U.S. patent application number 12/899372 was filed with the patent office on 2011-03-31 for mitigation of cot-1 dna distortion in nucleic acid hybridization.
This patent application is currently assigned to The Children's Mercy Hospital. Invention is credited to Joan Knoll, Heather Newkirk, Peter K. Rogan.
Application Number | 20110077165 12/899372 |
Document ID | / |
Family ID | 38189141 |
Filed Date | 2011-03-31 |
United States Patent
Application |
20110077165 |
Kind Code |
A1 |
Rogan; Peter K. ; et
al. |
March 31, 2011 |
MITIGATION OF Cot-1 DNA DISTORTION IN NUCLEIC ACID
HYBRIDIZATION
Abstract
A novel method of suppressing non-specific cross-hybridization
between repetitive elements present in nucleic acid probes and
corresponding repetitive elements in the target nucleic acid by
using DNA synthesized to contain a plurality of repetitive elements
while avoiding low and single copy sequences.
Inventors: |
Rogan; Peter K.; (Overland
Park, KS) ; Knoll; Joan; (Overland Park, KS) ;
Newkirk; Heather; (Lenexa, KS) |
Assignee: |
The Children's Mercy
Hospital
Kansas City
MO
|
Family ID: |
38189141 |
Appl. No.: |
12/899372 |
Filed: |
October 6, 2010 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11561004 |
Nov 17, 2006 |
7833713 |
|
|
12899372 |
|
|
|
|
60737986 |
Nov 18, 2005 |
|
|
|
Current U.S.
Class: |
506/9 ; 435/6.12;
435/6.14 |
Current CPC
Class: |
C12Q 1/6832 20130101;
C12Q 1/6876 20130101; C12Q 1/6832 20130101; C12Q 2525/151
20130101 |
Class at
Publication: |
506/9 ;
435/6 |
International
Class: |
C40B 30/04 20060101
C40B030/04; C12Q 1/68 20060101 C12Q001/68 |
Claims
1-11. (canceled)
12. A method of synthesizing suppression nucleic acid comprising
the steps of: identifying repetitive sequences in a representative
genomic region; and synthesizing said suppression nucleic acid by
synthesizing nucleic acid sequences hybridizable with said
identified repetitive sequences but not hybridizable with low copy
sequences near or within said representative genomic region.
13. The method of claim 12, said synthesized suppression nucleic
acid being substantially free of low copy sequences.
14. The method of claim 12, further comprising the step of
selecting certain identified repetitive sequences for synthesis as
said suppression nucleic acid based on their proximity to a low
copy sequence of interest.
15. The method of claim 14, said certain identified repetitive
sequences being closest in proximity to said low copy sequence of
interest.
16. The method of claim 14, said synthesized suppression nucleic
acid being free of sequences that are hybridizable with said low
copy sequence of interest.
17. The method of claim 12, further comprising the step of using
said synthesized suppressive nucleic acid in a hybridization
assay.
18. The method of claim 17, said hybridization assay being selected
from the group consisting of fluorescence in situ hybridization
assays, microarray assays, and microsphere hybridization
assays.
19-23. (canceled)
24. A method of accurately quantitating nucleic acid sequence copy
numbers, said method comprising the steps of: preparing a first,
spectrally-encoded, fluorescent microsphere having a first spectral
address, and a second, spectrally-encoded, fluorescent microsphere
having a second spectral address; identifying a target genomic
nucleic acid probe sequence by ascertaining the
nucleotide-by-nucleotide sequence of a target nucleic acid sequence
wherein the sequence of interest is suspected to reside;
synthesizing a low copy target probe derived from said identified
target genomic nucleic acid probe sequence, said target probe
comprising at least one low copy element and being substantially
devoid of repetitive elements; conjugating said target probe to
said first microsphere; synthesizing a reference probe selected to
hybridize to a reference nucleic acid sequence of said target
nucleic acid sequence; conjugating said reference probe to a
microsphere having a second spectral address; identifying
repetitive sequences in a representative genomic region;
synthesizing suppressive nucleic acid, said suppressive nucleic
acid comprising sequences of sufficient homology to hybridize to
said identified repetitive sequences, said suppressive nucleic acid
substantially comprising repetitive elements and being
substantially devoid of low copy elements; reacting said
suppressive nucleic acid with a chromosomal target sequence,
thereby causing repetitive elements in said suppressive nucleic
acid to hybridize with homologous repetitive elements in said
chromosomal target sequence; reacting said target probe to said
chromosomal target sequence thereby causing low copy elements in
said target probe to hybridize to homologous low copy elements in
said chromosomal target sequence; reacting said suppressive nucleic
acid with a chromosomal reference sequence containing said
chromosomal target sequence thereby causing repetitive elements in
said suppressive nucleic acid to hybridize to homologous repetitive
elements in said chromosomal reference sequence; reacting said
reference probe with said chromosomal reference sequence thereby
causing said reference probe to hybridize to said chromosomal
reference sequence; detecting the hybridized target probe via said
first spectral address; detecting the hybridized reference probe
via said second spectral address; and quantifying the detected
target probe by comparing the response of the detected hybridized
target probe with the response of the detected hybridized reference
probe.
25. The method of claim 24 wherein said suppressive DNA comprises
repetitive elements, said repetitive elements corresponding to
genomic repetitive elements adjacent to low copy elements in said
target.
Description
CROSS REFERENCE TO RELATED APPLICATION
[0001] This application claims the benefit of the prior filed,
co-pending provisional application Ser. No. 60/737,986, filed Nov.
18, 2005, which is hereby incorporated by reference.
SEQUENCE LISTING
[0002] A printed Sequence Listing, hereby incorporated by
reference, accompanies this application, and has also been
submitted with identical contents in the form of a
computer-readable ASCII file in the electronic filing system of the
U.S.P.T.O.
BACKGROUND OF THE INVENTION
[0003] 1. Field of the Invention
[0004] The present invention concerns materials and methods for
suppressing non-specific cross-hybridization between repetitive
elements present in the target genome or transcriptome and
corresponding repetitive elements in nucleic acid probes, while
avoiding incidental hybridization between single copy sequences in
the probes and adventitious single copy sequences in suppression
DNA. More particularly, the present invention concerns the
development and use of probes substantially lacking repetitive
sequences along with the development and use of suppressive,
synthetic repetitive DNA substantially devoid of single copy
elements. Even more particularly, such repetitive DNA comprises
repetitive sequences corresponding to moderate to high copy
repetitive elements adjacent to single copy elements in one or more
representative genomic regions.
[0005] 2. Description of the Prior Art
[0006] Genome-wide analysis of gene expression and locus copy
number has been facilitated by microarray and array-based
comparative genomic hybridization. Persistent questions regarding
reproducibility of these techniques have been raised by
cross-validation studies in different laboratories.sup.1-5.
Strategies to mitigate variability in the results obtained from
replicate studies have focused on standardizing technical factors,
such as array production, RNA synthesis, labeling, hybridization,
scanning, and data analysis.sup.6-8. Zakharkin et al.sup.9 suggest
that biological differences among samples is the largest source of
this variability and these other factors contribute to a lesser
degree.
[0007] When analyzing DNA using a hybridization probe, repetitive
sequences in the target DNA typically must be blocked prior to
hybridization of the probe to the target, in order to avoid high
background hybridizations between repetitive elements in the probe
and homologous repetitive elements in the target.
[0008] Repetitive sequences occur in multiple copies in the haploid
genome. The number of copies can range from two to hundreds of
thousands, wherein the Alu family of repetitive DNA are exemplary
of the latter numerous variety. The copies of a repeat may be
clustered or interspersed throughout the genome. Repeats may be
clustered in one or more locations in the genome, for example,
repetitive sequences occurring near the centromeres of each
chromosome, and variable number tandem repeats (VNTRs) Nakamura et
al, Science, 235: 1616 (1987); or the repeats may be distributed
over a single chromosome for example, repeats found only on the X
chromosome as described by Bardoni et al., Cytogenet. Cell Genet.,
46: 575 (1987); or the repeats may be distributed over all the
chromosomes, for example, the Alu family of repetitive
sequences.
[0009] Simple repeats of low complexity can be found within genes
but are more commonly found in non-coding genomic sequences. Such
repeated elements consist of mono-, di-, tri-, tetra-, or
penta-nucleotide core sequence elements arrayed in tandem units.
Often the number of tandem units comprising these repeated
sequences varies at the identical locations among genomes from
different individuals. These repetitive elements can be found by
searching for consecutive runs of the core sequence elements in
genomic sequences.
[0010] Competition hybridization, also known as suppression
hybridization, provides a means for blocking a potentially
overwhelming repetitive DNA signal. The unlabeled competitor or
suppressor DNA contains high incidents of repetitive elements which
bind to homologous repetitive elements in the target, thereby
preventing repetitive portions of the labeled probes from binding
to such repetitive elements in the target and increasing the
likelihood that the probes will hybridize substantially to the
targeted, typically non-repetitive, sequence.
[0011] The use of repetitive sequence-enriched (C.sub.ot-1) DNA to
suppress or block non-specific cross hybridization between
repetitive elements present in the probe with other locations in
the genome (or transcriptome) is a common requirement for most
microarray hybridization studies. Hybridization of suppressor DNA
such as C.sub.ot-1 to target DNA prior to FISH is commonly
practiced in the prior art to avoid background, i.e. non-specific,
hybridization. In humans, the C.sub.ot-1 fraction is highly
concentrated in families of interspersed repetitive elements, such
as short and long interspersed repetitive elements, SINEs and
LINEs.sup.10, 11. Commercial procedures for C.sub.ot-1 DNA
preparation iterate denaturation and re-annealing of genomic DNA,
and are monitored by enrichment for Alu elements (three-fold excess
over the corresponding level in the normal genome) and L1 elements
(four-fold excess over the corresponding level in the normal
genome). Current quality control procedures do not determine the
precise composition or sequence of C.sub.ot-1 DNA.
[0012] While the C.sub.ot-1 fraction appears to suppress
non-specific hybridization between the repetitive elements of the
probe and corresponding or homologous repetitive elements of the
target DNA, it also increases experimental noise.sup.12 (FIG. 1).
Therefore, it was investigated whether differences in C.sub.ot-1
composition could be a major source of variability in results from
genomic hybridization studies. The role of C.sub.ot-1 in genomic
hybridization was elucidated by quantitative microsphere
hybridization (QMH).sup.13, 20 using sequence-defined, genomic
single copy (sc) probes.sup.14 and probes composed of contiguous sc
and repetitive genomic sequences. It was determined that C.sub.ot-1
promotes the formation of stable duplexes (single copy sequences in
the probe sequence hybridized to the single copy sequences within
the Cot-1 DNA) containing adjacent paralogous repetitive sequences
often unrelated to the probe, thereby preventing accurate
quantification of single copy sequence hybridization. Incidents of
single copy elements within the C.sub.ot-1 hybridized to homologous
single copy elements in the probe, distort (falsely amplify) the
probe signal.
[0013] FIG. 1 illustrates hybridization of C.sub.ot-1 105 to a
genomic DNA target 100 to suppress or block a repetitive element
115 in the target 100 from being available for hybridization with
paralogous repetitive elements 120 in the probes 110. Repetitive
element 115 is shown in parallel relation to the suppressing
repetitive element 117 in the C.sub.ot-1 DNA 105, thereby
indicating hybridization of the elements 115 and 117. As is typical
in the prior art, probes 110 include both single copy elements 135
as well as adventitious repetitive elements 120, the single copy
elements 135 being selected and synthesized to selectively
hybridize to homologous single copy elements 140 in the target 100.
As illustrated, the probes 110 are conjugated to microspheres 145
used for probe 110 detection and quantitation. Probe 110' is shown
hybridized to the target 100, as anticipated by the study design.
In addition to hybridizing to the repetitive element in the target
115, however, single copy elements 130 in the C.sub.ot-1 105 also
hybridize to homologous single copy elements 135 in the probe 125,
thereby increasing the probe signal by three fold.
[0014] Patent application PCT/US2006/032693 entitled
"Quantification of Microsphere Suspension Hybridization and Uses
Thereof", filed Aug. 16, 2006, describes a microsphere suspension
hybridization assay utilizing low or single copy genomic
hybridization probes allowing direct analysis of whole genomic DNA
(or RNA) using flow cytometry and is hereby incorporated by
reference.
[0015] Accordingly, what is needed in the art are methods of
suppressing signal distortion caused by hybridization of nucleic
acid probes to elements present in C.sub.ot-1 DNA; methods of
suppressing non-specific hybridization of probes to target DNA;
methods of suppressing hybridization of suppressing or competitive
DNA to single copy sequences in the target as well as in the
probes; methods of identifying and synthesizing suppressive,
repetitive DNA; synthesized, repetitive DNA products efficacious
for use as suppressor DNA; and nucleic acid hybridization systems
utilizing such synthesized suppressive DNA in combination with
single copy probes substantially devoid of repetitive elements.
SUMMARY OF THE INVENTION
[0016] The present invention overcomes the problems outlined above
and provides novel methods and products for suppressing the
result-distorting effects of C.sub.ot-1 DNA through replacement of
C.sub.ot-1 with suppressive nucleic acids synthesized to be rich in
repeat elements but substantially devoid of single or low copy
elements. Generally speaking, the method of the present invention
includes the steps of preparing synthetic suppression DNA, and
hybridizing the suppression DNA to target genomic DNA in order to
block repetitive sequences in the target prior to hybridizing a
probe with the target. Preferably, the probe will be free or
substantially free of repetitive elements and the suppression DNA
will be free or substantially free of single or low copy DNA
stretches. In some preferred forms, the method will include the
steps of preparing a hybridization probe by coupling a
spectrally-encoded, polystyrene microsphere to a selected, low
copy, synthetic DNA sequence; pre-hybridizing target genomic DNA
with synthetic, suppressive or blocking DNA of the present
invention; hybridizing the probe to the target genomic DNA; and
detecting the product of the hybridization by flow cytometry. The
demonstrated signal distortion caused by C.sub.ot-1 in
hybridization assays was thereby mitigated by suppressing
cross-hybridization through pre-hybridization of the target to
synthetic repetitive elements that are free or substantially free
of single copy sequences, and preferably free or substantially free
of low copy sequences.
[0017] Unlike current hybridization assays, an assay in accordance
with the present invention substitutes C.sub.ot-1 suppressive DNA
with synthetic DNA developed to include selected repetitive
elements without including competing single (or low) copy elements.
Preferably, the synthetic DNA of the present invention is selected
due to its homology with repetitive regions of target DNA flanking
the single (or low) copy sequence of interest, which corresponds
to, or is homologous with, the sequence of the single (or low) copy
hybridization probe, which is designed to hybridize with the single
(or low) copy sequence of interest.
[0018] The methods and products of the present invention are
efficacious for mitigation of adventitious cross-hybridization (1)
between repetitive elements in suppression DNA and homologous
elements in probes, (2) between single or low copy elements in
probes and homologous single (or low) copy elements in suppression
DNA, and (3) between repetitive elements in the probe and
homologous elements in target genomic sequences. Preferably, in
accordance with the present invention, single or low copy probes
are substantially, even more preferably, completely, devoid of
repetitive elements, and suppression DNA is synthesized to be
substantially, even more preferably, completely, devoid of single
or low copy elements.
[0019] FIG. 2 illustrates hybridization of synthetic, suppressive
DNA 205 to a genomic DNA target 200 to suppress or block a
repetitive element 215 in the target. As shown, the synthetic,
suppressive DNA 205 does not present adventitious single or low
copy elements that would hybridize with single or low copy elements
235 in the probe 210 or single or low copy elements 240 in the
target 200, thereby significantly reducing cross-hybridization of
single or low copy elements in the assay. The probe 210 is
preferably synthesized to comprise one or more single or low copy
elements 235 but is devoid of repetitive elements that might
otherwise hybridize to homologous repeats in the suppressive DNA
205 or target 200. In the FIG. 2, the probe signal would have a
direct 1:1 correspondence with the single or low copy element 240
in the target 200.
[0020] Thus, one aspect of the invention provides a method of
suppressing non-specific cross-hybridization between repetitive
sequences present in nucleic acid probes and homologous repetitive
sequences in target genomic nucleic acid. Generally, the method
comprises identifying repetitive sequences in a representative
genomic region, synthesizing suppressive nucleic acid derived from
the identified repetitive sequences, and reacting the suppressive
nucleic acid with a target nucleic acid. Preferably the suppressive
nucleic acid comprises one or more sequence-defined PCR products
selected from the group consisting of short interspersed elements,
long interspersed elements, long terminal repeats, Alu elements, L1
elements, and DNA transposons. This reaction causes repetitive
sequences in the suppressive nucleic acid to hybridize to
homologous repetitive sequences in the target nucleic acid, thereby
substantially blocking the repetitive sequences in the target
nucleic acid from hybridizing with homologous repetitive sequences
in a subsequently reacted nucleic acid probe, and consequently
suppressing non-specific cross-hybridization between the repetitive
sequences in the probe and homologous repetitive sequences in the
target nucleic acid. This suppressive action is greatly enhanced by
having the suppressive nucleic acid be substantially comprised of
the identified repetitive sequences while also being substantially
devoid of low copy sequences. Preferably, the suppressive nucleic
acid is synthesized so as to be completely devoid of low copy
sequences. In preferred forms, the target nucleic acid comprises
low copy sequences. Preferably, the suppressive nucleic acid is
synthesized to contain a plurality of repetitive sequences selected
to correspond to repetitive sequences found adjacent to low copy
sequences in one or more representative genomic regions. In some
preferred forms, the method will include the further step of
hybridizing the target nucleic acid with one or more probes
containing low copy sequences homologous to low copy sequences in
the target. In preferred forms, the probe will be substantially,
and even more preferably completely, devoid of repetitive
sequences. In other preferred forms, the method will include the
step of conjugating the probe to a spectrally-encoded, polystyrene
microsphere. Preferably, the probe will be labeled with a
detectable moiety in order to enhance its utility. Some preferred
detectable moieties include fluorophores, enzymatic conjugates,
fluorophore-tagged nucleotides, fluorescently-labeled antibodies
bound to antigen-bearing nucleotides, biotin-dUTP,
digoxygenin-dUTP, and combinations thereof. This method, as well as
the others described and taught herein, can be used in any
procedure wherein Cot-1 DNA was used or could be used including an
assay selected from the group consisting of microarray
hybridization assays, fluorescence in situ hybridization assays,
and microsphere hybridization assays.
[0021] Another aspect provides a method of synthesizing suppression
nucleic acid. Such a method generally includes the steps of
identifying repetitive sequences in a representative genomic
region; and synthesizing the suppression nucleic acid by
synthesizing nucleic acid sequences hybridizable with the
identified repetitive sequences but not hybridizable with low copy
sequences near or within the representative genomic region.
Preferably, the synthesized suppression nucleic acid is
substantially free of low copy sequences. In some preferred forms,
the method can also include the step of selecting certain
identified repetitive sequences for synthesis as the suppression
nucleic acid based on their proximity to a low copy sequence of
interest. Preferably, such certain identified repetitive sequences
are the ones in closest proximity to the low copy sequence of
interest. Preferably, the synthesized suppression nucleic acid is
free of sequences that are hybridizable with the low copy sequence
of interest. Of course, a synthesized suppressive nucleic acid in
accordance with the present invention can be used in a
hybridization assay, and especially in a hybridization assay that
could use Cot-1 or blocking DNA. Some preferred hybridization
assays include fluorescence in situ hybridization assays,
microarray assays, and microsphere hybridization assays.
[0022] Another aspect of the present invention provides a novel
method of increasing hybridization specificity between low copy
number nucleic acid probes and homologous regions in a target
nucleic acid. Generally, such a method includes the steps of
hybridizing repetitive elements in the target nucleic acid with
homologous repetitive elements in a suppressive nucleic acid,
wherein the suppressive nucleic acid comprises a plurality of
repetitive elements and is synthesized or selected to be
substantially, and more preferably, completely devoid of low copy
number elements, and hybridizing low copy number elements in the
target nucleic acid with homologous low copy number elements in one
or more of the nucleic acid probes. In preferred forms, the
repetitive elements in the suppressive nucleic acid are selected
for having substantial homology to repetitive elements flanking low
copy elements in one or more representative genomic regions. Even
more preferably, the flanking repetitive elements are of moderate
to high copy number and the low copy elements comprise single copy
elements. Still more preferably, the probes are substantially
devoid of repetitive elements.
[0023] Another aspect of the present invention provides a method
for accurately quantitating nucleic acid sequence copy numbers.
Generally, such a method comprising the steps of preparing a first,
spectrally-encoded, fluorescent microsphere having a first spectral
address, and a second, spectrally-encoded, fluorescent microsphere
having a second spectral address, identifying a target genomic
nucleic acid probe sequence by ascertaining the
nucleotide-by-nucleotide sequence of a target nucleic acid sequence
wherein the sequence of interest is suspected to reside,
synthesizing a low copy target probe derived from the identified
target genomic nucleic acid probe sequence, the target probe
comprising at least one low copy element and being substantially
devoid of repetitive elements, conjugating the target probe to the
first microsphere, synthesizing a reference probe selected to
hybridize to a reference nucleic acid sequence of the target
nucleic acid sequence, conjugating the reference probe to a
microsphere having a second spectral address, identifying
repetitive sequences in a representative genomic region,
synthesizing suppressive nucleic acid, the suppressive nucleic acid
comprising sequences of sufficient homology to hybridize to the
identified repetitive sequences, the suppressive nucleic acid
substantially comprising repetitive elements and being
substantially devoid of low copy elements, reacting the suppressive
nucleic acid with a chromosomal target sequence, thereby causing
repetitive elements in the suppressive nucleic acid to hybridize
with homologous repetitive elements in the chromosomal target
sequence, reacting the target probe to the chromosomal target
sequence thereby causing low copy elements in the target probe to
hybridize to homologous low copy elements in the chromosomal target
sequence, reacting the suppressive nucleic acid with a chromosomal
reference sequence containing the chromosomal target sequence
thereby causing repetitive elements in the suppressive nucleic acid
to hybridize to homologous repetitive elements in the chromosomal
reference sequence, reacting the reference probe with the
chromosomal reference sequence thereby causing the reference probe
to hybridize to the chromosomal reference sequence, detecting the
hybridized target probe via the first spectral address, detecting
the hybridized reference probe via the second spectral address, and
quantifying the detected target probe by comparing the response of
the detected hybridized target probe with the response of the
detected hybridized reference probe. In preferred forms, the
suppressive DNA comprises repetitive elements with the repetitive
elements corresponding to genomic repetitive elements adjacent to
low copy elements in the target.
[0024] In another aspect of the present invention, a method for
suppressing non-specific cross-hybridization between repetitive
elements present in nucleic acid probes and homologous repetitive
elements in target nucleic acid is provided. Generally, the method
comprises the steps of hybridizing suppressive nucleic acid with
homologous repetitive elements in a target nucleic acid containing
one or more low copy elements. Preferably, the suppressive nucleic
acid is synthesized or selected such that it contains a plurality
of repetitive elements selected to correspond to one or more
representative genomic regions containing single copy regions
adjacent to moderate to high copy number repetitive element and is
substantially devoid of low copy elements. Then, the target nucleic
acid is hybridized with one or more probes containing low copy
elements homologous to low copy elements in the target, the probes
being substantially devoid of repetitive sequences.
[0025] In another aspect of the present invention, a method of
suppressing non-specific cross-hybridization between low copy
elements present in suppressive nucleic acid and homologous low
copy elements in nucleic acid probes or target nucleic acid is
provided. Generally, the method comprises the steps of identifying
repetitive and low copy elements within and near the target nucleic
acid, synthesizing suppressive nucleic acid sequences by selecting
repetitive sequences from the target nucleic acid for inclusion in
the suppressive nucleic acid while substantially avoiding the
inclusion of low copy sequences in the synthesis process, and
reacting the synthesized suppressive nucleic acid with the target
nucleic acid such that the respective homologous suppressive
nucleic acid and target nucleic acid elements hybridize with each
other.
[0026] The present invention also provides a method of increasing
the accuracy and reproducibility of assays using suppressive or
blocking DNA (e.g. Cot-1 DNA) comprising the steps of selecting or
synthesizing suppression nucleic acid that includes a plurality of
repetitive elements but is substantially free of low copy sequences
and using or substituting the selected or synthesized suppression
nucleic acid in place of Cot-1 DNA.
[0027] In another aspect of the present invention, a method of
suppressing adventitious hybridization of genomic target nucleic
acid with a nucleic acid probe is provided. Generally, the method
comprises the steps of preparing genomic target nucleic acid for
hybridization by selecting a sequence or sequences in the genome
corresponding to a sequence of interest; identifying low copy
sequences within the target sequences of interest; synthesizing low
copy probes homologous to the identified low copy target sequences,
with the low copy probes being substantially devoid of repetitive
sequences; identifying repetitive sequences adjacent to the target
low copy sequences; synthesizing suppression DNA homologous to the
target repetitive sequences, the suppression DNA substantially
comprising repetitive elements; reacting the target nucleic acid
with the suppression DNA so that the repetitive elements in the
suppression DNA hybridize to homologous repetitive elements in the
target nucleic acid; reacting the target nucleic acid with the low
copy probes to hybridize low copy elements within the probes to
homologous low copy elements in the target nucleic acid; and
detecting the low copy probes in order to quantitate hybridization
of the probe to the target, whereby instances of low copy elements
within the target nucleic acid may be ascertained.
Definitions
[0028] Unless defined otherwise, all technical and scientific terms
used herein have the same meaning as is commonly understood by one
of ordinary skill in the art to which this invention belongs. All
patents, applications, published applications and other
publications and sequences from GenBank and other databases
referred to herein are incorporated by reference in their entirety.
If a definition set forth in this section is contrary to or
otherwise inconsistent with a definition set forth in applications,
published applications and other publications and sequences from
GenBank and other data bases that are herein incorporated by
reference, the definition set forth in this section prevails over
the definition that is incorporated herein by reference.
[0029] As used herein, "a" or "an" means "at least one" or "one or
more."
[0030] As used herein, "nucleic acid(s)" refers to deoxyribonucleic
acid (DNA) and/or ribonucleic acid (RNA) in any form, including
inter alia, single-stranded, duplex, triplex, linear and circular
forms.
[0031] As used herein, "sequence" refers to a nucleic acid
sequence.
[0032] As used herein, the term "reference probe" means a probe
specific for a locus in the genome, preferably from an autosomal
sequence, that is severely damaging and preferably lethal in any
other copy number but 2. The reference probe may be derived from
any low or single copy chromosomal locus, so long as it has a
normal chromosomal complement in the patient sample. In
determination of genomic copy number for diagnosis of
constitutional disease, reference probes will typically be of
autosomal origin from one or more genes that are required to be
expressed from two alleles during normal development. For
determination of genomic copy number for diagnosis of neoplastic
disease, reference probes are selected from chromosomal domains
with a paucity of oncogenes and which have normal chromosomal
complement.
[0033] As used herein, "label" refers to any chemical group or
moiety having a detectable physical property or any compound
capable of causing a chemical group or moiety to exhibit a
detectable physical property, such as an enzyme that catalyzes
conversion of a substrate into a detectable product. The term
"label" also encompasses compounds that inhibit the expression of a
particular physical property. The "label" may also be a compound
that is a member of a binding pair, the other member of which bears
a detectable physical property. Exemplary labels include mass
groups, metals, fluorescent groups, luminescent groups,
chemiluminescent groups, optical groups, charge groups, polar
groups, colors, haptens, protein binding ligands, nucleotide
sequences, radioactive groups, enzymes, particulate particles and a
combinations thereof.
[0034] As used herein, "sample" refers to anything that may contain
a target nucleic acid to be analyzed. The sample may be a
biological sample, such as a biological fluid or a biological
tissue. Examples of biological fluids include urine, blood, plasma,
serum, saliva, semen, stool, sputum, cerebral spinal fluid, tears,
mucus, amniotic fluid, or the like. Biological tissues are
aggregates of cells, usually of a particular kind together with
their intercellular substance that form one of the structural
materials of a human, animal, plant, bacterial, fungal or viral
structure, including connective, epithelium, skin, muscle and nerve
tissues. Examples of biological tissues also include organs,
tumors, lymph nodes, arteries and collections of individual
cell(s), for example, isolated from plasma, blood or urine or by
collagenase treatment of solid tissues.
[0035] As used herein, "amplification" refers to a method for
linearly duplicating a target analyte nucleic acid in a sample to
improve assay sensitivity. As described herein, many different
methods for amplifying nucleic acids are known in the art.
[0036] As used herein, "set" refers to a collection of microspheres
harboring an identical spectral address conjugated either with a
single lc probe or a collection of lc probes.
[0037] As used herein, "low copy" or "lc" refers to a sequence
which will hybridize to ten or fewer sequence intervals in the
target nucleic acid or locations in a genome. It is preferred that
the copy number be 10 or fewer, more preferably 7 or fewer, still
more preferably 5 or fewer, and most preferably 3 or fewer.
[0038] As used herein, "single copy" or "sc" refers to a nucleic
acid sequence which will hybridize to three or less sequence
intervals in the target nucleic acid or locations in a genome.
Thus, the term will encompass sequences that are strictly unique
(i.e., sequences complementary to one and only one sequence in the
corresponding genome), as well as duplicons, and triplicons. The
terms "single copy element" and "single copy sequence" may also be
used to refer to such nucleic acid sequences.
[0039] As used herein, "highly reiterated" means present in more
than 1000 copies.
[0040] As used herein, "sequence identity" refers to a relationship
between two or more polynucleotide sequences, namely a reference
sequence and a given sequence to be compared with the reference
sequence. Sequence identity is determined by comparing the given
sequence to the reference sequence after the sequences have been
optimally aligned to produce the highest degree of sequence
similarity, as determined by the match between strings of such
sequences. Upon such alignment, sequence identity is ascertained on
a position-by-position basis, e.g., the sequences are "identical"
at a particular position if at that position, the nucleotides are
identical. The total number of such position identities is then
divided by the total number of nucleotides or residues in the
reference sequence to give % sequence identity. Sequence identity
can be readily calculated by known methods, including but not
limited to, those described in Computational Molecular Biology,
Lesk, A. N., ed., Oxford University Press, New York (1988),
Biocomputing: Informatics and Genome Projects, Smith, D. W., ed.,
Academic Press, New York (1993); Computer Analysis of Sequence
Data, Part I, Griffin, A. M., and Griffin, H. G., eds., Humana
Press, New Jersey (1994); Sequence Analysis in Molecular Biology,
von Heinge, G., Academic Press (1987); Sequence Analysis Primer,
Gribskov, M. and Devereux, J., eds., M. Stockton Press, New York
(1991); and Carillo, H., and Lipman, D., SIAM J. Applied Math., 48:
1073 (1988). Preferred methods to determine the sequence identity
are designed to give the largest match between the sequences
tested. Methods to determine sequence identity are codified in
publicly available computer programs which determine sequence
identity between given sequences. Examples of such programs
include, but are not limited to, the GCG program package (Devereux,
J., et al., Nucleic Acids Research, 12(1):387 (1984)), BLASTP,
BLASTN and FASTA (Altschul, S. F. et al., J. Molec. Biol.,
215:403410 (1990). The BLASTX program is publicly available from
NCBI and other sources (BLAST Manual, Altschul, S. et al., NCBI,
NLM, NIH, Bethesda, Md. 20894, Altschul, S. F. et al., J. Molec.
Biol., 215:403410 (1990)). These programs optimally align sequences
using default gap weights in order to produce the highest level of
sequence identity between the given and reference sequences. As an
illustration, by a polynucleotide having a nucleotide sequence
having at least, for example, 95% "sequence identity" to a
reference nucleotide sequence, it is intended that the nucleotide
sequence of the given polynucleotide is identical to the reference
sequence except that the given polynucleotide sequence may include
up to 5 differences per each 100 nucleotides of the reference
nucleotide sequence. In other words, in a polynucleotide having a
nucleotide sequence having at least 95% identity relative to the
reference nucleotide sequence, up to 5% of the nucleotides in the
reference sequence may be deleted or substituted with another
nucleotide, or a number of nucleotides up to 5% of the total
nucleotides in the reference sequence may be inserted into the
reference sequence. Inversions in either sequence are detected by
these computer programs based on the similarity of the reference
sequence to the antisense strand of the homologous test sequence.
These variants of the reference sequence may occur at the 5' or 3'
terminal positions of the reference nucleotide sequence or anywhere
between those terminal positions, interspersed either individually
among nucleotides in the reference sequence or in one or more
contiguous groups within the reference sequence.
[0041] As used herein, a "repeat sequence" is a sequence which
repeatedly appears in the genome of which the target DNA is a part,
with a sequence identity between repeats of at least about 60%,
more preferably at least about 80%, and which is of sufficient
length or has other qualities which would cause it to interfere
with the desired specific hybridization of the probe to the target
DNA, i.e., the probe would hybridize with multiple copies of the
repeat sequence. Generally speaking, a repeat sequence appears at
least 10 times in the genome, has a repeat size ranging from 1
nucleotide to hundreds of nucleotides, the repeat units having
lengths of at least 10 nucleotides to thousands of nucleotides.
Repeat sequences can be of any variety, e.g., tandem, interspersed,
palindromic or shared repetitive sequences (with some copies in the
target region and some elsewhere in the genome), and can appear
near the centromeres of chromosomes, distributed over a single
chromosome, or throughout some or all chromosomes. Normally, with
but few exceptions, repeat sequences do not express physiologically
useful proteins. A "repeat sequence" may also be referred to as a
"repetitive sequence" or a "repetitive element."
[0042] As used herein, a "short interspersed element," also
referred to herein as a SINE, means a highly repetitive
interspersed transposable element derived from RNA polymerase III
transcripts with repeat units ranging in length from 75 bp to 500
bp in length. The most abundant class of SINE elements is the Alu
family. Alu sequences are about 300 bp in length and are present in
the human genome in approximately 500,000 copies.
[0043] As used herein, a "long interspersed element," also referred
to herein as a LINE, means a highly repetitive interspersed
transposable element derived from RNA polymerase I transcripts and
with repeat units up to 7000 bp.
[0044] As used herein, a "long terminal repeat," also referred to
herein as a LTR, means a large class of transposable elements which
possess terminal direct repeats, typically 200-500 bp in
length.
[0045] As used herein, a "MIR" repeat means a mammalian
interspersed repetitive element which has a repeat unit length of
at least 260 bp and is found in approximately 105 copies in the
human genome.
[0046] As used herein, a "MER" repeat means a human moderately
interspersed repetitive elements of unknown origin with copy
numbers in the human genome ranging from 100's to 1000's.
[0047] As used herein, moderately repetitive DNA means repetitive
sequences distributed in the uniformly in the human genome, present
in 10 to 1000 copies and are 150 to 300 bp in repeat length. One
example is the Alu family.
[0048] As used herein, highly repetitive DNA means short repetitive
sequences 5 to 300 bp in length that present in up to 10.sup.5
copies in the human genome. One example is satellite DNA.
[0049] As used herein, the terms "DNA transposons" or "transposons"
refer to sequences of DNA that can move from one location to
another within the genome. These sequences may also be referred to
as "mobile genetic elements." Movement of transposons is typically
referred to as transposition.
BRIEF DESCRIPTION OF THE DRAWING FIGURES
[0050] FIG. 1 is a diagram illustrating hybridization of probes to
single copy elements in C.sub.ot-1 DNA.
[0051] FIG. 2 is a diagram illustrating hybridization of
suppression DNA to a repetitive sequence in target nucleic
acid.
[0052] FIG. 3 is a diagram illustrating potential structures
produced in QMH hybridization in the presence of C.sub.ot-1
DNA;
[0053] FIG. 4 is a diagram illustrating synthetic repetitive
products and probes used in suppression of cross-hybridization to
genomic templates.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0054] The following example sets forth preferred embodiments of
the present invention. These embodiments demonstrate hybridization
of single (or low) copy probes to genomic target previously
hybridized to synthetic DNA containing repeat elements but not
single or low copy elements. However, these embodiments are for
illustrative purposes only and the disclosure herein should not be
construed as a limitation upon the scope of the present
invention.
EXAMPLE
Materials and Methods
Quantitative Microsphere Hybridization (QMH)
[0055] Probe Selection, Synthesis, and Microsphere Conjugation.
[0056] The probes are in the form of labeled nucleic acid fragments
or a collection of labeled nucleic acid fragments whose
hybridization to a target sequence can be detected. The labeled
probes may be used with any nucleic acid target that contains
sequences homologous to sequences in the probe. These target
sequences may include, but are not limited to chromosomal or
purified nuclear DNA, heteronuclear RNA, or mRNA species that
contain single copy sequences as integral components of the
transcript. In the ensuing detailed explanation, the usual case of
a DNA target sequence and DNA probes is discussed; however, those
skilled in the art will understand that the discussion is equally
applicable (with art-recognized differences owing to the nature of
the target sequences and probes) to other nucleic acid species.
[0057] An important characteristic of the preferred probes of the
invention is that they are made up of "low copy", "single copy", or
"unique" DNA sequences which are both complementary to at least a
portion of the target DNA region of interest and are essentially
free of sequences complementary to repeat sequences within the
genome of which the target region is a part. Accordingly, a probe
made up of a single copy or unique sequence is preferably
complementary to three or fewer sequences, and preferably only one
sequence, in the corresponding genome.
[0058] Low copy, or mixed low copy and repetitive, sequence probes
were designed as previously described.sup.14, 15, 16, 20. In
preferred forms, the present invention utilizes low or single copy
hybridization probes specially designed to hybridize to a unique
locus in the haploid genome sequence with high specificity. The
method for probe selection and synthesis is disclosed in U.S. Pat.
Nos. 6,828,097 and 7,014,997, the teachings and content of which
are hereby incorporated by reference. These initial steps require
knowledge of the sequences of both the target and genomic repeats,
information that is increasingly available owing to the Human
Genome Project and related bioinformatic studies. Readily available
computer software was used to derive the low, or preferred single,
copy sequences.
[0059] In order to develop probes in accordance with the invention,
the sequence of the target DNA region must be known. The target
region may be an entire chromosome or only portions thereof where
rearrangements have been identified. With this sequence knowledge,
the objective is to determine the boundaries of single copy or
unique sequences within the target region. This is preferably
accomplished by inference from the locations of repetitive
sequences within the target region. Normally, the sequence of the
target region is compared with known repeat sequences from the
corresponding genome, using available computer software. Once the
repeat sequences within the target region are identified, the
intervening sequences are deduced to be low or single copy (i.e.,
the sequences between adjacent repeat sequences). Optimal alignment
of the target and repetitive sequences for comparison may be
conducted by the local homology algorithm of Smith et al., Adv.
Appl. Math., 2:482 (1981), or by the homology alignment algorithm
of Needleman et al., J. Mol. Biol., 48:443 (1970).
[0060] Preferably, at least two different probe sequences are
selected and synthesized. At least one set of probes should be
selected and synthesized for recognition of a particular nucleic
acid sequence wherein the abnormality, if present, would reside
(test probe), and another set of probes should be selected and
synthesized for recognition of a reference sequence (reference
probe). The low copy probes should be at least about 60 base pairs
and generally no more than 2500 base pairs in size. Preferably, the
probes are between 60 and 1000 base pairs, more preferably between
about 80-500 base pairs and most preferably between about 90-110
base pairs. It was found that microspheres conjugated to low copy
probes of about 100 base pairs produced well-defined mean
fluorescence distributions and consistently higher secondary
fluorochrome mean fluorescence intensity values, and thus more
precisely reflected the actual copy numbers. The shorter probe
conjugates are also more stable and can be used in hybridization
reactions for more than two months after conjugation when properly
stored, preferably in the dark and at about 4.degree. C. This
results in less lot-to-lot variation in labeled microsphere stocks,
thereby reducing the effort required to conjugate, quantify and
qualify probe-conjugated microspheres. Longer conjugated probes
showed degraded hybridization efficiency within two weeks after
conjugation.
[0061] The probes used in this example include probes with sc
intervals (i) ABL1a (May 2004, chr9:130623551-130625854) with
divergent AluJo/Sx/L2 repeats and (ii) ABL1b
(chr9:130627353-130628735) with divergent AluJo repeats from within
ABL1, designed and validated previously.sup.13, 14, (iii) a 1823 bp
chromosome 9 probe with Alu/MER1 repetitive sequences, ABL1AluMER1
(chr9:130621702-130623525), (iv) a 98 bp sc segment of a TEKT3
intron (Chr17:15149108-15149206) and (v) a 101 bp sc segment of a
PMP22 intron (Chr17:15073475-15073576), (vi) a 93 bp sc segment of
a HOXB1 intron (Chr17:43964237-43964330). Probes for genomic
reconstruction experiments included: (vii) HOXB1b
(chr17:43963396-43965681) and (viii) C1QTNF7
(chr4:15141452-15141500). Repetitive sequences found within probes
were defined as divergent, based on percent sequence differences
(>12%), percent deletion (>4%), and/or percent insertion
(>4%) relative to consensus family members (on the Internet at
girinst.org).
[0062] Coupling of Probes to Microspheres
[0063] Probes were synthesized and coupled to microspheres as
previously described.sup.13, 20. During synthesis, the probes can
be amine-tagged, depending upon the particular conjugation
reaction, for conjugation to spectrally-distinct microspheres.
Preferably, the probes are conjugated to the microspheres via a
modified carbodiimide reaction.
[0064] Fluorescent microspheres, each with distinct spectral
addresses (designated L1-L9; Duke Scientific, Palo Alto, Calif.)
and coated with approximately 200,000 carboxy-sites, were
conjugated individually to different lc probes. Purified
amino-modified lc probes were coupled to the carboxylated
microspheres via a modified carbodiimide coupling procedure (Dunbar
et al, 2003; Fulton et al, 1997). Each probe was initially heat
denatured and then snap-cooled on ice. Approximately
3.125.times.10.sup.5 microspheres with identical spectral
characteristics were pipetted into a 1.5 mL microcentrifuge tube
(USA Scientific, Ocala, Fla.), centrifuged for 2 minutes at 10,000
g, and drained of supernatant. 150 .mu.L of 0.1M MES buffer
(2-(N-morpholino)ethanesulfonic acid) pH 4.5 was added to each tube
and the microspheres were vortexed briefly followed by
centrifugation for 2 minutes at 10,000 g. The supernatant was
removed and the microspheres were resuspended by vortexing in 80
.mu.L of 0.1M MES. A single lc probe (0.5 nmol) was added to each
tube and mixed by vortexing. A 1.25 .mu.L volume of fresh 10 mg/ml
solution of 1-ethyl-3-3-dimethylaminopropyl
carbodiimidehydrochloride (EDC) was added and the reaction was
vortexed briefly and incubated in the dark for 30 minutes with
occasional mixing. Mixing and incubation of EDC was repeated twice,
using 1.25 .mu.L of freshly prepared EDC solution each time. The
reaction was stopped by the addition of 500 .mu.L 0.02% Tween20
followed by vortexing and centrifugation for 2 minutes at 10,000 g.
Following removal of the supernatant, 250 .mu.L of 0.1% SDS was
added to each tube, vortexed, and then centrifuged at 10,000 g for
2 minutes. The supernatant was carefully removed, 25 .mu.L of 0.1M
MES pH4.5 was added, and the tube was vortexed and stored in the
dark at 4.degree. C. Coupled microsphere concentrations were
quantitated by adding 1 .mu.L of each microsphere to 100 uL of
1.times.PBS and analyzing on the FACSCalibur flow cytometer (Becton
Dickinson, San Jose, Calif.) using conditions given below.
[0065] Other methods for coupling nucleic acids to microspheres
have been developed that are equivalent in scope to the instant
method. Another common method for conjugating DNA to microspheres
binds strepatividin-coated beads to probes containing a modified
nucleotide with a biotin moiety at the 5' terminus Gold
nanoparticles have been conjugated to thiol-modified nucleic acids
in U.S. Pat. No. 6,361,944. Protein-nucleic acids have been
conjugated to beads in U.S. Pat. Nos. 6,468,546; 6,838,243;
6,833,246; 6,828,146; and 6,828,142. Conjugation of
oligonucleotides to microspheres has also been carried out via an
electrophilic tether, namely N-chloroacetamidohexyl phosphoramidite
reagent (Guzaev, et al Bioorg Med Chem Lett. 1998 Dec. 15;
8(24):3671-6). DNA has also been conjugated to semiconductor
nanocrystalline particles (Taylor, J. R., Fang, M. M., & Nie,
S. M. Probing specific sequences on single DNA molecules with
bioconjugated fluorescent nanoparticles. Anal. Chem. 72, 1979-1986,
2000; W. Z. Guo, J. J. Li, Y. A. Wang, X. G. Peng, Conjugation
chemistry and bioapplications of semiconductor box nanocrystals
prepared via dendrimer bridging. Chem. Mater. 15, 3125-3133 (2003),
and U.S. Pat. No. 6,630,307). In a preferred embodiment, the
microspheres are internally dyed, fluorescent, polystyrene beads
with various spectral addresses, and are conjugated to low copy
probes such that various combinations of low copy probe-conjugated
beads result, wherein the reference probes are designated with a
distinct spectral address. The different spectral addresses are
recognized by the flow cytometer and allow for multiplexed
reactions with various low copy probes attached to different
microsphere sets.
[0066] Genomic Target Preparation
[0067] Genomic template (the target nucleic acid sequence) was
prepared using methanol-acetic acid fixed cell pellets derived from
cytogenetic preparations of bone marrow samples as previously
described.sup.13, 20. Unlike other methods, the target sequence is
not pre-selected or amplified. Therefore, in the present invention
an entire copy of a genome (or transcriptome) can be hybridized for
analysis. Depending on the source and condition of the sample, the
DNA (or RNA) is extracted from the cells and, if necessary, can be
replicated in vitro using any conventional method. Preferably, the
nucleic acid is replicated in vitro using a GenomiPhi kit (Qiagen,
Valencia Calif.), which utilizes less than one ng of sample nucleic
acid and requires less than 20 minutes hands-on time. The DNA is
then labeled by any conventional means, preferably by a direct
labeling step during in vitro replication or by an indirect
labeling system consisting of a label and a reporter molecule that
has an affinity for that label. The nucleic acid target is labeled
with an identifying label such as a fluorophore, an enzymatic
conjugate, or one selected from the group consisting of biotin or
the moieties recognized by avidin, strepavidin, or specific
antibodies. There are several types of non-isotopic identifying
labels. One type is a label which is chemically bound to the
nucleic acid target and serves as the means for direct
identification. An example of this would be a fluorochrome moiety,
which upon application of radiation of proper wavelengths will
become excited into a high energy state and emit fluorescent light.
Directly labeled fluorescent nucleotides such as Cy3-dUTP are known
in the art and would be suitable forms of labeling of target DNA
for use with the instant invention. Other methods of direct
labeling of DNA would also be suitable (an example would be the
amino-allyl labeling marketed as the Ulysses method (Kreatech,
Netherlands), however in such instances the genome DNA would have
to be fragmented (by sonication, DNAse I, shearing, or other
enzymatic digestion) to a suitable size for hybridization prior to
addition of the labeled target to probe conjugated microspheres. In
a preferred embodiment, the nucleic acid is directly labeled during
in vitro replication using biotin-dUTP or digoxygenin-dUTP and
resulting labeled sample is sonicated to yield fragments .about.300
bp to 1 kbp in length. The nucleic acid target can also be labeled
by nick translation using a modified or directly labeled nucleotide
(Rigby et al., J. Mol. Biol., 113:237-251, 1977) in the
conventional manner using a reactant comprising the identifying
label of choice (but not limited to) conjugated to a nucleotide
such as dUTP or dATP. The fragments are either directly labeled
with fluorophore-tagged nucleotide or indirectly labeled by binding
the labeled duplex to a fluorescently-labeled antibody that
recognizes the modified nucleotide that is incorporated into the
fragment as described below. Nick translations (100 .mu.L) utilize
endonuclease-free DNA polymerase I (Roche Molecular Biochemicals
and DNase I (Worthington Chemical). Each fragment is combined with
DNA polymerase I (4 units/microgram DNA), DNase (0.01-3
microgram/100 .mu.L reaction), labeled nucleotide (0.05 mm final)
and nick translation buffer. The reaction is performed at
15.degree. C. for 60 minutes and yields a variety of labeled probe
fragments of different nucleotide sizes in .about.300 to 1000 bp
size range. Alternatively, biotin-dUTP or digoxygenin-dUTP can be
incorporated during the in vitro replication procedure and
resulting labeled sample can be treated with DNAse I or sheared by
some other method to yield fragments .about.300 bp to 1 kb in
length. Other methods for labeling and detecting nucleic acids in
common use may be applied to the detection of low copy DNA
conjugated microspheres of the present method. These include
fluorochrome labels and fluorescent compositions such as energy
transfer groups, conjugated proteins, antibodies, or antigens.
[0068] More specifically, one .mu.g of genomic and pUC19 DNA was
nick-translated with biotin-16 dUTP to obtain products 100 bp-350
bp and 50 bp-300 bp in length, respectively.sup.17. One .mu.g of
each C.sub.ot-1 DNA (from manufacturers I and R) was
nick-translated with digoxygenin-11 dUTP to obtain products 50
bp-300 bp.
[0069] Hybridization Reactions and Flow Cytometry
[0070] Labeled DNA (50 ng) was diluted in 40 .mu.L 1.5.times.TMAC
hybridization buffer (3-mol/L tetramethylammonium chloride, 50
mmol/L Tris-HCl, pH8.0, 1 g/L Sarkosyl) containing 10,000
probe-coupled microspheres. Reactions were assembled with the
components listed in Table 1.
TABLE-US-00001 TABLE 1 Quantitative Microsphere Hybridization (Mean
Fluorescence) Repeat-blocking Geometric Mean Reaction Target DNA*
agent (ng)** Probe FL2-SPE* FL1-FITC** Effects of Cot-1 on
hybridization intensity levels affected by genomic location of
probe 1 Genomic 0 ABL1a 105.62 N/A 2 Genomic Cot-1 (50) ABL1a
235.19 N/A 3 Genomic 0 PMP22 433.76 N/A 4 Genomic Cot-1 (50) PMP22
469.27 N/A 5 Genomic 0 TEKT3 642.68 N/A 6 Genomic Cot-1 (50) TEKT3
734.04 N/A 7 Genomic 0 HOXB1 890.91 N/A 8 Genomic Cot-1 (50) HOXB1
821.35 N/A 9 Genomic 0 HOXB1 332.94 N/A 10 Genomic Cot-1 (50) HOXB1
279.1 N/A 11 Genomic 0 HOXB1 2034.76 N/A 12 Genomic Cot-1 (50)
HOXB1 1727.8 N/A Dual detection of genomic target and Cot-1 DNA in
single reactions 13 Genomic 0 ABL1a 187.02 5.67 14 Genomic Cot-1
(50) ABL1a 390.79 282.48 15 pUC19 Cot-1 (50) ABL1a 5.88 6.34
Dilution series of Cot-1 DNA in hybridization reactions 16 Genomic
Cot-1 (50) ABL1b 304.91 77.8 17 Genomic Cot-1 (100) ABL1b 407.61
141.41 18 Genomic Cot-1 (150) ABL1b 449.94 234.44 Hybridization
experiments with recovered products 19 Genomic 0 ABL1a 153.12 5.37
20 Genomic Cot-1 (50) ABL1a 339.8 191.57 21 Genomic.sup.R 0
ABL1AluMER1 4.55 3.27 22 Genomic.sup.R Cot-1 (50).sup.R ABL1AluMER1
5.36 35.32 Genomic reconstruction experiments: 23 PCR 0 C1QTNF7
270.72 N/A 24 PCR C1QTNF7LTR (500) C1QTNF7 270.42 N/A 25 PCR Cot-1
(50) C1QTNF7 321.02 N/A 26 Genomic 0 C1QTNF7 1001.83 N/A 27 Genomic
C1QTNF7LTR (500) C1QTNF7 806.59 N/A 28 Genomic Cot-1 (50) C1QTNF7
1226.61 N/A 29 Genomic 0 ABL1a 565.73 N/A 30 Genomic ABL1aAlu,
ABL1aL2 ABL1a 554.27 N/A (500) 31 Genomic Cot-1 (50) ABL1a 1205.01
N/A 32 PCR 0 HOXB1b 94.66 N/A 33 PCR HOXB1AluL1 (500) HOXB1b 28.41
N/A .sup.RRecovered products from previous hybridization assay
*Nick-translated using biotin-16dUTP and detected using SPE on FL2,
50 ng per reaction
[0071] Hybridization and detection of reactions were carried out as
previously described.sup.13, 20. The conditions for the
hybridization reaction are dependent on the particular nucleotide
composition and the length of each low copy probe, and are easily
determined by those of skill in the art. For hybridization, the
sample sequence is diluted in a hybridization buffer solution
containing the low copy probe-conjugated microspheres. The amount
of probe-conjugated microspheres to be utilized will depend upon
the amount of sample tested. Preferably, about 5 pg to 1 .mu.g of
sample, more preferably about 25-100 ng of sample, still more
preferably about 30-70 ng, yet more preferably about 40-60 ng of
sample, and most preferably about 50 ng of sample, is analyzed per
hybridization reaction. Accordingly, the buffer solution preferably
contains about 2,000-10,000 probe-conjugated microspheres, more
preferably 2,000-6,000 probe-conjugated microspheres, still more
preferably about 4,500-5,500 probe-conjugated microspheres, and
most preferably about 5,000 probe-conjugated microspheres for each
set to be hybridized. Once diluted, the hybridization reaction is
heat denatured, preferably at about 95.degree. C. and then
hybridized overnight at a suitable hybridization temperature,
preferably, at about 45 to 51.degree. C. depending upon the probe
nucleotide composition and length. The hybridized microspheres are
then washed and centrifuged to remove unhybridized target
sequence.
[0072] The supernatant is removed and the hybridized sample is
stained or labeled with an amount of a modified reporter molecule
or other suitable label, preferably one which acts as a secondary
fluorochrome, to detect the labeled sample hybridized to the low
copy probe-conjugated microspheres. The preferred reporter
molecules are phycoerythrin-labeled streptavidin or
anti-digoxigenin fluoroscein, which detect and bind the preferred
target sequence labels, biotin and digoxigenin, respectively. The
hybridized and labeled/stained sample is incubated at the same
temperature used for the hybridization reaction, for a period of
time sufficient for the reporter molecule to detect and bind the
labeled target sequence. Afterwards, the sample is washed to remove
residual stain. The samples are centrifuged, the supernatant
removed and the stained hybridized microspheres are resuspended in
an amount of hybridization buffer.
[0073] Before analysis by flow cytometry, the hybridized samples
can be diluted depending upon the flow cytometer manufacturer's
instructions. Preferably, about 2,000-6,000 microspheres of each
set are analyzed per reaction, more preferably about 4,500-5,500
microspheres, and most preferably about 5,000 microspheres per set
are analyzed per reaction. However, the amount of sample to be
analyzed may depend upon the particular flow cytometer utilized for
analysis. Calibration and operating settings for the flow cytometer
can be modified in a number of ways without undue experimentation,
by those skilled in the art, to determine the optimal ranges for
measuring a particular hybridization assay. These parameters will
also depend upon the software employed for analysis. Fluorescent
bead standards are widely available and can be used to calibrate
the intensity of different fluorochrome detection channels of the
flow cytometer. The instrument can also be calibrated with
fluorescent reference standards based on surface-labeled beads
calibrated in molecules of equivalent soluble fluorochrome (MESF)
units. Photomultiplier tube (PMT) voltage settings and thresholds
for forward scatter, side scatter, flow rate, and various detection
channels should preferably be optimized to minimize differences
between fluorescence intensities of two different probes hybridized
to a single patient sample with a normal genotype. Non-optimal
voltage parameters are readily apparent and result in broad
fluorescence peaks or non-linear data, whereas optimal parameters
preferably result in tightly clustered microspheres with different
spectral addresses when visualized using a side scatter plot.
Preferably, these settings are determined from derived fluorescence
measurements of arithmetic mean, geometric mean, median and peak
channel.
[0074] Reactions were denatured for 3 minutes and hybridized
overnight at 50.degree. C. Hybridized microspheres were washed and
stained with reporter molecule, streptavidin phycoerythrin (SPE;
Molecular Probes) and/or anti-digoxygenin-fluorescein
isothiocyanate (FITC; Molecular Probes). The hybridized samples
were then analyzed by flow cytometry (FACSCalibur, Becton
Dickinson, San Jose, Calif.), using dual laser detection, whereby
the cytometer co-detects the spectral addresses of the microspheres
and the secondary fluorochrome bound to the sample sequences in
order to identify and quantify the hybridized probes. The signal of
each sample sequence, hybridized to its complementary
probe-conjugated microsphere, is determined by quantifying the
fluorescence intensity of the secondary fluorochrome attached to
the sample sequence. Compatible microsphere spectral addresses are
selected to minimize overlap with the emission wavelengths of any
unbound secondary fluorochrome (reporter molecule). This can be
confirmed by comparison with results obtained from otherwise
identical unconjugated and unhybridized microspheres. A negative
control may also be maintained using a reaction tube containing all
of the components except for the sample nucleic acid in order to
determine background fluorescence in the secondary fluorochrome
detection channel. Preferably, the system is flushed with distilled
water between runs to remove any residual microspheres.
[0075] Approximately 5,000 microspheres were analyzed per reaction.
Hybridization was quantified from the SPE and/or FITC mean
fluorescence intensity (measured in channels FL2 and/or FL1,
respectively), which corresponds to the quantities of genomic
target (FL2) and of C.sub.ot-1 DNA (FL1) bound by probe.
Calibration studies with conjugated probes and labeled targets
containing identical sequences demonstrated that changes in mean
fluorescence intensity were linearly related to the amount of
target hybridized. The FL1 and FL2 channel background fluorescence
was separately determined in each hybridization experiment using a
negative control containing all reaction components except target
DNA.
[0076] Optimal PMT voltages were set as described previously; data
collection and analysis were performed with manufacturer-supplied
CellQuest software.sup.13, 20. Optimal photomultiplier tube voltage
settings were determined by selecting photomultiplier voltage tube
settings that minimized differences between fluorescence
intensities of two different probes hybridized to a single patient
DNA sample with a normal genotype. These settings were determined
from instrument-derived fluorescence measurements (CellQuest;
Becton Dickinson) of arithmetic mean, geometric mean, median and
peak channel. Typical photomultiplier tube voltage settings for the
FACSCalibur instrument were FSC (forward scatter)=E00 (no signal
amplification), SSC (side scatter)=344 V, FL1=727 V, FL2=640 V,
FL3=300 V, and FL4=500 V. Thresholds for FSC, FL1, FL2, and FL3
were set at the default of 52 V. The FSC threshold was selected as
the primary parameter and had a value of 52 V and the secondary
parameter was set at SSC with a value of 125 V. The flow rate was
set on low and the sheath fluid used was FACsFlow (Becton
Dickinson). The system was flushed between runs with 2-5 mL of
distilled water to remove any residual microspheres. CellQuest was
used for data collection and analysis. Analysis of data was also
performed using WinMDI2.8 flow cytometry package (WinMDI; J.
Trotter, Salk Institute, La Jolla, Calif.).
[0077] Recovery of Probe-Hybridized DNA Fragments
[0078] Aliquots (35 .mu.L) of genomic hybridizations with ABL1a
(Table 1: reactions 19 and 20) were washed with 250 .mu.L
0.1.times.SSC 1% SDS and pelleted by centrifugation
(13,000.times.g), and repeated twice. The hybridized genomic
sequences were heat denatured at 95.degree. C. for 5 minutes and
snap-cooled followed by centrifugation (13,000.times.g) at
4.degree. C. for 3 minutes. Recovered sequences were used as target
for QPCR and for hybridization to microsphere-coupled ABL1AluMER1
(Table 1: Reactions 21 and 22).
[0079] Synthetic Repetitive DNA
[0080] Synthetic repetitive DNA was prepared from genomic regions
selected based on the families of repetitive sequences contained
within them, since each is enriched in the C.sub.ot-1 manufacturing
process. However, any representative genomic region containing sc
regions adjacent to moderate to high copy number repetitive
elements could have been employed. To demonstrate that repeat
elements in genomic probes could be suppressed at locations beyond
the desired target interval, a probe was prepared containing a 1.1
kb LTR element centered between two 400 bp sc regions on chromosome
4p (chr4:15139704-15141581) located upstream of the C1QTNF7 gene
(FIG. 4, A). Subsequently, repetitive sequences situated within the
ABLa probe region for blocking this repeat element were
synthesized; ABL1a from chromosome 9 contains a 280 bp AluJo
repeat, a 300 bp AluSx repeat, and an 830 bp L2 element segment
(FIG. 4, C). A 2286 bp segment on chromosome 17q located 5' of
HOXB1 containing a 306 bp AluSx repeat and 154 bp L1 truncated
sequence (chr17:43963396-43965681) was also used as a probe (FIG.
4, B). Primers that amplified unique sequences immediately flanking
these repetitive elements (Table 2: HOXB1AluL1 and C1QTNF7LTR) were
developed for PCR amplification of each repeat sequence and of the
target product (Table 2: HOXB1b and C1QTNF7). Genomic DNA (Promega)
probes were amplified using Pfx (Invitrogen). Amplification
products were then electrophoresed and extracted by micro-spin
column centrifugation. Probes were conjugated to microspheres via a
modified carbodiimide reaction as previously described.sup.13, 20.
Hybridization reactions (Table 1: Reactions 23-33) evaluated the
effect of the synthetic repetitive PCR products hybridized to
homologous PCR product, and/or genomic DNA, in the presence and
absence of C.sub.ot-1 DNA. Reactions were hybridized, washed,
stained with SPE, and then analyzed by flow cytometry.
Quantitative PCR
[0081] QPCR and data analysis were performed using the Chromo4
quantitative PCR system (Bio-Rad Laboratories, Hercules, Calif.).
Primers and amplified intervals were verified for unique genomic
representation using BLAT.sup.18 (found on the Internet at
genome.ucsc.edu/cgi-bin/hgBlat) and BLAST (Table 2). BLAT is a
computer software tool that includes a sequence alignment algorithm
and an index of vertebrate sequences to identify regions in the
human genome of likely homology to the queried sequence. BLAT is an
alignment tool similar to BLAST, only structured differently since
BLAT works by keeping an index of an entire genome in memory,
whereas the target database for BLAST includes Genbank sequence
collections. Each 50 .mu.L reaction contained 0.5 .mu.M of each
primer, 50 ng C.sub.ot-1 template or positive control human genomic
DNA (Promega), and 25 .mu.L 2XQTSybrG master mix (Qiagen). Genomic
DNA was nicked using DNAse to generate fragments from 50 bp-300 bp,
and a negative control contained all reaction components except for
DNA. Thermal cycling conditions were 95.degree. C. for 15 minutes,
45 cycles of amplification (94.degree. C. for 15 seconds,
61.degree. C. for 30 seconds (data acquisition), 72.degree. C. for
30 seconds), followed by 72.degree. C. for 5 seconds with a
decrease in temperature by 20.degree. C. every second for the
generation of a melt curve. A calibration curve used to determine
the amount of input target sequence in the recovered genomic
template was generated by varying the amounts of normal genomic
template (1 ng, 2 ng, 4 ng, 10 ng, and 20 ng) and by determining
the C.sub.T values for each reaction.
[0082] The composition of sequences recovered from the ABL1a
product hybridization (1 .mu.L; Table 1: Reactions 21 and 22) was
determined by QPCR. Primer sets utilized several amplified
sequences from within the ABL1 region, which were not necessarily
homologous to this probe, including: ABL1a and ABL1c
(chr9:130709665-130711469), ABL1d (chr9:130699324-130700596)) as
well as primers specific for other unlinked genomic regions such as
DNJA3Alu (chr16:4421138-4421200), containing an Alu repeat located
5' of the DNAJ3 gene, TEKT3, and HOXB1 (Table 2). Reactions were
performed as described above. A positive control (human genomic
DNA) was run for each primer set to represent the initial quantity
of genomic DNA originally added to QMH reactions (50 ng). Molar
ratios of target sequences recovered from QMH were determined from
the quantity of initial template in test samples (interpolated from
its C.sub.T value cross-referenced against the standard calibration
curve) in the presence and absence of C.sub.ot-1 DNA.
TABLE-US-00002 TABLE 2 Probes and primers used in this study Probe
Chromosome Primer Name Sequence (5'->3') ABL1a 9 ABL1aF
GTGGCTTATGCCTGTAATTTC ACA (SEQ ID NO. 1) ABL1aR
AGAGACAGGGTCTTCTTATGT TGC (SEQ ID NO. 2) ABL1b 9 ABL1bF
ATTTGGAAAGATTATATCCAT CTACTTAATGC (SEQ ID NO. 3) ABL1bR
ACAAACCTACCTACGTTTCAA CACTCTCTT (SEQ ID NO. 4) ABL1c 9 ABL1cF
GCTTTATGAACTAGCTGATTT AGTTTGCTC (SEQ ID NO. 5) ABL1cR
CTCAATCTCTCTTTTATCTGTT TTGTCCATTG (SEQ ID NO. 6) ABL1d 9 ABL1dF
TAGTTAATTTAGAAGGTTTAA ATCACGAGAA (SEQ ID NO. 7) ABL1dR
CTAATTTTTAAATGTGTGAAT GCAATTTT (SEQ ID NO. 8) RRP4-1.6a 9
RRP4-1.6a5'F CAGAGGAAGGAAGACGTAGT GAAC (SEQ ID NO. 9) RRP4-1.6a5'R
GCTGAACCAAGCAGACACAG (SEQ ID NO. 10) RRP4-1.6a 9 RRP4-1.6aF
ATGGGAGCTTGGATAAGAGA TG (SEQ ID NO. 11) RRP4-1.6aR
CTATACCCTGAGGCGATAATG TTC (SEQ ID NO. 12) RRP4-1.6a 9 RRP4-1.6Fa3'F
AGCAGATCAGACATACAGGT CCAA (SEQ ID NO. 13) RRP4-1.6a3'R
GGCCACCGTAAGTTACAAGA CC (SEQ ID NO. 14) ABL1AluMer1 9 ABL1AluMER1-F
C12-Amine- CCTCTTCGGGGTAGAGTTTCG CTCT (SEQ ID NO. 15) ABL1AluMER1-R
CTCAGGCCCTTGTCACACTCT TGAA (SEQ ID NO. 16) DNJA3Alu 16 DNJA3Alu-F
CTCCTGTCCGTGTTCTCTGC (SEQ ID NO. 17) DNJA3Alu-R
AGGCTGGTAGTGACCTGTGG (SEQ ID NO. 18) HOXBlb 17 HOXB1b-F
TCACCCCCATTGCATCTATT (SEQ ID NO. 19) HOXB1b-R TAGGAAGGGGGTAGGGAGTG
(-biotin) (SEQ ID NO. 20) HOXB1AluL1 17 HOXB1AluLl-F
TCACCCCCATTGCATCTATT (SEQ ID NO. 21) HOXB1AluLl-R
TCCCAAAGTGCTAGGATTGC (SEQ ID NO. 22) C1QTNF7 4 C1QTNF7-F
TGCAATTCAAAACAGATTGA AAAT (SEQ ID NO. 23) C1QTNF7-R
CCACCATGTGAGAAGTTTGAC TAC-biotin (SEQ ID NO. 24) C1QTNF7LTR 4
C1QTNF7LTR-F AAGTGTGAAAGGCATATTTTA GCC (SEQ ID NO. 25) C1QTNF7LTR-R
TACATTTTGGGGTCATTTGTT ATG (SEQ ID NO. 26)
Fluorescence in Situ Hybridization (FISH)
[0083] The method of the present invention can also be utilized in
fluorescent in situ hybridization (FISH) experiments. The target
region for a FISH probe may be an entire chromosome or only
portions thereof. After probe synthesis and labeling.sup.15, 16,
FISH hybridization probes can be incubated with synthetic
repetitive DNA for repeat suppression instead of Cot-1 DNA prior to
hybridization to chromosomes fixed on slides. Often comparative
experiments prepared with and without probe prehybridization using
Cot-1 DNA show differing probe hybridization signals.sup.14. FISH
without Cot-1 DNA probe prehybridization reveals a weaker probe
signal on the chromosome as compared to the FISH experiment without
Cot-1 DNA prehybridization.sup.14. The weaker signal stems from
hybridization of single copy sequences in the probe to single copy
sequences present in the Cot-1 DNA. This reduces the amount of
probe available for hybridization to the target sequence on the
chromosomes and thus a weaker signal. However, as a consequence,
the experiment without Cot-1 DNA prehybridization while brighter in
probe signal intensity, typically shows more false positive prove
hybridizations, which results in a higher background level making
analysis more labor intensive. By prehybridizing probes with a pure
synthetic repetitive DNA fraction comprised of no single copy
sequences, any repetitive sequences found in the probe are
effectively suppressed leaving the single copy sequences available
for hybridization to the chromosomes. Thus, probe signal intensity
on the chromosome is not compromised and background (false positive
hybridization signals) is effectively minimized
Results
[0084] Quantitative Microsphere Hybridization with C.sub.ot-1
DNA
[0085] A FISH-validated, mixed sc and repetitive sequence probe,
ABL1a, from the 5' end of IVS1b of the ABL1 gene containing
divergent AluJo/Sx/L2 repeats (chr9:130623551-130625854) was
hybridized with biotin-labeled genomic DNA.sup.13, 20. Although it
was expected that commercially prepared C.sub.ot-1 DNA would
suppress repetitive sequence hybridization, in replicate
hybridizations of ABL1a with biotin-labeled genomic DNA, the mean
fluorescence (or hybridization) intensity of labeled genomic target
was consistently and significantly increased by 2.2 fold when
C.sub.ot-1 was included in replicate hybridizations of ABL1a with
nick-translated genomic DNA (Table 1: Reactions 1 and 2). Sc probes
derived from chromosome 17 genes, PMP22 (Chr17:15073475-15073576)
and TEKT3 (Chr17:15149108-15149206), showed smaller but
reproducible increases of 1.08 and 1.14 fold in hybridization
intensity in the presence of C.sub.ot-1 DNA (Table 1: Reactions
3-6). These experiments suggested that the effects due to
C.sub.ot-1 are related to the composition of repetitive sequences
surrounding these sc intervals. A sc probe from HOXB1
(Chr17:43964237-43964330) consistently exhibited a small decrease
in hybridization intensity with addition of C.sub.ot-1 DNA (Table
1, Reactions 7-12) with a 0.84-0.92 fold decrease in hybridization
intensity for genomic samples tested. The HOXB1 interval is
practically devoid of repetitive sequences (UCSC Genome Browser,
May 2004). The region circumscribing ABL1a contains highly dense,
conserved and abundant interspersed SINE (AluJo, AluSx) and LINE
(L2) elements. The TEKT3 and PMP22 intervals contain shorter, less
abundant and more divergent classes of repeat elements (MIR, MER,
and L2).
[0086] The degree to which addition of C.sub.ot-1 DNA altered
target hybridization to the ABL1a probe was determined by comparing
hybridizations of biotin-labeled target DNA (detected with
streptavidin-phycoerythrin [SPE] in the FL2 channel), a
biotin-labeled negative control target (pUC19 plasmid), and each of
these with digoxygenin-labeled C.sub.ot-1 DNA (detected by
FITC-conjugated anti-digoxygenin in the FL1 channel). The presence
of C.sub.ot-1 resulted in a 2-fold increase in the mean
fluorescence intensity for ABL1a hybridized to biotin-labeled
homologous genomic target sequence. However, the amount of labeled
C.sub.ot-1 sequence bound substantially exceeded that necessary for
suppression of repetitive sequences in ABL1a, based on a 50 fold
increase in intensity relative to reactions in which C.sub.ot-1
sequences were omitted (Table 1: Reactions 13 and 14). C.sub.ot-1
binding appears sequence-specific, since hybridization of ABL1a to
pUC19 exhibited background level signals (<10.sup.1), regardless
of whether C.sub.ot-1 was present (Table 1, Reaction 15). These
findings suggest that homologous sequences in C.sub.ot-1 are
directly binding to the ABL1a probe. Because the ABL1a sequence
presumably represents only a small proportion of the C.sub.ot-1
target, it alone cannot account for the increase in observed
hybridization.
[0087] To determine if the increased signal was related to the
quantity of C.sub.ot-1 DNA, varying amounts of digoxygenin-labeled
C.sub.ot-1 DNA added to a fixed quantity (50 ng) of biotin-labeled
genomic target were hybridized to ABL1b, which is a mixed sc and
repetitive probe. ABL1b contains two divergent AluJo repetitive
sequences (chr9:130627353-130628735). By doubling the amount of
C.sub.ot-1 from 50 to 100 ng in the reaction, probe hybridization
to C.sub.ot-1 increased by 1.8 fold and to homologous target by 1.3
fold (Table 1: Reactions 16 and 17). Similarly, 150 ng of labeled
C.sub.ot-1 DNA increased hybridization to ABL1b by 3 fold over 50
ng C.sub.ot-1, and by 1.5 fold to target DNA (Table 1: Reactions 17
and 18). Even though the stochiometric addition of C.sub.ot-1 DNA
dilutes the homologous biotinylated target between 2 and 4 fold,
the corresponding hybridization intensity is unexpectedly increased
1.5 fold.
[0088] The correlation of C.sub.ot-1 concentration with
hybridization intensity suggested that this reaction component
promoted the formation of duplex structures containing other
sequences besides the probe and desired genomic target. To
determine the composition of C.sub.ot-1 derived sequences bound to
probes, products were denatured and recovered after hybridization
to ABL1a-coupled microspheres (Table 1, Reactions 19 and 20). These
products were used as target sequences in subsequent hybridizations
to a non-overlapping sc and repetitive microsphere-conjugated
probe, ABL1AluMER1, containing Alu elements (AluJb, AluSq,
Charlie1, and AluSx) and MER1 sequences localized 2.3 kb
centromeric to ABL1a. Given the genomic location of ABL1AluMER1, it
was not expected to be present in the recovered nick-translated
genomic products. However, the labeled C.sub.ot-1 fraction was
found to be the source of the recovered ABL1AluMER1 sequence, based
on an 11 fold increase in mean fluorescence intensity in FL1
channel (Table 1: Reactions 21 and 22). Repetitive sequences
adjacent to hybridized ABL1a in C.sub.ot-1 DNA appear to nucleate
hybridization to genomic sequences by forming networks of
repetitive and single copy sequence elements (FIG. 3: Panels 1 and
2). This possibility was evaluated by quantitative PCR (QPCR)
analysis of sequences present in recovered hybridization
products.
Analysis of Hybridized Sequences by Quantitative PCR
[0089] The content of sc sequences in C.sub.ot-1 that were
homologous to our probes was determined by QPCR. Probes and primers
used in the study are identified in Table 2. Results of the
analysis are shown in Table 3.
TABLE-US-00003 TABLE 3 Quantitation of recovered hybridization
targets Reaction Template Primer Set C.sub.T ng 1 genomic DNA (500
ng) ABL1a 10.88 1.73 2 C.sub.ot-1 DNA (Manufacturer I) (500 ng)
ABL1a 7.06 4.25 3 C.sub.ot-1 DNA (Manufacturer R) (500 ng) ABL1a
9.86 3.02 4 genomic DNA RRP4-1.6a5' 1.734 n/a 5 C.sub.ot-1 DNA
(Manufacturer I) RRP4-1.6a5' 2.22 n/a 6 C.sub.ot-1 DNA
(Manufacturer R) RRP4-1.6a5' 1.96 n/a 7 genomic DNA RRP4-1.6a 2.003
n/a 8 C.sub.ot-1 DNA (Manufacturer I) RRP4-1.6a 2.75 n/a 9
C.sub.ot-1 DNA (Manufacturer R) RRP4-1.6a 6.63 n/a 10 genomic DNA
RRP4-1.6a3' 1.881 n/a 11 C.sub.ot-1 DNA (Manufacturer I)
RRP4-1.6a3' 1.93 n/a 12 C.sub.ot-1 DNA (Manufacturer R) RRP4-1.6a3'
4.64 n/a 13 Recovered ABL1a hybridized to ABL1a 9.23 n/a 14 genomic
DNA with C.sub.ot-1 ABL1a 1.36 n/a 15 Recovered ABL1a hybridized to
ABL1AluMER1 24.29 0.009526 16 genomic DNA with C.sub.ot-1
ABL1AluMER1 18.82 1.38 17 Recovered ABL1a hybridized to DNJA3Alu
n/a n/a 18 genomic DNA with C.sub.ot-1 DNJA3Alu 30.26 2.053
[0090] A 100 bp sc segment of ABL1a was amplified from 500 ng
samples of C.sub.ot-1 DNA and control genomic DNA (Table 2). Based
on their respective C.sub.T values, the C.sub.ot-1 fractions from
Manufacturers I and R exhibited a 14 and 2 fold increase,
respectively, in the amount of ABL1a hybridized (or a 2.5 and 1.7
molar increase) relative to its normal genomic composition (Table
3: Reactions 1-3). ABL1a sequences were recovered after
hybridization to determine the composition of genomic and
C.sub.ot-1 derived sequences hybridized to this probe (Table 1:
Reactions 21 and 22). ABL1a sequences were increased by 128 fold in
a hybridized sample containing both target and C.sub.ot-1 DNA
(Table 3: Reactions 13 and 14). Recovered sequences identical to
ABL1AluMER1 from hybridizations containing C.sub.ot-1 were 139 fold
more abundant than that found in duplicate reactions lacking
C.sub.ot-1 (Table 3: Reactions 15 and 16). Repetitive sequences
that are closely related to ABL1AluMER1 were also detected in
recovered hybridization products. An Alu element with 92%
similarity, DNJA3Alu (5' to DNJA3 gene; chr16:4421138-4421200), was
found in the hybridization reaction containing C.sub.ot-1, but not
in the reaction lacking C.sub.ot-1, indicating that C.sub.ot-1 was
the source of this contaminating sequence (Table 3: Reactions 17
and 18). Other sc genomic segments (i.e. from CMT1A, HOXB1 and
other ABL1 regions (ABL1c and ABL1d) were not detected in the
products recovered from hybridization to the ABL1a probe.
[0091] C.sub.ot-1 derived sequences hybridized to RRP4-1.6a, a
sequence linked to ABL1 (Table 2), containing both homologous sc
and repetitive sequences, despite the fact that this single copy
probe had been validated by FISH.sup.14. Moderately and highly
abundant MIR, L2, and L1 repeat elements surround this sequence in
the genome. QPCR demonstrated higher concentrations of repetitive
sequences recovered from upstream (5') and downstream (3')
amplicons relative to a short RRP4-1.6a product derived from within
the sc interval (Table 3: Reactions 4-12). Comparison of C.sub.T
values indicates sc sequences bordering genomic repeats
(RRP4-1.6a5' and RRP4-1.6a3') are only 6.8 fold more abundant in
genomic DNA than in the C.sub.ot-1 fraction for Manufacturer R (and
similarly, for Manufacturer I). As expected, the internal sc
RRP4-1.6a sequence is considerably more abundant in genomic DNA
than in C.sub.ot-1 (24 fold), but nevertheless it can still be
detected in C.sub.ot-1 (Table 3: Reactions 7-9). Enrichment for
SINEs and LINEs during C.sub.ot-1 preparation results in accretion
of linked lc or sc sequences which, during hybridization, can
potentially anneal to the conjugated probe or to actual sc target
sequences in labeled genomic DNA.
Suppression of Cross-Hybridization with Synthetic Repetitive
DNA
[0092] The hybridization effect of C.sub.ot-1 DNA was reversed at
three different genomic loci by substituting an excess of purified,
synthetic DNA(s) prepared specifically from the repetitive elements
adjacent to sc sequences (FIG. 4). A 1.9 kb amplification product
was synthesized containing a LTR-like repetitive element and a
single copy sequence upstream of C1QTNF7 on chromosome 4. The
addition of the purified synthetic LTR-like element, C1QTNF7LTR,
had no effect on the self-hybridization of this product to coupled
microspheres, whereas the addition of C.sub.ot-1 DNA increased the
mean fluorescence by 1.2 fold (Table 1: Reactions 23-25).
C1QTNF7LTR was used to block hybridization of repetitive sequences
nick-translated genomic DNA in the presence and absence of
C.sub.ot-1 DNA and obtained similar results (Table 1: Reactions
26-28). Hybridization of AluSx and L1 repetitive sequences was
suppressed within a .about.2.3 kb region on chromosome 17 upstream
of the HOXB1 locus (HOXB1b) using a synthetic PCR product,
HOXB1AluL1, containing these sequences. Hybridization of the HOXB1b
PCR product and corresponding microsphere-coupled probe in the
presence of the HOXB1AluL1 effectively blocked repetitive sequence
within amplified target, and, in fact, reduced hybridization
intensity by 0.3 fold, presumably because of the reduction in
target length (Table 1: Reactions 32 and 33). Hybridization of
repetitive sequences was also effectively suppressed in comparable
genomic hybridizations to ABL1a coupled to microspheres by addition
of synthetic Alu and L2 elements from within this target region
(Table 1: Reactions 29-31).
Impact of C.sub.ot-1 in Microarray Hybridization
[0093] The nearly universal inclusion of C.sub.ot-1 for repeat
sequence suppression in published hybridization studies raises the
question of how this reagent affects quantitative measures of
expression and/or genomic copy number. The variability in
dual-label hybridization intensities was evaluated across a set of
replicate target samples hybridized to arrays of cloned probes in
expression studies that utilized C.sub.ot-1 (source data from the
GEO database: http://www.ncbi.nlm.nih.gov/projects/geo). Results
were analyzed from cDNA probes of genes used in the microsphere
hybridization assay (including ABL1a, HOXB1, and TEKT3), then
subsequently the hybridization profiles for several gene sequences
located in genomic environments distinguished by their repetitive
sequence composition, ie. that were either densely (Table 4,
bottom) or sparsely (Table 4, top) populated with repetitive
sequences.
TABLE-US-00004 TABLE 4 Variation among replicate microarray studies
for different genes Coordinates (hg17) Gene Repetitive element(s)
log ratio range variance mean GDS record Regions containing single
copy sequences chr17: 43964237-43964330 HOXB1 N/A 2.44-2.51 0.07
2.472 GDS223/31555 chr17: 15149108-15149206 TEKT3 N/A 0.149-0.207
0.03 0.172 GDS226/729 chr6: 31,479,350-31,491,069 MICA N/A
2.91-2.93 0.02 2.92 GDS223/40755 chr6: 33,166,877-33,173,425
HLA-SX-alpha N/A 2.5-2.54 0.04 2.519 GDS223/34072 chr6:
31,546,991-31,548,163 MHC Class I 3.8-1 N/A 2.43-2.44 0.01 2.438
GDS223/34934 chr6: 31,651,329-31,654,091 TNFalpha N/A 2.58-2.65
0.07 2.614 GDS223/35402 chr12: 6,179,924-6,217,679 CD9 N/A
2.96-2.97 0.01 2.966 GDS223/39389 Regions containing repetitive
sequences chr9: 130623551-130625854 ABL1 (5' IVS1b) Alu, 12
(-)0.53-0.14 0.67 -0.0975 GDS751/20213 chr19: 61581409-61581526 N/A
L1 (-)0.22-1.34 1.56 0.225 GDS221/H200016688 chr14:
63636408-63636790 ZFYVE26 L1 (-)0.25-0.53 0.78 0.0825
GDS221/H200018057 chr6: 43004902-43014978 TNRC5 Alu, MIR, L1, L2,
LTR (-)0.248-0.447 0.688 0.215 GDS226/11917 chrX:
129482873-129483034 N/A retrotransposon L1 (-)0.47-.06 0.53 -0.2225
GDS221/H200014041 chr14: 67298146-67298238 N/A L1, L2 (-)0.3-0.13
0.43 -0.13375 GDS221/H200014930 chr10: 15,119,774-15,314,575 GAPDH
L2, LTR 1.51-2.12 0.61 1.7875 GDS221/H200007830 chr15:
38,115,535-38,118,631 SRP14 Simple Repeat (-)0.38-0.44 0.82 -0.045
GDS222/H007542
[0094] Replicate Cy3/Cy5 intensity ratios are significantly more
variable for sequences occurring within repeat-dense genomic
intervals relative to probes derived from genomic regions
containing fewer, more divergent repetitive sequences. For example,
ABL1 was found to exhibit both increased and decreased expression
using the same test sample in different replicates (eg. Database
record GDS751/20213 which displays a sample variance of 0.30 and
p=0.18; Table 4), analogous to the distortion in hybridization we
observed with microsphere conjugated-ABL1a. By contrast, HOXB1
showed little variability in log ratio intensities among replicate
expression array studies using the same test sample (GDS223/31555;
sample variance=0.001 and p<0.0001), consistent with our results
for this locus. This suggests that single copy sequences in
C.sub.ot-1 hybridize to probes, nucleating the formation of mixed
sc and repetitive sequence networks that capture labeled repetitive
sequences from target cDNA In microarray studies, C.sub.ot-1 thus
distorts the hybridization of cloned probes enriched for
interspersed repetitive sequences by forming complex hybridization
networks in a manner analogous to what is observed in QMH.
Discussion
[0095] The above-described analyses have demonstrated that
non-repetitive sequences present in C.sub.ot-1 DNA can
significantly alter the amount of labeled genomic target detected
in hybridization reactions with homologous probes. Rather than
suppressing cross-hybridization, C.sub.ot-1 enhanced hybridization
to probes containing repetitive sequences by as much as 3 fold. The
results suggest that unlabeled C.sub.ot-1 DNA sequences bridge lc
and repetitive sequences in sequence specific probes and
complementary target sequences. Repetitive sequences linked to
homologous lc sequences in the C.sub.ot-1 fraction can nucleate
subsequent hybridization of labeled repetitive sequences in genomic
targets. The addition of C.sub.ot-1 DNA to probe hybridizations
with labeled genomic templates catalyzes the formation of a network
of heteroduplexes homologous to the probe and elsewhere in the
genome (FIG. 3, example 2). "Partial" duplexes containing both lc
and repetitive sequences (FIG. 3, example 3) are facilitated by the
addition of C.sub.ot-1 DNA through labeled lc genomic targets to
linked repetitive elements (FIG. 3, example 4). Labeled repetitive
sequences linked to lc genomic target DNA sequences can also alter
hybridization intensities, but not to the same extent that
C.sub.ot-1 does, due to its enrichment for both lc and interspersed
repetitive sequences.
[0096] Since the advent of microarray and array CGH technologies,
many researchers have noted concerns about experimental
reproducibility.sup.4, 5. Perhaps the largest source of variation
in relation to cross-hybridization stems from repetitive
sequences.sup.7. However, many researchers believe this issue is
addressed by blocking repetitive elements with C.sub.ot-1 DNA prior
to hybridizing cDNA to an array.sup.6, 7. Dong et al..sup.19 found
"some regions of non-repetitive sequences were sufficiently
homologous to repetitive sequences to hybridize to the human
C.sub.ot-1 DNA fraction" and proposed that this was responsible for
skewing hybridization intensities in their microarray results.
C.sub.ot-1 affects the reproducibility of hybridization assays by
promoting the formation of repetitive sequence bridges between
probes and unrelated, labeled genomic targets. It also contains lc
and sc sequences that compete with labeled targets for probe sites.
A more extensive genome-wide analysis is warranted to identify
other genomic regions that are more likely to be susceptible to
this source of systematic error.
[0097] The repetitive component in C.sub.ot-1 DNA is fractionated
based on reassociation kinetics rather than being explicitly
defined based on sequence composition. Because it is not
contaminated with lc sequences, sequence-defined synthetic
repetitive DNA is more effective at blocking cross-hybridization by
repetitive sequences in probes to paralogous repetitive genomic
targets. Another advantage of a locus-specific synthetic reagent is
that repeat families that are underrepresented in the C.sub.ot-1
DNA fraction, or not represented, due to divergence of repetitive
sequences, can be synthesized, providing a more accurate and
comprehensive repertoire of genomic repeat sequences free of sc
sequences.
[0098] Nevertheless, replacement of C.sub.ot-1 with a synthetic
repetitive DNA reagent that comprehensively represents all known
repetitive elements throughout the genome is probably precluded
based on the cost and logistical challenges inherent in its
preparation. It may be possible to process C.sub.ot-1 further in
order to limit the amount of contaminating sc sequences that are
present. Reannealed repetitive sequences which comprise the
majority of double-stranded DNA in C.sub.ot-1 are linked to single
stranded sequences, which are themselves comprised of single copy
and non-overlapping repetitive components. Treatment of these mixed
duplex and single stranded structures with an obligatory processive
exonuclease, such as Mung Bean Nuclease or Lambda Exonuclease, will
trim single stranded sequences protruding from duplex DNA. These
enzymes should not cleave at mismatched nucleotides, which are
common among related members of the same repetitive sequence
family, within single stranded gapped intervals separated by base
paired sequences or at nicks in the duplex. This procedure will
digest single stranded repetitive sequences and single copy
intervals. This will particularly impact the representation of
repetitive elements which commonly show 5' (or 3') genomic
truncation, such as is seen in L1 retrotransposons.sup.11. Loss of
these sequences could be mitigated by addition of the corresponding
synthetic DNA reagents. It should be noted that this treatment of
C.sub.ot-1 DNA will not completely eliminate all sc sequences
because of the possibility that the sc sequences have reannealed,
however formation of such duplexes would not be favored by the
kinetics of the reaction.
[0099] In light of the above, substitution of a partially or
completely synthetic blocking reagent composed of defined
repetitive sequences in place of C.sub.ot-1 DNA should improve the
reproducibility of expression microarray and array comparative
genomic hybridization. This should ultimately lead to
standardization of experimental conditions in these widely-used
procedures.
REFERENCES
[0100] The following reference materials are hereby incorporated by
reference. [0101] 1. Oostlander, A., Meijer, G. & Ylstra, B.
(2004) Microarray-based comparative genomic hybridization and its
applications in human genetics. Clin. Genet., 66:488-95. [0102] 2.
Hijum, S. V. et al. (2005) A generally applicable validation scheme
for the assessment of factors involved in reproducibility and
quality of DNA-microarray data. BMC Genomics, 6:77. [0103] 3.
Bammler, T. et al. (2005) Standardizing global gene expression
analysis between laboratories and across platforms. Nature Methods,
2:351-6. [0104] 4. Sherlock, G. (2005) Of FISH and Chips. Nature
Methods, 2:329-330. [0105] 5. Dobbin, K. et al. (2005)
Interlaboratory Comparability Study of Cancer Gene Expression
Analysis Using Oligonucleotide Microarrays. Clinical Cancer
Research, 11:565-72. [0106] 6. Li, X., Weikuan, G., Mohan, S. and
Baylink, D. (2002) DNA Microarrays: Their use and misuse.
Microcirculation, 9:13-22. [0107] 7. Wren, J., Kulkarni, A.,
Joslin, J., Butow, R. and Garner, H. (2002) Cross-hybridization on
PCR-spotted microarrays. IEEE Engineering in Medicine and Biology,
71-75. [0108] 8. Marshall, E. (2004) Getting the noise out of gene
arrays. Science, 306:630-1. [0109] 9. Zakharkin, S., Kim, K.,
Mehta, T., Chen, L., Barnes, S., Scheirer, K., Parrish, R.,
Allison, D., and Page, G. (2005) Sources of variation in Affymetrix
microarray experiments. BMC Bioinformatics, 6:214-225. [0110] 10.
Britten, R. and Kohne, D. (1968) Repeated sequences in DNA.
Science, 161:529-540. [0111] 11. Rogan, P. K., Pan, J., and
Weissman, S. M. (1987) L1 repeat elements in the human epsilon-G
gamma globin gene intergenic region: sequence analysis and
concerted evolution within this family. Mol Biol Evol, 4(4):327-42.
[0112] 12. Carter, N., Fiegler, H. and Piper, J. (2002) Comparative
analysis of comparative genomic hybridization microarray
technologies: report of a workshop sponsored by the Wellcome Trust.
Cytometry, 49:43-8. [0113] 13. Newkirk, H., Miralles, M., Rogan, P.
and Knoll, J. (2006) Determination of genomic copy number with
quantitative microsphere hybridization. Human Mutation 27:376-386.
[0114] 14. Rogan, P., Cazcarro, P. and Knoll, J. (2001)
Sequence-based design of single-copy genomic DNA probes for
fluorescence in situ hybridization. Genome Research, 11:1086-94.
[0115] 15. Rogan, P. and Knoll, J. (2003) Sequence-based in situ
detection of chromosomal abnormalities at high resolution. American
Journal of Medical Genetics, 121:245-57. [0116] 16. Knoll J., Rogan
P. (2004) Single Copy Genomic Hybridization Probes and Method of
Generating Same. U.S. Pat. No. 6,828,097. [0117] 17. Knoll, J. and
Lichter, P. In situ hybridization to metaphase chromosomes and
interphase nuclei. (2005) In Dracopoli N., Haines J., Korf B., Moir
D., Morton C., Seidman C., Seidman J., Smith D. (eds): "Current
protocols in Human Genetics Volume 1" Unit 4.3, Green-Wiley, New
York. [0118] 18. Kent, W. (2002) BLAT--the BLAST-like alignment
tool. Genome Research, 12:656-64. [0119] 19. Dong, S. et al. (2001)
Flexible Use of High-Density Oligonucleotide Arrays for
Single-Nucleotide Polymorphism Discovery and Validation. Genome
Research, 11:1418-1424. [0120] 20. Newkirk H., Knoll J., Rogan P.
Quantification of Microsphere Suspension Hybridization and Uses
Thereof. Application Serial No. PCT/US2006/032693, filed Aug. 16,
2006.
Sequence CWU 1
1
26124DNAHomo sapiens 1gtggcttatg cctgtaattt caca 24224DNAHomo
sapiens 2agagacaggg tcttcttatg ttgc 24332DNAHomo sapiens
3atttggaaag attatatcca tctacttaat gc 32430DNAHomo sapiens
4acaaacctac ctacgtttca acactctctt 30530DNAHomo sapiens 5gctttatgaa
ctagctgatt tagtttgctc 30632DNAHomo sapiens 6ctcaatctct cttttatctg
ttttgtccat tg 32731DNAHomo sapiens 7tagttaattt agaaggttta
aatcacgaga a 31829DNAHomo sapiens 8ctaattttta aatgtgtgaa tgcaatttt
29924DNAHomo sapiens 9cagaggaagg aagacgtagt gaac 241020DNAHomo
sapiens 10gctgaaccaa gcagacacag 201122DNAHomo sapiens 11atgggagctt
ggataagaga tg 221224DNAHomo sapiens 12ctataccctg aggcgataat gttc
241324DNAHomo sapiens 13agcagatcag acatacaggt ccaa 241422DNAHomo
sapiens 14ggccaccgta agttacaaga cc 221525DNAHomo
sapiensmisc_feature(1)..(1)12 carbons and an amine are conjugated
at the 5 prime end 15cctcttcggg gtagagtttc gctct 251625DNAHomo
sapiens 16ctcaggccct tgtcacactc ttgaa 251720DNAHomo sapiens
17ctcctgtccg tgttctctgc 201820DNAHomo sapiens 18aggctggtag
tgacctgtgg 201920DNAHomo sapiens 19tcacccccat tgcatctatt
202020DNAHomo sapiensmisc_feature(20)..(20)biotin conjugated to the
3 prime end 20taggaagggg gtagggagtg 202120DNAHomo sapiens
21tcacccccat tgcatctatt 202220DNAHomo sapiens 22tcccaaagtg
ctaggattgc 202324DNAHomo sapiens 23tgcaattcaa aacagattga aaat
242424DNAHomo sapiensmisc_feature(24)..(24)bioton conjugated to the
3 prime end 24ccaccatgtg agaagtttga ctac 242524DNAHomo sapiens
25aagtgtgaaa ggcatatttt agcc 242624DNAHomo sapiens 26tacattttgg
ggtcatttgt tatg 24
* * * * *
References