U.S. patent application number 12/980802 was filed with the patent office on 2011-05-12 for probe for nucleic acid sequencing and methods of use.
This patent application is currently assigned to The Government of the U.S.A as represented by the Secretary of the Dept. of Health & Human Services. Invention is credited to Ilya G. Lyakhov, Danielle Needle, Thomas D. Schneider.
Application Number | 20110111975 12/980802 |
Document ID | / |
Family ID | 38051529 |
Filed Date | 2011-05-12 |
United States Patent
Application |
20110111975 |
Kind Code |
A1 |
Schneider; Thomas D. ; et
al. |
May 12, 2011 |
PROBE FOR NUCLEIC ACID SEQUENCING AND METHODS OF USE
Abstract
A nanoprobe for sequencing of nucleic acid molecules is
provided, as well as methods for using the nanoprobe. In particular
examples, the probe includes a polymerizing agent and one or more
molecular linkers that carry a chemical moiety capable of
reversibly binding to the template strand of a nucleic acid
molecule, without being detached from the linker, by specifically
binding with a complementary nucleotide in the target nucleic acid
molecule. The reversible binding of the chemical moiety on the
linker with a complementary nucleotide in the target nucleic acid
molecule is indicated by emission of a characteristic signal that
indicates pairing of the chemical moiety on the linker with its
complementary nucleotide. An example of such a chemical moiety is a
nonhydrolyzable nucleotide analog. In particular examples, the
polymerizing agent and the chemical moiety are associated with a
tag, such as a donor fluorophore and acceptor fluorophore
characteristic of the particular type of chemical moiety.
Inventors: |
Schneider; Thomas D.;
(Frederick, MD) ; Lyakhov; Ilya G.; (Frederick,
MD) ; Needle; Danielle; (Frederick, MD) |
Assignee: |
The Government of the U.S.A as
represented by the Secretary of the Dept. of Health & Human
Services
|
Family ID: |
38051529 |
Appl. No.: |
12/980802 |
Filed: |
December 29, 2010 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12095973 |
Jun 3, 2008 |
7871777 |
|
|
PCT/US06/47534 |
Dec 12, 2006 |
|
|
|
12980802 |
|
|
|
|
60749729 |
Dec 12, 2005 |
|
|
|
60749858 |
Dec 12, 2005 |
|
|
|
Current U.S.
Class: |
506/9 ;
536/24.3 |
Current CPC
Class: |
C12Q 1/6869 20130101;
Y10T 436/143333 20150115; C12Q 1/6818 20130101; C12Q 1/6818
20130101; G01N 33/542 20130101; C12Q 1/6869 20130101; C12Q 2535/107
20130101; C12Q 2525/197 20130101; C12Q 2565/101 20130101; C12Q
2525/197 20130101; C12Q 2521/30 20130101; C12Q 2563/107
20130101 |
Class at
Publication: |
506/9 ; 536/24.3;
435/6 |
International
Class: |
C40B 30/04 20060101
C40B030/04; C07H 21/00 20060101 C07H021/00; C12Q 1/68 20060101
C12Q001/68 |
Claims
1. A probe for sequencing a nucleic acid molecule, comprising: a
polymerizing agent having an active site capable of binding to a
target nucleic acid molecule and promoting synthesis of a
complementary nucleic acid molecule that elongates as complementary
nucleotides are incorporated into the complementary nucleic acid
molecule; and one or more molecular linkers spaced apart on the
polymerizing agent, wherein the molecular linkers are attached to
the polymerizing agent via a tether; wherein the molecular linkers
form a symmetrical branch structure, and wherein each branch
carries a different nucleotide analog that is capable of reversibly
binding to the target nucleic acid molecule, without being detached
from the linker, by specifically binding with a complementary
nucleotide in the target nucleic acid molecule, wherein specific
binding of the nucleotide analog on the linker with a complementary
nucleotide in the target nucleic acid molecule is indicated by
emission of a characteristic signal that indicates pairing of the
nucleotide analog on the linker with its complementary
nucleotide.
2. The probe of claim 1, wherein the nucleotide analog comprises a
non-hydrolyzable nucleotide analog.
3. The probe of claim 2, wherein the non-hydrolyzable nucleotide
analog comprises a non-hydrolyzable triphosphate nucleotide
analog.
4. The probe of claim 1, where the nucleotide analog is a
mono-nucleotide.
5. The probe of claim 1, wherein the branch structure comprises at
least four branches, wherein each branch carries a different
nucleotide analog capable of specifically binding with a different
nucleotide in the target nucleic acid molecule.
6. The probe of claim 1, wherein the polymerizing agent is
associated with a tag, and wherein each of the nucleotide analogs
is associated with a tag that identifies a particular nucleotide
analog carried by the linker, wherein interaction of the tag
associated with the polymerizing agent with the tag associated with
the nucleotide analog induces emission of the characteristic signal
that indicates pairing of the nucleotide analog on the linker with
its complementary nucleotide in the target nucleic acid
molecule.
7. The probe of claim 6, wherein the tag associated with the
polymerizing agent forms a donor-acceptor pair with the tag
associated with each nucleotide analog, whereby interaction of the
donor-acceptor pair stimulates emission of the characteristic
signal.
8. The probe of claim 7, wherein the donor-acceptor pair comprise a
donor that is stimulated by application of an external stimulus to
emit a stimulus to which the acceptor reacts to emit the
characteristic signal.
9. The probe of claim 6, wherein each tag comprises a
fluorophore.
10. The probe of claim 6, wherein each of the tags that identifies
a particular nucleotide analog carried by the linker, comprises one
or more fluorophores that emits a unique emission signal.
11. The probe of claim 1, wherein the molecular linkers comprise
linear polymers.
12. The probe of claim 11, wherein the polymers comprise nucleic
acids.
13. The probe of claim 1, wherein the one or more molecular linkers
maintain the polymerizing agent and the nucleotide analog
sufficiently spaced a distance from one another to avoid
substantial entanglement of the polymerizing agent and the
nucleotide analog in an absence of the target nucleic acid
molecule.
14. The probe of claim 1, wherein at least a portion of the
molecular linker is of a sufficient rigidity to reduce interaction
of the polymerizing agent and the nucleotide analog in the absence
of the target nucleic acid molecule.
15. The probe of claim 1, wherein the molecular linker comprises a
tether, a molecular rod, or combinations thereof.
16. The probe of claim 15, wherein the molecular rod comprises a
double-stranded DNA (dsDNA) of at least 10 nucleotides.
17. The probe of claim 15, wherein the tether comprises
polyethylene glycol (PEG).
18. The probe of claim 1 where the polymerizing agent comprises a
DNA polymerase, RNA polymerase, ribosome, or reverse
transcriptase.
19. The probe of claim 1, further comprising a primer that
specifically hybridizes to the target nucleic acid sequence under
high stringency conditions, wherein the primer is attached to the
polymerizing agent via a molecular linker.
20. The probe of claim 6, wherein the tags associated with the
nucleotide analogs are a coded fluorophore set that permits the
detection and correction of errors.
21. A method of determining a nucleic acid sequence of a target
nucleic acid molecule, comprising: exposing the target nucleic acid
molecule to the probe of claim 1 in the presence of an
oligonucleotide primer and a mixture of hydrolyzable nucleotides
that are capable of being incorporated into an elongating nucleic
acid molecule by hybridizing with a complementary nucleotide in the
target nucleic acid molecule, and replacing the nucleotide analog
that reversibly binds to the template nucleic acid molecule;
detecting emission of a sequence of signals comprising emission of
a plurality of the characteristic signals that indicates pairing of
the nucleotide analog on the molecular linker with its
complementary nucleotide.
22. The method of claim 21, wherein the polymerizing agent is
associated with a tag, and each of the nucleotide analogs is also
associated with a tag that identifies a particular nucleotide
analog carried by the linker, wherein interaction of the tag
associated with the polymerizing agent with the tag associated with
the nucleotide analogs induces emission of the characteristic
signal that indicates pairing of the nucleotide analogs on the
linker with its complementary nucleotide.
23. The method of claim 22, wherein the tag associated with the
polymerizing agent comprises a donor fluorophore and the tag that
identifies a particular nucleotide analog comprises one or more
acceptor fluorophores, wherein interaction of the polymerizing
agent and the nucleotide analog that specifically binds to the
complementary nucleotide in the target nucleic acid molecule brings
the acceptor fluorophore into a proximity with a donor fluorophore
to permit excitation of the acceptor fluorophore by the donor
fluorophore.
24. The method of claim 23, wherein detecting the signal comprises
detecting a fluorescent signal emitted from the acceptor
fluorophore or comprises detecting a reduction in fluorescent
signal emitted from the donor fluorophore.
25. The method of claim 21, wherein the emission of a sequence of
signals is converted into a nucleic acid sequence.
26. The method of claim 21, wherein the emission of a sequence of
signals is generated by luminescence resonance energy transfer
(LRET) or Forster resonance energy transfer (FRET).
27. The method of claim 26, further comprising exciting the donor
fluorophore to emit a signal which excites the one or more acceptor
fluorophores to emit the characteristic signal that indicates
pairing of the nucleotide analog on the linker with its
complementary nucleotide.
28. The method of claim 21, wherein the polymerizing agent is a
GFP-polymerase.
29. The method of claim 21, wherein the probe is fixed to a
substrate.
30. The method of claim 29, wherein the polymerizing agent is fixed
to the substrate by a linker.
31. The method of claim 21, wherein the target nucleic acid
molecule or the oligonucleotide primer is fixed to a substrate.
32. The method of claim 21, wherein the method comprises performing
a plurality of sequencing reactions substantially simultaneously,
and detecting the sequence of signals from the plurality of
sequencing reactions.
33. The method of claim 32, wherein a plurality of polymerizing
agents, target nucleic acid molecules, or oligonucleotide primers
are fixed directly or indirectly to the substrate in a
predetermined pattern, and detecting the sequence of signals
further comprises correlating the signal with a nucleic acid
molecule corresponding to a predetermined position within that
pattern.
34. The method of claim 33, wherein the polymerizing agents, target
nucleic acid molecules, or oligonucleotide primers are fixed to the
substrate in the predetermined pattern in channels which have been
etched in an orderly array.
35. The method of claim 33, wherein the polymerizing agents, target
nucleic acid molecules, or oligonucleotide primers are fixed to the
substrate in the predetermined pattern by micropipetting droplets
onto a substrate.
36. The method of claim 21, wherein the sequence of signals is
detected with a charge-coupled device (CCD) camera and converted
into the nucleic acid sequence.
37. The method of claim 21, wherein the sequence of signals is
stored in a computer-readable medium.
38. The method of claim 21, wherein the target nucleic acid
molecule is present in a biological sample obtained from a
subject.
39. The method of claim 21, wherein the target nucleic acid
molecule is present in a cell, and the exposing step comprises
introducing the oligonucleotide primer and the probe into the
cell.
40. The method of claim 39, wherein the cell is present in a
subject, and the introducing step comprises administering the
oligonucleotide primer and the probe to a subject.
41. The method of claim 21, wherein the target nucleic acid strand
comprises one or more mutations associated with disease.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This is a continuation of U.S. patent application Ser. No.
12/095,973, filed Jun. 3, 2008, now U.S. Pat. No. ______, which is
the U.S. National Stage of International Application No.
PCT/US2006/047534, filed Dec. 12, 2006 (published in English under
PCT Article 21(2)), which claims the benefit of U.S. Provisional
Application Nos. 60/749,729 and 60/749,858 both filed Dec. 12, 2005
and herein incorporated by reference.
FIELD
[0002] This disclosure relates to probes and methods for sequencing
nucleic acid molecules, such as DNA and RNA, which can be used for
research and the diagnosis of disease in clinical applications.
BACKGROUND
[0003] Numerous methods have been used to sequence nucleic acid
molecules. The traditional Maxam-Gilbert chemical degradation
method involves the chemical-specific cleavage of DNA (Maxam and
Gilbert, Proc. Natl. Acad. Sci., USA 74:560, 1977). In this method,
radio-labeled DNA molecules are incubated in four separate reaction
mixtures, each of which partially cleaves the DNA at one or two
nucleotides of a specific identity (G, A+G, C or C+T). The
resulting DNA fragments are separated by polyacrylamide gel
electrophoresis, with each of the four reactions fractionated in a
separate lane of the gel. The DNA sequence is determined after
autoradiography by observing the macromolecular separation of the
fragments in the four lanes of the gel.
[0004] The Sanger dideoxy chain termination method involves
generating DNA molecules of differing lengths by enzymatic
extension of a synthetic primer, using DNA polymerase and a mixture
of deoxy- and dideoxy-nucleoside triphosphates (Sanger et al.,
Proc. Natl. Acad. Sci., USA 74:5463, 1977). The reactions are
separated in four parallel lanes on polyacrylamide gels and the
sequence determined after autoradiography.
[0005] The use of fluorescent nucleotides has eliminated the need
for radioactive nucleotides, and provides a means to automate DNA
sequencing (for example see U.S. Pat. No. 5,124,247 to Ansorge,
U.S. Pat. No. 5,242,796 to Prober et al., U.S. Pat. No. 5,306,618
to Prober et al., U.S. Pat. No. 5,360,523 to Middendorf et al.,
U.S. Pat. No. 5,556,790 to Pettit, and U.S. Pat. No. 5,821,058 to
Smith et al.). However, methods that use fluorophores generally
still require gels or capillary electrophoresis, and thus are slow
and macroscopic.
[0006] Another potential obstacle with using fluorescently labeled
dNTPs is that no one has been able to synthesize a fully
fluorescently labeled DNA molecule. Therefore, sequencing methods
that permit the synthesis of the complementary nucleic acid strand
are still needed.
SUMMARY
[0007] The present disclosure provides an improved probe that can
be used in the sequencing of nucleic acid molecules, and methods
for using the probe. In particular examples the probe can be used
to determine the transcription levels of one or more genes. For
example, the probe can be used to count individual RNA transcripts,
thereby providing an estimate of the number produced in a cell. In
particular examples, the probes and methods disclosed herein are
used as an alternative to currently available microarray
technologies.
[0008] In particular examples, the probe, named "Medusa", includes
a polymerizing agent with one or more (such as a plurality of)
molecular linkers attached to the polymerizing agent to link (and
in some examples space) one or more chemical moieties (such as a
nonhydrolyzable nucleotide) to the polymerizing agent. The chemical
moieties are capable of reversibly binding to the template strand
of a nucleic acid molecule, without being detached from the linker,
by specifically binding with a complementary nucleotide in the
target nucleic acid molecule. In disclosed examples the reversible
incorporation occurs at the active site of the polymerizing agent.
However, ideally the chemical moieties are not capable of being
permanently incorporated into a growing nucleic acid strand. The
specific binding of the chemical moiety on the linker with a
complementary nucleotide in the target nucleic acid molecule is
indicated by emission of a characteristic signal that indicates
pairing of the chemical moiety on the linker with its complementary
nucleotide.
[0009] The polymerizing agent includes an active site that is
capable of binding to the target nucleic acid molecule to be
sequenced, and in some examples is capable of promoting synthesis
of a nucleic acid molecule complementary to the target nucleic acid
molecule, wherein the complementary nucleic acid molecule elongates
as complementary nucleotides are incorporated into the
complementary nucleic acid molecule. Polymerizing agents include
compounds capable of reacting monomer molecules (such as
nucleotides) together in a chemical reaction to form linear chains
(such as a complementary nucleic acid molecule). Exemplary
polymerizing agents include but are not limited to, DNA polymerase,
RNA polymerase, and reverse transcriptase. In particular examples,
the polymerase is a GFP-polymerase. The choice of polymerizing
agent can depend on the nucleic acid to be sequenced. For example,
if the target nucleic acid molecule is DNA, the polymerizing agent
can be a DNA or RNA polymerase, while if the target nucleic acid
molecule is RNA, the polymerizing agent can be a reverse
transcriptase.
[0010] The chemical moiety that is capable of reversibly binding to
a complementary nucleotide in the template strand of the target
nucleic acid molecule, without being detached from the linker, can
include a nucleotide analog, such as a non-hydrolyzable nucleotide
analog. Such analogs can pair with a complementary nucleotide in
the target nucleic acid molecule, but are not permanently
incorporated into the elongating complementary nucleic acid strand.
Non-hydrolyzable nucleotide analogs are known in the art, and
include non-hydrolyzable triphosphate nucleotide analogs, such as a
non-hydrolyzable triphosphate nucleotide analog with an alpha-beta
bond that is non-hydrolyzable.
[0011] In particular examples, the probe includes at least four
independent linkers, each of which carries a different chemical
moiety capable of specifically pairing with a different nucleotide
in the target nucleic acid molecule, but not capable of being
permanently incorporated into the elongating complementary nucleic
acid molecule. In other examples, the probe includes a plurality of
linkers that are joined to form a branched structure, wherein each
branch carries a different chemical moiety capable of specifically
pairing with a different nucleotide in the target nucleic acid
molecule, but not capable of being permanently incorporated into
the elongating complementary nucleic acid molecule. For example,
the branched structure may only attach to the polymerizing agent at
one point.
[0012] The molecular linker links the polymerizing agent to one or
more chemical moieties that are capable of reversibly binding to
the template (or target) strand of a nucleic acid molecule. In
particular examples, the molecular linker maintains the
polymerizing agent and the chemical moieties sufficiently spaced a
distance from one another to avoid substantial entanglement of the
polymerizing agent and the chemical moieties in the absence of the
target or template nucleic acid molecule, while allowing
interaction of the polymerizing agent and the chemical moieties in
the presence of the target nucleic acid molecule. For example, the
molecular linkers can be spaced around the polymerizing agent a
sufficient distance to inhibit entanglement of the linkers, and are
of sufficient length to reach the active site of the polymerizing
agent. In some examples, the molecular linker (or at least a
portion thereof) is of sufficient rigidity to reduce interaction of
the polymerizing enzyme and the chemical moieties in the absence of
the target nucleic acid molecule.
[0013] The molecular linker (or a portion thereof, such as a
molecular rod that is part of the molecular linker) has a
sufficient length in view of its flexibility to space the
polymerizing agent and the chemical moieties sufficiently apart to
avoid the undesired interaction in the absence of the target
nucleic acid molecule, but retain sufficient flexibility to allow
the polymerizing agent and the chemical moieties to interact with
each other and with the target nucleic acid molecule, for example
when the polymerizing agent binds to the target nucleic acid
molecule. For example, at least part of the molecular linker can
have a persistence length that permits at least a portion of the
molecular linker to be of sufficient rigidity and length to reduce
interaction of the polymerizing agent (such as a tag associated
with the polymerizing agent) and the chemical moieties in the
absence of the target nucleic acid molecule, and allows interaction
of the polymerizing agent and the chemical moieties in the presence
of the target nucleic acid molecule.
[0014] In particular examples, the total length of the molecular
linker is different than (such as greater or less than) the
persistence length of one or more components that make up the
linker, such as a double- or single-stranded nucleic acid molecule.
However, in particular examples, the total length of the molecular
linker does not exceed a length beyond which significant
interaction occurs between the polymerizing agent and the chemical
moieties in the absence of the target nucleic acid molecule, while
allowing significant interaction of the polymerizing agent and the
chemical moieties, as well as the target nucleic acid molecule, in
the presence of the target nucleic acid molecule. Such interactions
can be measured using methods known in the art, for example by
measuring acceptor emission fluorescence when the polymerizing
agent includes a donor fluorophore and one or more chemical
moieties include a corresponding acceptor fluorophore of a FRET
pair. In other examples, a polymerizing agent is substantially
maintained at a distance of at least twice the Foster radius (such
as a Foster radius of 22 to 90 .ANG.) from the chemical moieties in
the absence of the target.
[0015] Persistence length (lp) is the average local conformation
for a linear chain, which reflects the sum of the average
projections of all chain segments on a direction described by a
given segment. Therefore, persistence length is a measure of the
rigidity or stiffness of a polymer chain. In particular examples,
persistence length is the degree of bending (and hence the
effective stiffness of the chain) which, in effect, measures the
contour distance over which there occurs, on the average, a
68.40.degree. bend. Therefore, the persistence length will vary
depending on the composition of the molecular linker. For example,
the persistence length for a double-stranded DNA (dsDNA) molecule
will differ from that of a single-stranded DNA (ssDNA) molecule and
from polyethylene glycol (PEG). In particular examples, dsDNA has a
persistence length of about 400-500 .ANG. (such as 450-500 .ANG.),
and dsRNA has a persistence length of 700-750 .ANG., for example at
an ionic strength of about 0.2 M and at a temperature of 20.degree.
C. In particular examples, ssDNA has a persistence length of about
40 .ANG. (for example at 20.degree. C.) (Clossey and Carlon, Phys.
Rev. E. Stat. Nonlin. Soft. Matter. Phys. 68(6 Pt 1):061911, 2003).
In particular examples, PEG has a persistence length of about 3.8
.ANG..
[0016] In particular examples, the molecular linkers include linear
polymers, such as polymers of nucleic acids, amino acids, sugar,
PEG, or combinations thereof. For example, molecular linkers
include, but are not limited to, tethers, molecular rods, or
combinations thereof. For example, the molecular linker of
sufficient rigidity can include a molecular rod, for example a
molecular rod composed of a dsDNA. In some examples, the molecular
linker of sufficient rigidity includes multiple molecular rods
linked by tethers, or multiple tethers linked by molecular rods.
One particular example of a tether is a molecule composed of (or in
some examples consisting of) polyethylene glycol (PEG).
[0017] The polymerizing agent and the chemical moieties can be
linked in a spatially separated orientation by one or more
molecular linkers so that the polymerizing agent and the chemical
moieties do not interact to provide the reaction in the absence of
the target nucleic acid molecule. However, the molecular linker
permits the polymerizing agent and the chemical moieties, under
predetermined conditions, to be brought into sufficient proximity
with one another to interact and produce a predetermined reaction,
such as a detectable signal or interaction with the target nucleic
acid molecule. For example, at least one of the tags associated
with the polymerizing agent or the chemical moiety can be activated
when brought into sufficient proximity to another tag, such as the
excitation of an acceptor fluorophore tag by a donor fluorophore
tag when the donor and acceptor are in sufficient proximity with
one another.
[0018] Also provided by the present disclosure is a polymerizing
agent that includes an active site capable of binding to a target
nucleic acid molecule and promoting synthesis of a complementary
nucleic acid molecule that elongates as complementary nucleotides
are incorporated into the complementary nucleic acid molecule. The
polymerizing agent further includes one or more molecular linkers
spaced apart on the polymerizing agent to inhibit entanglement,
wherein each linker carries a different chemical moiety (such as a
nonhydrolyzable nucleotide analog) that is capable of reversibly
binding to the template strand of a nucleic acid molecule, without
being detached from the linker, by specifically binding with a
complementary nucleotide in the target nucleic acid molecule. In
particular examples, the polymerizing agent further includes a tag
associated with each chemical moiety that identifies the chemical
moiety carried by the linker. In addition, the polymerase can be
associated with a tag that interacts with the tag associated with
the chemical moiety to emit a characteristic signal that identifies
the chemical moiety carried by the linker.
[0019] Also provided by the present disclosure are methods of using
the disclosed nanoprobes, for example to determine the nucleic acid
sequence of a target nucleic acid molecule. In particular examples,
the method is used to determine if a particular target molecule is
present in a sample, and in some examples includes quantitating the
amount of target nucleic acid molecule present. For example,
methods are provided for using the probe to diagnose a subject
having a disease that is associated with one or more nucleic acid
mutations.
[0020] Sequencing can be done in vitro or in situ (for example on a
microscope slide) and in vivo (for example by introducing the probe
into a cell and observing the sequences of mRNA as they are
produced). The method allows several nucleic acids to be sequenced
simultaneously at the molecular level. For example, a plurality of
sequencing reactions can be performed substantially simultaneously,
and the signals from the plurality of sequencing reactions detected
and converted into a nucleic acid sequence.
[0021] In particular examples, the method includes exposing the
target nucleic acid molecule to the probes disclosed herein in the
presence of an oligonucleotide primer and a mixture of hydrolyzable
nucleotides (such as dATP, dCTP, dGTP, and dTTP or ATP, CTP, GTP
and UTP) that are capable of being incorporated into an elongating
nucleic acid molecule by base pairing with a complementary
nucleotide in the target nucleic acid molecule, and replacing the
chemical moiety carried by the linker that reversibly binds to the
template strand of the nucleic acid molecule. The emission of a
sequence of signals is detected, wherein the signals include the
emission of a plurality of the characteristic signals that
indicates pairing of the chemical moiety on the linker with its
complementary nucleotide. In some examples, the emission of a
sequence of signals is converted into a nucleic acid sequence.
[0022] In particular examples, the polymerizing agent is associated
with a tag (such as a donor fluorophore), and each different type
of chemical moiety (such as a non-hydrolyzable A, T/U, C or G
nucleotide analog) is associated with a unique tag that identifies
the particular chemical moiety carried by the linker, wherein
interaction of the tag associated with the polymerizing agent with
the tag associated with the chemical moiety induces emission of the
characteristic signal that indicates pairing of the chemical moiety
on the linker with its complementary nucleotide. In particular
examples, the tag is directly attached to the polymerizing agent or
the chemical moiety. However, the tag need not be directly
attached, and instead can be found on a molecular linker in
sufficient proximity to the polymerizing agent or the chemical
moiety to produce an emission of the characteristic signal when the
chemical moiety on the linker pairs with its complementary
nucleotide.
[0023] For example, the tag associated with the polymerizing agent
can be a donor fluorophore and the tag that identifies a particular
chemical moiety can include one or more acceptor fluorophores,
wherein interaction of the polymerizing agent and the chemical
moiety that cannot be incorporated into a synthesized nucleic acid
molecule brings the acceptor fluorophore into a proximity with a
donor fluorophore that permits excitation of the acceptor
fluorophore by the donor fluorophore. In such an example, detecting
the signal can include detecting a fluorescent signal emitted from
the acceptor fluorophore (or a decreased emission signal from the
donor fluorophore). In particular examples, the method further
includes exciting the donor fluorophore by a source of
electromagnetic radiation (such as a laser) that specifically
excites the donor fluorophore and not the acceptor fluorophores.
Alternatively, the donor fluorophore is a chemiluminescent
molecule, for example aequorin. In this example, the donor
fluorophore does not require excitation by a source of
electromagnetic radiation, because the chemiluminescent donor
fluorophore is naturally in an excited state. This excitation
induces the donor to emit light at a wavelength that can transfer
energy a distance only sufficient to excite the acceptor
fluorophore(s) associated with the chemical moiety that is pairing
with the target nucleic acid molecule.
[0024] In particular examples, the probe is attached or fixed to a
substrate, for example in an addressable location via a linker
molecule that attaches the polymerase component to the substrate.
Exemplary linkers include streptavidin-biotin, histidine-Ni,
S-tag-S-protein, and glutathione-glutathione-S-transferase (GST).
In another example, the target nucleic acid molecule to be
sequenced is attached or fixed to a substrate, for example in an
addressable location. In particular examples the oligonucleotide
primer is fixed to a substrate, for example at its 5' end. For
example, a nucleic acid molecule can be attached to the substrate
by its 5' end, 3' end or anywhere in between. In particular
examples, the sequencing reaction is performed in a three
dimensional polyacrylamide gel, wherein all of the reagents needed
for sequencing are present in the gel.
[0025] In some examples, a plurality of probes, primers, or nucleic
acid molecules are fixed directly or indirectly to the substrate in
a predetermined pattern, for example in an addressable location.
For example, the agents can be deposited into channels which have
been etched in an orderly array or by micropipetting droplets
containing the agent onto a slide, for example either by manually
pipetting or with an automated arrayer. Such methods permit
simultaneous (or substantially simultaneous) sequencing on a single
substrate, in which case signals are detected from each of the
sequencing reactions. The unique emission signals can be detected,
for example with a charge-coupled device (CCD) camera, which can
detect a sequence of signals from a predetermined position on the
substrate and convert them into the nucleic acid sequence. The
unique emission signals can be stored in a computer-readable
medium.
[0026] The foregoing and other features and advantages of the
disclosure will become more apparent from the following detailed
description of several examples which proceeds with reference to
the accompanying figures.
BRIEF DESCRIPTION OF THE FIGURES
[0027] FIG. 1A is a schematic drawing showing a nanoprobe that
includes a polymerizing agent with four molecular linkers to attach
the chemical moieties to the polymerizing agent.
[0028] FIG. 1B is a schematic drawing showing the nanoprobe
attached to a target nucleic acid strand and a complementary
primer, and the pairing of one of the chemical moieties with its
complementary nucleotide in the target nucleic acid strand.
[0029] FIG. 1C is a schematic drawing showing a nanoprobe that
includes a polymerizing agent with chemical moieties linked to a
"hub" created by a molecular linker attached at a single point on
the polymerase via a tether.
[0030] FIGS. 2A-D are schematic drawings of nanoprobes having the
molecular linkers attached to the polymerizing agent at a single
location in a variety of different configurations.
[0031] FIG. 3 is a schematic drawing illustrating a molecular
linker composed of dsDNA and PEG.
[0032] FIGS. 4A-F are graphs showing the distance between
fluorophores and FRET at several molecular rod lengths. A rod has
two tethers and FRET is measured between the tether tips. This is a
computer simulation. The tethers are 120 .ANG. long and consist of
segments that have the persistence length of PEG (3.8 .ANG.). (E
and F) rod length 0 .ANG.. (C and D) rod length 60 .ANG.. (A and B)
rod length 120 .ANG.. The data were generated using the bite
program and graphed using the genhis and genpic programs.
[0033] FIGS. 5A-D are graphs showing the effect of tether length on
FRET at various rod lengths. The FRET distance, R.sub.0, is 60
.ANG.. Each graph shows the FRET efficiency versus the rod length.
The color corresponds to the frequency that the nanoprobe gives a
particular FRET signal. (A) tether length 2 .ANG.; (B) tether
length 60 .ANG.; (C) tether length 120 .ANG.; (D) tether length 240
.ANG.. The data of the graphs of FIG. 4 can be obtained from the
lower left part of FIG. 5 (such as FIG. 5C, with a tether length of
120 .ANG.) by taking vertical slices at rod lengths of 0 .ANG., 60
.ANG. and 120 .ANG.. The data were generated using the bite program
and graphed using programs genhis and denplo.
[0034] FIG. 6 is a trace showing an example result for a target
sequence.
[0035] FIG. 7 is a schematic drawing illustrating (top) a hairpin
oligonucleotide having a 5' overhang and fluorescent donor label
(circle), and a 3' dideoxynucleotide. A freely diffusing dTTP is
labeled with a FRET acceptor (hexagon). The labeled dTTP can bind
to the first base of the overhang, but the dTTP cannot be
incorporated into the oligonucleotide. The bottom shows FRET
between the donor and acceptor when the labeled dTTP is held to the
hairpin by a polymerase (ellipse). This dwell can be measured using
methods known in the art, for example using fluorescence
correlation spectroscopy (FCS).
[0036] FIG. 8 is a schematic drawing illustrating (top) a hairpin
oligonucleotide ending with a dideoxynucleotide at the 3' end and
having a donor fluorophore near the 5' end. An acceptor-labeled
dTTP is attached via a PEG tether. Although the first base in the
overhang is an A, the tethered dTTP will not stay close to the "A"
and little or no FRET should occur. The bottom shows that when a
DNA polymerase (ellipse) binds to the DNA hairpin, the tethered
dTTP should dwell in the enzyme-DNA pocket, allowing FRET between
the two fluorophores.
SEQUENCE LISTING
[0037] The nucleic acid sequences listed in the accompanying
sequence listing are shown using standard letter abbreviations for
nucleotide bases. In particular examples, only one strand of a
nucleic acid sequence is shown, but the complementary strand is
understood as included by any reference to the displayed strand
(for example in the case of a dsDNA molecular rod).
[0038] SEQ ID NO: 1 is an exemplary target sequence.
[0039] SEQ ID NO: 2 is the compressed version of SEQ ID NO: 1.
[0040] SEQ ID NOS: 3-26 are sequences that can be used to generate
the probe shown in FIG. 2C.
[0041] SEQ ID NOS: 27-30 are sequences that can be substituted for
SEQ ID NOS: 3, 5, 7, and 9, respectively.
[0042] SEQ ID NOS: 31-38 are sequences that can form hairpin
loops.
[0043] SEQ ID NO: 39 is an exemplary target sequence.
DETAILED DESCRIPTION OF SEVERAL EMBODIMENTS
Abbreviations and Terms
[0044] The following explanations of terms and methods are provided
to better describe the present disclosure and to guide those of
ordinary skill in the art in the practice of the present
disclosure. As used herein, "comprising" means "including" and the
singular forms "a" or "an" or "the" include plural references
unless the context clearly dictates otherwise. For example,
reference to "a molecular linker" includes one or a plurality of
such molecular linkers, and reference to "the probe" includes
reference to one or more probes and equivalents thereof known to
those skilled in the art, and so forth. The term "or" refers to a
single element of stated alternative elements or a combination of
two or more elements, unless the context clearly indicates
otherwise. For example, the phrase "a tether or a molecular rod"
refers to one or more tethers, one or more molecular rods, or a
combination of both one or more tethers and one or more molecular
rods.
[0045] Unless explained otherwise, all technical and scientific
terms used herein have the same meaning as commonly understood to
one of ordinary skill in the art to which this disclosure belongs.
Although methods and materials similar or equivalent to those
described herein can be used in the practice or testing of the
present disclosure, suitable methods and materials are described
below. The materials, methods, and examples are illustrative only
and not intended to be limiting. Other features and advantages of
the disclosure are apparent from the following detailed description
and the claims.
[0046] .ANG. angstrom
[0047] dsDNA double-stranded DNA
[0048] FRET Forster resonance energy transfer
[0049] GFP green fluorescent protein
[0050] LNA locked nucleic acid
[0051] PEG polyethylene glycol
[0052] PNA peptide nucleic acid
[0053] RT reverse transcriptase
[0054] ssDNA single-stranded DNA
[0055] Acceptor fluorophore: Compounds which absorb energy from a
donor fluorophore, for example in the range of about 400 to 900 nm
(such as in the range of about 500 to 800 nm). Acceptor
fluorophores generally absorb light at a wavelength which is
usually at least 10 nm higher (such as at least 20 nm higher), than
the maximum absorbance wavelength of the donor fluorophore, and
have a fluorescence emission maximum at a wavelength ranging from
about 400 to 900 nm. Acceptor fluorophores have an excitation
spectrum which overlaps with the emission of the donor fluorophore,
such that energy emitted by the donor can excite the acceptor.
Ideally, an acceptor fluorophore is capable of being attached to
the disclosed nanoprobes.
[0056] Exemplary acceptor fluorophores include, but are not limited
to, rhodamine and its derivatives (such as
N,N,N',N'-tetramethyl-6-carboxyrhodamine (TAMRA),
6-carboxy-X-rhodamine (ROX)), fluorescein derivatives (such as
5-carboxyfluorescein (FAM) and
2'7'-dimethoxy-4'5'-dichloro-6-carboxyfluorescein (JOE)), green
fluorescent protein (GFP), BODIPY
(4,4-difluoro-4-bora-3a,4a-diaza-s-indacene) and cyanine dyes. In
particular examples, an acceptor fluorophore is capable of being
attached to a nucleotide analog, such as the base, sugar, or
phosphate (.alpha., .beta., or .gamma.) of the nucleotide.
[0057] In a particular example, an acceptor fluorophore is a dark
quencher, such as, Dabcyl, Black Hole Quenchers.TM. from Glen
Research, Eclipse.TM. Dark Quencher from Epoch Biosciences, Iowa
Black.TM. from Integrated DNA Technologies. In such an example,
instead of detecting an increase in emission signal from the
acceptor fluorophore when in sufficient proximity to the donor
fluorophore, a decrease in the emission signal from the donor
fluorophore can be detected when in sufficient proximity to the
quencher.
[0058] Active site: The catalytic site of an enzyme or antibody,
such as the region of a polymerase where the chemical reaction
occurs. The active site includes one or more residues or atoms in a
spatial arrangement that permits interaction with the substrate to
effect the reaction of the latter.
[0059] Binding: An association between two or more molecules, such
as the formation of a complex. Generally, the stronger the binding
of the molecules in a complex, the slower their rate of
dissociation. Specific binding refers to a preferential binding
between an agent and a target.
[0060] Particular examples of specific binding include, but are not
limited to, hybridization of one nucleic acid molecule to a
complementary nucleic acid molecule, and the association of a
protein (such as a polymerase) with a target protein or nucleic
acid molecule.
[0061] In a particular example, a protein is known to bind to a
nucleic acid molecule if a sufficient amount of the protein forms
non-covalent chemical bonds to the nucleic acid molecule, for
example a sufficient amount to permit detection of that
binding.
[0062] In one example, an oligonucleotide molecule (such as an
primer) is observed to bind to a target nucleic acid molecule if a
sufficient amount of the oligonucleotide molecule forms base pairs
or is hybridized to its target nucleic acid molecule to permit
detection of that binding. The binding between an oligonucleotide
and its target nucleic acid molecule is frequently characterized by
the temperature (T.sub.m) at which 50% of the oligonucleotide is
melted from its target. A higher (T.sub.m) means a stronger or more
stable complex relative to a complex with a lower (T.sub.m).
[0063] In a particular example, binding is assessed by detecting
labels present on the nanoprobe. For example, the fluorescent
signal generated following the interaction of donor and acceptor
fluorophores can be measured as an indication of binding between a
nucleotide analog on the nanoprobe and a complementary nucleotide
in the target nucleic acid molecule.
[0064] Chemical moiety: A portion or functional group of a
molecule. Examples include an agent, such as a nucleotide, that is
capable of reversibly binding to the template strand of a target
nucleic acid molecule by specifically binding with a complementary
nucleotide in the target nucleic acid molecule. In particular
examples, the chemical moiety is attached to a probe via a
molecular linker, and does not detach from the linker when the
chemical moiety specifically binds to a complementary nucleotide on
the target nucleic acid molecule.
[0065] Particular examples of chemical moieties include, but are
not limited to, nucleotide analogs that cannot be incorporated into
a growing complementary nucleic acid strand, such as a
non-hydrolyzable nucleotide analog.
[0066] cDNA (complementary DNA): A piece of DNA lacking internal,
non-coding segments (introns) and regulatory sequences which
determine transcription. cDNA is complementary to an mRNA and can
be synthesized using reverse transcriptase.
[0067] Complementary: A double-stranded DNA or RNA strand consists
of two complementary strands of base pairs. Since there is one
complementary base for each base found in DNA/RNA (such as A/T, and
C/G), the complementary strand for any single strand can be
determined
[0068] Detect: To determine if an agent is present or absent. In
some examples this can further include quantification. For example,
use of the disclosed probes in particular examples permits
detection of a chemical moiety, for example as the chemical moiety
binds to a complementary nucleotide in the target nucleic acid
molecule without being detached from the linker.
[0069] Detection can be in bulk, so that a macroscopic number of
molecules (such as at least 10.sup.23 molecules) can be observed
simultaneously. Detection can also include identification of
signals from single molecules using microscopy and such techniques
as total internal reflection to reduce background noise. The
spectra of individual molecules can be obtained by these techniques
(Ha et al., Proc. Natl. Acad. Sci. USA. 93:6264-8, 1996).
[0070] Donor Fluorophore: Fluorophores or luminescent molecules
capable of transferring energy to an acceptor fluorophore, thereby
generating a detectable fluorescent signal. Donor fluorophores are
generally compounds that absorb in the range of about 300 to 900
nm, for example about 350 to 800 nm. Donor fluorophores have a
strong molar absorbance coefficient at the desired excitation
wavelength, for example greater than about 10.sup.3 M.sup.-1
cm.sup.-1. A variety of compounds can be employed as donor
fluorescent components, including fluorescein (and derivatives
thereof), rhodamine (and derivatives thereof), GFP, phycoerythrin,
BODIPY, DAPI (4',6-diamidino-2-phenylindole), Indo-1, coumarin,
dansyl, terbium(and derivatives thereof), and cyanine dyes. In
particular examples, a donor fluorophore is a chemiluminescent
molecule, such as aequorin.
[0071] Electromagnetic radiation: A series of electromagnetic waves
that are propagated by simultaneous periodic variations of electric
and magnetic field intensity, and that includes radio waves,
infrared, visible light, ultraviolet light, X-rays and gamma rays.
In particular examples, electromagnetic radiation is emitted by a
laser, which can possess properties of monochromaticity,
directionality, coherence, polarization, and intensity. Lasers are
capable of emitting light at a particular wavelength (or across a
relatively narrow range of wavelengths), such that energy from the
laser can excite a donor but not an acceptor fluorophore.
[0072] Emission signal: The light of a particular wavelength
generated from a fluorophore after the fluorophore absorbs light at
its excitation wavelengths.
[0073] Emission spectrum: The energy spectrum which results after a
fluorophore is excited by a specific wavelength of light. Each
fluorophore has a characteristic emission spectrum. In one example,
individual fluorophores (or unique combinations of fluorophores)
are associated with a nucleotide analog and the emission spectra
from the fluorophores provide a means for distinguishing between
the different nucleotide analogs.
[0074] Entangled: To be twisted together, for example in a tangled
mass. In particular examples, entanglement of a nanoprobe would
reduce or prevent the chemical moieties (such as nucleotide
analogs) from interacting with the complementary nucleotide of a
target nucleic acid molecule, in the presence of the target
molecule. In other particular examples, entanglement of a nanoprobe
results in an undesirable interaction between the chemical moieties
(such as nucleotide analogs) or between the chemical moieties and
the polymerizing agent, for example an interaction that prevents
interaction with the target nucleic acid molecule.
[0075] Excitation or excitation signal: The light of a particular
wavelength necessary to excite a fluorophore to a state such that
the fluorophore will emit a different (such as a longer) wavelength
of light.
[0076] Fluorophore: A chemical compound, which when excited by
exposure to a particular stimulus such as a defined wavelength of
light, emits light (fluoresces), for example at a different
wavelength.
[0077] Fluorophores are part of the larger class of luminescent
compounds. Luminescent compounds include chemiluminescent
molecules, which do not require a particular wavelength of light to
luminesce, but rather use a chemical source of energy. Therefore,
the use of chemiluminescent molecules eliminates the need for an
external source of electromagnetic radiation, such as a laser.
Examples of chemiluminescent molecules include, but are not limited
to, aequorin (Tsien, 1998, Ann. Rev. Biochem. 67:509).
[0078] Examples of particular fluorophores that can be used in the
nanoprobes disclosed herein are provided in U.S. Pat. No. 5,866,366
to Nazarenko et al., such as
4-acetamido-4'-isothiocyanatostilbene-2,2'disulfonic acid, acridine
and derivatives such as acridine and acridine isothiocyanate,
5-(2'-aminoethyl)aminonaphthalene-1-sulfonic acid (EDANS),
4-amino-N-[3-vinylsulfonyl)phenyl]naphthalimide-3,5 disulfonate
(Lucifer Yellow VS), N-(4-anilino-1-naphthyl)maleimide,
anthranilamide, Brilliant Yellow, coumarin and derivatives such as
coumarin, 7-amino-4-methylcoumarin (AMC, Coumarin 120),
7-amino-4-trifluoromethylcouluarin (Coumaran 151); cyanosine;
4',6-diaminidino-2-phenylindole (DAPI);
5',5''-dibromopyrogallol-sulfonephthalein (Bromopyrogallol Red);
7-diethylamino-3-(4'-isothiocyanatophenyl)-4-methylcoumarin;
diethylenetriamine pentaacetate;
4,4'-diisothiocyanatodihydro-stilbene-2,2'-disulfonic acid;
4,4'-diisothiocyanatostilbene-2,2'-disulfonic acid;
5-[dimethylamino]naphthalene-1-sulfonyl chloride (DNS, dansyl
chloride); 4-dimethylaminophenylazophenyl-4'-isothiocyanate
(DABITC); eosin and derivatives such as eosin and eosin
isothiocyanate; erythrosin and derivatives such as erythrosin B and
erythrosin isothiocyanate; ethidium; fluorescein and derivatives
such as 5-carboxyfluorescein (FAM),
5-(4,6-dichlorotriazin-2-yl)aminofluorescein (DTAF),
2'7'-dimethoxy-4'5'-dichloro-6-carboxyfluorescein (JOE),
fluorescein, fluorescein isothiocyanate (FITC), and QFITC (XRITC);
fluorescamine; IR144; IR1446; Malachite Green isothiocyanate;
4-methylumbelliferone; ortho cresolphthalein; nitrotyrosine;
pararosaniline; Phenol Red; B-phycoerythrin; o-phthaldialdehyde;
pyrene and derivatives such as pyrene, pyrene butyrate and
succinimidyl 1-pyrene butyrate; Reactive Red 4 (Cibacron.RTM.
Brilliant Red 3B-A); rhodamine and derivatives such as
6-carboxy-X-rhodamine (ROX), 6-carboxyrhodamine (R6G), lissamine
rhodamine B sulfonyl chloride, rhodamine (Rhod), rhodamine B,
rhodamine 123, rhodamine X isothiocyanate, sulforhodamine B,
sulforhodamine 101 and sulfonyl chloride derivative of
sulforhodamine 101 (Texas Red);
N,N,N',N'-tetramethyl-6-carboxyrhodamine (TAMRA); tetramethyl
rhodamine; tetramethyl rhodamine isothiocyanate (TRITC);
riboflavin; rosolic acid and terbium chelate derivatives.
[0079] Other suitable fluorophores include thiol-reactive europium
chelates which emit at approximately 617 nm (Heyduk and Heyduk,
Analyt. Biochem. 248:216-27, 1997; J. Biol. Chem. 274:3315-22,
1999), as well as GFP, Lissamine.TM., diethylaminocoumarin,
fluorescein chlorotriazinyl, naphthofluorescein,
4,7-dichlororhodamine and xanthene (as described in U.S. Pat. No.
5,800,996 to Lee et al.) and derivatives thereof. In one example,
the fluorophore is a large Stokes shift protein (see Kogure et al.,
Nat. Biotech. 24:577-81, 2006). Other fluorophores known to those
skilled in the art can also be used, for example those available
from Molecular Probes (Eugene, Oreg.).
[0080] In particular examples, a fluorophore is used as a donor
fluorophore or as an acceptor fluorophore. Ideally, fluorophores
have the ability to be attached to a nanoprobe component without
sufficiently interfering with the ability of the nanoprobe to
interact with the target biomolecule, are stable against
photobleaching, and have high quantum efficiency. In examples where
multiple acceptor fluorophores are used, for example on a single
nanoprobe or for example on different nanoprobes that are used
together, the fluorophores are advantageously selected to have
distinguishable emission spectra, such that emission from one
fluorophore (or combination of two or more fluorophores) is
distinguishable from another fluorophore (or combination of two or
more fluorophores).
[0081] The fluorophores disclosed herein can be used as donor
fluorophores or as acceptor fluorophores. Particularly useful
fluorophores have the ability to be attached to a nanoprobe (for
example to a polymerase, a molecular linker, or to a nucleotide
analog), are stable against photobleaching, and have high quantum
efficiency. In addition, the fluorophores associated with different
sets of nucleotide analogs (such as those that correspond to A,
T/U, G, and C) are advantageously selected to have distinguishable
emission spectra, such that emission from one fluorophore (such as
one associated with A) is distinguishable from the fluorophore
associated with another nucleotide analog (such as one associated
with T).
[0082] Forster (or fluorescence) resonance energy transfer (FRET):
A process in which an excited fluorophore (the donor) transfers its
excited state energy to a lower-energy light absorbing molecule
(the acceptor). This energy transfer is non-radiative, and due
primarily to a dipole-dipole interaction between the donor and
acceptor fluorophores. This energy can be passed over a distance,
for example a limited distance such as 10-100 .ANG.. FRET
efficiency drops off according to 1/(1+(R/R0) 6) where R0 is the
distance at which the FRET efficiency is 50%.
[0083] FRET pairs: Sets (such as pairs) of fluorophores that can
engage in fluorescence resonance energy transfer (FRET). Examples
of FRET pairs that can be used are listed below. However, one
skilled in the art will recognize that numerous other combinations
of fluorophores can be used.
[0084] FAM is most efficiently excited by light with a wavelength
of 488 nm, emits light with a spectrum of 500 to 650 nm, and has an
emission maximum of 525 nm. FAM is a suitable donor fluorophore for
use with JOE, TAMRA, and ROX (all of which have their excitation
maxima at 514 nm, and will not be significantly stimulated by the
light that stimulates FAM).
[0085] The GFP mutant H9-40 (Tsien, 1998, Ann. Rev. Biochem.
67:509), which is excited at 399 nm and emits at 511 nm, can serve
as a suitable donor fluorophore for use with BODIPY, fluorescein,
rhodamine green and Oregon green. In addition, the fluorophores
tetramethylrhodamine, Lissamine.TM., Texas Red and
naphthofluorescein can be used as acceptor fluorophores with this
GFP mutant.
[0086] The fluorophore
3-(.epsilon.-carboxy-pentyl)-3'-ethyl-5,5'-dimethyloxacarbocyanine
(CYA) is maximally excited at 488 nm and can therefore serve as a
donor fluorophore for rhodamine derivatives (such as R6G, TAMRA,
and ROX) which can be used as acceptor fluorophores (see Hung et
al., Analytical Biochemistry, 243:15-27, 1996). However, CYA and
FAM are not examples of a good FRET pair, because both are excited
maximally at the same wavelength (488 nm).
[0087] One particular example of a FRET pair is GFP2 and YFP.
[0088] One of ordinary skill in the art can easily determine, using
art-known techniques of spectrophotometry, which fluorophores will
make suitable donor-acceptor FRET pairs. In addition, Grant et al.
(Biosens Bioelectron. 16:231-7, 2001) provide particular examples
of FRET pairs that can be used in the nanoprobes disclosed
herein.
[0089] Fusion Protein: A protein that includes two amino acid
sequences that are not found joined together in nature. The term
"GFP-polymerase fusion protein" refers to a protein that includes a
first amino acid sequence and a second amino acid sequence, wherein
the first amino acid sequence is a GFP molecule (mutant or
wild-type) and the second amino acid sequence is a polymerase.
Similarly, the term "GFP-aequorin fusion protein" refers to a
protein that includes a first amino acid sequence and a second
amino acid sequence, wherein the first amino acid sequence is a GFP
molecule (mutant or wild-type) and the second amino acid sequence
is an aequorin. GFP-aequorin fusion proteins can be generated using
the method of Baubet et al. (Proc. Natl. Acad. Sci. USA 97:7260-5,
2000, herein incorporated by reference).
[0090] These fusion proteins can be represented by the formula X-Y
wherein X is a tag, such as GFP, and Y is a polymerizing agent,
such as a polymerase. In some examples, an amino acid chain can be
used to link the first and second domains of the fusion
protein.
[0091] Green fluorescent protein (GFP): The source of fluorescent
light emission in Aequorea victoria. As used herein, GFP refers to
both the wild-type protein, and spectrally shifted mutants thereof,
for example as described in Tsien, 1998, Ann. Rev. Biochem. 67:509
and in U.S. Pat. Nos. 5,777,079 and 5,625,048 to Tsien and Heim,
herein incorporated by reference. In particular examples, GFP is
excited using a laser. In other examples, GFP is excited using
aequorin, for example using a GFP-aequorin fusion protein.
[0092] GFP-polymerase: Recombinant fusion protein containing both a
functional GFP molecule and a functional polymerase. The GFP can be
located at the N- or C-terminus of the polymerase, or anywhere
within the polymerase, as long as the polymerase retains
significant polymerizing activity (for example retaining the
ability to catalyze the elongation of a complementary nucleic acid
strand). GFP-polymerase can also include a linker
(linker-GFP-polymerase), for example to aid in its purification or
its attachment to a substrate. Furthermore, GFP-polymerase can also
include a functional aequorin sequence, for example if the use of
LRET is desired.
[0093] Hybridization: To form base pairs between complementary
regions of two strands of DNA, RNA, or between DNA and RNA, thereby
forming a duplex molecule. Hybridization conditions resulting in
particular degrees of stringency will vary depending upon the
nature of the hybridization method and the composition and length
of the hybridizing nucleic acid sequences. Generally, the
temperature of hybridization and the ionic strength (such as the
Na.sup.+ concentration) of the hybridization buffer will determine
the stringency of hybridization. Calculations regarding
hybridization conditions for attaining particular degrees of
stringency are discussed in Sambrook et al., (1989) Molecular
Cloning, second edition, Cold Spring Harbor Laboratory, Plainview,
N.Y. (chapters 9 and 11). The following is an exemplary set of
hybridization conditions and is not limiting:
[0094] Very High Stringency (Detects Sequences that Share at least
90% Identity)
[0095] Hybridization: 5.times.SSC at 65.degree. C. for 16 hours
[0096] Wash twice: 2.times.SSC at room temperature (RT) for 15
minutes each
[0097] Wash twice: 0.5.times.SSC at 65.degree. C. for 20 minutes
each
[0098] High Stringency (Detects Sequences that Share at least 80%
Identity)
[0099] Hybridization: 5.times.-6.times.SSC at 65.degree.
C.-70.degree. C. for 16-20 hours
[0100] Wash twice: 2.times.SSC at RT for 5-20 minutes each
[0101] Wash twice: 1.times.SSC at 55.degree. C.-70.degree. C. for
30 minutes each
[0102] Low Stringency (Detects Sequences that Share at least 50%
Identity)
[0103] Hybridization: 6.times.SSC at RT to 55.degree. C. for 16-20
hours
[0104] Wash at least twice: 2.times.-3.times.SSC at RT to
55.degree. C. for 20-30 minutes each.
[0105] 20.times.SSC is 3.0 M NaCl/0.3 M trisodium citrate.
[0106] Linker: A structure that joins one molecule to another, such
as attaches a probe of the present disclosure to a substrate,
wherein one portion of the linker is operably linked to a
substrate, and wherein another portion of the linker is operably
linked to the probe.
[0107] One particular type of linker is a molecular linker, such as
tethers, rods, or combinations thereof, which can attach a
polymerizing agent to one or more chemical moieties (such as one or
more nucleotide analogs) wherein one portion of the linker is
operably linked to the polymerizing agent, and wherein another
portion of the linker is operably linked to one or more chemical
moieties.
[0108] Locked Nucleic Acid (LNA.TM.): A bicyclic nucleic acid where
a ribonucleoside is linked between the 2'-oxygen and the 4'-carbon
atoms with a methylene unit. This link restricts the flexibility of
the ribofuranose ring of the nucleotide analog and locks it into
the rigid bicyclic N-type conformation. The LNA also induces
adjacent bases to adopt a conformation of the more
thermodynamically stable form of the A duplex.
[0109] LNA oligonucleotides can be synthesized by standard
phosphoramidite chemistry using DNA-synthesizers. In addition, LNA
can be mixed with DNA, RNA as well as other nucleic acid analogs.
In particular examples, LNAs are included as part of a molecular
linker.
[0110] Luminescence Resonance Energy Transfer (LRET): A process
similar to FRET, in which the donor molecule is a luminescent
molecule, or is excited by a luminescent molecule, instead of for
example by a laser. Using LRET can decrease the background
fluorescence. In particular examples, a chemiluminescent molecule
can be used to excite a donor fluorophore (such as GFP), without
the need for an external source of electromagnetic radiation. In
other examples, the luminescent molecule is the donor, wherein the
excited resonance of the luminescent molecule excites one or more
acceptor fluorophores.
[0111] Examples of luminescent molecules that can be used include,
but are not limited to, aequorin and luciferase. The
bioluminescence from aequorin, which peaks at 470 nm, can be used
to excite a donor GFP fluorophore (Tsien, 1998, Ann. Rev. Biochem.
67:509; Baubet et al., 2000, Proc. Natl. Acad. Sci. U.S.A.,
97:7260-5). GFP then excites an acceptor fluorophore disclosed
herein. In this example, both aequorin and GFP can be attached to a
nanoprobe of the present disclosure. The bioluminescence from
Photinus pyralis luciferase, which peaks at 555 nm, can excite an
acceptor fluorophore disclosed herein. In this example, both
luciferase and GFP can be attached to a nanoprobe of the present
disclosure. In some examples where luciferase is used, the dipole
of the acceptor fluorophore is aligned with the polarization of the
luciferase light. In other examples, a large number of luciferase
molecules are aligned next to or even surrounding the nanoprobe.
For example, a sphere, a dendrimer or a sheet could be made that
has many molecules of luciferase inside or on the surface.
[0112] Nanoprobe or probe: A molecular device that can be used to
sequence a nucleic acid molecule. In particular examples, a
nanoprobe or probe includes one or more tags that permit detection
of the sequence, such as an acceptor and donor fluorophore
pair.
[0113] Nucleic acid molecule (or sequence): A deoxyribonucleotide
or ribonucleotide polymer including without limitation, cDNA, mRNA,
genomic DNA, and synthetic (such as chemically synthesized) DNA or
RNA. The nucleic acid molecule can be double stranded (ds) or
single stranded (ss). Where single stranded, the nucleic acid
molecule can be the sense strand or the antisense strand. Nucleic
acid molecules can include natural nucleotides (such as A, T/U, C,
and G), and can also include analogs of natural nucleotides. A set
of bases linked to a peptide backbone, as in a peptide nucleic acid
(PNA), can be used as a substitute for a nucleic acid molecule.
[0114] A target nucleic acid molecule is a nucleic acid to be
sequenced, and can be obtained in purified form, by any method
known to those skilled in the art (for example, as described in
U.S. Pat. No. 5,674,743 to Ulmer). A complementary nucleic acid
molecule is complementary to the target nucleic acid molecule and
is the nucleic acid strand that is elongated when sequencing the
target nucleic acid molecule.
[0115] Nucleotide: A monomer that includes a base, such as a
pyrimidine, purine, or synthetic analogs thereof, linked to a sugar
and one or more phosphate groups. A nucleotide is one monomer in a
polynucleotide. A nucleotide sequence refers to the sequence of
bases in a polynucleotide.
[0116] The major nucleotides of DNA are deoxyadenosine
5'-triphosphate (dATP or A), deoxyguanosine 5'-triphosphate (dGTP
or G), deoxycytidine 5'-triphosphate (dCTP or C) and deoxythymidine
5'-triphosphate (dTTP or T). The major nucleotides of RNA are
adenosine 5'-triphosphate (ATP or A), guanosine 5'-triphosphate
(GTP or G), cytidine 5'-triphosphate (CTP or C) and uridine
5'-triphosphate (UTP or U).
[0117] The choice of nucleotide precursors is dependent on the
nucleic acid to be sequenced. If the template is a single-stranded
DNA molecule, deoxyribonucleotide precursors (dNTPs) are used in
the presence of a DNA-directed DNA polymerase. Alternatively,
ribonucleotide precursors (NTPs) are used in the presence of a
DNA-directed RNA polymerase. However, if the nucleic acid to be
sequenced is RNA, then dNTPs and an RNA-directed DNA polymerase are
used.
[0118] The nucleotides disclosed herein also include nucleotides
containing modified bases, modified sugar moieties and modified
phosphate backbones, for example as described in U.S. Pat. No.
5,866,336 to Nazarenko et al. (herein incorporated by reference).
Such modifications however, can allow for incorporation of the
nucleotide into a growing nucleic acid chain or for binding of the
nucleotide to the complementary nucleic acid chain. Modifications
described herein do not result in the termination of nucleic acid
synthesis.
[0119] Nucleotides can be modified at any position on their
structures. Examples include, but are not limited to, the modified
nucleotides 5-fluorouracil, 5-bromouracil, 5-chlorouracil,
5-iodouracil, hypoxanthine, xanthine, acetylcytosine,
5-(carboxyhydroxylmethyl) uracil,
5-carboxymethylaminomethyl-2-thiouridine,
5-carboxymethylaminomethyluracil, dihydrouracil,
beta-D-galactosylqueosine, inosine, N-6-sopentenyladenine,
1-methylguanine, 1-methylinosine, 2,2-dimethylguanine,
2-methyladenine, 2-methylguanine, 3-methylcytosine,
5-methylcytosine, N6-adenine, 7-methylguanine,
5-methylaminomethyluracil, methoxyarninomethyl-2-thiouracil,
beta-D-mannosylqueosine, 5'-methoxycarboxymethyluracil,
5-methoxyuracil, 2-methylthio-N6-isopentenyladenine,
uracil-5-oxyacetic acid, pseudouracil, queosine, 2-thiocytosine,
5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil,
uracil-5-oxyacetic acid methylester, uracil-S-oxyacetic acid,
5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl) uracil, and
2,6-diaminopurine.
[0120] Examples of modified sugar moieties which can be used to
modify nucleotides at any position on their structures include, but
are not limited to: arabinose, 2-fluoroarabinose, xylose, and
hexose, or a modified component of the phosphate backbone, such as
phosphorothioate, a phosphorodithioate, a phosphoramidothioate, a
phosphoramidate, a phosphordiamidate, a methylphosphonate, an alkyl
phosphotriester, or a formacetal or analog thereof.
[0121] Nucleotide analog: A nucleotide containing one or more
modifications of the naturally occurring base, sugar, phosphate
backbone, or combinations thereof. Such modifications can result in
the inability of the nucleotide to be incorporated into a growing
nucleic acid chain. A particular example includes a
non-hydrolyzable nucleotide. Non-hydrolyzable nucleotides include
mononucleotides and trinucleotides in which the oxygen between the
alpha and beta phosphates has been replaced with nitrogen or carbon
(Jena Bioscience). HIV-1 reverse transcriptase cannot hydrolyze
dTTP with the oxygen between the alpha and beta phosphates replaced
by nitrogen (Ma et al., J. Med. Chem., 35: 1938-41, 1992).
[0122] A "type" of nucleotide analog refers to one of a set of
nucleotide analogs that share a common characteristic that is to be
detected. For example, the sets of nucleotide analogs can be
divided into four types: A, T, C and G analogs (for DNA) or A, U, C
and G analogs (for RNA). In this example, each type of nucleotide
analog can be associated with a unique tag, such as one or more
acceptor fluorophores, so as to be distinguishable from the other
nucleotide analogs in the set (for example by fluorescent
spectroscopy or by other optical means).
[0123] An exemplary nucleotide analog that can be used in place of
"C" is a G-clamp (Glen Research). G-clamp is a tricyclic
Aminoethyl-Phenoxazine 2'-deoxyCytidine analogue (AP-dC). The
G-clamp is available as a phosphoramidite and so can be synthesized
into DNA structures. Such an analog can be used in the nanoprobes
provided herein (for example as one of the chemical moieties 22,
24, 26, 28 of the probe shown in FIG. 1A or it can be substituted
for the dCTP 22 shown in FIG. 1B).
[0124] Oligonucleotide: A linear polynucleotide (such as DNA or
RNA) sequence of at least 6 nucleotides, for example at least 9, at
least 15, at least 18, at least 24, at least 30, at least 50, at
least 100, at least 200 or even at least 500 nucleotides long. An
oligonucleotide can contain non-naturally occurring portions, such
as altered sugar moieties or inter-sugar linkages, such as a
phosphorothioate oligodeoxynucleotide. In particular examples, an
oligonucleotide containing non-naturally occurring portions can
bind to RNA or DNA, and include peptide nucleic acid (PNA)
molecules.
[0125] ORF (open reading frame): A series of nucleotide triplets
(codons) coding for amino acids without any termination codons.
These sequences are usually translatable into a peptide.
[0126] Pairing: The process of joining into a pair, such as the
binding of a chemical entity (such as a nucleotide analog) to its
complementary nucleotide on a target nucleic acid molecule. In
particular examples, pairing results in the formation of covalent
bonds. In other examples, pairing does not result in the formation
of chemical bonds.
[0127] Peptide Nucleic Acid (PNA): A class of informational
molecules containing a neutral peptide-like backbone with
nucleobases allowing it to hybridize to complementary RNA or DNA
with higher affinity and specificity than conventional
oligonucleotides. The structure of a PNA molecule is analogous with
DNA, wherein the deoxyribose phosphate backbone has been replaced
by a backbone similar to that found in peptides. In particular
examples, PNA is resistant to nucleases and proteases. PNAs can
include a functional group at the N(5)-terminus, such as a
fluorophore (for example an acceptor fluorophore).
[0128] Persistence length (/p): The average local conformation for
a linear chain, reflecting the sum of the average projections of
all chain segments on a direction described by a given segment. In
particular examples, persistence length is the degree of bending
(and hence the effective stiffness of the chain) which, in effect,
measures the contour distance over which there occurs, on the
average, a 68.40.degree. bend.
[0129] Polyethylene glycol (PEG): A polymer of ethylene compounds,
H(OCH.sub.2CH.sub.2).sub.nOH. Pegylation is the act of adding a PEG
structure to another molecule, for example, a functional molecule
such as a targeting or activatable moiety. PEG is soluble in water,
methanol, benzene, dichloromethane and is insoluble in diethyl
ether and hexane.
[0130] Particular examples of PEG that can be used in the disclosed
nanoprobes include, but are not limited to: 1-7 units of Spacer 18
(Integrated DNA Technologies, Coralville, Iowa), such as 3-5 units
of Spacer 18, C3 Spacer phosphoramidite (such as 1-10 units),
Spacer 9 (such as 1-10 units), PC (Photo-Cleavable) Spacer (such as
1-10 units), (all available from Integrated DNA Technologies). In
other examples, lengths of PEG that can be used in the disclosed
nanoprobes include, but are not limited to, 1 to 40 monomers of
PEG.
[0131] Polymerizing agent: A compound capable of reacting monomer
molecules (such as nucleotides) together in a chemical reaction to
form linear chains or a three-dimensional network of polymer
chains. A particular example of a polymerizing agent is polymerase,
an enzyme which synthesizes a nucleic acid strand complementary to
a nucleic acid template. Examples of polymerases that can be used
to sequence a nucleic acid molecule include, but are not limited to
the E. coli DNA polymerase I, specifically the Klenow fragment
which has 3' to 5' exonuclease activity, Taq polymerase, reverse
transcriptase (such as HIV-1 RT or reverse transcriptase of the L1
retrotransposon), E. coli RNA polymerase, and wheat germ RNA
polymerase II.
[0132] The choice of polymerase is dependent on the nucleic acid to
be sequenced. If the template is a single-stranded DNA molecule, a
DNA-directed DNA or RNA polymerase can be used; if the template is
a single-stranded RNA molecule, then a reverse transcriptase (such
as an RNA-directed DNA polymerase) can be used.
[0133] Primer: Short nucleic acid molecules, for example sequences
of at least 9 nucleotides, which can be annealed to a complementary
target nucleic acid molecule by nucleic acid hybridization to form
a hybrid between the primer and the target nucleic acid strand. A
primer can be extended along the target nucleic acid molecule by a
polymerase enzyme. Therefore, individual primers can be used for
nucleic acid sequencing, wherein the sequence of the primer is
specific for the target nucleic acid molecule, for example so that
the primer will hybridize to the target nucleic acid molecule under
stringent hybridization conditions.
[0134] In particular examples, a primer is at least 10 nucleotides
in length, such as at least 10 contiguous nucleotides complementary
to a target nucleic acid molecule to be sequenced. In order to
enhance specificity, longer primers can be employed, such as
primers having at least 12, at least 15, at least 20, or at least
30 contiguous nucleotides complementary to a target nucleic acid
molecule to be sequenced. Methods for preparing and using primers
are described in, for example, Sambrook et al. (1989) Molecular
Cloning: A Laboratory Manual, Cold Spring Harbor, N.Y.; Ausubel et
al. (1987) Current Protocols in Molecular Biology, Greene Publ.
Assoc. & Wiley-Intersciences.
[0135] Purified: The term purified does not imply absolute purity;
rather, it is intended as a relative term. Thus, for example, a
purified GFP-polymerase protein preparation is one in which the
GFP-polymerase protein is more pure than the protein in its
environment within a cell. In particular examples, a preparation of
a GFP-polymerase protein is purified such that the GFP-polymerase
protein represents at least 50% of the total protein content of the
preparation, but can be, for example 90 or even 98% of the total
protein content.
[0136] Quantum dots: Engineered, inorganic semiconductor
crystalline nanoparticles that fluoresce stably and possess a
uniform surface area that can be chemically modified to attach
biomolecules (such as one or more nanoprobes) to them. Although
generally spherical, quantum dots attached to nanoprobes of the
present disclosure can be of any shape (such a spherical, tubular,
pyramidal, conical or cubical), but particularly suitable
nanoparticles are spherical.
[0137] Generally, quantum dots can be prepared with relative
monodispersity (for example, with the diameter of the core varying
approximately less than 10% between quantum dots in the
preparation), as has been described previously (Bawendi et al., J.
Am. Chem. Soc. 115:8706, 1993). Quantum dots known in the art have,
for example, a core selected from the group consisting of CdSe,
CdS, and CdTe (collectively referred to as "CdX").
[0138] Recombinant: A recombinant nucleic acid molecule or protein
sequence is one that has a sequence that is not naturally occurring
or has a sequence that is made by an artificial combination of two
otherwise separated segments of sequence. In particular examples,
this artificial combination is accomplished by chemical synthesis
or by the artificial manipulation of isolated segments of nucleic
acid or protein sequences, for example by genetic engineering
techniques. In particular examples, a molecular rod composed of a
dsDNA is a recombinant molecule.
[0139] Reverse Transcriptase: A template-directed DNA polymerase
that generally uses RNA but can use DNA as its template.
[0140] Reversibly binding to a target nucleic acid molecule:
Temporary binding that exists in a reversible equilibrium. For
example, includes transient pairing of a nucleotide to its
complement at the active site of a polymerase, wherein the
nucleotide does not undergo a chemical reaction (such as hydrolysis
or covalent bond formation) that covalently incorporates the
nucleotide into the nucleic acid molecule being formed by the
polymerase.
[0141] RNA polymerase: An enzyme that catalyzes the polymerization
of ribonucleotide precursors that are complementary to the DNA
template.
[0142] Rod or molecular rod: A structure that can be included in a
nanoprobe's molecular linker to increase the rigidity of a portion
of the nanoprobe, such as a portion of the molecular linker.
Molecular rods are sufficiently rigid to reduce the interaction of
chemical moieties, polymerizing agents, or combinations thereof, in
the absence of the target nucleic acid molecule. In addition,
molecular rods are of a length that permits the chemical moieties,
polymerizing agents, or combinations thereof to interact in the
presence of the target biomolecule.
[0143] In a particular example, a molecular rod present in a
molecular linker has a length shorter than its persistence length,
thereby significantly reducing the interaction of the chemical
moieties, polymerizing agents, or combinations thereof in the
absence of the target biomolecule. In one example, a molecular rod
consisting of dsDNA has a length of 10-140 nucleotides, which is
shorter than the persistence length of dsDNA, about 150
nucleotides.
[0144] Exemplary molecular rods include, but are not limited to,
dsDNA molecules, peptide nucleic acids (PNAs), carbon nanotubes,
locked nucleic acid molecules (LNAs), a microtubule, a bacterium, a
linear virus particle, virus tail fibers or other protein
structures (such as protein components containing alpha helices or
beta barrels or other protein structures, such as a leucine zipper
structure). A molecular rod can be a portion of a three-dimensional
molecular construct, such as a cube or octahedron built from DNA
(for example see Seeman, Sci. Am. 290:64-9 and 72-5, 2004). In a
particular example, a molecular rod is a dsDNA molecule of at least
10 nucleotides, at least 35 nucleotides, or 150 nucleotides or
less, such as 10-150 nucleotides, 10-140 nucleotides, 20-100
nucleotides, 20-50 nucleotides, 20-40 nucleotides, 30-50
nucleotides, or about 20, 30, or 40 nucleotides.
[0145] Sample: Biological specimens such as samples containing
biomolecules, such as nucleic acid molecules (for example genomic
DNA, cDNA, RNA, or mRNA). Exemplary samples are those containing
cells or cell lysates from a subject, such as those present in
peripheral blood (or a fraction thereof such as serum), urine,
saliva, tissue biopsy, cheek swabs, surgical specimen, fine needle
aspirates, amniocentesis samples and autopsy material.
[0146] Sequence of signals: The sequential series of emission
signals, including electromagnetic signals such as light or
spectral signals, which are emitted upon specific binding of
chemical moieties (such as a nucleotide analog) with complementary
nucleotides in the target nucleic acid molecule, which indicates
pairing of the chemical moiety with its complementary nucleotide.
In a particular example, the sequence of signals are a series of
acceptor fluorophore emission signals, wherein each unique signal
is associated with a particular chemical moiety.
[0147] Signal: A detectable change or impulse in a physical
property that provides information. In the context of the disclosed
methods, examples include electromagnetic signals such as light,
for example light of a particular quantity or wavelength. In
certain examples the signal is the disappearance of a physical
event, such as quenching of light. A characteristic signal is the
particular signal expected when a particular nucleotide analog on
the nanoprobe specifically binds with a complementary nucleotide in
the target nucleic acid molecule. For example, a characteristic
signal can be the resulting signal emitted from a fluorescently
tagged non-hydrolyzable nucleotide analog, which can be predicted
by the fluorophore(s) attached to or associated with the nucleotide
analog.
[0148] Subject: Living multi-cellular vertebrate organisms,
including human and veterinary subjects, such as cows, pigs,
horses, dogs, cats, birds, reptiles, and fish.
[0149] Substrate: A material or surface to which other molecules
(such as proteins or nucleic acid molecules) can be attached or
embedded within In particular examples, the substrate is made of
biocompatible material that is transparent to light, including
glass and quartz. For example, the substrate can be a 3 cm long by
1 cm wide by 0.25 cm thick glass microscope slide. In yet another
example, for example when LRET is used, the substrate can be
opaque. In one example, the substrate is a gel matrix. In a
specific example, the substrate is a microfluidic device having a
parabolic flow channel profile.
[0150] In particular examples, a substrate is treated before
attaching other molecules. For example, glass microscope slides can
be washed by ultrasonication in water for 30 minutes, soaked in 10%
NaOH for 30 minutes, rinsed with distilled water and dried at
80.degree. C. for 10 minutes or air-dried overnight.
[0151] Tag: An agent capable of being detected, for example by
spectrophotometry, flow cytometry, or microscopy. For example, one
or more tags can be attached to a nanoprobe, thereby permitting
sequencing of a nucleic acid molecule. Exemplary tags include
radioactive isotopes, fluorophores, chemiluminescent agents,
charges, enzymes, and combinations thereof.
[0152] Tether: A structure that can be included in a nanoprobe to
link one or more chemical entities (such as a nucleotide analog) to
a polymerizing agent, directly or indirectly. For example, one or
more tethers, in combination with one or more molecular rods, can
be used to link one or more chemical entities (such as a nucleotide
analog) to a polymerizing agent. Ideally, the tether is a length
that reduces the likelihood that the tether will tangle with itself
or with other components of the nanoprobe, while still allowing the
chemical entities (such as a nucleotide analog), polymerizing
agent, tags, or combinations thereof to interact in the presence of
the target nucleic acid molecule.
[0153] Exemplary tethers include water soluble long chain
molecules, such as PEG, peptides (such as a peptide of at least 30
amino acids, for example at least 30 contiguous amino acids of the
RecB protein 70-amino acid-long flexible tether connecting the
helicase to the nuclease (Singleton et al., Nature 432:187-93,
2004)), sugar chains (such as 2000-14000 residues), abasic
phosphodiester spacers (such as the IDT 5' dSpacer), carbohydrate
chains (such as at least 10 sugar molecules), and polycaprolactone
chains (such as at least 10 monomers). In a particular example, a
tether is composed of PEG, for example a PEG length of about 23-164
.ANG..
[0154] Target nucleic acid sequence or molecule: A pre-selected
nucleic acid molecule, for example whose detection or sequence is
desired. The nucleic acid molecule need not be in a purified form.
Various other biomolecules can also be present with the target
nucleic acid molecule. For example, the target nucleic acid
molecule can be present in a cell or a biological sample (which can
include other nucleic acid molecules and proteins).
[0155] Transformed: A transformed cell is a cell into which has
been introduced a nucleic acid molecule by molecular biology
techniques. As used herein, the term transformation encompasses all
techniques by which a nucleic acid molecule can be introduced into
such a cell, including transfection with viral vectors,
transformation with plasmid vectors, and introduction of naked DNA
by electroporation, lipofection, injection, and particle gun
acceleration. In particular examples, a cell is transformed with a
probe disclosed herein.
[0156] Under conditions sufficient for: A phrase that is used to
describe any environment that permits the desired activity.
[0157] An example includes contacting a probe with a sample under
conditions sufficient to allow sequencing of a target nucleic acid
molecule in the sample, for example to determine whether the target
nucleic acid molecule is present in the sample, such as a target
nucleic acid molecule containing one or more mutations.
[0158] Unique Emission Signal: An emission signal that conveys
information about a specific event, such as the emission spectrum
for a particular fluorophore, which can be distinguished from other
signals (such as other emission spectrum signals). Examples in
association with the disclosed methods include associating one or
more individual fluorophores or other tags with each type of
chemical moiety (such as an A, T/U, C or G non-hydolyzable
nucleotide analog), such that pairing of the chemical moiety with
its complementary base on the target nucleic acid molecule results
in a unique signal or a combination of signals (such as
fluorophores that emit at different unique wavelengths). Each
chemical moiety will have a unique emission signal that in the
examples is based on the tag(s) associated with that chemical
moiety. This signal can be used to determine which type of chemical
moiety (such as an A, T/U, C or G non-hydolyzable nucleotide
analog) has been paired with the complementary nucleotide in the
target nucleic acid, and these signals in combination indicate the
nucleic acid sequence.
[0159] A signal can be characterized not only by different
wavelengths but also by different intensities at various
wavelengths, to form a unique spectrum. In particular, two signals
having the same set of wavelengths can be distinguished if they
have some different intensities at particular wavelengths.
General Strategy
[0160] The disclosed nanoprobes that can be used to sequence a
target nucleic acid molecule include a polymerizing agent and one
or more molecular linkers that space one or more a chemical
moieties that are capable of binding to a complementary nucleotide
in a target nucleic acid molecule. The chemical moieties are
generally not capable of being permanently incorporated into the
elongating nucleic acid molecule. The linker has a combination of
length and flexibility that substantially maintains the
polymerizing agent and chemical moieties spaced a desired distance
in the absence of the target nucleic acid molecule, but permits
them to substantially interact in the presence of the target
biomolecule. In addition, the molecular linker(s) substantially
avoid entanglement of the molecular linkers with one another, and
substantially avoid entanglement of the chemical moieties at the
ends of the linkers. Table 1 illustrates some combinations of
polymerizing agents and chemical moieties that can be used Also
provided are exemplary tags that can be associated with the
polymerizing agent and chemical moieties.
TABLE-US-00001 TABLE 1 Exemplary polymerizing agent/chemical
moiety/tag combinations. Target Polymerizing Agent/Tag Chemical
Moieties/Tag DNA DNA polymerase/donor Nonhydrolyzable dNTPs/
fluorophore acceptor fluorophores DNA Klenow/donor fluorophore
Mononucleotides/acceptor fluorophores DNA HIV-1-reverse dGMPCPP/Cy3
transcriptase/fluorescein dAMPCPP/Cy5 dCMPCPP/Texas Red
TMPCPP/Rhodamine Red RNA RNA polymerase/donor Nonhydrolyzable
dNTPs/acceptor fluorophore fluorophores RNA reverse
transcriptase/donor Mononucleotides/acceptor fluorophore
fluorophores
[0161] The probes need only to maintain potential interactions of
the polymerizing agent and the chemical moieties outside of a
minimum distance. Also, since the location of the molecular
components can only be expressed in terms of statistical
probabilities, it is understood that absences of interaction are
not absolute but instead refer to restriction of dynamic molecular
movements in a manner that reduces undesired interactions between
the polymerizing agent and the chemical moieties (and between the
chemical moieties themselves) to a desired level. Once the
polymerizing agent binds to a target nucleic acid molecule in the
presence of a primer, the flexibility of the molecular linker is
sufficient to permit the polymerizing agent and the chemical
moieties to interact (for example interaction of a nonhydrolyzable
nucleotide analog with the active site of a polymerase).
Nanoprobes for Sequencing a Nucleic Acid Molecule
[0162] The present disclosure provides nanoprobes for sequencing
target nucleic acid molecules. In particular examples, the
disclosed nanoprobes are used in vitro, ex vivo, in situ, or even
in vivo. The probes, referred to as "Medusa" probes, include a
polymerizing agent and one or more molecular linkers spaced apart
on the polymerizing agent, wherein the linkers carry a chemical
moiety that is capable of reversibly binding to the template strand
of a nucleic acid molecule, without being detached from the linker,
by specifically binding with a complementary nucleotide in the
target nucleic acid molecule. The reversible incorporation of the
chemical moiety on the linker with a complementary nucleotide in
the target nucleic acid molecule is indicated by emission of a
characteristic signal (such as a decrease in donor fluorophore
emission or an increase in acceptor fluorophore emission) that
indicates pairing of the chemical moiety on the linker with its
complementary nucleotide in the target nucleic acid molecule.
[0163] The polymerizing agent, such as a polymerase, includes an
active site capable of binding to a target nucleic acid molecule
and promoting synthesis of a complementary nucleic acid molecule
that elongates as complementary nucleotides are incorporated into
the complementary nucleic acid molecule. In particular examples,
the complementary nucleotides are hydrolyzable nucleotides that are
capable of being permanently incorporated into the elongating
nucleic acid molecule that is complementary to the target nucleic
acid molecule. For example, this is in contrast to a chemical
moiety (such as a nonhydrolyzable nucleotide analog, for example a
nonhydrolyzable dNTP) which may reversibly bind to the target
nucleic acid molecule (for example by forming hydrogen bonds with a
complementary nucleotide), but cannot be permanently incorporated
into the elongating complementary nucleic acid molecule.
[0164] The chemical moiety that is capable of reversibly binding to
the template strand of a nucleic acid molecule, without being
detached from the linker, is one that does not become permanently
incorporated into the elongating nucleic acid molecule that is
complementary to the target nucleic acid molecule. For example, the
chemical moiety may form one or more non-covalent chemical bonds
(such as hydrogen binding) with the template strand of the target
nucleic acid molecule, but such bonds exist in reversible
equilibrium at a rate that permits replacement of the chemical
moiety by a nucleotide that permits elongation of the complementary
strand, such as a hydrolyzable nucleotide (such as ATP, GTP, CTP,
UTP, dATP, dGTP, dCTP, dTTP) that is covalently incorporated into
the elongating strand. The chemical moieties can specifically and
reversibly bind with a complementary nucleotide in the target
nucleic acid molecule to bring an acceptor label associated with
the chemical moiety into sufficient proximity with a donor label to
stimulate the acceptor label. Such pairing can result in the
emission of a signal that is characteristic for the particular
chemical moiety that paired. For example, all of the different
chemical moieties may initially bind to the active site of a
polymerizing agent at the same rate, since this binding will be
related to the diffusion of the chemical moieties. However, since
the kinetics of release of the different chemical moieties are
related to the number and strength of the bonds formed, the
chemical moiety that is complementary to the exposed nucleotide in
the target strand will bind stronger and will stay bound in the
active site longer than the other chemical moieties. This increased
binding time permits generation and detection of the signal that is
characteristic for the particular chemical moiety that paired.
[0165] A particular example of such a chemical moiety is a
nucleotide analog, for example a nonhydrolyzable nucleotide analog.
The chemical moiety can be attached to the molecular linker by any
means that does not substantially interfere with the ability of the
chemical moiety to interact with the active site of the
polymerizing agent, to pair with a complementary nucleotide in the
target nucleic acid strand, and the ability to reversibly
non-covalently bind (usually by stacking) to the elongating nucleic
acid molecule. For example, if the chemical moiety is a nucleotide
analog, it can be attached to the molecular linker via the base,
sugar, or phosphate. In a particular example, if the chemical
moiety is a mono-nucleotide, it can be attached to the molecular
linker on the base or the 3' ribose carbon.
[0166] In particular examples, the molecular linkers used to attach
chemical moieties to the polymerizing agent include a plurality of
individual linkers attached at multiple points to the polymerizing
agent. For example, at least four independent molecular linkers,
each of which carries a different type of chemical moiety capable
of specifically binding with a different nucleotide in the target
nucleic acid molecule, can be attached to the polymerizing agent.
In a specific example, at least eight independent molecular
linkers, each of which carries a different fluorophore or
combination of fluorophores associated with a particular chemical
moiety capable of specifically binding with a different nucleotide
in the target nucleic acid molecule, can be attached to the
polymerizing agent. For example two of the eight linkers can
include a dCTP, wherein each dCTP is associated with a different
acceptor fluorophore or combination of fluorophores such that each
dCTP produces a distinct detectable signal. This allows runs of
bases, G in this case, to be more easily distinguished. However, in
other examples, the molecular linkers are attached at one point to
the polymerizing agent, for example through a single covalent bond
that allows free rotation, thereby allowing the chemical moieties
on the ends of the linkers to have equal access to the polymerizing
agent active site. For example, the molecular linkers can be joined
and attached to the polymerizing agent in one location. In a
particular example, the molecular linkers are joined and attached
to another agent (such as a linker), which is then attached to the
polymerizing agent. The molecular linkers used to attach chemical
moieties to the polymerizing agent can include a plurality of
molecular linkers that form a branched structure, which is attached
to the polymerizing agent. For example, each branch can carry a
different chemical moiety capable of specifically binding with a
different nucleotide in the target nucleic acid molecule. In a
specific example, the branch structure includes at least four
branches, wherein each branch carries a different chemical moiety.
In some examples, the branched molecular linker attaches at a
single point to the polymerizing agent.
[0167] In particular examples, the polymerizing agent is associated
with a tag, and each of the chemical moieties is associated with a
tag that identifies a particular chemical moiety carried by the
linker, wherein interaction of the tag associated with the
polymerizing agent with the tag associated with the chemical moiety
induces emission of the characteristic signal that indicates
pairing of the chemical moiety on the linker with its complementary
nucleotide. Association of the tag with a component of the probe
can include direct attachment of the tag with the component. For
example, the polymerizing agent can be a GFP-polymerase fusion
protein. Similarly, if the chemical moiety is a nucleotide analog,
the tag can be attached to the base, sugar, or a phosphate of the
nucleotide analog. Ideally, direct or indirect attachment of a tag
to a polymerizing agent or a chemical moiety of the probe does not
significantly inhibit the biological activity of that component.
For example, attachment of a tag to a polymerizing agent ideally
does not decrease the polymerase activity by more than 20%. In
other examples, association of the tag with a polymerizing agent or
a chemical moiety does not require direct attachment of the tag
with the component. For example, the tag can be on another part of
the probe, such as a molecular linker (for example on a tether or
on a rod). In such examples, the tag is in sufficient proximity to
the polymerizing agent or the chemical moiety to permit detection
of the chemical moiety in the active site of the polymerizing
agent, and the pairing of the chemical moiety with its
complementary nucleotide.
[0168] In particular examples, the tag associated with the
polymerizing agent forms a donor-acceptor pair with the tag
associated with each chemical moiety, whereby interaction of the
donor-acceptor pair stimulates emission of the characteristic
signal. In some examples, the donor is stimulated by application of
an external stimulus (such as a laser or chemiluminescent molecule)
to emit a stimulus to which the acceptor reacts to emit the
characteristic signal. For example, the tag associated with the
polymerizing agent can be a donor fluorophore, and each of the tags
associated with the chemical moiety includes one or more acceptor
fluorophores that emits a unique emission signal for a particular
chemical moiety.
[0169] In particular examples, the molecular linkers include linear
polymers, such as nucleotides. For example, the molecular linker
can include a tether, a rod, or combinations thereof. The molecular
linkers can be spaced around the polymerizing agent a sufficient
distance to inhibit entanglement of the linkers, and be of
sufficient length for the chemical moiety to reach the active site
of the polymerizing agent. In addition, the molecular linker can
maintain the polymerizing agent and the chemical moiety
sufficiently spaced a distance from one another to avoid
substantial entanglement of the polymerizing agent and the chemical
moiety in an absence of the target nucleic acid strand. In some
examples, at least a portion of the molecular linker (a rod) is of
a sufficient rigidity to reduce interaction of the polymerizing
agent and the chemical moiety in the absence of the target nucleic
acid molecule, such as a molecular rod having a length at least as
great as its persistence length, for example a dsDNA rod having a
length at 10-150 nucleotides. In a particular example, the
molecular rod is a dsDNA sequence of 10 to 140 nucleotides, such as
20-100 nucleotides, for example 40 nucleotides. In a specific
example the molecular rod is 120 angstroms (.ANG.) long.
[0170] For example, to increase the rigidity of the molecular
linker, the molecular linker can include one or more molecular
rods, such as at least two tethers linked by a molecular rod. The
inclusion of a molecular rod, such as a double-stranded DNA
molecule, can be included to increase the rigidity of the probe,
and can also further separate the functional groups. For example, a
molecular linker that includes a molecular rod with tethers on both
ends can have at least two points about which the chemical moieties
and polymerizing agent will move by Brownian motion. That is, there
will be at least two cloud spheres each of which represents all the
possible locations of a chemical moiety with respect to the end of
a rod as allowed by tethers. These spheres will intersect to some
degree. In the absence of a target nucleic acid molecule, the
nanoprobe can have the spheres not substantially intersecting. In
some examples, the distance between the two ends of the molecular
rod is less than the sum of the two tether lengths. In particular
examples, the molecular rod is used to decrease FRET between the
donor and acceptor fluorophores on the nanoprobe in the absence of
the target nucleic acid molecule.
[0171] The polymerizing agents disclosed herein include an active
site capable of binding to a target nucleic acid molecule and
promoting synthesis of a complementary nucleic acid molecule that
elongates as complementary nucleotides are incorporated into the
complementary nucleic acid molecule. The polymerizing agent also
includes one or more molecular linkers spaced apart on the
polymerizing agent a sufficient distance to significantly avoid
entanglement. Each linker carries a different chemical moiety (such
as a nonhydrolyzable nucleotide analog) that is capable of
reversibly binding to the template strand of a nucleic acid
molecule, without being detached from the linker, by specifically
binding with a complementary nucleotide in the target nucleic acid
molecule. The polymerizing agent can further include a tag, for
example a tag associated with the polymerizing agent, and a tag
associated with each chemical moiety that identifies the chemical
moiety carried by the linker. The tag associated with the
polymerase can interact with each tag associated with the chemical
moieties to emit a characteristic signal that identifies the
chemical moiety carried by the linker.
[0172] As noted above, in particular examples the length of the
molecular linker is one that maintains the polymerizing agent and
the chemical moieties sufficiently spaced from one another such
that the polymerizing agent (for example a tag associated with the
polymerizing agent) and the chemical moieties do not substantially
interact in an absence of the target biomolecule. Methods are known
in the art for determining whether one part of the probe interacts
with one or more other parts of the probe, for example in the
presence or absence of a target molecule. In one example, to
determine if a particular length molecular linker is appropriate, a
probe of the present disclosure having a particular molecular
linker length is generated using the methods disclosed herein. In
particular examples, multiple probes are generated, each having a
different molecular linker length. To identify lengths of molecular
linkers that are suitable for use, a donor fluorophore is attached
to the polymerizing agent at one end of the molecular linker and an
appropriate acceptor fluorophore is attached to the chemical moiety
at the other end of the molecular linker. In particular examples,
the donor and acceptor are a FRET pair. To determine if the ends of
the molecular linkers are capable of interacting with one another,
the molecular linker can be placed in a solution in the presence
and absence of the target nucleic acid molecule and an appropriate
primer, and acceptor emission fluorescence detected, for example by
spectrophotometry or fluorescence microscopy. In particular
examples, lengths of molecular linkers that only produce
significant acceptor emission fluorescence (for example above a
predetermined threshold) when the target nucleic acid molecule and
the primer are present, and produce no more than background levels
of acceptor emission fluorescence in the absence of the target
nucleic acid molecule and the primer, can be used in the probes of
the present disclosure. In contrast, in particular examples,
lengths of molecular linkers that do not produce significant
acceptor emission fluorescence when the target nucleic acid
molecule and the primer is present, or produce levels of acceptor
emission fluorescence that are significantly above background in
the absence of the target nucleic acid molecule and the primer, are
not used in the probes of the present disclosure. In some examples,
the length of the molecular linker that produces a desirable result
can vary depending on the particular FRET pair used. For example,
the length of the molecular linker used if a GFP/fluorescein FRET
pair is part of the probe, may be different than the length of the
molecular linker used if an Alexa Fluor 430/BODIPY 630 FRET pair is
part of the probe.
[0173] To reduce interaction of the polymerizing agent and the
chemical moieties in the absence of the target nucleic acid
molecule, the molecular linker (or a portion thereof) can have a
persistence length that permits the molecular linker to be of
sufficient rigidity to reduce the interaction of the polymerizing
agent (such as a tag associated with the polymerizing agent) and
the chemical moieties in the absence of the target nucleic acid
molecule (as well as interaction between the chemical moieties
themselves in the presence or absence of the target nucleic acid
molecule). Other portions of the molecular linker, such as tethers,
allow interaction of the polymerizing agent (such as its tag) and
the chemical moieties (or interaction of polymerizing agent and the
chemical moieties with the target nucleic acid molecule) in the
presence of the target nucleic acid molecule.
[0174] The total length of the molecular linker can be the same or
a different length than the persistence length for a particular
component of the molecular linker, as long as the length
differential is insufficient to yield undesired interaction of the
polymerizing agent and the chemical moieties (or interaction
between the chemical moieties themselves). For example, if the
molecular linker includes a molecular rod that has a particular
persistence length, the molecular linker can be shorter or longer
than that persistence length. In addition, the molecular rod length
itself can be shorter or greater than the persistence length of the
polymer used to generate the molecular rod. In particular examples,
a molecular linker includes a molecular rod, and the total length
of the rod is shorter than the persistence length of the molecule
composing the molecular rod (such as 0.1-times, 0.5-times, or
1-times the persistence length of the molecule composing the
molecular rod). In yet other particular examples, the length of the
linker can be greater or less than the persistence length of any
one of its components. For example, for a molecular linker that
includes a molecular rod, the total length of the molecular linker
is not more than 5-times shorter or longer than the persistence
length of the molecule composing the molecular rod (such as 1-5
times, 1-4 times, or 1-3 times the persistence length of the
molecular linker that includes the molecular rod). In one example,
the molecular rod is composed of dsDNA (which has a persistence
length of 400-500 .ANG.) and the length of the molecular rod is
greater than 400-500 .ANG. (such as 550-700 .ANG. or 550-1000
.ANG.) or shorter than the persistence length (such as 100-350
.ANG. or 200-350 .ANG.).
[0175] Those skilled in the art will recognize that at one
persistence length the far end of a rod is often still
substantially pointing in the same direction (68.40.degree.) as the
original direction and that a rod of this length, and hence
flexibility, can still provide a useful functional rigidity. Rods
of lengths greater than the persistence length provide a further
degree of flexibility that can be acceptable in some applications.
In other applications a single linker can consist of a single
molecule of a uniform kind (as 1000 bp of dsDNA, which is
substantially longer than the persistence length) wherein certain
portions of that linker are sufficiently close (for example 40 bp)
that they may act as molecular rods locally and provide nanoprobe
functions locally, while longer portions of the linker are
sufficiently far apart as to act as molecular tethers that allow
the parts to come together or not depending on Brownian motion and
the presence of target molecules that can be bound. Such a
situation occurs when local transcription factors bind to DNA in
essentially rigid positions relative to each other, while further
pieces of DNA can `loop` around to supply, for example, an
enhancer, activator or repressor (as for example in the GalR
binding sites of E. coli, Semsey et al., Genes Dev. 18:1898-907,
2004). Although such nanoprobe constructions are possible, in
general the constructions described herein distinguish clearly
between molecular rods as being not substantially larger than the
persistence length and molecular tethers as being substantially
longer than their corresponding persistence length. Unlike the
dsDNA transcriptional control systems found in nature, generally in
the nanoprobes described herein the molecular rods and tethers are
constructed by connecting different kinds of molecules that have
substantially different persistence lengths as for example dsDNA
with PEG.
[0176] The persistence length will vary depending on the
composition. For example, the persistence length for a
double-stranded DNA (dsDNA) molecule differs from that of a
single-stranded DNA (ssDNA) molecule and from polyethylene glycol
(PEG). For example, dsDNA has a persistence length of 400-500
.ANG.. In particular examples, ssDNA has a persistence length of
about 40 .ANG.. In particular examples, PEG has a persistence
length of about 3.8.+-.0.02 .ANG. (Kienberger et al., Single
Molecules 1:123-8, 2000).
[0177] To substantially avoid interaction of the polymerizing agent
and the chemical moieties in the absence of the target nucleic acid
molecule (as well as interaction between the chemical moieties
themselves in the presence or absence of the target nucleic acid
molecule), and allow interaction of the polymerizing agent and the
chemical moieties in the presence of the target biomolecule, the
length of the linker is at least sufficient to maintain the
functional groups spaced at least the Forster radius for the
particular donor and acceptor fluorophores used, such as a distance
of 22 to 90 .ANG.. In some examples, the length of the linker is
sufficient to separate charges on the polymerizing agent and the
chemical moieties, such as a distance of 10 to 1000 .ANG.. In
particular examples, the total length of the molecular linker is
about 10 to 500 .ANG., such as 10 to 300 .ANG., 10 to 200 .ANG., 20
to 200 .ANG., 20 to 187 .ANG., 20 to 150 .ANG., 60 to 120 .ANG., or
60 to 200 .ANG..
[0178] Examples of molecular linkers include, but are not limited
to, tethers, molecular rods, or combinations thereof. For example,
the molecular linker can include multiple molecular rods linked by
tethers or multiple tethers linked by molecular rods. One
particular example is shown in FIG. 1A, where the nanoprobe 10
includes a polymerizing agent 12 and a chemical moiety 28 that are
linked and spaced by the molecular linker 20, wherein the molecular
linker 20 is composed of a molecular rod 66 linked by tethers 68,
70. In a specific example, the molecular rod is about 100 to 200
.ANG. (such as about 120-140 .ANG.), and each tether is about 23 to
187 .ANG. (such as about 60 .ANG.).
[0179] The polymerizing agent and the chemical moieties can
interact with one another and with the target nucleic acid molecule
to provide a predetermined reaction, such as a detectable signal.
The polymerizing agent and the chemical moieties can be maintained
in a spatially separated orientation by a molecular linker so that
the polymerizing agent and the chemical moieties do not interact to
provide the reaction in the absence of the target molecule.
However, the molecular linker permits the polymerizing agent and
the chemical moieties, under predetermined conditions, to be
brought into sufficient proximity with one another to interact and
produce a predetermined reaction, such as a detectable signal.
[0180] In one example, each of the molecular linkers is the same or
nearly identical length. In another example, two or more of the
molecular linkers are different lengths. A probe with molecular
linkers of varied lengths can be used to control the binding
frequency of the chemical moieties. For example, if A and T
nonhydrolyzable nucleotide analogs are attached to shorter
molecular linkers, while C and G nonhydrolyzable nucleotide analogs
are attached to longer molecular linkers, it will be easier for the
A and T nucleotide analogs to get to the active site of the
polymerizing agent and thereby produce a stronger emission
signal.
Polymerizing Agents
[0181] Medusa probes include a polymerizing agent. Polymerizing
agents are compounds (such as enzymes) that are capable of reacting
monomer molecules (such as nucleotides) together in a chemical
reaction to form linear chains.
[0182] Particular examples of polymerizing agents are polymerases,
such as a DNA or RNA polymerase, and a ribosome. The choice of
polymerase is dependent on the nucleic acid to be sequenced. For
example, if the template is a single-stranded DNA molecule, a
DNA-directed DNA or RNA polymerase can be used; if the template is
a single-stranded RNA molecule, then a reverse transcriptase (such
as an RNA-directed DNA polymerase) can be used.
[0183] Particular non-limiting examples of polymerases include E.
coli DNA polymerase I (such as the Klenow fragment which has 3' to
5' exonuclease activity), Taq polymerase, reverse transcriptase
(such as HIV-1 RT, for example the single chain HIV RT disclosed in
see Le Grice et al., J. Virol. 62:2525:9, 1988), E. coli RNA
polymerase, and wheat germ RNA polymerase II.
[0184] In one example, the polymerase is HIV reverse transcriptase,
which can be used to provide sequence for both DNA and RNA, and the
chemical moiety is a nucleotide analog wherein the oxygen between
the .alpha. and .beta. phosphates is replaced by a nitrogen. Such
nucleotide analogs can bind to a complementary nucleotide on the
target nucleic acid molecule, but cannot be incorporated into the
elongating complementary strand.
[0185] In one example, a polymerase is a modified polymerase. Such
modification can be used to alter the biological activity of the
polymerase, for example alter its substrate specificity,
processivity, or accuracy. For example, the fidelity of a DNA
polymerase can be increased by mutations (Wisniewski et al., J.
Biol. Chem. 274:28175-84, 1999). For example, such a polymerase can
be used to sequence double-stranded genomic DNA, as well as
unfolded chromatin regions. In another example, the processivity of
a DNA polymerase can be improved by covalently linking the
polymerase domain to a sequence non-specific dsDNA binding protein
(such as Sso7d) (for example see Wang et al., Nucleic Acids Res.
32(3):1197-207, 2004). In another example, an HIV-1 RT includes a
mutation at position K65 to alter the nucleotide-binding
specificity of the enzyme.
[0186] As described herein, in particular examples the polymerizing
agent includes a tag, such as a donor fluorophore. Although the tag
need not be directly attached to the polymerase (for example is
attached to the polymerase via a linker), in particular examples
the tag is attached to the polymerase. For example, a
GFP-polymerase fusion protein can be generated using standard
molecular biology methods (for example see Liu et al., J. Biol.
Chem. 277:46712-9, 2002; and Kratz et al., Proc. Natl. Acad. Sci.
USA, 96:1915-20, 1999).
[0187] Therefore, a polymerase can be modified (for example
includes one or more amino acid substitutions) to permit attachment
of a tag. For example, one or more amino acids can be substituted
with a Cys using standard methods known in the art (such as
site-directed mutagenesis using PCR), to permit attachment of a
tag. Ideally, altering the amino acid sequence of the polymerase
does not significantly interfere with the biological activity of
the polymerase, such as the ability to promote synthesis of a
complementary nucleic acid molecule. If desired, solvent-accessible
cysteine residues can be replaced by serine residues. For example,
the HIV RT p66 subunit can be mutated to K287C or W24C to permit
attachment of a tag at these positions, such as the fluorophore
Alexa 488 (for example see Rothwell et al., Proc. Natl. Acad. Sci.
USA. 100:1655-60, 2003 and Kensch et al., J. Mol. Biol.
301:1029-39, 2000).
[0188] In a specific example, the polymerizing agent is mutant
HIV-1 RT(K287C)-Tus fusion protein, with a donor fluorophore
attached to the RT at cysteine 287.
[0189] In one example, the polymerizing agent is a fusion protein
that includes streptavidin. Such a fusion protein can be generated
using standard molecular biology methods. Attachment of a biotin to
the molecular linker can be used to attach one or more molecular
linkers to the streptavidin-polymerase fusion protein.
[0190] In one example, a polymerase includes both a donor
fluorophore and an acceptor fluorophore. By including both
fluorophores, movement or a change in conformation of the
polymerase can be monitored, for example as a timing signal. In a
particular example, a donor fluorophore is attached to one side of
the polymerase (such as the "fingers") and an acceptor fluorophore
is attached to the other side of the polymerase (such as the
"thumb"). As the polymerase closes, the donor and acceptor
fluorophore are brought into sufficient proximity for the donor to
excite the acceptor, resulting in the production of a detectable
acceptor emission signal (or a decrease in detectable donor
emission signal). As the polymerase opens, the donor and acceptor
fluorophore are brought sufficiently apart so that the donor cannot
sufficiently excite the acceptor, resulting in a decrease in
detectable acceptor emission signal (or an increase in detectable
donor emission signal). If the emission from the acceptor is
monitored, the increase in signal followed by a decrease in
emission signal (or vice versa if the donor emission is monitored)
can be used as a timing signal.
[0191] In a particular example, the donor fluorophore is EGFP
(excitation 484 nm; emission 510 nm) and the acceptor fluorophore
is EYFP (excitation 512 nm; emission 529 nm), wherein irradiation
at 480 nm of the probe that includes such a labeled polymerase will
result in emission of EGFP at 510 nm that will excite EYFP at 512
nm.
[0192] In one example, the HIV RT p66 subunit is mutated to K287C
or W24C, to permit attachment of a donor fluorophore to K287C and
an acceptor fluorophore to W24C (or vice versa). These two amino
acid residues are on the fingers and the thumb of the polymerase,
respectively, and so the distance between them can vary depending
on the state of the polymerase. Therefore, such a polymerase can be
used to obtain a timing signal. (Antibodies to the epitope around
positions 24 or 287 can be used to block attachment of one
fluorophore while the other is being attached. Alternatively other
chemistries could be used to uniquely attach the donor and acceptor
fluorophores.)
[0193] Table 2 shows the amino acids on a Klentaq 1 DNA polymerase
whose spatial mobility changes to the greatest extent during normal
polymerase activity (Li et al., EMBO J. 17: 7514-25, 1998). Such
residues are examples of residues to which a donor or acceptor
fluorophore can be attached to. For example, TRP24 is on the
fingers and LYS287 is on the thumb of HIV-1 RT. During the
transition from open to closed states of the polymerase, their
distance will change by about 15 .ANG..
TABLE-US-00002 TABLE 2 Amino acids whose spatial mobility is
altered in a Klentaq 1 DNA polymerase Amino Acid .ANG. and number
10.232 ARG 660 10.915 ALA 661 11.259 ALA 643 12.658 SER 644 12.925
MET 658 14.166 PRO 656 15.050 LEU 657 15.085 ASP 655
Chemical Moieties
[0194] As described above, the chemical moieties linked to the
polymerase via molecular linkers are agents that are capable of
binding to the template nucleic acid molecule, without being
detached from the linker, by pairing with the exposed complementary
nucleotide in the target nucleic acid molecule. For example,
chemical moieties will enter the polymerase active site for a
sufficient amount of time to generate a detectable signal, without
being permanently incorporated into the elongating complementary
strand. Although the chemical moiety may form one or more chemical
bonds with the active site, base pair with the elongating
complementary strand and bind with the template nucleic acid, such
bonds are reversible to permit replacement of the chemical moiety
by a hydrolyzable nucleotide, wherein the hydrolyzable nucleotide
becomes non-reversibly incorporated into the elongating
complementary strand. This steps the polymerizing agent forward one
base. Since the chemical moieties are not removed from the linker,
the probe can be used again.
[0195] Particular examples of such chemical moieties include
nucleotide analogs, such as a nonhydrolyzable nucleotide analog
(for example a nonhydrolyzable triphosphate nucleotide analog), for
example those available from Molecular Probes, such as BODIPY FL
AMPPNP (B22356) and BODIPY FL GMPPNP (B22355) as well as
mononucleotides. In a specific example, the nonhydrolyzable
triphosphate nucleotide analog is a nonhydrolyzable triphosphate
nucleotide analog with an alpha-beta bond that is
nonhydrolyzable.
[0196] Nonhydrolyzable nucleotide analogs are commercially
available (for example Jena Bioscience (Jena, Germany) sells
nonhydrolyzable analogs for all four dNTP bases, such as
.alpha.,.beta.-methylene-ATP; .alpha.,.beta.-N-dUTP;
.alpha.,.beta.-C-GTP). In addition, all four dNTP analogs
containing --NH-- or --CH.sub.2-- groups between the .alpha. and
.beta.-phosphates can be commercially produced (for example by Jena
Bioscience).
[0197] In a particular example, the nanoprobes disclosed herein
include a large number of nucleotides (such as hydrolyzable
nucleotides), thereby providing a self-contained sequencing probe.
This can allow the sequencing probe to report a limited number of
bases in a sequence. The nucleotides can be present on the
molecular linkers. For example, once a nucleotide that was
originally attached on the .gamma.-phosphate has been used, it
would be incorporated into the nucleic acid molecule to be
sequenced, and therefore that molecular linker would no longer
participate in the sequencing reaction.
Tethers
[0198] Molecular linkers can include one or more tethers, which can
provide flexibility to the probe. Ideally, tethers are flexible
enough to allow movement of the chemical moieties, for example to
permit the chemical moieties to interact with the polymerizing
agent and with the target nucleic acid molecule (such as the
exposed base on the target nucleic acid molecule). The length of
the tether should be sufficient to substantially avoid interaction
of the chemical moieties and the polymerizing agent in the absence
of the target nucleic acid molecule, and allow interaction of the
chemical moieties and the polymerizing agent in the presence of the
target nucleic acid molecule. However, the tether is ideally not so
long as to result in entanglement of the tether or the chemical
moieties (for example with each other, or with the polymerizing
agent). In particular examples, tethers are water soluble and
non-toxic.
[0199] In particular examples, the length of the tether is long
enough to separate the chemical moieties in the absence of the
target nucleic acid molecule, but not so long as to result in
tangling of the nanoprobe or the chemical moieties, and short
enough to allow the chemical moieties to interact with the target
nucleic acid molecule and the polymerizing agent.
[0200] Examples of particular materials that can be used as tethers
include, but are not limited to, single-stranded DNA molecules,
sugar chains, peptides (such as the connector between two parts of
the RecB protein), and polyethylene glycol (PEG) or any other
flexible polymer having the properties disclosed herein. In a
particular example, a tether is composed of two or more of these
agents. In a specific example a tether includes, or in some
examples consists of, PEG.
[0201] In particular examples, the tether is about 10-500 .ANG.,
such as 20-200 .ANG., 23-187 .ANG., 100-140 .ANG., or 70-94 .ANG.,
for example 120 .ANG.. In one example, the tether is less than 187
.ANG. in length.
[0202] In particular examples, the tether is composed of PEG, such
as 3 to 7 units of 18-atom PEG spacers that are 23.4 .ANG. long,
such as 2-4 or 3-4 of such spacers. PEG is non-toxic, flexible,
hydrophilic, and can be inserted as spacers during DNA synthesis
(SyntheGen, Glen Research).
[0203] In one example, the tether is a single-stranded DNA (ssDNA)
molecule, for example having a length of 10-40 nucleotides, such as
10-30 nucleotides, 10-20 nucleotides, for example 10 nucleotides,
20 nucleotides, or 40 nucleotides. In particular examples, a ssDNA
tether can anneal to another nucleic acid strand, thereby
converting a flexible tether into a rigid molecular rod. Ideally,
the sequence is one that does not specifically hybridize to itself,
the functional groups, or to a nucleic acid sequence in the sample
to be analyzed.
[0204] In one example, the tether is a sugar chain (for example
having a length of 10-100 sugar moieties, such as 10-75, 10-50, or
20-40 sugar moieties).
[0205] In one example, tethers include charges (such as a
-COO.sup.- or --NH.sub.3.sup.+), to reduce entanglement of the
molecular linkers that include the charged tethers.
Molecular Rods
[0206] Molecular linkers can include one or more molecular rods,
which can provide sufficient rigidity to the probe to reduce
interaction of the chemical moieties and the polymerizing agent in
the absence of the target nucleic acid molecule (or interaction of
the chemical moieties themselves in the presence or absence of the
target nucleic acid molecule, for example due to entanglement of
the molecular linkers). However, the length of the rod is
sufficient to permit interaction of the chemical moieties and the
polymerizing agent in the presence of the target nucleic acid
molecule. In some examples, the presence of a molecular rod in the
nanoprobe reduces the likelihood of entanglement and can increase
the speed of the binding of the chemical moieties to the active
site of the polymerizing agent.
[0207] The disclosed nanoprobes can include one or more molecular
rods, such as at least two molecular rods, for example 1, 2, 3, 4,
5, 6, 7, 8, 9, or 10 molecular rods. In one example, use of one or
more molecular rods reduces the required tether length, thereby
reducing the cost and size of the device.
[0208] In a particular example, the molecular rod is a dsDNA
sequence. The length of the dsDNA is one that allows interaction of
the chemical moieties and the polymerizing agent in the presence of
the target nucleic acid molecule, but reduces their interaction in
the absence of the target nucleic acid molecule. If the nanoprobe
includes donor and acceptor fluorophores, the length of the dsDNA
is one that allows interaction of the fluorophores in the presence
of the target nucleic acid molecule, but reduces their interaction
in the absence of the target nucleic acid molecule. In specific
examples, the dsDNA molecular rod is a length that is about equal
to the persistence length of 400-500 .ANG.. However, one skilled in
the art will recognize that lengths shorter or greater can be used,
as long as the rod reduces the interaction of functional groups in
the absence of the target biomolecule, and does not result in
significant entanglement of a molecular linker. In specific
examples, the dsDNA molecular rod is 150 to 200 nucleotides, such
as 10-150 nucleotides, such as 10-140 nucleotides, 20-140
nucleotides, 20-100 nucleotides, 20-50 nucleotides, 30-50
nucleotides, or 30-40 nucleotides, for example 35, 36, 37, 38, 39,
40, 41, 42, 43, 44, or 45 nucleotides. In specific examples, the
dsDNA molecular rod is at least 10 nucleotides, such as at least 20
nucleotides. In a particular example, the molecular rod is a dsDNA
of 40 bases. Bases are 3.38 .ANG. thick so 40 base pairs is 135
.ANG. long, which is greater than the typical FRET distance. In a
particular example, the sequence of the dsDNA is chosen using the
NANEV program (Goodman et al., BioTechniques, 38:548-50, 2005).
[0209] In other particular examples, the molecular rod is composed
of DNA molecules containing modifications or variants of the DNA,
such as peptide backbone DNA (Peptide Nucleic Acid, PNA) or locked
nucleic acids (LNAs). In particular examples, such DNA variants are
used to alter the helix thermal stability and resistance to
nucleases. In yet another example the molecular rod is composed of
carbon nanotubes (for example nanotubes that are 100-200 .ANG. in
length). In yet other examples, the molecular rod includes
bacteria, virus particles, or viral tail fibers.
Branched Molecular Linkers
[0210] In particular examples, the molecular linker is composed of
multiple parts that form a branched structure, for example as shown
in FIG. 1C. Such a structure can be created by appropriately
annealing single strands of synthetic DNA as described herein.
[0211] Alternatively, 5-Me-dC Brancher Phosphoramidites are
available for use in oligonucleotide synthesis. Synthesis of a
first strand can be performed such that a 5-Me-dC Brancher
Phosphoramidite is incorporated in the middle of the strand. The
end of the strand is then capped, the 5-Me-dC Brancher is then
unblocked and synthesis then proceeds on the second branch. This
creates a Y shaped molecule. Two such molecules can be synthesized
that have complementary sequences so that they form a single rod in
the center flanked by four arms. By appropriate the choice of
sequences in the arms and design of other oligonucleotides
complementary to those arms, a structure like that shown in FIG. 1C
can be created.
Tags
[0212] In particular examples, nanoprobes disclosed herein include
one or more tags, such as a detectable label, for example to permit
sequencing of a target nucleic acid molecule. Exemplary tags that
can be used include fluorophores, chemiluminescent agents, and
charge. In particular examples, a change in charge is detected as
the target nucleic acid molecule approaches a capacitor.
[0213] In a particular example, a nanoprobe includes an acceptor
fluorophore and one or more donor fluorophores. In the figures that
only show a single donor or single acceptor fluorophore on the
nanoprobe, one skilled in the art will appreciate that multiple
fluorophores can be included on the nanoprobe, for example to
increase the signal or to provide combinations of spectra. Ideally,
the acceptor and donor fluorophores are attached to the nanoprobe
in a position that decreases their interaction in the absence of
the target biomolecule (thereby reducing detectable signal).
However, in the presence of the target biomolecule, the interaction
of the polymerizing agent and the chemical moieties with each other
and with the exposed base on the target nucleic acid molecule
allows the acceptor and donor fluorophores to interact, such that
the donor fluorophore excites the acceptor fluorophore and the
acceptor emits at its characteristic wavelengths, thereby
generating a detectable signal.
[0214] In a particular example, the donor fluorophore has a large
Stokes shift. This decreases the excitation of the acceptor
fluorophore by the donor excitation light frequency. Appropriate
filtration can also reduce or remove the excitation wavelength,
leaving only the emission spectrum from the acceptor to be
detected.
[0215] In a particular example, the donor fluorophore is Green
Fluorescent Protein (GFP), or a variant thereof. For example, one
or more GFP molecules can be cloned onto a polymerizing agent (for
example to generate a GFP-polymerase fusion protein) using standard
molecular biology methods. In another particular example, the donor
fluorophore is a chemiluminescent molecule, such as aequorin.
Chelated lanthanides provide bright, large stokes shift,
non-bleaching luminophores with sharp emission spectra, and can
therefore be used as donors. The use of a chemiluminescent molecule
as the donor fluorophore eliminates the need for an external light
source. Similar to GFP, chemiluminescent molecules such as aequorin
can be cloned onto a polymerizing agent using standard molecular
biology methods (for example to generate an aequorin-polymerase
fusion protein).
[0216] Each different type of chemical moiety linked to the
polymerizing enzyme can be associated with one or more different
tags, such as one or more fluorophores. In a particular example,
each different type of chemical moiety is associated with one or
more different acceptor fluorophores, which can be excited by a
donor fluorophore (or luminescent molecule associated with the
polymerizing agent).
[0217] Particular examples of acceptor and donor fluorophore pairs
that can be used include, but are not limited to: GFP mutant H9-40
(Tsien, 1998, Ann. Rev. Biochem. 67:509) as a suitable donor
fluorophore for use with BODIPY, fluorescein, rhodamine green,
Oregon green, tetramethylrhodamine, Lissamine.TM., Texas Red and
naphthofluorescein as acceptor fluorophores, and fluorophore
3-(.epsilon.-carboxy-pentyl)-3'-ethyl-5,5'-dimethyloxacarbocyanine
(CYA) as a donor fluorophore for fluorescein or rhodamine
derivatives (such as R6G, TAMRA, and ROX) as acceptor fluorophores.
Other particular examples of acceptor and donor fluorophore pairs
include, but are not limited to: 7-dimethylaminocoumarin-4-acetic
acid (DMACA) and fluorescein-5-isothiocyanate (FITC);
7-amino-4-methyl-3-coumarinylacetic acid (AMCA) and
fluorescein-5-isothiocyanate (FITC); and
fluorescein-5-isothiocyanate (FITC) and tetramethylrhodamine
isothiocyanate (TRITC).
[0218] Particular examples of fluorescent tags that can be used
include the Alexa Fluor series (Molecular Probes, Eugene, Oreg.).
Alexa Fluor 430 absorbs at 430 nm and, because of its high Stokes
shift, emits far away at 540 nm, and can therefore be used as a
donor fluorophore. Alexa Fluor 430 can be used in particular
examples with Alexa Fluors 546, 555, 568, 594, 647, and BODIPY 630
as acceptor fluorophores since their excitation spectra overlap the
540 nm emission peak of Alexa Fluor 430.
[0219] Donor and acceptor molecules can also be designed using
bimolecular fluorescence complementation (BiFC) (Hu et al., Nat.
Biotechnol. 21:539-45, 2003; Hu et al., Mol. Cell. 9:789-98, 2002).
Two partial GFP fragments join to give a complementation and hence
fluorescence. The complementation takes only a few moments but
formation of the chromophore takes a long time, t.sub.1/2=300
seconds. So the method can be slower than FRET. Because the
chromophore forms permanently, it can be used in a nanoprobe to
provide a long-lasting result.
[0220] In one example, the tag is a quencher. For example, if a
quencher is used in combination with an acceptor fluorophore, the
decreased acceptor signal is the detectable signal. In another
example, a quencher is used in combination with a donor
fluorophore, the decreased acceptor signal is the detectable
signal.
Quantum Dots
[0221] In one example, one or more Medusa probes disclosed herein
are attached to fluorescent nanoparticles referred to as quantum
dots. The quantum dot or Cornell dot (silica coated fluorophores)
can be the donor fluorophore, while the nanoprobes attached to the
quantum dot can include one or more corresponding acceptor
fluorophores (for example associated with the chemical moieties).
In particular examples, the nanoprobes are attached to the quantum
dot directly, or via a linker, such as with antibodies coating the
quantum dot.
[0222] The quantum dots can be tethered together, for example with
a molecular linker of a sufficient length to prevent significant
FRET. In another example, quantum dots are tethered together using
a molecular linker (such as tetrahedron constructions) that keep
the chemical moieties a significant distance from the surface of
the quantum dot. Then when a chemical moiety on the nanoprobe pairs
with the complementary exposed base on the target nucleic acid
molecule, the chemical moiety is detected by FRET.
Attachment of Probe to a Substrate
[0223] In particular examples, the probes of the present disclosure
are attached to a substrate, for example via a linker. Therefore,
provided by the present disclosure are probes attached to a
substrate.
[0224] In particular examples, the polymerizing agent of the probe
is attached to a substrate, such as glass or a plastic material.
Methods of attaching proteins to a substrate are known in the art.
For example, a linker can be used to attach the polymerizing agent
to a substrate. Ideally, the linker does not significantly
interfere with the biological activity of the polymerizing agent.
The linker can be a covalent or non-covalent means of
attachment.
[0225] In one example, the linker is a pair of molecules, having
high affinity for one another, one molecule on the polymerase (such
as an affinity tag), the other on the substrate. Such high-affinity
molecules include streptavidin and biotin, histidine and nickel
(Ni), histidine and Si, and GST and glutathione. When the
polymerase and substrate are brought into contact, they bind to one
another due to the interaction of the high-affinity molecules. For
example, a polymerase can be engineered to include a 6.times.
His-tag (for example using standard molecular biology methods), and
then attached to a surface that includes Si (for example see Cha et
al., Proteomics 4:1965-76, 2004). Similarly, a polymerase can be
engineered to include an S-tag, glutathione-S-transferase (GST), or
streptavidin.
[0226] In another example, the linker is a straight-chain or
branched amino- or mercapto-hydrocarbon with more than two carbon
atoms in the unbranched chain. Examples include aminoalkyl,
aminoalkenyl and aminoalkynyl groups. Alternatively, the linker is
an alkyl chain of 10-20 carbons in length, and may be attached
through a Si-C direct bond or through an ester, Si--O--C, linkage
(see U.S. Pat. No. 5,661,028 to Foote, herein incorporated by
reference). Other linkers are provided in U.S. Pat. No. 5,306,518
to Prober et al., column 19; and U.S. Pat. No. 4,711,955 to Ward et
al., columns 8-9; and U.S. Pat. No. 5,707,804 to Mathies et al.
columns 6-7 (all herein incorporated by reference).
Exemplary Nanoprobes for Sequencing
[0227] The present disclosure provides multiple examples of
nanoprobes that can be used to sequence one or more target nucleic
acid sequences.
[0228] One particular example of a probe of the present disclosure
is shown in, FIG. 1A. The probe 10 includes polymerizing agent 12,
and four molecular linkers 14, 16, 18, 20 that attach the chemical
moieties 22, 24, 26, 28 to the polymerizing agent 12. The chemical
moieties 22, 24, 26, 28 are capable of interacting with one another
or with polymerizing agent 12 in a predetermined reaction, wherein
the molecular linkers 14, 16, 18, 20 maintain the chemical moieties
22, 24, 26, 28 sufficiently spaced from one another and from the
polymerizing agent 12 in the absence of a target nucleic acid. In
particular examples, the chemical moieties 22, 24, 26, 28 are
spaced a distance from one another to avoid substantial
entanglement of the chemical moieties 22, 24, 26, 28.
[0229] In some examples, the probe 10 includes a tag 30 that is
associated with the polymerizing agent 12 and different tags 32,
34, 36, 38 that are associated with the chemical moieties 22, 24,
26, 28, respectively. Probe 10 shows the tag 30 directly attached
to the polymerizing agent 12 and the tags 34, 36, 38 directly
attached to the chemical moieties 24, 26, 28, respectively. In
contrast, tag 32 is not attached directly to chemical moiety 22 but
is attached to linker 14 in sufficient proximity to chemical moiety
22 to emit a signal when chemical moiety 22 pairs with its
complementary nucleotide in the target nucleic acid molecule.
Similarly, tag 30 could be attached to the polymerizing agent 12
via a linker.
[0230] The molecular linkers 14, 16, 18, 20 are of a length and/or
rigidity such that the chemical moieties 22, 24, 26, 28 do not
substantially interact with one another or with the polymerizing
agent 12 in an absence of the target nucleic acid molecule.
However, in the presence of the target nucleic acid molecule, the
molecular linkers 14, 16, 18, 20 permit the chemical moieties 22,
24, 26, 28 to sufficiently interact with the polymerizing agent 12
in the presence of the target nucleic acid molecule in the
predetermined reaction. For example, in the presence of the target
nucleic acid molecule the polymerizing agent 12 attaches to the
target and its complementary primer to permit the tags 32, 34, 36,
38 on or near the chemical moieties 22, 24, 26, 28 to interact with
the tag 30 of polymerizing agent 12 (for example when tag 30 is
adjacent to the active site of the polymerizing agent) and with the
target nucleic acid molecule, to yield a signal (such as light).
For example, as shown in FIG. 1B, probe 39 can bind to a target
nucleic acid molecule 40 (not part of the probe) and to its
complementary primer 42 (not part of the probe), from which the
complementary strand elongates. As shown in FIG. 1B, the next
nucleotide on the target nucleic acid molecule 40 is a "T" 44,
which can specifically pair with the complementary chemical moiety
(shown here as mononucleotide "A" 26). The molecular linker 18 is
of a sufficient length and flexibility to bend towards polymerizing
agent 12 and permit the mononucleotide "A" 26 to reversibly
interact with the complementary strand 42, and pair with
complementary nucleotide T 44. However, "A" 26 will not be
incorporated permanently into the complementary strand 42. Instead,
"A" 26 will be replaced with a hydrolyzable dATP 46 (not part of
the probe) that is present in the sequencing reaction (along with
other nucleotides dCTP 48, dGTP 50, dTTP 52 that are not part of
the probe) that can be incorporated into the elongating
complementary strand 42. The pairing of "A" 26 with "T" 44 on the
target nucleic acid molecule 40 will generate a detectable signal
due to the interaction of the tag 30 associated with the
polymerizing agent 12 and the tag 36 associated with "A" 26.
However, the other chemical moieties 22, 24, 28 will not be present
in the active site of the polymerizing agent for a sufficient
amount of time to generate a detectable signal as they are not
complementary to the "T" 44 in the target nucleic acid molecule
40.
[0231] The probe 10 shown in FIG. 1A is an example of showing the
attachment of a plurality of molecular linkers 14, 16, 18, 20, to
multiple points on the polymerizing enzyme 12. An alternative
example showing the attachment of a plurality of molecular linkers
to a single point on the polymerizing enzyme is shown in FIG. 1C.
The probe 60 includes a polymerizing enzyme 12 and a molecular
linker composed of multiple tethers 14, 16, 18, 20 attached to a
molecular rod 62 which acts as a "hub". The molecular linker is
attached to the polymerizing enzyme 12 at one point via a linker 64
which allows the "hub" 62 to rotate freely, thereby providing equal
access to the polymerizing enzyme 12.
[0232] FIGS. 2A-D show Medusa nanoprobes that can be used to
sequence a nucleic acid molecule, wherein the molecular linker is a
branched structure attached to the polymerizing agent at a single
point. However, one skilled in the art will appreciate that
multiple branched molecular linkers can be attached to a single
polymerizing agent.
[0233] The probe 100 shown in FIG. 2A includes a molecular linker
102 having a branched structure. The molecular linker 102 is
attached to the polymerizing agent 104 at a single point via tether
106. The molecular linker 102 includes multiple tethers 106, 108,
110, 112, 114, 116, 118, 120 and multiple molecular rods 122, 124,
126, 128. The tethers 106, 108, 110, 112, 114, 116, 118, 120
provide flexibility to the probe, and the molecular rods 122, 124,
126, 128 provide rigidity, for example to decrease entanglement of
the branches of the molecular linker 102. The chemical moieties
130, 132, 134, 136 shown here as nonhydrolyzable A 130, C 132, G
134, and T 136 analogs, are attached to the molecular linker 102 at
the ends of the tethers 112, 114, 118, 120 respectively. For
example, the four nonhydrolyzable nucleotide analogs 130, 132, 134,
136 can be attached by their .gamma.-phosphate to an amino
terminated polyethylene glycol (PEG) tether 112, 114, 118, 120. The
tethers 112, 114, 118, 120 allow free rotation of each segment, so
that each of the four chemical moieties 130, 132, 134, 136 has
equal access to the polymerizing agent 104. Tethers 112, 114, are
attached to molecular rod 126 and tethers 118, 120 are attached to
molecular rod 128. The molecular rods 126, 128 are connected
together by tethers 110, 116 that are joined by another molecular
rod 124. Molecular rod 124 is connected to tether 108, which is
connected to molecular rod 122, which is connected to tether 106
that attaches to the polymerizing agent 104. For example, tether
106 can include an amino terminus that is attached to the
polymerizing agent 104 via a cysteine or a different chemically
modified residue on the polymerizing agent 104. In particular
examples, the tethers 106, 108, 110, 112, 114, 116, 118, 120 are
composed of PEG, and the molecular rods 122, 124, 126, 128 are
composed of dsDNA. If desired, the dsDNA can include restriction
sites as indicated in FIG. 2A, (such as EcoRI, BamHI, PstI or
HindIII) which can be used to confirm the proper construction of
the probe.
[0234] Probe 100 also includes a tag 138 associated with the
polymerizing agent 104, and different tags 140, 142, 144, 146
associated with each chemical moiety 130, 132, 134, 136
respectively. In probe 100, the tags 138, 140, 142, 144, 146 are
not directly attached to the polymerizing agent 104 or the chemical
moieties 130, 132, 134, 136. Instead, the tags 138, 140, 142, 144,
146 are located on part of the molecular linker 106, 112, 114, 118,
120. The probe 100 is shown bound to a primer 148, which is
hybridized to a target nucleic acid molecule 150. However, the
primer 148 and the target nucleic acid molecule 150 are not part of
the probe 100. The molecular rods 122, 124, 126, 128 can provide
rigidity, for example to reduce the interaction of the chemical
moieties 130, 132, 134, 136 with the polymerizing agent 104 in the
absence of the target nucleic acid molecule 150, or to reduce the
interaction of tag 138 with tags 140, 142, 144, 146 in the absence
of the target nucleic acid molecule 150. In addition, the molecular
rods 122, 124, 126, 128 reduce the interaction of the three
non-complementary chemical moieties when the complementary chemical
moiety is bound to the target nucleic acid molecule 150 in the
binding pocket of the polymerizing agent 104.
[0235] A variant of probe 100 is shown in FIG. 2B. Probe 200 also
includes a molecular linker 202 having a branched structure;
however the branched structure is more symmetrical. For example, in
probe 100, when one of the chemical moieties (such as 130) is bound
to the active site of the polymerizing agent 104, one of the other
chemical moieties (such as 132) is closer than the other chemical
moieties (such as 134, 136). This may increase background signal,
for example if donor and acceptor fluorophores are included in the
probe 100. In contrast, probe 200 allows all chemical moieties the
same access to the polymerizing agent.
[0236] The molecular linker 202 is attached to the polymerizing
agent 204 at a single point via tether 206. The molecular linker
202 includes multiple tethers 206, 208, 210, 212, 214 and multiple
molecular rods 216, 218, 220, 222, 224. The tethers 206, 208, 210,
212, 214 provide flexibility to the probe, and the molecular rods
216, 218, 220, 222, 224 provide rigidity, for example to decrease
entanglement of the branches of the molecular linker 202. The
chemical moieties 226, 228, 230, 232, shown here as nonhydrolyzable
A 226, C 228, G 230, and T 232 analogs, are attached to the
molecular linker 202 at the ends of the tethers 208, 210, 212, 214,
respectively. For example, the four nonhydrolyzable nucleotide
analogs 226, 228, 230, 232 can be attached by their
.gamma.-phosphate to an amino-terminated polyethylene glycol (PEG)
tether 208, 210, 212, 214. The tethers 206, 208, 210, 212, 214
allow free rotation of each Medusa "arm", so that each of the four
chemical moieties 226, 228, 230, 232 has equal access to the
polymerizing agent 204. Tethers 208, 210 are attached to molecular
rods 216, 218, respectively, and molecular rods 216, 218 are
attached to molecular rod 220. In particular examples, molecular
rods 216, 218, 222, 224 are each 20 nucleotides of ds DNA.
Molecular rod 220 is also attached to molecular rods 222, 224,
which are attached to tether 212 and 214, respectively. Molecular
rod 220 is connected to tether 206, which attaches to the
polymerizing agent 204. In particular examples, the tethers 206,
208, 210, 212, 214 are composed of PEG, and the molecular rods 216,
218, 220, 222, 224 are composed of dsDNA. If desired, the dsDNA can
include restriction sites as indicated in FIG. 2B, (such as EcoRI,
BamHI, PstI or HindIII) which can be used to confirm the proper
construction of the probe. In one example, the polymerizing agent
204 is attached to the molecular linker by including a ter DNA site
in molecular rod 220, wherein the polymerizing agent 204 is a
polymerase-Tus fusion protein. The ter DNA site will specifically
bind to the Tus protein. This eliminates the need for tether
206.
[0237] Probe 200 also includes a tag 234 associated with the
polymerizing agent 204, and different tags 236, 238, 240, 242
associated with each chemical moiety 226, 228, 230, 232,
respectively. In probe 200, the tags 234, 236, 238, 240, 242 are
not directly attached to the polymerizing agent 204 or the chemical
moieties 226, 228, 230, 232. Instead, the tags 234, 236, 238, 240,
242 are located on part of the molecular linkers 206, 208, 210,
212, 214. The probe 200 is shown bound to a primer 242, which is
hybridized to a target nucleic acid molecule 244. However, the
primer 242 and the target nucleic acid molecule 244 are not part of
the probe 200. The molecular rods 216, 218, 220, 222, 224 can
provide rigidity, for example to reduce the interaction of the
chemical moieties 226, 228, 230, 232 with the polymerizing agent
204 in the absence of the target nucleic acid molecule 244, or to
reduce the interaction of tag 234 with tags 236, 238, 240, 242 in
the absence of the target nucleic acid molecule 244. For example,
molecular rod 220 can keep the individual branches of the molecular
linker 202 away from the tag 234 in the absence of target nucleic
acid molecule 244. In addition, the molecular rods reduce the
interaction of the three non-complementary chemical moieties when
the complementary chemical moiety is bound to the target nucleic
acid molecule 244 in the binding pocket of the polymerizing agent
204.
[0238] A variant of probes 100 and 200 is shown in FIG. 2C. Probe
300 also includes a molecular linker 302 having a branched
structure. Probe 300 shows the use of DNA hybridization to
construct a probe using only one amino group per molecular
rod/tether (such as a DNA/PEG chain). The molecular linker 302 is
attached to the polymerizing agent 304 at a single point via
tethers 306, 308 joined by molecular rod 310. The molecular linker
302 includes multiple tethers 306, 308, 312, 314, 316, 318, 320,
322, 324, 326 and multiple molecular rods 310, 328, 330, 332, 334,
336, 338, 340, 342, 344. The tethers 306, 308, 312, 314, 316, 318,
320, 322, 324, 326 provide flexibility to the probe, and the
molecular rods 310, 328, 330, 332, 334, 336, 338, 340, 342, 344
provide rigidity, for example to decrease entanglement of the
branches of the molecular linker 302. The chemical moieties 346,
348, 350, 352, shown here as nonhydrolyzable A 346, C 348, G 350,
and T 352 analogs, are attached to the molecular linker 302 at the
ends of the tethers 318, 312, 326, 320, respectively. For example,
the four nonhydrolyzable nucleotide analogs 346, 348, 350, 352 can
be attached by their .gamma.-phosphate to an amino terminated
polyethylene glycol (PEG) tether 318, 312, 326, 320. The tethers
314, 316, 322, 324 allow free rotation of each segment, so that
each of the four chemical moieties 346, 348, 350, 352 has equal
access to the polymerizing agent 304. In particular examples, the
tethers 306, 308, 312, 314, 316, 318, 320, 322, 324, 326 are
composed of PEG, and the molecular rods 310, 328, 330, 332, 334,
336, 338, 340, 342, 344 are composed of dsDNA. If desired, the
dsDNA can include restriction sites as indicated in FIG. 2C, (such
as EcoRI, BamHI, PstI or HindIII) which can be used to confirm the
proper construction of the probe.
[0239] Probe 300 also includes a tag 354 associated with the
polymerizing agent 304, and different tags 356, 358, 360, 362
associated with each chemical moiety 346, 348, 350, 352,
respectively. In probe 300, the tags 354, 356, 358, 360, 362 are
not directly attached to the polymerizing agent 304 or the chemical
moieties 346, 348, 350, 352. Instead, the tags 354, 356, 358, 360,
362 are located on part of the molecular linker 310, 334, 328, 344,
338. FIG. 2C (double-headed arrow) also shows how multiple tags can
be associated with each chemical moiety (such as multiple
fluorophores or dendrimers), for example to reduce loss of the
signal by bleaching. For example molecular rod 334 can be formed by
DNA hybridization with a ssDNA including multiple tags 364, instead
of a ssDNA including only one tag. The probe 300 is shown bound to
a primer 366, which is hybridized to a target nucleic acid molecule
368. However, the primer 366 and the target nucleic acid molecule
368 are not part of the probe 300. The molecular rods 310, 328,
330, 332, 334, 336, 338, 340, 342, 344 can provide rigidity, for
example to reduce the interaction of the chemical moieties 346,
348, 350, 352 with the polymerizing agent 304 in the absence of the
target nucleic acid molecule 368, or to reduce the interaction of
tag 354 with tags 356, 358, 360, 362 in the absence of the target
nucleic acid molecule 368. In addition, the molecular rods reduce
the interaction of the three non-complementary chemical moieties
when the complementary chemical moiety is bound to the target
nucleic acid molecule 368 in the binding pocket of the polymerizing
agent 304.
[0240] A variant of probe 300 is shown in FIG. 2D. Probe 400 is
identical to probe 300, except that probe 400 includes a molecular
linker 402, wherein multiple types of tags associated with each
chemical moiety 346, 348, 350, 352, instead of a single tag. For
example, chemical moiety 346 is associated with tags 404, 406,
chemical moiety 348 is associated with tags 404, 408, chemical
moiety 350 is associated with tags 404, 410, and chemical moiety
352 is associated with tags 406, 408, 410. By using several tags,
corrections can be made to the signal emitted upon pairing of a
chemical moiety with its complementary base in the target nucleic
acid strand. For example, if the tag is an acceptor fluorophore,
probe 400 permits detection and in some examples correction of
fluorophore bleaching, or loss of one or more of the molecular
linker branches. The probe 400 is shown bound to a primer 366,
which is hybridized to a target nucleic acid molecule 368. However,
the primer 366 and the target nucleic acid molecule 368 are not
part of the probe 400.
[0241] In examples where the chemical moieties shown in FIGS. 1A-1C
and 2A-2D are nucleotide analogs, the nucleotide analogs can be
attached to the molecular linker by the base, at the 3' hydroxyl of
the sugar, or at a phosphate (such as the .alpha., .beta., or
.gamma. phosphate) or to any point on a nucleotide that does not
interfere with specific binding to the active site of a
polymerizing agent or complementary base pairing. The chemical
moieties shown in FIGS. 1A-1C and 2A-2D can be different chemical
moieties (as shown in FIGS. 1A-1C and 2A-2D), or can be the same
chemical moieties (in which case nanoprobes with each type of
chemical moiety could be included in the sequencing reaction). In
particular examples, the tag associated with the polymerizing
agents shown in FIGS. 1A-1C and 2A-2D is a donor fluorophore, and
the tag associated with each chemical moiety includes an acceptor
fluorophore. For example, if multiple types of chemical moieties
are on the same probe, each chemical moiety can be associated with
a unique acceptor fluorophore or combinations of fluorophores.
Generation of Nanoprobes
[0242] Many methods are available for generating the disclosed
nanoprobes. For example, methods of attaching a tag to another
molecule are known. In addition, methods of generating DNA-PEG
structures are known. Although particular methods are provided
herein, the disclosure is not limited to these methods.
DNA/PEG Synthesis and Attachments
[0243] In examples where the molecular linker includes one or more
DNA molecular rods and one or more PEG tethers, the following
methods can be used. DNA of any desired sequence can be obtained
from a variety of commercial sources (such as Invitrogen,
Synthegen, Sigma). The sequence of the DNA can be generated using
the NANEV program, which employs "evolutionary methods for the
design of nucleic acid nanostructures" (Goodman et al.,
BioTechniques, 38:548-50, 2005). This program can be used to design
DNA sequences in a nanoprobe so that only the desired structure
forms by hybridization. In particular examples a PEG tether is
incorporated as a standard phosphoramidite `spacer` anywhere within
the molecular linker. It is also possible to introduce an amino
group anywhere in the DNA sequence.
[0244] By appropriate use of DNA-DNA hybridization, a nanoprobe can
be constructed using only one amino group per DNA/PEG linker. This
allows the amino group to be used to attach a fluorophore or
protein on the nanoprobe, for example as shown in FIG. 1A.
[0245] In one example a DNA-PEG-NH.sub.2-dNTP is purified away from
DNA-PEG-NH.sub.2 using beads or another substrate to which a
polymerase is attached. DNA-PEG-NH.sub.2-dNTP will bind to the
polymerase, while DNA-PEG-NH.sub.2 will not.
Attachment of Tags to Chemical Moieties
[0246] A tag can be attached to a chemical moiety. For example, if
the chemical moiety is a nucleotide analog, the tag can be attached
to the base, sugar, .alpha., .beta., or .gamma. phosphate.
Attachment of Molecular Linker to Chemical Moieties
[0247] A chemical moiety can be attached to a molecular linker. For
example, if the chemical moiety is a nucleotide analog, the
molecular linker can be attached to the base, sugar (for example at
the 3' hydroxyl of the sugar), .alpha., .beta., or .gamma.
phosphate. Ideally, such attachment does not interfere with the
ability of the chemical moiety to bind to the active site of the
polymerizing agent or the ability to pair with a complementary
nucleotide base. Methods of attaching a chemical moiety to a
molecular linker are known in the art, and the disclosure is not
limited to particular methods. For example, to attach the molecular
linker to .gamma. phosphate, the 5'-Amino-Modifier C6 TFA, can be
used (available from Synthegen, Houston, Tex.; and IDT, Coralville,
Iowa). Other methods that can be used to attach a nucleotide analog
to a linker are described in U.S. Pat. No. 6,936,702 (herein
incorporated by reference).
Attachment of Molecular Linker to Polymerizing Agent
[0248] In one example, one or more molecular linkers are attached
to the polymerizing agent using the Tus protein to bind to a ter
DNA site. For example, the Tus protein can be fused to the
polymerizing agent using standard cloning techniques. Part of the
molecular linker can include a ter DNA site, which will
specifically bind to the Tus protein. The Tus-ter bond dissociation
constant is 10.sup.-13 M (Neylon et al., Microbial. Mol. Biol. Rev.
69:501-26, 2005).
Protein Linkers
[0249] In particular examples, the molecular linkers are composed
of flexible protein chains, such as ser-gly. For example, a
polymerizing agent can be extended to have flexible loops that form
the molecular linkers. The chains loop back to continue the
polymerase. The chemical moieties (such as dNTPs) can be added
enzymatically, for example by attachment to an amino acid such as
lysine or cysteine. The polymerase recognizes the particular
molecular linker and attaches the appropriate base. Attachment can
be, for example, on a regular dNTP if the result is
non-hydrolyzable. In one example, the polymerase and the flexible
molecular linker are expressed on the surface of a phage that
carries the gene for the modified polymerase. A particular dNTP can
be attached to a solid support, such as a column, for example on
the 3' end. The phage expressing the modified polymerase is
contacted with the solid support under conditions that permit
binding of the polymerase to the dNTP. This permits selection of
phage that express the modified polymerase. The modified polymerase
can further include a donor fluorophore such as GFP, YFP, RFP, CFP
and aequorin.
Methods of Sequencing a Target Nucleic Acid Molecule
[0250] The present disclosure provides methods of sequencing a
target nucleic acid molecule, such as two or more target nucleic
acid molecules simultaneously. Sequencing can be performed in
vitro, ex vivo, in situ (for example using a biological sample
obtained from a subject), or in vivo (for example by sequencing
within a cell). In particular examples, the target nucleic acid
strand includes one or more mutations associated with disease.
[0251] In particular examples, the target nucleic acid molecule is
obtained from a subject. For example, the target nucleic acid
molecule can be present in a biological sample obtained from a
subject. In other examples, the target nucleic acid molecule is
present in a subject, and exposing the template nucleic acid
molecule to an oligonucleotide primer and the probe includes
introduction of an oligonucleotide primer and the probe to a cell
of the subject.
[0252] In particular examples, the method of determining the
nucleic acid sequence of a target nucleic acid molecule includes
exposing the target nucleic acid molecule to one or more of the
probes disclosed herein, in the presence of an oligonucleotide
primer and a mixture of hydrolyzable nucleotides. The hydrolyzable
nucleotides are capable of being incorporated into an elongating
nucleic acid molecule by pairing with a complementary nucleotide in
the target nucleic acid molecule, and replacing the chemical moiety
that reversibly binds to the complementary nucleotide on the target
nucleic acid molecule. When the hydrolyzable nucleotide replaces
the chemical moiety this steps the polymerizing agent forward one
base. Since the chemical moieties are not permanently incorporated
into the elongating complementary strand, they will eventually
diffuse out of the active site of the polymerizing enzyme. The
emission of a sequence of signals is detected, wherein the emission
of a characteristic signal indicates pairing of the chemical moiety
on the linker with its complementary nucleotide. Such a
characteristic signal can also indicate which hydrolyzable
nucleotide will be incorporated next into the elongating nucleic
acid molecule that is complementary to the target nucleic acid
molecule. In particular examples, the emission of a sequence of
signals is converted into a nucleic acid sequence. In some
examples, the emission of a sequence of signals is generated by
luminescence resonance energy transfer (LRET) or Forster resonance
energy transfer (FRET). In particular examples, the sequence of
signals are detected with a charge-coupled device (CCD) camera and
converted into the nucleic acid sequence. The sequence of signals
can also be stored in a computer readable medium. Because the
chemical moieties are not removed from the linker, the probe can be
used again.
[0253] This method therefore solves the problem of incorporating
fluorescently labeled nucleotides into an elongating complementary
nucleic acid molecule, because the non-labeled hydrolyzable
nucleotides are the only ones incorporated into the elongating
strand. The resulting complementary nucleic acid molecule contains
normal nucleotides.
[0254] In particular examples, the polymerizing agent is associated
with a tag, and each of the chemical moieties is also associated
with a tag that identifies a particular chemical moiety carried by
the linker, wherein interaction of the tag associated with the
polymerizing agent with the tag associated with the chemical moiety
induces emission of the characteristic signal that indicates
pairing of the chemical moiety with its complementary nucleotide.
As described above, the tags can either be directly attached to the
polymerizing agent and the chemical moieties, or indirectly
associated with, for example present on, a molecular linker in
sufficient proximity to the polymerizing agent or chemical
moiety.
[0255] In some examples, the tag associated with the polymerizing
agent includes a donor fluorophore and the tag that identifies a
particular chemical moiety includes one or more acceptor
fluorophores. Sufficient interaction of the polymerizing agent and
the chemical moiety, for example the presence of the chemical
moiety in the active site in the polymerizing agent and pairing of
the chemical moiety with the complementary nucleotide on the target
nucleic acid strand, brings the acceptor fluorophore into a
proximity with a donor fluorophore to permit excitation of the
acceptor fluorophore by the donor fluorophore. In such examples,
detecting the signal can include detecting a fluorescent signal
emitted from the acceptor fluorophore (such as an increase in
fluorescence), or detecting a fluorescent signal emitted from the
donor fluorophore (such as a decrease in fluorescence). In a
specific example, the donor fluorophore is GFP, and the acceptor
fluorophores are BODIPY, fluorescein, rhodamine green, Oregon
green, or derivatives thereof In another specific example, the
donor fluorophore is Alexa Fluor 430, and the acceptor fluorophores
are Alexa Fluors 546, 568, 594, and 647.
[0256] In some examples where one of the tags is a donor
fluorophore, the method can further include exciting the donor
fluorophore to emit an excitation signal which stimulates the one
or more acceptor fluorophores to emit the characteristic signal
that indicates pairing of the chemical moiety on the linker with
its complementary nucleotide. For example, the donor can be
excited, for example using electromagnetic radiation, such as a
coherent beam of light provided by a laser which emits
electromagnetic radiation of a particular wavelength, or light
within a narrow range of wavelengths. In other examples, the donor
is excited by a luminescent molecule (such as aequorin). In some
examples, the donor is continually excited. However, not all donor
fluorophores will require excitation by an external source. For
example, chemiluminescent donor molecules do not require excitation
by an external source. Ideally, the source of excitation of the
donor fluorophore does not significantly excite the acceptor
fluorophores.
[0257] The emission of the characteristic signal that indicates
pairing of a particular chemical moiety (such as a nonhydrolyzable
A, C, G, or T analog) on the molecular linker with its
complementary nucleotide can be converted into a nucleic acid
sequence. The series of emission signals, for example emitted in a
microscope field as each chemical moiety is paired with its
complementary nucleotide, is captured. For example, the emission
signal can be collected with a microscope objective lens and a
complete emission spectrum for each tag associated with a chemical
moiety is generated by a spectrophotometer. The complete emission
spectrum is captured by a detection device, such as CCD-camera, for
each tag associated with a chemical moiety as each chemical moiety
is paired with its complementary nucleotide in the microscope field
of view. The CCD camera collects the emission spectrum and converts
the spectrum into a set of charges. The charges for each chemical
moiety pairing can be recorded by a computer, for converting the
sequence of emission spectra into a nucleic acid sequence for each
nucleic acid in the microscope field of view using an algorithm,
such as a least-squares fit between the signal spectrum and the
spectrum for the tag on each class of chemical moieties.
[0258] Although many different algorithms can be used to convert
the emission spectra into a nucleic acid sequence, this specific
example illustrates one approach. Four fluorescent spectra (Anm,
Cnm, Gnm and T/Unm) are generated from macroscopic measurements.
From the sample, an unknown noisy spectrum (Snm) is generated. The
unknown spectrum is assumed to be the sum of the four known spectra
with only four weights, a, c, g and t/u, representing the relative
proportions of the nonhydrolyzable analogs. So at 520 nm through
523 nm, this results in five equations:
A520*a+C520*c+G520*g+T520*t=S520
A521*a+C521*c+G521*g+T521*t=S521
A522*a+C522*c+G522*g+T522*t=S522
A523*a+C523*c+G523*g+T523*t=S523
A524*a+C524*c+G524*g+T524*t=S524
[0259] Filling in the known values, such as for example A520, the
unknown values a, c, g, and t/u are solved for by using a least
squares linear regression.
[0260] In this particular example, the donor fluorophore associated
with the polymerizing agent is GFP H9-40, and the chemical moieties
are associated with acceptor fluorophores as follows:
nonhydrolyzable A is labeled with BODIPY; nonhydrolyzable T is
labeled with fluorescein; nonhydrolyzable C is labeled with
rhodamine; nonhydrolyzable G is labeled with Oregon green. In
another example, the donor fluorophore associated with the
polymerase is H9-40, and the chemical moieties are associated with
acceptor fluorophores as follows: nonhydrolyzable A is labeled with
tetramethylrhodamine; nonhydrolyzable T/U is labeled with
napthofluorescein; nonhydrolyzable C is labeled with lissamine;
nonhydrolyzable G is labeled with Texas Red. The emission spectrum
of each of the acceptor fluorophores is monitored, and the spectrum
of each of the fluorophores can be distinguished from each other,
so that the pairing of each different type of chemical moiety with
its complementary base can be detected.
[0261] The process of determining the relative proportions of the
unknown tags is known in the art as `linear unmixing` (Dickinson et
al., Biotechniques 31:1272, 1274-6, 1278, 2001). An individual
nanoprobe will give predominantly a single nucleotide sequence,
while a collection of nanoprobes can give a mixture of nucleotide
sequences. If the collection of nanoprobes are synchronized for a
period of time or by stepping them along the sequence by adding
only one hydrolyzable nucleotide at a time (as in a flow cell) then
the collection will substantially report a single sequence. The
relative proportions of bases in a sequence can be presented by the
sequence logo technique (Schneider and Stephens, Nucleic Acids Res.
18:6097-100, 1990).
[0262] In particular examples, one or more components of the
sequencing reaction are attached or fixed to a substrate, such as a
glass, plastic, or metal substrate. For example, the probe, target
nucleic acid, or primer can be fixed to a substrate. As described
above, the probe can be attached to the substrate via the
polymerizing agent. Nucleic acid molecules (such as the target
nucleic acid or primer) can be attached to the substrate at the 5'
end, the 3' end, or internally.
[0263] The method can include performing a plurality of sequencing
reactions substantially simultaneously, and detecting the sequence
of signals from the plurality of sequencing reactions. For example,
a plurality of polymerizing agents, template nucleic acid
molecules, or oligonucleotide primers can be fixed directly or
indirectly to the substrate in a predetermined pattern. Detecting
the sequence of signals can include correlating the signal with a
nucleic acid molecule corresponding to a predetermined position
within that pattern. The polymerizing agents, template nucleic acid
molecules, or oligonucleotide primers can be fixed to the substrate
in the predetermined pattern in channels which have been etched in
an orderly array, by micropipetting droplets onto a substrate.
[0264] In some examples, the levels of nucleotides present in the
sequencing reaction are controlled. For example, the probe is
incubated with the primer and target nucleic acid molecule in the
absence of added hydrolyzable nucleotides. The signal generated
will indicate the nucleotide exposed on the target nucleic acid
molecule, and thus the next nucleotide to be added. That nucleotide
is then added, to step the probe forward by one or more positions.
The nucleotide is removed (for example by washing), and the cycle
is repeated.
[0265] FIG. 1B provides a particular example of how the disclosed
probes can be used to sequence a nucleic acid molecule. One skilled
in the art will appreciate that any of the disclosed probes can be
substituted for probe 39. The method can include contacting a
target nucleic acid sequence 40 with an oligonucleotide primer 42
and probe 39 (or any other probe shown herein, such as those shown
in FIGS. 1A-B and 2A-D), in the presence of a mixture of
non-labeled hydrolyzable nucleotides 46, 48, 50, 52 (such as dATP,
dCTP, dGTP, and dTTP; or NTPs for an RNA polymerase). In the
absence of a nucleic acid molecule to be sequenced 40 (not part of
the nanoprobe) there is little detectable signal. When the
polymerizing agent 12 is bound to a target nucleic acid sequence 40
at a primer 42, a base 44 (herein "T") is exposed on the target
strand 40. The molecular linkers 14, 16, 18, 20 will move by
Brownian motion, allowing the chemical moieties 22, 24, 26, 28 at
the ends to approach and pair to the exposed base 44 on the target
nucleic acid molecule 40 in the active site of the polymerizing
agent 12. The chemical moieties 22, 24, 26, 28 at the ends of the
molecular linkers 14, 16, 18, 20 compete for binding to base 44,
but only one of the four chemical moieties (in this case 26) will
be complementary to the exposed base 44. When an incorrect pairing
occurs by the non-complementary chemical moieties (in this case 22,
24, 28), the chemical moiety (in this case 22, 24, or 28) will
quickly dissociate. However, when a correct pairing occurs (in this
example complementary chemical moiety 26), the correct chemical
moiety will dwell for a substantial time in the active site of the
polymerizing agent 12 and pair with the complementary base 44.
During this time, the corresponding tag 36 (such as an acceptor
fluorophore) on the complementary chemical moiety 26 will be in
sufficient proximity to tag 30 (such as an donor fluorophore)
associated with the polymerizing agent 12 for tag 30 to interact
with tag 36, thereby producing a characteristic signal (such as
acceptor emission signal) for that chemical moiety 26. Each of the
tags 32, 34, 36, 38 produces a distinguishable emission signal. All
of the chemical moieties 22, 24, 26, 28, will diffuse in and out of
the active site, but the tag 36 associated with the chemical moiety
26 that is complementary to exposed base 44 will dominate the
signal because it occupies the active site the longest, and can
properly pair with the complementary base 44. Since the chemical
moieties 22, 24, 26, 28, cannot be added to the elongating nucleic
acid chain 42, the chain will not elongate until the chemical
moiety in the active site of the polymerizing agent is replaced by
a non-labeled hydrolyzable nucleotide (in this case 46). Thus the
detectable signal indicates the next non-labeled hydrolyzable
nucleotide (in this case 46) that will be incorporated into the
elongating complementary strand 42. The appropriate hydrolyzable
nucleotide 46 will eventually be incorporated into the elongating
complementary strand 42, and the polymerizing agent 12 will step
forward one position. This exposes the next complementary base on
the target nucleic acid 40 and the cycle is repeated. The varying
emission signals correspond to the target nucleotide sequence.
During the stepping process in which the hydrolyzable nucleotide 46
is incorporated, only donor signal will be emitted.
[0266] In particular examples, the polymerizing agent 12 is
attached to a substrate, such as a microscope slide (for example by
a linker). The substrate can be mounted onto a microscope stage. In
particular example, the sequencing reaction takes place in an
aqueous environment, which can be sealed to prevent desiccation,
for example by covering with a glass cover slip. In such examples,
the nucleic acid to be sequenced 40 has an annealed oligonucleotide
primer 42, and is bound by the anchored polymerizing agent 12. To
start the sequencing reaction, a mixture of non-labeled
hydrolyzable nucleotides 44, 46, 48, 50 is added along with the
nanoprobes. The sequencing reaction will proceed as described
above. Because all of the necessary components for sequencing are
supplied and available at all times, no external pumping devices or
reservoirs are required.
[0267] Therefore, the method allows for the sequencing of nucleic
acids by monitoring the pairing of a chemical moiety that is
reversibly bound to its complementary base on the target nucleic
acid molecule on the molecular level, instead of sequencing by
monitoring macromolecular events, such as a pattern on an
electrophoresis gel, whose signal is representative of a large
population of nucleic acid molecules. Using this method in
combination with a large field of view, it is possible that 1000 or
more DNA molecules could be sequenced simultaneously, at sequencing
speeds of up to 750 base pairs per second, which is the rate of a
fast DNA polymerase (Watson et al., Molecular Biology of the Gene,
4.sup.th Edition, The Benjamin/Cummings Publishing Co., Inc., Menlo
Park, Calif., 1987, page 110). Each DNA molecule to be
copied/sequenced, and its associated probe, can correspond to a
particular portion of the field of view in which the polymerizing
agent-mediated reaction is occurring.
Altering the Rate of Sequencing
[0268] In particular examples, the rate of nucleic acid sequencing
is controlled. For example, the sequencing reaction can be
performed at low temperatures, such as 0-30.degree. C., for example
4.degree. C., or room temperature (such as 20-25.degree. C.) to
decrease the rate of sequencing. At these lower temperatures, the
polymerizing agent can be one that is able to function properly at
lower temperatures. This temperature range allows for a more narrow
spectral line and hence higher coding complexity. The lower
temperature will sharpen the spectrum, allowing more distinct
spectra to be read. Freezing is avoided, as it can interfere with
the polymerization reaction. In another example, to decrease the
rate of sequencing, the environment in which the sequencing
reaction is performed is viscous, such as a viscosity of 9.95 cP in
20% Ficol 70. In addition, mutant polymerases can be used to
decrease the rate of sequencing, such as a polymerase containing
one or more mutations which slow the polymerase. The rate of
sequencing can also be controlled by the concentration of free
hydrolyzable nucleotides (such as dNTPs) present in the sequencing
reaction; reducing the concentration of free dNTPs will reduce the
rate of polymerization.
Compressed Sequences
[0269] The disclosed methods in particular examples provide a
compressed sequence. That is, if the target sequence includes two
or more of the same base in a row, the method may not detect the
difference between the two or more same bases, thereby generating a
compressed sequence. For example, the first 30 bases of an E. coli
sequence:
TABLE-US-00003 (1) agcttttcattctgactgcaacgggcaata (SEQ ID NO:
1)
[0270] would be compressed by removing strings of similar
bases:
TABLE-US-00004 (2) agct cat ctgactgca cg ca ta (SEQ ID NO: 2)
[0271] resulting in:
TABLE-US-00005 (3) agctcatctgactgcacgcata (SEQ ID NO: 2)
[0272] Such a compressed sequence is still usable because it is
unique. For example, if RNA from E. coli is sequenced and this
results in sequence 3 above, the location of the RNA can be
determined by comparing sequence 3 above to a compressed version of
the entire E. coli genome. When the entire human genome is
sequenced, this method can be used to count individual mRNA
molecules directly. The first step is to compress the entire human
genomic sequence. Then, the NCBI Basic Local Alignment Search Tool
(BLAST), or other program is used to search this compressed human
genomic sequence using the results obtained from the sequencing
methods of the present disclosure. This method does not require
macroscopic handling for high-throughput analysis, and it is highly
useful for studying gene expression.
[0273] However, methods are provided that permit detection of the
complete, non-compressed sequence. For example, the polymerizing
agent will only close on the active site when the correct chemical
moiety (such as the correct base) is in the active site. The change
in distance in parts of the polymerase can be measured, for example
by FRET. This timing signal can be generated by including a tag on
the polymerizing agent, wherein the movement of the tag is
detected. For example, the polymerizing agent can include a donor
and acceptor fluorophore pair, wherein opening and closing of the
polymerizing agent results in a detectable signal due to the
interaction of the fluorophores (such as the excitation of the
acceptor by the donor, and the resulting acceptor emission that can
be detected). Detection of the timing signal indicates
incorporation, so it is apparent that two bases have been added to
the nascent DNA polymer even if the two bases are identical.
[0274] Another method that can be used to detect the complete,
non-compressed sequence is to perform the sequencing reaction in a
system that permits agents to be added and removed, such as a flow
cell. For example, the probes can be attached to a surface (such as
a bead), and the primer/target nucleic acid molecule added. The
flow can provide any of the four hydrolyzable bases (such as
dNTPs). As the chemical moiety pairs with the complementary base on
the target nucleic acid molecule, the resulting signal will
indicate the hydrolyzable base that needs to be added next. That
hydrolyzable base is added to the sequencing reaction, and the
probe will step forward one base. The hydrolyzable base is then
removed, and the process repeated. In the population the probes
will make an exponential transition to the next missing base and
stop. Therefore, the population can be monitored over time. If
there are two bases to be added, then the transition will be
slower. That is, the number of added bases can be determined by
measuring the half life of the transition.
[0275] In another example, the probes of the present disclosure are
attached to a substrate, and are bound the target nucleic acid and
its primer. In such an example, the probe will include the same tag
associated with each of the chemical moieties (such as the same
acceptor fluorophore or combination of acceptor fluorophores). The
polymerizing agent is also associated with a tag (such as a donor
fluorophore). The non-labeled hydrolyzable nucleotides can be
added, for example one type at a time. In the absence of
non-labeled hydrolyzable nucleotides the chemical moiety will
persist in the active site, producing a detectable signal (such as
an acceptor fluorophore emission). Then one of the non-labeled
hydrolyzable nucleotides is added. If the incorrect non-labeled
hydrolyzable nucleotide is added, it will not replace the chemical
moiety, and therefore not significantly change the detectable
signal. In contrast, if the correct non-labeled hydrolyzable
nucleotide is added, it will replace the chemical moiety, and
therefore significantly change the detectable signal (for example
decrease acceptor emission or increase donor emission). Since the
timing of the recovery is dependent on the number of non-labeled
hydrolyzable nucleotide that are added to the elongating
complementary strand, if two non-labeled hydrolyzable nucleotides
are added it will take longer for the detectable signal to recover
than when one non-labeled hydrolyzable nucleotide is added.
Therefore, by cycling through the four non-labeled hydrolyzable
nucleotides, a complete sequence can be obtained.
[0276] Yet another method that can be used to detect a complete,
non-compressed sequence is to use a nanoprobe having a donor
fluorophore (such as a second donor fluorophore attached to the
polymerizing agent) that specifically activates an acceptor
fluorophore different from the acceptor fluorophores on the
chemical moieties on the nanoprobe. The nucleic acid to be
sequenced is labeled on at least one nucleotide with an acceptor
fluorophore (such as one excitable by the second donor
fluorophore). As the nanoprobe steps along the nucleic acid
molecule to be sequenced, the distance between the donor on the
polymerase and the acceptor-labeled template nucleic acid molecule
gives a varying signal. Thus if the nanoprobe steps over two
identical bases, they can be distinguished because simultaneously
the acceptor to donor signal varies.
[0277] Single base steps can be resolved physically (Greenleaf and
Block, Science, 313:801, 2006). Such methods can be combined with
the Medusa nanoprobes disclosed herein. Stepping along DNA can be
detected by the 3.4 .ANG. step (0.34 nm) and by the 34 or so degree
rotation (10.6 by per 360 degrees). The rotation can be amplified
by putting a fluorescent detector on a molecular linker attached to
the nucleic acid to be sequenced (such as DNA). As the DNA rotates,
a 34 degree rotation moves a greater distance with a longer arm.
The longer the arm, the larger the change. Either the polymerase
(such as a Medusa sequencer provided herein) moves or the DNA does.
A moving polymerase can be observed (using the methods of Greenleaf
and Block, Science 313:801, 2006). A moving target nucleic acid
molecule can be detected by labeling the target nucleic acid
molecule (for example by binding a DNA-binding GFP fusion protein).
As the labeled target nucleic acid molecule rotates, the label
rotate, thereby permitting detection of the stepping. If the label
is bound tightly to the target nucleic acid molecule such that when
target nucleic acid molecule rotates the angle of polarized light
changes, this permits detection of the polymerase moving relative
to the target nucleic acid molecule. Rotation will change the
number of photons from each position. The GFP-DNA-binding protein
is bound so that polymerase can remove it to read past it--or
through a nucleosome-like object (as has been observed for T7 RNA
polymerase).
[0278] Another method that can be used to detect movement of a
target nucleic acid molecule (such as a target DNA molecule) is to
use a nanoprobe that binds either along the target nucleic acid
molecule or around the target nucleic acid molecule. A polarized
FRET signal will occur when it binds. The molecular linkers can be
flexible or rigid. Rigid molecular linkers allow displacing the
point of detection away from the DNA, increasing the lever
molecular linker. Another example is to use a `Molecular Beacon
scissors DNA detector`. This is a rigid cross-shaped molecule in
which two arms bind the target DNA molecule on opposite faces of
the DNA. A flexible hinge in the center permits binding of the two
molecular linkers to the DNA such that when the linkers come close
together a FRET signal is produced and detected. This device does
not generate significant detectable FRET signal when not bound to a
target nucleic acid molecule such as DNA. When bound, FRET signals
are detected and when a Medusa sequencer moves the DNA, it moves
around the DNA producing a varying polarized signal.
[0279] Yet another method that can be used is to contact the DNA
with a DNA-intercalating dye, such as ethidium bromide. The dipole
will rotate when a polymerase passes by. Alternatively, pyrrolo dC
can be incorporated into the DNA as an internal fluorescent label.
As the DNA rotates, the signals from the pyrrolo dC will vary
because the dipole absorbing and emitting polarization angle would
change. This change in the dipole axis will result in a change in
signal (for example from ethidium bromide or pyrrolo dC) that can
be detected.
In Vivo Sequencing
[0280] In particular examples, one or more Medusa probes are
introduced into a cell, thereby permitting sequencing inside a live
cell. For example, the disclosed probes can be used to observe the
sequences of mRNA as they are produced (for example if the probe
includes a reverse transcriptase as the polymerizing agent). In a
particular example, the method is used to diagnose a genetic
disease or cancer.
[0281] Methods of introducing agents into a cell are known in the
art. In one example, one or more Medusa probes are incorporated
into a liposome, which is introduced into the cell using standard
methods known in the art. In another example, the probes are
injected directly into a cell, for example using the method of
Sokol et al. (Proc. Natl. Acad. Sci. USA 95:11538-43, 1998). In
particular examples, the cell is obtained from a mammalian subject,
such as a human. For example, cells can be obtained from a
biological sample of the subject, such as a blood sample (or
fraction thereof) or a cheek swab.
[0282] The nucleotides present in the cell can be the ones
incorporated into the growing complementary strand (the
hydrolyzable nucleotides, such as dNTPs). The primer can also be
introduced into the cell with the probe. In a particular example,
the primer is attached to the polymerizing agent, for example via a
molecular linker. In a particular example, the sequence of the
primer is determined based on the target sequence. For example, if
the goal is to determine if a particular mutation is present in the
target sequence, the primer sequence can be used to direct the
Medusa probe to that sequence. Alternatively, the primer can
consist of universal bases so that it will bind any sequence. (for
example see Berger et al., Nucleic Acids Res. 28:2911-4, 2000).
[0283] In particular examples, the alternative splicing variants on
mature RNA are identified.
EXAMPLE 1
Tagged Polymerases
[0284] This example describes methods that can be used to generate
polymerases containing at least one tag, such as a fluorophore or
luminescent molecule, for example a donor fluorophore. Although
particular fluorophores or luminescent molecules are described, one
skilled in the art will appreciate that others tags can be attached
to a polymerase using similar methods.
General Attachment of Tags
[0285] Tags can be attached to a polymerizing agent using standard
recombinant technologies. In general, tags are placed at the N-- or
C-terminus of a polymerizing agent. However, the tag can also be
attached to any amino acid within the polymerizing agent, for
example an amino acid exposed to the surface of the protein.
Ideally, attachment of the tag does not significantly interfere
with the polymerizing activity of the polymerizing agent. For
example, a fusion polymerizing agent protein will still have the
ability to incorporate nucleotides onto an elongating nucleic acid
molecule.
[0286] Methods for making fusion proteins are known in the art (for
example see Sambrook et al., Molecular Cloning, A Laboratory
Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.,
Chapter 17, 1989). To prepare a Tag-polymerase recombinant fusion
protein, vectors can be constructed which contain sequences
encoding the tag and the polymerase. The sequences are ordered to
generate the desired Tag-polymerase recombinant fusion protein.
This vector is expressed in bacteria such as E. coli, and the
protein purified. The method of purification can depend on the tag
attached. For example if an affinity tag is also attached to the
polymerizing agent, the bacterial lysate is applied to a column
containing a resin having high affinity for the tag on the fusion
protein. After applying the lysate and allowing the tagged-fusion
protein to bind, unbound proteins are washed away, and the fusion
protein is subsequently eluted.
[0287] Alternatively, the tag can be attached to the polymerizing
agent using chemical methods. For example, if the tag is to be
attached to a Cys residue, the tag can be attached to a
polymerizing agent using a thiol-reactive compound such as
maleimide.
Affinity Tags
[0288] In one example, an affinity tag is attached to a
polymerizing agent, such as a GFP-polymerase protein, to aid in its
purification and subsequent attachment to a substrate (see Example
7). Examples of affinity tags include histidine (His),
streptavidin, S-tags, and glutathione-S-transferase (GST). Other
tags known to those skilled in the art can also be used.
Commercially available vectors contain one or multiple affinity
tags. These vectors can be used directly, or if desired, the
sequences encoding the tag can be amplified from the vectors using
PCR, then ligated into a different vector such as a polymerizing
agent-containing vectors described above.
[0289] The six or ten consecutive histidine (His) residue moiety
has high affinity for metal ions. A His-6 or His-10 moiety can be
attached to a polymerizing agent by using pET vectors (Novagen,
Madison, Wis.). The generation of GFP-His (Park and Raines, Protein
Sci. 6:2344-9, 1997) and protein-GFP-His recombinant proteins have
described previously (Prescott et al., FEBS Lett. 411:97-101,
1997). The His-containing fusion proteins can be purified as
described in Paborsky et al. (Anal. Biochem., 234:60-5, 1996).
Briefly, the protein of interest from a cell lysate is immobilized
using affinity chromatography on Ni.sup.2+-NTA-Agarose (QIAGEN,
Valencia, Calif.). After washing away unbound proteins, for example
using a buffer containing 8 mM imidazole, 50 mM Tris HCl, pH 7.5,
150 mM NaCl, the bound recombinant protein is eluted using the same
buffer containing a higher concentration of imidazole, for example
100-500 mM.
[0290] The S-tag system is based on the interaction of the 15 amino
acid S-tag peptide with the S-protein derived from pancreatic
ribonuclease A. Several vectors for generating S-tag fusion
proteins, as well as kits for the purification of S-tagged
proteins, are available from Novagen (Madison, Wis.). For example
vectors pET29a-c and pET30a-c can be used. The S-tag fusion protein
is purified by incubating the cell lysate with S-protein agarose
beads, which retain S-tag fusion proteins. After washing away
unbound proteins, the fusion protein is released by incubation of
the agarose beads with site-specific protease, which leaves behind
the S-tag peptide.
[0291] The affinity tag streptavidin binds with very high affinity
to D-biotin. Vectors for generating streptavidin-fusion proteins,
and methods for purifying these proteins, are described in Santo
and Cantor (Biochem. Biophys. Res. Commun. 176:571-7, 1991, herein
incorporated by reference). To purify the fusion protein, the cell
lysate is applied to a 2-iminobiotin agarose column, (other
biotin-containing columns may be used), and after washing away
unbound proteins, the fusion protein is eluted, for example with 6
M urea, 50 mM ammonium acetate (pH 4.0).
[0292] The enzyme glutathione-S-transferase (GST) has high affinity
for gluathione. Plasmid expression vectors containing GST (pGEX)
are disclosed in U.S. Pat. No. 5,654,176 to Smith and in Sharrocks
(Gene, 138:105-8, 1994). pGEX vectors are available from Amersham
Pharmacia Biotech (Piscataway, N.J.). The cell lysate is incubated
with glutathione-agarose beads and after washing, the fusion
protein is eluted, for example, with 50 mM Tris-HCl (pH 8.0)
containing 5 mM reduced glutathione. After purification of the
GST-polymerizing agent fusion protein, the GST moiety can be
released by specific proteolytic cleavage. If the GST-fusion
protein is insoluble, it can be purified by affinity chromatography
if the protein is solubilized in a solubilizing agent that does not
disrupt binding to glutathione-agarose, such as 1% Triton X-100, 1%
Tween 20, 10 mM dithiothreitol or 0.03% NaDodSO.sub.4. Other
methods used to solubilize GST-fusion proteins are described by
Frangioni and Neel (Anal. Biochem. 210:179-87, 1993).
Recombinant GFP-Polymerase
[0293] Green fluorescent protein (GFP) includes a chromophore
formed by amino acids in the center of the GFP. Wild-type GFP is
excited at 393 nm or 476 nm to produce an emission at 508 nm. GFP
mutants have alternative excitation and emission spectra. GFP
mutant H9-40 has only a single absorption at 398 nm and emits at
511 nm A red-shifted GFP mutant RSGFP4 (Delagrave et al.,
Biotechnology 13:151-4, 1995) has an excitation at 490 nm and
emission at 505 nm. The blue-shifted GFP mutant BFP5 absorbs at 385
nm and emits at 450 nm (Mitra et al., Gene, 173:13-7, 1996).
[0294] A polymerizing agent can be attached to GFP to generate a
fusion protein, such as GFP-polymerase, by recombinant techniques
known to those skilled in the art. Plasmids containing the
wild-type or mutant GFP gene sequences and a multiple cloning site
(MCS) into which the polymerase sequence can be inserted (such as
pGFP), are available from Clontech (Palo Alto, Calif.).
[0295] Briefly, both the polymerase DNA and the GFP plasmid are
digested with the appropriate restriction enzyme(s) which allow for
the insertion of the polymerase into the MCS of the GFP plasmid in
the sense orientation. The resulting fragments are ligated and
expressed in bacteria, such as E. coli. The expressed recombinant
GFP-polymerase is then purified using methods known by those
skilled in the art. The GFP can be placed at the N-- or C-terminus
of the polymerase, or anywhere in between (such as an exposed Cys
residue). Ideally, GFP-polymerases retain their polymerizing
activity, and the fluorescent properties of the GFP.
Recombinant GFP-Aequorin-Polymerase
[0296] Recombinant GFP-aequorin-polymerase can be generated using
methods known to those skilled in the art, for example the method
disclosed by Baubet et al. (Proc. Natl. Acad. Sci. USA 97:7260-5,
2000, herein incorporated by reference).
[0297] Briefly, aequorin cDNA (for example Genbank Accession No.
L29571), polymerase DNA, and a GFP plasmid are digested with the
appropriate restriction enzyme(s) which allow for the insertion of
the aequorin and polymerase into the MCS of a GFP plasmid in the
sense orientation. The resulting fragments are ligated and
expressed in bacteria, such as E. coli. The expressed recombinant
GFP-aequorin-polymerase is then purified as described above.
Affinity tags can also be added.
[0298] The ordering of the GFP, aequorin, and polymerase sequences
can be optimized. The resulting GFP-aequorin-polymerases are tested
to determine which has the optimal properties for sequencing. Such
properties can include: ease of protein purification, amount of
protein produced, amount of chemiluminescent signal emitted, amount
of fluorescent signal emitted after excitation, minimal alteration
of the fluorescent properties of the GFP and aequorin, and amount
of polymerase activity.
Attachment of Fluorophores to a Polymerase
[0299] As an alternative to generating a GFP-polymerase fusion
protein, other fluorophores can be used. In particular examples,
fluorescently labeled polymerizing agents have a high fluorescence
yield and retain the biological activity of the polymerizing agent,
primarily the ability to synthesize a complementary strand of a
nucleic acid molecule. The polymerizing agent can therefore have a
less-than-maximal fluorescence yield to preserve the function of
the polymerizing agent. Methods for labeling proteins with reactive
dyes are well known to those well skilled in the art. In addition,
the manufacturers of such fluorescent dyes, such as Molecular
Probes (Eugene, Oreg.), provide instructions for carrying out such
reactions. Following conjugation of one or more fluorophores to the
polymerizing agent, unconjugated dye can be removed, for example by
gel filtration, dialysis or a combinations thereof.
[0300] For example, amine-reactive fluorophores can be attached to
a polymerizing agent. Examples of amine-reactive probes that can be
used include, but are not limited to: fluorescein, BODIPY,
rhodamine, Texas Red and their derivatives. Such dyes will attach
to lysine residues within the polymerase, as well as to the free
amine at the N-terminus. Reaction of amine-reactive fluorophores
usually proceeds at pH values in the range of pH 7-10.
[0301] Alternatively, thiol-reactive probes can be used to generate
a fluorescently-labeled polymerase. In proteins, thiol groups are
present in cysteine residues. Reaction of fluors with thiols
usually proceeds rapidly at or below room temperature in the
physiological pH range (pH 6.5-8.0) to yield chemically stable
thioesters. Examples of thiol-reactive probes that can be used
include, but are not limited to: fluorescein, BODIPY, cumarin,
rhodamine, Texas Red and their derivatives.
[0302] Other functional groups on the protein including alcohols
(serine, threonine, and tyrosine residues), carboxylic acids and
glutamine, can be used to conjugate other fluorescent probes to the
polymerase.
[0303] Another fluorophore which can be attached to the polymerase
is
4-[N-[(iodoacetoxy)ethyl]-N-methylamino]-7-nitrobenz-2-oxa-1,3-diazole
(IANBD), as described by Allen and Benkovic (Biochemistry, 1989,
28:9586).
EXAMPLE 2
Tagged Chemical Moieties
[0304] This example describes how to attach one or more tags to a
chemical moiety, such as a nonhydrolyzable nucleotide analog (for
example a dNMP or dNDP). In addition, one skilled in the art will
recognize that commercially available tagged chemical moieties can
be used in the probes of the present disclosure.
[0305] Tags, such as one or more acceptor fluorophores, can be
attached to any part of the chemical moiety. For example, if the
chemical moiety is a nucleotide analog, the tag can be directly or
indirectly attached to a base, sugar, or phosphate (such as an
.alpha., .beta., or .gamma.-phosphate). Ideally, such attachment
does not interfere with the ability of the chemical moiety to be
reversibly bound to the template strand, and to pair with a
complementary nucleotide in the target nucleic acid strand. In
addition, ideally the tag is capable of being attached to the
chemical moiety to provide a detectable signal.
[0306] In one example a tag, such as an acceptor fluorophore, is
attached indirectly to the chemical moiety by a linker molecule.
For example, a streptavidin linkage can be used. The linkage can be
peptidase sensitive, allowing the tag to be released after the
emission signal is detected as a result of pairing between the
chemical moiety and its complementary base on the target nucleic
acid strand. U.S. Pat. Nos. 5,047,519 and 5,151,507 to Hobbs et al.
(herein incorporated by reference) teach the use of linkers to
separate a nucleotide from a fluorophore. Examples of linkers may
include a straight-chained alkylene, C.sub.1-C.sub.20, optionally
containing within the chain double bonds, triple bonds, aryl groups
or heteroatoms such as N, O or S. Substituents on the diradical
moiety can include C.sub.1-C.sub.6 alkyl, aryl, ester, ether,
amine, amide or chloro groups.
[0307] Jena BioScience offers multiple different nucleotide analogs
that are not hydrolyzable, such as dGMPCPP, dAMPCPP, dCMPCPP,
TMPCPP, dGMPNPP, dAMPNPP, dCMPNPP, and TMPNPP where C represents a
CH.sub.2 group and N represents an NH group instead of the oxygen
between the alpha and beta phosphates.
[0308] In examples where the tag associated with each different
type of chemical moiety (such as dAMP, dCMP, dGMP and dTMP) is a
different donor fluorophore, ideally the frequency used to excite a
donor fluorophore on the polymerizing agent does not significantly
overlap the excitation spectra of the acceptor fluorophores.
However, each chemical moiety should possess at least one acceptor
fluorophore having an excitation spectrum which overlaps the
emission spectrum of the donor fluorophore attached to the
polymerizing agent, such that the emission from the donor
fluorophore excites the acceptor fluorophore. In addition, each
type of chemical moiety (such as dAMP, dCMP, dGMP and dTMP) will
have a unique tag (or a unique combination of tags) attached, such
that each type (such as dAMP, dCMP, dGMP and dTMP) will have a
distinct emission signal (such as an emission spectrum) from the
other types of (such as dAMP, dCMP, dGMP and dTMP). Hence a
chemical moiety that is complementary to "A" will give a different
emission signal from a chemical moiety that is complementary to
"C", "G", or "T"; a chemical moiety that is complementary to "C"
will give a different emission signal from a chemical moiety that
is complementary to "T", "G", or "A"; a chemical moiety that is
complementary to "G" will give a different emission signal from a
chemical moiety that is complementary to "C", "A", or "T"; and a
chemical moiety that is complementary to "T" will give a different
emission signal from a chemical moiety that is complementary to
"C", "G", or "A". In the case of RNA, U will be substituted for T
in this example.
[0309] To help ensure that a tagged chemical moiety can pair with a
complementary nucleotide on the target nucleic acid, the tagged
chemical moiety can be tested, for example using a fluorescence
spectrophotometer if the tag is an acceptor fluorophore.
[0310] A 5' fluorescein labeled oligonucleotide is synthesized that
contains a high Tm hairpin such that the oligonucleotide will
anneal to itself to form a dsDNA with a 4 base overhang (Lyakhov et
al., Nucl. Acid Res. 29: 4892-4900, 2001). A hairpin
oligonucleotide allows exactly equimolar amounts of the top and
bottom strands of the DNA and it does not require any annealing
preparation step. A polymerase can fill in the overhang and the
next base to be added is dTTP. In one version of this
oligonuclotide the 3' end has a normal dC with a hydroxyl terminus
that can be extended by one base using dTTP conjugated to Cy3. By
filling in, the fluorescein is close to the Cy3 and FRET is
measured between the two fluorophores using a fluorescence
spectrophotometer. This demonstrates that the polymerase can bind
to the DNA and polymerize under the given conditions. Another 5'
fluorescein labeled oligonucleotide is synthesized that terminates
in a dideoxy C (IDT, Coralville, Iowa). Fill in reaction conditions
are set up as with the first oligonucleotide. When the polymerase
is present FRET is observed between the 5' fluorescein and the
dTTP-Cy3 which cannot be covalently attached to the dideoxy
terminated oligonucleotide. Without the polymerase, no FRET is
observed, demonstrating that the observed FRET (when the polymerase
is present) is caused by the polymerase holding the Cy3-dTTP to its
complementary base on the DNA hairpin. Under these same conditions
dATP, dGTP, dCTP do not compete off the FRET but dTTP will,
demonstrating a preference by the polymerase-hairpin complex for
binding the correct next nucleotide but not the incorrect ones.
EXAMPLE 3
Attachment of a Linker to a Chemical Moiety
[0311] This example describes a method that can be used to attach a
linker (such as PEG) to a chemical moiety (such as a nucleotide
analog), such as the attachment of chemical moieties 22, 24, 26, 28
to molecular linkers 14, 16, 18, 20, respectively, shown in FIG.
1.
[0312] The end of a tether can include an amino group, which can be
joined to the .gamma.-phosphate of a non-hydrolyzable dNTP analog
through a phosphoramidite linkage:
DNA-PEG-DNA-NH2+PPNP-deoxyribonucleotide.fwdarw.DNA-PEG-DNA-NH-PPNP-deox-
yribonucleotide
where PPNP means that the .alpha.,.beta.-P--O--P bond is replaced
by an imido group, P--N--P. The reaction uses 1 M
1-ethyl-3-(dimethylaminopropyl)carbodiimide (EDC), pH 6.5,
20.degree. C. for 10-12 hours (Chatterji et al., Methods Enzymol.
274:456-78, 1996).
[0313] In addition, Jena BioScience offers dUTP with a tether
attached on the .gamma. phosphate that terminates in an amino group
(.gamma.-[(8-Aminooctyl)-imido]-dUTP).
EXAMPLE 4
Exemplary Molecular Linker
[0314] This example describes an exemplary molecular linker with a
specific bend. This would allow the probe to have only very
specific motions and it can remove the possibility of
entanglement.
[0315] In a particular example, a molecular linker includes a dsDNA
with bulges, missing bases, or a nick within the dsDNA (for example
near or at the middle). In another example, a dsDNA includes a
short PEG tether at the same location on both strands (FIG. 3).
Such a molecular linker can be used to further control the
flexibility and rigidity of the molecular linker. For example, a
bend can be designed with a range of particular angles to direct
the bending of the molecular linker to guide the chemical moietie's
tips to the active site of the polymerizing agent. In particular
examples, both the 3' and 5' end of the dsDNA are attached to the
polymerase, to avoid rotation.
EXAMPLE 5
Probe for Sequencing Nucleic Acid Molecules
[0316] This example describes a particular probe that can be used
to sequence a target nucleic acid molecule. Although particular
fluorophores, molecular linkers, and polymerases are described, one
skilled in the art will appreciate that variations to these can be
made, based on the teachings herein.
[0317] The design is based on FIG. 2C, but the method of attachment
of the molecular linker to the polymerase is changed by removing
the tether 306, dsDNA 310, and tether 308. dsDNA 336 is replaced by
a continuous dsDNA, without any break, that contains a binding site
(ter) for the Tus protein. The Tus protein is translationally fused
to HIV-1 RT (for example using the methods described in Example
1).
[0318] The DNA sequences were designed using the NANEV program and
checked to ensure that the restriction sites shown in FIG. 2C are
unique. In addition, a MaeIII restriction site naturally appears in
the ter sequence and this is unique in the probe. The Tus sequence
used is the consensus bases from nine known Tus sites. Given the
constraints that certain pairs of ssDNA sequences are complementary
to each other and that some sequences contain the restriction sites
shown in FIG. 2C, the NANEV program was used to evolve the
structure.
[0319] NANEV uses single letter names for dsDNA strands. Lower case
letters (a, c, g, t, e, h, b, p, m) represent a segment of ssDNA
that is to be hybridized to the corresponding ssDNA labeled with an
upper case letter (A, C, G, T, E, H, B, P, M). Each dsDNA branch is
named by the corresponding non-hydrolyzable base (A, C, G, T) while
the `hub` parts are named by restriction enzymes that cut them (E,
H, B, P, M). For example, for the branch 334 that has a
non-hydrolyzable adenosine 346, one oligonucleotide is named
356-334-1a, and it is bound to fluorophore 356. 356-334-1a will
anneal with 332-316-334-318-346-11E-2A.
[0320] The 14 dsDNA parts designed using NANEV are shown in Table
3:
TABLE-US-00006 TABLE 3 Sequences to generate nanoprobe SEQ ID #
name Sequence NO: 1 a GGCCTCCGTCCTCGGCAGTA 3 2 A
TACTGCCGAGGACGGAGGCC 4 3 c CGATAATGCCTGTCATGCAT 5 4 C
ATGCATGACAGGCATTATCG 6 5 g GAACGTCTAGACTTATCGC 7 6 G
GCGATAAGTCTAGACGTTCC 8 7 t CTCTCGCTCCGTGCCGTAAG 9 8 T
CTTACGGCACGGAGCGAGAG 10 9 eMh CGCTCCTGAATTCGACGTACGCTATATATTTA 11
GTATGTTGTAACTAAAGTCCAGCGCGAAGCT TAATGACT 10 pmb
ATTCAGTCTGCAGGAAGGCCGACTTTAGTTA 12 CAACATACTAAATATATAGCCAGTAAGGGAT
CCGATCTCG 11 E GTACGTCGAATTCAGGAGCG 13 12 B CGAGATCGGATCCCTTACTG 14
13 H AGTCATTAAGCTTCGCGCTG 15 14 P GGCCTTCCTGCAGACTGAAT 16
[0321] Some of these 14 components are joined by PEG and linked to
appropriate fluorophores to create ten oligonucleotides. The ten
oligonuclotides can be synthesized commercially by IDT (Coralville,
Iowa) or Midland (Midland, Tex.) as follows:
TABLE-US-00007 >356-334-1a: (SEQ ID NO: 3)
[fluorophore-356]-GGCCTCCGTCCTCGGCAGTA,
where [fluorophore-356] is Rhodamine Red.TM.-X (Absorbance Max: 574
nm, Emission Max: 594) "GREEN"
TABLE-US-00008 >358-328-3c: (SEQ ID NO: 5)
CGATAATGCCTGTCATGCAT-[fluorophore-358],
where [fluorophore-358] is Cy3.TM. (Absorbance Max: 550 nm,
Emission Max: 564) "BLUE"
TABLE-US-00009 >360-344-5g: (SEQ ID NO: 7)
GGAACGTCTAGACTTATCGC-[fluorophore-360],
where [fluorophore-360] is Texas Red.RTM.-X (Absorbance Max: 598
nm, Emission Max: 617) "YELLOW"
TABLE-US-00010 >362-338-7t: (SEQ ID NO: 9)
[fluorophore-362]-CTCTCGCTCCGTGCCGTAAG,
where [fluorophore-362] is Cy5.TM. (Absorbance Max: 648 nm,
Emission Max: 668) "RED"
TABLE-US-00011 >332-316-334-318-NH2-11E-2A: (SEQ ID NO: 17)
GTACGTCGAATTCAGGAGCG-[PEG18]-[PEG18]-[PEG18]-
TACTGCCGAGGACGGAGGCC-[PEG9]-NH2 >NH2-312-328-314-330-4C-12B:
(SEQ ID NO: 18) NH2-[PEG9]-ATGCATGACAGGCATTATCG-[PEG18]-[PEG18]-
[PEG18]-CGAGATCGGATCCCTTACTG >NH2-326-344-324-342-6G-13H: (SEQ
ID NO: 19) NH2-[PEG9]-GCGATAAGTCTAGACGTTCC-[PEG18]-[PEG18]-
[PEG18]-AGTCATTAAGCTTCGCGCTG >340-322-338-320-NH2-14P-8T: (SEQ
ID NO: 20) GGCCTTCCTGCAGACTGAAT-[PEG18]-[PEG18]-[PEG18]-
CTTACGGCACGGAGCGAGAG-[PEG9]-NH2 >332-336-342-9eMh: (SEQ ID NO:
21) CGCTCCTGAATTCGACGTACGCTATATATTTAGTATGTTGTAA
CTAAAGTCCAGCGCGAAGCTTAATGACT >340-336-330-10pmb: (SEQ ID NO: 22)
ATTCAGTCTGCAGGAAGGCCGACTTTAGTTACAACATACTAAATATATAG
CCAGTAAGGGATCCGATCTCG
[0322] Four non-hydrolyzable dNTPs are synthesized (for example by
Jena Bioscience): dGMPCPP, dAMPCPP, dCMPCPP, and TMPCPP, where C
represents a CH.sub.2 group instead of the oxygen between the
.alpha. and .beta. phosphates. Note that the older terminology
TMPCPP means dTMPCPP that is, deoxyribo-TMPCPP. (Jena Bioscience
can also provide dGMPNPP, dAMPNPP, dCMPNPP, and TMPNPP where N
represents an NH group instead of the oxygen between the .alpha.
and .beta. phosphates. Note that the older terminology TMPNPP means
dTMPNPP that is, deoxyribo-TMPNPP.
[0323] Each non-hydrolyzable dNTP is covalently attached by its
.gamma. phosphate to an amino group on the corresponding
oligonucleotide branch using the following reaction protocol
derived from Pierce Technical Resource TR0030.1 "Modify and label
oligonucleotide 5' phosphate groups" except that the roles of label
and oligonucleotide are reversed.
[0324] 1. Dissolve the non-hydrolyzable dNTP in 10 .mu.l reaction
buffer. (The reaction buffer recommended by Pierce is "Reaction
Buffer, such as phosphate buffered saline (PBS) with EDTA: 10 mM
sodium phosphate, 0.15 M NaCl, 10 mM EDTA, pH 7.2. Avoid using PBS
with >10 mM phosphate, which will interfere with the intended
reaction. Other amine free and carboxylate-free buffers can be
substituted, but avoid Tris, which contains a primary amine that
will quench the reaction.")
[0325] 2. Dissolve the oligonucleotide to a final concentration of
1 mM in 10 .mu.l of 0.1 M Imidazole, pH 6.
[0326] 3. Weigh 1.25 mg (6.52 micromol) of EDC
(1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride,
Pierce Product No. 22980.) into a microcentrifuge tube.
[0327] 4. Add 7.5 .mu.l of the prepared non-hydrolyzable dNTP to
the tube containing the EDC and immediately add 5 .mu.l of the
oligonucleotide/imidazole solution.
[0328] 5. Vortex tube until contents are completely dissolved, and
then briefly centrifuge the tube to gather contents.
[0329] 6. Add an additional 20 .mu.l of 0.1 M imidazole, pH 6.
[0330] 7. Incubate the reaction overnight at Room Temperature.
[0331] 8. Separate the unreacted oligonucleotide from the reaction
product on a 10% polyacrylamide gel.
[0332] It is also possible to purify the product by its ability to
bind to a DNA polymerase. The unreacted nucleotides are first
removed by using a size-exclusion column or dialysis. Then a column
is created that has HIV-1 RT or another polymerase attached (for
example HIV-1 RT with a histidine-6 tag bound to a nickel column) A
template DNA and annealed primer DNA can be added. This polymerase
column should retard the oligonucleotide to which is attached a
nucleotide, compared to the unreacted oligonucleotide that does not
have a tethered nucleotide. A description of the carbodiimide
cross-linking reaction described above is given in Chatterji and
Gopal (Methods Enzymol. 274:456-78, 1996). This protocol is
performed separately for each oligonucleotide.
TABLE-US-00012 The oligonucleotide: is attached to:
332-316-334-318-NH2-11E-2A (SEQ ID NO: 17) non-hydrolyzable dAMPCPP
NH2-312-328-314-330-4C-12B (SEQ ID NO: 18) non-hydrolyzable dCMPCPP
NH2-326-344-324-342-6G-13H (SEQ ID NO: 19) non-hydrolyzable dGMPCPP
340-322-338-320-NH2-14P-8T (SEQ ID NO: 20) non-hydrolyzable
TMPCPP
[0333] This creates the following structures:
TABLE-US-00013 >332-316-334-318-346-11E-2A: (SEQ ID NO: 23)
GTACGTCGAATTCAGGAGCG-[PEG18]-[PEG18]-[PEG18]-
TACTGCCGAGGACGGAGGCC-[PEG9]-NH-POOH-O-POOH-CH2- POOH-deoxyadenosine
>340-322-338-320-352-14P-8T: (SEQ ID NO: 24)
GGCCTTCCTGCAGACTGAAT-[PEG18]-[PEG18]-[PEG18]-
CTTACGGCACGGAGCGAGAG-[PEG9]-NH-POOH-O-POOH-CH2- POOH-deoxythymidine
>350-326-344-324-342-6G-13H: (SEQ ID NO: 25)
deoxyguanosine-POOH-CH2-POOH-O-POOH-NH-[PEG9]-
GCGATAAGTCTAGACGTTCC-[PEG18]-[PEG18]-[PEG18]- AGTCATTAAGCTTCGCGCTG
>348-312-328-314-330-4C-12B: (SEQ ID NO: 26)
deoxycytidine-POOH-CH2-POOH-O-POOH-NH-[PEG9]-
ATGCATGACAGGCATTATCG-[PEG18]-[PEG18]-[PEG18]-
CGAGATCGGATCCCTTACTG
[0334] The 10 oligonucleotides:
[0335] 332-316-334-318-346-11E-2A (SEQ ID NO: 23);
340-322-338-320-352-14P-8T (SEQ ID NO: 24);
350-326-344-324-342-6G-13H (SEQ ID NO: 25);
348-312-328-314-330-4C-12B (SEQ ID NO: 26); 356-334-1a (SEQ ID NO:
3); 358-328-3c (SEQ ID NO: 5); 360-344-5g (SEQ ID NO: 7);
362-338-7t (SEQ ID NO: 9); 332-336-342-9eMh (SEQ ID NO: 11);
340-336-330-10pmb (SEQ ID NO: 12); are then hybridized together to
form the molecular linker 302 of the probe shown in FIG. 2C. The
molecular linker 302 is then purified by gel electrophoresis, an
exclusion column or sucrose gradient. The structure of the
generated molecular linker 302 can be tested by digesting with the
five restriction enzymes separately and in combinations and by
observing the products on polyacrylamide gels.
[0336] The tus (termination utilization substance) gene from E.
coli has been cloned in pBAD33tus (Henderson et al., Mol. Genet.
Genomics 265:941-53, 2001, Guzman et al., J. Bacteriol. 77:4121-30,
1995). The HIV-1 RT p66 subunit has been cloned and modified to
replace all solvent-accessible cysteine residues with serine
residues (C38S and C280S) and to substitute a unique cysteine for
the lysine at 287, K287C (Kensch et al., J. Mol. Biol. 301:1029-39,
2000). The unique cysteine at 287 is on the "thumb" of the
polymerase, close to the active site of the polymerase, but far
enough away so as not to interfere with DNA binding or the active
site. There are only two cysteines in the Tus protein at CYS99 and
CYS255 and they are both completely buried, (PDB 1ECR Kamada et
al., Nature 383:598-603, 1996), so it is not necessary to engineer
Tus to avoid exposed cysteines. Tus is cloned in a translational
fusion with the mutated HIV-1 RT.
[0337] As seen in the three dimensional structures of HIV-1 RT (PDB
entry 1RTD Huang et al., Science 282:1669-1675, 1998) and Tus bound
to DNA (1ECR Kamada et al., Nature 383:598-603, 1996) the N and C
termini of both proteins are on their surfaces well away from the
active sites, so fusion of the two proteins will not interfere with
their structures or functions. The hydrophylic polypeptide that
connects the two parts of the RecB protein (PDB entry 1W36,
Singleton et al., Nature 432:187-93, 2004) is used to connect Tus
to HIV-1 RT to create Tus-HIV-1 RT.
[0338] Those skilled in the art will recognize that either Tus or
HIV-1 RT protein can be placed at the N terminus of the fusion and
that they can be interchanged. Those skilled in the art will also
recognize that 6-histidine tags can be placed on either end of the
construction to help isolation. A 6-histidine tag on the N terminus
of Tus has little effect on binding, while a 6-histidine tag on the
C terminus of HIV-1 has no known effect on polymerase activity.
[0339] The donor fluorophore is attached to the unique cysteine in
Tus-HIV-1 RT by using the maleimide labeling reagent
Fluorescein-5-Maleimide (Pierce, Rockford, Ill., using the
manufacturer's instructions). This donor fluorophore forms FRET
pairs with each of the four acceptor pairs described above. Those
skilled in the art will also recognize that additional acceptor
fluorophores can be added to the corresponding oligonucleotides to
adjust for the relative signal strength, if desired. Those skilled
in the art will recognize that many other possible combinations of
fluorophores are possible.
[0340] The Tus-HIV-1 RT protein is added to the core to create the
completed probe. The probe is then purified by gel electrophoresis,
an exclusion column or sucrose gradient. The final probe structure
is checked by digesting with the five restriction enzymes
separately and in combinations and by observing the products on
polyacrylamide gels.
[0341] In a second example, the reverse transcriptase is modified
by directed mutagenesis of F227A to reduce its error frequency
(Wisniewski et al., J. Biol. Chem. 274:28175-84, 1999). In a third
example, the connection between Tus and HIV-1 RT is determined as
it is for single chain Fv (scFv) linker sequences. The classical
sequence used is (Gly.sub.4Ser).sub.3, but phage display technology
can be used to obtain other variations (Tang et al., J. Biol. Chem.
271:15682-6, 1996; Hennecke et al., Protein Eng. 11:405-10,
1998).
[0342] Those skilled in the art will recognize that many other
design variations are possible for the nanoprobe of the present
disclosure.
EXAMPLE 6
Coded Probe for Sequencing Nucleic Acid Molecules
[0343] This example describes a variant of the probe described in
Examples 5, wherein multiple fluorophores are associated with each
nonhydrolyzable nucleotide analog. Although particular combinations
of fluorophores are described, one skilled in the art will
appreciate that other combinations can be used. Such a probe
permits detection of photobleaching of acceptor fluorophores
associated with each chemical moiety, and in particular examples
permits correction of such photobleaching.
[0344] If the chemical moieties on the probe are each only
associated with a single acceptor fluorophore, and that acceptor
fluorophore was lost by bleaching, no acceptor emission signal
would be detected from that acceptor fluorophore. If there were no
signal from this photobleached acceptor fluorophore, it would be
difficult to discern whether the loss of signal was due to
photobleaching, or whether a stretch of target sequence that simply
does not have that base. By associating two or more tags with each
chemical moiety, fluorophore bleaching can be detected and in some
examples corrected.
[0345] The probe shown in FIG. 2D includes multiple tags 404, 406,
408, 410 associated with each of the chemical moieties 346, 348,
350, 352. The inclusion of multiple acceptor fluorophores permits
the detection of a loss of the fluorophores by bleaching, or by
loss of part of the molecular linker.
[0346] In FIG. 2D, different tags 354, 404, 406, 408, 410 form a
code similar to a Hamming error correction code. If any one of
these tags has been destroyed by photobleaching, the resulting
signal will be distinct from that produced by an undamaged probe.
For example, if donor 354 is destroyed, then no donor emission will
be produced and none of the other fluorophores will be excited.
Sequence data from such a probe can be ignored. The "A" arm of the
probe has two acceptor fluorophores, 404 and 406. When a
complementary T is on the target DNA in the polymerase binding
site, both fluorophores will be excited by donor 354. This produces
a unique spectrum compared to the other three arms. That is, A is
associated with 404, 406; C is associated with 404, 408; G is
associated with 404, 410 and T is associated with 406, 408, 410. If
fluorophore 404 on rod 334 is photobleached, then the A arm will
report a signal containing only the spectrum of 406. This differs
from an undamaged A signal and from the signals produced by the
other three arms. Therefore the recording computer can determine
that the probe has been damaged and that signal reading from that
probe should be terminated. Since the T arm 338 has three
fluorophores, it is unlikely that both fluorophores 408 and 410
will have been destroyed simultaneously. So a signal containing
only the spectrum from 406 is likely to be caused by binding of the
A arm to the target nucleotide. The computer can therefore infer
that the next base in the sequence is indeed an A before
terminating reading. That is, the computer is able to perform an
error detection and an error correction.
[0347] If fluorophore 406 on the rod 334 has been destroyed, then
the received signal will consist of only the 404 spectrum. A
spectrum of 404 could also be produced by bleaching of fluorophore
408 on rod 328 or by bleaching of fluorophore 410 on rod 344.
Therefore the arm that has produced the 406 signal cannot be
determined unambiguously. In this case the computer reading the DNA
sequence can conclude that an error has been made but it will not
be able to correct the error. At this time reading from the Medusa
is terminated.
[0348] Destruction of fluorophores on rods 328 or 344 gives results
similar to destruction of fluorophores on rod 334. In all of these
cases if the common fluorophore 404 has been destroyed, then one
error can be detected and that error can be corrected. If the other
fluorophore that is not 404 (that is, fluorophores 406, 408, 410 on
rods 334 328 344 respectively) has been destroyed then one error
can be detected and no errors can be corrected. Once an error has
been detected, and perhaps corrected, sequencing is terminated
because a second error will give ambiguous results.
[0349] If any of the three fluorophores 406, 408, 410 on rod 338
have been photobleached then the remaining two fluorophores still
give a unique signal. For example if fluorophore 406 has been
destroyed then the signal when the T arm binds to an A on the
target nucleotide will consist of the spectra from fluorophores 408
and 410. These spectra alone are not produced by an undamaged probe
so one error can be detected and that error can be corrected. In
this case, as with the other three arms, sequencing is terminated
after the error correction because a second error will give
ambiguous results.
[0350] Other coding schemes are possible for the probes disclosed
herein, including schemes with more than four fluorophores. One
skilled in the art can predict the number of errors that can be
detected and corrected by various coding schemes. However the one
shown in FIG. 2D only requires four fluorophores to implement. A
basic probe such as that shown in FIG. 2C uses four fluorophores to
produce full sequence data, but the redundant rearrangement of only
four fluorophores allows for the construction of an error detecting
and correcting probe. Because the probe design allows for the
interchange of fluorophores, as shown in FIG. 2C where ssDNA 364
can be exchanged for ssDNA 334, once a basic non-coded probe has
been constructed it is possible to create a coded probe as shown in
FIG. 2D. The coded probe is constructed as in Example 5 except that
oligonucleotides 356-334-1a (SEQ ID NO: 3), 358-328-3c (SEQ ID NO:
5), 360-344-5g (SEQ ID NO: 7), and 362-338-7t (SEQ ID NO: 9) are
replaced by the following four oligonucleotides:
TABLE-US-00014 >404-406-334-1a (SEQ ID NO: 27)
[fluorophore-404]-[fluorophore-406]- GGCCTCCGTCCTCGGCAGTA "BLUE"
"RED" >404-408-328-3c (SEQ ID NO: 28)
CGATAATGCCTGTCATGCAT-[fluorophore-404]- [fluorophore-408] "BLUE"
"YELLOW" >404-410-344-5g (SEQ ID NO: 29)
GGAACGTCTAGACTTATCGC-[fluorophore-404]- [fluorophore-410] "BLUE"
"GREEN" >406-408-410-320-7t (SEQ ID NO: 30)
[fluorophore-406]-[fluorophore-408]-[fluorophore-
410]-CTCTCGCTCCGTGCCGTAAG "RED" "YELLOW" "GREEN"
[0351] where [fluorophore-404] is Cy3.RTM. (Absorbance Max: 550 nm,
Emission Max: 564) "BLUE" (corresponds to FIG. 2C fluorophore-358);
[fluorophore-406] is Cy5.RTM. (Absorbance Max: 648 nm, Emission
Max: 668) "RED" (corresponds to FIG. 2C fluorophore-362);
[fluorophore-408] is Texas Red.RTM.-X (Absorbance Max: 598 nm,
Emission Max: 617) "YELLOW" (corresponds to FIG. 2C
fluorophore-360); [fluorophore-410] is Rhodamine Red.TM.-X
(Absorbance Max: 574 nm, Emission Max: 594) "GREEN" (corresponds to
FIG. 2C fluorophore-356).
EXAMPLE 7
Attachment of a Probe or Nucleic Acid Molecule to a Substrate
[0352] This example describes methods that can be used to attach
the tagged polymerizing agent generated in Example 1 (for example
part of the probes of Examples 5 and 6), or a nucleic acid
molecule, to a substrate, such as a microscope slide or gel matrix.
During the sequencing reaction, the target nucleic acid molecule to
be sequenced, the oligonucleotide primer, or the probe, can be
attached to a substrate (for example in a microscope field of
view).
Attachment of Nucleic Acids
[0353] Several methods for attaching nucleic acids (for example the
target nucleic acid molecule to be sequenced or an oligonucleotide
primer) to a substrate are available. Nucleic acid molecules can be
attached to the substrate by their 5' or 3' end, or anywhere in
between. For example, a 5' biotinylated primer can be synthesized
(Beaucage, Tetrahedron Letters 22:1859-62, 1981; Caruthers, Meth.
Enzym. 154:287-313, 1987), and affixed to a streptavidin coated
substrate surface (Hultman, Nucl. Acids Res. 17:4937-46, 1989). In
another example, the nucleic acid molecule can be dried on
amino-propyl-silanized (APS) glass, as described by Ha et al.
(Proc. Natl. Acad. Sci. USA. 93:6264-68, 1996, herein incorporated
by reference). Methods for attaching the oligonucleotide primer to
the substrate via a linker are disclosed in U.S. Pat. No. 5,302,509
to Cheeseman, herein incorporated by reference.
[0354] In yet other examples, a nucleic acid molecule is
cross-linked to an unmodified substrate by conjugating an active
silyl moiety onto the nucleic acid molecule (for example using the
methods disclosed by Kumar et al. (Nucleic Acids Res. 28:e71,
2000). Briefly, silane is conjugated to a nucleic acid as follows.
Mercaptosilane [(3-Mercaptopropyl)-trimethoxysilane] is diluted to
5 mM stock solution with a reaction buffer such as sodium acetate
(30 mM, pH 4.3) or sodium citrate (30 mM, pH 4). For conjugation of
5'-thiol-labeled nucleotides with mercaptosilane, 1 nmol
nucleotides are reacted with 5 nmol mercaptosilane in 20 .mu.l of
the same buffer for 10-120 min at room temperature. The reaction
mixture is used directly or diluted with the reaction buffer to a
desired concentration for immobilization on a substrate, such as a
glass microscope slide. 5'-acrylic-labeled oligonucleotides are
conjugated to mercaptosilane using an identical procedure.
[0355] The 5'-thiol-labeled nucleotides are conjugated with
aminosilane [(3-aminopropyl)-trimethoxysilane] in dimethylsulfoxide
(DMSO) in the presence of heterobifunctional linkers
N-succinimidyl-3-(2-pyridyldithiol)-propionate (SPDP) or
succinimidyl-6-(iodoacetyl-amino)-hexanoate (SIAX). Nucleotides
(final concentration 5-50 .mu.M) are combined with 2.5 nmol
aminosilane (added from 5 mM solution in ethanol) and 2.5 nmol
bifunctional reagents (added from 5 mM stock solution in DMSO) in
10 .mu.l DMSO, and the reaction allowed to proceed for 1-2 hours at
room temperature.
[0356] Acrylic-labeled oligonucleotides (50-500 pmol) are combined
with 25 nmol acrylicsilane
(.gamma.-methacryloxy-propyl-trimethoxysilane) in 10 .mu.l of 30 mM
NaOAc, pH 4.3. Ammonium persulfate (10% in H2O) and
N,N,N',N'-tetramethylethylenediamine (TEMED) are added to final
concentration of 0.5 and 2%, respectively, and the mixture allowed
to react for 30 minutes at room temperature.
[0357] After the conjugation reactions, the reaction mixture is
referred to as silanized nucleic acid, and can be directly used for
spotting onto a substrate. Silanized nucleic acids can be spotted
on the glass slides manually (120 nl/spot) or with an automated
arrayer (Genetic Microsystem, Woburn. USA) (1 nl/spot). Nucleic
acids in aqueous solutions can be kept in a humidified chamber for
15 minutes at room temperature after spotting onto the glass slide,
dried at 50.degree. C. for five minutes, dipped into boiling water
for 30 seconds to remove non-covalently bound nucleic acids, and
dried with nitrogen before hybridization. Nucleotides in DMSO are
left at room temperature for 15 minutes after spotting onto glass
slides and dried at 50.degree. C. for 10 minutes. These slides are
sequentially washed with DMSO (3.times.2 min), ethanol (3.times.2
min) and boiling water (2 min) and dried with nitrogen for later
use.
[0358] To hybridize a complementary nucleic acid molecule to the
nucleic acid molecule attached to the substrate, such as an
oligonucleotide primer, the nucleic acid molecule to be hybridized
is diluted to between 20 nM and 1 .mu.M in 5.times.SSC (750 mM
NaCl, 125 mM sodium citrate, pH 7) with 0.1% Tween-20.
Hybridization is done under coverslips in a humidifier at
37.degree. C. for 30 minutes to overnight. Non-hybridized and
non-specific nucleic acid molecules are removed by washing with
5.times.SSC containing 0.1% Tween-20 (3.times.1 min) followed by
1.times.SSC containing 0.1% Tween-20 (2.times.15 min)
[0359] If a longer nucleic acid molecule is to be hybridized, such
as a sample nucleic acid molecule, hybridization can be carried out
at 65.degree. C. for four hours in 3.times. SSC with 0.1% SDS and 1
.mu.g/.mu.l yeast tRNA. The slides are then washed with 1.times.SSC
containing 0.1% SDS (3.times.2 min) and 0.1.times.SSC containing
0.1% SDS (3.times.5 min) at room temperature.
[0360] After washing, the slides can be dried with nitrogen gas. If
repeated hybridization on the same substrate is desired, the
substrate is boiled in water for one minute then dried with
nitrogen gas before proceeding to the next hybridization
reaction.
[0361] To attach a nucleic acid by the 3' end, a terminal
transferase can be used to "tail" the molecule.
Attachment of a Probe
[0362] The probes of the present disclosure can be attached or
fixed to a substrate via the polymerizing agent. For example, a
streptavidin-polymerase fusion protein can be generated (for
example using the methods described in Example 1), and then affixed
to a biotinylated substrate, for example as described by Mazzola
and Fodor (Biophys. J. 68:1653-60, 1995) or Itakura et al.
(Biochem. Biophys. Res. Commun. 196:1504-10, 1993).
[0363] Other methods of attaching the polymerizing agent to a
substrate are well known to those skilled in the art. For example,
the microscopic tip of an atomic force microscope may be used to
chemically alter the surface of a substrate (Travis, Science
268:30-1, 1995). Alternatively, if the polymerizing agent contains
6-10 consecutive histidine residues, it will bind to a
nickel-coated substrate. For example, Paborsky et al. (Anal.
Biochem. 234:60-5, 1996) describe a method for attaching nickel to
a plastic substrate. Briefly, to charge microtiter polystyrene
plates, 100 .mu.l of N,N-bis[carobxymethyl]lysine (BCML) is added
(10 mM BCML in 0.1 M NaPO.sub.4, pH 8) to each well and incubated
overnight at room temperature. The plate is subsequently washed
with 200 .mu.l of 0.05% Tween, blocked (3% BSA in 50 mM Tris HCl,
pH 7.5, 150 mM NaCl, 0.05% Tween) and washed with a series of
buffers. First 50 mM Tris HCl, pH 7.5, 500 mM imidazole, 0.05%
Tween; second, 0.05% Tween; third, 100 mM EDTA, pH 8.0 and last
0.05% Tween. The plate is next incubated with 10 mM NiSO.sub.4 for
20 minutes at room temperature. The plate is finally washed with
0.05% Tween and then 50 mM Tris HCl, 500 mM NaCl, pH 7.5.
[0364] Random attachment of the probe to a substrate should be
sufficient at low probe concentrations. To allow for the tightest
packing of sequencing signals in the field of view, the probes can
be arranged on a two-dimensional substrate surface in an organized
array. Probes can be spaced by micrometer distances as described by
Muller et al. (Science 268:272-3, 1995, herein incorporated by
reference). In addition, patterns of channels that are
approximately 50 .mu.m in width and approximately 10-20 .mu.m in
depth can be formed in the substrate using standard
photolithographic procedures followed by chemical wet etching as
described in U.S. Pat. No. 5,661,028 to Foote (herein incorporated
by reference). Much smaller channels can be generated using
nanolithography techniques. Dense periodic arrays of holes or
chambers 20 nm across are fabricated into a silicon nitride coated
substrate by the method of Park et al. (Science, 276:1401-4, 1997,
herein incorporated by reference). In each chamber, a single
sequencing reaction would take place. The probe can also be
attached to the substrate in an orderly array by micropipetting
droplets containing the probe onto the surface of the substrate.
The droplets can be covered, for example with a glass coverslip, to
prevent evaporation.
Embedding in a Gel Matrix
[0365] As an alternative to attaching the probe or nucleic acid
molecule to a two-dimensional surface, they can be embedded into a
three-dimensional gel matrix. For example, the probe, nucleic acid
molecules, or both, are added to the liquid matrix, which is
allowed to solidify, trapping the agents within it. Examples of
this type of matrix include agarose and acrylamide, for example
Ni.sup.2+-NTA-Agarose (QIAGEN, Valencia, Calif.).
EXAMPLE 8
Calculation of Distance between Fluorophores with Different Rod
Lengths
[0366] As described above, the disclosed nanoprobes can include a
polymerizing agent attached to a chemical moiety via a molecular
rod, for example a rod that includes a tether, for example a tether
composed of PEG (for example see molecular linkers 14, 16, 18 of
FIG. 1A). However, with no force to keep them separated, the free
PEG chains will each condense to form a cloud around a single
point. Therefore, the addition of one or more molecular rods to the
nanoprobe (for example as shown in molecular linker 20 of FIG. 1A)
can be included to further separate the polymerizing agent and the
chemical moieties, or to further separate fluorophores or other
tags on the probe.
[0367] This example describes computer simulations used to
determine how a FRET signal is affected by the length of a
molecular rod, which can be, for example, composed of dsDNA.
Molecular linker 20 in FIG. 1A shows the situation in the
simulation. Two tethers 68, 70 are connected to a rod 66 and the
distance between fluorophores 38 and 30 is measured. For the
purpose of the simulation, polymerizing agent 12, fluorophore 30,
moiety 28 and fluorophore 38 are all considered to be point
objects. For a single tether, assuming that the tether is
infinitely thin (does not have a problem intersecting with itself)
and that the distance from the attachment point to the end of the
tether is a random walk in three dimensions. In each single
dimension this is the sum of small random steps, which would give a
Gaussian distribution. In three dimensions it will be the
spherically symmetric Maxwell gas distribution (Schneider, J.
Theor. Biol., 148:83-123, 1991). It is not appropriate to merely
integrate over the intersection of two such distributions with a
given separation because individual molecules will be at specific
directions and distances. For this reason, an explicit simulation
was performed.
[0368] To summarize the method, for each rod length, the two
tethers were grown and the distance between the tips and then the
FRET efficiency was computed. In the simulation, encoded by the
program Bite (bi-tether), two polymers were attached to the ends of
a fixed rod. Each polymer was generated by a series of random
steps, starting from a rod end. The size of the steps is given by
the persistence length of the chain. For PEG, the persistence
length is 3.8.+-.0.02 .ANG.. The direction of each step was chosen
randomly. The FRET signal was computed for each pair of randomly
extended chains. This signal is a function the final distance
between the tether chain ends R, and the FRET radius R.sub.0
according to the FRET efficiency,
E=1/((R/R.sub.0).sup.6+1) (1)
[0369] The parameters used by the program include the persistence
length, the length of the tethers L and the rod length D that
separates the tether points. This process was repeated 1000 times
to obtain the distributions shown in FIG. 4.
[0370] When the distance, R, between the fluorophores is R.sub.0,
the transfer efficiency is 50%. For example, for a FRET pair with
an R.sub.0=60 .ANG., which is a typical distance, and a tether
length of 120 .ANG., FIGS. 4A-F show the effect of varying the rod
length. With a rod length of 0 (FIGS. 4E and 4F) the tethers gather
around a common point (FIG. 4E) leading to a large FRET signal
(FIG. 4F). As the rod length is increased to 60 .ANG. (FIG. 4C),
the FRET distribution signal spreads out (FIG. 4D). Sometimes the
two ends are close and some FRET will be observed. Strikingly, when
the rod length is 120 .ANG. (FIGS. 4A and 4B), the FRET signal is
almost completely eliminated (FIG. 4B). This happens when the
tether length is twice the rod length, so there is plenty of
potential overlap of the tethers, allowing the tethers to bind to
the target. Yet the FRET signal is almost undetectable. These
results demonstrate particular advantages of including a rod in a
molecular linker.
EXAMPLE 9
FRET with Different Tether Lengths
[0371] This example describes methods used to determine the effect
of changing the length of a tether on a FRET signal.
[0372] The Bite program was run with various tether lengths (FIG.
5). In the upper left (FIG. 5A) a very short tether of 2 .ANG.
results in the basic FRET curve given by equation (1). As the
tether length is increased from 2 to 60 .ANG., 120 .ANG. and then
140 .ANG. (FIGS. 5B, C and D), the basic FRET curve remains, but
the distribution becomes more spread out. With a molecular rod
length of about 120 .ANG. and tethers of 120 .ANG., there is little
FRET even though the tethers could overlap significantly.
Therefore, use of a molecular rod of about 120 .ANG. and tethers of
120 .ANG., results in almost no FRET until the two tethers are
brought together by binding to the target molecule.
[0373] Even with tethers that are 240 .ANG. long (FIG. 5D), the
right side of the distribution is almost the same as with 120 .ANG.
long tethers (FIG. 5C). That is, tether length makes little
difference to the FRET results, but molecular rod length has a
significant effect.
[0374] In summary, the length of the tether had little effect on
FRET, while the length of the molecular rod made a significant
difference. Including a rod in the molecular linker of a nanoprobe
reduces FRET to almost undetectable levels, even when tethers are
more than sufficiently long to reach the target. In contrast, in
the presence of a target the FRET signal can be large. This
provides a strong molecular switch on the output signal based on
the presence or absence of the target. An example of a useful
rod-tether combination for a nanoprobe uses a rod of 120 .ANG. with
two tethers also of 120 .ANG.. These are conveniently constructed
from 40 nucleotides of dsDNA, to create the rod, and 5 to 6 PEG 18
spacers of 23 .ANG. each, to create tethers.
[0375] Two time scales can be considered in understanding the
operation of molecular nanoprobes. On the time scale of molecular
vibrations, picoseconds, the tethers will explore a large variety
of possibilities and the joining of two tether tips that are
separated by a molecular rod appears to take a long time. For
example, this process could take several orders of magnitude longer
than molecular vibrations, for example, 100 milliseconds. Although
100 milliseconds is a long time from the viewpoint of molecular
motions, it is only 1/10th of a second on the human time scale.
Thus a detection process using a molecular probe may appear to be
quite rapid.
EXAMPLE 10
Using Medusa Sequencers Macroscopically
[0376] This example describes methods of using the probes described
herein macroscopically. For example, these methods can be used to
determine the properties of a Medusa probe without resorting to
single molecule detection.
[0377] To observe the transient dwell event, a hairpin DNA such as
the one described in Example 2 can be used. A schematic overview of
a hairpin oligonucleotide that can be used is shown in FIG. 7. The
top of FIG. 7 illustrates a hairpin oligonucleotide with a 5'
overhang (such as four base pairs) and fluorescent donor label
(circle). A freely diffusing dTTP is labeled with a FRET acceptor
(hexagon). The bottom shows FRET between the donor and acceptor
when the labeled dTTP is held to the hairpin by a polymerase
(ellipse). The hairpin is designed to have a small overhang that
exposes "A" as the next base to be read. The oligonucleotide has a
donor fluorophore on the 5' end. In some examples, this control DNA
is filled in with an acceptor fluorophore labeled dTTP (or dUTP).
This will result in FRET and an acceptor emission signal.
[0378] Measurements of single hairpin DNA molecules having a small
5' overhang (four bases) that exposes "A" as the next base to be
read, a donor fluorophore (Alexa Fluor 488) on the 5' end (SEQ ID
NO: 31, with a Alexa Flour 488 on the 5' end) were obtained using
Image Correlation Spectroscopy (ICS). Using an Olympus FluoView
FV1000 confocal microscope, a 1 nM sample of this hairpin
oligonucleotide was imaged. The low concentration of labeled DNA
ensured there was only one fluorophore per confocal volume (about 1
femtoliter).
[0379] Measurements of hairpin DNA molecules having a small 5'
overhang (four bases) that exposes "A" as the next base to be read,
a donor fluorophore (Alexa Fluor 488) on the 5' end, and a
covalently attached 3' acceptor-labeled dUTP (Alexa Fluor 594-dUTP)
(SEQ ID NO: 32) were made. FRET was observed at about 200 nM
oligonucleotide concentration using a Molecular Devices SpectraMax
Gemini EM plate reader, and at a much lower concentration (10 nM
oligo) using a Zeiss LSM 510 Meta NLO confocal system. Therefore,
this confocal method might be used to detect nucleotide dwell.
[0380] Measurements of both free Alexa Fluor 555-labeled
nucleotides and hairpin DNA molecules having a small overhang (four
bases) that exposes "A" as the next base to be read and a
fluorophore (Alexa Fluor 555) on the 5' end, (SEQ ID NO: 33) were
made using fluorescence correlation spectroscopy (FCS). The labeled
hairpin molecule diffused much slower than the labeled nucleotides
due to the higher mass of the hairpin oligonucleotide. Therefore,
FCS methods might be used to detect nucleotide dwell.
[0381] For example, a hairpin oligonucleotide having a
dideoxynucleotide on the 3' end (such as ddC), and a 5' end that
includes a small overhang (such as four bases) that exposes a
nucleotide (such as "A" or "G") as the next base to be read and a
donor fluorophore, can be used (see FIG. 7). Because this hairpin
oligonucleotide cannot be extended by a polymerase, and the
acceptor-labeled dNTP cannot be attached to the hairpin
oligonucleotide, it is a model for the non-hydrolyzable arms of the
disclosed sequencing probe. Such an unextendable oligonucleotide
can be imaged in the presence of a polymerase and labeled
nucleotides (such as labeled dNTPs, such as acceptor-labeled dUTP,
for example Alexa Fluor 647-labeled dUTP or Alexa Fluor 647-labeled
dCTP) to observe the nucleotides dwelling in the polymerase pocket.
Nucleotides bound to the pocket/template will diffuse much slower
than free nucleotides in solution. For example, comparing the
imaging of a matched nucleotide to one that is not complementary to
the template can be performed to monitor dwell, wherein nucleotides
that match will dwell longer than those that do not match. For
example, to demonstrate that the base is specifically but
noncovalently bound, the occurrence of dwell events in the presence
of acceptor-labeled dUTP will likely be minimally affected by
competition by dATP, dCTP or dGTP but should be drastically reduced
by competition with dUTP.
[0382] The different dwell times can be demonstrated by using
labeled non-complementary bases (for example bases having the label
on the same position). For example, fluorescent labels on dCTP and
dUTP from Invitrogen/Molecular Probes are all attached to the C5
position.
[0383] In some examples, the hairpin DNA contains a biotin for
attachment to surfaces thereby permitting measurements of
nucleotide dwell in individual molecules in discrete locations.
[0384] Another exemplary construct that can be used to monitor
dwell is shown in FIG. 8. In this example, the acceptor-labeled
nucleotide triphosphate (such as dNTP) is attached to the hairpin
oligonucleotide via a linker, such as by conjugating the
triphosphate's 5'.gamma.-phosphate to a primary amine on the linker
via a carbodiimide cross-linker. This will generate a single linker
or "arm" of Medusa. In intermediate designs, two or three tethered
arms can be added. In addition, the arms can attached to the
polymerase and the polymerase can be attached to a surface. The
polymerase can be induced to step along the hairpin DNA by adding
free nucleotide triphosphates. For example, if the first base to be
added is dCTP, the second base to be added is dTTP and the "arm"
contains a labeled dUTP, then there should be little signal without
dCTP. However, when dCTP is added, the polymerase will step,
allowing the labeled dUTP on the arm to FRET with the DNA donor.
The dwell times using a Medusa sequencer having multiple "arms" can
be measured by sequentially adding bases to a tethered DNA. As each
base is added to the solution, the predicted single molecule
spectrum is observed. This process can be observed in real time,
demonstrating a single nucleotide step. For example, single
molecule detection methods can be used to detect nucleotide dwell
using this construct.
[0385] Using the hairpin DNA molecules described above, it is also
possible to demonstrate that FRET occurred by cutting a hairpin
with a restriction enzyme such as EcoRI (GAATTC is in the sequence
along with a Fis site) or using DNase I, and the FRET should
decrease. A second oligonucleotide replaces a C at the 3' end with
a dideoxy C, so the next base cannot be covalently attached. Mixing
the oligonucleotide with the fluorescent dTTP will give no FRET.
Adding a polymerase will allow the fluorescent dTTP to bind and
give FRET. The FRET from the fluorescent dTTP can then be competed
away with regular dTTP, while dGTP, dATP and dCTP should not
compete. These methods can be used to demonstrate that the dTTP
dwells in the polymerase.
[0386] Progressively more complex constructs can be examined,
leading to a complete Medusa probe. For example, PEG can be added
to the 5' end of the hairpin oligonucleotide described above,
leading to a fluorophore and a T. This is, essentially, a single
arm Medusa probe that can be used as above except that free
fluorescent dTTP is not required because it is now part of the
experimental construction. A second arm can then be added to the
construction by using a stretch of DNA hybridized to a single
stranded DNA extended from the 5' end of the hairpin.
[0387] A complete Medusa probe can be tested using the original
hairpin without any attached fluorophore:
##STR00001##
The hairpin is designed so that the bases to be added at the 3' end
consist of the four dNTPs in a unique order. In the design shown,
the bases to be added to fill in the overhang are dTTP, dGTP, dCTP
and dATP.
[0388] The hairpin is mixed with Medusa molecules, without any
dNTPs and the solution is placed into a spectrofluorometer. Since
the next base to be added is a T the Medusa probe will produce a T
signal. This signal will be stable because there are no additional
nucleotides available in solution. All Medusa probes will give the
same signal, allowing the result to be read macroscopically. Any
Medusa probes that are not performing the correct operation will
give a background signal so this provides a means of estimating the
error rate of individual Medusa probes.
[0389] The result indicates that the template strand contains a T.
That is, the Medusa probes have read a single base of sequence.
Since T is the base reported by the probes, dTTP can be added to
the solution and the spectrum can be determined again. Over time
the spectrum will switch to giving a G signal since a C is now in
the pocket. The Medusa probes have therefore reported the second
base of the sequence. The sequence reported using these methods is
compressed. That is, if the overhang contained several bases of the
same kind adjacent to each other, the probes will only report a
single base.
[0390] The method proceeds as follows, starting again from the
beginning:
[0391] Adding dTTP the hairpin filled in by one base is
obtained:
##STR00002##
At this time the Medusa probes will report a G signal.
[0392] Adding dGTP the following hairpin filled in by two bases is
obtained:
##STR00003##
At this time the Medusa probes will report a C signal.
[0393] Adding dCTP the hairpin filled in by three bases is
obtained:
##STR00004##
Finally, the Medusa probes will report an A signal.
[0394] Adding dATP the fully filled in hairpin is obtained:
##STR00005##
[0395] All four nucleotides are in solution at this point. Because
the hairpin has been fully filled in, the Medusa probes will stop
producing signals.
[0396] These methods can therefore test all four Medusa arms and
also the state of completing a sequence without requiring a single
molecule detection system.
EXAMPLE 11
Microscope System
[0397] This example describes microscope systems that can be used
to sequence target nucleic acid molecules using the probes
disclosed herein.
Microscopes
[0398] Total internal reflection (TIR) fluorescence microscopy can
be used, for example using the methods and device described by
Pierce et al. (Nature, 388:338, 1997; Methods Cell Biol. 58:49,
1999); Funatsu et al. (Nature, 374:555, 1995); Weiss (Science,
283:1676, 1999) and Schutt et al. (U.S. Pat. No. 5,017,009). TIR is
an optical phenomenon that occurs when light is directed at less
than a critical angle, through a high refractive index material,
toward an interface of that material with a second material having
a lower refractive index. In this situation, all light is reflected
back from that interface, except for a microscopic evanescent wave
which propagates into the second material for only a short
distance. In particular examples, TIR and single molecule detection
are performed using a simple optic fiber in a regular fluorescent
microscope (for example see Fang and Tan. Anal. Chem., 71:3101-5,
1999; Xu and Yeung. Science, 275:1106-9, 1997; Ma et al., Anal
Chem, 72:4640-5, 2000; and Levene et al., Science, 299:682-6,
2003).
[0399] In TIR fluorescence microscopy, the first material is a
glass substrate and the second material is water or another aqueous
medium in which an assay is being conducted. When fluorescently
labeled materials approach the interface, within the field of the
evanescent wave, the fluorescent molecules can be excited, and
fluorescence detected which then emanates into the overlying
solution. TIR produces a superior signal-to-noise ratio, and
reduces the photobleaching of the fluorescent molecules since only
a thin layer of the sample is exposed.
[0400] Methods of reducing photobleaching are known in the art, and
the disclosed methods are not limited so particular reduction
methods. In one example, confocal microscopy can be used to reduce
photobleaching of fluorophores. An example of a confocal laser is
the Leica Confocal Spectrophotometer TCS-SP (Leica, Germany). The
confocal laser will only illuminate sequencing polymerases, leaving
the remainder of the reservoir dark. To accomplish this, one can
first scan the entire volume available for polymerases then program
the microscope to only expose those small regions containing
functioning polymerases. Confocal microscopy can be used to
sequence reactions in three dimensions (see U.S. Pat. No.
6,982,146). Confocal microscopy excludes planes that are not of
interest, allowing one to increase the total number of sequences
taken. This permits more sequencing reactions to be performed and
detected per field of view.
[0401] Near-field scanning optical microscopy (NSOM) can also be
used for the sequencing method disclosed herein. Several methods
and devices for NSOM have been described (U.S. Pat. No. 5,105,305
and PCT Publication WO 97/30366). In NSOM, an aperture having a
diameter that is smaller than an optical wavelength is positioned
in close proximity (such as within less than one wavelength) to the
surface of a specimen and scanned over the surface. Light can be
either emitted or collected by such an aperture in the end of a
probe. Mechanical or piezoelectric means are provided for moving
the probe relative to the sample. Light that has interacted with
the sample is collected and detected by, for example, a
spectrophotometer, and then a CCD camera. The strength of the
detected light signal is typically stored, in the form of digital
data, as a function of the probe position relative to the sample.
The stored data can be converted into a nucleic acid sequence. NSOM
allows optical measurements with sub-wavelength resolution, can
measure FRET, and works well in solution (Ha et al., Proc. Natl.
Acad. Sci. USA 93:6264-8, 1996). Standard microscopes can be
converted to a near-field optical microscope using a device sold by
Nanonics Ltd. (Malha, Jerusalem, Israel).
[0402] One advantage of NSOM is that high resolution of the sample
can be obtained. However, since the probe scans the surface of the
substrate, the number of sequencing reactions that can be monitored
at any one time decreases. To help compensate for this decrease,
the rate of nucleotide addition can be decreased by increasing the
viscosity of the solution (for example by including PEG, Ficoll,
glycerol, or combinations thereof, at appropriate concentrations to
the solution) or decreasing the temperature.
[0403] Kairos Scientific provides a Fluorescence Imaging
MicroSpectrophotometer (FIMS). This microscope generates a
fluorescence emission spectrum for every pixel in the field of
view. Therefore, a unique emission spectrum is generated for each
nucleotide as it is added to the complementary nucleic acid
strand.
[0404] In other examples, the method allows for single molecule
detection (SMD), for example using the system disclosed by Fang and
Tan (Anal. Chem. 1999, 71:3101-5, herein incorporated by
reference). Briefly, in this system an optical fiber is used to
probe into a solution (for example an aqueous environment or at a
solid surface). The optical fiber has total internal reflection,
allowing fluorescent molecules close to the surface to be excited
by the evanescent wave. The fluorescent signals generated by the
fluorophores are detected by an intensified charge-coupled device
(ICCD)-based microscope system. Optical fibers can be purchased
from Newport Corp. (Irvine, Calif.).
[0405] In yet other examples, SMD can be performed using the method
disclosed by Unger et al. (BioTechniques, 1999, 27:1008-14, herein
incorporated by reference). Briefly, using a standard fluorescent
microscope with mercury lamp excitation and a CCD camera, single
fluorescent molecules can be observed in air and in aqueous
solution, if the molecules are sufficiently separated by
dilution.
Reducing Photobleaching
[0406] Methods of reducing photobleaching are known in the art, and
the disclosed methods are not limited so particular reduction
methods. In one example, confocal microscopy can be used to reduce
photobleaching of fluorophores (described above). Another means
that can be used to reduce photobleaching is to incubate the sample
in a solution containing an oxygen scavenger system, for example as
described by Kitamura et al. (Nature, 397:129, 1999); Okada and
Hirokawa (Science, 283:1152, 1999); Harada et al. (J. Mol. Biol.
216:49, 1990). Examples of solutions include: 1% glucose, 0.05
mg/ml glucose oxidase and 0.1 mg/ml catalase; and 0.5%
2-mercaptoethanol, 4.5 mg/ml glucose, 216 .mu.g/ml glucose oxidase,
36 .mu.g/ml catalase, 2 mM ATP in buffer.
[0407] One method that can be used to reduce photobleaching is to
coat fluorophores with calcium phosphate (also known as molecular
dots). For example, when trapped inside 60 nm nanoparticles,
fluorophores remain extremely stable and do not significantly
decay. For the present probes, small nanoparticles of about 0.5-2
nm (such as 1 nm to 2 nm) having one amino group (or other unique
attachment point) on the surface can be used. For example, a
tethered fluorophore having an amino group (to permit attachment of
the fluorophore to the desired location on the nanoprobe) can be
coated and attached to a nanoprobe. The layering can be
accomplished by incubating the fluorophore with carboxyl (--COOH)
groups and then adding calcium or aluminum. On adding phosphate
H.sub.2PO.sub.4.sup.-, another layer is formed. In some examples,
gold is used to coat the fluorophores. The resulting particles have
plasmon resonance, possibly enhancing the fluorescence in addition
to the protective coating (see Lakowicz, Anal. Biochem. 298: 1-24,
2001).
[0408] Yet other methods of reducing photobleaching include placing
a nanoprobe sequencer disclosed herein and the target nucleic acid
molecule proximal to metallic islands (Lakowicz, Anal. Biochem.
298: 1-24, 2001) and incubation in Trolox (Rasnik et al., Nat.
Methods 3:891-3, 2006).
Sources of Electromagnetic Radiation
[0409] In particular examples, electromagnetic radiation is emitted
by a laser. The choice of laser used will depend on the specific
donor fluorophore used. The wavelength of the laser light is
selected to excite the donor fluorophore. For example, wild-type
GFP and FITC can be excited by an argon laser at 488 nm. To excite
the H9-40 GFP mutant, blue laser diodes which emit at 400 nm
(Nichia Chemical Industries Ltd.) or 404 nm (Power Technology Inc.,
Little Rock, Ark.) can be used. Other sources of electromagnetic
radiation known by those skilled in the art can also be used, for
example HeNe lasers and mercury lamps.
Fluidics
[0410] The use of a fluid handling system is optional. For
simplicity, one may prefer to add all of the necessary reagents,
then seal the chamber with a glass coverslip or a drop of oil to
prevent desiccation. Alternatively, a slow flow of
nucleotide-containing solution can be provided to replenish the
nucleotides and to remove the products (diphosphate). Such a system
would increase nucleotide use, but would maintain steady-state
conditions, which may increase the length of sequencing runs.
[0411] A computer chip that performs the liquid handling can be
built that sits on the stage of a fluorescent microscope.
Micromachine and microfluidic devices and methods for the
dispensing of nanoliter size liquid samples has been previously
described (Service, Science 282:399-401, 1998; Burns et al. Science
282:484-7 1998).
Detectors
[0412] A detector permits capture of the emission spectra generated
by the spectrophotometer.
[0413] A CCD camera can be used as the detector to capture the
image. The emission spectra generated by the spectrophotometer are
collected by the CCD camera, which converts this input into
charges. The charges are converted into a signal by the CCD output.
The resulting signal is digitized, as a characteristic signal
associated with each type of nucleotide (such as A, T/U, C or G),
and the digital data is captured into memory, such as the hard
drive of a computer. The sum of the captured data is then processed
into a nucleotide sequence. CCD cameras are commercially available
from many sources including Kodak (Rochester, N.Y.).
[0414] With color CCD cameras containing more than 1000 by 1000
pixel fields (for example the Kodak Professional DCS 520 Digital
Camera), or even 4096 by 4096 pixel fields (for example the Kodak
16.8i, KAF16800), it may be possible to sequence as many as 1000
nucleic acids in parallel, at a rate of up to 750 bases per second.
Therefore, molecular sequencing with the probes disclosed herein
has the potential to sequence entire chromosomes or genomes within
a day. If the polymerases are placed in a regular hexagonal array,
about 17 pixels would be available for each polymerase.
[0415] Alternatively, a monochrome CCD containing filters or other
means of obtaining a spectrum can be used. To reduce background
noise, any of the CCD cameras may be cooled.
[0416] The rate at which sequencing of the nucleic acids occurs can
be controlled by many factors. Faster rates can be obtained by
increasing the temperature (using a heat stable polymerase and PNA
for rods) or by running the reactions under high pressure, as in
HPLC. The reaction rate can be slowed by making the solution more
viscous, by lowering the reaction temperature, by having fewer
reactive nucleotides available, or by having free non-hydrolyzable,
non-fluorescent dNTPs available. The rate of polymerization may be
controlled in this manner not to exceed the rate of the CCD
integration and computer recording time. Therefore, the rate of
polymerization is controlled in this manner such that the
fluorescent signal can be more reliably read by the CCD and
interpreted by the computer.
[0417] In one example, the method is performed in a closed-chamber
device that produces sequencing signals, which enter the computer
directly. The method sequences nucleic acid molecules by monitoring
the pairing of a chemical moiety with its complementary nucleotide
in the target nucleic acid molecule on the molecular level, instead
of sequencing nucleic acids by monitoring macromolecular events,
such as a pattern on an electrophoresis gel, which is
representative of a large population of nucleic acid molecules.
Once the reaction has started, no further liquid handling is
necessary (but can be added if desired). Therefore, the machine has
no macroscopic moving parts during operation, which can facilitate
rapid sequencing.
[0418] As an alternative to a CCD camera, photomultiplier tubes or
an intensified charge-coupled device (ICCD) can be used
[0419] In one example, a superconductor is used to detect the FRET
signals. superconductor-based light detectors are sensitive
detectors coming that give the entire spectra from single molecules
with very little loss of photons. In some examples, the
superconductor is brought to its transition temperature. This is
the temperature at which it loses superconductivity. When a photon
hits the superconductor, it loses superconductivity in proportion
to the energy of the photon. Therefore, it can not only detect
individual photons but also can give the frequency of the light
since that is proportional to the energy (by hv). An individual
pixel of a detector can be maintained at the transition by placing
a voltage across the device. If the device temperature is too high,
the resistance increases, decreasing the current and reducing the
temperature again.
Increasing Signal
[0420] In addition to reducing photobleaching, methods are known in
the art to increase the signal detected. For example, a high
numerical aperture microscope objective can be used, as well as the
use of metallic islands near fluorophores (Lakowicz, Anal. Biochem.
298: 1-24, 2001). Metallic islands decrease the lifetime which
reduces photobleaching and increases the number of photons by about
100-fold.
[0421] In one example, mirrors are placed above the fluorophore. In
another example, the sample is surrounded by a parabolic reflector,
thereby increasing the FRET signals at the focal point. For
example, Kartalov et al. (BioTechniques, 40:85-90, 2006) provide
microfluidic devices having a parabolic flow channel profile. Such
devices can be used in the methods disclosed herein. In one
example, the channel of the microfluidic device has a reflective
substance, and a laser is directed down the length of the device to
excite the fluorophores. In one example, total internal reflectance
(TIR) is used to excite the fluorophores.
EXAMPLE 12
Computer System
[0422] The methods disclosed herein can be performed in the general
context of computer-executable instructions of a computer program
that runs on a personal computer. Generally, program modules
include routines, programs, components, data structures, etc. that
perform particular tasks or implement particular abstract data
types. Moreover, those skilled in the art will appreciate that the
method may be practiced with other computer system configurations,
including hand-held devices, multi-processor systems,
microprocessor-based or programmable consumer electronics,
minicomputers, mainframe computers, and the like. The methods
disclosed herein can also be practiced in distributed computing
environments where tasks are performed by remote processing devices
that are linked through a communications network. In a distributed
computing environment, program modules may be located in both local
and remote memory storage devices.
[0423] The present implementation platform of the methods disclosed
herein is a system implemented on a Sun computer having at least
one gigabyte of main memory and a one gigabyte hard disk drive,
with Unix as the user interface. The application software is
written in Pascal, Java or other computer languages.
[0424] In particular examples Hidden Markov Modeling (McKinney et
al., Biophys. J. 91:1941-51, 2006) is used to analyze and
characterize obtained FRET data.
[0425] In particular examples, linear unmixing is used to analyze
and characterize obtained FRET data. Linear unmixing is the process
of working backwards from a given spectrum to determine the amounts
of individual fluorophores that contributed to that spectrum (for
example see Thaler et al. Biophys. J. 89:2736-49, 2005). For
example, if it is determined that there is 99% A, 1% T, 0% G, 0% C,
it is inferred the base is an A.
EXAMPLE 13
Sequencing Using Probe
[0426] This example describes methods for sequencing nucleic acids
from different sources using the probes of the present disclosure.
Although particular methods are provided, one skilled in the art
will appreciate that variations to the method can be made.
[0427] In this example, reference will be made to the probe shown
in FIG. 1B. However, one skilled in the art will understand that
any of the probes disclosed herein can be substituted for this
probe. In this example, the polymerizing agent 12 is a
fluorescein-HIV-1-reverse transcriptase (and thus tag 30 is
fluorescein), the chemical moieties 22, 24, 26, 28 are
nonhydrolyzable dCMPCPP, dGMPCPP, dAMPCPP, and TMPCPP, and the tags
32, 34, 36, 38 associated with the chemical moieties are Cy3, Cy5,
Texas Red, Rhodamine Red.
[0428] The sequencing reaction includes 5 .mu.M probe, 5 .mu.M
primer, 1 g-1 .mu.g target nucleic acid sequence (such as 1 .mu.g
of sample nucleic acid), and 200 .mu.M of each dNTP, and the
reaction is performed in Ambion HIV RT First Strand Synthesis
Buffer (10.times.): 500 mM Tris-HCl (pH 8.3), 750 mM KCl, 30 mM
MgCl.sub.2, 50 mM DTT. In one example, the target nucleic acid is
obtained from a biological sample from a subject. In particular
examples, the reaction proceeds at 45.degree. C.
[0429] In this example, the donor fluorophore is fluorescein.
Therefore, the sequencing reaction can be excited by a laser, such
as a laser that emits a wavelength of light that will excite the
donor (such as a 488 nm Argon laser).
[0430] The sequencing reaction is incubated under conditions that
permit the fluorescein-polymerase 12 to bind to the primer/target
nucleic acid sequence, and permit the nonhydrolyzable dCMPCPP,
dGMPCPP, dAMPCPP, and TMPCPP 22, 24, 26, 28 to pair with the
currently exposed nucleotide 44 on the target nucleic acid strand.
When the fluorescein-polymerase binds to a target DNA or RNA 40
that has been primed by an oligonucleotide 42, each of the
molecular linkers 14, 16, 18, 20 can flexibly extend to place the
nonhydrolyzable dCMPCPP, dGMPCPP, dAMPCPP, and TMPCPP 22, 24, 26,
28 into the active site pocket of the fluorescein-polymerase 12.
Thus the correctly paired nonhydrolyzable dAMPCPP 26 will remain in
the polymerase active site pocket a long time (relative to the
non-complementary nonhydrolyzable 22, 24, 28). The corresponding
acceptor fluorophore 36 will be close to the donor fluorophore
fluorescein 30 so there will be FRET between the two, thereby
producing a spectral output that indicates which nonhydrolyzable
dCMPCPP, dGMPCPP, dAMPCPP, and TMPCPP 22, 24, 26, 28 is currently
pairing with the complementary base in the target strand being
sequenced.
[0431] The emission signal from the acceptor fluorophore 36
currently pairing with the complementary base 44 in the target
strand being sequenced 40 is detected. For example, the reaction
can be observed under a fluorescent microscope or by a confocal
microscope, wherein the microscope can capture the spectrum of each
acceptor fluorophore used.
[0432] The nonhydrolyzable dCMPCPP, dGMPCPP, dAMPCPP, and TMPCPP
22, 24, 26, 28 (in this example 26) will eventually be replaced in
the active site by the hydrolyzable non-labeled nucleotide (in this
case dATP, 46), and be incorporated into the elongating
complementary strand. This will step the probe forward one base on
the target nucleic acid molecule 40. This exposes the next base on
the target nucleic acid molecule 40 and the reaction will be
repeated as described above. An acceptor emission signal will be
detected when the complementary nonhydrolyzable nucleotide analog
on the probe pairs with the exposed base. Thus the probe produces a
time varying signal that represents the nucleotide sequence of the
target molecule.
[0433] For example, the resulting emission signals may generate a
series of pulses as shown in FIG. 6. The figure is similar to
clocking pulses for digital electronics and computers. Time is
along the horizontal axis, and the intensity of various signals is
given as horizontal lines. The target sequence is given along the
top, 5' A C G T T C A G T 3' (SEQ ID NO: 39). There is one line for
each base. Distinct, spectral signals from the four fluorescently
labeled nonhydrolyzable nucleotide analogs are converted into the
corresponding complementary base on the target strand. The bottom
line CLOSE represents when the polymerase is closed (as described
herein the polymerase can include tags that monitor opening and
closing of the polymerase). As each base on the target nucleic acid
strand pairs with the complementary nonhydrolyzable nucleotide
analog on the probe, the corresponding signal appears. Actual data
will likely be noisier than shown, and the timing lengths will not
likely be regular. When a pair of Ts are encountered as shown in
FIG. 6, their signals may not be distinct, because of the noise.
However, the polymerase must open and close to admit the second T,
so the CLOSE signal provides a clocking by which to read that there
were two T signals.
[0434] In one example, the method is used to determine if a subject
has a mutation in a target nucleic acid sequence, such as a
mutation associated with disease.
[0435] Many different sequences can be determined in parallel. One
application of the disclosed method is the sequencing of a plasmid.
After introducing random nicks into the plasmid, the DNA is added
onto a substrate containing fixed probes. The entire plasmid is
then sequenced from many points. The computer keeps track of all
the sequences and automatically assembles them into a complete
plasmid sequence.
[0436] Another use is for sequencing a randomly chemically
synthesized region of a nucleic acid. The primer used is specific
for a position just outside the randomized region. The randomized
nucleic acids are placed onto the field of fixed polymerases. This
method allows one to obtain the entire results of a randomization
experiment in parallel, thereby saving time and money.
[0437] Nick translation can be used to initiate sequencing on an
unknown nucleic acid.
EXAMPLE 14
Detection of Single Nucleotide Polymorphisms
[0438] The probes disclosed herein can be used to determine single
nucleotide polymorphisms (as for example see Twist et al., Anal.
Biochem. 327:35-44, 2004) by targeting the sequencers with the
sequence just upstream of the unknown base. No dNTPs are supplied.
Medusa probe settle on the end of the primer and report the unknown
base. To reduce costs, specialized probes that have fewer than four
arms, and hence which can distinguish fewer bases, could be used in
specific cases where many assays are desired.
EXAMPLE 15
Clinical Applications
[0439] This example describes how the methods disclosed herein can
be used for the analysis of pathology specimens. The source of
specimen obtained from a subject may include peripheral blood,
urine, saliva, tissue biopsy, fine needle aspirates, surgical
specimen, amniocentesis samples, tissue slices, cheek swabs, and
autopsy material.
[0440] In particular example, the biological sample is attached to
a substrate, such as a glass slide, under conditions that preserve
the nucleic acid molecules present in the sample. Alternatively,
the nucleic acids can be isolated from the sample, and then
subjected to methods described in Example 13. For example, one can
use the present method to sequence bacterial chromosomes and human
genes containing mutations. Using techniques described herein, the
presence of viral and/or bacterial pathogens can be detected by the
presence of the viral and/or bacterial nucleic acid sequences. In
addition, the methods disclosed herein allow for nucleic acid
sequencing in situ, by adding a primer, a probe, and the four
non-labeled hydrolyzable nucleotides, to a thin tissue slice.
[0441] In one example, the method is used to generated genetic
profiles of normal, precancerous, and tumor cells for one or more
cancers. For example, cDNA libraries from each of these cell types
are sequenced to determine the genetic profiles of cancer cells.
The disclosed methods can be used to obtain gene expression data
directly with no cloning, conventional sequencing, or microarrays.
This can reduce time and expense, thus allowing additional types of
tissues to be determined
[0442] In one example, the biological sample includes a tissue,
such as a tissue microarray that includes large numbers of
specimens, for example from large numbers of specimens. Such an
array permits screening of a large number of specimens from many
subjects, or many specimens from the same subject.
[0443] In view of the many possible embodiments to which the
principles of the present disclosure may be applied, it should be
recognized that the illustrated examples are only particular
examples and should not be taken as a limitation on the scope of
the disclosure. Rather, the scope of the disclosure is defined by
the following claims. We therefore claim as our invention all that
comes within the scope and spirit of these claims.
Sequence CWU 1
1
39130DNAEscherichia coli 1agcttttcat tctgactgca acgggcaata
30222DNAArtificialcompressed version of SEQ ID NO 1 2agctcatctg
actgcacgca ta 22320DNAArtificialsequence used to generate exemplary
nanoprobe. 3ggcctccgtc ctcggcagta 20420DNAArtificialsequence used
to generate exemplary nanoprobe. 4tactgccgag gacggaggcc
20520DNAArtificialsequence used to generate exemplary nanoprobe.
5cgataatgcc tgtcatgcat 20620DNAArtificialsequence used to generate
exemplary nanoprobe. 6atgcatgaca ggcattatcg
20719DNAArtificialsequence used to generate exemplary nanoprobe.
7gaacgtctag acttatcgc 19820DNAArtificialsequence used to generate
exemplary nanoprobe. 8gcgataagtc tagacgttcc
20920DNAArtificialsequence used to generate exemplary nanoprobe.
9ctctcgctcc gtgccgtaag 201020DNAArtificialsequence used to generate
exemplary nanoprobe. 10cttacggcac ggagcgagag
201171DNAArtificialsequence used to generate exemplary nanoprobe.
11cgctcctgaa ttcgacgtac gctatatatt tagtatgttg taactaaagt ccagcgcgaa
60gcttaatgac t 711271DNAArtificialsequence used to generate
exemplary nanoprobe. 12attcagtctg caggaaggcc gactttagtt acaacatact
aaatatatag ccagtaaggg 60atccgatctc g 711320DNAArtificialsequence
used to generate exemplary nanoprobe. 13gtacgtcgaa ttcaggagcg
201420DNAArtificialsequence used to generate exemplary nanoprobe.
14cgagatcgga tcccttactg 201520DNAArtificialsequence used to
generate exemplary nanoprobe. 15agtcattaag cttcgcgctg
201620DNAArtificialsequence used to generate exemplary nanoprobe.
16ggccttcctg cagactgaat 201740DNAArtificialsequence used to
generate exemplary nanoprobe; two PEG18 molecules between
nucleotides 20 and 21, a PET 9 molecule and an NH2 molecule after
nucleotide 40 17gtacgtcgaa ttcaggagcg tactgccgag gacggaggcc
401840DNAArtificialsequence used to generate exemplary nanoprobe;
an NH2 molecule and a PEG9 moleucle before the first nucleotide;
three PEG18 molecules between nucleotides 20 and 21 18atgcatgaca
ggcattatcg cgagatcgga tcccttactg 401940DNAArtificialsequence used
to generate exemplary nanoprobe; an NH2 molecule and a PEG9
molecule before the first nucleotide; three PEG18 molecules between
nucleotides 20 and 21 19gcgataagtc tagacgttcc agtcattaag cttcgcgctg
402040DNAArtificialsequence used to generate exemplary nanoprobe;
three PEG18 molecules between nucleotides 20 and 21; a PEG9
molecule and an NH2 after the last nucleotide. 20ggccttcctg
cagactgaat cttacggcac ggagcgagag 402171DNAArtificialsequence used
to generate exemplary nanoprobe. 21cgctcctgaa ttcgacgtac gctatatatt
tagtatgttg taactaaagt ccagcgcgaa 60gcttaatgac t
712271DNAArtificialsequence used to generate exemplary nanoprobe.
22attcagtctg caggaaggcc gactttagtt acaacatact aaatatatag ccagtaaggg
60atccgatctc g 712340DNAArtificialsequence used to generate
exemplary nanoprobe; three PEG 18 molecules between nucleotides 20
and 21; [PEG9]-NH-POOH-O-POOH-CH2-POOH-deoxyadenosine after
nucleotide 40. 23gtacgtcgaa ttcaggagcg tactgccgag gacggaggcc
402440DNAArtificialsequence used to generate exemplary nanoprobe;
three PEG 18 molecules between nucleotides 20 and 21;
[PEG9]-NH-POOH-O-POOH-CH2-POOH-deoxyadenosine after nucleotide 40.
24ggccttcctg cagactgaat cttacggcac ggagcgagag
402540DNAArtificialsequence used to generate exemplary nanoprobe;
deoxyguanosine-POOH-CH2-POOH-O-POOH-NH-[PEG9] before nucleotide 1;
three PEG 18 molecules between nucleotides 20 and 21; 25gcgataagtc
tagacgttcc agtcattaag cttcgcgctg 402640DNAArtificialsequence used
to generate exemplary nanoprobe;
deoxyguanosine-POOH-CH2-POOH-O-POOH-NH-[PEG9] before first
nucleotide; three PEG18 molecules between nucleotides 20 and 21.
26atgcatgaca ggcattatcg cgagatcgga tcccttactg
402720DNAArtificialsequence used to generate exemplary nanoprobe;
Cy3 and Cy5 molecules at the 5'-end. 27ggcctccgtc ctcggcagta
202820DNAArtificialsequence used to generate exemplary nanoprobe;
Cy3 and Texas Red molecules at the 3'-end. 28cgataatgcc tgtcatgcat
202920DNAArtificialsequence used to generate exemplary nanoprobe;
Cy3 and Rhodamine moleculesat the 3'-end. 29ggaacgtcta gacttatcgc
203020DNAArtificialsequence used to generate exemplary nanoprobe;
Cy5, Texas Red, and Rhodamine Red molecules at the 5'-end.
30ctctcgctcc gtgccgtaag 203165DNAArtificialoligonucleotide that can
form a haipin; Alexa Fluor 488 present on the 5'-end. 31tcgagtttgc
tcagaattcg atcacgatcg cgcgaagcgc gatcgtgatc gaattctgag 60caaac
653265DNAArtificialoligonucleotide that can form a haipin; Alexa
Fluor 488 at 5'-end; dUTP labeled with Alexa Fluor 594 after
nucleotide 65.. 32tcgagtttgc tcagaattcg atcacgatcg cgcgaagcgc
gatcgtgatc gaattctgag 60caaac 653365DNAArtificialoligonucleotide
that can form a haipin; Alexa Fluor 555 at 5'-end. 33tcgagtttgc
tcagaattcg atcacgatcg cgcgaagcgc gatcgtgatc gaattctgag 60caaac
653430DNAArtificialoligonucleotide that can form a haipin
34tttgcagtcg gactaccgcg gtagtccgac
303531DNAArtificialoligonucleotide that can form a haipin
35tttgcagtcg gactaccgcg gtagtccgac t
313632DNAArtificialoligonucleotide that can form a haipin
36tttgcagtcg gactaccgcg gtagtccgac tg
323733DNAArtificialoligonucleotide that can form a haipin
37tttgcagtcg gactaccgcg gtagtccgac tgc
333836DNAArtificialoligonucleotide that can form a haipin
38tttgcagtcg gactaccgcg gtagtccgac tgcaaa
36399DNAArtificialexemplary target sequence 39acgttcagt 9
* * * * *