Process For Producing Exogenous Protein In The Milk Of Transgenic Mammals And A Process For Purifying Proteins Therefrom

Melo; Carlos Alberto ;   et al.

Patent Application Summary

U.S. patent application number 12/781500 was filed with the patent office on 2011-03-24 for process for producing exogenous protein in the milk of transgenic mammals and a process for purifying proteins therefrom. This patent application is currently assigned to Sterrenbeld Biotechnologie North America, Inc.. Invention is credited to Lino Baranao, Cesar Horacio Carbonetto, Carlos Alberto Melo.

Application Number20110072526 12/781500
Document ID /
Family ID34427057
Filed Date2011-03-24

United States Patent Application 20110072526
Kind Code A1
Melo; Carlos Alberto ;   et al. March 24, 2011

PROCESS FOR PRODUCING EXOGENOUS PROTEIN IN THE MILK OF TRANSGENIC MAMMALS AND A PROCESS FOR PURIFYING PROTEINS THEREFROM

Abstract

The invention relates to a method of producing a protein of interest, comprising making a non-human transgenic mammal that produces said protein in its milk, obtaining said milk from the non-human transgenic mammal and purifying said protein of interest from the milk. Transgenic bovine animals were generated, which are able to produce human growth hormone in mammary glands. The method involves cloning of a genetic construct comprising the hGH gene and beta casein promoter sequences conveniently in an expression vector. It also includes transfection procedures into fetal bovine somatic cells, generally fibroblasts, and the nuclear transfer into enucleated bovine oocytes, generating thus transgenic embryos. The method also includes other procedures to generate transgenic embryos for further expansion of the transgenic herd, such as the subcloning of transgenic female bovines, the superovulation of transgenic cows and their insemination with semen from a non-transgenic or a transgenic male bovine, and the superovulation of non-transgenic cows and their insemination with semen from a transgenic male bovine. Afterwards, transgenic embryos give rise to transgenic cattle that produce human growth hormone in huge amounts in their milk, from which the hormone is completely purified and analysed to fulfill all the requirements for the manufacture of a pure biopharmaceutical product.


Inventors: Melo; Carlos Alberto; (Prov. de Buenos Aires, AR) ; Baranao; Lino; (Ciudad de Buenos Aires, AR) ; Carbonetto; Cesar Horacio; (Ciudad de Buenos Aires, AR)
Assignee: Sterrenbeld Biotechnologie North America, Inc.
Wilmington
DE

Family ID: 34427057
Appl. No.: 12/781500
Filed: May 17, 2010

Related U.S. Patent Documents

Application Number Filing Date Patent Number
10952377 Sep 29, 2004 7718845
12781500
11822985 Jul 11, 2007
10952377
10952377 Sep 29, 2004 7718845
11822985
60556026 Mar 25, 2004
60556027 Mar 25, 2004
60506735 Sep 30, 2003
60506736 Sep 30, 2003

Current U.S. Class: 800/7
Current CPC Class: C12N 15/8509 20130101; A01K 67/0275 20130101; C12N 2830/008 20130101; A01K 2267/01 20130101; C07K 14/61 20130101; A01K 2227/101 20130101; A01K 2217/05 20130101; C12N 15/8771 20130101
Class at Publication: 800/7
International Class: C12P 21/00 20060101 C12P021/00

Claims



1.-29. (canceled)

30. A method of purifying a recombinant growth hormone from milk of a non-human transgenic mammal of bovine species that produces a recombinant growth hormone in its milk, wherein said mammal produces increased growth hormone in its serum over a nontransgenic mammal of bovine species comprising: a) clarifying the milk of said non-human transgenic mammal, resulting in a clarified milk; and b) subjecting said clarified milk to chromatography, resulting in purified recombinant growth hormone.

31. The method of claim 30, wherein said chromatography is ion exchange chromatography, reverse phase chromatography, molecular exclusion chromatography or affinity chromatography.

32. The method of claim 31, wherein multiple chromatography steps are performed.

33. The method of claim 31, wherein said ion exchange chromatography is anion exchange chromatography.

34. The method of claim 31, wherein the affinity chromatography is immunochromatography.

35. The method of claim 31, further comprising a concentration step.

36. (canceled)

37. A method of purifying a recombinant growth hormone from milk of a non-human transgenic mammal of bovine species that produces a recombinant growth hormone in its milk, wherein said mammal produces increased growth hormone in its serum over a nontransgenic mammal of bovine species comprising: a) clarifying milk obtained from a transgenic mammal, resulting clarified milk; b) subjecting said clarified milk to immunoaffinity chromatography, resulting in an immunoaffinity chromatographed material; c) subjecting said immunoaffinity chromatographed material reverse phase chromatography, resulting in a reverse phase chromatographed material; d) subjecting said reverse phase chromatographed material to anionic exchange chromatography, resulting in an anionic exchange chromatographed material; e) subjecting said anionic exchange chromatographed material to molecular exclusion chromatography, resulting in a molecular exclusion chromatographed material; f) subjecting said molecular exclusion chromatographed material to concentration, resulting in a concentrated material; and g) subjecting said concentrated material to molecular exclusion chromatography, resulting in pure recombinant growth hormone.

38. The method of claim 37, wherein said growth hormone is a mammalian growth hormone.

39. The method of claim 38, wherein said mammalian growth hormone is human growth hormone, bovine growth hormone, porcine growth hormone, ovine growth hormone, caprine growth hormone or rodent growth hormone.

40. The method of claim 39, wherein said mammalian growth hormone is human growth hormone.

41. The method of claim 40, wherein said mammal produces human growth hormone at a level of at least about 1.0 g hGH/L milk.

42. The method of claim 41, wherein said mammal produces human growth hormone at a level of at least about 2.0 g hGH/L milk.

43. The method of claim 42, wherein said mammal produces human growth hormone at a level of at least about 3.0 g hGH/L milk.

44. The method of claim 43, wherein said mammal produces human growth hormone at a level of at least about 4.0 g hGH/L milk.

45. The method of claim 44, wherein said mammal produces human growth hormone at a level of at least about 5.0 g hGH/L milk.

46. The method of claim 45, wherein said mammal produces human growth hormone at a level of at least about 6.0 g hGH/L milk.

47.-48. (canceled)
Description



BACKGROUND OF THE INVENTION

[0001] Protein factors and hormones involved in human health care have been currently produced by pharmaceutical industry by extraction or by recombinant technology in the last decades. Expression of genetic constructs involving the desired genes were successfully expressed in bacteria, yeast or mammalian cell lines. However, the use of mammalian cell cultures to obtain complex proteins, such as those which require a proper glycosylation pattern, involves high cost procedures.

[0002] Recombinant DNA technology has been used increasingly over the past decade for the production of commercially important biological materials. To this end, the DNA sequences encoding a variety of medically important human proteins have been cloned. These include insulin, plasminogen activator, alpha1-antitrypsin and coagulation factors VIII and IX. At present, even with the emergent recombinant DNA techniques, these proteins are usually purified from blood and tissue, an expensive and time consuming process which may carry the risk of transmitting infectious agents such as those causing AIDS and hepatitis.

[0003] Although the expression of DNA sequences in bacteria to produce the desired medically important protein looks an attractive proposition, in practice the bacteria often prove unsatisfactory as hosts because in the bacterial cell foreign proteins are unstable and are not processed correctly.

[0004] Recognizing this problem, the expression of cloned genes in mammalian tissue culture has been attempted and has in some instances proved a viable strategy. However, batch fermentation of animal cells is an expensive and technically demanding process.

[0005] There is therefore a need for a high yield, low cost process for the production of biological substances such as correctly modified eukaryotic polypeptides. The absence of agents that are infectious to humans would be an advantage in such a process.

[0006] The possibility of obtaining transgenic animals, like cattle, for a desired gene, with the aim of getting large amounts of a human protein in milk, has been of great interest to the industry. Several groups in the literature report their success on producing human serum albumin, alpha anti-trypsin, and some other examples in transgenic cows or goats.

[0007] Many experiments have been previously performed in mice or rats, and transgene expression was always preferred to be confined to the mammary glands since beta casein or lactalbumin promoters were employed, which respond only to mammary gland transcription factors in lactating females.

[0008] The expression of a heterologous protein exclusively in milk is meant to avoid undesired influence on the host animal health and provide an easy method for purification.

[0009] People are now devoted to set up several systems to improve the yield of cell transfection or selection, and choose the source of homologous fetal somatic cell to improve survival and immunity conditions of cloned animals.

[0010] On the other hand, there is enormous interest in somatic cell nuclear transfer, mainly to make possible the propagation of elite domestic animals and engineering of transgenic animals, for agricultural and biomedical purposes. Briefly, nuclear transfer (NT) involves the enucleation of a recipient oocyte, followed by the transfer of donor cell to the perivitelline space in close apposition of the recipient cytoplast, and their fusion. Development is induced artificially by chemical or physical activation. Production of cloned offspring by somatic cell nuclear transfer has been successfully attained in sheep (Campbell, K. H., et al., Nature 380:64-66 (1996), 1996; Wells, D. N., et al., Biol Reprod 57:385-393 (1997); Wilmut, I., et al, Nature 385:810-813 (1997)); goat (Baguisi, A., et al., Nat Biotechnol 17:456-461 (1999)) and in cow (Cibelli, J. B., et al., Science 280:1256-1258 (1998); Kato, Y., et al., Science 282:2095-2098 (1998); Wells, D. N., et al., Reprod Fertil Dev 10:369-378 (1998)).

[0011] There are several factors that influence the results of NT including the methods of enucleation, fusion, activation and donor-recipient cell cycle synchrony. High efficiencies in enucleation of recipient oocytes have been achieved using DNA specific vital dyes to visualize chromatin (Stice, S. L., and Keefer, C. L., Biol Reprod 48:715-719 (1993); Westhusin, M. E., et al., J Reprod Fertil 95:475-480 (1992)). Fusion of the donor cell with the recipient oocyte depends on the accuracy of cell alignment in the pulse field, contact of the donor cell with the recipient oocyte and size of the donor cells (Collas, P., et al., Anal Biochem 208:1-9 (1993)). Activation of NT reconstructed embryo has been refined and rates of development to blastocysts are equivalent to in vitro fertilized oocytes (Liu, L., et al., Mol Reprod Dev 49:298-307 (1998)).

[0012] Successful development of NT embryos has been accomplished using mature oocytes (Willadsen, S. M., Nature 320:63-65 (1986)), zygotes (McGrath, J., and Solter, D., Dev Biol NY 4:37-55 (1985)), and cleavage-stage embryos (Tsunoda, Y., et al., J Reprod Fertil 96:275-281 (1992)) as recipient cytoplasts; however, this is dependent on the source of the donor nucleus. Compatibility of the cell cycle between the recipient cytoplasts and the donor cells is one of the important factors that influence the development of NT embryos. Appropriate synchronization is necessary to preserve the ploidy of the reconstituted embryo.

[0013] The mitotic cell cycle has the following consecutive phases: pre-replication gap (G.sub.1), synthesis of DNA (S), pre-mitotic gap (G.sub.2) and mitosis (M). During a single cell cycle, all genomic DNA replicates once prior to mitosis. An interphase donor nucleus transferred into an enucleate mature oocyte (metaphase II) undergoes several morphological changes. After fusion, but prior to donor nuclear envelope breakdown (NEBD), the chromosome condenses (PCC). These changes are induced by the activity of maturation/mitosis/meiosis-promoting factor (MPF) and mitogen-activated protein kinase (MAPK) (Collas, P., and Robl, J. M., Biol Reprod 45:455-465 (1991)). MPF and MAPK activities are found in all meiotic and mitotic cells and are highest at metaphase and in mammalian oocytes these high levels also induce arrest in metaphase II. Reduction of MPF and MAPK by fertilization or activation with calcium ionophore is the signal for completion of meiosis, second polar body emission, sperm nucleus decondensation and pronuclear formation.

[0014] The direct effect of NEBD and PCC on donor chromatin is dependent on the cell cycle of the donor nucleus at the time of the transfer. Diploid G.sub.0/G.sub.1 nuclei condense to form single chromatids, but tetraploid G.sub.2 nuclei condense to form double chromatids. However, nuclei in S phase at the time of the transfer show a characteristic "pulverized" appearance; PCC produces extensive DNA damage. Therefore, correct ploidy can be produced by transferring a G.sub.1 or G.sub.0 nuclei into metaphase II oocytes at the time of activation or before. A second method is to transfer nuclei in previously activated oocyte, in S phase, in this case is possible to use a donor cell in G.sub.1, G.sub.0 or S phase. Because MPF and MAPK are low; the chromatin decondenses, and undergoes DNA replication without PCC and NEBD.

[0015] A third synchronization scheme has been reported in mice, where development of a live offspring was produced by embryo reconstruction using a G.sub.2 or metaphase donor cell and an enucleated metaphase 2 oocyte (Cheong, H. T., et al., Biol Reprod 48:958-963 (1993); Kwon, O. Y., and Kono, T., Proc Natl Acad Sci USA 93:13010-13013 (1996)). The extrusion of a polar body from the NT reconstructed embryo was reported, resulting in single diploid embryo and a diploid polar body (Kwon, O. Y., and Kono, T., Proc Nail Acad Sci USA 93:13010-13013 (1996)). However, there is no report of polar body formation after NT into enucleated MII oocytes in cattle, sheep or pigs, suggesting differences between species in the mechanics controlling formation of intact spindles and extrusion of polar bodies.

[0016] The cell cycle stages of the donor cell and the recipient have been suggested to be also important to reprogram the donor cell nuclei. Increasing the time between donor nuclei transfer and zygotic transcription may improve nucleus reprogramming. For this reason, several authors activated the oocyte several hours after fusion (Cibelli, J. B., et al., Science 280:1256-1258 (1998); Wakayama, T., et al., Nature 394:369-374 (1998); Wells, D. N., et al., Biol Reprod 60:996-1005 (1999)). Other reports applied sequential nuclear transfer (Stice, S. L., and Keefer, C. L., Biol Reprod 48:715-719 (1993)).

[0017] An unexplored procedure to increase the time of donor nucleus reprogramming is by nuclear transfer before metaphase II. After germinal vesicle breakdown (GVBD), all the nuclei events are regulated by a substantial increase in oocyte cytosolic MPF and MAPK, which prevent reconstruction of the nuclear envelope and entrance in the S phase until fertilization or activation. Therefore, a maturing oocyte may be a universal recipient for metaphase or G.sub.2 donor cell. Even G.sub.1 or G.sub.0 can be used as donor cells if activation induces an S phase before cell division.

[0018] When blastomeres in G.sub.2 or M are used as donor cells, nuclear reprogramming is possible (Cheong, H. T., et al., Biol Reprod 48:958-963 (1993); Kwon, O. Y., and Kono, T., Proc Natl Acad Sci USA 93:13010-13013 (1996); Liu, L., et al., Mol Reprod Dev 47:255-264 (1997)). One explanation is that some factors are displaced from the chromatin as a result of chromosome condensation. In fact, for nuclear transfer, NEBD and PCC have been considered morphological signs of nucleus reprogramming. Additionally, at the time of fertilization sperm chromatin is extremely condensed, and its volume is considerably smaller than that of nuclei of somatic cells, and oocyte has the ability to remove sperm nuclear protein. Oocyte chromosomes, during sperm-oocyte fusion, are also condensed. It is possible that condensed chromatin conformation may have some biological relevance. Consequently, by mimicking this situation by metaphase nuclear transfer, a metaphase-enucleated recipient could improve NT result. However, few researchers have used this approach in domestic animals and using blastomeres as donor cells (Liu, L., et al., Mol Reprod Dev 47:255-264 (1997)).

[0019] One goal of this invention is to characterize and refine existing somatic cell nuclear transfer to a reliable and economical technique to produce genetically identical calves from adult donor cells.

SUMMARY OF THE INVENTION

[0020] The invention relates to a non-human transgenic mammal characterized by the production of unexpectedly high levels of a recombinant growth hormone in its milk. The recombinant growth hormone may be, but is not limited to, human growth hormone. The non-human transgenic mammal may be, but is not limited to, an animal of bovine species.

[0021] The invention further relates to a plasmid that provides the expression of a protein of interest in the mammary cells of mammals in which the expression is regulated by the beta casein promoter. The protein of interest may be, but is not limited to, human growth hormone.

[0022] The invention also relates to different methods of making a non-human transgenic mammal that produce a recombinant growth hormone in its milk. The recombinant growth hormone may be, but is not limited to, human growth hormone. The non-human transgenic mammal may be, but is not limited to, an animal of bovine species.

[0023] The invention also relates to a method of producing a protein of interest, comprising making a non-human transgenic mammal that produces said protein in its milk, obtaining said milk from the non-human transgenic mammal and purifying said protein of interest from the milk. The protein of interest may be, but is not limited to, human growth hormone. The non-human transgenic mammal may be, but is not limited to, an animal of bovine species.

[0024] The invention also relates to a method of producing and purifying a recombinant growth hormone from the milk of a transgenic mammal. The recombinant growth hormone may be, but is not limited to, human growth hormone. The transgenic mammal may be, but is not limited to, an animal of bovine species.

BRIEF DESCRIPTION OF THE FIGURES

[0025] FIGS. 1A-1C show the daily milk volume collected from a transgenic cow obtained by the fusion of an enucleated oocyte and a fibroblast previously transfected with a plasmid containing the gene which encodes the human growth hormone (hGH) and a promoter that directs its expression to mammary cells.

[0026] FIGS. 2A-2C show the bacteria count found in the milk collected from the same transgenic cow.

[0027] FIGS. 3A-3B show the biological activity of the hGH contained in the milk of the same transgenic cow.

[0028] FIG. 4A shows the daily mass of hGH produced in the milk of the same transgenic cow. This magnitude and the daily milk volume collected from the transgenic cow are plotted together in FIG. 4B.

[0029] FIG. 5A shows the concentration of hGH and insulin-like growth factor-1 (IGF-1) in the serum of the same transgenic cow, and the daily mass of hGH produced in the milk of the same transgenic cow. The concentration of hGH in the transgenic cow's serum and the daily mass of hGH produced in the milk of the transgenic cow are plotted together in FIG. 5B. In FIG. 5C, the time profiles of the transgenic cow's serum concentrations of hGH and IGF-1 are plotted together.

[0030] FIGS. 6A and 6B show the serum concentration of hGH and insulin-like growth factor-1 (IGF-1) in two transgenic calves obtained by subcloning of a cow which is transgenic for the production of hGH in its milk. In FIGS. 6C and 6D, the time profiles of serum concentrations of hGH and IGF-1 are plotted together for each of these transgenic calves.

DETAILED DESCRIPTION OF THE INVENTION

[0031] The invention relates to a non-human transgenic mammal characterized by the production of unexpectedly high levels of a recombinant growth hormone in its milk. This mammal may be, but is not limited to, an animal of bovine species. Other species of transgenic mammals may be, but are not limited to, porcine species, ovine species, caprine species, or rodent species.

[0032] The recombinant growth hormone can be, but is not limited to, human growth hormone. This molecule, also known as somatotropin, is a protein consisting in 191 amino acids, with a molecular weight of about 22 kD. It is essential for linear growth and its applications are well established.

[0033] The invention also relates to a transgenic mammal, characterized by the fact that the recombinant growth hormone produced in its milk self-stimulates the animal's mammary glands in order to produce more milk containing said hormone.

[0034] The invention also relates to a plasmid comprising a gene encoding a protein of interest operably linked to a beta casein promoter and a 13 lactamase gene. This protein of interest can be, but is not limited to, human growth hormone. This plasmid can be pR.beta.hGH.

[0035] In a further embodiment, the plasmid additionally includes a neomycin resistance gene for selection of geneticin resistant cells. An example of such plasmid is pRNeo.

[0036] In a further embodiment, the plasmid includes the gene coding for a green fluorescent protein such as GFP, which is under control of the cytomegalovirus (CMV) promoter. An example of such a plasmid is pRNeoGreen.

[0037] The invention further relates to a plasmid such us those described above, which has been linearized by restriction digestion. In particular, use of restriction enzime ApaLI is employed and the .beta. lactamase gene is excised.

[0038] The deposit procedure under the Budapest Treaty of the plasmids mentioned above is under way. The name and address of the depository are DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH, Mascheroder Weg 1b, 38124 Braunschweig, Germany. The correspondent accession numbers will be provided in due course.

[0039] The invention further relates to the plasmid constructed on basis of a Neo resistance gene-containing plasmid, into which a modified shorter beta casein promoter region was inserted upstream a hGH coding region, such as pVE.beta.cashGH. A linear fragment may be obtained from the plasmid pVE.beta.cashGH by excising the beta lactamase gene.

[0040] The plasmids pRhGH, pRNeo and pRNeoGreen were deposited under the terms of the Budapest Treaty. The name and address of the depository are DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH, Mascheroder Weg 1b, 38124 Braunschweig, Germany. pRhGH was deposited at the DSMZ on Oct. 1, 2004 and given DSMZ Deposit Number DSM 16763. pRNeo was deposited at the DSMZ on Oct. 1, 2004 and given DSMZ Deposit Number DSM 16764. pRNeoGreen was deposited at the DSMZ on Oct. 1, 2004 and given DSMZ Deposit Number DSM 16765.

[0041] Methods of selection of neomycin resistant cells in appropriate media are also described, as are methods of selecting green fluorescent transgenic cells. These cells are picked carefully, so as to avoid cell damage.

[0042] The invention also relates to a method of nuclear transfer of cells arrested in G.sub.0, or at different times of the cell cycle, into enucleated bovine oocytes.

[0043] The invention relates to a method of transgenic embryo transfer into hormone stimulated cow uteri.

[0044] According to the invention, a method of determining animal health parameters is disclosed. Analyses are performed on both the animal's serum and milk in order to determine such parameters.

[0045] The invention further relates to a method of making a non-human transgenic mammal comprising obtaining a gene which encodes a growth hormone, cloning the gene into a plasmid whereby the gene is operably linked to a promoter that will direct the expression of the gene in mammary cells, resulting in an expression plasmid, transfecting somatic cells with the expression plasmid so that the plasmid is incorporated into the genome of the cells, resulting in transgenic somatic cells, enucleating a mature oocyte, resulting in an enucleated oocyte, fusing one transgenic somatic cell with the enucleated oocyte resulting in a monocell embryo, implanting the embryo in the uterus of a receptive mammal, and monitoring the pregnancy through the birth of the transgenic mammal.

[0046] The invention further relates to a method of making a non-human transgenic mammal comprising extracting somatic cells from a female mammal which is transgenic for the production of a recombinant growth hormone in its milk, optionally fibroblasts, enucleating a mature oocyte, resulting in an enucleated oocyte, fusing one transgenic somatic cell with the enucleated oocyte resulting in a monocell embryo, implanting the embryo in the uterus of a receptive mammal, and monitoring the pregnancy through the birth of the transgenic mammal.

[0047] The invention further relates to a method of making a non-human transgenic mammal comprising superovulating a female non-human mammal which is transgenic for the production of a recombinant growth hormone in its milk, artificially inseminating the mammal with semen obtained from a male non-human, non-transgenic mammal, to produce embryos, collecting the embryos, implanting the embryos in the uterus of a receptive mammal, and monitoring the pregnancy through the birth of the transgenic mammal.

[0048] The invention further relates to a method of making a non-human transgenic mammal comprising superovulating a female non-human mammal which is transgenic for the production of a recombinant growth hormone in its milk, artificially inseminating the mammal with semen obtained from a male non-human mammal which is transgenic for the production of said recombinant growth hormone, to produce embryos, collecting the embryos, implanting the embryos in the uterus of a receptive mammal, and monitoring the pregnancy through the birth of the transgenic mammal.

[0049] The invention further relates to a method of making a non-human transgenic mammal comprising superovulating a female non-human, non-transgenic mammal, artificially inseminating the mammal with semen obtained from a male non-human mammal which is transgenic for the production of a recombinant growth hormone, to produce embryos, collecting the embryos, implanting the embryos in the uterus of a receptive mammal, and monitoring the pregnancy through the birth of the transgenic mammal.

[0050] The recombinant growth hormone may be, but is not limited to, human growth hormone. The non-human transgenic mammal may be, but is not limited to, an animal of bovine species.

[0051] The invention further relates to a method to produce a protein comprising making a non-human transgenic mammal that produces a protein of interest in unexpectedly high yields in its milk, obtaining the milk from the non-human transgenic mammal, and purifying the protein of interest from the milk.

[0052] The invention also relates to a method to produce a protein of interest in a non-human transgenic mammal made by a process comprising obtaining a gene which encodes said protein of interest, cloning the gene into a plasmid whereby the gene is operably linked to a promoter that will direct the expression of the gene in mammary cells, resulting in an expression plasmid, transfecting somatic cells, optionally fibroblasts, with the plasmid so that the plasmid is incorporated into the genome of said somatic cells, resulting in transgenic somatic cells, enucleating a mature oocyte, resulting in an enucleated oocyte, fusing one transgenic somatic cell with the enucleated oocyte resulting in a monocell embryo, implanting the embryo in the uterus of a receptive mammal, and monitoring the pregnancy through the birth of the transgenic mammal.

[0053] The invention further also relates to a method to produce a protein of interest in a non-human transgenic mammal made by a process comprising extracting somatic cells from a female mammal which is transgenic for the production of said protein of interest in its milk, optionally fibroblasts, enucleating a mature oocyte, resulting in an enucleated oocyte, fusing one transgenic somatic cell with the enucleated oocyte resulting in a monocell embryo, implanting the embryo in the uterus of a receptive mammal, and monitoring the pregnancy through the birth of the transgenic mammal

[0054] The invention also relates to a method to produce a protein of interest in a non-human transgenic mammal made by a process comprising superovulating a female non-human mammal which is transgenic for the production of said protein of interest in its milk, artificially inseminating the mammal with semen obtained from a male non-human, non-transgenic mammal, to produce embryos, collecting the embryos, implanting the embryos in the uterus of a receptive mammal, and monitoring the pregnancy through the birth of the transgenic mammal.

[0055] The invention also relates to a method to produce a protein of interest in a non-human transgenic mammal made by a process comprising superovulating a female non-human mammal which is transgenic for the production of said protein of interest in its milk, artificially inseminating the mammal with semen obtained from a male non-human mammal which is transgenic for the production of said protein of interest, to produce embryos, collecting the embryos, implanting the embryos in the uterus of a receptive mammal, and monitoring the pregnancy through the birth of the transgenic mammal.

[0056] The invention also relates to a method to produce a protein of interest in a non-human transgenic mammal made by a process comprising superovulating a female non-human, non-transgenic mammal, artificially inseminating the mammal with semen obtained from a male non-human mammal which is transgenic for the production of said protein of interest, to produce embryos, collecting the embryos, implanting the embryos in the uterus of a receptive mammal, and monitoring the pregnancy through the birth of the transgenic mammal.

[0057] The transgenic mammals characterized by the production of unexpectedly high levels of a protein of interest in their milk, can be, but are not limited to, animals of bovine species. Other species of transgenic mammals may be, but are not limited to, porcine species, ovine species, caprine species or rodent species. The protein of interest can be, but is not limited to, human growth hormone.

[0058] The invention further relates to a non-human transgenic mammal of bovine species that produces recombinant human growth hormone in its milk, whose genome comprises an integrated plasmid, said plasmid comprising the human growth hormone gene and a beta casein promoter that directs expression of said gene in mammary cells of the mammal.

[0059] The invention further relates to a transgenic mammal that produces hGH in unexpectedly high levels, yet does not show the physical growth expected with such a high level of hGH production. Since transgenic bovines are affected by the presence of human growth hormones, it would be expected that the animals would grow beyond non-transgenic growth rates, and to suffer from conditions such as diabetes mellitus, hypertension, increased risk of cardiovascular disease and enlargement of body organs, including the liver, spleen, kidneys and heart. Such high levels of hGH should render the animal, theoretically, non-viable. However, this is not the case. A mammal, such as a cow, with alarmingly high levels of a foreign hormone in its blood, but which is perfectly healthy and yields an outstanding productivity of a recombinant protein constitutes an unexpected and innovative contribution.

[0060] The recombinant human growth hormone of the invention is produced at unexpectedly high levels. The level of human growth hormone produced is greater than about 1.0 g/L milk. The level of hGH can be greater than about 2.0 g/L milk. The level of hGH produced can also be greater than about 3.0 g/L milk. In another embodiment, the level of hGH produced can be greater than about 4.0 g/L milk. In yet another embodiment, the level of hGH produced can be greater than about 5.0 g/L milk. In a further embodiment, the level of hGH produced can be greater than about 6.0 g/L milk. In yet a further embodiment, the level of hGH produced is about 1.0 g/L milk to about 7.0 g/L milk. In a further embodiment, the level of hGH produced is about 2.0 g/L milk to about 6.0 g/L milk. In yet another embodiment, the level of hGH produced is about 2.0 to about 5.0 g/L milk.

[0061] Additionally, the invention relates to a method of purifying a recombinant growth hormone from the milk of a transgenic mammal, as well as assays of said hormone. The purification methods can include chromatography and concentration steps. Different types of chromatography can be employed and include ion exchange chromatography, reverse phase chromatography, molecular exclusion chromatography or affinity chromatography. The ion exchange chromatography can be anion exchange chromatography. The affinity chromatography can be immunoaffinity chromatography. Further, multiple chromatography steps may be performed.

[0062] The invention further relates to a method of purifying a recombinant growth hormone from milk of a non-human transgenic mammal that produces a recombinant growth hormone comprising clarifying the milk of a non-human transgenic mammal, resulting in a clarified milk, and subjecting the clarified milk to chromatography, resulting in purified recombinant growth hormone.

[0063] The invention further relates to a method of purifying a recombinant growth hormone from milk of a non-human transgenic mammal that produces a recombinant growth hormone comprising clarifying the milk of a non-human transgenic mammal, resulting in a clarified milk, subjecting the clarified milk to expanded-bed anion exchange chromatography, resulting in an anion exchange chromatographed material, subjecting the anion exchange chromatographed material to reverse phase chromatography, resulting in a reverse phase chromatographed material, subjecting the reverse phase chromatographed material to anion exchange chromatography, resulting in an anion exchange chromatographed material, subjecting the anionic exchange chromatographed material to molecular exclusion chromatography, resulting in a molecular exclusion chromatographed material, concentrating the molecular exclusion chromatographed material, resulting in a concentrated material, and subjecting the concentrated material to molecular exclusion chromatography, resulting in pure recombinant growth hormone.

[0064] The invention also relates to a method of purifying a recombinant growth hormone from milk of a non-human transgenic mammal that produces a recombinant growth hormone comprising clarifying milk obtained from a transgenic mammal, resulting clarified milk, subjecting the clarified milk to immunoaffinity chromatography, resulting in an immunoaffinity chromatographed material, subjecting the immunoaffinity chromatographed material to reverse phase chromatography, resulting in a reverse phase chromatographed material, subjecting the reverse phase chromatographed material to anionic exchange chromatography, resulting in an anionic exchange chromatographed material, subjecting the anionic exchange chromatographed material to molecular exclusion chromatography, resulting in a molecular exclusion chromatographed material, subjecting the molecular exclusion chromatographed material to concentration, resulting in a concentrated material, and subjecting the concentrated material to molecular exclusion chromatography, resulting in pure recombinant growth hormone.

[0065] The recombinant growth hormone of the purification methods described above may be, but is not limited to, human growth hormone. The transgenic mammal may be, but is not limited to, a mammal of bovine species.

[0066] The following examples are illustrative, but not limiting, of the method and compositions of the present invention. Other suitable modifications and adaptations of the variety of conditions and parameters normally encountered in enzymatic production of chemicals and protein purification procedures which are obvious to those skilled in the art are within the spirit and scope of the invention.

Example 1

Construction of Expression Plasmids

[0067] We generated a construct bearing a large portion of the bovine beta casein gene promoter, including a short fragment of the 5' non-coding beta casein gene region, fused to the coding sequence of the human growth hormone gene. The beta casein region employed in different constructs was decreased from 3.8 kbp to about 1.3 kbp. The hGH gene encompasses about 2 to 2.2 kbp depending on whether the intrinsic polyA signal is included.

[0068] The expression cassette was accommodated in the polylinker of a usual cloning vector of the pUC or pBS type.

[0069] This promoter ensures the tissue specific and developmentally regulated expression of genes under its control, like beta casein, and the heterologous hGH in this case.

[0070] The most representative plasmid is pR.beta.hGH, which carries the full-length bovine beta casein promoter, fused to the coding sequence of the human growth hormone gene.

[0071] Other constructs disclosed are mainly derived from the original one, as depicted, to improve transfected cell selection or DNA integration efficiency into the bovine cell genome.

[0072] In the first period, co-transfection with a geneticin resistance gene-containing plasmid was performed to help selection, but next, other constructs were used, bearing NPT gene for neomycin resistance in the same vector containing the hGH expression cassette. An example of such plasmid is pRNeo.

[0073] Another plasmid for constitutive expression of green fluorescent protein was obtained, which includes the CMV promoter, an enhancer of vegetal origin (alfalfa), and the green fluorescent protein gene from the jellyfish A. victoria. An example of such plasmid is pRNeoGreen.

[0074] Besides, another plasmid was generated. This was constructed on basis of a Neo resistance gene-containing plasmid, into which a modified shorter beta casein promoter region was inserted upstream a hGH coding region. This plasmid is pVE.beta.cashGH.

[0075] Other constructs were generated in which the B lactamase region was excised by ApaLI restriction and the linear fragment containing the entire expression cassette was purified after agarose gel electrophoresis, and gel extraction.

[0076] Constructs were analyzed by restriction enzymes and DNA sequencing, and their ability to conduct hGH expression was previously tested in a mammary gland cell line by fluorescent antibody recognition.

[0077] The preparation of the plasmid pVE.beta.cashGH will be described in detail as an example of this part involving genetic constructs.

Preparation of pVE .beta.cashGH

[0078] The aim of this construct is to provide the minimal extension of beta casein promoter region to direct specific regulated transcription of the hGH gene fused immediately downstream, along with its polyA signal in a host organism.

[0079] The use of pVEX as the original vector permits the use of neomycin resistance gene regulated by a tk promoter already present in this plasmid. The early SV40 promoter comprising 554 by was eliminated by restriction with StuI and NdeI, and the last site filled in with Klenow, and self-ligation of the resulting vector.

[0080] Beta casein short promoter was obtained after PCR amplification of a 1.3 kbp fragment from the 3.8 kbp original gene promoter region, by using the following oligos as primers:

TABLE-US-00001 (SEQ ID NO: 1) PB1 5' TCTACTCGAGGATCATCTATCTGTCCCAAAG and (SEQ ID NO: 2) PB2 5' CTAGGATCCAATGATCTGATTTTGTGG

This fragment encompasses 1230 by of the canonical promoter plus 49 by of the first non coding exon of the beta casein gene.

[0081] The hGH gene fragment was obtained by PCR techniques on the original bovine genomic hGH clone using the following oligos as primers:

TABLE-US-00002 (SEQ ID NO: 3) PB4 5'CTAGGATCCATGGCTACAGGTAAGCGCC and (SEQ ID NO: 4) GHTE 5' ATGCTGTGTCTGGACGTCCT

The beta casein promoter fragment was blunted with Klenow enzyme and inserted into the BamHI filled-in site of pVEX. After selecting recombinant clones, we chose a certain direction appropriate to use the unique HindIII site located downstream in pVEX to insert the hGH coding region.

[0082] To this aim, the hGH fragment was also blunted and the plasmid HindIII site was filled in as well. Clones were selected which contain beta casein promoter and hGH properly fused to express hGH only under the control of this promoter.

[0083] The size of this plasmid is about 8.5 kbp.

Transfection of Somatic Cells

[0084] The plasmids pRBhGH (along with another plasmid with the geneticin resistance gene), pRNeo, pRNeoGreen, or pVE.beta.cashGH were then used for transfecting a primary culture of somatic cells, using calcium phosphate or liposome method. Fetal calf fibroblasts were generally employed to be transfected.

[0085] The transfected cells were selected adding geneticin to the culture. After a period of 2 to 8 weeks, the cells that were resistant to geneticin were suitable for being used as donor cells to obtain transgenic clones. Transfected selected cells were analyzed by PCR to contain the expression cassette, to ensure the appropriate nuclei transfer to generate transgenic embryos.

Example 2

Oocyte Enucleation and Metaphase Nuclear Transfer in Mature Enucleated Oocytes

Collection and In Vitro Maturation of Bovine Oocytes

[0086] Bovine oocytes were aspirated from slaughterhouse ovaries and matured in TCM-199+5% FCS at 39.degree. C. for 24 hs. The maturation medium was equilibrated with CO.sub.2 for at least 2 hours prior to use. Mature oocytes were denuded by vortexing for 2 minutes in warm TL-HEPES with 1 mg/ml bovine testis hyaluronidase.

Nuclear Transfer with Cumulus Cells

Enucleation

[0087] Oocytes were mechanically enucleated using a Narishige hydraulic micromanipulators and Nikon Diaphot microscopy. Enucleation was performed with 20 .mu.m beveled and sharpened pipettes. Oocytes were previously stained with 5 .mu.g/ml bisbenzimidine (Hoechst 33342.sup.1) dye for 20 minutes. Metaphases were enucleated by visualization of the stained chromosomes under ultraviolet light. Metaphase chromosomes were assessed after aspiration inside the pipette. A transgenic somatic cell was transferred into the perivitelline space and tightly opposed to the enucleated oocyte. .sup.1 Sigma Chemical Co., St. Louis, Mo., USA.

Fusion

[0088] A transgenic somatic cell and an enucleated oocyte were manually aligned in the fusion chamber so that the membranes to be fused were parallel to the electrodes. This was done using a glass embryo-handling pipette.

Fusion by Electrical Means

[0089] Fusion was performed using one electrical pulse of 180 volts/cm for 15 .mu.s (BTX Electro Cell Manipulator 200).sup.2 and monitored with a BTX Optimizer-Graphic Pulse Analyzer. The chamber for pulsing embryos consisted of two 0.5 mm stainless steel wire electrodes mounted 0.5 mm apart on glass microscope slide. Presumptive zygotes were monitored for fusion, lysis, and fragmentation. .sup.2 BTX Inc., San Diego, Calif., USA.

Assessment of Developmental Competence

[0090] Zygotes were evaluated at 48 hours after fertilization for cleavage and after 7 to 9 days for development to morulae or blastocysts.

Example 3

Cell and Embryo Culture

[0091] Different donor cells, culture systems and oocyte recipient treatments were tested in an experiment aimed at simplifying procedures and increasing embryo survival rate in a bovine cloning program. Three culture systems for reconstructed embryos were used when adult fibroblasts were used as donor cells: TCM-199+5% FCS, Menezo+5% FCS (both with VERO cells as co-culture) and SOF without co-culture but with lower O.sub.2 concentration. SOF medium was also used to culture reconstructed embryos when donor cell were genetically and non-genetically modified fetal fibroblasts. Finally, when genetically modified fetal fibroblasts were used as donor cells, recipient oocytes were previously treated with roscovitine (R), to suspend meiosis and optimize recipient usability. Oocytes were aspirated from slaughterhouse ovaries and matured in TCM-199+5% FCS at 39.degree. C. for 24 hours. For R treated group, oocytes were incubated with 25 .mu.M R in TCM 199+5% FCS for 24 hours at 39.degree. C. prior to the maturation. Mature oocytes were denuded by vortexing for 3 minutes in TL HEPES with 1 mg/ml bovine testis hyaluronidase. Metaphases were assessed and oocytes were enucleated by visualization with Hoechst 33342 (5 .mu.g/ml) under UV light (<6 seconds). Adult fibroblasts from an Angus bull and fetal fibroblasts from a 45-day old Jersey female fetus were used as donor cells. Transfection with constructs containing neomycin resistance gene was performed using liposomes. After selection with geneticin for 10-15 days, donor cells at G.sub.0/G1 stages were fused to enucleated oocytes by an electrical pulse. After 3 hours, activation was induced by incubation in TL-HEPES with 5 .mu.M ionomycin for 4 min and 2 mM 6-DMAP for 3 hours. The oocytes were then washed with TL-HEPES and co-cultured in either TCM-199+5% FCS+10 g/l albumin or Menezo+2% FCS both with VERO cells, or in SOF medium and atmosphere of 5% CO.sub.2+5% O.sub.2+90% N.sub.2. Generally, two blastocysts were transferred non-surgically per recipient cow, and pregnancies at 30-35 days determined by ultrasonography. Cleavage (48 hours), development to blastocysts (days 7 to 9) were recorded and analyzed by Chi-square. Cleavage rates and development to blastocysts were higher when embryos were cultured in SOF. However, no differences were observed in pregnancy rates due to different culture conditions or source of donor cells. Suspension of meiotic maturation for 24 hours did not compromise the developmental competence of recipient oocytes. Therefore, treatment with roscovitine might be used to increase the availability of oocytes for NT procedures. See Table 1 below.

TABLE-US-00003 TABLE 1 im- planted Blastocyst recipi- Treatment n Cleavage (%) (%) ent Preg. (%) Adult 294 156 (53.9).sup.a 22 (7.5).sup.a 13 5 (38.4) fibroblast TC199 + VERO Adult 324 236 (72.3).sup.bc 29 (8.9).sup.a 17 5 (29.4) fibroblast Menezo + VERO Adult 108 81 (75.0).sup.bc 24 (22.2).sup.b 11 5 (45.4) fibroblast SOF Fetal 197 122 (61.9).sup.ab 33 (16.7).sup.ab 16 5 (31.6) fibroblast SOF Transfected 646 476 (73.7).sup.bc 128 (19.8).sup.b 56 25 (44.6) fetal fibroblast SOF Transfected 228 191 (83.7).sup.c 51 (22.3).sup.b 30 16 (53.3) fetal fibroblast SOF-R Total 1797 1262 (70.2) 287 (15.9) 143 61 (44.5)

Percentages within columns with different superscripts are different (P<0.05)

[0092] The implanted cows are allowed to normally pass the pregnancy up to a natural delivery. Eventually a chirurgic approach (Caesarea) could be used for delivery. The newborns are fed with Ig rich colostrum during the first 48 hours, and then synthetic, later natural (all of them free of animal origin compounds) foods are used.

Example 4

Tests Performed on Transgenic Calves and the Recombinant Protein Produced

[0093] In the current example, we present a full description of the tests performed on a particular transgenic calf, which was obtained as a result of the procedure described in Examples 1 to 3, and on the recombinant protein produced by it. Nonetheless, it should remain clear that the same set of assays is performed on animals that are born as a consequence of other methods for obtaining transgenic calves, such as those that will be described in Examples 5 and 6 below.

[0094] It was proved by means of PCR reactions performed on DNA purified from the calf's white blood cells, using DNA from non-transgenic jersey calves as the negative control, that bovine beta casein promoter and the hGH encoding gene are included in the transgenic calf cells genome. They can be found together as a unique DNA fragment different to the homologue beta casein gene of the animal.

[0095] It was corroborated, by using a Pharmacia automatic sequencer, that the inserted gene sequence corresponds 100% to the hGH encoding gene. It includes the introns, secretion signal and terminator. The bovine beta casein promoter that controls that same hGH gene expression in our calf was sequenced, too. All those elements coincide exactly with the expected theoretical sequence from the genetic construct used to transform the cells out of which the clones were generated.

[0096] Once known the exactitude of the genetic phase of the experiment, we passed to prove the recombinant protein produced is the expected one and coincides in every one of its physical and chemical characteristics with the natural hGH.

[0097] For this purpose, we had to obtain milk from the calf, since the beta casein promoter allows the expression of the recombinant protein only in the mammary glands, when the animal is at its milk producing time.

[0098] The transgenic calf was then induced by a hormone treatment to produce milk by the time it completed her tenth month. By that time the calf weighed 240 kg (approximately 530 lbs).

[0099] The first phase of said treatment involved the combined administration, by subcutaneous route, of estrogens (estradiol benzoate, Histeren.RTM., Instituto Rosenbusch) and progestagens (medroxyprogesterone acetate, Pronal.RTM., Aton), comprising 5 successive applications of each drug, in a dose of 0.1 mg/kg and 0.25 mg/kg, respectively, every 48 hours (i.e., on days 1, 3, 5, 7 and 9, assuming that the treatment commences on day 1).

[0100] The second phase comprised the administration, by subcutaneous route, of dexamethasone (Decadron, Sidus) and oxytocin (Orasthin.RTM., Hoechst Marion Roussel); a total amount of 20 mg of the former being injected over a period comprising days 18 to 20 (a third of said total mass each day), and 3 applications of 50 IU of the latter, on days 21 to 23.

[0101] The information above is summarized in Table 2:

TABLE-US-00004 TABLE 2 Day 1 2 3 4 5 6 7 8 9 10 (...) 17 18 19 20 21 22 23 Histeren (mg/kg) 0.10 0.10 0.10 0.10 0.10 Pronal (mg/kg) 0.25 0.25 0.25 0.25 0.25 Decadron (mg) 6.66* 6.66* 6.66* Orasthin (IU) 50 50 50 *Approximately a third of the total mass (20 mg) was administered each day

[0102] As expected, the cow commenced producing colostrum the day after the treatment had finished, and then, progressively, the quality of the produced fluid turned to milk. The collected fluid was properly stored and thoroughly analyzed.

[0103] Several tests, whose results are shown in FIGS. 1-4, were performed on the colostrum and milk (for simplicity, both colostrum and milk will be hereinafter referred to as "milk", except when a distinction should be made). First, the volume of the collected milk was measured. The initial milk productivity (first five lactating days) was approximately 1,650 mL/day. During the first productive month, two manual milkings per day were performed, one in the morning and one in the afternoon (the contribution of each udder to the final volume can be noticed); whereas from the second month forth, as the production of milk started to increase, three milkings per day were performed (in the morning, at noon, and in the afternoon). The daily volumes increased in a more or less continuous way, until reaching close to the 10,000 mL three months after the first milking. Detailed information regarding this topic (FIGS. 1A-1B) can be visualized in the curve of daily milk volume vs. date (FIG. 1C).

[0104] In parallel with the measurements of milk volume, microbiological assays were performed on the milk, whose results (FIG. 2A) are shown in the corresponding plots of CFU (Colony-forming units) per ml vs date and (FIGS. 2B-2C).

[0105] Biological activity (of hGH) was also assessed by a biological activity assay in vitro in NB2 cells culture (FIGS. 3A-3B). It was proved that the biological activity of the recombinant hGH produced in the heifer's milk is within the method's error rank, at the normal values for human natural hGH. Moreover, the obtained milk was studied by Western blot, in which a main band, corresponding to intact hGH, was detected. Additional minor bands corresponding to cleaved variants and aggregates were also found, as expected in these productive systems.

[0106] With the information regarding the biological activity and the daily volumes, it was possible to calculate the daily production of hGH using Equation 1, where mhGH is the daily produced mass of hGH in milligrams; BA, the biological activity in International Units; SA, the specific activity of hGH (3 IU/mg); and V, the daily volume of collected milk. The data is shown in FIG. 4A. A plot of the daily mass of hGH is shown in FIG. 4B. In order to establish a visual correlation between the daily mass of hGH and daily volume of milk, the latter was also plotted in FIG. 4B.

m hGH = BA SA .times. V ( Eq . 1 ) ##EQU00001##

[0107] As it can be observed from this information, the daily mass of hGH in milk and the daily volume of milk tend to augment as the cow develops (the former in a greater proportion, though), which constitutes an upward trend in the recombinant hormone productivity (grams of hGH per milk liter). It can be noticed that this productivity passed from around 2 g of hGH per liter (first milking), when the product was colostrum, to an average amount of 5 g hGH per milk liter from the second lactating month forth. Thus, an unexpectedly high yield of human growth hormone was obtained as productivity increased, in a way more or less continuous as the fluid quality turned from colostrum to milk.

[0108] Although at present the mass of hGH produced per day is outstanding indeed, it should be noted that, as the cow is not fully grown yet, the upward trend in mass of recombinant protein produced per day should continue in the future, until a maximum is reached.

[0109] In parallel with the tests performed on milk, a different set of assays were carried out on the cow's serum, whose results are shown in FIGS. 5A-5C. First, measurements of the concentration of hGH in the cow's serum were performed. The results (FIG. 5A) are plotted in a graphic together with the daily mass of hGH in milk, to allow a comparison of both magnitudes (FIG. 5B).

[0110] The reference range for GH in serum (in humans) is 0.06-5 ng/ml. Assuming a hypothetical similar range for bovines, it can be noticed that, except for the beginning, the whole curve of hGH in the transgenic cow's serum versus date lies well over the upper limit of said range. This fact notwithstanding, it must be taken into account that, although hGH and the corresponding bovine hormone (bGH) are very similar regarding their amino acid sequence and 3D-structure, the former, although fully functional, is not fully active in cattle.

[0111] Therefore, in order to assess the potential risk to the cow's health due to these high levels of hGH in its serum, measurements of serum concentration of IGF-1 (Insulin-like Growth Factor 1, also known as Somatomedin C) were performed in parallel (FIG. 5A). Growth hormone performs its functions primarily through IGF-1, which is made in the liver. Because IGF-1 mediates many of the in vivo cell division and metabolic effects of growth hormone, IGF-1 assessment is a valuable diagnostic tool for the indirect evaluation of suspected growth hormone disorders. Thus, IGF-1 represents a dependable indicator of bioavailable growth hormone. The results of these analyses are shown in FIG. 5C, together with the ones corresponding to hGH, to permit the simultaneous visualization of both magnitudes.

[0112] Moreover, IGF-1 and hGH were measured in the serum of a group of non-transgenic cows in order to have a control group and thus to establish a comparison with the data corresponding to the transgenic cow. The averages of the measurements of both proteins for the non-transgenic group and the transgenic cow are displayed in Table 3 below.

TABLE-US-00005 TABLE 3 Averages [IGF-1] in Serum [hGH] in serum Non-transgenic 123.40 0.28 Transgenic 484.02 656.98

[0113] It is worth noticing that the average serum concentration of hGH in the non-transgenic group lies within the hypothetical reference range, whereas the average for the transgenic cow is well over the upper limit of said range. Besides, it is undoubted that the average level of IGF-1 in the transgenic animal's serum is categorically higher than the one corresponding to non-transgenic cows, which constitutes a fundamental difference.

[0114] Therefore, although the high concentration of hGH in the transgenic cow's serum (which in humans is known to cause disorders with severe consequences, such as diabetes mellitus, hypertension, increased risk of cardiovascular disease and enlargement of body organs, including the liver, spleen, kidneys and heart) should render the animal, theoretically, non-viable, this would not be representing, apparently, an obstacle to its health and well being. A cow with alarmingly high levels of a foreign hormone in its blood, but which is perfectly healthy and yields an outstanding productivity of a recombinant protein constitutes an unexpected and innovative contribution.

[0115] Another innovative aspect of the present invention is that the recombinant hGH which enters the cow's bloodstream, stimulates the mammary gland to produce more milk. This effect is indirectly achieved, i.e., through the action of IGF-1. This molecule increases the blood flow through the mammary gland, providing critical precursors for the synthesis of milk fat, protein, and lactose. Thus, IGF-1 acts to direct nutrients through the blood to the cells in the udder where they aid in the production of milk. Therefore, a self-stimulating animal is attained, since the recombinant hGH produced in the milk of the transgenic cow is promoting a sustained increase in the volume of milk produced by the animal through the stimulation of its mammary gland, with the corresponding secretion of more hGH in its milk.

Example 5

Obtaining Transgenic Calves by Subcloning

[0116] Five samples of tissue from the ear of a transgenic calf were taken employing a 1.5-mm-diameter needle, whose end had been previously beveled for this purpose. The samples were shipped under refrigeration to the laboratory in a PBS-based medium containing antibiotics and antimycotics.

[0117] Afterwards, the tissue samples were incubated for 72 hours in MEM medium with 10% bovine fetal serum and antibiotics at 39.degree. C. and atmosphere of 5% CO.sub.2. Eventually, the tissue samples were removed, and fibroblasts at the periphery of the plate were allowed to grow until confluence. Once this had been achieved, the fibroblasts were incubated for at least 5 days without changing the culture medium in order to attain their synchronization in G.sub.0 stage, which was assessed by means of visualization with a microscopy.

[0118] After trypsinization, individual fibroblasts were fused with enucleated bovines oocytes according to Example 2, and embryos thus obtained were cultured in SOF medium and atmosphere of 5% CO.sub.2+5% O.sub.2+90% N.sub.2 up to the stage of blastocyst. Afterwards, generally two blastocysts were transferred non-surgically per recipient cow, and pregnancies were determined at 30-35 days by ultrasonography.

[0119] The implanted cows are allowed to normally pass the pregnancy up to a natural delivery. Eventually a chirurgic approach (Caesarea) could be used for delivery. The newborns are fed with Ig rich colostrum during the first 48 hours, and then synthetic, later natural (all of them free of animal origin compounds) foods are used.

[0120] FIGS. 6A and 6B show measurements of serum concentration of hGH and IGF-1 performed in parallel for two of the transgenic animals obtained by subcloning of a transgenic cow, and the results of these analyses are depicted in FIGS. 6C and 6D, respectively, to permit the simultaneous visualization of both magnitudes for each animal. Since at present the calves are young, the values for both hGH and IGF-1 still lie within the respective range of reference, but it is expected that they will rise the same way they did in the transgenic cow out of which these two clones were obtained.

Example 6

Obtaining Transgenic Calves by Artificial Insemination of a Superovulated Transgenic Cow

[0121] An alternative approach for obtaining transgenic bovines will be disclosed in this example. This method comprises superovulating a transgenic cow by means of a hormonal treatment; artificially inseminating said cow; recollecting the embryos thus generated; the implantation of said embryos in surrogate cows; and the development of the pregnancy up to the birth of the animals. A description of this procedure is presented below.

Superovulation

[0122] In the morning of day 1 (i.e., the day the procedure started), 150 .mu.g of prostaglandins (D(+)-clorprostenol, Arsaprost.RTM., Arsa) were administered to the transgenic cow by intramuscular route. The animal was subjected to a 4-kg daily diet containing approximately 15% of proteins (before day 1, the animal had been given 2 kg of food, with the same content of proteins). In the morning of day 8, a CIDR (controlled internal drug release) device of progesterone was placed intravaginally. Besides, 50 mg of progesterone and estradiol were administered by intramuscular route. The amount of food the animal was fed rose to 6 kg/day, with the same content of proteins. Then, two intramuscular injections of FSH and LH (PLUSET.RTM., Calier) were administered on days 12, 13 and 14 (one in the morning and the other in the afternoon). The following day (day 15), the treatment went on with the administration, by intramuscular route, of two injections of PLUSET.RTM. (one in the morning and the other in the afternoon) and two injections of 150 .mu.g of prostaglandins each (same administration regimen). In the morning of day 16, the CIDR was removed. The total amount of PLUSET.RTM. administered throughout the superovulation phase was 350 IU.

Insemination

[0123] This phase comprised three successive administrations (the first and second, in the morning and in the afternoon of day 17, respectively, and the last, in the morning of day 18) of semen from a donor jersey bull, which had been obtained previously and kept frozen to preserve the viability of the spermatozoids.

Collection of Embryos and their Implantation in Surrogate Cows

[0124] The collection of embryos by flushing of both horns of the cow's uterus with 1 l of DMPBS (Nutricell.RTM.) took place in the morning of day 26. Immediately afterwards, two embryos were transferred non-surgically per recipient cow, and pregnancies were determined at 30-35 days by ultrasonography.

[0125] The implanted cows are allowed to normally pass the pregnancy up to a natural delivery. Eventually a chirurgic approach (Caesarea) could be used for delivery. The newborns are fed with Ig rich colostrum during the first 48 hours, and then synthetic, later natural (all of them free of animal origin compounds) foods are used.

[0126] Since the generation of biological offspring obeys Mendel's law, half of the animals being born as a consequence of the procedure described above should be transgenic, and, of these, half should be males and the other half, females. Therefore, there is a high probability of obtaining a transgenic male (founder animal), whose semen could be useful for setting up a Master Bank of jersey transgenic semen to be used for the insemination of superovulated transgenic/non-transgenic cows in order to expand the transgenic herd.

Example 7

Purification of Recombinant hGH from Milk

[0127] Once verified the approximate molecular weight, the Western blot results and the biological activity of the recombinant hGH produced in the calf s milk are correct, an exhaustive purification process was performed, for it is imperative, when manufacturing a biopharmaceutical product, that the protein of interest should be purified to homogeneity, in order to avoid the presence of possible contaminants in said product. This process comprised the steps of: obtaining the skim of the milk by means of centrifugation and dilution of the supernatant obtained to achieve a better solubility of recombinant hGH eventually retained in the micelles of casein (clarification); and passage of this solution through an expanded-bed anionic exchange chromatography column (an alternative to this step is the employ of an immunoaffinity column, see Example 8 below); the resulting solution is subdued to a reverse phase HPLC(C4) step; fractions rich in recombinant hGH are afterwards subjected to an anionic interchange chromatography.

[0128] Purified material is desalted, concentrated and subjected to molecular exclusion chromatography. This separates by a molecular weight in order to obtain the pure recombinant hGH.

[0129] The procedure for the purification of human growth hormone (hGH) from milk comprises the following steps in order: (a) clarification (b) expanded-bed anionic exchange chromatography, (c) reverse phase chromatography, (d) anionic exchange chromatography, (e) molecular exclusion chromatography (desalting), (f) concentration and (g) molecular exclusion chromatography.

Clarification

[0130] Fresh milk was mixed with a sufficient amount of Tween 80 in order to obtain a 0.5% solution. After addition of Tween 80, 2 M Tris-HCl was added to get a pH of 7.3.+-.0.1. Afterwards, the product was homogenized for 30 minutes, and then centrifugated at 14000 g in order to separate the fat layer. Later, the resulting solution was diluted with 0.5% Tween 80 up to a conductivity of less than, or equal to, 1500 .mu.S/cm. The pH was adjusted to 7.3.+-.0.1 with 2 M Tris-HCl and then the product was filtered through a 0.8 .mu.m pore membrane and stored conveniently.

Expanded-Bed Anionic Exchange Chromatography

[0131] The material resulting from the previous step is chromatographed using an anionic exchange matrix according to the following parameters:

[0132] 1. Equipment: [0133] A. Column: [0134] 1) Diameter: 5 cm [0135] 2) Bed height: 30 cm (compacted bed) [0136] 3) Matrix: [0137] a. Streamline Q XL (Amersham) [0138] b. Volume: 600 ml

[0139] 2. Solutions and buffers: [0140] A. 0.5 N NaOH [0141] B. 20% Ethanol [0142] C. Buffer A: 20 mM Tris.HCl, pH 7.3 [0143] D. Buffer B: 500 mM Tris.HCl, pH 7.3 [0144] E. Buffer C: 20 mM Tris.HCl, 150 mM NaCl, pH 7.3 [0145] F. Buffer D: 20 mM Tris.HCl, 500 mM NaCl, pH 7.3

[0146] 3. Material to be chromatographed [0147] A. Clarified milk. [0148] B. Sample conditions: [0149] 1) Volume: 25.+-.5 l [0150] 2) Conductivity: <1500 .mu.S/cm [0151] 3) pH: 7.3.+-.0.1

[0152] To equilibrate the column, 1.5 volumes of the column ("vc") (900 mL) of purified water were passed through it, at a flow of 115.+-.5 cm/hour (descending flow). Afterwards, the following solutions or buffers in the quantities hereinafter detailed were sequentially passed through it, at an flow of 230.+-.30 cm/hour (ascending flow): 3.0 vc (1,800 ml) of 0.5 N NaOH; 3.0 vc (1,800 ml) of purified water; 1.0 vc (600 ml) of Buffer B; and, finally, 3.0 vc (1,800 ml) of Buffer A.

[0153] Once the column was equilibrated, the material to be chromatographed was loaded. Said loading was performed at 12.+-.3.degree. C. and at a flow of 230.+-.30 cm/hour. Thereafter, the elution was performed at a 115.+-.15 cm/hour flow and at the same temperature. Firstly, a sufficient amount of Buffer A was passed through the column (ascending flow), and secondly the solutions and buffers hereinafter detailed were passed in the following order (descending flow): 1.5 vc (900 ml) of Buffer A; 2.0 vc (1,200 ml) of Buffer C; and, finally, 2.0 vc (1,200 ml) of Buffer D.

[0154] Once the step had finished, the following solutions or buffers in the quantities hereinafter detailed were sequentially passed through the column, in order to clean it: 1.5 vc (900 ml) of purified water; 1.5 vc (900 ml) of 0.5 N NaOH; 2.0 vc (1,200 ml) of purified water; 1.0 vc (600 ml) of Buffer B; 1.5 vc (900 ml) of purified water; and, finally, 1.5 vc (900 ml) of 20% Ethanol.

[0155] The selected hGH containing fractions were assayed for total proteins (by Bradford method) and for the protein of interest (by RIA), and stored at 2-8.degree. C.

Reverse Phase Chromatography

[0156] The material resulting from the previous step is chromatographed according to the following parameters:

[0157] 1. Equipment: [0158] A. Column: [0159] 1) Diameter: 4 cm [0160] 2) Bed height: 48 cm [0161] 3) Matrix [0162] a. BakerBond Wide-Pore Butyl (C4) 15 .mu.m prep LC Packing (Baker) [0163] b. Volume: 600 ml

[0164] 2. Solutions and buffers: [0165] A. Mobile Phase 1 (MP1): 30 mM NaHCO.sub.3, pH 7.2:Purified water:Acetonitrile (35:55:10) [0166] B. Mobile Phase 2 (MP2): 30 mM NaHCO.sub.3, pH 7.2:Purified water:Acetonitrile (20:10:70) [0167] C. 50% Methanol

[0168] 3. Material to be chromatographed [0169] A. Pool of selected fractions resulting from the previous step. [0170] B. Sample conditions: [0171] 1) Volume: 30.+-.15 l [0172] 2) pH: 7.3.+-.0.3

[0173] To equilibrate the column, the following solutions or buffers in the quantities hereinafter detailed were sequentially passed through it, at a flow of less than, or equal to, 478 cm/hour: 0.3 vc (180 ml) of 50% methanol; thereafter, a gradient of 50% methanol-MP2 was applied starting from a 100:0 ratio of said solutions until a 0:100 ratio of said solutions in a total volume of 1.0 vc (600 ml) was reached; once the gradient was finished, 1.0 vc (600 ml) of MP2 was passed through the column; thereafter, a gradient of MP2-MP1 was applied starting from a 100:0 ratio of said solutions until a 0:100 ratio of said solutions in a total volume of 1.0 vc (600 ml) was reached; and, finally, 2.0 vc (1,200 ml) of MP1 were passed through the column.

[0174] Once the column was equilibrated, the material to be chromatographed was filtered through a 0.45 .mu.m pore membrane, and loaded immediately afterwards. Said loading was performed at 20.+-.5.degree. C. and at a flow of less than, or equal to, 238 cm/hour. Thereafter, the elution was performed at a 478.+-.78 cm/hour flow and at the same temperature, and the solutions and buffers hereinafter detailed were passed in the following order: 1.0 vc (600 ml) of MP1; a gradient of MP1-MP2, starting from a 65:35 ratio of said solutions until a 45:55 ratio of said solutions in a total volume of 18.0 vc (9,000 ml) was reached; 1.0 vc (600 ml) of MP1-MP2 in a 45:55 ratio; and, finally, 2.0 vc (1,200 ml) of MP2.

[0175] Once the step had finished, in order to clean the column, a gradient of MP2-50% Methanol was applied, starting from a 100:0 ratio of said solutions until a 0:100 ratio of said solutions in a total volume of 1.0 vc (600 ml) was reached; and, finally, 2.0 vc (1,200 ml) of 50% methanol were passed through the column.

[0176] The fractions resulting from this chromatography were assayed by SDS-PAGE homogeneous 20% and for the oxidized hGH, and, depending on the results, a selection was performed. Afterwards, the selected hGH containing fractions were assayed for total proteins (by Bradford method), and stored at 2-8.degree. C.

Anionic Exchange Chromatography

[0177] The material resulting from the previous step is chromatographed using an anionic exchange matrix, as follows:

[0178] 1. Equipment: [0179] A. Column: [0180] 1) Diameter: 5 cm [0181] 2) Bed height: 25 cm [0182] 3) Matrix [0183] a. Source 30Q (Pharmacia) [0184] b. Volume: 500 ml

[0185] 2. Solutions and buffers: [0186] A. 20% Ethanol [0187] B. Solution K: 0.5 N NaOH, 3M NaCl [0188] C. Solution L: 50 mM Tris, pH 7.50 [0189] D. Solution M: 0.1 N HCl, 3 M NaCl [0190] E. Mobile Phase 3 (MP3): Solution L:Acetonitrile (70:30) [0191] F. Mobile Phase 4 (MP4): 50 mM Tris, 0.1 M NaCl, pH 7.50:Acetonitrile (70:30)

[0192] 3. Material to be chromatographed [0193] A. Selected fractions resulting from the previous step. [0194] B. Sample conditions: [0195] 1) Volume: 4.5.+-.11 [0196] 2) pH: 7.2.+-.0.2

[0197] To equilibrate and sanitize the column, the following solutions or buffers in the quantities hereinafter detailed were sequentially passed through it, at a flow of less than, or equal to, 183.+-.20 cm/hour: 1.0 vc (500 ml) of purified water; 1.0 vc (500 ml) of Solution K; 1.0 vc (500 ml) of Solution L; and, finally, 1.0 vc (500 mL) of MP3.

[0198] Once the column was equilibrated, the material to be chromatographed loaded. Said loading was performed at 20.+-.5.degree. C. and at a flow of less than, or equal to, 183 cm/hour. Thereafter, the elution was performed at a 183.+-.20 cm/hour flow and at the same temperature, and the solutions and buffers hereinafter detailed were passed in the following order: 1.0 vc (500 ml) of MP3; a gradient of MP3-MP4, starting from a 15:85 ratio of said solutions until a 25:75 ratio of said solutions in a total volume of 5.0 vc (2,500 ml) was reached; and, finally, 2.0 vc (1,000 ml) of MP4 was passed through the column.

[0199] Once the step had finished, the following solutions or buffers in the quantities hereinafter detailed were sequentially passed through the column, in order to clean it: a gradient of MP4-purified water, starting from a 100:0 ratio of said solutions until a 0:100 ratio of said solutions in a total volume of 0.5 vc (250 ml) was reached; 0.5 vc (250 ml) of purified water; a gradient of purified water-Solution K, starting from a 100:0 ratio of said solutions until a 0:100 ratio of said solutions in a total volume of 0.5 vc (250 ml) was reached; 1.0 vc (500 ml) of Solution K; a gradient of Solution K-purified water, starting from a 100:0 ratio of said solutions until a 0:100 ratio of said solutions in a total volume of 0.5 vc (250 ml) was reached; 0.5 vc (250 ml) of purified water; a gradient of purified water-Solution M, starting from a 100:0 ratio of said solutions until a 0:100 ratio of said solutions in a total volume of 0.5 vc (250 ml) was reached; 1.0 vc (500 ml) of Solution M; a gradient of Solution M-purified water, starting from a 100:0 ratio of said solutions until a 0:100 ratio of said solutions in a total volume of 0.5 vc (250 ml) was reached; 1.0 vc (500 ml) of purified water; a gradient of purified water-Solution L, starting from a 100:0 ratio of said solutions until a 0:100 ratio of said solutions in a total volume of 0.5 vc (250 ml) was reached; 0.5 vc (250 ml) of Solution L; a gradient of Solution L-purified water, starting from a 100:0 ratio of said solutions until a 0:100 ratio of said solutions in a total volume of 0.5 vc (250 ml) was reached; and, finally, 1.5 vc (750 ml) of purified water.

[0200] The selected hGH containing fractions were assayed for total proteins (by Bradford method), and stored at 2-8.degree. C.

Molecular Exclusion Chromatography

[0201] The material resulting from the previous step is chromatographed using a molecular exclusion matrix, as follows:

[0202] 1. Equipment: [0203] A. Column: [0204] 1) Diameter: 5 cm [0205] 2) Bed height: 25 cm [0206] 3) Matrix [0207] a. Cellufine GH25 (Millipore) [0208] b. Volume: 500 ml

[0209] 2. Solutions and buffers: [0210] A. 0.5 N NaOH [0211] B. 20% Ethanol [0212] C. Buffer C: 150 mM NaH.sub.2PO.sub.4, pH 7.2 [0213] D. Buffer G: 320 mM Glycine, 10 mM NaH.sub.2PO.sub.4, 0.1% Tween 80, pH 6.9

[0214] 3. Material to be chromatographed [0215] A. Selected fractions resulting from the previous step. [0216] B. Sample conditions: [0217] 1) Volume: 0.5.+-.0.2 l [0218] 2) pH: 7.5.+-.0.5

[0219] To equilibrate and sanitize the column, the following solutions or buffers in the quantities hereinafter detailed were sequentially passed through it, at a flow of less than, or equal to, 180 cm/hour: 1.0 vc (500 ml) of purified water; 1.0 vc (500 ml) of 0.5 N NaOH; 0.5 vc (250 ml) of purified water; 0.5 vc (250 ml) of Buffer C; and, finally, 2.0 vc (1000 ml) of Buffer G.

[0220] Once the column was equilibrated, the material to be chromatographed was loaded. Said loading was performed at 20.+-.5.degree. C. and at a flow of 183.+-.20 cm/hour. Thereafter, the elution was performed at the same flow rate and temperature, and 1.0 vc (500 ml) of Buffer G was passed through the column, as many times as the number of runs which was necessary to perform.

[0221] Once the step had finished, the following solutions or buffers in the quantities hereinafter detailed were sequentially passed through the column, in order to clean it: 0.5 vc (250 ml) of purified water; 1.0 vc (500 ml) of 0.5 N NaOH; 0.5 vc (250 ml) of purified water; 0.5 vc (250 ml) of Buffer C, 0.5 vc (250 ml) of purified water; and, finally, 1.5 vc (750 ml) of 20% ethanol.

[0222] The selected hGH containing fractions were assayed for total proteins, and stored at 2-8.degree. C.

Concentration

[0223] The fractions resulting from the previous example were concentrated according to the conditions described below:

[0224] 1. Equipment: [0225] A. Peristaltic pump: Watson Marlow--Cat. No. 302S [0226] B. Tubing: Watson Marlow--Cat. No. 902.0080.016 [0227] C. Concentrator: Prep Scale Millipore--Cat. No. CDU F006LC

[0228] 2. Solutions and buffers: [0229] A. 0.28% Sodium Dodecyl Sulfate (SDS) [0230] B. 0.06% Triton [0231] C. 0.125 N NaOH [0232] D. Buffer G: 320 mM Glycine, 10 mM NaH.sub.2PO.sub.4, 0.1% Tween 80, pH 6.9

[0233] 3. Material to be processed: [0234] A. Selected fractions resulting from the previous example. [0235] B. Sample conditions: [0236] 1) Volume: 1.0.+-.0.5 l [0237] 2) Conductivity: 1200.+-.100 .mu.S/cm [0238] 3) pH: 6.9.+-.0.1

[0239] The equipment was first cleaned, sanitized and equilibrated, and the following sequence of solutions and buffers were flowed through the equipment: 2 l of 0.125 N NaOH; 10 l of purified water; and, finally, 2 l of Buffer G. The equipment was then ready to be used for concentration on the selected fractions, following the usual methodology. The concentration procedure was performed until a protein concentration of 15 mg/ml (assessed by Bradford method) was reached.

[0240] The selected fractions were filtered through a 0.22 .mu.m pore membrane, assayed for total proteins (by Bradford method), and stored at 4.degree. C.

[0241] The conductivity and the pH of the selected fractions were 1,100-1,300 .mu.S/cm and 6.9.+-.0.1, respectively.

Molecular Exclusion Chromatography

[0242] The material resulting from the previous step is chromatographed using a molecular exclusion matrix, as follows:

[0243] 1. Equipment: [0244] A. Column: [0245] 1) Diameter: 5 cm [0246] 2) Bed height: 92 cm [0247] 3) Matrix [0248] a. Sephacryl S-200 High Resolution (Amersham Pharmacia) [0249] b. Volume: 1,800 ml

[0250] 2. Solutions and buffers: [0251] A. 0.5 N NaOH [0252] B. 20% Ethanol [0253] C. Buffer H: 320 mM Glycine, 2.2 mM NaH.sub.2PO.sub.4, 1.8 mM Na.sub.2HPO.sub.4, pH 7.30

[0254] 3. Material to be chromatographed [0255] A. Fractions selected from the previous step, concentrated [0256] B. Sample conditions: [0257] 1) Volume: 40.+-.20 ml [0258] 2) Conductivity: 1,200.+-.100 .mu.S/cm [0259] 3) pH: 7.3.+-.0.1

[0260] To equilibrate and sanitize the column, the following solutions or buffers in the quantities hereinafter detailed were sequentially passed through it, at a flow of less than 46 cm/hour: 1.0 vc (1,800 ml) of purified water; 1.0 vc (1,800 ml) of 0.5 N NaOH; and, finally, 2.0 vc (3,600 ml) of Buffer H.

[0261] Once the column was equilibrated, the material to be chromatographed was loaded. Said loading was performed at 20.+-.5.degree. C. and at a flow of 46.+-.15 cm/hour. Thereafter, the elution was performed at the same flow rate and temperature, and 1.0 vc (1,800 ml) of Buffer H was passed through the column, as many times as the number of runs which was necessary to perform.

[0262] Once the step had finished, the following solutions or buffers in the quantities hereinafter detailed were sequentially passed through the column, in order to clean it: 1.0 vc (1,800 ml) of purified water; and 1.5 vc (2,700 ml) of 20% ethanol.

[0263] The fractions containing pure hGH were aseptically filtered through a 0.22 .mu.m pore membrane into sterile, depyrogenated plastic bottles, assayed for total proteins, and stored at -20.degree. C.

Example 8

Alternative Procedure for the Purification of hGH from Milk

[0264] Instead of the purification method previously described, an alternative scheme can be employed in order to purify the recombinant hGH contained in the milk. The main difference between the procedure described in Example 7 and the alternative one presented in this example is that the second step of the former involves expanded-bed anionic exchange chromatography, whereas the corresponding step of the latter entails immunoaffinity chromatography. The clarification steps of both procedures are also slightly different. Since the rest of both purification schemes are identical, only the first two steps of the alternative procedure will be described below.

Clarification

[0265] Fresh milk was mixed with a sufficient amount of Tween 80 in order to obtain a 0.5% solution. After addition of Tween 80, 1 M Tris was added to get a pH of 7.3.+-.0.3. Afterwards, the product was homogenized for 30 minutes, and then centrifugated at 14000 g in order to separate the fat layer. Later, the resulting solution was diluted 20-fold with Buffer S (50 mM Tris.HCl, 500 mM NaCl, 0.5% Tween 80, pH 7.3), and then filtered through a 0.45 .mu.m pore membrane and stored conveniently.

Immunoaffinity Chromatography

[0266] The material resulting from the previous step is chromatographed using an immunoaffinity interaction matrix (Affigel 10 Ester Agarose, manufactured by BioRad, with covalently attached anti-GH Monoclonal Antibodies, manufactured by Bio Sidus) according to the following parameters:

[0267] 1. Equipment: [0268] A. Column: [0269] 1) Diameter: 30 cm [0270] 2) Bed height: 15 cm [0271] 3) Matrix: [0272] a. Affigel 10 Ester Agarose (BioRad), with covalently attached anti-GH Monoclonal Antibodies (Bio Sidus) [0273] b. Volume: 10 l

[0274] 2. Solutions and buffers: [0275] A. Buffer A: 50 mM Tris.HCl, 500 mM NaCl, pH 7.2 [0276] B. Buffer B: 100 mM Citric Acid, pH 3.0 [0277] C. Buffer C: 150 mM NaH.sub.2PO.sub.4, pH 7.2 [0278] D. Buffer D: 50 mM Tris.HCl, 500 mM NaCl, 500 mM Guanidine.HCl, pH 7.2 [0279] E. Buffer E: 50 mM Tris.HCl, 500 mM NaCl, pH 7.2, 0.2% Sodium Azide, 0.1 g/l Gentamicine.

[0280] 3. Material to be chromatographed [0281] A. Clarified milk. [0282] B. Sample conditions: [0283] 1) Volume: 30-50 l [0284] 2) Conductivity: 45.+-.15 mS/cm [0285] 3) pH: 7.3.+-.0.3

[0286] To equilibrate and sanitize the column, if it had not been used in the last seven days, the following solutions or buffers in the quantities hereinafter detailed were sequentially passed through it, at a flow of less than 51 cm/hour: 1.0 volume of the column ("vc") (10 l) of Buffer A; 2.0 vc (20 l) of Buffer D; 2.0 vc (20 l) of Buffer A; 1.0 vc (10 l) of Buffer B; 2.0 vc (20 l) of Buffer C; and, finally, 1.0 vc (10 l) of Buffer A.

[0287] On the other hand, if the column had been used in the last seven days, the following solutions or buffers in the quantities hereinafter detailed were sequentially passed through it, at a flow of less than 51 cm/hour: 1.0 vc (10 l) of Buffer C; and, finally, 2.0 vc (20 l) of Buffer A.

[0288] Once the column was equilibrated, the material to be chromatographed was loaded. Said loading was performed at 5.+-.3.degree. C. and at a flow of less than 51 cm/hour. Thereafter, the elution was performed at a 42.+-.9 cm/hour flow and at the same temperature, and the solutions and buffers hereinafter detailed were passed in the following order: 2.0 vc (20 l) of Buffer A; and 1.5 vc (15 l) of Buffer B.

[0289] Once the step had finished, the following solutions or buffers in the quantities hereinafter detailed were sequentially passed through the column, in order to clean it: 2.0 vc (20 l) of Buffer D; 2.0 vc (20 l) of Buffer A; and, finally, 2.0 vc (20 l) of Buffer E.

[0290] The selected hGH containing fractions were assayed for total proteins (by Bradford method) and for the protein of interest (by RIA), and stored at 4.degree. C.

Example 9

Quality Control of Pure Recombinant hGH

[0291] Two batches of pure recombinant hGH were subjected to a series of assays to verify that the product is indistinguishable from natural hGH. Such procedures included, but are not limited to, SDS/PAGE, Western blot, biological activity in vitro (cells nb2) and in vivo (hypophysectomized rats), peptide mapping, determination of the complete aminoacid sequence, isoelectric focusing (IEF), and reverse-phase and size exclusion HPLC analyses. The results obtained in all those assays were exactly the same for both recombinant and natural hGH, which proves that the pure recombinant hGH corresponds exactly to the natural hGH, being thus suitable for manufacturing a biopharmaceutical product.

[0292] Having now fully described the invention, it will be understood by those of ordinary skill in the art that the same can be performed within a wide and equivalent range of conditions, formulations and other parameters without affecting the scope of the invention or any embodiment thereof. All patents and publications cited herein are fully incorporated by reference herein in their entirety.

Sequence CWU 1

1

4131DNAArtificialPrimer PB1 1tctactcgag gatcatctat ctgtcccaaa g 31227DNAArtificialPrimer PB2 2ctaggatcca atgatctgat tttgtgg 27328DNAArtificialPrimer PB4 3ctaggatcca tggctacagg taagcgcc 28420DNAArtificialPrimer GHTE 4atgctgtgtc tggacgtcct 20

* * * * *


uspto.report is an independent third-party trademark research tool that is not affiliated, endorsed, or sponsored by the United States Patent and Trademark Office (USPTO) or any other governmental organization. The information provided by uspto.report is based on publicly available data at the time of writing and is intended for informational purposes only.

While we strive to provide accurate and up-to-date information, we do not guarantee the accuracy, completeness, reliability, or suitability of the information displayed on this site. The use of this site is at your own risk. Any reliance you place on such information is therefore strictly at your own risk.

All official trademark data, including owner information, should be verified by visiting the official USPTO website at www.uspto.gov. This site is not intended to replace professional legal advice and should not be used as a substitute for consulting with a legal professional who is knowledgeable about trademark law.

© 2024 USPTO.report | Privacy Policy | Resources | RSS Feed of Trademarks | Trademark Filings Twitter Feed