U.S. patent application number 12/943722 was filed with the patent office on 2011-04-07 for human g-protein chemokine receptor (ccr5) hdgnr10.
This patent application is currently assigned to Human Genome Sciences, Inc.. Invention is credited to Viktor Roschke, Craig A. Rosen, Steven M. Ruben.
Application Number | 20110081360 12/943722 |
Document ID | / |
Family ID | 46150072 |
Filed Date | 2011-04-07 |
United States Patent
Application |
20110081360 |
Kind Code |
A1 |
Roschke; Viktor ; et
al. |
April 7, 2011 |
Human G-Protein Chemokine Receptor (CCR5) HDGNR10
Abstract
The present invention relates to a novel human protein called
Human G-protein Chemokine Receptor (CCR5) HDGNR10, and isolated
polynucleotides encoding this protein. The invention is also
directed to human antibodies that bind Human G-protein Chemokine
Receptor (CCR5) HDGNR10 and to polynucleotides encoding those
antibodies. Also provided are vectors, host cells, antibodies, and
recombinant methods for producing Human G-protein Chemokine
Receptor (CCR5) HDGNR10 and human anti-Human G-protein Chemokine
Receptor (CCR5) HDGNR10 antibodies. The invention further relates
to diagnostic and therapeutic methods useful for diagnosing and
treating diseases, disorders, and/or conditions related to this
novel human protein and these novel human antibodies.
Inventors: |
Roschke; Viktor; (Rockville,
MD) ; Rosen; Craig A.; (Pasadena, MD) ; Ruben;
Steven M.; (Brookeville, MD) |
Assignee: |
Human Genome Sciences, Inc.
Rockville
MD
|
Family ID: |
46150072 |
Appl. No.: |
12/943722 |
Filed: |
November 10, 2010 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11626244 |
Jan 23, 2007 |
7862818 |
|
|
12943722 |
|
|
|
|
10067800 |
Feb 8, 2002 |
7175988 |
|
|
11626244 |
|
|
|
|
PCT/US01/04153 |
Feb 9, 2001 |
|
|
|
10067800 |
|
|
|
|
09779880 |
Feb 9, 2001 |
|
|
|
PCT/US01/04153 |
|
|
|
|
60297257 |
Jun 12, 2001 |
|
|
|
60310458 |
Aug 8, 2001 |
|
|
|
60328447 |
Oct 12, 2001 |
|
|
|
60341725 |
Dec 21, 2001 |
|
|
|
Current U.S.
Class: |
424/172.1 ;
530/387.1; 536/23.53 |
Current CPC
Class: |
A61P 11/00 20180101;
C07K 16/2866 20130101; C07K 14/7158 20130101; A61K 48/00 20130101;
A01K 2217/05 20130101; C12N 2799/026 20130101; C07K 16/24 20130101;
A61P 17/06 20180101; A61P 37/04 20180101; C07K 2319/00 20130101;
A61K 38/00 20130101; A01K 2217/075 20130101; A61P 17/00 20180101;
A61K 2039/505 20130101; A61P 9/00 20180101 |
Class at
Publication: |
424/172.1 ;
536/23.53; 530/387.1 |
International
Class: |
A61K 39/395 20060101
A61K039/395; C07H 21/04 20060101 C07H021/04; C07K 16/00 20060101
C07K016/00; A61P 37/04 20060101 A61P037/04; A61P 9/00 20060101
A61P009/00; A61P 17/06 20060101 A61P017/06; A61P 17/00 20060101
A61P017/00; A61P 11/00 20060101 A61P011/00 |
Claims
1. An isolated polynucleotide encoding a first antibody at least
95%, at least 96%, at least 97%, at least 98%, at least 99%, or at
least 100% identical to a second antibody comprising an amino acid
sequence selected from the group consisting of: (a) at least one
CDR region of a VH domain of the antibody expressed by the
XF27/28.43E2 hybridoma cell line; (b) at least two CDR regions of a
VH domain of the antibody expressed by the XF27/28.43E2 hybridoma
cell line; (c) at least three CDR regions of a VH domain of the
antibody expressed by the XF27/28.43E2 hybridoma cell line; (d) at
least one CDR region of a VL domain of the antibody expressed by
the XF27/28.43E2 hybridoma cell line; (e) at least two CDR regions
of a VL domain of the antibody expressed by the XF27/28.43E2
hybridoma cell line; and (f) at least three CDR regions of a VL
domain of the antibody expressed by the XF27/28.43E2 hybridoma cell
line.
2. An isolated first antibody at least 95%, at least 96%, at least
97%, at least 98%, at least 99%, or at least 100% identical to a
second antibody comprising an amino acid sequence selected from the
group consisting of: (a) at least one CDR region of a VH domain of
the antibody expressed by the XF27/28.43E2 hybridoma cell line; (b)
at least two CDR regions of a VH domain of the antibody expressed
by the XF27/28.43E2 hybridoma cell line; (c) at least three CDR
regions of a VH domain of the antibody expressed by the
XF27/28.43E2 hybridoma cell line; (d) at least one CDR region of a
VL domain of the antibody expressed by the XF27/28.43E2 hybridoma
cell line; (e) at least two CDR regions of a VL domain of the
antibody expressed by the XF27/28.43E2 hybridoma cell line; and (f)
at least three CDR regions of a VL domain of the antibody expressed
by the XF27/28.43E2 hybridoma cell line.
3. A method of inhibiting chemokine binding to CCR5, in order to
treat or ameliorate any one of the following inflammatory diseases
or disorders selected from the group consisting of: (a)
transplantation; (b) graft-versus-host disease; (c) rheumatoid
arthritis; (d) pulmonary disease; (e) hypersensitivity; (f)
multiple sclerosis; (g) dermatitis; (h) psoriasis; and (i) airway
inflammation; comprising administering an isolated antibody or
fragment thereof to an animal in need thereof, wherein the antibody
or fragment thereof specifically binds a CCR5 polypeptide, and
wherein the antibody or fragment thereof comprises: (a) the VH
domain of the antibody expressed by the XF27/28.43E2 hybridoma cell
line deposited under ATCC Deposit Accession Number PTA-4054 and the
VL domain of the antibody expressed by the XF27/28.43E2 hybridoma
cell line deposited under ATCC Deposit Accession Number PTA-4054;
or (b) the VHCDR1, VHCDR2, VHCDR3, VLCDR1, VLCDR2, and VLCDR3 of
the antibody expressed by the XF27/28.43E2 hybridoma cell line
deposited under ATCC Deposit Accession Number PTA-4054.
4. The method of claim 3, wherein the CCR5 polypeptide is expressed
on the surface of a cell, and wherein the CCR5 polypeptide is
encoded by a polynucleotide encoding amino acids 1 to 352 of SEQ ID
NO:22.
5. The method of claim 4, wherein the antibody or fragment thereof
binds to the second extracellular loop of the CCR5 polypeptide.
6. The method of claim 3, wherein the antibody or fragment thereof
is selected from the group consisting of: (a) a whole
immunoglobulin molecule; (b) an scFv; (c) a Fab fragment; (d) an
Fab' fragment; (e) an F(ab')2; (f) an Fv; and (g) a disulfide
linked Fv.
7. The method of claim 3, wherein the antibody or fragment thereof
is selected from the group consisting of: (a) a monoclonal antibody
or fragment thereof; (b) a human antibody or fragment thereof; (c)
a chimeric antibody or fragment thereof; and (d) a humanized
antibody or fragment thereof.
8. The method of claim 3, wherein the antibody or fragment thereof
comprises a heavy chain immunoglobulin constant domain.
9. The method of claim 8, wherein the heavy chain immunoglobulin
constant domain is selected from the group consisting of: (a) an
IgM constant domain; (b) an IgG1 constant domain; (c) an IgG2
constant domain; (d) an IgG3 constant domain; (e) an IgG4 constant
domain; and (f) an IgA constant domain.
10. The method of claim 8, wherein the heavy chain immunoglobulin
constant domain is human.
11. The method of claim 3, wherein the antibody or fragment thereof
comprises a light chain immunoglobulin constant domain.
12. The method of claim 11, wherein the light chain immunoglobulin
constant domain is selected from the group consisting of: (a) a
kappa constant domain; and (b) a lambda constant domain.
13. The method of claim 11, wherein the light chain immunoglobulin
constant domain is human.
14. The method of claim 3, wherein the antibody or fragment thereof
comprises a human IgG4 heavy chain immunoglobulin constant domain
and a human kappa light chain immunoglobulin constant domain.
15. The method of claim 3, wherein the antibody or fragment thereof
is an antagonist of CCR5.
16. The method of claim 3, wherein the antibody or fragment thereof
inhibits the binding of Eotaxin, RANTES, MCP-1, MCP-2, MCP-3,
MIP-1beta or MIP-1alpha to CCR5.
17. The method of claim 3, further comprising administering one or
more agents employed for treating inflammatory disorders selected
from the group consisting of: (a) an antibiotic; (b) a cytokine;
(c) a corticosteroid; (d) a salicyclic acid derivative; (e) an
antimetabolite; (f) an immunosuppressive agent; and (g) an
anti-angiogenic factor.
18. The method of claim 3, further comprising administering one or
more agents employed for treating inflammatory disorders selected
from the group consisting of: (a) ciprofloxacin; (b) metronidazole;
(c) mercaptopurine; (d) methotrexate; (e) azathioprine; (f)
cyclosporine; (g) prednisone; (h) methylprednisone; (i)
thalidomide; and (j) interleukin-11.
19. The method of claim 3, wherein the isolated antibody or
fragment thereof is administered by a route selected from the group
consisting of: (a) intradermal; (b) intramuscular; (c)
intraperitoneal; (d) intravenous; (e) subcutaneous; (f) intranasal;
(g) epidural; and (h) oral.
20. The method of claim 3, wherein the animal is a human.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a divisional of U.S. application Ser.
No. 11/626,244, filed 23 Jan. 2007; which is a divisional of U.S.
application Ser. No. 10/067,800, filed 8 Feb. 2002 (now U.S. Pat.
No. 7,175,988, issued 13 Feb. 2007); which is a
continuation-in-part of International Application No.
PCT/US01/04153, filed 9 Feb. 2001, which published in English under
PCT Article 21(2); and is a continuation-in-part of U.S.
application Ser. No. 09/779,880, filed 9 Feb. 2001; and claims the
benefit of U.S. Provisional Application No. 60/297,257, filed 12
Jun. 2001; and claims the benefit of U.S. Provisional Application
No. 60/310,458, filed 8 Aug. 2001; and claims the benefit of U.S.
Provisional Application No. 60/328,447, filed 12 Oct. 2001; and
claims the benefit of U.S. Provisional Application No. 60/341,725,
filed 21 Dec. 2001; each of said applications is hereby
incorporated herein by reference.
FIELD OF THE INVENTION
[0002] The present invention relates to a novel human gene encoding
a polypeptide which is a member of the G-protein Chemokine Receptor
(CCR5) family. More specifically, the present invention relates to
a polynucleotide encoding a novel human polypeptide named Human
G-protein Chemokine Receptor (CCR5) HDGNR10, referred to herein as
"G-protein Chemokine Receptor" or "HDGNR10." This invention also
relates to G-protein Chemokine Receptor (CCR5) polypeptides, as
well as vectors, host cells, antibodies directed to G-protein
Chemokine Receptor (CCR5) polypeptides, and the recombinant methods
for producing the same. Also provided are diagnostic methods for
detecting diseases, disorders, and/or conditions related to the
immune system and HIV infection, and therapeutic methods for
treating, preventing, and/or diagnosing such diseases, disorders,
and/or conditions. The invention further relates to screening
methods for identifying agonists and antagonists of G-protein
Chemokine Receptor (CCR5) activity. The G-protein Chemokine
Receptor (CCR5) is also known as CCR5.
BACKGROUND OF THE INVENTION
[0003] It is well established that many medically significant
biological processes are mediated by proteins participating in
signal transduction pathways that involve G-proteins and/or second
messengers, e.g., cAMP (Lefkowitz, Nature, 351:353-354 (1991)).
Herein these proteins are referred to as proteins participating in
pathways with G-proteins or PPG-proteins. Some examples of these
proteins include the GPC receptors, such as those for adrenergic
agents and dopamine (Kobilka, B. K., et al., PNAS, 84:46-50 (1987);
Kobilka, B. K., et al., Science, 238:650-656 (1987); Bunzow, J. R.,
et al., Nature, 336:783-787 (1988)), G-proteins themselves,
effector proteins, e.g., phospholipase C, adenyl cyclase, and
phosphodiesterase, and actuator proteins, e.g., protein kinase A
and protein kinase C (Simon, M. I., et al., Science, 252:802-8
(1991)).
[0004] For example, in one form of signal transduction, the effect
of hormone binding is activation of an enzyme, adenylate cyclase,
inside the cell. Enzyme activation by hormones is dependent on the
presence of the nucleotide GTP, and GTP also influences hormone
binding. A G-protein connects the hormone receptors to adenylate
cyclase. G-protein was shown to exchange GTP for bound GDP when
activated by hormone receptors. The GTP-carrying form then binds to
an activated adenylate cyclase. Hydrolysis of GTP to GDP, catalyzed
by the G-protein itself, returns the G-protein to its basal,
inactive form. Thus, the G-protein serves a dual role, as an
intermediate that relays the signal from receptor to effector, and
as a clock that controls the duration of the signal.
[0005] The membrane protein gene superfamily of G-protein coupled
receptors has been characterized as having seven putative
transmembrane domains. The domains are believed to represent
transmembrane .alpha.-helices connected by extracellular or
cytoplasmic loops. G-protein coupled receptors include a wide range
of biologically active receptors, such as hormone, viral, growth
factor and neuroreceptors.
[0006] G-protein coupled receptors have been characterized as
including these seven conserved hydrophobic stretches of about 20
to 30 amino acids, connecting at least eight divergent hydrophilic
loops. The G-protein family of coupled receptors includes dopamine
receptors which bind to neuroleptic drugs used for treating
psychotic and neurological disorders. Other examples of members of
this family include calcitonin, adrenergic, endothelin, cAMP,
adenosine, muscarinic, acetylcholine, serotonin, histamine,
thrombin, kinin, follicle stimulating hormone, opsins, endothelial
differentiation gene-1 receptor and rhodopsins, odorant,
cytomegalovirus receptors, etc.
[0007] G-protein coupled receptors can be intracellularly coupled
by heterotrimeric G-proteins to various intracellular enzymes, ion
channels and transporters (see, Johnson et al., Endoc., Rev.,
10:317-331 (1989)). Different G-protein .alpha.-subunits
preferentially stimulate particular effectors to modulate various
biological functions in a cell. Phosphorylation of cytoplasmic
residues of G-protein coupled receptors have been identified as an
important mechanism for the regulation of G-protein coupling of
some G-protein coupled receptors. G-protein coupled receptors are
found in numerous sites within a mammalian host.
[0008] Chemokines, also referred to as intercrine cytokines, are a
subfamily of structurally and functionally related cytokines. These
molecules are 8-10 kd in size. In general, chemokines exhibit 20%
to 75% homology at the amino acid level and are characterized by
four conserved cysteine residues that form two disulfide bonds.
Based on the arrangement of the first two cysteine residues,
chemokines have been classified into two subfamilies, alpha and
beta. In the alpha subfamily, the first two cysteines are separated
by one amino acid and hence are referred to as the "C-X-C"
subfamily. In the beta subfamily, the two cysteines are in an
adjacent position and are, therefore, referred to as the "C-C"
subfamily. Thus far, at least nine different members of this family
have been identified in humans.
[0009] The intercrine cytokines exhibit a wide variety of
functions. A hallmark feature is their ability to elicit
chemotactic migration of distinct cell types, including monocytes,
neutrophils, T lymphocytes, basophils and fibroblasts. Many
chemokines have proinflammatory activity and are involved in
multiple steps during an inflammatory reaction. These activities
include stimulation of histamine release, lysosomal enzyme and
leukotriene release, increased adherence of target immune cells to
endothelial cells, enhanced binding of complement proteins, induced
expression of granulocyte adhesion molecules and complement
receptors, and respiratory burst. In addition to their involvement
in inflammation, certain chemokines have been shown to exhibit
other activities. For example, macrophage inflammatory protein 1
(MIP-1) is able to suppress hematopoietic stem cell proliferation,
platelet factor-4 (PF-4) is a potent inhibitor of endothelial cell
growth, Interleukin-8 (IL-8) promotes proliferation of
keratinocytes, and GRO is an autocrine growth factor for melanoma
cells.
[0010] In light of the diverse biological activities, it is not
surprising that chemokines have been implicated in a number of
physiological and disease conditions, including lymphocyte
trafficking, wound healing, hematopoietic regulation and
immunological disorders such as allergy, asthma and arthritis.
[0011] Thus, there is a need for polypeptides that modulate immune
system regulation, since disturbances of such regulation may be
involved in diseases, disorders, and/or conditions relating to the
immune system. Therefore, there is a need for identification and
characterization of such human polypeptides which can play a role
in detecting, preventing, ameliorating or correcting such diseases,
disorders, and/or conditions.
[0012] The G-protein Chemokine Receptor (CCR5) is a seven-pass
transmembrane G-protein coupled receptor that is expressed in cells
of the immune system such as, for example, macrophages, including
immature dendritic cells such as Langerhans cells, and T cells,
including Th0 and Th1 effector cells. G-protein Chemokine Receptor
(CCR5) has also been detected in microglia, astrocytes, neurons,
and vascular endothelial cells of the central nervous system (CNS).
G-protein Chemokine Receptor (CCR5) is also expressed in monocyes
and T cells in the synovial fluid of rheumatoid arthritis patients,
and has also been implicated in other forms of arthritis.
[0013] Ligands of G-protein Chemokine Receptor (CCR5) include
MIP-1.alpha., MIP-1.beta., MCP-1, MCP-2, MCP-3, MCP-4, RANTES, and
Eotaxin. CCR5 is also a major co-receptor for HIV, and may be also
be recognized by other infectious agents, such as other viruses, to
allow entry into the cell. It was recently discovered that certain
individuals harboring a mutation of the CCR5 gene, were resistant
to HIV infection despite multiple exposure to the virus. This
mutation abrogated expression of CCR5 at the cell surface (Liu et
al., Cell 86:1 (1996)).
[0014] HIV is currently the leading lethal infectious disease in
the world, causing 2.6 million deaths in 1999. The number of deaths
resulting from HIV infection will continue to increase; In 1999,
there were 5.6 million new cases of HIV infection and 33.6 million
infected people living in the world. Although there are currently
14 approved drugs to treat HIV, as many as one half of pateints
fail to be successfully (with success being defined as no
detectable HIV RNA in serum (which in effect is equal to fewer than
50 copies/ml of HIV-1 RNA) treated after a one year drug regimen.
The reasons for the inability of these drug regimens to effectively
treat HIV are several fold: use of certain drugs results in the
development of drug resistant HIV strains; some individuals are
intolerant to certain drugs or the drugs have bad side effects;
patients have difficulty complying with complex dosing regimens;
and the drugs may not be able to access reservoirs of HIV in the
body. Thus, there remains a need in the art to develop improved HIV
vaccines and therapies.
SUMMARY OF THE INVENTION
[0015] The present invention relates to novel polynucleotides and
the encoded polypeptides of G-protein Chemokine Receptor (CCR5).
Moreover, the present invention relates to vectors, host cells,
antibodies, and recombinant and synthetic methods for producing the
polypeptides and polynucleotides. Also provided are diagnostic
methods for detecting diseases, disorders, and/or conditions
related to the polypeptides and polynucleotides, and therapeutic
methods for treating, preventing, and/or diagnosing such diseases,
disorders, and/or conditions. The invention further relates to
screening methods for identifying binding partners of G-protein
Chemokine Receptor (CCR5).
[0016] In accordance with one aspect of the present invention,
there are provided novel mature receptor polypeptides as well as
biologically active and diagnostically or therapeutically useful
fragments, analogs and derivatives thereof. The G-protein Chemokine
Receptor (CCR5) polypeptides of the present invention are of human
origin.
[0017] In accordance with another aspect of the present invention,
there are provided isolated nucleic acid molecules encoding the
G-protein Chemokine Receptor (CCR5) polypeptides of the present
invention, including mRNAs, DNAs, cDNAs, genomic DNA as well as
antisense analogs thereof and biologically active and
diagnostically or therapeutically useful fragments thereof.
[0018] In accordance with a further aspect of the present
invention, there are provided processes for producing the G-protein
Chemokine Receptor (CCR5) polypeptides by recombinant techniques
comprising culturing recombinant prokaryotic and/or eukaryotic host
cells, containing nucleic acid sequences encoding the receptor
polypeptides of the present invention, under conditions promoting
expression of said polypeptides and subsequent recovery of said
polypeptides.
[0019] In accordance with yet a further aspect of the present
invention, there are provided antibodies that bind the G-protein
Chemokine Receptor (CCR5) polypeptides. The present invention
encompasses antibodies (including molecules comprising, or
alternatively consisting of, antibody fragments or variants
thereof) that immunospecifically bind to a G-protein Chemokine
Receptor (CCR5) polypeptide or polypeptide fragment or variant of a
G-protein Chemokine Receptor (CCR5). In particular, the invention
encompasses antibodies (including molecules comprising, or
alternatively consisting of, antibody fragments or variants
thereof) that immunospecifically bind to a polypeptide or
polypeptide fragment or variant of human G-protein Chemokine
Receptor (CCR5) such as those of SEQ ID NO:2 or of the polypeptide
encoded by the deposited clone.
[0020] The present invention relates to methods and compositions
for preventing, treating or ameliorating a disease or disorder
comprising administering to an animal, preferably a human, an
effective amount of one or more antibodies or fragments or variants
thereof, or related molecules, that immunospecifically bind to a
G-protein Chemokine Receptor (CCR5) or a fragment or variant
thereof. In specific embodiments, the present invention relates to
methods and compositions for preventing, treating or ameliorating a
disease or disorder associated with G-protein Chemokine Receptor
(CCR5) function or G-protein Chemokine Receptor (CCR5) ligand
function or aberrant G-protein Chemokine Receptor (CCR5) or
G-protein Chemokine Receptor (CCR5) ligand expression, comprising
administering to an animal, preferably a human, an effective amount
of one or more antibodies or fragments or variants thereof, or
related molecules, that immunospecifically bind to a G-protein
Chemokine Receptor (CCR5) or a fragment or variant thereof. In
highly preferred embodiments, the present invention relates to
antibody-based methods and compositions for preventing, treating or
ameliorating HIV infection and/or conditions associated with HIV
infection. Other diseases and disorders which can be treated,
prevented or ameliorated with the antibodies of the invention
include, but are not limited to, immune disorders (e.g., autoimmune
disorders such as multiple sclerosis, Grave's disease, and
rheumatoid arthritis), neurodegenerative disorders (e.g.,
Alzheimer's disease) inflammatory disorders (e.g., asthma, allergic
disorders, or inflammatory kidney diseases such as
glomerulonephritis), infectious diseases (e.g., Hepatitis
infections, herpes viral infections, and other viral infections)
and proliferative disorders.
[0021] The present invention also encompasses methods and
compositions for detecting, diagnosing, or prognosing diseases or
disorders comprising administering to an animal, preferably a
human, an effective amount of one or more antibodies or fragments
or variants thereof, or related molecules, that immunospecifically
bind to G-protein Chemokine Receptor (CCR5) or a fragment or
variant thereof. In specific embodiments, the present invention
also encompasses methods and compositions for detecting,
diagnosing, or prognosing diseases or disorders associated with
G-protein Chemokine Receptor (CCR5) function or G-protein Chemokine
Receptor (CCR5) ligand function or aberrant G-protein Chemokine
Receptor (CCR5) or G-protein Chemokine Receptor (CCR5) ligand
expression, comprising administering to an animal, preferably a
human, an effective amount of one or more antibodies or fragments
or variants thereof, or related molecules, that immunospecifically
bind to G-protein Chemokine Receptor (CCR5) or a fragment or
variant thereof. In highly preferred embodiments, the present
invention relates to antibody-based methods and compositions for
detecting, diagnosing, or prognosing HIV infection and/or
conditions associated with HIV infection. Other diseases and
disorders which can be detected, diagnosed, or prognosed with the
antibodies of the invention include, but are not limited to, immune
disorders (e.g., autoimmune disorders such as multiple sclerosis,
Grave's disease, and rheumatoid arthritis), neurodegenerative
disorders (e.g., Alzheimer's disease) inflammatory (e.g., asthma,
allergic disorders, or inflammatory kidney diseases such as
glomerulonephritis), infectious diseases (e.g., Hepatitis
infections, herpes viral infections, and other viral infections)
and proliferative disorders.
[0022] Another embodiment of the present invention includes the use
of the antibodies of the invention as a diagnostic tool to monitor
the expression of G-protein Chemokine Receptor (CCR5) expression on
cells.
[0023] The present invention also encompasses cell lines that
express antibodies that immunospecifically bind one or more
G-protein Chemokine Receptor (CCR5) polypeptides (e.g., SEQ ID
NO:2, or the polypeptide encoded by the deposited clone).
[0024] Further, the present invention encompasses the
polynucleotides encoding the antibodies expressed by such cell
lines, as well as the amino acid sequences encoding the antibodies
expressed by these cell lines. Molecules comprising, or
alternatively consisting of, fragments or variants of these
antibodies (e.g., heavy chains, VH domains, VH CDRs, light chains,
VL domains, or VL CDRs having an amino acid sequence of any one of
those expressed by an antibody-expressing cell line of the
invention, that immunospecifically bind to one or more G-protein
Chemokine Receptor (CCR5) or fragments or variants thereof are also
encompassed by the invention, as are nucleic acid molecules that
encode these antibodies and/or molecules. In highly preferred
embodiments, the present invention encompasses antibodies, or
fragments or variants thereof, that bind to the extracellular
regions/domains of one or more G-protein Chemokine Receptor (CCR5)
or fragments and variants thereof.
[0025] The present inventors have generated hybridoma cell lines
that express antibodies that immunospecifically bind one or more
G-protein Chemokine Receptor (CCR5) polypeptides (e.g., SEQ ID NO:2
or the polypeptide encoded by the deposited clone). Thus, the
invention encompasses these cell lines, listed in Table 2 below
which were deposited with the American Type Culture Collection
("ATCC.TM.") on the dates listed in Table 2 and given the ATCC.TM.
Deposit Numbers identified in Table 2. The ATCC.TM. is located at
10801 University Boulevard, Manassas, Va. 20110-2209, USA. The
ATCC.TM. deposit was made pursuant to the terms of the Budapest
Treaty on the international recognition of the deposit of
microorganisms for purposes of patent procedure.
[0026] Further, the present invention encompasses the
polynucleotides encoding the antibodies expressed by these cell
lines, as well as the amino acid sequences encoding the antibodies
expressed by these cell lines. Molecules comprising, or
alternatively consisting of, fragments or variants of these
antibodies (e.g., heavy chains, VH domains, VH CDRs, light chains,
VL domains, or VL CDRs having an amino acid sequence of any one of
those expressed by one or more cell lines referred to in Table 2),
that immunospecifically bind to one or more G-protein Chemokine
Receptor (CCR5) or fragments or variants thereof are also
encompassed by the invention, as are nucleic acid molecules that
encode these antibodies and/or molecules. In highly preferred
embodiments, the present invention encompasses antibodies, or
fragments or variants thereof, that bind to the extracellular
regions/domains of one or more G-protein Chemokine Receptor (CCR5)
or fragments and variants thereof.
[0027] The present invention also provides antibodies that bind one
or more G-protein Chemokine Receptor (CCR5) polypeptides which are
coupled to a detectable label, such as an enzyme, a fluorescent
label, a luminescent label, or a bioluminescent label. The present
invention also provides antibodies that bind one or more G-protein
Chemokine Receptor (CCR5) polypeptides which are coupled to a
therapeutic or cytotoxic agent. The present invention also provides
antibodies that bind one or more G-protein Chemokine Receptor
(CCR5) polypeptides which are coupled to a radioactive
material.
[0028] The present invention further provides antibodies that
inhibit or abolish the ability of HIV to bind to, enter into/fuse
with (infect), and/or replicate in G-protein Chemokine Receptor
(CCR5) expressing cells. In highly preferred embodiments of the
present invention, anti-G-protein Chemokine Receptor (CCR5)
antibodies of the present invention are used to treat, prevent or
ameliorate HIV infection and/or conditions associated with HIV
infection. In other highly preferred embodiments, anti-G-protein
Chemokine Receptor (CCR5) antibodies of the present invention are
administered to an individual alone or in combination with other
therapeutic compounds, especially anti-retroviral agents, to treat,
prevent or ameliorate HIV infection and/or conditions associated
with HIV infection.
[0029] The present invention also provides antibodies that bind one
or more G-protein Chemokine Receptor (CCR5) polypeptides that act
as either G-protein Chemokine Receptor (CCR5) agonists or G-protein
Chemokine Receptor (CCR5) antagonists. In specific embodiments, the
antibodies of the invention stimulate chemotaxis of G-protein
Chemokine Receptor (CCR5) expressing cells. In other specific
embodiments, the antibodies of the invention inhibit G-protein
Chemokine Receptor (CCR5) ligand binding to a G-protein Chemokine
Receptor (CCR5). In other specific embodiments, the antibodies of
the invention upregulate G-protein Chemokine Receptor (CCR5)
expression.
[0030] The present invention also provides antibodies that
downregulate G-protein Chemokine Receptor (CCR5) expression. In
still other specific embodiments, the anti-G-protein Chemokine
Receptor (CCR5) antibodies of the invention downregulate G-protein
Chemokine Receptor (CCR5) expression by promoting G-protein
Chemokine Receptor (CCR5) internalization.
[0031] The present invention further provides antibodies that
inhibit or abolish the binding of a G-protein Chemokine Receptor
(CCR5) ligand, (e.g., MIP1-beta MIP-1alpha, MCP-1, MCP-2, MCP-3,
MCP-4, RANTES, and Eotaxin), to G-protein Chemokine Receptor (CCR5)
expressing cells.
[0032] The present invention also provides for a nucleic acid
molecule(s), generally isolated, encoding an antibody (including
molecules, such as scFvs, VH domains, or VL domains, that comprise,
or alternatively consist of, an antibody fragment or variant
thereof) of the invention. The present invention also provides a
host cell transformed with a nucleic acid molecule encoding an
antibody (including molecules, such as scFvs, VH domains, or VL
domains, that comprise, or alternatively consist of, an antibody
fragment or variant thereof) of the invention and progeny thereof.
The present invention also provides a method for the production of
an antibody (including a molecule comprising, or alternatively
consisting of, an antibody fragment or variant thereof) of the
invention. The present invention further provides a method of
expressing an antibody (including a molecule comprising, or
alternatively consisting of, an antibody fragment or variant
thereof) of the invention from a nucleic acid molecule. These and
other aspects of the invention are described in further detail
below.
[0033] In another embodiment, the present invention provides
vaccines comprising, or alternatively consisting of, G-protein
Chemokine Receptor (CCR5) polynucleotides or polypeptides or
fragments, variants or derivatives thereof.
[0034] In accordance with another aspect of the present invention
there are provided methods of screening for compounds which bind to
and activate or inhibit activation of the G-protein Chemokine
Receptor (CCR5) polypeptides of the present invention.
[0035] In accordance with still another embodiment of the present
invention there are provided processes of administering compounds
to a host which bind to and activate the receptor polypeptide of
the present invention which are useful in stimulating
haematopoiesis, wound healing, coagulation, angiogenesis, to treat
solid tumors, chronic infections, leukemia, T-cell mediated
auto-immune diseases, parasitic infections, psoriasis, and to
stimulate growth factor activity.
[0036] In accordance with another aspect of the present invention
there is provided a method of administering the receptor
polypeptides of the present invention via gene therapy to treat
conditions related to underexpression of the polypeptides or
underexpression of a ligand for the G-protein Chemokine Receptor
(CCR5) polypeptide.
[0037] In accordance with still another embodiment of the present
invention there are provided processes of administering compounds
to a host which bind to and inhibit activation of the receptor
polypeptides of the present invention which are useful in the
prevention and/or treatment of allergy, atherogenesis, anaphylaxis,
malignancy, chronic and acute inflammation, histamine and
IgE-mediated allergic reactions, prostaglandin-independent fever,
bone marrow failure, silicosis, sarcoidosis, rheumatoid arthritis,
shock and hyper-eosinophilic syndrome.
[0038] In accordance with yet another aspect of the present
invention, there are provided nucleic acid probes comprising
nucleic acid molecules of sufficient length to specifically
hybridize to the polynucleotide sequences of the present
invention.
[0039] In accordance with still another aspect of the present
invention, there are provided diagnostic assays for detecting
diseases related to mutations in the nucleic acid sequences
encoding such polypeptides and for detecting an altered level of
the soluble form of the receptor polypeptides.
[0040] In accordance with yet a further aspect of the present
invention, there are provided processes for utilizing such receptor
polypeptides, or polynucleotides encoding such polypeptides, for in
vitro purposes related to scientific research, synthesis of DNA and
manufacture of DNA vectors.
[0041] These and other aspects of the present invention should be
apparent to those skilled in the art from the teachings herein.
BRIEF DESCRIPTION OF THE DRAWINGS
[0042] The following drawings are illustrative of embodiments of
the invention and are not meant to limit the scope of the invention
as encompassed by the claims.
[0043] FIGS. 1A-1B show the DNA sequence and the corresponding
deduced amino acid sequence (SEQ ID NOs:1 and 2) of the G-protein
coupled receptor of the present invention. The standard one-letter
abbreviation for amino acids is used. Sequencing was performed
using a 373 Automated DNA sequencer (Applied Biosystems, Inc.).
[0044] FIG. 2 illustrates an amino acid alignment of the G-protein
Chemokine Receptor (CCR5) (SEQ ID NO: 2) of the present invention
and the human MCP-1 receptor (SEQ ID NO:9). This figure shows the
regions of identity between the amino acid sequence of the
G-protein Chemokine Receptor (CCR5) protein and the translation
product of the human MCP-1 receptor A (MCP-1 RA) (SEQ ID NO:9),
determined by BLAST analysis. Identical amino acids between the two
polypeptides are indicated by lines, while highly conservative
amino acid are indicated by colons and conservative amino acids are
indicated by periods. By examining the regions of identical, highly
conserved and conserved amino acids, the skilled artisan can
readily identify conserved domains between the two polypeptides.
These conserved domains are preferred embodiments of the present
invention.
[0045] FIG. 3 shows an analysis of the G-protein Chemokine Receptor
(CCR5) (SEQ ID NO: 2) amino acid sequence. Alpha, beta, turn and
coil regions; hydrophilicity and hydrophobicity; amphipathic
regions; flexible regions; antigenic index and surface probability
are shown, and all were generated using the default settings. In
the "Antigenic Index or Jameson-Wolf" graph, the positive peaks
indicate locations of the highly antigenic regions of the G-protein
Chemokine Receptor (CCR5) protein, i.e., regions from which
epitope-bearing peptides of the invention can be obtained. The
domains defined by these graphs are contemplated by the present
invention.
[0046] The data presented in FIG. 3 are also represented in tabular
form in Table 1. The columns are labeled with the headings "Res",
"Position", and Roman Numerals I-XIV. The column headings refer to
the following features of the amino acid sequence presented in FIG.
3, and Table 1: "Res": amino acid residue of SEQ ID NO:2 and FIG.
1; "Position": position of the corresponding residue within SEQ ID
NO:2 and FIG. 1; I: Alpha, Regions--Garnier-Robson; II: Alpha,
Regions--Chou-Fasman; III: Beta, Regions--Garnier-Robson; IV: Beta,
Regions--Chou-Fasman; V: Turn, Regions--Garnier-Robson; VI: Turn,
Regions--Chou-Fasman; VII: Coil, Regions--Garnier-Robson; VIII:
Hydrophilicity Plot--Kyte-Doolittle; IX: Hydrophobicity
Plot--Hopp-Woods; X: Alpha, Amphipathic Regions--Eisenberg; XI:
Beta, Amphipathic Regions--Eisenberg; XII: Flexible
Regions--Karplus-Schulz; XIII: Antigenic Index--Jameson-Wolf; and
XIV: Surface Probability Plot--Emini.
[0047] FIG. 4 shows the polynucleotide and amino acid sequence of
the VH (SEQ ID NOs:59-60) and VL (SEQ ID NOs:61-62) domains of
anti-CCR5 antibody XF11.1D8. Each CDR is indicated by a line above
the nucleotide sequence. See also, Table 6.
[0048] FIG. 5 shows the polynucleotide and amino acid sequence of
the VH (SEQ ID NOs:63-64) and VL (SEQ ID NOs:65-66) domains of
anti-CCR5 antibody XF22.3C9 (i.e., XF22.3C9.6). Each CDR is
indicated by a line above the nucleotide sequence. See also, Table
6.
[0049] FIG. 6 shows the polynucleotide and amino acid sequence of
the VH (SEQ ID NOs:67-68) and VL (SEQ ID NOs:69-70) domains of
anti-CCR5 antibody XF22.9E6. Each CDR is indicated by a line above
the nucleotide sequence. See also, Table 6.
DETAILED DESCRIPTION
[0050] In accordance with an aspect of the present invention, there
is provided an isolated nucleic acid (polynucleotide) which encodes
for the mature polypeptide having the deduced amino acid sequence
of FIG. 1 (SEQ ID NO:2) or for the mature polypeptide encoded by
the clone deposited as ATCC.TM. Deposit No. 97183 on Jun. 1, 1995.
A sample of the deposited clone, which contains the open reading
frame of the G-protein Chemokine Receptor (CCR5), has been obtained
from the ATCC.TM. and has been resequenced. The sequence data from
the resequenced clone is shown in SEQ ID NO:21 and 22. SEQ ID NO:21
differs from SEQ ID NO:1 at 5 positions (nucleotides 320, 433, 442,
646, and 1289 of SEQ ID NO:1) SEQ ID NO:22 differs from SEQ ID NO:2
at 5 positions (amino acid residues 21, 59, 62, 130, and 344).
[0051] The polynucleotide of this invention was discovered in a
genomic library derived from human monocytes. It is structurally
related to the G-protein-coupled receptor family. It contains an
open reading frame encoding a protein of 352 amino acid residues.
The protein exhibits the highest degree of homology to a human
MCP-1 receptor (SEQ ID NO:9) with 70.1% identity and 82.9%
similarity over a 347 amino acid stretch.
[0052] Polynucleotides of the invention include, but are not
limited to, the nucleotide sequence of SEQ ID NO:1, the nucleotide
sequence of the HDGNR10 deposited clone (ATCC.TM. Deposit Number
97183), the nucleotide sequence of SEQ ID NO:21), and/or fragments,
variants or derivatives thereof.
[0053] The polynucleotide of the present invention may be in the
form of RNA or in the form of DNA, which DNA includes cDNA, genomic
DNA, and synthetic DNA. The DNA may be double-stranded or
single-stranded, and if single stranded may be the coding strand or
non-coding (anti-sense) strand. The coding sequence which encodes
the mature polypeptide may be identical to the coding sequence
shown in FIG. 1 (SEQ ID NO:1) or that of the deposited clone or may
be a different coding sequence which coding sequence, as a result
of the redundancy or degeneracy of the genetic code, encodes the
same mature polypeptide as the DNA of FIG. 1 (SEQ ID NO:1) or the
deposited clone.
[0054] The polynucleotide which encodes for the mature polypeptide
of FIG. 1 or for the mature polypeptide encoded by the deposited
clone may include: only the coding sequence for the mature
polypeptide; the coding sequence for the mature polypeptide and
additional coding sequence such as a transmembrane (TM) or
intra-cellular domain; the coding sequence for the mature
polypeptide (and optionally additional coding sequence) and
non-coding sequence, such as introns or non-coding sequence 5'
and/or 3' of the coding sequence for the mature polypeptide.
[0055] Thus, the term "polynucleotide encoding a polypeptide"
encompasses a polynucleotide which includes only coding sequence
for the polypeptide as well as a polynucleotide which includes
additional coding and/or non-coding sequence.
[0056] The present invention further relates to variants of the
hereinabove described polynucleotides which encode for fragments,
analogs and derivatives of the polypeptide having the deduced amino
acid sequence of FIG. 1 or the polypeptide encoded by the deposited
clone. The variant of the polynucleotide may be a naturally
occurring allelic variant of the polynucleotide or a non-naturally
occurring variant of the polynucleotide.
[0057] Thus, the present invention includes polynucleotides
encoding the same mature polypeptide as shown in FIG. 1 (SEQ ID
NO:2) or the same mature polypeptide encoded by the deposited clone
as well as variants of such polynucleotides which variants encode
for a fragment, derivative or analog of the polypeptide of FIG. 1
(SEQ ID NO:2) or the polypeptide encoded by the deposited clone.
Such nucleotide variants include deletion variants, substitution
variants and addition or insertion variants.
[0058] As hereinabove indicated, the polynucleotide may have a
coding sequence which is a naturally occurring allelic variant of
the coding sequence shown in FIG. 1 (SEQ ID NO:1) or of the coding
sequence of the deposited clone. As known in the art, an allelic
variant is an alternate form of a polynucleotide sequence which may
have a substitution, deletion or addition of one or more
nucleotides, which does not substantially alter the function of the
encoded polypeptide.
[0059] The polynucleotides may also encode for a soluble form of
the G-protein Chemokine Receptor (CCR5) polypeptide which is the
extracellular portion of the polypeptide which has been cleaved
from the TM and intracellular domain of the full-length polypeptide
of the present invention.
[0060] The polynucleotides of the present invention may also have
the coding sequence fused in frame to a marker sequence which
allows for purification of the polypeptide of the present
invention. The marker sequence may be a hexa-histidine tag supplied
by a pQE-9 vector to provide for purification of the mature
polypeptide fused to the marker in the case of a bacterial host,
or, for example, the marker sequence may be a hemagglutinin (HA)
tag when a mammalian host, e.g. COS-7 cells, is used. The HA tag
corresponds to an epitope derived from the influenza hemagglutinin
protein (Wilson, I., et al., Cell, 37:767 (1984)).
[0061] The term "gene" means the segment of DNA involved in
producing a polypeptide chain; it includes regions preceding and
following the coding region (leader and trailer) as well as
intervening sequences (introns) between individual coding segments
(exons).
[0062] Fragments of the full length gene of the present invention
may be used as a hybridization probe for a cDNA library to isolate
the full length cDNA and to isolate other cDNAs which have a high
sequence similarity to the gene or similar biological activity.
Probes of this type preferably have at least 30 bases and may
contain, for example, 50 or more bases. The probe may also be used
to identify a cDNA clone corresponding to a full length transcript
and a genomic clone or clones that contain the complete gene
including regulatory and promoter regions, exons, and introns. An
example of a screen comprises isolating the coding region of the
gene by using the known DNA sequence to synthesize an
oligonucleotide probe. Labeled oligonucleotides having a sequence
complementary to that of the gene of the present invention are used
to screen a library of human cDNA, genomic DNA or mRNA to determine
which members of the library the probe hybridizes to.
[0063] The present invention further relates to polynucleotides
which hybridize to the hereinabove-described sequences if there is
at least 70%, preferably at least 90%, and more preferably at least
95% identity between the sequences. The present invention
particularly relates to polynucleotides which hybridize under
stringent conditions to the hereinabove-described polynucleotides.
As herein used, the term "stringent conditions" means hybridization
will occur only if there is at least 95% and preferably at least
97% identity between the sequences. The polynucleotides which
hybridize to the hereinabove described polynucleotides in a
preferred embodiment encode polypeptides which either retain
substantially the same biological function or activity as the
mature polypeptide encoded by the DNAs of FIG. 1 (SEQ ID NO:1) or
the deposited clone.
[0064] Alternatively, the polynucleotide may have at least 20
bases, preferably 30 bases, and more preferably at least 50 bases
which hybridize to a polynucleotide of the present invention and
which has an identity thereto, as hereinabove described, and which
may or may not retain activity. For example, such polynucleotides
may be employed as probes for the polynucleotide of SEQ ID NO:1 or
of the deposited clone, for example, for recovery of the
polynucleotide or as a diagnostic probe or as a PCR primer.
[0065] Thus, the present invention is directed to polynucleotides
having at least a 70% identity, preferably at least 90% and more
preferably at least a 95% identity to a polynucleotide which
encodes the polypeptide of SEQ ID NO:2 or that encoded by the
deposited clone as well as fragments thereof, which fragments have
at least 30 bases and preferably at least 50 bases and to
polypeptides encoded by such polynucleotides.
[0066] The deposit(s) referred to herein will be maintained under
the terms of the Budapest Treaty on the International Recognition
of the Deposit of Micro-organisms for purposes of patent Procedure.
These deposits are provided merely as convenience to those of skill
in the art and are not an admission that a deposit is required
under 35 U.S.C. .sctn.112. The sequence of the polynucleotides
contained in the deposited materials, as well as the amino acid
sequence of the polypeptides encoded thereby, are incorporated
herein by reference and are controlling in the event of any
conflict with any description of sequences herein. A license may be
required to make, or sell the deposited materials, and no such
license is hereby granted.
[0067] The present invention further relates to a G-protein
Chemokine Receptor (CCR5) polypeptide which has the deduced amino
acid sequence of FIG. 1 (SEQ ID NO:2) or which has the amino acid
sequence encoded by the deposited clone (SEQ ID NO:22), as well as
fragments, analogs and derivatives of such polypeptide.
[0068] The terms "fragment," "derivative" and "analog" when
referring to the polypeptide of FIG. 1 or that encoded by the
deposited clone, means a polypeptide which either retains
substantially the same biological function or activity as such
polypeptide, i.e. functions as a G-protein Chemokine Receptor
(CCR5), or retains the ability to bind the ligand or the receptor
even though the polypeptide does not function as a G-protein
Chemokine Receptor (CCR5), for example, a soluble form of the
receptor. An analog includes a proprotein which can be activated by
cleavage of the proprotein portion to produce an active mature
polypeptide.
[0069] The polypeptide of the present invention may be a
recombinant polypeptide, a natural polypeptide or a synthetic
polypeptide, preferably a recombinant polypeptide.
[0070] The fragment, derivative or analog of the polypeptide of
FIG. 1 (SEQ ID NO: 2) or that encoded by the deposited clone may be
(i) one in which one or more of the amino acid residues are
substituted with a conserved or non-conserved amino acid residue
(preferably a conserved amino acid residue) and such substituted
amino acid residue may or may not be one encoded by the genetic
code, or (ii) one in which one or more of the amino acid residues
includes a substituent group, or (iii) one in which the mature
polypeptide is fused with another compound, such as a compound to
increase the half-life of the polypeptide (for example,
polyethylene glycol), or (iv) one in which the additional amino
acids are fused to the mature polypeptide for purification of the
polypeptide or (v) one in which a fragment of the polypeptide is
soluble, i.e. not membrane bound, yet still binds ligands to the
membrane bound receptor. Such fragments, derivatives and analogs
are deemed to be within the scope of those skilled in the art from
the teachings herein.
[0071] The polypeptides and polynucleotides of the present
invention are preferably provided in an isolated form, and
preferably are purified to homogeneity.
[0072] The polypeptides of the present invention include the
polypeptide of SEQ ID NO:2 (in particular the mature polypeptide)
or that encoded by the deposited clone as well as polypeptides
which have at least 70% similarity (preferably a 70% identity) to
the polypeptide of SEQ ID NO:2) or to that encoded by the deposited
clone and more preferably a 90% similarity (more preferably a 90%
identity) to the polypeptide of SEQ ID NO:2) or to that encoded by
the deposited clone and still more preferably a 95% similarity
(still more preferably a 90% identity) to the polypeptide of SEQ ID
NO:2 and to portions of such polypeptide with such portion of the
polypeptide generally containing at least 30 amino acids and more
preferably at least 50 amino acids.
[0073] As known in the art "similarity" between two polypeptides is
determined by comparing the amino acid sequence and conserved amino
acid substitutes thereto of the polypeptide to the sequence of a
second polypeptide.
[0074] Fragments or portions of the polypeptides of the present
invention may be employed for producing the corresponding
full-length polypeptide by peptide synthesis, therefore, the
fragments may be employed as intermediates for producing the
full-length polypeptides. Fragments or portions of the
polynucleotides of the present invention may be used to synthesize
full-length polynucleotides of the present invention.
[0075] The term "gene" means the segment of DNA involved in
producing a polypeptide chain; it includes regions preceding and
following the coding region "leader and trailer" as well as
intervening sequences (introns) between individual coding segments
(exons).
[0076] The term "isolated" means that the material is removed from
its original environment (e.g., the natural environment if it is
naturally occurring). For example, a naturally-occurring
polynucleotide or polypeptide present in a living animal is not
isolated, but the same polynucleotide or polypeptide, separated
from some or all of the coexisting materials in the natural system,
is isolated. Such polynucleotides could be part of a vector and/or
such polynucleotides or polypeptides could be part of a
composition, and still be isolated in that such vector or
composition is not part of its natural environment.
[0077] The polypeptides of the present invention include the
polypeptide of SEQ ID NO:2) or to that encoded by the deposited
clone (in particular the mature polypeptide) as well as
polypeptides which have at least 70% similarity (preferably at
least 70% identity) and more preferably at least 90% similarity
(more preferably at least 90% identity) and still more preferably
at least 95% similarity (still more preferably at least 95%
identity) to the polypeptide of SEQ ID NO:2) or to that encoded by
the deposited clone and also include portions of such polypeptides
with such portion of the polypeptide generally containing at least
30 amino acids and more preferably at least 50 amino acids.
[0078] As known in the art "similarity" between two polypeptides is
determined by comparing the amino acid sequence and its conserved
amino acid substitutes of one polypeptide to the sequence of a
second polypeptide.
[0079] Fragments or portions of the polypeptides of the present
invention may be employed for producing the corresponding
full-length polypeptide by peptide synthesis; therefore, the
fragments may be employed as intermediates for producing the
full-length polypeptides. Fragments or portions of the
polynucleotides of the present invention may be used to synthesize
full-length polynucleotides of the present invention.
[0080] The present invention also relates to vectors which include
polynucleotides of the present invention, host cells which are
genetically engineered with vectors of the invention and the
production of polypeptides of the invention by recombinant
techniques.
[0081] Host cells are genetically engineered (transduced or
transformed or transfected) with the vectors of this invention
which may be, for example, a cloning vector or an expression
vector. The vector may be, for example, in the form of a plasmid, a
viral particle, a phage, etc. The engineered host cells can be
cultured in conventional nutrient media modified as appropriate for
activating promoters, selecting transformants or amplifying the
genes of the present invention. The culture conditions, such as
temperature, pH and the like, are those previously used with the
host cell selected for expression, and will be apparent to the
ordinarily skilled artisan.
[0082] The polynucleotides of the present invention may be employed
for producing polypeptides by recombinant techniques. Thus, for
example, the polynucleotide may be included in any one of a variety
of expression vectors for expressing a polypeptide. Such vectors
include chromosomal, nonchromosomal and synthetic DNA sequences,
e.g., derivatives of SV40; bacterial plasmids; phage DNA;
baculovirus; yeast plasmids; vectors derived from combinations of
plasmids and phage DNA, viral DNA such as vaccinia, adenovirus,
fowl pox virus, and pseudorabies. However, any other vector may be
used as long as it is replicable and viable in the host.
[0083] The appropriate DNA sequence may be inserted into the vector
by a variety of procedures. In general, the DNA sequence is
inserted into an appropriate restriction endonuclease site(s) by
procedures known in the art. Such procedures and others are deemed
to be within the scope of those skilled in the art.
[0084] The DNA sequence in the expression vector is operatively
linked to an appropriate expression control sequence(s) (promoter)
to direct mRNA synthesis. As representative examples of such
promoters, there may be mentioned: LTR or SV40 promoter, the E.
coli, lac or trp, the phage lambda P.sub.L promoter and other
promoters known to control expression of genes in prokaryotic or
eukaryotic cells or their viruses. The expression vector also
contains a ribosome binding site for translation initiation and a
transcription terminator. The vector may also include appropriate
sequences for amplifying expression.
[0085] In addition, the expression vectors preferably contain one
or more selectable marker genes to provide a phenotypic trait for
selection of transformed host cells such as dihydrofolate reductase
or neomycin resistance for eukaryotic cell culture, or such as
tetracycline or ampicillin resistance in E. coli.
[0086] The vector containing the appropriate DNA sequence as
hereinabove described, as well as an appropriate promoter or
control sequence, may be employed to transform an appropriate host
to permit the host to express the protein.
[0087] As representative examples of appropriate hosts, there may
be mentioned: bacterial cells, such as E. coli, Streptomyces,
Salmonella typhimurium; fungal cells, such as yeast; insect cells
such as Drosophila and Spodoptera Sf9; animal cells such as CHO,
COS or Bowes melanoma; adenovirus; plant cells, etc. The selection
of an appropriate host is deemed to be within the scope of those
skilled in the art from the teachings herein.
[0088] More particularly, the present invention also includes
recombinant constructs comprising one or more of the sequences as
broadly described above. The constructs comprise a vector, such as
a plasmid or viral vector, into which a sequence of the invention
has been inserted, in a forward or reverse orientation. In a
preferred aspect of this embodiment, the construct further
comprises regulatory sequences, including, for example, a promoter,
operably linked to the sequence. Large numbers of suitable vectors
and promoters are known to those of skill in the art, and are
commercially available. The following vectors are provided by way
of example. Bacterial: pQE70, pQE60, pQE-9 (Qiagen), pbs, pD10,
phagescript, psiX174, pBLUESCRIPT.TM. SK, pbsks, pNH8A, pNH16a,
pNH18A, pNH46A (STRATAGENE.TM.); ptrc99a, pKK223-3, pKK233-3,
pDR540, pRIT5 (PHARMACIA.TM.). Eukaryotic: pWLNEO, pSV2CAT, pOG44,
pXT1, pSG (STRATAGENE.TM.) pSVK3, pBPV, pMSG, pSVL (PHARMACIA.TM.).
However, any other plasmid or vector may be used as long as they
are replicable and viable in the host.
[0089] Promoter regions can be selected from any desired gene using
CAT (chloramphenicol transferase) vectors or other vectors with
selectable markers. Two appropriate vectors are PKK232-8 and PCM7.
Particular named bacterial promoters include lacI, lacZ, T3, T7,
gpt, lambda P.sub.R, P.sub.L and trp. Eukaryotic promoters include
CMV immediate early, HSV thymidine kinase, early and late SV40,
LTRs from retrovirus, and mouse metallothionein-I. Selection of the
appropriate vector and promoter is well within the level of
ordinary skill in the art.
[0090] In a further embodiment, the present invention relates to
host cells containing the above-described constructs. The host cell
can be a higher eukaryotic cell, such as a mammalian cell, or a
lower eukaryotic cell, such as a yeast cell, or the host cell can
be a prokaryotic cell, such as a bacterial cell. Introduction of
the construct into the host cell can be effected by calcium
phosphate transfection, DEAE-Dextran mediated transfection, or
electroporation. (Davis, L., et al., Basic Methods in Molecular
Biology, (1986)).
[0091] The constructs in host cells can be used in a conventional
manner to produce the gene product encoded by the recombinant
sequence. Alternatively, the polypeptides of the invention can be
synthetically produced by conventional peptide synthesizers.
[0092] Mature proteins can be expressed in mammalian cells, yeast,
bacteria, or other cells under the control of appropriate
promoters. Cell-free translation systems can also be employed to
produce such proteins using RNAs derived from the DNA constructs of
the present invention. Appropriate cloning and expression vectors
for use with prokaryotic and eukaryotic hosts are described by
Sambrook, et al., Molecular Cloning: A Laboratory Manual, Second
Edition, Cold Spring Harbor, N.Y., (1989), the disclosure of which
is hereby incorporated by reference.
[0093] Transcription of the DNA encoding the polypeptides of the
present invention by higher eukaryotes is increased by inserting an
enhancer sequence into the vector. Enhancers are cis-acting
elements of DNA, usually about from 10 to 300 bp that act on a
promoter to increase its transcription. Examples including the SV40
enhancer on the late side of the replication origin by 100 to 270,
a cytomegalovirus early promoter enhancer, the polyoma enhancer on
the late side of the replication origin, and adenovirus
enhancers.
[0094] Generally, recombinant expression vectors will include
origins of replication and selectable markers permitting
transformation of the host cell, e.g., the ampicillin resistance
gene of E. coli and S. cerevisiae TRP1 gene, and a promoter derived
from a highly-expressed gene to direct transcription of a
downstream structural sequence. Such promoters can be derived from
operons encoding glycolytic enzymes such as 3-phosphoglycerate
kinase (PGK), .alpha.-factor, acid phosphatase, or heat shock
proteins, among others. The heterologous structural sequence is
assembled in appropriate phase with translation initiation and
termination sequences, and preferably, a leader sequence capable of
directing secretion of translated protein into the periplasmic
space or extracellular medium. Optionally, the heterologous
sequence can encode a fusion protein including an N-terminal
identification peptide imparting desired characteristics, e.g.,
stabilization or simplified purification of expressed recombinant
product.
[0095] Useful expression vectors for bacterial use are constructed
by inserting a structural DNA sequence encoding a desired protein
together with suitable translation initiation and termination
signals in operable reading phase with a functional promoter. The
vector will comprise one or more phenotypic selectable markers and
an origin of replication to ensure maintenance of the vector and
to, if desirable, provide amplification within the host. Suitable
prokaryotic hosts for transformation include E. coli, Bacillus
subtilis, Salmonella typhimurium and various species within the
genera Pseudomonas, Streptomyces, and Staphylococcus, although
others may also be employed as a matter of choice.
[0096] As a representative but nonlimiting example, useful
expression vectors for bacterial use can comprise a selectable
marker and bacterial origin of replication derived from
commercially available plasmids comprising genetic elements of the
well known cloning vector pBR322 (ATCC.TM. 37017). Such commercial
vectors include, for example, pKK223-3 (Pharmacia Fine Chemicals,
Uppsala, Sweden) and GEM1 (Promega Biotec, Madison, Wis., USA).
These pBR322 "backbone" sections are combined with an appropriate
promoter and the structural sequence to be expressed.
[0097] Following transformation of a suitable host strain and
growth of the host strain to an appropriate cell density, the
selected promoter is induced by appropriate means (e.g.,
temperature shift or chemical induction) and cells are cultured for
an additional period.
[0098] Cells are typically harvested by centrifugation, disrupted
by physical or chemical means, and the resulting crude extract
retained for further purification.
[0099] Microbial cells employed in expression of proteins can be
disrupted by any convenient method, including freeze-thaw cycling,
sonication, mechanical disruption, or use of cell lysing agents,
such methods are well know to those skilled in the art.
[0100] Various mammalian cell culture systems can also be employed
to express recombinant protein. Examples of mammalian expression
systems include the COS-7 lines of monkey kidney fibroblasts,
described by Gluzman, Cell 23:175 (1981), and other cell lines
capable of expressing a compatible vector, for example, the C127,
3T3, CHO, HeLa and BHK cell lines. Mammalian expression vectors
will comprise an origin of replication, a suitable promoter and
enhancer, and also any necessary ribosome binding sites,
polyadenylation site, splice donor and acceptor sites,
transcriptional termination sequences, and 5' flanking
nontranscribed sequences. DNA sequences derived from the SV40
splice, and polyadenylation sites may be used to provide the
required nontranscribed genetic elements.
[0101] The G-protein Chemokine Receptor (CCR5) polypeptides can be
recovered and purified from recombinant cell cultures by methods
including ammonium sulfate or ethanol precipitation, acid
extraction, anion or cation exchange chromatography,
phosphocellulose chromatography, hydrophobic interaction
chromatography, affinity chromatography, hydroxylapatite
chromatography and lectin chromatography. Protein refolding steps
can be used, as necessary, in completing configuration of the
mature protein. Finally, high performance liquid chromatography
(HPLC) can be employed for final purification steps.
[0102] The polypeptides of the present invention may be a naturally
purified product, or a product of chemical synthetic procedures, or
produced by recombinant techniques from a prokaryotic or eukaryotic
host (for example, by bacterial, yeast, higher plant, insect and
mammalian cells in culture). Depending upon the host employed in a
recombinant production procedure, the polypeptides of the present
invention may be glycosylated or may be non-glycosylated.
Polypeptides of the invention may also include an initial
methionine amino acid residue.
[0103] The polynucleotides and polypeptides of the present
invention may be employed as research reagents and materials for
discovery of treatments and diagnostics to human disease.
[0104] The G-protein Chemokine Receptor (CCR5) of the present
invention may be employed in a process for screening for compounds
which activate (agonists) or inhibit activation (antagonists) of
the receptor polypeptide of the present invention.
[0105] In general, such screening procedures involve providing
appropriate cells which express the receptor polypeptide of the
present invention on the surface thereof. Such cells include cells
from mammals, yeast, drosophila or E. coli. In particular, a
polynucleotide encoding the receptor of the present invention is
employed to transfect cells to thereby express the G-protein
Chemokine Receptor (CCR5). The expressed receptor is then contacted
with a test compound to observe binding, stimulation or inhibition
of a functional response.
[0106] One such screening procedure involves the use of
melanophores which are transfected to express the G-protein
Chemokine Receptor (CCR5) of the present invention. Such a
screening technique is described in PCT WO 92/01810 published Feb.
6, 1992.
[0107] Thus, for example, such assay may be employed for screening
for a compound which inhibits activation of the receptor
polypeptide of the present invention by contacting the melanophore
cells which encode the receptor with both the receptor ligand and a
compound to be screened. Inhibition of the signal generated by the
ligand indicates that a compound is a potential antagonist for the
receptor, i.e., inhibits activation of the receptor.
[0108] The screen may be employed for determining a compound which
activates the receptor by contacting such cells with compounds to
be screened and determining whether such compound generates a
signal, i.e., activates the receptor.
[0109] Other screening techniques include the use of cells which
express the G-protein Chemokine Receptor (CCR5) (for example,
transfected CHO cells) in a system which measures extracellular pH
changes caused by receptor activation, for example, as described in
Science 246:181-296 (October 1989). For example, compounds may be
contacted with a cell which expresses the receptor polypeptide of
the present invention and a second messenger response, e.g. signal
transduction or pH changes, may be measured to determine whether
the potential compound activates or inhibits the receptor.
[0110] Another such screening technique involves introducing RNA
encoding the G-protein Chemokine Receptor (CCR5) into Xenopus
oocytes to transiently express the receptor. The receptor oocytes,
may then be contacted with the receptor ligand and a compound to be
screened, followed by detection of inhibition or activation of a
calcium signal in the case of screening for compounds which are
thought to inhibit activation of the receptor.
[0111] Another screening technique involves expressing the
G-protein Chemokine Receptor (CCR5) in which the receptor is linked
to a phospholipase C or D. As representative examples of such
cells, there may be mentioned endothelial cells, smooth muscle
cells, embryonic kidney cells, etc. The screening may be
accomplished as hereinabove described by detecting activation of
the receptor or inhibition of activation of the receptor from the
phospholipase second signal.
[0112] Another method involves screening for compounds which
inhibit activation of the receptor polypeptide of the present
invention antagonists by determining inhibition of binding of
labeled ligand to cells which have the receptor on the surface
thereof. Such a method involves transfecting a eukaryotic cell with
DNA encoding the G-protein Chemokine Receptor (CCR5) such that the
cell expresses the receptor on its surface and contacting the cell
with a compound in the presence of a labeled form of a known
ligand. The ligand can be labeled, e.g., by radioactivity. The
amount of labeled ligand bound to the receptors is measured, e.g.,
by measuring radioactivity of the receptors. If the compound binds
to the receptor as determined by a reduction of labeled ligand
which binds to the receptors, the binding of labeled ligand to the
receptor is inhibited.
[0113] An antibody, or in some cases an oligopeptide, may activate
a G-protein Chemokine Receptor (CCR5) of the present invention, by
binding to the G-protein Chemokine Receptor (CCR5) and initiating
second messenger response. Antibodies include anti-idiotypic
antibodies which recognize unique determinants generally associated
with the antigen-binding site of an antibody. Potential agonist
compounds also include proteins which are closely related to the
ligand of the G-protein Chemokine Receptor (CCR5), e.g., a fragment
of the ligand.
[0114] An antibody, or in some cases an oligopeptide, may
antagonize a G-protein Chemokine Receptor (CCR5) of the present
invention, by binding to the G-protein Chemokine Receptor (CCR5)
but failing to elicit a second messenger response such that the
activity of the G-protein Chemokine Receptor (CCR5) is prevented.
Antibodies include anti-idiotypic antibodies which recognize unique
determinants generally associated with the antigen-binding site of
an antibody. Potential antagonist compounds also include proteins
which are closely related to the ligand of the G-protein Chemokine
Receptor (CCR5), e.g., a fragment of the ligand that has lost
biological function and elicits no response when binding to the
G-protein Chemokine Receptor (CCR5).
[0115] An antisense construct prepared through the use of antisense
technology, may be used to control gene expression through
triple-helix formation or antisense DNA or RNA, both of which
methods are based on binding of a polynucleotide to DNA or RNA. For
example, the 5' coding portion of the polynucleotide sequence,
which encodes for the mature polypeptides of the present invention,
is used to design an antisense RNA oligonucleotide of from about 10
to 40 base pairs in length. A DNA oligonucleotide is designed to be
complementary to a region of the gene involved in transcription
(triple helix; see Lee et al., Nucl. Acids Res. 6:3073 (1979);
Cooney et al, Science 241:456 (1988); and Dervan et al., Science
251:1360 (1991)), thereby preventing transcription and the
production of G-protein Chemokine Receptor (CCR5). The antisense
RNA oligonucleotide hybridizes to the mRNA in vivo and blocks
translation of mRNA molecules into G-protein coupled receptor
(antisense--Okano, J. Neurochem. 56:560 (1991);
Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression,
CRC Press, Boca Raton, Fla. (1988)). The oligonucleotides described
above can also be delivered to cells such that the antisense RNA or
DNA may be expressed in vivo to inhibit production of G-protein
Chemokine Receptor (CCR5).
[0116] A small molecule which binds to the G-protein Chemokine
Receptor (CCR5), making it inaccessible to ligands such that normal
biological activity is prevented, for example small peptides or
peptide-like molecules, may also be used to inhibit activation of
the receptor polypeptide of the present invention.
[0117] A soluble form of the G-protein Chemokine Receptor (CCR5),
e.g. a fragment of the receptors, may be used to inhibit activation
of the receptor by binding to the ligand to a polypeptide of the
present invention and preventing the ligand from interacting with
membrane bound G-protein Chemokine Receptor (CCR5).
[0118] The compounds which bind to and activate the G-protein
Chemokine Receptor (CCR5) of the present invention may be employed
to stimulate haematopoiesis, wound healing, coagulation,
angiogenesis, to treat solid tumors, chronic infections, leukemia,
T-cell mediated auto-immune diseases, parasitic infections,
psoriasis, and to stimulate growth factor activity.
[0119] The compounds which bind to and inhibit the G-protein
Chemokine Receptor (CCR5) of the present invention may be employed
to treat allergy, atherogenesis, anaphylaxis, malignancy, chronic
and acute inflammation, histamine and IgE-mediated allergic
reactions, prostaglandin-independent fever, bone marrow failure,
silicosis, sarcoidosis, rheumatoid arthritis, shock and
hyper-eosinophilic syndrome.
[0120] The compounds may be employed in combination with a suitable
pharmaceutical carrier. Such compositions comprise a
therapeutically effective amount of the compound and a
pharmaceutically acceptable carrier or excipient. Such a carrier
includes but is not limited to saline, buffered saline, dextrose,
water, glycerol, ethanol, and combinations thereof. The formulation
should suit the mode of administration.
[0121] The invention also provides a pharmaceutical pack or kit
comprising one or more containers filled with one or more of the
ingredients of the pharmaceutical compositions of the invention.
Associated with such container(s) can be a notice in the form
prescribed by a governmental agency regulating the manufacture, use
or sale of pharmaceuticals or biological products, which notice
reflects approval by the agency of manufacture, use or sale for
human administration. In addition, the compounds of the present
invention may be employed in conjunction with other therapeutic
compounds.
[0122] The pharmaceutical compositions may be administered in a
convenient manner such as by the topical, intravenous,
intraperitoneal, intramuscular, subcutaneous, intranasal or
intradermal routes. The pharmaceutical compositions are
administered in an amount which is effective for treating and/or
prophylaxis of the specific indication. In general, the
pharmaceutical compositions will be administered in an amount of at
least about 10 .mu.g/kg body weight and in most cases they will be
administered in an amount not in excess of about 8 mg/Kg body
weight per day. In most cases, the dosage is from about 10 .mu.g/kg
to about 1 mg/kg body weight daily, taking into account the routes
of administration, symptoms, etc.
[0123] The G-protein Chemokine Receptor (CCR5) polypeptides and
antagonists or agonists which are polypeptides, may also be
employed in accordance with the present invention by expression of
such polypeptides in vivo, which is often referred to as "gene
therapy."
[0124] Thus, for example, cells from a patient may be engineered
with a polynucleotide (DNA or RNA) encoding a polypeptide ex vivo,
with the engineered cells then being provided to a patient to be
treated with the polypeptide. Such methods are well-known in the
art. For example, cells may be engineered by procedures known in
the art by use of a retroviral particle containing RNA encoding a
polypeptide of the present invention.
[0125] Similarly, cells may be engineered in vivo for expression of
a polypeptide in vivo by, for example, procedures known in the art.
As known in the art, a producer cell for producing a retroviral
particle containing RNA encoding the polypeptide of the present
invention may be administered to a patient for engineering cells in
vivo and expression of the polypeptide in vivo. These and other
methods for administering a polypeptide of the present invention by
such method should be apparent to those skilled in the art from the
teachings of the present invention. For example, the expression
vehicle for engineering cells may be other than a retrovirus, for
example, an adenovirus which may be used to engineer cells in vivo
after combination with a suitable delivery vehicle.
[0126] Retroviruses from which the retroviral plasmid vectors
hereinabove mentioned may be derived include, but are not limited
to, Moloney Murine Leukemia Virus, spleen necrosis virus,
retroviruses such as Rous Sarcoma Virus, Harvey Sarcoma Virus,
avian leukosis virus, gibbon ape leukemia virus, human
immunodeficiency virus, adenovirus, Myeloproliferative Sarcoma
Virus, and mammary tumor virus. In one embodiment, the retroviral
plasmid vector is derived from Moloney Murine Leukemia virus.
[0127] The vector includes one or more promoters. Suitable
promoters which may be employed include, but are not limited to,
the retroviral LTR; the SV40 promoter; and the human
cytomegalovirus (CMV) promoter described in Miller, et al.,
Biotechniques 7:980-990 (1989), or any other promoter (e.g.,
cellular promoters such as eukaryotic cellular promoters including,
but not limited to, the histone, pol III, and .beta.-actin
promoters). Other viral promoters which may be employed include,
but are not limited to, adenovirus promoters, thymidine kinase (TK)
promoters, and B19 parvovirus promoters. The selection of a
suitable promoter will be apparent to those skilled in the art from
the teachings contained herein.
[0128] The nucleic acid sequence encoding the polypeptide of the
present invention is under the control of a suitable promoter.
Suitable promoters which may be employed include, but are not
limited to, adenoviral promoters, such as the adenoviral major late
promoter; or heterologous promoters, such as the cytomegalovirus
(CMV) promoter; the respiratory syncytial virus (RSV) promoter;
inducible promoters, such as the MMT promoter, the metallothionein
promoter; heat shock promoters; the albumin promoter; the ApoAI
promoter; human globin promoters; viral thymidine kinase promoters,
such as the Herpes Simplex thymidine kinase promoter; retroviral
LTRs (including the modified retroviral LTRs hereinabove
described); the .beta.-actin promoter; and human growth hormone
promoters. The promoter also may be the native promoter which
controls the genes encoding the polypeptides.
[0129] The retroviral plasmid vector is employed to transduce
packaging cell lines to form producer cell lines. Examples of
packaging cells which may be transfected include, but are not
limited to, the PE501, PA317, .psi.-2, .psi.-AM, PA12, T19-14X,
VT-19-17-H2, .psi.CRE, .psi.CRIP, GP+E-86, GP+envAM12, and DAN cell
lines as described in Miller, Human Gene Therapy 1:5-14 (1990),
which is incorporated herein by reference in its entirety. The
vector may transduce the packaging cells through any means known in
the art. Such means include, but are not limited to,
electroporation, the use of liposomes, and CaPO.sub.4
precipitation. In one alternative, the retroviral plasmid vector
may be encapsulated into a liposome, or coupled to a lipid, and
then administered to a host.
[0130] The producer cell line generates infectious retroviral
vector particles which include the nucleic acid sequence(s)
encoding the polypeptides. Such retroviral vector particles then
may be employed, to transduce eukaryotic cells, either in vitro or
in vivo. The transduced eukaryotic cells will express the nucleic
acid sequence(s) encoding the polypeptide. Eukaryotic cells which
may be transduced include, but are not limited to, embryonic stem
cells, embryonic carcinoma cells, as well as hematopoietic stem
cells, hepatocytes, fibroblasts, myoblasts, keratinocytes,
endothelial cells, and bronchial epithelial cells.
[0131] The present invention also provides a method for determining
whether a ligand not known to be capable of binding to a G-protein
Chemokine Receptor (CCR5) can bind to such receptor which comprises
contacting a mammalian cell which expresses a G-protein Chemokine
Receptor (CCR5) with the ligand under conditions permitting binding
of ligands to the G-protein Chemokine Receptor (CCR5), detecting
the presence of a ligand which binds to the receptor and thereby
determining whether the ligand binds to the G-protein Chemokine
Receptor (CCR5). The systems hereinabove described for determining
agonists and/or antagonists may also be employed for determining
ligands which bind to the receptor.
[0132] This invention also provides a method of detecting
expression of a G-protein Chemokine Receptor (CCR5) polypeptide of
the present invention on the surface of a cell by detecting the
presence of mRNA coding for the receptor which comprises obtaining
total mRNA from the cell and contacting the mRNA so obtained with a
nucleic acid probe comprising a nucleic acid molecule of at least
10 nucleotides capable of specifically hybridizing with a sequence
included within the sequence of a nucleic acid molecule encoding
the receptor under hybridizing conditions, detecting the presence
of mRNA hybridized to the probe, and thereby detecting the
expression of the receptor by the cell.
[0133] The present invention also provides a method for identifying
receptors related to the receptor polypeptides of the present
invention. These related receptors may be identified by homology to
a G-protein Chemokine Receptor (CCR5) polypeptide of the present
invention, by low stringency cross hybridization, or by identifying
receptors that interact with related natural or synthetic ligands
and or elicit similar behaviors after genetic or pharmacological
blockade of the chemokine receptor polypeptides of the present
invention.
[0134] Fragments of the genes may be used as a hybridization probe
for a cDNA library to isolate other genes which have a high
sequence similarity to the genes of the present invention, or which
have similar biological activity. Probes of this type are at least
20 bases, preferably at least 30 bases and most preferably at least
50 bases or more. The probe may also be used to identify a cDNA
clone corresponding to a full length transcript and a genomic clone
or clones that contain the complete gene of the present invention
including regulatory and promoter regions, exons and introns. An
example of a screen of this type comprises isolating the coding
region of the gene by using the known DNA sequence to synthesize an
oligonucleotide probe. Labeled oligonucleotides having a sequence
complementary to that of the genes of the present invention are
used to screen a library of human cDNA, genomic DNA or mRNA to
determine which members of the library the probe hybridizes to.
[0135] The present invention also contemplates the use of the genes
of the present invention as a diagnostic, for example, some
diseases result from inherited defective genes. These genes can be
detected by comparing the sequences of the defective gene with that
of a normal one. Subsequently, one can verify that a "mutant" gene
is associated with abnormal receptor activity. In addition, one can
insert mutant receptor genes into a suitable vector for expression
in a functional assay system (e.g., colorimetric assay, expression
on MacConkey plates, complementation experiments, in a receptor
deficient strain of HEK293 cells) as yet another means to verify or
identify mutations. Once "mutant" genes have been identified, one
can then screen population for carriers of the "mutant" receptor
gene.
[0136] Individuals carrying mutations in the gene of the present
invention may be detected at the DNA level by a variety of
techniques. Nucleic acids used for diagnosis may be obtained from a
patient's cells, including but not limited to such as from blood,
urine, saliva, tissue biopsy and autopsy material. The genomic DNA
may be used directly for detection or may be amplified
enzymatically by using PCR (Saiki, et al., Nature 324:163-166
(1986)) prior to analysis. RNA or cDNA may also be used for the
same purpose. As an example, PCR primers complimentary to the
nucleic acid of the instant invention can be used to identify and
analyze mutations in the gene of the present invention. For
example, deletions and insertions can be detected by a change in
size of the amplified product in comparison to the normal genotype.
Point mutations can be identified by hybridizing amplified DNA to
radiolabeled RNA of the invention or alternatively, radiolabeled
antisense DNA sequences of the invention. Perfectly matched
sequences can be distinguished from mismatched duplexes by RNase A
digestion or by differences in melting temperatures. Such a
diagnostic would be particularly useful for prenatal or even
neonatal testing.
[0137] Sequence differences between the reference gene and
"mutants" may be revealed by the direct DNA sequencing method. In
addition, cloned DNA segments may be used as probes to detect
specific DNA segments. The sensitivity of this method is greatly
enhanced when combined with PCR. For example, a sequence primer is
used with double stranded PCR product or a single stranded template
molecule generated by a modified PCR. The sequence determination is
performed by conventional procedures with radiolabeled nucleotide
or by an automatic sequencing procedure with fluorescent-tags.
[0138] Genetic testing based on DNA sequence differences may be
achieved by detection of alterations in the electrophoretic
mobility of DNA fragments in gels with or without denaturing
agents. Sequences changes at specific locations may also be
revealed by nucleus protection assays, such RNase and 51 protection
or the chemical cleavage method (e.g. Cotton, et al., PNAS, USA
85:4397-4401 (1985)).
[0139] In addition, some diseases are a result of, or are
characterized by changes in gene expression which can be detected
by changes in the mRNA. Alternatively, the genes of the present
invention can be used as a reference to identify individuals
expressing a decrease of functions associated with receptors of
this type.
[0140] The present invention also relates to a diagnostic assay for
detecting altered levels of soluble forms of the G-protein
Chemokine Receptor (CCR5) polypeptides of the present invention in
various tissues. Assays used to detect levels of the soluble
receptor polypeptides in a sample derived from a host are well
known to those of skill in the art and include radioimmunoassays,
competitive-binding assays, Western blot analysis and preferably as
ELISA assay.
[0141] An ELISA assay initially comprises preparing an antibody
specific to antigens of the G-protein Chemokine Receptor (CCR5)
polypeptides, preferably a monoclonal antibody. In addition a
reporter antibody is prepared against the monoclonal antibody. To
the reporter antibody is attached a detectable reagent such as
radioactivity, fluorescence or in this example a horseradish
peroxidase enzyme. A sample is now removed from a host and
incubated on a solid support, e.g. a polystyrene dish, that binds
the proteins in the sample. Any free protein binding sites on the
dish are then covered by incubating with a non-specific protein
such as bovine serum albumin. Next, the monoclonal antibody is
incubated in the dish during which time the monoclonal antibodies
attach to any G-protein Chemokine Receptor (CCR5) proteins attached
to the polystyrene dish. All unbound monoclonal antibody is washed
out with buffer. The reporter antibody linked to horseradish
peroxidase is now placed in the dish resulting in binding of the
reporter antibody to any monoclonal antibody bound to G-protein
Chemokine Receptor (CCR5) proteins. Unattached reporter antibody is
then washed out. Peroxidase substrates are then added to the dish
and the amount of color developed in a given time period is a
measurement of the amount of G-protein Chemokine Receptor (CCR5)
proteins present in a given volume of patient sample when compared
against a standard curve.
[0142] The sequences of the present invention are also valuable for
chromosome identification. The sequence is specifically targeted to
and can hybridize with a particular location on an individual human
chromosome. Moreover, there is a current need for identifying
particular sites on the chromosome. Few chromosome marking reagents
based on actual sequence data (repeat polymorphisms) are presently
available for marking chromosomal location. The mapping of DNAs to
chromosomes according to the present invention is an important
first step in correlating those sequences with genes associated
with disease.
[0143] Briefly, sequences can be mapped to chromosomes by preparing
PCR primers (preferably 15-25 bp) from the clone. Computer analysis
of the DNA of the deposited clone is used to rapidly select primers
that do not span more than one exon in the genomic DNA, thus
complicating the amplification process. These primers are then used
for PCR screening of somatic cell hybrids containing individual
human chromosomes. Only those hybrids containing the human gene
corresponding to the primer will yield an amplified fragment.
[0144] PCR mapping of somatic cell hybrids is a rapid procedure for
assigning a particular DNA to a particular chromosome. Using the
present invention with the same oligonucleotide primers,
sublocalization can be achieved with panels of fragments from
specific chromosomes or pools of large genomic clones in an
analogous manner. Other mapping strategies that can similarly be
used to map to its chromosome include in situ hybridization,
prescreening with labeled flow-sorted chromosomes and preselection
by hybridization to construct chromosome specific-DNA
libraries.
[0145] Fluorescence in situ hybridization (FISH) of a DNA clone to
a metaphase chromosomal spread can be used to provide a precise
chromosomal location in one step. This technique can be used with
DNA as short as 50 or 60 bases. For a review of this technique, see
Verma et al., Human Chromosomes: a Manual of Basic Techniques,
Pergamon Press, New York (1988).
[0146] Once a sequence has been mapped to a precise chromosomal
location, the physical position of the sequence on the chromosome
can be correlated with genetic map data. Such data are found, for
example, in V. McKusick, Mendelian Inheritance in Man (available on
line through Johns Hopkins University Welch Medical Library). The
relationship between genes and diseases that have been mapped to
the same chromosomal region are then identified through linkage
analysis (coinheritance of physically adjacent genes).
[0147] Next, it is necessary to determine the differences in the
cDNA or genomic sequence between affected and unaffected
individuals. If a mutation is observed in some or all of the
affected individuals but not in any normal individuals, then the
mutation is likely to be the causative agent of the disease.
[0148] With current resolution of physical mapping and genetic
mapping techniques, a cDNA precisely localized to a chromosomal
region associated with the disease could be one of between 50 and
500 potential causative genes. (This assumes 1 megabase mapping
resolution and one gene per 20 kb).
[0149] The polypeptides, their fragments or other derivatives, or
analogs thereof, or cells expressing them can be used as an
immunogen to produce antibodies thereto. These antibodies can be,
for example, polyclonal or monoclonal antibodies. The present
invention also includes chimeric, single chain, and humanized
antibodies, as well as Fab fragments, or the product of an Fab
expression library. Various procedures known in the art may be used
for the production of such antibodies and fragments.
[0150] Antibodies generated against the polypeptides corresponding
to a sequence of the present invention can be obtained by direct
injection of the polypeptides into an animal or by administering
the polypeptides to an animal, preferably a nonhuman. The antibody
so obtained will then bind the polypeptides itself. In this manner,
even a sequence encoding only a fragment of the polypeptides can be
used to generate antibodies binding the whole native polypeptides.
Such antibodies can then be used to isolate the polypeptide from
tissue expressing that polypeptide.
[0151] For preparation of monoclonal antibodies, any technique
which provides antibodies produced by continuous cell line cultures
can be used. Examples include the hybridoma technique (Kohler and
Milstein, Nature 256:495-497 (1975)), the trioma technique, the
human B-cell hybridoma technique (Kozbor et al., Immunology Today
4:72 (1983)), and the EBV-hybridoma technique to produce human
monoclonal antibodies (Cole, et al., in Monoclonal Antibodies and
Cancer Therapy, Alan R. Liss, Inc. (1985), pp. 77-96).
[0152] Techniques described for the production of single chain
antibodies (U.S. Pat. No. 4,946,778) can be adapted to produce
single chain antibodies to immunogenic polypeptide products of this
invention. Also, transgenic mice may be used to express humanized
antibodies to immunogenic polypeptide products of this
invention.
[0153] The present invention will be further described with
reference to the following examples; however, it is to be
understood that the present invention is not limited to such
examples. All parts or amounts, unless otherwise specified, are by
weight.
[0154] In order to facilitate understanding of the following
examples certain frequently occurring methods and/or terms will be
described.
[0155] "Plasmids" are designated by a lower case p preceded and/or
followed by capital letters and/or numbers. The starting plasmids
herein are either commercially available, publicly available on an
unrestricted basis, or can be constructed from available plasmids
in accord with published procedures. In addition, equivalent
plasmids to those described are known in the art and will be
apparent to the ordinarily skilled artisan.
[0156] "Digestion" of DNA refers to catalytic cleavage of the DNA
with a restriction enzyme that acts only at certain sequences in
the DNA. The various restriction enzymes used herein are
commercially available and their reaction conditions, cofactors and
other requirements were used as would be known to the ordinarily
skilled artisan. For analytical purposes, typically 1 .mu.g of
plasmid or DNA fragment is used with about 2 units of enzyme in
about 20 .mu.l of buffer solution. For the purpose of isolating DNA
fragments for plasmid construction, typically 5 to 50 .mu.g of DNA
are digested with 20 to 250 units of enzyme in a larger volume.
Appropriate buffers and substrate amounts for particular
restriction enzymes are specified by the manufacturer. Incubation
times of about 1 hour at 37.degree. C. are ordinarily used, but may
vary in accordance with the supplier's instructions. After
digestion the reaction is electrophoresed directly on a
polyacrylamide gel to isolate the desired fragment.
[0157] Size separation of the cleaved fragments is performed using
8 percent polyacrylamide gel described by Goeddel, D. et al.,
Nucleic Acids Res. 8:4057 (1980).
[0158] "Oligonucleotides" refers to either a single stranded
polydeoxynucleotide or two complementary polydeoxynucleotide
strands which may be chemically synthesized. Such synthetic
oligonucleotides have no 5' phosphate and thus will not ligate to
another oligonucleotide without adding a phosphate with an ATP in
the presence of a kinase. A synthetic oligonucleotide will ligate
to a fragment that has not been dephosphorylated.
[0159] "Ligation" refers to the process of forming phosphodiester
bonds between two double stranded nucleic acid fragments (Maniatis,
T., et al., Id., p. 146). Unless otherwise provided, ligation may
be accomplished using known buffers and conditions with 10 units to
T4 DNA ligase ("ligase") per 0.5 .mu.g of approximately equimolar
amounts of the DNA fragments to be ligated.
[0160] Unless otherwise stated, transformation was performed as
described in the method of Graham, F. and Van der Eb, A., Virology
52:456-457 (1973).
[0161] In the present invention, "isolated" refers to material
removed from its original environment (e.g., the natural
environment if it is naturally occurring), and thus is altered "by
the hand of man" from its natural state. For example, an isolated
polynucleotide could be part of a vector or a composition of
matter, or could be contained within a cell, and still be
"isolated" because that vector, composition of matter, or
particular cell is not the original environment of the
polynucleotide. The term "isolated" does not refer to genomic or
cDNA libraries, whole cell total or mRNA preparations, genomic DNA
preparations (including those separated by electrophoresis and
transferred onto blots), sheared whole cell genomic DNA
preparations or other compositions where the art demonstrates no
distinguishing features of the polynucleotide/sequences of the
present invention.
[0162] In the present invention, a "secreted" or "soluble"
G-protein Chemokine Receptor (CCR5) protein refers to a protein
capable of being directed to the ER, secretory vesicles, or the
extracellular space as a result of a signal sequence, as well as a
G-protein Chemokine Receptor (CCR5) protein released into the
extracellular space without necessarily containing a signal
sequence. If the G-protein Chemokine Receptor (CCR5) secreted
protein is released into the extracellular space, the G-protein
Chemokine Receptor (CCR5) secreted protein can undergo
extracellular processing to produce a "mature" G-protein Chemokine
Receptor (CCR5) protein. Release into the extracellular space can
occur by many mechanisms, including exocytosis and proteolytic
cleavage. Examples of secreted or soluble G-protein Chemokine
Receptor (CCR5) protein include fragments comprising, or
alternatively consisting of, portions of the G-protein Chemokine
Receptor (CCR5) described herein. Preferred secreted or soluble
fragments comprise an extracellular loop, an intracellular loop,
the N-terminal extracellular domain, or the C-terminal
intracellular domain, or fragments thereof. Additional preferred
secreted or soluble fragments comprise an epitope of the G-protein
Chemokine Receptor (CCR5), such as described herein.
[0163] As used herein, a G-protein Chemokine Receptor (CCR5)
"polynucleotide" refers to a molecule having a nucleic acid
sequence contained in SEQ ID NO:1 or the G-protein Chemokine
Receptor DNA contained within the clone deposited with the
ATCC.TM.. For example, the G-protein Chemokine Receptor (CCR5)
polynucleotide can contain the nucleotide sequence of the full
length genomic sequence, including the 5' and 3' untranslated
sequences, the coding region, with or without the signal sequence,
the secreted protein coding region, as well as fragments, epitopes,
domains, and variants of the nucleic acid sequence. Moreover, as
used herein, a G-protein Chemokine Receptor (CCR5) "polypeptide"
refers to a molecule having the translated amino acid sequence
generated from the polynucleotide as broadly defined.
[0164] In specific embodiments, the polynucleotides of the
invention are at least 15, at least 30, at least 50, at least 100,
at least 125, at least 500, or at least 1000 continuous nucleotides
but are less than or equal to 300 kb, 200 kb, 100 kb, 50 kb, 15 kb,
10 kb, 7.5 kb, 5 kb, 2.5 kb, 2.0 kb, or 1 kb, in length. In a
further embodiment, polynucleotides of the invention comprise a
portion of the coding sequences, as disclosed herein, but do not
comprise all or a portion of any intron. In another embodiment, the
polynucleotides comprising coding sequences do not contain coding
sequences of a genomic flanking gene (i.e., 5' or 3' to the
G-protein Chemokine Receptor (CCR5) gene of interest in the
genome). In other embodiments, the polynucleotides of the invention
do not contain the coding sequence of more than 1000, 500, 250,
100, 50, 25, 20, 15, 10, 5, 4, 3, 2, or 1 genomic flanking
gene(s).
[0165] A representative clone containing the open reading frame of
the sequence for SEQ ID NO:1 was deposited with the American Type
Culture Collection ("ATCC.TM.") on Jun. 1, 1995, and was given the
ATCC.TM. Deposit Number 97183. The ATCC.TM. is located at 10801
University Boulevard, Manassas, Va. 20110-2209, USA. The ATCC.TM.
deposit was made pursuant to the terms of the Budapest Treaty on
the international recognition of the deposit of microorganisms for
purposes of patent procedure.
[0166] A G-protein Chemokine Receptor (CCR5) "polynucleotide" also
includes those polynucleotides capable of hybridizing, under
stringent hybridization conditions, to sequences contained in SEQ
ID NO:1, the complement thereof, or the DNA within the deposited
clone. "Stringent hybridization conditions" refers to an overnight
incubation at 42 degree C. in a solution comprising 50% formamide,
5.times.SSC (750 mM NaCl, 75 mM trisodium citrate), 50 mM sodium
phosphate (pH 7.6), 5.times.Denhardt's solution, 10% dextran
sulfate, and 20 .mu.g/ml denatured, sheared salmon sperm DNA,
followed by washing the filters in 0.1.times.SSC at about 65 degree
C.
[0167] Also contemplated are nucleic acid molecules that hybridize
to the G-protein Chemokine Receptor (CCR5) polynucleotides under
lower stringency hybridization conditions. Changes in the
stringency of hybridization and signal detection are primarily
accomplished through the manipulation of formamide concentration
(lower percentages of formamide result in lowered stringency); salt
conditions, or temperature. For example, lower stringency
conditions include an overnight incubation at 37 degree C. in a
solution comprising 6.times.SSPE (20.times.SSPE=3M NaCl; 0.2M
NaH.sub.2PO.sub.4; 0.02M EDTA, pH 7.4), 0.5% SDS, 30% formamide,
100 ug/ml salmon sperm blocking DNA; followed by washes at 50
degree C. with 1.times.SSPE, 0.1% SDS. In addition, to achieve even
lower stringency, washes performed following stringent
hybridization can be done at higher salt concentrations (e.g.
5.times.SSC).
[0168] Note that variations in the above conditions may be
accomplished through the inclusion and/or substitution of alternate
blocking reagents used to suppress background in hybridization
experiments. Typical blocking reagents include Denhardt's reagent,
BLOTTO, heparin, denatured salmon sperm DNA, and commercially
available proprietary formulations. The inclusion of specific
blocking reagents may require modification of the hybridization
conditions described above, due to problems with compatibility.
[0169] Of course, a polynucleotide which hybridizes only to polyA+
sequences (such as any 3' terminal polyA+ tract of a DNA shown in
the sequence listing), or to a complementary stretch of T (or U)
residues, would not be included in the definition of
"polynucleotide," since such a polynucleotide would hybridize to
any nucleic acid molecule containing a poly (A) stretch or the
complement thereof (e.g., practically any double-stranded cDNA
clone generated using oligo dT as a primer).
[0170] The G-protein Chemokine Receptor (CCR5) polynucleotide can
be composed of any polyribonucleotide or polydeoxyribonucleotide,
which may be unmodified RNA or DNA or modified RNA or DNA. For
example, G-protein Chemokine Receptor (CCR5) polynucleotides can be
composed of single- and double-stranded DNA, DNA that is a mixture
of single- and double-stranded regions, single- and double-stranded
RNA, and RNA that is mixture of single- and double-stranded
regions, hybrid molecules comprising DNA and RNA that may be
single-stranded or, more typically, double-stranded or a mixture of
single- and double-stranded regions. In addition, the G-protein
Chemokine Receptor (CCR5) polynucleotides can be composed of
triple-stranded regions comprising RNA or DNA or both RNA and DNA.
G-protein Chemokine Receptor (CCR5) polynucleotides may also
contain one or more modified bases or DNA or RNA backbones modified
for stability or for other reasons. "Modified" bases include, for
example, tritylated bases and unusual bases such as inosine. A
variety of modifications can be made to DNA and RNA; thus,
"polynucleotide" embraces chemically, enzymatically, or
metabolically modified forms.
[0171] G-protein Chemokine Receptor (CCR5) polypeptides can be
composed of amino acids joined to each other by peptide bonds or
modified peptide bonds, i.e., peptide isosteres, and may contain
amino acids other than the 20 gene-encoded amino acids. The
G-protein Chemokine Receptor (CCR5) polypeptides may be modified by
either natural processes, such as posttranslational processing, or
by chemical modification techniques which are well known in the
art. Such modifications are well described in basic texts and in
more detailed monographs, as well as in a voluminous research
literature. Modifications can occur anywhere in the G-protein
Chemokine Receptor (CCR5) polypeptide, including the peptide
backbone, the amino acid side-chains and the amino or carboxyl
termini. It will be appreciated that the same type of modification
may be present in the same or varying degrees at several sites in a
given G-protein Chemokine Receptor (CCR5) polypeptide. Also, a
given G-protein Chemokine Receptor (CCR5) polypeptide may contain
many types of modifications. G-protein Chemokine Receptor (CCR5)
polypeptides may be branched, for example, as a result of
ubiquitination, and they may be cyclic, with or without branching
Cyclic, branched, and branched cyclic G-protein Chemokine Receptor
(CCR5) polypeptides may result from posttranslation natural
processes or may be made by synthetic methods. Modifications
include acetylation, acylation, ADP-ribosylation, amidation,
covalent attachment of flavin, covalent attachment of a heme
moiety, covalent attachment of a nucleotide or nucleotide
derivative, covalent attachment of a lipid or lipid derivative,
covalent attachment of phosphotidylinositol, cross-linking,
cyclization, disulfide bond formation, demethylation, formation of
covalent cross-links, formation of cysteine, formation of
pyroglutamate, formylation, gamma-carboxylation, glycosylation, GPI
anchor formation, hydroxylation, iodination, methylation,
myristoylation, oxidation, pegylation, proteolytic processing,
phosphorylation, prenylation, racemization, selenoylation,
sulfation, transfer-RNA mediated addition of amino acids to
proteins such as arginylation, and ubiquitination. (See, for
instance, PROTEINS--STRUCTURE AND MOLECULAR PROPERTIES, 2nd Ed., T.
E. Creighton, W. H. Freeman and Company, New York (1993);
POSTTRANSLATIONAL COVALENT MODIFICATION OF PROTEINS, B. C. Johnson,
Ed., Academic Press, New York, pgs. 1-12 (1983); Seifter et al.,
Meth Enzymol 182:626-646 (1990); Rattan et al., Ann NY Acad Sci
663:48-62 (1992).)
[0172] "SEQ ID NO:1" refers to a G-protein Chemokine Receptor
(CCR5) polynucleotide sequence while "SEQ ID NO:2" refers to a
G-protein Chemokine Receptor (CCR5) polypeptide sequence.
[0173] A G-protein Chemokine Receptor (CCR5) polypeptide "having
biological activity" refers to polypeptides exhibiting activity
similar, but not necessarily identical to, an activity of a
G-protein Chemokine Receptor (CCR5) polypeptide, including mature
forms, as measured in a particular biological assay, with or
without dose dependency. In the case where dose dependency does
exist, it need not be identical to that of the G-protein Chemokine
Receptor (CCR5) polypeptide, but rather substantially similar to
the dose-dependence in a given activity as compared to the
G-protein Chemokine Receptor (CCR5) polypeptide (i.e., the
candidate polypeptide will exhibit greater activity or not more
than about 25-fold less and, preferably, not more than about
tenfold less activity, and most preferably, not more than about
three-fold less activity relative to the G-protein Chemokine
Receptor (CCR5) polypeptide).
G-Protein Chemokine Receptor (CCR5) Polynucleotides and
Polypeptides
[0174] Clone HDGNR10 was isolated from a human monocyte genomic DNA
library. This clone contains the entire coding region identified as
SEQ ID NO:2. The deposited clone contains a DNA insert having a
total of 1414 nucleotides, which encodes a predicted open reading
frame of 352 amino acid residues. (See FIG. 1.) The open reading
frame begins at a N-terminal methionine located at nucleotide
position 259, and ends at the last triplet coding for an amino acid
at nucleotide position 1314. The stop codon is at positions
1315-1317.
[0175] Subsequent expression analysis also showed G-protein
Chemokine Receptor (CCR5) expression in macrophages, including
immature dendritic cells such as Langerhans cells, and T cells,
including Th0 and Th1 effector cells, a pattern consistent with
immune system-specific expression. G-protein Chemokine Receptor
(CCR5) has also been detected in microglia, astrocytes, neurons,
and vascular endothelial cells of the central nervous system (CNS).
G-protein Chemokine Receptor (CCR5) is also expressed in monocyes
and T cells in the synovial fluid of rheumatoid arthritis patients,
and has also been implicated in other forms of arthritis.
[0176] G-protein Coupled Chemokine Receptors. Using BLAST analysis,
SEQ ID NO:2 was found to be homologous to members of the G-Protein
COUPLED Chemokine Receptor family. Particularly, SEQ ID NO:2
contains domains homologous to the translation product of the
MonoMac 6 mRNA for human MCP-1 receptor (MCP-1R) A (FIG. 2)
(GenBank Accession No. U03882; SEQ ID NO:9), including the
conserved transmembrane domain containing seven transmembrane
segments characteristic of the G-protein coupled receptor family,
which begins with amino acid 37 of SEQ ID NO:2 or the polypeptide
encoded by the deposited clone. G-protein Chemokine Receptor (CCR5)
also includes the DRY motif, which is known to be required for
signal transduction, found in many G-protein coupled receptors
immediately following the third transmembrane segment. Because
MCP-1R is thought to be important in the immune system, the
homology between MCP-1R and G-protein Chemokine Receptor (CCR5)
suggests that G-protein Chemokine Receptor (CCR5) may also be
involved in the immune system.
[0177] A second MCP-1R sequence has also been isolated which is
identical to the MCP-1RA sequence from the 5' untranslated region
through the putative seventh transmembrane domain but which
contains a different cytoplasmic tail. This second sequence, termed
MCP-1RB, appears to be an alternatively spliced version of MCP-1RA.
It is described further in U.S. Pat. No. 5,707,815.
[0178] Domains. Using BLAST analysis, SEQ ID NO:2 was found to be
homologous to members of the G-protein Chemokine Receptor (CCR5)
family. Particularly, SEQ ID NO:2 contains domains homologous to
the translation product of the MonoMac 6 mRNA for human MCP-1
receptor (MCP-1R) A (FIG. 2) (GenBank Accession No. U03882; SEQ ID
NO:9), including the following conserved domains: (a) a predicted
N-terminal extracellular domain located at about amino acids 1 to
36; (b) a predicted transmembrane domain located at about amino
acids 37 to 305; and (c) a predicted C-terminal intracellular
domain located at about amino acids 306 to 352. The predicted
transmembrane domain includes: seven transmembrane segments at
about amino acids 37 to 58 (segment 1), 68 to 88 (segment 2), 103
to 124 (segment 3), 142 to 166 (segment 4), 196 to 223 (segment 5),
236 to 260 (segment 6), and 287 to 305 (segment 7); three
intracellular loops at about amino acids 59 to 67 (intracellular
loop 1), 125 to 141 (intracellular loop 2), and 224 to 235
(intracellular loop 3); and three extracellular loops at about
amino acids 89 to 102 (extracellular loop 1), 167 to 195
(extracellular loop 2), and 261 to 274 (extracellular loop 3).
These polypeptide fragments of G-protein Chemokine Receptor (CCR5)
as defined above or as encoded by the deposited clone (SEQ ID
NO:22) are specifically contemplated in the present invention, as
are combinations of these and other regions disclosed herein. Also
contemplated are polypeptides which exclude one or more of these
domains, segments, and loops. The "loops" are also referred to as
"regions," "domains," and "portions" herein and in the art, e.g.,
extracellular "regions", intracellular "regions", extracellular
"domains", and intracellular "domains", extracellular "portions",
and intracellular "portions".
[0179] SEQ ID NO:1 and the translated SEQ ID NO:2 are sufficiently
accurate and otherwise suitable for a variety of uses well known in
the art and described further below. For instance, SEQ ID NO:1 is
useful for designing nucleic acid hybridization probes that will
detect nucleic acid sequences contained in SEQ ID NO:1 or the DNA
contained in the deposited clone. These probes will also hybridize
to nucleic acid molecules in biological samples, thereby enabling a
variety of forensic and diagnostic methods of the invention.
Similarly, polypeptides identified from SEQ ID NO:2 may be used,
for example, to generate antibodies which bind specifically to
proteins G-protein Chemokine Receptor.
[0180] Nevertheless, DNA sequences generated by sequencing
reactions can contain sequencing errors. The errors exist as
misidentified nucleotides, or as insertions or deletions of
nucleotides in the generated DNA sequence. The erroneously inserted
or deleted nucleotides cause frame shifts in the reading frames of
the predicted amino acid sequence. In these cases, the predicted
amino acid sequence diverges from the actual amino acid sequence,
even though the generated DNA sequence may be greater than 99.9%
identical to the actual DNA sequence (for example, one base
insertion or deletion in an open reading frame of over 1000
bases).
[0181] Accordingly, for those applications requiring precision in
the nucleotide sequence or the amino acid sequence, the present
invention provides not only the generated nucleotide sequence
identified as SEQ ID NO:1 and the predicted translated amino acid
sequence identified as SEQ ID NO:2, but also a sample of plasmid
DNA containing a human DNA of G-protein Chemokine Receptor (CCR5)
deposited with the ATCC.TM.. The nucleotide sequence of the
deposited G-protein Chemokine Receptor (CCR5) clone can readily be
determined by sequencing the deposited clone in accordance with
known methods. The predicted G-protein Chemokine Receptor (CCR5)
amino acid sequence can then be verified from such deposits.
Moreover, the amino acid sequence of the protein encoded by the
deposited clone can also be directly determined by peptide
sequencing or by expressing the protein in a suitable host cell
containing the deposited human G-protein Chemokine Receptor (CCR5)
DNA, collecting the protein, and determining its sequence. A sample
of the deposited clone, which contains the open reading frame of
the G-protein Chemokine Receptor (CCR5), has been obtained from the
ATCC.TM. and has been resequenced. The sequence data from the
resequenced clone is shown in SEQ ID NO:21 and 22. SEQ ID NO:21
differs from SEQ ID NO:1 at 5 positions (nucleotides 320, 433, 442,
646, and 1289 of SEQ ID NO:1) SEQ ID NO:22 differs from SEQ ID NO:2
at 5 positions (amino acid residues 21, 59, 62, 130, and 344).
[0182] The present invention also relates to the G-protein
Chemokine Receptor (CCR5) gene corresponding to SEQ ID NO:1, SEQ ID
NO:2, or the deposited clone. The G-protein Chemokine Receptor
(CCR5) gene can be isolated in accordance with known methods using
the sequence information disclosed herein. Such methods include
preparing probes or primers from the disclosed sequence and
identifying or amplifying the G-protein Chemokine Receptor (CCR5)
gene from appropriate sources of genomic material.
[0183] Also provided in the present invention are allelic variants,
orthologs, and/or species homologs. Procedures known in the art can
be used to obtain full-length genes, allelic variants, splice
variants, full-length coding portions, orthologs, and/or species
homologs of genes corresponding to SEQ ID NO:1, SEQ ID NO:2, or a
the deposited clone, using information from the sequences disclosed
herein or the clones deposited with the ATCC.TM.. For example,
allelic variants and/or species homologs may be isolated and
identified by making suitable probes or primers from the sequences
provided herein and screening a suitable nucleic acid source for
allelic variants and/or the desired homologue.
[0184] The G-protein Chemokine Receptor (CCR5) polypeptides can be
prepared in any suitable manner. Such polypeptides include isolated
naturally occurring polypeptides, recombinantly produced
polypeptides, synthetically produced polypeptides, or polypeptides
produced by a combination of these methods. Means for preparing
such polypeptides are well understood in the art.
[0185] The G-protein Chemokine Receptor (CCR5) polypeptides may be
in the form of the secreted protein, including the mature form, or
may be a part of a larger protein, such as a fusion protein (see
below). It is often advantageous to include an additional amino
acid sequence which contains secretory or leader sequences,
pro-sequences, sequences which aid in purification, such as
multiple histidine residues, or an additional sequence for
stability during recombinant production.
[0186] G-protein Chemokine Receptor (CCR5) polypeptides are
preferably provided in an isolated form, and preferably are
substantially purified. A recombinantly produced version of a
G-protein Chemokine Receptor (CCR5) polypeptide, including the
secreted polypeptide, can be substantially purified using
techniques described herein or otherwise known in the art, such as,
for example, by the one-step method described in Smith and Johnson,
Gene 67:31-40 (1988). G-protein Chemokine Receptor (CCR5)
polypeptides also can be purified from natural, synthetic or
recombinant sources using techniques described herein or otherwise
known in the art, such as, for example, antibodies of the invention
raised against the G-protein Chemokine Receptor (CCR5) protein.
[0187] The present invention provides a polynucleotide comprising,
or alternatively consisting of, the nucleic acid sequence of SEQ ID
NO:1, and/or a clone contained in ATCC.TM. deposit 97183. The
present invention also provides a polypeptide comprising, or
alternatively, consisting of, the polypeptide sequence of SEQ ID
NO:2 and/or a polypeptide encoded by the clone contained in
ATCC.TM. deposit 97183. Polynucleotides encoding a polypeptide
comprising, or alternatively consisting of the polypeptide sequence
of SEQ ID NO:2 and/or a polypeptide sequence encoded by the clone
contained in ATCC.TM. deposit 97183 are also encompassed by the
invention.
Signal Sequences
[0188] As described herein, the present invention also encompasses
fusions of a signal sequence with the polypeptide of SEQ ID NO:2,
and fragments thereof, and/or the polypeptide encoded by the
deposited clone, and fragments thereof, to direct secretion of the
polypeptide or fragment. Polynucleotides encoding such fusions are
also encompassed by the invention.
[0189] The present invention also encompasses mature forms of the
polypeptide having the sequence of SEQ ID NO:2, and fragments
thereof, and/or the polypeptide sequence encoded by the deposited
clone, and fragments thereof. Polynucleotides encoding the mature
forms (such as, for example, the polynucleotide sequence in SEQ ID
NO:1, and fragments thereof, and/or the polynucleotide sequence
contained in the deposited clone, and fragments thereof) are also
encompassed by the invention.
[0190] According to the signal hypothesis, proteins secreted by
mammalian cells have a signal or secretary leader sequence which is
cleaved from the mature protein once export of the growing chain
across the rough endoplasmic reticulum has been initiated. Most
mammalian cells and even insect cells cleave secreted proteins with
the same specificity. However, in some cases, cleavage of a
secreted protein is not entirely uniform, which results in two or
more mature species of the protein. Further, it has long been known
that cleavage specificity of a secreted protein is ultimately
determined by the primary structure of the complete protein, that
is, it is inherent in the amino acid sequence of the
polypeptide.
[0191] Methods for predicting whether a protein has a signal
sequence, as well as the cleavage point for that sequence, are
available. For instance, the method of McGeoch, Virus Res.
3:271-286 (1985), uses the information from a short N-terminal
charged region and a subsequent uncharged region of the complete
(uncleaved) protein. The method of von Heinje, Nucleic Acids Res.
14:4683-4690 (1986) uses the information from the residues
surrounding the cleavage site, typically residues -13 to +2, where
+1 indicates the amino terminus of the secreted protein. The
accuracy of predicting the cleavage points of known mammalian
secretory proteins for each of these methods is in the range of
75-80%. (von Heinje, supra.) However, the two methods do not always
produce the same predicted cleavage point(s) for a given
protein.
[0192] The deduced amino acid sequence of a secreted polypeptide
can be analyzed by a computer program called SignalP (Henrik
Nielsen et al., Protein Engineering 10:1-6 (1997)), which predicts
the cellular location of a protein based on the amino acid
sequence. As part of this computational prediction of localization,
the methods of McGeoch and von Heinje are incorporated.
[0193] As one of ordinary skill would appreciate, however, cleavage
sites sometimes vary from organism to organism and cannot be
predicted with absolute certainty. Cleavage of a heterologous
signal sequence in a fusion protein may occur at the junction of
the polypeptide sequences or cleavage may occur at a position on
either side of the junction. Accordingly, the present invention
provides secreted polypeptides having a sequence shown in SEQ ID
NO:2, and fragments thereof, which have an N-terminus beginning
within 5 residues (i.e., + or -5 residues) of the predicted
cleavage point. Similarly, it is also recognized that in some
cases, cleavage of the signal sequence from a secreted protein is
not entirely uniform, resulting in more than one secreted species.
These polypeptides and fragments, and the polynucleotides encoding
such polypeptides and fragments, are contemplated by the present
invention.
[0194] Moreover, the signal sequence identified by the above
analysis may not necessarily predict the naturally occurring signal
sequence. For example, the naturally occurring signal sequence may
be further upstream from the predicted signal sequence. However, it
is likely that the predicted signal sequence will be capable of
directing the secreted protein to the ER. Nonetheless, the present
invention provides the mature protein or fragment produced by
expression of the polynucleotide sequence of SEQ ID NO:1 or a
fragment thereof and/or the polynucleotide sequence contained in
the deposited clone or a fragment thereof, in a mammalian cell
(e.g., COS cells, as described below). These polypeptides, and the
polynucleotides encoding such polypeptides, are contemplated by the
present invention.
Polynucleotide and Polypeptide Variants
[0195] The present invention is directed to variants of the
polynucleotide sequence disclosed in SEQ ID NO:1, the complementary
strand thereto, and/or the sequence contained in a deposited
clone.
[0196] The present invention also encompasses variants of the
polypeptide sequence disclosed in SEQ ID NO:2 and/or encoded by a
deposited clone.
[0197] "Variant" refers to a polynucleotide or polypeptide
differing from the G-protein Chemokine Receptor (CCR5)
polynucleotide or polypeptide, but retaining essential properties
thereof. Generally, variants are overall closely similar, and, in
many regions, identical to the G-protein Chemokine Receptor (CCR5)
polynucleotide or polypeptide.
[0198] The present invention is also directed to nucleic acid
molecules which comprise, or alternatively consist of, a nucleotide
sequence which is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99%
identical to, for example, the nucleotide coding sequence in SEQ ID
NO:1 or the complementary strand thereto, the nucleotide coding
sequence contained in a deposited clone or the complementary strand
thereto, a nucleotide sequence encoding the polypeptide of SEQ ID
NO:2, a nucleotide sequence encoding the polypeptide encoded by the
HDGNR10 deposited clone, and/or polynucleotide fragments of any of
these nucleic acid molecules (e.g., those fragments described
herein). Polynucleotides which hybridize to these nucleic acid
molecules under stringent hybridization conditions or lower
stringency conditions are also encompassed by the invention, as are
polypeptides encoded by these polynucleotides.
[0199] The present invention is also directed to polypeptides which
comprise, or alternatively consist of, an amino acid sequence which
is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to,
for example, the polypeptide sequence shown in SEQ ID NO:2, the
polypeptide sequence encoded by the deposited clone, and/or
polypeptide fragments of any of these polypeptides (e.g., those
fragments described herein).
[0200] By a nucleic acid having a nucleotide sequence at least, for
example, 95% "identical" to a reference nucleotide sequence of the
present invention, it is intended that the nucleotide sequence of
the nucleic acid is identical to the reference sequence except that
the nucleotide sequence may include up to five point mutations per
each 100 nucleotides of the reference nucleotide sequence encoding
the G-protein Chemokine Receptor (CCR5) polypeptide. In other
words, to obtain a nucleic acid having a nucleotide sequence at
least 95% identical to a reference nucleotide sequence, up to 5% of
the nucleotides in the reference sequence may be deleted or
substituted with another nucleotide, or a number of nucleotides up
to 5% of the total nucleotides in the reference sequence may be
inserted into the reference sequence. The query sequence may be an
entire sequence shown of SEQ ID NO:1, the ORF (open reading frame)
of the HDGNR10 DNA in the deposited clone, or any fragment
specified as described herein.
[0201] As a practical matter, whether any particular nucleic acid
molecule or polypeptide is at least 80%, 85%, 90%, 95%, 96%, 97%,
98% or 99% identical to a nucleotide sequence or polypeptide of the
present invention can be determined conventionally using known
computer programs. A preferred method for determining the best
overall match between a query sequence (a sequence of the present
invention) and a subject sequence, also referred to as a global
sequence alignment, can be determined using the FASTDB computer
program based on the algorithm of Brutlag et al. (Comp. App.
Biosci. (1990) 6:237-245.) In a sequence alignment the query and
subject sequences are both DNA sequences. An RNA sequence can be
compared by converting U's to T's. The result of said global
sequence alignment is in percent identity. Preferred parameters
used in a FASTDB alignment of DNA sequences to calculate percent
identity are: Matrix=Unitary, k-tuple=4, Mismatch Penalty=1,
Joining Penalty=30, Randomization Group Length=0, Cutoff Score=1,
Gap Penalty=5, Gap Size Penalty 0.05, Window Size=500 or the length
of the subject nucleotide sequence, whichever is shorter.
[0202] If the subject sequence is shorter than the query sequence
because of 5' or 3' deletions, not because of internal deletions, a
manual correction must be made to the results. This is because the
FASTDB program does not account for 5' and 3' truncations of the
subject sequence when calculating percent identity. For subject
sequences truncated at the 5' or 3' ends, relative to the query
sequence, the percent identity is corrected by calculating the
number of bases of the query sequence that are 5' and 3' of the
subject sequence, which are not matched/aligned, as a percent of
the total bases of the query sequence. Whether a nucleotide is
matched/aligned is determined by results of the FASTDB sequence
alignment. This percentage is then subtracted from the percent
identity, calculated by the above FASTDB program using the
specified parameters, to arrive at a final percent identity score.
This corrected score is what is used for the purposes of the
present invention. Only bases outside the 5' and 3' bases of the
subject sequence, as displayed by the FASTDB alignment, which are
not matched/aligned with the query sequence, are calculated for the
purposes of manually adjusting the percent identity score.
[0203] For example, a 90 base subject sequence is aligned to a 100
base query sequence to determine percent identity. The deletions
occur at the 5' end of the subject sequence and therefore, the
FASTDB alignment does not show a matched/alignment of the first 10
bases at 5' end. The 10 unpaired bases represent 10% of the
sequence (number of bases at the 5' and 3' ends not matched/total
number of bases in the query sequence) so 10% is subtracted from
the percent identity score calculated by the FASTDB program. If the
remaining 90 bases were perfectly matched the final percent
identity would be 90%. In another example, a 90 base subject
sequence is compared with a 100 base query sequence. This time the
deletions are internal deletions so that there are no bases on the
5' or 3' of the subject sequence which are not matched/aligned with
the query. In this case the percent identity calculated by FASTDB
is not manually corrected. Once again, only bases 5' and 3' of the
subject sequence which are not matched/aligned with the query
sequence are manually corrected for. No other manual corrections
are to made for the purposes of the present invention.
[0204] By a polypeptide having an amino acid sequence at least, for
example, 95% "identical" to a query amino acid sequence of the
present invention, it is intended that the amino acid sequence of
the subject polypeptide is identical to the query sequence except
that the subject polypeptide sequence may include up to five amino
acid alterations per each 100 amino acids of the query amino acid
sequence. In other words, to obtain a polypeptide having an amino
acid sequence at least 95% identical to a query amino acid
sequence, up to 5% of the amino acid residues in the subject
sequence may be inserted, deleted, (indels) or substituted with
another amino acid. These alterations of the reference sequence may
occur at the amino or carboxy terminal positions of the reference
amino acid sequence or anywhere between those terminal positions,
interspersed either individually among residues in the reference
sequence or in one or more contiguous groups within the reference
sequence.
[0205] As a practical matter, whether any particular polypeptide is
at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to, for
instance, the amino acid sequences of SEQ ID NO:2 or to the amino
acid sequence encoded by the deposited clone can be determined
conventionally using known computer programs. A preferred method
for determining the best overall match between a query sequence (a
sequence of the present invention) and a subject sequence, also
referred to as a global sequence alignment, can be determined using
the FASTDB computer program based on the algorithm of Brutlag et
al. (Comp. App. Biosci. 6:237-245 (1990)). In a sequence alignment
the query and subject sequences are either both nucleotide
sequences or both amino acid sequences. The result of said global
sequence alignment is in percent identity. Preferred parameters
used in a FASTDB amino acid alignment are: Matrix=PAM 0, k-tuple=2,
Mismatch Penalty=1, Joining Penalty=20, Randomization Group
Length=0, Cutoff Score=1, Window Size=sequence length, Gap
Penalty=5, Gap Size Penalty=0.05, Window Size=500 or the length of
the subject amino acid sequence, whichever is shorter.
[0206] If the subject sequence is shorter than the query sequence
due to N- or C-terminal deletions, not because of internal
deletions, a manual correction must be made to the results. This is
because the FASTDB program does not account for N- and C-terminal
truncations of the subject sequence when calculating global percent
identity. For subject sequences truncated at the N- and C-termini,
relative to the query sequence, the percent identity is corrected
by calculating the number of residues of the query sequence that
are N- and C-terminal of the subject sequence, which are not
matched/aligned with a corresponding subject residue, as a percent
of the total bases of the query sequence. Whether a residue is
matched/aligned is determined by results of the FASTDB sequence
alignment. This percentage is then subtracted from the percent
identity, calculated by the above FASTDB program using the
specified parameters, to arrive at a final percent identity score.
This final percent identity score is what is used for the purposes
of the present invention. Only residues to the N- and C-termini of
the subject sequence, which are not matched/aligned with the query
sequence, are considered for the purposes of manually adjusting the
percent identity score. That is, only query residue positions
outside the farthest N- and C-terminal residues of the subject
sequence.
[0207] For example, a 90 amino acid residue subject sequence is
aligned with a 100 residue query sequence to determine percent
identity. The deletion occurs at the N-terminus of the subject
sequence and therefore, the FASTDB alignment does not show a
matching/alignment of the first 10 residues at the N-terminus. The
10 unpaired residues represent 10% of the sequence (number of
residues at the N- and C-termini not matched/total number of
residues in the query sequence) so 10% is subtracted from the
percent identity score calculated by the FASTDB program. If the
remaining 90 residues were perfectly matched the final percent
identity would be 90%. In another example, a 90 residue subject
sequence is compared with a 100 residue query sequence. This time
the deletions are internal deletions so there are no residues at
the N- or C-termini of the subject sequence which are not
matched/aligned with the query. In this case the percent identity
calculated by FASTDB is not manually corrected. Once again, only
residue positions outside the N- and C-terminal ends of the subject
sequence, as displayed in the FASTDB alignment, which are not
matched/aligned with the query sequence are manually corrected for.
No other manual corrections are to made for the purposes of the
present invention.
[0208] The G-protein Chemokine Receptor (CCR5) variants may contain
alterations in the coding regions, non-coding regions, or both.
Especially preferred are polynucleotide variants containing
alterations which produce silent substitutions, additions, or
deletions, but do not alter the properties or activities of the
encoded polypeptide. Nucleotide variants produced by silent
substitutions due to the degeneracy of the genetic code are
preferred. Moreover, variants in which 5-10, 1-5, or 1-2 amino
acids are substituted, deleted, or added in any combination are
also preferred. G-protein Chemokine Receptor (CCR5) polynucleotide
variants can be produced for a variety of reasons, e.g., to
optimize codon expression for a particular host (change codons in
the human mRNA to those preferred by a bacterial host such as E.
coli).
[0209] Naturally occurring G-protein Chemokine Receptor (CCR5)
variants are called "allelic variants," and refer to one of several
alternate forms of a gene occupying a given locus on a chromosome
of an organism. (Genes II, Lewin, B., ed., John Wiley & Sons,
New York (1985).) These allelic variants can vary at either the
polynucleotide and/or polypeptide level and are included in the
present invention. Alternatively, non-naturally occurring variants
may be produced by mutagenesis techniques or by direct
synthesis.
[0210] Using known methods of protein engineering and recombinant
DNA technology, variants may be generated to improve or alter the
characteristics of the G-protein Chemokine Receptor (CCR5)
polypeptides. For instance, one or more amino acids can be deleted
from the N-terminus or C-terminus of the secreted protein without
substantial loss of biological function. The authors of Ron et al.,
J. Biol. Chem. 268: 2984-2988 (1993), reported variant KGF proteins
having heparin binding activity even after deleting 3, 8, or 27
amino-terminal amino acid residues. Similarly, Interferon gamma
exhibited up to ten times higher activity after deleting 8-10 amino
acid residues from the carboxy terminus of this protein. (Dobeli et
al., J. Biotechnology 7:199-216 (1988).)
[0211] Moreover, ample evidence demonstrates that variants often
retain a biological activity similar to that of the naturally
occurring protein. For example, Gayle and coworkers (J. Biol. Chem.
268:22105-22111 (1993)) conducted extensive mutational analysis of
human cytokine IL-1a. They used random mutagenesis to generate over
3,500 individual IL-1a mutants that averaged 2.5 amino acid changes
per variant over the entire length of the molecule. Multiple
mutations were examined at every possible amino acid position. The
investigators found that "[m]ost of the molecule could be altered
with little effect on either [binding or biological activity]."
(See, Abstract.) In fact, only 23 unique amino acid sequences, out
of more than 3,500 nucleotide sequences examined, produced a
protein that significantly differed in activity from wild-type.
[0212] Furthermore, even if deleting one or more amino acids from
the N-terminus or C-terminus of a polypeptide results in
modification or loss of one or more biological functions, other
biological activities may still be retained. For example, the
ability of a deletion variant to induce and/or to bind antibodies
which recognize the secreted form will likely be retained when less
than the majority of the residues of the secreted form are removed
from the N-terminus or C-terminus. Whether a particular polypeptide
lacking N- or C-terminal residues of a protein retains such
immunogenic activities can readily be determined by routine methods
described herein and otherwise known in the art.
[0213] Thus, the invention further includes G-protein Chemokine
Receptor (CCR5) polypeptide variants which show substantial
biological activity. Such variants include deletions, insertions,
inversions, repeats, and substitutions selected according to
general rules known in the art so as have little effect on
activity.
[0214] The present application is directed to nucleic acid
molecules at least 90%, 95%, 96%, 97%, 98% or 99% identical to the
nucleic acid sequences disclosed herein, (e.g., encoding a
polypeptide having the amino acid sequence of an N and/or C
terminal deletion disclosed below as m-n of SEQ ID NO:2) or which
correspond to the polypeptide encoded by the deposited clone,
irrespective of whether they encode a polypeptide having G-protein
Chemokine Receptor (CCR5) functional activity. This is because even
where a particular nucleic acid molecule does not encode a
polypeptide having G-protein Chemokine Receptor (CCR5) functional
activity, one of skill in the art would still know how to use the
nucleic acid molecule, for instance, as a hybridization probe or a
polymerase chain reaction (PCR) primer. Uses of the nucleic acid
molecules of the present invention that do not encode a polypeptide
having G-protein Chemokine Receptor (CCR5) functional activity
include, inter alia, (1) isolating a G-protein Chemokine Receptor
(CCR5) gene or allelic or splice variants thereof in a cDNA
library; (2) in situ hybridization (e.g., "FISH") to metaphase
chromosomal spreads to provide precise chromosomal location of the
G-protein Chemokine Receptor (CCR5) gene, as described in Verma et
al., Human Chromosomes: A Manual of Basic Techniques, Pergamon
Press, New York (1988); and (3) Northern Blot analysis for
detecting G-protein Chemokine Receptor (CCR5) mRNA expression in
specific tissues.
[0215] Preferred, however, are nucleic acid molecules having
sequences at least 90%, 95%, 96%, 97%, 98% or 99% identical to the
nucleic acid sequences disclosed herein, which do, in fact, encode
a polypeptide having G-protein Chemokine Receptor (CCR5) functional
activity. By "a polypeptide having G-protein Chemokine Receptor
(CCR5) functional activity" is intended polypeptides exhibiting
activity similar, but not necessarily identical, to a functional
activity of the G-protein Chemokine Receptor (CCR5) polypeptides of
the present invention (e.g., complete (full-length) G-protein
Chemokine Receptor (CCR5), mature G-protein Chemokine Receptor
(CCR5) and soluble G-protein Chemokine Receptor (CCR5) (e.g.,
having sequences contained in the extracellular domain or regions
of G-protein Chemokine Receptor) as measured, for example, in a
particular immunoassay or biological assay. For example, a
G-protein Chemokine Receptor (CCR5) functional activity can
routinely be measured by determining the ability of a G-protein
Chemokine Receptor (CCR5) polypeptide to bind a G-protein Chemokine
Receptor (CCR5) ligand. G-protein Chemokine Receptor (CCR5)
functional activity may also be measured by determining the ability
of a polypeptide, such as cognate ligand which is free or expressed
on a cell surface, to induce cells expressing the polypeptide.
[0216] Of course, due to the degeneracy of the genetic code, one of
ordinary skill in the art will immediately recognize that a large
number of the nucleic acid molecules having a sequence at least
90%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid
sequence of the deposited clone, the nucleic acid sequence shown in
FIG. 1 (SEQ ID NO:1), or fragments thereof, will encode
polypeptides "having G-protein Chemokine Receptor (CCR5) functional
activity." In fact, since degenerate variants of any of these
nucleotide sequences all encode the same polypeptide, in many
instances, this will be clear to the skilled artisan even without
performing the above described comparison assay. It will be further
recognized in the art that, for such nucleic acid molecules that
are not degenerate variants, a reasonable number will also encode a
polypeptide having G-protein Chemokine Receptor (CCR5) functional
activity. This is because the skilled artisan is fully aware of
amino acid substitutions that are either less likely or not likely
to significantly effect protein function (e.g., replacing one
aliphatic amino acid with a second aliphatic amino acid), as
further described below.
[0217] For example, guidance concerning how to make phenotypically
silent amino acid substitutions is provided in Bowie et al.,
"Deciphering the Message in Protein Sequences: Tolerance to Amino
Acid Substitutions," Science 247:1306-1310 (1990), wherein the
authors indicate that there are two main strategies for studying
the tolerance of an amino acid sequence to change.
[0218] The first strategy exploits the tolerance of amino acid
substitutions by natural selection during the process of evolution.
By comparing amino acid sequences in different species, conserved
amino acids can be identified. These conserved amino acids are
likely important for protein function. In contrast, the amino acid
positions where substitutions have been tolerated by natural
selection indicates that these positions are not critical for
protein function. Thus, positions tolerating amino acid
substitution could be modified while still maintaining biological
activity of the protein.
[0219] The second strategy uses genetic engineering to introduce
amino acid changes at specific positions of a cloned gene to
identify regions critical for protein function. For example, site
directed mutagenesis or alanine-scanning mutagenesis (introduction
of single alanine mutations at every residue in the molecule) can
be used. (Cunningham and Wells, Science 244:1081-1085 (1989).) The
resulting mutant molecules can then be tested for biological
activity.
[0220] As the authors state, these two strategies have revealed
that proteins are surprisingly tolerant of amino acid
substitutions. The authors further indicate which amino acid
changes are likely to be permissive at certain amino acid positions
in the protein. For example, most buried (within the tertiary
structure of the protein) amino acid residues require nonpolar side
chains, whereas few features of surface side chains are generally
conserved. Moreover, tolerated conservative amino acid
substitutions involve replacement of the aliphatic or hydrophobic
amino acids Ala, Val, Leu and Ile; replacement of the hydroxyl
residues Ser and Thr; replacement of the acidic residues Asp and
Glu; replacement of the amide residues Asn and Gln, replacement of
the basic residues Lys, Arg, and His; replacement of the aromatic
residues Phe, Tyr, and Trp, and replacement of the small-sized
amino acids Ala, Ser, Thr, Met, and Gly.
[0221] For example, site directed changes at the amino acid level
of G-protein Chemokine Receptor (CCR5) can be made by replacing a
particular amino acid with a conservative amino acid. Preferred
conservative mutations of G-protein Chemokine Receptor (CCR5) (SEQ
ID NO:2) include: M1 replaced with A, G, I, L, S, T, or V; D2
replaced with E; Y3 replaced with F, or W; Q4 replaced with N; V5
replaced with A, G, I, L, S, T, or M; S6 replaced with A, G, I, L,
T, M, or V; S7 replaced with A, G, I, L, T, M, or V; I9 replaced
with A, G, L, S, T, M, or V; Y10 replaced with F, or W; D11
replaced with E; I12 replaced with A, G, L, S, T, M, or V; N13
replaced with Q; Y14 replaced with F, or W; Y15 replaced with F, or
W; T16 replaced with A, G, I, L, S, M, or V; S17 replaced with A,
G, I, L, T, M, or V; E18 replaced with D; K22 replaced with H, or
R; I23 replaced with A, G, L, S, T, M, or V; N24 replaced with Q;
V25 replaced with A, G, I, L, S, T, or M; K26 replaced with H, or
R; Q27 replaced with N; I28 replaced with A, G, L, S, T, M, or V;
A29 replaced with G, I, L, S, T, M, or V; A30 replaced with G, I,
L, S, T, M, or V; R31 replaced with H, or K; L32 replaced with A,
G, I, S, T, M, or V; L33 replaced with A, G, I, S, T, M, or V; L36
replaced with A, G, I, S, T, M, or V; Y37 replaced with F, or W;
S38 replaced with A, G, I, L, T, M, or V; L39 replaced with A, G,
I, S, T, M, or V; V40 replaced with A, G, I, L, S, T, or M; F41
replaced with W, or Y; I42 replaced with A, G, L, S, T, M, or V;
F43 replaced with W, or Y; G44 replaced with A, I, L, S, T, M, or
V; F45 replaced with W, or Y; V46 replaced with A, G, I, L, S, T,
or M; G47 replaced with A, I, L, S, T, M, or V; N48 replaced with
Q; M49 replaced with A, G, I, L, S, T, or V; L50 replaced with A,
G, I, S, T, M, or V; V51 replaced with A, G, I, L, S, T, or M; I52
replaced with A, G, L, S, T, M, or V; L53 replaced with A, G, I, S,
T, M, or V; I54 replaced with A, G, L, S, T, M, or V; L55 replaced
with A, G, I, S, T, M, or V; I56 replaced with A, G, L, S, T, M, or
V; N57 replaced with Q; Q59 replaced with N; R60 replaced with H,
or K; L61 replaced with A, G, I, S, T, M, or V; E62 replaced with
D; S63 replaced with A, G, I, L, T, M, or V; M64 replaced with A,
G, I, L, S, T, or V; T65 replaced with A, G, I, L, S, M, or V; D66
replaced with E; I67 replaced with A, G, L, S, T, M, or V; Y68
replaced with F, or W; L69 replaced with A, G, I, S, T, M, or V;
L70 replaced with A, G, I, S, T, M, or V; N71 replaced with Q; L72
replaced with A, G, I, S, T, M, or V; A73 replaced with G, I, L, S,
T, M, or V; I74 replaced with A, G, L, S, T, M, or V; S75 replaced
with A, G, I, L, T, M, or V; D76 replaced with E; L77 replaced with
A, G, I, S, T, M, or V; F78 replaced with W, or Y; F79 replaced
with W, or Y; L80 replaced with A, G, I, S, T, M, or V; L81
replaced with A, G, I, S, T, M, or V; T82 replaced with A, G, I, L,
S, M, or V; V83 replaced with A, G, I, L, S, T, or M; F85 replaced
with W, or Y; W86 replaced with F, or Y; A87 replaced with G, I, L,
S, T, M, or V; H88 replaced with K, or R; Y89 replaced with F, or
W; A90 replaced with G, I, L, S, T, M, or V; A91 replaced with G,
I, L, S, T, M, or V; A92 replaced with G, I, L, S, T, M, or V; Q93
replaced with N; W94 replaced with F, or Y; D95 replaced with E;
F96 replaced with W, or Y; G97 replaced with A, I, L, S, T, M, or
V; N98 replaced with Q; T99 replaced with A, G, I, L, S, M, or V;
M100 replaced with A, G, I, L, S, T, or V; Q102 replaced with N;
L103 replaced with A, G, I, S, T, M, or V; L104 replaced with A, G,
I, S, T, M, or V; T105 replaced with A, G, I, L, S, M, or V; G106
replaced with A, I, L, S, T, M, or V; L107 replaced with A, G, I,
S, T, M, or V; Y108 replaced with F, or W; F109 replaced with W, or
Y; I110 replaced with A, G, L, S, T, M, or V; G111 replaced with A,
I, L, S, T, M, or V; F112 replaced with W, or Y; F113 replaced with
W, or Y; S114 replaced with A, G, I, L, T, M, or V; G115 replaced
with A, I, L, S, T, M, or V; I116 replaced with A, G, L, S, T, M,
or V; F117 replaced with W, or Y; F118 replaced with W, or Y; I119
replaced with A, G, L, S, T, M, or V; I120 replaced with A, G, L,
S, T, M, or V; L121 replaced with A, G, I, S, T, M, or V; L122
replaced with A, G, I, S, T, M, or V; T123 replaced with A, G, I,
L, S, M, or V; I124 replaced with A, G, L, S, T, M, or V; D125
replaced with E; R126 replaced with H, or K; Y127 replaced with F,
or W; L128 replaced with A, G, I, S, T, M, or V; A129 replaced with
G, I, L, S, T, M, or V; I130 replaced with A, G, L, S, T, M, or V;
V131 replaced with A, G, I, L, S, T, or M; H132 replaced with K, or
R; A133 replaced with G, I, L, S, T, M, or V; V134 replaced with A,
G, I, L, S, T, or M; F135 replaced with W, or Y; A136 replaced with
G, I, L, S, T, M, or V; L137 replaced with A, G, I, S, T, M, or V;
K138 replaced with H, or R; A139 replaced with G, I, L, S, T, M, or
V; R140 replaced with H, or K; T141 replaced with A, G, I, L, S, M,
or V; V142 replaced with A, G, I, L, S, T, or M; T143 replaced with
A, G, I, L, S, M, or V; F144 replaced with W, or Y; G145 replaced
with A, I, L, S, T, M, or V; V146 replaced with A, G, I, L, S, T,
or M; V147 replaced with A, G, I, L, S, T, or M; T148 replaced with
A, G, I, L, S, M, or V; S149 replaced with A, G, I, L, T, M, or V;
V150 replaced with A, G, I, L, S, T, or M; I151 replaced with A, G,
L, S, T, M, or V; T152 replaced with A, G, I, L, S, M, or V; W153
replaced with F, or Y; V154 replaced with A, G, I, L, S, T, or M;
V155 replaced with A, G, I, L, S, T, or M; A156 replaced with G, I,
L, S, T, M, or V; V157 replaced with A, G, I, L, S, T, or M; F158
replaced with W, or Y; A159 replaced with G, I, L, S, T, M, or V;
S160 replaced with A, G, I, L, T, M, or V; L161 replaced with A, G,
I, S, T, M, or V; G163 replaced with A, I, L, S, T, M, or V; I164
replaced with A, G, L, S, T, M, or V; I165 replaced with A, G, L,
S, T, M, or V; F166 replaced with W, or Y; T167 replaced with A, G,
I, L, S, M, or V; R168 replaced with H, or K; S169 replaced with A,
G, I, L, T, M, or V; Q170 replaced with N; K171 replaced with H, or
R; E172 replaced with D; G173 replaced with A, I, L, S, T, M, or V;
L174 replaced with A, G, I, S, T, M, or V; H175 replaced with K, or
R; Y176 replaced with F, or W; T177 replaced with A, G, I, L, S, M,
or V; S179 replaced with A, G, I, L, T, M, or V; S180 replaced with
A, G, I, L, T, M, or V; H181 replaced with K, or R; F182 replaced
with W, or Y; Y184 replaced with F, or W; S185 replaced with A, G,
I, L, T, M, or V; Q186 replaced with N; Y187 replaced with F, or W;
Q188 replaced with N; F189 replaced with W, or Y; W190 replaced
with F, or Y; K191 replaced with H, or R; N192 replaced with Q;
F193 replaced with W, or Y; Q194 replaced with N; T195 replaced
with A, G, I, L, S, M, or V; L196 replaced with A, G, I, S, T, M,
or V; K197 replaced with H, or R; I198 replaced with A, G, L, S, T,
M, or V; V199 replaced with A, G, I, L, S, T, or M; I200 replaced
with A, G, L, S, T, M, or V; L201 replaced with A, G, I, S, T, M,
or V; G202 replaced with A, I, L, S, T, M, or V; L203 replaced with
A, G, I, S, T, M, or V; V204 replaced with A, G, I, L, S, T, or M;
L205 replaced with A, G, I, S, T, M, or V; L207 replaced with A, G,
I, S, T, M, or V; L208 replaced with A, G, I, S, T, M, or V; V209
replaced with A, G, I, L, S, T, or M; M210 replaced with A, G, I,
L, S, T, or V; V211 replaced with A, G, I, L, S, T, or M; I212
replaced with A, G, L, S, T, M, or V; Y214 replaced with F, or W;
S215 replaced with A, G, I, L, T, M, or V; G216 replaced with A, I,
L, S, T, M, or V; I217 replaced with A, G, L, S, T, M, or V; L218
replaced with A, G, I, S, T, M, or V; K219 replaced with H, or R;
T220 replaced with A, G, I, L, S, M, or V; L221 replaced with A, G,
I, S, T, M, or V; L222 replaced with A, G, I, S, T, M, or V; R223
replaced with H, or K; R225 replaced with H, or K; N226 replaced
with Q; E227 replaced with D; K228 replaced with H, or R; K229
replaced with H, or R; R230 replaced with H, or K; H231 replaced
with K, or R; R232 replaced with H, or K; A233 replaced with G, I,
L, S, T, M, or V; V234 replaced with A, G, I, L, S, T, or M; R235
replaced with H, or K; L236 replaced with A, G, I, S, T, M, or V;
I237 replaced with A, G, L, S, T, M, or V; F238 replaced with W, or
Y; T239 replaced with A, G, I, L, S, M, or V; I240 replaced with A,
G, L, S, T, M, or V; M241 replaced with A, G, I, L, S, T, or V;
I242 replaced with A, G, L, S, T, M, or V; V243 replaced with A, G,
I, L, S, T, or M; Y244 replaced with F, or W; F245 replaced with W,
or Y; L246 replaced with A, G, I, S, T, M, or V; F247 replaced with
W, or Y; W248 replaced with F, or Y; A249 replaced with G, I, L, S,
T, M, or V; Y251 replaced with F, or W; N252 replaced with Q; I253
replaced with A, G, L, S, T, M, or V; V254 replaced with A, G, I,
L, S, T, or M; L255 replaced with A, G, I, S, T, M, or V; L256
replaced with A, G, I, S, T, M, or V; L257 replaced with A, G, I,
S, T, M, or V; N258 replaced with Q; T259 replaced with A, G, I, L,
S, M, or V; F260 replaced with W, or Y; Q261 replaced with N; E262
replaced with D; F263 replaced with W, or Y; F264 replaced with W,
or Y; G265 replaced with A, I, L, S, T, M, or V; L266 replaced with
A, G, I, S, T, M, or V; N267 replaced with Q; N268 replaced with Q;
S270 replaced with A, G, I, L, T, M, or V; S271 replaced with A, G,
I, L, T, M, or V; S272 replaced with A, G, I, L, T, M, or V; N273
replaced with Q; R274 replaced with H, or K; L275 replaced with A,
G, I, S, T, M, or V; D276 replaced with E; Q277 replaced with N;
A278 replaced with G, I, L, S, T, M, or V; M279 replaced with A, G,
I, L, S, T, or V; Q280 replaced with N; V281 replaced with A, G, I,
L, S, T, or M; T282 replaced with A, G, I, L, S, M, or V; E283
replaced with D; T284 replaced with A, G, I, L, S, M, or V; L285
replaced with A, G, I, S, T, M, or V; G286 replaced with A, I, L,
S, T, M, or V; M287 replaced with A, G, I, L, S, T, or V; T288
replaced with A, G, I, L, S, M, or V; H289 replaced with K, or R;
I292 replaced with A, G, L, S, T, M, or V; N293 replaced with Q;
I295 replaced with A, G, L, S, T, M, or V; I296 replaced with A, G,
L, S, T, M, or V; Y297 replaced with F, or W; A298 replaced with G,
I, L, S, T, M, or V; F299 replaced with W, or Y; V300 replaced with
A, G, I, L, S, T, or M; G301 replaced with A, I, L, S, T, M, or V;
E302 replaced with D; K303 replaced with H, or R; F304 replaced
with W, or Y; R305 replaced with H, or K; N306 replaced with Q;
Y307 replaced with F, or W; L308 replaced with A, G, I, S, T, M, or
V; L309 replaced with A, G, I, S, T, M, or V; V310 replaced with A,
G, I, L, S, T, or M; F311 replaced with W, or Y; F312 replaced with
W, or Y; Q313 replaced with N; K314 replaced with H, or R; H315
replaced with K, or R; I316 replaced with A, G, L, S, T, M, or V;
A317 replaced with G, I, L, S, T, M, or V; K318 replaced with H, or
R; R319 replaced with H, or K; F320 replaced with W, or Y; K322
replaced with H, or R; S325 replaced with A, G, I, L, T, M, or V;
I326 replaced with A, G, L, S, T, M, or V; F327 replaced with W, or
Y; Q328 replaced with N; Q329 replaced with N; E330 replaced with
D; A331 replaced with G, I, L, S, T, M, or V; E333 replaced with D;
R334 replaced with H, or K; A335 replaced with G, I, L, S, T, M, or
V; S336 replaced with A, G, I, L, T, M, or V; S337 replaced with A,
G, I, L, T, M, or V; V338 replaced with A, G, I, L, S, T, or M;
Y339 replaced with F, or W; T340 replaced with A, G, I, L, S, M, or
V; R341 replaced with H, or K; S342 replaced with A, G, I, L, T, M,
or V; T343 replaced with A, G, I, L, S, M, or V; G344 replaced with
A, I, L, S, T, M, or V; E345 replaced with D; Q346 replaced with N;
E347 replaced with D; I348 replaced with A, G, L, S, T, M, or V;
S349 replaced with A, G, I, L, T, M, or V; V350 replaced with A, G,
I, L, S, T, or M; G351 replaced with A, I, L, S, T, M, or V; and/or
L352 replaced with A, G, I, S, T, M, or V.
[0222] Preferred conservative mutations of G-protein Chemokine
Receptor (CCR5) as encoded by the deposited HDGNR10 clone (SEQ ID
NO:22) include: M1 replaced with A, G, I, L, S, T, or V; D2
replaced with E; Y3 replaced with F, or W; Q4 replaced with N; V5
replaced with A, G, I, L, S, T, or M; S6 replaced with A, G, I, L,
T, M, or V; S7 replaced with A, G, I, L, T, M, or V; I9 replaced
with A, G, L, S, T, M, or V; Y10 replaced with F, or W; D11
replaced with E; I12 replaced with A, G, L, S, T, M, or V; N13
replaced with Q; Y14 replaced with F, or W; Y15 replaced with F, or
W; T16 replaced with A, G, I, L, S, M, or V; S17 replaced with A,
G, I, L, T, M, or V; E18 replaced with D; Q21 replaced with N; K22
replaced with H, or R; I23 replaced with A, G, L, S, T, M, or V;
N24 replaced with Q; V25 replaced with A, G, I, L, S, T, or M; K26
replaced with H, or R; Q27 replaced with N; I28 replaced with A, G,
L, S, T, M, or V; A29 replaced with G, I, L, S, T, M, or V; A30
replaced with G, I, L, S, T, M, or V; R31 replaced with H, or K;
L32 replaced with A, G, I, S, T, M, or V; L33 replaced with A, G,
I, S, T, M, or V; L36 replaced with A, G, I, S, T, M, or V; Y37
replaced with F, or W; S38 replaced with A, G, I, L, T, M, or V;
L39 replaced with A, G, I, S, T, M, or V; V40 replaced with A, G,
I, L, S, T, or M; F41 replaced with W, or Y; I42 replaced with A,
G, L, S, T, M, or V; F43 replaced with W, or Y; G44 replaced with
A, I, L, S, T, M, or V; F45 replaced with W, or Y; V46 replaced
with A, G, I, L, S, T, or M; G47 replaced with A, I, L, S, T, M, or
V; N48 replaced with Q; M49 replaced with A, G, I, L, S, T, or V;
L50 replaced with A, G, I, S, T, M, or V; V51 replaced with A, G,
I, L, S, T, or M; I52 replaced with A, G, L, S, T, M, or V; L53
replaced with A, G, I, S, T, M, or V; I54 replaced with A, G, L, S,
T, M, or V; L55 replaced with A, G, I, S, T, M, or V; I56 replaced
with A, G, L, S, T, M, or V; N57 replaced with Q; K59 replaced with
H, or R; R60 replaced with H, or K; L61 replaced with A, G, I, S,
T, M, or V; K62 replaced with H, or R; S63 replaced with A, G, I,
L, T, M, or V; M64 replaced with A, G, I, L, S, T, or V; T65
replaced with A, G, I, L, S, M, or V; D66 replaced with E; I67
replaced with A, G, L, S, T, M, or V; Y68 replaced with F, or W;
L69 replaced with A, G, I, S, T, M, or V; L70 replaced with A, G,
I, S, T, M, or V; N71 replaced with Q; L72 replaced with A, G, I,
S, T, M, or V; A73 replaced with G, I, L, S, T, M, or V; I74
replaced with A, G, L, S, T, M, or V; S75 replaced with A, G, I, L,
T, M, or V; D76 replaced with E; L77 replaced with A, G, I, S, T,
M, or V; F78 replaced with W, or Y; F79 replaced with W, or Y; L80
replaced with A, G, I, S, T, M, or V; L81 replaced with A, G, I, S,
T, M, or V; T82 replaced with A, G, I, L, S, M, or V; V83 replaced
with A, G, I, L, S, T, or M; F85 replaced with W, or Y; W86
replaced with F, or Y; A87 replaced with G, I, L, S, T, M, or V;
H88 replaced with K, or R; Y89 replaced with F, or W; A90 replaced
with G, I, L, S, T, M, or V; A91 replaced with G, I, L, S, T, M, or
V; A92 replaced with G, I, L, S, T, M, or V; Q93 replaced with N;
W94 replaced with F, or Y; D95 replaced with E; F96 replaced with
W, or Y; G97 replaced with A, I, L, S, T, M, or V; N98 replaced
with Q; T99 replaced with A, G, I, L, S, M, or V; M100 replaced
with A, G, I, L, S, T, or V; Q102 replaced with N; L103 replaced
with A, G, I, S, T, M, or V; L104 replaced with A, G, I, S, T, M,
or V; T105 replaced with A, G, I, L, S, M, or V; G106 replaced with
A, I, L, S, T, M, or V; L107 replaced with A, G, I, S, T, M, or V;
Y108 replaced with F, or W; F109 replaced with W, or Y; I110
replaced with A, G, L, S, T, M, or V; G111 replaced with A, I, L,
S, T, M, or V; F112 replaced with W, or Y; F113 replaced with W, or
Y; S114 replaced with A, G, I, L, T, M, or V; G115 replaced with A,
I, L, S, T, M, or V; I116 replaced with A, G, L, S, T, M, or V;
F117 replaced with W, or Y; F118 replaced with W, or Y; I119
replaced with A, G, L, S, T, M, or V; I120 replaced with A, G, L,
S, T, M, or V; L121 replaced with A, G, I, S, T, M, or V; L122
replaced with A, G, I, S, T, M, or V; T123 replaced with A, G, I,
L, S, M, or V; I124 replaced with A, G, L, S, T, M, or V; D125
replaced with E; R126 replaced with H, or K; Y127 replaced with F,
or W; L128 replaced with A, G, I, S, T, M, or V; A129 replaced with
G, I, L, S, T, M, or V; V130 replaced with A, G, I, L, S, T, or M;
V131 replaced with A, G, I, L, S, T, or M; H132 replaced with K, or
R; A133 replaced with G, I, L, S, T, M, or V; V134 replaced with A,
G, I, L, S, T, or M; F135 replaced with W, or Y; A136 replaced with
G, I, L, S, T, M, or V; L137 replaced with A, G, I, S, T, M, or V;
K138 replaced with H, or R; A139 replaced with G, I, L, S, T, M, or
V; R140 replaced with H, or K; T141 replaced with A, G, I, L, S, M,
or V; V142 replaced with A, G, I, L, S, T, or M; T143 replaced with
A, G, I, L, S, M, or V; F144 replaced with W, or Y; G145 replaced
with A, I, L, S, T, M, or V; V146 replaced with A, G, I, L, S, T,
or M; V147 replaced with A, G, I, L, S, T, or M; T148 replaced with
A, G, I, L, S, M, or V; S149 replaced with A, G, I, L, T, M, or V;
V150 replaced with A, G, I, L, S, T, or M; I151 replaced with A, G,
L, S, T, M, or V; T152 replaced with A, G, I, L, S, M, or V; W153
replaced with F, or Y; V154 replaced with A, G, I, L, S, T, or M;
V155 replaced with A, G, I, L, S, T, or M; A156 replaced with G, I,
L, S, T, M, or V; V157 replaced with A, G, I, L, S, T, or M; F158
replaced with W, or Y; A159 replaced with G, I, L, S, T, M, or V;
S160 replaced with A, G, I, L, T, M, or V; L161 replaced with A, G,
I, S, T, M, or V; G163 replaced with A, I, L, S, T, M, or V; I164
replaced with A, G, L, S, T, M, or V; I165 replaced with A, G, L,
S, T, M, or V; F166 replaced with W, or Y; T167 replaced with A, G,
I, L, S, M, or V; R168 replaced with H, or K; S169 replaced with A,
G, I, L, T, M, or V; Q170 replaced with N; K171 replaced with H, or
R; E172 replaced with D; G173 replaced with A, I, L, S, T, M, or V;
L174 replaced with A, G, I, S, T, M, or V; H175 replaced with K, or
R; Y176 replaced with F, or W; T177 replaced with A, G, I, L, S, M,
or V; S179 replaced with A, G, I, L, T, M, or V; S180 replaced with
A, G, I, L, T, M, or V; H181 replaced with K, or R; F182 replaced
with W, or Y; Y184 replaced with F, or W; S185 replaced with A, G,
I, L, T, M, or V; Q186 replaced with N; Y187 replaced with F, or W;
Q188 replaced with N; F189 replaced with W, or Y; W190 replaced
with F, or Y; K191 replaced with H, or R; N192 replaced with Q;
F193 replaced with W, or Y; Q194 replaced with N; T195 replaced
with A, G, I, L, S, M, or V; L196 replaced with A, G, I, S, T, M,
or V; K197 replaced with H, or R; I198 replaced with A, G, L, S, T,
M, or V; V199 replaced with A, G, I, L, S, T, or M; I200 replaced
with A, G, L, S, T, M, or V; L201 replaced with A, G, I, S, T, M,
or V; G202 replaced with A, I, L, S, T, M, or V; L203 replaced with
A, G, I, S, T, M, or V; V204 replaced with A, G, I, L, S, T, or M;
L205 replaced with A, G, I, S, T, M, or V; L207 replaced with A, G,
I, S, T, M, or V; L208 replaced with A, G, I, S, T, M, or V; V209
replaced with A, G, I, L, S, T, or M; M210 replaced with A, G, I,
L, S, T, or V; V211 replaced with A, G, I, L, S, T, or M; I212
replaced with A, G, L, S, T, M, or V; Y214 replaced with F, or W;
S215 replaced with A, G, I, L, T, M, or V; G216 replaced with A, I,
L, S, T, M, or V; I217 replaced with A, G, L, S, T, M, or V; L218
replaced with A, G, I, S, T, M, or V; K219 replaced with H, or R;
T220 replaced with A, G, I, L, S, M, or V; L221 replaced with A, G,
I, S, T, M, or V; L222 replaced with A, G, I, S, T, M, or V; R223
replaced with H, or K; R225 replaced with H, or K; N226 replaced
with Q; E227 replaced with D; K228 replaced with H, or R; K229
replaced with H, or R; R230 replaced with H, or K; H231 replaced
with K, or R; R232 replaced with H, or K; A233 replaced with G, I,
L, S, T, M, or V; V234 replaced with A, G, I, L, S, T, or M; R235
replaced with H, or K; L236 replaced with A, G, I, S, T, M, or V;
I237 replaced with A, G, L, S, T, M, or V; F238 replaced with W, or
Y; T239 replaced with A, G, I, L, S, M, or V; I240 replaced with A,
G, L, S, T, M, or V; M241 replaced with A, G, I, L, S, T, or V;
I242 replaced with A, G, L, S, T, M, or V; V243 replaced with A, G,
I, L, S, T, or M; Y244 replaced with F, or W; F245 replaced with W,
or Y; L246 replaced with A, G, I, S, T, M, or V; F247 replaced with
W, or Y; W248 replaced with F, or Y; A249 replaced with G, I, L, S,
T, M, or V; Y251 replaced with F, or W; N252 replaced with Q; I253
replaced with A, G, L, S, T, M, or V; V254 replaced with A, G, I,
L, S, T, or M; L255 replaced with A, G, I, S, T, M, or V; L256
replaced with A, G, I, S, T, M, or V; L257 replaced with A, G, I,
S, T, M, or V; N258 replaced with Q; T259 replaced with A, G, I, L,
S, M, or V; F260 replaced with W, or Y; Q261 replaced with N; E262
replaced with D; F263 replaced with W, or Y; F264 replaced with W,
or Y; G265 replaced with A, I, L, S, T, M, or V; L266 replaced with
A, G, I, S, T, M, or V; N267 replaced with Q; N268 replaced with Q;
S270 replaced with A, G, I, L, T, M, or V; S271 replaced with A, G,
I, L, T, M, or V; S272 replaced with A, G, I, L, T, M, or V; N273
replaced with Q; R274 replaced with H, or K; L275 replaced with A,
G, I, S, T, M, or V; D276 replaced with E; Q277 replaced with N;
A278 replaced with G, I, L, S, T, M, or V; M279 replaced with A, G,
I, L, S, T, or V; Q280 replaced with N; V281 replaced with A, G, I,
L, S, T, or M; T282 replaced with A, G, I, L, S, M, or V; E283
replaced with D; T284 replaced with A, G, I, L, S, M, or V; L285
replaced with A, G, I, S, T, M, or V; G286 replaced with A, I, L,
S, T, M, or V; M287 replaced with A, G, I, L, S, T, or V; T288
replaced with A, G, I, L, S, M, or V; H289 replaced with K, or R;
I292 replaced with A, G, L, S, T, M, or V; N293 replaced with Q;
I295 replaced with A, G, L, S, T, M, or V; I296 replaced with A, G,
L, S, T, M, or V; Y297 replaced with F, or W; A298 replaced with G,
I, L, S, T, M, or V; F299 replaced with W, or Y; V300 replaced with
A, G, I, L, S, T, or M; G301 replaced with A, I, L, S, T, M, or V;
E302 replaced with D; K303 replaced with H, or R; F304 replaced
with W, or Y; R305 replaced with H, or K; N306 replaced with Q;
Y307 replaced with F, or W; L308 replaced with A, G, I, S, T, M, or
V; L309 replaced with A, G, I, S, T, M, or V; V310 replaced with A,
G, I, L, S, T, or M; F311 replaced with W, or Y; F312 replaced with
W, or Y; Q313 replaced with N; K314 replaced with H, or R; H315
replaced with K, or R; I316 replaced with A, G, L, S, T, M, or V;
A317 replaced with G, I, L, S, T, M, or V; K318 replaced with H, or
R; R319 replaced with H, or K; F320 replaced with W, or Y; K322
replaced with H, or R; S325 replaced with A, G, I, L, T, M, or V;
I326 replaced with A, G, L, S, T, M, or V; F327 replaced with W, or
Y; Q328 replaced with N; Q329 replaced with N; E330 replaced with
D; A331 replaced with G, I, L, S, T, M, or V; E333 replaced with D;
R334 replaced with H, or K; A335 replaced with G, I, L, S, T, M, or
V; S336 replaced with A, G, I, L, T, M, or V; S337 replaced with A,
G, I, L, T, M, or V; V338 replaced with A, G, I, L, S, T, or M;
Y339 replaced with F, or W; T340 replaced with A, G, I, L, S, M, or
V; R341 replaced with H, or K; S342 replaced with A, G, I, L, T, M,
or V; T343 replaced with A, G, I, L, S, M, or V; E344 replaced with
D; E345 replaced with D; Q346 replaced with N; E347 replaced with
D; I348 replaced with A, G, L, S, T, M, or V; S349 replaced with A,
G, I, L, T, M, or V; V350 replaced with A, G, I, L, S, T, or M;
G351 replaced with A, I, L, S, T, M, or V; and/or L352 replaced
with A, G, I, S, T, M, or V.
[0223] The resulting constructs can be routinely screened for
activities or functions described throughout the specification and
known in the art. Preferably, the resulting constructs have an
increased and/or a decreased G-protein Chemokine Receptor (CCR5)
activity or function, while the remaining G-protein Chemokine
Receptor (CCR5) activities or functions are maintained. More
preferably, the resulting constructs have more than one increased
and/or decreased G-protein Chemokine Receptor (CCR5) activity or
function, while the remaining G-protein Chemokine Receptor (CCR5)
activities or functions are maintained.
[0224] Besides conservative amino acid substitution, variants of
G-protein Chemokine Receptor (CCR5) include (i) substitutions with
one or more of the non-conserved amino acid residues, where the
substituted amino acid residues may or may not be one encoded by
the genetic code, or (ii) substitution with one or more of amino
acid residues having a substituent group, or (iii) fusion of the
mature polypeptide with another compound, such as a compound to
increase the stability and/or solubility of the polypeptide (for
example, polyethylene glycol), or (iv) fusion of the polypeptide
with additional amino acids, such as, for example, an IgG Fc fusion
region peptide, or leader or secretory sequence, or a sequence
facilitating purification. Such variant polypeptides are deemed to
be within the scope of those skilled in the art from the teachings
herein.
[0225] For example, G-protein Chemokine Receptor (CCR5) polypeptide
variants containing amino acid substitutions of charged amino acids
with other charged or neutral amino acids may produce proteins with
improved characteristics, such as less aggregation. Aggregation of
pharmaceutical formulations both reduces activity and increases
clearance due to the aggregate's immunogenic activity. (Pinckard et
al., Clin. Exp. Immunol. 2:331-340 (1967); Robbins et al., Diabetes
36: 838-845 (1987); Cleland et al., Crit. Rev. Therapeutic Drug
Carrier Systems 10:307-377 (1993).)
For example, preferred non-conservative substitutions of G-protein
Chemokine Receptor (CCR5) (SEQ ID NO:2) include: M1 replaced with
D, E, H, K, R, N, Q, F, W, Y, P, or C; D2 replaced with H, K, R, A,
G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; Y3 replaced with D, E,
H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; Q4 replaced with D,
E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; V5 replaced
with D, E, H, K, R, N, Q, F, W, Y, P, or C; S6 replaced with D, E,
H, K, R, N, Q, F, W, Y, P, or C; S7 replaced with D, E, H, K, R, N,
Q, F, W, Y, P, or C; P8 replaced with D, E, H, K, R, A, G, I, L, S,
T, M, V, N, Q, F, W, Y, or C; I9 replaced with D, E, H, K, R, N, Q,
F, W, Y, P, or C; Y10 replaced with D, E, H, K, R, N, Q, A, G, I,
L, S, T, M, V, P, or C; D11 replaced with H, K, R, A, G, I, L, S,
T, M, V, N, Q, F, W, Y, P, or C; I12 replaced with D, E, H, K, R,
N, Q, F, W, Y, P, or C; N13 replaced with D, E, H, K, R, A, G, I,
L, S, T, M, V, F, W, Y, P, or C; Y14 replaced with D, E, H, K, R,
N, Q, A, G, I, L, S, T, M, V, P, or C; Y15 replaced with D, E, H,
K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; T16 replaced with D,
E, H, K, R, N, Q, F, W, Y, P, or C; S17 replaced with D, E, H, K,
R, N, Q, F, W, Y, P, or C; E18 replaced with H, K, R, A, G, I, L,
S, T, M, V, N, Q, F, W, Y, P, or C; P19 replaced with D, E, H, K,
R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or C; C20 replaced with
D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or P; P21
replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y,
or C; K22 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W,
Y, P, or C; I23 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or
C; N24 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W,
Y, P, or C; V25 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or
C; K26 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y,
P, or C; Q27 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V,
F, W, Y, P, or C; I28 replaced with D, E, H, K, R, N, Q, F, W, Y,
P, or C; A29 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C;
A30 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; R31
replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C;
L32 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L33
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; P34 replaced
with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or C;
P35 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F,
W, Y, or C; L36 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or
C; Y37 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V,
P, or C; S38 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C;
L39 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; V40
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; F41 replaced
with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; I42
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; F43 replaced
with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; G44
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; F45 replaced
with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; V46
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; G47 replaced
with D, E, H, K, R, N, Q, F, W, Y, P, or C; N48 replaced with D, E,
H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; M49 replaced
with D, E, H, K, R, N, Q, F, W, Y, P, or C; L50 replaced with D, E,
H, K, R, N, Q, F, W, Y, P, or C; V51 replaced with D, E, H, K, R,
N, Q, F, W, Y, P, or C; I52 replaced with D, E, H, K, R, N, Q, F,
W, Y, P, or C; L53 replaced with D, E, H, K, R, N, Q, F, W, Y, P,
or C; I54 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L55
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; I56 replaced
with D, E, H, K, R, N, Q, F, W, Y, P, or C; N57 replaced with D, E,
H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; C58 replaced
with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or P;
Q59 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y,
P, or C; R60 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F,
W, Y, P, or C; L61 replaced with D, E, H, K, R, N, Q, F, W, Y, P,
or C; E62 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F,
W, Y, P, or C; S63 replaced with D, E, H, K, R, N, Q, F, W, Y, P,
or C; M64 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; T65
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; D66 replaced
with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; I67
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; Y68 replaced
with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; L69
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L70 replaced
with D, E, H, K, R, N, Q, F, W, Y, P, or C; N71 replaced with D, E,
H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; L72 replaced
with D, E, H, K, R, N, Q, F, W, Y, P, or C; A73 replaced with D, E,
H, K, R, N, Q, F, W, Y, P, or C; I74 replaced with D, E, H, K, R,
N, Q, F, W, Y, P, or C; S75 replaced with D, E, H, K, R, N, Q, F,
W, Y, P, or C; D76 replaced with H, K, R, A, G, I, L, S, T, M, V,
N, Q, F, W, Y, P, or C; L77 replaced with D, E, H, K, R, N, Q, F,
W, Y, P, or C; F78 replaced with D, E, H, K, R, N, Q, A, G, I, L,
S, T, M, V, P, or C; F79 replaced with D, E, H, K, R, N, Q, A, G,
I, L, S, T, M, V, P, or C; L80 replaced with D, E, H, K, R, N, Q,
F, W, Y, P, or C; L81 replaced with D, E, H, K, R, N, Q, F, W, Y,
P, or C; T82 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C;
V83 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; P84
replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y,
or C; F85 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M,
V, P, or C; W86 replaced with D, E, H, K, R, N, Q, A, G, I, L, S,
T, M, V, P, or C; A87 replaced with D, E, H, K, R, N, Q, F, W, Y,
P, or C; H88 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F,
W, Y, P, or C; Y89 replaced with D, E, H, K, R, N, Q, A, G, I, L,
S, T, M, V, P, or C; A90 replaced with D, E, H, K, R, N, Q, F, W,
Y, P, or C; A91 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or
C; A92 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; Q93
replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or
C; W94 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V,
P, or C; D95 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q,
F, W, Y, P, or C; F96 replaced with D, E, H, K, R, N, Q, A, G, I,
L, S, T, M, V, P, or C; G97 replaced with D, E, H, K, R, N, Q, F,
W, Y, P, or C; N98 replaced with D, E, H, K, R, A, G, I, L, S, T,
M, V, F, W, Y, P, or C; T99 replaced with D, E, H, K, R, N, Q, F,
W, Y, P, or C; M100 replaced with D, E, H, K, R, N, Q, F, W, Y, P,
or C; C101 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N,
Q, F, W, Y, or P; Q102 replaced with D, E, H, K, R, A, G, I, L, S,
T, M, V, F, W, Y, P, or C; L103 replaced with D, E, H, K, R, N, Q,
F, W, Y, P, or C; L104 replaced with D, E, H, K, R, N, Q, F, W, Y,
P, or C; T105 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C;
G106 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L107
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; Y108 replaced
with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; F109
replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C;
I110 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; G111
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; F112 replaced
with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; F113
replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C;
S114 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; G115
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; I116 replaced
with D, E, H, K, R, N, Q, F, W, Y, P, or C; F117 replaced with D,
E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; F118 replaced
with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; I119
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; I120 replaced
with D, E, H, K, R, N, Q, F, W, Y, P, or C; L121 replaced with D,
E, H, K, R, N, Q, F, W, Y, P, or C; L122 replaced with D, E, H, K,
R, N, Q, F, W, Y, P, or C; T123 replaced with D, E, H, K, R, N, Q,
F, W, Y, P, or C; I124 replaced with D, E, H, K, R, N, Q, F, W, Y,
P, or C; D125 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q,
F, W, Y, P, or C; R126 replaced with D, E, A, G, I, L, S, T, M, V,
N, Q, F, W, Y, P, or C; Y127 replaced with D, E, H, K, R, N, Q, A,
G, I, L, S, T, M, V, P, or C; L128 replaced with D, E, H, K, R, N,
Q, F, W, Y, P, or C; A129 replaced with D, E, H, K, R, N, Q, F, W,
Y, P, or C; I130 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or
C; V131 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; H132
replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C;
A133 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; V134
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; F135 replaced
with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; A136
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L137 replaced
with D, E, H, K, R, N, Q, F, W, Y, P, or C; K138 replaced with D,
E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; A139 replaced
with D, E, H, K, R, N, Q, F, W, Y, P, or C; R140 replaced with D,
E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; T141 replaced
with D, E, H, K, R, N, Q, F, W, Y, P, or C; V142 replaced with D,
E, H, K, R, N, Q, F, W, Y, P, or C; T143 replaced with D, E, H, K,
R, N, Q, F, W, Y, P, or C; F144 replaced with D, E, H, K, R, N, Q,
A, G, I, L, S, T, M, V, P, or C; G145 replaced with D, E, H, K, R,
N, Q, F, W, Y, P, or C; V146 replaced with D, E, H, K, R, N, Q, F,
W, Y, P, or C; V147 replaced with D, E, H, K, R, N, Q, F, W, Y, P,
or C; T148 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C;
S149 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; V150
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; I151 replaced
with D, E, H, K, R, N, Q, F, W, Y, P, or C; T152 replaced with D,
E, H, K, R, N, Q, F, W, Y, P, or C; W153 replaced with D, E, H, K,
R, N, Q, A, G, I, L, S, T, M, V, P, or C; V154 replaced with D, E,
H, K, R, N, Q, F, W, Y, P, or C; V155 replaced with D, E, H, K, R,
N, Q, F, W, Y, P, or C; A156 replaced with D, E, H, K, R, N, Q, F,
W, Y, P, or C; V157 replaced with D, E, H, K, R, N, Q, F, W, Y, P,
or C; F158 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M,
V, P, or C; A159 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or
C; S160 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L161
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; P162 replaced
with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or C;
G163 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; I164
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; I165 replaced
with D, E, H, K, R, N, Q, F, W, Y, P, or C; F166 replaced with D,
E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; T167 replaced
with D, E, H, K, R, N, Q, F, W, Y, P, or C; R168 replaced with D,
E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; S169 replaced
with D, E, H, K, R, N, Q, F, W, Y, P, or C; Q170 replaced with D,
E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; K171 replaced
with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; E172
replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or
C; G173 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L174
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; H175 replaced
with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; Y176
replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C;
T177 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; C178
replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y,
or P; S179 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C;
S180 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; H181
replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C;
F182 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P,
or C; P183 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N,
Q, F, W, Y, or C; Y184 replaced with D, E, H, K, R, N, Q, A, G, I,
L, S, T, M, V, P, or C; S185 replaced with D, E, H, K, R, N, Q, F,
W, Y, P, or C; Q186 replaced with D, E, H, K, R, A, G, I, L, S, T,
M, V, F, W, Y, P, or C; Y187 replaced with D, E, H, K, R, N, Q, A,
G, I, L, S, T, M, V, P, or C; Q188 replaced with D, E, H, K, R, A,
G, I, L, S, T, M, V, F, W, Y, P, or C; F189 replaced with D, E, H,
K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; W190 replaced with D,
E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; K191 replaced
with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; N192
replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or
C; F193 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V,
P, or C; Q194 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V,
F, W, Y, P, or C; T195 replaced with D, E, H, K, R, N, Q, F, W, Y,
P, or C; L196 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C;
K197 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P,
or C; I198 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C;
V199 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; I200
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L201 replaced
with D, E, H, K, R, N, Q, F, W, Y, P, or C; G202 replaced with D,
E, H, K, R, N, Q, F, W, Y, P, or C; L203 replaced with D, E, H, K,
R, N, Q, F, W, Y, P, or C; V204 replaced with D, E, H, K, R, N, Q,
F, W, Y, P, or C; L205 replaced with D, E, H, K, R, N, Q, F, W, Y,
P, or C; P206 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V,
N, Q, F, W, Y, or C; L207 replaced with D, E, H, K, R, N, Q, F, W,
Y, P, or C; L208 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or
C; V209 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; M210
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; V211 replaced
with D, E, H, K, R, N, Q, F, W, Y, P, or C; I212 replaced with D,
E, H, K, R, N, Q, F, W, Y, P, or C; C213 replaced with D, E, H, K,
R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or P; Y214 replaced with
D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; S215 replaced
with D, E, H, K, R, N, Q, F, W, Y, P, or C; G216 replaced with D,
E, H, K, R, N, Q, F, W, Y, P, or C; I217 replaced with D, E, H, K,
R, N, Q, F, W, Y, P, or C; L218 replaced with D, E, H, K, R, N, Q,
F, W, Y, P, or C; K219 replaced with D, E, A, G, I, L, S, T, M, V,
N, Q, F, W, Y, P, or C; T220 replaced with D, E, H, K, R, N, Q, F,
W, Y, P, or C; L221 replaced with D, E, H, K, R, N, Q, F, W, Y, P,
or C; L222 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C;
R223 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P,
or C; C224 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N,
Q, F, W, Y, or P; R225 replaced with D, E, A, G, I, L, S, T, M, V,
N, Q, F, W, Y, P, or C; N226 replaced with D, E, H, K, R, A, G, I,
L, S, T, M, V, F, W, Y, P, or C; E227 replaced with H, K, R, A, G,
I, L, S, T, M, V, N, Q, F, W, Y, P, or C; K228 replaced with D, E,
A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; K229 replaced with
D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; R230 replaced
with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; H231
replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C;
R232 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P,
or C; A233 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C;
V234 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; R235
replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C;
L236 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; I237
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; F238 replaced
with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; T239
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; I240 replaced
with D, E, H, K, R, N, Q, F, W, Y, P, or C; M241 replaced with D,
E, H, K, R, N, Q, F, W, Y, P, or C; I242 replaced with D, E, H, K,
R, N, Q, F, W, Y, P, or C; V243 replaced with D, E, H, K, R, N, Q,
F, W, Y, P, or C; Y244 replaced with D, E, H, K, R, N, Q, A, G, I,
L, S, T, M, V, P, or C; F245 replaced with D, E, H, K, R, N, Q, A,
G, I, L, S, T, M, V, P, or C; L246 replaced with D, E, H, K, R, N,
Q, F, W, Y, P, or C; F247 replaced with D, E, H, K, R, N, Q, A, G,
I, L, S, T, M, V, P, or C; W248 replaced with D, E, H, K, R, N, Q,
A, G, I, L, S, T, M, V, P, or C; A249 replaced with D, E, H, K, R,
N, Q, F, W, Y, P, or C; P250 replaced with D, E, H, K, R, A, G, I,
L, S, T, M, V, N, Q, F, W, Y, or C; Y251 replaced with D, E, H, K,
R, N, Q, A, G, I, L, S, T, M, V, P, or C; N252 replaced with D, E,
H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; I253 replaced
with D, E, H, K, R, N, Q, F, W, Y, P, or C; V254 replaced with D,
E, H, K, R, N, Q, F, W, Y, P, or C; L255 replaced with D, E, H, K,
R, N, Q, F, W, Y, P, or C; L256 replaced with D, E, H, K, R, N, Q,
F, W, Y, P, or C; L257 replaced with D, E, H, K, R, N, Q, F, W, Y,
P, or C; N258 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V,
F, W, Y, P, or C; T259 replaced with D, E, H, K, R, N, Q, F, W, Y,
P, or C; F260 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T,
M, V, P, or C; Q261 replaced with D, E, H, K, R, A, G, I, L, S, T,
M, V, F, W, Y, P, or C; E262 replaced with H, K, R, A, G, I, L, S,
T, M, V, N, Q, F, W, Y, P, or C; F263 replaced with D, E, H, K, R,
N, Q, A, G, I, L, S, T, M, V, P, or C; F264 replaced with D, E, H,
K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; G265 replaced with D,
E, H, K, R, N, Q, F, W, Y, P, or C; L266 replaced with D, E, H, K,
R, N, Q, F, W, Y, P, or C; N267 replaced with D, E, H, K, R, A, G,
I, L, S, T, M, V, F, W, Y, P, or C; N268 replaced with D, E, H, K,
R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; C269 replaced with D,
E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or P; S270
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; S271 replaced
with D, E, H, K, R, N, Q, F, W, Y, P, or C; S272 replaced with D,
E, H, K, R, N, Q, F, W, Y, P, or C; N273 replaced with D, E, H, K,
R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; R274 replaced with D,
E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; L275 replaced
with D, E, H, K, R, N, Q, F, W, Y, P, or C; D276 replaced with H,
K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; Q277 replaced
with D, E, H, K, R, A, G, I, L, S, T,
M, V, F, W, Y, P, or C; A278 replaced with D, E, H, K, R, N, Q, F,
W, Y, P, or C; M279 replaced with D, E, H, K, R, N, Q, F, W, Y, P,
or C; Q280 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F,
W, Y, P, or C; V281 replaced with D, E, H, K, R, N, Q, F, W, Y, P,
or C; T282 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C;
E283 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y,
P, or C; T284 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C;
L285 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; G286
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; M287 replaced
with D, E, H, K, R, N, Q, F, W, Y, P, or C; T288 replaced with D,
E, H, K, R, N, Q, F, W, Y, P, or C; H289 replaced with D, E, A, G,
I, L, S, T, M, V, N, Q, F, W, Y, P, or C; C290 replaced with D, E,
H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or P; C291 replaced
with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or P;
I292 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; N293
replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or
C; P294 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q,
F, W, Y, or C; I295 replaced with D, E, H, K, R, N, Q, F, W, Y, P,
or C; I296 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C;
Y297 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P,
or C; A298 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C;
F299 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P,
or C; V300 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C;
G301 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; E302
replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or
C; K303 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y,
P, or C; F304 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T,
M, V, P, or C; R305 replaced with D, E, A, G, I, L, S, T, M, V, N,
Q, F, W, Y, P, or C; N306 replaced with D, E, H, K, R, A, G, I, L,
S, T, M, V, F, W, Y, P, or C; Y307 replaced with D, E, H, K, R, N,
Q, A, G, I, L, S, T, M, V, P, or C; L308 replaced with D, E, H, K,
R, N, Q, F, W, Y, P, or C; L309 replaced with D, E, H, K, R, N, Q,
F, W, Y, P, or C; V310 replaced with D, E, H, K, R, N, Q, F, W, Y,
P, or C; F311 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T,
M, V, P, or C; F312 replaced with D, E, H, K, R, N, Q, A, G, I, L,
S, T, M, V, P, or C; Q313 replaced with D, E, H, K, R, A, G, I, L,
S, T, M, V, F, W, Y, P, or C; K314 replaced with D, E, A, G, I, L,
S, T, M, V, N, Q, F, W, Y, P, or C; H315 replaced with D, E, A, G,
I, L, S, T, M, V, N, Q, F, W, Y, P, or C; I316 replaced with D, E,
H, K, R, N, Q, F, W, Y, P, or C; A317 replaced with D, E, H, K, R,
N, Q, F, W, Y, P, or C; K318 replaced with D, E, A, G, I, L, S, T,
M, V, N, Q, F, W, Y, P, or C; R319 replaced with D, E, A, G, I, L,
S, T, M, V, N, Q, F, W, Y, P, or C; F320 replaced with D, E, H, K,
R, N, Q, A, G, I, L, S, T, M, V, P, or C; C321 replaced with D, E,
H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or P; K322 replaced
with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; C323
replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y,
or P; C324 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N,
Q, F, W, Y, or P; S325 replaced with D, E, H, K, R, N, Q, F, W, Y,
P, or C; I326 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C;
F327 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P,
or C; Q328 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F,
W, Y, P, or C; Q329 replaced with D, E, H, K, R, A, G, I, L, S, T,
M, V, F, W, Y, P, or C; E330 replaced with H, K, R, A, G, I, L, S,
T, M, V, N, Q, F, W, Y, P, or C; A331 replaced with D, E, H, K, R,
N, Q, F, W, Y, P, or C; P332 replaced with D, E, H, K, R, A, G, I,
L, S, T, M, V, N, Q, F, W, Y, or C; E333 replaced with H, K, R, A,
G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; R334 replaced with D,
E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; A335 replaced
with D, E, H, K, R, N, Q, F, W, Y, P, or C; S336 replaced with D,
E, H, K, R, N, Q, F, W, Y, P, or C; S337 replaced with D, E, H, K,
R, N, Q, F, W, Y, P, or C; V338 replaced with D, E, H, K, R, N, Q,
F, W, Y, P, or C; Y339 replaced with D, E, H, K, R, N, Q, A, G, I,
L, S, T, M, V, P, or C; T340 replaced with D, E, H, K, R, N, Q, F,
W, Y, P, or C; R341 replaced with D, E, A, G, I, L, S, T, M, V, N,
Q, F, W, Y, P, or C; S342 replaced with D, E, H, K, R, N, Q, F, W,
Y, P, or C; T343 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or
C; G344 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; E345
replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or
C; Q346 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W,
Y, P, or C; E347 replaced with H, K, R, A, G, I, L, S, T, M, V, N,
Q, F, W, Y, P, or C; I348 replaced with D, E, H, K, R, N, Q, F, W,
Y, P, or C; S349 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or
C; V350 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; G351
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; and/or L352
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C.
Addition preferred non-conservative substitutions of G-protein
Chemokine Receptor (CCR5) as encoded by the HDGNR10 deposited clone
(SEQ ID NO:22) include: M1 replaced with D, E, H, K, R, N, Q, F, W,
Y, P, or C; D2 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q,
F, W, Y, P, or C; Y3 replaced with D, E, H, K, R, N, Q, A, G, I, L,
S, T, M, V, P, or C; Q4 replaced with D, E, H, K, R, A, G, I, L, S,
T, M, V, F, W, Y, P, or C; V5 replaced with D, E, H, K, R, N, Q, F,
W, Y, P, or C; S6 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or
C; S7 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; P8
replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y,
or C; I9 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; Y10
replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C;
D11 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y,
P, or C; I12 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C;
N13 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y,
P, or C; Y14 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T,
M, V, P, or C; Y15 replaced with D, E, H, K, R, N, Q, A, G, I, L,
S, T, M, V, P, or C; T16 replaced with D, E, H, K, R, N, Q, F, W,
Y, P, or C; S17 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or
C; E18 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W,
Y, P, or C; P19 replaced with D, E, H, K, R, A, G, I, L, S, T, M,
V, N, Q, F, W, Y, or C; C20 replaced with D, E, H, K, R, A, G, I,
L, S, T, M, V, N, Q, F, W, Y, or P; Q21 replaced with D, E, H, K,
R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; K22 replaced with D,
E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; I23 replaced
with D, E, H, K, R, N, Q, F, W, Y, P, or C; N24 replaced with D, E,
H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; V25 replaced
with D, E, H, K, R, N, Q, F, W, Y, P, or C; K26 replaced with D, E,
A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; Q27 replaced with
D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; I28
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; A29 replaced
with D, E, H, K, R, N, Q, F, W, Y, P, or C; A30 replaced with D, E,
H, K, R, N, Q, F, W, Y, P, or C; R31 replaced with D, E, A, G, I,
L, S, T, M, V, N, Q, F, W, Y, P, or C; L32 replaced with D, E, H,
K, R, N, Q, F, W, Y, P, or C; L33 replaced with D, E, H, K, R, N,
Q, F, W, Y, P, or C; P34 replaced with D, E, H, K, R, A, G, I, L,
S, T, M, V, N, Q, F, W, Y, or C; P35 replaced with D, E, H, K, R,
A, G, I, L, S, T, M, V, N, Q, F, W, Y, or C; L36 replaced with D,
E, H, K, R, N, Q, F, W, Y, P, or C; Y37 replaced with D, E, H, K,
R, N, Q, A, G, I, L, S, T, M, V, P, or C; S38 replaced with D, E,
H, K, R, N, Q, F, W, Y, P, or C; L39 replaced with D, E, H, K, R,
N, Q, F, W, Y, P, or C; V40 replaced with D, E, H, K, R, N, Q, F,
W, Y, P, or C; F41 replaced with D, E, H, K, R, N, Q, A, G, I, L,
S, T, M, V, P, or C; I42 replaced with D, E, H, K, R, N, Q, F, W,
Y, P, or C; F43 replaced with D, E, H, K, R, N, Q, A, G, I, L, S,
T, M, V, P, or C; G44 replaced with D, E, H, K, R, N, Q, F, W, Y,
P, or C; F45 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T,
M, V, P, or C; V46 replaced with D, E, H, K, R, N, Q, F, W, Y, P,
or C; G47 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; N48
replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or
C; M49 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L50
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; V51 replaced
with D, E, H, K, R, N, Q, F, W, Y, P, or C; I52 replaced with D, E,
H, K, R, N, Q, F, W, Y, P, or C; L53 replaced with D, E, H, K, R,
N, Q, F, W, Y, P, or C; I54 replaced with D, E, H, K, R, N, Q, F,
W, Y, P, or C; L55 replaced with D, E, H, K, R, N, Q, F, W, Y, P,
or C; I56 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; N57
replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or
C; C58 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q,
F, W, Y, or P; K59 replaced with D, E, A, G, I, L, S, T, M, V, N,
Q, F, W, Y, P, or C; R60 replaced with D, E, A, G, I, L, S, T, M,
V, N, Q, F, W, Y, P, or C; L61 replaced with D, E, H, K, R, N, Q,
F, W, Y, P, or C; K62 replaced with D, E, A, G, I, L, S, T, M, V,
N, Q, F, W, Y, P, or C; S63 replaced with D, E, H, K, R, N, Q, F,
W, Y, P, or C; M64 replaced with D, E, H, K, R, N, Q, F, W, Y, P,
or C; T65 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; D66
replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or
C; I67 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; Y68
replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C;
L69 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L70
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; N71 replaced
with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; L72
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; A73 replaced
with D, E, H, K, R, N, Q, F, W, Y, P, or C; I74 replaced with D, E,
H, K, R, N, Q, F, W, Y, P, or C; S75 replaced with D, E, H, K, R,
N, Q, F, W, Y, P, or C; D76 replaced with H, K, R, A, G, I, L, S,
T, M, V, N, Q, F, W, Y, P, or C; L77 replaced with D, E, H, K, R,
N, Q, F, W, Y, P, or C; F78 replaced with D, E, H, K, R, N, Q, A,
G, I, L, S, T, M, V, P, or C; F79 replaced with D, E, H, K, R, N,
Q, A, G, I, L, S, T, M, V, P, or C; L80 replaced with D, E, H, K,
R, N, Q, F, W, Y, P, or C; L81 replaced with D, E, H, K, R, N, Q,
F, W, Y, P, or C; T82 replaced with D, E, H, K, R, N, Q, F, W, Y,
P, or C; V83 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C;
P84 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F,
W, Y, or C; F85 replaced with D, E, H, K, R, N, Q, A, G, I, L, S,
T, M, V, P, or C; W86 replaced with D, E, H, K, R, N, Q, A, G, I,
L, S, T, M, V, P, or C; A87 replaced with D, E, H, K, R, N, Q, F,
W, Y, P, or C; H88 replaced with D, E, A, G, I, L, S, T, M, V, N,
Q, F, W, Y, P, or C; Y89 replaced with D, E, H, K, R, N, Q, A, G,
I, L, S, T, M, V, P, or C; A90 replaced with D, E, H, K, R, N, Q,
F, W, Y, P, or C; A91 replaced with D, E, H, K, R, N, Q, F, W, Y,
P, or C; A92 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C;
Q93 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y,
P, or C; W94 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T,
M, V, P, or C; D95 replaced with H, K, R, A, G, I, L, S, T, M, V,
N, Q, F, W, Y, P, or C; F96 replaced with D, E, H, K, R, N, Q, A,
G, I, L, S, T, M, V, P, or C; G97 replaced with D, E, H, K, R, N,
Q, F, W, Y, P, or C; N98 replaced with D, E, H, K, R, A, G, I, L,
S, T, M, V, F, W, Y, P, or C; T99 replaced with D, E, H, K, R, N,
Q, F, W, Y, P, or C; M100 replaced with D, E, H, K, R, N, Q, F, W,
Y, P, or C; C101 replaced with D, E, H, K, R, A, G, I, L, S, T, M,
V, N, Q, F, W, Y, or P; Q102 replaced with D, E, H, K, R, A, G, I,
L, S, T, M, V, F, W, Y, P, or C; L103 replaced with D, E, H, K, R,
N, Q, F, W, Y, P, or C; L104 replaced with D, E, H, K, R, N, Q, F,
W, Y, P, or C; T105 replaced with D, E, H, K, R, N, Q, F, W, Y, P,
or C; G106 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C;
L107 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; Y108
replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C;
F109 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P,
or C; I110 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C;
G111 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; F112
replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C;
F113 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P,
or C; S114 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C;
G115 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; I116
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; F117 replaced
with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; F118
replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C;
I119 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; I120
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L121 replaced
with D, E, H, K, R, N, Q, F, W, Y, P, or C; L122 replaced with D,
E, H, K, R, N, Q, F, W, Y, P, or C; T123 replaced with D, E, H, K,
R, N, Q, F, W, Y, P, or C; I124 replaced with D, E, H, K, R, N, Q,
F, W, Y, P, or C; D125 replaced with H, K, R, A, G, I, L, S, T, M,
V, N, Q, F, W, Y, P, or C; R126 replaced with D, E, A, G, I, L, S,
T, M, V, N, Q, F, W, Y, P, or C; Y127 replaced with D, E, H, K, R,
N, Q, A, G, I, L, S, T, M, V, P, or C; L128 replaced with D, E, H,
K, R, N, Q, F, W, Y, P, or C; A129 replaced with D, E, H, K, R, N,
Q, F, W, Y, P, or C; V130 replaced with D, E, H, K, R, N, Q, F, W,
Y, P, or C; V131 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or
C; H132 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y,
P, or C; A133 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C;
V134 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; F135
replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C;
A136 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L137
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; K138 replaced
with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; A139
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; R140 replaced
with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; T141
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; V142 replaced
with D, E, H, K, R, N, Q, F, W, Y, P, or C; T143 replaced with D,
E, H, K, R, N, Q, F, W, Y, P, or C; F144 replaced with D, E, H, K,
R, N, Q, A, G, I, L, S, T, M, V, P, or C; G145 replaced with D, E,
H, K, R, N, Q, F, W, Y, P, or C; V146 replaced with D, E, H, K, R,
N, Q, F, W, Y, P, or C; V147 replaced with D, E, H, K, R, N, Q, F,
W, Y, P, or C; T148 replaced with D, E, H, K, R, N, Q, F, W, Y, P,
or C; S149 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C;
V150 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; I151
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; T152 replaced
with D, E, H, K, R, N, Q, F, W, Y, P, or C; W153 replaced with D,
E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; V154 replaced
with D, E, H, K, R, N, Q, F, W, Y, P, or C; V155 replaced with D,
E, H, K, R, N, Q, F, W, Y, P, or C; A156 replaced with D, E, H, K,
R, N, Q, F, W, Y, P, or C; V157 replaced with D, E, H, K, R, N, Q,
F, W, Y, P, or C; F158 replaced with D, E, H, K, R, N, Q, A, G, I,
L, S, T, M, V, P, or C; A159 replaced with D, E, H, K, R, N, Q, F,
W, Y, P, or C; S160 replaced with D, E, H, K, R, N, Q, F, W, Y, P,
or C; L161 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C;
P162 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F,
W, Y, or C; G163 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or
C; I164 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; I165
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; F166 replaced
with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; T167
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; R168 replaced
with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; S169
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; Q170 replaced
with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; K171
replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C;
E172 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y,
P, or C; G173 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C;
L174 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; H175
replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C;
Y176 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P,
or C; T177 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C;
C178 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F,
W, Y, or P; S179 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or
C; S180 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; H181
replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C;
F182 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P,
or C; P183 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N,
Q, F, W, Y, or C; Y184 replaced with D, E, H, K, R, N, Q, A, G, I,
L, S, T, M, V, P, or C; S185 replaced with D, E, H, K, R, N, Q, F,
W, Y, P, or C; Q186 replaced with D, E, H, K, R, A, G, I, L, S, T,
M, V, F, W, Y, P, or C; Y187 replaced with D, E, H, K, R, N, Q, A,
G, I, L, S, T, M, V, P, or C; Q188 replaced with D, E, H, K, R, A,
G, I, L, S, T, M, V, F, W, Y, P, or C; F189 replaced with D, E, H,
K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; W190 replaced with D,
E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; K191 replaced
with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; N192
replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or
C; F193 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V,
P, or C; Q194 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V,
F, W, Y, P, or C; T195 replaced with D, E, H, K, R, N, Q, F, W, Y,
P, or C; L196 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C;
K197 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P,
or C; I198 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C;
V199 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; I200
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L201 replaced
with D, E, H, K, R, N, Q, F, W, Y, P, or C; G202 replaced with D,
E, H, K, R, N, Q, F, W, Y, P, or C; L203 replaced with D, E, H, K,
R, N, Q, F, W, Y, P, or C; V204 replaced with D, E, H, K, R, N, Q,
F, W, Y, P, or C; L205 replaced with D, E, H, K, R, N, Q, F, W, Y,
P, or C; P206 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V,
N, Q, F, W, Y, or C; L207 replaced with D, E, H, K, R, N, Q, F, W,
Y, P, or C; L208 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or
C; V209 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; M210
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; V211 replaced
with D, E, H, K, R, N, Q, F, W, Y, P, or C; I212 replaced with D,
E, H, K, R, N, Q, F, W, Y, P, or C; C213 replaced with D, E, H, K,
R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or P; Y214 replaced with
D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; S215 replaced
with D, E, H, K, R, N, Q, F, W, Y, P, or C; G216 replaced with D,
E, H, K, R, N, Q, F, W, Y, P, or C; I217 replaced with D, E, H, K,
R, N, Q, F, W, Y, P, or C; L218 replaced with D, E, H, K, R, N, Q,
F, W, Y, P, or C; K219 replaced with D, E, A, G, I, L, S, T, M, V,
N, Q, F, W, Y, P, or C; T220 replaced with D, E, H, K, R, N, Q, F,
W, Y, P, or C; L221 replaced with D, E, H, K, R, N, Q, F, W, Y, P,
or C; L222 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C;
R223 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P,
or C; C224 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N,
Q, F, W, Y, or P; R225 replaced with D, E, A, G, I, L, S, T, M, V,
N, Q, F, W, Y, P, or C; N226 replaced with D, E, H, K, R, A, G, I,
L, S, T, M, V, F, W, Y, P, or C; E227 replaced with H, K, R, A, G,
I, L, S, T, M, V, N, Q, F, W, Y, P, or C; K228 replaced with D, E,
A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; K229 replaced with
D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; R230 replaced
with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; H231
replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C;
R232 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P,
or C; A233 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C;
V234 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; R235
replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C;
L236 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; I237
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; F238 replaced
with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; T239
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; I240 replaced
with D, E, H, K, R, N, Q, F, W, Y, P, or C; M241 replaced with D,
E, H, K, R, N, Q, F, W, Y, P, or C; I242 replaced with D, E, H, K,
R, N, Q, F, W, Y, P, or C; V243 replaced with D, E, H, K, R, N, Q,
F, W, Y, P, or C; Y244 replaced with D, E, H, K, R, N, Q, A, G, I,
L, S, T, M, V, P, or C; F245 replaced with D, E, H, K, R, N, Q, A,
G, I, L, S, T, M, V, P, or C; L246 replaced with D, E, H, K, R, N,
Q, F, W, Y, P, or C; F247 replaced with D, E, H, K, R, N, Q, A, G,
I, L, S, T, M, V, P, or C; W248 replaced with D, E, H, K, R, N, Q,
A, G, I, L, S, T, M, V, P, or C; A249 replaced with D, E, H, K, R,
N, Q, F, W, Y, P, or C; P250 replaced with D, E, H, K, R, A, G, I,
L, S, T, M, V, N, Q, F, W, Y, or C; Y251 replaced with D, E, H, K,
R, N, Q, A, G, I, L, S, T, M, V, P, or C; N252 replaced with D, E,
H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; I253 replaced
with D, E, H, K, R, N, Q, F, W, Y, P, or C; V254 replaced with D,
E, H, K, R, N, Q, F, W, Y, P, or C; L255 replaced with D, E, H, K,
R, N, Q, F, W, Y, P, or C; L256 replaced with D, E, H, K, R, N, Q,
F, W, Y, P, or C; L257 replaced with D, E, H, K, R, N, Q, F, W, Y,
P, or C; N258 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V,
F, W, Y, P, or C; T259 replaced with D, E, H, K, R, N, Q, F, W, Y,
P, or C; F260 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T,
M, V, P, or C; Q261 replaced with D, E, H, K, R, A, G, I, L, S, T,
M, V, F, W, Y, P, or C; E262 replaced with H, K, R, A, G, I, L, S,
T, M, V, N, Q, F, W, Y, P, or C; F263 replaced with D, E, H, K, R,
N, Q, A, G, I, L, S, T, M, V, P, or C; F264 replaced with D, E, H,
K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; G265 replaced with D,
E, H, K, R, N, Q, F, W, Y, P, or C; L266 replaced with D, E, H, K,
R, N, Q, F, W, Y, P, or C; N267 replaced with D, E, H, K, R, A, G,
I, L, S, T, M, V, F, W, Y, P, or C; N268 replaced with D, E, H, K,
R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; C269 replaced with D,
E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or P; S270
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; S271 replaced
with D, E, H, K, R, N, Q, F, W, Y, P, or C; S272 replaced with D,
E, H, K, R, N, Q, F, W, Y, P, or C; N273 replaced with D, E, H, K,
R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; R274 replaced with D,
E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; L275 replaced
with D, E, H, K, R, N, Q, F, W, Y, P, or C; D276 replaced with H,
K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; Q277 replaced
with D, E, H, K, R, A, G, I, L, S, T,
M, V, F, W, Y, P, or C; A278 replaced with D, E, H, K, R, N, Q, F,
W, Y, P, or C; M279 replaced with D, E, H, K, R, N, Q, F, W, Y, P,
or C; Q280 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F,
W, Y, P, or C; V281 replaced with D, E, H, K, R, N, Q, F, W, Y, P,
or C; T282 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C;
E283 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y,
P, or C; T284 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C;
L285 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; G286
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; M287 replaced
with D, E, H, K, R, N, Q, F, W, Y, P, or C; T288 replaced with D,
E, H, K, R, N, Q, F, W, Y, P, or C; H289 replaced with D, E, A, G,
I, L, S, T, M, V, N, Q, F, W, Y, P, or C; C290 replaced with D, E,
H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or P; C291 replaced
with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or P;
I292 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; N293
replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or
C; P294 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q,
F, W, Y, or C; I295 replaced with D, E, H, K, R, N, Q, F, W, Y, P,
or C; I296 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C;
Y297 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P,
or C; A298 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C;
F299 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P,
or C; V300 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C;
G301 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; E302
replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or
C; K303 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y,
P, or C; F304 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T,
M, V, P, or C; R305 replaced with D, E, A, G, I, L, S, T, M, V, N,
Q, F, W, Y, P, or C; N306 replaced with D, E, H, K, R, A, G, I, L,
S, T, M, V, F, W, Y, P, or C; Y307 replaced with D, E, H, K, R, N,
Q, A, G, I, L, S, T, M, V, P, or C; L308 replaced with D, E, H, K,
R, N, Q, F, W, Y, P, or C; L309 replaced with D, E, H, K, R, N, Q,
F, W, Y, P, or C; V310 replaced with D, E, H, K, R, N, Q, F, W, Y,
P, or C; F311 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T,
M, V, P, or C; F312 replaced with D, E, H, K, R, N, Q, A, G, I, L,
S, T, M, V, P, or C; Q313 replaced with D, E, H, K, R, A, G, I, L,
S, T, M, V, F, W, Y, P, or C; K314 replaced with D, E, A, G, I, L,
S, T, M, V, N, Q, F, W, Y, P, or C; H315 replaced with D, E, A, G,
I, L, S, T, M, V, N, Q, F, W, Y, P, or C; I316 replaced with D, E,
H, K, R, N, Q, F, W, Y, P, or C; A317 replaced with D, E, H, K, R,
N, Q, F, W, Y, P, or C; K318 replaced with D, E, A, G, I, L, S, T,
M, V, N, Q, F, W, Y, P, or C; R319 replaced with D, E, A, G, I, L,
S, T, M, V, N, Q, F, W, Y, P, or C; F320 replaced with D, E, H, K,
R, N, Q, A, G, I, L, S, T, M, V, P, or C; C321 replaced with D, E,
H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or P; K322 replaced
with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; C323
replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y,
or P; C324 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N,
Q, F, W, Y, or P; S325 replaced with D, E, H, K, R, N, Q, F, W, Y,
P, or C; I326 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C;
F327 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P,
or C; Q328 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F,
W, Y, P, or C; Q329 replaced with D, E, H, K, R, A, G, I, L, S, T,
M, V, F, W, Y, P, or C; E330 replaced with H, K, R, A, G, I, L, S,
T, M, V, N, Q, F, W, Y, P, or C; A331 replaced with D, E, H, K, R,
N, Q, F, W, Y, P, or C; P332 replaced with D, E, H, K, R, A, G, I,
L, S, T, M, V, N, Q, F, W, Y, or C; E333 replaced with H, K, R, A,
G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; R334 replaced with D,
E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; A335 replaced
with D, E, H, K, R, N, Q, F, W, Y, P, or C; S336 replaced with D,
E, H, K, R, N, Q, F, W, Y, P, or C; S337 replaced with D, E, H, K,
R, N, Q, F, W, Y, P, or C; V338 replaced with D, E, H, K, R, N, Q,
F, W, Y, P, or C; Y339 replaced with D, E, H, K, R, N, Q, A, G, I,
L, S, T, M, V, P, or C; T340 replaced with D, E, H, K, R, N, Q, F,
W, Y, P, or C; R341 replaced with D, E, A, G, I, L, S, T, M, V, N,
Q, F, W, Y, P, or C; S342 replaced with D, E, H, K, R, N, Q, F, W,
Y, P, or C; T343 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or
C; E344 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W,
Y, P, or C; E345 replaced with H, K, R, A, G, I, L, S, T, M, V, N,
Q, F, W, Y, P, or C; Q346 replaced with D, E, H, K, R, A, G, I, L,
S, T, M, V, F, W, Y, P, or C; E347 replaced with H, K, R, A, G, I,
L, S, T, M, V, N, Q, F, W, Y, P, or C; I348 replaced with D, E, H,
K, R, N, Q, F, W, Y, P, or C; S349 replaced with D, E, H, K, R, N,
Q, F, W, Y, P, or C; V350 replaced with D, E, H, K, R, N, Q, F, W,
Y, P, or C; G351 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or
C; and/or L352 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or
C.
[0228] The resulting constructs can be routinely screened for
activities or functions described throughout the specification and
known in the art. Preferably, the resulting constructs have an
increased and/or decreased G-protein Chemokine Receptor (CCR5)
activity or function, while the remaining G-protein Chemokine
Receptor (CCR5) activities or functions are maintained. More
preferably, the resulting constructs have more than one increased
and/or decreased G-protein Chemokine Receptor (CCR5) activity or
function, while the remaining G-protein Chemokine Receptor (CCR5)
activities or functions are maintained.
[0229] Additionally, more than one amino acid (e.g., 2, 3, 4, 5, 6,
7, 8, 9 and 10) can be replaced with the substituted amino acids as
described above (either conservative or nonconservative). The
substituted amino acids can occur in the full length, mature, or
proprotein form of G-protein Chemokine Receptor (CCR5) protein, as
well as the N- and C-terminal deletion mutants, having the general
formula m-n, listed below.
[0230] A further embodiment of the invention relates to a
polypeptide which comprises the amino acid sequence of a G-protein
Chemokine Receptor (CCR5) polypeptide having an amino acid sequence
which contains at least one amino acid substitution, but not more
than 50 amino acid substitutions, even more preferably, not more
than 40 amino acid substitutions, still more preferably, not more
than 30 amino acid substitutions, and still even more preferably,
not more than 20 amino acid substitutions. Of course, in order of
ever-increasing preference, it is highly preferable for a
polypeptide to have an amino acid sequence which comprises the
amino acid sequence of a G-protein Chemokine Receptor (CCR5)
polypeptide, which contains at least one, but not more than 10, 9,
8, 7, 6, 5, 4, 3, 2 or 1 amino acid substitutions. In specific
embodiments, the number of additions, substitutions, and/or
deletions in the amino acid sequence of FIG. 1 or that encoded by
the deposited clone or fragments thereof (e.g., the mature form
and/or other fragments described herein), is 1-5, 5-10, 5-25, 5-50,
10-50 or 50-150, conservative amino acid substitutions are
preferable.
Polynucleotide and Polypeptide Fragments
[0231] The present invention is also directed to polynucleotide
fragments of the polynucleotides of the invention. In the present
invention, a "polynucleotide fragment" refers to a short
polynucleotide having a nucleic acid sequence which: is a portion
of that contained in a deposited clone, or encoding the polypeptide
encoded by deposited clone; is a portion of that shown in SEQ ID
NO:1 or the complementary strand thereto, or is a portion of a
polynucleotide sequence encoding the polypeptide of SEQ ID NO:2.
The nucleotide fragments of the invention are preferably at least
about 15 nt, and more preferably at least about 20 nt, still more
preferably at least about 30 nt, and even more preferably, at least
about 40 nt, at least about 50 nt, at least about 75 nt, or at
least about 150 nt in length. A fragment "at least 20 nt in
length," for example, is intended to include 20 or more contiguous
bases from the HDGNR10 DNA sequence contained in a deposited clone
or the nucleotide sequence shown in SEQ ID NO:1. In this context
"about" includes the particularly recited value, a value larger or
smaller by several (5, 4, 3, 2, or 1) nucleotides, at either
terminus or at both termini. These nucleotide fragments have uses
that include, but are not limited to, as diagnostic probes and
primers as discussed herein. Of course, larger fragments (e.g., 50,
150, 500, 600, 1000 nucleotides) are preferred.
[0232] Moreover, representative examples of polynucleotide
fragments of the invention, include, for example, fragments
comprising, or alternatively consisting of, a sequence from about
nucleotide number 1-50, 51-100, 101-150, 151-200, 201-250, 251-300,
301-350, 351-400, 401-450, 451-500, 501-550, 551-600, 651-700,
701-750, 751-800, 800-850, 851-900, 901-950, 951-1000, 1001-1050,
1051-1100, 1101-1150, 1151-1200, 1201-1250, 1251-1300, 1301-1350,
1351-1400, or 1401 to the end of SEQ ID NO:1, or the complementary
strand thereto, or the HDGNR10 DNA contained in the deposited
clone. In this context "about" includes the particularly recited
ranges, and ranges larger or smaller by several (5, 4, 3, 2, or 1)
nucleotides, at either terminus or at both termini. Preferably,
these fragments encode a polypeptide which has biological activity.
More preferably, these polynucleotides can be used as probes or
primers as discussed herein. Polynucleotides which hybridize to
these nucleic acid molecules under stringent hybridization
conditions or lower stringency conditions are also encompassed by
the invention, as are polypeptides encoded by these
polynucleotides. In the present invention, a "polypeptide fragment"
refers to an amino acid sequence which is a portion of that
contained in SEQ ID NO:2 or encoded by the HDGNR10 DNA contained in
the deposited clone. Protein (polypeptide) fragments may be
"free-standing," or comprised within a larger polypeptide of which
the fragment forms a part or region, most preferably as a single
continuous region. Representative examples of polypeptide fragments
of the invention, include, for example, fragments comprising, or
alternatively consisting of, from about amino acid number 1-20,
21-40, 41-60, 61-80, 81-100, 102-120, 121-140, 141-160, or 161 to
the end of the coding region. Moreover, polypeptide fragments can
be about 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140,
or 150 amino acids in length. In this context "about" includes the
particularly recited ranges or values, and ranges or values larger
or smaller by several (5, 4, 3, 2, or 1) amino acids, at either
extreme or at both extremes. Polynucleotides encoding these
polypeptides are also encompassed by the invention.
[0233] Even if deletion of one or more amino acids from the
N-terminus of a protein results in modification of loss of one or
more biological functions of the protein, other functional
activities (e.g., biological activities, ability to multimerize,
ability to bind G-protein Chemokine Receptor (CCR5) ligand) may
still be retained. For example, the ability of shortened G-protein
Chemokine Receptor (CCR5) muteins to induce and/or bind to
antibodies which recognize the complete or mature forms of the
polypeptides generally will be retained when less than the majority
of the residues of the complete or mature polypeptide are removed
from the N-terminus. Whether a particular polypeptide lacking
N-terminal residues of a complete polypeptide retains such
immunologic activities can readily be determined by routine methods
described herein and otherwise known in the art. It is not unlikely
that an G-protein Chemokine Receptor (CCR5) mutein with a large
number of deleted N-terminal amino acid residues may retain some
biological or immunogenic activities. In fact, peptides composed of
as few as six G-protein Chemokine Receptor (CCR5) amino acid
residues may often evoke an immune response.
[0234] Preferred polypeptide fragments include the secreted protein
as well as the mature form. Further preferred polypeptide fragments
include the secreted protein or the mature form having a continuous
series of deleted residues from the amino or the carboxy terminus,
or both. For example, any number of amino acids,
[0235] Accordingly, polypeptide fragments include the secreted
G-protein Chemokine Receptor (CCR5) protein as well as the mature
form. Further preferred polypeptide fragments include the secreted
G-protein Chemokine Receptor (CCR5) protein or the mature form
having a continuous series of deleted residues from the amino or
the carboxy terminus, or both. For example, any number of amino
acids, ranging from 1-60, can be deleted from the amino terminus of
either the secreted G-protein Chemokine Receptor (CCR5) polypeptide
or the mature form. Similarly, any number of amino acids, ranging
from 1-30, can be deleted from the carboxy terminus of the secreted
G-protein Chemokine Receptor (CCR5) protein or mature form.
Furthermore, any combination of the above amino and carboxy
terminus deletions are preferred. Similarly, polynucleotides
encoding these polypeptide fragments are also preferred.
[0236] Particularly, N-terminal deletions of the G-protein
Chemokine Receptor (CCR5) polypeptide can be described by the
general formula m-352, where m is an integer from 2 to 346, where m
corresponds to the position of the amino acid residue identified in
SEQ ID NO:2 or the polypeptide encoded by the deposited clone. More
in particular, the invention provides polynucleotides encoding
polypeptides comprising, or alternatively consisting of, the amino
acid sequence of residues of N-terminal deletions of the
polypeptide of the invention shown as SEQ ID NO:2 including
polypeptides comprising the amino acid sequence of residues: D-2 to
L-352; Y-3 to L-352; Q-4 to L-352; V-5 to L-352; S-6 to L-352; S-7
to L-352; P-8 to L-352; I-9 to L-352; Y-10 to L-352; D-11 to L-352;
I-12 to L-352; N-13 to L-352; Y-14 to L-352; Y-15 to L-352; T-16 to
L-352; S-17 to L-352; E-18 to L-352; P-19 to L-352; C-20 to L-352;
P-21 to L-352; K-22 to L-352; I-23 to L-352; N-24 to L-352; V-25 to
L-352; K-26 to L-352; Q-27 to L-352; I-28 to L-352; A-29 to L-352;
A-30 to L-352; R-31 to L-352; L-32 to L-352; L-33 to L-352; P-34 to
L-352; P-35 to L-352; L-36 to L-352; Y-37 to L-352; S-38 to L-352;
L-39 to L-352; V-40 to L-352; F-41 to L-352; I-42 to L-352; F-43 to
L-352; G-44 to L-352; F-45 to L-352; V-46 to L-352; G-47 to L-352;
N-48 to L-352; M-49 to L-352; L-50 to L-352; V-51 to L-352; I-52 to
L-352; L-53 to L-352; I-54 to L-352; L-55 to L-352; I-56 to L-352;
N-57 to L-352; C-58 to L-352; Q-59 to L-352; R-60 to L-352; L-61 to
L-352; E-62 to L-352; S-63 to L-352; M-64 to L-352; T-65 to L-352;
D-66 to L-352; I-67 to L-352; Y-68 to L-352; L-69 to L-352; L-70 to
L-352; N-71 to L-352; L-72 to L-352; A-73 to L-352; I-74 to L-352;
S-75 to L-352; D-76 to L-352; L-77 to L-352; F-78 to L-352; F-79 to
L-352; L-80 to L-352; L-81 to L-352; T-82 to L-352; V-83 to L-352;
P-84 to L-352; F-85 to L-352; W-86 to L-352; A-87 to L-352; H-88 to
L-352; Y-89 to L-352; A-90 to L-352; A-91 to L-352; A-92 to L-352;
Q-93 to L-352; W-94 to L-352; D-95 to L-352; F-96 to L-352; G-97 to
L-352; N-98 to L-352; T-99 to L-352; M-100 to L-352; C-101 to
L-352; Q-102 to L-352; L-103 to L-352; L-104 to L-352; T-105 to
L-352; G-106 to L-352; L-107 to L-352; Y-108 to L-352; F-109 to
L-352; I-110 to L-352; G-111 to L-352; F-112 to L-352; F-113 to
L-352; S-114 to L-352; G-115 to L-352; I-116 to L-352; F-117 to
L-352; F-118 to L-352; I-119 to L-352; I-120 to L-352; L-121 to
L-352; L-122 to L-352; T-123 to L-352; I-124 to L-352; D-125 to
L-352; R-126 to L-352; Y-127 to L-352; L-128 to L-352; A-129 to
L-352; I-130 to L-352; V-131 to L-352; H-132 to L-352; A-133 to
L-352; V-134 to L-352; F-135 to L-352; A-136 to L-352; L-137 to
L-352; K-138 to L-352; A-139 to L-352; R-140 to L-352; T-141 to
L-352; V-142 to L-352; T-143 to L-352; F-144 to L-352; G-145 to
L-352; V-146 to L-352; V-147 to L-352; T-148 to L-352; S-149 to
L-352; V-150 to L-352; I-151 to L-352; T-152 to L-352; W-153 to
L-352; V-154 to L-352; V-155 to L-352; A-156 to L-352; V-157 to
L-352; F-158 to L-352; A-159 to L-352; S-160 to L-352; L-161 to
L-352; P-162 to L-352; G-163 to L-352; I-164 to L-352; I-165 to
L-352; F-166 to L-352; T-167 to L-352; R-168 to L-352; S-169 to
L-352; Q-170 to L-352; K-171 to L-352; E-172 to L-352; G-173 to
L-352; L-174 to L-352; H-175 to L-352; Y-176 to L-352; T-177 to
L-352; C-178 to L-352; S-179 to L-352; S-180 to L-352; H-181 to
L-352; F-182 to L-352; P-183 to L-352; Y-184 to L-352; S-185 to
L-352; Q-186 to L-352; Y-187 to L-352; Q-188 to L-352; F-189 to
L-352; W-190 to L-352; K-191 to L-352; N-192 to L-352; F-193 to
L-352; Q-194 to L-352; T-195 to L-352; L-196 to L-352; K-197 to
L-352; I-198 to L-352; V-199 to L-352; I-200 to L-352; L-201 to
L-352; G-202 to L-352; L-203 to L-352; V-204 to L-352; L-205 to
L-352; P-206 to L-352; L-207 to L-352; L-208 to L-352; V-209 to
L-352; M-210 to L-352; V-211 to L-352; I-212 to L-352; C-213 to
L-352; Y-214 to L-352; S-215 to L-352; G-216 to L-352; I-217 to
L-352; L-218 to L-352; K-219 to L-352; T-220 to L-352; L-221 to
L-352; L-222 to L-352; R-223 to L-352; C-224 to L-352; R-225 to
L-352; N-226 to L-352; E-227 to L-352; K-228 to L-352; K-229 to
L-352; R-230 to L-352; H-231 to L-352; R-232 to L-352; A-233 to
L-352; V-234 to L-352; R-235 to L-352; L-236 to L-352; I-237 to
L-352; F-238 to L-352; T-239 to L-352; I-240 to L-352; M-241 to
L-352; I-242 to L-352; V-243 to L-352; Y-244 to L-352; F-245 to
L-352; L-246 to L-352; F-247 to L-352; W-248 to L-352; A-249 to
L-352; P-250 to L-352; Y-251 to L-352; N-252 to L-352; I-253 to
L-352; V-254 to L-352; L-255 to L-352; L-256 to L-352; L-257 to
L-352; N-258 to L-352; T-259 to L-352; F-260 to L-352; Q-261 to
L-352; E-262 to L-352; F-263 to L-352; F-264 to L-352; G-265 to
L-352; L-266 to L-352; N-267 to L-352; N-268 to L-352; C-269 to
L-352; S-270 to L-352; S-271 to L-352; S-272 to L-352; N-273 to
L-352; R-274 to L-352; L-275 to L-352; D-276 to L-352; Q-277 to
L-352; A-278 to L-352; M-279 to L-352; Q-280 to L-352; V-281 to
L-352; T-282 to L-352; E-283 to L-352; T-284 to L-352; L-285 to
L-352; G-286 to L-352; M-287 to L-352; T-288 to L-352; H-289 to
L-352; C-290 to L-352; C-291 to L-352; I-292 to L-352; N-293 to
L-352; P-294 to L-352; I-295 to L-352; I-296 to L-352; Y-297 to
L-352; A-298 to L-352; F-299 to L-352; V-300 to L-352; G-301 to
L-352; E-302 to L-352; K-303 to L-352; F-304 to L-352; R-305 to
L-352; N-306 to L-352; Y-307 to L-352; L-308 to L-352; L-309 to
L-352; V-310 to L-352; F-311 to L-352; F-312 to L-352; Q-313 to
L-352; K-314 to L-352; H-315 to L-352; I-316 to L-352; A-317 to
L-352; K-318 to L-352; R-319 to L-352; F-320 to L-352; C-321 to
L-352; K-322 to L-352; C-323 to L-352; C-324 to L-352; S-325 to
L-352; I-326 to L-352; F-327 to L-352; Q-328 to L-352; Q-329 to
L-352; E-330 to L-352; A-331 to L-352; P-332 to L-352; E-333 to
L-352; R-334 to L-352; A-335 to L-352; S-336 to L-352; S-337 to
L-352; V-338 to L-352; Y-339 to L-352; T-340 to L-352; R-341 to
L-352; S-342 to L-352; T-343 to L-352; G-344 to L-352; E-345 to
L-352; Q-346 to L-352; and/or E-347 to L-352 of SEQ ID NO:2.
Polynucleotides encoding these polypeptides are also encompassed by
the invention.
[0237] In addition, the invention provides polynucleotides encoding
polypeptides comprising, or alternatively consisting of, the amino
acid sequence of residues of N-terminal deletions of the
polypeptide of the invention encoded by the deposited HDGNR10 clone
(SEQ ID NO:22) including polypeptides comprising the amino acid
sequence of residues: D-2 to L-352; Y-3 to L-352; Q-4 to L-352; V-5
to L-352; S-6 to L-352; S-7 to L-352; P-8 to L-352; I-9 to L-352;
Y-10 to L-352; D-11 to L-352; I-12 to L-352; N-13 to L-352; Y-14 to
L-352; Y-15 to L-352; T-16 to L-352; S-17 to L-352; E-18 to L-352;
P-19 to L-352; C-20 to L-352; Q-21 to L-352; K-22 to L-352; I-23 to
L-352; N-24 to L-352; V-25 to L-352; K-26 to L-352; Q-27 to L-352;
I-28 to L-352; A-29 to L-352; A-30 to L-352; R-31 to L-352; L-32 to
L-352; L-33 to L-352; P-34 to L-352; P-35 to L-352; L-36 to L-352;
Y-37 to L-352; S-38 to L-352; L-39 to L-352; V-40 to L-352; F-41 to
L-352; I-42 to L-352; F-43 to L-352; G-44 to L-352; F-45 to L-352;
V-46 to L-352; G-47 to L-352; N-48 to L-352; M-49 to L-352; L-50 to
L-352; V-51 to L-352; I-52 to L-352; L-53 to L-352; I-54 to L-352;
L-55 to L-352; I-56 to L-352; N-57 to L-352; C-58 to L-352; K-59 to
L-352; R-60 to L-352; L-61 to L-352; K-62 to L-352; S-63 to L-352;
M-64 to L-352; T-65 to L-352; D-66 to L-352; I-67 to L-352; Y-68 to
L-352; L-69 to L-352; L-70 to L-352; N-71 to L-352; L-72 to L-352;
A-73 to L-352; I-74 to L-352; S-75 to L-352; D-76 to L-352; L-77 to
L-352; F-78 to L-352; F-79 to L-352; L-80 to L-352; L-81 to L-352;
T-82 to L-352; V-83 to L-352; P-84 to L-352; F-85 to L-352; W-86 to
L-352; A-87 to L-352; H-88 to L-352; Y-89 to L-352; A-90 to L-352;
A-91 to L-352; A-92 to L-352; Q-93 to L-352; W-94 to L-352; D-95 to
L-352; F-96 to L-352; G-97 to L-352; N-98 to L-352; T-99 to L-352;
M-100 to L-352; C-101 to L-352; Q-102 to L-352; L-103 to L-352;
L-104 to L-352; T-105 to L-352; G-106 to L-352; L-107 to L-352;
Y-108 to L-352; F-109 to L-352; I-110 to L-352; G-111 to L-352;
F-112 to L-352; F-113 to L-352; S-114 to L-352; G-115 to L-352;
I-116 to L-352; F-117 to L-352; F-118 to L-352; I-119 to L-352;
I-120 to L-352; L-121 to L-352; L-122 to L-352; T-123 to L-352;
I-124 to L-352; D-125 to L-352; R-126 to L-352; Y-127 to L-352;
L-128 to L-352; A-129 to L-352; V-130 to L-352; V-131 to L-352;
H-132 to L-352; A-133 to L-352; V-134 to L-352; F-135 to L-352;
A-136 to L-352; L-137 to L-352; K-138 to L-352; A-139 to L-352;
R-140 to L-352; T-141 to L-352; V-142 to L-352; T-143 to L-352;
F-144 to L-352; G-145 to L-352; V-146 to L-352; V-147 to L-352;
T-148 to L-352; S-149 to L-352; V-150 to L-352; I-151 to L-352;
T-152 to L-352; W-153 to L-352; V-154 to L-352; V-155 to L-352;
A-156 to L-352; V-157 to L-352; F-158 to L-352; A-159 to L-352;
S-160 to L-352; L-161 to L-352; P-162 to L-352; G-163 to L-352;
I-164 to L-352; I-165 to L-352; F-166 to L-352; T-167 to L-352;
R-168 to L-352; S-169 to L-352; Q-170 to L-352; K-171 to L-352;
E-172 to L-352; G-173 to L-352; L-174 to L-352; H-175 to L-352;
Y-176 to L-352; T-177 to L-352; C-178 to L-352; S-179 to L-352;
S-180 to L-352; H-181 to L-352; F-182 to L-352; P-183 to L-352;
Y-184 to L-352; S-185 to L-352; Q-186 to L-352; Y-187 to L-352;
Q-188 to L-352; F-189 to L-352; W-190 to L-352; K-191 to L-352;
N-192 to L-352; F-193 to L-352; Q-194 to L-352; T-195 to L-352;
L-196 to L-352; K-197 to L-352; I-198 to L-352; V-199 to L-352;
I-200 to L-352; L-201 to L-352; G-202 to L-352; L-203 to L-352;
V-204 to L-352; L-205 to L-352; P-206 to L-352; L-207 to L-352;
L-208 to L-352; V-209 to L-352; M-210 to L-352; V-211 to L-352;
I-212 to L-352; C-213 to L-352; Y-214 to L-352; S-215 to L-352;
G-216 to L-352; I-217 to L-352; L-218 to L-352; K-219 to L-352;
T-220 to L-352; L-221 to L-352; L-222 to L-352; R-223 to L-352;
C-224 to L-352; R-225 to L-352; N-226 to L-352; E-227 to L-352;
K-228 to L-352; K-229 to L-352; R-230 to L-352; H-231 to L-352;
R-232 to L-352; A-233 to L-352; V-234 to L-352; R-235 to L-352;
L-236 to L-352; I-237 to L-352; F-238 to L-352; T-239 to L-352;
I-240 to L-352; M-241 to L-352; I-242 to L-352; V-243 to L-352;
Y-244 to L-352; F-245 to L-352; L-246 to L-352; F-247 to L-352;
W-248 to L-352; A-249 to L-352; P-250 to L-352; Y-251 to L-352;
N-252 to L-352; I-253 to L-352; V-254 to L-352; L-255 to L-352;
L-256 to L-352; L-257 to L-352; N-258 to L-352; T-259 to L-352;
F-260 to L-352; Q-261 to L-352; E-262 to L-352; F-263 to L-352;
F-264 to L-352; G-265 to L-352; L-266 to L-352; N-267 to L-352;
N-268 to L-352; C-269 to L-352; S-270 to L-352; S-271 to L-352;
S-272 to L-352; N-273 to L-352; R-274 to L-352; L-275 to L-352;
D-276 to L-352; Q-277 to L-352; A-278 to L-352; M-279 to L-352;
Q-280 to L-352; V-281 to L-352; T-282 to L-352; E-283 to L-352;
T-284 to L-352; L-285 to L-352; G-286 to L-352; M-287 to L-352;
T-288 to L-352; H-289 to L-352; C-290 to L-352; C-291 to L-352;
I-292 to L-352; N-293 to L-352; P-294 to L-352; I-295 to L-352;
I-296 to L-352; Y-297 to L-352; A-298 to L-352; F-299 to L-352;
V-300 to L-352; G-301 to L-352; E-302 to L-352; K-303 to L-352;
F-304 to L-352; R-305 to L-352; N-306 to L-352; Y-307 to L-352;
L-308 to L-352; L-309 to L-352; V-310 to L-352; F-311 to L-352;
F-312 to L-352; Q-313 to L-352; K-314 to L-352; H-315 to L-352;
I-316 to L-352; A-317 to L-352; K-318 to L-352; R-319 to L-352;
F-320 to L-352; C-321 to L-352; K-322 to L-352; C-323 to L-352;
C-324 to L-352; S-325 to L-352; I-326 to L-352; F-327 to L-352;
Q-328 to L-352; Q-329 to L-352; E-330 to L-352; A-331 to L-352;
P-332 to L-352; E-333 to L-352; R-334 to L-352; A-335 to L-352;
S-336 to L-352; S-337 to L-352; V-338 to L-352; Y-339 to L-352;
T-340 to L-352; R-341 to L-352; S-342 to L-352; T-343 to L-352;
E-344 to L-352; E-345 to L-352; Q-346 to L-352; and/or E-347 to
L-352 of SEQ ID NO:22. Polynucleotides encoding these polypeptides
are also encompassed by the invention.
[0238] The present application is also directed to nucleic acid
molecules comprising, or alternatively, consisting of, a
polynucleotide sequence at least 90%, 92%, 95%, 96%, 97%, 98%, or
99% identical to the polynucleotide sequence encoding the G-protein
Chemokine Receptor (CCR5) polypeptide described above. The present
invention also encompasses the above polynucleotide sequences fused
to a heterologous polynucleotide sequence.
[0239] Also as mentioned above, even if deletion of one or more
amino acids from the C-terminus of a protein results in
modification of loss of one or more biological functions of the
protein, other functional activities (e.g., biological activities,
ability to multimerize, ability to bind G-protein Chemokine
Receptor (CCR5) ligand) may still be retained. For example the
ability of the shortened G-protein Chemokine Receptor (CCR5) mutein
to induce and/or bind to antibodies which recognize the complete or
mature forms of the polypeptide generally will be retained when
less than the majority of the residues of the complete or mature
polypeptide are removed from the C-terminus. Whether a particular
polypeptide lacking C-terminal residues of a complete polypeptide
retains such immunologic activities can readily be determined by
routine methods described herein and otherwise known in the art. It
is not unlikely that an G-protein Chemokine Receptor (CCR5) mutein
with a large number of deleted C-terminal amino acid residues may
retain some biological or immunogenic activities. In fact, peptides
composed of as few as six G-protein Chemokine Receptor (CCR5) amino
acid residues may often evoke an immune response.
[0240] Accordingly, the present invention further provides
polypeptides having one or more residues deleted from the carboxy
terminus of the amino acid sequence of the G-protein Chemokine
Receptor (CCR5) polypeptide shown in FIG. 1 (SEQ ID NO:2) or of the
polypeptide encoded by the deposited clone, as described by the
general formula 1-n, where n is an integer from 6 to 346, where n
corresponds to the position of amino acid residue identified in SEQ
ID NO:2 or in the polypeptide encoded by the deposited clone. More
in particular, the invention provides polynucleotides encoding
polypeptides comprising, or alternatively consisting of, the amino
acid sequence of residues of D-2 to G-351; D-2 to V-350; D-2 to
S-349; D-2 to I-348; D-2 to E-347; D-2 to Q-346; D-2 to E-345; D-2
to G-344; D-2 to T-343; D-2 to S-342; D-2 to R-341; D-2 to T-340;
D-2 to Y-339; D-2 to V-338; D-2 to S-337; D-2 to S-336; D-2 to
A-335; D-2 to R-334; D-2 to E-333; D-2 to P-332; D-2 to A-331; D-2
to E-330; D-2 to Q-329; D-2 to Q-328; D-2 to F-327; D-2 to I-326;
D-2 to S-325; D-2 to C-324; D-2 to C-323; D-2 to K-322; D-2 to
C-321; D-2 to F-320; D-2 to R-319; D-2 to K-318; D-2 to A-317; D-2
to I-316; D-2 to H-315; D-2 to K-314; D-2 to Q-313; D-2 to F-312;
D-2 to F-311; D-2 to V-310; D-2 to L-309; D-2 to L-308; D-2 to
Y-307; D-2 to N-306; D-2 to R-305; D-2 to F-304; D-2 to K-303; D-2
to E-302; D-2 to G-301; D-2 to V-300; D-2 to F-299; D-2 to A-298;
D-2 to Y-297; D-2 to I-296; D-2 to I-295; D-2 to P-294; D-2 to
N-293; D-2 to I-292; D-2 to C-291; D-2 to C-290; D-2 to H-289; D-2
to T-288; D-2 to M-287; D-2 to G-286; D-2 to L-285; D-2 to T-284;
D-2 to E-283; D-2 to T-282; D-2 to V-281; D-2 to Q-280; D-2 to
M-279; D-2 to A-278; D-2 to Q-277; D-2 to D-276; D-2 to L-275; D-2
to R-274; D-2 to N-273; D-2 to S-272; D-2 to S-271; D-2 to S-270;
D-2 to C-269; D-2 to N-268; D-2 to N-267; D-2 to L-266; D-2 to
G-265; D-2 to F-264; D-2 to F-263; D-2 to E-262; D-2 to Q-261; D-2
to F-260; D-2 to T-259; D-2 to N-258; D-2 to L-257; D-2 to L-256;
D-2 to L-255; D-2 to V-254; D-2 to I-253; D-2 to N-252; D-2 to
Y-251; D-2 to P-250; D-2 to A-249; D-2 to W-248; D-2 to F-247; D-2
to L-246; D-2 to F-245; D-2 to Y-244; D-2 to V-243; D-2 to I-242;
D-2 to M-241; D-2 to I-240; D-2 to T-239; D-2 to F-238; D-2 to
I-237; D-2 to L-236; D-2 to R-235; D-2 to V-234; D-2 to A-233; D-2
to R-232; D-2 to H-231; D-2 to R-230; D-2 to K-229; D-2 to K-228;
D-2 to E-227; D-2 to N-226; D-2 to R-225; D-2 to C-224; D-2 to
R-223; D-2 to L-222; D-2 to L-221; D-2 to T-220; D-2 to K-219; D-2
to L-218; D-2 to I-217; D-2 to G-216; D-2 to S-215; D-2 to Y-214;
D-2 to C-213; D-2 to I-212; D-2 to V-211; D-2 to M-210; D-2 to
V-209; D-2 to L-208; D-2 to L-207; D-2 to P-206; D-2 to L-205; D-2
to V-204; D-2 to L-203; D-2 to G-202; D-2 to L-201; D-2 to I-200;
D-2 to V-199; D-2 to I-198; D-2 to K-197; D-2 to L-196; D-2 to
T-195; D-2 to Q-194; D-2 to F-193; D-2 to N-192; D-2 to K-191; D-2
to W-190; D-2 to F-189; D-2 to Q-188; D-2 to Y-187; D-2 to Q-186;
D-2 to S-185; D-2 to Y-184; D-2 to P-183; D-2 to F-182; D-2 to
H-181; D-2 to S-180; D-2 to S-179; D-2 to C-178; D-2 to T-177; D-2
to Y-176; D-2 to H-175; D-2 to L-174; D-2 to G-173; D-2 to E-172;
D-2 to K-171; D-2 to Q-170; D-2 to S-169; D-2 to R-168; D-2 to
T-167; D-2 to F-166; D-2 to I-165; D-2 to I-164; D-2 to G-163; D-2
to P-162; D-2 to L-161; D-2 to S-160; D-2 to A-159; D-2 to F-158;
D-2 to V-157; D-2 to A-156; D-2 to V-155; D-2 to V-154; D-2 to
W-153; D-2 to T-152; D-2 to I-151; D-2 to V-150; D-2 to S-149; D-2
to T-148; D-2 to V-147; D-2 to V-146; D-2 to G-145; D-2 to F-144;
D-2 to T-143; D-2 to V-142; D-2 to T-141; D-2 to R-140; D-2 to
A-139; D-2 to K-138; D-2 to L-137; D-2 to A-136; D-2 to F-135; D-2
to V-134; D-2 to A-133; D-2 to H-132; D-2 to V-131; D-2 to I-130;
D-2 to A-129; D-2 to L-128; D-2 to Y-127; D-2 to R-126; D-2 to
D-125; D-2 to I-124; D-2 to T-123; D-2 to L-122; D-2 to L-121; D-2
to I-120; D-2 to I-119; D-2 to F-118; D-2 to F-117; D-2 to I-116;
D-2 to G-115; D-2 to S-114; D-2 to F-113; D-2 to F-112; D-2 to
G-111; D-2 to I-110; D-2 to F-109; D-2 to Y-108; D-2 to L-107; D-2
to G-106; D-2 to T-105; D-2 to L-104; D-2 to L-103; D-2 to Q-102;
D-2 to C-101; D-2 to M-100; D-2 to T-99; D-2 to N-98; D-2 to G-97;
D-2 to F-96; D-2 to D-95; D-2 to W-94; D-2 to Q-93; D-2 to A-92;
D-2 to A-91; D-2 to A-90; D-2 to Y-89; D-2 to H-88; D-2 to A-87;
D-2 to W-86; D-2 to F-85; D-2 to P-84; D-2 to V-83; D-2 to T-82;
D-2 to L-81; D-2 to L-80; D-2 to F-79; D-2 to F-78; D-2 to L-77;
D-2 to D-76; D-2 to S-75; D-2 to I-74; D-2 to A-73; D-2 to L-72;
D-2 to N-71; D-2 to L-70; D-2 to L-69; D-2 to Y-68; D-2 to I-67;
D-2 to D-66; D-2 to T-65; D-2 to M-64; D-2 to S-63; D-2 to E-62;
D-2 to L-61; D-2 to R-60; D-2 to Q-59; D-2 to C-58; D-2 to N-57;
D-2 to I-56; D-2 to L-55; D-2 to I-54; D-2 to L-53; D-2 to I-52;
D-2 to V-51; D-2 to L-50; D-2 to M-49; D-2 to N-48; D-2 to G-47;
D-2 to V-46; D-2 to F-45; D-2 to G-44; D-2 to F-43; D-2 to I-42;
D-2 to F-41; D-2 to V-40; D-2 to L-39; D-2 to S-38; D-2 to Y-37;
D-2 to L-36; D-2 to P-35; D-2 to P-34; D-2 to L-33; D-2 to L-32;
D-2 to R-31; D-2 to A-30; D-2 to A-29; D-2 to I-28; D-2 to Q-27;
D-2 to K-26; D-2 to V-25; D-2 to N-24; D-2 to I-23; D-2 to K-22;
D-2 to P-21; D-2 to C-20; D-2 to P-19; D-2 to E-18; D-2 to S-17;
D-2 to T-16; D-2 to Y-15; D-2 to Y-14; D-2 to N-13; D-2 to I-12;
D-2 to D-11; D-2 to Y-10; D-2 to I-9; and/or D-2 to P-8 of SEQ ID
NO:2. Moreover, a methionine may be added to the N-terminus of each
of these C-terminal contructs. Polynucleotides encoding these
polypeptides are also encompassed by the invention.
[0241] Additionally, the invention provides polynucleotides
encoding polypeptides comprising, or alternatively consisting of,
the amino acid sequence of residues of D-2 to G-351; D-2 to V-350;
D-2 to S-349; D-2 to I-348; D-2 to E-347; D-2 to Q-346; D-2 to
E-345; D-2 to E-344; D-2 to T-343; D-2 to S-342; D-2 to R-341; D-2
to T-340; D-2 to Y-339; D-2 to V-338; D-2 to S-337; D-2 to S-336;
D-2 to A-335; D-2 to R-334; D-2 to E-333; D-2 to P-332; D-2 to
A-331; D-2 to E-330; D-2 to Q-329; D-2 to Q-328; D-2 to F-327; D-2
to I-326; D-2 to S-325; D-2 to C-324; D-2 to C-323; D-2 to K-322;
D-2 to C-321; D-2 to F-320; D-2 to R-319; D-2 to K-318; D-2 to
A-317; D-2 to I-316; D-2 to H-315; D-2 to K-314; D-2 to Q-313; D-2
to F-312; D-2 to F-311; D-2 to V-310; D-2 to L-309; D-2 to L-308;
D-2 to Y-307; D-2 to N-306; D-2 to R-305; D-2 to F-304; D-2 to
K-303; D-2 to E-302; D-2 to G-301; D-2 to V-300; D-2 to F-299; D-2
to A-298; D-2 to Y-297; D-2 to I-296; D-2 to I-295; D-2 to P-294;
D-2 to N-293; D-2 to I-292; D-2 to C-291; D-2 to C-290; D-2 to
H-289; D-2 to T-288; D-2 to M-287; D-2 to G-286; D-2 to L-285; D-2
to T-284; D-2 to E-283; D-2 to T-282; D-2 to V-281; D-2 to Q-280;
D-2 to M-279; D-2 to A-278; D-2 to Q-277; D-2 to D-276; D-2 to
L-275; D-2 to R-274; D-2 to N-273; D-2 to S-272; D-2 to S-271; D-2
to S-270; D-2 to C-269; D-2 to N-268; D-2 to N-267; D-2 to L-266;
D-2 to G-265; D-2 to F-264; D-2 to F-263; D-2 to E-262; D-2 to
Q-261; D-2 to F-260; D-2 to T-259; D-2 to N-258; D-2 to L-257; D-2
to L-256; D-2 to L-255; D-2 to V-254; D-2 to I-253; D-2 to N-252;
D-2 to Y-251; D-2 to P-250; D-2 to A-249; D-2 to W-248; D-2 to
F-247; D-2 to L-246; D-2 to F-245; D-2 to Y-244; D-2 to V-243; D-2
to I-242; D-2 to M-241; D-2 to I-240; D-2 to T-239; D-2 to F-238;
D-2 to I-237; D-2 to L-236; D-2 to R-235; D-2 to V-234; D-2 to
A-233; D-2 to R-232; D-2 to H-231; D-2 to R-230; D-2 to K-229; D-2
to K-228; D-2 to E-227; D-2 to N-226; D-2 to R-225; D-2 to C-224;
D-2 to R-223; D-2 to L-222; D-2 to L-221; D-2 to T-220; D-2 to
K-219; D-2 to L-218; D-2 to I-217; D-2 to G-216; D-2 to S-215; D-2
to Y-214; D-2 to C-213; D-2 to I-212; D-2 to V-211; D-2 to M-210;
D-2 to V-209; D-2 to L-208; D-2 to L-207; D-2 to P-206; D-2 to
L-205; D-2 to V-204; D-2 to L-203; D-2 to G-202; D-2 to L-201; D-2
to I-200; D-2 to V-199; D-2 to I-198; D-2 to K-197; D-2 to L-196;
D-2 to T-195; D-2 to Q-194; D-2 to F-193; D-2 to N-192; D-2 to
K-191; D-2 to W-190; D-2 to F-189; D-2 to Q-188; D-2 to Y-187; D-2
to Q-186; D-2 to S-185; D-2 to Y-184; D-2 to P-183; D-2 to F-182;
D-2 to H-181; D-2 to S-180; D-2 to S-179; D-2 to C-178; D-2 to
T-177; D-2 to Y-176; D-2 to H-175; D-2 to L-174; D-2 to G-173; D-2
to E-172; D-2 to K-171; D-2 to Q-170; D-2 to S-169; D-2 to R-168;
D-2 to T-167; D-2 to F-166; D-2 to I-165; D-2 to I-164; D-2 to
G-163; D-2 to P-162; D-2 to L-161; D-2 to S-160; D-2 to A-159; D-2
to F-158; D-2 to V-157; D-2 to A-156; D-2 to V-155; D-2 to V-154;
D-2 to W-153; D-2 to T-152; D-2 to I-151; D-2 to V-150; D-2 to
S-149; D-2 to T-148; D-2 to V-147; D-2 to V-146; D-2 to G-145; D-2
to F-144; D-2 to T-143; D-2 to V-142; D-2 to T-141; D-2 to R-140;
D-2 to A-139; D-2 to K-138; D-2 to L-137; D-2 to A-136; D-2 to
F-135; D-2 to V-134; D-2 to A-133; D-2 to H-132; D-2 to V-131; D-2
to V-130; D-2 to A-129; D-2 to L-128; D-2 to Y-127; D-2 to R-126;
D-2 to D-125; D-2 to I-124; D-2 to T-123; D-2 to L-122; D-2 to
L-121; D-2 to I-120; D-2 to I-119; D-2 to F-118; D-2 to F-117; D-2
to I-116; D-2 to G-115; D-2 to S-114; D-2 to F-113; D-2 to F-112;
D-2 to G-111; D-2 to I-110; D-2 to F-109; D-2 to Y-108; D-2 to
L-107; D-2 to G-106; D-2 to T-105; D-2 to L-104; D-2 to L-103; D-2
to Q-102; D-2 to C-101; D-2 to M-100; D-2 to T-99; D-2 to N-98; D-2
to G-97; D-2 to F-96; D-2 to D-95; D-2 to W-94; D-2 to Q-93; D-2 to
A-92; D-2 to A-91; D-2 to A-90; D-2 to Y-89; D-2 to H-88; D-2 to
A-87; D-2 to W-86; D-2 to F-85; D-2 to P-84; D-2 to V-83; D-2 to
T-82; D-2 to L-81; D-2 to L-80; D-2 to F-79; D-2 to F-78; D-2 to
L-77; D-2 to D-76; D-2 to S-75; D-2 to I-74; D-2 to A-73; D-2 to
L-72; D-2 to N-71; D-2 to L-70; D-2 to L-69; D-2 to Y-68; D-2 to
I-67; D-2 to D-66; D-2 to T-65; D-2 to M-64; D-2 to S-63; D-2 to
K-62; D-2 to L-61; D-2 to R-60; D-2 to K-59; D-2 to C-58; D-2 to
N-57; D-2 to I-56; D-2 to L-55; D-2 to I-54; D-2 to L-53; D-2 to
I-52; D-2 to V-51; D-2 to L-50; D-2 to M-49; D-2 to N-48; D-2 to
G-47; D-2 to V-46; D-2 to F-45; D-2 to G-44; D-2 to F-43; D-2 to
I-42; D-2 to F-41; D-2 to V-40; D-2 to L-39; D-2 to S-38; D-2 to
Y-37; D-2 to L-36; D-2 to P-35; D-2 to P-34; D-2 to L-33; D-2 to
L-32; D-2 to R-31; D-2 to A-30; D-2 to A-29; D-2 to I-28; D-2 to
Q-27; D-2 to K-26; D-2 to V-25; D-2 to N-24; D-2 to I-23; D-2 to
K-22; D-2 to Q-21; D-2 to C-20; D-2 to P-19; D-2 to E-18; D-2 to
S-17; D-2 to T-16; D-2 to Y-15; D-2 to Y-14; D-2 to N-13; D-2 to
I-12; D-2 to D-11; D-2 to Y-10; D-2 to I-9; and/or D-2 to P-8 of
SEQ ID NO:22. Moreover, a methionine may be added to the N-terminus
of each of these C-terminal contructs. Polynucleotides encoding
these polypeptides are also encompassed by the invention.
[0242] The present application is also directed to nucleic acid
molecules comprising, or alternatively, consisting of, a
polynucleotide sequence at least 90%, 92%, 95%, 96%, 97%, 98%, or
99% identical to the polynucleotide sequence encoding the G-protein
Chemokine Receptor (CCR5) polypeptide described above. The present
invention also encompasses the above polynucleotide sequences fused
to a heterologous polynucleotide sequence.
[0243] In addition, any of the above listed N- or C-terminal
deletions can be combined to produce a N- and C-terminal deleted
G-protein Chemokine Receptor (CCR5) polypeptide. The invention also
provides polypeptides having one or more amino acids deleted from
both the amino and the carboxyl termini, which may be described
generally as having residues m-n of SEQ ID NO:2 or of the
polypeptide encoded by the deposited clone, where n and m are
integers as described above. Polynucleotides encoding these
polypeptides are also encompassed by the invention.
[0244] Also included are a nucleotide sequence encoding a
polypeptide consisting of a portion of the complete G-protein
Chemokine Receptor (CCR5) amino acid sequence encoded by the clone
contained in ATCC.TM. Deposit No. 97183, where this portion
excludes any integer of amino acid residues from 1 to about 342
amino acids from the amino terminus of the complete amino acid
sequence encoded by the clone contained in ATCC.TM. Deposit No.
97183, or any integer of amino acid residues from 1 to about 342
amino acids from the carboxy terminus, or any combination of the
above amino terminal and carboxy terminal deletions, of the
complete amino acid sequence encoded by the clone contained in
ATCC.TM. Deposit No. 97183. Polynucleotides encoding all of the
above deletion mutant polypeptide forms also are provided.
[0245] The present application is also directed to proteins
containing polypeptides at least 90%, 92%, 93%, 94%, 95%, 96%, 97%,
98% or 99% identical to the G-protein Chemokine Receptor (CCR5)
polypeptide sequence set forth herein m-n. In preferred
embodiments, the application is directed to proteins containing
polypeptides at least 90%, 95%, 96%, 97%, 98% or 99% identical to
polypeptides having the amino acid sequence of the specific
G-protein Chemokine Receptor (CCR5) N- and C-terminal deletions
recited herein. Polynucleotides encoding these polypeptides are
also encompassed by the invention.
[0246] Additional preferred polypeptide fragments comprise, or
alternatively consist of, the amino acid sequence of residues: M-1
to Y-15; D-2 to T-16; Y-3 to S-17; Q-4 to E-18; V-5 to P-19; S-6 to
C-20; S-7 to P-21; P-8 to K-22; I-9 to I-23; Y-10 to N-24; D-11 to
V-25; I-12 to K-26; N-13 to Q-27; Y-14 to I-28; Y-15 to A-29; T-16
to A-30; S-17 to R-31; E-18 to L-32; P-19 to L-33; C-20 to P-34;
P-21 to P-35; K-22 to L-36; I-23 to Y-37; N-24 to S-38; V-25 to
L-39; K-26 to V-40; Q-27 to F-41; I-28 to I-42; A-29 to F-43; A-30
to G-44; R-31 to F-45; L-32 to V-46; L-33 to G-47; P-34 to N-48;
P-35 to M-49; L-36 to L-50; Y-37 to V-51; S-38 to I-52; L-39 to
L-53; V-40 to I-54; F-41 to L-55; I-42 to I-56; F-43 to N-57; G-44
to C-58; F-45 to Q-59; V-46 to R-60; G-47 to L-61; N-48 to E-62;
M-49 to S-63; L-50 to M-64; V-51 to T-65; I-52 to D-66; L-53 to
I-67; I-54 to Y-68; L-55 to L-69; I-56 to L-70; N-57 to N-71; C-58
to L-72; Q-59 to A-73; R-60 to I-74; L-61 to S-75; E-62 to D-76;
S-63 to L-77; M-64 to F-78; T-65 to F-79; D-66 to L-80; I-67 to
L-81; Y-68 to T-82; L-69 to V-83; L-70 to P-84; N-71 to F-85; L-72
to W-86; A-73 to A-87; I-74 to H-88; S-75 to Y-89; D-76 to A-90;
L-77 to A-91; F-78 to A-92; F-79 to Q-93; L-80 to W-94; L-81 to
D-95; T-82 to F-96; V-83 to G-97; P-84 to N-98; F-85 to T-99; W-86
to M-100; A-87 to C-101; H-88 to Q-102; Y-89 to L-103; A-90 to
L-104; A-91 to T-105; A-92 to G-106; Q-93 to L-107; W-94 to Y-108;
D-95 to F-109; F-96 to I-110; G-97 to G-111; N-98 to F-112; T-99 to
F-113; M-100 to S-114; C-101 to G-115; Q-102 to I-116; L-103 to
F-117; L-104 to F-118; T-105 to I-119; G-106 to I-120; L-107 to
L-121; Y-108 to L-122; F-109 to T-123; I-110 to I-124; G-111 to
D-125; F-112 to R-126; F-113 to Y-127; S-114 to L-128; G-115 to
A-129; I-116 to I-130; F-117 to V-131; F-118 to H-132; I-119 to
A-133; I-120 to V-134; L-121 to F-135; L-122 to A-136; T-123 to
L-137; I-124 to K-138; D-125 to A-139; R-126 to R-140; Y-127 to
T-141; L-128 to V-142; A-129 to T-143; I-130 to F-144; V-131 to
G-145; H-132 to V-146; A-133 to V-147; V-134 to T-148; F-135 to
S-149; A-136 to V-150; L-137 to I-151; K-138 to T-152; A-139 to
W-153; R-140 to V-154; T-141 to V-155; V-142 to A-156; T-143 to
V-157; F-144 to F-158; G-145 to A-159; V-146 to S-160; V-147 to
L-161; T-148 to P-162; S-149 to G-163; V-150 to I-164; I-151 to
I-165; T-152 to F-166; W-153 to T-167; V-154 to R-168; V-155 to
S-169; A-156 to Q-170; V-157 to K-171; F-158 to E-172; A-159 to
G-173; S-160 to L-174; L-161 to H-175; P-162 to Y-176; G-163 to
T-177; I-164 to C-178; I-165 to S-179; F-166 to S-180; T-167 to
H-181; R-168 to F-182; S-169 to P-183; Q-170 to Y-184; K-171 to
S-185; E-172 to Q-186; G-173 to Y-187; L-174 to Q-188; H-175 to
F-189; Y-176 to W-190; T-177 to K-191; C-178 to N-192; S-179 to
F-193; S-180 to Q-194; H-181 to T-195; F-182 to L-196; P-183 to
K-197; Y-184 to I-198; S-185 to V-199; Q-186 to I-200; Y-187 to
L-201; Q-188 to G-202; F-189 to L-203; W-190 to V-204; K-191 to
L-205; N-192 to P-206; F-193 to L-207; Q-194 to L-208; T-195 to
V-209; L-196 to M-210; K-197 to V-211; I-198 to I-212; V-199 to
C-213; I-200 to Y-214; L-201 to S-215; G-202 to G-216; L-203 to
I-217; V-204 to L-218; L-205 to K-219; P-206 to T-220; L-207 to
L-221; L-208 to L-222; V-209 to R-223; M-210 to C-224; V-211 to
R-225; I-212 to N-226; C-213 to E-227; Y-214 to K-228; S-215 to
K-229; G-216 to R-230; I-217 to H-231; L-218 to R-232; K-219 to
A-233; T-220 to V-234; L-221 to R-235; L-222 to L-236; R-223 to
I-237; C-224 to F-238; R-225 to T-239; N-226 to I-240; E-227 to
M-241; K-228 to I-242; K-229 to V-243; R-230 to Y-244; H-231 to
F-245; R-232 to L-246; A-233 to F-247; V-234 to W-248; R-235 to
A-249; L-236 to P-250; I-237 to Y-251; F-238 to N-252; T-239 to
I-253; I-240 to V-254; M-241 to L-255; I-242 to L-256; V-243 to
L-257; Y-244 to N-258; F-245 to T-259; L-246 to F-260; F-247 to
Q-261; W-248 to E-262; A-249 to F-263; P-250 to F-264; Y-251 to
G-265; N-252 to L-266; I-253 to N-267; V-254 to N-268; L-255 to
C-269; L-256 to S-270; L-257 to S-271; N-258 to S-272; T-259 to
N-273; F-260 to R-274; Q-261 to L-275; E-262 to D-276; F-263 to
Q-277; F-264 to A-278; G-265 to M-279; L-266 to Q-280; N-267 to
V-281; N-268 to T-282; C-269 to E-283; S-270 to T-284; S-271 to
L-285; S-272 to G-286; N-273 to M-287; R-274 to T-288; L-275 to
H-289; D-276 to C-290; Q-277 to C-291; A-278 to I-292; M-279 to
N-293; Q-280 to P-294; V-281 to I-295; T-282 to I-296; E-283 to
Y-297; T-284 to A-298; L-285 to F-299; G-286 to V-300; M-287 to
G-301; T-288 to E-302; H-289 to K-303; C-290 to F-304; C-291 to
R-305; I-292 to N-306; N-293 to Y-307; P-294 to L-308; I-295 to
L-309; I-296 to V-310; Y-297 to F-311; A-298 to F-312; F-299 to
Q-313; V-300 to K-314; G-301 to H-315; E-302 to I-316; K-303 to
A-317; F-304 to K-318; R-305 to R-319; N-306 to F-320; Y-307 to
C-321; L-308 to K-322; L-309 to C-323; V-310 to C-324; F-311 to
S-325; F-312 to I-326; Q-313 to F-327; K-314 to Q-328; H-315 to
Q-329; I-316 to E-330; A-317 to A-331; K-318 to P-332; R-319 to
E-333; F-320 to R-334; C-321 to A-335; K-322 to S-336; C-323 to
S-337; C-324 to V-338; S-325 to Y-339; I-326 to T-340; F-327 to
R-341; Q-328 to S-342; Q-329 to T-343; E-330 to G-344; A-331 to
E-345; P-332 to Q-346; E-333 to E-347; R-334 to I-348; A-335 to
S-349; S-336 to V-350; S-337 to G-351; and/or V-338 to L-352 of SEQ
ID NO:2.
[0247] Additional preferred polypeptide fragments comprise, or
alternatively consist of, the amino acid sequence of residues: M-1
to Y-15; D-2 to T-16; Y-3 to S-17; Q-4 to E-18; V-5 to P-19; S-6 to
C-20; S-7 to Q-21; P-8 to K-22; I-9 to I-23; Y-10 to N-24; D-11 to
V-25; I-12 to K-26; N-13 to Q-27; Y-14 to I-28; Y-15 to A-29; T-16
to A-30; S-17 to R-31; E-18 to L-32; P-19 to L-33; C-20 to P-34;
Q-21 to P-35; K-22 to L-36; I-23 to Y-37; N-24 to S-38; V-25 to
L-39; K-26 to V-40; Q-27 to F-41; I-28 to I-42; A-29 to F-43; A-30
to G-44; R-31 to F-45; L-32 to V-46; L-33 to G-47; P-34 to N-48;
P-35 to M-49; L-36 to L-50; Y-37 to V-51; S-38 to I-52; L-39 to
L-53; V-40 to I-54; F-41 to L-55; I-42 to I-56; F-43 to N-57; G-44
to C-58; F-45 to K-59; V-46 to R-60; G-47 to L-61; N-48 to K-62;
M-49 to S-63; L-50 to M-64; V-51 to T-65; I-52 to D-66; L-53 to
I-67; I-54 to Y-68; L-55 to L-69; I-56 to L-70; N-57 to N-71; C-58
to L-72; K-59 to A-73; R-60 to I-74; L-61 to S-75; K-62 to D-76;
S-63 to L-77; M-64 to F-78; T-65 to F-79; D-66 to L-80; I-67 to
L-81; Y-68 to T-82; L-69 to V-83; L-70 to P-84; N-71 to F-85; L-72
to W-86; A-73 to A-87; I-74 to H-88; S-75 to Y-89; D-76 to A-90;
L-77 to A-91; F-78 to A-92; F-79 to Q-93; L-80 to W-94; L-81 to
D-95; T-82 to F-96; V-83 to G-97; P-84 to N-98; F-85 to T-99; W-86
to M-100; A-87 to C-101; H-88 to Q-102; Y-89 to L-103; A-90 to
L-104; A-91 to T-105; A-92 to G-106; Q-93 to L-107; W-94 to Y-108;
D-95 to F-109; F-96 to I-110; G-97 to G-111; N-98 to F-112; T-99 to
F-113; M-100 to S-114; C-101 to G-115; Q-102 to I-116; L-103 to
F-117; L-104 to F-118; T-105 to I-119; G-106 to I-120; L-107 to
L-121; Y-108 to L-122; F-109 to T-123; I-110 to I-124; G-111 to
D-125; F-112 to R-126; F-113 to Y-127; S-114 to L-128; G-115 to
A-129; I-116 to V-130; F-117 to V-131; F-118 to H-132; I-119 to
A-133; I-120 to V-134; L-121 to F-135; L-122 to A-136; T-123 to
L-137; I-124 to K-138; D-125 to A-139; R-126 to R-140; Y-127 to
T-141; L-128 to V-142; A-129 to T-143; V-130 to F-144; V-131 to
G-145; H-132 to V-146; A-133 to V-147; V-134 to T-148; F-135 to
S-149; A-136 to V-150; L-137 to I-151; K-138 to T-152; A-139 to
W-153; R-140 to V-154; T-141 to V-155; V-142 to A-156; T-143 to
V-157; F-144 to F-158; G-145 to A-159; V-146 to S-160; V-147 to
L-161; T-148 to P-162; S-149 to G-163; V-150 to I-164; I-151 to
I-165; T-152 to F-166; W-153 to T-167; V-154 to R-168; V-155 to
S-169; A-156 to Q-170; V-157 to K-171; F-158 to E-172; A-159 to
G-173; S-160 to L-174; L-161 to H-175; P-162 to Y-176; G-163 to
T-177; I-164 to C-178; I-165 to S-179; F-166 to S-180; T-167 to
H-181; R-168 to F-182; S-169 to P-183; Q-170 to Y-184; K-171 to
S-185; E-172 to Q-186; G-173 to Y-187; L-174 to Q-188; H-175 to
F-189; Y-176 to W-190; T-177 to K-191; C-178 to N-192; S-179 to
F-193; S-180 to Q-194; H-181 to T-195; F-182 to L-196; P-183 to
K-197; Y-184 to I-198; S-185 to V-199; Q-186 to I-200; Y-187 to
L-201; Q-188 to G-202; F-189 to L-203; W-190 to V-204; K-191 to
L-205; N-192 to P-206; F-193 to L-207; Q-194 to L-208; T-195 to
V-209; L-196 to M-210; K-197 to V-211; I-198 to I-212; V-199 to
C-213; I-200 to Y-214; L-201 to S-215; G-202 to G-216; L-203 to
I-217; V-204 to L-218; L-205 to K-219; P-206 to T-220; L-207 to
L-221; L-208 to L-222; V-209 to R-223; M-210 to C-224; V-211 to
R-225; I-212 to N-226; C-213 to E-227; Y-214 to K-228; S-215 to
K-229; G-216 to R-230; I-217 to H-231; L-218 to R-232; K-219 to
A-233; T-220 to V-234; L-221 to R-235; L-222 to L-236; R-223 to
I-237; C-224 to F-238; R-225 to T-239; N-226 to I-240; E-227 to
M-241; K-228 to I-242; K-229 to V-243; R-230 to Y-244; H-231 to
F-245; R-232 to L-246; A-233 to F-247; V-234 to W-248; R-235 to
A-249; L-236 to P-250; I-237 to Y-251; F-238 to N-252; T-239 to
I-253; I-240 to V-254; M-241 to L-255; I-242 to L-256; V-243 to
L-257; Y-244 to N-258; F-245 to T-259; L-246 to F-260; F-247 to
Q-261; W-248 to E-262; A-249 to F-263; P-250 to F-264; Y-251 to
G-265; N-252 to L-266; I-253 to N-267; V-254 to N-268; L-255 to
C-269; L-256 to S-270; L-257 to S-271; N-258 to S-272; T-259 to
N-273; F-260 to R-274; Q-261 to L-275; E-262 to D-276; F-263 to
Q-277; F-264 to A-278; G-265 to M-279; L-266 to Q-280; N-267 to
V-281; N-268 to T-282; C-269 to E-283; S-270 to T-284; S-271 to
L-285; S-272 to G-286; N-273 to M-287; R-274 to T-288; L-275 to
H-289; D-276 to C-290; Q-277 to C-291; A-278 to I-292; M-279 to
N-293; Q-280 to P-294; V-281 to I-295; T-282 to I-296; E-283 to
Y-297; T-284 to A-298; L-285 to F-299; G-286 to V-300; M-287 to
G-301; T-288 to E-302; H-289 to K-303; C-290 to F-304; C-291 to
R-305; I-292 to N-306; N-293 to Y-307; P-294 to L-308; I-295 to
L-309; I-296 to V-310; Y-297 to F-311; A-298 to F-312; F-299 to
Q-313; V-300 to K-314; G-301 to H-315; E-302 to I-316; K-303 to
A-317; F-304 to K-318; R-305 to R-319; N-306 to F-320; Y-307 to
C-321; L-308 to K-322; L-309 to C-323; V-310 to C-324; F-311 to
S-325; F-312 to I-326; Q-313 to F-327; K-314 to Q-328; H-315 to
Q-329; I-316 to E-330; A-317 to A-331; K-318 to P-332; R-319 to
E-333; F-320 to R-334; C-321 to A-335; K-322 to S-336; C-323 to
S-337; C-324 to V-338; S-325 to Y-339; I-326 to T-340; F-327 to
R-341; Q-328 to S-342; Q-329 to T-343; E-330 to E-344; A-331 to
E-345; P-332 to Q-346; E-333 to E-347; R-334 to I-348; A-335 to
S-349; S-336 to V-350; S-337 to G-351; and/or V-338 to L-352 of SEQ
ID NO:22.
[0248] These polypeptide fragments may retain the biological
activity of G-protein Chemokine Receptor (CCR5) polypeptides of the
invention and/or may be useful to generate or screen for
antibodies, as described further below. Polynucleotides encoding
these polypeptide fragments are also encompassed by the
invention.
[0249] The present application is also directed to nucleic acid
molecules comprising, or alternatively, consisting of, a
polynucleotide sequence at least 90%, 92%, 95%, 96%, 97%, 98%, or
99% identical to the polynucleotide sequence encoding the G-protein
Chemokine Receptor (CCR5) polypeptide described above. The present
invention also encompasses the above polynucleotide sequences fused
to a heterologous polynucleotide sequence.
[0250] Additionally, the present application is also directed to
proteins containing polypeptides at least 90%, 92%, 93%, 94%, 95%,
96%, 97%, 98% or 99% identical to the G-protein Chemokine Receptor
(CCR5) polypeptide fragments set forth above. Polynucleotides
encoding these polypeptides are also encompassed by the
invention.
[0251] Preferably, the polynucleotide fragments of the invention
encode a polypeptide which demonstrates a G-protein Chemokine
Receptor (CCR5) functional activity. By a polypeptide demonstrating
a G-protein Chemokine Receptor (CCR5) "functional activity" is
meant, a polypeptide capable of displaying one or more known
functional activities associated with a full-length (complete)
G-protein Chemokine Receptor (CCR5) protein. Such functional
activities include, but are not limited to, biological activity,
antigenicity [ability to bind (or compete with a G-protein
Chemokine Receptor (CCR5) polypeptide for binding) to an
anti-G-protein Chemokine Receptor (CCR5) antibody], immunogenicity
(ability to generate antibody which binds to a G-protein Chemokine
Receptor (CCR5) polypeptide), ability to form multimers with
G-protein Chemokine Receptor (CCR5) polypeptides of the invention,
and ability to bind to a receptor or ligand for a G-protein
Chemokine Receptor (CCR5) polypeptide.
[0252] The functional activity of G-protein Chemokine Receptor
(CCR5) polypeptides, and fragments, variants derivatives, and
analogs thereof, can be assayed by various methods.
[0253] For example, in one embodiment where one is assaying for the
ability to bind or compete with full-length G-protein Chemokine
Receptor (CCR5) polypeptide for binding to anti-G-protein Chemokine
Receptor (CCR5) antibody, various immunoassays known in the art can
be used, including but not limited to, competitive and
non-competitive assay systems using techniques such as
radioimmunoassays, ELISA (enzyme linked immunosorbent assay),
"sandwich" immunoassays, immunoradiometric assays, gel diffusion
precipitation reactions, immunodiffusion assays, in situ
immunoassays (using colloidal gold, enzyme or radioisotope labels,
for example), western blots, precipitation reactions, agglutination
assays (e.g., gel agglutination assays, hemagglutination assays),
complement fixation assays, immunofluorescence assays, protein A
assays, and immunoelectrophoresis assays, etc. In one embodiment,
antibody binding is detected by detecting a label on the primary
antibody. In another embodiment, the primary antibody is detected
by detecting binding of a secondary antibody or reagent to the
primary antibody. In a further embodiment, the secondary antibody
is labeled. Many means are known in the art for detecting binding
in an immunoassay and are within the scope of the present
invention.
[0254] In another embodiment, where a G-protein Chemokine Receptor
(CCR5) ligand is identified, or the ability of a polypeptide
fragment, variant or derivative of the invention to multimerize is
being evaluated, binding can be assayed, e.g., by means well-known
in the art, such as, for example, reducing and non-reducing gel
chromatography, protein affinity chromatography, and affinity
blotting. See generally, Phizicky, E., et al., 1995, Microbiol.
Rev. 59:94-123. In another embodiment, physiological correlates of
G-protein Chemokine Receptor (CCR5) binding to its substrates
(signal transduction) can be assayed.
[0255] In addition, assays described herein (see Examples) and
otherwise known in the art may routinely be applied to measure the
ability of G-protein Chemokine Receptor (CCR5) polypeptides and
fragments, variants derivatives and analogs thereof to elicit
G-protein Chemokine Receptor (CCR5) related biological activity
(either in vitro or in vivo). Other methods will be known to the
skilled artisan and are within the scope of the invention.
[0256] Among the especially preferred fragments of the invention
are fragments characterized by structural or functional attributes
of G-protein Chemokine Receptor. Such fragments include amino acid
residues that comprise alpha-helix and alpha-helix forming regions
("alpha-regions"), beta-sheet and beta-sheet-forming regions
("beta-regions"), turn and turn-forming regions ("turn-regions"),
coil and coil-forming regions ("coil-regions"), hydrophilic
regions, hydrophobic regions, alpha amphipathic regions, beta
amphipathic regions, surface forming regions, and high antigenic
index regions (i.e., containing four or more contiguous amino acids
having an antigenic index of greater than or equal to 1.5, as
identified using the default parameters of the Jameson-Wolf
program) of complete (i.e., full-length) G-protein Chemokine
Receptor (CCR5) (SEQ ID NO:2) or encoded by the deposited clone.
Certain preferred regions are those set out in FIG. 3 and include,
but are not limited to, regions of the aforementioned types
identified by analysis of the amino acid sequence depicted in FIG.
1 (SEQ ID NO:2) or encoded by the deposited clone, such preferred
regions include; Garnier-Robson predicted alpha-regions,
beta-regions, turn-regions, and coil-regions; Chou-Fasman predicted
alpha-regions, beta-regions, turn-regions, and coil-regions;
Kyte-Doolittle predicted hydrophilic and hydrophobic regions;
Eisenberg alpha and beta amphipathic regions; Emini surface-forming
regions; and Jameson-Wolf high antigenic index regions, as
predicted using the default parameters of these computer programs.
Polynucleotides encoding these polypeptides are also encompassed by
the invention.
[0257] In additional embodiments, the polynucleotides of the
invention encode functional attributes of G-protein Chemokine
Receptor. Preferred embodiments of the invention in this regard
include fragments that comprise alpha-helix and alpha-helix forming
regions ("alpha-regions"), beta-sheet and beta-sheet forming
regions ("beta-regions"), turn and turn-forming regions
("turn-regions"), coil and coil-forming regions ("coil-regions"),
hydrophilic regions, hydrophobic regions, alpha amphipathic
regions, beta amphipathic regions, flexible regions,
surface-forming regions and high antigenic index regions of
G-protein Chemokine Receptor.
[0258] The data representing the structural or functional
attributes of G-protein Chemokine Receptor (CCR5) set forth in FIG.
1 or encoded by the deposited clone and/or Table 1, as described
above, was generated using the various modules and algorithms of
the DNA*STAR set on default parameters. In a preferred embodiment,
the data presented in columns VIII, IX, XIII, and XIV of Table 1
can be used to determine regions of G-protein Chemokine Receptor
(CCR5) which exhibit a high degree of potential for antigenicity.
Regions of high antigenicity are determined from the data presented
in columns VIII, IX, XIII, and/or IV by choosing values which
represent regions of the polypeptide which are likely to be exposed
on the surface of the polypeptide in an environment in which
antigen recognition may occur in the process of initiation of an
immune response.
[0259] Certain preferred regions in these regards are set out in
FIG. 3, but may, as shown in Table 1, be represented or identified
by using tabular representations of the data presented in FIG. 3.
The DNA*STAR computer algorithm used to generate FIG. 3 (set on the
original default parameters) was used to present the data in FIG. 3
in a tabular format (See Table 1). The tabular format of the data
in FIG. 3 may be used to easily determine specific boundaries of a
preferred region.
[0260] The above-mentioned preferred regions set out in FIG. 3 and
in Table 1 include, but are not limited to, regions of the
aforementioned types identified by analysis of the amino acid
sequence set out in FIG. 1 or encoded by the deposited clone. As
set out in FIG. 3 and in Table 1, such preferred regions include
Garnier-Robson alpha-regions, beta-regions, turn-regions, and
coil-regions, Chou-Fasman alpha-regions, beta-regions, and
coil-regions, Kyte-Doolittle hydrophilic regions and hydrophobic
regions, Eisenberg alpha- and beta-amphipathic regions,
Karplus-Schulz flexible regions, Emini surface-forming regions and
Jameson-Wolf regions of high antigenic index.
TABLE-US-00001 TABLE 1 Res Position I II III IV V VI VII VIII IX X
XI XII XIII XIV Met 1 . . B . . . . 0.24 0.06 . * . 0.05 1.68 Asp 2
. . B B . . . 0.33 0.27 . * . -0.30 0.98 Tyr 3 . . B B . . . 0.42
0.23 . * . -0.15 1.02 Gln 4 . . B B . . . 0.60 0.19 . * . -0.15
1.38 Val 5 . . B B . . . 0.10 0.00 . * F 0.00 1.28 Ser 6 . . B B .
. . 0.46 0.69 * * F -0.45 0.57 Ser 7 . . B B . . . 0.46 0.69 * * F
-0.45 0.52 Pro 8 . . B B . . . -0.19 0.29 * * F 0.00 1.17 Ile 9 . .
B B . . . -0.19 0.33 * * . -0.30 0.61 Tyr 10 . . B B . . . 0.42
0.34 * . . -0.30 0.73 Asp 11 . . B . . T . 0.48 0.71 . . . -0.20
0.74 Ile 12 . . B . . T . 0.47 1.04 . . . -0.05 1.66 Asn 13 . . B .
. T . 0.38 0.84 * . . -0.05 1.53 Tyr 14 . . B . . T . 1.27 0.47 * .
. -0.05 1.23 Tyr 15 . . . B T . . 1.30 0.47 . * . -0.05 3.03 Thr 16
. . . B T . . 0.63 0.21 . * F 0.65 2.91 Ser 17 . . . B T . . 1.31
0.39 . * F 0.75 1.00 Glu 18 . . B . . . . 1.36 0.06 . * F 0.80 0.98
Pro 19 . . . . T . . 0.71 -0.70 . * F 2.50 1.36 Cys 20 . . . . T T
. 0.96 -0.50 . * F 2.50 0.71 Pro 21 . . . . T T . 0.41 -0.49 . * F
2.25 0.66 Lys 22 . . . . T T . 0.76 0.16 . * F 1.40 0.32 Ile 23 A .
. . . T . 0.76 -0.27 * * F 1.50 1.19 Asn 24 A A . . . . . 0.08
-0.44 . * F 0.85 1.33 Val 25 A A . . . . . 0.16 -0.19 . * . 0.30
0.47 Lys 26 . A B . . . . -0.22 0.31 . * . -0.30 0.67 Gln 27 . A B
. . . . -0.16 0.13 * * . -0.30 0.42 Ile 28 . A B . . . . -0.08
-0.27 * * . 0.45 1.11 Ala 29 . A B . . . . -0.89 -0.23 * * . 0.30
0.46 Ala 30 . A B . . . . -0.24 0.46 * * . -0.60 0.22 Arg 31 . A B
. . . . -0.50 0.49 * * . -0.60 0.48 Leu 32 . A B . . . . -1.31 0.23
* * . -0.30 0.74 Leu 33 . A B . . . . -0.67 0.41 * * . -0.60 0.60
Pro 34 . . . . . T C -0.38 0.67 * * F 0.15 0.48 Pro 35 . . . . T T
. -0.60 1.06 * * F 0.35 0.78 Leu 36 . . B . . T . -1.57 1.06 * * .
-0.20 0.78 Tyr 37 . . B . . T . -1.46 1.01 . . . -0.20 0.38 Ser 38
. . B B . . . -1.53 1.37 . . . -0.60 0.21 Leu 39 . . B B . . .
-2.02 1.63 . . . -0.60 0.18 Val 40 . . B B . . . -2.16 1.73 . . .
-0.60 0.10 Phe 41 . . B B . . . -2.04 1.40 . . . -0.60 0.07 Ile 42
. . B B . . . -2.66 1.80 . . . -0.60 0.08 Phe 43 . . B B . . .
-2.70 1.76 . . . -0.60 0.08 Gly 44 . . B B . . . -1.89 1.54 . . .
-0.60 0.09 Phe 45 . . . B T . . -1.63 1.16 . . . -0.20 0.20 Val 46
. . . B . . C -1.74 1.09 . . . -0.40 0.23 Gly 47 . . . B . . C
-1.71 0.99 . . . -0.40 0.19 Asn 48 A . . B . . . -1.90 1.20 . . .
-0.60 0.16 Met 49 A . . B . . . -2.37 1.10 . . . -0.60 0.15 Leu 50
A . . B . . . -2.56 1.14 . . . -0.60 0.13 Val 51 . . B B . . .
-2.51 1.40 . . . -0.60 0.06 Ile 52 . . B B . . . -3.06 1.69 . . .
-0.60 0.05 Leu 53 . . B B . . . -3.06 1.76 . . . -0.60 0.04 Ile 54
. . B B . . . -3.12 1.47 . * . -0.60 0.09 Leu 55 . . B B . . .
-2.31 1.40 * . . -0.60 0.07 Ile 56 . . B B . . . -1.34 1.11 * . .
-0.60 0.14 Asn 57 . . B B . . . -1.27 0.43 . * . -0.60 0.39 Cys 58
. A B B . . . -0.46 0.43 . . . -0.60 0.39 Gln 59 A A . B . . . 0.13
-0.26 * . . 0.30 0.96 Arg 60 A A . B . . . 0.34 -0.56 . . F 0.75
0.80 Leu 61 A A . B . . . 0.92 -0.34 . . F 0.60 1.47 Glu 62 . A B B
. . . 0.92 -0.43 . * F 0.60 1.23 Ser 63 . A B . . . . 0.70 -0.83 *
* F 0.90 1.05 Met 64 . A B B . . . 0.46 -0.14 * * F 0.45 0.89 Thr
65 . A B B . . . -0.47 -0.07 . * F 0.45 0.80 Asp 66 A A . B . . .
-0.47 0.61 . * . -0.60 0.50 Ile 67 A A . B . . . -0.47 0.91 . . .
-0.60 0.41 Tyr 68 A A . B . . . -0.98 0.70 . . . -0.60 0.46 Leu 69
A A . B . . . -0.97 0.90 . . . -0.60 0.23 Leu 70 A A . B . . .
-1.54 1.40 . * . -0.60 0.33 Asn 71 A A . B . . . -1.84 1.40 . . .
-0.60 0.15 Leu 72 . A B B . . . -0.96 1.03 * . . -0.60 0.24 Ala 73
A A . B . . . -1.52 0.34 * . . -0.30 0.48 Ile 74 A A . B . . .
-1.41 0.34 . . . -0.30 0.25 Ser 75 A A . B . . . -1.30 0.73 . * .
-0.60 0.26 Asp 76 A A . B . . . -2.11 0.83 . . . -0.60 0.22 Leu 77
. A B B . . . -2.11 1.01 . . . -0.60 0.26 Phe 78 . A B B . . .
-1.83 1.01 . . . -0.60 0.16 Phe 79 . A B B . . . -1.80 1.11 . . .
-0.60 0.14 Leu 80 . A B B . . . -1.71 1.76 . * . -0.60 0.13 Leu 81
. A B B . . . -2.41 1.50 . * . -0.60 0.22 Thr 82 . A B B . . .
-1.89 1.50 . * . -0.60 0.22 Val 83 . A . B . . C -1.78 1.63 . * .
-0.40 0.29 Pro 84 A A . B . . . -1.11 1.44 . * . -0.60 0.35 Phe 85
A A . B . . . -0.54 1.26 . . . -0.60 0.33 Trp 86 A A . B . . .
-0.32 1.53 . * . -0.60 0.70 Ala 87 A A . B . . . -0.60 1.39 . . .
-0.60 0.45 His 88 A A . B . . . -0.33 1.46 . . . -0.60 0.53 Tyr 89
A A . B . . . -0.12 1.17 . . . -0.60 0.51 Ala 90 A A . B . . . 0.29
0.66 . * . -0.60 0.87 Ala 91 A A . . . . . 0.58 1.07 . * . -0.60
0.67 Ala 92 A A . . . . . 0.47 0.57 . * . -0.60 0.72 Gln 93 A A . .
. . . 0.16 0.60 . * . -0.60 0.62 Trp 94 A A . . . . . 0.40 0.53 . *
. -0.60 0.60 Asp 95 . . . . T T . 0.68 0.43 . * . 0.20 0.96 Phe 96
. . . . T T . 0.67 0.41 . * . 0.20 0.80 Gly 97 . . . . T T . 0.59
0.63 * * F 0.35 0.75 Asn 98 . . . . T T . 0.59 0.29 * * F 0.65 0.24
Thr 99 . . . B T . . 0.07 0.69 * . . -0.20 0.48 Met 100 . . . B T .
. -0.74 0.59 * . . -0.20 0.40 Cys 101 . . B B . . . -0.36 0.84 * .
. -0.60 0.21 Gln 102 . . B B . . . -0.36 0.93 * . . -0.60 0.21 Leu
103 . . B B . . . -1.17 0.87 * . . -0.60 0.21 Leu 104 . . B B . . .
-1.10 0.94 . . . -0.60 0.32 Thr 105 . . B B . . . -1.20 1.13 * . .
-0.60 0.29 Gly 106 . . B B . . . -1.42 1.51 * . . -0.60 0.30 Leu
107 . . B B . . . -1.77 1.51 . . . -0.60 0.26 Tyr 108 . . B B . . .
-1.66 1.26 . . . -0.60 0.18 Phe 109 . . B B . . . -1.54 1.56 . . .
-0.60 0.15 Ile 110 . . B B . . . -1.53 1.91 . . . -0.60 0.16 Gly
111 . . B B . . . -1.53 1.61 . . . -0.60 0.14 Phe 112 . . B B . . .
-1.61 1.29 . . . -0.60 0.16 Phe 113 . . B B . . . -2.07 1.19 . . .
-0.60 0.16 Ser 114 . . . B . . C -2.07 1.29 . . . -0.40 0.14 Gly
115 . . . B . . C -2.07 1.64 . . . -0.40 0.14 Ile 116 . . . B . . C
-2.61 1.54 . . . -0.40 0.11 Phe 117 . . B B . . . -2.72 1.44 . . .
-0.60 0.06 Phe 118 . . B B . . . -2.83 1.74 . . . -0.60 0.05 Ile
119 . . B B . . . -2.84 2.00 . . . -0.60 0.06 Ile 120 . . B B . . .
-3.39 1.80 . * . -0.60 0.10 Leu 121 . . B B . . . -2.50 1.70 * . .
-0.60 0.08 Leu 122 . . B B . . . -1.69 0.91 * . . -0.60 0.18 Thr
123 A . . B . . . -1.23 0.23 * . . -0.30 0.52 Ile 124 A . . B . . .
-1.16 0.30 * . . -0.30 0.98 Asp 125 A . . . . T . -0.86 0.30 * . F
0.25 0.98 Arg 126 A . . . . T . -0.93 0.11 * . . 0.10 0.69 Tyr 127
A . . . . T . -0.98 0.31 * . . 0.10 0.69 Leu 128 A . . . . T .
-0.70 0.27 * . . 0.10 0.30 Ala 129 A . . B . . . -0.40 0.77 * . .
-0.60 0.21 Ile 130 A . . B . . . -1.26 1.27 * . . -0.60 0.14 Val
131 A . . B . . . -2.07 1.16 * . . -0.60 0.12 His 132 A . . B . . .
-2.41 1.26 . . . -0.60 0.11 Ala 133 A . . B . . . -2.41 1.26 . * .
-0.60 0.15 Val 134 A . . B . . . -1.78 1.26 . * . -0.60 0.17 Phe
135 A . . B . . . -1.48 0.61 . * . -0.60 0.25 Ala 136 A . . B . . .
-0.51 0.61 . * . -0.60 0.25 Leu 137 A . . B . . . -0.79 0.11 . * .
-0.30 0.65 Lys 138 A . . B . . . -1.06 -0.04 . * F 0.60 1.09 Ala
139 A . . B . . . -0.51 -0.19 . * F 0.45 0.80 Arg 140 A . . B . . .
-0.51 -0.20 . * F 0.60 1.40 Thr 141 . . B B . . . -0.27 -0.10 . * F
0.45 0.61 Val 142 . . B B . . . -0.31 0.33 . * . -0.30 0.59 Thr 143
. . B B . . . -1.21 0.47 . * . -0.60 0.23 Phe 144 . . B B . . .
-0.93 1.11 . . . -0.60 0.12 Gly 145 . . B B . . . -1.34 1.11 . . .
-0.60 0.23 Val 146 . . B B . . . -1.89 0.86 . . . -0.60 0.21 Val
147 . . B B . . . -1.92 1.01 . . . -0.60 0.18 Thr 148 . . B B . . .
-1.92 0.91 . . . -0.60 0.13 Ser 149 . . B B . . . -1.51 0.97 * . .
-0.60 0.25 Val 150 . . B B . . . -2.02 1.24 * . . -0.60 0.35 Ile
151 . . B B . . . -2.02 1.24 * . . -0.60 0.18 Thr 152 . . B B . . .
-1.76 1.40 * . . -0.60 0.10 Trp 153 . . B B . . . -2.30 1.51 * . .
-0.60 0.14 Val 154 . . B B . . . -2.70 1.51 * . . -0.60 0.14 Val
155 . . B B . . . -2.43 1.61 * . . -0.60 0.09 Ala 156 . . B B . . .
-1.84 1.63 * . . -0.60 0.08 Val 157 . . B B . . . -2.34 1.10 . . .
-0.60 0.15 Phe 158 . . B B . . . -2.27 1.14 . . . -0.60 0.17 Ala
159 . . B B . . . -1.76 0.93 . . . -0.60 0.25 Ser 160 . . . B . . C
-1.79 0.86 . . . -0.40 0.34 Leu 161 . . . B . . C -2.09 0.90 . . .
-0.40 0.27 Pro 162 . . . B . . C -1.93 0.80 . . . -0.40 0.19 Gly
163 . . . B T . . -1.54 1.09 * . . -0.20 0.12 Ile 164 . . B B . . .
-0.84 1.19 . . . -0.60 0.22 Ile 165 . . B B . . . -0.84 0.50 . * .
-0.60 0.27 Phe 166 . . B B . . . -0.03 0.46 . . . -0.26 0.37 Thr
167 . . B . . T . 0.22 0.43 * . F 0.63 0.91 Arg 168 . . B . . T .
0.57 -0.26 * . F 2.02 2.60 Ser 169 . . . . . T C 1.11 -0.94 * . F
2.86 5.21 Gln 170 . . . . T T . 1.19 -1.30 * . F 3.40 3.57 Lys 171
. . . . T . . 1.86 -1.10 * . F 2.86 1.50 Glu 172 . . . . T . . 1.92
-0.60 * . F 2.52 1.53 Gly 173 . . . B T . . 1.50 -0.23 * * F 1.68
1.38 Leu 174 . . B B . . . 1.13 -0.14 . . . 0.64 1.00 His 175 . . B
B . . . 0.83 0.43 . . . -0.60 0.31 Tyr 176 . . B B . . . 0.49 0.81
. . . -0.60 0.42 Thr 177 . . B B . . . 0.46 0.77 . * . -0.60 0.68
Cys 178 . . B . . T . 0.10 0.59 . * . -0.20 0.68 Ser 179 . . . . T
T . 0.70 0.87 . * . 0.20 0.38 Ser 180 . . . . T T . 0.49 0.54 . . .
0.20 0.40 His 181 . . . . T T . 0.43 0.81 . . . 0.35 1.18 Phe 182 .
. . . . T C 0.74 0.63 . . . 0.15 1.18 Pro 183 . . . . T T . 1.17
0.64 . . . 0.35 1.52 Tyr 184 . . . . T T . 1.47 1.01 . * . 0.35
1.75 Ser 185 . . . . T T . 1.07 0.91 . . . 0.35 3.50 Gln 186 . . B
B . . . 0.81 0.91 * . . -0.45 1.96 Tyr 187 . . . B T . . 1.56 1.40
* . . -0.05 1.31 Gln 188 . . . B T . . 1.77 0.64 * . . -0.05 1.96
Phe 189 . . . B T . . 1.31 0.66 * * . -0.05 1.82 Trp 190 . . . B T
. . 1.61 1.04 * * . -0.05 1.01 Lys 191 . . B B . . . 1.30 0.69 * *
. -0.45 1.01 Asn 192 . . . B T . . 0.73 0.77 * . . -0.05 1.68 Phe
193 . . . B T . . 0.78 0.67 * * . -0.05 1.32 Gln 194 A . . B . . .
0.59 -0.24 * . F 0.60 1.32 Thr 195 . . . B . . C 0.02 0.44 * * F
-0.25 0.57 Leu 196 . . B B . . . -0.91 0.69 * . . -0.60 0.49 Lys
197 . . B B . . . -1.72 0.59 . . . -0.60 0.20 Ile 198 . . B B . . .
-1.37 0.87 * . . -0.60 0.11 Val 199 . . B B . . . -2.18 0.81 * * .
-0.60 0.14 Ile 200 . . B B . . . -2.72 0.81 . * . -0.60 0.06 Leu
201 . . B B . . . -2.72 1.46 . * . -0.60 0.06 Gly 202 . . B B . . .
-2.98 1.46 . * . -0.60 0.07 Leu 203 . . B B . . . -2.90 1.24 . . .
-0.60 0.15 Val 204 . . B B . . . -2.86 1.24 . . . -0.60 0.15 Leu
205 . . B B . . . -2.82 1.24 . . . -0.60 0.12 Pro 206 . . B B . . .
-2.61 1.46 . . . -0.60 0.11 Leu 207 . . B B . . . -3.12 1.39 . . .
-0.60 0.15 Leu 208 . . B B . . . -3.20 1.39 . . . -0.60 0.13 Val
209 . . B B . . . -3.01 1.39 . . . -0.60 0.06 Met 210 . . B B . . .
-2.44 1.53 . . . -0.60 0.04 Val 211 . . B B . . . -2.53 1.60 . . .
-0.60 0.07 Ile 212 . . B B . . . -2.07 1.30 . . . -0.60 0.13 Cys
213 . . B . . T . -2.14 1.09 . . . -0.20 0.13 Tyr 214 . . B . . T .
-2.10 1.16 . . . -0.20 0.13 Ser 215 . . B . . T . -1.46 1.20 . . .
-0.20 0.15 Gly 216 . . B . . T . -0.91 0.51 * . . -0.20 0.55 Ile
217 . . B B . . . -0.83 0.43 . . . -0.60 0.51 Leu 218 . . B B . . .
-0.98 0.36 * * . -0.30 0.31 Lys 219 . . B B . . . -0.62 0.66 * * F
-0.45 0.26 Thr 220 . . B B . . . -0.99 0.23 * * . -0.30 0.73 Leu
221 . . B B . . . -0.53 0.11 * * . -0.30 0.47 Leu 222 A . . B . . .
0.36 -0.57 * * . 0.60 0.46 Arg 223 A . . B . . . 1.17 -0.17 * * .
0.30 0.52 Cys 224 A . . . . T . 1.17 -0.66 . * . 1.15 1.08 Arg 225
A . . . . T . 1.52 -1.34 * * F 1.30 2.63 Asn 226 A . . . . T . 2.44
-2.03 * * F 1.30 2.68 Glu 227 A . . . . T . 3.22 -2.03 . * F 1.30
9.80 Lys 228 A . . . . . . 3.22 -2.10 . * F 1.10 6.81 Lys 229 A . .
. . . . 3.30 -2.10 * * F 1.10 8.29 Arg 230 A . . . . . . 2.33 -2.00
* . F 1.10 4.83 His 231 A . . B . . . 2.44 -1.36 * * . 0.75 1.79
Arg 232 A . . B . . . 1.63 -1.36 * . . 0.75 1.76 Ala 233 A . . B .
. . 0.70 -0.67 * * . 0.60 0.74 Val 234 A . . B . . . -0.04 0.01 * .
. -0.30 0.38 Arg 235 A . . B . . . -0.47 0.30 * * . -0.30 0.17 Leu
236 . . B B . . . -1.32 0.79 * * . -0.60 0.24 Ile 237 . . B B . . .
-2.03 0.97 * * . -0.60 0.23 Phe 238 . . B B . . . -2.33 0.94 * * .
-0.60 0.11 Thr 239 . . B B . . . -2.33 1.63 * * . -0.60 0.10 Ile
240 . . B B . . . -2.69 1.59 * * . -0.60 0.10 Met 241 . . B B . . .
-2.58 1.66 . . . -0.60 0.19 Ile 242 . . B B . . . -2.50 1.66 . . .
-0.60 0.11 Val 243 . . B B . . . -2.50 1.86 . . . -0.60 0.13 Tyr
244 . . B B . . . -2.48 1.96 . . . -0.60 0.12 Phe 245 . . B B . . .
-2.18 2.26 . . . -0.60 0.17
Leu 246 . . B B . . . -1.79 2.07 . . . -0.60 0.24 Phe 247 . . . B T
. . -1.14 1.86 . . . -0.20 0.23 Trp 248 . . . B . . C -0.29 1.86 .
* . -0.40 0.42 Ala 249 . . . . . T C -0.93 1.47 . . . 0.00 0.82 Pro
250 . . . . . T C -1.09 1.47 . * . 0.00 0.67 Tyr 251 . . . . T T .
-1.09 1.33 . . . 0.20 0.47 Asn 252 . . B . . T . -1.20 1.10 . * .
-0.20 0.38 Ile 253 . . B B . . . -1.72 1.29 . * . -0.60 0.20 Val
254 . . B B . . . -1.13 1.54 . * . -0.60 0.11 Leu 255 . . B B . . .
-1.23 1.19 * . . -0.60 0.11 Leu 256 . . B B . . . -1.69 1.27 * . .
-0.60 0.22 Leu 257 . . B B . . . -1.69 1.37 * . . -0.60 0.26 Asn
258 . . B B . . . -0.80 1.13 * . . -0.60 0.54 Thr 259 A . . B . . .
-0.64 0.44 * . . -0.45 1.14 Phe 260 A . . B . . . -0.53 0.54 * . .
-0.45 1.20 Gln 261 . . B B . . . -0.07 0.64 * . . -0.60 0.64 Glu
262 . . B B . . . -0.07 0.67 * . . -0.60 0.44 Phe 263 . . B . . . .
-0.07 0.87 * . . -0.40 0.42 Phe 264 . . . . T . . 0.24 0.49 . . .
0.00 0.39 Gly 265 . . . . T . . 0.28 0.49 . . . 0.00 0.36 Leu 266 .
. . . T . . -0.02 1.06 . . . 0.00 0.22 Asn 267 . . . . T . . -0.32
0.66 . . . 0.00 0.35 Asn 268 . . . . T . . 0.08 0.26 . . F 0.45
0.47 Cys 269 . . . . T T . 0.78 0.21 * * F 0.65 0.76 Ser 270 . . .
. T T . 1.23 -0.07 * * F 1.25 0.76 Ser 271 . . . . T T . 1.23 -0.47
. * F 1.25 0.93 Ser 272 . . . . . T C 1.23 -0.19 * * F 1.20 1.43
Asn 273 . A . . T . . 1.23 -0.76 . * F 1.30 1.79 Arg 274 . A . . T
. . 1.31 -0.74 * * F 1.30 2.31 Leu 275 A A . . . . . 1.01 -0.63 * *
F 0.90 1.74 Asp 276 A A . . . . . 1.31 -0.40 * * F 0.60 1.07 Gln
277 A A . . . . . 0.76 -0.40 * * . 0.30 0.95 Ala 278 A . . B . . .
0.44 0.24 * * . -0.30 0.85 Met 279 . . B B . . . 0.33 0.04 * * .
-0.30 0.74 Gln 280 . . B B . . . 0.83 0.04 * * . -0.30 0.74 Val 281
. . B B . . . 0.02 0.13 * . . -0.15 1.05 Thr 282 A . . B . . .
-0.32 0.31 * . F -0.15 0.88 Glu 283 A . . B . . . -0.33 0.13 * . F
-0.15 0.50 Thr 284 A . . B . . . -0.04 0.34 . * F -0.15 0.67 Leu
285 A . . B . . . -0.08 0.19 . . . -0.30 0.67 Gly 286 . . . B T . .
0.11 0.20 . . . 0.10 0.52 Met 287 . . . B T . . -0.24 0.77 . . .
-0.20 0.19 Thr 288 . . B B . . . -1.13 0.86 . . . -0.60 0.13 His
289 . . B B . . . -0.82 0.86 . . . -0.60 0.09 Cys 290 . . B B . . .
-0.22 0.83 . . . -0.60 0.15 Cys 291 . . B B . . . -0.77 0.64 . . .
-0.60 0.16 Ile 292 . . B B . . . -1.06 0.84 . . . -0.60 0.08 Asn
293 . . B B . . . -0.99 1.03 * * . -0.60 0.11 Pro 294 . . B B . . .
-1.54 1.21 * . . -0.60 0.31 Ile 295 . A B B . . . -1.58 1.14 * . .
-0.60 0.44 Ile 296 . A B B . . . -1.77 1.24 * . . -0.60 0.24 Tyr
297 . A B B . . . -1.22 1.49 * . . -0.60 0.11 Ala 298 . A B B . . .
-1.22 1.49 . . . -0.60 0.16 Phe 299 . A B B . . . -0.97 0.80 . . .
-0.60 0.40 Val 300 . A B B . . . -0.78 0.11 * * . -0.30 0.51 Gly
301 A A . B . . . 0.22 0.14 * * F -0.15 0.44 Glu 302 A A . . . . .
0.47 -0.36 * * F 0.45 0.99 Lys 303 A A . . . . . 0.81 -0.74 * * F
0.90 2.14 Phe 304 A . . . . T . 0.70 -0.63 * * F 1.30 3.39 Arg 305
A . . . . T . 0.74 -0.37 * * . 0.85 1.62 Asn 306 A . . . . T . 0.23
0.31 * * . 0.10 0.67 Tyr 307 A . . . . T . -0.47 0.96 * * . -0.20
0.57 Leu 308 A . . B . . . -1.21 0.96 * * . -0.60 0.25 Leu 309 A .
. B . . . -0.51 1.74 * * . -0.60 0.14 Val 310 A . . B . . . -0.58
1.74 . . . -0.60 0.15 Phe 311 A . . B . . . -0.61 0.99 * . . -0.60
0.36 Phe 312 A . . B . . . -1.26 0.80 * . . -0.60 0.60 Gln 313 A .
. B . . . -1.03 0.80 * . . -0.60 0.57 Lys 314 A . . B . . . -0.18
0.66 * . . -0.60 0.66 His 315 A A . . . . . 0.79 -0.13 * * . 0.45
1.53 Ile 316 A A . . . . . 0.79 -0.91 * . . 0.75 1.73 Ala 317 A A .
. . . . 0.82 -0.53 * . . 0.88 0.75 Lys 318 A A . . . . . 0.87 0.04
* . . 0.26 0.30 Arg 319 . A . . T . . 0.16 -0.46 * . . 1.54 0.84
Phe 320 . A . . T . . -0.48 -0.57 * . . 2.12 0.45 Cys 321 . . . . T
T . 0.11 -0.50 * . . 2.80 0.12 Lys 322 . . . . T T . -0.19 -0.11 *
. . 2.22 0.08 Cys 323 . . . . T T . -0.93 0.57 * . . 1.04 0.07 Cys
324 . . . . T T . -1.04 0.57 * . . 0.76 0.11 Ser 325 . A . . T . .
-0.34 0.40 * . . 0.38 0.09 Ile 326 . A B . . . . 0.32 0.80 * . .
-0.60 0.30 Phe 327 . A B . . . . -0.31 0.23 * . . -0.30 0.97 Gln
328 A A . . . . . 0.14 0.16 . . F -0.15 0.73 Gln 329 A A . . . . .
0.81 0.20 . * F 0.00 1.61 Glu 330 A A . . . . . 1.22 -0.49 . * F
0.60 3.22 Ala 331 . A . . . . C 1.52 -1.27 . * F 1.10 3.64 Pro 332
A A . . . . . 1.92 -1.17 * * F 0.90 2.13 Glu 333 A A . . . . . 1.62
-1.19 * * F 0.90 1.64 Arg 334 A A . . . . . 0.77 -0.80 * . F 0.90
2.18 Ala 335 A A . B . . . 0.52 -0.66 * * F 0.90 1.05 Ser 336 . A B
B . . . 0.80 -0.33 * * F 0.45 0.95 Ser 337 . . B B . . . 1.12 0.16
* . F -0.15 0.70 Val 338 . . B B . . . 0.82 0.16 * * . -0.15 1.35
Tyr 339 . . B B . . . 0.40 0.04 * * F 0.30 1.35 Thr 340 . . B B . .
. 0.64 0.14 * * F 0.60 1.46 Arg 341 . . . B . . C 0.94 0.19 . * F
1.10 1.94 Ser 342 . . . . . T C 1.24 -0.46 . * F 2.40 2.15 Thr 343
. . . . . T C 2.10 -0.81 . * F 3.00 2.58 Gly 344 . . . . . T C 1.46
-1.30 . * F 2.70 2.28 Glu 345 . . . . . T C 1.47 -0.61 . * F 2.40
1.19 Gln 346 . . B B . . . 0.50 -0.61 . * F 1.50 1.11 Glu 347 . . B
B . . . 0.46 -0.46 . * F 0.75 0.83 Ile 348 . . B B . . . -0.04
-0.46 . * F 0.45 0.47 Ser 349 . . B B . . . -0.09 0.23 . * . -0.30
0.23 Val 350 . . B B . . . -0.48 0.26 . * . -0.30 0.17 Gly 351 . .
B B . . . -0.87 0.69 . * . -0.60 0.30 Leu 352 A . . B . . . -1.26
0.43 . * . -0.60 0.29
[0261] Among highly preferred fragments in this regard are those
that comprise regions of G-protein Chemokine Receptor (CCR5) that
combine several structural features, such as several of the
features set out above.
[0262] Other preferred polypeptide fragments are biologically
active G-protein Chemokine Receptor (CCR5) fragments. Biologically
active fragments are those exhibiting activity similar, but not
necessarily identical, to an activity of the G-protein Chemokine
Receptor (CCR5) polypeptide. The biological activity of the
fragments may include an improved desired activity, or a decreased
undesirable activity. Polynucleotides encoding these polypeptide
fragments are also encompassed by the invention.
[0263] However, many polynucleotide sequences, such as EST
sequences, are publicly available and accessible through sequence
databases. Some of these sequences are related to SEQ ID NO:1 or to
the deposited clone and may have been publicly available prior to
conception of the present invention. Preferably, such related
polynucleotides are specifically excluded from the scope of the
present invention. To list every related sequence would be
cumbersome. Accordingly, preferably excluded from the present
invention are one or more polynucleotides comprising a nucleotide
sequence described by the general formula of a-b, where a is any
integer between 1 to 1400 of SEQ ID NO:1, b is an integer of 15 to
1414, where both a and b correspond to the positions of nucleotide
residues shown in SEQ ID NO:1 or of the deposited clone, and where
the b is greater than or equal to a+14.
Epitopes and Antibodies
[0264] The present invention encompasses polypeptides comprising,
or alternatively consisting of, an epitope of the polypeptide
having an amino acid sequence of SEQ ID NO:2, or an epitope of the
polypeptide sequence encoded by a polynucleotide sequence contained
in ATCC.TM. Deposit No: 97183 or encoded by a polynucleotide that
hybridizes to the complement of the sequence of SEQ ID NO:1 or
contained in ATCC.TM. Deposit No: 97183 under stringent
hybridization conditions or lower stringency hybridization
conditions as defined supra. The present invention further
encompasses polynucleotide sequences encoding an epitope of a
polypeptide sequence of the invention (such as, for example, the
sequence disclosed in SEQ ID NO:1 or the sequence of the deposited
clone), polynucleotide sequences of the complementary strand of a
polynucleotide sequence encoding an epitope of the invention, and
polynucleotide sequences which hybridize to the complementary
strand under stringent hybridization conditions or lower stringency
hybridization conditions defined supra.
[0265] The term "epitopes," as used herein, refers to portions of a
polypeptide having antigenic or immunogenic activity in an animal,
preferably a mammal, and most preferably in a human. In a preferred
embodiment, the present invention encompasses a polypeptide
comprising an epitope, as well as the polynucleotide encoding this
polypeptide. An "immunogenic epitope," as used herein, is defined
as a portion of a protein that elicits an antibody response in an
animal, as determined by any method known in the art, for example,
by the methods for generating antibodies described infra. (See, for
example, Geysen et al., Proc. Natl. Acad. Sci. USA 81:3998-4002
(1983)). The term "antigenic epitope," as used herein, is defined
as a portion of a protein to which an antibody can
immunospecifically bind its antigen as determined by any method
well known in the art, for example, by the immunoassays described
herein. Immunospecific binding excludes non-specific binding but
does not necessarily exclude cross-reactivity with other antigens.
Antigenic epitopes need not necessarily be immunogenic. Either the
full-length protein or an antigenic peptide fragment can be used.
Regions having a high antigenicity index are shown in Table 1 and
FIG. 3.
[0266] Antibodies are preferably prepared from these regions or
from discrete fragments in these regions. However, antibodies can
be prepared from any region of the peptide as described herein. A
preferred fragment produces an antibody that diminishes or
completely prevents ligand binding. Antibodies can be developed
against the entire receptor or portions of the receptor, for
example, the intracellular carboxy terminal domain, the amino
terminal extracellular domain, the entire transmembrane domain or
specific transmembrane segments, any of the intracellular or
extracellular loops, or any portions of these regions. Antibodies
may also be developed against specific functional sites, such as
the site of ligand binding, the site of G-protein coupling, or
sites that are glycosylated, phosphorylated, myristoylated, or
amidated.
[0267] Fragments which function as epitopes may be produced by any
conventional means. (See, e.g., Houghten, Proc. Natl. Acad. Sci.
USA 82:5131-5135 (1985), further described in U.S. Pat. No.
4,631,211).
[0268] In the present invention, antigenic epitopes preferably
contain a sequence of at least 4, at least 5, at least 6, at least
7, more preferably at least 8, at least 9, at least 10, at least
11, at least 12, at least 13, at least 14, at least 15, at least
20, at least 25, at least 30, at least 40, at least 50, and, most
preferably, between about 15 to about 30 amino acids. Preferred
polypeptides comprising immunogenic or antigenic epitopes are at
least 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80,
85, 90, 95, or 100 amino acid residues in length. Additional
non-exclusive preferred antigenic epitopes include the antigenic
epitopes disclosed herein, as well as portions thereof. Antigenic
epitopes are useful, for example, to raise antibodies, including
monoclonal antibodies, that specifically bind the epitope.
Preferred antigenic epitopes include the antigenic epitopes
disclosed herein, as well as any combination of two, three, four,
five or more of these antigenic epitopes. Antigenic epitopes can be
used as the target molecules in immunoassays. (See, for instance,
Wilson et al., Cell 37:767-778 (1984); Sutcliffe et al., Science
219:660-666 (1983)). These fragments are not to be construed,
however, as encompassing any fragments which may be disclosed prior
to the invention.
[0269] Similarly, immunogenic epitopes can be used, for example, to
induce antibodies according to methods well known in the art. (See,
for instance, Sutcliffe et al., supra; Wilson et al., supra; Chow
et al., Proc. Natl. Acad. Sci. USA 82:910-914; and Bittle et al.,
J. Gen. Virol. 66:2347-2354 (1985). Preferred immunogenic epitopes
include the immunogenic epitopes disclosed herein, as well as any
combination of two, three, four, five or more of these immunogenic
epitopes. The polypeptides comprising one or more immunogenic
epitopes may be presented for eliciting an antibody response
together with a carrier protein, such as an albumin, to an animal
system (such as rabbit or mouse), or, if the polypeptide is of
sufficient length (at least about 25 amino acids), the polypeptide
may be presented without a carrier. However, immunogenic epitopes
comprising as few as 8 to 10 amino acids have been shown to be
sufficient to raise antibodies capable of binding to, at the very
least, linear epitopes in a denatured polypeptide (e.g., in Western
blotting).
[0270] Epitope-bearing polypeptides of the present invention may be
used to induce antibodies according to methods well known in the
art including, but not limited to, in vivo immunization, in vitro
immunization, and phage display methods. See, e.g., Sutcliffe et
al., supra; Wilson et al., supra, and Bittle et al., J. Gen.
Virol., 66:2347-2354 (1985). If in vivo immunization is used,
animals may be immunized with free peptide; however, anti-peptide
antibody titer may be boosted by coupling the peptide to a
macromolecular carrier, such as keyhole limpet hemacyanin (KLH) or
tetanus toxoid. For instance, peptides containing cysteine residues
may be coupled to a carrier using a linker such as
maleimidobenzoyl-N-hydroxysuccinimide ester (MBS), while other
peptides may be coupled to carriers using a more general linking
agent such as glutaraldehyde.
[0271] Epitope bearing peptides of the invention may also be
synthesized as multiple antigen peptides (MAPs), first described by
J. P. Tam in Proc. Natl. Acad. Sci. U.S.A. 85:5409 which is
incorporated by reference herein in its entirety. MAPs consist of
multiple copies of a specific peptide attached to a non-immunogenic
lysine core. Map peptides usually contain four or eight copies of
the peptide often referred to as MAP-4 or MAP-8 peptides. By way of
non-limiting example, MAPs may be synthesized onto a lysine core
matrix attached to a polyethylene glycol-polystyrene (PEG-PS)
support. The peptide of interest is synthesized onto the lysine
residues using 9-fluorenylmethoxycarbonyl (Fmoc) chemistry. For
example, Applied Biosystems (Foster City, Calif.) offers MAP
resins, such as, for example, the Fmoc Resin 4 Branch and the Fmoc
Resin 8 Branch which can be used to synthesize MAPs. Cleavage of
MAPs from the resin is performed with standard trifloroacetic acid
(TFA)-based cocktails known in the art. Purification of MAPs,
except for desalting, is not necessary. MAP peptides may be used as
an immunizing vaccine which elicits antibodies that recognize both
the MAP and the native protein from which the peptide was
derived.
[0272] Epitope bearing peptides of the invention may also be
incorporated into a coat protein of a virus which can then be used
as an immunogen or a vaccine with which to immunize animals,
including humans, in order encourage the production of anti-epitope
antibodies. For example, the V3 loop of the gp120 glycoprotein of
the human immunodeficiency virus type 1 (HIV-1) has been engineered
to be expressed on the surface of rhinovirus. Immunization with
this rhinovirus displaying the V3 loop peptide yielded apparently
effective mimics of the HIV-1 immunogens (as measured by their
ability to be neutralized by anti-HIV-1 antibodies as well as their
ability to elicit the production of antibodies capable of
neutralizing HIV-1 in cell culture). This techniques of using
engineered viral particles as an immunogen is described in more
detail in Smith et al., Behring Inst Mitt February; (98):229-39
(1997), Smith et al, J Virol 72:651-9 (1998), and Zhang et al.,
Biol Chem 380:365-74 (1999), which are hereby incorporated by
reference herein in their entireties.
[0273] Epitope bearing polypeptides of the invention may be
modified, for example, by the addition of amino acids at the amino-
and/or carboxy-termini of the peptide. Such modifications may be
performed, for example, to alter the conformation of the epitope
bearing polypeptide such that the epitope will have a conformation
more closely related to the structure of the epitope in the native
protein. An example of a modified epitope-bearing polypeptide of
the invention is a polypeptide in which one or more cysteine
residues have been added to the polypeptide to allow for the
formation of a disulfide bond between two cysteines, resulting in a
stable loop structure of the epitope bearing polypeptide under
non-reducing conditions. Disulfide bonds may form between a
cysteine residue added to the polypeptide and a cysteine residue of
the naturally occurring epitope, or may form between two cysteines
which have both been added to the naturally occurring epitope
bearing polypeptide. Additionally, it is possible to modify one or
more amino acid residues of the naturally occurring epitope bearing
polypeptide by substituting them with cysteines to promote the
formation of disulfide bonded loop structures. Cyclic thioether
molecules of synthetic peptides may be routinely generated using
techniques known in the art and are described in PCT publication WO
97/46251, incorporated in its entirety by reference herein. Other
modifications of epitope-bearing polypeptides contemplated by this
invention include biotinylation.
[0274] Animals such as rabbits, rats and mice are immunized with
either free or carrier-coupled peptides or MAP peptides, for
instance, by intraperitoneal and/or intradermal injection of
emulsions containing about 100 .mu.g of peptide or carrier protein
and Freund's adjuvant or any other adjuvant known for stimulating
an immune response. Several booster injections may be needed, for
instance, at intervals of about two weeks, to provide a useful
titer of anti-peptide antibody which can be detected, for example,
by ELISA assay using free peptide adsorbed to a solid surface. The
titer of anti-peptide antibodies in serum from an immunized animal
may be increased by selection of anti-peptide antibodies, for
instance, by adsorption to the peptide on a solid support and
elution of the selected antibodies according to methods well known
in the art.
[0275] As one of skill in the art will appreciate, and as discussed
above, the polypeptides of the present invention comprising an
immunogenic or antigenic epitope can be fused to other polypeptide
sequences. For example, the polypeptides of the present invention
may be fused with the constant domain of immunoglobulins (IgA, IgE,
IgG, IgM), or portions thereof (CH1, CH2, CH3, or any combination
thereof and portions thereof) or albumin (including but not limited
to recombinant human albumin or fragments or variants thereof (see,
e.g., U.S. Pat. No. 5,876,969, issued Mar. 2, 1999, EP Patent 0 413
622, and U.S. Pat. No. 5,766,883, issued Jun. 16, 1998, herein
incorporated by reference in their entirety)), resulting in
chimeric polypeptides. Such fusion proteins may facilitate
purification and may increase half-life in vivo. This has been
shown for chimeric proteins consisting of the first two domains of
the human CD4-polypeptide and various domains of the constant
regions of the heavy or light chains of mammalian immunoglobulins.
See, e.g., EP 394,827; Traunecker et al., Nature, 331:84-86 (1988).
Enhanced delivery of an antigen across the epithelial barrier to
the immune system has been demonstrated for antigens (e.g.,
insulin) conjugated to an FcRn binding partner such as IgG or Fc
fragments (see, e.g., PCT Publications WO 96/22024 and WO
99/04813). IgG Fusion proteins that have a disulfide-linked dimeric
structure due to the IgG portion disulfide bonds have also been
found to be more efficient in binding and neutralizing other
molecules than monomeric polypeptides or fragments thereof alone.
See, e.g., Fountoulakis et al., J. Biochem., 270:3958-3964 (1995).
Nucleic acids encoding the above epitopes can also be recombined
with a gene of interest as an epitope tag (e.g., the hemagglutinin
("HA") tag or flag tag) to aid in detection and purification of the
expressed polypeptide. For example, a system described by Janknecht
et al. allows for the ready purification of non-denatured fusion
proteins expressed in human cell lines (Janknecht et al., 1991,
Proc. Natl. Acad. Sci. USA 88:8972-897). In this system, the gene
of interest is subcloned into a vaccinia recombination plasmid such
that the open reading frame of the gene is translationally fused to
an amino-terminal tag consisting of six histidine residues. The tag
serves as a matrix binding domain for the fusion protein. Extracts
from cells infected with the recombinant vaccinia virus are loaded
onto Ni2+ nitriloacetic acid-agarose column and histidine-tagged
proteins can be selectively eluted with imidazole-containing
buffers.
[0276] Additional fusion proteins of the invention may be generated
through the techniques of gene-shuffling, motif-shuffling,
exon-shuffling, and/or codon-shuffling (collectively referred to as
"DNA shuffling"). DNA shuffling may be employed to modulate the
activities of polypeptides of the invention, such methods can be
used to generate polypeptides with altered activity, as well as
agonists and antagonists of the polypeptides. See, generally, U.S.
Pat. Nos. 5,605,793; 5,811,238; 5,830,721; 5,834,252; and
5,837,458, and Patten et al., Curr. Opinion Biotechnol. 8:724-33
(1997); Harayama, Trends Biotechnol. 16(2):76-82 (1998); Hansson,
et al., J. Mol. Biol. 287:265-76 (1999); and Lorenzo and Blasco,
Biotechniques 24(2):308-13 (1998) (each of these patents and
publications are hereby incorporated by reference in its entirety).
In one embodiment, alteration of polynucleotides corresponding to
SEQ ID NO:1 and the polypeptides encoded by these polynucleotides
may be achieved by DNA shuffling. DNA shuffling involves the
assembly of two or more DNA segments by homologous or site-specific
recombination to generate variation in the polynucleotide sequence.
In another embodiment, polynucleotides of the invention, or the
encoded polypeptides, may be altered by being subjected to random
mutagenesis by error-prone PCR, random nucleotide insertion or
other methods prior to recombination. In another embodiment, one or
more components, motifs, sections, parts, domains, fragments, etc.,
of a polynucleotide encoding a polypeptide of the invention may be
recombined with one or more components, motifs, sections, parts,
domains, fragments, etc. of one or more heterologous molecules.
Antibodies
[0277] Further polypeptides of the invention relate to antibodies
and T-cell antigen receptors (TCR) which immunospecifically bind a
polypeptide, polypeptide fragment, or variant of SEQ ID NO:2 or of
the polypeptide encoded by the deposited clone, and/or an epitope,
of the present invention (as determined by immunoassays well known
in the art for assaying specific antibody-antigen binding).
[0278] The basic antibody structural unit is known to comprise a
tetramer. Each tetramer is composed of two identical pairs of
polypeptide chains, each pair having one "light" (about 25 kDa) and
one "heavy" chain (about 50-70 kDa). The amino-terminal portion of
each chain includes a variable region of about 100 to 110 or more
amino acids primarily responsible for antigen recognition. The
carboxy-terminal portion of each chain defines a constant region
primarily responsible for effector function. Human light chains are
classified as kappa and lambda light chains. Heavy chains are
classified as mu, delta, gamma, alpha, or epsilon, and define the
antibody's isotype as IgM, IgD, IgG, IgA, and IgE, respectively.
See generally, Fundamental Immunology Ch. 7 (Paul, W., ed., 2nd ed.
Raven Press, N.Y. (1989)) (incorporated by reference in its
entirety for all purposes). The variable regions of each
light/heavy chain pair form the antibody binding site.
[0279] Thus, an intact IgG antibody has two binding sites. Except
in bifunctional or bispecific antibodies, the two binding sites are
the same.
[0280] The chains all exhibit the same general structure of
relatively conserved framework regions (FR) joined by three hyper
variable regions, also called complementarity determining regions
or CDRs. The CDRs from the heavy and the light chains of each pair
are aligned by the framework regions, enabling binding to a
specific epitope. From N-terminal to C-terminal, both light and
heavy chains comprise the domains FR1, CDR1, FR2, CDR2, FR3, CDR3
and FR4. The assignment of amino acids to each domain is in
accordance with the definitions of Kabat Sequences of Proteins of
Immunological Interest (National Institutes of Health, Bethesda,
Md. (1987 and 1991)), or Chothia & Lesk J Mol. Biol.
196:901-917 (1987); Chothia et al. Nature 342:878-883 (1989).
[0281] A bispecific or bifunctional antibody is an artificial
hybrid antibody having two different heavy/light chain pairs and
two different binding sites. Bispecific antibodies can be produced
by a variety of methods including fusion of hybridomas or linking
of Fab' fragments. See, e.g., Songsivilai & Lachmann Clin. Exp.
Immunol. 79: 315-321 (1990), Kostelny et al. J Immunol. 148:1547
1553 (1992). In addition, bispecific antibodies may be formed as
"diabodies" (Holliger et al. "`Diabodies`: small bivalent and
bispecific antibody fragments" PNAS USA 90:6444-6448 (1993)) or
"Janusins" (Traunecker et al. "Bispecific single chain molecules
(Janusins) target cytotoxic lymphocytes on HIV infected cells" EMBO
J 10:3655-3659 (1991) and Traunecker et al. "Janusin: new molecular
design for bispecific reagents" Int J Cancer Suppl 7:51-52
(1992)).
[0282] Antibodies of the invention include, but are not limited to,
polyclonal, monoclonal, multispecific, human, humanized or chimeric
antibodies, single chain antibodies, Fab fragments, F(ab')
fragments, fragments produced by a Fab expression library,
anti-idiotypic (anti-Id) antibodies (including, e.g., anti-Id
antibodies to antibodies of the invention), intracellularly-made
antibodies (i.e., intrabodies), and epitope-binding fragments of
any of the above. The term "antibody," as used herein, refers to
immunoglobulin molecules and immunologically active portions or
fragments of immunoglobulin molecules, i.e., molecules that contain
an antigen binding site that immunospecifically binds an antigen.
The immunoglobulin molecules of the invention can be of any type
(e.g., IgG, IgE, IgM, IgD, IgA and IgY), class (e.g., IgG1, IgG2,
IgG3, IgG4, IgA1 and IgA2) or subclass of immunoglobulin molecule.
In a preferred embodiment, the immunoglobulin is an IgM isotype. In
a preferred embodiment, the immunoglobulin is an IgG1 isotype. In
another preferred embodiment, the immunoglobulin is an IgG2
isotype. In another preferred embodiment, the immunoglobulin is an
IgG4 isotype. Immunoglobulins may have both a heavy and light
chain. An array of IgG, IgE, IgM, IgD, IgA, and IgY heavy chains
may be paired with a light chain of the kappa or lambda forms.
[0283] Most preferably the antibodies are human antigen-binding
antibody fragments of the present invention and include, but are
not limited to, Fab, Fab' and F(ab')2, Fd, single-chain Fvs (scFv),
single-chain antibodies, disulfide-linked Fvs (sdFv) and fragments
comprising either a VL or VH domain. Antigen-binding antibody
fragments, including single-chain antibodies, may comprise the
variable region(s) alone or in combination with the entirety or a
portion of the following: hinge region, CH1, CH2, and CH3 domains.
Also included in the invention are antigen-binding fragments also
comprising any combination of variable region(s) with a hinge
region, CH1, CH2, and CH3 domains. The antibodies of the invention
may be from any animal origin including birds and mammals.
Preferably, the antibodies are human, murine (e.g., mouse and rat),
donkey, ship rabbit, goat, guinea pig, camel, horse, or chicken. As
used herein, "human" antibodies include antibodies having the amino
acid sequence of a human immunoglobulin and include antibodies
isolated from human immunoglobulin libraries or from animals
transgenic for one or more human immunoglobulin and that do not
express endogenous immunoglobulins, as described infra and, for
example in, U.S. Pat. No. 5,939,598 by Kucherlapati et al.
[0284] The antibodies of the present invention may be monospecific,
bispecific, trispecific or of greater multispecificity.
Multispecific antibodies may be specific for different epitopes of
a polypeptide of the present invention or may be specific for both
a polypeptide of the present invention as well as for a
heterologous epitope, such as a heterologous polypeptide or solid
support material. See, e.g., PCT publications WO 93/17715; WO
92/08802; WO 91/00360; WO 92/05793; Tutt, et al., J. Immunol.
147:60-69 (1991); U.S. Pat. Nos. 4,474,893; 4,714,681; 4,925,648;
5,573,920; 5,601,819; Kostelny et al., J. Immunol. 148:1547-1553
(1992).
[0285] Antibodies of the present invention may be described or
specified in terms of the epitope(s) or portion(s) of a polypeptide
of the present invention which they recognize or specifically bind.
The epitope(s) or polypeptide portion(s) may be specified as
described herein, e.g., by N-terminal and C-terminal positions, by
size in contiguous amino acid residues, or listed in the Tables and
Figures. Preferred epitopes of the invention include: Thr16-Val25,
Gln59-Thr65, Thr167-Leu174, Ser 179-Ser185, Leu222-Ala233,
Asn268-Gln277, His315-Ser325, Glu330-Ser336, Tyr339-Ile348 of SEQ
ID NO:2 or of the polypeptide encoded by the deposited clone, as
well as polynucleotides that encode these epitopes. Even more
preferred epitopes of the invention include peptides corresponding
the extracellular loops of the G-protein Chemokine Receptor (CCR5)
of the invention or fragments and variants thereof, e.g., amino
acids 89-102, 167-195 and/or 261-274 of SEQ ID NO:2 or of the
polypeptide encoded by the deposited clone. Antibodies which
specifically bind any epitope or polypeptide of the present
invention may also be excluded. Therefore, the present invention
includes antibodies that specifically bind polypeptides of the
present invention, and allows for the exclusion of the same.
[0286] Antibodies of the present invention may also be described or
specified in terms of their cross-reactivity. Antibodies that do
not bind any other analog, ortholog, or homolog of a polypeptide of
the present invention are included. Antibodies that bind
polypeptides with at least 95%, at least 90%, at least 85%, at
least 80%, at least 75%, at least 70%, at least 65%, at least 60%,
at least 55%, and at least 50% identity (as calculated using
methods known in the art and described herein) to a polypeptide of
the present invention are also included in the present invention.
In specific embodiments, antibodies of the present invention
cross-react with murine, monkey, rat and/or rabbit homologs of
human proteins and the corresponding epitopes thereof. Antibodies
that do not bind polypeptides with less than 95%, less than 90%,
less than 85%, less than 80%, less than 75%, less than 70%, less
than 65%, less than 60%, less than 55%, and less than 50% identity
(as calculated using methods known in the art and described herein)
to a polypeptide of the present invention are also included in the
present invention. In a specific embodiment, the above-described
cross-reactivity is with respect to any single specific antigenic
or immunogenic polypeptide, or combination(s) of 2, 3, 4, 5, or
more of the specific antigenic and/or immunogenic polypeptides
disclosed herein. Further included in the present invention are
antibodies which bind polypeptides encoded by polynucleotides which
hybridize to a polynucleotide of the present invention under
stringent hybridization conditions (as described herein).
[0287] The antibodies of the invention (including molecules
comprising, or alternatively consisting of, antibody fragments or
variants thereof) may bind immunospecifically to that
immunospecifically bind to a polypeptide or polypeptide fragment or
variant of human G-protein Chemokine Receptor (CCR5) (SEQ ID NO:2
or of the polypeptide encoded by the deposited clone) and/or monkey
G-protein Chemokine Receptor (CCR5). Preferably, the antibodies of
the invention bind immunospecifically to human G-protein Chemokine
Receptor. Preferably, the antibodies of the invention bind
immunospecifically to human and monkey G-protein Chemokine
Receptor. Also preferably, the antibodies of the invention bind
immunospecifically to human G-protein Chemokine Receptor (CCR5) and
murine G-protein Chemokine Receptor. More preferably, antibodies of
the invention, bind immunospecifically and with higher affinity to
human G-protein Chemokine Receptor (CCR5) than to murine G-protein
Chemokine Receptor.
[0288] In preferred embodiments, the antibodies of the present
invention (including molecules comprising, or alternatively
consisting of, antibody fragments or variants thereof),
immunospecifically bind to G-protein Chemokine Receptor (CCR5) and
do not cross-react with any other antigens. In preferred
embodiments, the antibodies of the invention immunospecifically
bind to G-protein Chemokine Receptor (CCR5) and do not cross-react
with other chemokine receptors such as, for example, US28, CCR1,
CCR2, CCR3, CCR4, CCR6, CCR7, CCR8, CCR9, CXCR1, CXCR2, CXCR3,
CXCR4, and/or CXCR5.
[0289] In other preferred embodiments, the antibodies of the
invention immunospecifically bind to G-protein Chemokine Receptor
(CCR5) and cross-react with other chemokine receptors such as, for
example, US28, CCR1, CCR2, CCR3, CCR4, CCR6, CCR7, CCR8, CCR9,
CXCR1, CXCR2, CXCR3, CXCR4, and/or CXCR5. In more preferred
embodiments, the antibodies of the invention immunospecifically
bind to G-protein Chemokine Receptor (CCR5) and do cross-react with
CCR3 and/or CXCR4.
[0290] In a preferred embodiment, antibodies of the invention
preferentially bind G-protein Chemokine Receptor (CCR5) (SEQ ID
NO:2 or of the polypeptide encoded by the deposited clone), or
fragments and variants thereof relative to their ability to bind
other antigens, (such as, for example, other chemokine
receptors).
[0291] By way of non-limiting example, an antibody may be
considered to bind a first antigen preferentially if it binds said
first antigen with a dissociation constant (K.sub.D) that is less
than the antibody's K.sub.D for the second antigen. In another
non-limiting embodiment, an antibody may be considered to bind a
first antigen preferentially if it binds said first antigen with an
affinity that is at least one order of magnitude less than the
antibody's K.sub.D for the second antigen. In another non-limiting
embodiment, an antibody may be considered to bind a first antigen
preferentially if it binds said first antigen with an affinity that
is at least two orders of magnitude less than the antibody's
K.sub.D for the second antigen.
[0292] In another non-limiting embodiment, an antibody may be
considered to bind a first antigen preferentially if it binds said
first antigen with an off rate (k.sub.off) that is less than the
antibody's k.sub.off for the second antigen. In another
non-limiting embodiment, an antibody may be considered to bind a
first antigen preferentially if it binds said first antigen with an
affinity that is at least one order of magnitude less than the
antibody's k.sub.off for the second antigen. In another
non-limiting embodiment, an antibody may be considered to bind a
first antigen preferentially if it binds said first antigen with an
affinity that is at least two orders of magnitude less than the
antibody's k.sub.off for the second antigen.
[0293] Antibodies of the present invention may also be described or
specified in terms of their binding affinity to a polypeptide of
the invention. Preferred binding affinities include those with a
dissociation constant or Kd less than 5.times.10.sup.-2 M,
10.sup.-2 M, 5.times.10.sup.-3 M, 10.sup.-3 M, 5.times.10.sup.-4 M,
10.sup.-4 M. More preferred binding affinities include those with a
dissociation constant or Kd less than 5.times.10.sup.-5 M,
10.sup.-5 M, 5.times.10.sup.-6 M, 10.sup.-6M, 5.times.10.sup.-7 M,
10.sup.7 M, 5.times.10.sup.-8 M or 10.sup.-8 M. Even more preferred
binding affinities include those with a dissociation constant or Kd
less than 5.times.10.sup.-9 M, 10.sup.-9 M, 5.times.10.sup.-10 M,
10.sup.-10 M, 5.times.10.sup.-11 M, 10.sup.-11 M,
5.times.10.sup.-12 M, .sup.10-12 M, 5.times.10.sup.-13 M,
10.sup.-13 M, 5.times.10.sup.-14 M, 10.sup.-14 M,
5.times.10.sup.-15 M, or 10.sup.-15 M.
[0294] In specific embodiments, antibodies of the invention bind
G-protein Chemokine Receptor (CCR5) polypeptides or fragments or
variants thereof with an off rate (k.sub.off) of less than or equal
to 5.times.10.sup.-2 sec.sup.-1, 10.sup.-2 sec.sup.-1,
5.times.10.sup.-3 sec.sup.-1 or 10.sup.-3 sec.sup.-1. More
preferably, antibodies of the invention bind G-protein Chemokine
Receptor (CCR5) polypeptides or fragments or variants thereof with
an off rate (k.sub.off) less than or equal to 5.times.10.sup.-4
sec.sup.-1, 10.sup.-4 sec.sup.-1, 5.times.10.sup.-5 sec.sup.-1, or
10.sup.-5 sec.sup.-1 5.times.10.sup.-6 sec.sup.-1, 10.sup.-6
sec.sup.-1, 5.times.10.sup.-7 sec.sup.-1 or 10.sup.-7
sec.sup.-1.
[0295] In other embodiments, antibodies of the invention bind
G-protein Chemokine Receptor (CCR5) polypeptides or fragments or
variants thereof with an on rate (k.sub.on) of greater than or
equal to 10.sup.3 M.sup.-1 sec.sup.-1, 5.times.10.sup.3 M.sup.-1
sec.sup.-1, 10.sup.4 M.sup.-1 sec.sup.-1 or 5.times.10.sup.4
M.sup.-1 sec.sup.-1. More preferably, antibodies of the invention
bind G-protein Chemokine Receptor (CCR5) polypeptides or fragments
or variants thereof with an on rate (k.sub.on) greater than or
equal to 10.sup.5 M.sup.-1 sec.sup.-1, 5.times.10.sup.5M.sup.-1
sec.sup.-1, 10.sup.6M.sup.-1 sec.sup.-1, or
5.times.10.sup.6M.sup.-1 sec.sup.-1 or 10.sup.7M.sup.-1
sec.sup.-1.
[0296] The invention also provides antibodies that competitively
inhibit binding of an antibody to an epitope of the invention as
determined by any method known in the art for determining
competitive binding, for example, the immunoassays described
herein. In preferred embodiments, the antibody competitively
inhibits binding to the epitope by at least 95%, at least 90%, at
least 85%, at least 80%, at least 75%, at least 70%, at least 60%,
or at least 50%.
[0297] Antibodies of the present invention may act as agonists or
antagonists of the polypeptides of the present invention. For
example, the present invention includes antibodies which disrupt
the receptor/ligand interactions with the polypeptides of the
invention either partially or fully. Preferably, antibodies of the
present invention bind an antigenic epitope disclosed herein, or a
portion thereof. The invention features both receptor-specific
antibodies and ligand-specific antibodies. The invention also
features receptor-specific antibodies which do not prevent ligand
binding but prevent receptor activation. Receptor activation (i.e.,
signaling) may be determined by techniques described herein or
otherwise known in the art. For example, receptor activation can be
determined by detecting the phosphorylation (e.g., tyrosine or
serine/threonine) of the receptor or its substrate by
immunoprecipitation followed by western blot analysis (for example,
as described supra). In specific embodiments, antibodies are
provided that inhibit ligand activity or receptor activity by at
least 95%, at least 90%, at least 85%, at least 80%, at least 75%,
at least 70%, at least 60%, or at least 50% of the activity in
absence of the antibody.
[0298] The invention also features receptor-specific antibodies
which both prevent ligand binding and receptor activation as well
as antibodies that recognize the receptor-ligand complex, and,
preferably, do not specifically recognize the unbound receptor or
the unbound ligand. Likewise, included in the invention are
neutralizing antibodies which bind the ligand and prevent binding
of the ligand to the receptor, as well as antibodies which bind the
ligand, thereby preventing receptor activation, but do not prevent
the ligand from binding the receptor. Further included in the
invention are antibodies which activate the receptor. These
antibodies may act as receptor agonists, i.e., potentiate or
activate either all or a subset of the biological activities of the
ligand-mediated receptor activation, for example, by inducing
dimerization of the receptor. The antibodies may be specified as
agonists, antagonists or inverse agonists for biological activities
comprising the specific biological activities of the peptides of
the invention disclosed herein. The above antibody agonists can be
made using methods known in the art. See, e.g., PCT publication WO
96/40281; U.S. Pat. No. 5,811,097; Deng et al., Blood
92(6):1981-1988 (1998); Chen et al., Cancer Res. 58(16):3668-3678
(1998); Harrop et al., J. Immunol. 161(4):1786-1794 (1998); Zhu et
al., Cancer Res. 58(15):3209-3214 (1998); Yoon et al., J. Immunol.
160(7):3170-3179 (1998); Prat et al., J. Cell. Sci.
111(Pt2):237-247 (1998); Pitard et al., J. Immunol. Methods
205(2):177-190 (1997); Liautard et al., Cytokine 9(4):233-241
(1997); Carlson et al., J. Biol. Chem. 272(17):11295-11301 (1997);
Taryman et al., Neuron 14(4):755-762 (1995); Muller et al.,
Structure 6(9):1153-1167 (1998); Bartunek et al., Cytokine
8(1):14-20 (1996) (which are all incorporated by reference herein
in their entireties).
[0299] In one embodiment of the present invention, antibodies that
immunospecifically bind to a G-protein Chemokine Receptor (CCR5) or
a fragment or variant thereof, comprise a polypeptide having the
amino acid sequence of any one of the heavy chains expressed by an
anti-G-protein Chemokine Receptor (CCR5) antibody expressing cell
line of the invention and/or any one of the light chains expressed
by an anti-G-protein Chemokine Receptor (CCR5) antibody expressing
cell line of the invention. In another embodiment of the present
invention, antibodies that immunospecifically bind to a G-protein
Chemokine Receptor (CCR5) or a fragment or variant thereof,
comprise a polypeptide having the amino acid sequence of any one of
the VH domains of a heavy chain expressed by an anti-G-protein
Chemokine Receptor (CCR5) antibody expressing cell line of the
invention and/or any one of the VL domains of a light chain
expressed by an anti-G-protein Chemokine Receptor (CCR5) antibody
expressing cell line of the invention. In preferred embodiments,
antibodies of the present invention comprise the amino acid
sequence of a VH domain and VL domain expressed by a single
anti-G-protein Chemokine Receptor (CCR5) antibody expressing cell
line of the invention. In alternative embodiments, antibodies of
the present invention comprise the amino acid sequence of a VH
domain and a VL domain expressed by two different anti-G-protein
Chemokine Receptor (CCR5) antibody expressing cell lines of the
invention. Molecules comprising, or alternatively consisting of,
antibody fragments or variants of the VH and/or VL domains
expressed by an anti-G-protein Chemokine Receptor (CCR5) antibody
expressing cell line of the invention that immunospecifically bind
to a G-protein Chemokine Receptor (CCR5) are also encompassed by
the invention, as are nucleic acid molecules encoding these VH and
VL domains, molecules, fragments and/or variants.
[0300] The present invention also provides antibodies that
immunospecifically bind to a polypeptide, or polypeptide fragment
or variant of a G-protein Chemokine Receptor (CCR5), wherein said
antibodies comprise, or alternatively consist of, a polypeptide
having an amino acid sequence of any one, two, three, or more of
the VH CDRs contained in a heavy chain expressed by one or more
anti-G-protein Chemokine Receptor (CCR5) antibody expressing cell
lines of the invention. In particular, the invention provides
antibodies that immunospecifically bind a G-protein Chemokine
Receptor (CCR5), comprising, or alternatively consisting of, a
polypeptide having the amino acid sequence of a VH CDR1 contained
in a heavy chain expressed by one or more anti-G-protein Chemokine
Receptor (CCR5) antibody expressing cell lines of the invention. In
another embodiment, antibodies that immunospecifically bind a
G-protein Chemokine Receptor (CCR5), comprise, or alternatively
consist of, a polypeptide having the amino acid sequence of a VH
CDR2 contained in a heavy chain expressed by one or more
anti-G-protein Chemokine Receptor (CCR5) antibody expressing cell
lines of the invention. In a preferred embodiment, antibodies that
immunospecifically bind a G-protein Chemokine Receptor (CCR5),
comprise, or alternatively consist of a polypeptide having the
amino acid sequence of a VH CDR3 contained in a heavy chain
expressed by one or more anti-G-protein Chemokine Receptor (CCR5)
antibody expressing cell lines of the invention. Molecules
comprising, or alternatively consisting of, these antibodies, or
antibody fragments or variants thereof, that immunospecifically
bind to G-protein Chemokine Receptor (CCR5) or a G-protein
Chemokine Receptor (CCR5) fragment or variant thereof are also
encompassed by the invention, as are nucleic acid molecules
encoding these antibodies, molecules, fragments and/or
variants.
[0301] The present invention also provides antibodies that
immunospecifically bind to a polypeptide, or polypeptide fragment
or variant of a G-protein Chemokine Receptor (CCR5), wherein said
antibodies comprise, or alternatively consist of, a polypeptide
having an amino acid sequence of any one, two, three, or more of
the VL CDRs contained in a light chain expressed by one or more
anti-G-protein Chemokine Receptor (CCR5) antibody expressing cell
lines of the invention. In particular, the invention provides
antibodies that immunospecifically bind a G-protein Chemokine
Receptor (CCR5), comprising, or alternatively consisting of, a
polypeptide having the amino acid sequence of a VL CDR1 contained
in a light expressed by one or more anti-G-protein Chemokine
Receptor (CCR5) antibody expressing cell lines of the invention. In
another embodiment, antibodies that immunospecifically bind a
G-protein Chemokine Receptor (CCR5), comprise, or alternatively
consist of, a polypeptide having the amino acid sequence of a VL
CDR2 contained in a light chain expressed by one or more
anti-G-protein Chemokine Receptor (CCR5) antibody expressing cell
lines of the invention. In a preferred embodiment, antibodies that
immunospecifically bind a G-protein Chemokine Receptor (CCR5),
comprise, or alternatively consist of a polypeptide having the
amino acid sequence of a VL CDR3 contained in a light chain
expressed by one or more anti-G-protein Chemokine Receptor (CCR5)
antibody expressing cell lines of the invention. Molecules
comprising, or alternatively consisting of, these antibodies, or
antibody fragments or variants thereof, that immunospecifically
bind to G-protein Chemokine Receptor (CCR5) or a G-protein
Chemokine Receptor (CCR5) fragment or variant thereof are also
encompassed by the invention, as are nucleic acid molecules
encoding these antibodies, molecules, fragments and/or
variants.
[0302] The present invention also provides antibodies (including
molecules comprising, or alternatively consisting of, antibody
fragments or variants) that immunospecifically bind to a G-protein
Chemokine Receptor (CCR5) polypeptide or polypeptide fragment or
variant of a G-protein Chemokine Receptor (CCR5), wherein said
antibodies comprise, or alternatively consist of, one, two, three,
or more VH CDRs and one, two, three or more VL CDRs, as contained
in a heavy chain or light chain expressed by one or more
anti-G-protein Chemokine Receptor (CCR5) antibody expressing cell
lines of the invention. In particular, the invention provides for
antibodies that immunospecifically bind to a polypeptide or
polypeptide fragment or variant of a G-protein Chemokine Receptor
(CCR5), wherein said antibodies comprise, or alternatively consist
of, a VH CDR1 and a VL CDR1, a VH CDR1 and a VL CDR2, a VH CDR1 and
a VL CDR3, a VH CDR2 and a VL CDR1, VH CDR2 and VL CDR2, a VH CDR2
and a VL CDR3, a VH CDR3 and a VH CDR1, a VH CDR3 and a VL CDR2, a
VH CDR3 and a VL CDR3, or any combination thereof, of the VH CDRs
and VL CDRs contained in a light chain or light chain expressed by
one or more anti-G-protein Chemokine Receptor (CCR5) antibody
expressing cell lines of the invention. In a preferred embodiment,
one or more of these combinations are from a single anti-G-protein
Chemokine Receptor (CCR5) antibody expressing cell line of the
invention. Molecules comprising, or alternatively consisting of,
fragments or variants of these antibodies, that immunospecifically
bind to G-protein Chemokine Receptor (CCR5) are also encompassed by
the invention, as are nucleic acid molecules encoding these
antibodies, molecules, fragments or variants.
[0303] The present invention also provides for nucleic acid
molecules, generally isolated, encoding an antibody of the
invention (including molecules comprising, or alternatively
consisting of, antibody fragments or variants thereof). In a
specific embodiment, a nucleic acid molecule of the invention
encodes an antibody (including molecules comprising, or
alternatively consisting of, antibody fragments or variants
thereof), comprising, or alternatively consisting of, a VH domain
having an amino acid sequence of any one of the VH domains of a
heavy chain expressed by an anti-G-protein Chemokine Receptor
(CCR5) antibody expressing cell line of the invention and a VL
domain having an amino acid sequence of a light chain expressed by
an anti-G-protein Chemokine Receptor (CCR5) antibody expressing
cell line of the invention. In another embodiment, a nucleic acid
molecule of the invention encodes an antibody (including molecules
comprising, or alternatively consisting of, antibody fragments or
variants thereof), comprising, or alternatively consisting of, a VH
domain having an amino acid sequence of any one of the VH domains
of a heavy chain expressed by an anti-G-protein Chemokine Receptor
(CCR5) antibody expressing cell line of the invention or a VL
domain having an amino acid sequence of a light chain expressed by
an anti-G-protein Chemokine Receptor (CCR5) antibody expressing
cell line of the invention.
[0304] The present invention also provides antibodies that
comprise, or alternatively consist of, variants (including
derivatives) of the antibody molecules (e.g., the VH domains and/or
VL domains) described herein, which antibodies immunospecifically
bind to a G-protein Chemokine Receptor (CCR5) or fragment or
variant thereof. Standard techniques known to those of skill in the
art can be used to introduce mutations in the nucleotide sequence
encoding a molecule of the invention, including, for example,
site-directed mutagenesis and PCR-mediated mutagenesis which result
in amino acid substitutions. Preferably, the variants (including
derivatives) encode less than 50 amino acid substitutions, less
than 40 amino acid substitutions, less than 30 amino acid
substitutions, less than 25 amino acid substitutions, less than 20
amino acid substitutions, less than 15 amino acid substitutions,
less than 10 amino acid substitutions, less than 5 amino acid
substitutions, less than 4 amino acid substitutions, less than 3
amino acid substitutions, or less than 2 amino acid substitutions
relative to the reference VH domain, VHCDR1, VHCDR2, VHCDR3, VL
domain, VLCDR1, VLCDR2, or VLCDR3. A "conservative amino acid
substitution" is one in which the amino acid residue is replaced
with an amino acid residue having a side chain with a similar
charge. Families of amino acid residues having side chains with
similar charges have been defined in the art. These families
include amino acids with basic side chains (e.g., lysine, arginine,
histidine), acidic side chains (e.g., aspartic acid, glutamic
acid), uncharged polar side chains (e.g., glycine, asparagine,
glutamine, serine, threonine, tyrosine, cysteine), nonpolar side
chains (e.g., alanine, valine, leucine, isoleucine, proline,
phenylalanine, methionine, tryptophan), beta-branched side chains
(e.g., threonine, valine, isoleucine) and aromatic side chains
(e.g., tyrosine, phenylalanine, tryptophan, histidine).
Alternatively, mutations can be introduced randomly along all or
part of the coding sequence, such as by saturation mutagenesis, and
the resultant mutants can be screened for biological activity to
identify mutants that retain activity (e.g., the ability to bind a
G-protein Chemokine Receptor).
[0305] For example, it is possible to introduce mutations only in
framework regions or only in CDR regions of an antibody molecule.
Introduced mutations may be silent or neutral missense mutations,
i.e., have no, or little, effect on an antibody's ability to bind
antigen. These types of mutations may be useful to optimize codon
usage, or improve a hybridoma's antibody production. Alternatively,
non-neutral missense mutations may alter an antibody's ability to
bind antigen. The location of most silent and neutral missense
mutations is likely to be in the framework regions, while the
location of most non-neutral missense mutations is likely to be in
CDR, though this is not an absolute requirement. One of skill in
the art would be able to design and test mutant molecules with
desired properties such as no alteration in antigen binding
activity or alteration in binding activity (e.g., improvements in
antigen binding activity or change in antibody specificity).
Following mutagenesis, the encoded protein may routinely be
expressed and the functional and/or biological activity of the
encoded protein, (e.g., ability to immunospecifically bind a
G-protein Chemokine Receptor) can be determined using techniques
described herein or by routinely modifying techniques known in the
art.
[0306] In a specific embodiment, an antibody of the invention
(including a molecule comprising, or alternatively consisting of,
an antibody fragment or variant thereof), that immunospecifically
binds G-protein Chemokine Receptor (CCR5) polypeptides or fragments
or variants thereof, comprises, or alternatively consists of, an
amino acid sequence encoded by a nucleotide sequence that
hybridizes to a nucleotide sequence that is complementary to that
encoding one of the VH or VL domains expressed by one or more
anti-G-protein Chemokine Receptor (CCR5) antibody expressing cell
lines of the invention. under stringent conditions, e.g.,
hybridization to filter-bound DNA in 6.times. sodium
chloride/sodium citrate (SSC) at about 45.degree. C. followed by
one or more washes in 0.2.times.SSC/0.1% SDS at about 50-65.degree.
C., under highly stringent conditions, e.g., hybridization to
filter-bound nucleic acid in 6.times.SSC at about 45.degree. C.
followed by one or more washes in 0.1.times.SSC/0.2% SDS at about
68.degree. C., or under other stringent hybridization conditions
which are known to those of skill in the art (see, for example,
Ausubel, F. M. et al., eds., 1989, Current Protocols in Molecular
Biology, Vol. I, Green Publishing Associates, Inc. and John Wiley
& Sons, Inc., New York at pages 6.3.1-6.3.6 and 2.10.3).
Nucleic acid molecules encoding these antibodies are also
encompassed by the invention.
[0307] It is well known within the art that polypeptides, or
fragments or variants thereof, with similar amino acid sequences
often have similar structure and many of the same biological
activities. Thus, in one embodiment, an antibody (including a
molecule comprising, or alternatively consisting of, an antibody
fragment or variant thereof), that immunospecifically binds to a
G-protein Chemokine Receptor (CCR5) polypeptide or fragments or
variants of a G-protein Chemokine Receptor (CCR5) polypeptide,
comprises, or alternatively consists of, a VH domain having an
amino acid sequence that is at least 35%, at least 40%, at least
45%, at least 50%, at least 55%, at least 60%, at least 65%, at
least 70%, at least 75%, at least 80%, at least 85%, at least 90%,
at least 95%, or at least 99% identical, to the amino acid sequence
of a VH domain of a heavy chain expressed by an anti-G-protein
Chemokine Receptor (CCR5) antibody expressing cell line of the
invention.
[0308] In another embodiment, an antibody (including a molecule
comprising, or alternatively consisting of, an antibody fragment or
variant thereof), that immunospecifically binds to a G-protein
Chemokine Receptor (CCR5) polypeptide or fragments or variants of a
G-protein Chemokine Receptor (CCR5) polypeptide, comprises, or
alternatively consists of, a VL domain having an amino acid
sequence that is at least 35%, at least 40%, at least 45%, at least
50%, at least 55%, at least 60%, at least 65%, at least 70%, at
least 75%, at least 80%, at least 85%, at least 90%, at least 95%,
or at least 99% identical, to the amino acid sequence of a VL
domain of a light chain expressed by an anti-G-protein Chemokine
Receptor (CCR5) antibody expressing cell line of the invention.
[0309] The invention also encompasses antibodies (including
molecules comprising, or alternatively consisting of, antibody
fragments or variants thereof) that have one or more of the same
biological characteristics as one or more of the antibodies
described herein. By "biological characteristics" is meant, the in
vitro or in vivo activities or properties of the antibodies, such
as, for example, the ability to bind to G-protein Chemokine
Receptor (CCR5) (e.g., G-protein Chemokine Receptor (CCR5)
expressed on a cell surface, membrane-embedded G-protein Chemokine
Receptor (CCR5), and/or a fragment or variant of G-protein
Chemokine Receptor (CCR5)); the ability to substantially inhibit or
abolish the binding of the G-protein Chemokine Receptor (CCR5) to a
G-protein Chemokine Receptor (CCR5) ligand (e.g. MIP1-beta, see,
e.g., Example 61); the ability to downregulate G-protein Chemokine
Receptor (CCR5) expression on the surface of cells; the ability to
inhibit or abolish G-protein Chemokine Receptor (CCR5) mediated
biological activity (e.g., HIV binding to, infection (entry
into/fusion), and/or replication in, G-protein Chemokine Receptor
(CCR5) expressing cells (see, e.g., Example 60), the ability to
inhibit or abolish MIP1-beta induced chemotaxis of peripheral blood
mononuclear cells PBMC (or other G-protein Chemokine Receptor
(CCR5) expressing cells), or the ability to induce an intracellular
calcium flux in G-protein Chemokine Receptor (CCR5) expressing
cells, (see, e.g., Example 63). Optionally, the antibodies of the
invention will bind to the same epitope as at least one of the
antibodies specifically referred to herein. Such epitope binding
can be routinely determined using assays known in the art.
[0310] The present invention also provides for antibodies
(including molecules comprising, or alternatively consisting of,
antibody fragments or variants thereof), that neutralize G-protein
Chemokine Receptor (CCR5), said antibodies comprising, or
alternatively consisting of, a portion (e.g., VH CDR1, VH CDR2, VH
CDR3, VL CDR1, VL CDR2, and/or VL CDR3) of a VH or VL domain of an
antibody of the invention. An antibody that "neutralizes G-protein
Chemokine Receptor (CCR5) or a fragment or variant thereof" is, for
example, an antibody that diminishes or abolishes the ability of
G-protein Chemokine Receptor (CCR5) or a fragment or variant
thereof to bind to its ligand (e.g., HIV and MIP1-beta); that
diminishes or abolishes MIP1-beta induced chemotaxis of PBMC or
other CCR5 expressing cell; and/or that abolishes or inhibits the
G-protein Chemokine Receptor (CCR5) signaling cascade (e.g.,
calcium flux initiated by an activated G-protein Chemokine Receptor
(CCR5), see, e.g., Example 63). In one embodiment, an antibody that
neutralizes G-protein Chemokine Receptor (CCR5), comprises, or
alternatively consists of, a polypeptide having the amino acid
sequence of a VH domain of an antibody of the invention, or a
fragment or variant thereof and a VL domain of an antibody of the
invention, or a fragment or variant thereof. In another embodiment,
an antibody that neutralizes G-protein Chemokine Receptor (CCR5),
comprises, or alternatively consists of, a polypeptide having the
amino acid sequence of a VH domain and a VL domain from a single
antibody (or scFv or Fab fragment) of the invention, or fragments
or variants thereof. In one embodiment, an antibody that
neutralizes G-protein Chemokine Receptor (CCR5), comprises, or
alternatively consists of, a polypeptide having the amino acid
sequence of a VH domain of an antibody of the invention, or a
fragment or variant thereof. In another embodiment, an antibody
that neutralizes G-protein Chemokine Receptor (CCR5), comprises, or
alternatively consists of, a polypeptide having the amino acid
sequence of a VL domain of an antibody of the invention, or a
fragment or variant thereof. In another embodiment, an antibody
that neutralizes G-protein Chemokine Receptor (CCR5) or a fragment
or variant thereof, comprises, or alternatively consists of, a
polypeptide having the amino acid sequence of a VH CDR domain of an
antibody of the invention, or a fragment or variant thereof. In a
preferred embodiment, an antibody that neutralizes G-protein
Chemokine Receptor (CCR5) or a fragment or variant thereof,
comprises, or alternatively consists of, a polypeptide having the
amino acid sequence of a VH CDR3 of an antibody of the invention,
or a fragment or variant thereof. In another embodiment, an
antibody that neutralizes G-protein Chemokine Receptor (CCR5) or a
fragment or variant thereof, comprises, or alternatively consists
of, a polypeptide having the amino acid sequence of a VL CDR of an
antibody of the invention, or a fragment or variant thereof. In
another preferred embodiment, an antibody that neutralizes
G-protein Chemokine Receptor (CCR5) or a fragment or variant
thereof, comprises, or alternatively consists of, a polypeptide
having the amino acid sequence of a VL CDR3 of an antibody of the
invention, or a fragment or variant thereof. Nucleic acid molecules
encoding these antibodies are also encompassed by the
invention.
[0311] The present invention also provides for antibodies
(including molecules comprising, or alternatively consisting of,
antibody fragments or variants thereof), that reduces or abolishes
the ability of HIV viruses, particularly those that utilize
G-protein Chemokine Receptor (CCR5) as a co-receptor, to bind to,
infect (enter into/fuse with), and/or replicate in G-protein
Chemokine Receptor (CCR5) expressing cells, as determined by any
method known in the art such as, for example, the assays described
Example 60. Said antibodies may comprise, or alternatively consist
of, a portion (e.g., VH CDR1, VH CDR2, VH CDR3, VL CDR1, VL CDR2,
or VL CDR3) of a VH or VL domain having an amino acid sequence of
an antibody of the invention or a fragment or variant thereof. In
one embodiment, an antibody that reduces or abolishes the ability
of HIV viruses, particularly those that utilize G-protein Chemokine
Receptor (CCR5) as a co-receptor, to bind to, infect (enter
into/fuse with), and/or replicate in G-protein Chemokine Receptor
(CCR5) expressing cells, comprises, or alternatively consists of, a
polypeptide having the amino acid sequence of a VH domain of an
antibody of the invention, or a fragment or variant thereof and a
VL domain of an antibody of the invention, or a fragment or variant
thereof. In another embodiment, an antibody that reduces or
abolishes the ability of HIV viruses, particularly those that
utilize G-protein Chemokine Receptor (CCR5) as a co-receptor, to
bind to, infect (enter into/fuse with), and/or replicate in
G-protein Chemokine Receptor (CCR5) expressing cells, comprises, or
alternatively consists of, a polypeptide having the amino acid
sequence of a VH domain and a VL domain from a single antibody (or
scFv or Fab fragment) of the invention, or fragments or variants
thereof. In one embodiment, an antibody that reduces or abolishes
the ability of HIV viruses, particularly those that utilize
G-protein Chemokine Receptor (CCR5) as a co-receptor, to bind to,
infect (enter into/fuse with), and/or replicate in G-protein
Chemokine Receptor (CCR5) expressing cells, comprises, or
alternatively consists of, a polypeptide having the amino acid
sequence of a VH domain of an antibody of the invention, or a
fragment or variant thereof. In another embodiment, an antibody
that reduces or abolishes the ability of HIV viruses, particularly
those that utilize G-protein Chemokine Receptor (CCR5) as a
co-receptor, to bind to, infect (enter into/fuse with), and/or
replicate in G-protein Chemokine Receptor (CCR5) expressing cells,
comprises, or alternatively consists of, a polypeptide having the
amino acid sequence of a VL domain of an antibody of the invention,
or a fragment or variant thereof. In a preferred embodiment, an
antibody that reduces or abolishes the ability of HIV viruses,
particularly those that utilize G-protein Chemokine Receptor (CCR5)
as a co-receptor, to bind to, infect (enter into/fuse with), and/or
replicate in G-protein Chemokine Receptor (CCR5) expressing cells,
comprises, or alternatively consists of, a polypeptide having the
amino acid sequence of a VH CDR3 of an antibody of the invention,
or a fragment or variant thereof. In another preferred embodiment,
an antibody that reduces or abolishes the ability of HIV viruses,
particularly those that utilize G-protein Chemokine Receptor (CCR5)
as a co-receptor, to bind to, infect (enter into/fuse with), and/or
replicate in G-protein Chemokine Receptor (CCR5) expressing cells,
comprises, or alternatively consists of, a polypeptide having the
amino acid sequence of a VL CDR3 of an antibody of the invention,
or a fragment or variant thereof. Nucleic acid molecules encoding
these antibodies are also encompassed by the invention.
[0312] The present invention also provides for antibodies
(including molecules comprising, or alternatively consisting of,
antibody fragments or variants thereof), that inhibits or abolishes
MIP1-beta induced chemotaxis of peripheral blood mononuclear cells
PBMC or other G-protein Chemokine Receptor (CCR5) expressing cells,
as determined by any method known in the art such as, for example,
the assays described in Example 62. Said antibodies may comprise,
or alternatively consist of, a portion (e.g., VH CDR1, VH CDR2, VH
CDR3, VL CDR1, VL CDR2, or VL CDR3) of a VH or VL domain having an
amino acid sequence of an antibody of the invention or a fragment
or variant thereof. In one embodiment, an antibody that inhibits or
abolishes MIP1-beta induced chemotaxis of peripheral blood
mononuclear cells PBMC or other G-protein Chemokine Receptor (CCR5)
expressing cells, comprises, or alternatively consists of, a
polypeptide having the amino acid sequence of a VH domain of an
antibody of the invention, or a fragment or variant thereof and a
VL domain of an antibody of the invention, or a fragment or variant
thereof. In another embodiment, an antibody that inhibits or
abolishes MIP1-beta induced chemotaxis of peripheral blood
mononuclear cells PBMC or other G-protein Chemokine Receptor (CCR5)
expressing cells, comprises, or alternatively consists of, a
polypeptide having the amino acid sequence of a VH domain and a VL
domain from a single antibody (or scFv or Fab fragment) of the
invention, or fragments or variants thereof. In one embodiment, an
antibody that inhibits or abolishes MIP1-beta induced chemotaxis of
peripheral blood mononuclear cells PBMC or other G-protein
Chemokine Receptor (CCR5) expressing cells, comprises, or
alternatively consists of, a polypeptide having the amino acid
sequence of a VH domain of an antibody of the invention, or a
fragment or variant thereof. In another embodiment, an antibody
that inhibits or abolishes MIP1-beta induced chemotaxis of
peripheral blood mononuclear cells PBMC or other G-protein
Chemokine Receptor (CCR5) expressing cells, comprises, or
alternatively consists of, a polypeptide having the amino acid
sequence of a VL domain of an antibody of the invention, or a
fragment or variant thereof. In a preferred embodiment, an antibody
that inhibits or abolishes MIP1-beta induced chemotaxis of
peripheral blood mononuclear cells PBMC or other G-protein
Chemokine Receptor (CCR5) expressing cells, comprises, or
alternatively consists of, a polypeptide having the amino acid
sequence of a VH CDR3 of an antibody of the invention, or a
fragment or variant thereof. In another preferred embodiment, an
antibody that inhibits or abolishes MIP1-beta induced chemotaxis of
peripheral blood mononuclear cells PBMC or other G-protein
Chemokine Receptor (CCR5) expressing cells, comprises, or
alternatively consists of, a polypeptide having the amino acid
sequence of a VL CDR3 of an antibody of the invention, or a
fragment or variant thereof. Nucleic acid molecules encoding these
antibodies are also encompassed by the invention.
[0313] The present invention also provides for antibodies
(including molecules comprising, or alternatively consisting of,
antibody fragments or variants thereof), that downregulates the
cell-surface expression of G-protein Chemokine Receptor (CCR5), as
determined by any method known in the art such as, for example,
FACS analysis/the assays described in Examples 61 or 63. By way of
a non-limiting hypothesis, such down regulation may be the result
of antibody induced internalization of G-protein Chemokine Receptor
(CCR5). Said antibodies may comprise, or alternatively consist of,
a portion (e.g., VH CDR1, VH CDR2, VH CDR3, VL CDR1, VL CDR2, or VL
CDR3) of a VH or VL domain having an amino acid sequence of an
antibody of the invention or a fragment or variant thereof. In one
embodiment, an antibody that downregulates the cell-surface
expression of G-protein Chemokine Receptor (CCR5), comprises, or
alternatively consists of, a polypeptide having the amino acid
sequence of a VH domain of an antibody of the invention, or a
fragment or variant thereof and a VL domain of an antibody of the
invention, or a fragment or variant thereof. In another embodiment,
an antibody that downregulates the cell-surface expression of
G-protein Chemokine Receptor (CCR5), comprises, or alternatively
consists of, a polypeptide having the amino acid sequence of a VH
domain and a VL domain from a single antibody (or scFv or Fab
fragment) of the invention, or fragments or variants thereof. In
one embodiment, an antibody that downregulates the cell-surface
expression of G-protein Chemokine Receptor (CCR5), comprises, or
alternatively consists of, a polypeptide having the amino acid
sequence of a VH domain of an antibody of the invention, or a
fragment or variant thereof. In another embodiment, an antibody
that downregulates the cell-surface expression of G-protein
Chemokine Receptor (CCR5), comprises, or alternatively consists of,
a polypeptide having the amino acid sequence of a VL domain of an
antibody of the invention, or a fragment or variant thereof. In a
preferred embodiment, an antibody that downregulate the
cell-surface expression of G-protein Chemokine Receptor (CCR5),
comprises, or alternatively consists of, a polypeptide having the
amino acid sequence of a VH CDR3 of an antibody of the invention,
or a fragment or variant thereof. In another preferred embodiment,
an antibody that downregulates the cell-surface expression of
G-protein Chemokine Receptor (CCR5), comprises, or alternatively
consists of, a polypeptide having the amino acid sequence of a VL
CDR3 of an antibody of the invention, or a fragment or variant
thereof. Nucleic acid molecules encoding these antibodies are also
encompassed by the invention.
[0314] The present invention also provides for antibodies
(including molecules comprising, or alternatively consisting of,
antibody fragments or variants thereof), that enhance the activity
of G-protein Chemokine Receptor (CCR5), said antibodies comprising,
or alternatively consisting of, a portion (e.g., VH CDR1, VH CDR2,
VH CDR3, VL CDR1, VL CDR2, or VL CDR3) of a VH or VL domain of an
antibody of the invention, or a fragment or variant thereof. By way
of non-limiting example, an antibody that "enhances the activity of
G-protein Chemokine Receptor (CCR5) or a fragment or variant
thereof" is an antibody increases the ability of G-protein
Chemokine Receptor (CCR5) to bind to stimulate chemotaxis of PBMC
(or other G-protein Chemokine Receptor (CCR5) expressing cells),
and/or to stimulate the G-protein Chemokine Receptor (CCR5)
signaling cascade (e.g., to initiate an intracellular calcium flux,
See Example 63). In one embodiment, an antibody that that enhances
the activity of G-protein Chemokine Receptor (CCR5), comprises, or
alternatively consists of, a polypeptide having the amino acid
sequence of a VH domain of an antibody of the invention, or a
fragment or variant thereof and a VL domain of an antibody of the
invention, or a fragment or variant thereof. In another embodiment,
an antibody that enhances the activity of G-protein Chemokine
Receptor (CCR5), comprises, or alternatively consists of, a
polypeptide having the amino acid sequence of a VH domain and a VL
domain from a single antibody (or scFv or Fab fragment) of the
invention, or fragments or variants thereof. In one embodiment, an
antibody that enhances the activity of G-protein Chemokine Receptor
(CCR5) or a fragment or variant thereof, comprises, or
alternatively consists of, a polypeptide having the amino acid
sequence of a VH domain of an antibody of the invention, or a
fragment or variant thereof. In another embodiment, an antibody
that enhances the activity of G-protein Chemokine Receptor (CCR5)
or a fragment or variant thereof, comprises, or alternatively
consists of, a polypeptide having the amino acid sequence of a VL
domain of an antibody of the invention, or a fragment or variant
thereof. In another embodiment, an antibody that enhances the
activity of G-protein Chemokine Receptor (CCR5) or a fragment or
variant thereof, comprises, or alternatively consists of, a
polypeptide having the amino acid sequence of a VH CDR domain
referred to in Table 2, or a fragment or variant thereof. In a
preferred embodiment, an antibody that enhances the activity of
G-protein Chemokine Receptor (CCR5) or a fragment or variant
thereof, comprises, or alternatively consists of, a polypeptide
having the amino acid sequence of a VH CDR3 of an antibody of the
invention, or a fragment or variant thereof. In another embodiment,
an antibody that enhances G-protein Chemokine Receptor (CCR5) or a
fragment or variant thereof, comprises, or alternatively consists
of, a polypeptide having the amino acid sequence of a VL CDR domain
of an antibody of the invention, or a fragment or variant thereof.
In another preferred embodiment, an antibody that enhances the
activity of G-protein Chemokine Receptor (CCR5) or a fragment or
variant thereof, comprises, or alternatively consists of, a
polypeptide having the amino acid sequence of a VL CDR3 of an
antibody of the invention, or a fragment or variant thereof.
Nucleic acid molecules encoding these antibodies are also
encompassed by the invention.
[0315] The present invention also provides for fusion proteins
comprising, or alternatively consisting of, an antibody (including
molecules comprising, or alternatively consisting of, antibody
fragments or variants thereof), that immunospecifically binds to
G-protein Chemokine Receptor (CCR5), and a heterologous
polypeptide. Preferably, the heterologous polypeptide to which the
antibody is fused to is useful for function or is useful to target
the G-protein Chemokine Receptor (CCR5) expressing cells, including
but not limited to, MIP-1-beta; a CD4 binding polypeptide such as
an anti-CD4 antibody; a CXCR4 binding polypeptides such as stromal
derived factor 1-alpha (SDF1-alpha); and/or a CCR3 binding protein,
such as MIP1-alpha). In an alternative preferred embodiment, the
heterologous polypeptide to which the antibody is fused to is
useful for T cell, macrophage, and/or monocyte cell function or is
useful to target the antibody to a T cell, macrophage, or monocyte,
including but not limited to, MIP-1-beta; a CD4 binding polypeptide
such as an anti-CD4 antibody; a CXCR4 binding polypeptides such as
stromal derived factor 1-alpha (SDF1-alpha); and/or a CCR3 binding
protein, such as MIP1-alpha). In one embodiment, a fusion protein
of the invention comprises, or alternatively consists of, a
polypeptide having the amino acid sequence of any one or more of
the VH domains of an antibody of the invention or the amino acid
sequence of any one or more of the VL domains of an antibody of the
invention or fragments or variants thereof, and a heterologous
polypeptide sequence. In another embodiment, a fusion protein of
the present invention comprises, or alternatively consists of, a
polypeptide having the amino acid sequence of any one, two, three,
or more of the VH CDRs of an antibody of the invention, or the
amino acid sequence of any one, two, three, or more of the VL CDRs
of an antibody of the invention, or fragments or variants thereof,
and a heterologous polypeptide sequence. In a preferred embodiment,
the fusion protein comprises, or alternatively consists of, a
polypeptide having the amino acid sequence of, a VH CDR3 of an
antibody of the invention, or fragment or variant thereof, and a
heterologous polypeptide sequence, which fusion protein
immunospecifically binds to G-protein Chemokine Receptor (CCR5). In
another embodiment, a fusion protein comprises, or alternatively
consists of a polypeptide having the amino acid sequence of at
least one VH domain of an antibody of the invention and the amino
acid sequence of at least one VL domain of an antibody of the
invention or fragments or variants thereof, and a heterologous
polypeptide sequence. Preferably, the VH and VL domains of the
fusion protein correspond to a single antibody (or scFv or Fab
fragment) of the invention. In yet another embodiment, a fusion
protein of the invention comprises, or alternatively consists of a
polypeptide having the amino acid sequence of any one, two, three
or more of the VH CDRs of an antibody of the invention and the
amino acid sequence of any one, two, three or more of the VL CDRs
of an antibody of the invention, or fragments or variants thereof,
and a heterologous polypeptide sequence. Preferably, two, three,
four, five, six, or more of the VHCDR(s) or VLCDR(s) correspond to
single antibody (or scFv or Fab fragment) of the invention. Nucleic
acid molecules encoding these fusion proteins are also encompassed
by the invention.
[0316] Antibodies of the present invention may be used, for
example, but not limited to, to purify, detect, and target the
polypeptides of the present invention, including both in vitro and
in vivo diagnostic and therapeutic methods. For example, the
antibodies have use in immunoassays for qualitatively and
quantitatively measuring levels of the polypeptides of the present
invention in biological samples. See, e.g., Harlow et al.,
Antibodies: A Laboratory Manual, (Cold Spring Harbor Laboratory
Press, 2nd ed. 1988) (incorporated by reference herein in its
entirety).
[0317] By way of another non-limiting example, antibodies of the
invention may be administered to individuals as a form of passive
immunization. Alternatively, antibodies of the present invention
may be used for epitope mapping to identify the epitope(s) bound by
the antibody. Epitopes identified in this way may, in turn, for
example, be used as vaccine candidates, i.e., to immunize an
individual to elicit antibodies against the naturally occurring
forms of G-protein Chemokine Receptor.
[0318] As discussed in more detail below, the antibodies of the
present invention may be used either alone or in combination with
other compositions. The antibodies may further be recombinantly
fused to a heterologous polypeptide at the N- or C-terminus or
chemically conjugated (including covalently and non-covalently
conjugations) to polypeptides or other compositions. For example,
antibodies of the present invention may be recombinantly fused or
conjugated to molecules useful as labels in detection assays and
effector molecules such as heterologous polypeptides, drugs,
radionuclides, or toxins. See, e.g., PCT publications WO 92/08495;
WO 91/14438; WO 89/12624; U.S. Pat. No. 5,314,995; and EP
396,387.
[0319] The antibodies of the invention include derivatives that are
modified, i.e., by the covalent attachment of any type of molecule
to the antibody. For example, but not by way of limitation, the
antibody derivatives include antibodies that have been modified,
e.g., by glycosylation, acetylation, pegylation, phosphylation,
phosphorylation, amidation, derivatization by known
protecting/blocking groups, proteolytic cleavage, linkage to a
cellular ligand or other protein, etc. Any of numerous chemical
modifications may be carried out by known techniques, including,
but not limited to specific chemical cleavage, acetylation,
formylation, metabolic synthesis of tunicamycin, etc. Additionally,
the derivative may contain one or more non-classical amino
acids.
[0320] The antibodies of the present invention may be generated by
any suitable method known in the art. Polyclonal antibodies to an
antigen-of-interest can be produced by various procedures well
known in the art. For example, a polypeptide of the invention can
be administered to various host animals including, but not limited
to, rabbits, mice, rats, etc. to induce the production of sera
containing polyclonal antibodies specific for the antigen. Various
adjuvants may be used to increase the immunological response,
depending on the host species, and include but are not limited to,
Freund's (complete and incomplete), mineral gels such as aluminum
hydroxide, surface active substances such as lysolecithin, pluronic
polyols, polyanions, peptides, oil emulsions, keyhole limpet
hemocyanins, dinitrophenol, and potentially useful human adjuvants
such as BCG (bacille Calmette-Guerin) and corynebacterium parvum.
Such adjuvants are also well known in the art.
[0321] Monoclonal antibodies can be prepared using a wide variety
of techniques known in the art including the use of hybridoma,
recombinant, and phage display technologies, or a combination
thereof. For example, monoclonal antibodies can be produced using
hybridoma techniques including those known in the art and taught,
for example, in Harlow et al., Antibodies: A Laboratory Manual,
(Cold Spring Harbor Laboratory Press, 2nd ed. 1988); Hammerling, et
al., in: Monoclonal Antibodies and T-Cell Hybridomas 563-681
(Elsevier, N.Y., 1981) (said references incorporated by reference
in their entireties). The term "monoclonal antibody" as used herein
is not limited to antibodies produced through hybridoma technology.
The term "monoclonal antibody" refers to an antibody that is
derived from a single clone, including any eukaryotic, prokaryotic,
or phage clone, and not the method by which it is produced.
[0322] Methods for producing and screening for specific antibodies
using hybridoma technology are routine and well known in the art
and are discussed in detail in the Examples. In a non-limiting
example, mice can be immunized with a polypeptide of the invention
or a cell expressing such peptide. Once an immune response is
detected, e.g., antibodies specific for the antigen are detected in
the mouse serum, the mouse spleen is harvested and splenocytes
isolated. The splenocytes are then fused by well known techniques
to any suitable myeloma cells, for example cells from cell line
SP20 or P3X63-AG8.653 available from the ATCC.TM.. Hybridomas are
selected and cloned by limited dilution. The hybridoma clones are
then assayed by methods known in the art for cells that secrete
antibodies capable of binding a polypeptide of the invention.
Ascites fluid, which generally contains high levels of antibodies,
can be generated by immunizing mice with positive hybridoma
clones.
[0323] Accordingly, the present invention provides methods of
generating monoclonal antibodies as well as antibodies produced by
the method comprising culturing a hybridoma cell secreting an
antibody of the invention wherein, preferably, the hybridoma is
generated by fusing splenocytes isolated from a mouse immunized
with an antigen of the invention with myeloma cells and then
screening the hybridomas resulting from the fusion for hybridoma
clones that secrete an antibody able to bind a polypeptide of the
invention.
[0324] Another well known method for producing both polyclonal and
monoclonal human B cell lines is transformation using Epstein Barr
Virus (EBV). Protocols for generating EBV-transformed B cell lines
are commonly known in the art, such as, for example, the protocol
outlined in Chapter 7.22 of Current Protocols in Immunology,
Coligan et al., Eds., 1994, John Wiley & Sons, NY, which is
hereby incorporated in its entirety by reference herein. The source
of B cells for transformation is commonly human peripheral blood,
but B cells for transformation may also be derived from other
sources including, but not limited to, lymph nodes, tonsil, spleen,
tumor tissue, and infected tissues. Tissues are generally made into
single cell suspensions prior to EBV transformation. Additionally,
steps may be taken to either physically remove or inactivate T
cells (e.g., by treatment with cyclosporin A) in B cell-containing
samples, because T cells from individuals seropositive for anti-EBV
antibodies can suppress B cell immortalization by EBV. In general,
the sample containing human B cells is inoculated with EBV, and
cultured for 3-4 weeks. A typical source of EBV is the culture
supernatant of the B95-8 cell line (ATCC.TM. #VR-1492). Physical
signs of EBV transformation can generally be seen towards the end
of the 3-4 week culture period. By phase-contrast microscopy,
transformed cells may appear large, clear, hairy and tend to
aggregate in tight clusters of cells. Initially, EBV lines are
generally polyclonal. However, over prolonged periods of cell
cultures, EBV lines may become monoclonal or polyclonal as a result
of the selective outgrowth of particular B cell clones.
Alternatively, polyclonal EBV transformed lines may be subcloned
(e.g., by limiting dilution culture) or fused with a suitable
fusion partner and plated at limiting dilution to obtain monoclonal
B cell lines. Suitable fusion partners for EBV transformed cell
lines include mouse myeloma cell lines (e.g., SP2/0, X63-Ag8.653),
heteromyeloma cell lines (human.times.mouse; e.g., SPAM-8, SBC-H20,
and CB-F7), and human cell lines (e.g., GM 1500, SKO-007, RPMI
8226, and KR-4). Thus, the present invention also provides a method
of generating polyclonal or monoclonal human antibodies against
polypeptides of the invention or fragments thereof, comprising
EBV-transformation of human B cells.
[0325] Antibody fragments which recognize specific epitopes may be
generated by known techniques. For example, Fab and F(ab')2
fragments of the invention may be produced by proteolytic cleavage
of immunoglobulin molecules, using enzymes such as papain (to
produce Fab fragments) or pepsin (to produce F(ab')2 fragments).
F(ab')2 fragments contain the variable region, the light chain
constant region and the CH1 domain of the heavy chain.
[0326] For example, the antibodies of the present invention can
also be generated using various phage display methods known in the
art. In phage display methods, functional antibody domains are
displayed on the surface of phage particles which carry the
polynucleotide sequences encoding them. In a particular embodiment,
such phage can be utilized to display antigen binding domains
expressed from a repertoire or combinatorial antibody library
(e.g., human or murine). Phage expressing an antigen binding domain
that binds the antigen of interest can be selected or identified
with antigen, e.g., using labeled antigen or antigen bound or
captured to a solid surface or bead. Phage used in these methods
are typically filamentous phage including fd and M13 binding
domains expressed from phage with Fab, Fv or disulfide stabilized
Fv antibody domains recombinantly fused to either the phage gene
III or gene VIII protein. Examples of phage display methods that
can be used to make the antibodies of the present invention include
those disclosed in Brinkman et al., J. Immunol. Methods 182:41-50
(1995); Ames et al., J. Immunol. Methods 184:177-186 (1995);
Kettleborough et al., Eur. J. Immunol. 24:952-958 (1994); Persic et
al., Gene 187 9-18 (1997); Burton et al., Advances in Immunology
57:191-280 (1994); PCT application No. PCT/GB91/01134; PCT
publications WO 90/02809; WO 91/10737; WO 92/01047; WO 92/18619; WO
93/11236; WO 95/15982; WO 95/20401; and U.S. Pat. Nos. 5,698,426;
5,223,409; 5,403,484; 5,580,717; 5,427,908; 5,750,753; 5,821,047;
5,571,698; 5,427,908; 5,516,637; 5,780,225; 5,658,727; 5,733,743
and 5,969,108; each of which is incorporated herein by reference in
its entirety.
[0327] As described in the above references, after phage selection,
the antibody coding regions from the phage can be isolated and used
to generate whole antibodies, including human antibodies, or any
other desired antigen binding fragment, and expressed in any
desired host, including mammalian cells, insect cells, plant cells,
yeast, and bacteria, e.g., as described in detail below. For
example, techniques to recombinantly produce Fab, Fab' and F(ab')2
fragments can also be employed using methods known in the art such
as those disclosed in PCT publication WO 92/22324; Mullinax et al.,
BioTechniques 12(6):864-869 (1992); and Sawai et al., AJRI 34:26-34
(1995); and Better et al., Science 240:1041-1043 (1988) (said
references incorporated by reference in their entireties).
[0328] Examples of techniques which can be used to produce
single-chain Fvs and antibodies include those described in U.S.
Pat. Nos. 4,946,778 and 5,258,498; Huston et al., Methods in
Enzymology 203:46-88 (1991); Shu et al., PNAS 90:7995-7999 (1993);
and Skerra et al., Science 240:1038-1040 (1988). For some uses,
including in vivo use of antibodies in humans and in vitro
detection assays, it may be preferable to use chimeric, humanized,
or human antibodies. A chimeric antibody is a molecule in which
different portions of the antibody are derived from different
animal species, such as antibodies having a variable region derived
from a murine monoclonal antibody and a human immunoglobulin
constant region. Methods for producing chimeric antibodies are
known in the art. See e.g., Morrison, Science 229:1202 (1985); Oi
et al., BioTechniques 4:214 (1986); Gillies et al., (1989) J.
Immunol. Methods 125:191-202; U.S. Pat. Nos. 5,807,715; 4,816,567;
and 4,816,397, which are incorporated herein by reference in their
entirety. Humanized antibodies are antibody molecules from
non-human species antibody that binds the desired antigen having
one or more complementarity determining regions (CDRs) from the
non-human species and a framework regions from a human
immunoglobulin molecule. Often, framework residues in the human
framework regions will be substituted with the corresponding
residue from the CDR donor antibody to alter, preferably improve,
antigen binding. These framework substitutions are identified by
methods well known in the art, e.g., by modeling of the
interactions of the CDR and framework residues to identify
framework residues important for antigen binding and sequence
comparison to identify unusual framework residues at particular
positions. (See, e.g., Queen et al., U.S. Pat. No. 5,585,089;
Riechmann et al., Nature 332:323 (1988), which are incorporated
herein by reference in their entireties.) Antibodies can be
humanized using a variety of techniques known in the art including,
for example, CDR-grafting (EP 239,400; PCT publication WO 91/09967;
U.S. Pat. Nos. 5,225,539; 5,530,101; and 5,585,089), veneering or
resurfacing (EP 592,106; EP 519,596; Padlan, Molecular Immunology
28(4/5):489-498 (1991); Studnicka et al., Protein Engineering
7(6):805-814 (1994); Roguska. et al., PNAS 91:969-973 (1994)), and
chain shuffling (U.S. Pat. No. 5,565,332).
[0329] Completely human antibodies are particularly desirable for
therapeutic treatment of human patients. Human antibodies can be
made by a variety of methods known in the art including phage
display methods described above using antibody libraries derived
from human immunoglobulin sequences. See also, U.S. Pat. Nos.
4,444,887 and 4,716,111; and PCT publications WO 98/46645, WO
98/50433, WO 98/24893, WO 98/16654, WO 96/34096, WO 96/33735, and
WO 91/10741; each of which is incorporated herein by reference in
its entirety.
[0330] Human antibodies can also be produced using transgenic mice
which are incapable of expressing functional endogenous
immunoglobulins, but which can express human immunoglobulin genes.
For example, the human heavy and light chain immunoglobulin gene
complexes may be introduced randomly or by homologous recombination
into mouse embryonic stem cells. Alternatively, the human variable
region, constant region, and diversity region may be introduced
into mouse embryonic stem cells in addition to the human heavy and
light chain genes. The mouse heavy and light chain immunoglobulin
genes may be rendered non-functional separately or simultaneously
with the introduction of human immunoglobulin loci by homologous
recombination. In particular, homozygous deletion of the JH region
prevents endogenous antibody production. The modified embryonic
stem cells are expanded and microinjected into blastocysts to
produce chimeric mice. The chimeric mice are then bred to produce
homozygous offspring which express human antibodies. The transgenic
mice are immunized in the normal fashion with a selected antigen,
e.g., all or a portion of a polypeptide of the invention.
Monoclonal antibodies directed against the antigen can be obtained
from the immunized, transgenic mice using conventional hybridoma
technology. The human immunoglobulin transgenes harbored by the
transgenic mice rearrange during B cell differentiation, and
subsequently undergo class switching and somatic mutation. Thus,
using such a technique, it is possible to produce therapeutically
useful IgG, IgA, IgM and IgE antibodies. For an overview of this
technology for producing human antibodies, see Lonberg and Huszar,
Int. Rev. Immunol. 13:65-93 (1995). For a detailed discussion of
this technology for producing human antibodies and human monoclonal
antibodies and protocols for producing such antibodies, see, e.g.,
PCT publications WO 98/24893; WO 92/01047; WO 96/34096; WO
96/33735; European Patent No. 0 598 877; U.S. Pat. Nos. 5,413,923;
5,625,126; 5,633,425; 5,569,825; 5,661,016; 5,545,806; 5,814,318;
5,885,793; 5,916,771; 5,939,598; 6,075,181; and 6,114,598, which
are incorporated by reference herein in their entirety. In
addition, companies such as Abgenix, Inc. (Fremont, Calif.) and
Genpharm (San Jose, Calif.) can be engaged to provide human
antibodies directed against a selected antigen using technology
similar to that described above.
[0331] Completely human antibodies which recognize a selected
epitope can be generated using a technique referred to as "guided
selection." In this approach a selected non-human monoclonal
antibody, e.g., a mouse antibody, is used to guide the selection of
a completely human antibody recognizing the same epitope. (Jespers
et al., Bio/technology 12:899-903 (1988)).
[0332] Further, antibodies to the polypeptides of the invention
can, in turn, be utilized to generate anti-idiotype antibodies that
"mimic" polypeptides of the invention using techniques well known
to those skilled in the art. (See, e.g., Greenspan & Bona,
FASEB J. 7(5):437-444; (1989) and Nissinoff, J. Immunol.
147(8):2429-2438 (1991)). For example, antibodies which bind to and
competitively inhibit polypeptide multimerization and/or binding of
a polypeptide of the invention to a ligand can be used to generate
anti-idiotypes that "mimic" the polypeptide multimerization and/or
binding domain and, as a consequence, bind to and neutralize
polypeptide and/or its ligand. Such neutralizing anti-idiotypes or
Fab fragments of such anti-idiotypes can be used in therapeutic
regimens to neutralize polypeptide ligand. For example, such
anti-idiotypic antibodies can be used to bind a polypeptide of the
invention and/or to bind its ligands/receptors, and thereby
activate or block its biological activity.
[0333] Intrabodies are antibodies, often scFvs, that expressed from
a recombinant nucleic acid molecule and engineered to be retained
intracellularly (e.g., retained in the cytoplasm, endoplasmic
reticulum, or periplasm). Intrabodies may be used, for example, to
ablate the function of a protein to which the intrabody binds. The
expression of intrabodies may also be regulated through the use of
inducible promoters in the nucleic acid expression vector
comprising the intrabody. Intrabodies of the invention can be
produced using methods known in the art, such as those disclosed
and reviewed in Chen et al., Hum. Gene Ther. 5:595-601 (1994);
Marasco, W. A., Gene Ther. 4:11-15 (1997); Rondon and Marasco,
Annu. Rev. Microbiol. 51:257-283 (1997); Proba et al., J. Mol.
Biol. 275:245-253 (1998); Cohen et al., Oncogene 17:2445-2456
(1998); Ohage and Steipe, J. Mol. Biol. 291:1119-1128 (1999); Ohage
et al., J. Mol. Biol. 291:1129-1134 (1999); Wirtz and Steipe,
Protein Sci. 8:2245-2250 (1999); Zhu et al., J. Immunol. Methods
231:207-222 (1999); and references cited therein. In particular, a
CCR5 intrabody has been produced by Steinberger et al., Proc. Natl.
Acad. Sci. USA 97:805-810 (2000).
[0334] XENOMOUSE.TM. Technology
[0335] Antibodies in accordance with the invention are preferably
prepared by the utilization of a transgenic mouse that has a
substantial portion of the human antibody producing genome inserted
but that is rendered deficient in the production of endogenous,
murine, antibodies (e.g., XENOMOUSE.TM. strains available from
Abgenix Inc., Fremont, Calif.). Such mice, then, are capable of
producing human immunoglobulin molecules and antibodies and are
deficient in the production of murine immunoglobulin molecules and
antibodies. Technologies utilized for achieving the same are
disclosed in the patents, applications, and references disclosed
herein.
[0336] The ability to clone and reconstruct megabase-sized human
loci in YACs and to introduce them into the mouse germline provides
a powerful approach to elucidating the functional components of
very large or crudely mapped loci as well as generating useful
models of human disease. Furthermore, the utilization of such
technology for substitution of mouse loci with their human
equivalents could provide unique insights into the expression and
regulation of human gene products during development, their
communication with other systems, and their involvement in disease
induction and progression.
[0337] An important practical application of such a strategy is the
"humanization" of the mouse humoral immune system. Introduction of
human immunoglobulin (Ig) loci into mice in which the endogenous Ig
genes have been inactivated offers the opportunity to study the
mechanisms underlying programmed expression and assembly of
antibodies as well as their role in B cell development.
Furthermore, such a strategy could provide an ideal source for
production of fully human monoclonal antibodies (Mabs) an important
milestone towards fulfilling the promise of antibody therapy in
human disease.
[0338] Fully human antibodies are expected to minimize the
immunogenic and allergic responses intrinsic to mouse or
mouse-derivatized monoclonal antibodies and thus to increase the
efficacy and safety of the administered antibodies. The use of
fully human antibodies can be expected to provide a substantial
advantage in the treatment of chronic and recurring human diseases,
such as cancer, which require repeated antibody
administrations.
[0339] One approach towards this goal was to engineer mouse strains
deficient in mouse antibody production with large fragments of the
human Ig loci in anticipation that such mice would produce a large
repertoire of human antibodies in the absence of mouse antibodies.
Large human Ig fragments would preserve the large variable gene
diversity as well as the proper regulation of antibody production
and expression. By exploiting the mouse machinery for antibody
diversification and selection and the lack of immunological
tolerance to human proteins, the reproduced human antibody
repertoire in these mouse strains should yield high affinity
antibodies against any antigen of interest, including human
antigens. Using the hybridoma technology, antigen-specific human
Monoclonal antibodies with the desired specificity could be readily
produced and selected.
[0340] This general strategy was demonstrated in connection with
the generation of the first XENOMOUSE.TM. strains as published in
1994. See Green et al. Nature Genetics 7:13-21 (1994). The
XENOMOUSE.TM. strains were engineered with yeast artificial
chromosomes (YACS) containing 245 kb and 10 190 kb-sized germline
configuration fragments of the human heavy chain locus and kappa
light chain locus, respectively, which contained core variable and
constant region sequences. Id. The human Ig containing YACs proved
to be compatible with the mouse system for both rearrangement and
expression of antibodies and were capable of substituting for the
inactivated mouse Ig genes. This was demonstrated by their ability
to induce B-cell development, to produce an adult-like human
repertoire of fully human antibodies, and to generate
antigen-specific human monoclonal antibodies. These results also
suggested that introduction of larger portions of the human Ig loci
containing greater numbers of V genes, additional regulatory
elements, and human Ig constant regions might recapitulate
substantially the full repertoire that is characteristic of the
human humoral response to infection and immunization. The work of
Green et al. was recently extended to the introduction of greater
than approximately 80% of the human antibody repertoire through
introduction of megabase sized, germline configuration YAC
fragments of the human heavy chain loci and kappa light chain loci,
respectively, to produce XENOMOUSE.TM. mice. See Mendez et al.
Nature Genetics 15:146-156 (1997), Green and Jakobovits J Exp. Med.
188:483-495 (1998), Green, Journal of Immunological Methods
231:11-23 (1999) and U.S. patent application Ser. No. 08/759,620,
filed Dec. 3, 1996, the disclosures of which are hereby
incorporated by reference.
[0341] Such approach is further discussed and delineated in U.S.
patent application Ser. Nos. 07/466,008, filed Jan. 12, 1990,
07/710,515, filed Nov. 8, 1990, 07/919,297, filed Jul. 24, 1992,
07/922,649, filed Jul. 30, 1992, filed 08/031,801, filed Mar. 15,
1993, 08/112,848, filed Aug. 27, 1993, 08/234,145, filed Apr. 28,
1994, 08/376,279, filed Jan. 20, 1995, 08/430, 938, Apr. 27, 1995,
08/464,584, filed Jun. 5, 1995, 08/464,582, filed Jun. 5, 1995,
08/471,191, filed Jun. 5, 1995, 08/462,837, filed Jun. 5, 1995,
08/486,853, filed Jun. 5, 1995, 08/486,857, filed Jun. 5, 1995,
08/486,859, filed Jun. 5, 1995, 08/462,513, filed Jun. 5, 1995,
08/724,752, filed Oct. 2, 1996, and 08/759,620, filed Dec. 3, 1996.
See also Mendez et al. Nature Genetics 15:146-156 (1997) and Green
and Jakobovits J Exp. Med. 188:483 495 (1998). See also European
Patent No., EP 0 471 151 B1, grant published Jun. 12, 1996,
International Patent Application No., WO 94/02602, published Feb.
3, 1994, International Patent Application No., WO 96/34096,
published Oct. 31, 1996, and WO 98/24893, published Jun. 11, 1998.
The disclosures of each of the above-cited patents, applications,
and references are hereby incorporated by reference in their
entirety.
[0342] Human anti-mouse antibody (HAMA) responses have led the
industry to prepare chimeric or otherwise humanized antibodies.
While chimeric antibodies have a human constant region and a murine
variable region, it is expected that certain human anti-chimeric
antibody (HACA) responses will be observed, particularly in chronic
or multi-dose utilizations of the antibody. Thus, it would be
desirable to provide fully human antibodies against G-protein
Chemokine Receptor (CCR5) polypeptides in order to vitiate concerns
and/or effects of HAMA or HACA responses.
[0343] Monoclonal antibodies specific for G-protein Chemokine
Receptor (CCR5) polypeptides were prepared using hybridoma
technology. (Kohler et al., Nature 256:495 (1975); Kohler et al.,
Eur. J. Immunol. 6:511 (1976); Kohler et al., Eur. J. Immunol.
6:292 (1976); Hammerling et al., in: Monoclonal Antibodies and
T-Cell Hybridomas, Elsevier, N.Y., pp. 571-681 (1981)). Briefly,
XENOMOUSE.TM. mice were immunized with cells transfected with a
G-protein Chemokine Receptor (CCR5) expression vector (for details,
see Example 54). After immunization, the splenocytes of such mice
were extracted and fused with a suitable myeloma cell line. Any
suitable myeloma cell line may be employed in accordance with the
present invention; however, it is preferable to employ the parent
myeloma cell line (P3X63-AG8.653), available from the ATCC.TM..
After fusion, the resulting hybridoma cells are selectively
maintained in HAT medium, and then cloned by limiting dilution as
described by Wands et al. (Gastroenterology 80:225-232 (1981)). The
hybridoma cells obtained through such a selection are then assayed
to identify clones which secrete antibodies capable of binding the
G-protein Chemokine Receptor (CCR5) polypeptides.
[0344] The present invention is directed to fully human antibodies,
generally isolated, that immunospecifically bind G-protein
Chemokine Receptor (CCR5) polypeptides. Essentially, XENOMOUSE.TM.
lines of mice from Abgenix, Inc. (Fremont, Calif.) expressing human
antibodies were immunized with G-protein Chemokine Receptor (CCR5)
expressing cells (for details of immunization protocols, see
Example 54); spleen and/or lymph node cells (containing B-cells)
were recovered from the mice that had high titers of anti-G-protein
Chemokine Receptor (CCR5) antibodies; and such recovered cells were
fused with a myeloid-type cell line to prepare immortal hybridoma
cell lines. Hybridoma cell lines were screened to select and
identify hybridoma cell lines that produced antibodies specific to
the immunogen. We utilized these techniques in accordance with the
present invention for the preparation of antibodies specific to
G-protein Chemokine Receptor (CCR5) polypeptides. Herein, we
describe the production of multiple hybridoma cell lines that
produce antibodies specific to G-protein Chemokine Receptor (CCR5)
polypeptides. Further, we provide a characterization of the
antibodies produced by such cell lines.
[0345] The antibodies derived from hybridoma cell lines discussed
herein are listed in Table 2. Preferred antibodies of the invention
include, antibodies expressed by the following cell lines:
XF11.1D8, XF11.4D10, XF11.4C4, XF11.5H1, XF11.1G8, XF22.3C9.6,
XF22.9E6, XF27/28.7D5, XF27/28.18B5, XF27/28.25G10, XF27/28.36A12,
XF27/28.36F11, XF27/28.43E2, and XF27/28.55G4. XENOMOUSE.TM.
strains of mice from Abgenix, Inc. express human kappa light chains
with either human IgG1, IgG2, or IgG4. Each of the XENOMOUSE.TM.
strains can also produce antibodies of the human IgM isotype. The
IgG2 expressing strain was used to make the cell lines and
antibodies of the present invention, thus each of the antibodies
produced by cell lines are either fully human IgG2 heavy chains
with human kappa light chains or IgM heavy chains with human kappa
light chains. These hybridoma cell lines were deposited with the
American Type Culture Collection ("ATCC.TM.") on the date listed in
Table 2, and given ATCC.TM. Deposit Numbers listed in Table 2. The
ATCC.TM. is located at University Boulevard, Manassas, Va.
20110-2209, USA. The ATCC.TM. deposit was made pursuant to the
terms of the Budapest Treaty on the international recognition of
the deposit of microorganisms for purposes of patent procedure.
[0346] Hybridoma XF11.1D8 was deposited at the ATCC.TM. on Feb. 7,
2001 and given ATCC.TM. Deposit Number PTA-3030. Hybridoma
XF11.4D10 was deposited at the ATCC.TM. on Feb. 7, 2001 and given
ATCC.TM. Deposit Number PTA-3026. Hybridoma XF11.4C4 was deposited
at the ATCC.TM. on Feb. 7, 2001 and given ATCC.TM. Deposit Number
PTA-3028. Hybridoma XF11.5H1 was deposited at the ATCC.TM. on Feb.
7, 2001 and given ATCC.TM. Deposit Number PTA-3029. Hybridoma
XF11.1G8 was deposited at the ATCC.TM. on Feb. 7, 2001 and given
ATCC.TM. Deposit Number PTA-3027. Hybridoma XF3.5F1 was deposited
at the ATCC.TM. on Mar. 2, 2001 and given ATCC.TM. Deposit Number
PTA-3147. Hybridoma XF11.1F8 was deposited at the ATCC.TM. on Mar.
2, 2001 and given ATCC.TM. Deposit Number PTA-3150. Hybridoma
XF3.6A2 was deposited at the ATCC.TM. on Mar. 2, 2001 and given
ATCC.TM. Deposit Number PTA-3148. Hybridoma XF3.10B8 was deposited
at the ATCC.TM. on Mar. 2, 2001 and given ATCC.TM. Deposit Number
PTA-3151. Hybridoma XF22.3C9.6 was deposited at the ATCC.TM. on
Sep. 12, 2001 and given ATCC.TM. Deposit Number PTA-3702. Hybridoma
XF22.9E6 was deposited at the ATCC.TM. on Nov. 14, 2001 and given
ATCC.TM. Deposit Number PTA-3859. Hybridoma XF27/28.7D5 was
deposited at the ATCC.TM. on Feb. 1, 2002 and given ATCC.TM.
Deposit Number PTA-4049. Hybridoma XF27/28.18B5 was deposited at
the ATCC.TM. on Feb. 1, 2002 and given ATCC.TM. Deposit Number
PTA-4050. Hybridoma XF27/28.25G10 was deposited at the ATCC.TM. on
Feb. 1, 2002 and given ATCC.TM. Deposit Number PTA-4051. Hybridoma
XF27/28.36A12 was deposited at the ATCC.TM. on Feb. 1, 2002 and
given ATCC.TM. Deposit Number PTA-4052. Hybridoma XF27/28.36F11 was
deposited at the ATCC.TM. on Feb. 1, 2002 and given ATCC.TM.
Deposit Number PTA-4053. Hybridoma XF27/28.43E2 was deposited at
the ATCC.TM. on Feb. 1, 2002 and given ATCC.TM. Deposit Number
PTA-4054. The ATCC.TM. Deposit Numbers and the Hybridoma
designations are also presented in Table 2.
TABLE-US-00002 TABLE 2 Hybridoma Cell Lines Expressing
anti-G-protein Chemokine Receptor (CCR5) Receptor Antibodies
Hybridoma ATCC .TM. Deposit Number ATCC .TM. Deposit Date XF11.1D8
PTA-3030 Feb. 7, 2001 XF11.4D10 PTA-3026 Feb. 7, 2001 XF11.4C4
PTA-3028 Feb. 7, 2001 XF11.5H1 PTA-3029 Feb. 7, 2001 XF11.1G8
PTA-3027 Feb. 7, 2001 XF3.5F1 PTA-3147 Mar. 2, 2001 XF11.1F8
PTA-3150 Mar. 2, 2001 XF3.6A2 PTA-3148 Mar. 2, 2001 XF3.10B8
PTA-3151 Mar. 2, 2001 XF22.3C9.6 PTA-3702 Sep. 12, 2001 XF22.9E6
PTA-3859 Nov. 14, 2001 XF27/28.7D5 PTA-4049 Feb. 1, 2002
XF27/28.18B5 PTA-4050 Feb. 1, 2002 XF27/28.25G10 PTA-4051 Feb. 1,
2002 XF27/28.36A12 PTA-4052 Feb. 1, 2002 XF27/28.36F11 PTA-4053
Feb. 1, 2002 XF27/28.43E2 PTA-4054 Feb. 1, 2002 XF27/28.55G4
[0347] In one embodiment, the present invention provides hybridoma
cell lines expressing an antibody of the invention. In specific
embodiments, the hybridoma cell line of the invention is XF11.1D8.
In another specific embodiment, the hybridoma cell line of the
invention is XF11.4D10. In another specific embodiment, the
hybridoma cell line of the invention is XF11.4C4. In another
specific embodiment, the hybridoma cell line of the invention is
XF11.5H1. In another specific embodiment, the hybridoma cell line
of the invention is XF11.1G8. In another specific embodiment, the
hybridoma cell line of the invention is XF3.5F1. In another
specific embodiment, the hybridoma cell line of the invention is
XF11.1F8. In another specific embodiment, the hybridoma cell line
of the invention is XF3.6A2. In another specific embodiment, the
hybridoma cell line of the invention is XF3.10B8. In another
specific embodiment, the hybridoma cell line of the invention is
XF22.3C9.6. In another specific embodiment, the hybridoma cell line
of the invention is XF22.9E6. In another specific embodiment, the
hybridoma cell line of the invention is XF27/28.7D5. In another
specific embodiment, the hybridoma cell line of the invention is
XF27/28.18B5. In another specific embodiment, the hybridoma cell
line of the invention is XF27/28.25G10. In another specific
embodiment, the hybridoma cell line of the invention is
XF27/28.36A12. In another specific embodiment, the hybridoma cell
line of the invention is XF27/28.36F11. In another specific
embodiment, the hybridoma cell line of the invention is
XF27/28.43E2. In another specific embodiment, the hybridoma cell
line of the invention is XF27/28.55G4.
[0348] The present invention encompasses antibodies (including
molecules comprising, or alternatively consisting of, antibody
fragments or variants thereof) that immunospecifically bind to a
G-protein Chemokine Receptor (CCR5) polypeptide or a fragment,
variant, or fusion protein thereof. A G-protein Chemokine Receptor
(CCR5) polypeptide includes, but is not limited to, the G-protein
Chemokine Receptor (CCR5) polypeptide of SEQ ID NO:2 or the
polypeptide encoded by the DNA in clone HDGNR10 contained in
ATCC.TM. Deposit 97183 deposited Jun. 1, 1995; G-protein Chemokine
Receptor (CCR5) may be produced through recombinant expression of
nucleic acids encoding the polypeptides of SEQ ID NOS:2 or the
HDGNR10 DNA in ATCC.TM. Deposit Number 97183).
[0349] In one embodiment of the present invention, antibodies that
immunospecifically bind to a G-protein Chemokine Receptor (CCR5) or
a fragment or variant thereof, comprise a polypeptide having the
amino acid sequence of any one of the heavy chains expressed by at
least one of the cell lines referred to in Table 2 and/or any one
of the light chains expressed by at least one of the cell lines
referred to in Table 2. In another embodiment of the present
invention, antibodies that immunospecifically bind to a G-protein
Chemokine Receptor (CCR5) or a fragment or variant thereof,
comprise a polypeptide having the amino acid sequence of any one of
the VH domains of a heavy chain expressed by at least one of the
cell lines referred to in Table 2 and/or any one of the VL domains
of a light chain expressed by at least one of the cell lines
referred to in Table 2. In preferred embodiments, antibodies of the
present invention comprise the amino acid sequence of a VH domain
and VL domain expressed by the same cell line selected from the
group consisting of cell lines referred to in Table 2 In
alternative embodiments, antibodies of the present invention
comprise the amino acid sequence of a VH domain and a VL domain
from different cell lines referred to in Table 2. Molecules
comprising, or alternatively consisting of, antibody fragments or
variants of the VH and/or VL domains expressed by at least one of
the cell lines referred to in Table 2 that immunospecifically bind
to a G-protein Chemokine Receptor (CCR5) are also encompassed by
the invention, as are nucleic acid molecules encoding these VH and
VL domains, molecules, fragments and/or variants.
[0350] The present invention also provides antibodies that
immunospecifically bind to a polypeptide, or polypeptide fragment
or variant of a G-protein Chemokine Receptor (CCR5), wherein said
antibodies comprise, or alternatively consist of, a polypeptide
having an amino acid sequence of any one, two, three, or more of
the VH CDRs contained in a heavy chain expressed by one or more
cell lines referred to in Table 2. In particular, the invention
provides antibodies that immunospecifically bind a G-protein
Chemokine Receptor (CCR5), comprising, or alternatively consisting
of, a polypeptide having the amino acid sequence of a VH CDR1
contained in a heavy chain expressed by one or more cell lines
referred to in Table 2. In another embodiment, antibodies that
immunospecifically bind a G-protein Chemokine Receptor (CCR5),
comprise, or alternatively consist of, a polypeptide having the
amino acid sequence of a VH CDR2 contained in a heavy chain
expressed by one or more cell lines referred to in Table 2. In a
preferred embodiment, antibodies that immunospecifically bind a
G-protein Chemokine Receptor (CCR5), comprise, or alternatively
consist of a polypeptide having the amino acid sequence of a VH
CDR3 contained in a heavy chain expressed by one or more cell lines
referred to in Table 2. Molecules comprising, or alternatively
consisting of, these antibodies, or antibody fragments or variants
thereof, that immunospecifically bind to G-protein Chemokine
Receptor (CCR5) or a G-protein Chemokine Receptor (CCR5) fragment
or variant thereof are also encompassed by the invention, as are
nucleic acid molecules encoding these antibodies, molecules,
fragments and/or variants.
[0351] The present invention also provides antibodies that
immunospecifically bind to a polypeptide, or polypeptide fragment
or variant of a G-protein Chemokine Receptor (CCR5), wherein said
antibodies comprise, or alternatively consist of, a polypeptide
having an amino acid sequence of any one, two, three, or more of
the VL CDRs contained in a light chain expressed by one or more
cell lines referred to in Table 2. In particular, the invention
provides antibodies that immunospecifically bind a G-protein
Chemokine Receptor (CCR5), comprising, or alternatively consisting
of, a polypeptide having the amino acid sequence of a VL CDR1
contained in a light chain expressed by one or more cell lines
referred to in Table 2. In another embodiment, antibodies that
immunospecifically bind a G-protein Chemokine Receptor (CCR5),
comprise, or alternatively consist of, a polypeptide having the
amino acid sequence of a VL CDR2 contained in a light chain
expressed by one or more cell lines referred to in Table 2. In a
preferred embodiment, antibodies that immunospecifically bind a
G-protein Chemokine Receptor (CCR5), comprise, or alternatively
consist of a polypeptide having the amino acid sequence of a VL
CDR3 contained in a light chain expressed by one or more cell lines
referred to in Table 2. Molecules comprising, or alternatively
consisting of, these antibodies, or antibody fragments or variants
thereof, that immunospecifically bind to G-protein Chemokine
Receptor (CCR5) or a G-protein Chemokine Receptor (CCR5) fragment
or variant thereof are also encompassed by the invention, as are
nucleic acid molecules encoding these antibodies, molecules,
fragments and/or variants.
[0352] The present invention also provides antibodies (including
molecules comprising, or alternatively consisting of, antibody
fragments or variants) that immunospecifically bind to a G-protein
Chemokine Receptor (CCR5) polypeptide or polypeptide fragment or
variant of a G-protein Chemokine Receptor (CCR5), wherein said
antibodies comprise, or alternatively consist of, one, two, three,
or more VH CDRs and one, two, three or more VL CDRs, as contained
in a heavy chain or light chain expressed by one or more cell lines
referred to in Table 2. In particular, the invention provides for
antibodies that immunospecifically bind to a polypeptide or
polypeptide fragment or variant of a G-protein Chemokine Receptor
(CCR5), wherein said antibodies comprise, or alternatively consist
of, a VH CDR1 and a VL CDR1, a VH CDR1 and a VL CDR2, a VH CDR1 and
a VL CDR3, a VH CDR2 and a VL CDR1, VH CDR2 and VL CDR2, a VH CDR2
and a VL CDR3, a VH CDR3 and a VH CDR1, a VH CDR3 and a VL CDR2, a
VH CDR3 and a VL CDR3, or any combination thereof, of the VH CDRs
and VL CDRs contained in a heavy chain or light chain expressed by
one or more cell lines referred to in Table 2. In a preferred
embodiment, one or more of these combinations are from the same
scFv as disclosed in Table 2. Molecules comprising, or
alternatively consisting of, fragments or variants of these
antibodies, that immunospecifically bind to G-protein Chemokine
Receptor (CCR5) are also encompassed by the invention, as are
nucleic acid molecules encoding these antibodies, molecules,
fragments or variants.
Nucleic Acid Molecules Encoding Anti-G-Protein Chemokine Receptor
(CCR5) Antibodies Corresponding to Antibodies Derived from
XENOMOUSE.TM. Strains.
[0353] The present invention also provides for nucleic acid
molecules, generally isolated, encoding an antibody of the
invention (including molecules comprising, or alternatively
consisting of, antibody fragments or variants thereof). In a
specific embodiment, a nucleic acid molecule of the invention
encodes an antibody (including molecules comprising, or
alternatively consisting of, antibody fragments or variants
thereof), comprising, or alternatively consisting of, a VH domain
having an amino acid sequence of any one of the VH domains of a
heavy chain expressed by at least one of the cell lines referred to
in Table 2 and a VL domain having an amino acid sequence of a light
chain expressed by at least one of the cell lines referred to in
Table 2. In another embodiment, a nucleic acid molecule of the
invention encodes an antibody (including molecules comprising, or
alternatively consisting of, antibody fragments or variants
thereof), comprising, or alternatively consisting of, a VH domain
having an amino acid sequence of any one of the VH domains of a
heavy chain expressed by at least one of the cell lines referred to
in Table 2 or a VL domain having an amino acid sequence of a light
chain expressed by at least one of the cell lines referred to in
Table 2.
[0354] The present invention also provides antibodies that
comprise, or alternatively consist of, variants (including
derivatives) of the antibody molecules (e.g., the VH domains and/or
VL domains) described herein, which antibodies immunospecifically
bind to a G-protein Chemokine Receptor (CCR5) or fragment or
variant thereof. Standard techniques known to those of skill in the
art can be used to introduce mutations in the nucleotide sequence
encoding a molecule of the invention, including, for example,
site-directed mutagenesis and PCR-mediated mutagenesis which result
in amino acid substitutions. Preferably, the variants (including
derivatives) encode less than 50 amino acid substitutions, less
than 40 amino acid substitutions, less than 30 amino acid
substitutions, less than 25 amino acid substitutions, less than 20
amino acid substitutions, less than 15 amino acid substitutions,
less than 10 amino acid substitutions, less than 5 amino acid
substitutions, less than 4 amino acid substitutions, less than 3
amino acid substitutions, or less than 2 amino acid substitutions
relative to the reference VH domain, VHCDR1, VHCDR2, VHCDR3, VL
domain, VLCDR1, VLCDR2, or VLCDR3. A "conservative amino acid
substitution" is one in which the amino acid residue is replaced
with an amino acid residue having a side chain with a similar
charge. Families of amino acid residues having side chains with
similar charges have been defined in the art. These families
include amino acids with basic side chains (e.g., lysine, arginine,
histidine), acidic side chains (e.g., aspartic acid, glutamic
acid), uncharged polar side chains (e.g., glycine, asparagine,
glutamine, serine, threonine, tyrosine, cysteine), nonpolar side
chains (e.g., alanine, valine, leucine, isoleucine, proline,
phenylalanine, methionine, tryptophan), beta-branched side chains
(e.g., threonine, valine, isoleucine) and aromatic side chains
(e.g., tyrosine, phenylalanine, tryptophan, histidine).
Alternatively, mutations can be introduced randomly along all or
part of the coding sequence, such as by saturation mutagenesis, and
the resultant mutants can be screened for biological activity to
identify mutants that retain activity (e.g., the ability to bind a
G-protein Chemokine Receptor).
[0355] For example, it is possible to introduce mutations only in
framework regions or only in CDR regions of an antibody molecule.
Introduced mutations may be silent or neutral missense mutations,
i.e., have no, or little, effect on an antibody's ability to bind
antigen. These types of mutations may be useful to optimize codon
usage, or improve a hybridoma's antibody production. Alternatively,
non-neutral missense mutations may alter an antibody's ability to
bind antigen. The location of most silent and neutral missense
mutations is likely to be in the framework regions, while the
location of most non-neutral missense mutations is likely to be in
CDR, though this is not an absolute requirement. One of skill in
the art would be able to design and test mutant molecules with
desired properties such as no alteration in antigen binding
activity or alteration in binding activity (e.g., improvements in
antigen binding activity or change in antibody specificity).
Following mutagenesis, the encoded protein may routinely be
expressed and the functional and/or biological activity of the
encoded protein, (e.g., ability to immunospecifically bind a
G-protein Chemokine Receptor) can be determined using techniques
described herein or by routinely modifying techniques known in the
art.
[0356] In a specific embodiment, an antibody of the invention
(including a molecule comprising, or alternatively consisting of,
an antibody fragment or variant thereof), that immunospecifically
binds G-protein Chemokine Receptor (CCR5) polypeptides or fragments
or variants thereof, comprises, or alternatively consists of, an
amino acid sequence encoded by a nucleotide sequence that
hybridizes to a nucleotide sequence that is complementary to that
encoding one of the VH or VL domains expressed by one or more cell
lines referred to in Table 2. under stringent conditions, e.g.,
hybridization to filter-bound DNA in 6.times. sodium
chloride/sodium citrate (SSC) at about 45.degree. C. followed by
one or more washes in 0.2.times.SSC/0.1% SDS at about 50-65.degree.
C., under highly stringent conditions, e.g., hybridization to
filter-bound nucleic acid in 6.times.SSC at about 45.degree. C.
followed by one or more washes in 0.1.times.SSC/0.2% SDS at about
68.degree. C., or under other stringent hybridization conditions
which are known to those of skill in the art (see, for example,
Ausubel, F. M. et al., eds., 1989, Current Protocols in Molecular
Biology, Vol. I, Green Publishing Associates, Inc. and John Wiley
& Sons, Inc., New York at pages 6.3.1-6.3.6 and 2.10.3).
Nucleic acid molecules encoding these antibodies are also
encompassed by the invention.
[0357] It is well known within the art that polypeptides, or
fragments or variants thereof, with similar amino acid sequences
often have similar structure and many of the same biological
activities. Thus, in one embodiment, an antibody (including a
molecule comprising, or alternatively consisting of, an antibody
fragment or variant thereof), that immunospecifically binds to a
G-protein Chemokine Receptor (CCR5) polypeptide or fragments or
variants of a G-protein Chemokine Receptor (CCR5) polypeptide,
comprises, or alternatively consists of, a VH domain having an
amino acid sequence that is at least 35%, at least 40%, at least
45%, at least 50%, at least 55%, at least 60%, at least 65%, at
least 70%, at least 75%, at least 80%, at least 85%, at least 90%,
at least 95%, or at least 99% identical, to the amino acid sequence
of a VH domain of a heavy chain expressed by at least one of the
cell lines referred to in Table 2.
[0358] In another embodiment, an antibody (including a molecule
comprising, or alternatively consisting of, an antibody fragment or
variant thereof), that immunospecifically binds to a G-protein
Chemokine Receptor (CCR5) polypeptide or fragments or variants of a
G-protein Chemokine Receptor (CCR5) polypeptide, comprises, or
alternatively consists of, a VL domain having an amino acid
sequence that is at least 35%, at least 40%, at least 45%, at least
50%, at least 55%, at least 60%, at least 65%, at least 70%, at
least 75%, at least 80%, at least 85%, at least 90%, at least 95%,
or at least 99% identical, to the amino acid sequence of a VL
domain of a light chain expressed by at least one of the cell lines
referred to in Table 2.
Polynucleotides Encoding Antibodies
[0359] Antibodies of the invention (including antibody fragments or
variants) can be produced by any method known in the art. For
example, it will be appreciated that antibodies in accordance with
the present invention can be expressed in cell lines other than
hybridoma cell lines. Sequences encoding the cDNAs or genomic
clones for the particular antibodies can be used for transformation
of a suitable mammalian or nonmammalian host cells or to generate
phage display libraries, for example. Additionally, polypeptide
antibodies of the invention may be chemically synthesized or
produced through the use of recombinant expression systems.
[0360] One way to produce the antibodies of the invention would be
to clone the VH and/or VL domains expressed by any one or more of
the hybridoma cell lines referred to in Table 2. In order to
isolate the VH and VL domains from the hybridoma cell lines, PCR
primers including VH or VL nucleotide sequences (See Example 55),
may be used to amplify the expressed VH and VL sequences contained
in total RNA isolated from hybridoma cell lines. The PCR products
may then be cloned using vectors, for example, which have a PCR
product cloning site consisting of a 5' and 3' single T nucleotide
overhang, that is complementary to the overhanging single adenine
nucleotide added onto the 5' and 3' end of PCR products by many DNA
polymerases used for PCR reactions. The VH and VL domains can then
be sequenced using conventional methods known in the art.
[0361] The cloned VH and VL genes may be placed into one or more
suitable expression vectors. By way of non-limiting example, PCR
primers including VH or VL nucleotide sequences, a restriction
site, and a flanking sequence to protect the restriction site may
be used to amplify the VH or VL sequences. Utilizing cloning
techniques known to those of skill in the art, the PCR amplified VH
domains may be cloned into vectors expressing the appropriate
immunoglobulin constant region, e.g., the human IgG1 or IgG4
constant region for VH domains, and the human kappa or lambda
constant regions for kappa and lambda VL domains, respectively.
Preferably, the vectors for expressing the VH or VL domains
comprise a promoter suitable to direct expression of the heavy and
light chains in the chosen expression system, a secretion signal, a
cloning site for the immunoglobulin variable domain, immunoglobulin
constant domains, and a selection marker such as neomycin. The VH
and VL domains may also be cloned into a single vector expressing
the necessary constant regions. The heavy chain conversion vectors
and light chain conversion vectors are then co-transfected into
cell lines to generate stable or transient cell lines that express
full-length antibodies, e.g., IgG, using techniques known to those
of skill in the art (See, for example, Guo et al., J. Clin.
Endocrinol. Metab. 82:925-31 (1997), and Ames et al., J. Immunol.
Methods 184:177-86 (1995) which are herein incorporated in their
entireties by reference).
[0362] The invention further provides polynucleotides comprising a
nucleotide sequence encoding an antibody of the invention and
fragments thereof. The invention also encompasses polynucleotides
that hybridize under stringent or lower stringency hybridization
conditions, e.g., as defined supra, to polynucleotides that encode
an antibody, preferably, that specifically binds to a polypeptide
of the invention, preferably, an antibody that binds to a
polypeptide having the amino acid sequence of SEQ ID NO:2 or a
polypeptide encoded by the deposited clone.
[0363] The polynucleotides may be obtained, and the nucleotide
sequence of the polynucleotides determined, by any method known in
the art. For example, if the nucleotide sequence of the antibody is
known, a polynucleotide encoding the antibody may be assembled from
chemically synthesized oligonucleotides (e.g., as described in
Kutmeier et al., BioTechniques 17:242 (1994)), which, briefly,
involves the synthesis of overlapping oligonucleotides containing
portions of the sequence encoding the antibody, annealing and
ligating of those oligonucleotides, and then amplification of the
ligated oligonucleotides by PCR.
[0364] Alternatively, a polynucleotide encoding an antibody may be
generated from nucleic acid from a suitable source. If a clone
containing a nucleic acid encoding a particular antibody is not
available, but the sequence of the antibody molecule is known, a
nucleic acid encoding the immunoglobulin may be chemically
synthesized or obtained from a suitable source (e.g., an antibody
cDNA library, or a cDNA library generated from, or nucleic acid,
preferably poly A+ RNA, isolated from, any tissue or cells
expressing the antibody, such as hybridoma cells selected to
express an antibody of the invention) by PCR amplification using
synthetic primers hybridizable to the 3' and 5' ends of the
sequence (See Example 55) or by cloning using an oligonucleotide
probe specific for the particular gene sequence to identify, e.g.,
a cDNA clone from a cDNA library that encodes the antibody.
Amplified nucleic acids generated by PCR may then be cloned into
replicable cloning vectors using any method well known in the
art.
[0365] Once the nucleotide sequence and corresponding amino acid
sequence of the antibody is determined, the nucleotide sequence of
the antibody may be manipulated using methods well known in the art
for the manipulation of nucleotide sequences, e.g., recombinant DNA
techniques, site directed mutagenesis, PCR, etc. (see, for example,
the techniques described in Sambrook et al., 1990, Molecular
Cloning, A Laboratory Manual, 2d Ed., Cold Spring Harbor
Laboratory, Cold Spring Harbor, N.Y. and Ausubel et al., eds.,
1998, Current Protocols in Molecular Biology, John Wiley &
Sons, NY, which are both incorporated by reference herein in their
entireties), to generate antibodies having a different amino acid
sequence, for example to create amino acid substitutions,
deletions, and/or insertions.
[0366] In a specific embodiment, the amino acid sequence of the
heavy and/or light chain variable domains may be inspected to
identify the sequences of the complementarity determining regions
(CDRs) by methods that are well known in the art, e.g., by
comparison to known amino acid sequences of other heavy and light
chain variable regions to determine the regions of sequence
hypervariability. Using routine recombinant DNA techniques, one or
more of the CDRs may be inserted within framework regions, e.g.,
into human framework regions to humanize a non-human antibody, as
described supra. The framework regions may be naturally occurring
or consensus framework regions, and preferably human framework
regions (see, e.g., Chothia et al., J. Mol. Biol. 278: 457-479
(1998) for a listing of human framework regions). Preferably, the
polynucleotide generated by the combination of the framework
regions and CDRs encodes an antibody that specifically binds a
polypeptide of the invention. Preferably, as discussed supra, one
or more amino acid substitutions may be made within the framework
regions, and, preferably, the amino acid substitutions improve
binding of the antibody to its antigen. Additionally, such methods
may be used to make amino acid substitutions or deletions of one or
more variable region cysteine residues participating in an
intrachain disulfide bond to generate antibody molecules lacking
one or more intrachain disulfide bonds. Other alterations to the
polynucleotide are encompassed by the present invention and within
the skill of the art.
[0367] For some uses, such as for in vitro affinity maturation of
an antibody of the invention, it may be useful to express the VH
and VL domains of the heavy and light chains of one or more
antibodies of the invention as single chain antibodies or Fab
fragments in a phage display library. For example, the cDNAs
encoding the VH and VL domains of one or more antibodies of the
invention may be expressed in all possible combinations using a
phage display library, allowing for the selection of VH/VL
combinations that bind a G-protein Chemokine Receptor (CCR5)
polypeptides with preferred binding characteristics such as
improved affinity or improved off rates. Additionally, VH and VL
segments--the CDR regions of the VH and VL domains of one or more
antibodies of the invention, in particular, may be mutated in
vitro. Expression of VH and VL domains with "mutant" CDRs in a
phage display library allows for the selection of VH/VL
combinations that bind a G-protein Chemokine Receptor (CCR5)
receptor polypeptides with preferred binding characteristics such
as improved affinity or improved off rates.
[0368] In phage display methods, functional antibody domains are
displayed on the surface of phage particles which carry the
polynucleotide sequences encoding them. In particular, DNA
sequences encoding VH and VL domains are amplified from animal cDNA
libraries (e.g., human or murine cDNA libraries of lymphoid
tissues) or synthetic cDNA libraries. The DNA encoding the VH and
VL domains are joined together by an scFv linker by PCR and cloned
into a phagemid vector (e.g., p CANTAB 6 or pComb 3 HSS). The
vector is electroporated in E. coli and the E. coli is infected
with helper phage. Phage used in these methods are typically
filamentous phage including fd and M13 and the VH and VL domains
are usually recombinantly fused to either the phage gene III or
gene VIII. Phage expressing an antigen binding domain that binds to
an antigen of interest (i.e., a G-protein Chemokine Receptor
polypeptide or a fragment thereof) can be selected or identified
with antigen, e.g., using labeled antigen or antigen bound or
captured to a solid surface or bead. Examples of phage display
methods that can be used to make the antibodies of the present
invention include, but are not limited to, those disclosed in
Brinkman et al., J. Immunol. Methods 182:41-50 (1995); Ames et al.,
J. Immunol. Methods 184:177-186 (1995); Kettleborough et al., Eur.
J. Immunol. 24:952-958 (1994); Persic et al., Gene 187 9-18 (1997);
Burton et al., Advances in Immunology 57:191-280(1994); PCT
application No. PCT/GB91/O1 134; PCT publications WO 90/02809; WO
91/10737; WO 92/01047; WO 92/18719; WO 93/1 1236; WO 95/15982; WO
95/20401; WO97/13844; and U.S. Pat. Nos. 5,698,426; 5,223,409;
5,403,484; 5,580,717; 5,427,908; 5,750,753; 5,821,047; 5,571,698;
5,427,908; 5,516,717; 5,780,225; 5,658,727; 5,735,743 and
5,969,108; each of which is incorporated herein by reference in its
entirety.
[0369] In addition, techniques developed for the production of
"chimeric antibodies" (Morrison et al., Proc. Natl. Acad. Sci.
81:851-855 (1984); Neuberger et al., Nature 312:604-608 (1984);
Takeda et al., Nature 314:452-454 (1985)) by splicing genes from a
mouse antibody molecule of appropriate antigen specificity together
with genes from a human antibody molecule of appropriate biological
activity can be used. As described supra, a chimeric antibody is a
molecule in which different portions are derived from different
animal species, such as those having a variable region derived from
a murine mAb and a human immunoglobulin constant region, e.g.,
humanized antibodies.
[0370] Alternatively, techniques described for the production of
single chain antibodies (U.S. Pat. No. 4,946,778; Bird, Science
242:423-42 (1988); Huston et al., Proc. Natl. Acad. Sci. USA
85:5879-5883 (1988); and Ward et al., Nature 334:544-54 (1989)) can
be adapted to produce single chain antibodies. Single chain
antibodies are formed by linking the heavy and light chain
fragments of the Fv region via an amino acid bridge, resulting in a
single chain polypeptide. Techniques for the assembly of functional
Fv fragments in E. coli may also be used (Skerra et al., Science
242:1038-1041 (1988)).
Methods of Producing Antibodies
[0371] The antibodies of the invention can be produced by any
method known in the art for the synthesis of antibodies, in
particular, by chemical synthesis, by intracellular immunization
(i.e., intrabody technology), or preferably, by recombinant
expression techniques. Methods of producing antibodies include, but
are not limited to, hybridoma technology, EBV transformation, and
other methods discussed herein as well as through the use
recombinant DNA technology, as discussed below.
[0372] Recombinant expression of an antibody of the invention, or
fragment, derivative, variant or analog thereof, (e.g., a heavy or
light chain of an antibody of the invention or a single chain
antibody of the invention), requires construction of an expression
vector containing a polynucleotide that encodes the antibody. Once
a polynucleotide encoding an antibody molecule or a heavy or light
chain of an antibody, or portion thereof (preferably containing the
heavy or light chain variable domain), of the invention has been
obtained, the vector for the production of the antibody molecule
may be produced by recombinant DNA technology using techniques well
known in the art. Thus, methods for preparing a protein by
expressing a polynucleotide containing an antibody encoding
nucleotide sequence are described herein. Methods which are well
known to those skilled in the art can be used to construct
expression vectors containing antibody coding sequences and
appropriate transcriptional and translational control signals.
These methods include, for example, in vitro recombinant DNA
techniques, synthetic techniques, and in vivo genetic
recombination. The invention, thus, provides replicable vectors
comprising a nucleotide sequence encoding an antibody molecule of
the invention, or a heavy or light chain thereof, or a heavy or
light chain variable domain, operably linked to a promoter. Such
vectors may include the nucleotide sequence encoding the constant
region of the antibody molecule (see, e.g., PCT Publication WO
86/05807; PCT Publication WO 89/01036; and U.S. Pat. No. 5,122,464)
and the variable domain of the antibody may be cloned into such a
vector for expression of the entire heavy or light chain.
[0373] The expression vector is transferred to a host cell by
conventional techniques and the transfected cells are then cultured
by conventional techniques to produce an antibody of the invention.
Thus, the invention includes host cells containing a polynucleotide
encoding an antibody of the invention, or a heavy or light chain
thereof, or a single chain antibody of the invention, operably
linked to a heterologous promoter. In preferred embodiments for the
expression of double-chained antibodies, vectors encoding both the
heavy and light chains may be co-expressed in the host cell for
expression of the entire immunoglobulin molecule, as detailed
below.
[0374] A variety of host-expression vector systems may be utilized
to express the antibody molecules of the invention. Such
host-expression systems represent vehicles by which the coding
sequences of interest may be produced and subsequently purified,
but also represent cells which may, when transformed or transfected
with the appropriate nucleotide coding sequences, express an
antibody molecule of the invention in situ. These include but are
not limited to microorganisms such as bacteria (e.g., E. coli, B.
subtilis) transformed with recombinant bacteriophage DNA, plasmid
DNA or cosmid DNA expression vectors containing antibody coding
sequences; yeast (e.g., Saccharomyces, Pichia) transformed with
recombinant yeast expression vectors containing antibody coding
sequences; insect cell systems infected with recombinant virus
expression vectors (e.g., baculovirus) containing antibody coding
sequences; plant cell systems infected with recombinant virus
expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco
mosaic virus, TMV) or transformed with recombinant plasmid
expression vectors (e.g., Ti plasmid) containing antibody coding
sequences; or mammalian cell systems (e.g., COS, CHO, BHK, 293,
3T3, NSO cells) harboring recombinant expression constructs
containing promoters derived from the genome of mammalian cells
(e.g., metallothionein promoter) or from mammalian viruses (e.g.,
the adenovirus late promoter; the vaccinia virus 7.5K promoter).
Preferably, bacterial cells such as Escherichia coli, and more
preferably, eukaryotic cells, especially for the expression of
whole recombinant antibody molecule, are used for the expression of
a recombinant antibody molecule. For example, mammalian cells such
as Chinese hamster ovary cells (CHO), in conjunction with a vector
such as the major intermediate early gene promoter element from
human cytomegalovirus is an effective expression system for
antibodies (Foecking et al., Gene 45:101 (1986); Cockett et al.,
Bio/Technology 8:2 (1990)).
[0375] In bacterial systems, a number of expression vectors may be
advantageously selected depending upon the use intended for the
antibody molecule being expressed. For example, when a large
quantity of such a protein is to be produced, for the generation of
pharmaceutical compositions of an antibody molecule, vectors which
direct the expression of high levels of fusion protein products
that are readily purified may be desirable. Such vectors include,
but are not limited, to the E. coli expression vector pUR278
(Ruther et al., EMBO J. 2:1791 (1983)), in which the antibody
coding sequence may be ligated individually into the vector in
frame with the lac Z coding region so that a fusion protein is
produced; pIN vectors (Inouye & Inouye, Nucleic Acids Res.
13:3101-3109 (1985); Van Heeke & Schuster, J. Biol. Chem.
24:5503-5509 (1989)); and the like. pGEX vectors may also be used
to express foreign polypeptides as fusion proteins with glutathione
S-transferase (GST). In general, such fusion proteins are soluble
and can easily be purified from lysed cells by adsorption and
binding to matrix glutathione-agarose beads followed by elution in
the presence of free glutathione. The pGEX vectors are designed to
include thrombin or factor Xa protease cleavage sites so that the
cloned target gene product can be released from the GST moiety.
[0376] In an insect system, Autographa californica nuclear
polyhedrosis virus (AcNPV) is used as a vector to express foreign
genes. The virus grows in Spodoptera frugiperda cells. The antibody
coding sequence may be cloned individually into non-essential
regions (for example the polyhedrin gene) of the virus and placed
under control of an AcNPV promoter (for example the polyhedrin
promoter).
[0377] In mammalian host cells, a number of viral-based expression
systems may be utilized. In cases where an adenovirus is used as an
expression vector, the antibody coding sequence of interest may be
ligated to an adenovirus transcription/translation control complex,
e.g., the late promoter and tripartite leader sequence. This
chimeric gene may then be inserted in the adenovirus genome by in
vitro or in vivo recombination. Insertion in a non-essential region
of the viral genome (e.g., region E1 or E3) will result in a
recombinant virus that is viable and capable of expressing the
antibody molecule in infected hosts. (e.g., see Logan & Shenk,
Proc. Natl. Acad. Sci. USA 81:355-359 (1984)). Specific initiation
signals may also be required for efficient translation of inserted
antibody coding sequences. These signals include the ATG initiation
codon and adjacent sequences. Furthermore, the initiation codon
must be in phase with the reading frame of the desired coding
sequence to ensure translation of the entire insert. These
exogenous translational control signals and initiation codons can
be of a variety of origins, both natural and synthetic. The
efficiency of expression may be enhanced by the inclusion of
appropriate transcription enhancer elements, transcription
terminators, etc. (see Bittner et al., Methods in Enzymol.
153:51-544 (1987)).
[0378] In addition, a host cell strain may be chosen which
modulates the expression of the inserted sequences, or modifies and
processes the gene product in the specific fashion desired. Such
modifications (e.g., glycosylation) and processing (e.g., cleavage)
of protein products may be important for the function of the
protein. Different host cells have characteristic and specific
mechanisms for the post-translational processing and modification
of proteins and gene products. Appropriate cell lines or host
systems can be chosen to ensure the correct modification and
processing of the foreign protein expressed. To this end,
eukaryotic host cells which possess the cellular machinery for
proper processing of the primary transcript, glycosylation, and
phosphorylation of the gene product may be used. Such mammalian
host cells include but are not limited to CHO, VERY, BHK, Hela,
COS, MDCK, 293, 3T3, WI38, and in particular, breast cancer cell
lines such as, for example, BT483, Hs578T, HTB2, BT20 and T47D, and
normal mammary gland cell line such as, for example, CRL7030 and
Hs578Bst.
[0379] For long-term, high-yield production of recombinant
proteins, stable expression is preferred. For example, cell lines
which stably express the antibody molecule may be engineered.
Rather than using expression vectors which contain viral origins of
replication, host cells can be transformed with DNA controlled by
appropriate expression control elements (e.g., promoter, enhancer,
sequences, transcription terminators, polyadenylation sites, etc.),
and a selectable marker. Following the introduction of the foreign
DNA, engineered cells may be allowed to grow for 1-2 days in an
enriched media, and then are switched to a selective media. The
selectable marker in the recombinant plasmid confers resistance to
the selection and allows cells to stably integrate the plasmid into
their chromosomes and grow to form foci which in turn can be cloned
and expanded into cell lines. This method may advantageously be
used to engineer cell lines which express the antibody molecule.
Such engineered cell lines may be particularly useful in screening
and evaluation of compounds that interact directly or indirectly
with the antibody molecule.
[0380] A number of selection systems may be used, including but not
limited to the herpes simplex virus thymidine kinase (Wigler et
al., Cell 11:223 (1977)), hypoxanthine-guanine
phosphoribosyltransferase (Szybalska & Szybalski, Proc. Natl.
Acad. Sci. USA 48:202 (1992)), and adenine
phosphoribosyltransferase (Lowy et al., Cell 22:817 (1980)) genes
can be employed in tk-, hgprt- or aprt-cells, respectively. Also,
antimetabolite resistance can be used as the basis of selection for
the following genes: dhfr, which confers resistance to methotrexate
(Wigler et al., Natl. Acad. Sci. USA 77:357 (1980); O'Hare et al.,
Proc. Natl. Acad. Sci. USA 78:1527 (1981)); gpt, which confers
resistance to mycophenolic acid (Mulligan & Berg, Proc. Natl.
Acad. Sci. USA 78:2072 (1981)); neo, which confers resistance to
the aminoglycoside G-418 Clinical Pharmacy 12:488-505; Wu and Wu,
Biotherapy 3:87-95 (1991); Tolstoshev, Ann. Rev. Pharmacol.
Toxicol. 32:573-596 (1993); Mulligan, Science 260:926-932 (1993);
and Morgan and Anderson, Ann. Rev. Biochem. 62:191-217 (1993); May,
1993, TIB TECH 11(5):155-215); and hygro, which confers resistance
to hygromycin (Santerre et al., Gene 30:147 (1984)). Methods
commonly known in the art of recombinant DNA technology may be
routinely applied to select the desired recombinant clone, and such
methods are described, for example, in Ausubel et al. (eds.),
Current Protocols in Molecular Biology, John Wiley & Sons, NY
(1993); Kriegler, Gene Transfer and Expression, A Laboratory
Manual, Stockton Press, NY (1990); and in Chapters 12 and 13,
Dracopoli et al. (eds), Current Protocols in Human Genetics, John
Wiley & Sons, NY (1994); Colberre-Garapin et al., J. Mol. Biol.
150:1 (1981), which are incorporated by reference herein in their
entireties.
[0381] The expression levels of an antibody molecule can be
increased by vector amplification (for a review, see Bebbington and
Hentschel, The use of vectors based on gene amplification for the
expression of cloned genes in mammalian cells in DNA cloning, Vol.
3. (Academic Press, New York, 1987)). When a marker in the vector
system expressing antibody is amplifiable, increase in the level of
inhibitor present in culture of host cell will increase the number
of copies of the marker gene. Since the amplified region is
associated with the antibody gene, production of the antibody will
also increase (Crouse et al., Mol. Cell. Biol. 3:257 (1983)).
[0382] Vectors which use glutamine synthase (GS) or DHFR as the
selectable markers can be amplified in the presence of the drugs
methionine sulphoximine or methotrexate, respectively. An advantage
of glutamine synthase based vectors are the availability of cell
lines (e.g., the murine myeloma cell line, NS0) which are glutamine
synthase negative. Glutamine synthase expression systems can also
function in glutamine synthase expressing cells (e.g. Chinese
Hamster Ovary (CHO) cells) by providing additional inhibitor to
prevent the functioning of the endogenous gene. Vectors that use
glutamine synthase as the selectable marker include, but are not
limited to, the pEE6 expression vector described in Stephens and
Cockett, Nucl. Acids. Res 17:7110 (1989). A glutamine synthase
expression system and components thereof are detailed in PCT
publications: WO87/04462; WO86/05807; WO89/01036; WO89/10404; and
WO91/06657 which are incorporated in their entireties by reference
herein. Additionally, glutamine synthase expression vectors that
may be used according to the present invention are commercially
available from suppliers, including, for example Lonza Biologics,
Inc. (Portsmouth, N.H.). Expression and production of monoclonal
antibodies using a GS expression system in murine myeloma cells is
described in Bebbington et al., Bio/technology 10:169 (1992) and in
Biblia and Robinson Biotechnol. Prog. 11:1 (1995) which are
incorporated in their entireties by reference herein.
[0383] The host cell may be co-transfected with two expression
vectors of the invention, the first vector encoding a heavy chain
derived polypeptide and the second vector encoding a light chain
derived polypeptide. The two vectors may contain identical
selectable markers which enable equal expression of heavy and light
chain polypeptides. Alternatively, a single vector may be used
which encodes, and is capable of expressing, both heavy and light
chain polypeptides. In such situations, the light chain should be
placed before the heavy chain to avoid an excess of toxic free
heavy chain (Proudfoot, Nature 322:52 (1986); Kohler, Proc. Natl.
Acad. Sci. USA 77:2197 (1980)). The coding sequences for the heavy
and light chains may comprise cDNA or genomic DNA.
[0384] Once an antibody molecule of the invention has been produced
by an animal, chemically synthesized, or recombinantly expressed,
it may be purified by any method known in the art for purification
of an immunoglobulin molecule, for example, by chromatography
(e.g., ion exchange, affinity, particularly by affinity for the
specific antigen after Protein A, and sizing column
chromatography), centrifugation, differential solubility, or by any
other standard technique for the purification of proteins. In
addition, the antibodies of the present invention or fragments
thereof can be fused to heterologous polypeptide sequences
described herein or otherwise known in the art, to facilitate
purification.
[0385] Antibody Conjugates
[0386] The present invention encompasses antibodies recombinantly
fused or chemically conjugated (including both covalently and
non-covalently conjugations) to a polypeptide (or portion thereof,
preferably at least 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100 amino
acids of the polypeptide) of the present invention to generate
fusion proteins. The fusion does not necessarily need to be direct,
but may occur through linker sequences. The antibodies may be
specific for antigens other than polypeptides (or portion thereof,
preferably at least 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100 amino
acids of the polypeptide) of the present invention. For example,
antibodies may be used to target the polypeptides of the present
invention to particular cell types, either in vitro or in vivo, by
fusing or conjugating the polypeptides of the present invention to
antibodies specific for particular cell surface receptors.
Polypeptides and/or antibodies of the present invention (including
fragments or variants thereof) may be fused to either the N- or
C-terminal end of the heterologous protein (e.g., immunoglobulin Fc
polypeptide or human serum albumin polypeptide). Antibodies of the
invention may also be fused to albumin (including but not limited
to recombinant human serum albumin (see, e.g., U.S. Pat. No.
5,876,969, issued Mar. 2, 1999, EP Patent 0 413 622, and U.S. Pat.
No. 5,766,883, issued Jun. 16, 1998, herein incorporated by
reference in their entirety)), resulting in chimeric polypeptides.
In a preferred embodiment, polypeptides and/or antibodies of the
present invention (including fragments or variants thereof) are
fused with the mature form of human serum albumin (i.e., amino
acids 1-585 of human serum albumin as shown in FIGS. 1 and 2 of EP
Patent 0 322 094) which is herein incorporated by reference in its
entirety. In another preferred embodiment, polypeptides and/or
antibodies of the present invention (including fragments or
variants thereof) are fused with polypeptide fragments comprising,
or alternatively consisting of, amino acid residues 1-z of human
serum albumin, where z is an integer from 369 to 419, as described
in U.S. Pat. No. 5,766,883 herein incorporated by reference in its
entirety. Polynucleotides encoding fusion proteins of the invention
are also encompassed by the invention. Such fusion proteins may,
for example, facilitate purification and may increase half-life in
vivo. Antibodies fused or conjugated to the polypeptides of the
present invention may also be used in in vitro immunoassays and
purification methods using methods known in the art. See e.g.,
Harbor et al., supra, and PCT publication WO 93/21232; EP 439,095;
Naramura et al., Immunol. Lett. 39:91-99 (1994); U.S. Pat. No.
5,474,981; Gillies et al., PNAS 89:1428-1432 (1992); Fell et al.,
J. Immunol. 146:2446-2452 (1991), which are incorporated by
reference in their entireties.
[0387] The present invention further includes compositions
comprising the polypeptides of the present invention fused or
conjugated to antibody domains other than the variable regions. For
example, the polypeptides of the present invention may be fused or
conjugated to an antibody Fc region, or portion thereof. The
antibody portion fused to a polypeptide of the present invention
may comprise the constant region, hinge region, CH1 domain, CH2
domain, and CH3 domain or any combination of whole domains or
portions thereof. The polypeptides may also be fused or conjugated
to the above antibody portions to form multimers. For example, Fc
portions fused to the polypeptides of the present invention can
form dimers through disulfide bonding between the Fc portions.
Higher multimeric forms can be made by fusing the polypeptides to
portions of IgA and IgM. Methods for fusing or conjugating the
polypeptides of the present invention to antibody portions are
known in the art. See, e.g., U.S. Pat. Nos. 5,336,603; 5,622,929;
5,359,046; 5,349,053; 5,447,851; 5,112,946; EP 307,434; EP 367,166;
PCT publications WO 96/04388; WO 91/06570; Ashkenazi et al., Proc.
Natl. Acad. Sci. USA 88:10535-10539 (1991); Zheng et al., J.
Immunol. 154:5590-5600 (1995); and Vil et al., Proc. Natl. Acad.
Sci. USA 89:11337-11341 (1992) (said references incorporated by
reference in their entireties).
[0388] As discussed, supra, the polypeptides corresponding to a
polypeptide, polypeptide fragment, or a variant of SEQ ID NO:2 or
of the polypeptide encoded by the deposited clone may be fused or
conjugated to the above antibody portions to increase the in vivo
half life of the polypeptides or for use in immunoassays using
methods known in the art. Further, the polypeptides corresponding
to SEQ ID NO:2 or to the polypeptide encoded by the deposited clone
may be fused or conjugated to the above antibody portions to
facilitate purification. One reported example describes chimeric
proteins consisting of the first two domains of the human
CD4-polypeptide and various domains of the constant regions of the
heavy or light chains of mammalian immunoglobulins. (EP 394,827;
Traunecker et al., Nature 331:84-86 (1988). The polypeptides of the
present invention fused or conjugated to an antibody having
disulfide-linked dimeric structures (due to the IgG) may also be
more efficient in binding and neutralizing other molecules, than
the monomeric secreted protein or protein fragment alone.
(Fountoulakis et al., J. Biochem. 270:3958-3964 (1995)). In many
cases, the Fc part in a fusion protein is beneficial in therapy and
diagnosis, and thus can result in, for example, improved
pharmacokinetic properties. (EP A 232,262). Alternatively, deleting
the Fc part after the fusion protein has been expressed, detected,
and purified, would be desired. For example, the Fc portion may
hinder therapy and diagnosis if the fusion protein is used as an
antigen for immunizations. In drug discovery, for example, human
proteins, such as hIL-5, have been fused with Fc portions for the
purpose of high-throughput screening assays to identify antagonists
of hIL-5. (See, Bennett et al., J. Molecular Recognition 8:52-58
(1995); Johanson et al., J. Biol. Chem. 270:9459-9471 (1995).
[0389] Moreover, the antibodies or fragments thereof of the present
invention can be fused to marker sequences, such as a peptide to
facilitate purification. In preferred embodiments, the marker amino
acid sequence is a hexa-histidine peptide, such as the tag provided
in a pQE vector (QIAGEN, Inc., 9259 Eton Avenue, Chatsworth,
Calif., 91311), among others, many of which are commercially
available. As described in Gentz et al., Proc. Natl. Acad. Sci. USA
86:821-824 (1989), for instance, hexa-histidine provides for
convenient purification of the fusion protein. Other peptide tags
useful for purification include, but are not limited to, the "HA"
tag, which corresponds to an epitope derived from the influenza
hemagglutinin protein (Wilson et al., Cell 37:767 (1984)) and the
"flag" tag.
[0390] The present invention further encompasses antibodies or
fragments thereof conjugated to a diagnostic or therapeutic agent.
The antibodies can be used diagnostically to, for example, monitor
the development or progression of a tumor as part of a clinical
testing procedure to, e.g., determine the efficacy of a given
treatment regimen. Detection can be facilitated by coupling the
antibody to a detectable substance. Examples of detectable
substances include various enzymes, prosthetic groups, fluorescent
materials, luminescent materials, bioluminescent materials,
radioactive materials, positron emitting metals using various
positron emission tomographies, and nonradioactive paramagnetic
metal ions. The detectable substance may be coupled or conjugated
either directly to the antibody (or fragment thereof) or
indirectly, through an intermediate (such as, for example, a linker
known in the art) using techniques known in the art. See, for
example, U.S. Pat. No. 4,741,900 for metal ions which can be
conjugated to antibodies for use as diagnostics according to the
present invention. Examples of suitable enzymes include horseradish
peroxidase, alkaline phosphatase, beta-galactosidase, or
acetylcholinesterase; examples of suitable prosthetic group
complexes include streptavidin/biotin and avidin/biotin; examples
of suitable fluorescent materials include umbelliferone,
fluorescein, fluorescein isothiocyanate, rhodamine,
dichlorotriazinylamine fluorescein, dansyl chloride or
phycoerythrin; an example of a luminescent material includes
luminol; examples of bioluminescent materials include luciferase,
luciferin, and aequorin; and examples of suitable radioactive
material include iodine (.sup.121I, .sup.123I, .sup.125I,
.sup.131I) carbon (.sup.14C), sulfur (.sup.35S), tritium (.sup.3H),
indium (.sup.111In, .sup.112In, .sup.113mIn, .sup.115mIn)
technetium (.sup.99Tc, .sup.99mTc), thallium (.sup.201Ti), gallium
(.sup.68Ga, .sup.67Ga), palladium (.sup.103Pd), molybdenum
(.sup.99Mo), xenon (.sup.133Xe), fluorine (.sup.18F), .sup.153Sm,
.sup.177Lu, .sup.159Gd, .sup.149Pm, .sup.140La, .sup.175Yb,
.sup.166Ho, .sup.90Y, .sup.47Sc, .sup.186Re, .sup.188Re,
.sup.142Pr, .sup.105Rh, and .sup.97Ru;
[0391] In specific embodiments, G-protein Chemokine Receptor (CCR5)
polypeptides of the invention are attached to macrocyclic chelators
useful for conjugating radiometal ions, including but not limited
to, .sup.111In, .sup.177Lu, .sup.90Y, .sup.166Ho, and .sup.153Sm,
to polypeptides. In a preferred embodiment, the radiometal ion
associated with the macrocyclic chelators attached to G-protein
Chemokine Receptor (CCR5) polypeptides of the invention is
.sup.111In. In another preferred embodiment, the radiometal ion
associated with the macrocyclic chelator attached to G-protein
Chemokine Receptor (CCR5) polypeptides of the invention is
.sup.90Y. In specific embodiments, the macrocyclic chelator is
1,4,7,10-tetraazacyclododecane-N,N',N'',N'''-tetraacetic acid
(DOTA). In other specific embodiments, the DOTA is attached to the
G-protein Chemokine Receptor (CCR5) polypeptide of the invention
via a linker molecule. Examples of linker molecules useful for
conjugating DOTA to a polypeptide are commonly known in the
art--see, for example, DeNardo et al., Clin Cancer Res.
4(10):2483-90, 1998; Peterson et al., Bioconjug. Chem. 10(4):553-7,
1999; and Zimmerman et al, Nucl. Med. Biol. 26(8):943-50, 1999
which are hereby incorporated by reference in their entirety. In
addition, U.S. Pat. Nos. 5,652,361 and 5,756,065, which disclose
chelating agents that may be conjugated to antibodies, and methods
for making and using them, are hereby incorporated by reference in
their entireties. Though U.S. Pat. Nos. 5,652,361 and 5,756,065
focus on conjugating chelating agents to antibodies, one skilled in
the art could readily adapt the methods disclosed therein in order
to conjugate chelating agents to other polypeptides.
[0392] A cytotoxin or cytotoxic agent includes any agent that is
detrimental to cells. Examples include paclitaxol, cytochalasin B,
gramicidin D, ethidium bromide, emetine, mitomycin, etoposide,
tenoposide, vincristine, vinblastine, colchicin, doxorubicin,
daunorubicin, dihydroxy anthracin dione, mitoxantrone, mithramycin,
actinomycin D, 1-dehydrotestosterone, glucocorticoids, procaine,
tetracaine, lidocaine, propranolol, and puromycin and analogs or
homologs thereof. Therapeutic agents include, but are not limited
to, antimetabolites (e.g., methotrexate, 6-mercaptopurine,
6-thioguanine, cytarabine, 5-fluorouracil decarbazine), alkylating
agents (e.g., mechlorethamine, thiotepa chlorambucil, melphalan,
carmustine (BSNU) and lomustine (CCNU), cyclophosphamide, busulfan,
dibromomannitol, streptozotocin, mitomycin C, and
cis-dichlorodiamine platinum (II) (DDP) cisplatin), anthracyclines
(e.g., daunorubicin (formerly daunomycin) and doxorubicin),
antibiotics (e.g., dactinomycin (formerly actinomycin), bleomycin,
mithramycin, and anthramycin (AMC)), and anti-mitotic agents (e.g.,
vincristine and vinblastine).
[0393] The antibody conjugates of the invention can be used for
modifying a given biological response, the therapeutic agent or
drug moiety is not to be construed as limited to classical chemical
therapeutic agents. For example, the drug moiety may be a protein
or polypeptide possessing a desired biological activity. Such
proteins may include, for example, a toxin such as abrin, ricin A,
pseudomonas exotoxin, or diphtheria toxin; a protein such as tumor
necrosis factor, a-interferon, .beta.-interferon, nerve growth
factor, platelet derived growth factor, tissue plasminogen
activator, an apoptotic agent, e.g., TNF-alpha, TNF-beta, AIM I
(See, International Publication No. WO 97/33899), AIM II (See,
International Publication No. WO 97/34911), Fas Ligand (Takahashi
et al., Int. Immunol., 6:1567-1574 (1994)), VEGI (See,
International Publication No. WO 99/23105), a thrombotic agent or
an anti-angiogenic agent, e.g., angiostatin or endostatin; or,
biological response modifiers such as, for example, lymphokines,
interleukin-1 ("IL-1"), interleukin-2 ("IL-2"), interleukin-6
("IL-6"), granulocyte macrophage colony stimulating factor
("GM-CSF"), granulocyte colony stimulating factor ("G-CSF"), or
other growth factors.
[0394] Antibodies may also be attached to solid supports, which are
particularly useful for immunoassays or purification of the target
antigen. Such solid supports include, but are not limited to,
glass, cellulose, polyacrylamide, nylon, polystyrene, polyvinyl
chloride or polypropylene.
[0395] Techniques for conjugating such therapeutic moiety to
antibodies are well known, see, e.g., Arnon et al., "Monoclonal
Antibodies For Immunotargeting Of Drugs In Cancer Therapy", in
Monoclonal Antibodies And Cancer Therapy, Reisfeld et al. (eds.),
pp. 243-56 (Alan R. Liss, Inc. 1985); Hellstrom et al., "Antibodies
For Drug Delivery", in Controlled Drug Delivery (2nd Ed.), Robinson
et al. (eds.), pp. 623-53 (Marcel Dekker, Inc. 1987); Thorpe,
"Antibody Carriers Of Cytotoxic Agents In Cancer Therapy: A
Review", in Monoclonal Antibodies '84: Biological And Clinical
Applications, Pinchera et al. (eds.), pp. 475-506 (1985);
"Analysis, Results, And Future Prospective Of The Therapeutic Use
Of Radiolabeled Antibody In Cancer Therapy", in Monoclonal
Antibodies For Cancer Detection And Therapy, Baldwin et al. (eds.),
pp. 303-16 (Academic Press 1985), and Thorpe et al., "The
Preparation And Cytotoxic Properties Of Antibody-Toxin Conjugates",
Immunol. Rev. 62:119-58 (1982).
[0396] Alternatively, an antibody can be conjugated to a second
antibody to form an antibody heteroconjugate as described by Segal
in U.S. Pat. No. 4,676,980, which is incorporated herein by
reference in its entirety.
[0397] An antibody, with or without a therapeutic moiety conjugated
to it, administered alone or in combination with cytotoxic
factor(s) and/or cytokine(s) can be used as a therapeutic.
Immunophenotyping
[0398] The antibodies of the invention may be utilized for
immunophenotyping of cell lines and biological samples. The
translation product of the gene of the present invention may be
useful as a cell specific marker, or more specifically as a
cellular marker that is differentially expressed at various stages
of differentiation and/or maturation of particular cell types.
Monoclonal antibodies directed against a specific epitope, or
combination of epitopes, will allow for the screening of cellular
populations expressing the marker. Various techniques can be
utilized using monoclonal antibodies to screen for cellular
populations expressing the marker(s), and include magnetic
separation using antibody-coated magnetic beads, "panning" with
antibody attached to a solid matrix (i.e., plate), and flow
cytometry (See, e.g., U.S. Pat. No. 5,985,660; and Morrison et al.,
Cell, 96:737-49 (1999)).
[0399] These techniques allow for the screening of particular
populations of cells, such as might be found with hematological
malignancies (i.e. minimal residual disease (MRD) in acute leukemic
patients) and "non-self" cells in transplantations to prevent
Graft-versus-Host Disease (GVHD). Alternatively, these techniques
allow for the screening of hematopoietic stem and progenitor cells
capable of undergoing proliferation and/or differentiation, as
might be found in human umbilical cord blood.
Assays for Antibody Binding
[0400] The antibodies of the invention may be assayed for
immunospecific binding by any method known in the art. The
immunoassays which can be used include but are not limited to
competitive and non-competitive assay systems using techniques such
as BIACORE.TM. analysis (see, e.g., Example 59), FACS (Fluorescence
activated cell sorter) analysis (see, e.g., Example 54),
immunofluorescence (see, e.g., Example 56), immunocytochemistry,
western blots (see Examples 64 and 65), radioimmunoassays, ELISA
(enzyme linked immunosorbent assay) (See, e.g., Example 54),
"sandwich" immunoassays, immunoprecipitation assays, precipitin
reactions, gel diffusion precipitin reactions, immunodiffusion
assays, agglutination assays, complement-fixation assays,
immunoradiometric assays, fluorescent immunoassays, protein A
immunoassays, to name but a few. Such assays are routine and well
known in the art (see, e.g., Ausubel et al, eds, 1994, Current
Protocols in Molecular Biology, Vol. 1, John Wiley & Sons,
Inc., New York, which is incorporated by reference herein in its
entirety). Exemplary immunoassays are described briefly below (but
are not intended by way of limitation).
[0401] Immunoprecipitation protocols generally comprise lysing a
population of cells in a lysis buffer such as RIPA buffer (1% NP-40
or Triton X-100, 1% sodium deoxycholate, 0.1% SDS, 0.15 M NaCl,
0.01 M sodium phosphate at pH 7.2, 1% Trasylol) supplemented with
protein phosphatase and/or protease inhibitors (e.g., EDTA, PMSF,
aprotinin, sodium vanadate), adding the antibody of interest to the
cell lysate, incubating for a period of time (e.g., 1-4 hours) at
4.degree. C., adding protein A and/or protein G sepharose beads to
the cell lysate, incubating for about an hour or more at 4.degree.
C., washing the beads in lysis buffer and resuspending the beads in
SDS/sample buffer. The ability of the antibody of interest to
immunoprecipitate a particular antigen can be assessed by, e.g.,
western blot analysis. One of skill in the art would be
knowledgeable as to the parameters that can be modified to increase
the binding of the antibody to an antigen and decrease the
background (e.g., pre-clearing the cell lysate with sepharose
beads). For further discussion regarding immunoprecipitation
protocols see, e.g., Ausubel et al, eds, 1994, Current Protocols in
Molecular Biology, Vol. 1, John Wiley & Sons, Inc., New York at
10.16.1.
[0402] Western blot analysis generally comprises preparing protein
samples, electrophoresis of the protein samples in a polyacrylamide
gel (e.g., 8%-20% SDS-PAGE depending on the molecular weight of the
antigen), transferring the protein sample from the polyacrylamide
gel to a membrane such as nitrocellulose, PVDF or nylon, blocking
the membrane in blocking solution (e.g., PBS with 3% BSA or non-fat
milk), washing the membrane in washing buffer (e.g., PBS-Tween 20),
blocking the membrane with primary antibody (the antibody of
interest) diluted in blocking buffer, washing the membrane in
washing buffer, blocking the membrane with a secondary antibody
(which recognizes the primary antibody, e.g., an anti-human
antibody) conjugated to an enzymatic substrate (e.g., horseradish
peroxidase or alkaline phosphatase) or radioactive molecule (e.g.,
32P or 125I) diluted in blocking buffer, washing the membrane in
wash buffer, and detecting the presence of the antigen. One of
skill in the art would be knowledgeable as to the parameters that
can be modified to increase the signal detected and to reduce the
background noise. For further discussion regarding western blot
protocols see, e.g., Ausubel et al, eds, 1994, Current Protocols in
Molecular Biology, Vol. 1, John Wiley & Sons, Inc., New York at
10.8.1.
[0403] ELISAs comprise preparing antigen, coating the well of a 96
well microtiter plate with the antigen, adding the antibody of
interest conjugated to a detectable compound such as an enzymatic
substrate (e.g., horseradish peroxidase or alkaline phosphatase) to
the well and incubating for a period of time, and detecting the
presence of the antigen. In ELISAs the antibody of interest does
not have to be conjugated to a detectable compound; instead, a
second antibody (which recognizes the antibody of interest)
conjugated to a detectable compound may be added to the well.
Further, instead of coating the well with the antigen, the antibody
may be coated to the well. In this case, a second antibody
conjugated to a detectable compound may be added following the
addition of the antigen of interest to the coated well. One of
skill in the art would be knowledgeable as to the parameters that
can be modified to increase the signal detected as well as other
variations of ELISAs known in the art. For further discussion
regarding ELISAs see, e.g., Ausubel et al, eds, 1994, Current
Protocols in Molecular Biology, Vol. 1, John Wiley & Sons,
Inc., New York at 11.2.1.
[0404] The binding affinity of an antibody to an antigen and the
off-rate of an antibody-antigen interaction can be determined by
competitive binding assays. One example of a competitive binding
assay is a radioimmunoassay comprising the incubation of labeled
antigen (e.g., .sup.3H or .sup.125I), or fragment or variant
thereof, with the antibody of interest in the presence of
increasing amounts of unlabeled antigen, and the detection of the
antibody bound to the labeled antigen. The affinity of the antibody
of interest for a G-protein Chemokine Receptor (CCR5) and the
binding off-rates can be determined from the data by scatchard plot
analysis. Competition with a second antibody can also be determined
using radioimmunoassays. In this case, the G-protein Chemokine
Receptor (CCR5) is incubated with antibody of interest conjugated
to a labeled compound (e.g., compound labeled with .sup.3H or
.sup.125I) in the presence of increasing amounts of an unlabeled
second antibody. This kind of competitive assay between two
antibodies, may also be used to determine if two antibodies bind
the same or different epitopes.
[0405] In a preferred embodiment, BIACORE.TM. kinetic analysis is
used to determine the binding on and off rates of antibodies
(including antibody fragments or variants thereof) to a G-protein
Chemokine Receptor (CCR5), or fragments of a G-protein Chemokine
Receptor (CCR5). BIACORE.TM. kinetic analysis comprises analyzing
the binding and dissociation of antibodies from chips with
immobilized G-protein Chemokine Receptors (CCR5) on their surface
as described in Example 59.
Therapeutic Uses
[0406] The present invention is further directed to antibody-based
therapies which involve administering antibodies of the invention
to an animal, preferably a mammal, and most preferably a human,
patient for treating one or more of the disclosed diseases,
disorders, or conditions. Therapeutic compounds of the invention
include, but are not limited to, antibodies of the invention
(including fragments, analogs and derivatives thereof as described
herein) and nucleic acids encoding antibodies of the invention
(including fragments, analogs and derivatives thereof and
anti-idiotypic antibodies as described herein). The antibodies of
the invention can be used to treat, inhibit or prevent diseases,
disorders or conditions associated with aberrant expression and/or
activity of a polypeptide of the invention, including, but not
limited to, any one or more of the diseases, disorders, or
conditions described herein. The treatment and/or prevention of
diseases, disorders, or conditions associated with aberrant
expression and/or activity of a polypeptide of the invention
includes, but is not limited to, alleviating symptoms associated
with those diseases, disorders or conditions. Antibodies of the
invention may be provided in pharmaceutically acceptable
compositions as known in the art or as described herein.
[0407] A summary of the ways in which the antibodies of the present
invention may be used therapeutically includes binding
polynucleotides or polypeptides of the present invention locally or
systemically in the body or by direct cytotoxicity of the antibody,
e.g. as mediated by complement (CDC) or by effector cells (ADCC).
Some of these approaches are described in more detail below. Armed
with the teachings provided herein, one of ordinary skill in the
art will know how to use the antibodies of the present invention
for diagnostic, monitoring or therapeutic purposes without undue
experimentation.
[0408] The antibodies of this invention may be advantageously
utilized in combination with other monoclonal or chimeric
antibodies, or with lymphokines or hematopoietic growth factors
(such as, e.g., IL-2, IL-3 and IL-7), for example, which serve to
increase the number or activity of effector cells which interact
with the antibodies.
[0409] The antibodies of the invention may be administered alone or
in combination with other types of treatments (e.g., radiation
therapy, chemotherapy, hormonal therapy, immunotherapy, anti-tumor
agents, and anti-retroviral agents (see Example 28, below). In a
highly preferred embodiment, antibodies of the invention may be
administered alone or in combination with and anti-retroviral
agents (see Example 28, below). Generally, administration of
products of a species origin or species reactivity (in the case of
antibodies) that is the same species as that of the patient is
preferred. Thus, in a preferred embodiment, human antibodies,
fragments derivatives, analogs, or nucleic acids, are administered
to a human patient for therapy or prophylaxis.
[0410] It is preferred to use high affinity and/or potent in vivo
inhibiting and/or neutralizing antibodies against polypeptides or
polynucleotides of the present invention, fragments or regions
thereof, for both immunoassays directed to and therapy of disorders
related to polynucleotides or polypeptides, including fragments
thereof, of the present invention. Such antibodies, fragments, or
regions, will preferably have an affinity for polynucleotides or
polypeptides of the invention, including fragments thereof.
Preferred binding affinities include those with a dissociation
constant or Kd less than 5.times.10.sup.-2 M, 10.sup.-2 M,
5.times.10.sup.-3 M, 10.sup.-3 M, 5.times.10.sup.-4 M, 10.sup.-4 M.
More preferred binding affinities include those with a dissociation
constant or Kd less than 5.times.10.sup.-5 M, 10.sup.-5 M,
5.times.10.sup.-6 M, 10.sup.-6M, 5.times.10.sup.-7 M, 10.sup.7 M,
5.times.10.sup.-8 M or 10.sup.-8 M. Even more preferred binding
affinities include those with a dissociation constant or Kd less
than 5.times.10.sup.-9 M, 10.sup.-9 M, 5.times.10.sup.-10 M,
10.sup.-10 M, 5.times.10.sup.-11 M, 10.sup.-11 M,
5.times.10.sup.-12 M, .sup.10-12 M, 5.times.10.sup.-13 M,
10.sup.-13 M, 5.times.10.sup.-14 M, 10.sup.-14 M,
5.times.10.sup.-15 M, or 10.sup.-15 M.
Gene Therapy
[0411] In a specific embodiment, nucleic acids comprising sequences
encoding antibodies or functional derivatives thereof, are
administered to treat, inhibit or prevent a disease or disorder
associated with aberrant expression and/or activity of a
polypeptide of the invention, by way of gene therapy. Gene therapy
refers to therapy performed by the administration to a subject of
an expressed or expressible nucleic acid. In this embodiment of the
invention, the nucleic acids produce their encoded protein that
mediates a therapeutic effect.
[0412] Any of the methods for gene therapy available in the art can
be used according to the present invention. Exemplary methods are
described below.
[0413] For general reviews of the methods of gene therapy, see
Goldspiel et al., Clinical Pharmacy 12:488-505 (1993); Wu and Wu,
Biotherapy 3:87-95 (1991); Tolstoshev, Ann. Rev. Pharmacol.
Toxicol. 32:573-596 (1993); Mulligan, Science 260:926-932 (1993);
and Morgan and Anderson, Ann. Rev. Biochem. 62:191-217 (1993); May,
TIBTECH 11(5):155-215 (1993). Methods commonly known in the art of
recombinant DNA technology which can be used are described in
Ausubel et al. (eds.), Current Protocols in Molecular Biology, John
Wiley & Sons, NY (1993); and Kriegler, Gene Transfer and
Expression, A Laboratory Manual, Stockton Press, NY (1990).
[0414] In a preferred aspect, the compound comprises nucleic acid
sequences encoding an antibody, said nucleic acid sequences being
part of expression vectors that express the antibody or fragments
or chimeric proteins or heavy or light chains thereof in a suitable
host. In particular, such nucleic acid sequences have promoters
operably linked to the antibody coding region, said promoter being
inducible or constitutive, and, optionally, tissue-specific. In
another particular embodiment, nucleic acid molecules are used in
which the antibody coding sequences and any other desired sequences
are flanked by regions that promote homologous recombination at a
desired site in the genome, thus providing for intrachromosomal
expression of the antibody encoding nucleic acids (Koller and
Smithies, Proc. Natl. Acad. Sci. USA 86:8932-8935 (1989); Zijlstra
et al., Nature 342:435-438 (1989). In specific embodiments, the
expressed antibody molecule is a single chain antibody;
alternatively, the nucleic acid sequences include sequences
encoding both the heavy and light chains, or fragments thereof, of
the antibody.
[0415] Delivery of the nucleic acids into a patient may be either
direct, in which case the patient is directly exposed to the
nucleic acid or nucleic acid-carrying vectors, or indirect, in
which case, cells are first transformed with the nucleic acids in
vitro, then transplanted into the patient. These two approaches are
known, respectively, as in vivo or ex vivo gene therapy.
[0416] In a specific embodiment, the nucleic acid sequences are
directly administered in vivo, where it is expressed to produce the
encoded product. This can be accomplished by any of numerous
methods known in the art, e.g., by constructing them as part of an
appropriate nucleic acid expression vector and administering it so
that they become intracellular, e.g., by infection using defective
or attenuated retrovirals or other viral vectors (see U.S. Pat. No.
4,980,286), or by direct injection of naked DNA, or by use of
microparticle bombardment (e.g., a gene gun; BIOLISTIC.TM.,
DUPONT.TM.), or coating with lipids or cell-surface receptors or
transfecting agents, encapsulation in liposomes, microparticles, or
microcapsules, or by administering them in linkage to a peptide
which is known to enter the nucleus, by administering it in linkage
to a ligand subject to receptor-mediated endocytosis (see, e.g., Wu
and Wu, J. Biol. Chem. 262:4429-4432 (1987)) (which can be used to
target cell types specifically expressing the receptors), etc. In
another embodiment, nucleic acid-ligand complexes can be formed in
which the ligand comprises a fusogenic viral peptide to disrupt
endosomes, allowing the nucleic acid to avoid lysosomal
degradation. In yet another embodiment, the nucleic acid can be
targeted in vivo for cell specific uptake and expression, by
targeting a specific receptor (see, e.g., PCT Publications WO
92/06180; WO 92/22635; WO92/20316; WO93/14188, WO 93/20221).
Alternatively, the nucleic acid can be introduced intracellularly
and incorporated within host cell DNA for expression, by homologous
recombination (Koller and Smithies, Proc. Natl. Acad. Sci. USA
86:8932-8935 (1989); Zijlstra et al., Nature 342:435-438
(1989)).
[0417] In a specific embodiment, viral vectors that contains
nucleic acid sequences encoding an antibody of the invention are
used. For example, a retroviral vector can be used (see Miller et
al., Meth. Enzymol. 217:581-599 (1993)). These retroviral vectors
contain the components necessary for the correct packaging of the
viral genome and integration into the host cell DNA. The nucleic
acid sequences encoding the antibody to be used in gene therapy are
cloned into one or more vectors, which facilitates delivery of the
gene into a patient. More detail about retroviral vectors can be
found in Boesen et al., Biotherapy 6:291-302 (1994), which
describes the use of a retroviral vector to deliver the mdr1 gene
to hematopoietic stem cells in order to make the stem cells more
resistant to chemotherapy. Other references illustrating the use of
retroviral vectors in gene therapy are: Clowes et al., J. Clin.
Invest. 93:644-651 (1994); Kiem et al., Blood 83:1467-1473 (1994);
Salmons and Gunzberg, Human Gene Therapy 4:129-141 (1993); and
Grossman and Wilson, Curr. Opin. in Genetics and Devel. 3:110-114
(1993).
[0418] Adenoviruses are other viral vectors that can be used in
gene therapy. Adenoviruses are especially attractive vehicles for
delivering genes to respiratory epithelia. Adenoviruses naturally
infect respiratory epithelia where they cause a mild disease. Other
targets for adenovirus-based delivery systems are liver, the
central nervous system, endothelial cells, and muscle. Adenoviruses
have the advantage of being capable of infecting non-dividing
cells. Kozarsky and Wilson, Current Opinion in Genetics and
Development 3:499-503 (1993) present a review of adenovirus-based
gene therapy. Bout et al., Human Gene Therapy 5:3-10 (1994)
demonstrated the use of adenovirus vectors to transfer genes to the
respiratory epithelia of rhesus monkeys. Other instances of the use
of adenoviruses in gene therapy can be found in Rosenfeld et al.,
Science 252:431-434 (1991); Rosenfeld et al., Cell 68:143-155
(1992); Mastrangeli et al., J. Clin. Invest. 91:225-234 (1993); PCT
Publication WO94/12649; and Wang, et al., Gene Therapy 2:775-783
(1995). In a preferred embodiment, adenovirus vectors are used.
[0419] Adeno-associated virus (AAV) has also been proposed for use
in gene therapy (Walsh et al., Proc. Soc. Exp. Biol. Med.
204:289-300 (1993); U.S. Pat. No. 5,436,146).
[0420] Another approach to gene therapy involves transferring a
gene to cells in tissue culture by such methods as electroporation,
lipofection, calcium phosphate mediated transfection, or viral
infection. Usually, the method of transfer includes the transfer of
a selectable marker to the cells. The cells are then placed under
selection to isolate those cells that have taken up and are
expressing the transferred gene. Those cells are then delivered to
a patient.
[0421] In this embodiment, the nucleic acid is introduced into a
cell prior to administration in vivo of the resulting recombinant
cell. Such introduction can be carried out by any method known in
the art, including but not limited to transfection,
electroporation, microinjection, infection with a viral or
bacteriophage vector containing the nucleic acid sequences, cell
fusion, chromosome-mediated gene transfer, microcell-mediated gene
transfer, spheroplast fusion, etc. Numerous techniques are known in
the art for the introduction of foreign genes into cells (see,
e.g., Loeffler and Behr, Meth. Enzymol. 217:599-618 (1993); Cohen
et al., Meth. Enzymol. 217:618-644 (1993); Cline, Pharmac. Ther.
29:69-92m (1985) and may be used in accordance with the present
invention, provided that the necessary developmental and
physiological functions of the recipient cells are not disrupted.
The technique should provide for the stable transfer of the nucleic
acid to the cell, so that the nucleic acid is expressible by the
cell and preferably heritable and expressible by its cell
progeny.
[0422] The resulting recombinant cells can be delivered to a
patient by various methods known in the art. Recombinant blood
cells (e.g., hematopoietic stem or progenitor cells) are preferably
administered intravenously. The amount of cells envisioned for use
depends on the desired effect, patient state, etc., and can be
determined by one skilled in the art.
[0423] Cells into which a nucleic acid can be introduced for
purposes of gene therapy encompass any desired, available cell
type, and include but are not limited to epithelial cells,
endothelial cells, keratinocytes, fibroblasts, muscle cells,
hepatocytes; blood cells such as T lymphocytes, B lymphocytes,
monocytes, macrophages, neutrophils, eosinophils, megakaryocytes,
granulocytes; various stem or progenitor cells, in particular
hematopoietic stem or progenitor cells, e.g., as obtained from bone
marrow, umbilical cord blood, peripheral blood, fetal liver,
etc.
[0424] In a preferred embodiment, the cell used for gene therapy is
autologous to the patient.
[0425] In an embodiment in which recombinant cells are used in gene
therapy, nucleic acid sequences encoding an antibody are introduced
into the cells such that they are expressible by the cells or their
progeny, and the recombinant cells are then administered in vivo
for therapeutic effect. In a specific embodiment, stem or
progenitor cells are used. Any stem and/or progenitor cells which
can be isolated and maintained in vitro can potentially be used in
accordance with this embodiment of the present invention (see e.g.
PCT Publication WO 94/08598; Stemple and Anderson, Cell 71:973-985
(1992); Rheinwald, Meth. Cell Bio. 21A:229 (1980); and Pittelkow
and Scott, Mayo Clinic Proc. 61:771 (1986)).
[0426] In a specific embodiment, the nucleic acid to be introduced
for purposes of gene therapy comprises an inducible promoter
operably linked to the coding region, such that expression of the
nucleic acid is controllable by controlling the presence or absence
of the appropriate inducer of transcription.
Demonstration of Therapeutic or Prophylactic Activity
[0427] The compounds or pharmaceutical compositions of the
invention are preferably tested in vitro, and then in vivo for the
desired therapeutic or prophylactic activity, prior to use in
humans. For example, in vitro assays to demonstrate the therapeutic
or prophylactic utility of a compound or pharmaceutical composition
include, the effect of a compound on a cell line or a patient
tissue sample. The effect of the compound or composition on the
cell line and/or tissue sample can be determined utilizing
techniques known to those of skill in the art including, but not
limited to, rosette formation assays and cell lysis assays. In
accordance with the invention, in vitro assays which can be used to
determine whether administration of a specific compound is
indicated, include in vitro cell culture assays in which a patient
tissue sample is grown in culture, and exposed to or otherwise
administered a compound, and the effect of such compound upon the
tissue sample is observed.
Therapeutic/Prophylactic Administration and Composition
[0428] The invention provides methods of treatment, inhibition and
prophylaxis by administration to a subject of an effective amount
of a compound or pharmaceutical composition of the invention,
preferably an antibody of the invention. In a preferred aspect, the
compound is substantially purified (e.g., substantially free from
substances that limit its effect or produce undesired
side-effects). The subject is preferably an animal, including but
not limited to animals such as cows, pigs, horses, chickens, cats,
dogs, etc., and is preferably a mammal, and most preferably
human.
[0429] Formulations and methods of administration that can be
employed when the compound comprises a nucleic acid or an
immunoglobulin are described above; additional appropriate
formulations and routes of administration can be selected from
among those described herein below.
[0430] Various delivery systems are known and can be used to
administer a compound of the invention, e.g., encapsulation in
liposomes, microparticles, microcapsules, recombinant cells capable
of expressing the compound, receptor-mediated endocytosis (see,
e.g., Wu and Wu, J. Biol. Chem. 262:4429-4432 (1987)), construction
of a nucleic acid as part of a retroviral or other vector, etc.
Methods of introduction include but are not limited to intradermal,
intramuscular, intraperitoneal, intravenous, subcutaneous,
intranasal, epidural, and oral routes. The compounds or
compositions may be administered by any convenient route, for
example by infusion or bolus injection, by absorption through
epithelial or mucocutaneous linings (e.g., oral mucosa, rectal and
intestinal mucosa, etc.) and may be administered together with
other biologically active agents. Administration can be systemic or
local. In addition, it may be desirable to introduce the
pharmaceutical compounds or compositions of the invention into the
central nervous system by any suitable route, including
intraventricular and intrathecal injection; intraventricular
injection may be facilitated by an intraventricular catheter, for
example, attached to a reservoir, such as an Ommaya reservoir.
Pulmonary administration can also be employed, e.g., by use of an
inhaler or nebulizer, and formulation with an aerosolizing
agent.
[0431] In a specific embodiment, it may be desirable to administer
the pharmaceutical compounds or compositions of the invention
locally to the area in need of treatment; this may be achieved by,
for example, and not by way of limitation, local infusion during
surgery, topical application, e.g., in conjunction with a wound
dressing after surgery, by injection, by means of a catheter, by
means of a suppository, or by means of an implant, said implant
being of a porous, non-porous, or gelatinous material, including
membranes, such as sialastic membranes, or fibers. Preferably, when
administering a protein, including an antibody, of the invention,
care must be taken to use materials to which the protein does not
absorb.
[0432] In another embodiment, the compound or composition can be
delivered in a vesicle, in particular a liposome (see Langer,
Science 249:1527-1533 (1990); Treat et al., in Liposomes in the
Therapy of Infectious Disease and Cancer, Lopez-Berestein and
Fidler (eds.), Liss, New York, pp. 353-365 (1989); Lopez-Berestein,
ibid., pp. 317-327; see generally ibid.)
[0433] In yet another embodiment, the compound or composition can
be delivered in a controlled release system. In one embodiment, a
pump may be used (see Langer, supra; Sefton, CRC Crit. Ref. Biomed.
Eng. 14:201 (1987); Buchwald et al., Surgery 88:507 (1980); Saudek
et al., N. Engl. J. Med. 321:574 (1989)). In another embodiment,
polymeric materials can be used (see Medical Applications of
Controlled Release, Langer and Wise (eds.), CRC Pres., Boca Raton,
Fla. (1974); Controlled Drug Bioavailability, Drug Product Design
and Performance, Smolen and Ball (eds.), Wiley, New York (1984);
Ranger and Peppas, J., Macromol. Sci. Rev. Macromol. Chem. 23:61
(1983); see also Levy et al., Science 228:190 (1985); During et
al., Ann. Neurol. 25:351 (1989); Howard et al., J. Neurosurg.
71:105 (1989)). In yet another embodiment, a controlled release
system can be placed in proximity of the therapeutic target, i.e.,
the brain, thus requiring only a fraction of the systemic dose
(see, e.g., Goodson, in Medical Applications of Controlled Release,
supra, vol. 2, pp. 115-138 (1984)).
[0434] Other controlled release systems are discussed in the review
by Langer (Science 249:1527-1533 (1990)).
[0435] In a specific embodiment where the compound of the invention
is a nucleic acid encoding a protein, the nucleic acid can be
administered in vivo to promote expression of its encoded protein,
by constructing it as part of an appropriate nucleic acid
expression vector and administering it so that it becomes
intracellular, e.g., by use of a retroviral vector (see U.S. Pat.
No. 4,980,286), or by direct injection, or by use of microparticle
bombardment (e.g., a gene gun; BIOLISTIC.TM., DUPONT.TM.), or
coating with lipids or cell-surface receptors or transfecting
agents, or by administering it in linkage to a homeobox-like
peptide which is known to enter the nucleus (see e.g., Joliot et
al., Proc. Natl. Acad. Sci. USA 88:1864-1868 (1991)), etc.
Alternatively, a nucleic acid can be introduced intracellularly and
incorporated within host cell DNA for expression, by homologous
recombination.
[0436] The present invention also provides pharmaceutical
compositions. Such compositions comprise a therapeutically
effective amount of a compound, and a pharmaceutically acceptable
carrier. In a specific embodiment, the term "pharmaceutically
acceptable" means approved by a regulatory agency of the Federal or
a state government or listed in the U.S. Pharmacopeia or other
generally recognized pharmacopeia for use in animals, and more
particularly in humans. The term "carrier" refers to a diluent,
adjuvant, excipient, or vehicle with which the therapeutic is
administered. Such pharmaceutical carriers can be sterile liquids,
such as water and oils, including those of petroleum, animal,
vegetable or synthetic origin, such as peanut oil, soybean oil,
mineral oil, sesame oil and the like. Water is a preferred carrier
when the pharmaceutical composition is administered intravenously.
Saline solutions and aqueous dextrose and glycerol solutions can
also be employed as liquid carriers, particularly for injectable
solutions. Suitable pharmaceutical excipients include starch,
glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk,
silica gel, sodium stearate, glycerol monostearate, talc, sodium
chloride, dried skim milk, glycerol, propylene, glycol, water,
ethanol and the like. The composition, if desired, can also contain
minor amounts of wetting or emulsifying agents, or pH buffering
agents. These compositions can take the form of solutions,
suspensions, emulsion, tablets, pills, capsules, powders,
sustained-release formulations and the like. The composition can be
formulated as a suppository, with traditional binders and carriers
such as triglycerides. Oral formulation can include standard
carriers such as pharmaceutical grades of mannitol, lactose,
starch, magnesium stearate, sodium saccharine, cellulose, magnesium
carbonate, etc. Examples of suitable pharmaceutical carriers are
described in "Remington's Pharmaceutical Sciences" by E. W. Martin.
Such compositions will contain a therapeutically effective amount
of the compound, preferably in purified form, together with a
suitable amount of carrier so as to provide the form for proper
administration to the patient. The formulation should suit the mode
of administration.
[0437] In a preferred embodiment, the composition is formulated in
accordance with routine procedures as a pharmaceutical composition
adapted for intravenous administration to human beings. Typically,
compositions for intravenous administration are solutions in
sterile isotonic aqueous buffer. Where necessary, the composition
may also include a solubilizing agent and a local anesthetic such
as lignocaine to ease pain at the site of the injection. Generally,
the ingredients are supplied either separately or mixed together in
unit dosage form, for example, as a dry lyophilized powder or water
free concentrate in a hermetically sealed container such as an
ampoule or sachette indicating the quantity of active agent. Where
the composition is to be administered by infusion, it can be
dispensed with an infusion bottle containing sterile pharmaceutical
grade water or saline. Where the composition is administered by
injection, an ampoule of sterile water for injection or saline can
be provided so that the ingredients may be mixed prior to
administration.
[0438] The compounds of the invention can be formulated as neutral
or salt forms. Pharmaceutically acceptable salts include those
formed with anions such as those derived from hydrochloric,
phosphoric, acetic, oxalic, tartaric acids, etc., and those formed
with cations such as those derived from sodium, potassium,
ammonium, calcium, ferric hydroxides, isopropylamine,
triethylamine, 2-ethylamino ethanol, histidine, procaine, etc.
[0439] The amount of the compound of the invention which will be
effective in the treatment, inhibition and prevention of a disease
or disorder associated with aberrant expression and/or activity of
a polypeptide of the invention can be determined by standard
clinical techniques. In addition, in vitro assays may optionally be
employed to help identify optimal dosage ranges. The precise dose
to be employed in the formulation will also depend on the route of
administration, and the seriousness of the disease or disorder, and
should be decided according to the judgment of the practitioner and
each patient's circumstances. Effective doses may be extrapolated
from dose-response curves derived from in vitro or animal model
test systems.
[0440] For antibodies, the dosage administered to a patient is
typically 0.1 mg/kg to 100 mg/kg of the patient's body weight.
Preferably, the dosage administered to a patient is between 0.1
mg/kg and 20 mg/kg of the patient's body weight, more preferably 1
mg/kg to 10 mg/kg of the patient's body weight. Generally, human
antibodies have a longer half-life within the human body than
antibodies from other species due to the immune response to the
foreign polypeptides. Thus, lower dosages of human antibodies and
less frequent administration is often possible. Further, the dosage
and frequency of administration of antibodies of the invention may
be reduced by enhancing uptake and tissue penetration (e.g., into
the brain) of the antibodies by modifications such as, for example,
lipidation.
[0441] The invention also provides a pharmaceutical pack or kit
comprising one or more containers filled with one or more of the
ingredients of the pharmaceutical compositions of the invention.
Optionally associated with such container(s) can be a notice in the
form prescribed by a governmental agency regulating the
manufacture, use or sale of pharmaceuticals or biological products,
which notice reflects approval by the agency of manufacture, use or
sale for human administration.
Diagnosis and Imaging
[0442] Labeled antibodies, and derivatives and analogs thereof,
which specifically bind to a polypeptide of interest can be used
for diagnostic purposes to detect, diagnose, or monitor diseases,
disorders, and/or conditions associated with the aberrant
expression and/or activity of a polypeptide of the invention. The
invention provides for the detection of aberrant expression of a
polypeptide of interest, comprising (a) assaying the expression of
the polypeptide of interest in cells or body fluid of an individual
using one or more antibodies specific to the polypeptide interest
and (b) comparing the level of gene expression with a standard gene
expression level, whereby an increase or decrease in the assayed
polypeptide gene expression level compared to the standard
expression level is indicative of aberrant expression.
[0443] The invention provides a diagnostic assay for diagnosing a
disorder, comprising (a) assaying the expression of the polypeptide
of interest in cells or body fluid of an individual using one or
more antibodies specific to the polypeptide interest and (b)
comparing the level of gene expression with a standard gene
expression level, whereby an increase or decrease in the assayed
polypeptide gene expression level compared to the standard
expression level is indicative of a particular disorder. With
respect to cancer, the presence of a relatively high amount of
transcript in biopsied tissue from an individual may indicate a
predisposition for the development of the disease, or may provide a
means for detecting the disease prior to the appearance of actual
clinical symptoms. A more definitive diagnosis of this type may
allow health professionals to employ preventative measures or
aggressive treatment earlier thereby preventing the development or
further progression of the cancer.
[0444] Antibodies of the invention can be used to assay protein
levels in a biological sample using classical immunohistological
methods known to those of skill in the art (e.g., see Jalkanen, et
al., J. Cell. Biol. 101:976-985 (1985); Jalkanen, et al., J. Cell.
Biol. 105:3087-3096 (1987)). Other antibody-based methods useful
for detecting protein gene expression include immunoassays, such as
the enzyme linked immunosorbent assay (ELISA) and the
radioimmunoassay (RIA). Suitable antibody assay labels are known in
the art and include enzyme labels, such as, glucose oxidase;
radioisotopes, such as iodine (125I, 121I), carbon (14C), sulfur
(35S), tritium (3H), indium (112In), and technetium (99Tc);
luminescent labels, such as luminol; and fluorescent labels, such
as fluorescein and rhodamine, and biotin.
[0445] One aspect of the invention is the detection and diagnosis
of a disease or disorder associated with aberrant expression of a
polypeptide of interest in an animal, preferably a mammal and most
preferably a human. In one embodiment, diagnosis comprises: a)
administering (for example, parenterally, subcutaneously, or
intraperitoneally) to a subject an effective amount of a labeled
molecule which specifically binds to the polypeptide of interest;
b) waiting for a time interval following the administering for
permitting the labeled molecule to preferentially concentrate at
sites in the subject where the polypeptide is expressed (and for
unbound labeled molecule to be cleared to background level); c)
determining background level; and d) detecting the labeled molecule
in the subject, such that detection of labeled molecule above the
background level indicates that the subject has a particular
disease or disorder associated with aberrant expression of the
polypeptide of interest. Background level can be determined by
various methods including, comparing the amount of labeled molecule
detected to a standard value previously determined for a particular
system.
[0446] It will be understood in the art that the size of the
subject and the imaging system used will determine the quantity of
imaging moiety needed to produce diagnostic images. In the case of
a radioisotope moiety, for a human subject, the quantity of
radioactivity injected will normally range from about 5 to 20
millicuries of 99 mTc. The labeled antibody or antibody fragment
will then preferentially accumulate at the location of cells which
contain the specific protein. In vivo tumor imaging is described in
S. W. Burchiel et al., "Immunopharmacokinetics of Radiolabeled
Antibodies and Their Fragments." (Chapter 13 in Tumor Imaging: The
Radiochemical Detection of Cancer, S. W. Burchiel and B. A. Rhodes,
eds., Masson Publishing Inc. (1982).
[0447] Depending on several variables, including the type of label
used and the mode of administration, the time interval following
the administration for permitting the labeled molecule to
preferentially concentrate at sites in the subject and for unbound
labeled molecule to be cleared to background level is 6 to 48 hours
or 6 to 24 hours or 6 to 12 hours. In another embodiment the time
interval following administration is 5 to 20 days or 5 to 10
days.
[0448] In an embodiment, monitoring of the disease or disorder is
carried out by repeating the method for diagnosing the disease or
disease, for example, one month after initial diagnosis, six months
after initial diagnosis, one year after initial diagnosis, etc.
[0449] Presence of the labeled molecule can be detected in the
patient using methods known in the art for in vivo scanning. These
methods depend upon the type of label used. Skilled artisans will
be able to determine the appropriate method for detecting a
particular label. Methods and devices that may be used in the
diagnostic methods of the invention include, but are not limited
to, computed tomography (CT), whole body scan such as position
emission tomography (PET), magnetic resonance imaging (MRI), and
sonography.
[0450] In a specific embodiment, the molecule is labeled with a
radioisotope and is detected in the patient using a radiation
responsive surgical instrument (Thurston et al., U.S. Pat. No.
5,441,050). In another embodiment, the molecule is labeled with a
fluorescent compound and is detected in the patient using a
fluorescence responsive scanning instrument. In another embodiment,
the molecule is labeled with a positron emitting metal and is
detected in the patent using positron emission-tomography. In yet
another embodiment, the molecule is labeled with a paramagnetic
label and is detected in a patient using magnetic resonance imaging
(MRI).
[0451] Kits
[0452] The present invention provides kits that can be used in the
above methods. In one embodiment, a kit comprises an antibody of
the invention, preferably a purified antibody, in one or more
containers. In a specific embodiment, the kits of the present
invention contain a substantially isolated polypeptide comprising
an epitope which is specifically immunoreactive with an antibody
included in the kit. Preferably, the kits of the present invention
further comprise a control antibody which does not react with the
polypeptide of interest. In another specific embodiment, the kits
of the present invention contain a means for detecting the binding
of an antibody to a polypeptide of interest (e.g., the antibody may
be conjugated to a detectable substrate such as a fluorescent
compound, an enzymatic substrate, a radioactive compound or a
luminescent compound, or a second antibody which recognizes the
first antibody may be conjugated to a detectable substrate).
[0453] In another specific embodiment of the present invention, the
kit is a diagnostic kit for use in screening serum containing
antibodies specific against proliferative and/or cancerous
polynucleotides and polypeptides. Such a kit may include a control
antibody that does not react with the polypeptide of interest. Such
a kit may include a substantially isolated polypeptide antigen
comprising an epitope which is specifically immunoreactive with at
least one anti-polypeptide antigen antibody. Further, such a kit
includes means for detecting the binding of said antibody to the
antigen (e.g., the antibody may be conjugated to a fluorescent
compound such as fluorescein or rhodamine which can be detected by
flow cytometry). In specific embodiments, the kit may include a
recombinantly produced or chemically synthesized polypeptide
antigen. The polypeptide antigen of the kit may also be attached to
a solid support.
[0454] In a more specific embodiment the detecting means of the
above-described kit includes a solid support to which said
polypeptide antigen is attached. Such a kit may also include a
non-attached reporter-labeled anti-human antibody. In this
embodiment, binding of the antibody to the polypeptide antigen can
be detected by binding of the said reporter-labeled antibody.
[0455] In an additional embodiment, the invention includes a
diagnostic kit for use in screening serum containing antigens of
the polypeptide of the invention. The diagnostic kit includes a
substantially isolated antibody specifically immunoreactive with
polypeptide or polynucleotide antigens, and means for detecting the
binding of the polynucleotide or polypeptide antigen to the
antibody. In one embodiment, the antibody is attached to a solid
support. In a specific embodiment, the antibody may be a monoclonal
antibody. The detecting means of the kit may include a second,
labeled monoclonal antibody. Alternatively, or in addition, the
detecting means may include a labeled, competing antigen.
[0456] In one diagnostic configuration, test serum is reacted with
a solid phase reagent having a surface-bound antigen obtained by
the methods of the present invention. After binding with specific
antigen antibody to the reagent and removing unbound serum
components by washing, the reagent is reacted with reporter-labeled
anti-human antibody to bind reporter to the reagent in proportion
to the amount of bound anti-antigen antibody on the solid support.
The reagent is again washed to remove unbound labeled antibody, and
the amount of reporter associated with the reagent is determined.
Typically, the reporter is an enzyme which is detected by
incubating the solid phase in the presence of a suitable
fluorometric, luminescent or colorimetric substrate (SIGMA.TM., St.
Louis, Mo.).
[0457] The solid surface reagent in the above assay is prepared by
known techniques for attaching protein material to solid support
material, such as polymeric beads, dip sticks, 96-well plate or
filter material. These attachment methods generally include
non-specific adsorption of the protein to the support or covalent
attachment of the protein, typically through a free amine group, to
a chemically reactive group on the solid support, such as an
activated carboxyl, hydroxyl, or aldehyde group. Alternatively,
streptavidin coated plates can be used in conjunction with
biotinylated antigen(s).
[0458] Thus, the invention provides an assay system or kit for
carrying out this diagnostic method. The kit generally includes a
support with surface-bound recombinant antigens, and a
reporter-labeled anti-human antibody for detecting surface-bound
anti-antigen antibody.
Fusion Proteins
[0459] Any G-protein Chemokine Receptor (CCR5) polypeptide can be
used to generate fusion proteins. For example, the G-protein
Chemokine Receptor (CCR5) polypeptide, when fused to a second
protein, can be used as an antigenic tag. Antibodies raised against
the G-protein Chemokine Receptor (CCR5) polypeptide can be used to
indirectly detect the second protein by binding to the G-protein
Chemokine Receptor. Moreover, because secreted proteins target
cellular locations based on trafficking signals, the G-protein
Chemokine Receptor (CCR5) polypeptides can be used as targeting
molecules once fused to other proteins.
[0460] Examples of domains that can be fused to G-protein Chemokine
Receptor (CCR5) polypeptides include not only heterologous signal
sequences, but also other heterologous functional regions. The
fusion does not necessarily need to be direct, but may occur
through linker sequences.
[0461] In certain preferred embodiments, G-protein Chemokine
Receptor (CCR5) proteins of the invention comprise fusion proteins
wherein the G-protein Chemokine Receptor (CCR5) polypeptides are
those described above as m-n. In preferred embodiments, the
application is directed to nucleic acid molecules at least 90%,
95%, 96%, 97%, 98% or 99% identical to the nucleic acid sequences
encoding polypeptides having the amino acid sequence of the
specific N- and C-terminal deletions recited herein.
Polynucleotides encoding these polypeptides are also encompassed by
the invention.
[0462] Moreover, fusion proteins may also be engineered to improve
characteristics of the G-protein Chemokine Receptor (CCR5)
polypeptide. For instance, a region of additional amino acids,
particularly charged amino acids, may be added to the N-terminus of
the G-protein Chemokine Receptor (CCR5) polypeptide to improve
stability and persistence during purification from the host cell or
subsequent handling and storage. Also, peptide moieties may be
added to the G-protein Chemokine Receptor (CCR5) polypeptide to
facilitate purification. Such regions may be removed prior to final
preparation of the G-protein Chemokine Receptor (CCR5) polypeptide.
The addition of peptide moieties to facilitate handling of
polypeptides are familiar and routine techniques in the art.
[0463] As one of skill in the art will appreciate, polypeptides of
the present invention and the epitope-bearing fragments thereof
described above, can be combined with heterologous polypeptide
sequences. For example, polypeptides of the present invention
(including fragments or variants thereof), may be fused with the
constant domain of immunoglobulins (IgA, IgE, IgG, IgM), or
portions thereof (CH1, CH2, CH3, or any combination thereof and
portions thereof, resulting in chimeric polypeptides. By way of
another non-limiting example, polypeptides and/or antibodies of the
present invention (including fragments or variants thereof) may be
fused with albumin (including but not limited to recombinant human
serum albumin or fragments or variants thereof (see, e.g., U.S.
Pat. No. 5,876,969, issued Mar. 2, 1999, EP Patent 0 413 622, and
U.S. Pat. No. 5,766,883, issued Jun. 16, 1998, herein incorporated
by reference in their entirety)). In a preferred embodiment,
polypeptides and/or antibodies of the present invention (including
fragments or variants thereof) are fused with the mature form of
human serum albumin (i.e., amino acids 1-585 of human serum albumin
as shown in FIGS. 1 and 2 of EP Patent 0 322 094) which is herein
incorporated by reference in its entirety. In another preferred
embodiment, polypeptides and/or antibodies of the present invention
(including fragments or variants thereof) are fused with
polypeptide fragments comprising, or alternatively consisting of,
amino acid residues 1-z of human serum albumin, where z is an
integer from 369 to 419, as described in U.S. Pat. No. 5,766,883
herein incorporated by reference in its entirety. Polypeptides
and/or antibodies of the present invention (including fragments or
variants thereof) may be fused to either the N- or C-terminal end
of the heterologous protein (e.g., immunoglobulin Fc polypeptide or
human serum albumin polypeptide). Polynucleotides encoding fusion
proteins of the invention are also encompassed by the
invention.
[0464] These fusion proteins facilitate purification and show an
increased half-life in vivo. One reported example describes
chimeric proteins consisting of the first two domains of the human
CD4-polypeptide and various domains of the constant regions of the
heavy or light chains of mammalian immunoglobulins. (EP A 394,827;
Traunecker et al., Nature 331:84-86 (1988).) Fusion proteins having
disulfide-linked dimeric structures (due to the IgG) can also be
more efficient in binding and neutralizing other molecules, than
the monomeric secreted protein or protein fragment alone.
(Fountoulakis et al., J. Biochem. 270:3958-3964 (1995).)
[0465] Similarly, EP-A-O 464 533 (Canadian counterpart 2045869)
discloses fusion proteins comprising various portions of constant
region of immunoglobulin molecules together with another human
protein or part thereof. In many cases, the Fc part in a fusion
protein is beneficial in therapy and diagnosis, and thus can result
in, for example, improved pharmacokinetic properties. (EP-A 0232
262.) Alternatively, deleting the Fc part after the fusion protein
has been expressed, detected, and purified, would be desired. For
example, the Fc portion may hinder therapy and diagnosis if the
fusion protein is used as an antigen for immunizations. In drug
discovery, for example, human proteins, such as hIL-5, have been
fused with Fc portions for the purpose of high-throughput screening
assays to identify antagonists of hIL-5. (See, D. Bennett et al.,
J. Molecular Recognition 8:52-58 (1995); K. Johanson et al., J.
Biol. Chem. 270:9459-9471 (1995).)
[0466] Moreover, the G-protein Chemokine Receptor (CCR5)
polypeptides can be fused to marker sequences, such as a peptide
which facilitates purification of G-protein Chemokine Receptor. In
preferred embodiments, the marker amino acid sequence is a
hexa-histidine peptide, such as the tag provided in a pQE vector
(QIAGEN, Inc., 9259 Eton Avenue, Chatsworth, Calif., 91311), among
others, many of which are commercially available. As described in
Gentz et al., Proc. Natl. Acad. Sci. USA 86:821-824 (1989), for
instance, hexa-histidine provides for convenient purification of
the fusion protein. Another peptide tag useful for purification,
the "HA" tag, corresponds to an epitope derived from the influenza
hemagglutinin protein. (Wilson et al., Cell 37:767 (1984).)
[0467] Thus, any of these above fusions can be engineered using the
G-protein Chemokine Receptor (CCR5) polynucleotides or the
polypeptides.
Vectors, Host Cells, and Protein Production
[0468] The present invention also relates to vectors containing the
G-protein Chemokine Receptor (CCR5) polynucleotide, host cells, and
the production of polypeptides by recombinant techniques. The
vector may be, for example, a phage, plasmid, viral, or retroviral
vector. Retroviral vectors may be replication competent or
replication defective. In the latter case, viral propagation
generally will occur only in complementing host cells.
[0469] G-protein Chemokine Receptor (CCR5) polynucleotides may be
joined to a vector containing a selectable marker for propagation
in a host. Generally, a plasmid vector is introduced in a
precipitate, such as a calcium phosphate precipitate, or in a
complex with a charged lipid. If the vector is a virus, it may be
packaged in vitro using an appropriate packaging cell line and then
transduced into host cells.
[0470] The G-protein Chemokine Receptor (CCR5) polynucleotide
insert should be operatively linked to an appropriate promoter,
such as the phage lambda PL promoter, the E. coli lac, trp, phoA
and tac promoters, the SV40 early and late promoters and promoters
of retroviral LTRs, to name a few. Other suitable promoters will be
known to the skilled artisan. The expression constructs will
further contain sites for transcription initiation, termination,
and, in the transcribed region, a ribosome binding site for
translation. The coding portion of the transcripts expressed by the
constructs will preferably include a translation initiating codon
at the beginning and a termination codon (UAA, UGA or UAG)
appropriately positioned at the end of the polypeptide to be
translated.
[0471] As indicated, the expression vectors will preferably include
at least one selectable marker. Such markers include dihydrofolate
reductase, G418, glutamine synthase or neomycin resistance for
eukaryotic cell culture and tetracycline, kanamycin or ampicillin
resistance genes for culturing in E. coli and other bacteria.
Representative examples of appropriate hosts include, but are not
limited to, bacterial cells, such as E. coli, Streptomyces and
Salmonella typhimurium cells; fungal cells, such as yeast cells
(e.g., Saccharomyces cerevisiae or Pichia pastoris (ATCC.TM.
Accession No. 201178)); insect cells such as Drosophila S2 and
Spodoptera Sf9 cells; animal cells such as CHO, NSO, COS, 293, and
Bowes melanoma cells; and plant cells. Appropriate culture mediums
and conditions for the above-described host cells are known in the
art.
[0472] Vectors which use glutamine synthase (GS) or DHFR as the
selectable markers can be amplified in the presence of the drugs
methionine sulphoximine or methotrexate, respectively. The
availability of drugs which inhibit the function of the enzymes
encoded by these selectable markers allows for selection of cell
lines in which the vector sequences have been amplified after
integration into the host cell's DNA. An advantage of glutamine
synthase based vectors are the availability of cell lines (e.g.,
the murine myeloma cell line, NS0) which are glutamine synthase
negative. Glutamine synthase expression systems can also function
in glutamine synthase expressing cells (e.g. Chinese Hamster Ovary
(CHO) cells) by providing additional inhibitor to prevent the
functioning of the endogenous gene. Vectors that use glutamine
synthase as the selectable marker include the pEE6 expression
vector described in Stephens and Cockett, Nucl. Acids. Res 17:7110
(1989). A glutamine synthase expression system and components
thereof are detailed in PCT publications: WO87/04462; WO86/05807;
WO89/01036; WO89/10404; and WO91/06657 which are hereby
incorporated in their entireties by reference herein. Additionally,
glutamine synthase expression vectors that may be used according to
the present invention are commercially available from suppliers
including, for example, Lonza Biologics, Inc. (Portsmouth, N.H.).
Expression and production of monoclonal antibodies using a GS
expression system in murine myeloma cells is described in
Bebbington et al., Bio/technology 10:169 (1992) and in Biblia and
Robinson Biotechnol. Prog. 11:1 (1995) which are herein
incorporated by reference.
[0473] Among vectors preferred for use in bacteria include pQE70,
pQE60 and pQE-9, available from QIAGEN, Inc.; pBLUESCRIPT.TM.
vectors, Phagescript vectors, pNH8A, pNH16a, pNH18A, pNH46A,
available from Stratagene Cloning Systems, Inc.; and ptrc99a,
pKK223-3, pKK233-3, pDR540, pRIT5 available from PHARMACIA.TM.
Biotech, Inc. Among preferred eukaryotic vectors are pWLNEO,
pSV2CAT, pOG44, pXT1 and pSG available from STRATAGENE.TM.; and
pSVK3, pBPV, pMSG and pSVL available from PHARMACIA.TM.. Preferred
expression vectors for use in yeast systems include, but are not
limited to pYES2, pYD1, pTEF1/Zeo, pYES2/GS, pPICZ, pGAPZ,
pGAPZalph, pPIC9, pPIC3.5, pHIL-D2, pHIL-S1, pPIC3.5K, pPIC9K, and
PAO815 (all available from Invitrogen, Carlsbad, Calif.). Other
suitable vectors will be readily apparent to the skilled
artisan.
[0474] Introduction of the construct into the host cell can be
effected by calcium phosphate transfection, DEAE-dextran mediated
transfection, cationic lipid-mediated transfection,
electroporation, transduction, infection, or other methods. Such
methods are described in many standard laboratory manuals, such as
Davis et al., Basic Methods In Molecular Biology (1986). It is
specifically contemplated that G-protein Chemokine Receptor (CCR5)
polypeptides may in fact be expressed by a host cell lacking a
recombinant vector.
[0475] G-protein Chemokine Receptor (CCR5) polypeptides can be
recovered and purified from recombinant cell cultures by well-known
methods including ammonium sulfate or ethanol precipitation, acid
extraction, anion or cation exchange chromatography,
phosphocellulose chromatography, hydrophobic interaction
chromatography, affinity chromatography, hydroxylapatite
chromatography and lectin chromatography. Most preferably, high
performance liquid chromatography ("HPLC") is employed for
purification.
[0476] G-protein Chemokine Receptor (CCR5) polypeptides, and
preferably the secreted form, can also be recovered from: products
purified from natural sources, including bodily fluids, tissues and
cells, whether directly isolated or cultured; products of chemical
synthetic procedures; and products produced by recombinant
techniques from a prokaryotic or eukaryotic host, including, for
example, bacterial, yeast, higher plant, insect, and mammalian
cells. Depending upon the host employed in a recombinant production
procedure, the G-protein Chemokine Receptor (CCR5) polypeptides may
be glycosylated or may be non-glycosylated. In addition, G-protein
Chemokine Receptor (CCR5) polypeptides may also include an initial
modified methionine residue, in some cases as a result of
host-mediated processes. Thus, it is well known in the art that the
N-terminal methionine encoded by the translation initiation codon
generally is removed with high efficiency from any protein after
translation in all eukaryotic cells. While the N-terminal
methionine on most proteins also is efficiently removed in most
prokaryotes, for some proteins, this prokaryotic removal process is
inefficient, depending on the nature of the amino acid to which the
N-terminal methionine is covalently linked.
[0477] In one embodiment, the yeast Pichia pastoris is used to
express G-protein Chemokine Receptor (CCR5) protein in a eukaryotic
system. Pichia pastoris is a methylotrophic yeast which can
metabolize methanol as its sole carbon source. A main step in the
methanol metabolization pathway is the oxidation of methanol to
formaldehyde using O.sub.2. This reaction is catalyzed by the
enzyme alcohol oxidase. In order to metabolize methanol as its sole
carbon source, Pichia pastoris must generate high levels of alcohol
oxidase due, in part, to the relatively low affinity of alcohol
oxidase for O.sub.2. Consequently, in a growth medium depending on
methanol as a main carbon source, the promoter region of one of the
two alcohol oxidase genes (AOX1) is highly active. In the presence
of methanol, alcohol oxidase produced from the AOX1 gene comprises
up to approximately 30% of the total soluble protein in Pichia
pastoris. See, Ellis, S. B., et al., Mol. Cell. Biol. 5:1111-21
(1985); Koutz, P. J, et al., Yeast 5:167-77 (1989); Tschopp, J. F.,
et al., Nucl. Acids Res. 15:3859-76 (1987). Thus, a heterologous
coding sequence, such as, for example, a G-protein Chemokine
Receptor (CCR5) polynucleotide of the present invention, under the
transcriptional regulation of all or part of the AOX1 regulatory
sequence is expressed at exceptionally high levels in Pichia yeast
grown in the presence of methanol.
[0478] In one example, the plasmid vector pPIC9K is used to express
DNA encoding a G-protein Chemokine Receptor (CCR5) polypeptide of
the invention, as set forth herein, in a Pichia yeast system
essentially as described in "Pichia Protocols: Methods in Molecular
Biology," D. R. Higgins and J. Cregg, eds. The Humana Press,
Totowa, N.J., 1998. This expression vector allows expression and
secretion of a G-protein Chemokine Receptor (CCR5) protein of the
invention by virtue of the strong AOX1 promoter linked to the
Pichia pastoris alkaline phosphatase (PHO) secretory signal peptide
(i.e., leader) located upstream of a multiple cloning site.
[0479] Many other yeast vectors could be used in place of pPIC9K,
such as, pYES2, pYD1, pTEF1/Zeo, pYES2/GS, pPICZ, pGAPZ,
pGAPZalpha, pPIC9, pPIC3.5, pHIL-D2, pHIL-S1, pPIC3.5K, and PAO815,
as one skilled in the art would readily appreciate, as long as the
proposed expression construct provides appropriately located
signals for transcription, translation, secretion (if desired), and
the like, including an in-frame AUG as required.
[0480] In another embodiment, high-level expression of a
heterologous coding sequence, such as, for example, a G-protein
Chemokine Receptor (CCR5) polynucleotide of the present invention,
may be achieved by cloning the heterologous polynucleotide of the
invention into an expression vector such as, for example, pGAPZ or
pGAPZalpha, and growing the yeast culture in the absence of
methanol.
[0481] In addition to encompassing host cells containing the vector
constructs discussed herein, the invention also encompasses
primary, secondary, and immortalized host cells of vertebrate
origin, particularly mammalian origin, that have been engineered to
delete or replace endogenous genetic material (e.g., G-protein
Chemokine Receptor (CCR5) coding sequence), and/or to include
genetic material (e.g., heterologous polynucleotide sequences) that
is operably associated with G-protein Chemokine Receptor (CCR5)
polynucleotides of the invention, and which activates, alters,
and/or amplifies endogenous G-protein Chemokine Receptor (CCR5)
polynucleotides. For example, techniques known in the art may be
used to operably associate heterologous control regions (e.g.,
promoter and/or enhancer) and endogenous G-protein Chemokine
Receptor (CCR5) polynucleotide sequences via homologous
recombination, resulting in the formation of a new transcription
unit (see, e.g., U.S. Pat. No. 5,641,670, issued Jun. 24, 1997;
U.S. Pat. No. 5,733,761, issued Mar. 31, 1998; International
Publication No. WO 96/29411, published Sep. 26, 1996; International
Publication No. WO 94/12650, published Aug. 4, 1994; Koller et al.,
Proc. Natl. Acad. Sci. USA 86:8932-8935 (1989); and Zijlstra et
al., Nature 342:435-438 (1989), the disclosures of each of which
are incorporated by reference in their entireties).
[0482] In addition, polypeptides of the invention can be chemically
synthesized using techniques known in the art (e.g., see Creighton,
1983, Proteins: Structures and Molecular Principles, W.H. Freeman
& Co., N.Y., and Hunkapiller et al., Nature, 310:105-111
(1984)). For example, a polypeptide corresponding to a fragment of
a G-protein Chemokine Receptor (CCR5) polypeptide can be
synthesized by use of a peptide synthesizer. Furthermore, if
desired, nonclassical amino acids or chemical amino acid analogs
can be introduced as a substitution or addition into the G-protein
Chemokine Receptor (CCR5) polypeptide sequence. Non-classical amino
acids include, but are not limited to, to the D-isomers of the
common amino acids, 2,4-diaminobutyric acid, a-amino isobutyric
acid, 4-aminobutyric acid, Abu, 2-amino butyric acid, g-Abu, e-Ahx,
6-amino hexanoic acid, Aib, 2-amino isobutyric acid, 3-amino
propionic acid, ornithine, norleucine, norvaline, hydroxyproline,
sarcosine, citrulline, homocitrulline, cysteic acid,
t-butylglycine, t-butylalanine, phenylglycine, cyclohexylalanine,
b-alanine, fluoro-amino acids, designer amino acids such as
b-methyl amino acids, Ca-methyl amino acids, Na-methyl amino acids,
and amino acid analogs in general. Furthermore, the amino acid can
be D (dextrorotary) or L (levorotary).
[0483] The invention encompasses G-protein Chemokine Receptor
(CCR5) polypeptides which are differentially modified during or
after translation, e.g., by glycosylation, acetylation,
phosphorylation, amidation, derivatization by known
protecting/blocking groups, proteolytic cleavage, linkage to an
antibody molecule or other cellular ligand, etc. Any of numerous
chemical modifications may be carried out by known techniques,
including but not limited, to specific chemical cleavage by
cyanogen bromide, trypsin, chymotrypsin, papain, V8 protease,
NaBH.sub.4; acetylation, formylation, oxidation, reduction;
metabolic synthesis in the presence of tunicamycin; etc.
[0484] Additional post-translational modifications encompassed by
the invention include, for example, e.g., N-linked or O-linked
carbohydrate chains, processing of N-terminal or C-terminal ends),
attachment of chemical moieties to the amino acid backbone,
chemical modifications of N-linked or O-linked carbohydrate chains,
and addition or deletion of an N-terminal methionine residue as a
result of procaryotic host cell expression. The polypeptides may
also be modified with a detectable label, such as an enzymatic,
fluorescent, isotopic or affinity label to allow for detection and
isolation of the protein.
[0485] Also provided by the invention are chemically modified
derivatives of the polypeptides of the invention which may provide
additional advantages such as increased solubility, stability and
circulating time of the polypeptide, or decreased immunogenicity
(see U.S. Pat. No. 4,179,337). The chemical moieties for
derivitization may be selected from water soluble polymers such as
polyethylene glycol, ethylene glycol/propylene glycol copolymers,
carboxymethylcellulose, dextran, polyvinyl alcohol and the like.
The polypeptides may be modified at random positions within the
molecule, or at predetermined positions within the molecule and may
include one, two, three or more attached chemical moieties.
[0486] The polymer may be of any molecular weight, and may be
branched or unbranched. For polyethylene glycol, the preferred
molecular weight is between about 1 kDa and about 100 kDa (the term
"about" indicating that in preparations of polyethylene glycol,
some molecules will weigh more, some less, than the stated
molecular weight) for ease in handling and manufacturing. Other
sizes may be used, depending on the desired therapeutic profile
(e.g., the duration of sustained release desired, the effects, if
any on biological activity, the ease in handling, the degree or
lack of antigenicity and other known effects of the polyethylene
glycol to a therapeutic protein or analog).
[0487] The polyethylene glycol molecules (or other chemical
moieties) should be attached to the protein with consideration of
effects on functional or antigenic domains of the protein. There
are a number of attachment methods available to those skilled in
the art, e.g., EP 0 401 384, herein incorporated by reference
(coupling PEG to G-CSF), see also Malik et al., Exp. Hematol.
20:1028-1035 (1992) (reporting pegylation of GM-CSF using tresyl
chloride). For example, polyethylene glycol may be covalently bound
through amino acid residues via a reactive group, such as, a free
amino or carboxyl group. Reactive groups are those to which an
activated polyethylene glycol molecule may be bound. The amino acid
residues having a free amino group may include lysine residues and
the N-terminal amino acid residues; those having a free carboxyl
group may include aspartic acid residues glutamic acid residues and
the C-terminal amino acid residue. Sulfhydryl groups may also be
used as a reactive group for attaching the polyethylene glycol
molecules. Preferred for therapeutic purposes is attachment at an
amino group, such as attachment at the N-terminus or lysine
group.
[0488] One may specifically desire proteins chemically modified at
the N-terminus. Using polyethylene glycol as an illustration of the
present composition, one may select from a variety of polyethylene
glycol molecules (by molecular weight, branching, etc.), the
proportion of polyethylene glycol molecules to protein
(polypeptide) molecules in the reaction mix, the type of pegylation
reaction to be performed, and the method of obtaining the selected
N-terminally pegylated protein. The method of obtaining the
N-terminally pegylated preparation (i.e., separating this moiety
from other monopegylated moieties if necessary) may be by
purification of the N-terminally pegylated material from a
population of pegylated protein molecules. Selective proteins
chemically modified at the N-terminus modification may be
accomplished by reductive alkylation which exploits differential
reactivity of different types of primary amino groups (lysine
versus the N-terminal) available for derivatization in a particular
protein. Under the appropriate reaction conditions, substantially
selective derivatization of the protein at the N-terminus with a
carbonyl group containing polymer is achieved.
[0489] The G-protein Chemokine Receptor (CCR5) polypeptides of the
invention may be in monomers or multimers (i.e., dimers, trimers,
tetramers and higher multimers). Accordingly, the present invention
relates to monomers and multimers of the G-protein Chemokine
Receptor (CCR5) polypeptides of the invention, their preparation,
and compositions (preferably, Therapeutics) containing them. In
specific embodiments, the polypeptides of the invention are
monomers, dimers, trimers or tetramers. In additional embodiments,
the multimers of the invention are at least dimers, at least
trimers, or at least tetramers.
[0490] Multimers encompassed by the invention may be homomers or
heteromers. As used herein, the term homomer, refers to a multimer
containing only polypeptides corresponding to the amino acid
sequence of SEQ ID NO:2 or encoded by the HDGNR10 DNA contained in
the deposited clone (including fragments, variants, splice
variants, and fusion proteins, corresponding to these as described
herein). These homomers may contain G-protein Chemokine Receptor
(CCR5) polypeptides having identical or different amino acid
sequences. In a specific embodiment, a homomer of the invention is
a multimer containing only G-protein Chemokine Receptor (CCR5)
polypeptides having an identical amino acid sequence. In another
specific embodiment, a homomer of the invention is a multimer
containing G-protein Chemokine Receptor (CCR5) polypeptides having
different amino acid sequences. In specific embodiments, the
multimer of the invention is a homodimer (e.g., containing
G-protein Chemokine Receptor (CCR5) polypeptides having identical
or different amino acid sequences) or a homotrimer (e.g.,
containing G-protein Chemokine Receptor (CCR5) polypeptides having
identical and/or different amino acid sequences). In additional
embodiments, the homomeric multimer of the invention is at least a
homodimer, at least a homotrimer, or at least a homotetramer.
[0491] As used herein, the term heteromer refers to a multimer
containing one or more heterologous polypeptides (i.e.,
polypeptides of different proteins) in addition to the G-protein
Chemokine Receptor (CCR5) polypeptides of the invention. In a
specific embodiment, the multimer of the invention is a
heterodimer, a heterotrimer, or a heterotetramer. In additional
embodiments, the heteromeric multimer of the invention is at least
a heterodimer, at least a heterotrimer, or at least a
heterotetramer.
[0492] Multimers of the invention may be the result of hydrophobic,
hydrophilic, ionic and/or covalent associations and/or may be
indirectly linked, by for example, liposome formation. Thus, in one
embodiment, multimers of the invention, such as, for example,
homodimers or homotrimers, are formed when polypeptides of the
invention contact one another in solution. In another embodiment,
heteromultimers of the invention, such as, for example,
heterotrimers or heterotetramers, are formed when polypeptides of
the invention contact antibodies to the polypeptides of the
invention (including antibodies to the heterologous polypeptide
sequence in a fusion protein of the invention) in solution. In
other embodiments, multimers of the invention are formed by
covalent associations with and/or between the G-protein Chemokine
Receptor (CCR5) polypeptides of the invention. Such covalent
associations may involve one or more amino acid residues contained
in the polypeptide sequence (e.g., that recited in SEQ ID NO:2, or
contained in the polypeptide encoded by the clone HDGNR10). In one
instance, the covalent associations are cross-linking between
cysteine residues located within the polypeptide sequences which
interact in the native (i.e., naturally occurring) polypeptide. In
another instance, the covalent associations are the consequence of
chemical or recombinant manipulation. Alternatively, such covalent
associations may involve one or more amino acid residues contained
in the heterologous polypeptide sequence in a G-protein Chemokine
Receptor (CCR5) fusion protein. In one example, covalent
associations are between the heterologous sequence contained in a
fusion protein of the invention (see, e.g., U.S. Pat. No.
5,478,925). In a specific example, the covalent associations are
between the heterologous sequence contained in a G-protein
Chemokine Receptor-Fc fusion protein of the invention (as described
herein). In another specific example, covalent associations of
fusion proteins of the invention are between heterologous
polypeptide sequence from another protein that is capable of
forming covalently associated multimers, such as for example,
oseteoprotegerin (see, e.g., International Publication NO: WO
98/49305, the contents of which are herein incorporated by
reference in its entirety). In another embodiment, two or more
polypeptides of the invention are joined through peptide linkers.
Examples include those peptide linkers described in U.S. Pat. No.
5,073,627 (hereby incorporated by reference). Proteins comprising
multiple polypeptides of the invention separated by peptide linkers
may be produced using conventional recombinant DNA technology.
[0493] Another method for preparing multimer polypeptides of the
invention involves use of polypeptides of the invention fused to a
leucine zipper or isoleucine zipper polypeptide sequence. Leucine
zipper and isoleucine zipper domains are polypeptides that promote
multimerization of the proteins in which they are found. Leucine
zippers were originally identified in several DNA-binding proteins
(Landschulz et al., Science 240:1759, (1988)), and have since been
found in a variety of different proteins. Among the known leucine
zippers are naturally occurring peptides and derivatives thereof
that dimerize or trimerize. Examples of leucine zipper domains
suitable for producing soluble multimeric proteins of the invention
are those described in PCT application WO 94/10308, hereby
incorporated by reference. Recombinant fusion proteins comprising a
polypeptide of the invention fused to a polypeptide sequence that
dimerizes or trimerizes in solution are expressed in suitable host
cells, and the resulting soluble multimeric fusion protein is
recovered from the culture supernatant using techniques known in
the art.
[0494] Trimeric polypeptides of the invention may offer the
advantage of enhanced biological activity. Preferred leucine zipper
moieties and isoleucine moieties are those that preferentially form
trimers. One example is a leucine zipper derived from lung
surfactant protein D (SPD), as described in Hoppe et al. (FEBS
Letters 344:191, (1994)) and in U.S. patent application Ser. No.
08/446,922, hereby incorporated by reference. Other peptides
derived from naturally occurring trimeric proteins may be employed
in preparing trimeric polypeptides of the invention.
[0495] In another example, proteins of the invention are associated
by interactions between Flag.RTM. polypeptide sequence contained in
fusion proteins of the invention containing Flag.RTM. polypeptide
sequence. In a further embodiment, associations proteins of the
invention are associated by interactions between heterologous
polypeptide sequence contained in Flag.RTM. fusion proteins of the
invention and anti-Flag.RTM. antibody.
[0496] The multimers of the invention may be generated using
chemical techniques known in the art. For example, polypeptides
desired to be contained in the multimers of the invention may be
chemically cross-linked using linker molecules and linker molecule
length optimization techniques known in the art (see, e.g., U.S.
Pat. No. 5,478,925, which is herein incorporated by reference in
its entirety). Additionally, multimers of the invention may be
generated using techniques known in the art to form one or more
inter-molecule cross-links between the cysteine residues located
within the sequence of the polypeptides desired to be contained in
the multimer (see, e.g., U.S. Pat. No. 5,478,925, which is herein
incorporated by reference in its entirety). Further, polypeptides
of the invention may be routinely modified by the addition of
cysteine or biotin to the C terminus or N-terminus of the
polypeptide and techniques known in the art may be applied to
generate multimers containing one or more of these modified
polypeptides (see, e.g., U.S. Pat. No. 5,478,925, which is herein
incorporated by reference in its entirety). Additionally,
techniques known in the art may be applied to generate liposomes
containing the polypeptide components desired to be contained in
the multimer of the invention (see, e.g., U.S. Pat. No. 5,478,925,
which is herein incorporated by reference in its entirety).
[0497] Alternatively, multimers of the invention may be generated
using genetic engineering techniques known in the art. In one
embodiment, polypeptides contained in multimers of the invention
are produced recombinantly using fusion protein technology
described herein or otherwise known in the art (see, e.g., U.S.
Pat. No. 5,478,925, which is herein incorporated by reference in
its entirety). In a specific embodiment, polynucleotides coding for
a homodimer of the invention are generated by ligating a
polynucleotide sequence encoding a polypeptide of the invention to
a sequence encoding a linker polypeptide and then further to a
synthetic polynucleotide encoding the translated product of the
polypeptide in the reverse orientation from the original C-terminus
to the N-terminus (lacking the leader sequence) (see, e.g., U.S.
Pat. No. 5,478,925, which is herein incorporated by reference in
its entirety). In another embodiment, recombinant techniques
described herein or otherwise known in the art are applied to
generate recombinant polypeptides of the invention which contain a
transmembrane domain (or hydrophobic or signal peptide) and which
can be incorporated by membrane reconstitution techniques into
liposomes (see, e.g., U.S. Pat. No. 5,478,925, which is herein
incorporated by reference in its entirety).
Uses of the G-Protein Chemokine Receptor (CCR5) Polynucleotides
[0498] The G-protein Chemokine Receptor (CCR5) polynucleotides
identified herein can be used in numerous ways as reagents. The
following description should be considered exemplary and utilizes
known techniques.
[0499] There exists an ongoing need to identify new chromosome
markers, since few chromosome marking reagents, based on actual
sequence data (repeat polymorphisms), are presently available.
[0500] Briefly, sequences can be mapped to chromosomes by preparing
PCR primers (preferably 15-25 bp) from the sequences shown in SEQ
ID NO:1 or from the deposited clone. Primers can be selected using
computer analysis so that primers do not span more than one
predicted exon in the genomic DNA. These primers are then used for
PCR screening of somatic cell hybrids containing individual human
chromosomes. Only those hybrids containing the human G-protein
Chemokine Receptor (CCR5) gene corresponding to the SEQ ID NO:1 or
to the deposited clone will yield an amplified fragment.
[0501] Similarly, somatic hybrids provide a rapid method of PCR
mapping the polynucleotides to particular chromosomes. Three or
more clones can be assigned per day using a single thermal cycler.
Moreover, sublocalization of the G-protein Chemokine Receptor
(CCR5) polynucleotides can be achieved with panels of specific
chromosome fragments. Other gene mapping strategies that can be
used include in situ hybridization, prescreening with labeled
flow-sorted chromosomes, and preselection by hybridization to
construct chromosome specific-cDNA libraries.
[0502] Precise chromosomal location of the G-protein Chemokine
Receptor (CCR5) polynucleotides can also be achieved using
fluorescence in situ hybridization (FISH) of a metaphase
chromosomal spread. This technique uses polynucleotides as short as
500 or 600 bases; however, polynucleotides 2,000-4,000 bp are
preferred. For a review of this technique, see Verma et al., "Human
Chromosomes: a Manual of Basic Techniques," Pergamon Press, New
York (1988).
[0503] For chromosome mapping, the G-protein Chemokine Receptor
(CCR5) polynucleotides can be used individually (to mark a single
chromosome or a single site on that chromosome) or in panels (for
marking multiple sites and/or multiple chromosomes). Preferred
polynucleotides correspond to the noncoding regions of the cDNAs or
genomic clone because the coding sequences are more likely
conserved within gene families, thus increasing the chance of cross
hybridization during chromosomal mapping.
[0504] Once a polynucleotide has been mapped to a precise
chromosomal location, the physical position of the polynucleotide
can be used in linkage analysis. Linkage analysis establishes
coinheritance between a chromosomal location and presentation of a
particular disease. (Disease mapping data are found, for example,
in V. McKusick, Mendelian Inheritance in Man (available on line
through Johns Hopkins University Welch Medical Library).) Assuming
1 megabase mapping resolution and one gene per 20 kb, a cDNA
precisely localized to a chromosomal region associated with the
disease could be one of 50-500 potential causative genes.
[0505] Thus, once coinheritance is established, differences in the
G-protein Chemokine Receptor (CCR5) polynucleotide and the
corresponding gene between affected and unaffected individuals can
be examined. First, visible structural alterations in the
chromosomes, such as deletions or translocations, are examined in
chromosome spreads or by PCR. If no structural alterations exist,
the presence of point mutations are ascertained. Mutations observed
in some or all affected individuals, but not in normal individuals,
indicates that the mutation may cause the disease. However,
complete sequencing of the G-protein Chemokine Receptor (CCR5)
polypeptide and the corresponding gene from several normal
individuals is required to distinguish the mutation from a
polymorphism. If a new polymorphism is identified, this polymorphic
polypeptide can be used for further linkage analysis.
[0506] Furthermore, increased or decreased expression of the gene
in affected individuals as compared to unaffected individuals can
be assessed using G-protein Chemokine Receptor (CCR5)
polynucleotides. Any of these alterations (altered expression,
chromosomal rearrangement, or mutation) can be used as a diagnostic
or prognostic marker.
[0507] Thus, the invention also provides a diagnostic method useful
during diagnosis of a disorder, involving measuring the expression
level of polynucleotides of the present invention in cells or body
fluid from an individual and comparing the measured gene expression
level with a standard level of polynucleotide expression level,
whereby an increase or decrease in the gene expression level
compared to the standard is indicative of a disorder.
[0508] In still another embodiment, the invention includes a kit
for analyzing samples for the presence of proliferative and/or
cancerous polynucleotides derived from a test subject. In a general
embodiment, the kit includes at least one polynucleotide probe
containing a nucleotide sequence that will specifically hybridize
with a polynucleotide of the present invention and a suitable
container. In a specific embodiment, the kit includes two
polynucleotide probes defining an internal region of the
polynucleotide of the present invention, where each probe has one
strand containing a 31' mer-end internal to the region. In a
further embodiment, the probes may be useful as primers for
polymerase chain reaction amplification.
[0509] Where a diagnosis of a disorder, has already been made
according to conventional methods, the present invention is useful
as a prognostic indicator, whereby patients exhibiting enhanced or
depressed polynucleotide of the present invention expression will
experience a worse clinical outcome relative to patients expressing
the gene at a level nearer the standard level.
[0510] By "measuring the expression level of polynucleotide of the
present invention" is intended qualitatively or quantitatively
measuring or estimating the level of the polypeptide of the present
invention or the level of the mRNA encoding the polypeptide in a
first biological sample either directly (e.g., by determining or
estimating absolute protein level or mRNA level) or relatively
(e.g., by comparing to the polypeptide level or mRNA level in a
second biological sample). Preferably, the polypeptide level or
mRNA level in the first biological sample is measured or estimated
and compared to a standard polypeptide level or mRNA level, the
standard being taken from a second biological sample obtained from
an individual not having the disorder or being determined by
averaging levels from a population of individuals not having a
disorder. As will be appreciated in the art, once a standard
polypeptide level or mRNA level is known, it can be used repeatedly
as a standard for comparison.
[0511] By "biological sample" is intended any biological sample
obtained from an individual, body fluid, cell line, tissue culture,
or other source which contains the polypeptide of the present
invention or mRNA. As indicated, biological samples include body
fluids (such as semen, lymph, sera, plasma, urine, synovial fluid
and spinal fluid) which contain the polypeptide of the present
invention, and other tissue sources found to express the
polypeptide of the present invention. Methods for obtaining tissue
biopsies and body fluids from mammals are well known in the art.
Where the biological sample is to include mRNA, a tissue biopsy is
the preferred source.
[0512] The method(s) provided above may preferably be applied in a
diagnostic method and/or kits in which polynucleotides and/or
polypeptides are attached to a solid support. In one exemplary
method, the support may be a "gene chip" or a "biological chip" as
described in U.S. Pat. Nos. 5,837,832, 5,874,219, and 5,856,174.
Further, such a gene chip with polynucleotides of the present
invention attached may be used to identify polymorphisms between
the polynucleotide sequences, with polynucleotides isolated from a
test subject. The knowledge of such polymorphisms (i.e. their
location, as well as, their existence) would be beneficial in
identifying disease loci for many disorders, including cancerous
diseases and conditions. Such a method is described in U.S. Pat.
Nos. 5,858,659 and 5,856,104. The US patents referenced supra are
hereby incorporated by reference in their entirety herein.
[0513] The present invention encompasses polynucleotides of the
present invention that are chemically synthesized, or reproduced as
peptide nucleic acids (PNA), or according to other methods known in
the art. The use of PNAs would serve as the preferred form if the
polynucleotides are incorporated onto a solid support, or gene
chip. For the purposes of the present invention, a peptide nucleic
acid (PNA) is a polyamide type of DNA analog and the monomeric
units for adenine, guanine, thymine and cytosine are available
commercially (Perceptive Biosystems). Certain components of DNA,
such as phosphorus, phosphorus oxides, or deoxyribose derivatives,
are not present in PNAs. As disclosed by P. E. Nielsen, M. Egholm,
R. H. Berg and O. Buchardt, Science 254, 1497 (1991); and M.
Egholm, O. Buchardt, L. Christensen, C. Behrens, S. M. Freier, D.
A. Driver, R. H. Berg, S. K. Kim, B. Norden, and P. E. Nielsen,
Nature 365, 666 (1993), PNAs bind specifically and tightly to
complementary DNA strands and are not degraded by nucleases. In
fact, PNA binds more strongly to DNA than DNA itself does. This is
probably because there is no electrostatic repulsion between the
two strands, and also the polyamide backbone is more flexible.
Because of this, PNA/DNA duplexes bind under a wider range of
stringency conditions than DNA/DNA duplexes, making it easier to
perform multiplex hybridization. Smaller probes can be used than
with DNA due to the strong binding. In addition, it is more likely
that single base mismatches can be determined with PNA/DNA
hybridization because a single mismatch in a PNA/DNA 15-mer lowers
the melting point (T.sub.m) by 8.degree.-20.degree. C., vs.
4.degree.-16.degree. C. for the DNA/DNA 15-mer duplex. Also, the
absence of charge groups in PNA means that hybridization can be
done at low ionic strengths and reduce possible interference by
salt during the analysis.
[0514] The present invention is useful for detecting cancer in
mammals. In particular the invention is useful during diagnosis of
pathological cell proliferative neoplasias which include, but are
not limited to: acute myelogenous leukemias including acute
monocytic leukemia, acute myeloblastic leukemia, acute
promyelocytic leukemia, acute myelomonocytic leukemia, acute
erythroleukemia, acute megakaryocytic leukemia, and acute
undifferentiated leukemia, etc.; and chronic myelogenous leukemias
including chronic myelomonocytic leukemia, chronic granulocytic
leukemia, etc. Preferred mammals include monkeys, apes, cats, dogs,
cows, pigs, horses, rabbits and humans. Particularly preferred are
humans.
[0515] Pathological cell proliferative disorders are often
associated with inappropriate activation of proto-oncogenes.
(Gelmann, E. P. et al., "The Etiology of Acute Leukemia: Molecular
Genetics and Viral Oncology," in Neoplastic Diseases of the Blood,
Vol 1., Wiernik, P. H. et al. eds., 161-182 (1985)). Neoplasias are
now believed to result from the qualitative alteration of a normal
cellular gene product, or from the quantitative modification of
gene expression by insertion into the chromosome of a viral
sequence, by chromosomal translocation of a gene to a more actively
transcribed region, or by some other mechanism. (Gelmann et al.,
supra) It is likely that mutated or altered expression of specific
genes is involved in the pathogenesis of some leukemias, among
other tissues and cell types. (Gelmann et al., supra) Indeed, the
human counterparts of the oncogenes involved in some animal
neoplasias have been amplified or translocated in some cases of
human leukemia and carcinoma. (Gelmann et al., supra)
[0516] For example, c-myc expression is highly amplified in the
non-lymphocytic leukemia cell line HL-60. When HL-60 cells are
chemically induced to stop proliferation, the level of c-myc is
found to be down-regulated. (International Publication Number WO
91/15580) However, it has been shown that exposure of HL-60 cells
to a DNA construct that is complementary to the 5' end of c-myc or
c-myb blocks translation of the corresponding mRNAs which
downregulates expression of the c-myc or c-myb proteins and causes
arrest of cell proliferation and differentiation of the treated
cells. (International Publication Number WO 91/15580; Wickstrom et
al., Proc. Natl. Acad. Sci. 85:1028 (1988); Anfossi et al., Proc.
Natl. Acad. Sci. 86:3379 (1989)). However, the skilled artisan
would appreciate the present invention's usefulness would not be
limited to treatment of proliferative diseases, disorders, and/or
conditions of hematopoietic cells and tissues, in light of the
numerous cells and cell types of varying origins which are known to
exhibit proliferative phenotypes.
[0517] In addition to the foregoing, a G-protein Chemokine Receptor
(CCR5) polynucleotide can be used to control gene expression
through triple helix formation or antisense DNA or RNA. Antisense
techniques are discussed, for example, in Okano, J. Neurochem. 56:
560 (1991); "Oligodeoxynucleotides as Antisense Inhibitors of Gene
Expression, CRC Press, Boca Raton, Fla. (1988). Triple helix
formation is discussed in, for instance Lee et al., Nucleic Acids
Research 6: 3073 (1979); Cooney et al., Science 241: 456 (1988);
and Dervan et al., Science 251: 1360 (1991). Both methods rely on
binding of the polynucleotide to a complementary DNA or RNA. For
these techniques, preferred polynucleotides are usually
oligonucleotides 20 to 40 bases in length and complementary to
either the region of the gene involved in transcription (triple
helix--see Lee et al., Nucl. Acids Res. 6:3073 (1979); Cooney et
al., Science 241:456 (1988); and Dervan et al., Science 251:1360
(1991)) or to the mRNA itself (antisense--Okano, J. Neurochem.
56:560 (1991); Oligodeoxy-nucleotides as Antisense Inhibitors of
Gene Expression, CRC Press, Boca Raton, Fla. (1988).) Triple helix
formation optimally results in a shut-off of RNA transcription from
DNA, while antisense RNA hybridization blocks translation of an
mRNA molecule into polypeptide. Both techniques are effective in
model systems, and the information disclosed herein can be used to
design antisense or triple helix polynucleotides in an effort to
treat or prevent disease.
[0518] G-protein Chemokine Receptor (CCR5) polynucleotides are also
useful in gene therapy. One goal of gene therapy is to insert a
normal gene into an organism having a defective gene, in an effort
to correct the genetic defect. G-protein Chemokine Receptor (CCR5)
offers a means of targeting such genetic defects in a highly
accurate manner. Another goal is to insert a new gene that was not
present in the host genome, thereby producing a new trait in the
host cell.
[0519] The G-protein Chemokine Receptor (CCR5) polynucleotides are
also useful for identifying individuals from minute biological
samples. The United States military, for example, is considering
the use of restriction fragment length polymorphism (RFLP) for
identification of its personnel. In this technique, an individual's
genomic DNA is digested with one or more restriction enzymes, and
probed on a Southern blot to yield unique bands for identifying
personnel. This method does not suffer from the current limitations
of "Dog Tags" which can be lost, switched, or stolen, making
positive identification difficult. The G-protein Chemokine Receptor
(CCR5) polynucleotides can be used as additional DNA markers for
RFLP.
[0520] The G-protein Chemokine Receptor (CCR5) polynucleotides can
also be used as an alternative to RFLP, by determining the actual
base-by-base DNA sequence of selected portions of an individual's
genome. These sequences can be used to prepare PCR primers for
amplifying and isolating such selected DNA, which can then be
sequenced. Using this technique, individuals can be identified
because each individual will have a unique set of DNA sequences.
Once a unique ID database is established for an individual,
positive identification of that individual, living or dead, can be
made from extremely small tissue samples.
[0521] Forensic biology also benefits from using DNA-based
identification techniques as disclosed herein. DNA sequences taken
from very small biological samples such as tissues, e.g., hair or
skin, or body fluids, e.g., blood, saliva, semen, synovial fluid,
amniotic fluid, breast milk, lymph, pulmonary sputum or surfactant,
urine, fecal matter, etc., can be amplified using PCR. In one prior
art technique, gene sequences amplified from polymorphic loci, such
as DQa class II HLA gene, are used in forensic biology to identify
individuals. (Erlich, H., PCR Technology, Freeman and Co. (1992).)
Once these specific polymorphic loci are amplified, they are
digested with one or more restriction enzymes, yielding an
identifying set of bands on a Southern blot probed with DNA
corresponding to the DQa class II HLA gene. Similarly, G-protein
Chemokine Receptor (CCR5) polynucleotides can be used as
polymorphic markers for forensic purposes.
[0522] There is also a need for reagents capable of identifying the
source of a particular tissue. Such need arises, for example, in
forensics when presented with tissue of unknown origin. Appropriate
reagents can comprise, for example, DNA probes or primers specific
to particular tissue prepared from G-protein Chemokine Receptor
(CCR5) sequences. Panels of such reagents can identify tissue by
species and/or by organ type. In a similar fashion, these reagents
can be used to screen tissue cultures for contamination.
[0523] Because G-protein Chemokine Receptor (CCR5) is expressed in
macrophages and memory T cells, G-protein Chemokine Receptor (CCR5)
polynucleotides are useful as hybridization probes for differential
identification of the tissue(s) or cell type(s) present in a
biological sample. Similarly, polypeptides and antibodies directed
to G-protein Chemokine Receptor (CCR5) polypeptides are useful to
provide immunological probes for differential identification of the
tissue(s) or cell type(s). In addition, for a number of diseases,
disorders, and/or conditions of the above tissues or cells, or in
which these cells play a role, significantly higher or lower levels
of G-protein Chemokine Receptor (CCR5) gene expression may be
detected in certain tissues (e.g., cancerous and wounded tissues)
or bodily fluids (e.g., serum, plasma, urine, synovial fluid or
spinal fluid) taken from an individual having such a disorder,
relative to a "standard" G-protein Chemokine Receptor (CCR5) gene
expression level, i.e., the G-protein Chemokine Receptor (CCR5)
expression level in healthy tissue from an individual not having
the immune system-related disorder.
[0524] Thus, the invention provides a diagnostic method of a
disorder, which involves: (a) assaying G-protein Chemokine Receptor
(CCR5) gene expression level in cells or body fluid of an
individual; (b) comparing the G-protein Chemokine Receptor (CCR5)
gene expression level with a standard G-protein Chemokine Receptor
(CCR5) gene expression level, whereby an increase or decrease in
the assayed G-protein Chemokine Receptor (CCR5) gene expression
level compared to the standard expression level is indicative of
disorder in the immune system or related to the immune system.
[0525] In a further embodiment, the invention provides a method of
using G-protein Chemokine Receptor (CCR5) polynucleotides, or
fragments or variants thereof as a vaccine to elicit an immune
response to G-protein Chemokine Receptor. In a preferred
embodiment, the invention provides a method of using G-protein
Chemokine Receptor (CCR5) polynucleotides, or fragments or variants
thereof as a DNA vaccine to elicit a humoral (antibody-mediated)
immune response to G-protein Chemokine Receptor. In other highly
preferred embodiments, the invention provides a method of using
G-protein Chemokine Receptor (CCR5) polynucleotides comprising the
nucleotide sequence of one or more extracellular loops of G-protein
Chemokine Receptor (CCR5) (i.e., amino acids 89-102, 167-195 and/or
261-274 of SEQ ID NO:2 or of the polypeptide encoded by the
deposited clone (SEQ ID NO:22)) as a DNA vaccine to elicit immune
response to G-protein Chemokine Receptor. In other highly preferred
embodiments, the invention provides a method of using G-protein
Chemokine Receptor (CCR5) polynucleotides comprising the nucleotide
sequence of the first extracellular loop of G-protein Chemokine
Receptor (CCR5) (i.e., amino acids 89-102 of SEQ ID NO:2 or of the
polypeptide encoded by the deposited clone (SEQ ID NO:22)) as a DNA
vaccine to elicit an immune response to G-protein Chemokine
Receptor (CCR5). In other highly preferred embodiments, the
invention provides a method of using G-protein Chemokine Receptor
(CCR5) polynucleotides comprising the nucleotide sequence of the
second extracellular loop of G-protein Chemokine Receptor (CCR5)
(i.e., amino acids 167-195 of SEQ ID NO:2 or of the polypeptide
encoded by the deposited clone (SEQ ID NO:22)) as a DNA vaccine to
elicit an immune response to G-protein Chemokine Receptor (CCR5).
In other highly preferred embodiments, the invention provides a
method of using G-protein Chemokine Receptor (CCR5) polynucleotides
comprising the nucleotide sequence of the third extracellular loop
of G-protein Chemokine Receptor (CCR5) (i.e., 261-274 of SEQ ID
NO:2 or of the polypeptide encoded by the deposited clone (SEQ ID
NO:22)) as a DNA vaccine to elicit an immune response to G-protein
Chemokine Receptor (CCR5).
[0526] In other highly preferred embodiments, the invention
provides a method of using G-protein Chemokine Receptor (CCR5)
polynucleotides comprising the nucleotide sequence of one or more
extracellular loops of G-protein Chemokine Receptor (CCR5) (i.e.,
amino acids 89-102, 167-195 and/or 261-274 of SEQ ID NO:2 or of the
polypeptide encoded by the deposited clone (SEQ ID NO:22)) as a DNA
vaccine to elicit a humoral immune response to G-protein Chemokine
Receptor. In other highly preferred embodiments, the invention
provides a method of using G-protein Chemokine Receptor (CCR5)
polynucleotides comprising the nucleotide sequence of the first
extracellular loop of G-protein Chemokine Receptor (CCR5) (i.e.,
amino acids 89-102 of SEQ ID NO:2 or of the polypeptide encoded by
the deposited clone (SEQ ID NO:22)) as a DNA vaccine to elicit a
humoral immune response to G-protein Chemokine Receptor (CCR5). In
other highly preferred embodiments, the invention provides a method
of using G-protein Chemokine Receptor (CCR5) polynucleotides
comprising the nucleotide sequence of the second extracellular loop
of G-protein Chemokine Receptor (CCR5) (i.e., amino acids 167-195
of SEQ ID NO:2 or of the polypeptide encoded by the deposited clone
(SEQ ID NO:22)) as a DNA vaccine to elicit a humoral immune
response to G-protein Chemokine Receptor (CCR5). In other highly
preferred embodiments, the invention provides a method of using
G-protein Chemokine Receptor (CCR5) polynucleotides comprising the
nucleotide sequence of the third extracellular loop of G-protein
Chemokine Receptor (CCR5) (i.e., 261-274 of SEQ ID NO:2 or of the
polypeptide encoded by the deposited clone (SEQ ID NO:22)) as a DNA
vaccine to elicit a humoral immune response to G-protein Chemokine
Receptor (CCR5).
[0527] In another embodiment, the present invention provides a DNA
vaccine comprising, or alternatively consisting of, a G-protein
Chemokine Receptor (CCR5) polynucleotide, or fragment or variant
thereof. In another preferred embodiment, the present invention
provides a DNA vaccine comprising, or alternatively consisting of,
a G-protein Chemokine Receptor (CCR5) polynucleotide encoding the
nucleotide sequence of one or more extracellular loops of G-protein
Chemokine Receptor (CCR5) (i.e., amino acids 89-102, 167-195 and/or
261-274 of SEQ ID NO:2 or of the polypeptide encoded by the
deposited clone (SEQ ID NO:22)). In another preferred embodiment,
the present invention provides a DNA vaccine comprising, or
alternatively consisting of, a G-protein Chemokine Receptor (CCR5)
polynucleotide encoding the nucleotide sequence of the first
extracellular loop of G-protein Chemokine Receptor (CCR5) (i.e.,
amino acids 89-102, of SEQ ID NO:2 or of the polypeptide encoded by
the deposited clone (SEQ ID NO:22)). In another preferred
embodiment, the present invention provides a DNA vaccine
comprising, or alternatively consisting of, a G-protein Chemokine
Receptor (CCR5) polynucleotide encoding the nucleotide sequence of
the second extracellular loop of G-protein Chemokine Receptor
(CCR5) (i.e., amino acids 167-195 of SEQ ID NO:2 or of the
polypeptide encoded by the deposited clone (SEQ ID NO:22)). In
another preferred embodiment, the present invention provides a DNA
vaccine comprising, or alternatively consisting of, a G-protein
Chemokine Receptor (CCR5) polynucleotide encoding the nucleotide
sequence of the third extracellular loop of G-protein Chemokine
Receptor (CCR5) (i.e., amino acids 261-274 of SEQ ID NO:2 or of the
polypeptide encoded by the deposited clone (SEQ ID NO:22)).
[0528] In highly preferred embodiments, the vaccines described
above are administered to an animal, including humans, to prevent
viral infection. In even more highly preferred embodiments, the
vaccines described above are administered to an animal, including
humans, to prevent HIV infection. In still other highly preferred
embodiments, the vaccines described above are administered to an
animal, including humans, to prevent poxvirus infection. In still
other highly preferred embodiments, the vaccines described above
are administered to an animal, including humans, to prevent
cytomegalovirus infection.
[0529] In the very least, the G-protein Chemokine Receptor (CCR5)
polynucleotides can be used as molecular weight markers on Southern
gels, as diagnostic probes for the presence of a specific mRNA in a
particular cell type, as a probe to "subtract-out" known sequences
in the process of discovering novel polynucleotides, for selecting
and making oligomers for attachment to a "gene chip" or other
support, to raise anti-DNA antibodies using DNA immunization
techniques, and as an antigen to elicit an immune response.
Uses of G-Protein Chemokine Receptor (CCR5) Polypeptides
[0530] G-protein Chemokine Receptor (CCR5) polypeptides can be used
in numerous ways. The following description should be considered
exemplary and utilizes known techniques.
[0531] G-protein Chemokine Receptor (CCR5) polypeptides can be used
to assay protein levels in a biological sample using antibody-based
techniques. For example, protein expression in tissues can be
studied with classical immunohistological methods. (Jalkanen, M.,
et al., J. Cell. Biol. 101:976-985 (1985); Jalkanen, M., et al., J.
Cell. Biol. 105:3087-3096 (1987).) Other antibody-based methods
useful for detecting protein gene expression include immunoassays,
such as the enzyme linked immunosorbent assay (ELISA) and the
radioimmunoassay (RIA). Suitable antibody assay labels are known in
the art and include enzyme labels, such as, glucose oxidase, and
radioisotopes, such as iodine (125I, 121I), carbon (14C), sulfur
(35S), tritium (3H), indium (112In), and technetium (99mTc), and
fluorescent labels, such as fluorescein and rhodamine, and
biotin.
[0532] In addition to assaying G-protein levels in a biological
sample, proteins can also be detected in vivo by imaging. Antibody
labels or markers for in vivo imaging of protein include those
detectable by X-radiography, NMR or ESR. For X-radiography,
suitable labels include radioisotopes such as barium or cesium,
which emit detectable radiation but are not overtly harmful to the
subject. Suitable markers for NMR and ESR include those with a
detectable characteristic spin, such as deuterium, which may be
incorporated into the antibody by labeling of nutrients for the
relevant hybridoma.
[0533] A protein-specific antibody or antibody fragment which has
been labeled with an appropriate detectable imaging moiety, such as
a radioisotope (for example, 131I, 112In, 99mTc), a radio-opaque
substance, or a material detectable by nuclear magnetic resonance,
is introduced (for example, parenterally, subcutaneously, or
intraperitoneally) into the mammal. It will be understood in the
art that the size of the subject and the imaging system used will
determine the quantity of imaging moiety needed to produce
diagnostic images. In the case of a radioisotope moiety, for a
human subject, the quantity of radioactivity injected will normally
range from about 5 to 20 millicuries of 99mTc. The labeled antibody
or antibody fragment will then preferentially accumulate at the
location of cells which contain the specific protein. In vivo tumor
imaging is described in S. W. Burchiel et al.,
"Immunopharmacokinetics of Radiolabeled Antibodies and Their
Fragments." (Chapter 13 in Tumor Imaging: The Radiochemical
Detection of Cancer, S. W. Burchiel and B. A. Rhodes, eds., Masson
Publishing Inc. (1982).)
[0534] Thus, the invention provides a diagnostic method of a
disorder, which involves (a) assaying the expression of G-protein
Chemokine Receptor (CCR5) polypeptide in cells or body fluid of an
individual; (b) comparing the level of gene expression with a
standard gene expression level, whereby an increase or decrease in
the assayed G-protein Chemokine Receptor (CCR5) polypeptide gene
expression level compared to the standard expression level is
indicative of a disorder. With respect to cancer, the presence of a
relatively high amount of transcript in biopsied tissue from an
individual may indicate a predisposition for the development of the
disease, or may provide a means for detecting the disease prior to
the appearance of actual clinical symptoms. A more definitive
diagnosis of this type may allow health professionals to employ
preventative measures or aggressive treatment earlier thereby
preventing the development or further progression of the
cancer.
[0535] Moreover, G-protein Chemokine Receptor (CCR5) polypeptides
can be used to treat, prevent, and/or diagnose disease. For
example, patients can be administered G-protein Chemokine Receptor
(CCR5) polypeptides in an effort to replace absent or decreased
levels of the G-protein Chemokine Receptor (CCR5) polypeptide
(e.g., insulin), to supplement absent or decreased levels of a
different polypeptide (e.g., hemoglobin S for hemoglobin B, SOD,
catalase, DNA repair proteins), to inhibit the activity of a
polypeptide (e.g., an oncogene or tumor suppressor), to activate
the activity of a polypeptide (e.g., by binding to a receptor), to
reduce the activity of a membrane bound receptor by competing with
it for free ligand (e.g., soluble TNF receptors used in reducing
inflammation), or to bring about a desired response (e.g., blood
vessel growth inhibition, enhancement of the immune response to
proliferative cells or tissues).
[0536] Similarly, antibodies directed to G-protein Chemokine
Receptor (CCR5) polypeptides can also be used to treat, prevent,
and/or diagnose disease. For example, administration of an antibody
directed to a G-protein Chemokine Receptor (CCR5) polypeptide can
bind and reduce overproduction of the polypeptide. Similarly,
administration of an antibody can activate the polypeptide, such as
by binding to a polypeptide bound to a membrane (receptor).
[0537] In a further embodiment, the invention provides a method of
using G-protein Chemokine Receptor (CCR5) polypeptides, or
fragments or variants as a vaccine to elicit an immune response to
G-protein Chemokine Receptor. In a preferred embodiment, the
invention provides a method of using G-protein Chemokine Receptor
(CCR5) polypeptides, or fragments or variants thereof as a vaccine
to elicit a humoral (antibody-mediated) immune response to
G-protein Chemokine Receptor. In other highly preferred
embodiments, the invention provides a method of using G-protein
Chemokine Receptor (CCR5) polypeptides comprising the amino acid
sequence of one or more extracellular loops of G-protein Chemokine
Receptor (CCR5) (i.e., amino acids 89-102, 167-195 and/or 261-274
of SEQ ID NO:2 or of the polypeptide encoded by the deposited clone
(SEQ ID NO:22)) as a vaccine to elicit an immune response to
G-protein Chemokine Receptor. In other highly preferred
embodiments, the invention provides a method of using G-protein
Chemokine Receptor (CCR5) polypeptides comprising the amino acid
sequence of the first extracellular loop of G-protein Chemokine
Receptor (CCR5) (i.e., amino acids 89-102 of SEQ ID NO:2 or of the
polypeptide encoded by the deposited clone (SEQ ID NO:22)) as a
vaccine to elicit an immune response to G-protein Chemokine
Receptor (CCR5). In other highly preferred embodiments, the
invention provides a method of using G-protein Chemokine Receptor
(CCR5) polypeptides comprising the amino acid sequence of the
second extracellular loop of G-protein Chemokine Receptor (CCR5)
(i.e., amino acids 167-195 of SEQ ID NO:2 or of the polypeptide
encoded by the deposited clone (SEQ ID NO:22)) as a vaccine to
elicit an immune response to G-protein Chemokine Receptor (CCR5).
In other highly preferred embodiments, the invention provides a
method of using G-protein Chemokine Receptor (CCR5) polypeptides
comprising the amino acid sequence of the third extracellular loop
of G-protein Chemokine Receptor (CCR5) (i.e., 261-274 of SEQ ID
NO:2 or of the polypeptide encoded by the deposited clone (SEQ ID
NO:22)) as a vaccine to elicit an immune response to G-protein
Chemokine Receptor (CCR5).
[0538] In other highly preferred embodiments, the invention
provides a method of using G-protein Chemokine Receptor (CCR5)
polypeptides comprising the amino acid sequence of one or more
extracellular loops of G-protein Chemokine Receptor (CCR5) (i.e.,
amino acids 89-102, 167-195 and/or 261-274 of SEQ ID NO:2 or of the
polypeptide encoded by the deposited clone (SEQ ID NO:22)) as a
vaccine to elicit a humoral immune response to G-protein Chemokine
Receptor. In other highly preferred embodiments, the invention
provides a method of using G-protein Chemokine Receptor (CCR5)
polypeptides comprising the amino acid sequence of the first
extracellular loop of G-protein Chemokine Receptor (CCR5) (i.e.,
amino acids 89-102 of SEQ ID NO:2 or of the polypeptide encoded by
the deposited clone (SEQ ID NO:22)) as a vaccine to elicit a
humoral immune response to G-protein Chemokine Receptor (CCR5). In
other highly preferred embodiments, the invention provides a method
of using G-protein Chemokine Receptor (CCR5) polypeptides
comprising the amino acid sequence of the second extracellular loop
of G-protein Chemokine Receptor (CCR5) (i.e., amino acids 167-195
of SEQ ID NO:2 or of the polypeptide encoded by the deposited clone
(SEQ ID NO:22)) as a vaccine to elicit a humoral immune response to
G-protein Chemokine Receptor (CCR5). In other highly preferred
embodiments, the invention provides a method of using G-protein
Chemokine Receptor (CCR5) polypeptides comprising the amino acid
sequence of the third extracellular loop of G-protein Chemokine
Receptor (CCR5) (i.e., 261-274 of SEQ ID NO:2 or of the polypeptide
encoded by the deposited clone (SEQ ID NO:22)) as a vaccine to
elicit a humoral immune response to G-protein Chemokine Receptor
(CCR5).
[0539] In another embodiment, the present invention provides a
vaccine comprising, or alternatively consisting of, a G-protein
Chemokine Receptor (CCR5) polypeptide, or fragment or variant
thereof. In another preferred embodiment, the present invention
provides a vaccine comprising, or alternatively consisting of, a
G-protein Chemokine Receptor (CCR5) polypeptide encoding the amino
acid sequence of one or more extracellular loops of G-protein
Chemokine Receptor (CCR5) (i.e., amino acids 89-102, 167-195 and/or
261-274 of SEQ ID NO:2 or of the polypeptide encoded by the
deposited clone (SEQ ID NO:22)). In another preferred embodiment,
the present invention provides a vaccine comprising, or
alternatively consisting of, a G-protein Chemokine Receptor (CCR5)
polypeptide encoding the amino acid sequence of the first
extracellular loop of G-protein Chemokine Receptor (CCR5) (i.e.,
amino acids 89-102, of SEQ ID NO:2 or of the polypeptide encoded by
the deposited clone (SEQ ID NO:22)). In another preferred
embodiment, the present invention provides a vaccine comprising, or
alternatively consisting of, a G-protein Chemokine Receptor (CCR5)
polypeptide encoding the amino acid sequence of the second
extracellular loop of G-protein Chemokine Receptor (CCR5) (i.e.,
amino acids 167-195 of SEQ ID NO:2 or of the polypeptide encoded by
the deposited clone (SEQ ID NO:22)). In another preferred
embodiment, the present invention provides a vaccine comprising, or
alternatively consisting of, a G-protein Chemokine Receptor (CCR5)
polypeptide encoding the amino acid sequence of the third
extracellular loop of G-protein Chemokine Receptor (CCR5) (i.e.,
amino acids 261-274 of SEQ ID NO:2 or of the polypeptide encoded by
the deposited clone (SEQ ID NO:22)).
[0540] In highly preferred embodiments, the vaccines described
above are administered to an animal, including humans, to prevent
viral infection. In even more highly preferred embodiments, the
vaccines described above are administered to an animal, including
humans, to prevent HIV infection. In still other highly preferred
embodiments, the vaccines described above are administered to an
animal, including humans, to prevent poxvirus infection. In still
other highly preferred embodiments, the vaccines described above
are administered to an animal, including humans, to prevent
cytomegalovirus infection.
[0541] At the very least, the G-protein Chemokine Receptor (CCR5)
polypeptides can be used as molecular weight markers on SDS-PAGE
gels or on molecular sieve gel filtration columns using methods
well known to those of skill in the art. G-protein Chemokine
Receptor (CCR5) polypeptides can also be used to raise antibodies,
which in turn are used to measure protein expression from a
recombinant cell, as a way of assessing transformation of the host
cell. Moreover, G-protein Chemokine Receptor (CCR5) polypeptides
can be used to test the following biological activities.
Gene Therapy Methods
[0542] Another aspect of the present invention is to gene therapy
methods for treating or preventing disorders, diseases and
conditions. The gene therapy methods relate to the introduction of
nucleic acid (DNA, RNA and antisense DNA or RNA) sequences into an
animal to achieve expression of the G-protein Chemokine Receptor
(CCR5) polypeptide of the present invention. This method requires a
polynucleotide which codes for a G-protein Chemokine Receptor
(CCR5) polypeptide operatively linked to a promoter and any other
genetic elements necessary for the expression of the polypeptide by
the target tissue. Such gene therapy and delivery techniques are
known in the art, see, for example, WO90/11092, which is herein
incorporated by reference.
[0543] Thus, for example, cells from a patient may be engineered
with a polynucleotide (DNA or RNA) comprising a promoter operably
linked to a G-protein Chemokine Receptor (CCR5) polynucleotide ex
vivo, with the engineered cells then being provided to a patient to
be treated with the polypeptide. Such methods are well-known in the
art. For example, see Belldegrun, A., et al., J. Natl. Cancer Inst.
85: 207-216 (1993); Ferrantini, M. et al., Cancer Research 53:
1107-1112 (1993); Ferrantini, M. et al., J. Immunology 153:
4604-4615 (1994); Kaido, T., et al., Int. J. Cancer 60: 221-229
(1995); Ogura, H., et al., Cancer Research 50: 5102-5106 (1990);
Santodonato, L., et al., Human Gene Therapy 7:1-10 (1996);
Santodonato, L., et al., Gene Therapy 4:1246-1255 (1997); and
Zhang, J.-F. et al., Cancer Gene Therapy 3: 31-38 (1996)), which
are herein incorporated by reference. In one embodiment, the cells
which are engineered are arterial cells. The arterial cells may be
reintroduced into the patient through direct injection to the
artery, the tissues surrounding the artery, or through catheter
injection.
[0544] As discussed in more detail below, the G-protein Chemokine
Receptor (CCR5) polynucleotide constructs can be delivered by any
method that delivers injectable materials to the cells of an
animal, such as, injection into the interstitial space of tissues
(heart, muscle, skin, lung, liver, and the like). The G-protein
Chemokine Receptor (CCR5) polynucleotide constructs may be
delivered in a pharmaceutically acceptable liquid or aqueous
carrier.
[0545] In one embodiment, the G-protein Chemokine Receptor (CCR5)
polynucleotide is delivered as a naked polynucleotide. The term
"naked" polynucleotide, DNA or RNA refers to sequences that are
free from any delivery vehicle that acts to assist, promote or
facilitate entry into the cell, including viral sequences, viral
particles, liposome formulations, LIPOFECTIN.TM. or precipitating
agents and the like. However, the G-protein Chemokine Receptor
(CCR5) polynucleotides can also be delivered in liposome
formulations and LIPOFECTIN.TM. formulations and the like can be
prepared by methods well known to those skilled in the art. Such
methods are described, for example, in U.S. Pat. Nos. 5,593,972,
5,589,466, and 5,580,859, which are herein incorporated by
reference.
[0546] The G-protein Chemokine Receptor polynucleotide vector
constructs used in the gene therapy method are preferably
constructs that will not integrate into the host genome nor will
they contain sequences that allow for replication. Appropriate
vectors include pWLNEO, pSV2CAT, pOG44, pXT1 and pSG available from
STRATAGENE.TM.; pSVK3, pBPV, pMSG and pSVL available from
PHARMACIA.TM.; and pEF1/V5, pcDNA3.1, and pRc/CMV2 available from
Invitrogen. Other suitable vectors will be readily apparent to the
skilled artisan.
[0547] Any strong promoter known to those skilled in the art can be
used for driving the expression of G-protein Chemokine Receptor
(CCR5) polynucleotide sequence. Suitable promoters include
adenoviral promoters, such as the adenoviral major late promoter;
or heterologous promoters, such as the cytomegalovirus (CMV)
promoter; the respiratory syncytial virus (RSV) promoter; inducible
promoters, such as the MMT promoter, the metallothionein promoter;
heat shock promoters; the albumin promoter; the ApoAI promoter;
human globin promoters; viral thymidine kinase promoters, such as
the Herpes Simplex thymidine kinase promoter; retroviral LTRs; the
b-actin promoter; and human growth hormone promoters. The promoter
also may be the native promoter for G-protein Chemokine
Receptor.
[0548] Unlike other gene therapy techniques, one major advantage of
introducing naked nucleic acid sequences into target cells is the
transitory nature of the polynucleotide synthesis in the cells.
Studies have shown that non-replicating DNA sequences can be
introduced into cells to provide production of the desired
polypeptide for periods of up to six months.
[0549] The G-protein Chemokine Receptor (CCR5) polynucleotide
construct can be delivered to the interstitial space of tissues
within the an animal, including of muscle, skin, brain, lung,
liver, spleen, bone marrow, thymus, heart, lymph, blood, bone,
cartilage, pancreas, kidney, gall bladder, stomach, intestine,
testis, ovary, uterus, rectum, nervous system, eye, gland, and
connective tissue. Interstitial space of the tissues comprises the
intercellular, fluid, mucopolysaccharide matrix among the reticular
fibers of organ tissues, elastic fibers in the walls of vessels or
chambers, collagen fibers of fibrous tissues, or that same matrix
within connective tissue ensheathing muscle cells or in the lacunae
of bone. It is similarly the space occupied by the plasma of the
circulation and the lymph fluid of the lymphatic channels. Delivery
to the interstitial space of muscle tissue is preferred for the
reasons discussed below. They may be conveniently delivered by
injection into the tissues comprising these cells. They are
preferably delivered to and expressed in persistent, non-dividing
cells which are differentiated, although delivery and expression
may be achieved in non-differentiated or less completely
differentiated cells, such as, for example, stem cells of blood or
skin fibroblasts. In vivo muscle cells are particularly competent
in their ability to take up and express polynucleotides.
[0550] For the naked nucleic acid sequence injection, an effective
dosage amount of DNA or RNA will be in the range of from about 0.05
mg/kg body weight to about 50 mg/kg body weight. Preferably the
dosage will be from about 0.005 mg/kg to about 20 mg/kg and more
preferably from about 0.05 mg/kg to about 5 mg/kg. Of course, as
the artisan of ordinary skill will appreciate, this dosage will
vary according to the tissue site of injection. The appropriate and
effective dosage of nucleic acid sequence can readily be determined
by those of ordinary skill in the art and may depend on the
condition being treated and the route of administration.
[0551] The preferred route of administration is by the parenteral
route of injection into the interstitial space of tissues. However,
other parenteral routes may also be used, such as, inhalation of an
aerosol formulation particularly for delivery to lungs or bronchial
tissues, throat or mucous membranes of the nose. In addition, naked
G-protein Chemokine Receptor (CCR5) DNA constructs can be delivered
to arteries during angioplasty by the catheter used in the
procedure.
[0552] The naked polynucleotides are delivered by any method known
in the art, including, but not limited to, direct needle injection
at the delivery site, intravenous injection, topical
administration, catheter infusion, and so-called "gene guns". These
delivery methods are known in the art.
[0553] The constructs may also be delivered with delivery vehicles
such as viral sequences, viral particles, liposome formulations,
LIPOFECTIN.TM., precipitating agents, etc. Such methods of delivery
are known in the art.
[0554] In certain embodiments, the G-protein Chemokine Receptor
(CCR5) polynucleotide constructs are complexed in a liposome
preparation. Liposomal preparations for use in the instant
invention include cationic (positively charged), anionic
(negatively charged) and neutral preparations. However, cationic
liposomes are particularly preferred because a tight charge complex
can be formed between the cationic liposome and the polyanionic
nucleic acid. Cationic liposomes have been shown to mediate
intracellular delivery of plasmid DNA (Felgner et al., Proc. Natl.
Acad. Sci. USA (1987) 84:7413-7416, which is herein incorporated by
reference); mRNA (Malone et al., Proc. Natl. Acad. Sci. USA (1989)
86:6077-6081, which is herein incorporated by reference); and
purified transcription factors (Debs et al., J. Biol. Chem. (1990)
265:10189-10192, which is herein incorporated by reference), in
functional form.
[0555] Cationic liposomes are readily available. For example,
N[1-2,3-dioleyloxy)propyl]-N,N,N-triethylammonium (DOTMA) liposomes
are particularly useful and are available under the trademark
LIPOFECTIN.TM., from GIBCO BRL, Grand Island, N.Y. (See, also,
Felgner et al., Proc. Natl. Acad. Sci. USA (1987) 84:7413-7416,
which is herein incorporated by reference). Other commercially
available liposomes include transfectace (DDAB/DOPE) and DOTAP/DOPE
(Boehringer).
[0556] Other cationic liposomes can be prepared from readily
available materials using techniques well known in the art. See,
e.g. PCT Publication No. WO 90/11092 (which is herein incorporated
by reference) for a description of the synthesis of DOTAP
(1,2-bis(oleoyloxy)-3-(trimethylammonio)propane) liposomes.
Preparation of DOTMA liposomes is explained in the literature, see,
e.g., P. Felgner et al., Proc. Natl. Acad. Sci. USA 84:7413-7417,
which is herein incorporated by reference. Similar methods can be
used to prepare liposomes from other cationic lipid materials.
[0557] Similarly, anionic and neutral liposomes are readily
available, such as from Avanti Polar Lipids (Birmingham, Ala.), or
can be easily prepared using readily available materials. Such
materials include phosphatidyl, choline, cholesterol, phosphatidyl
ethanolamine, dioleoylphosphatidyl choline (DOPC),
dioleoylphosphatidyl glycerol (DOPG), dioleoylphosphatidyl
ethanolamine (DOPE), among others. These materials can also be
mixed with the DOTMA and DOTAP starting materials in appropriate
ratios. Methods for making liposomes using these materials are well
known in the art.
[0558] For example, commercially dioleoylphosphatidyl choline
(DOPC), dioleoylphosphatidyl glycerol (DOPG), and
dioleoylphosphatidyl ethanolamine (DOPE) can be used in various
combinations to make conventional liposomes, with or without the
addition of cholesterol. Thus, for example, DOPG/DOPC vesicles can
be prepared by drying 50 mg each of DOPG and DOPC under a stream of
nitrogen gas into a sonication vial. The sample is placed under a
vacuum pump overnight and is hydrated the following day with
deionized water. The sample is then sonicated for 2 hours in a
capped vial, using a Heat Systems model 350 sonicator equipped with
an inverted cup (bath type) probe at the maximum setting while the
bath is circulated at 15EC. Alternatively, negatively charged
vesicles can be prepared without sonication to produce
multilamellar vesicles or by extrusion through nucleopore membranes
to produce unilamellar vesicles of discrete size. Other methods are
known and available to those of skill in the art.
[0559] The liposomes can comprise multilamellar vesicles (MLVs),
small unilamellar vesicles (SUVs), or large unilamellar vesicles
(LUVs), with SUVs being preferred. The various liposome-nucleic
acid complexes are prepared using methods well known in the art.
See, e.g., Straubinger et al., Methods of Immunology (1983),
101:512-527, which is herein incorporated by reference. For
example, MLVs containing nucleic acid can be prepared by depositing
a thin film of phospholipid on the walls of a glass tube and
subsequently hydrating with a solution of the material to be
encapsulated. SUVs are prepared by extended sonication of MLVs to
produce a homogeneous population of unilamellar liposomes. The
material to be entrapped is added to a suspension of preformed MLVs
and then sonicated. When using liposomes containing cationic
lipids, the dried lipid film is resuspended in an appropriate
solution such as sterile water or an isotonic buffer solution such
as 10 mM Tris/NaCl, sonicated, and then the preformed liposomes are
mixed directly with the DNA. The liposome and DNA form a very
stable complex due to binding of the positively charged liposomes
to the cationic DNA. SUVs find use with small nucleic acid
fragments. LUVs are prepared by a number of methods, well known in
the art. Commonly used methods include Ca.sup.2+-EDTA chelation
(Papahadjopoulos et al., Biochim. Biophys. Acta (1975) 394:483;
Wilson et al., Cell (1979) 17:77); ether injection (Deamer, D. and
Bangham, A., Biochim. Biophys. Acta (1976) 443:629; Ostro et al.,
Biochem. Biophys. Res. Commun. (1977) 76:836; Fraley et al., Proc.
Natl. Acad. Sci. USA (1979) 76:3348); detergent dialysis (Enoch, H.
and Strittmatter, P., Proc. Natl. Acad. Sci. USA (1979) 76:145);
and reverse-phase evaporation (REV) (Fraley et al., J. Biol. Chem.
(1980) 255:10431; Szoka, F. and Papahadjopoulos, D., Proc. Natl.
Acad. Sci. USA (1978) 75:145; Schaefer-Ridder et al., Science
(1982) 215:166), which are herein incorporated by reference.
[0560] Generally, the ratio of DNA to liposomes will be from about
10:1 to about 1:10. Preferably, the ration will be from about 5:1
to about 1:5. More preferably, the ration will be about 3:1 to
about 1:3. Still more preferably, the ratio will be about 1:1.
[0561] U.S. Pat. No. 5,676,954 (which is herein incorporated by
reference) reports on the injection of genetic material, complexed
with cationic liposomes carriers, into mice. U.S. Pat. Nos.
4,897,355, 4,946,787, 5,049,386, 5,459,127, 5,589,466, 5,693,622,
5,580,859, 5,703,055, and international publication no. WO 94/9469
(which are herein incorporated by reference) provide cationic
lipids for use in transfecting DNA into cells and mammals. U.S.
Pat. Nos. 5,589,466, 5,693,622, 5,580,859, 5,703,055, and
international publication no. WO 94/9469 (which are herein
incorporated by reference) provide methods for delivering
DNA-cationic lipid complexes to mammals.
[0562] In certain embodiments, cells are engineered, ex vivo or in
vivo, using a retroviral particle containing RNA which comprises a
sequence encoding G-protein Chemokine Receptor. Retroviruses from
which the retroviral plasmid vectors may be derived include, but
are not limited to, Moloney Murine Leukemia Virus, spleen necrosis
virus, Rous sarcoma Virus, Harvey Sarcoma Virus, avian leukosis
virus, gibbon ape leukemia virus, human immunodeficiency virus,
Myeloproliferative Sarcoma Virus, and mammary tumor virus.
[0563] The retroviral plasmid vector is employed to transduce
packaging cell lines to form producer cell lines. Examples of
packaging cells which may be transfected include, but are not
limited to, the PE501, PA317, R-2, R-AM, PA12, T19-14X,
VT-19-17-H2, RCRE, RCRIP, GP+E-86, GP+envAm12, and DAN cell lines
as described in Miller, Human Gene Therapy 1:5-14 (1990), which is
incorporated herein by reference in its entirety. The vector may
transduce the packaging cells through any means known in the art.
Such means include, but are not limited to, electroporation, the
use of liposomes, and CaPO.sub.4 precipitation. In one alternative,
the retroviral plasmid vector may be encapsulated into a liposome,
or coupled to a lipid, and then administered to a host.
[0564] The producer cell line generates infectious retroviral
vector particles which include polynucleotide encoding G-protein
Chemokine Receptor. Such retroviral vector particles then may be
employed, to transduce eukaryotic cells, either in vitro or in
vivo. The transduced eukaryotic cells will express G-protein
Chemokine Receptor.
[0565] In certain other embodiments, cells are engineered, ex vivo
or in vivo, with G-protein Chemokine Receptor (CCR5) polynucleotide
contained in an adenovirus vector. Adenovirus can be manipulated
such that it encodes and expresses G-protein Chemokine Receptor
(CCR5), and at the same time is inactivated in terms of its ability
to replicate in a normal lytic viral life cycle. Adenovirus
expression is achieved without integration of the viral DNA into
the host cell chromosome, thereby alleviating concerns about
insertional mutagenesis. Furthermore, adenoviruses have been used
as live enteric vaccines for many years with an excellent safety
profile (Schwartz, A. R. et al. (1974) Am. Rev. Respir. Dis.
109:233-238). Finally, adenovirus mediated gene transfer has been
demonstrated in a number of instances including transfer of
alpha-1-antitrypsin and CFTR to the lungs of cotton rats
(Rosenfeld, M. A. et al. (1991) Science 252:431-434; Rosenfeld et
al., (1992) Cell 68:143-155). Furthermore, extensive studies to
attempt to establish adenovirus as a causative agent in human
cancer were uniformly negative (Green, M. et al. (1979) Proc. Natl.
Acad. Sci. USA 76:6606).
[0566] Suitable adenoviral vectors useful in the present invention
are described, for example, in Kozarsky and Wilson, Curr. Opin.
Genet. Devel. 3:499-503 (1993); Rosenfeld et al., Cell 68:143-155
(1992); Engelhardt et al., Human Genet. Ther. 4:759-769 (1993);
Yang et al., Nature Genet. 7:362-369 (1994); Wilson et al., Nature
365:691-692 (1993); and U.S. Pat. No. 5,652,224, which are herein
incorporated by reference. For example, the adenovirus vector Ad2
is useful and can be grown in human 293 cells. These cells contain
the E1 region of adenovirus and constitutively express E1a and E1b,
which complement the defective adenoviruses by providing the
products of the genes deleted from the vector. In addition to Ad2,
other varieties of adenovirus (e.g., Ad3, Ad5, and Ad7) are also
useful in the present invention.
[0567] Preferably, the adenoviruses used in the present invention
are replication deficient. Replication deficient adenoviruses
require the aid of a helper virus and/or packaging cell line to
form infectious particles. The resulting virus is capable of
infecting cells and can express a polynucleotide of interest which
is operably linked to a promoter, but cannot replicate in most
cells. Replication deficient adenoviruses may be deleted in one or
more of all or a portion of the following genes: E1a, E1b, E3, E4,
E2a, or L1 through L5.
[0568] In certain other embodiments, the cells are engineered, ex
vivo or in vivo, using an adeno-associated virus (AAV). AAVs are
naturally occurring defective viruses that require helper viruses
to produce infectious particles (Muzyczka, N., Curr. Topics in
Microbiol. Immunol. 158:97 (1992)). It is also one of the few
viruses that may integrate its DNA into non-dividing cells. Vectors
containing as little as 300 base pairs of AAV can be packaged and
can integrate, but space for exogenous DNA is limited to about 4.5
kb. Methods for producing and using such AAVs are known in the art.
See, for example, U.S. Pat. Nos. 5,139,941, 5,173,414, 5,354,678,
5,436,146, 5,474,935, 5,478,745, and 5,589,377.
[0569] For example, an appropriate AAV vector for use in the
present invention will include all the sequences necessary for DNA
replication, encapsidation, and host-cell integration. The
G-protein Chemokine Receptor (CCR5) polynucleotide construct is
inserted into the AAV vector using standard cloning methods, such
as those found in Sambrook et al., Molecular Cloning: A Laboratory
Manual, Cold Spring Harbor Press (1989). The recombinant AAV vector
is then transfected into packaging cells which are infected with a
helper virus, using any standard technique, including lipofection,
electroporation, calcium phosphate precipitation, etc. Appropriate
helper viruses include adenoviruses, cytomegaloviruses, vaccinia
viruses, or herpes viruses. Once the packaging cells are
transfected and infected, they will produce infectious AAV viral
particles which contain the G-protein Chemokine Receptor (CCR5)
polynucleotide construct. These viral particles are then used to
transduce eukaryotic cells, either ex vivo or in vivo. The
transduced cells will contain the G-protein Chemokine Receptor
(CCR5) polynucleotide construct integrated into its genome, and
will express G-protein Chemokine Receptor.
[0570] Another method of gene therapy involves operably associating
heterologous control regions and endogenous polynucleotide
sequences (e.g. encoding G-protein Chemokine Receptor) via
homologous recombination (see, e.g., U.S. Pat. No. 5,641,670,
issued Jun. 24, 1997; International Publication No. WO 96/29411,
published Sep. 26, 1996; International Publication No. WO 94/12650,
published Aug. 4, 1994; Koller et al., Proc. Natl. Acad. Sci. USA
86:8932-8935 (1989); and Zijlstra et al., Nature 342:435-438
(1989). This method involves the activation of a gene which is
present in the target cells, but which is not normally expressed in
the cells, or is expressed at a lower level than desired.
[0571] Polynucleotide constructs are made, using standard
techniques known in the art, which contain the promoter with
targeting sequences flanking the promoter. Suitable promoters are
described herein. The targeting sequence is sufficiently
complementary to an endogenous sequence to permit homologous
recombination of the promoter-targeting sequence with the
endogenous sequence. The targeting sequence will be sufficiently
near the 5' end of the G-protein Chemokine Receptor (CCR5) desired
endogenous polynucleotide sequence so the promoter will be operably
linked to the endogenous sequence upon homologous
recombination.
[0572] The promoter and the targeting sequences can be amplified
using PCR. Preferably, the amplified promoter contains distinct
restriction enzyme sites on the 5' and 3' ends. Preferably, the 3'
end of the first targeting sequence contains the same restriction
enzyme site as the 5' end of the amplified promoter and the 5' end
of the second targeting sequence contains the same restriction site
as the 3' end of the amplified promoter. The amplified promoter and
targeting sequences are digested and ligated together.
[0573] The promoter-targeting sequence construct is delivered to
the cells, either as naked polynucleotide, or in conjunction with
transfection-facilitating agents, such as liposomes, viral
sequences, viral particles, whole viruses, lipofection,
precipitating agents, etc., described in more detail above. The P
promoter-targeting sequence can be delivered by any method,
included direct needle injection, intravenous injection, topical
administration, catheter infusion, particle accelerators, etc. The
methods are described in more detail below.
[0574] The promoter-targeting sequence construct is taken up by
cells. Homologous recombination between the construct and the
endogenous sequence takes place, such that an endogenous G-protein
Chemokine Receptor (CCR5) sequence is placed under the control of
the promoter. The promoter then drives the expression of the
endogenous G-protein Chemokine Receptor (CCR5) sequence.
[0575] The polynucleotides encoding G-protein Chemokine Receptor
(CCR5) may be administered along with other polynucleotides
encoding an angiogenic protein. Examples of angiogenic proteins
include, but are not limited to, acidic and basic fibroblast growth
factors, VEGF-1, VEGF-2, VEGF-3, epidermal growth factor alpha and
beta, platelet-derived endothelial cell growth factor,
platelet-derived growth factor, tumor necrosis factor alpha,
hepatocyte growth factor, insulin like growth factor, colony
stimulating factor, macrophage colony stimulating factor,
granulocyte/macrophage colony stimulating factor, and nitric oxide
synthase.
[0576] In one preferred embodiment, the polynucleotide encoding
G-protein Chemokine Receptor (CCR5) contains a secretory signal
sequence that facilitates secretion of the protein. Typically, the
signal sequence is positioned in the coding region of the
polynucleotide to be expressed towards or at the 5' end of the
coding region. The signal sequence may be homologous or
heterologous to the polynucleotide of interest and may be
homologous or heterologous to the cells to be transfected.
Additionally, the signal sequence may be chemically synthesized
using methods known in the art.
[0577] Any mode of administration of any of the above-described
polynucleotides constructs can be used so long as the mode results
in the expression of one or more molecules in an amount sufficient
to provide a therapeutic effect. This includes direct needle
injection, systemic injection, catheter infusion, biolistic
injectors, particle accelerators (i.e., "gene guns"), gelfoam
sponge depots, other commercially available depot materials,
osmotic pumps (e.g., Alza minipumps), oral or suppositorial solid
(tablet or pill) pharmaceutical formulations, and decanting or
topical applications during surgery. For example, direct injection
of naked calcium phosphate-precipitated plasmid into rat liver and
rat spleen or a protein-coated plasmid into the portal vein has
resulted in gene expression of the foreign gene in the rat livers
(Kaneda et al., Science 243:375 (1989)).
[0578] A preferred method of local administration is by direct
injection. Preferably, a recombinant molecule of the present
invention complexed with a delivery vehicle is administered by
direct injection into or locally within the area of arteries.
Administration of a composition locally within the area of arteries
refers to injecting the composition centimeters and preferably,
millimeters within arteries.
[0579] Another method of local administration is to contact a
polynucleotide construct of the present invention in or around a
surgical wound. For example, a patient can undergo surgery and the
polynucleotide construct can be coated on the surface of tissue
inside the wound or the construct can be injected into areas of
tissue inside the wound.
[0580] Therapeutic compositions useful in systemic administration,
include recombinant molecules of the present invention complexed to
a targeted delivery vehicle of the present invention. Suitable
delivery vehicles for use with systemic administration comprise
liposomes comprising ligands for targeting the vehicle to a
particular site.
[0581] Preferred methods of systemic administration, include
intravenous injection, aerosol, oral and percutaneous (topical)
delivery. Intravenous injections can be performed using methods
standard in the art. Aerosol delivery can also be performed using
methods standard in the art (see, for example, Stribling et al.,
Proc. Natl. Acad. Sci. USA 189:11277-11281, 1992, which is
incorporated herein by reference). Oral delivery can be performed
by complexing a polynucleotide construct of the present invention
to a carrier capable of withstanding degradation by digestive
enzymes in the gut of an animal. Examples of such carriers, include
plastic capsules or tablets, such as those known in the art.
Topical delivery can be performed by mixing a polynucleotide
construct of the present invention with a lipophilic reagent (e.g.,
DMSO) that is capable of passing into the skin.
[0582] Determining an effective amount of substance to be delivered
can depend upon a number of factors including, for example, the
chemical structure and biological activity of the substance, the
age and weight of the animal, the precise condition requiring
treatment and its severity, and the route of administration. The
frequency of treatments depends upon a number of factors, such as
the amount of polynucleotide constructs administered per dose, as
well as the health and history of the subject. The precise amount,
number of doses, and timing of doses will be determined by the
attending physician or veterinarian.
[0583] Therapeutic compositions of the present invention can be
administered to any animal, preferably to mammals and birds.
Preferred mammals include humans, dogs, cats, mice, rats, rabbits
sheep, cattle, horses and pigs, with humans being particularly
preferred.
Biological Activities of G-Protein Chemokine Receptor
[0584] G-protein Chemokine Receptor (CCR5) polynucleotides or
polypeptides, or agonists or antagonists of G-protein Chemokine
Receptor (CCR5), can be used in assays to test for one or more
biological activities. If G-protein Chemokine Receptor (CCR5)
polynucleotides or polypeptides, or agonists or antagonists of
G-protein Chemokine Receptor (CCR5), do exhibit activity in a
particular assay, it is likely that G-protein Chemokine Receptor
(CCR5) may be involved in the diseases associated with the
biological activity. Therefore, G-protein Chemokine Receptor (CCR5)
could be used to treat, prevent, and/or diagnose the associated
disease.
[0585] Ligands of the G-protein Chemokine Receptor (CCR5) include
MIP-1alpha, MIP-1beta, MCP-1, MCP-2, MCP-3, MCP-4, RANTES, and
Eotaxin. The G-protein Chemokine Receptor (CCR5) is also a major
co-receptor for HIV, and may be also be recognized by other
infectious agents, such as other viruses, to allow entry into the
cell. Thus, G-protein Chemokine Receptor (CCR5) polynucleotides,
polypeptides, agonists and antagonists thereof are useful for
treating, preventing and diagnosing diseases associated with any of
the above ligands, such as the diseases disclosed herein. In highly
preferred embodiments, G-protein Chemokine Receptor (CCR5)
polynucleotides, polypeptides, agonists and antagonists thereof are
useful for treating, preventing and diagnosing HIV infection and/or
conditions associated with HIV infection, as described in the
section entitled "Treatment and prevention of HIV Infection."
[0586] G-protein Chemokine Receptor (CCR5) is predominantly
expressed on monocytes and T-cells. Expression of G-protein
Chemokine Receptor (CCR5) is found on microglial, dendritic and
some hematopoietic stem cells. Activation of G-protein Chemokine
Receptor (CCR5) on macrophages and lymphocytes by G-protein
Chemokine Receptor (CCR5) ligands (especially, RANTES, MIP-1beta
and MIP-1alpha) primarily results in chemoattraction of these cell
types to sites of inflammation, often sites of infection. G-protein
Chemokine Receptor (CCR5) may also be involved in the induction of
chemotaxis in NK cells, eosinophils and basophils. Activation of
G-protein Chemokine Receptor (CCR5) on macrophages and lymphocytes
by G-protein Chemokine Receptor (CCR5) ligands (especially, RANTES,
MIP-1beta and MIP-1alpha) can promote interactions between T-cells
and antigen presenting cells (e.g., dendritic cells, macrophages
and B cells.) G-protein Chemokine Receptor (CCR5) may also be
involved in cell sticking and migration through blood vessels via
adhesion molecules in transit to site of inflammation. Accordingly,
compositions of the invention (including polynucleotides,
polypeptides and antibodies of the invention, and fragments and
variants thereof) may be used in the diagnosis, prognosis,
prevention, and/or treatment of diseases and/or disorders
associated with defects in the biological activities of G-protein
Chemokine Receptor (CCR5) such as those described above.
[0587] In preferred embodiments, compositions of the invention
(including polynucleotides, polypeptides and antibodies of the
invention, and fragments and variants thereof) may be used in the
diagnosis, prognosis, prevention, and/or treatment of diseases
and/or disorders relating to immune function (e.g., viral infection
(especially HIV infection, poxvirus infection and/or
cytomegalovirus infection); autoimmune diseases (such as Rheumatoid
Arthritis, Grave's disease and Multiple Sclerosis); immune cell
chemotaxis; inflammatory conditions; and/or as described in "Immune
Activity") and neoplastic disorders such as those described under
"Hyperproliferative Disorders" below).
[0588] G-protein Chemokine Receptor (CCR5) polynucleotides,
polypeptides, agonists and antagonists (including antibodies) of
the invention are useful in the diagnosis, prognosis, prevention,
and/or treatment of diseases and/or disorders associated with
activities that include, but are not limited to, immune cell
chemoattraction, immune cell activation, antigen presentation,
inflammation, and viral infection.
[0589] More generally, G-protein Chemokine Receptor (CCR5)
polynucleotides, polypeptides, agonists and antagonists (including
antibodies) of the invention may be useful for the diagnosis,
prognosis, prevention, and/or treatment of diseases and/or
disorders described below.
[0590] Treatment and Prevention of HIV Infection. As CCR5 is HIV
co-receptor for macrophage tropic HIV it has major impact on HIV
infection and disease progression, especially early in HIV
infection when HIV is predominantly of R5 macrophage-tropic
strains. Therefore, G-protein Chemokine Receptor (CCR5)
polynucleotides or polypeptides, or agonists (including antibodies)
or antagonists (including antibodies) of G-protein Chemokine
Receptor (CCR5), may be used to diagnose, treat, prevent, and/or
ameliorate HIV infection.
[0591] In specific embodiments, G-protein Chemokine Receptor (CCR5)
polynucleotides or polypeptides, or agonists (including antibodies)
or antagonists (including antibodies) of G-protein Chemokine
Receptor (CCR5), may be used to diagnose, treat, prevent, and/or
ameliorate diseases, disorders or conditions associated with HIV
infection. Conditions associated with HIV infection include, but
are not limited to, Pneumocystis carinii pneumonia, Wasting
syndrome, Kaposi's sarcoma, Esophageal candidiasis, and pulmonary
Candidiasis, disseminated or extrapulmonary Mycobacterium
avium-intracellulare complex, disseminated or extrapulmonary
Mycobacterium kansasii, Cytomegalovirus disease, Cytomegalovirus
retinitis, HIV encephalopathy, Herpes simplex disease,
extrapulmonary Cryptococcosis, Toxoplasmosis of brain, chronic
Cryptosporidiosis, chronic intestinal Cryptosporidiosis,
immunoblastic lymphoma, extrapulmonary Mycobacterium tuberculosis,
pulmonary Mycobacterium tuberculosis, Mycobacterial disease,
extrapulmonary Mycobacterial disease, Burkitt's lymphoma,
progressive multifocal leukoencephalopathy, primary brain lymphoma,
chronic Isosporiasis, chronic intestinal Isosporiasis, disseminated
or extrapulmonary Coccidioidomycosis, Salmonella septicemia,
multiple or recurrent bacterial infections, invasive cervical
carcinoma, disseminated or extrapulmonary Histoplasmosis, Lymphoid
interstitial pneumonia, pulmonary lymphoid hyperplasia, recurrent
pneumonia, severe immunosuppression and/or AIDS dementia.
[0592] In preferred embodiments, G-protein Chemokine Receptor
(CCR5) polynucleotides or polypeptides, or agonists (including
antibodies) or antagonists (including antibodies) of G-protein
Chemokine Receptor (CCR5), may be used to diagnose, treat, prevent,
and/or ameliorate opportunistic infections (e.g., Herpes virus
infection, Mycobacterium Tuberculosis infection, or cytomegalovirus
infection) associated with HIV infection.
[0593] In preferred embodiments, G-protein Chemokine Receptor
(CCR5) polynucleotides or polypeptides, or agonists (including
antibodies) or antagonists (including antibodies) of G-protein
Chemokine Receptor (CCR5), may be used to diagnose, treat, prevent,
and/or ameliorate opportunistic Pneumocystis carinii infection
associated with HIV infection.
[0594] In preferred embodiments, G-protein Chemokine Receptor
(CCR5) polynucleotides or polypeptides, or agonists (including
antibodies) or antagonists (including antibodies) of G-protein
Chemokine Receptor (CCR5), may be used to diagnose, treat, prevent,
and/or ameliorate Kaposi's sarcoma associated with HIV
infection.
[0595] In other preferred embodiments, G-protein Chemokine Receptor
(CCR5) polynucleotides or polypeptides, or agonists (including
antibodies) or antagonists (including antibodies) of G-protein
Chemokine Receptor (CCR5), may be used to diagnose, treat, prevent,
and/or ameliorate the early stages of HIV infection.
[0596] In other embodiments, G-protein Chemokine Receptor (CCR5)
polynucleotides or polypeptides, or agonists (including antibodies)
or antagonists (including antibodies) of G-protein Chemokine
Receptor (CCR5), may be used to diagnose, treat, prevent, and/or
ameliorate the late stages of HIV infection.
[0597] In other embodiments, G-protein Chemokine Receptor (CCR5)
polynucleotides or polypeptides, or agonists (including antibodies)
or antagonists (including antibodies) of G-protein Chemokine
Receptor (CCR5), may be used to diagnose, treat, prevent, and/or
ameliorate the late stages of HIV infection.
[0598] In still other embodiments, G-protein Chemokine Receptor
(CCR5) polynucleotides or polypeptides, or agonists (including
antibodies) or antagonists (including antibodies) of G-protein
Chemokine Receptor (CCR5) are used as a prophylatic to prevent HIV
infection in persons who have an HIV-infected sexual partner or
persons with reason to believe they have been exposed to HIV,
(e.g., persons who have been stuck with a needle that had
previously been in contact with the biological fluid of another
individual (or animal), or rape victims).
[0599] In still other embodiments, G-protein Chemokine Receptor
(CCR5) polynucleotides or polypeptides, or agonists (including
antibodies) or antagonists (including antibodies) of G-protein
Chemokine Receptor (CCR5) are used as a prophylatic to prevent
maternal-fetal transmission of HIV.
[0600] Immune Activity. G-protein Chemokine Receptor (CCR5)
polynucleotides or polypeptides, or agonists or antagonists of
G-protein Chemokine Receptor (CCR5), may be useful in treating
diseases, disorders, and/or conditions of the immune system, by
activating or inhibiting the proliferation, differentiation, or
mobilization (chemotaxis) of immune cells. Immune cells develop
through a process called hematopoiesis, producing myeloid
(platelets, red blood cells, neutrophils, and macrophages) and
lymphoid (B and T lymphocytes) cells from pluripotent stem cells.
The etiology of these immune diseases, disorders, and/or conditions
may be genetic, somatic, such as cancer or some autoimmune
diseases, disorders, and/or conditions, acquired (e.g., by
chemotherapy or toxins), or infectious. Moreover, G-protein
Chemokine Receptor (CCR5) polynucleotides or polypeptides, or
agonists or antagonists of G-protein Chemokine Receptor (CCR5), can
be used as a marker or detector of a particular immune system
disease or disorder.
[0601] The G-protein Chemokine Receptor (CCR5) polynucleotides
and/or polypeptides of the present invention and/or agonists or
antagonists thereof may be used to modulate hematopoietic activity
(the formation of blood cells). For example, the G-protein
Chemokine Receptor (CCR5) polynucleotides and/or polypeptides of
the present invention and/or agonists or antagonists thereof may be
used to increase the quantity of all or subsets of blood cells,
such as, for example, erythrocytes, lymphocytes (B or T cells),
myeloid cells (e.g., basophils, eosinophils, neutrophils, mast
cells, macrophages) and platelets. The ability to decrease the
quantity of blood cells or subsets of blood cells may be useful in
the prevention, detection, diagnosis and/or treatment of anemias
and leukopenias described below. Alternatively, the G-protein
Chemokine Receptor (CCR5) polynucleotides and/or polypeptides of
the present invention and/or agonists or antagonists thereof may be
used to decrease the quantity of all or subsets of blood cells,
such as, for example, erythrocytes, lymphocytes (B or T cells),
myeloid cells (e.g., basophils, eosinophils, neutrophils, mast
cells, macrophages) and platelets. The ability to decrease the
quantity of blood cells or subsets of blood cells may be useful in
the prevention, detection, diagnosis and/or treatment of
leukocytoses, such as, for example eosinophilia.
[0602] G-protein Chemokine Receptor (CCR5) polynucleotides or
polypeptides, or agonists or antagonists of G-protein Chemokine
Receptor (CCR5), may be useful in treating, preventing, and/or
diagnosing diseases, disorders, and/or conditions of hematopoietic
cells. G-protein Chemokine Receptor (CCR5) polynucleotides or
polypeptides, or agonists or antagonists of G-protein Chemokine
Receptor (CCR5), could be used to increase differentiation and
proliferation of hematopoietic cells, including the pluripotent
stem cells, in an effort to treat or prevent those diseases,
disorders, and/or conditions associated with a decrease in certain
(or many) types hematopoietic cells. Examples of immunologic
deficiency syndromes include, but are not limited to, blood protein
diseases, disorders, and/or conditions (e.g. agammaglobulinemia,
dysgammaglobulinemia), ataxia telangiectasia, common variable
immunodeficiency, Digeorge Syndrome, HIV infection, HTLV-BLV
infection, leukocyte adhesion deficiency syndrome, lymphopenia,
phagocyte bactericidal dysfunction, severe combined
immunodeficiency (SCIDs), Wiskott-Aldrich Disorder, anemia,
thrombocytopenia, leukopenia, neutropenia, anemia or
hemoglobinuria. Alternatively, G-protein Chemokine Receptor (CCR5)
polynucleotides and/or polypeptides of the invention, and/or
agonists or antagonists thereof could be used to increase
differentiation and proliferation of hematopoietic cells, including
the pluripotent stem cells, in an effort to treat or prevent those
diseases, disorders, and/or conditions associated with an increase
in certain (or many) types of hematopoietic cells, including but
not limited to, histiocytosis.
[0603] In another embodiment, a G-protein Chemokine Receptor (CCR5)
polypeptide of the invention, or polynucleotides, antibodies,
agonists, or antagonists corresponding to that G-protein Chemokine
Receptor (CCR5) polypeptide, may be used to treat diseases and
disorders of the immune system and/or to inhibit or enhance an
immune response generated by cells associated with the tissue(s) in
which the polypeptide of the invention is expressed.
[0604] G-protein Chemokine Receptor (CCR5) polynucleotides and/or
polypeptides of the invention, and/or agonists or antagonists
thereof may be useful in treating, preventing, diagnosing, and/or
prognosing immunodeficiencies, including both congenital and
acquired immunodeficiencies. Examples of B cell immunodeficiencies
in which immunoglobulin levels B cell function and/or B cell
numbers are decreased include: X-linked agammaglobulinemia
(Bruton's disease), X-linked infantile agammaglobulinemia, X-linked
immunodeficiency with hyper IgM, non X-linked immunodeficiency with
hyper IgM, X-linked lymphoproliferative syndrome (XLP),
agammaglobulinemia including congenital and acquired
agammaglobulinemia, adult onset agammaglobulinemia, late-onset
agammaglobulinemia, dysgammaglobulinemia, hypogammaglobulinemia,
unspecified hypogammaglobulinemia, recessive agammaglobulinemia
(Swiss type), Selective IgM deficiency, selective IgA deficiency,
selective IgG subclass deficiencies, IgG subclass deficiency (with
or without IgA deficiency), Ig deficiency with increased IgM, IgG
and IgA deficiency with increased IgM, antibody deficiency with
normal or elevated Igs, Ig heavy chain deletions, kappa chain
deficiency, B cell lymphoproliferative disorder (BLPD), common
variable immunodeficiency (CVID), common variable immunodeficiency
(CVI) (acquired), and transient hypogammaglobulinemia of
infancy.
[0605] In specific embodiments, ataxia-telangiectasia or conditions
associated with ataxia-telangiectasia are treated, prevented,
diagnosed, and/or prognosing using the polypeptides or
polynucleotides of the invention, and/or agonists or antagonists
thereof.
[0606] Examples of congenital immunodeficiencies in which T cell
and/or B cell function and/or number is decreased include, but are
not limited to: DiGeorge anomaly, severe combined
immunodeficiencies (SCID) (including, but not limited to, X-linked
SCID, autosomal recessive SCID, adenosine deaminase deficiency,
purine nucleoside phosphorylase (PNP) deficiency, Class II MHC
deficiency (Bare lymphocyte syndrome), Wiskott-Aldrich syndrome,
and ataxia telangiectasia), thymic hypoplasia, third and fourth
pharyngeal pouch syndrome, 22q11.2 deletion, chronic mucocutaneous
candidiasis, natural killer cell deficiency (NK), idiopathic CD4+
T-lymphocytopenia, immunodeficiency with predominant T cell defect
(unspecified), and unspecified immunodeficiency of cell mediated
immunity
[0607] In specific embodiments, DiGeorge anomaly or conditions
associated with DiGeorge anomaly are treated, prevented, diagnosed,
and/or prognosed using polypeptides or polynucleotides of the
invention, or antagonists or agonists thereof.
[0608] Other immunodeficiencies that may be treated, prevented,
diagnosed, and/or prognosed using polypeptides or polynucleotides
of the invention, and/or agonists or antagonists thereof, include,
but are not limited to, chronic granulomatous disease,
Chediak-Higashi syndrome, myeloperoxidase deficiency, leukocyte
glucose-6-phosphate dehydrogenase deficiency, X-linked
lymphoproliferative syndrome (XLP), leukocyte adhesion deficiency,
complement component deficiencies (including C1, C2, C3, C4, C5,
C6, C7, C8 and/or C9 deficiencies), reticular dysgenesis, thymic
alymphoplasia-aplasia, immunodeficiency with thymoma, severe
congenital leukopenia, dysplasia with immunodeficiency, neonatal
neutropenia, short limbed dwarfism, and Nezelof syndrome-combined
immunodeficiency with Igs.
[0609] In a preferred embodiment, the immunodeficiencies and/or
conditions associated with the immunodeficiencies recited above are
treated, prevented, diagnosed and/or prognosed using G-protein
Chemokine Receptor (CCR5) polynucleotides and/or polypeptides of
the invention, and/or agonists or antagonists thereof.
[0610] In a preferred embodiment G-protein Chemokine Receptor
(CCR5) polynucleotides and/or polypeptides of the invention, and/or
agonists or antagonists thereof could be used as an agent to boost
immunoresponsiveness among immunodeficient individuals. In specific
embodiments, G-protein Chemokine Receptor (CCR5) polynucleotides
and/or polypeptides of the invention, and/or agonists or
antagonists thereof could be used as an agent to boost
immunoresponsiveness among B cell and/or T cell immunodeficient
individuals.
[0611] Moreover, G-protein Chemokine Receptor (CCR5)
polynucleotides or polypeptides, or agonists or antagonists of
G-protein Chemokine Receptor (CCR5), can also be used to modulate
hemostatic (the stopping of bleeding) or thrombolytic activity
(clot formation). For example, by increasing hemostatic or
thrombolytic activity, G-protein Chemokine Receptor (CCR5)
polynucleotides or polypeptides, or agonists or antagonists of
G-protein Chemokine Receptor (CCR5), could be used to treat or
prevent blood coagulation diseases, disorders, and/or conditions
(e.g., afibrinogenemia, factor deficiencies), blood platelet
diseases, disorders, and/or conditions (e.g. thrombocytopenia), or
wounds resulting from trauma, surgery, or other causes.
Alternatively, G-protein Chemokine Receptor (CCR5) polynucleotides
or polypeptides, or agonists or antagonists of G-protein Chemokine
Receptor (CCR5), that can decrease hemostatic or thrombolytic
activity could be used to inhibit or dissolve clotting. These
molecules could be important in the treatment or prevention of
heart attacks (infarction), strokes, or scarring.
[0612] G-protein Chemokine Receptor (CCR5) polynucleotides or
polypeptides, or agonists or antagonists of G-protein Chemokine
Receptor (CCR5), may also be useful in treating, preventing, and/or
diagnosing autoimmune diseases, disorders, and/or conditions. Many
autoimmune diseases, disorders, and/or conditions result from
inappropriate recognition of self as foreign material by immune
cells. This inappropriate recognition results in an immune response
leading to the destruction of the host tissue. Therefore, the
administration of G-protein Chemokine Receptor (CCR5)
polynucleotides or polypeptides, or agonists or antagonists of
G-protein Chemokine Receptor (CCR5), that can inhibit an immune
response, particularly the proliferation, differentiation, or
chemotaxis of T-cells, may be an effective therapy in preventing
autoimmune diseases, disorders, and/or conditions.
[0613] Examples of autoimmune diseases, disorders, and/or
conditions that can be treated, prevented, and/or diagnosed or
detected by G-protein Chemokine Receptor (CCR5) include, but are
not limited to: Addison's Disease, hemolytic anemia,
antiphospholipid syndrome, rheumatoid arthritis, dermatitis,
allergic encephalomyelitis, glomerulonephritis, Goodpasture's
Syndrome, Graves' Disease, Multiple Sclerosis, Myasthenia Gravis,
Neuritis, Ophthalmia, Bullous Pemphigoid, Pemphigus,
Polyendocrinopathies, Purpura, Reiter's Disease, Stiff-Man
Syndrome, Autoimmune Thyroiditis, Systemic Lupus Erythematosus,
Autoimmune Pulmonary Inflammation, Guillain-Barre Syndrome, insulin
dependent diabetes mellitis, and autoimmune inflammatory eye
disease.
[0614] Similarly, allergic reactions and conditions, such as asthma
(particularly allergic asthma) or other respiratory problems, may
also be treated, prevented, and/or diagnosed by G-protein Chemokine
Receptor (CCR5) polynucleotides or polypeptides, or agonists or
antagonists of G-protein Chemokine Receptor. Moreover, these
molecules can be used to treat anaphylaxis, hypersensitivity to an
antigenic molecule, or blood group incompatibility.
[0615] Additionally, G-protein Chemokine Receptor (CCR5)
polypeptides or polynucleotides of the invention, and/or agonists
or antagonists thereof, may be used to treat, prevent, diagnose
and/or prognose IgE-mediated allergic reactions. Such allergic
reactions include, but are not limited to, asthma, rhinitis, and
eczema. In specific embodiments, G-protein Chemokine Receptor
(CCR5) polynucleotides and/or polypeptides of the invention, and/or
agonists or antagonists thereof may be used to modulate IgE
concentrations in vitro or in vivo.
[0616] G-protein Chemokine Receptor (CCR5) polynucleotides or
polypeptides, or agonists or antagonists of G-protein Chemokine
Receptor (CCR5), may also be used to treat, prevent, and/or
diagnose organ rejection or graft-versus-host disease (GVHD). Organ
rejection occurs by host immune cell destruction of the
transplanted tissue through an immune response. Similarly, an
immune response is also involved in GVHD, but, in this case, the
foreign transplanted immune cells destroy the host tissues. The
administration of G-protein Chemokine Receptor (CCR5)
polynucleotides or polypeptides, or agonists or antagonists of
G-protein Chemokine Receptor (CCR5), that inhibits an immune
response, particularly the proliferation, differentiation, or
chemotaxis of T-cells, may be an effective therapy in preventing
organ rejection or GVHD. In specific embodiments, polypeptides,
antibodies, or polynucleotides of the invention, and/or agonists or
antagonists thereof, that inhibit an immune response, particularly
the activation, proliferation, differentiation, or chemotaxis of
T-cells, may be an effective therapy in preventing experimental
allergic and hyperacute xenograft rejection.
[0617] Similarly, G-protein Chemokine Receptor (CCR5)
polynucleotides or polypeptides, or agonists or antagonists of
G-protein Chemokine Receptor (CCR5), may also be used to modulate
inflammation. For example, since polypeptides, antibodies, or
polynucleotides of the invention, and/or agonists or antagonists of
the invention may inhibit the activation, proliferation and/or
differentiation of cells involved in an inflammatory response,
these molecules can be used to prevent and/or treat chronic and
acute inflammatory conditions. Such inflammatory conditions
include, but are not limited to, for example, inflammation
associated with infection (e.g., septic shock, sepsis, or systemic
inflammatory response syndrome), ischemia-reperfusion injury,
endotoxin lethality, complement-mediated hyperacute rejection,
nephritis, cytokine or chemokine induced lung injury, inflammatory
bowel disease, Crohn's disease, over production of cytokines (e.g.,
TNF or IL-1.), respiratory disorders (e.g., asthma and allergy);
gastrointestinal disorders (e.g., inflammatory bowel disease);
cancers (e.g., gastric, ovarian, lung, bladder, liver, and breast);
CNS disorders (e.g., multiple sclerosis; ischemic brain injury
and/or stroke, traumatic brain injury, neurodegenerative disorders
(e.g., Parkinson's disease and Alzheimer's disease); AIDS-related
dementia; and prion disease); cardiovascular disorders (e.g.,
atherosclerosis, myocarditis, cardiovascular disease, and
cardiopulmonary bypass complications); as well as many additional
diseases, conditions, and disorders that are characterized by
inflammation (e.g., hepatitis, rheumatoid arthritis, gout, trauma,
pancreatitis, sarcoidosis, dermatitis, renal ischemia-reperfusion
injury, Grave's disease, systemic lupus erythematosus, diabetes
mellitus, and allogenic transplant rejection).
[0618] Because inflammation is a fundamental defense mechanism,
inflammatory disorders can effect virtually any tissue of the body.
Accordingly, polynucleotides, polypeptides, and antibodies of the
invention, as well as agonists or antagonists thereof, have uses in
the treatment of tissue-specific inflammatory disorders, including,
but not limited to, adrenalitis, alveolitis, angiocholecystitis,
appendicitis, balanitis, blepharitis, bronchitis, bursitis,
carditis, cellulitis, cervicitis, cholecystitis, chorditis,
cochlitis, colitis, conjunctivitis, cystitis, dermatitis,
diverticulitis, encephalitis, endocarditis, esophagitis,
eustachitis, fibrositis, folliculitis, gastritis, gastroenteritis,
gingivitis, glossitis, hepatosplenitis, keratitis, labyrinthitis,
laryngitis, lymphangitis, mastitis, media otitis, meningitis,
metritis, mucitis, myocarditis, myosititis, myringitis, nephritis,
neuritis, orchitis, osteochondritis, otitis, pericarditis,
peritendonitis, peritonitis, pharyngitis, phlebitis, poliomyelitis,
prostatitis, pulpitis, retinitis, rhinitis, salpingitis, scleritis,
sclerochoroiditis, scrotitis, sinusitis, spondylitis, steatitis,
stomatitis, synovitis, syringitis, tendonitis, tonsillitis,
urethritis, and vaginitis.
[0619] In other embodiments, the G-protein Chemokine Receptor
(CCR5) polynucleotides and/or polypeptides of the present invention
and/or agonists or antagonists thereof may be useful as an agent to
enhance the migration, phagocytosis, superoxide production,
antibody dependent cellular cytotoxicity of neutrophils,
eosionophils and macrophages.
[0620] In another embodiment, the G-protein Chemokine Receptor
(CCR5) polynucleotides and/or polypeptides of the present invention
and/or agonists or antagonists thereof may be useful in diagnosing,
prognosing, preventing, and/or treating diseases and disorders
characterized by or associated with increased or decreased numbers
of white blood cells. Leukopenia occurs when the number of white
blood cells decreases below normal. Leukopenias include, but are
not limited to, neutropenia and lymphocytopenia. An increase in the
number of white blood cells compared to normal is known as
leukocytosis. The body generates increased numbers of white blood
cells during infection. Thus, leukocytosis may simply be a normal
physiological parameter that reflects infection. Alternatively,
leukocytosis may be an indicator of injury or other disease such as
cancer. Leokocytoses, include but are not limited to, eosinophilia,
and accumulations of macrophages. In specific embodiments, the
G-protein Chemokine Receptor (CCR5) polynucleotides and/or
polypeptides of the present invention and/or agonists or
antagonists thereof may be useful in diagnosing, prognosing,
preventing, and/or treating leukopenia. In other specific
embodiments, the G-protein Chemokine Receptor (CCR5)
polynucleotides and/or polypeptides of the present invention and/or
agonists or antagonists thereof may be useful in diagnosing,
prognosing, preventing, and/or treating leukocytosis.
[0621] Leukopenia may be a generalized decreased in all types of
white blood cells, or may be a specific depletion of particular
types of white blood cells. Thus, in specific embodiments, the
G-protein Chemokine Receptor (CCR5) polynucleotides and/or
polypeptides of the present invention and/or agonists or
antagonists thereof may be useful in diagnosing, prognosing,
preventing, and/or treating decreases in neutrophil numbers, known
as neutropenia. Neutropenias that may be diagnosed, prognosed,
prevented, and/or treated by the G-protein Chemokine Receptor
(CCR5) polynucleotides and/or polypeptides of the present invention
and/or agonists or antagonists thereof include, but are not limited
to, infantile genetic agranulocytosis, familial neutropenia, cyclic
neutropenia, neutropenias resulting from or associated with dietary
deficiencies (e.g., vitamin B 12 deficiency or folic acid
deficiency), neutropenias resulting from or associated with drug
treatments (e.g., antibiotic regimens such as penicillin treatment,
sulfonamide treatment, anticoagulant treatment, anticonvulsant
drugs, anti-thyroid drugs, and cancer chemotherapy), and
neutropenias resulting from increased neutrophil destruction that
may occur in association with some bacterial or viral infections,
allergic disorders, autoimmune diseases, conditions in which an
individual has an enlarged spleen (e.g., Felty syndrome, malaria
and sarcoidosis), and some drug treatment regimens.
[0622] The G-protein Chemokine Receptor (CCR5) polynucleotides
and/or polypeptides of the present invention and/or agonists or
antagonists thereof may be useful in diagnosing, prognosing,
preventing, and/or treating lymphocytopenias (decreased numbers of
B and/or T lymphocytes), including, but not limited
lymphocytopenias resulting from or associated with stress, drug
treatments (e.g., drug treatment with corticosteroids, cancer
chemotherapies, and/or radiation therapies), AIDS and/or other
diseases such as, for example, cancer, rheumatoid arthritis,
systemic lupus erythematosus, chronic infections, some viral
infections and/or hereditary disorders (e.g., DiGeorge syndrome,
Wiskott-Aldrich Syndrome, severe combined immunodeficiency, ataxia
telangiectasia).
[0623] The G-protein Chemokine Receptor (CCR5) polynucleotides
and/or polypeptides of the present invention and/or agonists or
antagonists thereof may be useful in diagnosing, prognosing,
preventing, and/or treating diseases and disorders associated with
macrophage numbers and/or macrophage function including, but not
limited to, Gaucher's disease, Niemann-Pick disease, Letterer-Siwe
disease and Hand-Schuller-Christian disease.
[0624] In another embodiment, the G-protein Chemokine Receptor
(CCR5) polynucleotides and/or polypeptides of the present invention
and/or agonists or antagonists thereof may be useful in diagnosing,
prognosing, preventing, and/or treating diseases and disorders
associated with eosinophil numbers and/or eosinophil function
including, but not limited to, idiopathic hypereosinophilic
syndrome, eosinophilia-myalgia syndrome, and
Hand-Schuller-Christian disease.
[0625] In yet another embodiment, the G-protein Chemokine Receptor
(CCR5) polynucleotides and/or polypeptides of the present invention
and/or agonists or antagonists thereof may be useful in diagnosing,
prognosing, preventing, and/or treating leukemias and lymphomas
including, but not limited to, acute lymphocytic (lymphoblastic)
leukemia (ALL), acute myeloid (myelocytic, myelogenous,
myeloblastic, or myelomonocytic) leukemia, chronic lymphocytic
leukemia (e.g., B cell leukemias, T cell leukemias, Sezary
syndrome, and Hairy cell leukemia), chronic myelocytic (myeloid,
myelogenous, or granulocytic) leukemia, Hodgkin's lymphoma,
non-hodgkin's lymphoma, Burkitt's lymphoma, and mycosis
fungoides.
[0626] In other embodiments, polypeptides, antibodies, or
polynucleotides of the invention, and/or agonists or antagonists
thereof, are useful to diagnose, prognose, prevent, and/or treat
immune complex diseases, including, but not limited to, serum
sickness, post streptococcal glomerulonephritis, polyarteritis
nodosa, and immune complex-induced vasculitis.
[0627] Polypeptides, antibodies, polynucleotides and/or agonists or
antagonists of the invention can be used to treat, detect, and/or
prevent infectious agents. For example, by increasing the immune
response, particularly increasing the proliferation activation
and/or differentiation of B and/or T cells, infectious diseases may
be treated, detected, and/or prevented. The immune response may be
increased by either enhancing an existing immune response, or by
initiating a new immune response. Alternatively, G-protein
Chemokine Receptor (CCR5) polynucleotides and/or polypeptides of
the invention, and/or agonists or antagonists thereof may also
directly inhibit the infectious agent (refer to section of
application listing infectious agents, etc), without necessarily
eliciting an immune response.
[0628] In another embodiment, G-protein Chemokine Receptor (CCR5)
polynucleotides and/or polypeptides of the invention, and/or
agonists or antagonists thereof are used as a vaccine adjuvant that
enhances immune responsiveness to an antigen. In a specific
embodiment, G-protein Chemokine Receptor (CCR5) polynucleotides
and/or polypeptides of the invention, and/or agonists or
antagonists thereof are used as an adjuvant to enhance
tumor-specific immune responses.
[0629] In another specific embodiment, G-protein Chemokine Receptor
(CCR5) polynucleotides and/or polypeptides of the invention, and/or
agonists or antagonists thereof are used as an adjuvant to enhance
anti-viral immune responses. Anti-viral immune responses that may
be enhanced using the compositions of the invention as an adjuvant,
include virus and virus associated diseases or symptoms described
herein or otherwise known in the art. In specific embodiments, the
compositions of the invention are used as an adjuvant to enhance an
immune response to a virus, disease, or symptom selected from the
group consisting of: AIDS, meningitis, Dengue, EBV, and hepatitis
(e.g., hepatitis B). In another specific embodiment, the
compositions of the invention are used as an adjuvant to enhance an
immune response to a virus, disease, or symptom selected from the
group consisting of: HIV/AIDS, respiratory syncytial virus, Dengue,
rotavirus, Japanese B encephalitis, influenza A and B,
parainfluenza, measles, cytomegalovirus, rabies, Junin,
Chikungunya, Rift Valley Fever, herpes simplex, and yellow
fever.
[0630] In another specific embodiment, G-protein Chemokine Receptor
(CCR5) polynucleotides and/or polypeptides of the invention, and/or
agonists or antagonists thereof are used as an adjuvant to enhance
anti-bacterial or anti-fungal immune responses. Anti-bacterial or
anti-fungal immune responses that may be enhanced using the
compositions of the invention as an adjuvant, include bacteria or
fungus and bacteria or fungus associated diseases or symptoms
described herein or otherwise known in the art. In specific
embodiments, the compositions of the invention are used as an
adjuvant to enhance an immune response to a bacteria or fungus,
disease, or symptom selected from the group consisting of: tetanus,
Diphtheria, botulism, and meningitis type B.
[0631] In another specific embodiment, the compositions of the
invention are used as an adjuvant to enhance an immune response to
a bacteria or fungus, disease, or symptom selected from the group
consisting of: Vibrio cholerae, Mycobacterium leprae, Salmonella
typhi, Salmonella paratyphi, Meisseria meningitidis, Streptococcus
pneumoniae, Group B streptococcus, Shigella spp., Enterotoxigenic
Escherichia coli, Enterohemorrhagic E. coli, and Borrelia
burgdorferi.
[0632] In another specific embodiment, G-protein Chemokine Receptor
(CCR5) polynucleotides and/or polypeptides of the invention, and/or
agonists or antagonists thereof are used as an adjuvant to enhance
anti-parasitic immune responses. Anti-parasitic immune responses
that may be enhanced using the compositions of the invention as an
adjuvant, include parasite and parasite associated diseases or
symptoms described herein or otherwise known in the art. In
specific embodiments, the compositions of the invention are used as
an adjuvant to enhance an immune response to a parasite. In another
specific embodiment, the compositions of the invention are used as
an adjuvant to enhance an immune response to Plasmodium (malaria)
or Leishmania.
[0633] In another specific embodiment, G-protein Chemokine Receptor
(CCR5) polynucleotides and/or polypeptides of the invention, and/or
agonists or antagonists thereof may also be employed to treat
infectious diseases including silicosis, sarcoidosis, and
idiopathic pulmonary fibrosis; for example, by preventing the
recruitment and activation of mononuclear phagocytes.
[0634] In another specific embodiment, G-protein Chemokine Receptor
(CCR5) polynucleotides and/or polypeptides of the invention, and/or
agonists or antagonists thereof are used as an antigen for the
generation of antibodies to inhibit or enhance immune mediated
responses against polypeptides of the invention.
[0635] In one embodiment, G-protein Chemokine Receptor (CCR5)
polynucleotides and/or polypeptides of the invention, and/or
agonists or antagonists thereof are administered to an animal
(e.g., mouse, rat, rabbit, hamster, guinea pig, pigs, micro-pig,
chicken, camel, goat, horse, cow, sheep, dog, cat, non-human
primate, and human, most preferably human) to boost the immune
system to produce increased quantities of one or more antibodies
(e.g., IgG, IgA, IgM, and IgE), to induce higher affinity antibody
production and immunoglobulin class switching (e.g., IgG, IgA, IgM,
and IgE), and/or to increase an immune response.
[0636] In another specific embodiment, G-protein Chemokine Receptor
(CCR5) polynucleotides and/or polypeptides of the invention, and/or
agonists or antagonists thereof are used as a stimulator of B cell
responsiveness to pathogens.
[0637] In another specific embodiment, G-protein Chemokine Receptor
(CCR5) polynucleotides and/or polypeptides of the invention, and/or
agonists or antagonists thereof are used as an activator of T
cells.
[0638] In another specific embodiment, G-protein Chemokine Receptor
(CCR5) polynucleotides and/or polypeptides of the invention, and/or
agonists or antagonists thereof are used as an agent that elevates
the immune status of an individual prior to their receipt of
immunosuppressive therapies.
[0639] In another specific embodiment, G-protein Chemokine Receptor
(CCR5) polynucleotides and/or polypeptides of the invention, and/or
agonists or antagonists thereof are used as an agent to induce
higher affinity antibodies.
[0640] In another specific embodiment, G-protein Chemokine Receptor
(CCR5) polynucleotides and/or polypeptides of the invention, and/or
agonists or antagonists thereof are used as an agent to increase
serum immunoglobulin concentrations.
[0641] In another specific embodiment, G-protein Chemokine Receptor
(CCR5) polynucleotides and/or polypeptides of the invention, and/or
agonists or antagonists thereof are used as an agent to accelerate
recovery of immunocompromised individuals.
[0642] In another specific embodiment, G-protein Chemokine Receptor
(CCR5) polynucleotides and/or polypeptides of the invention, and/or
agonists or antagonists thereof are used as an agent to boost
immunoresponsiveness among aged populations and/or neonates.
[0643] In another specific embodiment, G-protein Chemokine Receptor
(CCR5) polynucleotides and/or polypeptides of the invention, and/or
agonists or antagonists thereof are used as an immune system
enhancer prior to, during, or after bone marrow transplant and/or
other transplants (e.g., allogeneic or xenogeneic organ
transplantation). With respect to transplantation, compositions of
the invention may be administered prior to, concomitant with,
and/or after transplantation. In a specific embodiment,
compositions of the invention are administered after
transplantation, prior to the beginning of recovery of T-cell
populations. In another specific embodiment, compositions of the
invention are first administered after transplantation after the
beginning of recovery of T cell populations, but prior to full
recovery of B cell populations.
[0644] In another specific embodiment, G-protein Chemokine Receptor
(CCR5) polynucleotides and/or polypeptides of the invention, and/or
agonists or antagonists thereof are used as an agent to boost
immunoresponsiveness among individuals having an acquired loss of B
cell function. Conditions resulting in an acquired loss of B cell
function that may be ameliorated or treated by administering the
polypeptides, antibodies, polynucleotides and/or agonists or
antagonists thereof, include, but are not limited to, HIV
Infection, AIDS, bone marrow transplant, and B cell chronic
lymphocytic leukemia (CLL).
[0645] In another specific embodiment, G-protein Chemokine Receptor
(CCR5) polynucleotides and/or polypeptides of the invention, and/or
agonists or antagonists thereof are used as an agent to boost
immunoresponsiveness among individuals having a temporary immune
deficiency. Conditions resulting in a temporary immune deficiency
that may be ameliorated or treated by administering the
polypeptides, antibodies, polynucleotides and/or agonists or
antagonists thereof, include, but are not limited to, recovery from
viral infections (e.g., influenza), conditions associated with
malnutrition, recovery from infectious mononucleosis, or conditions
associated with stress, recovery from measles, recovery from blood
transfusion, and recovery from surgery.
[0646] In another specific embodiment, G-protein Chemokine Receptor
(CCR5) polynucleotides and/or polypeptides of the invention, and/or
agonists or antagonists thereof are used as a regulator of antigen
presentation by monocytes, dendritic cells, and/or B-cells. In one
embodiment, G-protein Chemokine Receptor (CCR5) polynucleotides
and/or polypeptides of the invention, and/or agonists or
antagonists thereof enhance antigen presentation or antagonizes
antigen presentation in vitro or in vivo. Moreover, in related
embodiments, said enhancement or antagonism of antigen presentation
may be useful as an anti-tumor treatment or to modulate the immune
system.
[0647] In another specific embodiment, G-protein Chemokine Receptor
(CCR5) polynucleotides and/or polypeptides of the invention, and/or
agonists or antagonists thereof are used as an agent to direct an
individual's immune system towards development of a humoral
response (i.e. TH2) as opposed to a TH1 cellular response.
[0648] In another specific embodiment, G-protein Chemokine Receptor
(CCR5) polynucleotides and/or polypeptides of the invention, and/or
agonists or antagonists thereof are used as a means to induce tumor
proliferation and thus make it more susceptible to anti-neoplastic
agents. For example, multiple myeloma is a slowly dividing disease
and is thus refractory to virtually all anti-neoplastic regimens.
If these cells were forced to proliferate more rapidly their
susceptibility profile would likely change.
[0649] In another specific embodiment, G-protein Chemokine Receptor
(CCR5) polynucleotides and/or polypeptides of the invention, and/or
agonists or antagonists thereof are used as a stimulator of B cell
production in pathologies such as AIDS, chronic lymphocyte disorder
and/or Common Variable Immunodificiency.
[0650] In another specific embodiment, G-protein Chemokine Receptor
(CCR5) polynucleotides and/or polypeptides of the invention, and/or
agonists or antagonists thereof are used as a therapy for
generation and/or regeneration of lymphoid tissues following
surgery, trauma or genetic defect. In another specific embodiment,
G-protein Chemokine Receptor (CCR5) polynucleotides and/or
polypeptides of the invention, and/or agonists or antagonists
thereof are used in the pretreatment of bone marrow samples prior
to transplant.
[0651] In another specific embodiment, G-protein Chemokine Receptor
(CCR5) polynucleotides and/or polypeptides of the invention, and/or
agonists or antagonists thereof are used as a gene-based therapy
for genetically inherited disorders resulting in
immuno-incompetence/immunodeficiency such as observed among SCID
patients.
[0652] In another specific embodiment, G-protein Chemokine Receptor
(CCR5) polynucleotides and/or polypeptides of the invention, and/or
agonists or antagonists thereof are used as a means of activating
monocytes/macrophages to defend against parasitic diseases that
effect monocytes such as Leishmania.
[0653] In another specific embodiment, G-protein Chemokine Receptor
(CCR5) polynucleotides and/or polypeptides of the invention, and/or
agonists or antagonists thereof are used as a means of regulating
secreted cytokines that are elicited by polypeptides of the
invention.
[0654] In another embodiment, G-protein Chemokine Receptor (CCR5)
polynucleotides and/or polypeptides of the invention, and/or
agonists or antagonists thereof are used in one or more of the
applications described herein, as they may apply to veterinary
medicine.
[0655] In another specific embodiment, G-protein Chemokine Receptor
(CCR5) polynucleotides and/or polypeptides of the invention, and/or
agonists or antagonists thereof are used as a means of blocking
various aspects of immune responses to foreign agents or self.
Examples of diseases or conditions in which blocking of certain
aspects of immune responses may be desired include autoimmune
disorders such as lupus, and arthritis, as well as
immunoresponsiveness to skin allergies, inflammation, bowel
disease, injury and diseases/disorders associated with
pathogens.
[0656] In another specific embodiment, G-protein Chemokine Receptor
(CCR5) polynucleotides and/or polypeptides of the invention, and/or
agonists or antagonists thereof are used as a therapy for
preventing the B cell proliferation and Ig secretion associated
with autoimmune diseases such as idiopathic thrombocytopenic
purpura, systemic lupus erythematosus and multiple sclerosis.
[0657] In another specific embodiment, G-protein Chemokine Receptor
(CCR5) polynucleotides and/or polypeptides of the invention, and/or
agonists or antagonists thereof are used as a inhibitor of B and/or
T cell migration in endothelial cells. This activity disrupts
tissue architecture or cognate responses and is useful, for example
in disrupting immune responses, and blocking sepsis.
[0658] In another specific embodiment, G-protein Chemokine Receptor
(CCR5) polynucleotides and/or polypeptides of the invention, and/or
agonists or antagonists thereof are used as a therapy for chronic
hypergammaglobulinemia evident in such diseases as monoclonal
gammopathy of undetermined significance (MGUS), Waldenstrom's
disease, related idiopathic monoclonal gammopathies, and
plasmacytomas.
[0659] In another specific embodiment, G-protein Chemokine Receptor
(CCR5) polynucleotides and/or polypeptides of the invention, and/or
agonists or antagonists thereof may be employed for instance to
inhibit polypeptide chemotaxis and activation of macrophages and
their precursors, and of neutrophils, basophils, B lymphocytes and
some T-cell subsets, e.g., activated and CD8 cytotoxic T cells and
natural killer cells, in certain autoimmune and chronic
inflammatory and infective diseases. Examples of autoimmune
diseases are described herein and include multiple sclerosis, and
insulin-dependent diabetes.
[0660] The G-protein Chemokine Receptor (CCR5) polynucleotides
and/or polypeptides of the invention, and/or agonists or
antagonists thereof may also be employed to treat idiopathic
hyper-eosinophilic syndrome by, for example, preventing eosinophil
production and migration.
[0661] In another specific embodiment, G-protein Chemokine Receptor
(CCR5) polynucleotides and/or polypeptides of the invention, and/or
agonists or antagonists thereof are used to enhance or inhibit
complement mediated cell lysis.
[0662] In another specific embodiment, G-protein Chemokine Receptor
(CCR5) polynucleotides and/or polypeptides of the invention, and/or
agonists or antagonists thereof are used to enhance or inhibit
antibody dependent cellular cytotoxicity.
[0663] In another specific embodiment, G-protein Chemokine Receptor
(CCR5) polynucleotides and/or polypeptides of the invention, and/or
agonists or antagonists thereof may also be employed for treating
atherosclerosis, for example, by preventing monocyte infiltration
in the artery wall.
[0664] In another specific embodiment, G-protein Chemokine Receptor
(CCR5) polynucleotides and/or polypeptides of the invention, and/or
agonists or antagonists thereof may be employed to treat adult
respiratory distress syndrome (ARDS).
[0665] In another specific embodiment, G-protein Chemokine Receptor
(CCR5) polynucleotides and/or polypeptides of the invention, and/or
agonists or antagonists thereof may be useful for stimulating wound
and tissue repair, stimulating angiogenesis, and/or stimulating the
repair of vascular or lymphatic diseases or disorders.
Additionally, agonists and antagonists of the invention may be used
to stimulate the regeneration of mucosal surfaces.
[0666] In a specific embodiment, polynucleotides or polypeptides,
and/or agonists thereof are used to diagnose, prognose, treat,
and/or prevent a disorder characterized by primary or acquired
immunodeficiency, deficient serum immunoglobulin production,
recurrent infections, and/or immune system dysfunction. Moreover,
polynucleotides or polypeptides, and/or agonists thereof may be
used to treat or prevent infections of the joints, bones, skin,
and/or parotid glands, blood-borne infections (e.g., sepsis,
meningitis, septic arthritis, and/or osteomyelitis), autoimmune
diseases (e.g., those disclosed herein), inflammatory disorders,
and malignancies, and/or any disease or disorder or condition
associated with these infections, diseases, disorders and/or
malignancies) including, but not limited to, CVID, other primary
immune deficiencies, HIV disease, CLL, recurrent bronchitis,
sinusitis, otitis media, conjunctivitis, pneumonia, hepatitis,
meningitis, herpes zoster (e.g., severe herpes zoster), and/or
pneumocystis carnii. Other diseases and disorders that may be
prevented, diagnosed, prognosed, and/or treated with
polynucleotides or polypeptides, and/or agonists of the present
invention include, but are not limited to, HIV infection, HTLV-BLV
infection, lymphopenia, phagocyte bactericidal dysfunction anemia,
thrombocytopenia, and hemoglobinuria.
[0667] In another embodiment, G-protein Chemokine Receptor (CCR5)
polynucleotides and/or polypeptides of the invention, and/or
agonists or antagonists thereof are used to treat, and/or diagnose
an individual having common variable immunodeficiency disease
("CVID"; also known as "acquired agammaglobulinemia" and "acquired
hypogammaglobulinemia") or a subset of this disease.
[0668] In a specific embodiment, G-protein Chemokine Receptor
(CCR5) polynucleotides and/or polypeptides of the invention, and/or
agonists or antagonists thereof may be used to diagnose, prognose,
prevent, and/or treat cancers or neoplasms including immune cell or
immune tissue-related cancers or neoplasms. Examples of cancers or
neoplasms that may be prevented, diagnosed, or treated by G-protein
Chemokine Receptor (CCR5) polynucleotides and/or polypeptides of
the invention, and/or agonists or antagonists thereof include, but
are not limited to, acute myelogenous leukemia, chronic myelogenous
leukemia, Hodgkin's disease, non-Hodgkin's lymphoma, acute
lymphocytic anemia (ALL) Chronic lymphocyte leukemia,
plasmacytomas, multiple myeloma, Burkitt's lymphoma,
EBV-transformed diseases, and/or diseases and disorders described
in the section entitled "Hyperproliferative Disorders" elsewhere
herein.
[0669] In another specific embodiment, G-protein Chemokine Receptor
(CCR5) polynucleotides and/or polypeptides of the invention, and/or
agonists or antagonists thereof are used as a therapy for
decreasing cellular proliferation of Large B-cell Lymphomas.
[0670] In another specific embodiment, G-protein Chemokine Receptor
(CCR5) polynucleotides and/or polypeptides of the invention, and/or
agonists or antagonists thereof are used as a means of decreasing
the involvement of B cells and Ig associated with Chronic
Myelogenous Leukemia.
[0671] In specific embodiments, the compositions of the invention
are used as an agent to boost immunoresponsiveness among B cell
immunodeficient individuals, such as, for example, an individual
who has undergone a partial or complete splenectomy.
[0672] Antagonists of the invention include, for example, binding
and/or inhibitory antibodies, antisense nucleic acids, ribozymes or
soluble forms of the polypeptides of the present invention (e.g.,
Fc fusion protein). Agonists of the invention include, for example,
binding or stimulatory antibodies, and soluble forms of the
polypeptides (e.g., Fc fusion proteins). G-protein Chemokine
Receptor (CCR5) polynucleotides and/or polypeptides of the
invention, and/or agonists or antagonists thereof may be employed
in a composition with a pharmaceutically acceptable carrier, e.g.,
as described herein.
[0673] In another embodiment, G-protein Chemokine Receptor (CCR5)
polynucleotides and/or polypeptides of the invention, and/or
agonists or antagonists thereof are administered to an animal
(including, but not limited to, those listed above, and also
including transgenic animals) incapable of producing functional
endogenous antibody molecules or having an otherwise compromised
endogenous immune system, but which is capable of producing human
immunoglobulin molecules by means of a reconstituted or partially
reconstituted immune system from another animal (see, e.g.,
published PCT Application Nos. WO98/24893, WO/9634096, WO/9633735,
and WO/9110741). Administration of G-protein Chemokine Receptor
(CCR5) polynucleotides and/or polypeptides of the invention, and/or
agonists or antagonists thereof to such animals is useful for the
generation of monoclonal antibodies against the G-protein Chemokine
Receptor (CCR5) polynucleotides and/or polypeptides of the
invention, and/or agonists or antagonists thereof.
[0674] Chemotaxis. G-protein Chemokine Receptor (CCR5)
polynucleotides or polypeptides, or agonists or antagonists of
G-protein Chemokine Receptor (CCR5), may have chemotaxis activity.
A chemotaxic molecule attracts or mobilizes cells (e.g., monocytes,
fibroblasts, neutrophils, T-cells, mast cells, eosinophils,
epithelial and/or endothelial cells) to a particular site in the
body, such as inflammation, infection, or site of
hyperproliferation. The mobilized cells can then fight off and/or
heal the particular trauma or abnormality.
[0675] G-protein Chemokine Receptor (CCR5) polynucleotides or
polypeptides, or agonists or antagonists of G-protein Chemokine
Receptor (CCR5), may increase chemotaxic activity of particular
cells. These chemotactic molecules can then be used to treat,
prevent, and/or diagnose inflammation, infection,
hyperproliferative diseases, disorders, and/or conditions, or any
immune system disorder by increasing the number of cells targeted
to a particular location in the body. For example, chemotaxic
molecules can be used to treat, prevent, and/or diagnose wounds and
other trauma to tissues by attracting immune cells to the injured
location. Chemotactic molecules of the present invention can also
attract fibroblasts, which can be used to treat, prevent, and/or
diagnose wounds.
[0676] It is also contemplated that G-protein Chemokine Receptor
(CCR5) polynucleotides or polypeptides, or agonists or antagonists
of G-protein Chemokine Receptor (CCR5), may inhibit chemotactic
activity. These molecules could also be used to treat, prevent,
and/or diagnose diseases, disorders, and/or conditions. Thus,
G-protein Chemokine Receptor (CCR5) polynucleotides or
polypeptides, or agonists or antagonists of G-protein Chemokine
Receptor (CCR5), could be used as an inhibitor of chemotaxis.
[0677] Infectious Disease. G-protein Chemokine Receptor (CCR5)
polynucleotides or polypeptides, or agonists or antagonists of
G-protein Chemokine Receptor (CCR5), can be used to treat, prevent,
and/or diagnose infectious agents. For example, by increasing the
immune response, particularly increasing the proliferation and
differentiation of B and/or T cells, infectious diseases may be
treated, prevented, and/or diagnosed. The immune response may be
increased by either enhancing an existing immune response, or by
initiating a new immune response. Alternatively, G-protein
Chemokine Receptor (CCR5) polynucleotides or polypeptides, or
agonists or antagonists of G-protein Chemokine Receptor (CCR5), may
also directly inhibit the infectious agent, without necessarily
eliciting an immune response.
[0678] Viruses are one example of an infectious agent that can
cause disease or symptoms that can be treated, prevented, and/or
diagnosed by a polynucleotide or polypeptide and/or agonist or
antagonist of the present invention. Examples of viruses, include,
but are not limited to the following DNA and RNA viruses and viral
families: Arbovirus, Adenoviridae, Arenaviridae, Arterivirus,
Birnaviridae, Bunyaviridae, Caliciviridae, Circoviridae,
Coronaviridae, Dengue, EBV, HIV, Flaviviridae, Hepadnaviridae
(Hepatitis), Herpesviridae (such as, Cytomegalovirus, Herpes
Simplex, Herpes Zoster), Mononegavirus (e.g., Paramyxoviridae,
Morbillivirus, Rhabdoviridae), Orthomyxoviridae (e.g., Influenza A,
Influenza B, and parainfluenza), Papiloma virus, Papovaviridae,
Parvoviridae, Picornaviridae, Poxyiridae (such as Smallpox or
Vaccinia), Reoviridae (e.g., Rotavirus), Retroviridae (HTLV-I,
HTLV-II, Lentivirus), and Togaviridae (e.g., Rubivirus). Viruses
falling within these families can cause a variety of diseases or
symptoms, including, but not limited to: arthritis, bronchiollitis,
respiratory syncytial virus, encephalitis, eye infections (e.g.,
conjunctivitis, keratitis), chronic fatigue syndrome, hepatitis (A,
B, C, E, Chronic Active, Delta), Japanese B encephalitis, Junin,
Chikungunya, Rift Valley fever, yellow fever, meningitis,
opportunistic infections (e.g., AIDS), pneumonia, Burkitt's
Lymphoma, chickenpox, hemorrhagic fever, Measles, Mumps,
Parainfluenza, Rabies, the common cold, Polio, leukemia, Rubella,
sexually transmitted diseases, skin diseases (e.g., Kaposi's,
warts), and viremia. Polynucleotides or polypeptides, or agonists
or antagonists of the invention, can be used to treat, prevent,
and/or diagnose any of these symptoms or diseases. In specific
embodiments, polynucleotides, polypeptides, or agonists or
antagonists of the invention are used to treat: meningitis, Dengue,
EBV, and/or hepatitis (e.g., hepatitis B). In an additional
specific embodiment polynucleotides, polypeptides, or agonists or
antagonists of the invention are used to treat patients
nonresponsive to one or more other commercially available hepatitis
vaccines. In a further specific embodiment polynucleotides,
polypeptides, or agonists or antagonists of the invention are used
to treat, prevent, and/or diagnose AIDS.
[0679] In highly preferred embodiments, G-protein Chemokine
Receptor (CCR5) polynucleotides and/or polypeptides of the present
invention and/or agonists or antagonists thereof, are used to
diagnose, treat, prevent or ameliorate HIV infection.
[0680] In other highly preferred embodiments, G-protein Chemokine
Receptor (CCR5) polynucleotides and/or polypeptides of the present
invention and/or agonists or antagonists thereof, are used to
diagnose, treat, prevent or ameliorate Cytomegalovirus
infections.
[0681] In other highly preferred embodiments, G-protein Chemokine
Receptor (CCR5) polynucleotides and/or polypeptides of the present
invention and/or agonists or antagonists thereof, are used to
diagnose, treat, prevent or ameliorate Poxyiridae infections.
[0682] Similarly, bacterial or fungal agents that can cause disease
or symptoms and that can be treated, prevented, and/or diagnosed by
a polynucleotide or polypeptide and/or agonist or antagonist of the
present invention include, but not limited to, include, but not
limited to, the following Gram-Negative and Gram-positive bacteria
and bacterial families and fungi: Actinomycetales (e.g.,
Corynebacterium, Mycobacterium, Norcardia), Cryptococcus
neoformans, Aspergillosis, Bacillaceae (e.g., Anthrax,
Clostridium), Bacteroidaceae, Blastomycosis, Bordetella, Borrelia
(e.g., Borrelia burgdorferi), Brucellosis, Candidiasis,
Campylobacter, Coccidioidomycosis, Cryptococcosis, Dermatocycoses,
E. coli (e.g., Enterotoxigenic E. coli and Enterohemorrhagic E.
coli), Enterobacteriaceae (Klebsiella, Salmonella (e.g., Salmonella
typhi, and Salmonella paratyphi), Serratia, Yersinia),
Erysipelothrix, Helicobacter, Legionellosis, Leptospirosis,
Listeria, Mycoplasmatales, Mycobacterium leprae, Vibrio cholerae,
Neisseriaceae (e.g., Acinetobacter, Gonorrhea, Menigococcal),
Meisseria meningitidis, Pasteurellacea Infections (e.g.,
Actinobacillus, Heamophilus (e.g., Heamophilus influenza type B),
Pasteurella), Pseudomonas, Rickettsiaceae, Chlamydiaceae, Syphilis,
Shigella spp., Staphylococcal, Meningiococcal, Pneumococcal and
Streptococcal (e.g., Streptococcus pneumoniae and Group B
Streptococcus). These bacterial or fungal families can cause the
following diseases or symptoms, including, but not limited to:
bacteremia, endocarditis, eye infections (conjunctivitis,
tuberculosis, uveitis), gingivitis, opportunistic infections (e.g.,
AIDS related infections), paronychia, prosthesis-related
infections, Reiter's Disease, respiratory tract infections, such as
Whooping Cough or Empyema, sepsis, Lyme Disease, Cat-Scratch
Disease, Dysentery, Paratyphoid Fever, food poisoning, Typhoid,
pneumonia, Gonorrhea, meningitis (e.g., meningitis types A and B),
Chlamydia, Syphilis, Diphtheria, Leprosy, Paratuberculosis,
Tuberculosis, Lupus, Botulism, gangrene, tetanus, impetigo,
Rheumatic Fever, Scarlet Fever, sexually transmitted diseases, skin
diseases (e.g., cellulitis, dermatocycoses), toxemia, urinary tract
infections, wound infections. Polynucleotides or polypeptides,
agonists or antagonists of the invention, can be used to treat,
prevent, and/or diagnose any of these symptoms or diseases. In
specific embodiments, polynucleotides, polypeptides, agonists or
antagonists of the invention are used to treat: tetanus, Diptheria,
botulism, and/or meningitis type B.
[0683] Moreover, parasitic agents causing disease or symptoms that
can be treated, prevented, and/or diagnosed by a polynucleotide or
polypeptide and/or agonist or antagonist of the present invention
include, but not limited to, the following families or class:
Amebiasis, Babesiosis, Coccidiosis, Cryptosporidiosis,
Dientamoebiasis, Dourine, Ectoparasitic, Giardiasis, Helminthiasis,
Leishmaniasis, Theileriasis, Toxoplasmosis, Trypanosomiasis, and
Trichomonas and Sporozoans (e.g., Plasmodium virax, Plasmodium
falciparium, Plasmodium malariae and Plasmodium ovale). These
parasites can cause a variety of diseases or symptoms, including,
but not limited to: Scabies, Trombiculiasis, eye infections,
intestinal disease (e.g., dysentery, giardiasis), liver disease,
lung disease, opportunistic infections (e.g., AIDS related),
malaria, pregnancy complications, and toxoplasmosis.
polynucleotides or polypeptides, or agonists or antagonists of the
invention, can be used to treat, prevent, and/or diagnose any of
these symptoms or diseases. In specific embodiments,
polynucleotides, polypeptides, or agonists or antagonists of the
invention are used to treat, prevent, and/or diagnose malaria.
[0684] Preferably, treatment or prevention using a polypeptide or
polynucleotide and/or agonist or antagonist of the present
invention could either be by administering an effective amount of a
polypeptide to the patient, or by removing cells from the patient,
supplying the cells with a polynucleotide of the present invention,
and returning the engineered cells to the patient (ex vivo
therapy). Moreover, the polypeptide or polynucleotide of the
present invention can be used as an antigen in a vaccine to raise
an immune response against infectious disease.
[0685] Neurological Diseases. Nervous system diseases, disorders,
and/or conditions, which can be treated with the G-protein
Chemokine Receptor (CCR5) compositions of the invention (e.g.,
G-protein Chemokine Receptor (CCR5) polypeptides, polynucleotides,
and/or agonists or antagonists), include, but are not limited to,
nervous system injuries, and diseases, disorders, and/or conditions
which result in either a disconnection of axons, a diminution or
degeneration of neurons, or demyelination. Nervous system lesions
which may be treated in a patient (including human and non-human
mammalian patients) according to the invention, include but are not
limited to, the following lesions of either the central (including
spinal cord, brain) or peripheral nervous systems: (1) ischemic
lesions, in which a lack of oxygen in a portion of the nervous
system results in neuronal injury or death, including cerebral
infarction or ischemia, or spinal cord infarction or ischemia; (2)
traumatic lesions, including lesions caused by physical injury or
associated with surgery, for example, lesions which sever a portion
of the nervous system, or compression injuries; (3) malignant
lesions, in which a portion of the nervous system is destroyed or
injured by malignant tissue which is either a nervous system
associated malignancy or a malignancy derived from non-nervous
system tissue; (4) infectious lesions, in which a portion of the
nervous system is destroyed or injured as a result of infection,
for example, by an abscess or associated with infection by human
immunodeficiency virus, herpes zoster, or herpes simplex virus or
with Lyme disease, tuberculosis, syphilis; (5) degenerative
lesions, in which a portion of the nervous system is destroyed or
injured as a result of a degenerative process including but not
limited to degeneration associated with Parkinson's disease,
Alzheimer's disease, Huntington's chorea, or amyotrophic lateral
sclerosis (ALS); (6) lesions associated with nutritional diseases,
disorders, and/or conditions, in which a portion of the nervous
system is destroyed or injured by a nutritional disorder or
disorder of metabolism including but not limited to, vitamin B12
deficiency, folic acid deficiency, Wernicke disease,
tobacco-alcohol amblyopia, Marchiafava-Bignami disease (primary
degeneration of the corpus callosum), and alcoholic cerebellar
degeneration; (7) neurological lesions associated with systemic
diseases including, but not limited to, diabetes (diabetic
neuropathy, Bell's palsy), systemic lupus erythematosus, carcinoma,
or sarcoidosis; (8) lesions caused by toxic substances including
alcohol, lead, or particular neurotoxins; and (9) demyelinated
lesions in which a portion of the nervous system is destroyed or
injured by a demyelinating disease including, but not limited to,
multiple sclerosis, human immunodeficiency virus-associated
myelopathy, transverse myelopathy or various etiologies,
progressive multifocal leukoencephalopathy, and central pontine
myelinolysis.
[0686] In a preferred embodiment, the G-protein Chemokine Receptor
(CCR5) polypeptides, polynucleotides, or agonists or antagonists of
the invention are used to protect neural cells from the damaging
effects of cerebral hypoxia. According to this embodiment, the
G-protein Chemokine Receptor (CCR5) compositions of the invention
are used to treat, prevent, and/or diagnose neural cell injury
associated with cerebral hypoxia. In one aspect of this embodiment,
the G-protein Chemokine Receptor (CCR5) polypeptides,
polynucleotides, or agonists or antagonists of the invention are
used to treat, prevent, and/or diagnose neural cell injury
associated with cerebral ischemia. In another aspect of this
embodiment, the G-protein Chemokine Receptor (CCR5) polypeptides,
polynucleotides, or agonists or antagonists of the invention are
used to treat, prevent, and/or diagnose neural cell injury
associated with cerebral infarction.
[0687] In another aspect of this embodiment, the G-protein
Chemokine Receptor (CCR5) polypeptides, polynucleotides, or
agonists or antagonists of the invention are used to treat,
prevent, and/or diagnose neural cell injury associated with a
stroke. In another aspect of this embodiment, the G-protein
Chemokine Receptor (CCR5) polypeptides, polynucleotides, or
agonists or antagonists of the invention are used to treat,
prevent, and/or diagnose cerebral neural cell injury associated
with a stroke.
[0688] In a further aspect of this embodiment, the G-protein
Chemokine Receptor (CCR5) polypeptides, polynucleotides, or
agonists or antagonists of the invention are used to treat,
prevent, and/or diagnose neural cell injury associated with a heart
attack.
[0689] In another aspect of this embodiment, the G-protein
Chemokine Receptor (CCR5) polypeptides, polynucleotides, or
agonists or antagonists of the invention are used to treat,
prevent, and/or diagnose cerebral neural cell injury associated
with a heart attack.
[0690] The compositions of the invention which are useful for
treating, preventing, and/or diagnosing a nervous system disorder
may be selected by testing for biological activity in promoting the
survival or differentiation of neurons. For example, and not by way
of limitation, G-protein Chemokine Receptor (CCR5) compositions of
the invention which elicit any of the following effects may be
useful according to the invention: (1) increased survival time of
neurons in culture; (2) increased sprouting of neurons in culture
or in vivo; (3) increased production of a neuron-associated
molecule in culture or in vivo, e.g., choline acetyltransferase or
acetylcholinesterase with respect to motor neurons; or (4)
decreased symptoms of neuron dysfunction in vivo. Such effects may
be measured by any method known in the art. In preferred,
non-limiting embodiments, increased survival of neurons may
routinely be measured using a method set forth herein or otherwise
known in the art, such as, for example, the method set forth in
Arakawa et al. (J. Neurosci. 10:3507-3515 (1990)); increased
sprouting of neurons may be detected by methods known in the art,
such as, for example, the methods set forth in Pestronk et al.
(Exp. Neurol. 70:65-82 (1980)) or Brown et al. (Ann. Rev. Neurosci.
4:17-42 (1981)); increased production of neuron-associated
molecules may be measured by bioassay, enzymatic assay, antibody
binding, Northern blot assay, etc., using techniques known in the
art and depending on the molecule to be measured; and motor neuron
dysfunction may be measured by assessing the physical manifestation
of motor neuron disorder, e.g., weakness, motor neuron conduction
velocity, or functional disability.
[0691] In specific embodiments, motor neuron diseases, disorders,
and/or conditions that may be treated according to the invention
include, but are not limited to, diseases, disorders, and/or
conditions such as infarction, infection, exposure to toxin,
trauma, surgical damage, degenerative disease or malignancy that
may affect motor neurons as well as other components of the nervous
system, as well as diseases, disorders, and/or conditions that
selectively affect neurons such as amyotrophic lateral sclerosis,
and including, but not limited to, progressive spinal muscular
atrophy, progressive bulbar palsy, primary lateral sclerosis,
infantile and juvenile muscular atrophy, progressive bulbar
paralysis of childhood (Fazio-Londe syndrome), poliomyelitis and
the post polio syndrome, and Hereditary Motorsensory Neuropathy
(Charcot-Marie-Tooth Disease).
[0692] Further, G-protein Chemokine Receptor (CCR5) polypeptides or
polynucleotides of the invention may play a role in neuronal
survival; synapse formation; conductance; neural differentiation,
etc. Thus, compositions of the invention (including G-protein
Chemokine Receptor (CCR5) polynucleotides and/or polypeptides,
and/or agonists or antagonists thereof) may be used to diagnose
and/or treat or prevent diseases or disorders associated with these
roles, including, but not limited to, learning and/or cognition
disorders. The compositions of the invention may also be useful in
the treatment or prevention of neurodegenerative disease states
and/or behavioral disorders. Such neurodegenerative disease states
and/or behavioral disorders include, but are not limited to,
Alzheimer's Disease, Parkinson's Disease, Huntington's Disease,
Tourette Syndrome, schizophrenia, mania, dementia, paranoia,
obsessive compulsive disorder, panic disorder, learning
disabilities, ALS, psychoses, autism, and altered behaviors,
including disorders in feeding, sleep patterns, balance, and
perception. In addition, compositions of the invention may also
play a role in the treatment, prevention and/or detection of
developmental disorders associated with the developing embryo, or
sexually-linked disorders.
[0693] Additionally, G-protein Chemokine Receptor (CCR5)
polynucleotides and/or polypeptides, and/or agonists or antagonists
thereof, may be useful in protecting neural cells from diseases,
damage, disorders, or injury, associated with cerebrovascular
disorders including, but not limited to, carotid artery diseases
(e.g., carotid artery thrombosis, carotid stenosis, or Moyamoya
Disease), cerebral amyloid angiopathy, cerebral aneurysm, cerebral
anoxia, cerebral arteriosclerosis, cerebral arteriovenous
malformations, cerebral artery diseases, cerebral embolism and
thrombosis (e.g., carotid artery thrombosis, sinus thrombosis, or
Wallenberg's Syndrome), cerebral hemorrhage (e.g., epidural or
subdural hematoma, or subarachnoid hemorrhage), cerebral
infarction, cerebral ischemia (e.g., transient cerebral ischemia,
Subclavian Steal Syndrome, or vertebrobasilar insufficiency),
vascular dementia (e.g., multi-infarct), leukomalacia,
periventricular, and vascular headache (e.g., cluster headache or
migraines).
[0694] In accordance with yet a further aspect of the present
invention, there is provided a process for utilizing G-protein
Chemokine Receptor (CCR5) polynucleotides and/or polypeptides,
and/or agonists or antagonists thereof, for therapeutic purposes,
for example, to stimulate neurological cell proliferation and/or
differentiation. Therefore, polynucleotides, polypeptides, agonists
and/or antagonists of the invention may be used to treat and/or
detect neurologic diseases. Moreover G-protein Chemokine Receptor
(CCR5) polynucleotides and/or polypeptides, and/or agonists or
antagonists thereof, can be used as a marker or detector of a
particular nervous system disease or disorder.
[0695] Examples of neurologic diseases which can be treated or
detected with the G-protein Chemokine Receptor (CCR5)
polynucleotides and/or polypeptides of the present invention,
and/or agonists or antagonists thereof, include brain diseases,
such as metabolic brain diseases which includes phenylketonuria
such as maternal phenylketonuria, pyruvate carboxylase deficiency,
pyruvate dehydrogenase complex deficiency, Wernicke's
Encephalopathy, brain edema, brain neoplasms such as cerebellar
neoplasms which include infratentorial neoplasms, cerebral
ventricle neoplasms such as choroid plexus neoplasms, hypothalamic
neoplasms, supratentorial neoplasms, canavan disease, cerebellar
diseases such as cerebellar ataxia which include spinocerebellar
degeneration such as ataxia telangiectasia, cerebellar dyssynergia,
Friederich's Ataxia, Machado-Joseph Disease, olivopontocerebellar
atrophy, cerebellar neoplasms such as infratentorial neoplasms,
diffuse cerebral sclerosis such as encephalitis periaxialis,
globoid cell leukodystrophy, metachromatic leukodystrophy and
subacute sclerosing panencephalitis.
[0696] Additional neurologic diseases which can be treated or
detected with the G-protein Chemokine Receptor (CCR5)
polynucleotides and/or polypeptides of the present invention,
and/or agonists or antagonists thereof, include cerebrovascular
disorders (such as carotid artery diseases which include carotid
artery thrombosis, carotid stenosis and Moyamoya Disease), cerebral
amyloid angiopathy, cerebral aneurysm, cerebral anoxia, cerebral
arteriosclerosis, cerebral arteriovenous malformations, cerebral
artery diseases, cerebral embolism and thrombosis such as carotid
artery thrombosis, sinus thrombosis and Wallenberg's Syndrome,
cerebral hemorrhage such as epidural hematoma, subdural hematoma
and subarachnoid hemorrhage, cerebral infarction, cerebral ischemia
such as transient cerebral ischemia, Subclavian Steal Syndrome and
vertebrobasilar insufficiency, vascular dementia such as
multi-infarct dementia, periventricular leukomalacia, vascular
headache such as cluster headache and migraine.
[0697] Additional neurologic diseases which can be treated or
detected with the G-protein Chemokine Receptor (CCR5)
polynucleotides and/or polypeptides of the present invention,
and/or agonists or antagonists thereof, include dementia such as
AIDS Dementia Complex, presenile dementia such as Alzheimer's
Disease and Creutzfeldt-Jakob Syndrome, senile dementia such as
Alzheimer's Disease and progressive supranuclear palsy, vascular
dementia such as multi-infarct dementia, encephalitis which include
encephalitis periaxialis, viral encephalitis such as epidemic
encephalitis, Japanese Encephalitis, St. Louis Encephalitis,
tick-borne encephalitis and West Nile Fever, acute disseminated
encephalomyelitis, meningoencephalitis such as
uveomeningoencephalitic syndrome, Postencephalitic Parkinson
Disease and subacute sclerosing panencephalitis, encephalomalacia
such as periventricular leukomalacia, epilepsy such as generalized
epilepsy which includes infantile spasms, absence epilepsy,
myoclonic epilepsy which includes MERRF Syndrome, tonic-clonic
epilepsy, partial epilepsy such as complex partial epilepsy,
frontal lobe epilepsy and temporal lobe epilepsy, post-traumatic
epilepsy, status epilepticus such as Epilepsia Partialis Continua,
and Hallervorden-Spatz Syndrome.
[0698] Additional neurologic diseases which can be treated or
detected with the G-protein Chemokine Receptor (CCR5)
polynucleotides and/or polypeptides of the present invention,
and/or agonists or antagonists thereof, include hydrocephalus such
as Dandy-Walker Syndrome and normal pressure hydrocephalus,
hypothalamic diseases such as hypothalamic neoplasms, cerebral
malaria, narcolepsy which includes cataplexy, bulbar poliomyelitis,
cerebri pseudotumor, Rett Syndrome, Reye's Syndrome, thalamic
diseases, cerebral toxoplasmosis, intracranial tuberculoma and
Zellweger Syndrome, central nervous system infections such as AIDS
Dementia Complex, Brain Abscess, subdural empyema,
encephalomyelitis such as Equine Encephalomyelitis, Venezuelan
Equine Encephalomyelitis, Necrotizing Hemorrhagic
Encephalomyelitis, Visna, and cerebral malaria.
[0699] Additional neurologic diseases which can be treated or
detected with the G-protein Chemokine Receptor (CCR5)
polynucleotides and/or polypeptides of the present invention,
and/or agonists or antagonists thereof, include meningitis such as
arachnoiditis, aseptic meningtitis such as viral meningtitis which
includes lymphocytic choriomeningitis, Bacterial meningtitis which
includes Haemophilus Meningtitis, Listeria Meningtitis,
Meningococcal Meningtitis such as Waterhouse-Friderichsen Syndrome,
Pneumococcal Meningtitis and meningeal tuberculosis, fungal
meningitis such as Cryptococcal Meningtitis, subdural effusion,
meningoencephalitis such as uvemeningoencephalitic syndrome,
myelitis such as transverse myelitis, neurosyphilis such as tabes
dorsalis, poliomyelitis which includes bulbar poliomyelitis and
postpoliomyelitis syndrome, prion diseases (such as
Creutzfeldt-Jakob Syndrome, Bovine Spongiform Encephalopathy,
Gerstmann-Straussler Syndrome, Kuru, Scrapie), and cerebral
toxoplasmosis.
[0700] Additional neurologic diseases which can be treated or
detected with the G-protein Chemokine Receptor (CCR5)
polynucleotides and/or polypeptides of the present invention,
and/or agonists or antagonists thereof, include central nervous
system neoplasms such as brain neoplasms that include cerebellar
neoplasms such as infratentorial neoplasms, cerebral ventricle
neoplasms such as choroid plexus neoplasms, hypothalamic neoplasms
and supratentorial neoplasms, meningeal neoplasms, spinal cord
neoplasms which include epidural neoplasms, demyelinating diseases
such as Canavan Diseases, diffuse cerebral sceloris which includes
adrenoleukodystrophy, encephalitis periaxialis, globoid cell
leukodystrophy, diffuse cerebral sclerosis such as metachromatic
leukodystrophy, allergic encephalomyelitis, necrotizing hemorrhagic
encephalomyelitis, progressive multifocal leukoencephalopathy,
multiple sclerosis, central pontine myelinolysis, transverse
myelitis, neuromyelitis optica, Scrapie, Swayback, Chronic Fatigue
Syndrome, Visna, High Pressure Nervous Syndrome, Meningism, spinal
cord diseases such as amyotonia congenita, amyotrophic lateral
sclerosis, spinal muscular atrophy such as Werdnig-Hoffmann
Disease, spinal cord compression, spinal cord neoplasms such as
epidural neoplasms, syringomyelia, Tabes Dorsalis, Stiff-Man
Syndrome, mental retardation such as Angelman Syndrome, Cri-du-Chat
Syndrome, De Lange's Syndrome, Down Syndrome, Gangliosidoses such
as gangliosidoses G(M1), Sandhoff Disease, Tay-Sachs Disease,
Hartnup Disease, homocystinuria, Laurence-Moon-Biedl Syndrome,
Lesch-Nyhan Syndrome, Maple Syrup Urine Disease, mucolipidosis such
as fucosidosis, neuronal ceroid-lipofuscinosis, oculocerebrorenal
syndrome, phenylketonuria such as maternal phenylketonuria,
Prader-Willi Syndrome, Rett Syndrome, Rubinstein-Taybi Syndrome,
Tuberous Sclerosis, WAGR Syndrome, nervous system abnormalities
such as holoprosencephaly, neural tube defects such as anencephaly
which includes hydrangencephaly, Arnold-Chairi Deformity,
encephalocele, meningocele, meningomyelocele, spinal dysraphism
such as spina bifida cystica and spina bifida occulta.
[0701] Additional neurologic diseases which can be treated or
detected with the G-protein Chemokine Receptor (CCR5)
polynucleotides and/or polypeptides of the present invention,
and/or agonists or antagonists thereof, include hereditary motor
and sensory neuropathies which include Charcot-Marie Disease,
Hereditary optic atrophy, Refsum's Disease, hereditary spastic
paraplegia, Werdnig-Hoffmann Disease, Hereditary Sensory and
Autonomic Neuropathies such as Congenital Analgesia and Familial
Dysautonomia, Neurologic manifestations (such as agnosia that
include Gerstmann's Syndrome, Amnesia such as retrograde amnesia,
apraxia, neurogenic bladder, cataplexy, communicative disorders
such as hearing disorders that includes deafness, partial hearing
loss, loudness recruitment and tinnitus, language disorders such as
aphasia which include agraphia, anomia, broca aphasia, and Wernicke
Aphasia, Dyslexia such as Acquired Dyslexia, language development
disorders, speech disorders such as aphasia which includes anomia,
broca aphasia and Wernicke Aphasia, articulation disorders,
communicative disorders such as speech disorders which include
dysarthria, echolalia, mutism and stuttering, voice disorders such
as aphonia and hoarseness, decerebrate state, delirium,
fasciculation, hallucinations, meningism, movement disorders such
as angelman syndrome, ataxia, athetosis, chorea, dystonia,
hypokinesia, muscle hypotonia, myoclonus, tic, torticollis and
tremor, muscle hypertonia such as muscle rigidity such as stiff-man
syndrome, muscle spasticity, paralysis such as facial paralysis
which includes Herpes Zoster Oticus, Gastroparesis, Hemiplegia,
ophthalmoplegia such as diplopia, Duane's Syndrome, Horner's
Syndrome, Chronic progressive external ophthalmoplegia such as
Kearns Syndrome, Bulbar Paralysis, Tropical Spastic Paraparesis,
Paraplegia such as Brown-Sequard Syndrome, quadriplegia,
respiratory paralysis and vocal cord paralysis, paresis, phantom
limb, taste disorders such as ageusia and dysgeusia, vision
disorders such as amblyopia, blindness, color vision defects,
diplopia, hemianopsia, scotoma and subnormal vision, sleep
disorders such as hypersomnia which includes Kleine-Levin Syndrome,
insomnia, and somnambulism, spasm such as trismus, unconsciousness
such as coma, persistent vegetative state and syncope and vertigo,
neuromuscular diseases such as amyotonia congenita, amyotrophic
lateral sclerosis, Lambert-Eaton Myasthenic Syndrome, motor neuron
disease, muscular atrophy such as spinal muscular atrophy,
Charcot-Marie Disease and Werdnig-Hoffmann Disease,
Postpoliomyelitis Syndrome, Muscular Dystrophy, Myasthenia Gravis,
Myotonia Atrophica, Myotonia Confenita, Nemaline Myopathy, Familial
Periodic Paralysis, Multiplex Paramyloclonus, Tropical Spastic
Paraparesis and Stiff-Man Syndrome, peripheral nervous system
diseases such as acrodynia, amyloid neuropathies, autonomic nervous
system diseases such as Adie's Syndrome, Barre-Lieou Syndrome,
Familial Dysautonomia, Horner's Syndrome, Reflex Sympathetic
Dystrophy and Shy-Drager Syndrome, Cranial Nerve Diseases such as
Acoustic Nerve Diseases such as Acoustic Neuroma which includes
Neurofibromatosis 2, Facial Nerve Diseases such as Facial
Neuralgia, Melkersson-Rosenthal Syndrome, ocular motility disorders
which includes amblyopia, nystagmus, oculomotor nerve paralysis,
ophthalmoplegia such as Duane's Syndrome, Horner's Syndrome,
Chronic Progressive External Ophthalmoplegia which includes Kearns
Syndrome, Strabismus such as Esotropia and Exotropia, Oculomotor
Nerve Paralysis, Optic Nerve Diseases such as Optic Atrophy which
includes Hereditary Optic Atrophy, Optic Disk Drusen, Optic
Neuritis such as Neuromyelitis Optica, Papilledema, Trigeminal
Neuralgia, Vocal Cord Paralysis, Demyelinating Diseases such as
Neuromyelitis Optica and Swayback, and Diabetic neuropathies such
as diabetic foot.
[0702] Additional neurologic diseases which can be treated or
detected with the G-protein Chemokine Receptor (CCR5)
polynucleotides and/or polypeptides of the present invention,
and/or agonists or antagonists thereof, include nerve compression
syndromes such as carpal tunnel syndrome, tarsal tunnel syndrome,
thoracic outlet syndrome such as cervical rib syndrome, ulnar nerve
compression syndrome, neuralgia such as causalgia, cervico-brachial
neuralgia, facial neuralgia and trigeminal neuralgia, neuritis such
as experimental allergic neuritis, optic neuritis, polyneuritis,
polyradiculoneuritis and radiculities such as polyradiculitis,
hereditary motor and sensory neuropathies such as Charcot-Marie
Disease, Hereditary Optic Atrophy, Refsum's Disease, Hereditary
Spastic Paraplegia and Werdnig-Hoffmann Disease, Hereditary Sensory
and Autonomic Neuropathies which include Congenital Analgesia and
Familial Dysautonomia, POEMS Syndrome, Sciatica, Gustatory Sweating
and Tetany).
[0703] Hyperproliferative Disorders. G-protein Chemokine Receptor
(CCR5) polynucleotides or polypeptides, or agonists or antagonists
of G-protein Chemokine Receptor (CCR5), can be used to treat,
prevent, and/or diagnose hyperproliferative diseases, disorders,
and/or conditions, including neoplasms. G-protein Chemokine
Receptor (CCR5) polynucleotides or polypeptides, or agonists or
antagonists of G-protein Chemokine Receptor (CCR5), may inhibit the
proliferation of the disorder through direct or indirect
interactions. Alternatively, G-protein Chemokine Receptor (CCR5)
polynucleotides or polypeptides, or agonists or antagonists of
G-protein Chemokine Receptor (CCR5), may proliferate other cells
which can inhibit the hyperproliferative disorder.
[0704] For example, by increasing an immune response, particularly
increasing antigenic qualities of the hyperproliferative disorder
or by proliferating, differentiating, or mobilizing T-cells,
hyperproliferative diseases, disorders, and/or conditions can be
treated, prevented, and/or diagnosed. This immune response may be
increased by either enhancing an existing immune response, or by
initiating a new immune response. Alternatively, decreasing an
immune response may also be a method of treating, preventing,
and/or diagnosing hyperproliferative diseases, disorders, and/or
conditions, such as a chemotherapeutic agent.
[0705] Examples of hyperproliferative diseases, disorders, and/or
conditions that can be treated, prevented, and/or diagnosed by
G-protein Chemokine Receptor (CCR5) polynucleotides or
polypeptides, or agonists or antagonists of G-protein Chemokine
Receptor (CCR5), include, but are not limited to neoplasms located
in the: colon, abdomen, bone, breast, digestive system, liver,
pancreas, peritoneum, endocrine glands (adrenal, parathyroid,
pituitary, testicles, ovary, thymus, thyroid), eye, head and neck,
nervous (central and peripheral), lymphatic system, pelvic, skin,
soft tissue, spleen, thoracic, and urogenital.
[0706] Similarly, other hyperproliferative diseases, disorders,
and/or conditions can also be treated, prevented, and/or diagnosed
by G-protein Chemokine Receptor (CCR5) polynucleotides or
polypeptides, or agonists or antagonists of G-protein Chemokine
Receptor. Examples of such hyperproliferative diseases, disorders,
and/or conditions include, but are not limited to:
hypergammaglobulinemia, lymphoproliferative diseases, disorders,
and/or conditions, paraproteinemias, purpura, sarcoidosis, Sezary
Syndrome, Waldenstron's Macroglobulinemia, Gaucher's Disease,
histiocytosis, and any other hyperproliferative disease, besides
neoplasia, located in an organ system listed above.
[0707] One preferred embodiment utilizes polynucleotides of the
present invention to inhibit aberrant cellular division, by gene
therapy using the present invention, and/or protein fusions or
fragments thereof.
[0708] Thus, the present invention provides a method for treating
cell proliferative diseases, disorders, and/or conditions by
inserting into an abnormally proliferating cell a polynucleotide of
the present invention, wherein said polynucleotide represses said
expression.
[0709] Another embodiment of the present invention provides a
method of treating cell-proliferative diseases, disorders, and/or
conditions in individuals comprising administration of one or more
active gene copies of the present invention to an abnormally
proliferating cell or cells. In a preferred embodiment,
polynucleotides of the present invention is a DNA construct
comprising a recombinant expression vector effective in expressing
a DNA sequence encoding said polynucleotides. In another preferred
embodiment of the present invention, the DNA construct encoding the
polynucleotides of the present invention is inserted into cells to
be treated utilizing a retrovirus, or more preferably an adenoviral
vector (See G J. Nabel, et. al., PNAS 1999 96: 324-326, which is
hereby incorporated by reference). In a most preferred embodiment,
the viral vector is defective and will not transform
non-proliferating cells, only proliferating cells. Moreover, in a
preferred embodiment, the polynucleotides of the present invention
inserted into proliferating cells either alone, or in combination
with or fused to other polynucleotides, can then be modulated via
an external stimulus (i.e. magnetic, specific small molecule,
chemical, or drug administration, etc.), which acts upon the
promoter upstream of said polynucleotides to induce expression of
the encoded protein product. As such the beneficial therapeutic
affect of the present invention may be expressly modulated (i.e. to
increase, decrease, or inhibit expression of the present invention)
based upon said external stimulus.
[0710] Polynucleotides of the present invention may be useful in
repressing expression of oncogenic genes or antigens. By
"repressing expression of the oncogenic genes" is intended the
suppression of the transcription of the gene, the degradation of
the gene transcript (pre-message RNA), the inhibition of splicing,
the destruction of the messenger RNA, the prevention of the
post-translational modifications of the protein, the destruction of
the protein, or the inhibition of the normal function of the
protein.
[0711] For local administration to abnormally proliferating cells,
polynucleotides of the present invention may be administered by any
method known to those of skill in the art including, but not
limited to transfection, electroporation, microinjection of cells,
or in vehicles such as liposomes, LIPOFECTIN.TM., or as naked
polynucleotides, or any other method described throughout the
specification. The polynucleotide of the present invention may be
delivered by known gene delivery systems such as, but not limited
to, retroviral vectors (Gilboa, J. Virology 44:845 (1982); Hocke,
Nature 320:275 (1986); Wilson, et al., Proc. Natl. Acad. Sci.
U.S.A. 85:3014), vaccinia virus system (Chakrabarty et al., Mol.
Cell. Biol. 5:3403 (1985) or other efficient DNA delivery systems
(Yates et al., Nature 313:812 (1985)) known to those skilled in the
art. These references are exemplary only and are hereby
incorporated by reference. In order to specifically deliver or
transfect cells which are abnormally proliferating and spare
non-dividing cells, it is preferable to utilize a retrovirus, or
adenoviral (as described in the art and elsewhere herein) delivery
system known to those of skill in the art. Since host DNA
replication is required for retroviral DNA to integrate and the
retrovirus will be unable to self replicate due to the lack of the
retrovirus genes needed for its life cycle. Utilizing such a
retroviral delivery system for polynucleotides of the present
invention will target said gene and constructs to abnormally
proliferating cells and will spare the non-dividing normal
cells.
[0712] The polynucleotides of the present invention may be
delivered directly to cell proliferative disorder/disease sites in
internal organs, body cavities and the like by use of imaging
devices used to guide an injecting needle directly to the disease
site. The polynucleotides of the present invention may also be
administered to disease sites at the time of surgical
intervention.
[0713] By "cell proliferative disease" is meant any human or animal
disease or disorder, affecting any one or any combination of
organs, cavities, or body parts, which is characterized by single
or multiple local abnormal proliferations of cells, groups of
cells, or tissues, whether benign or malignant.
[0714] Any amount of the polynucleotides of the present invention
may be administered as long as it has a biologically inhibiting
effect on the proliferation of the treated cells. Moreover, it is
possible to administer more than one of the polynucleotide of the
present invention simultaneously to the same site. By "biologically
inhibiting" is meant partial or total growth inhibition as well as
decreases in the rate of proliferation or growth of the cells. The
biologically inhibitory dose may be determined by assessing the
effects of the polynucleotides of the present invention on target
malignant or abnormally proliferating cell growth in tissue
culture, tumor growth in animals and cell cultures, or any other
method known to one of ordinary skill in the art.
[0715] The present invention is further directed to antibody-based
therapies which involve administering of anti-polypeptides and
anti-polynucleotide antibodies to a mammalian, preferably human,
patient for treating one or more of the described diseases,
disorders, and/or conditions. Methods for producing
anti-polypeptides and anti-polynucleotide antibodies polyclonal and
monoclonal antibodies are described in detail elsewhere herein.
Such antibodies may be provided in pharmaceutically acceptable
compositions as known in the art or as described herein.
[0716] A summary of the ways in which the antibodies of the present
invention may be used therapeutically includes binding
polynucleotides or polypeptides of the present invention locally or
systemically in the body or by direct cytotoxicity of the antibody,
e.g. as mediated by complement (CDC) or by effector cells (ADCC).
Some of these approaches are described in more detail below. Armed
with the teachings provided herein, one of ordinary skill in the
art will know how to use the antibodies of the present invention
for diagnostic, monitoring or therapeutic purposes without undue
experimentation.
[0717] In particular, the antibodies, fragments and derivatives of
the present invention are useful for treating a subject having or
developing cell proliferative and/or differentiation diseases,
disorders, and/or conditions as described herein. Such treatment
comprises administering a single or multiple doses of the antibody,
or a fragment, derivative, or a conjugate thereof.
[0718] The antibodies of this invention may be advantageously
utilized in combination with other monoclonal or chimeric
antibodies, or with lymphokines or hematopoietic growth factors,
for example, which serve to increase the number or activity of
effector cells which interact with the antibodies.
[0719] It is preferred to use high affinity and/or potent in vivo
inhibiting and/or neutralizing antibodies against polypeptides or
polynucleotides of the present invention, fragments or regions
thereof, for both immunoassays directed to and therapy of diseases,
disorders, and/or conditions related to polynucleotides or
polypeptides, including fragments thereof, of the present
invention. Such antibodies, fragments, or regions, will preferably
have an affinity for polynucleotides or polypeptides, including
fragments thereof. Preferred binding affinities include those with
a dissociation constant or Kd less than 5.times.10.sup.-2 M,
10.sup.-2 M, 5.times.10.sup.-3 M, 10.sup.-3 M, 5.times.10.sup.-4 M,
10.sup.-4 M. More preferred binding affinities include those with a
dissociation constant or Kd less than 5.times.10.sup.-5 M,
10.sup.-5 M, 5.times.10.sup.-6 M, 10.sup.-6M, 5.times.10.sup.-7 M,
10.sup.7 M, 5.times.10.sup.-8 M or 10.sup.-8 M. Even more preferred
binding affinities include those with a dissociation constant or Kd
less than 5.times.10.sup.-9 M, 10.sup.-9 M, 5.times.10.sup.-10 M,
10.sup.-10 M, 5.times.10.sup.-11 M, 10.sup.11 M, 5.times.10.sup.-12
M, .sup.10-12 M, 5.times.10.sup.-13 M, 10.sup.-13 M,
5.times.10.sup.-14 M, 10.sup.-14 M, 5.times.10.sup.-15 M, or
10.sup.-15 M.
[0720] Moreover, polypeptides of the present invention are useful
in inhibiting the angiogenesis of proliferative cells or tissues,
either alone, as a protein fusion, or in combination with other
polypeptides directly or indirectly, as described elsewhere herein.
In a most preferred embodiment, said anti-angiogenesis effect may
be achieved indirectly, for example, through the inhibition of
hematopoietic, tumor-specific cells, such as tumor-associated
macrophages (See Joseph I B, et al. J Natl Cancer Inst,
90(21):1648-53 (1998), which is hereby incorporated by reference).
Antibodies directed to polypeptides or polynucleotides of the
present invention may also result in inhibition of angiogenesis
directly, or indirectly (See Witte L, et al., Cancer Metastasis
Rev. 17(2):155-61 (1998), which is hereby incorporated by
reference)).
[0721] Polypeptides, including G-protein fusions, of the present
invention, or fragments thereof may be useful in inhibiting
proliferative cells or tissues through the induction of apoptosis.
Said polypeptides may act either directly, or indirectly to induce
apoptosis of proliferative cells and tissues, for example in the
activation of a death-domain receptor, such as tumor necrosis
factor (TNF) receptor-1, CD95 (Fas/APO-1), TNF-receptor-related
apoptosis-mediated protein (TRAMP) and TNF-related
apoptosis-inducing ligand (TRAIL) receptor-1 and -2 (See
Schulze-Osthoff K, et al., Eur J Biochem 254(3):439-59 (1998),
which is hereby incorporated by reference). Moreover, in another
preferred embodiment of the present invention, said polypeptides
may induce apoptosis through other mechanisms, such as in the
activation of other proteins which will activate apoptosis, or
through stimulating the expression of said proteins, either alone
or in combination with small molecule drugs or adjuvants, such as
apoptonin, galectins, thioredoxins, antiinflammatory proteins (See
for example, Mutat Res 400(1-2):447-55 (1998), Med. Hypotheses.
50(5):423-33 (1998), Chem Biol Interact. April 24; 111-112:23-34
(1998), J Mol Med. 76(6):402-12 (1998), Int J Tissue React;
20(1):3-15 (1998), which are all hereby incorporated by
reference).
[0722] Polypeptides, including G-protein fusions to, or fragments
thereof, of the present invention are useful in inhibiting the
metastasis of proliferative cells or tissues Inhibition may occur
as a direct result of administering polypeptides, or antibodies
directed to said polypeptides as described elsewhere herein, or
indirectly, such as activating the expression of proteins known to
inhibit metastasis, for example alpha 4 integrins, (See, e.g., Curr
Top Microbiol Immunol 1998; 231:125-41, which is hereby
incorporated by reference). Such therapeutic affects of the present
invention may be achieved either alone, or in combination with
small molecule drugs or adjuvants.
[0723] In another embodiment, the invention provides a method of
delivering compositions containing the polypeptides of the
invention (e.g., compositions containing polypeptides or
polypeptide antibodies associated with heterologous polypeptides,
heterologous nucleic acids, toxins, or prodrugs) to targeted cells
expressing the polypeptide of the present invention. Polypeptides
or polypeptide antibodies of the invention may be associated with
heterologous polypeptides, heterologous nucleic acids, toxins, or
prodrugs via hydrophobic, hydrophilic, ionic and/or covalent
interactions.
[0724] Polypeptides, protein fusions to, or fragments thereof, of
the present invention are useful in enhancing the immunogenicity
and/or antigenicity of proliferating cells or tissues, either
directly, such as would occur if the polypeptides of the present
invention `vaccinated` the immune response to respond to
proliferative antigens and immunogens, or indirectly, such as in
activating the expression of proteins known to enhance the immune
response (e.g. chemokines), to said antigens and immunogens.
[0725] Cardiovascular Disorders. G-protein Chemokine Receptor
(CCR5) polynucleotides or polypeptides, or agonists or antagonists
of G-protein Chemokine Receptor (CCR5), encoding G-protein
Chemokine Receptor (CCR5) may be used to treat, prevent, and/or
diagnose cardiovascular diseases, disorders, and/or conditions,
including peripheral artery disease, such as limb ischemia.
[0726] Cardiovascular diseases, disorders, and/or conditions
include cardiovascular abnormalities, such as arterio-arterial
fistula, arteriovenous fistula, cerebral arteriovenous
malformations, congenital heart defects, pulmonary atresia, and
Scimitar Syndrome. Congenital heart defects include aortic
coarctation, cor triatriatum, coronary vessel anomalies, crisscross
heart, dextrocardia, patent ductus arteriosus, Ebstein's anomaly,
Eisenmenger complex, hypoplastic left heart syndrome, levocardia,
tetralogy of fallot, transposition of great vessels, double outlet
right ventricle, tricuspid atresia, persistent truncus arteriosus,
and heart septal defects, such as aortopulmonary septal defect,
endocardial cushion defects, Lutembacher's Syndrome, trilogy of
Fallot, ventricular heart septal defects.
[0727] Cardiovascular diseases, disorders, and/or conditions also
include heart disease, such as arrhythmias, carcinoid heart
disease, high cardiac output, low cardiac output, cardiac
tamponade, endocarditis (including bacterial), heart aneurysm,
cardiac arrest, congestive heart failure, congestive
cardiomyopathy, paroxysmal dyspnea, cardiac edema, heart
hypertrophy, congestive cardiomyopathy, left ventricular
hypertrophy, right ventricular hypertrophy, post-infarction heart
rupture, ventricular septal rupture, heart valve diseases,
myocardial diseases, myocardial ischemia, pericardial effusion,
pericarditis (including constrictive and i), pneumopericardium,
postpericardiotomy syndrome, pulmonary heart disease, rheumatic
heart disease, ventricular dysfunction, hyperemia, cardiovascular
pregnancy complications, Scimitar Syndrome, cardiovascular
syphilis, and cardiovascular tuberculosis.
[0728] Arrhythmias include sinus arrhythmia, atrial fibrillation,
atrial flutter, bradycardia, extrasystole, Adams-Stokes Syndrome,
bundle-branch block, sinoatrial block, long QT syndrome,
parasystole, Lown-Ganong-Levine Syndrome, Mahaim-type
pre-excitation syndrome, Wolff-Parkinson-White syndrome, sick sinus
syndrome, tachycardias, and ventricular fibrillation. Tachycardias
include paroxysmal tachycardia, supraventricular tachycardia,
accelerated idioventricular rhythm, atrioventricular nodal reentry
tachycardia, ectopic atrial tachycardia, ectopic junctional
tachycardia, sinoatrial nodal reentry tachycardia, sinus
tachycardia, Torsades de Pointes, and ventricular tachycardia.
[0729] Heart valve disease include aortic valve insufficiency,
aortic valve stenosis, hear murmurs, aortic valve prolapse, mitral
valve prolapse, tricuspid valve prolapse, mitral valve
insufficiency, mitral valve stenosis, pulmonary atresia, pulmonary
valve insufficiency, pulmonary valve stenosis, tricuspid atresia,
tricuspid valve insufficiency, and tricuspid valve stenosis.
[0730] Myocardial diseases include alcoholic cardiomyopathy,
congestive cardiomyopathy, hypertrophic cardiomyopathy, aortic
subvalvular stenosis, pulmonary subvalvular stenosis, restrictive
cardiomyopathy, Chagas cardiomyopathy, endocardial fibroelastosis,
endomyocardial fibrosis, Kearns Syndrome, myocardial reperfusion
injury, and myocarditis.
[0731] Myocardial ischemias include coronary disease, such as
angina pectoris, coronary aneurysm, coronary arteriosclerosis,
coronary thrombosis, coronary vasospasm, myocardial infarction and
myocardial stunning
[0732] Cardiovascular diseases also include vascular diseases such
as aneurysms, angiodysplasia, angiomatosis, bacillary angiomatosis,
Hippel-Lindau Disease, Klippel-Trenaunay-Weber Syndrome,
Sturge-Weber Syndrome, angioneurotic edema, aortic diseases,
Takayasu's Arteritis, aortitis, Leriche's Syndrome, arterial
occlusive diseases, arteritis, enarteritis, polyarteritis nodosa,
cerebrovascular diseases, disorders, and/or conditions, diabetic
angiopathies, diabetic retinopathy, embolisms, thrombosis,
erythromelalgia, hemorrhoids, hepatic veno-occlusive disease,
hypertension, hypotension, ischemia, peripheral vascular diseases,
phlebitis, pulmonary veno-occlusive disease, Raynaud's disease,
CREST syndrome, retinal vein occlusion, Scimitar syndrome, superior
vena cava syndrome, telangiectasia, atacia telangiectasia,
hereditary hemorrhagic telangiectasia, varicocele, varicose veins,
varicose ulcer, vasculitis, and venous insufficiency.
[0733] Aneurysms include dissecting aneurysms, false aneurysms,
infected aneurysms, ruptured aneurysms, aortic aneurysms, cerebral
aneurysms, coronary aneurysms, heart aneurysms, and iliac
aneurysms.
[0734] Arterial occlusive diseases include arteriosclerosis,
intermittent claudication, carotid stenosis, fibromuscular
dysplasias, mesenteric vascular occlusion, Moyamoya disease, renal
artery obstruction, retinal artery occlusion, and thromboangiitis
obliterans.
[0735] Cerebrovascular diseases, disorders, and/or conditions
include carotid artery diseases, cerebral amyloid angiopathy,
cerebral aneurysm, cerebral anoxia, cerebral arteriosclerosis,
cerebral arteriovenous malformation, cerebral artery diseases,
cerebral embolism and thrombosis, carotid artery thrombosis, sinus
thrombosis, Wallenberg's syndrome, cerebral hemorrhage, epidural
hematoma, subdural hematoma, subarachnoid hemorrhage, cerebral
infarction, cerebral ischemia (including transient), subclavian
steal syndrome, periventricular leukomalacia, vascular headache,
cluster headache, migraine, and vertebrobasilar insufficiency.
[0736] Embolisms include air embolisms, amniotic fluid embolisms,
cholesterol embolisms, blue toe syndrome, fat embolisms, pulmonary
embolisms, and thromoboembolisms. Thrombosis include coronary
thrombosis, hepatic vein thrombosis, retinal vein occlusion,
carotid artery thrombosis, sinus thrombosis, Wallenberg's syndrome,
and thrombophlebitis.
[0737] Ischemia includes cerebral ischemia, ischemic colitis,
compartment syndromes, anterior compartment syndrome, myocardial
ischemia, reperfusion injuries, and peripheral limb ischemia.
Vasculitis includes aortitis, arteritis, Behcet's Syndrome,
Churg-Strauss Syndrome, mucocutaneous lymph node syndrome,
thromboangiitis obliterans, hypersensitivity vasculitis,
Schoenlein-Henoch purpura, allergic cutaneous vasculitis, and
Wegener's granulomatosis.
[0738] G-protein Chemokine Receptor (CCR5) polynucleotides or
polypeptides, or agonists or antagonists of G-protein Chemokine
Receptor (CCR5), are especially effective for the treatment of
critical limb ischemia and coronary disease.
[0739] G-protein Chemokine Receptor (CCR5) polypeptides may be
administered using any method known in the art, including, but not
limited to, direct needle injection at the delivery site,
intravenous injection, topical administration, catheter infusion,
biolistic injectors, particle accelerators, gelfoam sponge depots,
other commercially available depot materials, osmotic pumps, oral
or suppositorial solid pharmaceutical formulations, decanting or
topical applications during surgery, aerosol delivery. Such methods
are known in the art. G-protein Chemokine Receptor (CCR5)
polypeptides may be administered as part of a Therapeutic,
described in more detail below. Methods of delivering G-protein
Chemokine Receptor (CCR5) polynucleotides are described in more
detail herein.
[0740] Treatment of Carbohydrate Metabolism Disorders. In specific
embodiments, the polynucleotides and/or polypeptides corresponding
to this gene and/or agonists or antagonists of those polypeptides
(including antibodies) as well as fragments and variants of those
polynucleotides, polypeptides, agonists and antagonists, may be
used to diagnose, prognose, treat, prevent, or ameliorate diseases
and disorders associated with aberrant glucose metabolism or
glucose uptake into cells.
[0741] In a specific embodiment, the polynucleotides and/or
polypeptides corresponding to this gene and/or agonists and/or
antagonists thereof may be used to diagnose, prognose, treat,
prevent, and/or ameliorate type I diabetes mellitus (insulin
dependent diabetes mellitus, IDDM).
[0742] In another embodiment, the polynucleotides and/or
polypeptides corresponding to this gene and/or agonists and/or
antagonists thereof may be used to diagnose, prognose, treat,
prevent, and/or ameliorate type II diabetes mellitus (insulin
resistant diabetes mellitus).
[0743] Additionally, in other embodiments, the polynucleotides
and/or polypeptides corresponding to this gene and/or antagonists
thereof (especially neutralizing or antagonistic antibodies) may be
used to diagnose, prognose, treat, prevent, and/or ameliorate
conditions associated with (type I or type II) diabetes mellitus,
including, but not limited to, diabetic ketoacidosis, diabetic
coma, nonketotic hyperglycemic-hyperosmolar coma, seizures, mental
confusion, drowsiness, cardiovascular disease (e.g., heart disease,
atherosclerosis, microvascular disease, hypertension, stroke, and
other diseases and disorders as described in the "Cardiovascular
Disorders" section), dyslipidemia, kidney disease (e.g., renal
failure and nephropathy) nerve damage, neuropathy, vision
impairment (e.g., diabetic retinopathy and blindness), ulcers and
impaired wound healing, infections (e.g., infectious diseases and
disorders as described in the "Infectious Diseases" section,
especially of the urinary tract and skin), carpal tunnel syndrome
and Dupuytren's contracture.
[0744] In other embodiments, the polynucleotides and/or
polypeptides corresponding to this gene and/or agonists or
antagonists thereof are administered to an animal, preferably a
mammal, and most preferably a human, in order to regulate the
animal's weight. In specific embodiments the polynucleotides and/or
polypeptides corresponding to this gene and/or agonists or
antagonists thereof are administered to an animal, preferably a
mammal, and most preferably a human, in order to control the
animal's weight by modulating a biochemical pathway involving
insulin. In still other embodiments the polynucleotides and/or
polypeptides corresponding to this gene and/or agonists or
antagonists thereof are administered to an animal, preferably a
mammal, and most preferably a human, in order to control the
animal's weight by modulating a biochemical pathway involving
insulin-like growth factor.
[0745] Anti-Angiogenesis Activity. The naturally occurring balance
between endogenous stimulators and inhibitors of angiogenesis is
one in which inhibitory influences predominate. Rastinejad et al.,
Cell 56:345-355 (1989). In those rare instances in which
neovascularization occurs under normal physiological conditions,
such as wound healing, organ regeneration, embryonic development,
and female reproductive processes, angiogenesis is stringently
regulated and spatially and temporally delimited. Under conditions
of pathological angiogenesis such as that characterizing solid
tumor growth, these regulatory controls fail. Unregulated
angiogenesis becomes pathologic and sustains progression of many
neoplastic and non-neoplastic diseases. A number of serious
diseases are dominated by abnormal neovascularization including
solid tumor growth and metastases, arthritis, some types of eye
diseases, disorders, and/or conditions, and psoriasis. See, e.g.,
reviews by Moses et al., Biotech. 9:630-634 (1991); Folkman et al.,
N. Engl. J. Med., 333:1757-1763 (1995); Auerbach et al., J.
Microvasc. Res. 29:401-411 (1985); Folkman, Advances in Cancer
Research, eds. Klein and Weinhouse, Academic Press, New York, pp.
175-203 (1985); Patz, Am. J. Opthalmol. 94:715-743 (1982); and
Folkman et al., Science 221:719-725 (1983). In a number of
pathological conditions, the process of angiogenesis contributes to
the disease state. For example, significant data have accumulated
which suggest that the growth of solid tumors is dependent on
angiogenesis. Folkman and Klagsbrun, Science 235:442-447
(1987).
[0746] The present invention provides for treatment of diseases,
disorders, and/or conditions associated with neovascularization by
administration of the polynucleotides and/or polypeptides of the
invention, as well as agonists or antagonists of the present
invention. Malignant and metastatic conditions which can be treated
with the polynucleotides and polypeptides, or agonists or
antagonists of the invention include, but are not limited to,
malignancies, solid tumors, and cancers described herein and
otherwise known in the art (for a review of such disorders, see
Fishman et al., Medicine, 2d Ed., J. B. Lippincott Co.,
Philadelphia (1985)). Thus, the present invention provides a method
of treating an angiogenesis-related disease and/or disorder,
comprising administering to an individual in need thereof a
therapeutically effective amount of a polynucleotide, polypeptide,
antagonist and/or agonist of the invention. For example,
polynucleotides, polypeptides, antagonists and/or agonists may be
utilized in a variety of additional methods in order to
therapeutically treat or prevent a cancer or tumor. Cancers which
may be treated with polynucleotides, polypeptides, antagonists
and/or agonists include, but are not limited to solid tumors,
including prostate, lung, breast, ovarian, stomach, pancreas,
larynx, esophagus, testes, liver, parotid, biliary tract, colon,
rectum, cervix, uterus, endometrium, kidney, bladder, thyroid
cancer; primary tumors and metastases; melanomas; glioblastoma;
Kaposi's sarcoma; leiomyosarcoma; non-small cell lung cancer;
colorectal cancer; advanced malignancies; and blood born tumors
such as leukemias. For example, polynucleotides, polypeptides,
antagonists and/or agonists may be delivered topically, in order to
treat or prevent cancers such as skin cancer, head and neck tumors,
breast tumors, and Kaposi's sarcoma.
[0747] Within yet other aspects, polynucleotides, polypeptides,
antagonists and/or agonists may be utilized to treat, prevent,
and/or diagnose superficial forms of bladder cancer by, for
example, intravesical administration. Polynucleotides,
polypeptides, antagonists and/or agonists may be delivered directly
into the tumor, or near the tumor site, via injection or a
catheter. Of course, as the artisan of ordinary skill will
appreciate, the appropriate mode of administration will vary
according to the cancer to be treated. Other modes of delivery are
discussed herein.
[0748] Polynucleotides, polypeptides, antagonists and/or agonists
may be useful in treating other diseases, disorders, and/or
conditions, besides cancers, which involve angiogenesis. These
diseases, disorders, and/or conditions include, but are not limited
to: benign tumors, for example hemangiomas, acoustic neuromas,
neurofibromas, trachomas, and pyogenic granulomas; artheroscleric
plaques; ocular angiogenic diseases, for example, diabetic
retinopathy, retinopathy of prematurity, macular degeneration,
corneal graft rejection, neovascular glaucoma, retrolental
fibroplasia, rubeosis, retinoblastoma, uvietis and Pterygia
(abnormal blood vessel growth) of the eye; rheumatoid arthritis;
psoriasis; delayed wound healing; endometriosis; vasculogenesis;
granulations; hypertrophic scars (keloids); nonunion fractures;
scleroderma; trachoma; vascular adhesions; myocardial angiogenesis;
coronary collaterals; cerebral collaterals; arteriovenous
malformations; ischemic limb angiogenesis; Osler-Webber Syndrome;
plaque neovascularization; telangiectasia; hemophiliac joints;
angiofibroma; fibromuscular dysplasia; wound granulation; Crohn's
disease; and atherosclerosis.
[0749] For example, within one aspect of the present invention
methods are provided for treating hypertrophic scars and keloids,
comprising the step of administering a polynucleotide, polypeptide,
antagonist and/or agonist of the invention to a hypertrophic scar
or keloid.
[0750] Within one embodiment of the present invention
polynucleotides, polypeptides, antagonists and/or agonists are
directly injected into a hypertrophic scar or keloid, in order to
prevent the progression of these lesions. This therapy is of
particular value in the prophylactic treatment of conditions which
are known to result in the development of hypertrophic scars and
keloids (e.g., burns), and is preferably initiated after the
proliferative phase has had time to progress (approximately 14 days
after the initial injury), but before hypertrophic scar or keloid
development. As noted above, the present invention also provides
methods for treating neovascular diseases of the eye, including for
example, corneal neovascularization, neovascular glaucoma,
proliferative diabetic retinopathy, retrolental fibroplasia and
macular degeneration.
[0751] Moreover, ocular diseases, disorders, and/or conditions
associated with neovascularization which can be treated with the
polynucleotides and polypeptides of the present invention
(including agonists and/or antagonists) include, but are not
limited to: neovascular glaucoma, diabetic retinopathy,
retinoblastoma, retrolental fibroplasia, uveitis, retinopathy of
prematurity macular degeneration, corneal graft neovascularization,
as well as other eye inflammatory diseases, ocular tumors and
diseases associated with choroidal or iris neovascularization. See,
e.g., reviews by Waltman et al., Am. J. Ophthal. 85:704-710 (1978)
and Gartner et al., Surv. Ophthal. 22:291-312 (1978).
[0752] Thus, within one aspect of the present invention methods are
provided for treating neovascular diseases of the eye such as
corneal neovascularization (including corneal graft
neovascularization), comprising the step of administering to a
patient a therapeutically effective amount of a compound (as
described above) to the cornea, such that the formation of blood
vessels is inhibited. Briefly, the cornea is a tissue which
normally lacks blood vessels. In certain pathological conditions
however, capillaries may extend into the cornea from the
pericorneal vascular plexus of the limbus. When the cornea becomes
vascularized, it also becomes clouded, resulting in a decline in
the patient's visual acuity. Visual loss may become complete if the
cornea completely opacitates. A wide variety of diseases,
disorders, and/or conditions can result in corneal
neovascularization, including for example, corneal infections
(e.g., trachoma, herpes simplex keratitis, leishmaniasis and
onchocerciasis), immunological processes (e.g., graft rejection and
Stevens-Johnson's syndrome), alkali burns, trauma, inflammation (of
any cause), toxic and nutritional deficiency states, and as a
complication of wearing contact lenses.
[0753] Within particularly preferred embodiments of the invention,
may be prepared for topical administration in saline (combined with
any of the preservatives and antimicrobial agents commonly used in
ocular preparations), and administered in eyedrop form. The
solution or suspension may be prepared in its pure form and
administered several times daily. Alternatively, anti-angiogenic
compositions, prepared as described above, may also be administered
directly to the cornea. Within preferred embodiments, the
anti-angiogenic composition is prepared with a muco-adhesive
polymer which binds to cornea. Within further embodiments, the
anti-angiogenic factors or anti-angiogenic compositions may be
utilized as an adjunct to conventional steroid therapy. Topical
therapy may also be useful prophylactically in corneal lesions
which are known to have a high probability of inducing an
angiogenic response (such as chemical burns). In these instances
the treatment, likely in combination with steroids, may be
instituted immediately to help prevent subsequent
complications.
[0754] Within other embodiments, the compounds described above may
be injected directly into the corneal stroma by an ophthalmologist
under microscopic guidance. The preferred site of injection may
vary with the morphology of the individual lesion, but the goal of
the administration would be to place the composition at the
advancing front of the vasculature (i.e., interspersed between the
blood vessels and the normal cornea). In most cases this would
involve perilimbic corneal injection to "protect" the cornea from
the advancing blood vessels. This method may also be utilized
shortly after a corneal insult in order to prophylactically prevent
corneal neovascularization. In this situation the material could be
injected in the perilimbic cornea interspersed between the corneal
lesion and its undesired potential limbic blood supply. Such
methods may also be utilized in a similar fashion to prevent
capillary invasion of transplanted corneas. In a sustained-release
form injections might only be required 2-3 times per year. A
steroid could also be added to the injection solution to reduce
inflammation resulting from the injection itself.
[0755] Within another aspect of the present invention, methods are
provided for treating neovascular glaucoma, comprising the step of
administering to a patient a therapeutically effective amount of a
polynucleotide, polypeptide, antagonist and/or agonist to the eye,
such that the formation of blood vessels is inhibited. In one
embodiment, the compound may be administered topically to the eye
in order to treat or prevent early forms of neovascular glaucoma.
Within other embodiments, the compound may be implanted by
injection into the region of the anterior chamber angle. Within
other embodiments, the compound may also be placed in any location
such that the compound is continuously released into the aqueous
humor. Within another aspect of the present invention, methods are
provided for treating proliferative diabetic retinopathy,
comprising the step of administering to a patient a therapeutically
effective amount of a polynucleotide, polypeptide, antagonist
and/or agonist to the eyes, such that the formation of blood
vessels is inhibited.
[0756] Within particularly preferred embodiments of the invention,
proliferative diabetic retinopathy may be treated by injection into
the aqueous humor or the vitreous, in order to increase the local
concentration of the polynucleotide, polypeptide, antagonist and/or
agonist in the retina. Preferably, this treatment should be
initiated prior to the acquisition of severe disease requiring
photocoagulation.
[0757] Within another aspect of the present invention, methods are
provided for treating retrolental fibroplasia, comprising the step
of administering to a patient a therapeutically effective amount of
a polynucleotide, polypeptide, antagonist and/or agonist to the
eye, such that the formation of blood vessels is inhibited. The
compound may be administered topically, via intravitreous injection
and/or via intraocular implants.
[0758] Additionally, diseases, disorders, and/or conditions which
can be treated with the polynucleotides, polypeptides, agonists
and/or agonists include, but are not limited to, hemangioma,
arthritis, psoriasis, angiofibroma, atherosclerotic plaques,
delayed wound healing, granulations, hemophilic joints,
hypertrophic scars, nonunion fractures, Osler-Weber syndrome,
pyogenic granuloma, scleroderma, trachoma, and vascular
adhesions.
[0759] Moreover, diseases, disorders, and/or conditions and/or
states, which can be treated with be treated with the
polynucleotides, polypeptides, agonists and/or agonists include,
but are not limited to, solid tumors, blood born tumors such as
leukemias, tumor metastasis, Kaposi's sarcoma, benign tumors, for
example hemangiomas, acoustic neuromas, neurofibromas, trachomas,
and pyogenic granulomas, rheumatoid arthritis, psoriasis, ocular
angiogenic diseases, for example, diabetic retinopathy, retinopathy
of prematurity, macular degeneration, corneal graft rejection,
neovascular glaucoma, retrolental fibroplasia, rubeosis,
retinoblastoma, and uvietis, delayed wound healing, endometriosis,
vasculogenesis, granulations, hypertrophic scars (keloids),
nonunion fractures, scleroderma, trachoma, vascular adhesions,
myocardial angiogenesis, coronary collaterals, cerebral
collaterals, arteriovenous malformations, ischemic limb
angiogenesis, Osler-Webber Syndrome, plaque neovascularization,
telangiectasia, hemophiliac joints, angiofibroma fibromuscular
dysplasia, wound granulation, Crohn's disease, atherosclerosis,
birth control agent by preventing vascularization required for
embryo implantation controlling menstruation, diseases that have
angiogenesis as a pathologic consequence such as cat scratch
disease (Rochele minalia quintosa), ulcers (Helicobacter pylori),
Bartonellosis and bacillary angiomatosis.
[0760] In one aspect of the birth control method, an amount of the
compound sufficient to block embryo implantation is administered
before or after intercourse and fertilization have occurred, thus
providing an effective method of birth control, possibly a "morning
after" method. Polynucleotides, polypeptides, agonists and/or
agonists may also be used in controlling menstruation or
administered as either a peritoneal lavage fluid or for peritoneal
implantation in the treatment of endometriosis.
[0761] Polynucleotides, polypeptides, agonists and/or agonists of
the present invention may be incorporated into surgical sutures in
order to prevent stitch granulomas.
[0762] Polynucleotides, polypeptides, agonists and/or agonists may
be utilized in a wide variety of surgical procedures. For example,
within one aspect of the present invention a compositions (in the
form of, for example, a spray or film) may be utilized to coat or
spray an area prior to removal of a tumor, in order to isolate
normal surrounding tissues from malignant tissue, and/or to prevent
the spread of disease to surrounding tissues. Within other aspects
of the present invention, compositions (e.g., in the form of a
spray) may be delivered via endoscopic procedures in order to coat
tumors, or inhibit angiogenesis in a desired locale. Within yet
other aspects of the present invention, surgical meshes which have
been coated with anti-angiogenic compositions of the present
invention may be utilized in any procedure wherein a surgical mesh
might be utilized. For example, within one embodiment of the
invention a surgical mesh laden with an anti-angiogenic composition
may be utilized during abdominal cancer resection surgery (e.g.,
subsequent to colon resection) in order to provide support to the
structure, and to release an amount of the anti-angiogenic
factor.
[0763] Within further aspects of the present invention, methods are
provided for treating tumor excision sites, comprising
administering a polynucleotide, polypeptide, agonist and/or agonist
to the resection margins of a tumor subsequent to excision, such
that the local recurrence of cancer and the formation of new blood
vessels at the site is inhibited. Within one embodiment of the
invention, the anti-angiogenic compound is administered directly to
the tumor excision site (e.g., applied by swabbing, brushing or
otherwise coating the resection margins of the tumor with the
anti-angiogenic compound). Alternatively, the anti-angiogenic
compounds may be incorporated into known surgical pastes prior to
administration. Within particularly preferred embodiments of the
invention, the anti-angiogenic compounds are applied after hepatic
resections for malignancy, and after neurosurgical operations.
[0764] Within one aspect of the present invention, polynucleotides,
polypeptides, agonists and/or agonists may be administered to the
resection margin of a wide variety of tumors, including for
example, breast, colon, brain and hepatic tumors. For example,
within one embodiment of the invention, anti-angiogenic compounds
may be administered to the site of a neurological tumor subsequent
to excision, such that the formation of new blood vessels at the
site are inhibited.
[0765] The polynucleotides, polypeptides, agonists and/or agonists
of the present invention may also be administered along with other
anti-angiogenic factors. Representative examples of other
anti-angiogenic factors include: Anti-Invasive Factor, retinoic
acid and derivatives thereof, paclitaxel, Suramin, Tissue Inhibitor
of Metalloproteinase-1, Tissue Inhibitor of Metalloproteinase-2,
Plasminogen Activator Inhibitor-1, Plasminogen Activator
Inhibitor-2, and various forms of the lighter "d group" transition
metals.
[0766] Lighter "d group" transition metals include, for example,
vanadium, molybdenum, tungsten, titanium, niobium, and tantalum
species. Such transition metal species may form transition metal
complexes. Suitable complexes of the above-mentioned transition
metal species include oxo transition metal complexes.
[0767] Representative examples of vanadium complexes include oxo
vanadium complexes such as vanadate and vanadyl complexes. Suitable
vanadate complexes include metavanadate and orthovanadate complexes
such as, for example, ammonium metavanadate, sodium metavanadate,
and sodium orthovanadate. Suitable vanadyl complexes include, for
example, vanadyl acetylacetonate and vanadyl sulfate including
vanadyl sulfate hydrates such as vanadyl sulfate mono- and
trihydrates.
[0768] Representative examples of tungsten and molybdenum complexes
also include oxo complexes. Suitable oxo tungsten complexes include
tungstate and tungsten oxide complexes. Suitable tungstate
complexes include ammonium tungstate, calcium tungstate, sodium
tungstate dihydrate, and tungstic acid. Suitable tungsten oxides
include tungsten (IV) oxide and tungsten (VI) oxide. Suitable oxo
molybdenum complexes include molybdate, molybdenum oxide, and
molybdenyl complexes. Suitable molybdate complexes include ammonium
molybdate and its hydrates, sodium molybdate and its hydrates, and
potassium molybdate and its hydrates. Suitable molybdenum oxides
include molybdenum (VI) oxide, molybdenum (VI) oxide, and molybdic
acid. Suitable molybdenyl complexes include, for example,
molybdenyl acetylacetonate. Other suitable tungsten and molybdenum
complexes include hydroxo derivatives derived from, for example,
glycerol, tartaric acid, and sugars.
[0769] A wide variety of other anti-angiogenic factors may also be
utilized within the context of the present invention.
Representative examples include platelet factor 4; protamine
sulphate; sulphated chitin derivatives (prepared from queen crab
shells), (Murata et al., Cancer Res. 51:22-26, 1991); Sulphated
Polysaccharide Peptidoglycan Complex (SP-PG) (the function of this
compound may be enhanced by the presence of steroids such as
estrogen, and tamoxifen citrate); Staurosporine; modulators of
matrix metabolism, including for example, proline analogs,
cishydroxyproline, d,L-3,4-dehydroproline, Thiaproline,
alpha,alpha-dipyridyl, aminopropionitrile fumarate;
4-propyl-5-(4-pyridinyl)-2(3H)-oxazolone; Methotrexate;
Mitoxantrone; Heparin; Interferons; 2 Macroglobulin-serum; ChIMP-3
(Pavloff et al., J. Bio. Chem. 267:17321-17326, 1992); Chymostatin
(Tomkinson et al., Biochem J. 286:475-480, 1992); Cyclodextrin
Tetradecasulfate; Eponemycin; Camptothecin; Fumagillin (Ingber et
al., Nature 348:555-557, 1990); Gold Sodium Thiomalate ("GST";
Matsubara and Ziff, J. Clin. Invest. 79:1440-1446, 1987);
anticollagenase-serum; alpha2-antiplasmin (Holmes et al., J. Biol.
Chem. 262 (4):1659-1664, 1987); Bisantrene (National Cancer
Institute); Lobenzarit disodium
(N-(2)-carboxyphenyl-4-chloroanthronilic acid disodium or "CCA";
Takeuchi et al., Agents Actions 36:312-316, 1992); Thalidomide;
Angostatic steroid; AGM-1470; carboxynaminolmidazole; and
metalloproteinase inhibitors such as BB94.
[0770] Binding Activity. G-protein Chemokine Receptor (CCR5)
polypeptides may be used to screen for molecules that bind to
G-protein Chemokine Receptor (CCR5) or for molecules to which
G-protein Chemokine Receptor (CCR5) binds. The binding of G-protein
Chemokine Receptor (CCR5) and the molecule may activate (agonist),
increase, inhibit (antagonist), or decrease activity of the
G-protein Chemokine Receptor (CCR5) or the molecule bound. Examples
of such molecules include antibodies, oligonucleotides, proteins
(e.g., receptors), or small molecules.
[0771] Preferably, the molecule is closely related to the natural
ligand of G-protein Chemokine Receptor (CCR5), e.g., a fragment of
the ligand, or a natural substrate, a ligand, a structural or
functional mimetic. (See, Coligan et al., Current Protocols in
Immunology 1(2):Chapter 5 (1991).) Similarly, the molecule can be
closely related to the natural receptor to which G-protein
Chemokine Receptor (CCR5) binds, or at least, a fragment of the
receptor capable of being bound by G-protein Chemokine Receptor
(CCR5) (e.g., active site). In either case, the molecule can be
rationally designed using known techniques.
[0772] Preferably, the screening for these molecules involves
producing appropriate cells which express G-protein Chemokine
Receptor (CCR5), either as a secreted protein or on the cell
membrane. Preferred cells include cells from mammals, yeast,
Drosophila, or E. coli. Cells expressing G-protein Chemokine
Receptor (CCR5) (or cell membrane containing the expressed
polypeptide) are then preferably contacted with a test compound
potentially containing the molecule to observe binding,
stimulation, or inhibition of activity of either G-protein
Chemokine Receptor (CCR5) or the molecule.
[0773] The assay may simply test binding of a candidate compound to
G-protein Chemokine Receptor (CCR5), wherein binding is detected by
a label, or in an assay involving competition with a labeled
competitor. Further, the assay may test whether the candidate
compound results in a signal generated by binding to G-protein
Chemokine Receptor.
[0774] Alternatively, the assay can be carried out using cell-free
preparations, polypeptide/molecule affixed to a solid support,
chemical libraries, or natural product mixtures. The assay may also
simply comprise the steps of mixing a candidate compound with a
solution containing G-protein Chemokine Receptor (CCR5), measuring
G-protein Chemokine Receptor/molecule activity or binding, and
comparing the G-protein Chemokine Receptor/molecule activity or
binding to a standard.
[0775] Preferably, an ELISA assay can measure G-protein Chemokine
Receptor (CCR5) level or activity in a sample (e.g., biological
sample) using a monoclonal or polyclonal antibody. The antibody can
measure G-protein Chemokine Receptor (CCR5) level or activity by
either binding, directly or indirectly, to G-protein Chemokine
Receptor (CCR5) or by competing with G-protein Chemokine Receptor
(CCR5) for a substrate.
[0776] Additionally, the ligands to which G-protein Chemokine
Receptor (CCR5) binds can be identified by numerous methods known
to those of skill in the art, for example, ligand panning and FACS
sorting (Coligan, et al., Current Protocols in Immun., 1(2),
Chapter 5, (1991)). For example, expression cloning is employed
wherein polyadenylated RNA is prepared from a cell responsive to
the polypeptides, for example, NIH3T3 cells which are known to
contain multiple receptors for the FGF family proteins, and SC-3
cells, and a cDNA library created from this RNA is divided into
pools and used to transfect COS cells or other cells that are not
responsive to the polypeptides. Transfected cells which are grown
on glass slides are exposed to the polypeptide of the present
invention, after they have been labelled. The polypeptides can be
labeled by a variety of means including iodination or inclusion of
a recognition site for a site-specific protein kinase.
[0777] Following fixation and incubation, the slides are subjected
to auto-radiographic analysis. Positive pools are identified and
sub-pools are prepared and re-transfected using an iterative
sub-pooling and re-screening process, eventually yielding a single
clones that encodes the putative receptor.
[0778] As an alternative approach for receptor identification, the
labeled polypeptides can be photoaffinity linked with cell membrane
or extract preparations that express the receptor molecule.
Cross-linked material is resolved by PAGE analysis and exposed to
X-ray film. The labeled complex containing the receptors of the
polypeptides can be excised, resolved into peptide fragments, and
subjected to protein microsequencing. The amino acid sequence
obtained from microsequencing would be used to design a set of
degenerate oligonucleotide probes to screen a cDNA library to
identify the genes encoding the putative receptors.
[0779] Moreover, the techniques of gene-shuffling, motif-shuffling,
exon-shuffling, and/or codon-shuffling (collectively referred to as
"DNA shuffling") may be employed to modulate the activities of
G-protein Chemokine Receptor (CCR5) thereby effectively generating
agonists and antagonists of G-protein Chemokine Receptor. See
generally, U.S. Pat. Nos. 5,605,793, 5,811,238, 5,830,721,
5,834,252, and 5,837,458, and Patten, P. A., et al., Curr. Opinion
Biotechnol. 8:724-33 (1997); Harayama, S. Trends Biotechnol.
16(2):76-82 (1998); Hansson, L. O., et al., J. Mol. Biol.
287:265-76 (1999); and Lorenzo, M. M. and Blasco, R. Biotechniques
24(2):308-13 (1998) (each of these patents and publications are
hereby incorporated by reference). In one embodiment, alteration of
G-protein Chemokine Receptor (CCR5) polynucleotides and
corresponding polypeptides may be achieved by DNA shuffling. DNA
shuffling involves the assembly of two or more DNA segments into a
desired G-protein Chemokine Receptor (CCR5) molecule by homologous,
or site-specific, recombination. In another embodiment, G-protein
Chemokine Receptor (CCR5) polynucleotides and corresponding
polypeptides may be altered by being subjected to random
mutagenesis by error-prone PCR, random nucleotide insertion or
other methods prior to recombination. In another embodiment, one or
more components, motifs, sections, parts, domains, fragments, etc.,
of G-protein Chemokine Receptor (CCR5) may be recombined with one
or more components, motifs, sections, parts, domains, fragments,
etc. of one or more heterologous molecules. In preferred
embodiments, the heterologous molecules are G-protein Chemokine
Receptor (CCR5) family members. In further preferred embodiments,
the heterologous molecule is a growth factor such as, for example,
platelet-derived growth factor (PDGF), insulin-like growth factor
(IGF-I), transforming growth factor (TGF)-alpha, epidermal growth
factor (EGF), fibroblast growth factor (FGF), TGF-beta, bone
morphogenetic protein (BMP)-2, BMP-4, BMP-5, BMP-6, BMP-7, activins
A and B, decapentaplegic (dpp), 60A, OP-2, dorsalin, growth
differentiation factors (GDFs), nodal, MIS, inhibin-alpha,
TGF-beta1, TGF-beta2, TGF-beta3, TGF-beta5, and glial-derived
neurotrophic factor (GDNF).
[0780] Other preferred fragments are biologically active G-protein
Chemokine Receptor (CCR5) fragments. Biologically active fragments
are those exhibiting activity similar, but not necessarily
identical, to an activity of the G-protein Chemokine Receptor
(CCR5) polypeptide. The biological activity of the fragments may
include an improved desired activity, or a decreased undesirable
activity.
[0781] Additionally, this invention provides a method of screening
compounds to identify those which modulate the action of the
polypeptide of the present invention. An example of such an assay
comprises combining a mammalian fibroblast cell, a the polypeptide
of the present invention, the compound to be screened and .sup.3[H]
thymidine under cell culture conditions where the fibroblast cell
would normally proliferate. A control assay may be performed in the
absence of the compound to be screened and compared to the amount
of fibroblast proliferation in the presence of the compound to
determine if the compound stimulates proliferation by determining
the uptake of .sup.3[H] thymidine in each case. The amount of
fibroblast cell proliferation is measured by liquid scintillation
chromatography which measures the incorporation of .sup.3[H]
thymidine. Both agonist and antagonist compounds may be identified
by this procedure.
[0782] In another method, a mammalian cell or membrane preparation
expressing a receptor for a polypeptide of the present invention is
incubated with a labeled polypeptide of the present invention in
the presence of the compound. The ability of the compound to
enhance or block this interaction could then be measured.
Alternatively, the response of a known second messenger system
following interaction of a compound to be screened and the
G-protein Chemokine Receptor (CCR5) is measured and the ability of
the compound to bind to the receptor and elicit a second messenger
response is measured to determine if the compound is a potential
agonist or antagonist. Such second messenger systems include but
are not limited to, cAMP guanylate cyclase, ion channels or
phosphoinositide hydrolysis.
[0783] All of these above assays can be used as diagnostic or
prognostic markers. The molecules discovered using these assays can
be used to treat, prevent, and/or diagnose disease or to bring
about a particular result in a patient (e.g., blood vessel growth)
by activating or inhibiting the polypeptide/molecule. Moreover, the
assays can discover agents which may inhibit or enhance the
production of the polypeptides of the invention from suitably
manipulated cells or tissues. Therefore, the invention includes a
method of identifying compounds which bind to G-protein Chemokine
Receptor (CCR5) comprising the steps of: (a) incubating a candidate
binding compound with G-protein Chemokine Receptor; and (b)
determining if binding has occurred. Moreover, the invention
includes a method of identifying agonists/antagonists comprising
the steps of: (a) incubating a candidate compound with G-protein
Chemokine Receptor (CCR5), (b) assaying a biological activity, and
(b) determining if a biological activity of G-protein Chemokine
Receptor (CCR5) has been altered.
[0784] Also, one could identify molecules bind G-protein Chemokine
Receptor (CCR5) experimentally by using the beta-pleated sheet
regions disclosed in FIG. 3 and Table 1. Accordingly, specific
embodiments of the invention are directed to polynucleotides
encoding polypeptides which comprise, or alternatively consist of,
the amino acid sequence of each beta pleated sheet regions
disclosed in FIG. 3/Table 1. Additional embodiments of the
invention are directed to polynucleotides encoding G-protein
Chemokine Receptor (CCR5) polypeptides which comprise, or
alternatively consist of, any combination or all of the beta
pleated sheet regions disclosed in FIG. 3/Table 1. Additional
preferred embodiments of the invention are directed to polypeptides
which comprise, or alternatively consist of, the G-protein
Chemokine Receptor (CCR5) amino acid sequence of each of the beta
pleated sheet regions disclosed in FIG. 3/Table 1. Additional
embodiments of the invention are directed to G-protein Chemokine
Receptor (CCR5) polypeptides which comprise, or alternatively
consist of, any combination or all of the beta pleated sheet
regions disclosed in FIG. 3/Table 1.
Targeted Delivery
[0785] In another embodiment, the invention provides a method of
delivering compositions to targeted cells expressing a receptor for
a polypeptide of the invention, or cells expressing a cell bound
form of a polypeptide of the invention.
[0786] As discussed herein, polypeptides or antibodies of the
invention may be associated with heterologous polypeptides,
heterologous nucleic acids, toxins, or prodrugs via hydrophobic,
hydrophilic, ionic and/or covalent interactions. In one embodiment,
the invention provides a method for the specific delivery of
compositions of the invention to cells by administering
polypeptides of the invention (including antibodies) that are
associated with heterologous polypeptides or nucleic acids. In one
example, the invention provides a method for delivering a
therapeutic protein into the targeted cell. In another example, the
invention provides a method for delivering a single stranded
nucleic acid (e.g., antisense or ribozymes) or double stranded
nucleic acid (e.g., DNA that can integrate into the cell's genome
or replicate episomally and that can be transcribed) into the
targeted cell.
[0787] In another embodiment, the invention provides a method for
the specific destruction of cells (e.g., the destruction of tumor
cells) by administering polypeptides of the invention (e.g.,
polypeptides of the invention or antibodies of the invention) in
association with toxins or cytotoxic prodrugs.
[0788] By "toxin" is meant compounds that bind and activate
endogenous cytotoxic effector systems, radioisotopes, holotoxins,
modified toxins, catalytic subunits of toxins, or any molecules or
enzymes not normally present in or on the surface of a cell that
under defined conditions cause the cell's death. Toxins that may be
used according to the methods of the invention include, but are not
limited to, radioisotopes known in the art, compounds such as, for
example, antibodies (or complement fixing containing portions
thereof) that bind an inherent or induced endogenous cytotoxic
effector system, thymidine kinase, endonuclease, RNase, alpha
toxin, ricin, abrin, Pseudomonas exotoxin A, diphtheria toxin,
saporin, momordin, gelonin, pokeweed antiviral protein,
alpha-sarcin and cholera toxin. By "cytotoxic prodrug" is meant a
non-toxic compound that is converted by an enzyme, normally present
in the cell, into a cytotoxic compound. Cytotoxic prodrugs that may
be used according to the methods of the invention include, but are
not limited to, glutamyl derivatives of benzoic acid mustard
alkylating agent, phosphate derivatives of etoposide or mitomycin
C, cytosine arabinoside, daunorubisin, and phenoxyacetamide
derivatives of doxorubicin.
Drug Screening
[0789] Further contemplated is the use of the polypeptides of the
present invention, or the polynucleotides encoding these
polypeptides, to screen for molecules which modify the activities
of the polypeptides of the present invention. Such a method would
include contacting the polypeptide of the present invention with a
selected compound(s) suspected of having antagonist or agonist
activity, and assaying the activity of these polypeptides following
binding.
[0790] This invention is particularly useful for screening
therapeutic compounds by using the polypeptides of the present
invention, or binding fragments thereof, in any of a variety of
drug screening techniques. The polypeptide or fragment employed in
such a test may be affixed to a solid support, expressed on a cell
surface, free in solution, or located intracellularly. One method
of drug screening utilizes eukaryotic or prokaryotic host cells
which are stably transformed with recombinant nucleic acids
expressing the polypeptide or fragment. Drugs are screened against
such transformed cells in competitive binding assays. One may
measure, for example, the formulation of complexes between the
agent being tested and a polypeptide of the present invention.
[0791] Thus, the present invention provides methods of screening
for drugs or any other agents which affect activities mediated by
the polypeptides of the present invention. These methods comprise
contacting such an agent with a polypeptide of the present
invention or a fragment thereof and assaying for the presence of a
complex between the agent and the polypeptide or a fragment
thereof, by methods well known in the art. In such a competitive
binding assay, the agents to screen are typically labeled.
Following incubation, free agent is separated from that present in
bound form, and the amount of free or uncomplexed label is a
measure of the ability of a particular agent to bind to the
polypeptides of the present invention.
[0792] Another technique for drug screening provides high
throughput screening for compounds having suitable binding affinity
to the polypeptides of the present invention, and is described in
great detail in European Patent Application 84/03564, published on
Sep. 13, 1984, which is incorporated herein by reference herein.
Briefly stated, large numbers of different small peptide test
compounds are synthesized on a solid substrate, such as plastic
pins or some other surface. The peptide test compounds are reacted
with polypeptides of the present invention and washed. Bound
polypeptides are then detected by methods well known in the art.
Purified polypeptides are coated directly onto plates for use in
the aforementioned drug screening techniques. In addition,
non-neutralizing antibodies may be used to capture the peptide and
immobilize it on the solid support.
[0793] This invention also contemplates the use of competitive drug
screening assays in which neutralizing antibodies capable of
binding polypeptides of the present invention specifically compete
with a test compound for binding to the polypeptides or fragments
thereof. In this manner, the antibodies are used to detect the
presence of any peptide which shares one or more antigenic epitopes
with a polypeptide of the invention.
[0794] Thus, the polypeptides can be used to identify compounds
that modulate receptor activity. Both the receptor protein and
appropriate variants and fragments can be used in highthroughput
screens to assay candidate compounds for the ability to bind to the
receptor. These compounds can be further screened against a
functional receptor to determine the effect of the compound on the
receptor activity. Compounds can be identified that activate
(agonist) or inactivate (antagonist) the receptor to a desired
degree.
[0795] The terms "agonist" and "antagonist" represent compounds
that enhance or diminish a response. As one form of an agonist, the
compound binds to the same site as the endogenous compound and
produces the same type of signal, usually of equal or greater
magnitude than the endogenous agent. Another form of agonist binds
to a different site than the first agonist, producing no signal by
itself, however, an enhanced signal is generated when the
endogenous agent also binds to its site. This is called an
allosteric action. One form of antagonist binds to the site used by
the endogenous agent and diminishes or blocks the signal generated
by the endogenous agent. Another form of antagonist binds to an
allosteric site, similar to the second form of agonist, but
produces a diminished signal generated by the endogenous agent. A
third form of antagonist dissolves in the membrane or crosses the
membrane and intercepts the signal generated by the endogenous
agent within the membrane or on the intracellular side. An
antagonist, accordingly, encompasses negative agonists or "inverse
agonists", having a negative intrinsic activity that reduces the
receptor signal activity relative to the signaling activity
measured in the absence of the inverse agonist. Such an antagonist
is distinguished from an antagonist having no intrinsic activity
and no effect on the receptor's basal activity. Thus, for example,
an inverse agonist could alter the receptor confirmation, thereby
reducing or eliminating interaction with a ligand. See, Milligan et
al., TIPS 16:10 (1995).
[0796] The receptor polypeptides can be used to screen a compound
for the ability to stimulate or inhibit interaction between the
receptor protein and a target molecule that normally interacts with
the receptor protein. The target can be ligand or a component of
the signal pathway with which the receptor protein normally
interacts (for example, a G-protein or other interactor involved in
cAMP or phosphatidylinositol turnover and/or adenylate cyclase, or
phospholipase C activation). The assay includes the steps of
combining the receptor protein with a candidate compound under
conditions that allow the receptor protein or fragment to interact
with the target molecule, and to detect the formation of a complex
between the protein and the target or to detect the biochemical
consequence of the interaction with the receptor protein and the
target, such as any of the associated effects of signal
transduction, such as ion flux, G-protein phosphorylation, cyclic
AMP or phosphatidylinositol turnover, and adenylate cyclase or
phospholipase C activation.
[0797] The receptor polypeptides are useful in cell based assays
when they are overexpressed in a cell. Accordingly, such cells
overexpressing the receptor are useful to identify compounds that
are capable of modulating or compensating for the overexpression.
Cells overexpressing the receptor can be derived from natural
sources or can be created by routine recombinant methods.
[0798] The receptor polypeptides are also useful for screening
compounds in a cell based assay when constitutively activated on a
cell. Such cells expressing constitutively activated receptors are
useful for screening compounds that modulate receptor activation.
Such cells can be derived from natural sources or can be created by
recombinant means that are well known in the art. For example, see
Scheer et al., J. Receptor Signal Transduction Res. 17:57-73
(1997); U.S. Pat. No. 5,750,353.
[0799] Candidate compounds include, for example, (1) peptides such
as soluble peptides, including Ig-tailed fusion peptides and
members of random peptide libraries (see, e.g., Lam et al., Nature
354:82-84 (1991); Houghten et al., Nature 354:84-86 (1991)) and
combinatorial chemistry-derived molecular libraries made of D-
and/or L-configuration amino acids; (2) phosphopeptides (e.g.,
members of random and partially degenerate, directed phosphopeptide
libraries, see, e.g., Songyang et al., Cell 72:767-778 (1993)); (3)
antibodies (e.g., polyclonal, monoclonal, humanized,
anti-idiotypic, chimeric, intrabodies, and single chain antibodies,
as well as Fab, F(ab).sub.2, Fab expression library fragments, and
epitope-binding fragments of antibodies); and (4) small organic and
inorganic molecules (e.g., molecules obtained from combinatorial
and natural product libraries).
[0800] One candidate compound is a soluble full-length receptor or
fragment that competes for ligand binding. Other candidate
compounds include mutant receptors or appropriate fragments
containing mutations that affect receptor function and thus compete
for ligand. Accordingly, a fragment that competes for ligand, for
example with a higher affinity, or a fragment that binds ligand but
does not allow release, is encompassed by the invention.
[0801] The invention provides other end points to identify
compounds that modulate (stimulate or inhibit) receptor activity.
The assays typically involve an assay of events in the signal
transduction pathway that indicate receptor activity. Thus, the
expression of genes that are up- or down-regulated in response to
the receptor protein dependent signal cascade can be assayed. In
one embodiment, the regulatory region of such genes can be operably
linked to a marker that is easily detectable, such as luciferase.
Alternatively, phosphorylation of the receptor protein, or a
receptor protein target, could also be measured.
[0802] It is also understood that a disorder caused by aberrant
levels or mutations in the protein can be used as a basis for an
endpoint. Accordingly, specific deviations in the development or
course of the disorder in response to a compound that acts on the
receptor can serve as an endpoint.
[0803] Any of the biological or biochemical functions mediated by
the receptor can be used as an endpoint assay. These include all of
the biochemical or biochemical/biological events described herein,
in the references cited herein, incorporated by reference for these
endpoint assay targets, and other functions known to those of
ordinary skill in the art.
[0804] Binding and/or activating compounds can also be screened by
using chimeric receptor proteins in which the amino terminal
extracellular domain, or parts thereof, the entire transmembrane
domain or subregions, such as any of the seven transmembrane
segments or any of the intracellular or extracellular loops, and
the carboxy terminal intracellular domain, or parts thereof, can be
replaced by heterologous domains or subregions. For example, a
G-protein-binding region can be used that interacts with a
different G-protein than that which is recognized by the native
receptor. Accordingly, a different set of signal transduction
components is available as an end-point assay for activation.
Alternatively, the entire transmembrane portion or subregions (such
as transmembrane segments or intracellular or extracellular loops)
can be replaced with the entire transmembrane portion or subregions
specific to a host cell that is different from the host cell from
which the amino terminal extracellular domain and/or the G-protein
binding region are derived. This allows for assays to be performed
in other than the specific host cell from which the receptor is
derived. Alternatively, the amino terminal extracellular domain
(and/or other ligand-binding regions) could be replaced by a domain
(and/or other binding region) binding a different ligand, thus,
providing an assay for test compounds that interact with the
heterologous amino terminal extracellular domain (or region) but
still cause signal transduction. Finally, activation can be
detected by a reporter gene containing an easily detectable coding
region operably linked to a transcriptional regulatory sequence
that is part of the native signal transduction pathway.
[0805] The receptor polypeptides are also useful in competition
binding assays in methods designed to discover compounds that
interact with the receptor. Thus, a compound is exposed to a
receptor polypeptide under conditions that allow the compound to
bind or to otherwise interact with the polypeptide. Soluble
receptor polypeptide is also added to the mixture. If the test
compound interacts with the soluble receptor polypeptide, it
decreases the amount of complex formed or activity from the
receptor target. This type of assay is particularly useful in cases
in which compounds are sought that interact with specific regions
of the receptor. Thus, the soluble polypeptide that competes with
the target receptor region is designed to contain peptide sequences
corresponding to the target region.
[0806] To perform cell-free drug screening assays, it is desirable
to immobilize either the receptor protein, or fragment, or its
target molecule to facilitate separation of complexes from
uncomplexed forms of one or both of the proteins, as well as to
accommodate automation of the assay.
[0807] Techniques for immobilizing G-proteins on matrices can be
used in the drug screening assays. In one embodiment, a fusion
protein can be provided which adds a domain that allows the protein
to be bound to a matrix. For example,
glutathione-Stransferase/G-protein Chemokine Receptor (CCR5) fusion
proteins can be adsorbed onto glutathione sepharose beads (Sigma
Chemical, St. Louis, Mo.) or glutathione derivatized microtitre
plates, which are then combined with the cell lysates (e.g.,
.sup.35S-labeled) and the candidate compound, and the mixture
incubated under conditions conducive to complex formation (e.g., at
physiological conditions for salt and pH). Following incubation,
the beads are washed to remove any unbound label, and the matrix
immobilized and radiolabel determined directly, or in the
supernatant after the complexes are dissociated. Alternatively, the
complexes can be dissociated from the matrix, separated by
SDS-PAGE, and the level of receptor-binding protein found in the
bead fraction quantitated from the gel using standard
electrophoretic techniques, For example, either the polypeptide or
its target molecule can be immobilized utilizing conjugation of
biotin and streptavidin using techniques well known in the art.
Alternatively, antibodies reactive with the protein but which do
not interfere with binding of the protein to its target molecule
can be derivatized to the wells of the plate, and the protein
trapped in the wells by antibody conjugation. Preparations of a
receptor-binding protein and a candidate compound are incubated in
the receptor protein-presenting wells and the amount of complex
trapped in the well can be quantitated. Methods for detecting such
complexes, in addition to those described above for the
GST-immobilized complexes, include immunodetection of complexes
using antibodies reactive with the receptor protein target
molecule, or which are reactive with receptor protein and compete
with the target molecule; as well as enzyme-linked assays which
rely on detecting an enzymatic activity associated with the target
molecule.
[0808] Modulators of receptor protein activity identified according
to these drug screening assays can be used to treat a subject with
a disorder mediated by the receptor pathway, by treating cells that
express the receptor protein. These methods of treatment include
the steps of administering the modulators of protein activity in a
pharmaceutical composition as described herein, to a subject in
need of such treatment.
Antisense and Ribozyme (Antagonists)
[0809] In specific embodiments, antagonists according to the
present invention are nucleic acids corresponding to the sequences
contained in SEQ ID NO:1, or the complementary strand thereof,
and/or to nucleotide sequences contained in the deposited clone
97183. In one embodiment, antisense sequence is generated
internally, by the organism, in another embodiment, the antisense
sequence is separately administered (see, for example, O'Connor,
J., Neurochem. 56:560 (1991). Oligodeoxynucleotides as Antisense
Inhibitors of Gene Expression, CRC Press, Boca Raton, Fla. (1988).
Antisense technology can be used to control gene expression through
antisense DNA or RNA, or through triple-helix formation. Antisense
techniques are discussed for example, in Okano, J., Neurochem.
56:560 (1991); Oligodeoxynucleotides as Antisense Inhibitors of
Gene Expression, CRC Press, Boca Raton, Fla. (1988). Triple helix
formation is discussed in, for instance, Lee et al., Nucleic Acids
Research 6:3073 (1979); Cooney et al., Science 241:456 (1988); and
Dervan et al., Science 251:1300 (1991). The methods are based on
binding of a polynucleotide to a complementary DNA or RNA.
[0810] For example, the use of c-myc and c-myb antisense RNA
constructs to inhibit the growth of the non-lymphocytic leukemia
cell line HL-60 and other cell lines was previously described.
(Wickstrom et al. (1988); Anfossi et al. (1989)). These experiments
were performed in vitro by incubating cells with the
oligoribonucleotide. A similar procedure for in vivo use is
described in WO 91/15580. Briefly, a pair of oligonucleotides for a
given antisense RNA is produced as follows: A sequence
complimentary to the first 15 bases of the open reading frame is
flanked by an EcoR1 site on the 5 end and a HindIII site on the 3
end. Next, the pair of oligonucleotides is heated at 90.degree. C.
for one minute and then annealed in 2.times. ligation buffer (20 mM
TRIS HCl pH 7.5, 10 mM MgCl2, 10 MM dithiothreitol (DTT) and 0.2 mM
ATP) and then ligated to the EcoR1/Hind III site of the retroviral
vector PMV7 (WO 91/15580).
[0811] For example, the 5' coding portion of a polynucleotide that
encodes the mature polypeptide of the present invention may be used
to design an antisense RNA oligonucleotide of from about 10 to 40
base pairs in length. A DNA oligonucleotide is designed to be
complementary to a region of the gene involved in transcription
thereby preventing transcription and the production of the
receptor. The antisense RNA oligonucleotide hybridizes to the mRNA
in vivo and blocks translation of the mRNA molecule into receptor
polypeptide.
[0812] In one embodiment, the G-protein Chemokine Receptor (CCR5)
antisense nucleic acid of the invention is produced intracellularly
by transcription from an exogenous sequence. For example, a vector
or a portion thereof, is transcribed, producing an antisense
nucleic acid (RNA) of the invention. Such a vector would contain a
sequence encoding the G-protein Chemokine Receptor (CCR5) antisense
nucleic acid. Such a vector can remain episomal or become
chromosomally integrated, as long as it can be transcribed to
produce the desired antisense RNA. Such vectors can be constructed
by recombinant DNA technology methods standard in the art. Vectors
can be plasmid, viral, or others known in the art, used for
replication and expression in vertebrate cells. Expression of the
sequence encoding G-protein Chemokine Receptor (CCR5), or fragments
thereof, can be by any promoter known in the art to act in
vertebrate, preferably human cells. Such promoters can be inducible
or constitutive. Such promoters include, but are not limited to,
the SV40 early promoter region (Bernoist and Chambon, Nature
29:304-310 (1981), the promoter contained in the 3' long terminal
repeat of Rous sarcoma virus (Yamamoto et al., Cell 22:787-797
(1980), the herpes thymidine promoter (Wagner et al., Proc. Natl.
Acad. Sci. U.S.A. 78:1441-1445 (1981), the regulatory sequences of
the metallothionein gene (Brinster, et al., Nature 296:39-42
(1982)), etc.
[0813] The antisense nucleic acids of the invention comprise a
sequence complementary to at least a portion of an RNA transcript
of a G-protein Chemokine Receptor (CCR5) gene. However, absolute
complementarity, although preferred, is not required. A sequence
"complementary to at least a portion of an RNA," referred to
herein, means a sequence having sufficient complementarity to be
able to hybridize with the RNA, forming a stable duplex; in the
case of double stranded G-protein Chemokine Receptor (CCR5)
antisense nucleic acids, a single strand of the duplex DNA may thus
be tested, or triplex formation may be assayed. The ability to
hybridize will depend on both the degree of complementarity and the
length of the antisense nucleic acid. Generally, the larger the
hybridizing nucleic acid, the more base mismatches with a G-protein
Chemokine Receptor (CCR5) RNA it may contain and still form a
stable duplex (or triplex as the case may be). One skilled in the
art can ascertain a tolerable degree of mismatch by use of standard
procedures to determine the melting point of the hybridized
complex.
[0814] Oligonucleotides that are complementary to the 5' end of the
message, e.g., the 5' untranslated sequence up to and including the
AUG initiation codon, should work most efficiently at inhibiting
translation. However, sequences complementary to the 3'
untranslated sequences of mRNAs have been shown to be effective at
inhibiting translation of mRNAs as well. See generally, Wagner, R.,
1994, Nature 372:333-335. Thus, oligonucleotides complementary to
either the 5'- or 3'-non-translated, non-coding regions of
G-protein Chemokine Receptor (CCR5) shown in FIGS. 1A-B or within
the coding region of the deposited clone could be used in an
antisense approach to inhibit translation of endogenous G-protein
Chemokine Receptor (CCR5) mRNA. Oligonucleotides complementary to
the 5' untranslated region of the mRNA should include the
complement of the AUG start codon. Antisense oligonucleotides
complementary to mRNA coding regions are less efficient inhibitors
of translation but could be used in accordance with the invention.
Whether designed to hybridize to the 5'-, 3'- or coding region of
G-protein Chemokine Receptor (CCR5) mRNA or within the coding
region of the deposited clone, antisense nucleic acids should be at
least six nucleotides in length, and are preferably
oligonucleotides ranging from 6 to about 50 nucleotides in length.
In specific aspects the oligonucleotide is at least 10 nucleotides,
at least 17 nucleotides, at least 25 nucleotides or at least 50
nucleotides.
[0815] The polynucleotides of the invention can be DNA or RNA or
chimeric mixtures or derivatives or modified versions thereof,
single-stranded or double-stranded. The oligonucleotide can be
modified at the base moiety, sugar moiety, or phosphate backbone,
for example, to improve stability of the molecule, hybridization,
etc. The oligonucleotide may include other appended groups such as
peptides (e.g., for targeting host cell receptors in vivo), or
agents facilitating transport across the cell membrane (see, e.g.,
Letsinger et al., 1989, Proc. Natl. Acad. Sci. U.S.A. 86:6553-6556;
Lemaitre et al., 1987, Proc. Natl. Acad. Sci. 84:648-652; PCT
Publication No. WO88/09810, published Dec. 15, 1988) or the
blood-brain barrier (see, e.g., PCT Publication No. WO89/10134,
published Apr. 25, 1988), hybridization-triggered cleavage agents.
(See, e.g., Krol et al., 1988, BioTechniques 6:958-976) or
intercalating agents. (See, e.g., Zon, 1988, Pharm. Res.
5:539-549). To this end, the oligonucleotide may be conjugated to
another molecule, e.g., a peptide, hybridization triggered
cross-linking agent, transport agent, hybridization-triggered
cleavage agent, etc.
[0816] The antisense oligonucleotide may comprise at least one
modified base moiety which is selected from the group including,
but not limited to, 5-fluorouracil, 5-bromouracil, 5-chlorouracil,
5-iodouracil, hypoxanthine, xantine, 4-acetylcytosine,
5-(carboxyhydroxylmethyl) uracil,
5-carboxymethylaminomethyl-2-thiouridine,
5-carboxymethylaminomethyluracil, dihydrouracil,
beta-D-galactosylqueosine, inosine, N6-isopentenyladenine,
1-methylguanine, 1-methylinosine, 2,2-dimethylguanine,
2-methyladenine, 2-methylguanine, 3-methylcytosine,
5-methylcytosine, N6-adenine, 7-methylguanine,
5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil,
beta-D-mannosylqueosine, 5'-methoxycarboxymethyluracil,
5-methoxyuracil, 2-methylthio-N6-isopentenyladenine,
uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine,
2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil,
5-methyluracil, uracil-5-oxyacetic acid methylester,
uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil,
3-(3-amino-3-N-2-carboxypropyl) uracil, (acp3)w, and
2,6-diaminopurine.
[0817] The antisense oligonucleotide may also comprise at least one
modified sugar moiety selected from the group including, but not
limited to, arabinose, 2-fluoroarabinose, xylulose, and hexose.
[0818] In yet another embodiment, the antisense oligonucleotide
comprises at least one modified phosphate backbone selected from
the group including, but not limited to, a phosphorothioate, a
phosphorodithioate, a phosphoramidothioate, a phosphoramidate, a
phosphordiamidate, a methylphosphonate, an alkyl phosphotriester,
and a formacetal or analog thereof.
[0819] In yet another embodiment, the antisense oligonucleotide is
an a-anomeric oligonucleotide. An a-anomeric oligonucleotide forms
specific double-stranded hybrids with complementary RNA in which,
contrary to the usual b-units, the strands run parallel to each
other (Gautier et al., 1987, Nucl. Acids Res. 15:6625-6641). The
oligonucleotide is a 2'-0-methylribonucleotide (Inoue et al., 1987,
Nucl. Acids Res. 15:6131-6148), or a chimeric RNA-DNA analogue
(Inoue et al., 1987, FEBS Lett. 215:327-330).
[0820] Polynucleotides of the invention may be synthesized by
standard methods known in the art, e.g. by use of an automated DNA
synthesizer (such as are commercially available from Biosearch,
Applied Biosystems, etc.). As examples, phosphorothioate
oligonucleotides may be synthesized by the method of Stein et al.
(1988, Nucl. Acids Res. 16:3209), methylphosphonate
oligonucleotides can be prepared by use of controlled pore glass
polymer supports (Sarin et al., 1988, Proc. Natl. Acad. Sci. U.S.A.
85:7448-7451), etc.
[0821] While antisense nucleotides complementary to the G-protein
Chemokine Receptor (CCR5) coding region sequence could be used,
those complementary to the transcribed untranslated region are most
preferred.
[0822] Potential antagonists according to the invention also
include catalytic RNA, or a ribozyme (See, e.g., PCT International
Publication WO 90/11364, published Oct. 4, 1990; Sarver et al,
Science 247:1222-1225 (1990). While ribozymes that cleave mRNA at
site specific recognition sequences can be used to destroy
G-protein Chemokine Receptor (CCR5) mRNAs, the use of hammerhead
ribozymes is preferred. Hammerhead ribozymes cleave mRNAs at
locations dictated by flanking regions that form complementary base
pairs with the target mRNA. The sole requirement is that the target
mRNA have the following sequence of two bases: 5'-UG-3'. The
construction and production of hammerhead ribozymes is well known
in the art and is described more fully in Haseloff and Gerlach,
Nature 334:585-591 (1988). There are numerous potential hammerhead
ribozyme cleavage sites within the nucleotide sequence of G-protein
Chemokine Receptor (CCR5) (FIGS. 1A-B or the sequence of the
deposited clone). Preferably, the ribozyme is engineered so that
the cleavage recognition site is located near the 5' end of the
G-protein Chemokine Receptor (CCR5) mRNA; i.e., to increase
efficiency and minimize the intracellular accumulation of
non-functional mRNA transcripts.
[0823] As in the antisense approach, the ribozymes of the invention
can be composed of modified oligonucleotides (e.g. for improved
stability, targeting, etc.) and should be delivered to cells which
express G-protein Chemokine Receptor (CCR5) in vivo. DNA constructs
encoding the ribozyme may be introduced into the cell in the same
manner as described above for the introduction of antisense
encoding DNA. A preferred method of delivery involves using a DNA
construct "encoding" the ribozyme under the control of a strong
constitutive promoter, such as, for example, pol III or pol II
promoter, so that transfected cells will produce sufficient
quantities of the ribozyme to destroy endogenous G-protein
Chemokine Receptor (CCR5) messages and inhibit translation. Since
ribozymes unlike antisense molecules, are catalytic, a lower
intracellular concentration is required for efficiency.
[0824] Antagonist/agonist compounds may be employed to inhibit the
cell growth and proliferation effects of the polypeptides of the
present invention on neoplastic cells and tissues, i.e. stimulation
of angiogenesis of tumors, and, therefore, retard or prevent
abnormal cellular growth and proliferation, for example, in tumor
formation or growth.
[0825] The antagonist/agonist may also be employed to prevent
hyper-vascular diseases, and prevent the proliferation of
epithelial lens cells after extracapsular cataract surgery.
Prevention of the mitogenic activity of the polypeptides of the
present invention may also be desirous in cases such as restenosis
after balloon angioplasty.
[0826] The antagonist/agonist may also be employed to prevent the
growth of scar tissue during wound healing.
[0827] The antagonist/agonist may also be employed to treat the
diseases described herein.
[0828] Thus, the invention provides a method of treating or
preventing diseases, disorders, and/or conditions, including but
not limited to the diseases, disorders, and/or conditions listed
throughout this application, associated with overexpression of a
polynucleotide of the present invention by administering to a
patient (a) an antisense molecule directed to the polynucleotide of
the present invention, and/or (b) a ribozyme directed to the
polynucleotide of the present invention.
Use of Transmembrane Fragments as Antagonists/Inhibitors
[0829] In specific embodiments, the present invention relates to
modulating, especially inhibiting, biological activities of
G-protein Chemokine Receptor (CCR5) by exposing it to molecules
which interfere with correct receptor assembly. In particular, the
invention relates to isolated fragments or peptides of the
transmembrane domain of G-protein Chemokine Receptor (CCR5) that
inhibit G-protein Chemokine Receptor mediated signal transduction
or ligand-binding. In certain embodiments, charged residues are
added at one terminus of the fragment to promote correct
orientation of the fragment in the membrane.
[0830] It has been demonstrated that G-protein coupled receptor
(GPCR) transmembrane (TM) domain segments interact in a specific
way during the assembly of receptor molecules. These interactions
do not lead to a rigid structure because some flexibility is
required for conformational changes following ligand binding, which
allow the molecule to signal from the cell surface to the
intracellular parts. It was also demonstrated for several GPCRs
that the transmembrane domain is involved in ligand binding and
thus it contains openings that allow penetration of the ligands.
Reports that expression of missing transmembrane domains rescues
inactive truncated V2 vasopressin, beta-adrenergic and muscarinic
M3 receptors (Schoneberg et al. EMBO J. 15:1283 (1996); Wong et
al., J. Biol. Chem. 265:6219 (1990); Monnot et al., J. Biol. Chem.
271:1507 (1996); Gudermann et al., Annu. Rev. Neurosci. 20:399
(1997); Osuga et al., J. Biol. Chem. 272:25006 (1997)) suggested
peptide derived from the sixth transmembrane domain of
P2-adrenergic receptor was found to inhibit receptor activation and
dimerization (Hebert et al., J. Biol. Chem., 271(27):16384-92
(1996)). Thus, GPCR function can be rescued by targeting
intramembrane interactions of GPCRs.
[0831] Additionally, GPCR function can be inhibited by targeting
intramembrane interactions. For example, fragments corresponding to
predicted TM segments of CCR5, which functions as a coreceptor
during entry of HIV into cells, yielded potent inhibition of HIV
entry without apparent toxicity to the cells. (See WO 99/43711) The
usefulness of the method was also demonstrated by specifically
targeting CXCR4, which functions as a co-receptor during the cell
entry of T-cell tropic strains of HIV-1. Fragments containing 20-25
amino acid residues inhibited receptor signaling and HIV-1
infection in vitro at concentration as low as 0.2 micromolar. (See
WO 99/43711).
[0832] The hydrophobic and/or amphipathic nature of the
transmembrane fragments allows their penetration into the bilayer.
Further, orientation inside the membrane can be controlled by
addition of charged residues to the terminus that is exposed at the
extracellular side of the membrane in the intact receptor.
Insertion into the membrane is tested by fluorescent microscopy of
labeled peptide analogs using methodology known to those of
ordinary skill in the art, and as described in WO 99/43711.
[0833] In a particular embodiment, the invention encompasses
transmembrane fragments that modulate, and preferably inhibit the
biological properties and activities of G-protein Chemokine
Receptor (CCR5), by targeting the transmembrane domain of this
receptor. In a further embodiment, the invention specifically
comprises methods for disrupting G-protein Chemokine Receptor
(CCR5) function by using these antagonists.
[0834] Chemical or recombinant DNA technology may be used to obtain
G-protein Chemokine Receptor (CCR5) transmembrane fragments, which
preferably are as small as possible while still retaining
sufficiently high affinity for binding to, or association with,
G-protein Chemokine Receptor. Non-limiting examples of G-protein
Chemokine Receptor (CCR5) polypeptides include fragments of 10 to
50 amino acids corresponding to at least one transmembrane segment
of segments 1-7.
[0835] In another embodiment, the invention encompasses an isolated
G-protein Chemokine Receptor-modulating molecule comprising a
fragment, a peptide, or peptidomimetic that is a structural analog
of a portion of a transmembrane segment of G-protein Chemokine
Receptor (CCR5), wherein said molecule has an extracellular end and
an intracellular end and said molecule has at said extracellular
end a negatively charged group and at said intracellular end a
neutral charge under physiological conditions; said molecule
spontaneously inserts into a membrane in the same orientation as
the transmembrane domain from which it is derived; and said
molecule modulates a biological property or activity of said
G-protein Chemokine Receptor.
[0836] In a particular embodiment, the molecules contain a
hydrophilic, negatively charged non-peptidic head group and an
uncharged tail, which assures correct orientation of the molecule
in the cell membrane. In another embodiment, the negatively charged
head group is one or more acidic amino acids.
[0837] The G-protein Chemokine Receptor (CCR5) activity modulated
by said fragment includes inhibition of G-protein Chemokine
Receptor-mediated intracellular Ca.sup.2+ release and inhibition of
G-protein Chemokine Receptor-mediated HIV infection. The G-protein
Chemokine Receptor (CCR5) activity modulated by said peptide also
includes binding of a G-protein Chemokine Receptor (CCR5) ligand.
Additional G-protein Chemokine Receptor (CCR5) activities modulated
by said peptide include those in the Description and Examples
herein.
[0838] In another embodiment, the invention comprises methods of
modulating the biological activity of a G-protein Chemokine
Receptor (CCR5) by contacting a cell that expresses G-protein
Chemokine Receptor (CCR5) with a molecule of the invention. In one
method, the modulated biological activity is inhibition of
G-protein Chemokine Receptor-mediated HIV infection. In another
method, the modulated biological activity is inhibition of
G-protein Chemokine Receptor-mediated intracellular Ca.sup.2+
release. Other activities modulated include those described
elsewhere herein.
[0839] Another embodiment is a method of inhibiting HIV-1
infection, comprising contacting a cell that expresses G-protein
Chemokine Receptor (CCR5) which binds HIV-1 with a molecule that
comprises a polypeptide fragment, a peptide, or peptidomimetic that
is a structural analog of a portion of the transmembrane domain of
said G-protein Chemokine Receptor (CCR5), wherein contacting the
cell with said molecule inhibits HIV-1 infection. The peptide or
peptidomimetic may be a structural analog of a portion of a
transmembrane domain of G-protein Chemokine Receptor.
[0840] In one embodiment, the molecules of the present invention
mimic a transmembrane segment of G-protein Chemokine Receptor
(CCR5) and block self-assembly of the receptor, possibly by
competitive inhibition with the native TM segment. They thereby
block or inhibit signal transduction in the affected cell.
[0841] The invention also includes peptide analogs and
peptidomimetics which possess beneficial properties such as
increased half-life, lack of immunogenicity, and the ability to
cross the blood-brain barrier.
[0842] The peptide analogs of the invention mediate the chemical
and/or biological effects of hormone agonists/antagonists or other
peptides. They are useful for the development of pharmaceutical,
therapeutic, and diagnostic techniques. Accordingly, the invention
also provides methods for producing a prophylactic or therapeutic
response in a mammal by administering to the mammal a
pharmaceutically effective amount of one or more peptide analogs of
the invention. In preferred embodiments, the present invention
provides methods for producing such responses by modulating the
activity of G-protein Chemokine Receptor (CCR5) by administering an
effective amount of one or more peptide analogs of the
invention.
[0843] In another embodiment, more than one peptide of the
invention are administered as a cocktail to modulate the biological
activity of G-protein Chemokine Receptor.
[0844] The term "G-protein Chemokine Receptor (CCR5) transmembrane
peptide" can include a fragment of the transmembrane domain, a
transmembrane segment, a fragment of a transmembrane segment,
and/or a homologous peptide thereof. Preferred fragments include
those of at least 4-50, and preferably at least 4-30, and
preferably at least 10-30 amino acids in length, or any range
therein. Further preferred fragments include those of 5, 6, 7, 8,
9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25,
26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42,
43, 44, 45, 46, 47, 48, 49, or 50 amino acids in length. Also
included are any corresponding sequences having conservative amino
acid substitutions.
[0845] Sample transmembrane fragments of the invention include, but
are not limited to, any fragment described herein. A preferred
transmembrane fragment of the present invention, when contacted
with a cell or membrane structure (e.g., liposome) that contains
biologically active G-protein Chemokine Receptor (CCR5), modulates
the biological activity of said G-protein Chemokine Receptor (CCR5)
in vitro, in vivo, or in situ. The concentration of the fragment in
a solution that contacts the cell in vivo (e.g., blood plasma or
interstitial fluid) or in vitro (e.g., culture medium) is between 1
nanomolar and 50 micromolar, preferably between 1 nanomolar and 1
micromolar, and most preferably less than 5 micromolar.
[0846] "Negatively charged" refers to those amino acids, amino acid
derivatives, amino acid mimetics and chemical moieties that are
negatively charged at physiological pH. Negatively charged amino
acids include, for example Asp and Glu. An "acidic" residue is a
residue that is negatively charged at physiological pH.
[0847] "Positively charged" refers to those amino acids, amino acid
derivatives, amino acid mimetics and chemical moieties that are
positively charged at physiological pH. Positively charged amino
acids include, for example, Lys and Arg. A "basic residue" is a
residue that is positively charged at physiological pH.
[0848] "Neutral" refers to those amino acids, amino acid
derivatives, amino acid mimetics and chemical moieties that are
neither positively nor negatively charged at physiological pH.
[0849] The term "modulates a biological property or activity" means
that in the presence of a test transmembrane fragment a measurable
biological parameter or event is increased or decreased relative to
a control in the absence of said peptide. Examples of biological
property or activity include: conformation of G-protein Chemokine
Receptor (CCR5), association of the G-protein Chemokine Receptor
(CCR5) with other molecules, signal transduction, extracellular
secretion of cellular proteins, conformational changes in proteins,
changes in enzymatic activity, changes in metabolic activity,
changes in affinity for a ligand, changes in levels of viral
infection, changes in vasodilation, modulation of heart rate,
modulation of bronchodilation, modulation of endocrine secretions,
and modulation of gut peristalsis. Note that the G-protein
Chemokine Receptor (CCR5) biological activity need not be one that
is limited to the precise in vivo role performed by the G-protein
Chemokine Receptor. The term also covers G-protein Chemokine
Receptor (CCR5) properties, such as viral protein binding, that are
not part of the in vivo biological role of the G-protein Chemokine
Receptor. It further covers intrinsic properties of G-protein
Chemokine Receptor (CCR5) that are only disclosed by experimental
manipulation in the laboratory, such as the ability of G-protein
Chemokine Receptor (CCR5) in artificial bilayers (e.g., liposomes)
to interact with G-protein Chemokine Receptor (CCR5) ligands.
[0850] "Signal transduction" is the process by which binding of a
ligand to a receptor is translated into physiological change. In
general, binding of a ligand to a receptor causes a change in a
physical property of the receptor, for example a change in its
conformation, or its orientation, or in its ability to bind other
ligands. This change in a physical property can result, directly or
indirectly, in increased or decreased ion fluxes, increased or
decreased enzymatic activity, increased or decreased
phosphorylation, increased or decreased translocation of the
receptor or of any molecule (e.g., an inositol moiety or a
G-protein subunit) from one cellular compartment to another.
[0851] "G-protein Chemokine Receptor (CCR5) ligands" refers to
biological molecules that bind G-protein Chemokine Receptor (CCR5)
in vitro, in situ, or in vivo, and may include hormones,
neurotransmitters, viruses or receptor-binding domains thereof,
G-proteins, opsins, rhodopsins, nucleosides, nucleotides,
coagulation cascade factors, odorants or pheromones, toxins, colony
stimulating factors, platelet activating factors, neuroactive
peptides, neurohumor, or any biologically active compounds, such as
drugs or synthetic or naturally occurring compounds.
[0852] The phrase "inhibits HIV infection" means that a peptide of
the invention inhibits binding of a HIV to G-protein Chemokine
Receptor (CCR5) or inhibits a G-protein Chemokine Receptor (CCR5)
biological activity that mediates the entry and successful
reproduction of a HIV virus into a G-protein Chemokine
Receptor-expressing cell.
[0853] G-protein Chemokine Receptor (CCR5) polypeptides of the
present invention, or nucleic acids encoding therefor, include a
finite set of substantially corresponding sequences as substitution
peptides or polynucleotide which can be routinely obtained by one
of ordinary skill in the art, without undue experimentation, based
on the teachings and guidance presented herein. For a detailed
description of protein chemistry and structure, see Schulz et al.,
PRINCIPLES OF PROTEIN STRUCTURE, Springer-Verlag, New York, 1978,
and Creighton, T. E., PROTEINS: STRUCTURE AND MOLECULAR PROPERTIES,
W. H. Freeman & Co., San Francisco, 1983, which are hereby
incorporated by reference. For a presentation of nucleotide
sequence substitutions, such as codon preferences, see Ausubel et
al, supra, at sections A.1.1-A.1.24, and Sambrook et al., supra, at
Appendices C and D.
[0854] G-protein Chemokine Receptor (CCR5) polypeptides include
homologous sequences and/or fragments of the transmembrane domain,
in particular, at least one of transmembrane segment 1-7 of
G-protein Chemokine Receptor (CCR5) or homologs thereof.
[0855] However, in the context of the present invention, G-protein
Chemokine Receptor (CCR5) polypeptides of at least 15-20 amino
acids are preferred such that the G-protein Chemokine Receptor
(CCR5) polypeptides are able to span the lipid bilayer.
[0856] It is particularly preferred that peptides of the invention
be selected or modified so that one end is charged and the other is
neutral under physiological conditions. This is so that the peptide
spontaneously inserts into a membrane. It is of particular
importance that the peptide insert in the same orientation as the
transmembrane G-protein Chemokine Receptor (CCR5) domain from which
it is derived.
[0857] Peptides of the invention can be derived from any of the 7
TM segments. The amino acid positions of the TM segments can be
determined using molecular modeling, optionally combined with
hydrophobicity analysis (see Table 1), and/or fitting to model
helices, as non-limiting examples. Such modeling can be
accomplished according to known methods, for example, ECEPP,
INSIGHT, DISCOVER, CHEM-DRAW, AMBER, FRODO, and CHEM-X. Such
algorithms compare transmembrane domains and segments between
related GPCRs, determine probable energy-minimized structures and
define alternative transmembrane sequences.
[0858] Fragments of the G-protein Coupled Chemokine Receptor
transmembrane domain which are useful as antagonists comprise, or
alternatively consist of, the following portions of SEQ ID NO:2 or
of the polypeptide encoded by the deposited clone:
[0859] Segment 1: amino acids 31-58, 32-58, 33-58, 34-58, 35-58,
36-58, 37-58, 38-58, 31-57, 32-57, 33-57, 34-57, 35-57, 36-57,
37-57, 31-56, 32-56, 33-56, 34-56, 35-56, 36-56, 31-55, 32-55,
33-55, 34-55, 35-55, 31-54, 32-54, 33-54, 34-54, 31-53, 32-53,
33-53, 31-52, 32-52, 31-51 of SEQ ID NO:2 or of the polypeptide
encoded by the deposited clone, or any combination thereof,
preferably at least 15 amino acids in length;
[0860] Segment 2: amino acids 68-97, 69-97, 70-97, 71-97, 72-97,
73-97, 74-97, 75-97, 76-97, 68-96, 69-96, 70-96, 71-96, 72-96,
73-96, 74-96, 75-96, 76-96, 68-95, 69-95, 70-95, 71-95, 72-95,
73-95, 74-95, 75-95, 68-94, 69-94, 70-94, 71-94, 72-94, 73-94,
74-94, 68-93, 69-93, 70-93, 71-93, 72-93, 73-93, 68-92, 69-92,
70-92, 71-92, 72-92, 68-91, 69-91, 70-91, 71-91, 68-90, 69-90,
70-90, 68-89, 69-89, 68-88 of SEQ ID NO:2 or of the polypeptide
encoded by the deposited clone, or any combination thereof,
preferably at least 15 amino acids in length;
[0861] Segment 3: amino acids 103-124, 104-124, 105-124, 106-124,
107-124, 108-124, 109-124, 103-123, 103-122, 103-121, 103-120,
103-119, 103-118 of SEQ ID NO:2 or of the polypeptide encoded by
the deposited clone, or any combination thereof, preferably at
least 15 amino acids in length;
[0862] Segment 4: amino acids 142-169, 143-169, 144-169, 145-169,
146-169, 147-169, 148-169, 149-169, 142-168, 143-168, 144-168,
145-168, 146-168, 147-168, 148-168, 142-167, 143-167, 144-167,
145-167, 146-167, 147-167, 142-166, 143-166, 144-166, 145-166,
146-166, 142-165, 143-165, 144-165, 145-165, 142-164, 143-164,
144-164, 142-163, 143-163, 142-163 of SEQ ID NO:2 or of the
polypeptide encoded by the deposited clone, or any combination
thereof, preferably at least 15 amino acids in length;
[0863] Segment 5: amino acids 196-223, 197-223, 198-223, 199-223,
200-223, 201-223, 202-223, 203-223, 196-222, 197-222, 198-222,
199-222, 200-222, 201-222, 202-222, 196-221, 197-221, 198-221,
199-221, 200-221, 201-221, 196-220, 197-220, 198-220, 199-220,
200-220, 196-219, 197-219, 198-219, 199-219, 196-218, 197-218,
198-218, 196-217, 197-217, 196-216 of SEQ ID NO:2 or of the
polypeptide encoded by the deposited clone, or any combination
thereof, preferably at least 15 amino acids in length,
[0864] Segment 6: amino acids 236-260, 237-260, 238-260, 239-260,
240-260, 236-259, 237-259, 238-259, 239-259, 236-258, 237-258,
238-258, 236-257, 237-257, 236-256 of SEQ ID NO:2 or of the
polypeptide encoded by the deposited clone, or any combination
thereof, preferably at least 15 amino acids in length;
[0865] Segment 7: amino acids 275-305, 276-305, 277-305, 278-305,
279-305, 280-305, 281-305, 282-305, 283-305, 284-305, 285-305,
275-304, 276-304, 277-304, 278-304, 279-304, 280-304, 281-304,
282-304, 283-304, 284-304, 275-303, 276-303, 277-303, 278-303,
279-303, 280-303, 281-303, 282-303, 283-303, 275-302, 276-302,
277-302, 278-302, 279-302, 280-302, 281-302, 282-302, 275-301,
276-301, 277-301, 278-301, 279-301, 280-301, 281-301, 275-300,
276-300, 277-300, 278-300, 279-300, 280-300, 275-299, 276-299,
277-299, 278-299, 279-299, 275-298, 276-298, 277-298, 278-298,
275-297, 276-297, 277-297, 275-296, 276-296, 275-295 of SEQ ID NO:2
or of the polypeptide encoded by the deposited clone, or any
combination thereof, preferably at least 15 amino acids in
length;
[0866] The CCR5 fragments disclosed in WO 99/43711 are specifically
excluded from the embodiments in this section.
[0867] Negatively charged amino acids, such as Asp or Glu, may be
substituted or added at the extracellular end of the fragment. The
number of negatively charged amino acids is typically 1, 2, or 3.
Neutral amino acids may be substituted or added at the
intracellular end of the fragment. See, also, Example 57.
Other Activities
[0868] A polypeptide, polynucleotide, agonist, or antagonist of the
present invention, as a result of the ability to stimulate vascular
endothelial cell growth, may be employed in treatment for
stimulating re-vascularization of ischemic tissues due to various
disease conditions such as thrombosis, arteriosclerosis, and other
cardiovascular conditions. The polypeptide, polynucleotide,
agonist, or antagonist of the present invention may also be
employed to stimulate angiogenesis and limb regeneration, as
discussed above.
[0869] A polypeptide, polynucleotide, agonist, or antagonist of the
present invention may also be employed for treating, preventing,
and/or diagnosing wounds due to injuries, burns, post-operative
tissue repair, and ulcers since they are mitogenic to various cells
of different origins, such as fibroblast cells and skeletal muscle
cells, and therefore, facilitate the repair or replacement of
damaged or diseased tissue.
[0870] A polypeptide, polynucleotide, agonist, or antagonist of the
present invention may also be employed stimulate neuronal growth
and to treat and prevent neuronal damage which occurs in certain
neuronal diseases, disorders, and/or conditions or
neuro-degenerative conditions such as Alzheimer's disease,
Parkinson's disease, and AIDS-related complex. A polypeptide,
polynucleotide, agonist, or antagonist of the present invention may
have the ability to stimulate chondrocyte growth, therefore, they
may be employed to enhance bone and periodontal regeneration and
aid in tissue transplants or bone grafts.
[0871] A polypeptide, polynucleotide, agonist, or antagonist of the
present invention may be also be employed to prevent skin aging due
to sunburn by stimulating keratinocyte growth.
[0872] A polypeptide, polynucleotide, agonist, or antagonist of the
present invention may also be employed for preventing hair loss,
since FGF family members activate hair-forming cells and promotes
melanocyte growth. Along the same lines, a polypeptide,
polynucleotide, agonist, or antagonist of the present invention may
be employed to stimulate growth and differentiation of
hematopoietic cells and bone marrow cells when used in combination
with other cytokines.
[0873] A polypeptide, polynucleotide, agonist, or antagonist of the
present invention may also be employed to maintain organs before
transplantation or for supporting cell culture of primary tissues.
A polypeptide, polynucleotide, agonist, or antagonist of the
present invention may also be employed for inducing tissue of
mesodermal origin to differentiate in early embryos.
[0874] A polypeptide, polynucleotide, agonist, or antagonist of the
present invention may also increase or decrease the differentiation
or proliferation of embryonic stem cells, besides, as discussed
above, hematopoietic lineage.
[0875] A polypeptide, polynucleotide, agonist, or antagonist of the
present invention may also be used to modulate mammalian
characteristics, such as body height, weight, hair color, eye
color, skin, percentage of adipose tissue, pigmentation, size, and
shape (e.g., cosmetic surgery). Similarly, a polypeptide,
polynucleotide, agonist, or antagonist of the present invention may
be used to modulate mammalian metabolism affecting catabolism,
anabolism, processing, utilization, and storage of energy.
[0876] A polypeptide, polynucleotide, agonist, or antagonist of the
present invention may be used to change a mammal's mental state or
physical state by influencing biorhythms, caricadic rhythms,
depression (including depressive diseases, disorders, and/or
conditions), tendency for violence, tolerance for pain,
reproductive capabilities (preferably by Activin or Inhibin-like
activity), hormonal or endocrine levels, appetite, libido, memory,
stress, or other cognitive qualities.
[0877] A polypeptide, polynucleotide, agonist, or antagonist of the
present invention may also be used as a food additive or
preservative, such as to increase or decrease storage capabilities,
fat content, lipid, protein, carbohydrate, vitamins, minerals,
cofactors or other nutritional components.
[0878] The above-recited applications have uses in a wide variety
of hosts. Such hosts include, but are not limited to, human,
murine, rabbit, goat, guinea pig, camel, horse, mouse, rat,
hamster, pig, micro-pig, chicken, goat, cow, sheep, dog, cat,
non-human primate, and human. In specific embodiments, the host is
a mouse, rabbit, goat, guinea pig, chicken, rat, hamster, pig,
sheep, dog or cat. In preferred embodiments, the host is a mammal.
In most preferred embodiments, the host is a human.
[0879] Having generally described the invention, the same will be
more readily understood by reference to the following examples,
which are provided by way of illustration and are not intended as
limiting.
EXAMPLES
Example 1
Bacterial Expression and Purification of HDGNR10
[0880] The DNA sequence encoding for HDGNR10, ATCC.TM. No. 97183 is
initially amplified using PCR oligonucleotide primers corresponding
to the 5' and sequences of the processed HDGNR10 protein (minus the
signal peptide sequence) and the vector sequences 3' to the HDGNR10
gene. Additional nucleotides corresponding to HDGNR10 were added to
the 5' and 3' sequences respectively. The 5' oligonucleotide primer
has the sequence 5' CGGAATTCCTCCATGGATTATCAAGTGTCA 3' (SEQ ID NO:3)
and contains an EcoRI restriction enzyme site followed by 18
nucleotides of HDGNR10 coding sequence starting from the presumed
terminal amino acid of the processed protein codon.
[0881] The 3' sequence 5' CGGAAGCTTCGTCACAAGCCCACAGATAT 3' (SEQ ID
NO:4) contains complementary sequences to a HindIII site and is
followed by 18 nucleotides of HDGNR10 coding sequence. The
restriction enzyme sites correspond to the restriction enzyme sites
on the bacterial expression vector pQE-9 (Qiagen, Inc. 9259 Eton
Avenue, Chatsworth, Calif., 91311). pQE-9 encodes antibiotic
resistance (Amp.sup.r), a bacterial origin of replication (on), an
IPTG-regulatable promoter operator (P/O), a ribosome binding site
(RBS), a 6-His tag and restriction enzyme sites. pQE-9 was then
digested with EcoRI and HindIII. The amplified sequences were
ligated into pQE-9 and were inserted in frame with the sequence
encoding for the histidine tag and the RBS. The ligation mixture
was then used to transform E. coli strain M15/rep 4 (Qiagen, Inc.)
by the procedure described in Sambrook, J. et al., Molecular
Cloning: A Laboratory Manual, Cold Spring Laboratory Press, (1989).
M15/rep4 contains multiple copies of the plasmid pREP4, which
expresses the lad repressor and also confers kanamycin resistance
(Kan.sup.r). Transformants are identified by their ability to grow
on LB plates and ampicillin/kanamycin resistant colonies were
selected. Plasmid DNA was isolated and confirmed by restriction
analysis.
[0882] Clones containing the desired constructs were grown
overnight (O/N) in liquid culture in LB media supplemented with
both Amp (100 .mu.g/ml) and Kan (25 .mu.g/ml). The O/N culture is
used to inoculate a large culture at a ratio of 1:100 to 1:250. The
cells were grown to an optical density 600 (O.D..sup.600) of
between 0.4 and 0.6. IPTG ("Isopropyl-B-D-thiogalacto pyranoside")
was then added to a final concentration of 1 mM. IPTG induces by
inactivating the lad repressor, clearing the P/O leading to
increased gene expression. Cells were grown an extra 3 to 4 hours.
Cells were then harvested by centrifugation. The cell pellet was
solubilized in the chaotropic agent 6 Molar Guanidine HCl. After
clarification, solubilized HDGNR10 was purified from this solution
by chromatography on a Nickel-Chelate column under conditions that
allow for tight binding by proteins containing the 6-His tag.
Hochuli, E. et al., J. Chromatography 411:177-184 (1984). HDGNR10
was eluted from the column in 6 molar guanidine HCl pH 5.0 and for
the purpose of renaturation adjusted to 3 molar guanidine HCl, 100
mM sodium phosphate, 10 mmolar glutathione (reduced) and 2 mmolar
glutathione (oxidized). After incubation in this solution for 12
hours the protein was dialyzed to 10 mmolar sodium phosphate.
Example 2
Expression of Recombinant HDGNR10 in COS Cells
[0883] The expression of plasmid HDGNR10 HA is derived from a
vector pcDNAI/Amp (Invitrogen) containing: 1) SV40 origin of
replication, 2) ampicillin resistance gene, 3) E. coli replication
origin, 4) CMV promoter followed by a polylinker region, a SV40
intron and polyadenylation site. A DNA fragment encoding the entire
HDGNR10 precursor and a HA tag fused in frame to its 3' end was
cloned into the polylinker region of the vector, therefore, the
recombinant protein expression is directed under the CMV promoter.
The HA tag correspond to an epitope derived from the influenza
hemagglutinin protein as previously described (I. Wilson, et al.,
Cell 37:767 (1984)). The infusion of HA tag to the target protein
allows easy detection of the recombinant protein with an antibody
that recognizes the HA epitope.
[0884] The plasmid construction strategy is described as
follows:
[0885] The DNA sequence encoding for HDGNR10, ATCC.TM. No. 97183,
was constructed by PCR using two primers: the 5' primer 5'
GTCCAAGCTTGCCACCATGGATTATCAAGTGTCA 3' (SEQ ID NO:5) and contains a
HindIII site followed by 18 nucleotides of HDGNR10 coding sequence
starting from the initiation codon; the 3' sequence 5'
CTAGCTCGAGTCAAGCGTAGTCTGGGACGTCGTATGGGTAGCACAAGCCCACAGATATTTC 3'
(SEQ ID NO:6) contains complementary sequences to an XhoI site,
translation stop codon, HA tag and the last 18 nucleotides of the
HDGNR10 coding sequence (not including the stop codon). Therefore,
the PCR product contains a HindIII site HDGNR10 coding sequence
followed by HA tag fused in frame, a translation termination stop
codon next to the HA tag, and an XhoI site. The PCR amplified DNA
fragment and the vector, pcDNAI/Amp, were digested with HindIII and
XhoI restriction enzyme and ligated. The ligation mixture was
transformed into E. coli strain SURE (available from Stratagene
Cloning Systems, 11099 North Torrey Pines Road, La Jolla, Calif.
92037) the transformed culture was plated on ampicillin media
plates and resistant colonies were selected. Plasmid DNA was
isolated from transformants and examined by restriction analysis
for the presence of the correct fragment. For expression of the
recombinant HDGNR10, COS cells were transfected with the expression
vector by DEAE-DEXTRAN method. (J. Sambrook, E. Fritsch, T.
Maniatis, Molecular Cloning: A Laboratory Manual, Cold Spring
Laboratory Press, (1989)). The expression of the HDGNR10 HA protein
was detected by radiolabelling and immunoprecipitation method. (E.
Harlow, D. Lane, Antibodies: A Laboratory Manual, Cold Spring
Harbor Laboratory Press, (1988)). Cells were labelled for 8 hours
with .sup.35S-cysteine two days post transfection. Culture media
were then collected and cells were lysed with detergent (RIPA
buffer (150 mM NaCl, 1% NP-40, 0.1% SDS, 1% NP-40, 0.5% DOC, 50 mM
Tris, pH 7.5). (Wilson, I. et al., Id. 37:767 (1984) Both cell
lysate and culture media were precipitated with a HA specific
monoclonal antibody. Proteins precipitated were analyzed on 15%
SDS-PAGE gels.
Example 3
Cloning and Expression of HDGNR10 Using the Baculovirus Expression
System
[0886] The DNA sequence encoding the full length HDGNR10 protein,
ATCC.TM. No. 97183, was amplified using PCR oligonucleotide primers
corresponding to the 5' and 3' sequences of the gene:
[0887] The 5' primer has the sequence 5'
CGGGATCCCTCCATGGATTATCAAGTGTCA 3' (SEQ ID NO:7) and contains a
BamHI restriction enzyme site followed by 4 nucleotides resembling
an efficient signal for the initiation of translation in eukaryotic
cells (Kozak, M., J. Mol. Biol. 196:947-950 (1987)) and just behind
the first 18 nucleotides of the HDGNR10 gene (the initiation codon
for translation is "ATG").
[0888] The 3' primer has the sequence 5'
CGGGATCCCGCTCACAAGCCCACAGATAT 3' (SEQ ID NO:8) and contains the
cleavage site for the restriction endonuclease BamHI and 18
nucleotides complementary to the 3' non-translated sequence of the
HDGNR10 gene. The amplified sequences were isolated from a 1%
agarose gel using a commercially available kit ("GENECLEAN.TM.,"
BIO 101 Inc., La Jolla, Calif.). The fragment was then digested
with the endonuclease BamHI and purified as described above. This
fragment is designated F2.
[0889] The vector pRG1 (modification of pVL941 vector, discussed
below) is used for the expression of the HDGNR10 protein using the
baculovirus expression system (for review see: Summers, M. D. and
Smith, G. E. 1987, A manual of methods for baculovirus vectors and
insect cell culture procedures, Texas Agricultural Experimental
Station Bulletin No. 1555). This expression vector contains the
strong polyhedrin promoter of the Autographa californica nuclear
polyhedrosis virus (AcMNPV) followed by the recognition sites for
the restriction endonuclease BamHI. The polyadenylation site of the
simian virus (SV)40 is used for efficient polyadenylation. For an
easy selection of recombinant viruses the beta-galactosidase gene
from E. coli is inserted in the same orientation as the polyhedrin
promoter followed by the polyadenylation signal of the polyhedrin
gene. The polyhedrin sequences are flanked at both sides by viral
sequences for the cell-mediated homologous recombination of
co-transfected wild-type viral DNA. Many other baculovirus vectors
could be used in place of pRG1 such as pAc373, pVL941 and pAcIM1
(Luckow, V. A. and Summers, M. D., Virology 170:31-39).
[0890] The plasmid was digested with the restriction enzyme BamHI
and then dephosphorylated using calf intestinal phosphatase by
procedures known in the art. The DNA was then isolated from a 1%
agarose gel as described above. This vector DNA is designated
V2.
[0891] Fragment F2 and the dephosphorylated plasmid V2 were ligated
with T4 DNA ligase. E. coli HB101 cells were then transformed and
bacteria identified that contained the plasmid (pBacHDGNR10) with
the HDGNR10 gene using the enzyme BamHI. The sequence of the cloned
fragment was confirmed by DNA sequencing.
[0892] 5 .mu.g of the plasmid pBacHDGNR10 were co-transfected with
1.0 .mu.g of a commercially available linearized baculovirus
("BACULOGOLD.TM. baculovirus DNA", Pharmingen, San Diego, Calif.)
using the lipofection method (Felgner, et al., Proc. Natl. Acad.
Sci. USA 84:7413-7417 (1987)).
[0893] 1.1 g of BACULOGOLD.TM. virus DNA and 5 .mu.g of the plasmid
pBacHDGNR10 were mixed in a sterile well of a microtiter plate
containing 50 .mu.g of serum free Grace's medium (Life Technologies
Inc., Gaithersburg, Md.). Afterwards 10 .mu.l LIPOFECTIN.TM. plus
90 .mu.l Grace's medium were added, mixed and incubated for 15
minutes at room temperature. Then the transfection mixture was
added drop wise to the Sf9 insect cells (ATCC.TM. CRL 1711) seeded
in a 35 mm tissue culture plate with 1 ml Grace's medium without
serum. The plate was rocked back and forth to mix the newly added
solution. The plate was then incubated for 5 hours at 27.degree. C.
After 5 hours the transfection solution was removed from the plate
and 1 ml of Grace's insect medium supplemented with 10% fetal calf
serum was added. The plate was put back into an incubator and
cultivation continued at 27.degree. C. for four days.
[0894] After four days the supernatant was collected and a plaque
assay performed similar as described by Summers and Smith (supra).
As a modification an agarose gel with "Blue Gal" (Life Technologies
Inc., Gaithersburg) was used which allows an easy isolation of blue
stained plaques. (A detailed description of a "plaque assay" can
also be found in the user's guide for insect cell culture and
baculovirology distributed by Life Technologies Inc., Gaithersburg,
pages 9-10).
[0895] Four days after the serial dilution, the viruses were added
to the cells, blue stained plaques were picked with the tip of an
Eppendorf pipette. The agar containing the recombinant viruses was
then resuspended in an Eppendorf tube containing 200 .mu.l of
Grace's medium. The agar was removed by a brief centrifugation and
the supernatant containing the recombinant baculoviruses was used
to infect Sf9 cells seeded in 35 mm dishes. Four days later the
supernatants of these culture dishes were harvested and then stored
at 4.degree. C.
[0896] Sf9 cells were grown in Grace's medium supplemented with 10%
heat-inactivated FBS. The cells were infected with the recombinant
baculovirus V-HDGNR10 at a multiplicity of infection (MOI) of 2.
Six hours later the medium was removed and replaced with SF900 II
medium minus methionine and cysteine (Life Technologies Inc.,
Gaithersburg). 42 hours later 5 .mu.Ci of .sup.35S-methionine and 5
.mu.Ci .sup.35S cysteine (Amersham) were added. The cells were
further incubated for 16 hours before they were harvested by
centrifugation and the labelled proteins visualized by SDS-PAGE and
autoradiography.
Example 4
Expression Via Gene Therapy
[0897] Fibroblasts are obtained from a subject by skin biopsy. The
resulting tissue is placed in tissue-culture medium and separated
into small pieces. Small chunks of the tissue are placed on a wet
surface of a tissue culture flask, approximately ten pieces are
placed in each flask. The flask is turned upside down, closed tight
and left at room temperature over night. After 24 hours at room
temperature, the flask is inverted and the chunks of tissue remain
fixed to the bottom of the flask and fresh media (e.g., Ham's F12
media, with 10% FBS, penicillin and streptomycin, is added). This
is then incubated at 37.degree. C. for approximately one week. At
this time, fresh media is added and subsequently changed every
several days. After an additional two weeks in culture, a monolayer
of fibroblasts emerge. The monolayer is trypsinized and scaled into
larger flasks.
[0898] pMV-7 (Kirschmeier, P. T. et al, DNA 7:219-25 (1988) flanked
by the long terminal repeats of the Moloney murine sarcoma virus,
is digested with EcoRI and HindIII and subsequently treated with
calf intestinal phosphatase. The linear vector is fractionated on
agarose gel and purified, using glass beads.
[0899] The cDNA encoding a polypeptide of the present invention is
amplified using PCR primers which correspond to the 5' and 3' end
sequences respectively. The 5' primer contains an EcoRI site and
the 3' primer contains a HindIII site. Equal quantities of the
Moloney murine sarcoma virus linear backbone and the EcoRI and
HindIII fragment are added together, in the presence of T4 DNA
ligase. The resulting mixture is maintained under conditions
appropriate for ligation of the two fragments. The ligation mixture
is used to transform bacteria HB101, which are then plated onto
agar containing kanamycin for the purpose of confirming that the
vector had the gene of interest properly inserted.
[0900] The amphotropic pA317 or GP+aml2 packaging cells are grown
in tissue culture to confluent density in Dulbecco's Modified
Eagles medium (DMEM) with 10% calf serum (CS) penicillin and
streptomycin. The MSV vector containing the gene is then added to
the media and the packaging cells are transduced with the vector.
The packaging cells now produce infectious viral particles
containing the gene (the packaging cells are now referred to as
producer cells).
[0901] Fresh media is added to the transduced producer cells, and
subsequently, the media is harvested from a 10 cm plate of
confluent producer cells. The spent media, containing the
infectious viral particles, is filtered through a millipore filter
to remove detached producer cells and this media is then used to
infect fibroblast cells. Media is removed from a sub-confluent
plate of fibroblasts and quickly replaced with the media from the
producer cells. This media is removed and replaced with fresh
media. If the titer of virus is high, then virtually all
fibroblasts will be infected and no selection is required. If the
titer is very low, then it is necessary to use a retroviral vector
that has a selectable marker, such as neo or his.
[0902] The engineered fibroblasts are then injected into the host,
either alone or after having been grown to confluence on cytodex 3
microcarrier beads. The fibroblasts now produce the protein
product.
Example 5
Isolation of the G-Protein Chemokine Receptor (CCR5) DNA Clone from
the Deposited Sample
[0903] The DNA for G-protein Chemokine Receptor (CCR5) is inserted
into the multiple cloning site of pQE-9. (Qiagen, Inc.) pQE-9
contains an Ampicillin resistance gene and may be transformed into
E. coli strain DH10B, available from LIFE TECHNOLOGIES.TM.. (See,
for instance, Gruber, C. E., et al., Focus 15:59- (1993).)
[0904] Two approaches can be used to isolate G-protein Chemokine
Receptor (CCR5) from the deposited sample. First, the deposited
clone is transformed into a suitable host (such as XL-1 Blue
(STRATAGENE.TM.)) using techniques known to those of skill in the
art, such as those provided by the vector supplier or in related
publications or patents. The transformants are plated on 1.5% agar
plates (containing the appropriate selection agent, e.g.,
ampicillin) to a density of about 150 transformants (colonies) per
plate. A single colony is then used to generate DNA using nucleic
acid isolation techniques well known to those skilled in the art.
(e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd
Edit., (1989), Cold Spring Harbor Laboratory Press.)
[0905] Alternatively, two primers of 17-20 nucleotides derived from
both ends of the SEQ ID NO:1 or SEQ ID NO:21 (i.e., within the
region of SEQ ID NO:1 or SEQ ID NO:21 bounded by the 5' NT and the
3' NT of the clone) are synthesized and used to amplify the
G-protein Chemokine Receptor (CCR5) DNA using the deposited DNA
plasmid as a template. The polymerase chain reaction is carried out
under routine conditions, for instance, in 25 ul of reaction
mixture with 0.5 ug of the above DNA template. A convenient
reaction mixture is 1.5-5 mM MgCl.sub.2, 0.01% (w/v) gelatin, 20 uM
each of dATP, dCTP, dGTP, dTTP, 25 pmol of each primer and 0.25
Unit of Taq polymerase. Thirty five cycles of PCR (denaturation at
94 degree C. for 1 min; annealing at 55 degree C. for 1 min;
elongation at 72 degree C. for 1 min) are performed with a
Perkin-Elmer Cetus automated thermal cycler. The amplified product
is analyzed by agarose gel electrophoresis and the DNA band with
expected molecular weight is excised and purified. The PCR product
is verified to be the selected sequence by subcloning and
sequencing the DNA product.
[0906] Several methods are available for the identification of the
5' or 3' non-coding portions of the G-protein Chemokine Receptor
(CCR5) gene which may not be present in the deposited clone. These
methods include but are not limited to, filter probing, clone
enrichment using specific probes, and protocols similar or
identical to 5' and 3' "RACE" protocols which are well known in the
art. For instance, a method similar to 5' RACE is available for
generating the missing 5' end of a desired full-length transcript.
(Fromont-Racine et al., Nucleic Acids Res. 21(7):1683-1684
(1993).)
[0907] Briefly, a specific RNA oligonucleotide is ligated to the 5'
ends of a population of RNA presumably containing full-length gene
RNA transcripts. A primer set containing a primer specific to the
ligated RNA oligonucleotide and a primer specific to a known
sequence of the G-protein Chemokine Receptor (CCR5) gene of
interest is used to PCR amplify the 5' portion of the G-protein
Chemokine Receptor (CCR5) full-length gene. This amplified product
may then be sequenced and used to generate the full length
gene.
[0908] This above method starts with total RNA isolated from the
desired source, although poly-A+ RNA can be used. The RNA
preparation can then be treated with phosphatase if necessary to
eliminate 5' phosphate groups on degraded or damaged RNA which may
interfere with the later RNA ligase step. The phosphatase should
then be inactivated and the RNA treated with tobacco acid
pyrophosphatase in order to remove the cap structure present at the
5' ends of messenger RNAs. This reaction leaves a 5' phosphate
group at the 5' end of the cap cleaved RNA which can then be
ligated to an RNA oligonucleotide using T4 RNA ligase.
[0909] This modified RNA preparation is used as a template for
first strand cDNA synthesis using a gene specific oligonucleotide.
The first strand synthesis reaction is used as a template for PCR
amplification of the desired 5' end using a primer specific to the
ligated RNA oligonucleotide and a primer specific to the known
sequence of the gene of interest. The resultant product is then
sequenced and analyzed to confirm that the 5' end sequence belongs
to the G-protein Chemokine Receptor (CCR5) gene.
Example 6
Isolation of G-Protein Chemokine Receptor (CCR5) Genomic Clones
[0910] A human genomic P1 library (Genomic Systems, Inc.) is
screened by PCR using primers selected for the DNA sequence
corresponding to SEQ ID NO:1 or SEQ ID NO:21, according to the
method described in Example 5. (See also, Sambrook.)
Example 7
Tissue Distribution of G-Protein Chemokine Receptor (CCR5)
Polypeptides
[0911] Tissue distribution of mRNA expression of G-protein
Chemokine Receptor (CCR5) is determined using protocols for
Northern blot analysis, described by, among others, Sambrook et al.
For example, a G-protein Chemokine Receptor (CCR5) probe produced
by the method described in Example 5 is labeled with P.sup.32 using
the REDIPRIME.TM. DNA labeling system (Amersham Life Science),
according to manufacturer's instructions. After labeling, the probe
is purified using CHROMA SPIN-100.TM. column (Clontech
Laboratories, Inc.), according to manufacturer's protocol number
PT1200-1. The purified labeled probe is then used to examine
various human tissues for mRNA expression.
[0912] Multiple Tissue Northern (MTN) blots containing various
human tissues (H) or human immune system tissues (IM)
(CLONTECH.TM.) are examined with the labeled probe using
ExpressHyb.TM. hybridization solution (CLONTECH.TM.) according to
manufacturer's protocol number PT1190-1. Following hybridization
and washing, the blots are mounted and exposed to film at -70
degree C. overnight, and the films developed according to standard
procedures.
Example 8
Chromosomal Mapping of G-Protein Chemokine Receptor
[0913] An oligonucleotide primer set is designed according to the
sequence at the 5' end of SEQ ID NO:1 or SEQ ID NO:21. This primer
preferably spans about 100 nucleotides. This primer set is then
used in a polymerase chain reaction under the following set of
conditions: 30 seconds, 95 degree C.; 1 minute, 56 degree C.; 1
minute, 70 degree C. This cycle is repeated 32 times followed by
one 5 minute cycle at 70 degree C. Human, mouse, and hamster DNA is
used as template in addition to a somatic cell hybrid panel
containing individual chromosomes or chromosome fragments (Bios,
Inc). The reactions is analyzed on either 8% polyacrylamide gels or
3.5 agarose gels. Chromosome mapping is determined by the presence
of an approximately 100 bp PCR fragment in the particular somatic
cell hybrid.
Example 9
Bacterial Expression of G-Protein Chemokine Receptor
[0914] G-protein Chemokine Receptor (CCR5) polynucleotide encoding
a G-protein Chemokine Receptor (CCR5) polypeptide invention is
amplified using PCR oligonucleotide primers corresponding to the 5'
and 3' ends of the DNA sequence, as outlined in Example 5, to
synthesize insertion fragments. The primers used to amplify the
cDNA insert should preferably contain restriction sites, such as
BamHI and XbaI, at the 5' end of the primers in order to clone the
amplified product into the expression vector. For example, BamHI
and XbaI correspond to the restriction enzyme sites on the
bacterial expression vector pQE-9. (Qiagen, Inc., Chatsworth,
Calif.). This plasmid vector encodes antibiotic resistance
(Amp.sup.r), a bacterial origin of replication (on), an
IPTG-regulatable promoter/operator (P/O), a ribosome binding site
(RBS), a 6-histidine tag (6-His), and restriction enzyme cloning
sites.
[0915] The pQE-9 vector is digested with BamHI and XbaI and the
amplified fragment is ligated into the pQE-9 vector maintaining the
reading frame initiated at the bacterial RBS. The ligation mixture
is then used to transform the E. coli strain M15/rep4 (Qiagen,
Inc.) which contains multiple copies of the plasmid pREP4, which
expresses the lad repressor and also confers kanamycin resistance
(Kan.sup.r). Transformants are identified by their ability to grow
on LB plates and ampicillin/kanamycin resistant colonies are
selected. Plasmid DNA is isolated and confirmed by restriction
analysis.
[0916] Clones containing the desired constructs are grown overnight
(O/N) in liquid culture in LB media supplemented with both Amp (100
ug/ml) and Kan (25 ug/ml). The 0/N culture is used to inoculate a
large culture at a ratio of 1:100 to 1:250. The cells are grown to
an optical density 600 (O.D..sup.600) of between 0.4 and 0.6. IPTG
(Isopropyl-B-D-thiogalacto pyranoside) is then added to a final
concentration of 1 mM. IPTG induces by inactivating the lad
repressor, clearing the P/O leading to increased gene
expression.
[0917] Cells are grown for an extra 3 to 4 hours. Cells are then
harvested by centrifugation (20 mins at 6000.times.g). The cell
pellet is solubilized in the chaotropic agent 6 Molar Guanidine HCl
by stirring for 3-4 hours at 4 degree C. The cell debris is removed
by centrifugation, and the supernatant containing the polypeptide
is loaded onto a nickel-nitrilo-tri-acetic acid ("Ni-NTA") affinity
resin column (available from QIAGEN, Inc., supra). Proteins with a
6.times.His tag bind to the Ni-NTA resin with high affinity and can
be purified in a simple one-step procedure (for details see: The
QIAexpressionist (1995) QIAGEN, Inc., supra).
[0918] Briefly, the supernatant is loaded onto the column in 6 M
guanidine-HCl, pH 8, the column is first washed with 10 volumes of
6 M guanidine-HCl, pH 8, then washed with 10 volumes of 6 M
guanidine-HCl pH 6, and finally the polypeptide is eluted with 6 M
guanidine-HCl, pH 5.
[0919] The purified G-protein Chemokine Receptor (CCR5) protein is
then renatured by dialyzing it against phosphate-buffered saline
(PBS) or 50 mM Na-acetate, pH 6 buffer plus 200 mM NaCl.
Alternatively, the G-protein Chemokine Receptor (CCR5) protein can
be successfully refolded while immobilized on the Ni-NTA column.
The recommended conditions are as follows: renature using a linear
6M-1M urea gradient in 500 mM NaCl, 20% glycerol, 20 mM Tris/HCl pH
7.4, containing protease inhibitors. The renaturation should be
performed over a period of 1.5 hours or more. After renaturation
the proteins are eluted by the addition of 250 mM imidazole.
Immidazole is removed by a final dialyzing step against PBS or 50
mM sodium acetate pH 6 buffer plus 200 mM NaCl. The purified
G-protein Chemokine Receptor (CCR5) protein is stored at 4 degree
C. or frozen at -80 degree C.
[0920] In addition to the above expression vector, the present
invention further includes an expression vector comprising phage
operator and promoter elements operatively linked to a G-protein
Chemokine Receptor (CCR5) polynucleotide, called pHE4a. (ATCC.TM.
Accession Number 209645, deposited Feb. 25, 1998.) This vector
contains: 1) a neomycinphosphotransferase gene as a selection
marker, 2) an E. coli origin of replication, 3) a T5 phage promoter
sequence, 4) two lac operator sequences, 5) a Shine-Delgarno
sequence, and 6) the lactose operon repressor gene (lacIq). The
origin of replication (oriC) is derived from pUC19 (LTI,
Gaithersburg, Md.). The promoter sequence and operator sequences
are made synthetically.
[0921] DNA can be inserted into the pHEa by restricting the vector
with NdeI and XbaI, BamHI, XhoI, or Asp718, running the restricted
product on a gel, and isolating the larger fragment (the stuffer
fragment should be about 310 base pairs). The DNA insert is
generated according to the PCR protocol described in Example 5,
using PCR primers having restriction sites for NdeI (5' primer) and
XbaI, BamHI, XhoI, or Asp718 (3' primer). The PCR insert is gel
purified and restricted with compatible enzymes. The insert and
vector are ligated according to standard protocols.
[0922] The engineered vector could easily be substituted in the
above protocol to express protein in a bacterial system.
Example 10
Purification of G-Protein Chemokine Receptor (CCR5) Polypeptide
from an Inclusion Body
[0923] The following alternative method can be used to purify
G-protein Chemokine Receptor (CCR5) polypeptide expressed in E.
coli when it is present in the form of inclusion bodies. Unless
otherwise specified, all of the following steps are conducted at
4-10 degree C.
[0924] Upon completion of the production phase of the E. coli
fermentation, the cell culture is cooled to 4-10 degree C. and the
cells harvested by continuous centrifugation at 15,000 rpm (Heraeus
Sepatech). On the basis of the expected yield of protein per unit
weight of cell paste and the amount of purified protein required,
an appropriate amount of cell paste, by weight, is suspended in a
buffer solution containing 100 mM Tris, 50 mM EDTA, pH 7.4. The
cells are dispersed to a homogeneous suspension using a high shear
mixer.
[0925] The cells are then lysed by passing the solution through a
microfluidizer (Microfluidics, Corp. or APV Gaulin, Inc.) twice at
4000-6000 psi. The homogenate is then mixed with NaCl solution to a
final concentration of 0.5 M NaCl, followed by centrifugation at
7000.times.g for 15 min. The resultant pellet is washed again using
0.5M NaCl, 100 mM Tris, 50 mM EDTA, pH 7.4.
[0926] The resulting washed inclusion bodies are solubilized with
1.5 M guanidine hydrochloride (GuHCl) for 2-4 hours. After
7000.times.g centrifugation for 15 min., the pellet is discarded
and the polypeptide containing supernatant is incubated at 4 degree
C. overnight to allow further GuHCl extraction.
[0927] Following high speed centrifugation (30,000.times.g) to
remove insoluble particles, the GuHCl solubilized protein is
refolded by quickly mixing the GuHCl extract with 20 volumes of
buffer containing 50 mM sodium, pH 4.5, 150 mM NaCl, 2 mM EDTA by
vigorous stirring. The refolded diluted protein solution is kept at
4 degree C. without mixing for 12 hours prior to further
purification steps.
[0928] To clarify the refolded polypeptide solution, a previously
prepared tangential filtration unit equipped with 0.16 um membrane
filter with appropriate surface area (e.g., Filtron), equilibrated
with 40 mM sodium acetate, pH 6.0 is employed. The filtered sample
is loaded onto a cation exchange resin (e.g., Poros HS-50,
Perseptive Biosystems). The column is washed with 40 mM sodium
acetate, pH 6.0 and eluted with 250 mM, 500 mM, 1000 mM, and 1500
mM NaCl in the same buffer, in a stepwise manner. The absorbance at
280 nm of the effluent is continuously monitored. Fractions are
collected and further analyzed by SDS-PAGE.
[0929] Fractions containing the G-protein Chemokine Receptor (CCR5)
polypeptide are then pooled and mixed with 4 volumes of water. The
diluted sample is then loaded onto a previously prepared set of
tandem columns of strong anion (Poros HQ-50, Perseptive Biosystems)
and weak anion (Poros CM-20, Perseptive Biosystems) exchange
resins. The columns are equilibrated with 40 mM sodium acetate, pH
6.0. Both columns are washed with 40 mM sodium acetate, pH 6.0, 200
mM NaCl. The CM-20 column is then eluted using a 10 column volume
linear gradient ranging from 0.2 M NaCl, 50 mM sodium acetate, pH
6.0 to 1.0 M NaCl, 50 mM sodium acetate, pH 6.5. Fractions are
collected under constant A.sub.280 monitoring of the effluent.
Fractions containing the polypeptide (determined, for instance, by
16% SDS-PAGE) are then pooled.
[0930] The resultant G-protein Chemokine Receptor (CCR5)
polypeptide should exhibit greater than 95% purity after the above
refolding and purification steps. No major contaminant bands should
be observed from Commassie blue stained 16% SDS-PAGE gel when 5 ug
of purified protein is loaded. The purified G-protein Chemokine
Receptor (CCR5) protein can also be tested for endotoxin/LPS
contamination, and typically the LPS content is less than 0.1 ng/ml
according to LAL assays.
Example 11
Cloning and Expression of G-Protein Chemokine Receptor (CCR5) in a
Baculovirus Expression System
[0931] In this example, the plasmid shuttle vector pA2 is used to
insert G-protein Chemokine Receptor (CCR5) polynucleotide into a
baculovirus to express G-protein Chemokine Receptor. This
expression vector contains the strong polyhedrin promoter of the
Autographa californica nuclear polyhedrosis virus (AcMNPV) followed
by convenient restriction sites such as BamHI, Xba I and Asp718.
The polyadenylation site of the simian virus 40 ("SV40") is used
for efficient polyadenylation. For easy selection of recombinant
virus, the plasmid contains the beta-galactosidase gene from E.
coli under control of a weak Drosophila promoter in the same
orientation, followed by the polyadenylation signal of the
polyhedrin gene. The inserted genes are flanked on both sides by
viral sequences for cell-mediated homologous recombination with
wild-type viral DNA to generate a viable virus that express the
cloned G-protein Chemokine Receptor (CCR5) polynucleotide.
[0932] Many other baculovirus vectors can be used in place of the
vector above, such as pAc373, pVL941, and pAcIM1, as one skilled in
the art would readily appreciate, as long as the construct provides
appropriately located signals for transcription, translation,
secretion and the like, including a signal peptide and an in-frame
AUG as required. Such vectors are described, for instance, in
Luckow et al., Virology 170:31-39 (1989).
[0933] Specifically, the G-protein Chemokine Receptor (CCR5) cDNA
sequence contained in the deposited clone, including the AUG
initiation codon and any naturally associated leader sequence, is
amplified using the PCR protocol described in Example 5. If the
naturally occurring signal sequence is used to produce the secreted
protein, the pA2 vector does not need a second signal peptide.
Alternatively, the vector can be modified (pA2 GP) to include a
baculovirus leader sequence, using the standard methods described
in Summers et al., "A Manual of Methods for Baculovirus Vectors and
Insect Cell Culture Procedures," Texas Agricultural Experimental
Station Bulletin No. 1555 (1987).
[0934] The amplified fragment is isolated from a 1% agarose gel
using a commercially available kit ("GENECLEAN.TM.," BIO 101 Inc.,
La Jolla, Calif.). The fragment then is digested with appropriate
restriction enzymes and again purified on a 1% agarose gel.
[0935] The plasmid is digested with the corresponding restriction
enzymes and optionally, can be dephosphorylated using calf
intestinal phosphatase, using routine procedures known in the art.
The DNA is then isolated from a 1% agarose gel using a commercially
available kit ("GENECLEAN.TM." BIO 101 Inc., La Jolla, Calif.).
[0936] The fragment and the dephosphorylated plasmid are ligated
together with T4 DNA ligase. E. coli HB101 or other suitable E.
coli hosts such as XL-1 Blue (Stratagene Cloning Systems, La Jolla,
Calif.) cells are transformed with the ligation mixture and spread
on culture plates. Bacteria containing the plasmid are identified
by digesting DNA from individual colonies and analyzing the
digestion product by gel electrophoresis. The sequence of the
cloned fragment is confirmed by DNA sequencing.
[0937] Five ug of a plasmid containing the polynucleotide is
co-transfected with 1.0 ug of a commercially available linearized
baculovirus DNA ("BACULOGOLD.TM. baculovirus DNA", Pharmingen, San
Diego, Calif.), using the lipofection method described by Felgner
et al., Proc. Natl. Acad. Sci. USA 84:7413-7417 (1987). One ug of
BACULOGOLD.TM. virus DNA and 5 ug of the plasmid are mixed in a
sterile well of a microtiter plate containing 50 ul of serum-free
Grace's medium (Life Technologies Inc., Gaithersburg, Md.).
Afterwards, 10 ul LIPOFECTIN.TM. plus 90 ul Grace's medium are
added, mixed and incubated for 15 minutes at room temperature. Then
the transfection mixture is added drop-wise to Sf9 insect cells
(ATCC.TM. CRL 1711) seeded in a 35 mm tissue culture plate with 1
ml Grace's medium without serum. The plate is then incubated for 5
hours at 27 degrees C. The transfection solution is then removed
from the plate and 1 ml of Grace's insect medium supplemented with
10% fetal calf serum is added. Cultivation is then continued at 27
degrees C. for four days.
[0938] After four days the supernatant is collected and a plaque
assay is performed, as described by Summers and Smith, supra. An
agarose gel with "Blue Gal" (Life Technologies Inc., Gaithersburg)
is used to allow easy identification and isolation of
gal-expressing clones, which produce blue-stained plaques. (A
detailed description of a "plaque assay" of this type can also be
found in the user's guide for insect cell culture and
baculovirology distributed by Life Technologies Inc., Gaithersburg,
page 9-10.) After appropriate incubation, blue stained plaques are
picked with the tip of a micropipettor (e.g., Eppendorf). The agar
containing the recombinant viruses is then resuspended in a
microcentrifuge tube containing 200 ul of Grace's medium and the
suspension containing the recombinant baculovirus is used to infect
Sf9 cells seeded in 35 mm dishes. Four days later the supernatants
of these culture dishes are harvested and then they are stored at 4
degree C.
[0939] To verify the expression of the polypeptide, Sf9 cells are
grown in Grace's medium supplemented with 10% heat-inactivated FBS.
The cells are infected with the recombinant baculovirus containing
the polynucleotide at a multiplicity of infection ("MOI") of about
2. If radiolabeled proteins are desired, 6 hours later the medium
is removed and is replaced with SF900 II medium minus methionine
and cysteine (available from Life Technologies Inc., Rockville,
Md.). After 42 hours, 5 uCi of 35S-methionine and 5 uCi
35S-cysteine (available from Amersham) are added. The cells are
further incubated for 16 hours and then are harvested by
centrifugation. The proteins in the supernatant as well as the
intracellular proteins are analyzed by SDS-PAGE followed by
autoradiography (if radiolabeled).
[0940] Microsequencing of the amino acid sequence of the amino
terminus of purified protein may be used to determine the amino
terminal sequence of the produced G-protein Chemokine Receptor
(CCR5) protein.
Example 12
Expression of G-Protein Chemokine Receptor (CCR5) in Mammalian
Cells
[0941] G-protein Chemokine Receptor (CCR5) polypeptide can be
expressed in a mammalian cell. A typical mammalian expression
vector contains a promoter element, which mediates the initiation
of transcription of mRNA, a protein coding sequence, and signals
required for the termination of transcription and polyadenylation
of the transcript. Additional elements include enhancers, Kozak
sequences and intervening sequences flanked by donor and acceptor
sites for RNA splicing. Highly efficient transcription is achieved
with the early and late promoters from SV40, the long terminal
repeats (LTRs) from Retroviruses, e.g., RSV, HTLVI, HIVI and the
early promoter of the cytomegalovirus (CMV). However, cellular
elements can also be used (e.g., the human actin promoter).
[0942] Suitable expression vectors for use in practicing the
present invention include, for example, vectors such as pSVL and
pMSG (PHARMACIA.TM., Uppsala, Sweden), pRSVcat (ATCC.TM. 37152),
pSV2DHFR (ATCC.TM. 37146), pBC12MI (ATCC.TM. 67109), pCMVSport 2.0,
and pCMVSport 3.0. Mammalian host cells that could be used include,
human Hela, 293, H9 and Jurkat cells, mouse NIH3T3 and C127 cells,
Cos 1, Cos 7 and CV1, quail QC1-3 cells, mouse L cells and Chinese
hamster ovary (CHO) cells.
[0943] Alternatively, G-protein Chemokine Receptor (CCR5)
polypeptide can be expressed in stable cell lines containing the
G-protein Chemokine Receptor (CCR5) polynucleotide integrated into
a chromosome. The co-transfection with a selectable marker such as
DHFR, gpt, neomycin, hygromycin allows the identification and
isolation of the transfected cells.
[0944] The transfected G-protein Chemokine Receptor (CCR5) gene can
also be amplified to express large amounts of the encoded protein.
The DHFR (dihydrofolate reductase) marker is useful in developing
cell lines that carry several hundred or even several thousand
copies of the gene of interest. (See, e.g., Alt, F. W., et al., J.
Biol. Chem. 253:1357-1370 (1978); Hamlin, J. L. and Ma, C.,
Biochem. et Biophys. Acta, 1097:107-143 (1990); Page, M. J. and
Sydenham, M. A., Biotechnology 9:64-68 (1991).) Another useful
selection marker is the enzyme glutamine synthase (GS) (Murphy et
al., Biochem J. 227:277-279 (1991); Bebbington et al.,
Bio/Technology 10:169-175 (1992). Using these markers, the
mammalian cells are grown in selective medium and the cells with
the highest resistance are selected. These cell lines contain the
amplified gene(s) integrated into a chromosome. Chinese hamster
ovary (CHO) and NSO cells are often used for the production of
proteins.
[0945] Derivatives of the plasmid pSV2-DHFR (ATCC.TM. Accession No.
37146), the expression vectors pC4 (ATCC.TM. Accession No. 209646)
and pC6 (ATCC.TM. Accession No. 209647) contain the strong promoter
(LTR) of the Rous Sarcoma Virus (Cullen et al., Molecular and
Cellular Biology, 438-447 (March, 1985)) plus a fragment of the
CMV-enhancer (Boshart et al., Cell 41:521-530 (1985).) Multiple
cloning sites, e.g., with the restriction enzyme cleavage sites
BamHI, XbaI and Asp718, facilitate the cloning of G-protein
Chemokine Receptor. The vectors also contain the 3' intron, the
polyadenylation and termination signal of the rat preproinsulin
gene, and the mouse DHFR gene under control of the SV40 early
promoter.
[0946] Specifically, the plasmid pC6 or pC4 is digested with
restriction enzymes that cut within in the multiple cloning site
and then dephosphorylated using calf intestinal phosphates by
procedures known in the art. The vector is then isolated from a 1%
agarose gel.
[0947] The vector can be modified to include a heterologous signal
sequence in an effort to secrete the protein from the cell. (See,
e.g., WO 96/34891.)
[0948] The amplified fragment is then digested with restriction
enzymes that generate ends complementary to those of the digested
vector and purified on a 1% agarose gel using a commercially
available kit ("GENECLEAN.TM.," BIO 101 Inc., La Jolla, Calif.).
The isolated fragment and the dephosphorylated vector are then
ligated with T4 DNA ligase. E. coli HB101 or XL-1 Blue cells are
then transformed and bacteria are identified that contain the
fragment inserted into plasmid pC6 or pC4 using, for instance,
restriction enzyme analysis.
[0949] Chinese hamster ovary cells lacking an active DHFR gene is
used for transfection. Five .mu.g of the expression plasmid pC6 or
pC4 is cotransfected with 0.5 ug of the plasmid pSVneo using
LIPOFECTIN.TM. (Felgner et al., supra). The plasmid pSV2-neo
contains a dominant selectable marker, the neo gene from Tn5
encoding an enzyme that confers resistance to a group of
antibiotics including G418. The cells are seeded in alpha minus MEM
supplemented with 1 mg/ml G418. After 2 days, the cells are
trypsinized and seeded in hybridoma cloning plates (Greiner,
Germany) in alpha minus MEM supplemented with 10, 25, or 50 ng/ml
of methothrexate plus 1 mg/ml G418. After about 10-14 days single
clones are trypsinized and then seeded in 6-well petri dishes or 10
ml flasks using different concentrations of methotrexate (50 nM,
100 nM, 200 nM, 400 nM, 800 nM). Clones growing at the highest
concentrations of methotrexate are then transferred to new 6-well
plates containing even higher concentrations of methotrexate (1 uM,
2 uM, 5 uM, 10 mM, 20 mM). The same procedure is repeated until
clones are obtained which grow at a concentration of 100-200 uM.
Expression of G-protein Chemokine Receptor (CCR5) is analyzed, for
instance, by SDS-PAGE and Western blot or by reversed phase HPLC
analysis.
Example 13
Construction of N-Terminal and/or C-Terminal Deletion Mutants
[0950] The following general approach may be used to clone a
N-terminal or C-terminal deletion G-protein Chemokine Receptor
(CCR5) deletion mutant. Generally, two oligonucleotide primers of
about 15-25 nucleotides are derived from the desired 5' and 3'
positions of a polynucleotide of SEQ ID NO:1 or of the deposited
clone (SEQ ID NO:21). The 5' and 3' positions of the primers are
determined based on the desired G-protein Chemokine Receptor (CCR5)
polynucleotide fragment. An initiation and stop codon are added to
the 5' and 3' primers respectively, if necessary, to express the
G-protein Chemokine Receptor (CCR5) polypeptide fragment encoded by
the polynucleotide fragment. Preferred G-protein Chemokine Receptor
(CCR5) polynucleotide fragments are those encoding the N-terminal
and C-terminal deletion mutants disclosed above in the
"Polynucleotide and Polypeptide Fragments" section of the
Specification.
[0951] Additional nucleotides containing restriction sites to
facilitate cloning of the G-protein Chemokine Receptor (CCR5)
polynucleotide fragment in a desired vector may also be added to
the 5' and 3' primer sequences. The G-protein Chemokine Receptor
(CCR5) polynucleotide fragment is amplified from genomic DNA or
from the deposited cDNA clone using the appropriate PCR
oligonucleotide primers and conditions discussed herein or known in
the art. The G-protein Chemokine Receptor (CCR5) polypeptide
fragments encoded by the G-protein Chemokine Receptor (CCR5)
polynucleotide fragments of the present invention may be expressed
and purified in the same general manner as the full length
polypeptides, although routine modifications may be necessary due
to the differences in chemical and physical properties between a
particular fragment and full length polypeptide.
[0952] As a means of exemplifying but not limiting the present
invention, the polynucleotide encoding the G-protein Chemokine
Receptor (CCR5) polypeptide fragment Y-37 to Q-280 is amplified and
cloned as follows: A 5' primer is generated comprising a
restriction enzyme site followed by an initiation codon in frame
with the polynucleotide sequence encoding the N-terminal portion of
the polypeptide fragment beginning with Y-37. A complementary 3'
primer is generated comprising a restriction enzyme site followed
by a stop codon in frame with the polynucleotide sequence encoding
C-terminal portion of the G-protein Chemokine Receptor (CCR5)
polypeptide fragment ending with Q-280.
[0953] The amplified polynucleotide fragment and the expression
vector are digested with restriction enzymes which recognize the
sites in the primers. The digested polynucleotides are then ligated
together. The G-protein Chemokine Receptor (CCR5) polynucleotide
fragment is inserted into the restricted expression vector,
preferably in a manner which places the G-protein Chemokine
Receptor (CCR5) polypeptide fragment coding region downstream from
the promoter. The ligation mixture is transformed into competent E.
coli cells using standard procedures and as described in the
Examples herein. Plasmid DNA is isolated from resistant colonies
and the identity of the cloned DNA confirmed by restriction
analysis, PCR and DNA sequencing.
Example 14
Protein Fusions of G-Protein Chemokine Receptor
[0954] G-protein Chemokine Receptor (CCR5) polypeptides are
preferably fused to other proteins. These fusion proteins can be
used for a variety of applications. For example, fusion of
G-protein Chemokine Receptor (CCR5) polypeptides to His-tag,
HA-tag, protein A, IgG domains, and maltose binding protein
facilitates purification. (See Example 9; see also EP A 394,827;
Traunecker, et al., Nature 331:84-86 (1988).) Similarly, fusion to
IgG-1, IgG-3, and albumin increases the half-life time in vivo.
Nuclear localization signals fused to G-protein Chemokine Receptor
(CCR5) polypeptides can target the protein to a specific
subcellular localization, while covalent heterodimer or homodimers
can increase or decrease the activity of a fusion protein. Fusion
proteins can also create chimeric molecules having more than one
function. Finally, fusion proteins can increase solubility and/or
stability of the fused protein compared to the non-fused protein.
All of the types of fusion proteins described above can be made by
modifying the following protocol, which outlines the fusion of a
polypeptide to an IgG molecule, or the protocol described in
Example 9.
[0955] Briefly, the human Fc portion of the IgG molecule can be PCR
amplified, using primers that span the 5' and 3' ends of the
sequence described below. These primers also should have convenient
restriction enzyme sites that will facilitate cloning into an
expression vector, preferably a mammalian expression vector.
[0956] For example, if pC4 (Accession No. 209646) is used, the
human Fc portion can be ligated into the BamHI cloning site. Note
that the 3' BamHI site should be destroyed. Next, the vector
containing the human Fc portion is re-restricted with BamHI,
linearizing the vector, and G-protein Chemokine Receptor (CCR5)
polynucleotide, isolated by the PCR protocol described in Example
5, is ligated into this BamHI site. Note that the polynucleotide is
cloned without a stop codon, otherwise a fusion protein will not be
produced.
[0957] If the naturally occurring signal sequence is used to
produce the secreted protein, pC4 does not need a second signal
peptide. Alternatively, if the naturally occurring signal sequence
is not used, the vector can be modified to include a heterologous
signal sequence. (See, e.g., WO 96/34891.)
[0958] Human IgG Fc region:
TABLE-US-00003 (SEQ ID NO: 10)
GGGATCCGGAGCCCAAATCTTCTGACAAAACTCACACATGCCCACCGTGCCCAGCACCTGAATTCGAGGGTGCA-
CCG
TCAGTCTTCCTCTTCCCCCCAAAACCCAAGGACACCCTCATGATCTCCCGGACTCCTGAGGTCACATGCGTGGT-
GGT
GGACGTAAGCCACGAAGACCCTGAGGTCAAGTTCAACTGGTACGTGGACGGCGTGGAGGTGCATAATGCCAAGA-
CAA
AGCCGCGGGAGGAGCAGTACAACAGCACGTACCGTGTGGTCAGCGTCCTCACCGTCCTGCACCAGGACTGGCTG-
AAT
GGCAAGGAGTACAAGTGCAAGGTCTCCAACAAAGCCCTCCCAACCCCCATCGAGAAAACCATCTCCAAAGCCAA-
AGG
GCAGCCCCGAGAACCACAGGTGTACACCCTGCCCCCATCCCGGGATGAGCTGACCAAGAACCAGGTCAGCCTGA-
CCT
GCCTGGTCAAAGGCTTCTATCCAAGCGACATCGCCGTGGAGTGGGAGAGCAATGGGCAGCCGGAGAACAACTAC-
AAG
ACCACGCCTCCCGTGCTGGACTCCGACGGCTCCTTCTTCCTCTACAGCAAGCTCACCGTGGACAAGAGCAGGTG-
GCA
GCAGGGGAACGTCTTCTCATGCTCCGTGATGCATGAGGCTCTGCACAACCACTACACGCAGAAGAGCCTCTCCC-
TGT CTCCGGGTAAATGAGTGCGACGGCCGCGACTCTAGAGGAT
Example 15
Production of an Antibody
[0959] Hybridoma Technology
[0960] The antibodies of the present invention can be prepared by a
variety of methods. (See, Current Protocols, Chapter 2.) As one
example of such methods, cells expressing G-protein Chemokine
Receptor (CCR5) are administered to an animal to induce the
production of sera containing polyclonal antibodies. In a preferred
method, a preparation of G-protein Chemokine Receptor (CCR5)
protein is prepared and purified to render it substantially free of
natural contaminants. Such a preparation is then introduced into an
animal in order to produce polyclonal antisera of greater specific
activity.
[0961] Monoclonal antibodies specific for G-protein Chemokine
Receptor (CCR5) protein are prepared using hybridoma technology.
(Kohler et al., Nature 256:495 (1975); Kohler et al., Eur. J.
Immunol. 6:511 (1976); Kohler et al., Eur. J. Immunol. 6:292
(1976); Hammerling et al., in: Monoclonal Antibodies and T-Cell
Hybridomas, Elsevier, N.Y., pp. 563-681 (1981)). In general, an
animal (preferably a mouse) is immunized with G-protein Chemokine
Receptor (CCR5) polypeptide or, more preferably, with a secreted
G-protein Chemokine Receptor (CCR5) polypeptide-expressing cell.
Such polypeptide-expressing cells are cultured in any suitable
tissue culture medium, preferably in Earle's modified Eagle's
medium supplemented with 10% fetal bovine serum (inactivated at
about 56.degree. C.), and supplemented with about 10 g/l of
nonessential amino acids, about 1,000 U/ml of penicillin, and about
100 .mu.g/ml of streptomycin.
[0962] The splenocytes of such mice are extracted and fused with a
suitable myeloma cell line. Any suitable myeloma cell line may be
employed in accordance with the present invention; however, it is
preferable to employ the parent myeloma cell line (SP20), available
from the ATCC.TM.. After fusion, the resulting hybridoma cells are
selectively maintained in HAT medium, and then cloned by limiting
dilution as described by Wands et al. (Gastroenterology 80:225-232
(1981)). The hybridoma cells obtained through such a selection are
then assayed to identify clones which secrete antibodies capable of
binding the G-protein Chemokine Receptor (CCR5) polypeptide.
[0963] Alternatively, additional antibodies capable of binding to
G-protein Chemokine Receptor (CCR5) polypeptide can be produced in
a two-step procedure using anti-idiotypic antibodies. Such a method
makes use of the fact that antibodies are themselves antigens, and
therefore, it is possible to obtain an antibody which binds to a
second antibody. In accordance with this method, protein specific
antibodies are used to immunize an animal, preferably a mouse. The
splenocytes of such an animal are then used to produce hybridoma
cells, and the hybridoma cells are screened to identify clones
which produce an antibody whose ability to bind to the G-protein
Chemokine Receptor (CCR5) protein-specific antibody can be blocked
by G-protein Chemokine Receptor. Such antibodies comprise
anti-idiotypic antibodies to the G-protein Chemokine Receptor
(CCR5) protein-specific antibody and are used to immunize an animal
to induce formation of further G-protein Chemokine Receptor (CCR5)
protein-specific antibodies.
[0964] For in vivo use of antibodies in humans, an antibody is
"humanized". Such antibodies can be produced using genetic
constructs derived from hybridoma cells producing the monoclonal
antibodies described above. Methods for producing chimeric and
humanized antibodies are known in the art and are discussed herein.
(See, for review, Morrison, Science 229:1202 (1985); Oi et al.,
BioTechniques 4:214 (1986); Cabilly et al., U.S. Pat. No.
4,816,567; Taniguchi et al., EP 171496; Morrison et al., EP 173494;
Neuberger et al., WO 8601533; Robinson et al., WO 8702671;
Boulianne et al., Nature 312:643 (1984); Neuberger et al., Nature
314:268 (1985).)
[0965] Isolation of Antibody Fragments Directed Against G-Protein
Chemokine Receptor (CCR5) from a Library of scFvs
[0966] Naturally occurring V-genes isolated from human PBLs are
constructed into a library of antibody fragments which contain
reactivities against G-protein Chemokine Receptor (CCR5) to which
the donor may or may not have been exposed (see e.g., U.S. Pat. No.
5,885,793 incorporated herein by reference in its entirety).
[0967] Rescue of the Library. A library of scFvs is constructed
from the RNA of human PBLs as described in PCT publication WO
92/01047. To rescue phage displaying antibody fragments,
approximately 109 E. coli harboring the phagemid are used to
inoculate 50 ml of 2.times.TY containing 1% glucose and 100
.mu.g/ml of ampicillin (2.times.TY-AMP-GLU) and grown to an O.D. of
0.8 with shaking. Five ml of this culture is used to inoculate 50
ml of 2.times.TY-AMP-GLU, 2.times.108 TU of delta gene 3 helper
(M13 delta gene III, see PCT publication WO 92/01047) are added and
the culture incubated at 37.degree. C. for 45 minutes without
shaking and then at 37.degree. C. for 45 minutes with shaking. The
culture is centrifuged at 4000 r.p.m. for 10 min. and the pellet
resuspended in 2 liters of 2.times.TY containing 100 .mu.g/ml
ampicillin and 50 ug/ml kanamycin and grown overnight. Phage are
prepared as described in PCT publication WO 92/01047.
[0968] M13 delta gene III is prepared as follows: M13 delta gene
III helper phage does not encode gene III protein, hence the
phage(mid) displaying antibody fragments have a greater avidity of
binding to antigen. Infectious M13 delta gene III particles are
made by growing the helper phage in cells harboring a pUC19
derivative supplying the wild type gene III protein during phage
morphogenesis. The culture is incubated for 1 hour at 37.degree. C.
without shaking and then for a further hour at 37.degree. C. with
shaking. Cells are spun down (IEC-Centra 8,400 r.p.m. for 10 min),
resuspended in 300 ml 2.times.TY broth containing 100 .mu.g
ampicillin/ml and 25 .mu.g kanamycin/ml (2.times.TY-AMP-KAN) and
grown overnight, shaking at 37.degree. C. Phage particles are
purified and concentrated from the culture medium by two
PEG-precipitations (Sambrook et al., 1990), resuspended in 2 ml PBS
and passed through a 0.45 .mu.m filter (Minisart NML; Sartorius) to
give a final concentration of approximately 1013 transducing
units/ml (ampicillin-resistant clones).
[0969] Panning of the Library. Immunotubes (Nunc) are coated
overnight in PBS with 4 ml of either 100 .mu.g/ml or 10 .mu.g/ml of
a polypeptide of the present invention. Tubes are blocked with 2%
Marvel-PBS for 2 hours at 37.degree. C. and then washed 3 times in
PBS. Approximately 1013 TU of phage is applied to the tube and
incubated for 30 minutes at room temperature tumbling on an over
and under turntable and then left to stand for another 1.5 hours.
Tubes are washed 10 times with PBS 0.1% Tween-20 and 10 times with
PBS. Phage are eluted by adding 1 ml of 100 mM triethylamine and
rotating 15 minutes on an under and over turntable after which the
solution is immediately neutralized with 0.5 ml of 1.0M Tris-HCl,
pH 7.4. Phage are then used to infect 10 ml of mid-log E. coli TG1
by incubating eluted phage with bacteria for 30 minutes at
37.degree. C. The E. coli are then plated on TYE plates containing
1% glucose and 100 .mu.g/ml ampicillin. The resulting bacterial
library is then rescued with delta gene 3 helper phage as described
above to prepare phage for a subsequent round of selection. This
process is then repeated for a total of 4 rounds of affinity
purification with tube-washing increased to 20 times with PBS, 0.1%
Tween-20 and 20 times with PBS for rounds 3 and 4.
[0970] Characterization of Binders. Eluted phage from the 3rd and
4th rounds of selection are used to infect E. coli HB 2151 and
soluble scFv is produced (Marks, et al., 1991) from single colonies
for assay. ELISAs are performed with microtitre plates coated with
either 10 pg/ml of the polypeptide of the present invention in 50
mM bicarbonate pH 9.6. Clones positive in ELISA are further
characterized by PCR fingerprinting (see, e.g., PCT publication WO
92/01047) and then by sequencing. These ELISA positive clones may
also be further characterized by techniques known in the art, such
as, for example, epitope mapping, binding affinity, receptor signal
transduction, ability to block or competitively inhibit
antibody/antigen binding, and competitive agonistic or antagonistic
activity.
Example 16
Production of G-Protein Chemokine Receptor (CCR5) Protein or Ligand
for High-Throughput Screening Assays
[0971] The following protocol produces a supernatant containing a
soluble G-protein Chemokine Receptor (CCR5) polypeptide or a
G-protein Chemokine Receptor (CCR5) ligand to be tested. Ligands of
the G-protein Chemokine Receptor (CCR5) include MIP-1.alpha.,
MIP-1.beta., MCP-1, MCP-2, MCP-3, MCP-4, Eotaxin, RANTES, and HIV.
This supernatant can then be used in the Screening Assays described
in Examples 18-25.
[0972] First, dilute Poly-D-Lysine (644 587 Boehringer-Mannheim)
stock solution (1 mg/ml in PBS) 1:20 in PBS (w/o calcium or
magnesium 17-516F Biowhittaker) for a working solution of 50 ug/ml.
Add 200 ul of this solution to each well (24 well plates) and
incubate at RT for 20 minutes. Be sure to distribute the solution
over each well (note: a 12-channel pipetter may be used with tips
on every other channel). Aspirate off the Poly-D-Lysine solution
and rinse with 1 ml PBS (Phosphate Buffered Saline). The PBS should
remain in the well until just prior to plating the cells and plates
may be poly-lysine coated in advance for up to two weeks.
[0973] Plate 293T cells (do not carry cells past P+20) at
2.times.10.sup.5 cells/well in 0.5 ml DMEM (Dulbecco's Modified
Eagle Medium) (with 4.5 G/L glucose and L-glutamine (12-604F
Biowhittaker))/10% heat inactivated FBS (14-503F
Biowhittaker)/1.times. Penstrep (17-602E Biowhittaker). Let the
cells grow overnight.
[0974] The next day, mix together in a sterile solution basin: 300
ul Lipofectamine (18324-012 Gibco/BRL) and 5 ml Optimem I (31985070
Gibco/BRL)/96-well plate. With a small volume multi-channel
pipetter, aliquot approximately 2 ug of an expression vector
containing a polynucleotide insert, produced by the methods
described in Examples 8-10, into an appropriately labeled 96-well
round bottom plate. With a multi-channel pipetter, add 50 ul of the
Lipofectamine/Optimem I mixture to each well. Pipette up and down
gently to mix. Incubate at RT 15-45 minutes. After about 20
minutes, use a multi-channel pipetter to add 150 ul Optimem I to
each well. As a control, one plate of vector DNA lacking an insert
should be transfected with each set of transfections.
[0975] Preferably, the transfection should be performed by
tag-teaming the following tasks. By tag-teaming, hands on time is
cut in half, and the cells do not spend too much time on PBS.
First, person A aspirates off the media from four 24-well plates of
cells, and then person B rinses each well with 0.5-1 ml PBS. Person
A then aspirates off PBS rinse, and person B, using a 12-channel
pipetter with tips on every other channel, adds the 200 ul of
DNA/Lipofectamine/Optimem I complex to the odd wells first, then to
the even wells, to each row on the 24-well plates. Incubate at
37.degree. C. for 6 hours.
[0976] While cells are incubating, prepare appropriate media,
either 1% BSA in DMEM with 1.times. penstrep, or HGS CHO-5 media
(116.6 mg/L of CaCl2 (anhyd); 0.00130 mg/L CuSO.sub.4-5H.sub.2O;
0.050 mg/L of Fe(NO.sub.3).sub.3-9H.sub.2O; 0.417 mg/L of
FeSO.sub.4-7H.sub.2O; 311.80 mg/L of Kcl; 28.64 mg/L of MgCl.sub.2;
48.84 mg/L of MgSO.sub.4; 6995.50 mg/L of NaCl; 2400.0 mg/L of
NaHCO.sub.3; 62.50 mg/L of NaH.sub.2PO.sub.4--H.sub.20; 71.02 mg/L
of Na.sub.2HPO4; 0.4320 mg/L of ZnSO.sub.4-7H.sub.2O; 0.002 mg/L of
Arachidonic Acid; 1.022 mg/L of Cholesterol; 0.070 mg/L of
DL-alpha-Tocopherol-Acetate; 0.0520 mg/L of Linoleic Acid; 0.010
mg/L of Linolenic Acid; 0.010 mg/L of Myristic Acid; 0.010 mg/L of
Oleic Acid; 0.010 mg/L of Palmitric Acid; 0.010 mg/L of Palmitic
Acid; 100 mg/L of Pluronic F-68; 0.010 mg/L of Stearic Acid; 2.20
mg/L of Tween 80; 4551 mg/L of D-Glucose; 130.85 mg/ml of
L-Alanine; 147.50 mg/ml of L-Arginine-HCL; 7.50 mg/ml of
L-Asparagine-H.sub.20; 6.65 mg/ml of L-Aspartic Acid; 29.56 mg/ml
of L-Cystine-2HCL-H.sub.20; 31.29 mg/ml of L-Cystine-2HCL; 7.35
mg/ml of L-Glutamic Acid; 365.0 mg/ml of L-Glutamine; 18.75 mg/ml
of Glycine; 52.48 mg/ml of L-Histidine-HCL-H.sub.20; 106.97 mg/ml
of L-Isoleucine; 111.45 mg/ml of L-Leucine; 163.75 mg/ml of
L-Lysine HCL; 32.34 mg/ml of L-Methionine; 68.48 mg/ml of
L-Phenylalanine; 40.0 mg/ml of L-Proline; 26.25 mg/ml of L-Serine;
101.05 mg/ml of L-Threonine; 19.22 mg/ml of L-Tryptophan; 91.79
mg/ml of L-Tryrosine-2Na-2H.sub.2O; and 99.65 mg/ml of L-Valine;
0.0035 mg/L of Biotin; 3.24 mg/L of D-Ca Pantothenate; 11.78 mg/L
of Choline Chloride; 4.65 mg/L of Folic Acid; 15.60 mg/L of
i-Inositol; 3.02 mg/L of Niacinamide; 3.00 mg/L of Pyridoxal HCL;
0.031 mg/L of Pyridoxine HCL; 0.319 mg/L of Riboflavin; 3.17 mg/L
of Thiamine HCL; 0.365 mg/L of Thymidine; 0.680 mg/L of Vitamin
B.sub.12; 25 mM of HEPES Buffer; 2.39 mg/L of Na Hypoxanthine;
0.105 mg/L of Lipoic Acid; 0.081 mg/L of Sodium Putrescine-2HCL;
55.0 mg/L of Sodium Pyruvate; 0.0067 mg/L of Sodium Selenite; 20 uM
of Ethanolamine; 0.122 mg/L of Ferric Citrate; 41.70 mg/L of
Methyl-B-Cyclodextrin complexed with Linoleic Acid; 33.33 mg/L of
Methyl-B-Cyclodextrin complexed with Oleic Acid; 10 mg/L of
Methyl-B-Cyclodextrin complexed with Retinal Acetate. Adjust
osmolarity to 327 mOsm) with 2 mm glutamine and 1.times. penstrep.
(BSA (81-068-3 BAYER.TM.) 100 gm dissolved in 1 L DMEM for a 10%
BSA stock solution). Filter the media and collect 50 ul for
endotoxin assay in 15 ml polystyrene conical.
[0977] The transfection reaction is terminated, preferably by
tag-teaming, at the end of the incubation period. Person A
aspirates off the transfection media, while person B adds 1.5 ml
appropriate media to each well. Incubate at 37 degree C. for 45 or
72 hours depending on the media used: 1% BSA for 45 hours or CHO-5
for 72 hours.
[0978] On day four, using a 300 ul multichannel pipetter, aliquot
600 ul in one 1 ml deep well plate and the remaining supernatant
into a 2 ml deep well. The supernatants from each well can then be
used in the assays described in Examples 18-25.
[0979] It is specifically understood that when activity is obtained
in any of the assays described below using a supernatant, the
activity originates from either the G-protein Chemokine Receptor
(CCR5) polypeptide directly (e.g., as a secreted, soluble, or
membrane associated protein) or the G-protein Chemokine Receptor
(CCR5) ligand directly, or by the G-protein Chemokine Receptor
(CCR5) ligand inducing expression of other proteins, which are then
secreted into the supernatant. Thus, the invention further provides
a method of identifying the protein in the supernatant
characterized by an activity in a particular assay.
Example 17
Construction of GAS Reporter Construct
[0980] One signal transduction pathway involved in the
differentiation and proliferation of cells is called the Jaks-STATs
pathway. Activated proteins in the Jaks-STATs pathway bind to gamma
activation site "GAS" elements or interferon-sensitive responsive
element ("ISRE"), located in the promoter of many genes. The
binding of a protein to these elements alter the expression of the
associated gene.
[0981] GAS and ISRE elements are recognized by a class of
transcription factors called Signal Transducers and Activators of
Transcription, or "STATs." There are six members of the STATs
family. Stat1 and Stat3 are present in many cell types, as is Stat2
(as response to IFN-alpha is widespread). Stat4 is more restricted
and is not in many cell types though it has been found in T helper
class I, cells after treatment with IL-12. Stat5 was originally
called mammary growth factor, but has been found at higher
concentrations in other cells including myeloid cells. It can be
activated in tissue culture cells by many cytokines.
[0982] The STATs are activated to translocate from the cytoplasm to
the nucleus upon tyrosine phosphorylation by a set of kinases known
as the Janus Kinase ("Jaks") family. Jaks represent a distinct
family of soluble tyrosine kinases and include Tyk2, Jak1, Jak2,
and Jak3. These kinases display significant sequence similarity and
are generally catalytically inactive in resting cells.
[0983] The Jaks are activated by a wide range of receptors
summarized in the Table 3 below. (Adapted from review by Schidler
and Darnell, Ann. Rev. Biochem. 64:621-51 (1995).) A cytokine
receptor family, capable of activating Jaks, is divided into two
groups: (a) Class 1 includes receptors for IL-2, IL-3, IL-4, IL-6,
IL-7, IL-9, IL-11, IL-12, IL-15, Epo, PRL, GH, G-CSF, GM-CSF, LIF,
CNTF, and thrombopoietin; and (b) Class 2 includes IFN-a, IFN-g,
and IL-10. The Class 1 receptors share a conserved cysteine motif
(a set of four conserved cysteines and one tryptophan) and a WSXWS
motif (a membrane proximal region encoding Trp-Ser-Xxx-Trp-Ser (SEQ
ID NO:11)).
[0984] Thus, on binding of a ligand to a receptor, Jaks are
activated, which in turn activate STATs, which then translocate and
bind to GAS elements. This entire process is encompassed in the
Jaks-STATs signal transduction pathway.
[0985] Therefore, activation of the Jaks-STATs pathway, reflected
by the binding of the GAS or the ISRE element, can be used to
indicate proteins involved in the proliferation and differentiation
of cells. For example, growth factors and cytokines are known to
activate the Jaks-STATs pathway. (See Table 3 below.) Thus, by
using GAS elements linked to reporter molecules, activators of the
Jaks-STATs pathway can be identified.
TABLE-US-00004 TABLE 3 JAKs STATS Ligand tyk2 Jak1 Jak2 Jak3
GAS(elements) or ISRE IFN family IFN-a/B + + - - 1, 2, 3 ISRE IFN-g
+ + - 1 GAS (IRF1 > Lys6 > IFP) Il-10 + ? ? - 1, 3 gp130
family IL-6 (Pleiotrophic) + + + ? 1, 3 GAS (IRF1 > Lys6 >
IFP) Il-11 (Pleiotrophic) ? + ? ? 1, 3 OnM(Pleiotrophic) ? + + ? 1,
3 LIF(Pleiotrophic) ? + + ? 1, 3 CNTF(Pleiotrophic) -/+ + + ? 1, 3
G-CSF(Pleiotrophic) ? + ? ? 1, 3 IL-12(Pleiotrophic) + - + + 1, 3
g-C family IL-2 (lymphocytes) - + - + 1, 3, 5 GAS IL-4
(lymph/myeloid) - + - + 6 GAS(IRF1 = IFP >> Ly6)(IgH) IL-7
(lymphocytes) - + - + 5 GAS IL-9 (lymphocytes) - + - + 5 GAS IL-13
(lymphocyte) - + ? ? 6 GAS IL-15 ? + ? + 5 GAS gp140 family IL-3
(myeloid) - - + - 5 GAS (IRF1 > IFP >> Ly6) IL-5 (myeloid)
- - + - 5 GAS GM-CSF (myeloid) - - + - 5 GAS Growth hormone family
GH ? - + - 5 PRL ? +/- + - 1, 3, 5 EPO ? - + - 5 GAS(B-CAS >
IRF1 = IFP >> Ly6) Receptor Tyrosine Kinases EGF ? + + - 1, 3
GAS (IRF1) PDGF ? + + - 1, 3 CSF-1 ? + + - 1, 3 GAS (not IRF1)
[0986] To construct a synthetic GAS containing promoter element,
which is used in the Biological Assays described in Examples 18-19,
a PCR based strategy is employed to generate a GAS-SV40 promoter
sequence. The 5' primer contains four tandem copies of the GAS
binding site found in the IRF1 promoter and previously demonstrated
to bind STATs upon induction with a range of cytokines (Rothman et
al., Immunity 1:457-468 (1994).), although other GAS or ISRE
elements can be used instead. The 5' primer also contains 18 bp of
sequence complementary to the SV40 early promoter sequence and is
flanked with an XhoI site. The sequence of the 5' primer is:
TABLE-US-00005 (SEQ ID NO: 12)
5':GCGCCTCGAGATTTCCCCGAAATCTAGATTTCCCCGAAATGAT
TTCCCCGAAATGATTTCCCCGAAATATCTGCCATCTCAATTAG:3'
[0987] The downstream primer is complementary to the SV40 promoter
and is flanked with a Hind III site:
TABLE-US-00006 5':GCGGCAAGCTTTTTGCAAAGCCTAGGC:3' (SEQ ID NO:
13)
[0988] PCR amplification is performed using the SV40 promoter
template present in the B-gal:promoter plasmid obtained from
CLONTECH.TM.. The resulting PCR fragment is digested with XhoI/Hind
III and subcloned into BLSK2-. (STRATAGENE.TM..) Sequencing with
forward and reverse primers confirms that the insert contains the
following sequence:
TABLE-US-00007 (SEQ ID NO: 14)
5':CTCGAGATTTCCCCGAAATCTAGATTTCCCCGAAATGATTTCCCCGAAATGATTTCCCCGAAATATC
TGCCATCTCAATTAGTCAGCAACCATAGTCCCGCCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCC
AGTTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCG
GCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTTGCAAAAAGCTT:3'
[0989] With this GAS promoter element linked to the SV40 promoter,
a GAS:SEAP2 reporter construct is next engineered. Here, the
reporter molecule is a secreted alkaline phosphatase, or "SEAP."
Clearly, however, any reporter molecule can be instead of SEAP, in
this or in any of the other Examples. Well known reporter molecules
that can be used instead of SEAP include chloramphenicol
acetyltransferase (CAT), luciferase, alkaline phosphatase,
B-galactosidase, green fluorescent protein (GFP), or any protein
detectable by an antibody.
[0990] The above sequence confirmed synthetic GAS-SV40 promoter
element is subcloned into the pSEAP-Promoter vector obtained from
CLONTECH.TM. using HindIII and XhoI, effectively replacing the SV40
promoter with the amplified GAS:SV40 promoter element, to create
the GAS-SEAP vector. However, this vector does not contain a
neomycin resistance gene, and therefore, is not preferred for
mammalian expression systems.
[0991] Thus, in order to generate mammalian stable cell lines
expressing the GAS-SEAP reporter, the GAS-SEAP cassette is removed
from the GAS-SEAP vector using SalI and NotI, and inserted into a
backbone vector containing the neomycin resistance gene, such as
pGFP-1 (CLONTECH.TM.), using these restriction sites in the
multiple cloning site, to create the GAS-SEAP/Neo vector. Once this
vector is transfected into mammalian cells, this vector can then be
used as a reporter molecule for GAS binding as described in
Examples 18-19.
[0992] Other constructs can be made using the above description and
replacing GAS with a different promoter sequence. For example,
construction of reporter molecules containing NFK-B and EGR
promoter sequences are described in Examples 20 and 21. However,
many other promoters can be substituted using the protocols
described in these Examples. For instance, SRE, IL-2, NFAT, or
Osteocalcin promoters can be substituted, alone or in combination
(e.g., GAS/NF-KB/EGR, GAS/NF-KB, Il-2/NFAT, or NF-KB/GAS).
Similarly, other cell lines can be used to test reporter construct
activity, such as HELA (epithelial), HUVEC (endothelial), Reh
(B-cell), Saos-2 (osteoblast), HUVAC (aortic), or
Cardiomyocyte.
Example 18
High-Throughput Screening Assay for T-Cell Activity
[0993] The following protocol is used to assess T-cell activity by
identifying factors, and determining whether supernatant containing
a polypeptide of the invention or a ligand thereof proliferates
and/or differentiates T-cells. T-cell activity is assessed using
the GAS/SEAP/Neo construct produced in Example 17. Thus, factors
that increase SEAP activity indicate the ability to activate the
Jaks-STATS signal transduction pathway. The T-cell used in this
assay is Jurkat T-cells (ATCC.TM. Accession No. TIB-152), although
Molt-3 cells (ATCC.TM. Accession No. CRL-1552) and Molt-4 cells
(ATCC.TM. Accession No. CRL-1582) cells can also be used.
[0994] Jurkat T-cells are lymphoblastic CD4+ Th1 helper cells. In
order to generate stable cell lines, approximately 2 million Jurkat
cells are transfected with the GAS-SEAP/neo vector using DMRIE-C
(LIFE TECHNOLOGIES.TM.) (transfection procedure described below).
The transfected cells are seeded to a density of approximately
20,000 cells per well and transfectants resistant to 1 mg/ml
genticin selected. Resistant colonies are expanded and then tested
for their response to increasing concentrations of interferon
gamma. The dose response of a selected clone is demonstrated.
[0995] Specifically, the following protocol will yield sufficient
cells for 75 wells containing 200 ul of cells. Thus, it is either
scaled up, or performed in multiple to generate sufficient cells
for multiple 96 well plates. Jurkat cells are maintained in
RPMI+10% serum with 1% Pen-Strep. Combine 2.5 mls of OPTI-MEM.TM.
(LIFE TECHNOLOGIES.TM.) with 10 ug of plasmid DNA in a T25 flask.
Add 2.5 ml OPTI-MEM.TM. containing 50 ul of DMRIE-C and incubate at
room temperature for 15-45 mins.
[0996] During the incubation period, count cell concentration, spin
down the required number of cells (10.sup.7 per transfection), and
resuspend in OPTI-MEM.TM. to a final concentration of 10.sup.7
cells/ml. Then add 1 ml of 1.times.10.sup.7 cells in OPTI-MEM.TM.
to T25 flask and incubate at 37 degree C. for 6 hrs. After the
incubation, add 10 ml of RPMI+15% serum.
[0997] The Jurkat:GAS-SEAP stable reporter lines are maintained in
RPMI+10% serum, 1 mg/ml Genticin, and 1% Pen-Strep. These cells are
treated with supernatants containing G-protein Chemokine Receptor
(CCR5) polypeptides or G-protein Chemokine Receptor (CCR5) induced
polypeptides as produced by the protocol described in Example
16.
[0998] On the day of treatment with the supernatant, the cells
should be washed and resuspended in fresh RPMI+10% serum to a
density of 500,000 cells per ml. The exact number of cells required
will depend on the number of supernatants being screened. For one
96 well plate, approximately 10 million cells (for 10 plates, 100
million cells) are required.
[0999] Transfer the cells to a triangular reservoir boat, in order
to dispense the cells into a 96 well dish, using a 12 channel
pipette. Using a 12 channel pipette, transfer 200 ul of cells into
each well (therefore adding 100,000 cells per well).
[1000] After all the plates have been seeded, 50 ul of the
supernatants are transferred directly from the 96 well plate
containing the supernatants into each well using a 12 channel
pipette. In addition, a dose of exogenous interferon gamma (0.1,
1.0, 10 ng) is added to wells H9, H10, and H11 to serve as
additional positive controls for the assay.
[1001] The 96 well dishes containing Jurkat cells treated with
supernatants are placed in an incubator for 48 hrs (note: this time
is variable between 48-72 hrs). 35 ul samples from each well are
then transferred to an opaque 96 well plate using a 12 channel
pipette. The opaque plates should be covered (using sellophene
covers) and stored at -20 degree C. until SEAP assays are performed
according to Example 18. The plates containing the remaining
treated cells are placed at 4 degree C. and serve as a source of
material for repeating the assay on a specific well if desired.
[1002] As a positive control, 100 Unit/ml interferon gamma can be
used which is known to activate Jurkat T cells. Over 30 fold
induction is typically observed in the positive control wells.
[1003] The above protocol may be used in the generation of both
transient, as well as stable transfected cells, which would be
apparent to those of skill in the art.
Example 19
High-Throughput Screening Assay Identifying Myeloid Activity
[1004] The following protocol is used to assess myeloid activity of
G-protein Chemokine Receptor (CCR5) by determining whether
G-protein Chemokine Receptor (CCR5) or G-protein Chemokine Receptor
(CCR5) ligand proliferates and/or differentiates myeloid cells.
Myeloid cell activity is assessed using the GAS/SEAP/Neo construct
produced in Example 17. Thus, factors that increase SEAP activity
indicate the ability to activate the Jaks-STATS signal transduction
pathway. The myeloid cell used in this assay is U937, a
pre-monocyte cell line, although TF-1, HL60, or KG1 can be
used.
[1005] To transiently transfect U937 cells with the GAS/SEAP/Neo
construct produced in Example 17, a DEAE-Dextran method (Kharbanda
et. al., 1994, Cell Growth & Differentiation, 5:259-265) is
used. First, harvest 2.times.10e.sup.7 U937 cells and wash with
PBS. The U937 cells are usually grown in RPMI 1640 medium
containing 10% heat-inactivated fetal bovine serum (FBS)
supplemented with 100 units/ml penicillin and 100 mg/ml
streptomycin.
[1006] Next, suspend the cells in 1 ml of 20 mM Tris-HCl (pH 7.4)
buffer containing 0.5 mg/ml DEAE-Dextran, 8 ug GAS-SEAP2 plasmid
DNA, 140 mM NaCl, 5 mM KCl, 375 uM Na.sub.2HPO.sub.4.7H.sub.2O, 1
mM MgCl.sub.2, and 675 uM CaCl.sub.2. Incubate at 37 degrees C. for
45 min.
[1007] Wash the cells with RPMI 1640 medium containing 10% FBS and
then resuspend in 10 ml complete medium and incubate at 37 degree
C. for 36 hr.
[1008] The GAS-SEAP/U937 stable cells are obtained by growing the
cells in 400 ug/ml G418. The G418-free medium is used for routine
growth but every one to two months, the cells should be re-grown in
400 ug/ml G418 for couple of passages.
[1009] These cells are tested by harvesting 1.times.10.sup.8 cells
(this is enough for ten 96-well plates assay) and wash with PBS.
Suspend the cells in 200 ml above described growth medium, with a
final density of 5.times.10.sup.5 cells/ml. Plate 200 ul cells per
well in the 96-well plate (or 1.times.10.sup.5 cells/well).
[1010] Add 50 ul of the supernatant prepared by the protocol
described in Example 16. Incubate at 37 degree C. for 48 to 72 hr.
As a positive control, 100 Unit/ml interferon gamma can be used
which is known to activate U937 cells. Over 30 fold induction is
typically observed in the positive control wells. SEAP assay the
supernatant according to the protocol described in Example 22.
Example 20
High-Throughput Screening Assay Identifying Neuronal Activity
[1011] When cells undergo differentiation and proliferation, a
group of genes is activated through many different signal
transduction pathways. One of these genes, EGR1 (early growth
response gene 1), is induced in various tissues and cell types upon
activation. The promoter of EGR1 is responsible for such induction.
Using the EGR1 promoter linked to reporter molecules, activation of
cells by G-protein Chemokine Receptor (CCR5) or a ligand thereof
can be assessed.
[1012] Particularly, the following protocol is used to assess
neuronal activity in PC12 cell lines. PC12 cells (rat
phenochromocytoma cells) are known to proliferate and/or
differentiate by activation with a number of mitogens, such as TPA
(tetradecanoyl phorbol acetate), NGF (nerve growth factor), and EGF
(epidermal growth factor). The EGR1 gene expression is activated
during this treatment. Thus, by stably transfecting PC12 cells with
a construct containing an EGR promoter linked to SEAP reporter,
activation of PC12 cells by G-protein Chemokine Receptor (CCR5) or
a ligand thereof can be assessed.
[1013] The EGR/SEAP reporter construct can be assembled by the
following protocol. The EGR-1 promoter sequence (-633 to +1)
(Sakamoto K et al., Oncogene 6:867-871 (1991)) can be PCR amplified
from human genomic DNA using the following primers:
TABLE-US-00008 (SEQ ID NO: 15)
5'GCGCTCGAGGGATGACAGCGATAGAACCCCGG-3' (SEQ ID NO: 16)
5'GCGAAGCTTCGCGACTCCCCGGATCCGCCTC-3'
[1014] Using the GAS:SEAP/Neo vector produced in Example 17, EGR1
amplified product can then be inserted into this vector. Linearize
the GAS:SEAP/Neo vector using restriction enzymes XhoI/HindIII,
removing the GAS/SV40 stuffier. Restrict the EGR1 amplified product
with these same enzymes. Ligate the vector and the EGR1
promoter.
[1015] To prepare 96 well-plates for cell culture, two mls of a
coating solution (1:30 dilution of collagen type I (Upstate Biotech
Inc. Cat. No. 08-115) in 30% ethanol (filter sterilized)) is added
per one 10 cm plate or 50 ml per well of the 96-well plate, and
allowed to air dry for 2 hr.
[1016] PC12 cells are routinely grown in RPMI-1640 medium (Bio
Whittaker) containing 10% horse serum (JRH BIOSCIENCES, Cat. No.
12449-78P), 5% heat-inactivated fetal bovine serum (FBS)
supplemented with 100 units/ml penicillin and 100 ug/ml
streptomycin on a precoated 10 cm tissue culture dish. One to four
split is done every three to four days. Cells are removed from the
plates by scraping and resuspended with pipetting up and down for
more than 15 times.
[1017] Transfect the EGR/SEAP/Neo construct into PC12 using the
Lipofectamine protocol described in Example 16. EGR-SEAP/PC12
stable cells are obtained by growing the cells in 300 ug/ml G418.
The G418-free medium is used for routine growth but every one to
two months, the cells should be re-grown in 300 ug/ml G418 for
couple of passages.
[1018] To assay for neuronal activity, a 10 cm plate with cells
around 70 to 80% confluent is screened by removing the old medium.
Wash the cells once with PBS (Phosphate buffered saline). Then
starve the cells in low serum medium (RPMI-1640 containing 1% horse
serum and 0.5% FBS with antibiotics) overnight.
[1019] The next morning, remove the medium and wash the cells with
PBS. Scrape off the cells from the plate, suspend the cells well in
2 ml low serum medium. Count the cell number and add more low serum
medium to reach final cell density as 5.times.10.sup.5
cells/ml.
[1020] Add 200 ul of the cell suspension to each well of 96-well
plate (equivalent to 1.times.10.sup.5 cells/well). Add 50 ul
supernatant produced by Example 12, 37 degree C. for 48 to 72 hr.
As a positive control, a growth factor known to activate PC12 cells
through EGR can be used, such as 50 ng/ul of Neuronal Growth Factor
(NGF). Over fifty-fold induction of SEAP is typically seen in the
positive control wells. SEAP assay the supernatant according to
Example 22.
Example 21
High-Throughput Screening Assay for T-Cell Activity
[1021] NF-KB (Nuclear Factor KB) is a transcription factor
activated by a wide variety of agents including the inflammatory
cytokines IL-1 and TNF, CD30 and CD40, lymphotoxin-alpha and
lymphotoxin-beta, by exposure to LPS or thrombin, and by expression
of certain viral gene products. As a transcription factor, NF-KB
regulates the expression of genes involved in immune cell
activation, control of apoptosis (NF-KB appears to shield cells
from apoptosis), B and T-cell development, anti-viral and
antimicrobial responses, and multiple stress responses.
[1022] In non-stimulated conditions, NF-KB is retained in the
cytoplasm with I-KB (Inhibitor KB). However, upon stimulation, I-KB
is phosphorylated and degraded, causing NF-KB to shuttle to the
nucleus, thereby activating transcription of target genes. Target
genes activated by NF-KB include IL-2, IL-6, GM-CSF, ICAM-1 and
class 1 MHC.
[1023] Due to its central role and ability to respond to a range of
stimuli, reporter constructs utilizing the NF-KB promoter element
are used to screen the supernatants produced in Example 16.
Activators or inhibitors of NF-KB would be useful in treating,
preventing, and/or diagnosing diseases. For example, inhibitors of
NF-KB could be used to treat those diseases related to the acute or
chronic activation of NF-KB, such as rheumatoid arthritis.
[1024] To construct a vector containing the NF-KB promoter element,
a PCR based strategy is employed. The upstream primer contains four
tandem copies of the NF-KB binding site (GGGGACTTTCCC) (SEQ ID
NO:17), 18 bp of sequence complementary to the 5' end of the SV40
early promoter sequence, and is flanked with an XhoI site:
TABLE-US-00009 (SEQ ID NO: 18)
5':GCGGCCTCGAGGGGACTTTCCCGGGGACTTTCCGGG
GACTTTCCGGGACTTTCCATCCTGCCATCTCAATTAG:3'
[1025] The downstream primer is complementary to the 3' end of the
SV40 promoter and is flanked with a Hind III site:
5':GCGGCAAGCTTTTTGCAAAGCCTAGGC:3' (SEQ ID NO:19)
[1026] PCR amplification is performed using the SV40 promoter
template present in the pB-gal:promoter plasmid obtained from
CLONTECH.TM.. The resulting PCR fragment is digested with XhoI and
Hind III and subcloned into BLSK2-. (STRATAGENE.TM.) Sequencing
with the T7 and T3 primers confirms the insert contains the
following sequence:
TABLE-US-00010 (SEQ ID NO: 20)
5':CTCGAGGGGACTTTCCCGGGGACTTTCCGGGGACTTTCCGGGACTTTCCATCTGCCATCTCAATTAG
TCAGCAACCATAGTCCCGCCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCT
CCGCCCCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCGGCCTCTGAGCTATTC
CAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTTGCAAAAAGCTT:3'
[1027] Next, replace the SV40 minimal promoter element present in
the pSEAP2-promoter plasmid (CLONTECH.TM.) with this NF-KB/SV40
fragment using XhoI and HindIII. However, this vector does not
contain a neomycin resistance gene, and therefore, is not preferred
for mammalian expression systems.
[1028] In order to generate stable mammalian cell lines, the
NF-KB/SV40/SEAP cassette is removed from the above NF-KB/SEAP
vector using restriction enzymes SalI and NotI, and inserted into a
vector containing neomycin resistance. Particularly, the
NF-KB/SV40/SEAP cassette was inserted into pGFP-1 (CLONTECH.TM.),
replacing the GFP gene, after restricting pGFP-1 with SalI and
NotI.
[1029] Once NF-KB/SV40/SEAP/Neo vector is created, stable Jurkat
T-cells are created and maintained according to the protocol
described in Example 18. Similarly, the method for assaying
supernatants with these stable Jurkat T-cells is also described in
Example 18. As a positive control, exogenous TNF alpha (0.1, 1, 10
ng) is added to wells H9, H10, and H11, with a 5-10 fold activation
typically observed.
Example 22
Assay for SEAP Activity
[1030] As a reporter molecule for the assays described in Examples
18-21, SEAP activity is assayed using the Tropix Phospho-light Kit
(Cat. BP-400) according to the following general procedure. The
Tropix Phospho-light Kit supplies the Dilution, Assay, and Reaction
Buffers used below.
[1031] Prime a dispenser with the 2.5.times. Dilution Buffer and
dispense 15 ul of 2.5.times. dilution buffer into Optiplates
containing 35 ul of a supernatant. Seal the plates with a plastic
sealer and incubate at 65 degree C. for 30 min. Separate the
Optiplates to avoid uneven heating.
[1032] Cool the samples to room temperature for 15 minutes. Empty
the dispenser and prime with the Assay Buffer. Add 50 ml Assay
Buffer and incubate at room temperature 5 min Empty the dispenser
and prime with the Reaction Buffer (see the table below). Add 50 ul
Reaction Buffer and incubate at room temperature for 20 minutes.
Since the intensity of the chemiluminescent signal is time
dependent, and it takes about 10 minutes to read 5 plates on
luminometer, one should treat 5 plates at each time and start the
second set 10 minutes later.
[1033] Read the relative light unit in the luminometer. Set H12 as
blank, and print the results. An increase in chemiluminescence
indicates reporter activity.
Reaction Buffer Formulation:
TABLE-US-00011 [1034] # of plates Rxn buffer diluent (ml) CSPD (ml)
10 60 3 11 65 3.25 12 70 3.5 13 75 3.75 14 80 4 15 85 4.25 16 90
4.5 17 95 4.75 18 100 5 19 105 5.25 20 110 5.5 21 115 5.75 22 120 6
23 125 6.25 24 130 6.5 25 135 6.75 26 140 7 27 145 7.25 28 150 7.5
29 155 7.75 30 160 8 31 165 8.25 32 170 8.5 33 175 8.75 34 180 9 35
185 9.25 36 190 9.5 37 195 9.75 38 200 10 39 205 10.25 40 210 10.5
41 215 10.75 42 220 11 43 225 11.25 44 230 11.5 45 235 11.75 46 240
12 47 245 12.25 48 250 12.5 49 255 12.75 50 260 13
Example 23
High-Throughput Screening Assay Identifying Changes in Small
Molecule Concentration and Membrane Permeability
[1035] Binding of a ligand to a receptor is known to alter
intracellular levels of small molecules, such as calcium,
potassium, sodium, and pH, as well as alter membrane potential.
These alterations can be measured in an assay to identify
supernatants which bind to receptors of a particular cell. Although
the following protocol describes an assay for calcium, this
protocol can easily be modified to detect changes in potassium,
sodium, pH, membrane potential, or any other small molecule which
is detectable by a fluorescent probe.
[1036] The following assay uses Fluorometric Imaging Plate Reader
("FLIPR") to measure changes in fluorescent molecules (Molecular
Probes) that bind small molecules. Clearly, any fluorescent
molecule detecting a small molecule can be used instead of the
calcium fluorescent molecule, fluo-4 (Molecular Probes, Inc.;
catalog no. F-14202), used here.
[1037] For adherent cells, seed the cells at 10,000-20,000
cells/well in a Co-star black 96-well plate with clear bottom. The
plate is incubated in a CO.sub.2 incubator for 20 hours. The
adherent cells are washed two times in Biotek washer with 200 ul of
HBSS (Hank's Balanced Salt Solution) leaving 100 ul of buffer after
the final wash.
[1038] A stock solution of 1 mg/ml fluo-4 is made in 10% pluronic
acid DMSO. To load the cells with fluo-4, 50 ul of 12 ug/ml fluo-4
is added to each well. The plate is incubated at 37 degrees C. in a
CO.sub.2 incubator for 60 min. The plate is washed four times in
the Biotek washer with HBSS leaving 100 ul of buffer.
[1039] For non-adherent cells, the cells are spun down from culture
media. Cells are re-suspended to 2-5.times.10.sup.6 cells/ml with
HBSS in a 50-ml conical tube. 4 ul of 1 mg/ml fluo-4 solution in
10% pluronic acid DMSO is added to each ml of cell suspension. The
tube is then placed in a 37 degrees C. water bath for 30-60 min.
The cells are washed twice with HBSS, resuspended to
1.times.10.sup.6 cells/ml, and dispensed into a microplate, 100
ul/well. The plate is centrifuged at 1000 rpm for 5 min. The plate
is then washed once in Denley CellWash with 200 ul, followed by an
aspiration step to 100 ul final volume.
[1040] For a non-cell based assay, each well contains a fluorescent
molecule, such as fluo-4. The supernatant is added to the well, and
a change in fluorescence is detected.
[1041] To measure the fluorescence of intracellular calcium, the
FLIPR is set for the following parameters: (1) System gain is
300-800 mW; (2) Exposure time is 0.4 second; (3) Camera F/stop is
F/2; (4) Excitation is 488 nm; (5) Emission is 530 nm; and (6)
Sample addition is 50 ul. Increased emission at 530 nm indicates an
extracellular signaling event caused by a molecule, such as
G-protein Chemokine Receptor (CCR5) or a ligand thereof, or a
molecule induced by G-protein Chemokine Receptor (CCR5), which has
resulted in an increase in the intracellular Ca.sup.++
concentration.
Example 24
High-Throughput Screening Assay Identifying Tyrosine Kinase
Activity
[1042] The Protein Tyrosine Kinases (PTK) represent a diverse group
of transmembrane and cytoplasmic kinases. Within the Receptor
Protein Tyrosine Kinase (RPTK) group are receptors for a range of
mitogenic and metabolic growth factors including the PDGF, FGF,
EGF, NGF, HGF and Insulin receptor subfamilies. In addition there
are a large family of RPTKs for which the corresponding ligand is
unknown. Ligands for RPTKs include mainly secreted small proteins,
but also membrane-bound and extracellular matrix proteins.
[1043] Activation of RPTK by ligands involves ligand-mediated
receptor dimerization, resulting in transphosphorylation of the
receptor subunits and activation of the cytoplasmic tyrosine
kinases. The cytoplasmic tyrosine kinases include receptor
associated tyrosine kinases of the src-family (e.g., src, yes, lck,
lyn, fyn) and non-receptor linked and cytosolic protein tyrosine
kinases, such as the Jak family, members of which mediate signal
transduction triggered by the cytokine superfamily of receptors
(e.g., the Interleukins, Interferons, GM-CSF, and Leptin).
[1044] Because of the wide range of known factors capable of
stimulating tyrosine kinase activity, identifying whether G-protein
Chemokine Receptor (CCR5) or a ligand thereof, or a molecule
induced by G-protein Chemokine Receptor (CCR5) is capable of
activating tyrosine kinase signal transduction pathways is of
interest. Therefore, the following protocol is designed to identify
such molecules capable of activating the tyrosine kinase signal
transduction pathways.
[1045] Seed target cells (e.g., primary keratinocytes) at a density
of approximately 25,000 cells per well in a 96 well LOPRODYNE.TM.
Silent Screen Plates purchased from Nalge Nunc (Naperville, Ill.).
The plates are sterilized with two 30 minute rinses with 100%
ethanol, rinsed with water and dried overnight. Some plates are
coated for 2 hr with 100 ml of cell culture grade type I collagen
(50 mg/ml), gelatin (2%) or polylysine (50 mg/ml), all of which can
be purchased from Sigma Chemicals (St. Louis, Mo.) or 10%
MATRIGEL.TM. purchased from Becton Dickinson (Bedford, Mass.), or
calf serum, rinsed with PBS and stored at 4 degree C. Cell growth
on these plates is assayed by seeding 5,000 cells/well in growth
medium and indirect quantitation of cell number through use of
ALAMAR BLUE.TM. as described by the manufacturer Alamar
Biosciences, Inc. (Sacramento, Calif.) after 48 hr. Falcon plate
covers #3071 from Becton Dickinson (Bedford, Mass.) are used to
cover the LOPRODYNE.TM. Silent Screen Plates. Falcon Microtest III
cell culture plates can also be used in some proliferation
experiments.
[1046] To prepare extracts, A431 cells are seeded onto the nylon
membranes of LOPRODYNE.TM. plates (20,000/200 ml/well) and cultured
overnight in complete medium. Cells are quiesced by incubation in
serum-free basal medium for 24 hr. After 5-20 minutes treatment
with EGF (60 ng/ml) or 50 ul of the supernatant produced in Example
16, the medium was removed and 100 ml of extraction buffer ((20 mM
HEPES pH 7.5, 0.15 M NaCl, 1% Triton X-100, 0.1% SDS, 2 mM Na3VO4,
2 mM Na4P2O7 and a cocktail of protease inhibitors (# 1836170)
obtained from Boeheringer Mannheim (Indianapolis, Ind.) is added to
each well and the plate is shaken on a rotating shaker for 5
minutes at 4.degree. C. The plate is then placed in a vacuum
transfer manifold and the extract filtered through the 0.45 mm
membrane bottoms of each well using house vacuum. Extracts are
collected in a 96-well catch/assay plate in the bottom of the
vacuum manifold and immediately placed on ice. To obtain extracts
clarified by centrifugation, the content of each well, after
detergent solubilization for 5 minutes, is removed and centrifuged
for 15 minutes at 4 degree C. at 16,000.times.g.
[1047] Test the filtered extracts for levels of tyrosine kinase
activity. Although many methods of detecting tyrosine kinase
activity are known, one method is described here.
[1048] Generally, the tyrosine kinase activity of a supernatant is
evaluated by determining its ability to phosphorylate a tyrosine
residue on a specific substrate (a biotinylated peptide).
Biotinylated peptides that can be used for this purpose include
PSK1 (corresponding to amino acids 6-20 of the cell division kinase
cdc2-p34) and PSK2 (corresponding to amino acids 1-17 of gastrin).
Both peptides are substrates for a range of tyrosine kinases and
are available from Boehringer Mannheim.
[1049] The tyrosine kinase reaction is set up by adding the
following components in order. First, add 10 ul of 5 uM
Biotinylated Peptide, then 10 ul ATP/Mg.sub.2+ (5 mM ATP/50 mM
MgCl.sub.2), then 10 ul of 5.times. Assay Buffer (40 mM imidazole
hydrochloride, pH7.3, 40 mM beta-glycerophosphate, 1 mM EGTA, 100
mM MgCl.sub.2, 5 mM MnCl.sub.2, 0.5 mg/ml BSA), then 5 ul of Sodium
Vanadate (1 mM), and then 5 ul of water. Mix the components gently
and preincubate the reaction mix at 30 degree C. for 2 min. Initial
the reaction by adding 10 ul of the control enzyme or the filtered
supernatant.
[1050] The tyrosine kinase assay reaction is then terminated by
adding 10 ul of 120 mm EDTA and place the reactions on ice.
[1051] Tyrosine kinase activity is determined by transferring 50 ul
aliquot of reaction mixture to a microtiter plate (MTP) module and
incubating at 37 degree C. for 20 min. This allows the streptavadin
coated 96 well plate to associate with the biotinylated peptide.
Wash the MTP module with 300 ul/well of PBS four times. Next add 75
ul of anti-phosphotyrosine antibody conjugated to horse radish
peroxidase (anti-P-Tyr-POD (0.5 u/ml)) to each well and incubate at
37 degree C. for one hour. Wash the well as above.
[1052] Next add 100 ul of peroxidase substrate solution (Boehringer
Mannheim) and incubate at room temperature for at least 5 mins (up
to 30 min). Measure the absorbance of the sample at 405 nm by using
ELISA reader. The level of bound peroxidase activity is quantitated
using an ELISA reader and reflects the level of tyrosine kinase
activity.
Example 25
High-Throughput Screening Assay Identifying Phosphorylation
Activity
[1053] As a potential alternative and/or compliment to the assay of
protein tyrosine kinase activity described in Example 24, an assay
which detects activation (phosphorylation) of major intracellular
signal transduction intermediates can also be used. For example, as
described below one particular assay can detect tyrosine
phosphorylation of the Erk-1 and Erk-2 kinases. However,
phosphorylation of other molecules, such as Raf, JNK, p38 MAP, Map
kinase (MEK), MEK kinase, Src, Muscle specific kinase (MuSK), IRAK,
Tec, and Janus, as well as any other phosphoserine,
phosphotyrosine, or phosphothreonine molecule, can be detected by
substituting these molecules for Erk-1 or Erk-2 in the following
assay.
[1054] Specifically, assay plates are made by coating the wells of
a 96-well ELISA plate with 0.1 ml of protein G (1 ug/ml) for 2 hr
at room temp, (RT). The plates are then rinsed with PBS and blocked
with 3% BSA/PBS for 1 hr at RT. The protein G plates are then
treated with 2 commercial monoclonal antibodies (100 ng/well)
against Erk-1 and Erk-2 (1 hr at RT) (Santa Cruz Biotechnology).
(To detect other molecules, this step can easily be modified by
substituting a monoclonal antibody detecting any of the above
described molecules.) After 3-5 rinses with PBS, the plates are
stored at 4 degree C. until use.
[1055] A431 cells are seeded at 20,000/well in a 96-well
LOPRODYNE.TM. filterplate and cultured overnight in growth medium.
The cells are then starved for 48 hr in basal medium (DMEM) and
then treated with EGF (6 ng/well) or 50 ul of the supernatants
obtained in Example 16 for 5-20 minutes. The cells are then
solubilized and extracts filtered directly into the assay
plate.
[1056] After incubation with the extract for 1 hr at RT, the wells
are again rinsed. As a positive control, a commercial preparation
of MAP kinase (10 ng/well) is used in place of A431 extract. Plates
are then treated with a commercial polyclonal (rabbit) antibody (1
ug/ml) which specifically recognizes the phosphorylated epitope of
the Erk-1 and Erk-2 kinases (1 hr at RT). This antibody is
biotinylated by standard procedures. The bound polyclonal antibody
is then quantitated by successive incubations with
Europium-streptavidin and Europium fluorescence enhancing reagent
in the Wallac DELFIA instrument (time-resolved fluorescence). An
increased fluorescent signal over background indicates a
phosphorylation by G-protein Chemokine Receptor (CCR5) or a ligand
thereof or a molecule induced by G-protein Chemokine Receptor.
Example 26
Method of Determining Alterations in the G-Protein Chemokine
Receptor (CCR5) Gene
[1057] RNA isolated from entire families or individual patients
presenting with a phenotype of interest (such as a disease) is be
isolated. cDNA is then generated from these RNA samples using
protocols known in the art. (See, Sambrook.) The cDNA is then used
as a template for PCR, employing primers surrounding regions of
interest in SEQ ID NO:1. Suggested PCR conditions consist of 35
cycles at 95 degree C. for 30 seconds; 60-120 seconds at 52-58
degree C.; and 60-120 seconds at 70 degree C., using buffer
solutions described in Sidransky, D., et al., Science 252:706
(1991).
[1058] PCR products are then sequenced using primers labeled at
their 5' end with T4 polynucleotide kinase, employing SequiTherm
Polymerase. (Epicentre Technologies). The intron-exon borders of
selected exons of G-protein Chemokine Receptor (CCR5) is also
determined and genomic PCR products analyzed to confirm the
results. PCR products harboring suspected mutations in G-protein
Chemokine Receptor (CCR5) is then cloned and sequenced to validate
the results of the direct sequencing.
[1059] PCR products of G-protein Chemokine Receptor (CCR5) are
cloned into T-tailed vectors as described in Holton, T. A. and
Graham, M. W., Nucleic Acids Research, 19:1156 (1991) and sequenced
with T7 polymerase (United States Biochemical). Affected
individuals are identified by mutations in G-protein Chemokine
Receptor (CCR5) not present in unaffected individuals.
[1060] Genomic rearrangements are also observed as a method of
determining alterations in a gene corresponding to G-protein
Chemokine Receptor. Genomic clones isolated according to Example 6
are nick-translated with digoxigenindeoxy-uridine 5'-triphosphate
(Boehringer Manheim), and FISH performed as described in Johnson, C
g. et al., Methods Cell Biol. 35:73-99 (1991). Hybridization with
the labeled probe is carried out using a vast excess of human cot-1
DNA for specific hybridization to the G-protein Chemokine Receptor
(CCR5) genomic locus.
[1061] Chromosomes are counterstained with
4,6-diamino-2-phenylidole and propidium iodide, producing a
combination of C- and R-bands. Aligned images for precise mapping
are obtained using a triple-band filter set (Chroma Technology,
Brattleboro, Vt.) in combination with a cooled charge-coupled
device camera (Photometrics, Tucson, Ariz.) and variable excitation
wavelength filters. (Johnson, C v. et al., Genet. Anal. Tech.
Appl., 8:75 (1991).) Image collection, analysis and chromosomal
fractional length measurements are performed using the ISee
Graphical Program System. (Inovision Corporation, Durham, N.C.)
Chromosome alterations of the genomic region of G-protein Chemokine
Receptor (CCR5) (hybridized by the probe) are identified as
insertions, deletions, and translocations. These G-protein
Chemokine Receptor (CCR5) alterations are used as a diagnostic
marker for an associated disease.
Example 27
Method of Detecting Abnormal Levels of G-Protein Chemokine Receptor
(CCR5) in a Biological Sample
[1062] G-protein Chemokine Receptor (CCR5) polypeptides can be
detected in a biological sample, and if an increased or decreased
level of G-protein Chemokine Receptor (CCR5) is detected, this
polypeptide is a marker for a particular phenotype. Methods of
detection are numerous, and thus, it is understood that one skilled
in the art can modify the following assay to fit their particular
needs.
[1063] For example, antibody-sandwich ELISAs are used to detect
G-protein Chemokine Receptor (CCR5) in a sample, preferably a
biological sample. Wells of a microtiter plate are coated with
specific antibodies to G-protein Chemokine Receptor (CCR5), at a
final concentration of 0.2 to 10 ug/ml. The antibodies are either
monoclonal or polyclonal and are produced by the method described
in Example 15. The wells are blocked so that non-specific binding
of G-protein Chemokine Receptor (CCR5) to the well is reduced.
[1064] The coated wells are then incubated for >2 hours at RT
with a sample containing G-protein Chemokine Receptor. Preferably,
serial dilutions of the sample should be used to validate results.
The plates are then washed three times with deionized or distilled
water to remove unbounded G-protein Chemokine Receptor.
[1065] Next, 50 ul of specific antibody-alkaline phosphatase
conjugate, at a concentration of 25-400 ng, is added and incubated
for 2 hours at room temperature. The plates are again washed three
times with deionized or distilled water to remove unbounded
conjugate.
[1066] Add 75 ul of 4-methylumbelliferyl phosphate (MUP) or
p-nitrophenyl phosphate (NPP) substrate solution to each well and
incubate 1 hour at room temperature. Measure the reaction by a
microtiter plate reader. Prepare a standard curve, using serial
dilutions of a control sample, and plot G-protein Chemokine
Receptor (CCR5) polypeptide concentration on the X-axis (log scale)
and fluorescence or absorbance of the Y-axis (linear scale).
Interpolate the concentration of the G-protein Chemokine Receptor
(CCR5) in the sample using the standard curve.
Example 28
Formulation
[1067] The invention also provides methods of treatment and/or
prevention of diseases, disorders, and/or conditions (such as, for
example, any one or more of the diseases, disorders, and/or
conditions disclosed herein) by administration to a subject of an
effective amount of a Therapeutic. By therapeutic is meant a
polynucleotides or polypeptides of the invention (including
fragments and variants), agonists or antagonists thereof, and/or
antibodies thereto, in combination with a pharmaceutically
acceptable carrier type (e.g., a sterile carrier).
[1068] The Therapeutic will be formulated and dosed in a fashion
consistent with good medical practice, taking into account the
clinical condition of the individual patient (especially the side
effects of treatment with the Therapeutic alone), the site of
delivery, the method of administration, the scheduling of
administration, and other factors known to practitioners. The
"effective amount" for purposes herein is thus determined by such
considerations.
[1069] As a general proposition, the total pharmaceutically
effective amount of the Therapeutic administered parenterally per
dose will be in the range of about 1 ug/kg/day to 10 mg/kg/day of
patient body weight, although, as noted above, this will be subject
to therapeutic discretion. More preferably, this dose is at least
0.01 mg/kg/day, and most preferably for humans between about 0.01
and 1 mg/kg/day for the hormone. If given continuously, the
Therapeutic is typically administered at a dose rate of about 1
ug/kg/hour to about 50 ug/kg/hour, either by 1-4 injections per day
or by continuous subcutaneous infusions, for example, using a
mini-pump. An intravenous bag solution may also be employed. The
length of treatment needed to observe changes and the interval
following treatment for responses to occur appears to vary
depending on the desired effect.
[1070] Therapeutics can be are administered orally, rectally,
parenterally, intracistemally, intravaginally, intraperitoneally,
topically (as by powders, ointments, gels, drops or transdermal
patch), bucally, or as an oral or nasal spray. "Pharmaceutically
acceptable carrier" refers to a non-toxic solid, semisolid or
liquid filler, diluent, encapsulating material or formulation
auxiliary of any. The term "parenteral" as used herein refers to
modes of administration which include intravenous, intramuscular,
intraperitoneal, intrasternal, subcutaneous and intraarticular
injection and infusion.
[1071] Therapeutics of the invention are also suitably administered
by sustained-release systems. Suitable examples of
sustained-release Therapeutics are administered orally, rectally,
parenterally, intracistemally, intravaginally, intraperitoneally,
topically (as by powders, ointments, gels, drops or transdermal
patch), bucally, or as an oral or nasal spray. "Pharmaceutically
acceptable carrier" refers to a non-toxic solid, semisolid or
liquid filler, diluent, encapsulating material or formulation
auxiliary of any type. The term "parenteral" as used herein refers
to modes of administration which include intravenous,
intramuscular, intraperitoneal, intrasternal, subcutaneous and
intraarticular injection and infusion.
[1072] Therapeutics of the invention are also suitably administered
by sustained-release systems. Suitable examples of
sustained-release Therapeutics include suitable polymeric materials
(such as, for example, semi-permeable polymer matrices in the form
of shaped articles, e.g., films, or microcapsules), suitable
hydrophobic materials (for example as an emulsion in an acceptable
oil) or ion exchange resins, and sparingly soluble derivatives
(such as, for example, a sparingly soluble salt).
[1073] Sustained-release matrices include polylactides (U.S. Pat.
No. 3,773,919, EP 58,481), copolymers of L-glutamic acid and
gamma-ethyl-L-glutamate (Sidman et al., Biopolymers 22:547-556
(1983)), poly (2-hydroxyethyl methacrylate) (Langer et al., J.
Biomed. Mater. Res. 15:167-277 (1981), and Langer, Chem. Tech.
12:98-105 (1982)), ethylene vinyl acetate (Langer et al., Id.) or
poly-D-(-)-3-hydroxybutyric acid (EP 133,988).
[1074] Sustained-release Therapeutics also include liposomally
entrapped Therapeutics of the invention (see generally, Langer,
Science 249:1527-1533 (1990); Treat et al., in Liposomes in the
Therapy of Infectious Disease and Cancer, Lopez-Berestein and
Fidler (eds.), Liss, New York, pp. 317-327 and 353-365 (1989)).
Liposomes containing the Therapeutic are prepared by methods known
per se: DE 3,218,121; Epstein et al., Proc. Natl. Acad. Sci. (USA)
82:3688-3692 (1985); Hwang et al., Proc. Natl. Acad. Sci. (USA)
77:4030-4034 (1980); EP 52,322; EP 36,676; EP 88,046; EP 143,949;
EP 142,641; Japanese Pat. Appl. 83-118008; U.S. Pat. Nos. 4,485,045
and 4,544,545; and EP 102,324. Ordinarily, the liposomes are of the
small (about 200-800 Angstroms) unilamellar type in which the lipid
content is greater than about 30 mol. percent cholesterol, the
selected proportion being adjusted for the optimal Therapeutic.
[1075] In yet an additional embodiment, the Therapeutics of the
invention are delivered by way of a pump (see Langer, supra;
Sefton, CRC Crit. Ref. Biomed. Eng. 14:201 (1987); Buchwald et al.,
Surgery 88:507 (1980); Saudek et al., N. Engl. J. Med. 321:574
(1989)).
[1076] Other controlled release systems are discussed in the review
by Langer (Science 249:1527-1533 (1990)).
[1077] For parenteral administration, in one embodiment, the
Therapeutic is formulated generally by mixing it at the desired
degree of purity, in a unit dosage injectable form (solution,
suspension, or emulsion), with a pharmaceutically acceptable
carrier, i.e., one that is non-toxic to recipients at the dosages
and concentrations employed and is compatible with other
ingredients of the formulation. For example, the formulation
preferably does not include oxidizing agents and other compounds
that are known to be deleterious to the Therapeutic.
[1078] Generally, the formulations are prepared by contacting the
Therapeutic uniformly and intimately with liquid carriers or finely
divided solid carriers or both. Then, if necessary, the product is
shaped into the desired formulation. Preferably the carrier is a
parenteral carrier, more preferably a solution that is isotonic
with the blood of the recipient. Examples of such carrier vehicles
include water, saline, Ringer's solution, and dextrose solution.
Non-aqueous vehicles such as fixed oils and ethyl oleate are also
useful herein, as well as liposomes.
[1079] The carrier suitably contains minor amounts of additives
such as substances that enhance isotonicity and chemical stability.
Such materials are non-toxic to recipients at the dosages and
concentrations employed, and include buffers such as phosphate,
citrate, succinate, acetic acid, and other organic acids or their
salts; antioxidants such as ascorbic acid; low molecular weight
(less than about ten residues) polypeptides, e.g., polyarginine or
tripeptides; proteins, such as serum albumin, gelatin, or
immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone;
amino acids, such as glycine, glutamic acid, aspartic acid, or
arginine; monosaccharides, disaccharides, and other carbohydrates
including cellulose or its derivatives, glucose, manose, or
dextrins; chelating agents such as EDTA; sugar alcohols such as
mannitol or sorbitol; counterions such as sodium; and/or nonionic
surfactants such as polysorbates, poloxamers, or PEG.
[1080] The Therapeutic is typically formulated in such vehicles at
a concentration of about 0.1 mg/ml to 100 mg/ml, preferably 1-10
mg/ml, at a pH of about 3 to 8. It will be understood that the use
of certain of the foregoing excipients, carriers, or stabilizers
will result in the formation of polypeptide salts.
[1081] Any pharmaceutical used for therapeutic administration can
be sterile. Sterility is readily accomplished by filtration through
sterile filtration membranes (e.g., 0.2 micron membranes).
Therapeutics generally are placed into a container having a sterile
access port, for example, an intravenous solution bag or vial
having a stopper pierceable by a hypodermic injection needle.
[1082] Therapeutics ordinarily will be stored in unit or multi-dose
containers, for example, sealed ampoules or vials, as an aqueous
solution or as a lyophilized formulation for reconstitution. As an
example of a lyophilized formulation, 10-ml vials are filled with 5
ml of sterile-filtered 1% (w/v) aqueous Therapeutic solution, and
the resulting mixture is lyophilized. The infusion solution is
prepared by reconstituting the lyophilized Therapeutic using
bacteriostatic Water-for-Injection.
[1083] The invention also provides a pharmaceutical pack or kit
comprising one or more containers filled with one or more of the
ingredients of the Therapeutics of the invention. Associated with
such container(s) can be a notice in the form prescribed by a
governmental agency regulating the manufacture, use or sale of
pharmaceuticals or biological products, which notice reflects
approval by the agency of manufacture, use or sale for human
administration. In addition, the Therapeutics may be employed in
conjunction with other therapeutic compounds.
[1084] The Therapeutics of the invention may be administered alone
or in combination with adjuvants. Adjuvants that may be
administered with the Therapeutics of the invention include, but
are not limited to, alum, alum plus deoxycholate (ImmunoAg), MTP-PE
(Biocine Corp.), QS21 (Genentech, Inc.), BCG, and MPL. In a
specific embodiment, Therapeutics of the invention are administered
in combination with alum. In another specific embodiment,
Therapeutics of the invention are administered in combination with
QS-21. Further adjuvants that may be administered with the
Therapeutics of the invention include, but are not limited to,
Monophosphoryl lipid immunomodulator, AdjuVax 100a, QS-21, QS-18,
CRL1005, Aluminum salts, MF-59, and Virosomal adjuvant technology.
Vaccines that may be administered with the Therapeutics of the
invention include, but are not limited to, vaccines directed toward
protection against MMR (measles, mumps, rubella), polio, varicella,
tetanus/diptheria, hepatitis A, hepatitis B, haemophilus influenzae
B, whooping cough, pneumonia, influenza, Lyme's Disease, rotavirus,
cholera, yellow fever, Japanese encephalitis, poliomyelitis,
rabies, typhoid fever, and pertussis. Combinations may be
administered either concomitantly, e.g., as an admixture,
separately but simultaneously or concurrently; or sequentially.
This includes presentations in which the combined agents are
administered together as a therapeutic mixture, and also procedures
in which the combined agents are administered separately but
simultaneously, e.g., as through separate intravenous lines into
the same individual. Administration "in combination" further
includes the separate administration of one of the compounds or
agents given first, followed by the second.
[1085] The Therapeutics of the invention may be administered alone
or in combination with other therapeutic agents. Therapeutic agents
that may be administered in combination with the Therapeutics of
the invention, include but not limited to, other members of the TNF
family, chemotherapeutic agents, antibiotics, steroidal and
non-steroidal anti-inflammatories, conventional immunotherapeutic
agents, cytokines and/or growth factors. Combinations may be
administered either concomitantly, e.g., as an admixture,
separately but simultaneously or concurrently; or sequentially.
This includes presentations in which the combined agents are
administered together as a therapeutic mixture, and also procedures
in which the combined agents are administered separately but
simultaneously, e.g., as through separate intravenous lines into
the same individual. Administration "in combination" further
includes the separate administration of one of the compounds or
agents given first, followed by the second.
[1086] In one embodiment, the Therapeutics of the invention are
administered in combination with members of the TNF family. TNF,
TNF-related or TNF-like molecules that may be administered with the
Therapeutics of the invention include, but are not limited to,
soluble forms of TNF-alpha, lymphotoxin-alpha (LT-alpha, also known
as TNF-beta), LT-beta (found in complex heterotrimer
LT-alpha2-beta), OPGL, FasL, CD27L, CD30L, CD40L, 4-1BBL, DcR3,
OX40L, TNF-gamma (International Publication No. WO 96/14328), AIM-I
(International Publication No. WO 97/33899), endokine-alpha
(International Publication No. WO 98/07880), TR6 (International
Publication No. WO 98/30694), OPG, and neutrokine-alpha
(International Publication No. WO 98/18921, OX40, and nerve growth
factor (NGF), and soluble forms of Fas, CD30, CD27, CD40 and 4-IBB,
TR2 (International Publication No. WO 96/34095), DR3 (International
Publication No. WO 97/33904), DR4 (International Publication No. WO
98/32856), TR5 (International Publication No. WO 98/30693), TR6
(International Publication No. WO 98/30694), TR7 (International
Publication No. WO 98/41629), TRANK, TR9 (International Publication
No. WO 98/56892), TR10 (International Publication No. WO 98/54202),
312C2 (International Publication No. WO 98/06842), and TR12, and
soluble forms CD154, CD70, and CD153.
[1087] In certain embodiments, Therapeutics of the invention are
administered in combination with antiretroviral agents,
nucleoside/nucleotide reverse transcriptase inhibitors (NRTIs),
non-nucleoside reverse transcriptase inhibitors (NNRTIs), and/or
protease inhibitors (PIs). NRTIs that may be administered in
combination with the Therapeutics of the invention, include, but
are not limited to, RETROVIR.TM. (zidovudine/AZT), VIDEX.TM.
(didanosine/ddI), HIVID.TM. (zalcitabine/ddC), ZERIT.TM.
(stavudine/d4T), EPIVIR.TM. (lamivudine/3TC), and COMBIVIR.TM.
(zidovudine/lamivudine). NNRTIs that may be administered in
combination with the Therapeutics of the invention, include, but
are not limited to, VIRAMUNE.TM. (nevirapine), RESCRIPTOR.TM.
(delavirdine), and SUSTIVA.TM. (efavirenz). Protease inhibitors
that may be administered in combination with the Therapeutics of
the invention, include, but are not limited to, CRIXIVAN.TM.
(indinavir), NORVIR.TM. (ritonavir), INVIRASE.TM. (saquinavir), and
VIRACEPT.TM. (nelfinavir). In a specific embodiment, antiretroviral
agents, nucleoside reverse transcriptase inhibitors, non-nucleoside
reverse transcriptase inhibitors, and/or protease inhibitors may be
used in any combination with Therapeutics of the invention to treat
AIDS and/or to prevent or treat HIV infection.
[1088] Additional NRTIs include LODENOSINE.TM. (F-ddA; an
acid-stable adenosine NRTI; Triangle/ABBOTT.TM.; COVIRACIL.TM.
(emtricitabine/FTC; structurally related to lamivudine (3TC) but
with 3- to 10-fold greater activity in vitro; Triangle/ABBOTT.TM.);
dOTC (BCH-10652, also structurally related to lamivudine but
retains activity against a substantial proportion of
lamivudine-resistant isolates; Biochem Pharma); Adefovir (refused
approval for anti-HIV therapy by FDA; Gilead Sciences);
PREVEON.RTM. (Adefovir Dipivoxil, the active prodrug of adefovir;
its active form is PMEA-pp); TENOFOVIR.TM. (bis-POC PMPA, a PMPA
prodrug; Gilead); DAPD/DXG (active metabolite of DAPD;
Triangle/ABBOTT.TM.); D-D4FC (related to 3TC, with activity against
AZT/3TC-resistant virus); GW420867X (Glaxo Wellcome); ZIAGEN.TM.
(abacavir/159U89; Glaxo Wellcome Inc.); CS-87 (3'
azido-2',3'-dideoxyuridine; WO 99/66936); and S-acyl-2-thioethyl
(SATE)-bearing prodrug forms of .beta.-L-FD4C and .beta.-L-FddC (WO
98/17281).
[1089] Additional NNRTIs include COACTINON.TM. (Emivirine/MKC-442,
potent NNRTI of the HEPT class; Triangle/ABBOTT.TM.);
CAPRAVIRINE.TM. (AG-1549/S-1153, a next generation NNRTI with
activity against viruses containing the K103N mutation;
AGOURON.TM.); PNU-142721 (has 20- to 50-fold greater activity than
its predecessor delavirdine and is active against K103N mutants;
PHARMACIA.TM. & Upjohn); DPC-961 and DPC-963 (second-generation
derivatives of efavirenz, designed to be active against viruses
with the K103N mutation; DUPONT.TM.); GW-420867X (has 25-fold
greater activity than HBY097 and is active against K103N mutants;
Glaxo Wellcome); CALANOLIDE A (naturally occurring agent from the
latex tree; active against viruses containing either or both the
Y181C and K103N mutations); and Propolis (WO 99/49830).
[1090] Additional protease inhibitors include LOPINAVIR.TM.
(ABT378/r; Abbott Laboratories); BMS-232632 (an azapeptide;
Bristol-Myers Squibb); TIPRANAVIR.TM. (PNU-140690, a non-peptic
dihydropyrone; PHARMACIA.TM. & Upjohn); PD-178390 (a
nonpeptidic dihydropyrone; Parke-Davis); BMS 232632 (an azapeptide;
Bristol-Myers Squibb); L-756,423 (an indinavir analog; MERCK.TM.);
DMP-450 (a cyclic urea compound; Avid & DUPONT.TM.); AG-1776 (a
peptidomimetic with in vitro activity against protease
inhibitor-resistant viruses; AGOURON.TM.); VX-175/GW-433908
(phosphate prodrug of amprenavir; Vertex & Glaxo Welcome);
CGP61755 (Ciba); and AGENERASE.TM. (amprenavir; Glaxo Wellcome
Inc.).
[1091] Additional antiretroviral agents include fusion
inhibitors/gp41 binders. Fusion inhibitors/gp41 binders include
T-20 (a peptide from residues 643-678 of the HIV gp41 transmembrane
protein ectodomain which binds to gp41 in its resting state and
prevents transformation to the fusogenic state; Trimeris) and
T-1249 (a second-generation fusion inhibitor; Trimeris).
[1092] Additional antiretroviral agents include fusion
inhibitors/chemokine receptor antagonists. Fusion
inhibitors/chemokine receptor antagonists include CXCR4 antagonists
such as AMD 3100 (a bicyclam), SDF-1 and its analogs, and ALX40-4C
(a cationic peptide), T22 (an 18 amino acid peptide; Trimeris) and
the T22 analogs T134 and T140; CCR5 antagonists such as RANTES
(9-68), AOP-RANTES, NNY-RANTES, and TAK-779; and CCR5/CXCR4
antagonists such as NSC 651016 (a distamycin analog). Also included
are CCR2B, CCR3, and CCR6 antagonists. Chemokine receptor agonists
such as RANTES, SDF-1, MIP-1.alpha., MIP-1.beta., etc., may also
inhibit fusion.
[1093] Additional antiretroviral agents include integrase
inhibitors. Integrase inhibitors include dicaffeoylquinic (DFQA)
acids; L-chicoric acid (a dicaffeoyltartaric (DCTA) acid);
quinalizarin (QLC) and related anthraquinones; ZINTEVIR.TM. (AR
177, an oligonucleotide that probably acts at cell surface rather
than being a true integrase inhibitor; Arondex); and naphthols such
as those disclosed in WO 98/50347.
[1094] Additional antiretroviral agents include hydroxyurea-like
compounds such as BCX-34 (a purine nucleoside phosphorylase
inhibitor; Biocryst); ribonucleotide reductase inhibitors such as
DIDOX.TM. (Molecules for Health); inosine monophosphate
dehydrogenase (IMPDH) inhibitors sucha as VX-497 (Vertex); and
myvopholic acids such as CellCept (mycophenolate mofetil;
ROCHE.TM.)
[1095] Additional antiretroviral agents include inhibitors of viral
integrase, inhibitors of viral genome nuclear translocation such as
arylene bis(methylketone) compounds; inhibitors of HIV entry such
as AOP-RANTES, NNY-RANTES, RANTES-IgG fusion protein, soluble
complexes of RANTES and glycosaminoglycans (GAG), and AMD-3100;
nucleocapsid zinc finger inhibitors such as dithiane compounds;
targets of HIV Tat and Rev; and pharmacoenhancers such as
ABT-378.
[1096] Other antiretroviral therapies and adjunct therapies include
cytokines and lymphokines such as MIP-1.alpha., MIP-1.beta.,
SDF-1.alpha., IL-2, PROLEUKIN.TM. (aldesleukin/L2-7001;
CHIRON.TM.), IL-4, IL-10, IL-12, and IL-13; interferons such as
IFN-.alpha.2a; antagonists of TNFs, NF.kappa.B, GM-CSF, M-CSF, and
IL-10; agents that modulate immune activation such as cyclosporin
and prednisone; vaccines such as Remune.TM. (HIV Immunogen), APL
400-003 (Apollon), recombinant gp120 and fragments, bivalent (B/E)
recombinant envelope glycoprotein, rgp120CM235, MN rgp120, SF-2
rgp120, gp120/soluble CD4 complex, Delta JR-FL protein, branched
synthetic peptide derived from discontinuous gp120 C3/C4 domain,
fusion-competent immunogens, and Gag, Pol, Nef, and Tat vaccines;
gene-based therapies such as genetic suppressor elements (GSEs; WO
98/54366), and intrakines (genetically modified CC chemokines
targeted to the ER to block surface expression of newly synthesized
CCR5 (Yang et al., PNAS 94:11567-72 (1997); Chen et al., Nat. Med.
3:1110-16 (1997)); antibodies (for example, anti-CXCR4 antibodies
such as the anti-CXCR4 antibody 12G5, anti-CCR5 antibodies such as
the anti-CCR5 antibodies 2D7, 5C7, PA8, PA9, PA10, PA11, PA12, and
PA14, anti-CD4 antibodies such as the anti-CD4 antibodies Q4120 and
RPA-T4, anti-CCR3 antibodies such as the anti-CCR3 antibody 7B11,
anti-gp120 antibodies such as the anti-gp120 antibodies 17b, 48d,
447-52D, 257-D, 268-D and 50.1, anti-Tat antibodies,
anti-TNF-.alpha. antibodies, and monoclonal antibody 33A); aryl
hydrocarbon (AH) receptor agonists and antagonists such as TCDD,
3,3',4,4',5-pentachlorobiphenyl, 3,3',4,4'-tetrachlorobiphenyl, and
.alpha.-naphthoflavone (WO 98/30213); and antioxidants such as
.gamma.-L-glutamyl-L-cysteine ethyl ester (.gamma.-GCE; WO
99/56764).
[1097] Additional agents that may be used with Therapeutics of the
present invention with or without the agents above include
anti-lymphoproliferative agents such as all-trans-retinoic acid
(all-trans-RA), IFN-.gamma., EPOCH, and Cidofovir; inhibitors of
angiogenesis such as thalidomide; cytostatic chemotherapeutic
agents such as hydroxyurea; anti-infective agents such as
Rifabutin, Isoniazid, and Rifampin; and antidementia agents such as
LU 02-584 (CPI-1189; Centuar Pharmaceuticals Inc.).
[1098] Dosages of these various agents are known in the art, and
can be found in, for example, The Physician's Desk Reference and
the scientific literature.
[1099] The virus mutates very rapidly due to the error prone
reverse transcriptase (RT), thus developing resistance to multiple
therapeutic agents. By targeting multiple points in the viral
pathway (RT, protease, viral entry and viral neutralization) using
combination therapy, the high mutation rate should be effectively
countered. Thus, Therapeutics of the invention may be used with
combinations of antiretroviral agents, including two-drug,
three-drug, four-drug, five drug, six-drug, seven-drug, eight-drug,
nine-drug and greater combinations. Such combinations of
antiretroviral agents may be referred to in the literature as
active antiretroviral therapy (ART), highly active antiretroviral
therapy (HAART), continuous HAART, intermittent HAART, "mega" HAART
(more than 4, 5, 6, 7, or 8, and preferably more than 9 agents),
intensive high-dose multi-drug therapy, early treatment
intensification (ETI), maximally assisted therapy (MAT),
self-administered therapy (SAT), subcutaneous recombinant human
IL-2 in HIV-infected patients with low CD4+ counts under active
antiretroviral therapy (SILCAAT), and maintenance therapy.
Preferably, Therapeutics of the invention are used in combination
with highly active antiretroviral therapy. Therapeutics of the
invention may also be used in combination with adjunct agents, such
as those above and otherwise disclosed herein and those well known
in the art, either alone or together with antiretroviral
agents.
[1100] When combining Therapeutics of the invention with any of the
above agents or combinations of agents, the doses are adjusted as
necessary. NRTIs generally do not require dose adjustments when
combined, but NNRTIs and PIs may affect each other's levels and
potency. Guidance for such dose adjustments and for initiating,
continuing, managing, altering, and maintaining antiretroviral
therapy in general are well known by practitioners and are readily
available in, for example, Guidelines for the Use of Antiretroviral
Agents In HIV-Infected Adults and Adolescents, Panel on Clinical
Practices for Treatment of HIV Infection, Dept. Health and Human
Services and Henry J. Kaiser Foundation, Jan. 28, 2000, and
<<http://www.hivatis.org>> and other scientific
literature.
[1101] In other embodiments, Therapeutics of the invention may be
administered in combination with anti-opportunistic infection
agents. Anti-opportunistic agents that may be administered in
combination with the Therapeutics of the invention, include, but
are not limited to, TRIMETHOPRIM-SULFAMETHOXAZOLE.TM., DAPSONE.TM.,
PENTAMIDINE.TM., ATOVAQUONE.TM., ISONIAZID.TM., RIFAMPIN.TM.,
PYRAZINAMIDE.TM., ETHAMBUTOL.TM., RIFABUTIN.TM.,
CLARITHROMYCIN.TM., AZITHROMYCIN.TM., GANCICLOVIR.TM.,
FOSCARNET.TM., CIDOFOVIR.TM., FLUCONAZOLE.TM., ITRACONAZOLE.TM.,
KETOCONAZOLE.TM., ACYCLOVIR.TM., FAMCICOLVIR.TM.,
PYRIMETHAMINE.TM., LEUCOVORIN.TM., NEUPOGEN.TM. (filgrastim/G-CSF),
and LEUKINE.TM. (sargramostim/GM-CSF). In a specific embodiment,
Therapeutics of the invention are used in any combination with
TRIMETHOPRIM-SULFAMETHOXAZOLE.TM., DAPSONE.TM., PENTAMIDINE.TM.,
and/or ATOVAQUONE.TM. to prophylactically treat or prevent an
opportunistic Pneumocystis carinii pneumonia infection. In another
specific embodiment, Therapeutics of the invention are used in any
combination with ISONIAZID.TM., RIFAMPIN.TM., PYRAZINAMIDE.TM.,
and/or ETHAMBUTOL.TM. to prophylactically treat or prevent an
opportunistic Mycobacterium avium complex infection. In another
specific embodiment, Therapeutics of the invention are used in any
combination with RIFABUTIN.TM., CLARITHROMYCIN.TM., and/or
AZITHROMYCIN.TM. to prophylactically treat or prevent an
opportunistic Mycobacterium tuberculosis infection. In another
specific embodiment, Therapeutics of the invention are used in any
combination with GANCICLOVIR.TM., FOSCARNET.TM., and/or
CIDOFOVIR.TM. to prophylactically treat or prevent an opportunistic
cytomegalovirus infection. In another specific embodiment,
Therapeutics of the invention are used in any combination with
FLUCONAZOLE.TM. ITRACONAZOLE.TM., and/or KETOCONAZOLE.TM. to
prophylactically treat or prevent an opportunistic fungal
infection. In another specific embodiment, Therapeutics of the
invention are used in any combination with ACYCLOVIR.TM. and/or
FAMCICOLVIR.TM. to prophylactically treat or prevent an
opportunistic herpes simplex virus type I and/or type II infection.
In another specific embodiment, Therapeutics of the invention are
used in any combination with PYRIMETHAMINE.TM. and/or
LEUCOVORIN.TM. to prophylactically treat or prevent an
opportunistic Toxoplasma gondii infection. In another specific
embodiment, Therapeutics of the invention are used in any
combination with LEUCOVORIN.TM. and/or NEUPOGEN.TM. to
prophylactically treat or prevent an opportunistic bacterial
infection.
[1102] In a further embodiment, the Therapeutics of the invention
are administered in combination with an antiviral agent. Antiviral
agents that may be administered with the Therapeutics of the
invention include, but are not limited to, acyclovir, ribavirin,
amantadine, and remantidine.
[1103] In a further embodiment, the Therapeutics of the invention
are administered in combination with an antibiotic agent.
Antibiotic agents that may be administered with the Therapeutics of
the invention include, but are not limited to, amoxicillin,
beta-lactamases, aminoglycosides, beta-lactam (glycopeptide),
beta-lactamases, Clindamycin, chloramphenicol, cephalosporins,
ciprofloxacin, ciprofloxacin, erythromycin, fluoroquinolones,
macrolides, metronidazole, penicillins, quinolones, rifampin,
streptomycin, sulfonamide, tetracyclines, trimethoprim,
trimethoprim-sulfamthoxazole, and vancomycin.
[1104] Conventional nonspecific immunosuppressive agents, that may
be administered in combination with the Therapeutics of the
invention include, but are not limited to, steroids, cyclosporine,
cyclosporine analogs, cyclophosphamide methylprednisone,
prednisone, azathioprine, FK-506, 15-deoxyspergualin, and other
immunosuppressive agents that act by suppressing the function of
responding T cells.
[1105] In specific embodiments, Therapeutics of the invention are
administered in combination with immunosuppressants.
Immunosuppressants preparations that may be administered with the
Therapeutics of the invention include, but are not limited to,
ORTHOCLONE.TM. (OKT3), SANDIMMUNE.TM./NEORAL.TM./SANGDYA.TM.
(cyclosporin), PROGRAF.TM. (tacrolimus), CELLCEPT.TM.
(mycophenolate), Azathioprine, glucorticosteroids, and RAPAMUNE.TM.
(sirolimus). In a specific embodiment, immunosuppressants may be
used to prevent rejection of organ or bone marrow
transplantation.
[1106] In an additional embodiment, Therapeutics of the invention
are administered alone or in combination with one or more
intravenous immune globulin preparations. Intravenous immune
globulin preparations that may be administered with the
Therapeutics of the invention include, but not limited to,
GAMMAR.TM., IVEEGAM.TM., SANDOGLOBULIN.TM., GAMMAGARD S/D.TM., and
GAMIMUNE.TM.. In a specific embodiment, Therapeutics of the
invention are administered in combination with intravenous immune
globulin preparations in transplantation therapy (e.g., bone marrow
transplant).
[1107] In an additional embodiment, the Therapeutics of the
invention are administered alone or in combination with an
anti-inflammatory agent. Anti-inflammatory agents that may be
administered with the Therapeutics of the invention include, but
are not limited to, glucocorticoids and the nonsteroidal
anti-inflammatories, aminoarylcarboxylic acid derivatives,
arylacetic acid derivatives, arylbutyric acid derivatives,
arylcarboxylic acids, arylpropionic acid derivatives, pyrazoles,
pyrazolones, salicylic acid derivatives, thiazinecarboxamides,
e-acetamidocaproic acid, S-adenosylmethionine,
3-amino-4-hydroxybutyric acid, amixetrine, bendazac, benzydamine,
bucolome, difenpiramide, ditazol, emorfazone, guaiazulene,
nabumetone, nimesulide, orgotein, oxaceprol, paranyline, perisoxal,
pifoxime, proquazone, proxazole, and tenidap.
[1108] In another embodiment, compostions of the invention are
administered in combination with a chemotherapeutic agent.
Chemotherapeutic agents that may be administered with the
Therapeutics of the invention include, but are not limited to,
antibiotic derivatives (e.g., doxorubicin, bleomycin, daunorubicin,
and dactinomycin); antiestrogens (e.g., tamoxifen); antimetabolites
(e.g., fluorouracil, 5-FU, methotrexate, floxuridine, interferon
alpha-2b, glutamic acid, plicamycin, mercaptopurine, and
6-thioguanine); cytotoxic agents (e.g., carmustine, BCNU,
lomustine, CCNU, cytosine arabinoside, cyclophosphamide,
estramustine, hydroxyurea, procarbazine, mitomycin, busulfan,
cis-platin, and vincristine sulfate); hormones (e.g.,
medroxyprogesterone, estramustine phosphate sodium, ethinyl
estradiol, estradiol, megestrol acetate, methyltestosterone,
diethylstilbestrol diphosphate, chlorotrianisene, and
testolactone); nitrogen mustard derivatives (e.g., mephalen,
chorambucil, mechlorethamine (nitrogen mustard) and thiotepa);
steroids and combinations (e.g., bethamethasone sodium phosphate);
and others (e.g., dicarbazine, asparaginase, mitotane, vincristine
sulfate, vinblastine sulfate, and etoposide).
[1109] In a specific embodiment, Therapeutics of the invention are
administered in combination with CHOP (cyclophosphamide,
doxorubicin, vincristine, and prednisone) or any combination of the
components of CHOP. In another embodiment, Therapeutics of the
invention are administered in combination with Rituximab. In a
further embodiment, Therapeutics of the invention are administered
with Rituxmab and CHOP, or Rituxmab and any combination of the
components of CHOP.
[1110] In an additional embodiment, the Therapeutics of the
invention are administered in combination with cytokines. Cytokines
that may be administered with the Therapeutics of the invention
include, but are not limited to, IL2, IL3, IL4, IL5, IL6, IL7,
IL10, IL12, IL13, IL15, anti-CD40, CD40L, IFN-gamma and TNF-alpha.
In another embodiment, Therapeutics of the invention may be
administered with any interleukin, including, but not limited to,
IL-1alpha, IL-1beta, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8,
IL-9, IL-10, IL-11, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17,
IL-18, IL-19, IL-20, and IL-21.
[1111] In an additional embodiment, the Therapeutics of the
invention are administered in combination with angiogenic proteins.
Angiogenic proteins that may be administered with the Therapeutics
of the invention include, but are not limited to, Glioma Derived
Growth Factor (GDGF), as disclosed in European Patent Number
EP-399816; Platelet Derived Growth Factor-A (PDGF-A), as disclosed
in European Patent Number EP-682110; Platelet Derived Growth
Factor-B (PDGF-B), as disclosed in European Patent Number
EP-282317; Placental Growth Factor (PlGF), as disclosed in
International Publication Number WO 92/06194; Placental Growth
Factor-2 (PlGF-2), as disclosed in Hauser et al., Growth Factors,
4:259-268 (1993); Vascular Endothelial Growth Factor (VEGF), as
disclosed in International Publication Number WO 90/13649; Vascular
Endothelial Growth Factor-A (VEGF-A), as disclosed in European
Patent Number EP-506477; Vascular Endothelial Growth Factor-2
(VEGF-2), as disclosed in International Publication Number WO
96/39515; Vascular Endothelial Growth Factor B (VEGF-3); Vascular
Endothelial Growth Factor B-186 (VEGF-B186), as disclosed in
International Publication Number WO 96/26736; Vascular Endothelial
Growth Factor-D (VEGF-D), as disclosed in International Publication
Number WO 98/02543; Vascular Endothelial Growth Factor-D (VEGF-D),
as disclosed in International Publication Number WO 98/07832; and
Vascular Endothelial Growth Factor-E (VEGF-E), as disclosed in
German Patent Number DE19639601. The above mentioned references are
incorporated herein by reference herein.
[1112] In an additional embodiment, the Therapeutics of the
invention are administered in combination with hematopoietic growth
factors. Hematopoietic growth factors that may be administered with
the Therapeutics of the invention include, but are not limited to,
LEUKINE.TM. (SARGRAMOSTIM.TM.) and NEUPOGEN.TM.
(FILGRASTIM.TM.).
[1113] In an additional embodiment, the Therapeutics of the
invention are administered in combination with Fibroblast Growth
Factors. Fibroblast Growth Factors that may be administered with
the Therapeutics of the invention include, but are not limited to,
FGF-1, FGF-2, FGF-3, FGF-4, FGF-5, FGF-6, FGF-7, FGF-8, FGF-9,
FGF-10, FGF-11, FGF-12, FGF-13, FGF-14, and FGF-15.
[1114] In other embodiments, Therapeutics of the invention may be
administered in combination with porcine or human insulin or
mixtures thereof; insulin analogs; recombinant human insulin such
as HUMULIN.TM. and NOVOLIN.TM.; oral hypoglycemic agents such as
ORAMIDE.TM. and ORINASE.TM. (tolbutamide), DIABINESE.TM.
(chlorpropamide), TOLAMIDE.TM. and TOLINASE.TM. (tolazamide),
DYMELOR.TM. (acetohexamide), glibenclamide, MICRONASE.TM.,
DIBETA.TM. and GLYNASE.TM. (glyburide), GLUCOTROL.TM. (glipizide),
and DIAMICRON.TM. (gliclazide), GLUCOPHAGE.TM. (metformin),
PRECOSE.TM. (acarbose), AMARYL.TM. (glimepiride), and ciglitazone;
thiazolidinediones (TZDs) such as rosiglitazone, AVANDIA.TM.
(rosiglitazone maleate) ACTOS.TM. (piogliatazone), and
troglitazone; alpha-glucosidase inhibitors; bovine or porcine
glucagon; somatostatins such as SANDOSTATIN.TM. (octreotide); and
diazoxides such as PROGLYCEM.TM. (diazoxide). In still other
embodiments, Therapeutics of the invention are administered in
combination with one or more of the following: a biguanide
antidiabetic agent, a glitazone antidiabetic agent, and a
sulfonylurea antidiabetic agent.
[1115] In additional embodiments, the Therapeutics of the invention
are administered in combination with other therapeutic or
prophylactic regimens, such as, for example, radiation therapy.
Example 29
Method of Treating Decreased Levels of G-Protein Chemokine
Receptor
[1116] The present invention relates to a method for treating an
individual in need of an increased level of a polypeptide of the
invention in the body comprising administering to such an
individual a composition comprising a therapeutically effective
amount of an agonist of the invention (including polynucleotides of
the invention). Moreover, it will be appreciated that conditions
caused by a decrease in the standard or normal expression level of
G-protein Chemokine Receptor (CCR5) in an individual can be treated
by administering a G-protein Chemokine Receptor (CCR5) agonist,
preferably in the secreted form. Thus, the invention also provides
a method of treatment of an individual in need of an increased
level of G-protein Chemokine Receptor (CCR5) polypeptide comprising
administering to such an individual a Therapeutic comprising an
amount of G-protein Chemokine Receptor (CCR5) agonist to increase
the activity level of G-protein Chemokine Receptor (CCR5) in such
an individual.
[1117] For example, a patient with decreased levels of G-protein
Chemokine Receptor (CCR5) polypeptide receives a daily dose 0.1-100
ug/kg of the agonist for six consecutive days. The exact details of
the dosing scheme, based on administration and formulation, are
provided in Example 28.
Example 30
Method of Treating Increased Levels of G-Protein Chemokine
Receptor
[1118] The present invention also relates to a method of treating
an individual in need of a decreased level of a polypeptide of the
invention in the body comprising administering to such an
individual a composition comprising a therapeutically effective
amount of an antagonist of the invention (including polypeptides
and antibodies of the invention).
[1119] In one example, antisense technology is used to inhibit
production of G-protein Chemokine Receptor. This technology is one
example of a method of decreasing levels of G-protein Chemokine
Receptor (CCR5) polypeptide, preferably a soluble form, due to a
variety of etiologies, such as cancer.
[1120] For example, a patient diagnosed with abnormally increased
levels of G-protein Chemokine Receptor (CCR5) is administered
intravenously antisense polynucleotides at 0.5, 1.0, 1.5, 2.0 and
3.0 mg/kg day for 21 days. This treatment is repeated after a 7-day
rest period if the treatment was well tolerated. The formulation of
the antisense polynucleotide is provided in Example 28.
[1121] Other methods to decrease G-protein Chemokine Receptor
(CCR5) or to inhibit its activity are described herein (such as in
Example 57).
Example 31
Method of Treatment Using Gene Therapy--Ex Vivo
[1122] One method of gene therapy transplants fibroblasts, which
are capable of expressing G-protein Chemokine Receptor (CCR5)
polypeptides, onto a patient. Generally, fibroblasts are obtained
from a subject by skin biopsy. The resulting tissue is placed in
tissue-culture medium and separated into small pieces. Small chunks
of the tissue are placed on a wet surface of a tissue culture
flask, approximately ten pieces are placed in each flask. The flask
is turned upside down, closed tight and left at room temperature
over night. After 24 hours at room temperature, the flask is
inverted and the chunks of tissue remain fixed to the bottom of the
flask and fresh media (e.g., Ham's F12 media, with 10% FBS,
penicillin and streptomycin) is added. The flasks are then
incubated at 37 degree C. for approximately one week.
[1123] At this time, fresh media is added and subsequently changed
every several days. After an additional two weeks in culture, a
monolayer of fibroblasts emerge. The monolayer is trypsinized and
scaled into larger flasks.
[1124] pMV-7 (Kirschmeier, P. T. et al., DNA, 7:219-25 (1988)),
flanked by the long terminal repeats of the Moloney murine sarcoma
virus, is digested with EcoRI and HindIII and subsequently treated
with calf intestinal phosphatase. The linear vector is fractionated
on agarose gel and purified, using glass beads.
[1125] The DNA encoding G-protein Chemokine Receptor (CCR5) can be
amplified using PCR primers which correspond to the 5' and 3' end
sequences respectively as set forth in Example 5. Preferably, the
5' primer contains an EcoRI site and the 3' primer includes a
HindIII site. Equal quantities of the Moloney murine sarcoma virus
linear backbone and the amplified EcoRI and HindIII fragment are
added together, in the presence of T4 DNA ligase. The resulting
mixture is maintained under conditions appropriate for ligation of
the two fragments. The ligation mixture is then used to transform
bacteria HB101, which are then plated onto agar containing
kanamycin for the purpose of confirming that the vector contains
properly inserted G-protein Chemokine Receptor.
[1126] The amphotropic pA317 or GP+am12 packaging cells are grown
in tissue culture to confluent density in Dulbecco's Modified
Eagles Medium (DMEM) with 10% calf serum (CS), penicillin and
streptomycin. The MSV vector containing the G-protein Chemokine
Receptor (CCR5) gene is then added to the media and the packaging
cells transduced with the vector. The packaging cells now produce
infectious viral particles containing the G-protein Chemokine
Receptor (CCR5) gene (the packaging cells are now referred to as
producer cells).
[1127] Fresh media is added to the transduced producer cells, and
subsequently, the media is harvested from a 10 cm plate of
confluent producer cells. The spent media, containing the
infectious viral particles, is filtered through a millipore filter
to remove detached producer cells and this media is then used to
infect fibroblast cells. Media is removed from a sub-confluent
plate of fibroblasts and quickly replaced with the media from the
producer cells. This media is removed and replaced with fresh
media. If the titer of virus is high, then virtually all
fibroblasts will be infected and no selection is required. If the
titer is very low, then it is necessary to use a retroviral vector
that has a selectable marker, such as neo or his. Once the
fibroblasts have been efficiently infected, the fibroblasts are
analyzed to determine whether G-protein Chemokine Receptor (CCR5)
protein is produced.
[1128] The engineered fibroblasts are then transplanted onto the
host, either alone or after having been grown to confluence on
cytodex 3 microcarrier beads.
Example 32
Gene Therapy Using Endogenous G-Protein Chemokine Receptor (CCR5)
Gene
[1129] Another method of gene therapy according to the present
invention involves operably associating the endogenous G-protein
Chemokine Receptor (CCR5) sequence with a promoter via homologous
recombination as described, for example, in U.S. Pat. No.
5,641,670, issued Jun. 24, 1997; International Publication No. WO
96/29411, published Sep. 26, 1996; International Publication No. WO
94/12650, published Aug. 4, 1994; Koller et al., Proc. Natl. Acad.
Sci. USA 86:8932-8935 (1989); and Zijlstra et al., Nature
342:435-438 (1989). This method involves the activation of a gene
which is present in the target cells, but which is not expressed in
the cells, or is expressed at a lower level than desired.
[1130] Polynucleotide constructs are made which contain a promoter
and targeting sequences, which are homologous to the 5' non-coding
sequence of endogenous G-protein Chemokine Receptor (CCR5),
flanking the promoter. The targeting sequence will be sufficiently
near the 5' end of G-protein Chemokine Receptor (CCR5) so the
promoter will be operably linked to the endogenous sequence upon
homologous recombination. The promoter and the targeting sequences
can be amplified using PCR. Preferably, the amplified promoter
contains distinct restriction enzyme sites on the 5' and 3' ends.
Preferably, the 3' end of the first targeting sequence contains the
same restriction enzyme site as the 5' end of the amplified
promoter and the 5' end of the second targeting sequence contains
the same restriction site as the 3' end of the amplified
promoter.
[1131] The amplified promoter and the amplified targeting sequences
are digested with the appropriate restriction enzymes and
subsequently treated with calf intestinal phosphatase. The digested
promoter and digested targeting sequences are added together in the
presence of T4 DNA ligase. The resulting mixture is maintained
under conditions appropriate for ligation of the two fragments. The
construct is size fractionated on an agarose gel then purified by
phenol extraction and ethanol precipitation.
[1132] In this Example, the polynucleotide constructs are
administered as naked polynucleotides via electroporation. However,
the polynucleotide constructs may also be administered with
transfection-facilitating agents, such as liposomes, viral
sequences, viral particles, precipitating agents, etc. Such methods
of delivery are known in the art.
[1133] Once the cells are transfected, homologous recombination
will take place which results in the promoter being operably linked
to the endogenous G-protein Chemokine Receptor (CCR5) sequence.
This results in the expression of G-protein Chemokine Receptor
(CCR5) in the cell. Expression may be detected by immunological
staining, or any other method known in the art.
[1134] Fibroblasts are obtained from a subject by skin biopsy. The
resulting tissue is placed in DMEM+10% fetal calf serum.
Exponentially growing or early stationary phase fibroblasts are
trypsinized and rinsed from the plastic surface with nutrient
medium. An aliquot of the cell suspension is removed for counting,
and the remaining cells are subjected to centrifugation. The
supernatant is aspirated and the pellet is resuspended in 5 ml of
electroporation buffer (20 mM HEPES pH 7.3, 137 mM NaCl, 5 mM KCl,
0.7 mM Na.sub.2 HPO.sub.4, 6 mM dextrose). The cells are
recentrifuged, the supernatant aspirated, and the cells resuspended
in electroporation buffer containing 1 mg/ml acetylated bovine
serum albumin. The final cell suspension contains approximately
3.times.10.sup.6 cells/ml. Electroporation should be performed
immediately following resuspension.
[1135] Plasmid DNA is prepared according to standard techniques.
For example, to construct a plasmid for targeting to the G-protein
Chemokine Receptor (CCR5) locus, plasmid pUC18 (MBI Fermentas,
Amherst, N.Y.) is digested with HindIII. The CMV promoter is
amplified by PCR with an XbaI site on the 5' end and a BamHI site
on the 3' end. Two G-protein Chemokine Receptor (CCR5) non-coding
sequences are amplified via PCR: one G-protein Chemokine Receptor
(CCR5) non-coding sequence (G-protein Chemokine Receptor (CCR5)
fragment 1) is amplified with a HindIII site at the 5' end and an
Xba site at the 3' end; the other G-protein Chemokine Receptor
(CCR5) non-coding sequence (G-protein Chemokine Receptor (CCR5)
fragment 2) is amplified with a BamHI site at the 5' end and a
HindIII site at the 3' end. The CMV promoter and G-protein
Chemokine Receptor (CCR5) fragments (1 and 2) are digested with the
appropriate enzymes (CMV promoter--XbaI and BamHI; G-protein
Chemokine Receptor (CCR5) fragment 1--XbaI; G-protein Chemokine
Receptor (CCR5) fragment 2--BamHI) and ligated together. The
resulting ligation product is digested with HindIII, and ligated
with the HindIII-digested pUC18 plasmid.
[1136] Plasmid DNA is added to a sterile cuvette with a 0.4 cm
electrode gap (Bio-Rad). The final DNA concentration is generally
at least 120 .mu.g/ml. 0.5 ml of the cell suspension (containing
approximately 1.5.times.10.sup.6 cells) is then added to the
cuvette, and the cell suspension and DNA solutions are gently
mixed. Electroporation is performed with a Gene-Pulser apparatus
(Bio-Rad). Capacitance and voltage are set at 960 .mu.F and 250-300
V, respectively. As voltage increases, cell survival decreases, but
the percentage of surviving cells that stably incorporate the
introduced DNA into their genome increases dramatically. Given
these parameters, a pulse time of approximately 14-20 mSec should
be observed.
[1137] Electroporated cells are maintained at room temperature for
approximately 5 min, and the contents of the cuvette are then
gently removed with a sterile transfer pipette. The cells are added
directly to 10 ml of prewarmed nutrient media (DMEM with 15% calf
serum) in a 10 cm dish and incubated at 37 degree C. The following
day, the media is aspirated and replaced with 10 ml of fresh media
and incubated for a further 16-24 hours.
[1138] The engineered fibroblasts are then injected into the host,
either alone or after having been grown to confluence on cytodex 3
microcarrier beads. The fibroblasts now produce the protein
product. The fibroblasts can then be introduced into a patient as
described above.
Example 33
Method of Treatment Using Gene Therapy--In Vivo
[1139] Another aspect of the present invention is using in vivo
gene therapy methods to treat disorders, diseases and conditions.
The gene therapy method relates to the introduction of naked
nucleic acid (DNA, RNA, and antisense DNA or RNA) G-protein
Chemokine Receptor (CCR5) sequences into an animal to increase or
decrease the expression of the G-protein Chemokine Receptor (CCR5)
polypeptide. The G-protein Chemokine Receptor (CCR5) polynucleotide
may be operatively linked to a promoter or any other genetic
elements necessary for the expression of the G-protein Chemokine
Receptor (CCR5) polypeptide by the target tissue. Such gene therapy
and delivery techniques and methods are known in the art, see, for
example, WO90/11092, WO98/11779; U.S. Pat. Nos. 5,693,622,
5,705,151, 5,580,859; Tabata H. et al. (1997) Cardiovasc. Res.
35(3):470-479, Chao J et al. (1997) Pharmacol. Res. 35(6):517-522,
Wolff J. A. (1997) Neuromuscul. Disord. 7(5):314-318, Schwartz B.
et al. (1996) Gene Ther. 3(5):405-411, Tsurumi Y. et al. (1996)
Circulation 94(12):3281-3290 (incorporated herein by
reference).
[1140] The G-protein Chemokine Receptor (CCR5) polynucleotide
constructs may be delivered by any method that delivers injectable
materials to the cells of an animal, such as, injection into the
interstitial space of tissues (heart, muscle, skin, lung, liver,
intestine and the like). The G-protein Chemokine Receptor (CCR5)
polynucleotide constructs can be delivered in a pharmaceutically
acceptable liquid or aqueous carrier.
[1141] The term "naked" polynucleotide, DNA or RNA, refers to
sequences that are free from any delivery vehicle that acts to
assist, promote, or facilitate entry into the cell, including viral
sequences, viral particles, liposome formulations, LIPOFECTIN.TM.
or precipitating agents and the like. However, the G-protein
Chemokine Receptor (CCR5) polynucleotides may also be delivered in
liposome formulations (such as those taught in Felgner P. L. et al.
(1995) Ann. NY Acad. Sci. 772:126-139 and Abdallah B. et al. (1995)
Biol. Cell 85(1):1-7) which can be prepared by methods well known
to those skilled in the art.
[1142] The G-protein Chemokine Receptor (CCR5) polynucleotide
vector constructs used in the gene therapy method are preferably
constructs that will not integrate into the host genome nor will
they contain sequences that allow for replication. Any strong
promoter known to those skilled in the art can be used for driving
the expression of DNA. Unlike other gene therapies techniques, one
major advantage of introducing naked nucleic acid sequences into
target cells is the transitory nature of the polynucleotide
synthesis in the cells. Studies have shown that non-replicating DNA
sequences can be introduced into cells to provide production of the
desired polypeptide for periods of up to six months.
[1143] The G-protein Chemokine Receptor (CCR5) polynucleotide
construct can be delivered to the interstitial space of tissues
within the an animal, including of muscle, skin, brain, lung,
liver, spleen, bone marrow, thymus, heart, lymph, blood, bone,
cartilage, pancreas, kidney, gall bladder, stomach, intestine,
testis, ovary, uterus, rectum, nervous system, eye, gland, and
connective tissue. Interstitial space of the tissues comprises the
intercellular fluid, mucopolysaccharide matrix among the reticular
fibers of organ tissues, elastic fibers in the walls of vessels or
chambers, collagen fibers of fibrous tissues, or that same matrix
within connective tissue ensheathing muscle cells or in the lacunae
of bone. It is similarly the space occupied by the plasma of the
circulation and the lymph fluid of the lymphatic channels. Delivery
to the interstitial space of muscle tissue is preferred for the
reasons discussed below. They may be conveniently delivered by
injection into the tissues comprising these cells. They are
preferably delivered to and expressed in persistent, non-dividing
cells which are differentiated, although delivery and expression
may be achieved in non-differentiated or less completely
differentiated cells, such as, for example, stem cells of blood or
skin fibroblasts. In vivo muscle cells are particularly competent
in their ability to take up and express polynucleotides.
[1144] For the naked G-protein Chemokine Receptor (CCR5)
polynucleotide injection, an effective dosage amount of DNA or RNA
will be in the range of from about 0.05 g/kg body weight to about
50 mg/kg body weight. Preferably the dosage will be from about
0.005 mg/kg to about 20 mg/kg and more preferably from about 0.05
mg/kg to about 5 mg/kg. Of course, as the artisan of ordinary skill
will appreciate, this dosage will vary according to the tissue site
of injection. The appropriate and effective dosage of nucleic acid
sequence can readily be determined by those of ordinary skill in
the art and may depend on the condition being treated and the route
of administration. The preferred route of administration is by the
parenteral route of injection into the interstitial space of
tissues. However, other parenteral routes may also be used, such
as, inhalation of an aerosol formulation particularly for delivery
to lungs or bronchial tissues, throat or mucous membranes of the
nose. In addition, naked G-protein Chemokine Receptor (CCR5)
polynucleotide constructs can be delivered to arteries during
angioplasty by the catheter used in the procedure.
[1145] The dose response effects of injected G-protein Chemokine
Receptor (CCR5) polynucleotide in muscle in vivo is determined as
follows. Suitable G-protein Chemokine Receptor (CCR5) template DNA
for production of mRNA coding for G-protein Chemokine Receptor
(CCR5) polypeptide is prepared in accordance with a standard
recombinant DNA methodology. The template DNA, which may be either
circular or linear, is either used as naked DNA or complexed with
liposomes. The quadriceps muscles of mice are then injected with
various amounts of the template DNA.
[1146] Five to six week old female and male Balb/C mice are
anesthetized by intraperitoneal injection with 0.3 ml of 2.5%
Avertin. A 1.5 cm incision is made on the anterior thigh, and the
quadriceps muscle is directly visualized. The G-protein Chemokine
Receptor (CCR5) template DNA is injected in 0.1 ml of carrier in a
1 cc syringe through a 27 gauge needle over one minute,
approximately 0.5 cm from the distal insertion site of the muscle
into the knee and about 0.2 cm deep. A suture is placed over the
injection site for future localization, and the skin is closed with
stainless steel clips.
[1147] After an appropriate incubation time (e.g., 7 days) muscle
extracts are prepared by excising the entire quadriceps. Every
fifth 15 um cross-section of the individual quadriceps muscles is
histochemically stained for G-protein Chemokine Receptor (CCR5)
protein expression. A time course for G-protein Chemokine Receptor
(CCR5) protein expression may be done in a similar fashion except
that quadriceps from different mice are harvested at different
times. Persistence of G-protein Chemokine Receptor (CCR5) DNA in
muscle following injection may be determined by Southern blot
analysis after preparing total cellular DNA and HIRT supernatants
from injected and control mice. The results of the above
experimentation in mice can be use to extrapolate proper dosages
and other treatment parameters in humans and other animals using
G-protein Chemokine Receptor (CCR5) naked DNA.
Example 34
G-protein Chemokine Receptor (CCR5) Transgenic Animals
[1148] The G-protein Chemokine Receptor (CCR5) polypeptides can
also be expressed in transgenic animals. Animals of any species,
including, but not limited to, mice, rats, rabbits, hamsters,
guinea pigs, pigs, micro-pigs, goats, sheep, cows and non-human
primates, e.g., baboons, monkeys, and chimpanzees may be used to
generate transgenic animals. In a specific embodiment, techniques
described herein or otherwise known in the art, are used to express
polypeptides of the invention in humans, as part of a gene therapy
protocol.
[1149] Any technique known in the art may be used to introduce the
transgene (i.e., polynucleotides of the invention) into animals to
produce the founder lines of transgenic animals. Such techniques
include, but are not limited to, pronuclear microinjection
(Paterson et al., Appl. Microbiol. Biotechnol. 40:691-698 (1994);
Carver et al., Biotechnology (NY) 11:1263-1270 (1993); Wright et
al., Biotechnology (NY) 9:830-834 (1991); and Hoppe et al., U.S.
Pat. No. 4,873,191 (1989)); retrovirus mediated gene transfer into
germ lines (Van der Putten et al., Proc. Natl. Acad. Sci., USA
82:6148-6152 (1985)), blastocysts or embryos; gene targeting in
embryonic stem cells (Thompson et al., Cell 56:313-321 (1989));
electroporation of cells or embryos (Lo, 1983, Mol. Cell. Biol.
3:1803-1814 (1983)); introduction of the polynucleotides of the
invention using a gene gun (see, e.g., Ulmer et al., Science
259:1745 (1993); introducing nucleic acid constructs into embryonic
pleuripotent stem cells and transferring the stem cells back into
the blastocyst; and sperm-mediated gene transfer (Lavitrano et al.,
Cell 57:717-723 (1989); etc. For a review of such techniques, see
Gordon, "Transgenic Animals," Intl. Rev. Cytol. 115:171-229 (1989),
which is incorporated by reference herein in its entirety.
[1150] Any technique known in the art may be used to produce
transgenic clones containing polynucleotides of the invention, for
example, nuclear transfer into enucleated oocytes of nuclei from
cultured embryonic, fetal, or adult cells induced to quiescence
(Campell et al., Nature 380:64-66 (1996); Wilmut et al., Nature
385:810-813 (1997)).
[1151] The present invention provides for transgenic animals that
carry the transgene in all their cells, as well as animals which
carry the transgene in some, but not all their cells, i.e., mosaic
animals or chimeric. The transgene may be integrated as a single
transgene or as multiple copies such as in concatamers, e.g.,
head-to-head tandems or head-to-tail tandems. The transgene may
also be selectively introduced into and activated in a particular
cell type by following, for example, the teaching of Lasko et al.
(Lasko et al., Proc. Natl. Acad. Sci. USA 89:6232-6236 (1992)). The
regulatory sequences required for such a cell-type specific
activation will depend upon the particular cell type of interest,
and will be apparent to those of skill in the art. When it is
desired that the polynucleotide transgene be integrated into the
chromosomal site of the endogenous gene, gene targeting is
preferred.
[1152] Briefly, when such a technique is to be utilized, vectors
containing some nucleotide sequences homologous to the endogenous
gene are designed for the purpose of integrating, via homologous
recombination with chromosomal sequences, into and disrupting the
function of the nucleotide sequence of the endogenous gene. The
transgene may also be selectively introduced into a particular cell
type, thus inactivating the endogenous gene in only that cell type,
by following, for example, the teaching of Gu et al. (Gu et al.,
Science 265:103-106 (1994)). The regulatory sequences required for
such a cell-type specific inactivation will depend upon the
particular cell type of interest, and will be apparent to those of
skill in the art. The contents of each of the documents recited in
this paragraph is herein incorporated by reference in its
entirety.
[1153] In addition to expressing the polypeptide of the present
invention in a ubiquitous or tissue specific manner in transgenic
animals, it would also be routine for one skilled in the art to
generate constructs which regulate expression of the polypeptide by
a variety of other means (for example, developmentally or
chemically regulated expression).
[1154] Once transgenic animals have been generated, the expression
of the recombinant gene may be assayed utilizing standard
techniques. Initial screening may be accomplished by Southern blot
analysis or PCR techniques to analyze animal tissues to verify that
integration of the transgene has taken place. The level of mRNA
expression of the transgene in the tissues of the transgenic
animals may also be assessed using techniques which include, but
are not limited to, Northern blot analysis of tissue samples
obtained from the animal, in situ hybridization analysis, and
reverse transcriptase-PCR (rt-PCR). Samples of transgenic
gene-expressing tissue may also be evaluated immunocytochemically
or immunohistochemically using antibodies specific for the
transgene product.
[1155] Once the founder animals are produced, they may be bred,
inbred, outbred, or crossbred to produce colonies of the particular
animal. Examples of such breeding strategies include, but are not
limited to: outbreeding of founder animals with more than one
integration site in order to establish separate lines; inbreeding
of separate lines in order to produce compound transgenics that
express the transgene at higher levels because of the effects of
additive expression of each transgene; crossing of heterozygous
transgenic animals to produce animals homozygous for a given
integration site in order to both augment expression and eliminate
the need for screening of animals by DNA analysis; crossing of
separate homozygous lines to produce compound heterozygous or
homozygous lines; and breeding to place the transgene on a distinct
background that is appropriate for an experimental model of
interest.
[1156] Transgenic animals of the invention have uses which include,
but are not limited to, animal model systems useful in elaborating
the biological function of G-protein Chemokine Receptor (CCR5)
polypeptides, studying diseases, disorders, and/or conditions
associated with aberrant G-protein Chemokine Receptor (CCR5)
expression, and in screening for compounds effective in
ameliorating such diseases, disorders, and/or conditions.
Example 35
G-protein Chemokine Receptor (CCR5) Knock-Out Animals
[1157] Endogenous G-protein Chemokine Receptor (CCR5) gene
expression can also be reduced by inactivating or "knocking out"
the G-protein Chemokine Receptor (CCR5) gene and/or its promoter
using targeted homologous recombination. (E.g., see Smithies et
al., Nature 317:230-234 (1985); Thomas & Capecchi, Cell
51:503-512 (1987); Thompson et al., Cell 5:313-321 (1989); each of
which is incorporated by reference herein in its entirety). For
example, a mutant, non-functional polynucleotide of the invention
(or a completely unrelated DNA sequence) flanked by DNA homologous
to the endogenous polynucleotide sequence (either the coding
regions or regulatory regions of the gene) can be used, with or
without a selectable marker and/or a negative selectable marker, to
transfect cells that express polypeptides of the invention in vivo.
In another embodiment, techniques known in the art are used to
generate knockouts in cells that contain, but do not express the
gene of interest. Insertion of the DNA construct, via targeted
homologous recombination, results in inactivation of the targeted
gene. Such approaches are particularly suited in research and
agricultural fields where modifications to embryonic stem cells can
be used to generate animal offspring with an inactive targeted gene
(e.g., see Thomas & Capecchi 1987 and Thompson 1989, supra).
However this approach can be routinely adapted for use in humans
provided the recombinant DNA constructs are directly administered
or targeted to the required site in vivo using appropriate viral
vectors that will be apparent to those of skill in the art.
[1158] In further embodiments of the invention, cells that are
genetically engineered to express the polypeptides of the
invention, or alternatively, that are genetically engineered not to
express the polypeptides of the invention (e.g., knockouts) are
administered to a patient in vivo. Such cells may be obtained from
the patient (i.e., animal, including human) or an MHC compatible
donor and can include, but are not limited to fibroblasts, bone
marrow cells, blood cells (e.g., lymphocytes), adipocytes, muscle
cells, endothelial cells etc. The cells are genetically engineered
in vitro using recombinant DNA techniques to introduce the coding
sequence of polypeptides of the invention into the cells, or
alternatively, to disrupt the coding sequence and/or endogenous
regulatory sequence associated with the polypeptides of the
invention, e.g., by transduction (using viral vectors, and
preferably vectors that integrate the transgene into the cell
genome) or transfection procedures, including, but not limited to,
the use of plasmids, cosmids, YACs, naked DNA, electroporation,
liposomes, etc. The coding sequence of the polypeptides of the
invention can be placed under the control of a strong constitutive
or inducible promoter or promoter/enhancer to achieve expression,
and preferably secretion, of the G-protein Chemokine Receptor
(CCR5) polypeptides. The engineered cells which express and, in one
embodiment, preferably secrete the polypeptides of the invention
can be introduced into the patient systemically, e.g., in the
circulation, or intraperitoneally.
[1159] Alternatively, the cells can be incorporated into a matrix
and implanted in the body, e.g., genetically engineered fibroblasts
can be implanted as part of a skin graft; genetically engineered
endothelial cells can be implanted as part of a lymphatic or
vascular graft. (See, for example, Anderson et al. U.S. Pat. No.
5,399,349; and Mulligan & Wilson, U.S. Pat. No. 5,460,959 each
of which is incorporated by reference herein in its entirety).
[1160] When the cells to be administered are non-autologous or
non-MHC compatible cells, they can be administered using well known
techniques which prevent the development of a host immune response
against the introduced cells. For example, the cells may be
introduced in an encapsulated form which, while allowing for an
exchange of components with the immediate extracellular
environment, does not allow the introduced cells to be recognized
by the host immune system.
[1161] Knock-out animals of the invention have uses which include,
but are not limited to, animal model systems useful in elaborating
the biological function of G-protein Chemokine Receptor (CCR5)
polypeptides, studying diseases, disorders, and/or conditions
associated with aberrant G-protein Chemokine Receptor (CCR5)
expression, and in screening for compounds effective in
ameliorating such diseases, disorders, and/or conditions.
Example 36
Assays Detecting Stimulation or Inhibition of B Cell Proliferation
and Differentiation
[1162] Generation of functional humoral immune responses requires
both soluble and cognate signaling between B-lineage cells and
their microenvironment. Signals may impart a positive stimulus that
allows a B-lineage cell to continue its programmed development, or
a negative stimulus that instructs the cell to arrest its current
developmental pathway. To date, numerous stimulatory and inhibitory
signals have been found to influence B cell responsiveness
including IL-2, IL-4, IL-5, IL-6, IL-7, IL10, IL-13, IL-14 and
IL-15. Interestingly, these signals are by themselves weak
effectors but can, in combination with various co-stimulatory
proteins, induce activation, proliferation, differentiation,
homing, tolerance and death among B cell populations.
[1163] One of the best studied classes of B-cell co-stimulatory
proteins is the TNF-superfamily. Within this family CD40, CD27, and
CD30 along with their respective ligands CD154, CD70, and CD153
have been found to regulate a variety of immune responses. Assays
which allow for the detection and/or observation of the
proliferation and differentiation of these B-cell populations and
their precursors are valuable tools in determining the effects
various proteins may have on these B-cell populations in terms of
proliferation and differentiation. Listed below are two assays
designed to allow for the detection of the differentiation,
proliferation, or inhibition of B-cell populations and their
precursors.
[1164] In Vitro Assay: Purified G-protein Chemokine Receptor (CCR5)
protein, or truncated forms thereof, or purified G-protein
Chemokine Receptor (CCR5) ligand is assessed for its ability to
induce activation, proliferation, differentiation or inhibition
and/or death in B-cell populations and their precursors. The
activity of G-protein Chemokine Receptor (CCR5) protein on purified
human tonsillar B cells, measured qualitatively over the dose range
from 0.1 to 10,000 ng/mL, is assessed in a standard B-lymphocyte
co-stimulation assay in which purified tonsillar B cells are
cultured in the presence of either formalin-fixed Staphylococcus
aureus Cowan I (SAC) or immobilized anti-human IgM antibody as the
priming agent. Second signals such as IL-2 and IL-15 synergize with
SAC and IgM crosslinking to elicit B cell proliferation as measured
by tritiated-thymidine incorporation. Novel synergizing agents can
be readily identified using this assay. The assay involves
isolating human tonsillar B cells by magnetic bead (MACS) depletion
of CD3-positive cells. The resulting cell population is greater
than 95% B cells as assessed by expression of CD45R (B220).
[1165] Various dilutions of each sample are placed into individual
wells of a 96-well plate to which are added 10.sup.5 B-cells
suspended in culture medium (RPMI 1640 containing 10% FBS,
5.times.10.sup.-5M 2ME, 100 U/ml penicillin, 10 ug/ml streptomycin,
and 10.sup.-5 dilution of SAC) in a total volume of 150 ul.
Proliferation or inhibition is quantitated by a 20 h pulse (1
uCi/well) with 3H-thymidine (6.7 Ci/mM) beginning 72 h post factor
addition. The positive and negative controls are IL2 and medium
respectively.
[1166] In Vivo Assay: BALB/c mice are injected (i.p.) twice per day
with buffer only, or 2 mg/Kg of G-protein Chemokine Receptor (CCR5)
protein, or truncated forms thereof or G-protein Chemokine Receptor
(CCR5) ligand. Mice receive this treatment for 4 consecutive days,
at which time they are sacrificed and various tissues and serum
collected for analyses. Comparison of H&E sections from normal
and G-protein Chemokine Receptor (CCR5) protein-treated spleens
identify the results of the activity of G-protein Chemokine
Receptor (CCR5) protein on spleen cells, such as the diffusion of
pen-arterial lymphatic sheaths, and/or significant increases in the
nucleated cellularity of the red pulp regions, which may indicate
the activation of the differentiation and proliferation of B-cell
populations. Immunohistochemical studies using a B cell marker,
anti-CD45R (B220), are used to determine whether any physiological
changes to splenic cells, such as splenic disorganization, are due
to increased B-cell representation within loosely defined B-cell
zones that infiltrate established T-cell regions.
[1167] Flow cytometric analyses of the spleens from G-protein
Chemokine Receptor (CCR5) protein-treated mice is used to indicate
whether G-protein Chemokine Receptor (CCR5) protein specifically
increases the proportion of ThB+, CD45R (B220)dull B cells over
that which is observed in control mice.
[1168] Likewise, a predicted consequence of increased mature B-cell
representation in vivo is a relative increase in serum Ig titers.
Accordingly, serum IgM and IgA levels are compared between buffer
and G-protein Chemokine Receptor (CCR5) protein-treated mice.
[1169] The studies described in this example test activity in
G-protein Chemokine Receptor (CCR5) protein. However, one skilled
in the art could easily modify the exemplified studies to test the
activity of G-protein Chemokine Receptor (CCR5) polynucleotides
(e.g., gene therapy), agonists (including ligands), and/or
antagonists of G-protein Chemokine Receptor.
Example 37
T Cell Proliferation Assay
[1170] A CD3-induced proliferation assay is performed on PBMCs and
is measured by the uptake of .sup.3H-thymidine. The assay is
performed as follows. Ninety-six well plates are coated with 100
.mu.l/well of mAb to CD3 (HIT3a, Pharmingen) or isotype-matched
control mAb (B33.1) overnight at 4.degree. C. (1 .mu.g/ml in 0.05M
bicarbonate buffer, pH 9.5), then washed three times with PBS. PBMC
are isolated by F/H gradient centrifugation from human peripheral
blood and added to quadruplicate wells (5.times.10.sup.4/well) of
mAb coated plates in RPMI containing 10% FCS and P/S in the
presence of varying concentrations of G-protein Chemokine Receptor
(CCR5) protein (total volume 200 .mu.l). Relevant protein buffer
and medium alone are controls. After 48 hr. culture at 37.degree.
C., plates are spun for 2 min. at 1000 rpm and 100 .mu.l of
supernatant is removed and stored -20.degree. C. for measurement of
IL-2 (or other cytokines) if effect on proliferation is observed.
Wells are supplemented with 100 .mu.l of medium containing 0.5
.mu.Ci of .sup.3H-thymidine and cultured at 37.degree. C. for 18-24
hr. Wells are harvested and incorporation of .sup.3H-thymidine used
as a measure of proliferation. Anti-CD3 alone is the positive
control for proliferation. IL-2 (100 U/ml) is also used as a
control which enhances proliferation. Control antibody which does
not induce proliferation of T cells is used as the negative
controls for the effects of G-protein Chemokine Receptor (CCR5)
proteins.
[1171] The studies described in this example test activity in
G-protein Chemokine Receptor (CCR5) protein. However, one skilled
in the art could easily modify the exemplified studies to test the
activity of G-protein Chemokine Receptor (CCR5) polynucleotides
(e.g., gene therapy), agonists (including ligands), and/or
antagonists of G-protein Chemokine Receptor.
Example 38
Effect of G-Protein Chemokine Receptor (CCR5) on the Expression of
MHC Class II, Costimulatory and Adhesion Molecules and Cell
Differentiation of Monocytes and Monocyte-Derived Human Dendritic
Cells
[1172] Dendritic cells are generated by the expansion of
proliferating precursors found in the peripheral blood: adherent
PBMC or elutriated monocytic fractions are cultured for 7-10 days
with GM-CSF (50 ng/ml) and IL-4 (20 ng/ml). These dendritic cells
have the characteristic phenotype of immature cells (expression of
CD1, CD80, CD86, CD40 and MHC class II antigens). Treatment with
activating factors, such as TNF-.alpha., causes a rapid change in
surface phenotype (increased expression of MHC class I and II,
costimulatory and adhesion molecules, downregulation of
FC.gamma.RII, upregulation of CD83). These changes correlate with
increased antigen-presenting capacity and with functional
maturation of the dendritic cells.
[1173] FACS analysis of surface antigens is performed as follows.
Cells are treated 1-3 days with increasing concentrations of
G-protein Chemokine Receptor (CCR5) or a ligand thereof or LPS
(positive control), washed with PBS containing 1% BSA and 0.02 mM
sodium azide, and then incubated with 1:20 dilution of appropriate
FITC- or PE-labeled monoclonal antibodies for 30 minutes at
4.degree. C. After an additional wash, the labeled cells are
analyzed by flow cytometry on a FACScan (Becton Dickinson).
[1174] Effect on the production of cytokines. Cytokines generated
by dendritic cells, in particular IL-12, are important in the
initiation of T-cell dependent immune responses. IL-12 strongly
influences the development of Th1 helper T-cell immune response,
and induces cytotoxic T and NK cell function. An ELISA is used to
measure the IL-12 release as follows. Dendritic cells (10.sup.6/ml)
are treated with increasing concentrations of G-protein Chemokine
Receptor (CCR5) for 24 hours. LPS (100 ng/ml) is added to the cell
culture as positive control. Supernatants from the cell cultures
are then collected and analyzed for IL-12 content using commercial
ELISA kit (e.g., R & D Systems (Minneapolis, Minn.)). The
standard protocols provided with the kits are used.
[1175] Effect on the expression of MHC Class II, costimulatory and
adhesion molecules. Three major families of cell surface antigens
can be identified on monocytes: adhesion molecules, molecules
involved in antigen presentation, and Fc receptor. Modulation of
the expression of MHC class II antigens and other costimulatory
molecules, such as B7 and ICAM-1, may result in changes in the
antigen presenting capacity of monocytes and ability to induce T
cell activation. Increase expression of Fc receptors may correlate
with improved monocyte cytotoxic activity, cytokine release and
phagocytosis.
[1176] FACS analysis is used to examine the surface antigens as
follows. Monocytes are treated 1-5 days with increasing
concentrations of G-protein Chemokine Receptor (CCR5) or LPS
(positive control), washed with PBS containing 1% BSA and 0.02 mM
sodium azide, and then incubated with 1:20 dilution of appropriate
FITC- or PE-labeled monoclonal antibodies for 30 minutes at
4.degree. C. After an additional wash, the labeled cells are
analyzed by flow cytometry on a FACScan (Becton Dickinson).
[1177] Monocyte activation and/or increased survival Assays for
molecules that activate (or alternatively, inactivate) monocytes
and/or increase monocyte survival (or alternatively, decrease
monocyte survival) are known in the art and may routinely be
applied to determine whether a molecule of the invention functions
as an inhibitor or activator of monocytes. G-protein Chemokine
Receptor (CCR5), agonists, or antagonists of G-protein Chemokine
Receptor (CCR5) can be screened using the three assays described
below. For each of these assays, Peripheral blood mononuclear cells
(PBMC) are purified from single donor leukopacks (American Red
Cross, Baltimore, Md.) by centrifugation through a HISTOPAQUE.TM.
gradient (SIGMA.TM.). Monocytes are isolated from PBMC by
counterflow centrifugal elutriation.
[1178] Monocyte Survival Assay. Human peripheral blood monocytes
progressively lose viability when cultured in absence of serum or
other stimuli. Their death results from internally regulated
process (apoptosis). Addition to the culture of activating factors,
such as TNF-alpha dramatically improves cell survival and prevents
DNA fragmentation. Propidium iodide (PI) staining is used to
measure apoptosis as follows. Monocytes are cultured for 48 hours
in polypropylene tubes in serum-free medium (positive control), in
the presence of 100 ng/ml TNF-alpha (negative control), and in the
presence of varying concentrations of the compound to be tested.
Cells are suspended at a concentration of 2.times.10.sup.6/ml in
PBS containing PI at a final concentration of 5 .mu.g/ml, and then
incubated at room temperature for 5 minutes before FACScan
analysis. PI uptake has been demonstrated to correlate with DNA
fragmentation in this experimental paradigm.
[1179] Effect on cytokine release. An important function of
monocytes/macrophages is their regulatory activity on other
cellular populations of the immune system through the release of
cytokines after stimulation. An ELISA to measure cytokine release
is performed as follows. Human monocytes are incubated at a density
of 5.times.10.sup.5 cells/ml with increasing concentrations of
G-protein Chemokine Receptor (CCR5) and under the same conditions,
but in the absence of G-protein Chemokine Receptor. For IL-12
production, the cells are primed overnight with IFN (100 U/ml) in
presence of G-protein Chemokine Receptor. LPS (10 ng/ml) is then
added. Conditioned media are collected after 24 h and kept frozen
until use. Measurement of TNF-alpha, IL-10, MCP-1 and IL-8 is then
performed using a commercially available ELISA kit (e.g., R & D
Systems (Minneapolis, Minn.)) and applying the standard protocols
provided with the kit.
[1180] Oxidative burst. Purified monocytes are plated in 96-w plate
at 2-1.times.10.sup.5 cell/well. Increasing concentrations of
G-protein Chemokine Receptor (CCR5) are added to the wells in a
total volume of 0.2 ml culture medium (RPMI 1640 +10% FCS,
glutamine and antibiotics). After 3 days incubation, the plates are
centrifuged and the medium is removed from the wells. To the
macrophage monolayers, 0.2 ml per well of phenol red solution (140
mM NaCl, 10 mM potassium phosphate buffer pH 7.0, 5.5 mM dextrose,
0.56 mM phenol red and 19 U/ml of HRPO) is added, together with the
stimulant (200 nM PMA). The plates are incubated at 37.degree. C.
for 2 hours and the reaction is stopped by adding 20 .mu.l 1N NaOH
per well. The absorbance is read at 610 nm. To calculate the amount
of H.sub.2O.sub.2 produced by the macrophages, a standard curve of
a H.sub.2O.sub.2 solution of known molarity is performed for each
experiment.
[1181] The studies described in this example test activity in
G-protein Chemokine Receptor (CCR5) protein. However, one skilled
in the art could easily modify the exemplified studies to test the
activity of G-protein Chemokine Receptor (CCR5) polynucleotides
(e.g., gene therapy), agonists (including ligands), and/or
antagonists of G-protein Chemokine Receptor.
Example 39
G-protein Chemokine Receptor (CCR5) Biological Effects
Astrocyte and Neuronal Assays.
[1182] Recombinant G-protein Chemokine Receptor (CCR5), expressed
in Escherichia coli and purified as described above, can be tested
for activity in promoting the survival, neurite outgrowth, or
phenotypic differentiation of cortical neuronal cells and for
inducing the proliferation of glial fibrillary acidic protein
immunopositive cells, astrocytes. The selection of cortical cells
for the bioassay is based on the prevalent expression of FGF-1 and
FGF-2 in cortical structures and on the previously reported
enhancement of cortical neuronal survival resulting from FGF-2
treatment. A thymidine incorporation assay, for example, can be
used to elucidate G-protein Chemokine Receptor's activity on these
cells.
[1183] Moreover, previous reports describing the biological effects
of FGF-2 (basic FGF) on cortical or hippocampal neurons in vitro
have demonstrated increases in both neuron survival and neurite
outgrowth (Walicke, P. et al., "Fibroblast growth factor promotes
survival of dissociated hippocampal neurons and enhances neurite
extension." Proc. Natl. Acad. Sci. USA 83:3012-3016. (1986), assay
herein incorporated by reference in its entirety). However, reports
from experiments done on PC-12 cells suggest that these two
responses are not necessarily synonymous and may depend on not only
which FGF is being tested but also on which receptor(s) are
expressed on the target cells. Using the primary cortical neuronal
culture paradigm, the ability of G-protein Chemokine Receptor
(CCR5) to induce neurite outgrowth can be compared to the response
achieved with FGF-2 using, for example, a thymidine incorporation
assay.
Fibroblast and Endothelial Cell Assays.
[1184] Human lung fibroblasts are obtained from Clonetics (San
Diego, Calif.) and maintained in growth media from Clonetics.
Dermal microvascular endothelial cells are obtained from Cell
Applications (San Diego, Calif.). For proliferation assays, the
human lung fibroblasts and dermal microvascular endothelial cells
can be cultured at 5,000 cells/well in a 96-well plate for one day
in growth medium. The cells are then incubated for one day in 0.1%
BSA basal medium. After replacing the medium with fresh 0.1% BSA
medium, the cells are incubated with the test proteins for 3 days.
ALAMAR BLUE.TM. (Alamar Biosciences, Sacramento, Calif.) is added
to each well to a final concentration of 10%. The cells are
incubated for 4 hr. Cell viability is measured by reading in a
CYTOFLUOR.TM. fluorescence reader. For the PGE.sub.2 assays, the
human lung fibroblasts are cultured at 5,000 cells/well in a
96-well plate for one day. After a medium change to 0.1% BSA basal
medium, the cells are incubated with FGF-2 or G-protein Chemokine
Receptor (CCR5) with or without IL-1a for 24 hours. The
supernatants are collected and assayed for PGE.sub.2 by EIA kit
(Cayman, Ann Arbor, Mich.). For the IL-6 assays, the human lung
fibroblasts are cultured at 5,000 cells/well in a 96-well plate for
one day. After a medium change to 0.1% BSA basal medium, the cells
are incubated with FGF-2 or G-protein Chemokine Receptor (CCR5)
with or without IL-1.alpha. for 24 hours. The supernatants are
collected and assayed for IL-6 by ELISA kit (Endogen, Cambridge,
Mass.).
[1185] Human lung fibroblasts are cultured with FGF-2 or G-protein
Chemokine Receptor (CCR5) for 3 days in basal medium before the
addition of ALAMAR BLUE.TM. to assess effects on growth of the
fibroblasts. FGF-2 should show a stimulation at 10-2500 ng/ml which
can be used to compare stimulation with G-protein Chemokine
Receptor.
Parkinson Models.
[1186] The loss of motor function in Parkinson's disease is
attributed to a deficiency of striatal dopamine resulting from the
degeneration of the nigrostriatal dopaminergic projection neurons.
An animal model for Parkinson's that has been extensively
characterized involves the systemic administration of 1-methyl-4
phenyl 1,2,3,6-tetrahydropyridine (MPTP). In the CNS, MPTP is
taken-up by astrocytes and catabolized by monoamine oxidase B to
1-methyl-4-phenyl pyridine (MPP.sup.+) and released. Subsequently,
MPP.sup.+ is actively accumulated in dopaminergic neurons by the
high-affinity reuptake transporter for dopamine. MPP.sup.+ is then
concentrated in mitochondria by the electrochemical gradient and
selectively inhibits nicotidamide adenine disphosphate: ubiquinone
oxidoreductionase (complex I), thereby interfering with electron
transport and eventually generating oxygen radicals.
[1187] It has been demonstrated in tissue culture paradigms that
FGF-2 (basic FGF) has trophic activity towards nigral dopaminergic
neurons (Ferrari et al., Dev. Biol. 1989). Recently, Dr. Unsicker's
group has demonstrated that administering FGF-2 in gel foam
implants in the striatum results in the near complete protection of
nigral dopaminergic neurons from the toxicity associated with MPTP
exposure (Otto and Unsicker, J. Neuroscience, 1990).
[1188] Based on the data with FGF-2, G-protein Chemokine Receptor
(CCR5) can be evaluated to determine whether it has an action
similar to that of FGF-2 in enhancing dopaminergic neuronal
survival in vitro and it can also be tested in vivo for protection
of dopaminergic neurons in the striatum from the damage associated
with MPTP treatment. The potential effect of G-protein Chemokine
Receptor (CCR5) is first examined in vitro in a dopaminergic
neuronal cell culture paradigm. The cultures are prepared by
dissecting the midbrain floor plate from gestation day 14 Wistar
rat embryos. The tissue is dissociated with trypsin and seeded at a
density of 200,000 cells/cm.sup.2 on polyorthinine-laminin coated
glass coverslips. The cells are maintained in Dulbecco's Modified
Eagle's medium and F12 medium containing hormonal supplements (N1).
The cultures are fixed with paraformaldehyde after 8 days in vitro
and are processed for tyrosine hydroxylase, a specific marker for
dopaminergic neurons, immunohistochemical staining. Dissociated
cell cultures are prepared from embryonic rats. The culture medium
is changed every third day and the factors are also added at that
time.
[1189] Since the dopaminergic neurons are isolated from animals at
gestation day 14, a developmental time which is past the stage when
the dopaminergic precursor cells are proliferating, an increase in
the number of tyrosine hydroxylase immunopositive neurons would
represent an increase in the number of dopaminergic neurons
surviving in vitro. Therefore, if G-protein Chemokine Receptor
(CCR5) acts to prolong the survival of dopaminergic neurons, it
would suggest that G-protein Chemokine Receptor (CCR5) may be
involved in Parkinson's Disease.
[1190] The studies described in this example test activity in
G-protein Chemokine Receptor (CCR5) protein. However, one skilled
in the art could easily modify the exemplified studies to test the
activity of G-protein Chemokine Receptor (CCR5) polynucleotides
(e.g., gene therapy), agonists (including ligands), and/or
antagonists of G-protein Chemokine Receptor.
Example 40
The Effect of G-Protein Chemokine Receptor (CCR5) on the Growth of
Vascular Endothelial Cells
[1191] On day 1, human umbilical vein endothelial cells (HUVEC) are
seeded at 2-5.times.10.sup.4 cells/35 mm dish density in M199
medium containing 4% fetal bovine serum (FBS), 16 units/ml heparin,
and 50 units/ml endothelial cell growth supplements (ECGS,
Biotechnique, Inc.). On day 2, the medium is replaced with M199
containing 10% FBS, 8 units/ml heparin. G-protein Chemokine
Receptor (CCR5) protein of SEQ ID NO. 2 or SEQ ID NO:22, and
positive controls, such as VEGF and basic FGF (bFGF) are added, at
varying concentrations. On days 4 and 6, the medium is replaced. On
day 8, cell number is determined with a Coulter Counter.
[1192] An increase in the number of HUVEC cells indicates that
G-protein Chemokine Receptor (CCR5) may proliferate vascular
endothelial cells.
[1193] The studies described in this example test activity in
G-protein Chemokine Receptor (CCR5) protein. However, one skilled
in the art could easily modify the exemplified studies to test the
activity of G-protein Chemokine Receptor (CCR5) polynucleotides
(e.g., gene therapy), agonists (including ligands), and/or
antagonists of G-protein Chemokine Receptor.
Example 41
Stimulatory Effect of G-Protein Chemokine Receptor (CCR5) on the
Proliferation of Vascular Endothelial Cells
[1194] For evaluation of mitogenic activity of growth factors, the
colorimetric MTS
(3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl-
)2H-tetrazolium) assay with the electron coupling reagent PMS
(phenazine methosulfate) was performed (CellTiter 96 AQ,
PROMEGA.TM.). Cells are seeded in a 96-well plate (5,000
cells/well) in 0.1 mL serum-supplemented medium and are allowed to
attach overnight. After serum-starvation for 12 hours in 0.5% FBS,
conditions (bFGF, VEGF.sub.165 or G-protein Chemokine Receptor
(CCR5) in 0.5% FBS) with or without Heparin (8 U/ml) are added to
wells for 48 hours. 20 mg of MTS/PMS mixture (1:0.05) are added per
well and allowed to incubate for 1 hour at 37.degree. C. before
measuring the absorbance at 490 nm in an ELISA plate reader.
Background absorbance from control wells (some media, no cells) is
subtracted, and seven wells are performed in parallel for each
condition. See, Leak et al. In Vitro Cell. Dev. Biol. 30A:512-518
(1994).
[1195] The studies described in this example test activity in
G-protein Chemokine Receptor (CCR5) protein. However, one skilled
in the art could easily modify the exemplified studies to test the
activity of G-protein Chemokine Receptor (CCR5) polynucleotides
(e.g., gene therapy), agonists (including ligands), and/or
antagonists of G-protein Chemokine Receptor.
Example 42
Stimulation of Endothelial Migration
[1196] This example will be used to explore the possibility that
G-protein Chemokine Receptor (CCR5) may stimulate lymphatic
endothelial cell migration.
[1197] Endothelial cell migration assays are performed using a 48
well microchemotaxis chamber (Neuroprobe Inc., Cabin John, M D;
Falk, W., et al., J. Immunological Methods 1980; 33:239-247).
Polyvinylpyrrolidone-free polycarbonate filters with a pore size of
8 um (Nucleopore Corp. Cambridge, Mass.) are coated with 0.1%
gelatin for at least 6 hours at room temperature and dried under
sterile air. Test substances are diluted to appropriate
concentrations in M199 supplemented with 0.25% bovine serum albumin
(BSA), and 25 ul of the final dilution is placed in the lower
chamber of the modified Boyden apparatus. Subconfluent, early
passage (2-6) HUVEC or BMEC cultures are washed and trypsinized for
the minimum time required to achieve cell detachment. After placing
the filter between lower and upper chamber, 2.5.times.10.sup.5
cells suspended in 50 ul M199 containing 1% FBS are seeded in the
upper compartment. The apparatus is then incubated for 5 hours at
37.degree. C. in a humidified chamber with 5% CO2 to allow cell
migration. After the incubation period, the filter is removed and
the upper side of the filter with the non-migrated cells is scraped
with a rubber policeman. The filters are fixed with methanol and
stained with a Giemsa solution (Diff-Quick, Baxter, McGraw Park,
Ill.). Migration is quantified by counting cells of three random
high-power fields (40.times.) in each well, and all groups are
performed in quadruplicate.
[1198] The studies described in this example test activity in
G-protein Chemokine Receptor (CCR5) protein. However, one skilled
in the art could easily modify the exemplified studies to test the
activity of G-protein Chemokine Receptor (CCR5) polynucleotides
(e.g., gene therapy), agonists (including ligands), and/or
antagonists of G-protein Chemokine Receptor.
Example 43
Effect of G-Protein Chemokine Receptor (CCR5) on Cord Formation in
Angiogenesis
[1199] Another step in angiogenesis is cord formation, marked by
differentiation of endothelial cells. This bioassay measures the
ability of microvascular endothelial cells to form capillary-like
structures (hollow structures) when cultured in vitro.
[1200] CADMEC (microvascular endothelial cells) are purchased from
Cell Applications, Inc. as proliferating (passage 2) cells and are
cultured in Cell Applications' CADMEC Growth Medium and used at
passage 5. For the in vitro angiogenesis assay, the wells of a
48-well cell culture plate are coated with Cell Applications'
Attachment Factor Medium (200 ml/well) for 30 min. at 37.degree. C.
CADMEC are seeded onto the coated wells at 7,500 cells/well and
cultured overnight in Growth Medium. The Growth Medium is then
replaced with 300 mg Cell Applications' Chord Formation Medium
containing control buffer or G-protein Chemokine Receptor (CCR5)
(0.1 to 100 ng/ml) and the cells are cultured for an additional 48
hr. The numbers and lengths of the capillary-like chords are
quantitated through use of the Boeckeler VIA-170 video image
analyzer. All assays are done in triplicate.
[1201] Commercial (R&D) VEGF (50 ng/ml) is used as a positive
control. b-estradiol (1 ng/ml) is used as a negative control. The
appropriate buffer (without protein) is also utilized as a
control.
[1202] The studies described in this example test activity in
G-protein Chemokine Receptor (CCR5) protein. However, one skilled
in the art could easily modify the exemplified studies to test the
activity of G-protein Chemokine Receptor (CCR5) polynucleotides
(e.g., gene therapy), agonists (including ligands), and/or
antagonists of G-protein Chemokine Receptor.
Example 44
Angiogenic Effect on Chick Chorioallantoic Membrane
[1203] Chick chorioallantoic membrane (CAM) is a well-established
system to examine angiogenesis. Blood vessel formation on CAM is
easily visible and quantifiable. The ability of G-protein Chemokine
Receptor (CCR5) or a ligand thereof to stimulate angiogenesis in
CAM can be examined.
[1204] Fertilized eggs of the White Leghorn chick (Gallus gallus)
and the Japanese quail (Coturnix coturnix) are incubated at
37.8.degree. C. and 80% humidity. Differentiated CAM of 16-day-old
chick and 13-day-old quail embryos is studied with the following
methods.
[1205] On Day 4 of development, a window is made into the egg shell
of chick eggs. The embryos are checked for normal development and
the eggs sealed with cellotape. They are further incubated until
Day 13. THERMANOX.TM. coverslips (Nunc, Naperville, Ill.) are cut
into disks of about 5 mm in diameter. Sterile and salt-free growth
factors are dissolved in distilled water and about 3.3 mg/5 ml are
pipetted on the disks. After air-drying, the inverted disks are
applied on CAM. After 3 days, the specimens are fixed in 3%
glutaraldehyde and 2% formaldehyde and rinsed in 0.12 M sodium
cacodylate buffer. They are photographed with a stereo microscope
[Wild M8] and embedded for semi- and ultrathin sectioning as
described above. Controls are performed with carrier disks
alone.
[1206] The studies described in this example test activity in
G-protein Chemokine Receptor (CCR5) protein. However, one skilled
in the art could easily modify the exemplified studies to test the
activity of G-protein Chemokine Receptor (CCR5) polynucleotides
(e.g., gene therapy), agonists (including ligands), and/or
antagonists of G-protein Chemokine Receptor.
Example 45
Angiogenesis Assay Using a MATRIGEL.TM. Implant in Mouse
[1207] In vivo angiogenesis assay of G-protein Chemokine Receptor
(CCR5) measures the ability of an existing capillary network to
form new vessels in an implanted capsule of murine extracellular
matrix material (MATRIGEL.TM.). The protein is mixed with the
liquid MATRIGEL.TM. at 4 degree C. and the mixture is then injected
subcutaneously in mice where it solidifies. After 7 days, the solid
"plug" of MATRIGEL.TM. is removed and examined for the presence of
new blood vessels. MATRIGEL.TM. is purchased from Becton Dickinson
Labware/Collaborative Biomedical Products.
[1208] When thawed at 4 degree C. the MATRIGEL.TM. material is a
liquid. The MATRIGEL.TM. is mixed with G-protein Chemokine Receptor
(CCR5) at 150 ng/ml at 4 degree C. and drawn into cold 3 ml
syringes. Female C57B1/6 mice approximately 8 weeks old are
injected with the mixture of MATRIGEL.TM. and experimental protein
at 2 sites at the midventral aspect of the abdomen (0.5 ml/site).
After 7 days, the mice are sacrificed by cervical dislocation, the
MATRIGEL.TM. plugs are removed and cleaned (i.e., all clinging
membranes and fibrous tissue is removed). Replicate whole plugs are
fixed in neutral buffered 10% formaldehyde, embedded in paraffin
and used to produce sections for histological examination after
staining with Masson's Trichrome. Cross sections from 3 different
regions of each plug are processed. Selected sections are stained
for the presence of vWF. The positive control for this assay is
bovine basic FGF (150 ng/ml). MATRIGEL.TM. alone is used to
determine basal levels of angiogenesis.
[1209] The studies described in this example test activity in
G-protein Chemokine Receptor (CCR5) protein. However, one skilled
in the art could easily modify the exemplified studies to test the
activity of G-protein Chemokine Receptor (CCR5) polynucleotides
(e.g., gene therapy), agonists (including ligands), and/or
antagonists of G-protein Chemokine Receptor.
Example 46
Rescue of Ischemia in Rabbit Lower Limb Model
[1210] To study the in vivo effects of G-protein Chemokine Receptor
(CCR5) on ischemia, a rabbit hindlimb ischemia model is created by
surgical removal of one femoral arteries as described previously
(Takeshita, S. et al., Am J. Pathol 147:1649-1660 (1995)). The
excision of the femoral artery results in retrograde propagation of
thrombus and occlusion of the external iliac artery. Consequently,
blood flow to the ischemic limb is dependent upon collateral
vessels originating from the internal iliac artery (Takeshita, S.
et al. Am J. Pathol 147:1649-1660 (1995)). An interval of 10 days
is allowed for post-operative recovery of rabbits and development
of endogenous collateral vessels. At 10 day post-operatively (day
0), after performing a baseline angiogram, the internal iliac
artery of the ischemic limb is transfected with 500 mg naked
G-protein Chemokine Receptor (CCR5) expression plasmid by arterial
gene transfer technology using a hydrogel-coated balloon catheter
as described (Riessen, R. et al. Hum Gene Ther. 4:749-758 (1993);
Leclerc, G. et al. J. Clin. Invest. 90: 936-944 (1992)). When
G-protein Chemokine Receptor (CCR5) is used in the treatment, a
single bolus of 500 mg G-protein Chemokine Receptor (CCR5) protein
or control is delivered into the internal iliac artery of the
ischemic limb over a period of 1 min. through an infusion catheter.
On day 30, various parameters are measured in these rabbits: (a) BP
ratio--The blood pressure ratio of systolic pressure of the
ischemic limb to that of normal limb; (b) Blood Flow and Flow
Reserve-Resting FL: the blood flow during undilated condition and
Max FL: the blood flow during fully dilated condition (also an
indirect measure of the blood vessel amount) and Flow Reserve is
reflected by the ratio of max FL: resting FL; (c) Angiographic
Score--This is measured by the angiogram of collateral vessels. A
score is determined by the percentage of circles in an overlaying
grid that with crossing opacified arteries divided by the total
number m the rabbit thigh; (d) Capillary density--The number of
collateral capillaries determined in light microscopic sections
taken from hindlimbs.
[1211] The studies described in this example test activity in
G-protein Chemokine Receptor (CCR5) protein. However, one skilled
in the art could easily modify the exemplified studies to test the
activity of G-protein Chemokine Receptor (CCR5) polynucleotides
(e.g., gene therapy), agonists (including ligands), and/or
antagonists of G-protein Chemokine Receptor.
Example 47
Peripheral Arterial Disease Model
[1212] Angiogenic therapy using G-protein Chemokine Receptor (CCR5)
is a novel therapeutic strategy to obtain restoration of blood flow
around the ischemia in case of peripheral arterial diseases. The
experimental protocol includes:
[1213] a) One side of the femoral artery is ligated to create
ischemic muscle of the hindlimb, the other side of hindlimb serves
as a control.
[1214] b) G-protein Chemokine Receptor (CCR5) protein, in a dosage
range of 20 mg-500 mg, is delivered intravenously and/or
intramuscularly 3 times (perhaps more) per week for 2-3 weeks.
[1215] c) The ischemic muscle tissue is collected after ligation of
the femoral artery at 1, 2, and 3 weeks for the analysis of
G-protein Chemokine Receptor (CCR5) expression and histology.
Biopsy is also performed on the other side of normal muscle of the
contralateral hindlimb.
[1216] The studies described in this example test activity in
G-protein Chemokine Receptor (CCR5) protein. However, one skilled
in the art could easily modify the exemplified studies to test the
activity of G-protein Chemokine Receptor (CCR5) polynucleotides
(e.g., gene therapy), agonists (including ligands), and/or
antagonists of G-protein Chemokine Receptor.
Example 48
Ischemic Myocardial Disease Model
[1217] G-protein Chemokine Receptor (CCR5) is evaluated as a potent
mitogen capable of stimulating the development of collateral
vessels, and restructuring new vessels after coronary artery
occlusion. Alteration of G-protein Chemokine Receptor (CCR5)
expression is investigated in situ. The experimental protocol
includes:
[1218] a) The heart is exposed through a left-side thoracotomy in
the rat. Immediately, the left coronary artery is occluded with a
thin suture (6-0) and the thorax is closed.
[1219] b) G-protein Chemokine Receptor (CCR5) protein, in a dosage
range of 20 mg-500 mg, is delivered intravenously and/or
intramuscularly 3 times (perhaps more) per week for 2-4 weeks.
[1220] c) Thirty days after the surgery, the heart is removed and
cross-sectioned for morphometric and in situ analyzes.
[1221] The studies described in this example test activity in
G-protein Chemokine Receptor (CCR5) protein. However, one skilled
in the art could easily modify the exemplified studies to test the
activity of G-protein Chemokine Receptor (CCR5) polynucleotides
(e.g., gene therapy), agonists (including ligands), and/or
antagonists of G-protein Chemokine Receptor.
Example 49
Suppression of TNF Alpha-Induced Adhesion Molecule Expression by
G-Protein Chemokine Receptor
[1222] The recruitment of lymphocytes to areas of inflammation and
angiogenesis involves specific receptor-ligand interactions between
cell surface adhesion molecules (CAMs) on lymphocytes and the
vascular endothelium. The adhesion process, in both normal and
pathological settings, follows a multi-step cascade that involves
intercellular adhesion molecule-1 (ICAM-1), vascular cell adhesion
molecule-1 (VCAM-1), and endothelial leukocyte adhesion molecule-1
(E-selectin) expression on endothelial cells (EC). The expression
of these molecules and others on the vascular endothelium
determines the efficiency with which leukocytes may adhere to the
local vasculature and extravasate into the local tissue during the
development of an inflammatory response. The local concentration of
cytokines and growth factor participate in the modulation of the
expression of these CAMs.
[1223] Tumor necrosis factor alpha (TNF-a), a potent
proinflammatory cytokine, is a stimulator of all three CAMs on
endothelial cells and may be involved in a wide variety of
inflammatory responses, often resulting in a pathological
outcome.
[1224] The potential of G-protein Chemokine Receptor (CCR5) to
mediate a suppression of TNF-a induced CAM expression can be
examined. A modified ELISA assay which uses ECs as a solid phase
absorbent is employed to measure the amount of CAM expression on
TNF-a treated ECs when co-stimulated with a member of the FGF
family of proteins.
[1225] To perform the experiment, human umbilical vein endothelial
cell (HUVEC) cultures are obtained from pooled cord harvests and
maintained in growth medium (EGM-2; Clonetics, San Diego, Calif.)
supplemented with 10% FCS and 1% penicillin/streptomycin in a 37
degree C. humidified incubator containing 5% CO.sub.2. HUVECs are
seeded in 96-well plates at concentrations of 1.times.10.sup.4
cells/well in EGM medium at 37 degree C. for 18-24 hrs or until
confluent. The monolayers are subsequently washed 3 times with a
serum-free solution of RPMI-1640 supplemented with 100 U/ml
penicillin and 100 mg/ml streptomycin, and treated with a given
cytokine and/or growth factor(s) for 24 h at 37 degree C. Following
incubation, the cells are then evaluated for CAM expression.
[1226] Human Umbilical Vein Endothelial cells (HUVECs) are grown in
a standard 96 well plate to confluence. Growth medium is removed
from the cells and replaced with 90 ul of 199 Medium (10% FBS).
Samples for testing and positive or negative controls are added to
the plate in triplicate (in 10 ul volumes). Plates are incubated at
37 degree C. for either 5 h (selectin and integrin expression) or
24 h (integrin expression only). Plates are aspirated to remove
medium and 100 .mu.l of 0.1% paraformaldehyde-PBS (with Ca++ and
Mg++) is added to each well. Plates are held at 4.degree. C. for 30
min.
[1227] Fixative is then removed from the wells and wells are washed
1.times. with PBS (+Ca, Mg)+0.5% BSA and drained. Do not allow the
wells to dry. Add 10 .mu.l of diluted primary antibody to the test
and control wells. Anti-ICAM-1-Biotin, Anti-VCAM-1-Biotin and
Anti-E-selectin-Biotin are used at a concentration of 10 .mu.g/ml
(1:10 dilution of 0.1 mg/ml stock antibody). Cells are incubated at
37.degree. C. for 30 min. in a humidified environment. Wells are
washed .times.3 with PBS (+Ca, Mg)+0.5% BSA.
[1228] Then add 20 .mu.l of diluted EXTRAVIDIN.TM.-Alkaline
Phosphotase (1:5,000 dilution) to each well and incubated at
37.degree. C. for 30 min. Wells are washed .times.3 with PBS
(+Ca,Mg)+0.5% BSA. 1 tablet of p-Nitrophenol Phosphate pNPP is
dissolved in 5 ml of glycine buffer (pH 10.4). 100 .mu.l of pNPP
substrate in glycine buffer is added to each test well. Standard
wells in triplicate are prepared from the working dilution of the
EXTRAVIDIN.TM.-Alkaline Phosphotase in glycine buffer: 1:5,000
(10.sup.0)>10.sup.-0.5>10.sup.-1>10.sup.-1.5. 5 .mu.l of
each dilution is added to triplicate wells and the resulting AP
content in each well is 5.50 ng, 1.74 ng, 0.55 ng, 0.18 ng. 100
.mu.l of pNNP reagent must then be added to each of the standard
wells. The plate must be incubated at 37.degree. C. for 4 h. A
volume of 50 .mu.l of 3M NaOH is added to all wells. The results
are quantified on a plate reader at 405 nm. The background
subtraction option is used on blank wells filled with glycine
buffer only. The template is set up to indicate the concentration
of AP-conjugate in each standard well [5.50 ng; 1.74 ng; 0.55 ng;
0.18 ng]. Results are indicated as amount of bound AP-conjugate in
each sample.
[1229] The studies described in this example test activity in
G-protein Chemokine Receptor (CCR5) protein. However, one skilled
in the art could easily modify the exemplified studies to test the
activity of G-protein Chemokine Receptor (CCR5) polynucleotides
(e.g., gene therapy), agonists (including ligands), and/or
antagonists of G-protein Chemokine Receptor.
Example 50
Methods of Inhibiting G-Protein Coupled Receptor Activity Using
Transmembrane Fragments
[1230] WO 94/05695 and U.S. Pat. No. 5,508,384 set forth sequences
of transmembrane regions for 74 GPCRs. The WO 94/05695 patent
publication describes and claims polypeptides corresponding to
fragments or homologous sequences of GPCRs which can bind a GPCR
ligand or which can modulate ligand binding. Both references
disclose that a membrane spanning fragment of the third TM domain
of the dopamine D2 receptor specifically bound a ligand of the
intact receptor in a simple, small unilamellar vesicle model. The
fragment used was terminated with a lysine (which is positively
charged at physiological pH) at one end and with an aspartic acid
(which is negatively charged at physiological pH) at the other.
This peptide would not be expected to insert readily into a
biological membrane.
[1231] In contrast, this example relates to modulating, especially
inhibiting, biological activities of G-protein Chemokine Receptor
(CCR5) by exposing it to molecules which interfere with correct
receptor assembly. In particular, synthetic, isolated and/or
recombinant peptides, fragments and/or consensus peptides of the
transmembrane domain of G-protein Chemokine Receptor (CCR5) inhibit
G-protein Chemokine Receptor (CCR5)--mediated signal transduction.
Charged residues may be added at one terminus to promote correct
orientation of the peptide in the membrane. In particular, addition
of two negatively charged residues, such as Asp, at the
extracellular terminus of the fragment enhances antagonist
activity.
[1232] Fragments of the transmembrane domain can be synthesized by
flow-through solid phase peptide synthesis on 432A Applied
Biosystems Peptide Synthesizer utilizing Fmoc amino acid
derivatives. To overcome aggregation that may occur during
synthesis of the peptides and that may lead to blockage of the
growing peptide chain, FmocHmb derivatives of Ala, Val, and Leu are
introduced. Charged residues are added to the peptide termini to
assure a proper orientation of the peptides during penetration into
the cellular membrane, and to improve solubility of hydrophobic
peptides. Purity of the peptides is assessed by reverse phase HPLC
and the structures are confirmed by matrix-assisted
laser-desorption time-of-flight (MALDI-TOF) mass spectrometry
(Tarasova et al., Ad. Exp. Med. Biol., Plenum Press, NY, pp.
201-206 (1998).)
[1233] The antagonistic effect of the fragments is tested on human
kidney carcinoma (HEK) cells stably expressing the G-protein
Chemokine Receptor. RANTES is used as the agonist. Cells grown on
Nunc cover glass chamber slides are incubated with 1 .mu.M
Fura-2/AM for 20 min. in a CO.sub.2 incubator, rinsed with PBS, and
mounted on the stage of a Zeiss Axiovert inverted microscope.
[Ca.sup.2+]i measurements are performed using an Attofluor digital
imaging system (Atto Instruments). Fluorescence is monitored by an
intensified CCD camera using a 505 cut-off filter. Calibrations of
[Ca.sup.2+]i is performed using Ca.sup.2+ standards containing 1
.mu.M Fura. The antagonist activity of the fragments is further
optimized as described in Examples 1-4 of WO 99/43711.
[1234] The antagonist activity of the fragments is also tested by
the ability to inhibit G-protein Chemokine Receptor-HIV cell
fusion, and the ability to inhibit binding of a labeled ligand of
G-protein Chemokine Receptor (CCR5), by methods well-known in the
art and as described for CXCR4 in WO 99/43711.
Example 51
Herpes Virus Immortalized T Cells which Express the G-Protein
Chemokine Receptor (CCR5)
[1235] The construction of a Herpes Virus immortalized T cell line
which expresses the G-protein Chemokine Receptor (CCR5) is
described in Vella, et al., J. Virol. Methods 79:51-63 (1999). This
or a similar cell line is useful to assay agonists and antagonists
in the methods disclosed herein.
Example 52
Isolation of CCR5 Ligands and Anti-CCR5 Antibodies
[1236] A general method for solubilizing CCR5 in its native state
that may be used in ligand and antibody screening assays is
disclosed in Mirzabekov et al., J. Biol. Chem. 274:28745-50 (1999).
A method of selecting CCR5 antibody from a phage display library of
human antibodies is disclosed in Osbourn et al., Nat. Biotechnol.
16:778-81 (1998). Lee et al. disclose that the epitope recognized
by the CCR5-specific antibody 2D7 is a preferred target for
antibodies to inhibit HIV entry. Lee et al. J. Biol. Chem.
274:9617-26 (1999). Other methods of screening for ligands and
antibodies are well known in the art and are described herein.
Example 53
Assays for Antibody Neutralization
[1237] A cell-line based assay for measuring neutralization of
HIV-1 by antibodies is disclosed in Trkola et al., J. Virol.
73:8966-74 (1999). An assay for HIV-neutralizing antibody and
screen for a molecule that inhibits HIV binding or entry at any
stage is disclosed in Boritz et al., J. Virol. 73:6937-45 (1999). A
method for analyzing co-receptor inhibition is disclosed in Klasse
et al., J. Virol. 73:7453-66 (1999). Additional methods of assaying
neutralization of HIV entry, fusion, replication, etc., are well
known in the art and disclosed herein.
Example 54
Generation of Anti-G-Protein Chemokine Receptor (CCR5) Antibodies
Using XENOMOUSE.TM. Strains
[1238] XENOMOUSE.TM. strains of mice engineered to express a
repertoire of human IgM/Kappa or IgG2/kappa antibodies were
obtained from Abgenix, Inc, (Fremont, Calif.). Groups of mice were
immunized according to the following schedules:
[1239] Immunization Schedule 1 (XF3 Fusion):
[1240] XENOMOUSE.TM. mice (n=5) were initially injected in the base
of the tail with 100 micrograms in PBS of a DNA plasmid expression
vector encoding the full-length G-protein Chemokine Receptor (CCR5)
gene (CCR5 pcDNA3T). This was followed by three sub-cutaneous
injections given at two week intervals, each consisting of 10
million CHO cells transfected with a CCR5 expression vector
(hereinafter "CCR5 CHO cells") in incomplete Freund's adjuvant. The
animals were allowed to rest for 12 weeks and then given two more
sub-cutaneous injections separated by two weeks, each consisting of
10 million NSO cells transfected with a CCR5 expression vector
(hereinafter "CCR5 NSO cells") in incomplete Freund's adjuvant.
Three days after the last injection. Mice were sacrificed and
spleen and/or lymph node cells were collected for the purposes of
generating hybridomas. Hybridomas generated from this fusion are
referred to as "XF3.----" (Table 4).
[1241] Immunization Schedule 2 (XF6 Fusion):
[1242] XENOMOUSE.TM. mice (n=5) were initially injected
intraperitoneally with 7 million CCR5 CHO cells in complete
Freund's adjuvant. This was followed by six intraperitoneal
injections given at two week intervals, each consisting of 10
million CCR5 CHO cells. The animals were allowed to rest for 5
weeks and then given two more intraperitoneal injections separated
by two weeks, each consisting of 10 million CCR5 NSO cells in
incomplete Freund's adjuvant. Three days after the last injection.
Mice were sacrificed and spleen and/or lymph node cells were
collected for the purposes of generating hybridomas. Hybridomas
generated from this fusion are referred to as "XF6.----" (Table
4).
[1243] Immunization Schedule 3 (XF7 Fusion):
[1244] XENOMOUSE.TM. mice (n=5) were initially injected in the base
of the tail with 7 million CCR5 CHO cells in complete Freund's
adjuvant. This was followed by six additional injections in the
base of the tail given at two week intervals, each consisting of 10
million CCR5 CHO cells. The animals were allowed to rest for 5
weeks and then given two more injections in the base of the tail
separated by two weeks, each consisting of 10 million CCR5 NSO
cells in incomplete Freund's adjuvant. Three days after the last
injection, mice were sacrificed and spleen and/or lymph node cells
were collected for the purposes of generating hybridomas.
Hybridomas generated from this fusion are referred to as "XF7.----"
(Table 4).
[1245] Immunization Schedule 4 (XF11 Fusion):
[1246] XENOMOUSE.TM. mice (n=5) were immunized via injection in the
footpads given at two week intervals. Each immunization consisted
of a total of 10 million CCR5 NSO cells in RIBI adjuvant. A total
of eight such immunization were administered. Three days after the
last injection, mice were sacrificed and spleen and/or lymph node
cells were collected for the purposes of generating hybridomas.
Hybridomas generated from this fusion are referred to as
"XF11.----" (Table 4).
[1247] Immunization Schedule 5 (XF12 Fusion):
[1248] XENOMOUSE.TM. mice (n=5) were initially immunized with 10
million CCR5 NSO cells in complete Freund's adjuvant administered
via a combination of intraperitoneal and subcutaneous routes. This
was followed by six additional immunizations, given at two week
intervals, each consisting of 10 million CCR5 CHO cells in
incomplete Freund's adjuvant, also administered via a combination
of intraperitoneal and subcutaneous routes. One animal was
sacrificed for fusion three days after the third booster
immunization in incomplete Freund's adjuvant. Three days after the
last injection, the remaining mice were sacrificed and spleen
and/or lymph node cells were collected for the purposes of
generating hybridomas. Hybridomas generated from this fusion are
referred to as "XF12.----" (Table 4).
[1249] Immunization Schedule 6 (XF27/28 Fusion):
TABLE-US-00012 CCR5/XF27&28 FP Immunization Schedule Animals 20
mice Day No. Action Antigen Amount Volume Adjuvant Day 1 Inject
CCR5 NSO cells FP 5 .times. 10.sup.6 cells/ms 50 .mu.l 1:1 PBS/RIBI
Day 14 Inject CCR5 NSO cells FP 5 .times. 10.sup.6 cells/ms 50
.mu.l 1:1 PBS/RIBI Day 28 Inject CCR5 NSO cells FP 5 .times.
10.sup.6 cells/ms 50 .mu.l 1:1 PBS/RIBI Day 38 Inject CCR5 NSO
cells FP 5 .times. 10.sup.6 cells/ms 50 .mu.l PBS Day 41 Fusion
[1250] Hybridomas were generated according to protocols which are
commonly known in the art. The fusion partner used to generate
these hybridomas was P3.times.63-AG8.653 purchased from the
ATCC.TM., Batch F11545.
[1251] Antibodies produced by these hybridomas were screened for
the ability to bind CCR5 by both ELISA and FACS screening.
Membrane ELISA Screening for Anti-G-Protein Chemokine Receptor
(CCR5) Specific Antibodies
[1252] Plasma Membrane Preparation. Plasma membranes from CCR5 CHO
cells and vector control transfected CHO cells were prepared.
Briefly between 10.sup.8 to 10.sup.9 CCR5 CHO or CHO cells were
suspended in 40-50 milliliters of cold 12 mM Tris, pH 7.5, 250 mM
sucrose. Cells were lysed on ice, by homogenization using a
variable speed electric homogenator. Cell lysis was confirmed by
microscopy. The cell homogenate was centrifuged at 270.times.g, for
10 minutes at 4.degree. C. The supernatant (containing the plasma
membranes) was collected while the pellet (containing the nuclear
fraction was discarded. Next, the supernatant was centrifuge at
8000.times.g, for 10 minutes at 4.degree. C. Again, the supernatant
(containing the plasma membranes) was collected while the pellet
(containing the mitochondrial and lysosomal fractions) was
discarded. The plasma membranes were then spun out of the
supernatant by centrifugation in an ultracentrifuge at
100,000.times.g, for 60 minutes at 4.degree. C. The supernatant was
discarded. The pelleted plasma membranes were resuspended in
approximately 1 ml of PBS. After resuspension the volume of plasma
membranes was brought up to 5-10 ml with additional PBS. The
membrane solution was kept on ice and sonicated (on ice) until a
uniform solution was obtained. Care was taken not to overheat the
solution during sonication. The plasma membrane protein
concentration was determined using the BCA protein determination
kit available from Pierce Chemical Company (Rockford Ill.). The
plasma membranes were stored -70.degree. C. until use.
[1253] Membrane ELISA. Immulon 4 plates (Dynex) were coated with 50
microliters of either CCR5 CHO or vector control transfected CHO
plasma membranes (membrane solutions were at a concentration of 20
microgram/milliliter) overnight at 4.degree. C. The next morning,
the plates were washed three times with PBST (PBST=PBS containing
0.01% Tween20). The plates were then blocked for 1 hr at room
temperature with 200 microliters/well of 3% BSA/PBS. The blocking
solution was removed from the plates and 50 microliters/well of
samples (hybridoma supernatant) and controls were added to the
plates and incubated for 2 hours at room temperature or overnight
at 4.degree. C. Each sample/control was tested for binding to both
CCR5 CHO membranes as well as vector control transfected CHO
membranes. Next the plates were washed three times with PBST.
Following washing, 50 microliters/well of secondary antibody
(Vector Goat anti-Human IgG (H+L) at 0.25 ug/ml in 0.1% BSA/PBST+1%
Goat Serum) was added to the wells and incubated for 1 hour at room
temperature. While the plates were incubating, the ABC reagent
(Vector Laboratories) was prepared. The plate was then three times
with PBST. Next, 50 microliters/well of diluted ABC were added to
the plates and incubated for 30 minutes at room temperature. The
plates were then washed 6 times PBST. 100 microliters/well of TMB
reagent (Sigma Chemical Company, St. Louis, Mo.) were added to the
wells and incubated for 10 minutes at room temperature. The
reaction was then stopped by adding 25 microliters/well of 2M
H.sub.2SO.sub.4. The plate was read at 405 nm.
[1254] Results. 238 hybridomas showed binding to membranes of CCR5
CHO cells, of which approximately one half showed increased binding
to CCR5 CHO membranes compared to vector control transfected CHO
membranes. 217 (Table 4) of these hybridomas were expanded and the
membrane ELISA was repeated. Results from the second screening
demonstrated that the results of this screening procedure were
reproducible.
TABLE-US-00013 TABLE 4 Hybridomas that secrete antibodies that bind
CCR5 CHO membranes XF3 Fusion XF6 Fusion XF7 Fusion XF11 Fusion
XF12 Fusion XF3.10B8 XF6.LNG9 XF7.1A10 XF11.1 E2 XF12.10B2 XF3.10C4
XF6.4D11 XF7.2 E10 XF11.1 E6 XF12.11F5 XF3.10G4 XF6.LNC6 XF7.2A2
XF11.1A11 XF12.12B11 XF3.10H12 XF6.LNF6 XF7.2C4 XF11.1A2 XF12.13H6
XF3.11B5 XF6.LNC11 XF7.3A5 XF11.1A8 XF12.15B11 XF3.13D3 XF6.LND9
XF7.3H1 XF11.1B10 XF12.1B8 XF3.14 E12 XF6.LNF2 XF7.3H2 XF11.1B12
XF12.2E1 XF3.15C2 XF7.3H8 XF11.1B4 XF12.2E12 XF3.15F6 XF7.4 E8
XF11.1B7 XF12.2H5 XF3.2A3 XF7.4 E9 XF11.1B9 XF12.2H8 XF3.2E5
XF7.4A6 XF11.1C1 XF12.3E2 XF3.3H1 XF7.4B2 XF11.1C7 XF12.3A9 XF3.4B6
XF7.4G3 XF11.1D10 XF12.3C2 XF3.4C5 XF7.4G7 XF11.1D8 XF12.3G11
XF3.5F1 XF7.4H4 XF11.1F8 XF12.4A8 XF3.6A1 XF7.4H7 XF11.1G11
XF12.4G7 XF3.6A2 XF7.5A1 XF11.1G8 XF12.5B10 XF3.6H11 XF7.5B8
XF11.1H7 XF12.5B11 XF3.7C11 XF7.5B9 XF11.2E4 XF12.5F1 XF3.8D5
XF7.5H8 XF11.2E5 XF12.5H1 XF3.8G10 XF7.6B11 XF11.2B9 XF12.6B12
XF3.9G3 XF7.6B12 XF11.2C9 XF12.6H1 XF3.LNA2 XF7.6B3 XF11.2D1
XF12.6H7 XF3.LNB12 XF7.6D12 XF11.2D10 XF12.7F12 XF3.LNC10 XF7.6D3
XF11.2D11 XF12.LND11 XF3.LNC11 XF7.6D7 XF11.2D5 XF3.LNC2 XF7.7A9
XF11.2D8 XF3.LNC3 XF7.7B6 XF11.2F3 XF3.LNC4 XF7.7C11 XF11.2F5
XF3.LNC6 XF7.7C4 XF11.2F6 XF3.LND9 XF7.7E8 XF11.2F7 XF3.LNE7
XF7.7F8 XF11.2F8 XF3.LNF1 XF7.7G4 XF11.2F9 XF3.LNH5 XF7.LN1B1
XF11.2G11 XF7.LN1B7 XF11.2G4 XF7.LN1D10 XF11.2G6 XF7.LN1D11
XF11.2G8 XF7.LN1D9 XF11.2G9 XF7.LN1E10 XF11.2H10 XF7.LN1E11
XF11.2H2 XF7.LN1E12 XF11.2H4 XF7.LN2A11 XF11.2H8 XF7.LN2A7 XF11.3A3
XF11.3B10 XF11.3B9 XF11.3C3 XF11.3C6 XF11.3C7 XF11.3D1 XF11.3D12
XF11.3D2 XF11.3D3 XF11.3F4 XF11.3G12 XF11.3G2 XF11.3G3 XF11.3H7
XF11.4E11 XF11.4A1 XF11.4A5 XF11.4B10 XF11.4B12 XF11.4B3 XF11.4B4
XF11.4C10 XF11.4C12 XF11.4C4 XF11.4D10 XF11.4D12 XF11.4D3 XF11.4D4
XF11.4D5 XF11.4F11 XF11.5E2 XF11.5A2 XF11.5C10 XF11.5D12 XF11.5F2
XF11.5F3 XF11.5G10 XF11.5G11 XF11.5G4 XF11.5G5 XF11.5G6 XF11.5H1
XF11.5H4 XF11.5H5 XF11.6E12 XF11.6E4 XF11.6E7 XF11.6A3 XF11.6A5
XF11.6B3 XF11.6B4 XF11.6B9 XF11.6C11 XF11.6C5 XF11.6D7 XF11.6D8
XF11.6D9 XF11.6F2 XF11.6F9 XF11.6G1 XF11.6G6 XF11.6H11 XF11.6H2
XF11.6H4 XF11.6H7
FACS Screening for Anti-G-Protein Chemokine Receptor (CCR5)
Specific Antibodies
[1255] G-Protein Chemokine Receptor (CCR5) transfected or vector
control transfected CHO cells were harvested, washed with FACS
buffer (PBS with 0.1% NaN3 and 0.1% BSA). One million cells in 100
ul were dispensed to FACS tubes (Falcon 2052). 10 microliters of
hybridoma supernatant was added to each tube and incubated for 20
min at 4C. Each supernatant was analyzed for binding to both CCR5
CHO and vector control transfected CHO cells. Cells were washed,
and resuspended in 100 microliters of FACS buffer and 10
microliters of biotinylated Goat anti-Human IgG (H+L) (Vector) at 1
microgram/milliliter was added to the tubes and incubated 20 min at
4C. Cells were washed, resuspended in 100 microliters of FACS
buffer and 5 microliters of Streptavidin PE (DAKO) was added
followed by a 10 minute incubation at 4 degrees C. Cells were
washed, resuspended in 200 microliters of FACS buffer containing
0.5 micrograms/milliliter of propidium iodide and analyzed on
FACScan (Becton Dickinson).
[1256] Results. Of the 217 hybridomas supernatants screened by FACS
analysis, XF11.1D8, XF11.4D10, XF11.4C4, XF11.5H1, and XF11.1G8
were identified as showing significantly increased binding to CCR5
CHO compared to vector control transfected CHO cells.
[1257] Additional hybridomas were produced and their supernatants
were screened for anti-G-protein Chemokine Receptor (CCR5) specific
antibodies. A number of these were also found to have significantly
increased binding to CCR5 compared to controls. They are described
herein as preferred antibodies, and are listed in Table 2.
Example 55
Identification and Cloning of VH and VL Domains
[1258] One method to identify and clone VH and VL domains from cell
lines expressing a particular antibody is to perform PCR with VH
and VL specific primers on cDNA made from the antibody expressing
cell lines. Briefly, RNA is isolated from the cell lines and used
as a template for RT-PCR designed to amplify the VH and VL domains
of the antibodies expressed by the EBV cell lines. Cells may lysed
in the TRIZOL.RTM. reagent (LIFE TECHNOLOGIES.TM., Rockville. MD)
and extracted with one fifth volume of chloroform. After addition
of chloroform, the solution is allowed to incubate at room
temperature for 10 minutes, and the centrifuged at 14,000 rpm for
15 minutes at 4.degree. C. in a tabletop centrifuge. The
supernatant is collected and RNA is precipitated using an equal
volume of isopropanol. Precipitated RNA is pelleted by centrifuging
at 14,000 rpm for 15 minutes at 4.degree. C. in a tabletop
centrifuge. Following centrifugation, the supernatant is discarded
and washed with 75% ethanol. Following washing, the RNA is
centrifuged again at 800 rpm for 5 minutes at 4.degree. C. The
supernatant is discarded and the pellet allowed to air dry. RNA is
the dissolved in DEPC water and heated to 60.degree. C. for 10
minutes. Quantities of RNA can determined using optical density
measurements.
[1259] cDNA may be synthesized, according to methods well-known in
the art, from 1.5-2.5 micrograms of RNA using reverse transciptase
and random hexamer primers. cDNA is then used as a template for PCR
amplification of VH and VL domains. Primers used to amplify VH and
VL genes are shown in Table 5. Typically a PCR reaction makes use
of a single 5' primer and a single 3' primer. Sometimes, when the
amount of available RNA template is limiting, or for greater
efficiency, groups of 5' and/or 3' primers may be used. For
example, sometimes all five VH-5' primers and all JH3' primers are
used in a single PCR reaction. The PCR reaction is carried out in a
50 microliter volume containing 1.times.PCR buffer, 2 mM of each
dNTP, 0.7 units of High Fidelity Taq polymerase, 5' primer mix, 3'
primer mix and 7.5 microliters of cDNA. The 5' and 3' primer mix of
both VH and VL can be made by pooling together 22 pmole and 28
pmole, respectively, of each of the individual primers. PCR
conditions are: 96.degree. C. for 5 minutes; followed by 25 cycles
of 94.degree. C. for 1 minute, 50.degree. C. for 1 minute, and
72.degree. C. for 1 minute; followed by an extension cycle of
72.degree. C. for 10 minutes. After the reaction is completed,
sample tubes were stored 4.degree. C.
TABLE-US-00014 TABLE 5 Primer Sequences Used to Amplify VH and VL
domains. Primer name SEQ ID NO Primer Sequence (5'-3') VH Primers
Hu VH1-5' 23 CAGGTGCAGCTGGTGCAGTCTGG Hu VH2-5' 24
CAGGTCAACTTAAGGGAGTCTGG Hu VH3-5' 25 GAGGTGCAGCTGGTGGAGTCTGG Hu
VH4-5' 26 CAGGTGCAGCTGCAGGAGTCGGG Hu VH5-5' 27
GAGGTGCAGCTGTTGCAGTCTGC Hu VH6-5' 28 CAGGTACAGCTGCAGCAGTCAGG Hu
JH1,2-5' 29 TGAGGAGACGGTGACCAGGGTGCC Hu JH3-5' 30
TGAAGAGACGGTGACCATTGTCCC Hu JH4,5-5' 31 TGAGGAGACGGTGACCAGGGTTCC Hu
JH6-5' 32 TGAGGAGACGGTGACCGTGGTCCC VL Primers Hu Vkappa1-5' 33
GACATCCAGATGACCCAGTCTCC Hu Vkappa2a-5' 34 GATGTTGTGATGACTCAGTCTCC
Hu Vkappa2b-5' 35 GATATTGTGATGACTCAGTCTCC Hu Vkappa3-5' 36
GAAATTGTGTTGACGCAGTCTCC Hu Vkappa4-5' 37 GACATCGTGATGACCCAGTCTCC Hu
Vkappa5-5' 38 GAAACGACACTCACGCAGTCTCC Hu Vkappa6-5' 39
GAAATTGTGCTGACTCAGTCTCC Hu Vlambda1-5' 40 CAGTCTGTGTTGACGCAGCCGCC
Hu Vlambda2-5' 41 CAGTCTGCCCTGACTCAGCCTGC Hu Vlambda3-5' 42
TCCTATGTGCTGACTCAGCCACC Hu Vlambda3b-5' 43 TCTTCTGAGCTGACTCAGGACCC
Hu Vlambda4-5' 44 CACGTTATACTGACTCAACCGCC Hu Vlambda5-5' 45
CAGGCTGTGCTCACTCAGCCGTC Hu Vlambda6-5' 46 AATTTTATGCTGACTCAGCCCCA
Hu Jkappa1-3' 47 ACGTTTGATTTCCACCTTGGTCCC Hu Jkappa2-3' 48
ACGTTTGATCTCCAGCTTGGTCCC Hu Jkappa3-3' 49 ACGTTTGATATCCACTTTGGTCCC
Hu Jkappa4-3' 50 ACGTTTGATCTCCACCTTGGTCCC Hu Jkappa5-3' 51
ACGTTTAATCTCCAGTCGTGTCCC Hu Jlambda1-3' 52 CAGTCTGTGTTGACGCAGCCGCC
Hu Jlambda2-3' 53 CAGTCTGCCCTGACTCAGCCTGC Hu Jlambda3--3' 54
TCCTATGTGCTGACTCAGCCACC Hu Jlambda3b-3' 55 TCTTCTGAGCTGACTCAGGACCC
Hu Jlambda4-3' 56 CACGTTATACTGACTCAACCGCC Hu Jlambda5-3' 57
CAGGCTGTGCTCACTCAGCCGTC Hu Jlambda6-3' 58
AATTTTATGCTGACTCAGCCCCA
TABLE-US-00015 TABLE 6 Anti-CCR5 Antibodies XF11.1D8, XF22.3C9
(e.g., XF22.3C9.6), and XF22.9E6 VH VH VL VL Hybridoma DNA protein
AAs of AAs of AAs of DNA protein AAs of AAs of AAs of ATCC .TM.
ATCC .TM. Cell Line/ SEQ ID SEQ ID VH VH VH SEQ ID SEQ ID VL VL VL
Deposit Deposit Antibody NO: NO: CDR1 CDR2 CDR3 NO: NO: CDR1 CDR2
CDR3 Number Date XF11.1D8 59 60 31-35 50-65 98-110 61 62 24-35
51-57 90-98 PTA-3030 Feb. 7, 2001 XF22.3C9 63 64 31-35 50-68
102-115 65 66 24-34 50-56 89-97 PTA-3702 Sep. 12, 2001 XF22.9E6 67
68 31-35 50-65 98-115 69 70 24-35 51-57 90-98 PTA-3859 Nov. 14,
2001
[1260] PCR samples are then electrophoresed on a 1.3% agarose gel.
DNA bands of the expected sizes (-506 base pairs for VH domains,
and 344 base pairs for VL domains) can be cut out of the gel and
purified using methods well known in the art. Purified PCR products
can be ligated into a PCR cloning vector (TA vector from Invitrogen
Inc., Carlsbad, Calif.). Individual cloned PCR products can be
isolated after transfection of E. coli and blue/white color
selection. Cloned PCR products may then be sequenced using methods
commonly known in the art. The polynucleotide and amino acid
sequences of the VH and VL domains of anti-CCR5 antibodies
XF11.1D8, XF22.3C9.6, and XF22.9E6 are shown in FIGS. 4, 5, and 6
(see also, Table 6).
[1261] The PCR bands containing the VH domain and the VL domains
can also be used to create full-length Ig expression vectors. VH
and VL domains can be cloned into vectors containing the nucleotide
sequences of a heavy (e.g., human IgG1 or human IgG4) or light
chain (human kappa or human lambda) constant regions such that a
complete heavy or light chain molecule could be expressed from
these vectors when transfected into an appropriate host cell.
Further, when cloned heavy and light chains are both expressed in
one cell line (from either one or two vectors), they can assemble
into a complete functional antibody molecule that is secreted into
the cell culture medium. Methods using polynucleotides encoding VH
and VL antibody domain to generate expression vectors that encode
complete antibody molecules are well known within the art.
Example 56
Immunofluorescence Assay
[1262] The following immunofluorescence protocol may be used, for
example, to verify G-protein Chemokine Receptor (CCR5) expression
on cells, or to check for the presence of one or more antibodies
that bind G-protein Chemokine Receptor (CCR5) expressed on the
surface of cells. Briefly, Lab-Tek II chamber slides are coated at
4.degree. C. overnight with 10 micrograms/milliliter of bovine
collagen Type II in DPBS containing calcium and magnesium (DPBS++).
The slides are then washed twice with cold DPBS++ and seeded with
8000 CHO-CCR5 or CHO pC4 transfected cells in a total volume of 125
microliters and incubated at 37.degree. C. in the presence of 95%
oxygen/5% carbon dioxide. The culture medium is gently aspirated
out and the adhering cells are washed twice with DPBS++ at ambient
temperature. The slides are blocked with DPBS++ containing 0.2% BSA
(blocker) at 0-4.degree. C. for one hour. The blocking solution is
gently aspirated out and 125 microliters of antibody containing
solution (an antibody containing solution may be, for example, a
hybridoma culture supernatant which is usually used undiluted, or
serum/plasma which is usually diluted--around a 1/100 dilution).
The slides are incubated for 1 hour at 0-4.degree. C. Antibody
solutions are then gently aspirated off and the cells are washed 5
times with 400 microliters of ice cold blocking solution. Next. 125
microliters of a 1 microgram/milliliter of rhodamine labeled
secondary antibody (e.g., anti-human IgG) in the blocker is added
to the cells. Again, cells are incubated for 1 hour at 0-4.degree.
C. The secondary antibody solution is then aspirated off gently and
the cells washed 3 times with 400 microliters of ice cold blocking
solution and 5 times with cold DPBS++. The cells are then fixed
with 125 microliters of 3.7% formaldehyde in DPBS++ for 15 minutes
at ambient temperature. The cells are washed 5 times with 400 .mu.l
of DPBS++ at ambient temperature. Finally, the cells are mounted in
50% aqueous glycerol and viewed in a fluorescence microscope using
rhodamine filters.
Example 57
Western Blotting to Detect Binding to G-Protein Chemokine Receptor
(CCR5)
[1263] G-protein Chemokine Receptor (CCR5) is a membrane embedded
protein. In order to perform a western blot on G-protein Chemokine
Receptor (CCR5) proteins, cell membranes must first be solubilized.
The following protocol was worked out by Mirzabekov et al., J.
Biol. Chem. 274:28745 (1999) which is hereby incorporated in its
entirety by reference herein. A single cell suspension of G-protein
Chemokine Receptor (CCR5)-CHO cells or pC4-CHO (vector transfected
control CHO) cells, is pelleted and resuspended in solubilization
buffer composed of 100 mM (NH.sub.4).sub.2SO.sub.4, 20 mM Tris-HCl
(pH 7.5) and 1% (w/v) Cymal.TM.-5 (Anatrace Inc., Maumee, Ohio),
and protease inhibitor mixture (one tablet of Complete.TM. (Roche
Molecular Biochemicals) per 25 ml. After a 30 minute incubation at
4C on a rocking platform, the samples are centrifuged for 30
minutes at 14,000.times.g to remove cell debris. G-protein
Chemokine Receptor (CCR5) is immunoprecipitated from the
solubilized membrane using, for example, the monoclonal
anti-G-protein Chemokine Receptor (CCR5) antibody 2D7 described in
Wu et al., J. Exp. Med. 186:1373 (1997) conjugated to sepharose
beads. Following immunoprecipitation, the beads are washed
extensively with solubilization buffer and resuspended in
2.times.SDS-sample buffer. Samples are incubated in SDS-sample
buffer for 1 hour at 55 C prior to electrophoresis through an 11%
SDS-polyacrylamide gel. Western blotting on the G-protein Chemokine
Receptor (CCR5) samples can then be carried out according to
standard protocols known in the art.
Example 58
Western Blotting, Immunoprecipitation, and Purification of
G-Protein Chemokine Receptor (CCR5)
[1264] The membrane solubilization protocol or Mirzabekov et al
described in Example 57 above may also be used to prepare G-protein
Chemokine Receptor (CCR5) containing samples for western blotting,
immunoprecipitation or purification.
Example 59
BIACORE.TM. Analysis of the Affinity of G-Protein Chemokine
Receptor (CCR5) Binding Polypeptides
[1265] Binding of anti-G-protein Chemokine Receptor (CCR5)
antibodies to G-protein Chemokine Receptor (CCR5), for example, can
be analyzed by BIACORE.TM. analysis. Either G-protein Chemokine
Receptor (CCR5) (or other antigen to which one wants to know the
affinity of a anti-G-protein Chemokine Receptor (CCR5) antibody) or
anti-G-protein Chemokine Receptor (CCR5) antibody can be covalently
immobilized to a BIACORE.TM. sensor chip (CM5 chip) via amine
groups using
N-ethyl-N'-(dimethylaminopropyl)carboiimide/N-hydroxysuccinimide
chemistry. Various dilutions of anti-G-protein Chemokine Receptor
(CCR5) antibodies or G-protein Chemokine Receptor (CCR5) (or other
antigen to which one wants to know the affinity of a anti-G-protein
Chemokine Receptor (CCR5) antibody), respectively are flowed over
the derivatized CM5 chip in flow cells at 15 microliters/min for a
total volume of 50 microliters. The amount of bound protein is
determined during washing of the flow cell with HBS buffer (10 mM
HEPES, pH7.4, 150 mM NaCl, 3.4 mM EDTA, 0.005% surfactant p20).
Binding specificity for the protein of interest is determined by
competition with soluble competitor in the presence the protein of
interest.
[1266] The flow cell surface can be regenerated by displacing bound
protein by washing with 20 microliters of 10 mM glycine-HCl, pH2.3.
For kinetic analysis, the flow cells are tested at different flow
rates and different polypeptide densities on the CM5 chip. The
on-rates and off-rates can be determined using the kinetic
evaluation program in a BIAevaluation 3 software.
Example 60
Virus Neutralization Assay
[1267] Antibodies of the invention may be assayed for their ability
to inhibit or reduce ha ability of HIV-1 to infect (CCR5
expressing) cells using a virus neutralization assay such as the
assay described in Zolla-Pazner and Sharpe, AIDS Res. Hum.
Retrovir. 11:1449 (1995) which is incorporated in its entirety by
reference herein. Briefly, 2.times.10.sup.5 resting PBMC are added
to appropriate dilution(s) of antibodies of the invention. After a
one hour incubation, the cells are exposed to virus for 2 hours,
washed and resuspended in culture medium containing PHA and IL-2.
At various time points after infection, such as at days 7 and 9,
the amount of HIV p24 antigen in culture supernatant is measured
using ELISA. The percent neutralization was calculated relative to
a control experiment in which HIV was allow to infect cells in the
absence of antibodies of the invention, or alternatively (or in
addition), in the presence of an (isotype matched, if necessary)
control antibody with irrelevant specificity.
[1268] A variation of this assay is to perform it on activated,
rather than resting, PBMC. This can be achieved by culturing the
PBMC in the presence of PHA and IL-2 for two days before performing
the virus neutralization assay.
Example 61
MIP-1 beta Binding Assay
[1269] Antibodies of the invention may be assayed for their ability
to prevent a natural ligand of CCR5, e.g., MIP1-beta, from binding
to the CCR5 receptor.
[1270] The following .sup.125I-MIP1-beta binding assay is an
example of one assay that could be performed to determine the
ability of an antibody of the invention to prevent a natural ligand
of CCR5, MIP1-beta, from binding to the CCR5 receptor.
[1271] Twenty-five microCuries of .sup.125I-MIP-1beta (Amersham
Pharmacia Biotech, Cat# IM310, 25 microCuries, 2000 Ci/mmol) is
dissolved in 1 milliliter of distilled water to make a 12.5 nM
stock solution. If cultured cells, such as CCR5 CHO cells, are used
in this experiment, they are trypsinized, washed and resuspended at
10.times.10.sup.6 cells/milliliter in binding buffer (1 mM
CaCl.sub.2, 5 mM MgCl.sub.2, 50 mM Hepes, 0.5% BSA, 0.1% NaN.sub.3,
pH 7.5). If Peripheral Blood mononuclear cells (PBMC) are to be
used in this assay, they are isolated from healthy donors and
resuspended at 2.times.10.sup.6 cell/milliliter in binding
buffer.
[1272] To determine what concentration or quantity of MIP-1beta
would saturate the cells in this assay, a series of
.sup.125I-MIP-1beta dilutions at four times the desired final
concentration is made. (For example, for final concentrations of 3
nM, a 12 nM solution should be prepared). Typically, the desired
final concentration of .sup.125I-MIP-1beta range from 3 nM down to
0.05 nM. Additionally, a solution of cold (non-radioactive)
MIP-1beta at four times the desired final concentration is made.
Typically, the desired final concentration of cold MIP-1beta is 200
nM, so an 800 nM solution is prepared.
[1273] To measure the total binding of .sup.125I-MIP-1beta to
cells, 25 microliters binding buffer, 25 microliters hot
.sup.125I-MIP-1beta, and 50 microliters cell suspension are added
to a U-bottom 96 well microplate (Costa, Cat# 3799). The cells are
always added last. If the binding of .sup.125I-MIP-1beta is
non-specific, it will not be effectively competed away by cold
MIP-1beta. Therefore, to assess the specificity of binding, 25
microliters cold MIP-1beta (800 nM), 25 microliters hot
.sup.125I-MIP-1beta (various dilutions, and 50 microliters cell
suspension are added to a U-bottom 96 well microplate. Again the
cells are always added last. The mixtures are then incubated at
room temperature in a shaker for one hour. After incubation, each
sample is transferred to the top of tubes containing 200
microliters of an oil mixture (2:1 dibutyl phthalate:dioctyl
phthalate). The tubes are spun at 12000 rpm for 20 seconds using a
microcentrifuge. The bottom of the tube, containing the cell
pellet, is cut off and counted in a gamma counter. If the binding
of MIP-1beta is specific, less radioactivity will be measured in
the gamma counter in the competition assay. As a control for
ensuring that the MIP-1beta is binding, to G-protein Chemokine
Receptor (CCR5), one may choose to perform the experiment on a
suitable CCR5 non-expressing cells, e.g., vector transfected CHO
cells.
[1274] To perform a competition assay to determine if a chemokine
or antibody can compete with MIP-1 beta for binding to the same
G-protein Coupled Receptor, a dilution series of cold chemokine or
antibody at four times the desired final concentrations is
prepared. Additionally, a solution of .sup.125I-MIP-1beta at four
times the desired final concentration is prepared. For this type of
competition assay, a 2 nM solution of .sup.125I-MIP-1beta, which
will give a final concentration of 0.5 nM, is prepared.
[1275] To measure the total binding of .sup.125I-MIP-1beta to
cells, 25 microliters binding buffer, 25 microliters hot
.sup.125I-MIP-1beta (2 nM), and 50 microliters cell suspension are
added to a U-bottom 96 well microplate. The cells are always added
last. If another substance (e.g., anti-G-protein Chemokine Receptor
(CCR5) antibody, or another chemokine) binds the receptor of
MIP-1beta (i.e., G-protein Chemokine Receptor (CCR5)) the presence
of increasing amounts of cold (non-radioactive) substance (e.g.,
anti-G-protein Chemokine Receptor (CCR5) antibody, or another
chemokine) will compete for binding to the MIP-1beta receptor
(i.e., G-protein Chemokine Receptor (CCR5). Therefore, to determine
if a substance binds to the MIP-1beta receptor (i.e., G-protein
Chemokine Receptor (CCR5), and inhibits (radioactively labelled)
MIP-1beta from binding to its receptor (i.e., G-protein Chemokine
Receptor (CCR5), 25 microliters of cold substance (e.g.
anti-G-protein Chemokine Receptor (CCR5) antibody at various
dilutions), 25 microliters hot .sup.125I-MIP-1beta (2 nM), and 50
microliters cell suspension are added to a U-bottom 96 well
microplate. Again the cells are always added last. The mixtures are
then incubated at room temperature in a shaker for one hour. After
incubation, each sample is transferred to the top of tubes
containing 200 microliters of an oil mixture (2:1 dibutyl
phthalate:dioctyl phthalate). The tubes are spun at 12000 rpm for
20 seconds using a microcentrifuge. The bottom of the tube,
containing the cell pellet, is cut off and counted in a gamma
counter. If the binding of MIP-1beta is specific, less
radioactivity will be measured in the gamma counter in the
competition assay. As a control for ensuring that the MIP-1beta is
binding, to G-protein Chemokine Receptor (CCR5), one may choose to
perform the experiment on a suitable CCR5 non-expressing cells,
e.g., vector transfected CHO cells.
[1276] An alternative assay, but similar, assay to determine the
ability of an antibody of the invention to prevent a natural ligand
of CCR5, MIP1-beta, from binding to the CCR5 receptor is described
in Lopalco et al., J. Immunol., 164:3426 (2000) and in Trkola et
al., Nature, 384:184 (1996) which are incorporated in their
entireties by reference herein. Briefly, 10.sup.6 CCR5 expressing
cells (e.g., CD4+ T cells, CCR5 transfected-CHO cells) are
incubated on ice with appropriate dilution(s) of antibody of the
invention. After 45 minutes of incubation, 0.2 microCuries of
radiolabelled MIP1-beta (e.g., 125I-MIP1-beta (DuPont-NEN, Boston,
Mass.) is added to a final concentration of 0.1 nM. After a two
hour incubation on ice, unbound radioactivity is removed using a
two step gradient, as described in Grassi et al., J Exp Med. 174:53
(1991) which is incorporated in its entirety by reference herein,
in which the lower layer consists of fetal calf serum containing
10% sucrose, and the upper layer consists of 80% silicone (Sigma
Aldrich) and 20% mineral oil (Sigma Aldrich). Bound radioactivity
in cell pellets is measured in a gamma counter.
Example 62
Chemotaxis Assay
[1277] Polypeptides, and agonists or antagonists thereof of the
invention may be assayed for their ability to enhance, inhibit, or
not significantly alter chemotaxis of G-protein Chemokine Receptor
(CCR5) expressing cells in response to MIP1-beta. The G-protein
Chemokine Receptor (CCR5) expressing cells may be a homogeneous
population of purified G-protein Chemokine Receptor (CCR5)
expressing cells or a heterogeneous population, (e.g., peripheral
blood mononuclear cells, PBMC).
[1278] The following assay to measure MIP1-beta induced chemotaxis
of CCR5 expressing cells involves labeling cells with a
(fluorescent) tracer molecule, inducing chemotaxis in a well of a
96 well plate containing a filter through which cells can pass, and
measuring the number of migrated cells via fluorescence emission.
To perform this assay the following materials are needed:
[1279] HBSS, without calcium, without magnesium (Biofluids Cat#:
p325-000)
[1280] Albumin, Bovine Powder, fraction V, IgG free (SIGMA.TM.
Cat#: A-2058)
[1281] ChemoTx# 105-2 (for T cell, PBMC, NK cell), 108-1(for
eosinophil, PMN) (Neuro Probe, Inc)
[1282] Calcein, AM (1 milligram/milliliter in dry DMSO) (Molecular
Probes Cat#: C-3099)
[1283] PBS, 1.times., pH 7.4, without calcium and magnesium
(Biofluids Cat#: p312-00
[1284] Briefly, cells (e.g. PBMC) are washed twice with HBSS
(Biofluids Cat#: p325-000)/0.1% BSA and resuspended in the buffer
at 10.times.10.sup.6 cells/milliliter. 5 microliters of calcein AM
(1 milligram/milliliter stock) is added to 1 milliliter of the cell
suspension. Cells are incubated at 37.degree. C. incubator with
loose cap for 30 minutes. After incubation, cells are washed twice
with HBSS/0.1% BSA and resuspended at 10.times.10.sup.6/milliliter
in HBSS/0.1% BSA buffer. Twenty-nine microliters of test chemokine
or control buffer is added into bottom chamber of the chemotaxis
microplate. The filter is snapped onto the 96-well plate position
making sure no air bubbles get between the filter and the solution.
Next, 20 microliters of the cells are loaded on top of the filter
and the plate is covered to prevent evaporation. The plate is then
incubated at 37.degree. C. for 2 hours for T cells, PBMC, PMN and
NK cells and 3 hours for eosinophils. After incubating, carefully
flush the top surface of the filter with PBS buffer and then gently
wipe the non-migrated cells off the top of the filter with a
squeegee. Read the plate and filter at Excitation of 485
nm/Emission 530 nm using CYTOFLUOR.TM. fluorescence reader. Results
are expressed as chemotactic index, which represents the fold
increase in the number of migrated cells in response to chemokine
over the spontaneous cell migration in control medium.
[1285] This protocol can easily be modified to assay if an agonist
or antagonist of G-protein Chemokine Receptor (e.g., anti-G-protein
Chemokine Receptor (CCR5) antibodies can enhance, inhibit or not
significantly alter the ability of MIP-1beta to induce chemotaxis
in CCR5 expressing cells. To do this, one might preincubate the
cells with anti-G-protein Chemokine Receptor (CCR5) antibodies
(possibly at several concentrations in order to generate a
dose-response curve) prior to loading the cells on top of the
filter.
[1286] An alternative assay to measure the ability of polypeptides,
and agonists or antagonists thereof of the invention to enhance,
inhibit, or not significantly alter chemotaxis of G-protein
Chemokine Receptor (CCR5) expressing cells in response to MIP-1beta
can be performed in a transwell chamber, rather than in a 96 well
microplate. To perform this assay the following materials are
needed:
[1287] RPMI-1640 (GIBCO-BRL Cat#: 21870-084)
[1288] Albumin, Bovine Powder, fraction V, IgG free (SIGMA.TM.
Cat#: A-2058)
[1289] Transwell plate (Costar Cat#: 3421), 6.5 mm Diameter, 5.0
.mu.m pore size
[1290] MIP-1.beta. (R&D Systems Cat#: 271-BME)
[1291] Lymphocyte Separation Medium (ICN Biochemical Cat #:
50494)
[1292] Briefly, PBMC are isolated from fresh human peripheral blood
by using Lymphocyte Separation Medium and cultured in RPMI-1640
with 10% FBS for 2 days. Cultured PBMC are resuspended in
RPMI-1640/0.5% BSA at 20.times.10.sup.6 cells/milliliter. MIP-1beta
is diluted in RPMI-1640/0.5% BSA to final concentrations of 10, 100
and 1000 nanograms/milliliter. 600 microliters of MIP-1beta
solution or RPMI-1640/0.5% BSA alone is added to the bottom chamber
of the transwell and 100 microliters of the cell suspension is
added to the top of the filter. Cells are incubated at 37.degree.
C. for 4 hours. After the incubation, collect the cells that are
migrated to the bottom the chamber and then perform a FACS
analysis, for example, to determine the number and type of the
migrated cell population(s). Results are expressed as chemotactic
index, which represents the fold increase in the number of migrated
cells in response to chemokine over the spontaneous cell migration
in control medium.
[1293] An additional assay to determine the ability of an antibody
of the invention to prevent a natural ligand of CCR5, MIP1-beta,
from inducing chemotaxis in MIP-1beta expressing cells is described
in Lopalco et al., J. Immunol., 164:3426 (2000). Briefly PBMC are
activated (e.g., with phytohemagglutinin and IL-2) for 3 days in
the presence of antibodies of the invention. Then 3.times.10.sup.5
activated PBMC in 50 microliters of 1640 RPMI containing 3% human
serum albumin are placed in the upper chamber of a bare filter
transwell with 5 micrometer pore size (CoStar). 1.5 micrograms of
MIP1-beta is plated in the lower chambers. Chemotaxis was permitted
to occur for one half hour while the transwell chamber was
incubated at 37 degrees Celsius. Cells that migrated from the upper
to the lower chamber were then quantified by FACS analysis. Results
are expressed in terms of a migration index, (i.e. the number of
cells migrating to a lower chamber containing MIP1-beta/the number
of cells migrating to a lower chamber containing only control
medium.
Example 63
Calcium Mobilization Following Triggering of the G-Protein
Chemokine Receptor (CCR5) Protein
[1294] When the G-protein Chemokine Receptor (CCR5) is triggered,
calcium from intracellular stores and from extracellular spaces is
mobilized. This calcium mobilization can be monitored using
Fluorescent Ca.sup.++ indicators that can be excited with UV light,
such as for example, Fura-2, AM available from Molecular Probes,
Eugene, Oreg. (Cat# F-1221). An assay to monitor calcium
mobilization using Fura-2 AM is described below.
[1295] Briefly, cells (e.g., purified PBMC or CCR5 transfected
cells such as CCR5 CHO cells) are suspended at 5.times.10.sup.6
cells/milliliter in calcium buffer (20 mM Hepes buffer, 125 mM
NaCl, 5 mM KCl, 0.5 mM Glucose, 1 mM CaCl.sub.2, 1 mM MgCl.sub.2,
0.025% BSA, pH 7.4). Fura-2, AM (50 .mu.g/vial) is dissolved in 25
.mu.l of DMSO. Cells are labeled with dye by adding 1 .mu.l of the
Fura-2 AM to 2 ml of cell suspension. The cells are then incubated
for 30 minutes at room temperature in the dark. After incubation,
the cells are washed twice with calcium buffer and suspended at
1.times.10.sup.6 cells/milliliter in calcium buffer. Two
milliliters of the cell suspension is placed in a continuously
stirring cuvette at 37.degree. C. [Ca.sup.++].sub.i concentration
is measured using dual excitation wavelengths 340 nm and 380 nm,
and a single emission wavelength of 510 nm on an Hitachi
spectrophotometer. A baseline is established for 60 seconds before
adding the test chemokine, or anti-G-protein coupled Receptor
(CCR5) antibody. Twenty microliters of the test chemokine (100
times the final concentration) is then added to the cuvette and
changes in intracellular calcium concentration are monitored using
the spectrophotometer. This assay can be used, for example, if an
anti-G-protein coupled Receptor (CCR5) antibody is agonistic
(induces calcium mobilization) or antagonistic (fails to induce
calcium mobilization).
Example 64
Diabetic Mouse and Glucocorticoid-Impaired Wound Healing Models
[1296] Diabetic db+/db+ Mouse Model.
[1297] To demonstrate that G-protein Chemokine Receptor (CCR5)
accelerates the healing process, the genetically diabetic mouse
model of wound healing is used. The full thickness wound healing
model in the db+/db+ mouse is a well characterized, clinically
relevant and reproducible model of impaired wound healing. Healing
of the diabetic wound is dependent on formation of granulation
tissue and re-epithelialization rather than contraction (Gartner,
M. H. et al., J. Surg. Res. 52:389 (1992); Greenhalgh, D. G. et
al., Am. J. Pathol. 136:1235 (1990)).
[1298] The diabetic animals have many of the characteristic
features observed in Type II diabetes mellitus. Homozygous
(db+/db+) mice are obese in comparison to their normal heterozygous
(db+/+m) littermates. Mutant diabetic (db+/db+) mice have a single
autosomal recessive mutation on chromosome 4 (db+) (Coleman et al.
Proc. Natl. Acad. Sci. USA 77:283-293 (1982)). Animals show
polyphagia, polydipsia and polyuria. Mutant diabetic mice (db+/db+)
have elevated blood glucose, increased or normal insulin levels,
and suppressed cell-mediated immunity (Mandel et al., J. Immunol.
120:1375 (1978); Debray-Sachs, M. et al., Clin. Exp. Immunol.
51(1):1-7 (1983); Leiter et al., Am. J. of Pathol. 114:46-55
(1985)). Peripheral neuropathy, myocardial complications, and
microvascular lesions, basement membrane thickening and glomerular
filtration abnormalities have been described in these animals
(Norido, F. et al., Exp. Neurol. 83(2):221-232 (1984); Robertson et
al., Diabetes 29(1):60-67 (1980); Giacomelli et al., Lab Invest.
40(4):460-473 (1979); Coleman, D. L., Diabetes 31 (Suppl):1-6
(1982)). These homozygous diabetic mice develop hyperglycemia that
is resistant to insulin analogous to human type II diabetes (Mandel
et al., J. Immunol. 120:1375-1377 (1978)).
[1299] The characteristics observed in these animals suggests that
healing in this model may be similar to the healing observed in
human diabetes (Greenhalgh, et al., Am. J. of Pathol. 136:1235-1246
(1990)).
[1300] Genetically diabetic female C57BL/KsJ (db+/db+) mice and
their non-diabetic (db+/+m) heterozygous littermates are used in
this study (Jackson Laboratories). The animals are purchased at 6
weeks of age and are 8 weeks old at the beginning of the study.
Animals are individually housed and received food and water ad
libitum. All manipulations are performed using aseptic techniques.
The experiments are conducted according to the rules and guidelines
of Human Genome Sciences, Inc. Institutional Animal Care and Use
Committee and the Guidelines for the Care and Use of Laboratory
Animals.
[1301] Wounding protocol is performed according to previously
reported methods (Tsuboi, R. and Rifkin, D. B., J. Exp. Med.
172:245-251 (1990)). Briefly, on the day of wounding, animals are
anesthetized with an intraperitoneal injection of Avertin (0.01
mg/mL), 2,2,2-tribromoethanol and 2-methyl-2-butanol dissolved in
deionized water. The dorsal region of the animal is shaved and the
skin washed with 70% ethanol solution and iodine. The surgical area
is dried with sterile gauze prior to wounding. An 8 mm
full-thickness wound is then created using a Keyes tissue punch.
Immediately following wounding, the surrounding skin is gently
stretched to eliminate wound expansion. The wounds are left open
for the duration of the experiment. Application of the treatment is
given topically for 5 consecutive days commencing on the day of
wounding. Prior to treatment, wounds are gently cleansed with
sterile saline and gauze sponges.
[1302] Wounds are visually examined and photographed at a fixed
distance at the day of surgery and at two day intervals thereafter.
Wound closure is determined by daily measurement on days 1-5 and on
day 8. Wounds are measured horizontally and vertically using a
calibrated Jameson caliper. Wounds are considered healed if
granulation tissue is no longer visible and the wound is covered by
a continuous epithelium.
[1303] G-protein Chemokine Receptor (CCR5) is administered using at
a range different doses of G-protein Chemokine Receptor (CCR5),
from 4 mg to 500 mg per wound per day for 8 days in vehicle.
Vehicle control groups received 50 mL of vehicle solution.
[1304] Animals are euthanized on day 8 with an intraperitoneal
injection of sodium pentobarbital (300 mg/kg). The wounds and
surrounding skin are then harvested for histology and
immunohistochemistry. Tissue specimens are placed in 10% neutral
buffered formalin in tissue cassettes between biopsy sponges for
further processing.
[1305] Three groups of 10 animals each (5 diabetic and 5
non-diabetic controls) are evaluated: 1) Vehicle placebo control,
2) untreated; and 3) treated group.
[1306] Wound closure is analyzed by measuring the area in the
vertical and horizontal axis and obtaining the total square area of
the wound. Contraction is then estimated by establishing the
differences between the initial wound area (day 0) and that of post
treatment (day 8). The wound area on day 1 is 64 mm.sup.2, the
corresponding size of the dermal punch. Calculations are made using
the following formula:
[Open area on day 8]-[Open area on day 1]/[Open area on day 1]
[1307] Specimens are fixed in 10% buffered formalin and paraffin
embedded blocks are sectioned perpendicular to the wound surface (5
mm) and cut using a Reichert-Jung microtome. Routine
hematoxylin-eosin (H&E) staining is performed on cross-sections
of bisected wounds. Histologic examination of the wounds are used
to assess whether the healing process and the morphologic
appearance of the repaired skin is altered by treatment with
G-protein Chemokine Receptor. This assessment included verification
of the presence of cell accumulation, inflammatory cells,
capillaries, fibroblasts, re-epithelialization and epidermal
maturity (Greenhalgh, D. G. et al., Am. J. Pathol. 136:1235
(1990)). A calibrated lens micrometer is used by a blinded
observer.
[1308] Tissue sections are also stained immunohistochemically with
a polyclonal rabbit anti-human keratin antibody using ABC Elite
detection system. Human skin is used as a positive tissue control
while non-immune IgG is used as a negative control. Keratinocyte
growth is determined by evaluating the extent of
reepithelialization of the wound using a calibrated lens
micrometer.
[1309] Proliferating cell nuclear antigen/cyclin (PCNA) in skin
specimens is demonstrated by using anti-PCNA antibody (1:50) with
an ABC Elite detection system. Human colon cancer can serve as a
positive tissue control and human brain tissue can be used as a
negative tissue control. Each specimen includes a section with
omission of the primary antibody and substitution with non-immune
mouse IgG. Ranking of these sections is based on the extent of
proliferation on a scale of 0-8, the lower side of the scale
reflecting slight proliferation to the higher side reflecting
intense proliferation.
[1310] Experimental data are analyzed using an unpaired t test. A p
value of <0.05 is considered significant.
Steroid Impaired Rat Model
[1311] The inhibition of wound healing by steroids has been well
documented in various in vitro and in vivo systems (Wahl, S. M.
Glucocorticoids and Wound healing. In: Anti-Inflammatory Steroid
Action: Basic and Clinical Aspects. 280-302 (1989); Wahl, S. M. et
al., J. Immunol. 115: 476-481 (1975); Werb, Z. et al., J. Exp. Med.
147:1684-1694 (1978)). Glucocorticoids retard wound healing by
inhibiting angiogenesis, decreasing vascular permeability (Ebert,
R. H., et al., An. Intern. Med. 37:701-705 (1952)), fibroblast
proliferation, and collagen synthesis (Beck, L. S. et al., Growth
Factors. 5: 295-304 (1991); Haynes, B. F. et al., J. Clin. Invest.
61: 703-797 (1978)) and producing a transient reduction of
circulating monocytes (Haynes, B. F., et al., J. Clin. Invest. 61:
703-797 (1978); Wahl, S. M., "Glucocorticoids and wound healing",
In: Antiinflammatory Steroid Action: Basic and Clinical Aspects,
Academic Press, New York, pp. 280-302 (1989)). The systemic
administration of steroids to impaired wound healing is a well
establish phenomenon in rats (Beck, L. S. et al., Growth Factors.
5: 295-304 (1991); Haynes, B. F., et al., J. Clin. Invest. 61:
703-797 (1978); Wahl, S. M., "Glucocorticoids and wound healing",
In: Antiinflammatory Steroid Action: Basic and Clinical Aspects,
Academic Press, New York, pp. 280-302 (1989); Pierce, G. F. et al.,
Proc. Natl. Acad. Sci. USA 86: 2229-2233 (1989)).
[1312] To demonstrate that G-protein Chemokine Receptor (CCR5 can
accelerate the healing process, the effects of multiple topical
applications of G-protein Chemokine Receptor (CCR5) on full
thickness excisional skin wounds in rats in which healing has been
impaired by the systemic administration of methylprednisolone is
assessed.
[1313] Young adult male Sprague Dawley rats weighing 250-300 g
(Charles River Laboratories) are used in this example. The animals
are purchased at 8 weeks of age and are 9 weeks old at the
beginning of the study. The healing response of rats is impaired by
the systemic administration of methylprednisolone (17 mg/kg/rat
intramuscularly) at the time of wounding. Animals are individually
housed and received food and water ad libitum. All manipulations
are performed using aseptic techniques. This study is conducted
according to the rules and guidelines of Human Genome Sciences,
Inc. Institutional Animal Care and Use Committee and the Guidelines
for the Care and Use of Laboratory Animals.
[1314] The wounding protocol is followed according to section A,
above. On the day of wounding, animals are anesthetized with an
intramuscular injection of ketamine (50 mg/kg) and xylazine (5
mg/kg). The dorsal region of the animal is shaved and the skin
washed with 70% ethanol and iodine solutions. The surgical area is
dried with sterile gauze prior to wounding. An 8 mm full-thickness
wound is created using a Keyes tissue punch. The wounds are left
open for the duration of the experiment. Applications of the
testing materials are given topically once a day for 7 consecutive
days commencing on the day of wounding and subsequent to
methylprednisolone administration. Prior to treatment, wounds are
gently cleansed with sterile saline and gauze sponges.
[1315] Wounds are visually examined and photographed at a fixed
distance at the day of wounding and at the end of treatment. Wound
closure is determined by daily measurement on days 1-5 and on day
8. Wounds are measured horizontally and vertically using a
calibrated Jameson caliper. Wounds are considered healed if
granulation tissue is no longer visible and the wound is covered by
a continuous epithelium.
[1316] G-protein Chemokine Receptor (CCR5) is administered using at
a range different doses of G-protein Chemokine Receptor (CCR5),
from 4 mg to 500 mg per wound per day for 8 days in vehicle.
Vehicle control groups received 50 mL of vehicle solution.
[1317] Animals are euthanized on day 8 with an intraperitoneal
injection of sodium pentobarbital (300 mg/kg). The wounds and
surrounding skin are then harvested for histology. Tissue specimens
are placed in 10% neutral buffered formalin in tissue cassettes
between biopsy sponges for further processing.
[1318] Four groups of 10 animals each (5 with methylprednisolone
and 5 without glucocorticoid) are evaluated: 1) Untreated group 2)
Vehicle placebo control 3) G-protein Chemokine Receptor (CCR5)
treated groups.
[1319] Wound closure is analyzed by measuring the area in the
vertical and horizontal axis and obtaining the total area of the
wound. Closure is then estimated by establishing the differences
between the initial wound area (day 0) and that of post treatment
(day 8). The wound area on day 1 is 64 mm.sup.2, the corresponding
size of the dermal punch. Calculations are made using the following
formula:
[Open area on day 8]-[Open area on day 1]/[Open area on day 1]
[1320] Specimens are fixed in 10% buffered formalin and paraffin
embedded blocks are sectioned perpendicular to the wound surface (5
mm) and cut using an Olympus microtome. Routine hematoxylin-eosin
(H&E) staining is performed on cross-sections of bisected
wounds. Histologic examination of the wounds allows assessment of
whether the healing process and the morphologic appearance of the
repaired skin is improved by treatment with G-protein Chemokine
Receptor. A calibrated lens micrometer is used by a blinded
observer to determine the distance of the wound gap.
[1321] Experimental data are analyzed using an unpaired t test. A p
value of <0.05 is considered significant.
[1322] The studies described in this example test activity of
G-protein Chemokine Receptor (CCR5) protein. However, one skilled
in the art could easily modify the exemplified studies to test the
activity of G-protein Chemokine Receptor (CCR5) polynucleotides
(e.g., gene therapy), agonists (including ligands), and/or
antagonists of G-protein Chemokine Receptor.
Example 65
Evaluation of G-Protein Chemokine Receptor (CCR5) in a Diabetic
Mouse Model
[1323] The diabetic mouse model used in Example 64 may also be used
to determine whether G-protein Chemokine Receptor (CCR5) is
efficacious in preventing, treating and/or ameliorating the
diabetic condition per se. G-protein Chemokine Receptor (CCR5) is
administered to db+/db+ mice parenterally for various periods of
time either before or after the mice have developed diabetes, and
blood glucose, and/or insulin levels, or other art-known methods
for measuring disease severity, are measured to determine whether
administration prevents, slows, or lessens the onset or severity of
diabetes.
[1324] This example tests activity of G-protein Chemokine Receptor
(CCR5) protein. However, one skilled in the art could easily modify
the exemplified studies to test the activity of G-protein Chemokine
Receptor (CCR5) polynucleotides (e.g., gene therapy), agonists
(including ligands), and/or antagonists of G-protein Chemokine
Receptor.
Example 66
Evaluation of G-Protein Chemokine Receptor (CCR5) in a Model of
Inflammatory Bowel Disease & Colitis
[1325] The purpose of this study is to determine whether G-protein
Chemokine Receptor (CCR5) is efficacious in a model of murine
colitis induced by ad libitum exposure to dextran sodium sulfate in
the drinking water.
[1326] Six to eight week old female Swiss Webster mice (20-25 g,
Charles River, Raleigh, N.C.)) are used in a model of inflammatory
bowel disease induced with a 4% solution of sodium sulfate (DSS,
36,000-44,000 MW, American International Chemistry, Natick, Mass.))
administered ad libitum for one week. Agonists, antagonists,
preferably antibodies of the present invention, of G-protein
Chemokine Receptor (CCR5) is given by daily parenteral
administration (n=10). Three parameters are used to determine
efficacy: 1) clinical score, based on evaluation of the stool; 2)
histological score, based on evaluation of the colon; and 3) weight
change. The clinical score are comprised of two parts totaling a
maximum of score of four. Stool consistency is graded as: 0=firm;
1=loose; 2 diarrhea. Blood in the stool is also evaluated on a 0 to
2 scale with 0=no blood; 1=occult blood; and 2=gross rectal
bleeding. A mean group score above 3 indicates probable lethality,
and disease which has progressed beyond its treatable stage.
Clinical scores are taken on Day 0, 4, 5, 6, and 7. To arrive at a
histological score, slides of the ascending, transverse and
descending colon are evaluated in a blinded fashion based on
inflammation score (0-3) and crypt score (0-4). Body weight is
measured daily. Data is expressed as mean.+-.SEM. An unpaired
Student's t test is used to determine significant differences
compared to the disease control (* p<0.05; ** p<0.01; ***
p<0.001).
[1327] Results from this study may suggest G-protein Chemokine
Receptor (CCR5) role in IBD and colitis, including ulcerative
colitis. Thus, agonists, antagonists, including antibodies of the
present invention, and fragments of G-protein Chemokine Receptor
(CCR5) may be used to treat, prevent, or ameliorate patients having
IBD, colitis, and/or ulcerative colitis, or any other inflammation
of the intestine.
[1328] It will be clear that the invention may be practiced
otherwise than as particularly described in the foregoing
description and examples. Numerous modifications and variations of
the present invention are possible in light of the above teachings
and, therefore, are within the scope of the appended claims.
[1329] The entire disclosure of each document cited (including
patents, patent applications, journal articles, abstracts,
laboratory manuals, books, or other disclosures) in the Background
of the Invention, Detailed Description, and Examples is hereby
incorporated herein by reference. The disclosure of U.S.
application Ser. No. 09/195,662, filed Nov. 18, 1998, is herein
incorporated by reference. The disclosure of U.S. Provisional
Application Nos. 60/181,258 filed Feb. 9, 2000; 60/187,999 filed
Mar. 9, 2000; and 60/234,336 filed Sep. 22, 2000 are herein
incorporated by reference. The disclosure of International
Publication WO 98/54317 is herein incorporated by reference.
Additionally, the sequence listing of U.S. Pat. No. 5,707,815 is
herein incorporated by reference.
Sequence CWU 1
1
7011414DNAHomo sapiensCDS(259)..(1314) 1gtgagatggt gctttcatga
attcccccaa caagagccaa gctctccatc tagtggacag 60ggaagctagc agcaaacctt
cccttcacta cgaaacttca ttgcttggcc caaaagagag 120ttaattcaat
gtagacatct atgtaggcaa ttaaaaacct attgatgtat aaaacagttt
180gcattcatgg agggcaacta aatacattct aggactttat aaaagatcac
tttttattta 240tgcacagggt ggaacaag atg gat tat caa gtg tca agt cca
atc tat gac 291 Met Asp Tyr Gln Val Ser Ser Pro Ile Tyr Asp 1 5
10atc aat tat tat aca tcg gag ccc tgc cca aaa atc aat gtg aag caa
339Ile Asn Tyr Tyr Thr Ser Glu Pro Cys Pro Lys Ile Asn Val Lys Gln
15 20 25atc gca gcc cgc ctc ctg cct ccg ctc tac tca ctg gtg ttc atc
ttt 387Ile Ala Ala Arg Leu Leu Pro Pro Leu Tyr Ser Leu Val Phe Ile
Phe 30 35 40ggt ttt gtg ggc aac atg ctg gtc atc ctc atc ctg ata aac
tgc caa 435Gly Phe Val Gly Asn Met Leu Val Ile Leu Ile Leu Ile Asn
Cys Gln 45 50 55agg ctg gag agc atg act gac atc tac ctg ctc aac ctg
gcc atc tct 483Arg Leu Glu Ser Met Thr Asp Ile Tyr Leu Leu Asn Leu
Ala Ile Ser60 65 70 75gac ctg ttt ttc ctt ctt act gtc ccc ttc tgg
gct cac tat gct gcc 531Asp Leu Phe Phe Leu Leu Thr Val Pro Phe Trp
Ala His Tyr Ala Ala 80 85 90gcc cag tgg gac ttt gga aat aca atg tgt
caa ctc ttg aca ggg ctc 579Ala Gln Trp Asp Phe Gly Asn Thr Met Cys
Gln Leu Leu Thr Gly Leu 95 100 105tat ttt ata ggc ttc ttc tct gga
atc ttc ttc atc atc ctc ctg aca 627Tyr Phe Ile Gly Phe Phe Ser Gly
Ile Phe Phe Ile Ile Leu Leu Thr 110 115 120atc gat agg tac ctg gct
atc gtc cat gct gtg ttt gct tta aaa gcc 675Ile Asp Arg Tyr Leu Ala
Ile Val His Ala Val Phe Ala Leu Lys Ala 125 130 135agg acg gtc acc
ttt ggg gtg gtg aca agt gtg atc act tgg gtg gtg 723Arg Thr Val Thr
Phe Gly Val Val Thr Ser Val Ile Thr Trp Val Val140 145 150 155gct
gtg ttt gcg tct ctc cca gga atc atc ttt acc aga tct caa aaa 771Ala
Val Phe Ala Ser Leu Pro Gly Ile Ile Phe Thr Arg Ser Gln Lys 160 165
170gaa ggt ctt cat tac acc tgc agc tct cat ttt cca tac agt cag tat
819Glu Gly Leu His Tyr Thr Cys Ser Ser His Phe Pro Tyr Ser Gln Tyr
175 180 185caa ttc tgg aag aat ttc cag aca tta aag ata gtc atc ttg
ggg ctg 867Gln Phe Trp Lys Asn Phe Gln Thr Leu Lys Ile Val Ile Leu
Gly Leu 190 195 200gtc ctg ccg ctg ctt gtc atg gtc atc tgc tac tcg
gga atc cta aaa 915Val Leu Pro Leu Leu Val Met Val Ile Cys Tyr Ser
Gly Ile Leu Lys 205 210 215act ctg ctt cgg tgt cga aat gag aag aag
agg cac agg gct gtg agg 963Thr Leu Leu Arg Cys Arg Asn Glu Lys Lys
Arg His Arg Ala Val Arg220 225 230 235ctt atc ttc acc atc atg att
gtt tat ttt ctc ttc tgg gct ccc tac 1011Leu Ile Phe Thr Ile Met Ile
Val Tyr Phe Leu Phe Trp Ala Pro Tyr 240 245 250aac att gtc ctt ctc
ctg aac acc ttc cag gaa ttc ttt ggc ctg aat 1059Asn Ile Val Leu Leu
Leu Asn Thr Phe Gln Glu Phe Phe Gly Leu Asn 255 260 265aat tgc agt
agc tct aac agg ttg gac caa gct atg cag gtg aca gag 1107Asn Cys Ser
Ser Ser Asn Arg Leu Asp Gln Ala Met Gln Val Thr Glu 270 275 280act
ctt ggg atg acg cac tgc tgc atc aac ccc atc atc tat gcc ttt 1155Thr
Leu Gly Met Thr His Cys Cys Ile Asn Pro Ile Ile Tyr Ala Phe 285 290
295gtc ggg gag aag ttc aga aac tac ctc tta gtc ttc ttc caa aag cac
1203Val Gly Glu Lys Phe Arg Asn Tyr Leu Leu Val Phe Phe Gln Lys
His300 305 310 315att gcc aaa cgc ttc tgc aaa tgc tgt tct att ttc
cag caa gag gct 1251Ile Ala Lys Arg Phe Cys Lys Cys Cys Ser Ile Phe
Gln Gln Glu Ala 320 325 330ccc gag cga gca agc tca gtt tac acc cga
tcc act ggg gag cag gaa 1299Pro Glu Arg Ala Ser Ser Val Tyr Thr Arg
Ser Thr Gly Glu Gln Glu 335 340 345ata tct gtg ggc ttg tgacacggac
tcaagtgggc tggtgaccca gtcagagttg 1354Ile Ser Val Gly Leu
350tgcacatggc ttagttttca tacacagcct gggctggggg tggggtggaa
gaggtctttt 14142352PRTHomo sapiens 2Met Asp Tyr Gln Val Ser Ser Pro
Ile Tyr Asp Ile Asn Tyr Tyr Thr1 5 10 15Ser Glu Pro Cys Pro Lys Ile
Asn Val Lys Gln Ile Ala Ala Arg Leu 20 25 30Leu Pro Pro Leu Tyr Ser
Leu Val Phe Ile Phe Gly Phe Val Gly Asn 35 40 45Met Leu Val Ile Leu
Ile Leu Ile Asn Cys Gln Arg Leu Glu Ser Met 50 55 60Thr Asp Ile Tyr
Leu Leu Asn Leu Ala Ile Ser Asp Leu Phe Phe Leu65 70 75 80Leu Thr
Val Pro Phe Trp Ala His Tyr Ala Ala Ala Gln Trp Asp Phe 85 90 95Gly
Asn Thr Met Cys Gln Leu Leu Thr Gly Leu Tyr Phe Ile Gly Phe 100 105
110Phe Ser Gly Ile Phe Phe Ile Ile Leu Leu Thr Ile Asp Arg Tyr Leu
115 120 125Ala Ile Val His Ala Val Phe Ala Leu Lys Ala Arg Thr Val
Thr Phe 130 135 140Gly Val Val Thr Ser Val Ile Thr Trp Val Val Ala
Val Phe Ala Ser145 150 155 160Leu Pro Gly Ile Ile Phe Thr Arg Ser
Gln Lys Glu Gly Leu His Tyr 165 170 175Thr Cys Ser Ser His Phe Pro
Tyr Ser Gln Tyr Gln Phe Trp Lys Asn 180 185 190Phe Gln Thr Leu Lys
Ile Val Ile Leu Gly Leu Val Leu Pro Leu Leu 195 200 205Val Met Val
Ile Cys Tyr Ser Gly Ile Leu Lys Thr Leu Leu Arg Cys 210 215 220Arg
Asn Glu Lys Lys Arg His Arg Ala Val Arg Leu Ile Phe Thr Ile225 230
235 240Met Ile Val Tyr Phe Leu Phe Trp Ala Pro Tyr Asn Ile Val Leu
Leu 245 250 255Leu Asn Thr Phe Gln Glu Phe Phe Gly Leu Asn Asn Cys
Ser Ser Ser 260 265 270Asn Arg Leu Asp Gln Ala Met Gln Val Thr Glu
Thr Leu Gly Met Thr 275 280 285His Cys Cys Ile Asn Pro Ile Ile Tyr
Ala Phe Val Gly Glu Lys Phe 290 295 300Arg Asn Tyr Leu Leu Val Phe
Phe Gln Lys His Ile Ala Lys Arg Phe305 310 315 320Cys Lys Cys Cys
Ser Ile Phe Gln Gln Glu Ala Pro Glu Arg Ala Ser 325 330 335Ser Val
Tyr Thr Arg Ser Thr Gly Glu Gln Glu Ile Ser Val Gly Leu 340 345
350330DNAArtificial Sequence5' Oligonucleotide primer for HDGNR10
3cggaattcct ccatggatta tcaagtgtca 30429DNAArtificial Sequence3'
Oligonucleotide primer for HDGNR10 4cggaagcttc gtcacaagcc cacagatat
29534DNAArtificial Sequence5' Oligonucleotide primer for HDGNR10
5gtccaagctt gccaccatgg attatcaagt gtca 34661DNAArtificial
Sequence3' Oligonucleotide primer for HDGNR10 6ctagctcgag
tcaagcgtag tctgggacgt cgtatgggta gcacaagccc acagatattt 60c
61730DNAArtificial Sequence5' Oligonucleotide primer for HDGNR10
7cgggatccct ccatggatta tcaagtgtca 30829DNAArtificial Sequence3'
Oligonucleotide primer for HDGNR10 8cgggatcccg ctcacaagcc cacagatat
299344PRTHomo sapiens 9Glu Glu Val Thr Thr Phe Phe Asp Tyr Asp Tyr
Gly Ala Pro Cys His1 5 10 15Lys Phe Asp Val Lys Gln Ile Gly Ala Gln
Leu Leu Pro Pro Leu Tyr 20 25 30Ser Leu Val Phe Ile Phe Gly Phe Val
Gly Asn Met Leu Val Val Leu 35 40 45Ile Leu Ile Asn Cys Lys Lys Leu
Lys Cys Leu Thr Asp Ile Tyr Leu 50 55 60Leu Asn Leu Ala Ile Ser Asp
Leu Leu Phe Leu Ile Thr Leu Pro Leu65 70 75 80Trp Ala His Ser Ala
Ala Asn Glu Trp Val Phe Gly Asn Ala Met Cys 85 90 95Lys Leu Phe Thr
Gly Leu Tyr His Ile Gly Tyr Phe Gly Gly Ile Phe 100 105 110Phe Ile
Ile Leu Leu Thr Ile Asp Arg Tyr Leu Ala Ile Val His Ala 115 120
125Val Phe Ala Leu Lys Ala Arg Thr Val Thr Phe Gly Val Val Thr Ser
130 135 140Val Ile Thr Trp Leu Val Ala Val Phe Ala Ser Val Pro Gly
Ile Ile145 150 155 160Phe Thr Lys Cys Gln Lys Glu Asp Ser Val Tyr
Val Cys Gly Pro Tyr 165 170 175Phe Pro Arg Gly Trp Asn Asn Phe His
Thr Ile Met Arg Asn Ile Leu 180 185 190Gly Leu Val Leu Pro Leu Leu
Ile Met Val Ile Cys Tyr Ser Gly Ile 195 200 205Leu Lys Thr Leu Leu
Arg Cys Arg Asn Glu Lys Lys Arg His Arg Ala 210 215 220Val Arg Val
Ile Phe Thr Ile Met Ile Val Tyr Phe Leu Phe Trp Thr225 230 235
240Pro Tyr Asn Ile Val Ile Leu Leu Asn Thr Phe Gln Glu Phe Phe Gly
245 250 255Leu Ser Asn Cys Glu Ser Thr Ser Gln Leu Asp Gln Ala Thr
Gln Val 260 265 270Thr Glu Thr Leu Gly Met Thr His Cys Cys Ile Asn
Pro Ile Ile Tyr 275 280 285Ala Phe Val Gly Glu Lys Phe Arg Ser Leu
Phe His Ile Ala Leu Gly 290 295 300Cys Arg Ile Ala Pro Leu Gln Lys
Pro Val Cys Gly Gly Pro Gly Val305 310 315 320Arg Pro Gly Lys Asn
Val Lys Val Thr Thr Gln Gly Leu Leu Asp Gly 325 330 335Arg Gly Lys
Gly Lys Ser Ile Gly 34010733DNAHomo sapiens 10gggatccgga gcccaaatct
tctgacaaaa ctcacacatg cccaccgtgc ccagcacctg 60aattcgaggg tgcaccgtca
gtcttcctct tccccccaaa acccaaggac accctcatga 120tctcccggac
tcctgaggtc acatgcgtgg tggtggacgt aagccacgaa gaccctgagg
180tcaagttcaa ctggtacgtg gacggcgtgg aggtgcataa tgccaagaca
aagccgcggg 240aggagcagta caacagcacg taccgtgtgg tcagcgtcct
caccgtcctg caccaggact 300ggctgaatgg caaggagtac aagtgcaagg
tctccaacaa agccctccca acccccatcg 360agaaaaccat ctccaaagcc
aaagggcagc cccgagaacc acaggtgtac accctgcccc 420catcccggga
tgagctgacc aagaaccagg tcagcctgac ctgcctggtc aaaggcttct
480atccaagcga catcgccgtg gagtgggaga gcaatgggca gccggagaac
aactacaaga 540ccacgcctcc cgtgctggac tccgacggct ccttcttcct
ctacagcaag ctcaccgtgg 600acaagagcag gtggcagcag gggaacgtct
tctcatgctc cgtgatgcat gaggctctgc 660acaaccacta cacgcagaag
agcctctccc tgtctccggg taaatgagtg cgacggccgc 720gactctagag gat
733115PRTMembrane proximal region motifVariant(3)May be any amino
acid 11Trp Ser Xaa Trp Ser1 51286DNAArtificial Sequence5' Primer
for Gamma Activation Site-SV40 Early Promoter Construct
12gcgcctcgag atttccccga aatctagatt tccccgaaat gatttccccg aaatgatttc
60cccgaaatat ctgccatctc aattag 861327DNAArtificial Sequence3'
Oligonucleotide primer for SV40 Early Promoter 13gcggcaagct
ttttgcaaag cctaggc 2714271DNAArtificial SequenceGamma Activation
Site-SV40 Early Promoter Construct 14ctcgagattt ccccgaaatc
tagatttccc cgaaatgatt tccccgaaat gatttccccg 60aaatatctgc catctcaatt
agtcagcaac catagtcccg cccctaactc cgcccatccc 120gcccctaact
ccgcccagtt ccgcccattc tccgccccat ggctgactaa ttttttttat
180ttatgcagag gccgaggccg cctcggcctc tgagctattc cagaagtagt
gaggaggctt 240ttttggaggc ctaggctttt gcaaaaagct t
2711532DNAArtificial Sequence5' Oligonucleotide primer for EGR-1
Promoter Sequence 15gcgctcgagg gatgacagcg atagaacccc gg
321631DNAArtificial Sequence3' Oligonucleotide primer for EGR-1
Promoter Sequence 16gcgaagcttc gcgactcccc ggatccgcct c
311712DNAHomo Sapiens 17ggggactttc cc 121873DNAArtificial
Sequence5' Oligonucleotide primer for NF-KB-SV40 Early Promoter
Construct 18gcggcctcga ggggactttc ccggggactt tccggggact ttccgggact
ttccatcctg 60ccatctcaat tag 731927DNAArtificial Sequence3'
Oligonucleotide primer for SV40 Early Promoter 19gcggcaagct
ttttgcaaag cctaggc 2720256DNAArtificial SequenceNF-KB-SV40 Early
Promoter Construct 20ctcgagggga ctttcccggg gactttccgg ggactttccg
ggactttcca tctgccatct 60caattagtca gcaaccatag tcccgcccct aactccgccc
atcccgcccc taactccgcc 120cagttccgcc cattctccgc cccatggctg
actaattttt tttatttatg cagaggccga 180ggccgcctcg gcctctgagc
tattccagaa gtagtgagga ggcttttttg gaggcctagg 240cttttgcaaa aagctt
256211056DNAHomo sapiensCDS(1)..(1056) 21atg gat tat caa gtg tca
agt cca atc tat gac atc aat tat tat aca 48Met Asp Tyr Gln Val Ser
Ser Pro Ile Tyr Asp Ile Asn Tyr Tyr Thr1 5 10 15tcg gag ccc tgc caa
aaa atc aat gtg aag caa atc gca gcc cgc ctc 96Ser Glu Pro Cys Gln
Lys Ile Asn Val Lys Gln Ile Ala Ala Arg Leu 20 25 30ctg cct ccg ctc
tac tca ctg gtg ttc atc ttt ggt ttt gtg ggc aac 144Leu Pro Pro Leu
Tyr Ser Leu Val Phe Ile Phe Gly Phe Val Gly Asn 35 40 45atg ctg gtc
atc ctc atc ctg ata aac tgc aaa agg ctg aag agc atg 192Met Leu Val
Ile Leu Ile Leu Ile Asn Cys Lys Arg Leu Lys Ser Met 50 55 60act gac
atc tac ctg ctc aac ctg gcc atc tct gac ctg ttt ttc ctt 240Thr Asp
Ile Tyr Leu Leu Asn Leu Ala Ile Ser Asp Leu Phe Phe Leu65 70 75
80ctt act gtc ccc ttc tgg gct cac tat gct gcc gcc cag tgg gac ttt
288Leu Thr Val Pro Phe Trp Ala His Tyr Ala Ala Ala Gln Trp Asp Phe
85 90 95gga aat aca atg tgt caa ctc ttg aca ggg ctc tat ttt ata ggc
ttc 336Gly Asn Thr Met Cys Gln Leu Leu Thr Gly Leu Tyr Phe Ile Gly
Phe 100 105 110ttc tct gga atc ttc ttc atc atc ctc ctg aca atc gat
agg tac ctg 384Phe Ser Gly Ile Phe Phe Ile Ile Leu Leu Thr Ile Asp
Arg Tyr Leu 115 120 125gct gtc gtc cat gct gtg ttt gct tta aaa gcc
agg acg gtc acc ttt 432Ala Val Val His Ala Val Phe Ala Leu Lys Ala
Arg Thr Val Thr Phe 130 135 140ggg gtg gtg aca agt gtg atc act tgg
gtg gtg gct gtg ttt gcg tct 480Gly Val Val Thr Ser Val Ile Thr Trp
Val Val Ala Val Phe Ala Ser145 150 155 160ctc cca gga atc atc ttt
acc aga tct caa aaa gaa ggt ctt cat tac 528Leu Pro Gly Ile Ile Phe
Thr Arg Ser Gln Lys Glu Gly Leu His Tyr 165 170 175acc tgc agc tct
cat ttt cca tac agt cag tat caa ttc tgg aag aat 576Thr Cys Ser Ser
His Phe Pro Tyr Ser Gln Tyr Gln Phe Trp Lys Asn 180 185 190ttc cag
aca tta aag ata gtc atc ttg ggg ctg gtc ctg ccg ctg ctt 624Phe Gln
Thr Leu Lys Ile Val Ile Leu Gly Leu Val Leu Pro Leu Leu 195 200
205gtc atg gtc atc tgc tac tcg gga atc cta aaa act ctg ctt cgg tgt
672Val Met Val Ile Cys Tyr Ser Gly Ile Leu Lys Thr Leu Leu Arg Cys
210 215 220cga aat gag aag aag agg cac agg gct gtg agg ctt atc ttc
acc atc 720Arg Asn Glu Lys Lys Arg His Arg Ala Val Arg Leu Ile Phe
Thr Ile225 230 235 240atg att gtt tat ttt ctc ttc tgg gct ccc tac
aac att gtc ctt ctc 768Met Ile Val Tyr Phe Leu Phe Trp Ala Pro Tyr
Asn Ile Val Leu Leu 245 250 255ctg aac acc ttc cag gaa ttc ttt ggc
ctg aat aat tgc agt agc tct 816Leu Asn Thr Phe Gln Glu Phe Phe Gly
Leu Asn Asn Cys Ser Ser Ser 260 265 270aac agg ttg gac caa gct atg
cag gtg aca gag act ctt ggg atg acg 864Asn Arg Leu Asp Gln Ala Met
Gln Val Thr Glu Thr Leu Gly Met Thr 275 280 285cac tgc tgc atc aac
ccc atc atc tat gcc ttt gtc ggg gag aag ttc 912His Cys Cys Ile Asn
Pro Ile Ile Tyr Ala Phe Val Gly Glu Lys Phe 290 295 300aga aac tac
ctc tta gtc ttc ttc caa aag cac att gcc aaa cgc ttc 960Arg Asn Tyr
Leu Leu Val Phe Phe Gln Lys His Ile Ala Lys Arg Phe305 310 315
320tgc aaa tgc tgt tct att ttc cag caa gag gct ccc gag cga gca agc
1008Cys Lys Cys Cys Ser Ile Phe Gln Gln Glu Ala Pro Glu Arg Ala Ser
325 330 335tca gtt tac acc cga tcc act gag gag cag gaa ata tct gtg
ggc ttg 1056Ser Val Tyr Thr Arg Ser Thr Glu Glu Gln Glu Ile Ser Val
Gly Leu 340 345 35022352PRTHomo sapiens 22Met Asp Tyr Gln Val
Ser
Ser Pro Ile Tyr Asp Ile Asn Tyr Tyr Thr1 5 10 15Ser Glu Pro Cys Gln
Lys Ile Asn Val Lys Gln Ile Ala Ala Arg Leu 20 25 30Leu Pro Pro Leu
Tyr Ser Leu Val Phe Ile Phe Gly Phe Val Gly Asn 35 40 45Met Leu Val
Ile Leu Ile Leu Ile Asn Cys Lys Arg Leu Lys Ser Met 50 55 60Thr Asp
Ile Tyr Leu Leu Asn Leu Ala Ile Ser Asp Leu Phe Phe Leu65 70 75
80Leu Thr Val Pro Phe Trp Ala His Tyr Ala Ala Ala Gln Trp Asp Phe
85 90 95Gly Asn Thr Met Cys Gln Leu Leu Thr Gly Leu Tyr Phe Ile Gly
Phe 100 105 110Phe Ser Gly Ile Phe Phe Ile Ile Leu Leu Thr Ile Asp
Arg Tyr Leu 115 120 125Ala Val Val His Ala Val Phe Ala Leu Lys Ala
Arg Thr Val Thr Phe 130 135 140Gly Val Val Thr Ser Val Ile Thr Trp
Val Val Ala Val Phe Ala Ser145 150 155 160Leu Pro Gly Ile Ile Phe
Thr Arg Ser Gln Lys Glu Gly Leu His Tyr 165 170 175Thr Cys Ser Ser
His Phe Pro Tyr Ser Gln Tyr Gln Phe Trp Lys Asn 180 185 190Phe Gln
Thr Leu Lys Ile Val Ile Leu Gly Leu Val Leu Pro Leu Leu 195 200
205Val Met Val Ile Cys Tyr Ser Gly Ile Leu Lys Thr Leu Leu Arg Cys
210 215 220Arg Asn Glu Lys Lys Arg His Arg Ala Val Arg Leu Ile Phe
Thr Ile225 230 235 240Met Ile Val Tyr Phe Leu Phe Trp Ala Pro Tyr
Asn Ile Val Leu Leu 245 250 255Leu Asn Thr Phe Gln Glu Phe Phe Gly
Leu Asn Asn Cys Ser Ser Ser 260 265 270Asn Arg Leu Asp Gln Ala Met
Gln Val Thr Glu Thr Leu Gly Met Thr 275 280 285His Cys Cys Ile Asn
Pro Ile Ile Tyr Ala Phe Val Gly Glu Lys Phe 290 295 300Arg Asn Tyr
Leu Leu Val Phe Phe Gln Lys His Ile Ala Lys Arg Phe305 310 315
320Cys Lys Cys Cys Ser Ile Phe Gln Gln Glu Ala Pro Glu Arg Ala Ser
325 330 335Ser Val Tyr Thr Arg Ser Thr Glu Glu Gln Glu Ile Ser Val
Gly Leu 340 345 3502323DNAArtificial Sequence5' Oligonucleotide
primer for VH Domain 23caggtgcagc tggtgcagtc tgg
232423DNAArtificial Sequence5' Oligonucleotide primer for VH Domain
24caggtcaact taagggagtc tgg 232523DNAArtificial Sequence5'
Oligonucleotide primer for VH Domain 25gaggtgcagc tggtggagtc tgg
232623DNAArtificial Sequence5' Oligonucleotide primer for VH Domain
26caggtgcagc tgcaggagtc ggg 232723DNAArtificial Sequence5'
Oligonucleotide primer for VH Domain 27gaggtgcagc tgttgcagtc tgc
232823DNAArtificial Sequence5' Oligonucleotide primer for VH Domain
28caggtacagc tgcagcagtc agg 232924DNAArtificial Sequence5'
Oligonucleotide primer for VH Domain 29tgaggagacg gtgaccaggg tgcc
243024DNAArtificial Sequence5' Oligonucleotide primer for VH Domain
30tgaagagacg gtgaccattg tccc 243124DNAArtificial Sequence5'
Oligonucleotide primer for VH Domain 31tgaggagacg gtgaccaggg ttcc
243224DNAArtificial Sequence5' Oligonucleotide primer for VH Domain
32tgaggagacg gtgaccgtgg tccc 243323DNAArtificial Sequence5'
Oligonucleotide primer for VL Domain 33gacatccaga tgacccagtc tcc
233423DNAArtificial Sequence5' Oligonucleotide primer for VL Domain
34gatgttgtga tgactcagtc tcc 233523DNAArtificial Sequence5'
Oligonucleotide primer for VL Domain 35gatattgtga tgactcagtc tcc
233623DNAArtificial Sequence5' Oligonucleotide primer for VL Domain
36gaaattgtgt tgacgcagtc tcc 233723DNAArtificial Sequence5'
Oligonucleotide primer for VL Domain 37gacatcgtga tgacccagtc tcc
233823DNAArtificial Sequence5' Oligonucleotide primer for VL Domain
38gaaacgacac tcacgcagtc tcc 233923DNAArtificial Sequence5'
Oligonucleotide primer for VL Domain 39gaaattgtgc tgactcagtc tcc
234023DNAArtificial Sequence5' Oligonucleotide primer for VL Domain
40cagtctgtgt tgacgcagcc gcc 234123DNAArtificial Sequence5'
Oligonucleotide primer for VL Domain 41cagtctgccc tgactcagcc tgc
234223DNAArtificial Sequence5' Oligonucleotide primer for VL Domain
42tcctatgtgc tgactcagcc acc 234323DNAArtificial Sequence5'
Oligonucleotide primer for VL Domain 43tcttctgagc tgactcagga ccc
234423DNAArtificial Sequence5' Oligonucleotide primer for VL Domain
44cacgttatac tgactcaacc gcc 234523DNAArtificial Sequence5'
Oligonucleotide primer for VL Domain 45caggctgtgc tcactcagcc gtc
234623DNAArtificial Sequence5' Oligonucleotide primer for VL Domain
46aattttatgc tgactcagcc cca 234724DNAArtificial Sequence3'
Oligonucleotide primer for VL Domain 47acgtttgatt tccaccttgg tccc
244824DNAArtificial Sequence3' Oligonucleotide primer for VL Domain
48acgtttgatc tccagcttgg tccc 244924DNAArtificial Sequence3'
Oligonucleotide primer for VL Domain 49acgtttgata tccactttgg tccc
245024DNAArtificial Sequence3' Oligonucleotide primer for VL Domain
50acgtttgatc tccaccttgg tccc 245124DNAArtificial Sequence3'
Oligonucleotide primer for VL Domain 51acgtttaatc tccagtcgtg tccc
245223DNAArtificial Sequence3' Oligonucleotide primer for VL Domain
52cagtctgtgt tgacgcagcc gcc 235323DNAArtificial Sequence3'
Oligonucleotide primer for VL Domain 53cagtctgccc tgactcagcc tgc
235423DNAArtificial Sequence3' Oligonucleotide primer for VL Domain
54tcctatgtgc tgactcagcc acc 235523DNAArtificial Sequence3'
Oligonucleotide primer for VL Domain 55tcttctgagc tgactcagga ccc
235623DNAArtificial Sequence3' Oligonucleotide primer for VL Domain
56cacgttatac tgactcaacc gcc 235723DNAArtificial Sequence3'
Oligonucleotide primer for VL Domain 57caggctgtgc tcactcagcc gtc
235823DNAArtificial Sequence3' Oligonucleotide primer for VL Domain
58aattttatgc tgactcagcc cca 2359363DNAHomo sapiensCDS(1)..(363)
59cag gtg cag ctg cag gag tcg ggc cca gga ctg gtg aag cct tcg gag
48Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Glu1
5 10 15acc ctg tcc ctc acc tgc act gtc tct ggt ggc tcc atc agt agt
ttc 96Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Gly Ser Ile Ser Ser
Phe 20 25 30tac tgg agc tgg atc cgg cag ccc gcc ggg aag gga ctg gac
tgg att 144Tyr Trp Ser Trp Ile Arg Gln Pro Ala Gly Lys Gly Leu Asp
Trp Ile 35 40 45ggg cgt atc tat acc agc ggg aac acc aac tac aac ccc
tcc ctc aag 192Gly Arg Ile Tyr Thr Ser Gly Asn Thr Asn Tyr Asn Pro
Ser Leu Lys 50 55 60agt cga gtc acc atg tca gta gac acg tcc aag aac
cgg ttc tcc ctg 240Ser Arg Val Thr Met Ser Val Asp Thr Ser Lys Asn
Arg Phe Ser Leu65 70 75 80aaa ctg agc tct gtg acc gcc gcg gac acg
gcc gtg tat tac tgt gcg 288Lys Leu Ser Ser Val Thr Ala Ala Asp Thr
Ala Val Tyr Tyr Cys Ala 85 90 95aga gat cgg ggc agc agc tgg tac ccc
gat gct ttt gat atc tgg ggc 336Arg Asp Arg Gly Ser Ser Trp Tyr Pro
Asp Ala Phe Asp Ile Trp Gly 100 105 110caa ggg aca atg gtc acc gtc
tcc tca 363Gln Gly Thr Met Val Thr Val Ser Ser 115 12060121PRTHomo
sapiens 60Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro
Ser Glu1 5 10 15Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Gly Ser Ile
Ser Ser Phe 20 25 30Tyr Trp Ser Trp Ile Arg Gln Pro Ala Gly Lys Gly
Leu Asp Trp Ile 35 40 45Gly Arg Ile Tyr Thr Ser Gly Asn Thr Asn Tyr
Asn Pro Ser Leu Lys 50 55 60Ser Arg Val Thr Met Ser Val Asp Thr Ser
Lys Asn Arg Phe Ser Leu65 70 75 80Lys Leu Ser Ser Val Thr Ala Ala
Asp Thr Ala Val Tyr Tyr Cys Ala 85 90 95Arg Asp Arg Gly Ser Ser Trp
Tyr Pro Asp Ala Phe Asp Ile Trp Gly 100 105 110Gln Gly Thr Met Val
Thr Val Ser Ser 115 12061327DNAHomo sapiensCDS(1)..(327) 61gat att
gtg ttg acg cat tct cca ggc acc ctg tct ttg tct cca ggg 48Asp Ile
Val Leu Thr His Ser Pro Gly Thr Leu Ser Leu Ser Pro Gly1 5 10 15gaa
aga gcc acc ctc tcc tgc agg gcc agt cag cgt gtt acc agc agc 96Glu
Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Arg Val Thr Ser Ser 20 25
30tgc tta gcc tgg tac cag cag aaa cct ggc cag gct ccc agg ctc ctc
144Cys Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu
35 40 45atc tat ggt aca tcc agc agg gcc act ggc atc cca gac agg ttc
agt 192Ile Tyr Gly Thr Ser Ser Arg Ala Thr Gly Ile Pro Asp Arg Phe
Ser 50 55 60ggc agt ggg tct ggg aca gac ttc act ctc acc atc agc aga
ctg gag 240Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Arg
Leu Glu65 70 75 80cct gaa gat ttt gca gtg tat tac tgt cag cag tat
gtt agc tca cct 288Pro Glu Asp Phe Ala Val Tyr Tyr Cys Gln Gln Tyr
Val Ser Ser Pro 85 90 95ctc acc ttc ggc caa ggg aca cga ctc gag atc
aaa cgt 327Leu Thr Phe Gly Gln Gly Thr Arg Leu Glu Ile Lys Arg 100
10562109PRTHomo sapiens 62Asp Ile Val Leu Thr His Ser Pro Gly Thr
Leu Ser Leu Ser Pro Gly1 5 10 15Glu Arg Ala Thr Leu Ser Cys Arg Ala
Ser Gln Arg Val Thr Ser Ser 20 25 30Cys Leu Ala Trp Tyr Gln Gln Lys
Pro Gly Gln Ala Pro Arg Leu Leu 35 40 45Ile Tyr Gly Thr Ser Ser Arg
Ala Thr Gly Ile Pro Asp Arg Phe Ser 50 55 60Gly Ser Gly Ser Gly Thr
Asp Phe Thr Leu Thr Ile Ser Arg Leu Glu65 70 75 80Pro Glu Asp Phe
Ala Val Tyr Tyr Cys Gln Gln Tyr Val Ser Ser Pro 85 90 95Leu Thr Phe
Gly Gln Gly Thr Arg Leu Glu Ile Lys Arg 100 10563379DNAHomo
sapiensCDS(1)..(378) 63gag gtg cag ctg gtg gag tct ggg gga ggc ttg
gta aag tct ggg ggg 48Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu
Val Lys Ser Gly Gly1 5 10 15tcc ctt aga ctc tcc tgt gca gcc tcc gga
ttc act ttc agt aac gcc 96Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly
Phe Thr Phe Ser Asn Ala 20 25 30tgg atg acc tgg gtc cgc cag gct cca
ggg aag agg ctg gag tgg gtt 144Trp Met Thr Trp Val Arg Gln Ala Pro
Gly Lys Arg Leu Glu Trp Val 35 40 45ggc cgt att aaa agc aat gct gat
ggt ggg tca aca gac tac gct gca 192Gly Arg Ile Lys Ser Asn Ala Asp
Gly Gly Ser Thr Asp Tyr Ala Ala 50 55 60ccc gtg aaa ggc aga ttc acc
atc tca aga gat gat tca aaa aac acg 240Pro Val Lys Gly Arg Phe Thr
Ile Ser Arg Asp Asp Ser Lys Asn Thr65 70 75 80ctg tat ctg caa atg
aac agc ctg aaa acc gag gac aca gcc gtg tat 288Leu Tyr Leu Gln Met
Asn Ser Leu Lys Thr Glu Asp Thr Ala Val Tyr 85 90 95tac tgt aac aca
gat aag ggt ggg agc tac ccc tac tac tac tac ggt 336Tyr Cys Asn Thr
Asp Lys Gly Gly Ser Tyr Pro Tyr Tyr Tyr Tyr Gly 100 105 110atg gac
gtc tgg ggc caa ggg acc acg gtc acc gtc tcc tca g 379Met Asp Val
Trp Gly Gln Gly Thr Thr Val Thr Val Ser Ser 115 120 12564126PRTHomo
sapiens 64Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Lys Ser
Gly Gly1 5 10 15Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe
Ser Asn Ala 20 25 30Trp Met Thr Trp Val Arg Gln Ala Pro Gly Lys Arg
Leu Glu Trp Val 35 40 45Gly Arg Ile Lys Ser Asn Ala Asp Gly Gly Ser
Thr Asp Tyr Ala Ala 50 55 60Pro Val Lys Gly Arg Phe Thr Ile Ser Arg
Asp Asp Ser Lys Asn Thr65 70 75 80Leu Tyr Leu Gln Met Asn Ser Leu
Lys Thr Glu Asp Thr Ala Val Tyr 85 90 95Tyr Cys Asn Thr Asp Lys Gly
Gly Ser Tyr Pro Tyr Tyr Tyr Tyr Gly 100 105 110Met Asp Val Trp Gly
Gln Gly Thr Thr Val Thr Val Ser Ser 115 120 12565324DNAHomo
sapiensCDS(1)..(324) 65gac atc cag atg acc cag tct cca tcc tcc ctg
tct gca tct gta gga 48Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu
Ser Ala Ser Val Gly1 5 10 15gac aga gtc acc atc act tgc cgg gca agt
cag ggc att aga aat gat 96Asp Arg Val Thr Ile Thr Cys Arg Ala Ser
Gln Gly Ile Arg Asn Asp 20 25 30tta ggc tgg tat cag cag aaa cca ggg
aaa gcc cct aag cgc ctg atc 144Leu Gly Trp Tyr Gln Gln Lys Pro Gly
Lys Ala Pro Lys Arg Leu Ile 35 40 45tat gat gca tcc agt ttg caa agt
ggg gtc cca tca agg ttc agc ggc 192Tyr Asp Ala Ser Ser Leu Gln Ser
Gly Val Pro Ser Arg Phe Ser Gly 50 55 60agt gga tct ggg aca gaa ttc
act ctc aca atc agc agc ctg cag cct 240Ser Gly Ser Gly Thr Glu Phe
Thr Leu Thr Ile Ser Ser Leu Gln Pro65 70 75 80gaa gat ttt gca act
tat tac tgt cta cag cat aat agt tac cca ttc 288Glu Asp Phe Ala Thr
Tyr Tyr Cys Leu Gln His Asn Ser Tyr Pro Phe 85 90 95act ttc ggc cct
ggg acc aaa gtg gat atc aaa cga 324Thr Phe Gly Pro Gly Thr Lys Val
Asp Ile Lys Arg 100 10566108PRTHomo sapiens 66Asp Ile Gln Met Thr
Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly1 5 10 15Asp Arg Val Thr
Ile Thr Cys Arg Ala Ser Gln Gly Ile Arg Asn Asp 20 25 30Leu Gly Trp
Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Arg Leu Ile 35 40 45Tyr Asp
Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60Ser
Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro65 70 75
80Glu Asp Phe Ala Thr Tyr Tyr Cys Leu Gln His Asn Ser Tyr Pro Phe
85 90 95Thr Phe Gly Pro Gly Thr Lys Val Asp Ile Lys Arg 100
10567378DNAHomo sapiensCDS(1)..(378) 67gag gtg cag ctg gtg gag tct
ggc cca gga ctg gtg aag cct tcg gag 48Glu Val Gln Leu Val Glu Ser
Gly Pro Gly Leu Val Lys Pro Ser Glu1 5 10 15acc ctg tcc ctc acc tgc
act gtc tct ggt ggc tcc atc agt agt tac 96Thr Leu Ser Leu Thr Cys
Thr Val Ser Gly Gly Ser Ile Ser Ser Tyr 20 25 30tac tgg agc tgg atc
cgg cag ccc cca ggg aag gga ctg gag tgg att 144Tyr Trp Ser Trp Ile
Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp Ile 35 40 45ggg tat atc tat
tac agt ggg agc acc aac tac aac ccc tcc ctc aag 192Gly Tyr Ile Tyr
Tyr Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu Lys 50 55 60agt cga gtc
acc ata tca gta gac acg tcc aag aac cag ttc tcc ctg 240Ser Arg Val
Thr Ile Ser Val Asp Thr Ser Lys Asn Gln Phe Ser Leu65 70 75 80aag
ctg agc tct gtg acc gct gcg gac acg gcc gtg tat tac tgt gcg 288Lys
Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys Ala 85 90
95aga gat gtc atg cag cag ccg gta cgg ggt tac tac tac
tac tac ggt 336Arg Asp Val Met Gln Gln Pro Val Arg Gly Tyr Tyr Tyr
Tyr Tyr Gly 100 105 110atg gac gtc tgg ggc caa gga acc ctg gtc acc
gtc tcc tca 378Met Asp Val Trp Gly Gln Gly Thr Leu Val Thr Val Ser
Ser 115 120 12568126PRTHomo sapiens 68Glu Val Gln Leu Val Glu Ser
Gly Pro Gly Leu Val Lys Pro Ser Glu1 5 10 15Thr Leu Ser Leu Thr Cys
Thr Val Ser Gly Gly Ser Ile Ser Ser Tyr 20 25 30Tyr Trp Ser Trp Ile
Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp Ile 35 40 45Gly Tyr Ile Tyr
Tyr Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu Lys 50 55 60Ser Arg Val
Thr Ile Ser Val Asp Thr Ser Lys Asn Gln Phe Ser Leu65 70 75 80Lys
Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys Ala 85 90
95Arg Asp Val Met Gln Gln Pro Val Arg Gly Tyr Tyr Tyr Tyr Tyr Gly
100 105 110Met Asp Val Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser
115 120 12569327DNAHomo sapiensCDS(1)..(327) 69gaa att gtg ttg acg
cag tct cca ggc acc ctg tct ttg tct cca ggg 48Glu Ile Val Leu Thr
Gln Ser Pro Gly Thr Leu Ser Leu Ser Pro Gly1 5 10 15gaa aga gtc acc
ctc tcc tgc agg gcc agt cag aga gtt agc aac agc 96Glu Arg Val Thr
Leu Ser Cys Arg Ala Ser Gln Arg Val Ser Asn Ser 20 25 30tac tta gcc
tgg tac cag cag aaa cct ggc cag gct ccc agg ttc ctc 144Tyr Leu Ala
Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Phe Leu 35 40 45atc tat
ggt gta tcc agc agg gcc act ggc atc cca gac agg ttc agt 192Ile Tyr
Gly Val Ser Ser Arg Ala Thr Gly Ile Pro Asp Arg Phe Ser 50 55 60ggc
agt ggg tct ggg aca gac ttc act ctc acc atc agc aga ctg gag 240Gly
Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Arg Leu Glu65 70 75
80cct gaa gat ttt gca gtg tat tac tgt cag cag tat ggt agt tca ccg
288Pro Glu Asp Phe Ala Val Tyr Tyr Cys Gln Gln Tyr Gly Ser Ser Pro
85 90 95tgg acg ttc ggc caa ggg acc aag gtg gaa atc aaa cga 327Trp
Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg 100 10570109PRTHomo
sapiens 70Glu Ile Val Leu Thr Gln Ser Pro Gly Thr Leu Ser Leu Ser
Pro Gly1 5 10 15Glu Arg Val Thr Leu Ser Cys Arg Ala Ser Gln Arg Val
Ser Asn Ser 20 25 30Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ala
Pro Arg Phe Leu 35 40 45Ile Tyr Gly Val Ser Ser Arg Ala Thr Gly Ile
Pro Asp Arg Phe Ser 50 55 60Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu
Thr Ile Ser Arg Leu Glu65 70 75 80Pro Glu Asp Phe Ala Val Tyr Tyr
Cys Gln Gln Tyr Gly Ser Ser Pro 85 90 95Trp Thr Phe Gly Gln Gly Thr
Lys Val Glu Ile Lys Arg 100 105
* * * * *
References