U.S. patent application number 12/959234 was filed with the patent office on 2011-04-28 for antisense modulation of bcl2-associated x protein expression.
This patent application is currently assigned to Isis Pharmaceuticals, Inc.. Invention is credited to Andrew T. Watt, Hong Zhang.
Application Number | 20110098340 12/959234 |
Document ID | / |
Family ID | 25425276 |
Filed Date | 2011-04-28 |
United States Patent
Application |
20110098340 |
Kind Code |
A1 |
Zhang; Hong ; et
al. |
April 28, 2011 |
ANTISENSE MODULATION OF BCL2-ASSOCIATED X PROTEIN EXPRESSION
Abstract
Antisense compounds, compositions and methods are provided for
modulating the expression of BCL2-associated X protein. The
compositions comprise antisense compounds, particularly antisense
oligonucleotides, targeted to nucleic acids encoding
BCL2-associated X protein. Methods of using these compounds for
modulation of BCL2-associated X protein expression and for
treatment of diseases associated with expression of BCL2-associated
X protein are provided.
Inventors: |
Zhang; Hong; (Carlsbad,
CA) ; Watt; Andrew T.; (Vista, CA) |
Assignee: |
Isis Pharmaceuticals, Inc.
Carlsbad
CA
|
Family ID: |
25425276 |
Appl. No.: |
12/959234 |
Filed: |
December 2, 2010 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10728509 |
Dec 5, 2003 |
7846730 |
|
|
12959234 |
|
|
|
|
09908147 |
Jul 17, 2001 |
|
|
|
10728509 |
|
|
|
|
Current U.S.
Class: |
514/44A ;
435/375; 536/24.5 |
Current CPC
Class: |
C12N 2310/315 20130101;
C12N 2310/341 20130101; A61K 38/00 20130101; Y02P 20/582 20151101;
C12N 2310/321 20130101; C12N 15/113 20130101; C12N 2310/346
20130101; C12N 2310/3341 20130101; C12N 2310/321 20130101; C12N
2310/3525 20130101 |
Class at
Publication: |
514/44.A ;
536/24.5; 435/375 |
International
Class: |
C07H 21/02 20060101
C07H021/02; A61K 31/7105 20060101 A61K031/7105; C12N 5/07 20100101
C12N005/07 |
Claims
1. A modified oligonucleotide consisting of 12 to 30 linked
nucleosides and having a nucleobase sequence comprising an at least
8 consecutive nucleobase portion of nucleobases 485-676 of SEQ ID
NO:17, wherein the nucleobase sequence of the oligonucleotide is at
least 80% complementary to SEQ ID NO:17 as measured over the
entirety of the oligonucleotide.
2. The modified oligdnucleotide of claim 1, consisting of a
single-stranded modified oligonucleotide.
3. The modified oligonucleotide of claim 2, wherein the nucleobase
sequence of the modified oligonucleotide is 100% complementary to
SEQ ID NO:17 as measured over the entirety of the modified
oligonucleotide.
4. The modified oligonucleotide of claim 2, comprising at least one
modified internucleoside linkage.
5. The modified oligonucleotide of claim 4, wherein each
internucleoside linkage is a phosphorothioate internucleoside
linkage.
6. The modified oligonucleotide of claim 2, wherein at least one
nucleoside comprises a modified sugar.
7. The modified oligonucleotide of claim 6, wherein at least one
modified sugar is a bicyclic sugar.
8. The modified oligonucleotide of claim 6, wherein at least one
modified sugar comprises a 2'-O-methoxyethyl or a 4'-(CH2)n-O-2'
bridge, wherein n is 1 or 2.
9. The modified oligonucleotide of claim 2, wherein at least one
nucleoside comprises a modified nucleobase.
10. The modified oligonucleotide of claim 9, wherein the modified
nucleobase is a 5-methylcytosine.
11. The modified oligonucleotide of claim 1, comprising: a gap
segment consisting of linked deoxynucleosides; a 5' wing segment
consisting of linked nucleosides; a 3' wing segment consisting of
linked nucleosides; wherein the gap segment is positioned between
the 5' wing segment and the 3' wing segment and wherein each
nucleoside of each wing segment comprises a modified sugar.
12. The modified oligonucleotide of claim 11, comprising: a gap
segment consisting of ten linked deoxynucleosides; a 5' wing
segment consisting of five linked nucleosides; a 3' wing segment
consisting of five linked nucleosides; wherein the gap segment is
positioned between the 5' wing segment and the 3' wing segment,
wherein each nucleoside of each wing segment comprises a
2'-O-methoxyethyl sugar, wherein each cytosine in the
oligonucleotide is a 5-methylcytosine, and wherein each
internucleoside linkage of the oligonucleotide is a
phosphorothioate linkage.
13. The modified oligonucleotide of claim 12, consisting of 20
linked nucleosides.
14. The modified oligonucleotide of claim 1, comprising a chimeric
oligonucleotide compound selected from the group consisting of ISIS
134326 to ISIS 134343.
15. The modified oligonucleotide of claim 1, comprising a
nucleobase sequence selected from the group consisting of SEQ ID
NOs: 67 to 84.
16. The modified oligonucleotide of claim 1, consisting of a
nucleobase sequence selected from the group consisting of SEQ ID
NOs: 67 to 84.
17. A composition comprising the modified oligonucleotide of claim
1 and a pharmaceutically acceptable carrier or diluent.
18. The composition of claim 17, wherein the oligonucleotide
consists of a single-stranded oligonucleotide.
19. The composition of claim 17, wherein the oligonucleotide
consists of 20 linked nucleosides.
20. A method of inhibiting the expression of BCL2-associated X
protein in cells or tissues in vitro comprising contacting the
cells or tissues with the modified oligonucleotide of claim 1 such
that expression of BCL2-associated X protein is inhibited.
Description
INTRODUCTION
[0001] This application is a divisional of U.S. Ser. No.
10/728,509, filed Dec. 5, 2003, which is a continuation of U.S.
Ser. No. 09/908,147 filed Jul. 17, 2001, abandoned, each of which
is herein incorporated by reference in its entirety.
FIELD OF THE INVENTION
[0002] The present invention provides compositions and methods for
modulating the expression of BCL2-associated X protein. In
particular, this invention relates to compounds, particularly
oligonucleotides, specifically hybridizable with nucleic acids
encoding BCL2-associated X protein. Such compounds have been shown
to modulate the expression of BCL2-associated X protein.
BACKGROUND OF THE INVENTION
[0003] Apoptosis, or programmed cell death, is a naturally
occurring process that has been strongly conserved during evolution
to prevent uncontrolled cell proliferation. This form of cell
suicide plays a crucial role in ensuring the development and
maintenance of multicellular organisms by eliminating superfluous
or unwanted cells. However, if this process becomes overstimulated,
cell loss and degenerative disorders including neurological
disorders such as Alzheimers, Parkinsons, ALS, retinitis pigmentosa
and blood cell disorders can result. Stimuli which can trigger
apoptosis include growth factors such as tumor necrosis factor
(TNF), Fas and transforming growth factor beta (TGF.beta.),
neurotransmitters, growth factor withdrawal, loss of extracellular
matrix attachment and extreme fluctuations in intracellular calcium
levels (Afford and Randhawa, Mol. Pathol., 2000, 53, 55-63).
[0004] Alternatively, insufficient apoptosis, triggered by growth
factors, extracellular matrix changes, CD40 ligand, viral gene
products neutral amino acids, zinc, estrogen and androgens, can
contribute to the development of cancer, autoimmune disorders and
viral infections (Afford and Randhawa, Mol. Pathol., 2000, 53,
55-63). Consequently, apoptosis is regulated under normal
circumstances by the interaction of gene products that either
induce or inhibit cell death and several gene products which
modulate the apoptotic process have now been identified.
[0005] Apoptosis manifests itself in two major downstream execution
programs: the caspase pathway and mitochondrial dysfunction
(Korsmeyer et al., Cold Spring Harb. Symp. Quant. Biol., 1999, 64,
343-350; Korsmeyer et al., Cell Death Differ., 2000, 7, 1166-1173).
The BCL-2 family members play a pivotal role in determining whether
a cell will live or die by acting at the mitochondrial level. This
family includes both pro-apoptotic and anti-apoptotic proteins and
the ratio between these subsets is a determinant of the
susceptibility of the cells to death signals (Korsmeyer et al.,
Cold Spring Harb. Symp. Quant. Biol., 1999, 64, 343-350). Members
of the BCL-2 family have the ability to form homodimers or
heterodimers, suggesting neutralizing competition among these
proteins. An additional characteristic of functional significance
is the ability of BCL-2 family members to act as integral membrane
proteins (Korsmeyer et al., Cold Spring Harb. Symp. Quant. Biol.,
1999, 64, 343-350).
[0006] BCL2-associated X protein (also known as BAX), is a
pro-apoptotic BCL-2 family member. Activation of BCL2-associated X
protein involves subcellular translocation and dimerization. In
viable cells, a substantial portion of BCL2-associated X protein is
monomeric and found either in the cytosol or loosely associated
with membranes. Following a death stimulus, cytosolic monomeric
BCL2-associated X protein translocates to the mitochondria where it
becomes a cross-linkable, integral membrane protein. The ability of
BCL2-associated X protein to form distinct ion-conductive membrane
pores may be, in part, responsible for mitochondrial dysfunction
that leads to cell death (Korsmeyer et al., Cold Spring Harb. Symp.
Quant. Biol., 1999, 64, 343-350; Korsmeyer et al., Cell Death
Differ., 2000, 7, 1166-1173).
[0007] BCL2-associated X protein has been cloned (Oltvai et al.,
Cell, 1993, 74, 609-619) and mapped to chromosome 19q13.3 (Apte et
al., Genomics, 1995, 26, 592-594; Chou et al., Cancer Genet.
Cytogenet., 1996, 88, 136-140), and has been shown to encode a
number of splice variants, including BAX-alpha, BAX-beta, BAX-gamma
(Oltvai et al., Cell, 1993, 74, 609-619), BAX-delta (Apte et al.,
Genomics, 1995, 26, 592-594), BAX-omega (Zhou et al., J. Biol.
Chem., 1998, 273, 11930-11936) and BAX-epsilon (Shi et al.,
Biochem. Biophys. Res. Commun., 1999, 254, 779-785.). Nucleotide
sequences encoding BAX-alpha, BAX-beta and BAX-gamma are disclosed
and claimed in U.S. Pat. Nos. 5,691,179 and 5,955,595 (Korsmeyer,
1997; Korsmeyer, 1999). Nucleotide sequences encoding BAX-omega are
disclosed and claimed in US patent 6,140,484 and corresponding PCT
publication WO 97/01635 (Bitler et al., 2000; Bitler et al., 1997).
Also disclosed in U.S. Pat. No. 6,140,484 is a 22-mer antisense
oligonucleotide directed against the exon5/intron5 junction of
human BAX-omega (Bitler et al., 2000).
[0008] Overexpression of BCL2-associated X protein has been
observed in human diseases including, glomerular disease (Yoshimura
et al., Nephrol. Dial. Transplant, 1999, 14, 55-57), Hodgkin's
disease (Brousset et al., Blood, 1996, 87, 2470-2475),
cartilage-hair hypoplasia (Yel et al., J. Clin. Immunol., 1999, 19,
428-434) and ocular complications arising from diabetes (Podesta et
al., Am. J. Pathol., 2000, 156, 1025-1032). In addition, animal
models of human disease have been used to determine that
overexpression of BCL2-associated X protein also may occur in
Alzheimer's disease (MacGibbon et al., Brain Res., 1997, 750,
223-234), Parkinson's disease (Vila et al., Proc. Natl. Acad. Sci.
U.S.A., 2001, 98, 2837-2842), familial amyotrophic lateral
sclerosis (Vukosavic et al., J. Neurochem., 1999, 73, 2460-2468)
and scrapie infections (Park et al., NeuroReport, 2000, 11,
1677-1682).
[0009] BCL2-associated X protein knockout mice have been generated
and proved viable, but displayed lineage-specific aberrations in
cell death (Knudson et al., Science, 1995, 270, 96-99).
Additionally, prolongation of ovarian life span into advanced
chronological age has been observed in BCL2-associated X protein
knockout mice (Perez et al., Nat. Genet., 1999, 21, 200-203).
[0010] Currently there exists a need to identify methods of
modulating apoptosis for the therapeutic treatment of human
diseases.
[0011] Antisense oligonucleotides, 20 nucleotides in length,
targeting bases 83-102 and 103-122 of human BCL2-associated X
protein have been used to inhibit BCL2-associated X protein in
human myeloid cells (Manfredini et al., Antisense Nucleic Acid Drug
Dev., 1998, 8, 341-350) and neutrophils (Dibbert et al., Proc.
Natl. Acad. Sci. U.S.A., 1999, 96, 13330-13335).
[0012] Currently, there remains a need for additional agents
capable of effectively and selectively inhibiting the expression of
BCL2-associated X protein.
[0013] Modified antisense phosphorothioate oligonucleotides and
unmodified oligodeoxynucleotides targeting the start codon of rat
BCL2-associated X protein have been used to inhibit BCL2-associated
X protein in rat neurons (Gillardon et al., J. Neurosci. Res.,
1996, 43, 726-734; Isenmann et al., Cell Death Differ., 1999, 6,
673-682; Tamatani et al., J. Neurochem., 1998, 71, 1588-1596;
Tamatani et al., Cell Death Differ., 1998, 5, 911-919) and R6
fibroblasts (Otter et al., J. Biol. Chem., 1998, 273,
6110-6120).
[0014] Antisense technology is emerging as an effective means for
reducing the expression of specific gene products and may therefore
prove to be uniquely useful in a number of therapeutic, diagnostic,
and research applications for the modulation of BCL2-associated X
protein gene expression and cellular processes.
[0015] The present invention provides compositions and methods for
modulating BCL2-associated X protein expression, including
modulation of splice variants of BCL2-associated X protein
including BAX-alpha, BAX-beta, BAX-gamma, BAX-delta, BAX-omega, and
BAX-epsilon.
SUMMARY OF THE INVENTION
[0016] The present invention is directed to compounds, particularly
antisense oligonucleotides, which are targeted to a nucleic acid
encoding BCL2-associated X protein, and which modulate the
expression of BCL2-associated X protein. Pharmaceutical and other
compositions comprising the compounds of the invention are also
provided. Further provided are methods of modulating the expression
of BCL2-associated X protein in cells or tissues comprising
contacting said cells or tissues with one or more of the antisense
compounds or compositions of the invention. Further provided are
methods of treating an animal, particularly a human, suspected of
having or being prone to a disease or condition associated with
expression of BCL2-associated X protein by administering a
therapeutically or prophylactically effective amount of one or more
of the antisense compounds or compositions of the invention.
DETAILED DESCRIPTION OF THE INVENTION
[0017] The present invention employs oligomeric compounds,
particularly antisense oligonucleotides, for use in modulating the
function of nucleic acid molecules encoding BCL2-associated X
protein, ultimately modulating the amount of BCL2-associated X
protein produced. This is accomplished by providing antisense
compounds which specifically hybridize with one or more nucleic
acids encoding BCL2-associated X protein. As used herein, the terms
"target nucleic acid" and "nucleic acid encoding BCL2-associated X
protein" encompass DNA encoding BCL2-associated X protein, RNA
(including pre-mRNA and mRNA) transcribed from such DNA, and also
cDNA derived from such RNA. The specific hybridization of an
oligomeric compound with its target nucleic acid interferes with
the normal function of the nucleic acid. This modulation of
function of a target nucleic acid by compounds which specifically
hybridize to it is generally referred to as "antisense". The
functions of DNA to be interfered with include replication and
transcription. The functions of RNA to be interfered with include
all vital functions such as, for example, translocation of the RNA
to the site of protein translation, translation of protein from the
RNA, splicing of the RNA to yield one or more mRNA species, and
catalytic activity which may be engaged in or facilitated by the
RNA. The overall effect of such interference with target nucleic
acid function is modulation of the expression of BCL2-associated X
protein. In the context of the present invention, "modulation"
means either an increase (stimulation) or a decrease (inhibition)
in the expression of a gene. In the context of the present
invention, inhibition is the preferred form of modulation of gene
expression and mRNA is a preferred target.
[0018] It is preferred to target specific nucleic acids for
antisense. "Targeting" an antisense compound to a particular
nucleic acid, in the context of this invention, is a multistep
process. The process usually begins with the identification of a
nucleic acid sequence whose function is to be modulated. This may
be, for example, a cellular gene (or mRNA transcribed from the
gene) whose expression is associated with a particular disorder or
disease state, or a nucleic acid molecule from an infectious agent.
In the present invention, the target is a nucleic acid molecule
encoding BCL2-associated X protein. The targeting process also
includes determination of a site or sites within this gene for the
antisense interaction to occur such that the desired effect, e.g.,
detection or modulation of expression of the protein, will result.
Within the context of the present invention, a preferred intragenic
site is the region encompassing the translation initiation or
termination codon of the open reading frame (ORF) of the gene.
Since, as is known in the art, the translation initiation codon is
typically 5'-AUG (in transcribed mRNA molecules; 5'-ATG in the
corresponding DNA molecule), the translation initiation codon is
also referred to as the "AUG codon," the "start codon" or the "AUG
start codon". A minority of genes have a translation initiation
codon having the RNA sequence 5'-GUG, 5'-UUG or 5'-CUG, and 5'-AUA,
5'-ACG and 5'-CUG have been shown to function in vivo. Thus, the
terms "translation initiation codon" and "start codon" can
encompass many codon sequences, even though the initiator amino
acid in each instance is typically methionine (in eukaryotes) or
formylmethionine (in prokaryotes). It is also known in the art that
eukaryotic and prokaryotic genes may have two or more alternative
start codons, any one of which may be preferentially utilized for
translation initiation in a particular cell type or tissue, or
under a particular set of conditions. In the context of the
invention, "start codon" and "translation initiation codon" refer
to the codon or codons that are used in vivo to initiate
translation of an mRNA molecule transcribed frog' a gene encoding
BCL2-associated X protein, regardless of the sequence(s) of such
codons.
[0019] It is also known in the art that a translation termination
codon (or "stop codon") of a gene may have one of three sequences,
i.e., 5'-UAA, 5'-UAG and 5'-UGA (the corresponding DNA sequences
are 5'-TAA, 5'-TAG and 5'-TGA, respectively). The terms "start
codon region" and "translation initiation codon region" refer to a
portion of such an mRNA or gene that encompasses from about 25 to
about 50 contiguous nucleotides in either direction (i.e., 5' or
3') from a translation initiation codon. Similarly, the terms "stop
codon region" and "translation termination codon region" refer to a
portion of such an mRNA or gene that encompasses from about 25 to
about 50 contiguous nucleotides in either direction (i.e., 5' or
3') from a translation termination codon.
[0020] The open reading frame (ORF) or "coding region," which is
known in the art to refer to the region between the translation
initiation codon and the translation termination codon, is also a
region which may be targeted effectively. Other target regions
include the 5' untranslated region (5'UTR), known in the art to
refer to the portion of an mRNA in the 5' direction from the
translation initiation codon, and thus including nucleotides
between the 5' cap site and the translation initiation codon of an
mRNA or corresponding nucleotides on the gene, and the 3'
untranslated region (3'UTR), known in the art to refer to the
portion of an mRNA in the 3' direction from the translation
termination codon, and thus including nucleotides between the
translation termination codon and 3' end of an mRNA or
corresponding nucleotides on the gene. The 5' cap of an mRNA
comprises an N7-methylated guanosine residue joined to the 5'-most
residue of the mRNA via a 5'-5' triphosphate linkage. The 5' cap
region of an mRNA is considered to include the 5' cap structure
itself as well as the first 50 nucleotides adjacent to the cap. The
5' cap region may also be a preferred target region.
[0021] Although some eukaryotic mRNA transcripts are directly
translated, many contain one or more regions, known as "introns,"
which are excised from a transcript before it is translated. The
remaining (and therefore translated) regions are known as "exons"
and are spliced together to form a continuous mRNA sequence. mRNA
splice sites, i.e., intron-exon junctions, may also be preferred
target regions, and are particularly useful in situations where
aberrant splicing is implicated in disease, or where an
overproduction of a particular mRNA splice product is implicated in
disease. Aberrant fusion junctions due to rearrangements or
deletions are also preferred targets. It has also been found that
introns can also be effective, and therefore preferred, target
regions for antisense compounds targeted, for example, to DNA or
pre-mRNA.
[0022] Once one or more target sites have been identified,
oligonucleotides are chosen which are sufficiently complementary to
the target, i.e., hybridize sufficiently well and with sufficient
specificity, to give the desired effect.
[0023] In the context of this invention, "hybridization" means
hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed
Hoogsteen hydrogen bonding, between complementary nucleoside or
nucleotide bases. For example, adenine and thymine are
complementary nucleobases which pair through the formation of
hydrogen bonds. "Complementary," as used herein, refers to the
capacity for precise pairing between two nucleotides. For example,
if a nucleotide at a certain position of an oligonucleotide is
capable of hydrogen bonding with a nucleotide at the same position
of a DNA or RNA molecule, then the oligonucleotide and the DNA or
RNA are considered to be complementary to each other at that
position. The oligonucleotide and the DNA or RNA are complementary
to each other when a sufficient number of corresponding positions
in each molecule are occupied by nucleotides which can hydrogen
bond with each other. Thus, "specifically hybridizable" and
"complementary" are terms which are used to indicate a sufficient
degree of complementarity or precise pairing such that stable and
specific binding occurs between the oligonucleotide and the DNA or
RNA target. It is understood in the art that the sequence of an
antisense compound need not be 100% complementary to that of its
target nucleic acid to be specifically hybridizable. An antisense
compound is specifically hybridizable when binding of the compound
to the target DNA or RNA molecule interferes with the normal
function of the target DNA or RNA to cause a loss of utility, and
there is a sufficient degree of complementarity to avoid
non-specific binding of the antisense compound to non-target
sequences under conditions in which specific binding is desired,
i.e., under physiological conditions in the case of in vivo assays
or therapeutic treatment, and in the case of in vitro assays, under
conditions in which the assays are performed.
[0024] Antisense and other compounds of the invention which
hybridize to the target and inhibit expression of the target are
identified through experimentation, and the sequences of these
compounds are hereinbelow identified as preferred embodiments of
the invention. The target sites to which these preferred sequences
are complementary are hereinbelow referred to as "active sites" and
are therefore preferred sites for targeting. Therefore another
embodiment of the invention encompasses compounds which hybridize
to these active sites.
[0025] Antisense compounds are commonly used as research reagents
and diagnostics. For example, antisense oligonucleotides, which are
able to inhibit gene expression with exquisite specificity, are
often used by those of ordinary skill to elucidate the function of
particular genes. Antisense compounds are also used, for example,
to distinguish between functions of various members of a biological
pathway. Antisense modulation has, therefore, been harnessed for
research use.
[0026] For use in kits and diagnostics, the antisense compounds of
the present invention, either alone or in combination with other
antisense compounds or therapeutics, can be used as tools in
differential and/or combinatorial analyses to elucidate expression
patterns of a portion or the entire complement of genes expressed
within cells and tissues.
[0027] Expression patterns within cells or tissues treated with one
or more antisense compounds are compared to control cells or
tissues not treated with antisense compounds and the patterns
produced are analyzed for differential levels of gene expression as
they pertain, for example, to disease association, signaling
pathway, cellular localization, expression level, size, structure
or function of the genes examined. These analyses can be performed
on stimulated or unstimulated cells and in the presence or absence
of other compounds which affect expression patterns.
[0028] Examples of methods of gene expression analysis known in the
art include DNA arrays or microarrays (Brazma and Vilo, FEBS Lett.,
2000, 480, 17-24; Celis, et al., FEBS Lett., 2000, 480, 2-16), SAGE
(serial analysis of gene expression) (Madden, et al., Drug Discov.
Today, 2000, 5, 415-425), READS (restriction enzyme amplification
of digested cDNAs) (Prashar and Weissman, Methods Enzymol., 1999,
303, 258-72), TOGA (total gene expression analysis) (Sutcliffe, et
al., Proc. Natl. Acad. Sci. U.S.A., 2000, 97, 1976-81), protein
arrays and proteomics (Celis, et al., FEBS Lett., 2000, 480, 2-16;
Jungblut, et al., Electrophoresis, 1999, 20, 2100-10), expressed
sequence tag (EST) sequencing (Celis, et al., FEBS Lett., 2000,
480, 2-16; Larsson, et al., J. Biotechnol., 2000, 80, 143-57),
subtractive RNA fingerprinting (SuRF) (Fuchs, et al., Anal.
Biochem., 2000, 286, 91-98; Larson, et al., Cytometry, 2000, 41,
203-208), subtractive cloning, differential display (DD) (Jurecic
and Belmont, Curr. Opin. Microbiol., 2000, 3, 316-21), comparative
genomic hybridization (Carulli, et al., J. Cell Biochem. Suppl.,
1998, 31, 286-96), FISH (fluorescent in situ hybridization)
techniques (Going and Gusterson, Eur. J. Cancer, 1999, 35,
1895-904) and mass spectrometry methods (reviewed in (To, Comb.
Chem. High Throughput Screen, 2000, 3, 235-41).
[0029] The specificity and sensitivity of antisense is also
harnessed by those of skill in the art for therapeutic uses.
Antisense oligonucleotides have been ,employed as therapeutic
moieties in the treatment of disease states in animals and man.
Antisense oligonucleotide drugs, including ribozymes, have been
safely and effectively administered to humans and numerous clinical
trials are presently underway. It is thus established that
oligonucleotides can be useful therapeutic modalities that can be
configured to be useful in treatment regimes for treatment of
cells, tissues and animals, especially humans.
[0030] In the context of this invention, the term "oligonucleotide"
refers to an oligomer or polymer of ribonucleic acid (RNA) or
deoxyribonucleic acid (DNA) or mimetics thereof. This term includes
oligonucleotides composed of naturally-occurring nucleobases,
sugars and covalent internucleoside (backbone) linkages as well as
oligonucleotides having non-naturally-occurring portions which
function similarly. Such modified or substituted oligonucleotides
are often preferred over native forms because of desirable
properties such as, for example, enhanced cellular uptake, enhanced
affinity for nucleic acid target and increased stability in the
presence of nucleases.
[0031] While antisense oligonucleotides are a preferred form of
antisense compound, the present invention comprehends other
oligomeric antisense compounds, including but not limited to
oligonucleotide mimetics such as are described below. The antisense
compounds in accordance with this invention preferably comprise
from about 8 to about 50 nucleobases (i.e. from about 8 to about 50
linked nucleosides). Particularly preferred antisense compounds are
antisense oligonucleotides, even more preferably those comprising
from about 12 to about 30 nucleobases. Antisense compounds include
ribozymes, external guide sequence (EGS) oligonucleotides
(oligozymes), and other short catalytic RNAs or catalytic
oligonucleotides which hybridize to the target nucleic acid and
modulate its expression.
[0032] As is known in the art, a nucleoside is a base-sugar
combination. The base portion of the nucleoside is normally a
heterocyclic base. The two most common classes of such heterocyclic
bases are the purines and the pyrimidines. Nucleotides are
nucleosides that further include a phosphate group covalently
linked to the sugar portion of the nucleoside. For those
nucleosides that include a pentofuranosyl sugar, the phosphate
group can be linked to either the 2', 3' or 5' hydroxyl moiety of
the sugar. In forming oligonucleotides, the phosphate groups
covalently link adjacent nucleosides to one another to form a
linear polymeric compound. In turn the respective ends of this
linear polymeric structure can be further joined to form a circular
structure, however, open linear structures are generally preferred.
Within the oligonucleotide structure, the phosphate groups are
commonly referred to as forming the internucleoside backbone of the
oligonucleotide. The normal linkage or backbone of RNA and DNA is a
3' to 5' phosphodiester linkage.
[0033] Specific examples of preferred antisense compounds useful in
this invention include oligonucleotides containing modified
backbones or non-natural internucleoside linkages. As defined in
this specification, oligonucleotides having modified backbones
include those that retain a phosphorus atom in the backbone and
those that do not have a phosphorus atom in the backbone. For the
purposes of this specification, and as sometimes referenced in the
art, modified oligonucleotides that do not have a phosphorus atom
in their internucleoside backbone can also be considered to be
oligonucleosides.
[0034] Preferred modified oligonucleotide backbones include, for
example, phosphorothioates, chiral phosphorothioates,
phosphoro-dithioates, phosphotriesters, aminoalkylphosphotriesters,
methyl and other alkyl phosphonates including 3'-alkylene
phosphonates, 5'-alkylene phosphonates and chiral phosphonates,
phosphinates, phosphoramidates including 3'-amino phosphoramidate
and aminoalkylphosphoramidates, thionophosphoramidates,
thionoalkyl-phosphonates, thionoalkylphosphotriesters,
selenophosphates and boranophosphates having normal 3'-5' linkages,
2'-5' linked analogs of these, and those having inverted polarity
wherein one or more internucleotide linkages is a 3' to 3', 5' to
5' or 2' to 2' linkage. Preferred oligonucleotides having inverted
polarity comprise a single 3' to 3' linkage at the 3'-most
internucleotide linkage i.e. a single inverted nucleoside residue
which may be abasic (the nucleobase is missing or has a hydroxyl
group in place thereof). Various salts, mixed salts and free acid
forms are also included.
[0035] Representative United States patents that teach the
preparation of the above phosphorus-containing linkages include,
but are not limited to, U.S. Pat. Nos. 3,687,808; 4,469,863;
4,476,301; 5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019;
5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496;
5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,306;
5,550,111; 5,563,253; 5,571,799; 5,587,361; 5,194,599; 5,565,555;
5,527,899; 5,721,218; 5,672,697 and 5,625,050, certain of which are
commonly owned with this application, and each of which is herein
incorporated by reference.
[0036] Preferred modified oligonucleotide backbones that do not
include a phosphorus atom therein have backbones that are formed by
short chain alkyl or cycloalkyl internucleoside linkages, mixed
heteroatom and alkyl or cycloalkyl internucleoside linkages, or one
or more short chain heteroatomic or heterocyclic internucleoside
linkages. These include those having morpholino linkages (formed in
part from the sugar portion of a nucleoside); siloxane backbones;
sulfide, sulfoxide and sulfone backbones; formacetyl and
thioformacetyl backbones; methylene formacetyl and thioformacetyl
backbones; riboacetyl backbones; alkene containing backbones;
sulfamate backbones; methyleneimino and methylenehydrazino
backbones; sulfonate and sulfonamide backbones; amide backbones;
and others having mixed N, O, S and CH.sub.2 component parts.
[0037] Representative United States patents that teach the
preparation of the above oligonucleosides include, but are not
limited to, U.S. Pat. Nos. 5,034,506; 5,166,315; 5,185,444;
5,214,134; 5,216,141; 5,235,033; 5,264,562; 5,264,564; 5,405,938;
5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225;
5,596,086; 5,602,240; 5,610,289; 5,602,240; 5,608,046; 5,610,289;
5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; 5,792,608;
5,646,269 and 5,677,439, certain of which are commonly owned with
this application, and each of which is herein incorporated by
reference.
[0038] In other preferred oligonucleotide mimetics, both the sugar
and the internucleoside linkage, i.e., the backbone, of the
nucleotide units are replaced with novel groups. The base units are
maintained for hybridization with an appropriate nucleic acid
target compound. One such oligomeric compound, an oligonucleotide
mimetic that has been shown to have excellent hybridization
properties, is referred to as a peptide nucleic acid (PNA). In PNA
compounds, the sugar-backbone of an oligonucleotide is replaced
with an amide containing backbone, in particular an
aminoethylglycine backbone. The nucleobases are retained and are
bound directly or indirectly to aza nitrogen atoms of the amide
portion of the backbone. Representative United States patents that
teach the preparation of PNA compounds include, but are not limited
to, U.S. Pat. Nos. 5,539,082; 5,714,331; and 5,719,262, each of
which is herein incorporated by reference. Further teaching of PNA
compounds can be found in Nielsen et al., Science, 1991, 254,
1497-1500.
[0039] Most preferred embodiments of the invention are
oligonucleotides with phosphorothioate backbones and
oligonucleotides with heteroatom backbones, and in particular
--CH.sub.2--NH--O--CH.sub.2--,
--CH.sub.2--N(CH.sub.3)--O--CH.sub.2-- [known as a methylene
(methylimino) or MMI backbone],
--CH.sub.2--O--N(CH.sub.3)--CH.sub.2--,
--CH.sub.2--N(CH.sub.3)--N(CH.sub.3)--CH.sub.2-- and --O--
N(CH.sub.3)--CH.sub.2--CH.sub.2-- [wherein the native
phosphodiester backbone is represented as --O--P--O--CH.sub.2--] of
the above referenced U.S. Pat. No. 5,489,677, and the amide
backbones of the above'referenced U.S. Pat. No. 5,602,240. Also
preferred are oligonucleotides having morpholino backbone
structures of the above-referenced U.S. Pat. No. 5,034,506.
[0040] Modified oligonucleotides may also contain one or more
substituted sugar moieties. Preferred oligonucleotides comprise one
of the following at the 2' position: OH; F; O--, S--, or N-alkyl;
O--, S--, or N-alkenyl; O--, S-- or N-alkynyl; or O-alkyl-O-alkyl,
wherein the alkyl, alkenyl and alkynyl may be substituted or
unsubstituted C.sub.1 to C.sub.10 alkyl or C.sub.2 to C.sub.10
alkenyl and alkynyl. Particularly preferred are
O[(CH.sub.2).sub.nO].sub.mCH.sub.3, O(CH.sub.2).sub.nOCH.sub.3,
O(CH.sub.2).sub.nNH.sub.2, O(CH.sub.2).sub.nCH.sub.3,
O(CH.sub.2).sub.nONH.sub.2, and
O(CH.sub.2).sub.nON[(CH.sub.2).sub.nCH.sub.3)].sub.2, where n and m
are from 1 to about 10. Other preferred oligonucleotides comprise
one of the following at the 2' position: C.sub.1 to C.sub.10 lower
alkyl, substituted lower alkyl, alkenyl, alkynyl, alkaryl, aralkyl,
O-alkaryl or O-aralkyl, SH, SCH.sub.3, OCN, Cl, Br, CN, CF.sub.3,
OCF.sub.3, SOCH.sub.3, SO.sub.2CH.sub.3, ONO.sub.2, NO.sub.2,
N.sub.3, NH.sub.2, heterocycloalkyl, heterocycloalkaryl,
aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving
group, a reporter group, an intercalator, a group for improving the
pharmacokinetic properties of an oligonucleotide, or a group for.
improving the pharmacodynamic properties of an oligonucleotide, and
other substituents having similar properties. A preferred
modification includes 2'-methoxyethoxy
(2'-O--CH.sub.2CH.sub.2OCH.sub.3, also known as
2'-O-(2-methoxyethyl) or 2'-MOE) (Martin et al., Helv. Chim. Acta,
1995, 78, 486-504) i.e., an alkoxyalkoxy group. A further preferred
modification includes 2'-dimethylaminooxyethoxy, i.e., a
O(CH.sub.2).sub.2ON(CH.sub.3).sub.2 group, also known as 2'-DMAOE,
as described in examples hereinbelow, and
2'-dimethylaminoethoxyethoxy (also known in the art as
2'-O-dimethylaminoethoxyethyl or 2'-DMAEOE), i.e.,
2'-O--CH.sub.2--O--CH.sub.2--N(CH.sub.2).sub.2, also described in
examples hereinbelow.
[0041] A further prefered modification includes Locked Nucleic
Acids (LNAs) in which the 2'-hydroxyl group is linked to the 3' or
4' carbon atom of the sugar ring thereby forming a bicyclic sugar
moiety. The linkage is preferably a methelyne (--CH.sub.2--).sub.n
group bridging the 2' oxygen atom and the 4' carbon atom wherein n
is 1 or 2. LNAs and preparation thereof are described in WO
98/39352 and WO 99/14226.
[0042] Other preferred modifications include 2'-methoxy
(2'-O--CH.sub.3), 2'-aminopropoxy
(2'-OCH.sub.2CH.sub.2CH.sub.2NH.sub.2), 2'-allyl
(2'-CH.sub.2--CH.dbd.CH.sub.2), 2'-O-allyl
(2'-O--CH.sub.2--CH.dbd.CH.sub.2) and 2'-fluoro (2'-F). The
2'-modification may be in the arabino (up) position or ribo (down)
position. A preferred 2'-arabino modification is 2'-F. Similar
modifications may also be made at other positions on the
oligonucleotide, particularly the 3' position of the sugar on the
3' terminal nucleotide or in 2'-5' linked oligonucleotides and the
5' position of 5' terminal nucleotide. Oligonucleotides may also
have sugar mimetics such as cyclobutyl moieties in place of the
pentofuranosyl sugar. Representative United States patents that
teach the preparation of such modified sugar structures include,
but are not limited to, U.S. Pat. Nos. 4,981,957; 5,118,800;
5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785;
5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300;
5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; 5,792,747;
and 5,700,920, certain of which are commonly owned with the instant
application, and each of which is herein incorporated by reference
in its entirety.
[0043] Oligonucleotides may also include nucleobase (often referred
to in the art simply as "base") modifications or substitutions. As
used herein, "unmodified" or "natural" nucleobases include the
purine bases adenine (A) and guanine (G), and the pyrimidine bases
thymine (T), cytosine (C) and uracil (U). Modified nucleobases
include other synthetic and natural nucleobases such as
5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine,
hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives
of adenine and guanine, 2-propyl and other alkyl derivatives of
adenine and guanine, 2-thiouracil, 2-thiothymine and
2-thiocytosine, 5-halouracil and cytosine, 5-propynyl
(--C.ident.C--CH.sub.3) uracil and cytosine and other alkynyl
derivatives of pyrimidine bases, 6-azo uracil, cytosine and
thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino,
8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines
and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and
other 5-substituted uracils and cyto-sines, 7-methylguanine and
7-methyladenine, 2-F-adenine, 2-amino-adenine, 8-azaguanine and
8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine
and 3-deazaadenine. Further modified nucleobases include tricyclic
pyrimidines such as phenoxazine
cytidine(1H-pyrimido[5,4-b][1,4]benzoxazin-2(3H)-one),
phenothiazine
cytidine(1H-pyrimido[5,4-b][1,4]benzothiazin-2(3H)-one), G-clamps
such as a substituted phenoxazine cytidine (e.g.
9-(2-aminoethoxy)-H-pyrimido[5,4-b][1,4]benzoxazin-2(3H)-one),
carbazole cytidine(2H-pyrimido[4,5-b]indol-2-one), pyridoindole
cytidine(H-pyrido[3',2':4,5]pyrrolo[2,3-d]pyrimidin-2-one).
Modified nucleobases may also include those in which the purine or
pyrimidine base is replaced with other heterocycles, for example
7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone.
Further nucleobases include those disclosed in U.S. Pat. No.
3,687,808, those disclosed in The Concise Encyclopedia Of Polymer
Science And Engineering, pages 858-859, Kroschwitz, J. I., ed. John
Wiley & Sons, 1990, those disclosed by Englisch et al.,
Angewandte Chemie, International Edition, 1991, 30, 613, and those
disclosed by Sanghvi, Y. S., Chapter 15, Antisense Research and
Applications, pages 289-302, Crooke, S. T. and Lebleu, B., ed., CRC
Press, 1993. Certain of these nucleobases are particularly useful
for increasing the binding affinity of the oligomeric compounds of
the invention. These include 5-substituted pyrimidines,
6-azapyrimidines and N-2, N-6 and O-6 substituted purines,
including 2-aminopropyladenine, 5-propynyluracil and
5-propynylcytosine. 5-methylcytosine substitutions have been shown
to increase nucleic acid duplex stability by 0.6-1.2.degree. C.
(Sanghvi, Y. S., Crooke, S. T. and Lebleu, B., eds., Antisense
Research and Applications, CRC Press, Boca Raton, 1993, pp.
276-278) and are presently preferred base substitutions, even more
particularly when combined with 2'-O-methoxyethyl sugar
modifications.
[0044] Representative United States patents that teach the
preparation of certain of the above noted modified nucleobases as
well as other modified nucleobases include, but are not limited to,
the above noted U.S. Pat. No. 3,687,808, as well as U.S. Pat. Nos.
4,845,205; 5,130,302; 5,134,066; 5,175,273; 5,367,066; 5,432,272;
5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540;
5,587,469; 5,594,121, 5,596,091; 5,614,617; 5,645,985; 5,830,653;
5,763,588; 6,005,096; and 5,681,941, certain of which are commonly
owned with the instant application, and each of which is herein
incorporated by reference, and U.S. Pat. No. 5,750,692, which is
commonly owned with the instant application and also herein
incorporated by reference.
[0045] Another modification of the oligonucleotides of the
invention involves chemically linking to the oligonucleotide one or
more moieties or conjugates which enhance the activity, cellular
distribution or cellular uptake of the oligonucleotide. The
compounds of the invention can include conjugate groups covalently
bound to functional groups such as primary or secondary hydroxyl
groups. Conjugate groups of the invention include intercalators,
reporter molecules, polyamines, polyamides, polyethylene glycols,
polyethers, groups that enhance the pharmacodynamic properties of
oligomers, and groups that enhance the pharmacokinetic properties
of oligomers. Typical conjugates groups include cholesterols,
lipids, phospholipids, biotin, phenazine, folate, phenanthridine,
anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and
dyes. Groups that enhance the pharmacodynamic properties, in the
context of this invention, include groups that improve oligomer
uptake, enhance oligomer resistance to degradation, and/or
strengthen sequence-specific hybridization with RNA. Groups that
enhance the pharmacokinetic properties, in the context of this
invention, include groups that improve oligomer uptake,
distribution, metabolism or excretion. Representative conjugate
groups are disclosed in International Patent Application
PCT/US92/09196, filed Oct. 23, 1992 the entire disclosure of which
is incorporated herein by reference. Conjugate moieties include but
are not limited to lipid moieties such as a cholesterol moiety
(Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86,
6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Let.,
1994, 4, 1053-1060), a thioether, e.g., hexyl-S-tritylthiol
(Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660, 306-309;
Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3, 2765-2770), a
thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20,
533-538), an aliphatic chain, e.g., dodecandiol or undecyl residues
(Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et
al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie,
1993, 75, 49-54), a phospholipid, e.g., di-hexadecyl-rac-glycerol
or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate
(Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et
al., Nucl. Acids Res., 1990, 18, 3777-3783), a polyamine or a
polyethylene glycol chain (Manoharan et al., Nucleosides &
Nucleotides, 1995, 14, 969-973), or adamantane acetic acid
(Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654), a
palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264,
229-237), or an octadecylamine or
hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J.
Pharmacol. Exp. Ther., 1996, 277, 923-937. Oligonucleotides of the
invention may also be conjugated to active drug substances, for
example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen,
fenbufen, ketoprofen, (S)-(+)-pranoprofen, carprofen,
dansylsarcosine, 2,3,5-triiodobenzoic acid, flufenamic acid,
folinic acid, a benzothiadiazide, chlorothiazide, a diazepine,
indomethicin, a barbiturate, a cephalosporin, a sulfa drug, an
antidiabetic, an antibacterial or an antibiotic.
Oligonucleotide-drug conjugates and their preparation are described
in U.S. patent application Ser. No. 09/334,130 (filed Jun. 15,
1999) which is incorporated herein by reference in its
entirety.
[0046] Representative United States patents that teach the
preparation of such oligonucleotide conjugates include, but are not
limited to, U.S. Pat. Nos. 4,828,979; 4,948,882; 5,218,105;
5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731;
5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077;
5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735;
4,667,025; 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335;
4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830;
5,112,963; 5,214,136; 5,245,022; 5,254,469; 5,258,506; 5,262,536;
5,272,250; 5,292,873; 5,317,098; 5,371,241, 5,391,723; 5,416,203,
5,451,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810;
5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923;
5,599,928 and 5,688,941, certain of which are commonly owned with
the instant application, and each of which is herein incorporated
by reference.
[0047] It is not necessary for all positions in a given compound to
be uniformly modified, and in fact more than one of the
aforementioned modifications may be incorporated in a single
compound or even at a single nucleoside within an oligonucleotide.
The present invention also includes antisense compounds which are
chimeric compounds. "Chimeric" antisense compounds or "chimeras,"
in the context of this invention, are antisense compounds,
particularly oligonucleotides, which contain two or more chemically
distinct regions, each made up of at least one monomer unit, i.e.,
a nucleotide in the case of an oligonucleotide compound. These
oligonucleotides typically contain at least one region wherein the
oligonucleotide is modified so as to confer upon the
oligonucleotide increased resistance to nuclease degradation,
increased cellular uptake, and/or increased binding affinity for
the target nucleic acid. An additional region of the
oligonucleotide may serve as a substrate for enzymes capable of
cleaving RNA:DNA or RNA:RNA hybrids. By way of example, RNase H is
a cellular endonuclease which cleaves the RNA strand of an RNA:DNA
duplex. Activation of RNase H, therefore, results in cleavage of
the RNA target, thereby greatly enhancing the efficiency of
oligonucleotide inhibition of gene expression. Consequently,
comparable results can often be obtained with shorter
oligonucleotides when chimeric oligonucleotides are used, compared
to phosphorothioate deoxyoligonucleotides hybridizing to the same
target region. Cleavage of the RNA target can be routinely detected
by gel electrophoresis and, if necessary, associated nucleic acid
hybridization techniques known in the art.
[0048] Chimeric antisense compounds of the invention may be formed
as composite structures of two or more oligonucleotides, modified
oligonucleotides, oligonucleosides and/or oligonucleotide mimetics
as described above. Such compounds have also been referred to in
the art as hybrids or gapmers. Representative United States patents
that teach the preparation of such hybrid structures include, but
are not limited to, U.S. Pat. Nos. 5,013,830; 5,149,797; 5,220,007;
5,256,775; 5,366,878; 5,403,711; 5,491,133; 5,565,350; 5,623,065;
5,652,355; 5,652,356; and 5,700,922, certain of which are commonly
owned with the instant application, and each of which is herein
incorporated by reference in its entirety.
[0049] The antisense compounds used in accordance with this
invention may be conveniently and routinely made through the
well-known technique of solid phase synthesis. Equipment for such
synthesis is sold by several vendors including, for example,
Applied Biosystems (Foster City, Calif.). Any other means for such
synthesis known in the art may additionally or alternatively be
employed. It is well known to use similar techniques to prepare
oligonucleotides such as the phosphorothioates and alkylated
derivatives.
[0050] The antisense compounds of the invention are synthesized in
vitro and do not include antisense compositions of biological
origin, or genetic vector constructs designed to direct the in vivo
synthesis of antisense molecules.
[0051] The compounds of the invention may also be admixed,
encapsulated, conjugated or otherwise associated with other
molecules, molecule structures or mixtures of compounds, as for
example, liposomes, receptor targeted molecules, oral, rectal,
topical or other formulations, for assisting in uptake,
distribution and/or absorption. Representative United States
patents that teach the preparation of such uptake, distribution
and/or absorption assisting formulations include, but are not
limited to, U.S. Pat. Nos. 5,108,921; 5,354,844; 5,416,016;
5,459,127; 5,521,291; 5,543,158; 5,547,932; 5,583,020; 5,591,721;
4,426,330; 4,534,899; 5,013,556; 5,108,921; 5,213,804; 5,227,170;
5,264,221; 5,356,633; 5,395,619; 5,416,016; 5,417,978; 5,462,854;
5,469,854; 5,512,295; 5,527,528; 5,534,259; 5,543,152; 5,556,948;
5,580,575; and 5,595,756, each of which is herein incorporated by
reference.
[0052] The antisense compounds of the invention encompass any
pharmaceutically acceptable salts, esters, or salts of such esters,
or any other compound which, upon administration to an animal
including a human, is capable of providing (directly or indirectly)
the biologically active metabolite or residue thereof. Accordingly,
for example, the disclosure is also drawn to prodrugs and
pharmaceutically acceptable salts of the compounds of the
invention, pharmaceutically acceptable salts of such prodrugs, and
other bioequivalents.
[0053] The term "prodrug" indicates a therapeutic agent that is
prepared in an inactive form that is converted to an active form
(i.e., drug) within the body or cells thereof by the action of
endogenous enzymes or other chemicals and/or conditions. In
particular, prodrug versions of the oligonucleotides of the
invention are prepared as SATE [(S-acetyl-2-thioethyl)phosphate]
derivatives according to the methods disclosed in WO 93/24510 to
Gosselin et al., published Dec. 9, 1993 or in WO 94/26764 and U.S.
Pat. No. 5,770,713 to Imbach et al.
[0054] The term "pharmaceutically acceptable salts" refers to
physiologically and pharmaceutically acceptable salts of the
compounds of the invention: i.e., salts that retain the desired
biological activity of the parent compound and do not impart
undesired toxicological effects thereto.
[0055] Pharmaceutically acceptable base addition salts are formed
with metals or amines, such as alkali and alkaline earth metals or
organic amines. Examples of metals used as cations are sodium,
potassium, magnesium, calcium, and the like. Examples of suitable
amines are N,N'-dibenzylethylenediamine, chloroprocaine, choline,
diethanolamine, dicyclohexylamine, ethylenediamine,
N-methylglucamine, and procaine (see, for example, Berge et al.,
"Pharmaceutical Salts," J. of Pharma Sci., 1977, 66, 1-19). The
base addition salts of said acidic compounds are prepared by
contacting the free acid form with a sufficient amount of the
desired base to produce the salt in the conventional manner. The
free acid form may be regenerated by contacting the salt form with
an acid and isolating the free acid in the conventional manner. The
free acid forms differ from their respective salt forms somewhat in
certain physical properties such as solubility in polar solvents,
but otherwise the salts are equivalent to their respective free
acid for purposes of the present invention. As used herein, a
"pharmaceutical addition salt" includes a pharmaceutically
acceptable salt of an acid form of one of the components of the
compositions of the invention. These include organic or inorganic
acid salts of the amines. Preferred acid salts are the
hydrochlorides, acetates, salicylates, nitrates and phosphates.
Other suitable pharmaceutically acceptable salts are well known to
those skilled in the art and include basic salts of a variety pf
inorganic and organic acids, such as, for example, with inorganic
acids, such as for example hydrochloric acid, hydrobromic acid,
sulfuric acid or phosphoric acid; with organic carboxylic,
sulfonic, sulfo or phospho acids or N-substituted sulfamic acids,
for example acetic acid, propionic acid, glycolic acid, succinic
acid, maleic acid, hydroxymaleic acid, methylmaleic acid, fumaric
acid, malic acid, tartaric acid, lactic acid, oxalic acid, gluconic
acid, glucaric acid, glucuronic acid, citric acid, benzoic acid,
cinnamic acid, mandelic acid, salicylic acid, 4-aminosalicylic
acid, 2-phenoxybenzoic acid, 2-acetoxybenzoic acid, embonic acid,
nicotinic acid or isonicotinic acid; and with amino acids, such as
the 20 alpha-amino acids involved in the synthesis of proteins in
nature, for example glutamic acid or aspartic acid, and also with
phenylacetic acid, methanesulfonic acid, ethanesulfonic acid,
2-hydroxyethanesulfonic acid, ethane-1,2-disulfonic acid,
benzenesulfonic acid, 4-methylbenzenesulfonic acid,
naphthalene-2-sulfonic acid, naphthalene-1,5-disulfonic acid, 2- or
3-phosphoglycerate, glucose-6-phosphate, N-cyclohexylsulfamic acid
(with the formation of cyclamates), or with other acid organic
compounds, such as ascorbic acid. Pharmaceutically acceptable salts
of compounds may also be prepared with a pharmaceutically
acceptable cation. Suitable pharmaceutically acceptable cations are
well known to those skilled in the art and include alkaline,
alkaline earth, ammonium and quaternary ammonium cations.
Carbonates or hydrogen carbonates are also possible.
[0056] For oligonucleotides, preferred examples of pharmaceutically
acceptable salts include but are not limited to (a) salts formed
with cations such as sodium, potassium, ammonium, magnesium,
calcium, polyamines such as spermine and spermidine, etc.; (b) acid
addition salts formed with inorganic acids, for example
hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric
acid, nitric acid and the like; (c) salts formed with organic acids
such as, for example, acetic acid, oxalic acid, tartaric acid,
succinic acid, maleic acid, fumaric acid, gluconic acid, citric
acid, malic acid, ascorbic acid, benzoic acid, tannic acid,
palmitic acid, alginic acid, polyglutamic acid, naphthalenesulfonic
acid, methanesulfonic acid, p-toluenesulfonic acid,
naphthalenedisulfonic acid, polygalacturonic acid, and the like;
and (d) salts formed from elemental anions such as chlorine,
bromine, and iodine.
[0057] The antisense compounds of the present invention can be
utilized for diagnostics, therapeutics, prophylaxis and as research
reagents and kits. For therapeutics, an animal, preferably a human,
suspected of having a disease or disorder which can be treated by
modulating the expression of BCL2-associated X protein is treated
by administering antisense compounds in accordance with this
invention. The compounds of the invention can be utilized in
pharmaceutical compositions by adding an effective amount of an
antisense compound to a suitable pharmaceutically acceptable
diluent or carrier. Use of the antisense compounds and methods of
the invention may also be useful prophylactically, e.g., to prevent
or delay infection, inflammation or tumor formation, for
example.
[0058] The antisense compounds of the invention are useful for
research and diagnostics, because these compounds hybridize to
nucleic acids encoding BCL2-associated X protein, enabling sandwich
and other assays to easily be constructed to exploit this fact.
Hybridization of the antisense oligonucleotides of the invention
with a nucleic acid encoding BCL2-associated X protein can be
detected by means known in the art. Such means may include
conjugation of an enzyme to the oligonucleotide, radiolabelling of
the oligonucleotide or any other suitable detection means. Kits
using such detection means for detecting the level of
BCL2-associated X protein in a sample may also be prepared.
[0059] The present invention also includes pharmaceutical
compositions and formulations which include the antisense compounds
of the invention. The pharmaceutical compositions of the present
invention may be administered in a number of ways depending upon
whether local or systemic treatment is desired and upon the area to
be treated. Administration may be topical (including ophthalmic and
to mucous membranes including vaginal and rectal delivery),
pulmonary, e.g., by inhalation or insufflation of powders or
aerosols, including by nebulizer; intratracheal, intranasal,
epidermal and transdermal), oral or parenteral. Parenteral
administration includes intravenous, intraarterial, subcutaneous,
intraperitoneal or intramuscular injection or infusion; or
intracranial, e.g., intrathecal or intraventricular,
administration. Oligonucleotides with at least one
2'-O-methoxyethyl modification are believed to be particularly
useful for oral administration.
[0060] Pharmaceutical compositions and formulations for topical
administration may include transdermal patches, ointments, lotions,
creams, gels, drop's, suppositories, sprays, liquids and powders.
Conventional pharmaceutical carriers, aqueous, powder or oily
bases, thickeners and the like may be necessary or desirable.
Coated condoms, gloves and the like may also be useful. Preferred
topical formulations include those in which the oligonucleotides of
the invention are in admixture with a topical delivery agent such
as lipids, liposomes, fatty acids, fatty acid esters, steroids,
chelating agents and surfactants. Preferred lipids and liposomes
include neutral (e.g. dioleoylphosphatidyl DOPE ethanolamine,
dimyristoylphosphatidyl choline DMPC, distearolyphosphatidyl
choline) negative (e.g. dimyristoylphosphatidyl glycerol DMPG) and
cationic (e.g. dioleoyltetramethylaminopropyl DOTAP and
dioleoylphosphatidyl ethanolamine DOTMA). Oligonucleotides of the
invention may be encapsulated within liposomes or may form
complexes thereto, in particular to cationic liposomes.
Alternatively, oligonucleotides may be complexed to lipids, in
particular to cationic lipids. Preferred fatty acids and esters
include but are not limited arachidonic acid, oleic acid,
eicosanoic acid, lauric acid, caprylic acid, capric acid, myristic
acid, palmitic acid, stearic acid, linoleic acid, linolenic acid,
dicaprate, tricaprate, monoolein, dilaurin, glyceryl 1-monocaprate,
1-dodecylazacycloheptan-2-one, an acylcarnitine, an acylcholine, or
a C.sub.1-10 alkyl ester (e.g. isopropylmyristate IPM),
monoglyceride, diglyceride or pharmaceutically acceptable salt
thereof. Topical formulations are described in detail in U.S.
patent application Ser. No. 09/315,298 filed on May 20, 1999 which
is incorporated herein by reference in its entirety.
[0061] Compositions and formulations for oral administration
include powders or granules, microparticulates, nanoparticulates,
suspensions or solutions in water or non-aqueous media, capsules,
gel capsules, sachets, tablets or minitablets. Thickeners,
flavoring agents, diluents, emulsifiers, dispersing aids or binders
may be desirable. Preferred oral formulations are those in which
oligonucleotides of the invention are administered in conjunction
with one or more penetration enhancers surfactants and chelators.
Preferred surfactants include fatty acids and/or esters or salts
thereof, bile acids and/or salts thereof. Prefered bile acids/salts
include chenodeoxycholic acid (CDCA) and ursodeoxychenodeoxycholic
acid (UDCA), cholic acid, dehydrocholic acid, deoxycholic acid,
glucholic acid, glycholic acid, glycodeoxycholic acid, taurocholic
acid, taurodeoxycholic acid, sodium tauro-24,25-dihydro-fusidate,
sodium glycodihydrofusidate,. Prefered fatty acids include
arachidonic acid, undecanoic acid, oleic acid, lauric acid,
caprylic acid, capric acid, myristic acid, palmitic acid, stearic
acid, linoleic acid, linolenic acid, dicaprate, tricaprate,
monoolein, dilaurin, glyceryl 1-monocaprate,
1-dodecylazacycloheptan-2-one, an acylcarnitine, an acylcholine, or
a monoglyceride, a diglyceride or a pharmaceutically acceptable
salt thereof (e.g. sodium). Also prefered are combinations of
penetration enhancers, for example, fatty acids/salts in
combination with bile acids/salts. A particularly prefered
combination is the sodium salt of lauric acid, capric acid and
UDCA. Further penetration enhancers include
polyoxyethylene-9-lauryl ether, polyoxyethylene-20-cetyl ether.
Oligonucleotides of the invention may be delivered orally in
granular form including sprayed dried particles, or complexed to
form micro or nanoparticles. Oligonucleotide complexing agents
include poly-amino acids; polyimines; polyacrylates;
polyalkylacrylates, polyoxethanes, polyalkylcyanoacrylates;
cationized gelatins, albumins, starches, acrylates,
polyethyleneglycols (PEG) and starches; polyalkylcyanoacrylates;
DEAE-derivatized polyimines, pollulans, celluloses and starches.
Particularly preferred complexing agents include chitosan,
N-trimethylchitosan, poly-L-lysine, polyhistidine, polyornithine,
polyspermines, protamine, polyvinylpyridine,
polythiodiethylamino-methylethylene P(TDAE), polyaminostyrene (e.g.
p-amino), poly(methylcyanoacrylate), poly(ethylcyanoacrylate),
poly(butylcyanoacrylate), poly(isobutylcyanoacrylate),
poly(isohexylcynaoacrylate), DEAE-methacrylate, DEAE-hexylacrylate,
DEAE-acrylamide, DEAE-albumin and DEAE-dextran, polymethylacrylate,
polyhexylacrylate, poly(D,L-lactic acid),
poly(DL-lactic-co-glycolic acid (PLGA), alginate, and
polyethyleneglycol (PEG). Oral formulations for oligonucleotides
and their preparation are described in detail in U.S. application
Ser. No. 08/886,829 (filed Jul. 1, 1997), Ser. No. 09/108,673
(filed Jul. 1, 1998), Ser. No. 09/256,515 (filed Feb. 23, 1999),
Ser. No. 09/082,624 (filed May 21, 1998) and Ser. No. 09/315,298
(filed May 20, 1999) each of which is incorporated herein by
reference in their entirety.
[0062] Compositions and formulations for parenteral, intrathecal or
intraventricular administration may include sterile aqueous
solutions which may also contain buffers, diluents and other
suitable additives such as, but not limited to, penetration
enhancers, carrier compounds and other pharmaceutically acceptable
carriers or excipients.
[0063] Pharmaceutical compositions of the present invention
include, but are not limited to, solutions, emulsions, and
liposome-containing formulations. These compositions may be
generated from a variety of components that include, but are not
limited to, preformed liquids, self-emulsifying solids and
self-emulsifying semisolids.
[0064] The pharmaceutical formulations of the present invention,
which may conveniently be presented in unit dosage form, may be
prepared according to conventional techniques well known in the
pharmaceutical industry. Such techniques include the step of
bringing into association the active ingredients with the
pharmaceutical carrier(s) or excipient(s). In general the
formulations are prepared by uniformly and intimately bringing into
association the active ingredients with liquid carriers or finely
divided solid carriers or both, and then, if necessary, shaping the
product.
[0065] The compositions of the present invention may be formulated
into any of many possible dosage forms such as, but not limited to,
tablets, capsules, gel capsules, liquid syrups, soft gels,
suppositories, and enemas. The compositions of the present
invention may also be formulated as suspensions in aqueous,
non-aqueous or mixed media. Aqueous suspensions may further contain
substances which increase the viscosity of the suspension
including, for example, sodium carboxymethylcellulose, sorbitol
and/or dextran. The suspension may also contain stabilizers.
[0066] In one embodiment of the present invention the
pharmaceutical compositions may be formulated and used as foams.
Pharmaceutical foams include formulations such as, but not limited
to, emulsions, microemulsions, creams, jellies and liposomes. While
basically similar in nature these formulations vary in the
components and the consistency of the final product. The
preparation of such compositions and formulations is generally
known to those skilled in the pharmaceutical and formulation arts
and may be applied to the formulation of the compositions of the
present invention.
Emulsions
[0067] The compositions of the present invention may be prepared
and formulated as emulsions. Emulsions are typically heterogenous
systems of one liquid dispersed in another in the form of droplets
usually exceeding 0.1 .mu.m in diameter. (Idson, in Pharmaceutical
Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel
Dekker, Inc., New York, N.Y., volume 1, p. 199; Rosoff, in
Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.),
1988, Marcel Dekker, Inc., New York, N.Y., Volume 1, p. 245; Block
in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker
(Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 2, p.
335; Higuchi et al., in Remington's Pharmaceutical Sciences, Mack
Publishing Co., Easton, Pa., 1985, p. 301). Emulsions are often
biphasic systems comprising of two immiscible liquid phases
intimately mixed and dispersed with each other. In general,
emulsions may be either water-in-oil (w/o) or of the oil-in-water
(o/w) variety. When an aqueous phase is finely divided into and
dispersed as minute droplets into a bulk oily phase the resulting
composition is called a water-in-oil (w/o) emulsion. Alternatively,
when an oily phase is finely divided into and dispersed as minute
droplets into a bulk aqueous phase the resulting composition is
called an oil-in-water (o/w) emulsion. Emulsions may contain
additional components in addition to the dispersed phases and the
active drug which may be present as a solution in either the
aqueous phase, oily phase or itself as a separate phase.
Pharmaceutical excipients such as emulsifiers, stabilizers, dyes,
and anti-oxidants may also be present in emulsions as needed.
Pharmaceutical emulsions may also be multiple emulsions that are
comprised of more than two phases such as, for example, in the case
of oil-in-water-in-oil (o/w/o) and water-in-oil-in-water (w/o/w)
emulsions. Such complex formulations often provide certain
advantages that simple binary emulsions do not. Multiple emulsions
in which individual oil droplets of an o/w emulsion enclose small
water droplets constitute a w/o/w emulsion. Likewise a system of
oil droplets enclosed in globules of water stabilized in an oily
continuous provides an o/w/o emulsion.
[0068] Emulsions are characterized by little or no thermodynamic
stability. Often, the dispersed or discontinuous phase of the
emulsion is well dispersed into the external or continuous phase
and maintained in this form through the means of emulsifiers or the
viscosity of the formulation. Either of the phases of the emulsion
may be a semisolid or a solid, as is the case of emulsion-style
ointment bases and creams. Other means of stabilizing emulsions
entail the use of emulsifiers that may be incorporated into either
phase of the emulsion. Emulsifiers may broadly be classified into
four categories: synthetic surfactants, naturally occurring
emulsifiers, absorption bases, and finely dispersed solids (Idson,
in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker
(Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p.
199).
[0069] Synthetic surfactants, also known as surface active agents,
have found wide applicability in the formulation of emulsions and
have been reviewed in the literature (Rieger, in Pharmaceutical
Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel
Dekker, Inc., New York, N.Y., volume 1, p. 285; Idson, in
Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.),
Marcel Dekker, Inc., New York, N.Y., 1988, volume 1, p. 199).
Surfactants are typically amphiphilic and comprise a hydrophilic
and a hydrophobic portion. The ratio of the hydrophilic to the
hydrophobic nature of the surfactant has been termed the
hydrophile/lipophile balance (HLB) and is a valuable tool in
categorizing and selecting surfactants in the preparation of
formulations. Surfactants may be classified into different classes
based on the nature of the hydrophilic group: nonionic, anionic,
cationic and amphoteric (Rieger, in Pharmaceutical Dosage Forms,
Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New
York, N.Y., volume 1, p. 285).
[0070] Naturally occurring emulsifiers used in emulsion
formulations include lanolin, beeswax, phosphatides, lecithin and
acacia. Absorption bases possess hydrophilic properties such that
they can soak up water to form w/o emulsions yet retain their
semisolid consistencies, such as anhydrous lanolin and hydrophilic
petrolatum. Finely divided solids have also been used as good
emulsifiers especially in combination with surfactants and in
viscous preparations. These include polar inorganic solids, such as
heavy metal hydroxides, nonswelling clays such as bentonite,
attapulgite, hectorite, kaolin, montmorillonite, colloidal aluminum
silicate and colloidal magnesium aluminum silicate, pigments and
nonpolar solids such as carbon or glyceryl tristearate.
[0071] A large variety of non-emulsifying materials are also
included in emulsion formulations and contribute to the properties
of emulsions. These include fats, oils, waxes, fatty acids, fatty
alcohols, fatty esters, humectants, hydrophilic colloids,
preservatives and antioxidants (Block, in Pharmaceutical Dosage
Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker,
Inc., New York, N.Y., volume 1, p. 335; Idson, in Pharmaceutical
Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel
Dekker, Inc., New York, N.Y., volume 1, p. 199).
[0072] Hydrophilic colloids or hydrocolloids include naturally
occurring gums and synthetic polymers such as polysaccharides (for
example, acacia, agar, alginic acid, carrageenan, guar gum, karaya
gum, and tragacanth), cellulose derivatives (for example,
carboxymethylcellulose and carboxypropylcellulose), and synthetic
polymers (for example, carbomers, cellulose ethers, and
carboxyvinyl polymers). These disperse or swell in water to form
colloidal solutions that stabilize emulsions by forming strong
interfacial films around the dispersed-phase droplets and by
increasing the viscosity of the external phase.
[0073] Since emulsions often contain a number of ingredients such
as carbohydrates, proteins, sterols and phosphatides that may
readily support the growth of microbes, these formulations often
incorporate preservatives. Commonly used preservatives included in
emulsion formulations include methyl paraben, propyl paraben,
quaternary ammonium salts, benzalkonium chloride, esters of
p-hydroxybenzoic acid, and boric acid. Antioxidants are also
commonly added to emulsion formulations to prevent deterioration of
the formulation. Antioxidants used may be free radical scavengers
such as tocopherols, alkyl gallates, butylated hydroxyanisole,
butylated hydroxytoluene, or reducing agents such as ascorbic acid
and sodium metabisulfite, and antioxidant synergists such as citric
acid, tartaric acid, and lecithin.
[0074] The application of emulsion formulations via dermatological,
oral and parenteral routes and methods for their manufacture have
been reviewed in the literature (Idson, in Pharmaceutical Dosage
Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker,
Inc., New York, N.Y., volume 1, p. 199). Emulsion formulations for
oral delivery have been very widely used because of reasons of ease
of formulation, efficacy from an absorption and bioavailability
standpoint. (Rosoff, in Pharmaceutical Dosage Forms, Lieberman,
Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York,
N.Y., volume 1, p. 245; Idson, in Pharmaceutical Dosage Forms,
Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New
York, N.Y., volume 1, p. 199). Mineral-oil base laxatives,
oil-soluble vitamins and high fat nutritive preparations are among
the materials that have commonly been administered orally as o/w
emulsions.
[0075] In one embodiment of the present invention, the compositions
of oligonucleotides and nucleic acids are formulated as
microemulsions. A microemulsion may be defined as a system of
water, oil and amphiphile which is a single optically isotropic and
thermodynamically stable liquid solution (Rosoff, in Pharmaceutical
Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel
Dekker, Inc., New York, N.Y., volume 1, p. 245). Typically
microemulsions are systems that are prepared by first dispersing an
oil in an aqueous surfactant solution and then adding a sufficient
amount of a fourth component, generally an intermediate
chain-length alcohol to form a transparent system. Therefore,
microemulsions have also been described as thermodynamically
stable, isotropically clear dispersions of two immiscible liquids
that are stabilized by interfacial films of surface-active
molecules (Leung and Shah, in: Controlled Release of Drugs:
Polymers and Aggregate Systems, Rosoff, M., Ed., 1989, VCH
Publishers, New York, pages 185-215). Microemulsions commonly are
prepared via a combination of three to five components that include
oil, water, surfactant, cosurfactant and electrolyte. Whether the
microemulsion is of the water-in-oil (w/o) or an oil-in-water (o/w)
type is dependent on the properties of the oil and surfactant used
and on the structure and geometric packing of the polar heads and
hydrocarbon tails of the surfactant molecules (Schott, in
Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton,
Pa., 1985, p. 271).
[0076] The phenomenological approach utilizing phase diagrams has
been extensively studied and has yielded a comprehensive knowledge,
to one skilled in the art, of how to formulate microemulsions
(Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and
Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1,
p. 245; Block, in Pharmaceutical Dosage Forms, Lieberman, Rieger
and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y.,
volume 1, p. 335). Compared to conventional emulsions,
microemulsions offer the advantage of solubilizing water-insoluble
drugs in a formulation of thermodynamically stable droplets that
are formed spontaneously.
[0077] Surfactants used in the preparation of microemulsions
include, but are not limited to, ionic surfactants, non-ionic
surfactants, Brij 96, polyoxyethylene oleyl ethers, polyglycerol
fatty acid esters, tetraglycerol monolaurate (ML310), tetraglycerol
monooleate (MO310), hexaglycerol monooleate (PO310), hexaglycerol
pentaoleate (PO500), decaglycerol monocaprate (MCA750),
decaglycerol monooleate (MO750), decaglycerol sequioleate (SO0750),
decaglycerol decaoleate (DAO750), alone or in combination with
cosurfactants. The cosurfactant, usually a short-chain alcohol such
as ethanol, 1-propanol, and 1-butanol, serves to increase the
interfacial fluidity by penetrating into the surfactant film and
consequently creating a disordered film because of the void space
generated among surfactant molecules. Microemulsions may, however,
be prepared without the, use of cosurfactants and alcohol-free
self-emulsifying microemulsion systems are known in the art. The
aqueous phase may typically be, but is not limited to, water, an
aqueous solution of the drug, glycerol, PEG300, PEG400,
polyglycerols, propylene glycols, and derivatives of ethylene
glycol. The oil phase may include, but is not limited to, materials
such as Captex 300, Captex 355, Capmul MCM, fatty acid esters,
medium chain (C8-C12) mono, di, and tri-glycerides,
polyoxyethylated glyceryl fatty acid esters, fatty alcohols,
polyglycolized glycerides, saturated polyglycolized C8-C10
glycerides, vegetable oils and silicone oil.
[0078] Microemulsions are particularly of interest from the
standpoint of drug solubilization and the enhanced absorption of
drugs. Lipid based microemulsions (both o/w and w/o) have been
proposed to enhance the oral bioavailability of drugs, including
peptides (Constantinides et al., Pharmaceutical Research, 1994, 11,
1385-1390; Ritschel, Meth. Find. Exp. Clin. Pharmacol., 1993, 13,
205). Microemulsions afford advantages of improved drug
solubilization, protection of drug from enzymatic hydrolysis,
possible enhancement of drug absorption due to surfactant-induced
alterations in membrane fluidity and permeability, ease of
preparation, ease of oral administration over solid dosage forms,
improved clinical potency, and decreased toxicity (Constantinides
et al., Pharmaceutical Research, 1994, 11, 1385; Ho et al., J.
Pharm. Sci., 1996, 85, 138-143). Often microemulsions may form
spontaneously when their components are brought together at ambient
temperature. This may be particularly advantageous when formulating
thermolabile drugs, peptides or oligonucleotides. Microemulsions
have also been effective in the transdermal delivery of active
components in both cosmetic and pharmaceutical applications. It is
expected that the microemulsion compositions and formulations of
the present invention will facilitate the increased systemic
absorption of oligonucleotides and nucleic acids from the
gastrointestinal tract, as well as improve the local cellular
uptake of oligonucleotides and nucleic acids within the
gastrointestinal tract, vagina, buccal cavity and other areas of
administration.
[0079] Microemulsions of the present invention may also contain
additional components and additives such as sorbitan monostearate
(Grill 3), Labrasol, and penetration enhancers to improve the
properties of the formulation and to enhance the absorption of the
oligonucleotides and nucleic acids of the present invention.
Penetration enhancers used in the microemulsions of the present
invention may be classified as belonging to one of five broad
categories--surfactants, fatty acids, bile salts, chelating agents,
and non-chelating non-surfactants (Lee et al., Critical Reviews in
Therapeutic Drug Carrier Systems, 1991, p. 92). Each of these
classes has been discussed above.
Liposomes
[0080] There are many organized surfactant structures besides
microemulsions that have been studied and used for the formulation
of drugs. These include monolayers, micelles, bilayers and
vesicles. Vesicles, such as liposomes, have attracted great
interest because of their specificity and the duration of action
they offer from the standpoint of drug delivery. As used in the
present invention, the term "liposome" means a vesicle composed of
amphiphilic lipids arranged in a spherical bilayer or bilayers.
[0081] Liposomes are unilamellar or multilamellar vesicles which
have a membrane formed from a lipophilic material and an aqueous
interior. The aqueous portion contains the composition to be
delivered. Cationic liposomes possess the advantage of being able
to fuse to the cell wall. Non-cationic liposomes, although not able
to fuse as efficiently with the cell wall, are taken up by
macrophages in vivo.
[0082] In order to cross intact mammalian skin, lipid vesicles must
pass through a series of fine pores, each with a diameter less than
50 nm, under the influence of a suitable transdermal gradient.
Therefore, it is desirable to use a liposome which is highly
deformable and able to pass through such fine pores.
[0083] Further advantages of liposomes include; liposomes obtained
from natural phospholipids are biocompatible and biodegradable;
liposomes can incorporate a wide range of water and lipid soluble
drugs; liposomes can protect encapsulated drugs in their internal
compartments from metabolism and degradation (Rosoff, in
Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.),
1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245).
Important considerations in the preparation of liposome
formulations are the lipid surface charge, vesicle size and the
aqueous volume of the liposomes.
[0084] Liposomes are useful for the transfer and delivery of active
ingredients to the site of action. Because the liposomal membrane
is structurally similar to biological membranes, when liposomes are
applied to a tissue, the liposomes start to merge with the cellular
membranes. As the merging of the liposome and cell progresses, the
liposomal contents are emptied into the cell where-the active agent
may act.
[0085] Liposomal formulations have been the focus of extensive
investigation as the mode of delivery for many drugs. There is
growing evidence that for topical administration, liposomes present
several advantages over other formulations. Such advantages include
reduced side-effects related to high systemic absorption of the
administered drug, increased accumulation of the administered drug
at the desired target, and the ability to administer a wide variety
of drugs, both hydrophilic and hydrophobic, into the skin.
[0086] Several reports have detailed the ability of liposomes to
deliver agents including high-molecular weight DNA into the skin.
Compounds including analgesics, antibodies, hormones and
high-molecular weight DNAs have been administered to the skin. The
majority of applications resulted in the targeting of the upper
epidermis.
[0087] Liposomes fall into two broad classes. Cationic liposomes
are positively charged liposomes which interact with the negatively
charged DNA molecules to form a stable complex. The positively
charged DNA/liposome complex binds to the negatively charged cell
surface and is internalized in an endosome. Due to the acidic pH
within the endosome, the liposomes are ruptured, releasing their
contents into the cell cytoplasm (Wang et al., Biochem. Biophys.
Res. Commun., 1987, 147, 980-985).
[0088] Liposomes which are pH-sensitive or negatively-charged,
entrap DNA rather than complex with it. Since both the DNA and the
lipid are similarly charged, repulsion rather than complex
formation occurs. Nevertheless, some DNA is entrapped within the
aqueous interior of these liposomes. pH-sensitive liposomes have
been used to deliver DNA encoding the thymidine kinase gene to cell
monolayers in culture. Expression of the exogenous gene was
detected in the target cells (Zhou et al., Journal of Controlled
Release, 1992, 19, 269-274).
[0089] One major type of liposomal composition includes
phospholipids other than naturally-derived phosphatidylcholine.
Neutral liposome compositions, for example, can be formed from
dimyristoyl phosphatidylcholine (DMPC) or dipalmitoyl
phosphatidylcholine (DPPC). Anionic liposome compositions generally
are formed from dimyristoyl phosphatidylglycerol, while anionic
fusogenic liposomes are formed primarily from dioleoyl
phosphatidylethanolamine (DOPE). Another type of liposomal
composition is formed from phosphatidylcholine (PC) such as, for
example, soybean PC, and egg PC. Another type is formed from
mixtures of phospholipid and/or phosphatidylcholine and/or
cholesterol.
[0090] Several studies have assessed the topical delivery of
liposomal drug formulations to the skin. Application of liposomes
containing interferon to guinea pig skin resulted in a reduction of
skin herpes sores while delivery of interferon via other means
(e.g. as a solution or as an emulsion) were ineffective (Weiner et
al., Journal of Drug Targeting, 1992, 2, 405-410). Further, an
additional study tested the efficacy of interferon administered as
part of a liposomal formulation to the administration of interferon
using an aqueous system, and concluded that the liposomal
formulation was superior to aqueous administration (du Plessis et
al., Antiviral Research, 1992, 18, 259-265).
[0091] Non-ionic liposomal systems have also been examined to
determine their utility in the delivery of drugs to the skin, in
particular systems comprising non-ionic surfactant and cholesterol.
Non-ionic liposomal formulations comprising Novasome.TM. I
(glyceryl dilaurate/cholesterol/polyoxyethylene-10-stearyl ether)
and Novasome.TM. II (glyceryl distearate/
cholesterol/polyoxyethylene-10-stearyl ether) were used to deliver
cyclosporin-A into the dermis of mouse skin. Results indicated that
such non-ionic liposomal systems were effective in facilitating the
deposition of cyclosporin-A into different layers of the skin (Hu
et al. S.T.P. Pharma. Sci., 1994, 4, 6, 466).
[0092] Liposomes also include "sterically stabilized" liposomes, a
term which, as used herein, refers to liposomes comprising one or
more specialized lipids that, when incorporated into liposomes,
result in enhanced circulation lifetimes relative to liposomes
lacking such specialized lipids. Examples of sterically stabilized
liposomes are those in which part of the vesicle-forming lipid
portion of the liposome (A) comprises one or more glycolipids, such
as monosialoganglioside G.sub.M1, or (B) is derivatized with one or
more hydrophilic polymers, such as a polyethylene glycol (PEG)
moiety. While not wishing to be bound by any particular theory, it
is thought in the art that, at least for sterically stabilized
liposomes containing gangliosides, sphingomyelin, or
PEG-derivatized lipids, the enhanced circulation half-life of these
sterically stabilized liposomes derives from a reduced uptake into
cells of the reticuloendothelial system (RES) (Allen et al., FEBS
Letters, 1987, 223, 42; Wu et al., Cancer Research, 1993, 53,
3765). Various liposomes comprising one or more glycolipids are
known in the art. Papahadjopoulos et al. (Ann. N.Y. Acad. Sci.,
1987, 507, 64) reported the ability of monosialoganglioside
G.sub.M1, galactocerebroside sulfate and phosphatidylinositol to
improve blood half-lives of liposomes. These findings were
expounded upon by Gabizon et al. (Proc. Natl. Acad. Sci. U.S.A.,
1988, 85, 6949). U.S. Pat. No. 4,837,028 and WO 88/04924, both to
Allen et al., disclose liposomes comprising (1) sphingomyelin and
(2) the ganglioside G.sub.M1 or a galactocerebroside sulfate ester.
U.S. Pat. No. 5,543,152 (Webb et al.) discloses liposomes
comprising sphingomyelin. Liposomes comprising
1,2-sn-dimyristoylphosphatidylcholine are disclosed in WO 97/13499
(Lim et al.).
[0093] Many liposomes comprising lipids derivatized with one or
more hydrophilic polymers, and methods of preparation thereof, are
known in the art. Sunamoto et al. (Bull. Chem. Soc. Jpn., 1980, 53,
2778) described liposomes comprising a nonionic detergent,
2C.sub.1215G, that contains a PEG moiety. Ilium et al. (FEBS Lett.,
1984, 167, 79) noted that hydrophilic coating of polystyrene
particles with polymeric glycols results in significantly enhanced
blood half-lives. Synthetic phospholipids modified by the
attachment of carboxylic groups of polyalkylene glycols (e.g., PEG)
are described by Sears (U.S. Pat. Nos. 4,426,330 and 4,534,899).
Klibanov et al. (FEBS Lett., 1990, 268, 235) described experiments
demonstrating that liposomes comprising phosphatidylethanolamine
(PE) derivatized with PEG or PEG stearate have significant
increases in blood circulation half-lives. Blume et al. (Biochimica
et Biophysica Acta, 1990, 1029, 91) extended such observations to
other PEG-derivatized phospholipids, e.g., DSPE-PEG, formed from
the combination of distearoylphosphatidylethanolamine (DSPE) and
PEG. Liposomes having covalently bound PEG moieties on their
external surface are described in European Patent No. EP 0 445 131
B1 and WO 90/04384 to Fisher. Liposome compositions containing 1-20
mole percent of PE derivatized with PEG, and'methods of use
thereof, are described by Woodle et al. (U.S. Pat. Nos. 5,013,556
and 5,356,633) and Martin et al. (U.S. Pat. No. 5,213,804 and
European Patent No. EP 0 496 813 B1). Liposomes comprising a number
of other lipid-polymer conjugates are disclosed in WO 91/05545 and
U.S. Pat. No. 5,225,212 (both to Martin et al.) and in WO 94/20073
(Zalipsky et al.) Liposomes comprising PEG-modified ceramide lipids
are described in WO 96/10391 (Choi et al.). U.S. Pat. No. 5,540,935
(Miyazaki et al.) and U.S. Pat. No. 5,556,948 (Tagawa et al.)
describe PEG-containing liposomes that can be further derivatized
with functional moieties on their surfaces.
[0094] A limited number of liposomes comprising nucleic acids are
known in the art. WO 96/40062 to Thierry et al. discloses methods
for encapsulating high molecular weight nucleic acids in liposomes.
U.S. Pat. No. 5,264,221 to Tagawa et al. discloses protein-bonded
liposomes and asserts that the contents of such liposomes may
include an antisense RNA. U.S. Pat. No. 5,665,710 to Rahman et al.
describes certain methods of encapsulating oligodeoxynucleotides in
liposomes. WO 97/04787 to Love et al. discloses liposomes
comprising antisense oligonucleotides targeted to the raf gene.
[0095] Transfersomes are yet another type of liposomes, and are
highly deformable lipid aggregates which are attractive candidates
for drug delivery vehicles. Transfersomes may be described as lipid
droplets which are so highly deformable that they are easily able
to penetrate through pores which are smaller than the droplet.
Transfersomes are adaptable to the environment in which they are
used, e.g. they are self-optimizing (adaptive to the shape of pores
in the skin), self-repairing, frequently reach their targets
without fragmenting, and often self-loading. To make transfersomes
it is possible to add surface edge-activators, usually surfactants,
to a standard liposomal composition. Transfersomes have been used
to deliver serum albumin to the skin. The transfersome-mediated
delivery of serum albumin has been shown to be as effective as
subcutaneous injection of a solution containing serum albumin.
[0096] Surfactants find wide application in formulations such as
emulsions (including microemulsions) and liposomes. The most common
way of classifying and ranking the properties of the many different
types of surfactants, both natural and synthetic, is by the use of
the hydrophile/lipophile balance (HLB). The nature of the
hydrophilic group (also known as the "head") provides the most
useful means for categorizing the different surfactants used in
formulations (Rieger, in Pharmaceutical Dosage Forms, Marcel
Dekker, Inc., New York, N.Y., 1988; p. 285).
[0097] If the surfactant molecule is not ionized, it is classified
as a nonionic surfactant. Nonionic surfactants find wide
application in pharmaceutical and cosmetic products and are usable
over a wide range of pH values. In general their HLB values range
from 2 to about 18 depending on their structure. Nonionic
surfactants include nonionic esters such as ethylene glycol esters,
propylene glycol esters, glyceryl esters, polyglyceryl esters,
sorbitan esters, sucrose esters, and ethoxylated esters. Nonionic
alkanolamides and ethers such as fatty alcohol ethoxylates,
propoxylated alcohols, and ethoxylated/propoxylated block polymers
are also included in this class. The polyoxyethylene surfactants
are the most popular members of the nonionic surfactant class.
[0098] If the surfactant molecule carries a negative charge when it
is dissolved or dispersed in water, the surfactant is classified as
anionic. Anionic surfactants include carboxylates such as soaps,
acyl lactylates, acyl amides of amino acids, esters of sulfuric
acid such as alkyl sulfates and ethoxylated alkyl sulfates,
sulfonates such as alkyl benzene sulfonates, acyl isethionates,
acyl taurates and sulfosuccinates, and phosphates. The most
important members of the anionic surfactant class are the alkyl
sulfates and the soaps.
[0099] If the surfactant molecule carries a positive charge when it
is dissolved or dispersed in water, the surfactant is classified as
cationic. Cationic surfactants include quaternary ammonium salts
and ethoxylated amines. The quaternary ammonium salts are the most
used members of this class.
[0100] If the surfactant molecule has the ability to carry either a
positive or negative charge, the surfactant is classified as
amphoteric. Amphoteric surfactants include acrylic acid
derivatives, substituted alkylamides, N-alkylbetaines and
phosphatides.
[0101] The use of surfactants in drug products, formulations and in
emulsions has been reviewed (Rieger, in Pharmaceutical Dosage
Forms, Marcel Dekker, Inc., New York, N.Y., 1988, p. 285).
Penetration Enhancers
[0102] In one embodiment, the present invention employs various
penetration enhancers to effect the efficient delivery of nucleic
acids, particularly oligonucleotides, to the skin of animals. Most
drugs are present in solution in both ionized and nonionized forms.
However, usually only lipid soluble or lipophilic drugs readily
cross cell membranes. It has been discovered that even
non-lipophilic drugs may cross cell membranes if the membrane to be
crossed is treated with a penetration enhancer. In addition to
aiding the diffusion of non-lipophilic drugs across cell membranes,
penetration enhancers also enhance the permeability of lipophilic
drugs.
[0103] Penetration enhancers may be classified as belonging to one
of five broad categories, i.e., surfactants, fatty acids, bile
salts, chelating agents, and non-chelating non-surfactants (Lee et
al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p.
92). Each of the above mentioned classes of penetration enhancers
are described below in greater detail.
[0104] Surfactants: In connection with the present invention,
surfactants (or "surface-active agents") are chemical entities
which, when dissolved in an aqueous solution, reduce the surface
tension of the solution or the interfacial tension between the
aqueous solution and another liquid, with the result that
absorption of oligonucleotides through the mucosa is enhanced. In
addition to bile salts and fatty acids, these penetration enhancers
include, for example, sodium lauryl sulfate,
polyoxyethylene-9-lauryl ether and polyoxyethylene-20-cetyl ether)
(Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems,
1991, p. 92); and perfluorochemical emulsions, such as FC-43.
Takahashi et al., J. Pharm. Pharmacol., 1988, 40, 252).
[0105] Fatty acids: Various fatty acids and their derivatives which
act as penetration enhancers include, for example, oleic acid,
lauric acid, capric acid (n-decanoic acid), myristic acid, palmitic
acid, stearic acid, linoleic acid, linolenic acid, dicaprate,
tricaprate, monoolein (1-monooleoyl-rac-glycerol), dilaurin,
caprylic acid, arachidonic acid, glycerol 1-monocaprate,
1-dodecylazacycloheptan-2-one, acylcarnitines, acylcholines,
C.sub.1-10 alkyl esters thereof (e.g., methyl, isopropyl and
t-butyl), and mono- and di-glycerides thereof (i.e., oleate,
laurate, caprate, myristate, palmitate, stearate, linoleate, etc.)
(Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems,
1991, p. 92; Muranishi, Critical Reviews in Therapeutic Drug
Carrier Systems, 1990, 7, 1-33; El Hariri et al., J. Pharm.
Pharmacol., 1992, 44, 651-654).
[0106] Bile salts: The physiological role of bile includes the
facilitation of dispersion and absorption of lipids and fat-soluble
vitamins (Brunton, Chapter 38 in: Goodman & Gilman's The
Pharmacological Basis of Therapeutics, 9th Ed., Hardman et al.
Eds., McGraw-Hill, New York, 1996, pp. 934-935). Various natural
bile salts, and their synthetic derivatives, act as penetration
enhancers. Thus the term "bile salts" includes any of the naturally
occurring components of bile as well as any of their synthetic
derivatives. The bile salts of the invention include, for example,
cholic acid (or its pharmaceutically acceptable sodium salt, sodium
cholate), dehydrocholic acid (sodium dehydrocholate), deoxycholic
acid (sodium deoxycholate), glucholic acid (sodium glucholate),
glycholic acid (sodium glycocholate), glycodeoxycholic acid (sodium
glycodeoxycholate), taurocholic acid (sodium taurocholate),
taurodeoxycholic acid (sodium taurodeoxycholate), chenodeoxycholic
acid (sodium chenodeoxycholate), ursodeoxycholic acid (UDCA),
sodium tauro-24,25-dihydro-fusidate (STDHF), sodium
glycodihydrofusidate and polyoxyethylene-9-lauryl ether (POE) (Lee
et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991,
page 92; Swinyard, Chapter 39 In: Remington's Pharmaceutical
Sciences, 18th Ed., Gennaro, ed., Mack Publishing Co., Easton, Pa.,
1990, pages 782-783; Muranishi, Critical Reviews in Therapeutic
Drug Carrier Systems, 1990, 7, 1-33; Yamamoto et al., J. Pharm.
Exp. Ther., 1992, 263, 25; Yamashita et al., J. Pharm. Sci., 1990,
79, 579-583).
[0107] Chelating Agents: Chelating agents, as used in connection
with the present invention, can be defined as compounds that remove
metallic ions from solution by forming complexes therewith, with
the result that absorption of oligonucleotides through the mucosa
is enhanced. With regards to their use as penetration enhancers in
the present invention, chelating agents have the added advantage of
also serving as DNase inhibitors, as most characterized DNA
nucleases require a divalent metal ion for catalysis and are thus
inhibited by chelating agents (Jarrett, J. Chromatogr., 1993, 618,
315-339). Chelating agents of the invention include but are not
limited to disodium ethylenediaminetetraacetate (EDTA), citric
acid, salicylates (e.g., sodium salicylate, 5-methoxysalicylate and
homovanilate), N-acyl derivatives of collagen, laureth-9 and
N-amino acyl derivatives of beta-diketones (enamines) (Lee et al.,
Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page
92; Muranishi, Critical Reviews in Therapeutic Drug Carrier
Systems, 1990, 7, 1-33; Buur et al., J. Control Rel., 1990, 14,
43-51).
[0108] Non-chelating non-surfactants: As used herein, non-chelating
non-surfactant penetration enhancing compounds can be defined as
compounds that demonstrate insignificant activity as chelating
agents or as surfactants but that nonetheless enhance absorption of
oligonucleotides through the alimentary mucosa (Muranishi, Critical
Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33). This
class of penetration enhancers include, for example, unsaturated
cyclic ureas, 1-alkyl- and 1-alkenylazacyclo-alkanone derivatives
(Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems,
1991, page 92); and non-steroidal anti-inflammatory agents such as
diclofenac sodium, indomethacin and phenylbutazone (Yamashita et
al., J. Pharm. Pharmacol., 1987, 39, 621-626).
[0109] Agents that enhance uptake of oligonucleotides at the
cellular level may also be added to the pharmaceutical and other
compositions of the present invention. For example, cationic
lipids, such as lipofectin (Junichi et al, U.S. Pat. No.
5,705,188), cationic glycerol derivatives, and polycationic
molecules, such as polylysine (Lollo et al., PCT Application WO
97/30731), are also known to enhance the cellular uptake of
oligonucleotides.
[0110] Other agents may be utilized to enhance the penetration of
the administered nucleic acids, including glycols such as ethylene
glycol and propylene glycol, pyrrols such as 2-pyrrol, azones, and
terpenes such as limonene and menthone.
Carriers
[0111] Certain compositions of the present invention also
incorporate carrier compounds in the formulation. As used herein,
"carrier compound" or "carrier" can refer to a nucleic acid, or
analog thereof, which is inert (i.e., does not possess biological
activity per se) but is recognized as a nucleic acid by in vivo
processes that reduce the bioavailability of a nucleic acid having
biological activity by, for example, degrading the biologically
active nucleic acid or promoting its removal from circulation. The
coadministration of a nucleic acid and a carrier compound,
typically with an excess of the latter substance, can result in a
substantial reduction of the amount of nucleic acid recovered in
the liver, kidney or other extracirculatory reservoirs, presumably
due to competition between the carrier compound and the nucleic
acid for a common receptor. For example, the recovery of a
partially phosphorothioate oligonucleotide in hepatic tissue can be
reduced when it is coadministered with polyinosinic acid, dextran
sulfate, polycytidic acid or
4-acetamido-4'isothiocyano-stilbene-2,2'-disulfonic acid (Miyao et
al., Antisense Res. Dev., 1995, 5, 115-121; Takakura et al.,
Antisense & Nucl. Acid Drug Dev., 1996, 6, 177-183).
Excipients
[0112] In contrast to a carrier compound, a "pharmaceutical
carrier" or "excipient" is a pharmaceutically acceptable solvent,
suspending agent or any other pharmacologically inert vehicle for
delivering one or more nucleic acids to an animal. The excipient
may be liquid or solid and is selected, with the planned manner of
administration in mind, so as to provide for the desired bulk,
consistency, etc., when combined with a nucleic acid and the other
components of a given pharmaceutical composition. Typical
pharmaceutical carriers include, but are not limited to, binding
agents (e.g., pregelatinized maize starch, polyvinylpyrrolidone or
hydroxypropyl methylcellulose, etc.); fillers (e.g., lactose and
other sugars, microcrystalline cellulose, pectin, gelatin, calcium
sulfate, ethyl cellulose, polyacrylates or calcium hydrogen
phosphate, etc.); lubricants (e.g., magnesium stearate, talc,
silica, colloidal silicon dioxide, stearic acid, metallic
stearates, hydrogenated vegetable oils, corn starch, polyethylene
glycols, sodium benzoate, sodium acetate, etc.); disintegrants
(e.g., starch, sodium starch glycolate, etc.); and wetting agents
(e.g., sodium lauryl sulphate, etc.).
[0113] Pharmaceutically acceptable organic or inorganic excipient
suitable for non-parenteral administration which do not
deleteriously react with nucleic acids can also be used to
formulate the compositions of the present invention. Suitable
pharmaceutically acceptable carriers include, but are not limited
to, water, salt solutions, alcohols, polyethylene glycols, gelatin,
lactose, amylose, magnesium stearate, talc, silicic acid, viscous
paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the
like.
[0114] Formulations for topical administration of nucleic acids may
include sterile and non-sterile aqueous solutions, non-aqueous
solutions in common solvents such as alcohols, or solutions of the
nucleic acids in liquid or solid oil bases. The solutions may also
contain buffers, diluents and other suitable additives.
Pharmaceutically acceptable organic or inorganic excipients
suitable for non-parenteral administration which do not
deleteriously react with nucleic acids can be used.
[0115] Suitable pharmaceutically acceptable excipients include, but
are not limited to, water, salt solutions, alcohol, polyethylene
glycols, gelatin, lactose, amylose, magnesium stearate, talc,
silicic acid, viscous paraffin, hydroxymethylcellulose,
polyvinylpyrrolidone and the like.
Other Components
[0116] The compositions of the present invention may additionally
contain other adjunct components conventionally found in
pharmaceutical compositions, at their art-established usage levels.
Thus, for example, the compositions may contain additional,
compatible, pharmaceutically-active materials such as, for example,
antipruritics, astringents, local anesthetics or anti-inflammatory
agents, or may contain additional materials useful in physically
formulating various dosage forms of the compositions of the present
invention, such as dyes, flavoring agents, preservatives,
antioxidants, opacifiers, thickening agents and stabilizers.
However, such materials, when added, should not unduly interfere
with the biological activities of the components of the
compositions of the present invention. The formulations can be
sterilized and, if desired, mixed with auxiliary agents, e.g.,
lubricants, preservatives, stabilizers, wetting agents,
emulsifiers, salts for influencing osmotic pressure, buffers,
colorings, flavorings and/or aromatic substances and the like which
do not deleteriously interact with the nucleic acid(s) of the
formulation.
[0117] Aqueous suspensions may contain substances which increase
the viscosity of the suspension including, for example, sodium
carboxymethylcellulose, sorbitol and/or dextran. The suspension may
also contain stabilizers.
[0118] Certain embodiments of the invention provide pharmaceutical
compositions containing (a) one or more antisense compounds and (b)
one or more other chemotherapeutic agents which function by a
non-antisense mechanism. Examples of such chemotherapeutic agents
include but are not limited to daunorubicin, daunomycin,
dactinomycin, doxorubicin, epirubicin, idarubicin, esorubicin,
bleomycin, mafosfamide, ifosfamide, cytosine arabinoside,
bis-chloroethylnitrosurea, busulfan, mitomycin C, actinomycin D,
mithramycin, prednisone, hydroxyprogesterone, testosterone,
tamoxifen, dacarbazine, procarbazine, hexamethylmelamine,
pentamethylmelamine, mitoxantrone, amsacrine, chlorambucil,
methylcyclohexylnitrosurea, nitrogen mustards, melphalan,
cyclophosphamide, 6-mercaptopurine, 6-thioguanine, cytarabine,
5-azacytidine, hydroxyurea, deoxycoformycin,
4-hydroxyperoxycyclophosphoramide, 5-fluorouracil (5-FU),
5-fluorodeoxyuridine (5-FUdR), methotrexate (MTX), colchicine,
taxol, vincristine, vinblastine, etoposide (VP-16), trimetrexate,
irinotecan, topotecan, gemcitabine, teniposide, cisplatin and,
diethylstilbestrol (DES). See, generally, The Merck Manual of
Diagnosis and Therapy, 15th Ed. 1987, pp. 1206-1228, Berkow et al.,
eds., Rahway, N.J. When used with the compounds of the invention,
such chemotherapeutic agents may be used individually (e.g., 5-FU
and oligonucleotide), sequentially (e.g., 5-FU and oligonucleotide
for a period of time followed by MTX and oligonucleotide), or in
combination with one or more other such chemotherapeutic agents
(e.g., 5-FU, MTX and oligonucleotide, or 5-FU, radiotherapy and
oligonucleotide). Anti-inflammatory drugs, including but not
limited to nonsteroidal anti-inflammatory drugs and
corticosteroids, and antiviral drugs, including but not limited to
ribivirin, vidarabine, acyclovir and ganciclovir, may also be
combined in compositions of the invention. See, generally, The
Merck Manual of Diagnosis and Therapy, 15th Ed., Berkow et al.,
eds., 1987, Rahway, N.J., pages 2499-2506 and 46-49, respectively).
Other non-antisense chemotherapeutic agents are also within the
scope of this invention. Two or more combined compounds may be used
together or sequentially.
[0119] In another related embodiment, compositions of the invention
may contain one or more antisense compounds, particularly
oligonucleotides, targeted to a first nucleic acid and one or more
additional antisense compounds targeted to a second nucleic acid
target. Numerous examples of antisense compounds are known in the
art. Two or more combined compounds may be used together or
sequentially.
[0120] The formulation of therapeutic compositions and their
subsequent administration is believed to be within the skill of
those in the art. Dosing is dependent on severity and
responsiveness of the disease state to be treated, with the course
of treatment lasting from several days to several months, or until
a cure is effected or a diminution of the disease state is
achieved. Optimal dosing schedules can be calculated from
measurements of drug accumulation in the body of the patient.
Persons of ordinary skill can easily determine optimum dosages,
dosing methodologies and repetition rates. Optimum dosages may vary
depending on the relative potency of individual oligonucleotides,
and can generally be estimated based on EC.sub.50s found to be
effective in in vitro and in vivo animal models. In general, dosage
is from 0.01 ug to 100 g per kg of body weight, and may be given
once or more daily, weekly, monthly or yearly, or even once every 2
to 20 years. Persons of ordinary skill in the art can easily
estimate repetition rates for dosing based on measured residence
times and concentrations of the drug in bodily fluids or tissues.
Following successful treatment, it may be desirable to have the
patient undergo maintenance therapy to prevent the recurrence of
the disease state, wherein the oligonucleotide is administered in
maintenance doses, ranging from 0.01 ug to 100 g per kg of body
weight, once or more daily, to once every 20 years.
[0121] While the present invention has been described with
specificity in accordance with certain of its preferred
embodiments, the following examples serve only to illustrate the
invention and are not intended to limit the same.
EXAMPLES
Example 1
Nucleoside Phosphoramidites for Oligonucleotide Synthesis Deoxy and
2'-alkoxy amidites
[0122] 2'-Deoxy and 2'-methoxy beta-cyanoethyldiisopropyl
phosphor-amidites were purchased from commercial sources (e.g.
Chemgenes, Needham Mass. or Glen Research, Inc. Sterling Va.).
Other 2'-O-alkoxy substituted nucleoside amidites are prepared as
described in U.S. Pat. No. 5,506,351, herein incorporated by
reference. For oligonucleotides synthesized using 2'-alkoxy
amidites, the standard cycle for unmodified oligonucleotides was
utilized, except the wait step after pulse delivery of tetrazole
and base was increased to 360 seconds.
[0123] Oligonucleotides containing 5-methyl-2'-deoxycytidine
(5-Me-C) nucleotides were synthesized according to published
methods [Sanghvi, et. al., Nucleic Acids Research, 1993, 21,
3197-3203] using commercially available phosphoramidites (Glen
Research, Sterling Va. or ChemGenes, Needham Mass.).
2'-Fluoro amidites
2'-Fluorodeoxyadenosine amidites
[0124] 2'-fluoro oligonucleotides were synthesized as described
previously [Kawasaki, et. al., J. Med. Chem., 1993, 36, 831-841]
and U.S. Pat. No. 5,670,633, herein incorporated by reference.
Briefly, the protected nucleoside
N6-benzoyl-2'-deoxy-2'-fluoroadenosine was synthesized utilizing
commercially available 9-beta-D-arabinofuranosyladenine as starting
material and by modifying literature procedures whereby the
2'-alpha-fluoro atom is introduced by a S.sub.N2-displacement of a
2'-beta-trityl group. Thus
N6-benzoyl-9-beta-D-arabinofuranosyladenine was selectively
protected in moderate yield as the 3',5'-ditetrahydropyranyl (THP)
intermediate. Deprotection of the THP and N6-benzoyl groups was
accomplished using standard methodologies and standard methods were
used to obtain the 5'-dimethoxytrityl-(DMT) and
5'-DMT-3'-phosphoramidite intermediates.
2'-Fluorodeoxyguanosine
[0125] The synthesis of 2'-deoxy-2'-fluoroguanosine was
accomplished using tetraisopropyldisiloxanyl (TPDS) protected
9-beta-D-arabinofuranosylguanine as starting material, and
conversion to the intermediate
diisobutyrylarabinofuranosylguanosine. Deprotection of the TPDS
group was followed by protection of the hydroxyl group with THP to
give diisobutyryl di-THP protected arabinofuranosylguanine.
Selective O-deacylation and triflation was followed by treatment of
the crude product with fluoride, then deprotection of the THP
groups. Standard methodologies were used to obtain the 5'-DMT- and
5'-DMT-3'-phosphoramidites.
2'-Fluorouridine
[0126] Synthesis of 2'-deoxy-2'-fluorouridine was accomplished by
the modification of a literature procedure in which
2,2'-anhydro-1-beta-D-arabinofuranosyluracil was treated with 70%
hydrogen fluoride-pyridine. Standard procedures were used to obtain
the 5'-DMT and 5'-DMT-3'phosphoramidites.
2'-Fluorodeoxycytidine
[0127] 2'-deoxy-2'-fluorocytidine was synthesized via amination of
2'-deoxy-2'-fluorouridine, followed by selective protection to give
N4-benzoyl-2'-deoxy-2'-fluorocytidine. Standard procedures were
used to obtain the 5'-DMT and 5'-DMT-3'phosphoramidites.
2'-O-(2-Methoxyethyl) modified amidites
[0128] 2'-O-Methoxyethyl-substituted nucleoside amidites are
prepared as follows, or alternatively, as per the methods of
Martin, P., Helvetica Chimica Acta, 1995, 78, 486-504.
2,2'-Anhydro[1-(beta-D-arabinofuranosyl)-5-methyluridine]
[0129] 5-Methyluridine (ribosylthymine, commercially available
through Yamasa, Choshi, Japan) (72.0 g, 0.279 M), diphenylcarbonate
(90.0 g, 0.420 M) and sodium bicarbonate (2.0 g, 0.024 M) were
added to DMF (300 mL). The mixture was heated to reflux, with
stirring, allowing the evolved carbon dioxide gas to be released in
a controlled manner. After 1 hour, the slightly darkened solution
was concentrated under reduced pressure. The resulting syrup was
poured into diethylether (2.5 L), with stirring. The product formed
a gum. The ether was decanted and the residue was dissolved in a
minimum amount of methanol (ca. 400 mL). The solution was poured
into fresh ether (2.5 L) to yield a stiff gum. The ether was
decanted and the gum was dried in a vacuum oven (60.degree. C. at 1
mm Hg for 24 h) to give a solid that was crushed to a light tan
powder (57 g, 85% crude yield). The NMR spectrum was consistent
with the structure, contaminated with phenol as its sodium salt
(ca. 5%). The material was used as is for further reactions (or it
can be purified further by column chromatography using a gradient
of methanol in ethyl acetate (10-25%) to give a white solid, mp
222-4.degree. C.).
2'-O-Methoxyethyl-5-methyluridine
[0130] 2,2'-Anhydro-5-methyluridine (195 g, 0.81 M),
tris(2-methoxyethyl)borate (231 g, 0.98 M) and 2-methoxyethanol
(1.2 L) were added to a 2 L stainless steel pressure vessel and
placed in a pre-heated oil bath at 160.degree. C. After heating for
48 hours at 155-160.degree. C., the vessel was opened and the
solution evaporated to dryness and triturated with NeOH (200 mL).
The residue was suspended in hot acetone (1 L). The insoluble salts
were filtered, washed with acetone (150 mL) and the filtrate
evaporated. The residue (280 g) was dissolved in CH.sub.3CN (600
mL) and evaporated. A silica gel column (3 kg) was packed in
CH.sub.2Cl.sub.2/acetone/MeOH (20:5:3) containing 0.5% Et.sub.3NH.
The residue was dissolved in CH.sub.2Cl.sub.2 (250 mL) and adsorbed
onto silica (150 g) prior to loading onto the column. The product
was eluted with the packing solvent to give 160 g (63%) of product.
Additional material was obtained by reworking impure fractions.
2'-O-Methoxyethyl-5'-O-dimethoxytrityl-5-methyluridine
[0131] 2'-O-Methoxyethyl-5-methyluridine (160 g, 0.506 M) was
co-evaporated with pyridine (250 mL) and the dried residue
dissolved in pyridine (1.3 L). A first aliquot of dimethoxytrityl
chloride (94.3 g, 0.278 M) was added and the mixture stirred at
room temperature for one hour. A second aliquot of dimethoxytrityl
chloride (94.3 g, 0.278 M) was added and the reaction stirred for
an additional one hour. Methanol (170 mL) was then added to stop
the reaction. HPLC showed the presence of approximately 70%
product. The solvent was evaporated and triturated with CH.sub.3CN
(200 mL). The residue was dissolved in CHCl.sub.3 (1.5 L) and
extracted with 2.times.500 mL of saturated NaHCO.sub.3 and
2.times.500 mL of saturated NaCl. The organic phase was dried over
Na.sub.2SO.sub.4, filtered and evaporated. 275 g of residue was
obtained. The residue was purified on a 3.5 kg silica gel column,
packed and eluted with EtOAc/hexane/acetone (5:5:1) containing 0.5%
Et.sub.3NH. The pure fractions were evaporated to give 164 g of
product. Approximately 20 g additional was obtained from the impure
fractions to give a total yield of 183 g (57%).
3'-O-Acetyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methyl-uridine
[0132] 2'-O-Methoxyethyl-5'-O-dimethoxytrityl-5-methyluridine (106
g, 0.167 M), DMF/pyridine (750 mL of a 3:1 mixture prepared from
562 mL of DMF and 188 mL of pyridine) and acetic anhydride (24.38
mL, 0.258 M) were combined and stirred at room temperature for 24
hours. The reaction was monitored by TLC by first quenching the TLC
sample with the addition of NeOH. Upon completion of the reaction,
as judged by TLC, MeOH (50 mL) was added and the mixture evaporated
at 35.degree. C. The residue was dissolved in CHCl.sub.3 (800 mL)
and extracted with 2.times.200 mL of saturated sodium bicarbonate
and 2.times.200 mL of saturated NaCl. The water layers were back
extracted with 200 mL of CHCl.sub.3. The combined organics were
dried with sodium sulfate and evaporated to give 122 g of residue
(approx. 90% product). The residue was purified on a 3.5 kg silica
gel column and eluted using EtOAc/hexane(4:1). Pure product
fractions were evaporated to yield 96 g (84%). An additional 1.5 g
was recovered from later fractions.
3'-O-Acetyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methyl-4-triazoleurid-
ine
[0133] A first solution was prepared by dissolving
3'-O-acetyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methyluridine
(96 g, 0.144 M) in CH.sub.3CN (700 mL) and set aside. Triethylamine
(189 mL, 1.44 M) was added to a solution of triazole (90 g, 1.3 M)
in CH.sub.3CN (1 L), cooled to -5.degree. C. and stirred for 0.5 h
using an overhead stirrer. POCl.sub.3 was added dropwise, over a 30
minute period, to the stirred solution maintained at 0-10.degree.
C., and the resulting mixture stirred for an additional 2 hours.
The first solution was added dropwise, over a 45 minute period, to
the latter solution. The resulting reaction mixture was stored
overnight in a cold room. Salts were filtered from the reaction
mixture and the solution was evaporated. The residue was dissolved
in EtOAc (1 L) and the insoluble solids were removed by filtration.
The filtrate was washed with 1.times.300 mL of NaHCO.sub.3 and
2.times.300 mL of saturated NaCl, dried over sodium sulfate and
evaporated. The residue was triturated with EtOAc to give the title
compound.
2'-O-Methoxyethyl-5'-O-dimethoxytrityl-5-methylcytidine
[0134] A solution of
3'-O-acetyl-2'-O-methoxyethyl-5'-O-dimethoxy-trityl-5-methyl-4-triazoleur-
idine (103 g, 0.141 M) in dioxane (500 mL) and NH.sub.4OH (30 mL)
was stirred at room temperature for 2 hours. The dioxane solution
was evaporated and the residue azeotroped with MeOH (2.times.200
mL). The residue was dissolved in MeOH (300 mL) and transferred to
a 2 liter stainless steel pressure vessel. MeOH (400 mL) saturated
with NH.sub.3 gas was added and the vessel heated to 100.degree. C.
for 2 hours (TLC showed complete conversion). The vessel contents
were evaporated to dryness and the residue was dissolved in EtOAc
(500 mL) and washed once with saturated NaCl (200 mL). The organics
were dried over sodium sulfate and the solvent was evaporated to
give 85 g (95%) of the title compound.
N4-Benzoyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methyl-cytidine
[0135] 2'-O-Methoxyethyl-5'-O-dimethoxytrityl-5-methylcytidine (85
g, 0.134 M) was dissolved in DMF (800 mL) and benzoic anhydride
(37.2 g, 0.165 M) was added with stirring. After stirring for 3
hours, TLC showed the reaction to be approximately 95% complete.
The solvent was evaporated and the residue azeotroped with MeOH
(200 mL). The residue was dissolved in CHCl.sub.3 (700 mL) and
extracted with saturated NaHCO.sub.3 (2.times.300 mL) and saturated
NaCl (2.times.300 mL), dried over MgSO.sub.4 and evaporated to give
a residue (96 g). The residue was chromatographed on a 1.5 kg
silica column using EtOAc/hexane (1:1) containing 0.5% Et.sub.3NH
as the eluting solvent. The pure product fractions were evaporated
to give 90 g (90%) of the title compound.
N4-Benzoyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methyl-cytidine-3'-ami-
dite
[0136]
N4-Benzoyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methyl-cytidine
(74 g, 0.10 M) was dissolved in CH.sub.2Cl.sub.2 (1 L). Tetrazole
diisopropylamine (7.1 g) and
2-cyanoethoxy-tetra(isopropyl)-phosphite (40.5 mL, 0.123 M) were
added with stirring, under a nitrogen atmosphere. The resulting
mixture was stirred for 20 hours at room temperature (TLC showed
the reaction to be 95% complete). The reaction mixture was
extracted with saturated NaHCO.sub.3 (1.times.300 mL) and saturated
NaCl (3.times.300 mL). The aqueous washes were back-extracted with
CH.sub.2Cl.sub.2 (300 mL), and the extracts were combined, dried
over MgSO.sub.4 and concentrated. The residue obtained was
chromatographed on a 1.5 kg silica column using EtOAc/hexane (3:1)
as the eluting solvent. The pure fractions were combined to give
90.6 g (87%) of the title compound.
2'-O-(Aminooxyethyl) nucleoside amidites and
2'-O-(dimethylamino-oxyethyl)nucleoside amidites
2'-(Dimethylaminooxyethoxy)nucleoside amidites
[0137] 2'-(Dimethylaminooxyethoxy)nucleoside amidites [also known
in the art as 2'-O-(dimethylaminooxyethyl) nucleoside amidites] are
prepared as described in the following paragraphs. Adenosine,
cytidine and guanosine nucleoside amidites are prepared similarly
to the thymidine (5-methyluridine) except the exocyclic amines are
protected with a benzoyl moiety in the case of adenosine and
cytidine and with isobutyryl in the case of guanosine.
5'-O-tert-Butyldiphenylsilyl-O.sup.2-2'-anhydro-5-methyluridine
[0138] O.sup.2-2'-anhydro-5-methyluridine (Pro. Bio. Sint., Varese,
Italy, 100.0 g, 0.416 mmol), dimethylaminopyridine (0.66 g, 0.013
eq, 0.0054 mmol) were dissolved in dry pyridine (500 ml) at ambient
temperature under an argon atmosphere and with mechanical stirring.
tert-Butyldiphenylchlorosilane (125.8 g, 119.0 mL, 1.1 eq, 0.458
mmol) was added in one portion. The reaction was stirred for 16 h
at ambient temperature. TLC (Rf 0.22, ethyl acetate) indicated a
complete reaction. The solution was concentrated under reduced
pressure to a thick oil. This was partitioned between
dichloromethane (1 L) and saturated sodium bicarbonate (2.times.1
L) and brine (1 L). The organic layer was dried over sodium sulfate
and concentrated under reduced pressure to a thick oil. The oil was
dissolved in a 1:1 mixture of ethyl acetate and ethyl ether (600
mL) and the solution was cooled to -10.degree. C. The resulting
crystalline product was collected by filtration, washed with ethyl
ether (3.times.200 mL) and dried (40.degree. C., 1 mm Hg, 24 h) to
149 g (74.8%) of white solid. TLC and NMR were consistent with pure
product.
5'-O-tert-Butyldiphenylsilyl-2'-O-(2-hydroxyethyl)-5-methyluridine
[0139] In a 2 L stainless steel, unstirred pressure reactor was
added borane in tetrahydrofuran (1.0 M, 2.0 eq, 622 mL). In the
fume hood and with manual stirring, ethylene glycol (350 mL,
excess) was added cautiously at first until the evolution of
hydrogen gas subsided.
5'-O-tert-Butyldiphenylsilyl-O.sup.2-2'-anhydro-5-methyluridine
(149 g, 0.311 mol) and sodium bicarbonate (0.074 g, 0.003 eq) were
added with manual stirring. The reactor was sealed and heated in an
oil bath until an internal temperature of 160.degree. C. was
reached and then maintained for 16 h (pressure<100 psig). The
reaction vessel was cooled to ambient and opened. TLC (Rf 0.67 for
desired product and Rf 0.82 for ara-T side product, ethyl acetate)
indicated about 70% conversion to the product. In order to avoid
additional side product formation, the reaction was stopped,
concentrated under reduced pressure (10 to 1 mm Hg) in a warm water
bath (40-100.degree. C.) with the more extreme conditions used to
remove the ethylene glycol. [Alternatively, once the low boiling
solvent is gone, the remaining solution can be partitioned between
ethyl acetate and water. The product will be in the organic phase.]
The residue was purified by column chromatography (2 kg silica gel,
ethyl acetate-hexanes gradient 1:1 to 4:1). The appropriate
fractions were combined, stripped and dried to product as a white
crisp foam (84 g, 50%), contaminated starting material (17.4 g) and
pure reusable starting material 20 g. The yield based on starting
material less pure recovered starting material was 58%. TLC and NMR
were consistent with 99% pure product.
2'-O-([2-phthalimidoxy)ethyl]-5'-t-butyldiphenylsilyl-5-methyluridine
[0140]
5'-O-tert-Butyldiphenylsilyl-2'-O-(2-hydroxyethyl)-5-methyluridine
(20 g, 36.98 mmol) was mixed with triphenylphosphine (11.63 g,
44.36 mmol) and N-hydroxyphthalimide (7.24 g, 44.36 mmol). It was
then dried over P.sub.2O.sub.5 under high vacuum for two days at
40.degree. C. The reaction mixture was flushed with argon and dry
THF (369.8 mL, Aldrich, sure seal bottle) was added to get a clear
solution. Diethyl-azodicarboxylate (6.98 mL, 44.36 mmol) was added
dropwise to the reaction mixture. The rate of addition is
maintained such that resulting deep red coloration is just
discharged before adding the next drop. After the addition was
complete, the reaction was stirred for 4 hrs. By that time TLC
showed the completion of the reaction (ethylacetate:hexane, 60:40).
The solvent was evaporated in vacuum. Residue obtained was placed
on a flash column and eluted with ethyl acetate:hexane (60:40), to
get
2'-O-([2-phthalimidoxy)ethyl]-5'-t-butyldiphenylsilyl-5-methyluridine
as white foam (21.819 g, 86%).
5'-O-tert-butyldiphenylsilyl-2'-O-[(2-formadoximinooxy)ethyl]-5-methylurid-
ine
[0141]
2'-O-([2-phthalimidoxy)ethyl]-5'-t-butyldiphenylsilyl-5-methyluridi-
ne (3.1 g, 4.5 mmol) was dissolved in dry CH.sub.2Cl.sub.2 (4.5 mL)
and methylhydrazine (300 mL, 4.64 mmol) was added dropwise at
-10.degree. C. to 0.degree. C. After 1 h the mixture was filtered,
the filtrate was washed with ice cold CH.sub.2Cl.sub.2 and the
combined organic phase was washed with water, brine and dried over
anhydrous Na.sub.2SO.sub.4. The solution was concentrated to get
2'-O-(aminooxyethyl) thymidine, which was then dissolved in MeOH
(67.5 mL). To this formaldehyde (20% aqueous solution, w/w, 1.1
eq.) was added and the resulting mixture was strirred for 1 h.
Solvent was removed under vacuum; residue chromatographed to get
5'-O-tert-butyldiphenylsilyl-2'-O-[(2-formadoximinooxy)ethyl]-5-methyluri-
dine as white foam (1.95 g, 78%).
5'-O-tert-Butyldiphenylsilyl-2'-O--[N,N-dimethylaminooxyethyl]-5-methyluri-
dine
[0142]
5'-O-tert-butyldiphenylsilyl-2'-O-[(2-formadoximinooxy)ethyl]-5-met-
hyluridine (1.77 g, 3.12 mmol) was dissolved in a solution of 1M
pyridinium p-toluenesulfonate (PPTS) in dry MeOH (30.6 mL). Sodium
cyanoborohydride (0.39 g, 6.13 mmol) was added to this solution at
10.degree. C. under inert atmosphere. The reaction mixture was
stirred for 10 minutes at 10.degree. C. After that the reaction
vessel was removed from the ice bath and stirred at room
temperature for 2 h, the reaction monitored by TLC (5% MeOH in
CH.sub.2Cl.sub.2). Aqueous NaHCO.sub.3 solution (5%, 10 mL) was
added and extracted with ethyl acetate (2.times.20 mL). Ethyl
acetate phase was dried over anhydrous Na.sub.2SO.sub.4, evaporated
to dryness. Residue was dissolved in a solution of 1M PPTS in MeOH
(30.6 mL). Formaldehyde (20% w/w, 30 mL, 3.37 mmol) was added and
the reaction mixture was stirred at room temperature for 10
minutes. Reaction mixture cooled to 10.degree. C. in an ice bath,
sodium cyanoborohydride (0.39 g, 6.13 mmol) was added and reaction
mixture stirred at 10.degree. C. for 10 minutes. After 10 minutes,
the reaction mixture was removed from the ice bath and stirred at
room temperature for 2 hrs. To the reaction mixture 5% NaHCO.sub.3
(25 mL) solution was added and extracted with ethyl acetate
(2.times.25 mL). Ethyl acetate layer was dried over anhydrous
Na.sub.2SO.sub.4 and evaporated to dryness. The residue obtained
was purified by flash column chromatography and eluted with 5% MeOH
in CH.sub.2Cl.sub.2 to get
5'-O-tert-butyldiphenylsilyl-2'-O--[N,N-dimethylaminooxyethyl]-5-methylur-
idine as a white foam (14.6 g, 80%).
2'-O-(dimethylaminooxyethyl)-5-methyluridine
[0143] Triethylamine trihydrofluoride (3.91 mL, 24.0 mmol) was
dissolved in dry THF and triethylamine (1.67 mL, 12 mmol, dry, kept
over KOH). This mixture of triethylamine-2HF was then added to
5'-O-tert-butyldiphenylsilyl-2'-O--[N,N-dimethylaminooxyethyl]-5-methylur-
idine (1.40 g, 2.4 mmol) and stirred at room temperature for 24
hrs. Reaction was monitored by TLC (5% MeOH in CH.sub.2Cl.sub.2).
Solvent was removed under vacuum and the residue placed on a flash
column and eluted with 10% MeOH in CH.sub.2Cl.sub.2 to get
2'-O-(dimethylaminooxyethyl)-5-methyluridine (766 mg, 92.5%).
5-O-DMT-2'-O-(dimethylaminooxyethyl)-5-methyluridine
[0144] 2'-O-(dimethylaminooxyethyl)-5-methyluridine (750 mg, 2.17
mmol) was dried over P.sub.2O.sub.5 under high vacuum overnight at
40.degree. C. It was then co-evaporated with anhydrous pyridine (20
mL). The residue obtained was dissolved in pyridine (11 mL) under
argon atmosphere. 4-dimethylaminopyridine (26.5 mg, 2.60 mmol),
4,4'-dimethoxytrityl chloride (880 mg, 2.60 mmol) was added to the
mixture and the reaction mixture was stirred at room temperature
until all of the starting material disappeared. Pyridine was
removed under vacuum and the residue chromatographed and eluted
with 10% MeOH in CH.sub.2Cl.sub.2 (containing a few drops of
pyridine) to get
5'-O-DMT-2'-O-(dimethylamino-oxyethyl)-5-methyluridine (1.13 g,
80%).
5'-O-DMT-2'-O-(2-N,N-dimethylaminooxyethyl)-5-methyluridine-3'-[(2-cyanoet-
hyl)-N,N-diisopropylphosphoramidite]
[0145] 5'-O-DMT-2'-O-(dimethylaminooxyethyl)-5-methyluridine (1.08
g, 1.67 mmol) was co-evaporated with toluene (20 mL). To the
residue N,N-diisopropylamine tetrazonide (0.29 g, 1.67 mmol) was
added and dried over P.sub.2O.sub.5 under high vacuum overnight at
40.degree. C. Then the reaction mixture was dissolved in anhydrous
acetonitrile (8.4 mL) and
2-cyanoethyl-N,N,N.sup.1,N.sup.1-tetraisopropylphosphoramidite
(2.12 mL, 6.08 mmol) was added. The reaction mixture was stirred at
ambient temperature for 4 hrs under inert atmosphere. The progress
of the reaction was monitored by TLC (hexane:ethyl acetate 1:1).
The solvent was evaporated, then the residue was dissolved in ethyl
acetate (70 mL) and washed with 5% aqueous NaHCO.sub.3 (40 mL).
Ethyl acetate layer was dried over anhydrous Na.sub.2SO.sub.4 and
concentrated. Residue obtained was chromatographed (ethyl acetate
as eluent) to get
5'-O-DMT-2'-O-(2-N,N-dimethylaminooxyethyl)-5-methyluridine-3'-[(2-cyanoe-
thyl)-N,N-diisopropylphosphoramidite] as a foam (1.04 g,
74.9%).
2'-(Aminooxyethoxy)nucleoside amidites
[0146] 2'-(Aminooxyethoxy)nucleoside amidites [also known in the
art as 2'-O-(aminooxyethyl)nucleoside amidites] are prepared as
described in the following paragraphs. Adenosine, cytid
N2-isobutyryl-6-O-diphenylcarbamoyl-2'-O-(2-ethylacetyl)-5'-O-(4,4'-dimeth-
oxytrityl)guanosine-3'-[(2-cyanoethyl)-N,N-diisopropylphosphoramidite]
[0147] The 2'-O-aminooxyethyl guanosine analog may be obtained by
selective 2'-O-alkylation of diaminopurine riboside. Multigram
quantities of diaminopurine riboside may be purchased from Schering
AG (Berlin) to provide 2'-O-(2-ethylacetyl)diaminopurine riboside
along with a minor amount of the 3'-O-isomer.
2'-O-(2-ethylacetyl)diaminopurine riboside may be resolved and
converted to 2'-O-(2-ethylacetyl)guanosine by treatment with
adenosine deaminase. (McGee, D. P. C., Cook, P. D., Guinosso, C.
J., WO 94/02501 A1 940203.) Standard protection procedures should
afford 2'-O-(2-ethylacetyl)-5'-O-(4,4'-dimethoxytrityl)guanosine
and
2-N-isobutyryl-6-O-diphenylcarbamoyl-2'-O-(2-ethylacetyl)-5'-O-(4,4'-dime-
thoxytrityl)guanosine which may be reduced to provide
2-N-isobutyryl-6-O-diphenylcarbamoyl-2'-O-(2-hydroxyethyl)-5'-O-(4,4'-dim-
ethoxytrityl)guanosine. As before the hydroxyl group may be
displaced by N-hydroxyphthalimide via a Mitsunobu reaction, and the
protected nucleoside may phosphitylated as usual to yield
2-N-isobutyryl-6-O-diphenylcarbamoyl-2'-O-([2-phthalmidoxy]ethyl)-5'-O-(4-
,4'-dimethoxytrityl)guanosine-3'-[(2-cyanoethyl)-N,N-diisopropylphosphoram-
idite].
2'-dimethylaminoethoxyethoxy (2'-DMAEOE) nucleoside amidites
[0148] 2'-dimethylaminoethoxyethoxy nucleoside amidites (also known
in the art as 2'-O-dimethylaminoethoxyethyl, i.e.,
2'-O--CH.sub.2--O--CH.sub.2--N(CH.sub.2).sub.2, or 2'-DMAEOE
nucleoside amidites) are prepared as follows. Other nucleoside
amidites are prepared similarly.
2'-O-[2(2-N,N-dimethylaminoethoxy)ethyl]-5-methyl uridine
[0149] 2[2-(Dimethylamino)ethoxy]ethanol (Aldrich, 6.66 g, 50 mmol)
is slowly added to a solution of borane in tetrahydrofuran (1 M, 10
mL, 10 mmol) with stirring in a 100 mL bomb. Hydrogen gas evolves
as the solid dissolves. O.sup.2-,2'-anhydro-5-methyluridine (1.2 g,
5 mmol), and sodium bicarbonate (2.5 mg) are added and the bomb is
sealed, placed in an oil bath and heated to 155.degree. C. for 26
hours. The bomb is cooled to room temperature and opened. The crude
solution is concentrated and the residue partitioned between water
(200 mL) and hexanes (200 mL). The excess phenol is extracted into
the hexane layer. The aqueous layer is extracted with ethyl acetate
(3.times.200 mL) and the combined organic layers are washed once
with water, dried over anhydrous sodium sulfate and concentrated.
The residue is columned on silica gel using methanol/methylene
chloride 1:20 (which has 2% triethylamine) as the eluent. As the
column fractions are concentrated a colorless solid forms which is
collected to give the title compound as a white solid.
5'-O-dimethoxytrityl-2'-O-[2(2-N,N-dimethylaminoethoxy)ethyl)]-5-methyl
uridine
[0150] To 0.5 g (1.3 mmol) of
2'-O-[2(2-N,N-dimethylamino-ethoxy)ethyl)]-5-methyl uridine in
anhydrous pyridine (8 mL), triethylamine (0.36 mL) and
dimethoxytrityl chloride (DMT-C1, 0.87 g, 2 eq.) are added and
stirred for 1 hour. The reaction mixture is poured into water (200
mL) and extracted with CH.sub.2Cl.sub.2 (2.times.200 mL). The
combined CH.sub.2Cl.sub.2 layers are washed with saturated
NaHCO.sub.3 solution, followed by saturated NaCl solution and dried
over anhydrous sodium sulfate. Evaporation of the solvent followed
by silica gel chromatography using MeOH:CH.sub.2Cl.sub.2:Et.sub.3N
(20:1, v/v, with 1% triethylamine) gives the title compound.
5'-O-Dimethoxytrityl-2'-O-[2(2-N,N-dimethylaminoethoxy)-ethyl)]-5-methyl
uridine-3'-O-(cyanoethyl-N,N-diisopropyl)phosphoramidite
[0151] Diisopropylaminotetrazolide (0.6 g) and
2-cyanoethoxy-N,N-diisopropyl phosphoramidite (1.1 mL, 2 eq.) are
added to a solution of
5'-O-dimethoxytrityl-2'-O-[2(2-N,N-dimethylaminoethoxy)ethyl)]-5-methylur-
idine (2.17 g, 3 mmol) dissolved in CH.sub.2Cl.sub.2 (20 mL) under
an atmosphere of argon. The reaction mixture is stirred overnight
and the solvent evaporated. The resulting residue is purified by
silica gel flash column chromatography with ethyl acetate as the
eluent to give the title compound.
Example 2
Oligonucleotide Synthesis
[0152] Unsubstituted and substituted phosphodiester (P.dbd.O)
oligo-nucleotides are synthesized on an automated DNA synthesizer
(Applied Biosystems model 380B) using standard phosphoramidite
chemistry with oxidation by iodine.
[0153] Phosphorothioates (P.dbd.S) are synthesized as for the
phosphodiester oligonucleotides except the standard oxidation
bottle was replaced by 0.2 M solution of 3H-1,2-benzodithiole-3-one
1,1-dioxide in acetonitrile for the stepwise thiation of the
phosphite linkages. The thiation wait step was increased to 68 sec
and was followed by the capping step. After cleavage from the CPG
column and deblocking in concentrated ammonium hydroxide at
55.degree. C. (18 h), the oligonucleotides were purified by
precipitating twice with 2.5 volumes of ethanol from a 0.5 M NaCl
solution. Phosphinate oligonucleotides are prepared as described in
U.S. Pat. No. 5,508,270, herein incorporated by reference.
[0154] Alkyl phosphonate oligonucleotides are prepared as described
in U.S. Pat. No. 4,469,863, herein incorporated by reference.
[0155] 3'-Deoxy-3'-methylene phosphonate oligonucleotides are
prepared as described in U.S. Pat. Nos. 5,610,289 or 5,625,050,
herein incorporated by reference.
[0156] Phosphoramidite oligonucleotides are prepared as described
in U.S. Pat. No. 5,256,775 or U.S. Pat. No. 5,366,878, herein
incorporated by reference.
[0157] Alkylphosphonothioate oligonucleotides are prepared as
described in published PCT applications PCT/US94/00902 and
PCT/US93/06976 (published as WO 94/17093 and WO 94/02499,
respectively), herein incorporated by reference.
[0158] 3'-Deoxy-3'-amino phosphoramidate oligonucleotides are
prepared as described in U.S. Pat. No. 5,476,925, herein
incorporated by reference.
[0159] Phosphotriester oligonucleotides are prepared as described
in U.S. Pat. No. 5,023,243, herein incorporated by reference.
[0160] Borano phosphate oligonucleotides are prepared as described
in U.S. Pat. Nos. 5,130,302 and 5,177,198, both herein incorporated
by reference.
Example 3
Oligonucleoside Synthesis
[0161] Methylenemethylimino linked oligonucleosides, also
identified as MMI linked oligonucleosides, methylenedimethylhydrazo
linked oligonucleosides, also identified as MDH linked
oligonucleosides, and methylenecarbonylamino linked
oligonucleosides, also identified as amide-3 linked
oligonucleosides, and methyleneaminocarbonyl linked
oligonucleosides, also identified as amide-4 linked
oligo-nucleosides, as well as mixed backbone compounds having, for
instance, alternating MMI and P.dbd.O or P.dbd.S linkages are
prepared as described in U.S. Pat. Nos. 5,378,825, 5,386,023,
5,489,677, 5,602,240 and 5,610,289, all of which are herein
incorporated by reference.
[0162] Formacetal and thioformacetal linked oligonucleosides are
prepared as described in U.S. Pat. Nos. 5,264,562 and 5,264,564,
herein incorporated by reference.
[0163] Ethylene oxide linked oligonucleosides are prepared as
described in U.S. Pat. No. 5,223,618, herein incorporated by
reference.
Example 4
PNA Synthesis
[0164] Peptide nucleic acids (PNAs) are prepared in accordance with
any of the various procedures referred to in Peptide Nucleic Acids
(PNA): Synthesis, Properties and Potential Applications, Bioorganic
& Medicinal Chemistry, 1996, 4, 5-23. They may also be prepared
in accordance with U.S. Pat. Nos. 5,539,082, 5,700,922, and
5,719,262, herein incorporated by reference.
Example 5
Synthesis of Chimeric Oligonucleotides
[0165] Chimeric oligonucleotides, oligonucleosides or mixed
oligonucleotides/oligonucleosides of the invention can be of
several different types. These include a first type wherein the
"gap" segment of linked nucleosides is positioned between 5' and 3'
"wing" segments of linked nucleosides and a second "open end" type
wherein the "gap" segment is located at either the 3' or the 5'
terminus of the oligomeric compound. Oligonucleotides of the first
type are also known in the art as "gapmers" or gapped
oligonucleotides. Oligonucleotides of the second type are also
known in the art as "hemimers" or "wingmers".
[2'-O-Me]-[2'-deoxy]-[2'-O-Me]Chimeric Phosphorothioate
Oligonucleotides
[0166] Chimeric oligonucleotides having 2'-O-alkyl phosphorothioate
and 2'-deoxy phosphorothioate oligonucleotide segments are
synthesized using an Applied Biosystems automated DNA synthesizer
Model 380B, as above. Oligonucleotides are synthesized using the
automated synthesizer and
2'-deoxy-5'-dimethoxytrityl-3'-O-phosphoramidite for the DNA
portion and 5'-dimethoxytrityl-2'-O-methyl-3'-O-phosphoramidite for
5' and 3' wings. The standard synthesis cycle is modified by
increasing the wait step after the delivery of tetrazole and base
to 600 s repeated four times for RNA and twice for 2'-O-methyl. The
fully protected oligonucleotide is cleaved from the support and the
phosphate group is deprotected in 3:1 ammonia/ethanol at room
temperature overnight then lyophilized to dryness. Treatment in
methanolic ammonia for 24 hrs at room temperature is then done to
deprotect all bases and sample was again lyophilized to dryness.
The pellet is resuspended in 1M TBAF in THF for 24 hrs at room
temperature to deprotect the 2' positions. The reaction is then
quenched with 1M TEAA and the sample is then reduced to 1/2 volume
by rotovac before being desalted on a G25 size exclusion column.
The oligo recovered is then analyzed spectrophotometrically for
yield and for purity by capillary electrophoresis and by mass
spectrometry.
[2'-O-(2-Methoxyethyl)]-[2'-deoxy]-[2'-O-(Methoxyethyl)]Chimeric
Phosphorothioate Oligonucleotides
[0167]
[2'-O-(2-methoxyethyl)]-[2'-deoxy]-[-2'-O-(methoxyethyl)]chimeric
phosphorothioate oligonucleotides were prepared as per the
procedure above for the 2'-O-methyl chimeric oligonucleotide, with
the substitution of 2'-O-(methoxyethyl) amidites for the
2'-O-methyl amidites.
[2'-O-(2-Methoxyethyl)Phosphodiester]-[2'-deoxy
Phosphoro-thioate]-[2'-O-(2-Methoxyethyl) Phosphodiester]Chimeric
Oligonucleotides
[0168] [2'-O-(2-methoxyethyl phosphodiester]-[2'-deoxy
phosphoro-thioate]-[2'-O-(methoxyethyl)phosphodiester]chimeric
oligonucleotides are prepared as per the above procedure for the
2'-O-methyl chimeric oligonucleotide with the substitution of
2'-O-(methoxyethyl)amidites for the 2'-O-methyl amidites,
oxidization with iodine to generate the phosphodiester
internucleotide linkages within the wing portions of the chimeric
structures and sulfurization utilizing 3,H-1,2 benzodithiole-3-one
1,1 dioxide (Beaucage Reagent) to generate the phosphorothioate
internucleotide linkages for the center gap.
[0169] Other chimeric oligonucleotides, chimeric oligonucleosides
and mixed chimeric oligonucleotides/oligonucleosides are
synthesized according to U.S. Pat. No. 5,623,065, herein
incorporated by reference.
Example 6
Oligonucleotide Isolation
[0170] After cleavage from the controlled pore glass column
(Applied Biosystems) and deblocking in concentrated ammonium
hydroxide at 55.degree. C. for 18 hours, the oligonucleotides or
oligonucleosides are purified by precipitation twice out of 0.5 M
NaCl with 2.5 volumes ethanol. Synthesized oligonucleotides were
analyzed by polyacrylamide gel electrophoresis on denaturing gels
and judged to be at least 85% full length material. The relative
amounts of phosphorothioate and phosphodiester linkages obtained in
synthesis were periodically checked by .sup.31P nuclear magnetic
resonance spectroscopy, and for some studies oligonucleotides were
purified by HPLC, as described by Chiang et al., J. Biol. Chem.
1991, 266, 18162-18171. Results obtained with HPLC-purified
material were similar to those obtained with non-HPLC purified
material.
Example 7
Oligonucleotide Synthesis--96 Well Plate Format
[0171] Oligonucleotides were synthesized via solid phase P(III)
phosphoramidite chemistry on an automated synthesizer capable of
assembling 96 sequences simultaneously in a standard 96 well
format. Phosphodiester internucleotide linkages were afforded by
oxidation with aqueous iodine. Phosphorothioate internucleotide
linkages were generated by sulfurization utilizing 3,H-1,2
benzodithiole-3-one 1,1 dioxide (Beaucage Reagent) in anhydrous
acetonitrile. Standard base-protected beta-cyanoethyldiisopropyl
phosphoramidites were purchased from commercial vendors (e.g.
PE-Applied Biosystems, Foster City, Calif., or Pharmacia,
Piscataway, N.J.). Non-standard nucleosides are synthesized as per
known literature or patented methods. They are utilized as base
protected beta-cyanoethyldiisopropyl phosphoramidites.
[0172] Oligonucleotides were cleaved from support and deprotected
with concentrated NH.sub.4OH at elevated temperature (55-60.degree.
C.) for 12-16 hours and the released product then dried in vacuo.
The dried product was then re-suspended in sterile water to afford
a master plate from which all analytical and test plate samples are
then diluted utilizing robotic pipettors.
Example 8
Oligonucleotide Analysis--96 Well Plate Format
[0173] The concentration of oligonucleotide in each well was
assessed by dilution of samples and UV absorption spectroscopy. The
full-length integrity of the individual products was evaluated by
capillary electrophoresis (CE) in either the 96 well format
(Beckman P/ACE.TM. MDQ) or, for individually prepared samples, on a
commercial CE apparatus (e.g., Beckman P/ACE.TM. 5000, ABI 270).
Base and backbone composition was confirmed by mass analysis of the
compounds utilizing electrospray-mass spectroscopy. All assay test
plates were diluted from the master plate using single and
multi-channel robotic pipettors. Plates were judged to be
acceptable if at least 85% of the compounds on the plate were at
least 85% full length.
Example 9
Cell Culture and Oligonucleotide Treatment
[0174] The effect of antisense compounds on target nucleic acid
expression can be tested in any of a variety of cell types provided
that the target nucleic acid is present at measurable levels. This
can be routinely determined using, for example, PCR or Northern
blot analysis. The following 5 cell types are provided for
illustrative purposes, but other cell types can be routinely used,
provided that the target is expressed in the cell type chosen. This
can be readily determined by methods routine in the art, for
example Northern blot analysis, Ribonuclease protection assays, or
RT-PCR.
T-24 Cells:
[0175] The human transitional cell bladder carcinoma cell line T-24
was obtained from the American Type Culture Collection (ATCC)
(Manassas, Va.). T-24 cells were routinely cultured in complete
McCoy's 5A basal media (Gibco/Life Technologies, Gaithersburg, Md.)
supplemented with 10% fetal calf serum (Gibco/Life Technologies,
Gaithersburg, Md.), penicillin 100 units per mL, and streptomycin
100 micrograms per mL (Gibco/Life Technologies, Gaithersburg, Md.).
Cells were routinely passaged by trypsinization and dilution when
they reached 90% confluence. Cells were seeded into 96-well plates
(Falcon-Primaria #3872) at a density of 7000 cells/well for use in
RT-PCR analysis.
[0176] For Northern blotting or other analysis, cells may be seeded
onto 100 mm or other standard tissue culture plates and treated
similarly, using appropriate volumes of medium and
oligonucleotide.
A549 Cells:
[0177] The human lung carcinoma cell line A549 was obtained from
the American Type Culture Collection (ATCC) (Manassas, Va.). A549
cells were routinely cultured in DMEM basal media (Gibco/Life
Technologies, Gaithersburg, Md.) supplemented with 10% fetal calf
serum (Gibco/Life Technologies, Gaithersburg, Md.), penicillin 100
units per mL, and streptomycin 100 micrograms per mL (Gibco/Life
Technologies, Gaithersburg, Md.). Cells were routinely passaged by
trypsinization and dilution when they reached 90% confluence.
NHDF Cells:
[0178] Human neonatal dermal fibroblast (NHDF) were obtained from
the Clonetics Corporation (Walkersville Md.). NHDFs were routinely
maintained in Fibroblast Growth Medium (Clonetics Corporation,
Walkersville Md.) supplemented as recommended by the supplier.
Cells were maintained for up to 10 passages as recommended by the
supplier.
HEK Cells:
[0179] Human embryonic keratinocytes (HEK) were obtained from the
Clonetics Corporation (Walkersville Md.). HEKs were routinely
maintained in Keratinocyte Growth Medium (Clonetics Corporation,
Walkersville Md.) formulated as recommended by the supplier. Cells
were routinely maintained for up to 10 passages as recommended by
the supplier.
b.END Cells:
[0180] The mouse brain endothelial cell line b.END was obtained
from Dr. Werner Risau at the Max Plank Instititute (Bad Nauheim,
Germany). b.END cells were routinely cultured in DMEM, high glucose
(Gibco/Life Technologies, Gaithersburg, Md.) supplemented with 10%
fetal calf serum (Gibco/Life Technologies, Gaithersburg, Md.).
Cells were routinely passaged by trypsinization and dilution when
they reached 90% confluence. Cells were seeded into 96-well plates
(Falcon-Primaria #3872) at a density of 3000 cells/well for use in
RT-PCR analysis.
[0181] For Northern blotting or other analyses, cells may be seeded
onto 100 mm or other standard tissue culture plates and treated
similarly, using appropriate volumes of medium and oligonucleotide.
Treatment with antisense compounds:
[0182] When cells reached 80% confluency, they were treated with
oligonucleotide. For cells grown in 96-well plates, wells were
washed once with 200 .mu.L OPTI-MEM.TM.-1 reduced-serum medium
(Gibco BRL) and then treated with 130 .mu.L of OPTI-MEM.TM.-1
containing 3.75 .mu.g/mL LIPOFECTIN.TM. (Gibco BRL) and the desired
concentration of oligonucleotide. After 4-7 hours of treatment, the
medium was replaced with fresh medium. Cells were harvested 16-24
hours after oligonucleotide treatment.
[0183] The concentration of oligonucleotide used varies from cell
line to cell line. To determine the optimal oligonucleotide
concentration for a particular cell line, the cells are treated
with a positive control oligonucleotide at a range of
concentrations. For human cells the positive control
oligonucleotide is ISIS 13920, TCCGTCATCGCTCCTCAGGG, SEQ ID NO: 1,
a 2'-O-methoxyethyl gapmer (2'-O-methoxyethyls shown in bold) with
a phosphorothioate backbone which is targeted to human H-ras. For
mouse or rat cells the positive control oligonucleotide is ISIS
15770, ATGCATTCTGCCCCCAAGGA, SEQ ID NO: 2, a 2'-O-methoxyethyl
gapmer (2'-O-methoxyethyls shown in bold) with a phosphorothioate
backbone which is targeted to both mouse and rat c-raf. The
concentration of positive control oligonucleotide that results in
80% inhibition of c-Ha-ras (for ISIS 13920) or c-raf (for ISIS
15770) mRNA is then utilized as the screening concentration for new
oligonucleotides in subsequent experiments for that cell line. If
80% inhibition is not achieved, the lowest concentration of
positive control oligonucleotide that results in 60% inhibition of
H-ras or c-raf mRNA is then utilized as the oligonucleotide
screening concentration in subsequent experiments for that cell
line. If 60% inhibition is not achieved, that particular cell line
is deemed as unsuitable for oligonucleotide transfection
experiments.
Example 10
Analysis of Oligonucleotide Inhibition of BCL2-Associated X Protein
Expression
[0184] Antisense modulation of BCL2-associated X protein expression
can be assayed in a variety of ways known in the art. For example,
BCL2-associated X protein mRNA levels can be quantitated by, e.g.,
Northern blot analysis, competitive polymerase chain reaction
(PCR), or real-time PCR (RT-PCR). Real-time quantitative PCR is
presently preferred. RNA analysis can be performed on total
cellular RNA or poly(A)+ mRNA. Methods of RNA isolation are taught
in, for example, Ausubel, F. M. et al., Current Protocols in
Molecular Biology, Volume 1, pp. 4.1.1-4.2.9 and 4.5.1-4.5.3, John
Wiley & Sons, Inc., 1993. Northern blot analysis is routine in
the art and is taught in, for example, Ausubel, F. M. et al.,
Current Protocols in Molecular Biology, Volume 1, pp. 4.2.1-4.2.9,
John Wiley & Sons, Inc., 1996. Real-time quantitative (PCR) can
be conveniently accomplished using the commercially available ABI
PRISM.TM. 7700 Sequence Detection System, available from PE-Applied
Biosystems, Foster City, Calif. and used according to
manufacturer's instructions.
[0185] Protein levels of BCL2-associated X protein can be
quantitated in a variety of ways well known in the art, such as
immunoprecipitation, Western blot analysis (immunoblotting), ELISA
or fluorescence-activated cell sorting (FACS). Antibodies directed
to BCL2-associated X protein can be identified and obtained from a
variety of sources, such as the MSRS catalog of antibodies (Aerie
Corporation, Birmingham, Mich.), or can be prepared via
conventional antibody generation methods. Methods for preparation
of polyclonal antisera are taught in, for example, Ausubel, F. M.
et al., Current Protocols in Molecular Biology, Volume 2, pp.
11.12.1-11.12.9, John Wiley & Sons, Inc., 1997. Preparation of
monoclonal antibodies is taught in, for example, Ausubel, F. M. et
al., Current Protocols in Molecular Biology, Volume 2, pp.
11.4.1-11.11.5, John Wiley & Sons, Inc., 1997.
[0186] Immunoprecipitation methods are standard in the art and can
be found at, for example, Ausubel, F. M. et al., Current Protocols
in Molecular Biology, Volume 2, pp. 10.16.1-10.16.11, John Wiley
& Sons, Inc., 1998. Western blot (immunoblot) analysis is
standard in the art and can be found at, for example, Ausubel, F.
M. et al., Current Protocols in Molecular Biology, Volume 2, pp.
10.8.1-10.8.21, John Wiley & Sons, Inc., 1997. Enzyme-linked
immunosorbent assays (ELISA) are standard in the art and can be
found at, for example, Ausubel, F. M. et al., Current Protocols in
Molecular Biology, Volume 2, pp. 11.2.1-11.2.22, John Wiley &
Sons, Inc., 1991.
Example 11
Poly(A)+ mRNA Isolation
[0187] Poly(A)+ mRNA was isolated according to Miura et al., Clin.
Chem., 1996, 42, 1758-1764. Other methods for poly(A)+ mRNA
isolation are taught in, for example, Ausubel, F. M. et al.,
Current Protocols in Molecular Biology, Volume 1, pp. 4.5.1-4.5.3,
John Wiley & Sons, Inc., 1993. Briefly, for cells grown on
96-well plates, growth medium was removed from the cells and each
well was washed with 200 .mu.L cold PBS. 60 .mu.L lysis buffer (10
mM Tris-HCl, pH 7.6, 1 mM EDTA, 0.5 M NaCl, 0.5% NP-40, 20 mM
vanadyl-ribonucleoside complex) was added to each well, the plate
was gently agitated and then incubated at room temperature for five
minutes. 55 .mu.L of lysate was transferred to Oligo d(T) coated
96-well plates (AGCT Inc., Irvine Calif.). Plates were incubated
for 60 minutes at room temperature, washed 3 times with 200 .mu.L
of wash buffer (10 mM Tris-HCl pH 7.6, 1 mM EDTA, 0.3 M NaCl).
After the final wash, the plate was blotted on paper towels to
remove excess wash buffer and then air-dried for 5 minutes. 60
.mu.L of elution buffer (5 mM Tris-HCl pH 7.6), preheated to
70.degree. C. was added to each well, the plate was incubated on a
90.degree. C. hot plate for 5 minutes, and the eluate was then
transferred to a fresh 96-well plate.
[0188] Cells grown on 100 mm or other standard plates may be
treated similarly, using appropriate volumes of all solutions.
Example 12
Total RNA Isolation
[0189] Total RNA was isolated using an RNEASY 96.TM. kit and
buffers purchased from Qiagen Inc. (Valencia Calif.) following the
manufacturer's recommended procedures. Briefly, for cells grown on
96-well plates, growth medium was removed from the cells and each
well was washed with 200 .mu.L cold PBS. 100 .mu.L Buffer RLT was
added to each well and the plate vigorously agitated for 20
seconds. 100 .mu.L of 70% ethanol was then added to each well and
the contents mixed by pipetting three times up and down. The
samples were then transferred to the RNEASY 96.TM. well plate
attached to a QIAVAC.TM. manifold fitted with a waste collection
tray and attached to a vacuum source. Vacuum was applied for 15
seconds. 1 mL of Buffer RW1 was added to each well of the RNEASY
96.TM. plate and the vacuum again applied for 15 seconds. 1 mL of
Buffer RPE was then added to each well of the RNEASY 96.TM. plate
and the vacuum applied for a period of 15 seconds. The Buffer RPE
wash was then repeated and the vacuum was applied for an additional
10 minutes. The plate was then removed from the QIAVAC.TM. manifold
and blotted dry on paper towels. The plate was then re-attached to
the QIAVAC.TM. manifold fitted with a collection tube rack
containing 1.2 mL collection tubes. RNA was then eluted by
pipetting 60 .mu.L water into each well, incubating 1 minute, and
then applying the vacuum for 30 seconds. The elution step was
repeated with an additional 60 .mu.L water.
[0190] The repetitive pipetting and elution steps may be automated
using a QIAGEN Bio-Robot 9604 (Qiagen, Inc., Valencia Calif.).
Essentially, after lysing of the cells on the culture plate, the
plate is transferred to the robot deck where the pipetting, DNase
treatment and elution steps are carried out.
Example 13
Real-Time Quantitative PCR Analysis of BCL2-Associated X Protein
mRNA Levels
[0191] Quantitation of BCL2-associated X protein mRNA levels was
determined by real-time quantitative PCR using the ABI PRISM.TM.
7700 Sequence Detection System (PE-Applied Biosystems, Foster City,
Calif.) according to manufacturer's instructions. This is a
closed-tube, non-gel-based, fluorescence detection system which
allows high-throughput quantitation of polymerase chain reaction
(PCR) products in real-time. As opposed to standard PCR, in which
amplification products are quantitated after the PCR is completed,
products in real-time quantitative PCR are quantitated as they
accumulate. This is accomplished by including in the PCR reaction
an oligonucleotide probe that anneals specifically between the
forward and reverse PCR primers, and contains two fluorescent dyes.
A reporter dye (e.g., JOE, FAM, or VIC, obtained from either Operon
Technologies Inc., Alameda, Calif. or PE-Applied Biosystems, Foster
City, Calif.) is attached to the 5' end of the probe and a quencher
dye (e.g., TAMRA, obtained from either Operon Technologies Inc.,
Alameda, Calif. or PE-Applied Biosystems, Foster City, Calif.) is
attached to the 3' end of the probe. When the probe and dyes are
intact, reporter dye emission is quenched by the proximity of the
3' quencher dye. During amplification, annealing of the probe to
the target sequence creates a substrate that can be cleaved by the
5'-exonuclease activity of Taq polymerase. During the extension
phase of the PCR amplification cycle, cleavage of the probe by Taq
polymerase releases the reporter dye from the remainder of the
probe (and hence from the quencher moiety) and a sequence-specific
fluorescent signal is generated. With each cycle, additional
reporter dye molecules are cleaved from their respective probes,
and the fluorescence intensity is monitored at regular intervals by
laser optics built into the ABI PRISM.TM. 7700 Sequence Detection
System. In each assay, a series of parallel reactions containing
serial dilutions of mRNA from untreated control samples generates a
standard curve that is used to quantitate the percent inhibition
after antisense oligonucleotide treatment of test samples.
[0192] Prior to quantitative PCR analysis, primer-probe sets
specific to the target gene being measured are evaluated for their
ability to be "multiplexed" with a GAPDH amplification reaction. In
multiplexing, both the target gene and the internal standard gene
GAPDH are amplified concurrently in a single sample. In this
analysis, mRNA isolated from untreated cells is serially diluted.
Each dilution is amplified in the presence of primer-probe sets
specific for GAPDH only, target gene only ("single-plexing"), or
both (multiplexing). Following PCR amplification, standard curves
of GAPDH and target mRNA signal as a function of dilution are
generated from both the single-plexed and multiplexed samples. If
both the slope and correlation coefficient of the GAPDH and target
signals generated from the multiplexed samples fall within 10% of
their corresponding values generated from the single-plexed
samples, the primer-probe set specific for that target is deemed
multiplexable. Other methods of PCR are also known in the art.
[0193] PCR reagents were obtained from PE-Applied Biosystems,
Foster City, Calif. RT-PCR reactions were carried out by adding 25
.mu.L PCR cocktail (1.times. TAQMAN.TM. buffer A, 5.5 mM
MgCl.sub.2, 300 .mu.M each of dATP, dCTP and dGTP, 600 .mu.M of
dUTP, 100 nM each of forward primer, reverse primer, and probe, 20
Units RNAse inhibitor, 1.25 Units AMPLITAQ GOLD.TM., and 12.5 Units
MuLV reverse transcriptase) to 96 well plates containing 25 .mu.L
total RNA solution. The RT reaction was carried out by incubation
for 30 minutes at 48.degree. C. Following a 10 minute incubation at
95.degree. C. to activate the AMPLITAQ GOLD.TM., 40 cycles of a
two-step PCR protocol were carried out: 95.degree. C. for 15
seconds (denaturation) followed by 60.degree. C. for 1.5 minutes
(annealing/extension).
[0194] Gene target quantities obtained by real time RT-PCR are
normalized using either the expression level of GAPDH, a gene whose
expression is constant, or by quantifying total RNA using
RiboGreen.TM. (Molecular Probes, Inc. Eugene, Oreg.). GAPDH
expression is quantified by real time RT-PCR, by being run
simultaneously with the target, multiplexing, or separately. Total
RNA is quantified using RiboGreen.TM. RNA quantification reagent
from Molecular Probes. Methods of RNA quantification by
RiboGreen.TM. are taught in Jones, L. J., et al, Analytical
Biochemistry, 1998, 265, 368-374.
[0195] In this assay, 175 .mu.L of RiboGreen.TM. working reagent
(RiboGreen.TM. reagent diluted 1:2865 in 10 mM Tris-HCl, 1 mM EDTA,
pH 7.5) is pipetted into a 96-well plate containing 25 uL purified,
cellular RNA. The plate is read in a CytoFluor 4000 (PE Applied
Biosystems) with excitation at 480 nm and emission at 520 nm.
[0196] Probes and primers to human BCL2-associated X protein were
designed to hybridize to a human BCL2-associated X protein
sequence, using published sequence information (GenBank accession
number NM.sub.--004324, incorporated herein as SEQ ID NO:3). For
human BCL2-associated X protein the PCR primers were: [0197]
forward primer: CCGCCGTGGACACAGACT (SEQ ID NO: 4) [0198] reverse
primer: CCGGCCCCAGTTGAAGTT (SEQ ID NO: 5) and the PCR probe was:
FAM-CCCGAGAGGTCTTTTTCCGAGTGGC-TAMRA (SEQ ID NO: 6) where FAM
(PE-Applied Biosystems, Foster City, Calif.) is the fluorescent
reporter dye) and TAMRA (PE-Applied Biosystems, Foster City,
Calif.) is the quencher dye. For human GAPDH the PCR primers were:
[0199] forward primer: GAAGGTGAAGGTCGGAGTC (SEQ ID NO: 7) [0200]
reverse primer: GAAGATGGTGATGGGATTTC (SEQ ID NO: 8) and the PCR
probe was: 5' JOE-CAAGCTTCCCGTTCTCAGCC-TAMRA 3' (SEQ ID NO: 9)
where JOE (PE-Applied Biosystems, Foster City, Calif.) is the
fluorescent reporter dye) and TAMRA (PE-Applied Biosystems, Foster
City, Calif.) is the quencher dye.
[0201] Probes and primers to mouse BCL2-associated X protein were
designed to hybridize to a mouse BCL2-associated X protein
sequence, using published sequence information (GenBank accession
number NM.sub.--007527, incorporated herein as SEQ ID NO:10). For
mouse BCL2-associated X protein the PCR primers were: [0202]
forward primer: AGACACCTGAGCTGACCTTGGA (SEQ ID NO:11) [0203]
reverse primer: GAGACACTCGCTCAGCTTCTTG (SEQ ID NO: 12) and the PCR
probe was: FAM-AGCCGCCCCAGGATGCGTC-TAMRA (SEQ ID NO: 13) where FAM
(PE-Applied Biosystems, Foster City, Calif.) is the fluorescent
reporter dye) and TAMRA (PE-Applied Biosystems, Foster City,
Calif.) is the quencher dye. For mouse GAPDH the PCR primers were:
[0204] forward primer: GGCAAATTCAACGGCACAGT (SEQ ID NO: 14) [0205]
reverse primer: GGGTCTCGCTCCTGGAAGAT (SEQ ID NO: 15) and the PCR
probe was: 5' JOE-AAGGCCGAGAATGGGAAGCTTGTCATC-TAMRA 3' (SEQ ID NO:
16) where JOE (PE-Applied Biosystems, Foster City, Calif.) is the
fluorescent reporter dye) and TAMRA (PE-Applied Biosystems, Foster
City, Calif.) is the quencher dye.
Example 14
Northern Blot Analysis of BCL2-Associated X Protein mRNA Levels
[0206] Eighteen hours after antisense treatment, cell monolayers
were washed twice with cold PBS and lysed in 1 mL RNAZOL.TM.
(TEL-TEST "B" Inc., Friendswood, Tex.). Total RNA was prepared
following manufacturer's recommended protocols. Twenty micrograms
of total RNA was fractionated by electrophoresis through 1.2%
agarose gels containing 1.1% formaldehyde using a MOPS buffer
system (AMRESCO, Inc. Solon, Ohio). RNA was transferred from the
gel to HYBOND.TM.-N+ nylon membranes (Amersham Pharmacia Biotech,
Piscataway, N.J.) by overnight capillary transfer using a
Northern/Southern Transfer buffer system (TEL-TEST "B" Inc.,
Friendswood, Tex.). RNA transfer was confirmed by UV visualization.
Membranes were fixed by UV cross-linking using a STRATALINKER.TM.
UV Crosslinker 2400 (Stratagene, Inc, La Jolla, Calif.) and then
robed using QUICKHYB.TM. hybridization solution (Stratagene, La
Jolla, Calif.) using manufacturer's recommendations for stringent
conditions.
[0207] To detect human BCL2-associated X protein, a human
BCL2-associated X protein specific probe was prepared by PCR using
the forward primer CCGCCGTGGACACAGACT (SEQ ID NO: 4) and the
reverse primer CCGGCCCCAGTTGAAGTT (SEQ ID NO: 5). To normalize for
variations in loading and transfer efficiency membranes were
stripped and probed for human glyceraldehyde-3-phosphate
dehydrogenase (GAPDH) RNA (Clontech, Palo Alto, Calif.).
[0208] To detect mouse BCL2-associated X protein, a mouse
BCL2-associated X protein specific probe was prepared by PCR using
the forward primer AGACACCTGAGCTGACCTTGGA (SEQ ID NO:11) and the
reverse primer GAGACACTCGCTCAGCTTCTTG (SEQ ID NO: 12). To normalize
for variations in loading and transfer efficiency membranes were
stripped and probed for mouse glyceraldehyde-3-phosphate
dehydrogenase (GAPDH) RNA (Clontech, Palo Alto, Calif.).
[0209] Hybridized membranes were visualized and quantitated using a
PHOSPHORIMAGER.TM. and IMAGEQUANT.TM. Software V3.3 (Molecular
Dynamics, Sunnyvale, Calif.). Data was normalized to GAPDH levels
in untreated controls.
Example 15
Antisense Inhibition of Human BCL2-Associated X Protein Expression
by Chimeric Phosphorothioate Oligonucleotides having 2'-MOE Wings
and a Deoxy Gap
[0210] In accordance with the present invention, a series of
oligonucleotides were designed to target different regions of the
human BCL2-associated X protein RNA, using published sequences
(GenBank accession number NM.sub.--004324 representing the splice
variant BAX-beta and incorporated herein as SEQ ID NO: 3, GenBank
accession number AF007826 representing the splice variant
BAX-epsilon and incorporated herein as SEQ ID NO: 17, GenBank
accession number L22473 representing the splice variant BAX-alpha
and incorporated herein as SEQ ID NO: 18, GenBank accession number
AI382305, the complement of which represents a genomic portion of
the splice variant BAX-delta and incorporated herein as SEQ ID NO:
19, GenBank accession number AF008195 representing a genomic
portion of the splice variant BAX-epsilon and incorporated herein
as SEQ ID NO: 20, GenBank accession number AF008196 representing
the splice variant BAX-omega and incorporated herein as SEQ ID NO:
21, and GenBank accession number L22475 representing the splice
variant BAX-gamma and incorporated herein as SEQ ID NO: 22). The
oligonucleotides are shown in Table 1. "Target site" indicates the
first (5'-most) nucleotide number on the particular target sequence
to which the oligonucleotide binds. All compounds in Table 1 are
chimeric oligonucleotides ("gapmers") 20 nucleotides in length,
composed of a central "gap" region consisting of ten
2'-deoxynucleotides, which is flanked on both sides (5' and 3'
directions) by five-nucleotide "wings". The wings are composed of
2'-methoxyethyl (2'-MOE)nucleotides. The internucleoside (backbone)
linkages are phosphorothioate (P.dbd.S) throughout the
oligonucleotide. All cytidine residues are 5-methylcytidines. The
compounds were analyzed for their effect on human BCL2-associated X
protein mRNA levels by quantitative real-time PCR as described in
other examples herein. Data are averages from two experiments. If
present, "N.D." indicates "no data".
TABLE-US-00001 TABLE 1 Inhibition of human BCL2-associated X
protein mRNA levels by chimeric phosphorothioate oligonucleotides
having 2'-MOE wings and a deoxy gap TARGET SEQ SEQ TARGET ID ISIS #
REGION ID NO SITE SEQUENCE % INHIB NO 134282 Coding 3 561
tccagaaggcccagggtccc 51 23 134283 Coding 3 615 tatagaccacatctgatgat
56 24 134284 Coding 3 627 aggaaaacgcattatagacc 59 25 134285 Coding
17 6 tgggctgctccccggacccg 80 26 134286 Coding 17 32
ctcagagctggtgggccccc 32 27 134287 Coding 17 38 gatctgctcagagctggtgg
58 28 134288 Coding 17 50 ccctgtcttcatgatctgct 83 29 134289 Coding
17 51 cccctgtcttcatgatctgc 77 30 134290 Coding 17 52
gcccctgtcttcatgatctg 57 31 134291 Coding 17 54 gggcccctgtcttcatgatc
17 32 134292 Coding 17 58 aaaagggcccctgtcttcat 40 33 134293 Coding
17 70 aaaccctgaagcaaaagggc 54 34 134294 Coding 17 71
gaaaccctgaagcaaaaggg 42 35 134295 Coding 17 77 ctggatgaaaccctgaagca
15 36 134296 Coding 17 78 cctggatgaaaccctgaagc 44 37 134297 Coding
17 79 tcctggatgaaaccctgaag 29 38 134298 Coding 17 82
cgatcctggatgaaaccctg 58 39 134299 Coding 17 85 gctcgatcctggatgaaacc
67 40 134300 Coding 17 87 ctgctcgatcctggatgaaa 62 41 134301 Coding
17 90 gccctgctcgatcctggatg 71 42 134302 Coding 17 146
ggacgcatcctgaggcaccg 71 43 134303 Coding 17 147
tggacgcatcctgaggcacc 65 44 134304 Coding 17 155
cttcttggtggacgcatcct 69 45 134305 Coding 17 163
tcgctcagcttcttggtgga 32 46 134306 Coding 17 167
acactcgctcagcttcttgg 69 47 134307 Coding 17 168
gacactcgctcagcttcttg 78 48 134308 Coding 17 170
gagacactcgctcagcttct 57 49 134309 Coding 17 209
cagctccatgttactgtcca 71 50 134310 Coding 17 211
tgcagctccatgttactgtc 59 51 134311 Coding 17 214
ctctgcagctccatgttact 48 52 134312 Coding 17 220
atcatcctctgcagctccat 72 53 134313 Coding 17 224
ggcaatcatcctctgcagct 61 54 134314 Coding 17 226
gcggcaatcatcctctgcag 23 55 134315 Coding 17 227
ggcggcaatcatcctctgca 30 56 134316 Coding 17 237
ctgtgtccacggcggcaatc 76 57 134317 Coding 17 239
gtctgtgtccacggcggcaa 81 58 134318 Coding 17 263
tcggaaaaagacctctcggg 73 59 134319 Coding 17 271
gctgccactcggaaaaagac 69 60 134320 Coding 17 275
gtcagctgccactcggaaaa 77 61 134321 Coding 17 286
tcagaaaacatgtcagctgc 49 62 134322 Coding 17 292
ttgccgtcagaaaacatgtc 64 63 134323 Coding 17 305
gccccagttgaagttgccgt 84 64 134324 Coding 17 307
cggccccagttgaagttgcc 56 65 134325 Coding 17 331
gcaaagtagaaaagggcgac 43 66 134326 Stop 17 485 tggttctgatcagttccggc
51 67 Codon 134327 Stop 17 492 cccatgatggttctgatcag 52 68 Codon
134328 3'UTR 17 499 tgtccagcccatgatggttc 73 69 134329 3'UTR 17 517
ctcccggaggaagtccaatg 71 70 134330 3'UTR 17 521 gccgctcccggaggaagtcc
72 71 134331 3'UTR 17 541 gtcttggatccagcccaaca 57 72 134332 3'UTR
17 549 ccaccctggtcttggatcca 49 73 134333 3'UTR 17 556
gtcccaaccaccctggtctt 44 74 134334 3'UTR 17 564 aggaggccgtcccaaccacc
55 75 134335 3'UTR 17 571 gtaggagaggaggccgtccc 67 76 134336 3'UTR
17 605 agatggtcacggtctgccac 79 77 134337 3'UTR 17 607
aaagatggtcacggtctgcc 74 78 134338 3'UTR 17 613 cgccacaaagatggtcacgg
82 79 134339 3'UTR 17 645 ttccagatggtgagcgaggc 64 80 134340 3'UTR
17 647 tcttccagatggtgagcgag 55 81 134341 3'UTR 17 649
cttcttccagatggtgagcg 46 82 134342 3'UTR 17 652 catcttcttccagatggtga
52 83 134343 3'UTR 17 657 cagcccatcttcttccagat 49 84 134344 Coding
18 359 gcacagggccttgagcacca 68 85 134345 3'UTR 19 133
aatgcccatgtcccccaatc 66 86 134346 3'UTR 19 182 ctcaagaccacttttcccca
8 87 134347 3'UTR 19 213 tttttgggtcccgaaggagg 24 88 134348 Exon 4
20 91 cccaccttgagcaccagttt 71 89 134349 Exon 4 20 96
agctgcccaccttgagcacc 68 90 134350 Intron 4 20 261
tccagtaaatgcttgttgaa 74 91 134351 Intron 4 20 357
tcacccctgcacgtgaactc 67 92 134352 Intron 4 20 483
tgaaccaagatcatgccatt 7 93 134353 Intron 4 20 497
ggcagaggttgcagtgaacc 58 94 134354 Intron 21 197
caaatccgtcttccaaataa 1 95 134355 Intron 21 405 aggttgcgccattgcactcc
53 96 134356 Intron 21 490 tggcacatgcctgtaatccc 52 97 134357 Intron
21 511 atacaaaattaccgggcgtg 0 98 134358 Intron 21 796
cttggtgcacagggcctgtg 17 99 134359 Coding 22 22 gatgaaaccccgcctctggg
35 100
[0211] As shown in Table 1, SEQ ID NOs 23, 24, 25, 26, 28, 29, 30,
31, 33, 34, 35, 37, 39, 40, 41, 42, 43, 44, 45, 47, 48, 49, 50, 51,
52, 53, 54, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70,
71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 89,
90, 91, 92, 94, 96 and 97 demonstrated at least 40% inhibition of
human BCL2-associated X protein expression in this assay and are
therefore preferred. The target sites to which these preferred
sequences are complementary are herein referred to as "active
sites" and are therefore preferred sites for targeting by compounds
of the present invention.
Example 16
Targeting of Individual Oligonucleotides to Specific Variants of
BCL2-Associated X Protein
[0212] In one embodiment of the present invention are
oligonucleotides that target specific isoforms of BCL2-associated X
protein. A summary of the target sites of the variants ALPHA, BETA,
GAMMA, DELTA, EPSILON AND OMEGA for each individual oligonucleotide
is given in Table 2.
TABLE-US-00002 TABLE 2 Targeting of individual oligonucleotides to
specific variants of BCL2-associated X protein SEQ ID TARGET ISIS #
NO SITE VARIANT TARGET SEQ ID 134282 23 561 BETA 3 134283 24 615
BETA 3 134284 25 627 BETA 3 134285 26 6 ALPHA 18 134285 26 6 BETA 3
134285 26 6 GAMMA 22 134285 26 6 EPSILON 17 134286 27 32 ALPHA 18
134286 27 32 BETA 3 134286 27 32 EPSILON 17 134287 28 38 ALPHA 18
134287 28 38 BETA 3 134287 28 38 EPSILON 17 134288 29 50 ALPHA 18
134288 29 50 BETA 3 134288 29 50 EPSILON 17 134289 30 51 ALPHA 18
134289 30 51 BETA 3 134289 30 51 EPSILON 17 134290 31 52 ALPHA 18
134290 31 52 BETA 3 134290 31 52 EPSILON 17 134291 32 54 ALPHA 18
134291 32 54 BETA 3 134291 32 54 EPSILON 17 134292 33 58 ALPHA 18
134292 33 58 BETA 3 134292 33 58 EPSILON 17 134293 34 70 ALPHA 18
134293 34 70 BETA 3 134293 34 70 EPSILON 17 134294 35 71 ALPHA 18
134294 35 71 BETA 3 134294 35 71 EPSILON 17 134295 36 77 ALPHA 18
134295 36 77 BETA 3 134295 36 77 EPSILON 17 134296 37 78 ALPHA 18
134296 37 78 BETA 3 134296 37 78 EPSILON 17 134297 38 79 ALPHA 18
134297 38 79 BETA 3 134297 38 79 EPSILON 17 134298 39 82 ALPHA 18
134298 39 82 BETA 3 134298 39 82 EPSILON 17 134299 40 85 ALPHA 18
134299 40 85 BETA 3 134299 40 33 GAMMA 22 134299 40 85 EPSILON 17
134300 41 87 ALPHA 18 134300 41 87 BETA 3 134300 41 35 GAMMA 22
134300 41 87 EPSILON 17 134301 42 90 ALPHA 18 134301 42 90 BETA 3
134301 42 38 GAMMA 22 134301 42 90 EPSILON 17 134302 43 146 ALPHA
18 134302 43 146 BETA 3 134302 43 94 GAMMA 22 134302 43 146 EPSILON
17 134303 44 147 ALPHA 18 134303 44 147 BETA 3 134303 44 95 GAMMA
22 134303 44 147 EPSILON 17 134304 45 155 ALPHA 18 134304 45 155
BETA 3 134304 45 103 GAMMA 22 134304 45 155 EPSILON 17 134305 46
163 ALPHA 18 134305 46 163 BETA 3 134305 46 163 EPSILON 17 134306
47 167 ALPHA 18 134306 47 167 BETA 3 134306 47 167 EPSILON 17
134307 48 168 ALPHA 18 134307 48 168 BETA 3 134307 48 168 EPSILON
17 134308 49 170 ALPHA 18 134308 49 170 BETA 3 134308 49 170
EPSILON 17 134309 50 209 ALPHA 18 134309 50 209 BETA 3 134309 50
209 EPSILON 17 134310 51 211 ALPHA 18 134310 51 211 BETA 3 134310
51 211 EPSILON 17 134311 52 214 ALPHA 18 134311 52 214 BETA 3
134311 52 214 EPSILON 17 134312 53 220 ALPHA 18 134312 53 220 BETA
3 134312 53 220 EPSILON 17 134313 54 224 ALPHA 18 134313 54 224
BETA 3 134313 54 224 EPSILON 17 134314 55 226 ALPHA 18 134314 55
226 BETA 3 134314 55 226 EPSILON 17 134315 56 227 ALPHA 18 134315
56 227 BETA 3 134315 56 227 EPSILON 17 134316 57 237 ALPHA 18
134316 57 237 BETA 3 134316 57 237 EPSILON 17 134317 58 239 ALPHA
18 134317 58 239 BETA 3 134317 58 239 EPSILON 17 134318 59 263
ALPHA 18 134318 59 263 BETA 3 134318 59 263 EPSILON 17 134319 60
271 ALPHA 18 134319 60 271 BETA 3 134319 60 271 EPSILON 17 134319
60 7 EPSILON 20 134320 61 275 ALPHA 18 134320 61 275 BETA 3 134320
61 275 EPSILON 17 134320 61 11 EPSILON 20 134321 62 286 ALPHA 18
134321 62 286 BETA 3 134321 62 286 EPSILON 17 134321 62 22 EPSILON
20 134322 63 292 ALPHA 18 134322 63 292 BETA 3 134322 63 292
EPSILON 17 134322 63 28 EPSILON 20 134323 64 305 ALPHA 18 134323 64
305 BETA 3 134323 64 305 EPSILON 17 134323 64 41 EPSILON 20 134324
65 307 ALPHA 18 134324 65 307 BETA 3 134324 65 307 EPSILON 17
134324 65 43 EPSILON 20 134325 66 331 ALPHA 18 134325 66 331 BETA 3
134325 66 331 EPSILON 17 134325 66 67 EPSILON 20 134326 67 387
ALPHA 18 134326 67 387 BETA 3 134326 67 485 EPSILON 17 134327 68
394 ALPHA 18 134327 68 394 BETA 3 134327 68 492 EPSILON 17 134328
69 401 ALPHA 18 134328 69 401 BETA 3 134328 69 499 EPSILON 17
134329 70 419 ALPHA 18 134329 70 419 BETA 3 134329 70 517 EPSILON
17 134330 71 423 ALPHA 18 134330 71 423 BETA 3 134330 71 521
EPSILON 17 134331 72 443 ALPHA 18 134331 72 443 BETA 3 134331 72
541 EPSILON 17 134332 73 451 ALPHA 18 134332 73 451 BETA 3 134332
73 549 EPSILON 17 134333 74 458 ALPHA 18 134333 74 556 EPSILON 17
134334 75 466 ALPHA 18 134334 75 564 EPSILON 17 134335 76 473 ALPHA
18 134335 76 571 EPSILON 17 134336 77 507 ALPHA 18 134336 77 605
EPSILON 17 134337 78 509 ALPHA 18 134337 78 607 EPSILON 17 134338
79 515 ALPHA 18 134338 79 613 EPSILON 17 134339 80 547 ALPHA 18
134339 80 645 EPSILON 17 134340 81 549 ALPHA 18 134340 81 647
EPSILON 17 134341 82 551 ALPHA 18 134341 82 649 EPSILON 17 134342
83 554 ALPHA 18 134342 83 652 EPSILON 17 134343 84 559 ALPHA 18
134343 84 657 EPSILON 17 134344 85 359 ALPHA 18 134344 85 359 BETA
3 134345 86 133 DELTA 19 134346 87 182 DELTA 19 134347 88 213 DELTA
19 134348 89 91 EPSILON 20 134349 90 96 EPSILON 20 134350 91 261
EPSILON 20 134351 92 357 EPSILON 20 134352 93 483 EPSILON 20 134353
94 497 EPSILON 20 134354 95 197 OMEGA 21 134355 96 405 OMEGA 21
134356 97 490 OMEGA 21 134357 98 511 OMEGA 21 134358 99 796 OMEGA
21 134359 100 22 GAMMA 22
Example 17
Antisense Inhibition of Mouse BCL2-Associated X Protein Expression
by Chimeric Phosphorothioate Oligonucleotides having 2'-MOE Wings
and a Deoxy Gap
[0213] In accordance with the present invention, a second series of
oligonucleotides were designed to target different regions of the
mouse BCL2-associated X protein RNA, using published sequences
(GenBank accession number NM.sub.--007527, incorporated herein as
SEQ ID NO: 10, GenBank accession number AB029557, incorporated
herein as SEQ ID NO: 101, and GenBank accession number AA104861, an
EST suggesting a splice variant that diverges at nucleotide 34 of
GenBank accession number NM.sub.--007527, incorporated herein as
SEQ ID NO: 102). The oligonucleotides are shown in Table 3. "Target
site" indicates the first (5'-most) nucleotide number on the
particular target sequence to which the oligonucleotide binds. All
compounds in Table 3 are chimeric oligonucleotides ("gapmers") 20
nucleotides in length, composed of a central "gap" region
consisting of ten 2'-deoxynucleotides, which is flanked on both
sides (5' and 3' directions) by five-nucleotide "wings". The wings
are composed of 2'-methoxyethyl (2'-MOE)nucleotides. The
internucleoside (backbone) linkages are phosphorothioate (P.dbd.S)
throughout the oligonucleotide. All cytidine residues are
5-methylcytidines. The compounds were analyzed for their effect on
mouse BCL2-associated X protein mRNA levels by quantitative
real-time PCR as described in other examples herein. Data are
averages from two experiments. If present, "N.D." indicates "no
data".
TABLE-US-00003 TABLE 3 Inhibition of mouse BCL2-associated X
protein mRNA levels by chimeric phosphorothioate oligonucleotides
having 2'-MOE wings and a deoxy gap TARGET SEQ SEQ TARGET ID ISIS #
REGION ID NO SITE SEQUENCE % INHIB NO 134290 Coding 10 52
gcccctgtcttcatgatctg 43 31 134298 Coding 10 82 cgatcctggatgaaaccctg
56 39 134300 Coding 10 87 ctgctcgatcctggatgaaa 54 41 134305 Coding
10 163 tcgctcagcttcttggtgga 70 46 134307 Coding 10 168
gacactcgctcagcttcttg 66 48 134312 Coding 10 220
atcatcctctgcagctccat 32 53 134324 Coding 10 307
cggccccagttgaagttgcc 49 65 134327 Coding 10 394
cccatgatggttctgatcag 64 68 134328 Coding 10 401
tgtccagcccatgatggttc 16 69 134332 Coding 10 451
ccaccctggtcttggatcca 16 73 134342 Coding 10 554
catcttcttccagatggtga 58 83 134343 Stop 10 559 cagcccatcttcttccagat
76 84 Codon 134382 Coding 10 49 cctgtcttcatgatctgttc 48 103 134383
Coding 10 109 ggtgtctccccagccatcct 68 104 134384 Coding 10 116
cagctcaggtgtctccccag 61 105 134385 Coding 10 123
ccaaggtcagctcaggtgtc 64 106 134386 Coding 10 129
gctgctccaaggtcagctca 38 107 134387 Coding 10 134
gggcggctgctccaaggtca 34 108 134388 Coding 10 181
ccaattcgccggagacactc 49 109 134389 Coding 10 212
ctgcagctccatattgctat 62 110 134390 Coding 10 226
tcagcaatcatcctctgcag 51 111 134391 Coding 10 231
ccacgtcagcaatcatcctc 70 112 134392 Coding 10 238
tccgtgtccacgtcagcaat 63 113 134393 Coding 10 242
ggagtccgtgtccacgtcag 49 114 134394 Coding 10 269
tgccacccggaagaagacct 49 115 134395 Coding 10 283
gcaaacatgtcagctgccac 51 116 134396 Coding 10 292
ttgccatcagcaaacatgtc 45 117 134397 Coding 10 300
agttgaagttgccatcagca 57 118 134398 Coding 10 303
cccagttgaagttgccatca 42 119 134399 Coding 10 312
ccacgcggccccagttgaag 3 120 134400 Coding 10 340
agtttgctagcaaagtagaa 43 121 134401 Coding 10 348
tgagcaccagtttgctagca 71 122 134402 Coding 10 357
acagggccttgagcaccagt 31 123 134403 Coding 10 363
tagtgcacagggccttgagc 43 124 134404 Coding 10 365
tttagtgcacagggccttga 58 125 134405 Coding 10 374
ctcgggcactttagtgcaca 67 126 134406 Coding 10 376
agctcgggcactttagtgca 50 127 134407 Coding 10 380
gatcagctcgggcactttag 18 128 134408 Coding 10 387
tggttctgatcagctcgggc 49 129 134409 Coding 10 393
ccatgatggttctgatcagc 40 130 134410 Coding 10 409
aagtccagtgtccagcccat 54 131 134411 Coding 10 412
aggaagtccagtgtccagcc 73 132 134412 Coding 10 415
cggaggaagtccagtgtcca 16 133 134413 Coding 10 437
gatccagacaagcagccgct 37 134 134414 Coding 10 445
tggtcttggatccagacaag 39 135 134415 Coding 10 457
tcccagccaccctggtcttg 71 136 134416 Coding 10 505
atggtcactgtctgccatgt 61 137 134417 Coding 10 508
aagatggtcactgtctgcca 62 138 134418 Coding 10 514
gccacaaagatggtcactgt 67 139 134419 Coding 10 523
aggactccagccacaaagat 54 140 134420 Coding 10 533
cgaggcggtgaggactccag 46 141 134421 Coding 10 546
tccagatggtgagcgaggcg 48 142 134422 Coding 10 550
ttcttccagatggtgagcga 57 143 134423 Stop 10 560 tcagcccatcttcttccaga
54 144 Codon 134424 5'UTR 101 233 gcaggaccatctctctgagt 53 145
134425 5'UTR 101 264 tggtttgaaacctagcacac 32 146 134426 5'UTR 101
338 agatatgtccctgggccttg 48 147 134427 5'UTR 101 447
aaactagcacactgcttgac 16 148 134428 5'UTR 101 498
cctaccttggtttcccaaga 32 149 134429 5'UTR 101 655
gctgggattaaaggcgtgcg 46 150 134430 5'UTR 101 682
aaatccgcctgcctctgcct 31 151 134431 5'UTR 101 896
ggcctccaacatagagaacc 21 152 134432 5'UTR 101 1032
atctgggtgtcagaaagcct 28 153 134433 5'UTR 101 1303
cgcaggaaagtagatctctg 24 154 134434 5'UTR 101 1562
agcaagtgacaggtcaatta 22 155 134435 5'UTR 101 2077
aaacaggctgtacgcggtgg 19 156 134436 5'UTR 101 2210
agttgaccagagtgatggtc 38 157 134437 5'UTR 101 2530
gtcacgtgatcatcatcgct 47 158 134438 Start 101 2666
ggacccgtccatcactgccg 55 159 Codon 134439 Coding 102 107
actgcttctgatggacaggg 64 160 134440 Coding 102 116
ggcctggctactgcttctga 21 161 134441 Coding 102 124
gcatggaaggcctggctact 41 162 134442 Coding 102 137
gtagtgacaagtagcatgga 60 163 134443 Coding 102 143
accctagtagtgacaagtag 57 164 134444 Coding 102 178
taggctcataaccctgaggg 46 165 134445 Coding 102 187
atggataggtaggctcataa 48 166 134446 Coding 102 220
ctggactcctgggtcccagg 58 167 134447 Coding 102 263
tcagagctggtgggccctgg 62 168
[0214] As shown in Table 3, SEQ ID NOs 31, 39, 41, 46, 48, 65, 68,
83, 84, 103, 104, 105, 106, 109, 110, 111, 112, 113, 114, 115, 116,
117, 118, 119, 121, 122, 124, 125, 126, 127, 129, 130, 131, 132,
136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 147, 150, 158,
159, 160, 162, 163, 164, 165, 166, 167 and 168 demonstrated at
least 40% inhibition of mouse BCL2-associated X protein expression
in this experiment and are therefore preferred. The target sites to
which these preferred sequences are complementary are herein
referred to as "active sites" and are therefore preferred sites for
targeting by compounds of the present invention.
Example 18
Western Blot Analysis of BCL2-Associated X Protein Protein
Levels
[0215] Western blot analysis (immunoblot analysis) is carried out
using standard methods. Cells are harvested 16-20 h after
oligonucleotide treatment, washed once with PBS, suspended in
Laemmli buffer (100 ul/well), boiled for 5 minutes and loaded on a
16% SDS-PAGE gel. Gels are run for 1.5 hours at 150 V, and
transferred to membrane for western blotting. Appropriate primary
antibody directed to BCL2-associated X protein is used, with a
radiolabelled or fluorescently labeled secondary antibody directed
against the primary antibody species. Bands are visualized using a
PHOSPHORIMAGER.TM. (Molecular Dynamics, Sunnyvale Calif.).
Sequence CWU 1
1
168120DNAArtificial SequenceAntisense Oligonucleotide 1tccgtcatcg
ctcctcaggg 20220DNAArtificial SequenceAntisense Oligonucleotide
2atgcattctg cccccaagga 203657DNAHomo sapiensCDS(1)...(657) 3atg gac
ggg tcc ggg gag cag ccc aga ggc ggg ggg ccc acc agc tct 48Met Asp
Gly Ser Gly Glu Gln Pro Arg Gly Gly Gly Pro Thr Ser Ser1 5 10 15gag
cag atc atg aag aca ggg gcc ctt ttg ctt cag ggt ttc atc cag 96Glu
Gln Ile Met Lys Thr Gly Ala Leu Leu Leu Gln Gly Phe Ile Gln 20 25
30gat cga gca ggg cga atg ggg ggg gag gca ccc gag ctg gcc ctg gac
144Asp Arg Ala Gly Arg Met Gly Gly Glu Ala Pro Glu Leu Ala Leu Asp
35 40 45ccg gtg cct cag gat gcg tcc acc aag aag ctg agc gag tgt ctc
aag 192Pro Val Pro Gln Asp Ala Ser Thr Lys Lys Leu Ser Glu Cys Leu
Lys 50 55 60cgc atc ggg gac gaa ctg gac agt aac atg gag ctg cag agg
atg att 240Arg Ile Gly Asp Glu Leu Asp Ser Asn Met Glu Leu Gln Arg
Met Ile65 70 75 80gcc gcc gtg gac aca gac tcc ccc cga gag gtc ttt
ttc cga gtg gca 288Ala Ala Val Asp Thr Asp Ser Pro Arg Glu Val Phe
Phe Arg Val Ala 85 90 95gct gac atg ttt tct gac ggc aac ttc aac tgg
ggc cgg gtt gtc gcc 336Ala Asp Met Phe Ser Asp Gly Asn Phe Asn Trp
Gly Arg Val Val Ala 100 105 110ctt ttc tac ttt gcc agc aaa ctg gtg
ctc aag gcc ctg tgc acc aag 384Leu Phe Tyr Phe Ala Ser Lys Leu Val
Leu Lys Ala Leu Cys Thr Lys 115 120 125gtg ccg gaa ctg atc aga acc
atc atg ggc tgg aca ttg gac ttc ctc 432Val Pro Glu Leu Ile Arg Thr
Ile Met Gly Trp Thr Leu Asp Phe Leu 130 135 140cgg gag cgg ctg ttg
ggc tgg atc caa gac cag ggt ggt tgg gtg aga 480Arg Glu Arg Leu Leu
Gly Trp Ile Gln Asp Gln Gly Gly Trp Val Arg145 150 155 160ctc ctc
aag cct cct cac ccc cac cac cgc gcc ctc acc acc gcc cct 528Leu Leu
Lys Pro Pro His Pro His His Arg Ala Leu Thr Thr Ala Pro 165 170
175gcc cca ccg tcc ctg ccc ccc gcc act cct ctg gga ccc tgg gcc ttc
576Ala Pro Pro Ser Leu Pro Pro Ala Thr Pro Leu Gly Pro Trp Ala Phe
180 185 190tgg agc agg tca cag tgg tgc cct ctc ccc atc ttc aga tca
tca gat 624Trp Ser Arg Ser Gln Trp Cys Pro Leu Pro Ile Phe Arg Ser
Ser Asp 195 200 205gtg gtc tat aat gcg ttt tcc tta cgt gtc tga
657Val Val Tyr Asn Ala Phe Ser Leu Arg Val 210 215418DNAArtificial
SequencePCR Primer 4ccgccgtgga cacagact 18518DNAArtificial
SequencePCR Primer 5ccggccccag ttgaagtt 18625DNAArtificial
SequencePCR Probe 6cccgagaggt ctttttccga gtggc 25719DNAArtificial
SequencePCR Primer 7gaaggtgaag gtcggagtc 19820DNAArtificial
SequencePCR Primer 8gaagatggtg atgggatttc 20920DNAArtificial
SequencePCR Probe 9caagcttccc gttctcagcc 2010579DNAMus
musculusCDS(1)...(579) 10atg gac ggg tcc ggg gag cag ctt ggg agc
ggc ggg ccc acc agc tct 48Met Asp Gly Ser Gly Glu Gln Leu Gly Ser
Gly Gly Pro Thr Ser Ser1 5 10 15gaa cag atc atg aag aca ggg gcc ttt
ttg cta cag ggt ttc atc cag 96Glu Gln Ile Met Lys Thr Gly Ala Phe
Leu Leu Gln Gly Phe Ile Gln 20 25 30gat cga gca ggg agg atg gct ggg
gag aca cct gag ctg acc ttg gag 144Asp Arg Ala Gly Arg Met Ala Gly
Glu Thr Pro Glu Leu Thr Leu Glu 35 40 45cag ccg ccc cag gat gcg tcc
acc aag aag ctg agc gag tgt ctc cgg 192Gln Pro Pro Gln Asp Ala Ser
Thr Lys Lys Leu Ser Glu Cys Leu Arg 50 55 60cga att gga gat gaa ctg
gat agc aat atg gag ctg cag agg atg att 240Arg Ile Gly Asp Glu Leu
Asp Ser Asn Met Glu Leu Gln Arg Met Ile65 70 75 80gct gac gtg gac
acg gac tcc ccc cga gag gtc ttc ttc cgg gtg gca 288Ala Asp Val Asp
Thr Asp Ser Pro Arg Glu Val Phe Phe Arg Val Ala 85 90 95gct gac atg
ttt gct gat ggc aac ttc aac tgg ggc cgc gtg gtt gcc 336Ala Asp Met
Phe Ala Asp Gly Asn Phe Asn Trp Gly Arg Val Val Ala 100 105 110ctc
ttc tac ttt gct agc aaa ctg gtg ctc aag gcc ctg tgc act aaa 384Leu
Phe Tyr Phe Ala Ser Lys Leu Val Leu Lys Ala Leu Cys Thr Lys 115 120
125gtg ccc gag ctg atc aga acc atc atg ggc tgg aca ctg gac ttc ctc
432Val Pro Glu Leu Ile Arg Thr Ile Met Gly Trp Thr Leu Asp Phe Leu
130 135 140cgt gag cgg ctg ctt gtc tgg atc caa gac cag ggt ggc tgg
gaa ggc 480Arg Glu Arg Leu Leu Val Trp Ile Gln Asp Gln Gly Gly Trp
Glu Gly145 150 155 160ctc ctc tcc tac ttc ggg acc ccc aca tgg cag
aca gtg acc atc ttt 528Leu Leu Ser Tyr Phe Gly Thr Pro Thr Trp Gln
Thr Val Thr Ile Phe 165 170 175gtg gct gga gtc ctc acc gcc tcg ctc
acc atc tgg aag aag atg ggc 576Val Ala Gly Val Leu Thr Ala Ser Leu
Thr Ile Trp Lys Lys Met Gly 180 185 190tga 5791122DNAArtificial
SequencePCR Primer 11agacacctga gctgaccttg ga 221222DNAArtificial
SequencePCR Primer 12gagacactcg ctcagcttct tg 221319DNAArtificial
SequencePCR Probe 13agccgcccca ggatgcgtc 191420DNAArtificial
SequencePCR Primer 14ggcaaattca acggcacagt 201520DNAArtificial
SequencePCR Primer 15gggtctcgct cctggaagat 201627DNAArtificial
SequencePCR Probe 16aaggccgaga atgggaagct tgtcatc 2717677DNAHomo
sapiensCDS(1)...(495) 17atg gac ggg tcc ggg gag cag ccc aga ggc ggg
ggg ccc acc agc tct 48Met Asp Gly Ser Gly Glu Gln Pro Arg Gly Gly
Gly Pro Thr Ser Ser1 5 10 15gag cag atc atg aag aca ggg gcc ctt ttg
ctt cag ggt ttc atc cag 96Glu Gln Ile Met Lys Thr Gly Ala Leu Leu
Leu Gln Gly Phe Ile Gln 20 25 30gat cga gca ggg cga atg ggg ggg gag
gca ccc gag ctg gcc ctg gac 144Asp Arg Ala Gly Arg Met Gly Gly Glu
Ala Pro Glu Leu Ala Leu Asp 35 40 45ccg gtg cct cag gat gcg tcc acc
aag aag ctg agc gag tgt ctc aag 192Pro Val Pro Gln Asp Ala Ser Thr
Lys Lys Leu Ser Glu Cys Leu Lys 50 55 60cgc atc ggg gac gaa ctg gac
agt aac atg gag ctg cag agg atg att 240Arg Ile Gly Asp Glu Leu Asp
Ser Asn Met Glu Leu Gln Arg Met Ile65 70 75 80gcc gcc gtg gac aca
gac tcc ccc cga gag gtc ttt ttc cga gtg gca 288Ala Ala Val Asp Thr
Asp Ser Pro Arg Glu Val Phe Phe Arg Val Ala 85 90 95gct gac atg ttt
tct gac ggc aac ttc aac tgg ggc cgg gtt gtc gcc 336Ala Asp Met Phe
Ser Asp Gly Asn Phe Asn Trp Gly Arg Val Val Ala 100 105 110ctt ttc
tac ttt gcc agc aaa ctg gtg ctc aag gct ggc gtg aaa tgg 384Leu Phe
Tyr Phe Ala Ser Lys Leu Val Leu Lys Ala Gly Val Lys Trp 115 120
125cgt gat ctg ggc tca ctg caa cct ctg cct cct ggg ttc aag cga ttc
432Arg Asp Leu Gly Ser Leu Gln Pro Leu Pro Pro Gly Phe Lys Arg Phe
130 135 140acc tgc ctc agc atc cca agg agc tgg gat tac agg ccc tgt
gca cca 480Thr Cys Leu Ser Ile Pro Arg Ser Trp Asp Tyr Arg Pro Cys
Ala Pro145 150 155 160agg tgc cgg aac tga tcagaaccat catgggctgg
acattggact tcctccggga 535Arg Cys Arg Asn 165gcggctgttg ggctggatcc
aagaccaggg tggttgggac ggcctcctct cctactttgg 595gacgcccacg
tggcagaccg tgaccatctt tgtggcggga gtgctcaccg cctcgctcac
655catctggaag aagatgggct ga 67718579DNAHomo sapiensCDS(1)...(579)
18atg gac ggg tcc ggg gag cag ccc aga ggc ggg ggg ccc acc agc tct
48Met Asp Gly Ser Gly Glu Gln Pro Arg Gly Gly Gly Pro Thr Ser Ser1
5 10 15gag cag atc atg aag aca ggg gcc ctt ttg ctt cag ggt ttc atc
cag 96Glu Gln Ile Met Lys Thr Gly Ala Leu Leu Leu Gln Gly Phe Ile
Gln 20 25 30gat cga gca ggg cga atg ggg ggg gag gca ccc gag ctg gcc
ctg gac 144Asp Arg Ala Gly Arg Met Gly Gly Glu Ala Pro Glu Leu Ala
Leu Asp 35 40 45ccg gtg cct cag gat gcg tcc acc aag aag ctg agc gag
tgt ctc aag 192Pro Val Pro Gln Asp Ala Ser Thr Lys Lys Leu Ser Glu
Cys Leu Lys 50 55 60cgc atc ggg gac gaa ctg gac agt aac atg gag ctg
cag agg atg att 240Arg Ile Gly Asp Glu Leu Asp Ser Asn Met Glu Leu
Gln Arg Met Ile65 70 75 80gcc gcc gtg gac aca gac tcc ccc cga gag
gtc ttt ttc cga gtg gca 288Ala Ala Val Asp Thr Asp Ser Pro Arg Glu
Val Phe Phe Arg Val Ala 85 90 95gct gac atg ttt tct gac ggc aac ttc
aac tgg ggc cgg gtt gtc gcc 336Ala Asp Met Phe Ser Asp Gly Asn Phe
Asn Trp Gly Arg Val Val Ala 100 105 110ctt ttc tac ttt gcc agc aaa
ctg gtg ctc aag gcc ctg tgc acc aag 384Leu Phe Tyr Phe Ala Ser Lys
Leu Val Leu Lys Ala Leu Cys Thr Lys 115 120 125gtg ccg gaa ctg atc
aga acc atc atg ggc tgg aca ttg gac ttc ctc 432Val Pro Glu Leu Ile
Arg Thr Ile Met Gly Trp Thr Leu Asp Phe Leu 130 135 140cgg gag cgg
ctg ttg ggc tgg atc caa gac cag ggt ggt tgg gac ggc 480Arg Glu Arg
Leu Leu Gly Trp Ile Gln Asp Gln Gly Gly Trp Asp Gly145 150 155
160ctc ctc tcc tac ttt ggg acg ccc acg tgg cag acc gtg acc atc ttt
528Leu Leu Ser Tyr Phe Gly Thr Pro Thr Trp Gln Thr Val Thr Ile Phe
165 170 175gtg gcg gga gtg ctc acc gcc tcg ctc acc atc tgg aag aag
atg ggc 576Val Ala Gly Val Leu Thr Ala Ser Leu Thr Ile Trp Lys Lys
Met Gly 180 185 190tga 57919263DNAHomo sapiens 19accgtgacca
tctttgtggc gggagtgctc cccccctcac tccccatttg gaaaaaaatg 60ggctgaggcc
cccagctgcc ttggactgtg tttttccccc ataaattatg gcattttttt
120gggaggggtg gggattgggg gacatgggca tttttcttac ttttgtaatt
attggggggt 180gtggggaaaa gtggtcttga gggggtaata aacctccttc
gggacccaaa aaaaaaaaaa 240aaaaaaaaaa aaaaaaaaaa aaa 26320531DNAHomo
sapiens 20cgagaggtct ttttccgagt ggcagctgac atgttttctg acggcaactt
caactggggc 60cgggttgtcg cccttttcta ctttgccagc aaactggtgc tcaaggtggg
cagctgcagg 120gcagtgagcc cagggatgct ccccctcaga tctgtgagga
cctggggatc gtggtatcaa 180ccccctgcag tggcccagtg accacagagg
gcatggagag agatggctgt gcactgggtg 240tctgctcctt cttttattca
ttcaacaagc atttactgga cctgctatgt gccaggccta 300tacctggcac
ctgggacaca gcactgtaca aagcaggcta catccctgct ctcagggagt
360tcacgtgcag gggtgaagta aagtgggcag agtgatttag cagagtggac
aggaaagatt 420tctatttttt tttttttttt ttttgagatg gagttttgct
cttgttgccc aggcttgagt 480gcaatggcat gatcttggtt cactgcaacc
tctgcctccc aggttcaagc g 53121822DNAHomo sapiens 21gagaggccta
aaaggggagg agtcgggggg gggcgaccga aacatgaagt ggaaaggtgg 60ggtcaggcca
aggcgaggca acaaggggtt gggggggcac agtgctggtt cttatcgggg
120gtaaggggag ccacagaggg tcaggggggg ggcagttgga gagtaacaat
cttgttgaca 180attttatgtt ttatatttat ttggaagacg gatttgctta
tctccaaggc tggcgtgaaa 240tggcgtgatc tgggctcact gcaacctctg
cctcctgggt tcaagcgatt cacctgcctc 300agcatcccaa ggagctggga
ttacaggtgc ctgccaccac acccagctaa tttttgtatt 360tatttatttt
agagatggag ttttgctctt gttgtgccca ggctggagtg caatggcgca
420acctcggctc actgcaacct ccgcctcccg ggttcaagca attctcctgc
ctcagactcc 480caagtagctg ggattacagg catgtgccac cacgcccggt
aattttgtat ttttagtaga 540gatggcatta ctcccgtaat tggtcaggct
ggttttgaat ccggacttca agtgattccg 600ctgccttggc cttcccaaag
tgctgggatt acaggcatga gccgccgcac ctggccatgt 660ttacaatttt
tgaagccgat tcaattgtgg gtggcagaaa ttttgagggg aggcaaagaa
720ttgacaaagg aggtttgggg ccactatctc aggcagtggg gacaaggttc
agtccctaac 780gcccactcca ctccccacag gccctgtgca ccaaggtgcc gg
82222126DNAHomo sapiensCDS(1)...(126) 22atg gac ggg tcc ggg gag cag
ccc aga ggc ggg gtt tca tcc agg atc 48Met Asp Gly Ser Gly Glu Gln
Pro Arg Gly Gly Val Ser Ser Arg Ile1 5 10 15gag cag ggc gaa tgg ggg
ggg agg cac ccg agc tgg ccc tgg acc cgg 96Glu Gln Gly Glu Trp Gly
Gly Arg His Pro Ser Trp Pro Trp Thr Arg 20 25 30tgc ctc agg atg cgt
cca cca aga agc tga 126Cys Leu Arg Met Arg Pro Pro Arg Ser 35
402320DNAArtificial SequenceAntisense Oligonucleotide 23tccagaaggc
ccagggtccc 202420DNAArtificial SequenceAntisense Oligonucleotide
24tatagaccac atctgatgat 202520DNAArtificial SequenceAntisense
Oligonucleotide 25aggaaaacgc attatagacc 202620DNAArtificial
SequenceAntisense Oligonucleotide 26tgggctgctc cccggacccg
202720DNAArtificial SequenceAntisense Oligonucleotide 27ctcagagctg
gtgggccccc 202820DNAArtificial SequenceAntisense Oligonucleotide
28gatctgctca gagctggtgg 202920DNAArtificial SequenceAntisense
Oligonucleotide 29ccctgtcttc atgatctgct 203020DNAArtificial
SequenceAntisense Oligonucleotide 30cccctgtctt catgatctgc
203120DNAArtificial SequenceAntisense Oligonucleotide 31gcccctgtct
tcatgatctg 203220DNAArtificial SequenceAntisense Oligonucleotide
32gggcccctgt cttcatgatc 203320DNAArtificial SequenceAntisense
Oligonucleotide 33aaaagggccc ctgtcttcat 203420DNAArtificial
SequenceAntisense Oligonucleotide 34aaaccctgaa gcaaaagggc
203520DNAArtificial SequenceAntisense Oligonucleotide 35gaaaccctga
agcaaaaggg 203620DNAArtificial SequenceAntisense Oligonucleotide
36ctggatgaaa ccctgaagca 203720DNAArtificial SequenceAntisense
Oligonucleotide 37cctggatgaa accctgaagc 203820DNAArtificial
SequenceAntisense Oligonucleotide 38tcctggatga aaccctgaag
203920DNAArtificial SequenceAntisense Oligonucleotide 39cgatcctgga
tgaaaccctg 204020DNAArtificial SequenceAntisense Oligonucleotide
40gctcgatcct ggatgaaacc 204120DNAArtificial SequenceAntisense
Oligonucleotide 41ctgctcgatc ctggatgaaa 204220DNAArtificial
SequenceAntisense Oligonucleotide 42gccctgctcg atcctggatg
204320DNAArtificial SequenceAntisense Oligonucleotide 43ggacgcatcc
tgaggcaccg 204420DNAArtificial SequenceAntisense Oligonucleotide
44tggacgcatc ctgaggcacc 204520DNAArtificial SequenceAntisense
Oligonucleotide 45cttcttggtg gacgcatcct 204620DNAArtificial
SequenceAntisense Oligonucleotide 46tcgctcagct tcttggtgga
204720DNAArtificial SequenceAntisense Oligonucleotide 47acactcgctc
agcttcttgg 204820DNAArtificial SequenceAntisense Oligonucleotide
48gacactcgct cagcttcttg 204920DNAArtificial SequenceAntisense
Oligonucleotide 49gagacactcg ctcagcttct 205020DNAArtificial
SequenceAntisense Oligonucleotide 50cagctccatg ttactgtcca
205120DNAArtificial SequenceAntisense Oligonucleotide 51tgcagctcca
tgttactgtc 205220DNAArtificial SequenceAntisense Oligonucleotide
52ctctgcagct ccatgttact
205320DNAArtificial SequenceAntisense Oligonucleotide 53atcatcctct
gcagctccat 205420DNAArtificial SequenceAntisense Oligonucleotide
54ggcaatcatc ctctgcagct 205520DNAArtificial SequenceAntisense
Oligonucleotide 55gcggcaatca tcctctgcag 205620DNAArtificial
SequenceAntisense Oligonucleotide 56ggcggcaatc atcctctgca
205720DNAArtificial SequenceAntisense Oligonucleotide 57ctgtgtccac
ggcggcaatc 205820DNAArtificial SequenceAntisense Oligonucleotide
58gtctgtgtcc acggcggcaa 205920DNAArtificial SequenceAntisense
Oligonucleotide 59tcggaaaaag acctctcggg 206020DNAArtificial
SequenceAntisense Oligonucleotide 60gctgccactc ggaaaaagac
206120DNAArtificial SequenceAntisense Oligonucleotide 61gtcagctgcc
actcggaaaa 206220DNAArtificial SequenceAntisense Oligonucleotide
62tcagaaaaca tgtcagctgc 206320DNAArtificial SequenceAntisense
Oligonucleotide 63ttgccgtcag aaaacatgtc 206420DNAArtificial
SequenceAntisense Oligonucleotide 64gccccagttg aagttgccgt
206520DNAArtificial SequenceAntisense Oligonucleotide 65cggccccagt
tgaagttgcc 206620DNAArtificial SequenceAntisense Oligonucleotide
66gcaaagtaga aaagggcgac 206720DNAArtificial SequenceAntisense
Oligonucleotide 67tggttctgat cagttccggc 206820DNAArtificial
SequenceAntisense Oligonucleotide 68cccatgatgg ttctgatcag
206920DNAArtificial SequenceAntisense Oligonucleotide 69tgtccagccc
atgatggttc 207020DNAArtificial SequenceAntisense Oligonucleotide
70ctcccggagg aagtccaatg 207120DNAArtificial SequenceAntisense
Oligonucleotide 71gccgctcccg gaggaagtcc 207220DNAArtificial
SequenceAntisense Oligonucleotide 72gtcttggatc cagcccaaca
207320DNAArtificial SequenceAntisense Oligonucleotide 73ccaccctggt
cttggatcca 207420DNAArtificial SequenceAntisense Oligonucleotide
74gtcccaacca ccctggtctt 207520DNAArtificial SequenceAntisense
Oligonucleotide 75aggaggccgt cccaaccacc 207620DNAArtificial
SequenceAntisense Oligonucleotide 76gtaggagagg aggccgtccc
207720DNAArtificial SequenceAntisense Oligonucleotide 77agatggtcac
ggtctgccac 207820DNAArtificial SequenceAntisense Oligonucleotide
78aaagatggtc acggtctgcc 207920DNAArtificial SequenceAntisense
Oligonucleotide 79cgccacaaag atggtcacgg 208020DNAArtificial
SequenceAntisense Oligonucleotide 80ttccagatgg tgagcgaggc
208120DNAArtificial SequenceAntisense Oligonucleotide 81tcttccagat
ggtgagcgag 208220DNAArtificial SequenceAntisense Oligonucleotide
82cttcttccag atggtgagcg 208320DNAArtificial SequenceAntisense
Oligonucleotide 83catcttcttc cagatggtga 208420DNAArtificial
SequenceAntisense Oligonucleotide 84cagcccatct tcttccagat
208520DNAArtificial SequenceAntisense Oligonucleotide 85gcacagggcc
ttgagcacca 208620DNAArtificial SequenceAntisense Oligonucleotide
86aatgcccatg tcccccaatc 208720DNAArtificial SequenceAntisense
Oligonucleotide 87ctcaagacca cttttcccca 208820DNAArtificial
SequenceAntisense Oligonucleotide 88tttttgggtc ccgaaggagg
208920DNAArtificial SequenceAntisense Oligonucleotide 89cccaccttga
gcaccagttt 209020DNAArtificial SequenceAntisense Oligonucleotide
90agctgcccac cttgagcacc 209120DNAArtificial SequenceAntisense
Oligonucleotide 91tccagtaaat gcttgttgaa 209220DNAArtificial
SequenceAntisense Oligonucleotide 92tcacccctgc acgtgaactc
209320DNAArtificial SequenceAntisense Oligonucleotide 93tgaaccaaga
tcatgccatt 209420DNAArtificial SequenceAntisense Oligonucleotide
94ggcagaggtt gcagtgaacc 209520DNAArtificial SequenceAntisense
Oligonucleotide 95caaatccgtc ttccaaataa 209620DNAArtificial
SequenceAntisense Oligonucleotide 96aggttgcgcc attgcactcc
209720DNAArtificial SequenceAntisense Oligonucleotide 97tggcacatgc
ctgtaatccc 209820DNAArtificial SequenceAntisense Oligonucleotide
98atacaaaatt accgggcgtg 209920DNAArtificial SequenceAntisense
Oligonucleotide 99cttggtgcac agggcctgtg 2010020DNAArtificial
SequenceAntisense Oligonucleotide 100gatgaaaccc cgcctctggg
201012707DNAMus musculusCDS(2674)...(2707) 101ctagattagg ttggcttgtt
tgtgggaatt atctttgttg attgaagcgc caagtctcag 60cccactgtgg gtgactccat
tccctaggca gggacttctg gactatgtag gagtggagaa 120agtaaactca
gcattgacct ggatacattc attcaccaca ctttgctgtt gactatggat
180gtgatgtggc taggccctgc tggtgtgacg ttcctgctct ggctgtcctt
gaactcagag 240agatggtcct gcatctccct cctgtgtgct aggtttcaaa
ccatgcacca caatgcccag 300ctatgttgat tgattgattt tcatgtgaaa
cacctctcaa ggcccaggga catatctgac 360ttctgagaag acttgagttt
caaaggcagc cactgtctct agtacatcag ccaggcatta 420aaggatacat
ttggagatca ccatgtgtca agcagtgtgc tagtttctag ggaattgaga
480acaaatgaat acagtcttct tgggaaacca aggtaggtga gagccaccag
caatgaacga 540aaacactgca cacaaaatta attacagtgc tgtgaagcat
aataaaaccc agtggttaaa 600aaaagagaaa agaaaagaaa agaaaagaag
agaaaagaaa gccgggcgtg gtggcgcacg 660cctttaatcc cagcactggg
gaggcagagg caggcggatt tcggagttcg aggccagcct 720ggtctacaaa
gtgagttcca ggatagccag ggctatacag agaaaccctg tctcaaaaaa
780cccaccaaaa cagaaaagaa aagaaaagaa aagaaaagaa gggaaaagag
aagaaaaagg 840agagctgccc gtggtggtgc acaccttcaa tccccgcaca
gaagaagagg caggcggttc 900tctatgttgg aggccagcct ggtctacaga
ctgagttcca ggacagccag ggctccacag 960aagctgtttc aaataacaaa
caaaaactct gggtgctttc agagcttttt caacagagga 1020ctcaagccaa
gaggctttct gacacccaga taactctacc cttcccctgc tcaaaacttc
1080ccctgggtct caggtctcag acaccctcag aagactgata aattcctgca
agaaaactcc 1140agagtgtctg tcctggcctg ctgctacttc acattattcc
tcctcttcct ccttcttctc 1200ttttttttct ttctcttctt tttttttttt
ccaaaccagg gtttctctaa gtagccatgg 1260ctgtcctgga actggctttg
tagtccaggc tgacctcgaa ctcagagatc tactttcctg 1320cgttctgagg
gctgggatta aaagcataca caaccaccat ctgactcttt tttcttcttc
1380ctcctcttct ccttcctcct cctcctcttc cttttgcttg gcatcctagg
ctggcttcag 1440attcacagca attcttcata ggttctggga ttacaggtat
gggccaccat accagggtct 1500ctttgcaact cccatcttcc tcccggtttc
ttgttttgat taaggatctc agtatctaac 1560ttaattgacc tgtcacttgc
tatgtagact tgtgttttgt aaggtatgag tgaggtatgg 1620tgaggtgaga
agggtacctc agagggccca tcactgagaa atcccttcct cctgaagtac
1680cggccatgta gtatgtagca ccagatgatg tagtatggaa tagagtttat
ttaggacatg 1740ggaagtagag tttgggaaag gaggagagag agagaaagga
ggggaggaga agtagtggag 1800agagaagaga ccctccagaa acacctggaa
ggcggggaag gggagagaag gagaaacggg 1860gcagggagag aaggggcagg
aagtaagaga ataagacaag taagtgagca ggagagcgag 1920gagggggcaa
acagtcctta tatagtaggc taggcatacc tgactgttgc caggtaacta
1980tggggcggag cctagaagga ctgcttctag gatgtctcaa tttcacaggc
atctgcttgc 2040ttgtagttcc caaggctgaa attaaagatg ttgtagccac
cgcgtacagc ctgtttttgt 2100gttttgagat agattcttac ttaatggtgc
agcttggact caaactattt tatccaggct 2160tgcctcgaac tctttagcaa
tcttcttgct tcactctatc agaggtatgg accatcactc 2220tggtcaactg
gttttttttt tttttctccc cagactggag caatctctta tagtgcaggt
2280tggttttgag ctcgaggcaa tactcccgtc ctacctcagc ctctcaatgc
tgggatgaca 2340agatatccca ggcaagcttt gaacttgcgg caattctgct
ttaacctcct tagtgctctc 2400taccatgaat ctatgggaag aagaaataat
gggggcgggg ggggaaacaa ccaactctgg 2460gcatcagttc ggattaaggt
cgatccgcgc atgcgttcat ttagtacccg cggccccgcc 2520cctgcagcga
gcgatgatga tcacgtgact agtcctgcgg ggcggaggcc atgttgcggg
2580gcacccacgt gagggccgca cgtccacgat cagtcacgtg accgtggtgc
gccgcagccg 2640ccggggcgca cccggcgaga ggcagcggca gtg atg gac ggg tcc
ggg gag cag 2694 Met Asp Gly Ser Gly Glu Gln 1 5ctt ggg agc ggc g
2707Leu Gly Ser Gly 10102457DNAMus musculus 102agaaggccag
cgccacctcc tcccaccccc agctggggtc gtgtttgctt ttggcattct 60gctctctggg
tttgctgtgg agctgggatg caggccgggt cccgccccct gtccatcaga
120agcagtagcc aggccttcca tgctacttgt cactactagg gtccccagct
ctgtctcccc 180tcagggttat gagcctacct atccatcccc ctgactctcc
ctgggaccca ggagtccagg 240cacccctttc ctcctctctc ccccagggcc
caccagctct gaacagatca tgaagacagg 300ggcctttttg ctacagggtt
tcatccagga tcgagcaggg aggatggctg gggagacact 360gagctgacct
tggagcagcc gccccaggat gcgtccacca agaagctgag cgagtgtctc
420cggcgaattg gagatgaact ggacagcaat atggagc 45710320DNAArtificial
SequenceAntisense Oligonucleotide 103cctgtcttca tgatctgttc
2010420DNAArtificial SequenceAntisense Oligonucleotide
104ggtgtctccc cagccatcct 2010520DNAArtificial SequenceAntisense
Oligonucleotide 105cagctcaggt gtctccccag 2010620DNAArtificial
SequenceAntisense Oligonucleotide 106ccaaggtcag ctcaggtgtc
2010720DNAArtificial SequenceAntisense Oligonucleotide
107gctgctccaa ggtcagctca 2010820DNAArtificial SequenceAntisense
Oligonucleotide 108gggcggctgc tccaaggtca 2010920DNAArtificial
SequenceAntisense Oligonucleotide 109ccaattcgcc ggagacactc
2011020DNAArtificial SequenceAntisense Oligonucleotide
110ctgcagctcc atattgctat 2011120DNAArtificial SequenceAntisense
Oligonucleotide 111tcagcaatca tcctctgcag 2011220DNAArtificial
SequenceAntisense Oligonucleotide 112ccacgtcagc aatcatcctc
2011320DNAArtificial SequenceAntisense Oligonucleotide
113tccgtgtcca cgtcagcaat 2011420DNAArtificial SequenceAntisense
Oligonucleotide 114ggagtccgtg tccacgtcag 2011520DNAArtificial
SequenceAntisense Oligonucleotide 115tgccacccgg aagaagacct
2011620DNAArtificial SequenceAntisense Oligonucleotide
116gcaaacatgt cagctgccac 2011720DNAArtificial SequenceAntisense
Oligonucleotide 117ttgccatcag caaacatgtc 2011820DNAArtificial
SequenceAntisense Oligonucleotide 118agttgaagtt gccatcagca
2011920DNAArtificial SequenceAntisense Oligonucleotide
119cccagttgaa gttgccatca 2012020DNAArtificial SequenceAntisense
Oligonucleotide 120ccacgcggcc ccagttgaag 2012120DNAArtificial
SequenceAntisense Oligonucleotide 121agtttgctag caaagtagaa
2012220DNAArtificial SequenceAntisense Oligonucleotide
122tgagcaccag tttgctagca 2012320DNAArtificial SequenceAntisense
Oligonucleotide 123acagggcctt gagcaccagt 2012420DNAArtificial
SequenceAntisense Oligonucleotide 124tagtgcacag ggccttgagc
2012520DNAArtificial SequenceAntisense Oligonucleotide
125tttagtgcac agggccttga 2012620DNAArtificial SequenceAntisense
Oligonucleotide 126ctcgggcact ttagtgcaca 2012720DNAArtificial
SequenceAntisense Oligonucleotide 127agctcgggca ctttagtgca
2012820DNAArtificial SequenceAntisense Oligonucleotide
128gatcagctcg ggcactttag 2012920DNAArtificial SequenceAntisense
Oligonucleotide 129tggttctgat cagctcgggc 2013020DNAArtificial
SequenceAntisense Oligonucleotide 130ccatgatggt tctgatcagc
2013120DNAArtificial SequenceAntisense Oligonucleotide
131aagtccagtg tccagcccat 2013220DNAArtificial SequenceAntisense
Oligonucleotide 132aggaagtcca gtgtccagcc 2013320DNAArtificial
SequenceAntisense Oligonucleotide 133cggaggaagt ccagtgtcca
2013420DNAArtificial SequenceAntisense Oligonucleotide
134gatccagaca agcagccgct 2013520DNAArtificial SequenceAntisense
Oligonucleotide 135tggtcttgga tccagacaag 2013620DNAArtificial
SequenceAntisense Oligonucleotide 136tcccagccac cctggtcttg
2013720DNAArtificial SequenceAntisense Oligonucleotide
137atggtcactg tctgccatgt 2013820DNAArtificial SequenceAntisense
Oligonucleotide 138aagatggtca ctgtctgcca 2013920DNAArtificial
SequenceAntisense Oligonucleotide 139gccacaaaga tggtcactgt
2014020DNAArtificial SequenceAntisense Oligonucleotide
140aggactccag ccacaaagat 2014120DNAArtificial SequenceAntisense
Oligonucleotide 141cgaggcggtg aggactccag 2014220DNAArtificial
SequenceAntisense Oligonucleotide 142tccagatggt gagcgaggcg
2014320DNAArtificial SequenceAntisense Oligonucleotide
143ttcttccaga tggtgagcga 2014420DNAArtificial SequenceAntisense
Oligonucleotide 144tcagcccatc ttcttccaga 2014520DNAArtificial
SequenceAntisense Oligonucleotide 145gcaggaccat ctctctgagt
2014620DNAArtificial SequenceAntisense Oligonucleotide
146tggtttgaaa cctagcacac 2014720DNAArtificial SequenceAntisense
Oligonucleotide 147agatatgtcc ctgggccttg 2014820DNAArtificial
SequenceAntisense Oligonucleotide 148aaactagcac actgcttgac
2014920DNAArtificial SequenceAntisense Oligonucleotide
149cctaccttgg tttcccaaga 2015020DNAArtificial SequenceAntisense
Oligonucleotide 150gctgggatta aaggcgtgcg 2015120DNAArtificial
SequenceAntisense Oligonucleotide 151aaatccgcct gcctctgcct
2015220DNAArtificial SequenceAntisense Oligonucleotide
152ggcctccaac atagagaacc 2015320DNAArtificial SequenceAntisense
Oligonucleotide 153atctgggtgt cagaaagcct 2015420DNAArtificial
SequenceAntisense Oligonucleotide 154cgcaggaaag tagatctctg
2015520DNAArtificial SequenceAntisense Oligonucleotide
155agcaagtgac aggtcaatta 2015620DNAArtificial SequenceAntisense
Oligonucleotide 156aaacaggctg tacgcggtgg 2015720DNAArtificial
SequenceAntisense Oligonucleotide 157agttgaccag agtgatggtc
2015820DNAArtificial SequenceAntisense Oligonucleotide
158gtcacgtgat catcatcgct 2015920DNAArtificial SequenceAntisense
Oligonucleotide 159ggacccgtcc atcactgccg 2016020DNAArtificial
SequenceAntisense Oligonucleotide 160actgcttctg atggacaggg
2016120DNAArtificial SequenceAntisense Oligonucleotide
161ggcctggcta ctgcttctga 2016220DNAArtificial SequenceAntisense
Oligonucleotide 162gcatggaagg cctggctact 2016320DNAArtificial
SequenceAntisense Oligonucleotide 163gtagtgacaa gtagcatgga
2016420DNAArtificial SequenceAntisense Oligonucleotide
164accctagtag tgacaagtag 2016520DNAArtificial SequenceAntisense
Oligonucleotide 165taggctcata accctgaggg 2016620DNAArtificial
SequenceAntisense Oligonucleotide 166atggataggt aggctcataa
2016720DNAArtificial SequenceAntisense Oligonucleotide
167ctggactcct gggtcccagg 2016820DNAArtificial SequenceAntisense
Oligonucleotide 168tcagagctgg tgggccctgg 20
* * * * *