterogeneity. Genetically, autosomal dominant (AD), autosomal recessive (AR) and X-linked inheritance are observed and almost 34 genetic loci have been identified, but only 17 genes have been cloned (Depienne et al, 2007; Stevanin et al, 2008a). According to the putative roles of these genes, mitochondrial function, protein folding, abnormal development, cholesterol/neurosteroid metabolism and axonal transport have been implicated in the dying back of pyramidal tract axons in these disorders (Stevanin et al, 2008a).

[0004] The most common forms of AD-HSP, accounting for about 40-50% of cases (Depienne et al, 2007; Stevanin et al, 2008a), are caused by mutations in the SPG4 and SPG3A genes that encode for spastin and atlastin, respectively (Hazan et al. 1990, Zhao et al. 2001 and international patent application WO 01/18198). In AR-HSP, which is less common and more varied in clinical presentation, greater genetic heterogeneity is expected but SPG11 (patent application No. 06 291 433.8) was found to be frequently mutated, accounting for .about.21% of all ARHSP, but up to 59% of ARHSP with thin corpus callosum and mental impairment (Stevanin et al, 2007 and 2008b). The five other AR-HSP genes cloned so far (details are available on the "Online Mendelien Inheritance in Man" database at http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=OMIM), encoding for CYP7B1 (SPG5, MIM#270800, Tsaousidou et al. 2008), paraplegin (SPG7, MIM#607259, Casari et al. 1998), spartin (SPG20; MIM#275900, Patel et al. 2002) and maspardin (SPG21, MIM 248900, Simpson et al. 2003) as well as the gene responsible for the related spastic ataxia of Charlevoix Saguenay (ARSACS, MIM#270550, Engert et al. 2000) probably represent less than 10% of all cases (Depienne et al, 2007; Stevanin et al, 2008a).

[0005] In a clinical point of view, a very common form of AR-HSP associates spastic paraplegia, mental or cognitive deficit and thin corpus callosum (Martinez et al 1999, Shibasaki et al. 2000, Casali et al. 2004, Winner et al. 2004 and 2005, Lossos et al. 2006, Stevanin et al. 2006, Franca et al, 2007, Boukhris et al 2008a). The majority of the families appear to be linked to the SPG11 gene (Stevanin et al, 2007, Stevanin et al, 2008b). In the patent application No. 06 291 433.8 related to this SPG11 gene, the inventors claimed to have identified a gene responsible for a frequent form of Autosomal Recessive Hereditary Spastic Paraplegia (AR-HSP). They have indeed demonstrated that the disease is caused by mutations in the KIAA1840 gene (also known as FLJ21439), affecting the spatacsin protein expression, which was further confirmed independently by other groups (for review, see Stevanin et al, 2008a). The typical clinical features of this disease consist of early-onset spastic paraplegia (usually <20 years), urinary bladder dysfunction, deep sensory deficits in the legs and cognitive impairment that progress insidiously to severe functional disability over a period of 10-20 years (Winner et al, 2005; Franca et al, 2007, Boukhris et al 2008a). Some patients also develop arm involvement, dysarthria, contractures and muscle atrophy. Auxiliary studies frequently identify a thin corpus callosum (TCC) with white matter lesions and variable cerebral cortical atrophy on magnetic resonance imaging (MRI), variable cortical and thalamic glucose hypometabolism on positron emission tomography and predominantly axonal motor or sensorimotor peripheral neuropathy on nerve conduction studies (Winner et al. 2004).

[0006] Other loci have been found associated with this phenotype however: SPG15 (Hughes et al 2000), SPG21 (Simpson et al, 2003), HSP with epilepsy (Al-Yahyaee, 2006) and occasionally SPG7 (Coutinho et al, 1999) or SPG4 (Orlacchio et al, 2004). More particularly, SPG15 was thought to be a rare form of spastic paraplegia associated with pigmentary maculopathy, also known as the Kjellin syndrome (MIM 270700, www.ncbi.nlm.nih.gov/omim/), when it was mapped in two Irish families to a region of 16 Mb on chromosome 14q (Hughes et al, 2000). Recently, the inventors identified 7 families linked to SPG15 locus (Elleuch et al, 2007; Boukhris et al, 2008a and 2008b); Muglia et al, submitted), reduced its size to 5.3 Mb between markers D14S981 and rs8688 (Elleuch et al, 2007) then between markers VNTR25TG (identified in the human genome sequence by the inventors, primers in the table 4) and D14S1029 (FIG. 1) and estimated its frequency to 15% of ARHSP (Elleuch et al, 2007). In addition, the inventors showed that the clinical features varied among patients and families, but cognitive impairment with distal amyotrophy were frequently associated. Peripheral neuropathy, thin corpus callosum, maculopathy and cerebellar ataxia were also observed in some but not all patients (Elleuch et al, 2007, Boukhris et al, 2008a and 2008b). Therefore, SPG15 is expected to account for a significant proportion of the very common sub-form of ARHSP associating mental or cognitive deficits and thin corpus callosum, as SPG11, but could also account for other forms of ARHSP since all features of this clinical entity can be absent in certain families.

SUMMARY OF THE INVENTION

[0007] The inventors have now identified a new gene responsible for a complicated Autosomal Recessive Hereditary Spastic Paraplegia (AR-HSP). They have indeed demonstrated that the disease is caused by mutations in the ZFYVE26 gene (also known as KIAA0321), which are located at various positions along the gene (FIG. 2) and segregate with the HSP (FIGS. 3 to 10) by affecting the spastizin protein expression, structure or stability. Eighteen mutations were identified by the inventors in 16 unrelated families, including those previously published by the inventors as linked and that were used to restrict the candidate interval (Elleuch et al, 2007, Boukhris et al, 2008a and 2008b, FIG. 1).

[0008] The invention therefore provides the identification of a frequent gene responsible of AR-HSPs and opens thereby new opportunities to improve diagnosis and genetic counselling of said disease. Moreover, the invention also provides a mean to improve the medical care management of patient affected with said disease. In addition, since most patients with spastic paraplegia have isolated forms, it is conceivable that this new gene could account for a small proportion of these patients as well. Indeed, in Europe, due to the small size of the families, recessively inherited diseases are often found in apparently isolated cases.

[0009] A first aspect of the invention thus relates to an ex vivo method of diagnosing or predicting a hereditary spastic paraplegias (HSP), in a subject, which method comprises detecting a mutation in the ZFYVE26 gene or protein (spastizin), wherein said mutation is indicative of a hereditary spastic paraplegias (HSP).

[0010] A second aspect of the invention relates to an isolated nucleic acid specifically hybridizable to a region of ZFYVE26 gene that contains a mutation selected from the group consisting of: [0011] the substitutions: c.307G>T, c.427G>T, c.1240G>T, c.1477C>T, c.2182C>T, c.4312C>T, c.5422C>T, c.5791-6G>A/r.5791.sub.--5792ins5791-4.sub.--5791-1, c.5485-1G>A (predicted to alter splicing), c.7128+2T>A/r.6987.sub.--7128del, c.6011G>C (predicated to alter splicing), [0012] the deletions: c.2049delT, c.4068.sub.--4069delTG, c.5036delT, c.6702.sub.--6771del, [0013] the insertions: c.2331.sub.--2332insA, c.6296.sub.--6297insT, [0014] the complex rearrangement: g.67316025.sub.--67319414del/g.67316025.sub.--67316026insTCTA/g.67319319.- sub.--67319414i nv. Such an isolated nucleic acid can be used as a primer or probe.

[0015] More preferentially the invention relates to an isolated nucleic acid, which comprises a ZFYVE26 gene or cDNA or mRNA sequence that contains one or several mutation(s) selected from the group consisting of [0016] the substitutions: c.307G>T, c.427G>T, c.1240G>T, c.1477C>T, c.2182C>T, c.4312C>T, c.5422C>T, c.5791-6G>A/r.5791.sub.--5792ins5791-4.sub.--5791-1, c.5485-1G>A (predicted to alter splicing), c.7128+2T>A/r.6987.sub.--7128del, c.6011G>C (predicated to alter splicing), [0017] the deletions: c.2049delT, c.4068.sub.--4069delTG, c.5036delT, c.6702.sub.--6771del, [0018] the insertions: c.2331.sub.--2332insA, c.6296.sub.--6297insT, [0019] the complex rearrangement: g.67316025.sub.--67319414del/g.67316025.sub.--67316026insTCTA/g.67319319.- sub.--67319414i nv.

[0020] Another aspect of the invention relates to an isolated polypeptide which comprises the amino acid sequence of the spastizin or ZFYVE26 protein containing one or several mutation(s) selected from the group consisting of p.E103X, p.E143X, p.E414X, p.Q493X, p.F683LfsX685, p.R728X, p.D778RfsX793, p.R1209fsX1220, p.C1356fsX1356, p.R1438X, p.L1679RfsX1687, p.Q1808X, p.A1931PfxX1957X, p.S2004T, p.L2099LfsX2111, p.W2234CfsX2238, p.R2329RfsX2337 and those resulting from aberrant splicing identified by the inventors but for which the consequence on the protein, although clearly deleterious in silico since affecting splicing consensus sequences, could not be verified because of the absence of patient's cells for their analysis up to now (c.5485-1G>A, c.6011G>C). In addition, it should be noted that the consequence of the 6011G>C mutation might result in a missense substitution (p.S2004T) and/or of aberrant splicing (since affecting the last codon of an exon and predicted in silico to strongly alter splicing) or both.

[0021] Another aspect of the invention relates to an isolated monoclonal or polyclonal antibody that specifically recognizes a ZFYVE26 protein containing a mutation selected from the group consisting of p.E103X, p.E143X, p.E414X, p.Q493X, p.F683LfsX685, p.R728X, p.D778RfsX793, p.R1209fsX1220, p.C1356fsX1356, p.R1438X, p.L1679RfsX1687, p.Q1808X, p.A1931PfxX1957X, p.S2004T, p.L2099LfsX2111, p.W2234CfsX2238, p.R2329RfsX2337 and those resulting from aberrant splicing identified by the inventors but for which the consequence on the protein, although clearly deleterious in silico since affecting splicing consensus sequences, could not be verified because of the absence of patient's cells for their analysis up to now (c.5485-1G>A, c.6011G>C).

[0022] Another aspect of the present invention relates to the use of a monoclonal or polyclonal antibody recognizing the wild type protein to identify truncated forms of the protein spastizin.

DETAILED DESCRIPTION OF THE INVENTION

Definitions

[0023] A "coding sequence" or a sequence "encoding" an expression product, such as a RNA, polypeptide, protein, or enzyme, is a nucleotide sequence that, when expressed, results in the production of that RNA, polypeptide, protein, or enzyme, i.e., the nucleotide sequence encodes an amino acid sequence for that polypeptide, protein or enzyme. A coding sequence for a protein may include a start codon (usually ATG) and a stop codon.

[0024] The term "gene" means a DNA sequence that codes for or corresponds to a particular sequence of amino acids which comprise all or part of one or more proteins or enzymes, and may or may not include regulatory DNA sequences, such as promoter sequences, which determine for example the conditions under which the gene is expressed. Some genes, which are not structural genes, may be transcribed from DNA to RNA, but are not translated into an amino acid sequence. Other genes may function as regulators of structural genes or as regulators of DNA transcription. In particular, the term gene may be intended for the genomic sequence encoding a protein, i.e. a sequence comprising regulator, promoter, intron and exon sequences.

[0025] As used herein, the term "oligonucleotide" refers to a nucleic acid, generally of at least 10, preferably at least 15, and more preferably at least 20 nucleotides, preferably no more than 100 nucleotides, still preferably no more than 70 nucleotides, and which is hybridizable to a ZFYVE26 genomic DNA, cDNA, or mRNA. Oligonucleotides can be labelled according to any technique known in the art, such as with radiolabels, fluorescent labels, enzymatic labels, sequence tags, etc. A labelled oligonucleotide may be used as a probe to detect the presence of a mutated ZFYVE26 nucleic acid. Alternatively, oligonucleotides (one or both of which may be labelled) can be used for amplifying a ZFYVE26 nucleic acid, for instance by PCR (Saiki et al., 1988), to detect the presence of a mutation. Generally, oligonucleotides are prepared synthetically, preferably on a nucleic acid synthesizer. Accordingly, oligonucleotides can be prepared with non-naturally occurring phosphoester analog bonds, such as thioester bonds, etc.

[0026] A nucleic acid molecule is "hybridizable" or "hybridizes" to another nucleic acid molecule, such as a cDNA, genomic DNA, or RNA, when a single stranded form of the nucleic acid molecule can anneal to the other nucleic acid molecule under the appropriate conditions of temperature and solution ionic strength (Sambrook et al., 1989).

[0027] The conditions of temperature and ionic strength determine the "stringency" of the hybridization. For preliminary screening for homologous nucleic acids, low stringency hybridization conditions, corresponding to a Tm (melting temperature) of 55.degree. C., can be used, e.g., 5.times.SSC, 0.1% SDS, 0.25% milk, and no formamide; or 30% formamide, 5.times.SSC, 0.5% SDS). Moderate stringency hybridization conditions correspond to a higher Tm, e.g., 40% formamide, with 5.times. or 6.times.SCC. High stringency hybridization conditions correspond to the highest Tm, e.g., 50% formamide, 5.times. or 6.times.SCC. SCC is a 0.15 M NaCl, 0.015 M Na-citrate. Hybridization requires that the two nucleic acids contain complementary sequences, although depending on the stringency of the hybridization, mismatches between bases are possible. The appropriate stringency for hybridizing nucleic acids depends on the length of the nucleic acids and the degree of complementation, variables well known in the art. The greater the degree of similarity or homology between two nucleotide sequences, the greater the value of Tm for hybrids of nucleic acids having those sequences. The relative stability (corresponding to higher Tm) of nucleic acid hybridizations decreases in the following order: RNA:RNA, DNA:RNA, DNA:DNA. For hybrids of greater than 100 nucleotides in length, equations for calculating Tm have been derived (see Sambrook et al., 1989, 9.50-9.51). For hybridization with shorter nucleic acids, i.e., oligonucleotides, the position of mismatches becomes more important, and the length of the oligonucleotide determines its specificity (see Sambrook et al., 1989 I1.7-11.8). A minimum length for a hybridizable nucleic acid is at least about 10 nucleotides, preferably at least about 15 nucleotides, and more preferably the length is at least about 20 nucleotides.

[0028] In a specific embodiment, the term "standard hybridization conditions" refers to a Tm of 55.degree. C., and utilizes conditions as set forth above. In a preferred embodiment, the Tm is 60.degree. C. In a more preferred embodiment, the Tm is 65.degree. C. In a specific embodiment, "high stringency" refers to hybridization and/or washing conditions at 68.degree. C. in 0.2.times.SSC, at 42.degree. C. in 50% formamide, 4.times.SSC, or under conditions that afford levels of hybridization equivalent to those observed under either of these two conditions.

[0029] As used herein, an "amplification primer" is an oligonucleotide for amplification of a target sequence by extension of the oligonucleotide after hybridization to the target sequence or by ligation of multiple oligonucleotides, which are adjacent when hybridized to the target sequence. At least a portion of the amplification primer hybridizes to the target. This portion is referred to as the target binding sequence and it determines the target-specificity of the primer. In addition to the target binding sequence, certain amplification methods require specialized non-target binding sequences in the amplification primer. These specialized sequences are necessary for the amplification reaction to proceed and typically serve to append the specialized sequence to the target. For example, the amplification primers used in Strand Displacement Amplification (SDA) include a restriction endonuclease recognition site 5' to the target binding sequence (U.S. Pat. No. 5,455,166 and U.S. Pat. No. 5,270,184). Nucleic Acid Based Amplification (NASBA), self-sustaining sequence replication (3SR) and transcription based amplification primers require an RNA polymerase promoter linked to the target binding sequence of the primer. Linking such specialized sequences to a target binding sequence for use in a selected amplification reaction is routine in the art. In contrast, amplification methods such as PCR, which do not require specialized sequences at the ends of the target, generally employ amplification primers consisting of only target binding sequence.

[0030] As used herein, the terms "primer" and "probe" refer to the function of the oligonucleotide. A primer is typically extended by polymerase or ligation following hybridization to the target but a probe typically is not. A hybridized oligonucleotide may function as a probe if it is used to capture or detect a target sequence, and the same oligonucleotide may function as a primer when it is employed as a target binding sequence in an amplification primer. It will therefore be appreciated that any of the target binding sequences disclosed herein for amplification, detection or quantisation of ZFYVE26 may be used either as hybridization probes or as target binding sequences in primers for detection or amplification, optionally linked to a specialized sequence required by the selected amplification reaction or to facilitate detection.

[0031] As used herein, the terms "ZFYVE26 gene" (or its synonyms: SPG15, KIAA0321) denotes the ZFYVE26 gene of any species, especially human, but also other mammals or vertebrates to which the methods of the invention can apply. The human ZFYVE26 gene encodes a large protein of 2539 amino-acids (aa) of unknown function that the inventors have named Spastizin (SPASTIcity due to the ZFYVE26 proteIN) (SEQ ID NO: 2). Homo sapiens ZFYVE26 gene consists of 42 exons (Table 1) covering a genomic region of 70,064 bp (deposited in Genbank under accession number NC.sub.--000014, see Table 1) localized on chromosome 14q24.1 (FIG. 2), and its Coding Sequence (CDS) of 7,620 bp (exons 2-42) is deposited in Genebank under accession number NM.sub.--015346 (SEQ ID NO: 1) and in Ensembl (ENSG00000072121). Its expression in human tissues is ubiquitous (FIG. 11) and its brain expression pattern in rats (FIG. 12) closely resembles the one of SPG11, another gene responsible for a similar disease (Stevanin et al, 2007).

[0032] The ZFYVE26 protein, belongs to the FYVE-finger family, which includes more than 30 different members in mammals, including ZFYVE27 (Gillooly et al. 2001, Seet et al, 2001; Mannan et al, 2006). The FYVE domain is a highly conserved zinc-finger binding domain characterized by the presence of eight conserved cysteine residues, the third of which is flanked by characteristic basic amino acids: CX.sub.2CX.sub.9-39RRHHCRXCX.sub.4CX.sub.2-6CX.sub.4-48CX.sub.2C (where X represents non-conserved amino acid residues) and is suggested to bind the FYVE-finger proteins to endosomes. The majority of FYVE-finger proteins is involved in interactions with different forms of phosphoinositides and serve as regulators of endocytic membrane trafficking (Gillooly et al, 2001). All mutations identified by the inventors in the SPG15 families (FIGS. 3 to 10) appear to truncate this domain either because clearly located before it (FIG. 2), or because as non-sense mutations the mRNA of ZFYVE26 will be probably subjected to non-sense mediated mRNA decay, a well known mechanism of mRNA regulation and degradation in mammals (Frischmeyer et al. 1999, Amrani et al. 2006). In one case (c.6011G>C), the mutation is predicted to affect splicing and to produce amissense variation at the protein level (p.S2004T) (no mRNA of the corresponding patient was available to confirm the consequence on splicing). All mutations are thus expected to result in alteration of endosomal trafficking. Indeed, by overexpression in vitro in COS-7 cells, the inventors have shown that the epitope-tagged wild-type spastizin colocalized with endosomal markers, but not with markers of the Golgi, lysosomes, mitochondria or endoplasmic reticulum (FIG. 6).

TABLE-US-00001 TABLE 1 Partial genomic sequence from chromosome 14 reference assembly NC000014 with full exon composition and exon-intron boundaries of the human ZFYVE26 gene (according to the Ensembl database: ENSG00000072121) Position in the genomic sequence of chromosome Length Reference of 14 in in base Exon exon/Intron base pairs pairs Sequence 5' upstream ..........tgtcaccacccccaccaccgctgttcggagtgggttctgtc sequence acctgactc 1 ENSE00001355414 67,353,004 67,353,055 52 GGCTCAAACATGGCTGCGCTGAGAGCTCTATTGCTTTGGGCGCCGGGAGCAG Intron 1-2 67,352,517 67,353,003 487 gtgagtgtaagacacccctgagagg..........ctcactggcgttgtgtt gtttctag 2 ENSE00001338166 67,352,240 67,352,516 277 GAGGTACTCCGCGAATGAGAACATTGAGAATGTGTTCGGCATAACTCATTTC TTTGTATCTCCCTGCACTCTGTGCTGGGAAAATGAATCATCCATTTGGAAAA GAGGAAGCTGCTTCGCAGAAGCAGCTTTTTGGATTTTTCTGCGAATGCCTGC GGAGGGGAGAATGGGAGCTGGCAC AGGCATGTGTACCTCAGCTACAGGAGGGACAAGGGGATATCCCAAAGAGGGT AGAAGACA TACTTCAGGCATTGGTGGTGTGTCCAAATCTGCTGAG Intron 2-3 67,350,535 67,352,239 1,705 gtaagggatctcttttcctaccaga..........aagtctttctttttacc tttttcag 3 ENSE00001338165 67,350,456 67,350,534 79 ATGTGGGCAGGACATCAACCCTCAAAGAGTAGCCTGGGTCTGGCTTCTTGTA CTGGAGAAATGGTTGGCCCGGGAAAAG Intron 3-4 67,345,760 67,350,455 4,696 gtaagtaggtttatattaaattttc..........tgcttcattcttttgat tcttctag 4 ENSE00001338164 67,345,670 67,345,759 90 AAGTTACTCCCAGTTGTTTTCCGGAGAAAGCTTGAGTTTCTTTTATTGTCAG AAGACCTCCAAGGTGACATTCCAGAGAACATCCTCGAG Intron 4-5 67,344,391 67,345,669 1,279 gtgagagagagccctggtaccatct..........atccttttcttcatcct ctatttag 5 ENSE00001338163 67,343,868 67,344,390 523 GAGCTGTATGAGACCTTAACACAGGGTGCAGTAGGCCACGTGCCTGACGGAA ATCCAAGGAGGGAGAGCTGGACTCCTCGTCTCAGCTCCGAAGCTGTCTCTGT GCTCTGGGATCTCCTGAGGCAGTCTCCCCAGCCAGCACAGGCCCTGCTGGAG CTCCTGCTTGAGGAGGATGACGGTACTGGCCTCTGTCACTGGCCTCTGCAGA ATGCACTGGTGGACCTCATTCGAAAGGCATTGCGGGCTTTGCAGGGCCCTGA TTCGGTGCCCCCTGGGGTAGTCGATGCCATCTATGGAGCCCTGCGGACTCTG CGTTGCCCCGCAGAACCACTTGGGGTTGAGTTGCATCTCCTGTGTGAGGAAC TACTAGAGGCCTGCAGGACCGAGGGGAGTCCCCTGCGGGAGGAGCGGCTGCT CAGCTGCCTGCTGCACAAGGCCAGCCGGGGCCTGCTGTCCCTGTATGGCCAT ACCTATGCAGAGAAGGTCACAGAAAAGCCACCGAGGGCTACAGCCTCGGGAA AAG Intron 5-6 67,343,146 67,343,867 722 gtgtgttccctttgctgctgctcct..........gataaccgtcttgtttg atgttcag 6 ENSE00001338160 67,343,015 67,343,145 131 TCTCACCGGATCATCTAGATCCTGAGCGGGCAATGCTAGCCCTGTTCTCCAA TCCCAACCCAGCCGAGGCTTGGAAAGTGGCCTATTTCTACTGCCTGAGCAAC AACAAACACTTCCTCGAGCAGATTCTG Intron 6-7 67,342,089 67,343,014 926 gtaagtcaagcttaattgttcatca..........tataacagctttctttg acttacag 7 ENSE00001338158 67,341,924 67,342,088 165 GTAACAGCACTAACATTGTTGAAAGAAGAAGACTTCCCAAATCTTGGCTGCC TACTTGATAGAGAATTCAGGCCCCTCAGTTGCCTGCTTGTACTCCTGGGCTG GACACACTGCCAGAGCCTAGAGTCAGCCAAGAGGCTGCTCCAGACCCTGCAC AGGACCCAG Intron 7-8 67,341,776 67,341,923 148 gtaactctcactcagcatcccaggc..........tctttcttctcccatat caacatag 8 ENSE00001338155 67,341,687 67,341,775 89 GGCCCAGGCTGTGATGAGCTCCTCAGGGATGCCTGTGATGGGTTGTGGGCTC ACCTGGAGGTCCTGGAGTGGTGCATACAGCAGAGCAG Intron 8-9 67,340,735 67,341,686 952 gtatggccctgtgcagtcagcgcct..........ccatcctcccaactttt ccattcag 9 ENSE00001338153 67,340,571 67,340,734 164 CAACCCCATACCAAAGAGAGATCTGTTGTATCATTTACACGGTGGAGACAGC CACTCAGTGCTCTACACTCTCCATCACCTTACAAACCTTCCAGCCCTCAGGG AGGAAGATGTTCTCAAGCTCTTACAGAAAGTGCCAGCCAAGGACCCCCAGCA AGAGCCTG Intron 9-10 67,338,753 67,340,570 1,818 gtgagttgggatggaatgacctggc..........cagcctgtttctctttg taattcag 10 ENSE00001338151 67,338,549 67,338,752 204 ATGCAGTTGATGCTCCAGTCCCTGAGCACCTGAGCCAGTGTCAGAACCTGAC ACTCTACCAGGGCTTCTGTGCCATGAAGTATGCCATCTATGCCCTCTGTGTA AACTCACACCAGCACTCCCAGTGCCAGGACTGCAAAGACAGCCTCTCTGAGG ACCTGGCCTCAGCTACAGAGCCAGCGAATGACTCTCTCTCCTCCCCAG Intron 10-11 67,335,093 67,338,548 3,456 gtacagcacttccctccatccgtga..........tcttctcttgtacatgt ttttgtag 11 ENSE00001338147 67,334,484 67,335,092 609 GTGCTGCAAATCTCTTCTCAACTTACCTGGCCAGGTGTCAACAGTATCTGTG CAGTATTCCTGACTCTCTGTGCCTGGAGCTTCTGGAAAACATCTTCTCATTG CTTCTCATCACCTCTGCTGATCTTCACCCAGAGCCTCACTTGCCTGAGGACT ATGCTGAGGATGATGACATTGAGGGGAAGAGCCCCTCAGGTTTGAGGTCCCC ATCAGAGAGCCCTCAGCACATAGCACATCCTGAAAGGAAGTCAGAACGGGGT TCCCTGGGAGTCCCAAAGACCCTTGCTTATACAATGCCAAGCCATGTGAAGG CAGAGCCAAAAGACAGTTACCCAGGGCCTCATAGGCACAGCTTTTTGGACTT AAAACACTTTACTAGTGGTATCAGTGGATTTCTGGCTGATGAATTTGCAATA GGGGCCTTCCTCAGGCTTCTCCAAGAGCAACTGGATGAGATCAGTAGCCGCA GCCCTCCTGAGAAGCCAAAGCAAGAAAGTCAGAGCTGCTCAGGAAGCAGAGA TGGACTGCAGAGCCGCCTGCATCGACTTTCCAAGGTTGTCTCTGAGGCCCAG TGGAGACACAAGGTGGTGACAAGCAACCATCGTTCAG Intron 11-12 67,334,226 67,334,483 258 gtgagagaagggtggaactggtggg..........tgtcccattgggtttgc tctttcag 12 ENSE00001338145 67,334,142 67,334,225 84 AGGAGCAACCTTCCCGAAGATACCAGCCTGCCACACGTCACCCCAGTCTCCG CCGGGGTCGTCGGACAAGAAGGAGCCAGGCAG Intron 12-13 67,330,710 67,334,141 3,432 gtaatctgaagagctcattcccatg..........tctctcttcttcccaat acctgtag 13 ENSE00001338143 67,330,641 67,330,709 69 ATGGCCGAGACAGAGGTTCAAACCCATCCCTGGAAAGTACAAGTAGTGAGCT GAGCACAAGTACGTCAG Intron 13-14 67,330,230 67,330,640 411 gtatgcagatttccaccagttgcca..........cccacacattcttgtgt cccaacag 14 ENSE00001338141 67,330,078 67,330,229 152 AGGGAAGTCTGAGTGCCATGTCTGGCCGGAATGAGCTGCACAGTAGATTGCA CCCCCATCCTCAAAGTTCACTCATCCCCATGATGTTCTCCCCACCTGAGTCA CTGCTGGCATCCTGCATCCTTCGCGGGAACTTCGCAGAAGCCCATCAG Intron 14-15 67,327,244 67,330,077 2,834 gtgaggggaggccataccttttcag..........ccacacactccctctcc tatgacag 15 ENSE00001338140 67,327,042 67,327,243 202 GTGCTGTTCACGTTCAACCTGAAGTCCTCACCCAGTTCAGGGGAACTGATGT TCATGGAGCGCTACCAGGAAGTGATCCAAGAACTGGCCCAAGTAGAGCACAA GATTGAAAACCAGAACTCAGATGCGGGTAGCAGCACCATTCGGAGAACTGGC AGTGGCCGCTCAACTCTACAGGCCATTGGCAGCGCTGCAGCAGCAG Intron 15-16 67,326,069 67,327,041 973 gtcaggcttccctgctaacaccata..........ttttattcctctgctgg gcggccag 16 ENSE00001338139 67,325,805 67,326,068 264 GAATGGTGTTTTACTCTATCTCTGACGTGACTGACAAGCTGCTCAACACCTC TGGAGACCCCATCCCCATGCTCCAGGAGGACTTTTGGATAAGCACGGCTCTA GTGGAGCCCACTGCTCCCCTGAGAGAGGTTCTGGAAGACCTCAGTCCCCCTG CCATGGCTGCATTTGACCTAGCTTGCTCTCAGTGCCAGCTCTGGAAAACCTG CAAGCAGCTTTTGGAGACAGCCGAACGGCGTTTGAATAGTAGCCTTGAAAGG CGGG Intron 16-17 67,322,704 67,325,804 3,101 gtgagtgtgctgtgttagctgtatc..........tccctcttccttcatct atttccag 17 ENSE00000807790 67,322,584 67,322,703 120 GTCGACGGATAGACCACGTACTCCTAAATGCTGATGGCATTCGAGGTTTTCC AGTTGTTCTTCAGCAAATCAGTAAGAGTCTCAATTATCTGCTTATGTCAGCC AGTCAAACCAAATCAG Intron 17-18 67,322,493 67,322,583 91 gtgagttgcttttttctcttttctt..........tttctttctcatttgct ttccatag 18 ENSE00000658697 67,322,328 67,322,492 165 AGAGTGTGGAAGAAAAGGGAGGAGGCCCTCCACGGTGCAGCATCACTGAACT GCTTCAGATGTGCTGGCCCAGCCTAAGCGAGGACTGTGTTGCCAGCCACACC ACCCTCTCCCAGCAGCTAGATCAGGTCCTTCAGTCACTGAGAGAGGCACTAG AGCTGCCAG Intron 18-19 67,321,748 67,322,327 580 gtataaggctgtctgcttgggaaca..........ctttctcctgccatcct cctctcag 19 ENSE00000658696 67,321,529 67,321,747 219 AGCCCAGGACTCCTCCACTGTCTTCCCTGGTGGAGCAGGCAGCCCAGAAAGCT CCAGAGGCAGAGGCCCACCCTGTGCAGATCCAGACTCAGCTCCTCCAGAAGAA CCTGGGCAAACAGACCCCATCAGGCAGCAGGCAGATGGACTACTTGGGCACCT TCTTCAGTTACTGCAGCACCCTTGCTGCAGTTCTCCTTCAAAGTTTGAGCTCT GAGCCTG Intron 19-20 67,320,907 67,321,528 622 gtaggtagcaagaaagaggcaatag..........aagatcatgttctttacc tttgcag 20 ENSE00000658695 67,320,804 67,320,906 103 ATCATGTGGAGGTCAAGGTAGGAAATCCCTTTGTTCTGCTGCAACAGAGCTCT TCCCAACTGGTGTCACATCTCCTGTTTGAGAGACAAGTTCCCCCAGAGAG Intron 20-21 67,319,996 67,320,803 808 gtaggagccacctccatgcaagtca..........atgctttctgcttctctc cttccag 21 ENSE00000658694 67,319,250 67,319,995 746 ACTGGCAGCCCTTCTGGCCCAAGAGAATCTCAGCCTAAGTGTGCCACAGGTCA TCGTCAGCTGCTGCTGTGAGCCCCTTGCTCTTTGCTCATCCCGGCAAAGCCAG CAGACCTCCTCCCTCCTGACTCGTCTGGGTACTCTGGCCCAGCTACACGCCTC TCACTGCCTGGATGACCTCCCACTTTCTACACCGAGCTCCCCGAGGACAACTG AGAACCCTACATTGGAAAGAAAGCCCTACTCCTCCCCAAGGGACTCATCACTC CCAGCCCTCACCTCCTCTGCCTTGGCCTTTCTTAAGTCACGCTCAAAGCTCCT AGCTACGGTGGCCTGCCTGGGGGCTTCCCCGAGGTTAAAGGTCAGCAAACCCA GCTTGTCATGGAAGGAACTTCGTGGCCGCAGGGAGGTGCCTCTGGCTGCAGAG CAGGTAGCCCGGGAGTGTGAGCGCCTTCTGGAACAATTCCCTCTGTTTGAGGC CTTCCTCCTGGCTGCCTGGGAGCCCCTGCGAGGGTCTTTGCAGCAGGGGCAGA GTCTGGCAGTGAATCTCTGTGGTTGGGCCAGTCTTTCTACCGTTCTCCTGGGC CTACATTCTCCCATTGCCCTAGATGTACTGAGTGAGGCTTTTGAGGAATCCTT GGTGGCCAGAGATTGGTCCCGGGCCCTTCAGCTCACTGAAGTGTACGGGCGAG ATGTGGACGATTTGAGCAGCATAAAGGATGCAGTCCTGAGCTGTGCTGTGGCA TGTG Intron 21-22 67,318,000 67,319,249 1,250 gtgagcagaatgctatgcctccctt..........tctgagcatcttttttgt cttatag 22 ENSE00000658693 67,317,803 67,317,999 197 ACAAAGAAGGTTGGCAATACCTGTTTCCCGTGAAGGATGCATCTCTGAGAAGT CGGCTGGCCCTACAGTTTGTGGACAGGTGGCCCCTGGAGTCATGCCTGGAGAT TCTGGCCTACTGCATTTCAGACACGGCTGTCCAAGAAGGACTAAAGTGTGAGC TACAGAGGAAGCTGGCGGAGCTGCAGGTGTATCAGAAG Intron 22-23 67,316,816 67,317,802 987 gtatgggccctcgcatcaagagaaa..........gacggattttcttgtctt tccttag 23 ENSE00000658692 67,316,711 67,316,815 105 ATTCTGGGTTTGCAGTCTCCCCCAGTGTGGTGTGACTGGCAGACCTTGAGGAG CTGTTGTGTTGAGGACCCATCAACTGTCATGAACATGATTCTAGAAGCACAG Intron 23-24 67,314,719 67,316,710 1,992 gtaccgttttcctgggtggtgttcc..........tgaaggcatgtgtgtttc cttccag 24 ENSE00000658691 67,314,596 67,314,718 123 GAGTATGAACTGTGTGAAGAGTGGGGCTGCCTGTACCCCATTCCAAGAGAACA TTTAATCAGCCTTCATCAAAAGCATCTTCTCCACCTTCTAGAAAGAAGAGATC ATGACAAGGCTCTGCAA Intron 24-25 67,314,206 67,314,595 390 gtaagcccccagttctttccatttt..........ttcctcctctaccctttg acaatag 25 ENSE00000658690 67,314,029 67,314,205 177 CTCCTGCGAAGAATCCCTGACCCCACCATGTGCCTTGAAGTGACAGAGCAATC CCTCGACCAGCACACTAGCTTGGCCACTTCTCACTTCTTGGCCAACTACCTCA CCACCCACTTCTATGGACAACTGACTGCTGTCCGACACCGTGAAATCCAGGCG CTGTATGTGGGATCCAAG Intron 25-26 67,312,577 67,314,028 1,452

gtaaggatacaccgtgaaatccagg..........ctctatggatctacccca caaacag 26 ENSE00000658689 67,312,330 67,312,576 247 ATTCTGCTGACCCTGCCTGAGCAGCACCGGGCCAGCTATTCCCACTTGTCCTC TAACCCCCTGTTCATGCTGGAGCAGCTGCTTATGAACATGAAGGTGGATTGGG CCACTGTGGCTGTGCAGACTCTCCAGCAGCTGCTGGTTGGACAGGAGATTGGC TTCACTATGGACGAGGTGGACTCACTGCTTTCCAGATACGCAGAGAAAGCCCT GGACTTTCCATACCCTCAGAGGGAGAAACGATCAG Intron 26-27 67,311,585 67,312,329 745 gtaactgctagcatcctagaagggg..........ttgtcagcattttccctc tctacag 27 ENSE00000658688 67,311,486 67,311,584 99 ATTCTGTGATTCACCTCCAAGAAATTGTCCACCAGGCTGCAGATCCCGAGACC CTCCCTAGATCACCATCAGCAGAGTTCTCTCCTGCTGCTCCTCCTG Intron 27-28 67,308,681 67,311,485 2,805 gtaagaactggctctgatgattcac..........tctgacctctggctctgc ctcccag 28 ENSE00000658687 67,308,517 67,308,680 164 GTATCTCCAGTATACATTCCCCTAGTCTAAGGGAAAGGAGTTTCCCACCAACC CAGCCCTCACAGGAATTTGTGCCCCCAGCGACACCCCCTGCCAGGCACCAGTG GGTACCGGATGAGACTGAGAGTATCTGCATGGTCTGCTGCAGGGAGCACTTCA CCATG Intron 28-29 67,306,201 67,308,516 2,316 gtaagcagcatcggtctccactgtc..........ttctcctcctgatggcat tcctcag 29 ENSE00000658686 67,306,064 67,306,200 137 TTTAACAGGCGTCATCATTGTCGCCGCTGTGGCCGGCTAGTGTGCAGCTCCTG CTCCACTAAGAAAATGGTGGTTGAAGGCTGCAGAGAGAACCCTGCTCGTGTGT GTGATCAGTGCTATAGTTACTGCAACAAAGA Intron 29-30 67,305,019 67,306,063 1,045 gtgagtgtcctacagcagggctgtt..........ataatttttctttctctg ttttcag 30 ENSE00000658685 67,304,987 67,305,018 32 TGTACCAGAGGAGCCTTCAGAAAAACCAGAAG Intron 30-31 67,304,311 67,304,986 676 gtaaggccaaatcccgttctctgtg..........acatgaatggcatttctc ttctcag 31 ENSE00000658684 67,304,174 67,304,310 137 CTCTAGACAGCTCCAAGAATGAAAGCCCTCCATACTCGTTTGTGGTGAGAGTC CCCAAAGCAGATGAGGTGGAATGGATTTTGGATCTCAAAGAGGAGGAAAATGA GCTGGTGCGGAGTGAATTTTACTATGAGCAG Intron 31-32 67,302,918 67,304,173 1,256 gtaatagcaataaaatgcaatggtc..........ttctcccttcttccaccc cggccag 32 ENSE00000807789 67,302,697 67,302,917 221 GCCCCCAGCGCCTCCTTGTGCATTGCCATCCTGAATCTGCACCGGGACAGCAT TGCCTGTGGTCACCAGCTGATTGAGCACTGCTGCAGGCTCTCCAAGGGCCTCA CCAACCCAGAGGTGGATGCCGGGCTGCTCACGGACATCATGAAGCAGCTGCTG TTCAGCGCCAAGATGATGTTCGTCAAAGCCGGCCAGAGCCAAGACTTGGCTCT TTGTGACAG Intron 32-33 67,299,290 67,302,696 3,407 gtagagggcagtgggtctctattct..........ggccttgcccttttcctc cttgtag 33 ENSE00000658682 67,299,142 67,299,289 148 CTACATCAGCAAGGTAGATGTGCTGAATATTTTAGTTGCTGCTGCCTATCGCC ACGTGCCATCTTTGGATCAGATCTTGCAGCCAGCTGCAGTAACCAGGCTAAGG AACCAGCTTTTGGAAGCCGAGTACTACCAACTGGGCGTTGAG Intron 33-34 67,298,883 67,299,141 259 gtgagacaaagacaaagacaaagct..........ctaaaaggggcaattttt ctcccag 34 ENSE00000658681 67,298,673 67,298,882 210 GTCTCCACAAAGACTGGGCTTGATACCACCGGGGCGTGGCATGCTTGGGGCAT GGCCTGCCTCAAAGCCGGGAACCTCACTGCTGCACGGGAGAAGTTCAGTCGCT GTCTGAAGCCCCCATTTGACCTCAATCAGCTGAATCATGGCTCAAGGCTGGTG CAGGATGTGGTTGAGTACCTAGAGTCCACAGTGAGGCCCTTTGTATCCTTG Intron 34-35 67,298,055 67,298,672 618 gtaagagcaaggcaggaagagtgcc..........tctctctcgctccctgtg ctgtcag 35 ENSE00000658680 67,297,836 67,298,054 219 CAAGATGACGATTACTTTGCCACCCTGAGGGAACTGGAAGCTACCCTTCGGAC GCAGAGCCTTTCTCTGGCAGTGATTCCTGAAGGGAAAATCATGAACAACACCT ACTACCAGGAATGCCTCTTCTACCTGCACAACTATAGCACCAACCTGGCCATC ATCAGCTTCTACGTGAGGCACAGCTGCCTGCGGGAAGCTCTTCTGCACCTTCT CAACAAG Intron 35-36 67,292,616 67,297,835 5,220 gtgggacatggacacagctcaaaaa..........gacttctcgccctgccct gctccag 36 ENSE00000658679 67,292,418 67,292,615 198 GAGAGTCCTCCAGAAGTTTTTATAGAAGGCATTTTCCAACCAAGCTATAAAAG TGGGAAGCTACACACTTTGGAGAACTTGCTAGAATCCATTGATCCAACCTTGG AGAGCTGGGGAAAGTACTTGATTGCTGCCTGCCAACATTTACAGAAGAAGAAC TACTACCACATTCTGTATGAGCTGCAGCAGTTTATGAAG Intron 36-37 67,291,721 67,292,417 697 gtaatggcagccccttcctgccttc..........ctgaacatttattttcct cttctag 37 ENSE00000658678 67,291,521 67,291,720 200 GACCAAGTTCGGGCCGCCATGACCTGTATTCGGTTCTTCAGTCACAAAGCAAA GTCATATACAGAACTGGGAGAGAAGCTCTCATGGCTACTTAAGGCCAAGGACC ACCTGAAGATCTACCTCCAAGAAACATCCCGCAGCTCTGGAAGGAAGAAAACC ACATTCTTCAGAAAGAAGATGACTGCAGCTGATGTGTCAAG Intron 37-38 67,290,683 67,291,520 838 gtagctggaggttcaggggactatt..........gactgtgcatattctgtc accacag 38 ENSE00000658677 67,290,541 67,290,682 142 GCACATGAACACACTTCAGCTGCAGATGGAAGTGACCAGGTTCTTGCATCGGT GCGAAAGTGCTGGGACCTCTCAAATCACCACTTTGCCTCTGCCAACCCTGTTT GGAAATAACCACATGAAAATGGATGTTGCCTGCAAG Intron 38-39 67,290,237 67,290,540 304 gtacatgcagcgtttcagacctctg..........aagcatgattccctttcc ttttcag 39 ENSE00000658676 67,290,177 67,290,236 60 GTCATGCTGGGAGGGAAAAATGTAGAAGATGGTTTTGGAATTGCTTTCCGTGT TCTGCAG Intron 39-40 67,288,997 67,290,176 1,180 gtatgacttggatcattcaaatcat..........cccatcatgttgtgttct gttctag 40 ENSE00000658675 67,288,814 67,288,996 183 GACTTCCAGCTGGATGCTGCCATGACCTACTGCAGAGCTGCCCGCCAGTTGGT GGAGAAAGAGAAGTACAGTGAGATCCAGCAACTGCTCAAATGTGTCAGTGAGT CAGGCATGGCAGCCAAAAGTGACGGGGACACCATCCTCCTCAACTGCCTGGAA GCGTTCAAGAGAATTCCGCCCCAG Intron 40-41 67,287,567 67,288,813 1,247 gtacactccctcccgtacctcttgg..........acagtgctgtttctgttc tgcacag 41 ENSE00000807788 67,287,522 67,287,566 45 GAGCTGGAGGGCCTGATCCAGGCAATACACAATGATGACAACAAG Intron 41-42 67,285,110 67,287,521 2,412 gtgagcggaattgtctccaaacgct..........gctgtctcttataactga ctgccag 42 ENSE00001395974 67,282,992 67,285,109 2,118 GTTCGGGCCTACCTGATATGTTGCAAACTGCGTTCTGCCTACTTGATTGCTGT GAAGCAAGAACACTCACGGGCCACAGCCCTTGTCCAGCAGGTGCAGCAGGCCG CCAAGAGCAGCGGGGATGCAGTAGTGCAAGACATCTGTGCCCAGTGGCTTCTG ACAAGCCACCCCCGGGGTGCCCATGGCCCAGGCTCCAGGAAGTGACCTTGGGC AGTGGGGCCAGGAACACGTGGCCTGAGAGCTGGGCAACAGCAGTGATGGCGAT GCCCTCCACCTCTTTCCTCCAGTGGAGTGGGACTTCTCTGGCTCTGCCCTAGG TTGGAAAGAGTTGGATTGGACCCTACTTGCCTTCCCGGGCAAGGATAGGACCT TTCACGCAAGTGCCATGTTTCTCTAAAATTGTGGAATCTATGTGTGTTTGTCT GGAGATGGCCAGTTCTTTCTACCTCAGAGTGAGTGAGTGAGTATGTGTGCACA CACGTGTGCATGTTCCTGTGCGCTGATGTTTACGCCCAAGCATTTCTGAACAA ATGAAACTCTTCTCCATTTAAAAGAGGCACTTTACTTTAGACTTGCCACTCTG AAAACCTTCCCTGCGTTTTGGTTCTTGACCCGGGTTGTCCTGTTTGTATAGTC CCCCCTCTGTGGACGTGCTTTAGTAGCTCCTCTTACCTAGAGGGCTTTTACAG AGAATTAGAGCAACACCAAAAGGATTGCCTCTTTTCCTTCCTTCCCATTCCAA AATTCAGAGATGGCTTTGGGGCAAGTGCTACCTGTGGAATAAACCTGTTTTCC AGGTGTCTCTTCTCCCAAGCACAAGAAGTCCTGGAGTCTTTGGAAGGTAGTCT GAATAGAAGGGTTTTCAGGTGCAGGCATCTGAAAGCTGTGGGTATGTGTATAA ATGATCAGGTCTGTGAGGCTAACACGGGCAAGAGGGAAAGAAAGGCTAACCAT CCAAACAGGGATACAGGGGAGGCGGTGGGGGGTGGTGGGGGGAGCGGGTGCTC ACAAGCACAGAGC TGCCTGTTGTGAATGTCCCTGCTGCAAAGTTGGTGGGTGAGAGAATGGGACTT CCTCTTTGAGAGTCTGGGGAGAGAAAAGGTGGCCAGGATCCTAGGACTGAATG ACTCGATTTTACCTATTTGAGCTGCAGTCCTGTTTGCGCTCCTTGAATTGGTT AGGAAGCTGCTTCCTTTTCCCTCCTGCTTCCCTTCAGTCTCTTCAGGACCACA GGATGGATATGCAGACATGTGGGGTCATTGGGAAGGGAGTGCGCTTCTTTTCT CTGTCTTAGAAAAGGGAGTCAAGGGTTGGCTTTGGAATTGGGCCTCTGGACAG AGTCAGAATGAGGGAATAATGAATAGGTCACATCTGGTTGGTGGAAAACTAGG TGAAGTGCTTCTTTAATATGCACTGTCTTGTCTTCCCACGCAAGATGTGACAA TGTTTGAGAAAAGGTGTGTCATACTCAGTGACTTCAATTTGCAAATGTGGGGC CTAAAGAAAGCTCTGCAGCTCTGAACCTCTCACTGGCCAGAGCTCAGCCTATT GGTCCCATCCATGATGCTGAGACAAACAGAAACTGGAAGCTGAAGTCAGTGTC TCTGGTGCTCAGAAACCCTGTGGATTTCCCTCTGAACCAAGATTTTTAGTAGT AAAATAAACAACTCATGGACATCTGTCAGATGAGAAGTTTTGGTCCTGTTAGA GAGGAGAAAGACTGTAATGAAACTACTAGACCCATTTGGGCTAAAGTTTGGCT TTTCCTTCCTTGAGTCATAGAACGTATCCATCTCCCAGGAAATGTCCTTCTCT GGCGTCTGCTTGCCCTTCTGAGTCTGCCTTTTTTGCACTGAACATAAGCACTT TATACTAATGGGTCACAAATCTTGCAGCCCTTAATTTGGGATAAGACCAGATT TTCCTGACATTTTCCTCTAACTCATTGAACTATCAAATTATAGGCAACCACTG ACTAGACTGATATGAGATGAGGCTAAAAGCCTTTGAACACCACGCTGTAGTCT CCAACAGAAAAACACCACCAAAACAGATACCCATGTTGAGGGGTTGAATGTTT TACTACAAACAAGCCACAATAAAGTGTCTATCAACATG 3' downstream tttcttggcttcataacttcttggtgctgtcttgctcctaccctttgcat sequence

[0033] As used herein, the term "Spastizin" denotes the "SPASTIcity due to the ZFYVE26 proteIN", which is encoded by the ZFYVE26 gene. The amino-acid sequence of the human form is shown in SEQ ID NO:2.

[0034] The terms "mutant" and "mutation" mean any detectable change in genetic material, e.g. DNA, RNA, cDNA, or any process, mechanism, or result of such a change. This includes gene mutations, in which the structure (e.g. DNA sequence) of a gene is altered, any gene or DNA arising from any mutation process, and any expression product (e.g. protein or enzyme) expressed by a modified gene or DNA sequence. Generally a mutation is identified in a subject by comparing the sequence of a nucleic acid or polypeptide expressed by said subject with the corresponding nucleic acid or polypeptide expressed in a control population. A mutation in the genetic material may also be "silent", i.e. the mutation does not result in an alteration of the amino acid sequence of the expression product.

[0035] In the context of the instant application, mutations identified in ZFYVE26 gene are designated pursuant to the nomenclature of Den Dunnen et al. 2001 approved by the Human Genome Variation Society (http://www.genomic.unimelb.edu.au/mdi/mutnomen/). According to the invention, the position +1 in ZFYVE26 gene is the A of the start codon ATG of the cDNA sequence (see FIG. 2 and Table 1) which corresponds to the position +136 in SEQ ID NO: 1.

[0036] As defined by Dunnen and Antonarakis at the nucleic acid level, substitutions are designated by "c.position(nt)>(nt)", e.g. "c.1240G>T denotes that at nucleotide 1240 of the reference sequence G is changed to a T. The mutation at the protein level is denoted p.E414X: which means that a glutamic acid (E or Glu) at position 414 encoded by GAG is replaced by a STOP (TAG). Deletions are designated by "del" after the deleted interval (following the deleted nucleotides). For instance c.2049delT denotes a T deletion at nucleotide 2049. The consequence of this deletion, p.F683LfsX3, is a frameshift ("fs") leading to the replacement of aminoacid phenylalanine (F or Phe) at position 683 by a Leucine (L or Leu) and appearance of a premature STOP codon ("X") 2 codons after (F683 considered at position 1), at codon 685. An alternative nomenclature is to indicate the position of the stop codon in the resulting protein after the X; p.Phe683LeufsX685 indicates that the stop codon resulting from the mutation is at codon 685. Insertions are designated by "ins," followed by the inserted nucleotides. For example, c. 6296.sub.--6297insT denotes that a T was inserted between nucleotides 6296 and 6297. This leads to a frameshift maintaining the Leucine at position 2099 but leading to a premature STOP codon at position 2111: p.L2099LfsX2111. Inversions are designated by "inv", after positions of the inverted nucleotides. For example g.67319319-67319414inv denotes that nucleotides from positions 67319319 to 67319414 have been inverted. This inversion occurred at the genomic level and is not purely affecting the coding sequence as indicated by "g."

[0037] Sometimes, complex rearrangements are observed and their exact mechanism of origin is unknown: for example, the mutation g.67316025.sub.--67319414del/g.67316025.sub.--67316026insTCTA/g.67319319.- sub.--67319414inv likely combines at least three events which are a large deletion, a small insertion and the inversion of a small motif (FIG. 7-2). In such large genomic events, nucleotide numbering uses genomic positions according to the human genome sequence available at Ensembl, NCBI, Genbank or UCSC databases online.

[0038] Another class of mutations affects the correct splicing of a gene either directly by altering the splicing consensus sequences at intron-exon junctions or indirectly by alteration of exonic sequences responsible for the binding of enhancers of splicing elements (ESE: http://rulai.cshl.edu/cgi-bin/tools/ESE3/esefinder.cgi?process=home). More frequently and easily, splicing mutations are found at exon-intron junctions. For example the c.6011G>C mutation in ZFYVE26 is located at the end of exon 32 in the splicing consensus sequence and its splice site score (see legend of table 2), which represent the probability of a given site to be cognized by the splicing machinery, decreases from +4.5 to +0.7. In that case, because mRNA of patients was not available, the effect of the mutation, although likely, could not be verified and is therefore indicated "r.?" (r for RNA level) by convention. However, since the mutation is present in the exon, it can also alter the protein if synthesized and this fact is indicated too: p.S2004T so that the full description of the mutation is: c.6011G>C, r.?, p.S2004T. In another example, the mutation c.5791-6G>A is found in intron 31, again in a splicing consensus sequence. While there is no direct effect of the mutation in the coding sequence, in silico predictions indicate that there is creation of a novel splicing site with a better splice score of +4.2 versus +3.7. This was validated on mRNA of patients after PCR using flanking primers followed by direct sequencing of the PCR product allowing to precise the exact mutational effect which is a misplaced splicing leading to incorporation of 4 intronic bases to the mRNA (r.5791.sub.--5792ins5791-4.sub.--5791-1) and subsequent protein modification with frameshift and premature stop co don (p.A1931PfsX1957X).

[0039] Thus, the ZFYVE26 mutations according to the invention are as follows: [0040] c.307G>T which denotes that at nucleotide 307 (which corresponds to the position 442 in SEQ ID NO:1) of the ZFYVE26 sequence (coding sequence) G is changed to a T, [0041] c.427G>T which denotes that at nucleotide 427 (which corresponds to the position 562 in SEQ ID NO:1) of the ZFYVE26 sequence (coding sequence) G is changed to a T, [0042] c.1240G>T which denotes that at nucleotide 1240 (which corresponds to the position 1375 in SEQ ID NO:1) of the ZFYVE26 sequence (coding sequence) G is changed to a T, [0043] c.1477C>T which denotes that at nucleotide 1477 (which corresponds to the position 1612 in SEQ ID NO:1) of the ZFYVE26 sequence (coding sequence) C is changed to a T, [0044] c.2182C>T which denotes that at nucleotide 2182 (which corresponds to the position 2317 in SEQ ID NO:1) of the ZFYVE26 sequence (coding sequence) C is changed to a T, [0045] c.4312C>T which denotes that at nucleotide 4312 (which corresponds to the position 4447 in SEQ ID NO:1) of the ZFYVE26 sequence (coding sequence) C is changed to a T, [0046] c.5422C>T which denotes that at nucleotide 5422 (which corresponds to the position 5557 in SEQ ID NO:1) of the ZFYVE26 sequence (coding sequence) C is changed to a T, [0047] c.5791-6G>A/r.5791.sub.--5792ins5791-4.sub.--5791-1, which denotes that at the intronic nucleotide -6 before the exonic nucleotide 5791, the G is changed to A and which causes an insertion between nucleotide 5791 and 5792 of 4 intronic bases positioned at -4 to -1 relative to position 5791 (see table 1 for the position of the nucleotides). [0048] c.5485-1G>A which denotes that at intronic nucleotide -1 before the exonic nucleotide 5485 the G is changed to A (see table 1 for the position of the nucleotides). [0049] c.7128+2T>A/r.6987.sub.--7128del which denotes that at intronic nucleotide +2 after the exonic nucleotide 7128, the T is changed to A and which causes a deletion of the nucleotide between 6987 and 7128 in the RNA (see table 1 for the position of the nucleotides). [0050] c.6011G>C which denotes that at nucleotide 6011 (which corresponds to the position 6146 in SEQ ID NO:1) of the ZFYVE26 sequence (coding sequence) G is changed to a C, [0051] c.2049delT which denotes that at nucleotide 2049 (which corresponds to the position 2184 in SEQ ID NO:1) of the ZFYVE26 sequence (coding sequence) T is deleted, [0052] c.4068.sub.--4069delTG which denotes that at nucleotide 4068 and 4069 (which corresponds to the position 4203 and 4204 in SEQ ID NO:1) of the ZFYVE26 sequence (coding sequence) T and G are deleted, [0053] c.5036delT which denotes that at nucleotide 5036 (which corresponds to the position 5171 in SEQ ID NO:1) of the ZFYVE26 sequence (coding sequence) T is deleted, [0054] c.6702.sub.--6771del which denotes that between nucleotide 6702 and 6771 (which corresponds to the position 6837 and 6906 in SEQ ID NO:1) the nucleotides are deleted, [0055] c.2331.sub.--2332insA which denotes that between nucleotide 2331 and 2332 (which corresponds to the position 2466 and 2467 in SEQ ID NO:1) the nucleotide A is inserted, [0056] c.6296.sub.--6297insT which denotes that between nucleotide 6296 and 6297 (which corresponds to the position 6431 and 6432 in SEQ ID NO:1) the nucleotide T is inserted, [0057] g.67316025.sub.--67319414del/g.67316025.sub.--67316026insTCTA/g.67319319.- sub.--67319414inv which denotes that there is a large genomic deletion between nucleotide 67316025 and 67319414 associated with a TCTA insertion between nucleotide 67316025 and 67316026 and inversion of the genomic sequence between nucleotide 67319319 and 67319414 (positions are here indicated relative to the chromosome 14 assembly NC000014 at Genbank) (see FIG. 7-2).

[0058] The term "hereditary spastic paraplegias (HSP)" denotes genetically heterogeneous Mendelian disorders characterized by weakness, spasticity and loss of vibratory sense in the lower limbs (Fink 2006, Depienne et al. 2007, Stevanin et al. 2008). The term "Autosomal Recessive Hereditary Spastic Paraplegia" or "AR-HSP" denotes spastic paraplegia that is transmitted as an autosomal recessive trait. In non-consanguineous populations, this mode of inheritance can account for "apparently" sporadic cases. Patients with HSP or AR-HSP can have a pure phenotype, or, more often, a complex phenotype that associates various neurological signs (cerebellar ataxia, mental retardation, peripheral neuropathy, etc). The term "AR-HSP-TCC" denotes an AR-HSP with Thin Corpus Callosum (TCC) usually associated with, mental or cognitive deficit and peripheral neuropathy (Winner et al. 2005, Franca et al. 2007; Boukhris et al. 2008a). Families without proved TCC can also be mutated in this gene either because of slow progression of the disease in the patient or because magnetic resonance imaging (MRI) couldn't be performed due to patient refusal or impossibility (patients leaving far from cities in North-Africa). Alternatively, clinical heterogeneity has already been proved in families mutated in the same gene (Depienne et al. 2007, Stevanin et al. 2008b) and the clinical presentation of the patients linked and mutated in SPG15 can perfectly fit with this AR-HSP-TCC phenotype but sometimes not (Elleuch et al. 2007, Boukhris et al. 2008a and 2008b). The full spectrum of the phenotypes linked to SPG15 remains to be determined and other HSP phenotypes could be caused by mutations in this gene.

[0059] As used herein, the term "subject" denotes a mammal, such as a rodent, a feline, a canine, and a primate. Preferably a subject according to the invention is a human.

Mutations in the ZFYVE26 Gene and Spastizin Protein

[0060] The inventors identified various mutations in the ZFYVE26 gene. Eighteen different mutations on human ZFYVE26 gene were indeed identified in 16 families. They were either nonsense mutations (n=7), deletions (n=4), insertions (n=2), splice site mutations (n=4) and genomic rearrangements (n=1) and resulted in an abnormally truncated protein in all cases. The mutations identified by the inventors are presented on the following Table 2.

TABLE-US-00002 TABLE 2 Mutations identified in the ZFYVE26 gene and protein. Mutated Mutated family family Mutations at the at the Protein (alternative nomenclature) homozygous heterozygous Position Nucleotide variation or RNA consequence SEQ ID NO: state state Exon 4 c.307G > T p.E103X (p.Glu103X) 105 None FSP 656 (France) Exon 5 c.427G > T p.E143X (p.Glu143X) 106 None FSP 656 (France) Exon 8 c.1240G > T p.E414X (p.Glu414X) 107 None 708 (France) Exon 10 c.1477C > T p.Q493X (p.Gln493X) 108 TUN16 None (Tunisia) TUN17 (Tunisia) Exon 11 c.2049delT p.F683LfsX685 (p.Phe683LeufsX3) 109 TUN30 None (Tunisia) Exon 11 c.2182C > T p.R728X 118 None FSP917 (Belgium) Exon 12 c.2331_2332insA p.D778RfsX793 (p.D778RfsX16) 119 None FSP917 (Belgium) Intron 20 to g.67316025_67319414del; p.R1209fsX1220 (p.Arg1209fsX12) 110 761 None intron 23 g.67316025_67316026insTCTA; (Italy) g.67319319_67319414inv Exon 21 c.4068_4069delTG p.C1356fsX1356 (p.Cys1356X) 111 None 130 (France) Exon 21 c.4312C > T p.R1438X (p.Arg1438X) 112 1007 None (Ireland) 444 (Morocco) Exon 26 c.5036delT p.L1679RfsX1687 113 203 None (p.Leu1679ArgfsX9) (Syria) Exon 28 c.5422C > T p.Q1808X(p.Gln1808X) 114 739 None (Turkey) Intron 28 c.5485 -1G > A r.? (Aberrant splicing: splice score 353 None decreases from +3.1 to -7.8) (Algeria) Intron 31 c.5791 -6G > A r.5791_5792ins5791-4_5791-1, 130 None 130 p.A1931PfxX1957X (Aberrant splicing, (protein) (France) abolition of the wild-type splicing site and appearance of another splicing site with a better splice score +4.2 versus +3.7). Validated on mRNA Exon 32 c.6011G > C p.S2004T, r. ? (Aberrant splicing: 115 TUN 8 None splice score decreases from +4.5 (Tunisia) to +0.7) Exon 34 c.6296_6297insT p.L2099LfsX2111 116 352 None (p.Leu2099LeufsX13) (Portugal) Exon 36 c.6702_6771del p.W2234CfsX2238 117 671 None (p.Trp2234CysfsX5) (Israel Arab) Intron 38 c.7128 + 2T > A r.6987_7128del, p.R2329RfsX2337 131 None 708 (Aberrant splicing: splice score (protein) (France) decreases from +5.9 to -4.8). Validated on mRNA. Splice score predictions were calculated online at the BDGP Splice Site Prediction web site (http://www.fruitfly.org/seq_tools/splice.html) and at the Cold Spring Harbor Laboratory web site (http://rulai.cshl.edu/new_alt_exon_db2/HTML/score.html). For mutations predicted to affect the splicing, cells were only available in two cases and were not available yet to confirm in silico predictions of two of the splicing mutations but they were considered very likely as mutations given their locations in the splice consensus sites.

[0061] Each mutation are herein numbered according to human ZFYVE26 CDS using the A of first coding ATG in exon 2 (see table 1) for nucleotide +1 (position +136 in the SEQ ID NO: 1), and amino acid sequence.

[0062] Accordingly, the invention relates to an isolated nucleic acid specifically hybridizable to a region of ZFYVE26 gene coding sequence that contains a mutation selected from the group consisting of: [0063] the substitutions: c.307G>T, c.427G>T, c.1240G>T, c.1477C>T, c.2182C>T, c.4312C>T, c.5422C>T, c.5791-6G>A/r.5791.sub.--5792ins5791-4.sub.--5791-1 (proved splice site effect), c.5485-1G>A (predicted to affect splicing), c.7128+2T>A/r.6987.sub.--7128del (proved splice site effect), c.6011G>C (predicted to affect splicing), [0064] the deletions: c.2049delT, c.4068.sub.--4069delTG, c.5036delT, c.6702.sub.--6771del, [0065] the insertions: c.2331.sub.--2332insA, c.6296.sub.--6297insT, [0066] the complex rearrangement: g.67316025.sub.--67319414del/g.67316025.sub.--67316026insTCTA/g.67319319.- sub.--67319414inv. [0067] Said nucleic acid may be an oligonucleotide. Preferably, said nucleic acid or oligonucleotide is complementary to a region of the ZFYVE26 gene that contains at least one of the identified mutations. Such nucleic acid may advantageously be used as a primer or probe.

[0068] The invention also relates to an isolated nucleic acid, which comprises or consists in a ZFYVE26 gene coding sequence that contains one or several mutation(s) selected from the group consisting of: [0069] the substitutions: c.307G>T, c.427G>T, c.1240G>T, c.1477C>T, c.2182C>T, c.4312C>T, c.5422C>T, c.5791-6G>A, c.5485-1G>A, c.7128+2T>A, c.6011G>C, [0070] the deletions: c.2049delT, c.4068.sub.--4069delTG, c.5036delT, c.6702.sub.--6771del, [0071] the insertions: c.2331.sub.--2332insA, c.6296.sub.--6297insT, [0072] the complex rearrangement: g.67316025.sub.--67319414del/g.67316025.sub.--67316026insTCTA/g.67319319.- sub.--67319414inv or a sequence complementary thereto.

[0073] In another embodiment, the invention relates to an isolated polypeptide which comprises the polypeptide sequence of ZFYVE26 containing one or several mutation(s) selected from the group consisting of p.E103X, p.E143X, p.E414X, p.Q493X, p.F683LfsX685, p.R728X, p.D778RfsX793, p.R1209fsX1220, p.C1356fsX1356, p.R1438X, p.L1679RfsX1687, p.Q1808X, p.A1931PfxX1957X, p.S2004T, p.L2099LfsX2111, p.W2234CfsX2238, p.R2329RfsX2337 and those resulting from aberrant splicing identified by the inventors but for which the consequence on the protein, although clearly deleterious in silico since affecting splicing consensus sequences, could not be verified because of the absence of patient's cells for their analysis up to now (c.5485-1G>A, c.6011G>C). In the latter case, c.6011G>C is affecting the last codon of an exon, then probably affecting the splicing but also replacing the corresponding amino-acid as: p.S2004T.

Diagnostic Methods of the Invention

[0074] The inventors have further shown that ZFYVE26 mutations are associated with a hereditary spastic paraplegia (HSP), which is characterized by weakness, spasticity and often loss of vibration sense in the lower limbs. More particularly, the inventors have shown that ZFYVE26 mutations as above described in a subset of 22 affected patients correlated with early-onset spastic paraplegia (range: 5 to 19 years) associated with additional neurological symptoms that varied among patients and families: cognitive deterioration or mental retardation (73%, 16/22), axonal neuropathy (67%, 8/12), mild cerebellar signs (36%, 8/22) and, less frequently, a central hearing deficit, decreased visual acuity or retinal degeneration. A thin corpus callosum and white matter hyperintensities were found on brain MRI in 64% (7/11) and 36% (4/11) of the patients, respectively, independently of disease duration (see Table 5 in EXAMPLE).

[0075] Therefore the invention provides an ex vivo method of diagnosing or predicting a hereditary spastic paraplegias (HSP) in a subject, which method comprises detecting a mutation in the ZFYVE26 gene or protein (spastizin), as compared to a control population, wherein the presence of a mutation is indicative of a hereditary spastic paraplegia (HSP).

Nucleic Acids Assays:

[0076] According to a first embodiment the mutations may be detected by analysing a ZFYVE26 nucleic acid molecule. In the context of the invention, ZFYVE26 nucleic acid molecules include mRNA, genomic DNA and cDNA derived from mRNA. DNA or RNA can be single stranded or double stranded. These may be utilized for detection by amplification and/or hybridization with a probe, for instance.

[0077] Thus the invention provides an ex vivo method of diagnosing or predicting a hereditary spastic paraplegias (HSP), in a subject, which method may comprise the step consisting of detecting a ZFYVE26 mutation in a nucleic acid sample obtained from the subject, wherein the presence of a mutation is indicative of a hereditary spastic paraplegia (HSP).

[0078] The nucleic acid sample may be obtained from any cell source or tissue biopsy. Non-limiting examples of cell sources available include without limitation blood cells, buccal cells, epithelial cells, fibroblasts, or any cells present in a tissue obtained by biopsy or post-mortem. Cells may also be obtained from body fluids, such as blood, plasma, serum, lymph, etc. DNA may be extracted using any methods known in the art, such as described in Sambrook et al., 1989 or using new isolation method on purification column (Quiagen . . . ). RNA may also be isolated, for instance from tissue biopsy, using standard methods well known to the one skilled in the art such as guanidium thiocyanate-phenol-chloroform extraction (Chomocyznski et al., 1987).

[0079] A ZFYVE26 mutation according to the invention may be found and located in many exons or introns, including exon 4 and intron 38 (FIG. 2 and Table 2).

[0080] The ZFYVE26 mutations according to the invention are selected from the group consisting of: [0081] the substitutions: c.307G>T, c.427G>T, c.1240G>T, c.1477C>T, c.2182C>T, c.4312C>T, c.5422C>T, c.5791-6G>A/r.5791.sub.--5792ins5791-4.sub.--5791-1 (proved splice site effect), c.5485-1G>A (predicted to affect splicing), c.7128+2T>A/r.6987.sub.--7128del (proved splice site effect), c.6011G>C (predicted to affect splicing), [0082] the deletions: c.2049delT, c.4068.sub.--4069delTG, c.5036delT, c.6702.sub.--6771 del, [0083] the insertions: c.2331.sub.--2332insA, c.6296.sub.--6297insT, [0084] the complex rearrangement: g.67316025.sub.--67319414del/g.67316025.sub.--67316026insTCTA/g.67319319.- sub.--67319414inv.

[0085] ZFYVE26 mutations may be detected in a RNA or DNA sample, preferably after amplification. For instance, the isolated RNA may be subjected to coupled reverse transcription and amplification, such as reverse transcription and amplification by polymerase chain reaction (RT-PCR), using specific oligonucleotide primers that are specific for a mutated site or that enable amplification of a region containing the mutated site. According to a first alternative, conditions for primer annealing may be chosen to ensure specific reverse transcription (where appropriate) and amplification; so that the appearance of an amplification product be a diagnostic of the presence of a particular ZFYVE26 mutation. Otherwise, RNA may be reverse-transcribed and amplified, or DNA may be amplified, after which a mutated site may be detected in the amplified sequence by hybridization with a suitable probe or by direct sequencing, or any other appropriate method known in the art. For instance, a cDNA obtained from RNA may be cloned and sequenced to identify a mutation in ZFYVE26 sequence.

[0086] Actually numerous strategies for genotype analysis are available (Antonarakis et al., 1989; Cooper et al., 1991; Grompe, 1993). Briefly, the nucleic acid molecule may be tested for the presence or absence of a restriction site. When a base substitution mutation creates or abolishes the recognition site of a restriction enzyme, this allows a simple direct enzymatic test for the mutation. Further strategies include, but are not limited to, direct sequencing, restriction fragment length polymorphism (RFLP) analysis; hybridization with allele-specific oligonucleotides (ASO) that are short synthetic probes which hybridize only to a perfectly matched sequence under suitably stringent hybridization conditions; allele-specific PCR; PCR using mutagenic primers; ligase-PCR, HOT cleavage; denaturing gradient gel electrophoresis (DGGE), temperature denaturing gradient gel electrophoresis (TGGE), single-stranded conformational polymorphism (SSCP), high-resolution-melting (HRM) analysis, primer extension (Snapshot), and denaturing high performance liquid chromatography (DHPLC) (Kuklin et al., 1997). Direct sequencing may be accomplished by any method, including without limitation chemical sequencing, using the Maxam-Gilbert method; by enzymatic sequencing, using the Sanger method; mass spectrometry sequencing; sequencing using a chip-based technology; and real-time quantitative PCR. Preferably, DNA from a subject is first subjected to amplification by polymerase chain reaction (PCR) using specific amplification primers. However several other methods are available, allowing DNA to be studied independently of PCR, such as the rolling circle amplification (RCA), the Invader.TM. assay, or oligonucleotide ligation assay (OLA). OLA may be used for revealing base substitution mutations. According to this method, two oligonucleotides are constructed that hybridize to adjacent sequences in the target nucleic acid, with the join sited at the position of the mutation. DNA ligase will covalently join the two oligonucleotides only if they are perfectly hybridized (Nickerson et al., 1990).

[0087] The inventors designed a series of primers, manually or using Oligo6 (MBI, Cascade, Colo.), in order to amplify all coding exons of 6 genes from the candidate interval (primers and conditions available on request), including the mutated ZFYVE26 gene (see Table 4 in EXAMPLE). PCR-amplified fragments of genomic DNA were then sequenced using the fluorescent dideoxy-terminator method (BigDye v3, Applied Biosystem) on an automated ABI-3730 sequencer according to the manufacturer's recommendations. With the use of the software package SeqScape 2.5 (Applied Biosystems), sequences were aligned and compared to consensus sequences.

[0088] Protein Assays

[0089] According to a second embodiment said mutation may be detected in ZFYVE26 protein.

[0090] All of the identified mutations of the ZFYVE26 gene create some deletions of the C-terminal part of the spastizin protein either because of a premature STOP codon or because of abnormal splicing, both likely resulting in non-sense mediated mRNA decay. These deletions result in truncated proteins of sequences SEQ ID NO: 105 to SEQ ID NO:119 and SEQ ID NO: 130 and 131, respectively. It can not be excluded, however, that a shorten protein fragment may be synthesized due to the activation of new ATGs after the stop codon. Because mRNA couldn't be obtained yet from patients with two of the identified splicing mutations (n=4), the precise mutations at the protein level could not be established, although predicted in silico to strongly result in all cases on premature stop codons and likely on mRNA degradation.

[0091] Said mutation may be detected according to any appropriate method known in the art. In particular, a sample, such as a tissue biopsy, obtained from a subject may be contacted with antibodies specific of the mutated form of ZFYVE26 protein, i.e. antibodies that are capable of distinguishing between a mutated form of ZFYVE26 and the wild-type protein (or any other protein), to determine the presence or absence of a ZFYVE26 specified by the antibody. An antibody recognizing the wild type protein could also be used to check the presence of the protein or its abnormal location or size and could then be used as a diagnostic tool as well.

[0092] Antibodies that specifically recognize a mutated ZFYVE26 protein also make part of the invention. The antibodies are specific of mutated ZFYVE26 protein that is to say they do not cross-react with the wild-type ZFYVE26 protein. Such antibodies could detect an epitope modified by the mutation (ex: p.S2004T) and not the wild type protein. In addition, a truncated protein obtained because of premature stop codon could, if not degraded, adopt a different conformation that could be recognized by a specific antibody. In this latter case, whole protein injection in rabbits instead of peptides would probably be necessary to obtain a specific response.

[0093] A monoclonal or polyclonal antibody recognizing the wild-type ZFYVE26 protein may be used to detect the presence of the wild-type protein or one of its truncated forms. For instance, an antibody recognizing the N-terminal part of the wild-type ZFYVE26 protein may also recognize one or several truncated forms and can be used to reveal by immunoblotting, the different forms, wild-type and truncated, according to their molecular weights. An antibody recognizing the wild-type ZFYVE26 protein, but not recognizing the truncated forms, can be used for immunoblotting or in immunoassay as ELISA; in that case, an absence of signal reveals the presence of a truncated form in the sample or the absence of synthesis of a stable protein as compared with a positive control comprising the wild-type ZFYVE26 protein.

[0094] The antibodies of the present invention may be monoclonal or polyclonal antibodies, single chain or double chain, chimeric antibodies, humanized antibodies, or portions of an immunoglobulin molecule, including those portions known in the art as antigen binding fragments Fab, Fab', F(ab').sub.2 and F(v). They can also be immunoconjugated, e.g. with a toxin, or labelled antibodies.

[0095] Whereas polyclonal antibodies may be used, monoclonal antibodies are preferred for since they are more reproducible in the long run.

[0096] Procedures for raising "polyclonal antibodies" are also well known. Polyclonal antibodies can be obtained from serum of an animal immunized against spastizin, which may be produced by genetic engineering for example according to standard methods well-known by one skilled in the art. Typically, such antibodies can be raised by administering mutated ZFYVE26 protein or peptides of this protein subcutaneously to New Zealand white rabbits which have first been bled to obtain pre-immune serum. The antigens can be injected at a total volume of 100 .mu.l per site at six different sites. Each injected material may contain adjuvants with or without pulverized acrylamide gel containing the protein or polypeptide after SDS-polyacrylamide gel electrophoresis. The rabbits are then bled two weeks after the first injection and periodically boosted with the same antigen three times every six weeks. A sample of serum is then collected 10 days after each boost. Polyclonal antibodies are then recovered from the serum by affinity chromatography using the corresponding antigen to capture the antibody. This and other procedures for raising polyclonal antibodies are disclosed by Harlow et al. (1988).

[0097] A "monoclonal antibody" in its various grammatical forms refers to a population of antibody molecules that contains only one species of antibody combining site capable of immunoreacting with a particular epitope. A monoclonal antibody thus typically displays a single binding affinity for any epitope with which it immunoreacts. A monoclonal antibody may therefore contain an antibody molecule having a plurality of antibody combining sites, each immunospecific for a different epitope, e.g. a bispecific monoclonal antibody. Although historically a monoclonal antibody was produced by immortalization of a clonally pure immunoglobulin secreting cell line, a monoclonally pure population of antibody molecules can also be prepared by the methods of the present invention.

[0098] Laboratory methods for preparing monoclonal antibodies are well known in the art (see, for example, Harlow et al., 1988). Monoclonal antibodies (mAbs) may be prepared by immunizing purified mutated ZFYVE26 protein into a mammal, e.g. a mouse, rat, human and the like mammals. The antibody-producing cells in the immunized mammal are isolated and fused with myeloma or heteromyeloma cells to produce hybrid cells (hybridoma). The hybridoma cells producing the monoclonal antibodies are utilized as a source of the desired monoclonal antibody. This standard method of hybridoma culture is described in Kohler and Milstein (1975).

[0099] While mAbs can be produced by hybridoma culture the invention is not to be so limited. Also contemplated is the use of mAbs produced by an expressing nucleic acid cloned from a hybridoma of this invention. That is, the nucleic acid expressing the molecules secreted by a hybridoma of this invention can be transferred into another cell line to produce a transformant. The transformant is genotypically distinct from the original hybridoma but is also capable of producing antibody molecules of this invention, including immunologically active fragments of whole antibody molecules, corresponding to those secreted by the hybridoma. See, for example, U.S. Pat. No. 4,642,334 to Reading; PCT Publication No.; European Patent Publications No. 0239400 to Winter et al. and No. 0125023 to Cabilly et al.

[0100] Antibody generation techniques not involving immunisation are also contemplated such as for example using phage display technology to examine naive libraries (from non-immunised animals); see Barbas et al. (1992), and Waterhouse et al. (1993).

[0101] Antibodies raised against mutated ZFYVE26 protein may be cross reactive with wild-type ZFYVE26 protein. Accordingly a selection of antibodies specific for mutated ZFYVE26 protein is required. This may be achieved by depleting the pool of antibodies from those that are reactive with the wild-type ZFYVE26 protein, for instance by submitting the raised antibodies to an affinity chromatography against wild-type ZFYVE26 protein.

[0102] Alternatively, binding agents other than antibodies may be used for the purpose of the invention. These may be for instance aptamers, which are a class of molecule that represents an alternative to antibodies in term of molecular recognition. Aptamers are oligonucleotide or oligopeptide sequences with the capacity to recognize virtually any class of target molecules with high affinity and specificity. Such ligands may be isolated through Systematic Evolution of Ligands by EXponential enrichment (SELEX) of a random sequence library. The random sequence library is obtainable by combinatorial chemical synthesis of DNA. In this library, each member is a linear oligomer, eventually chemically modified, of a unique sequence. Peptide aptamers consists of a conformationally constrained antibody variable region displayed by a platform protein, such as E. coli Thioredoxin A that are selected from combinatorial libraries by two hybrid methods (Colas et al., 1996).

Kits of the Invention

[0103] According to another aspect of the invention, the ZFYVE26 mutation is detected by contacting the DNA of the subject with a nucleic acid probe, which is optionally labelled.

[0104] Primers may also be useful to amplify, analyse (dHPLC, Southern . . . ) or sequence the portion of the ZFYVE26 gene containing the mutated positions of interest.

[0105] Such probes or primers are nucleic acids that are capable of specifically hybridizing with a portion of the ZFYVE26 gene sequence containing the mutated positions of interest. That means that they are sequences that hybridize with the portion mutated ZFYVE26 nucleic acid sequence to which they refer under conditions of high stringency.

[0106] The present invention further provides kits suitable for determining at least one of the mutations of the ZFYVE26 gene.

[0107] The kits may include the following components:

[0108] (i) a probe, usually made of DNA, and that may be pre-labelled. Alternatively, the probe may be unlabelled and the ingredients for labelling may be included in the kit in separate containers; and

[0109] (ii) hybridization reagents: the kit may also contain other suitably packaged reagents and materials needed for the particular hybridization protocol, including solid-phase matrices, if applicable, and standards.

[0110] In another embodiment, the kits may include:

[0111] (i) sequence determination or amplification primers: sequencing primers may be pre-labelled or may contain an affinity purification or attachment moiety; and

[0112] (2) sequence determination or amplification reagents: the kit may also contain other suitably packaged reagents and materials needed for the particular sequencing amplification protocol. In one preferred embodiment, the kit comprises a panel of sequencing or amplification primers, whose sequences correspond to sequences adjacent to at least one of the polymorphic positions, as well as a means for detecting the presence of each polymorphic sequence.

[0113] In a particular embodiment, it is provided a kit which comprises a pair of oligonucleotide primers specific for amplifying all or part of the ZFYVE26 gene comprising at least one of the mutated positions that are identified above (see Table 2).

[0114] More preferably, the kits of the invention comprise a pair of primers as shown in Table 3 either for detection by direct sequencing or by screening by other techniques such as dHPLC.

TABLE-US-00003 TABLE 3 Primers used for PCR and sequencing to detect the mutations. SEQ ID Position Nucleotide variation For/Rev primers NO: Exon 4 c.307G > T tgcttcatcttagagaaatagcagaa/atgggcaacatcttggagac 3/4 Exon 5 c.427G > T gaaagcatgaaggcacacaa/ggctgggcatactggaatta 5/6 Exon 8 c. 1240G > T cttaggctgaatgcagagcc/ggtcaacattgccaactcaa 7/8 Exon 10 c.1477C > T aggaagtgcagggaactgaa/ccctgggtgaaataaaacca 9/10 Exon 11 c.2049delT taaatgagctaaagttgcgagaa/cctgaggaaggcccctatt 11/12 c.2182C > T gaagtcagaacggggttcc/ggtgacgatatgccctgagt 13/14 Exon 12 c.2331_2332insA tcagaacactggggtatgctc/gcatggaaaatttctgaaagg 120/121 Intron 20 g.67316025_6731941 caattaggaacttttatttacatttgc/ccgcctcggccagaatgtg 15/16 to intron 4del; 23 g.67316025_6731602 6insTCTA; g.67319319_6731941 4inv Exon 21 c.4068_69delTG caattaggaacttttatttacatttgc/actcccgggctacctgct 15/17 ctctgccttggcctttctta/gggcttctctctagagttaccg 18/19 Exon 21 c.4312 C > T caattaggaacttttatttacatttgc/actcccgggctacctgct 15/17 ctctgccttggcctttctta/gggcttctctctagagttaccg 18/19 Exon 26 c .5036delT cccctcatctggtgaaggta/tcctccaagaccaagatctctc 20/21 Exon 28 c.5422C > T tcaggaggcacacaatgttc/atggctgtttgagggtgtct 22/23 Intron 28 c.5485 -1G > A gcccatcagctgacagatatt/tggcatttcagtgtgaatgtt 24/25 Intron 31 c.5791 -6G > A gctttcttgtagaatctggttcc/ggaagaacacttgagatctgg 26/27 Exon 32 c.6011G > C gctttcttgtagaatctggttcc/ggaagaacacttgagatctgg 26/27 Exon 34 c. 6296_6297insT ggcagatagtgggaatgagg/cttgatgctgagccaggact 28/29 Exon 36 c.6702_6771del aggagagaagtgaagcagtcg/gctctagggtcagccaaaca 30/31 Intron 38 c.7128 + 2T > A tggcacataggtgctcaataa/gaggcagccatcaaacaaac 32/33 Note: The large exons 11 and 21 are amplified using 2 sets of primers.

Therapeutic Methods of the Invention

[0115] The inventors have demonstrated that all mutations identified in the ZFYVE26 gene cause or highly likely cause truncation of the protein, suggesting that pathogenicity results from loss of function. Any method leading to the replacement or overexpression of endogenous or exogenous ZFYVE26 is expected to be beneficial. It can not be excluded however that inhibiting specifically certain mutant alleles will be beneficial too, or at least less deleterious: this may be the case if a truncating protein is still or de novo produced and has stronger toxic effects than the loss of the wild type protein.

[0116] These results identify mutated ZFYVE26 gene as target for the preventive or curative treatment of a hereditary spastic paraplegia.

[0117] Thus the invention further relates to a method of treatment of an HSP which comprises the step of administering a subject in need thereof with a ZFYVE26 nucleic acid, i.e. a nucleic acid sequence that encodes a wild-type ZFYVE26 protein, so that spastizin is expressed in vivo by the cells of the subject that have been transfected with said nucleic acid, or alternatively a construction of exogenous ZFYVE26 gene that will modify or replace or inhibit the endogenous mutated ZFYVE26 gene. Accordingly, said method leads to an overexpression of wild-type spastizin that compensates expression of defective mutated ZFYVE26 protein, or alternatively, to a modification of its abnormal splicing, or inhibition of its expression, or modification of it's structure so that it will loss part of its toxicity if such demonstrated.

[0118] The invention also relates to the use of a ZFYVE26 nucleic acid for the manufacture of a medicament intended for the treatment of an HSP.

[0119] In the context of the invention, the term "treating" or "treatment", as used herein, means reversing, alleviating, inhibiting the progress of, or preventing the disorder or condition to which such term applies, or one or more symptoms of such disorder or condition.

[0120] Preferably said ZFYVE26 nucleic acid is administered in a therapeutically effective amount. A "therapeutically effective amount" is intended for a minimal amount of active agent (e.g., ZFYVE26 nucleic acid) which is necessary to impart therapeutic benefit to a subject. For example, a "therapeutically effective amount" to a mammal is such an amount which induces, ameliorates or otherwise causes an improvement in the pathological symptoms, disease progression or physiological conditions associated with or resistance to succumbing to a disorder.

[0121] The administered polynucleotide comprises the nucleotide sequence SEQ ID NO:1, or any homologous or similar sequence as defined below:

[0122] a) a sequence showing at least 70%, preferably at least 75% or 80% or 85% or 90% or 95% or 99%, sequence similarity with SEQ ID NO:1;

[0123] b) a sequence hybridizing with SEQ ID NO:1, or its complementary sequence, under stringent conditions;

[0124] c) a sequence encoding a protein of sequence SEQ ID NO:2, or any sequence substantially similar with SEQ ID NO:2.

[0125] The term "sequence similarity" in all its grammatical forms refers to the degree of identity or correspondence between nucleic acid or amino acid sequences of proteins that may or may not share a common evolutionary origin. Preferably the degree of sequence identity is calculated compared with the totality of a reference sequence.

[0126] In a specific embodiment, two DNA sequences are "substantially homologous" or "substantially similar" when at least 70%, preferably at least 75% or 80% or 85% or 90% or 95% or 99%, of the nucleotides match over the defined length of the DNA sequences, as determined by sequence comparison algorithms, such as BLAST, FASTA, DNA Strider, etc. Sequences that are substantially homologous can be identified by comparing the sequences using standard software available in sequence data banks, or in a Southern hybridization experiment under, for example, stringent conditions as defined for that particular system.

[0127] Similarly, in a particular embodiment, two amino acid sequences are "substantially similar" when greater than 80%, preferably than 85% or 90% or 95% or 99%, of the amino acids are similar (functionally identical). "Functionally identical" polypeptides are those in which a given amino acid residue has been changed without altering the overall conformation and function of the polypeptide, including, but not limited to, replacement of an amino acid with one having similar properties (such as, for example, polarity, hydrogen bonding potential, acidic, basic, hydrophobic, aromatic, and the like). Amino acids with similar properties are well known in the art. For example, arginine, histidine and lysine are hydrophilic-basic amino acids and may be interchangeable. Similarly, isoleucine, a hydrophobic amino acid, may be replaced with leucine, methionine or valine. Such changes are expected to have little or no effect on the apparent molecular weight or isoelectric point of the protein or polypeptide. Preferably, the similar sequences are identified by alignment using, for example, the GCG (Genetics Computer Group, Program Manual for the GCG Package, Version 7, Madison, Wis.) pileup program, or any of the programs described above (BLAST, FASTA, etc.).

[0128] Preferably the ZFYVE26 nucleic acid sequence according to the invention is associated with elements that enable for regulation of its expression, such as a promoter sequence.

[0129] Such a nucleic acid may be in the form of a DNA vector. The terms "vector" means the vehicle by which a DNA or RNA sequence (e.g. a foreign gene) can be introduced into a host cell, so as to transform the host and promote expression (e.g. transcription and translation) of the introduced sequence. A common type of vector is a "plasmid", which generally is a self-contained molecule of double-stranded DNA, usually of bacterial origin, that can readily accept additional (foreign) DNA and which can readily introduced into a suitable host cell. A plasmid vector often contains coding DNA and promoter DNA and has one or more restriction sites suitable for inserting foreign DNA.

[0130] The ZFYVE26 nucleic acid may be introduced into a target cell by means of any procedure known for the delivery of nucleic acids to the nucleus of cells, ex vivo, on cells in culture or removed from an animal or a patient, or in vivo.

[0131] Ex vivo introduction may be performed by any standard method well known by one skilled in the art, e.g. transfection, electroporation, lipofection, microinjection, transduction, cell fusion, DEAE dextran, calcium phosphate precipitation, or use of a gene gun.

[0132] The above methods do not limit the scope of the invention and it is to be understood that the one skilled in the art may readily make use of any other known appropriate methods for delivering a nucleic acid to a cell in vivo or in vitro.

[0133] The invention also relates to the use of wild-type ZFYVE26 protein (Spastizin) for the manufacture of a medicament intended for the treatment of an HSP.

[0134] Thus the invention further relates to a method of treatment of an HSP which comprises the step of administering a subject in need thereof with a therapeutically effective amount of wild-type ZFYVE26 protein.

[0135] The ZFYVE26 protein may be introduced to a target cell by means of any procedure known for the delivery of proteins to cells, ex vivo, on cells in culture or removed from an animal or a patient, or in vivo.

[0136] Protein delivery is the process by which a protein crosses the cell plasma membrane. Traditionally, methods to introduce antibodies, peptides or other membrane-impermeable molecules into cells include micro-injection and electroporation.

[0137] A number of protein-transduction domains (PTDs) have also been developed that mediate protein delivery into cells. These PTDs or signal peptide sequences are naturally occurring polypeptides of 15 to 30 amino acids, which normally mediate protein secretion in the cells. They are composed of a positively charged amino terminus, a central hydrophobic core and a carboxyl-terminal cleavage site recognized by a signal peptidase. Examples of such membrane-transducing peptides include Trojan peptides, human immunodeficiency virus (HIV)-1 transcriptional activator (TAT) protein or its functional domain peptides, and other peptides containing protein-transduction domains (PTDs) derived from translocation proteins such as Drosophilia homeotic transcription factor Antennapedia (Antp) and herpes simplex virus DNA-binding protein, VP22, and the like. Some commercially available peptides, for example, penetratin 1, Pep-1 (Chariot reagent, Active Motif Inc., CA) and HIV GP41 fragment (519-541), can be used for protein delivery.

[0138] Recently, the use of lipid liposomes or the like that can complex with a protein of interest and promote the delivery of the protein into the cell has also been demonstrated. Products available commercially can be used, such as BioPORTER (Gene Therapy Systems), or ProVectin (Imgenex, San Diego, Calif.).

[0139] The above methods do not limit the scope of the invention and it is to be understood that the one skilled in the art may readily make use of any other known appropriate methods for delivering a protein to a cell in vivo or in vitro.

[0140] The invention will be further illustrated by the following figures and examples.

FIGURES

[0141] FIG. 1: Refinement of the SPG15 locus and pedigree structure of families 444 and 353 with haplotype reconstruction for informative markers on chromosome 14q23.3-q24.2. Black circles (women) and squares (men) indicate affected members. The code numbers of all sampled individuals are given below the symbols. VNTR: variable number of tandem repeat chosen from the Human Genome Working Draft at UCSC (http://genome.ucsc.edu/) and amplified using primers indicated in table 4. Chromosomal position of microsatellite markers are indicated in base pairs (bp) according to the human genome draft sequence (UCSC and Ensembl databases: http://genome.ucsc.edu/, http://www.ensembl.org). The homozygous haplotype in which the mutated gene is most likely located in affected patients is flanked by black boxes. Arrows indicate the position of key recombination events that were used to restrict the candidate interval. The SPG15 interval was refined to 2.64 Megabases (Mb) between loci VNTR25TG (primers in the table 4) and D14S1029 because of obligatory recombinations observed between loci VNTR25TG and D14S1069 (patient 444-6), and loci D14S588 and D14S1029 (Individual 353-11, who is still unaffected at age 18)

[0142] FIG. 2: Critical region of the SPG15 locus, structure of the ZFYVE26 gene and mutations identified in 16 SPG15 families.

(A) Physical and genetic map of human chromosome 14q23.3-q24.2 with markers defining the reduced SPG15 candidate interval in bold. Location and direction of transcription (arrow) of the known genes are schematically represented. The candidate genes analysed by the inventors are indicated by black boxes (# indicates genes analysed by the authors and reported in Elleuch et al, 2007). Distances on chromosome 14 are according to the Ensembl and UCSC Genome Browser databases (http://genome.ucsc.edu/, http://www.ensembl.org). (B) Structure of the ZFYVE26 gene (GenBank NM.sub.--015346) and location of the 18 different disease-causing mutations. The gene, located on chromosome 14q24.1, is transcribed from telomere to centromere, and consists of 42 exons covering a genomic region of 70,063 bp. The full-length transcript is 9,688 bp long, with a coding sequence (exon 2-42) of 7,620 bp (mRNA NM.sub.--015346.2). The coding region is indicated in grey and UTRs (5' and 3') are in white. The mutations are numbered according to the nomenclature of the Human Genome Variation Society where +1 is the A of the start codon (ATG) of the cDNA sequence (http://www.hgvs.org/mutnomen/). (C) Putative functional domains (boxes) present in spastizin (according to Predictprotein, http://www.predictprotein.org/). Note: Numbering of nucleotides is respective to the A of the first coding ATG in exon 2 of ZFYVE26 gene sequence (position +136 in SEQ ID NO 1). In the case of the large genomic rearrangement, the genomic position of nucleotides in chromosome 14 is used according to the Ensembl (www.ensembl.org), NCBI (www.ncbi.nlm.nih.gov) databases (accession NO NC000014). Amino-acid positions are according to SEQ ID No. 2.

[0143] FIGS. 3 to 10: Pedigrees showing segregation of disease-causing mutations in ZFYVE26 in 16 families, including those found linked to SPG15. Square symbols represent men, circles women. Subjects represented with filled symbols are affected. The numbers are an internal reference for each sampled individual. The genotypes are indicated below the analyzed individuals. +=Wild type allele. For the detection of the genomic rearrangement in family 761, primers 21aF and 23R (table 4) were used and generated a 238 bp-fragment in mutation carriers only.

[0144] FIG. 11: Semiquantitative analysis of ZFYVE26 expression by RT-PCR in adult human tissues, in comparison with vimentin (NM.sub.--003380). Two probes that covered exons 2 to 5, and exons 38 to 42 gave similar results showing widespread expression of the gene in all tissues, but predominantly in adrenal gland, bone marrow, brain, fetal brain, lung, placenta, prostate, skeletal muscle, testis, thymus and retina.

[0145] FIG. 12: Expression profile of ZFYVE26 in rats by in situ hybridization with a pool of three antisense probes or a pool of three sense probes. No specific staining was observed with the sense probes. The same results were obtained using the pool of three probes or each probe independently.

a) Comparison of ZFYVE26 (SPG15) and KIAA1840 (SPG11) mRNA expression in the adult rat brain (P68). Both ZFYVE26 and KIAA1840 expression resemble expression of the neuronal marker NeuN more than expression of the glial marker GFAP labelled on adjacent slices. ZFYVE26 expression, as KIAA1840, was low throughout the brain except in the following structures: HIP, hippocampus; PG, pineal gland; GrC, granular cell layer of the cerebellum; and the edges of the ventricles (DV3, third ventricle; LV, lateral ventricles). b) In situ hybridization of ZFYVE26 in E14.5 rat embryos. Labelling concerns mainly the liver, lungs and the nervous system, particularly the spinal cord, the cortical, hippocampal, cerebellar and thalamic neuroepithelia, as well as the inferior and superior colliculi and the tegmental and basal telencephalic areas.

[0146] FIG. 13: Overexpression of ZFYVE26 in cell culture.

Expression in COS-7 cells of a spastizin-HIS-V5 fusion protein labeled 48 hours after transfection with an antibody against the V5 tag (green) compared to specific markers (red). Images were obtained using a Leica SP1 confocal microscope (objective x63, scale bar=10 .mu.m). The Pearson coefficient (Rr) was calculated to estimate the degree of colocalisation between spastizin-HISV5 and the organelle markers. The values range from -1.0 (not colocalized) and +1.0 (fully colocalized). Spastizin partially co-localized with the endosomal marker EEA1 and the endoplasmic reticulum marker calreticulin but did not show any significant colocalisation with Golgi (anti-Giantin), mitochondria (anti-Cox2) and lysosomes (anti-Lamp2). Expression of a V5-tagged fusion protein of the expected size was verified on western-blots of cell extracts with an anti-V5 antibody (data not shown).

[0147] FIG. 14: Immuno-detection of the endogenous spastizin protein [0148] 14-1: Localisation of the 4 peptides (Table 6) used for immunization along the protein. [0149] 14-2: Western blot showing the detection of the protein by the PER antibody at its expected size (280 KDa) in COST protein extracts except after preadsorption with the peptide. Note the detection of an additional specific band at 100 KDa probably corresponding to a smaller isoform. [0150] 14-3: Immuno-detection in cells using the PER antibody. (A-G): Immunohistochemical analysis of cells stained by anti-spastizin antibody. (A-D): in rat brain. (A) Large Betz cells of motor cortex stained by anti-spastizin antibody PER. Note spastizin in the cytoplasm & in the proximal dendrites of Betz cells; (B) spastizin staining blocked by PER antibody+peptide; (C) Purkinje cells of cerebellum stained by anti-spastizin antibody PER. Note cytoplasmic as well as nuclear staining of Purkinje cells by spastizin; (D) spastizin staining blocked by antibody+peptide; (E-G) in human brain. (E) Large Betz cells of motor cortex stained by anti-spastizin antibody PER. Note spastizin in the cytoplasm & in the proximal dendrites of Betz cells; (F) spastizin staining blocked by PER antibody+peptide; (G) motor neurons of spinal cord stained by anti-spastizin antibody PER. Note cytoplasmic as well as dendritic staining by spastizin; (H) spastizin staining blocked by antibody+peptide; (I-K) Confocal microscopic analysis of human neuronal cells (SH-SY5Y) stained by anti-spastizin antibodies PER. Note cytoplasmic staining of cells and partial co-localisation of SPG15 (in green) with mitochondria (Erab, in red), see merge pictures for co-localisation. In blue, nuclear counterstaining with Dapi.

EXAMPLE

Material & Methods

[0151] Patients and controls: We selected 8 previously described SPG15-linked AR-HSP families (Elleuch et al. 2007, Boukhris et al. 2008a and 2008b, Hughes et al. 2000), one large kindred partially reported (Casali et al. 2004) that we found significantly linked to SPG15 with a significant multipoint LOD score of +3.3 (FSP-761, Muglia et al. submitted), 3 families with linkage analysis compatible with segregation of SPG15 in patients and 3 index cases of families with a compatible phenotype. Affected patients and their relatives were recruited with their informed and written consent, as prescribed by the law on bioethics of the European Community and after approval by the local ethics committee (approval No. 03-12-07 granted to Drs. Brice and Durr by the "Comite Consultatif pour la Protection des Personnes et la Recherche Biomedicale", Paris-Necker). Genomic DNA from 300 unrelated healthy individuals (Caucasians n=200, North Africans n=100) were used as a control panel for molecular studies.

[0152] Linkage analysis: To further reduce the SPG15 interval, indirect genetic studies were undertaken in 2 of the families reported by Elleuch et al 2007. Primers flanking new polymorphic nucleotide repeats (table 4b) from the Working Draft of the Human Genome available at UCSC were designed in order to identify new critical recombination events in these 2 families that would allow the reduction of the SPG15 locus interval. Genotyping was performed by PCR with fluorescently-labeled primers, electrophoresis on an ABI-3730 sequencer and analysis with GeneMapper software 4.0 according to the manufacturer's recommendations (Applied Biosystems). Haplotypes were reconstructed manually by minimizing the number of recombination events. Genetic distances between markers were those of the Marshfield Centre for Medical Genetics (http://research.marshfieldclinic.org/genetics/home/index.asp) and map positions were verified on the draft of the Human Genome sequencing (UCSC and Ensembl centres).

[0153] Mutation screening: Four genes were screened for mutations in one affected member of each of the 15 families, using primers flanking the exon and intron-exon boundaries: ZFYVE26 (for zinc finger FYVE domain containing 26, Genbank accession number NM.sub.--015346; 42 exons); PLEK2 (encoding pleckstrin 2, NM.sub.--016445; 9 exons); PLEKHH (for pleckstrin homology domain containing, family H [with MyTH4 domain] member 1, NM.sub.--020715; 9 exons); and WDR22 (encoding WD repeat domain protein 22, NM.sub.--003861; 9 exons). PCR were performed in 10 .mu.l final volume using 1 pmol of each primer, at final concentrations of 1.5 mM MgCl2, 0.24 mM dNTP, 50 ng of matrix genomic DNA in the Quiagen buffer supplemented with the Q solution (1/5 vol) and 0.4 unit of Taq polymerase (Quiagen). Primers used for the amplification of the ZFYVE26 gene are listed in the following Table 4. The PCR conditions are as follows: [0154] 95.degree. C., 10 min [0155] then 35 cycles of: [0156] 95.degree. C., 30 s [0157] 60.degree. C., 30 s, [0158] 72.degree. C., 30 s [0159] then [0160] 72.degree. C., 10 min, and kept at 4.degree. C.

TABLE-US-00004 [0160] TABLE 4 Primers used for the amplification of all exons of the ZFYVE26 gene. Exon SEQ ID NO: Forward sequence (5'-3') Reverse sequence (5'-3') 1 34/35 cagccaggtagctgatttcc aattcagcaggaacctcccta 2 36/37 ataggaatccgcgtgaagag gcagccaggcttacattcag 3 38/39 caccgcacttggctaatttt ggcacaagactcatggtggt 4 3/4 tgcttcatcttagagaaatagcagaa atgggcaacatcttggagac 5 5/6 gaaagcatgaaggcacacaa ggctgggcatactggaatta 6 40/41 tgaagctcccaagggaagta cgatgtaaaatgactgcaactg 7 42/43 ctcccaaagtgctgggatta ctctgcattcagcctaagcc 8 7/8 cttaggctgaatgcagagcc ggtcaacattgccaactcaa 9 44/45 ggccctttctaggacctttc agacctcctcaccaccctct 10 9/10 aggaagtgcagggaactgaa ccctgggtgaaataaaacca 11a 11/12 taaatgagctaaagttgcgagaa cctgaggaaggcccctatt 11b 13/14 gaagtcagaacggggttcc ggtgacgatatgccctgagt 12 46/47 tcagaacactggggtatgctc gcatggaaaatttctgaaagg 13 48/49 acccaggtgaactctgttgc gctaaaatctggccatctgc 14 50/51 gtttgcccttcatttgagga cttgatgtggacccctgagt 15 52/53 tgaggctttggtggttttct tggacgtatcaggtttgctg 16 54/55 gaaaaagccctccctcatct ccatctgcctcctccaataa 17 56/57 tttgcattccctcttccttc tgttgctgacctaatgttcca 18 58/59 tgtcagccagtcaaaccaaa cctctgctccaaagtgcttc 19 60/61 ctggctgggaatcacttgtc gccagagatgaataagagagga 20 62/63 gagagcaggagttggctgtc agtgcagagtcacccactga 21a 15/17 caattaggaacttttatttacatttgc actcccgggctacctgct 21b 18/19 ctctgccttggcctttctta gggcttctctctagagttaccg 22 64/65 tcttccttctgaaagtctcatgg atgcaaagcaaaacccagac 23 66/16 tcctggataggttcactctgc ccgcctcggccagaatgtg 24 67/68 tgaacagtaagcctgcttcaa agctgagattgcatgggatt 25 69/70 gagaaagggttagtccaaaatga ggcaaaagagccattgaaaa 26 20/21 cccctcatctggtgaaggta tcctccaagaccaagatctctc 27 71/72 gtttgtttttcgaggcgttt ttctgaaggatagaataaggcaaga 28 22/23 tcaggaggcacacaatgttc atggctgtttgagggtgtct 29 24/25 gcccatcagctgacagatatt tggcatttcagtgtgaatgtt 30 73/74 cgcataggaaggaagacaca ggctgatacaaatgccaagaa 31 75/76 aagcaaacaaaaggaaccaagg ccaagatgttcattattttctgc 32 26/27 gctttcttgtagaatctggttcc ggaagaacacttgagatctgg 33 77/78 gaatcgtttgaacccaggag gtcatgtccccgattctacc 34 30/31 ggcagatagtgggaatgagg cttgatgctgagccaggact 35 79/80 cacaacgtgcaggtttgttac gttgtgcagagtcccctgtt 36 32/33 aggagagaagtgaagcagtcg gctctagggtcagccaaaca 37 81/82 ccagtcagtgcacttcagga caggattcaaggaatggacaa 38 34/35 tggcacataggtgctcaataa gaggcagccatcaaacaaac 39 83/84 tggtgatcaggtccattttg tcttgaatttgacccagttctgt 40 85/86 tgtggatgcttcctaaaggtc ccattattgcagaggggttc 41 87/88 caggcagacattttcattctga gtccatgttcacctgctcct 42 89/90 gcatatgtccagaatattgaaaga tgcgtgaaaggtcctatcct

[0161] These primers flanking newly described polymorphic markers were designed by the inventors on the human genome sequence draft in order to use them for the identification of critical recombination events in the SPG15 linked families. This was indeed successful since one of these markers revealed to be a flanking marker of the region (see FIG. 1) which allowed to focus the analysis of the candidate genes in the interval. Analysis of these markers was as described by Stevanin et al, 2006, a classical methodology for the analysis of microsatellite markers.

TABLE-US-00005 TABLE 4 bis: primers for the VNTR (VNTR = variable number of tandem repeat). VNTRs/chromosomal position SEQ ID NO: Forward sequence (5'-3') Reverse sequence (5'-3') VNTR20CA (66.57 Mb) 91/92 tctaatcaaagcgctaggc tgttgactttgtacccctgc VNTR25TG (66.91 Mb) 93/94 gcagcagcaaagcaaagatag cctgtaatctcaaacattcc VNTR17CA (66.66 Mb) 95/96 caaggacctaatgaattcct ggaattttcattctctgggc VNTR17AC (69.75 Mb) 97/98 gtgtgtagctgtcagtcaga ttgaagacagctccccttatc

[0162] PCR products of ZFYVE26 or other genes in the interval were sequenced using the Big Dye Terminator Cycle Sequencing Kit v3.1 (Applied Biosystems) on a ABI-3730 automated sequencer according to the manufacturer recommendations. Nucleotides were numbered relative to the A of the start codon (ATG) of the ZFYVE26 cDNA sequence (NM.sub.--015346).

[0163] Analysis at the mRNA Level: Peripheral blood mononuclear cells from two affected patients of families FSP-130 and FSP-708, respectively, were isolated by Ficoll gradient using lymphocyte separation medium LSM 1077 (PAA Laboratories, Les Mureaux, France). Lymphoblastoid cell lines were established after infection with Epstein-Barr virus. Extraction of total RNA from .about.5.10.sup.6 lymphoblastoid cells was performed using the Rneasy Mini kit (Qiagen, Hilden, Germany), according to the manufacturer's instructions, after treatment with emetin (10 .mu.g/ml) for 8 h in order to block nonsense-mediated mRNA decay (NMD). The quality of the RNA was verified and quantified using a BioAnalyzer2100 (Agilent Technologies). Reverse transcription (RT) of .about.1 .mu.g of total RNA was performed with the SuperScript kit (Invitrogen) to obtain double-strand cDNA. The SPG15 cDNA was amplified by PCR on a Thermocycler 3800 (Applied Biosystems) with 2.5 mmol MgCl.sub.2, 1.times.Q solution, 1 U of Taq polymerase (Qiagen) in a final reaction volume of 25 .mu.l using 10 pmol of each of the following exonic primers covering exons 37 to 42 for family FSP-708 (37f: ACATCCCGCAGCTCTGGAAG (SEQ ID NO.degree. 122, 42ar: GCAACATATCAGGTAGGCCC (SEQ ID NO.degree. 123)) and exons 30 to 33 for family FSP-130 (30f: TGTACCAGAGGAGCCTTCAG (SEQ ID NO.degree. 124), 33r: CTCAACGCCCAGTTGGTAGT (SEQ ID NO.degree. 125)). The PCR conditions for both sets used an annealing temperature of 60.degree. C. PCR products were verified for their size and specificity on a 2% agarose gel, then sub-cloned in the pcDNA3.1/V5-His.COPYRGT. TOPO.RTM. TA vector using TOP10 bacteria according to the manufacturer's recommendations (Invitrogen). Plasmid DNA extracted from bacterial clones with the Jetstar 2.0 kit (Genomed, Lohne, Germany) was amplified by PCR and clones having integrated the mutated allele were subsequently sequenced using universal and specific primers.

[0164] Quantification of ZFYVE26 mRNA in human tissues by RT-PCR: ZFYVE26 mRNA: expression was analysed semiquantitatively by RT-PCR in adult human tissues, normalized with respect to vimentin (VIM) expression. One microgram of commercially available RNA (Human Total RNA Master panel II, Clontech) were reverse-transcribed with the High Capacity cDNA Archive Kit (Applied Biosystems) primed with Oligo d(T)16 (Applied Biosystems) in accordance with the supplier's recommendations. A 470 bp fragment from exon 2 to exon 5 was amplified with forward primer 5'-aggggatatcccaaagaggg-3' (SEQ ID NO: 99) and reverse primer 5'-cctttcgaatgaggtccacc-3' (SEQ ID NO: 100), and a 507 bp fragment including exons 38 to 42 was amplified with forward primer 5'-tcaccactttgcctctgcca-3' (SEQ ID NO: 101) and reverse primer 5'-gccactgggcacagatgtct-3' (SEQ ID NO: 102). A 274 bp fragment of VIM (Genbank accession number NM.sub.--003380) containing exons 1 to 4 was amplified with forward primer 5'-accagctaaccaacgacaaa-3' (SEQ ID NO: 103) and reverse primer 5'-tgctgttcctgaatctgagc-3' (SEQ ID NO: 104), as a reference.

[0165] Expression of rat ZFYVE26 mRNA detected by in situ hybridization: Adult (P68, 200 g) Sprague-Dawley rats (Charles River) were killed by decapitation and their brains were rapidly extracted and frozen in isopentane at -50.degree. C. Sections were cut every 600 .mu.m on a cryostat (-20.degree. C.) from the medulla to the striatum (+1.7 mm from the bregma, according to the rat brain coordinates of Paxinos and Watson, thaw-mounted on glass slides and stored at -80.degree. C. Whole rat embryos (E14.5) were fixed in PFA 4% for 24 hours, rinsed in PBS, dehydrated in graded ethanols (70% to 100%), re-hydrated using the reverse procedure, cryoprotected in 15% sucrose for 24 hours, then frozen in isopentane at -35.degree. C. Sixteen micron slices were cut every 250 .mu.m and stored.

[0166] Rat ZFYVE26 mRNA expression was probed with three 34 bp antisense oligonucleotides recognizing exon 15 or the 5' or 3' portions of the large exon 21, designed with Helios ETC oligo design software (Helios Biosciences, Paris, France) from the mRNA sequence (XM.sub.--234335.3) of Rattus norvegicus. Each oligonucleotide or a mix of the three oligonucleotides gave identical results. A mix of three sense oligonucleotides was used as negative control. Briefly, the oligonucleotides were labeled with [.sup.35S]-dATP using terminal transferase (Amersham Biosciences) to a specific activity of 5.times.10.sup.8 dpm/.mu.g. The day of the experiment, slices were fixed in 4% formaldehyde in PBS, washed with PBS, rinsed with water, dehydrated in 70% ethanol and air-dried. Sections were then covered with 140 .mu.l of hybridization medium (Helios Biosciences, Paris, France) containing 3-5.times.10.sup.5 dpm of the labeled oligonucleotide mix. Slices were incubated overnight at 42.degree. C., washed and exposed to a BAS-SR Fujifilm Imaging Plate for 5-10 days. The plates were scanned with a Fujifilm BioImaging Analyzer BAS-5000 and analyzed with Multi Gauge Software (Fuji).

[0167] Immunohistochemistry in rat brain: Brains were processed as for in situ hybridization. Sections were fixed in 4% paraformaldehyde/PBS, preincubated in PBS containing 6% goat serum and 0.1% triton, then incubated in the same buffer with antibodies against NeuN (Chemicon International, 1/250, mouse) or GFAP (Dako, 1/500, rabbit) or the specific anti-spastizin antibodies, followed by biotinylated horse anti-mouse or rabbit IgG and ABC reagents (Vector Laboratories, Burlingame, Calif.). Labeling was revealed by autoradiography. Specificity of the anti-spastizin antibodies was verified by preincubation of the antibody with a large amount (.times.200) of peptide used for immunization (se FIG. 14).

[0168] Expression of epitope-labeled or endogenous spastizin in cultured cells: The ZFYVE26 cDNA from clone DKFZp781H1112Q (RPDZ) was PCR-amplified using Easy-A polymerase (Stratagene) and primers 5'-ggctcaaacatggctgcgct-3' and 5'-cttcttggagcctgggcca-3', and the PCR product was introduced in phase with the V5 and HIS tags in the pcDNA-3.1/V5-HIS-TOPO cloning vector, as recommended by the supplier (Invitrogen). The construction was verified by sequencing after ligation, transformation, plasmid extraction, using standard procedures, and correction of an initial nonsense mutation by directed-site mutagenesis (Quick-Change Site-Directed Mutagenesis Kit, Stratagene).

[0169] COS-7 cells, maintained in DMEM (Invitrogen) supplemented with 10% fetal bovine serum, penicillin (100 UI/ml) and streptomycin (100 .mu.g/ml), were plated on cover slips coated with collagen and transfected 24 hrs later with 2 .mu.g plasmid DNA per well, in 6-well plates with DMRIE-C, according to the manufacturer's instructions (Invitrogen). The cells were fixed for 15 minutes in 4% formaldehyde, 48 hours post-transfection, and immunocytochemistry was performed using classical procedures with the following primary antibodies: rabbit anti-giantin (1/2000, Abcam), rabbit anti-calreticulin (1/400, Stressgen), mouse anti-EAA1 (1/1000, BD Biosciences), rabbit anti-Cox2 (1/400, gift of Dr. A. Lombes), mouse anti-Lamp2 (1/200, Abcam), mouse anti-V5 (1/200, Invitrogen) mouse anti-erab (1/2,000, abcam) and rabbit anti-V5 (1 .mu.g/ml, Sigma). Secondary antibodies were alexa-488 anti-mouse and anti-rabbit (1/1000, Molecular Probes) and Cy3 anti-mouse and anti-rabbit (1/1000, Sigma). Cells were counterstained with DAPI (1 .mu.g/ml, Sigma) and mounted with Fluoromount-G (Southern Biotech). Images were acquired with a Leica SP1 confocal microscope and Leica software.

[0170] To detect the endogenous protein, COS-7 or SHSY5Y cell lines were cultured using a classical procedure as mentioned above. Protein extracts were processed for western-blot analysis after cell lysis, run on acrylamide gel, transfer into cellulose membrane and immuno labeling using a chemioluminescence kit (Pierce) as described (Latouche et al, 2006).

Results:

1. Refinement of the SPG15 Locus

[0171] The inventors recently refined the SPG15 locus in two large Arab families with AR-HSP and mental retardation but not maculopathy (Elleuch et al. 2007). To further restrict this interval, the authors analyzed additional polymorphic markers found in the Human Genome sequence draft (table 4b). Obligatory recombination events between loci VNTR25TG and D14S1069 (patient 444-6), and between loci D14S588 and D14S1029 (Individual 353-11, who is still unaffected at age 18 and assumed to be non-carrier of the disease gene), refined the centromeric and telomeric boundaries of this locus to a 2.64 Mb interval on chromosome 14q23.3-q24.2 (FIG. 1) containing 23 known genes and five putative new genes (FIG. 2).

2. Candidate Gene Analysis

[0172] Mutations causing other HSPs have been reported to affect cellular processes such as intracellular trafficking and mitochondrial function, but also myelination and development of corticospinal tract (Stevanin et al. 2008a). This information provided the inventors with criteria for selecting candidate genes located in the 2.64 Mb SPG15 interval (FIG. 2). The inventors first sequenced the exon and intron-exon boundaries of PLEK2, PLEKHH1 and WDR22. No disease causing alterations, but only already reported single nucleotide polymorphisms (reported at UCSC, available on request), were found in several affected patients of the families. Two other genes have been reported excluded by the authors previously (Elleuch et al. 2007).

[0173] The inventors then analysed the gene encoding ZFYVE26, which appeared to be a good candidate, since missense and nonsense mutations in two other genes of the same family were recently identified in patients with SPG33 (ZFYVE27 on chromosome 10q24.2; MIM#610244, Mannan et al. 2006) and Charcot-Marie-Tooth disease 4H (FGD4 on chromosome 12p11.21; MIM#611104, Delague et al. 2007, Stendel et al. 2007). Heighteen different truncating ZFYVE26 mutations were detected in the index patients of the 16 families (FIGS. 2 and 3, table 2). The 18 mutations segregated with the disease in all families (FIGS. 3 to 10) and they were not detected in a panel of 600 chromosomes from unrelated controls (Caucasians, n=400; North Africans, n=200).

[0174] Seven were nonsense mutations including two that were recurrent: c.1477C>T in two consanguineous Tunisian families (F16 and F17) with similar flanking haplotypes suggesting a common ancestral event (Boukhris et al, 2008a and 2008b) and c.4312C>T in patients from two apparently unrelated consanguineous families from Morocco (F444) and Ireland (F1007), in which the mutation probably resulted from deamination of cytosine 4312 located in a CpG pair, a documented mechanism of mutation (Glass et al. 2007).

[0175] Four mutations were frameshift deletions including a large 70 base pair deletion (c.6702.sub.--6771del) in a large consanguineous family of Arab origin from Israel (F671).

[0176] Two mutations were frameshift insertions.

[0177] Four mutations affected the splicing sites. The c.5485-1G>A was homozygous in patients of the Algerian family 353, and was shown, in silico, to strongly alter the splice score from +3.1 to -7.8. The c.5791-6G>A, found heterozygous in the French family FSP130, creates a new acceptor splicing site in exon 32 with a better score leading to abnormal splicing 4 bases before its normal position, with the appearance of a premature stop codon after 27 additional codons which was confirmed by direct sequencing of mRNA extracts of patients (see FIG. 4). The c.6011G>C mutation (Portuguese family FSP352) corresponds to a missense variant (p.S2004T), but its location near the donor site of exon 32 is predicted to abolish the splicing at this position (score of +0.7 vs +4.5). The heterozygous c.7128+2T>A mutation in the French kindred FSP708 affects the donor site of exon 38 which is strongly abolished (score -4.8 vs +5.9) according to in silico predictions. This latter mutation was confirmed by direct sequencing of mRNA extracts of patients (see FIG. 3) leading to exon 38 skipping and a premature stop codon in exon 39.

[0178] Finally, one mutation was a complex indel-inversion rearrangement that deleted exons 21-23 in four patients from a consanguineous Italian family (F761) and leading to a premature stop codon (FIG. 7). For the detection of the genomic rearrangement in family 761, primers 21aF and 23R were used and generated a 238 bp-fragment in mutation carriers only instead of 3,532 bp in controls. This was due to deletion of a large sequence fragment containing exons 21, 22 and 23 and surrounding sequences, a small TCTA insertion and a 95 bp inversion).

3. Phenotype of SPG15 Mutation-Carriers and Phenotype-Genotype Correlations

[0179] Some of the clinical features of the 22 patients from 8 of the 16 SPG15 families are summarized in the Table 5.

TABLE-US-00006 TABLE 5 Clinical and paraclinical features of 22 SPG15 patients. Sex/Age at Disease Functional Cognition mily/ onset duration handicap Mental Cognitive Cerebellar patient (years) (years) (Scale) LL/UL reflexes Retardation deterioration Signs 16/161 M/12 20 Severe (6/7) Brisk/Brisk + (Moderate) No No 30/274 F/11 17 Severe (6/7) Very brisk/ + (Moderate) No No Brisk 30/275 F/8 19 Severe (5/7) Very brisk/ + (Moderate) No No Brisk 30/279 F/8 1 Mild (2/7) Very brisk/ + (Mild) No No Normal 761/3 M/12 26 Severe (6/7) Very brisk/ No + (Severe) + Very brisk 761/5 F/12 22 Severe (6/7) Very brisk/ No + (Mild) + Normal 761/9 M/9 12 Severe (5/7) Very brisk/ No + (Mild- No Brisk Moderate) 761/10 M/5 12 Moderate (4/7) Very brisk/ + No No Normal 17/168 F/14 6 Moderate (3/7) Brisk/Normal No No No 1007/3 F/13 20 Severe (6/7) Brisk/Brisk + + + 1007/4 M/14 18 Severe (6/7) Brisk/Brisk + + + 1007/5 M/16 14 Severe (6/7) Brisk/Brisk + + + 353/3 F/12 20 Severe (6/7) Brisk/Brisk No + + 353/4 M/10 20 Severe (6/7) Brisk/Brisk No No + 353/6 F/10 15 Moderate (4/7) Brisk/Normal No No No 353/10 M/10 6 Moderate (3/7) Brisk/Normal No No + 444/7 F/12 15 Severe (7/7) Brisk/Brisk No + + 444/6 M/12 15 Severe (5/7) Brisk/Brisk No No + 444/9 F/16 2 Moderate (3/7) Brisk/Brisk No No No 671/10 F/<10 >13 Moderate (4/7) Very brisk/ No + No Brisk 671/4 F/18 6 Moderate (4/7) Very brisk/ No + No Brisk 671/5 F/19 4 Moderate (3/7) Brisk/Brisk No + No mily/ Visual patient function Others signs ENMG Brain MRI 16/161 Normal Pes cavus, pseudo bulbar dysarthria, Axonal PNP Normal severe UL and LL amyotrophy 30/274 Normal Pes cavus, scoliosis, pseudo bulbar Axonal PNP Normal dysarthria, moderate LL amyotrophy 30/275 Normal Severe LL amyotrophy ND ND 30/279 Normal None ND Normal 761/3 Reduced visual Pseudo bulbar dysarthria; oral and hand Axonal PNP TCC, WMA, marked acuity dystonia-Sensorineural hearing deficit cortical atrophy, mild cerebellar atrophy 761/5 Normal Pseudo bulbar dysarthria. Sensorineural Axonal PNP TCC, cortical and hearing deficit cerebellar atrophy 761/9 Pigmentary Pseudo bulbar dysarthria and nystagmus Axonal PNP TCC and WMA retinopathy Sensorineural hearing deficit 761/10 Normal Pseudo bulbar dysarthria Normal TCC 17/168 Normal Pes cavus ND TCC, cortical and mild cerebellar atrophy 1007/3 Macular Epilepsy, distal amyotrophy, bladder Normal Diffuse cerebral pigmentation dysfunction atrophy 1007/4 Macular Bladder dysfunction, pseudo bulbar Normal ND pigmentation dysarthria, distal amyotrophy, 1007/5 Normal Focal dystonia, distal amyotrophy, Normal ND bladder dysfonction Decreased vibration sense, distal 353/3 Normal amyotrophy, pes cavus, bladder Axonal PNP ND dysfunction 353/4 Normal Decreased vibration sense, distal ND ND amyotrophy, pes cavus 353/6 Normal Decreased vibration sense ND ND 353/10 Normal Pes cavus, Axonal PNP ND 444/7 ND Decreased vibration sense ND ND 444/6 ND Decreased vibration sense ND ND 444/9 ND Pes cavus, ND ND 671/10 Normal Decreased vibration sense, distal ND ND amyotrophy, bladder dysfunction 671/4 Normal Raynaud phenomenon, high-arched Axonal PNP TCC, WMA, mild palate, wide interdental spaces, distal cortical atrophy amyotrophy, bladder dysfunction 671/5 Normal Hands extrapyramidal rigidity, mild hand ND TCC, WMA tremor, decreased vibration sense, distal amyotrophy, indicates data missing or illegible when filed

[0180] The overall phenotype associated with SPG15 mutations was early-onset spastic paraplegia (range: 5 to 19 years) associated with additional neurological symptoms that varied among patients and families: cognitive deterioration or mental retardation (73%, 16/22), axonal neuropathy (67%, 8/12), mild cerebellar signs (36%, 8/22) and, less frequently, a central hearing deficit, decreased visual acuity or retinal degeneration. A thin corpus callosum and white matter hyperintensities were found on brain MRI in 64% (7/11) and 36% (4/11) of the patients, respectively, independently of disease duration.

[0181] Most mutations resulted in the loss of the c-terminal putative leucine zipper domain and, of the FYVE domain as well. Since all mutations resulted in premature stop codons, the RNA is probably degraded by non-sense mediated mRNA decay, but this could not be confirmed because cells of SPG15 patients were not available.

4. Analysis of the Expression of the SPG15 Gene

[0182] In order to obtain insight into the function of the SPG15 gene, the inventors first analyzed expression of ZFYVE26 mRNA by RT-PCR on total RNA from various human tissues. It was widely expressed, but most strongly in the adrenal gland, bone marrow, adult brain, fetal brain, lung, placenta, prostate, skeletal muscle, testis, thymus and retina (FIG. 11). Intermediate levels were detected in other structures, including spinal cord.

[0183] When the expression of ZFYVE26 was investigated by in situ hybridization in adult rat brain (P68), mRNA levels were generally low, but strong signals were observed in the pineal gland, the edges of the lateral ventricles, the granular layer of the cerebellum and the hippocampus (FIG. 12). Interestingly, expression was wider and stronger in rat embryos (E14.5) than in adult brain, in particular in the spinal cord and the cortical, cerebellar, thalamic and hippocampal neuroepithelia.

[0184] The ZFYVE26 protein or "spastizin" (SPASTIcity due to the ZFYVE26 proteIN), belongs to the FYVE-finger family which includes the early endosome antigen 1 (EAA1, MIM#605070), involved in endocytic membrane trafficking (Gilloly et al 2001, Seet et al. 2001). Because there was initially no antibody against endogenous spastizin, the inventors explored its subcellular location by overexpression of a spastizin-HIS-V5 fusion protein in COS-7 cells. Epitope-tagged wild-type spastizin expressed in COS-7 cells, and immunolabeled with antibodies against the V5 tag, was partially colocalized in small dots or vesicles with immuno labeled endosomal marker EAA1 and calreticulin (CALR, MIM#109091), a marker of the endoplasmic reticulum, but not with giantin (GOLGB1, MIM#602500), lysosomal-associated membrane protein 2 (LAMP2, MIM#309060) or mitochondrially encoded cytochrome c oxidase II (MT-CO2 [COX2)], MIM#516040), markers of the Golgi apparatus, lysosomes and mitochondria, respectively (FIG. 6).

[0185] In order to gain insight into the endogenous expression of spastizin, the inventors have then generated 4 polyclonal anti-spastizin antibodies using the Proteogenix facility (Table 6). Purified sera have been verified for their specificity on the endogenous proteins from various cell lines (COS-7, NSC34, SHSY5Y). One of them generated a specific signal at the expected size in western-blot (PER, FIG. 14), which was verified by competition tests with the peptides used for immunization.

TABLE-US-00007 TABLE 6 Peptide sequence used for immunozation of rabbits. Name Sequence SEQ ID NO.degree. LRR LRRGEWELAQACVPQL 126 PER PERLAALLAQENLSLSVP 127 PAA PAAVTRLRNQLLEAEYYQL 128 AAK AAKSSGDAVVQDICA 129

[0186] Thanks to the Brain Bank of INSERM/UPMC UMR679 (Dr E Hirsch) and the Neuropathology Department of the Pitie-Salp triere Hospital (Pr C Duyckaerts) for providing us paraffin embedded human brains, we have prepared sections from the human and the rat brain (adult female rat, P63). Immunohistochemical studies have been undertaken to determine the expression profile and subcellular localization of spastizin (SPG15) protein.

[0187] Expression studies with anti-spastizin revealed widespread pattern of expression of endogenous spastizin in the central nervous system of the adult rat. Spastizin is prominent in the cytoplasm of the cells though sometimes it is also observed in the nucleus of cells (FIG. 7C). Strongest expression of spastizin is found in the cerebral cortex, where the cells strongly express spastizin in their cytoplasm, including the Betz cells of layer V motor cortex (FIG. 7A). Spastizin is also expressed in the cells of cerebellum, hippocampus and the pons (FIG. 7C). This pattern of spastizin expression in brain cells was blocked by pre-incubation of the antibody with the peptide confirming specificity of spastizin staining (FIG. 7B, D).

[0188] In the adult human brain, Spastizin (SPG15) is also expressed strongly in neurons of cerebral cortex, spinal cord (FIG. 7E,G), and the pons and weakly in neurons of hippocampus and in the fibres of corpus callosum. Spastizin is pre-dominant in the cytoplasm of neurons sometimes also expressed in dendrite-like processes. Such immunoreactivity or pattern of expression was blocked by pre-incubation of the antibody with the peptide confirming that the staining observed are specific to spastizin (FIGS. 7F and H).

[0189] In SH-SY5Y (human neuroblastoma) and NSC34 (rodent motor-neuron), we observed cytoplasmic staining of cells. In both cell lines, spastizin seems to be distributed diffusely across the cytoplasm sometimes also staining punctuated vesicle-like structures (FIG. 7 I-K). This pattern of staining was specific as we did not observe it in cells treated only with secondary antibody. Its partial colocalization with Erab, a marker of mitochondria contrast with the results obtained in COS7 cells with the COX2 marker and might reveal cell type differences.

Discussion

[0190] The inventors, after identification of new families linked to the SPG15 locus (Elleuch et al. 2007, Boukhris et al. 2008a and 2008b) and its restriction to less than 6 Mbases (Elleuch et al. 2007), have then further refined the SPG15 locus to a 2.64 Mb interval on chromosome 14q23.3-q24.2 thanks to the analysis of newly described and designed markers in the interval (FIG. 1), which allowed them to identify ZFYVE26 as the causative gene.

[0191] Different pieces of evidence argue for the ZFYVE26 gene as responsible for SPG15: 1) the eighteen identified mutations segregated with a complex phenotype in 16 families, 2) 8 of these families were previously reported linked to SPG15, some of them significantly (Elleuch et al. 2007, Boukhris et al. 2008a and 2008b) and one was used to originally map the disease locus (Hughes et al. 2000), 3) the mutations were not found in a large series of control chromosomes (n=600), 4) among the genes of the restricted interval, 5 others were screened and no mutations were found, 5) the putative function of ZFYVE26 has already been implicated in other forms of HSP (Stevanin et al. 2008a) and its connection with endosomal trafficking has been highlighted by the inventors by overexpression studies (FIG. 6), 6) the expression profile in rat brain (FIG. 12) resembles SPG11, another HSP gene identified by the inventors (Stevanin et al, 2007).

[0192] The inventors have demonstrated the broad clinical variability of Kjellin syndrome, which is complete in only a minority of our mutated patients. The core features common to all mutated cases was a severe and early onset spastic paraplegia frequently associated with mental retardation and/or cognitive deterioration. Retinal degeneration, a major feature of this syndrome, as well as the MRI anomalies, may be absent in some patients, even after long disease durations, indicating that SPG15 might account for other forms HSP as well.

[0193] Spastizin, the product of the ZFYVE26 gene, is one of more than 30 different proteins with a FYVE domain in mammals (Gilloly et al. 2001, Seet et al. 2001). The FYVE domain is a zinc-finger binding domain, highly conserved from yeast to humans, characterized by the presence of eight conserved cysteine residues, the third of which is flanked by characteristic basic amino acids, CX.sub.2CX.sub.9-39RRHHCRXCX.sub.4CX.sub.2-6CX.sub.4-48CX.sub.2C(X=non-co- nserved amino acid residues), suggested to bind the FYVE-finger proteins to endosomes. The majority of FYVE-finger proteins are involved in interactions with different forms of phosphoinositides (e.g. phosphatidylinositol 3-phosphate [PtdIns3P; PI3P]), which are found mainly in endosomes and serve as regulators of endocytic membrane trafficking. These phospholipids are components of membranes and have been implicated in the recruitment of proteins to membranes for signal transduction, membrane trafficking, cytoskeletal functions and apoptosis. FYVE fingers bind with much higher affinity to membrane-associated PI3P than to its soluble analogues, explaining why most FYVE finger proteins are associated with endosomal trafficking.

[0194] The colocalization of spastizin with markers of the endoplasmic reticulum and endosomes suggests that this protein plays a role in endosomal trafficking. Using a newly developed specific antibody against spastizin, the inventors confirmed that the endogenous protein labels vesicle-like structures (FIG. 14). This contributes to accumulating evidence that defects in trafficking are an important underlying cause of HSP.

[0195] Additionally, the temporal and regional distribution of ZFYVE26 mRNA observed by in situ hybridization in adult rat brain was very reminiscent of the expression of the SPG11 gene (Stevanin et al. 2007), the clinical features of which overlap those of SPG15, suggesting that the corresponding proteins may interact or function in a common pathway (FIG. 12). In addition, the stronger and wider expression of ZFYVE26 in embryos, including in spinal cord and cerebellar, hyppocampal, thalamic and cortical neuroepithelia, suggests a critical role of this gene during the development (FIG. 12).

[0196] It has been previously demonstrated that an intact FYVE domain and several conserved cysteine residues in this domain are necessary for the endosomal localization of the proteins of this family. Interestingly, all of the mutations identified in the SPG15 families in ZFYVE26 were truncating mutations. Non-sense mediated mRNA decay, a well documented cellular mechanism (Frischmeyer et al. 1999, Amrani et al. 2006), probably contributes to the loss of function of this protein in all cases.

[0197] It is interesting to note that a missense mutation in the FYVE domain protein encoded by ZFYVE27 was identified in an "uncomplicated" form of autosomal dominant HSP in a single German family with SPG33 (Mannan et al. 2006). The ZFYVE27 protein product was found to bind spastin (SPG4), another HSP-associated protein, but the missense mutation in ZFYVE27 induces an aberrant structure which interferes with its interaction with spastin, and thus with microtubules. Whether spastizin also binds spastin remains to be determined.

[0198] In conclusion, the identification of ZFYVE26 as the gene responsible for SPG15 has increased the knowledge of the genetic and clinical heterogeneity of HSPs, and will help orient the molecular analysis of patients in view of a diagnosis. The in situ hybridization and colocalisation studies are also a starting point for the understanding of the normal cellular mechanisms in which spastizin participates and for the elucidation of the mechanisms underlying axonal degeneration in the SPG15, which probably include endosomal trafficking and development anomalies. Elucidation of these mechanisms will be necessary for the development of effective therapeutic strategies.

REFERENCES

[0199] Throughout this application, various references describe the state of the art to which this invention pertains. The disclosures of these references are hereby incorporated by reference into the present disclosure. [0200] Al-Yahyaee S, Al-Gazali L I, De Jonghe P, et al. A novel locus for hereditary spastic paraplegia with thin corpus callosum and epilepsy. Neurology. 2006; 66:1230-1234 [0201] Amrani, N, Sachs, M. S., and Jacobson, A. (2006). Early nonsense: mRNA decay solves a translation problem. Nat. Rev. (Mol. Cell. Biol.) 7, 415-425. [0202] Antonarakis et al. (1989), N. Engl. J. Med. 320:153-163 Diagnosis of genetic disorders at the DNA level [0203] Barbas C F, Bain J D, Hoekstra D M, Lerner R A. (1992), Semisynthetic combinatorial antibody libraries: a chemical solution to the diversity problem. PNAS USA, 89, 4457-4461 [0204] Boukhris A, Stevanin G, Feki I, et al.: Hereditary spastic paraplegia with mental impairment and thin corpus callosum in Tunisia: SPG11, SPG15 and further genetic heterogeneity. Arch Neurol 2008a, 65:393-402. [0205] Boukhris A, Feki I, Denis E, et al.: Spastic paraplegia 15: linkage and clinical description of three Tunisian families. Mov Disord 2008b, 23:429-433. [0206] Boukhris A, Stevanin G, Feki I, et al.: Tunisian hereditary spastic paraplegias: clinical variability supported by large genetic heterogeneity. Clin Genet 2009 (in press). [0207] Callebaut, I. et al. Deciphering protein sequence information through hydrophobic cluster analysis (HCA): current status and perspectives. Cell Mol. Life Sci. 53, 621-645 (1997). [0208] Casali, C. et al. Clinical and genetic studies in hereditary spastic paraplegia with thin corpus callosum. Neurology 62, 262-268 (2004). [0209] Casari, G. et al. Spastic paraplegia and OXPHOS impairment caused by mutations in paraplegin, a nuclear-encoded mitochondrial metalloprotease. Cell 93, 973-983 (1998). [0210] Chomocyznski et al., Anal. Biochem., 162:156, 1987 [0211] Cooper et al. (1991) Diagnosis of genetic disease using recombinant DNA, 3rd edition, Hum. Genet, 87:519-560 [0212] Coutinho P, Barros J, Zemmouri R, et al.: Clinical heterogeneity of autosomal recessive spastic paraplegias: analysis of 106 patients in 46 families. Arch Neurol 1999, 56:943-949 [0213] Delague, V., Jacquier, A., Hamadouche, T., Poitelon, Y., Baudot, C., Boccaccio, I., Chouery, E., Chaouch, M., Kassouri, N., Jabbour, R., et al. (2007). Mutations in FGD4 encoding the Rho GDP/GTP exchange factor FRABIN cause autosomal recessive Charcot-Marie-Tooth type 4H. Am. J. Hum. Genet. 81, 1-16. [0214] Depienne C, Stevanin G, Brice A, Durr A: Hereditary spastic paraplegias: an update. Curr Opin Neurol 2007, 20:674-680. [0215] Den Dunnen J. T., Antonarakis S. E.: Hum Genet 109 (1): 121-124, 2001. [0216] Elleuch N, Bouslam N, Hanein S, et al.: Refinement of the SPG15 candidate interval and phenotypic heterogeneity in three large Arab families. Neurogenetics 2007, 8:307-315. [0217] Engert, J. C. et al. ARSACS, a spastic ataxia common in northeastern Quebec, is caused by mutations in a new gene encoding an 11.5-kb ORF. Nat. Genet 24, 120-125 (2000). [0218] Fink, J. K. Advances in the hereditary spastic paraplegias. Exp. Neurol 184 Suppl 1, S106-S110 (2003). [0219] Fink, J. K. Hereditary spastic paraplegia. Curr. Neurol. Neurosci. Rep. 6, 65-76 (2006). [0220] Franca M C Jr, D'Abreu A, Maurer-Morelli C V, et al.: Prospective neuroimaging study in hereditary spastic paraplegia with thin corpus callosum. Mov Disord 2007, 22:1556-1562 [0221] Frischmeyer, P. A., and Dietz, H. C. (1999). Nonsense-mediated mRNA decay in Health and disease. Hum. Mol. Genet. 8, 1893-1900. [0222] Grompe M. The rapid detection of unknown mutations in nucleic acids (1993) Nat. Genet. 5 (2): 111-7 [0223] Gudbjartsson, D. F., Jonasson, K., Frigge, M. L., & Kong, A. Allegro, a new computer program for multipoint linkage analysis. Nature Genet. 25, 12-13 (2000). [0224] Gillooly, D. J., Simonsen, A., Stenmark, H. (2001). Cellular functions of phosphatidylinositol 3-phosphate and FYVE domain proteins. Biochem. J. 355, 249-258. [0225] Glass, J. L., Thompson, R. F., Khulan, B., Figueroa, M. E., Olivier, E. N., Oakley, E. J., Van Zant, G., Bouhassira, E. E., Melnick, A., Golden, A., et al. (2007). CG dinucleotide clustering is a species-specific property of the genome. Nucleic. Acids. Res. 35, 6798-6807. [0226] Harding, A. E. Classification of the hereditary ataxias and paraplegias. Lancet 1, 1151-1155 (1983). [0227] Harlow E. et al., Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, New York, (1988). [0228] Hazan, J. et al. Spastin, a new AAA protein, is altered in the most frequent form of autosomal dominant spastic paraplegia. Nature Genet. 23, 296-303 (1999). [0229] Hughes C A, Byrne P C, Webb S, et al. SPG15, a new locus for autosomal recessive complicated HSP on chromosome 14q. Neurology. 2000; 56:1230-1233 [0230] Kohler and Milstein (1975) Continuous cultures of fused cells secreting antibody of predefined specificity. Nature; 256, 495-7. [0231] Kuklin et al. Detection of single-nucleotide polymorphisms with the WAVE DNA fragment analysis system Genet. Test (1997-98), 1 (3):201-6 [0232] Lossos, A. et al. Hereditary spastic paraplegia with thin corpus callosum: reduction of the SPG11 interval and evidence for further heterogeneity. Arch Neurol 63 (5):756-60 (2006). [0233] Mannan, A. U., Krawen, P., Sauter, S. M., Boehm, J., Chronowska, A, Paulus, W., Neesen, J., Engel, W. (2006). ZFYVE27 (SPG33), a novel spastin-binding protein, is mutated in hereditary spastic paraplegia. Am. J. Hum. Genet. 79, 351-357. [0234] Martinez, M. F. et al. Genetic localization of a new locus for recessive familial spastic paraparesis to 15q13-15. Neurology 53, 50-56 (1999). [0235] Moutsimilli, L. et al. Selective cortical VGLUT1 increase as a marker for antidepressant activity. Neuropharmacology 49, 890-900 (2005). [0236] Olmez et al. Further Clinical and Genetic Characterization of SPG11: Hereditary Spastic Paraplegia with Thin Corpus Callosum. Neuropediatrics. 2006; 37:59-66. [0237] Orlacchio A, Kawarai T, Totaro A, et al.: Hereditary spastic paraplegia: clinical genetic study of 15 families. Arch Neurol 2004, 61:849-855 [0238] Patel, H. et al. SPG20 is mutated in Troyer syndrome, an hereditary spastic paraplegia. Nature Genet. 31, 347-348 (2002). [0239] Polo J M, Calleja J, Combarros O, Berciano J: Hereditary ataxias and paraplegias in Cantabria, Spain. An epidemiological and clinical study. Brain 1991, 114:855-866. [0240] Saiki et al., Science 1988, 239:487 [0241] Sambrook, Fritsch & Maniatis, Molecular Cloning: A Laboratory Manual, Second Edition (1989) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. [0242] Seet, L. F., and Hong, W. (2001). Endofin, an endosomal FYVE domain protein. J. Biol. Chem. 276, 42445-42454 [0243] Shibasaki, Y. et al. Linkage of autosomal recessive hereditary spastic paraplegia with mental impairment and thin corpus callosum to chromosome 15A13-15 Ann Neurol 48, 108-112 (2000). [0244] Simpson, M. A. et al. Maspardin is mutated in mast syndrome, a complicated form of hereditary spastic paraplegia associated with dementia. Am. J. Hum. Genet. 73, 1147-1156 (2003). [0245] Skre H. Hereditary spastic paraplegia in Western Norway. Clin Genet. 1974. 6:165-83 [0246] Stendel, C., Roos, A., Deconinck, T., Pereira, J., Castagner, F., Niemann, A., Kirschner, J., Korinthenberg, R., Ketelsen, U. P., Battaloglu, E., et al. (2007). Peripheral nerve demyelination caused by a mutant Rho GTPase guanine nucleotide exchange factor, frabin/FGD4. Am. J. Hum. Genet. 81, 158-164 (2007). [0247] Stevanin, G. et al. Spastic paraplegia with thin corpus callosum: description of 20 new families, refinement of the SPG11 locus, candidate gene analysis and evidence of genetic heterogeneity. Neurogenetics, 7, 149-156 (2006). [0248] Stevanin G, et al.: Mutations in SPG11, encoding spatacsin, are a major cause of spastic paraplegia with thin corpus callosum. Nat Genet, 39:366-372 (2007). [0249] Stevanin G, Ruberg M, Brice A. Recent Advances in the Genetics of Spastic Paraplegias. Cur Neurol Neurosci Rep, 8: 198-210 (2008a). [0250] Stevanin G, Azzedine H, Denora P, et al.: Mutations in SPG11 are frequent in autosomal recessive spastic paraplegia with thin corpus callosum, cognitive decline and lower motor neuron degeneration. Brain, 131:772-784 (2008b). [0251] Tallaksen, C. M., Durr, A., & Brice, A. Recent advances in hereditary spastic paraplegia. Curr. Opin. Neurol. 14, 457-463 (2001). [0252] Tsaousidou M K, et al.: Sequence alterations within CYP7B1 implicate defective cholesterol homeostasis in motor-neuron degeneration. Am J Hum Genet 2008, 82:510-515. [0253] Waterhouse P, Griffiths A D, Johnson K S, Winter G. (1993) Combinatorial infection and in vivo recombination: a strategy for making large phage antibody repertoires. Nucleic Acids Research, 21, 2265-2266. [0254] Winner, B. et al. Clinical progression and genetic analysis in hereditary spastic paraplegia with thin corpus callosum in spastic gait gene 11 (SPG11). Arch. Neurol. 61, 117-121 (2004). [0255] Winner, B. et al. Thin corpus callosum and amyotrophy in spastic paraplegia-Case report and review of literature. Clin. Neurol. Neurosurg. (2005). [0256] Woodcock, S., Mornon, J. P., & Henrissat, B. Detection of secondary structure elements in proteins by hydrophobic cluster analysis. Protein Eng 5, 629-635 (1992). [0257] Zhao, X. et al. Mutations in a newly identified GTPase gene cause autosomal dominant hereditary spastic paraplegia. Nature Genet. 29, 326-331 (2001).

Sequence CWU 1

1

13119688DNAHomo sapiens 1ggctcaaaca tggctgcgct gagagctcta ttgctttggg cgccgggagc aggaggtact 60ccgcgaatga gaacattgag aatgtgttcg gcataactca tttctttgta tctccctgca 120ctctgtgctg ggaaaatgaa tcatccattt ggaaaagagg aagctgcttc gcagaagcag 180ctttttggat ttttctgcga atgcctgcgg aggggagaat gggagctggc acaggcatgt 240gtacctcagc tacaggaggg acaaggggat atcccaaaga gggtagaaga catacttcag 300gcattggtgg tgtgtccaaa tctgctgaga tgtgggcagg acatcaaccc tcaaagagta 360gcctgggtct ggcttcttgt actggagaaa tggttggccc gggaaaagaa gttactccca 420gttgttttcc ggagaaagct tgagtttctt ttattgtcag aagacctcca aggtgacatt 480ccagagaaca tcctcgagga gctgtatgag accttaacac agggtgcagt aggccacgtg 540cctgacggaa atccaaggag ggagagctgg actcctcgtc tcagctccga agctgtctct 600gtgctctggg atctcctgag gcagtctccc cagccagcac aggccctgct ggagctcctg 660cttgaggagg atgacggtac tggcctctgt cactggcctc tgcagaatgc actggtggac 720ctcattcgaa aggcattgcg ggctttgcag ggccctgatt cggtgccccc tggggtagtc 780gatgccatct atggagccct gcggactctg cgttgccccg cagaaccact tggggttgag 840ttgcatctcc tgtgtgagga actactagag gcctgcagga ccgaggggag tcccctgcgg 900gaggagcggc tgctcagctg cctgctgcac aaggccagcc ggggcctgct gtccctgtat 960ggccatacct atgcagagaa ggtcacagaa aagccaccga gggctacagc ctcgggaaaa 1020gtctcaccgg atcatctaga tcctgagcgg gcaatgctag ccctgttctc caatcccaac 1080ccagccgagg cttggaaagt ggcctatttc tactgcctga gcaacaacaa acacttcctc 1140gagcagattc tggtaacagc actaacattg ttgaaagaag aagacttccc aaatcttggc 1200tgcctacttg atagagaatt caggcccctc agttgcctgc ttgtactcct gggctggaca 1260cactgccaga gcctagagtc agccaagagg ctgctccaga ccctgcacag gacccagggc 1320ccaggctgtg atgagctcct cagggatgcc tgtgatgggt tgtgggctca cctggaggtc 1380ctggagtggt gcatacagca gagcagcaac cccataccaa agagagatct gttgtatcat 1440ttacacggtg gagacagcca ctcagtgctc tacactctcc atcaccttac aaaccttcca 1500gccctcaggg aggaagatgt tctcaagctc ttacagaaag tgccagccaa ggacccccag 1560caagagcctg atgcagttga tgctccagtc cctgagcacc tgagccagtg tcagaacctg 1620acactctacc agggcttctg tgccatgaag tatgccatct atgccctctg tgtaaactca 1680caccagcact cccagtgcca ggactgcaaa gacagcctct ctgaggacct ggcctcagct 1740acagagccag cgaatgactc tctctcctcc ccaggtgctg caaatctctt ctcaacttac 1800ctggccaggt gtcaacagta tctgtgcagt attcctgact ctctgtgcct ggagcttctg 1860gaaaacatct tctcattgct tctcatcacc tctgctgatc ttcacccaga gcctcacttg 1920cctgaggact atgctgagga tgatgacatt gaggggaaga gcccctcagg tttgaggtcc 1980ccatcagaga gccctcagca catagcacat cctgaaagga agtcagaacg gggttccctg 2040ggagtcccaa agacccttgc ttatacaatg ccaagccatg tgaaggcaga gccaaaagac 2100agttacccag ggcctcatag gcacagcttt ttggacttaa aacactttac tagtggtatc 2160agtggatttc tggctgatga atttgcaata ggggccttcc tcaggcttct ccaagagcaa 2220ctggatgaga tcagtagccg cagcccccct gagaagccaa agcaagaaag tcagagctgc 2280tcaggaagca gagatggact gcagagccgc ctgcatcgac tttccaaggt tgtctctgag 2340gcccagtgga gacacaaggt ggtgacaagc aaccatcgtt cagaggagca accttcccga 2400agataccagc ctgccacacg tcaccccagt ctccgccggg gtcgtcggac aagaaggagc 2460caggcagatg gccgagacag aggttcaaac ccatccctgg aaagtacaag tagtgagctg 2520agcacaagta cgtcagaggg aagtctgagt gccatgtctg gccggaatga gctgcacagt 2580agattgcacc cccatcctca aagttcactc atccccatga tgttctcccc acctgagtca 2640ctgctggcat cctgcatcct tcgcgggaac ttcgcagaag cccatcaggt gctgttcacg 2700ttcaacctga agtcctcacc cagttcaggg gaactgatgt tcatggagcg ctaccaggaa 2760gtgatccaag aactggccca agtagagcac aagattgaaa accagaactc agatgcgggt 2820agcagcacca ttcggagaac tggcagtggc cgctcaactc tacaggccat tggcagcgct 2880gcagcagcag gaatggtgtt ttactctatc tctgacgtga ctgacaagct gctcaacacc 2940tctggagacc ccatccccat gctccaggag gacttttgga taagcacggc tctagtggag 3000cccactgctc ccctgagaga ggttctggaa gacctcagtc cccctgccat ggctgcattt 3060gacctagctt gctctcagtg ccagctctgg aaaacctgca agcagctttt ggagacagcc 3120gaacggcgtt tgaatagtag ccttgaaagg cggggtcgac ggatagacca cgtactccta 3180aatgctgatg gcattcgagg ttttccagtt gttcttcagc aaatcagtaa gagtctcaat 3240tatctgctta tgtcagccag tcaaaccaaa tcagagagtg tggaagaaaa gggaggaggc 3300cctccacggt gcagcatcac tgaactgctt cagatgtgct ggcccagcct aagcgaggac 3360tgtgttgcca gccacaccac cctctcccag cagctagatc aggtccttca gtcactgaga 3420gaggcactag agctgccaga gcccaggact cctccactgt cttccctggt ggagcaggca 3480gcccagaaag ctccagaggc agaggcccac cctgtgcaga tccagactca gctcctccag 3540aagaacctgg gcaaacagac cccatcaggc agcaggcaga tggactactt gggcaccttc 3600ttcagttact gcagcaccct tgctgcagtt ctccttcaaa gtttgagctc tgagcctgat 3660catgtggagg tcaaggtagg aaatcccttt gttctgctgc aacagagctc ttcccaactg 3720gtgtcacatc tcctgtttga gagacaagtt cccccagaga gactggcagc ccttctggcc 3780caagagaatc tcagcctaag tgtgccacag gtcatcgtca gctgctgctg tgagcccctt 3840gctctttgct catcccggca aagccagcag acctcctccc tcctgactcg tctgggtact 3900ctggcccagc tacacgcctc tcactgcctg gatgacctcc cactttctac accgagctcc 3960ccgaggacaa ctgagaaccc tacattggaa agaaagccct actcctcccc aagggactca 4020tcactcccag ccctcacctc ctctgccttg gcctttctta agtcacgctc aaagctccta 4080gctacggtgg cctgcctggg ggcttccccg aggttaaagg tcagcaaacc cagcttgtca 4140tggaaggaac ttcgtggccg cagggaggtg cctctggctg cagagcaggt agcccgggag 4200tgtgagcgcc ttctggaaca attccctctg tttgaggcct tcctcctggc tgcctgggag 4260cccctgcgag ggtctttgca gcaggggcag agtctggcag tgaatctctg tggttgggcc 4320agtctttcta ccgttctcct gggcctacat tctcccattg ccctagatgt actgagtgag 4380gcttttgagg aatccttggt ggccagagat tggtcccggg cccttcagct cactgaagtg 4440tacgggcgag atgtggacga tttgagcagc ataaaggatg cagtcctgag ctgtgctgtg 4500gcatgtgaca aagaaggttg gcaatacctg tttcccgtga aggatgcatc tctgagaagt 4560cggctggccc tacagtttgt ggacaggtgg cccctggagt catgcctgga gattctggcc 4620tactgcattt cagacacggc tgtccaagaa ggactaaagt gtgagctaca gaggaagctg 4680gcggagctgc aggtgtatca gaagattctg ggtttgcagt ctcccccagt gtggtgtgac 4740tggcagacct tgaggagctg ttgtgttgag gacccatcaa ctgtcatgaa catgattcta 4800gaagcacagg agtatgaact gtgtgaagag tggggctgcc tgtaccccat tccaagagaa 4860catttaatca gccttcatca aaagcatctt ctccaccttc tagaaagaag agatcatgac 4920aaggctctgc aactcctgcg aagaatccct gaccccacca tgtgccttga agtgacagag 4980caatccctcg accagcacac tagcttggcc acttctcact tcttggccaa ctacctcacc 5040acccacttct atggacaact gactgctgtc cgacaccgtg aaatccaggc gctgtatgtg 5100ggatccaaga ttctgctgac cctgcctgag cagcaccggg ccagctattc ccacttgtcc 5160tctaaccccc tgttcatgct ggagcagctg cttatgaaca tgaaggtgga ttgggccact 5220gtggctgtgc agactctcca gcagctgctg gttggacagg agattggctt cactatggac 5280gaggtggact cactgctttc cagatacgca gagaaagccc tggactttcc ataccctcag 5340agggagaaac gatcagattc tgtgattcac ctccaagaaa ttgtccacca ggctgcagat 5400cccgagaccc tccctagatc accatcagca gagttctctc ctgctgctcc tcctggtatc 5460tccagtatac attcccctag tctaagggaa aggagtttcc caccaaccca gccctcacag 5520gaatttgtgc ccccagcgac accccctgcc aggcaccagt gggtaccgga tgagactgag 5580agtatctgca tggtctgctg cagggagcac ttcaccatgt ttaacaggcg tcatcattgt 5640cgccgctgtg gccggctagt gtgcagctcc tgctccacta agaaaatggt ggttgaaggc 5700tgcagagaga accctgctcg tgtgtgtgat cagtgctata gttactgcaa caaagatgta 5760ccagaggagc cttcagaaaa accagaagct ctagacagct ccaagaatga aagccctcca 5820tactcgtttg tggtgagagt ccccaaagca gatgaggtgg aatggatttt ggatctcaaa 5880gaggaggaaa atgagctggt gcggagtgaa ttttactatg agcaggcccc cagcgcctcc 5940ttgtgcattg ccatcctgaa tctgcaccgg gacagcattg cctgtggtca ccagctgatt 6000gagcactgct gcaggctctc caagggcctc accaacccag aggtggatgc cgggctgctc 6060acggacatca tgaagcagct gctgttcagc gccaagatga tgttcgtcaa agccggccag 6120agccaagact tggctctttg tgacagctac atcagcaagg tagatgtgct gaatatttta 6180gttgctgctg cctatcgcca cgtgccatct ttggatcaga tcttgcagcc agctgcagta 6240accaggctaa ggaaccagct tttggaagcc gagtactacc aactgggcgt tgaggtctcc 6300acaaagactg ggcttgatac caccggggcg tggcatgctt ggggcatggc ctgcctcaaa 6360gccgggaacc tcactgctgc acgggagaag ttcagtcgct gtctgaagcc cccatttgac 6420ctcaatcagc tgaatcatgg ctcaaggctg gtgcaggatg tggttgagta cctagagtcc 6480acagtgaggc cctttgtatc cttgcaagat gacgattact ttgccaccct gagggaactg 6540gaagctaccc ttcggacgca gagcctttct ctggcagtga ttcctgaagg gaaaatcatg 6600aacaacacct actaccagga atgcctcttc tacctgcaca actatagcac caacctggcc 6660atcatcagct tctacgtgag gcacagctgc ctgcgggaag ctcttctgca ccttctcaac 6720aaggagagtc ctccagaagt ttttatagaa ggcattttcc aaccaagcta taaaagtggg 6780aagctacaca ctttggagaa cttgctagaa tccattgatc caaccttgga gagctgggga 6840aagtacttga ttgctgcctg ccaacattta cagaagaaga actactacca cattctgtat 6900gagctgcagc agtttatgaa ggaccaagtt cgggccgcca tgacctgtat tcggttcttc 6960agtcacaaag caaagtcata tacagaactg ggagagaagc tctcatggct acttaaggcc 7020aaggaccacc tgaagatcta cctccaagaa acatcccgca gctctggaag gaagaaaacc 7080acattcttca gaaagaagat gactgcagct gatgtgtcaa ggcacatgaa cacacttcag 7140ctgcagatgg aagtgaccag gttcttgcat cggtgcgaaa gtgctgggac ctctcaaatc 7200accactttgc ctctgccaac cctgtttgga aataaccaca tgaaaatgga tgttgcctgc 7260aaggtcatgc tgggagggaa aaatgtagaa gatggttttg gaattgcttt ccgtgttctg 7320caggacttcc agctggatgc tgccatgacc tactgcagag ctgcccgcca gttggtggag 7380aaagagaagt acagtgagat ccagcaactg ctcaaatgtg tcagtgagtc aggcatggca 7440gccaaaagtg acggggacac catcctcctc aactgcctgg aagcgttcaa gagaattccg 7500ccccaggagc tggagggcct gatccaggca atacacaatg atgacaacaa ggttcgggcc 7560tacctgatat gttgcaaact gcgttctgcc tacttgattg ctgtgaagca agaacactca 7620cgggccacag cccttgtcca gcaggtgcag caggccgcca agagcagcgg ggatgcagta 7680gtgcaagaca tctgtgccca gtggcttctg acaagccacc cccggggtgc ccatggccca 7740ggctccagga agtgaccttg ggcagtgggg ccaggaacac gtggcctgag agctgggcaa 7800cagcagtgat ggcgatgccc tccacctctt tcctccagtg gagtgggact tctctggctc 7860tgccctaggt tggaaagagt tggattggac cctacttgcc ttcccgggca aggataggac 7920ctttcacgca agtgccatgt ttctctaaaa ttgtggaatc tatgtgtgtt tgtctggaga 7980tggccagttc tttctacctc agagtgagtg agtgagtatg tgtgcacaca cgtgtgcatg 8040ttcctgtgcg ctgatgttta cgcccaagca tttctgaaca aatgaaactc ttctccattt 8100aaaagaggca ctttacttta gacttgccac tctgaaaacc ttccctgcgt tttggttctt 8160gacccgggtt gtcctgtttg tatagtcccc cctctgtgga cgtgctttag tagctcctct 8220tacctagagg gcttttacag agaattagag caacaccaaa aggattgcct cttttccttc 8280cttcccattc caaaattcag agatggcttt ggggcaagtg ctacctgtgg aataaacctg 8340ttttccaggt gtctcttctc ccaagcacaa gaagtcctgg agtctttgga aggtagtctg 8400aatagaaggg ttttcaggtg caggcatctg aaagctgtgg gtatgtgtat aaatgatcag 8460gtctgtgagg ctaacacggg caagagggaa agaaaggcta accatccaaa cagggataca 8520ggggaggcgg tggggggtgg tggggggagc gggtgctcac aagcacagag ctgcctgttg 8580tgaatgtccc tgctgcaaag ttggtgggtg agagaatggg acttcctctt tgagagtctg 8640gggagagaaa aggtggccag gatcctagga ctgaatgact cgattttacc tatttgagct 8700gcagtcctgt ttgcgctcct tgaattggtt aggaagctgc ttccttttcc ctcctgcttc 8760ccttcagtct cttcaggacc acaggatgga tatgcagaca tgtggggtca ttgggaaggg 8820agtgcgcttc ttttctctgt cttagaaaag ggagtcaagg gttggctttg gaattgggcc 8880tctggacaga gtcagaatga gggaataatg aataggtcac atctggttgg tggaaaacta 8940ggtgaagtgc ttctttaata tgcactgtct tgtcttccca cgcaagatgt gacaatgttt 9000gagaaaaggt gtgtcatact cagtgacttc aatttgcaaa tgtggggcct aaagaaagct 9060ctgcagctct gaacctctca ctggccagag ctcagcctat tggtcccatc catgatgctg 9120agacaaacag aaactggaag ctgaagtcag tgtctctggt gcttagaaac cctgtggatt 9180tccctctgaa ccaagatttt tagtagtaaa ataaacaact catggacatc tgtcagatga 9240gaagttttgg tcctgttaga gaggagaaag actgtaatga aactactaga cccatttggg 9300ctaaagtttg gcttttcctt ccttgagtca tagaacatat ccatctccca ggaaatgtcc 9360ttctctggcg tctgcttgcc cttctgagtc tgcctttttt gcactgaaca taagcacttt 9420atactaatgg gtcacaaatc ttgcagccct taatttggga taagaccaga ttttcctgac 9480attttcctct aactcattga actatcaaat tataggcaac cactgactag actgatatga 9540gatgaggcta aaagcctttg aacaccacgc tgtagtctcc aacagaaaaa caccaccaaa 9600acagataccc atgttgaggg gttgaatgtt ttactacaaa caagccacaa taaagtgtct 9660atcaacatga aaaaaaaaaa aaaaaaaa 968822539PRTHomo sapiens 2Met Asn His Pro Phe Gly Lys Glu Glu Ala Ala Ser Gln Lys Gln Leu1 5 10 15Phe Gly Phe Phe Cys Glu Cys Leu Arg Arg Gly Glu Trp Glu Leu Ala 20 25 30Gln Ala Cys Val Pro Gln Leu Gln Glu Gly Gln Gly Asp Ile Pro Lys 35 40 45Arg Val Glu Asp Ile Leu Gln Ala Leu Val Val Cys Pro Asn Leu Leu 50 55 60Arg Cys Gly Gln Asp Ile Asn Pro Gln Arg Val Ala Trp Val Trp Leu65 70 75 80Leu Val Leu Glu Lys Trp Leu Ala Arg Glu Lys Lys Leu Leu Pro Val 85 90 95Val Phe Arg Arg Lys Leu Glu Phe Leu Leu Leu Ser Glu Asp Leu Gln 100 105 110Gly Asp Ile Pro Glu Asn Ile Leu Glu Glu Leu Tyr Glu Thr Leu Thr 115 120 125Gln Gly Ala Val Gly His Val Pro Asp Gly Asn Pro Arg Arg Glu Ser 130 135 140Trp Thr Pro Arg Leu Ser Ser Glu Ala Val Ser Val Leu Trp Asp Leu145 150 155 160Leu Arg Gln Ser Pro Gln Pro Ala Gln Ala Leu Leu Glu Leu Leu Leu 165 170 175Glu Glu Asp Asp Gly Thr Gly Leu Cys His Trp Pro Leu Gln Asn Ala 180 185 190Leu Val Asp Leu Ile Arg Lys Ala Leu Arg Ala Leu Gln Gly Pro Asp 195 200 205Ser Val Pro Pro Gly Val Val Asp Ala Ile Tyr Gly Ala Leu Arg Thr 210 215 220Leu Arg Cys Pro Ala Glu Pro Leu Gly Val Glu Leu His Leu Leu Cys225 230 235 240Glu Glu Leu Leu Glu Ala Cys Arg Thr Glu Gly Ser Pro Leu Arg Glu 245 250 255Glu Arg Leu Leu Ser Cys Leu Leu His Lys Ala Ser Arg Gly Leu Leu 260 265 270Ser Leu Tyr Gly His Thr Tyr Ala Glu Lys Val Thr Glu Lys Pro Pro 275 280 285Arg Ala Thr Ala Ser Gly Lys Val Ser Pro Asp His Leu Asp Pro Glu 290 295 300Arg Ala Met Leu Ala Leu Phe Ser Asn Pro Asn Pro Ala Glu Ala Trp305 310 315 320Lys Val Ala Tyr Phe Tyr Cys Leu Ser Asn Asn Lys His Phe Leu Glu 325 330 335Gln Ile Leu Val Thr Ala Leu Thr Leu Leu Lys Glu Glu Asp Phe Pro 340 345 350Asn Leu Gly Cys Leu Leu Asp Arg Glu Phe Arg Pro Leu Ser Cys Leu 355 360 365Leu Val Leu Leu Gly Trp Thr His Cys Gln Ser Leu Glu Ser Ala Lys 370 375 380Arg Leu Leu Gln Thr Leu His Arg Thr Gln Gly Pro Gly Cys Asp Glu385 390 395 400Leu Leu Arg Asp Ala Cys Asp Gly Leu Trp Ala His Leu Glu Val Leu 405 410 415Glu Trp Cys Ile Gln Gln Ser Ser Asn Pro Ile Pro Lys Arg Asp Leu 420 425 430Leu Tyr His Leu His Gly Gly Asp Ser His Ser Val Leu Tyr Thr Leu 435 440 445His His Leu Thr Asn Leu Pro Ala Leu Arg Glu Glu Asp Val Leu Lys 450 455 460Leu Leu Gln Lys Val Pro Ala Lys Asp Pro Gln Gln Glu Pro Asp Ala465 470 475 480Val Asp Ala Pro Val Pro Glu His Leu Ser Gln Cys Gln Asn Leu Thr 485 490 495Leu Tyr Gln Gly Phe Cys Ala Met Lys Tyr Ala Ile Tyr Ala Leu Cys 500 505 510Val Asn Ser His Gln His Ser Gln Cys Gln Asp Cys Lys Asp Ser Leu 515 520 525Ser Glu Asp Leu Ala Ser Ala Thr Glu Pro Ala Asn Asp Ser Leu Ser 530 535 540Ser Pro Gly Ala Ala Asn Leu Phe Ser Thr Tyr Leu Ala Arg Cys Gln545 550 555 560Gln Tyr Leu Cys Ser Ile Pro Asp Ser Leu Cys Leu Glu Leu Leu Glu 565 570 575Asn Ile Phe Ser Leu Leu Leu Ile Thr Ser Ala Asp Leu His Pro Glu 580 585 590Pro His Leu Pro Glu Asp Tyr Ala Glu Asp Asp Asp Ile Glu Gly Lys 595 600 605Ser Pro Ser Gly Leu Arg Ser Pro Ser Glu Ser Pro Gln His Ile Ala 610 615 620His Pro Glu Arg Lys Ser Glu Arg Gly Ser Leu Gly Val Pro Lys Thr625 630 635 640Leu Ala Tyr Thr Met Pro Ser His Val Lys Ala Glu Pro Lys Asp Ser 645 650 655Tyr Pro Gly Pro His Arg His Ser Phe Leu Asp Leu Lys His Phe Thr 660 665 670Ser Gly Ile Ser Gly Phe Leu Ala Asp Glu Phe Ala Ile Gly Ala Phe 675 680 685Leu Arg Leu Leu Gln Glu Gln Leu Asp Glu Ile Ser Ser Arg Ser Pro 690 695 700Pro Glu Lys Pro Lys Gln Glu Ser Gln Ser Cys Ser Gly Ser Arg Asp705 710 715 720Gly Leu Gln Ser Arg Leu His Arg Leu Ser Lys Val Val Ser Glu Ala 725 730 735Gln Trp Arg His Lys Val Val Thr Ser Asn His Arg Ser Glu Glu Gln 740 745 750Pro Ser Arg Arg Tyr Gln Pro Ala Thr Arg His Pro Ser Leu Arg Arg 755 760 765Gly Arg Arg Thr Arg Arg Ser Gln Ala Asp Gly Arg Asp Arg Gly Ser 770 775 780Asn Pro Ser Leu Glu Ser Thr Ser Ser Glu Leu Ser Thr Ser Thr Ser785 790 795 800Glu Gly Ser Leu Ser Ala Met Ser Gly Arg Asn Glu Leu His Ser Arg 805 810 815Leu His Pro His Pro Gln Ser Ser Leu Ile Pro Met Met Phe Ser Pro 820 825 830Pro Glu Ser Leu Leu Ala Ser Cys Ile Leu Arg Gly Asn Phe Ala Glu 835 840 845Ala His Gln Val Leu Phe Thr Phe Asn Leu Lys Ser Ser Pro Ser Ser 850 855 860Gly Glu Leu Met Phe Met Glu Arg Tyr Gln Glu Val

Ile Gln Glu Leu865 870 875 880Ala Gln Val Glu His Lys Ile Glu Asn Gln Asn Ser Asp Ala Gly Ser 885 890 895Ser Thr Ile Arg Arg Thr Gly Ser Gly Arg Ser Thr Leu Gln Ala Ile 900 905 910Gly Ser Ala Ala Ala Ala Gly Met Val Phe Tyr Ser Ile Ser Asp Val 915 920 925Thr Asp Lys Leu Leu Asn Thr Ser Gly Asp Pro Ile Pro Met Leu Gln 930 935 940Glu Asp Phe Trp Ile Ser Thr Ala Leu Val Glu Pro Thr Ala Pro Leu945 950 955 960Arg Glu Val Leu Glu Asp Leu Ser Pro Pro Ala Met Ala Ala Phe Asp 965 970 975Leu Ala Cys Ser Gln Cys Gln Leu Trp Lys Thr Cys Lys Gln Leu Leu 980 985 990Glu Thr Ala Glu Arg Arg Leu Asn Ser Ser Leu Glu Arg Arg Gly Arg 995 1000 1005Arg Ile Asp His Val Leu Leu Asn Ala Asp Gly Ile Arg Gly Phe 1010 1015 1020Pro Val Val Leu Gln Gln Ile Ser Lys Ser Leu Asn Tyr Leu Leu 1025 1030 1035Met Ser Ala Ser Gln Thr Lys Ser Glu Ser Val Glu Glu Lys Gly 1040 1045 1050Gly Gly Pro Pro Arg Cys Ser Ile Thr Glu Leu Leu Gln Met Cys 1055 1060 1065Trp Pro Ser Leu Ser Glu Asp Cys Val Ala Ser His Thr Thr Leu 1070 1075 1080Ser Gln Gln Leu Asp Gln Val Leu Gln Ser Leu Arg Glu Ala Leu 1085 1090 1095Glu Leu Pro Glu Pro Arg Thr Pro Pro Leu Ser Ser Leu Val Glu 1100 1105 1110Gln Ala Ala Gln Lys Ala Pro Glu Ala Glu Ala His Pro Val Gln 1115 1120 1125Ile Gln Thr Gln Leu Leu Gln Lys Asn Leu Gly Lys Gln Thr Pro 1130 1135 1140Ser Gly Ser Arg Gln Met Asp Tyr Leu Gly Thr Phe Phe Ser Tyr 1145 1150 1155Cys Ser Thr Leu Ala Ala Val Leu Leu Gln Ser Leu Ser Ser Glu 1160 1165 1170Pro Asp His Val Glu Val Lys Val Gly Asn Pro Phe Val Leu Leu 1175 1180 1185Gln Gln Ser Ser Ser Gln Leu Val Ser His Leu Leu Phe Glu Arg 1190 1195 1200Gln Val Pro Pro Glu Arg Leu Ala Ala Leu Leu Ala Gln Glu Asn 1205 1210 1215Leu Ser Leu Ser Val Pro Gln Val Ile Val Ser Cys Cys Cys Glu 1220 1225 1230Pro Leu Ala Leu Cys Ser Ser Arg Gln Ser Gln Gln Thr Ser Ser 1235 1240 1245Leu Leu Thr Arg Leu Gly Thr Leu Ala Gln Leu His Ala Ser His 1250 1255 1260Cys Leu Asp Asp Leu Pro Leu Ser Thr Pro Ser Ser Pro Arg Thr 1265 1270 1275Thr Glu Asn Pro Thr Leu Glu Arg Lys Pro Tyr Ser Ser Pro Arg 1280 1285 1290Asp Ser Ser Leu Pro Ala Leu Thr Ser Ser Ala Leu Ala Phe Leu 1295 1300 1305Lys Ser Arg Ser Lys Leu Leu Ala Thr Val Ala Cys Leu Gly Ala 1310 1315 1320Ser Pro Arg Leu Lys Val Ser Lys Pro Ser Leu Ser Trp Lys Glu 1325 1330 1335Leu Arg Gly Arg Arg Glu Val Pro Leu Ala Ala Glu Gln Val Ala 1340 1345 1350Arg Glu Cys Glu Arg Leu Leu Glu Gln Phe Pro Leu Phe Glu Ala 1355 1360 1365Phe Leu Leu Ala Ala Trp Glu Pro Leu Arg Gly Ser Leu Gln Gln 1370 1375 1380Gly Gln Ser Leu Ala Val Asn Leu Cys Gly Trp Ala Ser Leu Ser 1385 1390 1395Thr Val Leu Leu Gly Leu His Ser Pro Ile Ala Leu Asp Val Leu 1400 1405 1410Ser Glu Ala Phe Glu Glu Ser Leu Val Ala Arg Asp Trp Ser Arg 1415 1420 1425Ala Leu Gln Leu Thr Glu Val Tyr Gly Arg Asp Val Asp Asp Leu 1430 1435 1440Ser Ser Ile Lys Asp Ala Val Leu Ser Cys Ala Val Ala Cys Asp 1445 1450 1455Lys Glu Gly Trp Gln Tyr Leu Phe Pro Val Lys Asp Ala Ser Leu 1460 1465 1470Arg Ser Arg Leu Ala Leu Gln Phe Val Asp Arg Trp Pro Leu Glu 1475 1480 1485Ser Cys Leu Glu Ile Leu Ala Tyr Cys Ile Ser Asp Thr Ala Val 1490 1495 1500Gln Glu Gly Leu Lys Cys Glu Leu Gln Arg Lys Leu Ala Glu Leu 1505 1510 1515Gln Val Tyr Gln Lys Ile Leu Gly Leu Gln Ser Pro Pro Val Trp 1520 1525 1530Cys Asp Trp Gln Thr Leu Arg Ser Cys Cys Val Glu Asp Pro Ser 1535 1540 1545Thr Val Met Asn Met Ile Leu Glu Ala Gln Glu Tyr Glu Leu Cys 1550 1555 1560Glu Glu Trp Gly Cys Leu Tyr Pro Ile Pro Arg Glu His Leu Ile 1565 1570 1575Ser Leu His Gln Lys His Leu Leu His Leu Leu Glu Arg Arg Asp 1580 1585 1590His Asp Lys Ala Leu Gln Leu Leu Arg Arg Ile Pro Asp Pro Thr 1595 1600 1605Met Cys Leu Glu Val Thr Glu Gln Ser Leu Asp Gln His Thr Ser 1610 1615 1620Leu Ala Thr Ser His Phe Leu Ala Asn Tyr Leu Thr Thr His Phe 1625 1630 1635Tyr Gly Gln Leu Thr Ala Val Arg His Arg Glu Ile Gln Ala Leu 1640 1645 1650Tyr Val Gly Ser Lys Ile Leu Leu Thr Leu Pro Glu Gln His Arg 1655 1660 1665Ala Ser Tyr Ser His Leu Ser Ser Asn Pro Leu Phe Met Leu Glu 1670 1675 1680Gln Leu Leu Met Asn Met Lys Val Asp Trp Ala Thr Val Ala Val 1685 1690 1695Gln Thr Leu Gln Gln Leu Leu Val Gly Gln Glu Ile Gly Phe Thr 1700 1705 1710Met Asp Glu Val Asp Ser Leu Leu Ser Arg Tyr Ala Glu Lys Ala 1715 1720 1725Leu Asp Phe Pro Tyr Pro Gln Arg Glu Lys Arg Ser Asp Ser Val 1730 1735 1740Ile His Leu Gln Glu Ile Val His Gln Ala Ala Asp Pro Glu Thr 1745 1750 1755Leu Pro Arg Ser Pro Ser Ala Glu Phe Ser Pro Ala Ala Pro Pro 1760 1765 1770Gly Ile Ser Ser Ile His Ser Pro Ser Leu Arg Glu Arg Ser Phe 1775 1780 1785Pro Pro Thr Gln Pro Ser Gln Glu Phe Val Pro Pro Ala Thr Pro 1790 1795 1800Pro Ala Arg His Gln Trp Val Pro Asp Glu Thr Glu Ser Ile Cys 1805 1810 1815Met Val Cys Cys Arg Glu His Phe Thr Met Phe Asn Arg Arg His 1820 1825 1830His Cys Arg Arg Cys Gly Arg Leu Val Cys Ser Ser Cys Ser Thr 1835 1840 1845Lys Lys Met Val Val Glu Gly Cys Arg Glu Asn Pro Ala Arg Val 1850 1855 1860Cys Asp Gln Cys Tyr Ser Tyr Cys Asn Lys Asp Val Pro Glu Glu 1865 1870 1875Pro Ser Glu Lys Pro Glu Ala Leu Asp Ser Ser Lys Asn Glu Ser 1880 1885 1890Pro Pro Tyr Ser Phe Val Val Arg Val Pro Lys Ala Asp Glu Val 1895 1900 1905Glu Trp Ile Leu Asp Leu Lys Glu Glu Glu Asn Glu Leu Val Arg 1910 1915 1920Ser Glu Phe Tyr Tyr Glu Gln Ala Pro Ser Ala Ser Leu Cys Ile 1925 1930 1935Ala Ile Leu Asn Leu His Arg Asp Ser Ile Ala Cys Gly His Gln 1940 1945 1950Leu Ile Glu His Cys Cys Arg Leu Ser Lys Gly Leu Thr Asn Pro 1955 1960 1965Glu Val Asp Ala Gly Leu Leu Thr Asp Ile Met Lys Gln Leu Leu 1970 1975 1980Phe Ser Ala Lys Met Met Phe Val Lys Ala Gly Gln Ser Gln Asp 1985 1990 1995Leu Ala Leu Cys Asp Ser Tyr Ile Ser Lys Val Asp Val Leu Asn 2000 2005 2010Ile Leu Val Ala Ala Ala Tyr Arg His Val Pro Ser Leu Asp Gln 2015 2020 2025Ile Leu Gln Pro Ala Ala Val Thr Arg Leu Arg Asn Gln Leu Leu 2030 2035 2040Glu Ala Glu Tyr Tyr Gln Leu Gly Val Glu Val Ser Thr Lys Thr 2045 2050 2055Gly Leu Asp Thr Thr Gly Ala Trp His Ala Trp Gly Met Ala Cys 2060 2065 2070Leu Lys Ala Gly Asn Leu Thr Ala Ala Arg Glu Lys Phe Ser Arg 2075 2080 2085Cys Leu Lys Pro Pro Phe Asp Leu Asn Gln Leu Asn His Gly Ser 2090 2095 2100Arg Leu Val Gln Asp Val Val Glu Tyr Leu Glu Ser Thr Val Arg 2105 2110 2115Pro Phe Val Ser Leu Gln Asp Asp Asp Tyr Phe Ala Thr Leu Arg 2120 2125 2130Glu Leu Glu Ala Thr Leu Arg Thr Gln Ser Leu Ser Leu Ala Val 2135 2140 2145Ile Pro Glu Gly Lys Ile Met Asn Asn Thr Tyr Tyr Gln Glu Cys 2150 2155 2160Leu Phe Tyr Leu His Asn Tyr Ser Thr Asn Leu Ala Ile Ile Ser 2165 2170 2175Phe Tyr Val Arg His Ser Cys Leu Arg Glu Ala Leu Leu His Leu 2180 2185 2190Leu Asn Lys Glu Ser Pro Pro Glu Val Phe Ile Glu Gly Ile Phe 2195 2200 2205Gln Pro Ser Tyr Lys Ser Gly Lys Leu His Thr Leu Glu Asn Leu 2210 2215 2220Leu Glu Ser Ile Asp Pro Thr Leu Glu Ser Trp Gly Lys Tyr Leu 2225 2230 2235Ile Ala Ala Cys Gln His Leu Gln Lys Lys Asn Tyr Tyr His Ile 2240 2245 2250Leu Tyr Glu Leu Gln Gln Phe Met Lys Asp Gln Val Arg Ala Ala 2255 2260 2265Met Thr Cys Ile Arg Phe Phe Ser His Lys Ala Lys Ser Tyr Thr 2270 2275 2280Glu Leu Gly Glu Lys Leu Ser Trp Leu Leu Lys Ala Lys Asp His 2285 2290 2295Leu Lys Ile Tyr Leu Gln Glu Thr Ser Arg Ser Ser Gly Arg Lys 2300 2305 2310Lys Thr Thr Phe Phe Arg Lys Lys Met Thr Ala Ala Asp Val Ser 2315 2320 2325Arg His Met Asn Thr Leu Gln Leu Gln Met Glu Val Thr Arg Phe 2330 2335 2340Leu His Arg Cys Glu Ser Ala Gly Thr Ser Gln Ile Thr Thr Leu 2345 2350 2355Pro Leu Pro Thr Leu Phe Gly Asn Asn His Met Lys Met Asp Val 2360 2365 2370Ala Cys Lys Val Met Leu Gly Gly Lys Asn Val Glu Asp Gly Phe 2375 2380 2385Gly Ile Ala Phe Arg Val Leu Gln Asp Phe Gln Leu Asp Ala Ala 2390 2395 2400Met Thr Tyr Cys Arg Ala Ala Arg Gln Leu Val Glu Lys Glu Lys 2405 2410 2415Tyr Ser Glu Ile Gln Gln Leu Leu Lys Cys Val Ser Glu Ser Gly 2420 2425 2430Met Ala Ala Lys Ser Asp Gly Asp Thr Ile Leu Leu Asn Cys Leu 2435 2440 2445Glu Ala Phe Lys Arg Ile Pro Pro Gln Glu Leu Glu Gly Leu Ile 2450 2455 2460Gln Ala Ile His Asn Asp Asp Asn Lys Val Arg Ala Tyr Leu Ile 2465 2470 2475Cys Cys Lys Leu Arg Ser Ala Tyr Leu Ile Ala Val Lys Gln Glu 2480 2485 2490His Ser Arg Ala Thr Ala Leu Val Gln Gln Val Gln Gln Ala Ala 2495 2500 2505Lys Ser Ser Gly Asp Ala Val Val Gln Asp Ile Cys Ala Gln Trp 2510 2515 2520Leu Leu Thr Ser His Pro Arg Gly Ala His Gly Pro Gly Ser Arg 2525 2530 2535Lys 326DNAArtificialprimer 3tgcttcatct tagagaaata gcagaa 26420DNAArtificialprimer 4atgggcaaca tcttggagac 20520DNAArtificialprimer 5gaaagcatga aggcacacaa 20620DNAArtificialprimer 6ggctgggcat actggaatta 20720DNAArtificialprimer 7cttaggctga atgcagagcc 20820DNAArtificialprimer 8ggtcaacatt gccaactcaa 20920DNAArtificialprimer 9aggaagtgca gggaactgaa 201020DNAArtificialprimer 10ccctgggtga aataaaacca 201123DNAArtificialprimer 11taaatgagct aaagttgcga gaa 231219DNAArtificialprimer 12cctgaggaag gcccctatt 191319DNAArtificialprimer 13gaagtcagaa cggggttcc 191420DNAArtificialprimer 14ggtgacgata tgccctgagt 201527DNAArtificialprimer 15caattaggaa cttttattta catttgc 271619DNAArtificialprimer 16ccgcctcggc cagaatgtg 191718DNAArtificialprimer 17actcccgggc tacctgct 181820DNAArtificialprimer 18ctctgccttg gcctttctta 201922DNAArtificialprimer 19gggcttctct ctagagttac cg 222020DNAArtificialprimer 20cccctcatct ggtgaaggta 202122DNAArtificialprimer 21tcctccaaga ccaagatctc tc 222220DNAArtificialprimer 22tcaggaggca cacaatgttc 202320DNAArtificialprimer 23atggctgttt gagggtgtct 202421DNAArtificialprimer 24gcccatcagc tgacagatat t 212521DNAArtificialprimer 25tggcatttca gtgtgaatgt t 212623DNAArtificialprimer 26gctttcttgt agaatctggt tcc 232721DNAArtificialprimer 27ggaagaacac ttgagatctg g 212820DNAArtificialprimer 28ggcagatagt gggaatgagg 202920DNAArtificialprimer 29cttgatgctg agccaggact 203021DNAArtificialprimer 30aggagagaag tgaagcagtc g 213120DNAArtificialprimer 31gctctagggt cagccaaaca 203221DNAArtificialprimer 32tggcacatag gtgctcaata a 213320DNAArtificialprimer 33gaggcagcca tcaaacaaac 203420DNAArtificialprimer 34cagccaggta gctgatttcc 203521DNAArtificialprimer 35aattcagcag gaacctccct a 213620DNAArtificialprimer 36ataggaatcc gcgtgaagag 203720DNAArtificialprimer 37gcagccaggc ttacattcag 203820DNAArtificialprimer 38caccgcactt ggctaatttt 203920DNAArtificialprimer 39ggcacaagac tcatggtggt 204020DNAArtificialprimer 40tgaagctccc aagggaagta 204122DNAArtificialprimer 41cgatgtaaaa tgactgcaac tg 224220DNAArtificialprimer 42ctcccaaagt gctgggatta 204320DNAArtificialprimer 43ctctgcattc agcctaagcc 204420DNAArtificialprimer 44ggccctttct aggacctttc 204520DNAArtificialprimer 45agacctcctc accaccctct 204621DNAArtificialprimer 46tcagaacact ggggtatgct c 214721DNAArtificialprimer 47gcatggaaaa tttctgaaag g 214820DNAArtificialprimer 48acccaggtga actctgttgc 204920DNAArtificialprimer 49gctaaaatct ggccatctgc 205020DNAArtificialprimer 50gtttgccctt catttgagga 205120DNAArtificialprimer 51cttgatgtgg acccctgagt 205220DNAArtificialprimer 52tgaggctttg gtggttttct 205320DNAArtificialprimer 53tggacgtatc aggtttgctg 205420DNAArtificialprimer 54gaaaaagccc tccctcatct 205520DNAArtificialprimer 55ccatctgcct cctccaataa 205620DNAArtificialprimer 56tttgcattcc ctcttccttc 205721DNAArtificialprimer 57tgttgctgac ctaatgttcc a 215820DNAArtificialprimer 58tgtcagccag tcaaaccaaa 205920DNAArtificialprimer 59cctctgctcc aaagtgcttc 206020DNAArtificialprimer 60ctggctggga atcacttgtc 206122DNAArtificialprimer 61gccagagatg aataagagag ga 226220DNAArtificialprimer

62gagagcagga gttggctgtc 206320DNAArtificialprimer 63agtgcagagt cacccactga 206423DNAArtificialprimer 64tcttccttct gaaagtctca tgg 236520DNAArtificialprimer 65atgcaaagca aaacccagac 206621DNAArtificialprimer 66tcctggatag gttcactctg c 216721DNAArtificialprimer 67tgaacagtaa gcctgcttca a 216820DNAArtificialprimer 68agctgagatt gcatgggatt 206923DNAArtificialprimer 69gagaaagggt tagtccaaaa tga 237020DNAArtificialprimer 70ggcaaaagag ccattgaaaa 207120DNAArtificialprimer 71gtttgttttt cgaggcgttt 207225DNAArtificialprimer 72ttctgaagga tagaataagg caaga 257320DNAArtificialprimer 73cgcataggaa ggaagacaca 207421DNAArtificialprimer 74ggctgataca aatgccaaga a 217522DNAArtificialprimer 75aagcaaacaa aaggaaccaa gg 227623DNAArtificialprimer 76ccaagatgtt cattattttc tgc 237720DNAArtificialprimer 77gaatcgtttg aacccaggag 207820DNAArtificialprimer 78gtcatgtccc cgattctacc 207921DNAArtificialprimer 79cacaacgtgc aggtttgtta c 218020DNAArtificialprimer 80gttgtgcaga gtcccctgtt 208120DNAArtificialprimer 81ccagtcagtg cacttcagga 208221DNAArtificialprimer 82caggattcaa ggaatggaca a 218320DNAArtificialprimer 83tggtgatcag gtccattttg 208423DNAArtificialprimer 84tcttgaattt gacccagttc tgt 238521DNAArtificialprimer 85tgtggatgct tcctaaaggt c 218620DNAArtificialprimer 86ccattattgc agaggggttc 208722DNAArtificialprimer 87caggcagaca ttttcattct ga 228820DNAArtificialprimer 88gtccatgttc acctgctcct 208924DNAArtificialprimer 89gcatatgtcc agaatattga aaga 249020DNAArtificialprimer 90tgcgtgaaag gtcctatcct 209119DNAArtificialprimer 91tctaatcaaa gcgctaggc 199220DNAArtificialprimer 92tgttgacttt gtacccctgc 209321DNAArtificialprimer 93gcagcagcaa agcaaagata g 219420DNAArtificialprimer 94cctgtaatct caaacattcc 209520DNAArtificialprimer 95caaggaccta atgaattcct 209620DNAArtificialprimer 96ggaattttca ttctctgggc 209720DNAArtificialprimer 97gtgtgtagct gtcagtcaga 209821DNAArtificialprimer 98ttgaagacag ctccccttat c 219920DNAArtificialprimer 99aggggatatc ccaaagaggg 2010020DNAArtificialprimer 100cctttcgaat gaggtccacc 2010120DNAArtificialprimer 101tcaccacttt gcctctgcca 2010220DNAArtificialprimer 102gccactgggc acagatgtct 2010320DNAArtificialprimer 103accagctaac caacgacaaa 2010420DNAArtificialprimer 104tgctgttcct gaatctgagc 20105102PRTHomo sapiens 105Met Asn His Pro Phe Gly Lys Glu Glu Ala Ala Ser Gln Lys Gln Leu1 5 10 15Phe Gly Phe Phe Cys Glu Cys Leu Arg Arg Gly Glu Trp Glu Leu Ala 20 25 30Gln Ala Cys Val Pro Gln Leu Gln Glu Gly Gln Gly Asp Ile Pro Lys 35 40 45Arg Val Glu Asp Ile Leu Gln Ala Leu Val Val Cys Pro Asn Leu Leu 50 55 60Arg Cys Gly Gln Asp Ile Asn Pro Gln Arg Val Ala Trp Val Trp Leu65 70 75 80Leu Val Leu Glu Lys Trp Leu Ala Arg Glu Lys Lys Leu Leu Pro Val 85 90 95Val Phe Arg Arg Lys Leu 100106142PRTHomo sapiens 106Met Asn His Pro Phe Gly Lys Glu Glu Ala Ala Ser Gln Lys Gln Leu1 5 10 15Phe Gly Phe Phe Cys Glu Cys Leu Arg Arg Gly Glu Trp Glu Leu Ala 20 25 30Gln Ala Cys Val Pro Gln Leu Gln Glu Gly Gln Gly Asp Ile Pro Lys 35 40 45Arg Val Glu Asp Ile Leu Gln Ala Leu Val Val Cys Pro Asn Leu Leu 50 55 60Arg Cys Gly Gln Asp Ile Asn Pro Gln Arg Val Ala Trp Val Trp Leu65 70 75 80Leu Val Leu Glu Lys Trp Leu Ala Arg Glu Lys Lys Leu Leu Pro Val 85 90 95Val Phe Arg Arg Lys Leu Glu Phe Leu Leu Leu Ser Glu Asp Leu Gln 100 105 110Gly Asp Ile Pro Glu Asn Ile Leu Glu Glu Leu Tyr Glu Thr Leu Thr 115 120 125Gln Gly Ala Val Gly His Val Pro Asp Gly Asn Pro Arg Arg 130 135 140107413PRTHomo sapiens 107Met Asn His Pro Phe Gly Lys Glu Glu Ala Ala Ser Gln Lys Gln Leu1 5 10 15Phe Gly Phe Phe Cys Glu Cys Leu Arg Arg Gly Glu Trp Glu Leu Ala 20 25 30Gln Ala Cys Val Pro Gln Leu Gln Glu Gly Gln Gly Asp Ile Pro Lys 35 40 45Arg Val Glu Asp Ile Leu Gln Ala Leu Val Val Cys Pro Asn Leu Leu 50 55 60Arg Cys Gly Gln Asp Ile Asn Pro Gln Arg Val Ala Trp Val Trp Leu65 70 75 80Leu Val Leu Glu Lys Trp Leu Ala Arg Glu Lys Lys Leu Leu Pro Val 85 90 95Val Phe Arg Arg Lys Leu Glu Phe Leu Leu Leu Ser Glu Asp Leu Gln 100 105 110Gly Asp Ile Pro Glu Asn Ile Leu Glu Glu Leu Tyr Glu Thr Leu Thr 115 120 125Gln Gly Ala Val Gly His Val Pro Asp Gly Asn Pro Arg Arg Glu Ser 130 135 140Trp Thr Pro Arg Leu Ser Ser Glu Ala Val Ser Val Leu Trp Asp Leu145 150 155 160Leu Arg Gln Ser Pro Gln Pro Ala Gln Ala Leu Leu Glu Leu Leu Leu 165 170 175Glu Glu Asp Asp Gly Thr Gly Leu Cys His Trp Pro Leu Gln Asn Ala 180 185 190Leu Val Asp Leu Ile Arg Lys Ala Leu Arg Ala Leu Gln Gly Pro Asp 195 200 205Ser Val Pro Pro Gly Val Val Asp Ala Ile Tyr Gly Ala Leu Arg Thr 210 215 220Leu Arg Cys Pro Ala Glu Pro Leu Gly Val Glu Leu His Leu Leu Cys225 230 235 240Glu Glu Leu Leu Glu Ala Cys Arg Thr Glu Gly Ser Pro Leu Arg Glu 245 250 255Glu Arg Leu Leu Ser Cys Leu Leu His Lys Ala Ser Arg Gly Leu Leu 260 265 270Ser Leu Tyr Gly His Thr Tyr Ala Glu Lys Val Thr Glu Lys Pro Pro 275 280 285Arg Ala Thr Ala Ser Gly Lys Val Ser Pro Asp His Leu Asp Pro Glu 290 295 300Arg Ala Met Leu Ala Leu Phe Ser Asn Pro Asn Pro Ala Glu Ala Trp305 310 315 320Lys Val Ala Tyr Phe Tyr Cys Leu Ser Asn Asn Lys His Phe Leu Glu 325 330 335Gln Ile Leu Val Thr Ala Leu Thr Leu Leu Lys Glu Glu Asp Phe Pro 340 345 350Asn Leu Gly Cys Leu Leu Asp Arg Glu Phe Arg Pro Leu Ser Cys Leu 355 360 365Leu Val Leu Leu Gly Trp Thr His Cys Gln Ser Leu Glu Ser Ala Lys 370 375 380Arg Leu Leu Gln Thr Leu His Arg Thr Gln Gly Pro Gly Cys Asp Glu385 390 395 400Leu Leu Arg Asp Ala Cys Asp Gly Leu Trp Ala His Leu 405 410108492PRTHomo sapiens 108Met Asn His Pro Phe Gly Lys Glu Glu Ala Ala Ser Gln Lys Gln Leu1 5 10 15Phe Gly Phe Phe Cys Glu Cys Leu Arg Arg Gly Glu Trp Glu Leu Ala 20 25 30Gln Ala Cys Val Pro Gln Leu Gln Glu Gly Gln Gly Asp Ile Pro Lys 35 40 45Arg Val Glu Asp Ile Leu Gln Ala Leu Val Val Cys Pro Asn Leu Leu 50 55 60Arg Cys Gly Gln Asp Ile Asn Pro Gln Arg Val Ala Trp Val Trp Leu65 70 75 80Leu Val Leu Glu Lys Trp Leu Ala Arg Glu Lys Lys Leu Leu Pro Val 85 90 95Val Phe Arg Arg Lys Leu Glu Phe Leu Leu Leu Ser Glu Asp Leu Gln 100 105 110Gly Asp Ile Pro Glu Asn Ile Leu Glu Glu Leu Tyr Glu Thr Leu Thr 115 120 125Gln Gly Ala Val Gly His Val Pro Asp Gly Asn Pro Arg Arg Glu Ser 130 135 140Trp Thr Pro Arg Leu Ser Ser Glu Ala Val Ser Val Leu Trp Asp Leu145 150 155 160Leu Arg Gln Ser Pro Gln Pro Ala Gln Ala Leu Leu Glu Leu Leu Leu 165 170 175Glu Glu Asp Asp Gly Thr Gly Leu Cys His Trp Pro Leu Gln Asn Ala 180 185 190Leu Val Asp Leu Ile Arg Lys Ala Leu Arg Ala Leu Gln Gly Pro Asp 195 200 205Ser Val Pro Pro Gly Val Val Asp Ala Ile Tyr Gly Ala Leu Arg Thr 210 215 220Leu Arg Cys Pro Ala Glu Pro Leu Gly Val Glu Leu His Leu Leu Cys225 230 235 240Glu Glu Leu Leu Glu Ala Cys Arg Thr Glu Gly Ser Pro Leu Arg Glu 245 250 255Glu Arg Leu Leu Ser Cys Leu Leu His Lys Ala Ser Arg Gly Leu Leu 260 265 270Ser Leu Tyr Gly His Thr Tyr Ala Glu Lys Val Thr Glu Lys Pro Pro 275 280 285Arg Ala Thr Ala Ser Gly Lys Val Ser Pro Asp His Leu Asp Pro Glu 290 295 300Arg Ala Met Leu Ala Leu Phe Ser Asn Pro Asn Pro Ala Glu Ala Trp305 310 315 320Lys Val Ala Tyr Phe Tyr Cys Leu Ser Asn Asn Lys His Phe Leu Glu 325 330 335Gln Ile Leu Val Thr Ala Leu Thr Leu Leu Lys Glu Glu Asp Phe Pro 340 345 350Asn Leu Gly Cys Leu Leu Asp Arg Glu Phe Arg Pro Leu Ser Cys Leu 355 360 365Leu Val Leu Leu Gly Trp Thr His Cys Gln Ser Leu Glu Ser Ala Lys 370 375 380Arg Leu Leu Gln Thr Leu His Arg Thr Gln Gly Pro Gly Cys Asp Glu385 390 395 400Leu Leu Arg Asp Ala Cys Asp Gly Leu Trp Ala His Leu Glu Val Leu 405 410 415Glu Trp Cys Ile Gln Gln Ser Ser Asn Pro Ile Pro Lys Arg Asp Leu 420 425 430Leu Tyr His Leu His Gly Gly Asp Ser His Ser Val Leu Tyr Thr Leu 435 440 445His His Leu Thr Asn Leu Pro Ala Leu Arg Glu Glu Asp Val Leu Lys 450 455 460Leu Leu Gln Lys Val Pro Ala Lys Asp Pro Gln Gln Glu Pro Asp Ala465 470 475 480Val Asp Ala Pro Val Pro Glu His Leu Ser Gln Cys 485 490109684PRTHomo sapiens 109Met Asn His Pro Phe Gly Lys Glu Glu Ala Ala Ser Gln Lys Gln Leu1 5 10 15Phe Gly Phe Phe Cys Glu Cys Leu Arg Arg Gly Glu Trp Glu Leu Ala 20 25 30Gln Ala Cys Val Pro Gln Leu Gln Glu Gly Gln Gly Asp Ile Pro Lys 35 40 45Arg Val Glu Asp Ile Leu Gln Ala Leu Val Val Cys Pro Asn Leu Leu 50 55 60Arg Cys Gly Gln Asp Ile Asn Pro Gln Arg Val Ala Trp Val Trp Leu65 70 75 80Leu Val Leu Glu Lys Trp Leu Ala Arg Glu Lys Lys Leu Leu Pro Val 85 90 95Val Phe Arg Arg Lys Leu Glu Phe Leu Leu Leu Ser Glu Asp Leu Gln 100 105 110Gly Asp Ile Pro Glu Asn Ile Leu Glu Glu Leu Tyr Glu Thr Leu Thr 115 120 125Gln Gly Ala Val Gly His Val Pro Asp Gly Asn Pro Arg Arg Glu Ser 130 135 140Trp Thr Pro Arg Leu Ser Ser Glu Ala Val Ser Val Leu Trp Asp Leu145 150 155 160Leu Arg Gln Ser Pro Gln Pro Ala Gln Ala Leu Leu Glu Leu Leu Leu 165 170 175Glu Glu Asp Asp Gly Thr Gly Leu Cys His Trp Pro Leu Gln Asn Ala 180 185 190Leu Val Asp Leu Ile Arg Lys Ala Leu Arg Ala Leu Gln Gly Pro Asp 195 200 205Ser Val Pro Pro Gly Val Val Asp Ala Ile Tyr Gly Ala Leu Arg Thr 210 215 220Leu Arg Cys Pro Ala Glu Pro Leu Gly Val Glu Leu His Leu Leu Cys225 230 235 240Glu Glu Leu Leu Glu Ala Cys Arg Thr Glu Gly Ser Pro Leu Arg Glu 245 250 255Glu Arg Leu Leu Ser Cys Leu Leu His Lys Ala Ser Arg Gly Leu Leu 260 265 270Ser Leu Tyr Gly His Thr Tyr Ala Glu Lys Val Thr Glu Lys Pro Pro 275 280 285Arg Ala Thr Ala Ser Gly Lys Val Ser Pro Asp His Leu Asp Pro Glu 290 295 300Arg Ala Met Leu Ala Leu Phe Ser Asn Pro Asn Pro Ala Glu Ala Trp305 310 315 320Lys Val Ala Tyr Phe Tyr Cys Leu Ser Asn Asn Lys His Phe Leu Glu 325 330 335Gln Ile Leu Val Thr Ala Leu Thr Leu Leu Lys Glu Glu Asp Phe Pro 340 345 350Asn Leu Gly Cys Leu Leu Asp Arg Glu Phe Arg Pro Leu Ser Cys Leu 355 360 365Leu Val Leu Leu Gly Trp Thr His Cys Gln Ser Leu Glu Ser Ala Lys 370 375 380Arg Leu Leu Gln Thr Leu His Arg Thr Gln Gly Pro Gly Cys Asp Glu385 390 395 400Leu Leu Arg Asp Ala Cys Asp Gly Leu Trp Ala His Leu Glu Val Leu 405 410 415Glu Trp Cys Ile Gln Gln Ser Ser Asn Pro Ile Pro Lys Arg Asp Leu 420 425 430Leu Tyr His Leu His Gly Gly Asp Ser His Ser Val Leu Tyr Thr Leu 435 440 445His His Leu Thr Asn Leu Pro Ala Leu Arg Glu Glu Asp Val Leu Lys 450 455 460Leu Leu Gln Lys Val Pro Ala Lys Asp Pro Gln Gln Glu Pro Asp Ala465 470 475 480Val Asp Ala Pro Val Pro Glu His Leu Ser Gln Cys Gln Asn Leu Thr 485 490 495Leu Tyr Gln Gly Phe Cys Ala Met Lys Tyr Ala Ile Tyr Ala Leu Cys 500 505 510Val Asn Ser His Gln His Ser Gln Cys Gln Asp Cys Lys Asp Ser Leu 515 520 525Ser Glu Asp Leu Ala Ser Ala Thr Glu Pro Ala Asn Asp Ser Leu Ser 530 535 540Ser Pro Gly Ala Ala Asn Leu Phe Ser Thr Tyr Leu Ala Arg Cys Gln545 550 555 560Gln Tyr Leu Cys Ser Ile Pro Asp Ser Leu Cys Leu Glu Leu Leu Glu 565 570 575Asn Ile Phe Ser Leu Leu Leu Ile Thr Ser Ala Asp Leu His Pro Glu 580 585 590Pro His Leu Pro Glu Asp Tyr Ala Glu Asp Asp Asp Ile Glu Gly Lys 595 600 605Ser Pro Ser Gly Leu Arg Ser Pro Ser Glu Ser Pro Gln His Ile Ala 610 615 620His Pro Glu Arg Lys Ser Glu Arg Gly Ser Leu Gly Val Pro Lys Thr625 630 635 640Leu Ala Tyr Thr Met Pro Ser His Val Lys Ala Glu Pro Lys Asp Ser 645 650 655Tyr Pro Gly Pro His Arg His Ser Phe Leu Asp Leu Lys His Phe Thr 660 665 670Ser Gly Ile Ser Gly Phe Leu Ala Asp Glu Leu Gln 675 6801101219PRTHomo sapiens 110Met Asn His Pro Phe Gly Lys Glu Glu Ala Ala Ser Gln Lys Gln Leu1 5 10 15Phe Gly Phe Phe Cys Glu Cys Leu Arg Arg Gly Glu Trp Glu Leu Ala 20 25 30Gln Ala Cys Val Pro Gln Leu Gln Glu Gly Gln Gly Asp Ile Pro Lys 35 40 45Arg Val Glu Asp Ile Leu Gln Ala Leu Val Val Cys Pro Asn Leu

Leu 50 55 60Arg Cys Gly Gln Asp Ile Asn Pro Gln Arg Val Ala Trp Val Trp Leu65 70 75 80Leu Val Leu Glu Lys Trp Leu Ala Arg Glu Lys Lys Leu Leu Pro Val 85 90 95Val Phe Arg Arg Lys Leu Glu Phe Leu Leu Leu Ser Glu Asp Leu Gln 100 105 110Gly Asp Ile Pro Glu Asn Ile Leu Glu Glu Leu Tyr Glu Thr Leu Thr 115 120 125Gln Gly Ala Val Gly His Val Pro Asp Gly Asn Pro Arg Arg Glu Ser 130 135 140Trp Thr Pro Arg Leu Ser Ser Glu Ala Val Ser Val Leu Trp Asp Leu145 150 155 160Leu Arg Gln Ser Pro Gln Pro Ala Gln Ala Leu Leu Glu Leu Leu Leu 165 170 175Glu Glu Asp Asp Gly Thr Gly Leu Cys His Trp Pro Leu Gln Asn Ala 180 185 190Leu Val Asp Leu Ile Arg Lys Ala Leu Arg Ala Leu Gln Gly Pro Asp 195 200 205Ser Val Pro Pro Gly Val Val Asp Ala Ile Tyr Gly Ala Leu Arg Thr 210 215 220Leu Arg Cys Pro Ala Glu Pro Leu Gly Val Glu Leu His Leu Leu Cys225 230 235 240Glu Glu Leu Leu Glu Ala Cys Arg Thr Glu Gly Ser Pro Leu Arg Glu 245 250 255Glu Arg Leu Leu Ser Cys Leu Leu His Lys Ala Ser Arg Gly Leu Leu 260 265 270Ser Leu Tyr Gly His Thr Tyr Ala Glu Lys Val Thr Glu Lys Pro Pro 275 280 285Arg Ala Thr Ala Ser Gly Lys Val Ser Pro Asp His Leu Asp Pro Glu 290 295 300Arg Ala Met Leu Ala Leu Phe Ser Asn Pro Asn Pro Ala Glu Ala Trp305 310 315 320Lys Val Ala Tyr Phe Tyr Cys Leu Ser Asn Asn Lys His Phe Leu Glu 325 330 335Gln Ile Leu Val Thr Ala Leu Thr Leu Leu Lys Glu Glu Asp Phe Pro 340 345 350Asn Leu Gly Cys Leu Leu Asp Arg Glu Phe Arg Pro Leu Ser Cys Leu 355 360 365Leu Val Leu Leu Gly Trp Thr His Cys Gln Ser Leu Glu Ser Ala Lys 370 375 380Arg Leu Leu Gln Thr Leu His Arg Thr Gln Gly Pro Gly Cys Asp Glu385 390 395 400Leu Leu Arg Asp Ala Cys Asp Gly Leu Trp Ala His Leu Glu Val Leu 405 410 415Glu Trp Cys Ile Gln Gln Ser Ser Asn Pro Ile Pro Lys Arg Asp Leu 420 425 430Leu Tyr His Leu His Gly Gly Asp Ser His Ser Val Leu Tyr Thr Leu 435 440 445His His Leu Thr Asn Leu Pro Ala Leu Arg Glu Glu Asp Val Leu Lys 450 455 460Leu Leu Gln Lys Val Pro Ala Lys Asp Pro Gln Gln Glu Pro Asp Ala465 470 475 480Val Asp Ala Pro Val Pro Glu His Leu Ser Gln Cys Gln Asn Leu Thr 485 490 495Leu Tyr Gln Gly Phe Cys Ala Met Lys Tyr Ala Ile Tyr Ala Leu Cys 500 505 510Val Asn Ser His Gln His Ser Gln Cys Gln Asp Cys Lys Asp Ser Leu 515 520 525Ser Glu Asp Leu Ala Ser Ala Thr Glu Pro Ala Asn Asp Ser Leu Ser 530 535 540Ser Pro Gly Ala Ala Asn Leu Phe Ser Thr Tyr Leu Ala Arg Cys Gln545 550 555 560Gln Tyr Leu Cys Ser Ile Pro Asp Ser Leu Cys Leu Glu Leu Leu Glu 565 570 575Asn Ile Phe Ser Leu Leu Leu Ile Thr Ser Ala Asp Leu His Pro Glu 580 585 590Pro His Leu Pro Glu Asp Tyr Ala Glu Asp Asp Asp Ile Glu Gly Lys 595 600 605Ser Pro Ser Gly Leu Arg Ser Pro Ser Glu Ser Pro Gln His Ile Ala 610 615 620His Pro Glu Arg Lys Ser Glu Arg Gly Ser Leu Gly Val Pro Lys Thr625 630 635 640Leu Ala Tyr Thr Met Pro Ser His Val Lys Ala Glu Pro Lys Asp Ser 645 650 655Tyr Pro Gly Pro His Arg His Ser Phe Leu Asp Leu Lys His Phe Thr 660 665 670Ser Gly Ile Ser Gly Phe Leu Ala Asp Glu Phe Ala Ile Gly Ala Phe 675 680 685Leu Arg Leu Leu Gln Glu Gln Leu Asp Glu Ile Ser Ser Arg Ser Pro 690 695 700Pro Glu Lys Pro Lys Gln Glu Ser Gln Ser Cys Ser Gly Ser Arg Asp705 710 715 720Gly Leu Gln Ser Arg Leu His Arg Leu Ser Lys Val Val Ser Glu Ala 725 730 735Gln Trp Arg His Lys Val Val Thr Ser Asn His Arg Ser Glu Glu Gln 740 745 750Pro Ser Arg Arg Tyr Gln Pro Ala Thr Arg His Pro Ser Leu Arg Arg 755 760 765Gly Arg Arg Thr Arg Arg Ser Gln Ala Asp Gly Arg Asp Arg Gly Ser 770 775 780Asn Pro Ser Leu Glu Ser Thr Ser Ser Glu Leu Ser Thr Ser Thr Ser785 790 795 800Glu Gly Ser Leu Ser Ala Met Ser Gly Arg Asn Glu Leu His Ser Arg 805 810 815Leu His Pro His Pro Gln Ser Ser Leu Ile Pro Met Met Phe Ser Pro 820 825 830Pro Glu Ser Leu Leu Ala Ser Cys Ile Leu Arg Gly Asn Phe Ala Glu 835 840 845Ala His Gln Val Leu Phe Thr Phe Asn Leu Lys Ser Ser Pro Ser Ser 850 855 860Gly Glu Leu Met Phe Met Glu Arg Tyr Gln Glu Val Ile Gln Glu Leu865 870 875 880Ala Gln Val Glu His Lys Ile Glu Asn Gln Asn Ser Asp Ala Gly Ser 885 890 895Ser Thr Ile Arg Arg Thr Gly Ser Gly Arg Ser Thr Leu Gln Ala Ile 900 905 910Gly Ser Ala Ala Ala Ala Gly Met Val Phe Tyr Ser Ile Ser Asp Val 915 920 925Thr Asp Lys Leu Leu Asn Thr Ser Gly Asp Pro Ile Pro Met Leu Gln 930 935 940Glu Asp Phe Trp Ile Ser Thr Ala Leu Val Glu Pro Thr Ala Pro Leu945 950 955 960Arg Glu Val Leu Glu Asp Leu Ser Pro Pro Ala Met Ala Ala Phe Asp 965 970 975Leu Ala Cys Ser Gln Cys Gln Leu Trp Lys Thr Cys Lys Gln Leu Leu 980 985 990Glu Thr Ala Glu Arg Arg Leu Asn Ser Ser Leu Glu Arg Arg Gly Arg 995 1000 1005Arg Ile Asp His Val Leu Leu Asn Ala Asp Gly Ile Arg Gly Phe 1010 1015 1020Pro Val Val Leu Gln Gln Ile Ser Lys Ser Leu Asn Tyr Leu Leu 1025 1030 1035Met Ser Ala Ser Gln Thr Lys Ser Glu Ser Val Glu Glu Lys Gly 1040 1045 1050Gly Gly Pro Pro Arg Cys Ser Ile Thr Glu Leu Leu Gln Met Cys 1055 1060 1065Trp Pro Ser Leu Ser Glu Asp Cys Val Ala Ser His Thr Thr Leu 1070 1075 1080Ser Gln Gln Leu Asp Gln Val Leu Gln Ser Leu Arg Glu Ala Leu 1085 1090 1095Glu Leu Pro Glu Pro Arg Thr Pro Pro Leu Ser Ser Leu Val Glu 1100 1105 1110Gln Ala Ala Gln Lys Ala Pro Glu Ala Glu Ala His Pro Val Gln 1115 1120 1125Ile Gln Thr Gln Leu Leu Gln Lys Asn Leu Gly Lys Gln Thr Pro 1130 1135 1140Ser Gly Ser Arg Gln Met Asp Tyr Leu Gly Thr Phe Phe Ser Tyr 1145 1150 1155Cys Ser Thr Leu Ala Ala Val Leu Leu Gln Ser Leu Ser Ser Glu 1160 1165 1170Pro Asp His Val Glu Val Lys Val Gly Asn Pro Phe Val Leu Leu 1175 1180 1185Gln Gln Ser Ser Ser Gln Leu Val Ser His Leu Leu Phe Glu Arg 1190 1195 1200Gln Val Pro Pro Glu Arg Lys Gly Leu Ile Gln Pro Ala Lys Gly 1205 1210 1215Leu1111355PRTHomo sapiens 111Met Asn His Pro Phe Gly Lys Glu Glu Ala Ala Ser Gln Lys Gln Leu1 5 10 15Phe Gly Phe Phe Cys Glu Cys Leu Arg Arg Gly Glu Trp Glu Leu Ala 20 25 30Gln Ala Cys Val Pro Gln Leu Gln Glu Gly Gln Gly Asp Ile Pro Lys 35 40 45Arg Val Glu Asp Ile Leu Gln Ala Leu Val Val Cys Pro Asn Leu Leu 50 55 60Arg Cys Gly Gln Asp Ile Asn Pro Gln Arg Val Ala Trp Val Trp Leu65 70 75 80Leu Val Leu Glu Lys Trp Leu Ala Arg Glu Lys Lys Leu Leu Pro Val 85 90 95Val Phe Arg Arg Lys Leu Glu Phe Leu Leu Leu Ser Glu Asp Leu Gln 100 105 110Gly Asp Ile Pro Glu Asn Ile Leu Glu Glu Leu Tyr Glu Thr Leu Thr 115 120 125Gln Gly Ala Val Gly His Val Pro Asp Gly Asn Pro Arg Arg Glu Ser 130 135 140Trp Thr Pro Arg Leu Ser Ser Glu Ala Val Ser Val Leu Trp Asp Leu145 150 155 160Leu Arg Gln Ser Pro Gln Pro Ala Gln Ala Leu Leu Glu Leu Leu Leu 165 170 175Glu Glu Asp Asp Gly Thr Gly Leu Cys His Trp Pro Leu Gln Asn Ala 180 185 190Leu Val Asp Leu Ile Arg Lys Ala Leu Arg Ala Leu Gln Gly Pro Asp 195 200 205Ser Val Pro Pro Gly Val Val Asp Ala Ile Tyr Gly Ala Leu Arg Thr 210 215 220Leu Arg Cys Pro Ala Glu Pro Leu Gly Val Glu Leu His Leu Leu Cys225 230 235 240Glu Glu Leu Leu Glu Ala Cys Arg Thr Glu Gly Ser Pro Leu Arg Glu 245 250 255Glu Arg Leu Leu Ser Cys Leu Leu His Lys Ala Ser Arg Gly Leu Leu 260 265 270Ser Leu Tyr Gly His Thr Tyr Ala Glu Lys Val Thr Glu Lys Pro Pro 275 280 285Arg Ala Thr Ala Ser Gly Lys Val Ser Pro Asp His Leu Asp Pro Glu 290 295 300Arg Ala Met Leu Ala Leu Phe Ser Asn Pro Asn Pro Ala Glu Ala Trp305 310 315 320Lys Val Ala Tyr Phe Tyr Cys Leu Ser Asn Asn Lys His Phe Leu Glu 325 330 335Gln Ile Leu Val Thr Ala Leu Thr Leu Leu Lys Glu Glu Asp Phe Pro 340 345 350Asn Leu Gly Cys Leu Leu Asp Arg Glu Phe Arg Pro Leu Ser Cys Leu 355 360 365Leu Val Leu Leu Gly Trp Thr His Cys Gln Ser Leu Glu Ser Ala Lys 370 375 380Arg Leu Leu Gln Thr Leu His Arg Thr Gln Gly Pro Gly Cys Asp Glu385 390 395 400Leu Leu Arg Asp Ala Cys Asp Gly Leu Trp Ala His Leu Glu Val Leu 405 410 415Glu Trp Cys Ile Gln Gln Ser Ser Asn Pro Ile Pro Lys Arg Asp Leu 420 425 430Leu Tyr His Leu His Gly Gly Asp Ser His Ser Val Leu Tyr Thr Leu 435 440 445His His Leu Thr Asn Leu Pro Ala Leu Arg Glu Glu Asp Val Leu Lys 450 455 460Leu Leu Gln Lys Val Pro Ala Lys Asp Pro Gln Gln Glu Pro Asp Ala465 470 475 480Val Asp Ala Pro Val Pro Glu His Leu Ser Gln Cys Gln Asn Leu Thr 485 490 495Leu Tyr Gln Gly Phe Cys Ala Met Lys Tyr Ala Ile Tyr Ala Leu Cys 500 505 510Val Asn Ser His Gln His Ser Gln Cys Gln Asp Cys Lys Asp Ser Leu 515 520 525Ser Glu Asp Leu Ala Ser Ala Thr Glu Pro Ala Asn Asp Ser Leu Ser 530 535 540Ser Pro Gly Ala Ala Asn Leu Phe Ser Thr Tyr Leu Ala Arg Cys Gln545 550 555 560Gln Tyr Leu Cys Ser Ile Pro Asp Ser Leu Cys Leu Glu Leu Leu Glu 565 570 575Asn Ile Phe Ser Leu Leu Leu Ile Thr Ser Ala Asp Leu His Pro Glu 580 585 590Pro His Leu Pro Glu Asp Tyr Ala Glu Asp Asp Asp Ile Glu Gly Lys 595 600 605Ser Pro Ser Gly Leu Arg Ser Pro Ser Glu Ser Pro Gln His Ile Ala 610 615 620His Pro Glu Arg Lys Ser Glu Arg Gly Ser Leu Gly Val Pro Lys Thr625 630 635 640Leu Ala Tyr Thr Met Pro Ser His Val Lys Ala Glu Pro Lys Asp Ser 645 650 655Tyr Pro Gly Pro His Arg His Ser Phe Leu Asp Leu Lys His Phe Thr 660 665 670Ser Gly Ile Ser Gly Phe Leu Ala Asp Glu Phe Ala Ile Gly Ala Phe 675 680 685Leu Arg Leu Leu Gln Glu Gln Leu Asp Glu Ile Ser Ser Arg Ser Pro 690 695 700Pro Glu Lys Pro Lys Gln Glu Ser Gln Ser Cys Ser Gly Ser Arg Asp705 710 715 720Gly Leu Gln Ser Arg Leu His Arg Leu Ser Lys Val Val Ser Glu Ala 725 730 735Gln Trp Arg His Lys Val Val Thr Ser Asn His Arg Ser Glu Glu Gln 740 745 750Pro Ser Arg Arg Tyr Gln Pro Ala Thr Arg His Pro Ser Leu Arg Arg 755 760 765Gly Arg Arg Thr Arg Arg Ser Gln Ala Asp Gly Arg Asp Arg Gly Ser 770 775 780Asn Pro Ser Leu Glu Ser Thr Ser Ser Glu Leu Ser Thr Ser Thr Ser785 790 795 800Glu Gly Ser Leu Ser Ala Met Ser Gly Arg Asn Glu Leu His Ser Arg 805 810 815Leu His Pro His Pro Gln Ser Ser Leu Ile Pro Met Met Phe Ser Pro 820 825 830Pro Glu Ser Leu Leu Ala Ser Cys Ile Leu Arg Gly Asn Phe Ala Glu 835 840 845Ala His Gln Val Leu Phe Thr Phe Asn Leu Lys Ser Ser Pro Ser Ser 850 855 860Gly Glu Leu Met Phe Met Glu Arg Tyr Gln Glu Val Ile Gln Glu Leu865 870 875 880Ala Gln Val Glu His Lys Ile Glu Asn Gln Asn Ser Asp Ala Gly Ser 885 890 895Ser Thr Ile Arg Arg Thr Gly Ser Gly Arg Ser Thr Leu Gln Ala Ile 900 905 910Gly Ser Ala Ala Ala Ala Gly Met Val Phe Tyr Ser Ile Ser Asp Val 915 920 925Thr Asp Lys Leu Leu Asn Thr Ser Gly Asp Pro Ile Pro Met Leu Gln 930 935 940Glu Asp Phe Trp Ile Ser Thr Ala Leu Val Glu Pro Thr Ala Pro Leu945 950 955 960Arg Glu Val Leu Glu Asp Leu Ser Pro Pro Ala Met Ala Ala Phe Asp 965 970 975Leu Ala Cys Ser Gln Cys Gln Leu Trp Lys Thr Cys Lys Gln Leu Leu 980 985 990Glu Thr Ala Glu Arg Arg Leu Asn Ser Ser Leu Glu Arg Arg Gly Arg 995 1000 1005Arg Ile Asp His Val Leu Leu Asn Ala Asp Gly Ile Arg Gly Phe 1010 1015 1020Pro Val Val Leu Gln Gln Ile Ser Lys Ser Leu Asn Tyr Leu Leu 1025 1030 1035Met Ser Ala Ser Gln Thr Lys Ser Glu Ser Val Glu Glu Lys Gly 1040 1045 1050Gly Gly Pro Pro Arg Cys Ser Ile Thr Glu Leu Leu Gln Met Cys 1055 1060 1065Trp Pro Ser Leu Ser Glu Asp Cys Val Ala Ser His Thr Thr Leu 1070 1075 1080Ser Gln Gln Leu Asp Gln Val Leu Gln Ser Leu Arg Glu Ala Leu 1085 1090 1095Glu Leu Pro Glu Pro Arg Thr Pro Pro Leu Ser Ser Leu Val Glu 1100 1105 1110Gln Ala Ala Gln Lys Ala Pro Glu Ala Glu Ala His Pro Val Gln 1115 1120 1125Ile Gln Thr Gln Leu Leu Gln Lys Asn Leu Gly Lys Gln Thr Pro 1130 1135 1140Ser Gly Ser Arg Gln Met Asp Tyr Leu Gly Thr Phe Phe Ser Tyr 1145 1150 1155Cys Ser Thr Leu Ala Ala Val Leu Leu Gln Ser Leu Ser Ser Glu 1160 1165 1170Pro Asp His Val Glu Val Lys Val Gly Asn Pro Phe Val Leu Leu 1175 1180 1185Gln Gln Ser Ser Ser Gln Leu Val Ser His Leu Leu Phe Glu Arg 1190 1195 1200Gln Val Pro Pro Glu Arg Leu Ala Ala Leu Leu Ala Gln Glu Asn 1205 1210 1215Leu Ser Leu Ser Val Pro Gln Val Ile Val Ser Cys Cys Cys Glu 1220 1225 1230Pro Leu Ala Leu Cys Ser Ser Arg Gln Ser Gln Gln Thr Ser Ser 1235 1240 1245Leu Leu Thr Arg Leu Gly Thr Leu Ala Gln Leu His Ala Ser His 1250 1255 1260Cys Leu Asp Asp Leu Pro Leu Ser Thr Pro Ser Ser Pro Arg Thr 1265 1270 1275Thr Glu Asn Pro Thr Leu Glu Arg Lys Pro Tyr Ser Ser Pro Arg 1280 1285 1290Asp Ser Ser Leu Pro Ala Leu Thr Ser Ser Ala

Leu Ala Phe Leu 1295 1300 1305Lys Ser Arg Ser Lys Leu Leu Ala Thr Val Ala Cys Leu Gly Ala 1310 1315 1320Ser Pro Arg Leu Lys Val Ser Lys Pro Ser Leu Ser Trp Lys Glu 1325 1330 1335Leu Arg Gly Arg Arg Glu Val Pro Leu Ala Ala Glu Gln Val Ala 1340 1345 1350Arg Glu 13551121437PRTHomo sapiens 112Met Asn His Pro Phe Gly Lys Glu Glu Ala Ala Ser Gln Lys Gln Leu1 5 10 15Phe Gly Phe Phe Cys Glu Cys Leu Arg Arg Gly Glu Trp Glu Leu Ala 20 25 30Gln Ala Cys Val Pro Gln Leu Gln Glu Gly Gln Gly Asp Ile Pro Lys 35 40 45Arg Val Glu Asp Ile Leu Gln Ala Leu Val Val Cys Pro Asn Leu Leu 50 55 60Arg Cys Gly Gln Asp Ile Asn Pro Gln Arg Val Ala Trp Val Trp Leu65 70 75 80Leu Val Leu Glu Lys Trp Leu Ala Arg Glu Lys Lys Leu Leu Pro Val 85 90 95Val Phe Arg Arg Lys Leu Glu Phe Leu Leu Leu Ser Glu Asp Leu Gln 100 105 110Gly Asp Ile Pro Glu Asn Ile Leu Glu Glu Leu Tyr Glu Thr Leu Thr 115 120 125Gln Gly Ala Val Gly His Val Pro Asp Gly Asn Pro Arg Arg Glu Ser 130 135 140Trp Thr Pro Arg Leu Ser Ser Glu Ala Val Ser Val Leu Trp Asp Leu145 150 155 160Leu Arg Gln Ser Pro Gln Pro Ala Gln Ala Leu Leu Glu Leu Leu Leu 165 170 175Glu Glu Asp Asp Gly Thr Gly Leu Cys His Trp Pro Leu Gln Asn Ala 180 185 190Leu Val Asp Leu Ile Arg Lys Ala Leu Arg Ala Leu Gln Gly Pro Asp 195 200 205Ser Val Pro Pro Gly Val Val Asp Ala Ile Tyr Gly Ala Leu Arg Thr 210 215 220Leu Arg Cys Pro Ala Glu Pro Leu Gly Val Glu Leu His Leu Leu Cys225 230 235 240Glu Glu Leu Leu Glu Ala Cys Arg Thr Glu Gly Ser Pro Leu Arg Glu 245 250 255Glu Arg Leu Leu Ser Cys Leu Leu His Lys Ala Ser Arg Gly Leu Leu 260 265 270Ser Leu Tyr Gly His Thr Tyr Ala Glu Lys Val Thr Glu Lys Pro Pro 275 280 285Arg Ala Thr Ala Ser Gly Lys Val Ser Pro Asp His Leu Asp Pro Glu 290 295 300Arg Ala Met Leu Ala Leu Phe Ser Asn Pro Asn Pro Ala Glu Ala Trp305 310 315 320Lys Val Ala Tyr Phe Tyr Cys Leu Ser Asn Asn Lys His Phe Leu Glu 325 330 335Gln Ile Leu Val Thr Ala Leu Thr Leu Leu Lys Glu Glu Asp Phe Pro 340 345 350Asn Leu Gly Cys Leu Leu Asp Arg Glu Phe Arg Pro Leu Ser Cys Leu 355 360 365Leu Val Leu Leu Gly Trp Thr His Cys Gln Ser Leu Glu Ser Ala Lys 370 375 380Arg Leu Leu Gln Thr Leu His Arg Thr Gln Gly Pro Gly Cys Asp Glu385 390 395 400Leu Leu Arg Asp Ala Cys Asp Gly Leu Trp Ala His Leu Glu Val Leu 405 410 415Glu Trp Cys Ile Gln Gln Ser Ser Asn Pro Ile Pro Lys Arg Asp Leu 420 425 430Leu Tyr His Leu His Gly Gly Asp Ser His Ser Val Leu Tyr Thr Leu 435 440 445His His Leu Thr Asn Leu Pro Ala Leu Arg Glu Glu Asp Val Leu Lys 450 455 460Leu Leu Gln Lys Val Pro Ala Lys Asp Pro Gln Gln Glu Pro Asp Ala465 470 475 480Val Asp Ala Pro Val Pro Glu His Leu Ser Gln Cys Gln Asn Leu Thr 485 490 495Leu Tyr Gln Gly Phe Cys Ala Met Lys Tyr Ala Ile Tyr Ala Leu Cys 500 505 510Val Asn Ser His Gln His Ser Gln Cys Gln Asp Cys Lys Asp Ser Leu 515 520 525Ser Glu Asp Leu Ala Ser Ala Thr Glu Pro Ala Asn Asp Ser Leu Ser 530 535 540Ser Pro Gly Ala Ala Asn Leu Phe Ser Thr Tyr Leu Ala Arg Cys Gln545 550 555 560Gln Tyr Leu Cys Ser Ile Pro Asp Ser Leu Cys Leu Glu Leu Leu Glu 565 570 575Asn Ile Phe Ser Leu Leu Leu Ile Thr Ser Ala Asp Leu His Pro Glu 580 585 590Pro His Leu Pro Glu Asp Tyr Ala Glu Asp Asp Asp Ile Glu Gly Lys 595 600 605Ser Pro Ser Gly Leu Arg Ser Pro Ser Glu Ser Pro Gln His Ile Ala 610 615 620His Pro Glu Arg Lys Ser Glu Arg Gly Ser Leu Gly Val Pro Lys Thr625 630 635 640Leu Ala Tyr Thr Met Pro Ser His Val Lys Ala Glu Pro Lys Asp Ser 645 650 655Tyr Pro Gly Pro His Arg His Ser Phe Leu Asp Leu Lys His Phe Thr 660 665 670Ser Gly Ile Ser Gly Phe Leu Ala Asp Glu Phe Ala Ile Gly Ala Phe 675 680 685Leu Arg Leu Leu Gln Glu Gln Leu Asp Glu Ile Ser Ser Arg Ser Pro 690 695 700Pro Glu Lys Pro Lys Gln Glu Ser Gln Ser Cys Ser Gly Ser Arg Asp705 710 715 720Gly Leu Gln Ser Arg Leu His Arg Leu Ser Lys Val Val Ser Glu Ala 725 730 735Gln Trp Arg His Lys Val Val Thr Ser Asn His Arg Ser Glu Glu Gln 740 745 750Pro Ser Arg Arg Tyr Gln Pro Ala Thr Arg His Pro Ser Leu Arg Arg 755 760 765Gly Arg Arg Thr Arg Arg Ser Gln Ala Asp Gly Arg Asp Arg Gly Ser 770 775 780Asn Pro Ser Leu Glu Ser Thr Ser Ser Glu Leu Ser Thr Ser Thr Ser785 790 795 800Glu Gly Ser Leu Ser Ala Met Ser Gly Arg Asn Glu Leu His Ser Arg 805 810 815Leu His Pro His Pro Gln Ser Ser Leu Ile Pro Met Met Phe Ser Pro 820 825 830Pro Glu Ser Leu Leu Ala Ser Cys Ile Leu Arg Gly Asn Phe Ala Glu 835 840 845Ala His Gln Val Leu Phe Thr Phe Asn Leu Lys Ser Ser Pro Ser Ser 850 855 860Gly Glu Leu Met Phe Met Glu Arg Tyr Gln Glu Val Ile Gln Glu Leu865 870 875 880Ala Gln Val Glu His Lys Ile Glu Asn Gln Asn Ser Asp Ala Gly Ser 885 890 895Ser Thr Ile Arg Arg Thr Gly Ser Gly Arg Ser Thr Leu Gln Ala Ile 900 905 910Gly Ser Ala Ala Ala Ala Gly Met Val Phe Tyr Ser Ile Ser Asp Val 915 920 925Thr Asp Lys Leu Leu Asn Thr Ser Gly Asp Pro Ile Pro Met Leu Gln 930 935 940Glu Asp Phe Trp Ile Ser Thr Ala Leu Val Glu Pro Thr Ala Pro Leu945 950 955 960Arg Glu Val Leu Glu Asp Leu Ser Pro Pro Ala Met Ala Ala Phe Asp 965 970 975Leu Ala Cys Ser Gln Cys Gln Leu Trp Lys Thr Cys Lys Gln Leu Leu 980 985 990Glu Thr Ala Glu Arg Arg Leu Asn Ser Ser Leu Glu Arg Arg Gly Arg 995 1000 1005Arg Ile Asp His Val Leu Leu Asn Ala Asp Gly Ile Arg Gly Phe 1010 1015 1020Pro Val Val Leu Gln Gln Ile Ser Lys Ser Leu Asn Tyr Leu Leu 1025 1030 1035Met Ser Ala Ser Gln Thr Lys Ser Glu Ser Val Glu Glu Lys Gly 1040 1045 1050Gly Gly Pro Pro Arg Cys Ser Ile Thr Glu Leu Leu Gln Met Cys 1055 1060 1065Trp Pro Ser Leu Ser Glu Asp Cys Val Ala Ser His Thr Thr Leu 1070 1075 1080Ser Gln Gln Leu Asp Gln Val Leu Gln Ser Leu Arg Glu Ala Leu 1085 1090 1095Glu Leu Pro Glu Pro Arg Thr Pro Pro Leu Ser Ser Leu Val Glu 1100 1105 1110Gln Ala Ala Gln Lys Ala Pro Glu Ala Glu Ala His Pro Val Gln 1115 1120 1125Ile Gln Thr Gln Leu Leu Gln Lys Asn Leu Gly Lys Gln Thr Pro 1130 1135 1140Ser Gly Ser Arg Gln Met Asp Tyr Leu Gly Thr Phe Phe Ser Tyr 1145 1150 1155Cys Ser Thr Leu Ala Ala Val Leu Leu Gln Ser Leu Ser Ser Glu 1160 1165 1170Pro Asp His Val Glu Val Lys Val Gly Asn Pro Phe Val Leu Leu 1175 1180 1185Gln Gln Ser Ser Ser Gln Leu Val Ser His Leu Leu Phe Glu Arg 1190 1195 1200Gln Val Pro Pro Glu Arg Leu Ala Ala Leu Leu Ala Gln Glu Asn 1205 1210 1215Leu Ser Leu Ser Val Pro Gln Val Ile Val Ser Cys Cys Cys Glu 1220 1225 1230Pro Leu Ala Leu Cys Ser Ser Arg Gln Ser Gln Gln Thr Ser Ser 1235 1240 1245Leu Leu Thr Arg Leu Gly Thr Leu Ala Gln Leu His Ala Ser His 1250 1255 1260Cys Leu Asp Asp Leu Pro Leu Ser Thr Pro Ser Ser Pro Arg Thr 1265 1270 1275Thr Glu Asn Pro Thr Leu Glu Arg Lys Pro Tyr Ser Ser Pro Arg 1280 1285 1290Asp Ser Ser Leu Pro Ala Leu Thr Ser Ser Ala Leu Ala Phe Leu 1295 1300 1305Lys Ser Arg Ser Lys Leu Leu Ala Thr Val Ala Cys Leu Gly Ala 1310 1315 1320Ser Pro Arg Leu Lys Val Ser Lys Pro Ser Leu Ser Trp Lys Glu 1325 1330 1335Leu Arg Gly Arg Arg Glu Val Pro Leu Ala Ala Glu Gln Val Ala 1340 1345 1350Arg Glu Cys Glu Arg Leu Leu Glu Gln Phe Pro Leu Phe Glu Ala 1355 1360 1365Phe Leu Leu Ala Ala Trp Glu Pro Leu Arg Gly Ser Leu Gln Gln 1370 1375 1380Gly Gln Ser Leu Ala Val Asn Leu Cys Gly Trp Ala Ser Leu Ser 1385 1390 1395Thr Val Leu Leu Gly Leu His Ser Pro Ile Ala Leu Asp Val Leu 1400 1405 1410Ser Glu Ala Phe Glu Glu Ser Leu Val Ala Arg Asp Trp Ser Arg 1415 1420 1425Ala Leu Gln Leu Thr Glu Val Tyr Gly 1430 14351131686PRTHomo sapiens 113Met Asn His Pro Phe Gly Lys Glu Glu Ala Ala Ser Gln Lys Gln Leu1 5 10 15Phe Gly Phe Phe Cys Glu Cys Leu Arg Arg Gly Glu Trp Glu Leu Ala 20 25 30Gln Ala Cys Val Pro Gln Leu Gln Glu Gly Gln Gly Asp Ile Pro Lys 35 40 45Arg Val Glu Asp Ile Leu Gln Ala Leu Val Val Cys Pro Asn Leu Leu 50 55 60Arg Cys Gly Gln Asp Ile Asn Pro Gln Arg Val Ala Trp Val Trp Leu65 70 75 80Leu Val Leu Glu Lys Trp Leu Ala Arg Glu Lys Lys Leu Leu Pro Val 85 90 95Val Phe Arg Arg Lys Leu Glu Phe Leu Leu Leu Ser Glu Asp Leu Gln 100 105 110Gly Asp Ile Pro Glu Asn Ile Leu Glu Glu Leu Tyr Glu Thr Leu Thr 115 120 125Gln Gly Ala Val Gly His Val Pro Asp Gly Asn Pro Arg Arg Glu Ser 130 135 140Trp Thr Pro Arg Leu Ser Ser Glu Ala Val Ser Val Leu Trp Asp Leu145 150 155 160Leu Arg Gln Ser Pro Gln Pro Ala Gln Ala Leu Leu Glu Leu Leu Leu 165 170 175Glu Glu Asp Asp Gly Thr Gly Leu Cys His Trp Pro Leu Gln Asn Ala 180 185 190Leu Val Asp Leu Ile Arg Lys Ala Leu Arg Ala Leu Gln Gly Pro Asp 195 200 205Ser Val Pro Pro Gly Val Val Asp Ala Ile Tyr Gly Ala Leu Arg Thr 210 215 220Leu Arg Cys Pro Ala Glu Pro Leu Gly Val Glu Leu His Leu Leu Cys225 230 235 240Glu Glu Leu Leu Glu Ala Cys Arg Thr Glu Gly Ser Pro Leu Arg Glu 245 250 255Glu Arg Leu Leu Ser Cys Leu Leu His Lys Ala Ser Arg Gly Leu Leu 260 265 270Ser Leu Tyr Gly His Thr Tyr Ala Glu Lys Val Thr Glu Lys Pro Pro 275 280 285Arg Ala Thr Ala Ser Gly Lys Val Ser Pro Asp His Leu Asp Pro Glu 290 295 300Arg Ala Met Leu Ala Leu Phe Ser Asn Pro Asn Pro Ala Glu Ala Trp305 310 315 320Lys Val Ala Tyr Phe Tyr Cys Leu Ser Asn Asn Lys His Phe Leu Glu 325 330 335Gln Ile Leu Val Thr Ala Leu Thr Leu Leu Lys Glu Glu Asp Phe Pro 340 345 350Asn Leu Gly Cys Leu Leu Asp Arg Glu Phe Arg Pro Leu Ser Cys Leu 355 360 365Leu Val Leu Leu Gly Trp Thr His Cys Gln Ser Leu Glu Ser Ala Lys 370 375 380Arg Leu Leu Gln Thr Leu His Arg Thr Gln Gly Pro Gly Cys Asp Glu385 390 395 400Leu Leu Arg Asp Ala Cys Asp Gly Leu Trp Ala His Leu Glu Val Leu 405 410 415Glu Trp Cys Ile Gln Gln Ser Ser Asn Pro Ile Pro Lys Arg Asp Leu 420 425 430Leu Tyr His Leu His Gly Gly Asp Ser His Ser Val Leu Tyr Thr Leu 435 440 445His His Leu Thr Asn Leu Pro Ala Leu Arg Glu Glu Asp Val Leu Lys 450 455 460Leu Leu Gln Lys Val Pro Ala Lys Asp Pro Gln Gln Glu Pro Asp Ala465 470 475 480Val Asp Ala Pro Val Pro Glu His Leu Ser Gln Cys Gln Asn Leu Thr 485 490 495Leu Tyr Gln Gly Phe Cys Ala Met Lys Tyr Ala Ile Tyr Ala Leu Cys 500 505 510Val Asn Ser His Gln His Ser Gln Cys Gln Asp Cys Lys Asp Ser Leu 515 520 525Ser Glu Asp Leu Ala Ser Ala Thr Glu Pro Ala Asn Asp Ser Leu Ser 530 535 540Ser Pro Gly Ala Ala Asn Leu Phe Ser Thr Tyr Leu Ala Arg Cys Gln545 550 555 560Gln Tyr Leu Cys Ser Ile Pro Asp Ser Leu Cys Leu Glu Leu Leu Glu 565 570 575Asn Ile Phe Ser Leu Leu Leu Ile Thr Ser Ala Asp Leu His Pro Glu 580 585 590Pro His Leu Pro Glu Asp Tyr Ala Glu Asp Asp Asp Ile Glu Gly Lys 595 600 605Ser Pro Ser Gly Leu Arg Ser Pro Ser Glu Ser Pro Gln His Ile Ala 610 615 620His Pro Glu Arg Lys Ser Glu Arg Gly Ser Leu Gly Val Pro Lys Thr625 630 635 640Leu Ala Tyr Thr Met Pro Ser His Val Lys Ala Glu Pro Lys Asp Ser 645 650 655Tyr Pro Gly Pro His Arg His Ser Phe Leu Asp Leu Lys His Phe Thr 660 665 670Ser Gly Ile Ser Gly Phe Leu Ala Asp Glu Phe Ala Ile Gly Ala Phe 675 680 685Leu Arg Leu Leu Gln Glu Gln Leu Asp Glu Ile Ser Ser Arg Ser Pro 690 695 700Pro Glu Lys Pro Lys Gln Glu Ser Gln Ser Cys Ser Gly Ser Arg Asp705 710 715 720Gly Leu Gln Ser Arg Leu His Arg Leu Ser Lys Val Val Ser Glu Ala 725 730 735Gln Trp Arg His Lys Val Val Thr Ser Asn His Arg Ser Glu Glu Gln 740 745 750Pro Ser Arg Arg Tyr Gln Pro Ala Thr Arg His Pro Ser Leu Arg Arg 755 760 765Gly Arg Arg Thr Arg Arg Ser Gln Ala Asp Gly Arg Asp Arg Gly Ser 770 775 780Asn Pro Ser Leu Glu Ser Thr Ser Ser Glu Leu Ser Thr Ser Thr Ser785 790 795 800Glu Gly Ser Leu Ser Ala Met Ser Gly Arg Asn Glu Leu His Ser Arg 805 810 815Leu His Pro His Pro Gln Ser Ser Leu Ile Pro Met Met Phe Ser Pro 820 825 830Pro Glu Ser Leu Leu Ala Ser Cys Ile Leu Arg Gly Asn Phe Ala Glu 835 840 845Ala His Gln Val Leu Phe Thr Phe Asn Leu Lys Ser Ser Pro Ser Ser 850 855 860Gly Glu Leu Met Phe Met Glu Arg Tyr Gln Glu Val Ile Gln Glu Leu865 870 875 880Ala Gln Val Glu His Lys Ile Glu Asn Gln Asn Ser Asp Ala Gly Ser 885 890 895Ser Thr Ile Arg Arg Thr Gly Ser Gly Arg Ser Thr Leu Gln Ala Ile 900 905 910Gly Ser Ala Ala Ala Ala Gly Met Val Phe Tyr Ser Ile Ser Asp Val 915 920 925Thr Asp Lys Leu Leu Asn Thr Ser Gly Asp Pro Ile Pro Met Leu Gln 930 935 940Glu Asp Phe Trp Ile Ser Thr Ala Leu Val Glu Pro Thr Ala Pro Leu945 950 955 960Arg Glu Val Leu Glu Asp Leu Ser Pro Pro Ala Met Ala Ala Phe Asp

965 970 975Leu Ala Cys Ser Gln Cys Gln Leu Trp Lys Thr Cys Lys Gln Leu Leu 980 985 990Glu Thr Ala Glu Arg Arg Leu Asn Ser Ser Leu Glu Arg Arg Gly Arg 995 1000 1005Arg Ile Asp His Val Leu Leu Asn Ala Asp Gly Ile Arg Gly Phe 1010 1015 1020Pro Val Val Leu Gln Gln Ile Ser Lys Ser Leu Asn Tyr Leu Leu 1025 1030 1035Met Ser Ala Ser Gln Thr Lys Ser Glu Ser Val Glu Glu Lys Gly 1040 1045 1050Gly Gly Pro Pro Arg Cys Ser Ile Thr Glu Leu Leu Gln Met Cys 1055 1060 1065Trp Pro Ser Leu Ser Glu Asp Cys Val Ala Ser His Thr Thr Leu 1070 1075 1080Ser Gln Gln Leu Asp Gln Val Leu Gln Ser Leu Arg Glu Ala Leu 1085 1090 1095Glu Leu Pro Glu Pro Arg Thr Pro Pro Leu Ser Ser Leu Val Glu 1100 1105 1110Gln Ala Ala Gln Lys Ala Pro Glu Ala Glu Ala His Pro Val Gln 1115 1120 1125Ile Gln Thr Gln Leu Leu Gln Lys Asn Leu Gly Lys Gln Thr Pro 1130 1135 1140Ser Gly Ser Arg Gln Met Asp Tyr Leu Gly Thr Phe Phe Ser Tyr 1145 1150 1155Cys Ser Thr Leu Ala Ala Val Leu Leu Gln Ser Leu Ser Ser Glu 1160 1165 1170Pro Asp His Val Glu Val Lys Val Gly Asn Pro Phe Val Leu Leu 1175 1180 1185Gln Gln Ser Ser Ser Gln Leu Val Ser His Leu Leu Phe Glu Arg 1190 1195 1200Gln Val Pro Pro Glu Arg Leu Ala Ala Leu Leu Ala Gln Glu Asn 1205 1210 1215Leu Ser Leu Ser Val Pro Gln Val Ile Val Ser Cys Cys Cys Glu 1220 1225 1230Pro Leu Ala Leu Cys Ser Ser Arg Gln Ser Gln Gln Thr Ser Ser 1235 1240 1245Leu Leu Thr Arg Leu Gly Thr Leu Ala Gln Leu His Ala Ser His 1250 1255 1260Cys Leu Asp Asp Leu Pro Leu Ser Thr Pro Ser Ser Pro Arg Thr 1265 1270 1275Thr Glu Asn Pro Thr Leu Glu Arg Lys Pro Tyr Ser Ser Pro Arg 1280 1285 1290Asp Ser Ser Leu Pro Ala Leu Thr Ser Ser Ala Leu Ala Phe Leu 1295 1300 1305Lys Ser Arg Ser Lys Leu Leu Ala Thr Val Ala Cys Leu Gly Ala 1310 1315 1320Ser Pro Arg Leu Lys Val Ser Lys Pro Ser Leu Ser Trp Lys Glu 1325 1330 1335Leu Arg Gly Arg Arg Glu Val Pro Leu Ala Ala Glu Gln Val Ala 1340 1345 1350Arg Glu Cys Glu Arg Leu Leu Glu Gln Phe Pro Leu Phe Glu Ala 1355 1360 1365Phe Leu Leu Ala Ala Trp Glu Pro Leu Arg Gly Ser Leu Gln Gln 1370 1375 1380Gly Gln Ser Leu Ala Val Asn Leu Cys Gly Trp Ala Ser Leu Ser 1385 1390 1395Thr Val Leu Leu Gly Leu His Ser Pro Ile Ala Leu Asp Val Leu 1400 1405 1410Ser Glu Ala Phe Glu Glu Ser Leu Val Ala Arg Asp Trp Ser Arg 1415 1420 1425Ala Leu Gln Leu Thr Glu Val Tyr Gly Arg Asp Val Asp Asp Leu 1430 1435 1440Ser Ser Ile Lys Asp Ala Val Leu Ser Cys Ala Val Ala Cys Asp 1445 1450 1455Lys Glu Gly Trp Gln Tyr Leu Phe Pro Val Lys Asp Ala Ser Leu 1460 1465 1470Arg Ser Arg Leu Ala Leu Gln Phe Val Asp Arg Trp Pro Leu Glu 1475 1480 1485Ser Cys Leu Glu Ile Leu Ala Tyr Cys Ile Ser Asp Thr Ala Val 1490 1495 1500Gln Glu Gly Leu Lys Cys Glu Leu Gln Arg Lys Leu Ala Glu Leu 1505 1510 1515Gln Val Tyr Gln Lys Ile Leu Gly Leu Gln Ser Pro Pro Val Trp 1520 1525 1530Cys Asp Trp Gln Thr Leu Arg Ser Cys Cys Val Glu Asp Pro Ser 1535 1540 1545Thr Val Met Asn Met Ile Leu Glu Ala Gln Glu Tyr Glu Leu Cys 1550 1555 1560Glu Glu Trp Gly Cys Leu Tyr Pro Ile Pro Arg Glu His Leu Ile 1565 1570 1575Ser Leu His Gln Lys His Leu Leu His Leu Leu Glu Arg Arg Asp 1580 1585 1590His Asp Lys Ala Leu Gln Leu Leu Arg Arg Ile Pro Asp Pro Thr 1595 1600 1605Met Cys Leu Glu Val Thr Glu Gln Ser Leu Asp Gln His Thr Ser 1610 1615 1620Leu Ala Thr Ser His Phe Leu Ala Asn Tyr Leu Thr Thr His Phe 1625 1630 1635Tyr Gly Gln Leu Thr Ala Val Arg His Arg Glu Ile Gln Ala Leu 1640 1645 1650Tyr Val Gly Ser Lys Ile Leu Leu Thr Leu Pro Glu Gln His Arg 1655 1660 1665Ala Ser Tyr Ser His Leu Ser Ser Asn Pro Arg Ser Cys Trp Ser 1670 1675 1680Ser Cys Leu 16851141807PRTHomo sapiens 114Met Asn His Pro Phe Gly Lys Glu Glu Ala Ala Ser Gln Lys Gln Leu1 5 10 15Phe Gly Phe Phe Cys Glu Cys Leu Arg Arg Gly Glu Trp Glu Leu Ala 20 25 30Gln Ala Cys Val Pro Gln Leu Gln Glu Gly Gln Gly Asp Ile Pro Lys 35 40 45Arg Val Glu Asp Ile Leu Gln Ala Leu Val Val Cys Pro Asn Leu Leu 50 55 60Arg Cys Gly Gln Asp Ile Asn Pro Gln Arg Val Ala Trp Val Trp Leu65 70 75 80Leu Val Leu Glu Lys Trp Leu Ala Arg Glu Lys Lys Leu Leu Pro Val 85 90 95Val Phe Arg Arg Lys Leu Glu Phe Leu Leu Leu Ser Glu Asp Leu Gln 100 105 110Gly Asp Ile Pro Glu Asn Ile Leu Glu Glu Leu Tyr Glu Thr Leu Thr 115 120 125Gln Gly Ala Val Gly His Val Pro Asp Gly Asn Pro Arg Arg Glu Ser 130 135 140Trp Thr Pro Arg Leu Ser Ser Glu Ala Val Ser Val Leu Trp Asp Leu145 150 155 160Leu Arg Gln Ser Pro Gln Pro Ala Gln Ala Leu Leu Glu Leu Leu Leu 165 170 175Glu Glu Asp Asp Gly Thr Gly Leu Cys His Trp Pro Leu Gln Asn Ala 180 185 190Leu Val Asp Leu Ile Arg Lys Ala Leu Arg Ala Leu Gln Gly Pro Asp 195 200 205Ser Val Pro Pro Gly Val Val Asp Ala Ile Tyr Gly Ala Leu Arg Thr 210 215 220Leu Arg Cys Pro Ala Glu Pro Leu Gly Val Glu Leu His Leu Leu Cys225 230 235 240Glu Glu Leu Leu Glu Ala Cys Arg Thr Glu Gly Ser Pro Leu Arg Glu 245 250 255Glu Arg Leu Leu Ser Cys Leu Leu His Lys Ala Ser Arg Gly Leu Leu 260 265 270Ser Leu Tyr Gly His Thr Tyr Ala Glu Lys Val Thr Glu Lys Pro Pro 275 280 285Arg Ala Thr Ala Ser Gly Lys Val Ser Pro Asp His Leu Asp Pro Glu 290 295 300Arg Ala Met Leu Ala Leu Phe Ser Asn Pro Asn Pro Ala Glu Ala Trp305 310 315 320Lys Val Ala Tyr Phe Tyr Cys Leu Ser Asn Asn Lys His Phe Leu Glu 325 330 335Gln Ile Leu Val Thr Ala Leu Thr Leu Leu Lys Glu Glu Asp Phe Pro 340 345 350Asn Leu Gly Cys Leu Leu Asp Arg Glu Phe Arg Pro Leu Ser Cys Leu 355 360 365Leu Val Leu Leu Gly Trp Thr His Cys Gln Ser Leu Glu Ser Ala Lys 370 375 380Arg Leu Leu Gln Thr Leu His Arg Thr Gln Gly Pro Gly Cys Asp Glu385 390 395 400Leu Leu Arg Asp Ala Cys Asp Gly Leu Trp Ala His Leu Glu Val Leu 405 410 415Glu Trp Cys Ile Gln Gln Ser Ser Asn Pro Ile Pro Lys Arg Asp Leu 420 425 430Leu Tyr His Leu His Gly Gly Asp Ser His Ser Val Leu Tyr Thr Leu 435 440 445His His Leu Thr Asn Leu Pro Ala Leu Arg Glu Glu Asp Val Leu Lys 450 455 460Leu Leu Gln Lys Val Pro Ala Lys Asp Pro Gln Gln Glu Pro Asp Ala465 470 475 480Val Asp Ala Pro Val Pro Glu His Leu Ser Gln Cys Gln Asn Leu Thr 485 490 495Leu Tyr Gln Gly Phe Cys Ala Met Lys Tyr Ala Ile Tyr Ala Leu Cys 500 505 510Val Asn Ser His Gln His Ser Gln Cys Gln Asp Cys Lys Asp Ser Leu 515 520 525Ser Glu Asp Leu Ala Ser Ala Thr Glu Pro Ala Asn Asp Ser Leu Ser 530 535 540Ser Pro Gly Ala Ala Asn Leu Phe Ser Thr Tyr Leu Ala Arg Cys Gln545 550 555 560Gln Tyr Leu Cys Ser Ile Pro Asp Ser Leu Cys Leu Glu Leu Leu Glu 565 570 575Asn Ile Phe Ser Leu Leu Leu Ile Thr Ser Ala Asp Leu His Pro Glu 580 585 590Pro His Leu Pro Glu Asp Tyr Ala Glu Asp Asp Asp Ile Glu Gly Lys 595 600 605Ser Pro Ser Gly Leu Arg Ser Pro Ser Glu Ser Pro Gln His Ile Ala 610 615 620His Pro Glu Arg Lys Ser Glu Arg Gly Ser Leu Gly Val Pro Lys Thr625 630 635 640Leu Ala Tyr Thr Met Pro Ser His Val Lys Ala Glu Pro Lys Asp Ser 645 650 655Tyr Pro Gly Pro His Arg His Ser Phe Leu Asp Leu Lys His Phe Thr 660 665 670Ser Gly Ile Ser Gly Phe Leu Ala Asp Glu Phe Ala Ile Gly Ala Phe 675 680 685Leu Arg Leu Leu Gln Glu Gln Leu Asp Glu Ile Ser Ser Arg Ser Pro 690 695 700Pro Glu Lys Pro Lys Gln Glu Ser Gln Ser Cys Ser Gly Ser Arg Asp705 710 715 720Gly Leu Gln Ser Arg Leu His Arg Leu Ser Lys Val Val Ser Glu Ala 725 730 735Gln Trp Arg His Lys Val Val Thr Ser Asn His Arg Ser Glu Glu Gln 740 745 750Pro Ser Arg Arg Tyr Gln Pro Ala Thr Arg His Pro Ser Leu Arg Arg 755 760 765Gly Arg Arg Thr Arg Arg Ser Gln Ala Asp Gly Arg Asp Arg Gly Ser 770 775 780Asn Pro Ser Leu Glu Ser Thr Ser Ser Glu Leu Ser Thr Ser Thr Ser785 790 795 800Glu Gly Ser Leu Ser Ala Met Ser Gly Arg Asn Glu Leu His Ser Arg 805 810 815Leu His Pro His Pro Gln Ser Ser Leu Ile Pro Met Met Phe Ser Pro 820 825 830Pro Glu Ser Leu Leu Ala Ser Cys Ile Leu Arg Gly Asn Phe Ala Glu 835 840 845Ala His Gln Val Leu Phe Thr Phe Asn Leu Lys Ser Ser Pro Ser Ser 850 855 860Gly Glu Leu Met Phe Met Glu Arg Tyr Gln Glu Val Ile Gln Glu Leu865 870 875 880Ala Gln Val Glu His Lys Ile Glu Asn Gln Asn Ser Asp Ala Gly Ser 885 890 895Ser Thr Ile Arg Arg Thr Gly Ser Gly Arg Ser Thr Leu Gln Ala Ile 900 905 910Gly Ser Ala Ala Ala Ala Gly Met Val Phe Tyr Ser Ile Ser Asp Val 915 920 925Thr Asp Lys Leu Leu Asn Thr Ser Gly Asp Pro Ile Pro Met Leu Gln 930 935 940Glu Asp Phe Trp Ile Ser Thr Ala Leu Val Glu Pro Thr Ala Pro Leu945 950 955 960Arg Glu Val Leu Glu Asp Leu Ser Pro Pro Ala Met Ala Ala Phe Asp 965 970 975Leu Ala Cys Ser Gln Cys Gln Leu Trp Lys Thr Cys Lys Gln Leu Leu 980 985 990Glu Thr Ala Glu Arg Arg Leu Asn Ser Ser Leu Glu Arg Arg Gly Arg 995 1000 1005Arg Ile Asp His Val Leu Leu Asn Ala Asp Gly Ile Arg Gly Phe 1010 1015 1020Pro Val Val Leu Gln Gln Ile Ser Lys Ser Leu Asn Tyr Leu Leu 1025 1030 1035Met Ser Ala Ser Gln Thr Lys Ser Glu Ser Val Glu Glu Lys Gly 1040 1045 1050Gly Gly Pro Pro Arg Cys Ser Ile Thr Glu Leu Leu Gln Met Cys 1055 1060 1065Trp Pro Ser Leu Ser Glu Asp Cys Val Ala Ser His Thr Thr Leu 1070 1075 1080Ser Gln Gln Leu Asp Gln Val Leu Gln Ser Leu Arg Glu Ala Leu 1085 1090 1095Glu Leu Pro Glu Pro Arg Thr Pro Pro Leu Ser Ser Leu Val Glu 1100 1105 1110Gln Ala Ala Gln Lys Ala Pro Glu Ala Glu Ala His Pro Val Gln 1115 1120 1125Ile Gln Thr Gln Leu Leu Gln Lys Asn Leu Gly Lys Gln Thr Pro 1130 1135 1140Ser Gly Ser Arg Gln Met Asp Tyr Leu Gly Thr Phe Phe Ser Tyr 1145 1150 1155Cys Ser Thr Leu Ala Ala Val Leu Leu Gln Ser Leu Ser Ser Glu 1160 1165 1170Pro Asp His Val Glu Val Lys Val Gly Asn Pro Phe Val Leu Leu 1175 1180 1185Gln Gln Ser Ser Ser Gln Leu Val Ser His Leu Leu Phe Glu Arg 1190 1195 1200Gln Val Pro Pro Glu Arg Leu Ala Ala Leu Leu Ala Gln Glu Asn 1205 1210 1215Leu Ser Leu Ser Val Pro Gln Val Ile Val Ser Cys Cys Cys Glu 1220 1225 1230Pro Leu Ala Leu Cys Ser Ser Arg Gln Ser Gln Gln Thr Ser Ser 1235 1240 1245Leu Leu Thr Arg Leu Gly Thr Leu Ala Gln Leu His Ala Ser His 1250 1255 1260Cys Leu Asp Asp Leu Pro Leu Ser Thr Pro Ser Ser Pro Arg Thr 1265 1270 1275Thr Glu Asn Pro Thr Leu Glu Arg Lys Pro Tyr Ser Ser Pro Arg 1280 1285 1290Asp Ser Ser Leu Pro Ala Leu Thr Ser Ser Ala Leu Ala Phe Leu 1295 1300 1305Lys Ser Arg Ser Lys Leu Leu Ala Thr Val Ala Cys Leu Gly Ala 1310 1315 1320Ser Pro Arg Leu Lys Val Ser Lys Pro Ser Leu Ser Trp Lys Glu 1325 1330 1335Leu Arg Gly Arg Arg Glu Val Pro Leu Ala Ala Glu Gln Val Ala 1340 1345 1350Arg Glu Cys Glu Arg Leu Leu Glu Gln Phe Pro Leu Phe Glu Ala 1355 1360 1365Phe Leu Leu Ala Ala Trp Glu Pro Leu Arg Gly Ser Leu Gln Gln 1370 1375 1380Gly Gln Ser Leu Ala Val Asn Leu Cys Gly Trp Ala Ser Leu Ser 1385 1390 1395Thr Val Leu Leu Gly Leu His Ser Pro Ile Ala Leu Asp Val Leu 1400 1405 1410Ser Glu Ala Phe Glu Glu Ser Leu Val Ala Arg Asp Trp Ser Arg 1415 1420 1425Ala Leu Gln Leu Thr Glu Val Tyr Gly Arg Asp Val Asp Asp Leu 1430 1435 1440Ser Ser Ile Lys Asp Ala Val Leu Ser Cys Ala Val Ala Cys Asp 1445 1450 1455Lys Glu Gly Trp Gln Tyr Leu Phe Pro Val Lys Asp Ala Ser Leu 1460 1465 1470Arg Ser Arg Leu Ala Leu Gln Phe Val Asp Arg Trp Pro Leu Glu 1475 1480 1485Ser Cys Leu Glu Ile Leu Ala Tyr Cys Ile Ser Asp Thr Ala Val 1490 1495 1500Gln Glu Gly Leu Lys Cys Glu Leu Gln Arg Lys Leu Ala Glu Leu 1505 1510 1515Gln Val Tyr Gln Lys Ile Leu Gly Leu Gln Ser Pro Pro Val Trp 1520 1525 1530Cys Asp Trp Gln Thr Leu Arg Ser Cys Cys Val Glu Asp Pro Ser 1535 1540 1545Thr Val Met Asn Met Ile Leu Glu Ala Gln Glu Tyr Glu Leu Cys 1550 1555 1560Glu Glu Trp Gly Cys Leu Tyr Pro Ile Pro Arg Glu His Leu Ile 1565 1570 1575Ser Leu His Gln Lys His Leu Leu His Leu Leu Glu Arg Arg Asp 1580 1585 1590His Asp Lys Ala Leu Gln Leu Leu Arg Arg Ile Pro Asp Pro Thr 1595 1600 1605Met Cys Leu Glu Val Thr Glu Gln Ser Leu Asp Gln His Thr Ser 1610 1615 1620Leu Ala Thr Ser His Phe Leu Ala Asn Tyr Leu Thr Thr His Phe 1625 1630 1635Tyr Gly Gln Leu Thr Ala Val Arg His Arg Glu Ile Gln Ala Leu 1640 1645 1650Tyr Val Gly Ser Lys Ile Leu Leu Thr Leu Pro Glu Gln His Arg 1655 1660 1665Ala Ser Tyr Ser His Leu Ser Ser Asn Pro Leu Phe Met Leu Glu 1670 1675 1680Gln Leu Leu Met Asn Met Lys Val Asp Trp Ala Thr Val Ala Val 1685 1690 1695Gln Thr Leu Gln Gln Leu Leu Val Gly Gln Glu Ile Gly Phe Thr 1700 1705 1710Met Asp Glu Val Asp Ser Leu Leu Ser Arg Tyr Ala Glu Lys Ala 1715 1720 1725Leu Asp Phe Pro

Tyr Pro Gln Arg Glu Lys Arg Ser Asp Ser Val 1730 1735 1740Ile His Leu Gln Glu Ile Val His Gln Ala Ala Asp Pro Glu Thr 1745 1750 1755Leu Pro Arg Ser Pro Ser Ala Glu Phe Ser Pro Ala Ala Pro Pro 1760 1765 1770Gly Ile Ser Ser Ile His Ser Pro Ser Leu Arg Glu Arg Ser Phe 1775 1780 1785Pro Pro Thr Gln Pro Ser Gln Glu Phe Val Pro Pro Ala Thr Pro 1790 1795 1800Pro Ala Arg His 18051152539PRTHomo sapiens 115Met Asn His Pro Phe Gly Lys Glu Glu Ala Ala Ser Gln Lys Gln Leu1 5 10 15Phe Gly Phe Phe Cys Glu Cys Leu Arg Arg Gly Glu Trp Glu Leu Ala 20 25 30Gln Ala Cys Val Pro Gln Leu Gln Glu Gly Gln Gly Asp Ile Pro Lys 35 40 45Arg Val Glu Asp Ile Leu Gln Ala Leu Val Val Cys Pro Asn Leu Leu 50 55 60Arg Cys Gly Gln Asp Ile Asn Pro Gln Arg Val Ala Trp Val Trp Leu65 70 75 80Leu Val Leu Glu Lys Trp Leu Ala Arg Glu Lys Lys Leu Leu Pro Val 85 90 95Val Phe Arg Arg Lys Leu Glu Phe Leu Leu Leu Ser Glu Asp Leu Gln 100 105 110Gly Asp Ile Pro Glu Asn Ile Leu Glu Glu Leu Tyr Glu Thr Leu Thr 115 120 125Gln Gly Ala Val Gly His Val Pro Asp Gly Asn Pro Arg Arg Glu Ser 130 135 140Trp Thr Pro Arg Leu Ser Ser Glu Ala Val Ser Val Leu Trp Asp Leu145 150 155 160Leu Arg Gln Ser Pro Gln Pro Ala Gln Ala Leu Leu Glu Leu Leu Leu 165 170 175Glu Glu Asp Asp Gly Thr Gly Leu Cys His Trp Pro Leu Gln Asn Ala 180 185 190Leu Val Asp Leu Ile Arg Lys Ala Leu Arg Ala Leu Gln Gly Pro Asp 195 200 205Ser Val Pro Pro Gly Val Val Asp Ala Ile Tyr Gly Ala Leu Arg Thr 210 215 220Leu Arg Cys Pro Ala Glu Pro Leu Gly Val Glu Leu His Leu Leu Cys225 230 235 240Glu Glu Leu Leu Glu Ala Cys Arg Thr Glu Gly Ser Pro Leu Arg Glu 245 250 255Glu Arg Leu Leu Ser Cys Leu Leu His Lys Ala Ser Arg Gly Leu Leu 260 265 270Ser Leu Tyr Gly His Thr Tyr Ala Glu Lys Val Thr Glu Lys Pro Pro 275 280 285Arg Ala Thr Ala Ser Gly Lys Val Ser Pro Asp His Leu Asp Pro Glu 290 295 300Arg Ala Met Leu Ala Leu Phe Ser Asn Pro Asn Pro Ala Glu Ala Trp305 310 315 320Lys Val Ala Tyr Phe Tyr Cys Leu Ser Asn Asn Lys His Phe Leu Glu 325 330 335Gln Ile Leu Val Thr Ala Leu Thr Leu Leu Lys Glu Glu Asp Phe Pro 340 345 350Asn Leu Gly Cys Leu Leu Asp Arg Glu Phe Arg Pro Leu Ser Cys Leu 355 360 365Leu Val Leu Leu Gly Trp Thr His Cys Gln Ser Leu Glu Ser Ala Lys 370 375 380Arg Leu Leu Gln Thr Leu His Arg Thr Gln Gly Pro Gly Cys Asp Glu385 390 395 400Leu Leu Arg Asp Ala Cys Asp Gly Leu Trp Ala His Leu Glu Val Leu 405 410 415Glu Trp Cys Ile Gln Gln Ser Ser Asn Pro Ile Pro Lys Arg Asp Leu 420 425 430Leu Tyr His Leu His Gly Gly Asp Ser His Ser Val Leu Tyr Thr Leu 435 440 445His His Leu Thr Asn Leu Pro Ala Leu Arg Glu Glu Asp Val Leu Lys 450 455 460Leu Leu Gln Lys Val Pro Ala Lys Asp Pro Gln Gln Glu Pro Asp Ala465 470 475 480Val Asp Ala Pro Val Pro Glu His Leu Ser Gln Cys Gln Asn Leu Thr 485 490 495Leu Tyr Gln Gly Phe Cys Ala Met Lys Tyr Ala Ile Tyr Ala Leu Cys 500 505 510Val Asn Ser His Gln His Ser Gln Cys Gln Asp Cys Lys Asp Ser Leu 515 520 525Ser Glu Asp Leu Ala Ser Ala Thr Glu Pro Ala Asn Asp Ser Leu Ser 530 535 540Ser Pro Gly Ala Ala Asn Leu Phe Ser Thr Tyr Leu Ala Arg Cys Gln545 550 555 560Gln Tyr Leu Cys Ser Ile Pro Asp Ser Leu Cys Leu Glu Leu Leu Glu 565 570 575Asn Ile Phe Ser Leu Leu Leu Ile Thr Ser Ala Asp Leu His Pro Glu 580 585 590Pro His Leu Pro Glu Asp Tyr Ala Glu Asp Asp Asp Ile Glu Gly Lys 595 600 605Ser Pro Ser Gly Leu Arg Ser Pro Ser Glu Ser Pro Gln His Ile Ala 610 615 620His Pro Glu Arg Lys Ser Glu Arg Gly Ser Leu Gly Val Pro Lys Thr625 630 635 640Leu Ala Tyr Thr Met Pro Ser His Val Lys Ala Glu Pro Lys Asp Ser 645 650 655Tyr Pro Gly Pro His Arg His Ser Phe Leu Asp Leu Lys His Phe Thr 660 665 670Ser Gly Ile Ser Gly Phe Leu Ala Asp Glu Phe Ala Ile Gly Ala Phe 675 680 685Leu Arg Leu Leu Gln Glu Gln Leu Asp Glu Ile Ser Ser Arg Ser Pro 690 695 700Pro Glu Lys Pro Lys Gln Glu Ser Gln Ser Cys Ser Gly Ser Arg Asp705 710 715 720Gly Leu Gln Ser Arg Leu His Arg Leu Ser Lys Val Val Ser Glu Ala 725 730 735Gln Trp Arg His Lys Val Val Thr Ser Asn His Arg Ser Glu Glu Gln 740 745 750Pro Ser Arg Arg Tyr Gln Pro Ala Thr Arg His Pro Ser Leu Arg Arg 755 760 765Gly Arg Arg Thr Arg Arg Ser Gln Ala Asp Gly Arg Asp Arg Gly Ser 770 775 780Asn Pro Ser Leu Glu Ser Thr Ser Ser Glu Leu Ser Thr Ser Thr Ser785 790 795 800Glu Gly Ser Leu Ser Ala Met Ser Gly Arg Asn Glu Leu His Ser Arg 805 810 815Leu His Pro His Pro Gln Ser Ser Leu Ile Pro Met Met Phe Ser Pro 820 825 830Pro Glu Ser Leu Leu Ala Ser Cys Ile Leu Arg Gly Asn Phe Ala Glu 835 840 845Ala His Gln Val Leu Phe Thr Phe Asn Leu Lys Ser Ser Pro Ser Ser 850 855 860Gly Glu Leu Met Phe Met Glu Arg Tyr Gln Glu Val Ile Gln Glu Leu865 870 875 880Ala Gln Val Glu His Lys Ile Glu Asn Gln Asn Ser Asp Ala Gly Ser 885 890 895Ser Thr Ile Arg Arg Thr Gly Ser Gly Arg Ser Thr Leu Gln Ala Ile 900 905 910Gly Ser Ala Ala Ala Ala Gly Met Val Phe Tyr Ser Ile Ser Asp Val 915 920 925Thr Asp Lys Leu Leu Asn Thr Ser Gly Asp Pro Ile Pro Met Leu Gln 930 935 940Glu Asp Phe Trp Ile Ser Thr Ala Leu Val Glu Pro Thr Ala Pro Leu945 950 955 960Arg Glu Val Leu Glu Asp Leu Ser Pro Pro Ala Met Ala Ala Phe Asp 965 970 975Leu Ala Cys Ser Gln Cys Gln Leu Trp Lys Thr Cys Lys Gln Leu Leu 980 985 990Glu Thr Ala Glu Arg Arg Leu Asn Ser Ser Leu Glu Arg Arg Gly Arg 995 1000 1005Arg Ile Asp His Val Leu Leu Asn Ala Asp Gly Ile Arg Gly Phe 1010 1015 1020Pro Val Val Leu Gln Gln Ile Ser Lys Ser Leu Asn Tyr Leu Leu 1025 1030 1035Met Ser Ala Ser Gln Thr Lys Ser Glu Ser Val Glu Glu Lys Gly 1040 1045 1050Gly Gly Pro Pro Arg Cys Ser Ile Thr Glu Leu Leu Gln Met Cys 1055 1060 1065Trp Pro Ser Leu Ser Glu Asp Cys Val Ala Ser His Thr Thr Leu 1070 1075 1080Ser Gln Gln Leu Asp Gln Val Leu Gln Ser Leu Arg Glu Ala Leu 1085 1090 1095Glu Leu Pro Glu Pro Arg Thr Pro Pro Leu Ser Ser Leu Val Glu 1100 1105 1110Gln Ala Ala Gln Lys Ala Pro Glu Ala Glu Ala His Pro Val Gln 1115 1120 1125Ile Gln Thr Gln Leu Leu Gln Lys Asn Leu Gly Lys Gln Thr Pro 1130 1135 1140Ser Gly Ser Arg Gln Met Asp Tyr Leu Gly Thr Phe Phe Ser Tyr 1145 1150 1155Cys Ser Thr Leu Ala Ala Val Leu Leu Gln Ser Leu Ser Ser Glu 1160 1165 1170Pro Asp His Val Glu Val Lys Val Gly Asn Pro Phe Val Leu Leu 1175 1180 1185Gln Gln Ser Ser Ser Gln Leu Val Ser His Leu Leu Phe Glu Arg 1190 1195 1200Gln Val Pro Pro Glu Arg Leu Ala Ala Leu Leu Ala Gln Glu Asn 1205 1210 1215Leu Ser Leu Ser Val Pro Gln Val Ile Val Ser Cys Cys Cys Glu 1220 1225 1230Pro Leu Ala Leu Cys Ser Ser Arg Gln Ser Gln Gln Thr Ser Ser 1235 1240 1245Leu Leu Thr Arg Leu Gly Thr Leu Ala Gln Leu His Ala Ser His 1250 1255 1260Cys Leu Asp Asp Leu Pro Leu Ser Thr Pro Ser Ser Pro Arg Thr 1265 1270 1275Thr Glu Asn Pro Thr Leu Glu Arg Lys Pro Tyr Ser Ser Pro Arg 1280 1285 1290Asp Ser Ser Leu Pro Ala Leu Thr Ser Ser Ala Leu Ala Phe Leu 1295 1300 1305Lys Ser Arg Ser Lys Leu Leu Ala Thr Val Ala Cys Leu Gly Ala 1310 1315 1320Ser Pro Arg Leu Lys Val Ser Lys Pro Ser Leu Ser Trp Lys Glu 1325 1330 1335Leu Arg Gly Arg Arg Glu Val Pro Leu Ala Ala Glu Gln Val Ala 1340 1345 1350Arg Glu Cys Glu Arg Leu Leu Glu Gln Phe Pro Leu Phe Glu Ala 1355 1360 1365Phe Leu Leu Ala Ala Trp Glu Pro Leu Arg Gly Ser Leu Gln Gln 1370 1375 1380Gly Gln Ser Leu Ala Val Asn Leu Cys Gly Trp Ala Ser Leu Ser 1385 1390 1395Thr Val Leu Leu Gly Leu His Ser Pro Ile Ala Leu Asp Val Leu 1400 1405 1410Ser Glu Ala Phe Glu Glu Ser Leu Val Ala Arg Asp Trp Ser Arg 1415 1420 1425Ala Leu Gln Leu Thr Glu Val Tyr Gly Arg Asp Val Asp Asp Leu 1430 1435 1440Ser Ser Ile Lys Asp Ala Val Leu Ser Cys Ala Val Ala Cys Asp 1445 1450 1455Lys Glu Gly Trp Gln Tyr Leu Phe Pro Val Lys Asp Ala Ser Leu 1460 1465 1470Arg Ser Arg Leu Ala Leu Gln Phe Val Asp Arg Trp Pro Leu Glu 1475 1480 1485Ser Cys Leu Glu Ile Leu Ala Tyr Cys Ile Ser Asp Thr Ala Val 1490 1495 1500Gln Glu Gly Leu Lys Cys Glu Leu Gln Arg Lys Leu Ala Glu Leu 1505 1510 1515Gln Val Tyr Gln Lys Ile Leu Gly Leu Gln Ser Pro Pro Val Trp 1520 1525 1530Cys Asp Trp Gln Thr Leu Arg Ser Cys Cys Val Glu Asp Pro Ser 1535 1540 1545Thr Val Met Asn Met Ile Leu Glu Ala Gln Glu Tyr Glu Leu Cys 1550 1555 1560Glu Glu Trp Gly Cys Leu Tyr Pro Ile Pro Arg Glu His Leu Ile 1565 1570 1575Ser Leu His Gln Lys His Leu Leu His Leu Leu Glu Arg Arg Asp 1580 1585 1590His Asp Lys Ala Leu Gln Leu Leu Arg Arg Ile Pro Asp Pro Thr 1595 1600 1605Met Cys Leu Glu Val Thr Glu Gln Ser Leu Asp Gln His Thr Ser 1610 1615 1620Leu Ala Thr Ser His Phe Leu Ala Asn Tyr Leu Thr Thr His Phe 1625 1630 1635Tyr Gly Gln Leu Thr Ala Val Arg His Arg Glu Ile Gln Ala Leu 1640 1645 1650Tyr Val Gly Ser Lys Ile Leu Leu Thr Leu Pro Glu Gln His Arg 1655 1660 1665Ala Ser Tyr Ser His Leu Ser Ser Asn Pro Leu Phe Met Leu Glu 1670 1675 1680Gln Leu Leu Met Asn Met Lys Val Asp Trp Ala Thr Val Ala Val 1685 1690 1695Gln Thr Leu Gln Gln Leu Leu Val Gly Gln Glu Ile Gly Phe Thr 1700 1705 1710Met Asp Glu Val Asp Ser Leu Leu Ser Arg Tyr Ala Glu Lys Ala 1715 1720 1725Leu Asp Phe Pro Tyr Pro Gln Arg Glu Lys Arg Ser Asp Ser Val 1730 1735 1740Ile His Leu Gln Glu Ile Val His Gln Ala Ala Asp Pro Glu Thr 1745 1750 1755Leu Pro Arg Ser Pro Ser Ala Glu Phe Ser Pro Ala Ala Pro Pro 1760 1765 1770Gly Ile Ser Ser Ile His Ser Pro Ser Leu Arg Glu Arg Ser Phe 1775 1780 1785Pro Pro Thr Gln Pro Ser Gln Glu Phe Val Pro Pro Ala Thr Pro 1790 1795 1800Pro Ala Arg His Gln Trp Val Pro Asp Glu Thr Glu Ser Ile Cys 1805 1810 1815Met Val Cys Cys Arg Glu His Phe Thr Met Phe Asn Arg Arg His 1820 1825 1830His Cys Arg Arg Cys Gly Arg Leu Val Cys Ser Ser Cys Ser Thr 1835 1840 1845Lys Lys Met Val Val Glu Gly Cys Arg Glu Asn Pro Ala Arg Val 1850 1855 1860Cys Asp Gln Cys Tyr Ser Tyr Cys Asn Lys Asp Val Pro Glu Glu 1865 1870 1875Pro Ser Glu Lys Pro Glu Ala Leu Asp Ser Ser Lys Asn Glu Ser 1880 1885 1890Pro Pro Tyr Ser Phe Val Val Arg Val Pro Lys Ala Asp Glu Val 1895 1900 1905Glu Trp Ile Leu Asp Leu Lys Glu Glu Glu Asn Glu Leu Val Arg 1910 1915 1920Ser Glu Phe Tyr Tyr Glu Gln Ala Pro Ser Ala Ser Leu Cys Ile 1925 1930 1935Ala Ile Leu Asn Leu His Arg Asp Ser Ile Ala Cys Gly His Gln 1940 1945 1950Leu Ile Glu His Cys Cys Arg Leu Ser Lys Gly Leu Thr Asn Pro 1955 1960 1965Glu Val Asp Ala Gly Leu Leu Thr Asp Ile Met Lys Gln Leu Leu 1970 1975 1980Phe Ser Ala Lys Met Met Phe Val Lys Ala Gly Gln Ser Gln Asp 1985 1990 1995Leu Ala Leu Cys Asp Thr Tyr Ile Ser Lys Val Asp Val Leu Asn 2000 2005 2010Ile Leu Val Ala Ala Ala Tyr Arg His Val Pro Ser Leu Asp Gln 2015 2020 2025Ile Leu Gln Pro Ala Ala Val Thr Arg Leu Arg Asn Gln Leu Leu 2030 2035 2040Glu Ala Glu Tyr Tyr Gln Leu Gly Val Glu Val Ser Thr Lys Thr 2045 2050 2055Gly Leu Asp Thr Thr Gly Ala Trp His Ala Trp Gly Met Ala Cys 2060 2065 2070Leu Lys Ala Gly Asn Leu Thr Ala Ala Arg Glu Lys Phe Ser Arg 2075 2080 2085Cys Leu Lys Pro Pro Phe Asp Leu Asn Gln Leu Asn His Gly Ser 2090 2095 2100Arg Leu Val Gln Asp Val Val Glu Tyr Leu Glu Ser Thr Val Arg 2105 2110 2115Pro Phe Val Ser Leu Gln Asp Asp Asp Tyr Phe Ala Thr Leu Arg 2120 2125 2130Glu Leu Glu Ala Thr Leu Arg Thr Gln Ser Leu Ser Leu Ala Val 2135 2140 2145Ile Pro Glu Gly Lys Ile Met Asn Asn Thr Tyr Tyr Gln Glu Cys 2150 2155 2160Leu Phe Tyr Leu His Asn Tyr Ser Thr Asn Leu Ala Ile Ile Ser 2165 2170 2175Phe Tyr Val Arg His Ser Cys Leu Arg Glu Ala Leu Leu His Leu 2180 2185 2190Leu Asn Lys Glu Ser Pro Pro Glu Val Phe Ile Glu Gly Ile Phe 2195 2200 2205Gln Pro Ser Tyr Lys Ser Gly Lys Leu His Thr Leu Glu Asn Leu 2210 2215 2220Leu Glu Ser Ile Asp Pro Thr Leu Glu Ser Trp Gly Lys Tyr Leu 2225 2230 2235Ile Ala Ala Cys Gln His Leu Gln Lys Lys Asn Tyr Tyr His Ile 2240 2245 2250Leu Tyr Glu Leu Gln Gln Phe Met Lys Asp Gln Val Arg Ala Ala 2255 2260 2265Met Thr Cys Ile Arg Phe Phe Ser His Lys Ala Lys Ser Tyr Thr 2270 2275 2280Glu Leu Gly Glu Lys Leu Ser Trp Leu Leu Lys Ala Lys Asp His 2285 2290 2295Leu Lys Ile Tyr Leu Gln Glu Thr Ser Arg Ser Ser Gly Arg Lys 2300 2305 2310Lys Thr Thr Phe Phe Arg Lys Lys Met Thr Ala Ala Asp Val Ser 2315 2320 2325Arg His Met Asn Thr Leu Gln Leu Gln Met Glu Val Thr Arg Phe 2330 2335 2340Leu His Arg Cys Glu Ser Ala Gly Thr Ser Gln Ile Thr Thr Leu 2345 2350 2355Pro Leu Pro Thr Leu Phe Gly Asn Asn His Met Lys Met Asp Val 2360 2365

2370Ala Cys Lys Val Met Leu Gly Gly Lys Asn Val Glu Asp Gly Phe 2375 2380 2385Gly Ile Ala Phe Arg Val Leu Gln Asp Phe Gln Leu Asp Ala Ala 2390 2395 2400Met Thr Tyr Cys Arg Ala Ala Arg Gln Leu Val Glu Lys Glu Lys 2405 2410 2415Tyr Ser Glu Ile Gln Gln Leu Leu Lys Cys Val Ser Glu Ser Gly 2420 2425 2430Met Ala Ala Lys Ser Asp Gly Asp Thr Ile Leu Leu Asn Cys Leu 2435 2440 2445Glu Ala Phe Lys Arg Ile Pro Pro Gln Glu Leu Glu Gly Leu Ile 2450 2455 2460Gln Ala Ile His Asn Asp Asp Asn Lys Val Arg Ala Tyr Leu Ile 2465 2470 2475Cys Cys Lys Leu Arg Ser Ala Tyr Leu Ile Ala Val Lys Gln Glu 2480 2485 2490His Ser Arg Ala Thr Ala Leu Val Gln Gln Val Gln Gln Ala Ala 2495 2500 2505Lys Ser Ser Gly Asp Ala Val Val Gln Asp Ile Cys Ala Gln Trp 2510 2515 2520Leu Leu Thr Ser His Pro Arg Gly Ala His Gly Pro Gly Ser Arg 2525 2530 2535Lys1162110PRTHomo sapiens 116Met Asn His Pro Phe Gly Lys Glu Glu Ala Ala Ser Gln Lys Gln Leu1 5 10 15Phe Gly Phe Phe Cys Glu Cys Leu Arg Arg Gly Glu Trp Glu Leu Ala 20 25 30Gln Ala Cys Val Pro Gln Leu Gln Glu Gly Gln Gly Asp Ile Pro Lys 35 40 45Arg Val Glu Asp Ile Leu Gln Ala Leu Val Val Cys Pro Asn Leu Leu 50 55 60Arg Cys Gly Gln Asp Ile Asn Pro Gln Arg Val Ala Trp Val Trp Leu65 70 75 80Leu Val Leu Glu Lys Trp Leu Ala Arg Glu Lys Lys Leu Leu Pro Val 85 90 95Val Phe Arg Arg Lys Leu Glu Phe Leu Leu Leu Ser Glu Asp Leu Gln 100 105 110Gly Asp Ile Pro Glu Asn Ile Leu Glu Glu Leu Tyr Glu Thr Leu Thr 115 120 125Gln Gly Ala Val Gly His Val Pro Asp Gly Asn Pro Arg Arg Glu Ser 130 135 140Trp Thr Pro Arg Leu Ser Ser Glu Ala Val Ser Val Leu Trp Asp Leu145 150 155 160Leu Arg Gln Ser Pro Gln Pro Ala Gln Ala Leu Leu Glu Leu Leu Leu 165 170 175Glu Glu Asp Asp Gly Thr Gly Leu Cys His Trp Pro Leu Gln Asn Ala 180 185 190Leu Val Asp Leu Ile Arg Lys Ala Leu Arg Ala Leu Gln Gly Pro Asp 195 200 205Ser Val Pro Pro Gly Val Val Asp Ala Ile Tyr Gly Ala Leu Arg Thr 210 215 220Leu Arg Cys Pro Ala Glu Pro Leu Gly Val Glu Leu His Leu Leu Cys225 230 235 240Glu Glu Leu Leu Glu Ala Cys Arg Thr Glu Gly Ser Pro Leu Arg Glu 245 250 255Glu Arg Leu Leu Ser Cys Leu Leu His Lys Ala Ser Arg Gly Leu Leu 260 265 270Ser Leu Tyr Gly His Thr Tyr Ala Glu Lys Val Thr Glu Lys Pro Pro 275 280 285Arg Ala Thr Ala Ser Gly Lys Val Ser Pro Asp His Leu Asp Pro Glu 290 295 300Arg Ala Met Leu Ala Leu Phe Ser Asn Pro Asn Pro Ala Glu Ala Trp305 310 315 320Lys Val Ala Tyr Phe Tyr Cys Leu Ser Asn Asn Lys His Phe Leu Glu 325 330 335Gln Ile Leu Val Thr Ala Leu Thr Leu Leu Lys Glu Glu Asp Phe Pro 340 345 350Asn Leu Gly Cys Leu Leu Asp Arg Glu Phe Arg Pro Leu Ser Cys Leu 355 360 365Leu Val Leu Leu Gly Trp Thr His Cys Gln Ser Leu Glu Ser Ala Lys 370 375 380Arg Leu Leu Gln Thr Leu His Arg Thr Gln Gly Pro Gly Cys Asp Glu385 390 395 400Leu Leu Arg Asp Ala Cys Asp Gly Leu Trp Ala His Leu Glu Val Leu 405 410 415Glu Trp Cys Ile Gln Gln Ser Ser Asn Pro Ile Pro Lys Arg Asp Leu 420 425 430Leu Tyr His Leu His Gly Gly Asp Ser His Ser Val Leu Tyr Thr Leu 435 440 445His His Leu Thr Asn Leu Pro Ala Leu Arg Glu Glu Asp Val Leu Lys 450 455 460Leu Leu Gln Lys Val Pro Ala Lys Asp Pro Gln Gln Glu Pro Asp Ala465 470 475 480Val Asp Ala Pro Val Pro Glu His Leu Ser Gln Cys Gln Asn Leu Thr 485 490 495Leu Tyr Gln Gly Phe Cys Ala Met Lys Tyr Ala Ile Tyr Ala Leu Cys 500 505 510Val Asn Ser His Gln His Ser Gln Cys Gln Asp Cys Lys Asp Ser Leu 515 520 525Ser Glu Asp Leu Ala Ser Ala Thr Glu Pro Ala Asn Asp Ser Leu Ser 530 535 540Ser Pro Gly Ala Ala Asn Leu Phe Ser Thr Tyr Leu Ala Arg Cys Gln545 550 555 560Gln Tyr Leu Cys Ser Ile Pro Asp Ser Leu Cys Leu Glu Leu Leu Glu 565 570 575Asn Ile Phe Ser Leu Leu Leu Ile Thr Ser Ala Asp Leu His Pro Glu 580 585 590Pro His Leu Pro Glu Asp Tyr Ala Glu Asp Asp Asp Ile Glu Gly Lys 595 600 605Ser Pro Ser Gly Leu Arg Ser Pro Ser Glu Ser Pro Gln His Ile Ala 610 615 620His Pro Glu Arg Lys Ser Glu Arg Gly Ser Leu Gly Val Pro Lys Thr625 630 635 640Leu Ala Tyr Thr Met Pro Ser His Val Lys Ala Glu Pro Lys Asp Ser 645 650 655Tyr Pro Gly Pro His Arg His Ser Phe Leu Asp Leu Lys His Phe Thr 660 665 670Ser Gly Ile Ser Gly Phe Leu Ala Asp Glu Phe Ala Ile Gly Ala Phe 675 680 685Leu Arg Leu Leu Gln Glu Gln Leu Asp Glu Ile Ser Ser Arg Ser Pro 690 695 700Pro Glu Lys Pro Lys Gln Glu Ser Gln Ser Cys Ser Gly Ser Arg Asp705 710 715 720Gly Leu Gln Ser Arg Leu His Arg Leu Ser Lys Val Val Ser Glu Ala 725 730 735Gln Trp Arg His Lys Val Val Thr Ser Asn His Arg Ser Glu Glu Gln 740 745 750Pro Ser Arg Arg Tyr Gln Pro Ala Thr Arg His Pro Ser Leu Arg Arg 755 760 765Gly Arg Arg Thr Arg Arg Ser Gln Ala Asp Gly Arg Asp Arg Gly Ser 770 775 780Asn Pro Ser Leu Glu Ser Thr Ser Ser Glu Leu Ser Thr Ser Thr Ser785 790 795 800Glu Gly Ser Leu Ser Ala Met Ser Gly Arg Asn Glu Leu His Ser Arg 805 810 815Leu His Pro His Pro Gln Ser Ser Leu Ile Pro Met Met Phe Ser Pro 820 825 830Pro Glu Ser Leu Leu Ala Ser Cys Ile Leu Arg Gly Asn Phe Ala Glu 835 840 845Ala His Gln Val Leu Phe Thr Phe Asn Leu Lys Ser Ser Pro Ser Ser 850 855 860Gly Glu Leu Met Phe Met Glu Arg Tyr Gln Glu Val Ile Gln Glu Leu865 870 875 880Ala Gln Val Glu His Lys Ile Glu Asn Gln Asn Ser Asp Ala Gly Ser 885 890 895Ser Thr Ile Arg Arg Thr Gly Ser Gly Arg Ser Thr Leu Gln Ala Ile 900 905 910Gly Ser Ala Ala Ala Ala Gly Met Val Phe Tyr Ser Ile Ser Asp Val 915 920 925Thr Asp Lys Leu Leu Asn Thr Ser Gly Asp Pro Ile Pro Met Leu Gln 930 935 940Glu Asp Phe Trp Ile Ser Thr Ala Leu Val Glu Pro Thr Ala Pro Leu945 950 955 960Arg Glu Val Leu Glu Asp Leu Ser Pro Pro Ala Met Ala Ala Phe Asp 965 970 975Leu Ala Cys Ser Gln Cys Gln Leu Trp Lys Thr Cys Lys Gln Leu Leu 980 985 990Glu Thr Ala Glu Arg Arg Leu Asn Ser Ser Leu Glu Arg Arg Gly Arg 995 1000 1005Arg Ile Asp His Val Leu Leu Asn Ala Asp Gly Ile Arg Gly Phe 1010 1015 1020Pro Val Val Leu Gln Gln Ile Ser Lys Ser Leu Asn Tyr Leu Leu 1025 1030 1035Met Ser Ala Ser Gln Thr Lys Ser Glu Ser Val Glu Glu Lys Gly 1040 1045 1050Gly Gly Pro Pro Arg Cys Ser Ile Thr Glu Leu Leu Gln Met Cys 1055 1060 1065Trp Pro Ser Leu Ser Glu Asp Cys Val Ala Ser His Thr Thr Leu 1070 1075 1080Ser Gln Gln Leu Asp Gln Val Leu Gln Ser Leu Arg Glu Ala Leu 1085 1090 1095Glu Leu Pro Glu Pro Arg Thr Pro Pro Leu Ser Ser Leu Val Glu 1100 1105 1110Gln Ala Ala Gln Lys Ala Pro Glu Ala Glu Ala His Pro Val Gln 1115 1120 1125Ile Gln Thr Gln Leu Leu Gln Lys Asn Leu Gly Lys Gln Thr Pro 1130 1135 1140Ser Gly Ser Arg Gln Met Asp Tyr Leu Gly Thr Phe Phe Ser Tyr 1145 1150 1155Cys Ser Thr Leu Ala Ala Val Leu Leu Gln Ser Leu Ser Ser Glu 1160 1165 1170Pro Asp His Val Glu Val Lys Val Gly Asn Pro Phe Val Leu Leu 1175 1180 1185Gln Gln Ser Ser Ser Gln Leu Val Ser His Leu Leu Phe Glu Arg 1190 1195 1200Gln Val Pro Pro Glu Arg Leu Ala Ala Leu Leu Ala Gln Glu Asn 1205 1210 1215Leu Ser Leu Ser Val Pro Gln Val Ile Val Ser Cys Cys Cys Glu 1220 1225 1230Pro Leu Ala Leu Cys Ser Ser Arg Gln Ser Gln Gln Thr Ser Ser 1235 1240 1245Leu Leu Thr Arg Leu Gly Thr Leu Ala Gln Leu His Ala Ser His 1250 1255 1260Cys Leu Asp Asp Leu Pro Leu Ser Thr Pro Ser Ser Pro Arg Thr 1265 1270 1275Thr Glu Asn Pro Thr Leu Glu Arg Lys Pro Tyr Ser Ser Pro Arg 1280 1285 1290Asp Ser Ser Leu Pro Ala Leu Thr Ser Ser Ala Leu Ala Phe Leu 1295 1300 1305Lys Ser Arg Ser Lys Leu Leu Ala Thr Val Ala Cys Leu Gly Ala 1310 1315 1320Ser Pro Arg Leu Lys Val Ser Lys Pro Ser Leu Ser Trp Lys Glu 1325 1330 1335Leu Arg Gly Arg Arg Glu Val Pro Leu Ala Ala Glu Gln Val Ala 1340 1345 1350Arg Glu Cys Glu Arg Leu Leu Glu Gln Phe Pro Leu Phe Glu Ala 1355 1360 1365Phe Leu Leu Ala Ala Trp Glu Pro Leu Arg Gly Ser Leu Gln Gln 1370 1375 1380Gly Gln Ser Leu Ala Val Asn Leu Cys Gly Trp Ala Ser Leu Ser 1385 1390 1395Thr Val Leu Leu Gly Leu His Ser Pro Ile Ala Leu Asp Val Leu 1400 1405 1410Ser Glu Ala Phe Glu Glu Ser Leu Val Ala Arg Asp Trp Ser Arg 1415 1420 1425Ala Leu Gln Leu Thr Glu Val Tyr Gly Arg Asp Val Asp Asp Leu 1430 1435 1440Ser Ser Ile Lys Asp Ala Val Leu Ser Cys Ala Val Ala Cys Asp 1445 1450 1455Lys Glu Gly Trp Gln Tyr Leu Phe Pro Val Lys Asp Ala Ser Leu 1460 1465 1470Arg Ser Arg Leu Ala Leu Gln Phe Val Asp Arg Trp Pro Leu Glu 1475 1480 1485Ser Cys Leu Glu Ile Leu Ala Tyr Cys Ile Ser Asp Thr Ala Val 1490 1495 1500Gln Glu Gly Leu Lys Cys Glu Leu Gln Arg Lys Leu Ala Glu Leu 1505 1510 1515Gln Val Tyr Gln Lys Ile Leu Gly Leu Gln Ser Pro Pro Val Trp 1520 1525 1530Cys Asp Trp Gln Thr Leu Arg Ser Cys Cys Val Glu Asp Pro Ser 1535 1540 1545Thr Val Met Asn Met Ile Leu Glu Ala Gln Glu Tyr Glu Leu Cys 1550 1555 1560Glu Glu Trp Gly Cys Leu Tyr Pro Ile Pro Arg Glu His Leu Ile 1565 1570 1575Ser Leu His Gln Lys His Leu Leu His Leu Leu Glu Arg Arg Asp 1580 1585 1590His Asp Lys Ala Leu Gln Leu Leu Arg Arg Ile Pro Asp Pro Thr 1595 1600 1605Met Cys Leu Glu Val Thr Glu Gln Ser Leu Asp Gln His Thr Ser 1610 1615 1620Leu Ala Thr Ser His Phe Leu Ala Asn Tyr Leu Thr Thr His Phe 1625 1630 1635Tyr Gly Gln Leu Thr Ala Val Arg His Arg Glu Ile Gln Ala Leu 1640 1645 1650Tyr Val Gly Ser Lys Ile Leu Leu Thr Leu Pro Glu Gln His Arg 1655 1660 1665Ala Ser Tyr Ser His Leu Ser Ser Asn Pro Leu Phe Met Leu Glu 1670 1675 1680Gln Leu Leu Met Asn Met Lys Val Asp Trp Ala Thr Val Ala Val 1685 1690 1695Gln Thr Leu Gln Gln Leu Leu Val Gly Gln Glu Ile Gly Phe Thr 1700 1705 1710Met Asp Glu Val Asp Ser Leu Leu Ser Arg Tyr Ala Glu Lys Ala 1715 1720 1725Leu Asp Phe Pro Tyr Pro Gln Arg Glu Lys Arg Ser Asp Ser Val 1730 1735 1740Ile His Leu Gln Glu Ile Val His Gln Ala Ala Asp Pro Glu Thr 1745 1750 1755Leu Pro Arg Ser Pro Ser Ala Glu Phe Ser Pro Ala Ala Pro Pro 1760 1765 1770Gly Ile Ser Ser Ile His Ser Pro Ser Leu Arg Glu Arg Ser Phe 1775 1780 1785Pro Pro Thr Gln Pro Ser Gln Glu Phe Val Pro Pro Ala Thr Pro 1790 1795 1800Pro Ala Arg His Gln Trp Val Pro Asp Glu Thr Glu Ser Ile Cys 1805 1810 1815Met Val Cys Cys Arg Glu His Phe Thr Met Phe Asn Arg Arg His 1820 1825 1830His Cys Arg Arg Cys Gly Arg Leu Val Cys Ser Ser Cys Ser Thr 1835 1840 1845Lys Lys Met Val Val Glu Gly Cys Arg Glu Asn Pro Ala Arg Val 1850 1855 1860Cys Asp Gln Cys Tyr Ser Tyr Cys Asn Lys Asp Val Pro Glu Glu 1865 1870 1875Pro Ser Glu Lys Pro Glu Ala Leu Asp Ser Ser Lys Asn Glu Ser 1880 1885 1890Pro Pro Tyr Ser Phe Val Val Arg Val Pro Lys Ala Asp Glu Val 1895 1900 1905Glu Trp Ile Leu Asp Leu Lys Glu Glu Glu Asn Glu Leu Val Arg 1910 1915 1920Ser Glu Phe Tyr Tyr Glu Gln Ala Pro Ser Ala Ser Leu Cys Ile 1925 1930 1935Ala Ile Leu Asn Leu His Arg Asp Ser Ile Ala Cys Gly His Gln 1940 1945 1950Leu Ile Glu His Cys Cys Arg Leu Ser Lys Gly Leu Thr Asn Pro 1955 1960 1965Glu Val Asp Ala Gly Leu Leu Thr Asp Ile Met Lys Gln Leu Leu 1970 1975 1980Phe Ser Ala Lys Met Met Phe Val Lys Ala Gly Gln Ser Gln Asp 1985 1990 1995Leu Ala Leu Cys Asp Ser Tyr Ile Ser Lys Val Asp Val Leu Asn 2000 2005 2010Ile Leu Val Ala Ala Ala Tyr Arg His Val Pro Ser Leu Asp Gln 2015 2020 2025Ile Leu Gln Pro Ala Ala Val Thr Arg Leu Arg Asn Gln Leu Leu 2030 2035 2040Glu Ala Glu Tyr Tyr Gln Leu Gly Val Glu Val Ser Thr Lys Thr 2045 2050 2055Gly Leu Asp Thr Thr Gly Ala Trp His Ala Trp Gly Met Ala Cys 2060 2065 2070Leu Lys Ala Gly Asn Leu Thr Ala Ala Arg Glu Lys Phe Ser Arg 2075 2080 2085Cys Leu Lys Pro Pro Phe Asp Leu Asn Gln Leu Glu Ser Trp Leu 2090 2095 2100Lys Ala Gly Ala Gly Cys Gly 2105 21101172237PRTHomo sapiens 117Met Asn His Pro Phe Gly Lys Glu Glu Ala Ala Ser Gln Lys Gln Leu1 5 10 15Phe Gly Phe Phe Cys Glu Cys Leu Arg Arg Gly Glu Trp Glu Leu Ala 20 25 30Gln Ala Cys Val Pro Gln Leu Gln Glu Gly Gln Gly Asp Ile Pro Lys 35 40 45Arg Val Glu Asp Ile Leu Gln Ala Leu Val Val Cys Pro Asn Leu Leu 50 55 60Arg Cys Gly Gln Asp Ile Asn Pro Gln Arg Val Ala Trp Val Trp Leu65 70 75 80Leu Val Leu Glu Lys Trp Leu Ala Arg Glu Lys Lys Leu Leu Pro Val 85 90 95Val Phe Arg Arg Lys Leu Glu Phe Leu Leu Leu Ser Glu Asp Leu Gln 100 105 110Gly Asp Ile Pro Glu Asn Ile Leu Glu Glu Leu Tyr Glu Thr Leu Thr 115 120 125Gln Gly Ala Val Gly His Val Pro Asp Gly Asn Pro Arg Arg Glu Ser 130 135 140Trp Thr Pro Arg Leu Ser Ser Glu Ala Val Ser Val Leu Trp Asp Leu145 150 155 160Leu Arg Gln Ser Pro Gln Pro Ala Gln Ala Leu Leu Glu Leu Leu Leu

165 170 175Glu Glu Asp Asp Gly Thr Gly Leu Cys His Trp Pro Leu Gln Asn Ala 180 185 190Leu Val Asp Leu Ile Arg Lys Ala Leu Arg Ala Leu Gln Gly Pro Asp 195 200 205Ser Val Pro Pro Gly Val Val Asp Ala Ile Tyr Gly Ala Leu Arg Thr 210 215 220Leu Arg Cys Pro Ala Glu Pro Leu Gly Val Glu Leu His Leu Leu Cys225 230 235 240Glu Glu Leu Leu Glu Ala Cys Arg Thr Glu Gly Ser Pro Leu Arg Glu 245 250 255Glu Arg Leu Leu Ser Cys Leu Leu His Lys Ala Ser Arg Gly Leu Leu 260 265 270Ser Leu Tyr Gly His Thr Tyr Ala Glu Lys Val Thr Glu Lys Pro Pro 275 280 285Arg Ala Thr Ala Ser Gly Lys Val Ser Pro Asp His Leu Asp Pro Glu 290 295 300Arg Ala Met Leu Ala Leu Phe Ser Asn Pro Asn Pro Ala Glu Ala Trp305 310 315 320Lys Val Ala Tyr Phe Tyr Cys Leu Ser Asn Asn Lys His Phe Leu Glu 325 330 335Gln Ile Leu Val Thr Ala Leu Thr Leu Leu Lys Glu Glu Asp Phe Pro 340 345 350Asn Leu Gly Cys Leu Leu Asp Arg Glu Phe Arg Pro Leu Ser Cys Leu 355 360 365Leu Val Leu Leu Gly Trp Thr His Cys Gln Ser Leu Glu Ser Ala Lys 370 375 380Arg Leu Leu Gln Thr Leu His Arg Thr Gln Gly Pro Gly Cys Asp Glu385 390 395 400Leu Leu Arg Asp Ala Cys Asp Gly Leu Trp Ala His Leu Glu Val Leu 405 410 415Glu Trp Cys Ile Gln Gln Ser Ser Asn Pro Ile Pro Lys Arg Asp Leu 420 425 430Leu Tyr His Leu His Gly Gly Asp Ser His Ser Val Leu Tyr Thr Leu 435 440 445His His Leu Thr Asn Leu Pro Ala Leu Arg Glu Glu Asp Val Leu Lys 450 455 460Leu Leu Gln Lys Val Pro Ala Lys Asp Pro Gln Gln Glu Pro Asp Ala465 470 475 480Val Asp Ala Pro Val Pro Glu His Leu Ser Gln Cys Gln Asn Leu Thr 485 490 495Leu Tyr Gln Gly Phe Cys Ala Met Lys Tyr Ala Ile Tyr Ala Leu Cys 500 505 510Val Asn Ser His Gln His Ser Gln Cys Gln Asp Cys Lys Asp Ser Leu 515 520 525Ser Glu Asp Leu Ala Ser Ala Thr Glu Pro Ala Asn Asp Ser Leu Ser 530 535 540Ser Pro Gly Ala Ala Asn Leu Phe Ser Thr Tyr Leu Ala Arg Cys Gln545 550 555 560Gln Tyr Leu Cys Ser Ile Pro Asp Ser Leu Cys Leu Glu Leu Leu Glu 565 570 575Asn Ile Phe Ser Leu Leu Leu Ile Thr Ser Ala Asp Leu His Pro Glu 580 585 590Pro His Leu Pro Glu Asp Tyr Ala Glu Asp Asp Asp Ile Glu Gly Lys 595 600 605Ser Pro Ser Gly Leu Arg Ser Pro Ser Glu Ser Pro Gln His Ile Ala 610 615 620His Pro Glu Arg Lys Ser Glu Arg Gly Ser Leu Gly Val Pro Lys Thr625 630 635 640Leu Ala Tyr Thr Met Pro Ser His Val Lys Ala Glu Pro Lys Asp Ser 645 650 655Tyr Pro Gly Pro His Arg His Ser Phe Leu Asp Leu Lys His Phe Thr 660 665 670Ser Gly Ile Ser Gly Phe Leu Ala Asp Glu Phe Ala Ile Gly Ala Phe 675 680 685Leu Arg Leu Leu Gln Glu Gln Leu Asp Glu Ile Ser Ser Arg Ser Pro 690 695 700Pro Glu Lys Pro Lys Gln Glu Ser Gln Ser Cys Ser Gly Ser Arg Asp705 710 715 720Gly Leu Gln Ser Arg Leu His Arg Leu Ser Lys Val Val Ser Glu Ala 725 730 735Gln Trp Arg His Lys Val Val Thr Ser Asn His Arg Ser Glu Glu Gln 740 745 750Pro Ser Arg Arg Tyr Gln Pro Ala Thr Arg His Pro Ser Leu Arg Arg 755 760 765Gly Arg Arg Thr Arg Arg Ser Gln Ala Asp Gly Arg Asp Arg Gly Ser 770 775 780Asn Pro Ser Leu Glu Ser Thr Ser Ser Glu Leu Ser Thr Ser Thr Ser785 790 795 800Glu Gly Ser Leu Ser Ala Met Ser Gly Arg Asn Glu Leu His Ser Arg 805 810 815Leu His Pro His Pro Gln Ser Ser Leu Ile Pro Met Met Phe Ser Pro 820 825 830Pro Glu Ser Leu Leu Ala Ser Cys Ile Leu Arg Gly Asn Phe Ala Glu 835 840 845Ala His Gln Val Leu Phe Thr Phe Asn Leu Lys Ser Ser Pro Ser Ser 850 855 860Gly Glu Leu Met Phe Met Glu Arg Tyr Gln Glu Val Ile Gln Glu Leu865 870 875 880Ala Gln Val Glu His Lys Ile Glu Asn Gln Asn Ser Asp Ala Gly Ser 885 890 895Ser Thr Ile Arg Arg Thr Gly Ser Gly Arg Ser Thr Leu Gln Ala Ile 900 905 910Gly Ser Ala Ala Ala Ala Gly Met Val Phe Tyr Ser Ile Ser Asp Val 915 920 925Thr Asp Lys Leu Leu Asn Thr Ser Gly Asp Pro Ile Pro Met Leu Gln 930 935 940Glu Asp Phe Trp Ile Ser Thr Ala Leu Val Glu Pro Thr Ala Pro Leu945 950 955 960Arg Glu Val Leu Glu Asp Leu Ser Pro Pro Ala Met Ala Ala Phe Asp 965 970 975Leu Ala Cys Ser Gln Cys Gln Leu Trp Lys Thr Cys Lys Gln Leu Leu 980 985 990Glu Thr Ala Glu Arg Arg Leu Asn Ser Ser Leu Glu Arg Arg Gly Arg 995 1000 1005Arg Ile Asp His Val Leu Leu Asn Ala Asp Gly Ile Arg Gly Phe 1010 1015 1020Pro Val Val Leu Gln Gln Ile Ser Lys Ser Leu Asn Tyr Leu Leu 1025 1030 1035Met Ser Ala Ser Gln Thr Lys Ser Glu Ser Val Glu Glu Lys Gly 1040 1045 1050Gly Gly Pro Pro Arg Cys Ser Ile Thr Glu Leu Leu Gln Met Cys 1055 1060 1065Trp Pro Ser Leu Ser Glu Asp Cys Val Ala Ser His Thr Thr Leu 1070 1075 1080Ser Gln Gln Leu Asp Gln Val Leu Gln Ser Leu Arg Glu Ala Leu 1085 1090 1095Glu Leu Pro Glu Pro Arg Thr Pro Pro Leu Ser Ser Leu Val Glu 1100 1105 1110Gln Ala Ala Gln Lys Ala Pro Glu Ala Glu Ala His Pro Val Gln 1115 1120 1125Ile Gln Thr Gln Leu Leu Gln Lys Asn Leu Gly Lys Gln Thr Pro 1130 1135 1140Ser Gly Ser Arg Gln Met Asp Tyr Leu Gly Thr Phe Phe Ser Tyr 1145 1150 1155Cys Ser Thr Leu Ala Ala Val Leu Leu Gln Ser Leu Ser Ser Glu 1160 1165 1170Pro Asp His Val Glu Val Lys Val Gly Asn Pro Phe Val Leu Leu 1175 1180 1185Gln Gln Ser Ser Ser Gln Leu Val Ser His Leu Leu Phe Glu Arg 1190 1195 1200Gln Val Pro Pro Glu Arg Leu Ala Ala Leu Leu Ala Gln Glu Asn 1205 1210 1215Leu Ser Leu Ser Val Pro Gln Val Ile Val Ser Cys Cys Cys Glu 1220 1225 1230Pro Leu Ala Leu Cys Ser Ser Arg Gln Ser Gln Gln Thr Ser Ser 1235 1240 1245Leu Leu Thr Arg Leu Gly Thr Leu Ala Gln Leu His Ala Ser His 1250 1255 1260Cys Leu Asp Asp Leu Pro Leu Ser Thr Pro Ser Ser Pro Arg Thr 1265 1270 1275Thr Glu Asn Pro Thr Leu Glu Arg Lys Pro Tyr Ser Ser Pro Arg 1280 1285 1290Asp Ser Ser Leu Pro Ala Leu Thr Ser Ser Ala Leu Ala Phe Leu 1295 1300 1305Lys Ser Arg Ser Lys Leu Leu Ala Thr Val Ala Cys Leu Gly Ala 1310 1315 1320Ser Pro Arg Leu Lys Val Ser Lys Pro Ser Leu Ser Trp Lys Glu 1325 1330 1335Leu Arg Gly Arg Arg Glu Val Pro Leu Ala Ala Glu Gln Val Ala 1340 1345 1350Arg Glu Cys Glu Arg Leu Leu Glu Gln Phe Pro Leu Phe Glu Ala 1355 1360 1365Phe Leu Leu Ala Ala Trp Glu Pro Leu Arg Gly Ser Leu Gln Gln 1370 1375 1380Gly Gln Ser Leu Ala Val Asn Leu Cys Gly Trp Ala Ser Leu Ser 1385 1390 1395Thr Val Leu Leu Gly Leu His Ser Pro Ile Ala Leu Asp Val Leu 1400 1405 1410Ser Glu Ala Phe Glu Glu Ser Leu Val Ala Arg Asp Trp Ser Arg 1415 1420 1425Ala Leu Gln Leu Thr Glu Val Tyr Gly Arg Asp Val Asp Asp Leu 1430 1435 1440Ser Ser Ile Lys Asp Ala Val Leu Ser Cys Ala Val Ala Cys Asp 1445 1450 1455Lys Glu Gly Trp Gln Tyr Leu Phe Pro Val Lys Asp Ala Ser Leu 1460 1465 1470Arg Ser Arg Leu Ala Leu Gln Phe Val Asp Arg Trp Pro Leu Glu 1475 1480 1485Ser Cys Leu Glu Ile Leu Ala Tyr Cys Ile Ser Asp Thr Ala Val 1490 1495 1500Gln Glu Gly Leu Lys Cys Glu Leu Gln Arg Lys Leu Ala Glu Leu 1505 1510 1515Gln Val Tyr Gln Lys Ile Leu Gly Leu Gln Ser Pro Pro Val Trp 1520 1525 1530Cys Asp Trp Gln Thr Leu Arg Ser Cys Cys Val Glu Asp Pro Ser 1535 1540 1545Thr Val Met Asn Met Ile Leu Glu Ala Gln Glu Tyr Glu Leu Cys 1550 1555 1560Glu Glu Trp Gly Cys Leu Tyr Pro Ile Pro Arg Glu His Leu Ile 1565 1570 1575Ser Leu His Gln Lys His Leu Leu His Leu Leu Glu Arg Arg Asp 1580 1585 1590His Asp Lys Ala Leu Gln Leu Leu Arg Arg Ile Pro Asp Pro Thr 1595 1600 1605Met Cys Leu Glu Val Thr Glu Gln Ser Leu Asp Gln His Thr Ser 1610 1615 1620Leu Ala Thr Ser His Phe Leu Ala Asn Tyr Leu Thr Thr His Phe 1625 1630 1635Tyr Gly Gln Leu Thr Ala Val Arg His Arg Glu Ile Gln Ala Leu 1640 1645 1650Tyr Val Gly Ser Lys Ile Leu Leu Thr Leu Pro Glu Gln His Arg 1655 1660 1665Ala Ser Tyr Ser His Leu Ser Ser Asn Pro Leu Phe Met Leu Glu 1670 1675 1680Gln Leu Leu Met Asn Met Lys Val Asp Trp Ala Thr Val Ala Val 1685 1690 1695Gln Thr Leu Gln Gln Leu Leu Val Gly Gln Glu Ile Gly Phe Thr 1700 1705 1710Met Asp Glu Val Asp Ser Leu Leu Ser Arg Tyr Ala Glu Lys Ala 1715 1720 1725Leu Asp Phe Pro Tyr Pro Gln Arg Glu Lys Arg Ser Asp Ser Val 1730 1735 1740Ile His Leu Gln Glu Ile Val His Gln Ala Ala Asp Pro Glu Thr 1745 1750 1755Leu Pro Arg Ser Pro Ser Ala Glu Phe Ser Pro Ala Ala Pro Pro 1760 1765 1770Gly Ile Ser Ser Ile His Ser Pro Ser Leu Arg Glu Arg Ser Phe 1775 1780 1785Pro Pro Thr Gln Pro Ser Gln Glu Phe Val Pro Pro Ala Thr Pro 1790 1795 1800Pro Ala Arg His Gln Trp Val Pro Asp Glu Thr Glu Ser Ile Cys 1805 1810 1815Met Val Cys Cys Arg Glu His Phe Thr Met Phe Asn Arg Arg His 1820 1825 1830His Cys Arg Arg Cys Gly Arg Leu Val Cys Ser Ser Cys Ser Thr 1835 1840 1845Lys Lys Met Val Val Glu Gly Cys Arg Glu Asn Pro Ala Arg Val 1850 1855 1860Cys Asp Gln Cys Tyr Ser Tyr Cys Asn Lys Asp Val Pro Glu Glu 1865 1870 1875Pro Ser Glu Lys Pro Glu Ala Leu Asp Ser Ser Lys Asn Glu Ser 1880 1885 1890Pro Pro Tyr Ser Phe Val Val Arg Val Pro Lys Ala Asp Glu Val 1895 1900 1905Glu Trp Ile Leu Asp Leu Lys Glu Glu Glu Asn Glu Leu Val Arg 1910 1915 1920Ser Glu Phe Tyr Tyr Glu Gln Ala Pro Ser Ala Ser Leu Cys Ile 1925 1930 1935Ala Ile Leu Asn Leu His Arg Asp Ser Ile Ala Cys Gly His Gln 1940 1945 1950Leu Ile Glu His Cys Cys Arg Leu Ser Lys Gly Leu Thr Asn Pro 1955 1960 1965Glu Val Asp Ala Gly Leu Leu Thr Asp Ile Met Lys Gln Leu Leu 1970 1975 1980Phe Ser Ala Lys Met Met Phe Val Lys Ala Gly Gln Ser Gln Asp 1985 1990 1995Leu Ala Leu Cys Asp Ser Tyr Ile Ser Lys Val Asp Val Leu Asn 2000 2005 2010Ile Leu Val Ala Ala Ala Tyr Arg His Val Pro Ser Leu Asp Gln 2015 2020 2025Ile Leu Gln Pro Ala Ala Val Thr Arg Leu Arg Asn Gln Leu Leu 2030 2035 2040Glu Ala Glu Tyr Tyr Gln Leu Gly Val Glu Val Ser Thr Lys Thr 2045 2050 2055Gly Leu Asp Thr Thr Gly Ala Trp His Ala Trp Gly Met Ala Cys 2060 2065 2070Leu Lys Ala Gly Asn Leu Thr Ala Ala Arg Glu Lys Phe Ser Arg 2075 2080 2085Cys Leu Lys Pro Pro Phe Asp Leu Asn Gln Leu Asn His Gly Ser 2090 2095 2100Arg Leu Val Gln Asp Val Val Glu Tyr Leu Glu Ser Thr Val Arg 2105 2110 2115Pro Phe Val Ser Leu Gln Asp Asp Asp Tyr Phe Ala Thr Leu Arg 2120 2125 2130Glu Leu Glu Ala Thr Leu Arg Thr Gln Ser Leu Ser Leu Ala Val 2135 2140 2145Ile Pro Glu Gly Lys Ile Met Asn Asn Thr Tyr Tyr Gln Glu Cys 2150 2155 2160Leu Phe Tyr Leu His Asn Tyr Ser Thr Asn Leu Ala Ile Ile Ser 2165 2170 2175Phe Tyr Val Arg His Ser Cys Leu Arg Glu Ala Leu Leu His Leu 2180 2185 2190Leu Asn Lys Glu Ser Pro Pro Glu Val Phe Ile Glu Gly Ile Phe 2195 2200 2205Gln Pro Ser Tyr Lys Ser Gly Lys Leu His Thr Leu Glu Asn Leu 2210 2215 2220Leu Glu Ser Ile Asp Pro Thr Leu Glu Ser Cys Ser Ser Leu 2225 2230 2235118728PRTHomo sapiensmisc_feature(728)..(728)Xaa can be any naturally occurring amino acid 118Met Asn His Pro Phe Gly Lys Glu Glu Ala Ala Ser Gln Lys Gln Leu1 5 10 15Phe Gly Phe Phe Cys Glu Cys Leu Arg Arg Gly Glu Trp Glu Leu Ala 20 25 30Gln Ala Cys Val Pro Gln Leu Gln Glu Gly Gln Gly Asp Ile Pro Lys 35 40 45Arg Val Glu Asp Ile Leu Gln Ala Leu Val Val Cys Pro Asn Leu Leu 50 55 60Arg Cys Gly Gln Asp Ile Asn Pro Gln Arg Val Ala Trp Val Trp Leu65 70 75 80Leu Val Leu Glu Lys Trp Leu Ala Arg Glu Lys Lys Leu Leu Pro Val 85 90 95Val Phe Arg Arg Lys Leu Glu Phe Leu Leu Leu Ser Glu Asp Leu Gln 100 105 110Gly Asp Ile Pro Glu Asn Ile Leu Glu Glu Leu Tyr Glu Thr Leu Thr 115 120 125Gln Gly Ala Val Gly His Val Pro Asp Gly Asn Pro Arg Arg Glu Ser 130 135 140Trp Thr Pro Arg Leu Ser Ser Glu Ala Val Ser Val Leu Trp Asp Leu145 150 155 160Leu Arg Gln Ser Pro Gln Pro Ala Gln Ala Leu Leu Glu Leu Leu Leu 165 170 175Glu Glu Asp Asp Gly Thr Gly Leu Cys His Trp Pro Leu Gln Asn Ala 180 185 190Leu Val Asp Leu Ile Arg Lys Ala Leu Arg Ala Leu Gln Gly Pro Asp 195 200 205Ser Val Pro Pro Gly Val Val Asp Ala Ile Tyr Gly Ala Leu Arg Thr 210 215 220Leu Arg Cys Pro Ala Glu Pro Leu Gly Val Glu Leu His Leu Leu Cys225 230 235 240Glu Glu Leu Leu Glu Ala Cys Arg Thr Glu Gly Ser Pro Leu Arg Glu 245 250 255Glu Arg Leu Leu Ser Cys Leu Leu His Lys Ala Ser Arg Gly Leu Leu 260 265 270Ser Leu Tyr Gly His Thr Tyr Ala Glu Lys Val Thr Glu Lys Pro Pro 275 280 285Arg Ala Thr Ala Ser Gly Lys Val Ser Pro Asp His Leu Asp Pro Glu 290 295 300Arg Ala Met Leu Ala Leu Phe Ser Asn Pro Asn Pro Ala Glu Ala Trp305 310 315 320Lys Val Ala Tyr Phe Tyr Cys Leu Ser Asn Asn Lys His Phe Leu Glu 325 330 335Gln Ile Leu Val Thr Ala Leu Thr Leu Leu Lys Glu Glu Asp Phe Pro 340 345 350Asn Leu Gly Cys Leu Leu Asp Arg Glu Phe Arg Pro Leu Ser Cys Leu 355 360 365Leu Val Leu Leu Gly Trp Thr His Cys

Gln Ser Leu Glu Ser Ala Lys 370 375 380Arg Leu Leu Gln Thr Leu His Arg Thr Gln Gly Pro Gly Cys Asp Glu385 390 395 400Leu Leu Arg Asp Ala Cys Asp Gly Leu Trp Ala His Leu Glu Val Leu 405 410 415Glu Trp Cys Ile Gln Gln Ser Ser Asn Pro Ile Pro Lys Arg Asp Leu 420 425 430Leu Tyr His Leu His Gly Gly Asp Ser His Ser Val Leu Tyr Thr Leu 435 440 445His His Leu Thr Asn Leu Pro Ala Leu Arg Glu Glu Asp Val Leu Lys 450 455 460Leu Leu Gln Lys Val Pro Ala Lys Asp Pro Gln Gln Glu Pro Asp Ala465 470 475 480Val Asp Ala Pro Val Pro Glu His Leu Ser Gln Cys Gln Asn Leu Thr 485 490 495Leu Tyr Gln Gly Phe Cys Ala Met Lys Tyr Ala Ile Tyr Ala Leu Cys 500 505 510Val Asn Ser His Gln His Ser Gln Cys Gln Asp Cys Lys Asp Ser Leu 515 520 525Ser Glu Asp Leu Ala Ser Ala Thr Glu Pro Ala Asn Asp Ser Leu Ser 530 535 540Ser Pro Gly Ala Ala Asn Leu Phe Ser Thr Tyr Leu Ala Arg Cys Gln545 550 555 560Gln Tyr Leu Cys Ser Ile Pro Asp Ser Leu Cys Leu Glu Leu Leu Glu 565 570 575Asn Ile Phe Ser Leu Leu Leu Ile Thr Ser Ala Asp Leu His Pro Glu 580 585 590Pro His Leu Pro Glu Asp Tyr Ala Glu Asp Asp Asp Ile Glu Gly Lys 595 600 605Ser Pro Ser Gly Leu Arg Ser Pro Ser Glu Ser Pro Gln His Ile Ala 610 615 620His Pro Glu Arg Lys Ser Glu Arg Gly Ser Leu Gly Val Pro Lys Thr625 630 635 640Leu Ala Tyr Thr Met Pro Ser His Val Lys Ala Glu Pro Lys Asp Ser 645 650 655Tyr Pro Gly Pro His Arg His Ser Phe Leu Asp Leu Lys His Phe Thr 660 665 670Ser Gly Ile Ser Gly Phe Leu Ala Asp Glu Phe Ala Ile Gly Ala Phe 675 680 685Leu Arg Leu Leu Gln Glu Gln Leu Asp Glu Ile Ser Ser Arg Ser Pro 690 695 700Pro Glu Lys Pro Lys Gln Glu Ser Gln Ser Cys Ser Gly Ser Arg Asp705 710 715 720Gly Leu Gln Ser Arg Leu His Xaa 725119793PRTHomo sapiensmisc_feature(793)..(793)Xaa can be any naturally occurring amino acid 119Met Asn His Pro Phe Gly Lys Glu Glu Ala Ala Ser Gln Lys Gln Leu1 5 10 15Phe Gly Phe Phe Cys Glu Cys Leu Arg Arg Gly Glu Trp Glu Leu Ala 20 25 30Gln Ala Cys Val Pro Gln Leu Gln Glu Gly Gln Gly Asp Ile Pro Lys 35 40 45Arg Val Glu Asp Ile Leu Gln Ala Leu Val Val Cys Pro Asn Leu Leu 50 55 60Arg Cys Gly Gln Asp Ile Asn Pro Gln Arg Val Ala Trp Val Trp Leu65 70 75 80Leu Val Leu Glu Lys Trp Leu Ala Arg Glu Lys Lys Leu Leu Pro Val 85 90 95Val Phe Arg Arg Lys Leu Glu Phe Leu Leu Leu Ser Glu Asp Leu Gln 100 105 110Gly Asp Ile Pro Glu Asn Ile Leu Glu Glu Leu Tyr Glu Thr Leu Thr 115 120 125Gln Gly Ala Val Gly His Val Pro Asp Gly Asn Pro Arg Arg Glu Ser 130 135 140Trp Thr Pro Arg Leu Ser Ser Glu Ala Val Ser Val Leu Trp Asp Leu145 150 155 160Leu Arg Gln Ser Pro Gln Pro Ala Gln Ala Leu Leu Glu Leu Leu Leu 165 170 175Glu Glu Asp Asp Gly Thr Gly Leu Cys His Trp Pro Leu Gln Asn Ala 180 185 190Leu Val Asp Leu Ile Arg Lys Ala Leu Arg Ala Leu Gln Gly Pro Asp 195 200 205Ser Val Pro Pro Gly Val Val Asp Ala Ile Tyr Gly Ala Leu Arg Thr 210 215 220Leu Arg Cys Pro Ala Glu Pro Leu Gly Val Glu Leu His Leu Leu Cys225 230 235 240Glu Glu Leu Leu Glu Ala Cys Arg Thr Glu Gly Ser Pro Leu Arg Glu 245 250 255Glu Arg Leu Leu Ser Cys Leu Leu His Lys Ala Ser Arg Gly Leu Leu 260 265 270Ser Leu Tyr Gly His Thr Tyr Ala Glu Lys Val Thr Glu Lys Pro Pro 275 280 285Arg Ala Thr Ala Ser Gly Lys Val Ser Pro Asp His Leu Asp Pro Glu 290 295 300Arg Ala Met Leu Ala Leu Phe Ser Asn Pro Asn Pro Ala Glu Ala Trp305 310 315 320Lys Val Ala Tyr Phe Tyr Cys Leu Ser Asn Asn Lys His Phe Leu Glu 325 330 335Gln Ile Leu Val Thr Ala Leu Thr Leu Leu Lys Glu Glu Asp Phe Pro 340 345 350Asn Leu Gly Cys Leu Leu Asp Arg Glu Phe Arg Pro Leu Ser Cys Leu 355 360 365Leu Val Leu Leu Gly Trp Thr His Cys Gln Ser Leu Glu Ser Ala Lys 370 375 380Arg Leu Leu Gln Thr Leu His Arg Thr Gln Gly Pro Gly Cys Asp Glu385 390 395 400Leu Leu Arg Asp Ala Cys Asp Gly Leu Trp Ala His Leu Glu Val Leu 405 410 415Glu Trp Cys Ile Gln Gln Ser Ser Asn Pro Ile Pro Lys Arg Asp Leu 420 425 430Leu Tyr His Leu His Gly Gly Asp Ser His Ser Val Leu Tyr Thr Leu 435 440 445His His Leu Thr Asn Leu Pro Ala Leu Arg Glu Glu Asp Val Leu Lys 450 455 460Leu Leu Gln Lys Val Pro Ala Lys Asp Pro Gln Gln Glu Pro Asp Ala465 470 475 480Val Asp Ala Pro Val Pro Glu His Leu Ser Gln Cys Gln Asn Leu Thr 485 490 495Leu Tyr Gln Gly Phe Cys Ala Met Lys Tyr Ala Ile Tyr Ala Leu Cys 500 505 510Val Asn Ser His Gln His Ser Gln Cys Gln Asp Cys Lys Asp Ser Leu 515 520 525Ser Glu Asp Leu Ala Ser Ala Thr Glu Pro Ala Asn Asp Ser Leu Ser 530 535 540Ser Pro Gly Ala Ala Asn Leu Phe Ser Thr Tyr Leu Ala Arg Cys Gln545 550 555 560Gln Tyr Leu Cys Ser Ile Pro Asp Ser Leu Cys Leu Glu Leu Leu Glu 565 570 575Asn Ile Phe Ser Leu Leu Leu Ile Thr Ser Ala Asp Leu His Pro Glu 580 585 590Pro His Leu Pro Glu Asp Tyr Ala Glu Asp Asp Asp Ile Glu Gly Lys 595 600 605Ser Pro Ser Gly Leu Arg Ser Pro Ser Glu Ser Pro Gln His Ile Ala 610 615 620His Pro Glu Arg Lys Ser Glu Arg Gly Ser Leu Gly Val Pro Lys Thr625 630 635 640Leu Ala Tyr Thr Met Pro Ser His Val Lys Ala Glu Pro Lys Asp Ser 645 650 655Tyr Pro Gly Pro His Arg His Ser Phe Leu Asp Leu Lys His Phe Thr 660 665 670Ser Gly Ile Ser Gly Phe Leu Ala Asp Glu Phe Ala Ile Gly Ala Phe 675 680 685Leu Arg Leu Leu Gln Glu Gln Leu Asp Glu Ile Ser Ser Arg Ser Pro 690 695 700Pro Glu Lys Pro Lys Gln Glu Ser Gln Ser Cys Ser Gly Ser Arg Asp705 710 715 720Gly Leu Gln Ser Arg Leu His Arg Leu Ser Lys Val Val Ser Glu Ala 725 730 735Gln Trp Arg His Lys Val Val Thr Ser Asn His Arg Ser Glu Glu Gln 740 745 750Pro Ser Arg Arg Tyr Gln Pro Ala Thr Arg His Pro Ser Leu Arg Arg 755 760 765Gly Arg Arg Thr Arg Arg Ser Gln Ala Arg Trp Pro Arg Gln Arg Phe 770 775 780Lys Pro Ile Pro Gly Lys Tyr Lys Xaa785 79012021DNAArtificialprimer 120tcagaacact ggggtatgct c 2112121DNAArtificialprimer 121gcatggaaaa tttctgaaag g 2112220DNAArtificialprimer 122acatcccgca gctctggaag 2012320DNAArtificialprimer 123gcaacatatc aggtaggccc 2012420DNAArtificialprimer 124tgtaccagag gagccttcag 2012520DNAArtificialprimer 125ctcaacgccc agttggtagt 2012616PRTArtificialpeptide 126Leu Arg Arg Gly Glu Trp Glu Leu Ala Gln Ala Cys Val Pro Gln Leu1 5 10 1512718PRTArtificialpeptide 127Pro Glu Arg Leu Ala Ala Leu Leu Ala Gln Glu Asn Leu Ser Leu Ser1 5 10 15Val Pro12819PRTArtificialpeptide 128Pro Ala Ala Val Thr Arg Leu Arg Asn Gln Leu Leu Glu Ala Glu Tyr1 5 10 15Tyr Gln Leu12915PRTArtificialpeptide 129Ala Ala Lys Ser Ser Gly Asp Ala Val Val Gln Asp Ile Cys Ala1 5 10 151301957PRTHomo sapiensmisc_feature(1957)..(1957)Xaa can be any naturally occurring amino acid 130Met Asn His Pro Phe Gly Lys Glu Glu Ala Ala Ser Gln Lys Gln Leu1 5 10 15Phe Gly Phe Phe Cys Glu Cys Leu Arg Arg Gly Glu Trp Glu Leu Ala 20 25 30Gln Ala Cys Val Pro Gln Leu Gln Glu Gly Gln Gly Asp Ile Pro Lys 35 40 45Arg Val Glu Asp Ile Leu Gln Ala Leu Val Val Cys Pro Asn Leu Leu 50 55 60Arg Cys Gly Gln Asp Ile Asn Pro Gln Arg Val Ala Trp Val Trp Leu65 70 75 80Leu Val Leu Glu Lys Trp Leu Ala Arg Glu Lys Lys Leu Leu Pro Val 85 90 95Val Phe Arg Arg Lys Leu Glu Phe Leu Leu Leu Ser Glu Asp Leu Gln 100 105 110Gly Asp Ile Pro Glu Asn Ile Leu Glu Glu Leu Tyr Glu Thr Leu Thr 115 120 125Gln Gly Ala Val Gly His Val Pro Asp Gly Asn Pro Arg Arg Glu Ser 130 135 140Trp Thr Pro Arg Leu Ser Ser Glu Ala Val Ser Val Leu Trp Asp Leu145 150 155 160Leu Arg Gln Ser Pro Gln Pro Ala Gln Ala Leu Leu Glu Leu Leu Leu 165 170 175Glu Glu Asp Asp Gly Thr Gly Leu Cys His Trp Pro Leu Gln Asn Ala 180 185 190Leu Val Asp Leu Ile Arg Lys Ala Leu Arg Ala Leu Gln Gly Pro Asp 195 200 205Ser Val Pro Pro Gly Val Val Asp Ala Ile Tyr Gly Ala Leu Arg Thr 210 215 220Leu Arg Cys Pro Ala Glu Pro Leu Gly Val Glu Leu His Leu Leu Cys225 230 235 240Glu Glu Leu Leu Glu Ala Cys Arg Thr Glu Gly Ser Pro Leu Arg Glu 245 250 255Glu Arg Leu Leu Ser Cys Leu Leu His Lys Ala Ser Arg Gly Leu Leu 260 265 270Ser Leu Tyr Gly His Thr Tyr Ala Glu Lys Val Thr Glu Lys Pro Pro 275 280 285Arg Ala Thr Ala Ser Gly Lys Val Ser Pro Asp His Leu Asp Pro Glu 290 295 300Arg Ala Met Leu Ala Leu Phe Ser Asn Pro Asn Pro Ala Glu Ala Trp305 310 315 320Lys Val Ala Tyr Phe Tyr Cys Leu Ser Asn Asn Lys His Phe Leu Glu 325 330 335Gln Ile Leu Val Thr Ala Leu Thr Leu Leu Lys Glu Glu Asp Phe Pro 340 345 350Asn Leu Gly Cys Leu Leu Asp Arg Glu Phe Arg Pro Leu Ser Cys Leu 355 360 365Leu Val Leu Leu Gly Trp Thr His Cys Gln Ser Leu Glu Ser Ala Lys 370 375 380Arg Leu Leu Gln Thr Leu His Arg Thr Gln Gly Pro Gly Cys Asp Glu385 390 395 400Leu Leu Arg Asp Ala Cys Asp Gly Leu Trp Ala His Leu Glu Val Leu 405 410 415Glu Trp Cys Ile Gln Gln Ser Ser Asn Pro Ile Pro Lys Arg Asp Leu 420 425 430Leu Tyr His Leu His Gly Gly Asp Ser His Ser Val Leu Tyr Thr Leu 435 440 445His His Leu Thr Asn Leu Pro Ala Leu Arg Glu Glu Asp Val Leu Lys 450 455 460Leu Leu Gln Lys Val Pro Ala Lys Asp Pro Gln Gln Glu Pro Asp Ala465 470 475 480Val Asp Ala Pro Val Pro Glu His Leu Ser Gln Cys Gln Asn Leu Thr 485 490 495Leu Tyr Gln Gly Phe Cys Ala Met Lys Tyr Ala Ile Tyr Ala Leu Cys 500 505 510Val Asn Ser His Gln His Ser Gln Cys Gln Asp Cys Lys Asp Ser Leu 515 520 525Ser Glu Asp Leu Ala Ser Ala Thr Glu Pro Ala Asn Asp Ser Leu Ser 530 535 540Ser Pro Gly Ala Ala Asn Leu Phe Ser Thr Tyr Leu Ala Arg Cys Gln545 550 555 560Gln Tyr Leu Cys Ser Ile Pro Asp Ser Leu Cys Leu Glu Leu Leu Glu 565 570 575Asn Ile Phe Ser Leu Leu Leu Ile Thr Ser Ala Asp Leu His Pro Glu 580 585 590Pro His Leu Pro Glu Asp Tyr Ala Glu Asp Asp Asp Ile Glu Gly Lys 595 600 605Ser Pro Ser Gly Leu Arg Ser Pro Ser Glu Ser Pro Gln His Ile Ala 610 615 620His Pro Glu Arg Lys Ser Glu Arg Gly Ser Leu Gly Val Pro Lys Thr625 630 635 640Leu Ala Tyr Thr Met Pro Ser His Val Lys Ala Glu Pro Lys Asp Ser 645 650 655Tyr Pro Gly Pro His Arg His Ser Phe Leu Asp Leu Lys His Phe Thr 660 665 670Ser Gly Ile Ser Gly Phe Leu Ala Asp Glu Phe Ala Ile Gly Ala Phe 675 680 685Leu Arg Leu Leu Gln Glu Gln Leu Asp Glu Ile Ser Ser Arg Ser Pro 690 695 700Pro Glu Lys Pro Lys Gln Glu Ser Gln Ser Cys Ser Gly Ser Arg Asp705 710 715 720Gly Leu Gln Ser Arg Leu His Arg Leu Ser Lys Val Val Ser Glu Ala 725 730 735Gln Trp Arg His Lys Val Val Thr Ser Asn His Arg Ser Glu Glu Gln 740 745 750Pro Ser Arg Arg Tyr Gln Pro Ala Thr Arg His Pro Ser Leu Arg Arg 755 760 765Gly Arg Arg Thr Arg Arg Ser Gln Ala Asp Gly Arg Asp Arg Gly Ser 770 775 780Asn Pro Ser Leu Glu Ser Thr Ser Ser Glu Leu Ser Thr Ser Thr Ser785 790 795 800Glu Gly Ser Leu Ser Ala Met Ser Gly Arg Asn Glu Leu His Ser Arg 805 810 815Leu His Pro His Pro Gln Ser Ser Leu Ile Pro Met Met Phe Ser Pro 820 825 830Pro Glu Ser Leu Leu Ala Ser Cys Ile Leu Arg Gly Asn Phe Ala Glu 835 840 845Ala His Gln Val Leu Phe Thr Phe Asn Leu Lys Ser Ser Pro Ser Ser 850 855 860Gly Glu Leu Met Phe Met Glu Arg Tyr Gln Glu Val Ile Gln Glu Leu865 870 875 880Ala Gln Val Glu His Lys Ile Glu Asn Gln Asn Ser Asp Ala Gly Ser 885 890 895Ser Thr Ile Arg Arg Thr Gly Ser Gly Arg Ser Thr Leu Gln Ala Ile 900 905 910Gly Ser Ala Ala Ala Ala Gly Met Val Phe Tyr Ser Ile Ser Asp Val 915 920 925Thr Asp Lys Leu Leu Asn Thr Ser Gly Asp Pro Ile Pro Met Leu Gln 930 935 940Glu Asp Phe Trp Ile Ser Thr Ala Leu Val Glu Pro Thr Ala Pro Leu945 950 955 960Arg Glu Val Leu Glu Asp Leu Ser Pro Pro Ala Met Ala Ala Phe Asp 965 970 975Leu Ala Cys Ser Gln Cys Gln Leu Trp Lys Thr Cys Lys Gln Leu Leu 980 985 990Glu Thr Ala Glu Arg Arg Leu Asn Ser Ser Leu Glu Arg Arg Gly Arg 995 1000 1005Arg Ile Asp His Val Leu Leu Asn Ala Asp Gly Ile Arg Gly Phe 1010 1015 1020Pro Val Val Leu Gln Gln Ile Ser Lys Ser Leu Asn Tyr Leu Leu 1025 1030 1035Met Ser Ala Ser Gln Thr Lys Ser Glu Ser Val Glu Glu Lys Gly 1040 1045 1050Gly Gly Pro Pro Arg Cys Ser Ile Thr Glu Leu Leu Gln Met Cys 1055 1060 1065Trp Pro Ser Leu Ser Glu Asp Cys Val Ala Ser His Thr Thr Leu 1070 1075 1080Ser Gln Gln Leu Asp Gln Val Leu Gln Ser Leu Arg Glu Ala Leu 1085 1090 1095Glu Leu Pro Glu Pro Arg Thr Pro Pro Leu Ser Ser Leu Val Glu 1100 1105 1110Gln Ala Ala Gln Lys Ala Pro Glu Ala Glu Ala His Pro Val Gln 1115 1120

1125Ile Gln Thr Gln Leu Leu Gln Lys Asn Leu Gly Lys Gln Thr Pro 1130 1135 1140Ser Gly Ser Arg Gln Met Asp Tyr Leu Gly Thr Phe Phe Ser Tyr 1145 1150 1155Cys Ser Thr Leu Ala Ala Val Leu Leu Gln Ser Leu Ser Ser Glu 1160 1165 1170Pro Asp His Val Glu Val Lys Val Gly Asn Pro Phe Val Leu Leu 1175 1180 1185Gln Gln Ser Ser Ser Gln Leu Val Ser His Leu Leu Phe Glu Arg 1190 1195 1200Gln Val Pro Pro Glu Arg Leu Ala Ala Leu Leu Ala Gln Glu Asn 1205 1210 1215Leu Ser Leu Ser Val Pro Gln Val Ile Val Ser Cys Cys Cys Glu 1220 1225 1230Pro Leu Ala Leu Cys Ser Ser Arg Gln Ser Gln Gln Thr Ser Ser 1235 1240 1245Leu Leu Thr Arg Leu Gly Thr Leu Ala Gln Leu His Ala Ser His 1250 1255 1260Cys Leu Asp Asp Leu Pro Leu Ser Thr Pro Ser Ser Pro Arg Thr 1265 1270 1275Thr Glu Asn Pro Thr Leu Glu Arg Lys Pro Tyr Ser Ser Pro Arg 1280 1285 1290Asp Ser Ser Leu Pro Ala Leu Thr Ser Ser Ala Leu Ala Phe Leu 1295 1300 1305Lys Ser Arg Ser Lys Leu Leu Ala Thr Val Ala Cys Leu Gly Ala 1310 1315 1320Ser Pro Arg Leu Lys Val Ser Lys Pro Ser Leu Ser Trp Lys Glu 1325 1330 1335Leu Arg Gly Arg Arg Glu Val Pro Leu Ala Ala Glu Gln Val Ala 1340 1345 1350Arg Glu Cys Glu Arg Leu Leu Glu Gln Phe Pro Leu Phe Glu Ala 1355 1360 1365Phe Leu Leu Ala Ala Trp Glu Pro Leu Arg Gly Ser Leu Gln Gln 1370 1375 1380Gly Gln Ser Leu Ala Val Asn Leu Cys Gly Trp Ala Ser Leu Ser 1385 1390 1395Thr Val Leu Leu Gly Leu His Ser Pro Ile Ala Leu Asp Val Leu 1400 1405 1410Ser Glu Ala Phe Glu Glu Ser Leu Val Ala Arg Asp Trp Ser Arg 1415 1420 1425Ala Leu Gln Leu Thr Glu Val Tyr Gly Arg Asp Val Asp Asp Leu 1430 1435 1440Ser Ser Ile Lys Asp Ala Val Leu Ser Cys Ala Val Ala Cys Asp 1445 1450 1455Lys Glu Gly Trp Gln Tyr Leu Phe Pro Val Lys Asp Ala Ser Leu 1460 1465 1470Arg Ser Arg Leu Ala Leu Gln Phe Val Asp Arg Trp Pro Leu Glu 1475 1480 1485Ser Cys Leu Glu Ile Leu Ala Tyr Cys Ile Ser Asp Thr Ala Val 1490 1495 1500Gln Glu Gly Leu Lys Cys Glu Leu Gln Arg Lys Leu Ala Glu Leu 1505 1510 1515Gln Val Tyr Gln Lys Ile Leu Gly Leu Gln Ser Pro Pro Val Trp 1520 1525 1530Cys Asp Trp Gln Thr Leu Arg Ser Cys Cys Val Glu Asp Pro Ser 1535 1540 1545Thr Val Met Asn Met Ile Leu Glu Ala Gln Glu Tyr Glu Leu Cys 1550 1555 1560Glu Glu Trp Gly Cys Leu Tyr Pro Ile Pro Arg Glu His Leu Ile 1565 1570 1575Ser Leu His Gln Lys His Leu Leu His Leu Leu Glu Arg Arg Asp 1580 1585 1590His Asp Lys Ala Leu Gln Leu Leu Arg Arg Ile Pro Asp Pro Thr 1595 1600 1605Met Cys Leu Glu Val Thr Glu Gln Ser Leu Asp Gln His Thr Ser 1610 1615 1620Leu Ala Thr Ser His Phe Leu Ala Asn Tyr Leu Thr Thr His Phe 1625 1630 1635Tyr Gly Gln Leu Thr Ala Val Arg His Arg Glu Ile Gln Ala Leu 1640 1645 1650Tyr Val Gly Ser Lys Ile Leu Leu Thr Leu Pro Glu Gln His Arg 1655 1660 1665Ala Ser Tyr Ser His Leu Ser Ser Asn Pro Leu Phe Met Leu Glu 1670 1675 1680Gln Leu Leu Met Asn Met Lys Val Asp Trp Ala Thr Val Ala Val 1685 1690 1695Gln Thr Leu Gln Gln Leu Leu Val Gly Gln Glu Ile Gly Phe Thr 1700 1705 1710Met Asp Glu Val Asp Ser Leu Leu Ser Arg Tyr Ala Glu Lys Ala 1715 1720 1725Leu Asp Phe Pro Tyr Pro Gln Arg Glu Lys Arg Ser Asp Ser Val 1730 1735 1740Ile His Leu Gln Glu Ile Val His Gln Ala Ala Asp Pro Glu Thr 1745 1750 1755Leu Pro Arg Ser Pro Ser Ala Glu Phe Ser Pro Ala Ala Pro Pro 1760 1765 1770Gly Ile Ser Ser Ile His Ser Pro Ser Leu Arg Glu Arg Ser Phe 1775 1780 1785Pro Pro Thr Gln Pro Ser Gln Glu Phe Val Pro Pro Ala Thr Pro 1790 1795 1800Pro Ala Arg His Gln Trp Val Pro Asp Glu Thr Glu Ser Ile Cys 1805 1810 1815Met Val Cys Cys Arg Glu His Phe Thr Met Phe Asn Arg Arg His 1820 1825 1830His Cys Arg Arg Cys Gly Arg Leu Val Cys Ser Ser Cys Ser Thr 1835 1840 1845Lys Lys Met Val Val Glu Gly Cys Arg Glu Asn Pro Ala Arg Val 1850 1855 1860Cys Asp Gln Cys Tyr Ser Tyr Cys Asn Lys Asp Val Pro Glu Glu 1865 1870 1875Pro Ser Glu Lys Pro Glu Ala Leu Asp Ser Ser Lys Asn Glu Ser 1880 1885 1890Pro Pro Tyr Ser Phe Val Val Arg Val Pro Lys Ala Asp Glu Val 1895 1900 1905Glu Trp Ile Leu Asp Leu Lys Glu Glu Glu Asn Glu Leu Val Arg 1910 1915 1920Ser Glu Phe Tyr Tyr Glu Gln Pro Gly Pro Gln Arg Leu Leu Val 1925 1930 1935His Cys His Pro Glu Ser Ala Pro Gly Gln His Cys Leu Trp Ser 1940 1945 1950Pro Ala Asp Xaa 19551312337PRTHomo sapiensmisc_feature(2337)..(2337)Xaa can be any naturally occurring amino acid 131Met Asn His Pro Phe Gly Lys Glu Glu Ala Ala Ser Gln Lys Gln Leu1 5 10 15Phe Gly Phe Phe Cys Glu Cys Leu Arg Arg Gly Glu Trp Glu Leu Ala 20 25 30Gln Ala Cys Val Pro Gln Leu Gln Glu Gly Gln Gly Asp Ile Pro Lys 35 40 45Arg Val Glu Asp Ile Leu Gln Ala Leu Val Val Cys Pro Asn Leu Leu 50 55 60Arg Cys Gly Gln Asp Ile Asn Pro Gln Arg Val Ala Trp Val Trp Leu65 70 75 80Leu Val Leu Glu Lys Trp Leu Ala Arg Glu Lys Lys Leu Leu Pro Val 85 90 95Val Phe Arg Arg Lys Leu Glu Phe Leu Leu Leu Ser Glu Asp Leu Gln 100 105 110Gly Asp Ile Pro Glu Asn Ile Leu Glu Glu Leu Tyr Glu Thr Leu Thr 115 120 125Gln Gly Ala Val Gly His Val Pro Asp Gly Asn Pro Arg Arg Glu Ser 130 135 140Trp Thr Pro Arg Leu Ser Ser Glu Ala Val Ser Val Leu Trp Asp Leu145 150 155 160Leu Arg Gln Ser Pro Gln Pro Ala Gln Ala Leu Leu Glu Leu Leu Leu 165 170 175Glu Glu Asp Asp Gly Thr Gly Leu Cys His Trp Pro Leu Gln Asn Ala 180 185 190Leu Val Asp Leu Ile Arg Lys Ala Leu Arg Ala Leu Gln Gly Pro Asp 195 200 205Ser Val Pro Pro Gly Val Val Asp Ala Ile Tyr Gly Ala Leu Arg Thr 210 215 220Leu Arg Cys Pro Ala Glu Pro Leu Gly Val Glu Leu His Leu Leu Cys225 230 235 240Glu Glu Leu Leu Glu Ala Cys Arg Thr Glu Gly Ser Pro Leu Arg Glu 245 250 255Glu Arg Leu Leu Ser Cys Leu Leu His Lys Ala Ser Arg Gly Leu Leu 260 265 270Ser Leu Tyr Gly His Thr Tyr Ala Glu Lys Val Thr Glu Lys Pro Pro 275 280 285Arg Ala Thr Ala Ser Gly Lys Val Ser Pro Asp His Leu Asp Pro Glu 290 295 300Arg Ala Met Leu Ala Leu Phe Ser Asn Pro Asn Pro Ala Glu Ala Trp305 310 315 320Lys Val Ala Tyr Phe Tyr Cys Leu Ser Asn Asn Lys His Phe Leu Glu 325 330 335Gln Ile Leu Val Thr Ala Leu Thr Leu Leu Lys Glu Glu Asp Phe Pro 340 345 350Asn Leu Gly Cys Leu Leu Asp Arg Glu Phe Arg Pro Leu Ser Cys Leu 355 360 365Leu Val Leu Leu Gly Trp Thr His Cys Gln Ser Leu Glu Ser Ala Lys 370 375 380Arg Leu Leu Gln Thr Leu His Arg Thr Gln Gly Pro Gly Cys Asp Glu385 390 395 400Leu Leu Arg Asp Ala Cys Asp Gly Leu Trp Ala His Leu Glu Val Leu 405 410 415Glu Trp Cys Ile Gln Gln Ser Ser Asn Pro Ile Pro Lys Arg Asp Leu 420 425 430Leu Tyr His Leu His Gly Gly Asp Ser His Ser Val Leu Tyr Thr Leu 435 440 445His His Leu Thr Asn Leu Pro Ala Leu Arg Glu Glu Asp Val Leu Lys 450 455 460Leu Leu Gln Lys Val Pro Ala Lys Asp Pro Gln Gln Glu Pro Asp Ala465 470 475 480Val Asp Ala Pro Val Pro Glu His Leu Ser Gln Cys Gln Asn Leu Thr 485 490 495Leu Tyr Gln Gly Phe Cys Ala Met Lys Tyr Ala Ile Tyr Ala Leu Cys 500 505 510Val Asn Ser His Gln His Ser Gln Cys Gln Asp Cys Lys Asp Ser Leu 515 520 525Ser Glu Asp Leu Ala Ser Ala Thr Glu Pro Ala Asn Asp Ser Leu Ser 530 535 540Ser Pro Gly Ala Ala Asn Leu Phe Ser Thr Tyr Leu Ala Arg Cys Gln545 550 555 560Gln Tyr Leu Cys Ser Ile Pro Asp Ser Leu Cys Leu Glu Leu Leu Glu 565 570 575Asn Ile Phe Ser Leu Leu Leu Ile Thr Ser Ala Asp Leu His Pro Glu 580 585 590Pro His Leu Pro Glu Asp Tyr Ala Glu Asp Asp Asp Ile Glu Gly Lys 595 600 605Ser Pro Ser Gly Leu Arg Ser Pro Ser Glu Ser Pro Gln His Ile Ala 610 615 620His Pro Glu Arg Lys Ser Glu Arg Gly Ser Leu Gly Val Pro Lys Thr625 630 635 640Leu Ala Tyr Thr Met Pro Ser His Val Lys Ala Glu Pro Lys Asp Ser 645 650 655Tyr Pro Gly Pro His Arg His Ser Phe Leu Asp Leu Lys His Phe Thr 660 665 670Ser Gly Ile Ser Gly Phe Leu Ala Asp Glu Phe Ala Ile Gly Ala Phe 675 680 685Leu Arg Leu Leu Gln Glu Gln Leu Asp Glu Ile Ser Ser Arg Ser Pro 690 695 700Pro Glu Lys Pro Lys Gln Glu Ser Gln Ser Cys Ser Gly Ser Arg Asp705 710 715 720Gly Leu Gln Ser Arg Leu His Arg Leu Ser Lys Val Val Ser Glu Ala 725 730 735Gln Trp Arg His Lys Val Val Thr Ser Asn His Arg Ser Glu Glu Gln 740 745 750Pro Ser Arg Arg Tyr Gln Pro Ala Thr Arg His Pro Ser Leu Arg Arg 755 760 765Gly Arg Arg Thr Arg Arg Ser Gln Ala Asp Gly Arg Asp Arg Gly Ser 770 775 780Asn Pro Ser Leu Glu Ser Thr Ser Ser Glu Leu Ser Thr Ser Thr Ser785 790 795 800Glu Gly Ser Leu Ser Ala Met Ser Gly Arg Asn Glu Leu His Ser Arg 805 810 815Leu His Pro His Pro Gln Ser Ser Leu Ile Pro Met Met Phe Ser Pro 820 825 830Pro Glu Ser Leu Leu Ala Ser Cys Ile Leu Arg Gly Asn Phe Ala Glu 835 840 845Ala His Gln Val Leu Phe Thr Phe Asn Leu Lys Ser Ser Pro Ser Ser 850 855 860Gly Glu Leu Met Phe Met Glu Arg Tyr Gln Glu Val Ile Gln Glu Leu865 870 875 880Ala Gln Val Glu His Lys Ile Glu Asn Gln Asn Ser Asp Ala Gly Ser 885 890 895Ser Thr Ile Arg Arg Thr Gly Ser Gly Arg Ser Thr Leu Gln Ala Ile 900 905 910Gly Ser Ala Ala Ala Ala Gly Met Val Phe Tyr Ser Ile Ser Asp Val 915 920 925Thr Asp Lys Leu Leu Asn Thr Ser Gly Asp Pro Ile Pro Met Leu Gln 930 935 940Glu Asp Phe Trp Ile Ser Thr Ala Leu Val Glu Pro Thr Ala Pro Leu945 950 955 960Arg Glu Val Leu Glu Asp Leu Ser Pro Pro Ala Met Ala Ala Phe Asp 965 970 975Leu Ala Cys Ser Gln Cys Gln Leu Trp Lys Thr Cys Lys Gln Leu Leu 980 985 990Glu Thr Ala Glu Arg Arg Leu Asn Ser Ser Leu Glu Arg Arg Gly Arg 995 1000 1005Arg Ile Asp His Val Leu Leu Asn Ala Asp Gly Ile Arg Gly Phe 1010 1015 1020Pro Val Val Leu Gln Gln Ile Ser Lys Ser Leu Asn Tyr Leu Leu 1025 1030 1035Met Ser Ala Ser Gln Thr Lys Ser Glu Ser Val Glu Glu Lys Gly 1040 1045 1050Gly Gly Pro Pro Arg Cys Ser Ile Thr Glu Leu Leu Gln Met Cys 1055 1060 1065Trp Pro Ser Leu Ser Glu Asp Cys Val Ala Ser His Thr Thr Leu 1070 1075 1080Ser Gln Gln Leu Asp Gln Val Leu Gln Ser Leu Arg Glu Ala Leu 1085 1090 1095Glu Leu Pro Glu Pro Arg Thr Pro Pro Leu Ser Ser Leu Val Glu 1100 1105 1110Gln Ala Ala Gln Lys Ala Pro Glu Ala Glu Ala His Pro Val Gln 1115 1120 1125Ile Gln Thr Gln Leu Leu Gln Lys Asn Leu Gly Lys Gln Thr Pro 1130 1135 1140Ser Gly Ser Arg Gln Met Asp Tyr Leu Gly Thr Phe Phe Ser Tyr 1145 1150 1155Cys Ser Thr Leu Ala Ala Val Leu Leu Gln Ser Leu Ser Ser Glu 1160 1165 1170Pro Asp His Val Glu Val Lys Val Gly Asn Pro Phe Val Leu Leu 1175 1180 1185Gln Gln Ser Ser Ser Gln Leu Val Ser His Leu Leu Phe Glu Arg 1190 1195 1200Gln Val Pro Pro Glu Arg Leu Ala Ala Leu Leu Ala Gln Glu Asn 1205 1210 1215Leu Ser Leu Ser Val Pro Gln Val Ile Val Ser Cys Cys Cys Glu 1220 1225 1230Pro Leu Ala Leu Cys Ser Ser Arg Gln Ser Gln Gln Thr Ser Ser 1235 1240 1245Leu Leu Thr Arg Leu Gly Thr Leu Ala Gln Leu His Ala Ser His 1250 1255 1260Cys Leu Asp Asp Leu Pro Leu Ser Thr Pro Ser Ser Pro Arg Thr 1265 1270 1275Thr Glu Asn Pro Thr Leu Glu Arg Lys Pro Tyr Ser Ser Pro Arg 1280 1285 1290Asp Ser Ser Leu Pro Ala Leu Thr Ser Ser Ala Leu Ala Phe Leu 1295 1300 1305Lys Ser Arg Ser Lys Leu Leu Ala Thr Val Ala Cys Leu Gly Ala 1310 1315 1320Ser Pro Arg Leu Lys Val Ser Lys Pro Ser Leu Ser Trp Lys Glu 1325 1330 1335Leu Arg Gly Arg Arg Glu Val Pro Leu Ala Ala Glu Gln Val Ala 1340 1345 1350Arg Glu Cys Glu Arg Leu Leu Glu Gln Phe Pro Leu Phe Glu Ala 1355 1360 1365Phe Leu Leu Ala Ala Trp Glu Pro Leu Arg Gly Ser Leu Gln Gln 1370 1375 1380Gly Gln Ser Leu Ala Val Asn Leu Cys Gly Trp Ala Ser Leu Ser 1385 1390 1395Thr Val Leu Leu Gly Leu His Ser Pro Ile Ala Leu Asp Val Leu 1400 1405 1410Ser Glu Ala Phe Glu Glu Ser Leu Val Ala Arg Asp Trp Ser Arg 1415 1420 1425Ala Leu Gln Leu Thr Glu Val Tyr Gly Arg Asp Val Asp Asp Leu 1430 1435 1440Ser Ser Ile Lys Asp Ala Val Leu Ser Cys Ala Val Ala Cys Asp 1445 1450 1455Lys Glu Gly Trp Gln Tyr Leu Phe Pro Val Lys Asp Ala Ser Leu 1460 1465 1470Arg Ser Arg Leu Ala Leu Gln Phe Val Asp Arg Trp Pro Leu Glu 1475 1480 1485Ser Cys Leu Glu Ile Leu Ala Tyr Cys Ile Ser Asp Thr Ala Val 1490 1495 1500Gln Glu Gly Leu Lys Cys Glu Leu Gln Arg Lys Leu Ala Glu Leu 1505 1510 1515Gln Val Tyr Gln Lys Ile Leu Gly Leu Gln Ser Pro Pro Val Trp 1520 1525 1530Cys Asp Trp Gln Thr Leu Arg Ser Cys Cys Val Glu Asp Pro Ser 1535 1540 1545Thr Val Met Asn Met Ile Leu Glu Ala Gln Glu Tyr Glu Leu Cys 1550 1555 1560Glu Glu Trp Gly Cys Leu Tyr Pro Ile Pro Arg Glu His Leu Ile 1565 1570 1575Ser Leu His Gln Lys His Leu Leu His Leu Leu Glu Arg Arg Asp 1580 1585 1590His Asp Lys Ala Leu Gln Leu Leu Arg Arg Ile Pro Asp Pro Thr 1595

1600 1605Met Cys Leu Glu Val Thr Glu Gln Ser Leu Asp Gln His Thr Ser 1610 1615 1620Leu Ala Thr Ser His Phe Leu Ala Asn Tyr Leu Thr Thr His Phe 1625 1630 1635Tyr Gly Gln Leu Thr Ala Val Arg His Arg Glu Ile Gln Ala Leu 1640 1645 1650Tyr Val Gly Ser Lys Ile Leu Leu Thr Leu Pro Glu Gln His Arg 1655 1660 1665Ala Ser Tyr Ser His Leu Ser Ser Asn Pro Leu Phe Met Leu Glu 1670 1675 1680Gln Leu Leu Met Asn Met Lys Val Asp Trp Ala Thr Val Ala Val 1685 1690 1695Gln Thr Leu Gln Gln Leu Leu Val Gly Gln Glu Ile Gly Phe Thr 1700 1705 1710Met Asp Glu Val Asp Ser Leu Leu Ser Arg Tyr Ala Glu Lys Ala 1715 1720 1725Leu Asp Phe Pro Tyr Pro Gln Arg Glu Lys Arg Ser Asp Ser Val 1730 1735 1740Ile His Leu Gln Glu Ile Val His Gln Ala Ala Asp Pro Glu Thr 1745 1750 1755Leu Pro Arg Ser Pro Ser Ala Glu Phe Ser Pro Ala Ala Pro Pro 1760 1765 1770Gly Ile Ser Ser Ile His Ser Pro Ser Leu Arg Glu Arg Ser Phe 1775 1780 1785Pro Pro Thr Gln Pro Ser Gln Glu Phe Val Pro Pro Ala Thr Pro 1790 1795 1800Pro Ala Arg His Gln Trp Val Pro Asp Glu Thr Glu Ser Ile Cys 1805 1810 1815Met Val Cys Cys Arg Glu His Phe Thr Met Phe Asn Arg Arg His 1820 1825 1830His Cys Arg Arg Cys Gly Arg Leu Val Cys Ser Ser Cys Ser Thr 1835 1840 1845Lys Lys Met Val Val Glu Gly Cys Arg Glu Asn Pro Ala Arg Val 1850 1855 1860Cys Asp Gln Cys Tyr Ser Tyr Cys Asn Lys Asp Val Pro Glu Glu 1865 1870 1875Pro Ser Glu Lys Pro Glu Ala Leu Asp Ser Ser Lys Asn Glu Ser 1880 1885 1890Pro Pro Tyr Ser Phe Val Val Arg Val Pro Lys Ala Asp Glu Val 1895 1900 1905Glu Trp Ile Leu Asp Leu Lys Glu Glu Glu Asn Glu Leu Val Arg 1910 1915 1920Ser Glu Phe Tyr Tyr Glu Gln Ala Pro Ser Ala Ser Leu Cys Ile 1925 1930 1935Ala Ile Leu Asn Leu His Arg Asp Ser Ile Ala Cys Gly His Gln 1940 1945 1950Leu Ile Glu His Cys Cys Arg Leu Ser Lys Gly Leu Thr Asn Pro 1955 1960 1965Glu Val Asp Ala Gly Leu Leu Thr Asp Ile Met Lys Gln Leu Leu 1970 1975 1980Phe Ser Ala Lys Met Met Phe Val Lys Ala Gly Gln Ser Gln Asp 1985 1990 1995Leu Ala Leu Cys Asp Ser Tyr Ile Ser Lys Val Asp Val Leu Asn 2000 2005 2010Ile Leu Val Ala Ala Ala Tyr Arg His Val Pro Ser Leu Asp Gln 2015 2020 2025Ile Leu Gln Pro Ala Ala Val Thr Arg Leu Arg Asn Gln Leu Leu 2030 2035 2040Glu Ala Glu Tyr Tyr Gln Leu Gly Val Glu Val Ser Thr Lys Thr 2045 2050 2055Gly Leu Asp Thr Thr Gly Ala Trp His Ala Trp Gly Met Ala Cys 2060 2065 2070Leu Lys Ala Gly Asn Leu Thr Ala Ala Arg Glu Lys Phe Ser Arg 2075 2080 2085Cys Leu Lys Pro Pro Phe Asp Leu Asn Gln Leu Asn His Gly Ser 2090 2095 2100Arg Leu Val Gln Asp Val Val Glu Tyr Leu Glu Ser Thr Val Arg 2105 2110 2115Pro Phe Val Ser Leu Gln Asp Asp Asp Tyr Phe Ala Thr Leu Arg 2120 2125 2130Glu Leu Glu Ala Thr Leu Arg Thr Gln Ser Leu Ser Leu Ala Val 2135 2140 2145Ile Pro Glu Gly Lys Ile Met Asn Asn Thr Tyr Tyr Gln Glu Cys 2150 2155 2160Leu Phe Tyr Leu His Asn Tyr Ser Thr Asn Leu Ala Ile Ile Ser 2165 2170 2175Phe Tyr Val Arg His Ser Cys Leu Arg Glu Ala Leu Leu His Leu 2180 2185 2190Leu Asn Lys Glu Ser Pro Pro Glu Val Phe Ile Glu Gly Ile Phe 2195 2200 2205Gln Pro Ser Tyr Lys Ser Gly Lys Leu His Thr Leu Glu Asn Leu 2210 2215 2220Leu Glu Ser Ile Asp Pro Thr Leu Glu Ser Trp Gly Lys Tyr Leu 2225 2230 2235Ile Ala Ala Cys Gln His Leu Gln Lys Lys Asn Tyr Tyr His Ile 2240 2245 2250Leu Tyr Glu Leu Gln Gln Phe Met Lys Asp Gln Val Arg Ala Ala 2255 2260 2265Met Thr Cys Ile Arg Phe Phe Ser His Lys Ala Lys Ser Tyr Thr 2270 2275 2280Glu Leu Gly Glu Lys Leu Ser Trp Leu Leu Lys Ala Lys Asp His 2285 2290 2295Leu Lys Ile Tyr Leu Gln Glu Thr Ser Arg Ser Ser Gly Arg Lys 2300 2305 2310Lys Thr Thr Phe Phe Arg Lys Lys Met Thr Ala Ala Asp Val Ser 2315 2320 2325Arg Ser Cys Trp Glu Gly Lys Met Xaa 2330 2335

Claims

1. An ex vivo method of diagnosing or predicting a hereditary spastic, paraplegias (HSP) in a subject, which method comprises detecting a mutation in the ZFYVE26 gene or protein (spastizin) in a sample obtained from said subject, wherein said mutation is indicative of a hereditary spastic paraplegias (HSP).

2. The method according to claim 1, wherein said method comprises the steps consisting of detecting a ZFYVE26 mutation in a nucleic acid sample obtained from the subject wherein the presence of a mutation is indicative of a hereditary spastic paraplegia (HSP).

3. The method according to claim 1, wherein said ZFYVE26 mutation is: a substitution selected from the group consisting of c.307G>T, c.427G>T, c.1240G>T, c.1477C>T, c.2182C>T, c.4312C>T, c.5422C>T, c.5791-6G>A/r.5791.sub.--5792ins5791-4.sub.--5791-1, c.5485-1G>A, c.7128+2T>A/r.6987.sub.--7128del, and c.6011G>C, a deletion selected from the group c.2049delT, c.4068.sub.--4069delTG, c.5036delT, c.6702.sub.--6771del, an insertion selected from the group consisting of c.2331.sub.--2332insA, c.6296.sub.--6297insT, a complex rearrangement which is g.67316025.sub.--67319414del/g.67316025.sub.--67316026insTCTA/g.67319319.- sub.--673194 14inv.

4. The method according to claim 1, which comprises the steps consisting of detecting a mutation in the ZFYVE26 protein (spastizin) or detecting a truncated form of the ZFYVE26 protein contained in a sample obtained from the subject, wherein the presence of a mutation in the ZFYVE26 protein or a truncated form of the ZFYVE26 protein is indicative of a hereditary spastic paraplegias (HSP).

5. The method according to claim 4, wherein in step (b) a monoclonal or polyclonal antibody recognizing the wild-type ZFYVE26 protein is used to detect the presence of the wild-type protein one of its truncated forms.

6. The method according to claim 4, wherein in step (b) the truncated ZFYVE26 protein is selected from the group consisting of SEQ ID NO: 105 to SEQ ID NO:117.

7. An isolated nucleic acid specifically hybridizable a region of ZFYVE26 gene sequence that contains a mutation which is: a substitution selected from the group consisting of c.427G>T, c.1240G>T, c.1477C>T, c.2182C>T, c.4312C>T, c.5422C>T, c.5791-6G>A, c.5485-1G>A, c.7128+2T>A, and c.6011G>C, a deletion selected from the group consisting of c.2049delT, c.4068.sub.--4069delTG, c.5036delT, c.6702.sub.--6771del, an insertion selected from the group consisting of c.2331.sub.--2332insA, or c.6296.sub.--6297insT a complex rearrangement which is g.67316025.sub.--67319414del/g.67316025.sub.--67316026insTCTA/g.- 67319319.sub.--673194 14inv.

8. The use of an isolated nucleic acid according to claim 7 for the detection of a mutation in the ZFYVE26 gene sequence.

9. The use of an isolated nucleic acid according to claim 7 as a primer or probe.

10. An isolated nucleic acid, which comprises or consists in a ZFYVE26 gene sequence that contains one or several mutation(s) selected from the group consisting of: the substitutions: c.427G>T, c.1240G>T, c.1477C>T, c.2182C>T, c.4312C>T, c.5422C>T, c.5791-6G>A, c.5485-1G>A, c.7128+2T>A, c.6011G>C, the deletions: c.2049delT, c.4068.sub.--4069delTG, c.5036delT, c.6702.sub.--6771del, the insertions: c.2331.sub.--2332insA, c.6296.sub.--6297insT, the complex rearrangements: g.67316025.sub.--67319414del/g.67316025.sub.--67316026insTCTA/g.67319319.- sub.--673194 14inv.

11. An isolated polypeptide which comprises the amino acid sequence of ZFYVE26 containing one or several mutation(s) selected from the group consisting of p.E103X, p.E143X, p.E414X, p.Q493X, p.F683LfsX685, p.R728X, p.D778RfsX15793, p.R1209fsX1220, p.C1356fsX1356, p.R1438X, p.L1679RfsX1687, p.Q1808X, p.A1931PfxX1957X, p.S2004T, p.L2099LfsX2111, p.W2234CfsX2238, p.R2329RfsX2337.

12. An isolated monoclonal or polyclonal antibody that specifically recognizes a ZFYVE26 protein containing a mutation selected from the group consisting of p.E103X, p.E143X, p.E414X, p.Q493X, p.F683LfsX685, p.R728X, p.D778RfsX793, p.R1209fsX1220, p.C1356fsX1356, p.R1438X, p.L1679RfsX1687, p.Q1808X, p.A1931PfxX1957X, p.S2004T, p.L2099LfsX2111, p.W2234CfsX2238, p.R2329RfsX2337.

13. The isolated nucleic acid of claim 7 further comprising at least a second mutation which is a c.307G>T substitution.

14. The isolated nucleic acid of claim 10 further comprising at least a second mutation which is a c.307G>T substitution.

15. The method according to claim 2, wherein said ZFYVE26 mutation is: a substitution selected from the group consisting of c.307G>T, c.427G>T, c.1240G>T, c.1477C>T, c.2182C>T, c.4312C>T, c.5422C>T, c.5791-6G>A/r.5791.sub.--5792ins5791-4.sub.--5791-1, c.5485-1G>A, c.7128+2T>A/r.6987.sub.--7128del, and c.6011G>C, a deletion selected from the group c.2049delT, c.4068.sub.--4069delTG, c.5036delT, c.6702.sub.--6771del, an insertion selected from the group consisting of c.2331.sub.--2332insA, c.6296.sub.--6297insT, a complex rearrangement which is g.67316025.sub.--67319414del/g.67316025.sub.--67316026insTCTA/g.67319319.- sub.--673194 14inv.