U.S. patent application number 12/822995 was filed with the patent office on 2011-04-28 for compositions and methods for treating cancer and modulating stress granule formation.
This patent application is currently assigned to Massachusetts Institute of Technology. Invention is credited to Paul Chang, Anthony Leung, Phillip A. Sharp, Sejal Vyas.
Application Number | 20110097329 12/822995 |
Document ID | / |
Family ID | 43387125 |
Filed Date | 2011-04-28 |
United States Patent
Application |
20110097329 |
Kind Code |
A1 |
Chang; Paul ; et
al. |
April 28, 2011 |
COMPOSITIONS AND METHODS FOR TREATING CANCER AND MODULATING STRESS
GRANULE FORMATION
Abstract
The invention provides methods for treating or decreasing the
likelihood of developing a stress-granule related disorder and/or
cancer by administering one or more poly-ADP-ribose polymerase
(PARP) inhibitors, one or more PARP activators, one or more
poly-ADP-ribose glycosylase (PARG) activators, and/or one or more
poly-ADP-ribose glycohydrolase ARH3 activators. The invention also
provides corresponding methods of decreasing stress granule
formation and/or proliferation in a cell or a population of cells.
The invention further provides methods of increasing the number of
stress granules and proliferation in a cell or a population of
cells by administering one or more PARP activators, one or more
PARP inhibitors, one or more PARG inhibitors, and/or one or more
ARH3 inhibitors. The invention also provides methods for screening
for agents for treating or decreasing the likelihood of developing
a stress granule-related disorder or cancer, and methods for
determining the propensity for developing a stress granule-related
disorder or cancer, as well as compositions and kits containing one
or more PARP inhibitors, one or more PARP activators, one or more
PARG activators, and one or more ARH3 activators.
Inventors: |
Chang; Paul; (Cambridge,
MA) ; Vyas; Sejal; (Cambridge, MA) ; Leung;
Anthony; (Somerville, MA) ; Sharp; Phillip A.;
(Newton, MA) |
Assignee: |
Massachusetts Institute of
Technology
Cambridge
MA
|
Family ID: |
43387125 |
Appl. No.: |
12/822995 |
Filed: |
June 24, 2010 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
61269614 |
Jun 26, 2009 |
|
|
|
Current U.S.
Class: |
424/137.1 ;
435/15; 435/375; 435/6.11 |
Current CPC
Class: |
A61K 39/395 20130101;
C07H 21/02 20130101; A61K 39/3955 20130101; C07K 16/40 20130101;
A61K 38/45 20130101; A61K 31/713 20130101; A61P 35/00 20180101;
C12N 2320/12 20130101; C12Q 1/6886 20130101; C12N 15/113 20130101;
G01N 33/6893 20130101; G01N 2500/02 20130101; G01N 2333/91142
20130101; A61K 38/47 20130101; C12N 2310/14 20130101; C12N 15/1137
20130101 |
Class at
Publication: |
424/137.1 ;
435/375; 435/6; 435/15 |
International
Class: |
A61K 39/395 20060101
A61K039/395; C12N 5/02 20060101 C12N005/02; A61P 35/00 20060101
A61P035/00; C12Q 1/48 20060101 C12Q001/48; C12Q 1/68 20060101
C12Q001/68 |
Claims
1. A method of treating or decreasing the likelihood of developing
a stress granule-related disorder in a subject comprising
administering to said subject a therapeutically effective amount of
one or more poly-ADP-ribose polymerase (PARP) inhibitor(s), one or
more poly-ADP ribose glycolase (PARG) activators, and/or one or
more PARP11 activators.
2. The method of claim 1, wherein said one or more PARP
inhibitor(s) selectively decrease the expression and/or one or more
activities of one or more PARP(s) selected from the group
consisting of PARP5a, PARP12, PARP13 isoform 1 (PARP13.1), PARP13
isoform 2 (PARP13.2), and PARP15.
3. The method of claim 1, wherein said decrease in expression is a
decrease in the level of one or more nucleic acid(s) comprising a
nucleic acid sequence having at least 95% sequence identity to
PARP5a (SEQ ID NO: 8 or 9), PARP5b (SEQ ID NO: 10), PARP13.1 (SEQ
ID NO: 19), PARP13.2 (SEQ ID NO: 20), or PARP15 (SEQ ID NOS: 22 or
23), or a decrease in the level of one or more polypeptides encoded
by said one or more nucleic acid(s); or said one or more activities
of said one or more PARP(s) is poly-ADP-ribosylation of a target
protein localized in a stress granule or a target protein involved
in the formation or disassembly of a stress granule, or the
formation or nucleation of a stress granule.
4.-6. (canceled)
7. The method of claim 1, wherein said one or more PARG activators
selectively increase the expression and/or one or more activities
of PARG protein or poly-ADP-ribose glycohydrolase ARH3.
8. The method of claim 7, wherein said increase in expression is an
increase in the level of one or more nucleic acid(s) comprising a
nucleic acid sequence having at least 95% sequence identity to PARG
(SEQ ID NO: 42) or ARH3 (SEQ ID NO: 41), or an increase in the
level of one or more polypeptide(s) encoded by said one or more
nucleic acid(s); or said one or more activities of PARG or ARH3 is
hydrolysis of poly-ADP-ribose, the prevention of the assembly of a
stress granule, or disassembly of a stress granule.
9.-12. (canceled)
13. The method of claim 1, wherein said one or more PARP11
activators selectively increase the expression and/or one or more
activities of PARP11.
14. The method of claim 13, wherein said increase in expression is
an increase in the level of one or more nucleic acid(s) comprising
a nucleic acid sequence having at least 95% sequence identity to
PARP11 (SEQ ID NO: 17), or an increase in the level of one or more
polypeptide(s) encoded by said one or more nucleic acid(s); or said
one or more activities of PARP11 is poly-ADP-ribosylation of a
target protein localized in a stress granule or a target protein
involved in the formation or disassembly of a stress granule, the
prevention of the assembly of a stress granule, or disassembly of a
stress granule.
15.-17. (canceled)
18. The method of claim 1, wherein said one or more PARP inhibitors
is an antibody or an antibody fragment that selectively binds one
or more of PARP5a, PARP12, PARP13.1, PARP13.2, and PARP15
polypeptide, or an RNA aptamer, said one or more PARG activators is
one or more nucleic acid(s) comprising a nucleic acid sequence
having at least 95% sequence identity to PARG (SEQ ID NO: 42) or
ARH3 (SEQ ID NO: 41); or said one or more PARP11 activators is one
or more nucleic acid(s) comprising a nucleic acid sequence having
at least 95% sequence identity to PARP11 (SEQ ID NO: 17).
19.-29. (canceled)
30. A method of decreasing the number of stress granules present in
a cell or a population of cells comprising contacting said cell or
population of cells with an effective amount of one or more
poly-ADP-ribose polymerase (PARP) inhibitor(s), one or more
poly-ADP ribose glycolase (PARG) activators, and/or one or more
PARP11 activators.
31.-51. (canceled)
52. A method of treating or decreasing the likelihood of developing
cancer in a subject comprising administering to said subject a
therapeutically effective amount of one or more poly-ADP-ribose
polymerase (PARP) inhibitor(s).
53.-64. (canceled)
65. A method of decreasing proliferation of a cell or a population
of cells by contacting said cell or population of cells with an
effective amount of one or more poly-ADP-ribose polymerase (PARP)
inhibitor(s).
66.-74. (canceled)
75. A pharmaceutical composition comprising one or more PARP
inhibitors, one or more PARG activators, and/or one or more PARP11
activators, wherein said one or more PARP inhibitor(s) selectively
decrease the expression and/or one or more activities of one or
more PARP(s) selected from the group consisting of PARP5a, PARP12,
PARP13 isoform 1 (PARP13.1), PARP13 isoform 2 (PARP13.2), and
PARP15.
76.-96. (canceled)
97. A kit comprising one or more pharmaceutical compositions of
claim 75 and instructions for administering the one or more
compositions to a subject diagnosed with a stress granule-related
disorder or diagnosed as having a propensity to develop a stress
granule-related disorder.
98. A pharmaceutical composition comprising one or more
poly-ADP-ribose polymerase (PARP) inhibitor(s), wherein said one or
more PARP inhibitor(s) selectively decrease the expression and/or
one or more activities of one or more PARP(s) selected from the
group consisting of PARP1, PARP2, PARP5A, PARP5B, PARP7, PARP8,
PARP14, and PARP16.
99.-106. (canceled)
107. A kit comprising one or more pharmaceutical compositions of
claim 98 and instructions for administering the one or more
compositions to a subject diagnosed with cancer or diagnosed as
having a propensity to develop a cancer.
108. A method for increasing the number of stress granules in a
cell or a population of cells comprising contacting said cell or
population of cells with one or more poly-ADP-ribose polymerase
(PARP) activators(s), one or more poly-ADP ribose glycolase (PARG)
inhibitors, and/or one or more PARP11 inhibitors.
109.-132. (canceled)
133. A method of increasing proliferation of a cell or a population
of cells comprising contacting said cell or population of cells
with an effective amount of one or more poly-ADP-ribose polymerase
(PARP) activators(s).
134.-141. (canceled)
142. A method of identifying a candidate agent for treating or
decreasing the likelihood of developing a stress granule-related
disorder comprising the steps of: a) providing one or more PARP,
PARG, and/or ARH3 proteins, and/or PARP, PARG, and/or ARH3 fusion
proteins encoded by a nucleic acid comprising a nucleic acid
sequence having at least 95% sequence identity to PARP5A (SEQ ID
NO: 8 or 9), PARP12 (SEQ ID NO: 18), PARP13.1 (SEQ ID NO: 19),
PARP13.2 (SEQ ID NO: 20) PARP15 (SEQ ID NO: 22 or 23), PARG (SEQ ID
NO: 42), or ARH3 (SEQ ID NO: 41); b) contacting said one or more
PARP, PARG, and/or ARH3 proteins, and/or PARP, PARG, and/or ARH3
fusion proteins with said agent and a labeled nicotinamide adenine
dinucleotide (NAD.sup.+) substrate; and c) measuring one or more
activities of said one or more PARP, PARG, and/or ARH3 proteins,
and/or PARP, PARG, and/or ARH3 fusion proteins, and/or the specific
binding of said agent to said one or more PARP proteins or fusion
proteins; wherein an agent that decreases one or more activities
and/or specifically binds to said one or more PARP proteins and/or
PARP fusion proteins, and/or increases one or more activities of
said one or more PARG and/or ARH3 proteins, and/or PARG and/or ARH3
fusion proteins is identified as a candidate agent for treating or
decreasing the likelihood of developing a stress granule-related
disorder.
143.-149. (canceled)
150. A method of identifying a candidate agent for treating or
decreasing the likelihood of developing cancer comprising the steps
of: a) providing one or more PARP proteins and/or PARP fusion
proteins encoded by a nucleic acid comprising a nucleic acid
sequence having at least 95% sequence identity to a PARP selected
from PARP1 (SEQ ID NO: 1 or 2), PARP2 (SEQ ID NO: 3), PARP5A (SEQ
ID NO: 8 or 9), PARP5B (SEQ ID NO: 10) PARP7 (SEQ ID NO: 12), PARP8
(SEQ ID NO: 13), PARP14 (SEQ ID NO: 21), or PARP16 (SEQ ID NO: 24);
b) contacting said one or more PARP proteins and/or PARP fusion
proteins with said agent and a labeled nicotinamide adenine
dinucleotide (NAD.sup.+) substrate; and c) measuring one or more
activities of said one or more PARP proteins and/or PARP fusion
proteins or the specific binding of said agent to said one or more
PARP proteins and/or PARP fusion proteins; wherein an agent that
decreases one or more activities and/or specifically binds to said
one or more PARP proteins and/or fusion proteins is identified as a
candidate agent for treating or decreasing the likelihood of
developing cancer.
151.-157. (canceled)
158. A method for determining the propensity of a subject to
develop a stress granule-related disorder comprising determining
the expression and/or one or more activities of one or more of
PARP5A, PARP11, PARP12, PARP13.1, PARP13.2, PARP15, PARG, and ARH3
in a subject, wherein an increase in the expression and/or one or
more activities of one or more of PARP5A, PARP12, PARP13.1,
PARP13.2, and PARP15, and/or a decrease in the expression or one or
more activities of PARP11, PARG, or ARH3 indicates an increased
propensity to develop a stress granule-related disorder.
159.-163. (canceled)
164. A method for determining the propensity of a subject to
develop cancer comprising determining the expression and/or one or
more activities of one or more of PARP1, PARP2, PARP5A, PARP5B,
PARP7, PARP8, PARP14, and PARP16 in a subject, wherein an increase
in the expression and/or one or more activities of one or more of
PARP1, PARP2, PARP5A, PARP5B, PARP7, PARP8, PARP14, and PARP16
indicates an increased propensity to develop cancer.
165. (canceled)
166. (canceled)
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit of the filing date of
U.S. Provisional Application No. 61/269,614, filed Jun. 26, 2009,
herein incorporated by reference in its entirety.
FIELD OF THE INVENTION
[0002] The present invention relates to the field of molecular
biology and molecular medicine.
BACKGROUND OF THE INVENTION
[0003] Poly-adenosine diphosphate (ADP)-ribose (PAR) polymers are
the product of post-translational modifications carried out by PAR
polymerases (PARPs). PAR is polymerized by PARPs onto acceptor
proteins using nicotinamide adenine dinucleotide (NAD.sup.+) as
substrate (FIG. 1). PAR polymers are localized to distinct cellular
structures in different phases of the cell cycle and localize to
the mitotic spindle during mitosis (FIG. 2). There are at least 18
PARPs in the human genome: the domain structure for several PARPs
is depicted in FIG. 3. However, the specific biological function
and protein substrates of these PARPs are not fully characterized
(Ame et al., Bioessays 26:882-893, 2004). The identification of the
function and the substrates of each member of this family of
proteins has been difficult to date.
[0004] PAR polymers are required for normal cell division and PARP
knockouts in Drosophila melanogaster are embryonic lethal (Tulin et
al., Genes Dev. 16:2108-2119, 2002). The concentration, length, and
extent of PAR branching are regulated by a balance of activities of
the PARPs and PAR glycohydrolase (PARG), a highly specific,
processive endo- and exo-glycosidase (Hatakeyama et al., J. Biol.
Chem. 261:14902-14911, 1986). Poly-ADP-ribose polymers have
generally been implicated for a role in several different human
diseases including cancer, ischemic injury, inflammatory diseases,
cardiovascular diseases, and neurodegenerative disorders.
[0005] We have discovered that several PARP proteins are localized
to the nucleus and/or are required for cell cycle progression
through mitosis. We have also discovered a role for several PARP
proteins in the formation, nucleation, and disassembly of stress
granules. Stress granules are distinct cellular structures that
form in the cytosol upon exposure of a cell to stress conditions.
Stress granules are composed of both proteins and RNA molecules.
The RNA molecules present in stress granules are mRNA molecules
stalled in translation pre-initiation complexes. Stress granules
are typically 100 to 200 nM in size and are commonly associated
with the endoplasmic reticulum. Stress granules have been
implicated in several different disease states including
cardiovascular disorders, inflammatory disorders, neurological
disorders, and ischemic-reperfusion injury.
[0006] Methods and compositions for the treatment of stress
granule-related disorders and cancer are presently desired.
SUMMARY OF THE INVENTION
[0007] The invention provides methods of treating or decreasing
(e.g., by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or
95%) the likelihood of developing a stress granule-related disorder
in a subject requiring administering to a subject a therapeutically
effective amount of one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9,
or 10) PARP inhibitor(s), one or more (e.g., 1, 2, 3, 4, 5, 6, 7,
8, 9, or 10) poly-ADP ribose glycosylase (PARG) activators, and/or
one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) PARP11
activators. The invention also provides methods for decreasing the
number of stress granules present in a cell or in a population of
cells requiring contacting the cell or population of cells with an
effective amount of one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9,
or 10) PARP inhibitor(s), one or more (e.g., 1, 2, 3, 4, 5, 6, 7,
8, 9, or 10) PARG activators, and/or one or more (e.g., 1, 2, 3, 4,
5, 6, 7, 8, 9, or 10) PARP11 activators. The invention also
provides compositions and kits containing one or more (e.g., 1, 2,
3, 4, 5, 6, 7, 8, 9, or 10) PARP inhibitor(s), one or more (e.g.,
1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) PARG activator(s), and/or one or
more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) PARP11
activators.
[0008] In each of the above of the above methods, compositions, and
kits, the one or more PARP inhibitor(s) may selectively decrease
(e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%,
99%, or even 100%) the expression (e.g., mRNA or protein) and/or
activity of one or more (e.g., 1, 2, 3, 4, or 5) of PARP5a, PARP12,
PARP13 isoform 1 (PARP13.1), PARP isoform 2 (PARP13.2), and PARP15.
In different embodiments of the above aspects of the invention, the
decrease in expression of one or more of PARP5a, PARP12, PARP13.1,
PARP13.2, or PARP15 is a decrease in the level of one or more
(e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) nucleic acid(s) containing
a nucleic acid sequence having at least 80% (e.g., at least 85%,
90%, 95%, 96%, 97%, 98%, 99%, or even 100%) sequence identity to
PARP5a (SEQ ID NO: 8 or 9), PARP12 (SEQ ID NO: 18), PARP13.1 (SEQ
ID NO: 19), PARP13.2 (SEQ ID NO: 20), or PARP15 (SEQ ID NO: 22 or
23), or a decrease in the level of one or more (e.g., 1, 2, 3, 4,
5, 6, 7, 8, 9, or 10) polypeptides encoded by these nucleic acids.
In different embodiments of the above aspects, the activity of the
one or more of PARP5a, PARP12, PARP13.1, PARP13.2, or PARP15 is
poly-ADP-ribosylation of one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8,
9, or 10) target protein(s) (e.g., a protein localized in a stress
granule, a polypeptide involved in the formation or disassembly of
a stress granule, and/or a PARP protein) or formation and/or
nucleation of a stress granule.
[0009] In each of the above aspects, the one or more PARG
activators may selectively increase (e.g., at least 10%, 20%, 30%,
40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, or 100%) the expression
(e.g., mRNA and/or protein) and/or one or more activities of PARG
protein or poly-ADP-ribose glycohydrolase ARH3. In different
embodiments of the above aspects of the invention, the increase in
expression of PARG or ARH3 is an increase in the level of one or
more (e.g., 1, 2, 3, 4, 5, or 6) nucleic acid(s) containing a
nucleic acid sequence having at least 80% sequence identity (e.g.,
at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100%) to PARG
(SEQ ID NO: 42) or ARH3 (SEQ ID NO: 41), or an increase in the
level of one or more (e.g., 1, 2, 3, 4, 5, or 6) polypeptides
encoded by these nucleic acids. In different embodiments of the
above aspects, the one or more (e.g., 1, 2, 3, 4, or 5) activities
of PARG or ARH3 is hydrolysis of poly-ADP-ribose (e.g.,
poly-ADP-ribose attached to one or more (e.g., 1, 2, 3, 4, or 5)
substrate protein(s), e.g., a protein localized in a stress
granule, a polypeptide involved in the formation or disassembly of
a stress granule, and/or a PARP protein), the prevention of the
assembly of a stress granule, or disassembly of a stress
granule.
[0010] In each of the above of the above methods, compositions, and
kits, the one or more PARP11 activator (s) may selectively increase
(e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%,
99%, or even 100%) the expression (e.g., mRNA and/or protein)
and/or one or more (e.g., 1, 2, 3, 4, or 5) activities of PARP11.
In different embodiments of the above aspects of the invention, the
increase in expression of PARP11 is an increase in the level of one
or more (e.g., 1, 2, 3, 4, or 5) nucleic acid(s) containing a
nucleic acid sequence having at least 80% sequence identity (e.g.,
at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100%) to PARP11
(SEQ ID NO: 17), or an increase in the level of one or more (e.g.,
1, 2, 3, 4, or 5) polypeptides encoded by these nucleic acids. In
different embodiments of the above aspects, the one or more (e.g.,
1, 2, 3, 4, or 5) activities of PARP11 is poly-ADP-ribosylation of
one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) target
protein(s) (e.g., a protein localized in a stress granule, a
polypeptide involved in the formation or disassembly of a stress
granule, and/or a PARP protein), the prevention of the assembly of
a stress granule, or the disassembly of a stress granule.
[0011] In each of the above aspects, the one or more PARP
inhibitors may be an antibody or antibody fragment that selectively
binds one or more (e.g., 1, 2, 3, 4, or 5) of PARP5a, PARP12,
PARP13.1, PARP13.2, and PARP15; an RNA aptamer (e.g., one or more
RNA aptamers containing the sequence of one of SEQ ID NOS: 40, 49,
99-113, and 122-129); or a small molecule. In each of the above
aspects, the one or more PARG activators may be one or more (e.g.,
1, 2, 3, 4, or 5) nucleic acid(s) containing a nucleic acid
sequence having at least 80% sequence identity (e.g., at least 85%,
90%, 95%, 96%, 97%, 98%, 99%, or even 100%) to PARG (SEQ ID NO: 42)
or ARH3 (SEQ ID NO: 41). In each of the above aspects, the one or
more PARP11 activators may be one or more (e.g., 1, 2, 3, 4, or 5)
nucleic acid(s) containing a nucleic acid sequence having at least
80% sequence identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%,
99%, or even 100%) to PARP11 (SEQ ID NO: 17).
[0012] In each of the above methods of treatment, the one or more
PARP inhibitor(s), one or more PARG activator(s), and/or one or
more PARP11 activators may be administered once a day or one or
more times a week (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13,
or 14 times a week), and/or administered parenterally (e.g.,
intravenous, intraarterial, subcutaneous, or intramuscular
administration) or orally, and/or administered with one or more
(e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) additional therapeutic
agents (e.g., one or more (e.g., 1, 2, 3, 4, or 5) non-steroidal
anti-inflammatory drug(s), one or more (e.g., 1, 2, 3, 4, or 5)
immunosuppressive agent(s), one or more (e.g., 1, 2, 3, 4, or 5)
calcineurin inhibitors, and/or one or more (e.g., 1, 2, 3, 4, or 5)
analgesic(s)). In each of the above methods of treating a cell or
cell population, the contacting may result in a reduction in the
number of stress granules in a cell (e.g., at least 10%, 20%, 30%,
40%, 50%, 60%, 70%, 80%, 90%, or even 100% reduction in the number
of stress granules in a cell or cell population compared to a
control cell or cell population, e.g., a cell or cell population
from a person having or diagnosed with a stress granule-related
disorder).
[0013] The invention further provides methods of treating or
decreasing (e.g., by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%,
80%, 90%, or 95%) the likelihood of developing cancer in a subject
requiring administering to a subject a therapeutically effective
amount of one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) PARP
inhibitor(s). The invention also provides methods for decreasing
(e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%,
or even 100%) proliferation of a cell or a population of cells
requiring contacting the cell or population of cells with an
effective amount of one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9,
or 10) PARP inhibitor(s). The invention also provides compositions
and kits containing one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9,
or 10) PARP inhibitor(s).
[0014] In each of these methods, compositions, and kits, the one or
more PARP inhibitor(s) may selectively decrease (e.g., at least
10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, or even 100%
decrease) the expression (e.g., mRNA and/or protein) and/or one or
more (e.g., 1, 2, 3, 4, or 5) activities of one or more (e.g., 1,
2, 3, 4, 5, 6, 7, or 8) of PARP1, PARP2, PARP5A, PARP5B, PARP7,
PARP8, PARP14, and PARP16. In different embodiments of these
aspects of the invention, the decrease in expression of the one or
more of PARP1, PARP2, PARP5A, PARP5B, PARP7, PARP8, PARP14, and
PARP16 is a decrease in the level of one or more (e.g., 1, 2, 3, 4,
5, 6, 7, 8, 9, or 10) nucleic acid(s) containing a nucleic acid
sequence having at least 80% sequence identity (e.g., at least 85%,
90%, 95%, 96%, 97%, 98%, 99%, or even 100%) to PARP1 (SEQ ID NO: 1
or 2), PARP2 (SEQ ID NO: 3), PARP5A (SEQ ID NO: 8 or 9), PARP5B
(SEQ ID NO: 10), PARP14 (SEQ ID NO: 21), or PARP16 (SEQ ID NO: 24),
or a decrease in the level of one or more (e.g., 1, 2, 3, 4, 5, 6,
7, 8, 9, or 10) polypeptides encoded by these nucleic acids. In
different embodiments of these aspects of the invention, the one or
more activities of the one or more of PARP1, PARP2, PARP5A, PARP5B,
PARP7, PARP8, PARP14, or PARP16 is poly-ADP-ribosylation of one or
more (e.g., 1, 2, 3, 4, or 5) target protein(s) (e.g., a protein
localized in the nucleus or mitotic spindle during cytokinesis,
and/or a PARP protein) or is required for progression through
mitosis.
[0015] In each of the these aspects, the one or more PARP
inhibitors may be an antibody or antibody fragment that selectively
binds one or more (e.g., 1, 2, 3, 4, 5, 6, 7, or 8) of PARP1,
PARP2, PARP5A, PARP5B, PARP7, PARP8, PARP14, and PARP16; an RNA
aptamer (e.g., an RNA aptamer containing the sequence of one or
more of SEQ ID NOS: 43-46, 49, 50, 59-74, 114-121, and 130-136); or
a small molecule. In each of these methods of treatment, the one or
more PARP inhibitor(s) may be administered once a day or one or
more times a week (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13,
or 14 times a week), and/or administered parenterally (e.g.,
intravenous, intraarterial, subcutaneous, or intramuscular
administration) or orally, and/or administered with one or more
(e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) additional therapeutic
agents (e.g., one or more (e.g., 1, 2, 3, 4, or 5) chemotherapeutic
agents, one or more (e.g., 1, 2, 3, 4, or 5) non-steroidal
anti-inflammatory drug(s), one or more (e.g., 1, 2, 3, 4, or 5)
immunosuppressive agent(s), one or more (e.g., 1, 2, 3, 4, or 5)
calcineurin inhibitors, and/or one or more (e.g., 1, 2, 3, 4, or 5)
analgesic(s)). In each of the these methods of treating a cell or
cell population, the contacting may result in a reduction in the
rate of proliferation of a cell or cell population (e.g., by at
least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or even 100%
reduction in the rate of proliferation of a cell or cell population
compared to a control cell or cell population, e.g., a cancer cell
or a cancer cell line).
[0016] The invention further provides methods for increasing (e.g.,
by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or even
100%) the number of stress granules in a cell or cell population by
contacting the cell or cell population with an effective amount of
one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) PARP
activators, one or more (e.g., 1, 2, 3, 4, or 5) PARG inhibitors,
and/or one or more (e.g., 1, 2, 3, 4, or 5) PARP11 inhibitors. In
one embodiment of these methods, the one or more PARP activators
selectively increase the expression (e.g., mRNA and/or protein)
and/or one or more (e.g., 1, 2, 3, 4, or 5) activities of one or
more (e.g., 1, 2, 3, 4, or 5) of PARP5A, PARP12, PARP13.1,
PARP13.2, and PARP15. In different embodiments of these methods,
the increase in expression is an increase (e.g., at least 10%, 20%,
30%, 40%, 50%, 60%, 70%, 80%, 90%, or even 100% increase) in the
level of one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10)
nucleic acid(s) containing a nucleic acid sequence having at least
80% sequence identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%,
99%, or even 100%) to PARP5A (SEQ ID NO: 8 or 9), PARP5b (SEQ ID
NO: 10), PARP13.1 (SEQ ID NO: 19), PARP13.2 (SEQ ID NO: 20), or
PARP15 (SEQ ID NO: 22 or 23), or an increase in the level of one or
more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) polypeptides encoded
by these nucleic acids. In different embodiments of this method,
the one or more activities of PARP5A, PARP12, PARP13.1, PARP13.2,
and PARP15 is the poly-ADP-ribosylation of one or more (e.g., 1, 2,
3, 4, or 5) target protein(s) (e.g., a protein localized in a
stress granule, a protein involved in the formation or disassembly
of a stress granule, and/or a PARP protein) or the formation or
nucleation of a stress granule.
[0017] In different embodiments of this method, the one or more
PARG inhibitors may selectively decrease (e.g., at least 10%, 20%,
30%, 40%, 50%, 60%, 70%, 80%, 90%, or even 100%) the expression
(e.g., mRNA and/or protein) and/or one or more (e.g., 1, 2, 3, 4,
or 5) activities of PARG or ARH3. In additional embodiments of this
method, the decrease in expression of PARG or ARH3 is a decrease in
the level of one or more (e.g., 1, 2, 3, 4, 5, or 6) nucleic
acid(s) containing a nucleic sequence having at least 80% sequence
identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even
100%) to PARG (SEQ ID NO: 42) or ARH3 (SEQ ID NO: 41), or a
decrease in the levels of one or more (e.g., 1, 2, 3, 4, 5, or 6)
polypeptides encoded by these nucleic acids. In additional
embodiments of this method, the one or more activities of PARG or
ARH3 is the hydrolysis of poly-ADP-ribose (e.g., poly-ADP-ribose
that is covalently attached to one or more (e.g., 1, 2, 3, 4, or 5)
substrate protein(s), e.g., a protein localized in a stress
granule, a protein involved in the formation or disassembly of a
stress granule, and/or a PARP protein), the prevention of assembly
of a stress granule protein, or disassembly of a stress
granule.
[0018] In an additional embodiment of this method, the one or more
PARP11 inhibitors may selectively decrease (e.g., at least 10%,
20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or even 100%) the
expression (e.g., mRNA and/or protein) and/or one or more
activities of PARP11. In different embodiments of this method, the
decrease (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%,
90%, or even 100%) in expression of PARP11 is a decrease in the
level of one or more (e.g., 1, 2, 3, 4, or 5) nucleic acid(s)
containing a nucleic acid having at least 80% sequence identity
(e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100%) to
PARP11 (SEQ ID NO: 17), or a decrease in the level of one or more
(e.g., 1, 2, 3, 4, or 5) polypeptides encoded by these nucleic
acids. In different embodiments of this method, the one or more
activities of PARP11 is poly-ADP-ribosylation of one or more (e.g.,
1, 2, 3, 4, or 5) target protein(s) (e.g., a protein localized in a
stress granule, a protein involved in the formation or disassembly
of a stress granule, and/or a PARP protein), the prevention of the
assembly of a stress granule, or disassembly of a stress
granule.
[0019] In additional embodiments of this method, the one or more
PARP activators is one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or
10) nucleic acid(s) comprising a nucleic acid sequence having at
least 80% sequence identity (e.g., at least 85%, 90%, 95%, 96%,
97%, 98%, 99%, or even 100%) to PARP5A (SEQ ID NO: 8 or 9), PARP5B
(SEQ ID NO: 10), PARP13.1 (SEQ ID NO: 19), PARP13.2 (SEQ ID NO:
20), or PARP15 (SEQ ID NO: 22 or 23). In additional embodiments of
this method, the one or more PARG inhibitors is an antibody or
antibody fragment that selectively binds to PARG or ARH3; an RNA
aptamer (e.g., a nucleic acid sequence that contains one or more of
SEQ ID NOS: 34-37); or a small molecule. In additional embodiments
of this method, the one or more PARP11 inhibitors may be an
antibody or an antibody fragment that selectively binds to PARP11;
an RNA aptamer (e.g., a nucleic acid sequence that contains one or
more of SEQ ID NOS: 91-98); or a small molecule.
[0020] In additional embodiments of this method, the contacting
results in at least a 10% (e.g., at least 20%, 30%, 40%, 50%, 60%,
70%, 80%, 90%, or even 100%) reduction in the number of stress
granules present in the cell or the population of cells compared to
a control cell or population of cells (e.g., a cell or population
of cells untreated with a PARP activator, a PARG inhibitor, or a
PARP11 inhibitor, e.g., a cell from a subject having or diagnosed
with a stress-granule disorder). In additional embodiments of this
method, the cell or population of cells is a mammalian cell(s) or a
plant cell(s).
[0021] The invention also provides methods of increasing (e.g., by
at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or even 100%)
the proliferation of a cell or a population of cells requiring
contacting the cell or population of cells with an effective amount
of one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) PARP
activators. In different embodiments of this method, the one or
more PARP activators selectively increase (e.g., at least 10%, 20%,
30%, 40%, 50%, 60%, 70%, 80%, 90%, or even 100%) the expression
(e.g., mRNA and/or protein) and/or one or more activities (e.g., 1,
2, 3, 4, or 5) of one or more (e.g., 1, 2, 3, 4, 5, 6, 7, or 8) of
PARP1, PARP2, PARP5A, PARP5B, PARP7, PARP8, PARP14, and PARP16. In
additional embodiments of this method, the increase in expression
of one or more of PARP1, PARP2, PARP5A, PARP5B, PARP7, PARP8,
PARP14, or PARP16 is an increase in the level of one or more (e.g.,
1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) nucleic acid(s) comprising a
nucleic acid sequence having at least 80% sequence identity (e.g.,
at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100%) to PARP1
(SEQ ID NO: 1 or 2), PARP2 (SEQ ID NO: 3), PARP5A (SEQ ID NO: 8 or
9), PARP5B (SEQ ID NO: 10), PARP14 (SEQ ID NO: 21), or PARP16 (SEQ
ID NO: 24), or an increase in the level of one or more (e.g., 1, 2,
3, 4, 5, 6, 7, 8, 9, or 10) polypeptides encoded by these nucleic
acids. In additional embodiments of this method, the one or more
activities of said one or more of PARP1, PARP2, PARP5A, PARP5B,
PARP7, PARP8, PARP14, or PARP16 is poly-ADP-ribosylation of one or
more (e.g., 1, 2, 3, 4, or 5) target protein(s) (e.g., a protein
localized in the nucleus or mitotic spindle during cytokinesis,
and/or a PARP protein) or is required for progression through
mitosis.
[0022] In additional embodiments of this method, the one or more
PARP activators is one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or
10) nucleic acid(s) containing a nucleic acid sequence having at
least 80% sequence identity (e.g., at least 85%, 90%, 95%, 96%,
97%, 98%, 99%, or even 100%) to PARP1 (SEQ ID NO: 1 or 2), PARP2
(SEQ ID NO: 3), PARP5A (SEQ ID NO: 8 or 9), PARP5B (SEQ ID NO: 10),
PARP14 (SEQ ID NO: 21), or PARP16 (SEQ ID NO: 24). In different
embodiments of this method, the cell or cell population is a plant
cell(s) or mammalian cell(s). In different embodiments of this
method, the contacting results in at least a 10% increase (e.g., at
least a 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or even 100%
increase) in the rate of proliferation of the cell or population of
cells compared to a control cell or cell population (e.g., a cell
or cell population not treated with a PARP activator).
[0023] The invention further provides methods for identifying a
candidate agent for treating or decreasing (e.g., by at least 10%,
20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95%) the likelihood of
developing a stress granule-related disorder requiring the steps
of: providing one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11,
12, 13, 14, 15, 16, 17, 18, 19, or 20) PARP, PARG, and/or ARH3
proteins, and/or PARP, PARG, and/or ARH3 fusion proteins encoded by
a nucleic acid containing a nucleic acid sequence having at least
80% sequence identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%,
99%, or even 100%) to PARP5A (SEQ ID NO: 8 or 9), PARP12 (SEQ ID
NO: 18), PARP13.1 (SEQ ID NO: 19), PARP13.2 (SEQ ID NO: 20), PARP15
(SEQ ID NO: 22 or 23), PARG (SEQ ID NO: 42), or ARH3 (SEQ ID NO:
41); contacting the one or more PARP, PARG, and/or ARH3 proteins,
and/or PARP, PARG, and/or ARH3 fusion proteins with the agent and a
labeled nicotinamide adenine dinucleotide (NAD.sup.+) substrate;
and measuring one or more (e.g., 1, 2, 3, 4, or 5) activities of
the one or more PARP, PARG, and/or ARH3 proteins, and/or PARP,
PARG, and/or ARH3 fusion proteins, or the specific binding of the
agent to said one or more PARP proteins and/or PARP fusion
proteins; wherein an agent that decreases (e.g., by at least 10%,
20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95%) the one or more
activities and/or specifically binds to the one or more (e.g., 1,
2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16) PARP
proteins and/or PARP fusion proteins, and/or increases the activity
of the one or more (e.g., 1, 2, 3, 4, 5, 6, 7, or 8) PARG and/or
ARH3 proteins, and/or PARG and/or ARH3 fusion proteins is
identified as a candidate agent for treating or decreasing the
likelihood of developing a stress granule-related disorder.
[0024] The invention further provides methods for identifying a
candidate agent for treating or decreasing (e.g., by at least 10%,
20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95%) the likelihood of
developing cancer requiring the steps of providing one or more
(e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16)
PARP protein(s) and/or PARP fusion protein(s) encoded by a nucleic
acid containing a nucleic acid sequence having at least 80%
sequence identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%,
99%, or even 100%) to PARP1 (SEQ ID NO: 1 or 2), PARP2 (SEQ ID NO:
3), PARP5A (SEQ ID NO: 8 or 9), PARP5B (SEQ ID NO: 10), PARP7 (SEQ
ID NO: 12), PARP8 (SEQ ID NO: 13), PARP14 (SEQ ID NO: 21), or
PARP16 (SEQ ID NO: 24); contacting the one or more PARP protein(s)
and/or PARP fusion protein(s) with the agent and a labeled
NAD.sup.+ substrate; and measuring the one or more (e.g., 1, 2, 3,
4, or 5) activities of the one or more PARP protein(s) and/or PARP
fusion protein(s), and/or the specific binding of the agent to the
one or more PARP protein(s) and/or PARP fusion protein(s); wherein
an agent that decreases (e.g., at least 10%, 20%, 30%, 40%, 50%,
60%, 70%, 80%, 90%, or 95%) the one or more activities and/or
specifically binds to the one or more PARP protein(s) and/or fusion
protein(s) is identified as a candidate for treating or reducing
the likelihood of developing cancer.
[0025] In different embodiments of the screening methods, the
labeled NAD.sup.+ substrate is labeled with a radioisotope (e.g.,
.sup.32P) or fluorophore, or is biotinylated. In different
embodiments of the screening methods, the one or more PARP, PARG,
and/or ARH3 protein(s) and/or PARP, PARG, and/or ARH3 fusion
protein(s) is purified. In another embodiment of the screening
methods, the one or more PARP, PARG, and/or ARH3 protein(s) and/or
PARP, PARG, and/or ARH3 fusion protein(s) is present in a cell
lysate. In different embodiments of the screening methods, the
agent is a small molecule (e.g., a small molecule from a chemical
library), a polypeptide or peptide fragment (e.g., a polypeptide or
peptide fragment present in a cellular lysate), or a nucleic acid.
In additional embodiments of the above screening methods, the one
or more PARP, PARG, and/or ARH3 protein(s) and/or PARP, PARG,
and/or ARH3 fusion protein(s) is attached to a substrate (e.g., a
magnetic bead) or a solid surface. In additional embodiments of the
above screening methods, the method is performed in a multi-well
plate.
[0026] The invention further provides methods for determining the
propensity of a subject to develop a stress granule-related
disorder by determining the expression and/or one or more (e.g., 1,
2, 3, 4, or 5) activities of one or more (e.g., 1, 2, 3, 4, 5, 6,
7, or 8) of PARP5A, PARP11, PARP12, PARP13.1, PARP13.2, PARP15,
PARG, and ARH3 in a subject, wherein an increase (e.g., at least
10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%) in the
expression (e.g., mRNA and/or protein) and/or one or more (e.g., 1,
2, 3, 4, or 5) activities of one or more (e.g., 1, 2, 3, 4, or 5)
of PARP5A, PARP12, PARP13.1, PARP13.2, and PARP15, and/or a
decrease (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%,
90%, or even 100%) in the expression (e.g., mRNA and/or protein) or
one or more (e.g., 1, 2, 3, 4, or 5) activities of one or more
(e.g., 1, 2, or 3) of PARP11, PARG, or ARH3 indicates an increased
propensity to develop a stress granule-related disorder. In an
additional embodiment of this method, the expression is the level
of one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) nucleic
acid(s) containing a nucleic acid sequence having at least 80%
sequence identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%,
99%, or even 100%) to PARP5A (SEQ ID NO: 8 or 9), PARP5B (SEQ ID
NO: 10), PARP11 (SEQ ID NO: 17), PARP13.1 (SEQ ID NO: 19), PARP13.2
(SEQ ID NO: 20), PARP15 (SEQ ID NO: 20 or 23), PARG (SEQ ID NO:
42), or ARH3 (SEQ ID NO: 41), or the level of one or more (e.g., 1,
2, 3, 4, 5, 6, 7, 8, 9, or 10) polypeptides encoded by these
nucleic acids.
[0027] The invention also provides a method for determining the
propensity of a subject to develop cancer comprising determining
the expression (e.g., mRNA and/or protein) and/or one or more
(e.g., 1, 2, 3, 4, or 5) activities of one or more (e.g., 1, 2, 3,
4, 5, 6, 7, or 8) of PARP1, PARP2, PARP5A, PARP5B, PARP7, PARP8,
PARP14, and PARP16 in a subject, wherein an increase in the
expression and/or one or more activities of one or more (e.g., 1,
2, 3, 4, 5, 6, 7, or 8) of PARP1, PARP2, PARP5A, PARP5B, PARP7,
PARP8, PARP14, and PARP16 indicates an increased propensity to
develop cancer. In an additional embodiment of this method, the
expression is the level of one or more (e.g., 1, 2, 3, 4, 5, 6, 7,
8, 9, or 10) nucleic acid(s) containing a nucleic acid sequence
having at least 80% sequence identity (e.g., at least 85%, 90%,
95%, 96%, 97%, 98%, 99%, or even 100%) to PARP1 (SEQ ID NO: 1 or
2), PARP2 (SEQ ID NO: 3), PARP5A (SEQ ID NO: 8 or 9), PARP5B (SEQ
ID NO: 10), PARP7 (SEQ ID NO: 12), PARP8 (SEQ ID NO: 13), PARP14
(SEQ ID NO: 21), or PARP16 (SEQ ID NO: 24), or the level of one or
more polypeptides (e.g., 1, 2, 3, 4, 5, 6, 7, or 8) encoded by
these nucleic acids.
[0028] In any of the above screening methods, the expression of the
one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) nucleic
acid(s) is determined using reverse transcriptase polymerase chain
reaction (RT-PCR). In additional embodiments of the above screening
methods, the expression of the one or more (e.g., 1, 2, 3, 4, 5, 6,
7, 8, 9, or 10) polypeptide(s) is determined using an
antibody-based technique (e.g., immunoblotting or an enzyme-linked
immunosorbent assay (ELISA)).
[0029] In all of the above aspects, a stress granule-related
disorder may be a cardiovascular disorder (e.g., an aneurysm,
angina, atherosclerosis, stroke, cerebrovascular disease,
congestive heart failure, coronary artery disease, myocardial
disease, peripheral vascular disease, granulomatous myocarditis,
chronic myocarditis, myocardial infarction, and primary
hypertrophic cardiomyopathy), an inflammatory disorder (e.g., an
autoimmune disease, asthma, an allergic intraocular inflammatory
disease, arthritis, atopic dermatitis, atopic eczema, cirrhosis,
Crohn's disease, ulcerative colitis, diabetes, hemolytic anemia,
inflammatory dermatosis, an inflammatory bowel disorder, systemic
lupus erythamatosus, psoriasis, rheumatoid arthritis, Wegener's
granulomatosis, Hashimoto's thyroiditis, chronic pancreatitis, and
reactive lymphoid hyperplasia), a neurological disorder (e.g.,
multiple sclerosis, Alzheimer's disease, Parkinson's disease,
Huntingon's disease, amyotrophic lateral sclerosis, retinosa
pigmentosum, macular degeneration, traumatic brain injury, stroke,
and peripheral neuropathy), or ischemic-reperfusion injury. In
different embodiments of all the above aspects, the treating may
result in a reduction (e.g., at least 5%, 10%, 20%, 30%, 40%, 50%,
60%, 70%, 80%, 90%, or even 100% reduction) in one or more (e.g.,
1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) symptoms of a stress
granule-related disorder or a reduction (e.g., at least a 5%, 10%,
20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or even 100% reduction) in
the likelihood of developing a stress granule-related disorder.
[0030] In all the above aspects, the cancer may be colon
adenocarcinoma, esophagas adenocarcinoma, liver hepatocellular
carcinoma, squamous cell carcinoma, pancreas adenocarcinoma, islet
cell tumor, rectum adenocarcinoma, gastrointestinal stromal tumor,
stomach adenocarcinoma, adrenal cortical carcinoma, follicular
carcinoma, papillary carcinoma, breast cancer, ductal carcinoma,
lobular carcinoma, intraductal carcinoma, mucinous carcinoma,
phyllodes tumor, Ewing's sarcoma, ovarian adenocarcinoma,
endometrium adenocarcinoma, granulose cell tumor, mucinous
cystadenocarcinoma, cervix adenocarcinoma, vulva squamous cell
carcinoma, basal cell carcinoma, prostate adenocarcinoma, giant
cell tumor of bone, bone osteosarcoma, larynx carcinoma, lung
adenocarcinoma, kidney carcinoma, urinary bladder carcinoma, Wilm's
tumor, lymphoma, and non-Hodgkin's lymphoma. In different
embodiments of all the above aspects, said treating may result in a
reduction (e.g., at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%,
80%, 90%, or even 100% reduction) in one or more (e.g., 1, 2, 3, 4,
5, 6, 7, 8, 9, or 10) symptoms of a cancer or a reduction (e.g., at
least a 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or even
100% reduction) in the likelihood of developing a cancer.
[0031] In all the above aspects of the invention, the cell or
population of cells is an epithelial cell, a fibroblast, a kidney
cell, a muscle cell, a neuron, a hepatocyte, an oocyte, a sperm, a
lymphocyte, or a macrophage.
[0032] In all the above aspects of the invention, the compositions
may be formulated for parenteral or oral administration.
[0033] By the term "ARH3" or "poly-ADP-ribose glycohydrolase ARH3"
is meant a nucleic acid having containing a sequence at least 80%
identical (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or
even 100% identical) to the sequence of SEQ ID NO: 41, or one or
more polypeptides encoded by these nucleic acids.
[0034] By the term "ARH3 fusion protein" or "poly-ADP-ribose
glycohydrolase ARH3 fusion protein" is meant a polypeptide
containing a polypeptide tag and a sequence having at least 80%
identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even
100% identity) to a protein encoded by ARH3 (SEQ ID NO: 41). The
polypeptide tag of an ARH3 fusion protein may be located at the N-
and/or C-terminus of the protein. The polypeptide tag may contain
one or more of a fluorescent protein (e.g., a green fluorescence
protein), a peptide epitope recognized by specific antibodies, a
protein that is bound by a partner binding protein with high
affinity (e.g., biotin and streptavidin), a His.sub.6-tag, or one
or more (e.g., 1, 2, 3, 4, 5, 6, or 7) protease recognition
sequence(s) (e.g., one or more of a TEV protease or Factor Xa
protease recognition sequence). ARH3 fusion proteins may be
purified using antibodies specific for the polypeptide tag. For
example, antibodies specific for the polypeptide tag or proteins
that bind specifically to the protein sequence in the polypeptide
tag may bound to a bead (e.g., a magnetic bead) or polymer surface
in order to allow for the purification of the ARH3 fusion protein.
An ARH3 fusion protein may also be purified and subsequently
treated with one or more (e.g., 1, 2, or 3) protease(s) to remove
the polypeptide tag from the ARH3 fusion protein. An ARH3 fusion
protein preferably has the same cellular localization and
biological activity as the wild-type ARH3 protein. Methods for the
generation and purification of ARH3 fusion proteins are described
herein.
[0035] By the term "biotinylated" is meant the covalent attachment
of a biotin molecule to a small molecule, surface, or protein. A
biotin molecule may be attached to a small molecule, surface, or
protein using methods known in the art including, but not limited
to, attachment to primary amines (e.g., epsilon-amines and
N-terminal .alpha.-amines of a protein), as well as attachment at a
sulfhydryl group, and a carboxyl group. Small molecules (e.g.,
NAD.sup.+) and proteins (e.g., one or more of the PARP fusion
proteins described herein) may be biotinylated. Biotinylated
NAD.sup.+ is available from a number of commercial sources
including R & D Systems, Gentaur, and Trevigen (e.g.,
6-biotin-17-NAD). Biotinylated small molecules and substrates may
be specifically bound and/or purified using streptavidin, a protein
that has a high affinity for biotin (Ka.about.10.sup.13 M.sup.-1),
or surfaces covalently attached to streptavidin (e.g.,
streptavidin-coated beads).
[0036] By the term "cancer" is meant a disease of uncontrolled or
misregulated cell proliferation or cell division. Non-limiting
examples of cancer include colon adenocarcinoma, esophagas
adenocarcinoma, liver hepatocellular carcinoma, squamous cell
carcinoma, pancreas adenocarcinoma, islet cell tumor, rectum
adenocarcinoma, gastrointestinal stromal tumor, stomach
adenocarcinoma, adrenal cortical carcinoma, follicular carcinoma,
papillary carcinoma, breast cancer, ductal carcinoma, lobular
carcinoma, intraductal carcinoma, mucinous carcinoma, phyllodes
tumor, Ewing's sarcoma, ovarian adenocarcinoma, endometrium
adenocarcinoma, granulose cell tumor, mucinous cystadenocarcinoma,
cervix adenocarcinoma, vulva squamous cell carcinoma, basal cell
carcinoma, prostate adenocarcinoma, giant cell tumor of bone, bone
osteosarcoma, larynx carcinoma, lung adenocarcinoma, kidney
carcinoma, urinary bladder carcinoma, Wilm's tumor, lymphoma, and
non-Hodgkin's lymphoma.
[0037] By the term "cell lysate" is meant the contents of the cell
once the plasma membrane has been disrupted or permeabilized. Cell
lysate also includes the contents of the intracellular organelles
(e.g., endoplasmic reticulum, nucleus, mitochondria, chloroplasts,
Golgi apparatus, and lysosome) upon disruption of their respective
membranes. Cell lysate contains an unpurified mixture of proteins,
small molecule metabolites, and nucleic acids (e.g., DNA and RNA).
Cell lysate may be prepared from any type of cell, e.g., a
mammalian cell (e.g. human, mouse, rat, and monkey cell), a
bacterial cell, fungal cell, and a yeast cell. Cell lysate may be
obtained by any methods known in the art including physical
disruption (e.g., sonication, homogenization, or freeze/thaw
procedures) or chemical disruption (e.g., treatment with a
detergent (e.g., Triton-X-100 and NP-40)). Cell lysate may be
prepared from a cell expressing one or more of the nucleic acid(s)
that encode one or more PARP, PARG, and/or ARH3 proteins and/or one
or more PARP, PARG, and/or ARH3 fusion protein(s). Cell lysate may
also be prepared from a cell arrested in a specific stage of the
cell cycle (e.g., mitosis or S-phase) or may be prepared from
asynchronous cells.
[0038] By the term "constitutive promoter" is meant a promoter that
is placed 5' relative to a nucleic acid sequence encoding a
protein, wherein the promoter regulates the consistent expression
of a nucleic acid encoding a protein. The sequence of the
constitutive promoter may be directly (no extraneous nucleotides)
5' to the first nucleotide of the sequence encoding the protein
(e.g., a PARP, PARG, and/or ARH3 protein and/or a PARP, PARG,
and/or ARH3 fusion protein as described herein) or may be between
1-20 nucleotides, 1-100 nucleotides, 10-260 nucleotides, 100-700
nucleotides, or 100 to 2,000 nucleotides from the first nucleotide
of the sequence encoding the protein. Examples of constitute
promoters include, but are not limited to, bacterial promoters
(e.g., E. coli .sigma..sup.70, .sigma..sup.S, .sigma..sup.32, or
.sigma..sup.54 promoters; B. subtilis .sigma..sup.A or
.sigma..sup.B promoters; T7 RNA polymerase-based promoters; and
bacteriophage SP6 promoter), yeast promoters (e.g., pCyc, pAdh,
pSte5, ADH1, cyc100, cyc70, cyc43, cyc28, cyc16, pPGK1, pCYC, GPD
(TDH3), and CLB1 promoters), and mammalian promoters (e.g.,
cytomegalovirus immediate early gene-based promoters, SV40 early
promoter, and Rous sarcoma virus promoter). A constitutive promoter
may be used to mediate the expression of a nucleic acid (e.g., one
or more nucleic acids encoding a PARP, PARG, and/or ARH3 protein,
and/or a PARP, PARG, and/or ARH3 fusion protein as described
herein) in a transgenic mammalian, bacterial, or yeast cell.
[0039] By the term "disassembly" of a stress granule is meant the
process of deconstructing or dissolution of one or more stress
granules in a cell or cell population. The disassembly of a stress
granule may take place by the catalytic activity of one or more
proteins (e.g., one or more of a PARG, ARH3, and/or PARP11, and/or
a PARG, ARH3, and/or PARP11 fusion protein). The disassembly of a
stress granule in a cell or cell population may occur following the
removal of a stress condition (e.g., washout of sodium arsenite or
pateamine A from the culture medium).
[0040] By the term "effective amount" or "therapeutically effective
amount" is meant the amount of the agent administered to a subject,
to a cell, or to a cell population that elicits a specific
desirable effect. For example, the amount of an agent (e.g., one or
more PARP inhibitor(s), one or more PARG activator(s), and/or one
or more PARP11 activator(s)) that decreases the number (e.g.,
prevents 1, 2, 3, 4, or 5 symptoms from occurring) or severity
(e.g., decrease of at least 5%, 10%, 15%, 20%, 25%, 30%, 40%, 50%,
60%, 70%, 80%, 90%, or 95% in the severity) of one or more (e.g.,
1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) symptoms of a stress
granule-related disorder or the amount of an agent (e.g., one or
more PARP inhibitor(s)) that decreases the number or severity of
one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) symptoms of
cancer. The effective amount or therapeutically effective amount of
an agent may determined by a skilled artisan using methods known in
the art and the methods described herein.
[0041] By "formation" of a stress granule is meant a series of
events that lead to the appearance of distinct protein- and
RNA-containing stress granules in the cytoplasm. The formation of a
stress granule in a cell may be accelerated by exposure to stress
conditions, including, but not limited to, chemical stress (e.g.,
sodium arsenite and pateamine A). By "nucleation" of a stress
granule is meant one of the initial steps or initial rate-limiting
steps in the formation of a stress granule in a cell. Examples of
proteins involved in the formation or nucleation of stress granules
include, without limitation, PARP 5A, PARP12, PARP13.1, PARP13.2,
and PARP 15.
[0042] By "labeled nicotinamide adenine dinucleotide" or "labeled
NAD.sup.+" is meant a molecule of nicotinamide adenine dinucleotide
(NAD.sup.+) that is covalently labeled with a fluorescent molecule,
a colorimetric molecule, or a molecule that is recognized by a
specific partner protein (e.g., biotinylation), or labeled with a
radioisotope. One example of a labeled NAD.sup.+ is biotinylated
NAD.sup.+ (e.g., 6-biotin-14-NAD). Examples of radiolabeled
NAD.sup.+ include, but are not limited to,
.sup.14C-adenine-NAD.sup.+, .sup.32P-NAD.sup.+, and
.sup.3H-NAD.sup.+. Additional examples of labeled NAD.sup.+ are
known in the art.
[0043] By the term "short RNA or DNA aptamer" is meant a short
sequence of DNA or RNA nucleotides that binds to a specific target
molecule (e.g., a protein or a target RNA or DNA molecule). A DNA
or RNA aptamer that specifically binds to its target molecule
(e.g., one or more (e.g., 1, 2, 3, 4, or 5) of the nucleic acids
encoding a PARP, PARG, and/or ARH3 protein, and/or a PARP, PARG,
and/or ARH3 fusion protein (as described herein) may decrease
(e.g., by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or
100%) or increase (e.g., by at least 10%, 20%, 30%, 40%, 50%, 60%,
70%, 80%, 90%, or 100%) one or more (e.g., 1, 2, 3, 4, or 5)
activities or expression (e.g., mRNA or protein level) of the
respective target molecule. For example, a specific DNA or RNA
aptamer may bind to one or more of the above-described PARP
proteins or PARP fusion proteins and increase or decrease the
poly-ADP ribosylation activity of the protein, the amount of
poly-ADP ribose attached to the protein, or the levels of one or
more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) PARP proteins or PARP
fusion proteins. The specific DNA or RNA aptamer may also bind to
one or more nucleic acids (e.g., DNA or RNA) that encode a specific
PARP, PARG, and/or ARH3 protein (e.g., a nucleic acid that encodes
a protein having at least 80% sequence identity (e.g., at least
85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100%) to PARP1 (SEQ ID
NO: 1 or 2), PARP2 (SEQ ID NO: 3), PARP3 (SEQ ID NO: 4), PARP3.2
(SEQ ID NO: 5), PARP3.3 (SEQ ID NO: 6), PARP4 (SEQ ID NO: 7),
PARP5A (SEQ ID NO: 8 or 9), PARP5B (SEQ ID NO: 10), PARP6 (SEQ ID
NO: 11), PARP7 (SEQ ID NO: 12), PARP8 (SEQ ID NO: 13), PARP9 (SEQ
ID NO: 14), PARP10 (SEQ ID NO: 15), PARP10.2 (SEQ ID NO: 16),
PARP11 (SEQ ID NO: 17), PARP12 (SEQ ID NO: 18), PARP13.1 (SEQ ID
NO: 19), PARP13.2 (SEQ ID NO: 20), PARP14 (SEQ ID NO: 21), PARP15.1
(SEQ ID NO: 22), PARP15.2 (SEQ ID NO: 23), PARP16 (SEQ ID NO: 24),
PARG (SEQ ID NO: 42), and ARH3 (SEQ ID NO: 41)), and mediate an
increase or decrease in the expression (e.g., protein and/or mRNA
level) of the PARP, PARG, or ARH3. A specific example of an RNA
aptamer is an inhibitory RNA (RNAi) molecule. Methods for the
design of RNAi molecules are known in the art. Examples of specific
RNAi molecules that may be used to decrease the expression of a
PARP, PARG, and/or ARH3 protein, and/or PARP, PARG, and/or ARH3
fusion protein are described herein.
[0044] By the term "fluorescent protein" is meant a protein that
absorbs light of a specific wavelength (e.g., absorption
wavelength) and emits light with a longer wavelength (e.g.,
emission wavelength). The term fluorescent protein encompasses
natural fluorescent proteins (i.e., the natural form of the
fluorescent protein without any genetic manipulations) and
genetically mutated fluorescent proteins (e.g., fluorescent
proteins engineered to change the identity of one or more amino
acid residues). Several different examples of fluorescent proteins
are known in the art, including, but limited to, green fluorescent
proteins (e.g., GFP, Emerald, Superfolder GFP, Azami Green,
mWasabi, TagGFP, TurboGFP, AcGFP, ZsGreen, T-Sapphire, and
T-Sapphire), blue fluorescent proteins (e.g., EBFP, EBFP2, Azurite,
mTagBFP), cyan fluorescent proteins (e.g., ECFP, mECFP, Cerulean,
CyPet, AmCyan1, Midori-Ishi Cyan, TagCFP, mTFP1 (Teal)), yellow
fluorescent proteins (e.g., EYFP, Topaz, Venus, mCitrine, YPet,
TanYFP, PhiYFP, ZsYellow1, and mBanana), orange fluorescent
proteins (e.g., Kurabira Orange, Kurabira Orange2, mOrange,
mOrange2, dTomato, dTomato-Tandem, TagRFP, TagRFP-T, DsRed, DsRed2,
DsRed-Express (T1), DsRed-Monomer, and mTangerine), and red
fluorescent proteins (e.g., mRuby, mApple, mStrawberry, AsRed2,
mRFP1, JRed, mCherry, HcRed1, mRaspberry, dKeima-Tandem,
HcRed-Tandem, mPlum, and AQ143). Fluorescent proteins may be
attached to the N- and/or C-terminus of a target protein (e.g., one
or more of the PARP, PARG, and/or ARH3 fusion proteins described
herein). Fusion proteins tagged with a fluorescent protein (e.g.,
one or more of the PARP, PARG, and/or ARH3 fusion proteins
described herein) may be analyzed using fluorescence-based
techniques known in the art (e.g., fluorescence microscopy,
fluorescence plate readers, fluorescence-assisted cell sorting, and
use of a second antibody specific for the fluorescent protein).
[0045] By the term "inducible promoter" is meant a promoter that is
placed 5' relative to a nucleic acid sequence encoding a protein,
wherein the promoter induces (or represses) the expression of a
nucleic acid upon addition (or removal) of a specific molecule or
protein. The sequence of the inducible promoter may be directly (no
extraneous nucleotides) 5' to the first nucleotide of the sequence
encoding the protein (e.g., a PARP fusion protein as described
herein) or may be between 1-20 nucleotides, 1-100 nucleotides,
10-260 nucleotides, 100-700 nucleotides, or 100 to 2,000
nucleotides from the first nucleotide of the sequence encoding the
protein. Examples of inducible promoters include, but are not
limited to alcohol dehydrogenase I gene promoters,
tetracycline-responsive promoter systems, glucocorticoid receptor
promoters, estrogen receptor promoter, ecdysone receptor promoters,
metallothionein-based promoters, and T7-polymerase based promoters.
An inducible promoter may be used to regulate the expression of a
nucleic acid (e.g., one or more nucleic acids encoding a PARP,
PARG, and/or ARH3 protein and/or PARP, PARG, and/or ARH3 fusion
protein as described herein) in a transgenic mammalian, bacterial,
or yeast cell.
[0046] By the term "nuclear lysate" is meant the contents of a
nucleus upon disruption of the nuclear membrane. Nuclear lysate
contains an unpurified mixture of proteins, small molecule
metabolites, and nucleic acids (e.g., DNA and RNA). Nuclear lysate
may be prepared from any type of nucleated cell, e.g., a mammalian
cell (e.g. human, mouse, rat, and monkey cell), a fungal cell, a
yeast cell, or a plant cell. Nuclear lysate may be obtained by any
methods known in the art including stepped lysis using two
different concentrations of detergents (e.g., NP-40) or a
combination of physical treatment to rupture the plasma membrane
and chemical treatment to rupture the nuclear membrane. Nuclear
lysate may be prepared from a cell expressing one or more of the
nucleic acid(s) of the invention that encode a one or more PARP,
PARG, or ARH3 proteins or PARP, PARG, or ARH3 fusion
protein(s).
[0047] By "PAR" or "poly-ADP ribose" is meant a chain of two or
more ADP-ribose molecules. The two or more molecules of ADP-ribose
making up PAR may occur in a single linear chain or as a branched
chain with one or more branches (e.g., at least 1, 2, 3, 4, 5, 6,
7, 8, 9, or 10 branches). Poly-ADP ribose may be attached to a
specific substrate (e.g., protein, lipid, DNA, RNA, or small
molecule) by the activity of one or more PARP proteins or PARP
fusion proteins (e.g., one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8,
9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22) of PARP1,
PARP2, PARP3, PARP3.2, PARP3.3, PARP4, PARP5A, PARP5B, PARP6,
PARP7, PARP8, PARP9, PARP10, PARP11, PARP12, PARP13.1, PARP13.2,
PARP14, PARP15.1, PARP15.2, and PARP16, or one or more of their
respective fusion proteins) or removed by the activity of one or
more PARG protein, PARG fusion protein, ARH3 protein, or ARH3
fusion protein (e.g., PARG protein or ARH3). Attachment of
poly-ADP-ribose to a substrate protein may affect the biological
activity of the substrate protein, localization of the protein, or
the identity and number of proteins that bind to the target
substrate (e.g., protein). PARP proteins may also be modified by
the covalent attachment of poly-ADP-ribose. The addition of
poly-ADP ribose to a PARP protein may occur by "auto-modification"
or "auto-modulation" (i.e., a specific PARP catalyzes the
attachment of poly-ADP ribose to itself) or may occur by the
activity of one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10)
other PARP proteins.
[0048] By the term "poly-ADP-ribose glycolase" or "PARG" is meant
any enzyme that has the ability to remove an ADP-ribose attached to
a substrate (e.g., a protein, RNA molecule, DNA molecule, or lipid)
or to remove one or more ADP-ribose molecules from a pre-existing
poly-ADP-ribose molecule covalently attached to a substrate (e.g.,
a protein, RNA molecule, DNA molecule, or lipid). For example, a
PARG may be one or more nucleic acids containing a sequence having
at least 80% identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%,
99%, or even 100%) to PARG (SEQ ID NO: 42) or ARH3 (SEQ ID NO: 41),
or one or more polypeptides encoded by these nucleic acids. A PARG
may have additional biological activities, such as decreasing
(e.g., by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%,
95%, or even 100%) the formation or rate of formation of a stress
granule in a cell or increasing the rate of disassembly of a stress
granule. The term PARG also includes the isoforms of PARG proteins
described in Meyer-Ficca et al., Exp. Cell. Res. 297(2):521-532,
2004.
[0049] By the term "PARG protein" or "poly-ADP-ribose glycolase
protein" is meant is meant a polypeptide encoded by a nucleic acid
containing a sequence having at least 80% sequence identity (e.g.,
at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100% identical)
to the sequence of SEQ ID NO: 42.
[0050] By the term "PARG fusion protein" or "poly-ADP-ribose
glycolase fusion protein" is meant a polypeptide containing a
polypeptide tag and a sequence encoded by a nucleic acid containing
a sequence having at least 80% sequence identity (e.g., at least
85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100% identity) to PARG
(SEQ ID NO: 42). The polypeptide tag of a PARG fusion protein may
be located at the N- and/or C-terminus of the protein. The
polypeptide tag may contain one or more of a fluorescent protein
(e.g., a green fluorescence protein), a peptide epitope recognized
by specific antibodies, a protein that is bound by a partner
binding protein with high affinity (e.g., biotin and streptavidin),
a His.sub.6-tag, or one or more (e.g., 1, 2, 3, 4, 5, 6, or 7)
protease recognition sequence(s) (e.g., one or more of a TEV
protease or Factor Xa protease recognition sequence). PARG fusion
proteins may be purified using antibodies specific for the
polypeptide tag. For example, antibodies specific for the
polypeptide tag or proteins that bind specifically to the protein
sequence in the polypeptide tag may bound to a bead (e.g., a
magnetic bead) or polymer surface in order to allow for the
purification of the PARG fusion protein. A PARG fusion protein may
also be purified and subsequently treated with one or more (e.g.,
1, 2, or 3) protease(s) to remove the polypeptide tag from the PARG
fusion protein. A PARG fusion protein preferably has the same
cellular localization and biological activity as the wild-type PARG
protein. Methods for the generation and purification of PARG fusion
proteins are described herein.
[0051] By the term "poly-ADP-ribose glycolase activator" or "PARG
activator" is meant an agent that increases (e.g., at least 10%,
20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or even 100%) the
expression (e.g., protein and/or mRNA level) or one or more (e.g.,
1, 2, 3, 4, or 5) biological activities of one or more (e.g., 1, 2,
3, 4, 5, 6, 7, 8, 9, or 10) PARG proteins. For example, a PARG
activator may increase the levels of one or more (e.g., 1, 2, 3, 4,
5, 6, 7, 8, 9, or 10) nucleic acids containing a nucleic acid
sequence having at least 80% sequence identity (e.g., at least 85%,
90%, 95%, 96%, 97%, 98%, 99%, or even 100%) to PARG (SEQ ID NO: 42)
or ARH3 (SEQ ID NO: 41), or increase the level of one or more
(e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) polypeptides encoded by
these nucleic acids. A PARG activator may increase one or more of
the biological activities of a PARG including the ability to remove
a ADP-ribose attached to a substrate (e.g., a protein, RNA
molecule, DNA molecule, lipid, or small molecule), the ability to
remove one or more ADP-ribose molecules from a pre-existing
poly-ADP-ribose molecule covalently attached to one or more
substrate(s) (e.g., a protein, RNA molecule, DNA molecule, lipid,
or small molecule), the ability to decrease or prevent the
formation or the rate of formation of a stress granule in a cell,
or the ability to increase the rate of disassembly of a stress
granule. Non-limiting examples of PARG activators include one or
more nucleic acids containing a nucleic acid having at least 80%
sequence identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%,
99%, or even 100%) to PARG (SEQ ID NO: 42) or ARH3 (SEQ ID NO:
41).
[0052] By the term "poly-ADP-ribose glycolase inhibitor" or "PARG
inhibitor" is meant an agent that decreases (e.g., at least 10%,
20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or even 100%) the
expression (e.g., protein and/or mRNA level) or one or more (e.g.,
1, 2, 3, 4, or 5) biological activities of one or more (e.g., 1, 2,
3, 4, 5, 6, 7, 8, 9, or 10) PARGs. For example, a PARG inhibitor
may decrease the levels of one or more (e.g., 1, 2, 3, 4, 5, 6, 7,
8, 9, or 10) nucleic acids containing a nucleic acid sequence
having at least 80% sequence identity (e.g., at least 85%, 90%,
95%, 96%, 97%, 98%, 99%, or even 100%) to PARG (SEQ ID NO: 42) or
ARH3 (SEQ ID NO: 41), or decrease the level of one or more (e.g.,
1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) polypeptides encoded by these
nucleic acids. A PARG activator may decrease one or more (e.g., 1,
2, 3, 4, or 5) of the biological activities of a PARG including,
but not limited to, the ability to remove a ADP-ribose attached to
one or more substrate(s) (e.g., a protein, RNA molecule, DNA
molecule, lipid, or small molecule), the ability to remove one or
more ADP-ribose molecules from a pre-existing poly-ADP-ribose
molecule covalently attached to a substrate (e.g., a protein, RNA
molecule, DNA molecule, lipid, or small molecule), the ability to
decrease or prevent the formation or the rate of formation of a
stress granule in a cell, or the ability to increase the rate of
disassembly of a stress granule. Non-limiting examples of PARG
inhibitors include antibodies or antibody fragments that
specifically bind to PARG protein, ARH3 protein, PARG fusion
protein, or ARH3 fusion protein; RNAi molecules (e.g., a nucleic
acid sequence that contains the sequence of one of SEQ ID NOS:
34-37), or small molecules.
[0053] By the term "peptide fragment" is meant a protein having at
least 2 amino acids (e.g., at least 5, 10, 15, 20, 25, 30, 35, 40,
45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 amino acids),
but having fewer amino acids than the wild-type protein.
Non-limiting examples of peptide fragments have between 2 to 250
amino acids, 5 to 200 amino acids, between 5 to 150 amino acids, or
between 5 to 100 amino acids. A peptide fragment may also represent
a protein that has been processed to remove one or more (e.g., 1,
2, or 3) post-translational targeting sequences (e.g., nuclear
localization sequence, ER signal peptide, mitochondrial targeting
signal, nuclear export sequence, or N-terminal secretion
sequence).
[0054] By "poly-ADP ribose polymerase nucleic acid" or "PARP
nucleic acid" is meant any nucleic acid containing a sequence that
has at least 80% sequence identity (e.g., at least 85%, 90%, 95%,
96%, 97%, 98%, 99%, or even 100% sequence identity) to one or more
of PARP1 (SEQ ID NO: 1 or 2), PARP2 (SEQ ID NO: 3), PARP3 (SEQ ID
NO: 4), PARP3.2 (SEQ ID NO: 5), PARP3.3 (SEQ ID NO: 6), PARP4 (SEQ
ID NO: 7), PARP5A (SEQ ID NO: 8 or 9), PARP5B (SEQ ID NO: 10),
PARP6 (SEQ ID NO: 11), PARP7 (SEQ ID NO: 12), PARP8 (SEQ ID NO:
13), PARP9 (SEQ ID NO: 14), PARP10 (SEQ ID NO: 15), PARP10.2 (SEQ
ID NO: 16), PARP11 (SEQ ID NO: 17), PARP12 (SEQ ID NO: 18),
PARP13.1 (SEQ ID NO: 19), PARP13.2 (SEQ ID NO: 20), PARP14 (SEQ ID
NO: 21), PARP15.1 (SEQ ID NO: 22), PARP15.2 (SEQ ID NO: 23), and
PARP16 (SEQ ID NO: 24). A PARP nucleic acid encodes a protein that
has a catalytic activity of attaching an ADP-ribose to a substrate
(e.g., protein, DNA, RNA, lipid, or small molecule) or attaching
one or more ADP-ribose molecules to an ADP-ribose molecule already
attached to the substrate (e.g., protein, DNA, RNA, lipid, or small
molecule) to create poly-ADP ribose. A PARP nucleic acid may encode
a protein having additional activities to those described above
(e.g., mediates increased stress granule formation, role in
progression through mitosis or cytokinesis, and modulation (e.g.,
increase or decrease) of RNAi function).
[0055] By "poly-ADP ribose polymerase protein" or "PARP protein" is
meant polypeptide containing a sequence having at least 80%
identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even
100% identity) to a protein encoded by a nucleic acid sequence
containing the sequence of PARP1 (SEQ ID NO: 1 or 2), PARP2 (SEQ ID
NO: 3), PARP3 (SEQ ID NO: 4), PARP3.2 (SEQ ID NO: 5), PARP3.3 (SEQ
ID NO: 6), PARP4 (SEQ ID NO: 7), PARP5A (SEQ ID NO: 8 or 9), PARP5B
(SEQ ID NO: 10), PARP6 (SEQ ID NO: 11), PARP7 (SEQ ID NO: 12),
PARP8 (SEQ ID NO: 13), PARP9 (SEQ ID NO: 14), PARP10 (SEQ ID NO:
15), PARP10.2 (SEQ ID NO: 16), PARP11 (SEQ ID NO: 17), PARP12 (SEQ
ID NO: 18), PARP13.1 (SEQ ID NO: 19), PARP13.2 (SEQ ID NO: 20),
PARP14 (SEQ ID NO: 21), PARP15.1 (SEQ ID NO: 22), PARP15.2 (SEQ ID
NO: 23), and PARP16 (SEQ ID NO: 24). A PARP protein may contain one
or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) post-translational
modifications, e.g., phosphorylation and ADP-ribosylation (e.g., at
least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 ADP-ribose molecules) on one
or more amino acid residues. Post-translation modification of a
PARP protein may occur within a cell (e.g., a transgenic cell
described above) or in vitro using purified enzymes. PARP protein
activity assays may be performed as described herein.
[0056] By "poly-ADP ribose polymerase fusion protein" or "PARP
fusion protein" is meant a polypeptide containing a polypeptide tag
and a sequence having at least 80% identity (e.g., at least 85%,
90%, 95%, 96%, 97%, 98%, 99%, or even 100% identity) to a protein
encoded by one or more of PARP1 (SEQ ID NO: 1 or 2), PARP2 (SEQ ID
NO: 3), PARP3 (SEQ ID NO: 4), PARP3.2 (SEQ ID NO: 5), PARP3.3 (SEQ
ID NO: 6), PARP4 (SEQ ID NO: 7), PARP5A (SEQ ID NO: 8 or 9), PARP5B
(SEQ ID NO: 10), PARP6 (SEQ ID NO: 11), PARP7 (SEQ ID NO: 12),
PARP8 (SEQ ID NO: 13), PARP9 (SEQ ID NO: 14), PARP10 (SEQ ID NO:
15), PARP10.2 (SEQ ID NO: 16), PARP11 (SEQ ID NO: 17), PARP12 (SEQ
ID NO: 18), PARP13.1 (SEQ ID NO: 19), PARP13.2 (SEQ ID NO: 20),
PARP14 (SEQ ID NO: 21), PARP15.1 (SEQ ID NO: 22), PARP15.2 (SEQ ID
NO: 23), and PARP16 (SEQ ID NO: 24). The polypeptide tag of a PARP
fusion protein may be located at the N- and/or C-terminus of the
protein. The polypeptide tag may contain one or more of a
fluorescent protein (e.g., a green fluorescence protein), a peptide
epitope recognized by specific antibodies, a protein that is bound
by a partner binding protein with high affinity (e.g., biotin and
streptavidin), a His.sub.6-tag, or one or more (e.g., 1, 2, 3, 4,
5, 6, or 7) protease recognition sequence(s) (e.g., one or more of
a TEV protease or Factor Xa protease recognition sequence). The
PARP fusion proteins of the invention may be purified using
antibodies specific for the polypeptide tag. For example,
antibodies specific for the polypeptide tag or proteins that bind
specifically to the protein sequence in the polypeptide tag may be
bound to a bead (e.g., a magnetic bead) or polymer surface in order
to allow for the purification of the PARP fusion protein. A PARP
fusion protein may also be purified and subsequently treated with
one or more (e.g., 1, 2, or 3) protease(s) to remove the
polypeptide tag from the PARP fusion protein. A PARP fusion protein
preferably has the same cellular localization and biological
activity as the wild-type PARP protein. Methods for the generation
and purification of PARP fusion proteins are described herein.
[0057] By "PARP activator" or "poly-ADP-ribose polymerase
activator" is meant an agent that increases the expression (e.g.,
mRNA or protein level) and/or one or more (e.g., 1, 2, 3, 4, 5, 6,
7, 8, 9, or 10) biological activities of one or more PARPs. For
example, a PARP activator may increase the level of one or more
(e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17,
18, 19, or 20) PARP nucleic acids or PARP proteins (described
above). A PARP activator may increase one or more biological
activities of a PARP protein including, but not limited to, the
ability to attach a poly-ADP-ribose molecule to one or more
substrate(s) (e.g., a protein, DNA molecule, RNA molecule, lipid,
or small molecule), the ability to promote formation of a stress
granule, the ability to nucleate the formation of a stress granule,
the ability to disassemble a stress granule, the ability to
decrease stress granule assembly, the ability to localize to a
stress granule, the ability of a PARP protein to bind to one or
more of its substrates, the ability of a PARP protein to localize
to the nucleus or the mitotic spindle, the ability to promote cell
proliferation, and the ability to promote progression through
cytokinesis. Specific PARP activators include nucleic acids
encoding one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12,
13, 14, 15, 16, 17, 18, 19, or 20) PARPs or the catalytic domains
of one or more PARPs. For example, a PARP activator may be a
nucleic acid containing a nucleic acid sequence having at least 80%
sequence identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%,
99%, or even 100%) to PARP1 (SEQ ID NO: 1 or 2), PARP2 (SEQ ID NO:
3), PARP3 (SEQ ID NO: 4), PARP3.2 (SEQ ID NO: 5), PARP3.3 (SEQ ID
NO: 6), PARP4 (SEQ ID NO: 7), PARP5A (SEQ ID NO: 8 or 9), PARP5B
(SEQ ID NO: 10), PARP6 (SEQ ID NO: 11), PARP7 (SEQ ID NO: 12),
PARP8 (SEQ ID NO: 13), PARP9 (SEQ ID NO: 14), PARP10 (SEQ ID NO:
15), PARP10.2 (SEQ ID NO: 16), PARP11 (SEQ ID NO: 17), PARP12 (SEQ
ID NO: 18), PARP13.1 (SEQ ID NO: 19), PARP13.2 (SEQ ID NO: 20),
PARP14 (SEQ ID NO: 21), PARP15.1 (SEQ ID NO: 22), PARP15.2 (SEQ ID
NO: 23), and PARP16 (SEQ ID NO: 24). Specific PARP activators may
increase the expression and/or one or more (e.g., 1, 2, 3, 4, or 5)
biological activities of a specific PARP or a specific subset of
PARPs (e.g., one or more of PARP5A, PARP12, PARP13.1, PARP13.2, and
PARP15; PARP11; and one or more of PARP1, PARP2, PARP5A, PARP5B,
PARP7, PARP8, PARP14, and PARP16).
[0058] By "PARP inhibitor" or "poly-ADP-ribose polymerase
inhibitor" is meant an agent that decreases the expression (e.g.,
mRNA or protein level) and/or one or more (e.g., 1, 2, 3, 4, 5, 6,
7, 8, 9, or 10) biological activities of one or more PARPs. For
example, a PARP inhibitor may decrease the level of one or more
(e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17,
18, 19, or 20) PARP nucleic acids or PARP proteins (described
above). A PARP inhibitor may decrease one or more (e.g., 1, 2, 3,
4, or 5) biological activities of a PARP protein including, but not
limited to, the ability to attach a poly-ADP-ribose molecule to a
substrate (e.g., a protein, DNA molecule, RNA molecule, lipid, or
small molecule), the ability to promote formation of a stress
granule, the ability to nucleate the formation of a stress granule,
the ability to disassemble a stress granule, the ability to
decrease stress granule assembly, the ability to localize to a
stress granule, the ability of a PARP protein to bind to one or
more of its substrates, the ability of a PARP protein to localize
to the nucleus or the mitotic spindle, the ability to promote cell
proliferation, and the ability to promote progression through
cytokinesis. Specific PARP inhibitors include antibody or antibody
fragments that specifically bind one or more PARP proteins
(described herein), one or more RNA aptamers (e.g., RNAi molecules;
e.g., SEQ ID NOS: 40 and 43-136), and one or more small molecules.
Specific PARP inhibitors may decrease the expression and/or one or
more biological activities (e.g., 1, 2, 3, 4, or 5) of a specific
PARP or a specific subset of PARPs (e.g., one or more (e.g., 1, 2,
3, 4, or 5) of PARP5A, PARP12, PARP13.1, PARP13.2, and PARP15;
PARP11; and one or more (e.g., 1, 2, 3, 4, 5, 6, 7, or 8) of PARP1,
PARP2, PARP5A, PARP5B, PARP7, PARP8, PARP14, and PARP16).
[0059] By "Poly-ADP-ribose polymerase 11 activator" is meant an
agent that increases the expression (e.g., mRNA or protein level)
and/or one or more (e.g., 1, 2, 3, 4, or 5) biological activities
of PARP11. For example, a PARP11 activator may increase the level
of one or more (e.g., 1, 2, 3, 4, or 5) nucleic acids containing a
sequence having at least 80% sequence identity (e.g., at least 85%,
90%, 95%, 96%, 97%, 98%, 99%, or even 100%) to PARP11 (SEQ ID NO:
17), and/or increase the level of one or more (e.g., 1, 2, 3, 4, or
5) polypeptides encoded by these nucleic acids. A PARP11 activator
may increase one or more (e.g., 1, 2, 3, 4, or 5) biological
activities of a PARP11 protein including, but not limited to, the
ability to attach a poly-ADP-ribose molecule to a substrate (e.g.,
a protein, DNA molecule, RNA molecule, lipid, or small molecule),
the ability to prevent or reduce the rate of formation of a stress
granule, the ability to prevent the nucleation of a stress granule,
the ability to disassemble a stress granule, the ability to
decrease stress granule assembly, the ability to localize to a
stress granule, or the ability of PARP11 protein to bind to one or
more of its substrates. Specific PARP11 activators include nucleic
acids encoding PARP11 or the catalytic domain of PARP11. For
example, a PARP activator may be a nucleic acid containing a
nucleic acid sequence having at least 80% sequence identity (e.g.,
at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100%) to PARP11
(SEQ ID NO: 17). Specific PARP11 activators may increase the
expression and/or one or more biological activities of a PARP11,
while having little or no effect on the expression and/or one or
more biological activities of other PARP proteins.
[0060] By "poly-ADP-ribose polymerase-11 inhibitor" or "PARP11
inhibitor" is meant an agent that decreases the expression (e.g.,
mRNA or protein level) and/or one or more (e.g., 1, 2, 3, 4, or 5)
biological activities of PARP11. For example, a PARP11 inhibitor
may decrease the level of one or more (e.g., 1, 2, 3, 4, or 5)
nucleic acids containing a sequence having at least 80% sequence
identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even
100%) to PARP11 (SEQ ID NO: 17), or decrease the level of one or
more (e.g., 1, 2, 3, 4, or 5) polypeptides encoded by these nucleic
acids. A PARP11 inhibitor may decrease one or more (e.g., 1, 2, 3,
4, or 5) biological activities of a PARP11 protein including, but
not limited to, the ability to attach a poly-ADP-ribose molecule to
a substrate (e.g., a protein, DNA molecule, RNA molecule, lipid, or
small molecule), the ability to prevent or reduce the rate of
formation of a stress granule, the ability to prevent the
nucleation of a stress granule, the ability to disassemble a stress
granule, the ability to decrease stress granule assembly, the
ability to localize to a stress granule, or the ability of PARP11
protein to bind to one or more of its substrates. Specific PARP11
inhibitors include antibody or antibody fragments that specifically
bind to PARP11 protein, one or more RNA aptamers (e.g., RNAi
molecules; e.g., SEQ ID NOS: 91-98), and one or more small
molecules. Specific PARP11 inhibitors decrease the expression
and/or one or more (e.g., 1, 2, 3, 4, or 5) biological activities
of PARP11, while having little or no effect on the expression
and/or activity of other PARP proteins.
[0061] By "PARP biological activity" is meant one or more (e.g., 1,
2, 3, 4, or 5) of the ability of a PARP protein or PARP fusion
protein to catalyze the attachment of a single ADP-ribose to a
target substrate (e.g., a protein, DNA, RNA, lipid, or small
molecule), the ability to attach one or more ADP-ribose molecules
to a ADP-ribose molecule already attached to a substrate, the
ability to add a branched ADP-ribose molecule to a pre-existing
poly-ADP-ribose, the ability to localize to the cell nucleus, the
ability to localize to stress granules, the ability to catalyze the
formation or nucleate stress granules, the ability to catalyze the
disassembly of stress granules, the ability to promote cell
division or progression through mitosis, or the ability to activate
or inhibit RNAi activity in the cell. Specific PARP proteins have a
different subset of biological activities. For example, PARP1,
PARP2, PARP5A, PARP5B, PARP7, PARP8, PARP14, and PARP16 have the
ability to localize to the nucleus and play a role in mitosis and
cell division. PARP 5A, PARP12, PARP13.1, PARP13.2, and PARP-15
have the ability to localize to stress granules and play a role in
the formation or nucleation of stress granules. PARP11 has the
ability to localize to stress granules and plays a role in
inhibiting stress granule formation or increasing the disassembly
of stress granules. PARP13 inhibits the activity of RNAi in the
cell. An additional PARP activity is "auto-modification"or
"auto-modulation," that is, attachment of one or more ADP-ribose
molecules to itself. Such auto-modulation of a PARP protein may
result in an increase or decrease in any of the above-listed PARP
activities. Assays for the measurement of the activity of each
specific PARP are described herein.
[0062] By "polypeptide tag" is meant a protein sequence that is
located at the 5' and/or 3' end of a polypeptide sequence of an
expressed protein (e.g., one or more PARP proteins as described
herein). A polypeptide tag may include one or more of a protease
recognition sequence (e.g., 1, 2, 3, 4, 5, or 6 of the same or
different protease recognition sequences), a epitope tag (e.g., 1,
2, 3, 4, or 5 epitope tags), a peptide that has a high affinity
binding partner (e.g., biotin and streptavidin), or one or more
(e.g., 1, 2, 3, or 4) tag(s) which aids in protein purification
(e.g., a His.sub.6 tag). The polypeptide tag may later be cleaved
from the purified fusion protein by incubation with one or more
(e.g., 1, 2, 3, or 4) protease(s) which cleaves the fusion protein
at one or more protease recognition sequence(s) (e.g., 1, 2, 3, 4,
5, 6, or 7) within the sequence of the polypeptide tag. Examples of
polypeptide tags are described herein.
[0063] By "positioned 3'" is meant a second nucleic acid sequence
that is located after the 3' terminus of a first nucleic acid
sequence (the second nucleotide sequence starts at the nucleotide
following the 3' terminus of the first sequence) or the second
nucleic acid sequence begins at a nucleotide that follows the 3'
terminus of the first nucleic acid (e.g., the second nucleotide
sequence starts at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25,
30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 200, 300, or 400
nucleotides following the 3' terminus of the first nucleic
acid).
[0064] By "positioned 5'" is meant a second nucleic acid sequence
that is located before the 5' terminus of a first nucleic acid
sequence (the second nucleotide sequence ends at the nucleotide
preceding the 5' terminus of the first sequence) or the second
nucleic acid sequence ends at a nucleotide that precedes the 5'
terminus of the first nucleic acid (e.g., the second nucleotide
sequence ends at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25,
30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 200, 300, or 400
nucleotides before the 5' terminus of the first nucleic acid).
[0065] By the term "propensity to develop disease" is meant the
calculated probability of a subject (e.g., a human) to develop a
disease (e.g., a stress granule-related disorder or cancer). The
probability of developing a disease may be calculated based on a
number of factors including a variety of health indicators (e.g.,
blood pressure, cholesterol, and levels of pro-inflammatory
cytokines), biological factors (e.g., weight, age, and sex), and
genetic susceptibility to disease (e.g., expression of a heritable
mutation in a gene, expression of a polymorphic sequence associated
with a disease, and expression of an allele associated with a
disease). The propensity to develop disease in a specific patient
population may be compared to a different patient population (e.g.,
a patient population not receiving a therapy).
[0066] By the term "protease recognition sequence" is meant a short
peptide sequence that is recognized as a substrate and cleaved by
one or more (e.g., 1, 2, 3, 4, or 5) proteases. Protease target
sequences are often 3-20 amino acids in length and often require
certain amino acids to be located at specific positions within the
target sequence, while any amino acid may be placed at other
positions within the target sequence. For example, the protease
recognition sequence for TEV protease is Glu-X-X-Tyr-X-Gln-Ser (SEQ
ID NO: 26), where X represents a position that may be filled by any
amino acid. Additional examples of protease recognition sequences
are known in the art and include, without limitation, factor Xa
(Ile-Glu/Asp-Gly-Arg), Ala-64 subtilisin (Gly-Ala-His-Arg),
clostripain (Arg and Lys-Arg), collagenase (Pro-Val-Gly-Pro),
enterokinase (Asp-Asp-Asp-Asp-Lys), renin (Pro-Phe-His-Leu-Leu),
and .alpha.-thrombin (Leu-Val-Pro-Arg-Gly-Ser). One or more of the
same or different protease recognition sequence(s) may be included
in the polypeptide tag of any of the PARP, PARG, or ARH3 fusion
proteins described herein. A protease recognition sequence may be
placed 5' or 3' to an amino acid sequence to be removed from the
protein. The polypeptide sequence of the protease recognition
sequence may directly abut the sequence encoding a PARP or may be
separated from the remaining coding sequence by one or more amino
acids (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16,
17, 18, 19, 20, 25, 30, 40, or 50 amino acids). An amino acid
sequence that may be removed from the protein may include one or
more antigenic sequence(s), a His.sub.6-tag, a fluorescent protein,
a peptide sequence that has high affinity to a second protein that
was used to purify the protein (e.g., His.sub.6 tag or
hemagglutinin tag), or a peptide sequence that was used to
stabilize the protein during purification (e.g., albumin).
[0067] By the term "purified" is meant purified from other common
components normally present within the cell. For example, a
purified protein is purified away from the other cellular proteins,
nucleic acids, and small metabolites present within the cell. A
purified protein is at least 85% pure by weight (e.g., at least
90%, 95%, 96%, 97%, 98%, 99%, or even 100% pure) from other
proteins, nucleic acids, or small metabolites present in the cell.
A purified nucleic acid is at least 85% free of other contaminating
nucleic acid molecules or adjoining sequences found in the
cell.
[0068] By the term "rate of proliferation" is meant the rate of a
cell or a cell population to undergo successive cell divisions. The
rate of cell proliferation of a cell or cell population may be
measured by methods known in the art including cell counting (e.g.,
by microscopic techniques) and the incorporation of labeled
nucleotides into newly synthesized DNA (e.g., incorporation of
.sup.3H-thymidine). The rate of proliferation of a cell or cell
population treated with one or more agent(s) (e.g., one or more
PARP activators or PARP inhibitors) may be compared to a control
cell or cell population not treated with the agent.
[0069] By the term "reduce the likelihood of developing" is meant a
reduction (e.g., at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%,
50%, 60%, 70%, 80%, 90%, or 95%) for an individual or a patient
population in the chance or rate of developing a specific disease
by administering one or more therapeutic agent(s) compared to an
individual or patient population not receiving the therapeutic
agent. The methods of the invention may also reduce the likelihood
of developing one or more (e.g., 1, 2, 3, 4, or 5) symptoms of a
stress granule-related disorder or reduce the likelihood of
developing one or more (e.g., 1, 2, 3, 4, or 5) symptoms of cancer
in a patient population or an individual receiving one or more
therapeutic agent(s).
[0070] By the term "RNAi" is meant a short double-stranded RNA
molecule that mediates the down-regulation of a target mRNA in a
cell. An RNAi molecule is typically 15 to 32 nucleotides in length.
RNAi molecules are also known as siRNAs, small RNAs, or microRNAs.
The design and therapeutic effectiveness of RNAi molecules is
described in McCaffrey et al. (Nature 418:38-39, 2002). The RNAi
molecules are at least 15 nucleotides, preferably, 17, 18, 19, 20,
21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35
nucleotides in length and even up to 50 or 100 nucleotides in
length (inclusive of all integers in between). Non-limiting
examples of RNAi molecules are at least 80% identical (e.g., at
least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100% identical) to
or complementary to the translational start sequence or the nucleic
acid sequence encoding the first 10, 20, 30, 40, 50, 60, 70, 80,
90, or 100 amino acids of a PARP, PARG, or ARH3 selected from a
nucleic acid sequence containing a sequence at least 80% identical
to one of PARP1 (SEQ ID NO: 1 or 2), PARP2 (SEQ ID NO: 3), PARP3
(SEQ ID NO: 4), PARP3.2 (SEQ ID NO: 5), PARP3.3 (SEQ ID NO: 6),
PARP4 (SEQ ID NO: 7), PARP5A (SEQ ID NO: 8 or 9), PARP5B (SEQ ID
NO: 10), PARP6 (SEQ ID NO: 11), PARP7 (SEQ ID NO: 12), PARP8 (SEQ
ID NO: 13), PARP9 (SEQ ID NO: 14), PARP10 (SEQ ID NO: 15), PARP10.2
(SEQ ID NO: 16), PARP11 (SEQ ID NO: 17), PARP12 (SEQ ID NO: 18),
PARP13.1 (SEQ ID NO: 19), PARP13.2 (SEQ ID NO: 20), PARP14 (SEQ ID
NO: 21), PARP15.1 (SEQ ID NO: 22), PARP15.2 (SEQ ID NO: 23), PARP16
(SEQ ID NO: 24), PARG (SEQ ID NO: 42), or ARH3 (SEQ ID NO: 41). An
RNAi molecule may target any part of the sequence encoding the
target protein (e.g., any part of an mRNA encoding one of the above
listed PARP, PARG, or ARH3 proteins).
[0071] The specific requirements and modifications of small RNA are
known in the art and are described, for example in PCT Publication
No. WO01/75164, and U.S. Application Publication Nos. 20060134787,
20050153918, 20050058982, 20050037988, and 20040203145, the
relevant portions of which are herein incorporated by reference.
siRNAs can also be synthesized or generated by processing longer
double-stranded RNAs, for example, in the presence of the enzyme
dicer under conditions in which the dsRNA is processed to RNA
molecules of about 17 to about 26 nucleotides. siRNAs can also be
generated by expression of the corresponding DNA fragment (e.g., a
hairpin DNA construct). Generally, the siRNA has a characteristic
2- to 3-nucleotide 3' overhanging ends, preferably these are
(2'-deoxy)thymidine or uracil. The siRNAs typically comprise a 3'
hydroxyl group. Single-stranded siRNAs or blunt-ended dsRNA may
also be used. In order to further enhance the stability of the RNA,
the 3' overhangs may be stabilized against degradation. For
example, the RNA may be stabilized by including purine nucleotides,
such as adenosine or guanosine. Alternatively, substitution of
pyrimidine nucleotides by modified analogs, e.g., substitution of
uridine 2-nucleotide overhangs by (2'-deoxy)thymidine is tolerated
and does not affect the efficiency of RNAi. The absence of a 2'
hydroxyl group significantly enhances the nuclease resistance of
the overhang in tissue culture medium.
[0072] siRNA molecules can also be obtained through a variety of
protocols including chemical synthesis or recombinant production
using a Drosophila in vitro system. They can be commercially
obtained from companies such as Dharmacon Research Inc. or Xeragon
Inc., or they can be synthesized using commercially available kits
such as the Silencer.TM. siRNA Construction Kit from Ambion
(catalog number 1620) or HiScribe.TM. RNAi Transcription Kit from
New England BioLabs (catalog number E2000S).
[0073] Alternatively siRNA can be prepared using standard
procedures for in vitro transcription of RNA and dsRNA annealing
procedures such as those described in Elbashir et al. (Genes &
Dev., 15:188-200, 2001), Girard et al. (Nature 442:199-202, 2006),
Aravin et al. (Nature 442:203-207, 2006), Grivna et al. (Genes Dev.
20:1709-1714, 2006), and Lau et al. (Science 313:305-306, 2006).
siRNAs may also be obtained by incubation of dsRNA that corresponds
to a sequence of the target gene in a cell-free Drosophila lysate
from syncytial blastoderm Drosophila embryos under conditions in
which the dsRNA is processed to generate siRNAs of about 21 to
about 23 nucleotides, which are then isolated using techniques
known to those of skill in the art. For example, gel
electrophoresis can be used to separate the 21-23 nt RNAs and the
RNAs can then be eluted from the gel slices. In addition,
chromatography (e.g., size exclusion chromatography), glycerol
gradient centrifugation, and affinity purification with antibody
can be used to isolate the small RNAs.
[0074] Short hairpin RNAs (shRNAs), as described in Yu et al.
(Proc. Natl. Acad. Sci. U.S.A. 99:6047-6052, 2002) or Paddison et
al. (Genes & Dev. 16:948-958, 2002), incorporated herein by
reference, may also be used. shRNAs are designed such that both the
sense and antisense strands are included within a single RNA
molecule and connected by a loop of nucleotides (3 or more). shRNAs
can be synthesized and purified using standard in vitro T7
transcription synthesis as described above and in Yu et al.
(supra). shRNAs can also be subcloned into an expression vector
that has the mouse U6 promoter sequences which can then be
transfected into cells and used for in vivo expression of the
shRNA.
[0075] A variety of methods and reagents are available for
transfection, or introduction, of dsRNA into mammalian cells
including but not limited to: TransIT-TKO.TM. (Mirus, Cat. # MIR
2150), Transmessenger.TM. (Qiagen, Cat. #301525),
Oligofectamine.TM. and Lipofectamine.TM. (Invitrogen, Cat. # MIR
12252-011 and Cat. #13778-075), siPORT.TM. (Ambion, Cat. #1631),
and DharmaFECT.TM. (Fisher Scientific, Cat. # T-2001-01). Agents
are also commercially available for electroporation-based methods
for transfection of siRNA, such as siPORTer.TM. (Ambion Inc. Cat.
#1629). Microinjection techniques can also be used. The small RNA
can also be transcribed from an expression construct introduced
into the cells, where the expression construct includes a coding
sequence for transcribing the small RNA operably-linked to one or
more transcriptional regulatory sequences. Where desired, plasmids,
vectors, or viral vectors can also be used for the delivery of
dsRNA or siRNA and such vectors are known in the art. Protocols for
each transfection reagent are available from the manufacturer.
Additional methods are known in the art and are described, for
example in U.S. Patent Application Publication No. 20060058255.
[0076] By the term "specifically binds" is meant a protein, nucleic
acid (e.g., DNA or RNA), or molecule that binds one or more target
molecules (e.g., polypeptides, DNA molecules, or RNA molecules)
present in a cell, while not binding the majority of other
proteins, DNA molecules, RNA molecules, or small molecules present
within a cell, cell lysate, extracellular medium, or biological
sample. For example, an antibody provided by the invention may bind
to a single PARP, PARG, or ARE protein, a PARP, PARG, or ARH3
fusion protein, or may bind more than one (e.g., 2, 3, 4, 5, 6, 7,
8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 or more) PARP,
PARG, or ARH3 proteins and/or PARP, PARG, or ARH3 fusion proteins
in a cell, cell lysate, extracellular medium, or biological
sample.
[0077] By "substrate" or "solid surface" is meant a surface on
which a moiety or protein is covalently attached which allows for
the binding and/or purification of a PARP, PARG, and/or ARH3 fusion
protein. The PARP, PARG, and/or ARH3 fusion protein will bind to
the substrate or solid surface through its polypeptide tag.
Moieties or peptides covalently attached to the substrate or solid
surface include, but are not limited to, monoclonal or polyclonal
antibodies specific for an antigenic peptide in the polypeptide tag
(e.g., anti-GFP antibody binding to GFP in the polypeptide tag),
specific metal complexes bound by a peptide located in the
polypeptide tag (e.g., Ni.sup.+ binding to a His.sub.6 polypeptide
tag), or a specific binding protein for a peptide located in the
polypeptide tag (e.g., IgG binding to a ZZ-domain in the
polypeptide tag). Examples of a substrate or solid surface include,
but are not limited to, a bead (e.g., a magnetic bead), a surface
in a multi-well plate, and beads in column (e.g., column
chromatography). One or more PARP, PARG, and/or ARH3 protein(s)
and/or PARP, PARG, and/or ARH3 fusion protein(s) may be bound to a
substrate or solid surface and eluted from the substrate or solid
surface by contacting the substrate or solid surface with an
elution buffer (e.g., a high salt elution buffer), a ligand that
competes for binding to the substrate or solid surface, or competes
for binding to the polypeptide tag (e.g., a non-bound antibody that
specifically binds to the protein in the polypeptide tag), or by
treating the bound fusion protein with a protease that recognizes
the one or more (e.g., 1, 2, 3, 4, 5, 6, or 7) specific cleavage
recognition sequence(s) found in the polypeptide tag.
[0078] By the term "stress granule-related disorder" is meant any
disorder that is characterized or in part caused by the activity or
formation of stress granules in a specific type of cell or cell
population. Non-limiting examples of stress granule-related
disorders include cardiovascular disorders (e.g., an aneurysm,
angina, atherosclerosis, stroke, cerebrovascular disease,
congestive heart failure, coronary artery disease, myocardial
disease, peripheral vascular disease, granulomatous myocarditis,
chronic myocarditis, myocardial infarction, and primary
hypertrophic cardiomyopathy), inflammatory disorders (e.g.,
autoimmune diseases, asthma, allergic intraocular inflammatory
diseases, arthritis, atopic dermatitis, atopic eczema, cirrhosis,
Crohn's disease, ulcerative colitis, diabetes, hemolytic anemia,
inflammatory dermatosis, an inflammatory bowel disorder, systemic
lupus erythamatosus, psoriasis, and rheumatoid arthritis, Wegener's
granulomatosis, Hashimoto's thyroiditis, chronic pancreatitis, and
reactive lymphoid hyperplasia), neurological disorders (e.g.,
multiple sclerosis, Alzheimer's disease, Parkinson's disease,
Huntingon's disease, amyotrophic lateral sclerosis, retinosa
pigmentosum, macular degeneration, traumatic brain injury, stroke,
and peripheral neuropathy), and ischemia-reperfusion injury (e.g.,
stroke). A stress granule-related disorder is typically
characterized by a disease etiology that involves oxidative stress
or the production of oxygen-based radicals in a tissue over the
progression of the disease. Methods for the diagnosis of several
stress granule-related disorders are known in the art.
[0079] By the term "symptoms of a stress-granule related disorder"
is meant one or more (e.g., 1, 2, 3, 4, or 5) of the physical
manifestations of a stress-granule related disorder. Non-limiting
examples of symptoms of a stress-granule related disorder include
pain, swelling, inflammation, loss of cognition, loss of vision,
loss of coordination, difficulty breathing, airway constriction,
artery occlusion, diarrhea, elevated blood glucose, increased
levels of pro-inflammatory cytokines, increased protein aggregates
or deposits, and increased cell death (e.g., apoptosis or
necrosis).
[0080] By the term "symptoms of cancer" is meant one or more (e.g.,
1, 2, 3, 4, or 5) of the physical manifestations of cancer.
Non-limiting examples of symptoms of cancer include blood in urine,
pain or burning upon urination, cloudy urine, pain in bone,
fractures in bones, fatigue, weight loss, repeated infections,
nausea, vomiting, constipation, numbness in the legs, bruising,
dizziness, drowsiness, abnormal eye movements, changes in vision,
changes in speech, headaches, thickening of a tissue, rectal
bleeding, abdominal cramps, loss of appetite, fever, enlarged
lymphnodes, persistent cough, blood in sputum, lung congestion,
itchy skin, lumps in skin, abdominal swelling, vaginal bleeding,
jaundice, heartburn, indigestion, cell proliferation, and loss of
regulation of controlled cell death.
[0081] By the term "target protein" or "substrate protein" is meant
a protein that is bound by one or more (e.g., 1, 2, 3, 4, or 5)
PARP protein(s), PARG protein(s), ARH3 protein(s), PARP fusion
protein(s), PARG fusion protein(s), and/or ARH3 fusion protein(s);
covalently modified by attachment of a ADP-ribose molecule by the
activity of one or more (e.g., 1, 2, 3, 4, or 5) PARP protein(s) or
PARP fusion protein(s); or contains a poly-ADP-ribosyl group that
is hydrolyzed by the activity of one or more (e.g., 1, 2, 3, 4, or
5) PARG proteins, PARG fusion proteins, ARH3 proteins, or ARH3
fusion proteins. A target or substrate protein may be co-localized
in the nucleus or in a stress granule, and/or may localize to the
mitotic spindle during cytokinesis. A target protein or substrate
protein may localize to different structures or organelles within a
cell during different stages of the cell cycle (e.g., interphase,
S-phase, prophase, metaphase, telephase, and anaphase) and may have
an activity in the formation, nucleation, or disassembly of stress
granules, an activity in cell proliferation or progression through
cytokinesis, or an activity in the regulation of miRNA or RNAi
activity. A target or substrate protein may be a PARP, PARG, or
ARH3 protein (described herein).
[0082] By the term "transgenic cell" is a meant a cell expressing
one or more nucleic acids introduced by recombinant DNA technology.
For example, a transgenic cell may express a nucleic acid encoding
one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,
15, 16, 17, or 18) of the presently described PARP, PARG, and/or
ARH3 proteins and/or one or more of the PARP, PARG, and/or ARH3
fusion proteins. A transgenic cell may be a mammalian cell (e.g., a
mouse, rat, monkey, or human cell), a bacterial cell, a fungal
cell, a yeast cell, or a plant cell. The transgenic cell may
express the introduced nucleic acids from an inducible promoter or
a constitutive promoter. The transgenic cell may also be located
within a transgenic animal or may be cultured in tissue culture.
The introduced one or more nucleic acid(s) may be integrated in the
chromosome of a cell or may be expressed from a plasmid.
[0083] By "ZZ-domain" is meant a polypeptide sequence encoded by a
nucleic acid having at least 80% identity (e.g., at least 85%, 90%,
95%, 96%, 97%, 98%, 99%, or even 100% identity) to the
Staphylcoccus aureus protein A domain encoded by SEQ ID NO: 27. The
ZZ domain has the ability to bind to Fc.gamma. (the constant region
of IgG involved in effector functions) and Fab (the Ig fragment
responsible for antigen recognition). The specific structure and
binding properties of the ZZ-domain are described in Graille et al.
(Proc. Natl. Acad. Sci. U.S.A. 97:5399-5404, 2000) and Roben et al.
(J. Immunol. 154:6437-6445, 1995). Expression of the ZZ-domain in
the polypeptide tag allows for the purification of a fusion protein
(e.g., one or more PARP fusion proteins as described herein) by the
use of an Fc-containing protein (e.g., IgG).
[0084] Other features and advantages of the invention will be
apparent from the following description of the preferred
embodiments thereof.
BRIEF DESCRIPTION OF THE DRAWINGS
[0085] The application file contains drawings executed in color
(FIGS. 2, 5, 9-11, 16-18, and 20-22). Copies of this patent or
patent application with color drawings will be provided by the
Office upon request and payment of the necessary fee.
[0086] FIG. 1 is a picture of the chemical structure of
nicotinamide adenine dinucleotide (NAD.sup.+) and poly-ADP
ribose.
[0087] FIG. 2 is a set of micrographs showing the mitotic
localization of poly-ADP ribose in HeLa cells during G2-M,
prophase, prometaphase (P-M), metaphase, anaphase, and cytokinesis
stages of the cell cycle using fluorescence microscopy following
staining with rabbit anti-PAR antibodies labeled with Alexa 488 and
X-rhodamine NHS esters.
[0088] FIG. 3 is a set of schematic diagrams showing the domain
organization of PARP1, PARP2, PARP3, PARP4, tankyrase 1 (PARP5A),
tankyrase 2 (PARP5B), TiPARP (PARP7), PARP12, PARP13, PARP9,
PARP14, PARP15, PARP10, PARP11, PARP6, PARP8, and PARP16.
[0089] FIG. 4 is a diagram of the pEGFP-C1 vector (SEQ ID NO: 28)
(Invitrogen) showing the CMV promoter, the EGFP sequence, the
multiple cloning site (MCS), and the SV40 poly A sequence. Also
shown is the polylinker sequence (SEQ ID NO: 29).
[0090] FIG. 5 is an immunoblot showing the expression and relative
size of the PARP-GFP fusion proteins of PARP1, PARP2, PARP3, PARP4,
PARP5A, PARP5B, PARP6, PARP7, PARP8, PARP9, PARP10, PARP11, PARP12,
PARP13, PARP14, PARP15, and PARP16 expressed in HeLa Kyoto cells
transfected with pEGFP-C1 plasmids containing a nucleic acid
encoding each respective PARP-GFP fusion protein. The immunoblot
was developed using a rabbit anti-GFP polyclonal antibody.
[0091] FIG. 6 is a set of micrographs showing the localization of
different PARP-GFP fusion proteins in asynchronous HeLa Kyoto cells
transfected with a pEGFP-C1 plasmid containing a nucleic acid
encoding a PARP-GFP protein. The transfected cells were
immunostained with rabbit anti-GFP polyclonal antibody and
fluorescently-labeled secondary Alexa Fluor 594 or 488 antibody
(Invitrogen), and visualized using fluorescence microscopy. The
localization of PARP1-GFP, PARP2-GFP, PARP3-GFP, PARP7-GFP,
PARP12-GFP, PARP13-GFP, PARP9-GFP, PARP14-GFP, PARP15-GFP,
PARP6-GFP, PARP8-GFP, PARP16-GFP, PARP4-GFP, PARP10-GFP,
PARP11-GFP, PARP5A-GFP, and PARP5B-GFP fusion proteins is
shown.
[0092] FIG. 7 is two sets of micrographs showing the localization
of different PARP-GFP fusion proteins in asynchronous hTERT-RPE and
HeLa Kyoto cells transfected with a pEGFP-C1 plasmid containing a
nucleic acid encoding a PARP-GFP protein. The transfected cells
were immunostained with rabbit anti-GFP polyclonal antibody and
fluorescently-labeled Alexa Fluor 594 or 488 antibodies
(Invitrogen), and visualized using fluorescence microscopy. The
localization of PARP1-GFP, PARP2-GFP, PARP3-GFP, PARP4-GFP,
PARP5A-GFP, PARP5B-GFP, PARP6-GFP, PARP7-GFP, PARP8-GFP, PARP9-GFP,
PARP10-GFP, PARP11-GFP, PARP12-GFP, PARP13-GFP, PARP14-GFP,
PARP15-GFP, and PARP16-GFP fusion proteins is shown for each cell
type.
[0093] FIG. 8 is a set of micrographs from asynchronous HeLa Kyoto
cells transfected with a pEGFP-C1 plasmid containing a nucleic acid
encoding a PARP-GFP protein following immunostaining with primary
rabbit antibodies raised against each specific PARP and
fluorescently-labeled Alexa Fluor 594 or 488 antibodies
(Invitrogen). The localization of PARP1, PARP2, PARP3, PARP4,
PARP5A, PARP5B, PARP6, PARP7, PARP8, PARP9, PARP10, PARP11, PARP12,
PARP13.1, PARP13.2, PARP14, PARP15, and PARP16 is shown.
[0094] FIG. 9 is a set of micrographs showing the localization of
each PARP-GFP fusion protein during S-phase and mitosis in
transfected HeLa Kyoto cells. In each experiment, HeLa Kyoto cells
were transfected using Lipofectamine 2000 with a specific PARP-GFP
expression vector (pEGFP-C1) and were arrested in mitosis or
S-phase by treatment with 100 nM nocodazole or 5 .mu.g/mL
aphidicolin for 12 hours. The resulting treated cells were
immunostained with rabbit anti-GFP polyclonal antibodies and
fluorescently-labeled Alexa Fluor 594 or 488 antibodies
(Invitrogen), and visualized using fluorescence microscopy.
S-phase-arrested cells were also stained with EdU and DAPI, and
mitosis-arrested cells were further stained with tubulin and
DAPI.
[0095] FIG. 10 is a set of micrographs showing the localization of
overexpressed PARP16-GFP in the endoplasmic reticulum of HeLa Kyoto
cells transfected with a pEGFP-C1 plasmid encoding a PARP16-GFP
fusion protein (middle panel) and the phenotype of HeLa Kyoto cells
transfected with an RNAi targeting endogenous PARP16 (right panel).
The left panel shows untransfected HeLa Kyoto cells stained with
anti-calnexin antibodies, secondary fluorescently-labeled
antibodies (Alexa Fluor 594 or 488 antibodies (Invitrogen)), and
DAPI. The middle panel the localization of PARP16-GFP and calnexin
in HeLa Kyoto cells transfected with a pEGFP-C1 plasmid expressing
a PARP16-GFP fusion protein following staining with anti-calnexin,
anti-GFP, Alexa Fluor 594 or 488 antibodies (Invitrogen), and DAPI.
The right panel shows the phenotype of HeLa Kyoto cells following
transfection with an RNAi molecule targeting endogenous PARP16 (SEQ
ID NO: 43) following staining with an anti-tubulin antibody, Alexa
Fluor 594 or 488 antibody (Invitrogen), and DAPI.
[0096] FIG. 11 is a set of micrographs showing the co-localization
of PARP7-GFP and coilin, and the co-localization of PARP16-GFP and
calnexin. In each experiment, HeLa Kyoto cells transfected with
pEGFP-C1 vectors expressing PARP7-GFP or PARP16-GFP were stained
with anti-GFP and anti-coilin or anti-calnexin antibodies, and
fluorescently labeled secondary antibodies (Alexa Fluor 594 or 488
antibodies). The figure also lists a number of protein markers of
specific cellular organelles and structures.
[0097] FIG. 12 is a diagram of the pcDNA3.1 vector (Invitrogen)
showing the CMV promoter and the restriction sites that may be used
for cloning.
[0098] FIG. 13 is a diagram of an example of an activity assay
using one or more of the PARP-GFP fusion proteins of the
invention.
[0099] FIG. 14 is a diagram of an example of an assay for
identifying an activator of one or more PARP-GFP fusion proteins of
the invention.
[0100] FIG. 15 is a picture of the Bio-Gel P-6 structure and a
picture of a Coomassie Blue-stained SDS-PAGE gel showing the use of
Bio-Gel P-6 for the purification of proteins from a crude HeLa
Kyoto cell extract. The SDS-PAGE gel shows the proteins present in
cell extract (Extract), in cell extract following lectin
clarification (Lectin Clarification), in the lysate prior to
passing over the Bio-Gel P-6 resin (Input), in the pellet following
centrifugation of the resin (Pellet), and in the eluate following
treatment with poly-ADP-ribose glycohydrolase ARH3 (ARH3
Release).
[0101] FIG. 16 is a set of micrographs showing the co-localization
of poly-ADP ribose polymers (pADPR) and eIF3, a part of the
translation initiation complex and a marker of stress granules, in
HeLa Kyoto cells following treatment with 0 or 250 .mu.M sodium
arsenite for 30 minutes and immunostaining with primary antibodies
specific for poly-ADP-ribose polymers and eIF3, and Alexa Fluor 594
or 488 secondary antibodies (Invitrogen).
[0102] FIG. 17 is a set of micrographs showing the co-localization
of PARP-GFP fusion proteins with eIF3 in transfected HeLa Kyoto
cells following treatment with 0 or 250 .mu.M sodium arsenite for
30 minutes. In these experiments, HeLa Kyoto cells were transfected
with a pEGFP-C1 plasmid expressing PARP5A-GFP, PARP12-GFP,
PARP13.1-GFP, PARP13.2-GFP, or PARP15-GFP fusion protein and
treated with 0 or 250 .mu.M sodium arsenite. The cells were fixed
and stained with anti-GFP and anti-eIF3, and secondary
fluorescently-labeled antibodies (Alexa Fluor 594 or 488 antibodies
(Invitrogen)) prior to imaging.
[0103] FIG. 18 is a set of micrographs showing the co-localization
of endogenous PARP5A, PARP12, PARP13/13.1, PARP15, or
poly-ADP-ribose glycohydrolase (PARG), and eIF3 (a stress granule
marker) in HeLa Kyoto cells following treatment with 250 .mu.M
sodium arsenite for 30 minutes. In these experiments, cells were
stained with rabbit antibodies specific for one of PARP5A, PARP12,
PARP13/13.1, PARP15, or PARG, and an anti-eIF3 antibody, and
fluorescently-labeled secondary antibodies (Alexa Fluor 594 or 488
antibodies (Invitrogen)).
[0104] FIG. 19 is a set of micrographs showing the localization of
poly-ADP-ribose (PAR), endogenous PARP5A, PARP12, PARP13, and
PARP15, and eIF3 (a stress granule marker) in hTERT RPE cells
following treatment with 250 .mu.M sodium arsenite for 30 minutes.
In these experiments, cells were stained with antibodies specific
for one of PAR, PARP5A, PARP12, PARP13, or PARP15, or an anti-eIF3
antibody, and a secondary fluorescently-labeled antibodies (Alexa
Fluor 594 or 488 antibodies (Invitrogen)).
[0105] FIG. 20 is a set of micrographs showing the effect of
PARP13.1-GFP, PARP13.2-GFP, or PARP15-GFP overexpression on stress
granule formation. In these experiments, HeLa Kyoto cells were
transfected with a plasmid expressing PARP13.1-GFP, PARP13.2-GFP,
or PARP15-GFP. The cells were fixed and stained using rabbit
anti-GFP and anti-eIF3 antibodies, and fluorescently-labeled
secondary antibodies (Alexa Fluor 594 or 488 antibodies
(Invitrogen)). The cells were also co-stained with DAPI.
[0106] FIG. 21 is a set of micrographs showing the co-localization
of PARP11-GFP and eIF3 (a stress granule marker) in HeLa Kyoto
cells transfected with a pEGFP-C1 vector expressing PARP11-GFP
following treatment with 250 .mu.M sodium arsenite for 30 minutes.
Following arsenite treatment, the cells were immediately fixed and
stained using rabbit anti-GFP and anti-eIF3 antibodies, and
fluorescently-labeled secondary antibodies (Alexa Fluor 594 or 488
antibodies (Invitrogen)). The cells were also stained with
DAPI.
[0107] FIG. 22 is a set of micrographs showing the effect of
PARG99-GFP, PARG102-GFP, or PARG110-GFP overexpression on stress
granule formation in HeLa Kyoto cells transfected with a pEGFP-C1
plasmid containing a nucleic acid sequence encoding each PARG-GFP
fusion protein, following treatment with 100 .mu.M sodium arsenite
for 30 minutes. Following arsenite treatment, the cells were fixed
and stained with rabbit anti-GFP and anti-eIF3 antibodies, and
fluorescently-labeled secondary antibodies (Alexa Fluor 594 or 488
antibodies (Invitrogen)). The images shown in the right panels show
the same data using a threshold filter.
[0108] FIG. 23 is a set of micrographs showing the effect of PARG
or ARH3 knockdown on stress granule formation in HeLa Kyoto cells
transfected with 30 nM PARG siRNA (CCAGUUGGAUGGACACUAAUU (SEQ ID
NO: 34) and UUACGAAGGUACC AUAGAAUU (SEQ ID NO: 35)), ARH3 siRNA
(GGACAGAAGCCUUGUACUAUU (SEQ ID NO: 36) and CCAUUGCUGGUGCCUACUAUU
(SEQ ID NO: 37)), or a control siRNA (All Stars Negative Control
siRNA; Qiagen Catalog No. 1027280) following treatment with 100
.mu.M sodium arsenite for 30 minutes, or 30 minutes or 1 hour
following sodium arsenite washout. The cells were fixed and stained
with an anti-eIF3 antibody and secondary fluorescently-labeled
antibodies (Alexa Fluor 594 or 488 antibodies) to visualize stress
granule formation. The panel on the left shows an immunoblot of
cell lysate from HeLa Kyoto cells treated with 30 nM PARG siRNA,
ARH3 siRNA, or control siRNA for 48 hours. The immunoblot was
developed using an anti-PARG antibody.
[0109] FIG. 24 is a graph showing the percentage of HeLa Kyoto
cells transfected with 30 nM PARG siRNA (SEQ ID NOS: 34 and 35),
ARH3 siRNA (SEQ ID NOS: 36 and 37), or a control siRNA (All Stars
Negative Control siRNA; Qiagen Catalog No. 1027280) containing
stress granules following treatment with 100 .mu.M sodium arsenite
for 30 minutes, or 30 minutes or 1 hour following sodium arsenite
washout. The cells were fixed and stained with a
fluorescently-labeled anti-eIF3 antibody to visualize stress
granule formation.
[0110] FIG. 25A is a Silver-stained 4-12% SDS-PAGE gel showing the
proteins immunoprecipitated with an anti-GFP antibody from lysate
from HeLa S3 cells transfected with a pEGFP-C1 plasmid expressing
GFP alone, PARP5A-GFP, PARP12-GFP, PARP13-GFP, PARP13.1-GFP, or
PARP15-GFP following treatment with 0 or 250 .mu.M sodium arsenite
for 30 minutes.
[0111] FIG. 25B is picture of an immunoblot of a 4-12% SDS-PAGE gel
containing proteins immunoprecipitated with an anti-GFP antibody
from lysate from HeLa S3 cells transfected with a pEGFP-C1 plasmid
expressing GFP, PARP5A-GFP, PARP12-GFP, PARP13-GFP, PARP13.1-GFP,
or PARP15-GFP following treatment with 0 or 250 .mu.M sodium
arsenite for 30 minutes. The immunoblot was developed using a
polyclonal anti-poly-ADP-ribose antibody.
[0112] FIG. 25C is a picture of several immunoblots of a 4-12%
SDS-PAGE gel containing proteins immunoprecipitated with an
anti-GFP antibody from lysate from HeLa S3 cells transfected with a
pEGFP-C1 plasmid expressing GFP, PARP5A-GFP, PARP12-GFP,
PARP13-GFP, PARP13.1-GFP, or PARP15-GFP following treatment with 0
or 20 nM pateamine A for 30 minutes. The immunoblots were developed
using one of the following antibodies: anti-Ago2, anti-DDX6,
anti-LSM1, anti-PABP, anti-FMRP, anti-eIF1A, anti-eIF2.alpha.,
anti-eIF3.eta., anti-eIF4A1, and anti-eIF4E.
[0113] FIG. 26A is picture of an immunoblot of a 4-12% SDS-PAGE gel
containing proteins immunoprecipitated with an anti-GFP antibody
from lysate from HeLa S3 cells transfected with a pEGFP-C1 plasmid
expressing TIA1-GFP, PABP-GFP, G3BP-GFP, or Ago2-GFP following
treatment with 0 or 20 nM pateamine A for 30 minutes. The
immunoblot was developed using a polyclonal anti-poly-ADP-ribose
antibody.
[0114] FIG. 26B is a picture of an immunoblot of an SDS-PAGE gel
containing proteins immunoprecipitated from lysate from
untransfected HeLa S3 cells using anti-G3BP and anti-Ago2
antibodies following treatment with 0 or 250 .mu.M sodium arsenite
for 60 minutes. The immunoblot was developed using a polyclonal
anti-poly-ADP-ribose antibody.
[0115] FIG. 26C is a picture of an immunoblot of an SDS-PAGE gel
containing proteins immunoprecipitated from lysate from HeLa S3
cells transfected with a pEGFP-C1 plasmid expressing G3BP1-GFP
(full-length), G3BP1-A-GFP (domain A), G3BP1-ABC-GFP (domains A, B,
and C), G3BP1-BC-GFP (domains B and C), G3BP1-BCD-GFP (domains B,
C, and D), and G3BP1-D-GFP (domain D) following treatment with 0 or
250 .mu.M sodium arsenite for 60 minutes. The immunoblot was
developed using a polyclonal anti-poly-ADP-ribose antibody.
[0116] FIG. 26D is a picture of an immunoblot of an SDS-PAGE gel
containing proteins immunoprecipitated from lysate from HeLa S3
cells transfected with a pEGFP-C1 plasmid expressing TIA1-GFP
(full-length) or TIA1.DELTA.RRM (mutant lacking RRM domain)
following treatment with 0 or 250 .mu.M sodium arsenite for 60
minutes. The immunoblot was developed using a polyclonal
anti-poly-ADP-ribose antibody.
[0117] FIG. 27 (left panel) is a set of micrographs showing the
localization of poly-ADP-ribose, and endogenous Ago2 and eIF3 in
HeLa cells following treatment with 250 .mu.M sodium arsenite for
30 minutes. The cells were imaged using fluorescently labeled
anti-poly-ADP-ribose, anti-Ago2, and anti-eIF3 antibodies. FIG. 26
(right panel) is an immunoblot of a 4-12% SDS-PAGE gel containing
proteins immunoprecipitated using an anti-Ago2 antibody from
untransfected HeLa cells following treatment with 0 or 250 .mu.M
sodium arsenite for 60 minutes. The immunoblot was developed using
anti-poly-ADP-ribose antibodies.
[0118] FIG. 28 is a picture of an immunoblot of a 4-12% SDS-PAGE
gel containing proteins immunoprecipitated with an anti-Ago2
antibody from lysate from untransfected HeLa cells following
treatment with 0 or 250 .mu.M sodium arsenite for 30 minutes. The
immunoblot was developed using a polyclonal anti-PARP13/13.1
antibody.
[0119] FIG. 29 is a picture of a Coomassie Blue-stained 4-12%
SDS-PAGE gel containing proteins immunoprecipitated using an
anti-GFP antibody from lysate from HeLa S3 cells transfected with a
pEGFP-C1 plasmid expressing PARP13-GFP following treatment with 0
or 250 .mu.M sodium arsenite for 30 minutes.
[0120] FIG. 30 is a graph showing the relative expression of
luciferase in lysates from 293T cells transfected with a modified
pGL4.72[hRlucCP].TM. vector (Promega); 10 nM of vector-target RNAi
(SEQ ID NOS: 38 and 39); and a pEGFP-C1 vector encoding EGFP, G3BP,
PAPR5A, PARP12, PARP13, PARP13.1, or PARP15. Luciferase expression
was measured in cell lysates at 48 hours post-transfection. The
level of luciferase in treated cells is compared to the level of
luciferase produced in cells transfected with the modified
pGL4.72[hRlucCP].TM. vector alone. As another positive control, the
level of luciferase produced from cells transfected with the
modified pGL4.72[hRlucCP].TM. vector and the vector-target RNAi is
shown (CXCR4 sponge).
[0121] FIG. 31 is a graph showing the relative expression of
luciferase in 293T cells transfected with a modified
pGL4.72[hRlucCP].TM. vector and 20 nM of negative RNAi control for
PARP13 siRNA (siNeg; All Stars Negative Control siRNA; Qiagen
Catalog No. 1027280) or PARP13 siRNA (siPARP13;
GCUCACGGAACUAUGAGCUGAGUUU; SEQ ID NO: 40) following treatment with
0 or 30 nM pateamine A for 30 minutes. Luciferase expression was
measured in cell lysates at 48 hours post-transfection.
DETAILED DESCRIPTION
[0122] We have discovered that specific PARP proteins and subsets
of PARP proteins have an effect on stress granule formation,
nucleation, or disassembly, and/or are localized in the nucleus and
are required for cell cycle progression through mitosis. We have
also discovered that PARGs have an effect on stress granule
formation, nucleation, and disassembly (i.e., stress granule
kinetics). The invention therefore provides methods, compositions,
and kits for the treatment of stress granule-related disorders and
cancer, and methods for determining the propensity of a subject to
develop a stress granule-related disorder or cancer based on these
unique activities of specific PARP proteins and PARGs. Conversely,
the invention also provides methods for increasing the
proliferation rate of a cell or cell population and increasing
stress granule formation in a cell or cell population by modulating
PARP function, PARG function, or poly-ADP-ribose pathways or
homeostasis in a cell or cell population. Lastly, the invention
provides screening methods for the identification of candidate
agents that may be useful for treating or reducing the likelihood
of developing a stress granule-related disorder and/or cancer.
Methods for Treating a Stress-Granule Related Disorder and
Decreasing Stress Granule Formation
[0123] The present invention provides methods for treating or
reducing the likelihood of developing one or more stress-granule
related disorders in a subject. Stress granule-related disorders
share a common etiology and pathology linked to oxidative stress
and inflammation. Stress granule-related disorders include, without
limitation, cardiovascular disorders, inflammatory disorders,
neurological disorders, or ischemic-reperfusion injury.
[0124] In the treatment methods provided by the invention, a
subject is administered a therapeutically effective dose of one or
more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) PARP inhibitor(s),
one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) PARG
activator(s), and/or one or more (e.g., 1, 2, 3, 4, or 5) PARP11
activator(s). A patient receiving the treatment may be previously
diagnosed as having a stress granule-related disorder, or may be
diagnosed as having a high probability (i.e., at significant risk)
of developing a stress granule-related disorder. A person receiving
the treatment may be asymptomatic or may be experiencing one or
more (e.g., 1, 2, 3, 4, or 5) of the symptoms of a stress
granule-related disorder.
[0125] Non-limiting examples of stress granule related disorders
include an aneurysm, angina, atherosclerosis, stroke,
cerebrovascular disease, congestive heart failure, coronary artery
disease, myocardial disease, peripheral vascular disease,
granulomatous myocarditis, chronic myocarditis, myocardial
infarction, primary hypertrophic cardiomyopathy, autoimmune
diseases, asthma, allergic intraocular inflammatory diseases,
arthritis, atopic dermatitis, atopic eczema, cirrhosis, Crohn's
disease, ulcerative colitis, diabetes, hemolytic anemia,
inflammatory dermatosis, an inflammatory bowel disorder, systemic
lupus erythamatosus, psoriasis, rheumatoid arthritis, Wegener's
granulomatosis, Hashimoto's thyroiditis, chronic pancreatitis,
reactive lymphoid hyperplasia, multiple sclerosis, Alzheimer's
disease, Parkinson's disease, Huntingon's disease, amyotrophic
lateral sclerosis, retinosa pigmentosum, macular degeneration,
traumatic brain injury, stroke, and peripheral neuropathy. Methods
for the diagnosis and monitoring of several stress granule related
disorders and known in the art. The methods of the invention may
reduce (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%,
or even 100%) one or more (e.g., 1, 2, 3, 4, or 5) of the symptoms
of a stress granule related-disorder or prevent the onset of one or
more (e.g., 1, 2, 3, 4, or 5) of the symptoms of a stress-related
disorder. Symptoms of a stress granule-related disorder include,
but are not limited to, pain, swelling, inflammation, loss of
cognition, loss of vision, loss of coordination, difficulty
breathing, airway constriction, artery occlusion, diarrhea,
elevated blood glucose, increased levels of pro-inflammatory
cytokines, increase protein aggregates or deposits, and increased
cell death (e.g., apoptosis or necrosis). The methods of treatment
provided herein may be used with one or more (e.g., 1, 2, 3, 4, or
5) other therapies or therapeutic agents used to treat a stress
granule-related disorder. The effectiveness of treatment may be
measured by a physician using methods known in the art.
[0126] In the treatment methods provided herein, a subject may be
administered one or more (e.g., 1, 2, 3, 4, or 5) PARP inhibitors.
The one or more PARP inhibitors preferably decrease (e.g., at least
10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or even 100% decrease)
the expression (e.g., protein and/or mRNA levels) and/or one or
more activities of PAR5A, PARP12, PARP13.1, PARP13.2, and PARIS.
The decrease in expression of PARP5A, PARP12, PARP13.1, PARP13.2,
and PARP15 preferably is a decrease in the expression of one or
more nucleic acids containing a sequence having at least 80%
sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even
100% identity) to PARP5A (SEQ ID NO: 8 or 9), PARP5B (SEQ ID NO:
10), PARP13.1 (SEQ ID NO: 19), PARP13.2 (SEQ ID NO: 20), or PARP15
(SEQ ID NO: 22 or 23), or one or more polypeptides encoded by these
nucleic acids. The PARP inhibitors also preferably inhibit one or
more of the activities of a PARP protein (e.g., PARP5A, PARP12,
PARP13.1, PARP13.2, or PARP15) including poly-ADP-ribosylation of a
target protein (e.g., a protein in a stress granule, a polypeptide
involved in the formation or disassembly of a stress granule, or a
PARP protein) or the formation or nucleation of a stress granule.
Methods for measuring the activity of one or more PARP proteins are
described herein.
[0127] A subject may also be administered one or more (e.g., 1, 2,
3, 4, or 5) PARG activators. Preferred PARG activators selectively
increase the expression and/or biological activity of PARG protein
or ARH3. For example, PARG activators desirably increase the level
of one or more nucleic acid(s) containing a nucleic acid sequence
having at least 80% sequence identity (e.g., at least 85%, 90%,
95%, 96%, 97%, 98%, 99%, or even 100% identity) to PARG (SEQ ID NO:
42) or ARH3 (SEQ ID NO: 41), or increase the level of one or more
polypeptides encoded by these nucleic acids. Desirably, a PARG
activator increases the one or more activities of a PARG protein or
ARH3, including, but not limited to, hydrolysis of poly-ADP-ribose
(e.g., poly-ADP-ribose attached to a substrate protein, e.g., a
protein localized in a stress granule, a polypeptide involved in
the formation or disassembly of a stress granule, or a PARP
protein), the prevention of the assembly of a stress granule, or
disassembly of a stress granule.
[0128] A subject may also be administered one or more (e.g., 1, 2,
3, 4, or 5) PARP11 activators. Desirably, the one or more PARP11
activators selectively increase the level of one or more nucleic
acids containing a sequence having at least 80% sequence identity
(e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100%
identity) to PARP11 (SEQ ID NO: 17), or increase the level of one
or more polypeptides encoded by these nucleic acids.
[0129] Additional desirable PARP11 activators increase one or more
activities of PARP11, including, but not limited to,
poly-ADP-ribosylation of a target protein (e.g., a protein
localized in a stress granule or a polypeptide involved in the
formation, a polypeptide involved in the disassembly of a stress
granule, and/or a PARP protein), the prevention of the assembly of
a stress granule, or the disassembly of a stress granule.
[0130] Examples of PARP inhibitors that may be used in these
methods include an antibody or antibody fragment that selectively
binds one or more of PARP5A, PARP12, PARP13.1, PARP13.2, and
PARP15; an RNA aptamer (e.g., SEQ ID NOS: 40, 49, 99-113, and
122-129); or a small molecule. Examples of PARG activators that may
be used in these methods include one or more nucleic acids
containing a sequence having at least 80% sequence identity (e.g.,
85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100% identity) to PARG
(SEQ ID NO: 42) or ARH3 (SEQ ID NO: 41). Examples of PARP11
activators that may be used in these methods include one or more
nucleic acids containing a nucleic acid sequence having at least
80% sequence identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%,
99%, or even 100% identity) to PARP11 (SEQ ID NO: 17).
[0131] In these methods, the one or more PARP inhibitors, one or
more PARG activators, and one or more PARP11 activators may be
administered co-extensively (overlapping bioactive periods) or
non-extensively (non-overlapping bioactive periods). In one
example, the one or more PARP inhibitors, one or more PARG
activators, and one or more PARP11 activators may be administered
together in a single dose or may be administered separately in one
or more separate doses (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10
doses). The amount of one or more PARP inhibitors, one or more PARG
activators, and one or more PARP11 activators that may be
administered to a subject per dose may be between 0.1 mg and 1 g,
0.1 mg and 750 mg, 0.1 mg and 600 mg, 0.1 mg and 500 mg, 10 mg and
450 mg, 10 mg and 400 mg, 10 mg and 350 mg, 10 mg and 350 mg, and
10 mg and 250 mg. Various combinations of the one or more PARP
inhibitors, one or more PARG activators, and one or more PARP11
activators are contemplated herein, for example, administration of
one or more PARP inhibitors alone, administration of one or more
PARG activators alone, administration of one or more PARP11
activators alone, administration of one or more PARP inhibitors and
one or more PARG activators together, and administration of one or
more PARP inhibitors and one or more PARP11 activators
together.
[0132] The one or more PARP inhibitors, one or more PARG
activators, and the one or more PARP11 activators may be
administered to the subjects once a day, twice a day, three times a
day, once a week, twice a week, three times a week, four times a
week, five times a week, six times a week, seven times a week,
bi-weekly, tri-weekly, or monthly. The one or more PARP inhibitors,
one or more PARG activators, and the one or more PARP11 activators
may be administered via the same route of administration or via
different routes of administration. For example, the one or more
PARP inhibitors may be administered orally and the PARG activators
may be administered parenterally (e.g., subcutaneously). The one or
more PARP inhibitors, one or more PARG activators, and/or the one
or more PARP11 activators may be formulated for any known route of
administration, including oral, intravenous, intraarterial,
intraocular, intranasal, intramuscular, and subcutaneous
administration. The one or more PARP inhibitors, one or more PARG
activators, and/or the one or more PARP11 activators may also be
formulated for administration in a sustained-release form. The
therapeutically effective dose of the one or more PARP inhibitors,
one or more PARG activators, and/or one or more PARP11 activators
may be determined by a skilled physician using methods known in the
art, in addition to the in vitro assays described herein.
[0133] The invention similarly provides methods of decreasing the
number of stress granules in a cell or a cell population by
contacting the cell or cell population with an effective amount of
one or more PARP inhibitors, one or more PARG activators, and one
or more PARP11 activators (as described for the treatment of
subjects above). In these methods, the one or more PARP inhibitors,
one or more PARG activators, and the one or more PARP11 activators
are added to the tissue culture medium to decrease the formation of
stress granules in a cell or a cell population. Desirably, the
cells are cultured for regenerative cell technology or the cells
are primary or germ cells. This method desirably confers on the
cells protection against oxidative stress and promotes the
longevity and morphology of the cultured cells. Preferred cells
that may be used in these methods include, without limitation, an
epithelial cell, a fibroblast, a kidney cell, a muscle cell, a
neuron, a hepatocyte, a sperm, a lymphocyte, or a macrophage. The
concentration of the one or more PARP inhibitors, the one or more
PARG activators, and the one or more PARP11 activators to be added
to the culture medium may be determined by using the methods
described herein (e.g., methods for the measurement of stress
granule formation).
Methods for Treating a Cancer and Decreasing Cell Proliferation
[0134] The present invention provides methods for treating or
reducing the likelihood of developing cancer in a subject. All
forms of cancer share a common etiology and pathology of
uncontrolled, unregulated, or misregulated cell proliferation or
cell division. Cancers that may be treated by the methods,
compositions, and kits of the invention include, without
limitation, colon adenocarcinoma, esophagas adenocarcinoma, liver
hepatocellular carcinoma, squamous cell carcinoma, pancreas
adenocarcinoma, islet cell tumor, rectum adenocarcinoma,
gastrointestinal stromal tumor, stomach adenocarcinoma, adrenal
cortical carcinoma, follicular carcinoma, papillary carcinoma,
breast cancer, ductal carcinoma, lobular carcinoma, intraductal
carcinoma, mucinous carcinoma, phyllodes tumor, Ewing's sarcoma,
ovarian adenocarcinoma, endometrium adenocarcinoma, granulose cell
tumor, mucinous cystadenocarcinoma, cervix adenocarcinoma, vulva
squamous cell carcinoma, basal cell carcinoma, prostate
adenocarcinoma, giant cell tumor of bone, bone osteosarcoma, larynx
carcinoma, lung adenocarcinoma, kidney carcinoma, urinary bladder
carcinoma, Wilm's tumor, lymphoma, and non-Hodgkin's lymphoma. The
methods of the invention may reduce (e.g., at least 10%, 20%, 30%,
40%, 50%, 60%, 70%, 80%, 90%, or even 100%) one or more (e.g., 1,
2, 3, 4, or 5) of the symptoms of a cancer or prevent the onset of
one or more (e.g., 1, 2, 3, 4, or 5) of the symptoms of a cancer.
Symptoms of a cancer include, but are not limited to, blood in
urine, pain or burning upon urination, cloudy urine, pain in bone,
fractures in bones, fatigue, weight loss, repeated infections,
nausea, vomiting, constipation, numbness in the legs, bruising,
dizziness, drowsiness, abnormal eye movements, changes in vision,
changes in speech, headaches, thickening of a tissue, rectal
bleeding, abdominal cramps, loss of appetite, fever, enlarged
lymphnodes, persistent cough, blood in sputum, lung congestion,
itchy skin, lumps in skin, abdominal swelling, vaginal bleeding,
jaundice, heartburn, indigestion, cell proliferation, and loss of
regulation of controlled cell death. The methods of treatment
provided herein may be used with one or more (e.g., 1, 2, 3, 4, or
5) other therapies or therapeutic agents used to treat a cancer
(e.g., chemotherapy, radiation, and/or surgery). The effectiveness
of treatment may be measured by a physician using methods known in
the art. Methods for the diagnosis and monitoring of several
cancers are known in the art.
[0135] In the treatment methods provided by the invention, a
subject is administered a therapeutically effective dose of one or
more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) of a PARP
inhibitor(s). A patient receiving the treatment may be previously
diagnosed as having a cancer, or may be diagnosed as having a high
probability (i.e., at significant risk) of developing a cancer. A
person receiving the treatment may be asymptomatic or may be
experiencing one or more of the symptoms of a cancer.
[0136] In the treatment methods provided herein, a subject may be
administered one or more PARP inhibitors. The one or more PARP
inhibitors preferably decrease (e.g., at least 10%, 20%, 30%, 40%,
50%, 60%, 70%, 80%, 90%, or even 100% decrease) the expression
and/or one or more (e.g., 1, 2, 3, 4, or 5) activities of one or
more of PARP1, PARP2, PARP5A, PARP 5B, PARP7, PARP8, PARP14, or
PARP16. Preferably, the decrease in expression is a decrease in the
level of one or more nucleic acids containing a sequence having at
least 80% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%,
99%, or even 100% identity) to PARP1 (SEQ ID NO: 1 or 2), PARP2
(SEQ ID NO: 3), PARP5A (SEQ ID NO: 8 or 9), PARP5B (SEQ ID NO: 10),
PARP7 (SEQ ID NO: 12), PARP8 (SEQ ID NO: 13), PARP14 (SEQ ID NO:
21), or PARP16 (SEQ ID NO: 24), or one or more polypeptides encoded
by these nucleic acids. The PARP inhibitors also preferably inhibit
one or more of the activities of a PARP protein (e.g., PARP1,
PARP2, PARP5A, PARP5B, PARP7, PARP8, PARP14, or PARP16) including
poly-ADP-ribosylation of a target protein (e.g., a protein
localized in the nucleus or mitotic spindle during cytokinesis, a
protein required for progression through mitosis, and/or a PARP
protein) or is required for progression through mitosis. Methods
for measuring the activity of one or more PARP proteins are
described herein.
[0137] Examples of PARP inhibitors that may be used in these
methods include an antibody or antibody fragment that selectively
binds one or more of PARP1, PARP2, PARP5A, PARP5B, PARP7, PARP8,
PARP14, and PARP16; an RNA aptamer (e.g., SEQ ID NOS: 43-46, 49,
50, 59-74, 114-121, and 130-136; shown in table below); or a small
molecule. In these methods, the one or more PARP inhibitors may be
administered co-extensively (overlapping bioactive periods) or
non-extensively (non-overlapping bioactive periods). In one
example, the one or more PARP inhibitors may be administered
together in a single dose or may be administered separately in one
or more separate doses (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10
doses). The amount of one or more PARP inhibitors may be between
0.1 mg and 1 g, 0.1 mg and 750 mg, 0.1 mg and 600 mg, 0.1 mg and
500 mg, 10 mg and 450 mg, 10 mg and 400 mg, 10 mg and 350 mg, 10 mg
and 350 mg, and 10 mg and 250 mg. Various combinations of the one
or more PARP inhibitors are contemplated herein, for example,
administration of one or more PARP inhibitors alone or
co-administration of one or more PARP inhibitors with another
therapeutic for the treatment of cancer or a therapeutic used to
alleviate one or more symptoms of a cancer.
TABLE-US-00001 TABLE 1 Specific PARP RNAi molecules PARP1
AAGCCUCCGCUCCUGAACAAU SEQ ID NO: 44 PARP2A AAUCAGUGUAAUGAACUACUA
SEQ ID NO: 45 PARP2B AAUGAUUCAGCUAUUAGAAGA SEQ ID NO: 46 PARP3
GGACCCAGGUGUAUGAGGACUACAA SEQ ID NO: 47 PARP4 AAACAAGGAUUUCUACUAAGA
SEQ ID NO: 48 PARP5A AACAAUUCACCGUCGUCCUCU SEQ ID NO: 49 PARP5B
AAGCUUCAGAAUGGUGCAAAU SEQ ID NO: 50 PARP6 CCCAACAAUGGAAACAUCUGAGCAA
SEQ ID NO: 51 PARP6 UUGCUCAGAUGUUUCCAUUGUUGGG SEQ ID NO: 52 PARP6
GGUUCAAGGCAAGUGGUACCAUCAA SEQ ID NO: 53 PARP6
UUGAUGGUACCACUUGCCUUGAACC SEQ ID NO: 54 PARP6
CAAAGUGGAAGUGUUUGGCUACCCU SEQ ID NO: 55 PARP6
AGGGUAGCCAAACACUUCCACUUUG SEQ ID NO: 56 PARP6
CAGAACAGAGGAUUCCAACAUUGAA SEQ ID NO: 57 PARP6
UUCAAUGUUGGAAUCCUCUGUUCUG SEQ ID NO: 58 PARP7
UGAGGUCUUUGAGGCCAAUAUUAAA SEQ ID NO: 59 PARP7
UUUAAUAUUGGCCUCAAAGACCUCA SEQ ID NO: 60 PARP7
GACUUUCUGCAAGGCACUUGUAUUU SEQ ID NO: 61 PARP7
AAAUACAAGUGCCUUGCAGAAAGUC SEQ ID NO: 62 PARP7
UCCUCCACCUCUUGAAGCAACUUCA SEQ ID NO: 63 PARP7
UGAAGUUGCUUCAAGAGGUGGAGGA SEQ ID NO: 64 PARP7
AAUGAUGACCAGAGUUACCCUUAUU SEQ ID NO: 65 PARP7
AAUAAGGGUAACUCUGGUCAUCAUU SEQ ID NO: 66 PARP8
GGAAGAUUCUGAAGGUGACAAUGAU SEQ ID NO: 67 PARP8
AUCAUUGUCACCUUCAGAAUCUUCC SEQ ID NO: 68 PARP8
CCCACAACUGGAAGCUGAUUUGUCA SEQ ID NO: 69 PARP8
UGACAAAUCAGCUUCCAGUUGUGGG SEQ ID NO: 70 PARP8
GAAGUGGAAUCUAUCUUAGUCCAAU SEQ ID NO: 71 PARP8
AUUGGACUAAGAUAGAUUCCACUUC SEQ ID NO: 72 PARP8
GCCUUAUGUGAAGUGAUCACCUCAU SEQ ID NO: 73 PARP8
AUGAGGUGAUCACUUCACAUAAGGC SEQ ID NO: 74 PARP9
GCCGGAGCAGCAGCUUACAAUGAAA SEQ ID NO: 75 PARP9
UUUCAUUGUAAGCUGCUGCUCCGGC SEQ ID NO: 76 PARP9
CCCUCUGAAUUUGUGUACAAAGACU SEQ ID NO: 77 PARP9
AGUCUUUGUACACAAAUUCAGAGGG SEQ ID NO: 78 PARP9
GGACCCUACUGUUGCUGCCUUUAAA SEQ ID NO: 79 PARP9
UUUAAAGGCAGCAACAGUAGGGUCC SEQ ID NO: 80 PARP9
UGGCAGACGGCAGAUGUAAUUGUUA SEQ ID NO: 81 PARP9
UAACAAUUACAUCUGCCGUCUGCCA SEQ ID NO: 82 PARP10
CAUGGUGCAGGGUAGAGGGAUUAUG SEQ ID NO: 83 PARP10
CAUAAUCCCUCUACCCUGCACCAUG SEQ ID NO: 84 PARP10
GCCUGGUGGAGAUGGUGCUAUUGAU SEQ ID NO: 85 PARP10
AUCAAUAGCACCAUCUCCACCAGGC SEQ ID NO: 86 PARP10
AGACGUCGCUCUCUUGCCACUUGAA SEQ ID NO: 87 PARP10
UUCAAGUGGCAAGAGAGCGACGUCU SEQ ID NO: 88 PARP10
UGGGCAGCAUUAGCUGCCAUGUGUU SEQ ID NO: 89 PARP10
AACACAUGGCAGCUAAUGCUGCCCA SEQ ID NO: 90 PARP11
CAACAAACAAUGAAGUGGAUGACAU SEQ ID NO: 91 PARP11
AUGUCAUCCACUUCAUUGUUUGUUG SEQ ID NO: 92 PARP11
CAGCCGGAUACCAACAGUCAGUGUU SEQ ID NO: 93 PARP11
AACACUGACUGUUGGUAUCCGGCUG SEQ ID NO: 94 PARP11
CAAACCCUUGUGGCUCCAUUUCUUU SEQ ID NO: 95 PARP11
AAAGAAAUGGAGCCACAAGGGUUUG SEQ ID NO: 96 PARP11
UGCCACCACACUGGGAGAAUGUGAA SEQ ID NO: 97 PARP11
UUCACAUUCUCCCAGUGUGGUGGCA SEQ ID NO: 98 PARP12
UCCACCUCUGCAGGUUCAUGGUCUA SEQ ID NO: 99 PARP12
UAGACCAUGAACCUGCAGAGGUGGA SEQ ID NO: 100 PARP12
UGCCAGAAAUUUGCCAACAUUACAA SEQ ID NO: 101 PARP12
UUGUAAUGUUGGCAAAUUUCUGGCA SEQ ID NO: 102 PARP12
GGUGAGCAGGCUGCCUACCAUUUAU SEQ ID NO: 103 PARP12
AUAAAUGGUAGGCAGCCUGCUCACC SEQ ID NO: 104 PARP12
AGGAUUUGGACAACAUGGAACUUAU SEQ ID NO: 105 PARP12
AUAAGUUCCAUGUUGUCCAAAUCCU SEQ ID NO: 106 PARP13
GCUGACCCAAGAGUAGCACUUGUUA SEQ ID NO: 107 PARP13
UAACAAGUGCUACUCUUGGGUCAGC SEQ ID NO: 108 PARP13
CCGGUGGCAGAUGCUUAUUGGUAAA SEQ ID NO: 109 PARP13
UUUACCAAUAAGCAUCUGCCACCGG SEQ ID NO: 110 PARP13
GCUCACGGAACUAUGAGCUGAGUUU SEQ ID NO: 40 PARP13
AAACUCAGCUCAUAGUUCCGUGAGC SEQ ID NO: 111 PARP13
UGCCUCAGUGGUAUGUGCAGCAGAU SEQ ID NO: 112 PARP13
AUCUGCUGCACAUACCACUGAGGCA SEQ ID NO: 113 PARP14
UGGCCUGUCUAAUGAUGACUUUCAA SEQ ID NO: 114 PARP14
UUGAAAGUCAUCAUUAGACAGGCCA SEQ ID NO: 115 PARP14
CCUGGUGCUGAUGACUACAGUUUAA SEQ ID NO: 116 PARP14
UUAAACUGUAGUCAUCAGCACCAGG SEQ ID NO: 117 PARP14
GCCACUUUCUGUGUUCCCAUACUAU SEQ ID NO: 118 PARP14
AUAGUAUGGGAACACAGAAAGUGGC SEQ ID NO: 119 PARP14
GAAGAGUCACUAGAUCUUCCCUUAU SEQ ID NO: 120 PARP14
AUAAGGGAAGAUCUAGUGACUCUUC SEQ ID NO: 121 PARP15
GAUGAAUUCACUAACUGGUCAAGAA SEQ ID NO: 122 PARP15
UUCUUGACCAGUUAGUGAAUUCAUC SEQ ID NO: 123 PARP15
CCUAUCACAGUUGCUGAUAACAUAA SEQ ID NO: 124 PARP15
UUAUGUUAUCAGCAACUGUGAUAGG SEQ ID NO: 125 PARP15
GGACUGACAUGAAUCAUCAGCUGUU SEQ ID NO: 126 PARP15
AACAGCUGAUGAUUCAUGUCAGUCC SEQ ID NO: 127 PARP15
CGAGUACUUACUGGAGUCUUCACAA SEQ ID NO: 128 PARP15
UUGUGAAGACUCCAGUAAGUACUCG SEQ ID NO: 129 PARP16
CAGUGCAGGGAAGGCAGAGUUUGAA SEQ ID NO: 130 PARP16
UUCAAACUCUGCCUUCCCUGCACUG SEQ ID NO: 131 PARP16
GAGACCAAAGGAGAACGAGACCUAA SEQ ID NO: 132 PARP16
UUAGGUCUCGUUCUCCUUUGGUCUC SEQ ID NO: 133 PARP16
GACUUGAGCCUGGCCCUCAUAUACA SEQ ID NO: 134 PARP16
UGUAUAUGAGGGCCAGGCUCAAGUC SEQ ID NO: 135 PARP16
CCCAAGUACUUCGUGGUCACCAAUA SEQ ID NO: 43 PARP16
UAUUGGUGACCACGAAGUACUUGGG SEQ ID NO: 136
[0138] The one or more PARP inhibitors may be administered to the
subjects once a day, twice a day, three times a day, once a week,
twice a week, three times a week, four times a week, five times a
week, six times a week, seven times a week, bi-weekly, tri-weekly,
or monthly. The one or more PARP inhibitors may be administered via
the same route of administration or via different routes of
administration. For example, the one or more PARP inhibitors may be
administered orally and one or more other PARP inhibitors may be
administered parenterally (e.g., subcutaneously). The one or more
PARP inhibitors may be formulated for any known route of
administration, including oral, intravenous, intraarterial,
intraocular, intranasal, intramuscular, and subcutaneous
administration. The one or more PARP inhibitors may also be
formulated for administration in a sustained-release form.
[0139] The invention similarly provides methods of decreasing the
proliferation rate in a cell or a cell population by contacting the
cell or cell population with an effective amount of one or more
PARP inhibitors (as described for the treatment of subjects above).
In these methods, the one or more PARP inhibitors are added to the
tissue culture medium to decrease the proliferation rate of a cell
or a cell population. Desirably, the cells are cultured for
regenerative cell technology, the cells are primary or germ cells,
or the cells are being stored for later therapeutic or experimental
use. This method desirably confers on the cells protection from
oxidative stress, promotes the longevity and morphology of the
cultured cells, and/or delays the onset of senescence of the cells.
Preferred cells that may be used in these methods include, without
limitation, an epithelial cell, a fibroblast, a kidney cell, a
muscle cell, a neuron, a hepatocyte, a sperm, a lymphocyte, or a
macrophage. The concentration of the one or more PARP inhibitors
may be determined using methods known in the art and those methods
described herein (e.g., methods for the measurement of cell growth
and division).
Pharmaceutical Compositions
[0140] The invention further provides pharmaceutical compositions
for treating or reducing the likelihood of developing one or more
stress granule disorders and cancer. For example, the compositions
for the treating or decreasing the likelihood of developing a
stress granule-related disorder may include one or more of the PARP
inhibitors (e.g., PARP5A, PARP12, PARP13.1, PARP13.2, and PARP15
inhibitors), one or more of the PARG activators (e.g., PARG protein
and ARH3 activators), and/or one or more of the PARP11 activators
as described above. Compositions for treating or decreasing the
likelihood of developing a cancer may include one or more of the
PARP inhibitors (e.g., PARP1, PARP2, PARP5A, PARP5B, PARP7, PARP8,
PARP14, and PARP16 inhibitors) as described above. The one or more
agents that may be used as pharmaceutical compositions for treating
or reducing the likelihood of developing a stress granule-related
disorder or cancer may also be identified using the screening
assays provided herein.
[0141] Examples of pharmaceutical compositions for treating or
reducing the likelihood of developing a stress granule related
disorder include one or more of an antibody or antibody fragment
that specifically binds to PARP5A, PARP12, PARP13.1, PARP13.2, and
PARP15; an RNAi molecule that decreases the expression of one or
more of PARP5A, PARP12, PARP13.1, PARP13.2, and PARP15 (e.g., SEQ
ID NOS: 40, 49, 99-113, and 122-129); one or more nucleic acids
containing a sequence having at least 80% sequence identity (e.g.,
at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100%) to PARP11
(SEQ ID NO: 17), PARG (SEQ ID NO: 42), or ARH3 (SEQ ID NO: 41), and
one or more small molecules or metabolites identified in the
screening assays provided herein.
[0142] Examples of pharmaceutical compositions for treating or
reducing the likelihood of developing a cancer include one or more
of an antibody or antibody fragment that specifically binds to
PARP1, PARP2, PARP5A, PARP5B, PARP7, PARP8, PARP14, and PARP16; an
RNAi molecule that decreases the expression of one or more of
PARP1, PARP2, PARP5A, PARP5B, PARP7, PARP8, PARP14, and PARP16
(e.g., SEQ ID NOS: 43-46, 49, 50, 59-74, 114-121, and 130-136); and
one or more small molecules or metabolites identified in the
screening assays provided herein.
[0143] The pharmaceutical compositions provided by the invention
may further include one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9,
or 10) secondary agents. Non-limiting examples of secondary agents
that may be included in the compositions of the invention are one
or more chemotherapeutic agent(s), one or more non-steroidal
anti-inflammatory drug(s), one or more immunosuppressive agent(s),
one or more calcineurin inhibitor(s), or one or more analgesic(s).
Examples of these classes of therapeutic agents are known in the
art.
[0144] The dose of one or more PARP inhibitors, PARP11 activators,
and/or PARG activators may be between 0.1 mg and 1 g, 0.1 mg and
750 mg, 0.1 mg and 600 mg, 0.1 mg and 500 mg, 10 mg and 450 mg, 10
mg and 400 mg, 10 mg and 350 mg, 10 mg and 350 mg, and 10 mg and
250 mg.
[0145] The dose of one or more secondary agents that may be
included in the compositions of the invention may be between 0.1 mg
and 2 g, 0.1 mg and 1.5 mg, 0.1 mg and 1 g, 0.1 mg and 750 mg, 1 mg
and 650 mg, 1 mg and 550 mg, 1 mg and 500 mg, 10 mg and 450 mg, 10
mg and 400 mg, 10 mg and 350 mg, 10 mg and 350 mg, and 10 mg and
250 mg.
[0146] The compositions may be formulated using any known method
including formulation as a pill, an injectible fluid (e.g., in
PBS), or in a sustained-release form. The compositions may be
formulated for any specific route of administration including oral,
intramuscular, intraocular, intranasal, subcutaneous,
intraarterial, and intravenous administration.
Kits
[0147] The invention further provides kits containing one or more
(e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) of the pharmaceutical
compositions described herein. The kits may further contain
materials to aid in the administration of the pharmaceutical agents
(e.g., a syringe). The kits may contain one or more doses of a
pharmaceutical agent provided by the invention. The kits may
further contain instructions for administering the pharmaceutical
compositions to a subject having a stress granule-related disorder
or cancer, or a subject that has a high probability of developing
(a high propensity) for developing a stress granule-related
disorder or cancer.
Medical Screening Assays
[0148] The invention further provides methods of determining the
propensity of a subject to develop a stress granule-related
disorder by determining the expression (e.g., protein or mRNA
levels) and/or one or more (e.g., 1, 2, 3, 4, or 5) activities of
one or more (e.g., 1, 2, 3, 4, 5, 6, 7, or 8) of PARP5A, PARP11,
PARP12, PARP13.1, PARP13.2, PARP15, PARG, and ARH3 in a subject,
wherein an increase (e.g., at least 5%, 10%, 20%, 30%, 40%, 50%,
60%, 70%, 80%, 90%, or 100%) in the expression (e.g., mRNA and/or
protein) and/or one or more (e.g., 1, 2, 3, 4, or 5) activities of
one or more (e.g., 1, 2, 3, 4, or 5) of PARP5A, PARP12, PARP13.1,
PARP13.2, and PARP15, and/or a decrease (e.g., at least 10%, 20%,
30%, 40%, 50%, 60%, 70%, 80%, 90%, or even 100%) in one or more
(e.g., 1, 2, or 3) of PARG, ARH3, and PARP11 expression (e.g.,
protein or mRNA levels) and/or one or more activities indicates an
increased propensity to develop a stress-granule related disorder.
In this method, the expression measured may be the level of one or
more nucleic acids containing a nucleic acid sequence having at
least 80% (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or
even 100%) to PARP5A (SEQ ID NO: 8 or 9), PARP5B (SEQ ID NO: 10),
PARP11 (SEQ ID NO: 17), PARP13.1 (SEQ ID NO: 19), PARP13.2 (SEQ ID
NO: 20), PARP15 (SEQ ID NO: 22 or 23), PARG (SEQ ID NO: 42), or
ARH3 (SEQ ID NO: 41), or one or more polypeptides encoded by these
nucleic acids.
[0149] The invention further provides methods of determining the
propensity of a subject to develop a cancer by determining the
expression (e.g., protein and/or mRNA level) and/or one or more
activities (e.g., 1, 2, 3, 4, or 5) of one or more (e.g., 1, 2, 3,
4, 5, 6, 7, or 8) of PARP1, PARP2, PARP5A, PARP5B, PARP7, PARP8,
PARP14, and PARP16 in a subject, wherein an increase (e.g., at
least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or even 100%) in
the expression and/or one or more activities of one or more (e.g.,
1, 2, 3, 4, 5, 6, 7, or 8) of PARP1, PARP2, PARP5A, PARP5B, PARP7,
PARP8, PARP14, and PARP16 indicates an increased propensity to
develop cancer. In this method, the expression measured may be the
level of one or more nucleic acids containing a nucleic acid
sequence having at least 80% (e.g., at least 85%, 90%, 95%, 96%,
97%, 98%, 99%, or even 100%) identity to PARP1 (SEQ ID NO: 1 or 2),
PARP2 (SEQ ID NO: 3), PARP5A (SEQ ID NO: 8 or 9), PARP5B (SEQ ID
NO: 10), PARP 7 (SEQ ID NO: 12), PARP8 (SEQ ID NO: 13), PARP14 (SEQ
ID NO: 21), and PARP16 (SEQ ID NO: 16), or the level of one or more
polypeptides encoded by these nucleic acids.
[0150] In each of these methods, the level of expression of a
nucleic acid may be determined using RT-PCR and the level of a
polypeptide encoded by a nucleic acid may be determined by a
variety of different antibody-based techniques including, but not
limited to, immunoblotting, fluorescence-assisted cell sorting
(FACS), and enzyme-linked immunosorbent assay (ELISA). In each
assay, the level of expression in a subject may be compared to a
subject known to have a stress granule-related disorder or cancer,
or a control subject that does not have a stress granule-related
disorder or cancer, or a very low propensity for developing a
stress granule-related disorder or cancer.
PARP, PARG, and ARH3 Fusion Proteins
[0151] General Design
[0152] The invention provides fusion proteins for each PARP, PARG,
and ARH3. The fusion proteins may be used to identify unique
biological activities for each PARP, PARG, and ARH3 protein and to
identify specific inhibitors and activators for each PARP, PARG, or
ARH3, or specific subsets of these proteins. The invention provides
nucleic acid sequences encoding these PARP, PARG, and ARH3 fusion
proteins. The nucleic acids contain a sequence that is at least 80%
identical (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or
even 100% identical) to the full-length sequence of PARP1 (SEQ ID
NO: 1 or 2), PARP2 (SEQ ID NO: 3), PARP3 (SEQ ID NO: 4), PARP3.2
(SEQ ID NO: 5), PARP3.3 (SEQ ID NO: 6), PARP4 (SEQ ID NO: 7),
PARP5A (SEQ ID NO: 8 or 9), PARP5B (SEQ ID NO: 10), PARP6 (SEQ ID
NO: 11), PARP7 (SEQ ID NO: 12), PARP8 (SEQ ID NO: 13), PARP9 (SEQ
ID NO: 14), PARP10 (SEQ ID NO: 15), PARP10.2 (SEQ ID NO: 16),
PARP11 (SEQ ID NO: 17), PARP12 (SEQ ID NO: 18), PARP13.1 (SEQ ID
NO: 19), PARP13.2 (SEQ ID NO: 20), PARP14 (SEQ ID NO: 21), PARP15.1
(SEQ ID NO: 22), PARP15.2 (SEQ ID NO: 23), PARP16 (SEQ ID NO: 24),
PARG (SEQ ID NO: 42), or ARH3 (SEQ ID NO: 41).
[0153] The nucleic acids of the invention further contain nucleic
acid sequences encoding one or two polypeptide tags. The nucleic
acids encoding a polypeptide tag may be placed at a position 5' or
a position 3' to the sequence encoding a PARP, PARG, or ARH3
protein. For example, the 3' end of a nucleic acid sequence
encoding a polypeptide tag may directly abut (i.e., no intervening
nucleotides) the 5' end of a nucleic acid sequence encoding a PARP,
PARG, or ARH3 protein. In another example, the 5' end of a nucleic
acid sequence encoding a polypeptide tag may directly abut (i.e.,
no intervening nucleotides) the 3' end of nucleic acid sequence
encoding a PARP, PARG, or ARH3 protein. In another example, one or
more nucleotides (e.g., at least 2, 3, 4, 5, 10, 15, 20, 25, 30,
35, 40, 45, 50, 60, 70, 80, 90, 100, 200, 300, or 400 nucleotides)
separate the 5' end of the sequence encoding the polypeptide tag
from the 3' end of the sequence encoding a PARP protein, or
separate the 3' end of the sequence encoding the polypeptide tag
from the 5' end of the sequence encoding the PARP protein.
Sequences encoding the polypeptide tags are described in further
detail below.
[0154] Polypeptide Tags
[0155] Polypeptide tags may be attached to a native protein
sequence in order to aid in the purification of the protein, to
label the protein for visualization in the cell, and/or to increase
the thermodynamic stability and/or half-life of a protein. Nucleic
acids encoding a polypeptide tag(s) may include one or more of the
following sequences: a sequence encoding an epitope which may be
recognized by a specific antibody recognizing the epitope (e.g., 1,
2, 3, 4 or 5 antigenic peptide sequences); a sequence encoding a
protein that is bound with high affinity by a specific binding
partner; one or more (e.g., 1, 2, 3, 4, or 5) sequence(s) encoding
a peptide sequence that aids in purification (e.g., a His.sub.6
tag); one or more (e.g., 1, 2, 3, 4, 5, 6, or 7) sequence(s)
encoding a protease recognition sequence; and one or more (e.g., 1,
2, 3, or 4) sequences encoding a protein or a domain of a protein
which increases the thermodynamic stability or half-life of the
protein. The size of the nucleic acid sequence encoding the
polypeptide tag may be between 1-50 nucleotides, 1-100 nucleotides,
1-200 nucleotides, 1-300 nucleotides, 1-400 nucleotides, 1-500
nucleotides, 200-500 nucleotides, 1-1,000 nucleotides, 1-5,000
nucleotides, 1-8,000 nucleotides, 1-10,000 nucleotides, or 1-20,000
nucleotides. Several polypeptide tags and sequences encoding
polypeptide tags are known in the art. Non-limiting examples of
sequences that may be incorporated in polypeptide tags are
described below.
[0156] The nucleic acids encoding a polypeptide tag may contain
sequences for one or more (e.g., 1, 2, 3, 4, or 5) epitopes or
antigenic peptide sequences. Epitopes incorporated into polypeptide
tags may be used to aid in the purification of a fusion protein,
for e.g., by use of an antibody that specifically binds to the
epitope. Examples of epitope sequences include, but are not limited
to, a FLAG peptide (DYKDDDDK; SEQ ID NO: 30); a
glutathione-S-transferase (GST) peptide; a KT3 peptide
(KPPTPPPEPET; SEQ ID NO: 31); a hemagglutinin peptide (YPYDVPDYA;
SEQ ID NO: 32), a calmodulin-binding peptide (Methods in Molecular
Biology: E. coli Gene Expression Protocols, volume 205, Humana
Press, 2003, pp. 79-97), a R-tag peptide (Jones et al., Protein
Expr. Purif. 53:404-410, 2007), a V5 peptide, a c-myc peptide, and
peptides derived from chitin-binding protein (CBP), CYD, Strep II,
HPC, and maltose binding protein (MBP), as described in Lichty et
al. (Protein Expr. Purif. 41:98-105, 2005).
[0157] Nucleic acids encoding a polypeptide tag may contain
sequences for one or more (e.g., 1, 2, 3, 4, or 5) proteins with
specific binding partners. Desirably, the specific binding partner
has a high affinity (e.g., K.sub.D<150 nM or K.sub.D<250 nM)
to the peptide sequence in the polypeptide tag. Non-limiting
examples of sequences that encode a protein with a high-affinity
binding partner is biotin and the ZZ-domain of S. aureus protein A
(e.g., a nucleic acid sequence with at least 80% identity to SEQ ID
NO: 27). Additionally, the polypeptide tag may contain one or more
peptide sequences that aid in the purification of the protein.
Non-limiting examples of peptide sequences that aid in the
purification of a protein include a His.sub.6 tag, chitin-binding
protein (CBP), maltose-binding protein (MBP), and
glutathione-S-transferase (GST). For example, a protein containing
a polypeptide tag containing a His.sub.6 tag may be purified by
passing a crude cellular lysate over a metal matrix (e.g., a
Ni.sup.+-Sepharose resin).
[0158] A polypeptide tag may also contain a sequence encoding a
protein that increases the thermodynamic stability, half-life,
and/or solubility of a protein. Non-limiting examples of peptides
that increase the solubility of a protein include thioredoxin and
poly(NANP). Additional non-limiting examples of proteins that
increase the thermodynamic stability or half-life of a protein
include the Fc domain of an antibody and albumin. A polypeptide tag
may also contain one or more (e.g., 1, 2, 3, or 4) sequences
encoding a protein that allows for the visualization of the fusion
protein in the cell (e.g., a polypeptide tag containing a sequence
encoding a fluorescent protein, such as green fluorescence
protein).
[0159] A polypeptide tag may also contain one or more (e.g., 1, 2,
3, 4, 5, 6, or 7) protease recognition sequences. A fusion protein
may be treated with one or more (e.g., 1, 2, 3, or 4) specific
proteases that cleave the fusion protein at the one or more
specific protease recognition sequences at any step in the
purification process (e.g., after being bound to a resin or solid
surface) to remove the polypeptide tag(s) from the remainder of the
fusion protein. Non-limiting examples of protease recognition
sequences include TEV protease (Glu-X-X-Tyr-X-Gln-Ser; SEQ ID NO:
26), factor Xa (Ile-Glu/Asp-Gly-Arg), Ala-64 subtilisin
(Gly-Ala-His-Arg), clostripain (Arg and Lys-Arg), collagenase
(Pro-Val-Gly-Pro), enterokinase (Asp-Asp-Asp-Asp-Lys), renin
(Pro-Phe-His-Leu-Leu), and .alpha.-thrombin
(Leu-Val-Pro-Arg-Gly-Ser). When a polypeptide tag is present at the
N-terminus of a fusion protein, a protease recognition sequence is
preferably located at a position 3' to a peptide sequence encoding
an epitope, a sequence encoding a protein that is bound with high
affinity by a specific binding partner, or a sequence encoding a
peptide sequence that aids in purification. When a polypeptide tag
is present at the C-terminus of a fusion protein, a protease
recognition sequence is preferably located at a position 5' to a
peptide sequence encoding an epitope, a sequence encoding a protein
that is bound with high affinity by a specific binding partner,
and/or a sequence encoding a peptide sequence that aids in
purification. A polypeptide tag may contain one or more (e.g., 1,
2, 3, 4, 5, 6, or 7) of the same or different protease recognition
sequences in tandem (i.e., without intervening amino acids) or with
one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) intervening
amino acids between each protease recognition sequence. Methods for
the treatment of a fusion protein containing a protease recognition
sequence in the polypeptide tag with one or more protease(s) are
known in the art.
[0160] Expression Vectors
[0161] A number of expression vectors for the expression of a
nucleic acid encoding one or more nucleic acids encoding a PARP,
PARG, and/or ARH3 fusion protein of the invention are known in the
art. Different examples of expression vectors are available for
expression of the PARP, PARG, and/or ARH3 fusion proteins in
mammalian cells, insect cells, yeast cells, and bacterial cells.
For example, the pEGFP-C1 mammalian vector (Invitrogen) contains a
CMV promoter sequence, a nucleic acid sequence encoding green
fluorescence protein, a multiple cloning site for insertion of
nucleic acid sequence encoding a PARP, PARG, or ARH3 nucleic acid
(e.g., a sequence with 80% to one of SEQ ID NOS: 1-24, 41, and 42).
Additional non-limiting examples of publicly-available mammalian
expression vectors include constitutive expression vectors
Gateway.RTM. pDEST.TM.26, pDEST.TM.27, pDEST.TM.40, and pDEST.TM.47
(Invitrogen); adenoviral expression vectors (e.g., pAd/CM/V5-Dest
Gateway.RTM. Vector Kit (Invitrogen); episomal expression vectors
pCEP4 and pEBNA DEST (Invitrogen); lentiviral expression vectors
(e.g., ViraPower.TM. Bsd; Invitrogen); and regulated expression
vectors Gateway.RTM. pT-Rex.TM.-DEST 30 and pT-Rex.TM.-DEST 31
(Invitrogen). Non-limiting examples of bacterial expression vectors
include Gateway.RTM. pDEST.TM.14; Gateway.RTM. pDEST.TM.15;
Gateway.RTM. pDEST.TM.17; Gateway.RTM. pDEST.TM.24; Gateway.RTM.
pET-DEST42; pEM7/Bsd; pEM7/Zeo; pRSET A, B, & C; pRSET-BFP;
pRSET-CFP; pRSET-EmGFP; pTrcHIs A, B, & C; and pTrcHIs2 A, B,
& C vectors (Invitrogen). Non-limiting examples yeast
expression vectors include pAO815; pGAPZ A, B, & C; pPIC3.5K;
pPIC9K; pTEF1/Bsd; pTEF1/Zeo; pYC2/CT; pYES2; pYES2/CT; and
pYES3/CT (Invitrogen). Non-limiting examples of insect and
baculovirus expression vectors include Gateway.RTM. pDEST.TM.10;
Gateway.RTM. pDEST.TM.20; Gateway.RTM. pDEST.TM.8; Gateway.RTM.
pMT-DEST.TM.48; pAC5.1/V5-His A, B, & C; pFastBac Dual; and
pIB/V5-His-DEST (Invitrogen).
[0162] The expression vectors used to express a fusion protein may
include one or more (e.g., 1, 2, 3, 4, or 5) constitutive promoter
sequences and/or one or more (e.g., 1, 2, 3, 4, or 5) inducible
promoter sequences. Non-limiting examples of constitutive promoter
sequences include bacterial promoters (e.g., E. coli
.sigma..sup.70, .sigma..sup.S, .sigma..sup.32, or .sigma..sup.54
promoters; B. subtilis .sigma..sup.A or .sigma..sup.B promoters; T7
RNA polymerase-based promoters; and a bacteriophage SP6 promoter),
yeast promoters (e.g., pCyc, pAdh, pSte5, ADH1, cyc100, cyc70,
cyc43, cyc28, cyc16, pPGK1, pCYC, GPD (TDH3), and CLB1 promoters),
and mammalian promoters (e.g., cytomegalovirus immediate early
gene-based promoters, SV40 early promoter, and Rous sarcoma virus
promoter). Non-limiting examples of inducible promoter sequences
include alcohol dehydrogenase I gene promoters,
tetracycline-responsive promoter systems, glucocorticoid receptor
promoters, estrogen receptor promoter, ecdysone receptor promoters,
metallothionein-based promoters, and T7-polymerase based promoters.
Several different mammalian expression vectors available that allow
for the inducible expression of a nucleic acid sequence (e.g., a
PARP fusion protein) are publicly available including
pTet-On-Advanced (Clontech), pERV3 (Stratagene), pNEBR-R1 (New
England BioLabs), and pCMV5-CymR (Qbiogene).
PARP, PARG, and ARH3 Proteins
[0163] The above-described methods for the generation of PARP,
PARG, or ARH3 fusion proteins may be modified to generate PARP,
PARG, or ARH3 proteins. In these methods, the expression vectors
that contain a nucleic acid sequence encoding a PARP, PARG, or ARH3
fusion protein may be modified to remove the nucleic acid sequences
encoding the polypeptide tag. The modified vector may then be
introduced into a cell to generate a transgenic cell for the
expression of the full-length or wild-type PARP, PARG, or ARH3
protein. The produced PARP, PARG, or ARH3 protein may contain one
or more post-translational modifications, including phosphorylation
and poly-ADP-riboyslation. The post-translational modifications may
be introduced using recombinant enzymes in vitro or may be the
result of processing within the transgenic cell.
[0164] Methods for the expression and purification of one or more
PARP, PARG, and ARH3 proteins are the same as those employed for
the corresponding PARP, PARG, and ARH3 fusion proteins, with the
exception that affinity purification using antibodies and molecules
that specifically recognize the polypeptide tag will not be
employed.
Transgenic Cells and Mammals
[0165] One or more nucleic acids encoding a PARP, PARG, and/or ARH3
protein, and/or PARP, PARG, and/or ARH3 fusion protein may be
introduced into a transgenic cell using methods known in the art,
including, but not limited to electroporation, microinjection,
lipid-mediated transfection (e.g., liposomal delivery systems),
calcium phosphate-mediated transfection, DEAE dextran-mediated
transfection, DNA transfection by biolistics, DNA transfection
mediated by polybrene, and virus-mediated transduction.
[0166] The one or more nucleic acids encoding a PARP, PARG, and/or
ARH3 protein, and/or PARP, PARG, and/or ARH3 fusion protein may be
introduced into any type of cell, including, but not limited to, a
mammalian cell (e.g., a human, mouse, rat, monkey, or rabbit cell),
a yeast cell, a bacterial cell, or an insect cell. A mammalian cell
that expresses one or more nucleic acids encoding a PARP, PARG,
and/or ARH3 protein, and/or PARP, PARG, and/or ARH3 fusion protein
may include a fibroblast, an epithelial cell, an endothelial cell,
a smooth muscle cell, a hepatocyte, a kidney cell, and a
lymphocyte. Additional examples of suitable mammalian cell lines
include COS-7 monkey kidney cells, CV-1, L cells, C127 cells, 3T3
cells, Chinese hamster ovary (CHO) cells, human embryonic kidney
(HEK) cells, HeLa cells (e.g., HeLa S3 or HeLa Kyoto cells), 293
cells, 293T cells, and BHK cell lines. One or more nucleic acids
may also be expressed in a cell (e.g., a mammalian cell, a
bacterial cell, or a yeast cell) that has been engineered to
express one or more (e.g., 1, 2, 3, or 4) chaperone proteins, one
or more (e.g., 1, 2, 3, or 4) enzymes that promote the
post-translational modification of proteins, and/or contain one or
more (e.g., 1, 2, 3, or 4) mutations in the nucleic acids encoding
one or more (e.g., 1, 2, 3, or 4) proteins that have a negative
effect on the expression of a transgenic protein (e.g., a PARP
fusion protein), such as a specific RNAse or protease. An example
of a bacterial cell that has been engineered to contain a mutation
in a RNAse is BL21 Star.TM. (Invitrogen). A variety of cells are
commercially available for the expression of one or more
recombinant proteins (e.g., one or more PARP, PARG, and/or ARH3
fusion proteins), including, but not limited to, bacterial
competent cells (e.g., BL21-AI.TM. One Shot.RTM., One
Shot.RTM.-BL21(DE3), and One Shot.RTM.-BL21(DE3) pLysE, One
Shot.RTM. BL21(DE3) pLysS (Invitrogen); and mammalian competent
cells (e.g., Espresso Competent Hela S3 Cells, Espresso Competent
CHO-K1 cells, and Espresso Competent HEK 293 cells (Neuromics),
MaxPAK Competent HeLa S3 cells, MaxPAK Competent CHO-K1 cells, and
MaxPAK Competent HEK 293 cells (Genlantis)).
[0167] A transgenic cell that contains one or more nucleic acids
encoding a PARP, PARG, and/or ARH3 protein, and/or PARP, PARG,
and/or ARH3 fusion protein may a stable cell line (e.g., a cell
that has integrated the one or more nucleic acids encoding a PARP
fusion protein into one or more of its chromosomes). Alternatively,
a transgenic cell may contain the one or more nucleic acids
encoding a PARP, PARG, and/or ARH3 protein, and/or PARP, PARG,
and/or ARH3 fusion protein in a plasmid or on an artificial
chromosome, which replicates independently of the chromosomes of
the cell.
[0168] A transgenic mammal may also be produced from a transgenic
cell containing one or more nucleic acids encoding a PARP, PARG,
and/or ARH3 protein, and/or a PARP, PARG, and/or ARH3 fusion
protein. A transgenic animal may be a mouse, a rat, a bovine, an
ovine, a caprine, a porcine, a horse, a rabbit, or a monkey. The
nucleic acid encoding one or more PARP, PARG, and/or ARH3 proteins,
and/or PARP, PARG, and/or ARH3 fusion proteins may contain a
tissue-specific promoter that allows the expression of one or more
transgenic proteins into a biological fluid of the mammal (e.g.,
into the milk or serum of the transgenic mammal). For example, a
protein may be engineered for expression in the milk of a mammal by
placing the sequence encoding the protein downstream of the casein
promoter (U.S. Pat. No. 4,873,316). A PARP, PARG, and/or ARH3
protein, and/or PARP, PARG, and/or ARH3 fusion protein produced in
a biological fluid of a transgenic mammal may be purified as
described below.
[0169] Methods for the production of a transgenic mammal from a
transgenic cell are known in the art and include, without
limitation, methods that require the transfer of a nucleus from a
transgenic cell to an enucleated oocyte and/or the microinjection
of one or more nucleic acids (e.g., a plasmid or an artificial
chromosome) encoding one or more PARP, PARG, and/or ARH3 proteins,
and/or PARP, PARG, and/or ARH3 fusion proteins into an oocyte. Such
genetically manipulated oocytes may then be transferred into a
recipient female host to produce a transgenic mammal.
Cell Lysates
[0170] Cell lysates may be prepared from the transgenic cells
containing a nucleic acid encoding one or more PARP, PARG, and/or
ARH3 proteins, and/or PARP, PARG, and/or ARH3 fusion proteins of
the invention. Cell lysates may be prepared by any methods known in
the art, including both physical disruption methods and chemical
disruption methods. Physical disruption methods include, but are
not limited to sonication, homogenization, and rapid freeze/thaw
lysis. Chemical disruption methods include, but are not limited to,
the use of lysis buffers (e.g., buffers containing a detergent such
as Triton-X-100 and NP-40). Following lysis of the cell membrane
using chemical and/or physical disruption methods, the lysate may
optionally be centrifuged to remove cellular debris and/or
partially purified by one or more (e.g., 1, 2, 3, 4, 5, 6, or 7) of
the following steps: salt gradient precipitation (e.g., ammonium
sulfate precipitation), size exclusion chromatography or dialysis,
and column chromatography (e.g., affinity chromatography, size
exclusion chromatography, anion exchange chromatography, and cation
exchange chromatography). The cell lysate may also be treated with
one or more (e.g., 1, 2, or 3) of a DNAse, RNAse, or lipase prior
to further use. One or more (e.g., 1, 2, 3, 4, or 5) protease
inhibitors may also be added to the cell lysate prior to use.
PARP, PARG, and ARH Protein and Fusion Protein Purification
[0171] One or more PARP, PARG, and/or ARH3 proteins, and/or PARP,
PARG, and/or ARH3 fusion proteins may be fully or partially
purified (e.g., at least 60%, 70%, 80%, 85%, 90%, 95%, and 99% pure
from other proteins in the cell) from cell lysates, a biological
medium (e.g., cell culture medium from a transgenic cell), or a
biological fluid (e.g., blood, serum, or milk) from transgenic
mammal expressing one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 or more) nucleic acids
encoding a PARP, PARG, and/or ARH3 protein, and/or a PARP, PARG,
and/or ARH3 fusion protein of the invention. Alternatively, one or
more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16,
17, 18, 19, or 20 or more) PARP, PARG, and/or ARH3 proteins, and/or
PARP, PARG, and/or ARH3 fusion proteins may be fully or partially
purified from the extracellular medium of a transgenic cell
expressing one or more nucleic acids encoding a PARP, PARG, and/or
ARH3 protein, and/or a PARP, PARG, and/or ARH3 fusion protein of
the invention. In each example, a cell lysate, biological fluid
(e.g., milk or serum), or extracellular medium containing one or
more PARP, PARG, and/or ARH3 proteins, and/or PARP, PARG, and/or
ARH3 fusion proteins is collected.
[0172] Methods for the purification of a recombinant protein from a
cell lysate, biological fluid, or extracellular medium are known in
the art. For example, in instances where the PARP, PARG, and/or
ARH3 fusion protein contains an epitope, an antibody specific for
the epitope (e.g., anti-GFP antibodies, anti-FLAG antibodies,
anti-GST antibodies, anti-hemagglutinin antibodies, anti-c-myc
antibodies, and anti-V5 antibodies) may be used to purify one or
more PARP, PARG, and/or ARH3 fusion protein(s). In another example,
a PARP, PARG, and/or ARH3 fusion protein may contain a polypeptide
tag containing a sequence that aids in affinity purification of the
protein (e.g., a His.sub.6 tag, a calmodulin-binding protein tag, a
glutathione S-transferase protein tag, a strep II tag, a HPC tag, a
maltose-binding protein tag). In each example, a solid surface,
resin, or bead (e.g., magnetic bead) may be covalently attached to
a protein or molecule specifically bound by the protein sequence
located in the polypeptide tag. In such instances, contacting the
one or more PARP, PARG, and/or ARH3 fusion protein(s) with the
solid surface, resin, or bead will cause the selective binding of
the one or more PARP, PARG, and/or ARH3 fusion protein(s) with the
solid surface, resin, or bead. The remaining non-bound proteins
will not bind and may be washed away using an appropriate buffer.
Specific methods for the affinity purification of proteins are
known in the art.
[0173] One or more PARP, PARG, and/or ARH3 fusion proteins may also
be purified from a cell lysate, biological sample, or a
extracellular medium by a purification protocol including, but
limited to: salt precipitation (e.g., ammonium sulfate
precipitation), pH precipitation, precipitation using organic
solvents, high performance liquid chromatography (HPLC), column
chromatography, ion exchange chromatography (e.g., cation exchange
chromatography and anion exchange chromatography), immobilized
metal affinity chromatography, gel filtration, or size exclusion
chromatography or dialysis. One or more (e.g., 1, 2, 3, 4, 5, 6, or
7) of these steps may also be used in combination with an affinity
purification step as described above.
[0174] The one or more purified PARP, PARG, and/or ARH3 proteins,
and/or PARP, PARG, and/or ARH3 fusion proteins may be dialyzed to
exchange the buffer or concentrated prior to use in one or more of
the assays described herein (e.g., PARP, PARG, and/or ARH3 activity
assays or assays for the identification of a specific PARP
activator or inhibitor). The one or more purified PARP, PARG,
and/or ARH3 proteins, and/or PARP, PARG, and/or ARH3 fusion
proteins may be stored at -70.degree. C. in the presence or absence
of one or more (e.g., 1, 2, 3, 4, or 5) stabilizing proteins
including, but not limited to, albumin.
PARP Protein and PARP Fusion Protein Assays
[0175] The biological activity of the one or more PARP proteins and
PARP fusion proteins of the invention include, but are not limited
to, one or more (e.g., 1, 2, 3, 4, or 5) of the ability to
covalently attach an ADP-ribose molecule to one or more (e.g., 1,
2, 3, 4, or 5) substrate(s) (e.g., a protein, a RNA molecule, a DNA
molecule, or a lipid), the ability to covalently attach an
ADP-ribose molecule to a ADP-ribose residue covalently attached to
a substrate, the ability to add a branched ADP-ribose molecule to a
pre-existing poly-ADP-ribose, the ability to localize to the cell
nucleus, the ability to localize to stress granules, the ability to
catalyze the formation or nucleation of stress granules, the
ability to catalyze the disassembly of stress granules, the ability
to promote cell division and mitosis, or the ability to inhibit
RNAi activity in the cell. Specific PARP proteins have a different
subset of biological activities: PARP1, PARP2, PARP5A, PARP5B,
PARP7, PARP8, PARP14, and PARP16 have the ability to localize to
the nucleus and/or the ability to promote cell division and
mitosis; PARP5A, PARP12, PARP13.1, PARP13.2, and PARP15 have the
ability to localize to stress granules and the ability to promote
or nucleate stress granule formation; PARP11 has the ability to
localize to stress granules and the ability to promote disassembly
of stress granules or prevent the formation of stress granules; and
PARP13.1 has the ability to decrease the activity of RNAi and the
ability to add one or more ADP-ribose molecules to Argonaut.
[0176] Assays to measure the ability of one or more PARP proteins
and PARP fusion protein(s) to covalently attach an ADP-ribose to
one or more (e.g., 1, 2, 3, 4, or 5) substrate(s) (e.g., a protein,
a RNA, a DNA, or a lipid) involve the incubation of one or more
PARP fusion protein(s) with the one or more substrate(s) in the
presence of a labeled NAD.sup.+ molecule (e.g., radiolabeled,
fluorescently-labeled, and colorimetrically-labeled NAD.sup.+). A
radiolabeled NAD.sup.+ substrate may contain one or more
radioisotopes including, but not limited to, .sup.14C (e.g.,
.sup.14C-adenine), .sup.32P, and .sup.3H. Additional NAD.sup.+
substrates include fluorescently-labeled NAD.sup.+ (Putt et al.,
Anal. Biochem. 78:326, 2004), colorimetrically-labeled NAD.sup.+
(Nottbohn et al., Agnew. Chem. Int. Ed. 46:2066-2069, 2007), and
biotinylated NAD.sup.+ (6-biotin-17-NAD; R & D Systems).
Following incubation of the one or more (e.g., 1, 2, 3, 4, 5, 6, 7,
8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 or more) PARP
proteins and/or the one or more PARP fusion proteins with the
labeled NAD.sup.+ and one or more (e.g., 1, 2, 3, 4, or 5)
substrate molecules, the specific labeling of the substrate(s) with
one or more labeled ADP-ribose molecules is determined by measuring
the amount of the label associated with the NAD.sup.+ that is
covalently bound to the one or more substrate molecules. An
increase (e.g., at least 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%,
70%, 80%, 90%, or 100%) in the amount of the label associated with
the NAD.sup.+ that is covalently bound to the one or more
substrate(s) indicates PARP protein or PARP fusion protein
activity.
[0177] In another example of a PARP assay, the auto-modification of
one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,
15, 16, 17, 18, 19, or 20 or more) PARP proteins or PARP fusion
protein(s) is measured by incubating the one or more PARP proteins
and/or PARP fusion proteins of the invention with a labeled
NAD.sup.+ substrate and subsequently, measuring the amount of the
label associated with the NAD.sup.+ covalently bound to the one or
more PARP fusion proteins. An increase in the amount of the label
associated with the NAD.sup.+ covalently bound to the one or more
PARP fusion proteins indicates PARP fusion protein
auto-modification.
[0178] In an alternative assay, one or more (e.g., 1, 2, 3, 4, 5,
6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 or more)
PARP proteins and/or PARP fusion proteins may be incubated with one
or more (e.g., 1, 2, 3, 4, or 5) substrates and a non-labeled
NAD.sup.+. The poly-ADP-ribosylation of the one or more substrates
may be measured by contacting the one or more substrates with a
poly-ADP-ribose antibody. For example, a sample of substrate
proteins may be electrophoresed and immunoblotted with an
anti-poly-ADP-ribose antibody. An increased number of proteins or
an increased level of detection using an anti-poly-ADP ribose
antibody indicates an increase in the activity of the one or more
PARP fusion proteins.
[0179] Assays to measure the ability of a PARP protein and/or PARP
fusion protein to localize to a specific cellular structure or
organelle using immunofluorescence microscopy are known in the art.
For example, antibodies specific for one or more PARP proteins
and/or fusion proteins, and antibodies specific for one or more
proteins or molecules specific to a cellular structure or organelle
(e.g., cytoskeleton, mitochondria, trans-Golgi network, endoplasmic
reticulum, early endosome, centrosome, GW bodies, nuclear envelope,
lysosome, peroxisomes, histones, Cajal bodies, nucleus, and
mitochondria) may be used to perform immunofluorescent microscopy.
Localization of one or more PARP proteins and/or PARP fusion
proteins may be measured in high-throughput experiments by
co-localization of one or more PARP proteins and/or fusion proteins
with one or more proteins specific for a cellular structure or
organelle (e.g., proteins listed in FIG. 10). Localization of one
or more PARP proteins and/or PARP fusion proteins in the nucleus
may also be demonstrated by co-localization of a dye that stains
DNA and an antibody that specifically binds the one or more PARP
proteins and/or PARP fusion proteins (e.g., co-localization of an
antibody specific for one or more PARP proteins and/or PARP fusion
proteins, and 4',6-diamindino-2-phenylindole (DAPI)).
[0180] Localization of one or more PARP proteins and/or PARP fusion
proteins to a specific cell structure or organelle may occur only
during one or more (e.g., 1, 2, 3, 4, 5, or 6) specific stages of
the cell cycle, including, but not limited to, G2-M, prophase,
prometaphase (P-M), metaphase, anaphase, cytokinesis, G.sub.o, and
G.sub.1 stages. For the purposes described herein, a PARP protein
and/or PARP fusion protein is deemed to have the ability to
localize to a specific cellular structure or organelle if it
localizes to the specific cellular structure or organelle in at
least one stage (e.g., mitosis or cytokinesis) of the cell
cycle.
[0181] The ability of a PARP protein and/or fusion protein to
promote stress granule assembly or to inhibit stress granule
assembly may be measured using fluorescence microscopy. In such a
method, cells are treated with one or more PARP inhibitors, one or
more PARP activators, or a nucleic acid encoding one or more PARP
proteins and/or PARP fusion proteins, and are subsequently fixed
and immunostained with antibodies specific for one or more stress
granule protein (e.g., one or more of eIF3, eIF1A, eIF2.alpha.,
eIF3.theta., eIF4A1, eIF4e, and G3BP). An increase in the number of
foci containing one or more stress granule proteins (e.g., intense
immunostaining in distinct cellular structures) indicates an
increase in the formation of stress granules. A decrease in the
number of foci containing one or more stress granule proteins,
likewise, indicates a decrease in the formation of stress granules.
In such assays, stress granule formation may be induced by exposure
to stress conditions, for example, by treatment with sodium
arsenite and pateamine A.
[0182] The ability of one of more PARP proteins and/or PARP fusion
proteins to promote cell division and mitosis may be measured using
any method known in the art. For example, cell proliferation assays
including, but not limited to, standard cell counting assays, BrdU
labeling, and quantitative assays for DNA synthesis such as
.sup.3H-thymidine incorporation may be used to measure the ability
of one or more PARP proteins and/or PARP fusion proteins to promote
cell division and mitosis. Likewise, inhibition of one or more PARP
proteins and/or PARP fusion proteins with the ability to promote
cell division and mitosis may result in cell death. Several assays
to measure cell death are known in the art, including, but not
limited to Hoechst 33342 staining of chromatin, propidium iodide
staining, annexin V staining of phosphoserine, and
3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT)
staining.
[0183] Assays for measuring RNAi activity in a cell are available
in the art. For example, psiCHECK.TM.-1, psiCHECK.TM.-2, and
pGL4.72[hRlucCP].TM. vector assay systems provide methods for the
measurement of RNAi activity in a cell. In these assays systems,
luciferase is used a primary reporter gene and a target sequence
(i.e., the target of one or more RNAi molecules) is cloned a
multiple cloning region located downstream of the luciferase
translational stop codon. Initiation of the RNAi process towards
the target gene results in the cleavage and subsequent degradation
of the fusion mRNA encoded by the vectors (i.e., upon treatment of
the transfected cell with a vector-target RNAi molecule).
Measurement of decreased luciferase activity in the transfected
cells following treatment with the vector-target RNAi indicates the
activity of RNAi in the cell. For example, in experiments using the
psiCHECK assay system, a cell transfected with the psiCHECK vector
is treated with the vector-target RNAi and with an activator or
inhibitor of one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10)
PARP proteins and/or PARP fusion proteins (e.g., 1, 2, 3, 4, or 5
RNAi molecules targeting a specific PARP). Transfected cells
treated with the vector-target RNAi and with a PARP inhibitor or
activator that demonstrate increased luciferase activity relative
to a transfected cell treated with the vector-target RNAi alone
indicate that the specific targeted PARP activates or inhibits RNAi
activity in the cell, respectively. Cells treated with a PARP
inhibitor or activator that demonstrate decreased luciferase
activity relative to a cell treated with vector-target RNAi alone
indicate that the specific targeted PARP inhibits or activates RNAi
activity in the cell, respectively.
[0184] Any of the above-referenced PARP protein and/or PARP fusion
protein activity assays may be performed to determine the activity
of PARP protein or PARP fusion protein sequence encoded by a
nucleic acid having at least 80% sequence identity to one of SEQ ID
NOS: 1-24. The domain structure of several PARP proteins are shown
in FIG. 3. Preferred mutations in the wild-type sequences of PARP
proteins (e.g., SEQ ID NOS: 1-24) do not introduce amino acid
changes in the catalytic domain in FIG. 3. In addition, the
biological activity of a PARP protein and/or PARP fusion protein
containing a sequence having at least 80% sequence identity to one
of SEQ ID NOS: 1-24 may be assessed using any of the
above-described cellular or in vitro assays.
PARG and ARH3 Protein and Fusion Protein Assays
[0185] The activity of one or more PARG protein, ARH3 protein, PARG
fusion protein, and/or ARH3 fusion protein may be determined using
assays known in the art. PARG and ARH3 proteins herein have been
demonstrated to decrease or prevent the formation of stress
granules. Assays for the measurement of stress granule formation
and disassembly are described herein.
[0186] Additional assays for PARG and ARH3 proteins (and fusion
proteins) include the hydrolysis of poly-ADP-ribose. Labeled
poly-ADP-ribose (e.g., .sup.32P, .sup.14C, or biotinylated ADP) may
be used as a substrate for the measurement of the hydrolysis and
release of ADP-ribose from a labeled and/or attached
poly-ADP-ribose polymer.
[0187] Additional assays for PARG and ARH3 proteins involve the use
of antibodies specific for poly-ADP-ribose. For example, cells may
be transfected with a nucleic acid that overexpresses a PARG
protein, ARH3 protein, PARG fusion protein, and/or ARH3 fusion
protein and cells untreated or treated with a stress condition
(e.g., sodium arsenite). Cells that contain an active form of a
PARG protein, ARH3 protein, PARG fusion protein, and/or ARH3 fusion
protein show decreased staining for poly-ADP-ribose than cells
transfected with a control form or inactive form of these proteins
(e.g., a form lacking its catalytic domain or a form containing an
inactivating mutation).
[0188] These activity assays will also aid in the identification of
which amino acids may be mutated to generate nucleic acids having
at least 80% (e.g., at least 85%, 90%, 95%, 99%, or 100% identity)
to PARG (SEQ ID NO: 42) or ARH3 (SEQ ID NO: 41). Preferred sites of
mutation lie outside the catalytic domains of PARG and/or ARH3.
PARP-Specific Antibodies
[0189] Antibodies specific to the one or more (e.g., 1, 2, 3, 4, 5,
6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 or more)
PARP proteins and/or PARP fusion proteins of the invention can be
generated using standard methods, such as those described herein.
Antibodies specific for one or more PARP fusion proteins, PARP
proteins, or fragments of PARP proteins and/or PARP fusion proteins
may be used in quantitative assays to measure to amount of one or
more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16,
17, 18, 19, or or more) PARP proteins and/or PARP fusion proteins
present in a cell, cell lysate, biological sample, or extracellular
medium. Antibodies specific to the one or more (e.g., 1, 2, 3, 4,
5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 or
more) PARP proteins and/or PARP fusion proteins of the invention
may also be used to identify specific binding partners or potential
inhibitors or activators of the one or more PARP proteins and/or
PARP fusion proteins.
[0190] For the preparation of polyclonal antibodies reactive with
one or more PARP proteins and/or PARP fusion proteins, one or more
PARP protein(s), PARP fusion protein(s), fragments of PARP
protein(s), or fragments of PARP fusion protein(s) can be purified
from natural sources (e.g., cultures of cells expressing one or
more PARP proteins) or synthesized in, e.g., mammalian, insect, or
bacterial cells by expression of corresponding DNA sequences
contained in a suitable cloning vehicle (e.g., the nucleic acids
encoding PARP proteins and PARP fusion proteins described herein).
Fusion proteins are commonly used as a source of antigen for
producing antibodies. The antigenic proteins can be optionally
purified, and then coupled to a carrier protein, mixed with
Freund's adjuvant to enhance stimulation of the antigenic response
in an inoculated animal, and injected into rabbits, mice, or other
laboratory animals. Primary immunizations are carried out with
Freund's complete adjuvant and subsequent immunizations performed
with Freund's incomplete adjuvant. Following booster injections at
bi-weekly intervals, the inoculated animals are then bled and the
sera isolated. The sera is used directly or is purified prior to
use by various methods, including affinity chromatography employing
reagents such as Protein A-Sepharose, antigen-Sepharose, and
anti-horse-Ig-Sepharose. Antibody titers can be monitored by
Western blot and immunoprecipitation analyses using one or more
PARP proteins, PARP fusion proteins, and/or fragments of PARP
fusion proteins or PARP proteins. Immune sera can be affinity
purified using one or more PARP proteins, PARP fusion proteins,
and/or fragments of PARP fusion proteins or PARP proteins coupled
to beads. Antiserum specificity can be determined using a panel of
proteins, such as one or more PARP proteins, PARP fusion proteins,
and/or fragments of PARP fusion proteins or PARP proteins.
[0191] Alternatively, monoclonal antibodies are produced by
removing the spleen from the inoculated animal, homogenizing the
spleen tissue, and suspending the spleen cells suspended in
phosphate buffered saline (PBS). The spleen cells serve as a source
of lymphocytes, some of which produce antibody of the appropriate
specificity. These cells are then fused with permanently growing
myeloma partner cells, and the products of the fusion plated into a
number of tissue culture wells in the presence of selective agents,
such as hypoxanthine, aminopterine, and thymidine (Mocikat, J.
Immunol. Methods 225:185-189, 1999; Jonak et al., Hum. Antibodies
Hybridomas 3:177-185, 1992; Srikumaran et al., Science 220:522,
1983). The wells can then be screened by ELISA to identify those
containing cells making antibody capable of binding to one or more
PARP proteins, PARP fusion proteins, fragments of PARP proteins,
and/or fragments of PARP fusion proteins, or mutants thereof. These
cells can then be re-plated and, after a period of growth, the
wells containing these cells can be screened again to identify
antibody-producing cells. Several cloning procedures can be carried
out until over 90% of the wells contain single clones that are
positive for specific antibody production. From this procedure, a
stable cell line of clones that produce the antibody are
established. The monoclonal antibody can then be purified by
affinity chromatography using Protein A Sepharose and ion-exchange
chromatography, as well as variations and combinations of these
techniques. Once produced, monoclonal antibodies are also tested
for specific PARP protein and/or PARP fusion protein recognition by
ELISA, Western blot, and/or immunoprecipitation analysis (see,
e.g., Kohler et al., Nature 256:495, 1975; Kohler et al., Eur. J.
Immunol. 6:511, 1976; Kohler et al., Eur. J. Immunol. 6:292, 1976;
Hammerling et al., In Monoclonal Antibodies and T Cell Hybridomas,
Elsevier, New York, N.Y., 1981).
[0192] As an alternate or adjunct immunogen to a PARP protein
and/or PARP fusion protein, peptides corresponding to relatively
unique regions of a PARP protein or PARP fusion protein can be
generated and coupled to keyhole limpet hemocyanin (KLH) through an
introduced C-terminal lysine. Antiserum to each of these peptides
can be similarly affinity-purified on peptides conjugated to BSA,
and specificity tested by ELISA and Western blotting using peptide
conjugates, and by Western blotting and immunoprecipitation using a
PARP protein, PARP fusion protein, and/or fragment of a PARP
protein or PARP fusion protein.
[0193] Antibodies of the invention are desirably produced using
PARP protein and/or PARP fusion protein amino acid sequences that
do not reside within highly conserved regions, and that appear
likely to be antigenic, as evaluated by criteria such as those
provided by the Peptide Structure Program (Genetics Computer Group
Sequence Analysis Package, Program Manual for the GCG Package,
Version 7, 1991) using the algorithm of Jameson et al., CABIOS
4:181, 1988. These fragments can be generated by standard
techniques, e.g., by PCR, and cloned into any appropriate
expression vector. For example, GST fusion proteins can be
expressed in E. coli and purified using a glutathione-agarose
affinity matrix. To minimize the potential for obtaining antisera
that is non-specific or exhibits low-affinity binding to one or
more PARP proteins, PARP fusion proteins, and/or fragments of PARP
proteins or PARP fusion proteins, two or three PARP fusion proteins
may be generated for each fragment injected into a separate animal.
Antisera are raised by injections in series, preferably including
at least three booster injections.
[0194] In addition to intact monoclonal and polyclonal anti-PARP
protein or anti-PARP fusion protein antibodies, various genetically
engineered antibodies and antibody fragments (e.g., F(ab')2, Fab',
Fab, Fv, and sFv fragments) can be produced using standard methods.
Truncated versions of monoclonal antibodies, for example, can be
produced by recombinant methods in which plasmids are generated
that express the desired monoclonal antibody fragment(s) in a
suitable host. Ladner (U.S. Pat. Nos. 4,946,778 and 4,704,692)
describes methods for preparing single polypeptide chain
antibodies. Ward et al., Nature 341:544-546, 1989, describes the
preparation of heavy chain variable domain which have high
antigen-binding affinities. McCafferty et al. (Nature 348:552-554,
1990) show that complete antibody V domains can be displayed on the
surface of fd bacteriophage, that the phage bind specifically to
antigen, and that rare phage (one in a million) can be isolated
after affinity chromatography. Boss et al. (U.S. Pat. No.
4,816,397) describes various methods for producing immunoglobulins,
and immunologically functional fragments thereof, that include at
least the variable domains of the heavy and light chains in a
single host cell. Cabilly et al. (U.S. Pat. No. 4,816,567)
describes methods for preparing chimeric antibodies. In addition,
the antibodies can be coupled to compounds, such as toxins or
radiolabels.
Methods for Identification of Specific PARP Inhibitors or
Activators
[0195] The PARP proteins and/or PARP fusion proteins of the
invention may be used to identify one or more (e.g., 1, 2, 3, 4, 5,
6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 or more)
specific PARP activators or inhibitors. In the provided assays, one
or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15,
16, 17, 18, 19, or 20 or more) PARP proteins and/or PARP fusion
proteins are contacted with an agent (e.g., a test agent), a
labeled NAD.sup.+ (e.g., a colorimetrically-labeled,
fluorescently-labeled, biotinylated-, or radioisotope-labeled
NAD.sup.+), and one or more substrates, and measuring the amount of
labeled ADP-ribose covalently attached to the one or more
substrates. In one example, one or more PARP protein and/or PARP
fusion proteins of the invention are incubated with a labeled
NAD.sup.+ substrate and the amount of label associated with the
NAD.sup.+ that is covalently attached to the one or more PARP
proteins and/or PARP fusion proteins is measured (e.g.,
auto-modulation activity assay). In this example, an agent that is
a specific PARP inhibitor mediates a decrease (e.g., at least a 5%,
10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%,
80%, 90%, 95%, or even 100% decrease) in the amount of labeled
ADP-ribose covalently attached to one or more (e.g., 1, 2, 3, 4, 5,
6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) PARP
proteins and/or fusion proteins, wherein the label on the
PARP-fusion proteins is the same as the label of the NAD.sup.+. In
a method for identifying an agent that is a specific PARP
activator, the agent mediates an increase (e.g., at least a 5%,
10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%,
80%, 90%, 95%, or even 100% increase) in the amount of labeled
ADP-ribose covalently attached to one or more (e.g., 1, 2, 3, 4, 5,
6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) PARP
proteins and/or PARP fusion proteins.
[0196] The one or more PARP proteins and/or PARP fusion proteins
utilized in each assay may be purified, partially purified (e.g.,
at least 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, or 95% pure) or
may be present in a cell lysate (e.g., a bacterial cell lysate, a
yeast cell lysate, or a mammalian cell lysate), in a biological
fluid from a transgenic animal (e.g., milk or serum), or an
extracellular medium. The one or more PARP proteins and/or PARP
fusion proteins utilized in the assay may be bound to substrate,
such as, but not limited to, a solid surface (e.g., a multi-well
plate), a resin, or a bead (e.g., a magnetic bead).
[0197] In additional examples of the assays, the one or more PARP
proteins and/or PARP fusion proteins may be bound to a solid
surface, resin, or bead (e.g., a magnetic bead) and subsequently
treated with one or more protease(s) (e.g., a TEV protease) prior
to contacting the one or more PARP proteins and/or PARP fusion
proteins with the labeled NAD.sup.+.
[0198] In preferred assays, an activator or inhibitor increases or
decreases the amount of labeled ADP-ribose covalently attached to a
specific PARP protein, PARP fusion protein, and/or subset of PARP
proteins or fusion proteins while having no or little (e.g., less
than 50%, 40%, 30%, 25%, 20%, 15%, 10%, or 5% change (e.g.,
increase or decrease)) affect on the amount of labeled ADP-ribose
covalently attached to other PARP proteins and/or PARP fusion
proteins, is identified as a PARP activator or inhibitor,
respectively. For example, the assay desirably identifies an agent
that specifically inhibits the amount of labeled ADP-ribose
covalently attached to one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8,
9, or 10) PARP5A proteins or fusion proteins, PARP12 proteins
and/or fusion proteins, PARP13.1 proteins and/or fusion proteins,
PARP13.2 proteins and/or fusion proteins, and PARP15 proteins
and/or fusion proteins. Another assay desirably identifies an agent
that specifically increases the amount of labeled ADP-ribose
covalently attached to one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8,
9, or 10) PARP5A proteins and/or fusion proteins, PARP12 proteins
and/or fusion proteins, PARP13.1 proteins and/or fusion proteins,
PARP 13.2 proteins and/or fusion proteins, and PARP15 proteins
and/or fusion proteins. Another example of the assay desirable
identifies an activator or inhibitor that specifically increases or
decreases, respectfully, the amount of labeled ADP-ribose
covalently bound to one or more (e.g., 1, 2, 3, 4, 5, or 6) PARP11
proteins and/or fusion proteins. Another example of the assay
desirably identifies an agent that specifically decreases the
amount of labeled ADP-ribose covalently attached to one or more
(e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) PARP1 proteins and/or
fusion proteins, PARP2 proteins and/or fusion proteins, PARP5A
proteins and/or fusion proteins, PARP5B proteins and/or fusion
proteins, PARP7 proteins and/or fusion proteins, PARP8 proteins
and/or fusion proteins, PARP14 proteins and/or fusion proteins, and
PARP16 proteins and/or fusion proteins. Another example of the
assay desirably identifies an agent that specifically increases the
amount of labeled ADP-ribose covalently attached to one or more
(e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) PARP1 proteins and/or
fusion proteins, PARP2 proteins and/or fusion proteins, PARP5A
proteins and/or fusion proteins, PARP5B proteins and/or fusion
proteins, PARP7 proteins and/or fusion proteins, PARP8 proteins
and/or fusion proteins, PARP14 proteins and/or fusion proteins, and
PARP16 proteins and/or fusion proteins. In another desirable
embodiment of the assay, the assay identifies an agent that
specifically increases or decreases the amount of labeled
ADP-ribose covalently attached to one or more (e.g., 1, 2, 3, 4, 5,
or 6) different PARP13.1 proteins and/or fusion proteins.
[0199] A variety of different agents may be tested in the
above-described assays provided by the invention. For example, a
tested agent may be a derived from or present in a crude lysate
(e.g., a lysate from a mammalian cell or plant extract) or be
derived from a commercially available chemical libraries. Large
libraries of natural product or synthetic (or semi-synthetic)
extracts or chemical libraries are commercially available and known
in the art. The screening methods of the present invention are
appropriate and useful for testing agents from a variety of sources
for activity as a specific PARP activator or inhibitor. The initial
screens may be performed using a diverse library of agents, but the
method is suitable for a variety of other compounds and compound
libraries. Such compound libraries can also be combinatorial
libraries. In addition, compounds from commercial sources can be
tested, as well as commercially available analogs of identified
inhibitors.
[0200] An agent may be a protein, a peptide, a DNA or RNA aptamer
(e.g., a RNAi molecule), a lipid, or a small molecule (e.g., a
lipid, carbohydrate, a bioinorganic molecule, or an organic
molecule).
[0201] Agents that may be tested as a specific PARP activator
include nucleic acids that contain a sequence encoding one or more
(e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) domains of a PARP protein
(e.g., a domain encoded by part of the nucleic acid sequence having
at least 80% sequence identity to any one of SEQ ID NOS: 1-24).
Methods for Identification of an Agent that Specifically Binds One
or More PARPs
[0202] The invention also provides methods for identifying an agent
that specifically binds to one or more (e.g., 1, 2, 3, 4, 5, 6, 7,
8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 or more) PARP
proteins and/or PARP fusion proteins. These methods require the
contacting of one or more of the PARP proteins and/or PARP fusion
proteins of the invention with a test agent and determining whether
the test agent specifically binds to the one or more PARP proteins
and/or PARP fusion proteins. An agent that specifically binds one
or more of the described PARP proteins and/or PARP fusion proteins
may act as an activator or inhibitor of the expression or activity
of the one or more PARP proteins and/or PARP fusion proteins in a
cell. For example, an agent that specifically binds to one or more
PARP proteins and/or PARP fusion proteins may selectively increase
the activity or expression of one or more PARP proteins and/or
fusion proteins, while at the same time decreasing the activity or
expression of one or more other PARP proteins and/or PARP fusion
proteins in the same cell or sample.
[0203] The one or more PARP proteins and/or PARP fusion proteins
used in this method may be attached to a solid surface or substrate
(e.g., a bead) and/or may be present in purified form or present in
a crude cell lysate, biological fluid, or extracellular medium. The
methods may optionally include one or more (e.g., 1, 2, 3, 4, or 5)
washing steps following contacting the one or more PARP proteins
and/or PARP fusion proteins with the test agent. The test agent may
be a small molecule, a lipid, an RNA molecule, a DNA molecule, a
protein, or a peptide fragment. The test agent may be purified in
form (e.g., at least 70%, 80%, 85%, 90%, 95%, or 99% pure by
weight) or may be present in a crude cell lysate. The test agent
may also, optionally be labeled (e.g., a colorimetric label, a
radionuclide label, labeled with a biotin molecule, or labeled with
a fluorophore).
[0204] The binding of the test agent to one of more PARP proteins
and/or PARP fusion proteins may detected by any known method
including, BIAcore, competitive binding assays (e.g., a competitive
binding assay using one or more of the antibodies provided by the
invention), and detection of the agent following its release from
the one or more PARP proteins and/or PARP fusion proteins (e.g.,
elution of the bound test agent following exposure to high salt or
a high or low pH buffer). The one or more PARP proteins and/or PARP
fusion proteins may be any of the example PARP proteins and PARP
fusion proteins described herein.
[0205] In one example of this method, a bead attached to one or
more PARP proteins and/or PARP fusion proteins of the invention
(e.g., a ZZ-TEV-PARP fusion protein) may be incubated with a crude
cell lysate, and the proteins or peptide fragments bound to the one
or more PARP proteins and/or PARP fusion proteins may be eluted
from the beads by exposure to a high salt buffer, a high detergent
buffer, or a high or low pH buffer. The resulting eluted proteins
may be electrophoresed onto an SDS-polyacrylamide gel and the
specific protein bands cut out from the gel and analyzed using mass
spectrometry to identify the specific agent that binds to the one
or more PARP proteins and/or PARP fusion proteins.
[0206] In another example of the method, a bead attached to one or
more PARP proteins and/or PARP fusion proteins of the invention is
incubated with a purified protein or peptide fragment. In this
instance, a protein or peptide fragment bound to the one or more
PARP proteins and/or PARP fusion proteins may be eluted using a
high salt buffer, a high detergent buffer, or a high or low pH
buffer. The amount of protein in the eluate may be detected by any
method known in the art including UV/vis spectroscopy, mass
spectrometry, or any colorimetric protein dye (e.g., a Bradford
assay).
[0207] In specific screening assays for agents that bind one or
more PARP proteins and/or PARP fusion proteins, one or more PARP
proteins and/or PARP fusion proteins may be placed in individual
wells of a multi-well plate (e.g., one or more PARP proteins and/or
PARP fusion proteins covalently linked to the plate surface) and
incubated with the test agent. Following a washing step, the amount
of test agent remaining in each well may be determined and the
ability of the test agent to bind one or more PARP proteins and/or
PARP fusion proteins determined.
[0208] The methods desirably identify a test agent that
specifically binds one or more of a PARP1 protein and/or fusion
protein, a PARP2 protein and/or fusion protein, a PARP5A protein
and/or fusion protein, a PARP5B protein and/or fusion protein, a
PARP7 protein and/or fusion protein, a PARP8 protein and/or fusion
protein, a PARP14 protein and/or fusion protein, and a PARP16
protein and/or fusion protein of the invention. The methods also
desirably identify a test agent that specifically binds to one or
more of a PARP5A protein and/or fusion protein, a PARP12 protein
and/or fusion protein, a PARP13.1 protein and/or fusion protein, a
PARP13.2 protein and/or fusion protein, and a PARP15 protein and/or
fusion protein of the invention. The methods also desirably
identify a test agent that specifically binds to a PARP13.1 protein
and/or fusion protein or a PARP11 protein and/or fusion protein of
the invention.
Methods for Quantification of the Level of One or More PARPs in a
Sample
[0209] The present invention further provides methods for
quantitating the level of one or more PARP proteins or PARP fusion
proteins present in a sample (e.g., a cell, a cell lysate, a
biological fluid, or an extracellular medium). In these methods, a
cell, cell lysate, biological fluid, or extracellular medium is
contacted with one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10)
antibodies of the invention (e.g., antibodies that specifically
bind to one or more PARP proteins or PARP fusion proteins described
herein) and the level of one or more PARP proteins and/or PARP
fusion proteins is determined by measuring the amount of the one or
more PARP proteins and/or PARP fusion proteins bound to the one or
more antibodies.
[0210] In these methods, the one or more antibodies may be
polyclonal antibodies. The antibodies used in these methods may
also be covalently bound to a bead (e.g., a magnetic bead or a bead
in a column) or may be covalently bound to the surface of a
multi-well plate (e.g., for use in an enzyme-linked immunosorbent
assay (ELISA)). The quantitation of the binding of the one or more
antibodies to the one or more PARP proteins and/or PARP fusion
proteins may be determined by any method known in the art,
including, but not limited to, BIAcore, immunofluorescence
microscopy, immunofluorescence-assisted cell sorting, ELISA,
immunoblotting, and competitive binding assays (e.g., assays using
purified labeled PARP proteins and/or PARP fusion proteins).
[0211] In these assays, the level of one or more PARP proteins
and/or PARP fusion proteins may be compared to a standard curve
control generated using one or more purified PARP proteins and/or
PARP fusion proteins as described herein. The level of one or more
PARP proteins present in a cell, cell lysate, or biological sample
may be used as an indicator of the status or severity of one or
more stress granule-related condition (e.g., a neurodegenerative
disease, a cardiovascular disease, an inflammatory disease, and
ischemia-reperfusion injury). For example, an increase in the level
of one or more of PARP5A, PARP12, PARP13.1, PARP13.2, and PARP15
indicates an increased severity or an increase in the likelihood of
developing a stress granule-related disorder.
Agent Screening Assays
[0212] The invention further provides methods for identifying a
candidate agent for treating or decreasing a stress granule-related
disorder requiring the steps of: providing one or more (e.g., 1, 2,
3, 4, 5, 6, 7, 8, 9, or 10) PARP, PARG, and/or ARH3 proteins,
and/or PARP, PARG, and/or ARH3 fusion proteins encoded by a nucleic
acid containing a nucleic acid sequence having at least 80%
sequence identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%,
99%, or even 100%) to PARP5A (SEQ ID NO: 8 or 9), PARP12 (SEQ ID
NO: 18), PAPR13.1 (SEQ ID NO: 19), PARP13.2 (SEQ ID NO: 20), PARP15
(SEQ ID NO: 22 or 23), PARG (SEQ ID NO: 42), or ARH3 (SEQ ID NO:
41); contacting the one or more PARP, PARG, and/or ARH3 proteins,
and/or PARP, PARG, and/or ARH3 fusion proteins with the agent and a
labeled NAD.sup.+ substrate; and measuring the activity of the one
or more PARP, PARG, and/or ARH3 proteins and/or PARP, PARG, and/or
ARH3 fusion proteins or the specific binding of the agent to the
one or more PARP fusion proteins; wherein an agent that decreases
(e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or
even 100%) the activity of the one or more PARP proteins and/or one
or more PARP fusion proteins, and/or specifically binds to the one
or more PARP proteins or fusion proteins, and/or increases the
activity of the one or more PARG and/or ARH3 proteins or fusion
proteins is identified as an agent for treating or decreasing the
likelihood of developing a stress granule-related disorder.
[0213] The invention further provides methods for identifying a
candidate agent for treating or decreasing the likelihood of
developing cancer requiring the steps of: providing one or more
(e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) PARP proteins and/or PARP
fusion proteins encoded by a nucleic acid containing a nucleic acid
sequence having at least 80% sequence identity (e.g., at least 85%,
90%, 95%, 96%, 97%, 98%, 99%, or even 100%) to a PARP selected from
PARP1 (SEQ ID NO: 1 or 2), PARP2 (SEQ ID NO: 3), PARP5A (SEQ ID NO:
8 or 9), PARP5B (SEQ ID NO: 10), PARP7 (SEQ ID NO: 12), PARP8 (SEQ
ID NO: 13), PARP14 (SEQ ID NO: 21), or PARP16 (SEQ ID NO: 24);
contacting the one or more PARP proteins and/or PARP fusion
proteins with the agent and a labeled NAD.sup.+ substrate; and
measuring the activity of one or more (e.g., 1, 2, 3, 4, 5, 6, 7,
8, 9, or 10) PARP proteins and/or PARP fusion proteins; wherein an
agent that decreases (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%,
70%, 80%, 90%, or even 100%) the activity and/or specifically binds
to the one or more PARP proteins and/or PARP fusion proteins is
identified as a candidate agent for treating or decreasing the
likelihood of developing cancer.
[0214] In all the above screening methods, the one or more PARP,
PARG, and/or ARH3 proteins, and/or PARP, PARG, and/or ARH3 fusion
proteins may be generated using any methods known in the art or the
methods described herein. The PARP, PARG, and/or ARH3 proteins,
and/or PARP, PARG, and/or ARH3 fusion proteins may be purified or
present in a crude cell lysate. The PARP, PARG, and/or ARH3
proteins, and/or PARP, PARG, and/or ARH3 fusion proteins may be
attached to a substrate (e.g., a magnetic bead) or a solid surface
(multi-well plate).
[0215] The methods of the assay include the measurement of the
activity of the one or more PARP, PARG, and/or ARH3 proteins,
and/or PARP, PARG, and/or ARH3 fusion proteins using any assay
known in the art or those assays described herein. The assays may
include the incubation of the one or more PARP, PARG, and/or ARH3
proteins, and/or PARP, PARG, and/or ARH3 fusion proteins with a
labeled NAD.sup.+ substrate and/or the incubation with other
substrates that are not labeled (e.g., non-labeled NAD.sup.+). Each
PARP, PARG, and/or ARH3 protein, and/or PARP, PARG, and ARH3 fusion
protein may have one or more activities (described herein). Any
known activity of a PARP, PARG, and/or ARH3 protein, and/or PARP,
PARG, and/or ARH3 fusion protein (or activity described herein) may
be measured in the above screening assays (e.g., catalytic addition
of an ADP-ribose molecule or polymerization of a poly-ADP-ribose
molecule, catalytic degradation of poly-ADP ribose or removal of a
ADP-ribose moiety from a substrate, localization to a particular
cell structure (e.g., nucleus or stress granule), formation of a
stress granule, disassembly of a stress granule, nucleation of a
stress granule, promotion of cell proliferation or cell division,
or required for cell cycle progression (e.g., progression through
cytokinesis or mitosis)).
[0216] The ability of an agent to bind to one or more PARP or PARP
fusion proteins may be measured using any method known in the art,
as well as those methods described herein. For example, the ability
of an agent to specifically bind to a PARP protein or PARP fusion
protein may be measured by chromatography (e.g., using beads
wherein a PARP protein, a PARP fusion protein, or a domain of a
PARP protein or PARP fusion protein is covalently attached),
BIAcore analysis, UV/vis spectroscopy, or calorimetry.
[0217] A variety of different agents may be tested in the
above-described screening assays provided by the invention. For
example, a candidate agent may be a derived from or present in a
crude lysate (e.g., a lysate from a mammalian cell or plant
extract) or be derived from a commercially available chemical
libraries. Large libraries of natural product or synthetic (or
semi-synthetic) extracts or chemical libraries are commercially
available and known in the art. The screening methods of the
present invention are appropriate and useful for testing agents
from a variety of sources for activity as a candidate agent. The
initial screens may be performed using a diverse library of agents,
but the method is suitable for a variety of other compounds and
compound libraries. Such compound libraries can also be
combinatorial libraries. In addition, compounds from commercial
sources can be tested, as well as commercially available analogs of
identified inhibitors.
[0218] An agent may be a protein, a peptide fragment, a DNA or RNA
aptamer (e.g., a RNAi molecule), a lipid, or a small molecule
(e.g., a lipid, carbohydrate, a bioinorganic molecule, or an
organic molecule).
[0219] Candidate agents that may be tested include nucleic acids
that contain a sequence encoding one or more (e.g., 1, 2, 3, 4, 5,
6, 7, 8, 9, or 10) domains of a PARP protein (e.g., a domain
encoded by part of the nucleic acid sequence having at least 80%
sequence identity to any one of SEQ ID NOS: 1-24), nucleic acids
that contain a sequence encoding one or more (e.g., 1, 2, 3, 4, 5,
6, 7, 8, 9, or 10) domains of a PARG protein or ARH3 (e.g., a
domain encoded by part of the nucleic acid sequence having at least
80% sequence identity to SEQ ID NO: 41 and 42), or any polypeptide
encoded by these nucleic acids.
[0220] In any of the above screening assays, the NAD.sup.+ may be
labeled with a radioisotope (e.g., .sup.32P) or fluorophore (e.g.,
fluorescein), or be biotinylated.
Methods for Increasing Cell Proliferation in a Cell
[0221] The invention further provides methods of increasing the
proliferation of a cell or population of cells requiring contacting
the cell or population of cells with an effective amount of one or
more PARP activators. In these methods, the one or more (e.g., 1,
2, 3, 4, or 5) PARP activators preferably increase the expression
(e.g., mRNA and/or protein) and/or one or more activities of a
PARP1, PARP2, PARP5A, PARP5B, PARP7, PARP8, PARP14, and PARP16. In
these methods, the expression may be an increase (e.g., at least
10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%) in the level
of one or more nucleic acid sequence(s) containing a sequence
having at least 80% sequence identity (e.g., at least 85%, 90%,
95%, 96%, 97%, 98%, 99% or even 100%) to PARP1 (SEQ ID NOS: 1 or
2), PARP2 (SEQ ID NO: 3), PARP5A (SEQ ID NOS: 8 or 9), PARP5B (SEQ
ID NO: 10), PARP14 (SEQ ID NO: 21), or PARP16 (SEQ ID NO: 24), or
one or more polypeptides encoded by one of these nucleic acids. The
activity of one or more PARPs may be any activity described herein,
including, but not limited to, poly-ADP-ribosylation of a target
protein (e.g., a protein localized to the nucleus or mitotic
spindle during cytokinesis, or a PARP protein) or is required for
progression through mitosis or cytokinesis.
[0222] A PARP activator encompassed by these methods may include
one or more nucleic acid sequences containing a sequence having at
least 80% sequence identity (e.g., 85%, 90%, 95%, 99%, or even
100%) to one of SEQ ID NOS: 1-3, 8-10, 21, or 24.
[0223] The rate of proliferation may be increased in a mammalian
cell or a plant cell using these methods. For example, the rate of
proliferation of a primary cell (e.g., a cell used for cell
replacement therapies) may be increased using these methods. In
another example, the rate of proliferation of a plant cell may be
increased using these methods. These methods include the
introduction of xenogenous nucleic acids encoding a PARP activator
to create a transgenic mammalian or plant cell or transgenic mammal
or plant.
Methods for Increasing Stress Granule Formation in a Cell
[0224] The invention further provides methods of increasing (e.g.,
by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%)
the number of stress granules in a cell or cell population
requiring contacting the cell or population of cells with one or
more (e.g., 1, 2, 3, 4, or 5) PARP activators, one or more (e.g.,
1, 2, 3, 4, or 5) PARG inhibitors, or one or more (e.g., 1, 2, 3,
4, or 5) PARP11 inhibitors. In these methods, the increased number
of stress granules may be the result of an increase in the rate of
stress granule nucleation or formation and/or a decrease in the
rate of stress granule breakdown or turnover.
[0225] In these methods, the one or more PARP activators preferably
increase (e.g., at least 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%,
80%, 90%, or 100%) the expression (e.g., mRNA and/or protein)
and/or activity of a protein encoded by a nucleic acid sequence
containing a sequence that is at least 80% identical (e.g., at
least 85%, 90%, 95%, 99%, or even 100% identical) to PARP5A (SEQ ID
NO: 8 or 9), PARP12 (SEQ ID NO: 18), PARP13.1 (SEQ ID NO: 19),
PARP13.2 (SEQ ID NO: 20), or PARP15 (SEQ ID NO: 22 or 23). The
activity of the one or more PARPs may be an increase in the
poly-ADP-ribosylation of one or more (e.g., 1, 2, 3, 4, or 5)
target protein(s) (e.g., a protein localized in a stress granule, a
protein involved in the formation or disassembly of a stress
granule, and/or a PARP protein) or the nucleation and/or formation
of a stress granule. Additional activities of a PARP protein are
described herein. Examples of the PARP activators that may be used
with these methods include, nucleic acid sequence containing a
sequence having at least 80% identity (e.g., at least 85%, 90%,
95%, 99%, or even 100% identical) to any one of SEQ ID NOS: 8, 9,
18-20, 22, or 23.
[0226] In these methods, the one or more PARG inhibitors may
selectively decrease (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%,
70%, 80%, 90%, or even 100% decrease) in the expression (e.g., mRNA
and/or protein) or activity of PARG or glycohydrolase ARH3. For
example, one or more PARG inhibitors may decrease the level of one
or more nucleic acid sequence(s) containing a sequence having at
least 80% sequence identity (e.g., at least 85%, 90%, 95%, 99%, or
even 100% identity) to PARG (SEQ ID NO: 42) or ARH3 (SEQ ID NO:
41), or a polypeptide encoded by these nucleic acids. The
activities of PARG protein or ARH3 glycohydrolase are described
herein and include, without limitation, the hydrolysis of
poly-ADP-ribose (e.g., poly-ADP-ribose attached to a protein, e.g.,
a protein localized in a stress granule, a protein involved in the
formation or disassembly of a stress granule, and/or a PARP), the
prevention of the assembly of a stress granule, or disassembly of a
stress granule. Examples of PARG inhibitors that may be used in
these methods include an antibody that specifically binds to a
polypeptide or peptide fragment encoded by a nucleic acid sequence
containing a sequence having at least 80% sequence identity (e.g.,
85%, 90%, 95%, 99%, or even 100%) to PARG (SEQ ID NO: 42) or ARH3
(SEQ ID NO: 41), or an RNA aptamer that binds to one or more of
these nucleic acid sequences. Specific examples of RNAi molecules
that may target PARG and ARH3 are SEQ ID NOS: 34 and 35, and SEQ ID
NOS: 36 and 37, respectively.
[0227] In these methods, the one or more PARP11 inhibitors may
selectively decrease (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%,
70%, 80%, 90%, or even 100%) the expression (mRNA and/or protein)
and/or activity of PARP11. In different examples of these methods,
the PARP11 inhibitor(s) may decrease the expression of one or more
nucleic acid(s) containing a sequence having at least 80% sequence
identity (e.g., at least 85%, 90%, 95%, 99%, or even 100%) to
PARP11 (SEQ ID NO: 17), or decrease the expression of one or more
polypeptides encoded by these nucleic acids. The activity of PARP11
may include poly-ADP-ribosylation of a target protein (e.g., a
protein localized in a stress granule, a polypeptide involved in
the formation or disassembly of a stress granule, and/or a PARP),
prevention of the assembly of a stress granule, or disassembly of a
stress granule. Examples of PARP11 inhibitors that may be used in
these methods include an antibody that specifically binds to a
polypeptide or peptide fragment encoded by a nucleic acid sequence
containing a sequence having at least 80% sequence identity (e.g.,
85%, 90%, 95%, 99%, or even 100%) to PARP11 (SEQ ID NO: 17), or an
RNA aptamer that binds to one or more of these nucleic acid
sequences. Specific examples of RNAi molecules that may target
PARP11 are SEQ ID NOS: 91-98.
[0228] These methods may allow for the specific up-regulation of
stress granule formation in cells in which increased resistance to
toxic stress is desired (e.g., a plant cell (e.g., a transgenic
plant cell) or a cultured mammalian cell (e.g., for cell
replacement therapies).
EXAMPLES
[0229] The features and other details of the invention will now be
more particularly described and pointed out in the following
examples describing preferred techniques and experimental results.
These examples are provided for the purpose of illustrating the
invention and should not be construed as limiting.
Example 1
Generation of PARP-GFP Fusion Proteins and Assays
[0230] Fusion proteins containing the sequence of each PARP and
green fluorescent protein (GFP) were generated using the pEGFP-C1
vector (Invitrogen) (FIG. 4). For these experiments, the DNA
sequences encoding each of PARP1 (SEQ ID NOS: 1 and 2), PARP3 (SEQ
ID NOS: 4, 5, and 6), PARP4 (SEQ ID NO: 7), PARP5A (SEQ ID NOS: 8
and 9), PARP5B (SEQ ID NO: 10), PARP6 (SEQ ID NO: 11), PARP7 (SEQ
ID NO: 12), PARP8 (SEQ ID NO: 13), PARP9 (SEQ ID NO: 14), PARP10
(SEQ ID NOS: 15 and 16), PARP11 (SEQ ID NO: 17), PARP12 (SEQ ID NO:
18), PARP13.1 (SEQ ID NO: 19), PARP13.2 (SEQ ID NO: 20), PARP14
(SEQ ID NO: 21), PARP15 (SEQ ID NOS: 22 and 23), and PARP16 (SEQ ID
NO: 24) were cloned into the pEGFP-C1 vector using the restriction
sites indicated in Table 2. Each resulting plasmid contained a
nucleic acid sequence encoding a PARP-GFP fusion protein, wherein
the nucleic acid sequence encoding GFP was located 5' to the
nucleic acid sequence encoding the PARP protein.
TABLE-US-00002 TABLE 2 Restriction Sites Used for Cloning PARP
Sequences into pEGFP-C1 PARP Restriction Sites 1 BglII, SalI 3
BglII, SalI 4 KpnI, ApaI 5a HinDIII, BglII 5b SalI, BamHI 6 SalI,
XmaI 7 BspEI, EcoRI 8 BspEI, SalI 9 BspEI, SalI 10 BamHI, BglII 11
SalI, BamHI 12 SalI, ApaI 13 isoform 1 BspEI, BamHI 13 isoform 2
BglII, BamHI 14 XhoI, SacII 15 SalI, BamHI 16 BglII, SalI
[0231] Each generated pEGFP-C1 vector was transfected into HeLa
Kyoto cells using Lipofectamine 2000, according to the
manufacturer's instructions. Cell lysate was prepared from the HeLa
cells at 48 hours following transfection. Electrophoresis was
performed on the cell lysate using 4-12% SDS-PAGE, and
immunoblotting was performed using a rabbit anti-GFP polyclonal
antibody (FIG. 5).
[0232] The localization of each PARP-GFP fusion protein in the
transfected HeLa Kyoto cells was determined using
immunofluorescence microscopy using rabbit anti-GFP polyclonal
antibody and a fluorescently-labeled secondary antibody (FIG. 6).
The data from this experiment indicate that several PARP-GFP
proteins are primarily localized in the nucleus of asynchronous
cells, including PARP1-GFP, PARP2-GFP, PARP7-GFP, and PARP8-GFP.
The data further indicate that several PARP-GFP fusion proteins are
localized in primarily in the cytoplasm of asynchronous cells,
including PARP12-GFP, PARP13-GFP, PARP14-GFP, PARP15-GFP,
PARP16-GFP, PARP10-GFP, PARP11-GFP, PARP5A-GFP, and PARP5B-GFP. In
addition, the data indicate that several PARP-GFP fusion proteins
are localized in both the cytoplasm and the nucleus of asynchronous
cells, including PARP3-GFP, PARP9-GFP, PARP6-GFP, and PARP4-GFP.
The same pattern of cell localization for each PARP-GFP fusion
protein was observed in the hTERT-RPE1 cell line (Clontech), a
telomerase-immortalized human retinal pigment epithelial (RPE)
normal cell line (FIG. 7).
[0233] Antibodies specific for each PARP were generated by
immunizing rabbits with PARP-specific peptides conjugated to
keyhole limpet hemocyanin (KLH) using known methods. The antibodies
produced in the rabbit serum were later affinity purified using
peptide columns (e.g., columns containing, as substrate, the
specific peptide sequence used to inoculate the rabbit).
[0234] The antibodies for each PARP and a secondary-fluorescently
labeled anti-rabbit polyclonal antibody were used to visualize the
location of each PARP in asynchronous HeLa Kyoto cells transfected
with a pEGFP-C1 plasmid encoding a PARP-GFP fusion protein (FIG.
8). The data from this experiment confirm that PARP1, PARP2, PARP7,
PARP8, and PARP14 are primarily localized in the nucleus of
asynchronous cells. The data from this experiment also confirm that
PARP3, PARP4, PARP6, PARP9, and PARP15 are localized in the both
the nucleus and the cytoplasm of asynchronous cells.
[0235] The localization of each PARP-GFP fusion protein (described
above) was also determined in HeLa Kyoto cells transfected with a
pEGFP-C1 plasmid encoding a PARP-GFP fusion protein following
12-hour treatment with 100 nM nocodazole or 5 .mu.g/mL aphidicolin.
Cells treated with nocodazole are arrested in S phase, while cells
treated with aphidicolin are arrested in mitotosis. FIG. 9 shows
the cellular localization for each PARP-GFP fusion protein
following cell arrest in S-phase or mitosis. The data show that the
PARP1-GFP, PARP2-GFP, and PARP8-GFP fusion proteins localize to the
nucleus during S-phase, and that PARP5A-GFP and PARP5B-GFP localize
to the mitotic spindle during mitosis. The localization of these
PARP-GFP fusion proteins (e.g., PARP1-GFP, PARP2-GFP, PARP5A-GFP,
PARP5B-GFP, and PARP8-GFP) to the nucleus during S-phase and
mitosis indicate a role for these PARP proteins in cell division
and cell proliferation.
[0236] In order to study the role of PARP16, additional experiments
were performed using RNAi knockdown of endogenous PARP16 or
overexpression of PAPR16-GFP fusion proteins to study the effect of
PARP16 knockdown and overexpression, respectively on cell
morphology. Asynchronous HeLa Kyoto cells overexpressing PARP16-GFP
protein had normal cell morphology (FIG. 10; middle panel). In
these cells, the PARP16-GFP protein was primarily localized in the
endoplasmic reticulum, as demonstrated by its co-localization with
calnexin (FIG. 10; middle panel). HeLa Kyoto cells transfected with
an RNAi molecule specific for PARP16 demonstrated significant
morphological changes, including cell shrinkage and dramatic
membrane defects (FIG. 10; right panel).
[0237] The specific cellular localization of each PARP-GFP fusion
protein may be further analyzed by immunofluorescence microscopy
using a combination of labeled antibodies specific for the GFP-tag
of each PARP-GFP fusion protein and one or more markers of cellular
structures or organelles. For example, immunofluorescence staining
of asynchronous HeLa Kyoto cells transfected with a pEGFP-C1 vector
expressing the PARP7-GFP fusion protein shows co-localization of an
anti-GFP antibody and an anti-coilin antibody (a marker of Cajal
bodies in the nucleus) (FIG. 11). In another example, asynchronous
HeLa Kyoto cells transfected with a pEGFP-C1 vector expressing the
PARP16-GFP fusion protein shows co-localization of an anti-GFP
antibody and an anti-calnexin antibody (a marker of the endoplasmic
reticulum) (FIG. 10). A non-limiting list of marker proteins that
may be used to determine the cellular localization of a PARP-GFP
fusion protein is also provided in FIG. 11.
Experimental Methods
[0238] Kyoto HeLa cells were grown in DMEM supplemented with 10%
FCS and penicillin/streptomycin at 37.degree. C. in 5% CO.sub.2.
Lipofectamine 2000 (Invitrogen) was used to transfect the cells
with each pEGFP-C1 vector according to the manufacturer's protocol.
Cells were arrested in mitosis and S-phase by treatment with 100 nM
nocodazole or 5 .mu.g/mL aphidicolin for 12 hours, respectively.
For immunofluorescence imaging, cells on coverslips were fixed in
ice-cold methanol for five minutes and rehydrated in phosphate
buffered saline (PBS). The cells were blocked in PBS containing 4%
bovine serum albumin (BSA) and 0.1% Triton-X 100. All antibodies
used for imaging were diluted in blocking buffer. The coverslips
were incubated with primary antibodies for 45 minutes and with
secondary antibodies for 30 minutes. Images were collected on a
Nikon TE2000 confocal microscope equipped with a Yokogawa CSU-X1
spinning disk head, Hamamatsu ORCA ER digital camera, and
NIS-Elements imaging software.
Example 2
Generation of ZZ-TEV-PARP Fusion Proteins
[0239] Fusion proteins containing the sequence of each PARP, a
ZZ-domain of SEQ ID NO: 27, and four TEV protease recognition
sequences (SEQ ID NO: 26) were cloned using the pcDNA3.1 vector
(SEQ ID NO: 33) (Invitrogen) (FIG. 12) to yield a ZZ-4x-TEV-PARP
fusion protein for each PARP. For these experiments, the DNA
sequences encoding PARP1 (SEQ ID NOS: 1 and 2), PARP2 (SEQ ID NO:
3), PARP3 (SEQ ID NOS: 4, 5, and 6), PARP4 (SEQ ID NO: 7), PARP5A
(SEQ ID NOS: 8 and 9), PARP6 (SEQ ID NO: 11), PARP7 (SEQ ID NO:
12), PARP9 (SEQ ID NO: 14), PARP10 (SEQ ID NOS: 15 and 16), PARP11
(SEQ ID NO: 17), PARP13.1 (SEQ ID NO: 19), PARP13.2 (SEQ ID NO:
20), PARP14 (SEQ ID NO: 21), PARP15 (SEQ ID NOS: 22 and 23), and
PARP16 (SEQ ID NO: 24) were cloned into the pcDNA3.1 vector using
the restriction sites indicated in Table 3. The sequence encoding
the ZZ-domain and the sequence encoding the four TEV protease
recognition sequences were cloned into the NheI and HinDIII
restriction sites in pcDNA3.1.
TABLE-US-00003 TABLE 3 Restriction Sites Used for Cloning PARP
Sequences into pcDNA3.1 PARP Restriction Sites 1 XhoI, PmeI 2
BamHI, NotI 3 EcoRV, NotI 4 KpnI, ApaI 5a HinDIII, XhoI 6 EcoRV,
NotI 7 BamHI, NotI 9 EcoRV, NotI 10 HinDIII, XbaI 11 BamHI, XbaI 13
isoform 1 KpnI, BamHI 13 isoform 2 BamHI, EcoRV 14 KpnI, XhoI 15
KpnI, XhoI 16 KpnI, XbaI
[0240] Each resulting plasmid contained a nucleic acid sequence
encoding a ZZ-TEV-PARP fusion protein, wherein the nucleic acid
sequence encoding ZZ domain was located 5' to the nucleic acid
sequence encoding the four TEV protease recognition sequences,
which in turn, was located 5' to the nucleic acid sequence encoding
each PARP.
[0241] Nucleic acids encoding each ZZ-TEV-PARP fusion protein may
be transfected into target cells (e.g., HeLa Kyoto or HeLa S3
cells) and the resulting ZZ-TEV-PARP fusion proteins purified by
binding to magnetic beads coated with a protein containing an Fc
domain (e.g., IgG). The resulting ZZ-TEV-PARP fusion proteins may
be used in the assays described below for the PARP-GFP fusion
proteins and the other assays described herein. Assays utilizing
the ZZ-TEV-PARP fusion proteins have the additional advantage of
containing an engineered TEV protease recognition sequence, whereby
the polypeptide tag on each PARP fusion protein (e.g., the
ZZ-domain and the four TEV protease recognition sequences) may
optionally be removed from the ZZ-TEV-PARP fusion proteins by
treatment with TEV protease. In one example, one or more
ZZ-TEV-PARP fusion proteins may be removed from a magnetic bead,
resin, or solid surface by treatment with a TEV protease.
Example 3
PARP Activity Assays and Screening Methods
[0242] The above-described PARP fusion proteins may be used in PARP
activity assays and in assays to identify an activator or inhibitor
for a specific PARP or a specific subset of PARPs. An example of
such an activity assay in shown in FIG. 13. In this example, cell
lysate is first prepared from a HeLa S3 cell culture expressing one
or more PARP-GFP fusion proteins. The cell lysate is then incubated
with an anti-GFP polyclonal antibody bound to Dynabead.RTM. Protein
A beads, and the beads magnetically removed from the cell lysate.
The isolated beads bound to one or more PARP-GFP fusion proteins
are placed into a multi-well plate and incubated with a labeled
NAD.sup.+ substrate (e.g., .sup.32P-NAD.sup.+). Following
incubation with the labeled NAD.sup.+ substrate, the magnetic beads
bound with the one or more PARP-GFP proteins are magnetically
isolated or washed, and the level of the label (i.e., the label
present in the labeled NAD.sup.+ substrate) that is covalently
attached to the one or more PARP-GFP fusion proteins bound to the
magnetic beads is determined (e.g., the amount of .sup.32P
covalently bound to the one or more PARP-GFP proteins attached to
the beads). This assay provides a means of measuring the
auto-modulation activity of one or more PARP-GFP fusion proteins
(e.g., the ability of a PARP to modify its own structure by
catalyzing the covalent attachment of one or more ADP-ribose
molecules). The assay may also be designed such that lysate or
PARP-GFP fusion proteins isolated from several different
transfected HeLa S3 cells, each expressing a different PARP-GFP
fusion proteins or subset of PARP-GFP fusion proteins, may be
placed in different wells of the multi-well plate. The assay may
also be designed such that the lysate from several different
transfected HeLa S3 cells is combined, wherein the lysate from each
transfected HeLa S3 cell culture contains one or more PARP-GFP
fusion proteins. In a different version of the assay, the PARP-GFP
fusion proteins may contain a protease recognition site. In this
version of the assay, the one or more PARP-GFP fusion proteins
bound to the magnetic beads may be treated with a specific protease
(i.e., a protease that recognizes a protease recognition sequence
in the PARP-GFP fusion protein) to mediate release of the PARP-GFP
fusion protein from the magnetic bead.
[0243] FIG. 14 provides an example of the use of the PARP-GFP
fusion proteins of the invention for the identification of an agent
that specifically inhibits the activity of one or more PARPs. This
assay is similar to the assay described above, except that the one
or more PARP-GFP fusion proteins is incubated with both a test
agent and a labeled NAD.sup.+ substrate. A specific PARP inhibitor
will decrease the amount of the label (i.e., the label present in
the labeled NAD.sup.+ substrate) covalently attached to the one or
more PARP-GFP fusion proteins bound to the magnetic beads relative
to the amount of the label attached to the one or more PARP-GFP
fusion proteins in the absence of the test agent. In different
examples of this assay, lysate or PARP-GFP fusion proteins isolated
from two or more different transfected HeLa S3 cells, each
expressing a different PARP-GFP fusion protein or subset of
PARP-GFP fusion proteins, may be placed in different wells of the
multi-well plate. The assay may also be designed such that the
lysate from several different transfected HeLa S3 cells is
combined, wherein the lysate from each transfected HeLa S3 cells
contains one or more PARP-GFP fusion proteins. The assay may also
be specifically designed to identify inhibitors of a specific
PARP-GFP protein or subset of PARP-GFP proteins including the
subsets of: one or more of PARP1-GFP, PARP2-GFP, PARP5A-GFP,
PARP5B-GFP, PARP7-GFP, PARP8-GFP, PARP14-GFP, and PARP16-GFP; one
or more of PARP5A-GFP, PARP12-GFP, PARP13.1-GFP, PARP13.2-GFP,
PARP15-GFP; PARP11-GFP; or PARP13.1-GFP.
[0244] Similar to the examples, described above, the PARP-GFP
fusion proteins of the invention may be used to identify activators
of one or more specific PARPs. In this instance, the assay may be
used to identify agents that increase the amount of the label
(i.e., the label present in the labeled NAD.sup.+ substrate)
covalently attached to the one or more PARP-GFP fusion proteins
bound to the magnetic beads relative to the amount of the label
covalently attached to the one or more PARP-GFP fusion proteins in
the absence of the test agent. Preferably, this assay may be
designed to identify activators of a specific PARP-GFP fusion
protein or subset of PARP-GFP fusion proteins including the subsets
of: one or more of PARP1-GFP, PARP2-GFP, PARP5A-GFP, PARP5B-GFP,
PARP7-GFP, PARP8-GFP, PARP14-GFP, and PARP16-GFP; one or more of
PARP5A-GFP, PARP12-GFP, PARP13.1-GFP, PARP13.2-GFP, and PARP15-GFP;
PARP11-GFP; or PARP13.1-GFP.
Example 4
Involvement of PARPs in Stress Granule Formation and
Disassembly
[0245] We have discovered through a PARP family-wide RNAi screen
that several PARP proteins are involved in the cell cycle and are
required for progression through mitosis (e.g., PARP16). The
identity of the various substrate proteins of the different PARP
proteins remains largely unknown. To further identify PARP
substrate proteins and/or proteins that bind to poly-ADP-ribose
polymers, the Bio-Gel P-6 resin shown in FIG. 15 was used to purify
proteins that bind poly-ADP-ribose polymer and/or act as an
acceptor of a ADP-ribose molecule or a poly-ADP-ribose polymer.
FIG. 15 also shows a Coomassie Blue-stained SDS-PAGE gel showing
the proteins present in the HeLa Kyoto cell extract (Extract), in
cell extract following lectin clarification (Lectin Clarification),
in the lysate prior to passing over the Bio-Gel P-6 resin (Input),
in the pellet following centrifugation of the resin (Pellet), and
in the eluate following treatment with poly-ADP-ribose
glycohydrolase ARH3 (ARH3 Release). The data in FIG. 15
demonstrates the selective purification of proteins bound to the
Bio-Gel P-6 resin.
[0246] We have discovered that poly-ADP-ribose polymers are
associated with stress granules in cells during exposure to stress
conditions. FIG. 16 shows the co-localization of poly-ADP-ribose
polymers and eIF3, a marker of stress granules, in HeLa Kyoto cells
following treatment with 0 or 250 .mu.M sodium arsenite for 30
minutes and immunostaining with fluorescently-labeled antibodies
specific for poly-ADP-ribose polymers and eIF3. The data indicate
that stress granules contain proteins modified with poly-ADP-ribose
polymers.
[0247] In order to identify the specific PARP proteins that mediate
the formation of the poly-ADP-ribose polymers present in stress
granules, experiments were performed to determine whether the
different PARP-GFP fusion proteins localize to stress granules. In
these experiments, HeLa Kyoto cells transfected with a pEGFP-C1
plasmid expressing a PARP-GFP fusion protein were visualized using
fluorescently-labeled anti-GFP and anti-eIF3 antibodies following
treatment with 250 .mu.M sodium arsenite for 30 minutes (FIG. 17).
The data indicate that the PARP5A-GFP, PARP12-GFP, PARP13.1-GFP,
PARP13.2-GFP, and PARP15-GFP fusion proteins localize to stress
granules under stress conditions.
[0248] Endogenous PARP5A, PARP12, PARP13/13.1, PARP15, and
poly-ADP-ribose glycohydrolase (PARG) also localize to stress
granules in HeLa Kyoto cells following treatment with 250 .mu.M
sodium arsenite for 30 minutes (FIG. 18). In these experiments, the
fixed cells were visualized using antibodies specific for one of
PAR5A, PARP12, PARP13/13.1, PARP15, or PARG, and an anti-eIF3
antibody, and secondary fluorescently-labeled antibodies. The data
indicate that PARG, as well as the endogenous- and fusion
protein-forms of PARP5A, PARP12, PARP13/13.1, and PARP15, localize
to stress granules under stress conditions. In a similar set of
experiments using hTERT RPE cells, endogenous PARP5A, PARP12,
PARP13, and PARP15 showed a similar cellular localization following
exposure to 250 .mu.M sodium arsenite for 30 minutes, as was
observed in HeLa Kyoto cells (FIG. 19).
[0249] Experiments using time-lapse immunofluorescence microscopy
in live HeLa Kyoto cells further indicate that endogenous PARP12,
PARP12-GFP, endogenous PARP13, and PARP13-GFP localize to stress
granules at an early point in stress granule assembly and
therefore, may play a regulatory role in the formation of stress
granules (data not shown).
[0250] In an additional set of experiments, the effect of PARP13.1,
PARP13.2, and PARP15 on stress granule formation was further
studied by measuring the effect of overexpression of PARP13.1-GFP,
PARP13.2-GFP, and PARP15-GFP on stress granule formation. In these
experiments, HeLa Kyoto cells were transfected with a pEGFP-C1
plasmid encoding PARP13.1-GFP, PARP13.2-GFP, or PARP15-GFP. The
transfected cells were stained with anti-GFP antibodies, anti-eIF3
antibodies, and fluorescently-labeled secondary antibodies. These
data indicate that overexpression of PARP13.1-GFP, PARP13.2-GFP, or
PARP15-GFP fusion protein nucleates stress granule formation (FIG.
20).
[0251] In contrast to the effect mediated by overexpression of
PARP13.1-GFP, PARP13.2-GFP, or PARP15-GFP fusion protein,
overexpression of PARP11-GFP in HeLa Kyoto cells mediates a
decrease in stress granule formation following treatment with 250
.mu.M sodium arsenite for 30 minutes (FIG. 21). In this experiment,
HeLa Kyoto cells transfected with a pEGFP-C1 vector expressing a
PARP11-GFP fusion protein were treated with sodium arsenite, and
stained with anti-GFP antibodies, anti-eIF3 antibodies, and
fluorescently-labeled secondary antibodies. These data indicate
that overexpression of PARP11-GFP suppresses the formation of
stress granules in cells exposed to stress conditions.
Experimental Methods
[0252] HeLa Kyoto cells were cultured as described above.
Lipofectamine 2000 (Invitrogen) was used to transfect the HeLa
Kyoto cells with a pEGFP-C1 plasmid encoding a PARP-GFP fusion
protein (described above) according to the manufacturer's
instructions. For stress granule induction, cells were treated with
250 .mu.M sodium arsenite for 30 minutes. For long-term, real-time
imaging of PARP-GFP transfected HeLa cells, the cells were split
into 24-well glass bottom plates and imaged every 20 minutes for 48
hours. Images were collected on a Nikon TE2000 confocal microscope
equipped with a Yokogawa CSU-X1 spinning disc head, Hamamatsu ORCA
ER digital camera, and NIS-Elements imaging software.
Example 5
Involvement of PARG and ARH3 in Stress Granule Disassembly
[0253] In order to determine the importance of poly-ADP-ribose
polymers on stress granule formation and disassembly, an additional
set of experiments were performed to test the effect of PARG and
ARH3 activity on stress granule dynamics. In a first set of
experiments, HeLa Kyoto cells were transfected with a pEGFP-C1
plasmid encoding PARG99-GFP, PARG102-GFP, or a PARG110-GFP fusion
protein. Overexpression of PARG99-GFP, PARG102-GFP, or PARG110-GFP
reduces the formation of stress granules in HeLa Kyoto cells
following exposure to 100 .mu.M sodium arsenite for 30 minutes
(FIG. 22). In these experiments, formation of stress granules was
determined by staining the fixed cells with anti-eIF3 antibodies
and secondary fluorescently-labeled antibodies. These data indicate
that PARG activity (hydrolysis of poly-ADP-ribose) inhibits the
formation of stress granules in cells under stress conditions.
[0254] Another set of experiments was performed to determine the
effect of knockdown of PARG (SEQ ID NO: 42) or ARH3 (SEQ ID NO: 41)
on stress granule formation in cells under stress conditions. In
these experiments, HeLa Kyoto cells were treated with 30 nM siRNA
specific for PARG (SEQ ID NOS: 34 and 35) or ARH3 (SEQ ID NOS: 36
and 37), or a control siRNA (All Stars Negative Control siRNA;
Qiagen Catalog No. 1027280), and treated with 100 .mu.M sodium
arsenite for 30 minutes, or 30 minutes or 1 hour following sodium
arsenite washout (FIG. 23). Cells treated with a PARG siRNA or ARH3
siRNA show a sustained presence of stress granules following
removal of sodium arsenite from the culture medium (via imaging
using anti-eIF3 antibodies and fluorescently-labeled secondary
antibodies). These data indicate that PARG and ARH3 activity
(hydrolysis of poly-ADP-ribose) has a positive effect on stress
granule disassembly, and that poly-ADP-ribose turnover kinetics
regulate the formation/disassembly of stress granules. The
percentage of cells with stress granules following 30-minute
washout and 1-hour washout after arsenite treatment was quantitated
for cells treated with control siRNA, PARG siRNA, and ARH3 siRNA
(FIG. 24). These data indicate that knockdown of PARG and ARH3
reduces the rate of stress granule disassembly following removal of
the stress condition (sodium arsenite).
Experimental Methods
[0255] HeLa Kyoto cells were cultured in medium as described above.
In PARG overexpression experiments, Lipofectamine 2000 (Invitrogen)
was used to transfect HeLa Kyoto cells with pEGFP-C1 plasmids
containing the nucleic acid sequences for each PARG isoform, i.e.,
PARG99, PARG102, and PARG110 (sequences described in Meyer-Ficca et
al., Exp. Cell. Res. 297(2):521-532, 2004) according to the
manufacturer's instructions. In PARG knockdown experiments, cells
were treated with 30 nM of a siRNA targeting PARG (SEQ ID NOS: 34
and 35), a siRNA targeting ARH3 (SEQ ID NO: 36 and 37), or a
control siRNA (AllStars Negative Control siRNA; Qiagen Catalog No.
1027280) using Lipofectamine 2000 according to the manufacturer's
instructions. In these experiments, stress granule formation was
induced by treatment with 100 .mu.M sodium arsenite for 30 minutes.
For stress granule disassembly experiments, the media was replaced
after sodium arsenite treatment, and cells were incubated for 30
minutes and 1 hour prior to fixation and immunostaining. At least
200 cells were counted for each condition (in triplicate) to
determine the percentage of cells containing stress granules.
Example 6
Stress Granule Proteins Bind to GFP-PARPs
[0256] Experiments were performed to further identify stress
granule-related proteins that may bind and be the substrates of one
or more of the PARPs localized in stress granules (e.g., PARP5A,
PARP12, PARP13, PARP13.1, and PARP15). In these experiments, HeLa
S3 cells were transfected with pEGFP-C1 plasmids containing a
nucleic acid sequence encoding PARP5A-GFP, PARP12-GFP, PARP13-GFP,
PARP13.1-GFP, or PARP15-GFP fusion protein and treated with 0 or
250 .mu.M sodium arsenite for 30 minutes. The resulting cell lysate
was immunoprecipitated using anti-GFP antibodies and the resulting
immunoprecipitated proteins were electrophoresed using SDS-PAGE.
The resulting gel indicates that each PARP-GFP fusion protein binds
to several proteins and that treatment with sodium arsenite results
in an alteration in the amount and identity of the proteins binding
to each PARP-GFP fusion protein (FIG. 25A). In a similar
experiment, the immunoprecipitated proteins are transferred to a
membrane and immunostained with an anti-poly-ADP-ribose antibody.
The data in this experiment show that PARP5A-GFP, PARP12-GFP,
PARP13-GFP, and PARP13.1-GFP fusion proteins bind to
poly-ADP-ribosylated proteins (FIG. 25B).
[0257] Data from a separate set of experiments indicate that
several stress granule-associated proteins bind to the PARP13-GFP,
PARP12-GFP, and PARP5A-GFP fusion proteins. In these experiments,
HeLa S3 cells were transfected with a pEGFP-C1 plasmid encoding a
PARP13-GFP, PARP12-GFP, or PARP5A-GFP fusion protein and treated
with 0 or 20 nM pateamine A for 30 minutes. Cell lysates from the
cells were immunoprecipitated using an anti-GFP antibody and the
immunoprecipitated proteins were electrophoresed using 4-12%
SDS-PAGE. The resulting proteins were transferred to a membrane and
immunoblotted using commercially-available antibodies specific for
different stress granule-associated proteins: Ago2, DDX6, LSM1,
PABP, FMRP, eIF1A, eIF2.alpha., eIF3.rho., eIF4A1, and eIF4E. The
data indicate that the PARP13-GFP, PARP12-GFP, and PARP5A-GFP
fusion proteins have the ability to interact with one or more of
these stress granule-associated proteins under both normal (0 nM
pateamine A) and stress conditions (30 nM pateamine A) (FIG. 25
C).
[0258] An additional set of experiments was performed to determine
whether one or more stress granule-associated proteins are
poly-ADP-ribosylated. In these experiments, HeLa S3 cells were
transfected with a pEGFP-C1 plasmid encoding a GFP fusion protein
of TIA1, PABP, G3BP, or Ago2, and treated with 0 or 20 nM pateamine
A for 30 minutes. Lysates from these cells were immunoprecipitated
using anti-GFP antibodies and immunoblotted using an anti-poly-ADP
ribose antibody. The data show that several proteins bind the
TIA1-GFP, PABP-GFP, G3BP-GFP, and Ago2-GFP fusion proteins in
untreated (0 nM pateamine A) and treated (20 nM pateamine A) cells
(FIG. 26A). In an additional experiment, the proteins that bind to
endogenous G3BP and Ago2 proteins in 250 .mu.M sodium
arsenite-treated HeLa S3 cells were also shown to be
poly-ADP-ribosylated (FIG. 26B). In this experiment, cell lysates
from untransfected HeLa S3 cells treated with 0 or 250 .mu.M sodium
arsenite for 60 minutes were immunoprecipitated with anti-G3BP or
anti-Ago2 antibodies and immunoblotted using an
anti-poly-ADP-ribose antibody.
[0259] G3BP1, a stress granule-associated protein, was shown to be
poly-ADP-ribosylated (FIG. 26C). In order to map the specific
domain in G3BP1 that is modified by a poly-ADP-ribose polymer,
GFP-fusion proteins of different truncation 250 .mu.M sodium
arsenite for 60 minutes. The specific nucleic acid sequences
encoding each G3BP1 truncation mutant are described in Tourriere et
al. (J. Cell Biol. 160:823-831, 2003). The cell lysate from each
cell sample was immunoprecipitated using anti-GFP antibodies and
immunoblotted using an anti-poly-ADP-ribose antibody. The data
demonstrate that poly-ADP-ribosylation of G3BP1 occurs within the
RNA-recognition motif (RRM) domain ("D" in FIG. 26C). The RRM
domain of G3BP1 is a domain that binds to RNA molecules. The
poly-ADP-ribosylation of G3BP1 in the RRM domain is thought to
regulate the RNA-binding activity of G3BP1.
[0260] TIA1, a stress granule-associated protein, was also shown to
be poly-ADP-ribosylated (FIG. 26D). In order to determine whether
TIA1 is poly-ADP-ribosylated in its RRM domain, GFP-fusion proteins
of full-length TIA1 and a truncation mutant of TIA1 lacking its RRM
domain (TIA1.DELTA.RRM) were expressed in HeLa S3 cells treated
with 0 or 250 .mu.M sodium arsenite for 60 minutes. The specific
nucleic acid sequences encoding the full-length TIA1 and the
TIA1.DELTA.RRM truncation mutant are described in Kedersha et al.
(J. Cell Biol. 151:1257-1268, 2000). The cell lysate from each cell
sample was immunoprecipitated using anti-GFP antibodies and
immunoblotting was performed using an anti-poly-ADP-ribose
antibody. The data demonstrate that poly-ADP-ribosylation of TIA1
also occurs within its RNA-recognition motif (RRM) domain (FIG.
26D). The poly-ADP-ribosylation of TIA1 in its RRM domain is also
thought to mediate an alteration in its RNA-binding activity.
Experimental Methods
[0261] Immunoprecipitation experiments to identify proteins binding
to PARP5A-GFP, PARP12-GFP, PARP13-GFP, PARP13.1-GFP, and PARP15-GFP
were performed using HeLa S3 cells transfected with a pEGFP-C1
plasmid containing a nucleic acid sequence encoding each respective
PARP-GFP fusion protein following treatment with 0 or 20 nM
pateamine A for 30 minutes. In each experiment, the cell lysate is
incubated with an anti-GFP antibody to immunoprecipitate proteins
bound to each of the PARP-GFP fusion proteins using standard
methods. The resulting immunoprepitated proteins were
electrophoresed on 4-12% SDS-PAGE gels, and either stained directly
with Coomassie Blue or transferred onto a membrane and
immunostained with one or more of the following antibodies:
anti-poly-ADP-ribose, anti-Ago2, anti-DDX6, anti-LSM1, anti-PABP,
anti-FMRP, anti-eIF1A, anti-eIF2.alpha., anti-eIF3.eta.,
anti-eIF4A1, and anti-eIF4e antibodies.
[0262] Immunoprecipitation experiments using TIA1-GFP, PABP-GFP,
G3BP-GFP, and Ago2-GFP fusion proteins were performed using HeLa S3
cells transfected with pEGFP-C1 plasmids containing a sequence
encoding a nucleic acid sequence encoding TIA1 (Kedersha et al., J.
Cell Biol. 151:1257-1268, 2000), PABP (NCBI Accession No.
NM.sub.--12154.2), G3BP (Tourriere et al., J. Cell Biol.
160:823-831, 2003), Ago2 (NCBI Accession No..sub.--002568.3), a
truncation mutant of G3BP (i.e., A, ABC, BC, BCD, and D truncation
mutants described in Tourriere et al., supra), or the .DELTA.RRM
truncation mutation of TIA1 (described in Kedersha et al., supra)
following treatment with 0 or 20 nM pateamine A for 30 minutes. In
each experiment, the cell lysate is incubated with an anti-GFP
antibody to immunoprecipitate proteins bound to each of the GFP
fusion proteins using standard methods. The resulting
immunoprepitated proteins were electrophoresed on 4-12% SDS-PAGE
gels, and either stained directly with Coomassie Blue or
transferred onto a membrane and immunostained with
anti-poly-ADP-ribose antibody.
Example 7
PARP13 and PARG Regulation of RNAi Activity
[0263] We have further discovered that PARP13 and PARG regulate the
activity of RNAi and miRNA molecules in cells. Regulation of RNAi
and miRNA activity in cells remains largely uncharacterized. One of
the proteins implicated for a role in the regulation of RNAi and
miRNA activity is Argonaut 2, a single-stranded RNAse. Using
immunofluorescence microscopy we have observed that Argonaut 2
localizes to stress granules in HeLa cells treated with 250 .mu.M
sodium arsenite for 30 minutes (FIG. 27, left panel). In these
experiments, cells were treated with sodium arsenite and stained
using both antibodies against Argonaut 2 and eIF3 (a stress granule
marker), and secondary fluorescently-labeled antibodies. The data
show that Argonaut 2 is poly-ADP-ribosylated in HeLa cells
following exposure to 250 .mu.M sodium arsenite for 30 minutes
(FIG. 27, right panel). In these experiments, cell lysate from
cells treated with 250 .mu.M sodium arsenite was immunoprecipitated
with an anti-Argonaut 2 antibody, and the resulting
immunoprecipitated proteins were immunoblotted using an
anti-poly-ADP-ribose antibody. The results indicate that Argonaut 2
is localized to stress granules and poly-ADP-ribosylated under
cellular stress conditions.
[0264] To determine whether one or more of the PARPs identified
herein mediate the poly-ADP-riboyslation of Argonaut 2,
immunoprecipitation experiments were performed on cell lysate from
untransfected HeLa cells treated with 0 or 250 .mu.M sodium
arsenite for 30 minutes using an anti-Argonaut 2 antibody. The
resulting immunoprecipitated proteins were immunoblotted using an
anti-PARP13/13.1 antibody. The data show that PARP13/13.1 binds to
Argonaut 2 under both normal (0 .mu.M sodium arsenite) and stress
conditions (250 .mu.M sodium arsenite) (FIG. 28).
[0265] To identify additional substrate proteins of PAPR13,
immunoprecipitation experiments were performed on lysate from HeLa
cells transfected with a pEGFP-C1 plasmid containing a sequence
encoding a PARP13-GFP fusion protein following treatment with
either 0 or 250 .mu.M sodium arsenite for 30 minutes. The cell
lysate was treated with an anti-GFP antibody and the resulting
immunoprecipitated proteins were electrophoresed using SDS-PAGE.
The data show that exposure to 250 .mu.M sodium arsenite increases
the number and identity of proteins that bind to the PARP13-GFP
fusion protein (FIG. 29). The identification of the specific
proteins co-immunoprecipitated with the PARP13-GFP fusion protein
will help to further elucidate the role of PARP13 in cellular
mechanisms, including its regulation of Argonaut 2 and its role in
the regulation of miRNA and RNAi activity. Additional experiments
were performed to determine the effect of PARP13 knockdown on miRNA
activity. For these experiments, the pGL4.72[hRlucCP].TM.-vector
assay (Promega) was used to measure RNAi activity in 293T cells.
The pGL4.72[hRlucCP].TM. vector contains a constitutively expressed
firefly luciferase gene which is located upstream of several
nucleic acid sequences targeted by an RNAi molecule. An increase in
the activity of an RNAi molecule targeting the downstream 3'
sequences of the vector results in a decrease in the amount of
luciferase produced from the vector. In experiments to study the
effect of PARP13 on miRNA activity, the pGL4.72[hRlucCP].TM. vector
was first engineered to contain 6 repeats of a sequence recognized
by an RNAi molecule targeting the vector ("vector-target RNAi;" SEQ
ID NOS: 38 and 39; GUUUUCACUCCAGCUAACACA and TTCAAAAGUGAGGUCGAUUGU,
respectively). In a first experiment, cells were transfected with a
modified pGL4.72[hRlucCP].TM. vector and a pEGFP-C1 plasmid
encoding EGFP (negative control), G3BP (negative control), PARP5a,
PARP12, PARP13, PARP13.1, or PARP15; and 10 nM of the vector-target
RNAi. In a positive control, the cells were transfected with the
modified pGL4.72[hRlucCP].TM. vector and vector-target RNAi alone
(CXCR4 sponge). Cells overexpressing PARP13 or PARP13.1 showed a
3-fold decrease in the level of miRNA-mediated repression compared
to control cells (e.g., EGFP- and G3BP-overexpressing cells) (FIG.
30). In a second set of experiments, the ability of the
vector-target RNAi to reduce the expression of luciferase was
measured in 293T cells transfected with pGL4.72[hRlucCP].TM.
vector, 20 nM vector-target RNAi, and 20 nM of negative RNAi
control for PARP13 siRNA (siNeg; AllStars Negative Control siRNA;
Qiagen Catalog No. 1027280) or PARP13 siRNA (siPARP13; SEQ ID NO:
40) following treatment with 0 or 30 nM pateamine A for 2 hours.
The data in FIG. 31 show that knockdown of PARP13 expression by
siPARP13 results in an increase in the activity of the
vector-target RNAi under stress conditions (i.e., 30 nM pateamine
A) (FIG. 31). These data indicate that PARP13 activity in the cell
has a negative effect on RNAi activity in the cell. This effect on
RNAi activity may occur through the poly-ADP-ribosylation of
Argonaut 2 by PARP13 or by the ability of PARP13 to modify or bind
other proteins located within stress granules or proteins required
for the assembly or disassembly of stress granules.
Experimental Methods
[0266] Immunopreciptation experiments were performed using
non-transfected HeLa cells following treatment with 0 or 250 .mu.M
sodium arsenite for 60 minutes using an anti-Argonaut 2 antibody.
The resulting precipitated proteins were electrophoresed using
4-12% SDS-PAGE and immunoblotted using an anti-poly-ADP ribose
antibody. Non-transfected HeLa cells treated with 250 .mu.M sodium
arsenite for 30 minutes were also stained for immunofluorescence
microscopy using antibodies specific for Argonaut 2 and eIF3 (a
marker of stress granules), and a secondary fluorescently-labeled
antibody (Alexa Fluor 594 and 488 antibodies).
[0267] Additional co-immunoprecipitation experiments were performed
using methods known in the art. In these experiments, HeLa cell
lysate was prepared from cells treated with 0 or 250 .mu.M sodium
arsenite for 30 minutes, and the lysate subsequently
immunoprecipitated with an anti-Argonaut 2 antibody. The resulting
precipitated proteins were immunoblotted using an anti-PARP13/13.1
antibody.
[0268] Experiments to identify additional proteins bound to a
PARP13-GFP fusion protein were performed by transfecting HeLa S3
cells with a pEGFP-C1 plasmid encoding a PARP13-GFP fusion protein.
The transfected cells were treated with 0 or 250 .mu.M sodium
arsenite for 30 minutes before lysis. The resulting cell lysate was
immunoprecipitated with an anti-GFP antibody and the resulting
precipitated proteins were electrophoresed using 4-12% SDS-PAGE and
the resulting gel stained with Coomassie Blue.
[0269] Experiments to determine the effect of knockdown of PARP13
on miRNA and RNAi activity were performed using a modified
pGL4.72[hRlucCP].TM.-vector assay (Promega). For these experiments,
the pGL4.72[hRlucCP].TM.-vector was modified by placing six copies
of a target sequence at a position 3' to the luciferase gene. RNAi
molecules targeting the vector were designed to bind the six copies
of the target sequence (SEQ ID NOS: 34 and 35). The modified
pGL4.72[hRlucCP].TM.-vector was introduced into 293T cells using
Lipofectamine 2000 (Invitrogen) according to the manufacturer's
instructions. In each experiment, the cells were further
transfected (Lipofectamine 2000) with 10 or 20 nM of the
vector-target RNAi alone or in combination with either 20 nM of a
control RNAi molecule for the siRNA targeting PARP13 (siNeg) or an
RNAi molecule targeting PARP13 (siPARG13), and the cells treated
with 0 or 30 nM pateamine A for 60 minutes. Following 48-hours
incubation, the level of luciferase protein production was measured
using a luciferase assay kit (Promega). The data are shown as the
relative level of luciferase protein produced in cells transfected
with the modified vector alone in the absence of any RNAi
treatment.
[0270] Experiments were also performed to determine the effect of
overexpression of a PARP-GFP protein on the activity of miRNA using
the modified pGL4.72[hRlucCP].TM.-vector assay described above. In
these experiments, 293T cells were transfected with pEGFP-C1
expression vectors encoding EGFP, G3BP, PARP5A, PARP12, PARP13,
PARP13.1, or PARP15; the modified pGL4.72[hRlucCP].TM. vector, and
10 nM vector-targeting RNAi. As a positive control for RNAi
activity, the cells were transfected with the modified
pGL4.72[hRlucCP].TM. and the vector-target RNAi alone (CXCR4
sponge).
[0271] From the foregoing description, one skilled in the art can
easily ascertain the essential characteristics of this invention;
can make various changes and modifications of the invention to
adapt it to various usages and conditions.
Sequence CWU 1
1
13613048DNAHomo sapiens 1aggatggcgg agtcttcgga taagctctat
cgagtcgagt acgccaagag cgggcgcgcc 60tcttgcaaga aatgcagcga gagcatcccc
aaggactcgc tccggatggc catcatggtg 120cagtcgccca tgtttgatgg
aaaagtccca cactggtacc acttctcctg cttctggaag 180gtgggccact
ccatccggca ccctgacgtt gaggtggatg ggttctctga gcttcggtgg
240gatgaccagc agaaagtcaa gaagacagcg gaagctggag gagtgacagg
caaaggccag 300gatggaattg gtagcaaggc agagaagact ctgggtgact
ttgcagcaga gtatgccaag 360tccaacagaa gtacgtgcaa ggggtgtatg
gagaagatag aaaagggcca ggtgcgcctg 420tccaagaaga tggtggaccc
ggagaagcca cagctaggca tgattgaccg ctggtaccat 480ccaggctgct
ttgtcaagaa cagggaggag ctgggtttcc ggcccgagta cagtgcgagt
540cagctcaagg gcttcagcct ccttgctaca gaggataaag aagccctgaa
gaagcagctc 600ccaggagtca agagtgaagg aaagagaaaa ggcgatgagg
tggatggagt ggatgaagtg 660gcgaagaaga aatctaaaaa agaaaaagac
aaggatagta agcttgaaaa agccctaaag 720gctcagaacg acctgatctg
gaacatcaag gacgagctaa agaaagtgtg ttcaactaat 780gacctgaagg
agctactcat cttcaacaag cagcaagtgc cttctgggga gtcggcgatc
840ttggaccgag tagctgatgg catggtgttc ggtgccctcc ttccctgcga
ggaatgctcg 900ggtcagctgg tcttcaagag cgatgcctat tactgcactg
gggacgtcac tgcctggacc 960aagtgtatgg tcaagacaca gacacccaac
cggaaggagt gggtaacccc aaaggaattc 1020cgagaaatct cttacctcaa
gaaattgaag gttaaaaagc aggaccgtat attcccccca 1080gaaaccagcg
cctccgtggc ggccacgcct ccgccctcca cagcctcggc tcctgctgct
1140gtgaactcct ctgcttcagc agataagcca ttatccaaca tgaagatcct
gactctcggg 1200aagctgtccc ggaacaagga tgaagtgaag gccatgattg
agaaactcgg ggggaagttg 1260acggggacgg ccaacaaggc ttccctgtgc
atcagcacca aaaaggaggt ggaaaagatg 1320aataagaaga tggaggaagt
aaaggaagcc aacatccgag ttgtgtctga ggacttcctc 1380caggacgtct
ccgcctccac caagagcctt caggagttgt tcttagcgca catcttgtcc
1440ccttgggggg cagaggtgaa ggcagagcct gttgaagttg tggccccaag
agggaagtca 1500ggggctgcgc tctccaaaaa aagcaagggc caggtcaagg
aggaaggtat caacaaatct 1560gaaaagagaa tgaaattaac tcttaaagga
ggagcagctg tggatcctga ttctggactg 1620gaacactctg cgcatgtcct
ggagaaaggt gggaaggtct tcagtgccac ccttggcctg 1680gtggacatcg
ttaaaggaac caactcctac tacaagctgc agcttctgga ggacgacaag
1740gaaaacaggt attggatatt caggtcctgg ggccgtgtgg gtacggtgat
cggtagcaac 1800aaactggaac agatgccgtc caaggaggat gccattgagc
agttcatgaa attatatgaa 1860gaaaaaaccg ggaacgcttg gcactccaaa
aatttcacga agtatcccaa aaagttttac 1920cccctggaga ttgactatgg
ccaggatgaa gaggcagtga agaagctcac agtaaatcct 1980ggcaccaagt
ccaagctccc caagccagtt caggacctca tcaagatgat ctttgatgtg
2040gaaagtatga agaaagccat ggtggagtat gagatcgacc ttcagaagat
gcccttgggg 2100aagctgagca aaaggcagat ccaggccgca tactccatcc
tcagtgaggt ccagcaggcg 2160gtgtctcagg gcagcagcga ctctcagatc
ctggatctct caaatcgctt ttacaccctg 2220atcccccacg actttgggat
gaagaagcct ccgctcctga acaatgcaga cagtgtgcag 2280gccaaggtgg
aaatgcttga caacctgctg gacatcgagg tggcctacag tctgctcagg
2340ggagggtctg atgatagcag caaggatccc atcgatgtca actatgagaa
gctcaaaact 2400gacattaagg tggttgacag agattctgaa gaagccgaga
tcatcaggaa gtatgttaag 2460aacactcatg caaccacaca cagtgcgtat
gacttggaag tcatcgatat ctttaagata 2520gagcgtgaag gcgaatgcca
gcgttacaag ccctttaagc agcttcataa ccgaagattg 2580ctgtggcacg
ggtccaggac caccaacttt gctgggatcc tgtcccaggg tcttcggata
2640gccccgcctg aagcgcccgt gacaggctac atgtttggta aagggatcta
tttcgctgac 2700atggtctcca agagtgccaa ctactaccat acgtctcagg
gagacccaat aggcttaatc 2760ctgttgggag aagttgccct tggaaacatg
tatgaactga agcacgcttc acatatcagc 2820aggttaccca agggcaagca
cagtgtcaaa ggtttgggca aaactacccc tgatccttca 2880gctaacatta
gtctggatgg tgtagacgtt cctcttggga ccgggatttc atctggtgtg
2940atagacacct ctctactata taacgagtac attgtctatg atattgctca
ggtaaatctg 3000aagtatctgc tgaaactgaa attcaatttt aagacctccc tgtggtaa
304821089DNAHomo sapiens 2atgctcacag taaatcctgg caccaagtcc
aagctcccca agccagttca ggacctcatc 60aagatgatct ttgatgtgga aagtatgaag
aaagccatgg tggagtatga gatcgacctt 120cagaagatgc ccttggggaa
gctgagcaaa aggcagatcc aggccgcata ctccatcctc 180agtgaggtcc
agcaggcggt gtctcagggc agcagcgact ctcagatcct ggatctctca
240aatcgctttt acaccctgat cccccacgac tttgggatga agaagcctcc
gctcctgaac 300aatgcagaca gtgtgcaggc caaggtggaa atgcttgaca
acctgctgga catcgaggtg 360gcctacagtc tgctcagggg agggtctgat
gatagcagca aggatcccat cgatgtcaac 420tatgagaagc tcaaaactga
cattaaggtg gttgacagag attctgaaga agccgagatc 480atcaggaagt
atgttaagaa cactcatgca accacacaca gtgcgtatga cttggaagtc
540atcgatatct ttaagataga gcgtgaaggc gaatgccagc gttacaagcc
ctttaagcag 600cttatgcata accgaagatt gctgtggcac gggtccagga
ccaccaactt tgctgggatc 660ctgtcccagg gtcttcggat agccccgcct
gaagcgcccg tgacaggcta catgtttggt 720aaagggatct atttcgctga
catggtctcc aagagtgcca actactacca tacgtctcag 780ggagacccaa
taggcttaat cctgttggga gaagttgccc ttggaaacat gtatgaactg
840aagcacgctt cacatatcag caggttaccc aagggcaagc acagtgtcaa
aggtttgggc 900aaaactaccc ctgatccttc agctaacatt agtctggatg
gtgtagacgt tcctcttggg 960accgggattt catctggtgt gatagacacc
tctctactat ataacgagta cattgtctat 1020gatattgctc aggtaaatct
gaagtatctg ctgaaactga aattcaattt taagacctcc 1080ctgtggtaa
108931716DNAHomo sapiens 3gccatggcgg cgcggcggcg acggagcacc
ggcggcggca gggcgagagc attaaatgaa 60agcaaaagag ttaataatgg caacacggct
ccagaagact cttcccctgc caagaaaact 120cgtagatgcc agagacagga
gtcgaaaaag atgcctgtgg ctggaggaaa agctaataag 180gacaggacag
aagacaagca agatgaatct gtgaaggcct tgctgttaaa gggcaaagct
240cctgtggacc cagagtgtac agccaaggtg gggaaggctc atgtgtattg
tgaaggaaat 300gatgtctatg atgtcatgct aaatcagacc aatctccagt
tcaacaacaa caagtactat 360ctgattcagc tattagaaga tgatgcccag
aggaacttca gtgtttggat gagatggggc 420cgagttggga aaatgggaca
gcacagcctg gtggcttgtt caggcaatct caacaaggcc 480aaggaaatct
ttcagaagaa attccttgac aaaacgaaaa acaattggga agatcgagaa
540aagtttgaga aggtgcctgg aaaatatgat atgctacaga tggactatgc
caccaatact 600caggatgaag aggaaacaaa gaaagaggaa tctcttaaat
ctcccttgaa gccagagtca 660cagctagatc ttcgggtaca ggagttaata
aagttgatct gtaatgttca ggccatggaa 720gaaatgatga tggaaatgaa
gtataatacc aagaaagccc cacttgggaa gctgacagtg 780gcacaaatca
aggcaggtta ccagtctctt aagaagattg aggattgtat tcgggctggc
840cagcatggac gagctctcat ggaagcatgc aatgaattct acaccaggat
tccgcatgac 900tttggactcc gtactcctcc actaatccgg acacagaagg
aactgtcaga aaaaatacaa 960ttactagagg ctttgggaga cattgaaatt
gctattaagc tggtgaaaac agagctacaa 1020agcccagaac acccattgga
ccaacactat agaaacctac attgtgcctt gcgccccctt 1080gaccatgaaa
gttatgagtt caaagtgatt tcccagtacc tacaatctac ccatgctccc
1140acacacagcg actataccat gaccttgctg gatttgtttg aagtggagaa
ggatggtgag 1200aaagaagcct tcagagagga ccttcataac aggatgcttc
tatggcatgg ttccaggatg 1260agtaactggg tgggaatctt gagccatggg
cttcgaattg ccccacctga agctcccatc 1320acaggttaca tgtttgggaa
aggaatctac tttgctgaca tgtcttccaa gagtgccaat 1380tactgctttg
cctctcgcct aaagaataca ggactgctgc tcttatcaga ggtagctcta
1440ggtcagtgta atgaactact agaggccaat cctaaggccg aaggattgct
tcaaggtaaa 1500catagcacca aggggctggg caagatggct cccagttctg
cccacttcgt caccctgaat 1560gggagtacag tgccattagg accagcaagt
gacacaggaa ttctgaatcc agatggttat 1620accctcaact acaatgaata
tattgtatat aaccccaacc aggtccgtat gcggtacctt 1680ttaaaggttc
agtttaattt ccttcagctg tggtga 171641605DNAHomo sapiens 4gccatggctc
caaagccgaa gccctgggta cagactgagg gccctgagaa gaagaagggc 60cggcaggcag
gaagggagga ggaccccttc cgctccaccg ctgaggccct caaggccata
120cccgcagaga agcgcataat ccgcgtggat ccaacatgtc cactcagcag
caaccccggg 180acccaggtgt atgaggacta caactgcacc ctgaaccaga
ccaacatcga gaacaacaac 240aacaagttct acatcatcca gctgctccaa
gacagcaacc gcttcttcac ctgctggaac 300cgctggggcc gtgtgggaga
ggtcggccag tcaaagatca accacttcac aaggctagaa 360gatgcaaaga
aggactttga gaagaaattt cgggaaaaga ccaagaacaa ctgggcagag
420cgggaccact ttgtgtctca cccgggcaag tacacactta tcgaagtaca
ggcagaggat 480gaggcccagg aagctgtggt gaaggtggac agaggcccag
tgaggactgt gactaagcgg 540gtgcagccct gctccctgga cccagccacg
cagaagctca tcactaacat cttcagcaag 600gagatgttca agaacaccat
ggccctcatg gacctggatg tgaagaagat gcccctggga 660aagctgagca
agcaacagat tgcacggggt ttcgaggcct tggaggcgct ggaggaggcc
720ctgaaaggcc ccacggatgg tggccaaagc ctggaggagc tgtcctcaca
cttttacacc 780gtcatcccgc acaacttcgg ccacagccag cccccgccca
tcaattcccc tgagcttctg 840caggccaaga aggacatgct gctggtgctg
gcggacatcg agctggccca ggccctgcag 900gcagtctctg agcaggagaa
gacggtggag gaggtgccac accccctgga ccgagactac 960cagcttctca
agtgccagct gcagctgcta gactctggag cacctgagta caaggtgata
1020cagacctact tagaacagac tggcagcaac cacaggtgcc ctacacttca
acacatctgg 1080aaagtaaacc aagaagggga ggaagacaga ttccaggccc
actccaaact gggtaatcgg 1140aagctgctgt ggcatggcac caacatggcc
gtggtggccg ccatcctcac tagtgggctc 1200cgcatcatgc cacattctgg
tgggcgtgtt ggcaagggca tctactttgc ctcagagaac 1260agcaagtcag
ctggatatgt tattggcatg aagtgtgggg cccaccatgt cggctacatg
1320ttcctgggtg aggtggccct gggcagagag caccatatca acacggacaa
ccccagcttg 1380aagagcccac ctcctggctt cgacagtgtc attgcccgag
gccacaccga gcctgatccg 1440acccaggaca ctgagttgga gctggatggc
cagcaagtgg tggtgcccca gggccagcct 1500gtgccctgcc cagagttcag
cagctccaca ttctcccaga gcgagtacct catctaccag 1560gagagccagt
gtcgcctgcg ctacctgctg gaggtccacc tctga 160551602DNAHomo sapiens
5gccatggctc caaagccgaa gccctgggta cagactgagg gccctgagaa gaagggccgg
60caggcaggaa gggaggagga ccccttccgc tccaccgctg aggccctcaa ggccataccc
120gcagagaagc gcataatccg cgtggatcca acatgtccac tcagcagcaa
ccccgggacc 180caggtgtatg aggactacaa ctgcaccctg aaccagacca
acatcgagaa caacaacaac 240aagttctaca tcatccagct gctccaagac
agcaaccgct tcttcacctg ctggaaccgc 300tggggccgtg tgggagaggt
cggccagtca aagatcaacc acttcacaag gctagaagat 360gcaaagaagg
actttgagaa gaaatttcgg gaaaagacca agaacaactg ggcagagcgg
420gaccactttg tgtctcaccc gggcaagtac acacttatcg aagtacaggc
agaggatgag 480gcccaggaag ctgtggtgaa ggtggacaga ggcccagtga
ggactgtgac taagcgggtg 540cagccctgct ccctggaccc agccacgcag
aagctcatca ctaacatctt cagcaaggag 600atgttcaaga acaccatggc
cctcatggac ctggatgtga agaagatgcc cctgggaaag 660ctgagcaagc
aacagattgc acggggtttc gaggccttgg aggcgctgga ggaggccctg
720aaaggcccca cggatggtgg ccaaagcctg gaggagctgt cctcacactt
ttacaccgtc 780atcccgcaca acttcggcca cagccagccc ccgcccatca
attcccctga gcttctgcag 840gccaagaagg acatgctgct ggtgctggcg
gacatcgagc tggcccaggc cctgcaggca 900gtctctgagc aggagaagac
ggtggaggag gtgccacacc ccctggaccg agactaccag 960cttctcaagt
gccagctgca gctgctagac tctggagcac ctgagtacaa ggtgatacag
1020acctacttag aacagactgg cagcaaccac aggtgcccta cacttcaaca
catctggaaa 1080gtaaaccaag aaggggagga agacagattc caggcccact
ccaaactggg taatcggaag 1140ctgctgtggc atggcaccaa catggccgtg
gtggccgcca tcctcactag tgggctccgc 1200atcatgccac attctggtgg
gcgtgttggc aagggcatct actttgcctc agagaacagc 1260aagtcagctg
gatatgttat tggcatgaag tgtggggccc accatgtcgg ctacatgttc
1320ctgggtgagg tggccctggg cagagagcac catatcaaca cggacaaccc
cagcttgaag 1380agcccacctc ctggcttcga cagtgtcatt gcccgaggcc
acaccgagcc tgatccgacc 1440caggacactg agttggagct ggatggccag
caagtggtgg tgccccaggg ccagcctgtg 1500ccctgcccag agttcagcag
ctccacattc tcccagagcg agtacctcat ctaccaggag 1560agccagtgtc
gcctgcgcta cctgctggag gtccacctct ga 160261602DNAHomo sapiens
6gccatggctc caaagccgaa gccctgggta cagactgagg gccctgagaa gaagggccgg
60caggcaggaa gggaggagga ccccttccgc tccaccgctg aggccctcaa ggccataccc
120gcagagaagc gcataatccg cgtggatcca acatgtccac tcagcagcaa
ccccgggacc 180caggtgtatg aggactacaa ctgcaccctg aaccagacca
acatcgagaa caacaacaac 240aagttctaca tcatccagct gctccaagac
agcaaccgct tcttcacctg ctggaaccgc 300tggggccgtg tgggagaggt
cggccagtca aagatcaacc acttcacaag gctagaagat 360gcaaagaagg
actttgagaa gaaatttcgg gaaaagacca agaacaactg ggcagagcgg
420gaccactttg tgtctcaccc gggcaagtac acacttatcg aagtacaggc
agaggatgag 480gcccaggaag ctgtggtgaa ggtggacaga ggcccagtga
ggactgtgac taagcgggtg 540cagccctgct ccctggaccc agccacgcag
aagctcatca ctaacatctt cagcaaggag 600atgttcaaga acaccatggc
cctcatggac ctggatgtga agaagatgcc cctgggaaag 660ctgagcaagc
aacagattgc acggggtttc gaggccttgg aggcgctgga ggaggccctg
720aaaggcccca cggatggtgg ccaaagcctg gaggagctgt cctcacactt
ttacaccgtc 780atcccgcaca acttcggcca cagccagccc ccgcccatca
attcccctga gcttctgcag 840gccaagaagg acatgctgct ggtgctggcg
gacatcgagc tggcccaggc cctgcaggca 900gtctctgagc aggagaagac
ggtggaggag gtgccacacc ccctggaccg agactaccag 960cttctcaagt
gccagctgca gctgctagac tctggagcac ctgagtacaa ggtgatacag
1020acctacttag aacagactgg cagcaaccac aggtgcccta cacttcaaca
catctggaaa 1080gtaaaccaag aaggggagga agacagattc caggcccact
ccaaactggg taatcggaag 1140ctgctgtggc atggcaccaa catggccgtg
gtggccgcca tcctcactag tgggctccgc 1200atcatgccac attctggtgg
gcgtgttggc aagggcatct actttgcctc agagaacagc 1260aagtcagctg
gatatgttat tggcatgaag tgtggggccc accatgtcgg ctacatgttc
1320ctgggtgagg tggccctggg cagagagcac catatcaaca cggacaaccc
cagcttgaag 1380agcccacctc ctggcttcga cagtgtcatt gcccgaggcc
acaccgagcc tgatccgacc 1440caggacactg agttggagct ggatggccag
caagtggtgg tgccccaggg ccagcctgtg 1500ccctgcccag agttcagcag
ctccacattc tcccagagcg agtacctcat ctaccaggag 1560agccagtgtc
gcctgcgcta cctgctggag gtccacctct ga 160275178DNAHomo sapiens
7aggatggtga tgggaatctt tgcaaattgt atcttctgtt tgaaagtgaa gtacttacct
60cagcagcaga agaaaaagct acaaactgac attaaggaaa atggcggaaa gttttccttt
120tcgttaaatc ctcagtgcac acatataatc ttagataatg ctgatgttct
gagtcagtac 180caactgaatt ctatccaaaa gaaccacgtt catattgcaa
acccagattt tatatggaaa 240tctatcagag aaaagagact cttggatgta
aagaattatg atccttataa gcccctggac 300atcacaccac ctcctgatca
gaaggcgagc agttctgaag tgaaaacaga aggtctatgc 360ccggacagtg
ccacagagga ggaagacact gtggaactca ctgagtttgg tatgcagaat
420gttgaaattc ctcatcttcc tcaagatttt gaagttgcaa aatataacac
cttggagaaa 480gtgggaatgg agggaggcca ggaagctgtg gtggtggagc
ttcagtgttc gcgggactcc 540agggactgtc ctttcctgat atcctcacac
ttcctcctgg atgatggcat ggagactaga 600agacagtttg ctataaagaa
aacctctgaa gatgcaagtg aatactttga aaattacatt 660gaagaactga
agaaacaagg atttctacta agagaacatt tcacacctga agcaacccaa
720ttagcatctg aacaattgca agcattgctt ttggaggaag tcatgaattc
aagcactctg 780agccaagagg tgagcgattt agtagagatg atttgggcag
aggccctggg ccacctggaa 840cacatgcttc tcaagccagt gaacaggatt
agcctcaacg atgtgagcaa ggcagagggg 900attctccttc tagtaaaggc
agcactgaaa aatggagaaa cagcagagca attgcaaaag 960atgatgacag
agttttacag actgatacct cacaaaggca caatgcccaa agaagtgaac
1020ctgggactat tggctaagaa agcagacctc tgccagctaa taagagacat
ggttaatgtc 1080tgtgaaacta atttgtccaa acccaaccca ccatccctgg
ccaaataccg agctttgagg 1140tgcaaaattg agcatgttga acagaatact
gaagaatttc tcagggttag aaaagaggtt 1200ttgcagaatc atcacagtaa
gagcccagtg gatgtcttgc agatatttag agttggcaga 1260gtgaatgaaa
ccacagagtt tttgagcaaa cttggtaatg tgaggccctt gttgcatggt
1320tctcctgtac aaaacatcgt gggaatcttg tgtcgagggt tgcttttacc
caaagtagtg 1380gaagatcgtg gtgtgcaaag aacagacgtc ggaaaccttg
gaagtgggat ttatttcagt 1440gattcgctca gtacaagtat caagtactca
cacccgggag agacagatgg caccagactc 1500ctgctcattt gtgacgtagc
cctcggaaag tgtatggact tacatgagaa ggactttccc 1560ttaactgaag
caccaccagg ctacgacagt gtgcatggag tttcacaaac agcctctgtc
1620accacagact ttgaggatga tgaatttgtt gtctataaaa ccaatcaggt
taaaatgaaa 1680tatattatta aattttccat gcctggagat cagataaagg
actttcatcc tagtgatcat 1740actgaattag aggaatacag acctgagttt
tcaaattttt caaaggttga agattaccag 1800ttaccagatg ccaaaacttc
cagcagcacc aaggccggcc tccaggatgc ctctgggaac 1860ttggttcctc
tggaggatgt ccacatcaaa gggagaatca tagacactgt agcccaggtc
1920attgtttttc agacatacac aaataaaagt cacgtgccca ttgaggcaaa
atatatcttt 1980cctttggatg acaaggccgc tgtgtgtggc ttcgaagcct
tcatcaatgg gaagcacata 2040gttggagaga ttaaagagaa ggaagaagcc
cagcaagagt acctagaagc cgtgacccag 2100ggccatggcg cttacctgat
gagtcaggat gctccggacg tttttactgt aagtgttgga 2160aacttacccc
ctaaggctaa ggttcttata aaaattacct acatcacaga actcagcatc
2220ctgggcactg ttggtgtctt tttcatgccc gccaccgtag caccctggca
acaggacaag 2280gctttgaatg aaaaccttca ggatacagta gagaagattt
gtataaaaga aataggaaca 2340aagcaaagct tctctttgac tatgtctatt
gagatgccgt atgtgattga attcattttc 2400agtgatacac atgaactgaa
acaaaagcgc acagactgca aagctgtcat tagcaccatg 2460gaaggcagct
ccttagacag cagtggattt tctctccaca tcggtttgtc tgctgcctat
2520ctcccaagaa tgtgggttga aaaacatcca gaaaaagaaa gcgaggcttg
catgcttgtc 2580tttcaacccg atctcgatgt cgacctccct gacctagcca
gtgagagcga agtgattatt 2640tgtcttgact gctccagttc catggagggt
gtgacattct tgcaagccaa gcaaatcacc 2700ttgcatgcgc tgtccttggt
gggtgagaag cagaaagtaa atattatcca gttcggcaca 2760ggttacaagg
agctattttc gtatcctaag catatcacaa gcaataccac ggcagcagag
2820ttcatcatgt ctgccacacc taccatgggg aacacagact tctggaaaac
actccgatat 2880cttagcttat tgtaccctgc tcgagggtca cggaacatcc
tcctggtgtc tgatgggcac 2940ctccaggatg agagcctgac attacagctc
gtgaagagga gccgcccgca caccaggtta 3000ttcgcctgcg gtatcggttc
tacagcaaat cgtcacgtct taaggatttt gtcccagtgt 3060ggtgccggag
tatttgaata ttttaatgca aaatccaagc atagttggag aaaacagata
3120gaagaccaaa tgaccaggct atgttctccg agttgccact ctgtctccgt
caaatggcag 3180caactcaatc cagatgcgcc cgaggccctg caggccccag
cccaggtgcc atccttgttt 3240cgcaatgatc gactccttgt ctatggattc
attcctcact gcacacaagc aactctgtgt 3300gcactaattc aagagaaaga
attttgtaca atggtgtcga ctactgagct tcagaagaca 3360actggaacta
tgatccacaa gctggcagcc cgagctctaa tcagagatta tgaagatggc
3420attcttcacg aaaatgaaac cagtcatgag atgaaaaaac aaaccttgaa
atctctgatt 3480attaaactca gtaaagaaaa ctctctcata acacaattta
caagctttgt ggcagttgag 3540aaaagggatg agaatgagtc gccttttcct
gatattccaa aagtttctga acttattgcc 3600aaagaagatg tagacttcct
gccctacatg agctggcagg gggagcccca agaagccgtc 3660aggaaccagt
ctcttttagc atcctctgag tggccagaat tacgtttatc caaacgaaaa
3720cataggaaaa ttccattttc caaaagaaaa atggaattat ctcagccaga
agtttctgaa 3780gattttgaag aggatggctt aggtgtacta ccagctttca
catcaaattt ggaacgtgga 3840ggtgtggaaa agctattgga tttaagttgg
acagagtcat gtaaaccaac agcaactgaa 3900ccactattta agaaagtcag
tccatgggaa acatctactt ctagcttttt tcctattttg 3960gctccggccg
ttggttccta tcttaccccg actacccgcg ctcacagtcc tgcttccttg
4020tcttttgcct catatcgtca ggtagctagt ttcggttcag ctgctcctcc
cagacagttt 4080gatgcatctc aattcagcca aggccctgtg cctggcactt
gtgctgactg gatcccacag 4140tcggcgtctt gtcccacagg acctccccag
aacccacctt ctgcacccta ttgtggcatt 4200gttttttcag ggagctcatt
aagctctgca cagtctgctc cactgcaaca tcctggaggc 4260tttactacca
ggccttctgc tggcaccttc cctgagctgg attctcccca gcttcatttc
4320tctcttccta cagaccctga tcccatcaga ggttttgggt cttatcatcc
ctctgcttac 4380tctccttttc attttcaacc ttccgcagcc tctttgactg
ccaaccttag gctgccaatg 4440gcctctgctt tacctgaggc tctttgcagt
cagtcccgga ctaccccagt agatctctgt 4500cttctagaag aatcagtagg
cagtctcgaa ggaagtcgat gtcctgtctt tgcttttcaa 4560agttctgaca
cagaaagtga tgagctatca gaagtacttc aagacagctg ctttttacaa
4620ataaagtgtg atacaaaaga tgacagtatc ccgtgctttc tggaattaaa
agaagaggat 4680gaaatagtgt gcacacaaca ctggcaggat gctgtgcctt
ggacagaact cctcagtcta 4740cagacagagg atggcttctg gaaacttaca
ccagaactgg gacttatatt aaatcttaat 4800acaaatggtt tgcacagctt
tcttaaacaa aaaggcattc aatctctagg tgtaaaagga 4860agagaatgtc
tcctggacct aattgccaca atgctggtac tacagtttat tcgcaccagg
4920ttggaaaaag agggaatagt gttcaaatca ctgatgaaaa tggatgaccc
ttctatttcc 4980aggaatattc cctgggcttt tgaggcaata aagcaagcaa
gtgaatgggt aagaagaact 5040gaaggacagt acccatctat ctgcccacgg
cttgaactgg ggaacgactg ggactctgcc 5100accaagcagt tgctgggact
ccagcccata agcactgtgt cccctcttca tagagtcctc 5160cattacagtc aaggctaa
517883987DNAHomo sapiens 8aagatggcgg cgtcgcgtcg ctctcagcat
catcaccacc atcatcaaca acagctccag 60cccgccccag gggcttcagc gccgccgccg
ccacctcctc ccccactcag ccctggcctg 120gccccgggga ccaccccagc
ctctcccacg gccagcggcc tggccccctt cgcctccccg 180cggcacggcc
tagcgctgcc ggagggggat ggcagtcggg atccgcccga caggccccga
240tccccggacc cggttgacgg taccagctgt tgcagtacca ccagcacaat
ctgtaccgtc 300gccgccgctc ccgtggtccc agcggtttct acttcatctg
ccgctggggt cgctcccaac 360ccagccggca gtggcagtaa caattcaccg
tcgtcctctt cttccccgac ttcttcctca 420tcttcctctc catcctcccc
tggatcgagc ttggcggaga gccccgaggc ggccggagtt 480agcagcacag
caccactggg gcctggggca gcaggacctg ggacaggggt cccagcagtg
540agcggggccc tacgggaact gctggaggcc tgtcgcaatg gggacgtgtc
ccgggtaaag 600aggctggtgg acgcggcaaa cgtaaatgca aaggacatgg
ccggccggaa gtcttctccc 660ctgcacttcg ctgcaggttt tggaaggaag
gatgttgtag aacacttact acagatgggt 720gctaatgtcc acgctcgtga
tgatggaggt ctcatcccgc ttcataatgc ctgttctttt 780ggccatgctg
aggttgtgag tctgttattg tgccaaggag ctgatccaaa tgccagggat
840aactggaact atacacctct gcatgaagct gctattaaag ggaagatcga
tgtgtgcatt 900gtgctgctgc agcacggagc tgacccaaac attcggaaca
ctgatgggaa atcagccctg 960gacctggcag atccttcagc aaaagctgtc
cttacaggtg aatacaagaa agacgaactc 1020ctagaagctg ctaggagtgg
taatgaagaa aaactaatgg ctttactgac tcctctaaat 1080gtgaattgcc
atgcaagtga tgggcgaaag tcgactcctt tacatctagc agcgggctac
1140aacagagttc gaatagttca gcttcttctt cagcatggtg ctgatgttca
tgcaaaagac 1200aaaggtggac ttgtgcctct tcataatgca tgttcatatg
gacattatga agtcacagaa 1260ctgctactaa agcatggagc ttgtgttaat
gccatggatc tctggcagtt tactccactg 1320cacgaggctg cttccaagaa
ccgtgtagaa gtctgctctt tgttacttag ccatggcgct 1380gatcctacgt
tagtcaactg ccatggcaaa agtgctgtgg atatggctcc aactccggag
1440cttagggaga gattgactta tgaatttaaa ggtcattctt tactacaagc
agccagagaa 1500gcagacttag ctaaagttaa aaaaacactc gctctggaaa
tcattaattt caaacaaccg 1560cagtctcatg aaacagcact gcactgtgct
gtggcctctc tgcatcccaa acgtaaacaa 1620gtgacagaat tgttacttag
aaaaggagca aatgttaatg aaaaaaataa agatttcatg 1680actcccctgc
atgttgcagc cgaaagagcc cataatgatg tcatggaagt tctgcataag
1740catggcgcca agatgaatgc actggacacc cttggtcaga ctgctttgca
tagagccgcc 1800ctagcaggcc acctgcagac ctgccgcctc ctgctgagtt
acggctctga cccctccatc 1860atctccttac aaggcttcac agcagcacag
atgggcaatg aagcagtgca gcagattctg 1920agtgagagta cacctatacg
tacttctgat gttgattatc gactcttaga ggcatctaaa 1980gctggagact
tggaaactgt gaagcaactt tgcagctctc aaaatgtgaa ttgtagagac
2040ttagagggcc ggcattccac gcccttacac ttcgcagcag gctacaaccg
cgtgtctgtt 2100gtagagtacc tgctacacca cggtgccgat gtccatgcca
aagacaaggg tggcttggtg 2160ccccttcata atgcctgttc atatggacac
tatgaggtgg ctgagctttt agtaaggcat 2220ggggcttctg tcaatgtggc
ggacttatgg aaatttaccc ctctccatga agcagcagct 2280aaaggaaagt
atgaaatctg caagctcctt ttaaaacatg gagcagatcc aactaaaaag
2340aacagagatg gaaatacacc tttggatttg gtaaaggaag gagacacaga
tattcaggac 2400ttactgaaag gggatgctgc tttgttggat gctgccaaga
agggctgcct ggcaagagtg 2460cagaagctct gtaccccaga gaatatcaac
tgcagagaca cccagggcag aaattcaacc 2520cctctgcacc tggcagcagg
ctataataac ctggaagtag ctgaatatct tctagagcat 2580ggagctgatg
ttaatgccca ggacaagggt ggtttaattc ctcttcataa tgcggcatct
2640tatgggcatg ttgacatagc ggctttattg ataaaataca acacgtgtgt
aaatgcaaca 2700gataagtggg cgtttactcc cctccatgaa gcagcccaga
aaggaaggac gcagctgtgc 2760gccctcctcc tagcgcatgg tgcagacccc
accatgaaga accaggaagg ccagacgcct 2820ctggatctgg caacagctga
cgatatcaga gctttgctga tagatgccat gcccccagag 2880gccttaccta
cctgttttaa acctcaggct actgtagtga gtgcctctct gatctcacca
2940gcatccaccc cctcctgcct ctcggctgcc agcagcatag acaacctcac
tggcccttta 3000gcagagttgg ccgtaggagg agcctccaat gcaggggatg
gcgccgcggg aacagaaagg 3060aaggaaggag aagttgctgg tcttgacatg
aatatcagcc aatttctaaa aagccttggc 3120cttgaacacc ttcgggatat
ctttgaaaca gaacagatta cactagatgt gttggctgat 3180atgggtcatg
aagagttgaa agaaataggc atcaatgcat atgggcaccg ccacaaatta
3240atcaaaggag tagaaagact cttaggtgga caacaaggca ccaatcctta
tttgactttt 3300cactgtgtta atcagggaac gattttgctg gatcttgctc
cagaagataa agaatatcag 3360tcagtggaag aagagatgca aagtactatt
cgagaacaca gagatggtgg taatgctggc 3420ggcatcttca acagatacaa
tgtcattcga attcaaaaag ttgtcaacaa gaagttgagg 3480gagcggttct
gccaccgaca gaaggaagtg tctgaggaga atcacaacca tcacaatgag
3540cgcatgttgt ttcatggttc tcctttcatt aatgccatta ttcataaagg
gtttgatgag 3600cgacatgcat acataggagg aatgtttggg gccgggattt
attttgctga aaactcctca 3660aaaagcaacc aatatgttta tggaattgga
ggaggaacag gctgccctac acacaaggac 3720aggtcatgct atatatgtca
cagacaaatg ctcttctgta gagtgaccct tgggaaatcc 3780tttctgcagt
ttagcaccat gaaaatggcc cacgcgcctc cagggcacca ctcagtcatt
3840ggtagaccga gcgtcaatgg gctggcatat gctgaatatg tcatctacag
aggagaacag 3900gcatacccag agtatcttat cacttaccag atcatgaagc
cagaagcccc ttcccagacc 3960gcaacagccg cagagcagaa gacctag
39879729DNAHomo sapiens 9atgttaggtg gacaacaagg caccaatcct
tatttgactt ttcactgtgt taatcaggga 60acgattttgc tggatcttgc tccagaagat
aaagaatatc agtcagtgga agaagagatg 120caaagtacta ttcgagaaca
cagagatggt ggtaatgctg gcggcatctt caacagatac 180aatgtcattc
gaattcaaaa agttgtcaac aagaagttga gggagcggtt ctgccaccga
240cagaaggaag tgtctgagga gaatcacaac catcacaatg agcgcatgtt
gtttcatggt 300tctcctttca ttaatgccat tattcataaa gggtttgatg
agcgacatgc atacatagga 360ggaatgtttg gggccgggat ttattttgct
gaaaactcct caaaaagcaa ccaatatgtt 420tatggaattg gaggaggaac
aggctgccct acacacaagg acaggtcatg ctatatatgt 480cacagacaaa
tgctcttctg tagagtgacc cttgggaaat cctttctgca gtttagcacc
540atgaaaatgg cccacgcgcc tccagggcac cactcagtca ttggtagacc
gagcgtcaat 600gggctggcat atgctgaata tgtcatctac agaggagaac
aggcataccc agagtatctt 660atcacttacc agatcatgaa gccagaagcc
ccttcccaga ccgcaacagc cgcagagcag 720aagacctag 729103504DNAHomo
sapiens 10atcatgtcgg gtcgccgctg cgccggcggg ggagcggcct gcgcgagcgc
cgcggccgag 60gccgtggagc cggccgcccg agagctgttc gaggcgtgcc gcaacgggga
cgtggaacga 120gtcaagaggc tggtgacgcc tgagaaggtg aacagccgcg
acacggcggg caggaaatcc 180accccgctgc acttcgccgc aggttttggg
cggaaagacg tagttgaata tttgcttcag 240aatggtgcaa atgtccaagc
acgtgatgat gggggcctta ttcctcttca taatgcatgc 300tcttttggtc
atgctgaagt agtcaatctc cttttgcgac atggtgcaga ccccaatgct
360cgagataatt ggaattatac tcctctccat gaagctgcaa ttaaaggaaa
gattgatgtt 420tgcattgtgc tgttacagca tggagctgag ccaaccatcc
gaaatacaga tggaaggaca 480gcattggatt tagcagatcc atctgccaaa
gcagtgctta ctggtgaata taagaaagat 540gaactcttag aaagtgccag
gagtggcaat gaagaaaaaa tgatggctct actcacacca 600ttaaatgtca
actgccacgc aagtgatggc agaaagtcaa ctccattaca tttggcagca
660ggatataaca gagtaaagat tgtacagctg ttactgcaac atggagctga
tgtccatgct 720aaagataaag gtgatctggt accattacac aatgcctgtt
cttatggtca ttatgaagta 780actgaacttt tggtcaagca tggtgcctgt
gtaaatgcaa tggacttgtg gcaattcact 840cctcttcatg aggcagcttc
taagaacagg gttgaagtat gttctcttct cttaagttat 900ggtgcagacc
caacactgct caattgtcac aataaaagtg ctatagactt ggctcccaca
960ccacagttaa aagaaagatt agcatatgaa tttaaaggcc actcgttgct
gcaagctgca 1020cgagaagctg atgttactcg aatcaaaaaa catctctctc
tggaaatggt gaatttcaag 1080catcctcaaa cacatgaaac agcattgcat
tgtgctgctg catctccata tcccaaaaga 1140aagcaaatat gtgaactgtt
gctaagaaaa ggagcaaaca tcaatgaaaa gactaaagaa 1200ttcttgactc
ctctgcacgt ggcatctgag aaagctcata atgatgttgt tgaagtagtg
1260gtgaaacatg aagcaaaggt taatgctctg gataatcttg gtcagacttc
tctacacaga 1320gctgcatatt gtggtcatct acaaacctgc cgcctactcc
tgagctatgg gtgtgatcct 1380aacattatat cccttcaggg ctttactgct
ttacagatgg gaaatgaaaa tgtacagcaa 1440ctcctccaag agggtatctc
attaggtaat tcagaggcag acagacaatt gctggaagct 1500gcaaaggctg
gagatgtcga aactgtaaaa aaactgtgta ctgttcagag tgtcaactgc
1560agagacattg aagggcgtca gtctacacca cttcattttg cagctgggta
taacagagtg 1620tccgtggtgg aatatctgct acagcatgga gctgatgtgc
atgctaaaga taaaggaggc 1680cttgtacctt tgcacaatgc atgttcttat
ggacattatg aagttgcaga acttcttgtt 1740aaacatggag cagtagttaa
tgtagctgat ttatggaaat ttacaccttt acatgaagca 1800gcagcaaaag
gaaaatatga aatttgcaaa cttctgctcc agcatggtgc agaccctaca
1860aaaaaaaaca gggatggaaa tactcctttg gatcttgtta aagatggaga
tacagatatt 1920caagatctgc ttaggggaga tgcagctttg ctagatgctg
ccaagaaggg ttgtttagcc 1980agagtgaaga agttgtcttc tcctgataat
gtaaattgcc gcgataccca aggcagacat 2040tcaacacctt tacatttagc
agctggttat aataatttag aagttgcaga gtatttgtta 2100caacacggag
ctgatgtgaa tgcccaagac aaaggaggac ttattccttt acataatgca
2160gcatcttacg ggcatgtaga tgtagcagct ctactaataa agtataatgc
atgtgtcaat 2220gccacggaca aatgggcttt cacacctttg cacgaagcag
cccaaaaggg acgaacacag 2280ctttgtgctt tgttgctagc ccatggagct
gacccgactc ttaaaaatca ggaaggacaa 2340acacctttag atttagtttc
agcagatgat gtcagcgctc ttctgacagc agccatgccc 2400ccatctgctc
tgccctcttg ttacaagcct caagtgctca atggtgtgag aagcccagga
2460gccactgcag atgctctctc ttcaggtcca tctagcccat caagcctttc
tgcagccagc 2520agtcttgaca acttatctgg gagtttttca gaactgtctt
cagtagttag ttcaagtgga 2580acagagggtg cttccagttt ggagaaaaag
gaggttccag gagtagattt tagcataact 2640caattcgtaa ggaatcttgg
acttgagcac ctaatggata tatttgagag agaacagatc 2700actttggatg
tattagttga gatggggcac aaggagctga aggagattgg aatcaatgct
2760tatggacata ggcacaaact aattaaagga gtcgagagac ttatctccgg
acaacaaggt 2820cttaacccat atttaacttt gaacacctct ggtagtggaa
caattcttat agatctgtct 2880cctgatgata aagagtttca gtctgtggag
gaagagatgc aaagtacagt tcgagagcac 2940agagatggag gtcatgcagg
tggaatcttc aacagataca atattctcaa gattcagaag 3000gtttgtaaca
agaaactatg ggaaagatac actcaccgga gaaaagaagt ttctgaagaa
3060aaccacaacc atgccaatga acgaatgcta tttcatgggt ctccttttgt
gaatgcaatt 3120atccacaaag gctttgatga aaggcatgcg tacataggtg
gtatgtttgg agctggcatt 3180tattttgctg aaaactcttc caaaagcaat
caatatgtat atggaattgg aggaggtact 3240gggtgtccag ttcacaaaga
cagatcttgt tacatttgcc acaggcagct gctcttttgc 3300cgggtaacct
tgggaaagtc tttcctgcag ttcagtgcaa tgaaaatggc acattctcct
3360ccaggtcatc actcagtcac tggtaggccc agtgtaaatg gcctagcatt
agctgaatat 3420gttatttaca gaggagaaca ggcttatcct gagtatttaa
ttacttacca gattatgagg 3480cctgaaggta tggtcgatgg ataa
3504111563DNAHomo sapiens 11ccaatggaca tcaaaggcca gttctggaat
gatgacgact cggagggaga taatgaatca 60gaggaatttc tctatggcgt tcaggggaac
tgtgcagccg acctgtatcg acacccacag 120cttgatgcag acattgaagc
cgtgaaggag atctacagtg agaactctgt atccatcaga 180gaatatggaa
ctatcgatga cgtggacatt gacctccaca tcaacatcag cttcctcgat
240gaggaagtct ctacagcctg gaaggtcctc cggacagaac ctattgtgtt
gaggctgcga 300ttttctctct cccagtacct agatggacca gaaccatcca
ttgaggtttt ccagccatca 360aataaggaag gatttgggct gggtcttcag
ttgaaaaaga tcctgggtat gtttacatcc 420caacaatgga aacatctgag
caatgatttc ttgaagaccc agcaggagaa gaggcacagt 480tggttcaagg
caagtggtac catcaagaag ttccgagctg gcctcagcat cttttcaccc
540atccccaagt ctcccagttt ccctatcata caggactcca tgctgaaagg
caaactaggt 600gtaccagagc ttcgggttgg gcgcctcatg aaccgttcca
tctcctgtac catgaagaac 660cccaaagtgg aagtgtttgg ctaccctccc
agcccccagg caggtctcct gtgccctcag 720cacgtgggcc tccctccccc
agcacggacc tctcctttgg tcagtggtca ctgcaagaac 780attcccactc
tggagtatgg attcctcgtt cagatcatga agtatgcaga acagaggatt
840ccaacattga atgagtactg tgtggtgtgt gatgagcagc atgtcttcca
aaatggatct 900atgctgaagc cagctgtctg tactcgtgaa ctatgcgttt
tctccttcta cacactgggc 960gtcatgtctg gagctgcaga ggaggtggcc
actggagcag aggtggtgga tctgctggtg 1020gccatgtgta gggcagcttt
agagtcccct agaaagagca tcatctttga gccttatccc 1080tctgtggtgg
accccactga tcccaagact ctggccttta accctaagaa gaagaattat
1140gagcggcttc agaaagctct ggatagtgtg atgtctattc gggagatgac
ccagggctca 1200tatttggaaa tcaagaaaca gatggacaag ttggatcccc
tggcccatcc tctcctgcag 1260tggatcatct ctagcaacag gtcacacatt
gtcaaactac ctctcagcag gcagctgaag 1320ttcatgcaca cctcacacca
gttcctcctg ctgagcagcc ctcctgccaa ggaggctcgg 1380ttccggaccg
ccaagaagct ctatggcagc acctttgcct tccatgggtc ccacattgag
1440aactggcatt cgatcctgcg caatgggctg gtcaatgcat cctacaccaa
actgcaggaa 1500tgggaaaagg acagcacagg atgccctcca aggatgagct
ggtccagaga tacaacagga 1560tga 1563121977DNAHomo sapiens
12attatggaaa tggaaaccac cgaacctgag ccagactgtg tagtgcagcc tccctctcct
60cctgatgact tttcatgcca aatgagactc tctgagaaga tcactccatt gaagacttgt
120tttaagaaaa aggatcagaa aagattggga actggaaccc tgaggtcttt
gaggccaata 180ttaaacactc ttctagaatc tggctcactt gatggggttt
ttagatctag gaaccagagt 240acagatgaga acagcttaca tgaacctatg
atgaagaaag ccatggaaat caattcatca 300tgcccaccag cagaaaataa
tatgtctgtt ctgattcctg ataggacaaa tgttggggac 360cagataccgg
aagcccatcc ttccactgaa gctccagaac gagtggttcc aatccaagat
420cacagctttc catcagaaac cctcagtggg acggtggcag attccacacc
agctcacttc 480cagactgatc ttttgcaccc agtttcaagt gatgttccta
ctagtcctga ctgcttagac 540aaagtcatag attatgttcc aggcattttc
caagaaaaca gttttacaat ccaatacatt 600ctggacacca gtgataagct
gagtactgag ctctttcagg acaaaagtga agaggcttcc 660cttgacctcg
tgtttgagct ggtgaaccag ttgcagtacc acactcacca agagaacgga
720attgaaattt gcatggactt tctgcaaggc acttgtattt atggcaggga
ttgtttgaag 780caccacactg tcttgccata tcattggcag atcaaaagga
caactactca aaagtggcag 840agtgtattca atgattctca ggagcacttg
gaaagatttt actgtaaccc agaaaatgat 900agaatgagaa tgaagtatgg
aggacaagaa ttttgggcag atttgaatgc catgaacgtg 960tatgaaacaa
ctgaatttga ccaactacga aggctgtcca caccaccctc tagcaatgtc
1020aactctattt accacacagt ctggaaattc ttctgtaggg accactttgg
atggagagag 1080tatcccgagt ctgtcattcg attgattgaa gaagccaact
ctcggggtct gaaagaggtt 1140cgatttatga tgtggaataa ccactacatc
ctccacaatt cattcttcag gagagagata 1200aaaaggagac ccctcttccg
ctcctgtttt atactgcttc catatttaca gacacttggt 1260ggggttccca
cacaagctcc tccacctctt gaagcaactt catcatcaca aattatctgc
1320ccagatgggg tcacttcagc aaacttttac cctgaaactt gggtttatat
gcatccatct 1380caggacttca tccaagtccc tgtttctgca gaggataaaa
gttatcggat catttacaat 1440ctttttcata agactgtgcc tgagtttaaa
tacagaattt tgcagatatt gagagtccaa 1500aaccagtttc tttgggagaa
atataaaagg aaaaaggaat atatgaacag gaaaatgttt 1560ggccgtgaca
ggataataaa tgagagacat ttatttcatg gaacatccca ggatgtggta
1620gatggaatct gcaaacacaa ctttgaccct cgagtctgtg gaaagcatgc
tacaatgttt 1680ggacaaggca gttattttgc aaagaaggca agctactctc
ataacttttc taagaagtcc 1740tccaaaggag tccacttcat gtttctggcc
aaagtgctga cgggcagata cacaatgggc 1800agtcatggca tgagaaggcc
cccgccagtc aatcctggca gtgtcaccag tgacctttat 1860gactcttgtg
tggataattt ctttgagcct cagatttttg tcatttttaa tgatgaccag
1920agttaccctt attttgttat ccaatatgaa gaagtcagta acactgtttc catttga
1977132568DNAHomo sapiens 13ttaatgggga tgtgttcaag gcaagagcga
attcagaagg atatcgacgt cgtgatccag 60aagtccagag ctgagaagga ctgcctgttt
gcagatttca gatactctga ctccaccttt 120acttttacct acgttggcgg
ccccagaagt gtatcctact cagtacatgt atctgaagat 180tacccagata
atacatatgt gtcaagttca gagaatgatg aagatgtgct agttactaca
240gagccaatac cagtaatttt tcatagaata gcaacagaat taagaaaaac
aaatgacatt 300aactgttgct tatccataaa atccaaatta caaaaggaaa
atggggagga atcaagacag 360aatagtacag tggaggaaga ttctgaaggt
gacaatgatt ccgaagaatt ttattacgga 420ggacaggtga actatgatgg
ggaactgcac aagcacccac aactggaagc tgatttgtca 480gcagttagag
agatatatgg gccacatgca gtttctctca gggaatatgg agccattgat
540gatgtagata ttgatctgca tatcgatgtt agctttcttg atgaggagat
tgctgtggct 600tgggaagtaa ttcgaacaga acctataatt gttcgactac
actgttcact tacacagtat 660ttaaatggcc cagtgcccac tgttgatgtc
tttcagattt ccacaaaaga gcgatttgga 720ttgggacatc agctgaaaaa
aatcatgcag acatttgtta cacagcagtg gaaacagagc 780aaagaaaaat
ccaattgcct gcacaataaa aagttgtcag agaagaaagt gaagtctccc
840ctgcatttat tttctacttt gcgcaggtcg ccaagttatc ctccccctgg
ttgtggcaaa 900agcaaatcca aactgaaatc tgagcaggac ggaatctcca
aaacgcataa gctgctgcgg 960aggacttgtt ccagcacagt caagactgat
gatgtgtgtg tcacaaagtc acacaggacc 1020tttggccgct ccttgtccag
cgatcccagg gcggagcagg ctatgacagc aattaaatcg 1080cacaaacttt
tgaaccgtcc ttgccctgca gctgttaagt cagaggaatg cctaactcta
1140aagtcgcata gactattgac tcgatcttgt tctggagatc cacgatgtga
gcacaacaca 1200aacttgaagc cccataaact gttaagcagg tcttactcta
gtaatctcag aatggaagaa 1260ttatatggac tgaaaaatca caaattgctc
agcaagtcct actccagtgc ccccaagtca 1320tccaaaactg agcttttcaa
ggaacctaac gcagagggca ggaggctctc tcttacctca 1380gggcttattg
gtatcctaac accatcttca tcttcatctt ctcagcttgc tccaaatggt
1440gcaaaatgca ttccagtacg agaccgtggc ttcctggtgc agacaattga
gtttgctgaa 1500cagcggatcc ctgtattaaa tgaatattgt gtggtttgtg
atgagccaca tgtgtttcaa 1560aatggcccta tgcttaggcc taccgtatgt
gaacgggagc tgtgtgtgtt tgcttttcaa 1620accctgggag taatgaatga
agctgctgat gaaatagcaa ctggagctca ggtggtagat 1680ctactagtat
ccatgtgtag gtctgcgttg gaatctccta gaaaagttgt gattttcgag
1740ccatatcctt ctgtggtaga tcctaatgat cctcagatgt tggccttcaa
ccccaggaaa 1800aagaactatg atcgagtaat gaaagcactg gatagcataa
cttctatcag agaaatgaca 1860caagcaccat atctggaaat caagaagcaa
atggataaac
aggaccccct tgctcatccc 1920ttactgcaat gggttatatc aagtaataga
tcacatattg tgaaactgcc agttaacagg 1980caattgaagt ttatgcatac
tccacatcag ttccttcttc tcagcagtcc accagccaaa 2040gaatccaatt
ttagagctgc taaaaaactc tttggaagca cctttgcatt tcatggctca
2100cacattgaaa actggcactc catcctgagg aatggtctgg ttgttgcttc
taatacacga 2160ttgcagctcc atggtgcaat gtatggaagt ggaatctatc
ttagtccaat gtcaagcata 2220tcatttggtt actcagggat gaacaagaaa
cagaaggtgt cagccaagga cgagccagct 2280tcaagcagta aaagcagcaa
tacatcacag tcacagaaaa aaggacagca atcccaattc 2340ctgcaaagcc
gtaacttaaa atgcatagcc ttatgtgaag tgatcacctc atctgacctg
2400cacaaacatg gagagatatg ggttgtcccc aatactgacc atgtctgcac
acgattcttt 2460ttcgtctatg aagacggcca agtgggagat gcaaatatta
atacacaaga aggaggcatt 2520cacaaagaga tcctccgagt aattggtaat
caaactgcta ctggttaa 2568142568DNAHomo sapiens 14aggatggact
tttccatggt ggccggagca gcagcttaca atgaaaaatc aggtaggatt 60acctcgctct
cactcttgtt tcagaaagtc tttgctcaga tctttcctca gtggagaaag
120gggaatacag aagaatgtct cccctacaag tgctcagaga ctggtgctct
tggagaaaac 180tatagttggc aaattcccat taaccacaat gacttcaaaa
ttttaaaaaa taatgagcgt 240cagctgtgtg aagtcctcca gaataagttt
ggctgtatct ctaccctggt ctctccagtt 300caggaaggca acagcaaatc
tctgcaagtg ttcagaaaaa tgctgactcc taggatagag 360ttatcagtct
ggaaagatga cctcaccaca catgctgttg atgctgtggt gaatgcagcc
420aatgaagatc ttctgcatgg gggaggcctg gccctggccc tggtaaaagc
tggtggattt 480gaaatccaag aagagagcaa acagtttgtt gccagatatg
gtaaagtgtc agctggtgag 540atagctgtca cgggagcagg gaggcttccc
tgcaaacaga tcatccatgc tgttgggcct 600cggtggatgg aatgggataa
acagggatgt actggaaagc tgcagagggc cattgtaagt 660attctgaatt
atgtcatcta taaaaatact cacattaaga cagtagcaat tccagccttg
720agctctggga tttttcagtt ccctctgaat ttgtgtacaa agactattgt
agagactatc 780cgggttagtt tgcaagggaa gccaatgatg agtaatttga
aagaaattca cctggtgagc 840aatgaggacc ctactgttgc tgcctttaaa
gctgcttcag aattcatcct agggaagagt 900gagctgggac aagaaaccac
cccttctttc aatgcaatgg tcgtgaacaa cctgaccctc 960cagattgtcc
agggccacat tgaatggcag acggcagatg taattgttaa ttctgtaaac
1020ccacatgata ttacagttgg acctgtggca aagtcaattc tacaacaagc
aggagttgaa 1080atgaaatcgg aatttcttgc cacaaaggct aaacagtttc
aacggtccca gttggtactg 1140gtcacaaaag gatttaactt gttctgtaaa
tatatatacc atgtactgtg gcattcagaa 1200tttcctaaac ctcagatatt
aaaacatgca atgaaggagt gtttggaaaa atgcattgag 1260caaaatataa
cttccatttc ctttcctgcc cttgggactg gaaacatgga aataaagaag
1320gaaacagcag cagagatttt gtttgatgaa gttttaacat ttgccaaaga
ccatgtaaaa 1380caccagttaa ctgtaaaatt tgtgatcttt ccaacagatt
tggagatata taaggctttc 1440agttctgaaa tggcaaagag gtccaagatg
ctgagtttga acaattacag tgtcccccag 1500tcaaccagag aggagaaaag
agaaaatggg cttgaagcta gatctcctgc catcaatctg 1560atgggattca
acgtggaaga gatgtgtgag gcccacgcat ggatccaaag aatcctgagt
1620ctccagaacc accacatcat tgagaataat catattctgt accttgggag
aaaggaacat 1680gacattttgt ctcagcttca gaaaacttca agtgtctcca
tcacagaaat tatcagccca 1740ggaaggacag agttagagat tgaaggagcc
cgggctgacc tcattgaggt ggttatgaac 1800attgaagata tgctttgtaa
agtacaggag gaaatggcaa ggaaaaagga gcgaggcctt 1860tggcgctcgt
taggacagtg gactattcag caacaaaaaa cccaagacga aatgaaagaa
1920aatatcatat ttctgaaatg tcctgtgcct ccaactcaag agcttctaga
tcaaaagaaa 1980cagtttgaaa aatgtggttt gcaggttcta aaggtggaga
agatagacaa tgaggtcctt 2040atggctgcct ttcaaagaaa gaagaaaatg
atggaagaaa aactgcacag gcaacctgtg 2100agccataggc tgtttcagca
agtcccatac cagttctgca atgtggtatg cagagttggc 2160tttcaaagaa
tgtactcgac accttgcgat ccaaaatacg gagctggcat atacttcacc
2220aagaacctca aaaacctggc agagaaggcc aagaaaatct ctgctgcaga
taagctgatc 2280tatgtgtttg aggctgaagt actcacaggc ttcttctgcc
agggacatcc gttaaatatt 2340gttcccccac cactgagtcc tggagctata
gatggtcatg acagtgtggt tgacaatgtc 2400tccagccctg aaacctttgt
tatttttagt ggcatgcagg ctatacctca gtatttgtgg 2460acatgcaccc
aggaatatgt acagtcacaa gattactcat caggaccaat gagacccttt
2520gcacagcatc cttggagggg attcgcaagt ggcagccctg ttgattaa
2568153081DNAHomo sapiens 15ggaatggttg caatggcgga ggcagaggca
ggggtggcag tggaggtccg tggactgccc 60cctgccgtgc ccgacgagct gctcactctc
tactttgaaa accgccgacg ctctggaggg 120ggacctgtgt tgagctggca
gagactgggc tgtgggggcg tcctcacctt cagagagcct 180gcagacgccg
agagggtctt ggcccaggca gatcatgaac tacatggtgc ccagctgagc
240ctgcggccag ctccaccacg agcccctgca cgcctgctgc tccaaggact
gccccctggc 300accacgcccc agcgcttgga gcagcatgtc caggccttgc
tgcgggcctc ggggctccca 360gtacagcctt gctgtgcctt ggccagcccc
cggccagacc gggctctggt ccagttgccc 420aagccccttt ctgaggcaga
tgtccgtgtc ctggaggagc aggcccagaa tctgggcctg 480gaggggacct
tggtgtccct ggcccgggtt ccccaggccc gagcggtgcg tgtggtgggg
540gatggtgcct ctgtggacct gctgttgctg gagttgtacc tggagaatga
gcgccgcagt 600ggtggggggc ccctggagga cctgcaacgc ctacccgggc
ccctgggcac tgttgcctcc 660ttccagcagt ggcaagtggc agaacgagtg
ttgcagcagg agcaccggtt gcagggctca 720gagctgagcc ttgtccccca
ctacgacgtc ctggagcccg aggagctggc tgagaacacc 780agtggagggg
accacccgtc cacccagggg cctagggcta ccaagcatgc tctcctgagg
840accggagggt tggtgacggc tctgcagggt gcagggactg tgacaatggg
ctctggcgag 900gaaccagggc agtcaggggc ctctctgagg acaggtccca
tagtgcaggg tagagggatt 960atgacaacag gctctggcca ggaaccaggg
cagtcaggga cctctctgag gacaggtccc 1020atggggtctc tgggacaggc
agagcaagtc agctcgatgc ccatggggtc tctggaacat 1080gaggggctgg
taagcctgag gcctgtgggg ttgcaggaac aggaggggcc catgagcctg
1140gggcctgtgg ggtctgcagg cccagtggag acctctaagg ggttgccggg
gcaggagggc 1200ctggtggaaa ttgccatgga ctcaccagag caagaggggc
tggtgggtcc catggagatc 1260accatggggt ctctggagaa ggcagggcct
gtgagcccag gatgtgtgaa gctggcaggg 1320caggagggcc tggtggagat
ggtgctattg atggagccag gggcgatgcg cttcctgcag 1380ctctaccatg
aggaccttct tgcgggcctg ggagacgtcg ctctcttgcc acttgaagga
1440ccggatatga ctggctttcg gctctgtgga gcccaggctt cctgccaggc
ggctgaggag 1500tttctgcgga gcctgctggg cagcattagc tgccatgtgt
tgtgcctgga gcactcgggc 1560agcgccaggt ttctcctggg cccagaaggg
cagcaccttc tccaggggct ggaggctcag 1620ttccagtgtg tctttgggac
agagcgcctg gccacagcca cgttggacac aggccttgaa 1680gaggtggacc
ctaccgaggc cctcccagtg ctccctggca acgcccacac cctgtggacc
1740ccagacagta caggtggtga ccaggaggac gtgagcctgg aggaggtccg
agaactgctg 1800gccaccctgg agggcctaga cctagacggg gaggactggc
tgcctcggga gctggaggag 1860gaagggcctc aggagcagcc agaggaggag
gcgaccccag ggcatgagga ggaggagcct 1920gtggccccca gcactgtggc
acccaggtgg ctggaggagg aggccgctct gcagctggcc 1980ctccaccggt
cactggagcc tcaaggtcag gtggctgagc aggaggaggc tgctgccctg
2040cggcaagccc taaccctctc cctgctggag cagcccccgt tggaggcaga
agagccccca 2100gatgggggga ctgatggcaa ggcccagctg gtggtgcact
cggcctttga gcaggatgtg 2160gaggagctgg accgggcgct cagggctgcc
ttggaggtcc acgtccagga ggagacggtg 2220gggccctggc gccgcacact
gcctgcagag ctgcgtgctc gcctggagcg gtgccatggt 2280gtgagtgttg
ccctgcgtgg tgactgcacc atcctccgtg gcttcggggc ccaccctgcc
2340cgtgctgccc gccacttggt ggcacttctg gctggcccct gggatcagag
tttggccttt 2400cccttggcag cttcaggccc taccttggcg gggcagacgc
tgaaggggcc ctggaacaac 2460ctggagcgtc tggcagagaa caccggggag
ttccaggagg tggtgcgggc cttctacgac 2520accctggacg ctgcccgcag
cagcatccgc gtcgttcgtg tggagcgcgt gtcgcacccg 2580ctgctgcagc
agcagtatga gctgtaccgg gagcgcctgc tgcagcgatg cgagcggcgc
2640ccggtggagc aggtgctgta ccacggcacg acggcaccgg cagtgcctga
catctgcgcc 2700cacggcttca accgcagctt ctgcggccgc aacgccacgg
tctacgggaa gggcgtgtat 2760ttcgccaagc gcgcctccct gtcggtgcag
gaccgctact cgccccccaa cgccgatggc 2820cataaggcgg tgttcgtggc
acgggtgctg actggcgact acgggcaggg ccgccgcggt 2880ctgcgggcgc
cccctctgcg gggtcctggc cacgtgctcc tgcgctacga cagcgccgtg
2940gactgcatct gccagcccag catcttcgtc atcttccacg acacccaggc
gctgcccacc 3000cacctcatca cctgcgagca cgtgccccgc gcttcccccg
acgacccctc tgggctcccg 3060ggccgctccc cagacactta a 3081163081DNAHomo
Sapiens 16ggaatggttg caatggcgga ggcagaggca ggggtggcag tggaggtccg
tggactgccc 60cctgccgtgc ccgacgagct gctcactctc tactttgaaa accgccgacg
ctctggaggg 120ggacctgtgt tgagctggca gagactgggc tgtgggggcg
tcctcacctt cagagagcct 180gcagacgccg agagggtctt ggcccaggca
gatcatgaac tacatggtgc ccagctgagc 240ctgcggccag ctccaccacg
agcccctgca cgcctgctgc tccaaggact gccccctggc 300accacgcccc
agcgcttgga gcagcatgtc caggccttgc tgcgggcctc ggggctccca
360gtacagcctt gctgtgcctt ggccagcccc cggccagacc gggctctggt
ccagttgccc 420aagccccttt ctgaggcaga tgtccgtgtc ctggaggagc
aggcccagaa tctgggcctg 480gaggggacct tggtgtccct ggcccgggtt
ccccaggccc gagcggtgcg tgtggtgggg 540gatggtgcct ctgtggacct
gctgttgctg gagttgtacc tggagaatga gcgccgcagt 600ggtggggggc
ccctggagga cctgcaacgc ctacccgggc ccctgggcac tgttgcctcc
660ttccagcagt ggcaagtggc agaacgagtg ttgcagcagg agcaccggtt
gcagggctca 720gagctgagcc ttgtccccca ctacgacgtc ctggagcccg
aggagctggc tgagaacacc 780agtggagggg accacccgtc cacccagggg
cctagggcta ccaagcatgc tctcctgagg 840accggagggt tggtgacggc
tctgcagggt gcagggactg tgacaatggg ctctggcgag 900gaaccagggc
agtcaggggc ctctctgagg acaggtccca tagtgcaggg tagagggatt
960atgacaacag gctctggcca ggaaccaggg cagtcaggga cctctctgag
gacaggtccc 1020atggggtctc tgggacaggc agagcaagtc agctcgatgc
ccatggggtc tctggaacat 1080gaggggctgg taagcctgag gcctgtgggg
ttgcaggaac aggaggggcc catgagcctg 1140gggcctgtgg ggtctgcagg
cccagtggag acctctaagg ggttgccggg gcaggagggc 1200ctggtggaaa
ttgccatgga ctcaccagag caagaggggc tggtgggtcc catggagatc
1260accatggggt ctctggagaa ggcagggcct gtgagcccag gatgtgtgaa
gctggcaggg 1320caggagggcc tggtggagat ggtgctattg atggagccag
gggcgatgcg cttcctgcag 1380ctctaccatg aggaccttct tgcgggcctg
ggagacgtcg ctctcttgcc acttgaagga 1440ccggatatga ctggctttcg
gctctgtgga gcccaggctt cctgccaggc ggctgaggag 1500tttctgcgga
gcctgctggg cagcattagc tgccatgtgt tgtgcctgga gcactcgggc
1560agcgccaggt ttctcctggg cccagaaggg cagcaccttc tccaggggct
ggaggctcag 1620ttccagtgtg tctttgggac agagcgcctg gccacagcca
cgttggacac aggccttgaa 1680gaggtggacc ctaccgaggc cctcccagtg
ctccctggca acgcccacac cctgtggacc 1740ccagacagta caggtggtga
ccaggaggac gtgagcctgg aggaggtccg agaactgctg 1800gccaccctgg
agggcctaga cctagacggg gaggactggc tgcctcggga gctggaggag
1860gaagggcctc aggagcagcc agaggaggag gcgaccccag ggcatgagga
ggaggagcct 1920gtggccccca gcactgtggc acccaggtgg ctggaggagg
aggccgctct gcagctggcc 1980ctccaccggt cactggagcc tcaaggtcag
gtggctgagc aggaggaggc tgctgccctg 2040cggcaagccc taaccctctc
cctgctggag cagcccccgt tggaggcaga agagccccca 2100gatgggggga
ctgatggcaa ggcccagctg gtggtgcact cggcctttga gcaggatgtg
2160gaggagctgg accgggcgct cagggctgcc ttggaggtcc acgtccagga
ggagacggtg 2220gggccctggc gccgcacact gcctgcagag ctgcgtgctc
gcctggagcg gtgccatggt 2280gtgagtgttg ccctgcgtgg tgactgcacc
atcctccgtg gcttcggggc ccaccctgcc 2340cgtgctgccc gccacttggt
ggcacttctg gctggcccct gggatcagag tttggccttt 2400cccttggcag
cttcaggccc taccttggcg gggcagacgc tgaaggggcc ctggaacaac
2460ctggagcgtc tggcagagaa caccggggag ttccaggagg tggtgcgggc
cttctacgac 2520accctggacg ctgcccgcag cagcatccgc gtcgttcgtg
tggagcgcgt gtcgcacccg 2580ctgctgcagc agcagtatga gctgtaccgg
gagcgcctgc tgcagcgatg cgagcggcgc 2640ccggtggagc aggtgctgta
ccacggcacg acggcaccgg cagtgcctga catctgcgcc 2700cacggcttca
accgcagctt ctgcggccgc aacgccacgg tctacgggaa gggcgtgtat
2760ttcgccaagc gcgcctccct gtcggtgcag gaccgctact cgccccccaa
cgccgatggc 2820cataaggcgg tgttcgtggc acgggtgctg actggcgact
acgggcaggg ccgccgcggt 2880ctgcgggcgc cccctctgcg gggtcctggc
cacgtgctcc tgcgctacga cagcgccgtg 2940gactgcatct gccagcccag
catcttcgtc atcttccacg acacccaggc gctgcccacc 3000cacctcatca
cctgcgagca cgtgccccgc gcttcccccg acgacccctc tgggctcccg
3060ggccgctccc cagacactta a 308117999DNAHomo sapiens 17gagatgtttc
acaaagcaga agaattattt tctaaaacaa caaacaatga agtggatgac 60atggacacgt
cagataccca gtggggctgg ttttacttgg cagaatgtgg gaagtggcac
120atgtttcagc cggataccaa cagtcagtgt tcagttagca gtgaagatat
cgaaaaaagc 180ttcaaaacaa acccttgtgg ctccatttct tttactactt
ccaaattcag ctacaagata 240gactttgcag aaatgaagca aatgaatctc
accactggaa agcagcgctt aataaaaaga 300gccccctttt ctatcagtgc
tttcagttac atctgtgaaa acgaggccat ccctatgcca 360ccacactggg
agaatgtgaa tactcaagta ccatatcagc ttattcctct gcacaatcaa
420acacatgaat ataatgaagt tgctaatctc tttgggaaga cgatggatcg
caaccgaatt 480aaaagaattc agagaattca aaacctagat ttgtgggagt
tcttttgcag gaaaaaggct 540cagctcaaga aaaaaagagg tgtgcctcag
attaatgaac aaatgctgtt tcatggtacc 600agcagtgaat ttgtggaagc
aatctgcatt cataactttg attggagaat aaatggtata 660catggtgctg
tctttggaaa aggaacctat tttgctagag atgctgctta ttccagtcgt
720ttctgcaaag atgacataaa gcatgggaac acattccaaa ttcatggtgt
cagcttgcaa 780cagcggcatc tgtttagaac atataaatct atgtttcttg
ctcgagtgct aattggagat 840tacataaacg gagactccaa atacatgcga
cctccttcca aagacgggag ctatgtgaat 900ttatatgaca gctgtgtgga
tgatacctgg aacccaaaga tctttgtggt ttttgatgcc 960aaccaaatct
atcctgagta cttgatagac tttcattga 999182109DNAHomo sapiens
18gccatggccc aggccggcgt cgtcggtgag gtcacccagg tgctgtgcgc ggccgggggc
60gccctggagt tgcccgagct gcggcgccgc ttgcggatgg gcttgagcgc cgacgcgctg
120gagcggctgc tgcggcagcg tgggcgcttc gtggtggcgg tgcgggcggg
cggcgcagcc 180gcggccccgg agcgcgtggt gctggccgcc tcgccgctgc
gcctgtgtcg cgcgcaccag 240ggctccaagc cgggctgcgt ggggctctgc
gcgcagctcc acctctgcag gttcatggtc 300tacggcgcct gcaagttcct
gagagccggg aagaactgta ggaatagtca cagcttgaca 360accgaacaca
acctgagtgt gctgagaact catggcgttg accacctgag ctataatgag
420ctatgccaac tcttgtttca gaacgacccc tggcttttgc cagaaatttg
ccaacattac 480aacaaaggag atggacccca cggctcttgt gcctttcaaa
agcagtgcat caagctccat 540atctgccagt attttttaca gggggaatgc
aagtttggca ctagctgtaa gagatcccat 600gatttctcta attctgagaa
tctggaaaaa ttggagaagt tgggtatgag ctcagacctg 660gtgagcaggc
tgcctaccat ttatagaaat gcacatgaca tcaagaataa gagctctgcc
720cccagcagag tgcctcctct ttttgtccca caggggactt ctgaaagaaa
agacagttca 780ggttctgtgt ccccaaacac tcttagccag gaggagggtg
atcagatctg tttgtaccat 840atccggaaaa gttgtagctt tcaagataag
tgccatagag ttcatttcca tttgccgtat 900cgatggcaat tcttggatag
aggcaaatgg gaggatttgg acaacatgga acttattgaa 960gaggcatatt
gcaatcccaa aatagaaagg atcctgtgct ctgagtcagc cagtaccttt
1020cactctcatt gtctgaactt taacgccatg acttacggtg ctacccaggc
tcgccgcctc 1080tccacggcct cctctgtcac caaacctcca cacttcatcc
tcaccactga ctggatttgg 1140tactggagtg atgagtttgg ttcttggcag
gaatatggaa gacagggcac ggtgcaccct 1200gtgaccactg tcagcagtag
cgacgtggag aaggcctacc tggcctactg tacaccgggg 1260tctgacggcc
aggcagccac cttgaagttc caggccggaa agcacaacta cgagttagat
1320ttcaaagcct tcgttcagaa aaacctggtc tatggcacaa ctaaaaaggt
ttgccgcaga 1380cccaaatacg tgtctcccca ggatgtgacg accatgcaaa
cctgcaatac caagtttcca 1440ggcccgaaga gcatcccaga ctattgggac
tcctctgccc tgccagaccc aggctttcag 1500aagatcaccc ttagttcttc
ctcggaagag tatcagaagg tctggaacct ctttaaccgc 1560acgctgcctt
tctactttgt tcagaagatt gagcgagtac agaacctggc cctctgggaa
1620gtctaccagt ggcaaaaagg acagatgcag aagcagaatg gagggaaggc
cgtggacgag 1680cggcagctgt tccacggcac cagcgccatt tttgtggacg
ccatctgcca gcagaacttt 1740gactggcggg tctgtggtgt tcatggcact
tcctacggca aggggagcta ctttgcccga 1800gatgctgcat attcccacca
ctacagcaaa tccgacacgc agacccacac gatgttcctg 1860gcccgggtgc
tggtgggcga gttcgtcagg ggcaatgcgt cctttgtccg tccgccggcc
1920aaggagggct ggagcaacgc cttctatgat agctgcgtga acagtgtgtc
cgacccctcc 1980atctttgtga tctttgagaa acaccaggtc tacccagagt
atgtcatcca gtacaccacc 2040tcctccaagc cctcggtcac accctccatc
ctgctggcct tgggctccct gttcagcagc 2100cgacagtga 2109192712DNAHomo
sapiens 19gccatggcgg acccggaggt gtgctgcttc atcaccaaaa tcctgtgcgc
ccacgggggc 60cgcatggccc tggacgcgct gctccaggag atcgcgctgt ctgagccgca
gctctgtgag 120gtgctgcagg tggccgggcc cgaccgcttt gtggtgttgg
agaccggcgg cgaggccggg 180atcacccgat cggtggtggc caccactcga
gcccgggtct gccgtcgcaa gtactgccag 240agaccctgcg ataacctgca
tctctgcaaa ctcaacttgc tgggccggtg caactattcg 300cagtccgagc
ggaatttatg caaatattct catgaggttc tctcagaaga gaacttcaaa
360gtcctgaaaa atcacgaact ctctggactg aacaaagagg aattagcagt
gctcctcctc 420caaagtgatc ctttttttat gcccgagata tgcaaaagtt
ataagggaga gggtcggcag 480cagatttgta accagcagcc accgtgttca
agactccaca tctgtgacca cttcacccga 540gggaactgtc gttttcccaa
ctgcctccgg tcccataacc tgatggacag aaaggtgctg 600gccatcatga
gggagcacgg gctgaacccc gacgtggtcc agaacatcca ggacatctgc
660aacagcaagc acatgcagaa gaatccccca gggcccagag ctccttcttc
acatcgtaga 720aacatggcat atagggctag aagcaagagt agagatcggt
tctttcaggg cagccaagaa 780tttcttgcgt ctgcttcagc gtctgctgag
aggtcctgca cacctagtcc agatcagatc 840agccacaggg cttccctgga
ggacgcgcct gtggacgatc tcacccgcaa gttcacgtat 900ctggggagtc
aggatcgcgc tcggcctccc tcaggctcgt ccaaggctac tgatcttgga
960ggaacaagtc aggccgggac aagccagagg tttttagaga acggcagtca
agaggacctc 1020ttgcatggaa atccaggcag cacttacctt gcttccaatt
caacatcagc ccccaactgg 1080aagagcctca catcctggac gaatgaccaa
ggcgccagga gaaagactgt gttttctccc 1140acgctacctg ccgcccgctc
ttctcttggc tctctgcaaa cacctgaagc tgtgaccacc 1200agaaagggca
caggcttgct ttcctcagac tacaggatca tcaatggcaa aagtggaact
1260caggacatcc agcctggccc tctttttaat aataatgctg atggagtggc
cacagatata 1320acttctacca gatccttaaa ttacaaaagc actagcagcg
gtcacagaga aatatcatca 1380cctaggattc aggatgctgg acctgcttcc
cgagatgtcc aggccactgg cagaatcgca 1440gatgatgctg acccaagagt
agcacttgtt aacgattctt tatctgatgt cacaagtacc 1500acatcttcta
gggtggatga tcatgactca gaggaaattt gtcttgacca tctgtgtaag
1560ggttgtccgc ttaatggtag ctgcagcaaa gtccacttcc atctgcctta
ccggtggcag 1620atgcttattg gtaaaacctg gacggacttt gagcacatgg
agacgatcga gaaaggctac 1680tgtaaccccg gaatccacct ctgttctgta
ggaagttata caatcaattt tcgggtaatg 1740agttgtgatt cctttcccat
ccgacgcctc tccactcctt cttctgtcac caagccagcc 1800aattctgtct
tcaccaccaa atggatttgg tattggaaga atgaatctgg cacatggatt
1860cagtatggag aagagaaaga caaacggaaa aattcaaacg tcgactcttc
atacctggag 1920tctctctatc aatcctgtcc gaggggagtt gtgccatttc
aggcgggctc acggaactat 1980gagctgagtt tccaagggat gattcagaca
aacatagctt ccaaaactca aaaggatgtc 2040atcagaagac caacatttgt
gcctcagtgg tatgtgcagc agatgaagag agggccagac 2100catcagccag
caaagacctc gtcagtgtct ttaactgcga cctttcgtcc tcaggaggac
2160ttttgcttcc tatcctcaaa gaaatataag ttgtcagaga tccatcacct
acatccagaa 2220tatgtcagag taagtgagca ttttaaagct tccatgaaaa
atttcaagat tgaaaagata 2280aagaagatcg agaactcaga gctcctggat
aaatttacat ggaagaaatc gcagatgaag 2340gaagaaggaa aactcctatt
ttatgcgaca agccgtgcct atgtggaatc tatctgttcg 2400aataattttg
acagtttcct acatgaaact catgaaaaca aatacggaaa aggaatttac
2460tttgcaaaag atgccatcta ttcccacaaa aattgcccgt atgatgccaa
aaacgtcgtt 2520atgtttgtag cccaagttct ggttggaaag tttactgaag
gaaatataac gtacacgagc 2580cctcctccac agttcgacag ctgtgtggat
accagatcga atccctccgt ttttgtcatc 2640tttcagaaag atcaggttta
cccacaatat gtgattgaat atactgaaga caaagcctgc 2700gtgattagtt ag
2712202103DNAHomo sapiens 20gccatggcgg acccggaggt gtgctgcttc
atcaccaaaa tcctgtgcgc ccacgggggc 60cgcatggccc tggacgcgct gctccaggag
atcgcgctgt ctgagccgca gctctgtgag 120gtgctgcagg tggccgggcc
cgaccgcttt gtggtgttgg agaccggcgg cgaggccggg 180atcacccgat
cggtggtggc caccactcga gcccgggtct gccgtcgcaa gtactgccag
240agaccctgcg ataacctgca tctctgcaaa ctcaacttgc tgggccggtg
caactattcg 300cagtccgagc ggaatttatg caaatattct catgaggttc
tctcagaaga gaacttcaaa 360gtcctgaaaa atcacgaact ctctggactg
aacaaagagg aattagcagt gctcctcctc 420caaagtgatc ctttttttat
gcccgagata tgcaaaagtt ataagggaga gggtcggcag 480cagatttgta
accagcagcc accgtgttca agactccaca tctgtgacca cttcacccga
540gggaactgtc gttttcccaa ctgcctccgg tcccataacc tgatggacag
aaaggtgctg 600gccatcatga gggagcacgg gctgaacccc gacgtggtcc
agaacatcca ggacatctgc 660aacagcaagc acatgcagaa gaatccccca
gggcccagag ctccttcttc acatcgtaga 720aacatggcat atagggctag
aagcaagagt agagatcggt tctttcaggg cagccaagaa 780tttcttgcgt
ctgcttcagc gtctgctgag aggtcctgca cacctagtcc agatcagatc
840agccacaggg cttccctgga ggacgcgcct gtggacgatc tcacccgcaa
gttcacgtat 900ctggggagtc aggatcgcgc tcggcctccc tcaggctcgt
ccaaggctac tgatcttgga 960ggaacaagtc aggccgggac aagccagagg
tttttagaga acggcagtca agaggacctc 1020ttgcatggaa atccaggcag
cacttacctt gcttccaatt caacatcagc ccccaactgg 1080aagagcctca
catcctggac gaatgaccaa ggcgccagga gaaagactgt gttttctccc
1140acgctacctg ccgcccgctc ttctcttggc tctctgcaaa cacctgaagc
tgtgaccacc 1200agaaagggca caggcttgct ttcctcagac tacaggatca
tcaatggcaa aagtggaact 1260caggacatcc agcctggccc tctttttaat
aataatgctg atggagtggc cacagatata 1320acttctacca gatccttaaa
ttacaaaagc actagcagcg gtcacagaga aatatcatca 1380cctaggattc
aggatgctgg acctgcttcc cgagatgtcc aggccactgg cagaatcgca
1440gatgatgctg acccaagagt agcacttgtt aacgattctt tatctgatgt
cacaagtacc 1500acatcttcta gggtggatga tcatgactca gaggaaattt
gtcttgacca tctgtgtaag 1560ggttgtccgc ttaatggtag ctgcagcaaa
gtccacttcc atctgcctta ccggtggcag 1620atgcttattg gtaaaacctg
gacggacttt gagcacatgg agacgatcga gaaaggctac 1680tgtaaccccg
gaatccacct ctgttctgta ggaagttata caatcaattt tcgggtaatg
1740agttgtgatt cctttcccat ccgacgcctc tccactcctt cttctgtcac
caagccagcc 1800aattctgtct tcaccaccaa atggatttgg tattggaaga
atgaatctgg cacatggatt 1860cagtatggag aagagaaaga caaacggaaa
aattcaaacg tcgactcttc atacctggag 1920tctctctatc aatcctgtcc
gaggggagtt gtgccatttc aggcgggctc acggaactat 1980gagctgagtt
tccaagggat gattcagaca aacatagctt ccaaaactca aaaggatgtc
2040atcagaagac caacatttgt gcctcagtgg tatgtgcagc agatgaagag
agggccagag 2100taa 2103214560DNAHomo sapiens 21atcatggcca
caaaactcga cttcaataaa atgccacttt ctgtgttccc atactatgcc 60tcattgggca
cagccttgta tggaaaggag aagcctctga tcaagcttcc agcaccattt
120gaagagtcac tagatcttcc cttatggaag ttcttacaga aaaagaatca
cctcattgag 180gagataaacg atgaaatgag gcgttgtcac tgtgagctca
cgtggtccca actcagtggt 240aaagttacca tcagaccagc agccacctta
gtcaatgaag gaagaccgag aatcaagacc 300tggcaggcag atacttccac
aacactctct agcatcaggt ctaaatataa agtcaaccca 360attaaagtgg
atccaacaat gtgggacacc ataaaaaatg atgtgaaaga tgacaggatt
420ttgattgagt ttgatacact taaggagatg gtaatcttag cagggaaatc
agaggatgtc 480caaagcattg aggtacaagt cagggagtta atagaaagca
ctactcaaaa aattaaaagg 540gaagagcaaa gtttgaagga aaaaatgatc
atttctccag gcaggtattt tcttttgtgt 600cacagcagtc tactggacca
tttactcacg gagtgcccag agatagagat ttgttacgat 660agagtcactc
aacacttgtg cttgaaagga cctagtgcag atgtgtataa agcaaagtgt
720gaaatccagg aaaaggtgta caccatggct cagaaaaaca ttcaggtttc
tcctgagatt 780tttcagtttt tgcaacaggt aaactggaaa gaattctcta
agtgtctttt catagcacag 840aagattcttg cactttatga gctagagggt
acaactgttc tcttaaccag ctgttcttct 900gaagccctgt tagaagcaga
aaagcaaatg ctcagtgcct taaattataa gcgcattgaa 960gttgagaaca
aagaagttct tcatggcaag aaatggaaag ggctcactca caatttgctt
1020aagaaacaaa attcctcccc aaacactgta atcatcaatg agttaacttc
agaaaccaca 1080gctgaagtca tcattacagg ctgtgtaaaa gaagtaaatg
aaacctataa attgcttttt 1140aacttcgttg aacaaaacat gaaaatagag
agactggttg aagtaaagcc ttccttagtt 1200attgactatt taaagacaga
aaagaagcta ttctggccaa agataaagaa ggtaaatgtg 1260caggtaagtt
tcaatcctga gaacaaacaa aaaggcattt tactaactgg ctcaaagacc
1320gaagtactga aggcagtgga cattgtcaag caagtctggg attcagtctg
tgttaaaagt 1380gtccatactg ataagccagg agccaagcag ttcttccagg
ataaagcacg gttttatcaa 1440agtgagatca aacggttgtt tggttgttac
attgaactac aggagaatga agtaatgaag 1500gagggaggca gccccgctgg
gcagaagtgc ttctctcgga cagtcttggc ccctggcgtt 1560gtgctgattg
tgcagcaggg tgacttggca cggcttcctg tcgatgtggt ggtgaatgca
1620tctaatgagg accttaagca ttatggtggc ctggccgctg cgctctcaaa
agcagctggc 1680cctgagctcc aggccgactg tgaccagata gtgaagagag
agggcagact cctaccgggc 1740aatgccacca tctccaaggc aggaaagctg
ccctaccacc acgtgatcca tgcagtgggg 1800ccccgctgga gcggatatga
ggccccgagg tgtgtgtacc tattaaggag agctgtgcaa 1860ctcagtctct
gtctagccga aaaatacaag taccgatcca tagccatccc agctattagt
1920tctggagtct ttggctttcc cttaggccga tgcgtggaga ccattgtttc
tgccatcaag 1980gaaaacttcc aattcaagaa ggatggacac tgcttgaaag
aaatctacct tgtggatgta 2040tctgagaaga ctgttgaggc ctttgcagaa
gctgtgaaaa ctgtatttaa agccaccctg 2100ccagatacag ctgccccgcc
aggtttacca ccagcagcag cggggcctgg gaaaacatca 2160tgggaaaaag
gaagcctggt gtccccggga ggcctgcaga tgctgttggt gaaagagggt
2220gtgcagaatg ctaagaccga tgttgttgtc aactccgttc ccttggatct
cgtgcttagt 2280agagggcctc tttctaagtc cctcttggaa aaagctggac
cagagctcca ggaggaattg 2340gacacagttg gacaaggggt ggctgtcagc
atgggcacag tgctcaaaac cagcagctgg 2400aatctggact gtcgctatgt
gcttcacgtg gtagctccgg agtggagaaa tggtagcaca 2460tcttcactca
agataatgga agacataatc agagaatgta tggagatcac tgagagcttg
2520tccttaaaat caattgcatt tccagcaata ggaacaggaa acttgggatt
tcctaaaaac 2580atattcgctg aattaatcat ttcagaggtg ttcaaattta
gtagcaagaa tcagctgaaa 2640actttacaag aggttcactt tctgctgcac
ccgagtgatc atgaaaatat tcaggcattt 2700tcagatgaat ttgccagaag
ggctaatgga aatctcgtca gtgacaaaat tccgaaggct 2760aaagatacac
aaggttttta tgggactgtt tctagccctg attcaggtgt gtatgaaatg
2820aagattggct ccatcatctt ccaggtggct tctggagata tcacgaaaga
agaggcagat 2880gtgattgtaa attcaacatc aaactcattc aatctcaaag
caggggtctc caaagcaatt 2940ttagaatgtg ctggacaaaa tgtagaaagg
gaatgttctc agcaagctca gcagcgcaaa 3000aatgattata taatcaccgg
aggtggattt ttgaggtgca agaatatcat tcatgtaatt 3060ggtggaaatg
atgtcaagag ttcagtttcc tctgttttgc aggagtgtga aaaaaaaaat
3120tactcatcca tttgcctccc agccattggg acaggaaatg ccaaacaaca
cccagataag 3180gttgctgaag ccataattga tgccattgaa gactttgtcc
agaaaggatc agcccagtct 3240gtgaaaaaag ttaaagttgt tatctttctg
cctcaagtac tggatgtgtt ttatgccaac 3300atgaagaaaa gagaagggac
tcagctttct tcccaacagt ctgtgatgtc taaacttgca 3360tcatttttgg
gcttttcaaa gcaatctccc caaaaaaaga atcatttggt tttggaaaag
3420aaaacagaat cagcaacttt tcgggtgtgt ggtgaaaatg tcacgtgtgt
ggaatatgct 3480atctcctggc tacaagacct gattgaaaaa gaacagtgtc
cttacaccag tgaagatgag 3540tgcatcaaag actttgatga aaaggagtat
caggagttga atgagctgca gaagaagtta 3600aatattaaca tttccctgga
ccataagaga cctttgatta aggttttggc aattagcaga 3660gatgtgatgc
aggctagaga tgaaattgag gcgatgatca agagagttcg attgggcaaa
3720gaacaggaat cccgggcaga ttgtatcagt gagtttatag aatggcagta
taatgacaat 3780aacacttctc attgttttaa caaaatgacc aatctgaaat
tagaggatgc aaggagagaa 3840aagaaaaaaa cagttgatgt caaaattaat
catcggcact acacagtgaa cttgaacaca 3900tacactgcca cagacacaaa
gggccacagt ttatctgttc agcgcctcac gaaatccaaa 3960gttgacatcc
ctgcacactg gagtgatatg aagcagcaga atttctgtgt ggtggagctg
4020ctgcctagtg atcctgagta caacacggtg gcaagcaagt ttaatcagac
ctgctcacac 4080ttcagaatag agaagattga gaggatccag aatccagatc
tctggaatag ctaccaggca 4140aagaaaaaaa ctatggatgc caagaatggc
cagacaatga atgagaagca actcttccat 4200gggacagatg ccggctccgt
gccacacgtc aatcgaaatg gctttaaccg cagctatgcc 4260ggaaagaatg
ctgtggcata tggaaaggga acctattttg ctgtcaatgc caattattct
4320gccaatgata cgtactccag accagatgca aatgggagaa agcatgtgta
ttatgtgcga 4380gtacttactg gaatctatac acatggaaat cattcattaa
ttgtgcctcc ttcaaagaac 4440cctcaaaatc ctactgacct gtatgacact
gtcacagata atgtgcacca tccaagttta 4500tttgtggcat tttatgacta
ccaagcatac ccagagtacc ttattacgtt tagaaaataa 4560222040DNAHomo
sapiens 22aggatggctg cgccaggccc ccttcctgcc gctgctctga gtccaggggc
tccgaccccc 60agagaactta tgcacggagt tgcaggtgtt acttccagag ccggacgaga
tcgggaggcg 120gggagcgtgc tgccggccgg gaaccgtggg gcgcggaagg
cctcccggcg ctcttcctcc 180cggagtatgt ccagagacaa caagttcagc
aagaaagatt gtctttcaat caggaatgtt 240gtagcttcaa tccaaaccaa
agaaggtctg aatctcaagt tgataagtgg agatgttctg 300tacatctggg
ccgatgtcat tgtcaacagc gttcccatga atcttcagct tggaggagga
360ccactatctc gggcattttt gcagaaagct ggtcccatgc tccagaaaga
gttagatgac 420agaaggcggg aaacagagga aaaagtaggt aacatattca
tgacaagcgg ctgcaatctg 480gactgcaaag ctgtgctcca tgctgtggct
ccatactgga ataatggagc agagacttct 540tggcagatca tggcaaatat
aatcaagaaa tgtttgacaa ctgtagaagt gctatctttc 600tcatcaatca
catttcccat gattggaaca ggaagtttgc agtttcccaa agctgttttt
660gctaaactaa tcctttcaga agtgttcgaa tacagtagca gcacaaggcc
gataactagc 720cctttacaag aagtccactt tctggtatat acaaatgacg
atgaaggctg tcaggcattt 780ttagatgaat tcactaactg gtcaagaata
aatcccaaca aggccaggat tcccatggca 840ggagataccc aaggtgtggt
cgggactgtc tctaagcctt gtttcacagc atatgaaatg 900aaaatcggtg
caattacttt tcaggttgct actggagata tagccactga acaggtagat
960gttattgtaa actcaacagc aaggacattt aatcggaaat caggtgtgtc
aagagctatt 1020ttagaaggtg ctggacaagc tgtggaaagt gaatgtgctg
tactagctgc acagcctcac 1080agagatttta taattacacc aggtggatgc
ttaaagtgca aaataataat tcatgttcct 1140gggggaaaag atgtcaggaa
aacggtcacc agtgttctag aagagtgtga acagaggaag 1200tacacatcgg
tttcccttcc agccattgga acaggaaatg ccggaaaaaa ccctatcaca
1260gttgctgata acataatcga tgctattgta gacttctcat cacaacattc
caccccatca 1320ttaaaaacag ttaaagttgt catttttcaa cctgagctgc
taaatatatt ctacgacagc 1380atgaaaaaaa gagacctctc tgcatcactg
aactttcagt ccacattctc catgactaca 1440tgtaatcttc ctgaacactg
gactgacatg aatcatcagc tgttttgcat ggtccagcta 1500gagccaggac
aatcagaata taataccata aaggacaagt tcacccgaac ttgttcttcc
1560tacgcaatag agaagattga gaggatacag aatgcatttc tctggcagag
ctaccaggta 1620aagaaaaggc aaatggatat caagaatgac cataagaata
atgagagact cctcttccat 1680gggacagatg cagactcagt gccatatgtc
aatcagcacg gctttaatag aagttgtgct 1740gggaaaaatg ctgtatccta
tggaaaagga acctattttg ctgtggatgc cagttattct 1800gccaaggaca
cctactccaa gccagacagc aatgggagaa agcacatgta cgttgtgcga
1860gtacttactg gagtcttcac aaagggacgt gcaggattag tcacccctcc
acccaagaat 1920cctcacaatc ccacagatct ctttgactca gtgacaaaca
atacacgatc tccaaagcta 1980tttgtggtat tctttgataa tcaggcttac
ccagaatatc tcataacttt cacggcttaa 2040231338DNAHomo sapiens
23tcaatgctcc aaagaattgg attaatattt ttacacaata ttgttgtagt cagtaactgt
60ttctatttcc aggcattttt agatgaattc actaactggt caagaataaa tcccaacaag
120gccaggattc ccatggcagg agatacccaa ggtgtggtcg ggactgtctc
taagccttgt 180ttcacagcat atgaaatgaa aatcggtgca attacttttc
aggttgctac tggagatata 240gccactgaac aggtagatgt tattgtaaac
tcaacagcaa ggacatttaa tcggaaatca 300ggtgtgtcaa gagctatttt
agaaggtgct ggacaagctg tggaaagtga atgtgctgta 360ctagctgcac
agcctcacag agattttata attacaccag gtggatgctt aaagtgcaaa
420ataataattc atgttcctgg gggaaaagat gtcaggaaaa cggtcaccag
tgttctagaa 480gagtgtgaac agaggaagta cacatcggtt tcccttccag
ccattggaac aggaaatgcc 540ggaaaaaacc ctatcacagt tgctgataac
ataatcgatg ctattgtaga cttctcatca 600caacattcca ccccatcatt
aaaaacagtt aaagttgtca tttttcaacc tgagctgcta 660aatatattct
acgacagcat gaaaaaaaga gacctctctg catcactgaa ctttcagtcc
720acattctcca tgactacatg taatcttcct gaacactgga ctgacatgaa
tcatcagctg 780ttttgcatgg tccagctaga gccaggacaa tcagaatata
ataccataaa ggacaagttc 840acccgaactt gttcttccta cgcaatagag
aagattgaga ggatacagaa tgcatttctc 900tggcagagct accaggtaaa
gaaaaggcaa atggatatca agaatgacca taagaataat 960gagagactcc
tcttccatgg gacagatgca gactcagtgc catatgtcaa tcagcacggc
1020tttaatagaa gttgtgctgg gaaaaatgct gtatcctatg gaaaaggaac
ctattttgct 1080gtggatgcca gttattctgc caaggacacc tactccaagc
cagacagcaa tgggagaaag 1140cacatgtacg ttgtgcgagt acttactgga
gtcttcacaa agggacgtgc aggattagtc 1200acccctccac ccaagaatcc
tcacaatccc acagatctct ttgactcagt gacaaacaat 1260acacgatctc
caaagctatt tgtggtattc tttgataatc aggcttaccc agaatatctc
1320ataactttca cggcttaa 133824975DNAHomo sapiens 24gggatgcagc
cctcaggctg ggcggccgcc agggaggcgg cgggccgcga catgctggcc 60gccgacctcc
ggtgcagcct cttcgcctcg gccctgcaga gctacaagcg cgactcggtg
120ctgcggccct tccccgcgtc ctacgcccgc ggcgactgta aggactttga
agccctgctt 180gcagatgcca gcaagttacc taacctgaaa gaacttctcc
agtcctccgg agacaaccac 240aaacgggcct gggacctggt gagctggatt
ttatcctcaa aggtcctgac aatccacagt 300gcagggaagg cagagtttga
aaagatccaa aagctgactg gggctcctca cacgcctgtt 360cctgcaccgg
acttcctgtt tgaaattgag tactttgacc cagccaacgc caaattttat
420gagaccaaag gagaacgaga cctaatctat gcatttcatg gtagccgcct
agaaaacttc 480cattccatta tccacaatgg cctgcactgc catctgaaca
agacatcctt gttcggagag 540gggacctacc tcaccagtga cttgagcctg
gccctcatat acagccccca tggccatggg 600tggcagcaca gcctcctcgg
ccccatcctt agctgtgtgg ccgtgtgtga ggtcattgac 660catccggacg
tcaagtgcca aaccaagaag aaggattcca aggagataga tcgcagacga
720gcgagaatca aacatagtga agggggagac atccctccca agtacttcgt
ggtcaccaat 780aaccagctgc tgcgagtgaa gtacctcctg gtgtattcac
agaagccacc caagagcagg 840gcttcgagcc agctctcctg gttttccagc
cattggttta ccgtcatgat atccctgtat 900ctgctgctgc tgctcatagt
gagtgtcatc aactcctctg ctttccaaca cttttggaat 960cgtgcgaaaa gataa
97525238PRTAequorea coerulescens 25Met Ser Lys Gly Ala Glu Leu Phe
Thr Gly Val Val Pro Ile Leu Ile1 5 10 15Glu Leu Asn Gly Asp Val Asn
Gly His Lys Phe Ser Val Ser Gly Glu 20 25 30Gly Glu Gly Asp Ala Thr
Tyr Gly Lys Leu Thr Leu Lys Phe Ile Cys 35 40 45Thr Thr Gly Lys Leu
Pro Val Pro Trp Pro Thr Leu Val Thr Thr Phe 50 55 60Ser Tyr Gly Val
Gln Cys Phe Ser Arg Tyr Pro Asp His Met Lys Gln65 70 75 80His Asp
Phe Phe Lys Ser Ala Met Pro Glu Gly Tyr Ile Gln Glu Arg 85 90 95Thr
Ile Phe Phe Lys Asp Asp Gly Asn Tyr Lys Ser Arg Ala Glu Val 100 105
110Lys Phe Glu Gly Asp Thr Leu Val Asn Arg Ile Glu Leu Thr Gly Thr
115 120 125Asp Phe Lys Glu Asp Gly Asn Ile Leu Gly Asn Lys Met Glu
Tyr Asn 130 135 140Tyr Asn Ala His Asn Val Tyr Ile Met Thr Asp Lys
Ala Lys Asn Gly145 150 155 160Ile Lys Val Asn Phe Lys Ile Arg His
Asn Ile Glu Asp Gly Ser Val 165 170 175Gln Leu Ala Asp His Tyr Gln
Gln Asn Thr Pro Ile Gly Asp Gly Pro 180 185 190Val Leu Leu Pro Asp
Asn His Tyr Leu Ser Thr Gln Ser Thr Leu Ser 195 200 205Lys Asp Pro
Asn Glu Lys Arg Asp His Met Ile Tyr Phe Glu Phe Val 210 215 220Thr
Ala Ala Ala Ile Thr His Gly Met Asp Glu Leu Tyr Lys225 230
235267PRTArtificial SequenceSynthetic Construct 26Glu Xaa Xaa Tyr
Xaa Gln Ser1 527126PRTStaphylococcus aureus 27Gly Pro Ser Ala Val
Asp Asn Lys Phe Asn Lys Glu Gln Gln Asn Ala1 5 10 15Phe Tyr Glu Ile
Leu His Leu Pro Asn Leu Asn Glu Glu Gln Arg Asn 20 25 30Ala Phe Ile
Gln Ser Leu Lys Asp Asp Pro Ser Gln Ser Ala Asn Leu 35 40 45Leu Ala
Glu Ala Lys Lys Leu Asn Asp Ala Gln Ala Pro Lys Val Asp 50 55 60Asn
Lys Phe Asn Lys Glu Gln Gln Asn Ala Phe Tyr Glu Ile Leu His65 70 75
80Leu Pro Asn Leu Asn Glu Glu Gln Arg Asn Ala Phe Ile Gln Ser Leu
85 90 95Lys Asp Asp Pro Ser Gln Ser Ala Asn Leu Leu Ala Glu Ala Lys
Lys 100 105 110Leu Asn Asp Ala Gln Ala Pro Lys Val Asp Ala Asn His
Gln 115 120 125284731DNAArtificial SequenceSynthetic Construct
28tagttattaa tagtaatcaa ttacggggtc attagttcat agcccatata tggagttccg
60cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc cccgcccatt
120gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc
attgacgtca 180atgggtggag tatttacggt aaactgccca cttggcagta
catcaagtgt atcatatgcc 240aagtacgccc cctattgacg tcaatgacgg
taaatggccc gcctggcatt atgcccagta 300catgacctta tgggactttc
ctacttggca gtacatctac gtattagtca tcgctattac 360catggtgatg
cggttttggc agtacatcaa tgggcgtgga tagcggtttg actcacgggg
420atttccaagt ctccacccca ttgacgtcaa tgggagtttg ttttggcacc
aaaatcaacg 480ggactttcca aaatgtcgta acaactccgc cccattgacg
caaatgggcg gtaggcgtgt 540acggtgggag gtctatataa gcagagctgg
tttagtgaac cgtcagatcc gctagcgcta 600ccggtcgcca ccatggtgag
caagggcgag gagctgttca ccggggtggt gcccatcctg 660gtcgagctgg
acggcgacgt aaacggccac aagttcagcg tgtccggcga gggcgagggc
720gatgccacct acggcaagct gaccctgaag ttcatctgca ccaccggcaa
gctgcccgtg 780ccctggccca ccctcgtgac caccctgacc tacggcgtgc
agtgcttcag ccgctacccc 840gaccacatga agcagcacga cttcttcaag
tccgccatgc ccgaaggcta cgtccaggag 900cgcaccatct
tcttcaagga cgacggcaac tacaagaccc gcgccgaggt gaagttcgag
960ggcgacaccc tggtgaaccg catcgagctg aagggcatcg acttcaagga
ggacggcaac 1020atcctggggc acaagctgga gtacaactac aacagccaca
acgtctatat catggccgac 1080aagcagaaga acggcatcaa ggtgaacttc
aagatccgcc acaacatcga ggacggcagc 1140gtgcagctcg ccgaccacta
ccagcagaac acccccatcg gcgacggccc cgtgctgctg 1200cccgacaacc
actacctgag cacccagtcc gccctgagca aagaccccaa cgagaagcgc
1260gatcacatgg tcctgctgga gttcgtgacc gccgccggga tcactctcgg
catggacgag 1320ctgtacaagt ccggactcag atctcgagct caagcttcga
attctgcagt cgacggtacc 1380gcgggcccgg gatccaccgg atctagataa
ctgatcataa tcagccatac cacatttgta 1440gaggttttac ttgctttaaa
aaacctccca cacctccccc tgaacctgaa acataaaatg 1500aatgcaattg
ttgttgttaa cttgtttatt gcagcttata atggttacaa ataaagcaat
1560agcatcacaa atttcacaaa taaagcattt ttttcactgc attctagttg
tggtttgtcc 1620aaactcatca atgtatctta acgcgtaaat tgtaagcgtt
aatattttgt taaaattcgc 1680gttaaatttt tgttaaatca gctcattttt
taaccaatag gccgaaatcg gcaaaatccc 1740ttataaatca aaagaataga
ccgagatagg gttgagtgtt gttccagttt ggaacaagag 1800tccactatta
aagaacgtgg actccaacgt caaagggcga aaaaccgtct atcagggcga
1860tggcccacta cgtgaaccat caccctaatc aagttttttg gggtcgaggt
gccgtaaagc 1920actaaatcgg aaccctaaag ggagcccccg atttagagct
tgacggggaa agccggcgaa 1980cgtggcgaga aaggaaggga agaaagcgaa
aggagcgggc gctagggcgc tggcaagtgt 2040agcggtcacg ctgcgcgtaa
ccaccacacc cgccgcgctt aatgcgccgc tacagggcgc 2100gtcaggtggc
acttttcggg gaaatgtgcg cggaacccct atttgtttat ttttctaaat
2160acattcaaat atgtatccgc tcatgagaca ataaccctga taaatgcttc
aataatattg 2220aaaaaggaag agtcctgagg cggaaagaac cagctgtgga
atgtgtgtca gttagggtgt 2280ggaaagtccc caggctcccc agcaggcaga
agtatgcaaa gcatgcatct caattagtca 2340gcaaccaggt gtggaaagtc
cccaggctcc ccagcaggca gaagtatgca aagcatgcat 2400ctcaattagt
cagcaaccat agtcccgccc ctaactccgc ccatcccgcc cctaactccg
2460cccagttccg cccattctcc gccccatggc tgactaattt tttttattta
tgcagaggcc 2520gaggccgcct cggcctctga gctattccag aagtagtgag
gaggcttttt tggaggccta 2580ggcttttgca aagatcgatc aagagacagg
atgaggatcg tttcgcatga ttgaacaaga 2640tggattgcac gcaggttctc
cggccgcttg ggtggagagg ctattcggct atgactgggc 2700acaacagaca
atcggctgct ctgatgccgc cgtgttccgg ctgtcagcgc aggggcgccc
2760ggttcttttt gtcaagaccg acctgtccgg tgccctgaat gaactgcaag
acgaggcagc 2820gcggctatcg tggctggcca cgacgggcgt tccttgcgca
gctgtgctcg acgttgtcac 2880tgaagcggga agggactggc tgctattggg
cgaagtgccg gggcaggatc tcctgtcatc 2940tcaccttgct cctgccgaga
aagtatccat catggctgat gcaatgcggc ggctgcatac 3000gcttgatccg
gctacctgcc cattcgacca ccaagcgaaa catcgcatcg agcgagcacg
3060tactcggatg gaagccggtc ttgtcgatca ggatgatctg gacgaagagc
atcaggggct 3120cgcgccagcc gaactgttcg ccaggctcaa ggcgagcatg
cccgacggcg aggatctcgt 3180cgtgacccat ggcgatgcct gcttgccgaa
tatcatggtg gaaaatggcc gcttttctgg 3240attcatcgac tgtggccggc
tgggtgtggc ggaccgctat caggacatag cgttggctac 3300ccgtgatatt
gctgaagagc ttggcggcga atgggctgac cgcttcctcg tgctttacgg
3360tatcgccgct cccgattcgc agcgcatcgc cttctatcgc cttcttgacg
agttcttctg 3420agcgggactc tggggttcga aatgaccgac caagcgacgc
ccaacctgcc atcacgagat 3480ttcgattcca ccgccgcctt ctatgaaagg
ttgggcttcg gaatcgtttt ccgggacgcc 3540ggctggatga tcctccagcg
cggggatctc atgctggagt tcttcgccca ccctaggggg 3600aggctaactg
aaacacggaa ggagacaata ccggaaggaa cccgcgctat gacggcaata
3660aaaagacaga ataaaacgca cggtgttggg tcgtttgttc ataaacgcgg
ggttcggtcc 3720cagggctggc actctgtcga taccccaccg agaccccatt
ggggccaata cgcccgcgtt 3780tcttcctttt ccccacccca ccccccaagt
tcgggtgaag gcccagggct cgcagccaac 3840gtcggggcgg caggccctgc
catagcctca ggttactcat atatacttta gattgattta 3900aaacttcatt
tttaatttaa aaggatctag gtgaagatcc tttttgataa tctcatgacc
3960aaaatccctt aacgtgagtt ttcgttccac tgagcgtcag accccgtaga
aaagatcaaa 4020ggatcttctt gagatccttt ttttctgcgc gtaatctgct
gcttgcaaac aaaaaaacca 4080ccgctaccag cggtggtttg tttgccggat
caagagctac caactctttt tccgaaggta 4140actggcttca gcagagcgca
gataccaaat actgtccttc tagtgtagcc gtagttaggc 4200caccacttca
agaactctgt agcaccgcct acatacctcg ctctgctaat cctgttacca
4260gtggctgctg ccagtggcga taagtcgtgt cttaccgggt tggactcaag
acgatagtta 4320ccggataagg cgcagcggtc gggctgaacg gggggttcgt
gcacacagcc cagcttggag 4380cgaacgacct acaccgaact gagataccta
cagcgtgagc tatgagaaag cgccacgctt 4440cccgaaggga gaaaggcgga
caggtatccg gtaagcggca gggtcggaac aggagagcgc 4500acgagggagc
ttccaggggg aaacgcctgg tatctttata gtcctgtcgg gtttcgccac
4560ctctgacttg agcgtcgatt tttgtgatgc tcgtcagggg ggcggagcct
atggaaaaac 4620gccagcaacg cggccttttt acggttcctg gccttttgct
ggccttttgc tcacatgttc 4680tttcctgcgt tatcccctga ttctgtggat
aaccgtatta ccgccatgca t 473129108DNAArtificial SequenecSynthetic
Construct 29ctgtacaagt ccggactcag atctcgagct caagcttcga attctgcagt
cgacggtacc 60gcgggcccgg gatccaccgg atctagataa ctgatcataa tcagccat
108308PRTArtificialSynthetic Construct 30Asp Tyr Lys Asp Asp Asp
Asp Lys1 53111PRTArtificial sequenceSynthetic Construct 31Lys Pro
Pro Thr Pro Pro Pro Glu Pro Glu Thr1 5 10329PRTArtificial
SequenceSynthetic Construct 32Tyr Pro Tyr Asp Val Pro Asp Tyr Ala1
5335427DNAArtificial SequenceSynthetic Construct 33gacggatcgg
gagatctccc gatcccctat ggtgcactct cagtacaatc tgctctgatg 60ccgcatagtt
aagccagtat ctgctccctg cttgtgtgtt ggaggtcgct gagtagtgcg
120cgagcaaaat ttaagctaca acaaggcaag gcttgaccga caattgcatg
aagaatctgc 180ttagggttag gcgttttgcg ctgcttcgcg atgtacgggc
cagatatacg cgttgacatt 240gattattgac tagttattaa tagtaatcaa
ttacggggtc attagttcat agcccatata 300tggagttccg cgttacataa
cttacggtaa atggcccgcc tggctgaccg cccaacgacc 360cccgcccatt
gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc
420attgacgtca atgggtggag tatttacggt aaactgccca cttggcagta
catcaagtgt 480atcatatgcc aagtacgccc cctattgacg tcaatgacgg
taaatggccc gcctggcatt 540atgcccagta catgacctta tgggactttc
ctacttggca gtacatctac gtattagtca 600tcgctattac catggtgatg
cggttttggc agtacatcaa tgggcgtgga tagcggtttg 660actcacgggg
atttccaagt ctccacccca ttgacgtcaa tgggagtttg ttttggcacc
720aaaatcaacg ggactttcca aaatgtcgta acaactccgc cccattgacg
caaatgggcg 780gtaggcgtgt acggtgggag gtctatataa gcagagctct
ctggctaact agagaaccca 840ctgcttactg gcttatcgaa attaatacga
ctcactatag ggagacccaa gctggctagc 900gtttaaacgg gccctctaga
ctcgagcggc cgccactgtg ctggatatct gcagaattcc 960accacactgg
actagtggat ccgagctcgg taccaagctt aagtttaaac cgctgatcag
1020cctcgactgt gccttctagt tgccagccat ctgttgtttg cccctccccc
gtgccttcct 1080tgaccctgga aggtgccact cccactgtcc tttcctaata
aaatgaggaa attgcatcgc 1140attgtctgag taggtgtcat tctattctgg
ggggtggggt ggggcaggac agcaaggggg 1200aggattggga agacaatagc
aggcatgctg gggatgcggt gggctctatg gcttctgagg 1260cggaaagaac
cagctggggc tctagggggt atccccacgc gccctgtagc ggcgcattaa
1320gcgcggcggg tgtggtggtt acgcgcagcg tgaccgctac acttgccagc
gccctagcgc 1380ccgctccttt cgctttcttc ccttcctttc tcgccacgtt
cgccggcttt ccccgtcaag 1440ctctaaatcg ggggctccct ttagggttcc
gatttagtgc tttacggcac ctcgacccca 1500aaaaacttga ttagggtgat
ggttcacgta gtgggccatc gccctgatag acggtttttc 1560gccctttgac
gttggagtcc acgttcttta atagtggact cttgttccaa actggaacaa
1620cactcaaccc tatctcggtc tattcttttg atttataagg gattttgccg
atttcggcct 1680attggttaaa aaatgagctg atttaacaaa aatttaacgc
gaattaattc tgtggaatgt 1740gtgtcagtta gggtgtggaa agtccccagg
ctccccagca ggcagaagta tgcaaagcat 1800gcatctcaat tagtcagcaa
ccaggtgtgg aaagtcccca ggctccccag caggcagaag 1860tatgcaaagc
atgcatctca attagtcagc aaccatagtc ccgcccctaa ctccgcccat
1920cccgccccta actccgccca gttccgccca ttctccgccc catggctgac
taattttttt 1980tatttatgca gaggccgagg ccgcctctgc ctctgagcta
ttccagaagt agtgaggagg 2040cttttttgga ggcctaggct tttgcaaaaa
gctcccggga gcttgtatat ccattttcgg 2100atctgatcaa gagacaggat
gaggatcgtt tcgcatgatt gaacaagatg gattgcacgc 2160aggttctccg
gccgcttggg tggagaggct attcggctat gactgggcac aacagacaat
2220cggctgctct gatgccgccg tgttccggct gtcagcgcag gggcgcccgg
ttctttttgt 2280caagaccgac ctgtccggtg ccctgaatga actgcaggac
gaggcagcgc ggctatcgtg 2340gctggccacg acgggcgttc cttgcgcagc
tgtgctcgac gttgtcactg aagcgggaag 2400ggactggctg ctattgggcg
aagtgccggg gcaggatctc ctgtcatctc accttgctcc 2460tgccgagaaa
gtatccatca tggctgatgc aatgcggcgg ctgcatacgc ttgatccggc
2520tacctgccca ttcgaccacc aagcgaaaca tcgcatcgag cgagcacgta
ctcggatgga 2580agccggtctt gtcgatcagg atgatctgga cgaagagcat
caggggctcg cgccagccga 2640actgttcgcc aggctcaagg cgcgcatgcc
cgacggcgag gatctcgtcg tgacccatgg 2700cgatgcctgc ttgccgaata
tcatggtgga aaatggccgc ttttctggat tcatcgactg 2760tggccggctg
ggtgtggcgg accgctatca ggacatagcg ttggctaccc gtgatattgc
2820tgaagagctt ggcggcgaat gggctgaccg cttcctcgtg ctttacggta
tcgccgctcc 2880cgattcgcag cgcatcgcct tctatcgcct tcttgacgag
ttcttctgag cgggactctg 2940gggttcgaaa tgaccgacca agcgacgccc
aacctgccat cacgagattt cgattccacc 3000gccgccttct atgaaaggtt
gggcttcgga atcgttttcc gggacgccgg ctggatgatc 3060ctccagcgcg
gggatctcat gctggagttc ttcgcccacc ccaacttgtt tattgcagct
3120tataatggtt acaaataaag caatagcatc acaaatttca caaataaagc
atttttttca 3180ctgcattcta gttgtggttt gtccaaactc atcaatgtat
cttatcatgt ctgtataccg 3240tcgacctcta gctagagctt ggcgtaatca
tggtcatagc tgtttcctgt gtgaaattgt 3300tatccgctca caattccaca
caacatacga gccggaagca taaagtgtaa agcctggggt 3360gcctaatgag
tgagctaact cacattaatt gcgttgcgct cactgcccgc tttccagtcg
3420ggaaacctgt cgtgccagct gcattaatga atcggccaac gcgcggggag
aggcggtttg 3480cgtattgggc gctcttccgc ttcctcgctc actgactcgc
tgcgctcggt cgttcggctg 3540cggcgagcgg tatcagctca ctcaaaggcg
gtaatacggt tatccacaga atcaggggat 3600aacgcaggaa agaacatgtg
agcaaaaggc cagcaaaagg ccaggaaccg taaaaaggcc 3660gcgttgctgg
cgtttttcca taggctccgc ccccctgacg agcatcacaa aaatcgacgc
3720tcaagtcaga ggtggcgaaa cccgacagga ctataaagat accaggcgtt
tccccctgga 3780agctccctcg tgcgctctcc tgttccgacc ctgccgctta
ccggatacct gtccgccttt 3840ctcccttcgg gaagcgtggc gctttctcat
agctcacgct gtaggtatct cagttcggtg 3900taggtcgttc gctccaagct
gggctgtgtg cacgaacccc ccgttcagcc cgaccgctgc 3960gccttatccg
gtaactatcg tcttgagtcc aacccggtaa gacacgactt atcgccactg
4020gcagcagcca ctggtaacag gattagcaga gcgaggtatg taggcggtgc
tacagagttc 4080ttgaagtggt ggcctaacta cggctacact agaagaacag
tatttggtat ctgcgctctg 4140ctgaagccag ttaccttcgg aaaaagagtt
ggtagctctt gatccggcaa acaaaccacc 4200gctggtagcg gtttttttgt
ttgcaagcag cagattacgc gcagaaaaaa aggatctcaa 4260gaagatcctt
tgatcttttc tacggggtct gacgctcagt ggaacgaaaa ctcacgttaa
4320gggattttgg tcatgagatt atcaaaaagg atcttcacct agatcctttt
aaattaaaaa 4380tgaagtttta aatcaatcta aagtatatat gagtaaactt
ggtctgacag ttaccaatgc 4440ttaatcagtg aggcacctat ctcagcgatc
tgtctatttc gttcatccat agttgcctga 4500ctccccgtcg tgtagataac
tacgatacgg gagggcttac catctggccc cagtgctgca 4560atgataccgc
gagacccacg ctcaccggct ccagatttat cagcaataaa ccagccagcc
4620ggaagggccg agcgcagaag tggtcctgca actttatccg cctccatcca
gtctattaat 4680tgttgccggg aagctagagt aagtagttcg ccagttaata
gtttgcgcaa cgttgttgcc 4740attgctacag gcatcgtggt gtcacgctcg
tcgtttggta tggcttcatt cagctccggt 4800tcccaacgat caaggcgagt
tacatgatcc cccatgttgt gcaaaaaagc ggttagctcc 4860ttcggtcctc
cgatcgttgt cagaagtaag ttggccgcag tgttatcact catggttatg
4920gcagcactgc ataattctct tactgtcatg ccatccgtaa gatgcttttc
tgtgactggt 4980gagtactcaa ccaagtcatt ctgagaatag tgtatgcggc
gaccgagttg ctcttgcccg 5040gcgtcaatac gggataatac cgcgccacat
agcagaactt taaaagtgct catcattgga 5100aaacgttctt cggggcgaaa
actctcaagg atcttaccgc tgttgagatc cagttcgatg 5160taacccactc
gtgcacccaa ctgatcttca gcatctttta ctttcaccag cgtttctggg
5220tgagcaaaaa caggaaggca aaatgccgca aaaaagggaa taagggcgac
acggaaatgt 5280tgaatactca tactcttcct ttttcaatat tattgaagca
tttatcaggg ttattgtctc 5340atgagcggat acatatttga atgtatttag
aaaaataaac aaataggggt tccgcgcaca 5400tttccccgaa aagtgccacc tgacgtc
54273421RNAArtificial SequencePARG RNAi 34ccaguuggau ggacacuaau u
213521RNAArtificial SequencePARG RNAi 35uuacgaaggu accauagaau u
213621RNAArtificial SequenceARH3 RNAi 36ggacagaagc cuuguacuau u
213721RNAArtificial SequenceARH3 RNAi 37ccauugcugg ugccuacuau u
213821RNAArtificial SequenceVector-target RNAi 38guuuucacuc
cagcuaacac a 213921RNAArtificial SequenceVector-target RNAi
39uucaaaagug aggucgauug u 214025RNAArtificial SequencePARP13 RNAi
40gcucacggaa cuaugagcug aguuu 25411671DNAHomo sapiens 41gcagtctgcg
cgcggatggc cgcagcggcg atggcggcag cggcaggtgg aggggctggc 60gcggcccgct
ccctctcgcg cttccgaggc tgcctggctg gcgcgctgct cggggactgc
120gtgggctcct tctacgaggc ccacgacacc gtcgacctga cgtcagtcct
gcgtcatgtc 180cagagtctgg agccggaccc cggcacgccc gggagtgagc
ggacagaagc cttgtactac 240acagatgaca cagccatggc cagggccctg
gtgcagtccc tgctagccaa ggaggccttt 300gacgaggtgg acatggctca
cagatttgct caggagtaca agaaagaccc tgacaggggc 360tatggtgctg
gagtagtcac tgtcttcaag aagctcctga accccaaatg tcgcgatgtc
420tttgagcctg cccgggccca gtttaacggg aaaggctcct atggcaatgg
aggtgccatg 480cgggtggctg gcatctccct ggcctatagc agtgtccagg
atgtgcagaa gtttgcccgg 540ctctcggccc agctgacaca cgcctcctcc
ctgggttaca atggcgccat cctgcaggcc 600ctggctgtgc acctggcctt
gcagggcgag tcttccagcg agcactttct caagcaactc 660ctgggccaca
tggaggatct ggagggtgat gcccagtccg tcttggatgc cagggagttg
720ggcatggagg agcgtccata ctccagccgc ctgaagaaga ttggagagct
tctagaccag 780gcatcggtga ccagggagga agtggtgtct gagctaggga
atggcattgc tgcctttgag 840tcggtaccca ccgccatcta ctgcttccta
cgctgcatgg agccagaccc tgagatccct 900tctgccttca atagcctcca
aaggactctc atttattcca tctcacttgg tggggacaca 960gacaccattg
ccaccatggc tggggccatt gctggtgcct actatgggat ggatcaggtg
1020ccagagagct ggcagcaaag ctgtgaaggc tacgaggaga cagacatcct
ggcccaaagc 1080ctgcaccgtg tcttccagaa gagttgatga gggctacagc
tgttggggct ctgccaggtc 1140ccctgggacc aactacagct ccaatcagaa
accctgcgct tccttgagtg tggcttccca 1200cttttcctgc attgtggagc
tgactgagta caccggtgag gctggggtct ctgcagggga 1260ggtcactgga
acagcgagca agggactggt gcctcgctgg tgctgggtct ctggtttgct
1320gcagagccgt aggacactcc tggctcctca gtaggacaga cagacgcagg
cgggtttatt 1380ttggaggggt acttgtggca ttttcctgta ttgtcttgga
catgggatgt ggggaggtgg 1440aaatgatgag cagtagcatc atttctccct
gttgggtttt agccagtttg ccagcaagcg 1500catcctagca gggtccccga
gcagcaggtt gtgtggatga agggacaggc acttgcatcc 1560agctgatcta
ggtcacacct ggctcttggc tgccatgtgg cttattaaca gcttccagtg
1620gaagtcgcaa taaacagttt ttggtaaatc tcaaaaaaaa aaaaaaaaaa a
1671424276DNAHomo sapiens 42cggtggtggg aaagtgaacg aatcccgaat
caaagcggcg cattgaggca ggtggggtgc 60cagtggaaga gagaaagcag gcgagtgttt
acggcctgac ttgggaggcc ggcggatcag 120caattgcaga agcaggcagc
ggcagagagg gaatggtgca ggcaggcgct gagaaggacg 180cgcagtccat
ctctctcagg ttagtgaaat gaggctctcc gcccggggcc ggcccgggga
240cagtgcgctg ctggtcccag catgaatgcg ggccccggct gtgaaccctg
caccaagcga 300ccccgctggg gcgccgctac aacttcgccg gctgcttcgg
acgcccggag ctttcccagc 360aggcagaggc gcgtcctcga ccccaaggac
gctcacgtgc agttcagggt cccaccgtcc 420tcgccagcct gcgtcccagg
gcgggcggga cagcacagag gcagcgccac ctcgcttgtt 480ttcaaacaaa
agactattac cagttggatg gacactaaag gaatcaagac agcggaatca
540gaaagtttgg atagtaaaga aaacaacaat acaagaatag aatccatgat
gagttctgta 600caaaaagata acttttacca acataatgta gaaaaattag
aaaatgtttc tcagctaagt 660cttgataagt cacccactga aaaaagtaca
cagtatttga accagcatca gactgcagca 720atgtgtaagt ggcaaaatga
agggaaacac acggagcagc ttttggaaag tgaacctcaa 780acagtaaccc
tggtaccaga gcagtttagt aatgctaaca ttgatcggtc acctcaaaat
840gatgatcaca gtgacacaga tagtgaagag aatagagaca atcaacagtt
tctcacaact 900gtaaagcttg caaatgcaaa gcagactacg gaagatgaac
aggccagaga agccaaaagc 960caccagaagt gcagcaagtc ttgcgatcct
ggggaagact gtgcaagttg tcagcaagat 1020gagatagatg tggtgccaga
gagtccattg tcagatgttg gctctgagga tgttggtact 1080gggccaaaaa
atgacaacaa attgactaga caagaaagtt gcctaggaaa ttctcctcca
1140tttgagaagg aaagtgaacc cgagtcaccg atggatgtgg ataattctaa
aaatagttgt 1200caagactcag aagcagatga ggagacaagt ccaggttttg
atgaacaaga agatggtagt 1260tcctcccaaa cagcaaataa accttcaagg
ttccaagcaa gagacgctga cattgaattt 1320aggaaacggt actctactaa
gggcggtgaa gttagattac atttccaatt tgaaggagga 1380gagagtcgca
ctggaatgaa tgatttaaat gctaaactac ctggaaatat ttctagcctg
1440aatgtagaat gcagaaattc taagcaacat ggaaaaaagg attctaaaat
cacagatcat 1500ttcatgagac tgcccaaagc agaggacaga agaaaagaac
agtgggaaac caaacatcaa 1560agaacagaaa ggaagatccc taaatacgtt
ccacctcacc tttctccaga taagaagtgg 1620cttggaactc ccattgagga
gatgagaaga atgcctcggt gtgggatccg gctgcctctc 1680ttgagaccat
ctgccaatca cacagtaact attcgggtag atcttttgcg agcaggagaa
1740gttcctaaac cttttccaac acattataaa gatttgtggg ataacaagca
tgttaaaatg 1800ccttgttcag aacaaaattt gtacccagtg gaagatgaga
atggtgagcg aactgcgggg 1860agccggtggg agctcattca gactgcactt
ctcaacaaat ttacacgacc ccaaaacttg 1920aaggatgcta ttctgaaata
caatgtggca tattctaaga aatgggactt tacagctttg 1980atcgatttct
gggataaggt acttgaagaa gcagaagctc aacatttata tcagtccatc
2040ttgcctgata tggtgaaaat tgcactctgt ctgccaaata tttgcaccca
gccaatacca 2100ctcctgaaac agaagatgaa tcattccatc acaatgtcgc
aggaacagat tgccagtctt 2160ttagctaatg ctttcttctg cacatttcca
cgacgaaatg ctaagatgaa atcggagtat 2220tctagttacc cagacattaa
cttcaatcga ttgtttgagg gacgttcatc aaggaaaccg 2280gagaaactta
aaacgctctt ctgctacttt agaagagtca cagagaaaaa acctactggg
2340ttggtgacat ttacaagaca gagtcttgaa gattttccag aatgggaaag
atgtgaaaaa 2400cccttgacac gattgcatgt cacttacgaa ggtaccatag
aagaaaatgg ccaaggcatg 2460ctacaggtgg attttgcaaa tcgttttgtt
ggaggtggtg taaccagtgc aggacttgtg 2520caagaagaaa tccgcttttt
aatcaatcct gagttgatta tttcacggct cttcactgag 2580gtgctggatc
acaatgaatg tctaattatc acaggtactg agcagtacag tgaatacaca
2640ggctatgctg agacatatcg ttggtcccgg agccacgaag atgggagtga
aagggacgac 2700tggcagcggc gctgcactga gatcgttgcc atcgatgctc
ttcacttcag acgctacctc 2760gatcagtttg tgcctgagaa aatgagacgc
gagctgaaca aggcttactg tggatttctc 2820cgtcctggag tttcttcaga
gaatctttct gcagtggcca
caggaaactg gggctgtggt 2880gcctttgggg gtgatgccag gttaaaagcc
ttaatacaga tattggcagc tgctgcagct 2940gagcgagatg tggtttattt
cacctttggg gactcagaat tgatgagaga catttacagc 3000atgcacattt
tccttactga aaggaaactc actgttggag atgtgtataa gctgttgcta
3060cgatactaca atgaagaatg cagaaactgt tccacccctg gaccagacat
caagctttat 3120ccattcatat accatgctgt cgagtcctgt gcagagaccg
ctgaccattc agggcaaagg 3180acagggacct gaggagccga gcgaatagca
tctcctccca cctcccacca gagacgtcct 3240gtttgagctg tcaggtgtaa
tatatgaatt gacttaagtt aatataaatg tgtacataat 3300ccacatttgt
agtcaaggac gcaatctctt ccacacatgt gcagttgtca gttggtacat
3360ctaaactccc tccatcctga ctcacgtgga cttagatatg ttttgtttct
attttcttct 3420atttcagttt ttcattcttt gatgtttatt tcttttgtcc
atcagatctc ttgtgaaatc 3480ccatggaagg ttgtgctcag cctgtcgggt
ctctttcttc ctgcccatat attataccag 3540ttgcttctgc agcccgcaga
tgccagcgat gccaggaaac aagttgaaat ccaggaatct 3600ctttaactga
ttttgctaaa aatctccctg tgagccttcc actcaactct taatatgctt
3660gcattgttta agtttttaaa ttctgaaaat taataattag ggtttttttc
atatgtgttg 3720cataatgcaa acctcctagg ttaaaatagt ttctttattt
aagatagaat aatttccaga 3780aattgtactt ttgaggtatc atttttatct
gtaatggttt gtctgtcttt tttcctctga 3840tcagtatttt tttataccag
ttttggagac tggctgagat gaaaggaaat gtggaataaa 3900aggaggtttt
cctgatgtgg tgtaaagaaa acagattcaa gagaattgaa gatttttttt
3960gtttcttggt acttttttct ttttaaatta ggactaatgt ttcttttgtg
gtgcttgagg 4020catattcata taaccaaagt ttgagaactg ggaacttcat
gctgatttgt acatattgaa 4080gtttctctgg tattcaaagg ttatatagtg
aatgaatttt cattaataaa tcactttgtc 4140agaaactccc atatcatcta
tattttatat atgtatatat aaacgtatgc tctttaagtg 4200tgtctatatg
tgagcacata aaatctaaat aaaattggac tggtgggaaa caaaaaaaaa
4260aaaaaaaaaa aaaaaa 42764325RNAArtificial SequencePARP16 RNAi
43cccaaguacu ucguggucac caaua 254421RNAArtificial SequencePARP1
RNAi 44aagccuccgc uccugaacaa u 214521RNAArtificial SequencePARP2A
RNAi 45aaucagugua augaacuacu a 214621RNAArtificial SequencePARP2B
RNAi 46aaugauucag cuauuagaag a 214725RNAArtificial SequencePARP3
RNAi 47ggacccaggu guaugaggac uacaa 254821RNAArtificial
SequencePARP4 RNAi 48aaacaaggau uucuacuaag a 214921RNAArtificial
SequencePARP5A RNAi 49aacaauucac cgucguccuc u 215021RNAArtificial
SequencePARP5B RNAi 50aagcuucaga auggugcaaa u 215125RNAArtificial
SequencePARP6 RNAi 51cccaacaaug gaaacaucug agcaa
255225RNAArtificial SequencePARP6 RNAi 52uugcucagau guuuccauug
uuggg 255325RNAArtificial SequencePARP6 RNAi 53gguucaaggc
aagugguacc aucaa 255425RNAArtificial SequencePARP6 RNAi
54uugaugguac cacuugccuu gaacc 255525RNAArtificial SequencePARP6
RNAi 55caaaguggaa guguuuggcu acccu 255625RNAArtificial
SequencePARP6 RNAi 56aggguagcca aacacuucca cuuug
255725RNAArtificial SequencePARP6 RNAi 57cagaacagag gauuccaaca
uugaa 255825RNAArtificial SequencePARP6 RNAi 58uucaauguug
gaauccucug uucug 255925RNAArtificial SequencePARP7 RNAi
59ugaggucuuu gaggccaaua uuaaa 256025RNAArtificial SequencePARP7
RNAi 60uuuaauauug gccucaaaga ccuca 256125RNAArtificial
SequencePARP7 RNAi 61gacuuucugc aaggcacuug uauuu
256225RNAArtificial SequencePARP7 RNAi 62aaauacaagu gccuugcaga
aaguc 256325RNAArtificial SequencePARP7 RNAi 63uccuccaccu
cuugaagcaa cuuca 256425RNAArtificial SequencePARP7 RNAi
64ugaaguugcu ucaagaggug gagga 256525RNAArtificial SequencePARP7
RNAi 65aaugaugacc agaguuaccc uuauu 256625RNAArtificial
SequencePARP7 RNAi 66aauaagggua acucugguca ucauu
256725RNAArtificial SequencePARP8 RNAi 67ggaagauucu gaaggugaca
augau 256825RNAArtificial SequencePARP8 RNAi 68aucauuguca
ccuucagaau cuucc 256925RNAArtificial SequencePARP8 RNAi
69cccacaacug gaagcugauu uguca 257025RNAArtificial SequencePARP8
RNAi 70ugacaaauca gcuuccaguu guggg 257125RNAArtificial
SequencePARP8 RNAi 71gaaguggaau cuaucuuagu ccaau
257225RNAArtificial SequencePARP8 RNAi 72auuggacuaa gauagauucc
acuuc 257325RNAArtificial SequencePARP8 RNAi 73gccuuaugug
aagugaucac cucau 257425RNAArtificial SequencePARP8 RNAi
74augaggugau cacuucacau aaggc 257525RNAArtificial SequencePARP9
RNAi 75gccggagcag cagcuuacaa ugaaa 257625RNAArtificial
SequencePARP9 RNAi 76uuucauugua agcugcugcu ccggc
257725RNAArtificial SequencePARP9 RNAi 77cccucugaau uuguguacaa
agacu 257825RNAArtificial SequencePARP9 RNAi 78agucuuugua
cacaaauuca gaggg 257925RNAArtificial SequencePARP9 RNAi
79ggacccuacu guugcugccu uuaaa 258025RNAArtificial SequencePARP9
RNAi 80uuuaaaggca gcaacaguag ggucc 258125RNAArtificial
SequencePARP9 RNAi 81uggcagacgg cagauguaau uguua
258225RNAArtificial SequencePARP9 RNAi 82uaacaauuac aucugccguc
ugcca 258325RNAArtificial SequencePARP10 RNAi 83cauggugcag
gguagaggga uuaug 258425RNAArtificial SequencePARP10 RNAi
84cauaaucccu cuacccugca ccaug 258525RNAArtificial SequencePARP10
RNAi 85gccuggugga gauggugcua uugau 258625RNAArtificial
SequencePARP10 RNAi 86aucaauagca ccaucuccac caggc
258725RNAArtificial SequencePARP10 RNAi 87agacgucgcu cucuugccac
uugaa 258825RNAArtificial SequencePARP10 RNAi 88uucaaguggc
aagagagcga cgucu 258925RNAArtificial SequencePARP10 RNAi
89ugggcagcau uagcugccau guguu 259025RNAArtificial SequencePARP10
RNAi 90aacacauggc agcuaaugcu gccca 259125RNAArtificial
SequencePARP11 RNAi 91caacaaacaa ugaaguggau gacau
259225RNAArtificial SequencePARP11 RNAi 92augucaucca cuucauuguu
uguug 259325RNAArtificial SequencePARP11 RNAi 93cagccggaua
ccaacaguca guguu 259425RNAArtificial SequencePARP11 RNAi
94aacacugacu guugguaucc ggcug 259525RNAArtificial SequencePARP11
RNAi 95caaacccuug uggcuccauu ucuuu 259625RNAArtificial
SequencePARP11 RNAi 96aaagaaaugg agccacaagg guuug
259725RNAArtificial SequencePARP11 RNAi 97ugccaccaca cugggagaau
gugaa 259825RNAArtificial SequencePARP11 RNAi 98uucacauucu
cccagugugg uggca 259925RNAArtificial SequencePARP12 RNAi
99uccaccucug cagguucaug gucua 2510025RNAArtificial SequencePARP12
RNAi 100uagaccauga accugcagag gugga 2510125RNAArtificial
SequencePARP12 RNAi 101ugccagaaau uugccaacau uacaa
2510225RNAArtificial SequencePARP12 RNAi 102uuguaauguu ggcaaauuuc
uggca 2510325RNAArtificial SequencePARP12 RNAi 103ggugagcagg
cugccuacca uuuau 2510425RNAArtificial SequencePARP12 RNAi
104auaaauggua ggcagccugc ucacc 2510525RNAArtificial SequencePARP12
RNAi 105aggauuugga caacauggaa cuuau 2510625RNAArtificial
SequencePARP12 RNAi 106auaaguucca uguuguccaa auccu
2510725RNAArtificial SequencePARP13 RNAi 107gcugacccaa gaguagcacu
uguua 2510825RNAArtificial SequencePARP13 RNAi 108uaacaagugc
uacucuuggg ucagc 2510925RNAArtificial SequencePARP13 RNAi
109ccgguggcag augcuuauug guaaa 2511025RNAArtificial SequencePARP13
RNAi 110uuuaccaaua agcaucugcc accgg 2511125RNAArtificial
SequencePARP13 RNAi 111aaacucagcu cauaguuccg ugagc
2511225RNAArtificial SequencePARP13 RNAi 112ugccucagug guaugugcag
cagau 2511325RNAArtificial SequencePARP13 RNAi 113aucugcugca
cauaccacug aggca 2511425RNAArtificial SequencePARP14 RNAi
114uggccugucu aaugaugacu uucaa 2511525RNAArtificial SequencePARP14
RNAi 115uugaaaguca ucauuagaca ggcca 2511625RNAArtificial
SequencePARP14 RNAi 116ccuggugcug augacuacag uuuaa
2511725RNAArtificial SequencePARP14 RNAi 117uuaaacugua gucaucagca
ccagg 2511825RNAArtificial SequencePARP14 RNAi 118gccacuuucu
guguucccau acuau 2511925RNAArtificial SequencePARP14 RNAi
119auaguauggg aacacagaaa guggc 2512025RNAArtificial SequencePARP14
RNAi 120gaagagucac uagaucuucc cuuau 2512125RNAArtificial
SequencePARP14 RNAi 121auaagggaag aucuagugac ucuuc
2512225RNAArtificial SequencePARP15 RNAi 122gaugaauuca cuaacugguc
aagaa 2512325RNAArtificial SequencePARP15 RNAi 123uucuugacca
guuagugaau ucauc 2512425RNAArtificial SequencePARP15 RNAi
124ccuaucacag uugcugauaa cauaa 2512525RNAArtificial SequencePARP15
RNAi 125uuauguuauc agcaacugug auagg 2512625RNAArtificial
SequencePARP15 RNAi 126ggacugacau gaaucaucag cuguu
2512725RNAArtificial SequencePARP15 RNAi 127aacagcugau gauucauguc
agucc 2512825RNAArtificial SequencePARP15 RNAi 128cgaguacuua
cuggagucuu cacaa 2512925RNAArtificial SequencePARP15 RNAi
129uugugaagac uccaguaagu acucg 2513025RNAArtificial SequencePARP16
RNAi 130cagugcaggg aaggcagagu uugaa 2513125RNAArtificial
SequencePARP16 RNAi 131uucaaacucu gccuucccug cacug
2513225RNAArtificial SequencePARP16 RNAi 132gagaccaaag gagaacgaga
ccuaa 2513325RNAArtificial SequencePARP16 RNAi 133uuaggucucg
uucuccuuug gucuc 2513425RNAArtificial SequencePARP16 RNAi
134gacuugagcc uggcccucau auaca 2513525RNAArtificial SequencePARP16
RNAi 135uguauaugag ggccaggcuc aaguc 2513625RNAArtificial
SequencePARP16 RNAi 136uauuggugac cacgaaguac uuggg 25
* * * * *