U.S. patent application number 12/416140 was filed with the patent office on 2011-04-21 for method of treating neurodegenerative disease.
This patent application is currently assigned to ALNYLAM PHARMACEUTICALS, INC.. Invention is credited to David Bumcrot, Matthew J. Farrer, Demetrius M. Maraganore, Hans-Peter Vornlocher.
Application Number | 20110092565 12/416140 |
Document ID | / |
Family ID | 34864348 |
Filed Date | 2011-04-21 |
United States Patent
Application |
20110092565 |
Kind Code |
A1 |
Bumcrot; David ; et
al. |
April 21, 2011 |
METHOD OF TREATING NEURODEGENERATIVE DISEASE
Abstract
Aspects featured in the invention relate to compositions and
methods for inhibiting alpha-synuclein (SNCA) gene expression, such
as for the treatment of neurodegenerative disorders. An anti-SNCA
agent featured herein that targets the SNCA gene can have been
modified to alter distribution in favor of neural cells.
Inventors: |
Bumcrot; David; (Belmont,
MA) ; Farrer; Matthew J.; (Jacksonville Beach,
FL) ; Maraganore; Demetrius M.; (Rochester, MN)
; Vornlocher; Hans-Peter; (Bayreuth, DE) |
Assignee: |
ALNYLAM PHARMACEUTICALS,
INC.
Cambridge
MA
|
Family ID: |
34864348 |
Appl. No.: |
12/416140 |
Filed: |
March 31, 2009 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11548890 |
Oct 12, 2006 |
7595306 |
|
|
12416140 |
|
|
|
|
10991286 |
Nov 17, 2004 |
|
|
|
11548890 |
|
|
|
|
PCT/US04/18271 |
Jun 9, 2004 |
|
|
|
10991286 |
|
|
|
|
60476947 |
Jun 9, 2003 |
|
|
|
Current U.S.
Class: |
514/44A |
Current CPC
Class: |
C12N 15/113 20130101;
C12N 2310/321 20130101; A61P 25/28 20180101; C12N 2310/315
20130101; C12N 2310/14 20130101; C12N 2310/3517 20130101; C12N
2310/321 20130101; C12N 2310/3521 20130101 |
Class at
Publication: |
514/44.A |
International
Class: |
A61K 31/7105 20060101
A61K031/7105; A61P 25/28 20060101 A61P025/28 |
Goverment Interests
GOVERNMENT SUPPORT
[0002] The work described herein was carried out, at least in part,
using funds from the U.S. government under grant number ES10751
awarded by National Institute of Environmental Health Sciences, and
grant numbers NS33978 and NS40256 awarded by the National Institute
of Neurological Disorders and Stroke. The government may therefore
have certain rights in the invention.
Claims
1. A method of reducing gene expression in .alpha.-synuclein (SNCA)
gene in a subject with an antisense or an RNAi agent.
2. The method of claim 1, wherein the SNCA gene is a wild type SNCA
gene.
3. The method of claim 1, wherein the subject comprises
haplotypes.
4. The method of claim 4, wherein the haplotypes are defined by
SNCA REP1 promoter variants.
5. The method of claim 1, wherein the gene expression occurs
through ubiquitin carboxy-terminal hydrolase L1 gene or the
ubiquitin proteasomal system.
6. The method of claim 1, wherein the subject comprises
pre-symptomatic Parkinson's Disease (PD).
7. The method of claim 7, wherein the pre-symptomatic PD is
identified by profiling risk factors and studying functional
neuroimaging of the subject.
8. The method of claim 8, wherein the functional imaging is
selected from the group consisting of fluorodopa and positron
emission tomography.
9. The method of claim 1, wherein the RNAi agent is delivered
across the blood brain barrier.
10. The method of claim 1, wherein the RNAi agent is administered
to a subject orally, parentally, or intraparentchymally.
11. A method of reducing gene expression in .alpha.-synuclein
(SNCA) gene in a patient with parkinsonism and/or Lewy body
dementia with an antisense or an RNAi agent.
12. A method of slowing the rate of PD progression by reducing gene
expression in .alpha.-synuclein (SNCA) gene in a subject with an
antisense or an RNAi agent.
Description
RELATED APPLICATIONS
[0001] This application is a continuation of U.S. application Ser.
No. 11/548,890, filed Oct. 12, 2006, which is a
continuation-in-part of U.S. application Ser. No. 10/991,286, filed
Nov. 17, 2004, which is a continuation-in-part of International
Application No. PCT/US2004/018271, filed Jun. 9, 2004, which claims
the benefit of U.S. Provisional Application No. 60/476,947, filed
Jun. 9, 2003. The contents of these applications are incorporated
herein by reference in their entirety.
SEQUENCE LISTING
[0003] This application incorporates by reference the nucleotide
and/or protein sequence information in the electronic Sequence
Listing (Item ID: 09323b67804bf888; 22.83 kb; 58 sequences), filed
with the USPTO on Mar. 20, 2007 in conjuction with U.S. application
Ser. No. 11/548,890, filed Oct. 12, 2006.
TECHNICAL FIELD
[0004] This invention relates to methods and compositions for
treating neurodegenerative disease, and more particularly to the
downregulation of the alpha-synuclein gene for the treatment of
synucleinopathies.
BACKGROUND
[0005] RNA interference or "RNAi" is a term initially coined by
Fire and co-workers to describe the observation that
double-stranded RNA (dsRNA) can block gene expression when it is
introduced into worms (Fire et al., Nature 391:806-811, 1998).
Short dsRNA directs gene-specific, post-transcriptional silencing
in many organisms, including vertebrates, and has provided a new
tool for studying gene function.
[0006] Expression of the SNCA gene produces the protein
alpha-synuclein. Mutations in the SNCA gene and SNCA gene
multiplications have been linked to familial Parkinson's disease
(PD). PD patients demonstrate alpha-synuclein protein aggregates in
the brain. Similar aggregates are observed in patients diagnosed
with sporadic PD, Alzheimer's Disease, multiple system atrophy, and
Lewy body dementia.
SUMMARY
[0007] Aspects of the invention relate to compositions for
inhibiting alpha-synuclein (SNCA) expression, and methods of using
those compositions. In one aspect, the invention features a method
of treating a subject by administering an agent which inhibits
expression of SNCA. In a preferred embodiment, the subject is a
mammal, such as a human, e.g., a subject diagnosed as having, or at
risk for developing, a neurodegenerative disorder. The inhibition
can be effected at any level, e.g., at the level of transcription,
the level of translation, or post-translationally. Agents that
inhibit SNCA expression include iRNA agents, ribozymes, and
antisense molecules that target SNCA RNA, zinc finger proteins, as
well as antibodies or naturally occurring or synthetic
polypeptides, or small molecules, which, in preferred embodiments,
bind to and inhibit the SNCA protein.
[0008] In a particularly preferred embodiment the inhibitory agent
is an iRNA agent that targets an SNCA nucleic acid, e.g., an SNCA
RNA. The iRNA agent has an antisense strand complementary to a
nucleotide sequence of an SNCA RNA, and a sense strand sufficiently
complementary to hybridize to the antisense strand. In one
embodiment, the iRNA agent includes a modification that stabilizes
the iRNA agent in a biological sample. For example, the modified
iRNA agent is less susceptible to degradation, e.g., less
susceptible to cleavage by an exo- or endonuclease. The mRNA agent
can include, for example, at least one 5'-uridine-adenine-3'
(5'-UA-3') dinucleotide wherein the uridine is a 2'-modified
nucleotide, or at least one 5'-uridine-guanine-3' (5'-UG-3')
dinucleotide, wherein the 5'-uridine is a 2'-modified nucleotide,
or at least one 5'-cytidine-adenine-3' (5'-CA-3') dinucleotide,
wherein the 5'-cytidine is a 2'-modified nucleotide, or at least
one 5'-uridine-uridine-3' (5'-UU-3') dinucleotide, wherein the
5'-uridine is a 2'-modified nucleotide, or at least one
5'-cytidine-cytidine-3' (5'-CC-3') dinucleotide, wherein the
5'-cytidine is a 2'-modified nucleotide. The iRNA agent can include
at least 2, at least 3, at least 4 or at least 5 of the
dinucleotides. In one embodiment, the 2'-modified nucleotide is a
2'-O-methylated nucleotide. In another embodiment the iRNA agent
includes a phosphorothioate.
[0009] In another embodiment, the antisense strand of the iRNA
agent includes the nucleotide sequence of SEQ ID NOs:6, 16, 18, 20,
22, or 24. In another embodiment, the sense strand of the iRNA
agent includes the nucleotide sequence of SEQ ID NOs:5, 15, 17, 19,
21, or 23. In yet another embodiment, the antisense strand of the
iRNA agent overlaps the nucleotide sequence of SEQ ID NOs:6, 16,
18, 20, 22, or 24, e.g., by at least 1, 5, 10, 11, 12, 13, 14, 15,
16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides. Likewise, the
sense strand of the iRNA agent can overlap the nucleotide sequence
of SEQ ID NOs:5, 15, 17, 19, 21, or 23, e.g., by at least 1, 5, 10,
11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24
nucleotides.
[0010] In another embodiment, the iRNA agent targets a wildtype
SNCA nucleic acid, and in yet another embodiment, the iRNA agent
targets a polymorphism or mutation of SNCA. For example, the iRNA
agent can target a mutation in a codon of the SNCA open reading
frame that corresponds to an A53T, A30P, or E46K mutation. In some
embodiments, the iRNA agent targets the 3'UTR or the 5'UTR of SNCA.
In some embodiment, the iRNA agent targets a spliced isoform of
SNCA. For example, the iRNA agent can target the splice junction
between exons 2 and 4 to downregulate expression of the 128 amino
acid isoform, or the iRNA agent can target the splice junction
between exons 4 and 6 to target the 112 amino acid isoform.
[0011] In some embodiments, the subject (e.g., the human) carries a
multiplication (e.g., a duplication or triplication) of the SNCA
gene, or a genetic variation in the Parkin or ubiquitin
carboxy-terminal hydrolase L1 (UCHL1) gene. In another embodiment,
the subject is diagnosed with a synucleinopathy. The
synucleinopathy is characterized by the aggregation of
alpha-synuclein monomers. An iRNA agent can be administered to a
human diagnosed as having, e.g., Parkinson's disease (PD),
Alzheimer's disease, multiple system atrophy, Lewy body dementia,
or a retinal disorder, e.g., a retinopathy.
[0012] In another embodiment, the iRNA agent is at least 21
nucleotides long and includes a sense RNA strand and an antisense
RNA strand, wherein the antisense RNA strand is 25 or fewer
nucleotides in length, and the duplex region of the iRNA agent is
18-25 nucleotides in length. The iRNA agent may further include a
nucleotide overhang having 1 to 4 unpaired nucleotides, and the
unpaired nucleotides may have at least one phosphorothioate
dinucleotide linkage. The nucleotide overhang can be, e.g., at the
3' end of the antisense strand of the iRNA agent.
[0013] In another aspect, the invention features an iRNA agent that
targets an SNCA nucleic acid, e.g., an SNCA RNA. The iRNA agent has
an antisense strand complementary to a nucleotide sequence of an
SNCA RNA, and a sense strand sufficiently complementary to
hybridize to the antisense strand. In one embodiment, the iRNA
agent includes a modification that stabilizes the iRNA agent in a
biological sample. For example, the modified iRNA agent is less
susceptible to degradation, e.g., less susceptible to cleavage by
an exo- or endonuclease. In another embodiment, the iRNA agent
comprises a phosphorothioate or 2'-O-methylated (2'-O-Me)
nucleotide. The iRNA agent can include, for example, at least one
5'-uridine-adenine-3' (5'-UA-3') dinucleotide wherein the uridine
is a 2'-modified nucleotide, or at least one 5'-uridine-guanine-3'
(5'-UG-3') dinucleotide, wherein the 5'-uridine is a 2'-modified
nucleotide, or at least one 5'-cytidine-adenine-3' (5'-CA-3')
dinucleotide, wherein the 5'-cytidine is a 2'-modified nucleotide,
or at least one 5'-uridine-uridine-3' (5'-UU-3') dinucleotide,
wherein the 5'-uridine is a 2'-modified nucleotide, or at least one
5'-cytidine-cytidine-3' (5'-CC-3') dinucleotide, wherein the
5'-cytidine is a 2'-modified nucleotide. The iRNA agent can include
at least 2, at least 3, at least 4 or at least 5 of the
dinucleotides. In one embodiment, the 2'-modified nucleotide is a
2'-O-methylated nucleotide.
[0014] In another embodiment, the iRNA agent is at least 21
nucleotides long and includes a sense RNA strand and an antisense
RNA strand, wherein the antisense RNA strand is 25 or fewer
nucleotides in length, and the duplex region of the iRNA agent is
18-25 nucleotides in length. The iRNA agent may further include a
nucleotide overhang having 1 to 4 unpaired nucleotides, and the
unpaired nucleotides may have at least one phosphorothioate
dinucleotide linkage. The nucleotide overhang can be, e.g., at the
3' end of the antisense strand of the iRNA agent.
[0015] In another embodiment, the antisense strand of the iRNA
agent includes the nucleotide sequence of SEQ ID NOs:6, 16, 18, 20,
22, or 24 (see Table 1). In another embodiment, the sense strand of
the iRNA agent includes the nucleotide sequence of SEQ ID NOs:5,
15, 17, 19, 21, or 23 (see Table 1). In yet another embodiment, the
antisense strand of the iRNA agent overlaps the nucleotide sequence
of SEQ ID NOs:6, 16, 18, 20, 22, or 24, e.g., by at least 1, 5, 10,
11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24
nucleotides. Likewise, the sense strand of the iRNA agent can
overlap the nucleotide sequence of SEQ ID NOs:5, 15, 17, 19, 21, or
23, e.g., by at least 1, 5, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19,
20, 21, 22, 23, or 24 nucleotides.
[0016] In another embodiment, the iRNA agent targets a wildtype
SNCA nucleic acid, and in yet another embodiment, the iRNA agent
targets a polymorphism or mutation of SNCA. For example, the iRNA
agent can target a mutation in a codon of the SNCA open reading
frame that corresponds to an A53T, A30P, or E46K mutation (see FIG.
1B). In some embodiments, the iRNA agent targets the 5'UTR or the
3'UTR of SNCA. In some embodiment, the iRNA agent targets a spliced
isoform of SNCA. For example, the iRNA agent can target the splice
junction between exons 2 and 4 to downregulate expression of the
128 amino acid isoform, or the iRNA agent can target the splice
junction between exons 4 and 6 to target the 112 amino acid
isoform.
[0017] The SNCA gene can be a target for treatment methods of
neurodegenerative disease. In one embodiment, an antisense
oligonucleotide, ribozyme, or zinc finger protein can be used to
inhibit gene expression, or an antibody or small molecule can be
used to target an SNCA polypeptide. A combination of therapies to
downregulate SNCA expression and activity can also be used.
[0018] In another aspect, the invention features a pharmaceutical
composition of an inhibitory agent described herein, e.g., an iRNA
agent, ribozyme, or antisense molecule which targets SNCA RNA, an
antibody or naturally occurring or synthetic polypeptide, or small
molecule, which preferably binds to and inhibits the SNCA protein,
and a pharmaceutically acceptable carrier.
[0019] In a particularly preferred embodiment, the pharmaceutical
composition includes an iRNA agent targeting the SNCA gene and a
pharmaceutically acceptable carrier. The iRNA agent has an
antisense strand complementary to a nucleotide sequence of an SNCA
RNA, and a sense strand sufficiently complementary to hybridize to
the antisense strand. In one embodiment, the iRNA agent of the
pharmaceutical composition includes a modification that stabilizes
the iRNA agent in a biological sample. For example, the modified
iRNA agent is less susceptible to degradation, e.g., less
susceptible to cleavage by an exo- or endonuclease. The iRNA agent
can include, for example, at least one 5'-uridine-adenine-3'
(5'-UA-3') dinucleotide wherein the uridine is a 2'-modified
nucleotide, or at least one 5'-uridine-guanine-3' (5'-UG-3')
dinucleotide, wherein the 5'-uridine is a 2'-modified nucleotide,
or at least one 5'-cytidine-adenine-3' (5'-CA-3') dinucleotide,
wherein the 5'-cytidine is a 2'-modified nucleotide, or at least
one 5'-uridine-uridine-3' (5'-UU-3') dinucleotide, wherein the
5'-uridine is a 2'-modified nucleotide, or at least one
5'-cytidine-cytidine-3' (5'-CC-3') dinucleotide, wherein the
5'-cytidine is a 2'-modified nucleotide. The iRNA agent can include
at least 2, at least 3, at least 4 or at least 5 of the
dinucleotides. In one embodiment, the 2'-modified nucleotide is a
2'-O-methylated nucleotide. In another embodiment the iRNA agent
includes a phosphorothioate.
[0020] In another embodiment, the iRNA agent of the pharmaceutical
composition is at least 21 nucleotides long and includes a sense
RNA strand and an antisense RNA strand, wherein the antisense RNA
strand is 25 or fewer nucleotides in length, and the duplex region
of the iRNA agent is 18-25 nucleotides in length. The iRNA agent of
the composition may further include a nucleotide overhang having 1
to 4 unpaired nucleotides, and the unpaired nucleotides may have at
least one phosphorothioate dinucleotide linkage. The nucleotide
overhang can be, e.g., at the 3' end of the antisense strand of the
iRNA agent.
[0021] In another embodiment, the antisense strand of the iRNA
agent of the pharmaceutical composition includes the nucleotide
sequence of SEQ ID NOs:6, 16, 18, 20, 22, or 24. In another
embodiment, the sense strand of the iRNA agent of the
pharmaceutical composition includes the nucleotide sequence of SEQ
ID NOs:5, 15, 17, 19, 21, or 23. In yet another embodiment, the
antisense strand of the iRNA agent overlaps the nucleotide sequence
of SEQ ID NOs:6, 16, 18, 20, 22, or 24, e.g., by at least 1, 5, 10,
11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24
nucleotides. Likewise, the sense strand of the iRNA agent can
overlap the nucleotide sequence of SEQ ID NOs:5, 15, 17, 19, 21, or
23, e.g., by at least 1, 5, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19,
20, 21, 22, 23, or 24 nucleotides.
[0022] In another embodiment, the iRNA agent targets a wildtype
SNCA nucleic acid, and in another embodiment, the iRNA agent
targets a polymorphism or mutation of SNCA. For example, the iRNA
agent can target a mutation in a codon of the SNCA open reading
frame that corresponds to an A53T, A30P, or E46K mutation. In some
embodiments, the iRNA agent targets the 3'UTR or the 5'UTR of SNCA.
In some embodiments, the iRNA agent targets a spliced isoform of
SNCA. For example, the iRNA agent can target the splice junction
between exons 2 and 4 to downregulate expression of the 128 amino
acid isoform, or the iRNA agent can target the splice junction
between exons 4 and 6 to target the 112 amino acid isoform. In
another aspect, the invention features a method of reducing the
amount of SNCA or SNCA RNA in a cell of a subject (e.g., a
mammalian subject, such as a human). The method includes contacting
cell with an agent which inhibits the expression of SNCA. The
inhibition can be effected at any level, e.g., at the level of
transcription, the level of translation, or post-translationally.
Agents which inhibit SNCA expression include iRNA agents and
antisense molecules which target SNCA RNA, as well as antibodies or
naturally occurring or synthetic polypeptides, or small molecules,
which, in preferred embodiments, bind to and inhibit the SNCA
protein.
[0023] In a particularly preferred embodiment SNCA RNA is reduced
by contacting a cell of the subject with an iRNA agent. In one
embodiment, the iRNA agent includes a modification that stabilizes
the iRNA agent in a biological sample. For example, the modified
iRNA agent is less susceptible to degradation, e.g., less
susceptible to cleavage by an exo- or endonuclease. The iRNA agent
can include, for example, at least one 5'-uridine-adenine-3'
(5'-UA-3') dinucleotide wherein the uridine is a 2'-modified
nucleotide, or at least one 5'-uridine-guanine-3' (5'-UG-3')
dinucleotide, wherein the 5'-uridine is a 2'-modified nucleotide,
or at least one 5'-cytidine-adenine-3' (5'-CA-3') dinucleotide,
wherein the 5'-cytidine is a 2'-modified nucleotide, or at least
one 5'-uridine-uridine-3' (5'-UU-3') dinucleotide, wherein the
5'-uridine is a 2'-modified nucleotide, or at least one
5'-cytidine-cytidine-3' (5'-CC-3') dinucleotide, wherein the
5'-cytidine is a 2'-modified nucleotide. The iRNA agent can include
at least 2, at least 3, at least 4 or at least 5 of the
dinucleotides. In one embodiment, the 2'-modified nucleotide is a
2'-O-methylated nucleotide. In another embodiment the iRNA agent
includes a phosphorothioate.
[0024] In another embodiment, the antisense strand of the iRNA
agent of the pharmaceutical composition includes the nucleotide
sequence of SEQ ID NOs:6, 16, 18, 20, 22, or 24. In another
embodiment, the sense strand of the iRNA agent of the
pharmaceutical composition includes the nucleotide sequence of SEQ
ID NOs:5, 15, 17, 19, 21, or 23. In yet another embodiment, the
antisense strand of the iRNA agent overlaps the nucleotide sequence
of SEQ ID NOs:6, 16, 18, 20, 22, or 24, e.g., by at least 1, 5, 10,
11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24
nucleotides. Likewise, the sense strand of the iRNA agent can
overlap the nucleotide sequence of SEQ ID NOs:5, 15, 17, 19, 21, or
23, e.g., by at least 1, 5, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19,
20, 21, 22, 23, or 24 nucleotides.
[0025] In another embodiment, the iRNA agent targets a wildtype
SNCA nucleic acid, and in another embodiment, the iRNA agent
targets a polymorphism or mutation of SNCA. For example, the iRNA
agent can target a mutation in a codon of the SNCA open reading
frame that corresponds to an A53T, A30P, or E46K mutation. In some
embodiments, the iRNA agent targets the 3'UTR or the 5'UTR of SNCA.
In some embodiments, the iRNA agent targets a spliced isoform of
SNCA. For example, the iRNA agent can target the splice junction
between exons 2 and 4 to downregulate expression of the 128 amino
acid isoform, or the iRNA agent can target the splice junction
between exons 4 and 6 to target the 112 amino acid isoform.
[0026] In another embodiment, the iRNA agent is at least 21
nucleotides long and includes a sense RNA strand and an antisense
RNA strand, wherein the antisense RNA strand is 25 or fewer
nucleotides in length, and the duplex region of the iRNA agent is
18-25 nucleotides in length. The iRNA agent may further include a
nucleotide overhang having 1 to 4 unpaired nucleotides, and the
unpaired nucleotides may have at least one phosphorothioate
dinucleotide linkage. The nucleotide overhang can be, e.g., at the
3' end of the antisense strand of the iRNA agent.
[0027] In another aspect, the invention features a method of making
an iRNA agent. The method includes selecting a nucleotide sequence
of between 18 and 25 nucleotides long from the nucleotide sequence
of an SNCA mRNA, and synthesizing the iRNA agent. The sense strand
of the iRNA agent includes the nucleotide sequence selected from
SNCA RNA, and the antisense strand is sufficiently complementary to
hybridize to the sense strand. In one embodiment, the method
further includes administering the iRNA agent to a subject (e.g., a
mammalian subject, such as a human subject) as described
herein.
[0028] In another aspect, the invention features a method of
evaluating an agent, e.g., an agent of a type described herein,
such as a small molecule (a small molecule has a molecular weight
of preferably less than 3,000 Daltons, more preferably less than
2,000 Daltons and yet more preferably of less than 1000 Daltons),
antisense, ribozyme, iRNA agent, or protein, polypeptide, or
peptide, e.g., a zinc finger protein, for the ability to inhibit
SNCA expression, e.g., an agent that targets an SNCA or SNCA
nucleic acid. The method includes: providing a candidate agent and
determining, e.g., by the use of one or more of the test systems
described herein, if said candidate agent modulates, e.g.,
inhibits, SNCA expression.
[0029] In a preferred embodiment the method includes evaluating the
agent in a first test system; and, if a predetermined level of
modulation is seen, evaluating the candidate in a second,
preferably different, test system. In a particularly preferred
embodiment the second test system includes administering the
candidate agent to an animal and evaluating the effect of the
candidate agent on SNCA expression in the animal. In a preferred
embodiment two test systems are used and the first is a
high-throughput system, e.g., in such embodiments the first or
initial test is used to screen at least 100, 1,000, or 10,000 times
more compounds than is the second, preferably animal, system.
[0030] A test system can include: contacting the candidate agent
with a target molecule, e.g., SNCA, an SNCA nucleic acid, e.g., an
RNA or DNA, preferably in vitro, and determining if there is an
interaction, e.g., binding of the candidate agent to the target, or
modifying the target, e.g., by making or breaking a covalent bond
in the target. Modification is correlated with the ability to
modulate SNCA expression. The test system can include contacting
the candidate agent with a cell and evaluating modulation of SNCA
expression. E.g., this can include contacting the candidate agent
with a cell capable of expressing SNCA or SCNA RNA (from an
endogenous gene or from an exogenous construct) and evaluating the
level of SNCA or SNCA RNA. In another embodiment the test system
can include contacting the candidate agent with a cell which
expresses an RNA or protein from an SNCA control region (e.g., an
SNCA control region) linked to a heterologous sequence, e.g., a
marker protein, e.g., a fluorescent protein such as GFP, which
construct can be either chromosomal or episomal, and determining
the effect on RNA or protein levels. The test system can also
include contacting the candidate agent, in vitro, with a tissue
sample, e.g., a brain tissue sample, e.g., a slice or section, an
optical tissue sample, or other sample which includes neural
tissue, and evaluating the level of SNCA or SNCA RNA. The test
system can include administering the candidate agent, in vivo, to
an animal, and evaluating the level of SNCA or SNCA RNA. In any of
these the effect of the candidate agent on SNCA expression can
include comparing SNCA gene expression with a predetermined
standard, e.g., with control, e.g., an untreated cell, tissue or
animal. SNCA gene expression can be compared, e.g., before and
after contacting with the candidate agent. The method allows
determining whether the iRNA agent is useful for inhibiting SNCA
gene expression.
[0031] In one embodiment, SNCA gene expression can be evaluated by
a method to examine SNCA RNA levels (e.g., Northern blot analysis,
RT-PCR, or RNAse protection assay) or SNCA protein levels (e.g.,
Western blot).
[0032] In one embodiment, e.g., as a second test, the agent is
administered to an animal, e.g., a mammal, such as a mouse, rat,
rabbit, human, or non-human primate, and the animal is monitored
for an effect of the agent. For example, a tissue of the animal,
e.g., a brain tissue or ocular tissue, is examined for an effect of
the agent on SNCA expression. The tissue can be examined for the
presence of SNCA RNA and/or protein, for example. In one
embodiment, the animal is observed to monitor an improvement or
stabilization of a cognitive symptom. The agent can be administered
to the animal by any method, e.g., orally, or by intrathecal or
parenchymal injection, such as by stereoscopic injection into the
brain.
[0033] In a particularly preferred embodiment, the invention
features a method of evaluating an iRNA agent, e.g., an iRNA agent
described herein, that targets an SNCA nucleic acid. The method
includes providing an iRNA agent that targets an SNCA nucleic acid
(e.g., an SNCA RNA); contacting the iRNA agent with a cell
containing, and capable of expressing, an SNCA gene; and evaluating
the effect of the iRNA agent on SNCA expression, e.g., by comparing
SNCA gene expression with a control, e.g., in the cell. SNCA gene
expression can be compared, e.g., before and after contacting the
iRNA agent with the cell. The method allows determining whether the
iRNA agent is useful for inhibiting SNCA gene expression. For
example, the iRNA agent can be determined to be useful for
inhibiting SNCA gene expression if the iRNA agent reduces
expression by a predetermined amount, e.g., by 10, 25, 50, 75, or
90%, e.g., as compared with a predetermined reference value, e.g.,
as compared with the amount of SNCA RNA or protein prior to
contacting the iRNA agent with the cell. The SNCA gene can be
endogenously or exogenously expressed.
[0034] The methods and compositions featured in the invention,
e.g., the methods and iRNA compositions to treat the
neurodegenerative disorders described herein, can be used with any
dosage and/or formulation described herein, as well as with any
route of administration described herein.
[0035] In addition to their presence in the brain, alpha-synuclein
polypeptides have been found in ocular tissues, including the
retina and optic nerve. Accordingly, the compositions and methods
described herein are suitable for treating synucleinopathies of the
eye or ocular tissues, including but not limited to
retinopathies.
[0036] Thus, in another aspect, the invention features a method of
treating a subject by administering an agent which inhibits the
expression of SNCA in the eye or in ocular tissue. In a preferred
embodiment, the subject is a mammal, such as a human, e.g., a
subject diagnosed as having, or at risk for developing a
synucleinopathy of the eye, e.g., a retinopathy. The inhibition can
be effected at any level, e.g., at the level of transcription, the
level of translation, or post-translationally. Agents which inhibit
SNCA expression include iRNA agents and antisense molecules which
target SNCA RNA, as well as antibodies or naturally occurring or
synthetic polypeptides, or small molecules, which, in preferred
embodiments, bind to and inhibit the SNCA protein.
[0037] In a particularly preferred embodiment the inhibitory agent
is an iRNA agent that targets an SNCA nucleic acid, e.g., an SNCA
RNA. The iRNA agent has an antisense strand complementary to a
nucleotide sequence of an SNCA RNA, and a sense strand sufficiently
complementary to hybridize to the antisense strand. In one
embodiment, the iRNA agent includes a modification that stabilizes
the iRNA agent in a biological sample. For example, the modified
iRNA agent is less susceptible to degradation, e.g., less
susceptible to cleavage by an exo- or endonuclease. The iRNA agent
can include, for example, at least one 5'-uridine-adenine-3'
(5'-UA-3') dinucleotide wherein the uridine is a 2'-modified
nucleotide, or at least one 5'-uridine-guanine-3' (5'-UG-3')
dinucleotide, wherein the 5'-uridine is a 2'-modified nucleotide,
or at least one 5'-cytidine-adenine-3' (5'-CA-3') dinucleotide,
wherein the 5'-cytidine is a 2'-modified nucleotide, or at least
one 5'-uridine-uridine-3' (5'-UU-3') dinucleotide, wherein the
5'-uridine is a 2'-modified nucleotide, or at least one
5'-cytidine-cytidine-3' (5'-CC-3') dinucleotide, wherein the
5'-cytidine is a 2'-modified nucleotide. The iRNA agent can include
at least 2, at least 3, at least 4 or at least 5 of the
dinucleotides. In one embodiment, the 2'-modified nucleotide is a
2'-O-methylated nucleotide. In another embodiment the iRNA agent
includes a phosphorothioate.
[0038] In another embodiment, the antisense strand of the iRNA
agent includes the nucleotide sequence of SEQ ID NOs:6, 16, 18, 20,
22, or 24. In another embodiment, the sense strand of the iRNA
agent includes the nucleotide sequence of SEQ ID NOs:5, 15, 17, 19,
21, or 23. In yet another embodiment, the antisense strand of the
iRNA agent overlaps the nucleotide sequence of SEQ ID NOs:6, 16,
18, 20, 22, or 24, e.g., by at least 1, 5, 10, 11, 12, 13, 14, 15,
16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides. Likewise, the
sense strand of the iRNA agent can overlap the nucleotide sequence
of SEQ ID NOs:5, 15, 17, 19, 21, or 23, e.g., by at least 1, 5, 10,
11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24
nucleotides.
[0039] In another embodiment, the iRNA agent targets a wildtype
SNCA nucleic acid, and in yet another embodiment, the iRNA agent
targets a polymorphism or mutation of SNCA. For example, the iRNA
agent can target a mutation in a codon of the SNCA open reading
frame that corresponds to an A53T, A30P, or E46K mutation. In some
embodiments, the iRNA agent targets the 3'UTR or the 5'UTR of SNCA.
In some embodiment, the iRNA agent targets a spliced isoform of
SNCA. For example, the iRNA agent can target the splice junction
between exons 2 and 4 to downregulate expression of the 128 amino
acid isoform, or the iRNA agent can target the splice junction
between exons 4 and 6 to target the 112 amino acid isoform.
[0040] In some embodiments, the subject (e.g., the human) carries a
multiplication (e.g., a duplication or triplication) of the SNCA
gene, or a genetic variation in the Parkin or ubiquitin
carboxy-terminal hydrolase L1 (UCHL1) gene. In another embodiment,
the subject is diagnosed with a synucleinopathy. The
synucleinopathy is characterized by the aggregation of
alpha-synuclein monomers. An mRNA agent can be administered to a
human diagnosed as having, e.g., Parkinson's disease (PD),
Alzheimer's disease, multiple system atrophy, Lewy body dementia,
or a retinal disorder, e.g., a retinopathy.
[0041] In another embodiment, the iRNA agent is at least 21
nucleotides long and includes a sense RNA strand and an antisense
RNA strand, wherein the antisense RNA strand is 25 or fewer
nucleotides in length, and the duplex region of the iRNA agent is
18-25 nucleotides in length. The iRNA agent may further include a
nucleotide overhang having 1 to 4 unpaired nucleotides, and the
unpaired nucleotides may have at least one phosphorothioate
dinucleotide linkage. The nucleotide overhang can be, e.g., at the
3' end of the antisense strand of the iRNA agent.
[0042] A "substantially identical" sequence includes a region of
sufficient homology to the target gene, and is of sufficient length
in terms of nucleotides, that the iRNA agent, or a fragment
thereof, can mediate down regulation of the target gene. Thus, the
iRNA agent is or includes a region which is at least partially, and
in some embodiments fully, complementary to a target RNA
transcript, e.g., the SNCA transcript. It is not necessary that
there be perfect complementarity between the iRNA agent and the
target, but the correspondence must be sufficient to enable the
iRNA agent, or a cleavage product thereof, to direct sequence
specific silencing, e.g., by RNAi cleavage of the target RNA, e.g.,
mRNA. Complementarity, or degree of homology with the target
strand, is most critical in the antisense strand. While perfect
complementarity, particularly in the antisense strand, is often
desired some embodiments can include, particularly in the antisense
strand, one or more but preferably 6, 5, 4, 3, 2, or fewer
mismatches (with respect to the target RNA). The mismatches,
particularly in the antisense strand, are most tolerated in the
terminal regions and if present are preferably in a terminal region
or regions, e.g., within 6, 5, 4, or 3 nucleotides of the 5' and/or
3' terminus. The sense strand need only be sufficiently
complementary with the antisense strand to maintain the overall
double strand character of the molecule.
[0043] An "RNA agent" as used herein, is an unmodified RNA,
modified RNA, or nucleoside surrogates, all of which are described
herein or are well known in the RNA synthetic art. While numerous
modified RNAs and nucleoside surrogates are described, preferred
examples include those which have greater resistance to nuclease
degradation than do unmodified RNAs. Preferred examples include
those that have a 2' sugar modification, a modification in a single
strand overhang, preferably a 3' single strand overhang, or,
particularly if single stranded, a 5'-modification which includes
one or more phosphate groups or one or more analogs of a phosphate
group.
[0044] An "iRNA agent" (abbreviation for "interfering RNA agent")
as used herein, is an RNA agent, which can downregulate the
expression of a target gene, e.g., an SNCA gene. While not wishing
to be bound by theory, an iRNA agent may act by one or more of a
number of mechanisms, including post-transcriptional cleavage of a
target mRNA sometimes referred to in the art as RNAi, or
pre-transcriptional or pre-translational mechanisms. An iRNA agent
can include a single strand or can include more than one strands,
e.g., it can be a double stranded (ds) iRNA agent. If the iRNA
agent is a single strand it is particularly preferred that it
include a 5' modification which includes one or more phosphate
groups or one or more analogs of a phosphate group.
[0045] An iRNA agent that targets an SNCA nucleic acid can be
referred to as an anti-SNCA iRNA agent.
[0046] The details of one or more embodiments of the invention are
set forth in the accompanying drawings and the description below.
Other features, objects, and advantages of the invention will be
apparent from this description, and from the claims. This
application incorporates all cited references, patents, and patent
applications by references in their entirety for all purposes.
BRIEF DESCRIPTION OF DRAWINGS
[0047] FIG. 1A is the sequence of the full length mRNA of human
SNCA (transcript variant NACP140; GenBank Access. No.
NM.sub.--000345; SEQ ID NO:1). The start and stop codons of the
open reading frame are denoted in bold and italics. Sequences
targeted by the siRNAs SNCA1, 3, 4, 5, 6, and 9 are underlined.
Sequences of the siRNAs SNCA2, 7 and 8 are shaded in gray. SNCA1
targets nucleotides 197-217; SNCA2 targets nucleotides 205-225;
SNCA3 targets nucleotides 308-330; SNCA4 targets nucleotides
231-251; SNCA5 targets nucleotides 356-376; SNCA6 targets
nucleotides 261-279; SNCA7 targets nucleotides 403-421; SNCA8
targets nucleotides 451-469; SNCA9 targets nucleotides 1311-1329.
Brackets flank the two alternative internal exons (exons 3 and
5).
[0048] FIG. 1B is the sequence of the full length protein of human
SNCA (transcript variant NACP140; GenBank Access. No.
NM.sub.--000345; SEQ ID NO:2).
[0049] FIG. 2 is a Western blot of EGFP or EGFP/NACP fusion
proteins expressed in BE(2)-M17 human neuroblastoma cells. The
cells were cotransfected with a vector expressing EGFP or EGFP/NACP
fusion protein and an siRNA listed in Table 1. In the figure,
siRNAs Mayo1, Mayo2, Mayo3, Mayo4, Mayo5, Mayo6, Mayo7, Mayo8, and
Mayo9, are equivalent to the siRNAs of Table 1 (SNCA1, SNCA2,
SNCA3, SNCA4, SNCA5, SNCA6, SNCA7, SNCA8, and SNCA9, respectively).
Control experiments included cotransfection of the EGFP and
EGFP/NACP vectors with the siRNA Mr control dsRNA (vector and
.alpha.-syn lanes labeled "siRNA Mr"), transfection of EGFP and
EGFP/NACP vectors without dsRNA, and untransfected cells. The
sequence of siRNA Mr is provided in Table 1.
[0050] FIG. 3 is a Western blot detecting EGFP/NACP fusion proteins
expressed in BE(2)-M17 human neuroblastoma cells. The cells were
cotransfected with a vector expressing an EGFP/NACP fusion protein
and varying nM concentrations of Mayo2, Mayo7, or Mayo8 siRNA.
These siRNAs are equivalent to siRNAs SNCA2, SNCA7, and SNCA8, of
Table 1 respectively. The Western blots were stripped of the
anti-GFP antibody, and reprobed with anti-tubulin antibody to
monitor equivalent loading of protein between samples.
[0051] FIG. 4 is a Western blot detecting EGFP/NACP fusion
expressed in BE(2)-M17 human neuroblastoma cells. The cells were
cotransfected with a vector expressing an EGFP/NACP fusion protein
and 50 nM Mayo2, Mayo7, or Mayo8 siRNA. These siRNAs are equivalent
to siRNAs SNCA2, SNCA7, and SNCA8 of Table 1, respectively. In the
"control" experiment, no siRNA was transfected with the fusion
construct. Protein expression was monitored over the course of six
days. The Western blots were stripped of the anti-GFP antibody, and
reprobed with anti-tubulin antibody to monitor equivalent loading
of protein between samples. The cells were non-dividing.
[0052] FIG. 5 is a graph depicting relative alpha-synuclein levels
assayed by Western blot analysis. Neuroblastoma cells were
transfected with Mayo2, Mayo7, or Mayo8 siRNA. Endogenous alpha
synuclein protein expression was monitored over the course of three
days. In the "untransfected" experiment, no siRNA was transfected,
and protein levels in these samples were set as 100% normal
expression.
[0053] FIG. 6 is a graph depicting the effect of Mayo2, 7, and 8
siRNAs on levels of endogenous alpha-synuclein RNA.
[0054] FIG. 7 is a graph depicting the activity of the siRNAs on
human and mouse alpha-synuclein/EGFP conjugate expression.
BE(2)-M17 human neuroblastoma cells were cotransfected with a
plasmid encoding EGFP (vector) or EGFP conjugated to either human
or mouse alpha-synuclein and Mayo2, Mayo7 or Mayo8. Expression was
equalized using tubulin immunoreactivity and measured as a
proportion of the expression of the plasmid-only EGFP
immunoreactivity (control).
[0055] FIG. 8A is a polyacrylamide gel depicting a T1 mapping
experiment of cleavage sites in Mayo7 (also called AL-DUP-1477) and
Mayo8 (also called AL-DUP-1478) siRNAs. Lanes 1 are controls and
represent siRNA incubated in T1 buffer; lanes 2 represent siRNA
incubated in 1.times.T1 RNAse; lanes 3 represent siRNA incubated in
0.1.times.T1 RNAse; lanes 4 are an alkaline ladder; lanes 5 are
Mayo7 and Mayo8, respectively, incubated in human serum for four
hours; lanes 6 are Mayo7 and Mayo8, respectively, prior to
incubation in human serum. *s indicates that the siRNA was 5'
.sup.32P-labeled on the sense strand by incubating with T4
Polynucleotide kinase and gamma-.sup.32P-ATP.
[0056] FIG. 8B is an illustration of the sites of siRNA cleavage
following the T1 RNAse assay. The cleavage sites include sites of
T1 cleavage (3' of G) and cleavage from nucleases in the human
serum.
[0057] FIG. 9A is a Western blot of EGFP or EGFP/NACP fusion
proteins expressed in a neuroblastoma cell line. The cells were
cotransfected with either a plasmid expressing EGFP, or a plasmid
expressing EGFP/NACP fusion protein, and an siRNA listed in Table
1. In the figure, siRNAs Mayo2, Mayo7, Mayo7s, Mayo8, Mayo8s1, and
Mayo8s2 are equivalent to the siRNAs of Table 1 (SNCA2, SNCA7,
SNCA7s, SNCA8, SNCA8s1, and SNCA8s2, respectively). In the control
experiment, siRNA was not transfected into cells with the EGFP and
EGFP-NACP vectors. The Western blots were stripped of the anti-GFP
antibody, and reprobed with anti-tubulin antibody to monitor
equivalent loading of protein between samples.
[0058] FIG. 9B is a graph depicting the effect of the dsRNAs of
FIG. 9A on EGFP/alpha-synuclein protein expression. The y-axis
represents percent EGFP immunoreactivity (IR) compared to the
control untransfected experiment (untrn).
[0059] FIG. 10A is a polyacrylamide gel demonstrating the stability
of SNCA8 siRNA (see Table 1). The RNA in the gel is detected with
Stains-All (Sigma, St. Louis, Mo.). Lane 1 is SNCA8 siRNA duplex.
Lane 2 is SNCA8 siRNA in PBS control at 0 hour time point. Lane 3
is SNCA8 siRNA in PBS control at 24 hour time point. Lane 4 is
SNCA8 siRNA in human serum at 0 hour time point. Lane 5 is SNCA8
siRNA in human serum following incubation for 30 minutes. Lane 6 is
SNCA8 siRNA in human serum following incubation for 4 hours. Lane 7
is SNCA8 siRNA in human serum following incubation for 24
hours.
[0060] FIG. 10B is a polyacrylamide gel demonstrating the stability
of SNCA8 siRNA (see Table 1). The RNA in the gel is detected with
Stains-All (Sigma, St. Louis, Mo.). Lane 1 is SNCA8s1 siRNA duplex.
Lane 2 is SNCA8s1 siRNA in PBS control at 0 hour time point. Lane 3
is SNCA8s1 siRNA in PBS control at 24 hour time point. Lane 4 is
SNCA8s1 siRNA in human serum at 0 hour time point. Lane 5 is
SNCA8s1 siRNA in human serum following incubation for 30 minutes.
Lane 6 is SNCA8s1 siRNA in human serum following incubation for 4
hours. Lane 7 is SNCA8s1 siRNA in human serum following incubation
for 24 hours.
[0061] FIG. 10C is a polyacrylamide gel demonstrating the stability
of SNCA8 siRNA (see Table 1). The RNA in the gel is detected with
Stains-All (Sigma, St. Louis, Mo.). Lane 1 is SNCA8s2 siRNA duplex.
Lane 2 is SNCA8s2 siRNA in PBS control at 0 hour time point. Lane 3
is SNCA8s2 siRNA in PBS control at 24 hour time point. Lane 4 is
SNCA8s2 siRNA in human serum at 0 hour time point. Lane 5 is
SNCA8s2 siRNA in human serum following incubation for 30 minutes.
Lane 6 is SNCA8s2 siRNA in human serum following incubation for 4
hours. Lane 7 is SNCA8s2 siRNA in human serum following incubation
for 24 hours.
[0062] FIG. 11 is a graph demonstrating the gene specificity of
Mayo2.
[0063] FIG. 12A is a graph demonstrating the effect of siRNA on
SNCA RNA expression in mouse brain tissue. E1, E2, and E3 represent
results from three different mice injected with 2 uL of 200 uM
Mayo-8s2m siRNA. C1, C2, and C3 represent results from three
different mice injected with 2 uL phosphate buffered saline. Avg-E
is the average .alpha.-synuclein/18S rRNA ratio of E1, E2, and E3.
Avg-C is the average .alpha.-synuclein/18S rRNA ratio of the three
control samples. The 18S rRNA control was amplified in an RT-PCR
reaction performed in a separate tube from the .alpha.-synuclein
RT-PCR reaction.
[0064] FIG. 12B is a graph demonstrating the effect of siRNA on
SNCA RNA expression in the same mouse brain tissue described in
FIG. 2A. In these RT-PCR reactions, the 18S rRNA control was
amplified in an RT-PCR reaction performed in the same tube as the
.alpha.-synuclein RT-PCR reaction.
[0065] FIG. 13 is a graph showing silencing of endogenous
alpha-synuclein by intraparenchymal infusion of siRNA.
[0066] FIG. 14 shows synuclein expression in cortex of siRNA
treated mice in the injected and non-injected sides of the
brain.
DETAILED DESCRIPTION
[0067] Double-stranded (dsRNA) directs the sequence-specific
silencing of mRNA through a process known as RNA interference
(RNAi). The process occurs in a wide variety of organisms,
including mammals and other vertebrates.
[0068] It has been demonstrated that 21-23 nt fragments of dsRNA
are sequence-specific mediators of RNA silencing, e.g., by causing
RNA degradation. While not wishing to be bound by theory, it may be
that a molecular signal, which may be merely the specific length of
the fragments, present in these 21-23 nt fragments, recruits
cellular factors that mediate RNAi. Described herein are methods
for preparing and administering these 21-23 nt fragments, and other
mRNA agents, and their use for specifically inactivating gene
function, and the function of the SNCA gene in particular. The use
of iRNA agents (or recombinantly produced or chemically synthesized
oligonucleotides of the same or similar nature) enables the
targeting of specific mRNAs for silencing in mammalian cells. In
addition, longer dsRNA agent fragments can also be used, e.g., as
described below.
[0069] Although, in mammalian cells, long dsRNAs can induce the
interferon response which is frequently deleterious, short dsRNAs
(sRNAs) do not trigger the interferon response, at least not to an
extent that is deleterious to the cell and host. In particular, the
length of the iRNA agent strands in an sRNA agent can be less than
31, 30, 28, 25, or 23 nt, e.g., sufficiently short to avoid
inducing a deleterious interferon response. Thus, the
administration of a composition of sRNA agent (e.g., formulated as
described herein) to a mammalian cell can be used to silence
expression of a target gene while circumventing the interferon
response. Further, use of a discrete species of iRNA agent can be
used to selectively target one allele of a target gene, e.g., in a
subject heterozygous for the allele.
[0070] Moreover, in one embodiment, a mammalian cell is treated
with an iRNA agent that disrupts a component of the interferon
response, e.g., dsRNA-activated protein kinase PKR. Such a cell can
be treated with a second iRNA agent that includes a sequence
complementary to a target RNA and that has a length that might
otherwise trigger the interferon response.
[0071] As used herein, a "subject" refers to a mammalian organism
undergoing treatment for a disorder mediated by SNCA expression.
The subject can be a mammal such as a cow, horse, mouse, rat, dog,
pig, goat, or a primate. In a preferred embodiment, the subject is
a human.
[0072] As used herein, disorders associated with SNCA expression
refers to any biological or pathological state that (1) is mediated
in part by the presence of SNCA protein and (2) whose outcome can
be affected by reducing the level of SNCA protein present. Specific
disorders associated with SNCA expression are noted below.
[0073] Because iRNA agent mediated silencing can persist for
several days after administering the iRNA agent composition, in
many instances, it is possible to administer the composition with a
frequency of less than once per day, or, for some instances, only
once for the entire therapeutic regimen.
[0074] Alpha-Synuclein
[0075] Alpha-synuclein protein is primarily found in the cytoplasm,
but has also been localized to the nucleus. In dopaminergic
neurons, alpha-synuclein is membrane bound. The protein is a
soluble monomer normally localized at the presynaptic region of
axons. The protein can form filamentous aggregates that are the
major component of intracellular inclusions in neurodegenerative
synucleinopathies.
[0076] Alpha-synuclein protein is associated with a number of
diseases characterized by synucleinopathies. Three point mutations
(A53T, A30P and E46K), and SNCA duplication and triplication events
are linked to autosomal dominant Parkinson's disease (familial PD,
also called FPD). The A53T and A30P mutations cause configuration
changes in the SNCA protein that promote in vitro protofibril
formation. The triplication event results in a two-fold
overexpression of SNCA protein. Alpha-synuclein is a major
fibrillar component of Lewy bodies, the cytoplasmic inclusions that
are characteristic of FPD and idiopathic PD, and the substantia
nigra of a Parkinson's disease brain is characterized by fibrillar
alpha-synuclein. In Alzheimer's patients, SNCA peptides are a major
component of amyloid plaques in the brains of patients with
Alzheimer's disease.
[0077] Aggregation of alpha-synuclein in the cytoplasm of cells can
be caused by a number of mechanisms, including overexpression of
the protein, inhibition of protein degradation, or a mutation that
affects the structure of the protein, resulting in an increased
tendency of the protein to self-associate.
[0078] An SNCA gene product can be a target for treatment methods
of neurodegenerative diseases such as PD. The treatment methods can
include targeting of an SNCA nucleic acid with an iRNA agent.
Alternatively, or additionally, an antisense RNA can be used to
inhibit gene expression, or an antibody or small molecule can be
used to target an SNCA nucleic acid. In general, an antisense RNA,
anti-SNCA antibody, or small molecule can be used in place of an
iRNA agent, e.g., by any of the methods or compositions described
herein. A combination of therapies to downregulate SNCA expression
and activity can also be used.
[0079] Sequencing of the SNCA gene has revealed common variants
including a dinucleotide repeat sequence (REP1) within the
promoter. REP1 varies in length across populations, and certain
allelic variants are associated with an increased risk for PD
(Kruger et al., Ann Neurol. 45:611-7, 1999). The SNCA gene REP1
locus is necessary for normal gene expression (Touchman et al.,
Genome Res. 11:78-86, 2001). SNCA gene expression levels among the
different REP1 alleles varied significantly over a 3-fold range,
suggesting that the association of specific genotypes with an
increased risk for PD may be a consequence of SNCA gene
over-expression (Chiba-Falek and Nussbaum, Hum Mol Genet.
10:3101-9, 2001). Functional analysis of intra-allelic variation at
the SNCA gene REP1 locus implied that overall length of the allele
plays the main role in transcriptional regulation; sequence
heterogeneity is unlikely to confound genetic association studies
based on alleles defined by length (Chiba-Falek et al., Hum Genet.
113:426-31, 2003). The recent discovery of SNCA gene triplication
as a rare cause of PD is consistent with the observation that
polymorphism within the gene promoter confers susceptibility via
the same mechanism of gene over-expression (Singleton et al.,
Science 302:841, 2003).
[0080] Three splice variants of SNCA have been identified (see FIG.
1A). The full-length 140 amino acid protein is the most abundant
form. A 128 amino acid form lacks exon 3, and a 112 amino acid form
lacks exon 5. An iRNA of the invention can target any isoform of
SNCA. An iRNA can target a common exon (e.g., exon 2, 4, 6, or 7)
to effectively target all known isoforms. An iRNA agent can target
a splice junction or an alternatively spliced exon to target
specific isoforms. For example, to target the 112 amino acid
isoform, an iRNA agent can target an mRNA sequence that overlaps
the exon 4/exon 6 splice junction. To target the 128 amino acid
protein isoform, an iRNA agent can target an mRNA sequence that
overlaps the exon 2/exon 4 junction.
Treatment of Parkinson's Disease
[0081] Any patient having PD (or any other alpha-synuclein related
disorder), is a candidate for treatment with a method or
composition described herein. Preferably the patient is not
terminally ill (e.g., the patient has life expectancy of two years
or more), and preferably the patient has not reached end-stage
Parkinson's disease (i.e., Hoehn and Yahr stage 5).
[0082] Presymptomatic subjects can also be candidates for treatment
with an anti-SNCA agent, e.g., an anti-SNCA iRNA agent, antisense
oligonucleotide, ribozyme, zinc finger protein, antibody, or small
molecule. In one embodiment, a presymptomatic candidate is
identified by either or both of risk-factor profiling and
functional neuroimaging (e.g., by fluorodopa and positron emission
tomography). For example, the candidate can be identified by
risk-factor profiling followed by functional neuroimaging.
[0083] Individuals having any genotype are candidates for
treatment. In some embodiments the patient will carry a particular
genetic mutation that places the patient at increased risk for
developing PD. For example, an individual carrying an SNCA gene
multiplication, e.g., an SNCA gene duplication or triplication is
at increased risk for developing PD and is a candidate for
treatment with the iRNA agent. In addition, a gain-of-function
mutation in SNCA can increase an individual's risk for developing
PD. An individual carrying an SNCA REP1 genotype (e.g., a REP1 "+1
allele" heterozygous or homozygous genotype) can be a candidate for
such treatment. An individual homozygous for the REP1 +1 allele
overexpresses SNCA. An individual carrying a mutation in the
UCHL-1, parkin, or SNCA gene is at increased risk for PD and can be
a candidate for treatment with an anti-SNCA iRNA agent.
Particularly, a mutation in the UCHL-1 or parkin gene will cause a
decrease in gene or protein activity. An individual carrying a Tau
genotype (e.g., a mutation in the Tau gene) or a Tau haplotype,
such as the H1 haplotype is also at risk for developing PD. Other
genetic risk factors include mutations in the MAPT, DJ1, PINK1, and
NURR1 genes, and polymorphism in several genes including the SNCA,
parkin, MAPT, and NAT2 genes.
[0084] Non-genetic (e.g., environmental) risk factors for PD
include age (e.g., over age 30, 35, 40, 45, or 50 years), gender
(men are generally have a higher risk than women), pesticide
exposure, heavy metal exposure, and head trauma. In general,
exogenous and endogenous factors that disrupt the ubiquitin
proteasomal pathway or more specifically inhibit the proteasome, or
which disrupt mitochondrial function, or which yield oxidative
stress, or which promote the aggregation and fibrillization of
alpha-synuclein, can increase the risk of an individual for
developing PD, and can contribute to the pathogenesis of PD.
[0085] In one embodiment, an iRNA agent can be used to target
wildtype SNCA in subjects with PD.
Treatment of Other Neurodegenerative Disorders
[0086] Any disease characterized by a synucleinopathy can be
treated with an inhibitory agent described herein (e.g., an agent
that targets SNCA), including Lewy body dementia, Multiple System
Atrophy, and Alzheimer's Disease. Individuals having any genotype
are candidates for treatment. In some embodiments, the patient will
carry a particular genetic mutation that places them at increased
risk for developing a synucleinopathy.
[0087] In one embodiment, an iRNA agent can be used to target
wildtype SNCA in subjects with a neurodegenerative disorder.
[0088] An individual can develop a synucleinopathy as a result of
certain environmental factors. For example, oxidative stress,
certain pesticides (e.g., 24D and agent orange), bacterial
infection, and head trauma have been linked to an increase in the
risk of developing PD, and can be determining factors for
determining the risk of an individual for synucleinopathies. These
factors (and others disclosed herein) can be considered when
evaluating the risk profile of a candidate subject for anti-SNCA
therapy.
Design and Selection of iRNA Agents
[0089] Candidate iRNA agents can be designed by performing, for
example, a gene walk analysis. Overlapping, adjacent, or closely
spaced candidate agents corresponding to all or some of the
transcribed region can be generated and tested. Each of the iRNA
agents can be tested and evaluated for the ability to down regulate
target gene expression (see below, "Evaluation of Candidate iRNA
agents").
[0090] An iRNA agent can be rationally designed based on sequence
information and desired characteristics. For example, an iRNA agent
can be designed according to the relative melting temperature of
the candidate duplex. Generally, the duplex will have a lower
melting temperature at the 5' end of the antisense strand than at
the 3' end of the antisense strand. This and other elements of
rational design are discussed in greater detail below (see, e.g.,
sections labeled "Palindromes," "Asymmetry," and "Z--X--Y," and
"Differential Modification of Terminal Duplex Stability" and
"Other-than-Watson-Crick Pairing."
[0091] An iRNA agent targeting an SNCA RNA can have the sequences
of any of the siRNAs of Table 1. In particular, the iRNA agent can
have the sequence of SNCA2, 7 (or 7s), or 8 (or 8s1 or 8s2), which
were found to be the most effective for silencing the SNCA gene in
vivo and in vitro.
Evaluation of Candidate iRNA Agents
[0092] A candidate anti-SNCA iRNA agent can be evaluated for its
ability to down-regulate SNCA gene expression. For example, a
candidate iRNA agent can be provided, and contacting with a cell
that expresses the SNCA gene. The level of SNCA gene expression
prior to and following contact with the candidate iRNA agent can be
compared. The SNCA target gene can be an endogenous or exogenous
gene within the cell. If it is determined that the amount of RNA or
protein expressed from the SNCA gene is lower following contact
with the iRNA agent, then it can be concluded that the iRNA agent
downregulates SNCA gene expression. The level of SNCA RNA or
protein in the cell can be determined by any method desired. For
example, the level of SNCA RNA can be determined by Northern blot
analysis, reverse transcription coupled with polymerase chain
reaction (RT-PCR), or RNAse protection assay. The level of protein
an be determined by, for example, Western blot analysis.
[0093] The iRNA agent can be tested in an in vitro or/and in an in
vivo system. For example, the target gene or a fragment thereof can
be fused to a reporter gene on a plasmid. The plasmid can be
transfected into a cell with a candidate iRNA agent. The efficacy
of the iRNA agent can be evaluated by monitoring expression of the
reporter gene. The reporter gene can be monitored in vivo, such as
by fluorescence or in situ hybridization. Exemplary fluorescent
reporter genes include but are not limited to green fluorescent
protein and luciferase. Expression of the reporter gene can also be
monitored by Northern blot, RT-PCR, RNAse-protection assay, or
Western blot analysis as described above.
[0094] Efficacy of an anti-SNCA mRNA agent can be tested in a
mammalian cell line (e.g., a mammalian neural cell line), such as a
human neuroblastoma cell line. For example, a cell line useful for
testing efficacy of an anti-SNCA iRNA agent are those with a
neuronal phenotype (neuroblastomas, neuronally differentiated
phaeochromocytomas and primary neuronal cultures) or non neuronal
cell lines (e.g. kidney, muscle or ovarian cells). Neuroblastoma
cell lines include BE(2)-M17, SH-SY5Y (both human) and N2a (mouse).
BE(2)-M17 cells biochemically mimic dopaminergic neurons of the
human brain affected by alpha-synucleinopathies.
[0095] Controls include [0096] (1) testing the efficacy and
specificity of an iRNA by assaying for a decrease in expression of
the target gene by, for example, comparison to expression of an
endogenous or exogenous off-target RNA or protein; and [0097] (2)
testing specificity of the effect on target gene expression by
administering a "nonfunctional" iRNA agent.
[0098] Nonfunctional control iRNA agents can [0099] (a) target a
gene not expressed in the cell; [0100] (b) be of nonsensical
sequence (e.g., a scrambled version of the test iRNA); or [0101]
(c) have a sequence complementary to the target gene, but be known
by previous experiments to lack an ability to silence gene
expression.
[0102] Assays include time course experiments to monitor stability
and duration of silencing effect by an iRNA agent and monitoring in
dividing versus nondividing cells. Presumably in dividing cells,
the dsRNA is diluted out over time, thus decreasing the duration of
the silencing effect. The implication is that dosage will have to
be adjusted in vivo, and/or an iRNA agent will have to be
administered more frequently to maintain the silencing effect. To
monitor nondividing cells, cells can be arrested by serum
withdrawal. Neurons are post-mitotic cells, and thus neural cells
are aptly suited for assaying the stability of iRNA agents, such as
an anti-SNCA iRNA agent, for use in therapeutic compositions for
the treatment of disorders of the nervous system, e.g.,
neurodegenerative disorders.
[0103] A candidate iRNA agent can also be evaluated for
cross-species reactivity. For example, cell lines derived from
different species (e.g., mouse vs. human) or in biological samples
(e.g., serum or tissue extracts) isolated from different species
can be transfected with a target iRNA agent and a candidate iRNA
agent. The efficacy of the iRNA agent can be determined for the
cell from the different species.
Stability Testing, Modification, and Retesting of iRNA Agents
[0104] A candidate iRNA agent can be evaluated with respect to its
susceptibility to cleavage by an endonuclease or exonuclease, such
as when the iRNA agent is introduced into the body of a subject.
Methods can be employed to identify sites that are susceptible to
modification, particularly cleavage, e.g., cleavage by a component
found in the body of a subject. The component (e.g., an exonuclease
or endonuclease) can be specific for a particular area of the body,
such as a particular tissue, organ, or bodily fluid (e.g., blood,
plasma, or serum). Sites in an iRNA agent that are susceptible to
cleavage, either by endonucleolytic or exonucleolytic cleavage, in
certain areas of the body, may be resistant to cleavage in other
areas of the body. An exemplary method includes: [0105] (1)
determining the point or points at which a substance present in the
body of a subject, and preferably a component present in a
compartment of the body into which a therapeutic dsRNA is to be
introduced (this includes compartments into which the therapeutic
is directly introduced, e.g., the circulation, as well as in
compartments to which the therapeutic is eventually targeted; in
some cases, e.g., the eye or the brain the two are the same),
cleaves a dsRNA, e.g., an iRNA agent, and [0106] (2) identifying
one or more points of cleavage, e.g., endonucleolytic,
exonucleolytic, or both, in the dsRNA. Optionally, the method
further includes providing an RNA modified to inhibit cleavage at
such sites.
[0107] These steps can be accomplished by using one or more of the
following assays: [0108] (i) (a) contacting a candidate dsRNA,
e.g., an iRNA agent, with a test agent (e.g., a biological agent),
[0109] (b) using a size-based assay, e.g., gel electrophoresis to
determine if the iRNA agent is cleaved. In a preferred embodiment a
time course is taken and a number of samples incubated for
different times are applied to the size-based assay. In preferred
embodiments, the candidate dsRNA is not labeled. The method can be
a "stains all" method. [0110] (ii) (a) supplying a candidate dsRNA,
e.g., an iRNA agent, which is radiolabeled; [0111] (b) contacting
the candidate dsRNA with a test agent, [0112] (c) using a
size-based assay, e.g., gel electrophoresis to determine if the
iRNA agent is cleaved. In a preferred embodiment a time course is
taken where a number of samples are incubated for different times
and applied to the size-based assay. In preferred embodiments, the
determination is made under conditions that allow determination of
the number of nucleotides present in a fragment. E.g., an incubated
sample is run on a gel having markers that allow assignment of the
length of cleavage products. The gel can include a standard that is
a "ladder" digestion. Either the sense or antisense strand can be
labeled. Preferably only one strand is labeled in a particular
experiment. The label can be incorporated at the 5' end, 3' end, or
at an internal position. Length of a fragment (and thus the point
of cleavage) can be determined from the size of the fragment based
on the ladder and mapping using a site-specific endonuclease such
as RNAse T1. [0113] (iii) fragments produced by any method, e.g.,
one of those above, can be analyzed by mass spectrometry. Following
contacting the iRNA with the test agent, the iRNA can be purified
(e.g., partially purified), such as by phenol-chloroform extraction
followed by precipitation. Liquid chromatography can then be used
to separate the fragments and mass spectrometry can be used to
determine the mass of each fragment. This allows determination of
the mechanism of cleavage, e.g., if by direct phosphate cleavage,
such as be 5' or 3' exonuclease cleavage, or mediated by the 2'OH
via formation of a cyclic phosphate.
[0114] More than one dsRNA, e.g., anti-SNCA mRNA agent, can be
evaluated. The evaluation can be used to select a sequence for use
in a therapeutic iRNA agent. For example, it allows the selection
of a sequence having an optimal (usually minimized) number of sites
that are cleaved by a substance(s), e.g., an enzyme, present in the
relevant compartments of a subject's body. Two or more dsRNA
candidates can be evaluated to select a sequence that is optimized.
For example, two or more candidates can be evaluated and the one
with optimum properties, e.g., fewer cleavage sites, selected.
[0115] The information relating to a site of cleavage can be used
to select a backbone atom, a sugar or a base, for modification,
e.g., a modification to decrease cleavage.
[0116] Exemplary modifications include modifications that inhibit
endonucleolytic degradation, including the modifications described
herein. Particularly favored modifications include: 2'
modification, e.g., provision of a 2' OMe moiety on a U in a sense
or antisense strand, but especially on a sense strand; modification
of the backbone, e.g., with the replacement of an O with an S, in
the phosphate backbone, e.g., the provision of a phosphorothioate
modification, on the U or the A or both, especially on an antisense
strand; replacement of the U with a C5 amino linker; replacement of
an A with a G (sequence changes are preferred to be located on the
sense strand and not the antisense strand); and modification of the
at the 2', 6', 7', or 8' position. Preferred embodiments are those
in which one or more of these modifications are present on the
sense but not the antisense strand, or embodiments where the
antisense strand has fewer of such modifications.
[0117] Exemplary modifications also include those that inhibit
degradation by exonucleases. Examples of modifications that inhibit
exonucleolytic degradation can be found herein. Particularly
favored modifications include: 2' modification, e.g., provision of
a 2' OMe moiety in a 3' overhang, e.g., at the 3' terminus (3'
terminus means at the 3' atom of the molecule or at the most 3'
moiety, e.g., the most 3' P or 2' position, as indicated by the
context); modification of the backbone, e.g., with the replacement
of a P with an S, e.g., the provision of a phosphorothioate
modification, or the use of a methylated P in a 3' overhang, e.g.,
at the 3' terminus; combination of a 2' modification, e.g.,
provision of a 2' OMe moiety and modification of the backbone,
e.g., with the replacement of a P with an S, e.g., the provision of
a phosphorothioate modification, or the use of a methylated P, in a
3' overhang, e.g., at the 3' terminus; modification with a 3'
alkyl; modification with an abasic pyrrolidine in a 3' overhang,
e.g., at the 3' terminus; modification with naproxen, ibuprofen, or
other moieties which inhibit degradation at the 3' terminus.
[0118] These methods can be used to select and or optimize a
therapeutic anti-SNCA iRNA agent.
[0119] The method can be used to evaluate a candidate dsRNA, e.g.,
a candidate iRNA agent, which is unmodified or which includes a
modification, e.g., a modification that inhibits degradation,
targets the dsRNA molecule, or modulates hybridization. Such
modifications are described herein. A cleavage assay can be
combined with an assay to determine the ability of a modified or
non-modified candidate to silence the target. E.g., one might
(optionally) test a candidate to evaluate its ability to silence a
target (or off-target sequence), evaluate its susceptibility to
cleavage, modify it (e.g., as described herein, e.g., to inhibit
degradation) to produce a modified candidate, and test the modified
candidate for one or both of the ability to silence and the ability
to resist degradation. The procedure can be repeated. Modifications
can be introduced one at a time or in groups. A cell-based method
can be used to monitor the ability of the iRNA agent to silence.
This can be followed by a different method, e.g., a whole animal
method, to confirm activity.
[0120] A test agent refers to a biological agent, e.g., biological
sample, tissue extract or prep, serum, a known enzyme or other
molecule known to modify, e.g., cleave, a dsRNA, e.g., an
endonuclease. The test agent can be in a compartment of the body in
which the RNAi agent will be exposed. For example, for an iRNA
agent that is administered directly in to neural tissue (e.g., into
the brain or into the spinal cord) the test agent could be brain
tissue extract or spinal fluid. An iRNA agent that is to be
supplied directly to the eye can be incubated with an extract of
the eye.
In Vivo Testing
[0121] An iRNA agent identified as being capable of inhibiting SNCA
gene expression can be tested for functionality in vivo in an
animal model (e.g., in a mammal, such as in mouse or rat). For
example, the mRNA agent can be administered to an animal, and the
iRNA agent evaluated with respect to its biodistribution,
stability, and its ability to inhibit SNCA gene expression.
[0122] The iRNA agent can be administered directly to the target
tissue, such as by injection, or the iRNA agent can be administered
to the animal model in the same manner that it would be
administered to a human. For example, the iRNA agent can be
injected directly into a target region of the brain (e.g., into the
cortex, the substantia nigra, the globus pallidus, or the
hippocampus), and after a period of time, the brain can be
harvested and tissue slices examined for distribution of the
agent.
[0123] The iRNA agent can also be evaluated for its intracellular
distribution. The evaluation can include determining whether the
iRNA agent was taken up into the cell. The evaluation can also
include determining the stability (e.g., the half-life) of the iRNA
agent. Evaluation of an iRNA agent in vivo can be facilitated by
use of an iRNA agent conjugated to a traceable marker (e.g., a
fluorescent marker such as fluorescein; a radioactive label, such
as .sup.32P, .sup.33P, or .sup.3H; gold particles; or antigen
particles for immunohistochemistry).
[0124] An iRNA agent useful for monitoring biodistribution can lack
gene silencing activity in vivo. For example, the iRNA agent can
target a gene not present in the animal (e.g., an iRNA agent
injected into mouse can target luciferase), or an iRNA agent can
have a non-sense sequence, which does not target any gene, e.g.,
any endogenous gene). Localization/biodistribution of the iRNA can
be monitored by a traceable label attached to the iRNA agent, such
as a traceable agent described above
[0125] The iRNA agent can be evaluated with respect to its ability
to down regulate SNCA expression. Levels of SNCA expression in vivo
can be measured, for example, by in situ hybridization, or by the
isolation of RNA from tissue prior to and following exposure to the
iRNA agent. SNCA RNA can be detected by any desired method,
including but not limited to RT-PCR, Northern blot, or RNAase
protection assay. Alternatively, or additionally, SNCA gene
expression can be monitored by performing Western blot analysis on
tissue extracts treated with the anti-SNCA iRNA agent.
[0126] An anti-SNCA mRNA agent can be tested in a mouse model for
PD, such as a mouse carrying a wildtype copy of the human SNCA gene
(Masliah et al., Science 287: 1265-1269, 2000) or in mouse carrying
a mutant human SNCA (Richfield et al., Exp. Neurol. 175: 35-48,
2002; Giasson et al., Neuron 34: 521-533, 2002; Lee et al., Proc
Natl Acad. Sci. 99: 8968-8973, 2002). The mutant mouse can carry a
human SNCA gene that expresses an A53T, A30P, or E46K mutation. A
treated mouse model can be observed for a decrease in symptoms
associated with PD.
[0127] iRNA Chemistry
[0128] Described herein are isolated iRNA agents, e.g., RNA
molecules, (double-stranded; single-stranded) that mediate RNAi.
The iRNA agents preferably mediate RNAi with respect to an
endogenous SNCA gene of a subject
[0129] Generally, the iRNA agents of the instant invention include
a region of sufficient complementarity to an SNCA RNA, and are of
sufficient length in terms of nucleotides, such that the iRNA
agent, or a fragment thereof, can mediate down regulation of the
SNCA gene. It is not necessary that there be perfect
complementarity between the iRNA agent and the target, but the
correspondence must be sufficient to enable the iRNA agent, or a
cleavage product thereof, to direct sequence specific silencing,
e.g., by RNAi cleavage of an SNCA RNA.
[0130] Therefore, the iRNA agents featured in the instant invention
include agents comprising a sense strand and antisense strand each
comprising a sequence of at least 16, 17 or 18 nucleotides which is
essentially identical, as defined below, to a sequence included in
FIG. 1, including an SNCA sequence of Table 1, except that not more
than 1, 2 or 3 nucleotides per strand, respectively, have been
substituted by other nucleotides (e.g., adenosine replaced by
uracil), while essentially retaining the ability to inhibit SNCA
expression in a mammalian cell. These agents will therefore possess
at least 15 nucleotides identical to a sequence of FIG. 1, but 1, 2
or 3 base mismatches with respect to either the target SNCA mRNA
sequence or between the sense and antisense strand are introduced.
Mismatches to the target SNCA mRNA sequence, particularly in the
antisense strand, are most tolerated in the terminal regions and if
present are preferably in a terminal region or regions, e.g.,
within 6, 5, 4, or 3 nucleotides of the 5' and/or 3' terminus, most
preferably within 6, 5, 4, or 3 nucleotides of the 5'-terminus of
the sense strand or the 3'-terminus of the antisense strand. The
sense strand need only be sufficiently complementary with the
antisense strand to maintain the over all double strand character
of the molecule.
[0131] Single stranded regions of an iRNA agent will often be
modified or include nucleoside surrogates, e.g., the unpaired
region or regions of a hairpin structure, e.g., a region which
links two complementary regions, can have modifications or
nucleoside surrogates. Modifications to stabilize one or both of
the 3'- or 5'-terminus of an iRNA agent, e.g., against
exonucleases, or to favor the antisense sRNA agent to enter into
RISC are also favored. Modifications can include C3 (or C6, C7,
C12) amino linkers, thiol linkers, carboxyl linkers,
non-nucleotidic spacers (C3, C6, C9, C12, abasic, triethylene
glycol, hexaethylene glycol), special biotin or fluorescein
reagents that come as phosphoramidites and that have another
DMT-protected hydroxyl group, allowing multiple couplings during
RNA synthesis. As discussed elsewhere herein, an iRNA agent will
often be modified or include a ribose replacement monomer subunit
(RRMS) in addition to the nucleotide surrogate. An RRMS replaces a
ribose sugar on a ribonucleotide with another moiety, e.g., a
non-carbohydrate (preferably cyclic) carrier. RRMS' are described
in greater detail below.
[0132] Although, in mammalian cells, long ds iRNA agents can induce
the interferon response which is frequently deleterious, short ds
iRNA agents do not trigger the interferon response, at least not to
an extent that is deleterious to the cell and host. The iRNA agents
of the present invention include molecules which are sufficiently
short that they do not trigger the interferon response in mammalian
cells. Thus, the administration of a composition of an iRNA agent
(e.g., formulated as described herein) to a mammalian cell can be
used to silence expression of the SNCA gene while circumventing the
interferon response. Molecules that are short enough that they do
not trigger an interferon response are termed sRNA agents or
shorter iRNA agents herein. "sRNA agent or shorter iRNA agent" as
used herein, refers to an iRNA agent, e.g., a double stranded RNA
agent or single strand agent, that is sufficiently short that it
does not induce a deleterious interferon response in a human cell,
e.g., it has a duplexed region of less than 60 but preferably less
than 50, 40, or 30 nucleotide pairs.
[0133] In addition to homology to target RNA and the ability to
down regulate a target gene, an iRNA agent will preferably have one
or more of the following properties: [0134] (1) it will be of the
Formula 1, 2, 3, or 4 set out in the RNA Agent section below;
[0135] (2) if single stranded it will have a 5' modification which
includes one or more phosphate groups or one or more analogs of a
phosphate group; [0136] (3) it will, despite modifications, even to
a very large number, or all of the nucleosides, have an antisense
strand that can present bases (or modified bases) in the proper
three dimensional framework so as to be able to form correct base
pairing and form a duplex structure with a homologous target RNA
which is sufficient to allow down regulation of the target, e.g.,
by cleavage of the target RNA; [0137] (4) it will, despite
modifications, even to a very large number, or all of the
nucleosides, still have "RNA-like" properties, i.e., it will
possess the overall structural, chemical and physical properties of
an RNA molecule, even though not exclusively, or even partly, of
ribonucleotide-based content. For example, an iRNA agent can
contain, e.g., a sense and/or an antisense strand in which all of
the nucleotide sugars contain e.g., 2' fluoro in place of 2'
hydroxyl. This deoxyribonucleotide-containing agent can still be
expected to exhibit RNA-like properties. While not wishing to be
bound by theory, the electronegative fluorine prefers an axial
orientation when attached to the C2' position of ribose. This
spatial preference of fluorine can, in turn, force the sugars to
adopt a C.sub.3'-endo pucker. This is the same puckering mode as
observed in RNA molecules and gives rise to the RNA-characteristic
A-family-type helix. Further, since fluorine is a good hydrogen
bond acceptor, it can participate in the same hydrogen bonding
interactions with water molecules that are known to stabilize RNA
structures. (Generally, it is preferred that a modified moiety at
the 2' sugar position will be able to enter into H-bonding which is
more characteristic of the OH moiety of a ribonucleotide than the H
moiety of a deoxyribonucleotide. A preferred iRNA agent will:
exhibit a C.sub.3'-endo pucker in all, or at least 50, 75, 80, 85,
90, or 95% of its sugars; exhibit a C.sub.3'-endo pucker in a
sufficient amount of its sugars that it can give rise to a the
RNA-characteristic A-family-type helix; will have no more than 20,
10, 5, 4, 3, 2, or 1 sugar which is not a C.sub.3'-endo pucker
structure. These limitations are particularly preferably in the
antisense strand; [0138] (5) regardless of the nature of the
modification, and even though the RNA agent can contain
deoxynucleotides or modified deoxynucleotides, particularly in
overhang or other single strand regions, it is preferred that DNA
molecules, or any molecule in which more than 50, 60, or 70% of the
nucleotides in the molecule, or more than 50, 60, or 70% of the
nucleotides in a duplexed region are deoxyribonucleotides, or
modified deoxyribonucleotides which are deoxy at the 2' position,
are excluded from the definition of RNA agent.
[0139] A "single strand iRNA agent" as used herein, is an iRNA
agent which is made up of a single molecule. It may include a
duplexed region, formed by intra-strand pairing, e.g., it may be,
or include, a hairpin or panhandle structure. Single strand iRNA
agents are preferably antisense with regard to the target molecule.
In preferred embodiments single strand iRNA agents are 5'
phosphorylated or include a phosphoryl analog at the 5' prime
terminus. 5'-phosphate modifications include those which are
compatible with RISC mediated gene silencing. Suitable
modifications include: 5'-monophosphate ((HO)2(O)P--O-5');
5'-diphosphate ((HO)2(O)P--O--P(HO)(O)--O-5'); 5'-triphosphate
((HO)2(O)P--O--(HO)(O)P--O--P(HO)(O)--O-5'); 5'-guanosine cap
(7-methylated or non-methylated)
(7m-G-O-5'-(HO)(O)P--O--(HO)(O)P--O--P(HO)(O)--O-5'); 5'-adenosine
cap (Appp), and any modified or unmodified nucleotide cap structure
(N--O-5'-(HO)(O)P--O--(HO)(O)P--O--P(HO)(O)--O-5');
5'-monothiophosphate (phosphorothioate; (HO)2(S)P--O-5');
5'-monodithiophosphate (phosphorodithioate; (HO)(HS)(S)P--O-5'),
5'-phosphorothiolate ((HO)2(O)P--S-5'); any additional combination
of oxygen/sulfur replaced monophosphate, diphosphate and
triphosphates (e.g. 5'-alpha-thiotriphosphate,
5'-gamma-thiotriphosphate, etc.), 5'-phosphoramidates
((HO)2(O)P--NH-5', (HO)(NH2)(O)P--O-5'), 5'-alkylphosphonates
(R=alkyl=methyl, ethyl, isopropyl, propyl, etc., e.g.
RP(OH)(O)--O-5'-, (OH)2(O)P-5'-CH2-), 5'-alkyletherphosphonates
(R=alkylether=methoxymethyl (MeOCH2-), ethoxymethyl, etc., e.g.
RP(OH)(O)--O-5'-). (These modifications can also be used with the
antisense strand of a double stranded iRNA.)
[0140] A "ds iRNA agent" (abbreviation for "double stranded iRNA
agent") as used herein, is an iRNA agent which includes more than
one, and preferably two, strands in which interchain hybridization
can form a region of duplex structure.
[0141] The antisense strand of a double stranded mRNA agent should
be equal to or at least, 14, 15, 16 17, 18, 19, 25, 29, 40, or 50
nucleotides in length. It should be equal to or less than 60, 50,
40, or 30, nucleotides in length. Preferred ranges are 15 to 30, 17
to 25, 19 to 23, and 19 to 21 nucleotides in length.
[0142] The sense strand of a double stranded mRNA agent should be
equal to or at least 14, 15, 16, 17, 18, 19, 25, 29, 40, or 50
nucleotides in length. It should be equal to or less than 60, 50,
40, or 30, nucleotides in length. Preferred ranges are 15 to 30, 17
to 25, 19 to 23, and 19 to 21 nucleotides in length.
[0143] The double strand portion of a double stranded mRNA agent
should be equal to or at least, 15, 16, 17, 18, 19, 20, 21, 22, 23,
24, 25, 29, 40, or 50 nucleotide pairs in length. It should be
equal to or less than 60, 50, 40, or 30, nucleotides pairs in
length. Preferred ranges are 15 to 30, 17 to 25, 19 to 23, and 19
to 21 nucleotides pairs in length.
[0144] It may be desirable to modify one or both of the antisense
and sense strands of a double strand iRNA agent. In some cases they
will have the same modification or the same class of modification
but in other cases the sense and antisense strand will have
different modifications, e.g., in some cases it is desirable to
modify only the sense strand. It may be desirable to modify only
the sense strand, e.g., to inactivate it, e.g., the sense strand
can be modified in order to inactivate the sense strand and prevent
formation of an active sRNA/protein or RISC. This can be
accomplished by a modification which prevents 5'-phosphorylation of
the sense strand, e.g., by modification with a 5'-O-methyl
ribonucleotide (see Nykanen et al., (2001) ATP requirements and
small interfering RNA structure in the RNA interference pathway.
Cell 107, 309-321.) Other modifications which prevent
phosphorylation can also be used, e.g., simply substituting the
5'-OH by H rather than O-Me. Alternatively, a large bulky group may
be added to the 5'-phosphate turning it into a phosphodiester
linkage, though this may be less desirable as phosphodiesterases
can cleave such a linkage and release a functional sRNA 5'-end.
Antisense strand modifications include 5' phosphorylation as well
as any of the other 5' modifications discussed herein, particularly
the 5' modifications discussed above in the section on single
stranded iRNA molecules.
[0145] It is preferred that the sense and antisense strands be
chosen such that the ds mRNA agent includes a single strand or
unpaired region at one or both ends of the molecule. Thus, a ds
iRNA agent contains sense and antisense strands, preferably paired
to contain an overhang, e.g., one or two 5' or 3' overhangs but
preferably a 3' overhang of 2-3 nucleotides. Most embodiments will
have a 3' overhang. Preferred iRNA agents will have single-stranded
overhangs, preferably 3' overhangs, of 1 to 4, or preferably 2 or 3
nucleotides in length at each end. The overhangs can be the result
of one strand being longer than the other, or the result of two
strands of the same length being staggered. 5' ends are preferably
phosphorylated.
[0146] Preferred lengths for the duplexed region is between 15 and
30, most preferably 18, 19, 20, 21, 22, and 23 nucleotides in
length, e.g., in the iRNA agent range discussed above. iRNA agents
can resemble in length and structure the natural Dicer processed
products from long dsRNAs. Embodiments in which the two strands of
the sRNA agent are linked, e.g., covalently linked are also
included. Hairpin, or other single strand structures which provide
the required double stranded region, and preferably a 3' overhang
are also within the invention.
[0147] As used herein, the phrase "mediates RNAi" refers to the
ability of an agent to silence, in a sequence specific manner, a
target gene. "Silencing a target gene" means the process whereby a
cell containing and/or secreting a certain product of the target
gene when not in contact with the agent, will contain and/or secret
at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% less of
such gene product when contacted with the agent, as compared to a
similar cell which has not been contacted with the agent. Such
product of the target gene can, for example, be a messenger RNA
(mRNA), a protein, or a regulatory element. While not wishing to be
bound by theory, it is believed that silencing by the agents
described herein uses the RNAi machinery or process and a guide
RNA, e.g., an iRNA agent of 15 to 30 nucleotide pairs.
[0148] As used herein, the term "complementary" is used to indicate
a sufficient degree of complementarity such that stable and
specific binding occurs between a compound of the invention and a
target RNA molecule, e.g., an SNCA mRNA molecule. Specific binding
requires a sufficient degree of complementarity to avoid
non-specific binding of the oligomeric compound to non-target
sequences under conditions in which specific binding is desired,
i.e., under physiological conditions in the case of in vivo assays
or therapeutic treatment, or in the case of in vitro assays, under
conditions in which the assays are performed. The non-target
sequences typically differ by at least 4 nucleotides.
[0149] As used herein, an iRNA agent is "sufficiently
complementary" to a target RNA, e.g., a target mRNA (e.g., a target
SCNA mRNA) if the iRNA agent reduces the production of a protein
encoded by the target RNA in a cell. The iRNA agent may also be
"exactly complementary" (excluding the RRMS containing subunit(s)
to the target RNA, e.g., the target RNA and the iRNA agent anneal,
preferably to form a hybrid made exclusively of Watson-Crick
basepairs in the region of exact complementarity. A "sufficiently
complementary" target RNA can include an internal region (e.g., of
at least 10 nucleotides) that is exactly complementary to a target
SNCA RNA. Moreover, in some embodiments, the iRNA agent
specifically discriminates a single-nucleotide difference. In this
case, the iRNA agent only mediates RNAi if exact complementary is
found in the region (e.g., within 7 nucleotides of) the
single-nucleotide difference. Preferred iRNA agents will be based
on or consist of or comprise the SNCA sense and antisense sequences
provided in Table 1 and/or sequences illustrated in FIG. 1.
[0150] RNA agents discussed herein include otherwise unmodified RNA
as well as RNA which have been modified, e.g., to improve efficacy,
and polymers of nucleoside surrogates. Unmodified RNA refers to a
molecule in which the components of the nucleic acid, namely
sugars, bases, and phosphate moieties, are the same or essentially
the same as that which occur in nature, preferably as occur
naturally in the human body. The art has referred to rare or
unusual, but naturally occurring, RNAs as modified RNAs, see, e.g.,
Limbach et al., (1994) Nucleic Acids Res. 22: 2183-2196. Such rare
or unusual RNAs, often termed modified RNAs (apparently because the
are typically the result of a post transcriptionally modification)
are within the term unmodified RNA, as used herein. Modified RNA as
used herein refers to a molecule in which one or more of the
components of the nucleic acid, namely sugars, bases, and phosphate
moieties, are different from that which occur in nature, preferably
different from that which occurs in the human body. While they are
referred to as modified "RNAs," they will of course, because of the
modification, include molecules which are not RNAs. Nucleoside
surrogates are molecules in which the ribophosphate backbone is
replaced with a non-ribophosphate construct that allows the bases
to the presented in the correct spatial relationship such that
hybridization is substantially similar to what is seen with a
ribophosphate backbone, e.g., non-charged mimics of the
ribophosphate backbone. Examples of all of the above are discussed
herein.
[0151] Much of the discussion below refers to single strand
molecules. In many embodiments of the invention a ds iRNA agent,
e.g., a partially double stranded iRNA agent, is required or
preferred. Thus, it is understood that double stranded structures
(e.g. where two separate molecules are contacted to form the double
stranded region or where the double stranded region is formed by
intramolecular pairing (e.g., a hairpin structure)) made of the
single stranded structures described below are within the
invention. Preferred lengths are described elsewhere herein.
[0152] As nucleic acids are polymers of subunits or monomers, many
of the modifications described below occur at a position which is
repeated within a nucleic acid, e.g., a modification of a base, or
a phosphate moiety, or the non-linking O of a phosphate moiety. In
some cases the modification will occur at all of the subject
positions in the nucleic acid but in many, and in fact in most,
cases it will not. By way of example, a modification may only occur
at a 3' or 5' terminal position, may only occur in a terminal
region, e.g. at a position on a terminal nucleotide or in the last
2, 3, 4, 5, or 10 nucleotides of a strand. A modification may occur
in a double strand region, a single strand region, or in both. A
modification may occur only in the double strand region of an RNA
or may only occur in a single strand region of an RNA. E.g., a
phosphorothioate modification at a non-linking O position may only
occur at one or both termini, may only occur in a terminal regions,
e.g., at a position on a terminal nucleotide or in the last 2, 3,
4, 5, or 10 nucleotides of a strand, or may occur in double strand
and single strand regions, particularly at termini. Similarly, a
modification may occur on the sense strand, antisense strand, or
both. In some cases, the sense and antisense strand will have the
same modifications or the same class of modifications, but in other
cases the sense and antisense strand will have different
modifications, e.g., in some cases it may be desirable to modify
only one strand, e.g. the sense strand. In some embodiments it is
particularly preferred, e.g., to enhance stability, to include
particular bases in overhangs, or to include modified nucleotides
or nucleotide surrogates, in single strand overhangs, e.g., in a 5'
or 3' overhang, or in both. E.g., it can be desirable to include
purine nucleotides in overhangs. In some embodiments all or some of
the bases in a 3' or 5' overhang will be modified, e.g., with a
modification described herein. Modifications can include, e.g., the
use of modifications at the 2' OH group of the ribose sugar, e.g.,
the use of deoxyribonucleotides, e.g., deoxythymidine, instead of
ribonucleotides, and modifications in the phosphate group, e.g.,
phosphothioate modifications. Overhangs need not be homologous with
the target sequence.
Modifications and nucleotide surrogates are discussed below.
##STR00001##
[0153] The scaffold presented above in Formula 1 represents a
portion of a ribonucleic acid. The basic components are the ribose
sugar, the base, the terminal phosphates, and phosphate
internucleotide linkers. Where the bases are naturally occurring
bases, e.g., adenine, uracil, guanine or cytosine, the sugars are
the unmodified 2' hydroxyl ribose sugar (as depicted) and W, X, Y,
and Z are all O, Formula 1 represents a naturally occurring
unmodified oligoribonucleotide.
[0154] Unmodified oligoribonucleotides may be less than optimal in
some applications, e.g., unmodified oligoribonucleotides can be
prone to degradation by e.g., cellular nucleases. Nucleases can
hydrolyze nucleic acid phosphodiester bonds. However, chemical
modifications to one or more of the above RNA components can confer
improved properties, and, e.g., can render oligoribonucleotides
more stable to nucleases. Unmodified oligoribonucleotides may also
be less than optimal in terms of offering tethering points for
attaching ligands or other moieties to an iRNA agent.
[0155] Modified nucleic acids and nucleotide surrogates can include
one or more of: [0156] (i) alteration, e.g., replacement, of one or
both of the non-linking (X and Y) phosphate oxygens and/or of one
or more of the linking (W and Z) phosphate oxygens (When the
phosphate is in the terminal position, one of the positions W or Z
will not link the phosphate to an additional element in a naturally
occurring ribonucleic acid. However, for simplicity of terminology,
except where otherwise noted, the W position at the 5' end of a
nucleic acid and the terminal Z position at the 3' end of a nucleic
acid, are within the term "linking phosphate oxygens" as used
herein); [0157] (ii) alteration, e.g., replacement, of a
constituent of the ribose sugar, e.g., of the 2' hydroxyl on the
ribose sugar, or wholesale replacement of the ribose sugar with a
structure other than ribose, e.g., as described herein; [0158]
(iii) wholesale replacement of the phosphate moiety (bracket I)
with "dephospho" linkers; [0159] (iv) modification or replacement
of a naturally occurring base; [0160] (v) replacement or
modification of the ribose-phosphate backbone (bracket II); [0161]
(vi) modification of the 3' end or 5' end of the RNA, e.g.,
removal, modification or replacement of a terminal phosphate group
or conjugation of a moiety, e.g. a fluorescently labeled moiety, to
either the 3' or 5' end of RNA.
[0162] The terms replacement, modification, alteration, and the
like, as used in this context, do not imply any process limitation,
e.g., modification does not mean that one must start with a
reference or naturally occurring ribonucleic acid and modify it to
produce a modified ribonucleic acid bur rather modified simply
indicates a difference from a naturally occurring molecule.
[0163] It is understood that the actual electronic structure of
some chemical entities cannot be adequately represented by only one
canonical form (i.e. Lewis structure). While not wishing to be
bound by theory, the actual structure can instead be some hybrid or
weighted average of two or more canonical forms, known collectively
as resonance forms or structures. Resonance structures are not
discrete chemical entities and exist only on paper. They differ
from one another only in the placement or "localization" of the
bonding and nonbonding electrons for a particular chemical entity.
It can be possible for one resonance structure to contribute to a
greater extent to the hybrid than the others. Thus, the written and
graphical descriptions of the embodiments of the present invention
are made in terms of what the art recognizes as the predominant
resonance form for a particular species. For example, any
phosphoroamidate (replacement of a nonlinking oxygen with nitrogen)
would be represented by X.dbd.O and Y.dbd.N in the above
figure.
[0164] Replacement of the Phosphate Group
[0165] The phosphate group can be replaced by non-phosphorus
containing connectors (cf. Bracket I in Formula 1 above). While not
wishing to be bound by theory, it is believed that since the
charged phosphodiester group is the reaction center in nucleolytic
degradation, its replacement with neutral structural mimics should
impart enhanced nuclease stability. Again, while not wishing to be
bound by theory, it can be desirable, in some embodiment, to
introduce alterations in which the charged phosphate group is
replaced by a neutral moiety.
[0166] Examples of moieties which can replace the phosphate group
include siloxane, carbonate, carboxymethyl, carbamate, amide,
thioether, ethylene oxide linker, sulfonate, sulfonamide,
thioformacetal, formacetal, oxime, methyleneimino,
methylenemethylimino, methylenehydrazo, methylenedimethylhydrazo
and methyleneoxymethylimino. Preferred replacements include the
methylenecarbonylamino and methylenemethylimino groups.
[0167] Candidate modifications can be evaluated as described
below.
[0168] Replacement of Ribophosphate Backbone
[0169] Oligonucleotide-mimicking scaffolds can also be constructed
wherein the phosphate linker and ribose sugar are replaced by
nuclease resistant nucleoside or nucleotide surrogates (see Bracket
II of Formula 1 above). While not wishing to be bound by theory, it
is believed that the absence of a repetitively charged backbone
diminishes binding to proteins that recognize polyanions (e.g.
nucleases). Again, while not wishing to be bound by theory, it can
be desirable in some embodiment, to introduce alterations in which
the bases are tethered by a neutral surrogate backbone.
[0170] Examples include the mophilino, cyclobutyl, pyrrolidine and
peptide nucleic acid (PNA) nucleoside surrogates. A preferred
surrogate is a PNA surrogate.
[0171] Candidate modifications can be evaluated as described
below.
[0172] Terminal Modifications
[0173] The 3' and 5' ends of an oligonucleotide can be modified.
Such modifications can be at the 3' end, 5' end or both ends of the
molecule. They can include modification or replacement of an entire
terminal phosphate or of one or more of the atoms of the phosphate
group. E.g., the 3' and 5' ends of an oligonucleotide can be
conjugated to other functional molecular entities such as labeling
moieties, e.g., fluorophores (e.g., pyrene, TAMRA, fluorescein, Cy3
or Cy5 dyes) or protecting groups (based e.g., on sulfur, silicon,
boron or ester). The functional molecular entities can be attached
to the sugar through a phosphate group and/or a spacer. The
terminal atom of the spacer can connect to or replace the linking
atom of the phosphate group or the C-3' or C-5' O, N, S or C group
of the sugar. Alternatively, the spacer can connect to or replace
the terminal atom of a nucleotide surrogate (e.g., PNAs). These
spacers or linkers can include e.g., --(CH.sub.2).sub.n--,
--(CH.sub.2).sub.nN--, --(CH.sub.2).sub.nO--,
--(CH.sub.2).sub.nS--, O(CH.sub.2CH.sub.2O).sub.nCH.sub.2CH.sub.2OH
(e.g., n=3 or 6), abasic sugars, amide, carboxy, amine, oxyamine,
oxyimine, thioether, disulfide, thiourea, sulfonamide, or
morpholino, or biotin and fluorescein reagents. When a
spacer/phosphate-functional molecular entity-spacer/phosphate array
is interposed between two strands of iRNA agents, this array can
substitute for a hairpin RNA loop in a hairpin-type RNA agent. The
3' end can be an --OH group. While not wishing to be bound by
theory, it is believed that conjugation of certain moieties can
improve transport, hybridization, and specificity properties.
Again, while not wishing to be bound by theory, it may be desirable
to introduce terminal alterations that improve nuclease resistance.
Other examples of terminal modifications include dyes,
intercalating agents (e.g. acridines), cross-linkers (e.g.
psoralene, mitomycin C), porphyrins (TPPC4, texaphyrin, Sapphyrin),
polycyclic aromatic hydrocarbons (e.g., phenazine,
dihydrophenazine), artificial endonucleases (e.g. EDTA), lipophilic
carriers (e.g., cholesterol, cholic acid, adamantane acetic acid,
1-pyrene butyric acid, dihydrotestosterone,
1,3-Bis-O(hexadecyl)glycerol, geranyloxyhexyl group,
hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl
group, palmitic acid, myristic acid, O3-(oleoyl)lithocholic acid,
O3-(oleoyl)cholenic acid, dimethoxytrityl, or phenoxazine) and
peptide conjugates (e.g., antennapedia peptide, Tat peptide),
alkylating agents, phosphate, amino, mercapto, PEG (e.g., PEG-40K),
MPEG, [MPEG].sub.2, polyamino, alkyl, substituted alkyl,
radiolabeled markers, enzymes, haptens (e.g. biotin),
transport/absorption facilitators (e.g., aspirin, vitamin E, folic
acid), synthetic ribonucleases (e.g., imidazole, bisimidazole,
histamine, imidazole clusters, acridine-imidazole conjugates, Eu3+
complexes of tetraazamacrocycles).
[0174] Terminal modifications can be added for a number of reasons,
including as discussed elsewhere herein to modulate activity or to
modulate resistance to degradation. Terminal modifications useful
for modulating activity include modification of the 5' end with
phosphate or phosphate analogs. E.g., in preferred embodiments iRNA
agents, especially antisense strands, are 5' phosphorylated or
include a phosphoryl analog at the 5' prime terminus. 5'-phosphate
modifications include those which are compatible with RISC mediated
gene silencing. Suitable modifications include: 5'-monophosphate
((HO)2(O)P--O-5'); 5'-diphosphate ((HO)2(O)P--O--P(HO)(O)--O-5');
5'-triphosphate ((HO)2(O)P--O--(HO)(O)P--O--P(HO)(O)--O-5');
5'-guanosine cap (7-methylated or non-methylated)
(7m-G-O-5'-(HO)(O)P--O--(HO)(O)P--O--P(HO)(O)--O-5'); 5'-adenosine
cap (Appp), and any modified or unmodified nucleotide cap structure
(N--O-5'-(HO)(O)P--O--(HO)(O)P--O--P(HO)(O)--O-5');
5'-monothiophosphate (phosphorothioate; (HO)2(S)P--O-5');
5'-monodithiophosphate (phosphorodithioate; (HO)(HS)(S)P--O-5'),
5'-phosphorothiolate ((HO)2(O)P--S-5'); any additional combination
of oxygen/sulfur replaced monophosphate, diphosphate and
triphosphates (e.g. 5'-alpha-thiotriphosphate,
5'-gamma-thiotriphosphate, etc.), 5'-phosphoramidates
((HO)2(O)P--NH-5', (HO)(NH2)(O)P--O-5'), 5'-alkylphosphonates
(R=alkyl=methyl, ethyl, isopropyl, propyl, etc., e.g.
RP(OH)(O)--O-5'-, (OH)2(O)P-5'-CH2-), 5'-alkyletherphosphonates
(R=alkylether=methoxymethyl (MeOCH2-), ethoxymethyl, etc., e.g.
RP(OH)(O)--O-5'-).
[0175] Terminal modifications can also be useful for monitoring
distribution, and in such cases the preferred groups to be added
include fluorophores, e.g., fluorescein or an Alexa dye, e.g.,
Alexa 488. Terminal modifications can also be useful for enhancing
uptake, useful modifications for this include cholesterol. Terminal
modifications can also be useful for cross-linking an RNA agent to
another moiety; modifications useful for this include mitomycin
C.
[0176] Evaluation of iRNA Agents
[0177] One can evaluate a candidate iRNA agent, e.g., a modified
iRNA agent. A general approach is described below, but methods more
specific to SNCA iRNA agents are discussed elsewhere herein. In
general, one can test for a selected property by exposing the agent
or modified molecule and a control molecule to the appropriate
conditions and evaluating for the presence of the selected
property. For example, resistance to a degradent can be evaluated
as follows. A candidate modified RNA (and preferably a control
molecule, usually the unmodified form) can be exposed to
degradative conditions, e.g., exposed to a milieu, which includes a
degradative agent, e.g., a nuclease. E.g., one can use a biological
sample, e.g., one that is similar to a milieu, which might be
encountered, in therapeutic use, e.g., blood or a cellular
fraction, e.g., a cell-free homogenate or disrupted cells. The
candidate and control could then be evaluated for resistance to
degradation by any of a number of approaches. For example, the
candidate and control could be labeled, preferably prior to
exposure, with, e.g., a radioactive or enzymatic label, or a
fluorescent label, such as Cy3 or Cy5. Control and modified RNA's
can be incubated with the degradative agent, and optionally a
control, e.g., an inactivated, e.g., heat inactivated, degradative
agent. A physical parameter, e.g., size, of the modified and
control molecules are then determined. They can be determined by a
physical method, e.g., by polyacrylamide gel electrophoresis or a
sizing column, to assess whether the molecule has maintained its
original length, or assessed functionally. Alternatively, Northern
blot analysis can be used to assay the length of an unlabeled
modified molecule.
[0178] A functional assay can also be used to evaluate the
candidate agent. A functional assay can be applied initially or
after an earlier non-functional assay, (e.g., assay for resistance
to degradation) to determine if the modification alters the ability
of the molecule to silence gene expression. For example, a cell,
e.g., a mammalian cell, such as a mouse or human cell, can be
co-transfected with a plasmid expressing a fluorescent protein,
e.g., GFP, and a candidate RNA agent homologous to the transcript
encoding the fluorescent protein (see, e.g., WO 00/44914). For
example, a modified siRNA homologous to the GFP mRNA can be assayed
for the ability to inhibit GFP expression by monitoring for a
decrease in cell fluorescence, as compared to a control cell, in
which the transfection did not include the candidate siRNA, e.g.,
controls with no agent added and/or controls with a non-modified
RNA added. Efficacy of the candidate agent on gene expression can
be assessed by comparing cell fluorescence in the presence of the
modified and unmodified iRNA agents.
[0179] The effect of the modified agent on target RNA levels can be
verified by Northern blot to assay for a decrease in the level of
target mRNA, or by Western blot to assay for a decrease in the
level of target protein, as compared to a negative control.
Controls can include cells in which with no agent is added and/or
cells in which a non-modified RNA is added.
Preferred mRNA Agents
[0180] Preferred RNA agents have the following structure (see
Formula 2 below):
##STR00002##
[0181] Referring to Formula 2 above, R.sup.1, R.sup.2, and R.sup.3
are each, independently, H, (i.e. abasic nucleotides), adenine,
guanine, cytosine and uracil, inosine, thymine, xanthine,
hypoxanthine, nubularine, tubercidine, isoguanisine,
2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and
guanine, 2-propyl and other alkyl derivatives of adenine and
guanine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine,
6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil),
4-thiouracil, 5-halouracil, 5-(2-aminopropyl)uracil, 5-amino allyl
uracil, 8-halo, amino, thiol, thioalkyl, hydroxyl and other
8-substituted adenines and guanines, 5-trifluoromethyl and other
5-substituted uracils and cytosines, 7-methylguanine, 5-substituted
pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted
purines, including 2-aminopropyladenine, 5-propynyluracil and
5-propynylcytosine, dihydrouracil, 3-deaza-5-azacytosine,
2-aminopurine, 5-alkyluracil, 7-alkylguanine, 5-alkyl cytosine,
7-deazaadenine, 7-deazaguanine, N6, N6-dimethyladenine,
2,6-diaminopurine, 5-amino-allyl-uracil, N3-methyluracil,
substituted 1,2,4-triazoles, 2-pyridinone, 5-nitroindole,
3-nitropyrrole, 5-methoxyuracil, uracil-5-oxyacetic acid,
5-methoxycarbonylmethyluracil, 5-methyl-2-thiouracil,
5-methoxycarbonylmethyl-2-thiouracil,
5-methylaminomethyl-2-thiouracil,
3-(3-amino-3-carboxypropyl)uracil, 3-methylcytosine,
5-methylcytosine, N.sup.4-acetyl cytosine, 2-thiocytosine,
N6-methyladenine, N6-isopentyladenine,
2-methylthio-N6-isopentenyladenine, N-methylguanines, or
O-alkylated bases.
[0182] R.sup.4, R.sup.5, and R.sup.6 are each, independently,
OR.sup.8, O(CH.sub.2CH.sub.2O).sub.mCH.sub.2CH.sub.2OR.sup.8;
O(CH.sub.2).sub.nR.sup.9; O(CH.sub.2).sub.nOR.sup.9, H; halo;
NH.sub.2; NHR.sup.8; N(R.sup.8).sub.2;
NH(CH.sub.2CH.sub.2NH).sub.mCH.sub.2CH.sub.2NHR.sup.9;
NHC(O)R.sup.8; cyano; mercapto, SR.sup.8; alkyl-thio-alkyl; alkyl,
aralkyl, cycloalkyl, aryl, heteroaryl, alkenyl, alkynyl, each of
which may be optionally substituted with halo, hydroxy, oxo, nitro,
haloalkyl, alkyl, alkaryl, aryl, aralkyl, alkoxy, aryloxy, amino,
alkylamino, dialkylamino, heterocyclyl, arylamino, diaryl amino,
heteroaryl amino, diheteroaryl amino, acylamino, alkylcarbamoyl,
arylcarbamoyl, aminoalkyl, alkoxycarbonyl, carboxy, hydroxyalkyl,
alkanesulfonyl, alkanesulfonamido, arenesulfonamido,
aralkylsulfonamido, alkylcarbonyl, acyloxy, cyano, or ureido; or
R.sup.4, R.sup.5, or R.sup.6 together combine with R.sup.7 to form
an [--O--CH.sub.2--] covalently bound bridge between the sugar 2'
and 4' carbons.
[0183] A.sup.1 is:
##STR00003## [0184] ; H; OH; OCH.sub.3; W.sup.1; an abasic
nucleotide; or absent; [0185] (a preferred A1, especially with
regard to anti-sense strands, is chosen from 5'-monophosphate
((HO).sub.2(O)P--O-5'), 5'-diphosphate
((HO).sub.2(O)P--O--P(HO)(O)--O-5'), 5'-triphosphate
((HO).sub.2(O)P--O--(HO)(O)P--O--P(HO)(O)--O-5'), 5'-guanosine cap
(7-methylated or non-methylated)
(7m-G-O-5'-(HO)(O)P--O--(HO)(O)P--O--P(HO)(O)--O-5'), 5'-adenosine
cap (Appp), and any modified or unmodified nucleotide cap structure
(N--O-5'-(HO)(O)P--O--(HO)(O)P--O--P(HO)(O)--O-5'),
5'-monothiophosphate (phosphorothioate; (HO).sub.2(S)P--O-5'),
5'-monodithiophosphate (phosphorodithioate; (HO)(HS)(S)P--O-5'),
5'-phosphorothiolate ((HO).sub.2(O)P--S-5'); any additional
combination of oxygen/sulfur replaced monophosphate, diphosphate
and triphosphates (e.g. 5'-alpha-thiotriphosphate,
5'-gamma-thiotriphosphate, etc.), 5'-phosphoramidates
((HO).sub.2(O)P--NH-5', (HO)(NH.sub.2)(O)P--O-5'),
5'-alkylphosphonates (R=alkyl=methyl, ethyl, isopropyl, propyl,
etc., e.g. RP(OH)(O)--O-5'-, (OH).sub.2(O)P-5'-CH.sub.2--),
5'-alkyletherphosphonates (R=alkylether=methoxymethyl
(MeOCH.sub.2--), ethoxymethyl, etc., e.g. RP(OH)(O)--O-5'-)).
[0186] A.sup.2 is:
##STR00004##
[0187] A.sup.3 is:
##STR00005##
and
[0188] A.sup.4 is:
##STR00006## [0189] ; H; Z.sup.4; an inverted nucleotide; an abasic
nucleotide; or absent.
[0190] W.sup.1 is OH, (CH.sub.2).sub.nR.sup.10,
(CH.sub.2).sub.nNHR.sup.10, (CH.sub.2).sub.nOR.sup.10,
(CH.sub.2).sub.nSR.sup.10; O(CH.sub.2).sub.nR.sup.10;
O(CH.sub.2).sub.nOR.sup.10, O(CH.sub.2).sub.nNR.sup.10,
O(CH.sub.2).sub.nSR.sup.10;
O(CH.sub.2).sub.nSS(CH.sub.2).sub.nOR.sup.10,
O(CH.sub.2).sub.nC(O)OR.sup.10, NH(CH.sub.2).sub.nR.sup.10;
NH(CH.sub.2).sub.nNR.sup.10; NH(CH.sub.2).sub.nOR.sup.10,
NH(CH.sub.2).sub.nSR.sup.10; S(CH.sub.2).sub.nR.sup.10,
S(CH.sub.2).sub.nNR.sup.10, S(CH.sub.2).sub.nOR.sup.10,
S(CH.sub.2).sub.nSR.sup.10
O(CH.sub.2CH.sub.2O).sub.mCH.sub.2CH.sub.2OR.sup.10;
O(CH.sub.2CH.sub.2O).sub.mCH.sub.2CH.sub.2NHR.sup.10,
NH(CH.sub.2CH.sub.2NH).sub.mCH.sub.2CH.sub.2NHR.sup.10; Q-R.sup.10,
O-Q-R.sup.10 N-Q-R.sup.10, S-Q-R.sup.10 or --O--. W.sup.4 is O,
CH.sub.2, NH, or S.
[0191] X.sup.1, X.sup.2, X.sup.3, and X.sup.4 are each,
independently, O or S.
[0192] Y.sup.1, Y.sup.2, Y.sup.3, and Y.sup.4 are each,
independently, OH, O.sup.-, OR.sup.8, S, Se, BH.sub.3.sup.-, H,
NHR.sup.9, N(R.sup.9).sub.2 alkyl, cycloalkyl, aralkyl, aryl, or
heteroaryl, each of which may be optionally substituted.
[0193] Z.sup.1, Z.sup.2, and Z.sup.3 are each independently O,
CH.sub.2, NH, or S. Z.sup.4 is OH, (CH.sub.2).sub.nR.sup.10,
(CH.sub.2).sub.nNHR.sup.10, (CH.sub.2).sub.nOR.sup.10,
(CH.sub.2).sub.n SR.sup.10; O(CH.sub.2).sub.nR.sup.10;
O(CH.sub.2).sub.nOR.sup.10, O(CH.sub.2).sub.nNR.sup.10,
O(CH.sub.2).sub.nSR.sup.10,
O(CH.sub.2).sub.nSS(CH.sub.2).sub.nOR.sup.10,
O(CH.sub.2).sub.nC(O)OR.sup.10; NH(CH.sub.2).sub.nR.sup.10;
NH(CH.sub.2).sub.nNR.sup.10; NH(CH.sub.2).sub.nOR.sup.10,
NH(CH.sub.2).sub.nSR.sup.10; S(CH.sub.2).sub.nR.sup.10,
S(CH.sub.2).sub.nNR.sup.10, S(CH.sub.2).sub.nOR.sup.10,
S(CH.sub.2).sub.nSR.sup.10
O(CH.sub.2CH.sub.2O).sub.mCH.sub.2CH.sub.2OR.sup.10,
O(CH.sub.2CH.sub.2O).sub.mCH.sub.2CH.sub.2NHR.sup.10,
NH(CH.sub.2CH.sub.2NH).sub.mCH.sub.2CH.sub.2NHR.sup.10; Q-R.sup.10,
O-Q-R.sup.10 N-Q-R.sup.10, S-Q-R.sup.10.
[0194] x is 5-100, chosen to comply with a length for an RNA agent
described herein.
[0195] R.sup.7 is H; or is together combined with R.sup.4, R.sup.5,
or R.sup.6 to form an [--O--CH.sub.2--] covalently bound bridge
between the sugar 2' and 4' carbons.
[0196] R.sup.8 is alkyl, cycloalkyl, aryl, aralkyl, heterocyclyl,
heteroaryl, amino acid, or sugar; R.sup.9 is NH.sub.2, alkylamino,
dialkylamino, heterocyclyl, arylamino, diaryl amino, heteroaryl
amino, diheteroaryl amino, or amino acid; and R.sup.10 is H;
fluorophore (pyrene, TAMRA, fluorescein, Cy3 or Cy5 dyes); sulfur,
silicon, boron or ester protecting group; intercalating agents
(e.g. acridines), cross-linkers (e.g. psoralene, mitomycin C),
porphyrins (TPPC4, texaphyrin, Sapphyrin), polycyclic aromatic
hydrocarbons (e.g., phenazine, dihydrophenazine), artificial
endonucleases (e.g. EDTA), lipophilic carriers (cholesterol, cholic
acid, adamantane acetic acid, 1-pyrene butyric acid,
dihydrotestosterone, 1,3-Bis-O(hexadecyl)glycerol, geranyloxyhexyl
group, hexadecylglycerol, borneol, menthol, 1,3-propanediol,
heptadecyl group, palmitic acid, myristic acid,
O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenic acid,
dimethoxytrityl, or phenoxazine) and peptide conjugates (e.g.,
antennapedia peptide, Tat peptide), alkylating agents, phosphate,
amino, mercapto, PEG (e.g., PEG-40K), MPEG, [MPEG].sub.2,
polyamino; alkyl, cycloalkyl, aryl, aralkyl, heteroaryl;
radiolabeled markers, enzymes, haptens (e.g. biotin),
transport/absorption facilitators (e.g., aspirin, vitamin E, folic
acid), synthetic ribonucleases (e.g., imidazole, bisimidazole,
histamine, imidazole clusters, acridine-imidazole conjugates, Eu3+
complexes of tetraazamacrocycles); or an RNA agent. m is
0-1,000,000, and n is 0-20. Q is a spacer selected from the group
consisting of abasic sugar, amide, carboxy, oxyamine, oxyimine,
thioether, disulfide, thiourea, sulfonamide, or morpholino, biotin
or fluorescein reagents.
[0197] Preferred RNA agents in which the entire phosphate group has
been replaced have the following structure (see Formula 3
below):
##STR00007##
[0198] Referring to Formula 3, A.sup.10-A.sup.40 is L-G-L; A.sup.10
and/or A.sup.40 may be absent, in which L is a linker, wherein one
or both L may be present or absent and is selected from the group
consisting of CH.sub.2(CH.sub.2).sub.g; N(CH.sub.2).sub.g;
O(CH.sub.2).sub.g; S(CH.sub.2).sub.g. G is a functional group
selected from the group consisting of siloxane, carbonate,
carboxymethyl, carbamate, amide, thioether, ethylene oxide linker,
sulfonate, sulfonamide, thioformacetal, formacetal, oxime,
methyleneimino, methylenemethylimino, methylenehydrazo,
methylenedimethylhydrazo and methyleneoxymethylimino.
[0199] R.sup.10, R.sup.20, and R.sup.30 are each, independently, H,
(i.e. abasic nucleotides), adenine, guanine, cytosine and uracil,
inosine, thymine, xanthine, hypoxanthine, nubularine, tubercidine,
isoguanisine, 2-aminoadenine, 6-methyl and other alkyl derivatives
of adenine and guanine, 2-propyl and other alkyl derivatives of
adenine and guanine, 5-halouracil and cytosine, 5-propynyl uracil
and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil
(pseudouracil), 4-thiouracil, 5-halouracil,
5-(2-aminopropyl)uracil, 5-amino allyl uracil, 8-halo, amino,
thiol, thioalkyl, hydroxyl and other 8-substituted adenines and
guanines, 5-trifluoromethyl and other 5-substituted uracils and
cytosines, 7-methylguanine, 5-substituted pyrimidines,
6-azapyrimidines and N-2, N-6 and O-6 substituted purines,
including 2-aminopropyladenine, 5-propynyluracil and
5-propynylcytosine, dihydrouracil, 3-deaza-5-azacytosine,
2-aminopurine, 5-alkyluracil, 7-alkylguanine, 5-alkyl cytosine,
7-deazaadenine, 7-deazaguanine, N6, N6-dimethyladenine,
2,6-diaminopurine, 5-amino-allyl-uracil, N3-methyluracil
substituted 1,2,4-triazoles, 2-pyridinone, 5-nitroindole,
3-nitropyrrole, 5-methoxyuracil, uracil-5-oxyacetic acid,
5-methoxycarbonylmethyluracil, 5-methyl-2-thiouracil,
5-methoxycarbonylmethyl-2-thiouracil,
5-methylaminomethyl-2-thiouracil,
3-(3-amino-3-carboxypropyl)uracil, 3-methylcytosine,
5-methylcytosine, N.sup.4-acetyl cytosine, 2-thiocytosine,
N6-methyladenine, N6-isopentyladenine,
2-methylthio-N-6-isopentenyladenine, N-methylguanines, or
O-alkylated bases.
[0200] R.sup.40, R.sup.50, and R.sup.60 are each, independently,
OR.sup.8, O(CH.sub.2CH.sub.2O).sub.mCH.sub.2CH.sub.2OR.sup.8;
O(CH.sub.2).sub.nR.sup.9; O(CH.sub.2).sub.nOR.sup.9, H; halo;
NH.sub.2; NHR.sup.8; N(R.sup.8).sub.2;
NH(CH.sub.2CH.sub.2NH).sub.mCH.sub.2CH.sub.2R.sup.9; NHC(O)R.sup.8;
cyano; mercapto, SR.sup.7; alkyl-thio-alkyl; alkyl, aralkyl,
cycloalkyl, aryl, heteroaryl, alkenyl, alkynyl, each of which may
be optionally substituted with halo, hydroxy, oxo, nitro,
haloalkyl, alkyl, alkaryl, aryl, aralkyl, alkoxy, aryloxy, amino,
alkylamino, dialkylamino, heterocyclyl, arylamino, diaryl amino,
heteroaryl amino, diheteroaryl amino, acylamino, alkylcarbamoyl,
arylcarbamoyl, aminoalkyl, alkoxycarbonyl, carboxy, hydroxyalkyl,
alkanesulfonyl, alkanesulfonamido, arenesulfonamido,
aralkylsulfonamido, alkylcarbonyl, acyloxy, cyano, and ureido
groups; or R.sup.40, R.sup.50, or R.sup.60 together combine with
R.sup.70 to form an [--O--CH.sub.2--] covalently bound bridge
between the sugar 2' and 4' carbons.
[0201] x is 5-100 or chosen to comply with a length for an RNA
agent described herein.
[0202] R.sup.70 is H; or is together combined with R.sup.40,
R.sup.50, or R.sup.60 to form an [--O--CH.sub.2--] covalently bound
bridge between the sugar 2' and 4' carbons.
[0203] R.sup.8 is alkyl, cycloalkyl, aryl, aralkyl, heterocyclyl,
heteroaryl, amino acid, or sugar; and R.sup.9 is NH.sub.2,
alkylamino, dialkylamino, heterocyclyl, arylamino, diaryl amino,
heteroaryl amino, diheteroaryl amino, or amino acid. m is
0-1,000,000, n is 0-20, and g is 0-2.
[0204] Preferred nucleoside surrogates have the following structure
(see Formula 4 below):
SLR.sup.100-(M-SLR.sup.200).sub.x-M-SLR.sup.300 FORMULA 4
[0205] S is a nucleoside surrogate selected from the group
consisting of mophilino, cyclobutyl, pyrrolidine and peptide
nucleic acid. L is a linker and is selected from the group
consisting of CH.sub.2(CH.sub.2).sub.g; N(CH.sub.2).sub.g;
O(CH.sub.2).sub.g; S(CH.sub.2).sub.g; --C(O)(CH.sub.2).sub.n-- or
may be absent. M is an amide bond; sulfonamide; sulfinate;
phosphate group; modified phosphate group as described herein; or
may be absent.
[0206] R.sup.100, R.sup.200, and R.sup.300 are each, independently,
H (i.e., abasic nucleotides), adenine, guanine, cytosine and
uracil, inosine, thymine, xanthine, hypoxanthine, nubularine,
tubercidine, isoguanisine, 2-aminoadenine, 6-methyl and other alkyl
derivatives of adenine and guanine, 2-propyl and other alkyl
derivatives of adenine and guanine, 5-halouracil and cytosine,
5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine,
5-uracil (pseudouracil), 4-thiouracil, 5-halouracil,
5-(2-aminopropyl)uracil, 5-amino allyl uracil, 8-halo, amino,
thiol, thioalkyl, hydroxyl and other 8-substituted adenines and
guanines, 5-trifluoromethyl and other 5-substituted uracils and
cytosines, 7-methylguanine, 5-substituted pyrimidines,
6-azapyrimidines and N-2, N-6 and O-6 substituted purines,
including 2-aminopropyladenine, 5-propynyluracil and
5-propynylcytosine, dihydrouracil, 3-deaza-5-azacytosine,
2-aminopurine, 5-alkyluracil, 7-alkylguanine, 5-alkyl cytosine,
7-deazaadenine, 7-deazaguanine, N6, N6-dimethyladenine,
2,6-diaminopurine, 5-amino-allyl-uracil, N3-methyluracil
substituted 1,2,4-triazoles, 2-pyridinones, 5-nitroindole,
3-nitropyrrole, 5-methoxyuracil, uracil-5-oxyacetic acid,
5-methoxycarbonylmethyluracil, 5-methyl-2-thiouracil,
5-methoxycarbonylmethyl-2-thiouracil,
5-methylaminomethyl-2-thiouracil,
3-(3-amino-3-carboxypropyl)uracil, 3-methylcytosine,
5-methylcytosine, N.sup.4-acetyl cytosine, 2-thiocytosine,
N6-methyladenine, N6-isopentyladenine,
2-methylthio-N6-isopentenyladenine, N-methylguanines, or
O-alkylated bases.
[0207] x is 5-100, or chosen to comply with a length for an RNA
agent described herein; and g is 0-2.
[0208] Nuclease Resistant Monomers
[0209] An RNA, e.g., an iRNA agent, can incorporate a nuclease
resistant monomer (NRM). For example, the invention includes an
iRNA agent described herein, e.g., a palindromic iRNA agent, an
iRNA agent having a non canonical pairing, an iRNA agent which
targets a gene described herein, e.g., an SNCA gene, an iRNA agent
having an architecture or structure described herein, an iRNA
associated with an amphipathic delivery agent described herein, an
iRNA associated with a drug delivery module described herein, an
iRNA agent administered as described herein, or an iRNA agent
formulated as described herein, which also incorporates an NRM.
[0210] An iRNA agent can include monomers which have been modified
so as to inhibit degradation, e.g., by nucleases, e.g.,
endonucleases or exonucleases, found in the body of a subject.
These monomers are referred to herein as NRMs, or nuclease
resistance promoting monomers or modifications. In many cases these
modifications will modulate other properties of the iRNA agent as
well, e.g., the ability to interact with a protein, e.g., a
transport protein, e.g., serum albumin, or a member of the RISC
(RNA-induced Silencing Complex), or the ability of the first and
second sequences to form a duplex with one another or to form a
duplex with another sequence, e.g., a target molecule.
[0211] While not wishing to be bound by theory, it is believed that
modifications of the sugar, base, and/or phosphate backbone in an
iRNA agent can enhance endonuclease and exonuclease resistance, and
can enhance interactions with transporter proteins and one or more
of the functional components of the RISC complex. Preferred
modifications are those that increase exonuclease and endonuclease
resistance and thus prolong the half-life of the iRNA agent prior
to interaction with the RISC complex, but at the same time do not
render the iRNA agent resistant to endonuclease activity in the
RISC complex. Again, while not wishing to be bound by any theory,
it is believed that placement of the modifications at or near the
3' and/or 5' end of antisense strands can result in iRNA agents
that meet the preferred nuclease resistance criteria delineated
above. Again, still while not wishing to be bound by any theory, it
is believed that placement of the modifications at e.g., the middle
of a sense strand can result in iRNA agents that are relatively
less likely to undergo off-targeting.
[0212] Modifications described herein can be incorporated into any
double-stranded RNA and RNA-like molecule described herein, e.g.,
an iRNA agent. An iRNA agent may include a duplex comprising a
hybridized sense and antisense strand, in which the antisense
strand and/or the sense strand may include one or more of the
modifications described herein. The antisense strand may include
modifications at the 3' end and/or the 5' end and/or at one or more
positions that occur 1-6 (e.g., 1-5, 1-4, 1-3, 1-2) nucleotides
from either end of the strand. The sense strand may include
modifications at the 3' end and/or the 5' end and/or at any one of
the intervening positions between the two ends of the strand. The
iRNA agent may also include a duplex comprising two hybridized
antisense strands. The first and/or the second antisense strand may
include one or more of the modifications described herein. Thus,
one and/or both antisense strands may include modifications at the
3' end and/or the 5' end and/or at one or more positions that occur
1-6 (e.g., 1-5, 1-4, 1-3, 1-2) nucleotides from either end of the
strand. Particular configurations are discussed below.
[0213] Modifications that can be useful for producing iRNA agents
that meet the preferred nuclease resistance criteria delineated
above can include one or more of the following chemical and/or
stereochemical modifications of the sugar, base, and/or phosphate
backbone: [0214] (i) chiral (S.sub.P) thioates. Thus, preferred
NRMs include nucleotide dimers with an enriched or pure for a
particular chiral form of a modified phosphate group containing a
heteroatom at the nonbridging position, e.g., S.sub.P or R.sub.P,
at the position X, where this is the position normally occupied by
the oxygen. The atom at X can also be S, Se, Nr.sub.2, or Br.sub.3.
When X is S, enriched or chirally pure S.sub.P linkage is
preferred. Enriched means at least 70, 80, 90, 95, or 99% of the
preferred form. Such NRMs are discussed in more detail below;
[0215] (ii) attachment of one or more cationic groups to the sugar,
base, and/or the phosphorus atom of a phosphate or modified
phosphate backbone moiety. Thus, preferred NRMs include monomers at
the terminal position derivatized at a cationic group. As the 5'
end of an antisense sequence should have a terminal --OH or
phosphate group this NRM is preferably not used at the 5' end of an
anti-sense sequence. The group should be attached at a position on
the base which minimizes interference with H bond formation and
hybridization, e.g., away form the face which interacts with the
complementary base on the other strand, e.g., at the 5' position of
a pyrimidine or a 7-position of a purine. These are discussed in
more detail below; [0216] (iii) nonphosphate linkages at the
termini. Thus, preferred NRMs include Non-phosphate linkages, e.g.,
a linkage of 4 atoms which confers greater resistance to cleavage
than does a phosphate bond. Examples include 3'
CH2-NCH.sub.3--O--CH.sub.2-5' and 3'
CH.sub.2--NH--(O.dbd.)--CH.sub.2-5'; [0217] (iv) 3'-bridging
thiophosphates and 5'-bridging thiophosphates. Thus, preferred
NRM's can included these structures; [0218] (v) L-RNA, 2'-5'
linkages, inverted linkages, a-nucleosides. Thus, other preferred
NRM's include: L nucleosides and dimeric nucleotides derived from
L-nucleosides; 2'-5' phosphate, non-phosphate and modified
phosphate linkages (e.g., thiophosphates, phosphoramidates and
boronophosphates); dimers having inverted linkages, e.g., 3'-3' or
5'-5' linkages; monomers having an alpha linkage at the 1' site on
the sugar, e.g., the structures described herein having an alpha
linkage; [0219] (vi) conjugate groups. Thus, preferred NRM's can
include, e.g., a targeting moiety or a conjugated ligand described
herein conjugated with the monomer, e.g., through the sugar, base,
or backbone; [0220] (vi) abasic linkages. Thus, preferred NRM's can
include an abasic monomer, e.g., an abasic monomer as described
herein (e.g., a nucleobaseless monomer); an aromatic or
heterocyclic or polyheterocyclic aromatic monomer as described
herein; and [0221] (vii) 5'-phosphonates and 5'-phosphate prodrugs.
Thus, preferred NRM's include monomers, preferably at the terminal
position, e.g., the 5' position, in which one or more atoms of the
phosphate group is derivatized with a protecting group, which
protecting group or groups, are removed as a result of the action
of a component in the subject's body, e.g., a carboxyesterase or an
enzyme present in the subject's body. E.g., a phosphate prodrug in
which a carboxy esterase cleaves the protected molecule resulting
in the production of a thioate anion which attacks a carbon
adjacent to the O of a phosphate and resulting in the production of
an unprotected phosphate.
[0222] One or more different NRM modifications can be introduced
into an iRNA agent or into a sequence of an iRNA agent. An NRM
modification can be used more than once in a sequence or in an iRNA
agent. As some NRMs interfere with hybridization the total number
incorporated, should be such that acceptable levels of iRNA agent
duplex formation are maintained.
[0223] In some embodiments NRM modifications are introduced into
the terminal cleavage site or in the cleavage region of a sequence
(a sense strand or sequence) which does not target a desired
sequence or gene in the subject. This can reduce off-target
silencing.
[0224] Chiral S.sub.P Thioates
[0225] A modification can include the alteration, e.g.,
replacement, of one or both of the non-linking (X and Y) phosphate
oxygens and/or of one or more of the linking (W and Z) phosphate
oxygens. Formula X below depicts a phosphate moiety linking two
sugar/sugar surrogate-base moieties, SB.sub.1 and SB.sub.2.
##STR00008##
[0226] In certain embodiments, one of the non-linking phosphate
oxygens in the phosphate backbone moiety (X and Y) can be replaced
by any one of the following: S, Se, BR.sub.3 (R is hydrogen, alkyl,
aryl, etc.), C (i.e., an alkyl group, an aryl group, etc.), H,
NR.sub.2 (R is hydrogen, alkyl, aryl, etc.), or OR (R is alkyl or
aryl). The phosphorus atom in an unmodified phosphate group is
achiral. However, replacement of one of the non-linking oxygens
with one of the above atoms or groups of atoms renders the
phosphorus atom chiral; in other words a phosphorus atom in a
phosphate group modified in this way is a stereogenic center. The
stereogenic phosphorus atom can possess either the "R"
configuration (herein R.sub.P) or the "S" configuration (herein
S.sub.P). Thus if 60% of a population of stereogenic phosphorus
atoms have the R.sub.P configuration, then the remaining 40% of the
population of stereogenic phosphorus atoms have the S.sub.P
configuration.
[0227] In some embodiments, iRNA agents, having phosphate groups in
which a phosphate non-linking oxygen has been replaced by another
atom or group of atoms, may contain a population of stereogenic
phosphorus atoms in which at least about 50% of these atoms (e.g.,
at least about 60% of these atoms, at least about 70% of these
atoms, at least about 80% of these atoms, at least about 90% of
these atoms, at least about 95% of these atoms, at least about 98%
of these atoms, at least about 99% of these atoms) have the S.sub.P
configuration. Alternatively, iRNA agents having phosphate groups
in which a phosphate non-linking oxygen has been replaced by
another atom or group of atoms may contain a population of
stereogenic phosphorus atoms in which at least about 50% of these
atoms (e.g., at least about 60% of these atoms, at least about 70%
of these atoms, at least about 80% of these atoms, at least about
90% of these atoms, at least about 95% of these atoms, at least
about 98% of these atoms, at least about 99% of these atoms) have
the R.sub.P configuration. In other embodiments, the population of
stereogenic phosphorus atoms may have the S.sub.P configuration and
may be substantially free of stereogenic phosphorus atoms having
the R.sub.P configuration. In still other embodiments, the
population of stereogenic phosphorus atoms may have the R.sub.P
configuration and may be substantially free of stereogenic
phosphorus atoms having the S.sub.P configuration. As used herein,
the phrase "substantially free of stereogenic phosphorus atoms
having the R.sub.P configuration" means that moieties containing
stereogenic phosphorus atoms having the R.sub.P configuration
cannot be detected by conventional methods known in the art (chiral
HPLC, .sup.1H NMR analysis using chiral shift reagents, etc.). As
used herein, the phrase "substantially free of stereogenic
phosphorus atoms having the S.sub.P configuration" means that
moieties containing stereogenic phosphorus atoms having the S.sub.P
configuration cannot be detected by conventional methods known in
the art (chiral HPLC, .sup.1H NMR analysis using chiral shift
reagents, etc.).
[0228] In a preferred embodiment, modified iRNA agents contain a
phosphorothioate group, i.e., a phosphate groups in which a
phosphate non-linking oxygen has been replaced by a sulfur
atom.
[0229] In an especially preferred embodiment, the population of
phosphorothioate stereogenic phosphorus atoms may have the S.sub.P
configuration and be substantially free of stereogenic phosphorus
atoms having the R.sub.P configuration.
[0230] Phosphorothioates may be incorporated into iRNA agents using
dimers e.g., formulas X-1 and X-2. The former can be used to
introduce phosphorothioate
##STR00009##
at the 3' end of a strand, while the latter can be used to
introduce this modification at the 5' end or at a position that
occurs e.g., 1, 2, 3, 4, 5, or 6 nucleotides from either end of the
strand. In the above formulas, Y can be 2-cyanoethoxy, W and Z can
be O, R.sub.2' can be, e.g., a substituent that can impart the C-3
endo configuration to the sugar (e.g., OH, F, OCH.sub.3), DMT is
dimethoxytrityl, and "BASE" can be a natural, unusual, or a
universal base.
[0231] X-1 and X-2 can be prepared using chiral reagents or
directing groups that can result in phosphorothioate-containing
dimers having a population of stereogenic phosphorus atoms having
essentially only the R.sub.P configuration (i.e., being
substantially free of the S.sub.P configuration) or only the
S.sub.P configuration (i.e., being substantially free of the
R.sub.P configuration). Alternatively, dimers can be prepared
having a population of stereogenic phosphorus atoms in which about
50% of the atoms have the R.sub.P configuration and about 50% of
the atoms have the S.sub.P configuration. Dimers having stereogenic
phosphorus atoms with the R.sub.P configuration can be identified
and separated from dimers having stereogenic phosphorus atoms with
the S.sub.P configuration using e.g., enzymatic degradation and/or
conventional chromatography techniques.
[0232] Cationic Groups
[0233] Modifications can also include attachment of one or more
cationic groups to the sugar, base, and/or the phosphorus atom of a
phosphate or modified phosphate backbone moiety. A cationic group
can be attached to any atom capable of substitution on a natural,
unusual or universal base. A preferred position is one that does
not interfere with hybridization, i.e., does not interfere with the
hydrogen bonding interactions needed for base pairing. A cationic
group can be attached e.g., through the C2' position of a sugar or
analogous position in a cyclic or acyclic sugar surrogate. Cationic
groups can include e.g., protonated amino groups, derived from
e.g., O-AMINE (AMINE=NH.sub.2; alkylamino, dialkylamino,
heterocyclyl, arylamino, diaryl amino, heteroaryl amino, or
diheteroaryl amino, ethylene diamine, polyamino); aminoalkoxy,
e.g., O(CH.sub.2).sub.nAMINE, (e.g., AMINE=NH.sub.2; alkylamino,
dialkylamino, heterocyclyl, arylamino, diaryl amino, heteroaryl
amino, or diheteroaryl amino, ethylene diamine, polyamino); amino
(e.g. NH.sub.2; alkylamino, dialkylamino, heterocyclyl, arylamino,
diaryl amino, heteroaryl amino, diheteroaryl amino, or amino acid);
or NH(CH.sub.2CH.sub.2NH).sub.nCH.sub.2CH.sub.2-AMINE
(AMINE=NH.sub.2; alkylamino, dialkylamino, heterocyclyl, arylamino,
diaryl amino, heteroaryl amino, or diheteroaryl amino).
[0234] Nonphosphate Linkages
[0235] Modifications can also include the incorporation of
nonphosphate linkages at the 5' and/or 3' end of a strand. Examples
of nonphosphate linkages which can replace the phosphate group
include methyl phosphonate, hydroxylamino, siloxane, carbonate,
carboxymethyl, carbamate, amide, thioether, ethylene oxide linker,
sulfonate, sulfonamide, thioformacetal, formacetal, oxime,
methyleneimino, methylenemethylimino, methylenehydrazo,
methylenedimethylhydrazo and methyleneoxymethylimino. Preferred
replacements include the methyl phosphonate and hydroxylamino
groups.
[0236] 3'-Bridging Thiophosphates and 5'-Bridging Thiophosphates;
Locked-RNA, 2'-5' Linkages, Inverted Linkages, .alpha.-Nucleosides;
Conjugate Groups; Abasic Linkages; and 5'-Phosphonates and
5'-Phosphate Prodrugs
[0237] Referring to formula X above, modifications can include
replacement of one of the bridging or linking phosphate oxygens in
the phosphate backbone moiety (W and Z). Unlike the situation where
only one of X or Y is altered, the phosphorus center in the
phosphorodithioates is achiral which precludes the formation of
iRNA agents containing a stereogenic phosphorus atom.
[0238] Modifications can also include linking two sugars via a
phosphate or modified phosphate group through the 2' position of a
first sugar and the 5' position of a second sugar. Also
contemplated are inverted linkages in which both a first and second
sugar are each linked through the respective 3' positions. Modified
RNA's can also include "abasic" sugars, which lack a nucleobase at
C-1'. The sugar group can also contain one or more carbons that
possess the opposite stereochemical configuration than that of the
corresponding carbon in ribose. Thus, a modified iRNA agent can
include nucleotides containing e.g., arabinose, as the sugar. In
another subset of this modification, the natural, unusual, or
universal base may have the .alpha.-configuration. Modifications
can also include L-RNA.
[0239] Modifications can also include 5'-phosphonates, e.g.,
P(O)(O.sup.-).sub.2--X--C.sup.5'-sugar (X.dbd.CH2, CF2, CHF and
5'-phosphate prodrugs, e.g.,
P(O)[OCH2CH2SC(O)R].sub.2CH.sub.2C.sup.5'-sugar. In the latter
case, the prodrug groups may be decomposed via reaction first with
carboxy esterases. The remaining ethyl thiolate group via
intramolecular S.sub.N2 displacement can depart as episulfide to
afford the underivatized phosphate group.
[0240] Modification can also include the addition of conjugating
groups described elsewhere herein, which are preferably attached to
an iRNA agent through any amino group available for
conjugation.
[0241] Nuclease resistant modifications include some which can be
placed only at the terminus and others which can go at any
position. Generally the modifications that can inhibit
hybridization so it is preferably to use them only in terminal
regions, and preferable to not use them at the cleavage site or in
the cleavage region of an sequence which targets a subject sequence
or gene. The can be used anywhere in a sense sequence, provided
that sufficient hybridization between the two sequences of the iRNA
agent is maintained. In some embodiments it is desirable to put the
NRM at the cleavage site or in the cleavage region of a sequence
which does not target a subject sequence or gene, as it can
minimize off-target silencing.
[0242] In addition, an iRNA agent described herein can have an
overhang which does not form a duplex structure with the other
sequence of the iRNA agent--it is an overhang, but it does
hybridize, either with itself, or with another nucleic acid, other
than the other sequence of the iRNA agent.
[0243] In most cases, the nuclease-resistance promoting
modifications will be distributed differently depending on whether
the sequence will target a sequence in the subject (often referred
to as an anti-sense sequence) or will not target a sequence in the
subject (often referred to as a sense sequence). If a sequence is
to target a sequence in the subject, modifications which interfere
with or inhibit endonuclease cleavage should not be inserted in the
region which is subject to RISC mediated cleavage, e.g., the
cleavage site or the cleavage region (As described in Elbashir et
al., 2001, Genes and Dev. 15: 188, hereby incorporated by
reference). Cleavage of the target occurs about in the middle of a
20 or 21 nt guide RNA, or about 10 or 11 nucleotides upstream of
the first nucleotide which is complementary to the guide sequence.
As used herein cleavage site refers to the nucleotide on either
side of the cleavage site, on the target or on the iRNA agent
strand which hybridizes to it. Cleavage region means an nucleotide
with 1, 2, or 3 nucleotides of the cleave site, in either
direction.)
[0244] Such modifications can be introduced into the terminal
regions, e.g., at the terminal position or with 2, 3, 4, or 5
positions of the terminus, of a sequence which targets or a
sequence which does not target a sequence in the subject.
[0245] An iRNA agent can have a first and a second strand chosen
from the following: [0246] a first strand which does not target a
sequence and which has an NRM modification at or within 1, 2, 3, 4,
5, or 6 positions from the 3' end; [0247] a first strand which does
not target a sequence and which has an NRM modification at or
within 1, 2, 3, 4, 5, or 6 positions from the 5' end; [0248] a
first strand which does not target a sequence and which has an NRM
modification at or within 1, 2, 3, 4, 5, or 6 positions from the 3'
end and which has a NRM modification at or within 1, 2, 3, 4, 5, or
6 positions from the 5' end; [0249] a first strand which does not
target a sequence and which has an NRM modification at the cleavage
site or in the cleavage region; [0250] a first strand which does
not target a sequence and which has an NRM modification at the
cleavage site or in the cleavage region and one or more of an NRM
modification at or within 1, 2, 3, 4, 5, or 6 positions from the 3'
end, a NRM modification at or within 1, 2, 3, 4, 5, or 6 positions
from the 5' end, or NRM modifications at or within 1, 2, 3, 4, 5,
or 6 positions from both the 3' and the 5' end; and [0251] a second
strand which targets a sequence and which has an NRM modification
at or within 1, 2, 3, 4, 5, or 6 positions from the 3' end; [0252]
a second strand which targets a sequence and which has an NRM
modification at or within 1, 2, 3, 4, 5, or 6 positions from the 5'
end (5' end NRM modifications are preferentially not at the
terminus but rather at a position 1, 2, 3, 4, 5, or 6 away from the
5' terminus of an antisense strand); [0253] a second strand which
targets a sequence and which has an NRM modification at or within
1, 2, 3, 4, 5, or 6 positions from the 3' end and which has a NRM
modification at or within 1, 2, 3, 4, 5, or 6 positions from the 5'
end; [0254] a second strand which targets a sequence and which
preferably does not have an NRM modification at the cleavage site
or in the cleavage region; [0255] a second strand which targets a
sequence and which does not have an NRM modification at the
cleavage site or in the cleavage region and one or more of an NRM
modification at or within 1, 2, 3, 4, 5, or 6 positions from the 3'
end, a NRM modification at or within 1, 2, 3, 4, 5, or 6 positions
from the 5' end, or NRM modifications at or within 1, 2, 3, 4, 5,
or 6 positions from both the 3' and the 5' end (5' end NRM
modifications are preferentially not at the terminus but rather at
a position 1, 2, 3, 4, 5, or 6 away from the 5' terminus of an
antisense strand).
[0256] An iRNA agent can also target two sequences and can have a
first and second strand chosen from: [0257] a first strand which
targets a sequence and which has an NRM modification at or within
1, 2, 3, 4, 5, or 6 positions from the 3' end; [0258] a first
strand which targets a sequence and which has an NRM modification
at or within 1, 2, 3, 4, 5, or 6 positions from the 5' end (5' end
NRM modifications are preferentially not at the terminus but rather
at a position 1, 2, 3, 4, 5, or 6 away from the 5' terminus of an
antisense strand); [0259] a first strand which targets a sequence
and which has an NRM modification at or within 1, 2, 3, 4, 5, or 6
positions from the 3' end and which has a NRM modification at or
within 1, 2, 3, 4, 5, or 6 positions from the 5' end; [0260] a
first strand which targets a sequence and which preferably does not
have an NRM modification at the cleavage site or in the cleavage
region; [0261] a first strand which targets a sequence and which
dose not have an NRM modification at the cleavage site or in the
cleavage region and one or more of an NRM modification at or within
1, 2, 3, 4, 5, or 6 positions from the 3' end, a NRM modification
at or within 1, 2, 3, 4, 5, or 6 positions from the 5' end, or NRM
modifications at or within 1, 2, 3, 4, 5, or 6 positions from both
the 3' and the 5' end (5' end NRM modifications are preferentially
not at the terminus but rather at a position 1, 2, 3, 4, 5, or 6
away from the 5' terminus of an antisense strand) and a second
strand which targets a sequence and which has an NRM modification
at or within 1, 2, 3, 4, 5, or 6 positions from the 3' end; [0262]
a second strand which targets a sequence and which has an NRM
modification at or within 1, 2, 3, 4, 5, or 6 positions from the 5'
end (5' end NRM modifications are preferentially not at the
terminus but rather at a position 1, 2, 3, 4, 5, or 6 away from the
5' terminus of an antisense strand); [0263] a second strand which
targets a sequence and which has an NRM modification at or within
1, 2, 3, 4, 5, or 6 positions from the 3' end and which has a NRM
modification at or within 1, 2, 3, 4, 5, or 6 positions from the 5'
end; [0264] a second strand which targets a sequence and which
preferably does not have an NRM modification at the cleavage site
or in the cleavage region; [0265] a second strand which targets a
sequence and which dose not have an NRM modification at the
cleavage site or in the cleavage region and one or more of an NRM
modification at or within 1, 2, 3, 4, 5, or 6 positions from the 3'
end, a NRM modification at or within 1, 2, 3, 4, 5, or 6 positions
from the 5' end, or NRM modifications at or within 1, 2, 3, 4, 5,
or 6 positions from both the 3' and the 5' end (5' end NRM
modifications are preferentially not at the terminus but rather at
a position 1, 2, 3, 4, 5, or 6 away from the 5' terminus of an
antisense strand).
[0266] Ribose Mimics
[0267] An RNA, e.g., an iRNA agent, can incorporate a ribose mimic.
In addition, the invention includes iRNA agents having a ribose
mimic and another element described herein. E.g., the invention
includes an iRNA agent described herein, e.g., a palindromic iRNA
agent, an iRNA agent having a non canonical pairing, an iRNA agent
which targets a gene described herein, e.g., an SNCA gene, an iRNA
agent having an architecture or structure described herein, an iRNA
associated with an amphipathic delivery agent described herein, an
iRNA associated with a drug delivery module described herein, an
iRNA agent administered as described herein, or an iRNA agent
formulated as described herein, which also incorporates a ribose
mimic.
[0268] Thus, an aspect of the invention features an iRNA agent that
includes a secondary hydroxyl group, which can increase efficacy
and/or confer nuclease resistance to the agent. Nucleases, e.g.,
cellular nucleases, can hydrolyze nucleic acid phosphodiester
bonds, resulting in partial or complete degradation of the nucleic
acid. The secondary hydroxy group confers nuclease resistance to an
iRNA agent by rendering the iRNA agent less prone to nuclease
degradation relative to an iRNA which lacks the modification. While
not wishing to be bound by theory, it is believed that the presence
of a secondary hydroxyl group on the iRNA agent can act as a
structural mimic of a 3' ribose hydroxyl group, thereby causing it
to be less susceptible to degradation.
[0269] The secondary hydroxyl group refers to an "OH" radical that
is attached to a carbon atom substituted by two other carbons and a
hydrogen. The secondary hydroxyl group that confers nuclease
resistance as described above can be part of any acyclic
carbon-containing group. The hydroxyl may also be part of any
cyclic carbon-containing group, and preferably one or more of the
following conditions is met (1) there is no ribose moiety between
the hydroxyl group and the terminal phosphate group or (2) the
hydroxyl group is not on a sugar moiety which is coupled to a base.
The hydroxyl group is located at least two bonds (e.g., at least
three bonds away, at least four bonds away, at least five bonds
away, at least six bonds away, at least seven bonds away, at least
eight bonds away, at least nine bonds away, at least ten bonds
away, etc.) from the terminal phosphate group phosphorus of the
iRNA agent. In preferred embodiments, there are five intervening
bonds between the terminal phosphate group phosphorus and the
secondary hydroxyl group.
[0270] Preferred mRNA agent delivery modules with five intervening
bonds between the terminal phosphate group phosphorus and the
secondary hydroxyl group have the following structure (see formula
Y below):
##STR00010##
[0271] Referring to formula Y, A is an iRNA agent, including any
iRNA agent described herein. The iRNA agent may be connected
directly or indirectly (e.g., through a spacer or linker) to "W" of
the phosphate group. These spacers or linkers can include e.g.,
--(CH.sub.2).sub.n--, --(CH.sub.2).sub.nN--, --(CH.sub.2).sub.nO--,
--(CH.sub.2).sub.nS--, O(CH.sub.2CH.sub.2O).sub.nCH.sub.2CH.sub.2OH
(e.g., n=3 or 6), abasic sugars, amide, carboxy, amine, oxyamine,
oxyimine, thioether, disulfide, thiourea, sulfonamide, or
morpholino, or biotin and fluorescein reagents.
[0272] The iRNA agents can have a terminal phosphate group that is
unmodified (e.g., W, X, Y, and Z are O) or modified. In a modified
phosphate group, W and Z can be independently NH, O, or S; and X
and Y can be independently S, Se, BH.sub.3.sup.-, C.sub.1-C.sub.6
alkyl, C.sub.6-C.sub.10 aryl, H, O, O.sup.-, alkoxy or amino
(including alkylamino, arylamino, etc.). Preferably, W, X and Z are
O and Y is S.
[0273] R.sub.1 and R.sub.3 are each, independently, hydrogen; or
C.sub.1-C.sub.100 alkyl, optionally substituted with hydroxyl,
amino, halo, phosphate or sulfate and/or may be optionally inserted
with N, O, S, alkenyl or alkynyl.
[0274] R.sub.2 is hydrogen; C.sub.1-C.sub.100 alkyl, optionally
substituted with hydroxyl, amino, halo, phosphate or sulfate and/or
may be optionally inserted with N, O, S, alkenyl or alkynyl; or,
when n is 1, R.sub.2 may be taken together with R.sub.4 or R.sub.6
to form a ring of 5-12 atoms.
[0275] R.sub.4 is hydrogen; C.sub.1-C.sub.100 alkyl, optionally
substituted with hydroxyl, amino, halo, phosphate or sulfate and/or
may be optionally inserted with N, O, S, alkenyl or alkynyl; or,
when n is 1, R.sub.4 may be taken together with R.sub.2 or R.sub.5
to form a ring of 5-12 atoms.
[0276] R.sub.5 is hydrogen, C.sub.1-C.sub.100 alkyl optionally
substituted with hydroxyl, amino, halo, phosphate or sulfate and/or
may be optionally inserted with N, O, S, alkenyl or alkynyl; or,
when n is 1, R.sub.5 may be taken together with R.sub.4 to form a
ring of 5-12 atoms.
[0277] R.sub.6 is hydrogen, C.sub.1-C.sub.100 alkyl, optionally
substituted with hydroxyl, amino, halo, phosphate or sulfate and/or
may be optionally inserted with N, O, S, alkenyl or alkynyl, or,
when n is 1, R.sub.6 may be taken together with R.sub.2 to form a
ring of 6-10 atoms;
[0278] R.sub.7 is hydrogen, C.sub.1-C.sub.100 alkyl, or
C(O)(CH.sub.2).sub.qC(O)NHR.sub.9; T is hydrogen or a functional
group; n and q are each independently 1-100; R.sub.8 is
C.sub.1-C.sub.10 alkyl or C.sub.6-C.sub.10 aryl; and R.sub.9 is
hydrogen, C1-C10 alkyl, C.sub.6-C.sub.10 aryl or a solid support
agent.
[0279] Preferred embodiments may include one of more of the
following subsets of iRNA agent delivery modules.
[0280] In one subset of RNAi agent delivery modules, A can be
connected directly or indirectly through a terminal 3' or 5' ribose
sugar carbon of the RNA agent.
[0281] In another subset of RNAi agent delivery modules, X, W, and
Z are 0 and Y is S.
[0282] In still yet another subset of RNAi agent delivery modules,
n is 1, and R.sub.2 and R.sub.6 are taken together to form a ring
containing six atoms and R.sub.4 and R.sub.5 are taken together to
form a ring containing six atoms. Preferably, the ring system is a
trans-decalin. For example, the RNAi agent delivery module of this
subset can include a compound of Formula (Y-1):
##STR00011##
[0283] The functional group can be, for example, a targeting group
(e.g., a steroid or a carbohydrate), a reporter group (e.g., a
fluorophore), or a label (an isotopically labeled moiety). The
targeting group can further include protein binding agents,
endothelial cell targeting groups (e.g., RGD peptides and
mimetics), cancer cell targeting groups (e.g., folate Vitamin B12,
Biotin), bone cell targeting groups (e.g., bisphosphonates,
polyglutamates, polyaspartates), multivalent mannose (for e.g.,
macrophage testing), lactose, galactose, N-acetyl-galactosamine,
monoclonal antibodies, glycoproteins, lectins, melanotropin, or
thyrotropin.
[0284] As can be appreciated by the skilled artisan, methods of
synthesizing the compounds of the formulae herein will be evident
to those of ordinary skill in the art. The synthesized compounds
can be separated from a reaction mixture and further purified by a
method such as column chromatography, high pressure liquid
chromatography, or recrystallization. Additionally, the various
synthetic steps may be performed in an alternate sequence or order
to give the desired compounds. Synthetic chemistry transformations
and protecting group methodologies (protection and deprotection)
useful in synthesizing the compounds described herein are known in
the art and include, for example, those such as described in R.
Larock, Comprehensive Organic Transformations, VCH Publishers
(1989); T. W. Greene and P. G. M. Wuts, Protective Groups in
Organic Synthesis, 2d. Ed., John Wiley and Sons (1991); L. Fieser
and M. Fieser, Fieser and Fieser's Reagents for Organic Synthesis,
John Wiley and Sons (1994); and L. Paquette, ed., Encyclopedia of
Reagents for Organic Synthesis, John Wiley and Sons (1995), and
subsequent editions thereof.
[0285] Ribose Replacement Monomer Subunits
[0286] iRNA agents can be modified in a number of ways which can
optimize one or more characteristics of the iRNA agent. An RNA
agent, e.g., an iRNA agent can include a ribose replacement monomer
subunit (RRMS), such as those described herein In addition, an iRNA
agent can have an RRMS and another element described herein. E.g.,
the invention includes an iRNA agent described herein, e.g., a
palindromic iRNA agent, an iRNA agent having a non canonical
pairing, an iRNA agent which targets a gene described herein, e.g.,
an SNCA gene, an iRNA agent having an architecture or structure
described herein, an iRNA associated with an amphipathic delivery
agent described herein, an iRNA associated with a drug delivery
module described herein, an iRNA agent administered as described
herein, or an iRNA agent formulated as described herein, which also
incorporates a RRMS.
[0287] The ribose sugar of one or more ribonucleotide subunits of
an iRNA agent can be replaced with another moiety, e.g., a
non-carbohydrate (preferably cyclic) carrier. A ribonucleotide
subunit in which the ribose sugar of the subunit has been so
replaced is referred to herein as an RRMS. A cyclic carrier may be
a carbocyclic ring system, i.e., all ring atoms are carbon atoms,
or a heterocyclic ring system, i.e., one or more ring atoms may be
a heteroatom, e.g., nitrogen, oxygen, sulfur. The cyclic carrier
may be a monocyclic ring system, or may contain two or more rings,
e.g. fused rings. The cyclic carrier may be a fully saturated ring
system, or it may contain one or more double bonds.
[0288] The carriers further include (i) at least two "backbone
attachment points" and (ii) at least one "tethering attachment
point." A "backbone attachment point" as used herein refers to a
functional group, e.g. a hydroxyl group, or generally, a bond
available for, and that is suitable for incorporation of the
carrier into the backbone, e.g., the phosphate, or modified
phosphate, e.g., sulfur containing, backbone, of a ribonucleic
acid. A "tethering attachment point" as used herein refers to a
constituent ring atom of the cyclic carrier, e.g., a carbon atom or
a heteroatom (distinct from an atom which provides a backbone
attachment point), that connects a selected moiety. The moiety can
be, e.g., a ligand, e.g., a targeting or delivery moiety, or a
moiety which alters a physical property, e.g., lipophilicity, of an
iRNA agent. Optionally, the selected moiety is connected by an
intervening tether to the cyclic carrier. Thus, it will include a
functional group, e.g., an amino group, or generally, provide a
bond, that is suitable for incorporation or tethering of another
chemical entity, e.g., a ligand to the constituent ring.
[0289] Incorporation of one or more RRMSs described herein into an
RNA agent, e.g., an iRNA agent, particularly when tethered to an
appropriate entity, can confer one or more new properties to the
RNA agent and/or alter, enhance or modulate one or more existing
properties in the RNA molecule. E.g., it can alter one or more of
lipophilicity or nuclease resistance. Incorporation of one or more
RRMSs described herein into an iRNA agent can, particularly when
the RRMS is tethered to an appropriate entity, modulate, e.g.,
increase, binding affinity of an iRNA agent to a target mRNA,
change the geometry of the duplex form of the iRNA agent, alter
distribution or target the iRNA agent to a particular part of the
body, or modify the interaction with nucleic acid binding proteins
(e.g., during RISC formation and strand separation).
[0290] Accordingly, in one aspect, the invention features, an iRNA
agent preferably comprising a first strand and a second strand,
wherein at least one subunit having a formula (R-1) is incorporated
into at least one of said strands.
##STR00012##
[0291] Referring to formula (R-1), X is N(CO)R.sup.7, NR.sup.7 or
CH.sub.2; Y is NR.sup.8, O, S, CR.sup.9R.sup.10, or absent; and Z
is CR.sup.11R.sup.12 or absent.
[0292] Each of R.sup.1, R.sup.2, R.sup.3, R.sup.4, R.sup.9, and
R.sup.10 is, independently, H, OR.sup.a, OR.sup.b,
(CH.sub.2).sub.nOR.sup.a, or (CH.sub.2).sub.nOR.sup.b, provided
that at least one of R.sup.1, R.sup.2, R.sup.3, R.sup.4, R.sup.9,
and R.sup.10 is OR.sup.a or OR.sup.b and that at least one of
R.sup.1, R.sup.2, R.sup.3, R.sup.4, R.sup.9, and R.sup.10 is
(CH.sub.2).sub.nOR.sup.a, or (CH.sub.2).sub.nOR.sup.b (when the
RRMS is terminal, one of R.sup.1, R.sup.2, R.sup.3, R.sup.4,
R.sup.9, and R.sup.10 will include R.sup.a and one will include
R.sup.b; when the RRMS is internal, two of R.sup.1, R.sup.2,
R.sup.3, R.sup.4, R.sup.9, and R.sup.10 will each include an
R.sup.b); further provided that preferably OR.sup.a may only be
present with (CH.sub.2).sub.nOR.sup.b and (CH.sub.2).sub.nOR.sup.a
may only be present with OR.sup.b.
[0293] Each of R.sup.5, R.sup.6, R.sup.11, and R.sup.12 is,
independently, H, C.sub.1-C.sub.6 alkyl optionally substituted with
1-3 R.sup.13, or C(O)NHR.sup.7; or R.sup.5 and R.sup.11 together
are C.sub.3-C.sub.8 cycloalkyl optionally substituted with
R.sup.14.
[0294] R.sup.7 is C.sub.1-C.sub.20 alkyl substituted with
NR.sup.cR.sup.d; R.sup.8 is C.sub.1-C.sub.6 alkyl; R.sup.13 is
hydroxy, C.sub.1-C.sub.4 alkoxy, or halo; and R.sup.14 is
NR.sup.cR.sup.7.
[0295] R.sup.a is:
##STR00013##
and
[0296] R.sup.b is:
##STR00014##
[0297] Each of A and C is, independently, O or S.
[0298] B is OH, O.sup.-, or
##STR00015##
[0299] R.sup.c is H or C1-C6 alkyl; R.sup.d is H or a ligand; and n
is 1-4.
[0300] In a preferred embodiment the ribose is replaced with a
pyrroline scaffold, and X is N(CO)R.sup.7 or NR.sup.7, Y is
CR.sup.9R.sup.10, and Z is absent.
[0301] In other preferred embodiments the ribose is replaced with a
piperidine scaffold, and X is N(CO)R.sup.7 or NR.sup.7, Y is
CR.sup.9R.sup.10, and Z is CR.sup.11R.sup.12.
[0302] In other preferred embodiments the ribose is replaced with a
piperazine scaffold, and X is N(CO)R.sup.7 or NR.sup.7, Y is
NR.sup.8, and Z is CR.sup.11R.sup.12.
[0303] In other preferred embodiments the ribose is replaced with a
morpholino scaffold, and X is N(CO)R.sup.7 or NR.sup.7, Y is O, and
Z is CR.sup.11R.sup.12.
[0304] In other preferred embodiments the ribose is replaced with a
decalin scaffold, and X is CH.sub.2; Y is CR.sup.9R.sup.10; and Z
is CR.sup.11R.sup.12; and R.sup.5 and R.sup.11 together are C.sup.6
cycloalkyl.
[0305] In other preferred embodiments the ribose is replaced with a
decalin/indane scaffold and, and X is CH.sub.2; Y is
CR.sup.9R.sup.10; and Z is CR.sup.11R.sup.12; and R.sup.5 and
R.sup.11 together are C.sup.5 cycloalkyl.
[0306] In other preferred embodiments, the ribose is replaced with
a hydroxyproline scaffold.
[0307] RRMSs described herein may be incorporated into any
double-stranded RNA-like molecule described herein, e.g., an iRNA
agent. An iRNA agent may include a duplex comprising a hybridized
sense and antisense strand, in which the antisense strand and/or
the sense strand may include one or more of the RRMSs described
herein. An RRMS can be introduced at one or more points in one or
both strands of a double-stranded iRNA agent. An RRMS can be placed
at or near (within 1, 2, or 3 positions) of the 3' or 5' end of the
sense strand or at near (within 2 or 3 positions of) the 3' end of
the antisense strand. In some embodiments it is preferred to not
have an RRMS at or near (within 1, 2, or 3 positions of) the 5' end
of the antisense strand. An RRMS can be internal, and will
preferably be positioned in regions not critical for antisense
binding to the target.
[0308] In an embodiment, an iRNA agent may have an RRMS at (or
within 1, 2, or 3 positions of) the 3' end of the antisense strand.
In an embodiment, an iRNA agent may have an RRMS at (or within 1,
2, or 3 positions of) the 3' end of the antisense strand and at (or
within 1, 2, or 3 positions of) the 3' end of the sense strand. In
an embodiment, an iRNA agent may have an RRMS at (or within 1, 2,
or 3 positions of) the 3' end of the antisense strand and an RRMS
at the 5' end of the sense strand, in which both ligands are
located at the same end of the iRNA agent.
[0309] In certain embodiments, two ligands are tethered,
preferably, one on each strand and are hydrophobic moieties. While
not wishing to be bound by theory, it is believed that pairing of
the hydrophobic ligands can stabilize the iRNA agent via
intermolecular van der Waals interactions.
[0310] In an embodiment, an iRNA agent may have an RRMS at (or
within 1, 2, or 3 positions of) the 3' end of the antisense strand
and an RRMS at the 5' end of the sense strand, in which both RRMSs
may share the same ligand (e.g., cholic acid) via connection of
their individual tethers to separate positions on the ligand. A
ligand shared between two proximal RRMSs is referred to herein as a
"hairpin ligand."
[0311] In other embodiments, an iRNA agent may have an RRMS at the
3' end of the sense strand and an RRMS at an internal position of
the sense strand. An iRNA agent may have an RRMS at an internal
position of the sense strand; or may have an RRMS at an internal
position of the antisense strand; or may have an RRMS at an
internal position of the sense strand and an RRMS at an internal
position of the antisense strand.
[0312] In preferred embodiments the iRNA agent includes a first and
second sequence, which are preferably two separate molecules as
opposed to two sequences located on the same strand, have
sufficient complementarity to each other to hybridize (and thereby
form a duplex region), e.g., under physiological conditions, e.g.,
under physiological conditions but not in contact with a helicase
or other unwinding enzyme.
[0313] It is preferred that the first and second sequences be
chosen such that the ds iRNA agent includes a single strand or
unpaired region at one or both ends of the molecule. Thus, a ds
iRNA agent contains first and second sequences, preferable paired
to contain an overhang, e.g., one or two 5' or 3' overhangs but
preferably a 3' overhang of 2-3 nucleotides. Most embodiments will
have a 3' overhang. Preferred sRNA agents will have single-stranded
overhangs, preferably 3' overhangs, of 1 or preferably 2 or 3
nucleotides in length at each end. The overhangs can be the result
of one strand being longer than the other, or the result of two
strands of the same length being staggered. 5' ends are preferably
phosphorylated.
[0314] Tethered Entities
[0315] A wide variety of entities can be tethered to an iRNA agent,
e.g., to the carrier of an RRMS. Examples are described below in
the context of an RRMS but that is only preferred, entities can be
coupled at other points to an iRNA agent. Preferred entities are
those which target to a neural cell, e.g., a neural cell expressing
SNCA.
[0316] Preferred moieties are ligands, which are coupled,
preferably covalently, either directly or indirectly via an
intervening tether, to the RRMS carrier. In preferred embodiments,
the ligand is attached to the carrier via an intervening tether. As
discussed above, the ligand or tethered ligand may be present on
the RRMS monomer when the RRMS monomer is incorporated into the
growing strand. In some embodiments, the ligand may be incorporated
into a "precursor" RRMS after a "precursor" RRMS monomer has been
incorporated into the growing strand. For example, an RRMS monomer
having, e.g., an amino-terminated tether (i.e., having no
associated ligand), e.g., TAP-(CH.sub.2).sub.nNH.sub.2 may be
incorporated into a growing sense or antisense strand. In a
subsequent operation, i.e., after incorporation of the precursor
monomer into the strand, a ligand having an electrophilic group,
e.g., a pentafluorophenyl ester or aldehyde group, can subsequently
be attached to the precursor RRMS by coupling the electrophilic
group of the ligand with the terminal nucleophilic group of the
precursor RRMS tether.
[0317] In preferred embodiments, a ligand alters the distribution,
targeting or lifetime of an iRNA agent into which it is
incorporated. In preferred embodiments a ligand provides an
enhanced affinity for a selected target, e.g., molecule, cell or
cell type, compartment, e.g., a cellular or organ compartment,
tissue, organ or region of the body, as, e.g., compared to a
species absent such a ligand. For example, in a preferred
embodiment, a ligand will provide enhanced selectivity to a neural
cell, such as in the brain. Preferred ligands will not take part in
duplex pairing in a duplexed nucleic acid.
[0318] Preferred ligands can improve transport, hybridization, and
specificity properties and may also improve nuclease resistance of
the resultant natural or modified oligoribonucleotide, or a
polymeric molecule comprising any combination of monomers described
herein and/or natural or modified ribonucleotides.
[0319] Ligands in general can include therapeutic modifiers, e.g.,
for enhancing uptake; diagnostic compounds or reporter groups e.g.,
for monitoring distribution; cross-linking agents; and
nuclease-resistance conferring moieties. General examples include
lipids, steroids, vitamins, sugars, proteins, peptides, polyamines,
and peptide mimics.
[0320] Ligands can include a naturally occurring substance, such as
a protein (e.g., human serum albumin (HSA), low-density lipoprotein
(LDL), or globulin); carbohydrate (e.g., a dextran, pullulan,
chitin, chitosan, inulin, cyclodextrin or hyaluronic acid); or a
lipid. The ligand may also be a recombinant or synthetic molecule,
such as a synthetic polymer, e.g., a synthetic polyamino acid.
Examples of polyamino acids include polyamino acid is a polylysine
(PLL), poly L-aspartic acid, poly L-glutamic acid, styrene-maleic
acid anhydride copolymer, poly(L-lactide-co-glycolide) copolymer,
divinyl ether-maleic anhydride copolymer,
N-(2-hydroxypropyl)methacrylamide copolymer (HMPA), polyethylene
glycol (PEG), polyvinyl alcohol (PVA), polyurethane,
poly(2-ethylacrylic acid), N-isopropylacrylamide polymers, or
polyphosphazine. Example of polyamines include: polyethylenimine,
polylysine (PLL), spermine, spermidine, polyamine,
pseudopeptide-polyamine, peptidomimetic polyamine, dendrimer
polyamine, arginine, amidine, protamine, cationic lipid, cationic
porphyrin, quaternary salt of a polyamine, or an alpha helical
peptide.
[0321] Ligands can also include targeting groups, e.g., a cell or
tissue targeting agent, e.g., a lectin, glycoprotein, lipid or
protein, e.g., an antibody, that binds to a specified cell type
such as a neural cell.
[0322] Other examples of ligands include dyes, intercalating agents
(e.g. acridines), cross-linkers (e.g. psoralene, mitomycin C),
porphyrins (TPPC4, texaphyrin, Sapphyrin), polycyclic aromatic
hydrocarbons (e.g., phenazine, dihydrophenazine), artificial
endonucleases (e.g. EDTA), lipophilic molecules, e.g., cholesterol,
cholic acid, adamantane acetic acid, 1-pyrene butyric acid,
dihydrotestosterone, 1,3-Bis-O(hexadecyl)glycerol, geranyloxyhexyl
group, hexadecylglycerol, borneol, menthol, 1,3-propanediol,
heptadecyl group, palmitic acid, myristic acid,
O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenic acid,
dimethoxytrityl, or phenoxazine) and peptide conjugates (e.g.,
antennapedia peptide, Tat peptide), alkylating agents, phosphate,
amino, mercapto, PEG (e.g., PEG-40K), MPEG, [MPEG].sub.2,
polyamino, alkyl, substituted alkyl, radiolabeled markers, enzymes,
haptens (e.g. biotin), transport/absorption facilitators (e.g.,
aspirin, vitamin E, folic acid), synthetic ribonucleases (e.g.,
imidazole, bisimidazole, histamine, imidazole clusters,
acridine-imidazole conjugates, Eu3+ complexes of
tetraazamacrocycles), dinitrophenyl, HRP, or AP. In one embodiment,
a ligand can facilitate the movement of the iRNA agent across the
blood-brain barrier.
[0323] Ligands can be proteins, e.g., glycoproteins, or peptides,
e.g., molecules having a specific affinity for a co-ligand, or
antibodies e.g., an antibody, that binds to a specified cell type
such as a neural cell. Ligands may also include hormones and
hormone receptors. They can also include non-peptidic species, such
as lipids, lectins, carbohydrates, vitamins, cofactors, multivalent
lactose, multivalent galactose, N-acetyl-galactosamine,
N-acetyl-glucosamine multivalent mannose, or multivalent
fucose.
[0324] The ligand can be a substance, e.g., a drug, which can
increase the uptake of the iRNA agent into the cell, for example,
by disrupting the cell's cytoskeleton, e.g., by disrupting the
cell's microtubules, microfilaments, and/or intermediate filaments.
The drug can be, for example, taxon, vincristine, vinblastine,
cytochalasin, nocodazole, japlakinolide, latrunculin A, phalloidin,
swinholide A, indanocine, or myoservin.
[0325] The ligand can increase the uptake of the iRNA agent into
the cell by activating an inflammatory response, for example.
Exemplary ligands that would have such an effect include tumor
necrosis factor alpha (TNFalpha), interleukin-1 beta, or gamma
interferon.
[0326] In one aspect, the ligand is a lipid or lipid-based
molecule. Such a lipid or lipid-based molecule preferably binds a
serum protein, e.g., human serum albumin (HSA). An HSA binding
ligand allows for distribution of the conjugate to a target tissue,
e.g., a non-liver target tissue of the body. Preferably, the target
tissue is the brain. Other molecules that can bind HSA can also be
used as ligands. For example, neproxin or aspirin can be used. A
lipid or lipid-based ligand can (a) increase resistance to
degradation of the conjugate, (b) increase targeting or transport
into a target cell or cell membrane, and/or (c) can be used to
adjust binding to a serum protein, e.g., HSA.
[0327] A lipid based ligand can be used to modulate, e.g., control
the binding of the conjugate to a target tissue. For example, a
lipid or lipid-based ligand that binds to HSA more strongly will be
less likely to be targeted to the liver and therefore less likely
to be cleared from the body.
[0328] In a preferred embodiment, the lipid based ligand binds HSA.
Preferably, it binds HSA with a sufficient affinity such that the
conjugate will be preferably distributed to a non-kidney tissue.
However, it is preferred that the affinity not be so strong that
the HSA-ligand binding cannot be reversed.
[0329] In another aspect, the ligand is a moiety, e.g., a vitamin,
which is taken up by a target cell, e.g., a proliferating cell.
These are particularly useful for treating disorders characterized
by unwanted cell proliferation, e.g., of the malignant or
non-malignant type, e.g., cancer cells. Exemplary vitamins include
vitamin A, E, and K. Other exemplary vitamins include are B
vitamin, e.g., folic acid, B12, riboflavin, biotin, pyridoxal or
other vitamins or nutrients taken up by cancer cells. Also included
are HSA and low density lipoprotein (LDL).
[0330] In another aspect, the ligand is a cell-permeation agent,
preferably a helical cell-permeation agent. Preferably, the agent
is amphipathic. An exemplary agent is a peptide such as tat or
antennopedia. If the agent is a peptide, it can be modified,
including a peptidylmimetic, invertomers, non-peptide or
pseudo-peptide linkages, and use of D-amino acids. The helical
agent is preferably an alpha-helical agent, which preferably has a
lipophilic and a lipophobic phase.
[0331] The ligand can be a peptide or peptidomimetic. A
peptidomimetic (also referred to herein as an oligopeptidomimetic)
is a molecule capable of folding into a defined three-dimensional
structure similar to a natural peptide. The attachment of peptide
and peptidomimetics to iRNA agents can affect pharmacokinetic
distribution of the iRNA, such as by enhancing cellular recognition
and absorption. The peptide or peptidomimetic moiety can be about
5-50 amino acids long, e.g., about 5, 10, 15, 20, 25, 30, 35, 40,
45, or 50 amino acids long (see Table 3, for example).
TABLE-US-00001 TABLE 3 Exemplary Cell Permeation Peptides Cell
Amino Permeation acid Peptide Sequence Reference Penetratin
RQIKIWFQNRRMKWKK Derossi et al., (SEQ ID NO: 31) J. Biol. Chem.
269:10444, 1994 Tat GRKKRRQRRRPPQC Vives et al., fragment (SEQ ID
NO: 32) J. Biol. Chem., (48-60) 272:16010, 1997 Signal
GALFLGWLGAAGST Chaloin et al., Sequence- MGAWSQPKKKRKV Biochem.
Biophys. based (SEQ ID NO: 33) Res. Commun., peptide 243:601, 1998
PVEC LLIILRRRIRKQAHAHSK Elmquist et al., (SEQ ID NO: 34) Exp. Cell
Res., 269:237, 2001 Transportan GWTLNSAGYLLKI Pooga et al.,
NLKALAALAKKIL FASEB J., (SEQ ID NO: 35) 12:67, 1998 Amphiphilic
KLALKLALKALKAALKLA Oehlke et al., model (SEQ ID NO: 36) Mol. Ther.,
peptide 2:339, 2000 Arg.sub.9 RRRRRRRRR Mitchell et al., (SEQ ID
NO: 37) J. Pept. Res., 56:318, 2000 Bacterial KFFKFFKFFK cell wall
(SEQ ID NO: 38) permeating LL-37 LLGDFFRKSKEKIGKEFKR
IVQRIKDFLRNLVPRTES (SEQ ID NO: 39) Cecropin P1 SWLSKTAKKLENSAKK
RISEGIAIAIQGGPR (SEQ ID NO: 40) .alpha.-defensin ACYCRIPACIAGERR
YGTCIYQGRLWAFCC (SEQ ID NO: 41) b-defensin DHYNCVSSGGQCLYSACP
IFTKIQGTCYRGKAKCCK (SEQ ID NO: 42) Bactenecin RKCRIVVIRVCR (SEQ ID
NO: 43) PR-39 RRRPRPPYLPRPRPPP FFPPRLPPRIPPGFPP RFPPRFPGKR-NH2 (SEQ
ID NO: 44) Indolicidin ILPWKWPWWPWRR-NH2 (SEQ ID NO: 45)
[0332] A peptide or peptidomimetic can be, for example, a cell
permeation peptide, cationic peptide, amphipathic peptide, or
hydrophobic peptide (e.g., consisting primarily of Tyr, Trp or
Phe). The peptide moiety can be a dendrimer peptide, constrained
peptide or crosslinked peptide. The peptide moiety can be an
L-peptide or D-peptide. In another alternative, the peptide moiety
can include a hydrophobic membrane translocation sequence (MTS). An
exemplary hydrophobic MTS-containing peptide is RFGF having the
amino acid sequence AAVALLPAVLLALLAP (SEQ ID NO:46). An RFGF
analogue (e.g., amino acid sequence AALLPVLLAAP (SEQ ID NO:47)
containing a hydrophobic MTS can also be a targeting moiety. The
peptide moiety can be a "delivery" peptide, which can carry large
polar molecules including peptides, oligonucleotides, and protein
across cell membranes. For example, sequences from the HIV Tat
protein (GRKKRRQRRRPPQ (SEQ ID NO:48) and the Drosophila
Antennapedia protein (RQIKIWFQNRRMKWKK (SEQ ID NO:49) have been
found to be capable of functioning as delivery peptides. A peptide
or peptidomimetic can be encoded by a random sequence of DNA, such
as a peptide identified from a phage-display library, or
one-bead-one-compound (OBOC) combinatorial library (Lam et al.,
Nature 354:82-84, 1991). Preferably the peptide or peptidomimetic
tethered to an iRNA agent via an incorporated monomer unit is a
cell targeting peptide such as an arginine-glycine-aspartic acid
(RGD)-peptide, or RGD mimic. A peptide moiety can range in length
from about 5 amino acids to about 40 amino acids. The peptide
moieties can have a structural modification, such as to increase
stability or direct conformational properties. Any of the
structural modifications described below can be utilized.
[0333] A "cell permeation peptide" is capable of permeating a cell,
e.g., a-mammalian cell, such as a human cell. A cell permeation
peptide can also include a nuclear localization signal (NLS). For
example, a cell permeation peptide can be a bipartite amphipathic
peptide, such as MPG, which is derived from the fusion peptide
domain of HIV-1 gp41 and the NLS of SV40 large T antigen (Simeoni
et al., Nucl. Acids Res. 31:2717-2724, 2003).
[0334] In one embodiment, a targeting peptide tethered to an RRMS
can be an amphipathic .alpha.-helical peptide. Exemplary
amphipathic .alpha.-helical peptides include, but are not limited
to, cecropins, lycotoxins, paradaxins, buforin, CPF, bombinin-like
peptide (BLP), cathelicidins, ceratotoxins, S. clava peptides,
hagfish intestinal antimicrobial peptides (HFIAPs), magainines,
brevinins-2, dermaseptins, melittins, pleurocidin, H.sub.2A
peptides, Xenopus peptides, esculentinis-1, and caerins. A number
of factors will preferably be considered to maintain the integrity
of helix stability. For example, a maximum number of helix
stabilization residues will be utilized (e.g., leu, ala, or lys),
and a minimum number helix destabilization residues will be
utilized (e.g., proline, or cyclic monomeric units. The capping
residue will be considered (for example Gly is an exemplary
N-capping residue and/or C-terminal amidation can be used to
provide an extra H-bond to stabilize the helix. Formation of salt
bridges between residues with opposite charges, separated by
i.+-.3, or i.+-.4 positions can provide stability. For example,
cationic residues such as lysine, arginine, homo-arginine,
ornithine or histidine can form salt bridges with the anionic
residues glutamate or aspartate.
[0335] Peptide and peptidomimetic ligands include those having
naturally occurring or modified peptides, e.g., D or L peptides;
.alpha., .beta., or .gamma. peptides; N-methyl peptides;
azapeptides; peptides having one or more amide, i.e., peptide,
linkages replaced with one or more urea, thiourea, carbamate, or
sulfonyl urea linkages; or cyclic peptides.
[0336] Methods for Making iRNA Agents
[0337] iRNA agents can include modified or non-naturally occurring
bases, e.g., bases described herein. In addition, iRNA agents can
have a modified or non-naturally occurring base and another element
described herein. E.g., the invention includes an iRNA agent
described herein, e.g., a palindromic iRNA agent, an iRNA agent
having a non canonical pairing, an iRNA agent which targets a gene
described herein, e.g., an SNCA gene, an iRNA agent having an
architecture or structure described herein, an iRNA associated with
an amphipathic delivery agent described herein, an iRNA associated
with a drug delivery module described herein, an iRNA agent
administered as described herein, or an iRNA agent formulated as
described herein, which also incorporates a modified or
non-naturally occurring base.
[0338] The synthesis and purification of oligonucleotide peptide
conjugates can be performed by established methods. See, for
example, Trufert et al., Tetrahedron, 52:3005, 1996; and Manoharan,
"Oligonucleotide Conjugates in Antisense Technology," in Antisense
Drug Technology, ed. S. T. Crooke, Marcel Dekker, Inc., 2001.
[0339] In one embodiment of the invention, a peptidomimetic can be
modified to create a constrained peptide that adopts a distinct and
specific preferred conformation, which can increase the potency and
selectivity of the peptide. For example, the constrained peptide
can be an azapeptide (Gante, Synthesis 405-413, 1989). An
azapeptide is synthesized by replacing the .alpha.-carbon of an
amino acid with a nitrogen atom without changing the structure of
the amino acid side chain. For example, the azapeptide can be
synthesized by using hydrazine in traditional peptide synthesis
coupling methods, such as by reacting hydrazine with a "carbonyl
donor," e.g., phenylchloroformate.
[0340] In one embodiment of the invention, a peptide or
peptidomimetic (e.g., a peptide or peptidomimetic tethered to an
RRMS) can be an N-methyl peptide. N-methyl peptides are composed of
N-methyl amino acids, which provide an additional methyl group in
the peptide backbone, thereby potentially providing additional
means of resistance to proteolytic cleavage. N-methyl peptides can
by synthesized by methods known in the art (see, for example,
Lindgren et al., Trends Pharmacol. Sci. 21:99, 2000; Cell
Penetrating Peptides: Processes and Applications, Langel, ed., CRC
Press, Boca Raton, Fla., 2002; Fische et al., Bioconjugate. Chem.
12: 825, 2001; Wander et al., J. Am. Chem. Soc., 124:13382, 2002).
For example, an Ant or Tat peptide can be an N-methyl peptide.
[0341] In one embodiment of the invention, a peptide or
peptidomimetic (e.g., a peptide or peptidomimetic tethered to an
RRMS) can be a .beta.-peptide. .beta.-peptides form stable
secondary structures such as helices, pleated sheets, turns and
hairpins in solutions. Their cyclic derivatives can fold into
nanotubes in the solid state. .beta.-peptides are resistant to
degradation by proteolytic enzymes. .beta.-peptides can be
synthesized by methods known in the art. For example, an Ant or Tat
peptide can be a .beta.-peptide.
[0342] In one embodiment of the invention, a peptide or
peptidomimetic (e.g., a peptide or peptidomimetic tethered to an
RRMS) can be a oligocarbamate. Oligocarbamate peptides are
internalized into a cell by a transport pathway facilitated by
carbamate transporters. For example, an Ant or Tat peptide can be
an oligocarbamate.
[0343] In one embodiment of the invention, a peptide or
peptidomimetic (e.g., a peptide or peptidomimetic tethered to an
RRMS) can be an oligourea conjugate (or an oligothiourea
conjugate), in which the amide bond of a peptidomimetic is replaced
with a urea moiety. Replacement of the amide bond provides
increased resistance to degradation by proteolytic enzymes, e.g.,
proteolytic enzymes in the gastrointestinal tract. In one
embodiment, an oligourea conjugate is tethered to an iRNA agent for
use in oral delivery. The backbone in each repeating unit of an
oligourea peptidomimetic can be extended by one carbon atom in
comparison with the natural amino acid. The single carbon atom
extension can increase peptide stability and lipophilicity, for
example. An oligourea peptide can therefore be advantageous when an
iRNA agent is directed for passage through a bacterial cell wall,
or when an iRNA agent must traverse the blood-brain barrier, such
as for the treatment of a neurological disorder. In one embodiment,
a hydrogen bonding unit is conjugated to the oligourea peptide,
such as to create an increased affinity with a receptor. For
example, an Ant or Tat peptide can be an oligourea conjugate (or an
oligothiourea conjugate).
[0344] The dsRNA peptide conjugates of the invention can be
affiliated with, e.g., tethered to, RRMSs occurring at various
positions on an iRNA agent. For example, a peptide can be
terminally conjugated, on either the sense or the antisense strand,
or a peptide can be bisconjugated (one peptide tethered to each
end, one conjugated to the sense strand, and one conjugated to the
antisense strand). In another option, the peptide can be internally
conjugated, such as in the loop of a short hairpin iRNA agent. In
yet another option, the peptide can be affiliated with a complex,
such as a peptide-carrier complex.
[0345] A peptide-carrier complex consists of at least a carrier
molecule, which can encapsulate one or more iRNA agents (such as
for delivery to a biological system and/or a cell), and a peptide
moiety tethered to the outside of the carrier molecule, such as for
targeting the carrier complex to a particular tissue or cell type.
A carrier complex can carry additional targeting molecules on the
exterior of the complex, or fusogenic agents to aid in cell
delivery. The one or more iRNA agents encapsulated within the
carrier can be conjugated to lipophilic molecules, which can aid in
the delivery of the agents to the interior of the carrier.
[0346] A carrier molecule or structure can be, for example, a
micelle, a liposome (e.g., a cationic liposome), a nanoparticle, a
microsphere, or a biodegradable polymer. A peptide moiety can be
tethered to the carrier molecule by a variety of linkages, such as
a disulfide linkage, an acid labile linkage, a peptide-based
linkage, an oxyamino linkage or a hydrazine linkage. For example, a
peptide-based linkage can be a GFLG peptide. Certain linkages will
have particular advantages, and the advantages (or disadvantages)
can be considered depending on the tissue target or intended use.
For example, peptide based linkages are stable in the blood stream
but are susceptible to enzymatic cleavage in the lysosomes.
DEFINITIONS
[0347] The term "halo" refers to any radical of fluorine, chlorine,
bromine or iodine.
[0348] The term "alkyl" refers to a hydrocarbon chain that may be a
straight chain or branched chain, containing the indicated number
of carbon atoms. For example, C.sub.1-C.sub.12 alkyl indicates that
the group may have from 1 to 12 (inclusive) carbon atoms in it. The
term "haloalkyl" refers to an alkyl in which one or more hydrogen
atoms are replaced by halo, and includes alkyl moieties in which
all hydrogens have been replaced by halo (e.g., perfluoroalkyl).
Alkyl and haloalkyl groups may be optionally inserted with O, N, or
S. The terms "aralkyl" refers to an alkyl moiety in which an alkyl
hydrogen atom is replaced by an aryl group. Aralkyl includes groups
in which more than one hydrogen atom has been replaced by an aryl
group. Examples of "aralkyl" include benzyl, 9-fluorenyl,
benzhydryl, and trityl groups.
[0349] The term "alkenyl" refers to a straight or branched
hydrocarbon chain containing 2-8 carbon atoms and characterized in
having one or more double bonds. Examples of a typical alkenyl
include, but not limited to, allyl, propenyl, 2-butenyl, 3-hexenyl
and 3-octenyl groups. The term "alkynyl" refers to a straight or
branched hydrocarbon chain containing 2-8 carbon atoms and
characterized in having one or more triple bonds. Some examples of
a typical alkynyl are ethynyl, 2-propynyl, and 3-methylbutynyl, and
propargyl. The sp.sup.2 and sp.sup.3 carbons may optionally serve
as the point of attachment of the alkenyl and alkynyl groups,
respectively.
[0350] The term "alkoxy" refers to an --O-alkyl radical. The term
"aminoalkyl" refers to an alkyl substituted with an amino. The term
"mercapto" refers to an --SH radical. The term "thioalkoxy" refers
to an --S-alkyl radical.
[0351] The term "alkylene" refers to a divalent alkyl (i.e.,
--R--), e.g., --CH.sub.2--, --CH.sub.2CH.sub.2--, and
--CH.sub.2CH.sub.2CH.sub.2--. The term "alkylenedioxo" refers to a
divalent species of the structure --O--R--O--, in which R
represents an alkylene.
[0352] The term "aryl" refers to an aromatic monocyclic, bicyclic,
or tricyclic hydrocarbon ring system, wherein any ring atom capable
of substitution can be substituted by a substituent. Examples of
aryl moieties include, but are not limited to, phenyl, naphthyl,
and anthracenyl.
[0353] The term "cycloalkyl" as employed herein includes saturated
cyclic, bicyclic, tricyclic, or polycyclic hydrocarbon groups
having 3 to 12 carbons, wherein any ring atom capable of
substitution can be substituted by a substituent. The cycloalkyl
groups herein described may also contain fused rings. Fused rings
are rings that share a common carbon-carbon bond. Examples of
cycloalkyl moieties include, but are not limited to, cyclohexyl,
adamantyl, and norbornyl.
[0354] The term "heterocyclyl" refers to a nonaromatic 3-10
membered monocyclic, 8-12 membered bicyclic, or 11-14 membered
tricyclic ring system having 1-3 heteroatoms if monocyclic, 1-6
heteroatoms if bicyclic, or 1-9 heteroatoms if tricyclic, said
heteroatoms selected from O, N, or S (e.g., carbon atoms and 1-3,
1-6, or 1-9 heteroatoms of N, O, or S if monocyclic, bicyclic, or
tricyclic, respectively), wherein any ring atom capable of
substitution can be substituted by a substituent. The heterocyclyl
groups herein described may also contain fused rings. Fused rings
are rings that share a common carbon-carbon bond. Examples of
heterocyclyl include, but are not limited to tetrahydrofuranyl,
tetrahydropyranyl, piperidinyl, morpholino, pyrrolinyl and
pyrrolidinyl.
[0355] The term "heteroaryl" refers to an aromatic 5-8 membered
monocyclic, 8-12 membered bicyclic, or 11-14 membered tricyclic
ring system having 1-3 heteroatoms if monocyclic, 1-6 heteroatoms
if bicyclic, or 1-9 heteroatoms if tricyclic, said heteroatoms
selected from O, N, or S (e.g., carbon atoms and 1-3, 1-6, or 1-9
heteroatoms of N, O, or S if monocyclic, bicyclic, or tricyclic,
respectively), wherein any ring atom capable of substitution can be
substituted by a substituent.
[0356] The term "oxo" refers to an oxygen atom, which forms a
carbonyl when attached to carbon, an N-oxide when attached to
nitrogen, and a sulfoxide or sulfone when attached to sulfur.
[0357] The term "acyl" refers to an alkylcarbonyl,
cycloalkylcarbonyl, arylcarbonyl, heterocyclylcarbonyl, or
heteroarylcarbonyl substituent, any of which may be further
substituted by substituents.
[0358] The term "substituents" refers to a group "substituted" on
an alkyl, cycloalkyl, alkenyl, alkynyl, heterocyclyl,
heterocycloalkenyl, cycloalkenyl, aryl, or heteroaryl group at any
atom of that group. Suitable substituents include, without
limitation, alkyl, alkenyl, alkynyl, alkoxy, halo, hydroxy, cyano,
nitro, amino, SO.sub.3H, sulfate, phosphate, perfluoroalkyl,
perfluoroalkoxy, methylenedioxy, ethylenedioxy, carboxyl, oxo,
thioxo, imino (alkyl, aryl, aralkyl), S(O).sub.nalkyl (where n is
0-2), S(O).sub.n aryl (where n is 0-2), S(O).sub.n heteroaryl
(where n is 0-2), S(O).sub.n heterocyclyl (where n is 0-2), amine
(mono-, di-, alkyl, cycloalkyl, aralkyl, heteroaralkyl, and
combinations thereof), ester (alkyl, aralkyl, heteroaralkyl), amide
(mono-, di-, alkyl, aralkyl, heteroaralkyl, and combinations
thereof), sulfonamide (mono-, di-, alkyl, aralkyl, heteroaralkyl,
and combinations thereof), unsubstituted aryl, unsubstituted
heteroaryl, unsubstituted heterocyclyl, and unsubstituted
cycloalkyl. In one aspect, the substituents on a group are
independently any one single, or any subset of the aforementioned
substituents.
[0359] The terms "adeninyl, cytosinyl, guaninyl, thyminyl, and
uracilyl" and the like refer to radicals of adenine, cytosine,
guanine, thymine, and uracil.
[0360] As used herein, an "unusual" nucleobase can include any one
of the following: [0361] 2-methyladeninyl, [0362]
N6-methyladeninyl, [0363] 2-methylthio-N6-methyladeninyl, [0364]
N6-isopentenyladeninyl, [0365] 2-methylthio-N6-isopentenyladeninyl,
[0366] N6-(cis-hydroxyisopentenyl)adeninyl, [0367]
2-methylthio-N6-(cis-hydroxyisopentenyl)adeninyl, [0368]
N6-glycinylcarbamoyladeninyl, [0369] N6-threonylcarbamoyladeninyl,
[0370] 2-methylthio-N6-threonyl carbamoyladeninyl, [0371]
N6-methyl-N6-threonylcarbamoyladeninyl, [0372]
N6-hydroxynorvalylcarbamoyladeninyl, [0373]
2-methylthio-N-6-hydroxynorvalyl carbamoyladeninyl, [0374]
N6,N6-dimethyladeninyl, [0375] 3-methylcytosinyl, [0376]
5-methylcytosinyl, [0377] 2-thiocytosinyl, [0378]
5-formylcytosinyl,
[0378] ##STR00016## [0379] N4-methylcytosinyl, [0380]
5-hydroxymethylcytosinyl, [0381] 1-methylguaninyl, [0382]
N2-methylguaninyl, [0383] 7-methylguaninyl, [0384]
N2,N2-dimethylguaninyl,
[0384] ##STR00017## ##STR00018## ##STR00019## [0385]
N2,N2,7-trimethylguaninyl, [0386] 1-methylguaninyl, [0387]
7-cyano-7-deazaguaninyl, [0388] 7-aminomethyl-7-deazaguaninyl,
[0389] pseudouracilyl, [0390] dihydrouracilyl, [0391]
5-methyluracilyl, [0392] 1-methylpseudouracilyl, [0393]
2-thiouracilyl, [0394] 4-thiouracilyl, [0395] 2-thiothyminyl [0396]
5-methyl-2-thiouracilyl, [0397]
3-(3-amino-3-carboxypropyl)uracilyl, [0398] 5-hydroxyuracilyl,
[0399] 5-methoxyuracilyl, [0400] uracilyl 5-oxyacetic acid, [0401]
uracilyl 5-oxyacetic acid methyl ester, [0402]
5-(carboxyhydroxymethyl)uracilyl, [0403]
5-(carboxyhydroxymethyl)uracilyl methyl ester, [0404]
5-methoxycarbonylmethyluracilyl, [0405]
5-methoxycarbonylmethyl-2-thiouracilyl, [0406]
5-aminomethyl-2-thiouracilyl, [0407] 5-methylaminomethyluracilyl,
[0408] 5-methylaminomethyl-2-thiouracilyl, [0409]
5-methylaminomethyl-2-selenouracilyl, [0410]
5-carbamoylmethyluracilyl, [0411]
5-carboxymethylaminomethyluracilyl, [0412]
5-carboxymethylaminomethyl-2-thiouracilyl, [0413] 3-methyluracilyl,
[0414] 1-methyl-3-(3-amino-3-carboxypropyl) pseudouracilyl, [0415]
5-carboxymethyluracilyl, [0416] 5-methyldihydrouracilyl, or [0417]
3-methylpseudouracilyl.
Palindromes
[0418] An RNA, e.g., an iRNA agent, can have a palindrome structure
as described herein. For example, the iRNA agents of the invention
can target more than one RNA region. For example, an iRNA agent can
include a first and second sequence that are sufficiently
complementary to each other to hybridize. The first sequence can be
complementary to a first target sequence of an SNCA RNA and the
second sequence can be complementary to a second target sequence of
an SNCA RNA. The first and second target sequences can differ by at
least 1 nucleotide. The first and second sequences of the iRNA
agent can be on different RNA strands, and the mismatch between the
first and second sequences can be less than 50%, 40%, 30%, 20%,
10%, 5%, or 1%. The first and second sequences of the iRNA agent
can be on the same RNA strand, and in a related embodiment more
than 50%, 60%, 70%, 80%, 90%, 95%, or 1% of the iRNA agent can be
in bimolecular form. The first and second sequences of the iRNA
agent can be fully complementary to each other.
[0419] The first and second target RNA regions can be on
transcripts encoded by first and second sequence variants, e.g.,
first and second alleles, of an SNCA gene. The sequence variants
can be mutations, or polymorphisms, for example. The first target
RNA region can include a nucleotide substitution, insertion, or
deletion relative to the second target RNA region, or the second
target RNA region can a mutant or variant of the first target
region.
[0420] The compositions of the invention can include mixtures of
iRNA agent molecules. For example, one iRNA agent can contain a
first sequence and a second sequence sufficiently complementary to
each other to hybridize, and in addition the first sequence is
complementary to a first target RNA region and the second sequence
is complementary to a second target RNA region. The mixture can
also include at least one additional iRNA agent variety that
includes a third sequence and a fourth sequence sufficiently
complementary to each other to hybridize, and where the third
sequence is complementary to a third target RNA region and the
fourth sequence is complementary to a fourth target RNA region. In
addition, the first or second sequence can be sufficiently
complementary to the third or fourth sequence to be capable of
hybridizing to each other. The first and second sequences can be on
the same or different RNA strands, and the third and fourth
sequences can be on the same or different RNA strands.
[0421] An iRNA agent can include a first sequence complementary to
a first variant SNCA RNA target region and a second sequence
complementary to a second variant SNCA RNA target region. The first
and second variant target RNA regions can include allelic variants,
mutations (e.g., point mutations), or polymorphisms of the SNCA
target gene. Other than Canonical Watson-Crick Duplex
Structures.
[0422] Other than Canonical Watson-Crick Duplex Structures
[0423] An RNA, e.g., an iRNA agent can include monomers that can
form other than a canonical Watson-Crick pairing with another
monomer, e.g., a monomer on another strand. The use of "other than
canonical Watson-Crick pairing" between monomers of a duplex can be
used to control, often to promote, melting of all or part of a
duplex. The iRNA agent can include a monomer at a selected or
constrained position that results in a first level of stability in
the iRNA agent duplex (e.g., between the two separate molecules of
a double stranded iRNA agent) and a second level of stability in a
duplex between a sequence of an iRNA agent and another sequence
molecule, e.g., a target or off-target sequence in a subject. In
some cases the second duplex has a relatively greater level of
stability, e.g., in a duplex between an anti-sense sequence of an
iRNA agent and a target mRNA. In this case one or more of the
monomers, the position of the monomers in the iRNA agent, and the
target sequence (sometimes referred to herein as the selection or
constraint parameters), are selected such that the iRNA agent
duplex has a comparatively lower free energy of association (which
while not wishing to be bound by mechanism or theory, is believed
to contribute to efficacy by promoting disassociation of the duplex
iRNA agent in the context of the RISC) while the duplex formed
between an antisense targeting sequence and its target sequence,
has a relatively higher free energy of association (which while not
wishing to be bound by mechanism or theory, is believed to
contribute to efficacy by promoting association of the antisense
sequence and the target RNA).
[0424] In other cases the second duplex has a relatively lower
level of stability, e.g., in a duplex between a sense sequence of
an iRNA agent and an off-target mRNA. In this case one or more of
the monomers, the position of the monomers in the iRNA agent, and
an off-target sequence, are selected such that the iRNA agent
duplex is has a comparatively higher free energy of association
while the duplex formed between a sense targeting sequence and its
off-target sequence, has a relatively lower free energy of
association (which while not wishing to be bound by mechanism or
theory, is believed to reduce the level of off-target silencing by
promoting disassociation of the duplex formed by the sense strand
and the off-target sequence).
[0425] Thus, inherent in the structure of the iRNA agent is the
property of having a first stability for the intra-iRNA agent
duplex and a second stability for a duplex formed between a
sequence from the iRNA agent and another RNA, e.g., a target mRNA.
As discussed above, this can be accomplished by judicious selection
of one or more of the monomers at a selected or constrained
position, the selection of the position in the duplex to place the
selected or constrained position, and selection of the sequence of
a target sequence (e.g., the particular region of a target gene
which is to be targeted). The iRNA agent sequences which satisfy
these requirements are sometimes referred to herein as constrained
sequences. Exercise of the constraint or selection parameters can
be, e.g., by inspection or by computer assisted methods. Exercise
of the parameters can result in selection of a target sequence and
of particular monomers to give a desired result in terms of the
stability, or relative stability, of a duplex.
[0426] Thus, in another aspect, the invention features an iRNA
agent which includes: a first sequence which targets a first target
region and a second sequence which targets a second target region.
The first and second sequences have sufficient complementarity to
each other to hybridize, e.g., under physiological conditions,
e.g., under physiological conditions but not in contact with a
helicase or other unwinding enzyme. In a duplex region of the iRNA
agent, at a selected or constrained position, the first target
region has a first monomer, and the second target region has a
second monomer. The first and second monomers occupy complementary
or corresponding positions. One, and preferably both monomers are
selected such that the stability of the pairing of the monomers
contribute to a duplex between the first and second sequence will
differ form the stability of the pairing between the first or
second sequence with a target sequence.
[0427] Usually, the monomers will be selected (selection of the
target sequence may be required as well) such that they form a
pairing in the iRNA agent duplex which has a lower free energy of
dissociation, and a lower Tm, than will be possessed by the paring
of the monomer with its complementary monomer in a duplex between
the iRNA agent sequence and a target RNA duplex.
[0428] The constraint placed upon the monomers can be applied at a
selected site or at more than one selected site. By way of example,
the constraint can be applied at more than 1, but less than 3, 4,
5, 6, or 7 sites in an iRNA agent duplex.
[0429] A constrained or selected site can be present at a number of
positions in the iRNA agent duplex. E.g., a constrained or selected
site can be present within 3, 4, 5, or 6 positions from either end,
3' or 5' of a duplexed sequence. A constrained or selected site can
be present in the middle of the duplex region, e.g., it can be more
than 3, 4, 5, or 6, positions from the end of a duplexed
region.
[0430] In some embodiment the duplex region of the iRNA agent will
have mismatches, in addition to the selected or constrained site or
sites. Preferably it will have no more than 1, 2, 3, 4, or 5 bases,
which do not form canonical Watson-Crick pairs or which do not
hybridize. Overhangs are discussed in detail elsewhere herein but
are preferably about 2 nucleotides in length. The overhangs can be
complementary to the gene sequences being targeted or can be other
sequence. TT is a preferred overhang sequence. The first and second
iRNA agent sequences can also be joined, e.g., by additional bases
to form a hairpin, or by other non-base linkers.
[0431] The monomers can be selected such that: first and second
monomers are naturally occurring ribonucleotides, or modified
ribonucleotides having naturally occurring bases, and when
occupying complementary sites either do not pair and have no
substantial level of H-bonding, or form a non canonical
Watson-Crick pairing and form a non-canonical pattern of H bonding,
which usually have a lower free energy of dissociation than seen in
a canonical Watson-Crick pairing, or otherwise pair to give a free
energy of association which is less than that of a preselected
value or is less, e.g., than that of a canonical pairing. When one
(or both) of the iRNA agent sequences duplexes with a target, the
first (or second) monomer forms a canonical Watson-Crick pairing
with the base in the complementary position on the target, or forms
a non-canonical Watson-Crick pairing having a higher free energy of
dissociation and a higher Tm than seen in the pairing in the iRNA
agent. The classical Watson-Crick parings are as follows: A-T, G-C,
and A-U. Non-canonical Watson-Crick pairings are known in the art
and can include, U-U, G-G, G-A.sub.trans, G-A.sub.cis, and GU.
[0432] The monomer in one or both of the sequences is selected such
that, it does not pair, or forms a pair with its corresponding
monomer in the other sequence which minimizes stability (e.g., the
H bonding formed between the monomer at the selected site in the
one sequence and its monomer at the corresponding site in the other
sequence are less stable than the H bonds formed by the monomer one
(or both) of the sequences with the respective target sequence. The
monomer of one or both strands is also chosen to promote stability
in one or both of the duplexes made by a strand and its target
sequence. E.g., one or more of the monomers and the target
sequences are selected such that at the selected or constrained
position, there is are no H bonds formed, or a non canonical
pairing is formed in the iRNA agent duplex, or they otherwise pair
to give a free energy of association which is less than that of a
preselected value or is less, e.g., than that of a canonical
pairing, but when one (or both) sequences form a duplex with the
respective target, the pairing at the selected or constrained site
is a canonical Watson-Crick paring.
[0433] The inclusion of such a monomer will have one or more of the
following effects: it will destabilize the iRNA agent duplex, it
will destabilize interactions between the sense sequence and
unintended target sequences, sometimes referred to as off-target
sequences, and duplex interactions between the a sequence and the
intended target will not be destabilized.
[0434] A non-naturally occurring or modified monomer or monomers
can be chosen such that when a non-naturally occurring or modified
monomer occupies a position at the selected or constrained position
in an iRNA agent they exhibit a first free energy of dissociation
and when one (or both) of them pairs with a naturally occurring
monomer, the pair exhibits a second free energy of dissociation,
which is usually higher than that of the pairing of the first and
second monomers. E.g., when the first and second monomers occupy
complementary positions they either do not pair and have no
substantial level of H-bonding, or form a weaker bond than one of
them would form with a naturally occurring monomer, and reduce the
stability of that duplex, but when the duplex dissociates at least
one of the strands will form a duplex with a target in which the
selected monomer will promote stability, e.g., the monomer will
form a more stable pair with a naturally occurring monomer in the
target sequence than the pairing it formed in the iRNA agent.
[0435] An example of such a pairing is 2-amino A and either of a
2-thio pyrimidine analog of U or T.
[0436] When placed in complementary positions of the iRNA agent
these monomers will pair very poorly and will minimize stability.
However, a duplex is formed between 2 amino A and the U of a
naturally occurring target, or a duplex is between 2-thio U and the
A of a naturally occurring target or 2-thio T and the A of a
naturally occurring target will have a relatively higher free
energy of dissociation and be more stable.
[0437] The term "other than canonical Watson-Crick pairing" as used
herein, refers to a pairing between a first monomer in a first
sequence and a second monomer at the corresponding position in a
second sequence of a duplex in which one or more of the following
is true: (1) there is essentially no pairing between the two, e.g.,
there is no significant level of H bonding between the monomers or
binding between the monomers does not contribute in any significant
way to the stability of the duplex; (2) the monomers are a
non-canonical paring of monomers having a naturally occurring
bases, i.e., they are other than A-T, A-U, or G-C, and they form
monomer-monomer H bonds, although generally the H bonding pattern
formed is less strong than the bonds formed by a canonical pairing;
or (3) at least one of the monomers includes a non-naturally
occurring bases and the H bonds formed between the monomers is,
preferably formed is less strong than the bonds formed by a
canonical pairing, namely one or more of A-T, A-U, G-C.
[0438] The term "off-target" as used herein, refers to as a
sequence other than the sequence to be silenced.
Universal Bases: "wild-cards"; shape-based complementarity [0439]
Bi-stranded, multisite replication of a base pair between
difluorotoluene and adenine: confirmation by `inverse` sequencing.
Liu, D.; Moran, S.; Kool, E. T. Chem. Biol., 1997, 4, 919-926)
[0439] ##STR00020## [0440] (Importance of terminal base pair
hydrogen-bonding in 3'-end proofreading by the Klenow fragment of
DNA polymerase I. Morales, J. C.; Kool, E. T. Biochemistry, 2000,
39, 2626-2632) [0441] (Selective and stable DNA base pairing
without hydrogen bonds. Matray, T, J.; Kool, E. T. J. Am. Chem.
Soc., 1998, 120, 6191-6192)
[0441] ##STR00021## [0442] (Difluorotoluene, a nonpolar isostere
for thymine, codes specifically and efficiently for adenine in DNA
replication. Moran, S. Ren, R. X.-F.; Rumney IV, S.; Kool, E. T. J.
Am. Chem. Soc., 1997, 119, 2056-2057) [0443] (Structure and base
pairing properties of a replicable nonpolar isostere for
deoxyadenosine. Guckian, K. M.; Morales, J. C.; Kool, E. T. J. Org.
Chem., 1998, 63, 9652-9656)
[0443] ##STR00022## [0444] (Universal bases for hybridization,
replication and chain termination. Berger, M.; Wu. Y.; Ogawa, A.
K.; McMinn, D. L.; Schultz, P. G.; Romesberg, F. E. Nucleic Acids
Res., 2000, 28, 2911-2914)
[0444] ##STR00023## [0445] (1. Efforts toward the expansion of the
genetic alphabet: Information storage and replication with
unnatural hydrophobic base pairs. Ogawa, A. K.; Wu, Y.; McMinn, D.
L.; Liu, J.; Schultz, P. G.; Romesberg, F. E. J. Am. Chem. Soc.,
2000, 122, 3274-3287. 2. Rational design of an unnatural base pair
with increased kinetic selectivity. Ogawa, A. K.; Wu. Y.; Berger,
M.; Schultz, P. G.; Romesberg, F. E. J. Am. Chem. Soc., 2000, 122,
8803-8804)
[0445] ##STR00024## [0446] (Efforts toward expansion of the genetic
alphabet: replication of DNA with three base pairs. Tae, E. L.; Wu,
Y.; Xia, G.; Schultz, P. G.; Romesberg, F. E. J. Am. Chem. Soc.,
2001, 123, 7439-7440)
[0446] ##STR00025## [0447] (1. Efforts toward expansion of the
genetic alphabet: Optimization of interbase hydrophobic
interactions. Wu, Y.; Ogawa, A. K.; Berger, M.; McMinn, D. L.;
Schultz, P. G.; Romesberg, F. E. J. Am. Chem. Soc., 2000, 122,
7621-7632. 2. Efforts toward expansion of genetic alphabet: DNA
polymerase recognition of a highly stable, self-pairing hydrophobic
base. McMinn, D. L.; Ogawa. A. K.; Wu, Y.; Liu, J.; Schultz, P. G.;
Romesberg, F. E. J. Am. Chem. Soc., 1999, 121, 11585-11586) [0448]
(A stable DNA duplex containing a non-hydrogen-bonding and
non-shape complementary base couple: Interstrand stacking as the
stability determining factor. Brotschi, C.; Haberli, A.; Leumann,
C. J. Angew. Chem. Int. Ed., 2001, 40, 3012-3014) [0449]
(2,2'-Bipyridine Ligandoside: A novel building block for modifying
DNA with intra-duplex metal complexes. Weizman, H.; Tor, Y. J. Am.
Chem. Soc., 2001, 123, 3375-3376)
[0449] ##STR00026## [0450] (Minor groove hydration is critical to
the stability of DNA duplexes. Lan, T.; McLaughlin, L. W. J. Am.
Chem. Soc., 2000, 122, 6512-13)
[0450] ##STR00027## [0451] (Effect of the Universal base
3-nitropyrrole on the selectivity of neighboring natural bases.
Oliver, J. S.; Parker, K. A.; Suggs, J. W. Organic Lett., 2001, 3,
1977-1980. 2. Effect of the
1-(2'-deoxy-.beta.-D-ribofuranosyl)-3-nitropyrrol residue on the
stability of DNA duplexes and triplexes. Amosova, O.; George J.;
Fresco, J. R. Nucleic Acids Res., 1997, 25, 1930-1934. 3.
Synthesis, structure and deoxyribonucleic acid sequencing with a
universal nucleosides:
1-(2'-deoxy-.beta.-D-ribofuranosyl)-3-nitropyrrole. Bergstrom, D.
E.; Zhang, P.; Toma, P. H.; Andrews, P. C.; Nichols, R. J. Am.
Chem. Soc., 1995, 117, 1201-1209)
[0451] ##STR00028## [0452] (Model studies directed toward a general
triplex DNA recognition scheme: a novel DNA base that binds a CG
base-pair in an organic solvent. Zimmerman, S. C.; Schmitt, P. J.
Am. Chem. Soc., 1995, 117, 10769-10770)
[0452] ##STR00029## [0453] (A universal, photocleavable DNA base:
nitropiperonyl 2'-deoxyriboside. J. Org. Chem., 2001, 66,
2067-2071)
[0453] ##STR00030## [0454] (Recognition of a single guanine bulge
by 2-acylamino-1,8-naphthyridine. Nakatani, K.; Sando, S.; Saito,
I. J. Am. Chem. Soc., 2000, 122, 2172-2177. b. Specific binding of
2-amino-1,8-naphthyridine into single guanine bulge as evidenced by
photooxidation of GC doublet, Nakatani, K.; Sando, S.; Yoshida, K.;
Saito, I. Bioorg. Med. Chem. Lett., 2001, 11, 335-337)
##STR00031##
[0455] Other universal bases can have the following formulas:
##STR00032## [0456] wherein: [0457] Q is N or CR.sup.44; [0458] Q'
is N or CR.sup.45; [0459] Q'' is N or CR.sup.47; [0460] Q''' is N
or CR.sup.49; [0461] Q.sup.iv is N or CR.sup.50; [0462] R.sup.44 is
hydrogen, halo, hydroxy, nitro, protected hydroxy, NH.sub.2,
NHR.sup.b, or NR.sup.bR.sup.c, C.sub.1-C.sub.6 alkyl,
C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 heteroaryl, C.sub.3-C.sub.8
heterocyclyl, or when taken together with R.sup.45 forms
--OCH.sub.2O--; [0463] R.sup.45 is hydrogen, halo, hydroxy, nitro,
protected hydroxy, NH.sub.2, NHR.sup.b, or NR.sup.bR.sup.c,
C.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10
heteroaryl, C.sub.3-C.sub.8 heterocyclyl, or when taken together
with R.sup.44 or R.sup.46 forms --OCH.sub.2O--; [0464] R.sup.46 is
hydrogen, halo, hydroxy, nitro, protected hydroxy, NH.sub.2,
NHR.sup.b, or NR.sup.bR.sup.c, C.sub.1-C.sub.6 alkyl,
C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 heteroaryl, C.sub.3-C.sub.8
heterocyclyl, or when taken together with R.sup.45 or R.sup.47
forms --OCH.sub.2O--; [0465] R.sup.47 is hydrogen, halo, hydroxy,
nitro, protected hydroxy, NH.sub.2, NHR.sup.b, or NR.sup.bR.sup.c,
C.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10
heteroaryl, C.sub.3-C.sub.8 heterocyclyl, or when taken together
with R.sup.46 or R.sup.48 forms --OCH.sub.2O--; [0466] R.sup.48 is
hydrogen, halo, hydroxy, nitro, protected hydroxy, NH.sub.2,
NHR.sup.b, or NR.sup.bR.sup.c, C.sub.1-C.sub.6 alkyl,
C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 heteroaryl, C.sub.3-C.sub.8
heterocyclyl, or when taken together with R.sup.47 forms
--OCH.sub.2O--; [0467] R.sup.49 R.sup.50, R.sup.51, R.sup.52,
R.sup.53, R.sup.54, R.sup.57, R.sup.58, R.sup.59, R.sup.60,
R.sup.61, R.sup.62, R.sup.63, R.sup.64, R.sup.65, R.sup.66,
R.sup.67, R.sup.68, R.sup.69, R.sup.70, R.sup.71, and R.sup.72 are
each independently selected from hydrogen, halo, hydroxy, nitro,
protected hydroxy, NH.sub.2, NHR.sup.b, or NR.sup.bR.sup.c,
C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkynyl, C.sub.6-C.sub.10
aryl, C.sub.6-C.sub.10 heteroaryl, C.sub.3-C.sub.8 heterocyclyl,
NC(O)R.sup.17, or NC(O)R.sup.o; [0468] R.sup.55 is hydrogen, halo,
hydroxy, nitro, protected hydroxy, NH.sub.2, NHR.sup.b, or
NR.sup.bR.sup.c, C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkynyl,
C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 heteroaryl, C.sub.3-C.sub.8
heterocyclyl, NC(O)R.sup.17, or NC(O)R.sup.o, or when taken
together with R.sup.56 forms a fused aromatic ring which may be
optionally substituted; [0469] R.sup.56 is hydrogen, halo, hydroxy,
nitro, protected hydroxy, NH.sub.2, NHR.sup.b, or NR.sup.bR.sup.c,
C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkynyl, C.sub.6-C.sub.10
aryl, C.sub.6-C.sub.10 heteroaryl, C.sub.3-C.sub.8 heterocyclyl,
NC(O)R.sup.17, or NC(O)R.sup.o, or when taken together with
R.sup.55 forms a fused aromatic ring which may be optionally
substituted; [0470] R.sup.17 is halo, NH.sub.2, NHR.sup.b, or
NR.sup.bR.sup.c; [0471] R.sup.b is C.sub.1-C.sub.6 alkyl or a
nitrogen protecting group; [0472] R.sup.c is C.sub.1-C.sub.6 alkyl;
and [0473] R.sup.o is alkyl optionally substituted with halo,
hydroxy, nitro, protected hydroxy, NH.sub.2, NHR.sup.b, or
NR.sup.bR.sup.c, C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkynyl,
C.sub.6-C.sub.10 aryl, C.sub.6-C.sub.10 heteroaryl, C.sub.3-C.sub.8
heterocyclyl, NC(O)R.sup.17, or NC(O)R.sup.o.
[0474] Examples of universal bases include:
##STR00033## ##STR00034##
[0475] Asymmetrical Modifications
[0476] An RNA, e.g., an mRNA agent, can be asymmetrically modified
as described herein, and as described in International Application
Serial No. PCT/US04/07070, filed Mar. 8, 2004, which is hereby
incorporated by reference.
[0477] In addition, the invention includes iRNA agents having
asymmetrical modifications and another element described herein.
E.g., the invention includes an iRNA agent described herein, e.g.,
a palindromic iRNA agent, an iRNA agent having a non canonical
pairing, an iRNA agent which targets a gene described herein, e.g.,
an SNCA gene, an iRNA agent having an architecture or structure
described herein, an iRNA associated with an amphipathic delivery
agent described herein, an iRNA associated with a drug delivery
module described herein, an iRNA agent administered as described
herein, or an iRNA agent formulated as described herein, which also
incorporates an asymmetrical modification.
[0478] An asymmetrically modified iRNA agent is one in which a
strand has a modification which is not present on the other strand.
An asymmetrical modification is a modification found on one strand
but not on the other strand. Any modification, e.g., any
modification described herein, can be present as an asymmetrical
modification. An asymmetrical modification can confer any of the
desired properties associated with a modification, e.g., those
properties discussed herein. E.g., an asymmetrical modification
can: confer resistance to degradation, an alteration in half life;
target the iRNA agent to a particular target, e.g., to a particular
tissue; modulate, e.g., increase or decrease, the affinity of a
strand for its complement or target sequence; or hinder or promote
modification of a terminal moiety, e.g., modification by a kinase
or other enzymes involved in the RISC mechanism pathway. The
designation of a modification as having one property does not mean
that it has no other property, e.g., a modification referred to as
one which promotes stabilization might also enhance targeting.
[0479] While not wishing to be bound by theory or any particular
mechanistic model, it is believed that asymmetrical modification
allows an iRNA agent to be optimized in view of the different or
"asymmetrical" functions of the sense and antisense strands. For
example, both strands can be modified to increase nuclease
resistance, however, since some changes can inhibit RISC activity,
these changes can be chosen for the sense stand. In addition, since
some modifications, e.g., targeting moieties, can add large bulky
groups that, e.g., can interfere with the cleavage activity of the
RISC complex, such modifications are preferably placed on the sense
strand. Thus, targeting moieties, especially bulky ones (e.g.
cholesterol), are preferentially added to the sense strand. In one
embodiment, an asymmetrical modification in which a phosphate of
the backbone is substituted with S, e.g., a phosphorothioate
modification, is present in the antisense strand, and a 2'
modification, e.g., 2' OMe is present in the sense strand. A
targeting moiety can be present at either (or both) the 5' or 3'
end of the sense strand of the iRNA agent. In a preferred example,
a P of the backbone is replaced with S in the antisense strand,
2'OMe is present in the sense strand, and a targeting moiety is
added to either the 5' or 3' end of the sense strand of the iRNA
agent.
[0480] In a preferred embodiment an asymmetrically modified iRNA
agent has a modification on the sense strand which modification is
not found on the antisense strand and the antisense strand has a
modification which is not found on the sense strand.
[0481] Each strand can include one or more asymmetrical
modifications. By way of example: one strand can include a first
asymmetrical modification which confers a first property on the
iRNA agent and the other strand can have a second asymmetrical
modification which confers a second property on the iRNA. E.g., one
strand, e.g., the sense strand can have a modification which
targets the iRNA agent to a tissue, and the other strand, e.g., the
antisense strand, has a modification which promotes hybridization
with the target gene sequence.
[0482] In some embodiments both strands can be modified to optimize
the same property, e.g., to increase resistance to nucleolytic
degradation, but different modifications are chosen for the sense
and the antisense strands, e.g., because the modifications affect
other properties as well. E.g., since some changes can affect RISC
activity these modifications are chosen for the sense strand.
[0483] In one embodiment, one strand has an asymmetrical 2'
modification, e.g., a 2' OMe modification, and the other strand has
an asymmetrical modification of the phosphate backbone, e.g., a
phosphorothioate modification. So, in one embodiment the antisense
strand has an asymmetrical 2' OMe modification and the sense strand
has an asymmetrical phosphorothioate modification (or vice versa).
In a particularly preferred embodiment, the RNAi agent will have
asymmetrical 2'-O alkyl, preferably, 2'-OMe modifications on the
sense strand and asymmetrical backbone P modification, preferably a
phosphorothioate modification in the antisense strand. There can be
one or multiple 2'-OMe modifications, e.g., at least 2, 3, 4, 5, or
6, of the subunits of the sense strand can be so modified. There
can be one or multiple phosphorothioate modifications, e.g., at
least 2, 3, 4, 5, or 6, of the subunits of the antisense strand can
be so modified. It is preferable to have an iRNA agent wherein
there are multiple 2'-OMe modifications on the sense strand and
multiple phosphorothioate modifications on the antisense strand.
All of the subunits on one or both strands can be so modified. A
particularly preferred embodiment of multiple asymmetric
modifications on both strands has a duplex region about 20-21, and
preferably 19, subunits in length and one or two 3' overhangs of
about 2 subunits in length.
[0484] Asymmetrical modifications are useful for promoting
resistance to degradation by nucleases, e.g., endonucleases. iRNA
agents can include one or more asymmetrical modifications which
promote resistance to degradation. In preferred embodiments the
modification on the antisense strand is one which will not
interfere with silencing of the target, e.g., one which will not
interfere with cleavage of the target. Most if not all sites on a
strand are vulnerable, to some degree, to degradation by
endonucleases. One can determine sites which are relatively
vulnerable and insert asymmetrical modifications which inhibit
degradation. It is often desirable to provide asymmetrical
modification of a UA site in an iRNA agent, and in some cases it is
desirable to provide the UA sequence on both strands with
asymmetrical modification. Examples of modifications which inhibit
endonucleolytic degradation can be found herein. Particularly
favored modifications include: 2' modification, e.g., provision of
a 2' OMe moiety on the U, especially on a sense strand;
modification of the backbone, e.g., with the replacement of an O
with an S, in the phosphate backbone, e.g., the provision of a
phosphorothioate modification, on the U or the A or both,
especially on an antisense strand; replacement of the U with a C5
amino linker; replacement of the A with a G (sequence changes are
preferred to be located on the sense strand and not the antisense
strand); and modification of the at the 2', 6', 7', or 8' position.
Preferred embodiments are those in which one or more of these
modifications are present on the sense but not the antisense
strand, or embodiments where the antisense strand has fewer of such
modifications.
[0485] Asymmetrical modification can be used to inhibit degradation
by exonucleases. Asymmetrical modifications can include those in
which only one strand is modified as well as those in which both
are modified. In preferred embodiments the modification on the
antisense strand is one which will not interfere with silencing of
the target, e.g., one which will not interfere with cleavage of the
target. Some embodiments will have an asymmetrical modification on
the sense strand, e.g., in a 3' overhang, e.g., at the 3' terminus,
and on the antisense strand, e.g., in a 3' overhang, e.g., at the
3' terminus. If the modifications introduce moieties of different
size it is preferable that the larger be on the sense strand. If
the modifications introduce moieties of different charge it is
preferable that the one with greater charge be on the sense
strand.
[0486] Examples of modifications which inhibit exonucleolytic
degradation can be found herein. Particularly favored modifications
include: 2' modification, e.g., provision of a 2' OMe moiety in a
3' overhang, e.g., at the 3' terminus (3' terminus means at the 3'
atom of the molecule or at the most 3' moiety, e.g., the most 3' P
or 2' position, as indicated by the context); modification of the
backbone, e.g., with the replacement of a P with an S, e.g., the
provision of a phosphorothioate modification, or the use of a
methylated P in a 3' overhang, e.g., at the 3' terminus;
combination of a 2' modification, e.g., provision of a 2' OMe
moiety and modification of the backbone, e.g., with the replacement
of a P with an S, e.g., the provision of a phosphorothioate
modification, or the use of a methylated P, in a 3' overhang, e.g.,
at the 3' terminus; modification with a 3' alkyl; modification with
an abasic pyrrolidine in a 3' overhang, e.g., at the 3' terminus;
modification with naproxen, ibuprofen, or other moieties which
inhibit degradation at the 3' terminus. Preferred embodiments are
those in which one or more of these modifications are present on
the sense but not the antisense strand, or embodiments where the
antisense strand has fewer of such modifications.
[0487] Modifications, e.g., those described herein, which affect
targeting can be provided as asymmetrical modifications. Targeting
modifications which can inhibit silencing, e.g., by inhibiting
cleavage of a target, can be provided as asymmetrical modifications
of the sense strand. A biodistribution altering moiety, e.g.,
cholesterol, can be provided in one or more, e.g., two,
asymmetrical modifications of the sense strand. Targeting
modifications which introduce moieties having a relatively large
molecular weight, e.g., a molecular weight of more than 400, 500,
or 1000 daltons, or which introduce a charged moiety (e.g., having
more than one positive charge or one negative charge) can be placed
on the sense strand.
[0488] Modifications, e.g., those described herein, which modulate,
e.g., increase or decrease, the affinity of a strand for its
compliment or target, can be provided as asymmetrical
modifications. These include: 5 methyl U; 5 methyl C;
pseudouridine, Locked nucleic acids include: 2 thio U and
2-amino-A. In some embodiments one or more of these is provided on
the antisense strand.
[0489] iRNA agents have a defined structure, with a sense strand
and an antisense strand, and in many cases short single strand
overhangs, e.g., of 2 or 3 nucleotides are present at one or both
3' ends. Asymmetrical modification can be used to optimize the
activity of such a structure, e.g., by being placed selectively
within the iRNA. E.g., the end region of the iRNA agent defined by
the 5' end of the sense strand and the 3' end of the antisense
strand is important for function. This region can include the
terminal 2, 3, or 4 paired nucleotides and any 3' overhang. In
preferred embodiments asymmetrical modifications which result in
one or more of the following are used: modifications of the 5' end
of the sense strand which inhibit kinase activation of the sense
strand, including, e.g., attachments of conjugates which target the
molecule or the use modifications which protect against 5'
exonucleolytic degradation; or modifications of either strand, but
preferably the sense strand, which enhance binding between the
sense and antisense strand and thereby promote a "tight" structure
at this end of the molecule.
[0490] The end region of the iRNA agent defined by the 3' end of
the sense strand and the 5' end of the antisense strand is also
important for function. This region can include the terminal 2, 3,
or 4 paired nucleotides and any 3' overhang. Preferred embodiments
include asymmetrical modifications of either strand, but preferably
the sense strand, which decrease binding between the sense and
antisense strand and thereby promote an "open" structure at this
end of the molecule. Such modifications include placing conjugates
which target the molecule or modifications which promote nuclease
resistance on the sense strand in this region. Modification of the
antisense strand which inhibit kinase activation are avoided in
preferred embodiments.
[0491] Exemplary modifications for asymmetrical placement in the
sense strand include the following: [0492] (a) backbone
modifications, e.g., modification of a backbone P, including
replacement of P with S, or P substituted with alkyl or allyl,
e.g., Me, and dithioates (S--P.dbd.S); these modifications can be
used to promote nuclease resistance; [0493] (b) 2'-O alkyl, e.g.,
2'-OMe, 3'-O alkyl, e.g., 3'-OMe (at terminal and/or internal
positions); these modifications can be used to promote nuclease
resistance or to enhance binding of the sense to the antisense
strand, the 3' modifications can be used at the 5' end of the sense
strand to avoid sense strand activation by RISC; [0494] (c) 2'-5'
linkages (with 2'-H, 2'-OH and 2'-OMe and with P.dbd.O or P.dbd.S)
these modifications can be used to promote nuclease resistance or
to inhibit binding of the sense to the antisense strand, or can be
used at the 5' end of the sense strand to avoid sense strand
activation by RISC; [0495] (d) L sugars (e.g., L ribose,
L-arabinose with 2'-H, 2'-OH and 2'-OMe); these modifications can
be used to promote nuclease resistance or to inhibit binding of the
sense to the antisense strand, or can be used at the 5' end of the
sense strand to avoid sense strand activation by RISC; [0496] (e)
modified sugars (e.g., locked nucleic acids (LNA's), hexose nucleic
acids (HNA's) and cyclohexene nucleic acids (CeNA's)); these
modifications can be used to promote nuclease resistance or to
inhibit binding of the sense to the antisense strand, or can be
used at the 5' end of the sense strand to avoid sense strand
activation by RISC; [0497] (f) nucleobase modifications (e.g., C-5
modified pyrimidines, N-2 modified purines, N-7 modified purines,
N-6 modified purines), these modifications can be used to promote
nuclease resistance or to enhance binding of the sense to the
antisense strand; [0498] (g) cationic groups and Zwitterionic
groups (preferably at a terminus), these modifications can be used
to promote nuclease resistance; [0499] (h) conjugate groups
(preferably at terminal positions), e.g., naproxen, biotin,
cholesterol, ibuprofen, folic acid, peptides, and carbohydrates;
these modifications can be used to promote nuclease resistance or
to target the molecule, or can be used at the 5' end of the sense
strand to avoid sense strand activation by RISC.
[0500] Exemplary modifications for asymmetrical placement in the
antisense strand include the following: [0501] (a) backbone
modifications, e.g., modification of a backbone P, including
replacement of P with S, or P substituted with alkyl or allyl,
e.g., Me, and dithioates (S--P.dbd.S); [0502] (b) 2'-O alkyl, e.g.,
2'-OMe, (at terminal positions); [0503] (c) 2'-5' linkages (with
2'-H, 2'-OH and 2'-OMe) e.g., terminal at the 3' end); e.g., with
P.dbd.O or P.dbd.S preferably at the 3'-end, these modifications
are preferably excluded from the 5' end region as they may
interfere with RISC enzyme activity such as kinase activity; [0504]
(d) L sugars (e.g., L ribose, L-arabinose with 2'-H, 2'-OH and
2'-OMe); e.g., terminal at the 3' end; e.g., with P.dbd.O or
P.dbd.S preferably at the 3'-end, these modifications are
preferably excluded from the 5' end region as they may interfere
with kinase activity; [0505] (e) modified sugars (e.g., LNA's,
HNA's and CeNA's); these modifications are preferably excluded from
the 5' end region as they may contribute to unwanted enhancements
of paring between the sense and antisense strands, it is often
preferred to have a "loose" structure in the 5' region,
additionally, they may interfere with kinase activity; [0506] (f)
nucleobase modifications (e.g., C-5 modified pyrimidines, N-2
modified purines, N-7 modified purines, N-6 modified purines);
[0507] (g) cationic groups and Zwitterionic groups (preferably at a
terminus); [0508] cationic groups and Zwitterionic groups at
2'-position of sugar; 3'-position of the sugar; as nucleobase
modifications (e.g., C-5 modified pyrimidines, N-2 modified
purines, N-7 modified purines, N-6 modified purines); [0509]
conjugate groups (preferably at terminal positions), e.g.,
naproxen, biotin, cholesterol, ibuprofen, folic acid, peptides, and
carbohydrates, but bulky groups or generally groups which inhibit
RISC activity should are less preferred.
[0510] The 5'-OH of the antisense strand should be kept free to
promote activity. In some preferred embodiments modifications that
promote nuclease resistance should be included at the 3' end,
particularly in the 3' overhang.
[0511] In another aspect, the invention features a method of
optimizing, e.g., stabilizing, an iRNA agent. The method includes
selecting a sequence having activity, introducing one or more
asymmetric modifications into the sequence, wherein the
introduction of the asymmetric modification optimizes a property of
the iRNA agent but does not result in a decrease in activity.
[0512] The decrease in activity can be less than a preselected
level of decrease. In preferred embodiments decrease in activity
means a decrease of less than 5, 10, 20, 40, or 50% activity, as
compared with an otherwise similar iRNA lacking the introduced
modification. Activity can, e.g., be measured in vivo, or in vitro,
with a result in either being sufficient to demonstrate the
required maintenance of activity.
[0513] The optimized property can be any property described herein
and in particular the properties discussed in the section on
asymmetrical modifications provided herein. The modification can be
any asymmetrical modification, e.g., an asymmetric modification
described in the section on asymmetrical modifications described
herein. Particularly preferred asymmetric modifications are 2'-O
alkyl modifications, e.g., 2'-OMe modifications, particularly in
the sense sequence, and modifications of a backbone O, particularly
phosphorothioate modifications, in the antisense sequence.
[0514] In a preferred embodiment a sense sequence is selected and
provided with an asymmetrical modification, while in other
embodiments an antisense sequence is selected and provided with an
asymmetrical modification. In some embodiments both sense and
antisense sequences are selected and each provided with one or more
asymmetrical modifications.
[0515] Multiple asymmetric modifications can be introduced into
either or both of the sense and antisense sequence. A sequence can
have at least 2, 4, 6, 8, or more modifications and all or
substantially all of the monomers of a sequence can be
modified.
[0516] Z--X--Y Architecture
[0517] An RNA, e.g., an iRNA agent, can have a Z--X--Y architecture
or structure such as those described herein. In addition, an iRNA
agent can have a Z--X--Y structure and another element described
herein. E.g., the invention includes an iRNA agent described
herein, e.g., a palindromic iRNA agent, an iRNA agent having a non
canonical pairing, an iRNA agent which targets a gene described
herein, e.g., an SNCA gene, an iRNA associated with an amphipathic
delivery agent described herein, an iRNA associated with a drug
delivery module described herein, an iRNA agent administered as
described herein, or an iRNA agent formulated as described herein,
which also incorporates a Z--X--Y architecture.
[0518] Thus, an iRNA agent can have a first segment, the Z region,
a second segment, the X region, and optionally a third region, the
Y region:
Z--X--Y.
[0519] It may be desirable to modify subunits in one or both of Z
and/or Y on one hand and X on the other hand. In some cases they
will have the same modification or the same class of modification
but it will more often be the case that the modifications made in Z
and/or Y will differ from those made in X.
[0520] The Z region typically includes a terminus of an iRNA agent.
The length of the Z region can vary, but will typically be from
2-14, more preferably 2-10, subunits in length. It typically is
single stranded, i.e., it will not base pair with bases of another
strand, though it may in some embodiments self associate, e.g., to
form a loop structure. Such structures can be formed by the end of
a strand looping back and forming an intrastrand duplex. E.g., 2,
3, 4, 5 or more intra-strand bases pairs can form, having a looped
out or connecting region, typically of 2 or more subunits which do
not pair. This can occur at one or both ends of a strand. A typical
embodiment of a Z region is a single strand overhang, e.g., an over
hang of the length described elsewhere herein. The Z region can
thus be or include a 3' or 5' terminal single strand. It can be
sense or antisense strand but if it is antisense it is preferred
that it is a 3-overhang. Typical inter-subunit bonds in the Z
region include: P.dbd.O; P.dbd.S; S--P.dbd.S; P--NR.sub.2; and
P--BR.sub.2. Chiral P.dbd.X, where X is S, N, or B) inter-subunit
bonds can also be present. Other preferred Z region subunit
modifications (also discussed elsewhere herein) can include: 3'-OR,
3'SR, 2'-OMe, 3'-OMe, and 2'OH modifications and moieties; alpha
configuration bases; and 2' arabino modifications.
[0521] The X region will in most cases be duplexed, in the case of
a single strand iRNA agent, with a corresponding region of the
single strand, or in the case of a double stranded iRNA agent, with
the corresponding region of the other strand. The length of the X
region can vary but will typically be between 10-45 and more
preferably between 15 and 35 subunits. Particularly preferred
region X' s will include 17, 18, 19, 29, 21, 22, 23, 24, or 25
nucleotide pairs, though other suitable lengths are described
elsewhere herein and can be used. Typical X region subunits include
2'-OH subunits. In typical embodiments phosphate inter-subunit
bonds are preferred while phosphorothioate or non-phosphate bonds
are absent. Other modifications preferred in the X region include:
modifications to improve binding, e.g., nucleobase modifications;
cationic nucleobase modifications; and C-5 modified pyrimidines,
e.g., allylamines. Some embodiments have 4 or more consecutive 2'OH
subunits. While the use of phosphorothioate is sometimes non
preferred they can be used if they connect less than 4 consecutive
2'OH subunits.
[0522] The Y region will generally conform to the parameters set
out for the Z regions. However, the X and Z regions need not be the
same, different types and numbers of modifications can be present,
and in fact, one will usually be a 3' overhang and one will usually
be a 5' overhang.
[0523] In a preferred embodiment the iRNA agent will have a Y
and/or Z region each having ribonucleosides in which the 2'-OH is
substituted, e.g., with 2'-OMe or other alkyl; and an X region that
includes at least four consecutive ribonucleoside subunits in which
the 2'-OH remains unsubstituted.
[0524] The subunit linkages (the linkages between subunits) of an
iRNA agent can be modified, e.g., to promote resistance to
degradation. Numerous examples of such modifications are disclosed
herein, one example of which is the phosphorothioate linkage. These
modifications can be provided between the subunits of any of the
regions, Y, X, and Z. However, it is preferred that their
occurrence is minimized and in particular it is preferred that
consecutive modified linkages be avoided.
[0525] In a preferred embodiment the iRNA agent will have a Y and Z
region each having ribonucleosides in which the 2'-OH is
substituted, e.g., with 2'-OMe; and an X region that includes at
least four consecutive subunits, e.g., ribonucleoside subunits in
which the 2'-OH remains unsubstituted.
[0526] As mentioned above, the subunit linkages of an iRNA agent
can be modified, e.g., to promote resistance to degradation. These
modifications can be provided between the subunits of any of the
regions, Y, X, and Z. However, it is preferred that they are
minimized and in particular it is preferred that consecutive
modified linkages be avoided.
[0527] Thus, in a preferred embodiment, not all of the subunit
linkages of the iRNA agent are modified and more preferably the
maximum number of consecutive subunits linked by other than a
phosphodiester bond will be 2, 3, or 4. Particularly preferred iRNA
agents will not have four or more consecutive subunits, e.g.,
2'-hydroxyl ribonucleoside subunits, in which each subunit is
joined by modified linkages--i.e. linkages that have been modified
to stabilize them from degradation as compared to the
phosphodiester linkages that naturally occur in RNA and DNA.
[0528] It is particularly preferred to minimize the occurrence in
region X. Thus, in preferred embodiments each of the nucleoside
subunit linkages in X will be phosphodiester linkages, or if
subunit linkages in region X are modified, such modifications will
be minimized. E.g., although the Y and/or Z regions can include
inter subunit linkages which have been stabilized against
degradation, such modifications will be minimized in the X region,
and in particular consecutive modifications will be minimized.
Thus, in preferred embodiments the maximum number of consecutive
subunits linked by other than a phosphodiester bond will be 2, 3,
or 4. Particularly preferred X regions will not have four or more
consecutive subunits, e.g., 2'-hydroxyl ribonucleoside subunits, in
which each subunits is joined by modified linkages--i.e., linkages
that have been modified to stabilize them from degradation as
compared to the phosphodiester linkages that naturally occur in RNA
and DNA.
[0529] In a preferred embodiment Y and/or Z will be free of
phosphorothioate linkages, though either or both may contain other
modifications, e.g., other modifications of the subunit
linkages.
[0530] In a preferred embodiment, region X, or in some cases, the
entire iRNA agent, has no more than 3 or no more than 4 subunits
having identical 2' moieties.
[0531] In a preferred embodiment, region X, or in some cases, the
entire iRNA agent, has no more than 3 or no more than 4 subunits
having identical subunit linkages.
[0532] In a preferred embodiment, one or more phosphorothioate
linkages (or other modifications of the subunit linkage) are
present in Y and/or Z, but such modified linkages do not connect
two adjacent subunits, e.g., nucleosides, having a 2' modification,
e.g., a 2'-O-alkyl moiety. E.g., any adjacent 2'-O-alkyl moieties
in the Y and/or Z, are connected by a linkage other than a
phosphorothioate linkage.
[0533] In a preferred embodiment, each of Y and/or Z independently
has only one phosphorothioate linkage between adjacent subunits,
e.g., nucleosides, having a 2' modification, e.g., 2'-O-alkyl
nucleosides. If there is a second set of adjacent subunits, e.g.,
nucleosides, having a 2' modification, e.g., 2'-O-alkyl
nucleosides, in Y and/or Z that second set is connected by a
linkage other than a phosphorothioate linkage, e.g., a modified
linkage other than a phosphorothioate linkage.
[0534] In a preferred embodiment, each of Y and/or Z independently
has more than one phosphorothioate linkage connecting adjacent
pairs of subunits, e.g., nucleosides, having a 2' modification,
e.g., 2'-O-alkyl nucleosides, but at least one pair of adjacent
subunits, e.g., nucleosides, having a 2' modification, e.g.,
2'-O-alkyl nucleosides, are be connected by a linkage other than a
phosphorothioate linkage, e.g., a modified linkage other than a
phosphorothioate linkage.
[0535] In a preferred embodiment one of the above recited
limitation on adjacent subunits in Y and or Z is combined with a
limitation on the subunits in X. E.g., one or more phosphorothioate
linkages (or other modifications of the subunit linkage) are
present in Y and/or Z, but such modified linkages do not connect
two adjacent subunits, e.g., nucleosides, having a 2' modification,
e.g., a 2'-O-alkyl moiety. E.g., any adjacent 2'-O-alkyl moieties
in the Y and/or Z, are connected by a linkage other than a
phosphorothioate linkage. In addition, the X region has no more
than 3 or no more than 4 identical subunits, e.g., subunits having
identical 2' moieties or the X region has no more than 3 or no more
than 4 subunits having identical subunit linkages.
[0536] A Y and/or Z region can include at least one, and preferably
2, 3 or 4 of a modification disclosed herein. Such modifications
can be chosen, independently, from any modification described
herein, e.g., from nuclease resistant subunits, subunits with
modified bases, subunits with modified intersubunit linkages,
subunits with modified sugars, and subunits linked to another
moiety, e.g., a targeting moiety. In a preferred embodiment more
than 1 of such subunit can be present but in some embodiments it is
preferred that no more than 1, 2, 3, or 4 of such modifications
occur, or occur consecutively. In a preferred embodiment the
frequency of the modification will differ between Y and/or Z and X,
e.g., the modification will be present one of Y and/or Z or X and
absent in the other.
[0537] An X region can include at least one, and preferably 2, 3 or
4 of a modification disclosed herein. Such modifications can be
chosen, independently, from any modification described herein,
e.g., from nuclease resistant subunits, subunits with modified
bases, subunits with modified intersubunit linkages, subunits with
modified sugars, and subunits linked to another moiety, e.g., a
targeting moiety. In a preferred embodiment more than 1 of such
subunits can b present but in some embodiments it is preferred that
no more than 1, 2, 3, or 4 of such modifications occur, or occur
consecutively.
[0538] An RRMS (described elsewhere herein) can be introduced at
one or more points in one or both strands of a double-stranded iRNA
agent. An RRMS can be placed in a Y and/or Z region, at or near
(within 1, 2, or 3 positions) of the 3' or 5' end of the sense
strand or at near (within 2 or 3 positions of) the 3' end of the
antisense strand. In some embodiments it is preferred to not have
an RRMS at or near (within 1, 2, or 3 positions of) the 5' end of
the antisense strand. An RRMS can be positioned in the X region,
and will preferably be positioned in the sense strand or in an area
of the antisense strand not critical for antisense binding to the
target.
Differential Modification of Terminal Duplex Stability
[0539] In one aspect, the invention features an mRNA agent which
can have differential modification of terminal duplex stability
(DMTDS).
[0540] In addition, the invention includes iRNA agents having DMTDS
and another element described herein. E.g., the invention includes
an iRNA agent described herein, e.g., a palindromic iRNA agent, an
iRNA agent having a non canonical pairing, an iRNA agent which
targets a gene described herein, e.g., an SNCA gene, an iRNA agent
having an architecture or structure described herein, an iRNA
associated with an amphipathic delivery agent described herein, an
iRNA associated with a drug delivery module described herein, an
iRNA agent administered as described herein, or an iRNA agent
formulated as described herein, which also incorporates DMTDS.
[0541] iRNA agents can be optimized by increasing the propensity of
the duplex to disassociate or melt (decreasing the free energy of
duplex association), in the region of the 5' end of the antisense
strand duplex. This can be accomplished, e.g., by the inclusion of
subunits, which increase the propensity of the duplex to
disassociate or melt in the region of the 5' end of the antisense
strand. This can also be accomplished by the attachment of a ligand
that increases the propensity of the duplex to disassociate of melt
in the region of the 5' end. While not wishing to be bound by
theory, the effect may be due to promoting the effect of an enzyme
such as a helicase, for example, promoting the effect of the enzyme
in the proximity of the 5' end of the antisense strand.
[0542] The inventors have also discovered that iRNA agents can be
optimized by decreasing the propensity of the duplex to
disassociate or melt (increasing the free energy of duplex
association), in the region of the 3' end of the antisense strand
duplex. This can be accomplished, e.g., by the inclusion of
subunits which decrease the propensity of the duplex to
disassociate or melt in the region of the 3' end of the antisense
strand. It can also be accomplished by the attachment of ligand
that decreases the propensity of the duplex to disassociate or melt
in the region of the 5' end.
[0543] Modifications which increase the tendency of the 5' end of
the duplex to dissociate can be used alone or in combination with
other modifications described herein, e.g., with modifications
which decrease the tendency of the 3' end of the duplex to
dissociate. Likewise, modifications which decrease the tendency of
the 3' end of the duplex to dissociate can be used alone or in
combination with other modifications described herein, e.g., with
modifications which increase the tendency of the 5' end of the
duplex to dissociate.
Decreasing the Stability of the AS 5' End of the Duplex
[0544] Subunit pairs can be ranked on the basis of their propensity
to promote dissociation or melting (e.g., on the free energy of
association or dissociation of a particular pairing, the simplest
approach is to examine the pairs on an individual pair basis,
though next neighbor or similar analysis can also be used). In
terms of promoting dissociation: [0545] A:U is preferred over G:C;
[0546] G:U is preferred over G:C; [0547] I:C is preferred over G:C
(I=inosine); [0548] mismatches, e.g., non-canonical or other than
canonical pairings (as described elsewhere herein) are preferred
over canonical (A:T, A:U, G:C) pairings; [0549] pairings which
include a universal base are preferred over canonical pairings.
[0550] A typical ds iRNA agent can be diagrammed as follows:
TABLE-US-00002 S 5' R.sub.1 N.sub.1 N.sub.2 N.sub.3 N.sub.4 N.sub.5
[N] N.sub.-5 N.sub.-4 N.sub.-3 N.sub.-2 N.sub.-1 R.sub.2 3' AS 3'
R.sub.3 N.sub.1 N.sub.2 N.sub.3 N.sub.4 N.sub.5 [N] N.sub.-5
N.sub.-4 N.sub.-3 N.sub.-2 N.sub.-1 R.sub.4 5' S: AS P.sub.1
P.sub.2 P.sub.3 P.sub.4 P.sub.5 [N] P.sub.-5 P.sub.-4 P.sub.-3
P.sub.-2 P.sub.-1 5'
[0551] S indicates the sense strand; AS indicates antisense strand;
R.sub.1 indicates an optional (and nonpreferred) 5' sense strand
overhang; R.sub.2 indicates an optional (though preferred) 3' sense
overhang; R.sub.3 indicates an optional (though preferred) 3'
antisense sense overhang; R.sub.4 indicates an optional (and
nonpreferred) 5' antisense overhang; N indicates subunits; [N]
indicates that additional subunit pairs may be present; and
P.sub.x, indicates a paring of sense N.sub.x and antisense N.sub.x.
Overhangs are not shown in the P diagram. In some embodiments a 3'
AS overhang corresponds to region Z, the duplex region corresponds
to region X, and the 3' S strand overhang corresponds to region Y,
as described elsewhere herein. (The diagram is not meant to imply
maximum or minimum lengths, on which guidance is provided elsewhere
herein.)
[0552] It is preferred that pairings which decrease the propensity
to form a duplex are used at 1 or more of the positions in the
duplex at the 5' end of the AS strand. The terminal pair (the most
5' pair in terms of the AS strand) is designated as P.sub.-1, and
the subsequent pairing positions (going in the 3' direction in
terms of the AS strand) in the duplex are designated, P.sub.-2,
P.sub.-3, P.sub.-4, P.sub.-5, and so on. The preferred region in
which to modify or modulate duplex formation is at P.sub.-5 through
P.sub.-1, more preferably P.sub.-4 through P.sub.-1, more
preferably P.sub.-3 through P.sub.-1. Modification at P.sub.-1, is
particularly preferred, alone or with modification(s) other
position(s), e.g., any of the positions just identified. It is
preferred that at least 1, and more preferably 2, 3, 4, or 5 of the
pairs of one of the recited regions be chosen independently from
the group of: [0553] A:U [0554] G:U [0555] I:C [0556] mismatched
pairs, e.g., non-canonical or other than canonical pairings or
pairings which include a universal base.
[0557] In preferred embodiments the change in subunit needed to
achieve a pairing which promotes dissociation will be made in the
sense strand, though in some embodiments the change will be made in
the antisense strand.
[0558] In a preferred embodiment the at least 2, or 3, of the pairs
in P.sub.-1, through P.sub.-4, are pairs which promote
dissociation.
[0559] In a preferred embodiment the at least 2, or 3, of the pairs
in P.sub.-1, through P.sub.-4, are A:U.
[0560] In a preferred embodiment the at least 2, or 3, of the pairs
in P.sub.-1, through P.sub.-4, are G:U.
[0561] In a preferred embodiment the at least 2, or 3, of the pairs
in P.sub.-1, through P.sub.-4, are I:C.
[0562] In a preferred embodiment the at least 2, or 3, of the pairs
in P.sub.-1, through P.sub.-4, are mismatched pairs, e.g.,
non-canonical or other than canonical pairings pairings.
[0563] In a preferred embodiment the at least 2, or 3, of the pairs
in P.sub.-1, through P.sub.-4, are pairings which include a
universal base.
Increasing the Stability of the AS 3' End of the Duplex
[0564] Subunit pairs can be ranked on the basis of their propensity
to promote stability and inhibit dissociation or melting (e.g., on
the free energy of association or dissociation of a particular
pairing, the simplest approach is to examine the pairs on an
individual pair basis, though next neighbor or similar analysis can
also be used). In terms of promoting duplex stability: [0565] G:C
is preferred over A:U [0566] Watson-Crick matches (A:T, A:U, G:C)
are preferred over non-canonical or other than canonical pairings
[0567] analogs that increase stability are preferred over
Watson-Crick matches (A:T, A:U, G:C) [0568] 2-amino-A:U is
preferred over A:U [0569] 2-thio U or 5 Me-thio-U:A are preferred
over U:A [0570] G-clamp (an analog of C having 4 hydrogen bonds):G
is preferred over C:G [0571] guanadinium-G-clamp:G is preferred
over C:G [0572] pseudo uridine:A is preferred over U:A [0573] sugar
modifications, e.g., 2' modifications, e.g., 2'F, ENA, or LNA,
which enhance binding are preferred over non-modified moieties and
can be present on one or both strands to enhance stability of the
duplex. It is preferred that pairings which increase the propensity
to form a duplex are used at 1 or more of the positions in the
duplex at the 3' end of the AS strand. The terminal pair (the most
3' pair in terms of the AS strand) is designated as P.sub.1, and
the subsequent pairing positions (going in the 5' direction in
terms of the AS strand) in the duplex are designated, P.sub.2,
P.sub.3, P.sub.4, P.sub.5, and so on. The preferred region in which
to modify to modulate duplex formation is at P.sub.5 through
P.sub.1, more preferably P.sub.4 through P.sub.1, more preferably
P.sub.3 through P.sub.1. Modification at P.sub.1, is particularly
preferred, alone or with modification(s) at other position(s),
e.g., any of the positions just identified. It is preferred that at
least 1, and more preferably 2, 3, 4, or 5 of the pairs of the
recited regions be chosen independently from the group of: [0574]
G:C [0575] a pair having an analog that increases stability over
Watson-Crick matches (A:T, A:U, G:C) [0576] 2-amino-A:U [0577]
2-thio U or 5 Me-thio-U:A [0578] G-clamp (an analog of C having 4
hydrogen bonds):G [0579] guanadinium-G-clamp:G [0580] pseudo
uridine:A [0581] a pair in which one or both subunits has a sugar
modification, e.g., a 2' modification, e.g., 2'F, ENA, or LNA,
which enhance binding.
[0582] In a preferred embodiment the at least 2, or 3, of the pairs
in P.sub.-1, through P.sub.-4, are pairs which promote duplex
stability.
[0583] In a preferred embodiment the at least 2, or 3, of the pairs
in P.sub.1, through P.sub.4, are G:C.
[0584] In a preferred embodiment the at least 2, or 3, of the pairs
in P.sub.1, through P.sub.4, are a pair having an analog that
increases stability over Watson-Crick matches.
[0585] In a preferred embodiment the at least 2, or 3, of the pairs
in P.sub.1, through P.sub.4, are 2-amino-A:U.
[0586] In a preferred embodiment the at least 2, or 3, of the pairs
in P.sub.1, through P.sub.4, are 2-thio U or 5 Me-thio-U:A.
[0587] In a preferred embodiment the at least 2, or 3, of the pairs
in P.sub.1, through P.sub.4, are G-clamp:G.
[0588] In a preferred embodiment the at least 2, or 3, of the pairs
in P.sub.1, through P.sub.4, are guanidinium-G-clamp:G.
[0589] In a preferred embodiment the at least 2, or 3, of the pairs
in P.sub.1, through P.sub.4, are pseudo uridine:A.
[0590] In a preferred embodiment the at least 2, or 3, of the pairs
in P.sub.1, through P.sub.4, are a pair in which one or both
subunits has a sugar modification, e.g., a 2' modification, e.g.,
2'F, ENA, or LNA, which enhances binding.
[0591] G-clamps and guanidinium G-clamps are discussed in the
following references: Holmes and Gait, "The Synthesis of
2'-O-Methyl G-Clamp Containing Oligonucleotides and Their
Inhibition of the HIV-1 Tat-TAR Interaction," Nucleosides,
Nucleotides & Nucleic Acids, 22:1259-1262, 2003; Holmes et al.,
"Steric inhibition of human immunodeficiency virus type-1
Tat-dependent trans-activation in vitro and in cells by
oligonucleotides containing 2'-O-methyl G-clamp ribonucleoside
analogues," Nucleic Acids Research, 31:2759-2768, 2003; Wilds, et
al., "Structural basis for recognition of guanosine by a synthetic
tricyclic cytosine analogue: Guanidinium G-clamp," Helvetica
Chimica Acta, 86:966-978, 2003; Rajeev, et al., "High-Affinity
Peptide Nucleic Acid Oligomers Containing Tricyclic Cytosine
Analogues," Organic Letters, 4:4395-4398, 2002; Ausin, et al.,
"Synthesis of Amino- and Guanidino-G-Clamp PNA Monomers," Organic
Letters, 4:4073-4075, 2002; Maier et al., "Nuclease resistance of
oligonucleotides containing the tricyclic cytosine analogues
phenoxazine and 9-(2-aminoethoxy)-phenoxazine ("G-clamp") and
origins of their nuclease resistance properties," Biochemistry,
41:1323-7, 2002; Flanagan, et al., "A cytosine analog that confers
enhanced potency to antisense oligonucleotides," Proceedings Of The
National Academy Of Sciences Of The United States Of America,
96:3513-8, 1999.
[0592] Simultaneously Decreasing the Stability of the AS 5' End of
the Duplex and Increasing the Stability of the AS 3' End of the
Duplex
[0593] As is discussed above, an iRNA agent can be modified to both
decrease the stability of the AS 5' end of the duplex and increase
the stability of the AS 3' end of the duplex. This can be effected
by combining one or more of the stability decreasing modifications
in the AS 5' end of the duplex with one or more of the stability
increasing modifications in the AS 3' end of the duplex.
Accordingly a preferred embodiment includes modification in
P.sub.-5 through P.sub.-1, more preferably P.sub.-4 through
P.sub.-1 and more preferably P.sub.-3 through P.sub.-1.
Modification at P.sub.-1, is particularly preferred, alone or with
other position, e.g., the positions just identified. It is
preferred that at least 1, and more preferably 2, 3, 4, or 5 of the
pairs of one of the recited regions of the AS 5' end of the duplex
region be chosen independently from the group of: [0594] A:U [0595]
G:U [0596] I:C [0597] mismatched pairs, e.g., non-canonical or
other than canonical pairings which include a universal base; and
[0598] a modification in P.sub.5 through P.sub.1, more preferably
P.sub.4 through P.sub.1 and more preferably P.sub.3 through
P.sub.1. Modification at P.sub.1, is particularly preferred, alone
or with other position, e.g., the positions just identified. It is
preferred that at least 1, and more preferably 2, 3, 4, or 5 of the
pairs of one of the recited regions of the AS 3' end of the duplex
region be chosen independently from the group of: [0599] G:C [0600]
a pair having an analog that increases stability over Watson-Crick
matches (A:T, A:U, G:C) [0601] 2-amino-A:U [0602] 2-thio U or 5
Me-thio-U:A [0603] G-clamp (an analog of C having 4 hydrogen
bonds):G [0604] guanadinium-G-clamp:G [0605] pseudo uridine:A
[0606] a pair in which one or both subunits has a sugar
modification, e.g., a 2' modification, e.g., 2'F, ENA, or LNA,
which enhance binding.
[0607] The invention also includes methods of selecting and making
iRNA agents having DMTDS. E.g., when screening a target sequence
for candidate sequences for use as iRNA agents one can select
sequences having a DMTDS property described herein or one which can
be modified, preferably with as few changes as possible, especially
to the AS strand, to provide a desired level of DMTDS.
[0608] The invention also includes, providing a candidate iRNA
agent sequence, and modifying at least one P in P.sub.-5 through
P.sub.-1 and/or at least one P in P.sub.5 through P.sub.1 to
provide a DMTDS iRNA agent.
[0609] DMTDS iRNA agents can be used in any method described
herein, e.g., to silence an SNCA RNA, to treat any disorder
described herein, e.g., a neurodegenerative disorder, in any
formulation described herein, and generally in and/or with the
methods and compositions described elsewhere herein. DMTDS iRNA
agents can incorporate other modifications described herein, e.g.,
the attachment of targeting agents or the inclusion of
modifications which enhance stability, e.g., the inclusion of
nuclease resistant monomers or the inclusion of single strand
overhangs (e.g., 3' AS overhangs and/or 3' S strand overhangs)
which self associate to form intrastrand duplex structure.
[0610] Preferably these iRNA agents will have an architecture
described herein.
Other Embodiments
[0611] An RNA, e.g., an iRNA agent, can be produced in a cell in
vivo, e.g., from exogenous DNA templates that are delivered into
the cell. For example, the DNA templates can be inserted into
vectors and used as gene therapy vectors. Gene therapy vectors can
be delivered to a subject by, for example, intravenous injection,
local administration (U.S. Pat. No. 5,328,470), or by stereotactic
injection (see, e.g., Chen et al., Proc. Natl. Acad. Sci. USA
91:3054-3057, 1994). The pharmaceutical preparation of the gene
therapy vector can include the gene therapy vector in an acceptable
diluent, or can comprise a slow release matrix in which the gene
delivery vehicle is imbedded. The DNA templates, for example, can
include two transcription units, one that produces a transcript
that includes the top strand of an iRNA agent and one that produces
a transcript that includes the bottom strand of an iRNA agent. When
the templates are transcribed, the iRNA agent is produced, and
processed into sRNA agent fragments that mediate gene
silencing.
[0612] In Vivo Delivery
[0613] An iRNA agent can be linked, e.g., noncovalently linked to a
polymer for the efficient delivery of the iRNA agent to a subject,
e.g., a mammal, such as a human. The iRNA agent can, for example,
be complexed with cyclodextrin. Cyclodextrins have been used as
delivery vehicles of therapeutic compounds. Cyclodextrins can form
inclusion complexes with drugs that are able to fit into the
hydrophobic cavity of the cyclodextrin. In other examples,
cyclodextrins form non-covalent associations with other
biologically active molecules such as oligonucleotides and
derivatives thereof. The use of cyclodextrins creates a
water-soluble drug delivery complex, that can be modified with
targeting or other functional groups. Cyclodextrin cellular
delivery system for oligonucleotides described in U.S. Pat. No.
5,691,316, which is hereby incorporated by reference, are suitable
for use in methods of the invention. In this system, an
oligonucleotide is noncovalently complexed with a cyclodextrin, or
the oligonucleotide is covalently bound to adamantine which in turn
is non-covalently associated with a cyclodextrin.
[0614] The delivery molecule can include a linear cyclodextrin
copolymer or a linear oxidized cyclodextrin copolymer having at
least one ligand bound to the cyclodextrin copolymer. Delivery
systems, as described in U.S. Pat. No. 6,509,323, herein
incorporated by reference, are suitable for use in methods of the
invention. An iRNA agent can be bound to the linear cyclodextrin
copolymer and/or a linear oxidized cyclodextrin copolymer. Either
or both of the cyclodextrin or oxidized cyclodextrin copolymers can
be crosslinked to another polymer and/or bound to a ligand.
[0615] A composition for iRNA delivery can employ an "inclusion
complex," a molecular compound having the characteristic structure
of an adduct. In this structure, the "host molecule" spatially
encloses at least part of another compound in the delivery vehicle.
The enclosed compound (the "guest molecule") is situated in the
cavity of the host molecule without affecting the framework
structure of the host. A "host" is preferably cyclodextrin, but can
be any of the molecules suggested in U.S. Patent Publ.
2003/0008818, herein incorporated by reference.
[0616] Cyclodextrins can interact with a variety of ionic and
molecular species, and the resulting inclusion compounds belong to
the class of "host-guest" complexes. Within the host-guest
relationship, the binding sites of the host and guest molecules
should be complementary in the stereoelectronic sense. A
composition of the invention can contain at least one polymer and
at least one therapeutic agent, generally in the form of a
particulate composite of the polymer and therapeutic agent, e.g.,
the iRNA agent. The iRNA agent can contain one or more complexing
agents. At least one polymer of the particulate composite can
interact with the complexing agent in a host-guest or a guest-host
interaction to form an inclusion complex between the polymer and
the complexing agent. The polymer and, more particularly, the
complexing agent can be used to introduce functionality into the
composition. For example, at least one polymer of the particulate
composite has host functionality and forms an inclusion complex
with a complexing agent having guest functionality. Alternatively,
at least one polymer of the particulate composite has guest
functionality and forms an inclusion complex with a complexing
agent having host functionality. A polymer of the particulate
composite can also contain both host and guest functionalities and
form inclusion complexes with guest complexing agents and host
complexing agents. A polymer with functionality can, for example,
facilitate cell targeting and/or cell contact (e.g., targeting or
contact to a neural cell), intercellular trafficking, and/or cell
entry and release.
[0617] Upon forming the particulate composite, the iRNA agent may
or may not retain its biological or therapeutic activity. Upon
release from the therapeutic composition, specifically, from the
polymer of the particulate composite, the activity of the iRNA
agent is restored. Accordingly, the particulate composite
advantageously affords the iRNA agent protection against loss of
activity due to, for example, degradation and offers enhanced
bioavailability. Thus, a composition may be used to provide
stability, particularly storage or solution stability, to an iRNA
agent or any active chemical compound. The iRNA agent may be
further modified with a ligand prior to or after particulate
composite or therapeutic composition formation. The ligand can
provide further functionality. For example, the ligand can be a
targeting moiety.
[0618] Physiological Effects
[0619] The iRNA agents described herein can be designed such that
determining therapeutic toxicity is made easier by the
complementarity of the iRNA agent with both a human and a non-human
animal sequence. By these methods, an iRNA agent can consist of a
sequence that is fully complementary to a nucleic acid sequence
from a human and a nucleic acid sequence from at least one
non-human animal, e.g., a non-human mammal, such as a rodent,
ruminant or primate. For example, the non-human mammal can be a
mouse, rat, dog, pig, goat, sheep, cow, monkey, Pan paniscus, Pan
troglodytes, Macaca mulatto, or Cynomolgus monkey. The sequence of
the iRNA agent could be complementary to sequences within
homologous genes, e.g., oncogenes or tumor suppressor genes, of the
non-human mammal and the human. By determining the toxicity of the
iRNA agent in the non-human mammal, one can extrapolate the
toxicity of the iRNA agent in a human. For a more strenuous
toxicity test, the iRNA agent can be complementary to a human and
more than one, e.g., two or three or more, non-human animals.
[0620] The methods described herein can be used to correlate any
physiological effect of an iRNA agent on a human, e.g., any
unwanted effect, such as a toxic effect, or any positive, or
desired effect.
[0621] Delivery Module
[0622] An RNA, e.g., an iRNA agent described herein, can be used
with a drug delivery conjugate or module, such as those described
herein. In addition, an iRNA agent described herein, e.g., a
palindromic iRNA agent, an iRNA agent having a non canonical
pairing, an iRNA agent which targets a gene described herein, e.g.,
an SNCA gene, an iRNA agent having a chemical modification
described herein, e.g., a modification which enhances resistance to
degradation, an iRNA agent having an architecture or structure
described herein, an iRNA agent administered as described herein,
or an iRNA agent formulated as described herein, combined with,
associated with, and delivered by such a drug delivery conjugate or
module.
[0623] The iRNA agents can be complexed to a delivery agent that
features a modular complex. The complex can include a carrier agent
linked to one or more of (preferably two or more, more preferably
all three of): (a) a condensing agent (e.g., an agent capable of
attracting, e.g., binding, a nucleic acid, e.g., through ionic or
electrostatic interactions); (b) a fusogenic agent (e.g., an agent
capable of fusing and/or being transported through a cell membrane,
e.g., an endosome membrane); and (c) a targeting group, e.g., a
cell or tissue targeting agent, e.g., a lectin, glycoprotein, lipid
or protein, e.g., an antibody, that binds to a specified cell type
such as a neural cell in the brain.
[0624] An iRNA agent, e.g., iRNA agent or sRNA agent described
herein, can be linked, e.g., coupled or bound, to the modular
complex. The iRNA agent can interact with the condensing agent of
the complex, and the complex can be used to deliver an iRNA agent
to a cell, e.g., in vitro or in vivo. For example, the complex can
be used to deliver an iRNA agent to a subject in need thereof,
e.g., to deliver an iRNA agent to a subject having a disorder,
e.g., a disorder described herein, such as a neurodegenerative
disease or disorder.
[0625] The fusogenic agent and the condensing agent can be
different agents or the one and the same agent. For example, a
polyamino chain, e.g., polyethyleneimine (PEI), can be the
fusogenic and/or the condensing agent.
[0626] The delivery agent can be a modular complex. For example,
the complex can include a carrier agent linked to one or more of
(preferably two or more, more preferably all three of): [0627] (a)
a condensing agent (e.g., an agent capable of attracting, e.g.,
binding, a nucleic acid, e.g., through ionic interaction), [0628]
(b) a fusogenic agent (e.g., an agent capable of fusing and/or
being transported through a cell membrane, e.g., an endosome
membrane), and [0629] (c) a targeting group, e.g., a cell or tissue
targeting agent, e.g., a lectin, glycoprotein, lipid or protein,
e.g., an antibody, that binds to a specified cell type such as a
neural cell (e.g., a neural cell in the brain). A targeting group
can be a thyrotropin, melanotropin, lectin, glycoprotein,
surfactant protein A, Mucin carbohydrate, multivalent lactose,
multivalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine
multivalent mannose, multivalent fucose, glycosylated polyamino
acids, multivalent galactose, transferrin, bisphosphonate,
polyglutamate, polyaspartate, a lipid, cholesterol, a steroid, bile
acid, folate, vitamin B12, biotin, Neproxin, or an RGD peptide or
RGD peptide mimetic.
[0630] Carrier agents. The carrier agent of a modular complex
described herein can be a substrate for attachment of one or more
of: a condensing agent, a fusogenic agent, and a targeting group.
The carrier agent would preferably lack an endogenous enzymatic
activity. The agent would preferably be a biological molecule,
preferably a macromolecule. Polymeric biological carriers are
preferred. It would also be preferred that the carrier molecule be
biodegradable.
[0631] The carrier agent can be a naturally occurring substance,
such as a protein (e.g., human serum albumin (HSA), low-density
lipoprotein (LDL), or globulin); carbohydrate (e.g., a dextran,
pullulan, chitin, chitosan, inulin, cyclodextrin or hyaluronic
acid); or lipid. The carrier molecule can also be a recombinant or
synthetic molecule, such as a synthetic polymer, e.g., a synthetic
polyamino acid. Examples of polyamino acids include polylysine
(PLL), poly L-aspartic acid, poly L-glutamic acid, styrene-maleic
acid anhydride copolymer, poly(L-lactide-co-glycolide) copolymer,
divinyl ether-maleic anhydride copolymer,
N-(2-hydroxypropyl)methacrylamide copolymer (HMPA), polyethylene
glycol (PEG), polyvinyl alcohol (PVA), polyurethane,
poly(2-ethylacrylic acid), N-isopropylacrylamide polymers, or
polyphosphazine. Other useful carrier molecules can be identified
by routine methods.
[0632] A carrier agent can be characterized by one or more of: (a)
is at least 1 Da in size; (b) has at least 5 charged groups,
preferably between 5 and 5000 charged groups; (c) is present in the
complex at a ratio of at least 1:1 carrier agent to fusogenic
agent; (d) is present in the complex at a ratio of at least 1:1
carrier agent to condensing agent; (e) is present in the complex at
a ratio of at least 1:1 carrier agent to targeting agent.
[0633] Fusogenic agents. A fusogenic agent of a modular complex
described herein can be an agent that is responsive to, e.g.,
changes charge depending on, the pH environment. Upon encountering
the pH of an endosome, it can cause a physical change, e.g., a
change in osmotic properties which disrupts or increases the
permeability of the endosome membrane. Preferably, the fusogenic
agent changes charge, e.g., becomes protonated, at pH lower than
physiological range. For example, the fusogenic agent can become
protonated at pH 4.5-6.5. The fusogenic agent can serve to release
the iRNA agent into the cytoplasm of a cell after the complex is
taken up, e.g., via endocytosis, by the cell, thereby increasing
the cellular concentration of the iRNA agent in the cell.
[0634] In one embodiment, the fusogenic agent can have a moiety,
e.g., an amino group, which, when exposed to a specified pH range,
will undergo a change, e.g., in charge, e.g., protonation. The
change in charge of the fusogenic agent can trigger a change, e.g.,
an osmotic change, in a vesicle, e.g., an endocytic vesicle, e.g.,
an endosome. For example, the fusogenic agent, upon being exposed
to the pH environment of an endosome, will cause a solubility or
osmotic change substantial enough to increase the porosity of
(preferably, to rupture) the endosomal membrane.
[0635] The fusogenic agent can be a polymer, preferably a polyamino
chain, e.g., polyethyleneimine (PEI). The PEI can be linear,
branched, synthetic or natural. The PEI can be, e.g., alkyl
substituted PEI, or lipid substituted PEI.
[0636] In other embodiments, the fusogenic agent can be
polyhistidine, polyimidazole, polypyridine, polypropyleneimine,
mellitin, or a polyacetal substance, e.g., a cationic polyacetal.
In some embodiment, the fusogenic agent can have an alpha helical
structure. The fusogenic agent can be a membrane disruptive agent,
e.g., mellittin.
[0637] A fusogenic agent can have one or more of the following
characteristics: (a) is at least 1Da in size; (b) has at least 10
charged groups, preferably between 10 and 5000 charged groups, more
preferably between 50 and 1000 charged groups; (c) is present in
the complex at a ratio of at least 1:1 fusogenic agent to carrier
agent; (d) is present in the complex at a ratio of at least 1:1
fusogenic agent to condensing agent; (e) is present in the complex
at a ratio of at least 1:1 fusogenic agent to targeting agent.
[0638] Other suitable fusogenic agents can be tested and identified
by a skilled artisan. The ability of a compound to respond to,
e.g., change charge depending on, the pH environment can be tested
by routine methods, e.g., in a cellular assay. For example, a test
compound is combined or contacted with a cell, and the cell is
allowed to take up the test compound, e.g., by endocytosis. An
endosome preparation can then be made from the contacted cells and
the endosome preparation compared to an endosome preparation from
control cells. A change, e.g., a decrease, in the endosome fraction
from the contacted cell vs. the control cell indicates that the
test compound can function as a fusogenic agent. Alternatively, the
contacted cell and control cell can be evaluated, e.g., by
microscopy, e.g., by light or electron microscopy, to determine a
difference in endosome population in the cells. The test compound
can be labeled. In another type of assay, a modular complex
described herein is constructed using one or more test or putative
fusogenic agents. The modular complex can be constructed using a
labeled nucleic acid instead of the iRNA. A two-step assay can be
performed, wherein a first assay evaluates the ability of a test
compound alone to respond to, e.g., change charge depending on, the
pH environment; and a second assay evaluates the ability of a
modular complex that includes the test compound to respond to,
e.g., change charge depending on, the pH environment.
[0639] Condensing agent. The condensing agent of a modular complex
described herein can interact with (e.g., attracts, holds, or binds
to) an iRNA agent and act to (a) condense, e.g., reduce the size or
charge of the iRNA agent and/or (b) protect the iRNA agent, e.g.,
protect the iRNA agent against degradation. The condensing agent
can include a moiety, e.g., a charged moiety, that can interact
with a nucleic acid, e.g., an iRNA agent, e.g., by ionic
interactions. The condensing agent would preferably be a charged
polymer, e.g., a polycationic chain. The condensing agent can be a
polylysine (PLL), spermine, spermidine, polyamine,
pseudopeptide-polyamine, peptidomimetic polyamine, dendrimer
polyamine, arginine, amidine, protamine, cationic lipid, cationic
porphyrin, quaternary salt of a polyamine, or an alpha helical
peptide.
[0640] A condensing agent can have the following characteristics:
(a) at least 1Da in size; (b) has at least 2 charged groups,
preferably between 2 and 100 charged groups; (c) is present in the
complex at a ratio of at least 1:1 condensing agent to carrier
agent; (d) is present in the complex at a ratio of at least 1:1
condensing agent to fusogenic agent; (e) is present in the complex
at a ratio of at least 1:1 condensing agent to targeting agent.
[0641] Other suitable condensing agents can be tested and
identified by a skilled artisan, e.g., by evaluating the ability of
a test agent to interact with a nucleic acid, e.g., an iRNA agent.
The ability of a test agent to interact with a nucleic acid, e.g.,
an iRNA agent, e.g., to condense or protect the iRNA agent, can be
evaluated by routine techniques. In one assay, a test agent is
contacted with a nucleic acid, and the size and/or charge of the
contacted nucleic acid is evaluated by a technique suitable to
detect changes in molecular mass and/or charge. Such techniques
include non-denaturing gel electrophoresis, immunological methods,
e.g., immunoprecipitation, gel filtration, ionic interaction
chromatography, and the like. A test agent is identified as a
condensing agent if it changes the mass and/or charge (preferably
both) of the contacted nucleic acid, compared to a control. A
two-step assay can also be performed, wherein a first assay
evaluates the ability of a test compound alone to interact with,
e.g., bind to, e.g., condense the charge and/or mass of, a nucleic
acid; and a second assay evaluates the ability of a modular complex
that includes the test compound to interact with, e.g., bind to,
e.g., condense the charge and/or mass of, a nucleic acid.
[0642] Amphipathic Delivery Agents
[0643] An RNA, e.g., an iRNA agent, described herein can be used
with an amphipathic delivery conjugate or module, such as those
described herein. In addition, an iRNA agent described herein,
e.g., a palindromic iRNA agent, an iRNA agent having a noncanonical
pairing, an iRNA agent which targets a gene described herein, e.g.,
an SNCA gene, an iRNA agent having a chemical modification
described herein, e.g., a modification which enhances resistance to
degradation, an iRNA agent having an architecture or structure
described herein, an iRNA agent administered as described herein,
or an iRNA agent formulated as described herein, combined with,
associated with, and delivered by such an amphipathic delivery
conjugate.
[0644] An amphipathic molecule is a molecule having a hydrophobic
and a hydrophilic region. Such molecules can interact with (e.g.,
penetrate or disrupt) lipids, e.g., a lipid bilayer of a cell. As
such, they can serve as delivery agent for an associated (e.g.,
bound) iRNA (e.g., an iRNA or sRNA described herein). A preferred
amphipathic molecule to be used in the compositions described
herein (e.g., the amphipathic iRNA constructs described herein) is
a polymer. The polymer may have a secondary structure, e.g., a
repeating secondary structure.
[0645] One example of an amphipathic polymer is an amphipathic
polypeptide, e.g., a polypeptide having a secondary structure such
that the polypeptide has a hydrophilic and a hydrophobic face. The
design of amphipathic peptide structures (e.g., alpha-helical
polypeptides) is routine to one of skill in the art. For example,
the following references provide guidance: Grell et al. (2001) J
Pept Sci 7(3):146-51; Chen et al. (2002) J Pept Res 59(1):18-33;
Iwata et al. (1994) J Biol Chem 269(7):4928-33; Cornut et al.
(1994) FEBS Lett 349(1):29-33; Negrete et al. (1998) Protein Sci
7(6):1368-79.
[0646] Another example of an amphipathic polymer is a polymer made
up of two or more amphipathic subunits, e.g., two or more subunits
containing cyclic moieties (e.g., a cyclic moiety having one or
more hydrophilic groups and one or more hydrophobic groups). For
example, the subunit may contain a steroid, e.g., cholic acid; or a
aromatic moiety. Such moieties preferably can exhibit
atropisomerism, such that they can form opposing hydrophobic and
hydrophilic faces when in a polymer structure.
[0647] The ability of a putative amphipathic molecule to interact
with a lipid membrane, e.g., a cell membrane, can be tested by
routine methods, e.g., in a cell free or cellular assay. For
example, a test compound is combined or contacted with a synthetic
lipid bilayer, a cellular membrane fraction, or a cell, and the
test compound is evaluated for its ability to interact with,
penetrate, or disrupt the lipid bilayer, cell membrane or cell. The
test compound can be labeled in order to detect the interaction
with the lipid bilayer, cell membrane, or cell. In another type of
assay, the test compound is linked to a reporter molecule or an
iRNA agent (e.g., an iRNA or sRNA described herein), and the
ability of the reporter molecule or iRNA agent to penetrate the
lipid bilayer, cell membrane or cell is evaluated. A two-step assay
can also be performed, wherein a first assay evaluates the ability
of a test compound alone to interact with a lipid bilayer, cell
membrane or cell; and a second assay evaluates the ability of a
construct (e.g., a construct described herein) that includes the
test compound and a reporter or iRNA agent to interact with a lipid
bilayer, cell membrane or cell.
[0648] An amphipathic polymer useful in the compositions described
herein has at least 2, preferably at least 5, more preferably at
least 10, 25, 50, 100, 200, 500, 1000, 2000, 50000 or more subunits
(e.g., amino acids or cyclic subunits). A single amphipathic
polymer can be linked to one or more, e.g., 2, 3, 5, 10 or more
iRNA agents (e.g., iRNA or sRNA agents described herein). In some
embodiments, an amphipathic polymer can contain both amino acid and
cyclic subunits, e.g., aromatic subunits.
[0649] The invention features a composition that includes an iRNA
agent (e.g., an iRNA or sRNA described herein) in association with
an amphipathic molecule. Such compositions may be referred to
herein as "amphipathic iRNA constructs." Such compositions and
constructs are useful in the delivery or targeting of iRNA agents,
e.g., delivery or targeting of iRNA agents to a cell. While not
wanting to be bound by theory, such compositions and constructs can
increase the porosity of, e.g., can penetrate or disrupt, a lipid
(e.g., a lipid bilayer of a cell), e.g., to allow entry of the iRNA
agent into a cell.
[0650] In one aspect, the invention relates to a composition
comprising an iRNA agent (e.g., an iRNA or sRNA agent described
herein) linked to an amphipathic molecule. The iRNA agent and the
amphipathic molecule may be held in continuous contact with one
another by either covalent or noncovalent linkages.
[0651] The amphipathic molecule of the composition or construct is
preferably other than a phospholipid, e.g., other than a micelle,
membrane or membrane fragment.
[0652] The amphipathic molecule of the composition or construct is
preferably a polymer. The polymer may include two or more
amphipathic subunits. One or more hydrophilic groups and one or
more hydrophobic groups may be present on the polymer. The polymer
may have a repeating secondary structure as well as a first face
and a second face. The distribution of the hydrophilic groups and
the hydrophobic groups along the repeating secondary structure can
be such that one face of the polymer is a hydrophilic face and the
other face of the polymer is a hydrophobic face.
[0653] The amphipathic molecule can be a polypeptide, e.g., a
polypeptide comprising an .alpha.-helical conformation as its
secondary structure.
[0654] In one embodiment, the amphipathic polymer includes one or
more subunits containing one or more cyclic moiety (e.g., a cyclic
moiety having one or more hydrophilic groups and/or one or more
hydrophobic groups). In one embodiment, the polymer is a polymer of
cyclic moieties such that the moieties have alternating hydrophobic
and hydrophilic groups. For example, the subunit may contain a
steroid, e.g., cholic acid. In another example, the subunit may
contain an aromatic moiety. The aromatic moiety may be one that can
exhibit atropisomerism, e.g., a
2,2'-bis(substituted)-1-1'-binaphthyl or a 2,2'-bis(substituted)
biphenyl. A subunit may include an aromatic moiety of Formula
(M):
##STR00035##
[0655] The invention features a composition that includes an mRNA
agent (e.g., an mRNA or sRNA described herein) in association with
an amphipathic molecule. Such compositions may be referred to
herein as "amphipathic iRNA constructs." Such compositions and
constructs are useful in the delivery or targeting of iRNA agents,
e.g., delivery or targeting of iRNA agents to a cell. While not
wanting to be bound by theory, such compositions and constructs can
increase the porosity of, e.g., can penetrate or disrupt, a lipid
(e.g., a lipid bilayer of a cell), e.g., to allow entry of the iRNA
agent into a cell.
[0656] Referring to Formula M, R.sub.1 is C.sub.1-C.sub.100 alkyl
optionally substituted with aryl, alkenyl, alkynyl, alkoxy or halo
and/or optionally inserted with O, S, alkenyl or alkynyl;
C.sub.1-C.sub.100 perfluoroalkyl; or OR.sub.5.
[0657] R.sub.2 is hydroxy; nitro; sulfate; phosphate; phosphate
ester; sulfonic acid; OR.sub.6; or C.sub.1-C.sub.100 alkyl
optionally substituted with hydroxy, halo, nitro, aryl or alkyl
sulfinyl, aryl or alkyl sulfonyl, sulfate, sulfonic acid,
phosphate, phosphate ester, substituted or unsubstituted aryl,
carboxyl, carboxylate, amino carbonyl, or alkoxycarbonyl, and/or
optionally inserted with O, NH, S, S(O), SO.sub.2, alkenyl, or
alkynyl.
[0658] R.sub.3 is hydrogen, or when taken together with R.sub.4
forms a fused phenyl ring.
[0659] R.sub.4 is hydrogen, or when taken together with R.sub.3
forms a fused phenyl ring.
[0660] R.sub.5 is C.sub.1-C.sub.100 alkyl optionally substituted
with aryl, alkenyl, alkynyl, alkoxy or halo and/or optionally
inserted with O, S, alkenyl or alkynyl; or C.sub.1-C.sub.100
perfluoroalkyl; and R.sub.6 is C.sub.1-C.sub.100 alkyl optionally
substituted with hydroxy, halo, nitro, aryl or alkyl sulfinyl, aryl
or alkyl sulfonyl, sulfate, sulfonic acid, phosphate, phosphate
ester, substituted or unsubstituted aryl, carboxyl, carboxylate,
amino carbonyl, or alkoxycarbonyl, and/or optionally inserted with
O, NH, S, S(O), SO.sub.2, alkenyl, or alkynyl.
[0661] Increasing Cellular Uptake of dsRNAs
[0662] A method of the invention that can include the
administration of an iRNA agent and a drug that affects the uptake
of the iRNA agent into the cell. The drug can be administered
before, after, or at the same time that the iRNA agent is
administered. The drug can be covalently linked to the iRNA agent.
The drug can have a transient effect on the cell.
[0663] The drug can increase the uptake of the iRNA agent into the
cell, for example, by disrupting the cell's cytoskeleton, e.g., by
disrupting the cell's microtubules, microfilaments, and/or
intermediate filaments. The drug can be, for example, taxon,
vincristine, vinblastine, cytochalasin, nocodazole, japlakinolide,
latrunculin A, phalloidin, swinholide A, indanocine, or
myoservin.
[0664] iRNA Conjugates
[0665] An iRNA agent can be coupled, e.g., covalently coupled, to a
second agent. For example, an iRNA agent used to treat a particular
disorder can be coupled to a second therapeutic agent, e.g., an
agent other than the iRNA agent. The second therapeutic agent can
be one which is directed to the treatment of the same disorder. For
example, in the case of an iRNA used to treat a disorder
characterized by alpha-synuclein aggregates, e.g., PD, the iRNA
agent can be coupled to a second agent which is useful for the
treatment of PD.
[0666] iRNA Production
[0667] An mRNA can be produced, e.g., in bulk, by a variety of
methods. Exemplary methods include: organic synthesis and RNA
cleavage, e.g., in vitro cleavage.
[0668] Organic Synthesis. An iRNA can be made by separately
synthesizing each respective strand of a double-stranded RNA
molecule. The component strands can then be annealed.
[0669] A large bioreactor, e.g., the OligoPilot II from Pharmacia
Biotec AB (Uppsala Sweden), can be used to produce a large amount
of a particular RNA strand for a given iRNA. The OligoPilotII
reactor can efficiently couple a nucleotide using only a 1.5 molar
excess of a phosphoramidite nucleotide. To make an RNA strand,
ribonucleotides amidites are used. Standard cycles of monomer
addition can be used to synthesize the 21 to 23 nucleotide strand
for the iRNA. Typically, the two complementary strands are produced
separately and then annealed, e.g., after release from the solid
support and deprotection.
[0670] Organic synthesis can be used to produce a discrete iRNA
species. The complementary of the species to a particular target
gene can be precisely specified. For example, the species may be
complementary to a region that includes a polymorphism, e.g., a
single nucleotide polymorphism. Further the location of the
polymorphism can be precisely defined. In some embodiments, the
polymorphism is located in an internal region, e.g., at least 4, 5,
7, or 9 nucleotides from one or both of the termini.
[0671] dsRNA Cleavage. iRNAs can also be made by cleaving a larger
ds iRNA. The cleavage can be mediated in vitro or in vivo. For
example, to produce iRNAs by cleavage in vitro, the following
method can be used:
[0672] In vitro transcription. dsRNA is produced by transcribing a
nucleic acid (DNA) segment in both directions. For example, the
HiScribe.TM. RNAi transcription kit (New England Biolabs) provides
a vector and a method for producing a dsRNA for a nucleic acid
segment that is cloned into the vector at a position flanked on
either side by a T7 promoter. Separate templates are generated for
T7 transcription of the two complementary strands for the dsRNA.
The templates are transcribed in vitro by addition of T7 RNA
polymerase and dsRNA is produced. Similar methods using PCR and/or
other RNA polymerases (e.g., T3 or SP6 polymerase) can also be
used. In one embodiment, RNA generated by this method is carefully
purified to remove endotoxins that may contaminate preparations of
the recombinant enzymes.
[0673] In vitro cleavage. dsRNA is cleaved in vitro into iRNAs, for
example, using a Dicer or comparable RNAse III-based activity. For
example, the dsRNA can be incubated in an in vitro extract from
Drosophila or using purified components, e.g. a purified RNAse or
RISC complex (RNA-induced silencing complex). See, e.g., Ketting et
al. Genes Dev 2001 Oct. 15; 15(20):2654-9. and Hammond Science 2001
Aug. 10; 293(5532):1146-50.
[0674] dsRNA cleavage generally produces a plurality of iRNA
species, each being a particular 21 to 23 nt fragment of a source
dsRNA molecule. For example, iRNAs that include sequences
complementary to overlapping regions and adjacent regions of a
source dsRNA molecule may be present.
[0675] Regardless of the method of synthesis, the iRNA preparation
can be prepared in a solution (e.g., an aqueous and/or organic
solution) that is appropriate for formulation. For example, the
iRNA preparation can be precipitated and redissolved in pure
double-distilled water, and lyophilized. The dried iRNA can then be
resuspended in a solution appropriate for the intended formulation
process.
[0676] Synthesis of modified and nucleotide surrogate iRNA agents
is discussed below.
[0677] Formulation
[0678] The iRNA agents described herein can be formulated for
administration to a subject.
[0679] For ease of exposition, the formulations, compositions, and
methods in this section are discussed largely with regard to
unmodified iRNA agents. It should be understood, however, that
these formulations, compositions, and methods can be practiced with
other iRNA agents, e.g., modified iRNA agents, and such practice is
within the invention.
[0680] A formulated iRNA composition can assume a variety of
states. In some examples, the composition is at least partially
crystalline, uniformly crystalline, and/or anhydrous (e.g., less
than 80, 50, 30, 20, or 10% water). In another example, the mRNA is
in an aqueous phase, e.g., in a solution that includes water.
[0681] The aqueous phase or the crystalline compositions can, e.g.,
be incorporated into a delivery vehicle, e.g., a liposome
(particularly for the aqueous phase) or a particle (e.g., a
microparticle as can be appropriate for a crystalline composition).
Generally, the iRNA composition is formulated in a manner that is
compatible with the intended method of administration.
[0682] In particular embodiments, the composition is prepared by at
least one of the following methods: spray drying, lyophilization,
vacuum drying, evaporation, fluid bed drying, or a combination of
these techniques; or sonication with a lipid, freeze-drying,
condensation and other self-assembly.
[0683] A iRNA preparation can be formulated in combination with
another agent, e.g., another therapeutic agent or an agent that
stabilizes a iRNA, e.g., a protein that complexes with iRNA to form
an iRNP. Still other agents include chelators, e.g., EDTA (e.g., to
remove divalent cations such as Mg.sup.2+), salts, RNAse inhibitors
(e.g., a broad specificity RNAse inhibitor such as RNAsin) and so
forth.
[0684] In one embodiment, the iRNA preparation includes another
iRNA agent, e.g., a second iRNA that can mediated RNAi with respect
to a second gene, or with respect to the same gene. Still other
preparation can include at least three, five, ten, twenty, fifty,
or a hundred or more different iRNA species. Such iRNAs can
mediated RNAi with respect to a similar number of different
genes.
[0685] In one embodiment, the iRNA preparation includes at least a
second therapeutic agent (e.g., an agent other than an RNA or a
DNA). For example, a iRNA composition for the treatment of a
neurodegenerative disease, e.g. PD, might include a known PD
therapeutic (e.g., levadopa or depronil)
[0686] Targeting
[0687] For ease of exposition the formulations, compositions and
methods in this section are discussed largely with regard to
unmodified iRNAs. It should be understood, however, that these
formulations, compositions and methods can be practiced with other
iRNA agents, e.g., modified iRNA agents, and such practice is
within the invention.
[0688] In some embodiments, an iRNA agent, e.g., a double-stranded
iRNA agent, or sRNA agent, (e.g., a precursor, e.g., a larger iRNA
agent which can be processed into a sRNA agent, or a DNA which
encodes an iRNA agent, e.g., a double-stranded iRNA agent, or sRNA
agent, or precursor thereof) is targeted to a particular cell. For
example, a liposome or particle or other structure that includes a
iRNA can also include a targeting moiety that recognizes a specific
molecule on a target cell. The targeting moiety can be a molecule
with a specific affinity for a target cell. Targeting moieties can
include antibodies directed against a protein found on the surface
of a target cell, or the ligand or a receptor-binding portion of a
ligand for a molecule found on the surface of a target cell.
[0689] An antigen, can be used to target an iRNA to a neural cell
in the brain.
[0690] In one embodiment, the targeting moiety is attached to a
liposome. For example, U.S. Pat. No. 6,245,427 describes a method
for targeting a liposome using a protein or peptide. In another
example, a cationic lipid component of the liposome is derivatized
with a targeting moiety. For example, WO 96/37194 describes
converting N-glutaryldioleoylphosphatidyl ethanolamine to a
N-hydroxysuccinimide activated ester. The product was then coupled
to an RGD peptide.
[0691] Antibodies
[0692] An composition described herein can include an antibody that
targets a synuclein polypeptide, e.g., to block synuclein activity
and/or inhibit synuclein aggregation. An antibody can be an
antibody or a fragment thereof, e.g., an antigen binding portion
thereof. As used herein, the term "antibody" refers to a protein
comprising at least one, and preferably two, heavy (H) chain
variable regions (abbreviated herein as VH), and at least one and
preferably two light (L) chain variable regions (abbreviated herein
as VL). The VH and VL regions can be further subdivided into
regions of hypervariability, termed "complementarity determining
regions" ("CDR"), interspersed with regions that are more
conserved, termed "framework regions" (FR). The extent of the
framework region and CDR's has been precisely defined (see, Kabat
et al., Sequences of Proteins of Immunological Interest, Fifth
Edition, U.S. Department of Health and Human Services, NIH
Publication No. 91-3242, 1991, and Chothia et al., J. Mol. Biol.
196:901-917, 1987, which are incorporated herein by reference).
Each VH and VL is composed of three CDR's and four FRs, arranged
from amino-terminus to carboxyl-terminus in the following order:
FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4.
[0693] The antibody can further include a heavy and light chain
constant region, to thereby form a heavy and light immunoglobulin
chain, respectively. In one embodiment, the antibody is a tetramer
of two heavy immunoglobulin chains and two light immunoglobulin
chains, wherein the heavy and light immunoglobulin chains are
inter-connected by, e.g., disulfide bonds. The heavy chain constant
region is comprised of three domains, CH1, CH2 and CH3. The light
chain constant region is comprised of one domain, CL. The variable
region of the heavy and light chains contains a binding domain that
interacts with an antigen. The constant regions of the antibodies
typically mediate the binding of the antibody to host tissues or
factors, including various cells of the immune system (e.g.,
effector cells) and the first component (C1q) of the classical
complement system.
[0694] The term "antigen-binding fragment" of an antibody (or
simply "antibody portion," or "fragment"), as used herein, refers
to one or more fragments of a full-length antibody that retain the
ability to specifically bind to an antigen (e.g., a polypeptide
encoded by an SNCA nucleic acid). Examples of binding fragments
encompassed within the term "antigen-binding fragment" of an
antibody include (i) a Fab fragment, a monovalent fragment
consisting of the VL, VH, CL and CH1 domains; (ii) a F(ab').sub.2
fragment, a bivalent fragment comprising two Fab fragments linked
by a disulfide bridge at the hinge region; (iii) a Fd fragment
consisting of the VH and CH1 domains; (iv) a Fv fragment consisting
of the VL and VH domains of a single arm of an antibody, (v) a dAb
fragment (Ward et al., Nature 341:544-546, 1989), which consists of
a VH domain; and (vi) an isolated complementarity determining
region (CDR). Furthermore, although the two domains of the Fv
fragment, VL and VH, are coded for by separate nucleic acids, they
can be joined, using recombinant methods, by a synthetic linker
that enables them to be made as a single protein chain in which the
VL and VH regions pair to form monovalent molecules (known as
single chain Fv (scFv); see e.g., Bird et al., Science 242:423-426,
1988, and Huston et al., Proc. Natl. Acad. Sci. USA 85:5879-5883,
1988). Such single chain antibodies are also intended to be
encompassed within the term "antigen-binding fragment" of an
antibody. These antibody fragments are obtained using conventional
techniques known to those with skill in the art, and the fragments
are screened for utility in the same manner as are intact
antibodies. The term "monoclonal antibody" or "monoclonal antibody
composition", as used herein, refers to a population of antibody
molecules that contain only one species of an antigen binding site
capable of immunoreacting with a particular epitope. A monoclonal
antibody composition thus typically displays a single binding
affinity for a particular protein with which it immunoreacts.
[0695] Anti-protein/anti-peptide antisera or monoclonal antibodies
can be made as described herein by using standard protocols (See,
for example, Antibodies: A Laboratory Manual ed. by Harlow and
Lane, Cold Spring Harbor Press, 1988).
[0696] A protein described herein, e.g., an alpha synuclein
polypeptide, can be used as an immunogen to generate antibodies
that bind the component using standard techniques for polyclonal
and monoclonal antibody preparation. The full-length component
protein can be used or, alternatively, antigenic peptide fragments
of the component can be used as immunogens.
[0697] Typically, a peptide is used to prepare antibodies by
immunizing a suitable subject, (e.g., rabbit, goat, mouse or other
mammal) with the immunogen. An appropriate immunogenic preparation
can contain, for example, a recombinant form of a protein described
herein, e.g., an alpha-synuclein polypeptide. See, e.g., U.S. Pat.
No. 5,460,959; and co-pending U.S. applications U.S. Ser. No.
08/334,797; U.S. Ser. No. 08/231,439; U.S. Ser. No. 08/334,455; and
U.S. Ser. No. 08/928,881, which are hereby expressly incorporated
by, reference in their entirety. The nucleotide and amino acid
sequences of alpha-synuclein are known. The preparation can further
include an adjuvant, such as Freund's complete or incomplete
adjuvant, or similar immunostimulatory agent. Immunization of a
suitable subject with an immunogenic protein described herein,
e.g., an alpha-synuclein polypeptide, or fragment preparation
induces a polyclonal antibody response.
[0698] Additionally, antibodies produced by genetic engineering
methods, such as chimeric and humanized monoclonal antibodies,
comprising both human and non-human portions, which can be made
using standard recombinant DNA techniques, can be used. Such
chimeric and humanized monoclonal antibodies can be produced by
genetic engineering using standard DNA techniques known in the art,
for example using methods described in Robinson et al.
International Application No. PCT/US86/02269; Akira, et al.
European Patent Application 184,187; Taniguchi, M., European Patent
Application 171,496; Morrison et al. European Patent Application
173,494; Neuberger et al. PCT International Publication No. WO
86/01533; Cabilly et al. U.S. Pat. No. 4,816,567; Cabilly et al.
European Patent Application 125,023; Better et al., Science
240:1041-1043, 1988; Liu et al., PNAS 84:3439-3443, 1987; Liu et
al., J. Immunol. 139:3521-3526, 1987; Sun et al., PNAS 84:214-218,
1987; Nishimura et al., Canc. Res. 47:999-1005, 1987; Wood et al.,
Nature 314:446-449, 1985; and Shaw et al., J. Natl. Cancer Inst.
80:1553-1559, 1988); Morrison, S. L., Science 229:1202-1207, 1985;
Oi et al., BioTechniques 4:214, 1986; Winter U.S. Pat. No.
5,225,539; Jones et al., Nature 321:552-525, 1986; Verhoeyan et
al., Science 239:1534, 1988; and Beidler et al., J. Immunol.
141:4053-4060, 1988.
[0699] In addition, a human monoclonal antibody directed against a
protein described herein, e.g., an alpha-synuclein protein, can be
made using standard techniques. For example, human monoclonal
antibodies can be generated in transgenic mice or in immune
deficient mice engrafted with antibody-producing human cells.
Methods of generating such mice are describe, for example, in Wood
et al. PCT publication WO 91/00906; Kucherlapati et al. PCT
publication WO 91/10741; Lonberg et al. PCT publication WO
92/03918; Kay et al. PCT publication WO 92/03917; Kay et al. PCT
publication WO 93/12227; Kay et al. PCT publication WO 94/25585;
Rajewsky et al. PCT publication WO 94/04667; Ditullio et al. PCT
publication WO 95/17085; Lonberg et al., Nature 368:856-859, 1994;
Green et al., Nature Genet. 7:13-21, 1994; Morrison et al., Proc.
Natl. Acad. Sci. USA 81:6851-6855, 1994; Bruggeman et al., Year
Immunol 7:33-40, 1993; Choi et al., Nature Genet. 4:117-123, 1993;
Tuaillon et al., PNAS 90:3720-3724, 1993; Bruggeman et al., Eur J
Immunol 21:1323-1326, 1991; Duchosal et al. PCT publication WO
93/05796; U.S. Pat. No. 5,411,749; McCune et al., Science
241:1632-1639, 1988; Kamel-Reid et al., Science 242:1706, 1988;
Spanopoulou, Genes & Development 8:1030-1042, 1994; and Shinkai
et al., Cell 68:855-868, 1992. A human antibody-transgenic mouse or
an immune deficient mouse engrafted with human antibody-producing
cells or tissue can be immunized with a protein described herein,
e.g., an alpha-synuclein protein, or an antigenic peptide thereof,
and splenocytes from these immunized mice can then be used to
create hybridomas. Methods of hybridoma production are well
known.
[0700] Human monoclonal antibodies against a protein described
herein, e.g., an alpha-synuclein polypeptide, can also be prepared
by constructing a combinatorial immunoglobulin library, such as a
Fab phage display library or an scFv phage display library, using
immunoglobulin light chain and heavy chain cDNAs prepared from mRNA
derived from lymphocytes of a subject. See, e.g., McCafferty et al.
PCT publication WO 92/01047; Marks et al., J. Mol. Biol.
222:581-597, 1991; and Griffiths et al., EMBO J. 12:725-734, 1993.
In addition, a combinatorial library of antibody variable regions
can be generated by mutating a known human antibody. For example, a
variable region of a human antibody known to bind a protein
described herein can be mutated by, for example, using randomly
altered mutagenized oligonucleotides, to generate a library of
mutated variable regions which can then be screened to bind to a
protein described herein, e.g., an alpha-synuclein. Methods of
inducing random mutagenesis within the CDR regions of
immunoglobulin heavy and/or light chains, methods of crossing
randomized heavy and light chains to form pairings and screening
methods can be found in, for example, Barbas et al. PCT publication
WO 96/07754; and Barbas et al., Proc. Nat'l Acad. Sci. USA
89:4457-4461, 1992.
[0701] The immunoglobulin library can be expressed by a population
of display packages, preferably derived from filamentous phage, to
form an antibody display library. Examples of methods and reagents
particularly amenable for use in generating an antibody display
library can be found in, for example, Ladner et al. U.S. Pat. No.
5,223,409; Kang et al. PCT publication WO 92/18619; Dower et al.
PCT publication WO 91/17271; Winter et al. PCT publication WO
92/20791; Markland et al. PCT publication WO 92/15679; Breitling et
al. PCT publication WO 93/01288; McCafferty et al. PCT publication
WO 92/01047; Garrard et al. PCT publication WO 92/09690; Ladner et
al. PCT publication WO 90/02809; Fuchs et al., Bio/Technology
9:1370-1372; 1991; Hay et al., Hum Antibod Hybridomas 3:81-85,
1992; Huse et al., Science 246:1275-1281, 1989; Griffiths et al.,
1993, supra; Hawkins et al., J Mol Biol 226:889-896, 1992; Clackson
et al., Nature 352:624-628, 1991; Gram et al., PNAS 89:3576-3580,
1992; Garrad et al., Bio/Technology 9:1373-1377, 1991; Hoogenboom
et al., Nuc Acid Res 19:4133-4137, 1991; and Barbas et al., PNAS
88:7978-7982, 1991. Once displayed on the surface of a display
package (e.g., filamentous phage), the antibody library is screened
to identify and isolate packages that express an antibody that
binds a protein described herein, e.g., an alpha-synuclein
polypeptide. In a preferred embodiment, the primary screening of
the library involves panning with an immobilized protein described
herein, and display packages expressing antibodies that bind
immobilized proteins described herein are selected.
[0702] Antisense Nucleic Acid Sequences
[0703] Nucleic acid molecules that are antisense to a nucleotide
encoding a protein described herein, e.g., an alpha-synuclein
polypeptide, can also be used as an agent that inhibits expression
of the protein. An "antisense" nucleic acid includes a nucleotide
sequence that is complementary to a "sense" nucleic acid encoding
the component, e.g., complementary to the coding strand of a
double-stranded cDNA molecule or complementary to an mRNA sequence.
Accordingly, an antisense nucleic acid can form hydrogen bonds with
a sense nucleic acid. The antisense nucleic acid can be
complementary to a portion of a coding strand or the noncoding
strand.
[0704] The coding strand sequences encoding alpha-synuclein
proteins are known. Given a coding strand sequence (e.g., the
sequence of a sense strand of a cDNA molecule), antisense nucleic
acids can be designed according to the rules of Watson and Crick
base pairing. The antisense nucleic acid molecule can be
complementary to a portion of the coding or noncoding region of
mRNA. For example, the antisense oligonucleotide can be
complementary to the region surrounding the translation start site
of the mRNA, e.g., the 5' UTR. An antisense oligonucleotide can be,
for example, about 10 to 25 nucleotides in length (e.g., 11, 12,
13, 14, 15, 16, 18, 19, 20, or 24 nucleotides in length).
[0705] An antisense nucleic acid can be constructed using chemical
synthesis and enzymatic ligation reactions using procedures known
in the art. For example, an antisense nucleic acid (e.g., an
antisense oligonucleotide) can be chemically synthesized using
naturally occurring nucleotides or variously modified nucleotides
designed to increase the biological stability of the molecules or
to increase the physical stability of the duplex formed between the
antisense and sense nucleic acids, e.g., phosphorothioate
derivatives and acridine substituted nucleotides can be used.
Examples of modified nucleotides that can be used to generate the
antisense nucleic acid include 2'-O-methylated nucleotides,
5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil,
hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxylmethyl)
uracil, 5-carboxymethylaminomethyl-2-thiouridine,
5-carboxymethylaminomethyluracil, dihydrouracil,
beta-D-galactosylqueosine, inosine, N6-isopentenyladenine,
1-methylguanine, 1-methylinosine, 2,2-dimethylguanine,
2-methyladenine, 2-methylguanine, 3-methylcytosine,
5-methylcytosine, N6-adenine, 7-methylguanine,
5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil,
beta-D-mannosylqueosine, 5'-methoxycarboxymethyluracil,
5-methoxyuracil, 2-methylthio-N6-isopentenyladenine,
uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine,
2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil,
5-methyluracil, uracil-5-oxyacetic acid methylester,
uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil,
3-(3-amino-3-N-2-carboxypropyl) uracil, (acp3)w, and
2,6-diaminopurine. Alternatively, the antisense nucleic acid can be
produced biologically using an expression vector into which a
nucleic acid has been subcloned in an antisense orientation (i.e.,
RNA transcribed from the inserted nucleic acid will be of an
antisense orientation to a target nucleic acid of interest).
[0706] An antisense agent can include ribonucleotides only,
deoxyribonucleotides only (e.g., oligodeoxynucleotides), or both
deoxyribonucleotide and ribonucleotide sequences. For example, an
antisense agent consisting only of ribonucleotides can hybridize to
a complementary RNA, e.g., an alpha-synuclein RNA, and prevent
access of the translation machinery to the target RNA transcript,
thereby preventing protein synthesis. An antisense molecule
including only deoxyribonucleotides, or deoxyribonucleotides and
ribonucleotides, e.g., DNA sequence flanked by RNA sequence at the
5' and 3' ends of the antisense agent, can hybridize to a
complementary RNA, and the RNA target can be subsequently cleaved
by an enzyme, e.g., RNAseH. Degradation of the target RNA prevents
translation. The flanking RNA sequences can include 2'-O-methylated
nucleotides, and phosphorothioate linkages, and the internal DNA
sequence can include phosphorothioate internucleotide linkages. The
internal DNA sequence is preferably at least five nucleotides in
length when targeting by RNAseH activity is desired.
[0707] For increased nuclease resistance, an antisense agent can be
further modified by inverting the nucleoside at the 3'-terminus
with a 3'-3' linkage. In another alternative, the 3'-terminus can
be blocked with an aminoalkyl group.
[0708] Zinc Finger Proteins (ZFPs)
[0709] Zinc finger protein technology can be used to down-regulate
transcription of a candidate target gene, e.g., an SNCA gene. For
example, an SNCA gene-specific DNA binding domain can be fused to a
repressor domain to down-regulate SNCA gene expression. Zinc finger
proteins can be assembled using variable numbers of zinc finger
domains of varied specificity providing DNA binding proteins that
not only recognize novel sequences but also sequences of varied
length. Zinc finger binding proteins for the regulation of gene
expression are described, for example, in U.S. Pat. Nos. 6,607,882,
and 6,534,261.
[0710] The target site recognized by a ZFP can be any suitable site
in the target gene (e.g., the SNCA gene) that will allow repression
of gene expression by a ZFP, optionally linked to a regulatory
domain. Preferred target sites include regions adjacent to,
downstream, or upstream of the transcription start site. In
addition, target sites can also be located in enhancer regions,
repressor sites, RNA polymerase pause sites, and specific
regulatory sites (e.g., a REP1 site), sites in the cDNA encoding
region or in an expressed sequence tag (EST) coding region.
Typically each finger recognizes 2-4 base pairs, with a two finger
ZFP binding to a 4 to 7 by target site, a three finger ZFP binding
to a 6 to 10 base pair site, and a six finger ZFP binding to two
adjacent target sites, each target site having from about 6-10 base
pairs.
[0711] Typically, the zinc finger DNA-binding domain is linked to a
regulatory domain, e.g., a transcription factor repressor domain
such as the Kruppel-associated box (KRAB), the ERF repressor domain
(ERD), or the mSIN3 interaction domain (SID). For repression of
gene expression, typically the expression of the gene is reduced by
about 20% (i.e., 80% of non-ZFP modulated expression), more
preferably by about 50% (i.e., 50% of non-ZFP modulated
expression), more preferably by about 75-100% (i.e., 25% to 0% of
non-ZFP modulated expression).
[0712] A zinc finger protein can be engineered to respond to a
small molecule, such that the small molecule can regulate activity
of the zinc finger protein. In one embodiment, a cell comprises two
zinc finger proteins. The zinc finger proteins can target two
different candidate genes. For example, one ZFP can target an SNCA
gene to inhibit expression, and a second ZFP can target a gene
encoding a component of the proteosome machinery, e.g., to enhance
expression. Alternatively, the second ZFP can target and inhibit
expression of a second gene that contributes to the alpha-synuclein
aggregation phenotype. Alternatively, the zinc finger proteins can
target two different target sites on the same candidate gene.
Expression of each zinc finger protein can be under small molecule
control (e.g., by two different small molecules) to allow for
variations in the degree of repression of gene expression.
[0713] A "small molecule," as used herein is a chemical compound
that can affect the phenotype of a cell or organism by, for
example, modulating the activity of a specific protein or nucleic
acid, e.g., an SNCA protein or nucleic acid, within a cell. Small
molecules may affect a cell by directly interacting with a protein
or by interacting with a molecule that acts upstream or downstream
of the biochemical cascade that results in protein expression or
activity. Typically, a small molecule has a molecular weight of
less than about 3000, preferably less than about 2000, more
preferably less than about 1000, less than about 900, less than
about 800, less than about 700 or less than about 600 Da.
[0714] Treatment Methods and Routes of Delivery
[0715] The following discussion refers to treatment with an iRNA
agent. However, it is to be understood that the invention includes
analogous methods and compositions which use or embody other
inhibitory agents disclosed herein, e.g., antisense molecules and
ribozymes that target SNCA RNA, zinc finger proteins, and
antibodies, and synthetic and naturally-occurring polypeptides, or
small molecules that, in preferred embodiments, bind to and inhibit
the SNCA protein. A composition that includes a composition
targeting alpha-synuclein, e.g., a ribozyme, antisense
oligonucleotide, iRNA agent, antibody, small molecule, or zinc
finger protein, can be delivered to a subject by a variety of
routes. Exemplary routes include intrathecal, parenchymal (e.g., in
the brain), intravenous, nasal, and ocular delivery. A preferred
route of delivery is directly to the brain. The anti-SNCA agents
can be incorporated into pharmaceutical compositions suitable for
administration. For example, compositions can include one or more
species of an iRNA agent and a pharmaceutically acceptable carrier.
As used herein the language "pharmaceutically acceptable carrier"
is intended to include any and all solvents, dispersion media,
coatings, antibacterial and antifungal agents, isotonic and
absorption delaying agents, and the like, compatible with
pharmaceutical administration. The use of such media and agents for
pharmaceutically active substances is well known in the art. Except
insofar as any conventional media or agent is incompatible with the
active compound, use thereof in the compositions is contemplated.
Supplementary active compounds can also be incorporated into the
compositions.
[0716] The pharmaceutical compositions of the present invention may
be administered in a number of ways depending upon whether local or
systemic treatment is desired and upon the area to be treated.
Administration may be topical (including ophthalmic, intranasal,
transdermal), oral or parenteral. Parenteral administration
includes intravenous drip, subcutaneous, intraperitoneal or
intramuscular injection, or intrathecal or intraventricular
administration.
[0717] The route of delivery can be dependent on the disorder of
the patient. For example, a subject diagnosed with PD can be
administered an anti-SNCA iRNA agent directly to the brain, e.g.,
directly to the substantia nigra of the brain (e.g., into the
striatal dopamine domains within the substantia nigra). A subject
diagnosed with multiple system atrophy can be administered an iRNA
agent directly into the brain, e.g., into the striatum and
substantia nigra regions of the brain, and into the spinal cord. A
subject diagnosed with Lewy body dementia can be administered an
iRNA agent directly into the brain, e.g., directly into the cortex
of the brain, and administration can be diffuse. In addition to an
agent which inhibits SNCA expression, e.g., an anti-SNCA iRNA
agent, a patient can be administered a second therapy, e.g., a
palliative therapy and/or disease-specific therapy. A palliative
therapy can be a dopaminergic therapy, for example, such as
methyldopa or coenzymeQ10.
[0718] In some embodiments, such as for the treatment of
Parkinson's Disease, the secondary therapy can be, for example,
symptomatic (e.g., for alleviating symptoms), neuroprotective
(e.g., for slowing or halting disease progression), or restorative
(e.g., for reversing the disease process). Symptomatic therapies
include the drugs carbidopa/levodopa, entacapone, tolcapone,
pramipexole, ropinerole, pergolide, bromocriptine, selegeline,
amantadine, and several anticholingergic agents. Deep brain
stimulation surgery as well as stereotactic brain lesioning may
also provide symptomatic relief. Neuroprotective therapies include,
for example, carbidopa/levodopa, selegeline, vitamin E, amantadine,
pramipexole, ropinerole, coenzyme Q10, and GDNF. Restorative
therapies can include, for example, surgical transplantation of
stem cells.
[0719] An anti-SNCA iRNA agent can be delivered to neural cells of
the brain. Delivery methods that do not require passage of the
composition across the blood-brain barrier can be utilized. For
example, a pharmaceutical composition containing an iRNA agent can
be delivered to the patient by injection directly into the area
containing the alpha-synuclein aggregates. For example, the
pharmaceutical composition can be delivered by injection directly
into the brain. The injection can be by stereotactic injection into
a particular region of the brain (e.g., the substantia nigra,
cortex, hippocampus, or globus pallidus). The iRNA agent can be
delivered into multiple regions of the central nervous system
(e.g., into multiple regions of the brain, and/or into the spinal
cord). The iRNA agent can be delivered into diffuse regions of the
brain (e.g., diffuse delivery to the cortex of the brain).
[0720] In one embodiment, the iRNA agent can be delivered by way of
a cannula or other delivery device having one end implanted in a
tissue, e.g., the brain, e.g., the substantia nigra, cortex,
hippocampus, or globus pallidus of the brain. The cannula can be
connected to a reservoir of iRNA agent. The flow or delivery can be
mediated by a pump, e.g., an osmotic pump or minipump. In one
embodiment, a pump and reservoir are implanted in an area distant
from the tissue, e.g., in the abdomen, and delivery is effected by
a conduit leading from the pump or reservoir to the site of
release. Devices for delivery to the brain are described, for
example, in U.S. Pat. Nos. 6,093,180, and 5,814,014.
[0721] An iRNA agent can be modified such that it is capable of
traversing the blood brain barrier. For example, the iRNA agent can
be conjugated to a molecule that enables the agent to traverse the
barrier. Such modified iRNA agents can be administered by any
desired method, such as by intraventricular or intramuscular
injection, or by pulmonary delivery, for example.
[0722] The anti-SNCA iRNA agent can be administered ocularly, such
as to treat retinal disorder, e.g., a retinopathy. For example, the
pharmaceutical compositions can be applied to the surface of the
eye or nearby tissue, e.g., the inside of the eyelid. They can be
applied topically, e.g., by spraying, in drops, as an eyewash, or
an ointment. Ointments or droppable liquids may be delivered by
ocular delivery systems known in the art such as applicators or eye
droppers. Such compositions can include mucomimetics such as
hyaluronic acid, chondroitin sulfate, hydroxypropyl methylcellulose
or poly(vinyl alcohol), preservatives such as sorbic acid, EDTA or
benzylchronium chloride, and the usual quantities of diluents
and/or carriers. The pharmaceutical composition can also be
administered to the interior of the eye, and can be introduced by a
needle or other delivery device which can introduce it to a
selected area or structure. The composition containing the iRNA
agent can also be applied via an ocular patch.
[0723] Administration can be provided by the subject or by another
person, e.g., a another caregiver. A caregiver can be any entity
involved with providing care to the human: for example, a hospital,
hospice, doctor's office, outpatient clinic; a healthcare worker
such as a doctor, nurse, or other practitioner; or a spouse or
guardian, such as a parent. The medication can be provided in
measured doses or in a dispenser which delivers a metered dose.
[0724] The subject can be monitored for reactions to the treatment,
such as edema or hemorrhaging. For example, the patient can be
monitored by MRI, such as daily or weekly following injection, and
at periodic time intervals following injection.
[0725] The subject can also be monitored for an improvement or
stabilization of disease symptoms. Such monitoring can be achieved,
for example, by serial clinical assessments (e.g., using the United
Parkinson's Disease Rating Scale) or functional neuroimaging.
Monitoring can also include serial quantitative measures of
striatal dopaminergic function (e.g., fluorodopa and positron
emission tomography) comparing treated subjects to normative data
collected from untreated subjects. Additional outcome measures can
include survival and survival free of palliative therapy and
nursing home placement. Statistically significant differences in
these measurements and outcomes for treated and untreated subjects
is evidence of the efficacy of the treatment.
[0726] A pharmaceutical composition containing an anti-SNCA iRNA
agent can be administered to any patient diagnosed as having or at
risk for developing a neurodegenerative disorder, such as a
synucleinopathy. In one embodiment, the patient is diagnosed as
having a neurodegenerative order, and the patient is otherwise in
general good health. For example, the patient is not terminally
ill, and the patient is likely to live at least 2, 3, 5, or 10
years or longer following diagnosis. The patient can be treated
immediately following diagnosis, or treatment can be delayed until
the patient is experiencing more debilitating symptoms, such as
motor fluctuations and dyskinesis in PD patients. In another
embodiment, the patient has not reached an advanced stage of the
disease, e.g., the patient has not reached Hoehn and Yahr stage 5
of PD (Hoehn and Yahr, Neurology 17:427-442, 1967). In another
embodiment, the patient is not terminally ill. In general, an
anti-SNCA iRNA agent can be administered by any suitable method. As
used herein, topical delivery can refer to the direct application
of an iRNA agent to any surface of the body, including the eye, a
mucous membrane, surfaces of a body cavity, or to any internal
surface. Formulations for topical administration may include
transdermal patches, ointments, lotions, creams, gels, drops,
sprays, and liquids. Conventional pharmaceutical carriers, aqueous,
powder or oily bases, thickeners and the like may be necessary or
desirable. Topical administration can also be used as a means to
selectively deliver the iRNA agent to the epidermis or dermis of a
subject, or to specific strata thereof, or to an underlying
tissue.
[0727] Compositions for intrathecal or intraventricular
administration may include sterile aqueous solutions which may also
contain buffers, diluents and other suitable additives.
[0728] Formulations for parenteral administration may include
sterile aqueous solutions which may also contain buffers, diluents
and other suitable additives. Intraventricular injection may be
facilitated by an intraventricular catheter, for example, attached
to a reservoir. For intravenous use, the total concentration of
solutes should be controlled to render the preparation
isotonic.
[0729] An anti-SNCA iRNA agent can be administered to a subject by
pulmonary delivery. Pulmonary delivery compositions can be
delivered by inhalation by the patient of a dispersion so that the
composition, preferably iRNA, within the dispersion can reach the
lung where it can be readily absorbed through the alveolar region
directly into blood circulation. Pulmonary delivery can be
effective both for systemic delivery and for localized delivery to
treat diseases of the lungs. In one embodiment, an anti-SNCA iRNA
agent administered by pulmonary delivery has been modified such
that it is capable of traversing the blood brain barrier.
[0730] Pulmonary delivery can be achieved by different approaches,
including the use of nebulized, aerosolized, micellular and dry
powder-based formulations. Delivery can be achieved with liquid
nebulizers, aerosol-based inhalers, and dry powder dispersion
devices. Metered-dose devices are preferred. One of the benefits of
using an atomizer or inhaler is that the potential for
contamination is minimized because the devices are self contained.
Dry powder dispersion devices, for example, deliver drugs that may
be readily formulated as dry powders. An iRNA composition may be
stably stored as lyophilized or spray-dried powders by itself or in
combination with suitable powder carriers. The delivery of a
composition for inhalation can be mediated by a dosing timing
element which can include a timer, a dose counter, time measuring
device, or a time indicator which when incorporated into the device
enables dose tracking, compliance monitoring, and/or dose
triggering to a patient during administration of the aerosol
medicament.
[0731] The term "therapeutically effective amount" is the amount
present in the composition that is needed to provide the desired
level of drug in the subject to be treated to give the anticipated
physiological response.
[0732] The term "physiologically effective amount" is that amount
delivered to a subject to give the desired palliative or curative
effect.
[0733] The term "pharmaceutically acceptable carrier" means that
the carrier can be taken into the lungs with no significant adverse
toxicological effects on the lungs.
[0734] The types of pharmaceutical excipients that are useful as
carrier include stabilizers such as human serum albumin (HSA),
bulking agents such as carbohydrates, amino acids and polypeptides;
pH adjusters or buffers; salts such as sodium chloride; and the
like. These carriers may be in a crystalline or amorphous form or
may be a mixture of the two.
[0735] Bulking agents that are particularly valuable include
compatible carbohydrates, polypeptides, amino acids or combinations
thereof. Suitable carbohydrates include monosaccharides such as
galactose, D-mannose, sorbose, and the like; disaccharides, such as
lactose, trehalose, and the like; cyclodextrins, such as
2-hydroxypropyl-.beta.-cyclodextrin; and polysaccharides, such as
raffinose, maltodextrins, dextrans, and the like; alditols, such as
mannitol, xylitol, and the like. A preferred group of carbohydrates
includes lactose, threhalose, raffinose maltodextrins, and
mannitol. Suitable polypeptides include aspartame. Amino acids
include alanine and glycine, with glycine being preferred.
[0736] Suitable pH adjusters or buffers include organic salts
prepared from organic acids and bases, such as sodium citrate,
sodium ascorbate, and the like; sodium citrate is preferred.
[0737] An anti-SNCA iRNA agent can be administered by an oral and
nasal delivery. For example, drugs administered through these
membranes have a rapid onset of action, provide therapeutic plasma
levels, avoid first pass effect of hepatic metabolism, and avoid
exposure of the drug to the hostile gastrointestinal (GI)
environment. Additional advantages include easy access to the
membrane sites so that the drug can be applied, localized and
removed easily. In one embodiment, an anti-SNCA iRNA agent
administered by oral or nasal delivery has been modified to be
capable of traversing the blood-brain barrier.
[0738] In one embodiment, unit doses or measured doses of a
composition that include iRNA are dispensed by an implanted device.
The device can include a sensor that monitors a parameter within a
subject. For example, the device can include a pump, such as an
osmotic pump and, optionally, associated electronics.
[0739] An iRNA agent can be packaged in a viral natural capsid or
in a chemically or enzymatically produced artificial capsid or
structure derived therefrom.
[0740] Dosage. An anti-SCNA iRNA agent can be administered at a
unit dose less than about 1.4 mg per kg of bodyweight, or less than
10, 5, 2, 1, 0.5, 0.1, 0.05, 0.01, 0.005, 0.001, 0.0005, 0.0001,
0.00005 or 0.00001 mg per kg of bodyweight, and less than 200 nmole
of RNA agent (e.g., about 4.4.times.1016 copies) per kg of
bodyweight, or less than 1500, 750, 300, 150, 75, 15, 7.5, 1.5,
0.75, 0.15, 0.075, 0.015, 0.0075, 0.0015, 0.00075, 0.00015 nmole of
RNA agent per kg of bodyweight. The unit dose, for example, can be
administered by injection (e.g., intravenous or intramuscular,
intrathecally, or directly into the brain), an inhaled dose, or a
topical application. Particularly preferred dosages are less than
2, 1, or 0.1 mg/kg of body weight.
[0741] Delivery of an iRNA agent directly to an organ (e.g.,
directly to the brain) can be at a dosage on the order of about
0.00001 mg to about 3 mg per organ, or preferably about
0.0001-0.001 mg per organ, about 0.03-3.0 mg per organ, about
0.1-3.0 mg per eye or about 0.3-3.0 mg per organ.
[0742] The dosage can be an amount effective to treat or prevent a
disease or disorder, e.g., a disease or disorder associated with
synucleinopathies.
[0743] In one embodiment, the unit dose is administered less
frequently than once a day, e.g., less than every 2, 4, 8 or 30
days. In another embodiment, the unit dose is not administered with
a frequency (e.g., not a regular frequency). For example, the unit
dose may be administered a single time.
[0744] In one embodiment, the effective dose is administered with
other traditional therapeutic modalities. In one embodiment, the
subject has PD and the modality is a therapeutic agent other than
an iRNA agent, e.g., other than a double-stranded iRNA agent, or
sRNA agent. The therapeutic modality can be, for example, levadopa
or depronil.
[0745] In one embodiment, a subject is administered an initial
dose, and one or more maintenance doses of an iRNA agent, e.g., a
double-stranded iRNA agent, or sRNA agent, (e.g., a precursor,
e.g., a larger iRNA agent which can be processed into an sRNA
agent, or a DNA which encodes an iRNA agent, e.g., a
double-stranded iRNA agent, or sRNA agent, or precursor thereof).
The maintenance dose or doses are generally lower than the initial
dose, e.g., one-half less of the initial dose. A maintenance
regimen can include treating the subject with a dose or doses
ranging from 0.01 .mu.g to 1.4 mg/kg of body weight per day, e.g.,
10, 1, 0.1, 0.01, 0.001, or 0.00001 mg per kg of bodyweight per
day. The maintenance doses are preferably administered no more than
once every 5, 10, or 30 days. Further, the treatment regimen may
last for a period of time which will vary depending upon the nature
of the particular disease, its severity and the overall condition
of the patient. In preferred embodiments the dosage may be
delivered no more than once per day, e.g., no more than once per
24, 36, 48, or more hours, e.g., no more than once every 5 or 8
days. Following treatment, the patient can be monitored for changes
in his condition and for alleviation of the symptoms of the disease
state. The dosage of the compound may either be increased in the
event the patient does not respond significantly to current dosage
levels, or the dose may be decreased if an alleviation of the
symptoms of the disease state is observed, if the disease state has
been ablated, or if undesired side-effects are observed.
[0746] The effective dose can be administered in a single dose or
in two or more doses, as desired or considered appropriate under
the specific circumstances. If desired to facilitate repeated or
frequent infusions, implantation of a delivery device, e.g., a
pump, semi-permanent stent (e.g., intravenous, intraperitoneal,
intracisternal or intracapsular), or reservoir may be
advisable.
[0747] In one embodiment, the iRNA agent pharmaceutical composition
includes a plurality of iRNA agent species. In another embodiment,
the iRNA agent species has sequences that are non-overlapping and
non-adjacent to another species with respect to a naturally
occurring target sequence. In another embodiment, the plurality of
iRNA agent species is specific for different naturally occurring
target genes. In another embodiment, the iRNA agent is allele
specific.
[0748] Following successful treatment, it may be desirable to have
the patient undergo maintenance therapy to prevent the recurrence
of the disease state, wherein the compound of the invention is
administered in maintenance doses, ranging from 0.01 .mu.g to 100 g
per kg of body weight (see U.S. Pat. No. 6,107,094).
[0749] The concentration of the iRNA agent composition is an amount
sufficient to be effective in treating or preventing a disorder or
to regulate a physiological condition in humans. The concentration
or amount of iRNA agent administered will depend on the parameters
determined for the agent and the method of administration, e.g.
nasal, buccal, or pulmonary. For example, nasal formulations tend
to require much lower concentrations of some ingredients in order
to avoid irritation or burning of the nasal passages. It is
sometimes desirable to dilute an oral formulation up to 10-100
times in order to provide a suitable nasal formulation.
[0750] Certain factors may influence the dosage required to
effectively treat a subject, including but not limited to the
severity of the disease or disorder, previous treatments, the
general health and/or age of the subject, and other diseases
present. Moreover, treatment of a subject with a therapeutically
effective amount of an iRNA agent, e.g., a double-stranded iRNA
agent, or sRNA agent (e.g., a precursor, e.g., a larger iRNA agent
which can be processed into a sRNA agent, or a DNA which encodes an
iRNA agent, e.g., a double-stranded iRNA agent, or sRNA agent, or
precursor thereof) can include a single treatment or, preferably,
can include a series of treatments. It will also be appreciated
that the effective dosage of an iRNA agent such as an sRNA agent
used for treatment may increase or decrease over the course of a
particular treatment. Changes in dosage may result and become
apparent from the results of diagnostic assays as described herein.
For example, the subject can be monitored after administering an
iRNA agent composition. Based on information from the monitoring,
an additional amount of the iRNA agent composition can be
administered.
[0751] Dosing is dependent on severity and responsiveness of the
disease condition to be treated, with the course of treatment
lasting from several days to several months, or until a cure is
effected or a diminution of disease state is achieved. Optimal
dosing schedules can be calculated from measurements of drug
accumulation in the body of the patient. Persons of ordinary skill
can easily determine optimum dosages, dosing methodologies and
repetition rates. Optimum dosages may vary depending on the
relative potency of individual compounds, and can generally be
estimated based on EC50s found to be effective in in vitro and in
vivo animal models. In some embodiments, the animal models include
transgenic animals that express a human gene, e.g., a gene that
produces a target RNA, e.g., an SNCA RNA. The transgenic animal can
be deficient for the corresponding endogenous RNA. In another
embodiment, the composition for testing includes an iRNA agent that
is complementary, at least in an internal region, to a sequence
that is conserved between the target RNA in the animal model and
the target RNA in a human.
[0752] Kits. In certain other aspects, the invention provides kits
that include a suitable container containing a pharmaceutical
formulation of an iRNA agent, e.g., a double-stranded iRNA agent,
or sRNA agent, (e.g., a precursor, e.g., a larger iRNA agent which
can be processed into a sRNA agent, or a DNA which encodes an iRNA
agent, e.g., a double-stranded iRNA agent, or sRNA agent, or
precursor thereof). In certain embodiments the individual
components of the pharmaceutical formulation may be provided in one
container. Alternatively, it may be desirable to provide the
components of the pharmaceutical formulation separately in two or
more containers, e.g., one container for an iRNA agent preparation,
and at least another for a carrier compound. The kit may be
packaged in a number of different configurations such as one or
more containers in a single box. The different components can be
combined, e.g., according to instructions provided with the kit.
The components can be combined according to a method described
herein, e.g., to prepare and administer a pharmaceutical
composition. The kit can also include a delivery device.
[0753] The invention is further illustrated by the following
examples, which should not be construed as further limiting.
EXAMPLES
Example 1
Design of iRNA Agents Targeting SNCA
[0754] Double stranded RNAs having the sequences described in Table
1 were synthesized. FIG. 1A shows the sequence of the full-length
SNCA mRNA, and the target sites of the dsRNAs SNCA1-9 (Table
1).
[0755] The sequences of SNCA6, 7, 8, and 9 were designed using the
dsRNA Selection Tool developed at the Whitehead Institute
(Cambridge, Mass.) and available free on-line. By using the dsRNA
Selection Tool, all possible siRNAs having a GC content between 30
and 70% were selected, except (a) any sequences containing runs of
four or more A, T or G residues, and (b) any sequences with more
than seven consecutive GC pairs in a row. A total of 237 candidate
siRNAs matched this criteria. The 237 candidate siRNAs were then
screened against the human UniGene database (Pontius et al.,
UniGene: a unified view of the transcriptome. In: The NCBI
Handbook. Bethesda (MD): National Center for Biotechnology
Information; 2003) to identify those siRNAs having a sequence that
only matched human alpha-synuclein. The screening was performed
using BLAST search technology (Altschul et al., Nucleic Acids Res.
25:3389-3402, 1997). The identified subset of siRNAs was screened
against mouse UniGene using BLAST to identify those siRNAs having a
sequence that only matches the alpha-synuclein gene in mouse.
Thirteen sequences were identified, and four non-overlapping
duplexes (SNCA6, 7, 8, and 9) were selected for use in the assays
described below.
TABLE-US-00003 TABLE 1 dsRNA sequences SED ID dsRNA.sup.a NO Strand
Sequence.sup.b SNCA1 3 Sense 5'-GGUGUGGCAA CAGUGGCUGAG-3' 4 Anti-
3'-UACCACACCGU sense UGUCACCGACUC-5' SNCA2 5 Sense 5'-AACAGUGGCU
GAGAAGACCAA-3' 6 Anti- 3'-CGUUGUCACCG sense ACUCUUCUGGUU-5' SNCA3 7
Sense 5'-AUUGCAGCAG CCACUGGCUUU-3' 8 Anti- 3'-CGUAACGUCGU sense
CGGUGACCGAAA-5' SNCA4 9 Sense 5'-AAGUGACAAA UGUUGGAGGAG-3' 10 Anti-
3'-CGUUCACUGUU sense UACAACCUCCAC-5' SNCA5 11 Sense 5'-GAAGAAGGAG
CCCCACAGGAA-3' 12 Anti- 3'-UACUUCUUCCU sense CGGGGUGUCCUU-5' SNCA6
13 Sense 5'-CGGGUGUGACA GCAGUAGCdTdT-3' 14 Anti- 3'-dTdTGCCCACA
sense CUGUCGUCAUCG-5' SNCA7 15 Sense 5'-UCCUGACAAUG AGGCUUAUdTdT-3'
16 Anti- 3'-dTdTAGGACUG sense UUACUCCGAAUA-5' SNCA7s 17 Sense
5'-U*CCUGACAAUG AGGCUUAUdT*dT-3' 18 Anti- 3'-dT*dTAGGACUG sense
UUACUCCGAAU*A-5' SNCA8 19 Sense 5'-CUACGAACCUG AAGCCUAAdTdT-3' 20
Anti- 3'-dTdTGAUGCUU sense GGACUUCGGAUU-5' SNCA8s1 21 Sense
5'-C*UACGAACCUG AAGCCUAAdT*dT-3' 22 Anti- 3'-dT*dTGAUGCUU sense
GGACUUCGGAU*U-5' SNCA8s2 23 Sense 5'-C*UACGAACCUG AAGCCUAAdT*dT-3'
24 Anti- 3'-dT*dTGAUGCUU sense GGACUUCGGAU*U-5' SNCA9 25 Sense
5'-CUAUUGUAGAG UGGUCUAUdTdT-3' 26 Anti- 3'-dTdTGAUAACA sense
UCUCACCAGAUA-5' ALN-DP- 27 Sense 5'-GAACUGUGUGUG 3000
AGAGGUCCU-3'-F 28 Anti- 3'-C*C*CUUGACAC sense ACACUCUCCAGGA-5'
SiRNA Mr 29 Sense 5'-GACGUAAACG GCCACAAGUUC-3' 30 Anti-
3'-CGCUGCAUUU sense GCCGGUGUUCA-5' SNCA8s2m 50 Sense
5'-C*UAUGAGCCUG AAGCCUAAdT*dT-3' 51 Anti- 3'-dT*dTGAUACUCG sense
GACUUCGGAU*U-5' .sup.aSNCA name designations are equivalent to Mayo
designations (e.g., SNCA1 is equivalent to Mayo1);
.sup.bnucleotides marked with * carry a phosphorothioate
modification; underlined nucleotides carry a 2'-O-Me modification;
"F" indicates a fluorescein conjugate
Example 2
SNCA dsRNAs Decreased Protein Expression In Vitro
[0756] Neuroblastoma cells (BE(2)-M17) were co-transfected with 50
nM dsRNA and a plasmid expressing either EGFP or an
.alpha.-synuclein-EGFP (EGFP/NACP) fusion protein (as used herein
NACP is synonymous with the gene product of SNCA). Expression of
the EGFP and EGFP/NACP fusion proteins was assayed by Western blot
analysis (FIG. 2).
[0757] The in vitro cell-based assay monitors the ability of the
test dsRNAs of Table 1 to downregulate expression of an SNCA RNA.
The SNCA target RNA in these experiments is fused to an EGFP RNA.
Antibodies against EGFP facilitate the detection of an EGFP/NACP
fusion protein translated from the RNA.
[0758] Control experiments used in this assay included the use of a
dsRNA targeting a luciferase RNA (see the lanes marked "siRNA Mr"
in FIG. 2), and cells not transfected with siRNA. Antibodies
against alpha tubulin were used as controls to monitor the amount
of total protein loaded in each lane. The control experiments
indicated that EGFP and the EGFP/NACP proteins are expressed in
about equal amounts when in the absence of anti-SNCA dsRNA. The
strongest down-regulatory effect of EGFP/NACP expression was
observed with Mayo2, Mayo7, and Mayo8 dsRNAs (as used herein, MayoX
siRNAs are synonymous with SNCAX dsRNAs). A weaker effect was
observed with Mayo1, Mayo6, and Mayo9 dsRNAs. siRNA Mr affected
expression of both the vector derived EGFP and the EGFP/NACP
conjugate, demonstrating the suitability of the assay.
[0759] The inhibitory effect of the most effective dsRNAs (Mayo2,
Mayo7, and Mayo8) was examined at varying dsRNA concentrations
during a 24 h incubation (FIG. 3). The IC.sub.50 value was
determined to be less than 1 nM.
[0760] The inhibitory effect of the most effective siRNAs was
tested in slowly-dividing neuroblastoma cells in cultures with low
levels of serum. BE(2)-M17 cells were transfected with a plasmid
expressing the EGFP/NACP fusion protein alone (control) or
cotransfected with the dsRNAs Mayo2, Mayo7, or Mayo8. Expression of
the EGFP/NACP protein was monitored over a period of six days.
Fusion protein expression was observed to be effectively silenced
for at least three days (FIG. 4). The dsRNAs also inhibited
endogenous protein expression in similar cells for at least three
days (FIG. 5). The Mayo2, Mayo7, and Mayo8 siRNAs also inhibited
expression of endogenous alpha synuclein RNA in slowly dividing
cells (FIG. 6). After 6 days, Mayo2 and Mayo8 continued to
effectively inhibit endogenous SNCA expression. Levels of alpha
synuclein mRNA in the cells were measured by the Taqman.RTM. method
of quantitative RT-PCR normalized against 18S rRNA expression
levels. Mayo9, which targets the 3'UTR of SNCA, did not inhibit
expression of endogenous alpha synuclein RNA.
[0761] The efficacy of the Mayo2, 7, and 8 dsRNAs were tested
against mouse SNCA. Cells were cotransfected with the dsRNAs and a
plasmid encoding EGFP alone (vector) or EGFP-NACP of human or mouse
origin. Expression of EGFP and EGFP-NACP was assayed by Western
blot. While all three dsRNAs inhibited expression of human
EGFP-NACP, only Mayo2 inhibited expression in mouse EGFP-NACP (FIG.
7). The human and mouse mRNA sequence is identical at the Mayo2
locus, but diverges by two nucleotides at each of the Mayo7 and
Mayo8 loci.
[0762] SNCB (beta-synuclein) shares sequence similarity with
alpha-synuclein at the Mayo2 locus, but differs in sequence by four
nucleotides. The efficacy of the Mayo2 was tested against SNCB.
BE(2)-M17 cells were transfected with a plasmid expressing the
dsRNAs Mayo2 or Mayo9. Expression of endogenous SNCA and SNCB RNA
was assayed by Taqman.RTM. method quantitative RT-PCR. Mayo2
inhibited expression of SNCA but not expression of SNCB (FIG. 11).
As was expected, Mayo9 did not inhibit expression of SNCB or
SNCA.
Example 3
Stability of SNCA siRNAs
[0763] The stability of the sense and antisense strands of the SNCA
siRNAs was examined in 90% mouse serum or 90% human serum, and in
mouse brain tissue. To perform the stability assays, siRNA was
radioactively labeled on the sense or antisense strand (both
strands were assayed for stability in the serum and brain tissue).
Protein extracts were prepared from mouse brain, and 100 nM siRNA
duplex was incubated with the extract at 37.degree. C. At time
points over the course of 4-5 hours, sample was removed and
analyzed on a polyacrylamide denaturing gel.
[0764] The stability of Mayo2, 7, and 8 was tested in mouse serum
and brain extract. Further, the cleavage sites of Mayo7 and Mayo8
were mapped by T1 analysis (FIGS. 8A and 8B). RNAse T1 cleaves 3'
of G nucleotides, and T1 digestion of an RNA that has a known
sequence provides orientation and a basis for comparison to detect
non-RNAse T1 cleavage sites. T1 was used to map the cleavage sites
of Mayo7 (also called SNCA7, or AL-DUP-1477) and Mayo8 (also called
SNCA8, or AL-DUP-1478) siRNAs (FIGS. 8A and 8B, respectively, and
Table 1). Mayo7 and 8 were 5' end labeled with .sup.32P on the
sense strand, and RNAse T1 digestion was performed for four hours.
The samples were analyzed by electrophoresis. Mayo7 was found to be
susceptible to endonucleolytic cleavage 3' of U16 and U17. Mayo8
was found to be susceptible to endonucleolytic cleavage 3' of
U16.
[0765] To increase stability of the Mayo7 and Mayo8 siRNAs,
nucleotides were modified with a 2'-O-Me group or a
phosphorothioate linkage to create Mayo7s, Mayo8s1, and Mayo8s2
(Table 1). The modified siRNAs (50 nM) were cotransfected with an
EGFP-NACP vector into cells as described above. Untransfected cells
served as a control. Gene expression was monitored by Western blot
analysis. Each of the three modified siRNAs inhibited expression of
the EGFP-NACP construct (FIGS. 9A and 9B).
[0766] The modified and unmodified Mayo8 siRNAs were analyzed by
Stains-All (cat. #E9379, Sigma, St. Louis, Mo.), which was
performed as follows. All solutions were prepared in nuclease-free
water (cat. #9930, Ambion, Austin, Tex.), using nuclease-free
reagents. A 50 .mu.M stock of dsRNA for use in the stability assays
was prepared by mixing 50 .mu.M sense strand RNA and 50 .mu.M
antisense strand in 1.times.PBS. This mixture was incubated at
90.degree. C. for 2 minutes to denature the nucleic acids, then
37.degree. C. for one hour for annealing.
[0767] To perform the stability assay, human serum from clotted
male whole blood type AB (cat. #H1513, Sigma, St. Louis, Mo.) was
used. Serum was thawed on ice, and mixed with dsRNA to a final
concentration of about 4.5 .mu.M (i.e., about 4.2 .mu.g, or about
300 pmoles dsRNA). At time point "0," one control sample was frozen
on dry ice immediately following addition of dsRNA to serum, and
the sample was stored at -80.degree. C. For other time points (15,
30, 60, 120, and 240 minutes in human serum), the samples were
incubated at 37.degree. C. in a Thermomixer (Eppendorf, Hamburg,
Germany). At each endpoint, the samples were frozen on dry-ice and
stored at -80.degree. C.
[0768] To extract the RNA from the serum, samples were thawed on
ice, and then 0.5 M NaCl (nuclease free; cat #9760, Ambion, Austin,
Tex.) was added to the sample to yield a final concentration of
about 0.45 M NaCl. The sample was vortexed briefly (about 5
seconds), and then transferred to a prepared and chilled Phase
Lock-Gel-Eppis (Eppendorf, Hamburg, Germany). Five hundred
microliters phenol:chloroform:isoamyl alcohol (25:24:1) and 300
.mu.L chloroform were added to the mix. The sample was vortexed
briefly for 30 seconds, then centrifuged at 13,200 rpm for 15
minutes at 4.degree. C.
[0769] The aqueous phase was transferred to a clean eppendorf tube,
and 3M NaOAc, pH 5.2, was added to a final concentration of about
0.1M NaOAc. The solution was vortexed for about 20 seconds and then
1 .mu.L of Glyco Blue (Ambion, Austin, Tex.) was added. The
solution was vortexed briefly and gently, then 1 mL ice-cold 100%
ethanol was added. The solution was vortexed for about 20 seconds,
then stored at -80.degree. C. for one hour, or at -20.degree. C.
overnight to precipitate the RNA. Following precipitation, the
mixture was centrifuged at 13,200 rpm for 30 min. at 4.degree. C.,
and the RNA pellet was washed with 500 .mu.L 70% ethanol. The
pellet was air-dried, then 30 .mu.L of gel loading buffer (95%
formamide, 50 mM EDTA, Xylenecyanol, bromophenol blue) was added to
the mix, and the mix vortexed for 2 minutes to resuspend.
[0770] The RNA sample was analyzed on a 20 cm.times.20 cm.times.0.8
mm (length.times.width.times.thickness) 20% polyacrylamide gel. To
make the gel, 24 g 8 M Urea, 25 mL 40% (19:1) Acrylamide, and 8 mL
formamide was mixed in 1.times.TBE in a 50 mL solution.
Polymerization was activated by 50 uL Temed and 200 uL 10% APS
(ammonium persulfate). The gel was run in 1.times.TBE. The gel was
pre-run for 30 minutes at 40 mA. The samples were heated at
100.degree. C. for 5 min. and then immediately chilled on ice. For
control experiments, 2 .mu.L of dsRNA was mixed with 8 .mu.L of gel
loading buffer. The samples were centrifuged at 13,200 rpm (20
seconds, 4.degree. C.) and 10 .mu.L was loaded onto the gel. The
gel was run for about one hour at 40 mA.
[0771] To visualize the RNA, the gel was stained with Stains-All
solution (cat. #E9379, Sigma, St. Louis, Mo.) (100 mg Stains-All
dissolved in 800 mL formamide:water (1:1 v/v)) for 30 minutes. The
gel was destained in water for 30-60 minutes as needed. The gel was
them imaged on a scanner and analyzed.
[0772] The results of the stability assay are shown in FIGS. 10A,
10B and 10C. Comparison indicates that the unmodified SNCA8 dsRNA
is rapidly degraded, the partially modified dsRNA (SNCA8s1) is
partially stabilized, and the further modified SNCA8s2) is the most
stable of the three duplexes.
Example 4
In Vivo Analysis of siRNA Biodistribution
[0773] To determine whether siRNA could be delivered into neural
cells in vivo, siRNA targeting luciferase (ALN-DP-3000) (Table 1)
was conjugated with a fluorescein label and administered to
distinct areas of mouse brain by stereotactic injection (Table 2).
ALN-DP-3000 was injected into the cortex, the hippocampus, and the
globus pallidus areas of the brain. At different time points
post-injection, brain tissue was harvested, sectioned, and examined
microscopically for the localization of the fluorescently-labeled
siRNA. In all brain regions examined (cortex, hippocampus, and
globus pallidus), and at all time points post-injection, siRNA was
found to localize to extracellular spaces as well as
intracellularly.
TABLE-US-00004 TABLE 2 Analysis of ALN-DP-3000 biodistribution in
brain tissue Stereotactic Time post-injection Injection Site
coordinates of tissue analysis Cortex AP -0.0 1 hr. L -3.5 DV -1.8
Cortex AP -0.0 24 hr. L -3.5 DV -1.8 Hippocampus AP -1.8 1 hr. L
-2.2 DV -1.2 Hippocampus AP -1.8 24 hr. L -2.2 DV -1.2 Globus
Pallidus AP -0.3 1 hr. L -1.8 DV -3.5 Globus Pallidus AP -0.3 2 hr.
L -1.8 DV -3.5 Globus Pallidus AP -0.3 4 hr. L -1.8 DV -3.5
[0774] To assess activity in vivo, siRNA duplexes were administered
by stereotactic injection to the substantia nigra of wild-type mice
(C57BL/6 mice; Taconic, Germantown, N.Y.). Coordinates for
stereotactic injection were as follows: AP -3.4 mm; L -1.5 mm; DV
-3.8 mm. Three animals each received two microliters of a 200 .mu.M
solution of Mayo-8s2m siRNA in phosphate buffered saline (PBS)
(Table 1; FIG. 12A, bars labeled "E"). As a control, three animals
were injected with PBS (FIG. 12B, bars labeled "C"). Twenty-four
hours after injection, animals were sacrificed and brains were
removed. Tissue blocks encompassing the injection track were
dissected and total RNA was isolated from about 100 mg of tissue
using Trizol reagent (Invitrogen, Carlsbad, Calif.). Taqman.RTM.
quantitative RT-PCR (Applied Biosystems, Foster City, Calif.) was
used to measure relative levels of alpha-synuclein mRNA. As a
normalization standard, 18S rRNA was measured separately
("individual tube") or in the same Taqman.RTM. reaction with
alpha-synuclein ("duplex"). Reverse transcription was performed at
48.degree. C. for 30 minutes, and PCR was performed for 40 cycles
of (95.degree. C. for 15 sec., 65.degree. C. for 1 min.). Each
experiment was performed three times, and in each experiment,
reactions were performed in quadruplicate. The comparative count
method (.DELTA..DELTA.Ct) was used to determine relative levels of
alpha synuclein compared to control (Heid et al., Genome Res.
6:986-994, 1996). SDS 2.1 software (Applied Biosystems, Foster
City, Calif.) was applied with automatic threshold values and
automatic outlier removal.
[0775] The preliminary results shown in FIGS. 12A and 12B indicated
that, on average, the Mayo-8s2m siRNA specifically decreased SNCA
mRNA levels in mouse brain, as relative levels of the control 18S
rRNA were not affected.
Example 5
Silencing of Endogenous Alpha-Synuclein by Intraparenchymal
Infusion of siRNA
[0776] Methods
[0777] Using stereotactic surgery, infusion cannulae were implanted
into the hippocampus of eight-week old, female B6 mice (coordinates
from bregma: x=(-)2.0, y=(-)1.5, z=2.0 calculated from Paxinos and
Franklin, The Mouse Brain in Stereotaxic Coordinates). Cannulae
were implanted into the right hemisphere of the brain. The cannulae
were connected via catheters to osmotic mini-pumps (Alzet model
1002) containing approximately one hundred microliters of 2.1 mM
siRNA solution in Phosphate Buffered Saline (PBS). The pumps were
implanted subcutaneously. The infusion rate of 0.25 microliters per
hour resulted in a dose of approximately 180 micrograms of siRNA
per day. Infusion continued for a period of fifteen days. Treatment
groups were: PBS (n=10), alpha-synuclein duplex (SNCA siRNA; n=8),
cholesterol conjugated alpha-synuclein duplex (SNCA siRNA-chol;
n=8), luciferase control duplex (n=8), cholesterol conjugated
luciferase control duplex (n=10). The sequences of the duplexes, as
well as chemical modifications are shown below in Table 3.
TABLE-US-00005 TABLE 3 siRNA Sequence Luc control S 5'
cuuAcGcuGAGuAcuucGATsT 3' AS 5' UCGAAGuACUcAGCGuAAGTsT 3' Luc
control S 5' cuuAcGcuGAGuAcuucGATsTs- chol chol 3' AS 5'
UCGAAGuACUcAGCGuAAGTsT 3' SNCA S 5' CsuAUGAGCCUGAAGCcuaATsT 3' AS
5'usuAGGCUUCAGGCUCAuAGTsT 3' SNCA chol S 5'
CsuAUGAGCCUGAAGCcuaATsT- chol 3' AS 5' usuAGGCUUCAGGCUCAuAGTsT 3'
Key A, C, G, U-ribonucleotides c, u-2'-OMe nucleotides
s-phosphorothioate linkage T-thymidine
[0778] Following the infusion period, brains were collected and the
regions corresponding to the hippocampus were dissected from each
hemisphere. Total RNA was isolated and used to prepare cDNA by
random hexamer priming. Relative levels of alpha-synuclein were
measured by TaqMan.RTM. quantitative PCR using gene expression MGB
probes (SNCA Mm0044733_ml, GAPDH Mm99999915_gl, HPRT Mm00446968_ml,
Tau Mm00521988_ml; Applied Biosystems). For more accurate
normalization among tissues, levels of GAPDH, HPRT and tau were
measured and used to determine a normalization factor. Relative
levels of alpha-synuclein were calculated for the right and left
hemispheres from each animal, and group means and standard
deviations were calculated.
[0779] Results
[0780] A decrease of alpha-synuclein expression of approximately
30% (right vs left side) was measured in the animals infused with
the SCNA siRNA. Statistical significance (p=0.036) was determined
by T-test (FIG. 13).
Example 7
In Situ Hybridization Showing Silencing of Endogenous
.alpha.-Synuclein by Intraparenchymal Infusion of siRNA
[0781] Infusion cannulae were implanted into the hippocampus of
eight-week old, female B6 mice (coordinates from bregma: x=(-)2.0,
y=(-)1.5, z=2.0 calculated from Paxinos and Franklin, The Mouse
Brain in Stereotaxic Coordinates). The cannulae were connected via
catheters to osmotic mini-pumps (Alzet model 1002) containing
approximately one hundred microliters of 2.1 mM siRNA solution in
Phosphate Buffered Saline (PBS). The pumps were implanted
subcutaneously. The infusion rate of 0.25 microliters per hour
resulted in a dose of approximately 180 micrograms of siRNA per
day. Infusion continued for a period of fifteen days. Treatment
groups were: PBS (n=10), alpha-synuclein duplex (SNCA siRNA; n=9),
luciferase control duplex (n=10). The sequences of the duplexes, as
well as chemical modifications are shown below (Table 4).
TABLE-US-00006 TABLE 4 siRNA Sequence Luc control S 5'
cuuAcGcuGAGuAcuucGATsT 3' AS 5' UCGAAGuACUcAGCGuAAGTsT 3' SNCA S 5'
CsuAUGAGCCUGAAGCcuaATsT 3' AS 5' usuAGGCUUCAGGCUCAuAGTsT 3' Key
A,C,G,U-ribonucleotides c,u-2'-OMe nucleotides s-phosphorothioate
linkage T-thymidine
[0782] Following the infusion period, brains were dissected
rapidly. To ensure sampling consistency, the brain was placed in a
tissue matrix and the region anterior and posterior to the
hippocampus was removed using a flat blade. The resulting three
brain segments were snap frozen on dry ice and stored at
-80.degree. C. until use. Frozen sections were cut at 15 .mu.m on a
cryostat at -18.degree. C. throughout the entire hippocampus and
air dried for 20 minutes before freezing at -80.degree. C. On the
day of the experiment, frozen sections were removed on dry ice and
dried quickly on a slide warmer at 55.degree. C., then fixed in 4%
paraformaldehyde in 0.1M Sorensen's Phosphate buffer for 20
minutes, washed twice in PBS and then dehydrated in ascending
alcohols. Hybridization was then performed at 37.degree. C.
overnight, in a moist chamber, with approximately 0.02 ng of
[.alpha.-.sup.33P] dATP 3' end labeled probe per 1 .mu.l of
hybridization buffer (4.times.SSC, 1.times.Denhardt's solution, 50%
(w/v) de-ionised formamide, 10% (w/v) dextran sulphate, 200
mg/.mu.l herring sperm DNA). The probe
(5'GGTCTTCTCAGCCACTGTTGTCACTCCATGAACCAC'3) was designed to exon 3
on mouse SNCA. Specific activity of the probe was
>1.times.10.sup.8 cpm/.mu.g and after dilution in hybridization
buffer corresponded to .about.1.times.10.sup.4 cpm/.mu.l. Control
hybridizations were also set up that contained a 50-fold molar
excess of unlabelled probe to determine non-specific signal. Slides
were washed in 1.times.SSC at room temperature (RT) to remove
excess hybridization buffer; three times, each for 30 minutes, at
55.degree. and at RT for 60 minutes. Slides were then dipped for 30
seconds in 70% (v/v) ethanol/300 mM ammonium acetate, then for 30
seconds in absolute alcohol, air dried and co-exposed with .sup.14C
microscale standards (Amersham) to Biomax MS film (Kodak) for 7-10
days.
[0783] The Metamorph software (Universal imaging) was used to
perform densitometry. Specifically, optical density of mRNA labeled
with the SNCA specific probe was measured in a standard square with
and area of 240 pixels.sup.2 in the cortex. Optical density was
measured and values were compared to optical density of the known
.sup.14C standards. From these values and a graph was constructed
and concentration of radioactivity in nCi/g in each sample was
extrapolated. A t-test was used to determine if there was
difference between groups.
[0784] Results
[0785] There was a reduction in the expression of siRNA in the
hippocampus and cortex in the injected side (right) compared
uninjected side (left) of the siRNA treated animal (B). The PBS
animal did not show a reduction in the injected side (A) in all the
animals used in the in situ hybridization experiment (n=3).
Densitometry analysis of the in situ hybridization film showed
significant reduction (.about.60%) in SNCA mRNA expression in the
injected side compared to the uninjected side (C) of the cortex
(*p=0.003, t-test). Boxes in A and B show cortical region measured
(FIG. 14).
Example 7
Method of Treating a Patient Diagnosed with a Synucleinopathy
[0786] A patient diagnosed with a synucleinopathy can be
administered a pharmaceutical composition containing an iRNA agent
that targets the SCNA gene. The composition can be delivered
directly to the brain by a device that includes an osmotic pump and
mini-cannula and is bilaterally implanted into the patient.
[0787] Prior to implantation of the device, the patient receives an
MRI with stereotactic frame. A computer-guided trajectory is used
for delivery of the cannula to the brain. The mini-pump device is
implanted into the abdomen, and then the patient is hospitalized
for 2-3 days to monitor for hemorrhaging.
[0788] Approximately two weeks post-implantation of the pump, the
patient can receive an MRI to check the implanted device. If the
human is healing well, and no complications have occurred as a
result of implanting the device, then the anti-SNCA composition can
be infused into the pump, and into the cannula. A test dose of the
anti-SNCA agent can be administered prior to the initiation of the
therapeutic regimen.
[0789] MRIs taken at 3 months, six months, and one year following
the initial treatment can be used to monitor the condition of the
device, and the reaction of the patient to the device and treatment
with the iRNA agent. Clinicians should watch for the development of
edema and an inflammatory response. Following the one-year
anniversary of the initiation of the treatment, MRIs can be
performed as needed.
[0790] The patient can be monitored for an improvement or
stabilization in disease symptoms throughout the course of the
therapy. Monitoring can include serial clinical assessments and
functional neuroimaging, e.g., by MRI.
Other Embodiments
[0791] A number of embodiments of the invention have been
described. Nevertheless, it will be understood that various
modifications may be made without departing from the spirit and
scope of the invention. Accordingly, other embodiments are within
the scope of the following claims.
Sequence CWU 1
1
5911543DNAHomo sapiensCDS(47)..(466) 1ggagtggcca ttcgacgaca
gtgtggtgta aaggaattca ttagcc atg gat gta 55 Met Asp Val 1ttc atg
aaa gga ctt tca aag gcc aag gag gga gtt gtg gct gct gct 103Phe Met
Lys Gly Leu Ser Lys Ala Lys Glu Gly Val Val Ala Ala Ala 5 10 15gag
aaa acc aaa cag ggt gtg gca gaa gca gca gga aag aca aaa gag 151Glu
Lys Thr Lys Gln Gly Val Ala Glu Ala Ala Gly Lys Thr Lys Glu20 25 30
35ggt gtt ctc tat gta ggc tcc aaa acc aag gag gga gtg gtg cat ggt
199Gly Val Leu Tyr Val Gly Ser Lys Thr Lys Glu Gly Val Val His Gly
40 45 50gtg gca aca gtg gct gag aag acc aaa gag caa gtg aca aat gtt
gga 247Val Ala Thr Val Ala Glu Lys Thr Lys Glu Gln Val Thr Asn Val
Gly 55 60 65gga gca gtg gtg acg ggt gtg aca gca gta gcc cag aag aca
gtg gag 295Gly Ala Val Val Thr Gly Val Thr Ala Val Ala Gln Lys Thr
Val Glu 70 75 80gga gca ggg agc att gca gca gcc act ggc ttt gtc aaa
aag gac cag 343Gly Ala Gly Ser Ile Ala Ala Ala Thr Gly Phe Val Lys
Lys Asp Gln 85 90 95ttg ggc aag aat gaa gaa gga gcc cca cag gaa gga
att ctg gaa gat 391Leu Gly Lys Asn Glu Glu Gly Ala Pro Gln Glu Gly
Ile Leu Glu Asp100 105 110 115atg cct gtg gat cct gac aat gag gct
tat gaa atg cct tct gag gaa 439Met Pro Val Asp Pro Asp Asn Glu Ala
Tyr Glu Met Pro Ser Glu Glu 120 125 130ggg tat caa gac tac gaa cct
gaa gcc taagaaatat ctttgctccc 486Gly Tyr Gln Asp Tyr Glu Pro Glu
Ala 135 140agtttcttga gatctgctga cagatgttcc atcctgtaca agtgctcagt
tccaatgtgc 546ccagtcatga catttctcaa agtttttaca gtgtatctcg
aagtcttcca tcagcagtga 606ttgaagtatc tgtacctgcc cccactcagc
atttcggtgc ttccctttca ctgaagtgaa 666tacatggtag cagggtcttt
gtgtgctgtg gattttgtgg cttcaatcta cgatgttaaa 726acaaattaaa
aacacctaag tgactaccac ttatttctaa atcctcacta tttttttgtt
786gctgttgttc agaagttgtt agtgatttgc tatcatatat tataagattt
ttaggtgtct 846tttaatgata ctgtctaaga ataatgacgt attgtgaaat
ttgttaatat atataatact 906taaaaatatg tgagcatgaa actatgcacc
tataaatact aaatatgaaa ttttaccatt 966ttgcgatgtg ttttattcac
ttgtgtttgt atataaatgg tgagaattaa aataaaacgt 1026tatctcattg
caaaaatatt ttatttttat cccatctcac tttaataata aaaatcatgc
1086ttataagcaa catgaattaa gaactgacac aaaggacaaa aatataaagt
tattaatagc 1146catttgaaga aggaggaatt ttagaagagg tagagaaaat
ggaacattaa ccctacactc 1206ggaattccct gaagcaacac tgccagaagt
gtgttttggt atgcactggt tccttaagtg 1266gctgtgatta attattgaaa
gtggggtgtt gaagacccca actactattg tagagtggtc 1326tatttctccc
ttcaatcctg tcaatgtttg ctttatgtat tttggggaac tgttgtttga
1386tgtgtatgtg tttataattg ttatacattt ttaattgagc cttttattaa
catatattgt 1446tatttttgtc tcgaaataat tttttagtta aaatctattt
tgtctgatat tggtgtgaat 1506gctgtacctt tctgacaata aataatattc gaccatg
15432140PRTHomo sapiens 2Met Asp Val Phe Met Lys Gly Leu Ser Lys
Ala Lys Glu Gly Val Val1 5 10 15Ala Ala Ala Glu Lys Thr Lys Gln Gly
Val Ala Glu Ala Ala Gly Lys 20 25 30Thr Lys Glu Gly Val Leu Tyr Val
Gly Ser Lys Thr Lys Glu Gly Val 35 40 45Val His Gly Val Ala Thr Val
Ala Glu Lys Thr Lys Glu Gln Val Thr 50 55 60Asn Val Gly Gly Ala Val
Val Thr Gly Val Thr Ala Val Ala Gln Lys65 70 75 80Thr Val Glu Gly
Ala Gly Ser Ile Ala Ala Ala Thr Gly Phe Val Lys 85 90 95Lys Asp Gln
Leu Gly Lys Asn Glu Glu Gly Ala Pro Gln Glu Gly Ile 100 105 110Leu
Glu Asp Met Pro Val Asp Pro Asp Asn Glu Ala Tyr Glu Met Pro 115 120
125Ser Glu Glu Gly Tyr Gln Asp Tyr Glu Pro Glu Ala 130 135
140321RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 3gguguggcaa caguggcuga g
21423RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 4cucagccacu guugccacac cau
23521RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 5aacaguggcu gagaagacca a
21623RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 6uuggucuucu cagccacugu ugc
23721RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 7auugcagcag ccacuggcuu u
21823RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 8aaagccagug gcugcugcaa ugc
23921RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 9aagugacaaa uguuggagga g
211023RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 10caccuccaac auuugucacu ugc
231121RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 11gaagaaggag ccccacagga a
211223RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 12uuccuguggg gcuccuucuu cau
231321DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 13cgggugugac agcaguagct t
211421DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 14gcuacugcug ucacacccgt t
211521DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 15uccugacaau gaggcuuaut t
211621DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 16auaagccuca uugucaggat t
211721DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 17uccugacaau gaggcuuaut t
211821DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 18auaagccuca uugucaggat t
211921DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 19cuacgaaccu gaagccuaat t
212021DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 20uuaggcuuca gguucguagt t
212121DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 21cuacgaaccu gaagccuaat t
212221DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 22uuaggcuuca gguucguagt t
212321DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 23cuacgaaccu gaagccuaat t
212421DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 24uuaggcuuca gguucguagt t
212521DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 25cuauuguaga guggucuaut t
212621DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 26auagaccacu cuacaauagt t
212721DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 27gaacugugug ugagaggucc u
212823RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 28aggaccucuc acacacaguu ccc
232921RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 29gacguaaacg gccacaaguu c
213021RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 30acuuguggcc guuuacgucg c
213116PRTArtificial SequenceDescription of Artificial Sequence
Synthetic exemplary cell permeation peptide 31Arg Gln Ile Lys Ile
Trp Phe Gln Asn Arg Arg Met Lys Trp Lys Lys1 5 10
153214PRTArtificial SequenceDescription of Artificial Sequence
Synthetic exemplary cell permeation peptide 32Gly Arg Lys Lys Arg
Arg Gln Arg Arg Arg Pro Pro Gln Cys1 5 103327PRTArtificial
SequenceDescription of Artificial Sequence Synthetic exemplary cell
permeation peptide 33Gly Ala Leu Phe Leu Gly Trp Leu Gly Ala Ala
Gly Ser Thr Met Gly1 5 10 15Ala Trp Ser Gln Pro Lys Lys Lys Arg Lys
Val 20 253418PRTArtificial SequenceDescription of Artificial
Sequence Synthetic exemplary cell permeation peptide 34Leu Leu Ile
Ile Leu Arg Arg Arg Ile Arg Lys Gln Ala His Ala His1 5 10 15Ser
Lys3526PRTArtificial SequenceDescription of Artificial Sequence
Synthetic exemplary cell permeation peptide 35Gly Trp Thr Leu Asn
Ser Ala Gly Tyr Leu Leu Lys Ile Asn Leu Lys1 5 10 15Ala Leu Ala Ala
Leu Ala Lys Lys Ile Leu 20 253618PRTArtificial SequenceDescription
of Artificial Sequence Synthetic exemplary cell permeation peptide
36Lys Leu Ala Leu Lys Leu Ala Leu Lys Ala Leu Lys Ala Ala Leu Lys1
5 10 15Leu Ala379PRTArtificial SequenceDescription of Artificial
Sequence Synthetic exemplary cell permeation peptide 37Arg Arg Arg
Arg Arg Arg Arg Arg Arg1 53810PRTArtificial SequenceDescription of
Artificial Sequence Synthetic exemplary cell permeation peptide
38Lys Phe Phe Lys Phe Phe Lys Phe Phe Lys1 5 103937PRTArtificial
SequenceDescription of Artificial Sequence Synthetic exemplary cell
permeation polypeptide 39Leu Leu Gly Asp Phe Phe Arg Lys Ser Lys
Glu Lys Ile Gly Lys Glu1 5 10 15Phe Lys Arg Ile Val Gln Arg Ile Lys
Asp Phe Leu Arg Asn Leu Val 20 25 30Pro Arg Thr Glu Ser
354031PRTArtificial SequenceDescription of Artificial Sequence
Synthetic exemplary cell permeation polypeptide 40Ser Trp Leu Ser
Lys Thr Ala Lys Lys Leu Glu Asn Ser Ala Lys Lys1 5 10 15Arg Ile Ser
Glu Gly Ile Ala Ile Ala Ile Gln Gly Gly Pro Arg 20 25
304130PRTArtificial SequenceDescription of Artificial Sequence
Synthetic exemplary cell permeation polypeptide 41Ala Cys Tyr Cys
Arg Ile Pro Ala Cys Ile Ala Gly Glu Arg Arg Tyr1 5 10 15Gly Thr Cys
Ile Tyr Gln Gly Arg Leu Trp Ala Phe Cys Cys 20 25
304236PRTArtificial SequenceDescription of Artificial Sequence
Synthetic exemplary cell permeation polypeptide 42Asp His Tyr Asn
Cys Val Ser Ser Gly Gly Gln Cys Leu Tyr Ser Ala1 5 10 15Cys Pro Ile
Phe Thr Lys Ile Gln Gly Thr Cys Tyr Arg Gly Lys Ala 20 25 30Lys Cys
Cys Lys 354312PRTArtificial SequenceDescription of Artificial
Sequence Synthetic exemplary cell permeation peptide 43Arg Lys Cys
Arg Ile Val Val Ile Arg Val Cys Arg1 5 104442PRTArtificial
SequenceDescription of Artificial Sequence Synthetic exemplary cell
permeation polypeptide 44Arg Arg Arg Pro Arg Pro Pro Tyr Leu Pro
Arg Pro Arg Pro Pro Pro1 5 10 15Phe Phe Pro Pro Arg Leu Pro Pro Arg
Ile Pro Pro Gly Phe Pro Pro 20 25 30Arg Phe Pro Pro Arg Phe Pro Gly
Lys Arg 35 404513PRTArtificial SequenceDescription of Artificial
Sequence Synthetic exemplary cell permeation peptide 45Ile Leu Pro
Trp Lys Trp Pro Trp Trp Pro Trp Arg Arg1 5 104616PRTArtificial
SequenceDescription of Artificial Sequence Synthetic exemplary
hydrophobic peptide 46Ala Ala Val Ala Leu Leu Pro Ala Val Leu Leu
Ala Leu Leu Ala Pro1 5 10 154711PRTArtificial SequenceDescription
of Artificial Sequence Synthetic exemplary hydrophobic peptide
47Ala Ala Leu Leu Pro Val Leu Leu Ala Ala Pro1 5 104813PRTHuman
immunodeficiency virus 48Gly Arg Lys Lys Arg Arg Gln Arg Arg Arg
Pro Pro Gln1 5 104916PRTDrosophila antennapedia 49Arg Gln Ile Lys
Ile Trp Phe Gln Asn Arg Arg Met Lys Trp Lys Lys1 5 10
155021DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 50cuaugagccu gaagccuaat t
215121DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 51uuaggcuuca ggcucauagt t
215221DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 52cuuacgcuga guacuucgat t
215321DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 53ucgaaguacu cagcguaagt t
215421DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 54cuuacgcuga guacuucgat t
215521DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 55cuaugagccu gaagccuaat t
215621DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 56uuaggcuuca ggcucauagt t
215721DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 57cuaugagccu gaagccuaat t
215836DNAArtificial SequenceDescription of Artificial Sequence
Synthetic probe 58ggtcttctca gccactgttg tcactccatg aaccac
36594PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 59Gly Phe Leu Gly1
* * * * *