U.S. patent application number 12/991111 was filed with the patent office on 2011-04-14 for methods for producing enucleated erythroid cells derived from pluripotent stem cells.
This patent application is currently assigned to ADVANCED CELL TECHNOLOGY, INC.. Invention is credited to Robert Lanza, Shi-Jiang Lu.
Application Number | 20110086424 12/991111 |
Document ID | / |
Family ID | 41265390 |
Filed Date | 2011-04-14 |
United States Patent
Application |
20110086424 |
Kind Code |
A1 |
Lanza; Robert ; et
al. |
April 14, 2011 |
METHODS FOR PRODUCING ENUCLEATED ERYTHROID CELLS DERIVED FROM
PLURIPOTENT STEM CELLS
Abstract
Methods for generating enucleated erythroid cells using
pluripotent stem cells are provided. The methods permit the
production of large numbers of cells. The cells obtained by the
methods disclosed may be used for a variety of research, clinical,
and therapeutic applications. Methods for generating megakaryocyte
and platelets are also provided.
Inventors: |
Lanza; Robert; (Clinton,
MA) ; Lu; Shi-Jiang; (Shrewsbury, MA) |
Assignee: |
ADVANCED CELL TECHNOLOGY,
INC.
Marlborough
MA
|
Family ID: |
41265390 |
Appl. No.: |
12/991111 |
Filed: |
May 6, 2009 |
PCT Filed: |
May 6, 2009 |
PCT NO: |
PCT/US09/43050 |
371 Date: |
November 4, 2010 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
61126803 |
May 6, 2008 |
|
|
|
61189491 |
Aug 19, 2008 |
|
|
|
61190282 |
Aug 26, 2008 |
|
|
|
Current U.S.
Class: |
435/366 ;
435/325; 435/377 |
Current CPC
Class: |
C12N 5/0641 20130101;
C12N 2501/115 20130101; C12N 2502/1394 20130101; C12N 2501/125
20130101; C12N 2501/26 20130101; A61K 35/12 20130101; C12N 2500/25
20130101; C12N 2506/45 20130101; C12N 2533/78 20130101; C12N
2501/14 20130101; A61P 7/00 20180101; C12N 5/0644 20130101; C12N
2501/60 20130101; C12N 2500/38 20130101; C12N 5/0647 20130101; C12N
2501/165 20130101; A61P 7/06 20180101; C12N 2501/145 20130101; C12N
2506/02 20130101; C12N 2501/155 20130101; C12N 5/0692 20130101;
C12N 2501/23 20130101; C12N 2502/1358 20130101 |
Class at
Publication: |
435/366 ;
435/377; 435/325 |
International
Class: |
C12N 5/0797 20100101
C12N005/0797 |
Claims
1. A method of producing a pluripotent stem cell-derived enucleated
erythroid cell, comprising: providing a pluripotent stem cell; and
differentiating said pluripotent stem cell into an enucleated
erythroid cell by culturing said pluripotent stem cell with OP9
mouse stromal cells or human mesenchymal stem cells (MSCs).
2. The method of claim 1, wherein said pluripotent stem cell is an
embryonic stem cell or embryo-derived cell.
3. The method of claim 1, wherein said pluripotent stem cell is an
induced pluripotent stem cell.
4. The method of claim 1, wherein said pluripotent stem cell is a
human cell.
5. The method of claim 1, wherein said pluripotent stem cell is
genetically manipulated prior to differentiation.
6. The method of claim 1, wherein differentiating said pluripotent
stem cell into an enucleated erythroid cell comprises
differentiating said pluripotent stem cell into a hemangioblast,
non-engrafting hemangio cell, or blast cell.
7. The method of claim 6, wherein said hemangioblast,
non-engrafting hemangio cell, or blast cell is expanded prior to
being differentiated into said enucleated erythroid cell.
8. The method of claim 7, wherein said hemangioblasts,
non-engrafting hemangio cells, or blast cells are expanded in
Stemline II medium with Epo, IL-3, and SCF.
9. The method of claim 6, wherein said pluripotent stem cell is a
human pluripotent stem cell and differentiating said human
pluripotent stem cell into said hemangioblast is done in vitro by a
method comprising: (a) culturing a cell culture comprising human
pluripotent stem cell in serum-free media in the presence of at
least one growth factor in an amount sufficient to induce the
differentiation of said human pluripotent stem cell into embryoid
bodies; and (b) adding at least two growth factors to said culture
comprising embryoid bodies and continuing to culture said culture
in serum-free media, wherein said growth factor is in an amount
sufficient to expand said human hemangioblast in said embryoid
bodies culture, wherein said human pluripotent stem cells, embryoid
bodies and hemangioblasts are grown in serum-free media throughout
steps (a) and (b) of said method, and wherein said at least two
growth factors in step (b) comprise BMP4 and VEGF.
10. The method of claim 9, wherein differentiating said human
pluripotent stem cell into said hemangioblast further comprises:
(c) disaggregating said embryoid bodies into single cells; and (d)
adding at least one growth factor to said culture comprising said
single cells and continuing to culture said culture in serum-free
media, wherein said growth factor is in an amount sufficient to
expand human hemangioblasts in said culture comprising said single
cells, and wherein said human pluripotent stem cells, embryoid
bodies and hemangio-colony foaming cells are grown in serum-free
media throughout steps (a)-(d) of said method.
11-18. (canceled)
19. The method of claim 6, wherein said pluripotent stem cell is a
human pluripotent stem cell and differentiating said human
pluripotent stem cell into said non-engrafting hemangio cell is
done in vitro by a method comprising: (a) culturing a cell culture
comprising said human pluripotent stem cell in serum-free media in
the presence of at least one growth factor in an amount sufficient
to induce the differentiation of said human pluripotent stem cell
into embryoid bodies; and (b) adding at least one growth factor to
said culture comprising embryoid bodies and continuing to culture
said culture in serum-free media, wherein said growth factor is in
an amount sufficient to expand said human non-engrafting hemangio
cell in said embryoid bodies culture, wherein said embryoid bodies
are cultured for 10-13 days, and wherein said human pluripotent
stem cell, embryoid bodies and non-engrafting hemangio cells are
grown in serum-free media throughout steps (a) and (b) of said
method.
20. The method of claim 19, wherein differentiating said
pluripotent stem cell into said non-engrafting hemangio cell
further comprises: (c) disaggregating said embryoid bodies into
single cells; and (d) adding at least one growth factor to said
culture comprising said single cells and continuing to culture said
culture in serum-free media, wherein said growth factor is in an
amount sufficient to expand said human non-engrafting hemangio cell
in said culture comprising said single cells, wherein said
embryo-derived cells, embryoid bodies and non-engrafting hemangio
cells are grown in serum-free media throughout steps (a)-(d) of
said method.
21-28. (canceled)
29. The method of claim 1, wherein differentiating said pluripotent
stem cell into said enucleated erythroid cell further comprises
culturing said pluripotent stem cell in the culture medium
comprising EPO.
30. The method of claim 29, wherein differentiating said
pluripotent stem cell into said enucleated erythroid cell further
comprises: culturing said pluripotent stem cell in a culture medium
comprising a supplement selected from the group consisting of
inositol, folic acid, monothioglycerol, transferrin, insulin,
ferrous nitrate, ferrous sulfate, BSA, L-glutamine,
penicillin-streptomycin and combinations thereof; and culturing
said pluripotent stem cell in said culture medium wherein said
culture medium further comprises an agent selected from the group
consisting of hydrocortisone, SCF, IL3, Epo and combinations
thereof.
31. An enucleated erythroid cell produced by the method of claim
1.
32. A method of producing a pluripotent stem cell-derived erythroid
cell, comprising: providing a pluripotent stem cell; and
differentiating said pluripotent stem cell into an erythroid cell
by culturing said pluripotent stem cell in a medium comprising
EPO.
33. The method of claim 32, wherein said pluripotent stem cell is
an embryonic stem cell or embryo-derived cell.
34. The method of claim 32, wherein said pluripotent stem cell is
an induced pluripotent stem cell.
35. The method of claim 32, wherein said pluripotent stem cell is a
human cell.
36. The method of claim 32, wherein said pluripotent stem cell is
genetically manipulated prior to differentiation.
37. The method of claim 32, wherein differentiating said
pluripotent stem cell into an erythroid cell comprises
differentiating said pluripotent stem cell into a hemangioblast,
non-engrafting hemangio cell, or blast cell.
38. The method of claim 37, wherein said hemangioblast,
non-engrafting hemangio cell, or blast cell is expanded prior being
differentiated into said erythroid cell.
39. The method of claim 38, wherein said hemangioblasts,
non-engrafting hemangio cells, or blast cells are expanded in
Stemline II medium with Epo, IL-3, and SCF.
40. The method of claim 32, wherein said pluripotent stem cell is a
human pluripotent stem cell and differentiating said human
pluripotent stem cell into said hemangioblast is done in vitro by a
method comprising: (a) culturing a cell culture comprising said
human pluripotent stem cell in serum-free media in the presence of
at least one growth factor in an amount sufficient to induce the
differentiation of said human pluripotent stem cell into embryoid
bodies; and (b) adding at least two growth factors to said culture
comprising embryoid bodies and continuing to culture said culture
in serum-free media, wherein said growth factor is in an amount
sufficient to expand said human hemangioblast in said embryoid
bodies culture, wherein said human pluripotent stem cells, embryoid
bodies and hemangioblasts are grown in serum-free media throughout
steps (a) and (b) of said method, and wherein said at least two
growth factors in step (b) comprise BMP4 and VEGF.
41. The method of claim 40, wherein differentiating said human
pluripotent stem cell into said hemangioblast further comprises:
(c) disaggregating said embryoid bodies into single cells; and (d)
adding at least one growth factor to said culture comprising said
single cells and continuing to culture said culture in serum-free
media, wherein said growth factor is in an amount sufficient to
expand human hemangioblasts in said culture comprising said single
cells, and wherein said pluripotent stem cells, embryoid bodies and
hemangio-colony forming cells are grown in serum-free media
throughout steps (a)-(d) of said method.
42-49. (canceled)
50. The method of claim 32, wherein said pluripotent stem cell is a
human pluripotent stem cell and differentiating said pluripotent
stem cell into said non-engrafting hemangio cell is done in vitro
by a method comprising: (a) culturing a cell culture comprising
human pluripotent stem cell in serum-free media in the presence of
at least one growth factor in an amount sufficient to induce the
differentiation of said human pluripotent stem cell into embryoid
bodies; and (b) adding at least one growth factor to said culture
comprising embryoid bodies and continuing to culture said culture
in serum-free media, wherein said growth factor is in an amount
sufficient to expand said human non-engrafting hemangio cells in
said embryoid bodies culture, wherein said embryoid bodies are
cultured for 10-13 days, and wherein said human pluripotent stem
cell, embryoid bodies and non-engrafting hemangio cells are grown
in serum-free media throughout steps (a) and (b) of said
method.
51. The method of claim 50, wherein differentiating said
pluripotent stem cell into said non-engrafting hemangio cell
further comprises (c) disaggregating said embryoid bodies into
single cells; and (d) adding at least one growth factor to said
culture comprising said single cells and continuing to culture said
culture in serum-free media, wherein said growth factor is in an
amount sufficient to expand human non-engrafting hemangio cells in
said culture comprising said single cells, wherein said human
pluripotent stem cell, embryoid bodies and non-engrafting hemangio
cells are gown in scrum-free media throughout steps (a)-(d) of said
method.
52-57. (canceled)
58. An erythroid cell produced by the method of claim 32.
59. A method of producing a megakaryocyte or a platelet,
comprising: providing a pluripotent stem cell; differentiating said
pluripotent stem cell into a hemangioblast, non-engrafting hemangio
cell, or blast cell; and differentiating said hemangioblast,
non-engrafting hemangio cell, or blast cell into said megakaryocyte
or said platelet by culturing in megakaryocyte (MK) culture medium
comprising TPO.
60. The method of claim 59, wherein said pluripotent stem cell is
an embryonic stem cell or embryo-derived cell.
61. The method of claim 59, wherein said pluripotent stem cell is
an induced pluripotent stem cell.
62. The method of claim 59, wherein said pluripotent stern cell is
a human cell.
63. The method of claim 59, wherein said pluripotent stem cell is
genetically manipulated prior to differentiation.
64. The method of claim 59, wherein said hemangioblast,
non-engrafting hemangio cell, or blast cell is expanded prior to
being differentiated into said megakaryocyte or said platelet.
65. The method of claim 64, wherein said hemangioblasts,
non-engrafting hemangio cells, or blast cells are expanded in
Stemline II medium with Epo, IL-3, and SCF.
66. The method of claim 59, wherein said pluripotent stem cell is a
human pluripotent stem cell and differentiating said human
pluripotent stem cell into said hemangioblast is done in vitro by a
method comprising: (a) culturing a cell culture comprising human
pluripotent stem cell in serum-free media in the presence of at
least one growth factor in an amount sufficient to induce the
differentiation of said human pluripotent stem cell into embryoid
bodies; and (b) adding at least two growth factors to said culture
comprising embryoid bodies and continuing to culture said culture
in serum-free media, wherein said growth factor is in an amount
sufficient to expand said human hemangioblast in said embryoid
bodies culture, wherein said human pluripotent stem cells, embryoid
bodies and hemangioblasts are grown in serum-free media throughout
steps (a) and (b) of said method, and wherein said at least two
growth factors in step (b) comprise BMP4 and VEGF.
67. The method of claim 66, wherein differentiating said human
pluripotent stem cell into said hemangioblast further comprises:
(c) disaggregating said embryoid bodies into single cells; and (d)
adding at least one growth factor to said culture comprising said
single cells and continuing to culture said culture in serum-free
media, wherein said growth factor is in an amount sufficient to
expand human hemangioblasts in said culture comprising said single
cells, and wherein said human pluripotent stem cells, embryoid
bodies and hemangio-colony forming cells are grown in serum-free
media throughout steps (a)-(d) of said method.
68-73. (canceled)
74. The method of claim 59, wherein differentiating said
hemangioblast, non-engrafting hemangio cell, or blast cell into
said megakaryocyte or said platelet is done after about 6 to 8 days
of hemangioblast, non-engrafting hemangio cell, or blast cell
culture.
75. The method of claim 59, wherein said pluripotent stem cell is a
human pluripotent stem cell and differentiating said human
pluripotent stem cell into said non-engrafting hemangio cell is
done in vitro by a method comprising: (a) culturing a cell culture
comprising said human pluripotent stem cell in serum-free media in
the presence of at least one growth factor in an amount sufficient
to induce the differentiation of said human pluripotent stem cell
into embryoid bodies; and (b) adding at least one growth factor to
said culture comprising embryoid bodies and continuing to culture
said culture in serum-free media, wherein said growth factor is in
an amount sufficient to expand said human non-engrafting hemangio
cell in said embryoid bodies culture, wherein said embryoid bodies
are cultured for 10-13 days, and wherein said human pluripotent
stem cell, embryoid bodies and non-engrafting hemangio cells are
grown in serum-free media throughout steps (a) and (b) of said
method.
76. The method of claim 75, wherein differentiating said
pluripotent stem cell into said non-engrafting hemangio cell
further comprises: (c) disaggregating said embryoid bodies into
single cells; and (d) adding at least one growth factor to said
culture comprising said single cells and continuing to culture said
culture in serum-free media, wherein said growth factor is in an
amount sufficient to expand said human non-engrafting hemangio cell
in said culture comprising said single cells, wherein said
embryo-derived cells, embryoid bodies and non-engrafting hemangio
cells are grown in serum-free media throughout steps (a)-(d) of
said method.
77-82. (canceled)
83. A megakaryocyte or a platelet produced by the method of claim
59.
Description
FIELD OF INVENTION
[0001] The present invention relates to producing human enucleated
erythroid cells from pluripotent stem cells.
BACKGROUND
[0002] All publications herein are incorporated by reference to the
same extent as if each individual publication or patent application
was specifically and individually indicated to be incorporated by
reference. The following description includes information that may
be useful in understanding the present invention. It is not an
admission that any of the information provided herein is prior art
or relevant to the presently claimed invention, or that any
publication specifically or implicitly referenced is prior art.
[0003] There is a critical need for available blood for
transfusion. The Red Cross and other suppliers of blood report a
near constant shortage of blood. This is especially true for
patients with unique blood types, patients who are Rh+, or
following accidents or disasters resulting in mass casualties.
Additionally, in times of war, the military has an acute need for
available blood for use in the treatment of traumatic war-related
injuries. The present invention provides improved methods and
compositions for use in blood banking and transfusion. The cells
and methods of the present invention will provide a safe and
reliable advance beyond the traditional reliance on blood
donations, and will help prevent critical shortages in available
blood.
SUMMARY OF THE INVENTION
[0004] The following embodiments and aspects thereof are described
and illustrated in conjunction with compositions and methods which
are meant to be exemplary and illustrative, not limiting in
scope.
[0005] The present invention provides methods for making and using
erythroid cells and enucleated erythroid cells derived from
pluripotent stem cells.
[0006] In certain embodiments, the present invention provides for a
method of producing a pluripotent stem cell-derived enucleated
erythroid cell, comprising: providing a pluripotent stem cell; and
differentiating said pluripotent stem cell into an enucleated
erythroid cell by culturing said pluripotent stem cell with OP9
mouse stromal cells or human mesenchymal stem cells (MSCs).
[0007] In certain embodiments, differentiating said pluripotent
stem cell into an enucleated erythroid cell comprises
differentiating said pluripotent stem cell into a hemangioblast,
non-engrafting hemangio cell or blast cell. In certain embodiments,
said hemangioblast, non-engrafting hemangio cell, or blast cell is
expanded prior to being differentiated into said enucleated
erythroid cell. In certain embodiments, said hemangioblasts,
non-engrafting hemangio cells, or blast cells are expanded in
Stemline II medium with Epo, IL-3, and SCF.
[0008] In certain embodiments, said pluripotent stem cell is a
human pluripotent stem cell and differentiating said human
pluripotent stem cell into said hemangioblast is done in vitro by a
method comprising: (a) culturing a cell culture comprising human
pluripotent stem cell in serum-free media in the presence of at
least one growth factor in an amount sufficient to induce the
differentiation of said human pluripotent stem cell into embryoid
bodies; and (b) adding at least two growth factors to said culture
comprising embryoid bodies and continuing to culture said culture
in serum-free media, wherein said growth factor is in an amount
sufficient to expand said human hemangioblast in said embryoid
bodies culture, wherein said human pluripotent stem cells, embryoid
bodies and hemangioblasts are grown in serum-free media throughout
steps (a) and (b) of said method, and wherein said at least two
growth factors in step (b) comprise BMP4 and VEGF. In certain
embodiments, differentiating said human pluripotent stem cell into
said hemangioblast further comprises (c) disaggregating said
embryoid bodies into single cells; and (d) adding at least one
growth factor to said culture comprising said single cells and
continuing to culture said culture in serum-free media, wherein
said growth factor is in an amount sufficient to expand human
hemangioblasts in said culture comprising said single cells, and
wherein said human pluripotent stem cells, embryoid bodies and
hemangio-colony forming cells are grown in serum-free media
throughout steps (a)-(d) of said method.
[0009] In certain embodiments, said pluripotent stem cell is a
human pluripotent stem cell and differentiating said human
pluripotent stem cell into said non-engrafting hemangio cell is
done in vitro by a method comprising: (a) culturing a cell culture
comprising said human pluripotent stem cell in serum-free media in
the presence of at least one growth factor in an amount sufficient
to induce the differentiation of said human pluripotent stem cell
into embryoid bodies; and (b) adding at least one growth factor to
said culture comprising embryoid bodies and continuing to culture
said culture in serum-free media, wherein said growth factor is in
an amount sufficient to expand said human non-engrafting hemangio
cell in said embryoid bodies culture, wherein said embryoid bodies
are cultured for 10-13 days, and wherein said human pluripotent
stem cell, embryoid bodies and non-engrafting hemangio cells are
grown in serum-free media throughout steps (a) and (b) of said
method. In certain embodiments, differentiating said pluripotent
stem cell into said non-engrafting hemangio cell further comprises
(c) disaggregating said embryoid bodies into single cells; and (d)
adding at least one growth factor to said culture comprising said
single cells and continuing to culture said culture in serum-free
media, wherein said growth factor is in an amount sufficient to
expand said human non-engrafting hemangio cell in said culture
comprising said single cells, wherein said embryo-derived cells,
embryoid bodies and non-engrafting hemangio cells are grown in
serum-free media throughout steps (a)-(d) of said method.
[0010] In certain embodiments, differentiating said pluripotent
stem cell into said enucleated erythroid cell further comprises
culturing said pluripotent stem cell in the culture medium
comprising EPO. In certain embodiments, differentiating said
pluripotent stem cell into said enucleated erythroid cell further
comprises: culturing said pluripotent stem cell in a culture medium
comprising a supplement selected from the group consisting of
inositol, folic acid, monothioglycerol, transferrin, insulin,
ferrous nitrate, ferrous sulfate, BSA, L-glutamine,
penicillin-streptomycin and combinations thereof; and culturing
said pluripotent stem cell in said culture medium wherein said
culture medium further comprises an agent selected from the group
consisting of hydrocortisone, SCF, IL3, Epo and combinations
thereof.
[0011] In certain embodiments, said pluripotent stem cell used in
the present invention is an embryonic stem cell or embryo-derived
cell. In certain embodiments, said pluripotent stem cell is an
induced pluripotent stem cell. In certain embodiments, said
pluripotent stem cell is a human cell. In certain embodiments, said
pluripotent stem cell is genetically manipulated prior to
differentiation.
[0012] In certain embodiments, said growth factor used in the
present invention is a fusion protein that comprises HOXB4 and a
protein transduction domain (PTD). In certain embodiments, said
HOXB4 is mammalian HOXB4. In certain embodiments, said mammalian
HOXB4 is mouse or human HOXB4.
[0013] In certain embodiments, said growth factor used in the
present invention is selected from the group consisting of vascular
endothelial growth factor (VEGF), bone morphogenic proteins (BMP),
stem cell factor (SCF), Flt-3L (FL) thrombopoietin (TPO) and
erythropoietin (EPO). In certain embodiments, said vascular
endothelial growth factor (VEGF), bone morphogenic protein (BMP),
or both, are added to step (a) within 0-48 hours of cell culture.
In certain embodiments, said stem cell factor (SCF), Flt-3L (FL) or
thrombopoietin (TPO), or any combination thereof, are added to said
culture within 48-72 hours from the start of step (a).
[0014] In certain embodiments, the methods further comprise the
step of adding erythropoietin (EPO) to step (a) or further
comprises the step of adding erythropoietin (EPO) to step (a) or
(d).
[0015] In certain embodiments, the present invention provides
enucleated erythroid cells produced by methods as described
above.
[0016] Other embodiments of the present invention also provides a
method of producing a pluripotent stem cell-derived erythroid cell,
comprising: providing a pluripotent stem cell; and differentiating
said pluripotent stem cell into an erythroid cell by culturing said
pluripotent stem cell in a medium comprising EPO.
[0017] In certain embodiments, differentiating said pluripotent
stem cell into an erythroid cell comprises differentiating said
pluripotent stem cell into a hemangioblast, non-engrafting hemangio
cell, or blast cell. In certain embodiments, said hemangioblast,
non-engrafting hemangio cell, or blast cell is expanded prior being
differentiated into said erythroid cell. In certain embodiments,
said hemangioblasts, non-engrafting hemangio cells, or blast cells
are expanded in Stemline II medium with Epo, IL-3, and SCF.
[0018] In certain embodiments, said pluripotent stem cell is a
human pluripotent stem cell and differentiating said human
pluripotent stem cell into said hemangioblast is done in vitro by a
method comprising: (a) culturing a cell culture comprising said
human pluripotent stem cell in serum-free media in the presence of
at least one growth factor in an amount sufficient to induce the
differentiation of said human pluripotent stem cell into embryoid
bodies; and (b) adding at least two growth factors to said culture
comprising embryoid bodies and continuing to culture said culture
in serum free media, wherein said growth factor is in an amount
sufficient to expand said human hemangioblast in said embryoid
bodies culture, wherein said human pluripotent stem cells, embryoid
bodies and hemangioblasts are grown in serum-free media throughout
steps (a) and (b) of said method, and wherein said at least two
growth factors in step (b) comprise BMP4 and VEGF.
[0019] In certain embodiments, differentiating said human
pluripotent stem cell into said hemangioblast further comprises (c)
disaggregating said embryoid bodies into single cells; and (d)
adding at least one growth factor to said culture comprising said
single cells and continuing to culture said culture in serum-free
media, wherein said growth factor is in an amount sufficient to
expand human hemangioblasts in said culture comprising said single
cells, and wherein said pluripotent stem cells, embryoid bodies and
hemangio-colony forming cells are grown in serum-free media
throughout steps (a)-(d) of said method.
[0020] In certain embodiments, said pluripotent stem cell is a
human pluripotent stem cell and differentiating said pluripotent
stem cell into said non-engrafting hemangio cell is done in vitro
by a method comprising: (a) culturing a cell culture comprising
human pluripotent stem cell in serum-free media in the presence of
at least one growth factor in an amount sufficient to induce the
differentiation of said human pluripotent stem cell into embryoid
bodies; and (b) adding at least one growth factor to said culture
comprising embryoid bodies and continuing to culture said culture
in serum-free media, wherein said growth factor is in an amount
sufficient to expand said human non-engrafting hemangio cells in
said embryoid bodies culture, wherein said embryoid bodies are
cultured for 10-13 days, and wherein said human pluripotent stem
cell, embryoid bodies and non-engrafting hemangio cells are grown
in serum-free media throughout steps (a) and (b) of said
method.
[0021] In certain embodiments, differentiating said pluripotent
stem cell into said non-engrafting hemangio cell further comprises
(c) disaggregating said embryoid bodies into single cells; and (d)
adding at least one growth factor to said culture comprising said
single cells and continuing to culture said culture in serum-free
media, wherein said growth factor is in an amount sufficient to
expand human non-engrafting hemangio cells in said culture
comprising said single cells, wherein said human pluripotent stem
cell, embryoid bodies and non-engrafting hemangio cells are grown
in serum-free media throughout steps (a)-(d) of said method.
[0022] In certain embodiments, said pluripotent stem cell used in
the present invention is an embryonic stem cell or embryo-derived
cell. In certain embodiments, said pluripotent stem cell is an
induced pluripotent stem cell. In certain embodiments, said
pluripotent stem cell is a human cell. In certain embodiments, said
pluripotent stem cell is genetically manipulated prior to
differentiation.
[0023] In certain embodiments, said growth factor used in the
present invention is a fusion protein that comprises HOXB4 and a
protein transduction domain (PTD). In certain embodiments, said
HOXB4 is mammalian HOXB4. In certain embodiments, said mammalian
HOXB4 is mouse or human HOXB4.
[0024] In certain embodiments, said growth factor used in the
present invention is selected from the group consisting of vascular
endothelial growth factor (VEGF), bone morphogenic proteins (BMP),
stem cell factor (SCF), Flt-3L (FL) thrombopoietin (TPO) and
erythropoietin (EPO). In certain embodiments, said vascular
endothelial growth factor (VEGF), bone morphogenic protein (BMP),
or both, are added to step (a) within 0-48 hours of cell culture.
In certain embodiments, said stem cell factor (SCF), Flt-3L (FL) or
thrombopoietin (TPO), or any combination thereof, are added to said
culture within 48-72 hours from the start of step (a).
[0025] In certain embodiments, the methods further comprise the
step of adding erythropoietin (EPO) to step (a) or further
comprises the step of adding erythropoietin (EPO) to step (a) or
(d).
[0026] In certain embodiments, the present invention provides
erythroid cells produced by methods as described above.
[0027] Still other embodiments of the present invention provides
methods of producing a megakaryocyte or a platelet, comprising:
providing a pluripotent stem cell; differentiating said pluripotent
stem cell into a hemangioblast, non-engrafting hemangio cell, or
blast cell; and differentiating said hemangioblast, non-engrafting
hemangio cell, or blast cell into said megakaryocyte or said
platelet by culturing in megakaryocyte (MK) culture medium
comprising TPO.
[0028] In certain embodiments, said pluripotent stem cell used in
the present invention is an embryonic stem cell or embryo-derived
cell. In certain embodiments, said pluripotent stem cell is an
induced pluripotent stem cell. in certain embodiments, said
pluripotent stem cell is a human cell. In certain embodiments, said
pluripotent stem cell is genetically manipulated prior to
differentiation. In certain embodiments, said hemangioblast,
non-engrafting hemangio cell, or blast cell is expanded prior to
being differentiated into said megakaryocyte or said platelet.
[0029] In certain embodiments, said hemangioblasts, non-engrafting
hemangio cells, or blast cells are expanded in Stemline II medium
with Epo, IL-3, and SCF.
[0030] In certain embodiments, said pluripotent stem cell is a
human pluripotent stem cell and differentiating said human
pluripotent stem cell into said hemangioblast is done in vitro by a
method comprising: (a) culturing a cell culture comprising human
pluripotent stem cell in serum-free media in the presence of at
least one growth factor in an amount sufficient to induce the
differentiation of said human pluripotent stem cell into embryoid
bodies; and (b) adding at least two growth factors to said culture
comprising embryoid bodies and continuing to culture said culture
in serum-free media, wherein said growth factor is in an amount
sufficient to expand said human hemangioblast in said embryoid
bodies culture, wherein said human pluripotent stem cells, embryoid
bodies and hemangioblasts are grown in serum-free media throughout
steps (a) and (b) of said method, and wherein said at least two
growth factors in step (b) comprise BMP4 and VEGF.
[0031] In certain embodiments, differentiating said human
pluripotent stem cell into said hemangioblast further comprises:
(c) disaggregating said embryoid bodies into single cells; and (d)
adding at least one growth factor to said culture comprising said
single cells and continuing to culture said culture in serum-free
media, wherein said growth factor is in an amount sufficient to
expand human hemangioblasts in said culture comprising said single
cells, and wherein said human pluripotent stem cells, embryoid
bodies and hemangio-colony forming cells are grown in serum free
media throughout steps (a)-(d) of said method.
[0032] In certain embodiments, differentiating said hemangioblast,
non-engrafting hemangio cell, or blast cell into said megakaryocyte
or said platelet is done after about 6 to 8 days of hemangioblast,
non-engrafting hemangio cell, or blast cell culture.
[0033] In certain embodiments, said pluripotent stem cell is a
human pluripotent stem cell and differentiating said human
pluripotent stem cell into said non-engrafting hemangio cell is
done in vitro by a method comprising: (a) culturing a cell culture
comprising said human pluripotent stem cell in serum-free media in
the presence of at least one growth factor in an amount sufficient
to induce the differentiation of said human pluripotent stem cell
into embryoid bodies; and (b) adding at least one growth factor to
said culture comprising embryoid bodies and continuing to culture
said culture in serum-free media, wherein said growth factor is in
an amount sufficient to expand said human non-engrafting hemangio
cell in said embryoid bodies culture, wherein said embryoid bodies
are cultured for 10-13 days, and wherein said human pluripotent
stem cell, embryoid bodies and non-engrafting hemangio cells are
grown in serum-free media throughout steps (a) and (b) of said
method.
[0034] In certain embodiments, differentiating said pluripotent
stem cell into said non-engrafting hemangio cell further comprises:
(c) disaggregating said embryoid bodies into single cells; and (d)
adding at least one growth factor to said culture comprising said
single cells and continuing to culture said culture in serum free
media, wherein said growth factor is in an amount sufficient to
expand said human non-engrafting hemangio cell in said culture
comprising said single cells, wherein said embryo-derived cells,
embryoid bodies and non-engrafting hemangio cells are grown in
serum-free media throughout steps (a)-(d) of said method.
[0035] In certain embodiments, said growth factor used in the
present invention is a fusion protein that comprises HOXB4 and a
protein transduction domain (PTD). In certain embodiments, said
HOXB4 is mammalian HOXB4. In certain embodiments, said mammalian
HOXB4 is mouse or human HOXB4.
[0036] In certain embodiments, said growth factor used in the
present invention is selected from the group consisting of vascular
endothelial growth factor (VEGF), bone morphogenic proteins (BMP),
stem cell factor (SCF), Flt-3L (FL) thrombopoietin (TPO) and
erythropoietin (EPO). In certain embodiments, said vascular
endothelial growth factor (VEGF), bone morphogenic protein (BMP),
or both, are added to step (a) within 0-48 hours of cell culture.
In certain embodiments, said stem cell factor (SCF), Flt-3L (FL) or
thrombopoietin (TPO), or any combination thereof, are added to said
culture within 48-72 hours from the start of step (a).
[0037] The present invention also provides a megakaryocyte or a
platelet produced by any one of the method as described above.
[0038] Still other embodiments, the invention provides a method of
producing an enucleated erythroid cell comprising the steps of (a)
providing a pluripotent stem cell; and (b) differentiating said
pluripotent stem cell into enucleated erythroid cells. In certain
embodiments, said pluripotent stem cell is an embryonic stem cell
or embryo-derived cell. In certain embodiments, said pluripotent
stem cell is an induced pluripotent stem cell. In certain
embodiments, said pluripotent stem cell is a human cell. In certain
embodiments, said pluripotent stem cell is genetically manipulated
prior to differentiation. In certain embodiments, said pluripotent
stem cell is differentiated into hemangioblasts (e.g.,
hemangioblasts, hemangio colony forming cells, hemangio cells,
non-engrafting hemangio cells, or blast cells) prior to step (b).
In certain embodiments, said hemangioblasts or blast cells are
expanded prior to step (b). In certain embodiments, hemangioblasts,
non-engrafting hemangio cells, or blast cells are expanded about 5,
6, 7, 8, 9, 10, 11, 12, 13, 14 or 15 days. In certain embodiments,
hemangioblasts, non-engrafting hemangio cells, or blast cells are
expanded from about day 3.5 to about day 10. In certain
embodiments, said hemangioblasts, non-engrafting hemangio cells, or
blast cells are expanded in Stemline II medium with Epo, IL-3, and
SCF. In certain embodiments, hemangioblasts or blast cells are
differentiated for about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15
days. In certain embodiments, hemangioblasts, non-engrafting
hemangio cells, or blast cells are differentiated from about day 11
to about day 20. In certain embodiments, said enucleated erythroid
cells are cultured with OP9 or MSC cells. In certain embodiments,
said culture is supplemented with Epo. The invention contemplates
all suitable combinations of any of the forgoing or following
aspects and embodiments of the invention.
[0039] In certain embodiments, the present invention provides
enucleated erythroid cells produced by methods as described
above.
[0040] Other features and advantages of the invention will become
apparent from the following detailed description, taken in
conjunction with the accompanying drawings, which illustrate, by
way of example, various features of embodiments of the
invention.
BRIEF DESCRIPTION OF THE FIGURES
[0041] Exemplary embodiments are illustrated in referenced figures.
It is intended that the embodiments and figures disclosed herein
are to be considered illustrative rather than restrictive.
[0042] FIG. 1 depicts large scale production of erythroid cells
from hESCs in accordance with an embodiment of the present
invention. (A) Erythroid cells (pellet) derived from
2.times.10.sup.6 human ESCs. (B), erythroid cells from FIG. 1A were
resuspended in equivalent hematocrit of human whole blood; (C, D)
Morphology of erythroid cells derived from human ESCs (C,
(originally 200.times. and D, originally 1000.times.). (E)
Electrospray ionization mass spectra of globin chains in
hemoglobins from hESC-derived erythroid cells, confirming the
presence of .alpha., .zeta., .epsilon. and G.gamma. globins. The
observed molecular weight for each of the globins is shown. (F)
Flow cytometry analysis of hESC-derived erythroid cells. Erythroid
cells derived from hESCs were labeled with specific antibodies
conjugated with PE and analyzed on a FacScan flow cytometer (Becton
Dickinson) with the CellQuest program. Corresponding unspecific
isotype antibodies conjugated with the same dyes were used as
negative controls.
[0043] FIG. 2 depicts functional characterization of hESC-derived
erythroid cells in accordance with an embodiment of the present
invention. (A) Oxygen equilibrium curves of normal human RBCs and
human ESC-derived erythroid cells. Note, the two curves are
virtually indistinguishable at their midpoints, whereas the curve
of human ESC-derived erythroid cells is leftward shifted at low
(arrow) and high (arrow head) oxygen saturation percentages. (B)
The Bohr effect. (C) Effects of 2,3-DPG depletion. The solid lines
represent the normal RBC control and the dashed lines represent the
human ESC-derived erythroid cells. For each pair, the line on the
right represents the fresh cells and the one to the left is the
curve from cells depleted of 2,3-DPG.
[0044] FIG. 3 depicts characterization of Rh(D) and ABO genotype of
hESC lines by PCR in accordance with an embodiment of the present
invention. (A) Genotyping of RhD locus: Specific primers were
designed for the Rh locus that when Rh(D) positive DNA was used,
1,200-bp (weak) and 600-bp PCR products were amplified; whereas DNA
from RhD-negative cells generated only the 1,200-bp fragment. (B,
C) Genotyping of the ABO locus: two pairs of primers were designed
to amplify two regions of the ABO locus. The PCR products were
digested with restriction enzymes to distinguish ABO types. ABO and
Rh(D) genotypes are as follows: WA01, O(+); MA99, B(-); MA133,
A(-); WA07 and MA09, B(+); and WA09 and MA01, A(+). (D) RhD antigen
expression analysis on erythroid cells derived from MA01 and MA99
hESCs by FACS. Erythroid cells generated from MA01 and MA99 hESCs
were stained with PE-labeled monoclonal anti-RhD antibody and
analyzed by FACS. (E) ABO type characterization of hESC-derived
erythroid cells. Panel A (originally 400.times.), cells stained
with monoclonal antibody against A-antigen; Panel B (originally
400.times.), cells stained with monoclonal antibody against
B-antigen.
[0045] FIG. 4 depicts enucleation of hESC-derived erythroid cells
in vitro in accordance with an embodiment of the present invention.
(A) Diameter decreases with time in culture. Data for each day
represent diameters of nucleated cells except "27e" represents
diameters of enucleated cells at 27 days. Enucleated cells decrease
to less than half the original diameter on day 8. (B) Nuclear to
cytoplasm ratio decreases with time in culture. Samples
significantly different from day 8 are denoted by
*=P<0.05,**=P<0.001, #=P<0.002. (C, E) Erythroid cells
derived from human ESCs were cultured in vitro for four weeks in
Stemline II media with supplements and co-cultured with OP9 stromal
cells on day 36. On day 42, cells were cytospun and stained with
Wright-Giemsa dye. (C, originally 200.times. and E, originally
1000.times.); (D, F) Red blood cells from human blood were also
cytospun and stained with Wright-Giemsa and compared with
hESC-derived erythroid cells. (D, originally 200.times. and F,
originally 1000.times.) Scale bar=10 .mu.m.
[0046] FIG. 5 depicts maturation of hESC-derived erythroid cells
mimic erythroid development in accordance with an embodiment of the
present invention. (A) Expression of CD235a, a mature erythrocyte
marker, increases with time and CD71, an immature red blood cell
marker, shows a decrease in expression over time. (B) Expression of
.beta.-globin chain in hESC-derived erythroid cells. Cytospin
samples of hESC-derived erythroid cells collected from day 17 and
day 28 differentiation and maturation cultures were stained with
human .beta.-globin chain specific antibody. (C) Progressive
maturation of hESC-derived erythroid cells in vitro. Progressive
morphological changes from blast cells to erythroblasts, and
eventually matured erythrocytes are accompanied by significant
increase of hemoglobin and decrease in size during their in vitro
differentiation and maturation. Cells were stained with both
Wright-Giemsa and benzidine (A and B, originally 200.times.).
[0047] FIG. 6 depicts expression of glyphorin A in hESC-derived
erythroid cells in accordance with an embodiment of the present
invention. Cytospin samples of hESC-derived erythroid cells
collected from day 28 differentiation and maturation cultures were
stained with human CD235a antibody. Almost 100% of cells stained
positive for CD235a. (originally 200.times.).
[0048] FIG. 7 depicts expression of .beta.-globin chain in
hESC-derived erythroid cells in accordance with an embodiment of
the present invention. Cytospin samples of hESC-derived erythroid
cells collected from day 28 differentiation and maturation cultures
were stained with human .beta.-globin chain specific antibody.
(originally 200.times.).
[0049] FIG. 8 depicts analysis of .beta.-cluster globin gene
expressions by RT-PCR in accordance with an embodiment of the
present invention. Erythroid cells differentiated at different
stages were collected and the expression of .beta.-, .gamma.- and
.epsilon.-globin genes was analyzed by RT-PCR using globin chain
specific primers. RNA from adult bone marrow cells was used as a
positive control for .beta.-globin gene and a negative control for
.epsilon.-globin gene. Day 28a and Day 28b are erythroid cells from
two separate experiments. BM, bone marrow.
[0050] FIG. 9 depicts the effects of BMPs and VEGF.sub.165 on the
development of blast colonies in accordance with an embodiment of
the present invention. A. Different doses of BMP-4 were added in EB
medium containing 50 ng/ml of VEGF.sub.165, and a dose dependent
development of blast colonies was observed for BMP-4. B. EB medium
containing 50 ng/ml of BMP-4 and VEGF.sub.165 were supplemented
with different doses (0, 10 and 20 ng/ml) of BMP-2 and BMP-7. BMP-2
and BMP-7 failed in promoting blast colony development. C.
Different doses of VEGF.sub.165 were added in EB medium containing
50 ng/ml of BMP-4. The development of blast colonies is
VEGF.sub.165 dose dependent. **P<0.01, n=3. 1.times.10.sup.5
cells from day 3.5 EBs were plated per well.
[0051] FIG. 10 depicts the effect of bFGF on the development of
blast colonies added during different stages in accordance with an
embodiment of the present invention. (a) Different doses of bFGF
were added in EB medium; (b) Different doses of bFGF were
supplemented in blast colony growth medium (BGM); (c) Different
doses of bFGF were added in both EB medium and BGM. **P<0.01,
n=3. B and C. Net-work like structure formation of endothelial
cells derived from BCs developed in BGM with (B) and without (C)
bFGF. Endothelial cells from both sources formed net-work like
structures with no obvious difference.
[0052] FIG. 11 depicts the effect of bFGF on the development of
blast colonies from three hESC lines in accordance with an
embodiment of the present invention. Diagonal Strips Different
doses of bFGF were added in BGM. Horizontal Strips: Various doses
of bFGF were added in EB medium. *P<0.05; **P<0.01, n=3.
[0053] FIG. 12 depicts hESC grown under feeder-free conditions
retain pluripotency markers and are capable of robust hemangioblast
differentiation in accordance with an embodiment of the present
invention. After 4-5 passages under feeder-free conditions WA01
cells were stained for expression of the hESC markers Oct-4 (A-C:
DAPI, Oct-4 and merged respectively) and Tra-1-60 (D-F DAPI,
TRA-1-60, and merged respectively) Panels G and H demonstrate
differences in colony morphology when hESCs are cultured on
Matrigel (G) verses MEFs (H). Magnification: originally X100. In
panel I, hESCs were grown either on MEFs or Matrigel and then
differentiated under the optimized conditions described herein.
Considerably more hemangioblast expansion was observed in Matrigel
cultured cells as compared to MEF cultured hESCs. *P<0.03,
n=3.
[0054] FIG. 13 depicts qRT-PCR analysis of gene expression in EBs
cultured under different conditions in accordance with an
embodiment of the present invention. Expression levels of various
genes associated with development of hemangioblasts were analyzed
in EBs derived in the presence or absence of either or a
combination of both BMP-4 and VEGF.sub.165. .beta.-Actin was used
as an internal control to normalize gene expression. Relative gene
expression is presented as a fold difference compared to average
expression levels observed in undifferentiated hESCs. **P<0.002;
***P<0.0004, n=3.
[0055] FIG. 14 depicts identification of surface markers for
hemangioblast progenitors in accordance with an embodiment of the
present invention. EB cells were enriched with different antibodies
using EasySep Kit, then plated for the development of blast
colonies. **P<0.01, n=3.
[0056] FIG. 15 depicts a wild-type nucleic acid sequence of HOXB4
protein in accordance with an embodiment of the present
invention.
[0057] FIG. 16 depicts a wild-type nucleic acid sequence of HOXB4
protein in accordance with an embodiment of the present
invention.
[0058] FIG. 17 depicts an amino acid sequence of HOXB4 in
accordance with an embodiment of the present invention.
[0059] FIG. 18 depicts an amino acid sequence of HOXB4 in
accordance with an embodiment of the present invention.
[0060] FIG. 19 depicts iPSCs (IMR90-1) grown under feeder-free
conditions retain pluripotency markers in accordance with an
embodiment of the present invention. After 4-5 passages under
feeder-free conditions iPS(IMR90)-1 cells were stained for
expression of pluripotency markers. a, bright field; b, Nanog; c,
Oct-4; d, SSEA-4; and e, TRA-1-60. Magnification: originally
X200.
[0061] FIG. 20 depicts the effect of ROCK inhibitor on IPSO
hemangioblastic differentiation in accordance with an embodiment of
the present invention. EBs generated from iPS(IMR90)-1 cells 24 hr
after plating without (a, originally 100.times.) and with (b,
originally 100.times.) ROCK inhibitor; Blast colonies derived from
iPS(IMR90)-1 cells without ROCK inhibitor (c, originally
200.times.), with ROCK inhibitor (d, originally 200.times.), and
with ROCK inhibitor plus Art pathway inhibitor (e, originally
200.times.) during EB formation; ; f-j: Hematopoietic and
endothelial cell differentiation of iPSC-derived hemangioblasts: f
(originally 200.times.);CFU-E; g (originally 100.times.), CFU-M; h
(originally 40.times.), CFU-G; i (originally 400.times.), uptake of
Ac-LDL (red) by endothelial cells stained with VE-Cadherin (green);
j (originally 40.times.), tube-like network after plating
endothelial cells on Matrigel.
[0062] FIG. 21 depicts characterization of hESC-derived
megakaryocytes in accordance with an embodiment of the present
invention. A. FACS analysis of cells from day 4 megakaryocyte
maturation cultures. Cells were stained with megakaryocyte markers
CD41a, CD42b and erythroid lineage marker CD235a. B. FACS analysis
of DNA content (Propidium iodide staining) of gated CD41a+
megakaryocytes from day 6 maturation culture. The intensity of PI
staining is shown in log scale. C. A May-grunwald giemsa stained
mature polyploid megakaryocyte. D. Immuno-fluorescent staining of a
mature polyploid megakaryocyte with CD41 (green) and VWF (red) from
the cytospin preparation of day 6 megakaryocyte maturation culture.
E. A phase contrast image shows proplatelet forming megakaryocytes
(red arrows) in day 7 liquid maturation culture.
[0063] FIG. 22 depicts FACS analysis of in vitro hESC derived
platelets in accordance with an embodiment of the present
invention. Human peripheral blood platelets were used as controls.
CD41a+ particles derived from hESCs are of similar FSC and SSC
characteristics of peripheral blood platelets.
DESCRIPTION OF THE INVENTION
[0064] All references cited herein are incorporated by reference in
their entirety as though fully set forth. Unless defined otherwise,
technical and scientific terms used herein have the same meaning as
commonly understood by one of ordinary skill in the art to which
this invention belongs. Singleton et al., Dictionary of
Microbiology and Molecular Biology 3.sup.rd ed., J. Wiley &
Sons (New York, N.Y. 2001); March, Advanced Organic Chemistry
Reactions, Mechanisms and Structure 5.sup.th ed., J. Wiley &
Sons (New York, N.Y. 2001); and Sambrook and Russel, Molecular
Cloning: A Laboratory Manual 3rd ed., Cold Spring Harbor Laboratory
Press (Cold Spring Harbor, N.Y. 2001), provide one skilled in the
art with a general guide to many of the terms used in the present
application.
[0065] One skilled in the art will recognize many methods and
materials similar or equivalent to those described herein, which
could be used in the practice of the present invention. Indeed, the
present invention is in no way limited to the methods and materials
described. For purposes of the present invention, the following
terms are defined below.
[0066] As used in the description herein and throughout the claims
that follow, the meaning of "a," "an," and "the" includes plural
reference unless the context clearly dictates otherwise. Also, as
used in the description herein, the meaning of "in" includes "in"
and "on" unless the context clearly dictates otherwise.
[0067] Throughout this specification, the word "comprise" or
variations such as "comprises" or "comprising" will be understood
to imply the inclusion of a stated integer or groups of integers
but not the exclusion of any other integer or group of
integers.
[0068] The term "embryonic stem cells" (ES cells) refers to
embryo-derived cells and is used herein as it is used in the art.
This term includes cells derived from the inner cell mass of human
blastocysts or morulae, including those that have been serially
passaged as cell lines. When used to refer to cells from humans,
the term human embryonic stem cell (hES) cell is used. The ES cells
may be derived from fertilization of an egg cell with sperm, as
well as using DNA, nuclear transfer, parthenogenesis, or by means
to generate ES cells with homozygosity in the HLA region. ES cells
are also cells derived from a zygote, blastomeres, or
blastocyst-staged mammalian embryo produced by the fusion of a
sperm and egg cell, nuclear transfer, parthenogenesis,
androgenesis, or the reprogramming of chromatin and subsequent
incorporation of the reprogrammed chromatin into a plasma membrane
to produce a cell. Embryonic stem cells, regardless of their source
or the particular method use to produce them, can be identified
based on (i) the ability to differentiate into cells of all three
germ layers, (ii) expression of at least Oct-4 and alkaline
phosphatase, and (iii) ability to produce teratomas when
transplanted into immunodeficient animals.
[0069] As used herein, the term "pluripotent stem cells" includes
embryonic stem cells, embryo-derived stem cells, and induced
pluripotent stem cells, regardless of the method by which the
pluripotent stem cells are derived. Pluripotent stem cells are
defined functionally as stem cells that are: (a) capable of
inducing teratomas when transplanted in immunodeficient (SCID)
mice; (b) capable of differentiating to cell types of all three
germ layers (e.g., can differentiate to ectodermal, mesodermal, and
endodermal cell types); and (c) express one or more markers of
embryonic stem cells (e.g., express Oct 4, alkaline phosphatase,
SSEA-3 surface antigen, SSEA-4 surface antigen, nanog, TRA-1-60,
TRA-1-81, SOX2, REX1, etc). Exemplary pluripotent stem cells can be
generated using, for example, methods known in the art. Exemplary
pluripotent stem cells include embryonic stem cells derived from
the ICM of blastocyst stage embryos, as well as embryonic stem
cells derived from one or more blastomeres of a cleavage stage or
morula stage embryo (optionally without destroying the remainder of
the embryo). Such embryonic stem cells can be generated from
embryonic material produced by fertilization or by asexual means,
including somatic cell nuclear transfer (SCNT), parthenogenesis,
and androgenesis. Further exemplary pluripotent stem cells include
induced pluripotent stem cells (iPS cells) generated by
reprogramming a somatic cell by expressing a combination of factors
(herein referred to as reprogramming factors). iPS cells can be
generated using fetal, postnatal, newborn, juvenile, or adult
somatic cells. In certain embodiments, factors that can be used to
reprogram somatic cells to pluripotent stem cells include, for
example, a combination of Oct4 (sometimes referred to as Oct 3/4),
Sox2, c-Myc, and Klf4. In other embodiments, factors that can be
used to reprogram somatic cells to pluripotent stem cells include,
for example, a combination of Oct 4, Sox2, Nanog, and Lin28. In
other embodiments, somatic cells are reprogrammed by expressing at
least 2 reprogramming factors, at least three reprogramming
factors, or four reprogramming factors. In other embodiments,
additional reprogramming factors are identified and used alone or
in combination with one or more known reprogramming factors to
reprogram a somatic cell to a pluripotent stem cell. Induced
pluripotent stem cells are defined functionally and include cells
that are reprogrammed using any of a variety of methods
(integrative vectors, non-integrative vectors, chemical means,
etc).
[0070] The pluripotent stem cells can be from any species.
Embryonic stem cells have been successfully derived in, for
example, mice, multiple species of non-human primates, and humans,
and embryonic stem-like cells have been generated from numerous
additional species. Thus, one of skill in the art can generate
embryonic stem cells and embryo-derived stem cells from any
species, including but not limited to, human, non-human primates,
rodents (mice, rats), ungulates (cows, sheep, etc), dogs (domestic
and wild dogs), cats (domestic and wild cats such as lions, tigers,
cheetahs), rabbits, hamsters, gerbils, squirrel, guinea pig, goats,
elephants, panda (including giant panda), pigs, raccoon, horse,
zebra, marine mammals (dolphin, whales, etc.) and the like. In
certain embodiments, the species is an endangered species. In
certain embodiments, the species is a currently extinct
species.
[0071] Similarly, iPS cells can be from any species. iPS cells have
been successfully generated using mouse and human cells. iPS cells
have been successfully generated using embryonic, fetal, newborn,
and adult tissue. Accordingly, one can readily generate iPS cells
using a donor cell from any species. Thus, one can generate iPS
cells from any species, including but not limited to, human,
non-human primates, rodents (mice, rats), ungulates (cows, sheep,
etc), dogs (domestic and wild dogs), cats (domestic and wild cats
such as lions, tigers, cheetahs), rabbits, hamsters, goats,
elephants, panda (including giant panda), pigs, raccoon, horse,
zebra, marine mammals (dolphin, whales, etc.) and the like. In
certain embodiments, the species is an endangered species. In
certain embodiments, the species is a currently extinct
species.
[0072] Induced pluripotent stem cells can be generated using, as a
starting point, virtually any somatic cell of any developmental
stage. For example, the cell can be from an embryo, fetus, neonate,
juvenile, or adult donor. Exemplary somatic cells that can be used
include fibroblasts, such as dermal fibroblasts obtained by a skin
sample or biopsy, synoviocytes from synovial tissue, foreskin
cells, cheek cells, or lung fibroblasts. Although skin and cheek
provide a readily available and easily attainable source of
appropriate cells, virtually any cell can be used. In certain
embodiments, the somatic cell is not a fibroblast.
[0073] Note that the pluripotent stem cells can be, for example, ES
cells or induced pluripotent stem cells. Induced pluripotent stem
cells can be produced by expressing a combination of reprogramming
factors in a somatic cell. In certain embodiments, at least two
reprogramming factors are expressed in a somatic cell to
successfully reprogram the somatic cell. In other embodiments, at
least three reprogramming factors are expressed in a somatic cell
to successfully reprogram the somatic cell. In other embodiments,
at least four reprogramming factors are expressed in a somatic cell
to successfully reprogram the somatic cell.
[0074] The term "protein transduction domain" ("PTD") refers to any
amino acid sequence that translocates across a cell membrane into
cells or confers or increases the rate of, for example, another
molecule (such as, for example, a protein domain) to which the PTD
is attached, to translocate across a cell membrane into cells. The
protein transduction domain may be a domain or sequence that occurs
naturally as part of a larger protein (e.g., a PTD of a viral
protein such as HIV TAT) or may be a synthetic or artificial amino
acid sequence.
[0075] The terms "hemangioblast" and "hemangio-colony forming cell"
will be used interchangeably throughout this application. The cells
have numerous structural and functional characteristics. Amongst
the characteristics of these cells is the ability to engraft into
the bone marrow when administered to a host. These cells can be
described based on numerous structural and functional properties
including, but not limited to, expression (RNA or protein) or lack
of expression (RNA or protein) of one or more markers.
Hemangio-colony forming cells are capable of differentiating to
give rise to at least hematopoietic cell types or endothelial cell
types. Hemangio-colony forming cells are preferably bi-potential
and capable of differentiating to give rise to at least
hematopoietic cell types and endothelial cell types. As such,
hemangio-colony forming cells of the present invention are at least
uni-potential, and preferably bi-potential. Additionally however,
hemangio-colony forming cells may have a greater degree of
developmental potential and can, in certain embodiments,
differentiate to give rise to cell types of other lineages. In
certain embodiments, the hemangio-colony forming cells are capable
of differentiating to give rise to other mesodermal derivatives
such as cardiac cells (for example, cardiomyocytes) and/or smooth
muscle cells.
[0076] The term "non-engrafting hemangio cells" is used throughout
this application to refer to a novel population of cells that share
some of the characteristics of hemangio-colony forming cells.
However, the non-engrafting hemangio cells are distinguishable in
that they do not engraft into the bone marrow when administered to
an immunodeficient host. Despite this difference, non-engrafting
hemangio cells may share one or more than one (2, 3, 4, 5, 6, 7, 8,
9, 10) of the functional or structural characteristics/properties
of hemangio-colony forming cells. For example, in certain
embodiments, the non-engrafting hemangio cells are loosely adherent
to each other. In other embodiments, the non-engrafting hemangio
cells do not express one or more than one (2, 3, 4) of the
following proteins: CD34, KDR, CD133, CD31. Without being bound by
theory, non-engrafting hemangio cells may provide a distinct stem
cell population that is somewhat more committed than
hemangio-colony forming cells, and yet still capable of producing a
range of hematopoietic cell types.
Enucleated Erythroid Cells
[0077] Embodiments of present invention generally relates to
methods for differentiating human pluripotent stem cells into
enucleated erythroid cells. Erythroid cells of the invention have a
variety of uses in vitro and in vivo. Red blood cells of the
invention will be useful in various therapeutic applications.
Furthermore, the expanded numbers of red blood cells derived by the
present invention may be utilized in novel therapeutic strategies
in the treatment of hematopoietic disorders or in blood
banking.
[0078] In certain embodiments of the application pluripotent stem
cells are hemangioblasts (e.g., hemangioblasts, hemangio colony
forming cells, non-engrafting hemangio cells, hemangio cells, or
blast cells, see e.g., US Patent Application 2008/0014180, herein
incorporated by reference in its entirety).
[0079] In certain embodiments, the red blood cells of the
application may be used in transfusions. The ability to generate
large numbers of cells for transfusion will alleviate the chronic
shortage of blood experienced in blood banks and hospitals across
the country. In certain embodiments, the methods of the invention
allow for the production of universal cells for transfusion.
Specifically, red blood cells that are type O and Rh-- can be
readily generated and will serve as a universal blood source for
transfusion.
[0080] The methods of this invention allow for the in vitro
expansion of pluripotent stem cells to large quantities useful for
a variety of commercial and clinical applications. In certain
embodiments, the cell preparations comprise at least
1.times.10.sup.6 cells. In other embodiments, the cell preparations
comprise at least 2.times.10.sup.6 human pluripotent stem cells and
in further embodiments at least 3.times.10.sup.6 human pluripotent
stem cells. In still other embodiments, the cell preparations
comprise at least 4.times.10.sup.6 human pluripotent stem
cells.
[0081] The present invention relates to a solution, a preparation,
and a composition comprising between 10,000 and 4 million or more
mammalian (such as human) hemangioblast cells. The number of
hemangioblast cells in such a solution, a preparation, and a
composition may be any number between the range of 10,000 to 4
million, or more. This number could be, for example, 20,000,
50,000, 100,000, 500,000, 1 million, etc.
[0082] Similarly, the invention relates to preparations of red
blood cells. The invention further relates to methods of producing,
storing, and distributing pluripotent stem cells and/or red blood
cells.
[0083] The invention also provides methods and solutions suitable
for transfusion into human or animal patients. In particular
embodiments, the invention provides methods of making red blood
cells. In certain embodiments, the invention is suitable for use in
blood banks and hospitals to provide blood for transfusion
following trauma, or in the treatment of a blood-related disease or
disorder. In certain embodiments, the invention provides red blood
cells that are universal donor cells. In certain embodiments, the
red blood cells are functional and express hemoglobin F prior to
transfusion.
[0084] In certain embodiments, red blood cells are transfused to
treat trauma, blood loss during surgery, or blood diseases such as
anemia, Sickle cell anemia, or hemolytic disease. In certain
embodiments, differentiated red blood cells are transfused to treat
trauma, blood loss during surgery, blood diseases such as anemia,
Sickle cell anemia, or hemolytic diseases, or malignant disease. In
certain embodiments, a mixed population of red blood cells is
transfused. It should be noted that many differentiated
hematopoietic cell types, particularly red blood cells, typically
exist in vivo as a mixed population. Specifically, circulating red
blood cells of varying levels of age and differentiation are found
in vivo. Additionally, red blood cells mature over time so as to
express less fetal hemoglobin and more adult hemoglobin. The
present invention contemplates transfusion of either purified
populations of red blood cells or of a mixed population of red
blood cells having varying levels of age and levels of
differentiation. In particular embodiments, the invention
contemplates transfusion of red blood cells expressing fetal
hemoglobin (hemoglobin F). Transfusion of red blood cells that
express fetal hemoglobin may be especially useful in the treatment
of Sickle cell anemia. The ability to generate large numbers of
cells for transfusion will alleviate the chronic shortage of blood
experienced in blood banks and hospitals across the country.
[0085] In certain embodiments, the methods of the invention allow
for the production of universal cells for transfusion.
Specifically, red blood cells that are type O and Rh-- can be
readily generated and will serve as a universal blood source for
transfusion. In certain embodiments, the red blood cells produced
from the methods of the application are functional. in certain
embodiments, the red blood cells express hemoglobin F prior to
transfusion. In certain embodiments, the red blood cells carry
oxygen. In certain embodiments, the red blood cells have a lifespan
equal to naturally derived red blood cells. In certain embodiments,
the red blood cells have a lifespan that is 75% of that of
naturally derived red blood cells. In certain embodiments, the red
blood cells have a lifespan that is 50% of that of naturally
derived red blood cells. In certain embodiments, the red blood
cells have a lifespan that is 25% of that of naturally derived red
blood cells.
[0086] The differentiation of stem cells into mature red blood
cells is a current challenge. The impact of this achievement is
enormous, as there is a constant blood donor shortage, with
inconsistent supply and high demand, especially in times of
unexpected crisis situations. Embryonic stem cells (ESCs) are a
potential consistent and reliable source of red blood cells, with
the benefits of unlimited supply of O-universal blood, and avoiding
the additional cost of disease screening and blood typing with each
donation. The hallmark of mature red blood cells is loss of the
nucleus, as well as production of mature hemoglobin. Many
researchers, including our laboratory, have achieved
differentiation of ESCs into erythroblasts, which still contain
their nuclei, and express immature hemoglobin. To date, enucleation
has not been achieved with human embryonic stem cells.
[0087] By contrast, enucleation has been achieved with CD34+ bone
marrow and cord blood stem cells, which are further along in
development, thus probably aiding in their enucleation capability.
Malik achieved 10-40% enucleation after 19 days of treatment of
CD34+ bone marrow cells with Epo (Malik 1998). Miharada achieved a
rate of 77% enucleation from CD34+ cord blood stem cells with a
20-day treatment of growth factors and cytokines including SCF,
Epo, IL-3, VEGF, IGF-II, and mifepristone (Miharada 2006). Douay
achieved an even higher enucleation rate in CD34+ cord blood stem
cells of 90-100% with an 18-day protocol in a cocktail of factors
found in the bone marrow environment (SCF, IL-3, Epo,
hydrocortisone), with the addition of co-culturing the cells with
MS-5 mouse stromal line or mesenchymal stem cells (MSCs) (Douay
2005). Although growth factors are used to mimic the environment of
the bone marrow niche in which erythroblasts mature, cell contacts
may also be necessary to signal enucleation, as shown by the
abrogation of enucleation when cord blood and stromal cells were
separated from physical contact but grown in the same media.
Although successful for cord blood stem cells, these protocols fail
to produce enucleation in ESCs.
[0088] In certain embodiments, the present inventive method uses
OP9 cells to induce differentiation in human ESCs in a completely
in vitro system, which is relevant to clinical therapies. In
certain embodiments, the first step consists of differentiating
ESCs into hemangioblasts, hemangio colony forming cells,
non-engrafting hemangio cells, or blast cells. In certain
embodiments, the second step is expansion of these cells in
Stemline II medium (Sigma) with Epo, IL-3, SCF and various
supplements used by Douay for cord blood enucleation (Douay 2005).
In certain embodiments, the third step introduces the OP9 cells to
the ESC-derived erythroblasts, as well as the addition of Epo.
[0089] In certain embodiments, differentiating ESCs into the
hemangioblasts, hemangio colony forming cells, and non-engrafting
hemangio cells are produced and expanded in accordance to methods
described herein.
[0090] In certain embodiments, blast cells are cultured as
described in Lu 2006. In certain embodiments, day 6-8 blast cells
from Day 3.25-Day 4.25 embryoid bodies are picked or filtered and
plated in Stemline II medium with Epo, IL-3, SCF, hydrocortisone,
inositol, folic acid, mono-thioglycerol, transferrin, insulin,
ferrous nitrate, ferrous sulfate and bovine serum albumin for 12-30
days. In certain embodiments, blast cells are then co-cultured with
OP9 mouse stromal cells or human mesenchymal stem cells (MSCs) in
the same media listed above, without hydrocortisone. In certain
embodiments, cells begin co-culturing between day 12 and 29 days.
In certain embodiments, cells are further cultured for 12-18 days
before enucleation occurs. In certain embodiments, enucleation
initiated by OP9 cells can occur in as little as 3 days after
stromal growth. In certain embodiments, enucleation is induced in
Stempro34 medium with hydrocortisone, inositol, folic acid,
mono-thioglycerol, transferrin, insulin, ferrous nitrate, ferrous
sulfate and bovine serum albumin. In certain embodiments, cells are
fed every 3-4 days and cultured on a new stromal layer every
week.
[0091] The invention contemplates all suitable combinations of any
of the forgoing or following aspects and embodiments of the
invention.
Megakaryocytes and Platelets
[0092] The present invention also provides methods of producing a
megakaryocyte or a platelet, comprising: providing a pluripotent
stem cell; differentiating said pluripotent stem cell into a
hemangioblast, non-engrafting hemangio cell, or blast cell; and
differentiating said hemangioblast, non-engrafting hemangio cell,
or blast cell into said megakaryocyte or said platelet by culturing
in megakaryocyte (MK) culture medium comprising TPO.
[0093] The present invention also provides methods of producing a
megakaryocyte or a platelet, comprising: providing a hemangioblast,
non-engrafting hemangio cell, or blast cell; and differentiating
said hemangioblast, non-engrafting hemangio cell, or blast cell
into said megakaryocyte or said platelet by culturing in
megakaryocyte (MK) culture medium comprising TPO.
[0094] The hemangioblast, non-engrafting hemangio cell, or blast
cell may be obtained or produced by methods described herein.
[0095] In certain embodiments, said pluripotent stem cell used in
the present invention is an embryonic stem cell or embryo-derived
cell. In certain embodiments, said pluripotent stem cell is an
induced pluripotent stem cell. In certain embodiments, said
pluripotent stem cell is a human cell. In certain embodiments, said
pluripotent stem cell is genetically manipulated prior to
differentiation.
[0096] In certain embodiments, said hemangioblast, non-engrafting
hemangio cell, or blast cell is expanded prior to being
differentiated into said megakaryocyte or said platelet. In certain
embodiments, said hemangioblasts, non-engrafting hemangio cells, or
blast cells are expanded in Stemline II medium with Epo, IL-3, and
SCF.
[0097] In certain embodiments, differentiating said hemangioblast,
non-engrafting hemangio cell, or blast cell into said megakaryocyte
or said platelet is done after about 6 to 8 days of hemangioblast,
non-engrafting hemangio cell, or blast cell culture.
[0098] The present invention also provides a megakaryocyte or a
platelet produced by any one of the method as described herein.
[0099] The methods of producing a megakaryocyte or a platelet are
described in more detail in the ensuing examples.
Hemangio-Colony Forming Cells
[0100] This invention provides a method for generating and
expanding human hemangio-colony forming cells from human
pluripotent stem cells, preparations and compositions comprising
human hemangio-colony forming cells, methods of producing various
cell types partially or terminally differentiated from
hemangio-colony forming cells, methods of using hemangio-colony
forming cells therapeutically, and methods of therapeutically using
various cell types partially or terminally differentiated from
hemangio-colony forming cells.
[0101] Here, the inventors report a simpler and more efficient
method for robust generation of hemangioblastic progenitors. In
addition to eliminating several expensive factors that are
unnecessary, it is demonstrated that bone morphogenetic protein-4
(BMP-4) and vascular endothelial growth factor (VEGF) are necessary
and sufficient to induce hemangioblastic commitment and development
from pluripotent stem cells during early stages of differentiation.
BMP-4 and VEGF significantly up-regulate T-brachyury, KDR, CD31 and
LMO2 gene expression, while dramatically down-regulating Oct-4
expression. The addition of basic fibroblast growth factor (bFGF)
during growth and expansion was found to further enhance BC
development, consistently generating approximately 1.times.10.sup.8
BCs from one six-well plate of hESCs.
[0102] This invention also provides a method for expanding
mammalian hemangio-colony forming cells obtained from any source,
including ES cells, blastocysts or blastomeres, cord blood from
placenta or umbilical tissue, peripheral blood, bone marrow, or
other tissue or by any other means known in the art. Human
hemangio-colony forming cells can also be generated from human
pluripotent stem cells. Human pluripotent stem cells may be a
substantially homogeneous population of cells, a heterogeneous
population of cells, or all or a portion of an embryonic tissue. As
an example of pluripotent stem cells that can be used in the
methods of the present invention, human hemangio-colony forming
cells can be generated from human embryonic stem cells. Such
embryonic stem cells include embryonic stem cells derived from or
using, for example, blastocysts, plated ICMs, one or more
blastomeres, or other portions of a pre-implantation-stage embryo
or embryo-like structure, regardless of whether produced by
fertilization, somatic cell nuclear transfer (SCNT),
parthenogenesis, androgenesis, or other sexual or asexual
means.
[0103] In certain embodiments, hemangioblasts can be further
differentiated to hematopoietic cells including, but not limited
to, platelets and red blood cells. Such cells may be used in
transfusions. The ability to generate large numbers of cells for
transfusion will alleviate the chronic shortage of blood
experienced in blood banks and hospitals across the country. In
certain embodiments, the methods of the invention allow for the
production of universal cells for transfusion. Specifically, red
blood cells that are type O and Rh-- can be readily generated and
will serve as a universal blood source for transfusion.
[0104] The methods of this invention allow for the in vitro
expansion of hemangioblasts to large quantities useful for a
variety of commercial and clinical applications. Expansion of
hemangioblasts in vitro refers to the proliferation of
hemangioblasts. While the methods of the invention enable the
expansion of human hemangioblast cells to reach commercially useful
quantities, the present invention also relates to large numbers of
hemangioblast cells and to cell preparations comprising large
numbers of human hemangioblast cells (for example, at least 10,000,
100,000, or 500,000 cells). In certain embodiments, the cell
preparations comprise at least 1.times.10.sup.6 cells. In other
embodiments, the cell preparations comprise at least
2.times.10.sup.6 human hemangioblast cells and in further
embodiments at least 3.times.10.sup.6 human hemangioblast cells. In
still other embodiments, the cell preparations comprise at least
4.times.10.sup.6 human hemangioblast cells.
[0105] The present invention relates to a solution, a preparation,
and a composition comprising between 10,000 and 4 million or more
mammalian (such as human) hemangioblast cells. The number of
hemangioblast cells in such a solution, a preparation, and a
composition may be any number between the range of 10,000 to 4
million, or more. This number could be, for example, 20,000,
50,000, 100,000, 500,000, 1 million, etc.
[0106] Similarly, the invention relates to preparations of human
hemangioblast progeny cells (e.g., human hematopoietic cells
including human hematopoietic stem cells, and endothelial cells).
The invention further relates to methods of producing, storing, and
distributing hemangioblast cells and/or hemangioblast lineage
cells.
[0107] The invention also provides methods and solutions suitable
for transfusion into human or animal patients. In particular
embodiments, the invention provides methods of making red blood
cells and/or platelets, and/or other hematopoietic cell types for
transfusion. In certain embodiments, the invention is suitable for
use in blood banks and hospitals to provide blood for transfusion
following trauma, or in the treatment of a blood-related disease or
disorder. In certain embodiments, the invention provides red blood
cells that are universal donor cells. In certain embodiments, the
red blood cells are functional and express hemoglobin F prior to
transfusion.
[0108] The invention also provides for human hemangio-colony
forming cells, cell cultures comprising a substantially purified
population of human hemangio-colony forming cells, pharmaceutical
preparations comprising human hemangio-colony forming cells and
cryopreserved preparations of the hemangio-colony forming cells. In
certain embodiments, the invention provides for the use of the
human hemangio-colony forming cells in the manufacture of a
medicament to treat a condition in a patient in need thereof.
Alternatively, the invention provides the use of the cell cultures
in the manufacture of a medicament to treat a condition in a
patient in need thereof. The invention also provides the use of the
pharmaceutical preparations in the manufacture of a medicament to
treat a condition in a patient in need thereof.
[0109] The hemangio-colony forming cells can be identified and
characterized based on their structural properties. Specifically,
and in certain embodiments, these cells are unique in that they are
only loosely adherent to each other (loosely adherent to other
hemangio-colony forming cells). Because these cells are only
loosely adherent to each other, cultures or colonies of
hemangio-colony forming cells can be dissociated to single cells
using only mechanical dissociation techniques and without the need
for enzymatic dissociation techniques. The cells are sufficiently
loosely adherent to each other that mechanical dissociation alone,
rather than enzymatic dissociation or a combination of mechanical
and enzymatic dissociation, is sufficient to disaggregate the
cultures or colonies without substantially impairing the viability
of the cells. In other words, mechanical dissociation does not
require so much force as to cause substantial cell injury or death
when compared to that observed subsequent to enzymatic dissociation
of cell aggregates.
[0110] Furthermore, hemangio-colony forming cells can be identified
or characterized based on the expression or lack of expression (as
assessed at the level of the gene or the level of the protein) of
one or more markers. For example, in certain embodiments,
hemangio-colony forming cells can be identified or characterized
based on lack of expression of one or more (e.g., the cells can be
characterized based on lack of expression of at least one, at least
two, at least three or at least four of the following markers) of
the following cell surface markers: CD34, KDR, CD133, or CD31.
Additionally or alternatively, hemangio-colony forming cells can be
identified or characterized based on expression of GATA2 and/or
LMO2. Additionally or alternatively, hemangio-colony forming cells
can be identified or characterized based on expression or lack of
expression markers.
[0111] Hemangio-colony forming cells of the present invention can
be identified or characterized based on one or any combination of
these structural or functional characteristics. Note that although
these cells can be derived from any of a number of sources, for
example, embryonic tissue, prenatal tissue, or perinatal tissue,
the term "hemangio-colony forming cells" applies to cells,
regardless of source, that are capable of differentiating to give
rise to at least hematopoietic cell types and/or endothelial cell
types and that have one or more of the foregoing structural or
functional properties.
[0112] In certain embodiments, marker(s) for the progenitor of BCs
can be used to select BCs after initial culturing.
[0113] In certain embodiments, hemangio-colonies are produced from
pluripotent cells without forming embryoid bodies.
In Vitro Differentiation of Pluripotent Stem Cells to Obtain
Embryoid Bodies and Hemangioblasts
[0114] The present invention provides a method for generating and
expanding human hemangioblasts derived from human pluripotent stem
cells, or from human blastocysts or blastomeres. The hemangioblasts
so produced may be purified and/or isolated.
[0115] Human hemangio-colony forming cells can also be generated
from human pluripotent stem cells. Human pluripotent stem cells may
be a substantially homogeneous population of cells, a heterogeneous
population of cells, or all or a portion of an embryonic tissue. As
an example of pluripotent stem cells that can be used in the
methods of the present invention, human hemangio-colony forming
cells can be generated from human embryonic stem cells. Such
embryonic stem cells include embryonic stem cells derived from or
using, for example, blastocysts, plated ICMs, one or more
blastomeres, or other portions of a pre-implantation-stage embryo
or embryo-like structure, regardless of whether produced by
fertilization, somatic cell nuclear transfer (SCNT),
parthenogenesis, androgenesis, or other sexual or asexual
means.
[0116] Additionally or alternatively, hemangio-colony forming cells
can be generated from other pluripotent stem cells. For example,
hemangio-colony forming cells can be generated (without necessarily
going through a step of embryonic stem cell derivation) from or
using plated embryos, ICMs, blastocysts, trophoblast/trophectoderm
cells, one or more blastomeres, trophoblast stem cells, embryonic
germ cells, or other portions of a pre-implantation-stage embryo or
embryo-like structure, regardless of whether produced by
fertilization, somatic cell nuclear transfer (SCNT),
parthenogenesis, androgenesis, or other sexual or asexual means.
Similarly, hemangio-colony forming cells can be generated using
cells or cell lines partially differentiated from pluripotent stem
cells. For example, if a human embryonic stem cell line is used to
produce cells that are more developmentally primitive than
hemangio-colony forming cells, in terms of development potential
and plasticity, such pluripotent stem cells could then be used to
generate hemangio-colony forming cells.
[0117] Additionally or alternatively, hemangio-colony forming cells
can be generated from other pre-natal or peri-natal sources
including, without limitation, umbilical cord, umbilical cord
blood, amniotic fluid, amniotic stem cells, and placenta.
[0118] It is noted that when hemangio-colony forming cells are
generated from human embryonic tissue a step of embryoid body
formation may be needed. However, given that embryoid body
formation serves, at least in part, to help recapitulate the three
dimensional interaction of the germ layers that occurs during early
development, such a step is not necessarily required when the
pluripotent stem cells already have a structure or organization
that serves substantially the same purpose as embryoid body
formation. By way of example, when hemangio-colony forming cells
are generated from plated blastocysts, a level of three dimensional
organization already exists amongst the cells in the blastocyst. As
such, a step of embryoid body formation is not necessarily required
to provide intercellular signals, inductive cues, or three
dimensional architecture.
[0119] The methods and uses of the present invention can be used to
generate hemangio-colony forming cells from pluripotent stem cells
or embryo-derived cells. In certain embodiments, the embryo-derived
cells are embryonic stem cells. In certain other embodiments, the
embryo-derived cells are plated embryos, ICMs, blastocysts,
trophoblast/trophectoderm cells, one or more blastomeres,
trophoblast stem cells, or other portions of an early
pre-implantation embryo. For any of the foregoing, the
embryo-derived cells may be from embryos produced by fertilization,
somatic cell nuclear transfer (SCNT), parthenogenesis,
androgenesis, or other sexual or asexual means.
[0120] Throughout this application, when a method is described by
referring specifically to generating hemangio-colony forming cells
from embryonic stem cells, the invention similarly contemplates
generating hemangio-colony forming cells from or using other
pluripotent stem cells or embryonic-derived cells, and using the
generated cells for any of the same therapeutic applications.
[0121] In certain aspects of the invention, the human embryonic
stem cells may be the starting material of this method. The
embryonic stem cells may be cultured in any way known in the art,
such as in the presence or absence of feeder cells.
[0122] Embryonic stem cells may form embryoid bodies ("EBs") in
suspension in medium containing serum (Wang et al. 2005 J Exp Med
(201):1603-1614; Wang at al. 2004 Immunity (21): 31-41; Chadwick et
al. 2003 Blood (102): 906-915). The addition of serum, however,
presents certain challenges, including variability in experiments,
cost, potential for infectious agents, and limited supply. Further,
for clinical and certain commercial applications, use of serum
necessitates additional U.S. and international regulatory
compliance issues that govern biological products.
[0123] The present invention provides methods of generating and
expanding human hemangioblasts from pluripotent stem cells in which
no serum is used. The serum-free conditions are more conducive to
scale-up production under good manufacturing process (GMP)
guidelines than are conditions which require serum. Furthermore,
serum-free conditions extend the half-life of certain factors added
to the medium (for example, the half-life of proteins including
growth factors, cytokines, and HOXB4 in media is increased when no
serum is present). In certain embodiments, the media is
supplemented with BMP4 and VEGF. In certain embodiments, serum-free
media is used throughout the method of this invention for
generating and expanding human hemangioblasts.
[0124] In the first step of this method for generating and
expanding human hemangioblast cells, human stem cells are grown in
serum-free media and are induced to differentiate into embryoid
bodies. To induce embryoid body formation, embryonic stem cells may
be pelleted and resuspended in serum-free medium (e.g., in Stemline
I or II media (Sigma.TM.)) supplemented with one or more
morphogenic factors and cytokines and then plated on low attachment
(e.g., ultra-low attachment) culture dishes. Morphogenic factors
and cytokines may include, but are not limited to, bone morphogenic
proteins (e.g., BMP2, BMP-4, BMP-7, but not BMP-3) and VEGF, SCF
and FL. Bone morphogenic proteins and VEGF may be used alone or in
combination with other factors. The morphogenic factors and
cytokines may be added to the media from 0-48 hours of cell
culture. Following incubation under these conditions, incubation in
the presence of early hematopoietic expansion cytokines, including,
but not limited to, thrombopoietin (TPO), Flt-3 ligand, and stem
cell factor (SCF), allows the plated ES cells to form EBs. In
addition to TPO, Flt-3 ligand, and SCF, VEGF, BMP-4, and HoxB4 may
also be added to the media. In one embodiment, human ES cells are
first grown in the presence of BMP-4 and VEGF.sub.165 (e.g., 25-100
ng/ml), followed by growing in the presence of BMP-4, VEGF.sub.165,
SCF, TPO, and FLT3 ligand (e.g., 10-50 ng/ml) and HoxB4 (e.g.,
1.5-5 .mu.g/ml of a triple protein transduction domain-HoxB4 fusion
protein as disclosed herein). The additional factors may be added
48-72 hours after plating.
[0125] In this method of the present invention, human hemangioblast
cells are isolated from early embryoid bodies ("EBs"). Isolating
hemangioblast cells from early EBs supports the expansion of the
cells in vitro. For human cells, hemangioblast cells may be
obtained from EBs grown for less than 10 days. In certain
embodiments of the present invention, hemangioblast cells arise in
human EBs grown for 2-6 days. According to one embodiment,
hemangioblast cells are identified and may be isolated from human
EBs grown for 4-6 days. In other embodiments, human EBs are grown
for 2-5 days before hemangioblast cells are isolated. In certain
embodiments, human EBs are grown for 3-4.5 days before
hemangioblast cells are isolated.
[0126] In certain embodiments, early EBs are washed and dissociated
(e.g., by Trypsin/EDTA or collagenase B). A select number of cells
(e.g., 2-5.times.10.sup.5 cells) are then mixed with serum-free
methylcellulose medium optimized for hemangioblast cell growth
(e.g., BL-CFU medium, for example Stem Cell Technologies Catalogue
H4436, or hemangioblast cell expansion medium (HGM), or any medium
containing 1.0% methylcellulose in MDM, 1-2% Bovine serum albumin,
0.1 mM 2-mercaptoethanol, 10 .mu.g/ml rh-Insulin, 200 .mu.g/ml iron
saturated human transferrin, 20 ng/ml rh-GM-CSF, 20 ng/ml rh-IL-3,
20 ng/ml rh-IL-6, 20 ng/ml rh-G-CSF) ("rh" stands for "recombinant
human"). This medium may be supplemented with early stage cytokines
(including, but not limited to, EPO, TPO, SCF, FL, FLt-3, VEGF,
BMPs such as BMP2, BMP4 and BMP7, but not BMP3) and HOXB4 (or
another homeobox protein). In certain embodiments, erythropoietin
(EPO) is added to the media. In further embodiments, EPO, SCF,
VEGF, BMP-4 and HoxB4 are added to the media. In additional
embodiments, the cells are grown in the presence of EPO, TPO and
FL. In certain embodiments where H9 is the starting human ES cell
line, EPO, TPO and FL are added to the media. In addition to EPO,
TPO and FL, media for cells derived from H9 or other ES cells may
further comprise VEGF, BMP-4, and HoxB4.
[0127] The cells so obtained by this method (the cells may be in
BL-CFU medium), which include hemangioblast cells, are plated onto
ultra-low attachment culture dishes and incubated in a CO.sub.2
incubator to grow hemangioblast colonies. Some cells may be able to
form secondary EBs. Following approximately 3-6 days, and in some
instances 3-4.5 days, hemangioblast colonies are observed.
Hemangioblast colonies may be distinguished from other cells such
as secondary EBs by their distinctive grape-like morphology and/or
by their small size. In addition, hemangioblasts may be identified
by the expression of certain markers (e.g., the expression of both
early hematopoietic and endothelial cell markers) as well as their
ability to differentiate into at least both hematopoietic and
endothelial cells (see below, Deriving hemangioblast lineage
cells). For example, while hemangioblasts lack certain features
characteristic of mature endothelial or hematopoietic cells, these
cells may be identified by the presence of certain markers (such
as, for example, CD71+) and the absence of other markers (for
example, CD34-). Hemangioblasts may also express GATA-1 and GATA-2
proteins, CXCR-4, and TPO and EPO receptors. In addition,
hemangioblasts may be characterized by the absence or low
expression of other markers (e.g., CD31, CD34, KDR, or other
adhesion molecules). Further, hemangioblasts may be characterized
by the expression of certain genes, (e.g., genes associated with
hemangioblasts and early primitive erythroblast development, such
as, for example, SCL, LMO2, FLT-1, embryonic fetal globin genes,
NF-E2, GATA-1, EKLF, ICAM-4, glycophoriuns, and EPO receptor).
[0128] Accordingly, hemangioblasts may be isolated by size (being
smaller than the other cells) or purified with an anti-CD71+
antibody, such as by immunoaffinity column chromatography.
[0129] The hemangioblast cells may be isolated by size and/or
morphology by the following procedure. After 6 to 7 days of growth,
the cell mixture contains EBs, which are round and represent a
clump of multiple cells, and hemangioblasts, which are grape-like,
smaller than the EBs, and are single cells. Accordingly,
hemangioblasts may be isolated based on their morphology and size.
The hemangioblast cells may be manually picked, for example, when
observing the cell mixture under a microscope. The cells may
subsequently grow into colonies, each colony having between 100-150
cells.
[0130] Human hemangioblast colonies derived as described above may
be picked and replated onto methylcellulose CFU-medium to form
hematopoietic CFUs. In certain embodiments, CFU-medium comprises
StemCell Technologies H4436. In further embodiments, hemangioblasts
are plated in Stemline II media supplemented with cytokines and
other factors. For example, individual BL-CFC colonies may be
handpicked and transferred to a fibronectin-coated plate containing
Stemline II with recombinant human SCF (e.g., 20 ng/ml), TPO (e.g.,
20 ng/ml), FL (e.g., 20 ng/ml), IL-3 (e.g., 20 ng/ml) VEGF (e.g.,
20 ng/ml), G-CSF (e.g., 20 n ng/ml), BMP-4 (e.g., 15 ng/ml), IL-6
(e.g., 10 ng/ml), IGF-1 (e.g., 10 ng/ml), endothelial cell growth
supplement (ECGS, e.g., 100 pg/ml), Epo (e.g., 3 U/ml). Following
one week of growth in vitro, non-adherent hematopoietic cells may
be removed by gentle pipetting and used directly for hematopoietic
CFU assay. Following removal of the non-adherent cells, the
adherent populations may be grown for one more week in EGM-2
endothelial cell medium (Cambrex.TM.), and then examined for the
expression of vWF.
Expansion of Hemangioblasts In Vitro
[0131] Certain aspects of the invention relate to the in vitro
expansion of hemangioblasts. In certain embodiments, hemangioblasts
expanded by the methods of the invention are obtained from early
embryoid bodies derived from human embryonic stem cells as
described above.
[0132] In addition to deriving hemangioblasts from human embryonic
stem cells (hES cells), hemangioblasts to be expanded may also be
isolated from other mammalian sources, such as mammalian embryos
(Ogawa et al. 2001 Int Rev Immunol (20):21-44, US patent
publication no. 2004/0052771), cord blood from placenta and
umbilical tissues (Pelosi, et al. 2002 Blood (100): 3203-3208;
Cogle et al. 2004 Blood (103):133-5), peripheral blood and bone
marrow (Pelosi et al. 2002 Hematopoiesis (100): 3203-3208). In
certain embodiments, non-human hemangioblasts to be expanded may be
generated from non-human (such as mouse and non-human primates)
embryonic stem cells. In certain embodiments, hemangioblasts are
obtained from umbilical cord blood (UCB) or bone marrow by methods
such as, for example, magnetic bead positive selection or
purification techniques (e.g. MACS column). Cells may be selected
based on their CD71+ status and may be confirmed as CD34-. Further,
the isolated hemangioblasts may be tested for their potential to
give rise to both hematopoietic and endothelial cell lineages. In
certain embodiments, hemangioblasts isolated or purified and
optionally enriched from embryos, cord blood, peripheral blood,
bone marrow, or other tissue, are more than 95% pure.
[0133] Bone marrow-derived cells may be obtained from any stage of
development of the donor individual, including prenatal (e.g.,
embryonic or fetal), infant (e.g., from birth to approximately
three years of age in humans), child (e.g., from about three years
of age to about 13 years of age in humans), adolescent (e.g., from
about 13 years of age to about 18 years of age in humans), young
adult (e.g., from about 18 years of age to about 35 years of age in
humans), adult (from about 35 years of age to about 55 years of age
in humans) or elderly (e.g. from about 55 years and beyond of age
in humans).
[0134] Human bone marrow may be harvested by scraping from the
split sternum of a patient undergoing surgery, for example. Bone
marrow may then be preserved in tissue clumps of 0.1 to 1 mm.sup.3
in volume and then grown on a mouse embryonic feeder layer (e.g., a
mitomycin C-treated or irradiated feeder layer). The bone marrow
cells will attach to the plates and over a period of 1-2 weeks of
culture, hemangioblast cells may be identified based on
morphological features and/or cell markers and isolated (see US
patent publication no. 2004/0052771). The cells may then be
subsequently grown and expanded in serum-free conditions according
to the methods disclosed herein.
[0135] In addition, bone marrow cells and cells from blood or other
tissue may be fractionated to obtain hemangioblasts cells. Methods
of fractionation are well known in the art, and generally involve
both positive selection (i.e., retention of cells based on a
particular property) and negative selection (i.e., elimination of
cells based on a particular property). Methods for fractionation
and enrichment of bone marrow-derived cells are best characterized
for human and mouse cells.
[0136] There are a variety of methods known in the art for
fractionating and enriching bone marrow-derived or other cells.
Positive selection methods such as enriching for cells expressing
CD71 may be used. And negative selection methods which remove or
reduce cells expressing CD3, CD10, CD11b, CD14, CD16, CD15, CD16,
CD19, CD20, CD32, CD45, CD45R/B220 or Ly6G may also be used alone
or in combination with positive selection techniques. In the case
of bone marrow cells, when the donor bone marrow-derived cells are
not autologous, negative selection may be performed on the cell
preparation to reduce or eliminate differentiated T cells.
[0137] Generally, methods used for selection/enrichment of bone
marrow-derived, blood, or other cells will utilize immunoaffinity
technology, although density centrifugation methods are also
useful. Immunoaffinity technology may take a variety of forms, as
is well known in the art, but generally utilizes an antibody or
antibody derivative in combination with some type of segregation
technology. The segregation technology generally results in
physical segregation of cells bound by the antibody and cells not
bound by the antibody, although in some instances the segregation
technology which kills the cells bound by the antibody may be used
for negative selection.
[0138] Any suitable immunoaffinity technology may be utilized for
selection/enrichment of hemangioblasts from bone marrow-derived,
blood, or other cells, including fluorescence-activated cell
sorting (FAGS), panning, immunomagnetic separation, immunoaffinity
chromatography, antibody-mediated complement fixation, immunotoxin,
density gradient segregation, and the like. After processing in the
immunoaffinity process, the desired cells (the cells bound by the
immunoaffinity reagent in the case of positive selection, and cells
not bound by the immunoaffinity reagent in the case of negative
selection) are collected and may be subjected to further rounds of
immunoaffinity selection/enrichment.
[0139] Immunoaffinity selection/enrichment is typically carried out
by incubating a preparation of cells comprising bone marrow-derived
cells with an antibody or antibody-derived affinity reagent (e.g.,
an antibody specific for a given surface marker), then utilizing
the bound affinity reagent to select either for or against the
cells to which the antibody is bound. The selection process
generally involves a physical separation, such as can be
accomplished by directing droplets containing single cells into
different containers depending on the presence or absence of bound
affinity reagent (FACS), by utilizing an antibody bound (directly
or indirectly) to a solid phase substrate (panning, immunoaffinity
chromatography), or by utilizing a magnetic field to collect the
cells which are bound to magnetic particles via the affinity
reagent (immunomagnetic separation). Alternatively, undesirable
cells may be eliminated from the bone marrow-derived cell
preparation using an affinity reagent which directs a cytotoxic
insult to the cells bound by the affinity reagent. The cytotoxic
insult may be activated by the affinity reagent (e.g., complement
fixation), or may be localized to the target cells by the affinity
reagent (e.g., immunotoxin, such as ricin B chain).
[0140] Although the methods described above refer to enrichment of
cells from a preparation of bone marrow-derived or blood cells, one
skilled in the art will recognize that similar positive and
negative selection techniques may be applied to cell preparations
from other tissues.
[0141] Certain aspects of the invention relate to the in vitro
expansion of hemangioblasts. In certain embodiments, hemangioblasts
expanded by the methods of the invention are obtained from early
embryoid bodies derived from human embryonic stem cells as
described above. In other embodiments, the hemangioblasts are
isolated or enriched from human tissue (e.g., placenta or cord
blood, peripheral blood, bone marrow, etc.)
[0142] In certain embodiments, the hemangioblasts are expanded in
the presence of a homeodomain protein (also referred to herein as a
homeobox protein). In further embodiments, the hemangioblasts are
expanded in the presence of HOXB4. In certain embodiments, HOXB4 is
added to the hemangioblast cells throughout the method for
expanding hemangioblast cells.
[0143] HOXB4 is a homeodomain transcription factor (also called
HOX2F, HOX2, HOX-2.6, and in the rat HOXA5) that is expressed in
vivo in the stem cell fraction of the bone marrow and that is
subsequently down-regulated during differentiation. Expression of
the HOXB4 gene is associated with the maintenance of primitive stem
cell phenotypes (Sauvageau et al. 1995 Genes Dev 9: 1753-1765;
Buske et al. 2002 Blood 100: 862-868; Thorsteinsdottir et al. 1999
Blood 94: 2605-2612; Antonchuk of al. 2001 Exp Hematol 29:
1125-1134).
[0144] HOXB4 used in the methods of the present invention to
generate and expand hemangioblasts, includes, but is not limited
to, full length HOXB4 (e.g., HOXB4 polypeptides specified by public
accession numbers GI:13273315 (FIG. 17), GI:29351568 (FIG. 18), as
well as any functional variants and active fragments thereof. The
wild-type HOXB4 protein may be encoded by the amino acid sequence
of SEQ ID NO: 1, SEQ ID NO: 3 or any other alternative allelic
forms of such protein. Such sequences may be accessed via publicly
available databases, such as Genbank. Further, HOXB4 may be
ectopically expressed within the cell or may be provided in the
media. HOXB4 expressed ectopically may be operably linked to an
inducible promoter. HOXB4 provided in the media may be excreted by
another cell type (e.g., a feeder layer) or added directly to the
media.
[0145] The present invention also relates to fusion proteins
comprising HOXB4 (including fusion proteins comprising full length
HOXB4, or HOXB4 functional variants or active fragments of HOXB4).
In addition to HOXB4, this fusion protein may also comprise any
additional proteins, protein domains or peptides. In certain
embodiments, HOXB4 may be joined to a protein transduction domain
(PTD) to allow translocation of the protein from the medium into
the cells and subsequently into nuclear compartments. Fusion
proteins may or may not comprise one or more linker sequences
located in between the protein domains.
[0146] Functional variants of HOXB4 include mutants of HOXB4 and
allelic variants, and active fragments thereof. Functional variants
of HOXB4 include any HOXB4 polypeptides and active fragments
thereof that are capable of expanding hemangioblasts according to
the methods of the present invention. HOXB4 functional variants
also include HOXB4 polypeptides that exhibit greater
transcriptional activity compared to the native HOXB4 protein.
HOXB4 variants include proteins with one or more amino acid
substitution, addition, and/or deletion in relation to a wild-type
HOXB4. HOXB4 variants also include, but are not limited to,
polypeptides that are at least 75% similar to the sequence provided
in SEQ ID NO: 1 or SEQ ID NO: 3. Accordingly, HOXB4 variants
include polypeptides that are 80%, 85%, 90%, 95%, and 99% similar
to the amino acid sequence provided in SEQ ID NO: 1 or SEQ ID NO:
3.
[0147] HOXB4 variants also include polypeptides encoded by nucleic
acid sequences that are at least 80% identical to a nucleic acid
sequence encoding its complement (e.g., the wild-type HOXB4 protein
may be encoded by nucleic acid sequences of SEQ ID NO: 2
(GI:85376187; FIG. 15) or SEQ ID NO: 4 (GI:29351567; FIG. 16)).
Thus, HOXB4 variants include HOXB4 polypeptides that are encoded by
nucleic acid sequences that are 85%, 90%, 95%, and 99% identical to
the sequence provided in SEQ ID NO: 2 or SEQ ID NO: 4 or complement
thereto.
[0148] Nucleic acid sequences encoding HOXB4 also include, but are
not limited to, any nucleic acid sequence that hybridizes under
stringent conditions to a nucleic acid sequence of SEQ ID NO: 2 or
4, complement thereto, or fragment thereof. Similarly, nucleic
acids which differ from the nucleic acids as set forth in SEQ ID
NO: 2 or 4 due to degeneracy in the genetic code are also within
the scope of the invention. HOXB4 variant polypeptides also include
splice variants or other naturally occurring HOXB4 proteins or
nucleic acid sequences.
[0149] Active fragments of HOXB4 include, but are not limited to,
any fragment of full length HOXB4 polypeptide that is capable of
maintaining hemangioblasts according to the methods of the present
invention. Accordingly, in one embodiment, a HOXB4 protein of the
present invention is a HOXB4 protein that lacks part of the
N-terminus, such as, for example, the N-terminal 31,32, or 33 amino
acids of full length HOXB4.
[0150] Any of the HOXB4 proteins may be fused with additional
proteins or protein domains. For example, HOXB4 may be joined to a
protein transduction domain (PTD).
[0151] Protein transduction domains, covalently or non-covalently
linked to HOXB4, allow the translocation of HOXB4 across the cell
membranes so the protein may ultimately reach the nuclear
compartments of the cells.
[0152] PTDs that may be fused with a HOXB4 protein include the PTD
of the HIV transactivating protein (TAT) (Tat 47-57) (Schwarze and
Dowdy 2000 Trends Pharmacol. Sci. 21: 45-48; Krosl et al. 2003
Nature Medicine (9): 1428-1432). For the HIV TAT protein, the amino
acid sequence conferring membrane translocation activity
corresponds to residues 47-57 (YGRKKRRQRRR, SEQ ID NO: 5) (Ho et
al., 2001, Cancer Research 61: 473-477; Vives et al., 1997, J.
Biol. Chem. 272: 16010-16017). This sequence alone can confer
protein translocation activity. The TAT PTD may also be the nine
amino acids peptide sequence RKKRRQRRR (SEQ ID NO: 6) (Park et al.
Mol Cells 2002 (30):202-8). The TAT PTD sequences may be any of the
peptide sequences disclosed in Ho et al., 2001, Cancer Research 61:
473-477 (the disclosure of which is hereby incorporated by
reference herein), including YARKARRQARR (SEQ ID NO: 7),
YARAAARQARA (SEQ ID NO: 8), YARAARRAARR (SEQ ID NO: 9) and
RARAARRAARA (SEQ ID NO: 10).
[0153] Other proteins that contain PTDs that may be fused to HOXB4
proteins of the present invention include the herpes simplex virus
1 (HSV-1) DNA-binding protein
[0154] VP22 and the Drosophila Antennapedia (Antp) homeotic
transcription factor (Schwarze et al. 2000 Trends Cell Biol. (10):
290-295). For Antp, amino acids 43-58 (RQIKIWFQNRRMKWKK, SEQ ID NO:
11) represent the protein transduction domain, and for HSV VP22 the
PTD is represented by the residues
DAATATRGRSAASRPTERPRAPARSASRPRRPVE (SEQ ID NO: 12). Alternatively,
HeptaARG (RRRRRRR, SEQ ID NO: 13) or artificial peptides that
confer transduction activity may be used as a PTD of the present
invention.
[0155] In additional embodiments, the PTD may be a PTD peptide that
is duplicated or multimerized. In certain embodiments, the PTD is
one or more of the TAT PTD peptide YARAAARQARA (SEQ ID NO: 14). In
certain embodiments, the PTD is a multimer consisting of three of
the TAT PTD peptide YARAAARQARA (SEQ ID NO: 15). A HOXB4 protein
that is fused or linked to a multimeric PTD, such as, for example,
a triplicated synthetic protein transduction domain (tPTD), may
exhibit reduced lability and increased stability in cells. Such a
HOXB4 construct may also be stable in serum-free medium and in the
presence of hES cells.
[0156] Techniques for making fusion genes encoding fusion proteins
are well known in the art. Essentially, the joining of various DNA
fragments coding for different polypeptide sequences is performed
in accordance with conventional techniques. In another embodiment,
the fusion gene can be synthesized by conventional techniques
including automated DNA synthesizers. Alternatively, PCR
amplification of gene fragments can be carried out using anchor
primers which give rise to complementary overhangs between two
consecutive gene fragments which can subsequently be annealed to
generate a chimeric gene sequence (see, for example, Current
Protocols in Molecular Biology, eds. Ausubel et al., John Wiley
& Sons: 1992).
[0157] In certain embodiments, a fusion gene coding for a
purification leader sequence, such as a poly-(His) sequence, may be
linked to the N-terminus of the desired portion of the HOXB4
polypeptide or HOXB4-fusion protein, allowing the fusion protein be
purified by affinity chromatography using a Ni.sup.2+ metal resin.
The purification leader sequence can then be subsequently removed
by treatment with enterokinase to provide the purified HOXB4
polypeptide (e.g., see Hochuli et al., (1987) J. Chromatography
411:177; and Janknecht et al., PNAS USA 88:8972).
[0158] In certain embodiments, a HOXB4 protein or functional
variant or active domain of it, is linked to the C-terminus or the
N-terminus of a second protein or protein domain (e.g., a PTD) with
or without an intervening linker sequence. The exact length and
sequence of the linker and its orientation relative to the linked
sequences may vary. The linker may comprise, for example, 2, 10,
20, 30, or more amino acids and may be selected based on desired
properties such as solubility, length, steric separation, etc. In
particular embodiments, the linker may comprise a functional
sequence useful for the purification, detection, or modification,
for example, of the fusion protein. In certain embodiments, the
linker comprises a polypeptide of two or more glycines.
[0159] The protein domains and/or the linker by which the domains
are fused may be modified to alter the effectiveness, stability
and/or functional characteristics of HOXB4.
[0160] In certain embodiments, HOXB4 is ectopically expressed
within the hemangioblast cell or is provided in the media. HOXB4
expressed ectopically may be operably linked to a regulatory
sequence. Regulatory sequences are art-recognized and are selected
to direct expression of the HOXB4 polypeptide.
[0161] HOXB4 provided in the media may be excreted by another cell
type. The other cell type may be a feeder layer, such as a mouse
stromal cell layer transduced to express excretable HOXB4. For
example, HOXB4 may be fused to or engineered to comprise a signal
peptide, or a hydrophobic sequence that facilitates export and
secretion of the protein. Alternatively, HOXB4, such as a fusion
protein covalently or non-covalently linked to a PTD, may be added
directly to the media. Additionally, HOXB4 may be borne on a viral
vector, such as a retroviral vector or an adenoviral vector. Such a
vector could transduce either the hemangioblasts or other cells in
their culture.
[0162] Depending on the HOXB4 protein used, in particular
embodiments HOXB4 is added to the media at selected times during
the expansion of the hemangioblasts. Because the hemangioblasts are
expanded in serum-free medium, HOXB4 is relatively stable.
Accordingly, in certain embodiments, a HOXB4 protein or fusion
protein is added every day to the human hemangioblasts. In other
embodiments, a HOXB4 protein or fusion protein is added every other
day, and in still other embodiments, a HOXB4 protein or fusion
protein is added every 2 days. In one embodiment, a HOXB4 fusion
protein, HOXB4-PTD, is added every 2 days to the media.
[0163] In certain embodiments, the hemangioblasts can be expanded
in the presence of any other growth factors or proteins that are
present in an amount sufficient to expand such cells.
[0164] Hemangioblasts obtained from any source, including human or
non-human ES cells, bone marrow, placenta or umbilical cord blood,
peripheral blood, or other tissue may be expanded according to the
methods described above. Accordingly, in certain embodiments, a
select number of purified hemangioblasts or enriched cells are
mixed with serum-free methylcellulose medium optimized for
hemangioblast growth (e.g., BL-CFU medium,). This medium may be
supplemented with early stage cytokines (including, but not limited
to, EPO, TPO, FL, VGF, BMPs like BMP2, BMP4 and BMP7, but not BMP3)
and HOXB4. In certain embodiments, erythropoietin (EPO) is added to
the media. In certain embodiments, EPO, TPO and FL are added to the
media. The cells are then plated onto ultra-low attachment culture
dishes and grown in a CO.sub.2 incubator. As mentioned above,
hemangioblast colonies exhibit a distinctive grape-like morphology
and are comparatively smaller than other cells and may consequently
be distinguished from other cell types. The hemangioblasts may also
be tested for markers as well as for their ability to differentiate
further into either hematopoietic or endothelial cell lineages. The
hemangioblasts are subsequently isolated and expanded in vitro.
Media that may be used for expansion includes serum-free
methylcellulose medium optimized for hemangioblasts growth (e.g.,
BL-CFU) supplemented with early stage cytokines and HOXB4. Early
stage cytokines include, but are not limited to, EPO, TPO, FL,
VEGF, BMPs like BMP2, BMP4 and BMP7, but not BMP3. In certain
embodiments, erythropoietin (EPO) is added to the medium. In
further embodiments, EPO, TPO and FL are added to the medium.
[0165] Accordingly, a medium for expanding hemangioblasts may
comprise VEGF, SCF, EPO, BMP-4, and HoxB4; in certain embodiments
the medium may further comprise TPO and FL. For example, single
cells prepared from EBs cultured for approximately 3.5 days, were
collected and dissociated by 0.05% trypsin-0.53 mM EDTA
(Invitrogen) for 2-5 min, and a single cell suspension was prepared
by passing through 22 G needle 3-5 times. Cells were collected by
centrifugation at 1,000 rpm for 5 min. Cell pellets were
resuspended in 50-200 .mu.l of Stemline I media. To expand
hemangioblasts, single cell suspension derived from differentiation
of 2 to 5.times.10.sup.5 hES cells were mixed with 2 ml
hemangioblast expansion media (HGM) containing 1.0% methylcellulose
in Iscove's MDM, 1-2% Bovine serum albumin, 0.1 mM
2-mercaptoethanol, 10 .mu.g/ml rh-Insulin, 200 .mu.g/ml iron
saturated human transferrin, 20 ng/ml rh-GM-CSF, 20 ng/ml rh-IL-3,
20 ng/ml rh-IL-6, 20 ng/ml rh-G-CSF, 3 to 6 units/ml rh-Epo, 50
ng/ml rh-SCF, 50 ng/ml rh-VEGF and 50 ng/ml rh-BMP-4, and 1.5
.mu.g/ml of tPTD-HoxB4, with/without 50 ng/ml of Tpo and FL. The
cell mixtures were plated on ultra-low dishes and incubated at
37.degree. C. in 5% CO.sub.2 for 4-6 days.
[0166] In certain situations it may be desirable to obtain
hemangioblasts from a patient or patient relative and expand said
hemangioblasts in vitro. Such situations include, for example, a
patient scheduled to begin chemotherapy or radiation therapy, or
other situations wherein an autologous HSC transplantation (using
the patient's own stem cells) may be used. Thus, the present
invention provides methods of treating patients in need of
cell-based therapy (for example, patients in need of hematopoietic
reconstitution or treatment, or blood vessel growth or treatment of
vascular injuries including ischemia, see below) using the expanded
hemangioblasts or hemangioblast lineage cells of the invention,
wherein the hemangioblasts are obtained from the bone marrow,
blood, or other tissue of the patient or a patient relative.
Accordingly, in certain embodiments, methods of treating a patient
in need of hemangioblasts (or hemangioblast lineage cells) may
comprise a step of isolating hemangioblasts from the patient or a
patient relative. Hemangioblasts isolated from the patient or
patient relative may be expanded in vitro according to the methods
of the present invention and subsequently administered to the
patient. Alternatively the expanded hemangioblasts may be grown
further to give rise to hematopoietic cells or endothelial cells
before patient treatment.
[0167] It is also possible to obtain human ES cells from such a
patient by any method known in the art, such as somatic cell
nuclear transfer. Hemangioblasts of that patient may then be
generated and expanded from his own ES cells using a method of this
invention. Those hemangioblasts or lineage derivatives thereof may
be administered to that patient or to his relatives.
[0168] Using the methods of the present invention, human
hemangioblasts are expanded to reach commercially large quantities
which can be subsequently used in various therapeutic and clinical
applications. Furthermore, the hemangioblasts obtained by the
methods disclosed herein may be differentiated further to give rise
to either hematopoietic or endothelial cell lineages for use in
clinical applications.
[0169] The hemangioblasts obtained from the method of this
invention for generating and expanding human hemangioblasts from
human ES cells have the potential to differentiate into at least
endothelial cells or hematopoietic cells (i.e., they are at least
bi-potential). Other hemangioblasts may be bi-potential as well.
Yet other hemangioblasts may be able to differentiate into cells
other than hematopoietic and endothelial cells, i.e., they are
multi- or pluri-potential).
Engineering MHC Genes in Human Embryonic Stem Cells to Obtain
Reduced-Complexity Hemangioblasts
[0170] The human embryonic stem cells used as the starting point
for the method of generating and expanding human hemangioblast
cells of this invention may also be derived from a library of human
embryonic stem cells, each of which is hemizygous or homozygous for
at least one MHC allele present in a human population. In certain
embodiments, each member of said library of stem cells is
hemizygous or homozygous for a different set of MHC alleles
relative to the remaining members of the library. In certain
embodiments, the library of stem cells is hemizygous or homozygous
for all MHC alleles that are present in a human population. In the
context of this invention, stem cells that are homozygous for one
or more histocompatibility antigen genes include cells that are
nullizygous for one or more (and in some embodiments, all) such
genes. Nullizygous for a genetic locus means that the gene is null
at that locus, i.e., both alleles of that gene are deleted or
inactivated. Stem cells that are nullizygous for all MHC genes may
be produced by standard methods known in the art, such as, for
example, gene targeting and/or loss of heterozygocity (LOH). See,
for example, United States patent publications US 20040091936, US
20030217374 and US 20030232430, and U.S. provisional application
No. 60/729,173, the disclosures of all of which are hereby
incorporated by reference herein.
[0171] Accordingly, the present invention relates to methods of
obtaining hemangioblasts, including a library of hemangioblasts,
with reduced MHC complexity. Hemangioblasts and hemangioblast
lineage cells with reduced MHC complexity will increase the supply
of available cells for therapeutic applications as it will
eliminate the difficulties associated with patient matching. Such
cells may be derived from stem cells that are engineered to be
hemizygous or homozygous for genes of the MHC complex.
[0172] A human ES cell may comprise modifications to one of the
alleles of sister chromosomes in the cell's MHC complex. A variety
of methods for generating gene modifications, such as gene
targeting, may be used to modify the genes in the MHC complex.
Further, the modified alleles of the MHC complex in the cells may
be subsequently engineered to be homozygous so that identical
alleles are present on sister chromosomes. Methods such as loss of
heterozygosity (LOH) may be utilized to engineer cells to have
homozygous alleles in the MHC complex. For example, one or more
genes in a set of MHC genes from a parental allele can be targeted
to generate hemizygous cells. The other set of MHC genes can be
removed by gene targeting or LOH to make a null line. This null
line can be used further as the embryonic cell line in which to
drop arrays of the HLA genes, or individual genes, to make a
hemizygous or homozygous bank with an otherwise uniform genetic
background.
[0173] In one aspect, a library of ES cell lines, wherein each
member of the library is homozygous for at least one HLA gene, is
used to derive hemangioblasts according to the methods of the
present invention. In another aspect, the invention provides a
library of hemangioblasts (and/or hemangioblast lineage cells),
wherein several lines of ES cells are selected and differentiated
into hemangioblasts. These hemangioblasts and/or hemangioblast
lineage cells may be used for a patient in need of a cell-based
therapy.
[0174] Accordingly, certain embodiments of this invention pertain
to a method of administering human hemangioblasts, hematopoietic
stem cells, or human endothelial cells that have been derived from
reduced-complexity embryonic stem cells to a patient in need
thereof. In certain embodiments, this method comprises the steps
of: (a) identifying a patient that needs treatment involving
administering human hemangioblasts, hematopoietic stem cells, or
human endothelial cells to him or her; (b) identifying MHC proteins
expressed on the surface of the patient's cells; (c) providing a
library of human hemangioblasts of reduced WIC complexity made by
the method for generating and expanding human hemangioblast cells
in vitro of the present invention; (d) selecting the human
hemangioblast cells from the library that match this patient's MHC
proteins on his or her cells; (e) optionally differentiating the
human hemangioblast cells identified in step (d) into human
hematopoietic stem cells, endothelial cells or both, or cells that
are further differentiated in either or both of these two lineages,
depending on need; (f) administering any of the cells from step (d)
and/or (e) to said patient. This method may be performed in a
regional center, such as, for example, a hospital, a clinic, a
physician's office, and other health care facilities. Further, the
hemangioblasts selected as a match for the patient, if stored in
small cell numbers, may be expanded prior to patient treatment.
Human Hemangio-Colony Forming Cells/Hemangioblasts
[0175] In certain aspects, the present invention provides human
hemangio-colony forming cells. These cells are a unique, primitive
cell type with a variety of therapeutic and other uses.
Furthermore, this cell type provides an important tool for studying
development of at least the hematopoietic and/or endothelial
lineages. As such, the invention contemplates various preparations
(including pharmaceutical preparations) and compositions comprising
human hemangio-colony forming cells, as well as preparations
(including pharmaceutical preparations) and compositions comprising
one or more cell types partially or terminally differentiated from
hemangio-colony forming cells.
[0176] Human hemangio-colony forming cells of the present invention
have at least one of the following structural characteristics: (a)
can differentiate to give rise to at least hematopoietic cell types
or endothelial cell types; (b) can differentiate to give rise to at
least hematopoietic cell types and endothelial cell types; (c) are
loosely adherent to each other (to other human hemangio-colony
forming cells; (d) do not express CD34 protein; (e) do not express
CD31 protein; (f) do not express KDR protein; (g) do not express
CD133 protein; (h) express GATA2 protein; (i) express LMO2 protein.
In certain embodiments, human hemangio-colony forming cells have at
least two, at least three, at least four, at least five, at least
six, at least seven, at least eight, or at least nine of the
structural or functional characteristics detailed herein.
[0177] The invention provides for human hemangio-colony forming
cells. Such cells can differentiate to produce at least
hematopoietic and/or endothelial cell types. In certain
embodiments, the cells are characterized as being loosely adherent
to other human hemangio-colony forming cells. Alternatively or
additionally, these cells may also be described based on expression
or lack of expression of certain markers. For example, these cells
may also be described based on lack of expression of at least one
of the following proteins: CD34, KDR, CD133, and CD31.
[0178] As detailed above, one of the interesting properties of
human hemangio-colony forming cells is that they are loosely
adherent to each other. Because these cells are only loosely
adherent to each other, cultures or colonies of hemangio-colony
forming cells can be dissociated to single cells using only
mechanical dissociation techniques and without the need for
enzymatic dissociation techniques. The cells are sufficiently
loosely adherent to each other that mechanical dissociation alone,
rather than enzymatic dissociation or a combination thereof, is
sufficient to disaggregate the cultures or colonies without
substantially impairing the viability of the cells. In other words,
mechanical dissociation does not require so much force as to cause
substantial cell injury or death.
[0179] This property is not only useful in describing the cells and
distinguishing them phenotypically from other cell types, but it
also has significant therapeutic implications. For example,
relatively large numbers (greater than 1.times.10.sup.6 or even
greater than 1.times.10.sup.7 or even greater than
1.times.10.sup.8) of the hemangio-colony forming cells can be
injected into humans or other animals with substantially less risk
of causing clots or emboli, or otherwise lodging in the lung. This
is a significant advance in cellular therapy. The ability to safely
administer relatively large numbers of cells makes cellular therapy
practical and possible for the effective treatment of an increasing
number of diseases and conditions.
[0180] The term "loosely adherent" is described qualitatively above
and refers to behavior of the human hemangio-colony forming cells
with respect to each other. Cultures or colonies of hemangio-colony
forming cells can be dissociated to single cells using only
mechanical dissociation techniques and without the need for
enzymatic dissociation techniques. The cells are sufficiently
loosely adherent to each other that mechanical dissociation alone,
rather than enzymatic dissociation or a combination thereof, is
sufficient to disaggregate the cultures or colonies without
substantially impairing the viability of the cells. In other words,
mechanical dissociation does not require so much force as to cause
substantial cell injury or death.
[0181] The term can also be described more quantitatively. For
example and in certain embodiments, the term "loosely adherent" is
used to refer to cultures or colonies of hemangio-colony forming
cells wherein at least 50% of the cells in the culture can be
dissociated to single cells using only mechanical dissociation
techniques and without the need for enzymatic dissociation
techniques. In other embodiments, the term refers to cultures in
which at least 60%, 65%, 70%, or 75% of the cells in the culture
can be dissociated to single cells using only mechanical
dissociation techniques and without the need for enzymatic
dissociation techniques. In still other embodiments, the term
refers to cultures in which at least 80%, 85%, 90%, 95%, 96%, 97%,
98%, 99%, or even 100% of the cells in the culture can be
dissociated to single cells using only mechanical dissociation
techniques and without the need for enzymatic dissociation
techniques.
[0182] The ability to dissociate the hemangio-colony forming cells
using only mechanical dissociation techniques and without the need
for enzymatic dissociation techniques can be further quantitated
based on the health and viability of the cells following mechanical
dissociation. In other words, if dissociation without enzymatic
techniques requires so much mechanical force that a significant
number of the cells are damaged or killed, the cells are not
loosely adherent, as defined herein. For example and in certain
embodiments, the term "loosely adherent" refers to cultures of
cells that can be dissociated to single cells using only mechanical
dissociation techniques and without the need for enzymatic
dissociation techniques, without substantially impairing the health
or viability or the cells in comparison to that observed when the
same cells are dissociated using enzymatic dissociation techniques.
For example, the health or viability of the cells is decreased by
less than 15%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or even less
than 1% in comparison to that observed when a culture of the same
cells are dissociated using enzymatic dissociation techniques.
[0183] Exemplary enzymatic dissociation techniques include, but are
not limited to, treatment with trypsin, collagenase, or other
enzymes that disrupt cell-cell or cell-matrix interactions.
Exemplary mechanical dissociation techniques include, but are not
limited to, one or more passages through a pipette.
[0184] Human hemangio-colony forming cells according to the present
invention are defined structurally and functionally. Such cells can
be generated from any of a number of sources including from
embryonic tissue, prenatal tissue, perinatal tissue, and even from
adult tissue. By way of example, human hemangio-colony forming
cells can be generated from human embryonic stem cells, other
embryo-derived cells (blastocysts, blastomeres, ICMs, embryos,
trophoblasts/trophectoderm cells, trophoblast stem cells,
primordial germ cells, embryonic germ cells, etc.), amniotic fluid,
amniotic stem cells, placenta, placental stem cells, and umbilical
cord.
[0185] The invention provides human hemangio-colony forming cells,
compositions comprising human hemangio-colony forming cells, and
preparations (including pharmaceutical preparations) comprising
human hemangio-colony forming cells. Certain features of these
aspects of the invention are described in detail below. The
invention contemplates combinations of any of the following aspects
and embodiments of the invention.
[0186] In one aspect, the invention provides a human
hemangio-colony forming cell. The cell can differentiate to produce
at least hematopoietic and/or endothelial cell types. In certain
embodiments, the cell is loosely adherent to other human
hemangio-colony forming cells. In certain embodiments, the cell
does not express CD34 protein. In certain other embodiments, the
cell does not express one or more of (e.g., the cell does not
express at least one, at least two, at least three, or at least
four of the following proteins) the following proteins: CD34, CD31,
CD133, KDR. In certain other embodiments, the cell does express
GATA2 and/or LMO2 protein.
[0187] In another aspect, the invention provides a human
hemangio-colony forming cell. The cell, which cell can
differentiate to produce at least hematopoietic and/or endothelial
cell types, and the cell does not express any of the following
proteins: CD34, CD31, KDR, and CD133. In certain embodiments, the
cell is loosely adherent to other human hemangio-colony forming
cells. In other embodiments, the cell does express GATA2 and/or
LMO2 protein.
[0188] In another aspect, the invention provides a cell culture
comprising a substantially purified population of human
hemangio-colony forming cells. The cells can differentiate to
produce at least hematopoietic and endothelial cell types, and the
cells are loosely adherent to each other. In certain embodiments,
the cell does not express CD34 protein. In certain other
embodiments, the cell does not express one or more of (e.g., the
cell does not express at least one, at least two, at least three,
or at least four of the following proteins) the following proteins:
CD34, CD31, CD133, KDR. In certain other embodiments, the cell does
express GATA2 and/or LMO2 protein.
[0189] In another aspect, the invention provides a cell culture
comprising human hemangio-colony forming cells differentiated from
embryonic tissue. In certain embodiments, the hemangio-colony
forming cells are loosely adherent to each other. In certain
embodiments, the cells can differentiate to produce at least
hematopoietic and/or endothelial cell types, and the cells are
loosely adherent to each other. In certain embodiments, the cell
does not express CD34 protein. In certain other embodiments, the
cell does not express one or more of (e.g., the cell does not
express at least one, at least two, at least three, or at least
four of the following proteins) the following proteins: CD34, CD31,
CD133, KDR. In certain other embodiments, the cell does express
GATA2 and/or LMO2 protein.
[0190] In another aspect, the invention provides a cell culture
comprising human hemangio-colony forming cells, which cells can
differentiate to produce at least hematopoietic and/or endothelial
cell types. In certain embodiments, the cells are loosely adherent
to each other. In certain embodiments, the cell does not express
CD34 protein. In certain other embodiments, the cell does not
express one or more of (e.g., the cell does not express at least
one, at least two, at least three, or at least four of the
following proteins) the following proteins: CD34, CD31, CD133, KDR.
In certain other embodiments, the cell does express GATA2 and/or
LMO2 protein.
[0191] In another aspect, the invention provides a pharmaceutical
preparation comprising human hemangio-colony forming cells, which
cells can differentiate to produce at least hematopoietic and/or
endothelial cell types. In certain embodiments, the hemangio-colony
forming cells are loosely adherent to each other. In certain
embodiments, the cell does not express CD34 protein. In certain
other embodiments, the cell does not express one or more of (e.g.,
the cell does not express at least one, at least two, at least
three, or at least four of the following proteins) the following
proteins: CD34, CD31, CD133, KDR. In certain other embodiments, the
cell does express GATA2 and/or LMO2 protein. The pharmaceutical
preparation can be prepared using any pharmaceutically acceptable
carrier or excipient.
[0192] In another aspect, the invention provides a pharmaceutical
preparation comprising human hemangio-colony forming cells, wherein
the hemangio-colony forming cells do not express any of the
following proteins: CD34, CD31, KDR, and CD133. In certain
embodiments, the hemangio-colony forming cells can differentiate to
produce at least hematopoietic and/or endothelial cell types. In
certain embodiments, the hemangio-colony forming cells are loosely
adherent to each other. In certain other embodiments, the cell does
express GATA2 and/or LMO2 protein. The pharmaceutical preparation
can be prepared using any pharmaceutically acceptable carrier or
excipient.
[0193] In certain embodiments of any of the foregoing, the
composition or pharmaceutical preparation comprises at least
1.times.10.sup.5 human hemangio-colony forming cells. In certain
other embodiment, of any of the foregoing, the composition or
pharmaceutical preparation comprises at least 1.times.10.sup.6, at
least 5.times.10.sup.6, at least 1.times.10.sup.7, or greater than
1.times.10.sup.7 human hemangio-colony forming cells.
[0194] Additional cells, compositions, and preparations include
cells partially or terminally differentiated from human
hemangio-colony forming cells. For example, the invention
contemplates compositions and preparations comprising one or more
hematopoietic and/or endothelial cell type differentiated from a
hemangio-colony forming cell. Exemplary hematopoietic cell types
include hematopoietic stem cells, platelets, RBCs, lymphocytes,
megakaryocytes, and the like. By way of further examples, the
invention contemplates compositions and preparations comprising one
or more other cell type, such as one or more partially or
terminally differentiated mesodermal cell type, differentiated from
hemangio-colony forming cells.
[0195] In certain embodiments of any of the foregoing, the
invention provides a cryopreserved preparation of human
hemangio-colony cells or cells partially or terminally
differentiated therefrom.
[0196] In certain embodiments of any of the foregoing, the
invention provides for the therapeutic use of human hemangio-colony
forming cells, or compositions or preparations of human
hemangio-colony forming cells. Such cells and preparations can be
used in the treatment of any of the conditions or diseases detailed
throughout the specification, as well as in the blood banking
industry. Furthermore, cells differentiated from human
hemangio-colony forming cells, or compositions or preparations of
human hemangio-colony forming cells, can be used therapeutically in
the treatment of any of the conditions or diseases detailed
throughout the specification, as well as in the blood banking
industry.
[0197] The human hemangio-colony forming cells of the invention are
can be used therapeutically. Additionally or alternatively, human
hemangio-colony forming cells can be used to study development of
endothelial and hematopoietic lineages or in screening assays to
identify factors that can be used, for example, to (i) maintain
human hemangio-colony forming cells or (ii) to promote
differentiation of human hemangio-colony forming cells to one or
more partially or terminally differentiated cell types.
Furthermore, human hemangio-colony forming cells can be used to
generate one or more partially or terminally differentiated cell
types for in vitro or in vivo use.
[0198] The human hemangio-colony forming cells of the invention can
be used in any of the methods or application described in the
present application including, but not limited to, in the treatment
of any of the diseases or conditions described herein.
Cell Preparations Comprising Hemangioblasts Expanded In Vitro
[0199] In certain embodiments of the present invention, mammalian
(including human) hemangioblasts are expanded to reach commercial
quantities and are used in various therapeutic and clinical
applications. In particular embodiments, hemangioblasts are
expanded to reach cell numbers on the order of 10,000 to 4 million
(or more). These cell numbers may be reached within 3-4 days of
starting the initial preparations. Accordingly, the present
invention relates to preparations comprising large numbers of
hemangioblasts, said preparations comprising at least 10,000,
50,000, 100,000, 500,000, a million, 2 million, 3 million or 4
million cells.
[0200] This invention also provides for a solution, a composition,
and a preparation comprising large numbers of hemangioblasts, said
solution, said composition, and said preparation comprising at
least 10,000, 50,000, 100,000, 500,000, a million, 2 million, 3
million or 4 million cells. The hemangioblasts could be human.
[0201] Other aspects of the present invention relate to
differentiating the hemangioblasts obtained by the methods
disclosed herein into either hematopoietic or endothelial cell
lineages, or both, that are subsequently used in clinical
applications. Thus, the present invention also relates to cell
preparations comprising large numbers of hematopoietic or
endothelial cells. The invention also relates to differentiating
the hemangioblasts obtained by the methods disclosed herein into
other cell lineages, other than hematopoietic and endothelial
cells. Thus, the present invention also relates to cell
preparations comprising large numbers of other
hemangioblast-derived cells.
[0202] Compositions and preparations comprising large numbers
(e.g., thousands or millions) of hemangioblasts may be obtained by
expanding hemangioblasts that are obtained as described above.
Accordingly, the invention pertains to compositions and
preparations comprising large numbers of hemangioblasts achieved by
expanding ES cells (such as human ES cells) or hemangioblasts
obtained from cord blood, peripheral blood or bone marrow. Further,
as the methods of expansion may be applied to hemangioblasts of
mouse, rat, bovine, or non-human primate origin, for example, the
present invention also relates to compositions and preparations
comprising large numbers of hemangioblasts of other species in
addition to human. The hemangioblasts to be expanded by the methods
of this invention may be bi-potential, i.e., can differentiate into
either endothelial cells or hematopoietic stem cells. In certain
embodiments, the human hemangioblasts generated and expanded from
human ES cells are bi-potential. Hemangio-colony forming cells are
capable of differentiating to give rise to at least hematopoietic
cell types or endothelial cell types. Hemangio-colony forming cells
are preferably bi-potential and capable of differentiating to give
rise to at least hematopoietic cell types and endothelial cell
types. As such, hemangio-colony forming cells of the present
invention are at least uni-potential, and preferably bi-potential.
Additionally however, hemangio-colony forming cells may have a
greater degree of developmental potential and can, in certain
embodiments, differentiate to give rise to cell types of other
lineages. In certain embodiments, the hemangio-colony forming cells
are capable of differentiating to give rise to other mesodermal
derivatives such as cardiac cells (for example, cardiomyocytes)
and/or smooth muscle cells.
Mammalian Hemangioblast Cell Markers
[0203] As described above, the hemangio-colony forming cells lack
certain features characteristic of mature endothelial or
hematopoietic cells. These hemangio-colony forming cells or
hemangioblasts, however, may be identified by various markers such
as, for example, CD71+, GATA-1 and GATA-2 proteins, CXCR-4, and TPO
and EPO receptors. In additional embodiments, the hemangioblasts
express LMO-2. Hemangioblasts may additionally be characterized by
the absence or low expression of other markers. Accordingly,
hemangioblasts may be CD34- CD31-, and KDR-. In further
embodiments, the hemangioblasts may be CD34-, CD31-, KDR-, and
CD133-.
[0204] Accordingly, in certain embodiments, the hemangioblasts
generated and expanded by the methods of present invention are
characterized by the presence or absence of any one or more of the
markers listed in Table 2 of WO2007/120811, incorporated herein by
reference in its entirety. For example, the hemangioblasts may test
negative for expression of any one or more of the markers listed in
Table 2 that is denoted as "-" under "BL-CFC". Accordingly, in some
embodiments, the hemangioblasts may be negative for CD34
expression. The cells may additionally or alternatively be negative
for CD31, CD133, and/or KDR expression. In further embodiments, the
hemangioblasts may express any of the markers denoted in Table 2
with "+". For example, the cells may express one or more of the
markers LMO-2 and GATA-2. Expression of a marker may be assessed by
any method, such as, for example, immunohistochemistry or
immunoblotting to test for protein expression, or mRNA analysis to
test for expression at the RNA level.
Deriving Hemangioblast Lineage Cells
[0205] The methods and cell preparations of the present invention
also relate to hemangioblast derivative cells. Human hemangioblasts
generated and expanded by this invention and mammalian
hemangioblasts expanded by the methods of the invention may be
differentiated in vitro to obtain hematopoietic cells (including
hematopoietic stem cells (HSCs)) or endothelial cells, as well as
cells that are further differentiated in these two lineages. These
cells may subsequently be used in the therapeutic and commercial
applications described below.
[0206] In certain embodiments, hematopoietic cells are derived by
growing the hemangioblasts in serum-free BL-CFU for 3-10 days. In
other embodiments, single-cell suspensions of hES-derived BL-CFC
cells are grown for 10-14 days. Maintaining serum-free conditions
is optimal insofar as serum-free conditions facilitate scale-up
production and compliance with regulatory guidelines as well as
reduce cost. Hemangioblasts of the present invention may also be
grown in serum-free Hem-culture (Bhatia et al. 1997 J Exp Med
(186): 619-624), which sustains human hematopoietic stem cells and
comprises BSA (e.g., 1% BSA), insulin (e.g., 5 .mu.g/ml human
insulin), transferrin media or transferrin (e.g., 100 .mu.g/ml
human transferrin), L-glutamine, beta-mercaptoethanol (e.g.,
10.sup.-4 M), and growth factors. The growth factors may comprise
SCF (e.g., 300 ng/ml), granulocytic-colony-stimulating factor
(G-CSF) (e.g., 50 ng/ml), Flt-3 (e.g., 300 ng/ml), IL-3 (e.g., 10
ng/ml), and IL-6 (e.g., 10 ng/ml). Other factors useful for
obtaining hematopoietic cells from hemangioblasts include
thrombopoietin (TPO) and VEGF (see, for example, Wang et al. 2005
Ann NY Acad Sci (1044): 29-40) and BMP-4. The hemangioblasts may
also be grown in serum-free methylcellulose medium supplemented
with a multilineage hematopoietic growth factor cocktail. Thus, the
hemangioblasts may be grown in methylcellulose in Iscove modified
Dulbecco medium (IMDM) comprising BSA, saturated human transferrin,
human LDL, supplemented with early acting growth factors (e.g.,
c-kit ligand, flt3 ligand), multilineage growth factors (e.g.,
IL-3, granulocyte macrophage-CSF (GM-CSF)), and unilineage growth
factors (e.g., G-CSF, M-CSF, EPO, TPO)), VEGF, and bFGF.
Alternatively, the hemangioblasts may be grown in medium comprising
unilineage growth factors to support the growth of one type of
hematopoietic cell (e.g., red blood cells, macrophages, or
granulocytes).
[0207] In one embodiment, hemangioblast colonies are resuspended in
Stemline I media. Cells are then mixed with 1 ml of serum-free
hematopoietic CFU media (H4436, Stem Cell Technologies.TM.) plus
1.5 .mu.g/ml of tPTD-HoxB4 and 0.5% EX-CYTE (Serologicals Proteins
Inc..TM.). The cell mixtures are then plated on cell culture
untreated plates and incubated at 37.degree. C. for 10-14 days.
Hematopoietic CFUs arising following 10-14 days after initial
plating may be characterized morphologically, such as by staining
with Wright-Giemsa dye.
[0208] Hematopoietic cells may also be derived from the
hemangioblast using other conditions known in the art (e.g., in
media comprising IMDM, 30% fetal calf serum (FCS), 1% bovine serum
albumin (BSA), 10.sup.-4 M beta-mercaptoethanol, and 2 mM
L-glutamine). Further, in other embodiments basic fibroblast growth
factor may be used to promote both BL-CFC frequency within EBs and
promote hematopoietic differentiation (Faloon et al. 2000
Development (127): 1931-1941). In yet other embodiments, the growth
factor hemangiopoietin (HAPO) is used to promote growth and
hematopoietic differentiation of the hemangioblasts (Liu et al.
2004 Blood (103): 4449-4456). The differentiation into
hematopoietic cells may be assessed by CD45 status (CD45+) and the
CFU assay, for example.
[0209] To form hematopoietic cells, human hemangioblasts may be
grown for 3-10 days, or optionally for longer periods of time
(e.g., 10-14 days) in CFU-medium. Human hemangioblasts of the
present invention are able to form CFUs comprising granulocytes,
erythrocytes, macrophages, and megakaryocytes (CFU-GEMM/mix) as
well as colony forming units containing only one of the latter cell
types (e.g., CFU-G, CFU-E, CFU-M, and CFU-GM). In certain
embodiments, single-cell suspensions of hES-derived BL-CFC cells
are grown for 10-14 days to derive hematopoietic cells such as, for
example, erythroid, myeloid, macrophage, and multilineage
hematopoietic cells.
[0210] Other aspects of the invention relate to endothelial cells
derived from the human hemangioblasts obtained and expanded or
mammalian hemangioblasts expanded by the methods described herein.
The hemangioblasts may be grown in conditions favorable to
endothelial maturation.
[0211] In certain embodiments of the present invention, to obtain
endothelial cells, hemangioblasts are first plated onto a
fibronectin-coated surface and following 3-5 days (or in other
embodiments 3-7 days), are replated onto a thick layer of Matrigel
to support differentiation into endothelial cells. These conditions
maintain the serum-free conditions established during hemangioblast
development. Alternatively, hemangioblasts may be grown in media
known to support differentiation into endothelial cells. Such
conditions include, for example, Endo-culture comprising 20% fetal
bovine serum (FBS), 50 ng/ml endothelial cell growth supplement
(i.e., pituitary extracts), 10 IU/ml heparin, and 5 ng/ml human
VEGF-A.sub.165 (Terramani et al. 2000 In vitro Cell Dev Biol Anim
(36): 125-132). Other conditions known in the art include medium
supplemented with 25% FCS/horse serum, and in some embodiments
heparin (e.g., 10 U/ml), insulin like growth factor (IGF1) (e.g., 2
ng), and EC growth supplement (EGGS, e.g., 100 .mu.g). The growth
factors VEGF and EGF may also be used in combination with HAPO to
support endothelial differentiation (Liu et al. 2004). The
hemangioblasts may also be seeded onto dishes coated with collagen
and fibronectin, for example, to promote differentiation into
endothelial cells. Cells may be analyzed for von Willebrand factor
(vWF) and endothelial nitric oxide synthase (eNOS) and the ability
to form an endothelial network in vitro.
[0212] Accordingly, to form endothelial cells, hemangioblast
colonies derived by the methods described above are picked and
replated onto fibronectin-coated culture plates optimized for the
first step towards endothelial differentiation. The cells may be
plated in EGM-2 or EGM-2MV complete media (Cambrex.TM.). Following
3 to 5 days, and in alternative embodiments 3 to 7 days, the cells
are re-plated on a surface that supports endothelial
differentiation, such as on a layer of Matrigel. Following 16-24
hours of incubation, the formation of branched tube-cords suggests
typical endothelial cell behavior. Endothelial-specific assays such
as LDL-uptake may also be used to confirm that these cells are of
endothelial nature.
[0213] In other aspects of the invention, human hemangioblasts
generated and expanded by this invention and mammalian
hemangioblasts expanded by the methods of the invention may be
differentiated in vitro to obtain other cells, as well as cells
that are further differentiated from these cell lineages. Such
additional cell lineages may be derived from the hemangioblasts
generated and expanded by this invention and mammalian
hemangioblasts expanded by the methods of the invention because the
hemangioblast cells may have an even greater degree of
developmental potential beyond differentiating into hematopoietic
and endothelial cells.
Non-Engrafting Hemangio Cells
[0214] The present invention provides a novel cell population that
shares some characteristics of previously identified hemangioblasts
and hemangio-colony forming cells. However, the novel cell
population described herein is distinct in that it does not engraft
into the bone marrow when administered to immunodeficient animals.
This novel progenitor cell population is useful for the study of
basic developmental and stem cell biology, is useful to generate
partially and terminally differentiated cell type in vitro and in
vivo, and is useful for the development of therapeutics.
Additionally, these cells can be used in screening assays to
identify, for example, (i) factors or conditions that promote the
expansion of non-engrafting hemangio cells and (ii) factors or
conditions that promote the generation of one or more
differentiated cell type from non-engrafting hemangio cells.
Identified factors and conditions can be used in the production of
cell-based and cell free therapies, in the production of mediums
and formulations, and in the study of developmental and stem cell
biology.
Overview
[0215] The present invention provides non-engrafting hemangio
cells, compositions and preparations comprising non-engrafting
hemangio cells, methods of producing and expanding non-engrafting
hemangio cells, methods of producing differentiated cell types from
non-engrafting hemangio cells, and methods of using non-engrafting
hemangio cells or cells derived there from therapeutically.
[0216] The methods described herein can be used to generate human
non-engrafting hemangio cells. However, cells can be obtained from
other species including, but not limited to, mice, rats, rabbits,
cows, dogs, cats, sheep, pigs, and non-human primates.
[0217] This invention provides a method for expanding mammalian
non-engrafting hemangio cells obtained from any source, including
ES cells, blastocysts or blastomeres, cord blood from placenta or
umbilical tissue, peripheral blood, bone marrow, or other tissue or
by any other means known in the art. In certain embodiments, human
non-engrafting hemangio cells are generated from embryonic stem
cells or other pluripotent stem cells. By way of example, human
non-engrafting hemangio cells can be generated from embryonic stem
cells, as well as from iPS cells. In other embodiments,
non-engrafting hemangio cells are generated from human
embryo-derived cells. Human embryo-derived cells may be a
substantially homogeneous population of cells, a heterogeneous
population of cells, or all or a portion of an embryonic tissue. As
an example of embryo-derived cells that can be used in the methods
of the present invention, human non-engrafting hemangio cells can
be generated from human embryonic stem cells. Such embryonic stem
cells include embryonic stem cells derived from or using, for
example, blastocysts, plated ICMs, one or more blastomeres, or
other portions of a pre-implantation-stage embryo or embryo-like
structure, regardless of whether produced by fertilization, somatic
cell nuclear transfer (SCNT), parthenogenesis, androgenesis, or
other sexual or asexual means. In certain embodiments,
non-engrafting hemangio cells are generated from pluripotent stem
cells. Exemplary pluripotent stem cells include, but are not
limited to, embryonic stem cells and iPS cells. In certain
embodiments, human non-engrafting hemangio cells are generated from
non-pluripotent cells. Non-pluripotent cells may include somatic
cells, such as cells derived from skin, bone, blood, connective
tissue, heart, kidney, lung, liver, or any other internal organ. In
certain embodiments, the non-pluripotent cells may be cells derived
from connective tissue, such as fibroblasts. In certain
embodiments, the non-pluripotent cells are cells derived from an
adult tissue.
[0218] In certain embodiments, non-engrafting hemangio cells can be
further differentiated to hematopoietic stem cells and/or
hematopoietic cell types including, but not limited to, platelets
and red blood cells. Such cells may be used in transfusions or in
other therapies. Although such cells have numerous uses, a
particularly important use would be in improving the availability
of blood for transfusions. In certain embodiments, the invention
provides red blood cells differentiated from non-engrafting
hemangio cells. Such differentiated red blood cells could be used
for transfusions.
[0219] Further aspects of the invention relate to methods of
generating differentiated hematopoietic cells from non-engrafting
hemangio cells for use in blood transfusions for those in need
thereof. In certain embodiments, differentiated hematopoietic cells
are transfused to treat trauma, blood loss during surgery, blood
diseases such as anemia, Sickle cell anemia, or hemolytic diseases,
or malignant disease. In certain embodiments, red blood cells are
transfused to treat trauma, blood loss during surgery, or blood
diseases such as anemia, Sickle cell anemia, or hemolytic disease.
In certain embodiments, a mixed population of red blood cells is
transfused. It should be noted that many differentiated
hematopoietic cell types, particularly red blood cells, typically
exist in vivo as a mixed population. Specifically, circulating red
blood cells of varying levels of age and differentiation are found
in vivo. Additionally, red blood cells mature over time so as to
express less fetal hemoglobin and more adult hemoglobin. The
present invention contemplates transfusion of either purified
populations of red blood cells or of a mixed population of red
blood cells having varying levels of age and levels of
differentiation. In particular embodiments, the invention
contemplates transfusion of red blood cells expressing fetal
hemoglobin (hemoglobin F). Transfusion of red blood cells that
express fetal hemoglobin may be especially useful in the treatment
of Sickle cell anemia. The ability to generate large numbers of
cells for transfusion will alleviate the chronic shortage of blood
experienced in blood banks and hospitals across the country.
[0220] In certain embodiments, the methods of the invention allow
for the production of universal cells for transfusion.
Specifically, red blood cells that are type O and Rh-- can be
readily generated and will serve as a universal blood source for
transfusion. In certain embodiments, the red blood cells produced
from the methods of the application are functional. In certain
embodiments, the red blood cells express hemoglobin F prior to
transfusion. In certain embodiments, the red blood cells carry
oxygen. In certain embodiments, the red blood cells have a lifespan
equal to naturally derived red blood cells. In certain embodiments,
the red blood cells have a lifespan that is 75% of that of
naturally derived red blood cells. In certain embodiments, the red
blood cells have a lifespan that is 50% of that of naturally
derived red blood cells. In certain embodiments, the red blood
cells have a lifespan that is 25% of that of naturally derived red
blood cells.
[0221] In certain embodiments, non-engrafting hemangio cells may
have a greater developmental potential, and may differentiate to
produce endothelial cell types, smooth muscle cell types, or
cardiac cell types.
[0222] The methods of this invention allow for the in vitro
expansion of non-engrafting hemangio cells to large quantities
useful for a variety of commercial and clinical applications.
Expansion of non-engrafting hemangio cells in vitro refers to the
proliferation of non-engrafting hemangio cells. While the methods
of the invention enable the expansion of human non-engrafting
hemangio cells to reach commercially useful quantities, the present
invention also relates to large numbers of non-engrafting hemangio
cells and to cell preparations comprising large numbers of human
non-engrafting hemangio cells (for example, at least 10,000,
100,000, or 500,000 cells). In certain embodiments, the cell
preparations comprise at least 1.times.10.sup.6 cells. In other
embodiments, the cell preparations comprise at least
2.times.10.sup.6 human non-engrafting hemangio cells and in further
embodiments at least 3.times.10.sup.6 human non-engrafting hemangio
cells. In still other embodiments, the cell preparations comprise
at least 4.times.10.sup.6 human non-engrafting hemangio cells. Note
that these cell preparations may be purified or substantially
purified. However, in certain embodiments, suitable cell
preparations comprise a mixture of non-engrafting hemangio cells
and hemangio-colony forming cells. The mixture may be any ratio,
including mixtures comprising a greater proportion of
non-engrafting hemangio cells and mixtures comprising a greater
proportion of hemangio-colony forming cells.
[0223] The present invention relates to a solution, a preparation,
or a composition comprising between 10,000 and 4 million or more
mammalian (such as human) non-engrafting hemangio cells. The number
of non-engrafting hemangio cells in such a solution, a preparation,
and a composition may be any number between the range of 10,000 to
4 million, or more. This number could be, for example, 20,000,
50,000, 100,000, 500,000, 1 million, etc.
[0224] Similarly, the invention relates to preparations of human
non-engrafting hemangio progeny cells (e.g., human hematopoietic
cells including human hematopoietic stem cells). The invention
further relates to methods of producing, storing, and distributing
non-engrafting hemangio cells and/or non-engrafting hemangio cell
progeny.
[0225] The invention also provides methods and solutions suitable
for transfusion into human or animal patients. In particular
embodiments, the invention provides methods of making red blood
cells and/or platelets, and/or other hematopoietic cell types for
transfusion. In certain embodiments, the invention is suitable for
use in blood banks and hospitals to provide blood for transfusion
following trauma, or in the treatment of a blood-related disease or
disorder. In certain embodiments, the invention provides red blood
cells that are universal donor cells. In certain embodiments, the
red blood cells are functional and express hemoglobin F prior to
transfusion.
[0226] The invention also provides for human non-engrafting
hemangio cells, cell cultures comprising a substantially purified
population of human non-engrafting hemangio cells, pharmaceutical
preparations comprising human non-engrafting hemangio cells and
cryopreserved preparations of the non-engrafting hemangio cells. In
certain embodiments, the invention provides for the use of the
human non-engrafting hemangio cells in the manufacture of a
medicament to treat a condition in a patient in need thereof.
Alternatively, the invention provides the use of the cell cultures
in the manufacture of a medicament to treat a condition in a
patient in need thereof. The invention also provides the use of the
pharmaceutical preparations in the manufacture of a medicament to
treat a condition in a patient in need thereof.
[0227] The non-engrafting hemangio cells can be identified and
characterized based on their structural properties and/or function
properties. These progenitor cells do not engraft when administered
to an immunodeficient host. In certain embodiments, these cells are
unique in that they are only loosely adherent to each other
(loosely adherent to other non-engrafting hemangio cells). In
embodiments in which the cells are loosely adherent, cultures or
colonies of non-engrafting hemangio cells can be dissociated to
single cells using only mechanical dissociation techniques and
without the need for enzymatic dissociation techniques. In certain
embodiments, the cells are sufficiently loosely adherent to each
other that mechanical dissociation alone, rather than enzymatic
dissociation or a combination of mechanical and enzymatic
dissociation, is sufficient to disaggregate the cultures or
colonies without substantially impairing the viability of the
cells. In other words, mechanical dissociation does not require so
much force as to cause substantial cell injury or death when
compared to that observed subsequent to enzymatic dissociation of
cell aggregates.
[0228] In certain embodiments, the non-engrafting hemangio cells
can be further identified or characterized based on the expression
or lack of expression (as assessed at the level of the gene or the
level of the protein) of one or more markers. In certain
embodiments, the non-engrafting hemangio cells have one or more of
the characteristics of human hemangio-colony forming cells. For
example, in certain embodiments, non-engrafting hemangio cells can
be identified or characterized based on lack of expression of one
or more (e.g., the cells can be characterized based on lack of
expression of at least one, at least two, at least three or at
least four of the following markers) of the following cell surface
markers: CD34, KDR, CD133, or CD31. Additionally or alternatively,
non-engrafting hemangio cells can be identified or characterized
based on expression of GATA2 and/or LMO2.
Human Non-Engrafting Hemangio Cells
[0229] In certain aspects, the present invention provides human
non-engrafting hemangio cells. These cells are a unique, primitive
cell type with a variety of therapeutic and other uses.
Furthermore, this cell type provides an important tool for studying
development of at least the hematopoietic lineages. As such, the
invention contemplates various preparations (including
pharmaceutical preparations) and compositions comprising human
non-engrafting hemangio cells, as well as preparations (including
pharmaceutical preparations) and compositions comprising one or
more cell types partially or terminally differentiated from
non-engrafting hemangio cells. Without being bound by any
particular theory, these cells represent a distinct, somewhat more
committed (than hemangio-colony forming cells) stem cell population
that retain the ability to generate numerous hematopoietic cell
types.
[0230] Non-engrafting hemangio cells of the present invention can
be identified or characterized based on one or any combination of
the structural or functional characteristics described for
hemangio-colony forming cells. Note that although these cells can
be derived from any of a number of sources, for example, embryonic
tissue, prenatal tissue, or perinatal tissue, the term
"non-engrafting hemangio cells" applies to cells, regardless of
source, that do not engraft and that are capable of differentiating
to give rise to at least one hematopoietic cell type, and
optionally have one or more of the foregoing structural or
functional properties.
[0231] To illustrate, human non-engrafting hemangio cells of the
present invention do not engraft when administered to a
immunodeficient host and have at least one of the following
structural characteristics: (a) can differentiate to give rise to
at least one hematopoietic cell type; (b) can differentiate to give
rise to at least hematopoietic cell types and endothelial cell
types; (c) are loosely adherent to each other (to other
non-engrafting hemangio cells); (d) do not express CD34 protein;
(e) do not express CD31 protein; (f) do not express KDR protein;
(g) do not express CD133 protein; (h) express GATA2 protein; (i)
express LMO2 protein. In certain embodiments, human non-engrafting
hemangio cells have at least two, at least three, at least four, at
least five, at least six, at least seven, at least eight, or at
least nine of the structural or functional characteristics detailed
herein.
[0232] As detailed above, one of the interesting properties of
human non-engrafting hemangio cells is that they are loosely
adherent to each other. Because these cells are only loosely
adherent to each other, cultures or colonies of non-engrafting
hemangio cells can be dissociated to single cells using only
mechanical dissociation techniques and without the need for
enzymatic dissociation techniques. The cells are sufficiently
loosely adherent to each other that mechanical dissociation alone,
rather than enzymatic dissociation or a combination thereof, is
sufficient to disaggregate the cultures or colonies without
substantially impairing the viability of the cells. In other words,
mechanical dissociation does not require so much force as to cause
substantial cell injury or death.
[0233] This property is not only useful in describing the cells and
distinguishing them phenotypically from other cell types, but it
also has significant therapeutic implications. For example,
relatively large numbers (greater than 1.times.10.sup.8 or even
greater than 1.times.10.sup.7 or even greater than
1.times.10.sup.8) of the non-engrafting hemangio cells can be
injected into humans or other animals with substantially less risk
of causing clots or emboli, or otherwise lodging in the lung. This
is a significant advance in cellular therapy. The ability to safely
administer relatively large numbers of cells makes cellular therapy
practical and possible for the effective treatment of an increasing
number of diseases and conditions.
[0234] The term "loosely adherent" is described qualitatively above
and refers to behavior of the human non-engrafting hemangio cells
with respect to each other. Cultures or colonies of non-engrafting
hemangio cells can be dissociated to single cells using only
mechanical dissociation techniques and without the need for
enzymatic dissociation techniques. The cells are sufficiently
loosely adherent to each other that mechanical dissociation alone,
rather than enzymatic dissociation or a combination thereof, is
sufficient to disaggregate the cultures or colonies without
substantially impairing the viability of the cells. In other words,
mechanical dissociation does not require so much force as to cause
substantial cell injury or death.
[0235] The term can also be described more quantitatively. For
example and in certain embodiments, the term "loosely adherent" is
used to refer to cultures or colonies of non-engrafting hemangio
cells wherein at least 50% of the cells in the culture can be
dissociated to single cells using only mechanical dissociation
techniques and without the need for enzymatic dissociation
techniques. In other embodiments, the term refers to cultures in
which at least 60%, 65%, 70%, or 75% of the cells in the culture
can be dissociated to single cells using only mechanical
dissociation techniques and without the need for enzymatic
dissociation techniques. In still other embodiments, the term
refers to cultures in which at least 80%, 85%, 90%, 95%, 96%, 97%,
98%, 99%, or even 100% of the cells in the culture can be
dissociated to single cells using only mechanical dissociation
techniques and without the need for enzymatic dissociation
techniques.
[0236] The ability to dissociate the non-engrafting hemangio cells
using only mechanical dissociation techniques and without the need
for enzymatic dissociation techniques can be further quantitated
based on the health and viability of the cells following mechanical
dissociation. In other words, if dissociation without enzymatic
techniques requires so much mechanical force that a significant
number of the cells are damaged or killed, the cells are not
loosely adherent, as defined herein. For example and in certain
embodiments, the term "loosely adherent" refers to cultures of
cells that can be dissociated to single cells using only mechanical
dissociation techniques and without the need for enzymatic
dissociation techniques, without substantially impairing the health
or viability or the cells in comparison to that observed when the
same cells are dissociated using enzymatic dissociation techniques.
For example, the health or viability of the cells is decreased by
less than 15%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3% , 2%, or even less
than 1% in comparison to that observed when a culture of the same
cells are dissociated using enzymatic dissociation techniques.
[0237] Exemplary enzymatic dissociation techniques include, but are
not limited to, treatment with trypsin, collagenase, or other
enzymes that disrupt cell-cell or cell-matrix interactions.
Exemplary mechanical dissociation techniques include, but are not
limited to, one or more passages through a pipette.
[0238] Human non-engrafting hemangio cells according to the present
invention are defined structurally and functionally. Such cells can
be generated from any of a number of sources including from
embryonic tissue, prenatal tissue, perinatal tissue, and even from
adult tissue. By way of example, human non-engrafting hemangio
cells can be generated from human embryonic stem cells, other
embryo-derived cells (blastocysts, blastomeres, ICMs, embryos,
trophoblasts/trophectoderm cells, trophoblast stem cells,
primordial germ cells, embryonic germ cells, etc.), amniotic fluid,
amniotic stem cells, placenta, placental stem cells, and umbilical
cord. More generally, non-engrafting hemangio cells can be
generated from pluripotent cells, such as embryonic stem cells or
pluripotent stem cells. Exemplary pluripotent stem cells include,
but are not limited to, embryonic stem cells and induced
pluripotent stem cells (iPS cells). Human non-engrafting hemangio
cells can also be generated from non-pluripotent cells, such as
somatic cells, including but not limited to, cells derived from
skin, bone, blood, connective tissue, heart, kidney, lung, liver,
or any other internal organ. In certain embodiments, the
non-pluripotent cells may be cells derived from connective tissue,
such as fibroblasts. In certain embodiments, the non-pluripotent
cells are cells derived from an adult tissue.
[0239] The invention provides non-engrafting hemangio cells (such
as human cells), compositions comprising human non-engrafting
hemangio cells, and preparations (including pharmaceutical
preparations) comprising human non-engrafting hemangio cells.
Certain features of these aspects of the invention are described in
detail below. The invention contemplates combinations of any of the
following aspects and embodiments of the invention, as well as
combinations with the disclosure provided at U.S. application Ser.
No. 11/787,262, which is incorporated by reference in its
entirety.
[0240] As detailed above, hemangio-colony forming cells and/or
non-engrafting hemangio cells can be produced from a variety of
cells including, but not limited to, pluripotent cells (embryonic
stem cells, embryo-derived cells, and induced pluripotent stem
cells).
[0241] In one aspect, the invention provides a non-engrafting
hemangio cells (such as human cells). The cell can differentiate to
produce at least one hematopoietic cell types. In certain
embodiments, the cell is loosely adherent to other human
non-engrafting hemangio cells. In certain embodiments, the cell
does not express CD34 protein. In certain other embodiments, the
cell does not express one or more of (e.g., the cell does not
express at least one, at least two, at least three, or at least
four of the following proteins) the following proteins: CD34, CD31,
CD133, KDR. In certain other embodiments, the cell does express
GATA2 and/or LMO2 protein. In certain other embodiments, the cell
shares one or more than one (2, 3, 4, 5, 6, 7, 8, 9, 10) of the
functional or structural characteristics of human hemangio colony
forming cells.
[0242] In another aspect, the invention provides a cell culture
comprising a substantially purified population of non-engrafting
hemangio cells (such as human cells). The cells can differentiate
to produce at least hematopoietic cell types. In certain
embodiments, the cells are loosely adherent to each other. In
certain embodiments, the cell does not express CD34 protein. In
certain other embodiments, the cell does not express one or more of
(e.g., the cell does not express at least one, at least two, at
least three, or at least four of the following proteins) the
following proteins: CD34, CD31, CD133, KDR. In certain other
embodiments, the cell does express GATA2 and/or LMO2 protein. In
certain other embodiments, the cell shares one or more than one (2,
3, 4, 5, 6, 7, 8, 9, 10) of the functional or structural
characteristics of human hemangio colony forming cells.
[0243] In another aspect, the invention provides a cell culture
comprising non-engrafting hemangio cells differentiated from
embryonic tissue. In certain embodiments, the invention provides a
cell culture comprising non-engrafting hemangio cells
differentiated from pluripotent cells (pluripotent stem cells). In
certain embodiments, the non-engrafting hemangio cells are loosely
adherent to each other. In certain embodiments, the cells can
differentiate to produce at least hematopoietic cell types, and the
cells are loosely adherent to each other. In certain embodiments,
the cell does not express CD34 protein. In certain other
embodiments, the cell does not express one or more of (e.g., the
cell does not express at least one, at least two, at least three,
or at least four of the following proteins) the following proteins:
CD34, CD31, CD133, KDR. In certain other embodiments, the cell does
express GATA2 and/or LMO2 protein. In certain other embodiments,
the cell shares one or more than one (2, 3, 4, 5, 6, 7, 8, 9, 10)
of the functional or structural characteristics of human hemangio
colony forming cells.
[0244] In another aspect, the invention provides a cell culture
comprising human non-engrafting hemangio cells, which cells can
differentiate to produce at least hematopoietic cell types. In
certain embodiments, the cells are loosely adherent to each other.
In certain embodiments, the cell does not express CD34 protein. In
certain other embodiments, the cell does not express one or more of
(e.g., the cell does not express at least one, at least two, at
least three, or at least four of the following proteins) the
following proteins: CD34, CD31, CD133, KDR. In certain other
embodiments, the cell does express GATA2 and/or LMO2 protein. In
certain other embodiments, the cell shares one or more than one (2,
3, 4, 5, 6, 7, 8, 9, 10) of the functional or structural
characteristics of human hemangio colony forming cells.
[0245] In another aspect, the invention provides a pharmaceutical
preparation comprising human non-engrafting hemangio cells, which
cells can differentiate to produce at least hematopoietic cell
types. In certain embodiments, the non-engrafting hemangio cells
are loosely adherent to each other. In certain embodiments, the
cell does not express CD34 protein. In certain other embodiments,
the cell does not express one or more of (e.g., the cell does not
express at least one, at least two, at least three, or at least
four of the following proteins) the following proteins: CD34, CD31,
CD133, KDR. In certain other embodiments, the cell does express
GATA2 and/or LMO2 protein. In certain other embodiments, the cell
shares one or more than one (2, 3, 4, 5, 6, 7, 8, 9, 10) of the
functional or structural characteristics of human hemangio colony
forming cells. The pharmaceutical preparation can be prepared using
any pharmaceutically acceptable carrier or excipient.
[0246] In another aspect, the invention provides a pharmaceutical
preparation comprising human non-engrafting hemangio cells. The
pharmaceutical preparation can be prepared using any
pharmaceutically acceptable carrier or excipient.
[0247] In certain embodiments of any of the foregoing, the
composition or pharmaceutical preparation comprises at least
1.times.10.sup.5 human non-engrafting hemangio cells. In certain
other embodiment, of any of the foregoing, the composition or
pharmaceutical preparation comprises at least 1.times.10.sup.6, at
least 5.times.10.sup.6, at least 1.times.10.sup.7, or greater than
1.times.10.sup.7 human non-engrafting hemangio cells. In certain
embodiments, the preparation is a purified or substantially
purified preparation. In other embodiments, the preparation
comprises a mixture of non-engrafting hemangio cells and other cell
types. For example, a mixture of non-engrafting hemangio cells and
hemangio-colony forming cells.
[0248] Additional cells, compositions, and preparations include
cells partially or terminally differentiated from human
non-engrafting hemangio cells. For example, the invention
contemplates compositions and preparations comprising one or more
hematopoietic and/or endothelial cell type differentiated from a
non-engrafting hemangio cells. Exemplary hematopoietic cell types
include hematopoietic stem cells, platelets, RBCs, lymphocytes,
megakaryocytes, and the like. By way of further examples, the
invention contemplates compositions and preparations comprising one
or more other cell type, such as one or more partially or
terminally differentiated mesodermal cell type, differentiated from
non-engrafting hemangio cells.
[0249] In certain embodiments of any of the foregoing, the
invention provides a cryopreserved preparation of human
non-engrafting hemangio cells or cells partially or terminally
differentiated therefrom.
[0250] In certain embodiments of any of the foregoing, the
invention provides for the therapeutic use of human non-engrafting
hemangio cells, or compositions or preparations of human
non-engrafting hemangio cells. Such cells and preparations can be
used in the treatment of any of the conditions or diseases detailed
throughout the specification, as well as in the blood banking
industry. Furthermore, cells differentiated from human
non-engrafting hemangio cells, or compositions or preparations of
human non-engrafting hemangio cells, can be used therapeutically in
the treatment of any of the conditions or diseases detailed
throughout the specification.
[0251] The human non-engrafting hemangio cells of the invention can
be used therapeutically. Additionally or alternatively, human
non-engrafting hemangio cells can be used to study development of
endothelial and hematopoietic lineages or in screening assays to
identify factors that can be used, for example, to (i) maintain
human non-engrafting hemangio cells or (ii) to promote
differentiation of human non-engrafting hemangio cells to one or
more partially or terminally differentiated cell types.
Furthermore, human non-engrafting hemangio cells can be used to
generate one or more partially or terminally differentiated cell
types for in vitro or in vivo use.
[0252] The human non-engrafting hemangio cells of the invention can
be used in any of the methods or application described in the
present application including, but not limited to, in the treatment
of any of the diseases or conditions described herein. Exemplary
diseases and conditions are further discussed in U.S. application
Ser. No. 11/787,262, which is incorporated by reference in its
entirety. Further, human hemangio-colony forming cells and
non-engrafting hemangio cells can be used to produce differentiated
hematopoietic cell types, including functional red blood cells.
Cell Preparations Comprising Hemangioblasts Expanded In Vitro
[0253] In certain embodiments of the present invention, mammalian
(including human) non-engrafting hemangio cells are expanded to
reach commercial quantities and are used in various therapeutic and
clinical applications. In particular embodiments, non-engrafting
hemangio cells are expanded to reach cell numbers on the order of
10,000 to 4 million (or more). These cell numbers may be reached
within 3-4 days of starting the initial preparations. Accordingly,
the present invention relates to preparations comprising large
numbers of non-engrafting hemangio cells, said preparations
comprising at least 10,000, 50,000, 100,000, 500,000, a million, 2
million, 3 million or 4 million cells.
[0254] This invention also provides for a solution, a composition,
and a preparation comprising large numbers of non-engrafting
hemangio cells, said solution, said composition, and said
preparation comprising at least 10,000, 50,000, 100,000, 500,000, a
million, 2 million, 3 million or 4 million cells. The
non-engrafting hemangio cells could be human. The solutions can be
purified, substantially purified, or mixtures with other progenitor
cells types including, but not limited to hemangio-colony forming
cells.
[0255] Other aspects of the present invention relate to
differentiating the non-engrafting hemangio cells obtained by the
methods disclosed herein into hematopoietic or endothelial cell
lineages, or both, that are subsequently used in clinical
applications. Thus, the present invention also relates to cell
preparations comprising large numbers of partially or terminally
differentiated cell types.
[0256] Compositions and preparations comprising large numbers
(e.g., thousands or millions) of non-engrafting hemangio cells may
be obtained by expanding non-engrafting hemangio cells that are
obtained as described above. Accordingly, the invention pertains to
compositions and preparations comprising large numbers of
non-engrafting hemangio cells achieved by expanding ES cells (such
as human ES cells) or non-engrafting hemangio cells obtained from
cord blood, peripheral blood or bone marrow. Further, as the
methods of expansion may be applied to non-engrafting hemangio
cells of mouse, rat, bovine, or non-human primate origin, for
example, the present invention also relates to compositions and
preparations comprising large numbers of non-engrafting hemangio
cells of other species in addition to human. The non-engrafting
hemangio cells to be expanded by the methods of this invention may
be bi-potential, i.e., can differentiate into either endothelial
cells or hematopoietic stem cells. In certain embodiments, the
human non-engrafting hemangio cells generated and expanded from
human ES cells are bi-potential. Non-engrafting hemangio cells are
capable of differentiating to give rise to at least hematopoietic
cell types. Non-engrafting hemangio cells are, in certain
embodiments, bi-potential and capable of differentiating to give
rise to at least hematopoietic cell types and endothelial cell
types. As such, non-engrafting hemangio cells of the present
invention are at least uni-potential, and may be bi-potential.
Additionally however, non-engrafting hemangio cells may have a
greater degree of developmental potential and can, in certain
embodiments, differentiate to give rise to cell types of other
lineages. In certain embodiments, the non-engrafting hemangio cells
are capable of differentiating to give rise to other mesodermal
derivatives such as cardiac cells (for example, cardiomyocytes)
and/or smooth muscle cells.
[0257] In addition, the non-engrafting hemangio cells can be used
in screening assays to identify agents that, for example, (i)
promote differentiation of the cells to one or more hematopoietic
cell type or (ii) promote proliferation and/or survival of the
cells to facilitate cell banking and storage. The non-engrafting
hemangio cells can also be used to study basic developmental
biology or can be compared to hemangio-colony forming cells to
ascertain the developmental differences between the two related
stem cell populations.
Clinical and Commercial Embodiments of Human Hemangioblasts,
Non-Engrafting Hemangio Cells, Hemangioblast Lineage Cells and
Non-Engrafting Hemangio Lineage Cells
Cell-Based Therapies
[0258] While human hemangioblast cells and non-engrafting hemangio
cells have the potential to differentiate in vivo into either
hematopoietic or endothelial cells, they can be used in cell-based
treatments in which either of these two cell types are needed or
would improve treatment. Further, a patient may be treated with any
therapy or treatment comprising hemangioblast lineage cells or and
non-engrafting hemangio lineage cells (i.e., hematopoietic cells
and/or endothelial cells). The following section describes methods
of using the human hemangioblasts and non-engrafting hemangio cells
of this invention generated and expanded by the methods of this
invention, or expanded by the methods of this invention.
[0259] In certain embodiments of the present invention, treatments
to increase or treat hematopoietic cells and treatments for
increasing blood vessel growth and/or facilitating blood vessel
repair are contemplated. Accordingly, in certain aspects, the
present invention relates to methods and compositions for treating
a patient in need of hematopoietic cells or blood vessel growth or
repair. The hemangioblasts or non-engrafting hemangio cells may be
injected into the blood vessel of a subject or be administered to
the blood vessel of a subject through operation. The patient or the
subject may be human.
[0260] In certain embodiments of the present invention, human
hemangioblast cells or non-engrafting hemangio cells are used in
transplantation, where HSC transplantation would otherwise be used.
Such transplantation may be used, for example, in hematopoietic
reconstitution for the treatment of patients with acute or chronic
leukemia, aplastic anemia and various immunodeficiency syndromes,
as well as various non-hematological malignancies and auto-immune
disorders, and to rescue patients from treatment-induced aplasia
following high-dose chemotherapy and/or radiotherapy. Such
transplantation may be achieved in vivo or ex vivo (such as in bone
marrow transplant).
[0261] In other embodiments of the invention, human hemangioblast
cells or non-engrafting hemangio cells are used to treat patients
in need of hematopoietic reconstitution or hematopoietic treatment.
Such patients in include, for example, patients with thalassemias,
sickle cell anemia, aplastic anemia (also called hypoplastic
anemia), cytopenia, marrow hypoplasia, platelet deficiency,
hematopoietic malignancies such as leukemias, paroxysmal nocturnal
hemoglobinuria (PNH), and ADA (e.g., deaminase (ADA)-deficient
severe combined immunodeficiency (SCID)).
[0262] Particular embodiments of the present invention therefore
relate to methods of treating a patient in need of hematopoietic
reconstitution or hematopoietic treatment using the hemangioblasts
of the invention. Accordingly, the invention relates to methods of
treating a patient in need of hematopoietic reconstitution or
treatment comprising selecting a patient in need thereof,
generating and expanding or expanding human hemangioblasts or
non-engrafting hemangio cells according to the methods of the
present invention, and administering the human hemangioblasts or
the non-engrafting hemangio cells into the patient. Alternatively,
the method may comprise differentiating the generated and expanded
or expanded human hemangioblasts or non-engrafting hemangio cells
into human hematopoietic cells and subsequently administering the
hematopoietic cells to the patient.
[0263] Alternative embodiments include methods in which human
hemangioblasts or non-engrafting hemangio cells are produced on a
large scale and stored prior to the selection of a patient in need
thereof. Thus, other embodiments of the invention relate to methods
of treating a patient in need of hematopoietic reconstitution or
treatment comprising selecting a patient in need thereof, placing
an order for human hemangioblasts or non-engrafting hemangio cells
already isolated and expanded according to the methods described
above, and administering said human hemangioblasts or
non-engrafting hemangio cells to the patient. Likewise, the method
may comprise differentiating said human hemangioblasts or
non-engrafting hemangio cells into human hematopoietic cells and
administering said hematopoietic cells to the patient. In
additional embodiments, hemangioblasts or non-engrafting hemangio
cells hemizygous or homozygous for at least one MHC allele are
grown, optionally grown to commercial quantities, and optionally
stored by a business entity. When a patient presents a need for
such cells, hemangioblast lineage cells or non-engrafting hemangio
lineage cells, a clinician or hospital will place an order with the
business for such cells.
[0264] Because the human hemangioblast cells and non-engrafting
hemangio cells of the invention will proliferate and differentiate
into endothelial cells under an angiogenic microenvironment, the
human hemangioblast cells may be used in a therapeutic manner to
provide new blood vessels or to induce repair of damaged blood
vessels at a site of injury in a patient. Thus in certain aspects,
the present invention relates to methods of promoting new blood
vessel growth or repairing injured vasculature. The human
hemangioblasts or non-engrafting hemangio cells of the present
invention may be used to treat endothelial injury, such as
myocardium infarction, stroke and ischemic brain, ischemic limbs
and skin wounds including ischemic limbs and wounds that occur in
diabetic animals or patients, and ischemic reperfusion injury in
the retina. Other ischemic conditions that may be treated with the
hemangioblasts or non-engrafting hemangio cells of the present
invention include renal ischemia, pulmonary ischemia, and ischemic
cardiomyopathy. Hemangioblasts may also be used to help repair
injured blood vessels following balloon angioplasty or deployment
of an endovascular stent. Hemangioblasts or non-engrafting hemangio
cells may additionally be used in tissue grafting, surgery and
following radiation injury. Further, the hemangioblasts or
non-engrafting hemangio cells may be used to treat and/or prevent
progression of atherosclerosis as well as to repair endothelial
cell damage that occurs in systemic sclerosis and Raynaud's
phenomenon (RP) (Blann et al., 1993 J Rheumatol. (20):1325-30).
[0265] Accordingly, the invention provides various methods involved
in providing blood vessel growth or repair to a patient in need
thereof. In one embodiment, the invention provides for a method for
inducing formation of new blood vessels in an ischemic tissue in a
patient in need thereof, comprising administering to said patient
an effective amount of the purified preparation of human
hemangioblast cells or non-engrafting hemangio cells described
above to induce new blood vessel formation in said ischemic tissue.
Thus certain aspects of the present invention provide a method of
enhancing blood vessel formation in a patient in need thereof,
comprising selecting the patient in need thereof, isolating human
hemangioblast cells or non-engrafting hemangio cells as described
above, and administering the hemangioblast cells or non-engrafting
hemangio cells to the patient. In yet another aspect, the present
invention provides a method for treating an injured blood vessel in
a patient in need thereof, comprising selecting the patient in need
thereof, expanding or generating and expanding human hemangioblast
cells or non-engrafting hemangio cells as described above, and
administering the hemangioblast cells or non-engrafting hemangio
cells to the patient. In addition to the aforementioned
embodiments, the hemangioblasts or non-engrafting hemangio cells
may be produced on a large scale and stored prior to the selection
of patient in need of hemangioblasts. In further embodiments,
hemangioblasts hemizygous or homozygous for at least one MHC allele
are grown, optionally grown to commercial quantities, and
optionally stored before a patient is selected for hemangioblast or
non-engrafting hemangio cell treatment. Any of the aforementioned
hemangioblasts, non-engrafting hemangio cells, or cell preparations
of these cells may be administered directly into the circulation
(intravenously). In certain embodiments (e.g., where vascular
repair is necessary in the eye, such as in the treatment of
ischemia/reperfusion injury to the retina), the hemangioblast
cells, non-engrafting hemangio cells, or cell preparations of these
cells may be administered by intra-vitreous injection.
[0266] Administration of the solutions or preparations of
hemangioblasts, non-engrafting hemangio cells, and derivative cells
thereof may be accomplished by any route and may be determined on a
case by case basis. Also, an effective amount to be administered of
these solutions or preparations of hemangioblasts or derivative
cells thereof is an amount that is therapeutically effective and
may be determined on a case by case basis.
[0267] In further aspects, hemangioblast lineage cells or
non-engrafting hemangio lineage cells are used in therapeutic
applications, including in the treatment of the indications
described above, for example. Accordingly, hemangioblasts or
non-engrafting hemangio cells generated and expanded or expanded by
the methods described herein are differentiated in vitro first to
obtain hematopoietic and/or endothelial cells, and then to obtain
cells that are further differentiated in these two lineages. These
cells may be subsequently administered to a subject or patient to
treat hematopoietic conditions or for hematopoietic reconstitution,
or for the treatment of ischemia or vascular injury, for
example.
[0268] HSCs derived from the human hemangioblasts or non-engrafting
hemangio cells obtained by the methods disclosed herein are grown
further to expand the HSCs and/or to derive other hematopoietic
lineage cell types. Certain aspects of the present invention relate
to the use of HSCs derived from the hemangioblasts or
non-engrafting hemangio cells in transplantation. In additional
embodiments, differentiated hematopoietic cells (such as, for
example, granulocytes, erythrocytes, myeloid cells, megakaryocytes,
platelets, macrophages, mast cells and neutrophils (Wiles and
Keller 1991 Development (111): 259)) are used in various treatments
such as transfusion therapy or for the treatment of infections.
Accordingly, other embodiments of the present invention relate to
methods of treating a patient in need of hematopoietic
reconstitution or treatment using the HSCs or hematopoietic lineage
cells derived from hemangioblasts of the invention.
[0269] In certain aspects, therefore, the present invention relates
to methods of treating a patient in need of hematopoietic cells or
treatment comprising selecting a patient in need thereof, expanding
or isolating and expanding human hemangioblasts or non-engrafting
hemangio cells according to the methods of the present invention,
differentiating said hemangioblast cells or non-engrafting hemangio
cells into hematopoietic stem cells and/or mature hematopoietic
cells, and administering the hematopoietic cells to the
patient.
[0270] In other aspects of the invention, the hemangioblasts or
non-engrafting hemangio cells are grown to give rise to endothelial
cells according to the methods disclosed herein. The endothelial
may subsequently be used to provide new blood vessels or to induce
repair of damaged blood vessels at a site of injury in a patient.
Thus in certain aspects, the present invention relates to methods
of promoting new blood vessel growth or repairing injured
vasculature in which endothelial cells derived from hemangioblasts
or non-engrafting hemangio cells are used as a therapy. The
endothelial cells may be used to treat endothelial injury, such as
myocardium infarction and pulmonary ischemia, stroke and ischemic
brain, ischemic limbs and skin wounds including ischemic limbs and
wounds that occur in diabetic animals or patients, ischemic
reperfusion injury in the retina, renal ischemia. The endothelial
cells may also be used to help repair injured blood vessels
following balloon angioplasty or deployment of an endovascular
stent as well as in grafting, surgery and following radiation
injury. Further, the endothelial cells may be used to treat and/or
prevent progression of atherosclerosis as well as to repair
endothelial cell damage that occurs in systemic sclerosis and
Raynaud's phenomenon.
[0271] The endothelial cell may be further differentiated and those
cells, as appropriate, may be used in treating one or more of the
"endothelial cell" disease or conditions, such as those listed in
the preceding paragraph.
[0272] Accordingly, certain aspects of the invention relate to
methods of treating a patient with endothelial or vascular injury
or in need of blood vessel growth or repair comprising selecting a
patient in need thereof, expanding or isolating and expanding human
hemangioblasts or non-engrafting hemangio cells according to the
methods of the present invention, differentiating said
hemangioblast cells or non-engrafting hemangio cells into
endothelial cells, and administering the endothelial cells to the
patient.
Blood Banking
[0273] Another aspect of the present invention provides methods of
producing hematopoietic cells suitable for transfusion. Although
such cells and methods have numerous uses, a particularly important
use would be in improving the availability of blood for
transfusions. In certain preferred embodiments, the invention
provides red blood cells differentiated from
hemangioblasts/hemangio-colony forming units or non-engrafting
hemangio cells. Such differentiated red blood cells could be used
for transfusions.
[0274] Further aspects of the invention relate to methods of
generating differentiated hematopoietic cells from
hemangioblasts/hemangio-colony forming units or non-engrafting
hemangio cells for use in blood transfusions for those in need
thereof. In certain embodiments, differentiated hematopoietic cells
are transfused to treat trauma, blood loss during surgery, blood
diseases such as anemia, Sickle cell anemia, or hemolytic diseases,
or malignant disease. In certain embodiments, red blood cells are
transfused to treat trauma, blood loss during surgery, or blood
diseases such as anemia, Sickle cell anemia, or hemolytic disease.
In certain embodiments, platelets are transfused to treat
congenital platelet disorders or malignant disease. In certain
embodiments, a mixed population of red blood cells and platelets
are transfused.
[0275] It should be noted that many differentiated hematopoietic
cell types, particularly red blood cells, typically exist in vivo
as a mixed population. Specifically, circulating red blood cells of
varying levels of age and differentiation are found in vivo.
Additionally, red blood cells mature over time so as to express
less fetal hemoglobulin and more adult hemoglobin. The present
invention contemplates transfusion of either purified populations
of red blood cells or of a mixed population of red blood cells
having varying levels of age and levels of differentiation. In
particular embodiments, the invention contemplates transfusion of
red blood cells expressing fetal hemoglobin (hemoglobin F).
[0276] This invention provides a method for producing
differentiated hematopoietic cells from human hemangio-colony
forming cells and non-engrafting hemangio cells in vitro, said
method comprising the steps of:
[0277] (a) providing human hemangio-colony forming cells or
non-engrafting hemangio cells; and
[0278] b) differentiating said hemangio-colony forming cells or
non-engrafting hemangio cells into differentiated hematopoietic
cells.
[0279] This invention also provides a method for performing blood
transfusions using hematopoietic cells that were differentiated in
vitro from human hemangio-colony forming cells or non-engrafting
hemangio cells, said method comprising the steps of:
[0280] (a) providing human hemangio-colony forming cells or
non-engrafting hemangio cells;
[0281] (b) differentiating said hemangio-colony forming cells or
non-engrafting hemangio cells into differentiated hematopoietic
cells; and
[0282] (c) performing blood transfusions with said differentiated
hematopoietic cells.
[0283] This invention also provides a method for performing blood
transfusions using hematopoietic cells that had been differentiated
in vitro from human hemangio-colony forming cells, said method
comprising the steps of:
[0284] (a) culturing a cell culture comprising human embryonic stem
cells in serum-free media in the presence of at least one growth
factor in an amount sufficient to induce the differentiation of
said embryonic stem cells into embryoid bodies;
[0285] (b) adding at least one growth factor to said culture
comprising embryoid bodies and continuing to culture said culture
in serum-free media, wherein said growth factor is in an amount
sufficient to expand human hemangio-colony forming cells or
non-engrafting hemangio cells in said embryoid bodies culture;
[0286] (c) differentiating said hemangio-colony forming cells or
non-engrafting hemangio cells into differentiated hematopoietic
cells; and
[0287] (d) performing blood transfusions with said differentiated
hematopoietic cells.
[0288] In certain embodiments, said stem cells, embryoid bodies and
hemangio-colony forming are grown in serum-free media throughout
steps (a) and (b) of said method.
[0289] This invention also provides a method for performing blood
transfusions using hematopoietic cells that had been differentiated
in vitro from human hemangio-colony forming cells, said method
comprising the steps of:
[0290] (a) culturing a cell culture comprising human pluripotent
stem cells in serum-free media in the presence of at least one
growth factor in an amount sufficient to induce the differentiation
of said pluripotent stem cells into embryoid bodies;
[0291] (b) adding at least one growth factor to said culture
comprising embryoid bodies and continuing to culture said culture
in serum-free media, wherein said growth factor is in an amount
sufficient to expand human hemangio-colony forming cells or
non-engrafting hemangio cells in said embryoid bodies culture;
[0292] (c) disaggregating said embryoid bodies into single
cells;
[0293] (d) adding at least one growth factor to said culture
comprising said single cells and continuing to culture said culture
in serum-free media, wherein said growth factor is in an amount
sufficient to expand human hemangio-colony forming cells or
non-engrafting hemangio cells in said culture comprising said
single cells;
[0294] (e) differentiating said hemangio-colony forming cells or
non-engrafting hemangio cells into differentiated hematopoietic
cells; and
[0295] (f) performing blood transfusions with said differentiated
hematopoietic cells.
[0296] In certain embodiments, said pluripotent stem cells,
embryoid bodies, hemangio-colony forming cells, non-engrafting
hemangio cells and single cells are grown in serum-free media
throughout steps (a)-(d) of said method.
[0297] In certain embodiments, the pluripotent stem cell is an
embryonic stem cell.
[0298] In certain embodiments, the growth factor is a protein that
comprises a homeobox protein, or a functional variant or an active
fragment thereof. In certain embodiments, the homeobox protein
comprises a HOXB4 protein, or a functional variant or an active
fragment thereof.
[0299] In certain embodiments, the differentiated hematopoietic
cells are produced as a single cell type such as red blood cells,
platelets, and phagocytes. Note, however, that when a single cell
type is produced, the cell type may be heterogeneous in terms of
the level of maturity or differentiation of the particular cell
type. By way of example, differentiated red blood cells may be
heterogeneous in terms of level of maturity and cellular age.
Without being bound by theory, such heterogeneity of erythrocytic
cells may be beneficial because it mimics the way in which red
blood cells are found in vivo.
[0300] In certain embodiments, the single cell types are mixed to
equal the proportion of differentiated cell types that is found in
blood. In certain embodiments, multiple differentiated
hematopoietic cell types are produced in the same step. In certain
embodiments, the phagocyte is selected from: granulocytes,
neutrophils, basophils, eosinophils, lymphocytes or monocytes. In
certain embodiments, the hematopoietic cell types are produced in a
proportion approximately equal to the proportion of differentiated
hematopoietic cell types found in blood, 96% red blood cells, 1%
platelets, and 3% phagocytes. In certain embodiments, plasma is
added to the differentiated hematopoietic cells before transfusion.
In certain embodiments, packed cells, for example packed red blood
cells, are transfused in the absence or substantial absence of
plasma.
[0301] In certain embodiments, the differentiated hematopoietic
cells produced from the methods of the application are functional.
In certain embodiments, the platelets produced from the methods of
the application are functional. In certain embodiments, the
phagocytes produced from the methods of the application are
functional. In certain embodiments, the red blood cells produced
from the methods of the application are functional. In certain
embodiments, the red blood cells express hemoglobin F prior to
transfusion. In certain embodiments, the red blood cells carry
oxygen. In certain embodiments, the red blood cells have a lifespan
equal to naturally derived red blood cells. In certain embodiments,
the red blood cells have a lifespan that is 75% of that of
naturally derived red blood cells. In certain embodiments, the red
blood cells have a lifespan that is 50% of that of naturally
derived red blood cells. In certain embodiments, the red blood
cells have a lifespan that is 25% of that of naturally derived red
blood cells.
[0302] In certain embodiments, the methods of the application
produce 1.times.10.sup.6 cells per 100 mm dish. In certain
embodiments, 2.times.10.sup.6 cells are produced per 100 mm dish.
In certain embodiments, 3.times.10.sup.6 cells are produced per 100
mm dish. In certain embodiments, 4.times.10.sup.6 cells are
produced per 100 mm dish. In certain embodiments, 5.times.10.sup.6
cells are produced per 100 mm dish. In certain embodiments,
6.times.10.sup.6 cells are produced per 100 mm dish. In certain
embodiments, 7.times.10.sup.6 cells are produced per 100 mm dish.
In certain embodiments, 8.times.10.sup.6 cells are produced per 100
mm dish. In certain embodiments, 9.times.10.sup.6 cells are
produced per 100 mm dish. In certain embodiments, 1.times.10.sup.7
cells are produced per 100 mm dish. In certain embodiments,
5.times.10.sup.7 cells are produced per 100 mm dish. In certain
embodiments, 1.times.10.sup.8 cells are produced per 100 mm
dish.
[0303] In certain embodiments, the differentiation step is
performed using conditions known to one of skill in the art as
discussed above. In certain embodiments, the differentiation step
is performed using methods specific to differentiate cells into red
blood cells (see WO20051118780, herein incorporated by reference).
In certain embodiments, the differentiation step is performed using
methods specific to differentiate cells into platelets. In certain
embodiments, the differentiation step is performed using methods
specific to differentiate cells into leukocytes.
[0304] Differentiation agents which can be used according to the
present invention include cytokines such as interferon-alpha A,
interferon-alpha A/D, interferon-.beta., interferon-gamma,
interferon-gamma-inducible protein-10, interleukin-1,
interleukin-2, interleukin-3, interleukin-4, interleukin-5,
interleukin-6, interleukin-7, interleukin-8, interleukin-9,
interleukin-10, interleukin-1, interleukin-12, interleukin-13,
interleukin-15, interleukin-17, keratinocyte growth factor, leptin,
leukemia inhibitory factor, macrophage colony-stimulating factor,
and macrophage inflammatory protein-1 alpha.
[0305] Differentiation agents according to the invention also
include growth factors such as 6Ckine (recombinant), activin A,
AlphaA-interferon, alpha-interferon, amphiregulin, angiogenin,
B-endothelial cell growth factor, beta cellulin, B-interferon,
brain derived neurotrophic factor, Cl0 (recombinant),
cardiotrophin-1, ciliary neurotrophic factor, cytokine-induced
neutrophil chemoattractant-1, endothelial cell growth supplement,
eotaxin, epidermal growth factor, epithelial neutrophil activating
peptide-78, erythropoietin, estrogen receptor-alpha, estrogen
receptor-B, fibroblast growth factor (acidic/basic, heparin
stabilized, recombinant), FLT-3/FLK-2 ligand (FLT-3 ligand),
gamma-interferon, glial cell line-derived neurotrophic factor,
Gly-His-Lys, granulocyte colony-stimulating factor, granulocyte
macrophage colony-stimulating factor, GRO-alpha/MGSA, GRO-B,
GRO-gamma, HCC-1, heparin-binding epidermal growth factor like
growth factor, hepatocyte growth factor, heregulin-alpha (EGF
domain), insulin growth factor binding protein-1, insulin-like
growth factor binding protein-1/IGF-1 complex, insulin-like growth
factor, insulin-like growth factor II, 2.5S nerve growth factor
(NGF), 7S-NGF, macrophage inflammatory protein-1B, macrophage
inflammatory protein-2, macrophage inflammatory protein-3 alpha,
macrophage inflammatory protein-3B, monocyte chemotactic protein-1,
monocyte chemotactic protein-2, monocyte chemotactic protein-3,
neurotrophin-3, neurotrophin-4, NGF-B (human or rat recombinant),
oncostatin M (human or mouse recombinant), pituitary extract,
placenta growth factor, platelet-derived endothelial cell growth
factor, platelet-derived growth factor, pleiotrophin, rantes, stem
cell factor, stromal cell-derived factor 1B/pre-B cell growth
stimulating factor, thrombopoetin, transforming growth factor
alpha, transforming growth factor-B1, transforming growth
factor-B2, transforming growth factor-B3, transforming
growth-factor-B5, tumor necrosis factor (alpha and B), and vascular
endothelial growth factor.
[0306] Differentiation agents according to the invention also
include hormones and hormone antagonists, such as 17B-estradiol,
adrenocorticotropic hormone, adrenomedullin, alpha-melanocyte
stimulating hormone, chorionic gonadotropin, corticosteroid-binding
globulin, corticosterone, dexamethasone, estriol, follicle
stimulating hormone, gastrin 1, glucagon, gonadotropin,
hydrocortisone, insulin, insulin-like growth factor binding
protein, L-3,3',5'-triiodothyronine, L-3,3',5-triiodothyronine,
leptin, leutinizing hormone, L-thyroxine, melatonin, MZ-4,
oxytocin, parathyroid hormone, PEC-60, pituitary growth hormone,
progesterone, prolactin, secretin, sex hormone binding globulin,
thyroid stimulating hormone, thyrotropin releasing factor,
thyroxine-binding globulin, and vasopressin.
[0307] In addition, differentiation agents according to the
invention include extracellular matrix components such as
fibronectin, proteolytic fragments of fibronectin, laminin,
thrombospondin, aggrecan, and syndezan.
[0308] Differentiation agents according to the invention also
include antibodies to various factors, such as anti-low density
lipoprotein receptor antibody, anti-progesterone receptor, internal
antibody, anti-alpha interferon receptor chain 2 antibody, anti-c-c
chemokine receptor 1 antibody, anti-CD 118 antibody, anti-CD 119
antibody, anti-colony stimulating factor-1 antibody, anti-CSF-1
receptor/c-fins antibody, anti-epidermal growth factor (AB-3)
antibody, anti-epidermal growth factor receptor antibody,
anti-epidermal growth factor receptor, phospho-specific antibody,
anti-epidermal growth factor (AB-1) antibody, anti-erythropoietin
receptor antibody, anti-estrogen receptor antibody, anti-estrogen
receptor, C-terminal antibody, anti-estrogen receptor-B antibody,
anti-fibroblast growth factor receptor antibody, anti-fibroblast
growth factor, basic antibody, anti-gamma-interferon receptor chain
antibody, anti-gamma-interferon human recombinant antibody,
anti-GFR alpha-1 C-terminal antibody, anti-GFR alpha-2 C-terminal
antibody, anti-granulocyte colony-stimulating factor (AB-1)
antibody, anti-granulocyte colony-stimulating factor receptor
antibody, anti-insulin receptor antibody, anti-insulin-like growth
factor-1 receptor antibody, anti-interleukin-6 human recombinant
antibody, anti-interleukin-1 human recombinant antibody,
anti-interleukin-2 human recombinant antibody, anti-leptin mouse
recombinant antibody, anti-nerve growth factor receptor antibody,
anti-p60, chicken antibody, anti-parathyroid hormone-like protein
antibody, anti-platelet-derived growth factor receptor antibody,
anti-platelet-derived growth factor receptor-B antibody,
anti-platelet-derived growth factor-alpha antibody,
anti-progesterone receptor antibody, anti-retinoic acid
receptor-alpha antibody, anti-thyroid hormone nuclear receptor
antibody, anti-thyroid hormone nuclear receptor-alpha 1/Bi
antibody, anti-transferrin receptor/CD71 antibody,
anti-transforming growth factor-alpha antibody, anti-transforming
growth factor-B3 antibody, anti-tumor necrosis factor-alpha
antibody, and anti-vascular endothelial growth factor antibody.
[0309] This invention also provides a library of differentiated
hematopoietic cells that can provide matched cells to potential
patient recipients as described above. In certain embodiments, the
cells are stored frozen. Accordingly, in one embodiment, the
invention provides a method of conducting a pharmaceutical
business, comprising the step of providing differentiated
hematopoietic cell preparations that are homozygous for at least
one histocompatibility antigen, wherein cells are chosen from a
bank of such cells comprising a library of human hemangio-colony
forming cells or non-engrafting hemangio cells that can be expanded
by the methods disclosed herein, wherein each hemangio-colony
forming cell or non-engrafting hemangio cells preparation is
hemizygous or homozygous for at least one MHC allele present in the
human population, and wherein said bank of hemangio-colony forming
cells or non-engrafting hemangio cells comprises cells that are
each hemizygous or homozygous for a different set of MHC alleles
relative to the other members in the bank of cells. As mentioned
above, gene targeting or loss of heterozygosity may be used to
generate the hemizygous or homozygous MHC allele stem cells used to
derive the hemangio-colony forming cells or non-engrafting hemangio
cells. In certain embodiments, hemangio-colony forming cells or
non-engrafting hemangio cells of all blood types are included in
the bank. In certain embodiments, hemangio-colony forming cells or
non-engrafting hemangio cells are matched to a patient to ensure
that differentiated hematopoietic cells of the patient's own blood
type are produced. In certain embodiments, hemangio-colony forming
cells or non-engrafting hemangio cells are negative for antigenic
factors A, B, Rh, or any combination thereof. In certain
embodiments, the differentiated hematopoietic cells are universal
donor cells. By way of example, hematopoietic cells that are type O
and Rh negative can be universally used for blood transfusion. In
certain embodiments, the invention provides methods for producing
type O, Rh negative red blood cells for universal transfusion.
[0310] In certain embodiments, red blood cells differentiated from
hemangio-colony forming cells or non-engrafting hemangio cells
express fetal hemoglobin. Transfusion of red blood cells that
express fetal hemoglobin may be especially useful in the treatment
of Sickle cell anemia. As such, the present invention provides
improved methods for treating Sickle cell anemia.
[0311] In one embodiment, after a particular hemangio-colony
forming cell preparation or a non-engrafting hemangio cell
preparation is chosen to be suitable for a patient, it is
thereafter expanded to reach appropriate quantities for patient
treatment and differentiated to obtain differentiated hematopoietic
cells prior to administering cells to the recipient. Methods of
conducting a pharmaceutical business may also comprise establishing
a distribution system for distributing the preparation for sale or
may include establishing a sales group for marketing the
pharmaceutical preparation.
[0312] In any of the foregoing, hemangio-colony forming cells or
non-engrafting hemangio cells can be directly differentiated or
hemangio-colony forming cells or non-engrafting hemangio cells can
be frozen for later use. In certain embodiments, the invention
provides a frozen culture of hemangio-colony forming cells or
non-engrafting hemangio cells suitable for later thawing and
expansion, and also suitable for differentiation to hematopoietic
or endothelial lineages.
[0313] Human hemangio-colony forming cells or non-engrafting
hemangio cells can be used to generate substantial numbers of
hematopoietic cell types that can be used in blood transfusions.
For examples, substantial numbers of homogeneous or heterogeneous
populations RBCs and/or platelets can be generated from human
hemangio-colony forming cells. Hemangio-colony forming cells,
non-engrafting hemangio cells and hematopoietic cell types
differentiated therefrom can be banked, as is currently done with
donated blood products, and used in transfusions and other
treatments. Banking of these products will help alleviate the
critical shortage of donated blood products. Additionally,
hemangio-colony forming cells, non-engrafting hemangio cells and
derivative products can be genetically manipulated in vitro to
provide universal donor blood products.
[0314] As such, in certain aspects the invention provides a method
of conducting a blood banking business. The subject banking
business involves the derivation and storage (long or short term)
of hemangio-colony forming cells, non-engrafting hemangio cells
and/or hematopoietic cell types (e.g., RBCs, platelets,
lymphocytes, etc.) generated therefrom. Cells can be cryopreserved
for long term storage, or maintained in culture for relatively
short term storage. Cells can be typed and cross-matched in much
the same way the currently available blood products are typed, and
the cells can be stored based on type. Additionally and in certain
embodiments, cells can be modified to specifically generate cells
that are A negative and/or B negative and/or Rh negative to produce
cells that are universally or nearly universally suitable for
transfusion into any patient.
[0315] Note that hemangio-colony forming cells, non-engrafting
hemangio cells and/or differentiated hematopoietic cell types can
be generated using any of the methods of the invention detailed
through the specification.
[0316] In certain embodiments of a method of conducting a blood
banking business, the cells (hemangio-colony forming cells,
non-engrafting hemangio cells and/or differentiated hematopoietic
cell types) are generated and stored at one or more central
facilities. Cells can then be transferred to, for example,
hospitals or treatment facilities for use in patient care. In
certain other embodiments, cells are maintained in a cryopreserved
state and specifically thawed and prepared for transfusion based on
orders from hospitals or other treatment facilities. Such orders
may be a standing order (e.g., generate and provide a certain
quantity of cells of a certain number of units
[0317] In certain embodiments, the method includes a system for
billing hospitals or insurance companies for the costs associated
with the banked products.
[0318] In certain embodiments of any of the foregoing, the cells
can be allocated based on cell number, volume, or any unit that
permits the user to quantify the dose being administered to
patients and/or to compare these doses to that administered during
a standard blood transfusion.
[0319] In certain embodiments, the cells are generated, stored, and
administered as a mixed population of cells. For example, the
preparation may include cells of varying developmental stages, as
well as distinct cell types. In other embodiments, the cells are
generated, stored, and/or administered as a substantially purified
preparation of a single cell type.
[0320] In certain embodiments, the preparations of cells are
screened for one or more infectious diseases. Screening may occur
prior to or subsequent to generation or storage. For example, the
preparations of cells may be screened to identify hepatitis, HIV,
or other blood-borne infectious disease that could be transmitted
to recipients of these products.
Induction of Tolerance in Graft Recipients
[0321] The human hemangioblast cells generated and expanded by the
methods of this invention, or expanded by the methods of this
invention, may be used to induce immunological tolerance.
Immunological tolerance refers to the inhibition of a graft
recipient's immune response which would otherwise occur, e.g., in
response to the introduction of a nonself MHC antigen (e.g., an
antigen shared with the graft and the tolerizing hemangioblasts)
into the recipient. Thus, tolerance refers to inhibition of the
immune response induced by a specific donor antigen as opposed to
the broad spectrum immune inhibition that may be elicited using
immunosuppressants. Tolerance may involve humoral, cellular, or
both humoral and cellular responses. Tolerance may include the
elimination and/or inactivation of preexisting mature
donor-reactive T cells as well as long-term (e.g. lifelong)
elimination and/or inactivation of newly developing donor-reactive
T cells.
[0322] The methods described in the present invention of generating
and expanding human hemangioblasts offer several advantages for
inducing tolerance. The methods of the present invention result in
the generation of large, previously unobtainable numbers of human
hemangioblasts. Large numbers of human hemangioblasts allow
induction of tolerance in graft recipients with less toxic
preconditioning protocols. Furthermore, the methods of the present
invention provide for the generation of a library of human
hemangioblasts, each of which is hemizygous or homozygous for at
least one MHC allele present in the human population, wherein each
member of said library of hemangioblast cells is hemizygous or
homozygous for a different set of MHC alleles relative to the other
members in the library. Such a library of human hemangioblasts can
be used in the selection of tolerizing human hemangioblast cells
such that cells can be selected to match any available donor
graft.
[0323] Bone marrow transplantation and subsequent establishment of
hematopoietic or mixed chimerism have previously been shown to
induce specific tolerance to new tissue types derived from
hematopoietic stem cells in both murine and human models.
Hematopoietic or mixed chimerism refers to the production in a
recipient of hematopoietic cells derived from both donor and
recipient stem cells. Hence, if a recipient achieves hematopoietic
chimerism, the recipient will be tolerant to donor-specific
antigens. In many protocols for inducing tolerance, the tolerizing
donor cells that are administered to the recipient engraft into the
bone marrow of the recipient. To create hematopoietic space in the
recipient bone marrow for the donor cells, some protocols require a
step of creating hematopoietic space (e.g., by whole body
irradiation), and such a step is typically toxic or harmful to the
recipient. However, if very large numbers of donor tolerizing cells
are available, there is evidence from rodent models that
irradiation can be completely eliminated, thereby achieving
hematopoietic or mixed chimerism with the advantage of less toxic
pre-conditioning regimens. Thus, mixed chimerism can be achieved,
for example, with specific, non-myeloablative recipient
conditioning.
[0324] Accordingly, as the novel methods described herein enable
the production of large numbers of human hemangioblast cells, the
present invention offers the advantage of inducing immune tolerance
with less rigorous or less toxic conditioning protocols. For
example, the hematopoietic space-creating step may be eliminated if
a sufficient number of tolerizing donor cells are used.
[0325] Accordingly, in certain embodiments of the present
invention, human hemangioblast cells generated and expanded or
expanded by the methods described herein may be used to induce
immunological tolerance. While not wishing to be bound by any
theory on the mechanism, the human hemangioblast cells may induce
immunological tolerance by homing to the recipient's bone marrow
and engrafting into the recipient's bone marrow in order to produce
mixed chimerism.
[0326] In certain embodiments, donor human hemangioblast cells are
administered to a recipient patient (e.g., by intravenous
injection) prior to implanting a graft or transplanting an organ,
tissue, or cells from the donor into the recipient patient. In
certain embodiments, human hemangioblasts are administered to
induce tolerance in patients in need thereof (e.g., graft or
transplant recipients). Accordingly, in certain embodiments the
method of inducing tolerance in a human recipient patient comprises
the steps of: (a) selecting a patient in need of a transplant or
cellular therapy; (b) administering to said patient human
hemangioblast cells derived from a donor or that are matched to the
donor, wherein said hemangioblast cells are generated and expanded
or expanded according to the methods of this invention, and (c)
implanting a donor organ, tissue, or cell graft into the recipient
patient, wherein said hemangioblast cells induce tolerance to donor
antigens. In certain embodiments, the patient will receive an
organ, tissue, or cell therapy, wherein the organ, tissue, or cells
are obtained from the donor or a donor cell source. For example,
hemangioblast cells from a donor can be (1) expanded according to
the methods described herein to generate a large number of donor
tolerizing cells, and (2) expanded and differentiated in vitro to
obtain hematopoietic or endothelial cells or tissues, which can be
subsequently implanted into the recipient patient. In other
embodiments, the organ, tissue, or cell therapy is not derived from
donor hemangioblast cells but is matched to the donor
hemangioblasts.
[0327] As used herein, the term "matched" relates to how similar
the HLA typing is between the donor and the recipient (e.g.,
graft). In one embodiment, the term "matched" with respect to donor
hemangioblast cells and graft refers to a degree of match t the MHC
class I and/or at the MHC class II alleles such that rejection does
not occur. In another embodiment, the term "matched" with respect
to donor hemangioblasts and graft refers to a degree of match at
the MHC class I and/or at the MHC class II alleles such that the
donor graft is tolerized by its matching donor hemangioblast cells.
In another embodiment, the term "matched" with respect to donor
hemangioblast and graft refers to a degree of match at the MHC
class I and/or at the MHC class II alleles such that
immunosuppression is not required.
[0328] The methods described herein for inducing tolerance to an
allogeneic antigen or allogeneic graft may be used where, as
between the donor and recipient, there is degree of mismatch at MHC
loci or other loci, such that graft rejection results. Accordingly,
for example, in certain embodiments, there may be a mismatch at
least one MHC locus or at least one other locus that mediates
recognition and rejection, e.g., a minor antigen locus. In some
embodiments, for example, the HLA alleles of the recipient and
donor are mismatched and result in one or more mismatched antigens.
With respect to class I and class II MHC loci, the donor and
recipient may be, for example: matched at class I and mismatched at
class II; mismatched at class I and matched at class II; mismatched
at class I and mismatched at class II; matched at class I, matched
at class II. In any of these combinations other loci which control
recognition and rejection, e.g., minor antigen loci, may be matched
or mismatched. Mismatched at MHC class I means mismatched for one
or more MHC class I loci, e.g., mismatched at one or more of HLA-A,
HLA-B, or HLA-C. Mismatched at MHC class II means mismatched at one
or more MHC class II loci, e.g., mismatched at one or more of a
DPA, a DPB, a DQA, a DQB, a DRA, or a DRB. For example, the
hemangioblasts and the graft may be matched at class II HLA-DRB1
and DQB1 alleles. The hemangioblasts and graft may further be
matched at two or more class I HLA-A, B, or C, alleles (in addition
to having matched DRB1 and DQB1 alleles).
[0329] In other embodiments, the tolerizing donor cells are cells
derived from the hemangioblasts generated and expanded or expanded
by the methods described herein. According to this embodiment,
donor human hemangioblasts are differentiated in vitro to give rise
to donor hematopoietic stem cells, and the donor hematopoietic stem
cells are then administered to the recipient patient to induce
tolerance. In any of the above methods, the donor hemangioblasts or
hematopoietic stem cells derived therefrom and administered to said
recipient prepare the recipient patient for the matched (with
respect to the donor tolerizing cells) transplant or graft by
inducing tolerance in said recipient.
[0330] In other embodiments, the method of inducing tolerance
further comprises the step(s) of creating hematopoietic space (to
promote engraftment of hemangioblasts or hematopoietic stem cells
derived therefrom). In another embodiment, the method of inducing
tolerance further comprises the step(s) of temporarily inhibiting
rejection of donor hemangioblast cells or hematopoietic stem cells
derived therefrom by, for example, eliminating and/or inactivating
preexisting donor-reactive T cells. In order to create
hematopoietic space, the method may include irradiation (e.g.,
whole body, lymphoid, or selective thymic irradiation). To prevent
rejection of donor cells, the method may further comprise the
administration of drugs or antibodies (e.g., inhibitors of cell
proliferation, anti-metabolites, or anti-T cell or anti-CD8 or
anti-CD4 antibodies), and/or other treatments that promote survival
and engraftment of the donor cells and the formation of mixed
chimerism (e.g., the administration of stromal cells or growth
factors, cytokines, etc. to said recipient, or other agents that
deplete or inactive the recipient's natural antibodies). In certain
embodiments, the irradiation, antibodies, drugs, and/or other
agents administered to create hematopoietic space and/or promote
survival of donor cells in the recipient, is sufficient to
inactivate thymocytes and/or T cells in the recipient. Such a step
of creating hematopoietic space and/or temporarily inhibiting
rejection of donor cells may be performed, for example, before the
introduction of the donor hemangioblast cells to said recipient.
Alternatively, the patient may receive an agent or method for
blocking, eliminating, or inactivating T cells concurrently with
the administration of the donor tolerizing cells.
[0331] In certain embodiments, a combination of hematopoietic
space-creating and immunosuppressive methods is used. For example,
a recipient may receive an anti-T cell antibody in combination with
low dose whole body irradiation and/or thymic irradiation. In one
embodiment, the recipient may receive anti-CD4 and anti-CD8
antibodies, followed by a mild, nonmyeloablative dose of whole body
irradiation (e.g., a dose that eliminates a fraction of the
recipient's bone marrow without rendering the bone marrow
unrecoverable) and selective thymic irradiation or alternatively,
an additional dose of T cell-inactivating antibodies or
costimulatory blocking reagents (e.g., CTLA4-Ig and/or anti-CD40L
antibody). Following the irradiation, donor hemangioblast cells, or
hematopoietic stem cells derived therefrom, may be administered to
the recipient (e.g., by intravenous injection). In this embodiment,
whole body irradiation to promote engraftment of donor cells may be
replaced by administering a large number of donor human
hemangioblasts or hematopoietic stem cells derived therefrom.
Obtaining such large numbers of donor human cells can be achieved
according to the methods described herein.
[0332] In another embodiment, treatments to deplete or inactivate
recipient T cells may help to prevent inhibition of engraftment or
promote survival of the administered donor tolerizing human
hemangioblast cells. In another embodiment, the method may include
clonal deletion of donor-reactive cells in the recipient patient.
For example, a patient may receive a mild dose of whole body
irradiation, followed by administration of donor human
hemangioblasts and T cell costimulatory blockade. Alternatively, a
patient may receive T cell costimulatory blockade and
administration of large numbers of donor human hemangioblast cells
without receiving irradiation.
[0333] In another embodiment, tolerance may be achieved without
myeloablative conditioning of the recipient. In one embodiment, a
recipient may receive donor human hemangioblasts in combination
with anti-CD40L to facilitate engraftment of donor hemangioblasts.
For example, a recipient may receive large numbers of donor
hemangioblasts, along with anti-CD40L monoclonal antibody, followed
within a few days by a dose of CTLA4-Ig. Such a protocol may delete
donor-reactive T cells and block the CD40-CD40L interaction. The
novel methods described herein for generating and expanding human
hemangioblasts in vitro render such a mild tolerance protocol
feasible.
[0334] Following recipient conditioning and/or depletion or
blocking of donor-reactive T cells, donor tolerizing human
hemangioblasts generated by the methods of the present invention
are administered to the recipient. Donor human hemangioblasts may
be derived from hemangioblasts obtained from a tissue or cell
source from the donor. Alternatively, donor human hemangioblasts
may be obtained from a different non-donor source that is matched
to the donor.
[0335] In certain embodiments, tolerance is induced in a recipient
patient by administering donor human hemangioblasts in multiple
administrations (e.g., by two, three, four, or more administrations
of the donor cells). Accordingly, tolerance may be induced by a
method comprising multiple administrations of donor tolerizing
cells, wherein the multiple administrations are given to the
recipient within a timeframe of a week or less.
[0336] In certain embodiments, the ability of the human
hemangioblast cells of this invention to induce immunological
tolerance may be evaluated using different experimental model
systems. For example, the ability to establish a human immune
system in a SCID mouse has been used to study the human immune
response in an experimental model. It has been previously shown
that human fetal liver and thymus tissue may be used to
reconstitute a functional human immune system in an
immuno-incompetent mouse recipient. Similarly, the functional
capacity of the human hemangioblast cells of this invention can be
assessed using a similar experimental model system. For example,
the ability of human hemangioblasts to replace human fetal liver in
establishing a functional human immune system in the mouse can be
evaluated using the above-described experimental model. Further, in
a mouse with a functional human immune system (e.g., where a human
fetal liver and thymus tissue is used to establish a human immune
system in a SCID mouse to produce a hu-SCID mouse), human "donor"
hemangioblasts (mismatched with respect to the fetal liver and
thymic tissue used to establish the hu-SCID mouse) may be
administered to the hu-SCID mouse, according to any of the methods
described above, in order to achieve mixed chimerism. Tolerance to
donor antigen can be subsequently tested upon implantation of an
allograft matched with respect to the donor hemangioblasts into
these animals.
[0337] In certain embodiments, the present invention relates to
cell combinations. Effective cell combinations comprise two
components: a first cell type to induce immunological tolerance,
and a second cell type that regenerates the needed function. Both
cell types may be produced by the methods of the present invention
and obtained from the same donor. For example, human hemangioblast
cells from a donor may be used as the tolerizing donor cells. Cells
from the donor (e.g., embryonic stem cells, pluripotent stem cells
or early progenitor cells, or hemangioblasts) may also be used to
generate, for example, hematopoietic cells or endothelial cells (as
described herein), neural cells such as oligodendrocytes,
hepatocytes, cardiomyocytes or cardiomyocyte precursors, or
osteoblasts and their progenitors. Accordingly, the donor human
hemangioblasts may be used to induce tolerance in a recipient such
that the recipient is tolerant to cells or tissues derived from
said donor hemangioblast cells or from said donor embryonic or
pluripotent stem cells.
[0338] In another embodiment, the two cell components of the cell
combinations of the present invention may be obtained from
different sources or donors, wherein the two sources or donors are
matched. For example, hemangioblasts may be generated from an
embryonic stem cell source, whereas the graft cells or tissues may
be obtained from a source that is different from the embryonic stem
cell source used to generate the human hemangioblasts. In such
embodiments, the two sources are matched.
[0339] For any of the therapeutic purposes described herein, human
hemangioblast or hematopoietic cells derived therefrom for
immunotolerance may be supplied in the form of a pharmaceutical
composition, comprising an isotonic excipient prepared under
sufficiently sterile conditions for human administration.
Hemangioblasts in Gene Therapy
[0340] Other aspects of the invention relate to the use of
hemangioblast cells, non-engrafting hemangio cells, or
hematopoietic or endothelial cells differentiated therefrom, or in
turn cells further differentiated from these cells, in gene
therapy. The preparation of mammalian hemangioblast cells or
non-engrafting hemangio cells of the invention may be used to
deliver a therapeutic gene to a patient that has a condition that
is amenable to treatment by the gene product of the therapeutic
gene. The hemangioblasts and non-engrafting hemangio cells are
particularly useful to deliver therapeutic genes that are involved
in or influence angiogenesis (e.g. VEGF to induce formation of
collaterals in ischemic tissue), hematopoiesis (e.g. erythropoietin
to induce red cell production), blood vessel function (e.g. growth
factors to induce proliferation of vascular smooth muscles to
repair aneurysm) or blood cell function (e.g. clotting factors to
reduce bleeding) or code for secreted proteins e.g. growth hormone.
Methods for gene therapy are known in the art. See for example,
U.S. Pat. No. 5,399,346 by Anderson et al. A biocompatible capsule
for delivering genetic material is described in PCT Publication WO
95/05452 by Baetge et al. Methods of gene transfer into bone-marrow
derived cells have also previously been reported (see U.S. Pat. No.
6,410,015 by Gordon et al.). The therapeutic gene can be any gene
having clinical usefulness, such as a gene encoding a gene product
or protein that is involved in disease prevention or treatment, or
a gene having a cell regulatory effect that is involved in disease
prevention or treatment. The gene products may substitute a
defective or missing gene product, protein, or cell regulatory
effect in the patient, thereby enabling prevention or treatment of
a disease or condition in the patient.
[0341] Accordingly, the invention further provides a method of
delivering a therapeutic gene to a patient having a condition
amenable to gene therapy comprising, selecting the patient in need
thereof, modifying the preparation of hemangioblasts or
non-engrafting hemangio cells so that the cells carry a therapeutic
gene, and administering the modified preparation to the patient.
The preparation may be modified by techniques that are generally
known in the art. The modification may involve inserting a DNA or
RNA segment encoding a gene product into the mammalian
hemangioblast cells, where the gene enhances the therapeutic
effects of the hemangioblast cells or the non-engrafting hemangio
cells. The genes are inserted in such a manner that the modified
hemangioblast cell will produce the therapeutic gene product or
have the desired therapeutic effect in the patient's body. In one
embodiment, the hemangioblasts or non-engrafting hemangio cells are
prepared from a cell source originally acquired from the patient,
such as bone marrow. The gene may be inserted into the
hemangioblast cells or non-engrafting hemangio cells using any gene
transfer procedure, for example, naked DNA incorporation, direct
injection of DNA, receptor-mediated DNA uptake, retroviral-mediated
transfection, viral-mediated transfection, non-viral transfection,
lipid-mediated transfection, electrotransfer, electroporation,
calcium phosphate-mediated transfection, microinjection or
proteoliposomes, all of which may involve the use of gene therapy
vectors. Other vectors can be used besides retroviral vectors,
including those derived from DNA viruses and other RNA viruses. As
should be apparent when using an RNA virus, such virus includes RNA
that encodes the desired agent so that the hemangioblast cells that
are transfected with such RNA virus are therefore provided with DNA
encoding a therapeutic gene product. Methods for accomplishing
introduction of genes into cells are well known in the art (see,
for example, Ausubel, id.).
[0342] In accordance with another aspect of the invention, a
purified preparation of human hemangioblast cells or non-engrafting
hemangio cells, in which the cells have been modified to carry a
therapeutic gene, may be provided in containers or commercial
packages that further comprise instructions for use of the
preparation in gene therapy to prevent and/or treat a disease by
delivery of the therapeutic gene. Accordingly, the invention
further provides a commercial package (i.e., a kit) comprising a
preparation of mammalian hemangioblast cells or non-engrafting
hemangio cells of the invention, wherein the preparation has been
modified so that the cells of the preparation carry a therapeutic
gene, and instructions for treating a patient having a condition
amenable to treatment with gene therapy.
Other Commercial Applications and Methods
[0343] Certain aspects of the present invention pertain to the
expansion of human hemangioblasts and non-engrafting hemangio cells
to reach commercial quantities. In particular embodiments, human
hemangioblasts and non-engrafting hemangio cells are produced on a
large scale, stored if necessary, and supplied to hospitals,
clinicians or other healthcare facilities. Once a patient presents
with an indication such as, for example, ischemia or vascular
injury, or is in need of hematopoietic reconstitution, human
hemangioblasts or non-engrafting hemangio cells can be ordered and
provided in a timely manner. Accordingly, the present invention
relates to methods of generating and expanding human hemangioblasts
and non-engrafting hemangio cells to attain cells on a commercial
scale, cell preparations comprising human hemangioblasts or
non-engrafting hemangio cells derived from said methods, as well as
methods of providing (i.e., producing, optionally storing, and
selling) human hemangioblasts or non-engrafting hemangio cells to
hospitals and clinicians. Further, hemangioblast lineage cells or
non-engrafting hemangio lineage cells may be produced in vitro and
optionally stored and sold to hospitals and clinicians.
[0344] Accordingly certain aspects of the present invention relate
to methods of production, storage, and distribution of
hemangioblasts or non-engrafting hemangio cells expanded by the
methods disclosed herein. Following human hemangioblast or
non-engrafting hemangio cells generation and expansion in vitro,
human hemangioblasts or non-engrafting hemangio cells may be
harvested, purified and optionally stored prior to a patient's
treatment. Alternatively, in situations in which hemangioblast or
non-engrafting hemangio lineage cells are desired, human
hemangioblasts or non-engrafting hemangio cells may be
differentiated further in vitro prior to a patient's treatment.
Thus, in particular embodiments, the present invention provides
methods of supplying hemangioblasts or non-engrafting hemangio
cells to hospitals, healthcare centers, and clinicians, whereby
hemangioblasts, non-engrafting hemangio cells, hemangioblast
lineage cells, or non-engrafting hemangio lineage cells produced by
the methods disclosed herein are stored, ordered on demand by a
hospital, healthcare center, or clinician, and administered to a
patient in need of hemangioblast, non-engrafting hemangio cells,
hemangioblast lineage, or non-engrafting hemangio lineage therapy.
In alternative embodiments, a hospital, healthcare center, or
clinician orders human hemangioblasts or non-engrafting hemangio
cells based on patient specific data, human hemangioblasts or
non-engrafting hemangio cells are produced according to the
patient's specifications and subsequently supplied to the hospital
or clinician placing the order.
[0345] Further aspects of the invention relate to a library of
hemangioblasts, non-engrafting hemangio cells, hemangioblast
lineage cells, and/or non-engrafting hemangio lineage cells that
can provide matched cells to potential patient recipients.
Accordingly, in one embodiment, the invention provides a method of
conducting a pharmaceutical business, comprising the step of
providing hemangioblast or non-engrafting hemangio cell
preparations that are homozygous for at least one
histocompatibility antigen, wherein cells are chosen from a bank of
such cells comprising a library of human hemangioblasts or
non-engrafting hemangio cells that can be expanded by the methods
disclosed herein, wherein each hemangioblast or non-engrafting
hemangio cell preparation is hemizygous or homozygous for at least
one MHC allele present in the human population, and wherein said
bank of hemangioblast cells or non-engrafting hemangio cells
comprises cells that are each hemizygous or homozygous for a
different set of MHC alleles relative to the other members in the
bank of cells. As mentioned above, gene targeting or loss of
heterozygosity may be used to generate the hemizygous or homozygous
MHC allele stem cells used to derive the hemangioblasts. In one
embodiment, after a particular hemangioblast or non-engrafting
hemangio cell preparation is chosen to be suitable for a patient,
it is thereafter expanded to reach appropriate quantities for
patient treatment. Such methods may further comprise the step of
differentiating the hemangioblasts or non-engrafting hemangio cells
to obtain hematopoietic and/or endothelial cells prior to
administering cells to the recipient. Methods of conducting a
pharmaceutical business may also comprise establishing a
distribution system for distributing the preparation for sale or
may include establishing a sales group for marketing the
pharmaceutical preparation.
[0346] Other aspects of the invention relate to the use of the
human hemangioblasts and non-engrafting hemangio cells of the
present invention as a research tool in settings such as a
pharmaceutical, chemical, or biotechnology company, a hospital, or
an academic or research institution. For example, human
hemangioblasts, non-engrafting hemangio cells and derivative cells
thereof (e.g., endothelial cells) may be used to screen and
evaluate angiogenic and anti-angiogenic factors or may be used in
tissue engineering. In addition, because the hemangioblasts and
non-engrafting hemangio cells obtained and expanded by the methods
disclosed herein have dual potential to differentiate into
hematopoietic and endothelial cells, they may be used for the
cellular and molecular biology of hematopoiesis and vasculogenesis.
Further, the human hemangioblasts and non-engrafting hemangio cells
may be used for the discovery of novel markers of these cells,
genes, growth factors, and differentiation factors that play a role
in hematopoiesis and vasculogenesis, or for drug discovery and the
development of screening assays for potentially toxic or protective
agents.
[0347] In other embodiments of the present invention, hemangioblast
and non-engrafting hemangio lineage cells (such as blood cells) are
also used commercially. Hematopoietic cells may be used to generate
blood products, such as hemoglobin and growth factors, that may be
used for clinical and research applications.
[0348] The present invention also includes methods of obtaining
human ES cells from a patient and then generating and expanding
human hemangioblasts or non-engrafting hemangio cells derived from
the ES cells. These hemangioblasts and non-engrafting hemangio
cells may be stored. In addition, these hemangioblasts and
non-engrafting hemangio cells may be used to treat the patient from
which the ES were obtained or a relative of that patient.
[0349] As the methods and applications described above relate to
treatments, pharmaceutical preparations, and the storing of
hemangioblasts or non-engrafting hemangio cells, the present
invention also relates to solutions of hemangioblasts and
non-engrafting hemangio cells that are suitable for such
applications. The present invention accordingly relates to
solutions of hemangioblasts and non-engrafting hemangio cells that
are suitable for injection into a patient. Such solutions may
comprise cells formulated in a physiologically acceptable liquid
(e.g., normal saline, buffered saline, or a balanced salt
solution). A solution may optionally comprise factors that
facilitate cell differentiation in vivo. A solution may be
administered to a patient by vascular administration (e.g.,
intravenous infusion), in accordance with art accepted methods
utilized for bone marrow transplantation. In some embodiments, the
cell solution is administered into a peripheral vein, a superficial
peripheral vein, or alternatively, by central venous administration
(e.g., through a central venous catheter). The number of cells in
the solution may be at least about 10.sup.2 and less than about
10.sup.9 cells. In other embodiments, the number of cells in the
solution may range from about 10.sup.1, 10.sup.2, 5.times.10.sup.2,
10.sup.3, 5.times.10.sup.3, 10.sup.4, 10.sup.5, 10.sup.6, 10.sup.7,
or 10.sup.8 to about 5.times.10.sup.2, 10.sup.3, 5.times.10.sup.3,
10.sup.4, 10.sup.5, 10.sup.6, 10.sup.7, 10.sup.8, or 10.sup.9,
where the upper and lower limits are selected independently, except
that the lower limit is always less than the upper limit. Further,
the cells may be administered in a single or in multiple
administrations.
[0350] The present invention will now be more fully described with
reference to the following examples, which are illustrative only
and should not be considered as limiting the invention described
above.
EXAMPLES
[0351] The following examples are provided to better illustrate the
claimed invention and are not to be interpreted as limiting the
scope of the invention. To the extent that specific materials are
mentioned, it is merely for purposes of illustration and is not
intended to limit the invention. One skilled in the art may develop
equivalent means or reactants without the exercise of inventive
capacity and without departing from the scope of the invention.
Example 1
Materials and Methods
[0352] Generation and Expansion of Erythroid Cells from hESCs Via
Hemangioblasts
[0353] Four human ESC lines were used in the current study:, H1
(National Institutes of Health registered as WA01), MA01 and MA99
(derived at Advanced Cell Technology), and HuES-3 (established by
Cowan et al. (N. Engl. J. Med. 2004; 350:1353-1356) and obtained
from the Harvard Stem Cell Institute). hESCs were grown on
mitomycin C-treated mouse embryonic fibroblast (MEF) in complete
hESC media until they reached 80% confluence. A four step procedure
was used for the generation and expansion of erythroid cells from
hESCs.
[0354] Step 1, EB formation and hemangioblast precursor induction
(Day [-] 3.5-0): To induce hemangioblast precursor (mesoderm)
formation, EBs were formed by plating one well of hESCs per EB
culture well (ultra-low six-well plates, Corning) in 3-4 ml serum
free Stemline media (Sigma) with BMP-4, VEGF165 (50 ng/ml each,
R&D Systems) and basic FGF (20 ng/ml, Invitrogen). Half of the
media was refreshed 48 hours later with the addition of SCF, Tpo
and FLT3 ligand (20 ng/ml each R&D Systems).
[0355] Step 2, Hemangioblast expansion (Day 0-10): After 3.5 days,
EBs were collected and dissociated with trypsin. A single cell
suspension was obtained by passing the cells through a G21 needle
three times and filtering through a 40 .mu.m filter. After
resuspending in Stemline II medium, the cells were mixed with
blast-colony growth media (BGM) (5.times.10.sup.5 cells/ml) and
plated in 100 mm ultra low dishes (10 ml/dish). The cultures were
expanded for 9-10 days in BGM. The addition of 20 ng/ml of bFGF and
2 ug/ml of the recombinant tPTD-HOXB4 fusion protein to BGM was
found to significantly enhance hematopoietic cell proliferation.
HOXB4 protein has been shown to promote hematopoietic development
in both mouse and human ESC differentiation systems (Helgason et
al., Blood 1996; 87:2740-2749; Kyba et al., Cell 2002; 109:29-37;
Wang et al., Proc. Natl. Acad. Sci. U.S.A 2005; 102:19081-19086;
Bowles et al., Stem Cells 2006; 24:1359-1369; Pilat et al., Proc.
Natl. Acad. Sci. U.S.A 2005; 102:12101-12106; Lu et al., Stem Cells
Dev. 2007; 16:547-560). The grape-like blast colonies were usually
visible by microscopy after 4-6 days, and expanded rapidly outward.
Additional BGM was added to keep the density of blast cells at
1-2.times.10.sup.6 cells/ml.
[0356] Step 3, Erythroid cell differentiation and expansion (Day
11-20): At the end of step 2, the cell density was often very high
(.gtoreq.2.times.10.sup.6/ml). Equal volumes of BGM, containing 3
units/ml of Epo (total Epo is 6 units/ml) without HOXB4, were added
to supplement the existing BGM. The blast cells were further
expanded and differentiated into erythroid cells for an additional
5 days. For further expansion, the erythroid cells were transferred
into 150 mm Petri dishes and Stemline 1'-based medium containing
SCF (100 ng/ml), Epo (3 unit/ml) and 0.5% methylcellulose added
every 2-3 days. (When the cells reached confluence, it was very
important to split the cells at a ratio of 1:3 to allow maximum
expansion for an additional 7 days [cell density
2-4.times.10.sup.6/ml]).
[0357] Step 4, Enrichment of erythroid cells (Day 21): Erythroid
cells obtained from step 3 were diluted in 5 volumes of IMDM plus
0.5% BSA medium and collected by centrifugation at 1000 rpm for 5
minutes. The cell pellets were washed twice with IMDM medium
containing 0.5% BSA, and plated in tissue culture flasks overnight
to allow nonerythroid cells (usually the larger cells) to attach.
The non-adherent cells were then collected by brief
centrifugation.
[0358] Plating in BGM after the 3.5 day EB dissociation step was
denoted as day 0 of erythroid culture. The time period for the
entire procedure was 19-21 days from the plating of EB cells in BGM
medium, with a final culture volume of 3-4 liters for
5-6.times.10.sup.6 MA01 hESCs. It was observed that the efficiency
of RBC generation from MA99, H1 and HuES-3 was approximately 5-6
times less than from MA01 hESCs (with a correspondingly lower final
culture volume). RBCs obtained from this procedure (before put into
culture for further maturation and enucleation) were used for
functional characterization, flow cytometry and hemoglobin
analyses. The large scale culture experiments were carried out with
hESC lines MA01 (n=6), H1 (n=2), HuES-3 (n=2), and MA99 (n=1).
[0359] For further maturation, cells collected at day 18-19 (step
3) were diluted with IMDM containing 0.5% BSA (1:5 dilution) and
centrifuged at 450g for 10 min. To partially enrich the cells for
RBCs, the top white portion of cell pellet was removed using a
pipette with a long fine tip. The RBCs were then plated in Stem
Pro-34 SCF (Invitrogen) medium containing SCF (100 ng/ml) and Epo
(3 unit/ml) at a density of 2.times.10.sup.6 cells/ml. The cells
were cultured 6 days with media changes every 2 days, and then
switched to StemPro-34 containing Epo (3 unit/ml) for 4-5 more
days. These cells were used for .beta.-globin chain and benzidine
stain analyses.
FACS Analysis of Erythroid Cells
[0360] All of the conjugated antibodies and the corresponding
isotype controls were purchased from Pharmingen/BD Biosciences
except for the RhD and HbF assay (ComDF) purchased from Chemicon.
The antibodies used were HLAabc, Duffy group, CD14, CD15, CD34,
CD35, CD36, CD41, CD44, CD45, CD71, CD133, CD184 (CXCR4), GPA, RhD
and HbF. Erythroid cells were collected at 19-21 days and washed
2.times. in PBS with 0.1% BSA and stained in accordance with the
manufacturer's suggested concentration of conjugated antibody for
30 min at 4.degree. C. The stained cells were then washed 2.times.
in PBS+0.1% BSA and fixed with the wash buffer supplemented with 1%
paraformaldehyde. The RhD and HbF assay was performed per
manufacturer's protocol that included a 0.5% glutaraldehyde/0.1%
BSA in PBS prefixing treatment and a 0.1% Triton X/0.1% BSA in PBS
permeabilization step prior to staining.
[0361] After staining with the ComDF reagent for 15 min at room
temperature, cells were washed 1.times. in 0.1% BSA in PBS and
fixed in wash buffer supplemented with 1% paraformaldehyde. The
samples were then analyzed using a flow cytometer (FacScan, Becton
Dickinson). Cell populations were analyzed with the CellQuest
program (Becton Dickinson)
Functional Analysis of Hemoglobin
[0362] Cells collected at 19-21 days were washed 3 times in 0.9%
NaCl, then suspended in 9 volumes of water, lysed with saponin, and
clarified by centrifugation at 600.times.g. Hemoglobins were then
separated by cellulose acetate electrophoresis. Oxygen equilibrium
curves were determined using a Hemox-Analyzer, Model B (TCS
Scientific Corp., New Hope, Pa.). The gas phase gradients were
obtained using nitrogen and room air, and the curves were run in
both directions. Data were used only from runs showing negligible
hysterisis as described previously (Honig et al., Am. J. Hematol.
1990; 34:199-203; Honig et al., J. Biol. Chem. 1990; 265:126-132).
Globin mass spectra were obtained using a Voyager-DE Pro MALDI-TOF
mass spectrometer (Applied Biosystems, Foster City, Calif.) as
described by Lee at al. (Rapid Commun. Mass Spectrom. 2005;
19:2629-2635). In brief, ZipTips (Millipore, Billerica, Mass.)
packed with C18 and C4 resin were used to prepare the solution for
MS analysis of peptide and protein, respectively.
Cyano-4-hydroxycinnamic acid (CHCA) and sinapinic acid (SA) were
used as the matrix for peptide and protein, respectively. Aliquots
(1.3 ml) of the matrix solution (3-10 mg CHCA or SA in 1 ml aqueous
solution of 50% acetonitrile containing 0.1% TFA) were used to
elute the peptide/protein from ZipTips and spotted onto a MALDI-TOF
(matrix-assisted laser desorption/ionization time-of-flight)
target. A Voyager-DE PRO Mass Spectrometer (Applied Biosystems)
equipped with a 337 nm pulsed nitrogen laser was used to analyze
the samples. Protein mass was measured using the positive-ion
linear mode. External mass calibration was performed using the
peaks of a mixture of cytochrome c (equine) at m/z 12362,
apomyoglobin (equine) at m/z 16952, and adolase (rabbit muscle) at
m/z 39212.
RhD and ABO Genotyping
[0363] RhD genotyping of hES cell lines by PCR was reported by Arce
at al. (Blood 1993; 82:651-655) and Simsek et al. (Blood 1995;
85:2975-2980) with minor modifications. Since all hES cells were
maintained on MEF, the inventors designed a pair of human DNA
specific PCR primers that only amplified human DNA sequences.
Genotyping of ABO blood group was developed based on the
polymorphism of glycosyltransferase among ABO blood group
individuals (Yamamoto et al., Nature 1990; 345:229-233).
Characterization of hESC-Derived Erythroid Cells
[0364] Cells collected at different time points were cytospun at
low speed (<1000 rpm) on superfrost plus slides (VWR). Slides
were dried and stained with Wright-Giemsa dye for 5 min and washed
three times with distilled water. For immunofluorescence staining,
cytospun slides were fixed in 4% paraformaldehyde for 15 min,
incubated in 1% BSA for 30 min and incubated overnight at 4.degree.
C. in 1:200 primary antibodies of CD235a/Glycophorin A (Dako), CD71
(BD Biosciences), or human .beta.-globin chain specific antibody
(Santa Cruz Biotechnology). Cells were then incubated for 1 h in
1:200 secondary anti-mouse IgG conjugated to rhodamine or FITC
(Jackson ImmunoResearch Lab). For total hemoglobin stain, cells at
different stages of differentiation using the erythroid expansion
maturation protocol outlined above were collected and cytospun on
slides. Air dried cytospin samples were fixed in 100% methanol for
10 min. After washing with PBS for 10 min, cells were stained with
3'3-diaminobenzidine reagent (Sigma) according to manufacturer's
instruction. The cells (like all RBCs) containing hemoglobin
stained brown and nuclei of cells stained blue with
Wright-Giemsa.
[0365] For immunological blood type characterization, erythroid
cells were collected at 19-21 days, cytospun on glass slides and
stained with monoclonal anti-human blood group A and B antibodies
(Virogen, MA) overnight at 4.degree. C. Slides were then incubated
with corresponding secondary antibodies labeled with Rhodamine or
FITC (Jackson ImmunoResearch Lab) for 30-60 min. After a final
wash, the cells were checked by fluorescence microscopy.
RT-PCR Analysis
[0366] Erythroid cells differentiated at different stages using the
erythroid expansion protocol outlined above were collected and the
expression of .beta.-, .gamma.- and .epsilon.-globin genes was
analyzed by RT-PCR. In brief, total RNA was isolated using an
RNAeasy Micro Kit (Qiagen), cDNA pools were constructed using the
SMART cDNA synthesis kit (Clontech) as previously reported (Lu et
al., Blood 2004; 103:4134-4141). Primers specific for .beta.-,
.gamma.- and .epsilon.-globin genes, as reported previously (Qiu et
al., Blood 2008; 111:2400-2408), were used to amplify corresponding
messages. PCR products were separated on a 2.5% agarose gel and
visualized by ethidium bromide fluorescence.
Enucleation of hESC-Derived Erythroid Cells In Vitro
[0367] Blast cells were cultured as described above up until day
7.
[0368] Step 1: Day 7 blast cells in BGM were filtered and plated in
Stemline II (Sigma) with supplements based on Giarratana et al.
(Nat. Biotechnol. 2005; 23:69-74). These included 40 .mu.g/ml
inositol, 10 .mu.g/ml folic acid, 160 .mu.M monothioglycerol, 120
.mu.g/ml transferrin, 10 .mu.g/ml insulin, 90 ng/ml ferrous
nitrate, 900 ng/ml ferrous sulfate, 10 mg/ml BSA (Stem Cell
Technologies), 4 mM L-glutamine (Gibco), and 1%
penicillin-streptomycin (Gibco). All reagents were from Sigma
unless otherwise noted.
[0369] Step 2: For the first seven days in this media (day 7-14),
cells were cultured in 1 .mu.M hydrocortisone, 100 ng/ml SCF
(Invitrogen), 5 ng/ml IL3 (Invitrogen) and 3 IU/ml Epo (Cell
Sciences) and maintained at 1.times.10.sup.6 cells/ml.
[0370] Step 3: From day 14 onward, SCF and IL3 were discontinued
and Epo was continued. Cells were maintained at a density of
2.times.10.sup.6 cells/ml. Medium was changed every few days.
[0371] Step 4: Cells were co-culture with human mesenchymal stem
cells (MSC, Lonza) or OP9 mouse stromal cells at various time
points (day 19-36) in Stemline II with supplements described above
and Epo. Before co-culture, MSCs were expanded in MSC Growth Medium
(MSCGM, Lonza) and OP9 cells were expanded in 20% FBS (Atlas) in
.alpha.-MEM (Invitrogen) with 4 mM L-glutamine and 1%
penicillin-streptomycin (Gibco).
Statistical Analysis of Cell Dimensions
[0372] The area of cells and nuclei on cytospun Wright-Giemsa
stained slides were measured during the enucleation protocol using
Scion Image. The area of the cytoplasm was calculated as the
difference between the total cell area and nuclear area and nuclear
to cytoplasmic ratio (N/C). Diameter was calculated from the area
of the nucleus. Differences between diameter and N/C at each time
point were measured by an analysis of variance (ANOVA), followed by
the Holm's test. Data was presented as mean+/-standard deviation
with significance of at least P<0.05.
Example 2
Differentiation of hESCs into Red Blood Cells
[0373] Blast cells (BCs) were generated from hESCs as previously
described (Lu et al., Nat. Methods 2007; 4:501-509). A four-step
protocol was employed to differentiate the BCs toward the erythroid
lineage, which included [1] EB formation from undifferentiated
hESCs, [2] BC formation and expansion, [3] erythroid
differentiation and amplification into a mass population of red
blood cells and [4] enrichment of red blood cells. Early-stage EBs
were generated from hESCs cultured in serum-free media supplemented
with a combination of morphogens and early hematopoietic cytokines.
The EBs were then dissociated and individual cells were plated in
serum-free semi-solid blast-colony growth medium (BGM) for the
growth and expansion of BCs. Grape-like blast colonies appeared at
the beginning of 3 days, and rapidly expanded from 4 days. The BCs
were then induced to proliferate and differentiate into
erythrocytes by adding BGM and Epo for several days. To further
expand the erythroid cells, Stemline II-based media containing SCF,
Epo, and methylcellulose was added every 2 or 3 days for one week.
Cells were then diluted in IMDM with added BSA, collected by brief
centrifugation and plated in tissue culture flasks overnight to
allow the non-erythroid cells to attach. The remaining non-adherent
cells were collected (representing greater than 95% erythroid
cells) (FIGS. 1A, 1B, 1C and 1D). Using this optimized (19-21 day)
protocol of expansion and differentiation with the addition of bFGF
(20 ng/ml) and HOXB4 protein (2 .mu.g/ml) in BGM medium,
3.86.+-.1.19.times.10.sup.10 (mean.+-.SD, n=6) RBCs were generated
from one 6-well plate of MA01 hESCs (.apprxeq.1.2.times.10.sup.7
cells). RBCs were also generated with high efficiency from H1
(n=2), HuES-3 (n=2), and MA99 (n=1) hESCs, but the yield was 5-6
times less that obtained from MA01 hESCs. The inventors found that
the quality of hESCs is one of the most important factors for
high-efficient generation of RBCs; high quality hESCs (i.e., hESC
culture should be composed of colonies with tight borders with
minimal signs of differentiation as seen under microscope at about
80% confluent but not touching each other; grown at moderated rate:
1:3 split getting confluent in 3-5 days; stained positive with
markers of pluripotency for almost every cells; and formed uniform
EBs 24 hours after replating) usually generate a high number of EB
cells (e.g., 2.times.10.sup.6 high quality hESCs will
generate.apprxeq.2-3.times.10.sup.6 EB cells after 3.5 days). It
was also noted that the presence of 0.2-0.5% methylcellulose in the
differentiation and expansion medium prevents cells from
aggregating, resulting in enhanced expansion.
Example 3
Characterization of hESC-Derived RBCs
[0374] Morphologically, the RBCs obtained using the above (19-21
day) protocol were nucleated (>95%) and substantially larger
than definitive erythrocytes with an average diameter of
approximately 10 .mu.m. Giemsa-Wright staining showed an abundance
of hemoglobin in the cytoplasm (FIGS. 1C and 1D). The identity of
the cells was confirmed by immunological characterization (Table 1
and FIG. 1F). Over 65% of the cells expressed fetal hemoglobin
(HbF), >75% were CD71 positive, and 30% of the cells expressed
CD235a, whereas the majority of the cells did not express
myelomonocytic or megakaryocytic antigens (All cells were negative
for CD14, whereas 0.4% of cells expressed CD15; 8.6% of cells
expressed CD41) and progenitor antigens (0.3% cells were positive
for CD34; 10% cells expressed CD35, and 5% cells were positive for
CD36) (Table 1). The inventors have previously shown that BCs
express the chemokine receptor CXCR413. However, the inventors did
not detect the expression of CXCR4 or CD133 on the surface of the
hESC-derived RBCs, which is consistent with the findings from
erythroid cells expanded from cord blood progenitors in vitro
(Giarratana et al., Nat. Biotechnol. 2005; 23:69-74; Miharada et
al., Nat. Biotechnol. 2006; 24:1255-1256). Interestingly, few or
none of the cells expressed HLA (<5%) or Duffy (0%) group
antigens, a finding that has also been observed for CD34+CD38-
hematopoietic precursors derived from hESCs (Lu et al., Blood 2004;
103:4134-4141).
[0375] Mass spectral analysis showed that the main globin types
found in the RBCs obtained at day 19-21 from MA01 and H1 hESCs
included the embryonic .zeta.- and .epsilon.-chains, and the fetal
G.gamma.-chain (FIG. 1E). Substantial quantities of .alpha.-chains
were also present, but neither A.gamma.- nor adult .beta.-globin
chains could be detected. Nevertheless these results demonstrate
that hemoglobin synthesis in these cells corresponds to the
embryonic and early fetal developmental stage, and are consistent
with recent reports showing that even definitive-appearing
erythroid cells derived from hESCs coexpress high levels of
embryonic and fetal globins with little or no adult globin (Lu et
al., Blood 2004; 103:4134-4141; Chang et al., Blood 2006;
108:1515-1523; Qiu et al., Blood 2008; 111:2400-2408; Lu et al.,
Stem Cells Dev. 2007; 16:547-560).
Example 4
Functional Analysis
[0376] In six separate experiments, the oxygen equilibrium curves
of the hESC-derived erythroid cells (day 19-21 cultures) were
either very similar to (FIG. 2A) or somewhat rightward shifted,
relative to that of normal adult RBC's. The oxygen equilibrium
curve illustrated in FIG. 2A has a biphasic appearance. At the low
end of the oxygen saturation, its curve is to the left of the
normal, and it is hyperbolic in shape (arrow). At their midpoint,
the two curves are virtually identical, and at higher saturation
levels, the curve of ESC-derived erythroid cells is again displaced
slightly to the left of the normal (arrow head). Hill's n
coefficient was also similar to that of the normal control (FIG.
2C). The ESC-derived erythroid cells showed a comparable Bohr
effect at physiological and higher pH values, but a lesser shift at
lower pH (FIG. 2B). The response to 2,3-diphosphoglycerate
(2,3-DPG) depletion of these cells was significantly less than in
the normal control (FIG. 2C), consistent with the known lack of
interaction between Hb F and 2,3-DPG (Maurer et al., Nature 1970;
227:388-390). These findings demonstrate that the hESC-derived RBCs
have oxygen carrying properties that are comparable to those of
normal adult erythrocytes.
Example 5
Generation of RhD(-) RBCs from hESCs
[0377] The manufacture of O/RhD(-) RBCs would substantially aid in
the prevention of alloimmunization when transfused into RhD(-)
mismatched patients. The anticipated need for universal donor RBCs
(O--) in Western countries is greater than in Asian countries such
as Korea, Japan and China, where the RhD(-) type is less prevalent
(<0.5% vs 15%, respectively). Genotype analysis by PCR showed
that only two out of twenty hESC lines studied, MA99 and MA133,
were RhD(-) (FIG. 3A). Erythroid cells from 19-21 day cultures were
used for FACS and immunological analyses. FACS analyses
demonstrated that RBCs generated from MA01 expressed RhD antigen on
their surfaces, whereas cells derived from MA99 lacked the
expression of RhD antigen (FIG. 3D), confirming the results of
genomic DNA PCR analysis (FIG. 3A). Immunocytochemical analysis
using monoclonal antibodies against the A and B antigens showed
that approximately 5% of RBCs generated from MA01 cells expressed
the A, but not the B antigen (FIG. 3E), demonstrating that MA01
cells have a phenotype of A(+); about 5% of RBCs derived from MA99
cells expressed the B, but not the A antigen (FIG. 3E), suggesting
MA99 cells have a B(-) phenotype, while RBCs derived from WA01
cells expressed neither A nor B antigens, confirming WA01 cells as
O-type, consistent with the results of genomic PCR analysis (FIGS.
3B and 3C). However, it is worth noting that not all erythroid
cells expressed the A or B antigen, which may reflect the early
developmental stage of the cells (Wada et al., Blood 1990;
75:505-511; Hosoi et al., Transfusion 2003; 43:65-71).
Example 6
Enucleation and Maturation of hESC-Derived Erythroid Cells In
Vitro
[0378] A critical scientific and clinical issue is whether
hESC-derived erythroid cells can be matured in vitro to generate
enucleated erythrocytes. To investigate this, several different
strategies and culture conditions were studied. It was found that
hematopoietic stem cell expansion medium Stemline II plus
supplements and cytokines reported by Giarratana et al. (Nat.
Biotechnol. 2005; 23:69-74) supported the growth, expansion,
maturation and enucleation of hESC-derived erythroid cells with
significantly higher efficiency than other tested conditions. Blast
cells cultured in this condition without stromal layers resulted in
10-30% enucleation, while culturing on MSC stromal cells resulted
in approximately 30% enucleation and OP9 stromal cell layers
further enhanced the enucleation process. Approximately 30-65% of
erythroid cells (40.+-.17% [mean.+-.SD, n=4]) were enucleated when
these cells were transferred to OP9 stromal layers from non-stromal
five week cultures and co-cultured from days 36-42 (FIGS. 4C and
4E). The enucleated erythrocytes (FIGS. 4C and 4E) show similar
staining pattern and size as mature RBCs from normal human blood
(FIGS. 4D and 4F). These erythroblasts were derived from hESCs
grown without MEFs using the BD Matrigel system. The fact that
erythroblasts kept in non-stromal conditions (without transfer to
MSC or OP9) could enucleate 10-30% suggests that enucleation could
be achieved completely feeder-free.
[0379] Total of six experiments were performed with hESC lines H1
(n=3), MA01 (n=2) and huES-3 (n=1), all exhibiting varying levels
of enucleation and expansion of 30-50-fold. Stromal cells,
especially OP9, were able to enhance survival of the cells after
long term culture compared to non-stromal conditions.
[0380] To further investigate the events associated with
enucleation, multiple characteristics related to the process of
erythrocyte maturation were exampled. It was observed a progressive
decrease in cell size and nuclear to cytoplasm (N/C) ratio before
enucleation occurred. Prior to transfer to the OP9 stromal layer,
the size and N/C of these cells decreased significantly from 18.3
.mu.m in diameter on day 8 to 12.9 .mu.m for nucleated cells
(p<0.001) and to 7.5 .mu.m for enucleated cells on day 27
(p<0.001), and N/C ratios from 0.82 on day 8 to 0.30 by day 27
(p<0.001, FIGS. 4A and 4B), indicating substantial nuclear
condensation during the process. Wright-Giemsa stains demonstrated
a gradual progression from blue to purple to pink stain, indicative
of pronormoblast to polychromatic erythroblast to orthochromatic
normoblast transition. These cells expressed a high level of CD71,
an early erythroblast marker, on day 8 and decreased their
expression over time; whereas they showed low to negligible level
of CD235a (Glycophorin A) protein, a mature erythrocyte marker, in
the beginning, but increased their expression dramatically with
their maturation (FIG. 5A and FIG. 6). Benzidine stains also showed
a progressive accumulation of hemoglobins in these cells and a
decrease in cell size over time (FIG. 5C).
[0381] Preliminary experiments confirmed that the immature
enucleated erythroid cells mainly expressed the embryonic .zeta.-
and .epsilon.-globin chains, and the fetal .gamma.-globin chain
(FIG. 1E). Although substantial quantities of .alpha.-chains were
present in these cells, adult .beta.-globin chains were not
detected. Subsequent studies were carried out to determine whether
the erythroid cells possess the capacity to express the adult
definitive .beta.-globin chain upon further differentiation and
maturation in vitro. Globin chain specific immunofluorescent
analysis showed that the cells increased expression of the adult
.beta.-globin chain (0% at day 17, FIG. 5B) to about 16.37% after
28 days of in vitro culture (some cells expressed the .beta.-globin
chain at very high levels, FIG. 5B and FIG. 7). The expression of
p-globin chain gene in these cells was confirmed by globin chain
specific RT-PCR analysis (Qiu et al., Blood 2008; 111:2400-2408)
(FIG. 8). Consistent with a recent report (Zambidis et al.,
[abstract]. 6th ISSCR Annual Meeting 2008; 357), the inventors also
observed that all the cells expressed the fetal .gamma.-globin
chain irrespective of the .beta.-globin chain expression
status.
TABLE-US-00001 TABLE 1 Characterization of hESC-derived erythroid
cells by FACS analysis Antibodies Positive Range (%. n = 5) Average
(Mean .+-. SE) HbF 40.03-96.60 66.79 .+-. 9.88 CD47 95.00-99.21
97.51 .+-. 0.85 GPA 21.31-41.93 30.10 .+-. 3.79 CD71 59.40-83.39
76.07 .+-. 4.33 CD44 18.61-44.56 30.72 .+-. 4.55 CD45 10.06-40.21
22.23 .+-. 5.45 CD41 4.44-20.16 8.61 .+-. 2.98 CD14 0 0 CD15
0.20-0.60 0.38 .+-. 0.08 CD34 0-1.62 0.34 .+-. 0.32 CD35 5.82-17.46
9.79 .+-. 2.00 CD36 1.08-13.30 4.99 .+-. 2.14 CD133 0 0 CD184
(CXCR-4) 0 0 Duffy 0 0 HLAabc 0.75-6.25 4.15 .+-. 1.14
Example 7
RhD and ABO Genotyping
[0382] RhD genotyping of hES cell lines by PCR was reported by Arce
et al. and Simsek et al. (Arce et al., Molecular cloning of RhD
cDNA derived from a gene present in RhD-positive, but not
RhD-negative individuals. Blood 1993; 82:651-655; Simsek et al.
Rapid RhD genotyping by polymerase chain reaction-based
amplification of DNA. Blood 1995; 85:2975-2980) with minor
modifications. Since all hES cells were maintained on MEF, the
inventors designed a pair of human DNA specific PCR primers that
only amplified human DNA sequences PCR primers were: RhD-F,
5'-tgaccctgagatggctgtcacc-3' (SEQ ID NO: 34) and RhD-R,
5'-agcaacgatacccagtttgtct-3' (SEQ ID NO: 35), which amplify intron
4 between exons 4 and 5, and generate only a 1,200 by fragment with
DNA from RhD negative individuals, whereas in RhD positive
individuals, 100 bp and 1,200 bp (which is weak due to the fragment
size of amplification) are generated. This strategy has been
confirmed to be in complete agreement with serologically determined
phenotypes (Simsek et al., Blood 1995). In brief, genomic DNA was
isolated from hES cells using a QIAamp DNA Mini Kit (Qiagen,
Valencia, Calif.), and 200 ng DNA per reaction in 50 .mu.l was used
for PCR amplification. PCR conditions: 94.degree. C. for 45 sec,
60.degree. C. for 1.5 min, and 72.degree. C. for 2.0 min for 35
cycles with final extension at 72.degree. C. for 7 min. PCR
products were separated on a 1.2% agarose gel and visualized by
ethidium bromide staining. DNA from mononuclear cells of normal
human blood with RhD positive and negative individuals was used as
positive and negative controls.
[0383] Genotyping of ABO blood group was developed based on the
polymorphism of glycosyltransferase among ABO blood group
individuals (Yamamoto et al., Molecular genetic basis of the
histo-blood group ABO system. Nature 1990; 345:229-233.). First,
human specific PCR primers were designed to amplify a DNA fragment
surrounding nucleotide 258, in which O allele contains one
nucleotide (G) deletion at this site and generates a cutting site
for restriction enzyme Kpn I, but eliminates a cutting site of
restriction enzyme Bst EII. PCR products were then subjected to
restriction digestion by Kpn I and Bst EII: PCR product from O/O
genotype can only be digested by Kpn I to generate two new shorter
fragments, but is resistant to the digestion of Bst EII; while PCR
product from A/A, B/B and A/B genotypes is resistant to Kpn I
digestion, and is only cut by Bst EII; whereas PCR product from
genotypes of A/O or B/O can be digested partially by both enzymes.
Therefore, the first PCR amplification and restriction digestion is
able to distinguish O blood type and non-O blood type. Based on the
results, the second set of PCR primers were designed to amplify the
region of nucleotide 700, where both A and O alleles contain a G
nucleotide that can be digested by Msp I, while the B allele has an
A nucleotide at this position that generates an Alu I cutting site.
The combination of two separate PCR amplification at two diagnostic
positions of the glycosyltransferase, and four restriction enzyme
digestions can clearly distinguish A, B or O alleles. In brief, the
PCR reaction was carried out with a set of primers amplifying the
region of nucleotide 258 (primers: O-type-F,
5'-gccgtgtgccagaggcgcatgt-3' (SEQ ID NO: 36), O-Type-R,
5'-aatgtccacagtcactcgccac-3' (SEQ ID NO: 37), PCR product, 268 bp),
the PCR product was purified by a Qiagen Kit, digested by Kpn I and
Bst E11, and separated on a 2% agarose gel and visualized by
ethidium bromide staining. For the O/O genotype, Kpn I generates
174 bp and 93 bp fragments, and Bst EII does not cut the PCR
product; for the A/A, B/B and A/B genotypes, Kpn I does not cut the
PCR product, Bst EII generates 174 bp and 93 bp fragments; for A/O
or B/O genotypes, both Kpn I and Bst EII partially cuts the PCR
product and generates 267 bp (original), 174 bp and 93 bp
fragments. Second PCR amplification using primers amplifying the
region of nucleotide 700 was carried out (primers: AB-Type-F,
5'-tgctggaggtgcgcgcctacaag-3' (SEQ ID NO: 38), AB-Type-R,
5'-gtagaaatcgccctcgtccttg-3' (SEQ ID NO: 39), PCR product, 278 bp),
PCR product was purified, digested by Alu I and Msp I and separated
as above. For the B/B genotype, Alu I digestion generates 187 bp+91
bp fragments, and Msp I digestion generates 206 bp+47 bp. For A/A,
A/O and O/O genotypes, Alu I does not cut the PCR product, Msp I
generates 187 bp+47 bp fragments. For the A/B or B/O genotypes, Alu
I generates 278 bp (no cut)+187 bp+91 bp fragments; and Msp I
generates 206 bp and 187 bp+47 bp fragments.
Example 8
Materials and Methods
[0384] Culture of hESCs
[0385] hESC lines WA01(H1), HUES3, and MA01 were used and
maintained as previously described.sup.(6). Briefly, hESCs were
grown on mitomycin C-treated mouse embryonic fibroblast (MEF) in
complete hESC media. The hESCs were passaged every 3-5 days before
reaching confluence using 0.05% trypsin-0.53 mM EDTA. For
feeder-free culture, the cells were then grown on hESC-qualified
Matrigel matrix (BD Biosciences) in complete Modified TeSR.TM.1
(mTeSR.TM.1) medium (Stem Cell Technologies, Inc), which is based
on the formulation of Ludwig et al..sup.(7,8). Cells were
maintained according to manufacture's suggested instructions.
Briefly, cells were passaged when they reached approximately 90%
confluence, usually every 5-7 days with split ratios ranging from
1:3 to 1:6. Cells were treated with dispase (1 mg/ml BD,
Biosciences) and incubated for 3-5 minutes at 37.degree. C. to
begin dislodging the colonies. Colonies were washed with DMEM/F12
(Mediatech) to remove dispase solution. To extricate the colonies
from the tissue culture plastic, the wells were coated with
DMEM/F12 and gently scraped until all of the colonies had been
displaced. The colonies were transferred to conical tubes, the
wells were washed with DMEM/F12 and the cells pooled to collect any
remaining in the wells. They were centrifuged for 5 minutes at 1000
rpm. The cell pellets were resuspended in mTeSR.TM.1 media and
transferred to Matrigel coated 6 well plates, in 2 ml of mTeSR.TM.1
media per well. Cells were maintained at 37.degree. C. under 5% CO2
and the mTeSR.TM.1 medium was replenished daily.
Immunofluorescent Cytochemistry Analysis
[0386] Feeder-free hESC colonies were assayed for Oct-4 and
Tra-1-60 expression using immunofluorescence. The cells were fixed
with 4% paraformaldhyde (PFA), washed with PBS, and blocked with 5%
Normal Goat Serum (Vector Labs), 1% BSA (Sigma) and 0.2%
Triton-X-100 (Sigma) in PBS for 30 minutes at room temperature.
Cells were incubated with primary antibodies against Oct-4 (Santa
Cruz Biotechnology) or Tra-1-60 (Millipore/Chemicon), in blocking
solution, overnight at 4.degree. C., washed with PBS and incubated
with a biotin conjugated secondary antibody (Jackson ImmunoResearch
Labs), in blocking solution, for 45 minutes at room temp. After
further washing, cells were incubated with Alexa 954 conjugated
streptavidin (Invitrogen/Molecular probes), for 15 minutes at room
temp followed by an extended final wash in PBS. Cells were mounted
in Prolong Gold with DAPI (Invitrogen/Molecular Probes).
Differentiation of Hemangioblasts from hESCs
[0387] To induce hESCs cultured on MEFs into hemangioblasts, 80-90%
confluent plates were dissociated by 0.05% trypsin digestion. To
differentiate feeder-free hESCs into hemangioblasts, 85-90%
confluent cells were dislodged from the Matrigel matrix using the
protocol described above. Cells from both conditions were plated on
Ultra-Low dishes (Corning, N.Y.) in Stemline II (Sigma) medium with
different doses of BMP-4, VEGF and bFGF as described
previously.sup.(2). Half of the medium was replaced after 48 hours
with fresh medium containing the same cytokines or the same medium
plus SCF, FLT3 ligand (FL) and Tpo (20 ng/ml, R&D System) which
depend on different experiment conditions. After 3.5 days, EBs were
collected and dissociated by 0.05% trypsin. Single-cell suspensions
were obtained by passing the cells through 22-gauge needle and
through a 40-.mu.m cell strainer, collected by centrifugation, and
resuspended in 50-100 .mu.l of Stemline II media. Cells
(0.75.times.10.sup.5 to 1.times.10.sup.5) were mixed with 2.5 ml of
blast colony growth medium (BGM) as previously described.sup.(2),
plated in Ultra-Low dishes and incubated at 37.degree. C. Blast
colonies derived from both MEF and feeder-free hESCs were observed
3-4 days after plating, followed shortly thereafter by rapid
expansion. Blast cells (BC) are defined in the current study as
cells obtained from day-6 blast colonies.
Enrichment of Hemangioblast Precursors
[0388] Potential BC precursor surface markers CD31, CD34, KDR,
CXCR-4, CD133, ACE, PCLP1, PDGFR.alpha., Tie-2, Nrp-2, Tpo-R and
bFGFR-1 were selected for cell enrichment. All antibodies are mouse
monoclonal IgG isotype and they are: CD31 and CD34 (Dako
Cytomation), KDR and Tpo-R(R&D Systems, Inc.), CXCR-4 (Abcam
Inc.), Nrp-2, ACE, PCLP1 and PDGFR.alpha. (Santa Cruz
Biotechnology), Tie-2 (Cell Signaling Technology, Inc.), bFGFR-1
(Zymed Laboratories), and CD133 (Miltenyi Biotech). Antibody
cocktail assembly was performed by EasySep "Do-it-Yourself"
Selection Kit (Stem Cell Technologies). Cell suspensions derived
from EBs were centrifuged at 1200 rpm for 4 min and resuspended in
PBS with 2% FBS/1 mM EDTA buffer at a concentration of
1-2.times.10.sup.6 cells/100 .mu.l. The cells were mixed with
different antibody cocktails for 15 min at RT and then incubated
with EasySep Nanoparticle at RT for 10 additional minutes. Positive
selected cells were separated after pouring off supernatant when
placing tube with cells in a Magnet holder. Antibody selected
positive cells (1.times.10.sup.5) were mix with 2.5 ml of BGM and
plated for blast colony development.
Real Time RT-PCR and Data Analysis
[0389] Total RNA was extracted from EBs or undifferentiated hESCs
using RNeasy Micro Kits (Qiagen) according to manufacture's
protocol. cDNAs were synthesized using BD SMART PCR cDNA Synthesis
Kit (BD Biosciences) per manual instructions. Real time RT-PCR
(qRT-PCR) was performed using FullVelocity SYBR Green QPCR Master
Mix (Stratagene). The reactions were set up in triplicate with the
following components per reaction: 50 ng of template, 0.2
micromoles of each primer and 1.times. Master mix. Gene specific
sequences of the primers used are listed in Table 1, and annealing
temperature for all primers is 55.degree. C. Amplification and
real-time data acquisition were performed in a Stratagene Mx3005P
with MxPro version 3.0 software. The following cycle conditions
were used: one cycle of 95.degree. C. for ten minutes followed by
forty cycles of 95.degree. C. for 30 seconds, 55.degree. C. for 1
minute, 72.degree. C. for 30 seconds followed by a final cycle of
95.degree. C. for 1 minute, 55.degree. C. for 30 seconds and
95.degree. C. for 30 seconds. Relative quantification of each
target gene was performed based on cycle threshold (C.sub.T)
normalization to .beta.-actin (.DELTA.C.sub.T) using the
.DELTA..DELTA.C.sub.T method.sup.(9). Analysis of relative gene
expression data using real-time quantitative PCR and the 2(-delta
deltaC(T)) method.sup.(9), where the .DELTA.C.sub.T of each
examined gene in the experimental samples was compared to average
.DELTA.C.sub.T of each gene in an undifferentiated hESC control
sample (.DELTA..DELTA.C.sub.T). Then the fold change in expression
was calculated as 2.sup.-.DELTA..DELTA.CT. The negative fold
difference data was convert to a linear "Fold change in expression"
value using the following formula: Linear Fold Change in
expression=-(1/fold change in expression).
Statistical Analysis
[0390] All data were presented as mean.+-.SEM. Intergroup
comparisons were performed by unpaired Student's t-test using
GraphPad Prism, version 4, software (GraphPad Software, Inc., San
Diego, Calif.). p<0.05 was interpreted as statistically
significant.
Example 9
Both BMP-4 and VEGFs are Required for Hemangioblast Development
[0391] A serum free system to induce hESC differentiation toward
the hemangioblastic and hematopoietic lineages was previously
described.sup.(2,10). Although BMP-4, VEGF, and a cocktail of early
hematopoietic cytokines were used, the absolute requirement and
optimal concentrations of the individual factors were not examined.
In order to reduce the expense and effort necessary to generate
hemangioblasts for future research and clinical applications, the
inventors specifically examined the minimal requirements and
effects of VEGFs, BMPs, and three early hematopoietic cytokines
(TPO, FL and SCF) on the efficient development of blast colonies
from hESCs. It was found that BMP-4 is absolutely required for the
development of blast colonies under serum-free conditions. No blast
colonies were obtained without the supplement of BPM-4 in the
medium during EB formation and a clear dose-response effect of
BMP-4 was observed for the formation of blast colonies from hESCs
(FIG. 9A). Furthermore, BMP-4 could not be substituted by other
members of the BMP family. BMP-2 and BMP-7 alone, or a combination
of the two, failed to promote BC development. Furthermore,
supplementation of BMP-2 and BMP-7 in EB medium containing BMP-4,
either showed no effect (10 ng/ml) or inhibited (20 ng/ml) blast
colony development (FIG. 9B). However, addition of BMP-4, and BMP-2
and/or BMP-7 in blast colony growth medium (BGM) did not have any
effect on the development of blast colonies, suggesting that BMP-4
only promotes the mesoderm/hemangioblastic specification stage, but
not the growth and expansion of BCs. Similarly, no blast colonies
developed when VEGF.sub.165 was eliminated from the EB formation
medium. VEGF.sub.165 was found to promote the development of blast
colonies in a dose dependent manner (FIG. 9C). VEGF.sub.121, an
isoform of VEGF members that can only bind to KDR and FLT1
receptors.sup.(11), can be used as a substitute of VEGF.sub.165 in
promoting the development of blast colonies from hESCs; almost
identical numbers of blast colonies (68.+-.5 vs. 67.+-.12) were
developed when 50 ng/ml of either VEGF.sub.165 or VEGF.sub.121,
which is the optimal dose under serum-free condition, was added in
EB medium. However, in contrast to BMP-4, no blast colonies were
obtained if VEGF was absent in BGM, demonstrating that VEGF plays a
critical role both in early stage of mesoderm/hemangioblastic
specification and in the growth and expansion of BCs.
[0392] In the inventors' original report.sup.(2), TPO, FL and SCF
were added 48 hours after plating hESCs in EB medium in an effort
to further promote early hematopoietic progenitor growth and
expansion. Here it was examined whether TPO, FL, and SCF played any
role in the specification of hESCs toward the
mesoderm/hemangioblast lineage. EBs were formed by plating hESCs in
Stemline II medium with 50 ng/ml of BMP-4 and VEGF, and divided
into two wells after 48 hours: to one well, 20 ng/ml of TPO, FL and
SCF was added, to the other well, no additional factor was added,
and the EBs were incubated for another 36 hours. EBs were then
collected and single cell suspension was obtained and plated for
blast colony formation. Our results show that supplement of TPO, FL
and SCF during EB formation has no effect on the development of
blast colonies, 242.+-.16 vs. 287.+-.33 blast colonies developed
per 1.times.10.sup.5 cells derived from EBs treated with and
without TPO, FL and SCF, respectively.
Example 10
bFGF Promotes the Growth, but not Commitment, of Hemangioblasts
from hESCs
[0393] Previous studies have shown that supplement of bFGF during
early differentiation promotes murine and human ESC hematopoietic
development.sup.(12,13,14,5). Thus, we investigated whether the
addition of bFGF during the EB differentiation stage would enhance
blast colony formation from hESCs. Addition of bFGF during EB
formation had no effect on the development of blast colonies, and,
in fact, at a higher dose (40 ng/ml) inhibited the formation of
blast colonies from multiple hESC lines (FIG. 10A and FIGS. 11). In
contrast, the addition of bFGF in BGM significantly enhanced the
development of blast colonies (FIG. 10A, FIG. 11). Both the number
of blast colonies (p<0.001) and total number of BCs increased
significantly compared to BGM without bFGF supplementation. With
bFGF at optimal dose (20 ng/ml) in BGM, the blast colonies are
larger and healthier, and we consistently harvest approximately
1.times.10.sup.8 BCs from one six-well plate of high quality WA01
hESCs (approximately 1.2.times.10.sup.7 cells) after 6 days growth,
which is 8.+-.1 fold higher than that obtained from BGM without the
supplement of bFGF.
[0394] To investigate the lineage differentiation potentials of BCs
generated with and without supplementation of bFGF, equal numbers
of pooled BCs were plated for hematopoietic and endothelial lineage
differentiation as previously described.sup.(2). For hematopoietic
CFU formation, 129.+-.9 and 86.+-.22 CFUs/10.sup.4 BCs were formed
from BCs derived from BGMs supplemented with and without bFGF (20
ng/ml), respectively. Furthermore, no difference was observed for
the development of different CFUs (CFU-mix, CFU-G, CFU-M and CFU-E)
between the two groups (data not shown). For endothelial lineage
differentiation, more BCs (62.+-.3%) from BGM with bFGF (20 ng/ml)
differentiated into endothelial cells than BCs (55.+-.3%) derived
from BGM without bFGF supplement. Endothelial cells from both
sources formed capillary-vascular like structures efficiently after
plating on Matrigel (FIGS. 10B and 2C). These results suggest that
bFGF promotes the growth of BCs, but does not cause preferential
lineage differentiation.
Example 11
Robust Generation of Hemangioblasts from hESCs Maintained Without
Feeder Cells
[0395] It has been reported that hESCs maintained on MEF feeders
contain the nonhuman sialic acid N-glycolylneuraminic acid
(Neu5Gc).sup.(15,7,8), and that animal sources of Neu5Gc can cause
a potential immunogenic reaction with human complement. The
culturing of hESCs on MEF feeder layers prevents complete
elimination of animal Neu5Gc, and raises concerns for the potential
clinical applications of hemangioblasts generated from hESC lines
maintained under these conditions. Therefore, we have taken steps
to determine whether hemangioblasts can be generated from hESCs
maintained without MEF feeders. Three hESC lines were passaged with
dispase onto plates coated with hESC-qualified Matrigel matrix, and
maintained in mTeSR medium as described in Materials and Methods.
Their undifferentiated state was confirmed with immunofluorescence
staining for the expression of Oct-4 and Tra-1-60 antigens and
colony morphology (FIG. 12A-12H). These cells were collected and
utilized for the development of BCs using the optimized conditions
described above. Interestingly, a significantly higher number of
BCs were observed with feeder-free hESCs as compared to hESCs
cultured on MEF feeders when identical numbers of EB cells were
plated (FIG. 12l, p<0.05). These results were observed for all
three tested hESC lines WA01, MA01 and HUES-3 (data not shown).
Example 12
Mechanism Underlying the Effects of BMP-4 and VEGF on Hemangioblast
Development
[0396] In order to dissect the molecular mechanism underlying the
effects of BMP-4 and VEGF on hemangioblast development from hESCs,
the inventors compared the expression of genes associated with the
development of hemangio blasts in 3.5 day-old EBs that were formed
in Stemline II medium both with and without each factor, as well as
with a combination of BMP-4 and VEGF. Gene expression was analyzed
by real-time RT-PCR (qRT-PCR) and compared with their levels in
undifferentiated hESCs. EBs formed without any factor expressed
higher levels of OCT-4, a marker for hESCs, than undifferentiated
hESCs. Supplementation of VEGF in EB medium led to a moderate down
regulation of OCT-4 expression; whereas the addition of BMP-4 or
BMP-4 plus VEGF resulted in a significant decrease in OCT-4
expression (p<0.0005, FIG. 13). There was no additive effect of
BMP-4 and VEGF on OCT-4 expression. The expression of T-brachyury
gene, the earliest marker expressed in mesoderm cells, was
downregulated in all samples except EBs derived from cultures
containing both BMP-4 and VEGF (the latter showing a significant
increase in its expression (p<0.0005). Similar expression
patterns were observed for CD31 and LMO2; significantly increased
levels of expression were only detected in EBs exposed to a
combination of BMP-4 and VEGF (p<0.0005). KDR, one of the most
studied VEGF receptor, has been shown to be expressed in all hESC
lines.sup.(4,5); its expression was dramatically down regulated in
EBs derived from media with no addition of exogenous factor, and
with supplement of BMP-4 or VEGF alone. However, a moderate but
significant increase in KDR expression was observed in EBs formed
in the presence of BMP-4 and VEGF (p<0.002), a condition that
promoted efficient development of hemangioblasts from hESCs.
Surprisingly, in contrast to a recent report.sup.(14), substantial
decreases in the expression of MixL and SCL/TAL-1 genes were
detected in EBs formed in all conditions. One possible explanation
is that growth in different serum-free media caused a different
expression pattern in these genes. Nevertheless, these results
suggest that the commitment and development of
mesoderm/hemangioblast from hESCs requires both BMP-4 and VEGF,
consistent with the results of blast colony development (FIG.
9).
Example 13
Identification of Surface Markers for Progenitors of Blast
Cells
[0397] In our original method.sup.(2), BCs were generated by
replating day 3.5 EBs cells in 1% methylcellulose supplemented with
defined factors. This strategy is important when identifying BCs
that possess the potential to form hematopoietic and endothelial
cells, and it is also reproducible when generating BCs from hESCs.
However, this approach utilizes dishes in standard tissue culture
incubators, and thus cannot be adapted to rotary bioreactors for
scale-up. This limitation is mainly due to the fact that cells from
day 3.5 EBs are heterogeneous and include undifferentiated hESCs
(only a portion of the cells are BC progenitors). Replating this
heterogeneous population in liquid culture would therefore lead to
the growth of all cells including the formation of secondary EBs
from undifferentiated hESCs, excluding their possible use in
clinical applications. However, if a marker(s) for the progenitor
of BCs can be identified, the purified progenitor can be seeded in
liquid culture adapted with a rotary bioreactor for scaled-up
production of BCs. We therefore selected 12 cell surface molecules
that are associated with the development of mesoderm derivatives.
The corresponding antibodies were used to enrich cells from day 3.5
EBs, and the enriched cells assayed for blast colony forming
ability. As shown in FIG. 14, KDR+ cells from 3.5 day EBs generated
three times more blast colonies than the unfractioned control cells
(p<0.01), which is consistent with previous studies.sup.(5).
Although we also found a moderate increase in blast colonies
(.apprxeq.1.5 fold) after plating CD31+ and CD34+ enriched
populations, the increase did not reach statistical significance.
All other enriched populations produced equal or less blast
colonies as compared with unfractioned control cells, indicating
that the BC progenitor does not express these molecules. The
unbound (flow through) cells of all antibodies tested also formed
similar numbers of blast colonies as the unfractioned cells,
suggesting that even KDR+, CD34+ and CD31+ cells represent a very
limited portion of the cells that are capable of forming blast
colonies.
TABLE-US-00002 TABLE 1 Sequences of gene-specific primers used in
qRT-PCR SEQ ID SEQ ID Gene Forward Primer, 5'- 3' NO Reverse
Primer, 5'- 3' NO Ref OCT-4 GAAGGTATTCAGCCAAACGC 16
GTTACAGAACCACACTCGGA 17 NA BRACH TGCTTCCCTGAGACCCAGTT 18
GATCACTTCTTTCCTTTGCAT 19 .sup.(33) CAAG MixL1 CCGAGTCCAGGATCCAGGTA
20 CTCTGACGCCGAGACTTGG 21 .sup.(33) KDR/Flk1 CCAGCCAAGCTGTCTCAGT 22
CTGCATGTCAGGTTGCAAAG 23 .sup. (4) CD31 GAGTCCTGCTGACCCTTCTG 24
ATTTTGCACCGTCCAGTCC 25 .sup. (4) Scl/TAL1 ATGAGATGGAGATTACTGATG 26
GCCCCGTTCACATTCTGCT 27 .sup. (4) LMO2 AACTGGGCCGGAAGCTCT 28
CTTGAAACATTCCAGGTGATA 29 .sup. (4) CA GAPDH CGATGCTGGCGCTGAGTAC 30
CCACCACTGACACGTTGGC 31 NA .beta.-Actin GCGGGAAATCGTGCGTGACA 32
GATGGAGTTGAAGGTAGTTTC 33 NA G
Example 14
Generation of Human Hemangio-Colony Forming Cells from Human ES
Cells
[0398] Human ES cell culture. The hES cell lines used in this study
were previously described H1 and H9 (NIH-registered as WA01 and
WA09) and four lines (MA01, MA03, MA40, and MA09) derived at
Advanced Cell Technology. Undifferentiated human ES cells were
cultured on inactivated (mitomycin C-treated) mouse embryonic
fibroblast (MEF) cells in complete hES media until they reach 80%
confluence (Klimanskaya & McMahon; Approaches of derivation and
maintenance of human ES cells: Detailed procedures and
alternatives, in Handbook of Stem Cells. Volume 1: Embryonic Stem
Cells, ed. Lanza, R. et al., (Elsevier/Academic Press, San Diego,
2004). Then the undifferentiated hES cells were dissociated by
0.05% trypsin-0.53 mM EDTA (Invitrogen) for 2-5 min and collected
by centrifugation at 1,000 rpm for 5 minutes.
[0399] EB formation. To induce hemangioblast precursor (mesoderm)
formation, hES cells (2 to 5.times.10.sup.5 cells/ml) were plated
on ultra-low attachment dishes (Corning) in serum-free Stemline
media (for e.g., Stemline I or II, Sigma.TM.) with the addition of
BMP-4 and VEGF.sub.165 (50 ng/ml, R&D Systems) and cultured in
5% CO2. Approximately 48 hours later, the EB medium was replenished
and supplemented with a cocktail of early hematopoietic/endothelial
growth factors. For example, half the media were removed and fresh
media were added with the same final concentrations of BMP-4 and
VEGF, plus SCF, TPO and FLT3 ligand (20 ng/ml, R&D Systems).
The triple protein transduction domain (tPTD)-HoxB4 fusion protein
(1.5 .mu.g/ml) was added to the culture media between 48-72 hr to
expand hemangioblast and its precursor.
[0400] Hemangioblast expansion. After 3.5-5 days, EBs were
collected and dissociated by 0.05% trypsin-0.53 mM EDTA
(Invitrogen) for 2-5 min, and a single cell suspension was prepared
by passing through 22G needle 3-5 times. Cells were collected by
centrifugation at 1,000 rpm for 5 minutes and counted. Cell pellets
were resuspended in 50-200 .mu.l of serum-free Stemline media. To
expand hemangioblasts, single cell suspensions from EBs derived
from differentiation of 2 to 5.times.10.sup.5 hES cells were mixed
with 2 ml BL-CFC/hemangioblast expansion media (BGM) containing
1.0% methylcellulose in Iscove's MDM, 1-2% Bovine serum albumin,
0.1 mM 2-mercaptoethanol and a cocktail of growth factors. For
example, 10 .mu.g/ml rh-Insulin, 200 .mu.g/ml iron saturated human
transferrin, 20 ng/ml rh-GM-CSF, 20 ng/ml rh-IL-3, 20 ng/ml
rh-IL-6, 20 ng/ml rh-G-CSF, 3 to 6 units/ml rh-EPO, 50 ng/ml
rh-SCF, 50 ng/ml rh-FLt3 ligand, 50 ng/ml rh-VEGF and 50 ng/ml
rh-BMP-4) ("rh" stands for "recombinant human") and 1.5 .mu.g/ml of
tPTD-HoxB4 fusion protein, with/without 50 ng/ml of TPO and FL was
added. The cell mixtures were plated on ultra-low attachment dishes
and incubated at 37.degree. C. in 5% CO.sub.2 for 4-7 days. After
4-6 days, grape-like hemangioblast blast colonies (referred to as
BL-CFCs or BCs) were visible by microscopy. Cytospin preparation
and Wright-Giemsa staining of the hES-derived blast colonies
confirmed morphologic features of immature blast cells. To extend
these results to other hES cell lines (WA09 [H9], MA01, MA03, MA40
and MA09, supplements of FL and Tpo were necessary for sustained
growth of the BC colonies (without FL and Tpo, small (10-20 cell
hES-BCs were obtained which died after 4-8 days). Epo was also
essential for BC formation and growth in all hES cell lines tested.
These cells could be readily expanded (one 6-well plate of hES
generated approximately 6.1.+-.0.66 [mean.+-.SD] million
hemangioblasts) under the well-defined and reproducible conditions
described above.
[0401] For BL-CFC immunocytochemical analysis, purified BL-CFCs
were cytospun onto polylysine treated glass slides and fixed in 4%
paraformaldehyde. For examining the expression of most genes,
primary antibodies were incubated at 4.degree. C. overnight,
followed by fluorescent dye labeled secondary antibodies, and
finally examined under fluorescent microscope. Normal human BM
cells, K562 cells and HUVEC were used as controls.
[0402] Immunocytochemical analysis revealed that the hES
cell-derived BL-CFCs or BCs expressed GATA-1 and GATA-2 proteins,
LMO2 proteins, CXCR-4, TPO and EPO receptors, and readily reacted
with antibody specific for CD71, the transferrin receptor (Table 1
and FIG. 16d-v). The cells expressed little or no CD31, CD34 and
KDR, or other adhesion molecules. As described more fully in
11/787,262, the cells are hemangio-colony forming cells.
Example 15
Expansion of a Distinct Cell Type
Non-Engrafting Hemangio Cell
[0403] As detailed above and in Ser. No. 11/787,262,
hemangio-colony forming cells were generated following expansion
for approximately 4-7 days. Under certain conditions, further
culture of EBs beyond 7 days produced large numbers of a distinct
cell type. As described throughout, this distinct progenitor cell
type is referred to as a non-engrafting hemangio cell.
[0404] EBs were cultured as described above. On day 7 of the
expansion protocol, following formation of grape-like clusters
indicative of hemangio-colony forming cells, 5 ml of BL-medium was
added on top of the these cultures of grape-like clusters of cells.
The cultures are semi-solid and contain 10 mL of methylcellulose
medium. Following addition of fresh medium, the cells are cultured
an additional 3-6 days, for a total of 10-13 days in culture
post-EB formation.
[0405] The addition of fresh medium greatly enhanced continued cell
proliferation and survival during these prolonged culture periods.
After 10-13 days in culture, cells were purified from the cluster.
Similar to hemangio-colony forming cells, these non-engrafting
hemangio cells formed grape-like clusters and were loosely adherent
to each other. However, as detailed below, these cells were not
identical to the previously identified hemangio-colony forming
cells.
[0406] When the cells were separated from the clusters on day 10,
and the yield of cells compared to the yield of hemangio-colony
forming cells generally observed when collected on day 7, we
observed a dramatic increase in the number of cells obtained.
Specifically, greater than 5 fold more cells were purified on day
10 versus day 7. As such, larger quantities of non-engrafting
hemangio cells can be readily produced and used, for example, to
produce larger quantities of differentiated cell types.
[0407] The cells identified after 10-13 days of expansion culture
are similar, in many respects, to the previously identified
hemangio-colony forming cells. For example, the cells are typically
loosely adherent to each other (like hemangio-colony forming
cells). Additionally, cells identified after 10-13 days of
expansion culture differentiated in vitro to produce hematopoietic
cell types. Specifically, non-engrafting hemangio cells retain the
capacity to form hematopoietic CFUs. Cells were separated from the
grape-like clusters after 10-13 days in culture and plated in
semi-solid methylcellulose medium containing cytokines that support
growth of hematopoietic CFUs. After 10-12 days in culture,
erythrocyte CFUs, granulocyte CFUs, macrophage CFUs, and mixed
hematopoietic CFUs were observed, thus demonstrating the potential
to produce hematopoietic cell types.
[0408] Despite the similarities between hemangio-colony forming
cells and the non-engrafting hemangio cells described herein, these
cells do not have the same differentiation potential. Without
wishing to be bound by any particular theory, the non-engrafting
hemangio cells may represent a developmentally distinct cell type
that, in contrast to hemangio-colony forming cells, are no longer
capable of engrafting into the bone marrow upon in vivo delivery to
an immunodeficient animal. Specifically, 1-5 million human
non-engrafting hemangio cells (e.g., cells cultured for 10-13 days
post-EB formation) were administered to NOD/SCID mice. Examination
of 24 mice failed to reveal engraftment of human cells into the
bone marrow or spleen. In contrast, when similar numbers of human
hemangio-colony forming cells (e.g., cells cultured for 6-8 days)
were administered to NOD/SCID mice, human cells engrafted in the
bone marrow of all 12 animals examined.
[0409] Other illustrative methods, compositions, preparations, and
features of the invention are described in the following documents:
U.S. application Ser. No. 11/787,262, filed Apr. 13, 2007, and
entitled "Hemangio-Colony Forming Cells." The teachings of this
application are hereby incorporated by reference in their
entirety.
[0410] It should be noted that Applicants consider all operable
combinations of the disclosed illustrative embodiments to be
patentable subject matter including combinations of the subject
matter disclosed in U.S. application Ser. No. 11/787,262. For
example, the non-engrafting hemangio cells provided herein (i) may
have one or more of the properties of the cells described in U.S.
application Ser. No. 11/787,262, (ii) may be formulated as
compositions, preparations, cryopreserved preparations, or purified
or mixed solutions as described in U.S. application Ser. No.
11/787,262, (iii) may be used therapeutically and in blood banking
as described in U.S. application Ser. No. 11/787,262, and (iv) may
be used to generate partially and terminally differentiated cell
types for in vitro or in vivo use as described in U.S. application
Ser. No. 11/787,262. Furthermore, the non-engrafting hemangio cells
can be derived from ES cells, ED cells, pluripotent stem cells
(including iPS cells) etc. using any of the methodologies described
herein and in U.S. application Ser. No. 11/787,262.
Example 16
Efficient Generation of Hemangioblasts from Human iPSCs
[0411] Based on the method to efficiently and reproducibly generate
large numbers of hemangioblasts from multiple hESC lines described
herein (see also Lu et al. Nat Methods 2007; 4:501-509; Lu et al.
Regen Med 2008; 3:693-704), the inventors further used the
hemangioblast platform to differentiate hESCs through
hemangioblastic progenitors into erythroid cells on a large scale
(approximately 10.sup.10 to 10.sup.11 cells/six-well plate hESCs),
which is over a thousand-fold more efficient than previously
reported. As discussed supra, the cells possess oxygen-transporting
capacity comparable to normal RBCs and respond to changes in pH
(Bohr effect) and 2,3-diphosphoglyerate (DPG) (see also, Lu et al.
Blood 2008; 112:4475-4484). Importantly, the erythroid cells
underwent multiple maturation events in vitro, including a
progressive decrease in size and increase in glycophorin A
expression, chromatin and nuclear condensation, and increased
expression of definitive adult .beta.-globin chain. Globin chain
specific immunofluorescent analysis showed that the cells (0% at 17
days) increased expression of the adult .beta.-globin chain to
16.37% after 28 days of in vitro culture. This process resulted in
the extrusion of the pycnotic nucleus in 30-60% of the cells
generating RBCs with a diameter of approximately 6-8 .mu.m. The
results show that it is feasible to differentiate and mature
hESC-derived hemangioblasts into functional oxygen-carrying
erythrocytes on a large scale.
[0412] Human iPSCs share a number of characteristics with hESCs,
and represent an important new source of stem cells. The
identification of an iPSC line with a O(--) genotype would permit
the production of ABO and RhD compatible (and pathogen-free)
"universal donor" RBCs, and using a patient's specific iPSC lines
would allow the generation of patient's own platelets in vitro for
transfusion. However, little has been reported about the capacity
of iPSCs to undergo directed differentiation, especially, toward
hemangioblasts. A recent report by Choi et al. (STEM CELLS 2009;
27(3):559-567) describes studies with human iPSCs utilizing an OP9
feeder-based culture system that yielded hematopoietic and
endothelial differentiation, demonstrating the potential of human
iPSCs. Similarly, Zhang et al. (Circ Res 2009; 104:e30-e41.)
reports the derivation of functional cardiomyocytes from human
iPSCs, albeit with low efficiency compared to hESCs, using EB
method. Therefore, efficient generation of hemangioblasts from
human iPSCs is described herein. The inventors describe conditions
for efficient generation of hemangioblasts from human iPSCs, using
their experiences with the hESC system.
Generation of High Quality iPSCs
[0413] In several of the inventors' preliminary studies, they are
able to generate hemangioblast colonies from human IMR90 (FIG. 20c)
and Adult4-3 iPSCs (data not shown), using the optimized hESC
differentiation conditions. Although their efficiency was much
lower compared to hESCs, they clearly demonstrate the hemangioblast
differentiation potential of human iPSCs. The observed low
efficiency may be due to multiple factors, one of them being the
quality of the iPSCs. The inventors observed this to be one of the
most important factors for high-efficient generation of
hemangioblasts. High quality hESC cultures are composed of colonies
with tight borders with minimal signs of differentiation as seen
under microscope, at about 80% confluence, but not touching each
other. They grow at a moderate rate: 1:3 split passaged hESCs will
reach confluence in 3-5 days with positive staining of pluripotency
markers in almost every cell. High quality hESCs usually generate a
high number of EB cells (e.g. 2.times.10.sup.6 high quality hESCs
will generate=2-3.times.10.sup.6 EB cells after 3.5 days). The
critical steps for obtaining high quality iPSCs include: (1)
passaging with trypsin vs. collagenase: The inventors have
demonstrated that hESCs can be routinely passaged by trypsin/EDTA
after the initial adaptation from mechanically passaged cultures
has been performed (Klimanskaya et al. Approaches of derivation and
maintenance of human ES cells: Detailed procedures and
alternatives. In: Lanza Rea, ed. Handbook of Stem Cells. Volume 1:
Embryonic Stem Cells. New York, USA: Elsevier/Academic Press,
2004:437-449.). In the inventors' experience, trypsin works better
than widely used collagenase IV because it produces smaller cell
clumps (2-5 cells) and single cells that form more uniformly
distributed and similarly sized colonies, which will eliminate
premature contact between colonies and limit spontaneous
differentiation, whereas collagenase passaging results in larger
colonies that show more extensive differentiation and have to be
passed either at a lower splitting ratio or before the desired
density of the culture is reached. Overall, trypsin/EDTA passaging
allows the ability to scale up the culture 3-4 times faster than
collagenase and to get a homogenous cell population. These
observations may also be valid for human iPSCs. The inventors
experiments showed that human iPSCs can be adapted to trypsin
digestion, and these cells maintain undifferentiated status after
more than 20 passages; (2) Maintaining with mouse embryonic
fibroblasts (MEF feeder) or feeder-free: long term maintenance of
hESCs and iPSCs required MEF feeders. The culturing of hESCs and
iPSCs on MEF feeder layers prevents complete elimination of animal
components, and raises concerns for the potential clinical
applications of derivatives generated from hESCs and iPSCs
maintained under these conditions. Therefore, the first step has
been taken to determine whether hemangioblasts can be generated
from hESCs maintained on Matrigel matrix in mTeSR medium. The
inventors have demonstrated that a significantly higher number
(3-fold increase) of hemangioblasts were generated with feeder-free
hESCs as compared to hESCs cultured on MEF feeders when identical
numbers of EB cells were plated (p<0.05) for all three tested
hESC lines WA01, MA01 and HuES-3 (Lu et al. Regen Med 2008;
3:693-704.). The inventors then initiated the experiments of
culturing human iPSCs in the above feeder-free system, and human
iPSCs maintained in feeder-free condition expressed the
pluoripotency markers of Nanog, Oct-4, SSEA-4, and Tra-1-60 (FIG.
19). Whether human iPSCs from feeder-free condition will
differentiate to hemangioblasts with high efficiency will be
tested.
Optimization of Embryoid Body (EB) Formation and Differentiation:
Human
[0414] iPSCs show poor survival ability after cell dissociation and
during EB formation, a phenomenon also observed for hESCs. It has
been shown that addition of a selective Rho-associated kinase
(ROCK) inhibitor. Y-27632, to serum-free EB formation medium
prevents hESCs from apoptosis, enhances EB formation, and promotes
differentiation (Watanabe et al. Nat Biotechnol 2007; 25:681-686).
The experiments showed that supplement of Y-27632 in the serum-free
EB formation and differentiation medium resulted in better
formation of EBs from human iPS(IMR90)-1 cells than control medium:
EBs in StemLine II medium plus cytokines only are usually smaller
with many dead cells after 24 hrs; whereas EBs in medium added with
Y-27632 are smooth and large with many fewer dead cells surrounding
them (FIGS. 20a and 20b), indicating healthier EBs were formed.
After plating for blast colony formation, cells from EBs treated
with Y-27632 developed substantial more and healthier blast
colonies than that derived from EBs without Y-27632 treatment
(FIGS. 20c and 20d), generating >2 fold more hemangioblasts.
Previous studies also suggest that insulin, a component in almost
all cell culture media including StemLine II medium used in the EB
formation system described herein, is a potent inhibitor of hESC
mesoderm differentiation, possibly through PI3K/Akt signaling
pathway. Inhibition of PI3K/Akt signaling pathway enhanced mesoderm
differentiation of hESCs in serum-free conditions (Freund et al.
Stem Cells 2008; 26:724-733.). The results showed that
supplementation with a PI3K/Akt signaling pathway inhibitor in EB
formation and differentiation medium substantially increased the
formation of hemangioblasts from MA09 hESCs. A >2.5 fold
increase of hemangioblasts was obtained from dishes treated with
PI3K/Akt inhibitor as compared with dishes from controls.
Similarly, supplementation with the PI3K/Akt signaling pathway
inhibitor alone or plus Y-27632 during EB formation also resulted
in more and healthier blast colonies from iPS(IMR90)-1 cells than
controls (FIG. 20e), producing 2.1-fold and 2.6 fold more
hemangioblasts for PI3K/Art inhibitor treated EBs and PI3K/Art
inhibitor plus ROCK inhibitor treated EBs, respectively. The
hemangioblasts were then purified and plated under conditions for
hematopoietic or endothelial cell differentiation. As shown in FIG.
20f-20j, these cells differentiated into both hematopoietic and
endothelial cells after replating under appropriate conditions.
Example 17
Directed Differentiation of hESCs into Megakaryocyte and
Platelets
[0415] Pluripotent human embryonic stem cells (hESCs) and iPS cells
are potential alternative sources for blood cells used in
transfusion therapies. In addition, directed hESC differentiation
into blood can provide a useful tool to study the ontogeny of
hematopoiesis. Efficient and directed differentiation of hESCs into
transfusible megakaryocytes/platelets is of great clinical
significances. However, previously reported methods for generating
megakaryocytes and platelets from human ESCs are problematic for
potential clinical applications, because 1) the yield of
megakaryocytes/platelets from hESCs are too low, 2) they require
undefined animal stromal cells (e.g., OP9) and 3) these methods
will be difficult to scale up for massive production (Gaur et al. J
Thromb Haemost 2006; 4:436-442; Takayama et al. Blood 2008;
111:5298-5306.). A robust model system that can efficiently
generate large numbers of hemangioblasts (blast cells, BCs) from
multiple hESC lines using well-defined conditions is described
herein (see also Lu et al. Nat Methods 2007; 4:501-509; Lu et al.,
Regen Med 2008; 3:693-704). These BCs can be further induced to
produce functional RBCs in large scale as described herein (see
also Lu et al. Blood 2008; 112:4475-4484). Since RBCs and
megakaryocytes come from common progenitors, the explored the
possibility of producing megakaryocytes and platelets from our hESC
derived hemangioblasts.
Diagram of Culture Methods for Generating Megakaryocytes
[0416] Serum free hES cells.fwdarw.Embryoid Body Day
3.5-4.fwdarw.Blast Culture Day 6.fwdarw.Megakaryocyte culture Day
7
[0417] Three hESC lines are tested so far for MK generation: H1, H7
and HuES-3. Standard protocol was used to generate hemangioblasts
(see also Lu et al. Nat Methods 2007; 4:501-509; Lu et al. Regen
Med 2008; 3:693-704). Briefly, human ES cells were cultured in
serum free media and harvested for embryoid body (EB) culture. Day
3 to 4 EB cells were collected and prepared as single cell
suspension. 5.times.10.sup.5 EB cells were resuspended in 1 ml
blast growth media for the production of hemangioblasts. Cells from
day 8 hemangioblast culture were harvested for setting up MK
culture suspension in suspension. In summary, the have successfully
adapted the hemangioblast model system to efficiently generate
megakaryocytes and platelets from hESCs. Using the improved blast
culture method, the inventors can now routinely produce 10 million
blast cells from one million hESCs after 6 to 8 days of
hemangioblast culture (see also Lu et al. Regen Med 2008;
3:693-704). For directed differentiation into megakaryocyte
lineage, these blast cells are harvested and plated in liquid
megakaryocyte maturation culture in serum free media supplemented
with defined growth factors including TPO. 1.5 to 2 times increase
in cell number at the early stage of this culture is usually
obtained. The limited expansion under the current condition is
likely due to the death of cells committed to other lineages and
the initiation of endomitosis of megakaryocytes. By day 4 of liquid
maturation culture, greater than 90% CD41a+ megakaryocytes can be
achieved without the need of purification (FIG. 21A). Majority of
these CD41a+ megakaryocytes are co-expressing CD42b, an additional
marker for megakaryocytes. As a result, 8 to 9 million CD41+
megakaryocytes can be produced from one million hESCs in 14 to 15
days. In comparison, the most recent article by Takayama et al.
reported the generation of 2 million CD41a+ megakaryocytes (50% of
total population) from one million hESCs using a co-culture system
with OP9 stromal cells and fetal bovine serum (Takayama et al.
Blood 2008; 111:5298-5306). Clearly, hemangioblast system described
herein represents a significant improvement for in vitro generation
of megakaryocytes from hESCs.
[0418] In addition to cell surface markers, Giemsa staining shows
that megakaryocytes in maturation culture increase in cell size,
undergo endomitosis and become polyploid (FIG. 21C). Furthermore,
specific immunostaining of von Willebrand Factor (VWF) in cellular
granules indicates that the cytoplasmic maturation process occurs
in these cells (FIG. 21D). By day 6 of liquid maturation culture,
greater than 50% of CD41a+ cells show >4 n DNA content by FACS
analysis (FIG. 21B). Importantly, these in vitro derived
megakaryocytes undergo terminal differentiation by showing
proplatelet formation, an essential step towards thrombopoiesis
(FIG. 21E). With the current conditions described herein,
proplatelet forming cells are observed as early as day 3 in liquid
culture and usually reach to a peak of 2-3% of viable cells by day
7 to 8.
[0419] After the removal of cells by centrifugation, the
supernatant of megakaryocyte maturation culture was examined for
platelet generation. Indeed, CD41a+ particles are detected and
their forward and side scatter characteristics are very similar to
human peripheral blood platelets controls used in our FACS analysis
(FIG. 22).
REFERENCES
[0420] 1. Wagner R C: Endothelial cell embryology and growth. Adv.
Microcirc. 9, 45-75 (1980). [0421] 2. Lu S J, Feng Q, Caballero S
et al: Generation of functional hemangioblasts from human embryonic
stem cells. Nat. Methods 4(6), 501-509 (2007). [0422] 3. Wang L, Li
L, Shojaei F et al: Endothelial and hematopoietic cell fate of
human embryonic stem cells originates from primitive endothelium
with hemangioblastic properties. Immunity. 21(1), 31-41 (2004).
[0423] 4. Zambidis E T, Peault B, Park T S, Bunz F, Civin C I:
Hematopoietic differentiation of human embryonic stem cells
progresses through sequential hematoendothelial, primitive, and
definitive stages resembling human yolk sac development. Blood
106(3), 860-870 (2005). [0424] 5. Kennedy M, D'Souza S L,
Lynch-Kattman M, Schwantz S, Keller G: Development of the
hemangioblast defines the onset of hematopoiesis in human ES cell
differentiation cultures. Blood 109(7), 2679-2687 (2007). [0425] 6.
Klimanskaya I, McMahon J. Approaches of derivation and maintenance
of human ES cells: Detailed procedures and alternatives. In:
Handbook of Stem Cells. Volume 1: Embryonic Stem Cells. Lanza Rea
(Eds.). Elsevier/Academic Press, 2004) [0426] 7. Ludwig T E,
Bergendahl V, Levenstein M E, Yu J, Probasco M D, Thomson J A:
Feeder-independent culture of human embryonic stem cells. Nat.
Methods 3(8), 637-646 (2006). [0427] 8. Ludwig T E, Levenstein M E,
Jones J M et al: Derivation of human embryonic stem cells in
defined conditions. Nat. Biotechnol. 24(2), 185-187 (2006). [0428]
9. Livak K J, Schmittgen T D: Analysis of relative gene expression
data using real-time quantitative PCR and the 2(-Delta Delta C(T))
Method. Methods 25(4), 402-408 (2001). [0429] 10. Lu S J, Feng Q,
Ivanova Y et al: Recombinant HoxB4 Fusion Proteins Enhance
Hematopoietic Differentiation of Human Embryonic Stem Cells. Stem
Cells Dev. 16(4), 547-560 (2007). [0430] 11. Soker S, Takashima S,
Miao H Q, Neufeld G, Klagsbrun M: Neuropilin-1 is expressed by
endothelial and tumor cells as an isoform-specific receptor for
vascular endothelial growth factor. Cell 92(6), 735-745 (1998).
[0431] 12. Faloon P, Arentson E, Kazarov A et al: Basic fibroblast
growth factor positively regulates hematopoietic development.
Development 127(9), 1931-1941 (2000). [0432] 13. Pearson S,
Sroczynska P, Lacaud G, Kouskoff V: The stepwise specification of
embryonic stem cells to hematopoietic fate is driven by sequential
exposure to Bmp4, activin A, bFGF and VEGF. Development 135(8),
1525-1535 (2008). [0433] 14. Pick M, Azzola L, Mossman A, Stanley E
G, Elefanty A G: Differentiation of human embryonic stem cells in
serum-free medium reveals distinct roles for bone morphogenetic
protein 4, vascular endothelial growth factor, stem cell factor,
and fibroblast growth factor 2 in hematopoiesis. Stem Cells 25(9),
2206-2214 (2007). [0434] 15. Martin M J, Muotri A, Gage F, Varki A:
Human embryonic stem cells express an immunogenic nonhuman sialic
acid. Nat. Med. 11(2), 228-232 (2005). [0435] 16. Huber T L, Zhou
Y, Mead P E, Zon L I: Cooperative effects of growth factors
involved in the induction of hematopoietic mesoderm. Blood 92(11),
4128-4137 (1998). [0436] 17. Winnier G, Blessing M, Labosky P A,
Hogan B L: Bone morphogenetic protein-4 is required for mesoderm
formation and patterning in the mouse. Genes Dev. 9(17), 2105-2116
(1995). [0437] 18. Johansson B M, Wiles M V: Evidence for
involvement of activin A and bone morphogenetic protein 4 in
mammalian mesoderm and hematopoietic development. Mol. Cell Biol.
15(1), 141-151 (1995). [0438] 19. Wiles M V, Johansson B M:
Embryonic stem cell development in a chemically defined medium.
Exp. Cell Res. 247(1), 241-248 (1999). [0439] 20. Nakayama N, Lee
J, Chiu L: Vascular endothelial growth factor synergistically
enhances bone morphogenetic protein-4-dependent lymphohematopoietic
cell generation from embryonic stem cells in vitro. Blood 95(7),
2275-2283 (2000). [0440] 21. Li F, Lu S-J, Vida L, Thomson J A,
Honig G R: Bone morphogenetic protein-4 induces efficient
hematopoietic differentiation of rhesus monkey embryonic stem cells
in vitro. Blood 98(2), 335-342 (2001). [0441] 22. Tian X, Morris J
K, Linehan J L, Kaufman D S: Cytokine requirements differ for
stroma and embryoid body-mediated hematopoiesis from human
embryonic stem cells. Exp. Hematol. 32(10), 1000-1009 (2004).
[0442] 23. Chadwick K, Wang L, Li L et al: Cytokines and BMP-4
promote hematopoietic differentiation of human embryonic stem
cells. Blood 2003 102(3), 906-915 (2003). [0443] 24. Cerdan C,
Rouleau A, Bhatia M: VEGF-A165 augments erythropoietic development
from human embryonic stem cells. Blood 103(7), 2504-2512 (2004).
[0444] 25. Park C, Afrikanova I, Chung Y S et al: A hierarchical
order of factors in the generation of FLK- and SCL-expressing
hematopoietic and endothelial progenitors from embryonic stem
cells. Development 131(11), 2749-2762 (2004). [0445] 26. Xu C,
Rosier E, Jiang J et al: Basic fibroblast growth factor supports
undifferentiated human embryonic stem cell growth without
conditioned medium. Stem Cells 23(3), 315-323 (2005). [0446] 27. Xu
R H, Peck R M, Li D S, Feng X, Ludwig T, Thomson J A: Basic FGF and
suppression of BMP signaling sustain undifferentiated proliferation
of human ES cells. Nat. Methods 2(3), 185-190 (2005). [0447] 28.
Levenstein M E, Ludwig T E, Xu R H et al: Basic fibroblast growth
factor support of human embryonic stem cell self-renewal. Stem
Cells 24(3), 568-574 (2006). [0448] 29. Yeoh J S, van O R, Weersing
E et al: Fibroblast growth factor-1 and -2 preserve long-term
repopulating ability of hematopoietic stem cells in serum-free
cultures. Stem Cells 24(6), 1564-1572 (2006). [0449] 30. Dell'Era
P, Ronca R, Coco L, Nicoli S, Metra M, Presta M: Fibroblast growth
factor receptor-1 is essential for in vitro cardiomyocyte
development. Circ. Res. 93(5), 414-420 (2003). [0450] 31. de H G,
Weersing E, Dontje B et al: In vitro generation of long-term
repopulating hematopoietic stem cells by fibroblast growth
factor-1. Dev. Cell 4(2), 241-251 (2003). [0451] 32. Ginis I, Luo
Y, Miura T et al: Differences between human and mouse embryonic
stem cells. Dev. Biol. 269(2), 360-380 (2004). [0452] 33. D'Amour K
A, Agulnick A D, Eliazer S, Kelly O G, Kroon E, Baetge E E:
Efficient differentiation of human embryonic stem cells to
definitive endoderm. Nat. Biotechnol. 23(12), 1534-1541 (2005).
[0453] Various embodiments of the invention are described above in
the Detailed Description. While these descriptions directly
describe the above embodiments, it is understood that those skilled
in the art may conceive modifications and/or variations to the
specific embodiments shown and described herein. Any such
modifications or variations that fall within the purview of this
description are intended to be included therein as well. Unless
specifically noted, it is the intention of the inventors that the
words and phrases in the specification and claims be given the
ordinary and accustomed meanings to those of ordinary skill in the
applicable art(s).
[0454] The foregoing description of various embodiments of the
invention known to the applicant at this time of filing the
application has been presented and is intended for the purposes of
illustration and description. The present description is not
intended to be exhaustive nor limit the invention to the precise
form disclosed and many modifications and variations are possible
in the light of the above teachings. The embodiments described
serve to explain the principles of the invention and its practical
application and to enable others skilled in the art to utilize the
invention in various embodiments and with various modifications as
are suited to the particular use contemplated. Therefore, it is
intended that the invention not be limited to the particular
embodiments disclosed for carrying out the invention.
[0455] While particular embodiments of the present invention have
been shown and described, it will be obvious to those skilled in
the art that, based upon the teachings herein, changes and
modifications may be made without departing from this invention and
its broader aspects and, therefore, the appended claims are to
encompass within their scope all such changes and modifications as
are within the true spirit and scope of this invention. It will be
understood by those within the art that, in general, terms used
herein are generally intended as "open" terms (e.g., the term
"including" should be interpreted as "including but not limited
to," the term "having" should be interpreted as "having at least,"
the term "includes" should be interpreted as "includes but is not
limited to," etc.).
Sequence CWU 1
1
391251PRTHomo sapiens 1Met Ala Met Ser Ser Phe Leu Ile Asn Ser Asn
Tyr Val Asp Pro Lys1 5 10 15Phe Pro Pro Cys Glu Glu Tyr Ser Gln Ser
Asp Tyr Leu Pro Ser Asp 20 25 30His Ser Pro Gly Tyr Tyr Ala Gly Gly
Gln Arg Arg Glu Ser Ser Phe 35 40 45Gln Pro Glu Ala Gly Phe Gly Arg
Arg Ala Ala Cys Thr Val Gln Arg 50 55 60Tyr Ala Ala Cys Arg Asp Pro
Gly Pro Pro Pro Pro Pro Pro Pro Pro65 70 75 80Pro Pro Pro Pro Pro
Pro Pro Gly Leu Ser Pro Arg Ala Pro Ala Pro 85 90 95Pro Pro Ala Gly
Ala Leu Leu Pro Glu Pro Gly Gln Arg Cys Glu Ala 100 105 110Val Ser
Ser Ser Pro Pro Pro Pro Pro Cys Ala Gln Asn Pro Leu His 115 120
125Pro Ser Pro Ser His Ser Ala Cys Lys Glu Pro Val Val Tyr Pro Trp
130 135 140Met Arg Lys Val His Val Ser Thr Val Asn Pro Asn Tyr Ala
Gly Gly145 150 155 160Glu Pro Lys Arg Ser Arg Thr Ala Tyr Thr Arg
Gln Gln Val Leu Glu 165 170 175Leu Glu Lys Glu Phe His Tyr Asn Arg
Tyr Leu Thr Arg Arg Arg Arg 180 185 190Val Glu Ile Ala His Ala Leu
Cys Leu Ser Glu Arg Gln Ile Lys Ile 195 200 205Trp Phe Gln Asn Arg
Arg Met Lys Trp Lys Lys Asp His Lys Leu Pro 210 215 220Asn Thr Lys
Ile Arg Ser Gly Gly Ala Ala Gly Ser Ala Gly Gly Pro225 230 235
240Pro Gly Arg Pro Asn Gly Gly Pro Arg Ala Leu 245 25022042DNAHomo
sapiens 2ggaaaacgag tcaggggtcg gaataaattt tagtatattt tgtgggcaat
tcccagaaat 60taatggctat gagttctttt ttgatcaact caaactatgt cgaccccaag
ttccctccat 120gcgaggaata ttcacagagc gattacctac ccagcgacca
ctcgcccggg tactacgccg 180gcggccagag gcgagagagc agcttccagc
cggaggcggg cttcgggcgg cgcgcggcgt 240gcaccgtgca gcgctacgcg
gcctgccggg accctgggcc cccgccgcct ccgccaccac 300ccccgccgcc
cccgccaccg cccggtctgt cccctcgggc tcctgcgccg ccacccgccg
360gggccctcct cccggagccc ggccagcgct gcgaggcggt cagcagcagc
cccccgccgc 420ctccctgcgc ccagaacccc ctgcacccca gcccgtccca
ctccgcgtgc aaagagcccg 480tcgtctaccc ctggatgcgc aaagttcacg
tgagcacggt aaaccccaat tacgccggcg 540gggagcccaa gcgctctcgg
accgcctaca cgcgccagca ggtcttggag ctggagaagg 600aatttcacta
caaccgctac ctgacacggc gccggagggt ggagatcgcc cacgcgctct
660gcctctccga gcgccagatc aagatctggt tccagaaccg gcgcatgaag
tggaaaaaag 720accacaagtt gcccaacacc aagatccgct cgggtggtgc
ggcaggctca gccggagggc 780cccctggccg gcccaatgga ggcccccgcg
cgctctagtg cccccgcacg cgggagccac 840gaacctcggg gtgggggtgg
gcagtgagtg caggggatgg ggtgggggga caggaggggg 900ccctggggcc
tgggccccgg aaaaatctat ctgccctccc ccacacttta tatacgaata
960aacgcagaag agggggaggg gaagctttat ttatagaaat gacaatagag
ggccacgggg 1020aggccccccc agaagcaaga ttcaaatctc ttgctttctt
tcttaaaaaa aagaaaaaga 1080aaaagcaaga agaaggaaga aagaaaaaga
cagaaagaga aataggagga ggctgcagct 1140cctcgttttc agctttggcg
aagatggatc cacgtttcat ctttaatcac gccaggtcca 1200ggcccatctg
tcttgtttcc tctgccgagg agaagacggg cctcggtggc gaccattacc
1260tcgacacccg ctaacaaatg aggcccggct cggccgcctc cgcctctgct
actgccgctg 1320ctggaagaca gcctggattt cctttctttg tcccccactc
ccgataccca gcgaaagcac 1380cctctgactg ccagatagtg cagtgttttg
gtcacggtaa cacacacaca ctctccctca 1440tctttcgtgc ccattcactg
agggccagaa tgactgctca cccacttcca ccgtggggtt 1500gggggtgggc
aacagaggag gggagcaagt agggaagggg gtggccttga caactcagga
1560gtgagcagga aaattgagtc caaggaaaaa gagagactca gagacccggg
agggccttcc 1620tctgaaaggc caagccaagc catgcttggc agggtgaggg
gccagttgag ttctgggagc 1680tgggcactac tctgccagtc cagagttgta
cagcagaagc ctctctccta gactgaaaat 1740gaatgtgaaa ctaggaaata
aaatgtgccc ctcccagtct gggaggagga tgttgcagag 1800ccctctccca
tagtttatta tgttgcatcg tttattatta ttattgataa tattattatt
1860actatttttt tgtgtcatgt gagtcctctc tccttttctc tttctgacat
tccaaaacca 1920ggccccttcc tacctctggg gctgcttgag tctagaaccc
ttcgtatgtg tgaatatctg 1980tgtgctgtac agagtgacaa tagaaataaa
tgtttggttt cttgtgacca gcaaaaaaaa 2040aa 20423251PRTHomo sapiens
3Met Ala Met Ser Ser Phe Leu Ile Asn Ser Asn Tyr Val Asp Pro Lys1 5
10 15Phe Pro Pro Cys Glu Glu Tyr Ser Gln Ser Asp Tyr Leu Pro Ser
Asp 20 25 30His Ser Pro Gly Tyr Tyr Ala Gly Gly Gln Arg Arg Glu Ser
Ser Phe 35 40 45Gln Pro Glu Ala Gly Phe Gly Arg Arg Ala Ala Cys Thr
Val Gln Arg 50 55 60Tyr Ala Ala Cys Arg Asp Pro Gly Pro Pro Pro Pro
Pro Pro Pro Pro65 70 75 80Pro Pro Pro Pro Pro Pro Pro Gly Leu Ser
Pro Arg Ala Pro Ala Pro 85 90 95Pro Pro Ala Gly Ala Leu Leu Pro Glu
Pro Gly Gln Arg Cys Glu Ala 100 105 110Val Ser Ser Ser Pro Pro Pro
Pro Pro Cys Ala Gln Asn Pro Leu His 115 120 125Pro Ser Pro Ser His
Ser Ala Cys Lys Glu Pro Val Val Tyr Pro Trp 130 135 140Met Arg Lys
Val His Val Ser Thr Val Asn Pro Asn Tyr Ala Gly Gly145 150 155
160Glu Pro Lys Arg Ser Arg Thr Ala Tyr Thr Arg Gln Gln Val Leu Glu
165 170 175Leu Glu Lys Glu Phe His Tyr Asn Arg Tyr Leu Thr Arg Arg
Arg Arg 180 185 190Val Glu Ile Ala His Ala Leu Cys Leu Ser Glu Arg
Gln Ile Lys Ile 195 200 205Trp Phe Gln Asn Arg Arg Met Lys Trp Lys
Lys Asp His Lys Leu Pro 210 215 220Asn Thr Lys Ile Arg Ser Gly Gly
Ala Ala Gly Ser Ala Gly Gly Pro225 230 235 240Pro Gly Arg Pro Asn
Gly Gly Pro Arg Ala Leu 245 25042040DNAHomo sapiens 4ggaaaacgag
tcaggggtcg gaataaattt tagtatattt tgtgggcaat tcccagaaat 60taatggctat
gagttctttt ttgatcaact caaactatgt cgaccccaag ttccctccat
120gcgaggaata ttcacagagc gattacctac ccagcgacca ctcgcccggg
tactacgccg 180gcggccagag gcgagagagc agcttccagc cggaggcggg
cttcgggcgg cgcgcggcgt 240gcaccgtgca gcgctacgcg gcctgccggg
accctgggcc cccgccgcct ccgccaccac 300ccccgccgcc cccgccaccg
cccggtctgt cccctcgggc tcctgcgccg ccacccgccg 360gggccctcct
cccggagccc ggccagcgct gcgaggcggt cagcagcagc cccccgccgc
420ctccctgcgc ccagaacccc ctgcacccca gcccgtccca ctccgcgtgc
aaagagcccg 480tcgtctaccc ctggatgcgc aaagttcacg tgagcacggt
aaaccccaat tacgccggcg 540gggagcccaa gcgctctcgg accgcctaca
cgcgccagca ggtcttggag ctggagaagg 600aatttcacta caaccgctac
ctgacacggc gccggagggt ggagatcgcc cacgcgctct 660gcctctccga
gcgccagatc aagatctggt tccagaaccg gcgcatgaag tggaaaaaag
720accacaagtt gcccaacacc aagatccgct cgggtggtgc ggcaggctca
gccggagggc 780cccctggccg gcccaatgga ggcccccgcg cgctctagtg
cccccgcacg cgggagccac 840gaacctcggg gtgggggtgg gcagtgagtg
caggggatgg ggtgggggga caggaggggg 900ccctggggcc tgggccccgg
aaaaatctat ctgccctccc ccacacttta tatacgaata 960aacgcagaag
agggggaggg gaagctttat ttatagaaat gacaatagag ggccacgggg
1020aggccccccc agaagcaaga ttcaaatctc ttgctttctt tcttaaaaaa
aagaaaaaga 1080aaaagcaaga agaaggaaga aagaaaaaga cagaaagaga
aataggagga ggctgcagct 1140cctcgttttc agctttggcg aagatggatc
cacgtttcat ctttaatcac gccaggtcca 1200ggcccatctg tcttgtttcc
tctgccgagg agaagacggg cctcggtggc gaccattacc 1260tcgacacccg
ctaacaaatg aggcccggct cggccgcctc cgcctctgct actgccgctg
1320ctggaagaca gcctggattt cctttctttg tcccccactc ccgataccca
gcgaaagcac 1380cctctgactg ccagatagtg cagtgttttg gtcacggtaa
cacacacaca ctctccctca 1440tctttcgtgc ccattcactg agggccagaa
tgactgctca cccacttcca ccgtggggtt 1500gggggtgggc aacagaggag
gggagcaagt agggaagggg gtggccttga caactcagga 1560gtgagcaggg
aaattgagtc caaggaaaaa gagagactca gagacccggg agggccttcc
1620tctgaaaggc caagccaagc catgcttggc agggtgaggg gccagttgag
ttctgggagc 1680tgggcactac tctgccagtc cagagttgta cagcagaagc
ctctctccta gactgaaaat 1740gaatgtgaaa ctaggaaata aaatgtgccc
ctcccagtct gggaggagga tgttgcagag 1800ccctctccca tagtttatta
tgttgcatcg tttattatta ttattgataa tattattatt 1860actatttttt
tgtgtcatgt gagtcctctc tccttttctc tttctgacat tccaaaacca
1920ggccccttcc tacctctggg gctgcttgag tctagaaccc ttcgtatgtg
tgaatatctg 1980tgtgctgtac agagtgacaa tagaaataaa tgtttggttt
cttgtgaaaa aaaaaaaaaa 2040511PRTHuman immunodeficiency virus 5Tyr
Gly Arg Lys Lys Arg Arg Gln Arg Arg Arg1 5 1069PRTHuman
immunodeficiency virus 6Arg Lys Lys Arg Arg Gln Arg Arg Arg1
5711PRTArtificialsynthetic construct 7Tyr Ala Arg Lys Ala Arg Arg
Gln Ala Arg Arg1 5 10811PRTArtificialsynthetic construct 8Tyr Ala
Arg Ala Ala Ala Arg Gln Ala Arg Ala1 5 10911PRTArtificialsynthetic
construct 9Tyr Ala Arg Ala Ala Arg Arg Ala Ala Arg Arg1 5
101011PRTArtificialsynthetic construct 10Arg Ala Arg Ala Ala Arg
Arg Ala Ala Arg Ala1 5 101116PRTDrosophila antennapedia 11Arg Gln
Ile Lys Ile Trp Phe Gln Asn Arg Arg Met Lys Trp Lys Lys1 5 10
151234PRTHerpes simplex virus 1 12Asp Ala Ala Thr Ala Thr Arg Gly
Arg Ser Ala Ala Ser Arg Pro Thr1 5 10 15Glu Arg Pro Arg Ala Pro Ala
Arg Ser Ala Ser Arg Pro Arg Arg Pro 20 25 30Val
Glu137PRTArtificialsynthetic construct 13Arg Arg Arg Arg Arg Arg
Arg1 51411PRTArtificialsynthetic construct 14Tyr Ala Arg Ala Ala
Ala Arg Gln Ala Arg Ala1 5 101511PRTArtificialsynthetic construct
15Tyr Ala Arg Ala Ala Ala Arg Gln Ala Arg Ala1 5 101620DNAHomo
sapiens 16gaaggtattc agccaaacgc 201720DNAHomo sapiens 17gttacagaac
cacactcgga 201820DNAHomo sapiens 18tgcttccctg agacccagtt
201925DNAHomo sapiens 19gatcacttct ttcctttgca tcaag 252020DNAHomo
sapiens 20ccgagtccag gatccaggta 202119DNAHomo sapiens 21ctctgacgcc
gagacttgg 192219DNAHomo sapiens 22ccagccaagc tgtctcagt
192320DNAHomo sapiens 23ctgcatgtca ggttgcaaag 202420DNAHomo sapiens
24gagtcctgct gacccttctg 202519DNAHomo sapiens 25attttgcacc
gtccagtcc 192621DNAHomo sapiens 26atgagatgga gattactgat g
212719DNAHomo sapiens 27gccccgttca cattctgct 192818DNAHomo sapiens
28aactgggccg gaagctct 182923DNAHomo sapiens 29cttgaaacat tccaggtgat
aca 233019DNAHomo sapiens 30cgatgctggc gctgagtac 193119DNAHomo
sapiens 31ccaccactga cacgttggc 193220DNAHomo sapiens 32gcgggaaatc
gtgcgtgaca 203322DNAHomo sapiens 33gatggagttg aaggtagttt cg
223422DNAHomo sapiens 34tgaccctgag atggctgtca cc 223522DNAHomo
sapiens 35agcaacgata cccagtttgt ct 223622DNAHomo sapiens
36gccgtgtgcc agaggcgcat gt 223722DNAHomo sapiens 37aatgtccaca
gtcactcgcc ac 223823DNAHomo sapiens 38tgctggaggt gcgcgcctac aag
233922DNAHomo sapiens 39gtagaaatcg ccctcgtcct tg 22
* * * * *