U.S. patent application number 12/526296 was filed with the patent office on 2011-05-12 for nrf2 screening assays and related methods and compositions.
Invention is credited to Matvey E Lukashev.
Application Number | 20110112196 12/526296 |
Document ID | / |
Family ID | 39682314 |
Filed Date | 2011-05-12 |
United States Patent
Application |
20110112196 |
Kind Code |
A1 |
Lukashev; Matvey E |
May 12, 2011 |
NRF2 SCREENING ASSAYS AND RELATED METHODS AND COMPOSITIONS
Abstract
Provided are certain methods of screening, identifying, and
evaluating neuroprotective compounds useful for treatment of
neurological diseases, such as, e.g., multiple sclerosis (MS). The
compounds described upregulate the cellular cytoprotective pathway
regulated by Nrf2. Also provided are certain methods of utilizing
such compounds in therapy for neurological disease, particularly,
for slowing or reducing demyelination, axonal loss, or neuronal and
oligodendrocyte death.
Inventors: |
Lukashev; Matvey E;
(Tewksbury, MA) |
Family ID: |
39682314 |
Appl. No.: |
12/526296 |
Filed: |
February 7, 2008 |
PCT Filed: |
February 7, 2008 |
PCT NO: |
PCT/US2008/001602 |
371 Date: |
January 13, 2011 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60888921 |
Feb 8, 2007 |
|
|
|
Current U.S.
Class: |
514/574 ;
435/29 |
Current CPC
Class: |
A61K 31/436 20130101;
A61K 31/4704 20130101; A61K 31/194 20130101; A61K 31/7076 20130101;
G01N 33/502 20130101; A61P 25/00 20180101; A61K 31/137 20130101;
A61K 9/0065 20130101; A61K 45/06 20130101; G01N 2333/90209
20130101; A61K 31/225 20130101; A61K 31/277 20130101; A61K 38/217
20130101; G01N 2800/285 20130101; A61K 9/4891 20130101; A61K 9/28
20130101; A61K 31/197 20130101; G01N 33/5041 20130101; A61P 25/28
20180101; A61K 2300/00 20130101; A61K 31/194 20130101; A61K 2300/00
20130101 |
Class at
Publication: |
514/574 ; 435/29;
435/6 |
International
Class: |
A61K 31/194 20060101
A61K031/194; C12Q 1/02 20060101 C12Q001/02; C12Q 1/68 20060101
C12Q001/68; A61P 25/00 20060101 A61P025/00 |
Claims
1. A method of evaluating neuroprotective properties of at least
one test compound, the method comprising: a) contacting a cell with
the at least one test compound, b) determining whether the Nrf2
pathway is upregulated in the cell, c) determining whether the at
least one test compound slows or prevents at least one of
demyelination, axonal loss, and neuronal death, and d) selecting
the test compound as a candidate for treating neurodegeneration in
a neurological disease if 1) the Nrf2 pathway is upregulated and,
optionally, e) further determining whether at least one of
demyelination, axonal loss, and neuronal death are prevented or
slowed by the compound.
2. The method of claim 1, wherein the neurological disease is a
demyelinating disease.
3. The method of claim 2, wherein the demyelinating disease is
multiple sclerosis.
4. The method of claim 1, wherein the cell in step a) is contacted
with a plurality of test compounds.
5. The method of claim 1, wherein the Nrf2 pathway upregulation is
determined by the levels of expression or activity of NQO1.
6. The method of claim 1, wherein the Nrf2 pathway is upregulated
by at least 30% as indicated by one or more of the following
parameters: i) expression levels of at least one of endogenously
produced and exogenously introduced Nrf2; ii) at least one of
subcellular localization and nuclear translocation of Nrf2; iii)
the expression level of at least one gene under control of Nrf2;
iv) the level of Nrf2 binding to the Nrf2-binding DNA element ARE;
v) the stability of Nrf2/Keap1 complexes; and vi) modification
levels of at least one protein selected from Keap1 and other
Nrf2/Keap1-associated proteins.
7. The method of claim 6, wherein the at least one gene under
control of Nrf2 is an Nrf2-regulated reporter gene in an artificial
reporter construct.
8. The method of claim 1, further comprising comparing the level of
Nrf2 pathway upregulation by the at least one test compound with
the level of Nrf2 pathway upregulation by at least one comparator
compound.
9. The method of claim 8, wherein the at least one comparator
compound is selected from dimethyl fumarate and monomethyl
fumarate.
10. The method of claim 1, wherein the at least one test compound
has the structure of Formula I.
11. The method of claim 1, wherein the at least one test compound
is selected from fumaric acid, its salts, and fumaric acid
derivatives.
12. The method of claim 1, wherein the at least one test compound
is chosen from FTY 720, ABT-874, GSK683699, NeuroVax, MLN 1202,
interferon .gamma., Tysabri.TM., Rituxan, TV 5010, NBI-788,
MBP8298, Cladribine, Teriflunomide, Temsirolimus, and
Laquinimod.
13. A method of treating a mammal having a neurological disease,
comprising: a) selecting a test compound according to the method of
any one of claims 1-10, and b) administering the selected test
compound a mammal in need thereof, thereby treating
neurodegeneration in the mammal.
14. A method of treating a mammal having a neurological disease by
combination therapy, the method comprising: a) administering to the
mammal a therapeutically effective amount of at least one first
compound that upregulates the Nrf2 pathway, and b) administering a
therapeutically effective amount of at least one second compound
that does not upregulate the Nrf2 pathway.
15. The method of claim 14, wherein the at least one first compound
is selected from fumaric acid, its salts, and fumaric acid
derivatives.
16. The method of claim 13 or 14, wherein the neurological disease
is a demyelinating disease.
17. The method of claim 16, wherein the demyelinating disease is
multiple sclerosis.
Description
[0001] Provided are certain compounds for treating neurological
diseases, including demyelinating neurological diseases, such as,
e.g., multiple sclerosis.
[0002] Multiple sclerosis (MS) is an autoimmune disease with the
autoimmune activity directed against central nervous system (CNS)
antigens. The disease is characterized by inflammation in parts of
the CNS, leading to the loss of the myelin sheathing around
neuronal axons (demyelination), loss of axons, and the eventual
death of neurons, oligodenrocytes and glial cells.
[0003] An estimated 2,500,000 people in the world suffer from MS.
It is one of the most common diseases of the CNS in young adults.
MS is a chronic, progressing, disabling disease, which generally
strikes its victims some time after adolescence, with diagnosis
generally made between 20 and 40 years of age, although onset may
occur earlier. The disease is not directly hereditary, although
genetic susceptibility plays a part in its development.
Relapsing-remitting MS presents in the form of recurrent attacks of
focal or multifocal neurologic dysfunction. Attacks may occur,
remit, and recur, seemingly randomly over many years. Remission is
often incomplete and as one attack follows another, a stepwise
downward progression ensues with increasing permanent neurological
deficit.
[0004] Although various immunotherapeutic drugs can provide relief
in patients with MS, none is capable of reversing disease
progression, and some can cause serious adverse effects. Most
current therapies for MS are aimed at the reduction of inflammation
and suppression or modulation of the immune system. As of 2006, the
available treatments for MS reduce inflammation and the number of
new episodes but not all have an effect on disease progression. A
number of clinical trials have shown that the suppression of
inflammation in chronic MS rarely significantly limits the
accumulation of disability through sustained disease progression,
suggesting that neuronal damage and inflammation are independent
pathologies. Promoting CNS remyelination as a repair mechanism and
otherwise preventing axonal loss and neuronal death are some of the
important goals for the treatment of MS. For a comprehensive review
of MS and its current therapies, see, e.g., McAlpine's Multiple
Sclerosis, by Alastair Compston et al., 4th edition, Churchill
Livingstone Elsevier, 2006.
[0005] "Phase 2 enzymes" serve as a protection mechanism in
mammalian cells against oxygen/nitrogen species (ROS/RNS),
electrophiles and xenobiotics. These enzymes are not normally
expressed at their maximal levels and, their expression can be
induced by a variety of natural and synthetic agents. Nuclear
factor E2-related factor 2 (Nrf2) is a transcription factor
responsible for the induction of a variety of important antioxidant
and detoxification enzymes that coordinate a protective cellular
response to metabolic and toxic stress.
[0006] ROS/RNS are most damaging in the brain and neuronal tissue,
where they attack post-mitotic (i.e., non-dividing) cells such as
glial cells, oligodendocytes, and neurons, which are particularly
sensitive to free radicals. This process leads to neuronal damage.
Oxidative stress has been implicated in the pathogenesis of a
variety of neurodegenerative diseases, including ALS, Alzheimer's
disease (AD), and Parkinson's disease (PD). For review, see, e.g.,
van Muiswinkel et al., Curr. Drug Targets CNS--Neurol. Disord.,
2005, 4:267-281. An anti-oxidative enzyme under control of Nrf2,
NQO1 (NAD(P)H dehydrogenase, quinone (1), was recently reported to
be substantially upregulated in the brain tissues of AD and PD
subjects (Muiswinkel et al., Neurobiol. Aging, 2004, 25: 1253).
Similarly, increased expression of NQO1 was reported in the ALS
subjects' spinal cord (Muiswinkel et al., Curr. Drug Targets--CNS.
Neurol. Disord., 2005, 4:267-281) and in active and chronic lesions
in the brains of patients suffering from MS (van Horssen et al.,
Free Radical Biol. & Med., 2006, 41 311-311). These
observations indicate that the Nrf2 pathway may be activated in
neurodegenerative and neuroinflammatory diseases as an endogenous
protective mechanism. Indeed, most recently, it has been reported
that induced activation of Nrf2-dependent genes by certain
cyclopenanone-based compounds (NEPP) counters the toxic effects of
metabolic inhibition and ROS/RNS production in the brain and
protects neurons from death in vitro and in vivo (see Satoh et al.,
PNAS, 2006, 103(3):768-773).
[0007] Additionally, many publications have reported
neuroprotective effects of compounds in natural plant-derived
compounds ("phytochemicals"), including a-tocopherol (vitamin E),
lycopene (tomatoes), resveratrol (red grapes), sulforaphane
(broccoli), EGCG (green tea), etc. For review, see Mattson and
Cheng, Trends in Neurosci., 2006, 29(11):632-639. Originally, the
action of these compounds was attributed to their anti-oxidant
properties. However, while most anti-oxidants are effective only at
high concentrations, at least some of these compounds appear to
exert neuroprotective effects at much lower doses. Emerging
evidence suggests that these compounds may exert their
neuroprotective effects by activating cellular stress-response
pathways, including the Nrf2 pathway, resulting in the upregulation
of neuroprotective genes. However, the exact mechanism of action of
these compounds remains poorly understood.
[0008] To date, more than 10 different chemical classes of inducers
of Nrf2 pathway have been identified including isothiocyanates and
their thiol addition products, dithiocarbamates, as well as
1,2-dithiole-3-thiones, trivalent arsenic derivatives (e.g., phenyl
arsenoxide), heavy metals, certain conjugated cyclic and acyclic
polyenes (including porphyrins, chlorophyllins, and chlorophyll),
and vicinal dimercaptans. These inducers have few structural
similarities. They are mostly electrophiles, and all can react
chemically with thiol groups by alkylation, oxidation, or
reduction, suggesting that the intracellular sensor for inducers is
likely to contain very highly reactive (cysteine) thiols. The
inducers can modify thiol groups by a variety of mechanisms
including: alkylation (Michael addition acceptors, isothiocyanates,
quinones); oxidation (e.g., peroxides and hydroperoxides); and
direct reaction with thiol/disulfide linkages (e.g., vicinal
dithiols such as 1,2-dimercaptopropanol, lipoic acid). These
diverse response mechanisms provide plasticity for cellular
responses to a variety of electrophilic and oxidant stressors.
[0009] Provided are methods that comprise at least one of the
following methods: [0010] 1) methods of screening for at least one
new candidate compound for treating a neurological disease; [0011]
2) methods of evaluating neuroprotective properties of at least one
drug candidate for treating a neurological disease; [0012] 3)
methods of comparing (e.g., for bioequivalence) at least two
pharmaceutical compositions which comprise fumaric acid
derivatives; [0013] 4) methods of treating a neurological disease
by administering to the subject in need thereof at least one
compound that is partially structurally similar to DMF or MMF; and
[0014] 5) methods of treating a neurological disease by a
combination therapy that comprises administration of at least one
first compound that upregulates the Nrf2 pathway and at least one
second compound that does not upregulate the Nrf2 pathway.
[0015] In some embodiments, the neurological disease is a
neurodegenerative disease such as, for example, ALS, Parkinson's
disease, Alzheimer's disease, and Huntington's disease. In some
embodiments the neurological disease is MS or another demyelinating
neurological disease.
[0016] In some embodiments, the methods 1-3 further comprise:
[0017] a) contacting a cell with the test compound, and [0018] b)
determining whether the Nrf2 pathway is upregulated in the cell. In
some embodiments, the methods may further comprise: [0019] c)
determining whether the test compound slows or prevents
demyelination, axonal loss, and/or neuronal death, and/or [0020] d)
selecting the test compound as a candidate for treating
neurodegeneration in a neurological disease if 1) the Nrf2 pathway
is upregulated and 2) demyelination, axonal loss, and/or neuronal
death are/is prevented or slowed.
[0021] In some embodiments, the methods 1-3 comprise contacting a
cell with at least one test compound and determining whether the
Nrf2 pathway is upregulated in the cell. In such methods, an
upregulation of the Nrf2 pathway above a threshold (e.g., by at
least 30% over a control) indicates that the at least one compound
has at least one biological property beneficial in treating a
neurological disease (e.g., neuroprotective properties). In some
embodiments, the upregulation of the Nrf2 pathway is assessed (in
vivo and/or in vitro) by at least one of the following: [0022] i)
expression levels of endogenously produced and/or exogenously
introduced Nrf2; [0023] ii) subcellular localization and/or nuclear
translocation of Nrf2; [0024] iii) expression levels and/or
activity of one or more genes under control of Nrf2 (e.g.,
endogenous NQO1) or an Nrf2-regulated reporter gene in an
artificial reporter construct; [0025] iv) levels of Nrf2 binding to
the Nrf2-binding DNA element ARE; [0026] v) stability of Nrf2/Keap1
complexes; and [0027] vi) modification (e.g., alkylation) levels of
Keap1 and/or at least one other Nrf2/Keap1-associated proteins.
[0028] In some embodiments of methods 1-3, the compounds that are
being screened, evaluated, or compared comprise at least one member
of at least one of the following classes of compounds: mild
alkylating agents, Michael addition acceptors, and compounds that
are metabolized upon administration to Michael addition acceptors.
In some embodiments, the Michael addition acceptor has the
structure of Formula I, II, Ill, or IV set forth below.
[0029] In some embodiments method 1 comprises: [0030] a) contacting
a cell with a plurality of test compounds, [0031] b) determining
whether the Nrf2 pathway is upregulated in the cell, and [0032] c)
selecting from the plurality of compounds at least one compound
that upregulates the Nrf2 pathway, wherein an upregulation of the
Nrf2 pathway by the selected at least one compound indicates that
the selected at least one compound may be useful for treating a
neurological disease. The plurality of compounds may be
represented, e.g., by a combinatorial chemical library, and the
method may be performed, e.g., by high-throughput screening.
[0033] In some embodiments method 2 comprises: [0034] a) contacting
a cell with the at least one drug or drug candidate, and [0035] b)
determining whether the Nrf2 pathway is upregulated in the cell,
wherein an upregulation of the Nrf2 pathway by the at least one
drug or drug candidate indicates that the at least one drug or drug
candidate is useful for neuroprotection in treating a human having
a neurological disease.
[0036] In some embodiments method 3 comprises: [0037] a) contacting
a cell with a first composition comprising at least one test
compound, and [0038] b) comparing the level of Nrf2 pathway
upregulation in the cell by the at least one test compound to the
corresponding level of the Nrf2 pathway upregulation in a control
cell treated with a second composition comprising at least one of
DMF and MMF.
[0039] In some embodiments of method 3, the test compound is
fumaric acid, a salt thereof, or a fumaric acid derivative. In some
embodiments, the first composition comprises DMF, MMF, or both. In
some embodiments, the dose and/or the formulation of the first
composition differs from the dose and/or the formulation of the
second composition.
[0040] In some embodiments, method 3 further comprises: [0041] c)
comparing at least one pharmacokinetic parameter (e.g.,
serum-half-life) of the first and the second compositions.
[0042] In some embodiments method 4 comprises administering to the
mammal a therapeutically effective amount of at least one
neuroprotective compound having Formula I, II, III, or IV, e.g., a
fumaric acid derivative (e.g., DMF or MMF).
[0043] In some embodiments method 4 provides a method of slowing or
preventing neurodegeneration in a patient in need thereof, by
administering the compound in an amount and for a period of time
sufficient to slow or prevent demyelination, axonal loss, and/or
neuronal death, e.g., by at least 30% relative to a control.
[0044] In some embodiments method 5 comprises: [0045] a)
administering to the mammal a therapeutically effective amount of
at least one first compound that upregulates the Nrf2 pathway, and
[0046] b) administering a therapeutically effective amount of at
least one second compound that does not upregulate the Nrf2
pathway.
[0047] In some embodiments of method 5, the at least one first
compound, used in step (a), is a compound of Formula I, II, III, or
IV, e.g., a fumaric acid derivative (e.g., DMF or MMF); and the at
least one second compound, which is used in step (b), is an
immunosuppressive or an immunomodulatory compound that does not
upregulate the Nrf2 pathway (e.g., by more than 30% over a
control).
[0048] In some embodiments method 5 comprises administering to the
mammal a therapeutically effective amount of a compound of Formula
I, II, III, or IV.
[0049] In some embodiments of methods 1-5, the at least onecompound
being screened, identified, evaluated, or used for treating a
neurological disorder is not fumaric acid or its salt, or a fumaric
acid derivative (e.g., DMF or MMF).
[0050] Other features and embodiments of the invention will be
apparent from the following description and the claims.
BRIEF DESCRIPTION OF THE FIGURES
[0051] FIG. 1 demonstrates that DMF and MMF are activators of Nrf2
at concentrations within clinical exposure range (cells in
culture).
[0052] FIG. 2 shows results of RNAi experiments.
[0053] FIG. 3 shows evidence of Nrf2 activation by DMF and MMF In
vivo.
[0054] FIG. 4 shows evidence of Nrf2 activation by DMF and MMF In
vivo.
[0055] Fumaric acid esters, such as DMF, have been proposed for
treatment of MS (see, e.g., Schimrigk et al., Eur. J. Neurol.,
2006, 13(6):604-10; Drugs R&D, 2005, 6(4):229-30).
[0056] Provided are, among other things, means for identifying
compounds with a new therapeutic modality useful in at least one of
multiple neurological indications and, optionally, complementary to
other drugs for the treatment of a neurological disease, including
a number of currently used immunomodulators.
[0057] DMF is a member of a large group of anti-oxidant molecules
known for their cytoprotective and anti-inflammatory properties.
These molecules also share the property of the Nrf2 pathway
activation. Thus, the finding that DMF activates the Nrf2 pathway
in conjunction with the neuroprotective effects of DMF further
offers a rationale for identification of structurally and/or
mechanistically related molecules that would be expected to be
therapeutically effective for the treatment of neurological
disorders, such as, e.g., MS.
[0058] Certain terms are defined in this section; additional
definitions are provided throughout the description.
[0059] The terms "activation" and "upregulation," when used in
reference to the Nrf2 pathway, are used interchangeably herein.
[0060] The terms "disease" and "disorder" are used interchangeably
herein.
[0061] The term "a drug for treating a neurological disease" refers
to a compound that has a therapeutic benefit in a specified
neurological disease as shown in at least one animal model of a
neurological disease or in human clinical trials for the treatment
of a neurological disease.
[0062] The term "neuroprotection" and its cognates refer to
prevention or a slowing in neuronal degeneration, including, for
example, demyelination and/or axonal loss, and/or, neuronal and/or
oligodendrocyte death. Neuroprotection may occur through several
mechanisms, e.g., through reducing inflammation, providing
neurotrophic factors, scavenging free radicals, etc. As used
herein, a compound is considered neuroprotective if it (1)
upregulates the Nrf2 pathway above a certain threshold and (2)
provides neuroprotection, regardless of possible other mechanisms
of action.
[0063] The terms "treatment," "therapeutic method," "therapeutic
benefits," and the like refer to therapeutic as well as
prophylactic/preventative measures. Thus, those in need of
treatment may include individuals already having a specified
disease and those who are at risk for acquiring that disease.
[0064] The terms "therapeutically effective dose" and
"therapeutically effective amount" refer to that amount of a
compound which results in at least one of prevention or delay of
onset or amelioration of symptoms of a neurological disorder in a
subject or an attainment of a desired biological outcome, such as
reduced neurodegeneration (e.g., demyelination, axonal loss, and
neuronal death) or reduced inflammation of the cells of the
CNS.
[0065] In one aspect, provided are methods of evaluating
neuroprotective properties of test compounds, including the
following methods: [0066] 1) methods of screening for new candidate
compounds that may be useful for treating a neurological disease;
[0067] 2) methods of evaluating neuroprotective properties of drugs
and candidates that are used or proposed for treating a
neurological disease; [0068] 3) methods of comparing (e.g., for
bioequivalence) two or more pharmaceutical compositions which
contain fumaric acid derivatives;
[0069] In some embodiments, methods 1-3 may comprise: [0070] a)
contacting a cell with the test compound, [0071] b) determining
whether the Nrf2 pathway is upregulated in the cell, and, in some
embodiments, additionally performing the following step(s): [0072]
c) determining whether the test compound slows or prevents
demyelination, axonal loss, and/or neuronal death, and/or [0073] d)
selecting the test compound as a candidate for treating
neurodegeneration in a neurological disease if 1) the Nrf2 pathway
is upregulated and 2) demyelination, axonal loss, and/or neuronal
death are/is prevented or slowed.
Method 1
[0074] In some embodiments the methods of screening for a candidate
compound for treating a neurological disease comprise: [0075] a)
contacting a cell with a plurality of test compounds, [0076] b)
determining whether the Nrf2 pathway is upregulated in the cell,
and [0077] c) selecting from the plurality of compounds at least
one compound that upregulates the Nrf2 pathway, wherein an
upregulation of the Nrf2 pathway by the selected at least one
compound indicates that the selected at least one compound may be
useful for treating a neurological disease. For example, the
plurality of compounds may be represented by a combinatorial
chemical library, and the screening method may be performed by a
high-throughput screening as described in, e.g., High-Throughput
Screening in Drug Discovery (Methods and Principles in Medicinal
Chemistry), by Jorg Huser (ed.), John Wiley & Sons (2006).
[0078] Combinatorial libraries of compounds are also described in,
e.g., Solid-Supported Combinatorial and Parallel Synthesis of
Small-Molecular-Weight Compound Libraries (Tetrahedron Organic
Chemistry) Ian Salusbury (ed.), Elsevier (1998); Combinatorial
Libraries: Synthesis, Screening and Application Potential (Library
Binding), by Riccardo Cortese (ed.), Walter de Gruyter (1995). The
libraries of compounds may be, for example, quinone libraries and
other libraries as described in Mittoo, Comb. Chem. & High
Throughput Screen, 2006, 9:421-423.
[0079] In some embodiments, the at least one compound or plurality
of compounds being screened and/or selected comprises at least one
compound selected from at least one of the following groups of
compounds: mild alkylating agents, Michael addition acceptors or
compounds that are metabolized to Michael addition acceptors,
including compounds of Formulas I, II, III, or IV.
[0080] In some of the embodiments, the at least one compound is
selected from fumaric acid, its salts, and fumaric acid
derivatives.
Method 2
[0081] Also provided are methods of evaluating neuroprotective
properties of at least one drug or drug candidate for treating at
least one neurological disease. Such methods comprise: [0082] a)
contacting a cell with the at least one drug or drug candidate, and
[0083] b) determining whether the Nrf2 pathway is upregulated in
the cell, wherein the upregulation of the Nrf2 pathway by the at
least one drug or drug candidate indicates that the at least one
drug or drug candidate is neuroprotective in treating a human
having a neurological disease.
[0084] In some embodiments, the upregulation of the Nrf2 pathway by
the at least one drug or drug candidate indicates that the at least
one drug or drug candidate has at least one activity selected from
slowing demyelination, slowing the loss of axons, and slowing the
rate of neuronal death.
[0085] In some embodiments, the method of evaluating at least one
drug or drug candidate comprises an additional step: [0086] c)
evaluating demyelination, loss of axons, and/or neuronal death.
[0087] In some embodiments, steps a) and c) are performed in vivo
in at least one model of a neurological disease, e.g., as described
below.
[0088] In other embodiments, particularly those in which the
neurological disease is multiple sclerosis or another demyelinating
disease, the evaluated at least one drug or drug candidate for a
neurological disease is chosen from the following: FTY720
(2-(4-octylphenethyl)-2-aminopropane-1,3-diol; Novartis); anti-IL12
antibody (e.g., ABT-874; Abbott Laboratories); GSK683699
(GSK/Tanabe); NeuroVax (Immune Response Corp.; Darlington, Curr.
Opin. Mol. Ther., 2005, 7(6):598-603); anti-CCR2 antibody (e.g.,
MLN 1202; Millennium); interferon .beta.-1a (e.g., Avonex.RTM.;
Biogen Idec); anti-.alpha.4-integrin antibody (e.g., Tysabri.RTM.;
Biogen Idec/Elan); anti-CD20 antibody (e.g., Rituxan.RTM. (Biogen
Idec/Genentech); TV 5010 (Teva); NBI-788 (Neurocrine); MBP8298
(BioMS (see Warren et al., Eur. J. Neurol., 2006, 13(8):887-95);
Mylinax (Oral Cladribine; 2-chlorodeoxyadenosine; Serono/IVAX);
Teriflunomide
((Z)-2-cyano-N-(4-(trifluoromethyl)phenyl)-3-hydroxybut-2-enamide;
Sanofi-Aventis); Temsirolimus (Wyeth); Laquinimod
(5-chloro-N-ethyl-1,2-dihydro-4-hydroxy-1-methyl-2-oxo-N-phenylquinoline--
3-carboxamide; Active Biotech/Teva); and interferon tau (Tauferon;
Pepgen).
[0089] In some embodiments, the at least one drug or drug candidate
being evaluated is at least one compound selected from at least one
class selected from a mild alkylating agent, a Michael addition
acceptor, and a compound that is metabolized to a Michael addition
acceptor, including compounds of Formulas I, II, III, or IV.
[0090] In some of the embodiments, the compound is fumaric acid,
its salt, or a fumaric acid derivative.
Method 3
[0091] Also provided are methods of comparing (e.g., for
bioequivalence) at least two pharmaceutical compositions. Such
methods comprise: [0092] a) contacting a cell with at least one
first composition comprising a test compound, and [0093] b)
comparing the level of the Nrf2 pathway upregulation in the cell by
the test compound to the corresponding level of the Nrf2 pathway
upregulation in a cell treated with at least one second composition
("comparator composition") comprising DMF, MMF, or both.
[0094] In some embodiments, substantially dissimilar levels of
upregulation by the at least one first and at least one second
compositions indicate that the compositions are not
bioequivalent.
[0095] In some embodiments, the test compound is fumaric acid, its
salt thereof, a fumaric acid derivative, or mixtures thereof. In
some embodiments, the first composition comprises at least one of
DMF, MMF, and both DMF and MMF. In some embodiments, the dose
and/or the formulation of the at least one first composition
differs from the dose and/or the formulation of the at least one
second composition. The at least one first composition may be a
controlled release composition such as, e.g., compositions
described in WO 2006/037342.
[0096] In some embodiments, the method further comprises and
additional step: [0097] c) comparing at least one pharmacokinetic
parameter of the at least one first and the at least one second
compositions.
[0098] Pharmacokinetic parameters and methods for evaluating the
same are well known and are described in, e.g., Pharmacokinetics,
Second Edition (Drugs and the Pharmaceutical Sciences) by Milo
Gibaldi et al. (eds.), Informa Healthcare (1982). Examples of such
pharmacokinetic parameters that can be evaluated include serum
half-life, clearance, and volume distribution.
[0099] In some embodiments, substantially dissimilar
pharmacokinetic parameter(s) of the a least one first and at least
one second compositions indicate that the compositions are not
bioequivalent.
[0100] In some embodiments, the test compound being evaluated is a
mild alkylating agent, and more specifically, a Michael addition
acceptor, or a compound that is metabolized to a Michael addition
acceptor.
[0101] In some of the embodiments, the test compound is fumaric
acid or its salt, or a fumaric acid derivative.
[0102] Also provided are methods of treating a mammal who has or is
at risk for developing a neurological disease, including the
following methods: [0103] 4) methods of treating a neurological
disease by administering to the subject in need thereof at least
one compound that is partially structurally similar to DMF or MMF
(including compounds selected using methods 1-3 described above);
and [0104] 5) methods of treating a neurological disorder by a
combination therapy that includes administration of a first
compound that does not upregulate the Nrf2 pathway and a second
compound that upregulates the Nrf2 pathway.
Method 4
[0105] Also provided are methods of treating a neurological disease
by administering to the subject in need thereof at least one
compound that is at least partially structurally similar to DMF
and/or MMF.
[0106] In some embodiments of method 4, a method of treating a
mammal who has or is at risk for a neurological disease is
provided. The methods comprises administering to the mammal a
therapeutically effective amount of at least one neuroprotective
compound which has Formula I, II, III, or IV, e.g., a fumaric acid
derivative (e.g., DMF or MMF).
[0107] In some embodiments of method 4, a method of slowing or
preventing neurodegeneration (more specifically, e.g.,
demyelination, axonal loss, and/or neuronal death) in a subject in
need thereof, by administering the at least one compound in an
amount and for a period of time sufficient to do at least one of
slow or prevent demyelination, slow or prevent axonal loss, and
alow or prevent neuronal death, e.g., by at least 30%, 50%, 100% or
higher over a control over a period of at least 5, 10, 12, 20, 40,
52, 100, or 200 weeks, or more.
Method 5
[0108] Also provided are methods of treating a mammal having a
neurological disease by combination therapy. In some embodiments
such methods comprise: [0109] a) administering to the mammal a
therapeutically effective amount of at least one first compound
that upregulates the Nrf2 pathway, and [0110] b) administering a
therapeutically effective amount of at least one second compound
that does not upregulate the Nrf2 pathway.
[0111] In some of embodiments of method 5, the at least one first
compound, used in step (a), is a compound of Formula I, II, III, or
IV, e.g., DMF or MMF; and the at least one second compound, which
is used in step (b), is an immunosuppressive or an immunomodulatory
compound that does not upregulate the Nrf2 pathway (e.g., by more
than 30%, 50%, 100% over a control).
[0112] In some embodiments of method 5, the method comprises
administering to the mammal a therapeutically effective amount of a
compound of Formula I, II, III, or IV.
[0113] In method 5, the at least one first compound and the at
least one second compound may be administered concurrently (as
separate compositions or a mixed composition) or consecutively over
overlapping or non-overlapping intervals. In the sequential
administration, the at least one first compound and the at least
one second compound can be administered in any order. In some
embodiments, the length of an overlapping interval is more than 2,
4, 6, 12, 24, or 48 weeks, for example.
[0114] Michael addition acceptors generally include olefins or
acetylenes conjugated to an electron withdrawing group, such as
carbonyl containing groups, thiocarbonyl containing groups, cyano,
sulfonyl, sulfonamido, amido, formyl, keto, and nitro. Exemplary
carbonyl groups include carboxylic acid esters and carboxylic
acid.
[0115] In some embodiments of methods 1-5, the at least one
compound being screened, identified, evaluated, or used for
treating a neurological disorder is selected from a mild alkylating
agent, a Michael addition acceptor, and a compound that is
metabolized to a Michael addition acceptor.
[0116] In some embodiments, the Michael addition acceptor has the
structure of Formula I:
##STR00001##
or a pharmaceutically acceptable salt thereof, wherein:
[0117] X is O; S; C(R)(C.sub.1-12)alkyl; or
C(R)(C.sub.2-12)alkenyl, wherein R is H, (C.sub.1-12)alkyl or
(C.sub.2-12)alkenyl;
[0118] R.sup.1, R.sup.2, R.sup.3 and R.sup.4 are independently
selected from: H; OH; O.sup.-; CO.sub.2H, CO.sub.2.sup.-; SH;
S.sup.-; SO.sub.2H, SO.sub.2.sup.-; (C.sub.1-24)alkyl;
(C.sub.1-24)alkenyl; (C.sub.6-50)aryl, CO.sub.2(C.sub.1-24)alkyl;
SO.sub.2(C.sub.1-24)alkyl; CO.sub.2(C.sub.1-24)alkenyl;
SO.sub.2(C.sub.1-24)alkenyl, CO.sub.2Y, wherein Y is psoralen-9-yl,
retinyl, alpha-tocopherol, calciferyl, corticostreoid-21-yl or
monosaccarid-.omega.-yl; (C.sub.1-24)alkoxy;
(C.sub.1-24)alkenyloxy; (C.sub.6-50)aryloxy; (C.sub.1-24)alkylthio;
(C.sub.1-24)alkenylthio; (C.sub.6-50)arylthio, amino; amido;
arylalkyl; cyano; nitro; sulfonyl; sulfoxido; sulfonamido; formyl;
keto; and D and L natural or unnatural amino acids; or any two of
X, R.sup.1, R.sup.2 and R.sup.3, and R.sup.4 may be joined together
to form a cyclic moiety; and wherein the alkyl, alkoxy, alkenyl,
alkenyloxy, aryl and aryloxy groups may be optionally substituted
with at least one group chosen from halogen (F, Cl, Br, or I), OH,
(C.sub.1-4)alkoxy, nitro and cyano.
[0119] In some embodiments, the at least one Michael addition
acceptor has the structure of Formula I, with the following
provisos:
[0120] R.sup.1 is selected from: H; OH; O.sup.-; CO.sub.2H,
CO.sub.2.sup.-; SH; S.sup.-; SO.sub.2H, SO.sub.2.sup.-;
(C.sub.1-24)alkyl; (C.sub.1-24)alkenyl; (C.sub.6-50)aryl;
CO.sub.2(C.sub.1-24)alkyl, SO.sub.2(C.sub.1-24)alkyl;
CO.sub.2(C.sub.1-24)alkenyl; SO.sub.2(C.sub.1-24)alkenyl;
CO.sub.2Y, wherein Y is psoralen-9-yl, retinyl, alpha-tocopherol,
calciferyl, corticostreoid-21-yl or monosaccarid-.omega.-yl;
(C.sub.1-24)alkoxy; (C.sub.1-24)alkenyloxy; (C.sub.6-50)aryloxy;
(C.sub.1-24)alkylthio; (C.sub.1-24)alkenylthio;
(C.sub.6-50)arylthio; arylalkyl; amino; amido; cyano; nitro;
sulfonyl, sulfoxido; sulfonamido; formyl, keto; and D or L natural
or unnatural amino acids; and wherein the alkyl, alkoxy, alkenyl,
alkyenyloxy, aryl and aryloxy groups may be optionally substituted
with at least one group chosen from halogen (F, Cl, Br, or I), OH,
(C.sub.1-4)alkoxy, nitro and cyano;
[0121] R.sup.2 is selected from: H; CO.sub.2H; CO.sub.2.sup.-;
SO.sub.2H; SO.sub.2.sup.-; (C.sub.1-24)alkyl; (C.sub.1-24)alkenyl;
(C.sub.6-50)aryl; CO.sub.2(C.sub.1-24)alkyl;
SO.sub.2(C.sub.1-24)alkyl; CO.sub.2(C.sub.1-24)alkenyl;
SO.sub.2(C.sub.1-24)alkenyl; CO.sub.2Y, wherein Y is psoralen-9-yl,
retinyl, alpha-tocopherol, calciferyl, corticostreoid-21-yl or
monosaccarid-.omega.-yl; (C.sub.1-24)alkoxy;
(C.sub.1-24)alkenyloxy; (C.sub.6-50)aryloxy; (C.sub.1-24)alkylthio;
(C.sub.1-24)alkenylthio; (C.sub.6-50)arylthio, amido; arylalkyl;
cyano; nitro; sulfonyl, sulfoxido, sulfonamido; formyl, keto; and D
or L natural or unnatural amino acids; wherein the alkyl, alkoxy,
alkenyl, alkyenyloxy, aryl and aryloxy groups may be optionally
substituted with at least one group chosen from halogen (F, Cl, Br,
or I), OH, (C.sub.1-4)alkoxy, nitro and cyano; and
[0122] R.sup.3 and R.sup.4 are independently selected from: H;
CO.sub.2H; CO.sub.2.sup.-; SO.sub.2H; SO.sub.2.sup.-;
(C.sub.1-24)alkyl; (C.sub.1-24)alkenyl; (C.sub.6-50)aryl;
CO.sub.2(C.sub.1-24)alkyl; SO.sub.2(C.sub.1-24)alkyl;
CO.sub.2(C.sub.1-24)alkenyl; SO.sub.2(C.sub.1-24)alkenyl;
CO.sub.2Y, wherein Y is psoralen-9-yl, retinyl, alpha-tocopherol,
calciferyl, corticostreoid-21-yl or monosaccarid-.omega.-yl;
(C.sub.1-24)alkoxy; (C.sub.1-24)alkenyloxy; (C.sub.6-50)aryloxy;
(C.sub.1-24)alkylthio; (C.sub.1-24)alkenylthio;
(C.sub.6-50)arylthio; amido; arylalkyl; cyano; nitro; cyano; nitro;
sulfonyl; sulfoxido; sulfonamido; formyl; and keto; wherein the
alkyl, alkoxy, alkenyl, alkyenyloxy, aryl and aryloxy groups may be
optionally substituted with at least one group chosen from halogen
(F, Cl, Br, or I), OH, (C.sub.1-4)alkoxy, nitro and cyano.
[0123] In some embodiments, the at least one Michael addition
acceptor has the structure of Formula II:
##STR00002##
or a pharmaceutically acceptable salt thereof, wherein:
[0124] X is selected from O; S; C(R)(C.sub.1-12)alkyl; and
C(R)(C.sub.2-12)alkenyl, wherein R is selected from H;
(C.sub.1-12)alkyl; and (C.sub.2-12)alkenyl; and R.sup.1, R.sup.2,
R.sup.3, and R.sup.4 are independently selected from: H; OH;
O.sup.-; CO.sub.2H; CO.sub.2.sup.-; (C.sub.1-12)alkyl;
(C.sub.1-12)alkenyl; and CO.sub.2(C.sub.1-.sub.12)alkyl;
[0125] or any two of X, R.sup.1, R.sup.2 and R.sup.3 may be joined
together to form a cyclic moiety.
[0126] In some embodiments of the compounds of Formulae I-IV, the
pharmaceutically acceptable salt is a salt of a metal (M) cation,
wherein M can be an alkali, alkaline earth, or transition metal
such as Li, Na, K, Ca, Zn, Sr, Mg, Fe, or Mn.
[0127] In some embodiments of methods 1-5, the compounds of Formula
I include fumaric acid, its salts, and fumaric acid
derivatives.
[0128] In some embodiments, the at least one compound of Formula I
has the structure of Formula III:
##STR00003##
or a pharmaceutically acceptable salt thereof, wherein:
[0129] R.sup.1 and R.sup.3 are independently selected from OH;
O.sup.-; (C.sub.1-24)alkoxy; (C.sub.1-24)alkenyloxy;
(C.sub.6-50)aryloxy; psoralen-9-yloxy; retinyloxy;
alpha-tocopheroloxy; calciferyloxy; corticostreoid-21-yloxy;
monosaccarid-.omega.-yloxy; amino; and a D or L natural or
unnatural amino acid; and wherein at least one of the the
(C.sub.1-24)alkoxy; (C.sub.1-24)alkenyloxy; and (C.sub.6-50)aryloxy
groups may be optionally substituted with at least one group chosen
from halogen (F, Cl, Br, or I), OH, (C.sub.1-4)alkoxy, nitro and
cyano.
[0130] Compounds wherein at least one of R.sup.1 and R.sup.3 is
derived from a natural or unnatural D or L amino acid are described
in U.S. application Ser. No. 10/433,295, paragraphs 10 to 11 and
18-28, and Ser. No. 11/421,083, which are incorporated herein by
reference.
[0131] In some embodiments, the compound of formula (I) has the
structure of Formula IV:
##STR00004##
or a pharmaceutically acceptable salt thereof, wherein:
[0132] R.sup.1 and R.sup.3 are independently selected from OH;
O.sup.-; (C.sub.1-24)alkoxy; allyloxy; vinyloxy;
(C.sub.6-50)aryloxy; psoralen-9-yloxy; retinyloxy;
alpha-tocopheroloxy; calciferyloxy; corticostreoid-21-yloxy;
monosaccarid-.omega.-yloxy; amino; and a D or L natural or
unnatural amino acid; and wherein at least one of the the
(C.sub.1-24)alkoxy, allyloxy, vinyloxy, and (C.sub.6-50)aryloxy may
be optionally substituted with at least one group chosen from Cl,
F, I, Br, OH, (C.sub.1-4)alkoxy, nitro, and cyano.
[0133] In some embodiments, the "fumaric acid derivative" is chosen
from the compounds of Formula III, compounds of Formula IV and the
following:
[0134] 1) fumaric acid amides derived from natural and unnatural
amino D or L acids, as described in U.S. patent application Ser.
No. 10/433,295, paragraphs 10 to 11 and 18-28, and Ser. No.
11/421,083.
[0135] 2) a carbocyclic or oxacyclic fumaric acid oligomer as
described in U.S. patent application Ser. No. 10/511,564,
paragraphs 15-44; and
[0136] 3) a glycerol or alkane diol or polyol derivative of fumaric
acid as described in U.S. Pat. Nos. 4,851,439, 5,149,695,
5,451,667, at cols. 2-4.
[0137] In some embodiments, "fumaric acid derivative" is one or
more dialkyl fumarates (e.g., DMF), mono alkyl fumarates (MMF) or
salts thereof.
[0138] In some of the embodiments of methods 1-5, the at least one
compound being screened, evaluated, compared or used for treating a
neurological disorder is not fumaric acid or its salt, or a fumaric
acid derivative (e.g., DMF or MMF).
[0139] Nrf2 (Nuclear Factor-E2-related factor 2; for sequence of
the Nrf2, see Accession No. AAB32188) is a transcription factor
that, upon activation by oxidative stress, binds to the antioxidant
response element (ARE), and activates transcription of
Nrf2-regulated genes. This pathway has been well characterized for
its role in hepatic detoxification and chemoprevention through the
activation of phase II gene expression. ARE-regulated genes may
also contribute to the maintenance of redox homeostasis by serving
as endogenous anti-oxidant systems. At present, the list of
Nfr2-regulated genes contains over 200 genes encoding proteins and
enzymes involved in detoxification and antioxidant response (Kwak
et al., J. Biol. Chem., 2003, 278:8135) such as, e.g., HO-1,
ferritin, glutathione peroxidase, glutathione-S-transferases
(GSTs), NAD(P)H:quinone oxidoreductases, now commonly known as
nicotinamide quinone oxidoreductase 1 (NQO1; EC 1.6.99.2; also
known as DT diaphorase and menadione reductase), NQO2,
g-glutamylcysteine synthase (g-GCS), glucuronosyltransferase,
ferritin, and heme oxygenase-1 (HO-1), as well as any one of the
enzymes proteins listed in Table 1 in Chen & Kunsch, Curr.
Pharm. Designs, 2004, 10:879-891; Lee et al., J. Biol. Chem., 2003,
278(14):12029-38, and Kwak, supra.
[0140] Accordingly, in some embodiments, the at least one
Nrf2-regulated gene which is used to assess the activation of the
Nrf2 pathway is selected from a phase II detoxification enzyme, an
anti-oxidant enzyme, an enzyme of the NADPH generating system, and
Nrf2 itself. Examples of the phase II detoxification enzymes
include NQO1, NQO2, GST-Ya, GST-pi, GST-theta 2, GST-mu (1,2,3),
microsomal GST 3, catalytic y-GCS, regulatory-GCS, microsomal
epoxide hydrolase, UDP-glucuronosyltransferase, transaldolase,
transketolase, and drug-metabolizing enzyme. Examples of the
anti-oxidant enzymes include HO-1, ferritin (L), glutathione
reductase, glutathione peroxidase, metallothionein I, thioredoxin,
thioredoxin reductase, peroxiredoxin MSP23, Cu/Zn superoxide
dismutase, and catalase. Examples of the enzymes of the NADPH
generating system include malic enzyme, UDP-glucose dehydrogenase,
malate oxidoreductase, and glucose-6-phosphate dehydrogenase.
[0141] The antioxidant response element (ARE, also referred to as
the electrophile response element (EpRE), GRE1, ARE4, and StREb) is
a cis-acting DNA regulatory element with a core nucleotide sequence
of 5'-TGA(C/T/G)NNNGC-3' (SEQ ID NO:1) (Rushmore et al., J. Biol.
Chem., 1991, 266(18):11632-9; see also Nioi et al., Mutation Res.,
2004, 555:14-171).
[0142] Accordingly, in some embodiments, the DNA sequence of the
ARE element, to which Nrf2 binds (whether the former is a part of
an endogenous gene or an artificial construct), comprises the core
ARE sequence TGA(C/T/G)NNNGC (SEQ ID NO:2) or the ARE consensus
sequence (G/A)TGA(C/T/G)NNNGC(A/G) (SEQ ID NO:3). In further
specific embodiments, the ARE sequence comprises any one of the
"minimal enhancer" sequences shown in Table 1.
[0143] In some embodiments, the ARE sequence further comprises at
least one of corresponding 5'- and 3'-USR sequences as shown in
Table 1. In some embodiments, the ARE sequence comprises the
sequence GTGANNNNGCA (SEQ ID NO:4), or more particularly, the mouse
(NNNN=gtcg) or human (NNNN=ctca) versions thereof.
TABLE-US-00001 TABLE 1 Minimal Species Gene Element 5'-USR enhancer
3'-USR SEQ ID NO mouse nqo1 ARE agTCAca GTGAgtcgGCA aaattt SEQ ID
NO: 5 rat NQO1 ARE agTCAca GTGACttgGCA aaatct SEQ ID NO: 6 human
NQO1 ARE agTCAca GTGACtcaGCA gaatct SEQ ID NO: 7 mouse gsta1 EpRE
gcTAAtg GTGACaaaGCA actttc SEQ ID NO: 8 rat GSTA2 ARE gcTAAtg
GTGACaaaGCA actttc SEQ ID NO: 9 mouse gsta3 ARE ctcAggc ATGACattGCA
tttttc SEQ ID NO: 10 rat GSTP1 GPE1 agTCAct ATGATtcaGCA acaaaa SEQ
ID NO: 11 human GCLC ARE4 ccTCccc GTGACtcaGCG ctttgt SEQ ID NO: 12
human GCLM EpRE gaagAca ATGACtaaGCA gaaatc SEQ ID NO: 13 mouse ho1
StREb cccAAcc ATGACacaGCA taaaag SEQ ID NO: 14 ARE `core` . . .
TGACnnnGC SEQ ID NO: 15 TAAnn ATGACnnnGCA aaaa SEQ ID NO: 16 ARE
consensus . . . C G T G tttt
[0144] A current model of Nrf2 function is as follows. Under basal
conditions, Nrf2 is sequestered in the cytoplasm to the actin-bound
Kelch-like ECH-associated protein 1 (Keap1; Accession No.
NP.sub.--987096 for human Keap1), a Cullin3 ubiquitin ligase
adaptor protein. More specifically, the N-terminal domain of Nrf2,
known as Neh2 domain, is thought to interact with the C-terminal
Kelch-like domain of Keap1. In response to xenobiotics or oxidative
stress, Nrf2 is released from the Keap1/Nrf2 complex, thereby
promoting nuclear translocation of Nrf2 and concomitant activation
of ARE-mediated gene transcription. Keap1 function, in turn,
requires association with Cullin3, a scaffold protein that
positions Keap1 and its substrate in proximity to the E3 ligase
Rbx1, allowing the substrate (Nrf2) to be polyubiquitinated and
thus targeted for degradation. The exact mechanism of how the
Keap1/Nrf2 complex senses oxidative stress is not fully understood.
Human Keap1 contains 25 cysteine residues that were hypothesized to
function as sensors of oxidative stress; 9 of the cysteines are
thought to be highly reactive (Dinkova-Kostova et al., PNAS, 2005,
102(12):4584-9). It was theorized but is not relied on for the
purposes of this invention that alkylation of cysteins leads to a
conformational change, resulting in the liberation of Nrf2 from
Nrf2/Keap1/Cullin3 complexes, followed by nuclear translocation of
the liberated Nrf2.
[0145] In some embodiments, methods 1-3 described herein comprise
contacting a cell with at least one test compound and determining
whether the Nrf2 pathway is upregulated in the cell. In such
methods, an upregulation of the Nrf2 pathway above a threshold
(e.g., by at least 30%, 50%, 100%, 200%, 500% over a control)
indicates that the at least one compound has certain biological
properties beneficial in treating a neurological disease (e.g.,
neuroprotective properties).
[0146] The ability of a compound to activate the Nrf2 pathway can
be determined by one or more in vitro and in vivo assays,
including, e.g., the following assays described below.
[0147] i) Expression levels of Nrf2--The sequence of the promoter
region of the nrf2 gene (-1065 to -35) has been published, for
example, in Chan et al., PNAS, 1996, 93:13943-13948. One may use an
artificially constructed expression construct containing the Nrf2
promoter element and an artificial reporter gene. Alternatively,
one may use PCR or Northern blotting to determine expression levels
of Nrf2 mRNA, or Western blotting to determine Nrf2 protein levels.
Exemplary procedures for determining expression levels of Nrf2 are
described in Kwak et al., Mol. Cell. Biol. 2002, 22(9):2883-2892
and Kwak et al., Mol. Med., 2001, 7:135-145. Antibodies against
Nrf2 are can be produced by methods known in the art and are
commercially available from, for example, StressGen. Accordingly,
in some embodiments, the Nrf2 pathway is activated so that the
expression levels of Nrf2 are increased by, for example, at least
30%, 50%, 100%, 200%, 500% or more as compared to the non-activated
state.
[0148] ii) Subcellular localization and/or nuclear translocation of
Nrf2--Such assays include cell staining, or analysis of cytoplasmic
versus nuclear cell extracts. For example, a Nrf2-green
fluorescence protein (GFP) fusion protein construct can be made and
introduced into cells and visualized as described in, e.g., Kraft
et al., J. Neurosci., 2004, 24, 1101-1112; and Satoh et al., PNAS,
2006, 103(3):768-773. Accordingly, in some embodiments, the Nrf2
pathway is activated so that the ratio between cytomplasmic and
nuclear Nrf2 is elevated by, for example, at least 30%, 50%, 100%,
200%, 500% or more as compared to the non-activated state.
[0149] iii) Expression levels and/or activity of one or more genes
under the control of Nrf2--Such genes under the control of Nrf2
include endogenous or artificially introduced reporter genes in
reporter constructs introduced into cells. For example, expression
levels of endogenous or exogenously introduced NQO1 may be
determined as described in the Examples. Alternatively, a reporter
gene construct with one or more ARE sites operably linked to a
reporter gene (e.g., luceferase or GFP) can be made, as described
in, e.g., Satoh et al., PNAS, 2006, 103(3):768-773. Expression
levels of an Nrf-2 induced gene product can be measured at the
protein (e.g., by Western blotting or enzymatic activity assays) or
at the mRNA levels (e.g., by PCR). Methods for performing RT-PCT
are described in, e.g., Calabrese et al., J. Neurosci. Res., 2005,
79:509-521 for HO-1, in Wierinckx et al., J. Neuroimmunology, 2005,
166:132-143 for NQO1. Methods for measuring enzymatic activity of
NQO1, using for example, menadione as a substrate, are described in
Dinkova-Kostova et al., PNAS, 2001, 98:3404-09 or by Prochaska et
al., Anal. Biochem., 1988, 169:328-336. Methods for measuring GST
activity, using for example, 1-chloro-2,4-dinitrobenzene as a
substrate, are described in Ramos-Gomez et al., J. Neurosci., 2004,
24(5):1101-1112 and Habig et al., 1974, J. Biol. Chem., 219,
7130-7139. Methods for measuring HO-1 activity are described in,
e.g., in Calabrese et al., 2005, J. Neurosci. Res., 79:509-521.
Accordingly, in some embodiments, the Nrf2 pathway is activated so
that the expression levels and/or activity of the gene produced are
increased by, for example, at least 30%, 50%, 100%, 200%, 500% or
more as compared to the non-activated state.
[0150] iv) Levels of Nrf2 binding to ARE--For example, such assays
may utilize electromobility shift assays (EMSA) and Chromatin
Immununoprecipitation (ChIP) assay, as described in, e.g., Satoh et
al., PNAS, 2006, 103(3):768-773 and Kwak et al., Mol. Cell Biol.,
2002, 22(9):2883-2892. Accordingly, in some embodiments, the Nrf2
pathway is activated so that the level of Nrf2 binding to ARE is
increased by, for example, at least 30%, 50%, 100%, 200%, 500% or
more as compared to the non-activated state.
[0151] v) The stability of Nrf2/Keap1 complexes--Such assay may
include analysis of immunoprecipitated complexes with Nrf2 and/or
Keap1 or other Nrf2/Keap1-associated proteins as described in,
e.g., Satoh et al., PNAS, 2006, 103(3):768-773. Anti-Keap1
antibodies can be produced using methods known in the art and are
available commercially from, for example, Santa Cruz Biotechnology.
Accordingly, in some embodiments, the Nrf-2 pathway is activated so
that the stability of Nrf2/Keap1 complexes is increased by, for
example, at least 30%, 50%, 100%, 200%, 500% or more as compared to
the non-activated state.
[0152] vi) Modification (e.g., alkylation levels) of Keap1 and
other Nrf2/Keap1-associated proteins--Such assays may include mass
spectrometric analysis of immunoprecipitated Keap1, using
techniques as described in, e.g., Dinkova-Kostova et al., PNAS,
2005, 102(12):4584-9 and Gao et al., J. Biol. Chem., on-line pub.
Manuscript M607622200. In some embodiments, the Nrf-2 pathway is
activated so that the level of Keap1 and other
Nrf2/Keap1-associated proteins is increased by, for example, at
least 30%, 50%, 100%, 200%, 500% or more as compared to the
non-activated state.
[0153] Alkylating capacity of a compound can be assessed using
recombinant Keap1, by a competition reaction with
5,5'-dithiobis(2-nitrobezoic acid) (DTNB) as described in, e.g.,
Gao et al., J. Biol. Chem., on-line pub. Manuscript M607622200.
[0154] In some embodiments, the cell being contacted with at least
one test compound is a neuron or a neuronal cell line. In some
embodiments, the cell being contacted with the at least one test
compound is selected from a colon carcinoma cell line (e.g., DLD1),
a neuroblastoma cell line (e.g., SkNSH or IMR32), and a primary
monocyte. The cell may be a cell in culture (in vitro) or be inside
of an animal (in vivo).
[0155] Cell viability, and in particular, neuronal viability can be
assessed in vivo or in vitro using any suitable method, including
methods as described in the Examples. For example, neuronal
viability can be assessed using an MTT assay after exposure of
neuronal cell cultures to cytotoxic levels of glutamate as
described in, e.g., Shih et al., J. Neurosci., 2005,
25(44):10321-35. Additionally, cell viability may also be assessed
in assays in which cell death is induced by oxidative damage, for
example, by the addition of glucose oxidase to astrocyte cell
cultures, as described in, e.g., Calabrese et al., J. Neurosci.
Res., 2005, 79:509-521. In vivo assays may be performed as
described in, e.g., Misgeld, Histochem. Cell Biol., 2005,
124:189-196.
[0156] The amount of the reporter gene expressed can be determined
by any suitable method. Expression levels, at the RNA or the
protein level, can be determined using routine methods. Expression
levels are usually scaled and/or normalized per total amount of RNA
or protein in the sample and/or a control, which is typically a
housekeeping gene such as actin or GAPDH. RNA levels are determined
by quantitative PCR (e.g., RT-PCR), Northern blotting, or any other
method for determining RNA levels, e.g., as described in Cloning: A
Laboratory Manual, by Sambrook et al. (eds.), 2nd ed., Cold Spring
Harbor Laboratory Press, 1989; Lodie et al., Tissue Eng., 2002,
8(5):739-751); or as described in the Examples. Protein levels are
determined using, Western blotting, ELISA, enzymatic activity
assays, or any other method for determining protein levels as
described in, e.g., Current Protocols in Molecular Biology, by
Ausubel et al. (eds.), John Wiley and Sons, 1998.
[0157] Expression levels may also be determined using reporter gene
assays in cell/tissue extracts or by tissue or whole-animal
imaging. In addition to MRI, tissue imaging on living animals can
be performed by fluorescence detection (Hoffman Lancet Oncol., 2002
3:546-556; Tung et al., Cancer Res., 2000, 60:4953-4958),
bioluminescence detection (Shi et al., PNAS, 2001, 98:12754-12759;
Luke et al., J. Virol., 2002, 76:12149-12161; and U.S. Pat. Nos.
5,650,135 and 6,217,847), positron emission tomography (Liang et
al., Mol. Ther., 2002, 6:73-82, near-infrared fluorescence (Tung et
al., Cancer Res., 2000, 60:4953-4958), or X-ray imaging (Hemminki
et al., J. Nat. Cancer Inst., 2002, 94:741-749).
[0158] A neurological disease in methods 1-5 above can be a
neurodegenerative disease such as, for example, ALS, Parkinson's
disease, Alzheimer's disease, and Huntington's disease. The
neurological disease can also be multiple sclerosis (MS), or other
demyelinating diseases of the central or peripheral nervous system.
In some embodiments the form of MS in methods 1-5 is selected from:
relapsing remitting MS (RRMS), secondary progressive MS (SPMS),
primary progressive MS (PPMS), and malignant MS (Marburg
Variant).
[0159] The subject being treated or administered the compound as
per methods described herein, is a mammal in need thereof, such as
a subject in need of neuroprotection, including a subject who has
or is at risk for developing a demyelinating and another specified
neurodegenerative disease. The subject is mammalian, and can be a
rodent or another laboratory animal, e.g., a non-human primate. In
some embodiments, the subject is human.
[0160] Neurodegenerative diseases are described in, for example,
Neurodegenerative Diseases: Neurobiology, Pathogenesis and
Therapeutics, M. Flint Beal, Anthony E. Lang, Albert C. Ludolph,
Cambridge University Press (Jul. 11, 2005). Examples of
neurological diseases suitable for the methods described herein
include neurodegenerative diseases such as amyotrophic lateral
sclerosis (ALS), Parkinson's disease, Alzheimer's disease, and
Huntington's disease. Other examples include demyelinating
neurological disease including, in addition to MS, the following
diseases: acute haemorrhagic leucoencephalomyelitis, Hurst's
disease, acute disseminated encephalomyelitis, optic neuritis,
Devic's disease, spinal cord lesions, acute necrotizing myelitis,
transverse myelitis, chronic progressive myelopathy, progressive
multifocal leukoencephalopathy (PML), radiation myelopathy, HTLV-1
associated myelopathy, monophasic isolated demyelination, central
pontine myelinolysis, and leucodystrophy (e.g.,
adrenoleucodystrophy, metachromatic leucodystrophy, Krabbe's
disease, Canavan's disease, Alexander's disease,
Pelizaeus-Merbacher disease, vanishing white matter disease,
oculodentodigital syndrome, Zellweger's syndrome), chronic
inflammatory demyelinating polyneuropathy (CIDP), acute
inflammatory demyelinating polyneuropathy (AIDP), Leber's optic
atrophy, and Charcot-Marie-Tooth disease.
[0161] Additional examples of diseases suitable for the methods
described herein include polyneuritis and mitochondrial disorders
with demyelination. These disorders may be co-presented with, and
possibly aggravated by diabetes, e.g., insulin-dependent diabetes
mellitus (IDDM; type I diabetes), or other diseases.
[0162] A test compound may be further assayed in an animal model of
MS, known as Experimental Autoimmune Encephalomyelitis (EAE) (Tuohy
et al., J. Immunol., 1988, 141:1126-1130, Sobel et al. J. Immunol.,
1984, 132:2393-2401, and Traugott, Cell Immunol., 1989
119:114-129). Chronic relapsing EAE provides a well established
experimental model for testing agents that would be useful for the
treatment of MS. The mouse EAE is an induced autoimmune
demyelinating disease with many similarities to human MS in its
clinical manifestations. In both EAE and MS, clinical disease is
associated with blood-brain barrier (BBB) dysfunction, infiltration
of central nervous system by mononuclear cells (mainly macrophages
and T lymphocytes, and serum products), and demyelination (Baker et
al. J. Neuroimmunol., 1990, 28:261; Butter et al., J. Neurol. Sci.,
1991, 104:9; Harris et al., Ann. Neurol., 1991, 29:548; Kermonde et
al., Brain, 1990, 113:1477).
[0163] Clinical signs of MS and demyelinating pathology in EAE
result from immunization with CNS myelin proteins or peptides
(e.g., MBP, PLP, and MOG) under Th1 conditions (direct immunization
model), or by adoptive transfer of CNS antigen-specific Th1 cells
(adoptive transfer model) (Ben-Nun et al., Eur. J. Immunol., 1981,
11:195-199; Ando et al., Cell Immunol., 1989, 124:132-143; Zamvil
et al., Nature, 1985, 317:355-358; Zamvil et al., Ann. Rev.
Immunol., 1990, 8:579-621). For example, in the SJL mouse model of
EAE, immunization with the CNS peptide PLP 139-151 or adoptive
transfer of PLP-specific Th1 cells results in a disease course
consisting of an acute phase with loss of tail tone on day 10 to
day 12, followed by hind limb paralysis and CNS mononuclear cell
infiltration (Tuohy et al., J. Immunol., 1988, 141:1126-1130, Sobel
et al., J. Immunol., 1984, 132:2393-2401, and Traugott, Cell
Immunol., 1989, 119:114-129). Resolution of clinical signs and
recovery occurs on day 20 to day 25 and the animals may undergo
several more relapses less severe than the initial phase. EAE has
been used to evaluate new therapeutic approaches to T-cell-mediated
autoimmune disease because of the clinical and histopathological
similarities to the human demyelinating MS.
[0164] The ability of a compound to slow or prevent
neurodegeneration (including demyelination and neuronal death) can
be assessed in the EAE model or another animal model, including for
example, Thieler's murine encephalomyelitis virus (TMEV)-induced
demyelinating disease, murine hepatitis virus (MHV), Semliki Forest
Virus, or Sindbis virus as described in, e.g., Ercoli et al., J.
immunol., 2006, 175:3293-3298.
[0165] A compound may be optionally tested in at least one
additional animal model (see, generally, Immunologic Defects in
Laboratory Animals, eds. Gershwin et al., Plenum Press, 1981), for
example, such as the following: the SWR X NZB (SNF1) mouse model
(Uner et al., J. Autoimmune Disease, 1998, 11(3):233-240), the KRN
transgenic mouse (K/BxN) model (Ji et al., Immunol. Rev., 1999,
69:139); NZB X NZW (B/W) mice, a model for SLE (Riemekasten et al.,
Arthritis Rheum., 2001, 44(10):2435-2445); the NOD mouse model of
diabetes (Baxter et al., Autoimmunity, 1991, 9(1):61-67), etc.); or
mouse models of multiple sclerosis (see, e.g., Linker et al., Eur.
J. Immunol., 2002, 8(6):620-624, and Eugster et al., Nat. Med.,
1999, 29:626-632; and Gold et al., Brain, 2006, 129:1953-1971).
[0166] Preliminary doses, for example, as determined in animal
tests, and the scaling of dosages for human administration is
performed according to art-accepted practices. Toxicity and
therapeutic efficacy can be determined by standard pharmaceutical
procedures in cell cultures or experimental animals, e.g., for
determining the LD.sub.50 (the dose lethal to 50% of the
population) and the ED.sub.50 (the dose therapeutically effective
in 50% of the population). The dose ratio between toxic and
therapeutic effects is the therapeutic index and it can be
expressed as the ratio LD.sub.50/ED.sub.50. In some embodiments
compositions that exhibit large therapeutic indices are used.
[0167] The therapeutically effective dose can be estimated
initially from cell culture assays. A dose may be formulated in
animal models to achieve a circulating plasma concentration range
that includes the IC.sub.50 (i.e., the concentration of the
therapeutic compound which achieves a half-maximal inhibition of
symptoms) as determined in cell culture assays or animal models.
Levels in plasma may be measured, for example, by ELISA or HPLC.
The effects of any particular dosage can be monitored by a suitable
bioassay. Examples of dosages are: about 0.1.times.IC.sub.50, about
0.5.times.IC.sub.50, about 1.times.IC.sub.50, about
5.times.IC.sub.50, 10.times.IC.sub.50, about 50.times.IC.sub.50,
and about 100.times.IC.sub.50.
[0168] The data obtained from the in vitro assays or animal studies
can be used in formulating a range of dosages for use in humans.
Therapeutically effective dosages achieved in one animal model can
be converted for use in another animal, including humans, using
conversion factors known in the art (see, e.g., Freireich et al.,
Cancer Chemother. Reports, 1966, 50(4):219-244 and Table 2 for
Equivalent Surface Area Dosage Factors).
TABLE-US-00002 TABLE 2 To: Mouse Rat Monkey Dog Human From: (20 g)
(150 g) (3.5 kg) (8 kg) (60 kg) Mouse 1 1/2 1/4 1/6 1/12 Rat 2 1
1/2 1/4 1/7 Monkey 4 2 1 3/5 1/3 Dog 6 4 3/5 1 1/2 Human 12 7 3 2
1
[0169] In some embodiments the dosage of such compounds lies within
a range of circulating concentrations that include the ED.sub.50
with little or no toxicity. In some embodiments the dosage varies
within this range depending upon the dosage form employed and the
route of administration utilized. Generally, a therapeutically
effective amount may vary with the subject's age, condition, and
sex, as well as the severity of the medical condition in the
subject. Examples of pharmaceutically acceptable dosages for
compounds described herein are from 1 .mu.g/kg to 25 mg/kg,
depending on the compounds, severity of the symptoms and the
progression of the disease. The appropriate therapeutically
effective doses can be selected by a treating clinician and in some
embodiments range approximately from 1 .mu.g/kg to 20 mg/kg, from 1
.mu.g/kg to 10 mg/kg, from 1 .mu.g/kg to 1 mg/kg, from 10 .mu.g/kg
to 1 mg/kg, from 10 .mu.g/kg to 100 .mu.g/kg, from 100 .mu.g to 1
mg/kg. Additionally, certain specific dosages are indicated in the
Examples.
[0170] For DMF or MMF, an effective amount can range from 1 mg/kg
to 50 mg/kg (e.g., from 2.5 mg/kg to 20 mg/kg or from 2.5 mg/kg to
15 mg/kg). Effective doses will also vary, as recognized by those
skilled in the art, dependent on route of administration, excipient
usage, and the possibility of co-usage with other therapeutic
treatments including use of other therapeutic agents. For example,
an effective dose of DMF or MMR to be administered to a subject
orally can be from about 0.1 g to 1 g per pay, 200 mg to about 800
mg per day (e.g., from about 240 mg to about 720 mg per day; or
from about 480 mg to about 720 mg per day; or about 720 mg per
day). For example, the 720 mg per day may be administered in
separate administrations of 2, 3, 4, or 6 equal doses.
[0171] The dosage may be determined by a physician and adjusted, as
necessary, to suit observed effects of the treatment. The
compositions may be given as a bolus dose, to maximize the
circulating levels for the greatest length of time after the dose.
Continuous infusion may also be used after the bolus dose.
[0172] In some embodiments, compositions used in the methods
described herein further comprise a pharmaceutically acceptable
excipient. As used herein, the phrase "pharmaceutically acceptable
excipient" refers to any and all solvents, dispersion media,
coatings, antibacterial and antifungal agents, isotonic and
absorption delaying agents, and the like, that are compatible with
pharmaceutical administration. The use of such media and agents for
pharmaceutically active substances is well known in the art. The
compositions may also contain other active compounds providing
supplemental, additional, or enhanced therapeutic functions. The
pharmaceutical compositions may also be included in a container,
pack, or dispenser together with instructions for
administration.
[0173] A pharmaceutical composition is formulated to be compatible
with its intended route of administration. Methods to accomplish
the administration are known in the art. "Administration" is not
limited to any particular delivery system and may include, without
limitation, parenteral (including subcutaneous, intravenous,
intramedullary, intraarticular, intramuscular, or intraperitoneal
injection), rectal, topical, transdermal, or oral (for example, in
capsules (e.g., as, poweder, granules, microtablet, micropellets,
etc.), suspensions, or tablets). Examples of some of formulations
containing DMF and/or MMF are given in, e.g., U.S. Pat. Nos.
6,509,376, and 6,436,992.
[0174] Administration to an individual may occur in a single dose
or in repeat administrations, and in any of a variety of
physiologically acceptable salt forms, and/or with an acceptable
pharmaceutical carrier and/or additive as part of a pharmaceutical
composition. Physiologically acceptable salt forms and standard
pharmaceutical formulation techniques and excipients are well known
to persons skilled in the art.
[0175] The following Examples are intended for illustrative
purposes and do not limit the inventions claimed.
EXAMPLES
Example 1
[0176] Human colon carcinoma DLD1 cells were treated with DMF or
MMF at indicated concentrations (5, 15, or 50 .mu.M) for 16 hours,
rinsed with PBS, and harvested into reducing SDS sample buffer. The
lysates were subjected to SDS PAGE and the separated proteins were
electrophoretically transferred onto nitrocellulose membranes for
Western blot analysis. To detect Nrf2 and NQO1, the membranes were
incubated with the respective primary antibodies overnight at
4.degree. C., washed, and incubated with peroxidase-conjugated
secondary antibodies followed by the chemiluminescent peroxidase
substrate. Detection of the target protein band luminescence and
image acquisition were done using CCD-equipped imaging station
Kodak2000R. The results shown in FIG. 1, demonstrate that DMF and
MMF are potent activators of Nrf2 at concentrations within clinical
exposure range.
Example 2
[0177] DLD1 cells were grown in MEM supplemented with 10% fetal
bovine serum. The cells were transfected with the indicated siRNA's
using the Lipofectamine reagent (Invitrogen) according to the
manufacturer's instructions and 30 hrs later stimulated with 30
.mu.M DMF for 40 hours. The cells were harvested and processed for
Western blotting analysis of Nrf2 and NQO1 levels as described in
Example 1. Sources and the identity of reagents used in Examples 1
and 2 are specified Table 3 below:
TABLE-US-00003 Target Reagent Source/Sequence Vendor Primary Nrf2
Nrf2 (T-19) goat polyclonal antibody Santa Cruz Antibody
Biotechnology Keap1 Keap1 (E-20) goat polyclonal antibody Santa
Cruz Biotechnology NQO1 NQO1 (A180) mouse monoclonal antibody Santa
Cruz Biotechnology GAPDH Anti-GAPDH mouse monoclonal antibody
Ambion Secondary anti-mouse HRP-Mouse sheep Amersham antibody IgG
Biosciences anti-rabbit HRP-Rabbit donkey Amersham IgG Biosciences
anti-Goat HRP-Goat Bovine Santa Cruz IgG Biotechnology siRNA Nrf2
Nrf2-2 UCAUUGAACUGCUCUUUGGUU Dharmacon (antisense) (SEQ ID NO: 17)
Keap1 Keap1-1 GAAUUAAGGCGGUUUGUCCUU Dharmacon (antisense) (SEQ ID
NO: 18)
[0178] The results are shown in FIG. 2 (for ease of representation,
the image of the Western blot is turned upside down). The results
demonstrate that DMF-induced upregulation of NQO1 requires Nrf2 and
can be mimicked by activation of Nrf2 through repression of Keap1.
Therefore, DMF acts as an Nrf2 agonist causing cellular
accumulation of Nrf2 and Nrf2 target gene expression.
Example 3
[0179] For induction of EAE, mice received s.c. injections in the
flanks and tail base of 50 .mu.g MOG 35-55 peptide in PBS
emulsified in an equal volume of complete Freund's adjuvant (CFA)
containing Mycobacterium tuberculosis H37RA (Difco, Detroit Mich.,
USA) at a final concentration of 0.5 mg/ml. Two injections of
pertussis toxin (List Biological Laboratories Inc., California,
USA; 200 ng per mouse i.p) were given on days 0 and 2.
[0180] DMF and MMF was diluted in 200 .mu.l 0.08% Methocel/H.sub.2O
as vehicle and administered by oral gavage starting from day 3 post
immunization (p.i) until termination. Each treatment group
consisted of 8 animals: vehicle alone as a negative control, 5
mg/kg body weight DMF twice a day, 15 mg/kg body weight DMF twice a
day, 15 mg/kg body weight MMF twice a day. The compounds were
obtained via Fumapharm AG. Oral gavage was used to ensure exact
dosing and to avoid compound degradation.
[0181] Spinal cord tissues were fixed in 4% paraformaldehyde and
embedded in paraffin. Slides were deparaffinized and rehydrated in
graded alcohol solutions. Antigen retreival was performed by
immersing the slides in 10 mM Citrate, pH 6.0 for 20 minutes in a
pressure cooker at 120 C (Pascal, Dako Cytomation).
[0182] Immunohistochemistry was performed using the Dako
autostainer as follows. Endogenous peroxidase was quenched by a 10
minute incubation in 3% H.sub.20.sub.2/Methanol. The rabbit anti
Nrf2 antibody C-20 (sc-722, Santa Cruz Biotechnology) was added at
a 1:250 dilution in Dako Diluent with Background Reducing
Components (Dako #S3022) C-20 antibody was detected using the
Envision anti rabbit labeled polymer-HRP (Dako #K4003) and DAB
(Vector Labs #SK-4100) was used as the chromogenic substrate.
Morphometric analysis of Nrf2 immunostaining was performed using
ImageJ software from NIH (http://rsb.info.ih.gov/ij/).
[0183] The resuluts, shown in FIGS. 3 and 4, demonstrate MMF and
DMF activation of Nrf2 in vivo.
[0184] All publications and patent documents cited herein are
incorporated by reference in their entirety. To the extent the
material incorporated by reference contradicts or is inconsistent
with the present specification, the present specification will
supersede any such material.
Sequence CWU 1
1
1819DNAArtificial Sequencesource/="Description of Artificial
Sequence Synthetic core nucleotide sequence" 1tgabnnngc
929DNAArtificial Sequencesource/="Description of Artificial
Sequence Synthetic core nucleotide sequence" 2tgabnnngc
9311DNAArtificial Sequencesource/="Description of Artificial
Sequence Synthetic core nucleotide sequence" 3rtgabnnngc r
11411DNAArtificial Sequencesource/="Description of Artificial
Sequence Synthetic oligonucleotide" 4gtgannnngc a
11524DNAArtificial Sequencesource/="Description of Artificial
Sequence Synthetic construct" 5agtcacagtg agtcggcaaa attt
24624DNAArtificial Sequencesource/="Description of Artificial
Sequence Synthetic construct" 6agtcacagtg acttggcaaa atct
24724DNAArtificial Sequencesource/="Description of Artificial
Sequence Synthetic construct" 7agtcacagtg actcagcaga atct
24824DNAArtificial Sequencesource/="Description of Artificial
Sequence Synthetic construct" 8gctaatggtg acaaagcaac tttc
24924DNAArtificial Sequencesource/="Description of Artificial
Sequence Synthetic construct" 9gctaatggtg acaaagcaac tttc
241024DNAArtificial Sequencesource/="Description of Artificial
Sequence Synthetic construct" 10ctcaggcatg acattgcatt tttc
241124DNAArtificial Sequencesource/="Description of Artificial
Sequence Synthetic construct" 11agtcactatg attcagcaac aaaa
241224DNAArtificial Sequencesource/="Description of Artificial
Sequence Synthetic construct" 12cctccccgtg actcagcgct ttgt
241324DNAArtificial Sequencesource/="Description of Artificial
Sequence Synthetic construct" 13gaagacaatg actaagcaga aatc
241424DNAArtificial Sequencesource/="Description of Artificial
Sequence Synthetic construct" 14cccaaccatg acacagcata aaag
24159DNAArtificial Sequencesource/="Description of Artificial
Sequence Synthetic construct" 15tgacnnngc 91620DNAArtificial
Sequencesource/="Description of Artificial Sequence Synthetic
construct" 16taannatgac nnngcaaaaa 201721RNAArtificial
Sequencesource/="Description of Artificial Sequence Synthetic
oligonucleotide" 17ucauugaacu gcucuuuggu u 211821RNAArtificial
Sequencesource/="Description of Artificial Sequence Synthetic
oligonucleotide" 18gaauuaaggc gguuuguccu u 21
* * * * *
References