U.S. patent application number 12/869060 was filed with the patent office on 2011-04-21 for antibodies to myostatin.
This patent application is currently assigned to AMGEN FREMONT INC.. Invention is credited to Eva Rose Chin, Larry L. Green, Chikwendu Ibebunjo, Philip Albert Krasney, Junming Yie, Joseph Zachwieja.
Application Number | 20110091455 12/869060 |
Document ID | / |
Family ID | 37215358 |
Filed Date | 2011-04-21 |
United States Patent
Application |
20110091455 |
Kind Code |
A1 |
Chin; Eva Rose ; et
al. |
April 21, 2011 |
ANTIBODIES TO MYOSTATIN
Abstract
The present invention relates to antibodies including human
antibodies and antigen-binding portions thereof that bind to
myostatin, and that function to inhibit myostatin. The invention
also relates to human anti-myostatin antibodies and antigen-binding
portions thereof. The invention also relates to antibodies that are
chimeric, bispecific, derivatized, single chain antibodies or
portions of fusion proteins. The invention also relates to isolated
heavy and light chain immunoglobulins derived from human
anti-myostatin antibodies and nucleic acid molecules encoding such
immunoglobulins. The present invention also relates to methods of
making human anti-myostatin antibodies, compositions comprising
these antibodies and methods of using the antibodies and
compositions for diagnosis and treatment. The invention also
provides gene therapy methods using nucleic acid molecules encoding
the heavy and/or light immunoglobulin molecules that comprise the
human anti-myostatin antibodies. The invention also relates to
transgenic animals or plants comprising nucleic acid molecules of
the present invention.
Inventors: |
Chin; Eva Rose; (Mystic,
CT) ; Green; Larry L.; (San Francisco, CA) ;
Ibebunjo; Chikwendu; (Quincy, MA) ; Krasney; Philip
Albert; (Old Lyme, CT) ; Yie; Junming;
(Thousand Oaks, CA) ; Zachwieja; Joseph;
(Oceanside, CA) |
Assignee: |
AMGEN FREMONT INC.
Fremont
CA
AGOURON PHARMACEUTICALS, INC.
San Diego
CA
|
Family ID: |
37215358 |
Appl. No.: |
12/869060 |
Filed: |
August 26, 2010 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11410886 |
Apr 24, 2006 |
7807159 |
|
|
12869060 |
|
|
|
|
60674933 |
Apr 25, 2005 |
|
|
|
Current U.S.
Class: |
424/133.1 ;
424/139.1; 424/152.1 |
Current CPC
Class: |
A61P 19/00 20180101;
A61K 2039/505 20130101; A61P 25/00 20180101; C07K 2317/33 20130101;
C07K 16/22 20130101; A61P 21/06 20180101; C07K 2317/21 20130101;
C07K 2317/76 20130101; A61P 3/00 20180101; C07K 2317/34 20130101;
A61P 3/04 20180101; A61P 3/02 20180101; A61P 3/08 20180101; A61P
21/00 20180101; A61P 19/08 20180101; C07K 2317/56 20130101 |
Class at
Publication: |
424/133.1 ;
424/152.1; 424/139.1 |
International
Class: |
A61K 39/395 20060101
A61K039/395; A61P 21/06 20060101 A61P021/06 |
Claims
1-23. (canceled)
24. A method for promoting muscle growth in an animal, comprising
the step of administering to said animal a monoclonal antibody or
an antigen-binding portion thereof that specifically binds to
myostatin and inhibits myostatin activity, wherein said antibody or
antigen-binding portion has at least one property selected from the
group consisting of: (a) competes for binding to myostatin with an
antibody selected from: 1.sub.--116.sub.--1 (PTA-6566);
1.sub.--136.sub.--3 (PTA-6568); 1.sub.--257.sub.--1 (PTA-6569);
1.sub.--46.sub.--1 (PTA-6572); 2.sub.--112.sub.--1 (PTA-6574);
1.sub.--314.sub.--1 (PTA-6571); 1.sub.--66.sub.--1 (PTA-6573);
2.sub.--43.sub.--1 (PTA-6575); 2.sub.--177.sub.--1 (PTA-6576);
1.sub.--132.sub.--1 (PTA-6567); or 1.sub.--268.sub.--1 (PTA-6570);
(b) binds to the same epitope of myostatin as an antibody selected
from: 1.sub.--116.sub.--1 (PTA-6566); 1.sub.--136.sub.--3
(PTA-6568); 1.sub.--257.sub.--1 (PTA-6569); 1.sub.--46.sub.--1
(PTA-6572); 2.sub.--112.sub.--1 (PTA-6574); 1.sub.--314.sub.--1
(PTA-6571); 1.sub.--66.sub.--1 (PTA-6573); 2.sub.--43.sub.--1
(PTA-6575); 2.sub.--177.sub.--1 (PTA-6576); 1.sub.--132.sub.--1
(PTA-6567); or 1.sub.--268.sub.--1 (PTA-6570); (c) binds to
myostatin peptide 1 (SEQ ID NO: 103); (d) binds to myostatin
peptide 5 (SEQ ID NO:107); and (e) is cross-reactive with myostatin
peptide 1 (SEQ ID NO: 103) and myostatin peptide 5 (SEQ ID
NO:107).
25. The method of claim 24, wherein said antibody or
antigen-binding portion selectively binds myostatin over Growth and
Differentiation Factor 11 (GDF11) by at least 50-fold.
26. The method of claim 24, wherein said antibody or
antigen-binding portion comprises human CDRs.
27. The method of claim 24, wherein said antibody or
antigen-binding portion is a non-competitive neutralizing
antibody.
28. The method of claim 24, wherein said antibody or
antigen-binding portion is chimeric.
29. The method of claim 24, wherein the animal is a chicken or a
turkey.
30. The method of claim 24, wherein said antibody or
antigen-binding portion comprises (a) the amino acid sequences of
the heavy chain CDR1, CDR2, and CDR3 included in SEQ ID NO: 45 and
the amino acid sequences of the light chain CDR1, CDR2, and CDR3
included in SEQ ID NO: 47; (b) the amino acid sequences of the
heavy chain CDR1, CDR2, and CDR3 included in SEQ ID NO: 49 and the
amino acid sequences of the light chain CDR1, CDR2, and CDR3
included in SEQ ID NO: 51; (c) the amino acid sequences of the
heavy chain CDR1, CDR2, and CDR3 included in SEQ ID NO: 53 and the
amino acid sequences of the light chain CDR1, CDR2, and CDR3
included in SEQ ID NO: 55; (d) the amino acid sequences of the
heavy chain CDR1, CDR2, and CDR3 included in SEQ ID NO: 57 and the
amino acid sequences of the light chain CDR1, CDR2, and CDR3
included in SEQ ID NO: 59; (e) the amino acid sequences of the
heavy chain CDR1, CDR2, and CDR3 included in SEQ ID NO: 61 and the
amino acid sequences of the light chain CDR1, CDR2, and CDR3
included in SEQ ID NO: 63; (f) the amino acid sequences of the
heavy chain CDR1, CDR2, and CDR3 included in SEQ ID NO: 65 and the
amino acid sequences of the light chain CDR1, CDR2, and CDR3
included in SEQ ID NO: 67; (g) the amino acid sequences of the
heavy chain CDR1, CDR2, and CDR3 included in SEQ ID NO: 69 and the
amino acid sequences of the light chain CDR1, CDR2, and CDR3
included in SEQ ID NO: 71; (h) the amino acid sequences of the
heavy chain CDR1, CDR2, and CDR3 included in SEQ ID NO: 73 and the
amino acid sequences of the light chain CDR1, CDR2, and CDR3
included in SEQ ID NO: 75; (i) the amino acid sequences of the
heavy chain CDR1, CDR2, and CDR3 included in SEQ ID NO: 77 and the
amino acid sequences of the light chain CDR1, CDR2, and CDR3
included in SEQ ID NO: 79; (j) the amino acid sequences of the
heavy chain CDR1, CDR2, and CDR3 included in SEQ ID NO: 81 and the
amino acid sequences of the light chain CDR1, CDR2, and CDR3
included in SEQ ID NO: 83; (k) the amino acid sequences of the
heavy chain CDR1, CDR2, and CDR3 included in SEQ ID NO: 85 and the
amino acid sequences of the light chain CDR1, CDR2, and CDR3
included in SEQ ID NO: 87; or (l) the amino acid sequences of the
heavy chain CDR1, CDR2, and CDR3 included in SEQ ID NO: 118 and the
amino acid sequences of the light chain CDR1, CDR2, and CDR3
included in SEQ ID NO: 120, wherein said CDR regions have less than
3 conservative amino acid substitutions.
31. The method of claim 24, wherein: (a) the heavy chain of said
antibody or antigen-binding portion comprises the heavy chain CDR1,
CDR2 and CDR3 amino acid sequences of an antibody selected from:
1.sub.--116.sub.--1 (PTA-6566); 1.sub.--136.sub.--3 (PTA-6568);
1.sub.--257.sub.--1 (PTA-6569); 1.sub.--46.sub.--1 (PTA-6572);
2.sub.--112.sub.--1 (PTA-6574); 1.sub.--314.sub.--1 (PTA-6571);
1.sub.--66.sub.--1 (PTA-6573); 2.sub.--43.sub.--1 (PTA-6575);
2.sub.--177.sub.--1 (PTA-6576); 1.sub.--132.sub.--1 (PTA-6567); or
1.sub.--268.sub.--1 (PTA-6570); (b) the light chain of said
antibody or antigen-binding portion comprises the light chain CDR1,
CDR2 and CDR3 amino acid sequences of an antibody selected from:
1.sub.--116.sub.--1 (PTA-6566); 1.sub.--136.sub.--3 (PTA-6568);
1.sub.--257.sub.--1 (PTA-6569); 1.sub.--46.sub.--1 (PTA-6572);
2.sub.--112.sub.--1 (PTA-6574); 1.sub.--314.sub.--1 (PTA-6571);
1.sub.--66.sub.--1 (PTA-6573); 2.sub.--43.sub.--1 (PTA-6575);
2.sub.--177.sub.--1 (PTA-6576); 1.sub.--132.sub.--1 (PTA-6567); or
1.sub.--268.sub.--1 (PTA-6570); or (c) said antibody or
antigen-binding portion comprises a heavy chain of (a) and a light
chain of (b).
32. The method of claim 24, wherein said antibody or
antigen-binding portion is selected from the group consisting of:
(a) an antibody comprising the amino acid sequences set forth in
SEQ ID NO: 2 and SEQ ID NO: 4. (b) an antibody comprising the amino
acid sequences set forth in SEQ ID NO: 6 and SEQ ID NO: 8; (c) an
antibody comprising the amino acid sequences set forth in SEQ ID
NO: 10 and SEQ ID NO: 12; (d) an antibody comprising the amino acid
sequences set forth in SEQ ID NO: 14 and SEQ ID NO: 16; (e) an
antibody comprising the amino acid sequences set forth in SEQ ID
NO: 18 and SEQ ID NO: 20; (f) an antibody comprising the amino acid
sequences set forth in SEQ ID NO: 22 and SEQ ID NO: 24; (g) an
antibody comprising the amino acid sequences set forth in SEQ ID
NO: 26 and SEQ ID NO: 28; (h) an antibody comprising the amino acid
sequences set forth in SEQ ID NO: 30 and SEQ ID NO: 32; (i) an
antibody comprising the amino acid sequences set forth in SEQ ID
NO: 34 and SEQ ID NO: 36; (j) an antibody comprising the amino acid
sequences set forth in SEQ ID NO: 38 and SEQ ID NO: 40; (k) an
antibody comprising the amino acid sequences set forth in SEQ ID
NO: 42 and SEQ ID NO: 44; and (l) an antibody comprising the amino
acid sequences set forth in SEQ ID NO: 115 and SEQ ID NO: 117.
33. The method of claim 24, wherein said antibody or
antigen-binding portion is selected from the group consisting of:
(a) an antibody or antigen-binding portion comprising the variable
domain amino acid sequences set forth in SEQ ID NO: 2 and SEQ ID
NO: 4. (b) an antibody or antigen-binding portion comprising the
variable domain amino acid sequences set forth in SEQ ID NO: 6 and
SEQ ID NO: 8; (c) an antibody or antigen-binding portion comprising
the variable domain amino acid sequences set forth in SEQ ID NO: 10
and SEQ ID NO: 12; (d) an antibody or antigen-binding portion
comprising the variable domain amino acid sequences set forth in
SEQ ID NO: 14 and SEQ ID NO: 16; (e) an antibody or antigen-binding
portion comprising the variable domain amino acid sequences set
forth in SEQ ID NO: 18 and SEQ ID NO: 20; (f) an antibody or
antigen-binding portion comprising the variable domain amino acid
sequences set forth in SEQ ID NO: 22 and SEQ ID NO: 24; (g) an
antibody or antigen-binding portion comprising the variable domain
amino acid sequences set forth in SEQ ID NO: 26 and SEQ ID NO: 28;
(h) an antibody or antigen-binding portion comprising the variable
domain amino acid sequences set forth in SEQ ID NO: 30 and SEQ ID
NO: 32; (i) an antibody or antigen-binding portion comprising the
variable domain amino acid sequences set forth in SEQ ID NO: 34 and
SEQ ID NO: 36; (j) an antibody or antigen-binding portion
comprising the variable domain amino acid sequences set forth in
SEQ ID NO: 38 and SEQ ID NO: 40; (k) an antibody or antigen-binding
portion comprising the variable domain amino acid sequences set
forth in SEQ ID NO: 42 and SEQ ID NO: 44; and (l) an antibody or
antigen-binding portion comprising the variable domain amino acid
sequences set forth in SEQ ID NO: 115 and SEQ ID NO: 117.
34. The method of claim 24, wherein said antibody or
antigen-binding portion comprises a first CDR sequence set
comprising a first CDR1, first CDR2 and first CDR3 and a second CDR
sequence set comprising a second CDR1, second CDR2 and second CDR3,
wherein said first CDR set and said second CDR set each
sequentially together have at least 90% identity to the CDR1, CDR2
and CDR3 sequences, sequentially together, of: (a) SEQ ID NO: 2 and
SEQ ID NO: 4, respectively; (b) SEQ ID NO: 6 and SEQ ID NO: 8,
respectively; (c) SEQ ID NO:10 and SEQ ID NO:12, respectively; (d)
SEQ ID NO:14 and SEQ ID NO:16, respectively; (e) SEQ ID NO:18 and
SEQ ID NO:20, respectively; (f) SEQ ID NO:22 and SEQ ID NO:24,
respectively; (g) SEQ ID NO:26 and SEQ ID NO:28, respectively; (h)
SEQ ID NO:30 and SEQ ID NO:32, respectively; (i) SEQ ID NO:34 and
SEQ ID NO:36, respectively; (j) SEQ ID NO:38 and SEQ ID NO:40,
respectively; (k) SEQ ID NO:42 and SEQ ID NO:44, respectively; and
(l) SEQ ID NO:115 and SEQ ID NO:117, respectively.
35. The method of claim 24, wherein said antibody or
antigen-binding portion comprises a first CDR sequence set
comprising a first CDR1, first CDR2 and first CDR3 and a second CDR
sequence set comprising a second CDR1, second CDR2 and second CDR3,
wherein said first CDR set and said second CDR set are each the
CDR1, CDR2 and CDR3 sequences, sequentially together, of: (a) SEQ
ID NO: 2 and SEQ ID NO: 4, respectively; (b) SEQ ID NO: 6 and SEQ
ID NO: 8, respectively; (c) SEQ ID NO:10 and SEQ ID NO:12,
respectively; (d) SEQ ID NO:14 and SEQ ID NO:16, respectively; (e)
SEQ ID NO:18 and SEQ ID NO:20, respectively; (f) SEQ ID NO:22 and
SEQ ID NO:24, respectively; (g) SEQ ID NO:26 and SEQ ID NO:28,
respectively; (h) SEQ ID NO:30 and SEQ ID NO:32, respectively; (i)
SEQ ID NO:34 and SEQ ID NO:36, respectively; (j) SEQ ID NO:38 and
SEQ ID NO:40, respectively; (k) SEQ ID NO:42 and SEQ ID NO:44,
respectively; and (l) SEQ ID NO:115 and SEQ ID NO:117,
respectively.
36. The method of claim 24, wherein said antibody is produced by a
cell having ATCC Deposit Designation Number selected from the group
consisting of PTA-6566, PTA-6567, PTA-6568, PTA-6569, PTA-6570,
PTA-6571, PTA-6572, PTA-6573, PTA-6574, PTA-6575, and PTA-6576.
37. The method of claim 24, wherein said monoclonal antibody or
antigen-binding portion binds to myostatin peptide 1 (SEQ ID NO:
103).
38. The method of claim 24, wherein said monoclonal antibody or
antigen-binding portion binds to myostatin peptide 5 (SEQ ID
NO:107).
39. The method of claim 24, wherein said monoclonal antibody or
antigen-binding portion is cross-reactive with myostatin peptide 1
(SEQ ID NO: 103) and myostatin peptide 5 (SEQ ID NO:107).
40. The method of claim 24, wherein said antibody or
antigen-binding portion competes for binding to myostatin with an
antibody selected from: 1.sub.--116.sub.--1 (PTA-6566);
1.sub.--136.sub.--3 (PTA-6568); 1.sub.--257.sub.--1 (PTA-6569);
1.sub.--46.sub.--1 (PTA-6572); 2.sub.--112.sub.--1 (PTA-6574);
1.sub.--314.sub.--1 (PTA-6571); 1.sub.--66.sub.--1 (PTA-6573);
2.sub.--43.sub.--1 (PTA-6575); 2.sub.--177.sub.--1 (PTA-6576);
1.sub.--132.sub.--1 (PTA-6567); or 1.sub.--268.sub.--1
(PTA-6570).
41. The method of claim 24, wherein said antibody or
antigen-binding portion binds to the same epitope of myostatin as
an antibody selected from: 1.sub.--116.sub.--1 (PTA-6566);
1.sub.--136.sub.--3 (PTA-6568); 1.sub.--257.sub.--1 (PTA-6569);
1.sub.--46.sub.--1 (PTA-6572); 2.sub.--112.sub.--1 (PTA-6574);
1.sub.--314.sub.--1 (PTA-6571); 1.sub.--66.sub.--1 (PTA-6573);
2.sub.--43.sub.--1 (PTA-6575); 2.sub.--177.sub.--1_(PTA-6576);
1.sub.--132.sub.--1 (PTA-6567); or 1.sub.--268.sub.--1 (PTA-6570).
Description
REFERENCE TO RELATED APPLICATIONS
[0001] This application is a divisional of U.S. application Ser.
No. 11/410,886 filed Apr. 24, 2006, which claims the benefit of the
filing date of U.S. Provisional application No. 60/674,933, filed
Apr. 25, 2005. The above-referenced applications are herein
incorporated by reference in their entirety.
BACKGROUND OF THE INVENTION
[0002] A growing body of evidence indicates that myostatin (mstn,
Growth and Differentiation Factor-8, or GDF-8) negatively regulates
skeletal muscle growth. For example, a myostatin null mutation in a
child has been associated with dramatic muscle hypertrophy without
any obvious abnormalities (Schuelke et al. (2004) Myostatin
Mutation Associated with Gross Muscle Hypertrophy in a Child. New
Engl. J. Med. 350:2682-8). A negative correlation between muscle
myostatin protein levels and skeletal muscle mass has also been
demonstrated (Schulte, J. N. and Yarasheski, K. E. (2001). Effects
of resistance training on the rate of muscle protein synthesis in
frail elderly people. Int. J. Sport Nutr. Exerc. Metab. 11
Suppl:S111-820; Walker K S et al. (2004) Resistance training alters
plasma myostatin but not IGF-1 in healthy men. Med Sci Sports
Exerc. 36(5):787-93.). For example, there is an increased
expression of muscle myostatin levels with age and increased
myostatin expression has also been shown to contribute to muscle
wasting in HIV-infected patients (Gonzalez-cadavid et al. (1998)
Organization of the human myostatin gene and expression in healthy
men and HIV-infected men with muscle wasting. PNAS 95:14938-4321).
In addition, elevated myostatin levels are found in elderly
populations. (Yarasheski K E et al., (2002) Serum
myostatin-immunoreactive protein is increased in 60-92 year old
women and men with muscle wasting. J. Nutr. Health Aging.
6(5):343-8). Myostatin also influences bone mass as
myostatin-deficient mice have increased bone mineral density
(Hamrick et al., (2003) Bone Architecture and Disc Degeneration in
the Lumbar Spine of Mice Lacking GDF-8 (Myostatin). J. Orthopaedic
Res. 21: 1025-1032 (and references therein).
[0003] Antibodies to circulating myostatin have been shown to cause
increased muscle mass and improved glucose homeostasis in murine
models of type 2 diabetes mellitus. Inhibition of myostatin by ip
injection of a neutralizing antibody increases skeletal muscle
mass, lowers fasting blood glucose and improves glucose sensitivity
in obese diabetic mice (Li X. et al. (2002) Inhibition of myostatin
increases muscle mass and improves glucose sensitivity in obese,
diabetic mice. Poster #224, in Keystone Symposia: Diabetes
Mellitus: Molecular Mechanisms, Genetics and New Therapies). In
addition, A.sup.y/a mice are known to develop insulin resistance
and are used as a model for type 2 diabetes. When A.sup.y/a mice
are made devoid of myostatin by deletion of the myostatin locus,
they have normal fed glucose and insulin levels, and dramatically
lower glucose levels following an exogenous glucose load relative
to normal A.sup.y/amice (McPherron et al. (2002) J. Clin. Invest.
109:595-601).
[0004] Considering the detrimental muscle, bone and metabolic
defects associated with myostatin, there is an urgent need for
antibodies as therapeutics that are specific for myostatin and
which prevent or treat conditions by reducing myostatin activity,
as well as antibodies as diagnostics to identify individuals that
are in need of treatment to reduce myostatin activity.
SUMMARY OF THE INVENTION
[0005] The invention provides anti-myostatin antibodies, nucleic
acids encoding them, vectors and host cells for producing the
antibodies, compositions and kits comprising the antibodies and
methods of making and using the antibodies. Various embodiments of
the invention described in the following numbered paragraphs
include, but are not limited to those. [0006] 1. A human, chimeric
or humanized monoclonal antibody or an antigen-binding portion
thereof that specifically binds to myostatin. [0007] 2. The
monoclonal antibody or antigen-binding portion according to
paragraph 1 wherein the myostatin is human myostatin. [0008] 3. A
monoclonal antibody or antigen-binding portion according to
paragraph 1, wherein said antibody or portion selectively binds
myostatin over GDF11 by at least 50-fold. [0009] 4. A monoclonal
antibody or antigen-binding portion according to paragraph 3,
wherein said antibody or portion inhibits myostatin binding to an
activin type I or type II receptor. [0010] 5. A monoclonal antibody
or antigen-binding portion according to paragraph 1, wherein the
antibody or portion thereof has at least one property selected from
the group consisting of: [0011] (a) competes for binding to
myostatin with an antibody selected from the group consisting of
1.sub.--116.sub.--1; 1.sub.--136.sub.--3; 1.sub.--257.sub.--1;
1.sub.--46.sub.--1; 2.sub.--112.sub.--; 1.sub.--314.sub.--1;
1.sub.--66.sub.--1; 2.sub.--43.sub.--1; 2.sub.--177.sub.--1;
1.sub.--132.sub.--1; 1.sub.--268.sub.--1; 2.sub.--112_K;
1.sub.--116.sub.--1L-Q45K; 1.sub.--257.sub.--1L-L21I;
1.sub.--314.sub.--1H-T92A; 1.sub.--46.sub.--1H-L81M;
2.sub.--112.sub.--1H-I12V; 2.sub.--112.sub.--1L-F58I;
2.sub.--112.sub.--1L-I85V; 2.sub.--112.sub.--1H-L81M, L-F58I;
2.sub.--112.sub.--1H-L81M, L-I85V; and 2.sub.--112.sub.--1H-L81M,
L-F58I, I85V; [0012] (b) binds to the same epitope of myostatin as
an antibody selected from the group consisting of
1.sub.--116.sub.--1; 1.sub.--136.sub.--3; 1.sub.--257.sub.--1;
1.sub.--46.sub.--1; 2.sub.--112.sub.--; 1.sub.--314.sub.--1;
1.sub.--66.sub.--1; 2.sub.--43.sub.--1; 2.sub.--177.sub.--1;
1.sub.--132.sub.--1; 1.sub.--268.sub.--1; 2.sub.--112_K;
1.sub.--116.sub.--1L-Q45K; 1.sub.--257.sub.--1L-L21I;
1.sub.--314.sub.--1H-T92A; 1.sub.--46.sub.--1H-L81M;
2.sub.--112.sub.--1H-I12V; 2.sub.--112.sub.--1L-F58I;
2.sub.--112.sub.--1L-I85V; 2.sub.--112.sub.--1H-L81M, L-F58I;
2.sub.--112.sub.--1H-L81M, L-I85V; and 2.sub.--112.sub.--1H-L81M,
L-F58I, I85V; [0013] (c) binds to myostatin with substantially the
same K.sub.D as an antibody selected from the group consisting of
1.sub.--116.sub.--1; 1.sub.--136.sub.--3; 1.sub.--257.sub.--1;
1.sub.--46.sub.--1; 2.sub.--112.sub.--1; 1.sub.--314.sub.--1;
1.sub.--66.sub.--1; 2.sub.--43.sub.--1; 2.sub.--177.sub.--1;
1.sub.--132.sub.--1; 1.sub.--268.sub.--1; 2.sub.--112_K;
1.sub.--116.sub.--1L-Q45K; 1.sub.--257.sub.--1L-L21I;
1.sub.--314.sub.--1H-T92A; 1.sub.--46.sub.--1H-L81M;
2.sub.--112.sub.--1H-I12V; 2.sub.--112.sub.--1L-F58I;
2.sub.--112.sub.--1L-I85V; 2.sub.--112.sub.--1H-L81M, L-F58I;
2.sub.--112.sub.--1H-L81M, L-I85V; and 2.sub.--112.sub.--1H-L81M,
L-F58I, I85V; and [0014] (d) binds to myostatin with substantially
the same off rate as an antibody selected from the group consisting
of 1.sub.--116.sub.--1; 1.sub.--136.sub.--3; 1.sub.--257.sub.--1;
1.sub.--46.sub.--1; 2.sub.--112.sub.--1; 1.sub.--314.sub.--1;
1.sub.--66.sub.--1; 2.sub.--43.sub.--1; 2.sub.--177.sub.--1;
1.sub.--132.sub.--1; 1.sub.--268.sub.--1; 2.sub.--112_K;
1.sub.--116.sub.--1L-Q45K; 1.sub.--257.sub.--1L-L21I;
1.sub.--314.sub.--1H-T92A; 1.sub.--46.sub.--1H-L81M;
2.sub.--112.sub.--1H-I12V; 2.sub.--112.sub.--1L-F58I;
2.sub.--112.sub.--1L-I85V; 2.sub.--112.sub.--1H-L81M, L-F58I;
2.sub.--112.sub.--1H-L81M, L-I85V; and 2.sub.--112.sub.--1H-L81M,
L-F58I, I85V. [0015] 6. A monoclonal antibody or antigen-binding
portion thereof comprising: [0016] (a) a CDR set, CDR1, CDR2, and
CDR3, that sequentially together are at least 90% identical in
amino acid sequence to heavy chain CDRs, CDR1, CDR2, and CDR3,
sequentially together, that are included in the amino acid sequence
set forth in any one of SEQ ID NOs: 45, 49, 53, 57, 61, 65, 69, 73,
77, 81, 85 and 118; [0017] (b) a CDR set, CDR1, CDR2, and CDR3,
that sequentially together are at least 90% identical in amino acid
sequence to light chain CDRs, CDR1, CDR2, and CDR3, sequentially
together, that are included in the amino acid sequence set forth in
any one of SEQ ID NOs: 47, 51, 55, 59, 63, 67, 71, 75, 83, 87 and
120; or [0018] (c) a first CDR set of (a) and a second CDR set of
(b). [0019] 7. A monoclonal antibody or antigen-binding portion
thereof according to paragraph 1, wherein said antibody comprises
heavy chain CDRs CDR1, CDR2, and CDR3, that sequentially together
are at least 90% identical in amino acid sequence to heavy chain
CDRs, CDR1, CDR2, and CDR3, sequentially together, that are
included in the amino acid sequence set forth in any one of SEQ ID
NOs: 45, 49, 53, 57, 61, 65, 69, 73, 77, 81, 85 and 118. [0020] 8.
A monoclonal antibody or antigen-binding portion thereof according
to paragraph 1, wherein said antibody comprises light chain CDRs
CDR1, CDR2, and CDR3, that sequentially together are at least 90%
identical in amino acid sequence to light chain CDRs, CDR1, CDR2,
and CDR3, sequentially together, that are included in the amino
acid sequence set forth in any one of SEQ ID NOs: 47, 51, 55, 59,
63, 67, 71, 75, 83, 87 and 120. [0021] 9. A monoclonal antibody or
antigen-binding portion according to paragraph 1, wherein said
antibody or antigen-binding portion comprises the heavy chain CDR1,
CDR2 and CDR3 sequences found in any one of SEQ ID NOs: 45, 49, 53,
57, 61, 65, 69, 73, 77, 81, 85 or 118. [0022] 10. A monoclonal
antibody or antigen-binding portion according to paragraph 1,
wherein said antibody or antigen-binding portion comprises the
light chain CDR1, CDR2 and CDR3 sequences found in any one of SEQ
ID NOs: 47, 51, 55, 59, 63, 67, 71, 75, 79, 83, 87 or 120. [0023]
11. A monoclonal antibody or antigen-binding portion according to
paragraph 1, wherein said antibody or portion comprises a heavy
chain that utilizes a human V.sub.H 1-02 gene, a human V.sub.H 3-21
gene or a human V.sub.H 3-23 gene. [0024] 12. A monoclonal antibody
or an antigen-binding portion according to paragraph 1, wherein
said antibody or portion comprises a light chain that utilizes a
human V.sub.K L2 gene, a human V.sub.K A3 gene or a human V.sub.K
A30 gene. [0025] 13. A monoclonal antibody according to paragraph 1
comprising a V.sub.H domain at least 90% identical in amino acid
sequence to the V.sub.H domain in any one of SEQ ID NOs: 2, 6, 10,
14, 18, 22, 26, 30, 34, 38, 42 or 115. [0026] 14. A monoclonal
antibody according to paragraph 1 comprising a V.sub.L domain at
least 90% identical in amino acid sequence to the V.sub.L domain in
any one of SEQ ID NOs:4, 8, 12, 16, 20, 24, 28, 32, 36, 40, 44 or
117. [0027] 15. A monoclonal antibody or an antigen-binding portion
according to paragraph 1 that specifically binds myostatin,
wherein: [0028] (a) the heavy chain comprises the heavy chain CDR1,
CDR2 and CDR3 amino acid sequences of an antibody selected from the
group consisting of: 1.sub.--116.sub.--1; 1.sub.--136.sub.--3;
1.sub.--257.sub.--1; 1.sub.--46.sub.--1; 2.sub.--112.sub.--;
1.sub.--314.sub.--1; 1.sub.--66.sub.--1; 2.sub.--43.sub.--1;
2.sub.--177.sub.--1; 1.sub.--132.sub.--1; 1.sub.--268.sub.--1;
2.sub.--112_K; 1.sub.--116.sub.--1L-Q45K;
1.sub.--257.sub.--1L-L21I; 1.sub.--314.sub.--1H-T92A;
1.sub.--46.sub.--1H-L81M; 2.sub.--112.sub.--1H-I12V;
2.sub.--112.sub.--1L-F58I; 2.sub.--112.sub.--1L-I85V;
2.sub.--112.sub.--1H-L81M, L-F58I; 2.sub.--112.sub.--1H-L81M,
L-I85V; and 2.sub.--112.sub.--1H-L81M, L-F58I, I85V; [0029] (b) the
light chain comprises the light chain CDR1, CDR2 and CDR3 amino
acid sequences of an antibody selected from the group consisting of
1.sub.--116.sub.--1; 1.sub.--136.sub.--3; 1.sub.--257.sub.--1;
1.sub.--46.sub.--1; 2.sub.--112.sub.--; 1.sub.--314.sub.--1;
1.sub.--66.sub.--1; 2.sub.--43.sub.--1; 2.sub.--177.sub.--1;
1.sub.--132.sub.--1; 1.sub.--268.sub.--1; 2.sub.--112_K;
1.sub.--116.sub.--1L-Q45K; 1.sub.--257.sub.--1L-L21I;
1.sub.--314.sub.--1H-T92A; 1.sub.--46.sub.--1H-L81M;
2.sub.--112.sub.--1H-I12V; 2.sub.--112.sub.--1L-F58I;
2.sub.--112.sub.--1L-I85V; 2.sub.--112.sub.--1H-L81M, L-F58I;
2.sub.--112.sub.--1H-L81M, L-I85V; and 2.sub.--112.sub.--1H-L81M,
L-F58I, I85V; or [0030] (c) the antibody comprises a heavy chain of
(a) and a light chain of (b). [0031] 16. A monoclonal antibody
according to paragraph 12 further comprising a V.sub.L domain at
least 90% identical in amino acid sequence to the variable domain
in any one of SEQ ID NOs: 4, 8, 12, 16, 20, 24, 28, 32, 36, 40, 44
or 117. [0032] 17. A monoclonal antibody selected from the group
consisting of: [0033] (a) an antibody comprising the amino acid
sequences set forth in SEQ ID NO: 2 and SEQ ID NO: 4. [0034] (b) an
antibody comprising the amino acid sequences set forth in SEQ ID
NO: 6 and SEQ ID NO: 8; [0035] (c) an antibody comprising the amino
acid sequences set forth in SEQ ID NO: 10 and SEQ ID NO: 12; [0036]
(d) an antibody comprising the amino acid sequences set forth in
SEQ ID NO: 14 and SEQ ID NO: 16; [0037] (e) an antibody comprising
the amino acid sequences set forth in SEQ ID NO: 18 and SEQ ID NO:
20; [0038] (f) an antibody comprising the amino acid sequences set
forth in SEQ ID NO: 22 and SEQ ID NO: 24; [0039] (g) an antibody
comprising the amino acid sequences set forth in SEQ ID NO: 26 and
SEQ ID NO: 28; [0040] (h) an antibody comprising the amino acid
sequences set forth in SEQ ID NO: 30 and SEQ ID NO: 32; [0041] (i)
an antibody comprising the amino acid sequences set forth in SEQ ID
NO: 34 and SEQ ID NO: 36; [0042] (j) an antibody comprising the
amino acid sequences set forth in SEQ ID NO: 38 and SEQ ID NO: 40;
[0043] (k) an antibody comprising the amino acid sequences set
forth in SEQ ID NO: 42 and SEQ ID NO: 44; and [0044] (l) an
antibody comprising the amino acid sequences set forth in SEQ ID
NO: 115 and SEQ ID NO: 117. [0045] 18. A monoclonal antibody or
antigen-binding portion thereof selected from the group consisting
of: [0046] (a) an antibody or antigen-binding portion comprising
the variable domain amino acid sequences set forth in SEQ ID NO: 2
and SEQ ID NO: 4. [0047] (b) an antibody or antigen-binding portion
comprising the variable domain amino acid sequences set forth in
SEQ ID NO: 6 and SEQ ID NO: 8; [0048] (c) an antibody or
antigen-binding portion comprising the variable domain amino acid
sequences set forth in SEQ ID NO: 10 and SEQ ID NO: 12; [0049] (d)
an antibody or antigen-binding portion comprising the variable
domain amino acid sequences set forth in SEQ ID NO: 14 and SEQ ID
NO: 16; [0050] (e) an antibody or antigen-binding portion
comprising the variable domain amino acid sequences set forth in
SEQ ID NO: 18 and SEQ ID NO: 20; [0051] (f) an antibody or
antigen-binding portion comprising the variable domain amino acid
sequences set forth in SEQ ID NO: 22 and SEQ ID NO: 24; [0052] (g)
an antibody or antigen-binding portion comprising the variable
domain amino acid sequences set forth in SEQ ID NO: 26 and SEQ ID
NO: 28; [0053] (h) an antibody or antigen-binding portion
comprising the variable domain amino acid sequences set forth in
SEQ ID NO: 30 and SEQ ID NO: 32; [0054] (i) an antibody or
antigen-binding portion comprising the variable domain amino acid
sequences set forth in SEQ ID NO: 34 and SEQ ID NO: 36; [0055] (j)
an antibody or antigen-binding portion comprising the variable
domain amino acid sequences set forth in SEQ ID NO: 38 and SEQ ID
NO: 40; [0056] (k) an antibody or antigen-binding portion
comprising the variable domain amino acid sequences set forth in
SEQ ID NO: 42 and SEQ ID NO: 44; and [0057] (l) an antibody or
antigen-binding portion comprising the variable domain amino acid
sequences set forth in SEQ ID NO: 115 and SEQ ID NO: 117. [0058]
19. A monoclonal antibody or antigen-binding portion thereof
comprising a first CDR sequence set comprising a first CDR1, first
CDR2 and first CDR3 and a second CDR sequence set comprising a
second CDR1, second CDR2 and second CDR3, wherein said first CDR
set and said second CDR set each sequentially together have at
least 90% identity to the CDR1, CDR2 and CDR3 sequences,
sequentially together, of: [0059] (a) SEQ ID NO: 2 and SEQ ID NO:
4, respectively; [0060] (b) SEQ ID NO: 6 and SEQ ID NO: 8,
respectively; [0061] (c) SEQ ID NO:10 and SEQ ID NO:12,
respectively; [0062] (d) SEQ ID NO:14 and SEQ ID NO:16,
respectively; [0063] (e) SEQ ID NO:18 and SEQ ID NO:20,
respectively; [0064] (f) SEQ ID NO:22 and SEQ ID NO:24,
respectively; [0065] (g) SEQ ID NO:26 and SEQ ID NO:28,
respectively; [0066] (h) SEQ ID NO:30 and SEQ ID NO:32,
respectively; [0067] (i) SEQ ID NO:34 and SEQ ID NO:36,
respectively; [0068] (j) SEQ ID NO:38 and SEQ ID NO:40,
respectively; [0069] (k) SEQ ID NO:42 and SEQ ID NO:44,
respectively; and [0070] (l) SEQ ID NO:115 and SEQ ID NO:117,
respectively. [0071] 20. A monoclonal antibody or antigen-binding
portion thereof comprising a first CDR sequence set comprising a
first CDR1, first CDR2 and first CDR3 and a second CDR sequence set
comprising a second CDR1, second CDR2 and second CDR3, wherein said
first CDR set and said second CDR set are each the CDR1, CDR2 and
CDR3 sequences, sequentially together, of [0072] a) SEQ ID NO: 2
and SEQ ID NO: 4, respectively; [0073] (b) SEQ ID NO: 6 and SEQ ID
NO: 8, respectively; [0074] (c) SEQ ID NO:10 and SEQ ID NO:12,
respectively; [0075] (d) SEQ ID NO:14 and SEQ ID NO:16,
respectively; [0076] (e) SEQ ID NO:18 and SEQ ID NO:20,
respectively; [0077] (f) SEQ ID NO:22 and SEQ ID NO:24,
respectively; [0078] (g) SEQ ID NO:26 and SEQ ID NO:28,
respectively; [0079] (h) SEQ ID NO:30 and SEQ ID NO:32,
respectively; [0080] (i) SEQ ID NO:34 and SEQ ID NO:36,
respectively; [0081] (k) SEQ ID NO:38 and SEQ ID NO:40,
respectively; [0082] (l) SEQ ID NO:42 and SEQ ID NO:44,
respectively; and [0083] (m) SEQ ID NO:115 and SEQ ID NO:117,
respectively. [0084] 21. A monoclonal antibody that specifically
binds myostatin comprising the heavy chain amino acid sequence set
forth in SEQ ID NO:115 and the light chain amino acid sequence set
forth in SEQ ID NO:117. [0085] 22. A monoclonal antibody or an
antigen-binding portion thereof comprising the variable regions
contained in SEQ ID NO:115 and SEQ ID NO:117. [0086] 23. A
monoclonal antibody or an antigen-binding portion thereof, that
specifically binds myostatin comprising CDRs CDR1, CDR2, and CDR3
contained in SEQ ID NO:115 and SEQ ID NO:117. [0087] 24. A
monoclonal antibody or an antigen-binding portion thereof said
monoclonal antibody or antigen-binding portion binds to peptide 1
and peptide 5 portions of myostatin, wherein peptide 1 comprises
the amino acid sequence of SEQ ID NO: 103 and peptide 5 comprises
the amino acid sequence of SEQ ID NO: 107.
[0088] 25. An antibody produced by a cell having ATCC Deposit
Designation Number selected from the group consisting of PTA-6566,
PTA-6567, PTA-6568, PTA-6569, PTA-6570, PTA-6571, PTA-6572,
PTA-6573, PTA-6574, PTA-6575, and PTA-6576. [0089] 26. A
pharmaceutical composition comprising an antibody or an
antigen-binding portion according to any one of paragraphs 1 to 25
and a pharmaceutically acceptable carrier. [0090] 27. A
pharmaceutical composition according to paragraph 26, further
comprising at least one therapeutic agent. [0091] 28. A method
comprising the step of administering to said subject an antibody or
an antigen-binding portion according to any one of paragraphs 1 to
25 or the pharmaceutical composition according to paragraph 26,
wherein said antibody, antigen-binding portion or pharmaceutical
composition inhibits myostatin activity, wherein said subject is in
need of increasing muscle mass, promoting skeletal muscle
development, treating a muscle wasting disorder or enhancing
skeletal muscle growth. [0092] 29. An isolated cell line that
produces an antibody or an antigen-binding portion according to any
one of paragraphs 1 to 25 or the heavy chain or light chain of said
antibody or said antigen-binding portion. [0093] 30. An isolated
nucleic acid molecule comprising a nucleotide sequence that encodes
the heavy chain or an antigen-binding portion thereof or the light
chain or an antigen-binding portion thereof of an antibody
according to any one of paragraphs 1 to 25. [0094] 31. A vector
comprising the nucleic acid molecule according to paragraph 30
wherein the vector optionally comprises an expression control
sequence operably linked to the nucleic acid molecule. [0095] 32. A
host cell comprising the vector according to paragraph 31 or the
nucleic acid molecule according to paragraph 30. [0096] 33. A
method for producing an anti-myostatin antibody or an
antigen-binding portion thereof, comprising culturing the host cell
according to paragraph 32 or the cell line according to paragraph
29 under suitable conditions and recovering said antibody or
antigen-binding portion. [0097] 34. A non-human transgenic organism
carrying the nucleic acid according to paragraph 30 either
chromosomally or extrachromosomally, wherein the non-human
transgenic organism expresses said nucleic acid. [0098] 35. A
method for isolating an antibody or an antigen-binding portion
thereof that specifically binds to myostatin, comprising the step
of isolating the antibody from the non-human transgenic organism
according to paragraph 34. [0099] 36. A method for treating a
subject in need thereof with an antibody or an antigen-binding
portion thereof that specifically binds to myostatin comprising the
steps of: [0100] (a) administering to said subject an effective
amount of an isolated nucleic acid molecule according to paragraph
30; and [0101] (b) expressing said nucleic acid molecule. [0102]
37. A method for producing a human monoclonal antibody that
specifically binds to myostatin, comprising the steps of: [0103]
(a) immunizing a non-human transgenic animal that is capable of
producing human antibodies with myostatin, an immunogenic portion
of myostatin, or a cell or tissue expressing myostatin; [0104] (b)
allowing the non-human transgenic animal to mount an immune
response to myostatin; [0105] (c) isolating B lymphocytes from the
non-human transgenic animal; and [0106] (d) isolating a monoclonal
antibody that specifically binds to myostatin from said isolated B
lymphocytes. [0107] 38. An isolated antibody produced by the method
according to paragraph 37. [0108] 39. A method for inhibiting the
binding of myostatin to cells expressing an activin Type II or IIB
receptor comprising contacting the myostatin with an antibody or
antigen-binding portion according to any one of paragraphs 1 to 25,
wherein said antibody or antigen-binding portion inhibits myostatin
activity. [0109] 40. A method for increasing myoblast proliferation
comprising contacting a composition comprising myoblasts and
myostatin with an antibody or antigen-binding portion according to
any one of paragraphs 1 to 25, wherein said antibody or
antigen-binding portion inhibits myostatin activity. [0110] 41. A
method comprising administering to a subject an antibody or an
antigen-binding portion thereof according to any one of paragraphs
1 to 25, wherein said antibody or antigen-binding portion inhibits
myostatin activity, wherein said subject is in need of improving
glucose homeostasis, decreasing fat mass, increasing insulin
sensitivity, improving kidney function, decreasing fat
accumulation, treating, preventing or inhibiting a disease or
condition characterized by bone loss, said disease or condition
including osteoporosis, osteopenia, osteoarthritis and bone
fractures, treating metabolic syndrome, or counteracting muscle
wasting from sustained administration of a glucocorticoid or a
steroid hormone during the time that said subject is undergoing
treatment with a glucocorticoid or a steroid hormone. [0111] 42. A
method for reducing myostatin activity in a subject in need thereof
comprising the step of administering to said subject a monoclonal
antibody or an antigen-binding portion thereof according to any one
of paragraphs 1 to 25, wherein said monoclonal antibody or
antigen-binding portion inhibits myostatin activity. [0112] 43. A
method for reversing age-related decline in muscle mass in a
subject in need thereof comprising the step of administering to
said subject an antibody or an antigen-binding portion according to
any one of paragraphs 1 to 25, wherein said antibody or
antigen-binding portion inhibits myostatin activity. [0113] 44. A
method for increasing myoblast proliferation and differentiation in
a subject in need thereof comprising the step of administering to
said subject an antibody or antigen-binding portion according to
any one of paragraphs 1 to 25, wherein said antibody or
antigen-binding portion inhibits myostatin activity. [0114] 45. A
method for reducing myostatin-induced activin type IIA or IIB
membrane receptor mediated cell signalling in a subject in need
thereof comprising the step of administering to said subject an
antibody or an antigen-binding portion according to any one of
paragraphs 1 to 25, wherein said antibody or antigen-binding
portion inhibits myostatin activity. [0115] 46. A method for
decreasing myostatin-mediated activation of an activin type I
membrane receptor in a subject in need thereof comprising the step
of administering to said subject an antibody or an antigen-binding
portion according to any one of paragraphs 1 to 25, wherein said
antibody or antigen-binding portion inhibits myostatin activity.
[0116] 47. A method for reducing myostatin-mediated phosphorylation
of one or more R-smad proteins selected from the group consisting
of: Smad 2 and Smad 3 in a subject in need thereof comprising the
step of administering to said subject an antibody or
antigen-binding portion according to any one of paragraphs 1 to 18,
wherein said antibody or antigen-binding portion inhibits myostatin
activity. [0117] 48. A method for increasing expression of a gene
selected from the group consisting of: myoD, myf5 and myogenin, in
a subject in need thereof comprising the step of administering to
said subject an antibody or antigen-binding portion according to
any one of paragraphs 1 to 25, wherein said antibody or
antigen-binding portion inhibits myostatin activity. [0118] 49. A
method for promoting muscle growth, weight gain or aiding in the
prevention of frailty in cattle, swine, sheep, chickens, turkeys,
horses, fish, dogs and cats in need thereof comprising the step of
administering to said subject an antibody or antigen-binding
portion according to any one of paragraphs 1 to 25, wherein said
antibody or antigen-binding portion inhibits myostatin activity.
[0119] 50. A monoclonal antibody or antigen binding portion thereof
selected from the group consisting of: [0120] (a) an antibody or
antigen binding portion thereof comprising the variable domain
amino acid sequences set forth in SEQ ID NO: 45 and SEQ ID NO:47;
[0121] (b) an antibody or antigen binding portion thereof
comprising the variable domain amino acid sequences set forth in
SEQ ID NO:49 and SEQ ID NO:51; [0122] (c) an antibody or antigen
binding portion thereof comprising the variable domain amino acid
sequences set forth in SEQ ID NO: 53 and SEQ ID NO:55; [0123] (d)
an antibody or antigen binding portion thereof comprising the
variable domain amino acid sequences set forth in SEQ ID NO:57 and
SEQ ID NO:59; [0124] (e) an antibody or antigen binding portion
thereof comprising the variable domain amino acid sequences set
forth in SEQ ID NO:61 and SEQ ID NO:63; [0125] (f) an antibody or
antigen binding portion thereof comprising the variable domain
amino acid sequences set forth in SEQ ID NO:65 and SEQ ID NO:67;
[0126] (g) an antibody or antigen binding portion thereof
comprising the variable domain amino acid sequences set forth in
SEQ ID NO:69 and SEQ ID NO:71; [0127] (h) an antibody or antigen
binding portion thereof comprising the variable domain amino acid
sequences set forth in SEQ ID NO:73 and SEQ ID NO:75; [0128] (i) an
antibody or antigen binding portion thereof comprising the variable
domain amino acid sequences set forth in SEQ ID NO:77 and SEQ ID
NO:79; [0129] (j) an antibody or antigen binding portion thereof
comprising the variable domain amino acid sequences set forth in
SEQ ID NO:81 and SEQ ID NO:83; and [0130] (k) an antibody or
antigen binding portion thereof comprising the variable domain
amino acid sequences set forth in SEQ ID NO:85 and SEQ ID NO:87;
and [0131] (l) an antibody or antigen binding portion thereof
comprising the variable domain amino acid sequences set forth in
SEQ ID NO: 118 and SEQ ID NO:120. [0132] 51. A method of treating
metabolic syndrome in a subject in need thereof comprising the step
of administering to said subject an antibody or antigen-binding
portion according to any one of paragraphs 1 to 25, wherein said
antibody or antigen-binding portion inhibits myostatin activity.
[0133] 52. A mammalian host cell line comprising polynucleotides
encoding the heavy and light chains of a human, chimeric or
humanized monoclonal antibody that competes for binding to
myostatin with an antibody or an antigen-binding portion thereof,
wherein the antibody or portion thereof has at least one property
selected from the group consisting of: [0134] (a) competes for
binding to myostatin with an antibody selected from the group
consisting of 1.sub.--116.sub.--1; 1.sub.--136.sub.--3;
1.sub.--257.sub.--1; 1.sub.--46.sub.--1; 2.sub.--112.sub.--;
1.sub.--314.sub.--1; 1.sub.--66.sub.--1; 2.sub.--43.sub.--1;
2.sub.--177.sub.--1; 1.sub.--132.sub.--1; 1.sub.--268.sub.--1;
2.sub.--112_K; 1.sub.--116.sub.--1L-Q45K;
1.sub.--257.sub.--1L-L21I; 1.sub.--314.sub.--1H-T92A;
1.sub.--46.sub.--1H-L81M; 2.sub.--112.sub.--1H-I12V;
2.sub.--112.sub.--1L-F58I; 2.sub.--112.sub.--1L-I85V;
2.sub.--112.sub.--1H-L81M, L-F58I; 2.sub.--112.sub.--1H-L81M,
L-I85V; and 2.sub.--112.sub.--1H-L81M, L-F58I, I85V; [0135] (b)
binds to the same epitope of myostatin as an antibody selected from
the group consisting of 1.sub.--116.sub.--1; 1.sub.--136.sub.--3;
1.sub.--257.sub.--1; 1.sub.--46.sub.--1; 2.sub.--112.sub.--;
1.sub.--314.sub.--1; 1.sub.--66.sub.--1; 2.sub.--43.sub.--1;
2.sub.--177.sub.--1; 1.sub.--132.sub.--1; 1.sub.--268.sub.--1;
2.sub.--112_K; 1.sub.--116.sub.--1L-Q45K;
1.sub.--257.sub.--1L-L21I; 1.sub.--314.sub.--1H-T92A;
1.sub.--46.sub.--1H-L81M; 2.sub.--112.sub.--1H-I12V;
2.sub.--112.sub.--1L-F58I; 2.sub.--112.sub.--1L-I85V;
2.sub.--112.sub.--1H-L81M, L-F58I; 2.sub.--112.sub.--1H-L81M,
L-I85V; and 2.sub.--112.sub.--1H-L81M, L-F58I, I85V; [0136] (c)
binds to myostatin with substantially the same K.sub.D as an
antibody selected from the group consisting of 1.sub.--116.sub.--1;
1.sub.--136.sub.--3; 1.sub.--257.sub.--1; 1.sub.--46.sub.--1;
2.sub.--112.sub.--1; 1.sub.--314.sub.--1; 1.sub.--66.sub.--1;
2.sub.--43.sub.--1; 2.sub.--177.sub.--1; 1.sub.--132.sub.--1;
1.sub.--268.sub.--1; 2.sub.--112_K; 1.sub.--116.sub.--1L-Q45K;
1.sub.--257.sub.--1L-L21I; 1.sub.--314.sub.--1H-T92A;
1.sub.--46.sub.--1H-L81M; 2.sub.--112.sub.--1H-I12V;
2.sub.--112.sub.--1L-F58I; 2.sub.--112.sub.--1L-I85V;
2.sub.--112.sub.--1H-L81M, L-F58I; 2.sub.--112.sub.--1H-L81M,
L-I85V; and 2.sub.--112.sub.--1H-L81M; L-F58I, I85V; and [0137] (d)
binds to myostatin with substantially the same off rate as an
antibody selected from the group consisting of 1.sub.--116.sub.--1;
1.sub.--136.sub.--3; 1.sub.--257.sub.--1; 1.sub.--46.sub.--1;
2.sub.--112.sub.--1; 1.sub.--314.sub.--1; 1.sub.--66.sub.--1;
2.sub.--43.sub.--1; 2.sub.--177.sub.--1; 1.sub.--132.sub.--1;
1.sub.--268.sub.--1; 2.sub.--112_K; 1.sub.--116.sub.--1L-Q45K;
1.sub.--257.sub.--1L-L21I; 1.sub.--314.sub.--1H-T92A;
1.sub.--46.sub.--1H-L81M; 2.sub.--112.sub.--1H-I12V;
2.sub.--112.sub.--1L-F58I; 2.sub.--112.sub.--1L-I85V;
2.sub.--112.sub.--1H-L81M, L-F58I; 2.sub.--112.sub.--1H-L81M,
L-I85V; and 2.sub.--112.sub.--1H-L81M; L-F58I, I85V. [0138] 53. A
mammalian host cell line comprising polynucleotides encoding the
heavy and light chains of a monoclonal antibody or antigen-binding
portion thereof that competes for binding to myostatin with an
antibody comprising: [0139] (a) a heavy chain that utilizes a human
V.sub.H 1-02 gene, a human V.sub.H 3-21 gene or a human V.sub.H
3-23 gene; and [0140] (b) a light chain that utilizes a human
V.sub.K L2 gene, a human V.sub.K A3 gene or a human V.sub.K A30
gene. [0141] 54. A mammalian host cell line comprising
polynucleotides encoding the heavy and light chains of a monoclonal
antibody or an antigen-binding portion of said monoclonal antibody
having the same amino acid sequence as the antibody produced by a
hybridoma cell line having ATCC Deposit Designation Number selected
from the group consisting of PTA-6566, PTA-6567, PTA-6568,
PTA-6569, PTA-6570, PTA-6571, PTA-6572, PTA-6573, PTA-6574,
PTA-6575, and PTA-6576. [0142] 55. A mammalian host cell line
comprising polynucleotides encoding an antibody having the same
amino acid sequence as the antibody produced by a hybridoma cell
having an ATCC Deposit Designation Number selected from the group
consisting of PTA-6566, PTA-6567, PTA-6568, PTA-6569, PTA-6570,
PTA-6571, PTA-6572, PTA-6573, PTA-6574, PTA-6575, and PTA-6576.
[0143] 56. A method comprising expressing said human monoclonal
antibody in said mammalian host cell line of any one of paragraphs
52-55 and recovering said human monoclonal antibody. [0144] 57. A
hybridoma cell line selected from the group consisting of ATCC
Deposit Designation Numbers PTA-6566, PTA-6567, PTA-6568, PTA-6569,
PTA-6570, PTA-6571, PTA-6572, PTA-6573, PTA-6574, PTA-6575, and
PTA-6576 [0145] 58. A. mammalian host cell line comprising
polynucleotides encoding the heavy and light chains of a human,
chimeric or humanized monoclonal antibody, wherein the antibody or
portion thereof has at least one property selected from the group
consisting of:
[0146] (a) competes for binding to myostatin with an antibody
selected from the group consisting of: 1.sub.--116.sub.--1;
1.sub.--136.sub.--3; 1.sub.--257.sub.--1; 1.sub.--46.sub.--1;
2.sub.--112.sub.--; 1.sub.--314.sub.--1; 1.sub.--66.sub.--1;
2.sub.--43.sub.--1; 2.sub.--177.sub.--1; 1.sub.--132.sub.--1;
1.sub.--268.sub.--1; 2.sub.--112_K; 1.sub.--116.sub.--1L-Q45K;
1.sub.--257.sub.--1L-L21I; 1.sub.--314.sub.--1H-T92A;
1.sub.--46.sub.--1H-L81M; 2.sub.--112.sub.--1H-I12V;
2.sub.--112.sub.--1L-F58I; 2.sub.--112.sub.--1L-I85V;
2.sub.--112.sub.--1H-L81M, L-F58I; 2.sub.--112.sub.--1H-L81M,
L-I85V; and 2.sub.--112.sub.--1H-L81M, L-F58I, I85V; [0147] (b)
binds to the same epitope of myostatin as an antibody selected from
the group consisting of: 1.sub.--116.sub.--1; 1.sub.--136.sub.--3;
1.sub.--257.sub.--1; 1.sub.--46.sub.--1; 2.sub.--112.sub.--;
1.sub.--314.sub.--1; 1.sub.--66.sub.--1; 2.sub.--43.sub.--1;
2.sub.--177.sub.--1; 1.sub.--132.sub.--1; 1.sub.--268.sub.--1;
2.sub.--112_K; 1.sub.--116.sub.--1L-Q45K;
1.sub.--257.sub.--1L-L21I; 1.sub.--314.sub.--1H-T92A;
1.sub.--46.sub.--1H-L81M; 2.sub.--112.sub.--1H-I12V;
2.sub.--112.sub.--1L-F58I; 2.sub.--112.sub.--1L-I85V;
2.sub.--112.sub.--1H-L81M, L-F58I; 2.sub.--112.sub.--1H-L81M,
L-I85V; and 2.sub.--112.sub.--1H-L81M, L-F58I, I85V; [0148] (c) is
an antibody having the same amino acid sequence as the antibody
produced by a hybridoma cell having an ATCC Deposit Designation
Number selected from the group consisting of PTA-6566, PTA-6567,
PTA-6568, PTA-6569, PTA-6570, PTA-6571, PTA-6572, PTA-6573,
PTA-6574, PTA-6575, and PTA-6576; and [0149] (d) is a hybridoma
cell line selected from the group consisting of ATCC Deposit
Designation Numbers PTA-6566, PTA-6567, PTA-6568, PTA-6569,
PTA-6570, PTA-6571, PTA-6572, PTA-6573, PTA-6574, PTA-6575, and
PTA-6576.
BRIEF DESCRIPTION OF THE DRAWINGS
[0150] FIG. 1 shows the results of a myostatin responsive reporter
gene assay. As shown, neutralizing anti-myostatin antibodies
inhibit myostatin induced luciferase activity in A204 cells. Human
antibody variants 1.sub.--116.sub.--1L-Q45K; 1.sub.--257-1L-L21I;
1.sub.--314.sub.--1H-T92A and 2.sub.--112.sub.--1H-I12V, L-F 58I,
I85V inhibited luciferase activity to the same extent as wild type
antibodies.
[0151] FIG. 2 shows the results of an L6 Aurora beta-lactamase
assay. As shown, neutralizing anti-myostatin antibodies inhibit
myostatin induced beta-lactamase activity in L6 rat myoblasts.
Human antibody variants 1.sub.--116.sub.--1L-Q45K;
1.sub.--257-1L-L21I; 1.sub.--314.sub.--1H-T92A and
2.sub.--112.sub.--1H-I12V, L-F58I, I85V inhibited beta-lactamase
activity to the same extent as the wild type antibodies.
[0152] FIG. 3 shows the results of a western blot. As shown,
neutralizing anti-myostatin antibodies of the invention inhibit
myostatin induced smad2 phosphorylation in HepG2 cells by western
blot.
[0153] FIG. 4 shows the results of myf5 mRNA expression assays. (A)
Neutralizing anti-myostatin antibodies 1.sub.--268.sub.--1,
2.sub.--177.sub.--1, and 2.sub.--112.sub.--1 rescued myf5 gene
expression inhibited by myostatin in C2C12 mouse myoblasts, whereas
a non-neutralizing antibody 1.sub.--159.sub.--1 could not. Myf5
mRNA level was detected by TAQMAN.RTM. PCR. (B) 1.sub.--116.sub.--1
rescued myf5 gene expression in a dose-dependent manner.
[0154] FIG. 5 shows the results of C2C12 muscle cell
differentiation assays.
(A) Neutralizing anti-myostatin antibodies 2.sub.--43.sub.--1,
1.sub.--314.sub.--1, and 1.sub.--257.sub.--1 rescued
myostatin-blocked muscle differentiation in C2C12 mouse muscle
cells. Embryonic myosin heavy chain (MHC) protein level was used a
marker to measure C2C12 differentiation. (B) Antibodies
2.sub.--112.sub.--1, 1.sub.--46.sub.--1, and 1.sub.--116.sub.--1
rescued myostatin-blocked C2C12 muscle differentiation.
[0155] FIG. 6 (A) illustrates peptides generated from mature GDF8
(SEQ ID NO: 89) to test anti-myostatin antibody binding. Amino
acids in lower case letters are the amino acids that are different
from GDF11 (B) Summary of peptide binding. As shown in the Figure,
some antibodies do not bind to any of the peptides. Some antibodies
bind to non-contiguous peptides. (C) Predicted GDF8 structure with
the illustration of peptide binding of the human anti-myostatin
antibodies. GDF8 structure was generated using SWISS-MODEL; a fully
automated protein structure homology-modeling server, accessible
via the ExPASy web server, or from the program DeepView (Swiss
Pdb-Viewer). The first seven amino acids were missing from the
predicted structure. Mature GDF8 is a homodimer protein. Only one
subunit is shown. The antibodies disclosed herein bind to GDF8 as a
homodimer. As shown in the Figure, human monoclonal antibodies
2.sub.--43.sub.--1, 2.sub.--112.sub.--1, and 2.sub.--177.sub.--1
bind to both peptide 1 and 5. Peptides 1 and 5 are proximal
spatially but not in primary structure.
[0156] FIG. 7 shows the amino acid sequences of peptides 1-11 and
corresponding sequence identifiers (SEQ ID NOs 103-113).
[0157] FIG. 8 depicts epitope binning. Epitope binding of the human
anti-myostatin antibodies of the invention was mapped by
cross-competition experiments using a BIACORE.RTM. 3000 instrument.
Antibodies are depicted as labeled boxes. Antibodies in one circle
compete with antibodies in overlapping circles. For instance,
antibody 1.sub.--46.sub.--1 competes with antibody
1.sub.--136.sub.--3, but antibody 1.sub.--46.sub.--1 does not
compete with antibody 1.sub.--268.sub.--1. When two or more
antibodies are in the same circle their respective binding cannot
be distinguished.
[0158] FIG. 9 shows the results of an immunoprecipitation study to
test the ability of human anti-myostatin antibodies of the
invention to pull down mature GDF8 and mature GDF8/propeptide
latent complex. Conditioned medium containing 293T cells
transfected with GDF8 was used. As shown in the Figure, antibodies
2.sub.--112.sub.--1, 2.sub.--43.sub.--1, and 2.sub.--177.sub.--1
pulled down mature GDF8, mature GDF8/propeptide complex, and
unprocessed GDF8; antibody 1.sub.--66.sub.--1 pulled down mature
GDF8 and mature GDF8/propeptide complex; no other antibodies pulled
down mature GDF8, propeptide, or unprocessed GDF8. Lane 4 is the
1/10 medium loading control, and lane 7 is immunoprecipitation
control with medium only.
[0159] FIG. 10 shows the results of an immunoprecipitation study to
test the ability of anti-myostatin antibodies of the invention to
pull down mature GDF8 from mouse serum. As shown is the Figure,
antibodies 2.sub.--112.sub.--1, 2.sub.--43.sub.--1, and
2.sub.--177.sub.--1 pulled down mature GDF8 from the mouse serum,
whereas antibodies 1.sub.--116.sub.--1, and 1.sub.--66.sub.--1
could not.
[0160] FIG. 11 is a sequence alignment of mature human GDF8 and
GDF11. Mature GDF8 (SEQ ID NO: 89) and GDF11 (SEQ ID NO: 90) share
approximately 90% identical amino acid sequences. Both mature GDF8
and GDF11 form homodimers. Both mature GDF8 or GDF11 have nine
cysteines, which form four internal disulfide bonds and one
intermolecular disulfide bond. As shown in the Figure, cysteines
that form a disulfide bond with each other are labeled with the
same dots or plus. One cysteine (cys73) that forms intermolecular
disulfide bond was labeled with a star. GDF8 structure was
predicted using SWISS-MODEL (see FIG. 6C).
[0161] FIG. 12 is a table summarizing in vitro assay data.
[0162] FIG. 13 is a table summarizing gene usage, epitope binning
and peptide binding.
[0163] FIGS. 14 and 15 show the effects on muscle mass in mice
following in vivo treatment with anti-myostatin antibodies as
compared with vehicle for the gastrocnemius-pantaris-sloeus (GPS),
tibilalis anterior (TA) and quadriceps (Quads) muscles.
[0164] FIG. 16 shows the effects on muscle weight (A) and strength
(B) in SCID mice following in vivo treatment with an anti-myostatin
antibody (2.sub.--112_K).
[0165] FIG. 17 illustrates the effects on muscle weight (A; B; C
and D) in SCID mice following in vivo treatment with varying doses
of an anti-myostatin antibody (2.sub.--112_K).
[0166] FIG. 18 is a dose (A) and concentration (B) response
analysis of varying doses of an anti-myostatin antibody
(2.sub.--112_K) and their effects on muscle weight.
[0167] FIG. 19 is an alignment of the heavy (A) and light chain (B)
variable regions of antibodies 2.sub.--112.sub.--1 (heavy chain:
SEQ ID NO:77; light chain: SEQ ID NO:79) and 2.sub.--112_K (heavy
chain: SEQ ID NO:118; light chain: SEQ ID NO:120).
[0168] FIG. 20 show the effects on muscle mass (A) and adipose mass
(B) in mice following in vivo treatment with cortisone with an
anti-myostatin antibody (2.sub.--112_K) as compared with vehicle
for the gastrocnemius-pantaris-sloeus (GPS), tibilalis anterior
(TA) and quadriceps (Quads) muscles (in 20A) and the inguinal,
epididymal and abdominla fat pad masses (in 20B).
DETAILED DESCRIPTION OF THE INVENTION
Definitions and General Techniques
[0169] Unless otherwise defined herein, scientific and technical
terms used in connection with the present invention shall have the
meanings that are commonly understood by those of ordinary skill in
the art. Further, unless otherwise required by context, singular
terms shall include pluralities and plural terms shall include the
singular. Generally, nomenclature used in connection with, and
techniques of, cell and tissue culture, molecular biology,
immunology, microbiology, genetics and protein and nucleic acid
chemistry and hybridization described herein are those well known
and commonly used in the art.
[0170] The methods and techniques of the present invention are
generally performed according to conventional methods well known in
the art and as described in various general and more specific
references that are cited and discussed throughout the present
specification unless otherwise indicated. See, e.g., Sambrook et
al. Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring
Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989) and
Ausubel et al., Current Protocols in Molecular Biology, Greene
Publishing Associates (1992), and Harlow and Lane Antibodies: A
Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, N.Y. (1990), incorporated herein by reference. Enzymatic
reactions and purification techniques are performed according to
manufacturer's specifications, as commonly accomplished in the art
or as described herein. The nomenclature used in connection with,
and the laboratory procedures and techniques of, analytical
chemistry, synthetic organic chemistry, and medicinal and
pharmaceutical chemistry described herein are those well known and
commonly used in the art. Standard techniques are used for chemical
syntheses, chemical analyses, pharmaceutical preparation,
formulation, and delivery, and treatment of patients.
[0171] The following terms, unless otherwise indicated, shall be
understood to have the following meanings:
[0172] The term "polypeptide" encompasses native or artificial
proteins, protein fragments and polypeptide analogs of a protein
sequence. A polypeptide may be monomeric or polymeric.
[0173] The term "isolated protein", "isolated polypeptide" or
"isolated antibody" is a protein, polypeptide or antibody that by
virtue of its origin or source of derivation (1) is not associated
with naturally associated components that accompany it in its
native state, (2) is free of other proteins from the same species,
(3) is expressed by a cell from a different species, or (4) does
not occur in nature. Thus, a polypeptide that is chemically
synthesized or synthesized in a cellular system different from the
cell from which it naturally originates will be "isolated" from its
naturally associated components. A protein may also be rendered
substantially free of naturally associated components by isolation,
using protein purification techniques well known in the art.
[0174] In various embodiments an isolated anti-myostatin antibody
is one that has been protein A-purified (see, e.g., Example XVI),
one that has been synthesized by a hybridoma or other cell line in
vitro, and/or a human anti-myostatin antibody derived from a
transgenic mouse.
[0175] A protein or polypeptide is "substantially pure,"
"substantially homogeneous," or "substantially purified" when at
least about 60 to 75% of a sample exhibits a single species of
polypeptide. The polypeptide or protein may be monomeric or
multimeric. A substantially pure polypeptide or protein will
typically comprise about 50%, 60%, 70%, 80% or 90% W/W of a protein
sample, more usually about 95%, and preferably will be over 99%
pure. Protein purity or homogeneity may be indicated by a number of
means well known in the art, such as polyacrylamide gel
electrophoresis of a protein sample, followed by visualizing a
single polypeptide band upon staining the gel with a stain well
known in the art. For certain purposes, higher resolution may be
provided by using HPLC or other means well known in the art for
purification.
[0176] The term "non-human transgenic organism" as used herein
refers to any non-human transgenic individual living thing,
including a non-human transgenic animal, plant, bacterium, protist,
or fungus.
[0177] The term "polypeptide fragment" as used herein refers to a
polypeptide that has an amino-terminal and/or carboxy-terminal
deletion, but where the remaining amino acid sequence is identical
to the corresponding positions in the naturally-occurring sequence.
In some embodiments, fragments are at least 5, 6, 8 or 10 amino
acids long. In other embodiments, the fragments are at least 14, at
least 20, at least 50, or at least 70, 80, 90, 100, 150 or 200
amino acids long.
[0178] The term "polypeptide analog" as used herein refers to a
polypeptide that comprises a segment that has substantial identity
to a portion of an amino acid sequence and that has at least one of
the following properties: (1) specific binding to myostatin under
suitable binding conditions, (2) ability to inhibit or activate
myostatin. Typically, polypeptide analogs comprise a conservative
amino acid substitution (or insertion or deletion) with respect to
the native sequence. Analogs typically are at least 20 or 25 amino
acids long, preferably at least 50, 60, 70, 80, 90, 100, 150 or 200
amino acids long or longer, and can often be as long as a
full-length polypeptide. Some embodiments of the invention include
polypeptide fragments or polypeptide analog antibodies with 1, 2,
3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 or 17 substitutions
from the germline amino acid sequence.
[0179] In certain embodiments, amino acid substitutions to an
anti-myostatin antibody or antigen-binding portion thereof are
those which: (1) reduce susceptibility to proteolysis, (2) reduce
susceptibility to oxidation, (3) alter binding affinity for forming
protein complexes, and (4) confer or modify other physicochemical
or functional properties of such analogs, but still retain specific
binding to myostatin. Analogs can include various muteins of a
sequence other than the normally-occurring peptide sequence. For
example, single or multiple amino acid substitutions, preferably
conservative amino acid substitutions, may be made in the
normally-occurring sequence, preferably in the portion of the
polypeptide outside the domain(s) forming intermolecular contacts.
A conservative amino acid substitution should not substantially
change the structural characteristics of the parent sequence; e.g.,
a replacement amino acid should not alter the anti-parallel
.beta.-sheet that makes up the immunoglobulin binding domain that
occurs in the parent sequence, or disrupt other types of secondary
structure that characterizes the parent sequence. In general,
glycine and proline would not be used in an anti-parallel
.beta.-sheet. Examples of art-recognized polypeptide secondary and
tertiary structures are described in Proteins, Structures and
Molecular Principles (Creighton, Ed., W.H. Freeman and Company, New
York (1984)); Introduction to Protein Structure (C. Branden and J.
Tooze, eds., Garland Publishing, New York, N.Y. (1991)); and
Thornton et al., Nature 354:105 (1991), incorporated herein by
reference.
[0180] Non-peptide analogs are commonly used in the pharmaceutical
industry as drugs with properties analogous to those of the
template peptide. These types of non-peptide compound are termed
"peptide mimetics" or "peptidomimetics." Fauchere, J. Adv. Drug
Res. 15:29 (1986); Veber and Freidinger, TINS p. 392 (1985); and
Evans et al., J. Med. Chem. 30:1229 (1987), incorporated herein by
reference. Such compounds are often developed with the aid of
computerized molecular modeling. Peptide mimetics that are
structurally similar to therapeutically useful peptides may be used
to produce an equivalent therapeutic or prophylactic effect.
Generally, peptidomimetics are structurally similar to a paradigm
polypeptide (i.e., a polypeptide that has a desired biochemical
property or pharmacological activity), such as a human antibody,
but have one or more peptide linkages optionally replaced by a
linkage selected from the group consisting of: --CH.sub.2NH--,
--CH.sub.2S--, --CH.sub.2--CH.sub.2--, --CH.dbd.CH-(cis and trans),
--COCH.sub.2--, --CH(OH)CH.sub.2--, and --CH.sub.2SO--, by methods
well known in the art. Systematic substitution of one or more amino
acids of a consensus sequence with a D-amino acid of the same type
(e.g., D-lysine in place of L-lysine) may also be used to generate
more stable peptides. In addition, constrained peptides comprising
a consensus sequence or a substantially identical consensus
sequence variation may be generated by methods known in the art
(Rizo and Gierasch, Ann. Rev. Biochem. 61:387 (1992), incorporated
herein by reference); for example, by adding internal cysteine
residues capable of forming intramolecular disulfide bridges which
cyclize the peptide.
[0181] Where an "antibody" is referred to herein with respect to
the invention, it is normally understood that an antigen-binding
portion thereof may also be used. An antigen-binding portion
competes with the intact antibody for specific binding. See
generally, Fundamental Immunology, Ch. 7 (Paul, W., ed., 2nd ed.
Raven Press, N.Y. (1989)) (incorporated by reference in its
entirety for all purposes). Antigen-binding portions may be
produced by recombinant DNA techniques or by enzymatic or chemical
cleavage of intact antibodies. In some embodiments, antigen-binding
portions include Fab, Fab', F(ab').sub.2, Fd, Fv, dAb, and
complementarity determining region (CDR) fragments, single-chain
antibodies (scFv), chimeric antibodies, diabodies and polypeptides
that contain at least a portion of an antibody that is sufficient
to confer specific antigen binding to the polypeptide.
[0182] From N-terminus to C-terminus, both the mature light and
heavy chain variable domains comprise, sequentially, the regions
FR1, CDR1, FR2, CDR2, FR3, CDR3 and FR4. The assignment of amino
acids to each domain herein is in accordance with the definitions
of Kabat, Sequences of Proteins of Immunological Interest (National
Institutes of Health, Bethesda, Md. (1987 and 1991)), Chothia &
Lesk, J. Mol. Biol. 196:901-917 (1987) or Chothia et al., Nature
342:878-883 (1989).
[0183] As used herein, an antibody that is referred to by number is
the same as a monoclonal antibody that is obtained from the
hybridoma of the same number. For example, monoclonal antibody
2.sub.--112 is the same antibody as one obtained from hybridoma
2.sub.--112, or a subclone thereof, such as 2.sub.--112.sub.--1,
2.sub.--112.sub.--2, and the like. The only exception is
1.sub.--136.sub.--3 which is a different hybridoma from subclones
1.sub.--136.sub.--1 and 1.sub.--136.sub.--2.
[0184] As used herein, a Fd fragment means an antibody fragment
that consists of the V.sub.H and C.sub.H1 domains; an Fv fragment
consists of the V.sub.L and V.sub.H domains of a single arm of an
antibody; and a dAb fragment (Ward et al., Nature 341:544-546
(1989)) consists of a V.sub.H domain.
[0185] In some embodiments, the antibody is a single-chain antibody
(scFv) in which V.sub.L and V.sub.H domains are paired to form a
monovalent molecules via a synthetic linker that enables them to be
made as a single protein chain. (Bird et al., Science 242:423-426
(1988) and Huston et al., Proc. Natl. Acad. Sci. USA 85:5879-5883
(1988).) In some embodiments, the antibodies are diabodies, i.e.,
are bivalent antibodies in which V.sub.H and V.sub.L domains are
expressed on a single polypeptide chain, but using a linker that is
too short to allow for pairing between the two domains on the same
chain, thereby forcing the domains to pair with complementary
domains of another chain and creating two antigen binding sites.
(See e.g., Holliger P. et al., Proc. Natl. Acad. Sci. USA
90:6444-6448 (1993), and Poljak R. J. et al., Structure 2:1121-1123
(1994).) In some embodiments, one or more CDRs from an antibody of
the invention may be incorporated into a molecule either covalently
or noncovalently to make it an immunoadhesin that specifically
binds to myostatin. In such embodiments, the CDR(s) may be
incorporated as part of a larger polypeptide chain, may be
covalently linked to another polypeptide chain, or may be
incorporated noncovalently. Further, the framework regions (FRs)
may be derived from one of the anti-myostatin antibodies from which
one or more of the CDRs are taken or from one or more different
human antibodies.
[0186] In embodiments having one or more binding sites, the binding
sites may be identical to one another or may be different.
[0187] As used herein, the term "human antibody" means any antibody
in which the variable and constant domain sequences are human
sequences. The term encompasses antibodies with sequences derived
from (i.e., that utilize) human genes, but which have been changed,
e.g. to decrease possible immunogenicity, increase affinity,
eliminate cysteines that might cause undesirable folding, etc. The
term encompasses such antibodies produced recombinantly in
non-human cells, which might impart glycosylation not typical of
human cells. These antibodies may be prepared in a variety of ways,
as described below.
[0188] The term "chimeric antibody" as used herein means an
antibody that comprises regions from two or more different
antibodies. In one embodiment, one or more of the CDRs of the
chimeric antibody are derived from a human anti-myostatin antibody.
In another embodiment, all of the CDRs are derived from a human
anti-myostatin antibodies. In another embodiment, the CDRs from
more than one human anti-myostatin antibodies are combined in a
chimeric antibody. For instance, a chimeric antibody may comprise a
CDR1 from the light chain of a first human anti-myostatin antibody,
a CDR2 from the light chain of a second human anti-myostatin
antibody and a CDR3 from the light chain of a third human
anti-myostatin antibody, and CDRs from the heavy chain may be
derived from one or more other anti-myostatin antibodies. Further,
the framework regions may be derived from one of the anti-myostatin
antibodies from which one or more of the CDRs are taken or from one
or more different human antibodies.
[0189] In some embodiments, a chimeric antibody of the invention is
a humanized anti-myostatin antibody. A humanized anti-myostatin
antibody of the invention comprises the amino acid sequence of one
or more framework regions and/or the amino acid sequence from at
least a portion of the constant region of one or more human
anti-myostatin antibodies of the invention and further comprises
sequences derived from a non-human anti-myostatin antibody, for
example CDR sequences.
[0190] Fragments or analogs of antibodies or immunoglobulin
molecules can be readily prepared by those of ordinary skill in the
art following the teachings of this specification. Preferred amino-
and carboxy-termini of fragments or analogs occur near boundaries
of functional domains. Structural and functional domains can be
identified by comparison of the nucleotide and/or amino acid
sequence data to public or proprietary sequence databases.
Preferably, computerized comparison methods are used to identify
sequence motifs or predicted protein conformation domains that
occur in other proteins of known structure and/or function. Methods
to identify protein sequences that fold into a known
three-dimensional structure are known. See Bowie et al., Science
253:164 (1991).
[0191] The term "surface plasmon resonance", as used herein, refers
to an optical phenomenon that allows for the analysis of real-time
biospecific interactions by detection of alterations in protein
concentrations within a biosensor matrix, for example using the
BIACORE.RTM. system (Pharmacia Biosensor AB, Uppsala, Sweden and
Piscataway, N.J.). For further descriptions, see Johnsson U. et
al., Ann. Biol. Clin. 51:19-26 (1993); Jonsson U. et al.,
Biotechniques 11:620-627 (1991); Jonsson B. et al., J. Mol.
Recognit. 8:125-131 (1995); and Johnsson B. et al., Anal. Biochem.
198:268-277 (1991).
[0192] The term "K.sub.D" means the equilibrium dissociation
constant of a particular antibody-antigen interaction.
[0193] The term "off rate" means the dissociation rate constant of
a particular antibody-antigen interaction.
[0194] The term "epitope" includes any protein determinant capable
of specific binding to an immunoglobulin or T-cell receptor or
otherwise interacting with a molecule. Epitopic determinants
generally consist of chemically active surface groupings of
molecules such as amino acids or carbohydrate or sugar side chains
and generally have specific three dimensional structural
characteristics, as well as specific charge characteristics. An
epitope may be "linear" or "conformational." In a linear epitope,
all of the points of interaction between the protein and the
interacting molecule (such as an antibody) occur linearly along the
primary amino acid sequence of the protein. In a conformational
epitope, the points of interaction occur across amino acid residues
on the protein that are separated from one another. An antibody is
said to specifically bind an antigen when the dissociation constant
is .ltoreq.1 mM, preferably .ltoreq.100 nM and most preferably
.ltoreq.10 nM. In certain embodiments, the K.sub.D is 1 pM to 500
pM. In other embodiments, the K.sub.D is between 500 pM to 1 .mu.M.
In other embodiments, the K.sub.D is between 1 .mu.M to 100 nM. In
other embodiments, the K.sub.D is between 100 mM to 10 nM. Once a
desired epitope on an antigen is determined, it is possible to
generate antibodies to that epitope, e.g., using the techniques
described in the present invention. Alternatively, during the
discovery process, the generation and characterization of
antibodies may elucidate information about desirable epitopes. From
this information, it is then possible to competitively screen
antibodies for binding to the same epitope. An approach to achieve
this is to conduct cross-competition studies to find antibodies
that competitively bind with one another, e.g., the antibodies
compete for binding to the antigen. A high throughput process for
"binning" antibodies based upon their cross-competition is
described in International Patent Application No. WO 03/48731.
[0195] As used herein, the twenty conventional amino acids and
their abbreviations follow conventional usage. See Immunology--A
Synthesis (2.sup.nd Edition, E. S. Golub and D. R. Gren, Eds.,
Sinauer Associates, Sunderland, Mass. (1991)), incorporated herein
by reference.
[0196] The term "polynucleotide" as referred to herein means a
polymeric form of nucleotides of at least 10 bases in length,
either ribonucleotides or deoxynucleotides or a modified form of
either type of nucleotide. The term includes single and double
stranded forms.
[0197] The term "isolated polynucleotide" as used herein means a
polynucleotide of genomic, cDNA, or synthetic origin or some
combination thereof, which by virtue of its origin the "isolated
polynucleotide" (1) is not associated with all or a portion of a
polynucleotides with which the "isolated polynucleotide" is found
in nature, (2) is operably linked to a polynucleotide to which it
is not linked in nature, or (3) does not occur in nature as part of
a larger sequence.
[0198] The term "naturally occurring nucleotides" as used herein
includes deoxyribonucleotides and ribonucleotides. The term
"modified nucleotides" as used herein includes nucleotides with
modified or substituted sugar groups and the like. The term
"oligonucleotide linkages" referred to herein includes
oligonucleotides linkages such as phosphorothioate,
phosphorodithioate, phosphoroselenoate, phosphorodiselenoate,
phosphoroanilothioate, phoshoraniladate, phosphoroamidate, and the
like. See e.g., LaPlanche et al., Nucl. Acids Res. 14:9081 (1986);
Stec et al., J. Am. Chem. Soc. 106:6077 (1984); Stein et al., Nucl.
Acids Res. 16:3209 (1988); Zon et al., Anti-Cancer Drug Design
6:539 (1991); Zon et al. Oligonucleotides and Analogues; A
Practical Approach, pp. 87-108 (F. Eckstein, Ed., Oxford University
Press, Oxford England (1991)); U.S. Pat. No. 5,151,510; Uhlmann and
Peyman, Chemical Reviews 90:543 (1990), the disclosures of which
are hereby incorporated by reference. An oligonucleotide can
include a label for detection, if desired.
[0199] "Operably linked" sequences include both expression control
sequences that are contiguous with the gene of interest and
expression control sequences that act in trans or at a distance to
control the gene of interest. The term "expression control
sequence" as used herein means polynucleotide sequences that are
necessary to effect the expression and processing of coding
sequences to which they are ligated. Expression control sequences
include appropriate transcription initiation, termination, promoter
and enhancer sequences; efficient RNA processing signals such as
splicing and polyadenylation signals; sequences that stabilize
cytoplasmic mRNA; sequences that enhance translation efficiency
(i.e., Kozak consensus sequence); sequences that enhance protein
stability; and when desired, sequences that enhance protein
secretion. The nature of such control sequences differs depending
upon the host organism; in prokaryotes, such control sequences
generally include promoter, ribosomal binding site, and
transcription termination sequence; in eukaryotes, generally, such
control sequences include promoters and transcription termination
sequence. The term "control sequences" is intended to include, at a
minimum, all components whose presence is essential for expression
and processing, and can also include additional components whose
presence is advantageous, for example, leader sequences and fusion
partner sequences.
[0200] The term "vector", as used herein, means a nucleic acid
molecule capable of transporting another nucleic acid to which it
has been linked. In some embodiments, the vector is a plasmid,
i.e., a circular double stranded piece of DNA into which additional
DNA segments may be ligated. In some embodiments, the vector is a
viral vector, wherein additional DNA segments may be ligated into
the viral genome. In some embodiments, the vectors are capable of
autonomous replication in a host cell into which they are
introduced (e.g., bacterial vectors having a bacterial origin of
replication and episomal mammalian vectors). In other embodiments,
the vectors (e.g., non-episomal mammalian vectors) can be
integrated into the genome of a host cell upon introduction into
the host cell, and thereby are replicated along with the host
genome. Moreover, certain vectors are capable of directing the
expression of genes to which they are operatively linked. Such
vectors are referred to herein as "recombinant expression vectors"
(or simply, "expression vectors").
[0201] The term "recombinant host cell" (or simply "host cell"), as
used herein, means a cell into which a recombinant expression
vector has been introduced. It should be understood that
"recombinant host cell" and "host cell" mean not only the
particular subject cell but also the progeny of such a cell.
Because certain modifications may occur in succeeding generations
due to either mutation or environmental influences, such progeny
may not, in fact, be identical to the parent cell, but are still
included within the scope of the term "host cell" as used
herein.
[0202] The term "selectively hybridize" referred to herein means to
detectably and specifically bind. Polynucleotides, oligonucleotides
and fragments thereof in accordance with the invention selectively
hybridize to nucleic acid strands under hybridization and wash
conditions that minimize appreciable amounts of detectable binding
to nonspecific nucleic acids. "High stringency" or "highly
stringent" conditions can be used to achieve selective
hybridization conditions as known in the art and discussed herein.
One example of "high stringency" or "highly stringent" conditions
is the incubation of a polynucleotide with another polynucleotide,
wherein one polynucleotide may be affixed to a solid surface such
as a membrane, in a hybridization buffer of 6.times.SSPE or SSC,
50% formamide, 5.times.Denhardt's reagent, 0.5% SDS, 100 .mu.g/ml
denatured, fragmented salmon sperm DNA at a hybridization
temperature of 42.degree. C. for 12-16 hours, followed by twice
washing at 55.degree. C. using a wash buffer of 1.times.SSC, 0.5%
SDS. See also Sambrook et al., supra, pp. 9.50-9.55.
[0203] The term "percent sequence identity" in the context of
nucleic acid sequences means the residues in two sequences that are
the same when aligned for maximum correspondence. The length of
sequence identity comparison may be over a stretch of at least
about nine nucleotides, usually at least about 18 nucleotides, more
usually at least about 24 nucleotides, typically at least about 28
nucleotides, more typically at least about 32 nucleotides, and
preferably at least about 36, 48 or more nucleotides. There are a
number of different algorithms known in the art which can be used
to measure nucleotide sequence identity. For instance,
polynucleotide sequences can be compared using FASTA, Gap or
BESTFIT.RTM., which are programs in Wisconsin Package Version 10.0,
Genetics Computer Group (GCG), Madison, Wis. FASTA, which includes,
e.g., the programs FASTA2 and FASTA3, provides alignments and
percent sequence identity of the regions of the best overlap
between the query and search sequences (Pearson, Methods Enzymol.
183:63-98 (1990); Pearson, Methods Mol. Biol. 132:185-219 (2000);
Pearson, Methods Enzymol. 266:227-258 (1996); Pearson, J. Mol.
Biol. 276:71-84 (1998); incorporated herein by reference). Unless
otherwise specified, default parameters for a particular program or
algorithm are used. For instance, percent sequence identity between
nucleic acid sequences can be determined using FASTA with its
default parameters (a word size of 6 and the NOPAM factor for the
scoring matrix) or using Gap with its default parameters as
provided in GCG Version 6.1, incorporated herein by reference.
[0204] A reference to a nucleotide sequence encompasses its
complement unless otherwise specified. Thus, a reference to a
nucleic acid having a particular sequence should be understood to
encompass its complementary strand, with its complementary
sequence.
[0205] As used herein, the terms "percent sequence identity" and
"percent sequence homology" are used interchangeably.
[0206] The term "substantial similarity" or "substantial sequence
similarity," when referring to a nucleic acid or fragment thereof,
means that when optimally aligned with appropriate nucleotide
insertions or deletions with another nucleic acid (or its
complementary strand), there is nucleotide sequence identity in at
least about 85%, preferably at least about 90%, and more preferably
at least about 95%, 96%, 97%, 98% or 99% of the nucleotide bases,
as measured by any well-known algorithm of sequence identity, such
as FASTA, BLAST or Gap, as discussed above.
[0207] As applied to polypeptides, the term "substantial identity"
means that two peptide sequences, when optimally aligned, such as
by the programs GAP or BESTFIT.RTM. using default gap weights as
supplied with the programs, share at least 70%, 75% or 80% sequence
identity, preferably at least 90% or 95% sequence identity, and
more preferably at least 97%, 98% or 99% sequence identity. In
certain embodiments, residue positions that are not identical
differ by conservative amino acid substitutions. A "conservative
amino acid substitution" is one in which an amino acid residue is
substituted by another amino acid residue having a side chain R
group with similar chemical properties (e.g., charge or
hydrophobicity). In general, a conservative amino acid substitution
will not substantially change the functional properties of a
protein. In cases where two or more amino acid sequences differ
from each other by conservative substitutions, the percent sequence
identity may be adjusted upwards to correct for the conservative
nature of the substitution. Means for making this adjustment are
well-known to those of skill in the art. See, e.g., Pearson,
Methods Mol. Biol. 243:307-31 (1994). Examples of groups of amino
acids that have side chains with similar chemical properties
include 1) aliphatic side chains: glycine, alanine, valine,
leucine, and isoleucine; 2) aliphatic-hydroxyl side chains: serine
and threonine; 3) amide-containing side chains: asparagine and
glutamine; 4) aromatic side chains: phenylalanine, tyrosine, and
tryptophan; 5) basic side chains: lysine, arginine, and histidine;
6) acidic side chains: aspartic acid and glutamic acid; and 7)
sulfur-containing side chains: cysteine and methionine.
Conservative amino acids substitution groups are:
valine-leucine-isoleucine, phenylalanine-tyrosine, lysine-arginine,
alanine-valine, glutamate-aspartate, and asparagine-glutamine.
[0208] Alternatively, a conservative replacement is any change
having a positive value in the PAM250 log-likelihood matrix
disclosed in Gonnet et al., Science 256:1443-45 (1992),
incorporated herein by reference. A "moderately conservative"
replacement is any change having a nonnegative value in the PAM250
log-likelihood matrix.
[0209] Sequence identity for polypeptides is typically measured
using sequence analysis software. Protein analysis software matches
sequences using measures of similarity assigned to various
substitutions, deletions and other modifications, including
conservative amino acid substitutions. For instance, GCG contains
programs such as "Gap" and "BESTFIT.RTM." which can be used with
default parameters as specified by the programs to determine
sequence homology or sequence identity between closely related
polypeptides, such as homologous polypeptides from different
species of organisms or between a wild type protein and a mutein
thereof. See, e.g., GCG Version 6.1 (University of Wisconsin, WI).
Polypeptide sequences also can be compared using FASTA using
default or recommended parameters, see GCG Version 6.1. FASTA
(e.g., FASTA2 and FASTA3) provides alignments and percent sequence
identity of the regions of the best overlap between the query and
search sequences (Pearson, Methods Enzymol. 183:63-98 (1990);
Pearson, Methods Mol. Biol. 132:185-219 (2000)). Another preferred
algorithm when comparing a sequence of the invention to a database
containing a large number of sequences from different organisms is
the computer program BLAST, especially blastp or tblastn, using
default parameters as supplied with the programs. See, e.g.,
Altschul et al., J. Mol. Biol. 215:403-410 (1990); Altschul et al.,
Nucleic Acids Res. 25:3389-402 (1997).
[0210] The length of polypeptide sequences compared for homology
will generally be at least about 16 amino acid residues, usually at
least about 20 residues, more usually at least about 24 residues,
typically at least about 28 residues, and preferably more than
about 35 residues. When searching a database containing sequences
from a large number of different organisms, it is preferable to
compare amino acid sequences.
[0211] As used herein, the terms "label" or "labeled" refers to
incorporation of another molecule in the antibody. In one
embodiment, the label is a detectable marker, e.g., incorporation
of a radiolabeled amino acid or attachment to a polypeptide of
biotinyl moieties that can be detected by marked avidin (e.g.,
streptavidin containing a fluorescent marker or enzymatic activity
that can be detected by optical or colorimetric methods). In
another embodiment, the label or marker can be therapeutic, e.g., a
drug conjugate or toxin. Various methods of labeling polypeptides
and glycoproteins are known in the art and may be used. Examples of
labels for polypeptides include, but are not limited to, the
following: radioisotopes or radionuclides (e.g., .sup.3H, .sup.14C,
.sup.15N, .sup.35S, .sup.90Y .sup.99Tc, .sup.111In, .sup.125I,
.sup.131I), fluorescent labels (e.g., FITC, rhodamine, lanthanide
phosphors), enzymatic labels (e.g., horseradish peroxidase,
.beta.-galactosidase, luciferase, alkaline phosphatase),
chemiluminescent markers, biotinyl groups, predetermined
polypeptide epitopes recognized by a secondary reporter (e.g.,
leucine zipper pair sequences, binding sites for secondary
antibodies, metal binding domains, epitope tags), magnetic agents,
such as gadolinium chelates, toxins such as pertussis toxin,
TAXOL.RTM. (paclitaxel), cytochalasin B, gramicidin D, ethidium
bromide, emetine, mitomycin, etoposide, tenoposide, vincristine,
vinblastine, colchicine, doxorubicin, daunorubicin, dihydroxy
anthracin dione, mitoxantrone, mithramycin, actinomycin D,
1-dehydrotestosterone, glucocorticoids, procaine, tetracaine,
lidocaine, propranolol, and puromycin and analogs or homologs
thereof. In some embodiments, labels are attached by spacer arms of
various lengths to reduce potential steric hindrance.
[0212] Throughout this specification and claims, the word
"comprise," or variations such as "comprises" or "comprising," will
be understood to imply the inclusion of a stated integer or group
of integers but not the exclusion of any other integer or group of
integers.
Human Anti-Myostatin Antibodies and Characterization Thereof
[0213] The invention herein provides anti-myostatin antibodies. In
some embodiments, the antibodies are human. In other embodiments,
the antibodies are humanized. In some embodiments, human
anti-myostatin antibodies are produced by immunizing a non-human
transgenic animal, e.g., a rodent, whose genome comprises human
immunoglobulin genes so that the transgenic animal produces human
antibodies.
[0214] An anti-myostatin antibody of the invention can comprise a
human kappa or a human lambda light chain or an amino acid sequence
derived therefrom. In some embodiments comprising a kappa light
chain, the light chain variable domain (V.sub.L) utilizes a human
A30, A3 or L2 V.sub.K gene
[0215] In some embodiments, the V.sub.L of the anti-myostatin
antibody comprises one or more amino acid substitutions, deletions
or insertions (additions) relative to the germline V.sub.K amino
acid sequence. In some embodiments, the V.sub.L of the
anti-myostatin antibody comprises 1, 2, 3, 4 or 5 amino acid
substitutions relative to the germline V.sub.K amino acid sequence.
In some embodiments, one or more of the substitutions from germline
is in the CDR regions of the light chain. In some embodiments, the
V.sub.K amino acid substitutions relative to germline are at one or
more of the same positions as the substitutions relative to
germline found in any one or more of the V.sub.L of the antibodies
provided herein. For example, the V.sub.L of an anti-myostatin
antibody of the invention may contain one or more of the amino acid
substitutions compared to germline found in the V.sub.L of antibody
1.sub.--257.sub.--1. There also may be one or more amino acid
substitutions compared to germline found in the V.sub.L of antibody
1.sub.--116.sub.--1, which utilizes the same V.sub.K gene as
antibody 1.sub.--257.sub.--1. In some embodiments, the amino acid
changes are at one or more of the same positions, but involve a
different substitution than in the reference antibody. In all
cases, the recitation of an antibody clone with dashes is
equivalent to the same antibody clone with dots (e.g.,
1.sub.--257.sub.--1=1.257.1).
[0216] In some embodiments, amino acid substitutions relative to
germline occur at one or more of the same positions as
substitutions from germline in any of the V.sub.L of antibodies
1.sub.--116.sub.--1, 1.sub.--136.sub.--3, 1.sub.--257.sub.--1,
1.sub.--46.sub.--1, 2.sub.--112.sub.--, 1.sub.--314.sub.--1,
1.sub.--66.sub.--1, 2.sub.--43.sub.--1, 2.sub.--177.sub.--1,
1.sub.--132.sub.--1, 1.sub.--268.sub.--1,
1.sub.--116.sub.--1L-Q45K; 1.sub.--257.sub.--1L-L21I;
1.sub.--314.sub.--1H-T92A; 1.sub.--46.sub.--1H-L81M;
2.sub.--112.sub.--1H-I12V; 2.sub.--112.sub.--1L-F58I;
2.sub.--112.sub.--1L-I85V; 2.sub.--112.sub.--1H-L81M, L-F58I;
2.sub.--112.sub.--1H-L81M, L-I85V; or 2.sub.--112.sub.--1H-L81M,
L-F58I, I85V, but the substitutions may represent conservative
amino acid substitutions at such position(s) relative to the amino
acid in the reference antibody. For example, if a particular
position in one of these antibodies is changed relative to germline
and is glutamate, one may substitute aspartate at that position.
Similarly, if an amino acid substitution compared to germline in an
exemplified antibody is serine, one may conservatively substitute
threonine for serine at that position. Conservative amino acid
substitutions are discussed supra, throughout this application.
[0217] In some embodiments, the anti-myostatin antibody comprises a
light chain amino acid sequence selected from the group consisting
of SEQ ID NOS: 4, 8, 12, 16, 20, 24, 28, 32, 36, 40 and 44. In
other embodiments, the light chain comprises the light chain amino
acid sequence of antibody 1.sub.--116.sub.--1L-Q45K;
1.sub.--257.sub.--1L-L21I; 2.sub.--112.sub.--1L-F58I;
2.sub.--112.sub.--1L-I85V or 2.sub.--112.sub.--1L-F58I, I85V. In
some embodiments, the light chain of the human anti-myostatin
antibody comprises the V.sub.L amino acid sequence of antibody
1.sub.--116.sub.--1 (SEQ ID NO: 4); 1.sub.--136.sub.--3 (SEQ ID NO:
12); 1.sub.--257.sub.--1 (SEQ ID NO: 16); 1.sub.--46.sub.--1 (SEQ
ID NO: 24); 2.sub.--112.sub.--1 (SEQ ID NO: 28);
1.sub.--314.sub.--1 (SEQ ID NO: 20); 1.sub.--66.sub.--1 (SEQ ID NO:
36); 2.sub.--43.sub.--1 (SEQ ID NO: 44); 2.sub.--177.sub.--1 (SEQ
ID NO: 40); 1.sub.--132.sub.--1 (SEQ ID NO: 8); or
1.sub.--268.sub.--1 (SEQ ID NO: 32) or said amino acid sequence
having up to 1, 2, 3, 4 or 5 conservative amino acid substitutions
and/or a total of up to 3 non-conservative amino acid
substitutions. In other embodiments the light chain of the human
anti-myostatin antibody comprises the V.sub.L amino acid sequence
of antibody 1.sub.--116.sub.--1L-Q45K; 1.sub.--257.sub.--1L-L21I;
2.sub.--112.sub.--1L-F58I; 2.sub.--112.sub.--1L-I85V or
2.sub.--112.sub.--1L-F58I, I85V. In some embodiments, the light
chain comprises the amino acid sequence from the beginning of the
CDR1 to the end of the CDR3 of any one of the foregoing
antibodies.
[0218] In some embodiments, the light chain may comprise the amino
acid sequences of CDR1, CDR2 and CDR3 regions independently
selected from the light chain CDR1, CDR2 and CDR3 regions,
respectively, of two or more monoclonal antibodies selected from
1.sub.--116.sub.--1 (SEQ ID NO: 4); 1.sub.--136.sub.--3 (SEQ ID NO:
12); 1.sub.--257.sub.--1 (SEQ ID NO: 16); 1.sub.--46.sub.--1 (SEQ
ID NO: 24); 2.sub.--112.sub.--1 (SEQ ID NO: 28);
1.sub.--314.sub.--1 (SEQ ID NO: 20); 1.sub.--66.sub.--1 (SEQ ID NO:
36); 2.sub.--43.sub.--1 (SEQ ID NO: 44); 2.sub.--177.sub.--1 (SEQ
ID NO: 40); 1.sub.--132.sub.--1 (SEQ ID NO: 8); or
1.sub.--268.sub.--1 (SEQ ID NO: 32), or said CDR regions each
having less than 3 or less than 2 conservative amino acid
substitutions and/or a total of three or fewer non-conservative
amino acid substitutions.
[0219] In certain embodiments, the light chain of the
anti-myostatin antibody comprises the amino acid sequences of the
light chain CDR1, CDR2 and CDR3 regions of an antibody selected
from 1.sub.--116.sub.--1 (SEQ ID NO: 4); 1.sub.--136.sub.--3 (SEQ
ID NO: 12); 1.sub.--257.sub.--1 (SEQ ID NO: 16); 1.sub.--46.sub.--1
(SEQ ID NO: 24); 2.sub.--112.sub.--1 (SEQ ID NO: 28);
1.sub.--314.sub.--1 (SEQ ID NO: 20); 1.sub.--66.sub.--1 (SEQ ID NO:
36); 2.sub.--43.sub.--1 (SEQ ID NO: 44); 2.sub.--177.sub.--1 (SEQ
ID NO: 40); 1.sub.--132.sub.--1 (SEQ ID NO: 8); or
1.sub.--268.sub.--1 (SEQ ID NO: 32) or said CDR regions each having
less than 3 or less than 2 conservative amino acid substitutions
and/or a total of three or fewer non-conservative amino acid
substitutions.
[0220] With regard to the heavy chain, in some embodiments, the
variable domain (V.sub.H) utilizes a human V.sub.H 1-02, V.sub.H
3-21 or V.sub.H 3-23 gene. In some embodiments, the V.sub.H
sequence of the anti-myostatin antibody contains one or more amino
acid substitutions, deletions or insertions (additions),
collectively "mutations", relative to the germline V.sub.H amino
acid sequence. In some embodiments, the variable domain of the
heavy chain comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or 11 mutations
from the germline V.sub.H amino acid sequence. In some embodiments,
the mutation(s) are non-conservative substitutions compared to the
germline amino acid sequence. In some embodiments, the mutations
are in the CDR regions of the heavy chain.
[0221] In some embodiments, amino acid substitutions are at one or
more of the same positions as the substitutions from germline in
any one or more of the V.sub.H of antibodies 1.sub.--116.sub.--1,
1.sub.--136.sub.--3, 1.sub.--257.sub.--1, 1.sub.--46.sub.--1,
2.sub.--112.sub.--, 1.sub.--314.sub.--1, 1.sub.--66.sub.--1,
2.sub.--43.sub.--1, 2.sub.--177.sub.--1, 1.sub.--132.sub.--1,
1.sub.--268.sub.--1, 1.sub.--116.sub.--1L-Q45K;
1.sub.--257.sub.--1L-L21I; 1.sub.--314.sub.--1H-T92A;
1.sub.--46.sub.--1H-L81M; 2.sub.--112.sub.--1H-I12V;
2.sub.--112.sub.--1L-F58I; 2.sub.--112.sub.--1L-I85V;
2.sub.--112.sub.--1H-L81M, L-F58I; 2.sub.--112.sub.--1H-L81M,
L-I85V; or 2.sub.--112.sub.--1H-L81M, L-F58I, I85V. In other
embodiments, the amino acid changes are at one or more of the same
positions but involve a different substitution than in the
reference antibody.
[0222] In some embodiments, the heavy chain comprises an amino acid
sequence selected from the group consisting of SEQ ID NOS: 2, 6,
10, 14, 18, 22, 26, 30, 34, 38 and 42. In other embodiments, the
heavy chain comprises the heavy chain amino acid sequence of
antibody 1.sub.--314.sub.--1H-T92A; 1.sub.--46.sub.--1H-L81M; or
2.sub.--112.sub.--1H-I12V. In some embodiments, the heavy chain
comprises the V.sub.H amino acid sequence of antibody
1.sub.--116.sub.--1 (SEQ ID NO: 2), 1.sub.--136.sub.--3 (SEQ ID NO:
10), 1.sub.--257.sub.--1 (SEQ ID NO: 14), 1.sub.--46.sub.--1 (SEQ
ID NO: 22), 2.sub.--112.sub.--1 (SEQ ID NO: 26),
1.sub.--314.sub.--1 (SEQ ID NO: 18), 1.sub.--66.sub.--1 (SEQ ID NO:
34), 2.sub.--43.sub.--1 (SEQ ID NO: 42), 2.sub.--177.sub.--1 (SEQ
ID NO: 38), 1.sub.--132.sub.--1 (SEQ ID NO: 6) and
1.sub.--268.sub.--1 (SEQ ID NO: 30); or said V.sub.H amino acid
sequence having up to 1, 2, 3, 4, 6, 8, 9, 10 or 11 conservative
amino acid substitutions and/or a total of up to 3 non-conservative
amino acid substitutions. In other embodiments, the heavy chain
comprises the V.sub.H amino acid sequence of antibody
1.sub.--314.sub.--1H-T92A; 1.sub.--46.sub.--1H-L81M; or
2.sub.--112.sub.--1H-I12V. In some embodiments, the heavy chain
comprises the amino acid sequence from the beginning of the CDR1 to
the end of the CDR3 of any one of the foregoing antibodies.
[0223] In some embodiments, the heavy chain comprises the heavy
chain CDR1, CDR2 and CDR3 regions of antibody 1.sub.--116.sub.--1,
1.sub.--136.sub.--3, 1.sub.--257.sub.--1, 1.sub.--46.sub.--1,
2.sub.--112.sub.--, 1.sub.--314.sub.--1, 1.sub.--66.sub.--1,
2.sub.--43.sub.--1, 2.sub.--177.sub.--1, 1.sub.--132.sub.--1,
1.sub.--268.sub.--1, 1.sub.--116.sub.--1L-Q45K;
1.sub.--257.sub.--1L-L21I; 1.sub.--314.sub.--1H-T92A;
1.sub.--46.sub.--1H-L81M; 2.sub.--112.sub.--1H-I12V;
2.sub.--112.sub.--1L-F58I; 2.sub.--112.sub.--1 L-I85V;
2.sub.--112.sub.--1H-L81M, L-F58I; 2.sub.--112.sub.--1H-L81M,
L-I85V; or 2.sub.--112.sub.--1H-L81M, L-F58I, I85V or said CDR
regions each having less than 8, less than 6, less than 4, or less
than 3 conservative amino acid substitutions and/or a total of
three or fewer non-conservative amino acid substitutions.
[0224] In some embodiments, the heavy chain CDR regions are
independently selected from the CDR regions of two or more
antibodies selected from antibodies 1.sub.--116.sub.--1,
1.sub.--136.sub.--3, 1.sub.--257.sub.--1, 1.sub.--46.sub.--1,
2.sub.--112.sub.--, 1.sub.--314.sub.--1, 1.sub.--66.sub.--1,
2.sub.--43.sub.--1, 2.sub.--177.sub.--1, 1.sub.--132.sub.--1,
1.sub.--268.sub.--1, 1.sub.--116.sub.--1 L-Q45K;
1.sub.--257.sub.--1 L-L21I; 1.sub.--314.sub.--1H-T92A;
1.sub.--46.sub.--1H-L81M; 2.sub.--112.sub.--1H-I12V;
2.sub.--112.sub.--1L-F58I; 2.sub.--112.sub.--1L-I85V;
2.sub.--112.sub.--1H-L81M, L-F58I; 2.sub.--112.sub.--1H-L81M,
L-I85V; or 2.sub.--112.sub.--1H-L81M, L-F58I, I85V. In another
embodiment, the antibody comprises a light chain as disclosed above
and a heavy chain as disclosed above. In a further embodiment, the
light chain CDRs and the heavy chain CDRs are from the same
antibody.
[0225] In various embodiments, the anti-myostatin antibodies have
the full-length heavy chain and full length light chain amino acid
sequence(s), the V.sub.H and V.sub.L amino acid sequences, the
heavy chain CDR1, CDR2 and CDR3 and light chain CDR1, CDR2 and CDR3
amino acid sequences or the heavy chain amino acid sequence from
the beginning of the CDR1 to the end of the CDR3 and the light
chain amino acid sequence from the beginning of the CDR1 to the end
of the CDR3 of an anti-myostatin antibody provided herein.
[0226] One type of amino acid substitution that may be made is to
change one or more cysteines in the antibody, which may be
chemically reactive, to another residue, such as, without
limitation, alanine or serine. In one embodiment, there is a
substitution of a non-canonical cysteine. The substitution can be
made in a CDR or framework region of a variable domain or in the
constant domain of an antibody. In some embodiments, the cysteine
is canonical.
[0227] Another type of amino acid substitution that may be made is
to remove potential proteolytic sites in the antibody. Such sites
may occur in a CDR or framework region of a variable domain or in
the constant domain of an antibody. Substitution of cysteine
residues and removal of proteolytic sites may decrease the risk of
heterogeneity in the antibody product and thus increase its
homogeneity. Another type of amino acid substitution is to
eliminate asparagine-glycine pairs, which form potential
deamidation sites, by altering one or both of the residues.
[0228] In some embodiments, the C-terminal lysine of the heavy
chain of the anti myostatin antibody of the invention is cleaved.
In various embodiments of the invention, the heavy and light chains
of the anti-myostatin antibodies may optionally include a signal
sequence.
[0229] In one aspect, the invention provides to eleven inhibitory
human anti-myostatin monoclonal antibodies and the hybridoma cell
lines that produce them. Table 1 lists the sequence identifiers
(SEQ ID NOs) of the nucleic acids encoding the full-length heavy
and light chains and variable domain containing portions of those
chains, and the corresponding full-length deduced amino acid
sequences.
TABLE-US-00001 TABLE 1 SEQUENCE IDENTIFIERS (SEQ ID NO) FULL LENGTH
V DOMAIN CONTAINING PORTION Heavy Light Heavy Light Mab DNA PROTEIN
DNA PROTEIN PROTEIN DNA PROTEIN DNA 1_116_1 1 2 3 4 45 46 47 48
1_132_1 5 6 7 8 49 50 51 52 1_136_3 9 10 11 12 53 54 55 56 1_257_1
13 14 15 16 57 58 59 60 1_314_1 17 18 19 20 65 66 67 68 1_46_1 21
22 23 24 69 70 71 72 2_112_1 25 26 27 28 77 78 79 80 1_268_1 29 30
31 32 61 62 63 64 1_66_1 33 34 35 36 73 74 75 76 2_177_1 37 38 39
40 81 82 83 84 2_43_1 41 42 43 44 85 86 87 88 2_112_K 114 115 116
117 118 119 120 121
[0230] The invention further provides heavy and/or light chain
variants of certain of the above-listed human anti-myostatin
antibodies, comprising one or more amino acid modifications. To
designate the variants, the first letter is the one letter symbol
for the amino acid of the naturally-occurring antibody chain, the
number refers to the position of the amino acid (wherein position
one is the N-terminal amino acid of the FRI), and the second letter
is the one letter symbol for the variant amino acid.
[0231] The invention provides a light chain variant of monoclonal
antibody 1.sub.--116.sub.--1 called 1.sub.--116.sub.--1L-Q45K,
which has a lysine at position 45 of SEQ ID NO: 4.
[0232] Another light chain variant is 1.sub.--257.sub.--1 L-L21I,
which has an isoleucine residue at position 21 of SEQ ID NO:
16.
[0233] A heavy chain varianty of monoclonal antibody of
1.sub.--314.sub.--1 called 1.sub.--314.sub.--1H-T92A which has an
alanine residue at position 92 of SEQ ID NO: 18.
[0234] The invention further provides a heavy chain variant of
monoclonal antibody 1.sub.--46.sub.--1 called
1.sub.--46.sub.--1H-L81M, which has a methionine at position 81 of
SEQ ID NO: 22.
[0235] The invention provides a heavy chain variant (I12V) and two
light chain variants (F581 and I85V) of monoclonal antibody
2.sub.--112.sub.--1. The heavy chain variant called
2.sub.--112.sub.--1H-I12V has a valine at position 12 of SEQ ID NO:
26. One light chain variant, 2.sub.--112.sub.--1L-F85I, has an
isoleucine at position 85 of SEQ ID NO: 28. The other light chain
variant, called 2.sub.--112.sub.--1L-I85V, has a valine at position
85 of SEQ ID NO: 28. The invention also provides a light chain
variant comprising both mutations, i.e., 2.sub.--112.sub.--1L-F85I,
I85V. The invention also includes antibodies comprising the heavy
chain variant with either one or both of the light chain mutations,
i.e., 2.sub.--112.sub.--1H-I12V, L-F58I; 2.sub.--112.sub.--1H-I12V,
L-I85V; and 2.sub.--112.sub.--1H-I12V, L-F58I, I85V.
[0236] In still further embodiments, the invention includes
antibodies comprising variable domain amino acid sequences with
more than 80%, more than 85%, more than 90%, more than 95%, more
than 96%, more than 97%, more than 98% or more than 99% sequence
identity to a variable domain amino acid sequence of any of the
above-listed human anti-myostatin antibodies
Class and Subclass of Anti-myostatin Antibodies
[0237] The class and subclass of anti-myostatin antibodies may be
determined by any method known in the art. In general, the class
and subclass of an antibody may be determined using antibodies that
are specific for a particular class and subclass of antibody. Such
antibodies are commercially available. The class and subclass can
be determined by ELISA, or Western Blot as well as other
techniques. Alternatively, the class and subclass may be determined
by sequencing all or a portion of the constant domains of the heavy
and/or light chains of the antibodies, comparing their amino acid
sequences to the known amino acid sequences of various class and
subclasses of immunoglobulins, and determining the class and
subclass of the antibodies.
[0238] In some embodiments, the anti-myostatin antibody is a
monoclonal antibody. The anti-myostatin antibody can be an IgG, an
IgM, an IgE, an IgA, or an IgD molecule. In a preferred embodiment,
the anti-myostatin antibody is an IgG and is an IgG1, IgG2, IgG3,
IgG4 subclass. In another preferred embodiment, the antibody is
subclass IgG2.
Identification of Myostatin Epitopes Recognized by Anti-Myostatin
Antibodies
[0239] The invention provides a human anti-myostatin monoclonal
antibody that binds to myostatin and competes or cross-competes
with and/or binds the same epitope as: (a) an antibody selected
from 1.sub.--116.sub.--1, 1.sub.--136.sub.--3, 1.sub.--257.sub.--1,
1.sub.--46.sub.--1, 2.sub.--112.sub.--, 1.sub.--314.sub.--1,
1.sub.--66.sub.--1, 2.sub.--43.sub.--1, 2.sub.--177.sub.--1,
1.sub.--132.sub.--1, 1.sub.--268.sub.--1,
1.sub.--116.sub.--1L-Q45K; 1.sub.--257.sub.--1L-L21I;
1.sub.--314.sub.--1H-T92A; 1.sub.--46.sub.--1H-L81M;
2.sub.--112.sub.--1H-I12V; 2.sub.--112.sub.--1L-F58I;
2.sub.--112.sub.--1 L-I85V; 2.sub.--112.sub.--1H-L81M, L-F58I;
2.sub.--112.sub.--1H-L81M, L-I85V; or 2.sub.--112.sub.--1H-L81M,
L-F58I, I85V; (b) an antibody that comprises a heavy chain variable
domain having the amino acid sequence of the V.sub.H domain in any
one of SEQ ID NOS: 2, 6, 10, 14, 18, 22, 26, 30, 34, 38, 42, 45,
49, 53, 57, 61, 65, 69, 73, 77, 81 or 85, (c) an antibody that
comprises a light chain variable domain having the amino acid
sequence of the V.sub.L domain in any one of SEQ ID NOS: 4, 8, 12,
16, 20, 24, 28, 32, 36, 40, 44, 47, 51, 55, 59, 63, 67, 71, 75, 79,
83 or 87 (d) an antibody that comprises both a heavy chain variable
domain as defined in (b) and a light chain variable domain as
defined in (c).
[0240] One can determine whether an antibody binds to the same
epitope or cross competes for binding with an anti-myostatin
antibody by using methods known in the art. In one embodiment, one
allows the anti-myostatin antibody of the invention to bind to
myostatin under saturating conditions and then measures the ability
of the test antibody to bind to myostatin. If the test antibody is
able to bind to myostatin at the same time as the reference
anti-myostatin antibody, then the test antibody binds to a
different epitope than the reference anti-myostatin antibody.
However, if the test antibody is not able to bind to myostatin at
the same time, then the test antibody binds to the same epitope, an
overlapping epitope, or an epitope that is in close proximity to
the epitope bound by the anti-myostatin antibody of the invention.
This experiment can be performed using ELISA, RIA, BIACORE.RTM., or
flow cytometry. To test whether an anti-myostatin antibody
cross-competes with another anti-myostatin antibody, one may use
the competition method described above in two directions, i.e.
determining if the known antibody blocks the test antibody and vice
versa. In a preferred embodiment, the experiment is performed using
ELISA.
Inhibition of Myostatin Activity by Anti-Myostatin Antibody
[0241] One can identify anti-myostatin monoclonal antibodies that
inhibit myostatin binding using a number of assays. For example,
neutralizing anti-myostatin antibodies can be identified by their
ability to block myostatin-induced luciferase activity in A204
cells transfected with a Smad response elements/luciferase
construct as described in Example III. Preferred anti-myostatin
antibodies have an IC.sub.50 of no more than 500 nM, 250 nM, 100
nM, 75 nM, 50 nM, 40 nM, 30 nM, 20 nM, 10 nM, 1 nM, 0.5 nM or 0.1
nM.
[0242] One also can determine the ability of an anti-myostatin
antibody to block myostatin-induced Smad protein activation by
contacting L6 rat myoblast cells transfected with a Smad
2/3-binding element/beta lactamase construct with an anti-myostatin
antibody as described in Example IV. In various embodiments, the
anti-myostatin antibody has an IC.sub.50 in this assay of no more
than 500 nM, 250 nM, 100 nM, 75 nM, 50 nM, 40 nM, 30 nM, 20 nM, 10
nM, 1 nM, 0.5 nM or 0.1 nM.
[0243] Alternatively, neutralizing anti-myostatin anti-bodies can
be identified by their ability to inhibit Smad 2 or 3
phosphorylation in a Western Blot as described in Example V.
[0244] In other embodiments, an anti-myostatin antibody of the
invention modulates the expression of genes associated with muscle
cell proliferation and differentiation. Such modulation includes
but is not limited to decreasing expression of the cell cycle
inhibitor P21 protein and pro-apoptotic Bax protein, increasing
phosphorylation of Rb, and increasing expression of Cdk2. In some
embodiments, antagonist anti-myostatin antibodies of the invention
increase the expression of MyoD, myogenin and Myf5. The effect of
an anti-myostatin antibody on gene expression can be determined
using any of a number of routine techniques. (See e.g., Example
VI).
[0245] In some embodiments, a neutralizing anti-myostatin antibody
of the invention enhances myoblast differentiation. The ability of
an antibody to enhance such proliferation and differentiation can
be determined by assays using, e.g., C2C12 cells as described in
Example VII.
Competitive Vs Non-Competitive Human Anti-Myostatin Antibodies
[0246] Human anti-myostatin antibodies of the invention can be
categorized as competitive and non-competitive with other
inhibitory myostatin binding proteins using immunoprecipitation
experiments. For example, the propeptide, which forms a complex
with mature GDF8 is an inhibitory protein. Conditioned medium from
293T cells expressing GDF8 contains mature GDF8, mature
GDF8/propeptide complex and unprocessed GDF8. Immunoprecipitation
studies were conducted to test the binding of the human
anti-myostatin antibodies in the invention to mature GDF8/propetide
complex using this conditioned medium. As described in Example X,
antibodies 2.sub.--112.sub.--1, 2.sub.--43.sub.--1 and
2.sub.--177.sub.--1 bound and immunoprecipitated mature GDF8,
mature GDF8/propeptide complex, and unprocessed GDF8. Antibody
1.sub.--66.sub.--1 bound and immunoprecipitated mature GDF8 and
mature GDF8/propeptide complex. None of the other antibodies
immunoprecipitated mature GDF8, propeptide, or unprocessed GDF8.
Antibodies 2.sub.--112.sub.--1, 2.sub.--43.sub.--1 and
2.sub.--177.sub.--1, thus, are non-competitive antibodies, and
antibody 1.sub.--66.sub.--1 also is a non-competitive antibody but
one that binds to a different epiptope of myostatin. A
non-competitive neutralizing antibody, i.e., one that binds
myostatin in the presence of other inhibitory proteins, will have
better in vivo efficacy than a competitive antibody.
[0247] In other embodiments, an anti-myostatin antibody of the
invention immunoprecipitates mature GDF8 from mouse serum. As
described in Example XI, monoclonal antibodies 2.sub.--112,
2.sub.--43.sub.--1 and 2.sub.--177 pull down more mature GDF8 than
1.sub.--116.sub.--1 and 1.sub.--66.sub.--1.
Species Specificity and Molecular Selectivity
[0248] In another aspect of the invention, the anti-myostatin
antibodies demonstrate both species specificity and molecular
selectivity. In some embodiments, the anti-myostatin antibody binds
to human, mouse, Rattus norvegicus (Norway rat), cynomolgus macaque
(monkey), Macaca fascicularis (crab-eating macaque), Meleagris
gallopavo (turkey), Sus scrofa (pig), Gallus gallus (chicken),
Gallus gallus (chicken), Canis familiaris (dog), Equus caballus
(horse), Coturnix chinensis (Quail), Coturnix coturnix (common
quail), and Columba livia (domestic pigeon) myostatin. Following
the teachings of the specification, one may determine the species
specificity for the anti-myostatin antibody using methods well
known in the art. For instance, one may determine the species
specificity using Western blot, surface plasmon resonance, e.g.,
BIACORE.RTM., ELISA, immunoprecipitation or RIA.
[0249] In other embodiments, the anti-myostatin antibody has a
selectivity for myostatin over GDF11 of at least 50-fold or at
least 100-fold. GDF11 is a close family member of myostatin that
shares ninety percent identity in its mature protein. In some
embodiments, the anti-myostatin antibody does not exhibit any
appreciable specific binding to any other protein other than
myostatin. One can determine the selectivity of the anti-myostatin
antibody for myostatin using methods well known in the art
following the teachings of the specification. For instance one can
determine the selectivity using Western blot, flow cytometry,
ELISA, immunoprecipitation or RIA.
[0250] In other embodiments of the invention, the anti-myostatin
antibody does not have this high degree of selectivity for GDF8
over GDF11.
Methods of Producing Antibodies and Antibody Producing Cell
Lines
Immunization
[0251] In some embodiments, human antibodies are produced by
immunizing a non-human, transgenic animal comprising within its
genome some or all of human immunoglobulin heavy chain and light
chain loci with a myostatin antigen. In a preferred embodiment, the
non-human animal is a XENOMOUSE.RTM. animal. (Abgenix, Inc.,
Fremont, Calif.).
[0252] XENOMOUSE.RTM. mice are engineered mouse strains that
comprise large fragments of human immunoglobulin heavy chain and
light chain loci and are deficient in mouse antibody production.
See, e.g., Green et al., Nature Genetics 7:13-21 (1994) and U.S.
Pat. Nos. 5,916,771, 5,939,598, 5,985,615, 5,998,209, 6,075,181,
6,091,001, 6,114,598, 6,130,364, 6,162,963 and 6,150,584. See also
WO 91/10741, WO 94/02602, WO 96/34096, WO 96/33735, WO 98/16654, WO
98/24893, WO 98/50433, WO 99/45031, WO 99/53049, WO 00/09560, and
WO 00/037504.
[0253] In another aspect, the invention provides a method for
making anti-myostatin antibodies from non-human, non-mouse animals
by immunizing non-human transgenic animals that comprise human
immunoglobulin loci with a myostatin antigen. One can produce such
animals using the methods described in the above-cited documents.
The methods disclosed in these documents can be modified as
described in U.S. Pat. No. 5,994,619, which is hereby incorporated
by reference. U.S. Pat. No. 5,994,619 describes methods for
producing novel cultured inner cell mass (CICM) cells and cell
lines, derived from pigs and cows, and transgenic CICM cells into
which heterologous DNA has been inserted. CICM transgenic cells can
be used to produce cloned transgenic embryos, fetuses, and
offspring. The '619 patent also describes methods of producing
transgenic animals that are capable of transmitting the
heterologous DNA to their progeny. In preferred embodiments of the
current invention, the non-human animals are mammals, particularly
rats, sheep, pigs, goats, cattle, horses or chickens.
[0254] XENOMOUSE.RTM. mice produce an adult-like human repertoire
of fully human antibodies and generate antigen-specific human
antibodies. In some embodiments, the XENOMOUSE.RTM. mice contain
approximately 80% of the human antibody V gene repertoire through
introduction of megabase sized, germline configuration fragments of
the human heavy chain loci and kappa light chain loci in yeast
artificial chromosome (YAC). In other embodiments, XENOMOUSE.RTM.
mice further contain approximately all of the human lambda light
chain locus. See Mendez et al., Nature Genetics 15:146-156 (1997),
Green and Jakobovits, J. Exp. Med. 188:483-495 (1998), and WO
98/24893, the disclosures of which are hereby incorporated by
reference.
[0255] In some embodiments, the non-human animal comprising human
immunoglobulin genes are animals that have a human immunoglobulin
"minilocus". In the minilocus approach, an exogenous Ig locus is
mimicked through the inclusion of individual genes from the Ig
locus. Thus, one or more V.sub.H genes, one or more D.sub.H genes,
one or more J.sub.H genes, a mu constant domain, and a second
constant domain (preferably a gamma constant domain) are formed
into a construct for insertion into an animal. This approach is
described, inter alia, in U.S. Pat. Nos. 5,545,807, 5,545,806,
5,569,825, 5,625,126, 5,633,425, 5,661,016, 5,770,429, 5,789,650,
5,814,318, 5,591,669, 5,612,205, 5,721,367, 5,789,215, and
5,643,763, hereby incorporated by reference.
[0256] In another aspect, the invention provides a method for
making humanized anti-myostatin antibodies. In some embodiments,
non-human animals are immunized with a myostatin antigen as
described below under conditions that permit antibody production.
Antibody-producing cells are isolated from the animals, and nucleic
acids encoding the heavy and light chains of an anti-myostatin
antibody of interest are isolated from the isolated
antibody-producing cells or from an immortalized cell line produced
from such cells. These nucleic acids are subsequently engineered
using techniques known to those of skill in the art and as
described further below to reduce the amount of non-human sequence,
i.e., to humanize the antibody to reduce the immune response in
humans.
[0257] In some embodiments, the myostatin antigen is isolated
and/or purified myostatin. In some embodiments, the myostatin
antigen is human myostatin. However, because the C-terminal mature
myostatin from humans, mice, rat, dog, quail, chicken, turkey, pig,
horse, and monkeys is identical and is not glycosylated in cells,
myostatin from these species and other species having the same
mature protein sequence also can be used as the immunogen. In other
embodiments, the myostatin antigen is a cell that expresses or
overexpresses myostatin. In other embodiments, the myostatin
antigen is a recombinant protein expressed from yeast, insect
cells, bacteria such as E. Coli, or other resources by recombinant
technology.
[0258] Immunization of animals can be by any method known in the
art. See, e.g., Harlow and Lane, Antibodies: A Laboratory Manual
New York: Cold Spring Harbor Press, 1990. Methods for immunizing
non-human animals such as mice, rats, sheep, goats, pigs, cattle
and horses are well known in the art. See, e.g., Harlow and Lane,
supra, and U.S. Pat. No. 5,994,619. In a preferred embodiment, the
myostatin antigen is administered with an adjuvant to stimulate the
immune response. Exemplary adjuvants include complete or incomplete
Freund's adjuvant, RIBI (muramyl dipeptides) or ISCOM
(immunostimulating complexes). Such adjuvants may protect the
polypeptide from rapid dispersal by sequestering it in a local
deposit, or they may contain substances that stimulate the host to
secrete factors that are chemotactic for macrophages and other
components of the immune system. Preferably, if a polypeptide is
being administered, the immunization schedule will involve two or
more administrations of the polypeptide, spread out over several
weeks. Example I exemplifies a method for producing anti-myostatin
monoclonal antibodies in XENOMOUSE.RTM. mice.
Production of Antibodies and Antibody-Producing Cell Lines
[0259] After immunization of an animal with a myostatin antigen,
antibodies and/or antibody-producing cells can be obtained from the
animal. In some embodiments, anti-myostatin antibody-containing
serum is obtained from the animal by bleeding or sacrificing the
animal. The serum may be used as it is obtained from the animal, an
immunoglobulin fraction may be obtained from the serum, or the
anti-myostatin antibodies may be purified from the serum.
[0260] In some embodiments, antibody-producing cell lines are
prepared from cells isolated from the immunized animal. After
immunization, the animal is sacrificed and lymph node and/or
splenic B cells are immortalized by any means known in the art.
Methods of immortalizing cells include, but are not limited to,
transfecting them with oncogenes, infecting them with an oncogenic
virus and cultivating them under conditions that select for
immortalized cells, subjecting them to carcinogenic or mutating
compounds, fusing them with an immortalized cell, e.g., a myeloma
cell, and inactivating a tumor suppressor gene. See, e.g., Harlow
and Lane, supra. If fusion with myeloma cells is used, the myeloma
cells preferably do not secrete immunoglobulin polypeptides (a
non-secretory cell line). Immortalized cells are screened using
myostatin, or a portion thereof. In a preferred embodiment, the
initial screening is performed using an enzyme-linked immunoassay
(ELISA) or a radioimmunoassay. An example of ELISA screening is
provided in WO 00/37504, incorporated herein by reference.
[0261] Anti-myostatin antibody-producing cells, e.g., hybridomas,
are selected, cloned and further screened for desirable
characteristics, including robust growth, high antibody production
and desirable antibody characteristics, as discussed further below.
Hybridomas can be expanded in vivo in syngeneic animals, in animals
that lack an immune system, e.g., nude mice, or in cell culture in
vitro. Methods of selecting, cloning and expanding hybridomas are
well known to those of ordinary skill in the art.
[0262] In a preferred embodiment, the immunized animal is a
non-human animal that expresses human immunoglobulin genes and the
splenic B cells are fused to a myeloma cell line from the same
species as the non-human animal. In a more preferred embodiment,
the immunized animal is a XENOMOUSE.RTM. mouse and the myeloma cell
line is a non-secretory mouse myeloma. In an even more preferred
embodiment, the myeloma cell line is P3-X63-Ag8.653 (American Type
Culture Collection). See, e.g., Example I.
[0263] Thus, in one embodiment, the invention provides methods for
producing a cell line that produces a human monoclonal antibody or
a fragment thereof directed to myostatin comprising (a) immunizing
a non-human transgenic animal described herein with myostatin, a
portion of myostatin or a cell or tissue expressing myostatin; (b)
allowing the transgenic animal to mount an immune response to
myostatin; (c) isolating antibody-producing cells from transgenic
animal; (d) immortalizing the antibody-producing cells; (e)
creating individual monoclonal populations of the immortalized
antibody-producing cells; and (f) screening the immortalized
antibody-producing cells to identify an antibody directed to
myostatin.
[0264] In another aspect, the invention provides a cell line that
produces a human anti-myostatin antibody. In some embodiments the
cell line is a hybridoma cell line. In some embodiments, the
hybridomas are mouse hybridomas, as described above. In other
embodiments, the hybridomas are produced in a non-human, non-mouse
species such as rats, sheep, pigs, goats, cattle or horses. In
another embodiment, the hybridomas are human hybridomas.
[0265] In another embodiment, a transgenic animal is immunized with
a myostatin antigen, primary cells, e.g., spleen or peripheral
blood B cells, are isolated from an immunized transgenic animal and
individual cells producing antibodies specific for the desired
antigen are identified. Polyadenylated mRNA from each individual
cell is isolated and reverse transcription polymerase chain
reaction (RT-PCR) is performed using sense primers that anneal to
variable domain sequences, e.g., degenerate primers that recognize
most or all of the FR1 regions of human heavy and light chain
variable domain genes and anti-sense primers that anneal to
constant or joining region sequences. cDNAs of the heavy and light
chain variable domains are then cloned and expressed in any
suitable host cell, e.g., a myeloma cell, as chimeric antibodies
with respective immunoglobulin constant regions, such as the heavy
chain and K or .lamda. constant domains. See Babcook, J. S. et al.,
Proc. Natl. Acad. Sci. USA 93:7843-48, 1996, incorporated herein by
reference. Anti myostatin antibodies may then be identified and
isolated as described herein.
[0266] In another embodiment, phage display techniques can be used
to provide libraries containing a repertoire of antibodies with
varying affinities for myostatin. For production of such
repertoires, it is unnecessary to immortalize the B cells from the
immunized animal. Rather, the primary B cells can be used directly
as a source of mRNA. The mixture of cDNAs obtained from B cell,
e.g., derived from spleens, is used to prepare an expression
library, for example, a phage display library transfected into E.
coli. The resulting cells are tested for immunoreactivity to
myostatin. Techniques for the identification of high affinity human
antibodies from such libraries are described by Griffiths et al.,
EMBO J., 13:3245-3260 (1994); Nissim et al., ibid, pp. 692-698 and
by Griffiths et al., ibid, 12:725-734, which are incorporated by
reference. Ultimately, clones from the library are identified that
produce binding affinities of a desired magnitude for the antigen
and the DNA encoding the product responsible for such binding is
recovered and manipulated for standard recombinant expression.
Phage display libraries may also be constructed using previously
manipulated nucleotide sequences and screened in a similar fashion.
In general, the cDNAs encoding heavy and light chains are
independently supplied or linked to form Fv analogs for production
in the phage library.
[0267] The phage library is then screened for the antibodies with
the highest affinities for myostatin and the genetic material
recovered from the appropriate clone. Further rounds of screening
can increase affinity of the original antibody isolated.
Nucleic Acids, Vectors, Host Cells, and Recombinant Methods of
Making Antibodies
Nucleic Acids
[0268] The present invention also encompasses nucleic acid
molecules encoding anti-myostatin antibodies or an antigen-binding
fragments thereof. In some embodiments, different nucleic acid
molecules encode a heavy chain and a light chain of an
anti-myostatin immunoglobulin. In other embodiments, the same
nucleic acid molecule encodes a heavy chain and a light chain of an
anti-myostatin immunoglobulin.
[0269] In some embodiments, the nucleic acid molecule encoding the
variable domain of the light chain (V.sub.L) utilizes a human A3,
A30 or L2 VK gene, and a human JK1, JK3 or JK4 gene. In some
embodiments the nucleic acid molecule utilizes a human A30, A3 or
L2 VK gene and a human JK4 gene. In other embodiments, the nucleic
acid molecule utilizes a human A30, A3 or L2 gene and a human JK1
gene. In some embodiments, the nucleic acid molecule encoding the
light chain encodes an amino acid sequence comprising 1, 2, 3, 4,
5, 6, 7, 8, 9, or 10 substitutions from the germline amino acid
sequence(s). In some embodiments, the nucleic acid molecule
comprises a nucleotide sequence that encodes a V.sub.L amino acid
sequence comprising 1, 2, 3, 4 or 5 conservative amino acid
substitutions and/or 1, 2, or 3 non-conservative substitutions
compared to germline V.sub.K and J.sub.K sequences. Substitutions
may be in the CDR regions, the framework regions, or in the
constant domain.
[0270] In some embodiments, the nucleic acid molecule encodes a
V.sub.L amino acid sequence comprising one or more mutations
compared to the germline sequence that are identical to the
mutations from germline found in the V.sub.L of any one of
antibodies 1.sub.--116.sub.--1, 1.sub.--136.sub.--3,
1.sub.--257.sub.--1, 1.sub.--46.sub.--1, 2.sub.--112.sub.--,
1.sub.--314.sub.--1, 1.sub.--66.sub.--1, 2.sub.--43.sub.--1,
2.sub.--177.sub.--1, 1.sub.--132.sub.--1, 1.sub.--268.sub.--1,
1.sub.--116.sub.--1L-Q45K; 1.sub.--257.sub.--1L-L21I;
1.sub.--314.sub.--1H-T92A; 1.sub.--46.sub.--1H-L81M;
2.sub.--112.sub.--1H-I12V; 2.sub.--112.sub.--1L-F58I;
2.sub.--112.sub.--1L-I85V; 2.sub.--112.sub.--1H-L81M, L-F58I;
2.sub.--112.sub.--1H-L81M, L-I85V; or 2.sub.--112.sub.--1H-L81M,
L-F58I, I85V.
[0271] In some embodiments, the nucleic acid molecule encodes at
least three amino acid substitutions compared to the germline
sequence found in the V.sub.L of any one of the antibodies
1.sub.--116.sub.--1, 1.sub.--136.sub.--3, 1.sub.--257.sub.--1,
1.sub.--46.sub.--1, 2.sub.--112.sub.--, 1.sub.--314.sub.--1,
1.sub.--66.sub.--1, 2.sub.--43.sub.--1, 2.sub.--177.sub.--1,
1.sub.--132.sub.--1, 1.sub.--268.sub.--1,
1.sub.--116.sub.--1L-Q45K; 1.sub.--257.sub.--1L-L21I;
1.sub.--314.sub.--1H-T92A; 1.sub.--46.sub.--1H-L81M;
2.sub.--112.sub.--1H-I12V; 2.sub.--112.sub.--1L-F58I;
2.sub.--112.sub.--1L-I85V; 2.sub.--112.sub.--1H-L81M, L-F58I;
2.sub.--112.sub.--1H-L81M, L-I85V; or 2.sub.--112.sub.--1H-L81M,
L-F58I, I85V.
[0272] In some embodiments, the nucleic acid molecule comprises a
nucleotide sequence that encodes the V.sub.L amino acid sequence of
monoclonal antibody 1.sub.--116.sub.--1 (SEQ ID NO: 4);
1.sub.--136.sub.--3 (SEQ ID NO: 12); 1.sub.--257.sub.--1 (SEQ ID
NO: 16); 1.sub.--46.sub.--1 (SEQ ID NO: 24); 2.sub.--112.sub.--1
(SEQ ID NO: 28); 1.sub.--314.sub.--1 (SEQ ID NO: 20-_);
1.sub.--66.sub.--1 (SEQ ID NO: 36); 2.sub.--43.sub.--1 (SEQ ID NO:
28); 2.sub.--177.sub.--1 (SEQ ID NO: 40); 1.sub.--132.sub.--1 (SEQ
ID NO: 8); or 1.sub.--268.sub.--1 (SEQ ID NO: 32) or a variant or
portion thereof. In some embodiments, the nucleic acid encodes an
amino acid sequence comprising the light chain CDRs of one of said
above-listed antibodies. In some embodiments, said portion is a
contiguous portion comprising CDR1-CDR3.
[0273] In some embodiments, the nucleic acid molecule comprises a
nucleotide sequence that encodes the amino acid sequence of one of
SEQ ID NOs: 4, 8, 12, 16, 20, 24, 28, 32, 36, 40, 44, 47, 51, 55,
59, 63, 67, 71, 75, 79, 83 or 87. In some embodiments, the nucleic
acid molecule comprises the nucleotide sequence of SEQ ID NOs: 3,
7, 11, 15, 19, 23, 27, 31, 35, 39, 43, 48, 52, 56, 60, 68, 72, 80,
64, 76, 84 or 88 or a portion thereof. In some embodiments, the
nucleic acid encodes the amino acid sequence of the light chain of
one, two or all three CDRs of said antibody. In some embodiments,
said portion encodes a contiguous region from CDR1-CDR3 of the
light chain of an anti-myostatin antibody.
[0274] In some embodiments, the nucleic acid molecule encodes a
V.sub.L amino acid sequence that is at least 70%, 75%, 80%, 85%,
90%, 95%, 97%, 98% or 99% identical to the V.sub.L amino acid
sequence of any one of antibodies 1.sub.--116.sub.--1,
1.sub.--136.sub.--3, 1.sub.--257.sub.--1, 1.sub.--46.sub.--1,
2.sub.--112.sub.--1, 1.sub.--314.sub.--1, 1.sub.--66.sub.--1,
2.sub.--43.sub.--1, 2.sub.--177.sub.--1, 1.sub.--132.sub.--1,
1.sub.--268.sub.--1, 1.sub.--116.sub.--1L-Q45K;
1.sub.--257.sub.--1L-L21I; 1.sub.--314.sub.--1H-T92A;
1.sub.--46.sub.--1H-L81M; 2.sub.--112.sub.--1H-I12V;
2.sub.--112.sub.--1L-F58I; 2.sub.--112.sub.--1L-I85V; or
2.sub.--112.sub.--1H-L81M, L-F58I; 2.sub.--112.sub.--1H-L81M,
L-I85V; or 2.sub.--112.sub.--1H-L81M, L-F58I, I85V, or to the amino
acid sequence of the V.sub.L region of any one of SEQ ID NOs: 4, 8,
12, 16, 20, 24, 28, 32, 36, 40, 44, 47, 51, 55, 59, 63, 67, 71, 75,
79, 83 or 87. Nucleic acid molecules of the invention include
nucleic acids that hybridize under highly stringent conditions,
such as those described above, or that are at least 70%, 75%, 80%,
85%, 90%, 95%, 97%, 98% or 99% identical to a nucleic acid encoding
the amino acid sequence the V.sub.L region of SEQ ID NOs: 4, 8, 12,
16, 20, 24, 28, 32, 36, 40, 44, 47, 51, 55, 59, 63, 67, 71, 75, 79,
83 or 87 or to a nucleic acid comprising the V.sub.L region
nucleotide sequence of SEQ ID NOs: 3, 7, 11, 15, 19, 23, 27, 31,
35, 39, 43, 48, 52, 56, 60, 68, 72, 80, 64, 76, 84 or 88
[0275] In other preferred embodiments, the nucleic acid molecule
encodes the variable domain of a heavy chain (V.sub.H) that
utilizes a human 1-02, 3-21 or 3-23 V.sub.H gene sequence or a
sequence derived therefrom. In various embodiments, the nucleic
acid molecule utilizes a human V.sub.H 1-02 gene, a D4-23 gene and
a human J.sub.H6b gene; a human V.sub.H 3-21 gene, a human D3-16 or
D5-12 gene and a human J.sub.H6b gene; a human V.sub.H 3-21 gene, a
human D1-26 or D5-5 gene and a human J.sub.H4b gene; a human
V.sub.H 3-23 gene, a human D1-7 gene and a human J.sub.H3b
gene.
[0276] In some embodiments, the nucleic acid molecule encodes an
amino acid sequence comprising 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or 11
mutations compared to the germline amino acid sequence of the human
V, D or J genes. In some embodiments, said mutations are in the
V.sub.H region. In some embodiments, said mutations are in the CDR
regions.
[0277] In some embodiments, the nucleic acid molecule encodes a
V.sub.H sequence comprising one or more amino acid mutations
compared to the germline V.sub.H sequence that are identical to
amino acid mutations found in the V.sub.H of monoclonal antibody
1.sub.--116.sub.--1, 1.sub.--136.sub.--3, 1.sub.--257.sub.--1,
1.sub.--46.sub.--1, 2.sub.--112.sub.--, 1.sub.--314.sub.--1,
1.sub.--66.sub.--1, 2.sub.--43.sub.--1, 2.sub.--177.sub.--1,
1.sub.--132.sub.--1, 1.sub.--268.sub.--1,
1.sub.--116.sub.--1L-Q45K; 1.sub.--257.sub.--1L-L21I;
1.sub.--314.sub.--1H-T92A; 1.sub.--46.sub.--1H-L81M;
2.sub.--112.sub.--1H-I12V; 2.sub.--112.sub.--1L-F58I;
2.sub.--112.sub.--1L-I85V; 2.sub.--112.sub.--1H-L81M, L-F58I;
2.sub.--112.sub.--1H-L81M, L-I85V; or 2.sub.--112.sub.--1H-L81M,
L-F58I, I85V. In some embodiments, the nucleic acid encodes at
least three amino acid mutations compared to the germline sequences
that are identical to at least three amino acid mutations found in
one of the above-listed monoclonal antibodies.
[0278] In some embodiments, the nucleic acid molecule comprises a
nucleotide sequence that encodes at least a portion of the V.sub.H
amino acid sequence of a monoclonal antibody selected from
1.sub.--116.sub.--1 (SEQ ID NO: 2); 1.sub.--136.sub.--3 (SEQ ID NO:
10); 1.sub.--257.sub.--1 (SEQ ID NO: 14); 1.sub.--46.sub.--1 (SEQ
ID NO: 22); 2.sub.--112.sub.--1 (SEQ ID NO: 26);
1.sub.--314.sub.--1 (SEQ ID NO: 18); 1.sub.--66.sub.--1 (SEQ ID NO:
34); 2.sub.--43.sub.--1 (SEQ ID NO: 42); 2.sub.--177.sub.--1 (SEQ
ID NO: 38); 1.sub.--132.sub.--1 (SEQ ID NO: 6); or
1.sub.--268.sub.--1 (SEQ ID NO: 30), a variant thereof, or said
sequence having conservative amino acid mutations and/or a total of
three or fewer non-conservative amino acid substitutions. In
various embodiments the sequence encodes one or more CDR regions,
preferably a CDR3 region, all three CDR regions, a contiguous
portion including CDR1-CDR3, or the entire V.sub.H region, of an
above-listed anti-myostatin antibody.
[0279] In some embodiments, the nucleic acid molecule comprises a
nucleotide sequence that encodes the amino acid sequence of one of
SEQ ID NOs: 2, 6, 10, 14, 18, 22, 26, 30, 34, 38, 42, 45, 49, 53,
57, 61, 65, 69, 73, 77, 81 or 85. In various preferred embodiments,
the nucleic acid molecule comprises at least a portion of the
nucleotide sequence of SEQ ID NOS: 1, 5, 9, 13, 17, 21, 25, 29, 33,
37, 41, 46, 50, 54, 58, 62, 66, 70, 74, 78, 82 or 86. In some
embodiments, said portion encodes the V.sub.H region, a CDR3
region, all three CDR regions, or a contiguous region including
CDR1-CDR3.
[0280] In some embodiments, the nucleic acid molecule encodes a
V.sub.H amino acid sequence that is at least 70%, 75%, 80%, 85%,
90%, 95%, 97%, 98% or 99% identical to the V.sub.H amino acid
sequence in any one of SEQ ID NOS: 2, 6, 10, 14, 18, 22, 26, 30,
34, 38, 42, 45, 49, 53, 57, 61, 65, 69, 73, 77, 81 or 85. Nucleic
acid molecules of the invention include nucleic acids that
hybridize under highly stringent conditions, such as those
described above, or that are at least 70%, 75%, 80%, 85%, 90%, 95%,
97%, 98% or 99% identical to a nucleic acid encoding the amino acid
sequence of SEQ ID NO: 2, 6, 10, 14, 18, 22, 26, 30, 34, 38 or 42
or to a V.sub.H region thereof, or to a nucleic acid comprising the
nucleotide sequence of SEQ ID NOs: 1, 5, 9, 13, 17, 21, 25, 29, 33,
37 or 41 or the nucleotide sequence that encodes a V.sub.H region
thereof.
[0281] In another embodiment, the nucleic acid encodes a
full-length heavy chain of an antibody selected from
1.sub.--116.sub.--1, 1.sub.--136.sub.--3, 1.sub.--257.sub.--1,
1.sub.--46.sub.--1, 2.sub.--112.sub.--, 1.sub.--314.sub.--1,
1.sub.--66.sub.--1, 2.sub.--43.sub.--1, 2.sub.--177.sub.--1,
1.sub.--132.sub.--1, 1.sub.--268.sub.--1,
1.sub.--116.sub.--1L-Q45K; 1.sub.--257.sub.--1L-L21I;
1.sub.--314.sub.--1H-T92A; 1.sub.--46.sub.--1H-L81M;
2.sub.--112.sub.--1H-I12V; 2.sub.--112.sub.--1L-F58I;
2.sub.--112.sub.--1L-I85V; 2.sub.--112.sub.--1H-L81M, L-F58I;
2.sub.--112.sub.--1H-L81M, L-I85V; or 2.sub.--112.sub.--1H-L81M,
L-F58I, I85V, or a heavy chain comprising the amino acid sequence
of SEQ ID NOs: 2, 6, 10, 14, 18, 22, 26, 30, 34, 38 or 42. Further,
the nucleic acid may comprise the nucleotide sequence of SEQ ID
NOs: 1, 5, 9, 13, 17, 21, 25, 29, 33, 37 or 41.
[0282] A nucleic acid molecule encoding the heavy or light chain of
an anti-myostatin antibody or portions thereof can be isolated from
any source that produces such antibody. In various embodiments, the
nucleic acid molecules are isolated from a B cell that expresses an
anti-myostatin antibody isolated from an animal immunized with
myostatin or from an immortalized cell derived from such a B cell.
Methods of isolating nucleic acids encoding an antibody are
well-known in the art. See, e.g., Sambrook et al. mRNA may be
isolated and used to produce cDNA for use in the polymerase chain
reaction (PCR) or cDNA cloning of antibody genes. In a preferred
embodiment, the nucleic acid molecule is isolated from a hybridoma
that has as one of its fusion partners a cell from a non-human
transgenic animal, said cell producing a human immunoglobulin. In
an even more preferred embodiment, the cell producing human
immunoglobulin is isolated from a XENOMOUSE.RTM. animal. In another
embodiment, the cell producing the human immunoglobulin is isolated
from a non-human, non-mouse transgenic animal, as described above.
In another embodiment, the nucleic acid is isolated from a
non-human, non-transgenic animal. The nucleic acid molecules
isolated from a non-human, non-transgenic animal may be used, e.g.,
for humanized antibodies that comprise one or more amino acid
sequences from a human anti-myostatin antibody of the present
invention.
[0283] In some embodiments, a nucleic acid encoding a heavy chain
of an anti-myostatin antibody of the invention can comprise a
nucleotide sequence encoding a V.sub.H domain of the invention
joined in-frame to a nucleotide sequence encoding a heavy chain
constant domain from any source. Similarly, a nucleic acid molecule
encoding a light chain of an anti-myostatin antibody of the
invention can comprise a nucleotide sequence encoding a V.sub.L
domain of the invention joined in-frame to a nucleotide sequence
encoding a light chain constant domain from any source.
[0284] In a further aspect of the invention, nucleic acid molecules
encoding the variable domain of the heavy (V.sub.H) and/or light
(V.sub.L) chains are "converted" to full-length antibody genes. In
one embodiment, nucleic acid molecules encoding the V.sub.H or
V.sub.L domains are converted to full-length antibody genes by
insertion into an expression vector already encoding heavy chain
constant (C.sub.H) or light chain constant (C.sub.L) domains,
respectively, such that the V.sub.H segment is operatively linked
to the C.sub.H segment(s) within the vector, and/or the V.sub.L
segment is operatively linked to the C.sub.L segment within the
vector. In another embodiment, nucleic acid molecules encoding the
V.sub.H and/or V.sub.L domains are converted into full-length
antibody genes by linking, e.g., ligating, a nucleic acid molecule
encoding a V.sub.H and/or V.sub.L domains to a nucleic acid
molecule encoding a C.sub.H and/or C.sub.L domain using standard
molecular biological techniques. Nucleic acid sequences of human
heavy and light chain immunoglobulin constant domain genes are
known in the art. See, e.g., Kabat et al. Sequences of Proteins of
Immunological Interest, 5th Ed., NIH Publ. No. 91-3242, 1991.
Nucleic acid molecules encoding the full-length heavy and/or light
chains may then be expressed from a cell into which they have been
introduced and the anti-myostatin antibody isolated.
[0285] The nucleic acid molecules may be used to recombinantly
express large quantities of anti-myostatin antibodies. The nucleic
acid molecules also may be used to produce chimeric antibodies,
bispecific antibodies, single chain antibodies, immunoadhesins,
diabodies, mutated antibodies and antibody derivatives, as
described further below. If the nucleic acid molecules are derived
from a non-human, non-transgenic animal, the nucleic acid molecules
may be used for antibody humanization, also as described below.
[0286] In another embodiment, a nucleic acid molecule of the
invention is used as a probe or PCR primer for a specific antibody
sequence. For instance, the nucleic acid can be used as a probe in
diagnostic methods or as a PCR primer to amplify regions of DNA
that could be used, inter alia, to isolate additional nucleic acid
molecules encoding variable domains of anti-myostatin antibodies.
In some embodiments, the nucleic acid molecules are
oligonucleotides. In some embodiments, the oligonucleotides are
from highly variable domains of the heavy and light chains of the
antibody of interest. In some embodiments, the oligonucleotides
encode all or a part of one or more of the CDRs of antibodies
1.sub.--116.sub.--1, 1.sub.--136.sub.--3, 1.sub.--257.sub.--1,
1.sub.--46.sub.--1, 2.sub.--112.sub.--, 1.sub.--314.sub.--1,
1.sub.--66.sub.--1, 2.sub.--43.sub.--1, 2.sub.--177.sub.--1,
1.sub.--132.sub.--1, 1.sub.--268.sub.--1,
1.sub.--116.sub.--1L-Q45K; 1.sub.--257.sub.--1L-L21I;
1.sub.--314.sub.--1H-T92A; 1.sub.--46.sub.--1H-L81M;
2.sub.--112.sub.--1H-I12V; 2.sub.--112.sub.--1L-F58I;
2.sub.--112.sub.--1L-I85V; 2.sub.--112.sub.--1H-L81M, L-F581; or
2.sub.--112.sub.--1H-L81M, L-I85V; or 2.sub.--112.sub.--1H-L81M,
L-F58I, I85V or variants thereof as described herein.
Vectors
[0287] The invention provides vectors comprising nucleic acid
molecules that encode the heavy chain of an anti-myostatin antibody
of the invention or an antigen-binding portion thereof. The
invention also provides vectors comprising nucleic acid molecules
that encode the light chain of such antibodies or antigen-binding
portion thereof. The invention further provides vectors comprising
nucleic acid molecules encoding fusion proteins, modified
antibodies, antibody fragments, and probes thereof.
[0288] In some embodiments, the anti-myostatin antibodies of the
invention or antigen-binding portions are expressed by inserting
DNAs encoding partial or full-length light and heavy chains,
obtained as described above, into expression vectors such that the
genes are operatively linked to necessary expression control
sequences such as transcriptional and translational control
sequences. Expression vectors include plasmids, retroviruses,
adenoviruses, adeno-associated viruses (AAV), plant viruses such as
cauliflower mosaic virus, tobacco mosaic virus, cosmids, YACs, EBV
derived episomes, and the like. The antibody gene is ligated into a
vector such that transcriptional and translational control
sequences within the vector serve their intended function of
regulating the transcription and translation of the antibody gene.
The expression vector and expression control sequences are chosen
to be compatible with the expression host cell used. The antibody
light chain gene and the antibody heavy chain gene can be inserted
into separate vectors. In a preferred embodiment, both genes are
inserted into the same expression vector. The antibody genes are
inserted into the expression vector by standard methods (e.g.,
ligation of complementary restriction sites on the antibody gene
fragment and vector, or blunt end ligation if no restriction sites
are present).
[0289] A convenient vector is one that encodes a functionally
complete human C.sub.H or C.sub.L immunoglobulin sequence, with
appropriate restriction sites engineered so that any V.sub.H or
V.sub.L sequence can easily be inserted and expressed, as described
above. In such vectors, splicing usually occurs between the splice
donor site in the inserted J region and the splice acceptor site
preceding the human C domain, and also at the splice regions that
occur within the human C.sub.H exons. Polyadenylation and
transcription termination occur at native chromosomal sites
downstream of the coding regions. The recombinant expression vector
also can encode a signal peptide that facilitates secretion of the
antibody chain from a host cell. The antibody chain gene may be
cloned into the vector such that the signal peptide is linked
in-frame to the amino terminus of the immunoglobulin chain. The
signal peptide can be an immunoglobulin signal peptide or a
heterologous signal peptide (i.e., a signal peptide from a
non-immunoglobulin protein).
[0290] In addition to the antibody chain genes, the recombinant
expression vectors of the invention carry regulatory sequences that
control the expression of the antibody chain genes in a host cell.
It will be appreciated by those skilled in the art that the design
of the expression vector, including the selection of regulatory
sequences may depend on such factors as the choice of the host cell
to be transformed, the level of expression of protein desired, etc.
Preferred regulatory sequences for mammalian host cell expression
include viral elements that direct high levels of protein
expression in mammalian cells, such as promoters and/or enhancers
derived from retroviral LTRs, cytomegalovirus (CMV) (such as the
CMV promoter/enhancer), Simian Virus 40 (SV40) (such as the SV40
promoter/enhancer), adenovirus, (e.g., the adenovirus major late
promoter (AdMLP)), polyoma and strong mammalian promoters such as
native immunoglobulin and actin promoters. For further description
of viral regulatory elements, and sequences thereof, see e.g., U.S.
Pat. No. 5,168,062, U.S. Pat. No. 4,510,245 and U.S. Pat. No.
4,968,615. Methods for expressing antibodies in plants, including a
description of promoters and vectors, as well as transformation of
plants is known in the art. See, e.g., U.S. Pat. No. 6,517,529,
incorporated herein by reference. Methods of expressing
polypeptides in bacterial cells or fungal cells, e.g., yeast cells,
are also well known in the art.
[0291] In addition to the antibody chain genes and regulatory
sequences, the recombinant expression vectors of the invention may
carry additional sequences, such as sequences that regulate
replication of the vector in host cells (e.g., origins of
replication) and selectable marker genes. The selectable marker
gene facilitates selection of host cells into which the vector has
been introduced (see e.g., U.S. Pat. Nos. 4,399,216, 4,634,665 and
5,179,017, incorporated herein by reference). For example,
typically the selectable marker gene confers resistance to drugs,
such as G418, hygromycin or methotrexate, on a host cell into which
the vector has been introduced. Preferred selectable marker genes
include the dihydrofolate reductase (DHFR) gene (for use in
dhfr-host cells with methotrexate selection/amplification), the neo
gene (for G418 selection), and the glutamate synthetase gene.
Non-Hybridoma Host Cells and Methods of Recombinantly Producing
Protein
[0292] Nucleic acid molecules encoding anti-myostatin antibodies
and vectors comprising these nucleic acid molecules can be used for
transfection of a suitable mammalian, plant, bacterial or yeast
host cell. Transformation can be by any known method for
introducing polynucleotides into a host cell. Methods for
introduction of heterologous polynucleotides into mammalian cells
are well known in the art and include dextran-mediated
transfection, calcium phosphate precipitation, polybrene-mediated
transfection, protoplast fusion, electroporation, encapsulation of
the polynucleotide(s) in liposomes, and direct microinjection of
the DNA into nuclei. In addition, nucleic acid molecules may be
introduced into mammalian cells by viral vectors. Methods of
transforming cells are well known in the art. See, e.g., U.S. Pat.
Nos. 4,399,216, 4,912,040, 4,740,461, and 4,959,455, incorporated
herein by reference). Methods of transforming plant cells are well
known in the art, including, e.g., Agrobacterium-mediated
transformation, biolistic transformation, direct injection,
electroporation and viral transformation. Methods of transforming
bacterial and yeast cells are also well known in the art.
[0293] Mammalian cell lines available as hosts for expression are
well known in the art and include many immortalized cell lines
available from the American Type Culture Collection (ATCC). These
include, inter alia, Chinese hamster ovary (CHO) cells, NS0 cells,
SP2 cells, HEK-293T cells, NIH-3T3 cells, HeLa cells, baby hamster
kidney (BHK) cells, African green monkey kidney cells (COS), human
hepatocellular carcinoma cells (e.g., Hep G2), A549 cells, and a
number of other cell lines. Cell lines of particular preference are
selected through determining which cell lines have high expression
levels.
[0294] Cell lines other than those of mammalian origin can also be
used. These include insect cell lines (such as Sf9 or Sf21 cells),
plant cells (including those from Nicotiana, Arabidopsis, duckweed,
corn, wheat, potato, etc.), bacterial cells (including E. coli and
Streptomyces) and yeast cells (including Schizosaccharomyces pombe,
Saccharomyces cerevisiae and Pichia pastoris).
[0295] When recombinant expression vectors encoding antibody genes
are introduced into host cells, the antibodies are produced by
culturing the host cells for a period of time sufficient to allow
for expression of the antibody in the host cells or, more
preferably, secretion of the antibody into the culture medium in
which the host cells are grown. Antibodies can be recovered from
the culture medium using standard protein purification methods.
[0296] Expression of antibodies of the invention from production
cell lines can be enhanced using a number of known techniques. For
example, the glutamine synthetase gene expression system (the GS
system) is a common approach for enhancing expression under certain
conditions. The GS system is discussed in whole or part in
connection with European Patent Nos. 0 216 846, 0 256 055, 0 323
997 and 0 338 841.
[0297] It is likely that antibodies expressed by different cell
lines or in transgenic animals will have different glycosylation
from each other. However, all antibodies encoded by the nucleic
acid molecules provided herein, or comprising the amino acid
sequences provided herein are part of the instant invention,
regardless of the glycosylation of the antibodies.
Transgenic Animals and Plants
[0298] Anti-myostatin antibodies of the invention also can be
produced transgenically through the generation of a mammal or plant
that is transgenic for the immunoglobulin heavy and light chain
sequences of interest and production of the antibody in a
recoverable form therefrom. In connection with the transgenic
production in mammals, anti-myostatin antibodies can be produced
in, and recovered from, the milk of goats, cows, or other mammals.
See, e.g., U.S. Pat. Nos. 5,827,690, 5,756,687, 5,750,172, and
5,741,957, incorporated herein by reference. In some embodiments,
non-human transgenic animals that comprise human immunoglobulin
loci are immunized with myostatin or an immunogenic portion
thereof, as described above. Methods for making antibodies in
plants are described, e.g., in U.S. Pat. Nos. 6,046,037 and
5,959,177, incorporated herein by reference.
[0299] In some embodiments, non-human transgenic animals or plants
are produced by introducing one or more nucleic acid molecules
encoding an anti-myostatin antibody of the invention into the
animal or plant by standard transgenic techniques. See Hogan and
U.S. Pat. No. 6,417,429, supra. The transgenic cells used for
making the transgenic animal can be embryonic stem cells or somatic
cells or a fertilized egg. The transgenic non-human organisms can
be chimeric, nonchimeric heterozygotes, and nonchimeric
homozygotes. See, e.g., Hogan et al., Manipulating the Mouse
Embryo: A Laboratory Manual 2.sup.nd ed., Cold Spring Harbor Press
(1999); Jackson et al., Mouse Genetics and Transgenics: A Practical
Approach, Oxford University Press (2000); and Pinkert Transgenic
Animal Technology: A Laboratory Handbook, Academic Press (1999),
all incorporated herein by reference. In some embodiments, the
transgenic non-human animals have a targeted disruption and
replacement by a targeting construct that encodes a heavy chain
and/or a light chain of interest. In a preferred embodiment, the
transgenic animals comprise and express nucleic acid molecules
encoding heavy and light chains that specifically bind to
myostatin, preferably human myostatin. In some embodiments, the
transgenic animals comprise nucleic acid molecules encoding a
modified antibody such as a single-chain antibody, a chimeric
antibody or a humanized antibody. The anti-myostatin antibodies may
be made in any transgenic animal. In a preferred embodiment, the
non-human animals are mice, rats, sheep, pigs, goats, cattle or
horses. The non-human transgenic animal expresses said encoded
polypeptides in blood, milk, urine, saliva, tears, mucus and other
bodily fluids.
Phage Display Libraries
[0300] The invention provides a method for producing an
anti-myostatin antibody or antigen-binding portion thereof
comprising the steps of synthesizing a library of human antibodies
on phage, screening the library with myostatin or an
antibody-binding portion thereof, isolating phage that bind
myostatin, and obtaining the antibody from the phage. By way of
example, one method for preparing the library of antibodies for use
in phage display techniques comprises the steps of immunizing a
non-human animal comprising human immunoglobulin loci with
myostatin or an antigenic portion thereof to create an immune
response, extracting antibody-producing cells from the immunized
animal; isolating RNA encoding heavy and light chains of antibodies
of the invention from the extracted cells, reverse transcribing the
RNA to produce cDNA, amplifying the cDNA using primers, and
inserting the cDNA into a phage display vector such that antibodies
are expressed on the phage. Recombinant anti-myostatin antibodies
of the invention may be obtained in this way.
[0301] Recombinant human anti-myostatin antibodies of the invention
can be isolated by screening a recombinant combinatorial antibody
library. Preferably the library is a scFv phage display library,
generated using human V.sub.L and V.sub.H cDNAs prepared from mRNA
isolated from B cells. Methods for preparing and screening such
libraries are known in the art. Kits for generating phage display
libraries are commercially available (e.g., the Pharmacia
Recombinant Phage Antibody System, catalog no. 27-9400-01; and the
Stratagene SURFZAP phage display kit, catalog no. 240612). There
also are other methods and reagents that can be used in generating
and screening antibody display libraries (see, e.g., U.S. Pat. No.
5,223,409; PCT Publication Nos. WO 92/18619, WO 91/17271, WO
92/20791, WO 92/15679, WO 93/01288, WO 92/01047, WO 92/09690; Fuchs
et al., Bio/Technology 9:1370-1372 (1991); Hay et al., Hum.
Antibod. Hybridomas 3:81-85 (1992); Huse et al., Science
246:1275-1281 (1989); McCafferty et al., Nature 348:552-554 (1990);
Griffiths et al., EMBO J. 12:725-734 (1993); Hawkins et al., J.
Mol. Biol. 226:889-896 (1992); Clackson et al., Nature 352:624-628
(1991); Gram et al., Proc. Natl. Acad. Sci. USA 89:3576-3580
(1992); Garrad et al., Bio/Technology 9:1373-1377 (1991); Hoogen
boom et al., Nuc. Acid Res. 19:4133-4137 (1991); and Barbas et al.,
Proc. Natl. Acad. Sci. USA 88:7978-7982 (1991), all incorporated
herein by reference.
[0302] In one embodiment, to isolate and produce human
anti-myostatin antibodies with the desired characteristics, a human
anti-myostatin antibody as described herein is first used to select
human heavy and light chain sequences having similar binding
activity toward myostatin, using the epitope imprinting methods
described in PCT Publication No. WO 93/06213, incorporated herein
by reference. The antibody libraries used in this method are
preferably scFv libraries prepared and screened as described in PCT
Publication No. WO 92/01047, McCafferty et al., Nature 348:552-554
(1990); and Griffiths et al., EMBO J. 12:725-734 (1993), all
incorporated herein by reference. The scFv antibody libraries
preferably are screened using human myostatin as the antigen.
[0303] Once initial human V.sub.L and V.sub.H domains are selected,
"mix and match" experiments are performed, in which different pairs
of the initially selected V.sub.L and V.sub.H segments are screened
for myostatin binding to select preferred V.sub.L/V.sub.H pair
combinations. Additionally, to further improve the quality of the
antibody, the V.sub.L and V.sub.H segments of the preferred
V.sub.L/V.sub.H pair(s) can be randomly mutated, preferably within
the CDR3 region of V.sub.H and/or V.sub.L, in a process analogous
to the in vivo somatic mutation process responsible for affinity
maturation of antibodies during a natural immune response. This in
vitro affinity maturation can be accomplished by amplifying V.sub.H
and V.sub.L domains using PCR primers complimentary to the V.sub.H
CDR3 or V.sub.L CDR3, respectively, which primers have been
"spiked" with a random mixture of the four nucleotide bases at
certain positions such that the resultant PCR products encode
V.sub.H and V.sub.L segments into which random mutations have been
introduced into the V.sub.H and/or V.sub.L CDR3 regions. These
randomly mutated V.sub.H and V.sub.L segments can be re-screened
for binding to myostatin.
[0304] Following screening and isolation of an anti-myostatin
antibody of the invention from a recombinant immunoglobulin display
library, nucleic acids encoding the selected antibody can be
recovered from the display package (e.g., from the phage genome)
and subcloned into other expression vectors by standard recombinant
DNA techniques. If desired, the nucleic acid can further be
manipulated to create other antibody forms of the invention, as
described below. To express a recombinant human antibody isolated
by screening of a combinatorial library, the DNA encoding the
antibody is cloned into a recombinant expression vector and
introduced into a mammalian host cells, as described above.
Class Switching
[0305] Another aspect of the invention provides a method for
converting the class or subclass of an anti-myostatin antibody to
another class or subclass. In some embodiments, a nucleic acid
molecule encoding a V.sub.L or V.sub.H that does not include
sequences encoding C.sub.L or C.sub.H is isolated using methods
well-known in the art. The nucleic acid molecule then is
operatively linked to a nucleic acid sequence encoding a C.sub.L or
C.sub.H from a desired immunoglobulin class or subclass. This can
be achieved using a vector or nucleic acid molecule that comprises
a C.sub.L or C.sub.H chain, as described above. For example, an
anti-myostatin antibody that was originally IgM can be class
switched to an IgG. Further, the class switching may be used to
convert one IgG subclass to another, e.g., from IgG1 to IgG2.
Another method for producing an antibody of the invention
comprising a desired isotype comprises the steps of isolating a
nucleic acid encoding a heavy chain of an anti-myostatin antibody
and a nucleic acid encoding a light chain of an anti-myostatin
antibody, isolating the sequence encoding the V.sub.H region,
ligating the V.sub.H sequence to a sequence encoding a heavy chain
constant domain of the desired isotype, expressing the light chain
gene and the heavy chain construct in a cell, and collecting the
anti-myostatin antibody with the desired isotype.
Deimmunized Antibodies
[0306] In another aspect of the invention, the antibody may be
deimmunized to reduce its immunogenicity using the techniques
described in, e.g., PCT Publication Nos. WO98/52976 and WO00/34317
(incorporated herein by reference).
Mutated Antibodies
[0307] In another embodiment, the nucleic acid molecules, vectors
and host cells may be used to make mutated anti-myostatin
antibodies. The antibodies may be mutated in the variable domains
of the heavy and/or light chains, e.g., to alter a binding property
of the antibody. For example, a mutation may be made in one or more
of the CDR regions to increase or decrease the K.sub.D of the
antibody for myostatin, to increase or decrease k.sub.off, or to
alter the binding specificity of the antibody. Techniques in
site-directed mutagenesis are well-known in the art. See, e.g.,
Sambrook et al. and Ausubel et al., supra. In another embodiment,
one or more mutations are made at an amino acid residue that is
known to be changed compared to the germline in monoclonal antibody
1.sub.--116.sub.--1, 1.sub.--136.sub.--3, 1.sub.--257.sub.--1,
1.sub.--46.sub.--1, 2.sub.--112.sub.--, 1.sub.--314.sub.--1,
1.sub.--66.sub.--1, 2.sub.--43.sub.--1, 2.sub.--177.sub.--1,
1.sub.--132.sub.--1, 1.sub.--268.sub.--1,
1.sub.--116.sub.--1L-Q45K; 1.sub.--257.sub.--1L-L21I;
1.sub.--314.sub.--1H-T92A; 1.sub.--46.sub.--1H-L81M;
2.sub.--112.sub.--1H-I12V; 2.sub.--112.sub.--1L-F58I;
2.sub.--112.sub.--1L-I85V; 2.sub.--112.sub.--1H-L81M, L-F58I;
2.sub.--112.sub.--1H-L81M, L-I85V; or 2.sub.--112.sub.--1H-L81M,
L-F58I, I85V. The mutations may be made in a CDR region or
framework region of a variable domain, or in a constant domain. In
a preferred embodiment, the mutations are made in a variable
domain. In some embodiments, one or more mutations are made at an
amino acid residue that is known to be changed compared to the
germline in a CDR region or framework region of a variable domain
of an amino acid sequence selected from SEQ ID NO: 2, 4, 6, 8, 10,
12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44,
45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77,
79, 81, 83, 85 or 87 or whose nucleic acid sequence is presented in
SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29,
31, 33, 35, 37, 39, 41, 43, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64,
66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86 or 88.
[0308] In another embodiment, the framework region is mutated so
that the resulting framework region(s) have the amino acid sequence
of the corresponding germline gene. A mutation may be made in a
framework region or constant domain to increase the half-life of
the anti-myostatin antibody. See, e.g., PCT Publication No. WO
00/09560, incorporated herein by reference. A mutation in a
framework region or constant domain also can be made to alter the
immunogenicity of the antibody, to provide a site for covalent or
non-covalent binding to another molecule, or to alter such
properties as complement fixation, FcR binding and
antibody-dependent cell-mediated cytotoxicity (ADCC). According to
the invention, a single antibody may have mutations in any one or
more of the CDRs or framework regions of the variable domain or in
the constant domain.
[0309] In some embodiments, there are from 1 to 8, including any
number in between, amino acid mutations in either the V.sub.H or
V.sub.L domains of the mutated anti-myostatin antibody compared to
the anti-myostatin antibody prior to mutation. In any of the above,
the mutations may occur in one or more CDR regions. Further, any of
the mutations can be conservative amino acid substitutions. In some
embodiments, there are no more than 5, 4, 3, 2, or 1 amino acid
changes in the constant domains.
Modified Antibodies
[0310] In another embodiment, a fusion antibody or immunoadhesin
may be made that comprises all or a portion of an anti-myostatin
antibody of the invention linked to another polypeptide. In a
preferred embodiment, only the variable domains of the
anti-myostatin antibody are linked to the polypeptide. In another
preferred embodiment, the V.sub.H domain of an anti-myostatin
antibody is linked to a first polypeptide, while the V.sub.L domain
of an anti-myostatin antibody is linked to a second polypeptide
that associates with the first polypeptide in a manner such that
the V.sub.H and V.sub.L domains can interact with one another to
form an antigen binding site. In another preferred embodiment, the
V.sub.H domain is separated from the V.sub.L domain by a linker
such that the V.sub.H and V.sub.L domains can interact with one
another (see below under Single Chain Antibodies). The
V.sub.H-linker-V.sub.L antibody is then linked to the polypeptide
of interest. In addition, fusion antibodies can be created in which
two (or more) single-chain antibodies are linked to one another.
This is useful if one wants to create a divalent or polyvalent
antibody on a single polypeptide chain, or if one wants to create a
bispecific antibody.
[0311] To create a single chain antibody, (scFv) the V.sub.H- and
V.sub.L-encoding DNA fragments are operatively linked to another
fragment encoding a flexible linker, e.g., encoding the amino acid
sequence (Gly.sub.4-Ser).sub.3, (SEQ ID NO:122) such that the
V.sub.H and V.sub.L sequences can be expressed as a contiguous
single-chain protein, with the V.sub.L and V.sub.H domains joined
by the flexible linker. See, e.g., Bird et al., Science 242:423-426
(1988); Huston et al., Proc. Natl. Acad. Sci. USA 85:5879-5883
(1988); McCafferty et al., Nature 348:552-554 (1990). The single
chain antibody may be monovalent, if only a single V.sub.H and
V.sub.L are used, bivalent, if two V.sub.H and V.sub.L are used, or
polyvalent, if more than two V.sub.H and V.sub.L are used.
Bispecific or polyvalent antibodies may be generated that bind
specifically to myostatin and to another molecule.
[0312] In other embodiments, other modified antibodies may be
prepared using anti-myostatin antibody encoding nucleic acid
molecules. For instance, "Kappa bodies" (III et al., Protein Eng.
10: 949-57 (1997)), "Minibodies" (Martin et al., EMBO J. 13: 5303-9
(1994)), "Diabodies" (Holliger et al., Proc. Natl. Acad. Sci. USA
90: 6444-6448 (1993)), or "Janusins" (Traunecker et al., EMBO J.
10:3655-3659 (1991) and Traunecker et al., Int. J. Cancer (Suppl.)
7:51-52 (1992)) may be prepared using standard molecular biological
techniques following the teachings of the specification.
[0313] Bispecific antibodies or antigen-binding fragments can be
produced by a variety of methods including fusion of hybridomas or
linking of Fab' fragments. See, e.g., Songsivilai & Lachmann,
Clin. Exp. Immunol. 79: 315-321 (1990), Kostelny et al., J.
Immunol. 148:1547-1553 (1992). In addition, bispecific antibodies
may be formed as "diabodies" or "Janusins." In some embodiments,
the bispecific antibody binds to two different epitopes of
myostatin. In some embodiments, the bispecific antibody has a first
heavy chain and a first light chain from monoclonal antibody
1.sub.--116.sub.--1, 1.sub.--136.sub.--3, 1.sub.--257.sub.--1,
1.sub.--46.sub.--1, 2.sub.--112.sub.--, 1.sub.--314.sub.--1,
1.sub.--66.sub.--1, 2.sub.--43.sub.--1, 2.sub.--177.sub.--1,
1.sub.--132.sub.--1, 1.sub.--268.sub.--1,
1.sub.--116.sub.--1L-Q45K; 1.sub.--257.sub.--1L-L21I;
1.sub.--314.sub.--1H-T92A; 1.sub.--46.sub.--1H-L81M;
2.sub.--112.sub.--1H-I12V; 2.sub.--112.sub.--1L-F58I;
2.sub.--112.sub.--1L-I85V; 2.sub.--112.sub.--1H-L81M, L-F58I;
2.sub.--112.sub.--1H-L81M, L-I85V; or 2.sub.--112.sub.--1H-L81M,
L-F58I, I85V and an additional antibody heavy chain and light
chain. In some embodiments, the additional light chain and heavy
chain also are from one of the above-identified monoclonal
antibodies, but are different from the first heavy and light
chains.
[0314] In some embodiments, the modified antibodies described above
are prepared using one or more of the variable domains or CDR
regions from a human anti-myostatin monoclonal antibody provided
herein.
Derivatized and Labeled Antibodies
[0315] An anti-myostatin antibody or antigen-binding portion of the
invention can be derivatized or linked to another molecule (e.g.,
another peptide or protein). In general, the antibodies or portion
thereof are derivatized such that the myostatin binding is not
affected adversely by the derivatization or labeling. Accordingly,
the antibodies and antibody portions of the invention are intended
to include both intact and modified forms of the human
anti-myostatin antibodies described herein. For example, an
antibody or antibody portion of the invention can be functionally
linked (by chemical coupling, genetic fusion, noncovalent
association or otherwise) to one or more other molecular entities,
such as another antibody (e.g., a bispecific antibody or a
diabody), a detection agent, a pharmaceutical agent, and/or a
protein or peptide that can mediate association of the antibody or
antibody portion with another molecule (such as a streptavidin core
region or a polyhistidine tag).
[0316] One type of derivatized antibody is produced by crosslinking
two or more antibodies (of the same type or of different types,
e.g., to create bispecific antibodies). Suitable crosslinkers
include those that are heterobifunctional, having two distinctly
reactive groups separated by an appropriate spacer (e.g.,
m-maleimidobenzoyl-N-hydroxysuccinimide ester) or homobifunctional
(e.g., disuccinimidyl suberate). Such linkers are available from
Pierce Chemical Company, Rockford, Ill.
[0317] Another type of derivatized antibody is a labeled antibody.
Useful detection agents with which an antibody or antigen-binding
portion of the invention may be derivatized include fluorescent
compounds, including fluorescein, fluorescein isothiocyanate,
rhodamine, 5-dimethylamine-1-napthalenesulfonyl chloride,
phycoerythrin, lanthanide phosphors and the like. An antibody can
also be labeled with enzymes that are useful for detection, such as
horseradish peroxidase, .beta.-galactosidase, luciferase, alkaline
phosphatase, glucose oxidase and the like. When an antibody is
labeled with a detectable enzyme, it is detected by adding
additional reagents that the enzyme uses to produce a reaction
product that can be discerned. For example, when the agent
horseradish peroxidase is present, the addition of hydrogen
peroxide and diaminobenzidine leads to a colored reaction product,
which is detectable. An antibody can also be labeled with biotin,
and detected through indirect measurement of avidin or streptavidin
binding. An antibody can also be labeled with a predetermined
polypeptide epitope recognized by a secondary reporter (e.g.,
leucine zipper pair sequences, binding sites for secondary
antibodies, metal binding domains, epitope tags). In some
embodiments, labels are attached by spacer arms of various lengths
to reduce potential steric hindrance.
[0318] An anti-myostatin antibody can also be derivatized with a
chemical group such as polyethylene glycol (PEG), a methyl or ethyl
group, or a carbohydrate group. These groups are useful to improve
the biological characteristics of the antibody, e.g., to increase
serum half-life.
Pharmaceutical Compositions and Kits
[0319] The invention also relates to compositions comprising a
human anti-myostatin antibody with inhibitory properties.
[0320] The antagonist anti-myostatin antibodies of the invention
are useful to prevent or treat a wide range of conditions and
disorders in which it is desirable to increase skeletal muscle mass
and/or bone. In some cases, such conditions and disorders may be
age related or disease related. An antagonist anti-myostatin
antibody of the invention may be used to treat, prevent or inhibit
age-related loss of muscle mass and strength including muscle
atrophy that results from, e.g., immobilization.
[0321] In addition, an antagonist anti-myostatin antibody of the
invention is useful to treat or prevent muscle loss in wasting
diseases or other diseases or conditions, associated with loss of
muscle mass including, but not limited to, trauma (including
muscle, nerve and bone trauma), burns, AIDS, cancer, hip fractures
(especially in the elderly), joint replacement, acute knee
injuries, arthritis, chronic renal failure (CRF), congestive heart
failure (CHF), chronic obstructive pulmonary disease (COPD),
multiple sclerosis (MS), Parkinson's Disease, chronic critical
illness, central nervous system (CNS) injury, stroke, cachexia,
muscular dystrophies syndrome, surgery and joint injury.
[0322] Antagonist anti-myostatin antibodies of the invention also
are useful to treat metabolic conditions. Such conditions include
type 2 diabetes mellitus, metabolic syndromes such as syndrome X,
insulin resistance, impaired glucose tolerance, and obesity.
[0323] Further, an antagonist anti-myostatin antibody of the
invention is useful to treat or prevent disorders associated with
bone loss, including but not limited to age- or hormone-related
osteoporosis osteopenia, osteoarthritis, and osteoporosis-related
fractures.
[0324] Treatment may involve administration of one or more
inhibitory anti-myostatin monoclonal antibodies of the invention,
or antigen-binding fragments thereof, alone or with a
pharmaceutically acceptable carrier. Inhibitory anti-myostatin
antibodies of the invention and compositions comprising them, can
be administered in combination with one or more other therapeutic,
diagnostic or prophylactic agents. Additional therapeutic agents
include anti-muscular dystrophy agents (including steroids such as
prednisone, deflazacort), and anabolic steroids, albuterol,
nutritional supplements such as creatine, and antibiotics such as
gentamycin. Additional therapeutic agents also include
anti-diabetes agents including but not limited to metformin,
sulfonylureas, insulin, SYMLIN.RTM. (pramlintide), TZDs such as
AVANDIA.RTM. (rosiglitazone) and ACTOS.RTM. (pioglitazone), GLP-1
analogs, such exenitide, and DPP-IV inhibitors, such as LAF237.
Further, additional therapeutic agents include anti-osteoporosis
agents including but not limit to bisphosphonates such as
FOSAMAX.RTM. (alendronate) and ACTONEL.RTM. (risedronate),
MIACALCIN.RTM. (calcitonin), EVISTA.RTM. (raloxifene), hormonal
agents such estrogen and parathyroid. Such additional agents may be
included in the same composition or administered separately. As
used herein, "pharmaceutically acceptable carrier" means any and
all solvents, dispersion media, coatings, antibacterial and
antifungal agents, isotonic and absorption delaying agents, and the
like that are physiologically compatible. Some examples of
pharmaceutically acceptable carriers are water, saline, phosphate
buffered saline, dextrose, glycerol, ethanol and the like, as well
as combinations thereof. In many cases, it will be preferable to
include isotonic agents, for example, sugars, polyalcohols such as
mannitol, sorbitol, or sodium chloride in the composition.
Additional examples of pharmaceutically acceptable substances are
wetting agents or minor amounts of auxiliary substances such as
wetting or emulsifying agents, preservatives or buffers, which
enhance the shelf life or effectiveness of the antibody.
[0325] The compositions of this invention may be in a variety of
forms, for example, liquid, semi-solid and solid dosage forms, such
as liquid solutions (e.g., injectable and infusible solutions),
dispersions or suspensions, tablets, pills, powders, liposomes and
suppositories. The preferred form depends on the intended mode of
administration and therapeutic application. Typical preferred
compositions are in the form of injectable or infusible solutions,
such as compositions similar to those used for passive immunization
of humans. The preferred mode of administration is parenteral
(e.g., intravenous, subcutaneous, intraperitoneal, intramuscular).
In a preferred embodiment, the antibody is administered by
intravenous infusion or injection. In another preferred embodiment,
the antibody is administered by intramuscular or subcutaneous
injection.
[0326] Therapeutic compositions typically must be sterile and
stable under the conditions of manufacture and storage. The
composition can be formulated as a solution, microemulsion,
dispersion, liposome, or other ordered structure suitable to high
drug concentration. Sterile injectable solutions can be prepared by
incorporating the anti-myostatin antibody in the required amount in
an appropriate solvent with one or a combination of ingredients
enumerated above, as required, followed by filtered sterilization.
Generally, dispersions are prepared by incorporating the active
compound into a sterile vehicle that contains a basic dispersion
medium and the required other ingredients from those enumerated
above. In the case of sterile powders for the preparation of
sterile injectable solutions, the preferred methods of preparation
are vacuum drying and freeze-drying that yields a powder of the
active ingredient plus any additional desired ingredient from a
previously sterile-filtered solution thereof. The proper fluidity
of a solution can be maintained, for example, by the use of a
coating such as lecithin, by the maintenance of the required
particle size in the case of dispersion and by the use of
surfactants. Prolonged absorption of injectable compositions can be
brought about by including in the composition an agent that delays
absorption, for example, monostearate salts and gelatin.
[0327] In one embodiment, the antibody is administered in a
formulation as a sterile aqueous solution having a pH that ranges
from about 5.0 to about 6.5 and comprising from about 1 mg/ml to
about 200 mg/ml of antibody, from about 1 millimolar to about 100
millimolar of histidine buffer, from about 0.01 mg/ml to about 10
mg/ml of polysorbate 80, from about 100 millimolar to about 400
millimolar of trehalose, and from about 0.01 millimolar to about
1.0 millimolar of disodium EDTA dihydrate.
[0328] The antibodies of the present invention can be administered
by a variety of methods known in the art, although for many
therapeutic applications, the preferred route/mode of
administration is subcutaneous, intramuscular, or intravenous
infusion. As will be appreciated by the skilled artisan, the route
and/or mode of administration will vary depending upon the desired
results.
[0329] In certain embodiments, the antibody compositions active
compound may be prepared with a carrier that will protect the
antibody against rapid release, such as a controlled release
formulation, including implants, transdermal patches, and
microencapsulated delivery systems. Biodegradable, biocompatible
polymers can be used, such as ethylene vinyl acetate,
polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and
polylactic acid. Many methods for the preparation of such
formulations are patented or generally known to those skilled in
the art. See, e.g., Sustained and Controlled Release Drug Delivery
Systems (J. R. Robinson, ed., Marcel Dekker, Inc., New York,
1978).
[0330] In certain embodiments, an anti-myostatin antibody of the
invention can be orally administered, for example, with an inert
diluent or an assimilable edible carrier. The compound (and other
ingredients, if desired) can also be enclosed in a hard or soft
shell gelatin capsule, compressed into tablets, or incorporated
directly into the subject's diet. For oral therapeutic
administration, the anti-myostatin antibodies can be incorporated
with excipients and used in the form of ingestible tablets, buccal
tablets, troches, capsules, elixirs, suspensions, syrups, wafers,
and the like. To administer a compound of the invention by other
than parenteral administration, it may be necessary to coat the
compound with, or co-administer the compound with, a material to
prevent its inactivation.
[0331] Additional active compounds also can be incorporated into
the compositions. In certain embodiments, an inhibitory
anti-myostatin antibody of the invention is co-formulated with
and/or co-administered with one or more additional therapeutic
agents. These agents include, without limitation, antibodies that
bind other targets, antineoplastic agents, antitumor agents,
chemotherapeutic agents, peptide analogues that inhibit myostatin,
or antibodies or other molecules that bind to Type II membrane
receptors and prevent their binding to or activation by myostatin.
Such combination therapies may require lower dosages of the
inhibitory anti-myostatin antibody as well as the co-administered
agents, thus avoiding possible toxicities or complications
associated with the various monotherapies.
[0332] Inhibitory anti-myostatin antibodies of the invention and
compositions comprising them also may be administered in
combination with other therapeutic regimens, in particular in
combination with exercise and/or dietary (including nutritional)
supplements.
[0333] In certain embodiments, an inhibiting anti-myostatin
antibody of the invention is co-formulated with and/or
co-administered with one or more additional therapeutic agents
discussed, supra. These agents include those that inhibit
myostatin. Further, such combination therapies may also be used to
treat, prevent or inhibit any of the aforementioned diseases and
conditions. Such combination therapies may require lower dosages of
the inhibitory anti-myostatin antibody as well as the
co-administered agents, thus avoiding possible toxicities or
complications associated with the various monotherapies.
[0334] The compositions of the invention may include a
"therapeutically effective amount" or a "prophylactically effective
amount" of an antibody or antigen-binding portion of the invention.
A "therapeutically effective amount" refers to an amount effective,
at dosages and for periods of time necessary, to achieve the
desired therapeutic result. A therapeutically effective amount of
the antibody or antibody portion may vary according to factors such
as the disease state, age, sex, and weight of the individual, and
the ability of the antibody or antibody portion to elicit a desired
response in the individual. A therapeutically effective amount is
also one in which any toxic or detrimental effects of the antibody
or antibody portion are outweighed by the therapeutically
beneficial effects. A "prophylactically effective amount" refers to
an amount effective, at dosages and for periods of time necessary,
to achieve the desired prophylactic result. Typically, since a
prophylactic dose is used in subjects prior to or at an earlier
stage of disease, the prophylactically effective amount may be less
than the therapeutically effective amount.
[0335] Dosage regimens can be adjusted to provide the optimum
desired response (e.g., a therapeutic or prophylactic response).
For example, a single bolus can be administered, several divided
doses can be administered over time or the dose can be
proportionally reduced or increased as indicated by the exigencies
of the therapeutic situation. It is especially advantageous to
formulate parenteral compositions in dosage unit form for ease of
administration and uniformity of dosage. Dosage unit form as used
herein refers to physically discrete units suited as unitary
dosages for the mammalian subjects to be treated; each unit
containing a predetermined quantity of active compound calculated
to produce the desired therapeutic effect in association with the
required pharmaceutical carrier. The specification for the dosage
unit forms of the invention are dictated by and directly dependent
on (a) the unique characteristics of the anti-myostatin antibody or
portion thereof and the particular therapeutic or prophylactic
effect to be achieved, and (b) the limitations inherent in the art
of compounding such an antibody for the treatment of sensitivity in
individuals.
[0336] An exemplary, non-limiting range for a therapeutically or
prophylactically effective amount of an antibody or antibody
portion of the invention is 0.025 to 50 mg/kg, more preferably 0.1
to 50 mg/kg, more preferably 0.1-25, 0.1 to 10 or 0.1 to 3 mg/kg.
In some embodiments, a formulation contains 5 mg/ml of antibody in
a buffer of 20 mM sodium citrate, pH 5.5, 140 mM NaCl, and 0.2
mg/ml polysorbate 80. It is to be noted that dosage values may vary
with the type and severity of the condition to be alleviated. It is
to be further understood that for any particular subject, specific
dosage regimens should be adjusted over time according to the
individual need and the professional judgment of the person
administering or supervising the administration of the
compositions, and that dosage ranges set forth herein are exemplary
only and are not intended to limit the scope or practice of the
claimed composition.
[0337] Another aspect of the present invention provides kits
comprising an anti-myostatin antibody or antigen-binding portion of
the invention or a composition comprising such an antibody or
portion. A kit may include, in addition to the antibody or
composition, diagnostic or therapeutic agents. A kit can also
include instructions for use in a diagnostic or therapeutic method.
In a preferred embodiment, the kit includes the antibody or a
composition comprising it and a diagnostic agent that can be used
in a method described below. In another preferred embodiment, the
kit includes the antibody or a composition comprising it and one or
more therapeutic agents that can be used in a method described
below.
Diagnostic Methods of Use
[0338] In another aspect, the invention provides diagnostic
methods. The anti-myostatin antibodies can be used to detect
myostatin in a biological sample in vitro or in vivo.
[0339] The anti-myostatin antibodies can be used in a conventional
immunoassay, including, without limitation, an ELISA, an RIA, flow
cytometry, tissue immunohistochemistry, Western blot or
immunoprecipitation. The anti-myostatin antibodies of the invention
can be used to detect myostatin from humans. In another embodiment,
the anti-myostatin antibodies can be used to detect myostatin from,
for example, mice, cynomolgus monkeys, rat, dog, quail, chicken,
turkey, pig and horse.
[0340] The invention provides a method for detecting myostatin in a
biological sample comprising contacting the biological sample with
an anti-myostatin antibody of the invention and detecting the bound
antibody. In one embodiment, the anti-myostatin antibody is
directly labeled with a detectable label. In another embodiment,
the anti-myostatin antibody (the first antibody) is unlabeled and a
second antibody or other molecule that can bind the anti-myostatin
antibody is labeled. As is well known to one of skill in the art, a
second antibody is chosen that is able to specifically bind the
particular species and class of the first antibody. For example, if
the anti-myostatin antibody is a human IgG, then the secondary
antibody could be an anti-human-IgG. Other molecules that can bind
to antibodies include, without limitation, Protein A and Protein G,
both of which are available commercially, e.g., from Pierce
Chemical Co.
[0341] Suitable labels for the antibody or secondary antibody have
been disclosed supra, and include various enzymes, prosthetic
groups, fluorescent materials, luminescent materials and
radioactive materials. Examples of suitable enzymes include
horseradish peroxidase, alkaline phosphatase, .beta.-galactosidase,
or acetylcholinesterase; examples of suitable prosthetic group
complexes include streptavidin/biotin and avidin/biotin; examples
of suitable fluorescent materials include umbelliferone,
fluorescein, fluorescein isothiocyanate, rhodamine,
dichlorotriazinylamine fluorescein, dansyl chloride or
phycoerythrin; an example of a luminescent material includes
luminol; and examples of suitable radioactive material include
.sup.125I, .sup.131I, .sup.35S or .sup.3H.
[0342] In other embodiments, myostatin can be assayed in a
biological sample by a competition immunoassay utilizing myostatin
standards labeled with a detectable substance and an unlabeled
anti-myostatin antibody. In this assay, the biological sample, the
labeled myostatin standards and the anti-myostatin antibody are
combined and the amount of labeled myostatin standard bound to the
unlabeled antibody is determined. The amount of myostatin in the
biological sample is inversely proportional to the amount of
labeled myostatin standard bound to the anti-myostatin
antibody.
[0343] One can use the immunoassays disclosed above for a number of
purposes. For example, the anti-myostatin antibodies can be used to
detect myostatin in cultured cells. In a preferred embodiment, the
anti-myostatin antibodies are used to determine the amount of
myostatin produced by cells that have been treated with various
compounds. This method can be used to identify compounds that
modulate myostatin protein levels. According to this method, one
sample of cells is treated with a test compound for a period of
time while another sample is left untreated. If the total level of
myostatin is to be measured, the cells are lysed and the total
myostatin level is measured using one of the immunoassays described
above. The total level of myostatin in the treated versus the
untreated cells is compared to determine the effect of the test
compound.
[0344] A preferred immunoassay for measuring total myostatin levels
is flow cytometry or immunohistochemistry. Methods such as ELISA,
RIA, flow cytometry, Western blot, immunohistochemistry, cell
surface labeling of integral membrane proteins and
immunoprecipitation are well known in the art. See, e.g., Harlow
and Lane, supra. In addition, the immunoassays can be scaled up for
high throughput screening in order to test a large number of
compounds for either activation or inhibition of myostatin
expression.
[0345] The anti-myostatin antibodies of the invention also can be
used to determine the levels of myostatin in a tissue or serum. In
some embodiments, the tissue is a diseased tissue. In some
embodiments of the method, a tissue or a biopsy thereof is excised
from a patient. The method comprises the steps of administering a
detectably labeled anti-myostatin antibody or a composition
comprising them to a patient in need of such a diagnostic test and
subjecting the patient to imaging analysis to determine the
location of the myostatin-expressing tissues. Imaging analysis is
well known in the medical art, and includes, without limitation,
x-ray analysis, magnetic resonance imaging (MRI) or computed
tomography (CT). The antibody can be labeled with any agent
suitable for in vivo imaging, for example a contrast agent, such as
barium, which can be used for x-ray analysis, or a magnetic
contrast agent, such as a gadolinium chelate, which can be used for
MRI or CT. Other labeling agents include, without limitation,
radioisotopes, such as .sup.99Tc. In another embodiment, the
anti-myostatin antibody will be unlabeled and will be imaged by
administering a second antibody or other molecule that is
detectable and that can bind the anti-myostatin antibody. In
embodiment, a biopsy is obtained from the patient to determine
whether the tissue of interest expresses myostatin.
Therapeutic Methods of Use
[0346] In another embodiment, the invention provides a method for
inhibiting myostatin activity by administering an anti-myostatin
antibody to a patient in need thereof. Any of the types of
antibodies described herein may be used therapeutically. In various
embodiments, the anti-myostatin antibody is a human, chimeric or
humanized antibody. In a preferred embodiment, the myostatin is
human and the patient is a human patient. Alternatively, the
patient may be a mammal that expresses a myostatin that the
anti-myostatin antibody cross-reacts with. The antibody may be
administered to a non-human mammal expressing myostatin with which
the antibody cross-reacts (i.e. a rat, a mouse, or a cynomolgus
monkey) for veterinary purposes or as an animal model of human
disease. Such animal models may be useful for evaluating the
therapeutic efficacy of antibodies of this invention.
[0347] These antibodies may be used in promoting muscle growth,
weight gain and aiding in the prevention of frailty in livestock
(cattle, swine, sheep, horses, chickens, turkeys and fish) and
companion animals (dogs, cats and horses).
[0348] In another embodiment, the invention provides a method for
promoting muscle growth, weight gain and aiding in the prevention
of frailty in cattle, swine, sheep, chickens, turkeys, horses,
fish, dogs and cats in need thereof comprising the step of
administering to said subject an antibody or antigen-binding
portion as described herein.
[0349] As used herein, the term "a condition that may be prevented
or treated by reducing myostatin activity" is intended to include
diseases and other disorders in which the presence of high levels
of myostatin in a subject suffering from the disorder has been
shown to be or is suspected of being either responsible for the
pathophysiology of the disorder or a factor that contributes to a
worsening of the disorder. Such disorders may be evidenced, for
example, by an increase in the levels of myostatin in tissues and
fluids or phosphorylated Smad 2 or 3 in muscle tissue in the
affected cells or tissues of a subject suffering from the disorder.
The increase in myostatin levels may be detected, for example,
using an anti-myostatin antibody as described above.
[0350] In another preferred embodiment, an anti-myostatin antibody
may be administered to a patient who expresses inappropriately high
levels of myostatin. It is known in the art that high-level
expression of myostatin can lead to a variety of wasting
conditions, bone loss and to accumulation of fat mass. In one
embodiment, said method relates to the treatment of diseases and
conditions in which it is desirable to decrease the loss of or to
increase skeletal muscle mass, to decrease bone loss or to increase
bone mass and/or to reduce fat mass by neutralizing the effects of
myostatin. Such conditions and diseases are mentioned supra.
[0351] In another preferred embodiment, an anti-myostatin antibody
may be administered to a patient who does not express inappropriate
levels of myostatin (high or low), but whose condition would still
be successfully treated or prevented by using anti-moystatin
treatment. In one embodiment, said method relates to the treatment
of diseases and conditions in which it is desirable to inhibit
moystatin activity to treat the loss of or to improve skeletal
muscle mass, to treat bone loss or to increase bone mass and/or to
treat fat mass by neutralizing the effects of myostatin. Such
diseases and conditions are known in the art and would include
diseases and conditions that associate with a variety of wasting
conditions that can include bone loss and accumulation of fat mass,
e.g., age-related degenerative diseases and non-degenerative,
normal age-related conditions.
[0352] The antibody may be administered once, but more preferably
is administered multiple times. The antibody may be administered
from three times daily to once every six months or longer. The
administering may be on a schedule such as three times daily, twice
daily, once daily, once every two days, once every three days, once
weekly, once every two weeks, once every month, once every two
months, once every three months and once every six months. The
antibody may also be administered continuously via a minipump. The
antibody may be administered via an oral, mucosal, buccal,
intranasal, inhalable, intravenous, subcutaneous, intramuscular or
parenteral route. The antibody may be administered once, at least
twice or for at least the period of time until the condition is
treated, palliated or cured. The antibody generally will be
administered for as long as the condition is present. The antibody
will generally be administered as part of a pharmaceutical
composition as described supra. The dosage of antibody will
generally be in the range of 0.1-100 mg/kg, more preferably 0.5-50
mg/kg, more preferably 1-20 mg/kg, and even more preferably 1-10
mg/kg. The serum concentration of the antibody may be measured by
any method known in the art.
[0353] Co-administration of the antibody with an additional
therapeutic agent (combination therapy) encompasses administering a
pharmaceutical composition comprising the anti-myostatin antibody
and the additional therapeutic agent as well as administering two
or more separate pharmaceutical compositions, one comprising the
anti-myostatin antibody and the other(s) comprising the additional
therapeutic agent(s). Further, although co-administration or
combination therapy generally means that the antibody and
additional therapeutic agents are administered at the same time as
one another, it also encompasses instances in which the antibody
and additional therapeutic agents are administered at different
times. For instance, the antibody may be administered once every
three days, while the additional therapeutic agent is administered
once daily. Alternatively, the antibody may be administered prior
to or subsequent to treatment of the disorder with the additional
therapeutic agent, for example after a patient has failed therapy
with the additional agent. Similarly, administration of the
anti-myostatin antibody may be administered prior to or subsequent
to other therapy, such as exercise and/or dietary (including
nutritional) supplements. The antibody and one or more additional
therapeutic agents (the combination therapy) may be administered
once, twice or at least the period of time until the condition is
treated, palliated or cured. Preferably, the combination therapy is
administered multiple times. The combination therapy may be
administered from three times daily to once every six months. The
administering may be on a schedule such as three times daily, twice
daily, once daily, once every two days, once every three days, once
weekly, once every two weeks, once every month, once every two
months, once every three months and once every six months, or may
be administered continuously via a minipump. The combination
therapy may be administered via an oral, mucosal, buccal,
intranasal, inhalable, intravenous, subcutaneous, intramuscular or
parenteral route.
Gene Therapy
[0354] The nucleic acid molecules of the present invention can be
administered to a patient in need thereof via gene therapy. The
therapy may be either in vivo or ex vivo. In a preferred
embodiment, nucleic acid molecules encoding both a heavy chain and
a light chain are administered to a patient. In a more preferred
embodiment, the nucleic acid molecules are administered such that
they are stably integrated into chromosomes of B cells because
these cells are specialized for producing antibodies. In a
preferred embodiment, precursor B cells are transfected or infected
ex vivo and re-transplanted into a patient in need thereof. In
another embodiment, precursor B cells or other cells are infected
in vivo using a virus known to infect the cell type of interest.
Typical vectors used for gene therapy include liposomes, plasmids
and viral vectors. Exemplary viral vectors are retroviruses,
adenoviruses and adeno-associated viruses. After infection either
in vivo or ex vivo, levels of antibody expression can be monitored
by taking a sample from the treated patient and using any
immunoassay known in the art or discussed herein.
[0355] In a preferred embodiment, the gene therapy method comprises
the steps of administering an isolated nucleic acid molecule
encoding the heavy chain or an antigen-binding portion thereof of
an anti-myostatin antibody and expressing the nucleic acid
molecule. In another embodiment, the gene therapy method comprises
the steps of administering an isolated nucleic acid molecule
encoding the light chain or an antigen-binding portion thereof of
an anti-myostatin antibody and expressing the nucleic acid
molecule. In a more preferred method, the gene therapy method
comprises the steps of administering of an isolated nucleic acid
molecule encoding the heavy chain or an antigen-binding portion
thereof and an isolated nucleic acid molecule encoding the light
chain or the antigen-binding portion thereof of an anti-myostatin
antibody of the invention and expressing the nucleic acid
molecules. The gene therapy method may also comprise the step of
administering one or more additional therapeutic agents, such as
those mentioned, supra.
[0356] In order that this invention may be better understood, the
following examples are set forth. These examples are for purposes
of illustration only and are not to be construed as limiting the
scope of the invention in any manner.
Example I
Generation of Hybridomas Producing Anti-Myostatin Antibody
[0357] Antibodies of the invention were prepared, selected, and
assayed as follows: Eight to ten week old XENOMOUSE.RTM. mice were
immunized intraperitoneally or in their hind footpads with either a
c-terminal mature myostatin (10 .mu.g/dose/mouse) (R&D Systems,
Catalog #788-G8) or with a full-length cynomolgus mature myostatin.
This dose was repeated seven times over a three to four week
period. Four days before fusion, the mice were given a final
injection of the myostatin in PBS. The spleen and lymph node
lymphocytes from immunized mice were fused with the non-secretory
myeloma P3-X63-Ag8.653 cell line, and these fused cells were
subjected to HAT selection as previously described (Galfre and
Milstein, Methods Enzymol. 73:3-46, 1981). A panel of hybridomas
was recovered that all secrete myostatin specific human IgG2 or
IgG4 antibodies.
GDF8 and GDF11 ELISA Assay Protocol:
[0358] ELISA assay was used to detect antibody binding to myostatin
or GDF11. Myostatin or GDF11 was coated onto a 96-well Immulon
microtiter plate (NUNC-IMMUNO.RTM. plate MAXISORP.RTM. surface,
Nalge Nunc International, Cat. No. 439454) at 4 .mu.g/ml in 50 mM
sodium bicarbonate buffer for overnight at 4.degree. C. Plates were
washed, and then blocked with phosphate-buffered saline (PBS)
containing 0.1% Tween-20 and 0.5% bovine serum albumin. Antibodies
were added to the blocked ELISA plates, incubated for 1 hour, and
washed with PBS with Tween-20. Binding was detected by anti-human
IgG-horseradish peroxidase (Pierce Cat. No. 31420) followed by the
addition of ABTS (Pierce Cat. No. 37615). Colorimetric measurements
were performed at 405 nm in a micro-plate reader (We used
SpectraMax Plus 384, Molecular Devices).
[0359] Eleven hybridomas were selected for further study and were
designated 1.sub.--116.sub.--1, 1.sub.--136.sub.--3,
1.sub.--257.sub.--1, 1.sub.--46.sub.--1, 2.sub.--112.sub.--,
1.sub.--314.sub.--1, 1.sub.--66.sub.--1, 2.sub.--43.sub.--1,
2.sub.--177.sub.--1, 1.sub.--132.sub.--1, and 1.sub.--268.sub.--1.
The eleven hybridomas were deposited under terms in accordance with
the Budapest Treaty with the American Type Culture Collection
(ATCC), 10801 University Blvd., Manassas, Va. 20110-2209 on Feb.
10, 2005. The hybridomas have been assigned the following reference
numbers:
TABLE-US-00002 Antibody Hybridoma Identifier ATCC Reference No.
1_116_1 PF8-1-116-1 (LN 15902) PTA-6566 1_132_1 PF8-1-132-1 (LN
15903) PTA-6567 1_136_3 PF8-1-136-3 (LN 15904) PTA-6568 1_257_1
PF8-1-257-1 (LN 15905) PTA-6569 1_268_1 PF8-1-268-1 (LN 15906)
PTA-6570 1_314_1 PF8-1-314-1 (LN 15907) PTA-6571 1_46_1 PF8-1-46-1
(LN 15908) PTA-6572 1_66_1 PF8-1-66-1 (LN 15909) PTA-6573 2_112_1
PF8-2-112-1 (LN 15910) PTA-6574 2_43_1 PF8-2-43-1 (LN 15911)
PTA-6575 2_177_1 PF8-2-177-1 (LN 15912) PTA-6576
Example II
Sequences of Anti-Myostatin-Antibodies Prepared in Accordance with
the Invention
[0360] To analyze the structure of antibodies produced in
accordance with the invention, nucleic acids were cloned that
encode heavy and light chain fragments from hybridomas producing
anti-myostatin monoclonal antibodies.
[0361] Cloning and sequencing of the antibody variable regions, was
accomplished as follows: Poly(A).sup.+ mRNA was isolated using a
Fast-Track kit (Invitrogen) from approximately 2.times.10.sup.5
hybridoma cells derived from XENOMOUSE.RTM. mice immunized with
myostatin. cDNA was synthesized from the mRNA by using random
primers. The randomly primed cDNA was amplified using human V.sub.H
or human VK family specific variable domain primers (Marks et al.,
"Oligonucleotide primers for polymerase chain reaction
amplification of human immunoglobulin variable genes and design of
family-specific oligonucleotide probes." Eur. J. Immunol.
21:985-991 (1991)) or a universal human V.sub.H primer [MG-30,
5'-CAGGTGCAGCTGGAGCAGTCIGG-3] (SEQ ID NO: 91), in conjunction with
primers specific for the human C.gamma..sub.2 constant region,
MG-40d [5'-GCTGAGGGAGTAGAGTCCTGAGGA-3'] (SEQ ID NO: 92) or a CK
constant region [hKP2; as previously described in Green et al.,
1994]. Nucleic acid molecules were obtained that encode human heavy
and kappa light chain transcripts from the anti-myostatin producing
hybridomas by PCR amplification from poly(A.sup.+) RNA using the
primers described above. The PCR products were cloned into [pCRII
(Invitrogen)] using a TA cloning kit (Invitrogen) and both strands
were sequenced using Prism dye-terminator sequencing kits (Applied
Biosystems Inc) and an ABI 377 sequencing machine (Applied
Biosystems Inc). All sequences were analyzed by alignments to the
"V BASE sequence directory" (Tomlinson et al., MRC Centre for
Protein Engineering, Cambridge, UK) using MACVECTOR (Accelrys, San
Diego, Calif.) and GENEWORKS (Hindmarsh, S. A. Australia) software
programs.
[0362] To obtain the full-length expressed nucleic acid sequence of
antibodies produced in accordance with the invention, nucleic acids
were cloned that encode full-length heavy and light chain coding
regions from hybridomas producing anti-myostatin antibodies.
Cloning and sequencing was accomplished as follows: Poly(A).sup.+
mRNA was isolated using an RNeasy Mini Kit (Qiagen) and cDNA
synthesized from the mRNA with the Advantage RT-for-PCR kit (BD
Biosciences) using oligo(dT) priming. The oligo(dT) primed cDNA was
amplified in two independent reactions using degenerate primers
designed to hybridize to the 5' untranslated region (5'UTR) of
human V.sub.H or human V.sub..kappa. gene segments (TABLE 2A and
2B) in conjunction with non-degenerate primers specific for regions
in the 3'UTR of IGHG2 or IGHG4 [G.sub.--3UTR_R,
5'TACGTGCCAAGCATCCTCGC] (SEQ ID NO: 93) or IGK [K.sub.--3UTR_R,
5'AGGCTGGAACTGAGGAGCAGGTG] (SEQ ID NO: 94). Amplification was
achieved using the Expand High Fidelity PCR kit (Roche) and a
PTC-200 DNA Engine (MJ Research) with cycling as follows: 2 minutes
at 94.degree. C.; 23.times. (30 seconds at 94.degree. C., 50
seconds at 52.degree. C., 2 minutes at 72.degree. C.); 8 minutes at
72.degree. C. For both heavy and light chain reactions, the PCR
products from two independent PCRs were cloned into pCR2.1 using a
TOPO-TA cloning kit (Invitrogen) and both strands of two clones
were sequenced using Grills 16.sup.th BDTv3.1/dGTP chemistry
(Applied Biosystems Inc) and a 3730xl DNA Analyzer (Applied
Biosystems Inc).
TABLE-US-00003 TABLE 2A Heavy and Light Chain 5' Amplification
Primers: Primer Name Primer Sequence SEQ ID NO VH1a_5UTR_F
CCCTGAGAGCATCAYMYARMAACC 95 VH3a_5UTR_F HVTHTCCACTYGGTGATCRGCACTG
96 VH3c_5UTR_F ATTYRGTGATCAGSACTGAACASAG 97 VK1a_5UTR_F
GSARTCAGWCYCWVYCAGGACACAGC 98 VK2_5UTR_F CACCAGGKGATTTGCATATTRTCCC
99 VK3_5UTR_F ATCAATGCCTGKGTCAGAGCYYTG 100
TABLE-US-00004 TABLE 2B 5' Primers used for amplification of
anti-myostatin antibody heavy and light chains: Clone Forward Heavy
Chain Primer Forward Light Chain Primer 1_116_1 VH3a_5UTR_F
VK1a_5UTR_F 1_132_1 VH1a_5UTR_F VK2_5UTR_F 1_136_3 VH3a_5UTR_F
VK1a_5UTR_F 1_257_1 VH3a_5UTR_F VK1a_5UTR_F 1_314_1 VH3a_5UTR_F
VK1a_5UTR_F 1_46_1 VH1a_5UTR_F VK2_5UTR_F 2_112_1 VH3c_5UTR_F
VK3_5UTR_F 1_268_1 VH3a_5UTR_F VK1a_5UTR_F 1_66_1 VH3a_5UTR_F
VK1a_5UTR_F 2_177_1 VH3c_5UTR_F VK3_5UTR_F 2_43_1 VH3c_5UTR_F
VK3_5UTR_F
Gene Utilization Analysis
[0363] From the nucleic acid sequence and predicted amino acid
sequence of the antibodies, the gene usage was identified for each
antibody chain. Table 3 sets forth the gene utilization of selected
hybridoma clones of antibodies in accordance with the
invention:
TABLE-US-00005 TABLE 3 Heavy and Light Chain Gene Segment
Utilization: Heavy Chain Gene Utilization Kappa Chain Gene
Utilization Clone SEQ ID NO: V.sub.H D.sub.H J.sub.H C.sub.H SEQ ID
NO: V.kappa. J.kappa. 1_116_1 1 V3-21 D5-5 JH4B G2 3 A30 JK1
1_132_1 5 V1-02 D4-23 JH6B G2 7 A3 JK4 1_136_3 9 V3-21 D5-5 JH4B G2
11 A30 JK1 1_257_1 13 V3-21 D5-12 JH6B G2 15 A30 JK3 1_314_1 17
V3-21 -- JH6B G2 19 A30 JK1 1_46_1 21 V1-02 D4-23 JH6B G2 23 A3 JK4
2_112_1 25 V3-23 D1-7 JH3B G4 27 L2 JK4 1_268_1 29 V3-21 D1-26 JH4B
G2 31 A30 JK4 1_66_1 33 V3-21 D5-5 JH4B G2 35 A30 JK3 2_177_1 37
V3-21 D1-7 JH3B G4 39 L2 JK4 2_43_1 41 V3-23 D1-7 JH3B G4 43 L2
JK4
[0364] Mutations that developed during antibody maturation of the
framework regions were modified back to the germline sequences as
illustrated in the sequence alignment of FIG. 19. Specifically,
residue 12 in the heavy chain of monoclonal antibody
2.sub.--112.sub.--1 (SEQ ID NOs: 26 and 77) was modified from Ile
to Val. In the light chain (SEQ ID NOs:28 and 79), residue 58 was
modified from Phe to Ile and residue 85 was modified from Ile to
Val. Mutagenesis of specific residues of the heavy and light chains
of antibody 2.sub.--112.sub.--1 was carried out by designing
primers and using the QuickChange Site Directed Mutagenesis Kit
from Stratagene, according to the manufacturer's instructions.
Mutations were confirmed by automated sequencing, and mutagenized
inserts were subcloned into expression vectors. These expression
vectors were transfected into NS0 (ECACC # 85110503) and HEK-293T
cells (American Type Culture Collection) to express recombinant
antibodies of the invention. The resulting antibody having
back-mutated framework regions is designated antibody
2.sub.--112_K.
Example III
Inhibition of Myostatin by Human Anti-Myostatin Antibodies (A204
Luciferase Assay)
[0365] A myostatin responsive reporter gene assay (see, Thies, et
al., Growth Factors, (2001) 18:251-259.) was used to assess the
biological activity of active myostatin in vitro. This assay uses a
reporter vector pGL3(CAGA).sub.15 coupled to luciferase. The CAGA
box sequence (AGCCAGACA) (SEQ ID NO: 101) was reported to be a
TGF-.beta.-responsive element in the promoter region of a
TGF-.beta.-induced gene, PAI-1. (Zawel, et al. Mol. Cell, (1998)
1:611-617). This reporter vector was generated by inserting 15
copies of CAGA boxes into the SmaI and XhoI sites of pGL3-promoter
vector (Promega, Cat. No. E1761). The human rhabdomyosarcoma cell
line, A204 (ATCC Cell No. HTB-82), was transiently transfected with
pGL3(CAGA)15 and CMV .beta.-GAL using Fugene 6 transfection reagent
(Roche Diagnostics, Cat. No. 1814443). Transfected cells were
cultured in McCoy's 5A medium (Invitrogen, Cat. No. 16600)
supplemented with 10% fetal bovine serum, 100 U/ml streptomycin,
and 100 .mu.g/ml penicillin for 16 hours. Cells were changed to
starvation medium (McCoy's 5A medium with streptomycin, penicillin,
and 1 mg/ml bovine serum albumin), and then treated with myostatin,
GDF11, or activin for 6 hours at 37.degree. C. Luciferase activity
was measured using the DUAL-LIGHT.RTM. luciferase assay system
(Applied Biosytems, Cat. No. T1004). Myostatin activates the
reporter to about 10 fold with EC50 around 8 ng/ml. GDF11 activates
the reporter in the very similar response. The neutralization
activity of an antibody was determined by preincubating antibody
with myostatin for 30 minutes prior to addition to the A204 cells.
As shown in FIG. 1, human anti-myostatin antibodies of the
invention inhibited myostatin-stimulated luciferase activity in the
A204 cells. A similar experiment using GDF11 also was performed to
study the specificities of the antibodies of the invention. The
data is summarized in the FIG. 1. Most antibodies have much more
potent neutralizing activity against GDF8 than GDF11. Monoclonal
antibodies 1.sub.--46.sub.--1 and 1.sub.--132.sub.--1 neutralize
both GDF8 and GDF11 with equal potency.
Example IV
Inhibition of Myostatin by Human Anti-Myostatin Antibodies (L6
Beta-Lactamase Assay)
[0366] In vitro assays to measure myostatin binding to Type II
membrane receptors in the presence of anti-myostatin antibodies
were conducted to determine if the anti-myostatin antibodies were
capable of inhibiting such binding and their degree of
inhibition.
[0367] An L6 Aurora reporter assay was performed to assess the
biological activity of active myostatin in vitro. L6 myostatin LD10
is a cell line stably expressing a beta-lactamase reporter gene.
The promoter region in the inserted reporter consists of 16 copies
of Smad-binding element (SBE, GTCTAGAC (SEQ ID NO: 102), Zawel et
al., Mol. Cell. 1: 611-17 (1998)). The cells were cultured in DMEM
high glucose (Invitrogen, Cat. No. 11995) supplemented with 10%
heat-inactivated fetal bovine serum (FBS), 200-400 .mu.g/ml Zeocin,
100 U/ml streptomycin, and 100 .mu.g/ml penicillin. Cells were
plated to 96-well plate on day one and changed to the starvation
medium (DMEM with Zeocin, streptomycin, penicillin, and 0.1% FBS)
in afternoon of the second day. On the morning of the third day,
cells were treated with myostatin, GDF11, or activin for 4 hours at
37.degree. C. Aurora CCF2 loading kit was used to analyze
beta-lactamase activity according to the manufacture's suggestion
(Invitrogen, Cat. No. K1032).
[0368] Myostatin activated smad-mediated expression of the reporter
to about 2-3 fold with EC50 around 5 ng/ml. GDF11 and activin
activated the reporter in the very similar response.
[0369] The neutralization activity of an antibody was determined by
preincubating antibody with myostatin for 30 minutes prior to
addition to the L6 myostatin LD10 cells. As shown in FIGS. 2 and
11, all human anti-myostatin antibodies tested inhibited smad
protein activation in a range from about 1 to about 225 nM.
Example V
Inhibition of Myostatin-Induced Smad 2 Phosphorylation (Western
Blot)
[0370] HepG2 human hepatocellular carcinoma cells (ATTC Cell No.
HB-8065) were cultured in DMEM high glucose (Invitrogen, Cat. No.
11995) supplemented with 10% fetal bovine serum (FBS), 100 U/ml
streptomycin, and 100 .mu.g/ml penicillin. 60-70% confluent cells
were changed to the starvation medium (DMEM with streptomycin,
penicillin, and 0.5% FBS) overnight. Cells were treated with
myostatin for 30 minutes. The neutralization activity of an
antibody was determined by preincubating antibody with myostatin
for 30 minutes prior to addition to the HepG2 cells. Cells were
lysed for western blot. Phosphorylated Smad2 was detected using a
rabbit anti-phospho-Smad2 antibody (Cell Signalling, Cat. No.
3101), which was then detected by anti-Rabbit Alex 680 (Molecular
Probes, Cat. No. A21076). The amount of phosphorylated Smad2 was
quantified using ODYSSEY.RTM. Infrared Imager (L1-Cor).
Glyseraldehyde-3-phosphate dehydrogenase (GAPDH) was used for
normalization. As shown in FIG. 3, all of the neutralizing human
anti-myostatin antibodies tested inhibited smad 2
phosphorylation.
Example VI
Enhanced Expression of myf5 by Human Anti-Myostatin Antibodies
[0371] C2C12 myoblasts (ATCC Cell No. CRL-1772) were cultured in
DMEM high glucose (Invitrogen, Cat. No. 11995) supplemented with
10% fetal bovine serum (FBS), 100 U/ml streptomycin, and 100
.mu.g/ml penicillin. Cells were treated with 300 ng/ml myostatin
for 2 hours. The neutralization activity of an antibody was
determined by preincubating antibody with myostatin for 30 minutes
prior to addition to the C2C12 cells. Cells were harvested and RNA
purified using RNeasy miniprep kit (Qiagen Cat. No. 74104).
Purified RNA was quantified with RIBOGREEN.RTM. RNA Quantitation
Kit (Molecular Probes, Cat. No. R11490). Equal amount of total RNA
was used for real time PCR analysis to detect myf5 RNA expression.
Primer/probe sets for mouse myf5 RNA detection were purchased from
ASSAYS-ON-DEMAND.RTM. gene expression products (Applied Biosystems,
Cat. No. Hs00271574_ml). Assay conditions used were according to
the manufacture's recommendations. One-step RT-PCR was run on the
sequence detection system ABI7900 (Applied Biosystems). As shown in
FIG. 4, neutralizing human anti-myostatin antibodies of the
invention enhanced myf5 expression. One non-neutralizing human
anti-myostatin antibody, 1.sub.--159.sub.--1, did not enhance myf5
expression.
Example VII
Enhancement of Cell Differentiation by Human Anti-Myostatin
Antibodies
[0372] The ability of antibodies to inhibit myostatin-mediated
inhibition of myoblast differentiation was assessed in C2C12
myoblasts. C2C12 cells were plated in 96-well plates at 25,000
cells/well in 200 .mu.l DMEM/20% FBS/Penn-Strep. Twenty-four hours
later, the media was aspirated, the cells rinsed 1.times. with HIT
media (DMEM/2% horse serum/Penn-Strep), and 200 .mu.l HIT media
alone or supplemented with 300 ng/ml GDF-8 (R&D Systems) alone
or with various concentrations of antibody added. Forty-eight hours
later, the media was aspirated and the cells lysed in 100 .mu.l of
lysis buffer (25 mM Tris pH 7.5, 3 mM EDTA, 1% NP-40, 1%
Deoxycholate, 0.1% SDS and 1 tablet of Roche Complete protease
inhibitor/25 ml of lysis buffer). Embryonic myosin heavy chain
(MHC) levels in the lysates were determined by spotting 5 .mu.l of
lysate into individual wells of High Bind MA6000 plates
(MSD#P11XB-1, Meso Scale Discovery, MSD), air drying for 1 hour,
adding 100 .mu.l of Blocker A (MSD#R93BA-2), incubating for 1 hour
at 25.degree. C. with shaking, washing 4.times. with PBS/0.05%
Tween-20, adding 50 .mu.l of embryonic MHC antibody (conditioned
media from ATCC #CRL-2039 hybridoma), incubating for 1.5 hours at
25.degree. C. with shaking, washing 4.times. as before, adding 50
.mu.l of Sulfo-TAG Anti-Mouse IgG (MSD #R32AC) which had been
diluted 1:1000 in antibody diluent (MSD #R50AA-2), incubating for
1.5 hours at 25.degree. C. with shaking, washing 4.times. as
before, adding 150 .mu.l of 1.times. Read Buffer (MSD#R92TC-2) and
analyzing chemiluminescence in a Sector Imager 6000 (MSD). As shown
in FIG. 5, neutralizing human anti-myostatin antibodies reversed
myostatin-blocked muscle differentiation in the MHC assay.
Example VIII
Myostatin Peptide Binding
[0373] Eleven peptides were generated from mature GDF8 to test and
localize antibody binding (See FIG. 6). Peptide ELISA was done on
glutaraldehyde coated ELISA plates and on uncoated ELISA plates
(NUNC-IMMUNO.RTM. plate MAXISORP.RTM. surface, Nalge Nunc
International, Cat. No. 439454). Glutaraldehyde coated plates were
prepared by mixing 250 .mu.l glutaraldehyde (50% w/v) with 50 ml
deionized water and adding 200 .mu.l of the solution into each
well. Plates were incubated for at least 1 hour at room
temperature. The glutaraldehyde was shaken out of the plate and
smashed upside down on paper towels to remove all the liquid prior
to use.
[0374] ELISA plates were coated with peptide at 1.0 .mu.g/well/50
.mu.l (in Sodium bicarbonate buffer, pH 9.6) for at least 4 hours,
and then blocked with 200 .mu.l blocker (1% BSA, 1% Ethanolamine pH
7.4) for minimum 4 hours. Plates were washed with PBST three times
with 200 .mu.l/well. 50 .mu.l antibody (1 .mu.g/ml in PBST,
Phosphate-buffered saline (PBS) with 0.05% Tween-20) sample was
added to the wells for 1 hour. Plates were then washed with PBST
three times. 50 .mu.l anti-human IgG-horseradish peroxidase (HRP)
(Pierce, Cat# 31420) diluted in PBST is added for another hour. The
wells were washed again with TBST three times, and then with
deionized water twice. 50 .mu.l ABTS (MOSS) was added for 5-20
minutes, and the signal was detected at 405 nm in a colormetric
plate reader. The results of the binding experiment are shown in
FIG. 6. The eleven peptides are shown in FIG. 7.
Example IX
Epitope Mapping Studies
[0375] Cross-competition experiments were performed using the
BIACORE.RTM. 3000 instrument (Biacore International AB, Uppsala,
Sweden and Piscataway, N.J.), following the manufacturer's
protocols.
[0376] Experiments were performed in a BIACORE.RTM. 3000 instrument
at 25.degree. C. in 0.01 M HEPES pH 7.4, 0.15 M NaCl, 3 mM EDTA,
0.005% Tween-20. Myostatin was immobilized on a CM5 chip
(Biacore.TM.) using standard amine coupling procedures yielding
approximately 1300 RU (resonance units). Antibody samples were
prepared at 50 nM and injected in pairs, for example, a reference
mAb was injected for 10 minutes immediately followed by a 10 minute
injection of a test mAb. The surface was regenerated and the
injections were repeated in reverse order. The procedure was
repeated for all possible pairs of antibodies. A cross-comparison
of the total response obtained for a pair of antibodies to that
obtained for duplicate injections of each individual antibody was
used to find antibodies that competitively bind with one another,
e.g., the antibodies compete for binding to the antigen. A response
greater than that observed for either of the duplicate injections
was indicative of binding to different epitopes whereas a response
intermediate to those observed for the duplicate injections was
indicative of binding to the same or overlapping or adjacent
epitopes. The results of this experiment are shown in FIG. 8 and
summarized in FIG. 13.
Example X
Immunoprecipitation of Myostatin from Cell Culture Medium
[0377] An immunoprecipitation study was conducted to test the
binding of myostatin antibodies to mature GDF8 and mature
GDF8/propeptide complex. 293T cells were transfected with GDF-8
expression construct. Conditioned media was harvested 7 days after
transfection, which contained mature GDF8 and latent complex. 100
.mu.l conditioned media was incubated with 10 .mu.g myostatin
antibodies for 16 hours at 4.degree. C. Protein A Dynabeads (Dynal,
Norway) were added and incubated for 90 minutes at 4.degree. C. The
immunoprecipitate was collected using MPC-E magnetic concentrator
(Dynal, Norway), and washed four times with PBS. The
immunoprecipitate was resuspended in the reducing sample buffer and
loaded on 4-12% Bis-Tris NuPage gel (Invitrogen). Western blotting
was performed using ODYSSEY.RTM. infrared imaging system (L1-Cor).
Mature GDF8 and unprocessed GDF8 were detected using goat
anti-myostatin antibody (R&D systems, Cat# AF788). Rabbit
anti-propeptide polyclonal antibody (made in-house) was used to
detect both propeptide and unprocessed GDF8. As shown in the FIG.
9, antibodies 2.sub.--112.sub.--1, 2.sub.--43.sub.--1, and
2.sub.--177.sub.--1 immunoprecipitated mature GDF8, mature
GDF8/propeptide complex, and unprocessed GDF8; antibody
1.sub.--66.sub.--1 immunoprecipitated mature GDF8 and mature
GDF8/propeptide complex. No other antibodies immunoprecipitated
mature GDF8, propeptide, or unprocessed GDF8. Lane 4 is the 1/10
medium loading control, and lane 7 is immunoprecipitation control
with medium only.
Example XI
Immunoprecipitation of Myostatin from Mouse Serum
[0378] An immunoprecipitation study was conducted to test the
binding of myostatin antibodies to mature GDF8 from mouse serum.
200 .mu.l mouse serum (Rockland, Cat ## D208-00) was incubated with
20 .mu.g myostatin antibodies for 16 hours at 4.degree. C. Protein
A Dynalbeads were added and incubated for 90 minutes at 4.degree.
C. The immunoprecipitate was collected using MPC-E magnetic
concentrator (Dynal, Norway), and washed four times with PBS. The
immunoprecipitate was resuspended in the reducing sample buffer and
loaded on 4-12% Bis-Tris NuPage gel (Invitrogen). Western blotting
was performed using ODYSSEY.RTM. Infrared imaging system (L1-Cor).
Mature GDF8 was detected using biotinylated goat anti-myostatin
antibody (R&D systems, Cat# BAF788). As shown in the FIG. 10,
antibodies 2.sub.--112.sub.--1, 2.sub.--43.sub.--1, and
2.sub.--177.sub.--1 immunoprecipitated mature GDF8 from the mouse
serum, whereas 1.sub.--116.sub.--1 and 1.sub.--66.sub.--1 could
not. It is known that mature GDF8 in the serum binds to many
inhibitory proteins such as propeptide, FLRG, and GASAP1 (Hill et
al. (2002) The myostatin propeptide and the follistatin-related
gene are inhibitory binding proteins of myostatin in normal serum.
J. Biol. Chem. 277: 40735-40741. Hill et al. (2003) Regulation of
myostatin in vivo by growth and differentiation factor-associated
serum protein-1: a novel protein with protease inhibitor and
follistatin domains. Mol. Endocrin. 17(6): 1144-1154). This
experiment indicates that antibodies 2.sub.--112.sub.--1,
2.sub.--43.sub.--1, and 2.sub.--177.sub.--1 are truly
non-competitive neutralizing antibodies, i.e., the antibodies
neutralize myostatin but do not block binding of inhibitory binding
proteins present in serum. Such non-competitive neutralizing
antibodies would be advantageous in vivo.
Example XII
Comparison of Anti-Myostatin Antibodies In Vivo
[0379] Five week old KKA.sup.y/a mice (The Jackson Laboratory (Bar
Harbor, Me.)) were treated with 10 mg/kg of monoclonal antibodies
2.sub.--43.sub.--1, 2.sub.--177.sub.--1, and 2.sub.--112_K or
vehicle (PBS) given subcutaneously once per week for five weeks. At
the end of the study animals were euthanized and the
gastrocnemius-plantaris-soleus (GPS), tibialis anterior (TA) and
quadriceps (Quads) muscle groups were dissected and weighed.
Treatment with the 2.sub.--112_k antibody significantly increased
(p<0.05) absolute muscle mass for the GPS (+15.5%) and Quads
(+30.6%). The 2.sub.--177 antibody significantly increased Quads
(+11.5%) only. Although TA increased following treatment with
antibody 2.sub.--112_K (+16.8%), the increase was not statistically
significant (p=0.330). Body weight increased over the 5 weeks but
was not significantly different between treatment groups at any
time point during the study. When muscle mass was corrected for
body weight (muscle mass index), there were significant differences
only with 2.sub.--112_K treatment (+11.4% in GPS and +20.6% in
Quads). The results of this experiment are shown in FIGS. 14 and
15.
Example XIII
In Vivo Pharmacology and Efficacy of Antibody
[0380] The in vivo pharmacology and efficacy of antibody
2.sub.--112_K was evaluated in mice. To avoid potential
immunomodulation due to a mouse anti-human antibody (MAHA)
response, in vivo studies were performed in immune-deficient Severe
Combined Immunodecifient (SCID) beige mice. Subcutaneous
administration of antibody 2.sub.--112_K to these mice at 10
mg/kg/week s.c. for 5 weeks increased skeletal muscle mass by
19-25% and muscle strength by about 15%. Extending the duration of
this treatment to 10 weeks resulted in a further increase in muscle
strength to 21% but no further increase in muscle mass (by 18-27%).
Also, the Dose of 50 mg/kg/week s.c. for 10 weeks did not yield
superior increases in muscle mass or strength compared with 10
mg/kg/week. The results of this experiment are shown in FIG.
16.
Example XIV
Dose and Concentration Response Effects
[0381] When administered subcutaneously to SCID mice at doses
ranging from no-effect to maximum feasible dose (0.01, 0.1, 1 and
10 mg/kg/week), antibody 2.sub.--112_K dose-dependently increased
skeletal muscle mass by about 0%, 3%, 7% and 28%, respectively,
after 5 weeks (FIG. 17). Extending the duration of treatment to 10
weeks did not result in any further increases in muscle mass but
tended to increase tibialis muscle strength marginally by an
additional 5%. Also, the antibody dose-dependently altered the body
fat composition of these mice by +10%, +1%, -10%, -22% relative to
PBS controls at the 0.01, 0.1, 1.0 and 10 mg/kg/week for 5
weeks.
[0382] Non-linear, four-parameter analysis of the dose- and
concentration-response data yielded estimated ED50 and EC50 values
of 3.6 mg/kg/week and 20.4 mg/mL (-136 nM), respectively, assuming
the increase in muscle mass achieved with the 10 mg/kg/week dose to
be maximum efficacy. The relationship between the dose or serum
concentration of antibody 2.sub.--112_K versus changes in muscle
mass are shown in FIG. 18.
Example XV
Efficacy of Antibody for Attenuation of Muscle Wasting
[0383] Ten week old KK mice (JAX laboratories, Bar Harbor, Me.)
were randomized into three groups: placebo/vehicle,
cortisone/vehicle, and cortisone/antibody 2.sub.--112_K. Mice were
dosed subcutaneously with either vehicle (PBS) or 10 mg/kg antibody
2.sub.--112_K for five weeks followed by implant of a placebo or
cortisone pellet. Five days later, mice were euthanized, sacrificed
and muscle mass and fat pad mass were assessed. To assess muscle
mass, the gastrocnemius-plantaris-soleus (GPS), tibialis anterior
(TA) and quadriceps (quads) muscle groups were dissected and
weighed. Cortisone implant resulted in a significant decrease
(p<0.05) in muscle mass to 85.1.+-.2.2% (GPS), 85.5.+-.3.9% (TA)
and 84.1.+-.3.7% (quads) of the placebo/vehicle level. Treatment
with antibody 2.sub.--112_K ameliorated entirely the
cortisone-induced wasting of placebo/vehicle level for GPS
((102.0.+-.2.2%), TA (99.5.+-.3.6) and quads (104.6.+-.2.8%).
Values were similar when normalized per gram body weight. To test
if this effect was specific for muscle mass, fat pad mass was
determined. For fat pad mass, inguinal, epididymal and abdominal
fat pads were dissected and weighed. Treatment with antibody
2.sub.--112-K did not significantly (p<0.05) spare the loss in
fat pad mass due to cortisone implant for inguinal,
(cortisone/vehicle (75.1.+-.4.7%) and cortisone/2.sub.--112_K,
(82.3.+-.5.3%)), epididymal (cortisone/vehicle (79.3.+-.5.0%) and
cortisone/2.sub.--112_K (87.1.+-.3.9%)), or abdominal,
(cortisone/vehicle (79.5.+-.5.5%) and cortisone/2.sub.--112_K
(82.2.+-.4.2%)), fat pads. Values are expressed relative to
placebo/vehicle fat pad. The results of this experiment are shown
in FIGS. 20A and 20B.
Example XVI
Protein A Purification of Myostatin Antibody
[0384] 1-2 liters of concentrated (10-fold) HEK293 media was
filtered (2 micron) and loaded on an equilibrated protein A column
(Amersham Biosciences, Piscataway, N.J.) (53 mLs, equilibrated with
5 column volumes of D-PBS, pH 7.0) at 2 mL/min. The column was
washed with 5 column volumes of acetate buffer (20 mM sodium
acetate, pH 5.5) and the protein eluted with 4 column volumes of pH
3.2-3.5 sodium acetate (20 mM). The pH of the eluate was adjusted
to pH 5.5 with sodium hydroxide and filtered if needed. Finally the
material was concentrated to 10 mg/mL, dialyzed into 140 mM sodium
chloride, 20 mM sodium acetate, pH 5.5, filtered and stored at 4
degrees C.
[0385] All publications and patent applications cited in this
specification are incorporated herein by reference as if each
individual publication or patent application were specifically and
individually indicated to be incorporated by reference. Although
the foregoing invention has been described in some detail by way of
illustration and example for purposes of clarity of understanding,
it will be readily apparent to those of ordinary skill in the art
in light of the teachings of this invention that certain changes
and modifications may be made thereto without departing from the
spirit or scope of the appended claims.
Sequence CWU 1
1
12211338DNAHomo sapiens 1gaggtgcagc tggtggagtc tgggggaggc
ctggtcaagc ctggggggtc cctgagactc 60tcctgtgcag cctctggatt caccttcagt
agctatagca tgaattgggt ccgccaggct 120ccagggaagg ggctggagtg
ggtctcatcc attagtagta gtagtagtta catatactac 180gcagactcag
tgaagggccg attcaccatc tccagagaca acgccaagaa ctcactgtat
240ctgcaaatga acagcctgag agccgaggac acggctgtgt attactgtgc
gagagatcgg 300gggtacagct atggtcttga ctactggggc cagggaaccc
tggtcaccgt ctcctcagcc 360tccaccaagg gcccatcggt cttccccctg
gcgccctgct ccaggagcac ctccgagagc 420acagcggccc tgggctgcct
ggtcaaggac tacttccccg aaccggtgac ggtgtcgtgg 480aactcaggcg
ctctgaccag cggcgtgcac accttcccag ctgtcctaca gtcctcagga
540ctctactccc tcagcagcgt ggtgaccgtg ccctccagca acttcggcac
ccagacctac 600acctgcaacg tagatcacaa gcccagcaac accaaggtgg
acaagacagt tgagcgcaaa 660tgttgtgtcg agtgcccacc gtgcccagca
ccacctgtgg caggaccgtc agtcttcctc 720ttccccccaa aacccaagga
caccctcatg atctcccgga cccctgaggt cacgtgcgtg 780gtggtggacg
tgagccacga agaccccgag gtccagttca actggtacgt ggacggcgtg
840gaggtgcata atgccaagac aaagccacgg gaggagcagt tcaacagcac
gttccgtgtg 900gtcagcgtcc tcaccgttgt gcaccaggac tggctgaacg
gcaaggagta caagtgcaag 960gtctccaaca aaggcctccc agcccccatc
gagaaaacca tctccaaaac caaagggcag 1020ccccgagaac cacaggtgta
caccctgccc ccatcccggg aggagatgac caagaaccag 1080gtcagcctga
cctgcctggt caaaggcttc taccccagcg acatcgccgt ggagtgggag
1140agcaatgggc agccggagaa caactacaag accacacctc ccatgctgga
ctccgacggc 1200tccttcttcc tctacagcaa gctcaccgtg gacaagagca
ggtggcagca ggggaacgtc 1260ttctcatgct ccgtgatgca tgaggctctg
cacaaccact acacgcagaa gagcctctcc 1320ctgtctccgg gtaaatga
13382445PRTHomo sapiens 2Glu Val Gln Leu Val Glu Ser Gly Gly Gly
Leu Val Lys Pro Gly Gly1 5 10 15Ser Leu Arg Leu Ser Cys Ala Ala Ser
Gly Phe Thr Phe Ser Ser Tyr 20 25 30Ser Met Asn Trp Val Arg Gln Ala
Pro Gly Lys Gly Leu Glu Trp Val 35 40 45Ser Ser Ile Ser Ser Ser Ser
Ser Tyr Ile Tyr Tyr Ala Asp Ser Val 50 55 60Lys Gly Arg Phe Thr Ile
Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr65 70 75 80Leu Gln Met Asn
Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Arg Asp
Arg Gly Tyr Ser Tyr Gly Leu Asp Tyr Trp Gly Gln Gly 100 105 110Thr
Leu Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro Ser Val Phe 115 120
125Pro Leu Ala Pro Cys Ser Arg Ser Thr Ser Glu Ser Thr Ala Ala Leu
130 135 140Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val
Ser Trp145 150 155 160Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr
Phe Pro Ala Val Leu 165 170 175Gln Ser Ser Gly Leu Tyr Ser Leu Ser
Ser Val Val Thr Val Pro Ser 180 185 190Ser Asn Phe Gly Thr Gln Thr
Tyr Thr Cys Asn Val Asp His Lys Pro 195 200 205Ser Asn Thr Lys Val
Asp Lys Thr Val Glu Arg Lys Cys Cys Val Glu 210 215 220Cys Pro Pro
Cys Pro Ala Pro Pro Val Ala Gly Pro Ser Val Phe Leu225 230 235
240Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu
245 250 255Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu
Val Gln 260 265 270Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn
Ala Lys Thr Lys 275 280 285Pro Arg Glu Glu Gln Phe Asn Ser Thr Phe
Arg Val Val Ser Val Leu 290 295 300Thr Val Val His Gln Asp Trp Leu
Asn Gly Lys Glu Tyr Lys Cys Lys305 310 315 320Val Ser Asn Lys Gly
Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys 325 330 335Thr Lys Gly
Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser 340 345 350Arg
Glu Glu Met Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys 355 360
365Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln
370 375 380Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Met Leu Asp Ser
Asp Gly385 390 395 400Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp
Lys Ser Arg Trp Gln 405 410 415Gln Gly Asn Val Phe Ser Cys Ser Val
Met His Glu Ala Leu His Asn 420 425 430His Tyr Thr Gln Lys Ser Leu
Ser Leu Ser Pro Gly Lys 435 440 4453645DNAHomo sapiens 3gacatccaga
tgacccagtc tccatcctcc ctgtctgcat ctgtaggaga cagagtcacc 60atcacttgcc
gggcaagtca gggcattaga aatgctttag gctggtatca gcagaaacca
120gggaaagccc ctcagcgcct gatctatgct gcatccagtt tgcaaagtgg
ggtcccatca 180aggttcagcg gcagtggatc tgggacagaa ttcactctca
caatcagcag cctgcagcct 240gaagattttg caacttatta ctgtctacag
cataatagtt accctcggac gttcggccaa 300gggaccaagg tggaaatcaa
acgaactgtg gctgcaccat ctgtcttcat cttcccgcca 360tctgatgagc
agttgaaatc tggaactgcc tctgttgtgt gcctgctgaa taacttctat
420cccagagagg ccaaagtaca gtggaaggtg gataacgccc tccaatcggg
taactcccag 480gagagtgtca cagagcagga cagcaaggac agcacctaca
gcctcagcag caccctgacg 540ctgagcaaag cagactacga gaaacacaaa
gtctacgcct gcgaagtcac ccatcagggc 600ctgagctcgc ccgtcacaaa
gagcttcaac aggggagagt gttag 6454214PRTHomo sapiens 4Asp Ile Gln Met
Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly1 5 10 15Asp Arg Val
Thr Ile Thr Cys Arg Ala Ser Gln Gly Ile Arg Asn Ala 20 25 30Leu Gly
Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Gln Arg Leu Ile 35 40 45Tyr
Ala Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55
60Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro65
70 75 80Glu Asp Phe Ala Thr Tyr Tyr Cys Leu Gln His Asn Ser Tyr Pro
Arg 85 90 95Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg Thr Val
Ala Ala 100 105 110Pro Ser Val Phe Ile Phe Pro Pro Ser Asp Glu Gln
Leu Lys Ser Gly 115 120 125Thr Ala Ser Val Val Cys Leu Leu Asn Asn
Phe Tyr Pro Arg Glu Ala 130 135 140Lys Val Gln Trp Lys Val Asp Asn
Ala Leu Gln Ser Gly Asn Ser Gln145 150 155 160Glu Ser Val Thr Glu
Gln Asp Ser Lys Asp Ser Thr Tyr Ser Leu Ser 165 170 175Ser Thr Leu
Thr Leu Ser Lys Ala Asp Tyr Glu Lys His Lys Val Tyr 180 185 190Ala
Cys Glu Val Thr His Gln Gly Leu Ser Ser Pro Val Thr Lys Ser 195 200
205Phe Asn Arg Gly Glu Cys 21051350DNAHomo sapiens 5caggtgcagc
tggtgcagtc tggggctgag gtgaagaagc ctggggcctc agtgaaggtc 60tcctgcaagg
cttctggata caccttcacc ggctactata tgcactgggt gcgacaggcc
120cctggacaag ggcttgagtg gatgggatgg atcaacccta acaatggtgg
cacaaactat 180gcacagaagt ttcagggcag ggtcaccatg accagggaca
cgtccatcag cacagcctac 240atggagctga gcaggctgag atctgacgac
acggccgtgt atcactgtgc gagaaatacg 300gtgggaagtg ggtactacta
ctacggtatg gacgtctggg gccaagggac cacggtcacc 360gtctcctcag
cctccaccaa gggcccatcg gtcttccccc tggcgccctg ctccaggagc
420acctccgaga gcacagcggc cctgggctgc ctggtcaagg actacttccc
cgaaccggtg 480acggtgtcgt ggaactcagg cgctctgacc agcggcgtgc
acaccttccc agctgtccta 540cagtcctcag gactctactc cctcagcagc
gtggtgaccg tgccctccag caacttcggc 600acccagacct acacctgcaa
cgtagatcac aagcccagca acaccaaggt ggacaagaca 660gttgagcgca
aatgttgtgt cgagtgccca ccgtgcccag caccacctgt ggcaggaccg
720tcagtcttcc tcttcccccc aaaacccaag gacaccctca tgatctcccg
gacccctgag 780gtcacgtgcg tggtggtgga cgtgagccac gaagaccccg
aggtccagtt caactggtac 840gtggacggcg tggaggtgca taatgccaag
acaaagccac gggaggagca gttcaacagc 900acgttccgtg tggtcagcgt
cctcaccgtt gtgcaccagg actggctgaa cggcaaggag 960tacaagtgca
aggtctccaa caaaggcctc ccagccccca tcgagaaaac catctccaaa
1020accaaagggc agccccgaga accacaggtg tacaccctgc ccccatcccg
ggaggagatg 1080accaagaacc aggtcagcct gacctgcctg gtcaaaggct
tctaccccag cgacatcgcc 1140gtggagtggg agagcaatgg gcagccggag
aacaactaca agaccacacc tcccatgctg 1200gactccgacg gctccttctt
cctctacagc aagctcaccg tggacaagag caggtggcag 1260caggggaacg
tcttctcatg ctccgtgatg catgaggctc tgcacaacca ctacacgcag
1320aagagcctct ccctgtctcc gggtaaatga 13506449PRTHomo sapiens 6Gln
Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala1 5 10
15Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Gly Tyr
20 25 30Tyr Met His Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp
Met 35 40 45Gly Trp Ile Asn Pro Asn Asn Gly Gly Thr Asn Tyr Ala Gln
Lys Phe 50 55 60Gln Gly Arg Val Thr Met Thr Arg Asp Thr Ser Ile Ser
Thr Ala Tyr65 70 75 80Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr
Ala Val Tyr His Cys 85 90 95Ala Arg Asn Thr Val Gly Ser Gly Tyr Tyr
Tyr Tyr Gly Met Asp Val 100 105 110Trp Gly Gln Gly Thr Thr Val Thr
Val Ser Ser Ala Ser Thr Lys Gly 115 120 125Pro Ser Val Phe Pro Leu
Ala Pro Cys Ser Arg Ser Thr Ser Glu Ser 130 135 140Thr Ala Ala Leu
Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val145 150 155 160Thr
Val Ser Trp Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe 165 170
175Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val
180 185 190Thr Val Pro Ser Ser Asn Phe Gly Thr Gln Thr Tyr Thr Cys
Asn Val 195 200 205Asp His Lys Pro Ser Asn Thr Lys Val Asp Lys Thr
Val Glu Arg Lys 210 215 220Cys Cys Val Glu Cys Pro Pro Cys Pro Ala
Pro Pro Val Ala Gly Pro225 230 235 240Ser Val Phe Leu Phe Pro Pro
Lys Pro Lys Asp Thr Leu Met Ile Ser 245 250 255Arg Thr Pro Glu Val
Thr Cys Val Val Val Asp Val Ser His Glu Asp 260 265 270Pro Glu Val
Gln Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn 275 280 285Ala
Lys Thr Lys Pro Arg Glu Glu Gln Phe Asn Ser Thr Phe Arg Val 290 295
300Val Ser Val Leu Thr Val Val His Gln Asp Trp Leu Asn Gly Lys
Glu305 310 315 320Tyr Lys Cys Lys Val Ser Asn Lys Gly Leu Pro Ala
Pro Ile Glu Lys 325 330 335Thr Ile Ser Lys Thr Lys Gly Gln Pro Arg
Glu Pro Gln Val Tyr Thr 340 345 350Leu Pro Pro Ser Arg Glu Glu Met
Thr Lys Asn Gln Val Ser Leu Thr 355 360 365Cys Leu Val Lys Gly Phe
Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu 370 375 380Ser Asn Gly Gln
Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Met Leu385 390 395 400Asp
Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys 405 410
415Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu
420 425 430Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser
Pro Gly 435 440 445Lys7660DNAHomo sapiens 7gatattgtga tgactcagtc
tccactctcc ctgcccgtca cccctggaga gccggcctcc 60atctcctgca ggtctagtca
gagcctcctg catagtaatg gatacaacta tttggattgg 120tacctgcaga
agtcagggca gtctccacag ctcctgatcc atttgggttc taatcgggcc
180tccggggtcc ctgacaggtt cagtggcagt ggatcaggca cagattttac
actgaaaatc 240agcagagtgg aggctgagga tgttggggtt tattactgca
tgcaagttct acaaactccg 300ctcactttcg gcggagggac caaggtggag
atcaaacgaa ctgtggctgc accatctgtc 360ttcatcttcc cgccatctga
tgagcagttg aaatctggaa ctgcctctgt tgtgtgcctg 420ctgaataact
tctatcccag agaggccaaa gtacagtgga aggtggataa cgccctccaa
480tcgggtaact cccaggagag tgtcacagag caggacagca aggacagcac
ctacagcctc 540agcagcaccc tgacgctgag caaagcagac tacgagaaac
acaaagtcta cgcctgcgaa 600gtcacccatc agggcctgag ctcgcccgtc
acaaagagct tcaacagggg agagtgttag 6608219PRTHomo sapiens 8Asp Ile
Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly1 5 10 15Glu
Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser 20 25
30Asn Gly Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Ser Gly Gln Ser
35 40 45Pro Gln Leu Leu Ile His Leu Gly Ser Asn Arg Ala Ser Gly Val
Pro 50 55 60Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu
Lys Ile65 70 75 80Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr
Cys Met Gln Val 85 90 95Leu Gln Thr Pro Leu Thr Phe Gly Gly Gly Thr
Lys Val Glu Ile Lys 100 105 110Arg Thr Val Ala Ala Pro Ser Val Phe
Ile Phe Pro Pro Ser Asp Glu 115 120 125Gln Leu Lys Ser Gly Thr Ala
Ser Val Val Cys Leu Leu Asn Asn Phe 130 135 140Tyr Pro Arg Glu Ala
Lys Val Gln Trp Lys Val Asp Asn Ala Leu Gln145 150 155 160Ser Gly
Asn Ser Gln Glu Ser Val Thr Glu Gln Asp Ser Lys Asp Ser 165 170
175Thr Tyr Ser Leu Ser Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu
180 185 190Lys His Lys Val Tyr Ala Cys Glu Val Thr His Gln Gly Leu
Ser Ser 195 200 205Pro Val Thr Lys Ser Phe Asn Arg Gly Glu Cys 210
21591338DNAHomo sapiens 9gaggtgcagc tggtggagtc tgggggaggc
ctggtcaagc ctggggggtc cctgagactc 60tcctgtgcag cctctggatt caccttcagt
agctatagca tgaactgggt ccgccaggct 120ccagggaagg ggctggagtg
ggtctcatcc attagtagta gtagtagtta catatactac 180gcagactcag
tgaagggccg attcaccatc tccagagaca acgccaagaa ctcactgtat
240ctgcaaatga acagcctgag agccgaggac acggctgtgt attactgtgc
gagagatcgt 300ggatacagct atggtattga ctactggggc cagggaaccc
tggtcaccgt ctcctcagcc 360tccaccaagg gcccatcggt cttccccctg
gcgccctgct ccaggagcac ctccgagagc 420acagcggccc tgggctgcct
ggtcaaggac tacttccccg aaccggtgac ggtgtcgtgg 480aactcaggcg
ctctgaccag cggcgtgcac accttcccag ctgtcctaca gtcctcagga
540ctctactccc tcagcagcgt ggtgaccgtg ccctccagca acttcggcac
ccagacctac 600acctgcaacg tagatcacaa gcccagcaac accaaggtgg
acaagacagt tgagcgcaaa 660tgttgtgtcg agtgcccacc gtgcccagca
ccacctgtgg caggaccgtc agtcttcctc 720ttccccccaa aacccaagga
caccctcatg atctcccgga cccctgaggt cacgtgcgtg 780gtggtggacg
tgagccacga agaccccgag gtccagttca actggtacgt ggacggcgtg
840gaggtgcata atgccaagac aaagccacgg gaggagcagt tcaacagcac
gttccgtgtg 900gtcagcgtcc tcaccgttgt gcaccaggac tggctgaacg
gcaaggagta caagtgcaag 960gtctccaaca aaggcctccc agcccccatc
gagaaaacca tctccaaaac caaagggcag 1020ccccgagaac cacaggtgta
caccctgccc ccatcccggg aggagatgac caagaaccag 1080gtcagcctga
cctgcctggt caaaggcttc taccccagcg acatcgccgt ggagtgggag
1140agcaatgggc agccggagaa caactacaag accacacctc ccatgctgga
ctccgacggc 1200tccttcttcc tctacagcaa gctcaccgtg gacaagagca
ggtggcagca ggggaacgtc 1260ttctcatgct ccgtgatgca tgaggctctg
cacaaccact acacgcagaa gagcctctcc 1320ctgtctccgg gtaaatga
133810445PRTHomo sapiens 10Glu Val Gln Leu Val Glu Ser Gly Gly Gly
Leu Val Lys Pro Gly Gly1 5 10 15Ser Leu Arg Leu Ser Cys Ala Ala Ser
Gly Phe Thr Phe Ser Ser Tyr 20 25 30Ser Met Asn Trp Val Arg Gln Ala
Pro Gly Lys Gly Leu Glu Trp Val 35 40 45Ser Ser Ile Ser Ser Ser Ser
Ser Tyr Ile Tyr Tyr Ala Asp Ser Val 50 55 60Lys Gly Arg Phe Thr Ile
Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr65 70 75 80Leu Gln Met Asn
Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Arg Asp
Arg Gly Tyr Ser Tyr Gly Ile Asp Tyr Trp Gly Gln Gly 100 105 110Thr
Leu Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro Ser Val Phe 115 120
125Pro Leu Ala Pro Cys Ser Arg Ser Thr Ser Glu Ser Thr Ala Ala Leu
130 135 140Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val
Ser Trp145 150 155 160Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr
Phe Pro Ala Val Leu 165 170 175Gln Ser Ser Gly Leu Tyr Ser Leu Ser
Ser Val Val Thr Val Pro Ser 180 185 190Ser Asn Phe Gly Thr Gln Thr
Tyr Thr Cys Asn Val Asp His Lys Pro 195 200 205Ser Asn Thr Lys Val
Asp Lys Thr Val Glu Arg Lys Cys Cys Val Glu 210 215
220Cys Pro Pro Cys Pro Ala Pro Pro Val Ala Gly Pro Ser Val Phe
Leu225 230 235 240Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser
Arg Thr Pro Glu 245 250 255Val Thr Cys Val Val Val Asp Val Ser His
Glu Asp Pro Glu Val Gln 260 265 270Phe Asn Trp Tyr Val Asp Gly Val
Glu Val His Asn Ala Lys Thr Lys 275 280 285Pro Arg Glu Glu Gln Phe
Asn Ser Thr Phe Arg Val Val Ser Val Leu 290 295 300Thr Val Val His
Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys305 310 315 320Val
Ser Asn Lys Gly Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys 325 330
335Thr Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser
340 345 350Arg Glu Glu Met Thr Lys Asn Gln Val Ser Leu Thr Cys Leu
Val Lys 355 360 365Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu
Ser Asn Gly Gln 370 375 380Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro
Met Leu Asp Ser Asp Gly385 390 395 400Ser Phe Phe Leu Tyr Ser Lys
Leu Thr Val Asp Lys Ser Arg Trp Gln 405 410 415Gln Gly Asn Val Phe
Ser Cys Ser Val Met His Glu Ala Leu His Asn 420 425 430His Tyr Thr
Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys 435 440 44511645DNAHomo
sapiens 11gacatccaga tgacccagtc tccatcctcc ctgtctgcat ctgtaggaga
cagagtcacc 60atcacttgcc gggcaagtca gggcattaga aatgctttag gctggtatca
gcagaaacca 120gggaaagccc ctaagcgcct gatctatgct gcatccagtt
tgcaaagtgg ggtcccatca 180aggttcagcg gcagtggatc tgggacagaa
ttcactctca caatcagcag cctgcagcct 240gaagattttg caacttatta
ctgtctacag cataatagtt accctcggac gttcggccaa 300gggaccaagg
tggaaatcaa acgaactgtg gctgcaccat ctgtcttcat cttcccgcca
360tctgatgagc agttgaaatc tggaactgcc tctgttgtgt gcctgctgaa
taacttctat 420cccagagagg ccaaagtaca gtggaaggtg gataacgccc
tccaatcggg taactcccag 480gagagtgtca cagagcagga cagcaaggac
agcacctaca gcctcagcag caccctgacg 540ctgagcaaag cagactacga
gaaacacaaa gtctacgcct gcgaagtcac ccatcagggc 600ctgagctcgc
ccgtcacaaa gagcttcaac aggggagagt gttag 64512214PRTHomo sapiens
12Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly1
5 10 15Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Ile Arg Asn
Ala 20 25 30Leu Gly Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Arg
Leu Ile 35 40 45Tyr Ala Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg
Phe Ser Gly 50 55 60Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser
Ser Leu Gln Pro65 70 75 80Glu Asp Phe Ala Thr Tyr Tyr Cys Leu Gln
His Asn Ser Tyr Pro Arg 85 90 95Thr Phe Gly Gln Gly Thr Lys Val Glu
Ile Lys Arg Thr Val Ala Ala 100 105 110Pro Ser Val Phe Ile Phe Pro
Pro Ser Asp Glu Gln Leu Lys Ser Gly 115 120 125Thr Ala Ser Val Val
Cys Leu Leu Asn Asn Phe Tyr Pro Arg Glu Ala 130 135 140Lys Val Gln
Trp Lys Val Asp Asn Ala Leu Gln Ser Gly Asn Ser Gln145 150 155
160Glu Ser Val Thr Glu Gln Asp Ser Lys Asp Ser Thr Tyr Ser Leu Ser
165 170 175Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu Lys His Lys
Val Tyr 180 185 190Ala Cys Glu Val Thr His Gln Gly Leu Ser Ser Pro
Val Thr Lys Ser 195 200 205Phe Asn Arg Gly Glu Cys 210131338DNAHomo
sapiens 13gaggtgcagc tggtggagtc tgggggaggc ctggtcaagc ctggggggtc
cctgagactc 60tcctgtgcag cctctggatt caccttcagt agctatagca tgaactgggt
ccgccaggct 120ccagggaagg ggctggagtg ggtctcatcc attagtagta
gtagtagtta catatactac 180gcagactcag tgaagggccg attcaccatc
tccagagaca acgccaagaa ctcactgtat 240ctgcaaatga acagcctgag
agccgaggac acggctgtgt attactgtgc gagagatagg 300ggatactact
acggtatgga cgtctggggc caagggacca cggtcaccgt ctcctcagcc
360tccaccaagg gcccatcggt cttccccctg gcgccctgct ccaggagcac
ctccgagagc 420acagcggccc tgggctgcct ggtcaaggac tacttccccg
aaccggtgac ggtgtcgtgg 480aactcaggcg ctctgaccag cggcgtgcac
accttcccag ctgtcctaca gtcctcagga 540ctctactccc tcagcagcgt
ggtgaccgtg ccctccagca acttcggcac ccagacctac 600acctgcaacg
tagatcacaa gcccagcaac accaaggtgg acaagacagt tgagcgcaaa
660tgttgtgtcg agtgcccacc gtgcccagca ccacctgtgg caggaccgtc
agtcttcctc 720ttccccccaa aacccaagga caccctcatg atctcccgga
cccctgaggt cacgtgcgtg 780gtggtggacg tgagccacga agaccccgag
gtccagttca actggtacgt ggacggcgtg 840gaggtgcata atgccaagac
aaagccacgg gaggagcagt tcaacagcac gttccgtgtg 900gtcagcgtcc
tcaccgttgt gcaccaggac tggctgaacg gcaaggagta caagtgcaag
960gtctccaaca aaggcctccc agcccccatc gagaaaacca tctccaaaac
caaagggcag 1020ccccgagaac cacaggtgta caccctgccc ccatcccggg
aggagatgac caagaaccag 1080gtcagcctga cctgcctggt caaaggcttc
taccccagcg acatcgccgt ggagtgggag 1140agcaatgggc agccggagaa
caactacaag accacacctc ccatgctgga ctccgacggc 1200tccttcttcc
tctacagcaa gctcaccgtg gacaagagca ggtggcagca ggggaacgtc
1260ttctcatgct ccgtgatgca tgaggctctg cacaaccact acacgcagaa
gagcctctcc 1320ctgtctccgg gtaaatga 133814445PRTHomo sapiens 14Glu
Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly1 5 10
15Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30Ser Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp
Val 35 40 45Ser Ser Ile Ser Ser Ser Ser Ser Tyr Ile Tyr Tyr Ala Asp
Ser Val 50 55 60Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn
Ser Leu Tyr65 70 75 80Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr
Ala Val Tyr Tyr Cys 85 90 95Ala Arg Asp Arg Gly Tyr Tyr Tyr Gly Met
Asp Val Trp Gly Gln Gly 100 105 110Thr Thr Val Thr Val Ser Ser Ala
Ser Thr Lys Gly Pro Ser Val Phe 115 120 125Pro Leu Ala Pro Cys Ser
Arg Ser Thr Ser Glu Ser Thr Ala Ala Leu 130 135 140Gly Cys Leu Val
Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser Trp145 150 155 160Asn
Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val Leu 165 170
175Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro Ser
180 185 190Ser Asn Phe Gly Thr Gln Thr Tyr Thr Cys Asn Val Asp His
Lys Pro 195 200 205Ser Asn Thr Lys Val Asp Lys Thr Val Glu Arg Lys
Cys Cys Val Glu 210 215 220Cys Pro Pro Cys Pro Ala Pro Pro Val Ala
Gly Pro Ser Val Phe Leu225 230 235 240Phe Pro Pro Lys Pro Lys Asp
Thr Leu Met Ile Ser Arg Thr Pro Glu 245 250 255Val Thr Cys Val Val
Val Asp Val Ser His Glu Asp Pro Glu Val Gln 260 265 270Phe Asn Trp
Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys 275 280 285Pro
Arg Glu Glu Gln Phe Asn Ser Thr Phe Arg Val Val Ser Val Leu 290 295
300Thr Val Val His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys
Lys305 310 315 320Val Ser Asn Lys Gly Leu Pro Ala Pro Ile Glu Lys
Thr Ile Ser Lys 325 330 335Thr Lys Gly Gln Pro Arg Glu Pro Gln Val
Tyr Thr Leu Pro Pro Ser 340 345 350Arg Glu Glu Met Thr Lys Asn Gln
Val Ser Leu Thr Cys Leu Val Lys 355 360 365Gly Phe Tyr Pro Ser Asp
Ile Ala Val Glu Trp Glu Ser Asn Gly Gln 370 375 380Pro Glu Asn Asn
Tyr Lys Thr Thr Pro Pro Met Leu Asp Ser Asp Gly385 390 395 400Ser
Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln 405 410
415Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn
420 425 430His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys 435
440 44515645DNAHomo sapiens 15gacatccaga tgacccagtc tccatcctcc
ctgtctgcat ctgtaggaga cagagtcacc 60ctcacttgcc gggcaagtca gggcattaga
aatgctttag gctggtatca gcagaaacca 120gggaaagccc ctaagcgcct
gatctatggt gcatccagtt tgcaaagtgg ggtcccatca 180aggttcagcg
gcagtggatc tgggacagaa ttcactctca caatcagcag cctgcagcct
240gaagattttg caacttatta ctgtctacag cataatagtt acccattcac
tttcggccct 300gggaccaaag tggatatcaa acgaactgtg gctgcaccat
ctgtcttcat cttcccgcca 360tctgatgagc agttgaaatc tggaactgcc
tctgttgtgt gcctgctgaa taacttctat 420cccagagagg ccaaagtaca
gtggaaggtg gataacgccc tccaatcggg taactcccag 480gagagtgtca
cagagcagga cagcaaggac agcacctaca gcctcagcag caccctgacg
540ctgagcaaag cagactacga gaaacacaaa gtctacgcct gcgaagtcac
ccatcagggc 600ctgagctcgc ccgtcacaaa gagcttcaac aggggagagt gttag
64516214PRTHomo sapiens 16Asp Ile Gln Met Thr Gln Ser Pro Ser Ser
Leu Ser Ala Ser Val Gly1 5 10 15Asp Arg Val Thr Leu Thr Cys Arg Ala
Ser Gln Gly Ile Arg Asn Ala 20 25 30Leu Gly Trp Tyr Gln Gln Lys Pro
Gly Lys Ala Pro Lys Arg Leu Ile 35 40 45Tyr Gly Ala Ser Ser Leu Gln
Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60Ser Gly Ser Gly Thr Glu
Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro65 70 75 80Glu Asp Phe Ala
Thr Tyr Tyr Cys Leu Gln His Asn Ser Tyr Pro Phe 85 90 95Thr Phe Gly
Pro Gly Thr Lys Val Asp Ile Lys Arg Thr Val Ala Ala 100 105 110Pro
Ser Val Phe Ile Phe Pro Pro Ser Asp Glu Gln Leu Lys Ser Gly 115 120
125Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe Tyr Pro Arg Glu Ala
130 135 140Lys Val Gln Trp Lys Val Asp Asn Ala Leu Gln Ser Gly Asn
Ser Gln145 150 155 160Glu Ser Val Thr Glu Gln Asp Ser Lys Asp Ser
Thr Tyr Ser Leu Ser 165 170 175Ser Thr Leu Thr Leu Ser Lys Ala Asp
Tyr Glu Lys His Lys Val Tyr 180 185 190Ala Cys Glu Val Thr His Gln
Gly Leu Ser Ser Pro Val Thr Lys Ser 195 200 205Phe Asn Arg Gly Glu
Cys 210171338DNAHomo sapiens 17gaggtgcagc tggtggagtc tgggggaggc
ctggtcaagc ctggggggtc cctgagactc 60tcctgtgcag cctctggatt caccttcagt
agctatagca tgaactgggt ccgccaggct 120ccagggaagg ggctggagtg
ggtctcatcc attagtagta gtagtagtta catatactac 180gcagactcag
tgaagggccg attcaccatc tccagagaca acgccaagaa ctcactgtat
240ctgcaaatga acagcctgag agccgaggac acgactgtgt attactgtgc
gagagatcga 300ggctacctct acggtatgga cgtctggggc caagggacca
cggtcaccgt ctcctcagcc 360tccaccaagg gcccatcggt cttccccctg
gcgccctgct ccaggagcac ctccgagagc 420acagcggccc tgggctgcct
ggtcaaggac tacttccccg aaccggtgac ggtgtcgtgg 480aactcaggcg
ctctgaccag cggcgtgcac accttcccag ctgtcctaca gtcctcagga
540ctctactccc tcagcagcgt ggtgaccgtg ccctccagca acttcggcac
ccagacctac 600acctgcaacg tagatcacaa gcccagcaac accaaggtgg
acaagacagt tgagcgcaaa 660tgttgtgtcg agtgcccacc gtgcccagca
ccacctgtgg caggaccgtc agtcttcctc 720ttccccccaa aacccaagga
caccctcatg atctcccgga cccctgaggt cacgtgcgtg 780gtggtggacg
tgagccacga agaccccgag gtccagttca actggtacgt ggacggcgtg
840gaggtgcata atgccaagac aaagccacgg gaggagcagt tcaacagcac
gttccgtgtg 900gtcagcgtcc tcaccgttgt gcaccaggac tggctgaacg
gcaaggagta caagtgcaag 960gtctccaaca aaggcctccc agcccccatc
gagaaaacca tctccaaaac caaagggcag 1020ccccgagaac cacaggtgta
caccctgccc ccatcccggg aggagatgac caagaaccag 1080gtcagcctga
cctgcctggt caaaggcttc taccccagcg acatcgccgt ggagtgggag
1140agcaatgggc agccggagaa caactacaag accacacctc ccatgctgga
ctccgacggc 1200tccttcttcc tctacagcaa gctcaccgtg gacaagagca
ggtggcagca ggggaacgtc 1260ttctcatgct ccgtgatgca tgaggctctg
cacaaccact acacgcagaa gagcctctcc 1320ctgtctccgg gtaaatga
133818445PRTHomo sapiens 18Glu Val Gln Leu Val Glu Ser Gly Gly Gly
Leu Val Lys Pro Gly Gly1 5 10 15Ser Leu Arg Leu Ser Cys Ala Ala Ser
Gly Phe Thr Phe Ser Ser Tyr 20 25 30Ser Met Asn Trp Val Arg Gln Ala
Pro Gly Lys Gly Leu Glu Trp Val 35 40 45Ser Ser Ile Ser Ser Ser Ser
Ser Tyr Ile Tyr Tyr Ala Asp Ser Val 50 55 60Lys Gly Arg Phe Thr Ile
Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr65 70 75 80Leu Gln Met Asn
Ser Leu Arg Ala Glu Asp Thr Thr Val Tyr Tyr Cys 85 90 95Ala Arg Asp
Arg Gly Tyr Leu Tyr Gly Met Asp Val Trp Gly Gln Gly 100 105 110Thr
Thr Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro Ser Val Phe 115 120
125Pro Leu Ala Pro Cys Ser Arg Ser Thr Ser Glu Ser Thr Ala Ala Leu
130 135 140Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val
Ser Trp145 150 155 160Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr
Phe Pro Ala Val Leu 165 170 175Gln Ser Ser Gly Leu Tyr Ser Leu Ser
Ser Val Val Thr Val Pro Ser 180 185 190Ser Asn Phe Gly Thr Gln Thr
Tyr Thr Cys Asn Val Asp His Lys Pro 195 200 205Ser Asn Thr Lys Val
Asp Lys Thr Val Glu Arg Lys Cys Cys Val Glu 210 215 220Cys Pro Pro
Cys Pro Ala Pro Pro Val Ala Gly Pro Ser Val Phe Leu225 230 235
240Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu
245 250 255Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu
Val Gln 260 265 270Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn
Ala Lys Thr Lys 275 280 285Pro Arg Glu Glu Gln Phe Asn Ser Thr Phe
Arg Val Val Ser Val Leu 290 295 300Thr Val Val His Gln Asp Trp Leu
Asn Gly Lys Glu Tyr Lys Cys Lys305 310 315 320Val Ser Asn Lys Gly
Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys 325 330 335Thr Lys Gly
Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser 340 345 350Arg
Glu Glu Met Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys 355 360
365Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln
370 375 380Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Met Leu Asp Ser
Asp Gly385 390 395 400Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp
Lys Ser Arg Trp Gln 405 410 415Gln Gly Asn Val Phe Ser Cys Ser Val
Met His Glu Ala Leu His Asn 420 425 430His Tyr Thr Gln Lys Ser Leu
Ser Leu Ser Pro Gly Lys 435 440 44519645DNAHomo sapiens
19gacatccaga tgacccagtc tccatcctcc ctgtctgcat ctgtaggaga cagagtcacc
60atcacttgcc gggcaagtca ggccattaga aatgatttag gctggtatca gcagaaacca
120gggaaagccc ctaagcgcct gatctatgct gcatccagtt tgcaaagtgg
ggtcccatca 180aggttcagcg gcagtggatc tgggacagaa ttcactctca
caatcagcag cctgcagcct 240gaagattttg caacttatta ctgtctacag
cataatagtt accctcggac gttcggccaa 300gggaccaagg tggaaatcaa
acgaactgtg gctgcaccat ctgtcttcat cttcccgcca 360tctgatgagc
agttgaaatc tggaactgcc tctgttgtgt gcctgctgaa taacttctat
420cccagagagg ccaaagtaca gtggaaggtg gataacgccc tccaatcggg
taactcccag 480gagagtgtca cagagcagga cagcaaggac agcacctaca
gcctcagcag caccctgacg 540ctgagcaaag cagactacga gaaacacaaa
gtctacgcct gcgaagtcac ccatcagggc 600ctgagctcgc ccgtcacaaa
gagcttcaac aggggagagt gttag 64520214PRTHomo sapiens 20Asp Ile Gln
Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly1 5 10 15Asp Arg
Val Thr Ile Thr Cys Arg Ala Ser Gln Ala Ile Arg Asn Asp 20 25 30Leu
Gly Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Arg Leu Ile 35 40
45Tyr Ala Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly
50 55 60Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Ser Leu Gln
Pro65 70 75 80Glu Asp Phe Ala Thr Tyr Tyr Cys Leu Gln His Asn Ser
Tyr Pro Arg 85 90 95Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg
Thr Val Ala Ala 100 105 110Pro Ser Val Phe Ile Phe Pro Pro Ser Asp
Glu Gln Leu Lys Ser Gly
115 120 125Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe Tyr Pro Arg
Glu Ala 130 135 140Lys Val Gln Trp Lys Val Asp Asn Ala Leu Gln Ser
Gly Asn Ser Gln145 150 155 160Glu Ser Val Thr Glu Gln Asp Ser Lys
Asp Ser Thr Tyr Ser Leu Ser 165 170 175Ser Thr Leu Thr Leu Ser Lys
Ala Asp Tyr Glu Lys His Lys Val Tyr 180 185 190Ala Cys Glu Val Thr
His Gln Gly Leu Ser Ser Pro Val Thr Lys Ser 195 200 205Phe Asn Arg
Gly Glu Cys 210211350DNAHomo sapiens 21caggtgcagc tggtgcagtc
tggggctgag gtgaagaagc ctggggcctc agtgaaggtc 60tcctgcaagg cttctggata
taccttcacc ggctactata tgcactgggt gcgacaggcc 120cctggacaag
ggcttgagtg gatgggatgg atcaacccta acagtggtgg cacaaactat
180gcacagaagt ttcagggcag ggtcaccatg accagggaca cgtccatcag
cacagcctac 240ctggagctga gcaggctgag atctgacgac acggccgtgt
attactgtgc gagaaatacg 300gtgggaactg gatactacta ctacggtatg
gacgtctggg gccaagggac cacggtcacc 360gtctcctcag cctccaccaa
gggcccatcg gtcttccccc tggcgccctg ctccaggagc 420acctccgaga
gcacagcggc cctgggctgc ctggtcaagg actacttccc cgaaccggtg
480acggtgtcgt ggaactcagg cgctctgacc agcggcgtgc acaccttccc
agctgtccta 540cagtcctcag gactctactc cctcagcagc gtggtgaccg
tgccctccag caacttcggc 600acccagacct acacctgcaa cgtagatcac
aagcccagca acaccaaggt ggacaagaca 660gttgagcgca aatgttgtgt
cgagtgccca ccgtgcccag caccacctgt ggcaggaccg 720tcagtcttcc
tcttcccccc aaaacccaag gacaccctca tgatctcccg gacccctgag
780gtcacgtgcg tggtggtgga cgtgagccac gaagaccccg aggtccagtt
caactggtac 840gtggacggcg tggaggtgca taatgccaag acaaagccac
gggaggagca gttcaacagc 900acgttccgtg tggtcagcgt cctcaccgtt
gtgcaccagg actggctgaa cggcaaggag 960tacaagtgca aggtctccaa
caaaggcctc ccagccccca tcgagaaaac catctccaaa 1020accaaagggc
agccccgaga accacaggtg tacaccctgc ccccatcccg ggaggagatg
1080accaagaacc aggtcagcct gacctgcctg gtcaaaggct tctaccccag
cgacatcgcc 1140gtggagtggg agagcaatgg gcagccggag aacaactaca
agaccacacc tcccatgctg 1200gactccgacg gctccttctt cctctacagc
aagctcaccg tggacaagag caggtggcag 1260caggggaacg tcttctcatg
ctccgtgatg catgaggctc tgcacaacca ctacacgcag 1320aagagcctct
ccctgtctcc gggtaaatga 135022449PRTHomo sapiens 22Gln Val Gln Leu
Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala1 5 10 15Ser Val Lys
Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Gly Tyr 20 25 30Tyr Met
His Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met 35 40 45Gly
Trp Ile Asn Pro Asn Ser Gly Gly Thr Asn Tyr Ala Gln Lys Phe 50 55
60Gln Gly Arg Val Thr Met Thr Arg Asp Thr Ser Ile Ser Thr Ala Tyr65
70 75 80Leu Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr
Cys 85 90 95Ala Arg Asn Thr Val Gly Thr Gly Tyr Tyr Tyr Tyr Gly Met
Asp Val 100 105 110Trp Gly Gln Gly Thr Thr Val Thr Val Ser Ser Ala
Ser Thr Lys Gly 115 120 125Pro Ser Val Phe Pro Leu Ala Pro Cys Ser
Arg Ser Thr Ser Glu Ser 130 135 140Thr Ala Ala Leu Gly Cys Leu Val
Lys Asp Tyr Phe Pro Glu Pro Val145 150 155 160Thr Val Ser Trp Asn
Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe 165 170 175Pro Ala Val
Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val 180 185 190Thr
Val Pro Ser Ser Asn Phe Gly Thr Gln Thr Tyr Thr Cys Asn Val 195 200
205Asp His Lys Pro Ser Asn Thr Lys Val Asp Lys Thr Val Glu Arg Lys
210 215 220Cys Cys Val Glu Cys Pro Pro Cys Pro Ala Pro Pro Val Ala
Gly Pro225 230 235 240Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp
Thr Leu Met Ile Ser 245 250 255Arg Thr Pro Glu Val Thr Cys Val Val
Val Asp Val Ser His Glu Asp 260 265 270Pro Glu Val Gln Phe Asn Trp
Tyr Val Asp Gly Val Glu Val His Asn 275 280 285Ala Lys Thr Lys Pro
Arg Glu Glu Gln Phe Asn Ser Thr Phe Arg Val 290 295 300Val Ser Val
Leu Thr Val Val His Gln Asp Trp Leu Asn Gly Lys Glu305 310 315
320Tyr Lys Cys Lys Val Ser Asn Lys Gly Leu Pro Ala Pro Ile Glu Lys
325 330 335Thr Ile Ser Lys Thr Lys Gly Gln Pro Arg Glu Pro Gln Val
Tyr Thr 340 345 350Leu Pro Pro Ser Arg Glu Glu Met Thr Lys Asn Gln
Val Ser Leu Thr 355 360 365Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp
Ile Ala Val Glu Trp Glu 370 375 380Ser Asn Gly Gln Pro Glu Asn Asn
Tyr Lys Thr Thr Pro Pro Met Leu385 390 395 400Asp Ser Asp Gly Ser
Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys 405 410 415Ser Arg Trp
Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu 420 425 430Ala
Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly 435 440
445Lys23660DNAHomo sapiens 23gatattgtga tgactcagtc tccactctcc
ctgcccgtca cccctggaga gccggcctcc 60atctcctgca ggtctagtca gagcctcctg
catagtaatg gatacaacta tttggattgg 120tacctgcaga agccagggca
gtctccacag gtcctgatct atttggtttc taatcgggcc 180tccggggtcc
ctgacaggtt cagtggcagt ggatcaggca cagattttac actgaaaatc
240agcagagtgg aggctgagga tgttggggtt tattactgca tgcaagctct
acaaactcct 300cccactttcg gcggagggac caaggtggag atcaaacgaa
ctgtggctgc accatctgtc 360ttcatcttcc cgccatctga tgagcagttg
aaatctggaa ctgcctctgt tgtgtgcctg 420ctgaataact tctatcccag
agaggccaaa gtacagtgga aggtggataa cgccctccaa 480tcgggtaact
cccaggagag tgtcacagag caggacagca aggacagcac ctacagcctc
540agcagcaccc tgacgctgag caaagcagac tacgagaaac acaaagtcta
cgcctgcgaa 600gtcacccatc agggcctgag ctcgcccgtc acaaagagct
tcaacagggg agagtgttag 66024219PRTHomo sapiens 24Asp Ile Val Met Thr
Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly1 5 10 15Glu Pro Ala Ser
Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser 20 25 30Asn Gly Tyr
Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45Pro Gln
Val Leu Ile Tyr Leu Val Ser Asn Arg Ala Ser Gly Val Pro 50 55 60Asp
Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70 75
80Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Ala
85 90 95Leu Gln Thr Pro Pro Thr Phe Gly Gly Gly Thr Lys Val Glu Ile
Lys 100 105 110Arg Thr Val Ala Ala Pro Ser Val Phe Ile Phe Pro Pro
Ser Asp Glu 115 120 125Gln Leu Lys Ser Gly Thr Ala Ser Val Val Cys
Leu Leu Asn Asn Phe 130 135 140Tyr Pro Arg Glu Ala Lys Val Gln Trp
Lys Val Asp Asn Ala Leu Gln145 150 155 160Ser Gly Asn Ser Gln Glu
Ser Val Thr Glu Gln Asp Ser Lys Asp Ser 165 170 175Thr Tyr Ser Leu
Ser Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu 180 185 190Lys His
Lys Val Tyr Ala Cys Glu Val Thr His Gln Gly Leu Ser Ser 195 200
205Pro Val Thr Lys Ser Phe Asn Arg Gly Glu Cys 210 215251350DNAHomo
sapiens 25gaggtgcagc tattggagtc tgggggaggc ttgatacagc ctggggggtc
cctgagactc 60tcctgtgcag cctctggatt cacctttagc agctttgcca tgagctgggt
ccgccaggct 120ccagggaagg ggctggaatg ggtctcaact attagtggta
gtggtggtta cacattctac 180gcagactccg tgaagggccg gttcaccatc
tccagagaca attccaagaa cacgctgtat 240ctgcaaatga acagcctgag
agccgaggac acggccgtat attactgtgc gaaagatgga 300aggtataact
ggaactacgg ggcttttgat atctggggcc aagggacaat ggtcaccgtc
360tcttcagctt ccaccaaggg cccatccgtc ttccccctgg cgccctgctc
caggagcacc 420tccgagagca cagccgccct gggctgcctg gtcaaggact
acttccccga accggtgacg 480gtgtcgtgga actcaggcgc cctgaccagc
ggcgtgcaca ccttcccggc tgtcctacag 540tcctcaggac tctactccct
cagcagcgtg gtgaccgtgc cctccagcag cttgggcacg 600aagacctaca
cctgcaacgt agatcacaag cccagcaaca ccaaggtgga caagagagtt
660gagtccaaat atggtccccc atgcccatca tgcccagcac ctgagttcct
ggggggacca 720tcagtcttcc tgttcccccc aaaacccaag gacactctca
tgatctcccg gacccctgag 780gtcacgtgcg tggtggtgga cgtgagccag
gaagaccccg aggtccagtt caactggtac 840gtggatggcg tggaggtgca
taatgccaag acaaagccgc gggaggagca gttcaacagc 900acgtaccgtg
tggtcagcgt cctcaccgtc ctgcaccagg actggctgaa cggcaaggag
960tacaagtgca aggtctccaa caaaggcctc ccgtcctcca tcgagaaaac
catctccaaa 1020gccaaagggc agccccgaga gccacaggtg tacaccctgc
ccccatccca ggaggagatg 1080accaagaacc aggtcagcct gacctgcctg
gtcaaaggct tctaccccag cgacatcgcc 1140gtggagtggg agagcaatgg
gcagccggag aacaactaca agaccacgcc tcccgtgctg 1200gactccgacg
gctccttctt cctctacagc aggctaaccg tggacaagag caggtggcag
1260gaggggaatg tcttctcatg ctccgtgatg catgaggctc tgcacaacca
ctacacacag 1320aagagcctct ccctgtctct gggtaaatga 135026449PRTHomo
sapiens 26Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Ile Gln Pro
Gly Gly1 5 10 15Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe
Ser Ser Phe 20 25 30Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly
Leu Glu Trp Val 35 40 45Ser Thr Ile Ser Gly Ser Gly Gly Tyr Thr Phe
Tyr Ala Asp Ser Val 50 55 60Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn
Ser Lys Asn Thr Leu Tyr65 70 75 80Leu Gln Met Asn Ser Leu Arg Ala
Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Lys Asp Gly Arg Tyr Asn
Trp Asn Tyr Gly Ala Phe Asp Ile Trp 100 105 110Gly Gln Gly Thr Met
Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro 115 120 125Ser Val Phe
Pro Leu Ala Pro Cys Ser Arg Ser Thr Ser Glu Ser Thr 130 135 140Ala
Ala Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr145 150
155 160Val Ser Trp Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe
Pro 165 170 175Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser
Val Val Thr 180 185 190Val Pro Ser Ser Ser Leu Gly Thr Lys Thr Tyr
Thr Cys Asn Val Asp 195 200 205His Lys Pro Ser Asn Thr Lys Val Asp
Lys Arg Val Glu Ser Lys Tyr 210 215 220Gly Pro Pro Cys Pro Ser Cys
Pro Ala Pro Glu Phe Leu Gly Gly Pro225 230 235 240Ser Val Phe Leu
Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser 245 250 255Arg Thr
Pro Glu Val Thr Cys Val Val Val Asp Val Ser Gln Glu Asp 260 265
270Pro Glu Val Gln Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn
275 280 285Ala Lys Thr Lys Pro Arg Glu Glu Gln Phe Asn Ser Thr Tyr
Arg Val 290 295 300Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu
Asn Gly Lys Glu305 310 315 320Tyr Lys Cys Lys Val Ser Asn Lys Gly
Leu Pro Ser Ser Ile Glu Lys 325 330 335Thr Ile Ser Lys Ala Lys Gly
Gln Pro Arg Glu Pro Gln Val Tyr Thr 340 345 350Leu Pro Pro Ser Gln
Glu Glu Met Thr Lys Asn Gln Val Ser Leu Thr 355 360 365Cys Leu Val
Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu 370 375 380Ser
Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu385 390
395 400Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Arg Leu Thr Val Asp
Lys 405 410 415Ser Arg Trp Gln Glu Gly Asn Val Phe Ser Cys Ser Val
Met His Glu 420 425 430Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu
Ser Leu Ser Leu Gly 435 440 445Lys27645DNAHomo sapiens 27gaaatagtga
tgacgcagtc tccagccacc ctgtctgtgt ctccagggga aagagccacc 60ctctcctgca
gggccagtca gagtgttagt agcaacttag cctggtacca gcagaaacct
120ggccaggctc ccaggctcct catctatggt gcatccacca gggccactgg
tttcccagcc 180aggttcagtg gcagtgggtc tgggacagag ttcactctca
ccatcagcag cctgcagtct 240gaagattttg caatttatta ctgtcagcag
tataataact ggccgctcac tttcggcggg 300gggaccaagg tggagatcaa
acgaactgtg gctgcaccat ctgtcttcat cttcccgcca 360tctgatgagc
agttgaaatc tggaactgcc tctgttgtgt gcctgctgaa taacttctat
420cccagagagg ccaaagtaca gtggaaggtg gataacgccc tccaatcggg
taactcccag 480gagagtgtca cagagcagga cagcaaggac agcacctaca
gcctcagcag caccctgacg 540ctgagcaaag cagactacga gaaacacaaa
gtctacgcct gcgaagtcac ccatcagggc 600ctgagctcgc ccgtcacaaa
gagcttcaac aggggagagt gttag 64528214PRTHomo sapiens 28Glu Ile Val
Met Thr Gln Ser Pro Ala Thr Leu Ser Val Ser Pro Gly1 5 10 15Glu Arg
Ala Thr Leu Ser Cys Arg Ala Ser Gln Ser Val Ser Ser Asn 20 25 30Leu
Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu Ile 35 40
45Tyr Gly Ala Ser Thr Arg Ala Thr Gly Phe Pro Ala Arg Phe Ser Gly
50 55 60Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Ser Leu Gln
Ser65 70 75 80Glu Asp Phe Ala Ile Tyr Tyr Cys Gln Gln Tyr Asn Asn
Trp Pro Leu 85 90 95Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys Arg
Thr Val Ala Ala 100 105 110Pro Ser Val Phe Ile Phe Pro Pro Ser Asp
Glu Gln Leu Lys Ser Gly 115 120 125Thr Ala Ser Val Val Cys Leu Leu
Asn Asn Phe Tyr Pro Arg Glu Ala 130 135 140Lys Val Gln Trp Lys Val
Asp Asn Ala Leu Gln Ser Gly Asn Ser Gln145 150 155 160Glu Ser Val
Thr Glu Gln Asp Ser Lys Asp Ser Thr Tyr Ser Leu Ser 165 170 175Ser
Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu Lys His Lys Val Tyr 180 185
190Ala Cys Glu Val Thr His Gln Gly Leu Ser Ser Pro Val Thr Lys Ser
195 200 205Phe Asn Arg Gly Glu Cys 210291338DNAHomo sapiens
29gaggtgcagc tggtggagtc tgggggaggc ctggtcaagc ctggggggtc cctgagactc
60tcctgtgcag cctctggatt caccttcagt agctatagca tgaactgggt ccgccaggct
120ccagggaagg ggctggagtg ggtctcatcc attagtagta gtagtagtta
catatactac 180gcagactcag tgaagggccg attcaccatc tccagagaca
acgccaagaa ctcactgtat 240ctgcaaatga acagcctgag agccgaggac
acggctgtgt attactgtgc gagagaccgt 300gggagctact tcctctttga
ctactggggc cagggaaccc tggtcaccgt ctcctcagcc 360tccaccaagg
gcccatcggt cttccccctg gcgccctgct ccaggagcac ctccgagagc
420acagcggccc tgggctgcct ggtcaaggac tacttccccg aaccggtgac
ggtgtcgtgg 480aactcaggcg ctctgaccag cggcgtgcac accttcccag
ctgtcctaca gtcctcagga 540ctctactccc tcagcagcgt ggtgaccgtg
ccctccagca acttcggcac ccagacctac 600acctgcaacg tagatcacaa
gcccagcaac accaaggtgg acaagacagt tgagcgcaaa 660tgttgtgtcg
agtgcccacc gtgcccagca ccacctgtgg caggaccgtc agtcttcctc
720ttccccccaa aacccaagga caccctcatg atctcccgga cccctgaggt
cacgtgcgtg 780gtggtggacg tgagccacga agaccccgag gtccagttca
actggtacgt ggacggcgtg 840gaggtgcata atgccaagac aaagccacgg
gaggagcagt tcaacagcac gttccgtgtg 900gtcagcgtcc tcaccgttgt
gcaccaggac tggctgaacg gcaaggagta caagtgcaag 960gtctccaaca
aaggcctccc agcccccatc gagaaaacca tctccaaaac caaagggcag
1020ccccgagaac cacaggtgta caccctgccc ccatcccggg aggagatgac
caagaaccag 1080gtcagcctga cctgcctggt caaaggcttc taccccagcg
acatcgccgt ggagtgggag 1140agcaatgggc agccggagaa caactacaag
accacacctc ccatgctgga ctccgacggc 1200tccttcttcc tctacagcaa
gctcaccgtg gacaagagca ggtggcagca ggggaacgtc 1260ttctcatgct
ccgtgatgca tgaggctctg cacaaccact acacgcagaa gagcctctcc
1320ctgtctccgg gtaaatga 133830445PRTHomo sapiens 30Glu Val Gln Leu
Val Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly1 5 10 15Ser Leu Arg
Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30Ser Met
Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45Ser
Ser Ile Ser Ser Ser Ser Ser Tyr Ile Tyr Tyr Ala Asp Ser Val 50 55
60Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr65
70 75 80Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr
Cys 85 90 95Ala Arg Asp Arg Gly Ser Tyr Phe Leu Phe Asp Tyr Trp Gly
Gln Gly 100 105 110Thr Leu Val Thr Val Ser Ser Ala Ser Thr Lys Gly
Pro Ser Val Phe 115 120 125Pro Leu Ala Pro Cys Ser Arg
Ser Thr Ser Glu Ser Thr Ala Ala Leu 130 135 140Gly Cys Leu Val Lys
Asp Tyr Phe Pro Glu Pro Val Thr Val Ser Trp145 150 155 160Asn Ser
Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val Leu 165 170
175Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro Ser
180 185 190Ser Asn Phe Gly Thr Gln Thr Tyr Thr Cys Asn Val Asp His
Lys Pro 195 200 205Ser Asn Thr Lys Val Asp Lys Thr Val Glu Arg Lys
Cys Cys Val Glu 210 215 220Cys Pro Pro Cys Pro Ala Pro Pro Val Ala
Gly Pro Ser Val Phe Leu225 230 235 240Phe Pro Pro Lys Pro Lys Asp
Thr Leu Met Ile Ser Arg Thr Pro Glu 245 250 255Val Thr Cys Val Val
Val Asp Val Ser His Glu Asp Pro Glu Val Gln 260 265 270Phe Asn Trp
Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys 275 280 285Pro
Arg Glu Glu Gln Phe Asn Ser Thr Phe Arg Val Val Ser Val Leu 290 295
300Thr Val Val His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys
Lys305 310 315 320Val Ser Asn Lys Gly Leu Pro Ala Pro Ile Glu Lys
Thr Ile Ser Lys 325 330 335Thr Lys Gly Gln Pro Arg Glu Pro Gln Val
Tyr Thr Leu Pro Pro Ser 340 345 350Arg Glu Glu Met Thr Lys Asn Gln
Val Ser Leu Thr Cys Leu Val Lys 355 360 365Gly Phe Tyr Pro Ser Asp
Ile Ala Val Glu Trp Glu Ser Asn Gly Gln 370 375 380Pro Glu Asn Asn
Tyr Lys Thr Thr Pro Pro Met Leu Asp Ser Asp Gly385 390 395 400Ser
Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln 405 410
415Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn
420 425 430His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys 435
440 44531645DNAHomo sapiens 31gacatgcaga tgacccagtc tccatcctcc
ctgtctgcat ctgtaggaga cagagtcacc 60atcacttgcc gggcaagtca gggcattaga
aatgatttag gctggtatca gcagaaacca 120gggaaagccc ctaagcgcct
gatctatggt gcatccagtt tgcaaagtgg ggtcccatca 180aggttcagcg
gcagtggatc tgggacagaa ttcactctca caatcagcag cctgcagcct
240gaagattctg caacttatta ctgtctacag cataatagtt acccgctcac
tttcggcgga 300gggaccaagg tggagatcaa acgaactgtg gctgcaccat
ctgtcttcat cttcccgcca 360tctgatgagc agttgaaatc tggaactgcc
tctgttgtgt gcctgctgaa taacttctat 420cccagagagg ccaaagtaca
gtggaaggtg gataacgccc tccaatcggg taactcccag 480gagagtgtca
cagagcagga cagcaaggac agcacctaca gcctcagcag caccctgacg
540ctgagcaaag cagactacga gaaacacaaa gtctacgcct gcgaagtcac
ccatcagggc 600ctgagctcgc ccgtcacaaa gagcttcaac aggggagagt gttag
64532214PRTHomo sapiens 32Asp Met Gln Met Thr Gln Ser Pro Ser Ser
Leu Ser Ala Ser Val Gly1 5 10 15Asp Arg Val Thr Ile Thr Cys Arg Ala
Ser Gln Gly Ile Arg Asn Asp 20 25 30Leu Gly Trp Tyr Gln Gln Lys Pro
Gly Lys Ala Pro Lys Arg Leu Ile 35 40 45Tyr Gly Ala Ser Ser Leu Gln
Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60Ser Gly Ser Gly Thr Glu
Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro65 70 75 80Glu Asp Ser Ala
Thr Tyr Tyr Cys Leu Gln His Asn Ser Tyr Pro Leu 85 90 95Thr Phe Gly
Gly Gly Thr Lys Val Glu Ile Lys Arg Thr Val Ala Ala 100 105 110Pro
Ser Val Phe Ile Phe Pro Pro Ser Asp Glu Gln Leu Lys Ser Gly 115 120
125Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe Tyr Pro Arg Glu Ala
130 135 140Lys Val Gln Trp Lys Val Asp Asn Ala Leu Gln Ser Gly Asn
Ser Gln145 150 155 160Glu Ser Val Thr Glu Gln Asp Ser Lys Asp Ser
Thr Tyr Ser Leu Ser 165 170 175Ser Thr Leu Thr Leu Ser Lys Ala Asp
Tyr Glu Lys His Lys Val Tyr 180 185 190Ala Cys Glu Val Thr His Gln
Gly Leu Ser Ser Pro Val Thr Lys Ser 195 200 205Phe Asn Arg Gly Glu
Cys 210331338DNAHomo sapiens 33gaggtgcagc tggtggagtc tgggggaggc
ctggtcaagc ctggggggtc cctgagactc 60tcctgtgcag cctctggatt caccttcagt
agctatagca tgaactgggt ccgccaggct 120ccagggaagg ggctggagtg
ggtctcatcc attagtagta gtagtagtta catatactac 180gcagactcag
tgaagggccg attcaccatc tccagagaca acgccaagaa ctcactgtat
240ctgcaaatga acagcctgag agccgaggac acggctgtgt attactgtgc
gagagatcgt 300ggatacagct atggtcttga ctactggggc cagggaaccc
tggtcaccgt ctcctcagcc 360tccaccaagg gcccatcggt cttccccctg
gcgccctgct ccaggagcac ctccgagagc 420acagcggccc tgggctgcct
ggtcaaggac tacttccccg aaccggtgac ggtgtcgtgg 480aactcaggcg
ctctgaccag cggcgtgcac accttcccag ctgtcctaca gtcctcagga
540ctctactccc tcagcagcgt ggtgaccgtg ccctccagca acttcggcac
ccagacctac 600acctgcaacg tagatcacaa gcccagcaac accaaggtgg
acaagacagt tgagcgcaaa 660tgttgtgtcg agtgcccacc gtgcccagca
ccacctgtgg caggaccgtc agtcttcctc 720ttccccccaa aacccaagga
caccctcatg atctcccgga cccctgaggt cacgtgcgtg 780gtggtggacg
tgagccacga agaccccgag gtccagttca actggtacgt ggacggcgtg
840gaggtgcata atgccaagac aaagccacgg gaggagcagt tcaacagcac
gttccgtgtg 900gtcagcgtcc tcaccgttgt gcaccaggac tggctgaacg
gcaaggagta caagtgcaag 960gtctccaaca aaggcctccc agcccccatc
gagaaaacca tctccaaaac caaagggcag 1020ccccgagaac cacaggtgta
caccctgccc ccatcccggg aggagatgac caagaaccag 1080gtcagcctga
cctgcctggt caaaggcttc taccccagcg acatcgccgt ggagtgggag
1140agcaatgggc agccggagaa caactacaag accacacctc ccatgctgga
ctccgacggc 1200tccttcttcc tctacagcaa gctcaccgtg gacaagagca
ggtggcagca ggggaacgtc 1260ttctcatgct ccgtgatgca tgaggctctg
cacaaccact acacgcagaa gagcctctcc 1320ctgtctccgg gtaaatga
133834445PRTHomo sapiens 34Glu Val Gln Leu Val Glu Ser Gly Gly Gly
Leu Val Lys Pro Gly Gly1 5 10 15Ser Leu Arg Leu Ser Cys Ala Ala Ser
Gly Phe Thr Phe Ser Ser Tyr 20 25 30Ser Met Asn Trp Val Arg Gln Ala
Pro Gly Lys Gly Leu Glu Trp Val 35 40 45Ser Ser Ile Ser Ser Ser Ser
Ser Tyr Ile Tyr Tyr Ala Asp Ser Val 50 55 60Lys Gly Arg Phe Thr Ile
Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr65 70 75 80Leu Gln Met Asn
Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Arg Asp
Arg Gly Tyr Ser Tyr Gly Leu Asp Tyr Trp Gly Gln Gly 100 105 110Thr
Leu Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro Ser Val Phe 115 120
125Pro Leu Ala Pro Cys Ser Arg Ser Thr Ser Glu Ser Thr Ala Ala Leu
130 135 140Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val
Ser Trp145 150 155 160Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr
Phe Pro Ala Val Leu 165 170 175Gln Ser Ser Gly Leu Tyr Ser Leu Ser
Ser Val Val Thr Val Pro Ser 180 185 190Ser Asn Phe Gly Thr Gln Thr
Tyr Thr Cys Asn Val Asp His Lys Pro 195 200 205Ser Asn Thr Lys Val
Asp Lys Thr Val Glu Arg Lys Cys Cys Val Glu 210 215 220Cys Pro Pro
Cys Pro Ala Pro Pro Val Ala Gly Pro Ser Val Phe Leu225 230 235
240Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu
245 250 255Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu
Val Gln 260 265 270Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn
Ala Lys Thr Lys 275 280 285Pro Arg Glu Glu Gln Phe Asn Ser Thr Phe
Arg Val Val Ser Val Leu 290 295 300Thr Val Val His Gln Asp Trp Leu
Asn Gly Lys Glu Tyr Lys Cys Lys305 310 315 320Val Ser Asn Lys Gly
Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys 325 330 335Thr Lys Gly
Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser 340 345 350Arg
Glu Glu Met Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys 355 360
365Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln
370 375 380Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Met Leu Asp Ser
Asp Gly385 390 395 400Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp
Lys Ser Arg Trp Gln 405 410 415Gln Gly Asn Val Phe Ser Cys Ser Val
Met His Glu Ala Leu His Asn 420 425 430His Tyr Thr Gln Lys Ser Leu
Ser Leu Ser Pro Gly Lys 435 440 44535645DNAHomo sapiens
35gacatccaga tgacccagtc tccatcctcc ctgtctgcat ctgtaggaga cagagtcacc
60atcacttgcc gggcaagtca gggcattaga aatgatttag gctggtatca gcagaaacca
120gggaaagccc ctaagcgcct gatctatgct gcatccagtt tgcaaagtgg
ggtcccatca 180aggttcagcg gcagtggatc tgggacagaa ttcactctca
caatcagcag cctgcagcct 240gaagattttg cgacttatta ctgtctacag
cttaatagtt acccattcac tttcggccct 300gggaccaaag tggatatcaa
acgaactgtg gctgcaccat ctgtcttcat cttcccgcca 360tctgatgagc
agttgaaatc tggaactgcc tctgttgtgt gcctgctgaa taacttctat
420cccagagagg ccaaagtaca gtggaaggtg gataacgccc tccaatcggg
taactcccag 480gagagtgtca cagagcagga cagcaaggac agcacctaca
gcctcagcag caccctgacg 540ctgagcaaag cagactacga gaaacacaaa
gtctacgcct gcgaagtcac ccatcagggc 600ctgagctcgc ccgtcacaaa
gagcttcaac aggggagagt gttag 64536214PRTHomo sapiens 36Asp Ile Gln
Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly1 5 10 15Asp Arg
Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Ile Arg Asn Asp 20 25 30Leu
Gly Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Arg Leu Ile 35 40
45Tyr Ala Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly
50 55 60Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Ser Leu Gln
Pro65 70 75 80Glu Asp Phe Ala Thr Tyr Tyr Cys Leu Gln Leu Asn Ser
Tyr Pro Phe 85 90 95Thr Phe Gly Pro Gly Thr Lys Val Asp Ile Lys Arg
Thr Val Ala Ala 100 105 110Pro Ser Val Phe Ile Phe Pro Pro Ser Asp
Glu Gln Leu Lys Ser Gly 115 120 125Thr Ala Ser Val Val Cys Leu Leu
Asn Asn Phe Tyr Pro Arg Glu Ala 130 135 140Lys Val Gln Trp Lys Val
Asp Asn Ala Leu Gln Ser Gly Asn Ser Gln145 150 155 160Glu Ser Val
Thr Glu Gln Asp Ser Lys Asp Ser Thr Tyr Ser Leu Ser 165 170 175Ser
Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu Lys His Lys Val Tyr 180 185
190Ala Cys Glu Val Thr His Gln Gly Leu Ser Ser Pro Val Thr Lys Ser
195 200 205Phe Asn Arg Gly Glu Cys 210371350DNAHomo sapiens
37gaggtgcagc tattggagtc tgggggaggc ttgatacagc ctggggggtc cctgagactc
60tcctgtgcag cctctggatt cacctttagc agctttgcca tgagctgggt ccgccaggct
120ccagggaagg ggctggaatg ggtctcaact attagtggta gtggtggtag
cacatactac 180gcagacttcg tgaagggccg gttcaccatc tccagagaca
attccaagaa cacgctgtat 240ctgcaaatga acagcctgag agccgaggac
acggccgtat attactgtgc gaaagatgga 300aggtataact ggaactacgg
ggcttttgat atctggggcc aagggacaat ggtcaccgtc 360tcttcagctt
ccaccaaggg cccatccgtc ttccccctgg cgccctgctc caggagcacc
420tccgagagca cagccgccct gggctgcctg gtcaaggact acttccccga
accggtgacg 480gtgtcgtgga actcaggcgc cctgaccagc ggcgtgcaca
ccttcccggc tgtcctacag 540tcctcaggac tctactccct cagcagcgtg
gtgaccgtgc cctccagcag cttgggcacg 600aagacctaca cctgcaacgt
agatcacaag cccagcaaca ccaaggtgga caagagagtt 660gagtccaaat
atggtccccc atgcccatca tgcccagcac ctgagttcct ggggggacca
720tcagtcttcc tgttcccccc aaaacccaag gacactctca tgatctcccg
gacccctgag 780gtcacgtgcg tggtggtgga cgtgagccag gaagaccccg
aggtccagtt caactggtac 840gtggatggcg tggaggtgca taatgccaag
acaaagccgc gggaggagca gttcaacagc 900acgtaccgtg tggtcagcgt
cctcaccgtc ctgcaccagg actggctgaa cggcaaggag 960tacaagtgca
aggtctccaa caaaggcctc ccgtcctcca tcgagaaaac catctccaaa
1020gccaaagggc agccccgaga gccacaggtg tacaccctgc ccccatccca
ggaggagatg 1080accaagaacc aggtcagcct gacctgcctg gtcaaaggct
tctaccccag cgacatcgcc 1140gtggagtggg agagcaatgg gcagccggag
aacaactaca agaccacgcc tcccgtgctg 1200gactccgacg gctccttctt
cctctacagc aggctaaccg tggacaagag caggtggcag 1260gaggggaatg
tcttctcatg ctccgtgatg catgaggctc tgcacaacca ctacacacag
1320aagagcctct ccctgtctct gggtaaatga 135038449PRTHomo sapiens 38Glu
Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Ile Gln Pro Gly Gly1 5 10
15Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Phe
20 25 30Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp
Val 35 40 45Ser Thr Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp
Phe Val 50 55 60Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn
Thr Leu Tyr65 70 75 80Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr
Ala Val Tyr Tyr Cys 85 90 95Ala Lys Asp Gly Arg Tyr Asn Trp Asn Tyr
Gly Ala Phe Asp Ile Trp 100 105 110Gly Gln Gly Thr Met Val Thr Val
Ser Ser Ala Ser Thr Lys Gly Pro 115 120 125Ser Val Phe Pro Leu Ala
Pro Cys Ser Arg Ser Thr Ser Glu Ser Thr 130 135 140Ala Ala Leu Gly
Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr145 150 155 160Val
Ser Trp Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro 165 170
175Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr
180 185 190Val Pro Ser Ser Ser Leu Gly Thr Lys Thr Tyr Thr Cys Asn
Val Asp 195 200 205His Lys Pro Ser Asn Thr Lys Val Asp Lys Arg Val
Glu Ser Lys Tyr 210 215 220Gly Pro Pro Cys Pro Ser Cys Pro Ala Pro
Glu Phe Leu Gly Gly Pro225 230 235 240Ser Val Phe Leu Phe Pro Pro
Lys Pro Lys Asp Thr Leu Met Ile Ser 245 250 255Arg Thr Pro Glu Val
Thr Cys Val Val Val Asp Val Ser Gln Glu Asp 260 265 270Pro Glu Val
Gln Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn 275 280 285Ala
Lys Thr Lys Pro Arg Glu Glu Gln Phe Asn Ser Thr Tyr Arg Val 290 295
300Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys
Glu305 310 315 320Tyr Lys Cys Lys Val Ser Asn Lys Gly Leu Pro Ser
Ser Ile Glu Lys 325 330 335Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg
Glu Pro Gln Val Tyr Thr 340 345 350Leu Pro Pro Ser Gln Glu Glu Met
Thr Lys Asn Gln Val Ser Leu Thr 355 360 365Cys Leu Val Lys Gly Phe
Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu 370 375 380Ser Asn Gly Gln
Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu385 390 395 400Asp
Ser Asp Gly Ser Phe Phe Leu Tyr Ser Arg Leu Thr Val Asp Lys 405 410
415Ser Arg Trp Gln Glu Gly Asn Val Phe Ser Cys Ser Val Met His Glu
420 425 430Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser
Leu Gly 435 440 445Lys39645DNAHomo sapiens 39gaaatagtga tgacgcagtc
tccagccacc ctgtctgtgt ctccagggga aagagccacc 60ctctcctgca gggccagtca
gagtgttaga agcaatttag cctggttcca gcagaaacct 120ggccaggctc
ccaggctcct catctatggt gcatccacca gggccactgg tatcccagcc
180aggttcagtg gcagtgggtc tgggacagag ttcactctca ccatcagcag
cctgcagtct 240gaagattttg cagtttatta ctgtcagcag tataataact
ggccgctcac tttcggcgga 300gggaccaagg tggagatcaa acgaactgtg
gctgcaccat ctgtcttcat cttcccgcca 360tctgatgagc agttgaaatc
tggaactgcc tctgttgtgt gcctgctgaa taacttctat 420cccagagagg
ccaaagtaca gtggaaggtg gataacgccc tccaatcggg taactcccag
480gagagtgtca cagagcagga cagcaaggac agcacctaca gcctcagcag
caccctgacg 540ctgagcaaag cagactacga gaaacacaaa gtctacgcct
gcgaagtcac ccatcagggc 600ctgagctcgc ccgtcacaaa gagcttcaac
aggggagagt gttag 64540214PRTHomo sapiens 40Glu Ile Val Met Thr Gln
Ser Pro Ala Thr Leu Ser Val Ser Pro Gly1 5 10 15Glu Arg Ala Thr Leu
Ser Cys Arg Ala Ser Gln Ser Val Arg Ser Asn 20 25
30Leu Ala Trp Phe Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu Ile
35 40 45Tyr Gly Ala Ser Thr Arg Ala Thr Gly Ile Pro Ala Arg Phe Ser
Gly 50 55 60Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Ser Leu
Gln Ser65 70 75 80Glu Asp Phe Ala Val Tyr Tyr Cys Gln Gln Tyr Asn
Asn Trp Pro Leu 85 90 95Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys
Arg Thr Val Ala Ala 100 105 110Pro Ser Val Phe Ile Phe Pro Pro Ser
Asp Glu Gln Leu Lys Ser Gly 115 120 125Thr Ala Ser Val Val Cys Leu
Leu Asn Asn Phe Tyr Pro Arg Glu Ala 130 135 140Lys Val Gln Trp Lys
Val Asp Asn Ala Leu Gln Ser Gly Asn Ser Gln145 150 155 160Glu Ser
Val Thr Glu Gln Asp Ser Lys Asp Ser Thr Tyr Ser Leu Ser 165 170
175Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu Lys His Lys Val Tyr
180 185 190Ala Cys Glu Val Thr His Gln Gly Leu Ser Ser Pro Val Thr
Lys Ser 195 200 205Phe Asn Arg Gly Glu Cys 210411350DNAHomo sapiens
41gaggtgcagc tgttggagtc tgggggaggc ttggtacagc ctggggggtc cctgagactc
60tcctgtgcag cctctggatt cacctttagc agctatgcca tgagctgggt ccgccaggct
120ccagggaagg ggctggagtg ggtctcagct attagtggta gtggtggtag
cacattctac 180gcagactccg tgacgggccg gttcaccatc tccagagaca
attccaagaa cacgctgttt 240ctgcaattga acagcctgag agccgaggac
acggccgtat atcactgtgc gaaagatgga 300aggtttaact ggaactacgg
ggcttctgat atctggggcc aagggaccat ggtcaccgtc 360tcttcagctt
ccaccaaggg cccatccgtc ttccccctgg cgccctgctc caggagcacc
420tccgagagca cagccgccct gggctgcctg gtcaaggact acttccccga
accggtgacg 480gtgtcgtgga actcaggcgc cctgaccagc ggcgtgcaca
ccttcccggc tgtcctacag 540tcctcaggac tctactccct cagcagcgtg
gtgaccgtgc cctccagcag cttgggcacg 600aagacctaca cctgcaacgt
agatcacaag cccagcaaca ccaaggtgga caagagagtt 660gagtccaaat
atggtccccc atgcccatca tgcccagcac ctgagttcct ggggggacca
720tcagtcttcc tgttcccccc aaaacccaag gacactctca tgatctcccg
gacccctgag 780gtcacgtgcg tggtggtgga cgtgagccag gaagaccccg
aggtccagtt caactggtac 840gtggatggcg tggaggtgca taatgccaag
acaaagccgc gggaggagca gttcaacagc 900acgtaccgtg tggtcagcgt
cctcaccgtc ctgcaccagg actggctgaa cggcaaggag 960tacaagtgca
aggtctccaa caaaggcctc ccgtcctcca tcgagaaaac catctccaaa
1020gccaaagggc agccccgaga gccacaggtg tacaccctgc ccccatccca
ggaggagatg 1080accaagaacc aggtcagcct gacctgcctg gtcaaaggct
tctaccccag cgacatcgcc 1140gtggagtggg agagcaatgg gcagccggag
aacaactaca agaccacgcc tcccgtgctg 1200gactccgacg gctccttctt
cctctacagc aggctaaccg tggacaagag caggtggcag 1260gaggggaatg
tcttctcatg ctccgtgatg catgaggctc tgcacaacca ctacacacag
1320aagagcctct ccctgtctct gggtaaatga 135042449PRTHomo sapiens 42Glu
Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly1 5 10
15Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp
Val 35 40 45Ser Ala Ile Ser Gly Ser Gly Gly Ser Thr Phe Tyr Ala Asp
Ser Val 50 55 60Thr Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn
Thr Leu Phe65 70 75 80Leu Gln Leu Asn Ser Leu Arg Ala Glu Asp Thr
Ala Val Tyr His Cys 85 90 95Ala Lys Asp Gly Arg Phe Asn Trp Asn Tyr
Gly Ala Ser Asp Ile Trp 100 105 110Gly Gln Gly Thr Met Val Thr Val
Ser Ser Ala Ser Thr Lys Gly Pro 115 120 125Ser Val Phe Pro Leu Ala
Pro Cys Ser Arg Ser Thr Ser Glu Ser Thr 130 135 140Ala Ala Leu Gly
Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr145 150 155 160Val
Ser Trp Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro 165 170
175Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr
180 185 190Val Pro Ser Ser Ser Leu Gly Thr Lys Thr Tyr Thr Cys Asn
Val Asp 195 200 205His Lys Pro Ser Asn Thr Lys Val Asp Lys Arg Val
Glu Ser Lys Tyr 210 215 220Gly Pro Pro Cys Pro Ser Cys Pro Ala Pro
Glu Phe Leu Gly Gly Pro225 230 235 240Ser Val Phe Leu Phe Pro Pro
Lys Pro Lys Asp Thr Leu Met Ile Ser 245 250 255Arg Thr Pro Glu Val
Thr Cys Val Val Val Asp Val Ser Gln Glu Asp 260 265 270Pro Glu Val
Gln Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn 275 280 285Ala
Lys Thr Lys Pro Arg Glu Glu Gln Phe Asn Ser Thr Tyr Arg Val 290 295
300Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys
Glu305 310 315 320Tyr Lys Cys Lys Val Ser Asn Lys Gly Leu Pro Ser
Ser Ile Glu Lys 325 330 335Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg
Glu Pro Gln Val Tyr Thr 340 345 350Leu Pro Pro Ser Gln Glu Glu Met
Thr Lys Asn Gln Val Ser Leu Thr 355 360 365Cys Leu Val Lys Gly Phe
Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu 370 375 380Ser Asn Gly Gln
Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu385 390 395 400Asp
Ser Asp Gly Ser Phe Phe Leu Tyr Ser Arg Leu Thr Val Asp Lys 405 410
415Ser Arg Trp Gln Glu Gly Asn Val Phe Ser Cys Ser Val Met His Glu
420 425 430Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser
Leu Gly 435 440 445Lys43645DNAHomo sapiens 43gaaatagtga tgacgcagtc
tccagccact ctgtctgtgt ctccagggga aagagccacc 60ctctcctgca ggaccagtca
gagtgttagc agcaacttag cctggtacca gcagaaacct 120ggccaggctc
ccaggctcct catctatggt gcatccacca gggccactgg tatcccagcc
180aggttcagtg gcagtgggtc tgggacagag ttcactctca ccatcagcag
cctgcagtct 240gaagattttg cagtttatta ctgtcagcag tataataact
ggccgctcac tttcggcgga 300gggaccaagg tggagatcaa acgaactgtg
gctgcaccat ctgtcttcat cttcccgcca 360tctgatgagc agttgaaatc
tggaactgcc tctgttgtgt gcctgctgaa taacttctat 420cccagagagg
ccaaagtaca gtggaaggtg gataacgccc tccaatcggg taactcccag
480gagagtgtca cagagcagga cagcaaggac agcacctaca gcctcagcag
caccctgacg 540ctgagcaaag cagactacga gaaacacaaa gtctacgcct
gcgaagtcac ccatcagggc 600ctgagctcgc ccgtcacaaa gagcttcaac
aggggagagt gttag 64544214PRTHomo sapiens 44Glu Ile Val Met Thr Gln
Ser Pro Ala Thr Leu Ser Val Ser Pro Gly1 5 10 15Glu Arg Ala Thr Leu
Ser Cys Arg Thr Ser Gln Ser Val Ser Ser Asn 20 25 30Leu Ala Trp Tyr
Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu Ile 35 40 45Tyr Gly Ala
Ser Thr Arg Ala Thr Gly Ile Pro Ala Arg Phe Ser Gly 50 55 60Ser Gly
Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Ser Leu Gln Ser65 70 75
80Glu Asp Phe Ala Val Tyr Tyr Cys Gln Gln Tyr Asn Asn Trp Pro Leu
85 90 95Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys Arg Thr Val Ala
Ala 100 105 110Pro Ser Val Phe Ile Phe Pro Pro Ser Asp Glu Gln Leu
Lys Ser Gly 115 120 125Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe
Tyr Pro Arg Glu Ala 130 135 140Lys Val Gln Trp Lys Val Asp Asn Ala
Leu Gln Ser Gly Asn Ser Gln145 150 155 160Glu Ser Val Thr Glu Gln
Asp Ser Lys Asp Ser Thr Tyr Ser Leu Ser 165 170 175Ser Thr Leu Thr
Leu Ser Lys Ala Asp Tyr Glu Lys His Lys Val Tyr 180 185 190Ala Cys
Glu Val Thr His Gln Gly Leu Ser Ser Pro Val Thr Lys Ser 195 200
205Phe Asn Arg Gly Glu Cys 21045119PRTHomo sapiens 45Glu Val Gln
Leu Val Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly1 5 10 15Ser Leu
Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30Ser
Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40
45Ser Ser Ile Ser Ser Ser Ser Ser Tyr Ile Tyr Tyr Ala Asp Ser Val
50 55 60Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu
Tyr65 70 75 80Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val
Tyr Tyr Cys 85 90 95Ala Arg Asp Arg Gly Tyr Ser Tyr Gly Leu Asp Tyr
Trp Gly Gln Gly 100 105 110Thr Leu Val Thr Val Ser Ser
11546358DNAHomo sapiens 46gaggtgcagc tggtggagtc tgggggaggc
ctggtcaagc ctggggggtc cctgagactc 60tcctgtgcag cctctggatt caccttcagt
agctatagca tgaattgggt ccgccaggct 120ccagggaagg ggctggagtg
ggtctcatcc attagtagta gtagtagtta catatactac 180gcagactcag
tgaagggccg attcaccatc tccagagaca acgccaagaa ctcactgtat
240ctgcaaatga acagcctgag agccgaggac acggctgtgt attactgtgc
gagagatcgg 300gggtacagct atggtcttga ctactggggc cagggaaccc
tggtcaccgt ctcctcag 35847107PRTHomo sapiens 47Asp Ile Gln Met Thr
Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly1 5 10 15Asp Arg Val Thr
Ile Thr Cys Arg Ala Ser Gln Gly Ile Arg Asn Ala 20 25 30Leu Gly Trp
Tyr Gln Gln Lys Pro Gly Lys Ala Pro Gln Arg Leu Ile 35 40 45Tyr Ala
Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60Ser
Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro65 70 75
80Glu Asp Phe Ala Thr Tyr Tyr Cys Leu Gln His Asn Ser Tyr Pro Arg
85 90 95Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys 100
10548322DNAHomo sapiens 48gacatccaga tgacccagtc tccatcctcc
ctgtctgcat ctgtaggaga cagagtcacc 60atcacttgcc gggcaagtca gggcattaga
aatgctttag gctggtatca gcagaaacca 120gggaaagccc ctcagcgcct
gatctatgct gcatccagtt tgcaaagtgg ggtcccatca 180aggttcagcg
gcagtggatc tgggacagaa ttcactctca caatcagcag cctgcagcct
240gaagattttg caacttatta ctgtctacag cataatagtt accctcggac
gttcggccaa 300gggaccaagg tggaaatcaa ac 32249123PRTHomo sapiens
49Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala1
5 10 15Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Gly
Tyr 20 25 30Tyr Met His Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu
Trp Met 35 40 45Gly Trp Ile Asn Pro Asn Asn Gly Gly Thr Asn Tyr Ala
Gln Lys Phe 50 55 60Gln Gly Arg Val Thr Met Thr Arg Asp Thr Ser Ile
Ser Thr Ala Tyr65 70 75 80Met Glu Leu Ser Arg Leu Arg Ser Asp Asp
Thr Ala Val Tyr His Cys 85 90 95Ala Arg Asn Thr Val Gly Ser Gly Tyr
Tyr Tyr Tyr Gly Met Asp Val 100 105 110Trp Gly Gln Gly Thr Thr Val
Thr Val Ser Ser 115 12050370DNAHomo sapiens 50caggtgcagc tggtgcagtc
tggggctgag gtgaagaagc ctggggcctc agtgaaggtc 60tcctgcaagg cttctggata
caccttcacc ggctactata tgcactgggt gcgacaggcc 120cctggacaag
ggcttgagtg gatgggatgg atcaacccta acaatggtgg cacaaactat
180gcacagaagt ttcagggcag ggtcaccatg accagggaca cgtccatcag
cacagcctac 240atggagctga gcaggctgag atctgacgac acggccgtgt
atcactgtgc gagaaatacg 300gtgggaagtg ggtactacta ctacggtatg
gacgtctggg gccaagggac cacggtcacc 360gtctcctcag 37051112PRTHomo
sapiens 51Asp Ile Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr
Pro Gly1 5 10 15Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu
Leu His Ser 20 25 30Asn Gly Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys
Ser Gly Gln Ser 35 40 45Pro Gln Leu Leu Ile His Leu Gly Ser Asn Arg
Ala Ser Gly Val Pro 50 55 60Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr
Asp Phe Thr Leu Lys Ile65 70 75 80Ser Arg Val Glu Ala Glu Asp Val
Gly Val Tyr Tyr Cys Met Gln Val 85 90 95Leu Gln Thr Pro Leu Thr Phe
Gly Gly Gly Thr Lys Val Glu Ile Lys 100 105 11052337DNAHomo sapiens
52gatattgtga tgactcagtc tccactctcc ctgcccgtca cccctggaga gccggcctcc
60atctcctgca ggtctagtca gagcctcctg catagtaatg gatacaacta tttggattgg
120tacctgcaga agtcagggca gtctccacag ctcctgatcc atttgggttc
taatcgggcc 180tccggggtcc ctgacaggtt cagtggcagt ggatcaggca
cagattttac actgaaaatc 240agcagagtgg aggctgagga tgttggggtt
tattactgca tgcaagttct acaaactccg 300ctcactttcg gcggagggac
caaggtggag atcaaac 33753119PRTHomo sapiens 53Glu Val Gln Leu Val
Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly1 5 10 15Ser Leu Arg Leu
Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30Ser Met Asn
Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45Ser Ser
Ile Ser Ser Ser Ser Ser Tyr Ile Tyr Tyr Ala Asp Ser Val 50 55 60Lys
Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr65 70 75
80Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95Ala Arg Asp Arg Gly Tyr Ser Tyr Gly Ile Asp Tyr Trp Gly Gln
Gly 100 105 110Thr Leu Val Thr Val Ser Ser 11554358DNAHomo sapiens
54gaggtgcagc tggtggagtc tgggggaggc ctggtcaagc ctggggggtc cctgagactc
60tcctgtgcag cctctggatt caccttcagt agctatagca tgaactgggt ccgccaggct
120ccagggaagg ggctggagtg ggtctcatcc attagtagta gtagtagtta
catatactac 180gcagactcag tgaagggccg attcaccatc tccagagaca
acgccaagaa ctcactgtat 240ctgcaaatga acagcctgag agccgaggac
acggctgtgt attactgtgc gagagatcgt 300ggatacagct atggtattga
ctactggggc cagggaaccc tggtcaccgt ctcctcag 35855107PRTHomo sapiens
55Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly1
5 10 15Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Ile Arg Asn
Ala 20 25 30Leu Gly Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Arg
Leu Ile 35 40 45Tyr Ala Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg
Phe Ser Gly 50 55 60Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser
Ser Leu Gln Pro65 70 75 80Glu Asp Phe Ala Thr Tyr Tyr Cys Leu Gln
His Asn Ser Tyr Pro Arg 85 90 95Thr Phe Gly Gln Gly Thr Lys Val Glu
Ile Lys 100 10556322DNAHomo sapiens 56gacatccaga tgacccagtc
tccatcctcc ctgtctgcat ctgtaggaga cagagtcacc 60atcacttgcc gggcaagtca
gggcattaga aatgctttag gctggtatca gcagaaacca 120gggaaagccc
ctaagcgcct gatctatgct gcatccagtt tgcaaagtgg ggtcccatca
180aggttcagcg gcagtggatc tgggacagaa ttcactctca caatcagcag
cctgcagcct 240gaagattttg caacttatta ctgtctacag cataatagtt
accctcggac gttcggccaa 300gggaccaagg tggaaatcaa ac 32257119PRTHomo
sapiens 57Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Lys Pro
Gly Gly1 5 10 15Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe
Ser Ser Tyr 20 25 30Ser Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly
Leu Glu Trp Val 35 40 45Ser Ser Ile Ser Ser Ser Ser Ser Tyr Ile Tyr
Tyr Ala Asp Ser Val 50 55 60Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn
Ala Lys Asn Ser Leu Tyr65 70 75 80Leu Gln Met Asn Ser Leu Arg Ala
Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Arg Asp Arg Gly Tyr Tyr
Tyr Gly Met Asp Val Trp Gly Gln Gly 100 105 110Thr Thr Val Thr Val
Ser Ser 11558358DNAHomo sapiens 58gaggtgcagc tggtggagtc tgggggaggc
ctggtcaagc ctggggggtc cctgagactc 60tcctgtgcag cctctggatt caccttcagt
agctatagca tgaactgggt ccgccaggct 120ccagggaagg ggctggagtg
ggtctcatcc attagtagta gtagtagtta catatactac 180gcagactcag
tgaagggccg attcaccatc tccagagaca acgccaagaa ctcactgtat
240ctgcaaatga acagcctgag agccgaggac acggctgtgt attactgtgc
gagagatagg 300ggatactact acggtatgga cgtctggggc caagggacca
cggtcaccgt ctcctcag 35859107PRTHomo sapiens 59Asp Ile Gln Met Thr
Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly1 5 10
15Asp Arg Val Thr Leu Thr Cys Arg Ala Ser Gln Gly Ile Arg Asn Ala
20 25 30Leu Gly Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Arg Leu
Ile 35 40 45Tyr Gly Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe
Ser Gly 50 55 60Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Ser
Leu Gln Pro65 70 75 80Glu Asp Phe Ala Thr Tyr Tyr Cys Leu Gln His
Asn Ser Tyr Pro Phe 85 90 95Thr Phe Gly Pro Gly Thr Lys Val Asp Ile
Lys 100 10560322DNAHomo sapiens 60gacatccaga tgacccagtc tccatcctcc
ctgtctgcat ctgtaggaga cagagtcacc 60ctcacttgcc gggcaagtca gggcattaga
aatgctttag gctggtatca gcagaaacca 120gggaaagccc ctaagcgcct
gatctatggt gcatccagtt tgcaaagtgg ggtcccatca 180aggttcagcg
gcagtggatc tgggacagaa ttcactctca caatcagcag cctgcagcct
240gaagattttg caacttatta ctgtctacag cataatagtt acccattcac
tttcggccct 300gggaccaaag tggatatcaa ac 32261119PRTHomo sapiens
61Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly1
5 10 15Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser
Tyr 20 25 30Ser Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu
Trp Val 35 40 45Ser Ser Ile Ser Ser Ser Ser Ser Tyr Ile Tyr Tyr Ala
Asp Ser Val 50 55 60Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys
Asn Ser Leu Tyr65 70 75 80Leu Gln Met Asn Ser Leu Arg Ala Glu Asp
Thr Ala Val Tyr Tyr Cys 85 90 95Ala Arg Asp Arg Gly Ser Tyr Phe Leu
Phe Asp Tyr Trp Gly Gln Gly 100 105 110Thr Leu Val Thr Val Ser Ser
11562358DNAHomo sapiens 62gaggtgcagc tggtggagtc tgggggaggc
ctggtcaagc ctggggggtc cctgagactc 60tcctgtgcag cctctggatt caccttcagt
agctatagca tgaactgggt ccgccaggct 120ccagggaagg ggctggagtg
ggtctcatcc attagtagta gtagtagtta catatactac 180gcagactcag
tgaagggccg attcaccatc tccagagaca acgccaagaa ctcactgtat
240ctgcaaatga acagcctgag agccgaggac acggctgtgt attactgtgc
gagagaccgt 300gggagctact tcctctttga ctactggggc cagggaaccc
tggtcaccgt ctcctcag 35863107PRTHomo sapiens 63Asp Met Gln Met Thr
Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly1 5 10 15Asp Arg Val Thr
Ile Thr Cys Arg Ala Ser Gln Gly Ile Arg Asn Asp 20 25 30Leu Gly Trp
Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Arg Leu Ile 35 40 45Tyr Gly
Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60Ser
Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro65 70 75
80Glu Asp Ser Ala Thr Tyr Tyr Cys Leu Gln His Asn Ser Tyr Pro Leu
85 90 95Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100
10564322DNAHomo sapiens 64gacatgcaga tgacccagtc tccatcctcc
ctgtctgcat ctgtaggaga cagagtcacc 60atcacttgcc gggcaagtca gggcattaga
aatgatttag gctggtatca gcagaaacca 120gggaaagccc ctaagcgcct
gatctatggt gcatccagtt tgcaaagtgg ggtcccatca 180aggttcagcg
gcagtggatc tgggacagaa ttcactctca caatcagcag cctgcagcct
240gaagattctg caacttatta ctgtctacag cataatagtt acccgctcac
tttcggcgga 300gggaccaagg tggagatcaa ac 32265119PRTHomo sapiens
65Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly1
5 10 15Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser
Tyr 20 25 30Ser Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu
Trp Val 35 40 45Ser Ser Ile Ser Ser Ser Ser Ser Tyr Ile Tyr Tyr Ala
Asp Ser Val 50 55 60Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys
Asn Ser Leu Tyr65 70 75 80Leu Gln Met Asn Ser Leu Arg Ala Glu Asp
Thr Thr Val Tyr Tyr Cys 85 90 95Ala Arg Asp Arg Gly Tyr Leu Tyr Gly
Met Asp Val Trp Gly Gln Gly 100 105 110Thr Thr Val Thr Val Ser Ser
11566358DNAHomo sapiens 66gaggtgcagc tggtggagtc tgggggaggc
ctggtcaagc ctggggggtc cctgagactc 60tcctgtgcag cctctggatt caccttcagt
agctatagca tgaactgggt ccgccaggct 120ccagggaagg ggctggagtg
ggtctcatcc attagtagta gtagtagtta catatactac 180gcagactcag
tgaagggccg attcaccatc tccagagaca acgccaagaa ctcactgtat
240ctgcaaatga acagcctgag agccgaggac acgactgtgt attactgtgc
gagagatcga 300ggctacctct acggtatgga cgtctggggc caagggacca
cggtcaccgt ctcctcag 35867107PRTHomo sapiens 67Asp Ile Gln Met Thr
Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly1 5 10 15Asp Arg Val Thr
Ile Thr Cys Arg Ala Ser Gln Ala Ile Arg Asn Asp 20 25 30Leu Gly Trp
Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Arg Leu Ile 35 40 45Tyr Ala
Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60Ser
Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro65 70 75
80Glu Asp Phe Ala Thr Tyr Tyr Cys Leu Gln His Asn Ser Tyr Pro Arg
85 90 95Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys 100
10568322DNAHomo sapiens 68gacatccaga tgacccagtc tccatcctcc
ctgtctgcat ctgtaggaga cagagtcacc 60atcacttgcc gggcaagtca ggccattaga
aatgatttag gctggtatca gcagaaacca 120gggaaagccc ctaagcgcct
gatctatgct gcatccagtt tgcaaagtgg ggtcccatca 180aggttcagcg
gcagtggatc tgggacagaa ttcactctca caatcagcag cctgcagcct
240gaagattttg caacttatta ctgtctacag cataatagtt accctcggac
gttcggccaa 300gggaccaagg tggaaatcaa ac 32269123PRTHomo sapiens
69Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala1
5 10 15Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Gly
Tyr 20 25 30Tyr Met His Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu
Trp Met 35 40 45Gly Trp Ile Asn Pro Asn Ser Gly Gly Thr Asn Tyr Ala
Gln Lys Phe 50 55 60Gln Gly Arg Val Thr Met Thr Arg Asp Thr Ser Ile
Ser Thr Ala Tyr65 70 75 80Leu Glu Leu Ser Arg Leu Arg Ser Asp Asp
Thr Ala Val Tyr Tyr Cys 85 90 95Ala Arg Asn Thr Val Gly Thr Gly Tyr
Tyr Tyr Tyr Gly Met Asp Val 100 105 110Trp Gly Gln Gly Thr Thr Val
Thr Val Ser Ser 115 12070370DNAHomo sapiens 70caggtgcagc tggtgcagtc
tggggctgag gtgaagaagc ctggggcctc agtgaaggtc 60tcctgcaagg cttctggata
taccttcacc ggctactata tgcactgggt gcgacaggcc 120cctggacaag
ggcttgagtg gatgggatgg atcaacccta acagtggtgg cacaaactat
180gcacagaagt ttcagggcag ggtcaccatg accagggaca cgtccatcag
cacagcctac 240ctggagctga gcaggctgag atctgacgac acggccgtgt
attactgtgc gagaaatacg 300gtgggaactg gatactacta ctacggtatg
gacgtctggg gccaagggac cacggtcacc 360gtctcctcag 37071112PRTHomo
sapiens 71Asp Ile Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr
Pro Gly1 5 10 15Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu
Leu His Ser 20 25 30Asn Gly Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys
Pro Gly Gln Ser 35 40 45Pro Gln Val Leu Ile Tyr Leu Val Ser Asn Arg
Ala Ser Gly Val Pro 50 55 60Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr
Asp Phe Thr Leu Lys Ile65 70 75 80Ser Arg Val Glu Ala Glu Asp Val
Gly Val Tyr Tyr Cys Met Gln Ala 85 90 95Leu Gln Thr Pro Pro Thr Phe
Gly Gly Gly Thr Lys Val Glu Ile Lys 100 105 11072337DNAHomo sapiens
72gatattgtga tgactcagtc tccactctcc ctgcccgtca cccctggaga gccggcctcc
60atctcctgca ggtctagtca gagcctcctg catagtaatg gatacaacta tttggattgg
120tacctgcaga agccagggca gtctccacag gtcctgatct atttggtttc
taatcgggcc 180tccggggtcc ctgacaggtt cagtggcagt ggatcaggca
cagattttac actgaaaatc 240agcagagtgg aggctgagga tgttggggtt
tattactgca tgcaagctct acaaactcct 300cccactttcg gcggagggac
caaggtggag atcaaac 33773119PRTHomo sapiens 73Glu Val Gln Leu Val
Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly1 5 10 15Ser Leu Arg Leu
Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30Ser Met Asn
Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45Ser Ser
Ile Ser Ser Ser Ser Ser Tyr Ile Tyr Tyr Ala Asp Ser Val 50 55 60Lys
Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr65 70 75
80Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95Ala Arg Asp Arg Gly Tyr Ser Tyr Gly Leu Asp Tyr Trp Gly Gln
Gly 100 105 110Thr Leu Val Thr Val Ser Ser 11574358DNAHomo sapiens
74gaggtgcagc tggtggagtc tgggggaggc ctggtcaagc ctggggggtc cctgagactc
60tcctgtgcag cctctggatt caccttcagt agctatagca tgaactgggt ccgccaggct
120ccagggaagg ggctggagtg ggtctcatcc attagtagta gtagtagtta
catatactac 180gcagactcag tgaagggccg attcaccatc tccagagaca
acgccaagaa ctcactgtat 240ctgcaaatga acagcctgag agccgaggac
acggctgtgt attactgtgc gagagatcgt 300ggatacagct atggtcttga
ctactggggc cagggaaccc tggtcaccgt ctcctcag 35875107PRTHomo sapiens
75Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly1
5 10 15Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Ile Arg Asn
Asp 20 25 30Leu Gly Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Arg
Leu Ile 35 40 45Tyr Ala Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg
Phe Ser Gly 50 55 60Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser
Ser Leu Gln Pro65 70 75 80Glu Asp Phe Ala Thr Tyr Tyr Cys Leu Gln
Leu Asn Ser Tyr Pro Phe 85 90 95Thr Phe Gly Pro Gly Thr Lys Val Asp
Ile Lys 100 10576322DNAHomo sapiens 76gacatccaga tgacccagtc
tccatcctcc ctgtctgcat ctgtaggaga cagagtcacc 60atcacttgcc gggcaagtca
gggcattaga aatgatttag gctggtatca gcagaaacca 120gggaaagccc
ctaagcgcct gatctatgct gcatccagtt tgcaaagtgg ggtcccatca
180aggttcagcg gcagtggatc tgggacagaa ttcactctca caatcagcag
cctgcagcct 240gaagattttg cgacttatta ctgtctacag cttaatagtt
acccattcac tttcggccct 300gggaccaaag tggatatcaa ac 32277122PRTHomo
sapiens 77Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Ile Gln Pro
Gly Gly1 5 10 15Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe
Ser Ser Phe 20 25 30Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly
Leu Glu Trp Val 35 40 45Ser Thr Ile Ser Gly Ser Gly Gly Tyr Thr Phe
Tyr Ala Asp Ser Val 50 55 60Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn
Ser Lys Asn Thr Leu Tyr65 70 75 80Leu Gln Met Asn Ser Leu Arg Ala
Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Lys Asp Gly Arg Tyr Asn
Trp Asn Tyr Gly Ala Phe Asp Ile Trp 100 105 110Gly Gln Gly Thr Met
Val Thr Val Ser Ser 115 12078367DNAHomo sapiens 78gaggtgcagc
tattggagtc tgggggaggc ttgatacagc ctggggggtc cctgagactc 60tcctgtgcag
cctctggatt cacctttagc agctttgcca tgagctgggt ccgccaggct
120ccagggaagg ggctggaatg ggtctcaact attagtggta gtggtggtta
cacattctac 180gcagactccg tgaagggccg gttcaccatc tccagagaca
attccaagaa cacgctgtat 240ctgcaaatga acagcctgag agccgaggac
acggccgtat attactgtgc gaaagatgga 300aggtataact ggaactacgg
ggcttttgat atctggggcc aagggacaat ggtcaccgtc 360tcttcag
36779107PRTHomo sapiens 79Glu Ile Val Met Thr Gln Ser Pro Ala Thr
Leu Ser Val Ser Pro Gly1 5 10 15Glu Arg Ala Thr Leu Ser Cys Arg Ala
Ser Gln Ser Val Ser Ser Asn 20 25 30Leu Ala Trp Tyr Gln Gln Lys Pro
Gly Gln Ala Pro Arg Leu Leu Ile 35 40 45Tyr Gly Ala Ser Thr Arg Ala
Thr Gly Phe Pro Ala Arg Phe Ser Gly 50 55 60Ser Gly Ser Gly Thr Glu
Phe Thr Leu Thr Ile Ser Ser Leu Gln Ser65 70 75 80Glu Asp Phe Ala
Ile Tyr Tyr Cys Gln Gln Tyr Asn Asn Trp Pro Leu 85 90 95Thr Phe Gly
Gly Gly Thr Lys Val Glu Ile Lys 100 10580322DNAHomo sapiens
80gaaatagtga tgacgcagtc tccagccacc ctgtctgtgt ctccagggga aagagccacc
60ctctcctgca gggccagtca gagtgttagt agcaacttag cctggtacca gcagaaacct
120ggccaggctc ccaggctcct catctatggt gcatccacca gggccactgg
tttcccagcc 180aggttcagtg gcagtgggtc tgggacagag ttcactctca
ccatcagcag cctgcagtct 240gaagattttg caatttatta ctgtcagcag
tataataact ggccgctcac tttcggcggg 300gggaccaagg tggagatcaa ac
32281122PRTHomo sapiens 81Glu Val Gln Leu Leu Glu Ser Gly Gly Gly
Leu Ile Gln Pro Gly Gly1 5 10 15Ser Leu Arg Leu Ser Cys Ala Ala Ser
Gly Phe Thr Phe Ser Ser Phe 20 25 30Ala Met Ser Trp Val Arg Gln Ala
Pro Gly Lys Gly Leu Glu Trp Val 35 40 45Ser Thr Ile Ser Gly Ser Gly
Gly Ser Thr Tyr Tyr Ala Asp Phe Val 50 55 60Lys Gly Arg Phe Thr Ile
Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr65 70 75 80Leu Gln Met Asn
Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Lys Asp
Gly Arg Tyr Asn Trp Asn Tyr Gly Ala Phe Asp Ile Trp 100 105 110Gly
Gln Gly Thr Met Val Thr Val Ser Ser 115 12082367DNAHomo sapiens
82gaggtgcagc tattggagtc tgggggaggc ttgatacagc ctggggggtc cctgagactc
60tcctgtgcag cctctggatt cacctttagc agctttgcca tgagctgggt ccgccaggct
120ccagggaagg ggctggaatg ggtctcaact attagtggta gtggtggtag
cacatactac 180gcagacttcg tgaagggccg gttcaccatc tccagagaca
attccaagaa cacgctgtat 240ctgcaaatga acagcctgag agccgaggac
acggccgtat attactgtgc gaaagatgga 300aggtataact ggaactacgg
ggcttttgat atctggggcc aagggacaat ggtcaccgtc 360tcttcag
36783107PRTHomo sapiens 83Glu Ile Val Met Thr Gln Ser Pro Ala Thr
Leu Ser Val Ser Pro Gly1 5 10 15Glu Arg Ala Thr Leu Ser Cys Arg Ala
Ser Gln Ser Val Arg Ser Asn 20 25 30Leu Ala Trp Phe Gln Gln Lys Pro
Gly Gln Ala Pro Arg Leu Leu Ile 35 40 45Tyr Gly Ala Ser Thr Arg Ala
Thr Gly Ile Pro Ala Arg Phe Ser Gly 50 55 60Ser Gly Ser Gly Thr Glu
Phe Thr Leu Thr Ile Ser Ser Leu Gln Ser65 70 75 80Glu Asp Phe Ala
Val Tyr Tyr Cys Gln Gln Tyr Asn Asn Trp Pro Leu 85 90 95Thr Phe Gly
Gly Gly Thr Lys Val Glu Ile Lys 100 10584322DNAHomo sapiens
84gaaatagtga tgacgcagtc tccagccacc ctgtctgtgt ctccagggga aagagccacc
60ctctcctgca gggccagtca gagtgttaga agcaatttag cctggttcca gcagaaacct
120ggccaggctc ccaggctcct catctatggt gcatccacca gggccactgg
tatcccagcc 180aggttcagtg gcagtgggtc tgggacagag ttcactctca
ccatcagcag cctgcagtct 240gaagattttg cagtttatta ctgtcagcag
tataataact ggccgctcac tttcggcgga 300gggaccaagg tggagatcaa ac
32285122PRTHomo sapiens 85Glu Val Gln Leu Leu Glu Ser Gly Gly Gly
Leu Val Gln Pro Gly Gly1 5 10 15Ser Leu Arg Leu Ser Cys Ala Ala Ser
Gly Phe Thr Phe Ser Ser Tyr 20 25 30Ala Met Ser Trp Val Arg Gln Ala
Pro Gly Lys Gly Leu Glu Trp Val 35 40 45Ser Ala Ile Ser Gly Ser Gly
Gly Ser Thr Phe Tyr Ala Asp Ser Val 50 55 60Thr Gly Arg Phe Thr Ile
Ser Arg Asp Asn Ser Lys Asn Thr Leu Phe65 70 75 80Leu Gln Leu Asn
Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr His Cys 85 90 95Ala Lys Asp
Gly Arg Phe Asn Trp Asn Tyr Gly Ala Ser Asp Ile Trp 100 105 110Gly
Gln Gly Thr Met Val Thr Val Ser Ser 115 12086367DNAHomo sapiens
86gaggtgcagc tgttggagtc tgggggaggc ttggtacagc ctggggggtc cctgagactc
60tcctgtgcag cctctggatt cacctttagc agctatgcca
tgagctgggt ccgccaggct 120ccagggaagg ggctggagtg ggtctcagct
attagtggta gtggtggtag cacattctac 180gcagactccg tgacgggccg
gttcaccatc tccagagaca attccaagaa cacgctgttt 240ctgcaattga
acagcctgag agccgaggac acggccgtat atcactgtgc gaaagatgga
300aggtttaact ggaactacgg ggcttctgat atctggggcc aagggaccat
ggtcaccgtc 360tcttcag 36787107PRTHomo sapiens 87Glu Ile Val Met Thr
Gln Ser Pro Ala Thr Leu Ser Val Ser Pro Gly1 5 10 15Glu Arg Ala Thr
Leu Ser Cys Arg Thr Ser Gln Ser Val Ser Ser Asn 20 25 30Leu Ala Trp
Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu Ile 35 40 45Tyr Gly
Ala Ser Thr Arg Ala Thr Gly Ile Pro Ala Arg Phe Ser Gly 50 55 60Ser
Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Ser Leu Gln Ser65 70 75
80Glu Asp Phe Ala Val Tyr Tyr Cys Gln Gln Tyr Asn Asn Trp Pro Leu
85 90 95Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100
10588322DNAHomo sapiens 88gaaatagtga tgacgcagtc tccagccact
ctgtctgtgt ctccagggga aagagccacc 60ctctcctgca ggaccagtca gagtgttagc
agcaacttag cctggtacca gcagaaacct 120ggccaggctc ccaggctcct
catctatggt gcatccacca gggccactgg tatcccagcc 180aggttcagtg
gcagtgggtc tgggacagag ttcactctca ccatcagcag cctgcagtct
240gaagattttg cagtttatta ctgtcagcag tataataact ggccgctcac
tttcggcgga 300gggaccaagg tggagatcaa ac 32289109PRTHomo sapiens
89Asp Phe Gly Leu Asp Cys Asp Glu His Ser Thr Glu Ser Arg Cys Cys1
5 10 15Arg Tyr Pro Leu Thr Val Asp Phe Glu Ala Phe Gly Trp Asp Trp
Ile 20 25 30Ile Ala Pro Lys Arg Tyr Lys Ala Asn Tyr Cys Ser Gly Glu
Cys Glu 35 40 45Phe Val Phe Leu Gln Lys Tyr Pro His Thr His Leu Val
His Gln Ala 50 55 60Asn Pro Arg Gly Ser Ala Gly Pro Cys Cys Thr Pro
Thr Lys Met Ser65 70 75 80Pro Ile Asn Met Leu Tyr Phe Asn Gly Lys
Glu Gln Ile Ile Tyr Gly 85 90 95Lys Ile Pro Ala Met Val Val Asp Arg
Cys Gly Cys Ser 100 10590109PRTHomo sapiens 90Asn Leu Gly Leu Asp
Cys Asp Glu His Ser Ser Glu Ser Arg Cys Cys1 5 10 15Arg Tyr Pro Leu
Thr Val Asp Phe Glu Ala Phe Gly Trp Asp Trp Ile 20 25 30Ile Ala Pro
Lys Arg Tyr Lys Ala Asn Tyr Cys Ser Gly Gln Cys Glu 35 40 45Tyr Met
Phe Met Gln Lys Tyr Pro His Thr His Leu Val Gln Gln Ala 50 55 60Asn
Pro Arg Gly Ser Ala Gly Pro Cys Cys Thr Pro Thr Lys Met Ser65 70 75
80Pro Ile Asn Met Leu Tyr Phe Asn Asp Lys Gln Gln Ile Ile Tyr Gly
85 90 95Lys Ile Pro Gly Met Val Val Asp Arg Cys Gly Cys Ser 100
1059123DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 91caggtgcagc tggagcagtc ngg 239224DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
92gctgagggag tagagtcctg agga 249320DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
93tacgtgccaa gcatcctcgc 209423DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 94aggctggaac tgaggagcag gtg
239524DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 95ccctgagagc atcaymyarm aacc 249625DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
96hvthtccact yggtgatcrg cactg 259725DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
97attyrgtgat cagsactgaa casag 259826DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
98gsartcagwc ycwvycagga cacagc 269925DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
99caccaggkga tttgcatatt rtccc 2510024DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
100atcaatgcct gkgtcagagc yytg 241019DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 101agccagaca 91028DNAArtificial SequenceDescription
of Artificial Sequence Synthetic oligonucleotide 102gtctagac
810318PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 103Asp Phe Gly Leu Asp Cys Asp Glu His Ser Thr
Glu Ser Arg Cys Cys1 5 10 15Arg Tyr10418PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 104Pro
Leu Thr Val Asp Phe Glu Ala Phe Gly Trp Asp Trp Ile Ile Ala1 5 10
15Pro Lys10518PRTArtificial SequenceDescription of Artificial
Sequence Synthetic peptide 105Arg Tyr Lys Ala Asn Tyr Cys Ser Gly
Glu Cys Glu Phe Val Phe Leu1 5 10 15Gln Lys10618PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 106Tyr
Pro His Thr His Leu Val His Gln Ala Asn Pro Arg Gly Ser Ala1 5 10
15Gly Pro10718PRTArtificial SequenceDescription of Artificial
Sequence Synthetic peptide 107Cys Cys Thr Pro Thr Lys Met Ser Pro
Ile Asn Met Leu Tyr Phe Asn1 5 10 15Gly Lys10819PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 108Glu
Gln Ile Ile Tyr Gly Lys Ile Pro Ala Met Val Val Asp Arg Cys1 5 10
15Gly Cys Ser10918PRTArtificial SequenceDescription of Artificial
Sequence Synthetic peptide 109His Ser Thr Glu Ser Arg Cys Cys Arg
Tyr Pro Leu Thr Val Asp Phe1 5 10 15Glu Ala11018PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 110Phe
Gly Trp Asp Trp Ile Ile Ala Pro Lys Arg Tyr Lys Ala Asn Tyr1 5 10
15Cys Ser11118PRTArtificial SequenceDescription of Artificial
Sequence Synthetic peptide 111Gly Glu Cys Glu Phe Val Phe Leu Gln
Lys Tyr Pro His Thr His Leu1 5 10 15Val His11218PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 112Gln
Ala Asn Pro Arg Gly Ser Ala Gly Pro Cys Cys Thr Pro Thr Lys1 5 10
15Met Ser11318PRTArtificial SequenceDescription of Artificial
Sequence Synthetic peptide 113Pro Ile Asn Met Leu Tyr Phe Asn Gly
Lys Glu Gln Ile Ile Tyr Gly1 5 10 15Lys Ile1141347DNAHomo sapiens
114gaggtgcagc tgttggagtc tgggggaggc ttggtacagc ctggggggtc
cctgagactc 60tcctgtgcag cctctggatt cacctttagc agctttgcca tgagctgggt
ccgccaggct 120ccagggaagg ggctggaatg ggtctcaact attagtggta
gtggtggtta cacattctac 180gcagactccg tgaagggccg gttcaccatc
tccagagaca attccaagaa cacgctgtat 240ctgcaaatga acagcctgag
agccgaggac acggccgtat attactgtgc gaaagatgga 300aggtataact
ggaactacgg ggcttttgat atctggggcc aagggacaat ggtcaccgtc
360tcctcagcct ccaccaaggg cccatcggtc ttccccctgg cgccctgctc
caggagcacc 420tccgagagca cagcggccct gggctgcctg gtcaaggact
acttccccga accggtgacg 480gtgtcgtgga actcaggcgc tctgaccagc
ggcgtgcaca ccttcccggc tgtcctacag 540tcctcaggac tctactccct
cagcagcgta gtgaccgtgc cctccagcaa cttcggcacc 600cagacctaca
cctgcaacgt agatcacaag cccagcaaca ccaaggtgga caagacagtt
660gagcgcaaat gttgtgtcga gtgcccaccg tgcccagcac cacctgtggc
aggaccgtca 720gtcttcctct tccccccaaa acccaaggac accctcatga
tctcccggac ccctgaggtc 780acgtgcgtgg tggtggacgt gagccacgaa
gaccccgagg tccagttcaa ctggtacgtg 840gacggcgtgg aggtgcataa
tgccaagaca aagccacggg aggagcagtt caacagcacg 900ttccgtgtgg
tcagcgtcct caccgtcgtg caccaggact ggctgaacgg caaggagtac
960aagtgcaagg tctccaacaa aggcctccca gcccccatcg agaaaaccat
ctccaaaacc 1020aaagggcagc cccgagaacc acaggtgtac accctgcccc
catcccggga ggagatgacc 1080aagaaccagg tcagcctgac ctgcctggtc
aaaggcttct accccagcga catcgccgtg 1140gagtgggaga gcaatgggca
gccggagaac aactacaaga ccacacctcc catgctggac 1200tccgacggct
ccttcttcct ctacagcaag ctcaccgtgg acaagagcag gtggcagcag
1260gggaacgtct tctcatgctc cgtgatgcat gaggctctgc acaaccacta
cacacagaag 1320agcctctccc tgtctccggg taaatga 1347115448PRTHomo
sapiens 115Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro
Gly Gly1 5 10 15Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe
Ser Ser Phe 20 25 30Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly
Leu Glu Trp Val 35 40 45Ser Thr Ile Ser Gly Ser Gly Gly Tyr Thr Phe
Tyr Ala Asp Ser Val 50 55 60Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn
Ser Lys Asn Thr Leu Tyr65 70 75 80Leu Gln Met Asn Ser Leu Arg Ala
Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Lys Asp Gly Arg Tyr Asn
Trp Asn Tyr Gly Ala Phe Asp Ile Trp 100 105 110Gly Gln Gly Thr Met
Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro 115 120 125Ser Val Phe
Pro Leu Ala Pro Cys Ser Arg Ser Thr Ser Glu Ser Thr 130 135 140Ala
Ala Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr145 150
155 160Val Ser Trp Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe
Pro 165 170 175Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser
Val Val Thr 180 185 190Val Pro Ser Ser Asn Phe Gly Thr Gln Thr Tyr
Thr Cys Asn Val Asp 195 200 205His Lys Pro Ser Asn Thr Lys Val Asp
Lys Thr Val Glu Arg Lys Cys 210 215 220Cys Val Glu Cys Pro Pro Cys
Pro Ala Pro Pro Val Ala Gly Pro Ser225 230 235 240Val Phe Leu Phe
Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg 245 250 255Thr Pro
Glu Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro 260 265
270Glu Val Gln Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala
275 280 285Lys Thr Lys Pro Arg Glu Glu Gln Phe Asn Ser Thr Phe Arg
Val Val 290 295 300Ser Val Leu Thr Val Val His Gln Asp Trp Leu Asn
Gly Lys Glu Tyr305 310 315 320Lys Cys Lys Val Ser Asn Lys Gly Leu
Pro Ala Pro Ile Glu Lys Thr 325 330 335Ile Ser Lys Thr Lys Gly Gln
Pro Arg Glu Pro Gln Val Tyr Thr Leu 340 345 350Pro Pro Ser Arg Glu
Glu Met Thr Lys Asn Gln Val Ser Leu Thr Cys 355 360 365Leu Val Lys
Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser 370 375 380Asn
Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Met Leu Asp385 390
395 400Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys
Ser 405 410 415Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met
His Glu Ala 420 425 430Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser
Leu Ser Pro Gly Lys 435 440 445116645DNAHomo sapiens 116gaaatagtga
tgacgcagtc tccagccacc ctgtctgtgt ctccagggga aagagccacc 60ctctcctgca
gggccagtca gagtgttagt agcaacttag cctggtacca gcagaaacct
120ggccaggctc ccaggctcct catctatggt gcatccacca gggccactgg
tatcccagcc 180aggttcagtg gcagtgggtc tgggacagag ttcactctca
ccatcagcag cctgcagtct 240gaagattttg cagtttatta ctgtcagcag
tataataact ggccgctcac tttcggcgga 300gggaccaagg tggagatcaa
acgaactgtg gctgcaccat ctgtcttcat cttcccgcca 360tctgatgagc
agttgaaatc tggaactgcc tctgttgtgt gcctgctgaa taacttctat
420cccagagagg ccaaagtaca gtggaaggtg gataacgccc tccaatcggg
taactcccag 480gagagtgtca cagagcagga cagcaaggac agcacctaca
gcctcagcag caccctgacg 540ctgagcaaag cagactacga gaaacacaaa
gtctacgcct gcgaagtcac ccatcagggc 600ctgagctcgc ccgtcacaaa
gagcttcaac aggggagagt gttag 645117214PRTHomo sapiens 117Glu Ile Val
Met Thr Gln Ser Pro Ala Thr Leu Ser Val Ser Pro Gly1 5 10 15Glu Arg
Ala Thr Leu Ser Cys Arg Ala Ser Gln Ser Val Ser Ser Asn 20 25 30Leu
Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu Ile 35 40
45Tyr Gly Ala Ser Thr Arg Ala Thr Gly Ile Pro Ala Arg Phe Ser Gly
50 55 60Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Ser Leu Gln
Ser65 70 75 80Glu Asp Phe Ala Val Tyr Tyr Cys Gln Gln Tyr Asn Asn
Trp Pro Leu 85 90 95Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys Arg
Thr Val Ala Ala 100 105 110Pro Ser Val Phe Ile Phe Pro Pro Ser Asp
Glu Gln Leu Lys Ser Gly 115 120 125Thr Ala Ser Val Val Cys Leu Leu
Asn Asn Phe Tyr Pro Arg Glu Ala 130 135 140Lys Val Gln Trp Lys Val
Asp Asn Ala Leu Gln Ser Gly Asn Ser Gln145 150 155 160Glu Ser Val
Thr Glu Gln Asp Ser Lys Asp Ser Thr Tyr Ser Leu Ser 165 170 175Ser
Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu Lys His Lys Val Tyr 180 185
190Ala Cys Glu Val Thr His Gln Gly Leu Ser Ser Pro Val Thr Lys Ser
195 200 205Phe Asn Arg Gly Glu Cys 210118122PRTHomo sapiens 118Glu
Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly1 5 10
15Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Phe
20 25 30Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp
Val 35 40 45Ser Thr Ile Ser Gly Ser Gly Gly Tyr Thr Phe Tyr Ala Asp
Ser Val 50 55 60Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn
Thr Leu Tyr65 70 75 80Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr
Ala Val Tyr Tyr Cys 85 90 95Ala Lys Asp Gly Arg Tyr Asn Trp Asn Tyr
Gly Ala Phe Asp Ile Trp 100 105 110Gly Gln Gly Thr Met Val Thr Val
Ser Ser 115 120119367DNAHomo sapiens 119gaggtgcagc tgttggagtc
tgggggaggc ttggtacagc ctggggggtc cctgagactc 60tcctgtgcag cctctggatt
cacctttagc agctttgcca tgagctgggt ccgccaggct 120ccagggaagg
ggctggaatg ggtctcaact attagtggta gtggtggtta cacattctac
180gcagactccg tgaagggccg gttcaccatc tccagagaca attccaagaa
cacgctgtat 240ctgcaaatga acagcctgag agccgaggac acggccgtat
attactgtgc gaaagatgga 300aggtataact ggaactacgg ggcttttgat
atctggggcc aagggacaat ggtcaccgtc 360tcctcag 367120107PRTHomo
sapiens 120Glu Ile Val Met Thr Gln Ser Pro Ala Thr Leu Ser Val Ser
Pro Gly1 5 10 15Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Ser Val
Ser Ser Asn 20 25 30Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro
Arg Leu Leu Ile 35 40 45Tyr Gly Ala Ser Thr Arg Ala Thr Gly Ile Pro
Ala Arg Phe Ser Gly 50 55 60Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr
Ile Ser Ser Leu Gln Ser65 70 75 80Glu Asp Phe Ala Val Tyr Tyr Cys
Gln Gln Tyr Asn Asn Trp Pro Leu 85 90 95Thr Phe Gly Gly Gly Thr Lys
Val Glu Ile Lys 100 105121322DNAHomo sapiens 121gaaatagtga
tgacgcagtc tccagccacc ctgtctgtgt ctccagggga aagagccacc 60ctctcctgca
gggccagtca gagtgttagt agcaacttag cctggtacca gcagaaacct
120ggccaggctc ccaggctcct catctatggt gcatccacca gggccactgg
tatcccagcc 180aggttcagtg gcagtgggtc tgggacagag ttcactctca
ccatcagcag cctgcagtct 240gaagattttg cagtttatta ctgtcagcag
tataataact ggccgctcac tttcggcgga 300gggaccaagg tggagatcaa ac
32212215PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 122Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly
Gly Gly Gly Ser1 5 10 15
* * * * *