Attractin/mahogany-like Polypeptides, Polynucleotides, Antibodies And Methods Of Use Thereof

Abstract

The present disclosure provides attractin/mahogany-like polypeptides and fragments thereof, polynucleotides encoding such polypeptides and fragments, processes for production of recombinant forms of such polypeptides, antibodies generated against these polypeptides or fragments, and assays and methods employing these polypeptides, antibodies, and polynucleotides.

Description

CROSS REFERENCE TO RELATED APPLICATIONS

[0001] This application is a divisional of U.S. patent application Ser. No. 12/148,929, filed Apr. 22, 2008, which is a divisional of U.S. patent application Ser. No. 10/154,670, filed May 23, 2002, which claims the benefit of priority under 35 U.S.C. .sctn.119 to U.S. Provisional Application Ser. No. 60/293,608, filed May 25, 2001, and to U.S. Provisional Application Ser. No. 60/324,626, filed Sep. 24, 2001, the disclosures of which are incorporated by reference herein.

REFERENCE TO SEQUENCE LISTING

[0002] The present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled 3224-US-DIV2_ST25.txt, created Dec. 21, 2010, which is 69 KB in size. The information in the electronic format of the Sequence Listing is incorporated herein by reference in its entirety.

FIELD OF THE INVENTION

[0003] The invention is directed to novel attractin/mahogany-like polypeptides and fragments thereof, polynucleotides encoding such polypeptides, processes for production of recombinant forms of such polypeptides, antibodies generated against these polypeptides or fragments, and assays and methods employing these polypeptides, antibodies, and polynucleotides.

BACKGROUND

[0004] Attractin (DPPT-L) is a human glycoprotein belonging to a family of proteins called the CUB family of cell adhesion and guidance proteins. Attractin is normally secreted by activated human T lymphocytes and modulates immune cell interactions.

[0005] Attractin is an 1198 amino acid protein containing four EGF-like domains along with other domains. Proteins with EGF-like domains typically play a role in extracellular signaling or cellular guidance. For example, purified-serum attractin and recombinant attractin enhance the proliferative response of peripheral blood mononuclear cells (PBMC) to recall antigens such as tetanus toxoid (Duke-Cohan et al., Proc. Nat. Acad. Sci., 95:11336-41, 1998). Attractin causes spreading of adherent monocytes to which lymphocytes attach (Duke-Cohan et al., supra). These adherent cells become the foci for T-lymphocyte clustering, and it is thought that attractin is involved in mediating the interactions between T-cells and macrophages, by influencing binding between the cells, antigen presentation, or by proteolytic modification. In addition attractin has also been identified as being related to the murine mahogany protein with a connection to control of pigmentation and energy metabolism (Tang et al., Proc. Nat. Acad. Sci., 97(11):6025-30, 2000).

[0006] Mahogany is a murine protein that is an ortholog of human attractin (Gunn et al., Nature, 398:152, 1999). Murine Mahogany is a transmembrane protein of 1428 amino acids, which contains a single transmembrane domain. The extracellular domain of murine mahogany has homology to attractin. Murine mahogany has been shown to be involved in suppression of obesity (Nagle et al., Nature, 398:148-152, 1999; see also U.S. Pat. No. 6,274,339, which is incorporated herein by reference in its entirety).

SUMMARY OF THE INVENTION

[0007] The invention provides a substantially pure polypeptide comprising an amino acid sequence that has at least 80%, 90% or 100% identity to a sequence as set forth in SEQ ID NO:2 or 19.

[0008] In addition, the invention provides a substantially pure polypeptide comprising an amino acid sequence that has at least 80%, 90% or 100% identity to a sequence as set forth from about amino acid 61 to 1379 of SEQ ID NO:2.

[0009] The invention also provides bioactive fragments of SEQ ID NO:2 comprising a sequence as set forth in SEQ ID NO:2 from amino acid 1 to 61, 61 to 1230, 61 to 1379, 1231 to 1252, or 1252 to 1379.

[0010] The invention further provides a substantially pure polypeptide comprising an amino acid sequence that has at least 80%, 90% or 100% identity to a sequence as set forth from about amino acid 61 to 1230 of SEQ ID NO:2.

[0011] The invention provides a substantially pure polypeptide having a sequence as set forth in SEQ ID NO:2 from amino acid 61 to amino acid 1230 operably linked to a sequence as set forth from about amino acid 1252 to 1379 of SEQ ID NO:2.

[0012] The invention also provides a fusion polypeptide comprising a first polypeptide comprising an amino acid sequence as set forth from about amino acid 61 to 1230 of SEQ ID NO:2 operably linked to a second polypeptide. In one aspect, the second polypeptide is an Fc polypeptide. In another aspect, the second polypeptide is a leucine zipper polypeptide. In yet another aspect the second polypeptide has a sequence as set forth in SEQ ID NO:2 or 19, including bioactive fragments thereof. In yet a further aspect a linker polypeptide separates the first polypeptide and the second polypeptide and is operably linked to the first and second polypeptide.

[0013] The invention further provides an isolated polynucleotide encoding the polypeptides of the invention. In one embodiment, the isolated polynucleotide comprises a sequence selected from the group consisting of: SEQ ID NO:1 or 18; SEQ ID NO:1 or 18, wherein T can also be U; sequences complementary to SEQ ID NO:1 or 18; and fragments of a), b), or c) that are at least 20 bases in length and that will hybridize under moderate to highly stringent conditions to a nucleic acid which encodes a polypeptide comprising a sequence as set forth in SEQ ID NO:2 or 19. In yet a further embodiment, the isolated polynucleotide comprising a sequence selected from the group consisting of: SEQ ID NO:1 from about nucleotide 181 to 4137; SEQ ID NO:1 from about nucleotide 181 to 3690; sequences complementary to SEQ ID NO:1 from about nucleotide 181 to 4137; sequences complementary to SEQ ID NO:1 from about nucleotide 181 to 3690; and any of a), b), c), or d) wherein T can also be U.

[0014] The invention further provides an isolated polynucleotide encoding a fusion polypeptide of the invention.

[0015] The invention provides a vector comprising a polynucleotide of the invention. In one embodiment, the vector is a is a plasmid or a viral vector.

[0016] The invention also provides a host cell comprising a vector of the invention. The invention further provides a recombinant host cell comprising a polynucleotide of the invention under the control of a heterologous regulatory sequence. The host cell can be prokaryotic or eukaryotic.

[0017] The invention further provides a method of producing a polypeptide comprising culturing a host cell or recombinant host cell of the invention under condition that promote expression of a polypeptide of the invention.

[0018] In another aspect of the invention a polypeptide is provided wherein the polypeptide is produced by culturing a host cell of the invention under conditions that promote expression of the polypeptide.

[0019] The invention also provides a purified antibody that specifically binds to a polypeptide of the invention. In one aspect the antibody is monoclonal. In another aspect the antibody is a human or humanized antibody.

[0020] The invention provides a pharmaceutical composition comprising an antibody of the invention or a polypeptide comprising an amino acid sequence selected from the group consisting of: SEQ ID NO:2 from amino acid 61 to 1379; and SEQ ID NO:2 from amino acid 61 to 1230, and a pharmaceutical carrier, excipient or diluent.

[0021] In another aspect, the invention provides a method for identifying an agent which modulates the expression of a polynucleotide comprising a sequence as set forth in SEQ ID NO:1 or 18, comprising contacting a sample containing the polynucleotide with a test agent and measuring the expression of the polynucleotide compared to a control, wherein a change in expression compared to the control is indicative of an agent that modulates expression of the polynucleotide. The agent can be a polypeptide, a peptide, a peptidomimetic, a nucleic acid, and a small molecule.

[0022] Also provided by the invention is a method for identifying an agent which modulates the activity of a polypeptide comprising a sequence selected from the group consisting of SEQ ID NO:2 or 19, SEQ ID NO:2 from about 61 to 1379, SEQ ID NO:2 from about 61 to 1230, comprising contacting a sample containing the polypeptide with a test agent and measuring the activity of the polypeptide compared to a control, wherein a change in activity compared to the control is indicative of an agent that modulates activity of the polypeptide.

[0023] The invention further provides a method of treating a HAM-associated disorder or disease comprising contacting a subject with a HAM polypeptide, HAM polynucleotide, or an antibody to a HAM polypeptide in an amount effective to treat the HAM-associated disorder or disease. The HAM-associated disorder is selected from the group consisting of a rheumatologic disorder, a bone marrow or solid organ transplant disorder, a graft-versus-host disorder, an inflammatory disorder, an autoimmune disorder, a neurologic disorder, a myelination disorder, a cell proliferative disorder, an infection, a cardiovascular disorder, a hematologic disorder, liver disorder, metabolic disorders, weight disorders, and a bone disorder. In one aspect the HAM polypeptide has a sequence as set forth in SEQ ID NO:2 or 19 or a bioactive fragment thereof.

BRIEF DESCRIPTION OF THE FIGURES

[0024] FIG. 1A-D shows a cDNA sequence and a corresponding polypeptide sequence of the invention. The arrows depict the primers used to amplify various fragments of the coding sequence.

[0025] FIG. 2A-C shows an alignment of the human Homologue of Attractin/Mahagony (HAM), human attractin and murine mahogany sequences.

[0026] FIG. 3A-B shows the putative domains of a HAM polypeptide of the invention.

[0027] FIG. 4A-B shows an alignment of a human HAM polypeptide of SEQ ID NO:2 with that of a murine HAM polypeptide of SEQ ID NO:19.

[0028] FIG. 5A-C shows the nucleotide sequence (SEQ ID NO:18) encoding the polypeptide sequence of SEQ ID NO:19.

DETAILED DESCRIPTION OF THE INVENTION

[0029] The present invention provides for the first time novel polypeptides having homology to attractin and mahogany proteins termed herein "HAM" for Homologue of Attractin and Mahogany. Also provided are polynucleotides encoding the novel HAM polypeptides as well as methods of use of the polynucleotides and polypeptides.

[0030] Attractin molecules modulate the interaction between T cells and macrophages and monocytes, permitting more rapid and/or more effective antigen presentation. The association of the three cell types is neither simultaneous nor random. Rather the antigen-presenting cell clusters first with the helper T cells, and this cluster acts as a focus for recognition by effector cells. In the absence of antigen, no proliferation occurs in soluble attractin-1-induced clusters of monocytes and T cells, but if a recall antigen such as tetanus toxoid is present; the clustering of cells maximizes the potential response to the antigen. Attractin may regulate local cytokine activity, either by influencing binding and presentation or by proteolytic modification. Soluble attractin-1 has recently been shown to cleave an N-terminal dipeptide which converts full-length RANTES 1-68 (consisting of amino acid residues 1-68), a potent monocyte chemoattractant, to RANTES 3-68, an equally potent inhibitor of monocyte chemotaxis. Soluble attractin-1 has also been found to bind to macrophages and monocytes. It is possible that it is via this binding that attractin, in any of its forms, may regulate the activity of macrophages and monocytes. For example, by providing requisite signals for the induction of spreading and subsequent enhanced T-cell clustering. Alternatively, the molecule could complement binding of another molecule to a receptor on macrophages/monocytes. Further, the molecule could form a bridge between T cells and macrophages/monocytes. Since membrane attractin-1 and -2 have a cytoplasmic domain it is likely that binding of a putative ligand to an extracellular region of the membrane attractin results in signaling to the T cell. It should be understood, however, that the invention is not limited by a particular mechanism of action.

[0031] Based upon their homology to attractins, the HAM molecules of the invention are predicted to have similar biological activity as the attractins and thus are predicted to play a role in inflammation and inflammatory responses. Other biological activities for the HAM molecules include energy metabolism and pigmentation, which activity is based upon HAM's homology to the mahogany protein and mahogany's role in the regulation of obesity (Nagle et al., Nature, 398:148-152, 1999). A correlation of the two types of activities (e.g., inflammatory and obesity) has been shown by higher white blood cell counts in obese children (Visser et al., supra) that are likely due to cytokines induced by inflammatory cell activation as well as additional cell types including preadipocytes. Preadipocytes exhibit functional features of macrophages, such as phagocytosis and anti-microbial activity, suggesting that preadipose cells could play a role in the inflammatory process or immune response (Cousin et al. J. Cell Physiol., 186:380-6, 2001).

[0032] Similar functional characteristics can be found in the ob gene product, Leptin, an adipocyte-derived peptide with circulating levels proportional to body fat mass. Serum leptin levels are correlated with adiposity and increased by as much as 3-4 fold in obese humans. The levels are lowered by fasting and increased by inflammation. Leptin, is a pleiotropic molecule that regulates food intake, metabolic and endocrine functions, and has a regulatory role in immunity, inflammation, and hematopoiesis (Fantuzzi and Faggioni, J. Leukoc Biol, 68(4):437-46, 2000). In addition to its role as a satiety signal, leptin is also pro-inflammatory: leptin receptors belong to the class I family of cytokine receptors and have been demonstrated on a variety of hematopoietic cells, including macrophages and T cells, in which leptin promotes the release of inflammatory cytokines. Thus, a link between inflammation and obesity exists (Visser et al., Pediatrics, 107(1):E13, 2001). Leptin's role in energy metabolism and inflammation is predictive of the role of HAM. Accordingly, HAM can play a role in obesity, inflammatory responses, inflammation, metabolism, pigmentation and neurolgical (e.g., myelination related disorders).

[0033] The HAM polypeptides, polynucleotides and antibodies provided herein find use in the treatment of inflammatory disease, obesity, energy metabolism, appetite, and the modulation of inflammatory responses.

[0034] The invention provides polypeptides referred to herein as "HAM polypeptides". As used herein a "HAM polypeptide" of the invention means a polypeptide which contains or comprises an amino acid sequence as set forth in SEQ ID NO:2 or 19; polypeptides having substantial homology or substantial identity to the sequence set forth in SEQ ID NO:2 or 19; fragments of the foregoing sequence (e.g., bioactive fragments); and conservative variants of the foregoing. The HAM polypeptides have been shown to have homology to attractin and mahogany polypeptides and thus have predicted function and biological activity similar to attractin and mahogany polypeptides.

[0035] As used herein, "polypeptide" means any chain of amino acids (including L- or D-amino acids), regardless of length or post-translational modification (e.g., glycosylation or phosphorylation), and include natural proteins, synthetic or recombinant polypeptides and fragments as well as a recombinant molecule consisting of a hybrid with a first portion, for example, having all or part of a HAM polypeptide amino acid sequence and a second portion comprising all or part of a polypeptide of interest. Typically, the HAM polypeptide is substantially pure of other components from which it is normally present in nature. The term "substantially pure" or "purified" when referring to a polypeptide, means a polypeptide that is at least 30% free from the proteins and naturally-occurring organic molecules with which it is naturally associated. Preferably the substantially pure polypeptide of the invention is at least 35-50%, preferably 60-70%, more preferably 75%, more preferably at least 90%, and most preferably at least 99% by weight purified from other naturally occurring organic molecules. A substantially pure polypeptide of the invention can be obtained, for example, by extraction from a natural source, by expression of a recombinant polynucleotide encoding the polypeptide, or by chemically synthesizing the polypeptide. Purity can be measured by any appropriate method, e.g., column chromatography, polyacrylamide gel electrophoresis, or HPLC analysis.

[0036] In general, a recombinant polypeptide or fragment can be isolated from a host cell if not secreted, or from the medium or supernatant if soluble and secreted, followed by one or more rounds of concentration, salting-out, ion exchange, hydrophobic interaction, affinity purification or size exclusion chromatography. If desired, the culture medium first can be concentrated using a commercially available protein concentration filter, for example, an Amicon or Millipore Pellicon ultrafiltration unit. Following the concentration step, the concentrate can be applied to a purification matrix such as a gel filtration medium. Alternatively, an anion exchange resin can be employed, for example, a matrix or substrate having pendant diethylaminoethyl (DEAE) groups. The matrices can be acrylamide, agarose, dextran, cellulose or other types commonly employed in protein purification. Alternatively, a cation exchange step can be employed, including various insoluble matrices comprising sulfopropyl or carboxymethyl groups. In addition, a chromatofocusing step or, alternatively, a hydrophobic interaction chromatography step can be employed. Suitable matrices can be phenyl or octyl moieties bound to resins. In addition, affinity chromatography with a matrix, which selectively binds the recombinant protein, can be employed. Examples of such resins employed are lectin columns, dye columns, and metal-chelating columns. Finally, one or more reversed-phase high performance liquid chromatography (RP-HPLC) steps employing hydrophobic RP-HPLC media, (e.g., silica gel or polymer resin having pendant methyl, octyl, octyldecyl or other aliphatic groups) can be employed to further purify the polypeptides. Some or all of the foregoing purification steps, in various combinations, are well known and can be employed to provide a substantially purified polypeptide of the invention.

[0037] It is also possible to utilize an affinity column comprising a polypeptide-binding protein, such as a monoclonal antibody generated against a polypeptide of the invention, to affinity-purify expressed polypeptides. These polypeptides can be removed from an affinity column using conventional techniques, e.g., in a high salt elution buffer and then dialyzed into a lower salt buffer for use or by changing pH or other components depending on the affinity matrix utilized, or be competitively removed using the naturally occurring substrate of the affinity moiety, such as a polypeptide derived from the invention.

[0038] Accordingly, polypeptide-binding proteins, such as anti-polypeptide antibodies or other proteins that may interact with a polypeptide of the invention, can be bound to a solid phase support such as a column chromatography matrix or a similar substrate suitable for identifying, separating, or purifying cells that express polypeptides of the invention on their surface. Adherence of polypeptide-binding proteins of the invention to a solid phase contacting surface can be accomplished by any means, for example, magnetic microspheres can be coated with these polypeptide-binding proteins and held in the incubation vessel through a magnetic field. Suspensions of cell mixtures are contacted with the solid phase that has such polypeptide-binding proteins thereon. Cells having polypeptides of the invention on their surface bind to the fixed polypeptide-binding protein and unbound cells then are washed away. This affinity-binding method is useful for purifying, screening, or separating such polypeptide-expressing cells from solution. The cells can be released, for example, by using a preferably non-toxic enzyme that cleaves the cell-surface binding partner, or by effecting such release by modifying the composition of the buffer.

[0039] Alternatively, mixtures of cells suspected of containing HAM polypeptide-expressing cells of the invention can be incubated with a biotinylated polypeptide-binding protein, such as an anti-HAM antibody. Sufficient binding usually occurs within about one hour, after which the mixture then is passed through a column packed with avidin-coated beads, to which the biotin moiety will bind with high affinity (see Berenson, et al. J. Cell. Biochem., 10D:239, 1986). Unbound cells are washed free of the column, and bound cells are eluted according to conventional methods. This method can be used to isolate cells expressing membrane-bound HAM polypeptides.

[0040] When purifying polypeptides, the desired degree of purity will depend on the intended use of the polypeptide. A relatively high degree of purity is desired when the polypeptide is to be administered in vivo, for example. In such a case, the polypeptides typically are purified such that no bands corresponding to other proteins are detectable by SDS-polyacrylamide gel electrophoresis (SDS-PAGE). One skilled in the art will understand that multiple bands corresponding to the polypeptide may be visualized by SDS-PAGE, due to differential glycosylation, differential post-translational processing, and the like. Most preferably, the polypeptide of the invention is purified to substantial homogeneity, as indicated by a single protein band upon analysis by SDS-PAGE. The band may be visualized by silver staining, Coomassie blue staining, or (if the protein is radiolabeled) by autoradiography.

[0041] Several distinct regions can be discerned within a human HAM polypeptide of the invention. A leader sequence, also called a signal peptide, is present in these polypeptides. For example, a leader sequence present in the full-length polypeptide of the invention is predicted to include amino acids 1-60 of SEQ ID NO:2. The signal peptide clevage site for HAM was predicted using a computer algorithm. However, one of skill in the art will recognize that the cleavage site of the signal sequence may vary depending upon a number of factors including the organism in which the polypeptide is expressed. Accordingly, the N-terminus of a mature form of a HAM polypeptide of the invention may vary by about 2 to 5 amino acids. Thus, a mature form of the HAM polypeptide comprising SEQ ID NO:2 may include at its N-terminus amino acids 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, or 65 of SEQ ID NO:2. Accordingly, a mature form can include amino acid 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, or 65 to about amino acid 1379 (or, in the case of a soluble polypeptide, to amino acid 1230) of SEQ ID NO:2. The extracellular regions of the HAM polypeptide of SEQ ID NO:2 are located from about amino acids 61 to 1230 of SEQ ID NO:2. The EGF-like domains, CUB domain, C-type Lectin or carbohydrate-recognition domain (CLECT domain), KELCH motif and Laminin EGF-like domain assignments, as well as those for the transmembrane and cytoplasmic domains are based upon computer algorithms and on previous reports (Gunn et al., Nature 398:152-157, 1999). For example, the extracellular region of human HAM putatively contains three EGF-like domains, a CUB domain, a KELCH motif, a C-type Lectin or carbohydrate-recognition domain, a putative ligand binding motif of the common gamma cytokine chain, and a Laminin EGF-like domain located at about amino acids 63-90, 211-244, 261-280, 93-208, 581-612, 749-873, 670-686, and 1014-1055 of SEQ ID NO:2, respectively (see FIG. 3). The transmembrane region for the HAM polypeptides are located at about amino acids 1231 to 1251 of SEQ ID NO:2. The intracellular regions are located at about amino acids 1252 to 1379 of SEQ ID NO:2. FIGS. 2 and 3 show the relative domains and conserved cysteine residues of HAM indicative of an attractin or mahogany polypeptide. Utilizing the alignment provided in FIG. 4A-B the putative domains of the murine HAM polypeptide (SEQ ID NO:19) based upon the corresponding domains in the human HAM polypeptide (SEQ ID NO:2) can be determined The relative domains of the murine HAM polypeptide (SEQ ID NO:19) and the corresponding polynucleotide fragments encoding such domains (e.g., fragments of SEQ ID NO:18) are specifically encompassed by the present invention.

[0042] Accordingly, several distinct regions can be discerned within a murine HAM polypeptide of the invention. A leader sequence, also called a signal peptide, is present in these polypeptides. For example, a leader sequence present in the full-length polypeptide of the invention is predicted to include amino acids 1-59 of SEQ ID NO:19. The signal peptide clevage site for murine HAM was predicted using a computer algorithm and alignment with human HAM. However, one of skill in the art will recognize that the cleavage site of the signal sequence may vary depending upon a number of factors including the organism in which the polypeptide is expressed. Accordingly, the N-terminus of a mature form of a murine HAM polypeptide of the invention may vary by about 2 to 5 amino acids. Thus, a mature form of a murine HAM polypeptide comprising SEQ ID NO:19 may include at its N-terminus amino acids 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, or 64 of SEQ ID NO:19. Accordingly, a mature form can include amino acid 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, or 64 to about amino acid 1378 (or, in the case of a soluble polypeptide, to amino acid 1229) of SEQ ID NO:2. The extracellular regions of a murine HAM polypeptide of SEQ ID NO:19 are located from about amino acids 60 to 1229 of SEQ ID NO:19. The EGF-like domains, CUB domain, C-type Lectin or carbohydrate-recognition domain (CLECT domain), KELCH motif and Laminin EGF-like domain assignments, as well as those for the transmembrane and cytoplasmic domains are based upon computer algorithms, alignments with human HAM (SEQ ID NO:2) and on previous reports (Gunn et al., Nature 398:152-157, 1999). For example, the extracellular region of murine HAM putatively contains three EGF-like domains, a CUB domain, a KELCH motif, a C-type Lectin or carbohydrate-recognition domain, a putative ligand binding motif of the common gamma cytokine chain, and a Laminin EGF-like domain located at about amino acids 62-89, 210-243, 260-279, 92-207, 580-611, 748-872, 669-685, and 1013-1054 of SEQ ID NO:19, respectively. The transmembrane region for a murine HAM polypeptide is located at about amino acids 1230 to 1250 of SEQ ID NO:19. The intracellular regions are located at about amino acids 1251 to 1378 of SEQ ID NO:19.

[0043] The invention provides both full-length and mature forms of HAM polypeptides. Full-length polypeptides are those having the complete primary amino acid sequence of the polypeptide as initially translated. The amino acid sequences of full-length polypeptides can be obtained, for example, by translation of the complete open reading frame ("ORF") of a cDNA molecule. Several full-length polypeptides may be encoded by a single genetic locus if multiple mRNA forms are produced from that locus by alternative splicing or by the use of multiple translation initiation sites. An example of a full length HAM polypeptide of the invention comprises amino acid 1 to amino acid 1379 of SEQ ID NO:2 and 1 to 1378 of SEQ ID NO:19. Such a full length polypeptide is contemplated to include, for example, the signal peptide comprising amino acids 1 to about amino acid 60 of SEQ ID NO:2 and amino acids 1 to about amino acid 59 of SEQ ID NO:19, respectively.

[0044] The "mature form" of a polypeptide refers to a polypeptide that has undergone post-translational processing steps, if any, such as, for example, cleavage of the signal sequence or proteolytic cleavage to remove a prodomain. Multiple mature forms of a particular full-length polypeptide may be produced, for example, by imprecise cleavage of the signal sequence, or by differential regulation of proteases that cleave the polypeptide. The mature form(s) of such polypeptide may be obtained by expression, in a suitable mammalian cell or other host cell, of a polynucleotide that encodes the full-length polypeptide. The sequence of the mature form of the polypeptide may also be determinable from the amino acid sequence of the full-length form, through identification of signal sequences or protease cleavage sites (e.g., a protease cleavage site is predicted between the Ser-Lys residues at positions 60 and 61 of SEQ ID NO:2). An example of a mature form of a HAM polypeptide of the invention comprises a sequence as set forth from about amino acid 61 to amino acid 1379 of SEQ ID NO:2.

[0045] The HAM polypeptides of the invention also include polypeptides that result from post-transcriptional or post-translational processing events such as alternate mRNA processing which can yield a truncated but biologically active polypeptide, for example, a naturally occurring soluble form of the polypeptide. Also encompassed within the invention are variations attributable to proteolysis such as differences in the N- or C-termini upon expression in different types of host cells, due to proteolytic removal of one or more terminal amino acids from the polypeptide (generally from 1-5 terminal amino acids).

[0046] In another embodiment, the invention provides bioactive fragments of a HAM polypeptide. By "bioactive fragment" means a fragment of SEQ ID NO:2 or 19 having a biological activity associated with an attractin and/or mahogany polypeptide and/or a biological activity associated with a full-length or mature form of a HAM polypeptide of the invention. A bioactive fragment may have one or more of the following biological activities including, for example, inducing monocyte and macrophage activation, promoting the secretion and/or expression of pro-inflammatory cytokines (e.g., IL-6), modulating metabolic activity, modulating weight gain/loss, and modulating appetite and energy consumption. Examples of bioactive fragments of a HAM polypeptide molecules include those having a sequence as set forth in SEQ ID NO:2 comprising about amino acid 61 to 1230 or as set forth in SEQ ID NO:19 comprising about amino acid 60 to 1229 and fragments of either of the foregoing. Such bioactive fragments represent potential soluble molecules lacking the predicted transmembrane domain (e.g., the domain beginning at about amino acid 1231 to amino acid 1251 of SEQ ID NO:2). Bioactive fragment of HAM polypeptides are capable of interacting, for example, with a HAM polypeptide cognate, or with an antibody developed against a HAM polypeptide of SEQ ID NO:2 or 19. Methods of determining whether a HAM polypeptide or bioactive fragment of a HAM polypeptide of the invention has a desired activity can be accomplished by assaying the polypeptide by any of the methods described below.

[0047] Accordingly, the polypeptides of the invention may be membrane-bound or they may be secreted and thus soluble. Soluble polypeptides are capable of being secreted from the cells in which they are expressed. In general, soluble polypeptides may be identified (and distinguished from non-soluble membrane-bound counterparts) by separating intact cells which express the desired polypeptide from the culture medium, e.g., by centrifugation, and assaying the medium (supernatant) for the presence of the desired polypeptide or by contacting cell-free media obtained from the culture with an antibody specific for HAM. The presence of polypeptide in the medium indicates that the polypeptide was secreted from the cells and thus is a soluble form of the polypeptide.

[0048] In one embodiment, the soluble polypeptides (e.g., a bioactive fragment of a HAM polypeptide) comprise all or part of the extracellular domain, but lack the transmembrane domain that would cause retention of the polypeptide in a cell membrane. In some embodiments the soluble polypeptide lacks a transmembrane domain in addition to one or more additional domains including, for example, the signal sequence or cytoplasmic domain. A soluble polypeptide according to the invention may include the cytoplasmic domain, or a portion thereof, so long as the polypeptide is secreted from the cell in which it is produced.

[0049] In general, the use of soluble forms is advantageous for certain applications. Purification of the polypeptides from recombinant host cells is facilitated, since the soluble polypeptides are secreted from the cells. Further, soluble polypeptides are generally more suitable for intravenous administration.

[0050] The invention also provides polypeptides and fragments of the extracellular domain that retain the capacity to modulate inflammatory responses, immune system activity wieght gain/loss, and/or energy metabolism. Such a fragment may be a soluble polypeptide, as described above.

[0051] Also provided herein are polypeptide fragments comprising at least 25, or at least 30 contiguous amino acids of a sequence as set forth in SEQ ID NO:2 or 19. Fragments derived from the cytoplasmic domain find use in studies of signal transduction, and in regulating cellular processes associated with transduction of biological signals, such as inhibitory signals, and in identifying small molecule mimics or inhibitors of receptor interaction with signaling molecules. Polypeptide fragments comprising at least about 8 to 11, or more preferably 10 to 30, contiguous amino acids of SEQ ID NO:2 or 19 also may be employed as immunogens for generating antibodies, as well as larger polypeptides.

[0052] Naturally occurring variants and derived variants of the disclosed polypeptides and fragments are provided herein. Variants may exhibit amino acid sequences that are at least 80% identical to the disclosed polypeptides and fragments. Also provided are polypeptides or fragments comprising an amino acid sequence that is at least 85% identical, at least 90% identical, at least 95% identical, at least 98% identical, at least 99% identical, or at least 99.9% identical to the amino acid sequences disclosed herein. Percent identity may be determined by visual inspection and mathematical calculation. Alternatively, the percent identity of two protein sequences can be determined by comparing sequence information using a computer program, such as the GAP program, based on the algorithm of Needleman and Wunsch (J. Mol. Bio. 48:443, 1970) and available from the University of Wisconsin Genetics Computer Group (UWGCG). The preferred default parameters for the GAP program include: (1) a scoring matrix, blosum62, as described by Henikoff and Henikoff (Proc. Natl. Acad. Sci. USA 89:10915, 1992); (2) a gap weight of 12; (3) a gap length weight of 4; and (4) no penalty for end gaps. Similar comparison parameters can be implemented using other computer programs such as, for example, BESTFIT, FASTA, TFASTA (see, e.g., Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wis.), or PILEUP (a simplification of the progressive alignment method of Feng & Doolittle, J. Mol. Evol. 35:351-360 (1987)).

[0053] The variants of the invention include, for example, those that result from alternate mRNA splicing events or from proteolytic cleavage. Alternate splicing of mRNA may, for example, yield a truncated but biologically active protein, such as a naturally occurring soluble form of the protein. Variations attributable to proteolysis include, for example, differences in the N- or C-termini upon expression in different types of host cells, due to proteolytic removal of one or more terminal amino acids from the protein (generally from 1-5 terminal amino acids). Proteins in which differences in amino acid sequence are attributable to genetic polymorphism (allelic variation among individuals producing the protein) are also contemplated herein.

[0054] Additional variants within the scope of the invention include polypeptides that may be modified to create derivatives thereof by forming covalent or aggregate conjugates with other chemical moieties, such as glycosyl groups, lipids, phosphate, acetyl groups and the like. Covalent derivatives may be prepared by linking the chemical moieties to functional groups on amino acid side chains or at the N-terminus or C-terminus of a polypeptide. Conjugates comprising diagnostic (detectable) or therapeutic agents attached thereto are contemplated herein, as discussed in more detail below.

[0055] Other derivatives include covalently bonded or aggregate conjugates of the polypeptides with other proteins or polypeptides, such as by synthesis in recombinant culture as N-terminal or C-terminal fusions. Examples of fusion polypeptides are discussed below in connection with oligomers. Further, fusion polypeptides can comprise peptides added to facilitate purification and identification. Such peptides include, for example, poly-His or the antigenic identification peptides described in U.S. Pat. No. 5,011,912 and in Hopp et al., Bio/Technology 6:1204, 1988. One such peptide is the FLAG.RTM. peptide, Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys (SEQ ID NO:3), which is highly antigenic and provides an epitope reversibly bound by a specific monoclonal antibody, enabling rapid assay and facile purification of expressed recombinant protein. A murine hybridoma designated 4E11 produces a monoclonal antibody that binds the FLAG.RTM. peptide in the presence of certain divalent metal cations, as described in U.S. Pat. No. 5,011,912, hereby incorporated by reference. The 4E11 hybridoma cell line has been deposited with the American Type Culture Collection under accession no. HB 9259. Monoclonal antibodies that bind the FLAG.RTM. peptide are available from Eastman Kodak Co., Scientific Imaging Systems Division, New Haven, Conn.

[0056] Among the variant polypeptides provided herein are variants of native HAM polypeptides that retain the native binding properties or biological activity of a mature HAM polypeptide of SEQ ID NO:2 or 19 or the substantial equivalent thereof. For example a variant includes a molecule that binds its binding partner with essentially the same binding affinity as does the native form. Binding affinity can be measured by conventional procedures, e.g., as described in U.S. Pat. No. 5,512,457 and as set forth below.

[0057] Variants include polypeptides that are substantially homologous to the native form, but which have an amino acid sequence different from that of the native form because of one or more deletions, insertions or substitutions. Particular embodiments include, but are not limited to, polypeptides that comprise from one to ten deletions, insertions or substitutions of amino acid residues, when compared to a native sequence.

[0058] A given amino acid may be replaced, for example, by a residue having similar physiochemical characteristics. Examples of such conservative substitutions include substitution of one aliphatic residue for another, such as Ile, Val, Leu, or Ala for one another; substitutions of one polar residue for another, such as between Lys and Arg, Glu and Asp, or Gln and Asn; or substitutions of one aromatic residue for another, such as Phe, Trp, or Tyr for one another. Other conservative substitutions, e.g., involving substitutions of entire regions having similar hydrophobicity characteristics, are well known. Also included are the substitution of L-amino acids for D-amino acids. The presence of D-amino acids provides resistance to proteases and increases the stability of a polypeptide or fragment thereof. Amino acid substitutions and other alterations (deletions, insertions, and the like) to a HAM polypeptide of the invention is predicted to be more likely to alter or disrupt HAM polypeptide activities if they result in changes to the conserved residues indicated by the "consensus," indicated in FIG. 2A-C. Conversely, if a change is made to a HAM polypeptide resulting in substitution of one or more FIG. 2 consensus sequence residues for the HAM polypeptide residue at that conserved position, it is less likely that such an alteration will affect HAM polypeptide function. In one aspect, the invention provides HAM polypeptides that have from 1-10 amino acid substitutions, insertions, and/or deletions.

[0059] Similarly, the polynucleotides of the invention include variants that differ from a native HAM polynucleotide because of one or more deletions, insertions or substitutions, but that encode a biologically active polypeptide.

[0060] In addition, "conservatively modified variants" applies to both polypeptides and polynucleotides. With respect to a particular polynucleotide, conservatively modified variants refer to codons in the polynucleotide which encode identical or essentially identical amino acids. Because of the degeneracy of the genetic code, a large number of functionally identical polynucleotides encode any given protein. For instance, the codons GCA, GCC, GCG and GCU all encode the amino acid alanine. Thus, at every position where an alanine is specified by a codon, the codon can be altered to any of the corresponding codons described without altering the encoded polypeptide. Such variations are "silent variations," which are one species of conservatively modified variations. Every polynucleotide sequence herein that encodes a polypeptide also describes every possible silent variation of the nucleic acid. One of skill will recognize that each codon in a polynucleotide (except AUG, which is ordinarily the only codon for methionine) can be modified to yield a functionally identical molecule. Accordingly, each silent variation of a nucleic acid that encodes a polypeptide is implicit in each described sequence.

[0061] The invention further includes polypeptides of the invention with or without associated native-pattern glycosylation. Polypeptides expressed in yeast or mammalian expression systems (e.g., COS-1 or COS-7 cells) can be similar to or significantly different from a native polypeptide in molecular weight and glycosylation pattern, depending upon the choice of expression system. Expression of any of the polypeptides of the invention in bacterial expression systems, such as E. coli, provides non-glycosylated forms of the polypeptides. Further, a given preparation may include multiple differentially glycosylated species of the protein. Glycosyl groups can be removed through conventional methods, in particular those utilizing glycopeptidase. In general, glycosylated polypeptides of the invention can have their carbohydrate moieties removed by being incubated with a molar excess of glycopeptidase (Boehringer Mannheim).

[0062] N-glycosylation sites in eukaryotic polypeptides are characterized by an amino acid triplet Asn-X--Y, wherein X is any amino acid except Pro and Y is Ser or Thr. The HAM polypeptides of the invention have a number of putative glycosylations sites. For example, the Asn residue at one or more of the following positions is a potential glycosylation site: 76N, 174N, 198N, 214N, 272N, 326N, 380N, 542N, 590N, 697N, 704N, 763N, 778N, 817N, 831N, 842N, 898N, 942N, 1033N, 1149N, 1157N, 1201N, and 1210N of SEQ ID NO:2. Murine HAM also has putative glycosylation sites at 75N, 173N, 197N, 213N, 271N, 325N, 380N, 541N, 589N, 696N, 703N, 762N, 777N, 816N, 830N, 841N, 897N, 941N, 1032N, 1148N, 1156N, 1200N, and 1209N of SEQ ID NO:19. N-glycosylation sites in the polypeptide extracellular domain can be modified to preclude glycosylation, allowing expression of a reduced carbohydrate analog in mammalian and yeast expression systems. Accordingly, modifications (e.g., treatment with a glycopeptidase) or substitutions or deletions of these residues can modulate the activity of a mature HAM polypeptide of the invention.

[0063] Correspondingly, similar polynucleotide constructs that encode various additions or substitutions of amino acid residues or sequences, or deletions of terminal or internal residues or sequences are encompassed by the invention. Appropriate substitutions, additions, or deletions to the nucleotide sequence encoding these triplets (e.g., Asn-X-Y) will result in prevention of attachment of carbohydrate residues at the Asn side chain. Alteration of a single nucleotide, chosen so that Asn is replaced by a different amino acid, for example, is sufficient to inactivate an N-glycosylation site. Alternatively, a Ser or Thr in the triplet can by replaced with another amino acid, such as Ala. Known procedures for inactivating N-glycosylation sites in proteins include those described in U.S. Pat. No. 5,071,972 and EP 276,846. One of skill in the art can identify the codons corresponding to the Asn residues for HAM as described above, as well as the Ser and Thr residues of the Asn-X--Y triplet.

[0064] In another example of variants, sequences encoding Cys residues that are not essential for biological activity can be altered to cause the Cys residues to be deleted or replaced with other amino acids, preventing formation of incorrect intramolecular disulfide bridges upon folding or renaturation. A number of putative conserved Cys residues of a HAM polypeptide of the invention are identified in the alignment provided in FIG. 2 and FIG. 4.

[0065] Other variants are prepared by modification of adjacent dibasic amino acid residues, to enhance expression in yeast systems in which KEX2 protease activity is present. EP 212,914 discloses the use of site-specific mutagenesis to inactivate KEX2 protease processing sites in a protein. KEX2 protease processing sites are inactivated by deleting, adding or substituting residues to alter Arg-Arg, Arg-Lys, and Lys-Arg pairs to eliminate the occurrence of these adjacent basic residues. Lys-Lys pairings are considerably less susceptible to KEX2 cleavage, and conversion of Arg-Lys or Lys-Arg to Lys-Lys represents a conservative and preferred approach to inactivating KEX2 sites.

[0066] Oligomers

[0067] Encompassed by the invention are oligomers and fusion polypeptides, that comprises a HAM polypeptide or a bioactive fragment thereof linked to a polypeptide of interest. In a preferred embodiment, the fusion partner is linked to the C-terminus of the HAM polypeptide or a bioactive fragment thereof. Such oligomers may be in the form of covalently-linked or non-covalently-linked multimers, including dimers, trimers, or higher oligomers. As noted above, preferred polypeptides are soluble and thus these oligomers typically comprise soluble polypeptides. In one aspect of the invention, the oligomers maintain the binding ability of the polypeptide components and provide therefor, bivalent, trivalent, and the like, binding sites.

[0068] One embodiment of the invention is directed to oligomers comprising multiple polypeptides joined via covalent or non-covalent interactions between peptide moieties fused to the polypeptides. Such peptide moieties may be peptide linkers (spacers), or peptides that have the property of promoting oligomerization. Examples of peptide linkers include -Gly-Gly-, GGGGS (SEQ ID NO:4) (GGGGS).sub.n (SEQ ID NO:5), GKSSGSGSESKS (SEQ ID NO:6), GSTSGSGKSSEGKG (SEQ ID NO:7), GSTSGSGKSSEGSGSTKG (SEQ ID NO:8), GSTSGSGKPGSGEGSTKG (SEQ ID NO:9), or EGKSSGSGSESKEF (SEQ ID NO:10). Linking moieties are described, for example, in Huston, J. S., et al., PNAS 85:5879-5883 (1988), Whitlow, M., et al., Protein Engineering 6:989-995 (1993), and Newton, D. L., et al., Biochemistry 35:545-553 (1996). Other suitable peptide linkers are those described in U.S. Pat. Nos. 4,751,180 and 4,935,233, which are hereby incorporated by reference. A polynucleotide encoding a desired peptide linker can be inserted between, and in the same reading frame as, a polynucleotide encoding a HAM polypeptide or bioactive fragment of the invention, using any suitable conventional technique. In particular embodiments, a fusion polypeptide comprises from two to four bioactive fragments of a HAM polypeptide (e.g., a soluble fragment), separated by peptide linkers. In one embodiment, the invention provides a fusion polypeptide having an Fc polypeptide domain and a HAM polypeptide or bioactive fragment (e.g., a fragment as set forth in SEQ ID NO:2 from about amino acid 61 to 1230). Leucine zippers and certain polypeptides derived from antibodies are among the peptides that can promote oligomerization of the polypeptides attached thereto, as described in more detail below.

[0069] As one alternative, an oligomer or fusion polypeptide is prepared using polypeptides derived from immunoglobulins. Preparation of fusion polypeptides comprising certain heterologous polypeptides fused to various portions of antibody-derived polypeptides (including the Fc domain) has been described, e.g., by Ashkenazi et al. (PNAS USA 88:10535, 1991); Byrn et al. (Nature 344:677, 1990); and Hollenbaugh and Aruffo ("Construction of Immunoglobulin Fusion Proteins", in Current Protocols in Immunology Suppl. 4, pages 10.19.1-10.19.11, 1992).

[0070] One embodiment of the present invention is directed to a dimer comprising two fusion proteins created by fusing a HAM polypeptide or bioactive fragment of the invention to an Fc polypeptide derived from an antibody. A gene fusion encoding a HAM polypeptide/Fc fusion protein is inserted into an appropriate expression vector. HAM polypeptide/Fc fusion proteins are expressed in host cells transformed with the recombinant expression vector, and allowed to assemble much like antibody molecules, whereupon interchain disulfide bonds form between the Fc moieties to yield divalent molecules.

[0071] An Fc polypeptide includes native and mutein forms of polypeptides made up of the Fc region of an antibody comprising any or all of the CH domains of the Fc region. Truncated forms of such polypeptides containing the hinge region that promotes dimerization are also included. Preferred polypeptides comprise an Fc polypeptide derived from a human IgG1 antibody. The Fc polypeptides preferably are linked to the COOH-terminus of a HAM polypeptide or bioactive fragment of the invention.

[0072] One suitable Fc polypeptide, described in PCT application WO 93/10151 (hereby incorporated by reference), is a single chain polypeptide extending from the N-terminal hinge region to the native C-terminus of the Fc region of a human IgG1 antibody. Another useful Fc polypeptide is the Fc mutein described in U.S. Pat. No. 5,457,035 and in Baum et al., (EMBO J. 13:3992-4001, 1994) incorporated herein by reference. The amino acid sequence of this mutein is identical to that of the native Fc sequence presented in WO 93/10151, except that amino acid 19 has been changed from Leu to Ala, amino acid 20 has been changed from Leu to Glu, and amino acid 22 has been changed from Gly to Ala. The mutein exhibits reduced affinity for Fc receptors.

[0073] The above-described fusion proteins comprising Fc moieties (and oligomers formed therefrom) offer the advantage of facile purification by affinity chromatography over Protein A or Protein G columns.

[0074] In other embodiments, the polypeptides of the invention may be substituted for the variable portion of an antibody heavy or light chain. If fusion proteins are made with both heavy and light chains of an antibody, it is possible, for example, to form an oligomer with as many as four HAM extracellular regions.

[0075] Another method for preparing the oligomers of the invention involves use of a leucine zipper. Leucine zipper domains are peptides that promote oligomerization of the proteins in which they are found. Leucine zippers were originally identified in several DNA-binding proteins (Landschulz et al., Science 240:1759, 1988), and have since been found in a variety of different proteins. Among the known leucine zippers are naturally occurring peptides and derivatives thereof that dimerize or trimerize.

[0076] The zipper domain (also referred to herein as an oligomerizing, or oligomer-forming, domain) comprises a repetitive heptad repeat, often with four or five leucine residues interspersed with other amino acids. Examples of zipper domains are those found in the yeast transcription factor GCN4 and a heat-stable DNA-binding protein found in rat liver (C/EBP; Landschulz et al., Science 243:1681, 1989). Two nuclear transforming proteins, fos and jun, also exhibit zipper domains, as does the gene product of the murine proto-oncogene, c-myc (Landschulz et al., Science 240:1759, 1988). The products of the nuclear oncogenes fos and jun comprise zipper domains that preferentially form heterodimer (O'Shea et al., Science 245:646, 1989, Turner and Tjian, Science 243:1689, 1989).

[0077] The fusogenic proteins of several different viruses, including paramyxovirus, coronavirus, measles virus and many retroviruses, also possess zipper domains (Buckland and Wild, Nature 338:547,1989; Britton, Nature 353:394, 1991; Delwart and Mosialos, AIDS Research and Human Retroviruses 6:703, 1990). The zipper domains in these fusogenic viral proteins are near the transmembrane region of the proteins; it has been suggested that the zipper domains could contribute to the oligomeric structure of the fusogenic proteins. Oligomerization of fusogenic viral proteins is involved in fusion pore formation (Spruce et al., Proc. Natl. Acad. Sci. USA 88:3523, 1991). Zipper domains have also been reported to play a role in oligomerization of heat-shock transcription factors (Rabindran et al., Science 259:230, 1993).

[0078] Zipper domains fold as short, parallel coiled coils (O'Shea et al., Science 254:539, 1991). The general architecture of the parallel coiled coil has been characterized, with a "knobs-into-holes" packing as proposed by Crick in 1953 (Acta Crystallogr. 6:689). The dimer formed by a zipper domain is stabilized by the heptad repeat, designated (abcdefg).sub.naccording to the notation of McLachlan and Stewart (J. Mol. Biol 98:293; 1975), in which residues a and d are generally hydrophobic residues, with d being a leucine, which line up on the same face of a helix. Oppositely-charged residues commonly occur at positions g and e. Thus, in a parallel coiled coil formed from two helical zipper domains, the "knobs" formed by the hydrophobic side chains of the first helix are packed into the "holes" formed between the side chains of the second helix.

[0079] The residues at position d (often leucine) contribute large hydrophobic stabilization energies, and are important for oligomer formation (Krystek: et al., Int. J. Peptide Res. 3 8:229, 1991). Lovejoy et al (Science 259:1288, 1993) reported the synthesis of a triple-stranded a-helical bundle in which the helices run up-up-down. Their studies confirmed that hydrophobic stabilization energy provides the main driving force for the formation of coiled coils from helical monomers. These studies also indicate that electrostatic interactions contribute to the stoichiometry and geometry of coiled coils. Additional discussion of the structure of leucine zippers is found in Harbury et al (Science 262:1401, 26 November 1993).

[0080] Examples of leucine zipper domains suitable for producing soluble oligomeric proteins include the leucine zipper described in PCT application WO 94/10308 and the leucine zipper derived from lung surfactant protein D (SPD) described in Hoppe et al. (FEBS Letters 344:191, 1994), hereby incorporated by reference. The use of a modified leucine zipper that allows for stable trimerization of a heterologous protein fused thereto is described in Fanslow et al. (Semin. Immunol 6.267-278, 1994). Recombinant fusion proteins comprising a bioactive fragment of the invention (e.g., a soluble fragment) fused to a leucine zipper peptide are expressed in suitable host cells, and the soluble oligomer that forms is recovered from the culture supernatant.

[0081] Certain leucine zipper moieties form trimers. One example is a leucine zipper derived from lung surfactant protein D (SPD) noted above, as described in Hoppe et al and in U.S. Pat. No. 5,716,805, hereby incorporated by reference in their entirety. This lung SPD-derived leucine zipper peptide comprises the amino acid sequence: Pro-Asp-Val-Ala-Ser-Leu-Arg-Gln-Gln-Val-Glu-Ala-Leu-Gln-Gly-Gln-Val-Gln-H- is-Leu-Gln-Ala-Ala-Phe-Ser-Gln-Tyr (SEQ ID NO:11).

[0082] Another example of a leucine zipper that promotes trimerization is a peptide comprising the amino acid sequence Arg-Met-Lys-Gln-Ile-Glu-Asp-Lys-Ile-Glu-Glu-Ile-Leu-Ser-Lys-Ile-Tyr-His-I- le-Glu-Asn-Glu-Ile-Ala-Arg-Ile-Lys-Lys-Leu-Ile-Gly-Glu-Arg (SEQ ID NO:12), as described in U.S. Pat. No. 5,716,805. In one alternative embodiment, an N-terminal Asp residue is added; in another, the peptide lacks the N-terminal Arg residue.

[0083] Fragments of the foregoing zipper peptides that retain the property of promoting oligomerization may be employed as well. Examples of such fragments include, but are not limited to, peptides lacking one or two of the N-terminal or C-terminal residues presented in the foregoing amino acid sequences. Leucine zippers may be derived from naturally occurring leucine zipper peptides, e.g., via conservative substitution(s) in the native amino acid sequence, wherein the peptide's ability to promote oligomerization is retained. In particular embodiments, leucine residues in a leucine zipper moiety are replaced by isoleucine residues. Such peptides comprising isoleucine may be referred to as isoleucine zippers, but are encompassed by the term "leucine zippers" as employed herein.

[0084] Antibodies

[0085] The polypeptides, fragments (e.g., soluble or bioactive fragments), variants, fusion proteins, and the like, as set forth above may be employed as "immunogens" in producing antibodies immunoreactive therewith. More specifically, the polypeptides, fragment, variants, fusion proteins, and the like, contain antigenic determinants or epitopes that elicit the formation of antibodies. Suitable antigenic determinants or epitopes may be either linear or conformational (discontinuous). Linear epitopes are composed of a linear series of amino acids linked to one another by covalent bonds, while conformational or discontinuous epitopes are composed of amino acids sections from different regions of the polypeptide chain that are brought into close proximity upon protein folding (C. A. Janeway, Jr. and P. Travers, Immuno Biology 3:9 (Garland Publishing Inc., 2nd ed. 1996)). Because folded proteins have complex surfaces, the number of epitopes available is quite numerous; however, due to the conformation of the protein and steric hinderances, the number of antibodies that actually bind to the epitopes is less than the number of available epitopes (C. A. Janeway, Jr. and P. Travers, Immuno Biology 2:14 (Garland Publishing Inc., 2nd ed. 1996)). Epitopes may be identified by any number of methods known in the art.

[0086] The epitopes derived from the disclosed polypeptides are useful for raising antibodies, including monoclonal antibodies, and can be used as research reagents, in assays, and to purify specific binding antibodies from substances such as polyclonal sera or supernatants from cultured hybridomas. Such epitopes or variants thereof can be produced using techniques well known in the art such as solid-phase synthesis, chemical or enzymatic cleavage of a polypeptide, or using recombinant DNA technology.

[0087] The polyclonal and monoclonal antibodies elicited by the disclosed polypeptides, whether the epitopes have been isolated or remain part of the polypeptides, may be prepared by conventional techniques. See, for example, Monoclonal Antibodies, Hybridomas: A New Dimension in Biological Analyses, Kennet et al (eds.), Plenum Press, New York (1980); and Antibodies: A Laboratory Manual, Harlow and Land (eds.), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., (1988).

[0088] Hybridoma cell lines that produce monoclonal antibodies specific for the polypeptides of the invention are also contemplated herein, and may be produced and identified by conventional techniques. One method for producing such a hybridoma cell line comprises immunizing an animal with a polypeptide; harvesting spleen cells from the immunized animal; fusing said spleen cells to a myeloma cell line, thereby generating hybridoma cells; and identifying a hybridoma cell line that produces a monoclonal antibody that binds the polypeptide. The monoclonal antibodies may be recovered by conventional techniques.

[0089] The monoclonal antibodies of the present invention include chimeric antibodies, e.g., humanized versions of murine monoclonal antibodies. Such humanized antibodies may be prepared by known techniques and offer the advantage of reduced immunogenicity when the antibodies are administered to humans, such as for therapeutic purposes. In one embodiment, a humanized monoclonal antibody comprises the variable region of a murine antibody (or just the antigen-binding site thereof) and a constant region derived from a human antibody. Alternatively, a humanized antibody fragment may comprise the antigen-binding site of a murine monoclonal antibody and a variable region fragment (lacking the antigen-binding site) derived from a human antibody. Procedures for the production of chimeric and further engineered monoclonal antibodies include those described in Riechmann et al. (Nature 332:323, 1988), Liu et al (PNAS 84:3439, 1987), Larrick et al (Bio/Technology 7:934, 1989), and Winter and Harris (TIPS 14:139, May, 1993). Procedures to generate antibodies transgenically can be found in GB 2,272,440, U.S. Pat. Nos. 5,569,825 and 5,545,806 and related patents claiming priority therefrom, all of which are incorporated by reference herein. Procedures to generate antibodies transgenically can be found in GB 2,272,440, U.S. Pat. Nos. 5,569,825 and 5,545,806 and related patents claiming priority therefrom, all of which are incorporated by reference herein. Preferably, for use in humans, the antibodies are human; techniques for creating such human antibodies are also known and transgenic mice useful for creating such antibodies are commercially available from, for example, Medarex Inc. (Princeton, N.J.) and Abgenix Inc. (Fremont, Calif.).

[0090] Antigen-binding fragments of the antibodies, which may be produced by conventional techniques, are also encompassed by the present invention. Examples of such fragments include, but are not limited to, scFv, Fab and F(ab').sub.2 fragments. Antibody fragments and derivatives produced by genetic engineering techniques are also provided.

[0091] The antibodies of the invention can be used in assays to detect the presence of the polypeptides or fragments of the invention, either in vitro or in vivo. The antibodies also may be employed in purifying polypeptides or fragments of the invention by immunoaffinity chromatography.

[0092] Those antibodies that block binding of the polypeptides of the invention to their binding partners may be used to inhibit a biological activity that results from such binding. Such blocking antibodies may be identified using any suitable assay procedure, such as by testing antibodies for the ability to inhibit binding of a HAM polypeptide or bioactive fragment thereof to certain cells expressing the binding partners of such polypeptide or fragment. Alternatively, blocking antibodies may be identified in assays for the ability to inhibit a biological effect that results from binding of the polypeptides of the invention to target cells. Antibodies may be assayed for the ability to inhibit HAM polypeptide-mediated cellular activities, for example.

[0093] Such antibodies may be employed in in vitro procedures, or administered in vivo to inhibit a biological activity mediated by the polypeptide to which the antibody binds. Disorders caused or exacerbated (directly or indirectly) by the interaction of the polypeptides of the invention with cell surface (binding partner) receptor thus may be treated. A therapeutic method involves in vivo administration of a blocking antibody to a mammal in an amount effective in inhibiting a HAM polypeptide-mediated biological activity. Monoclonal antibodies are generally preferred for use in such therapeutic methods. In one embodiment, an antigen-binding antibody fragment is employed. In addition, therapeutics of diagnostic labels may be conjugated to the antibodies of the invention thereby targeting the therapeutic or diagnostic to cells expressing a HAM polypeptide.

[0094] Antibodies may be screened for agonistic (i.e., HAM-mimicking) properties. An agonsitic antibody includes antibodies that bind to HAM and activate HAM (e.g., by cross-linking the HAM molecule). Such antibodies, upon binding to HAM cognate on a cell surface, induce biological effects (e.g., transduction of biological signals) similar to the biological effects induced when a HAM polypeptide binds to cell surface ligands.

[0095] Compositions comprising an antibody that is directed against a HAM polypeptide or fragment thereof and a physiologically acceptable diluent, excipient, or carrier, are provided herein. Suitable components of such compositions are as described here and are similar to those described for compositions containing a HAM polypeptide or fragment thereof. Also provided herein are conjugates comprising a detectable (e.g., diagnostic) or therapeutic agent, attached to the antibody. The conjugates find use in in vitro or in vivo procedures.

[0096] Polynucleotides

[0097] The invention also provides polynucleotides encoding HAM polypeptides and bioactive fragments thereof. The term "polynucleotide" refers to a polymeric form of nucleotides of at least 10 bases in length. The nucleotides can be ribonucleotides, deoxyribonucleotides, or modified forms of either type of nucleotide. The term includes single and double stranded forms of DNA or RNA. DNA includes, for example, cDNA, genomic DNA (e.g., a sequence containing introns and exons), chemically synthesized DNA, DNA amplified by PCR, and combinations thereof. The polynucleotides of the invention include full-length genes and cDNA molecules as well as a combination of fragments thereof. The polynucleotides of the invention are preferentially derived from human sources, but the invention includes those derived from non-human species, as well.

[0098] By "isolated polynucleotide" is meant a polynucleotide that is not immediately contiguous with both of the coding sequences with which it is immediately contiguous (one on the 5' end and one on the 3' end) in the naturally occurring genome of the organism from which it is derived. The term therefore includes, for example, a recombinant polynucleotide molecule, which is incorporated into a vector, e.g., an expression vector; into an autonomously replicating plasmid or virus; or into the genomic DNA of a prokaryote or eukaryote, or which exists as a separate molecule (e.g., a cDNA) independent of other sequences.

[0099] A polynucleotide of the invention comprises (1) a sequence as set forth in SEQ ID NO:1 or 18; (2) sequences complementary to a sequence as set forth in SEQ ID NO:1 or 18; (3) fragments of SEQ ID NO:1 or 18 or their complements that specifically hybridize to the polynucleotide of (1) or (2) under moderate to highly stringent conditions, wherein the fragments are about 50 to 100 consecutive bases in length, 200 to 300 consecutive bases in length, or 500 to 1000 consecutive bases in length or longer; and (4) sequences of (1), (2), or (3) wherein T can also be U (e.g., RNA sequences). Also encompassed by the invention are homologues of a polynucleotide of the invention. These homologues can be identified in several ways, including isolation of genomic or cDNA molecules from a suitable source, or computer searches of available sequence databases. Oligonucleotides or polynucleotides corresponding to the amino acid sequences described herein can be used as probes or primers for the isolation of polynucleotide homologues or as query sequences for database searches. Degenerate oligonucleotide sequences can be obtained by "back-translation" from the amino acid sequences (e.g., a sequence of SEQ ID NO:2 or 19). The polymerase chain reaction (PCR) procedure can be employed to isolate and amplify a polynucleotide encoding a HAM polypeptide. Fragments of the polynucleotides of the invention are useful as probes and primers to identify or amplify related sequence or obtain full-length sequences of a HAM polynucleotide of the invention. The oligonucleotides can additionally contain recognition sites for restriction endonucleases, to facilitate insertion of the amplified combination of DNA fragments into an expression vector. PCR techniques are described in Saiki et al., Science 239:487 (1988); Recombinant DNA Methodology, Wu et al., eds., Academic Press, Inc., San Diego (1989), pp. 189-196; and PCR Protocols: A Guide to Methods and Applications, Innis et. al., eds., Academic Press, Inc. (1990).

[0100] The invention also includes polynucleotides and oligonucleotides that hybridize under reduced stringency conditions, more preferably moderately stringent conditions, and most preferably highly stringent conditions, to polynucleotides encoding HAM polypeptides described herein. The basic parameters affecting the choice of hybridization conditions and guidance for devising suitable conditions are set forth by Sambrook, J., E. F. Fritsch, and T. Maniatis (1989, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., chapters 9 and 11; and Current Protocols in Molecular Biology, 1995, F. M. Ausubel et al., eds., John Wiley & Sons, Inc., sections 2.10 and 6.3-6.4, incorporated herein by reference), and can be readily determined by those having ordinary skill in the art based on, for example, the length and/or base composition of the nucleic acid. One way of achieving moderately stringent conditions involves the use of a prewashing solution containing 5.times.SSC, 0.5% SDS, 1.0 mM EDTA (pH 8.0), hybridization buffer of about 50% formamide, 6.times.SSC, and a hybridization temperature of about 55.degree. C. (or other similar hybridization solutions, such as one containing about 50% formamide, with a hybridization temperature of about 42.degree. C.), and washing conditions of about 60.degree. C., in 0.5.times.SSC, 0.1% SDS. Generally, highly stringent conditions are defined as hybridization conditions as above, but with washing at approximately 68.degree. C., 0.2.times.SSC, 0.1% SDS. SSPE (1.times. SSPE is 0.15M NaCl, 10 mM NaH.sub.2PO.sub.4, and 1.25 mM EDTA, pH 7.4) can be substituted for SSC (1.times.SSC is 0.15M NaCl and 15 mM sodium citrate) in the hybridization and wash buffers; washes are performed for 15 minutes after hybridization is complete. It should be understood that the wash temperature and wash salt concentration can be adjusted as necessary to achieve a desired degree of stringency by applying the basic principles that govern hybridization reactions and duplex stability, as known to those skilled in the art and described further below (see, e.g., Sambrook et al., 1989). When hybridizing a nucleic acid to a target polynucleotide of unknown sequence, the hybrid length is assumed to be that of the hybridizing nucleic acid. When nucleic acids of known sequence are hybridized, the hybrid length can be determined by aligning the sequences of the nucleic acids and identifying the region or regions of optimal sequence complementarity. The hybridization temperature for hybrids anticipated to be less than 50 base pairs in length should be 5 to 10.degree. C. less than the melting temperature (T.sub.m) of the hybrid, where T.sub.m is determined according to the following equations. For hybrids less than 18 base pairs in length, T.sub.m (.degree. C.)=2(# of A+T bases)+4(# of G+C bases). For hybrids above 18 base pairs in length, T.sub.m (.degree. C.)=81.5+16.6(log 10 [Na.sup.+9 )+0.41(% G+C)-(600/N), where N is the number of bases in the hybrid, and [Na.sup.+] is the concentration of sodium ions in the hybridization buffer ([Na.sup.+ ]for 1.times.SSC=0.165M). Preferably, each such hybridizing nucleic acid has a length that is at least 25% (more preferably at least 50%, or at least 60%, or at least 70%, and most preferably at least 80%) of the length of the nucleic acid of the invention to which it hybridizes, and has at least 60% sequence identity (more preferably at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97.5%, or at least 99%, and most preferably at least 99.5%) with the polynucleotide of the invention to which it hybridizes.

[0101] Other embodiments of the invention include polynucleotides having sequences that encode discrete domains of a HAM polypeptide having a sequence as set forth in SEQ ID NO:2 or 19. Computer analysis predicts that the signal peptide of the HAM polypeptides is most likely to be cleaved after residue 60 of SEQ ID NO:2 and after residue 59 of SEQ ID NO:19, though other possible cleavage sites include after amino acids 54, 55, 59, 172, or 173. These cleavage sites predict a mature HAM polypeptide comprising from about amino acid 55 to 1379, from about 56 to 1379, from about 60 to 1379, from about 61 to 1379, or from about 174 to 1379 of SEQ ID NO:2, and from about 55 to 1378, from about 56 to 1378, from about 60 to 1378, from about 61 to 1378, or from about 173 to 1378 of SEQ ID NO:19. The EGF-like domains located, for example, at about amino acids 63-90, 211-243, and 261-280 of SEQ ID NO:2 are likely to be involved in extracellular signaling or cellular guidance. A CUB domain, a KELCH motif, a C-type Lectin or carbohydrate-recognition domain, a putative ligand binding motif of the common gamma cytokine chain, and a Laminin EGF -like domain located at about amino acids 93-208, 581-612, 749-873, 670-686, and 1014-1055 of SEQ ID NO:2, respectively (see FIG. 3). A transmembrane region is present at about amino acids 1231 to 1251, and a cytoplasmic domain at about amino acids 1252 to 1379 of SEQ ID NO:2. Thus, the invention provides polynucleotides encoding these discrete polypeptide fragments, as well as the polypeptide fragments comprising each domain separately or in various combinations. The invention provides polynucleotides comprising from about nucleotide 1-162, from about 1-165, from about 1-177, from about 1-180, or from about 1-522 of SEQ ID NO:1, which encode the signal peptides residing at about amino acids 1-54, 1-55, 1-59, 1-60, or 1-173 of SEQ ID NO:2; from about nucleotides 163-4137, from about 166-4137, from about 178-4137, from about 181-4137, or from about 523-4137 of SEQ ID NO:1, which encode mature HAM polypeptides comprising, respectively, amino acids 55-1379, 56-1379, 60-1379, 61-1379, or 174-1379 of SEQ ID NO:2; nucleotides 3691-3753 of SEQ ID NO:1, encoding a transmembrane region comprising amino acids 1231-1251 of SEQ ID NO:2; nucleotides 163-3690, 166-3690, 178-3690, 181-3690, or 523-3690 of SEQ ID NO:1, encoding extracellular domains of the HAM polypeptide comprising amino acids 55-1230, 56-1230, 60-1230, 61-1230, or 174-1230, respectively, of SEQ ID NO:2; and nucleotides 3754-4137 of SEQ ID NO:1, encoding a cytoplasmic domain comprising amino acids 1252-1379 of SEQ ID NO:2.

[0102] In addition, the invention provides polynucleotides comprising from about nucleotides 1-177 of SEQ ID NO:18, which encode the signal peptide residing at about amino acids 1-59 of SEQ ID NO:19; from about nucleotides 178-4134 of SEQ ID NO:18, which encodes a mature murine HAM polypeptide comprising amino acids 60-1378 of SEQ ID NO:19; and from about nucleotides 178-3687 of SEQ ID NO:18, encoding an extracellular domain of a murine HAM polypeptide comprising amino acids 60-1229 of SEQ ID NO:19.

[0103] Polynucleotides of the invention may be used in developing treatments for any disorder mediated (directly or indirectly) by defective, or insufficient amounts of, the genes corresponding to the polynucleotides of the invention. Disclosure herein of sequences corresponding to the polynucleotides of the invention permits the detection of defective genes, and the replacement thereof with normal genes. Defective genes may be detected in in vitro diagnostic assays, and by comparison of the polynucleotide sequences disclosed herein with that of a gene derived from a subject suspected of harboring a defect in the genes.

[0104] Expression, isolation and purification of the polypeptides and fragments of the invention may be accomplished by any suitable technique, including the utilization of expression systems such as those known in the art as well as those described herein. In one embodiment, the invention provides an expression vector comprising a polynucleotide encoding a HAM polypeptide of the invention. The polynucleotide of the invention (e.g., a polynucleotide comprising a sequence as set forth in SEQ ID NO:1 or 18) may be operably inserted into, for example, a commercially available expression vector by recombinant techniques known in the art. Typically the polynucleotide will be inserted downstream (or 3') of and operably linked to a control or regulatory sequence. As used herein, a "control sequence" or "regulatory sequence" are used interchangeably to include a promoter, enhancer-promoter combination, or other sequence that effects the expression or transcription of the downstream polynucleotide sequence. A promoter is a transcriptional regulatory element composed of a region of a DNA molecule typically within 100 nucleotide pairs in front of (upstream of) the point at which transcription starts. Another transcriptional regulatory element is an enhancer, which provides specificity in terms of time, location, and expression level Unlike a promoter, an enhancer can function when located at variable distances from the transcription site, provided a promoter is present. An enhancer can also be located downstream of the transcription initiation site. Other regulatory sequences include transcription termination sequence, internal ribosome entry sites (IRES), and the like.

[0105] Typically, to bring a coding sequence under control of a promoter, it is necessary to position the translation initiation site of the translational reading frame of the peptide or polypeptide between one and about fifty nucleotides downstream (3') of the promoter. Such regulatory elements include but are not limited to the cytomegalovirus hCMV immediate early gene, the early or late promoters of SV40 adenovirus, the lac system, the trp system, the TAC system, the TRC system, the major operator and promoter regions of phage A, the control regions of fd coat protein, the promoter for 3-phosphoglycerate kinase, the promoters of acid phosphatase, and the promoters of the yeast .alpha.-mating factors, to name a few.

[0106] Expression vectors and methods for their construction are known to those skilled in the art (Ausubel et al., cited herein). Suitable vectors include plasmids, and viral vectors such as herpes viruses, retroviruses, canary poxviruses, adenoviruses and adeno-associated viruses, among others, and derivatives thereof.

[0107] A polynucleotide and regulatory sequences are "operably linked" when they are connected in such a way as to permit expression when the coding sequence (e.g., the HAM coding sequence) of the polynucleotide is bound to the regulatory sequences, e.g., within an expression vector. An origin of replication that confers the ability to replicate in the desired host cells, and a selection gene (e.g., kan.sup.r, amp.sup.r) by which transformants are identified, are generally incorporated into the expression vector.

[0108] Expression vectors comprising a polynucleotide of the invention may be used to prepare the polypeptides or fragments of the invention encoded by the polynucleotide. A method for producing polypeptides comprises culturing host cells transformed or tranfected with a recombinant expression vector encoding the polypeptide, under conditions that promote expression of the polypeptide, then recovering the expressed polypeptides from the cells or from culture medium in which the host cell is grown. The procedure for purifying the expressed polypeptides will vary according to the type of host cells employed, and whether the polypeptide is membrane-bound or is a secreted soluble form of the polypeptide.

[0109] In addition, a sequence encoding an appropriate signal peptide (native or heterologous) can be incorporated into expression vectors. A DNA sequence for a signal peptide may be fused in frame to a polynucleotide sequence of the invention so that the polynucleotide is initially transcribed, and the mRNA translated, into a fusion protein comprising the signal peptide. Signal peptides may be employed that direct transmembrane proteins to the cell surface or different signal peptides may be used that promote the secretion of a soluble form of the protein. Generally, the signal peptide is cleaved during maturation of the protein. A polynucleotide encoding a localization sequence, or signal sequence, can be ligated or fused at the 5' terminus of a polynucleotide encoding a HAM polypeptide such that the signal peptide is located at the amino terminal end of the resulting fusion polynucleotide/polypeptide. In eukaryotes, the signal peptide functions to transport the fusion polypeptide across the endoplasmic reticulum. The secretory protein is then transported through the Golgi apparatus, into secretory vesicles and into the extracellular space or, preferably, the external environment. Signal peptides, which can be utilized according to the invention, include pre-pro peptides, which contain a proteolytic enzyme recognition site.

[0110] The localization sequence can be a nuclear localization sequence, an endoplasmic reticulum localization sequence, a peroxisome localization sequence, a mitochondrial localization sequence, or a localized protein. Localization sequences can be targeting sequences that are described, for example, in "Protein Targeting", chapter 35 of Stryer, L., Biochemistry (4th ed.). W. H. Freeman, 1995. Some important localization sequences include those targeting the nucleus (e.g., KKKRK (SEQ ID NO:13)), mitochondrion (MLRTSSLFTRRVQPSLFRNILRLQST (SEQ ID NO:14)), endoplasmic reticulum (KDEL (SEQ ID NO:15)), peroxisome (SKF), prenylation or insertion into plasma membrane (CAAX (SEQ ID NO:16), CC, CXC, or CCXX (SEQ ID NO:17)), cytoplasmic side of plasma membrane (fusion to SNAP-25), or the Golgi apparatus (fusion to furin). Other examples of heterologous signal peptides that are functional in mammalian host cells include the signal sequence for interleukin-7 (IL-7) described in U.S. Pat. No. 4,965,195; the signal sequence for interleukin-2 receptor described in Cosman et al., Nature 312:768 (1984); the interleukin-4 receptor signal peptide described in EP 367,566; the type I interleukin-1 receptor signal peptide described in U.S. Pat. No. 4,968,607; and the type II interleukin-1 receptor signal peptide described in EP 460,846.

[0111] The skilled artisan will also recognize that the position(s) at which the signal peptide is cleaved may differ from that predicted by computer program, and may vary according to such factors as the type of host cells employed in expressing a recombinant polypeptide. A protein preparation may include a mixture of protein molecules having different N-terminal amino acids, resulting from cleavage of the signal peptide at more than one site. Particular embodiments of mature HAM polypeptides provided herein having a native signal sequence include, but are not limited to, polypeptides wherein the N-terminus amino acid is any amino acid between 55 and 61 of SEQ ID NO:2.

[0112] Suitable host cells for expression of polypeptides include prokaryotes (e.g., E. coli), yeast, plant cells, and insect or higher eukaryotic cells. Most typically, yeast or mammalian cells are used. Appropriate cloning and expression vectors for use with bacterial, fungal, yeast, and mammalian cellular hosts are described, for example, in Pouwels et al. Cloning Vectors: A Laboratory Manual, Elsevier, N.Y., (1985). Cell-free translation systems could also be employed to produce polypeptides using RNAs derived from DNA constructs disclosed herein.

[0113] Suitable prokaryotic host cells for transformation may be gram-negative or gram-positive, and include, for example, E. coli, Bacillus subtilis, Salmonella typhimurium, and various other species within the genera Pseudomonas, Streptomyces, and Staphylococcus. In a prokaryotic host cell, such as E. coli, a polypeptide may include an N-terminal methionine (met) residue to facilitate expression of the recombinant polypeptide in the prokaryotic host cell. The N-terminal Met may be cleaved from the expressed recombinant polypeptide.

[0114] Expression vectors for use in prokaryotic host cells generally comprise one or more phenotypic selectable marker genes, which may include, for example, a gene encoding a protein that confers antibiotic resistance or that supplies an autotrophic requirement. Useful prokaryotic expression vectors include those derived from commercially available plasmids such as the cloning vector pBR322 (ATCC 37017), with ampicillin and tetracycline resistance genes. Other suitable vectors include, pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden) and pGEM1 (Promega Biotec, Madison, Wis., USA). An appropriate promoter and a polynucleotide sequence encoding the desired polypeptide may be inserted into the vector.

[0115] Promoter sequences commonly used for recombinant prokaryotic host cell expression vectors include .beta.-lactamase (penicillinase), lactose promoter system (Chang et al., Nature 275:615, 1978; and Goeddel et al., Nature 281:544, 1979), tryptophan (trp) promoter system (Goeddel et al., Nucl. Acids Res. 8:4057, 1980) and tac promoter (Maniatis et al., Molecular Cloning: A Laboratory Manual, first ed., Cold Spring Harbor Laboratory, p. 412, 1982). A particularly useful prokaryotic host cell expression system employs a phage .lamda.PL promoter and a cI857ts thermolabile repressor sequence. Plasmid vectors available from the American Type Culture Collection which incorporate derivatives of the .lamda.PL promoter include plasmid pHUB2 (resident in E. coli strain JMB9, ATCC 37092) and pPLc28 (resident in E. coli RR1, ATCC 53082).

[0116] Alternatively, the polypeptides may be expressed in yeast host cells, such as from the Saccharomyces genus (e.g., S. cerevisiae). Alternatively, Pichia, Kluyveromyces, or other yeast genera may be employed. Yeast vectors will often contain an origin of replication sequence from a 2mu yeast plasmid, an autonomously replicating sequence (ARS), a promoter region, sequences for polyadenylation, sequences for transcription termination, and a selectable marker gene. Suitable promoter sequences include those derived from the yeast metallothionein or 3-phosphoglycerate kinase genes (Hitzeman et al., J. Biol. Chem. 255:2073, 1980) or other genes encoding glycolytic enzymes (Hess et al., J. Adv. Enzyme Reg. 7:149, 1968; and Holland et al., Biochem. 17:4900, 1978), such as enolase, glyceraldehyde-3-phosphate dehydrogenase, hexokinase, pyruvate decarboxylase, phosphofructokinase, glucose-6-phosphate isomerase, 3-phosphoglycerate mutase, pyruvate kinase, triosephosphate isomerase, phospho-glucose isomerase, and glucokinase. Other suitable vectors and promoters for use in yeast expression are known in the art (e.g., see in Hitzeman, EPA-73,657; Russell et al., J. Biol. Chem. 258:2674, 1982; and Beier et al., Nature 300:724, 1982).

[0117] The yeast .alpha.-factor leader sequence may be employed to direct secretion of the polypeptide, and often is inserted between the promoter sequence and the structural gene sequence (e.g., Kurjan et al., Cell 30:933, 1982 and Bitter et al., Proc. Natl. Acad. Sci. USA 81:5330, 1984).

[0118] Yeast transformation protocols are known to those of skill in the art, including a protocol involving selection for Trp transformants in a medium containing yeast nitrogen base, casamino acids, glucose, 10 mg/ml adenine and 20 mg/ml uracil (see, e.g., Hinnen et al., Proc. Natl. Acad. Sci. USA 75:1929, 1978). In other protocols, yeast cells transformed by vectors containing an ADH2 promoter sequence may be grown in a "rich" medium. An example of a rich medium is one consisting of 1% yeast extract, 2% peptone, and 1% glucose supplemented with 80 mg/ml adenine and 80 mg/ml uracil. Derepression of the ADH2 promoter occurs when glucose is exhausted from the medium.

[0119] Mammalian or insect host cell culture systems also may be employed to express recombinant polypeptides, such as the bacculovirus systems reviewed by Luckow and Summers, Bio/Technology 6:47 (1988). Established cell lines of mammalian origin also may be employed. Examples of suitable mammalian host cell lines include the COS-7 line of monkey kidney cells (ATCC CRL 1651) (Gluzman et al., Cell 23:175, 1981), L cells, C127 cells, 3T3 cells (ATCC CCL 163), Chinese hamster ovary (CHO) cells, HeLa cells, and BHK (ATCC CRL 10) cell lines, and the CV1/EBNA cell line derived from the African green monkey kidney cell line CV1 (ATCC CCL 70) as described by McMahan et al. (EMBO J. 10: 2821, 1991).

[0120] Established methods for introducing polynucleotides into mammalian cells have been described (Kaufman, R. J., Large Scale Mammalian Cell Culture, 1990, pp. 15-69). Additional protocols using commercially available reagents, such as Lipofectamine lipid reagent (Gibco/BRL) or Lipofectamine-Plus lipid reagent, can be used to transfect cells (Feigner et al., Proc. Natl. Acad. Sci. USA 84:7413-7417, 1987). In addition, electroporation can be used to transfect mammalian cells using conventional procedures, such as those in Sambrook et al., 1989. Selection of stable transformants can be performed using methods known in the art, such as, for example, resistance to cytotoxic drugs. Kaufman et al., Meth. in Enzymology 185:487-511, 1990, describes several selection schemes, such as dihydrofolate reductase (DHFR) resistance. A suitable host strain for DHFR selection is CHO strain DX-B11, which is deficient in DHFR (Urlaub and Chasin, Proc. Natl. Acad. Sci. USA 77:4216-4220, 1980). A plasmid expressing the DHFR cDNA can be introduced into strain DX-B11, and only cells that contain the plasmid can grow in the appropriate selective media. Other examples of selectable markers include genes conferring resistance to antibiotics, such as G418 and hygromycin B, which permit selection of cells harboring the vector on the basis of resistance to these agents.

[0121] Transcriptional and translational control sequences for mammalian host cell expression vectors can be excised from viral genomes. Commonly used promoter sequences and enhancer sequences are derived from polyoma virus, adenovirus 2, simian virus 40 (SV40), and human cytomegalovirus. Polynucleotide sequences derived from the SV40 viral genome, for example, SV40 origin, early and late promoter, enhancer, splice, and polyadenylation sites can be used to provide other genetic elements for expression of a structural gene sequence in a mammalian host cell. Viral early and late promoters are particularly useful because both are easily obtained from a viral genome as a fragment, which can also contain a viral origin of replication (Fiers et al., Nature 273:113, 1978; Kaufman, Meth. in Enzymology, 1990). Smaller or larger SV40 fragments can also be used, provided the approximately 250 by sequence extending from the Hind III site toward the Bgl I site located in the SV40 viral origin of replication site is included.

[0122] Additional control sequences shown to improve expression of heterologous genes from mammalian expression vectors include such elements as the expression augmenting sequence element (EASE) derived from CHO cells (Morris et al., Animal Cell Technology, 1997, pp. 529-534 and PCT Application WO 97/25420) and the tripartite leader (TPL) and VA gene RNAs from Adenovirus 2 (Gingeras et al., J. Biol. Chem. 257:13475-13491, 1982). The internal ribosome entry site (IRES) sequences of viral origin allows dicistronic mRNAs to be translated efficiently (Oh and Sarnow, Current Opinion in Genetics and Development 3:295-300, 1993; Ramesh et al., Nucleic Acids Research 24:2697-2700, 1996). Expression of a heterologous cDNA as part of a dicistronic mRNA followed by the gene for a selectable marker (e.g. DHFR) has been shown to improve transfectability of the host and expression of the heterologous polynucleotides (Kaufman, Meth. in Enzymology, 1990). Exemplary expression vectors that employ dicistronic mRNAs are pTR-DC/GFP described by Mosser et al., Biotechniques 22:150-161, 1997, and p2A5I described by Morris et al., Animal Cell Technology, 1997, pp. 529-534.

[0123] A useful high expression vector, pCAVNOT, has been described by Mosley et al., Cell 59:335-348, 1989. Other expression vectors for use in mammalian host cells can be constructed as disclosed by Okayama and Berg (Mol. Cell. Biol. 3:280, 1983). A useful system for stable high level expression of mammalian cDNAs in C127 murine mammary epithelial cells can be constructed substantially as described by Cosman et al. (Mol. Immunol. 23:935, 1986). A useful high expression vector, PMLSV N1/N4, described by Cosman et al., Nature 312:768, 1984, has been deposited as ATCC 39890. Additional useful mammalian expression vectors are described in EP-A-0367566, and in WO 91/18982, incorporated by reference herein. In yet another alternative, the vectors can be derived from retroviruses.

[0124] Additional useful expression vectors, pFLAG.RTM. and pDC311, can also be used. FLAG.RTM. technology is centered on the fusion of a low molecular weight (1 kD), hydrophilic, FLAG.RTM. marker peptide to the N-terminus of a recombinant protein expressed by pFLAG.RTM. expression vectors. pDC311 is another specialized vector used for expressing proteins in CHO cells. pDC311 is characterized by a bicistronic sequence containing the gene of interest and a dihydrofolate reductase (DHFR) gene with an internal ribosome binding site for DHFR translation, an expression augmenting sequence element (EASE), the human CMV promoter, a tripartite leader sequence, and a polyadenylation site.

[0125] Other useful fragments of the disclosed polynucleotides include antisense or sense oligonucleotides comprising a single-stranded polynucleotide sequence (either RNA or DNA) capable of binding to target mRNA (sense) or DNA (antisense) sequences. Antisense or sense oligonucleotides, according to the present invention, comprise fragments of the polynucleotide having a sequence as set forth in SEQ ID NO:1 or 18. Such a fragment generally comprises at least about 14 nucleotides, preferably from about 14 to about 30 nucleotides. The ability to derive an antisense or a sense oligonucleotide, based upon a nucleic acid sequence encoding a given protein is described in, for example, Stein and Cohen (Cancer Res. 48:2659, 1988) and van der Krol et al. (Bio Techniques 6:958, 1988).

[0126] Binding of antisense or sense oligonucleotides to target nucleic acids results in the formation of duplexes that block or inhibit protein expression by one of several means, including enhanced degradation of the mRNA by RNAse H, inhibition of splicing, premature termination of transcription or translation, or by other means. The antisense oligonucleotides thus may be used to block expression of proteins. Antisense or sense oligonucleotides further comprise oligonucleotides having modified sugar-phosphodiester backbones (or other sugar linkages, such as those described in WO91/06629) and wherein such sugar linkages are resistant to endogenous nucleases. Such oligonucleotides with resistant sugar linkages are stable in vivo (ie., capable of resisting enzymatic degradation) but retain sequence specificity to be able to bind to target nucleic acids.

[0127] Other examples of sense or antisense oligonucleotides include those oligonucleotides which are covalently linked to organic moieties, such as those described in WO 90/10448, and other moieties that increases affinity of the oligonucleotide for a target nucleic acid, such as poly-(L)-lysine. Further still, intercalating agents, such as ellipticine, and alkylating agents or metal complexes may be attached to sense or antisense oligonucleotides to modify binding specificities of the antisense or sense oligonucleotide for the target nucleotide sequence.

[0128] Antisense or sense oligonucleotides may be introduced into a cell containing the target nucleic acid by any gene transfer method, including, for example, lipofection, CaPO.sub.4-mediated DNA transfection, electroporation, or by using gene transfer vectors such as Epstein-Barr virus or adenovirus.

[0129] Sense or antisense oligonucleotides also may be introduced into a cell containing the target nucleic acid by formation of a conjugate with a ligand-binding molecule, as described in WO 91/04753. Suitable ligand binding molecules include, but are not limited to, cell surface receptors, growth factors, other cytokines, or other ligands that bind to cell surface receptors. Preferably, conjugation of the ligand-binding molecule does not substantially interfere with the ability of the ligand-binding molecule to bind to its corresponding molecule or receptor, or block entry of the sense or antisense oligonucleotide or its conjugated version into the cell.

[0130] Alternatively, a sense or an antisense oligonucleotide may be introduced into a cell containing the target nucleic acid by formation of an oligonucleotide-lipid complex, as described in WO 90/10448. The sense or antisense oligonucleotide-lipid complex is preferably dissociated within the cell by an endogenous lipase.

[0131] The polynucleotides of the invention enable the construction of vectors (e.g., expression vectors) comprising a polynucleotide encoding a HAM polypeptide of the invention, or fragment thereof; host cells transfected or transformed with the vectors; methods of producing and purifying biologically active polypeptides and bioactive fragments thereof; the use of the polynucleotides or oligonucleotides thereof as probes to identify nucleic acids encoding related attractin or mahogany family proteins; the use of the polynucleotides or oligonucleotides thereof to correlate the location of genes encoding HAM polypeptides of the invention with chromosome regions associated with human diseases; the use of the polynucleotides or oligonucleotides thereof to identify genes associated with tumors, immune disorders, syndromes or other human conditions; the administration of the disclosed proteins or fragments thereof for the treatment of disorders characterized by a mutation in a gene encoding a HAM polypeptide or by an excess or a deficiency of a HAM polypeptide; and the use of single-stranded sense or antisense oligonucleotides to inhibit expression of polynucleotides encoding a HAM polypeptide. In addition, the invention provides the use of the disclosed polypeptides and soluble fragments thereof as competitive inhibitors of the binding of native HAM polypeptides to their ligands, cognates, or counter-structure binding partners; the use of HAM polypeptides and fragments thereof as unique molecular weight markers or as controls for peptide fragmentation as well as kits comprising these reagents; the use of HAM polypeptides and fragments thereof to generate antibodies; and the use of such antibodies to purify HAM polypeptides; as affinity reagents for the separation of hematopoietic cells expressing the proteins as well as the use of the antibodies in the modulation of HAM polypeptide biological activity. For treatment of humans, typically human HAM polypeptides, fragments and polynucleotides encoding the foregoing are used.

[0132] Activity Assays

[0133] The purified polypeptides of the invention (including proteins, polypeptides, fragments, variants, oligomers, and other forms) may be tested for the ability to bind a HAM binding partner. Such activities can be measured in any suitable assay, such as a conventional binding or enzymatic assay. To illustrate, in a typical binding assay the polypeptide may be labeled with a detectable reagent (e.g., a radionuclide, chromophore, enzyme that catalyzes a colorimetric or fluorometric reaction, and the like), and then contacted with cells expressing a HAM binding partner on its surface. The cells are washed to remove unbound-labeled polypeptide, and the presence of cell-bound label is determined by a suitable technique. For example, a recombinant expression vector is constructed containing a polynucleotide encoding a HAM polypeptide (or bioactive fragment thereof) fused to an Fc region according to methods well known in the art. Upon expression the polynucleotide encodes, for example, a soluble HAM polypeptide comprising the extracellular portions of the HAM polypeptide, or the extracellular domain and a cytoplasmic domain with the transmembrane region removed. For example, host cells are transfected with the recombinant expression vector comprising a polynucleotide of the invention. After culturing the transfected cells, culture medium containing a HAM or other soluble polypeptide of the invention is collected from the transfected cells and the amount of the polypeptide is quantified using standard methods.

[0134] Cells expressing the HAM binding partner are cultured and washed with BM-NFDM, which is binding medium (RPMI 1640 containing 25 mg/ml bovine serum albumin, 2 mg/ml sodium azide, 20 mM Hepes pH 7.2) to which 50 mg/ml nonfat dry milk has been added. The cells then are incubated with various concentrations of, for example, a soluble polypeptide/Fc fusion protein made as set forth above. Cells are washed and incubated with a constant saturating concentration of a .sup.125I-mouse anti-human IgG in binding medium, with gentle agitation for 1 hour at 37.degree. C. After extensive washing, cells are released via trypsinization.

[0135] The mouse anti-human IgG employed above is directed against the Fc region of human IgG and can be obtained from Jackson Immunoresearch Laboratories, Inc., West Grove, Pa. The antibody is radioiodinated using the standard chloramine-T method. The antibody will bind to the Fc portion of any polypeptide/Fc protein that has bound to the cells. In all assays, non-specific binding of .sup.125I-antibody is assayed in the absence of the Fc fusion protein/Fc, as well as in the presence of the Fc fusion protein and a 200-fold molar excess of unlabeled mouse anti-human IgG antibody.

[0136] Cell-bound .sup.125I-antibody is quantified on a Packard Autogamma counter. Affinity calculations (Scatchard, Ann. N.Y. Acad. Sci. 51:660, 1949) are generated on RS/1 (BBN Software, Boston, Mass.) run on a Microvax computer.

[0137] To illustrate, the substrate may be labeled with a detectable reagent (e.g., a radionuclide, chromophore, and the like), and then contacted with cells or a sample containing a HAM polypeptide or fragment thereof. The labeled-substrate is typically bound to a microtiter plate or the like. Following incubation of the two components the plate is washed and the amount of label still present on the plate is quantitated compared to a control plate. A reduction in label on the plate is indicative of enzymatic activity.

[0138] Another type of suitable binding assay is a competitive binding assay. To illustrate, biological activity of a variant may be determined by assaying for the variant's ability to compete with the native proteins for binding to its binding partner.

[0139] Competitive binding assays can be performed by conventional methodology. Reagents that may be employed in competitive binding assays include a radiolabeled soluble HAM polypeptide or intact cells expressing a HAM polypeptide (endogenous or recombinant) on the cell surface. For example, a radiolabeled bioactive fragment of a HAM polypeptide can be used to compete with a soluble variant for binding to a cell surface-binding partner. Instead of intact cells, one could substitute a bioactive fragment of a HAM polypeptide/Fc fusion protein bound to a solid phase through the interaction of Protein A or Protein G (on the solid phase) with the Fc moiety. Chromatography columns that contain Protein A and Protein G include those available from Pharmacia Biotech, Inc., Piscataway, N.J.

[0140] Another type of competitive binding assay utilizes a radiolabeled soluble bioactive fragment of a HAM polypeptide, such as a soluble bioactive fragment/Fc fusion protein, and intact cells expressing HAM binding partners. Qualitative results can be obtained by competitive autoradiographic plate binding assays, while Scatchard plots (Scatchard, Ann. N.Y. Acad. Sci. 51:660, 1949) may be utilized to generate quantitative results.

[0141] Diagnostic Assays

[0142] The polynucleotides and polypeptides provided herein are useful as diagnostic reagents in assays to detect malfunctioning or mutant HAM genes. Samples for diagnosis may be obtained from a subject's tissues, for example, throat swab, blood, serum, urine, saliva, cerebrospinal fluid, feces, tissue biopsy, and so on. Similar samples are taken from normal individuals (from persons not suffering from the disorder or mutation in question), and these normal or standard samples provide a basis for comparison. Alternatively, purified reagents (e.g., HAM polynucleotides, polypeptides, and antibodies) may be used as standards for the diagnostic assays. In some embodiments, fragments of the polynucleotides of the invention are used as probes for Northern or Southern blots or as PCR primers to detect mutated forms of a HAM polypeptide encoded by the target nucleic acid.

[0143] Conditions that may be diagnosed include those characterized by an excess or deficiency of a HAM polypeptide, or that are characterized by a mutated form of such a polypeptide. Such conditions include, but are not limited to, absence of the polypeptide in a cell that requires its expression, altered enzymatic activity, altered signalling ability, overexpression or underexpression in a cell that under normal conditions has such an activity.

[0144] Particular conditions that may be diagnosed using these assays include but are not limited to: rheumatologic diseases (e.g., rheumatoid arthritis, psoriatic arthritis, seronegative spondyloarthropathies), inflammatatory conditions, bone marrow or solid organ transplantation, graft-versus-host disease, allergies (e.g., asthma, allergic rhinitis), neurologic disorders (e.g., Alzheimer's, Parkinson's, dementia, brain cancer, Bell's palsy, post-herpetic neuralgia), cell proliferative disorders including neoplasms or cancer (e.g., lymphoma, B-cell, T-cell and myeloid cell leukemias), infections (e.g., bacterial, parasitic, protozoal and viral infections, including AIDS), chemotherapy or radiation-induced toxicity, cachexia, cardiovascular disorders (e.g., congestive heart failure, myocardial infarction, ischemia/reperfusion injury, arteritis, stroke), gastrointestinal disorders (e.g., inflammatory bowel disease, Crohn's disease, celiac disease), diabetes mellitus, skin diseases (e.g., psoriasis, scleroderma, dermatomyositis), hematologic disorders (e.g., myelodysplastic syndromes, acquired or Fanconi's aplastic anemia), septic shock, liver diseases (e.g., viral hepatitis or alcohol-associated), bone disorders (e.g., osteoporosis, osteopetrosis).

[0145] In some embodiments of the invention, the condition being diagnosed is a hematologic disorder, and the tissue sample is blood or a lymph node biopsy.

[0146] Screening for Modulators of HAM Polypeptides and Polynucleotides

[0147] The HAM polypeptides and polynucleotides disclosed herein find use in screening assays for identifying agents that modulate the expression or activity of the polynucleotides and polypeptides of the invention, respectively. Once identified, agents that modulate expression or activity of a HAM polynucleotides and polypeptides may be administered, for example, to suppress HAM expression in conditions characterized by overproduction of HAM or other attractin/mahogany related proteins. Similarly, agents that stimulate the biological activity or expresion of a HAM polypeptide in cultured cells or in subjects may be administered to stimulate activity or expression where a condition is characterized by a deficiency of the normal endogenous activator of HAM.

[0148] Methods to identify an agent that modulates the activity or expression of a HAM polypeptide can be carried out using the teachings provided herein. For example, to identify an agent that modulates HAM polypeptide activity a test agent is contacted with a sample containing a HAM polypeptide of the invention. The sample is then assayed to measure HAM activity and the HAM activity in the presence of the test agent is compared to the activity present in a standard (ie., a control) sample that does not have the agent present. A sample can be, for example, a cell-free sample, a cell-containing sample (e.g., a cell culture), or a tissue sample (e.g., a tissue sample obtained or derived from a subject). A standard sample includes, for example, the sample prior to contact with the test agent or a sample that represents normal activity. Activity can be measured using any of the assay methods identified herein (e.g., competitive binding assays, enzymatic assays, and the like). A change in activity compared to a control or standard sample is indicative of an agent that modulates (e.g., increases or decreases) activity.

[0149] Similarly, the invention provides a method for identifying an agent that modulates expression of a HAM polypeptide. Such methods include, for example, contacting a sample comprising a polynucleotide of the invention with a test agent and measuring expression of the polynucleotide compared to a standard or control sample. The level of expression can be determined by methods know in the art, including detecting protein (e.g., by Western Blot), or by detecting the amount of mRNA transcribed (e.g., by PCR). As above, the sample can be a cellular sample, a tissue sample, and the like. A change in expression compared to a control or standard sample is indicative of an agent that modulates (e.g., increases or decreases) expression.

[0150] A test agent can include, for example, a protein, a peptide, a peptidomimetic, and antibody, a small molecule, or a polynucleotide (e.g., an antisense or ribozyme). An example of a test agent is a ligand that binds specifically with a HAM polypeptide, or other molecules capable of forming functional heteromers with a HAM polypeptide.

[0151] Cells used for these screening assays may include, for example, cells that naturally express a HAM polypeptide, such as glial cells, T-cells, myeloid cells and other hematopoietic cells, or any convenient cell type that has been transformed or transfected with a heterologous nucleic acid that directs the expression of a HAM polypeptide.

[0152] In other assays, cells expressing a bioactive fragment of a HAM polypeptide (e.g., a soluble form) may be cultured with the test molecule to determine whether the molecule has the capacity to modulate the amount of the bioactive fragment produced by the cells. The amount of bioactive fragment produced may be measured by any suitable method, including enzyme-linked immunosorbent assay (ELISA), dot blot employing an antibody that binds the bioactive fragment, or a solid phase binding assay.

[0153] Methods of Therapy

[0154] This invention provides compounds, compositions, and methods for treating a subject, preferably a mammalian subject, and most preferably a human subject, who is suffering from a medical disorder, and in particular a HAM-mediated disorder. Such HAM-mediated disorders include conditions caused (directly or indirectly) or exacerbated by binding between a HAM polypeptide and a binding partner. For purposes of this disclosure, the terms "illness," "disease," "medical condition," "abnormal condition," and the like are used interchangeably with the term "medical disorder." The terms "treat", "treating", and "treatment" used herein include curative, preventative (e.g., prophylactic) and palliative or ameliorative treatment.

[0155] The polypeptides and polynucleotides of the invention may be administered therapeutically to a mammalian subject (e.g., bovine, equine, feline, canine, porcine, primates), preferably a human subject, having a disorder involving a malfunctioning HAM gene or polypeptide, including an excess or a deficiency of such a polypeptide, or expression of a deleterious mutant form of the polypeptide. Such disorders include conditions caused (directly or indirectly) or exacerbated by such forms of the polypeptides. Where administration is to a human subject the molecules are preferably based upon a human HAM sequence (e.g., a sequence as set forth in SEQ ID NO:1 or 2).

[0156] For these therapeutic methods, agents that modulate activity or expression of a HAM polypeptide or polynucleotide, respectively, may be employed. Such modulating agents are identified by screening, such as by employing the screening methods disclosed herein. Antibodies that bind specifically with the HAM polypeptide or its ligand may modulate the biological activity of the HAM polypeptide.

[0157] Disorders and diseases treatable by the methods and compositions of the invention include, but are not limited to: rheumatologic disorders (e.g., rheumatoid arthritis, psoriatic arthritis, seronegative spondyloarthropathies), bone marrow or solid organ transplant, graft-versus-host reaction, inflammatory conditions, autoimmune disorders (e.g., systemic lupus erythematosus, Hashimoto's thyroiditis, Sjogren's syndrome), allergies (e.g., asthma, allergic rhinitis), neurologic disorders (e.g., Alzheimer's, Parkinson's, dementia, brain cancer, Bell's palsy, post-herpetic neuralgia), cancers (e.g., lymphoma, B-cell, T-cell and myeloid cell leukemias), infections (e.g., bacterial, parasitic, protozoal and viral infections, including AIDS), chemotherapy or radiation-induced toxicity, cachexia, cardiovascular disorders (e.g., congestive heart failure, myocardial infarction, ischemia/reperfusion injury, arteritis, stroke), diabetes mellitus, skin diseases (e.g., psoriasis, scleroderma, dermatomyositis), hematologic disorders (e.g., myelodysplastic syndromes, acquired or Fanconi's aplastic anemia), septic shock, liver diseases (e.g., viral hepatitis or alcohol-associated), bone disorders (e.g., osteoporosis, osteopetrosis), and weight-related or energy metabolism disorders including obesity.

[0158] For treating any one or more of the above disorders, the therapeutic agent, may be administered in an amount effective to measurably reduce one or more signs or symptoms of the disorder being treated. In addition, such disorders may be treated by administration in vivo or ex vivo of a vector or liposome that delivers a non-defective form of the malfunctioning gene to the cell type in which the malfunction is present.

[0159] Therapeutic compositions may comprise a substantially purified HAM polypeptide in any form described herein, such as a native polypeptide, a variant, a derivative, an oligomer, and a bioactive fragment. The composition may comprise a soluble polypeptide or an oligomer comprising a soluble HAM polypeptide. In another embodiment, a composition comprises an antibody directed against at least one HAM polypeptide epitope. In yet another embodiment, a therapeutic agent is attached to the antibody and the antibody is used to target the therapeutic agent to a cell expressing a HAM polypeptide.

[0160] Combination therapies also are envisioned, in which another pharmacologically active agent is co-administered with a therapeutic agent of the present invention. Other agents suitable for co-administration include, but are not limited to, cytokines, lymphokines, chemokines, chemotherapy agents, anti-inflammatories, DMARDs, anti-angiogenic agents (e.g., anti-VEGF antibodies), or any other compound effective in treating the target disease or disorder.

[0161] Pharmaceutical compositions of the invention furthermore may comprise other components such as a physiologically acceptable diluent, carrier, or excipient, and are formulated according to known methods. They can be combined in admixture, either as the sole active material or with other known active materials suitable for a given indication, with pharmaceutically acceptable diluents (e.g., saline, Tris-HCl, acetate, and phosphate buffered solutions), preservatives (e.g., thimerosal, benzyl alcohol, parabens), emulsifiers, solubilizers, adjuvants and/or carriers. Suitable formulations for pharmaceutical compositions include those described in Remington's Pharmaceutical Sciences, 16th ed. 1980, Mack Publishing Company, Easton, Pa.

[0162] In addition, such compositions can be complexed with polyethylene glycol (PEG), metal ions, or incorporated into polymeric compounds such as polyacetic acid, polyglycolic acid, hydrogels, dextran, and the like, or incorporated into liposomes, microemulsions, micelles, unilamellar or multilamellar vesicles, erythrocyte ghosts or spheroblasts. Such compositions will influence the physical state, solubility, stability, rate of in vivo release, and rate of in vivo clearance, and are thus chosen according to the intended application.

[0163] The compositions of the invention can be administered in any suitable manner, e.g., orally, topically, parenterally, or by inhalation. The term "parenteral" includes injection, e.g., by subcutaneous, intravenous, or intramuscular routes, also including localized administration, e.g., at a site of disease or injury. Sustained release from implants is also contemplated. Suitable dosages will vary, depending upon such factors as the nature of the disorder to be treated, the subject's body weight, age, and general condition, and the route of administration. Preliminary doses can be determined according to animal tests, and the scaling of dosages for human administration is performed according to art-accepted practices.

[0164] The dose, route of administration, frequency of administration and duration of an effective regimen of treatment will vary, depending factors such as the particular condition being treated, the severity of the condition, the age, weight, and health of the subject, and the like, and may be adjusted accordingly by the subject's physician.

[0165] In one method of treatment, the active agent is a polypeptide, and is administered by injection one to three times a week at a dose ranging from 0.1-100 mg/kg, or more preferably at a dose of 0.4-50 mg/kg. Treatment is continued until a measurable improvement in the subject's condition has been ascertained, which in most cases will require at least two to eight weeks or more of treatment. Maintenance doses may be administered thereafter, and treatment may be resumed if evidence of disease should reappear. Suitable regimens for other routes of administration may be determined according to methods known in the art. Similarly, suitable regimens for administering antibodies, small molecules, antisense or gene therapy reagents may be determined according to methods known in the art.

[0166] Included within the scope of the invention are pharmacologically acceptable compositions comprising the described therapeutic agents, including compositions suitable for administration by each of the described routes. Such compositions are forumlated in accord with standard practices.

[0167] The following examples are provided to further illustrate particular embodiments of the invention, and are not to be construed as limiting the scope of the present invention.

EXAMPLES

Example 1

Identification, Cloning, and Sequencing of HAM

[0168] Mouse dendritic cell (DC) cDNA microarrays were used to identify novel DC-related genes. High-density nylon arrays were prepared from inserts from a cDNA library prepared from CD11c.sup.+ mouse DCs, which were isolated from the spleens of Flt3L-treated/resting and Flt3L-treated/SEB-stimulated mice. These arrays were then hybridized with labeled first strand cDNAs from mouse DC subsets derived under a number of stimulation conditions. Differentially expressed genes were identified by differential array signals. Changes in signal patterns were identified and the corresponding clones were sequenced and analyzed. One identified clone which contained a sequence that was upregulated in CD8.sup.+/CD11b low (see Table immediately below), in vivo DC, was identified by a BLAST search as being most closely related to Attractin, a type I membrane protein with multiple biological functions, including immunoregulatory (promotion of macrophage spreading coupled to T cell adhesion; defective expression in Combined Variable Immunodeficiency), myelination (mutant gene in the Zitter rat), and metabolism (mutant gene in the Mahogany mouse). A BLAST search using the sequence obtained from the DC clone also identified GenBank accession CAC12966, an ORF predicted from a human genomic contig (GenBank AL355530) which appeared to be orthologous to the mouse DC sequence, and homologous to the N-terminus of Attractin. Additional BLAST analyses identified an EST from human brain cDNA (GenBank AB011106) which showed homology with the 3' end of Attractin. Both CAC12966 and AB011106 are incorporated herein by reference.

Upregulated Sequence in CD8.sup.+/CD11b Low

TABLE-US-00001 [0169] GGAGCCGGGGGTCCGGGCCCGCTCGGGTGCCCCGCAGCCGGCCTCCCCGGTGCTGTGGAG E P G V R A R S G A P Q P A S P V L W R GGCTCGGCCGGCGGGCGGTGGGGGCGCCTCCTCCTGGCTGCTGCTGGACGGGAACAGCTG A R P A G G G G A S S W L L L D G N S W GCTGCTGTGCTATGGCTTCCTCTACCTGGCGCTCTATGCTCAGGTGTCCCAGTCCAAGCC L L C Y G F L Y L A L Y A Q V S Q S K P CTGCGAGAGGACTGGCTCCTGCTTCTCCGGTCGCTGTGTCAACTCCACCTGCCTGTGCGA C E R T G S C F S G R C V N S T C L C D CCCGGGCTGGGTTGGGGACCAGTGCCAGCACTGCCAGGGCAGGTTCAAGTTAACAGAACC P G W V G D Q C Q H C Q G R F K L T E P TTCTGGATATTTAACAGATGGACCAATTAACTATAAATATAAAACAAAGTGTACATGGCT S G Y L T D G P I N Y K Y K T K C T W L AATTGAAGGCTATCCAAATGCAGTGCTAAGGTTAAGATTCAATCATTTTGCTACAGAATG I E G Y P N A V L R L R F N H F A T E C CAGCTGGGATCATATGTATGTTTATGATGGAGATTCTATATACGCACCTTTAGTAGCTGT S W D H M Y V Y D G D S I Y A P L V A V ACTTAGTGGCTTGATCGTTCCTGAAGTGAGGGGTAACGAGACCGTGCCTGAGGTGGTCAC L S G L I V P E V R G N E T V P E V V T GACGTCTGGCTACGCGCTGCTCCACTTTTTCAGCGATGCTGCATATAACCTAACTGGCTT T S G Y A L L H F F S D A A Y N L T G F CAACATTTTTTATTCGATCAATTCCTGTCCTAACAACTGCTCTGGTCATGAAAGTGC N I F Y S I N S C P N N C S G H E S

[0170] A full-length cDNA was amplified in six segments, using PCR primers based on AL355530 and AB011106 sequence. Human ovary cDNA library was used as a template for the PCR. Arrows superimposed on the sequence shown in FIG. 1 depict that position of primers for each fragment.

TABLE-US-00002 Fragment Size Strand Primers A 494 bp sense: 5'-GGGGAAGATGGAGACTGG (SEQ ID NO: 20) antisense: 5'-GTACAGCTATTAAAGGTGCATATATTGAATCTCC (SEQ ID NO: 21) B 952 bp sense: 5'-TTAACAGAACCTTCTGGATATTTAACAGATGGC (SEQ ID NO: 22) antisense: 5'-CTGAATGTCCCTCCACAGCATACTGCTG (SEQ ID NO: 23) C 837 bp sense: 5'-GTTCTTGGACATGGTCAGCAGTATGCTGTG (SEQ ID NO: 24) antisense: 5'-TTGTATTGGCAGTACAGCTGGCACAATCTG (SEQ ID NO: 25) D 897 bp sense: 5'-GCTGCTTCTGATGACAGATGTTACAGATATGC (SEQ ID NO: 26) antisense: 5'-CACATCCAGGCTGTTCCAAACACTGTCCAC (SEQ ID NO: 27) E 855 bp sense: 5'-CCATATGGACAATGTCTAGAGTGGCAAACTGC (SEQ ID NO: 28) antisense: 5'-GCTGACGTACACATAGAACGTAATGTTAGGATTGC (SEQ ID NO: 29) F 650 bp sense: 5'-CAATATCTGGGGAAGAGACTTCTATAGTTTCCAAG (SEQ ID NO: 30) antisense: 5'-GGTTTCCATTTCTCAGACACAAGTTCCTTGACGTGT (SEQ ID NO: 31)

[0171] Several PCR fragments from each amplification were ligated into a cloning vector for sequencing. Sequencing was conducted using standard methodology.

Example 2

Sequence Analysis

[0172] The open reading frame (ORF) of human HAM (SEQ ID NO:1) is predicted to be encoded on 29 exons. Four putative alternatively spliced variants were found during the PCR amplifications including a deletion of exon 7, deletion of exon 10, deletion of exon 19, and a deletion of exon 21. These variants/deletions may occur individually or in combination. In addition, various nucleotide substitutions were identified as follows with reference to SEQ ID NO:1:

TABLE-US-00003 Amino acid Nucleotide of Type of residue of SEQ ID NO: 1 Change Change Result SEQ ID NO: 2 120 aaC > aaT Silent Asn > Asn 40 140 gGc > gAc Gly > Asp 46 400 Aga > Gga Arg > Gly 134 696 taT > taC Silent Tyr > Tyr 232 783 tgT > tgC Silent Cys > Cys 261 1213 Cat > Tat His > Tyr 405 1244 tCa > tTa Ser > Leu 415 1334 cAg > cGg Gln > Arg 445 1418 gTg > gCc Val > Ala 473 1779 atG > atA Met > Ile 593 1950 aaT > aaC Silent Asn > Asn 650 2084 aAt > aGt Asn > Ser 695 2097 agT > agC Silent Ser > Ser 699 2275 Tgt > Cgt Cys > Arg 759 2510 cTt > cCt Leu > Pro 837 2809 Acc > Gcc Thr > Ala 935 2843 aCc > aTc Thr > Ile 948 2947 Ctt > TTT Leu > Phe 982 3005 aAg > aGg Lys > Arg 1002 3013 Gag > Aag Glu > Lys 1005 3222 Deleted Frame- premature at 1074 shift stop 3226 Tgt > Cgt Cys > Arg 1076 3262 Tgc > Cgc Cys > Arg 1088 3288 cgC > cgT Silent Arg > Arg 1097 3374 gAt > gGt Asp > Gly 1125 3376 Cgc > Tgc Arg > Cys 1126 3523 Tct > Cct Ser > Pro 1175 3621-3626 Deletion 1207-1209 (in-frame) 3609 acG > acA Silent Thr > Thr 1203 3653 cAg > cGG Gln > Arg 1218 3718 Tgt > Cgt Cys > Arg 1240 3750 gtG > gtA silent Val > Val 1250 3877 Aca > Gca Thr > Ala 1293 3881 gAg > gGg Glu > Gly 1294 4039 Cta > Tta silent Leu > Leu 1347 4116 tcA > tcG silent Ser > Ser 1372

[0173] An analysis of the sequence as set forth in SEQ ID NO:2 or 19 identified distinct regions of the HAM polypeptides of the invention. A leader sequence, also called a signal peptide, is present in these polypeptides. For example, the leader sequence present in the full-length human HAM polypeptide of the invention is predicted to include amino acids 1-60 of SEQ ID NO:2 and amino acids 1-59 of SEQ ID NO:19. The signal peptide clevage site for HAM was predicted using a computer algorithm. However, one of skill in the art will recognize that the cleavage site of the signal sequence may vary depending upon a number of factors including the organism in which the polypeptide is expressed. Accordingly, the N-terminus of a mature form of a HAM polypeptide of the invention may vary by about 2 to 5 amino acids. Thus, a mature form of the human HAM polypeptide of the invention may include at its N-terminus amino acids 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, or 65 of SEQ ID NO:2. Accordingly, a mature form human HAM can include amino acid 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, or 65 to about amino acid 1379 (or, in the case of a soluble polypeptide, to amino acid 1230) of SEQ ID NO:2. The extracellular regions of the human HAM polypeptides are located at about amino acids 61 to 1230 of SEQ ID NO:2. The EGF-like domains, CUB domain, C-type Lectin or carbohydrate-recognition domain (CLECT domain), KELCH motif and Laminin EGF-like domain assignments, as well as those for the transmembrane and cytoplasmic domains are based upon computer algorithms and on previous reports (Gunn et al., Nature 398:152-157, 1999). The extracellular region of human HAM putatively contains three EGF-like domains, a CUB domain, a KELCH motif, a C-type Lectin or carbohydrate-recognition domain, a putative ligand binding motif of the common gamma cytokine chain, and a Laminin EGF-like domain located at about amino acids 63-90, 211-243, 261-280, 93-208, 581-612, 749-873, 670-686, and 1014-1055 of SEQ ID NO:2, respectively (see FIG. 3). The transmembrane region for the human HAM polypeptides are located at about amino acids 1231 to 1251 of SEQ ID NO:2. The intracellular regions are located at about amino acids 1252 to 1379 of SEQ ID NO:2. In addition, the the recognized sequences above, the sequence RXXHSAVXINGXMXIFGG was found to be repeated in the human HAM sequence of the invention (see for example, amino acids 521 to 540 and 581 to 600 of SEQ ID NO:2). A BLAST of this repeated sequence identified a number attractin and mahogany sequences. Accordingly, this repeat sequence is a putative HAM conserved domain. FIG. 3 shows the relative domains and conserved residues of HAM indicative of an attractin or mahogany polypeptide.

Example 3

Tissue Expression of HAM

[0174] PCR for the attractin homolog used the following primers, which were designed to amplify an approximately 650 by fragment from the predicted 3' end of the coding region. The primers were based on the predicted coding region found within the genomic sequence and are identical to sequences found in the AB011106 sequence:

TABLE-US-00004 (SEQ ID NO: 32) sense strand 5'CAATATCTGGGGAAGAGACTTCTATAGTTTCCAAG (SEQ ID NO: 33) antisense 5'GGTTTCCATTTCTCAGACACAAGTTCCTTGACGTGT

[0175] PCR showed a positive signal using these first strand cDNAs as templates in: placenta, liver, kidney, pancreas, spleen, testis, lymph node, heart, skeletal muscle, brain, ovary, small intestine, esophagus, fetal liver, fetal brain, fetal lung, fetal spleen, fetal, thymus, fetal kidney, and fetal skeletal muscle. No PCR product was detectable in stomach, bone marrow, lung, colon, prostate, thymus, leukocyte and skin. Accordingly, HAM may be used as a tissue specific marker.

Example 4

Monoclonal Antibodies that Bind HAM Polypeptides

[0176] Substantially purified HAM polypeptides or fragments thereof can be used to generate monoclonal antibodies immunoreactive therewith, using conventional techniques such as those described in U.S. Pat. No. 4,411,993. Briefly, mice are immunized with a HAM polypeptide immunogen emulsified in complete Freund's adjuvant, and injected in amounts ranging from 10-100 .mu.g subcutaneously or intraperitoneally. Ten to twelve days later, the immunized animals are boosted with additional HAM polypeptide, or fragment thereof, emulsified in incomplete Freund's adjuvant. Mice are periodically boosted thereafter on a weekly to bi-weekly immunization schedule. Serum samples are periodically taken by retro-orbital bleeding or tail-tip excision to test for HAM antibodies by dot blot assay, ELISA (Enzyme-Linked Immunosorbent Assay), or inhibition of binding of a HAM polypeptide to a HAM polypeptide binding partner.

[0177] Following detection of an appropriate antibody titer, positive animals are provided one last intravenous injection of a HAM polypeptide or fragment in saline. Three to four days later, the animals are sacrificed, spleen cells harvested, and spleen cells are fused to a murine myeloma cell line, e.g., NS1 or preferably P3x63Ag8.653 (ATCC CRL 1580). Fusions generate hybridoma cells, which are plated in multiple microtiter plates in a HAT (hypoxanthine, aminopterin and thymidine) selective medium to inhibit proliferation of non-fused cells, myeloma hybrids, and spleen cell hybrids.

[0178] The hybridoma cells are screened by ELISA for reactivity against a substantially pure HAM polypeptide by adaptations of the techniques disclosed in Engvall et al., (Immunochem. 8:871, 1971) and in U.S. Pat. No. 4,703,004. A preferred screening technique is the antibody capture technique described in Beckmann et al., (J. Immunol. 144:4212, 1990). Positive hybridoma cells can be injected intraperitoneally into syngeneic BALB/c mice to produce ascites containing high concentrations of anti-HAM polypeptide monoclonal antibody. Alternatively, hybridoma cells can be grown in vitro in flasks or roller bottles by various techniques. Monoclonal antibodies produced in mouse ascites can be purified by ammonium sulfate precipitation, followed by gel exclusion chromatography. Alternatively, affinity chromatography based upon binding of antibody to Polypeptide A or Polypeptide G can also be used, as can affinity chromatography based upon binding to HAM polypeptide.

Example 5

Chromosome Mapping

[0179] Chromosome mapping can be carried out in, for example, one of the following two methods. The gene corresponding to a HAM polypeptide is mapped using PCR-based mapping strategies. Initial human chromosomal assignments are made using HAM-specific PCR primers and a BIOS Somatic Cell Hybrid PCRable DNA kit from BIOS Laboratories (New Haven, Conn.), following the manufacturer's instructions. More detailed mapping is performed using a Genebridge 4 Radiation Hybrid Panel (Research Genetics, Huntsville, Ala.; described in Walter, M A et al., Nature Genetics 7:22-28, 1994). Data from this analysis is then submitted electronically to the MIT Radiation Hybrid Mapper following the instructions contained therein. This analysis yields specific genetic marker names which, when submitted electronically to the NCBI Genemap browser to yield the specific chromosome interval.

[0180] Alternatively, database analysis can yield information on the location of the polynucleotide sequence encoding HAM polypeptide. Analysis of human genomic contigs using the Celera human genome database identified the HAM sequence as being located on human chromsome 10q26.

Example 6

Binding Assay

[0181] HAM polypeptides or fragments thereof are expressed by recombinant DNA techniques, purified and tested for the ability to bind with various cells of the various lineages (e.g., hematopoietic cells). The binding assays employ HAM polypeptides, including soluble forms of these polypeptides, and oligomers formed as described below.

[0182] Oligomers for assays are prepared as follows. Fusion proteins comprising a leucine zipper peptide fused to the COOH-terminus of a HAM polypeptide are constructed as described above. The polypeptide can comprise a soluble form of HAM polypeptide, such as the extracellular region of a HAM polypeptide. An expression construct is prepared, essentially as described in Baum et al. (EMBO J. 13:3992-4001, 1994). The construct, in expression vector pDC409, encodes a leader sequence derived from human cytomegalovirus, followed by the leucine zipper moiety fused to the C-terminus of a soluble HAM polypeptide. Alternatively, a gene fusion encoding a HAM polypeptide/Fc fusion protein is inserted into an appropriate expression vector. Polypeptide/Fc fusion proteins are expressed in host cells transformed with the recombinant expression vector, and allowed to assemble by the formation of interchain disulfide bonds between the Fc moieties, thus yielding dimeric molecules.

[0183] The expressed Fc/HAM polypeptide or leucine zipper/HAM polypeptide fusion protein is contacted with a cell suspected of expressing a HAM polypeptide-binding partner. In one embodiment, the activity of the fusion protein is measured by detecting a change in energy metabolism or immune cell activation via any number of indicators. In another embodiment, the activity of the fusion protein is measured by detecting the ability of a cell expressing a native HAM polypeptide to bind to or interact with a cell expressing a HAM polypeptide-binding partner in the presence and absence of the fusion protein. In yet another embodiment, the binding activity of the fusion construct is detected by detecting binding of the fusion protein to a HAM polypeptide cognate using, for example, a labeled anti-IgG antibody.

Sequence CWU 1

1

3314140DNAhomo sapiensCDS(1)..(4140) 1atg gag act ggg ggc cgg gcc cgc act ggt acc ccg cag cca gcg gcc 48Met Glu Thr Gly Gly Arg Ala Arg Thr Gly Thr Pro Gln Pro Ala Ala1 5 10 15ccg ggg gtg tgg agg gct cgg ccg gcg ggc ggc ggc ggc ggg ggc gcc 96Pro Gly Val Trp Arg Ala Arg Pro Ala Gly Gly Gly Gly Gly Gly Ala 20 25 30tcc tcc tgg ctg ctg gac ggg aac agc tgg ctg ctg tgc tat ggc ttc 144Ser Ser Trp Leu Leu Asp Gly Asn Ser Trp Leu Leu Cys Tyr Gly Phe 35 40 45ctc tac ctg gcg ctc tac gcg cag gtg tcc cag tcc aag ccg tgc gag 192Leu Tyr Leu Ala Leu Tyr Ala Gln Val Ser Gln Ser Lys Pro Cys Glu 50 55 60agg acc ggc tcc tgc ttc tcg ggc cgc tgt gtc aac tcc acc tgc ctc 240Arg Thr Gly Ser Cys Phe Ser Gly Arg Cys Val Asn Ser Thr Cys Leu65 70 75 80tgc gac ccg ggc tgg gtg ggg gac cag tgc cag cac tgc cag ggc agg 288Cys Asp Pro Gly Trp Val Gly Asp Gln Cys Gln His Cys Gln Gly Arg 85 90 95ttc aag tta aca gaa cct tct gga tat tta aca gat ggc cca att aac 336Phe Lys Leu Thr Glu Pro Ser Gly Tyr Leu Thr Asp Gly Pro Ile Asn 100 105 110tat aaa tat aaa act aaa tgt act tgg ctc att gaa ggc tat cca aat 384Tyr Lys Tyr Lys Thr Lys Cys Thr Trp Leu Ile Glu Gly Tyr Pro Asn 115 120 125gca gtg tta aga tta aga ttc aat cat ttt gct aca gaa tgt agc tgg 432Ala Val Leu Arg Leu Arg Phe Asn His Phe Ala Thr Glu Cys Ser Trp 130 135 140gat cat atg tat gtt tat gat gga gat tca ata tat gca cct tta ata 480Asp His Met Tyr Val Tyr Asp Gly Asp Ser Ile Tyr Ala Pro Leu Ile145 150 155 160gct gta ctt agt ggt ttg ata gtc cct gaa ata agg ggc aat gaa act 528Ala Val Leu Ser Gly Leu Ile Val Pro Glu Ile Arg Gly Asn Glu Thr 165 170 175gtg cct gaa gtt gtt act aca tct ggc tat gca ctg tta cat ttt ttt 576Val Pro Glu Val Val Thr Thr Ser Gly Tyr Ala Leu Leu His Phe Phe 180 185 190agt gat gct gcg tat aat cta act ggt ttc aac att ttc tat tca atc 624Ser Asp Ala Ala Tyr Asn Leu Thr Gly Phe Asn Ile Phe Tyr Ser Ile 195 200 205aat tct tgt cct aac aat tgc tct ggt cat ggg aag tgt aca act agt 672Asn Ser Cys Pro Asn Asn Cys Ser Gly His Gly Lys Cys Thr Thr Ser 210 215 220gtc tct gtt cca agt caa gta tat tgt gaa tgt gat aaa tac tgg aag 720Val Ser Val Pro Ser Gln Val Tyr Cys Glu Cys Asp Lys Tyr Trp Lys225 230 235 240ggt gaa gct tgt gat att cct tac tgt aaa gcc aat tgc ggc agt cca 768Gly Glu Ala Cys Asp Ile Pro Tyr Cys Lys Ala Asn Cys Gly Ser Pro 245 250 255gat cac ggt tac tgt gac ctg act gga gaa aaa tta tgt gtc tgc aat 816Asp His Gly Tyr Cys Asp Leu Thr Gly Glu Lys Leu Cys Val Cys Asn 260 265 270gat agt tgg caa ggt cct gat tgt tct ttg aat gtt ccc tct act gag 864Asp Ser Trp Gln Gly Pro Asp Cys Ser Leu Asn Val Pro Ser Thr Glu 275 280 285tct tac tgg att ctg cca aac gtt aaa ccc ttc agt cct tct gta ggt 912Ser Tyr Trp Ile Leu Pro Asn Val Lys Pro Phe Ser Pro Ser Val Gly 290 295 300cgg gct tca cat aaa gca gtt tta cac ggg aaa ttt atg tgg gtg att 960Arg Ala Ser His Lys Ala Val Leu His Gly Lys Phe Met Trp Val Ile305 310 315 320ggt gga tat act ttt aac tac agt tct ttt caa atg gtc cta aat tac 1008Gly Gly Tyr Thr Phe Asn Tyr Ser Ser Phe Gln Met Val Leu Asn Tyr 325 330 335aat tta gaa agc agt ata tgg aat gta gga act cca tca agg gga cct 1056Asn Leu Glu Ser Ser Ile Trp Asn Val Gly Thr Pro Ser Arg Gly Pro 340 345 350ctc cag aga tat gga cac tct ctt gct tta tat cag gaa aac atc ttt 1104Leu Gln Arg Tyr Gly His Ser Leu Ala Leu Tyr Gln Glu Asn Ile Phe 355 360 365atg tat gga ggc aga att gaa aca aat gat ggc aat gtc aca gat gaa 1152Met Tyr Gly Gly Arg Ile Glu Thr Asn Asp Gly Asn Val Thr Asp Glu 370 375 380tta tgg gtt ttt aac ata cat agt cag tca tgg agt aca aaa act cct 1200Leu Trp Val Phe Asn Ile His Ser Gln Ser Trp Ser Thr Lys Thr Pro385 390 395 400act gtt ctt gga cat ggt cag cag tat gct gtg gag gga cat tca gca 1248Thr Val Leu Gly His Gly Gln Gln Tyr Ala Val Glu Gly His Ser Ala 405 410 415cat att atg gag ttg gat agt aga gat gtt gtc atg atc ata ata ttt 1296His Ile Met Glu Leu Asp Ser Arg Asp Val Val Met Ile Ile Ile Phe 420 425 430gga tat tct gca ata tat ggt tat aca agc agc ata cag gaa tac cat 1344Gly Tyr Ser Ala Ile Tyr Gly Tyr Thr Ser Ser Ile Gln Glu Tyr His 435 440 445atc tca tca aac act tgg ctt gtt cca gaa act aaa gga gct att gta 1392Ile Ser Ser Asn Thr Trp Leu Val Pro Glu Thr Lys Gly Ala Ile Val 450 455 460caa ggt gga tat ggc cat act agt gtg tat gat gaa ata aca aag tcc 1440Gln Gly Gly Tyr Gly His Thr Ser Val Tyr Asp Glu Ile Thr Lys Ser465 470 475 480att tat gtt cat gga ggg tat aaa gca ttg cca ggg aac aaa tat gga 1488Ile Tyr Val His Gly Gly Tyr Lys Ala Leu Pro Gly Asn Lys Tyr Gly 485 490 495ttg gtt gat gat ctt tat aaa tat gaa gtt aac act aag act tgg act 1536Leu Val Asp Asp Leu Tyr Lys Tyr Glu Val Asn Thr Lys Thr Trp Thr 500 505 510att ttg aaa gaa agt ggg ttt gcc aga tac ctt cat tca gct gtt ctt 1584Ile Leu Lys Glu Ser Gly Phe Ala Arg Tyr Leu His Ser Ala Val Leu 515 520 525atc aat gga gct atg ctt att ttt gga gga aat acc cat aat gac act 1632Ile Asn Gly Ala Met Leu Ile Phe Gly Gly Asn Thr His Asn Asp Thr 530 535 540tcc ttg agt aac ggt gca aaa tgt ttt tct gcc gat ttc ctg gca tat 1680Ser Leu Ser Asn Gly Ala Lys Cys Phe Ser Ala Asp Phe Leu Ala Tyr545 550 555 560gac ata gct tgt gat gaa tgg aaa ata cta cca aaa cca aat ctt cat 1728Asp Ile Ala Cys Asp Glu Trp Lys Ile Leu Pro Lys Pro Asn Leu His 565 570 575aga gat gtc aac aga ttt gga cac tct gca gta gtc att aac ggg tcc 1776Arg Asp Val Asn Arg Phe Gly His Ser Ala Val Val Ile Asn Gly Ser 580 585 590atg tat ata ttt ggg gga ttt tct agt gta ctc ctt aat gat atc ctt 1824Met Tyr Ile Phe Gly Gly Phe Ser Ser Val Leu Leu Asn Asp Ile Leu 595 600 605gta tac aag cct cca aat tgc aag gct ttc aga gat gaa gaa ctt tgt 1872Val Tyr Lys Pro Pro Asn Cys Lys Ala Phe Arg Asp Glu Glu Leu Cys 610 615 620aaa aat gct ggt cca ggg ata aaa tgt gtt tgg aat aaa aat cac tgt 1920Lys Asn Ala Gly Pro Gly Ile Lys Cys Val Trp Asn Lys Asn His Cys625 630 635 640gaa tct tgg gaa tct ggg aat act aat aat att ctt aga gca aag tgc 1968Glu Ser Trp Glu Ser Gly Asn Thr Asn Asn Ile Leu Arg Ala Lys Cys 645 650 655cct cct aaa aca gct gct tct gat gac aga tgt tac aga tat gca gat 2016Pro Pro Lys Thr Ala Ala Ser Asp Asp Arg Cys Tyr Arg Tyr Ala Asp 660 665 670tgt gcc agc tgt act gcc aat aca aat ggg tgc caa tgg tgt gat gac 2064Cys Ala Ser Cys Thr Ala Asn Thr Asn Gly Cys Gln Trp Cys Asp Asp 675 680 685aag aaa tgc att tcg gca aat agt aac tgc agt atg tct gtc aag aac 2112Lys Lys Cys Ile Ser Ala Asn Ser Asn Cys Ser Met Ser Val Lys Asn 690 695 700tac acc aaa tgt cat gtg aga aat gag cag att tgt aac aaa ctt acc 2160Tyr Thr Lys Cys His Val Arg Asn Glu Gln Ile Cys Asn Lys Leu Thr705 710 715 720agc tgt aaa agc tgt tca cta aac ttg aat tgc cag tgg gat cag aga 2208Ser Cys Lys Ser Cys Ser Leu Asn Leu Asn Cys Gln Trp Asp Gln Arg 725 730 735cag caa gaa tgc cag gct tta cca gct cat ctt tgt gga gaa gga tgg 2256Gln Gln Glu Cys Gln Ala Leu Pro Ala His Leu Cys Gly Glu Gly Trp 740 745 750agt cat att ggg gat gct tgt ctt aga gtc aat tcc agt aga gaa aac 2304Ser His Ile Gly Asp Ala Cys Leu Arg Val Asn Ser Ser Arg Glu Asn 755 760 765tat gac aat gca aaa ctt tat tgc tat aat ctt agt gga aat ctt gct 2352Tyr Asp Asn Ala Lys Leu Tyr Cys Tyr Asn Leu Ser Gly Asn Leu Ala 770 775 780tca tta aca acc tca aaa gaa gta gaa ttt gtt ctg gat gaa ata cag 2400Ser Leu Thr Thr Ser Lys Glu Val Glu Phe Val Leu Asp Glu Ile Gln785 790 795 800aag tat aca caa cag aaa gta tca cct tgg gta ggc ttg cgc aag atc 2448Lys Tyr Thr Gln Gln Lys Val Ser Pro Trp Val Gly Leu Arg Lys Ile 805 810 815aat ata tcc tat tgg gga tgg gaa gac atg tct cct ttt aca aac aca 2496Asn Ile Ser Tyr Trp Gly Trp Glu Asp Met Ser Pro Phe Thr Asn Thr 820 825 830aca cta cag tgg ctt cct ggc gaa ccc aat gat tct ggg ttt tgt gca 2544Thr Leu Gln Trp Leu Pro Gly Glu Pro Asn Asp Ser Gly Phe Cys Ala 835 840 845tat ctg gaa agg gct gca gtg gca ggc tta aaa gct aat cct tgt aca 2592Tyr Leu Glu Arg Ala Ala Val Ala Gly Leu Lys Ala Asn Pro Cys Thr 850 855 860tct atg gca aat ggc ctt gtc tgt gaa aaa cct gtt gtt agt cca aat 2640Ser Met Ala Asn Gly Leu Val Cys Glu Lys Pro Val Val Ser Pro Asn865 870 875 880caa aat gcg agg ccg tgc aaa aag cca tgc tct ctg agg aca tca tgt 2688Gln Asn Ala Arg Pro Cys Lys Lys Pro Cys Ser Leu Arg Thr Ser Cys 885 890 895tcc aac tgt aca agc aat ggc atg gag tgt atg tgg tgc agc agt acg 2736Ser Asn Cys Thr Ser Asn Gly Met Glu Cys Met Trp Cys Ser Ser Thr 900 905 910aaa cga tgt gtt gac tct aat gcc tat atc atc tct ttt cca tat gga 2784Lys Arg Cys Val Asp Ser Asn Ala Tyr Ile Ile Ser Phe Pro Tyr Gly 915 920 925caa tgt cta gag tgg caa act gcc acc tgc tcc cct caa aat tgt tct 2832Gln Cys Leu Glu Trp Gln Thr Ala Thr Cys Ser Pro Gln Asn Cys Ser 930 935 940gga ttg aga acc tgt gga cag tgt ttg gaa cag cct gga tgt ggc tgg 2880Gly Leu Arg Thr Cys Gly Gln Cys Leu Glu Gln Pro Gly Cys Gly Trp945 950 955 960tgc aat gat cct agt aat aca gga aga gga cat tgc att gaa ggt tct 2928Cys Asn Asp Pro Ser Asn Thr Gly Arg Gly His Cys Ile Glu Gly Ser 965 970 975tca cgg gga cca atg aag ctt att gga atg cac cac aat gag atg gtt 2976Ser Arg Gly Pro Met Lys Leu Ile Gly Met His His Asn Glu Met Val 980 985 990ctt gac acc aat ctt tgc ccc aaa gaa aag aac tat gag tgg tcc ttt 3024Leu Asp Thr Asn Leu Cys Pro Lys Glu Lys Asn Tyr Glu Trp Ser Phe 995 1000 1005atc cag tgt cca gct tgc cag tgt aat gga cat agc act tgc atc 3069Ile Gln Cys Pro Ala Cys Gln Cys Asn Gly His Ser Thr Cys Ile 1010 1015 1020aat aat aat gtg tgc gaa cag tgt aaa aat ctc acc aca gga aag 3114Asn Asn Asn Val Cys Glu Gln Cys Lys Asn Leu Thr Thr Gly Lys 1025 1030 1035cag tgt caa gat tgt atg cca ggt tat tat gga gat cca acc aat 3159Gln Cys Gln Asp Cys Met Pro Gly Tyr Tyr Gly Asp Pro Thr Asn 1040 1045 1050ggt gga cag tgc aca gct tgt aca tgc agt ggc cat gca aat atc 3204Gly Gly Gln Cys Thr Ala Cys Thr Cys Ser Gly His Ala Asn Ile 1055 1060 1065tgt cat ctg cac aca gga aaa tgt ttc tgc aca act aaa gga ata 3249Cys His Leu His Thr Gly Lys Cys Phe Cys Thr Thr Lys Gly Ile 1070 1075 1080aaa ggt gac caa tgc caa tta tgt gac tct gaa aat cgc tat gtt 3294Lys Gly Asp Gln Cys Gln Leu Cys Asp Ser Glu Asn Arg Tyr Val 1085 1090 1095ggt aat cca ctt aga gga aca tgt tat tac agc ctt ttg att gat 3339Gly Asn Pro Leu Arg Gly Thr Cys Tyr Tyr Ser Leu Leu Ile Asp 1100 1105 1110tat caa ttt acc ttc agc tta tta cag gaa gat gat cgc cac cat 3384Tyr Gln Phe Thr Phe Ser Leu Leu Gln Glu Asp Asp Arg His His 1115 1120 1125act gcc ata aac ttt ata gca aac cca gaa cag tcg aac aaa aat 3429Thr Ala Ile Asn Phe Ile Ala Asn Pro Glu Gln Ser Asn Lys Asn 1130 1135 1140ctg gat ata tca att aat gca tca aac aac ttt aat ctc aac att 3474Leu Asp Ile Ser Ile Asn Ala Ser Asn Asn Phe Asn Leu Asn Ile 1145 1150 1155acg tgg tct gtc ggt tca aca gct gga aca ata tct ggg gaa gag 3519Thr Trp Ser Val Gly Ser Thr Ala Gly Thr Ile Ser Gly Glu Glu 1160 1165 1170 act tct ata gtt tcc aag aat aat ata aag gaa tac aga gat agt 3564Thr Ser Ile Val Ser Lys Asn Asn Ile Lys Glu Tyr Arg Asp Ser 1175 1180 1185ttt tcc tat gaa aaa ttt aac ttt aga agc aat cct aac att acg 3609Phe Ser Tyr Glu Lys Phe Asn Phe Arg Ser Asn Pro Asn Ile Thr 1190 1195 1200ttc tat gtg tac gtc agc aac ttt tcc tgg cct att aaa ata cag 3654Phe Tyr Val Tyr Val Ser Asn Phe Ser Trp Pro Ile Lys Ile Gln 1205 1210 1215att gca ttc tca caa cac aat aca atc atg gac ctt gtg cag ttt 3699Ile Ala Phe Ser Gln His Asn Thr Ile Met Asp Leu Val Gln Phe 1220 1225 1230ttt gtc acc ttc ttc agt tgt ttc cta tcc tta ttg ctg gtg gct 3744Phe Val Thr Phe Phe Ser Cys Phe Leu Ser Leu Leu Leu Val Ala 1235 1240 1245gct gtg gta tgg aag atc aaa caa act tgt tgg gct tct cga cgg 3789Ala Val Val Trp Lys Ile Lys Gln Thr Cys Trp Ala Ser Arg Arg 1250 1255 1260aga gag caa ctg ctt cga gaa cga cag cag atg gcc agc cgt ccc 3834Arg Glu Gln Leu Leu Arg Glu Arg Gln Gln Met Ala Ser Arg Pro 1265 1270 1275ttt gct tct gtt gat gta gct ctg gaa gtg gga gct gaa caa aca 3879Phe Ala Ser Val Asp Val Ala Leu Glu Val Gly Ala Glu Gln Thr 1280 1285 1290gag ttt ctg cga ggg cca tta gag ggg gca ccc aag cca att gcc 3924Glu Phe Leu Arg Gly Pro Leu Glu Gly Ala Pro Lys Pro Ile Ala 1295 1300 1305att gaa cca tgt gct ggg aac aga gct gct gtt ctg act gtg ttt 3969Ile Glu Pro Cys Ala Gly Asn Arg Ala Ala Val Leu Thr Val Phe 1310 1315 1320ctt tgt cta cca cga gga tca tca ggt gcc cct ccc cct ggg cag 4014Leu Cys Leu Pro Arg Gly Ser Ser Gly Ala Pro Pro Pro Gly Gln 1325 1330 1335tca ggc ctt gca att gcc agt gcc cta ata gat att tca caa cag 4059Ser Gly Leu Ala Ile Ala Ser Ala Leu Ile Asp Ile Ser Gln Gln 1340 1345 1350aaa gct tca gat agt aaa gat aag act tct gga gtc cgg aat cga 4104Lys Ala Ser Asp Ser Lys Asp Lys Thr Ser Gly Val Arg Asn Arg 1355 1360 1365aaa cac ctt tca aca cgt caa gga act tgt gtc tga 4140Lys His Leu Ser Thr Arg Gln Gly Thr Cys Val 1370 137521379PRThomo sapiens 2Met Glu Thr Gly Gly Arg Ala Arg Thr Gly Thr Pro Gln Pro Ala Ala1 5 10 15Pro Gly Val Trp Arg Ala Arg Pro Ala Gly Gly Gly Gly Gly Gly Ala 20 25 30Ser Ser Trp Leu Leu Asp Gly Asn Ser Trp Leu Leu Cys Tyr Gly Phe 35 40 45Leu Tyr Leu Ala Leu Tyr Ala Gln Val Ser Gln Ser Lys Pro Cys Glu 50 55 60Arg Thr Gly Ser Cys Phe Ser Gly Arg Cys Val Asn Ser Thr Cys Leu65 70 75 80Cys Asp Pro Gly Trp Val Gly Asp Gln Cys Gln His Cys Gln Gly Arg 85 90 95Phe Lys Leu Thr Glu Pro Ser Gly Tyr Leu Thr Asp Gly Pro Ile Asn 100 105 110Tyr Lys Tyr Lys Thr Lys Cys Thr Trp Leu Ile Glu Gly Tyr Pro Asn 115 120 125Ala Val Leu Arg Leu Arg Phe Asn His Phe Ala Thr Glu Cys Ser Trp 130 135 140Asp His Met Tyr Val Tyr Asp Gly Asp Ser Ile Tyr Ala Pro Leu Ile145 150 155 160Ala Val Leu Ser Gly Leu Ile Val Pro Glu Ile Arg Gly Asn Glu Thr 165 170 175Val Pro Glu Val Val Thr Thr Ser Gly Tyr Ala Leu Leu His Phe Phe 180 185 190Ser Asp Ala Ala Tyr Asn Leu Thr Gly Phe Asn Ile Phe Tyr Ser Ile 195 200 205Asn Ser Cys Pro Asn Asn Cys Ser Gly His Gly Lys Cys Thr Thr Ser 210 215 220Val Ser Val Pro Ser Gln Val Tyr Cys Glu

Cys Asp Lys Tyr Trp Lys225 230 235 240Gly Glu Ala Cys Asp Ile Pro Tyr Cys Lys Ala Asn Cys Gly Ser Pro 245 250 255Asp His Gly Tyr Cys Asp Leu Thr Gly Glu Lys Leu Cys Val Cys Asn 260 265 270Asp Ser Trp Gln Gly Pro Asp Cys Ser Leu Asn Val Pro Ser Thr Glu 275 280 285Ser Tyr Trp Ile Leu Pro Asn Val Lys Pro Phe Ser Pro Ser Val Gly 290 295 300Arg Ala Ser His Lys Ala Val Leu His Gly Lys Phe Met Trp Val Ile305 310 315 320Gly Gly Tyr Thr Phe Asn Tyr Ser Ser Phe Gln Met Val Leu Asn Tyr 325 330 335Asn Leu Glu Ser Ser Ile Trp Asn Val Gly Thr Pro Ser Arg Gly Pro 340 345 350Leu Gln Arg Tyr Gly His Ser Leu Ala Leu Tyr Gln Glu Asn Ile Phe 355 360 365Met Tyr Gly Gly Arg Ile Glu Thr Asn Asp Gly Asn Val Thr Asp Glu 370 375 380Leu Trp Val Phe Asn Ile His Ser Gln Ser Trp Ser Thr Lys Thr Pro385 390 395 400Thr Val Leu Gly His Gly Gln Gln Tyr Ala Val Glu Gly His Ser Ala 405 410 415His Ile Met Glu Leu Asp Ser Arg Asp Val Val Met Ile Ile Ile Phe 420 425 430Gly Tyr Ser Ala Ile Tyr Gly Tyr Thr Ser Ser Ile Gln Glu Tyr His 435 440 445Ile Ser Ser Asn Thr Trp Leu Val Pro Glu Thr Lys Gly Ala Ile Val 450 455 460Gln Gly Gly Tyr Gly His Thr Ser Val Tyr Asp Glu Ile Thr Lys Ser465 470 475 480Ile Tyr Val His Gly Gly Tyr Lys Ala Leu Pro Gly Asn Lys Tyr Gly 485 490 495Leu Val Asp Asp Leu Tyr Lys Tyr Glu Val Asn Thr Lys Thr Trp Thr 500 505 510Ile Leu Lys Glu Ser Gly Phe Ala Arg Tyr Leu His Ser Ala Val Leu 515 520 525Ile Asn Gly Ala Met Leu Ile Phe Gly Gly Asn Thr His Asn Asp Thr 530 535 540Ser Leu Ser Asn Gly Ala Lys Cys Phe Ser Ala Asp Phe Leu Ala Tyr545 550 555 560Asp Ile Ala Cys Asp Glu Trp Lys Ile Leu Pro Lys Pro Asn Leu His 565 570 575Arg Asp Val Asn Arg Phe Gly His Ser Ala Val Val Ile Asn Gly Ser 580 585 590Met Tyr Ile Phe Gly Gly Phe Ser Ser Val Leu Leu Asn Asp Ile Leu 595 600 605Val Tyr Lys Pro Pro Asn Cys Lys Ala Phe Arg Asp Glu Glu Leu Cys 610 615 620Lys Asn Ala Gly Pro Gly Ile Lys Cys Val Trp Asn Lys Asn His Cys625 630 635 640Glu Ser Trp Glu Ser Gly Asn Thr Asn Asn Ile Leu Arg Ala Lys Cys 645 650 655Pro Pro Lys Thr Ala Ala Ser Asp Asp Arg Cys Tyr Arg Tyr Ala Asp 660 665 670Cys Ala Ser Cys Thr Ala Asn Thr Asn Gly Cys Gln Trp Cys Asp Asp 675 680 685Lys Lys Cys Ile Ser Ala Asn Ser Asn Cys Ser Met Ser Val Lys Asn 690 695 700Tyr Thr Lys Cys His Val Arg Asn Glu Gln Ile Cys Asn Lys Leu Thr705 710 715 720Ser Cys Lys Ser Cys Ser Leu Asn Leu Asn Cys Gln Trp Asp Gln Arg 725 730 735Gln Gln Glu Cys Gln Ala Leu Pro Ala His Leu Cys Gly Glu Gly Trp 740 745 750Ser His Ile Gly Asp Ala Cys Leu Arg Val Asn Ser Ser Arg Glu Asn 755 760 765Tyr Asp Asn Ala Lys Leu Tyr Cys Tyr Asn Leu Ser Gly Asn Leu Ala 770 775 780Ser Leu Thr Thr Ser Lys Glu Val Glu Phe Val Leu Asp Glu Ile Gln785 790 795 800Lys Tyr Thr Gln Gln Lys Val Ser Pro Trp Val Gly Leu Arg Lys Ile 805 810 815Asn Ile Ser Tyr Trp Gly Trp Glu Asp Met Ser Pro Phe Thr Asn Thr 820 825 830Thr Leu Gln Trp Leu Pro Gly Glu Pro Asn Asp Ser Gly Phe Cys Ala 835 840 845Tyr Leu Glu Arg Ala Ala Val Ala Gly Leu Lys Ala Asn Pro Cys Thr 850 855 860Ser Met Ala Asn Gly Leu Val Cys Glu Lys Pro Val Val Ser Pro Asn865 870 875 880Gln Asn Ala Arg Pro Cys Lys Lys Pro Cys Ser Leu Arg Thr Ser Cys 885 890 895Ser Asn Cys Thr Ser Asn Gly Met Glu Cys Met Trp Cys Ser Ser Thr 900 905 910Lys Arg Cys Val Asp Ser Asn Ala Tyr Ile Ile Ser Phe Pro Tyr Gly 915 920 925Gln Cys Leu Glu Trp Gln Thr Ala Thr Cys Ser Pro Gln Asn Cys Ser 930 935 940Gly Leu Arg Thr Cys Gly Gln Cys Leu Glu Gln Pro Gly Cys Gly Trp945 950 955 960Cys Asn Asp Pro Ser Asn Thr Gly Arg Gly His Cys Ile Glu Gly Ser 965 970 975Ser Arg Gly Pro Met Lys Leu Ile Gly Met His His Asn Glu Met Val 980 985 990Leu Asp Thr Asn Leu Cys Pro Lys Glu Lys Asn Tyr Glu Trp Ser Phe 995 1000 1005Ile Gln Cys Pro Ala Cys Gln Cys Asn Gly His Ser Thr Cys Ile 1010 1015 1020Asn Asn Asn Val Cys Glu Gln Cys Lys Asn Leu Thr Thr Gly Lys 1025 1030 1035Gln Cys Gln Asp Cys Met Pro Gly Tyr Tyr Gly Asp Pro Thr Asn 1040 1045 1050Gly Gly Gln Cys Thr Ala Cys Thr Cys Ser Gly His Ala Asn Ile 1055 1060 1065Cys His Leu His Thr Gly Lys Cys Phe Cys Thr Thr Lys Gly Ile 1070 1075 1080Lys Gly Asp Gln Cys Gln Leu Cys Asp Ser Glu Asn Arg Tyr Val 1085 1090 1095Gly Asn Pro Leu Arg Gly Thr Cys Tyr Tyr Ser Leu Leu Ile Asp 1100 1105 1110Tyr Gln Phe Thr Phe Ser Leu Leu Gln Glu Asp Asp Arg His His 1115 1120 1125Thr Ala Ile Asn Phe Ile Ala Asn Pro Glu Gln Ser Asn Lys Asn 1130 1135 1140Leu Asp Ile Ser Ile Asn Ala Ser Asn Asn Phe Asn Leu Asn Ile 1145 1150 1155Thr Trp Ser Val Gly Ser Thr Ala Gly Thr Ile Ser Gly Glu Glu 1160 1165 1170Thr Ser Ile Val Ser Lys Asn Asn Ile Lys Glu Tyr Arg Asp Ser 1175 1180 1185Phe Ser Tyr Glu Lys Phe Asn Phe Arg Ser Asn Pro Asn Ile Thr 1190 1195 1200Phe Tyr Val Tyr Val Ser Asn Phe Ser Trp Pro Ile Lys Ile Gln 1205 1210 1215Ile Ala Phe Ser Gln His Asn Thr Ile Met Asp Leu Val Gln Phe 1220 1225 1230Phe Val Thr Phe Phe Ser Cys Phe Leu Ser Leu Leu Leu Val Ala 1235 1240 1245Ala Val Val Trp Lys Ile Lys Gln Thr Cys Trp Ala Ser Arg Arg 1250 1255 1260Arg Glu Gln Leu Leu Arg Glu Arg Gln Gln Met Ala Ser Arg Pro 1265 1270 1275Phe Ala Ser Val Asp Val Ala Leu Glu Val Gly Ala Glu Gln Thr 1280 1285 1290Glu Phe Leu Arg Gly Pro Leu Glu Gly Ala Pro Lys Pro Ile Ala 1295 1300 1305Ile Glu Pro Cys Ala Gly Asn Arg Ala Ala Val Leu Thr Val Phe 1310 1315 1320Leu Cys Leu Pro Arg Gly Ser Ser Gly Ala Pro Pro Pro Gly Gln 1325 1330 1335Ser Gly Leu Ala Ile Ala Ser Ala Leu Ile Asp Ile Ser Gln Gln 1340 1345 1350Lys Ala Ser Asp Ser Lys Asp Lys Thr Ser Gly Val Arg Asn Arg 1355 1360 1365Lys His Leu Ser Thr Arg Gln Gly Thr Cys Val 1370 137538PRTArtificial SequenceFLAG peptide sequence 3Asp Tyr Lys Asp Asp Asp Asp Lys1 545PRTArtificial SequencePeptide Linker 4Gly Gly Gly Gly Ser1 556PRTArtificial SequencePeptide Linker 5Gly Gly Gly Gly Ser Xaa1 5612PRTArtificial SequencePeptide Linker 6Gly Lys Ser Ser Gly Ser Gly Ser Glu Ser Lys Ser1 5 10714PRTArtificial SequencePeptide Linker 7Gly Ser Thr Ser Gly Ser Gly Lys Ser Ser Glu Gly Lys Gly1 5 10818PRTArtificial SequencePeptide Linker 8Gly Ser Thr Ser Gly Ser Gly Lys Ser Ser Glu Gly Ser Gly Ser Thr1 5 10 15Lys Gly918PRTArtificial SequencePeptide Linker 9Gly Ser Thr Ser Gly Ser Gly Lys Pro Gly Ser Gly Glu Gly Ser Thr1 5 10 15Lys Gly1014PRTArtificial SequencePeptide Linker 10Glu Gly Lys Ser Ser Gly Ser Gly Ser Glu Ser Lys Glu Phe1 5 101127PRTArtificial SequenceLeucine Zipper Peptide 11Pro Asp Val Ala Ser Leu Arg Gln Gln Val Glu Ala Leu Gln Gly Gln1 5 10 15Val Gln His Leu Gln Ala Ala Phe Ser Gln Tyr 20 251233PRTArtificial SequenceLeucine Zipper Peptide 12Arg Met Lys Gly Ile Glu Asp Lys Ile Glu Glu Ile Leu Ser Lys Phe1 5 10 15Tyr His Ile Glu Asn Glu Ile Ala Arg Ile Lys Lys Leu Ile Gly Glu 20 25 30 Arg135PRTArtificial SequencePeptide Localization Sequence 13Lys Lys Lys Arg Lys1 51426PRTArtificial SequencePeptide Localization Sequence 14Met Leu Arg Thr Ser Ser Leu Phe Thr Arg Arg Val Gln Pro Ser Leu1 5 10 15Phe Arg Asn Ile Leu Arg Leu Gln Ser Thr 20 25 154PRTArtificial SequencePeptide Localization Sequence 15Lys Asp Glu Leu1164PRTArtificial SequencePeptide Localization Sequence 16Cys Ala Ala Xaa1174PRTArtificial SequencePeptide Localization Sequence 17Cys Cys Xaa Xaa1184134DNAhomo sapiensCDS(1)..(4134) 18atg gag ccg ggg gtc cgg gcc cgc tcg ggt gcc ccg cag ccg gcc tcc 48Met Glu Pro Gly Val Arg Ala Arg Ser Gly Ala Pro Gln Pro Ala Ser1 5 10 15ccg gtg ctg tgg agg gct cgg ccg gcg ggc ggt ggg ggc gcc tcc tcc 96Pro Val Leu Trp Arg Ala Arg Pro Ala Gly Gly Gly Gly Ala Ser Ser 20 25 30tgg ctg ctg ctg gac ggg aac agc tgg ctg ctg tgc tat ggc ttc ctc 144Trp Leu Leu Leu Asp Gly Asn Ser Trp Leu Leu Cys Tyr Gly Phe Leu 35 40 45tac ctg gcg ctc tat gct cag gtg tcc cag tcc aag ccc tgc gag agg 192Tyr Leu Ala Leu Tyr Ala Gln Val Ser Gln Ser Lys Pro Cys Glu Arg 50 55 60act ggc tcc tgc ttc tcc ggt cgc tgt gtc aac tcc acc tgc ctg tgc 240Thr Gly Ser Cys Phe Ser Gly Arg Cys Val Asn Ser Thr Cys Leu Cys65 70 75 80gac ccg ggc tgg gtt ggg gac cag tgc cag cac tgc cag ggc agg ttc 288Asp Pro Gly Trp Val Gly Asp Gln Cys Gln His Cys Gln Gly Arg Phe 85 90 95aag tta aca gaa cct tct gga tat tta aca gat gga cca att aac tat 336Lys Leu Thr Glu Pro Ser Gly Tyr Leu Thr Asp Gly Pro Ile Asn Tyr 100 105 110aaa tat aaa aca aag tgt aca tgg cta att gaa ggc tat cca aat gca 384Lys Tyr Lys Thr Lys Cys Thr Trp Leu Ile Glu Gly Tyr Pro Asn Ala 115 120 125gtg cta agg tta aga ttc aat cat ttt gct aca gaa tgc agc tgg gat 432Val Leu Arg Leu Arg Phe Asn His Phe Ala Thr Glu Cys Ser Trp Asp 130 135 140cat atg tat gtt tat gat gga gat tct ata tac gca cct tta gta gct 480His Met Tyr Val Tyr Asp Gly Asp Ser Ile Tyr Ala Pro Leu Val Ala145 150 155 160gta ctt agt ggc ttg atc gtt cct gaa gtg agg ggt aac gag acc gtg 528Val Leu Ser Gly Leu Ile Val Pro Glu Val Arg Gly Asn Glu Thr Val 165 170 175cct gag gtg gtc acg acg tct ggc tac gcg ctg ctc cac ttt ttc agc 576Pro Glu Val Val Thr Thr Ser Gly Tyr Ala Leu Leu His Phe Phe Ser 180 185 190gat gct gca tat aac cta act ggc ttc aac att ttt tat tcg atc aat 624Asp Ala Ala Tyr Asn Leu Thr Gly Phe Asn Ile Phe Tyr Ser Ile Asn 195 200 205tcc tgt cct aac aac tgc tct ggt cat gga aag tgt aca acc agt gtc 672Ser Cys Pro Asn Asn Cys Ser Gly His Gly Lys Cys Thr Thr Ser Val 210 215 220tct gtt gca agt caa gtg tat tgt gaa tgc gac aaa tac tgg aaa ggg 720Ser Val Ala Ser Gln Val Tyr Cys Glu Cys Asp Lys Tyr Trp Lys Gly225 230 235 240gaa gca tgt gac att cct tac tgt aaa gcc aat tgt ggg agt cca gat 768Glu Ala Cys Asp Ile Pro Tyr Cys Lys Ala Asn Cys Gly Ser Pro Asp 245 250 255cat ggc tac tgt gac cta aca gga gag aaa ctc tgt gtc tgc aac gat 816His Gly Tyr Cys Asp Leu Thr Gly Glu Lys Leu Cys Val Cys Asn Asp 260 265 270agt tgg caa ggc cca gat tgt tct ctg aat gtc cct tct act gag tct 864Ser Trp Gln Gly Pro Asp Cys Ser Leu Asn Val Pro Ser Thr Glu Ser 275 280 285tac tgg att ttg cca aat gtt aaa ccc ttc agc cct tcc gta ggt cgg 912Tyr Trp Ile Leu Pro Asn Val Lys Pro Phe Ser Pro Ser Val Gly Arg 290 295 300gcc tca cat aaa gca gtt tta cat ggg aaa ttc atg tgg gtg att gga 960Ala Ser His Lys Ala Val Leu His Gly Lys Phe Met Trp Val Ile Gly305 310 315 320gga tat act ttt aac tac agt tct ttt caa atg gtt ctg aat tac aat 1008Gly Tyr Thr Phe Asn Tyr Ser Ser Phe Gln Met Val Leu Asn Tyr Asn 325 330 335tta gaa agc agt ata tgg aat gta ggt gct gta tca agg ggc cct ctt 1056Leu Glu Ser Ser Ile Trp Asn Val Gly Ala Val Ser Arg Gly Pro Leu 340 345 350cag aga tac gga cat tct ctt gcc ctc tat cag gaa aac atc ttt atg 1104Gln Arg Tyr Gly His Ser Leu Ala Leu Tyr Gln Glu Asn Ile Phe Met 355 360 365tac gga ggc aga atg gag acc agt gat ggc aac gtc acc gat gaa tta 1152Tyr Gly Gly Arg Met Glu Thr Ser Asp Gly Asn Val Thr Asp Glu Leu 370 375 380tgg gtg ttt aac gta cgc agt caa tca tgg agc acg aaa acc ccc act 1200Trp Val Phe Asn Val Arg Ser Gln Ser Trp Ser Thr Lys Thr Pro Thr385 390 395 400gtc ctt ggc cac agt cag cag tac gct gtg gag gga cac tcg gca cac 1248Val Leu Gly His Ser Gln Gln Tyr Ala Val Glu Gly His Ser Ala His 405 410 415atc atg gag ctg gac agt aga gac gtg gtc atg att gtc ata ttt gga 1296Ile Met Glu Leu Asp Ser Arg Asp Val Val Met Ile Val Ile Phe Gly 420 425 430tat tct gca ata tat ggc tat acc agc agc ata cag gaa tac cat atc 1344Tyr Ser Ala Ile Tyr Gly Tyr Thr Ser Ser Ile Gln Glu Tyr His Ile 435 440 445tcc tca aac act tgg cta gtt cca gaa acg aaa gga gcc att gtg caa 1392Ser Ser Asn Thr Trp Leu Val Pro Glu Thr Lys Gly Ala Ile Val Gln 450 455 460ggt gga tat ggc cac aca agt gtg tat gac gaa gtg acc aag tcc atc 1440Gly Gly Tyr Gly His Thr Ser Val Tyr Asp Glu Val Thr Lys Ser Ile465 470 475 480tat gtt cac gga ggc tac aaa gca ttg cct ggc aat aag tac ggg ctg 1488Tyr Val His Gly Gly Tyr Lys Ala Leu Pro Gly Asn Lys Tyr Gly Leu 485 490 495gtg gac gac ctc tat aag tac gaa gtc aac acc agg act tgg act att 1536Val Asp Asp Leu Tyr Lys Tyr Glu Val Asn Thr Arg Thr Trp Thr Ile 500 505 510ttg aaa gaa agt ggg ttt gcc aga tac ctt cac tca gct gtt ctt atc 1584Leu Lys Glu Ser Gly Phe Ala Arg Tyr Leu His Ser Ala Val Leu Ile 515 520 525aat gga gct atg ctt att ttt gga gga aat acc cat aat gat act tcc 1632Asn Gly Ala Met Leu Ile Phe Gly Gly Asn Thr His Asn Asp Thr Ser 530 535 540ctg agt aac ggt gca aaa tgt ttt tct gcc gat ttc ctg gca tat gac 1680Leu Ser Asn Gly Ala Lys Cys Phe Ser Ala Asp Phe Leu Ala Tyr Asp545 550 555 560ata gct tgt gac gaa tgg aag aca ttg cct aaa cca aat ctc cat aga 1728Ile Ala Cys Asp Glu Trp Lys Thr Leu Pro Lys Pro Asn Leu His Arg 565 570 575gac gtc aac cga ttt ggg cat tct gca gtc gtc atc aat ggg tca atg 1776Asp Val Asn Arg Phe Gly His Ser Ala Val Val Ile Asn Gly Ser Met 580 585 590tat ata ttt ggt gga ttt tct agt gta ctc ctt aat gat atc ctt gtg 1824Tyr Ile Phe Gly Gly Phe Ser Ser Val Leu Leu Asn Asp Ile Leu Val 595 600 605tat aaa ccc cca aat tgc aaa gct ttc cga gat gaa gaa ctg tgc aga 1872Tyr Lys Pro Pro Asn Cys Lys Ala Phe Arg Asp Glu Glu Leu Cys Arg 610 615 620aac gct ggt cca ggg ata aaa tgt gtt tgg aat aag aat cac tgt gaa 1920Asn Ala Gly Pro Gly Ile Lys Cys Val Trp Asn Lys Asn His Cys Glu625

630 635 640tct tgg gag tct ggg aat aca aat aat att ctc aga gcc aag tgc cct 1968Ser Trp Glu Ser Gly Asn Thr Asn Asn Ile Leu Arg Ala Lys Cys Pro 645 650 655ccc aag aca gct gct acc gat gac aga tgt tac aga tat gct gac tgt 2016Pro Lys Thr Ala Ala Thr Asp Asp Arg Cys Tyr Arg Tyr Ala Asp Cys 660 665 670gcc agc tgc aca gcc aac acg aac ggg tgc cag tgg tgt gac gac aag 2064Ala Ser Cys Thr Ala Asn Thr Asn Gly Cys Gln Trp Cys Asp Asp Lys 675 680 685aaa tgc atc tca gcc agc agc aac tgc agc acg tct gtc aga aac tac 2112Lys Cys Ile Ser Ala Ser Ser Asn Cys Ser Thr Ser Val Arg Asn Tyr 690 695 700act aaa tgt cat ata aga aat gag cag att tgt aac aaa ctt aca agc 2160Thr Lys Cys His Ile Arg Asn Glu Gln Ile Cys Asn Lys Leu Thr Ser705 710 715 720tgt aaa agc tgt tca ctc aac ttg aat tgc cag tgg gat cag cgg cag 2208Cys Lys Ser Cys Ser Leu Asn Leu Asn Cys Gln Trp Asp Gln Arg Gln 725 730 735cag gaa tgt cag gct ttg cca gct cac ctt tgt gga gaa ggc tgg aat 2256Gln Glu Cys Gln Ala Leu Pro Ala His Leu Cys Gly Glu Gly Trp Asn 740 745 750cat gtt ggg gac gct tgt ctt cga atc aat tcc agt cga gaa agc tat 2304His Val Gly Asp Ala Cys Leu Arg Ile Asn Ser Ser Arg Glu Ser Tyr 755 760 765gat aat gcc aaa ctt tat tgc tat aac ctc agt gga aat ctc gcc tcc 2352Asp Asn Ala Lys Leu Tyr Cys Tyr Asn Leu Ser Gly Asn Leu Ala Ser 770 775 780ctg acc acg tcc aag gag gtg gag ttt gtg ttg gat gaa ata cag aag 2400Leu Thr Thr Ser Lys Glu Val Glu Phe Val Leu Asp Glu Ile Gln Lys785 790 795 800ttc aca cag cag aaa gtg tca ccg tgg gta ggc cta cgc aag atc aac 2448Phe Thr Gln Gln Lys Val Ser Pro Trp Val Gly Leu Arg Lys Ile Asn 805 810 815ata tcc tac tgg gga tgg gag gac atg tct cct ttc aca aat aca agc 2496Ile Ser Tyr Trp Gly Trp Glu Asp Met Ser Pro Phe Thr Asn Thr Ser 820 825 830ctg cag tgg ctt cct ggt gag cca aat gac tct gga ttc tgt gcc tac 2544Leu Gln Trp Leu Pro Gly Glu Pro Asn Asp Ser Gly Phe Cys Ala Tyr 835 840 845tta gaa agg gct gca gtg gca ggg tta aaa gca aac cct tgc aca tcc 2592Leu Glu Arg Ala Ala Val Ala Gly Leu Lys Ala Asn Pro Cys Thr Ser 850 855 860atg gca gat gga ctc gtt tgt gaa aag cct gta gta agc cca aat cag 2640Met Ala Asp Gly Leu Val Cys Glu Lys Pro Val Val Ser Pro Asn Gln865 870 875 880aac gcg agg ccg tgc aag aag ccg tgc tcc ctg agg acc tcc tgc gcc 2688Asn Ala Arg Pro Cys Lys Lys Pro Cys Ser Leu Arg Thr Ser Cys Ala 885 890 895aac tgc acg agc agc ggc atg gag tgc atg tgg tgc agc agc acg aag 2736Asn Cys Thr Ser Ser Gly Met Glu Cys Met Trp Cys Ser Ser Thr Lys 900 905 910cgc tgt gtg gac tcc aac gct tac atc atc tcc ttt ccc tac gga cag 2784Arg Cys Val Asp Ser Asn Ala Tyr Ile Ile Ser Phe Pro Tyr Gly Gln 915 920 925tgc ctg gag tgg cag act gcc acc tgc tcg cct caa aat tgt tct ggg 2832Cys Leu Glu Trp Gln Thr Ala Thr Cys Ser Pro Gln Asn Cys Ser Gly 930 935 940tta aga acc tgt gga cag tgc ttg gag cag cca ggg tgt ggc tgg tgc 2880Leu Arg Thr Cys Gly Gln Cys Leu Glu Gln Pro Gly Cys Gly Trp Cys945 950 955 960aac gat cct agt aac aca gga aga ggc tat tgc atc gaa ggg tct tcc 2928Asn Asp Pro Ser Asn Thr Gly Arg Gly Tyr Cys Ile Glu Gly Ser Ser 965 970 975cgg ggc cca atg aaa ctc gtg ggg gtc cac aac agt gac gtg gtt ctt 2976Arg Gly Pro Met Lys Leu Val Gly Val His Asn Ser Asp Val Val Leu 980 985 990gac acc agc ctc tgc ccc aag gag aag aac tac gag tgg tct ttt atc 3024Asp Thr Ser Leu Cys Pro Lys Glu Lys Asn Tyr Glu Trp Ser Phe Ile 995 1000 1005cag tgt cca gct tgc cag tgt aat gga cac agc acg tgc atc aac 3069Gln Cys Pro Ala Cys Gln Cys Asn Gly His Ser Thr Cys Ile Asn 1010 1015 1020aac aac gtc tgt gag cag tgt aag aat ctc acc act ggg cga cag 3114Asn Asn Val Cys Glu Gln Cys Lys Asn Leu Thr Thr Gly Arg Gln 1025 1030 1035tgt cag gaa tgc atg cca ggg tac tat gga gac cca acc aac ggt 3159Cys Gln Glu Cys Met Pro Gly Tyr Tyr Gly Asp Pro Thr Asn Gly 1040 1045 1050ggg cag tgc aca gct tgc acg tgc ggc ggc cat gcg aac gtc tgt 3204Gly Gln Cys Thr Ala Cys Thr Cys Gly Gly His Ala Asn Val Cys 1055 1060 1065cac ctg cac acg gga aag tgt ttt tgc aca acc aag ggg atc aag 3249His Leu His Thr Gly Lys Cys Phe Cys Thr Thr Lys Gly Ile Lys 1070 1075 1080ggt gac cag tgc cag cta tgt gac tct gaa aat cgc tat gtt ggt 3294Gly Asp Gln Cys Gln Leu Cys Asp Ser Glu Asn Arg Tyr Val Gly 1085 1090 1095aat cca ctt agg ggg aca tgc tat tac agt ctt ctg att gac tac 3339Asn Pro Leu Arg Gly Thr Cys Tyr Tyr Ser Leu Leu Ile Asp Tyr 1100 1105 1110cag ttt acc ttc agc ttg ctg cag gaa gat gac cgg cac cac act 3384Gln Phe Thr Phe Ser Leu Leu Gln Glu Asp Asp Arg His His Thr 1115 1120 1125gcc atc aac ttc atc gcc aac cca gag cag tca aac aaa aac ttg 3429Ala Ile Asn Phe Ile Ala Asn Pro Glu Gln Ser Asn Lys Asn Leu 1130 1135 1140gac att tcg att aat gct tcc aac aac ttt aat ctc aac att acg 3474Asp Ile Ser Ile Asn Ala Ser Asn Asn Phe Asn Leu Asn Ile Thr 1145 1150 1155tgg tca gtt ggc tca aca ggt gga acc ata tct ggg gaa gag act 3519Trp Ser Val Gly Ser Thr Gly Gly Thr Ile Ser Gly Glu Glu Thr 1160 1165 1170cct ata gtt tct aag aca aat ata aag gaa tac aga gac agc ttt 3564Pro Ile Val Ser Lys Thr Asn Ile Lys Glu Tyr Arg Asp Ser Phe 1175 1180 1185tcc tat gaa aaa ttt aac ttc aga agc aat cct aat atc aca ttt 3609Ser Tyr Glu Lys Phe Asn Phe Arg Ser Asn Pro Asn Ile Thr Phe 1190 1195 1200tat gtg tat gtc agc aac ttc tcc tgg cct att aaa ata cag att 3654Tyr Val Tyr Val Ser Asn Phe Ser Trp Pro Ile Lys Ile Gln Ile 1205 1210 1215gcg ttt tca caa cac aac acg atc atg gat ctc gtg cag ttc ttt 3699Ala Phe Ser Gln His Asn Thr Ile Met Asp Leu Val Gln Phe Phe 1220 1225 1230gtc acc ttc ttc agt tgt ttt tta tct tta ctg ctg gtg gct gct 3744Val Thr Phe Phe Ser Cys Phe Leu Ser Leu Leu Leu Val Ala Ala 1235 1240 1245gtg gtc tgg aag atc aaa caa act tgc tgg gct tct cgt cgg agg 3789Val Val Trp Lys Ile Lys Gln Thr Cys Trp Ala Ser Arg Arg Arg 1250 1255 1260gag caa ctg ctt cga gaa cga cag cag atg gcc agc cgt ccc ttt 3834Glu Gln Leu Leu Arg Glu Arg Gln Gln Met Ala Ser Arg Pro Phe 1265 1270 1275gct tct gtt gat gta gcc ctg gaa gta gga gct gaa cag aca gac 3879Ala Ser Val Asp Val Ala Leu Glu Val Gly Ala Glu Gln Thr Asp 1280 1285 1290ttt ctg cga ggg cca tta gag ggt gcc cct aag cca ata gcc atc 3924Phe Leu Arg Gly Pro Leu Glu Gly Ala Pro Lys Pro Ile Ala Ile 1295 1300 1305gaa ccc tgc gct ggg aac aga gct gct gtc ctg act gtg ttt ctc 3969Glu Pro Cys Ala Gly Asn Arg Ala Ala Val Leu Thr Val Phe Leu 1310 1315 1320tgt cta ccg aga gga tct tca ggc gcc cca ccc cct ggg cag tca 4014Cys Leu Pro Arg Gly Ser Ser Gly Ala Pro Pro Pro Gly Gln Ser 1325 1330 1335ggc ctt gct atc gcc agt gcc ctg ata gac atc tca cag cag aag 4059Gly Leu Ala Ile Ala Ser Ala Leu Ile Asp Ile Ser Gln Gln Lys 1340 1345 1350cct tct gat aat aaa gac aag act tct gga gtc cgc aat cgg aag 4104Pro Ser Asp Asn Lys Asp Lys Thr Ser Gly Val Arg Asn Arg Lys 1355 1360 1365cac ctc tcc aca cgt caa gga act tgt gtc 4134His Leu Ser Thr Arg Gln Gly Thr Cys Val 1370 1375191378PRThomo sapiens 19Met Glu Pro Gly Val Arg Ala Arg Ser Gly Ala Pro Gln Pro Ala Ser1 5 10 15Pro Val Leu Trp Arg Ala Arg Pro Ala Gly Gly Gly Gly Ala Ser Ser 20 25 30Trp Leu Leu Leu Asp Gly Asn Ser Trp Leu Leu Cys Tyr Gly Phe Leu 35 40 45Tyr Leu Ala Leu Tyr Ala Gln Val Ser Gln Ser Lys Pro Cys Glu Arg 50 55 60Thr Gly Ser Cys Phe Ser Gly Arg Cys Val Asn Ser Thr Cys Leu Cys65 70 75 80Asp Pro Gly Trp Val Gly Asp Gln Cys Gln His Cys Gln Gly Arg Phe 85 90 95Lys Leu Thr Glu Pro Ser Gly Tyr Leu Thr Asp Gly Pro Ile Asn Tyr 100 105 110Lys Tyr Lys Thr Lys Cys Thr Trp Leu Ile Glu Gly Tyr Pro Asn Ala 115 120 125Val Leu Arg Leu Arg Phe Asn His Phe Ala Thr Glu Cys Ser Trp Asp 130 135 140His Met Tyr Val Tyr Asp Gly Asp Ser Ile Tyr Ala Pro Leu Val Ala145 150 155 160Val Leu Ser Gly Leu Ile Val Pro Glu Val Arg Gly Asn Glu Thr Val 165 170 175Pro Glu Val Val Thr Thr Ser Gly Tyr Ala Leu Leu His Phe Phe Ser 180 185 190Asp Ala Ala Tyr Asn Leu Thr Gly Phe Asn Ile Phe Tyr Ser Ile Asn 195 200 205Ser Cys Pro Asn Asn Cys Ser Gly His Gly Lys Cys Thr Thr Ser Val 210 215 220Ser Val Ala Ser Gln Val Tyr Cys Glu Cys Asp Lys Tyr Trp Lys Gly225 230 235 240Glu Ala Cys Asp Ile Pro Tyr Cys Lys Ala Asn Cys Gly Ser Pro Asp 245 250 255His Gly Tyr Cys Asp Leu Thr Gly Glu Lys Leu Cys Val Cys Asn Asp 260 265 270Ser Trp Gln Gly Pro Asp Cys Ser Leu Asn Val Pro Ser Thr Glu Ser 275 280 285Tyr Trp Ile Leu Pro Asn Val Lys Pro Phe Ser Pro Ser Val Gly Arg 290 295 300Ala Ser His Lys Ala Val Leu His Gly Lys Phe Met Trp Val Ile Gly305 310 315 320Gly Tyr Thr Phe Asn Tyr Ser Ser Phe Gln Met Val Leu Asn Tyr Asn 325 330 335Leu Glu Ser Ser Ile Trp Asn Val Gly Ala Val Ser Arg Gly Pro Leu 340 345 350Gln Arg Tyr Gly His Ser Leu Ala Leu Tyr Gln Glu Asn Ile Phe Met 355 360 365Tyr Gly Gly Arg Met Glu Thr Ser Asp Gly Asn Val Thr Asp Glu Leu 370 375 380Trp Val Phe Asn Val Arg Ser Gln Ser Trp Ser Thr Lys Thr Pro Thr385 390 395 400Val Leu Gly His Ser Gln Gln Tyr Ala Val Glu Gly His Ser Ala His 405 410 415Ile Met Glu Leu Asp Ser Arg Asp Val Val Met Ile Val Ile Phe Gly 420 425 430Tyr Ser Ala Ile Tyr Gly Tyr Thr Ser Ser Ile Gln Glu Tyr His Ile 435 440 445Ser Ser Asn Thr Trp Leu Val Pro Glu Thr Lys Gly Ala Ile Val Gln 450 455 460Gly Gly Tyr Gly His Thr Ser Val Tyr Asp Glu Val Thr Lys Ser Ile465 470 475 480Tyr Val His Gly Gly Tyr Lys Ala Leu Pro Gly Asn Lys Tyr Gly Leu 485 490 495Val Asp Asp Leu Tyr Lys Tyr Glu Val Asn Thr Arg Thr Trp Thr Ile 500 505 510Leu Lys Glu Ser Gly Phe Ala Arg Tyr Leu His Ser Ala Val Leu Ile 515 520 525Asn Gly Ala Met Leu Ile Phe Gly Gly Asn Thr His Asn Asp Thr Ser 530 535 540Leu Ser Asn Gly Ala Lys Cys Phe Ser Ala Asp Phe Leu Ala Tyr Asp545 550 555 560Ile Ala Cys Asp Glu Trp Lys Thr Leu Pro Lys Pro Asn Leu His Arg 565 570 575Asp Val Asn Arg Phe Gly His Ser Ala Val Val Ile Asn Gly Ser Met 580 585 590Tyr Ile Phe Gly Gly Phe Ser Ser Val Leu Leu Asn Asp Ile Leu Val 595 600 605Tyr Lys Pro Pro Asn Cys Lys Ala Phe Arg Asp Glu Glu Leu Cys Arg 610 615 620Asn Ala Gly Pro Gly Ile Lys Cys Val Trp Asn Lys Asn His Cys Glu625 630 635 640Ser Trp Glu Ser Gly Asn Thr Asn Asn Ile Leu Arg Ala Lys Cys Pro 645 650 655Pro Lys Thr Ala Ala Thr Asp Asp Arg Cys Tyr Arg Tyr Ala Asp Cys 660 665 670Ala Ser Cys Thr Ala Asn Thr Asn Gly Cys Gln Trp Cys Asp Asp Lys 675 680 685Lys Cys Ile Ser Ala Ser Ser Asn Cys Ser Thr Ser Val Arg Asn Tyr 690 695 700Thr Lys Cys His Ile Arg Asn Glu Gln Ile Cys Asn Lys Leu Thr Ser705 710 715 720Cys Lys Ser Cys Ser Leu Asn Leu Asn Cys Gln Trp Asp Gln Arg Gln 725 730 735Gln Glu Cys Gln Ala Leu Pro Ala His Leu Cys Gly Glu Gly Trp Asn 740 745 750His Val Gly Asp Ala Cys Leu Arg Ile Asn Ser Ser Arg Glu Ser Tyr 755 760 765Asp Asn Ala Lys Leu Tyr Cys Tyr Asn Leu Ser Gly Asn Leu Ala Ser 770 775 780Leu Thr Thr Ser Lys Glu Val Glu Phe Val Leu Asp Glu Ile Gln Lys785 790 795 800Phe Thr Gln Gln Lys Val Ser Pro Trp Val Gly Leu Arg Lys Ile Asn 805 810 815Ile Ser Tyr Trp Gly Trp Glu Asp Met Ser Pro Phe Thr Asn Thr Ser 820 825 830Leu Gln Trp Leu Pro Gly Glu Pro Asn Asp Ser Gly Phe Cys Ala Tyr 835 840 845Leu Glu Arg Ala Ala Val Ala Gly Leu Lys Ala Asn Pro Cys Thr Ser 850 855 860Met Ala Asp Gly Leu Val Cys Glu Lys Pro Val Val Ser Pro Asn Gln865 870 875 880Asn Ala Arg Pro Cys Lys Lys Pro Cys Ser Leu Arg Thr Ser Cys Ala 885 890 895Asn Cys Thr Ser Ser Gly Met Glu Cys Met Trp Cys Ser Ser Thr Lys 900 905 910Arg Cys Val Asp Ser Asn Ala Tyr Ile Ile Ser Phe Pro Tyr Gly Gln 915 920 925Cys Leu Glu Trp Gln Thr Ala Thr Cys Ser Pro Gln Asn Cys Ser Gly 930 935 940Leu Arg Thr Cys Gly Gln Cys Leu Glu Gln Pro Gly Cys Gly Trp Cys945 950 955 960Asn Asp Pro Ser Asn Thr Gly Arg Gly Tyr Cys Ile Glu Gly Ser Ser 965 970 975Arg Gly Pro Met Lys Leu Val Gly Val His Asn Ser Asp Val Val Leu 980 985 990Asp Thr Ser Leu Cys Pro Lys Glu Lys Asn Tyr Glu Trp Ser Phe Ile 995 1000 1005Gln Cys Pro Ala Cys Gln Cys Asn Gly His Ser Thr Cys Ile Asn 1010 1015 1020Asn Asn Val Cys Glu Gln Cys Lys Asn Leu Thr Thr Gly Arg Gln 1025 1030 1035Cys Gln Glu Cys Met Pro Gly Tyr Tyr Gly Asp Pro Thr Asn Gly 1040 1045 1050Gly Gln Cys Thr Ala Cys Thr Cys Gly Gly His Ala Asn Val Cys 1055 1060 1065His Leu His Thr Gly Lys Cys Phe Cys Thr Thr Lys Gly Ile Lys 1070 1075 1080Gly Asp Gln Cys Gln Leu Cys Asp Ser Glu Asn Arg Tyr Val Gly 1085 1090 1095Asn Pro Leu Arg Gly Thr Cys Tyr Tyr Ser Leu Leu Ile Asp Tyr 1100 1105 1110Gln Phe Thr Phe Ser Leu Leu Gln Glu Asp Asp Arg His His Thr 1115 1120 1125Ala Ile Asn Phe Ile Ala Asn Pro Glu Gln Ser Asn Lys Asn Leu 1130 1135 1140Asp Ile Ser Ile Asn Ala Ser Asn Asn Phe Asn Leu Asn Ile Thr 1145 1150 1155Trp Ser Val Gly Ser Thr Gly Gly Thr Ile Ser Gly Glu Glu Thr 1160 1165 1170Pro Ile Val Ser Lys Thr Asn Ile Lys Glu Tyr Arg Asp Ser Phe 1175 1180 1185Ser Tyr Glu Lys Phe Asn Phe Arg Ser Asn Pro Asn Ile Thr Phe 1190 1195 1200Tyr Val Tyr Val Ser Asn Phe Ser Trp Pro Ile Lys Ile Gln Ile 1205 1210 1215Ala Phe Ser Gln His Asn Thr Ile Met Asp Leu Val Gln Phe Phe 1220 1225 1230Val Thr Phe Phe Ser Cys Phe Leu Ser Leu Leu Leu Val Ala Ala 1235 1240 1245Val

Val Trp Lys Ile Lys Gln Thr Cys Trp Ala Ser Arg Arg Arg 1250 1255 1260Glu Gln Leu Leu Arg Glu Arg Gln Gln Met Ala Ser Arg Pro Phe 1265 1270 1275Ala Ser Val Asp Val Ala Leu Glu Val Gly Ala Glu Gln Thr Asp 1280 1285 1290Phe Leu Arg Gly Pro Leu Glu Gly Ala Pro Lys Pro Ile Ala Ile 1295 1300 1305Glu Pro Cys Ala Gly Asn Arg Ala Ala Val Leu Thr Val Phe Leu 1310 1315 1320Cys Leu Pro Arg Gly Ser Ser Gly Ala Pro Pro Pro Gly Gln Ser 1325 1330 1335Gly Leu Ala Ile Ala Ser Ala Leu Ile Asp Ile Ser Gln Gln Lys 1340 1345 1350Pro Ser Asp Asn Lys Asp Lys Thr Ser Gly Val Arg Asn Arg Lys 1355 1360 1365His Leu Ser Thr Arg Gln Gly Thr Cys Val 1370 13752018DNAArtificial SequencePCR Primer; sense strand 20ggggaagatg gagactgg 182134DNAArtificial SequencePCR Primer; Antisense strand 21gtacagctat taaaggtgca tatattgaat ctcc 342233DNAArtificial SequencePCR Primer; sense strand 22ttaacagaac cttctggata tttaacagat ggc 332328DNAArtificial SequencePCR Primer; Antisense strand 23ctgaatgtcc ctccacagca tactgctg 282430DNAArtificial SequencePCR Primer; sense strand 24gttcttggac atggtcagca gtatgctgtg 302530DNAArtificial SequencePCR Primer; Antisense strand 25ttgtattggc agtacagctg gcacaatctg 302632DNAArtificial SequencePCR Primer; sense strand 26gctgcttctg atgacagatg ttacagatat gc 322730DNAArtificial SequencePCR Primer; Antisense strand 27cacatccagg ctgttccaaa cactgtccac 302832DNAArtificial SequencePCR Primer; sense strand 28ccatatggac aatgtctaga gtggcaaact gc 322935DNAArtificial SequencePCR Primer; Antisense strand 29gctgacgtac acatagaacg taatgttagg attgc 353035DNAArtificial SequencePCR Primer; sense strand 30caatatctgg ggaagagact tctatagttt ccaag 353136DNAArtificial SequencePCR Primer; Antisense strand 31ggtttccatt tctcagacac aagttccttg acgtgt 363235DNAArtificial SequencePCR Primer; sense strand 32caatatctgg ggaagagact tctatagttt ccaag 353336DNAArtificial SequencePCR Primer; Antisense strand 33ggtttccatt tctcagacac aagttccttg acgtgt 36

Claims

1. A substantially purified polypeptide comprising a HAM polypeptide, wherein the HAM polypeptide is at least 80% identical to a sequence as set forth in SEQ ID NO:2 or 19.

2. The substantially purified polypeptide of claim 1, wherein the HAM polypeptide is at least 90% identical to a sequence as set forth in SEQ ID NO:2 or 19.

3. The substantially purified polypeptide of claim 1, wherein the HAM polypeptide has a sequence as set forth in SEQ ID NO:2 or 19.

4. The substantially purified polypeptide of claim 1, wherein the sequence comprises from about amino acid 61 to 1379 of SEQ ID NO:2 or from about amino acid 60 to 1378 of SEQ ID NO:19.

5. The substantially purified polypeptide of claim 1, wherein the sequence comprises from about amino acid 61 to 1230 of SEQ ID NO:2 or fragment thereof, or from about amino acid 60 to 1229 of SEQ ID NO:19 or a fragment thereof.

6. A substantially purified polypeptide comprising a HAM polypeptide, wherein the HAM polypeptide is at least 80% identical to a sequence as set forth from about amino acid 61 to 1230 of SEQ ID NO:2 or fragment thereof, or from about amino acid 60 to 1229 of SEQ ID NO:19 or a fragment thereof, and wherein the HAM polypeptide has a HAM biological activity.

7. The substantially purified polypeptide of claim 6, wherein the sequence is at least 90% identical to a sequence as set forth from about amino acid 61 to 1230 of SEQ ID NO:2 or fragment thereof, or from about amino acid 60 to 1229 of SEQ ID NO:19 or a fragment thereof.

8. A substantially pure polypeptide comprising an amino acid sequence as set forth from about amino acid 61 to 1230 of SEQ ID NO:2 or from about amino acid 60 to 1229 of SEQ ID NO:19.

9. A fusion polypeptide comprising a first polypeptide operably linked to a second polypeptide, wherein the first polypeptide is selected from the consisting of: (i) a polypeptide having a sequence as set forth from about amino acid 61 to 1230 of SEQ ID NO:2; (ii) a polypeptide having a sequence as set forth from about amino acid 60 to 1229 of SEQ ID NO:19; (iii) a polypeptide having a sequence as set forth from about amino acid 61 to 1379 of SEQ ID NO:2; and (iv) a polypeptide having a sequence as set forth from about amino acid 60 to 1378 of SEQ ID NO:19.

10. The fusion polypeptide of claim 9, wherein the second polypeptide is an Fc polypeptide.

11. The fusion polypeptide of claim 9, wherein the second polypeptide is a leucine zipper polypeptide.

12. The fusion polypeptide of claim 9, comprising a linker polypeptide separating the first polypeptide and the second polypeptide and operably linked to the first and second polypeptide.

13. An isolated polynucleotide encoding a polypeptide of claim 1.

14. An isolated polynucleotide comprising a sequence selected from the group consisting of: a) SEQ ID NO:1 or 18; b) SEQ ID NO:1 or 18, wherein T can also be U; c) sequences complementary to SEQ ID NO:1 or 18; and d) fragments of a), b), or c) that are at least 50 bases in length and that will hybridize under moderate to highly stringent conditions to a nucleic acid molecule that encodes a polypeptide comprising a sequence as set forth in SEQ ID NO:2 or 19.

15. An isolated polynucleotide comprising a sequence selected from the group consisting of: a) SEQ ID NO:1 from about nucleotide 181 to 4137; b) SEQ ID NO:1 from about nucleotide 181 to 3690; c) SEQ ID NO:18 from about nucleotide 178 to 4134; d) SEQ ID NO:18 from about nucleotide 178 to 3687; e) sequences complementary to a), b), c), and d); and f) any of a), b), c), or d) wherein T can also be U.

16. A vector comprising the polynucleotide of claim 14.

17. The vector of claim 16, wherein the vector is a plasmid.

18. The vector of claim 16, wherein the vector is a viral vector.

19. A host cell containing the vector of claim 16.

20. A recombinant host cell comprising a polynucleotide of claim 14 under the control of a heterologous regulatory sequence.

21. The host cell of claim 20, wherein the cell is prokaryotic.

22. The host cell of claim 20, wherein the cell is eukaryotic.

23. A method of producing a polypeptide comprising culturing a host cell of claim 20 under conditions that promote expression of the polypeptide.

24. A polypeptide produced by culturing a host cell of claim 20 under conditions that promote expression of the polypeptide.

25. A purified antibody that specifically binds to a polypeptide consisting of a sequence as set forth in SEQ ID NO:2 or 19.

26. The antibody of claim 25, wherein the antibody is a monoclonal antibody.

27. The antibody of claim 25, wherein the antibody is a human or humanized antibody.

28. A pharmaceutical composition comprising the antibody of claim 25 or a polypeptide comprising an amino acid sequence selected from the group consisting of: (a) SEQ ID NO:2 from amino acid 61 to 1379; (b) SEQ ID NO:2 from amino acid 61 to 1230; (c) SEQ ID NO:19 from amino acid 60 to 1378; and (d) SEQ ID NO:19 from amino acid 60 to 1229, and a pharmaceutical carrier, excipient or diluent.

29. A method for identifying an agent which modulates the expression of a polynucleotide comprising a sequence as set forth in SEQ ID NO:1 or 18, comprising contacting a sample containing the polynucleotide with a test agent and measuring the expression of the polynucleotide compared to a control, wherein a change in expression compared to the control is indicative of an agent that modulates expression of the polynucleotide.

30. The method of claim 29, wherein the agent is selected from the group consisting of a polypeptide, a peptide, a peptidomimetic, a nucleic acid, and a small molecule.

31. The method of claim 29, wherein the sample is a biological sample from a subject.

32. The method of claim 29, wherein the sample comprises cells.

33. The method of claim 29, wherein the change in expression is an increase in expression.

34. The method of claim 29, wherein the measuring is by PCR or Northern Blot.

35. The method of claim 29, wherein the measuring is by detecting a polypeptide expressed by the polynucleotide.

36. A method for identifying an agent which modulates the activity of a polypeptide comprising a sequence as set forth in SEQ ID NO:2 or 19 comprising contacting a sample containing the polypeptide with a test agent and measuring the activity of the polypeptide compared to a control, wherein a change in activity compared to the control is indicative of an agent that modulates activity of the polypeptide.

37. The method of claim 36, wherein the agent is selected from the group consisting of a polypeptide, a peptide, a peptidomimetic, a nucleic acid, and a small molecule.

38. The method of claim 36, wherein the sample is a biological sample from a subject.

39. The method of claim 36, wherein the sample comprises cells.

40. The method of claim 36, wherein the change in activity is an increase in activity.

41. The method of claim 36, wherein the measuring is by quantitating the amount of polypeptide in the sample.

42. A method of treating a HAM-associated disorder or disease comprising contacting a subject with a HAM polypeptide, a HAM polynucleotide, or an antibody that specifically binds to a HAM polypeptide in an amount effective to treat the HAM-associated disorder or disease.

43. The method of claim 42, wherein the HAM-associated disorder is selected from the group consisting of a rheumatologic disorder, a bone marrow or solid organ transplant disorder, a graft-versus-host disorder, an inflammatory disorder, an autoimmune disorder, a neurologic disorder, a myelination disorder, a cell proliferative disorder, an infection, a cardiovascular disorder, a hematologic disorder, liver disorder, a metabolic disorder, a weight disorder, and a bone disorder.

44. The method of claim 42, wherein the HAM polypeptide has a sequence as set forth in SEQ ID NO:2 or 19 or a bioactive fragment thereof.

45. The method of claim 42, wherein the bioactive fragment has a sequence as set forth in SEQ ID NO:2 from about amino acid 61 to 1230, or as set forth in SEQ ID NO:19 from about amino acid 60 to 1229.

46. The method of claim 42, wherein the HAM polynucleotide has a sequence as set forth in SEQ ID NO:1 or 18.

47. The method of claim 42, wherein the subject is a mammal.