U.S. patent application number 12/625940 was filed with the patent office on 2011-03-17 for immunosuppressant target proteins.
This patent application is currently assigned to ARIAD Gene Therapeutics, Inc.. Invention is credited to Vivian Berlin, Maria Isabel Chiu, Guillaume Cottarel, Veronique Damagnez.
Application Number | 20110065898 12/625940 |
Document ID | / |
Family ID | 26941149 |
Filed Date | 2011-03-17 |
United States Patent
Application |
20110065898 |
Kind Code |
A1 |
Berlin; Vivian ; et
al. |
March 17, 2011 |
Immunosuppressant Target Proteins
Abstract
The present invention relates to the discovery of novel proteins
of mammalian origin which are immediate downstream targets for
FKBP/rapamycin complexes.
Inventors: |
Berlin; Vivian; (Arlington,
MA) ; Chiu; Maria Isabel; (Boston, MA) ;
Cottarel; Guillaume; (West Roxbury, MA) ; Damagnez;
Veronique; (Cambridge, MA) |
Assignee: |
ARIAD Gene Therapeutics,
Inc.
Cambridge
MA
|
Family ID: |
26941149 |
Appl. No.: |
12/625940 |
Filed: |
November 25, 2009 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10877320 |
Jun 24, 2004 |
|
|
|
12625940 |
|
|
|
|
09517491 |
Mar 2, 2000 |
|
|
|
10877320 |
|
|
|
|
08360144 |
Dec 20, 1994 |
6150137 |
|
|
09517491 |
|
|
|
|
08250795 |
May 27, 1994 |
|
|
|
08360144 |
|
|
|
|
Current U.S.
Class: |
530/350 ;
536/24.31; 536/24.33 |
Current CPC
Class: |
C12Q 1/25 20130101; G01N
33/5005 20130101; G01N 33/5008 20130101; C07K 2319/00 20130101;
G01N 33/502 20130101; C12N 9/93 20130101; G01N 33/6845 20130101;
G01N 33/5011 20130101; C12N 9/1205 20130101; C12Q 2600/158
20130101; C07K 14/4702 20130101; G01N 33/68 20130101; C07K 14/40
20130101; A01K 2217/05 20130101; C12Q 1/6897 20130101; G01N 33/9493
20130101; G01N 33/5091 20130101; G01N 2500/00 20130101; C12Q 1/6883
20130101 |
Class at
Publication: |
530/350 ;
536/24.31; 536/24.33 |
International
Class: |
C07K 14/00 20060101
C07K014/00; C07H 21/04 20060101 C07H021/04 |
Claims
1. A soluble polypeptide which specifically binds an FKBP/rapamycin
complex, which binding is rapamycin-dependent.
2-50. (canceled)
51. A probe/primer comprising a substantially purified
oligonucleotide, wherein the oligonucleotide comprises a region of
nucleotide sequence which hybridizes under stringent conditions,
including a wash step of 0.2.times.SSC at 65.degree. C., to at
least 20 consecutive nucleotides of sense or antisense sequence of
SEQ ID No: 1, SEQ ID No: 11, or of the 3.74 kb gene insert of
pIC524 having ATCC Accession No. 75787.
Description
RELATED APPLICATIONS
[0001] This application is a continuation-in-part of U.S. Ser. No.
08/250,795, filed May 27, 1994 and entitled "Immunosuppressant
Target Proteins", the specification of which are incorporated by
reference herein.
BACKGROUND OF THE INVENTION
[0002] Cyclosporin A, FK506, and rapamycin are microbial products
with potent immunosuppressive properties that result primarily from
a selective inhibition of T lymphocyte activation. Rapamycin was
first described as an antifungal antibiotic extracted from a
streptomycete (Streptomyces hygroscopicus) (Vezina et al. (1975).
J. Antibiot., 28:721; Sehgal et al. (1975) J. Antibiot. 28:727; and
Sehgal et al., U.S. Pat. No. 3,929,992). Subsequently, the
macrolide drug rapamycin was shown to exhibit immunosuppressive as
well as antineoplastic and antiproliferative properties (Morris
(1992) Transplant Res 6:39-87).
[0003] Each of these compounds, cyclosporin A, FK506 and rapamycin,
suppress the immune system by blocking distinctly different
biochemical reactions which would ordinarily initiate the
activation of immune cells. Briefly, cyclosporin A and FK506 act
soon after Ca.sup.2+-dependent T-cell activation to prevent the
synthesis of cytokines important for the perpetuation and
amplification of the immune response. Rapamycin acts later to block
multiple affects of cytokines on immune cells including the
inhibition of interleukin-2 (IL2)-triggered T-cell proliferation,
but its antiproliferative effects are not restricted solely to T
and B cells. Rapamycin also selectively inhibits the proliferation
of growth factor-dependent and growth factor-independent nonimmune
cells. Rapamycin is generally believed to inhibit cell
proliferation by blocking specific signaling events necessary for
the initiation of S phase in a number of cell types, including
lymphocytes (Bierer et al. (1990) PNAS 87:9231-9235; and Dumont et
al. (1990) J. Immunol 144:1418-1424), as well as non-immune cells,
such as hepatocytes (Francavilla et al. (1992) Hepatology
15:871-877; and Price et al. (1992) Science 257:973-977). Several
lines of evidence suggest that the association of rapamycin with
different members of a family of intracellular FK506/rapamycin
binding proteins (FKBPs) is necessary for the inhibition of G.sub.1
progression as mediated by rapamycin. For instance, the actions of
rapamycin are reversed by an excess of the structurally
FKBP-ligands FK506 or 506BD (Bierer et al. supra.; Dumont et al.
supra.; and Bierer et al. (1990) Science 250:556-559).
[0004] Cyclosporin A binds to a class of proteins called
cyclophilins (Walsh et al. (1992) J. Biol. Chem. 267:13115-13118),
whereas the primary targets for both FK506 and rapamycin, as
indicated above, are the FKBPs (Harding et al. (1989) Nature
341:758-7601; Siekienka et al. (1989) Nature 341:755-757; and
Soltoff et al. (1992 J. Biol. Chem. 267:17472-17477). Both the
cyclophilin/cyclosporin and FKBPI2/FK506 complexes bind to a
specific protein phosphatase (calcineurin) which is hypothesized to
control the activity of IL-2 gene specific transcriptional
activators (reviewed in Schreiber (1991) Cell 70:365-368). In
contrast, the downstream cellular targets for the
rapamycin-sensitive signaling pathway have not been especially well
characterized, particularly with regard to the identity of the
direct target of the FKBP-rapamycin complex.
[0005] The TOR1 and TOR2 genes of S. cerevisiae were originally
identified by mutations that rendered cells resistant to rapamycin
(Heitman et al. (1991) Science 253:905-909) and there was early
speculation that the FKBP/rapamycin complex might inhibit the
cellular function of the TOR gene product by binding directly to a
phosphoserine residue of either TOR1 or TOR2. Subsequently,
however, new models for rapamycin drug interaction have been
proposed which do not involve direct binding of the FKBP/rapamycin
complex to the TOR proteins. For example, based on experimental
data regarding cyclin-cdk activity in rapamycin treated cells,
Stuart Schreiber wrote in Albers et al. (1993) J. Biol. Chem.
268:22825-22829: [0006] "Although it is possible the TOR2 gene
product is a direct target of the FKBP-rapamycin complex, a more
likely explanation is that the TOR2 gene product lies downstream of
the direct target of rapamycin and that the TOR2 mutation caused
the protein to be constitutively active. If the latter model is
correct, then the TOR2 gene product joins p70.sup.s6k,
cyclin-dependent kinases, and cyclin D1 as proteins that lie
downstream of the direct target of the FKBP-rapamycin complex and
have been shown to play important roles in cell cycle progression.
The identification of the direct target of the FKBP-rapamycin
complex will likely reveal an upstream component of the signal
transduction pathway that leads to G1 progression and will help
delineate the signal transduction pathways that link growth
factor-mediated signaling events and cyclin-cdk activity required
for cell cycle progression."
[0007] Likewise, after studying the role of TOR1 and TOR2 mutations
in rapamycin-resistant yeast cells, George Livi wrote in Cafferkey
et al. (1993) Mol. Cell. Biol. 13:6012-6023: [0008] "Thus, the
amino acid changes that we have identified in the
rapamycin-released DRR1 [TOR1] protein may allow it to compensate
for the loss of the proliferative signal inhibited by rapamycin by
constitutively activating an alternative signal rather than by
preventing its association with the FKBP12-rapamycin complex. The
positions of the mutations within the kinase domain, but in a
region not shared by the PI 3-kinases, support this idea.
Therefore, it is entirely possible that DRR1 is not a component of
the rapamycin-sensitive pathway in wild-type yeast cells. Instead,
missense mutations in DRR1 at Ser-1972 may alter its normal
activity and allow it to substitute for the function of an
essential protein which is the true target of rapamycin."
[0009] It is an object of the present invention to identify
cellular proteins which are the direct downstream target proteins
for the FKBP/rapamycin complex, and isolate the genes encoding
those proteins.
SUMMARY OF THE INVENTION
[0010] The present invention relates to the discovery of novel
proteins of mammalian origin which are immediate downstream targets
for FKBP/rapamycin complexes. As described herein, a drug-dependent
interaction trap assay was used to isolate a number of proteins
which interact with an FK506-binding protein/rapamycin complex, and
which are collectively referred to herein as "RAP-binding proteins"
or "RAP-BPs". In particular, mouse and human genes have been cloned
for a protein (referred to herein as "RAPT1") which is apparently
related to the yeast TOR1 and TOR2 gene products. Furthermore, a
novel ubiquitin-conjugating enzyme (referred to herein as
"rap-UBC") has been cloned based on its ability to bind
FKBP/rapamycin complexes. In addition, a RAPT1-like protein was
cloned from the human pathogen Candida albicans. The present
invention, therefore, makes available novel proteins (both
recombinant and purified forms), recombinant genes, antibodies to
RAP-binding proteins, and other novel reagents and assays for
diagnostic and therapeutic use.
[0011] The present invention relates to the discovery in eukaryotic
cells, particularly human cells, of novel protein-protein
interactions between the Wilms tumor regulatory protein rapamycin
complexes and certain cellular proteins, referred to hereinafter as
"RAP-binding proteins" or "RAP-BP".
[0012] In general, the invention features a mammalian RAPT1
polypeptide, preferably a substantially pure preparation of a RAPT1
polypeptide, or a recombinant RAPT1 polypeptide. In preferred
embodiments the polypeptide has a biological activity associated
with its binding to rapamycin, e.g., it remains the ability to bind
to an FKBP/rapamycin complex, though it may be able to either
agonize or antagonize assembly of rapamycin-dependent complexes.
The polypeptide can be identical to a polypeptide shown in one of
SEQ ID No: 2 or 12, or it can merely be homologous to that
sequence. For instance, the polypeptide preferably has an amino
acid sequence at least 60% homologous to the amino acid sequence of
at least one of either SEQ ID No: 2 or 12, though higher sequence
homologies of, for example, 80%, 90% or 95% are also contemplated.
The polypeptide can comprise the full length protein, or a portion
of a full length protein, such as the RAPT1 polypeptides
represented in either SEQ ID No: 2 or 12, or an even smaller
fragment of that protein, which fragment may be, for instance, at
least 5, 10, 20, 50 or 100 amino acids in length. As described
below, the RAPT1 polypeptide can be either an agonist (e.g.
mimics), or alternatively, an antagonist of a biological activity
of a naturally occurring form of the protein, e.g., the polypeptide
is able to modulate assembly of rapamycin complexes, such as
complexes involving FK506-binding proteins, or cell cycle
regulatory proteins.
[0013] In a preferred embodiment, a peptide having at least one
biological activity of the subject RAPT1 polypeptides may differ in
amino acid sequence from the sequence in SEQ ID No: 2 or 12, but
such differences result in a modified protein which functions in
the same or similar manner as the native RAPT1 protein or which has
the same or similar characteristics of the native RAPT1 protein.
However, homologs of the naturally occurring protein are
contemplated which are antagonistic of the normal cellular role of
the naturally occurring protein.
[0014] In yet other preferred embodiments, the RAPT1 protein is a
recombinant fusion protein which includes a second polypeptide
portion, e.g., a second polypeptide having an amino acid sequence
unrelated to the RAPT1 polypeptide portion, e.g. the second
polypeptide portion is glutathione-S-transferase, e.g. the second
polypeptide portion is a DNA binding domain of transcriptional
regulatory protein, e.g. the second polypeptide portion is an RNA
polymerase activating domain, e.g. the fusion protein is functional
in a two-hybrid assay.
[0015] Yet another aspect of the present invention concerns an
immunogen comprising a RAPT1 peptide in an immunogenic preparation,
the immunogen being capable of eliciting an immune response
specific for the RAPT1 polypeptide; e.g. a humoral response, e.g.
an antibody response; e.g. a cellular response. In preferred
embodiments, the immunogen comprising an antigenic determinant,
e.g. a unique determinant, from a protein represented by SEQ ID No:
2 and/or 12.
[0016] A still further aspect of the present invention features an
antibody preparation specifically reactive with an epitope of the
RAPT1 immunogen.
[0017] In another aspect, the invention features a ubiquitin
conjugating enzyme (rap-UBC), preferably a substantially pure
preparation of a rap-UBC polypeptide, or a recombinant rap-UBC
polypeptide. As above, in preferred embodiments the rap-UBC
polypeptide has a biological activity associated with its binding
to rapamycin, e.g., it retains the ability to bind to a rapamycin
complex, and may additionally retain a ubiquitin conjugating
activity. The polypeptide can be identical to the polypeptide shown
in SEQ ID No: 24, or it can merely be homologous to that sequence.
For instance, the polypeptide preferably has an amino acid sequence
at least 60% homologous to the amino acid sequence in SEQ ID No:
24, though higher sequence homologies of, for example, 80%, 90% or
95% are also contemplated. The rap-UBC polypeptide can comprise the
full length polypeptide represented in SEQ ID No: 24, or it can
comprise a fragment of that protein, which fragment may be, for
instance, at least 5, 10, 20, 50 or 100 amino acids in length. The
rap-UBC polypeptide can be either an agonist (e.g. mimics), or
alternatively, an antagonist of a biological activity of a
naturally occurring form of the protein.
[0018] In a preferred embodiment, a peptide having at least one
biological activity of the subject rap-UBC polypeptide may differ
in amino acid sequence from the sequence in SEQ ID No: 24, but such
differences result in a modified protein which functions in the
same or similar manner as the native rap-UBC or which has the same
or similar characteristics of the native protein. However, homologs
of the naturally occurring rap-UBC protein are contemplated which
are antagonistic of the normal cellular role of the naturally
occurring protein.
[0019] In yet other preferred embodiments, the rap-UBC protein is a
recombinant fusion protein which includes a second polypeptide
portion, e.g., a second polypeptide having an amino acid sequence
unrelated to the rap-UBC sequence, e.g. the second polypeptide
portion is glutathione-S-transferase, e.g. the second polypeptide
portion is a DNA binding domain of transcriptional regulatory
protein, e.g. the second polypeptide portion is an RNA polymerase
activating domain, e.g. the fusion protein is functional in a
two-hybrid assay.
[0020] Yet another aspect of the present invention concerns an
immunogen comprising a rap-UBC peptide in an immunogenic
preparation, the immunogen being capable of eliciting an immune
response specific for the rap-UBC polypeptide; e.g. a humoral
response, e.g. an antibody response; e.g. a cellular response. In
preferred embodiments, the immunogen comprising an antigenic
determinant, e.g. a unique determinant, from a protein represented
by SEQ ID No: 24.
[0021] A still further aspect of the present invention features an
antibody preparation specifically reactive with an epitope of the
rap-UBC immunogen.
[0022] In still another aspect, the invention features a RAPT1-like
polypeptide from a Candida species (caRAPT1), preferably a
substantially pure preparation of a caRAPT1 polypeptide, or a
recombinant caRAPT1 polypeptide. As above, in preferred embodiments
the caRAPT1 polypeptide has a biological activity associated with
its binding to rapamycin, e.g., it retains the ability to bind to a
rapamycin complex, such as an FKBP/rapamycin complex. The
polypeptide can be identical to the polypeptide shown in SEQ ID No:
14, or it can merely be homologous to that sequence. For instance,
the caRAPT1 polypeptide preferably has an amino acid sequence at
least 60% homologous to the amino acid sequence in SEQ ID No: 14,
though higher sequence homologies of, for example, 80%, 90% or 95%
are also contemplated. The caRAPT1 polypeptide can comprise the
entire polypeptide represented in SEQ ID No: 14, or it can comprise
a fragment of that protein, which fragment may be, for instance, at
least 5, 10, 20, 50 or 100 amino acids in length. The caRAPT1
polypeptide can be either an agonist (e.g. mimics), or
alternatively, an antagonist of a biological activity of a
naturally occurring form of the protein.
[0023] In a preferred embodiment, a peptide having at least one
biological activity of the subject caRAPT1 polypeptide may differ
in amino acid sequence from the sequence in SEQ ID No: 14, but such
differences result in a modified protein which functions in the
same or similar mariner as the native caRAPT1 or which has the same
or similar characteristics of the native protein. However, homologs
of the naturally occurring caRAPT1 protein are contemplated which
are antagonistic of the normal cellular role of the naturally
occurring protein.
[0024] In yet other preferred embodiments, the caRAPT1 protein is a
recombinant fusion protein which includes a second polypeptide
portion, e.g., a second polypeptide having an amino acid sequence
unrelated to the caRAPT1 sequence, e.g. the second polypeptide
portion is glutathione-S-transferase, e.g. the second polypeptide
portion is a DNA binding domain of transcriptional regulatory
protein, e.g. the second polypeptide portion is an RNA polymerase
activating domain, e.g. the fusion protein is functional in a
two-hybrid assay.
[0025] Yet another aspect of the present invention concerns an
immunogen comprising a caRAPT1 peptide in an immunogenic
preparation, the immunogen being capable of eliciting an immune
response specific for the caRAPT1 polypeptide; e.g. a humoral
response, e.g. an antibody response; e.g. a cellular response. In
preferred embodiments, the immunogen comprising an antigenic
determinant, e.g. a unique determinant, from a protein represented
by SEQ ID No: 14.
[0026] A still further aspect of the present invention features an
antibody preparation specifically reactive with an epitope of the
caRAPT1 immunogen.
[0027] Another aspect of the present invention provides a
substantially isolated nucleic acid having a nucleotide sequence
which encodes a RAPT1 polypeptide. In preferred embodiments: the
encoded polypeptide specifically binds a rapamycin complexes and/or
is able to either agonize or antagonize assembly of
rapamycin-containing protein complexes. The coding sequence of the
nucleic acid can comprise a RAPT1-encoding sequence which can be
identical to the cDNA shown in SEQ ID No: 1 or 11, or it can merely
be homologous to that sequence. For instance, the RAPT1-encoding
sequence preferably has a sequence at least 60% homologous to one
or both of the nucleotide sequences in SEQ ID No: 1 or 11, though
higher sequence homologies of, for example, 80%, 90% or 95% are
also contemplated. The nucleic acid can comprise the nucleotide
sequence represented in SEQ ID No: 1, or it can comprise a fragment
of that nucleic acid, which fragment may be, for instance, encode a
fragment of which is, for example, at least 5, 10, 20, 50, 100 or
133 amino acids in length. The polypeptide encoded by the nucleic
acid can be either an agonist (e.g. mimics), or alternatively, an
antagonist of a biological activity of a naturally occurring form
of the RAPT1 protein, e.g., the polypeptide is able to modulate
rapamycin-mediated protein complexes.
[0028] Furthermore, in certain preferred embodiments, the subject
RAPT1 nucleic acid will include a transcriptional regulatory
sequence, e.g. at least one of a transcriptional promoter or
transcriptional enhancer sequence, which regulatory sequence is
operably linked to the RAPT1 gene sequence. Such regulatory
sequences can be used in to render the RAPT1 gene sequence suitable
for use as an expression vector.
[0029] In yet a further preferred embodiment, the nucleic acid
hybridizes under stringent conditions to a nucleic acid probe
corresponding to at least 12 consecutive nucleotides of SEQ ID No:
1 and/or 11; preferably to at least 20 consecutive nucleotides, and
more preferably to at least 40 consecutive nucleotides.
[0030] Another aspect of the present invention provides a
substantially isolated nucleic acid having a nucleotide sequence
which encodes a rap-UBC polypeptide. In preferred embodiments: the
encoded polypeptide specifically binds a rapamycin complexes and/or
is able to either agonize or antagonize assembly of
rapamycin-containing protein complexes. The coding sequence of the
nucleic acid can comprise a rap-UBC-encoding sequence which can be
identical to the cDNA shown in SEQ ID No: 23, or it can merely be
homologous to that sequence. For instance, the rap-UBC-encoding
sequence preferably has a sequence at least 60% homologous to the
nucleotide sequences in SEQ ID No: 23, though higher sequence
homologies of, for example, 80%, 90% or 95% are also contemplated.
The nucleic acid can comprise the nucleotide sequence represented
in SEQ ID No: 23, or it can comprise a fragment of that nucleic
acid, which fragment may be, for instance, encode a fragment of
which is, for example, at least 5, 10, 20, 50, or 100 amino acids
in length. The polypeptide encoded by the nucleic acid can be
either an agonist (e.g. mimics), or alternatively, an antagonist of
a biological activity of a naturally occurring form of the rap-UBC
protein, e.g., the polypeptide is able to modulate
rapamycin-mediated protein complexes.
[0031] Furthermore, in certain preferred embodiments, the subject
rap-UBC nucleic acid will include a transcriptional regulatory
sequence, e.g. at least one of a transcriptional promoter or
transcriptional enhancer sequence, which regulatory sequence is
operably linked to the rap-UBC gene sequence. Such regulatory
sequences can be used in to render the rap-UBC gene sequence
suitable for use as an expression vector.
[0032] In yet a further preferred embodiment, the nucleic acid
hybridizes under stringent conditions to a nucleic acid probe
corresponding to at least 12 consecutive nucleotides of SEQ ID No:
23; preferably to at least 20 consecutive nucleotides, and more
preferably to at least 40 consecutive nucleotides.
[0033] Another aspect of the present invention provides a
substantially isolated nucleic acid having a nucleotide sequence
which encodes a caRAPT1 polypeptide. In preferred embodiments: the
encoded polypeptide specifically binds a rapamycin complexes and/or
is able to either agonize or antagonize assembly of
rapamycin-containing protein complexes. The coding sequence of the
nucleic acid can comprise a caRAPT1-encoding sequence which can be
identical to the cDNA shown in SEQ ID No: 13, or it can merely be
homologous to that sequence. For instance, the caRAPT1-encoding
sequence preferably has a sequence at least 60% homologous to the
nucleotide sequences in SEQ ID No: 13, though higher sequence
homologies of, for example, 80%, 90% or 95% are also contemplated.
The nucleic acid can comprise the nucleotide sequence represented
in SEQ ID No: 13, or it can comprise a fragment of that nucleic
acid, which fragment may be, for instance, encode a fragment of
which is, for example, at least 5, 10, 20, 50, 100 or 133 amino
acids in length. The polypeptide encoded by the nucleic acid can be
either an agonist (e.g. mimics), or alternatively, an antagonist of
a biological activity of a naturally occurring form of the caRAPT1
protein, e.g., the polypeptide is able to modulate
rapamycin-mediated protein complexes.
[0034] Furthermore, in certain preferred embodiments, the subject
caRAPT1 nucleic acid will include a transcriptional regulatory
sequence, e.g. at least one of a transcriptional promoter or
transcriptional enhancer sequence, which regulatory sequence is
operably linked to the caRAPT1 gene sequence. Such regulatory
sequences can be used in to render the caRAPT1 gene sequence
suitable for use as an expression vector.
[0035] In yet a further preferred embodiment, the nucleic acid
hybridizes under stringent conditions to a nucleic acid probe
corresponding to at least 12 consecutive nucleotides of SEQ ID No:
13; preferably to at least 20 consecutive nucleotides, and more
preferably to at least 40 consecutive nucleotides.
[0036] The invention also features transgenic non-human animals,
e.g. mice, rats, rabbits or pigs, having a transgene, e.g., animals
which include (and preferably express) a heterologous form of one,
of the RAP-BP genes described herein, e.g. a gene derived from
humans, or which misexpress an endogenous RAP-BP gene, e.g., an
animal in which expression of one or more of the subject
RAP-binding proteins is disrupted. Such a transgenic animal can
serve as an animal model for studying cellular disorders comprising
mutated or mis-expressed RAP-BP alleles or for use in drug
screening.
[0037] The invention also provides a probe/primer comprising a
substantially purified oligonucleotide, wherein the oligonucleotide
comprises a region of nucleotide sequence which hybridizes under
stringent conditions to at least 10 consecutive nucleotides of
sense or antisense sequence of one of SEQ ID Nos: 1, 11, 13 or 24,
or naturally occurring mutants thereof. In preferred embodiments,
the probe/primer further includes a label group attached thereto
and able to be detected. The label group can be selected, e.g.,
from a group consisting of radioisotopes, fluorescent compounds,
enzymes, and enzyme co-factors. Probes of the invention can be used
as a part of a diagnostic test kit for identifying transformed
cells, such as for detecting in a sample of cells isolated from a
patient, a level of a nucleic acid encoding one of the subject
RAP-binding proteins; e.g. measuring the RAP-BP mRNA level in a
cell, or determining whether the genomic RAP-BP gene has been
mutated or deleted. Preferably, the oligonucleotide is at least 10
nucleotides in length, though primers of 20, 30, 50, 100, or 150
nucleotides in length are also contemplated.
[0038] In yet another aspect, the invention provides assay systems
for screening test compounds for an molecules which induce an
interaction between a RAP-binding protein and a rapamycin/protein
complexes. An exemplary method includes the steps of (i) combining
a RAP-binding protein of the invention, an FK506-binding protein,
and a test compound, e.g., under conditions wherein, but for the
test compound, the FK506-binding protein and the RAP-binding
protein are unable to interact; and (ii) detecting the formation of
a drug-dependent complex which includes the FK506-binding protein
and the RAP-binding protein. A statistically significant change,
such as an increase, in the formation of the complex in the
presence of a test compound (relative to what is seen in the
absence of the test compound) is indicative of a modulation, e.g.,
induction, of the interaction between the FK506-binding protein and
the RAP-binding protein. Moreover, primary screens are provided in
which the FK506-binding protein and the RAP-binding protein are
combined in a cell-free system and contacted with the test
compound; i.e. the cell-free system is selected from a group
consisting of a cell lysate and a reconstituted protein mixture.
Alternatively, FK506-binding protein and the RAP-binding protein
are simultaneously expressed in a cell, and the cell is contacted
with the test compound, e.g. as an interaction trap assay (two
hybrid assay).
[0039] The present invention also provides a method for treating an
animal having unwanted cell growth characterized by a loss of
wild-type function of one or more of the subject RAP-binding
proteins, comprising administering a therapeutically effective
amount of an agent able to inhibit the interaction of the
RAP-binding protein with other cellular or viral proteins. In one
embodiment, the method comprises administering a nucleic acid
construct encoding a polypeptides represented in one of SEQ ID Nos:
2, 12 or 24, under conditions wherein the construct is incorporated
by cells deficient in that RAP-binding protein, and under
conditions wherein the recombinant gene is expressed, e.g. by gene
therapy techniques. In other embodiments, the action of a
naturally-occurring RAP-binding protein is antagonized by
therapeutic expression of a RAP-BP homolog which is an antagonist
of, for example, assembly of rapamycin-mediated complexes, or by
delivery of an antisense nucleic acid molecule which inhibits
transcription and/or translation of the targeted RAP-BP gene.
[0040] Another aspect of the present invention provides a method of
determining if a subject, e.g. a human patient, is at risk for a
disorder characterized by unwanted cell proliferation. The method
includes detecting, in a tissue of the subject, the presence or
absence of a genetic lesion characterized by at least one of (i) a
mutation of a gene encoding a protein represented by one of SEQ ID
Nos: 1, 11 or 13, or a homolog thereof; (ii) the mis-expression of
a gene encoding a protein represented by one of SEQ ID Nos: 1, 11
or 13; or (iii) the mis-incorporation of a RAP-binding protein in a
regulatory protein complex, e.g. a rapamycin-containing complex. In
preferred embodiments: detecting the genetic lesion includes
ascertaining the existence of at least one of: a deletion of one or
more nucleotides from the RAP-BP gene; an addition of one or more
nucleotides to the gene, an substitution of one or more nucleotides
of the gene, a gross chromosomal rearrangement of the gene; an
alteration in the level of a messenger RNA transcript of the gene;
the presence of a non-wild type splicing pattern of a messenger RNA
transcript of the gene; or a non-wild type level of the
protein.
[0041] For example, detecting the genetic lesion can include (i)
providing a probe/primer including an oligonucleotide containing a
region of nucleotide sequence which hybridizes to a sense or
antisense sequence of one of SEQ ID Nos: 1, 11 or 23, or naturally
occurring mutants thereof or 5' or 3' flanking sequences naturally
associated with the RAP-BP gene; (ii) exposing the probe/primer to
nucleic acid of the tissue; and (iii) detecting, by hybridization
of the probe/primer to the nucleic acid, the presence or absence of
the genetic lesion; e.g. wherein detecting the lesion comprises
utilizing the probe/primer to determine the nucleotide sequence of
the RAP-BP gene and, optionally, of the flanking nucleic acid
sequences. For instance, the probe/primer can be employed in a
polymerase chain reaction (PCR) or in a ligation chain reaction
(LCR). In alternate embodiments, the level of the RAP-binding
protein is detected in an immunoassay using an antibody which is
specifically immunoreactive with a protein represented by one of
SEQ ID Nos: 1, 11 or 23.
[0042] Another aspect of the present invention concerns a novel in
vivo method for the isolation of genes encoding proteins which
physically interact with a "bait" protein/drug complex. The method
relies on detecting the reconstitution of a transcriptional
activator in the presence of the drug, particularly wherein the
drug is a non-peptidyl small organic molecule (e.g. <2500K),
e.g. a macrolide, e.g. rapamycin, FK506 or cyclosporin. In
particular, the method makes use of chimeric genes which express
hybrid proteins. The first hybrid comprises the DNA-binding domain
of a transcriptional activator fused to the bait protein. The
second hybrid protein contains a transcriptional activation domain
fused to a "fish" protein, e.g. a test protein derived from a cDNA
library. If the fish and bait proteins are able to interact in a
drug-dependent manner, they bring into close proximity the two
domains of the transcriptional activator. This proximity is
sufficient to cause transcription of a reporter gene which is
operably linked to a transcriptional regulatory site responsive to
the transcriptional activator, and expression of the marker gene
can be detected and used to score for the interaction of the bait
protein/drug complex with another protein.
[0043] The practice of the present invention will employ, unless
otherwise indicated, conventional techniques of cell biology, cell
culture, molecular biology, transgenic biology, microbiology,
recombinant DNA, and immunology, which are within the skill of the
art. Such techniques are explained fully in the literature. See,
for example, Molecular Cloning A Laboratory Manual, 2nd Ed., ed. by
Sambrook, Fritsch and Maniatis (Cold Spring Harbor Laboratory
Press: 1989); DNA Cloning, Volumes I and II (D. N. Glover ed.,
1985); Oligonucleotide Synthesis (M. J. Gait ed., 1984); Mullis et
al. U.S. Pat. No. 4,683,195; Nucleic Acid Hybridization (B. D.
Hames & S. J. Higgins eds. 1984); Transcription And Translation
(B. D. Hames & S. J. Higgins eds. 1984); Culture Of Animal
Cells (R. I. Freshney, Alan R. Liss, Inc., 1987); Immobilized Cells
And Enzymes (IRL Press, 1986); B. Perbal, A Practical Guide To
Molecular Cloning (1984); the treatise, Methods In Enzymology
(Academic Press, Inc., N.Y.); Gene Transfer Vectors For Mammalian
Cells (J. H. Miller and M. P. Calos eds., 1987, Cold Spring Harbor
Laboratory); Methods In Enzymology, Vols. 154 and 155 (Wu et al.
eds.), Immunochemical Methods In Cell And Molecular Biology (Mayer
and Walker, eds., Academic Press, London, 1987); Handbook Of
Experimental Immunology, Volumes I-IV (D. M. Weir and C. C.
Blackwell, eds., 1986); Manipulating the Mouse Embryo, (Cold Spring
Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1986).
[0044] Other features and advantages of the invention will be
apparent from the following detailed description, and from the
claims.
DESCRIPTION OF THE FIGURES
[0045] FIG. 1 illustrates the map of the pACT vector used to clone
the human RAPT1 clone. The RAPT1-containing version of pACT, termed
"pIC524" has been deposited with the ATCC.
[0046] FIG. 2 illustrates the interaction of FKBP12 and hRAPT1
(rapamycin-binding domain) as a function of rapamycin
concentration. INteraction is detected as .beta.-galactosidase
activity. No interaction is detected if FK506 is used in place of
rapamycin, or if lex.da (a control plasmid) replaces FKBP12.
[0047] FIG. 3 illustrates the relative strengths of interaction
between pairs of FK506-binding proteins and rapamycin-binding
domain (BD) fusions in the presence of varying concentrations of
rapamycin, measured by .beta.-galactosidase expression (see Example
8). The yeast reporter strain VBY567 was transformed with the
indicated pairs of plasmids. LexA DNA-binding domain fusions to
human FKBP12, yeast FKBP12 and an unrelated sequence serving as
negative control were used as "baits". The VP16 acidic activation
domain fusions to human RAPT1 BD, human RAPT1 BD containing the
serine to arginine substitution, yeast Tor1 BD, yeast Tor2 BD (not
shown) and Candida albicans RAPT1 BD were tested for interaction
against the bait fusions. Transformants containing each pair of
plasmids were tested for .beta.-galactosidase expression on media
containing the chromogenic substrate X-gal. Colonies were scored as
either white (open bars) or blue (solid bars) after growth at
30.degree. C. for 2 days. The levels of .beta.-galactosidase
expression were qualitatively scored by the intensity of the blue
color, ranging from 1 (light blue) to 4 (deep blue).
DETAILED DESCRIPTION OF THE INVENTION
[0048] Recent studies have provided some remarkable insights into
the molecular basis of eukaryotic cell cycle regulation. Passage of
a mammalian cell through the cell cycle is regulated at a number of
key control points. Among these are the points of entry into and
exit from quiescence (G.sub.0), the restriction point, the
G.sub.1/S transition, and the G.sub.2/M transition (for review, see
Draetta (1990) Trends Biol Sci 15:378-383; and Sherr (1993) Cell
73:1059-1065). Ultimately, information from these check-point
controls is integrated through the regulated activity of a group of
related kinases, the cyclin-dependent kinases (CDKs). For example,
the G.sub.1-to-S phase transition is now understood to be timed
precisely by the transient assembly of multiprotein complexes
involving the periodic interaction of a multiplicity of cyclins and
cyclin-dependent kinases.
[0049] To illustrate, stimulation of quiescent T lymphocytes by
cell-bound antigens triggers a complex activation program resulting
in cell cycle entry (G.sub.0-to-G.sub.1 transition) and the
expression of high affinity interleukin-2 (IL-2) receptors. The
subsequent binding of IL-2 to its high affinity receptor drives the
progression of activated T cells through a late G.sub.1-phase
"restriction point" (Pardee (1989) Science 246:603-608), after
which the cells are committed to complete a relatively autonomous
program of DNA replication and, ultimately, mitosis.
[0050] One important outcome of the information concerning
eukaryotic cell cycle regulation is the delineation of a novel
class of molecular targets for potential growth-modulatory drugs.
The macrolide ester, rapamycin, is a potent immunosuppressant whose
mechanism of action is related to the inhibition of
cytokine-dependent T cell proliferation (Bierer et al. (1990) PNAS
87:9231-9235; Dumont et al. (1990) J Immunol 144:1418-1424; Sigal
et al. (1991) Transplant Proc 23:1-5; and Sigal et al. (1992) Annu
Rev Immunol 110:519-560). Rapamycin specifically interferes with a
late G.sub.1-phase event required for the progression of IL-2
stimulated cells into S-phase (Morice et al. (1993) J Biol Chem
268:3734-3738). The location of the cell cycle arrest point induced
by rapamycin hints that this drug interferes with the regulatory
proteins that govern the G.sub.1-to-S phase transition,
particularly in lymphocytes.
[0051] As described herein, the present invention relates to the
discovery of novel proteins of mammalian origin which are immediate
downstream targets for FKBP/rapamycin complexes. As described
below, a drug-dependent interaction trap assay was used to isolate
a number of proteins which bind the FKBP12/rapamycin complex, and
which are collectively referred to herein as "RAP-binding proteins"
or "RAP-BPs". In particular, mouse and human genes have been cloned
for a protein (referred to herein as "RAPT1") which is apparently
related to the yeast TOR1 and TOR2 gene products. Furthermore, a
novel ubiquitin-conjugating enzyme (referred to herein as
"rap-UBC") has been cloned based on its ability to bind
FKBP/rapamycin complexes. The present invention, therefore, makes
available novel proteins (both recombinant and purified forms),
recombinant genes, antibodies to RAP-binding proteins, and other
novel reagents and assays for diagnostic and therapeutic use.
Moreover, drug discovery assays are provided for identifying agents
which can modulate the binding of one or more of the subject
RAP-binding proteins with FK506-binding proteins. Such agents can
be useful therapeutically to alter the growth and/or
differentiation of a cell, but can also be used in vitro as
cell-culture additives for controlling proliferation and/or
differentiation of cultured cells and tissue. Other aspects of the
invention are described below or will be apparent to those skilled
in the art in light of the present disclosure.
[0052] For convenience, certain terms employed in the
specification, examples, and appended claims are collected
here.
[0053] As used herein, the term "nucleic acid" refers to
polynucleotides such as deoxyribonucleic acid (DNA), and, where
appropriate, ribonucleic acid (RNA). The term should also be
understood to include, as equivalents, analogs of either RNA or DNA
made from nucleotide analogs, and, as applicable to the embodiment
being described, single-stranded (such as sense or antisense) and
double-stranded polynucleotides.
[0054] The term "gene" or "recombinant gene" refers to a nucleic
acid comprising an open reading frame encoding a RAP-binding
protein of the present invention, including both exon and
(optionally) intron sequences. A "recombinant gene" refers to
nucleic acid encoding a RAP-binding protein and comprising RAP-BP
encoding exon sequences, though it may optionally include intron
sequences which are either derived from a chromosomal RAP-BP gene
or from an unrelated chromosomal gene. Exemplary recombinant genes
encoding illustrative RAP-binding proteins include a nucleic acid
sequence represented by on of SEQ ID Nos: 1, 11 or 23. The term
"intron" refers to a DNA sequence present in a given RAP-BP gene
which is not translated into protein and is generally found between
exons.
[0055] As used herein, the term "transfection" refers to the
introduction of a nucleic acid, e.g., an expression vector, into a
recipient cell by nucleic acid-mediated gene transfer.
"Transformation", as used herein, refers to a process in which a
cell's genotype is changed as a result of the cellular uptake of
exogenous DNA or RNA, and, for example, the transformed cell
expresses a recombinant form of the RAP-binding protein of the
present invention or where anti-sense expression occurs from the
transferred gene, the expression for a naturally-occurring form of
the RAP-binding protein is disrupted.
[0056] As used herein, the term "vector" refers to a nucleic acid
molecule capable of transporting another nucleic acid to which it
has been linked. One type of preferred vector is an episome, i.e.,
a nucleic acid capable of extra-chromosomal replication. Preferred
vectors are those capable of autonomous replication and/expression
of nucleic acids to which they are linked. Vectors capable of
directing the expression of genes to which they are operatively
linked are referred to herein as "expression vectors". In general,
expression vectors of utility in recombinant DNA techniques are
often in the form of "plasmids" which refer to circular double
stranded DNA loops which, in their vector form are not bound to the
chromosome. In the present specification, "plasmid" and "vector"
are used interchangeably as the plasmid is the most commonly used
form of vector. However, the invention is intended to include such
other forms of expression vectors which serve equivalent functions
and which become known in the art subsequently hereto.
[0057] "Transcriptional regulatory sequence" is a generic term used
throughout the specification to refer to DNA sequences, such as
initiation signals, enhancers, and promoters, which induce or
control transcription of protein coding sequences with which they
are operably linked. In preferred embodiments, transcription of a
recombinant RAP-BP gene is under the control of a promoter sequence
(or other transcriptional regulatory sequence) which controls the
expression of the recombinant gene in a cell-type in which
expression is intended. It will also be understood that the
recombinant gene can be under the control of transcriptional
regulatory sequences which are the same or which are different from
those sequences which control transcription of the
naturally-occurring form of the RAP-binding protein.
[0058] As used herein, the term "tissue-specific promoter" means a
DNA sequence that serves as a promoter, i.e., regulates expression
of a selected DNA sequence operably linked to the promoter, and
which effects expression of the selected DNA sequence in specific
cells of a tissue, such as cells of a lymphoid lineage, e.g. B or T
lymphocytes, or alternatively, e.g. hepatic cells. In an
illustrative embodiment, gene constructs utilizing
lymphoid-specific promoters can be used as a part of gene therapy
to provide dominant negative mutant forms of a RAP-binding protein
to render lymphatic cells resistant to rapamycin by directing
expression of the mutant form of RAP-BP in only lymphatic tissue.
The term also covers so-called "leaky" promoters, which regulate
expression of a selected DNA primarily in one tissue, but cause
expression in other tissues as well.
[0059] As used herein, a "transgenic animal" is any animal,
preferably a non-human mammal, a bird or an amphibian, in which one
or more of the cells of the animal contain heterologous nucleic
acid introduced by way of human intervention, such as by trangenic
techniques well known in the art. The nucleic acid is introduced
into the cell, directly or indirectly by introduction into a
precursor of the cell, by way of deliberate genetic manipulation,
such as by microinjection or by infection with a recombinant virus.
The term genetic manipulation does not include classical
cross-breeding, or in vitro fertilization, but rather is directed
to the introduction of a recombinant DNA molecule. This molecule
may be integrated within a chromosome, or it may be
extrachromosomally replicating DNA. In the typical transgenic
animals described herein, the transgene causes cells to express a
recombinant form of a subject RAP-binding protein, e.g. either
agonistic or antagonistic forms. However, transgenic animals in
which the recombinant RAP-BP gene is silent are also contemplated,
as for example, the FLP or CRE recombinase dependent constructs
described below. The "non-human animals" of the invention include
vertebrates such as rodents, non-human primates, sheep, dog, cow,
chickens, amphibians, reptiles, etc. Preferred non-human animals
are selected from the rodent family including rat and mouse, most
preferably mouse, though transgenic amphibians, such as members of
the Xenopus genus, and transgenic chickens can also provide
important tools for understanding, for example, embryogenesis and
tissue patterning. The term "chimeric animal" is used herein to
refer to animals in which the recombinant gene is found, or in
which the recombinant is expressed in some but not all cells of the
animal. The term "tissue-specific chimeric animal" indicates that
the recombinant RAP-BP gene is present and/or expressed in some
tissues but not others.
[0060] As used herein, the term "transgene" means a nucleic acid
sequence (encoding, e.g., a RAP-binding protein), which is partly
or entirely heterologous, i.e., foreign, to the transgenic animal
or cell into which it is introduced, or, is homologous to an
endogenous gene of the transgenic animal or cell into which it is
introduced, but which is designed to be inserted, or is inserted,
into the animal's genome in such a way as to alter the genome of
the cell into which it is inserted (e.g., it is inserted at a
location which differs from that of the natural gene or its
insertion results in a knockout). A transgene can include one or
more transcriptional regulatory sequences and any other nucleic
acid, such as introns, that may be necessary for optimal expression
of a selected nucleic acid.
[0061] As is well known, genes for a particular polypeptide may
exist in single or multiple copies within the genome of an
individual. Such duplicate genes may be identical or may have
certain modifications, including nucleotide substitutions,
additions or deletions, which all still code for polypeptides
having substantially the same activity. The term "DNA sequence
encoding a RAP-binding protein" may thus refer to one or more genes
within a particular individual. Moreover, certain differences in
nucleotide sequences may exist between individual organisms, which
are called alleles. Such allelic differences may or may not result
in differences in amino acid sequence of the encoded polypeptide
yet still encode a protein with the same biological activity.
[0062] "Homology" refers to sequence similarity between two
peptides or between two nucleic acid molecules. Homology can be
determined by comparing a position in each sequence which may be
aligned for purposes of comparison. When a position in the compared
sequence is occupied by the same base or amino acid, then the
molecules are homologous at that position. A degree of homology
between sequences is a function of the number of matching or
homologous positions shared by the sequences.
[0063] "Cells," "host cells" or "recombinant host cells" are terms
used interchangeably herein. It is understood that such terms refer
not only to the particular subject cell but to the progeny or
potential progeny of such a cell. Because certain modifications may
occur in succeeding generations due to either mutation or
environmental influences, such progeny may not, in fact, be
identical to the parent cell, but are still included within the
scope of the term as used herein.
[0064] A "chimeric protein" or "fusion protein" is a fusion of a
first amino acid sequence encoding one of the subject RAP-binding
proteins with a second amino acid sequence defining a domain
foreign to and not substantially homologous with any domain of the
subject RAP-BP. A chimeric protein may present a foreign domain
which is found (albeit in a different protein) in an organism which
also expresses the first protein, or it may be an "interspecies",
"intergeneric", etc. fusion of protein structures expressed by
different kinds of organisms.
[0065] The term "evolutionarily related to", with respect to
nucleic acid sequences encoding RAP-binding proteins, refers to
nucleic acid sequences which have arisen naturally in an organism,
including naturally occurring mutants. Moreover, the term also
refers to nucleic acid sequences which, while initially derived
from naturally-occurring isoforms of RAP-binding proteins, have
been altered by mutagenesis, as for example, such combinatorial
mutagenesis as described below, yet which still encode polypeptides
that bind FKBP/rapamycin complexes, or that retain at least one
activity of the parent RAP-binding protein, or which are
antagonists of that protein's activities.
[0066] The term "isolated" as also used herein with respect to
nucleic acids, such as DNA or RNA, refers to molecules separated
from other DNAs, or RNAs, respectively, that are present in the
natural source of the macromolecule. For example, an isolated
nucleic acid encoding one of the subject RAP-binding proteins
preferably includes no more than 10 kilobases (kb) of nucleic acid
sequence which naturally immediately flanks that particular RAP-BP
gene in genomic DNA, more preferably no more than 5 kb of such
naturally occurring flanking sequences, and most preferably less
than 1.5 kb of such naturally occurring flanking sequence. The term
isolated as used herein also refers to a nucleic acid or peptide
that is substantially free of cellular material, viral material, or
culture medium when produced by recombinant DNA techniques, or
chemical precursors or other chemicals when chemically synthesized.
Moreover, an "isolated nucleic acid" is meant to include nucleic
acid fragments which are not naturally occurring as fragments and
would not be found in the natural state.
[0067] As used herein, an "rapamycin-binding domain" refers to a
polypeptide sequence which confers a binding activity for
specifically interacting with an FKBP/rapamycin complex. Exemplary
rapamycin-binding domains are represented within the polypeptides
defined by Val26-Tyr160 of SEQ ID No. 2, Val1272-Tyr1444 of SEQ ID
No. 12, Val41-Tyr173 of SEQ ID No. 14, Val1-Tyr133 of SEQ ID No.
16, and Val1-Arg133 of SEQ ID No. 18.
[0068] A "RAPT1-like polypeptide" refers to a eukaryotic cellular
protein which is a direct binding target protein for an
FKBP/rapamycin complex, and which shares some sequence homology
with a mammalian RAPT1 protein of the present invention. Exemplary
RAPT1-like polypeptides include the yeast TOR1 and TOR2
proteins.
[0069] A "soluble protein" refers to a polypeptide which does not
precipitate (e.g. at least about 95-percent, more preferably at
least 99-percent remains in the supernatant) from an aqueous buffer
under physiologically isotonic condition, for example, 0.14M NaCl
or sucrose, at a protein concentration of as much as 10 .mu.M, more
preferably as much as 10 mM. These conditions specifically relate
to the absence of detergents or other denaturants in effective
concentrations.
[0070] As described below, one aspect of this invention pertains to
an isolated nucleic acid comprising the nucleotide sequence
encoding a RAP-binding protein, fragments thereof, and/or
equivalents of such nucleic acids. The term nucleic acid as used
herein is intended to include such fragments and equivalents. The
term equivalent is understood to include nucleotide sequences
encoding functionally equivalent RAP-binding proteins or
functionally equivalent peptides which, for example, retain the
ability to bind to the FKBP/rapamycin complex, and which may
additionally retain other activities of a RAP-binding protein such
as described herein. Equivalent nucleotide sequences will include
sequences that differ by one or more nucleotide substitutions,
additions or deletions, such as allelic variants; and will also
include sequences that differ from the nucleotide sequence of the
mammalian RAPT1 genes represented in SEQ ID No: 1 or SEQ ID No. 11,
or the nucleotide sequence of the fungal RAPT1 protein of SEQ ID
No. 13, or the nucleotide sequence encoding the UBC enzyme
represented in SEQ ID No. 23, due to the degeneracy of the genetic
code. Equivalent nucleic acids will also include nucleotide
sequences that hybridize under stringent conditions (i.e.,
equivalent to about 20-27.degree. C. below the melting temperature
(T.sub.m) of the DNA duplex formed in about 1M salt) to a
nucleotide sequence of a RAPT1 protein comprising either the
sequence shown in SEQ ID No: 2 or 12, or to a nucleotide sequence
of the RAPT1 gene insert of pIC524 (ATCC accession no. 75787).
Likewise, equivalent nucleic acids encoding homologs of the subject
rap-UBC enzyme include nucleotide sequences that hybridize under
stringent conditions to a nucleotide sequence represented in SEQ ID
No. 23, or to a nucleotide sequence of the rap-UBC gene insert of
SMR4-15 (ATCC accession no. 75786). In one embodiment, equivalents
will further include nucleic acid sequences derived from, and
evolutionarily related to, a nucleotide sequence comprising that
shown in either SEQ ID No. 1, or SEQ ID No. 11, or SEQ ID No. 13,
or SEQ ID No. 23.
[0071] The amino acid sequences shown in each of SEQ ID Nos: 2 and
12 represent biologically active portions of larger full-length
forms of mammalian RAPT1 proteins. In preferred embodiments, the
RAPT1 polypeptide includes a binding domain for binding to
FKBP/rapamycin complexes, such as the rap-binding domains
represented by residues 28-160 of SEQ ID No. 2, or residues
1272-1444 of SEQ ID No. 12. In preferred embodiments, portions of
the RAPT1 protein isolated from the full-length form will retain a
specific binding affinity for an FKBP/rapamycin complex, e.g. an
FKBP12/rapamycin complex, e.g. an affinity at least 50%, more
preferably at least 75%, and even more preferably at least 90% that
of the binding affinity of a naturally-occurring form of RAPT1 for
such a rapamycin complex. A polypeptide is considered to possess a
biological activity of a RAPT1 protein if the polypeptide has one
or more of the following properties: the ability to bind an
FKBP/drug complex, e.g., an FKBP/macrolide complex, e.g., an
FKBP/rapamycin complex; the ability to bind to an FKBP12/rapamycin
complex; the ability to modulate assembly of
FKBP/rapamycin-complexes; the ability to regulate cell
proliferation, e.g., to regulate the cell-cycle, e.g., to regulate
the progression of a cell through the G.sub.1 phase. Moreover,
based on sequence analysis, the biological function of the subject
RAPT1 proteins can include a phosphatidyl inositol-kinase activity,
such as a PI-3-kinase activity. A protein also has biological
activity if it is a specific agonist or antagonist of one of the
above recited properties.
[0072] Likewise, the amino acid sequence shown in SEQ ID No. 24
represents a biologically active portion of a larger full-length
form of a human ubiquitin-conjugating enzyme. Accordingly,
preferred embodiments of the subject rap-UBC comprise at least a
portion of the amino acid sequence of SEQ ID No. 24 (or of the
rap-UBC gene insert of SMR4-15 described in Example 5) which
possess either the ability to bind a FKBP/rapamycin complex or the
ability to conjugating ubiquitin to a cellular protein, or both.
Given that rapamycin causes a block in the cell-cycle during G1
phase, it is probable that the spectrum of biological activity of
the subject rap-UBC enzyme includes control of half-lives of
certain cell cycle regulatory proteins, particularly relatively
short lived proteins (e.g. proteins which have half-lives on the
order of 30 minutes to 2 hours). For example, the subject UBC may
have the ability to mediate ubiquitination of, for example, p53,
myc and/or cyclins, and therefore affects the cellular half-life of
a cell-cycle regulatory protein in proliferating cells. The binding
of the rap-UBC to the FKBP/rapamycin complex may result in
sequestering of the enzyme away from its substrate proteins. Thus,
rapamycin may interfere with the ubiquitin-mediated degradation of
p53 in a manner which causes cellular p53 levels to rise which in
turn inhibits progression of the G1 phase.
[0073] Moreover, it will be generally appreciated that, under
certain circumstances, it may be advantageous to provide homologs
of the cloned RAP-binding proteins which function in a limited
capacity as one of either a RAP-BP agonists or a RAP-BP
antagonists, in order to either promote or inhibit only a subset of
the biological activities of the naturally occurring form of the
protein. Thus, specific biological effects can be elicited by
treatment with a homolog of limited function, and with fewer side
effects relative to treatment with agonists or antagonists which
are directed- to all RAP-BP related biological activities. For
instance, RAPT1 analogs and rap-UBC analogs can be generated which
do not bind in any substantial fashion to an FKBP/rapamycin
complex, yet which retain most of the other biological functions
ascribed to the naturally-occurring form of the protein. For
example, the RAPT1 homolog might retain a kinase activity, such as
a phosphatidyl inositol kinase activity, e.g. a PI-3-kinase
activity. Conversely, the RAPT1 homolog may be engineered to lack a
kinase activity, yet retain the ability to bind an FKBP/rapamycin
complex. For instance, the FKBP/rapamycin binding portions of the
RAPT1 homologs, such as the rapamycin-binding domains represented
in SEQ ID Nos. 2 or 12, can be used to competitively inhibit
binding to rapamycin complexes by the naturally-occurring form of
RAPT1. In similar fashion, rap-UBC homologs can be provided which,
for example, are catalytically inactive (e.g. an active site
mutant, e.g. Cys-92 to Ser) yet which still binds an FKBP/rapamycin
complex. Such a homolog is likely to act antagonistically to the
role of the natural enzyme in rapamycin action
[0074] Homologs of the subject RAP-binding proteins can be
generated by mutagenesis, such as by discrete point mutation(s), or
by truncation. For instance, mutation can give rise to homologs
which retain substantially the same, or merely a subset, of the
biological activity of the RAP-BP from which it was derived.
Alternatively, antagonistic forms of the protein can be generated
which are able to inhibit the function of the naturally occurring
form of the protein, such as by competitively binding to
FKBP/rapamycin complexes.
[0075] The nucleotide sequence shown in SEQ ID No: 1 encodes a
biologically active portion of the mouse RAPT1 protein, and in
particular, includes a rapamycin-binding domain. Accordingly, in
one embodiment of the present invention, the nucleic acid is a cDNA
encoding a peptide including an amino acid sequence substantially
homologous to that portion of the RAPT1 protein represented by SEQ
ID No: 2. Preferably, the nucleic acid is a cDNA molecule
comprising at least a portion of the nucleotide sequence shown in
SEQ ID No: 1. Likewise, the nucleotide sequence shown in SEQ ID No.
11 encodes a biologically active portion of the human RAPT1
protein. Thus, another embodiment of the present invention provides
a cDNA encoding a peptide having an amino acid sequence
substantially homologous to that portion of the RAPT1 protein
represented by SEQ ID No. 12. In similar fashion, the present
invention provides a cDNA encoding at least a portion of the
Candida RAPT1 polypeptide of SEQ ID No. 14.
[0076] Preferred nucleic acids encode a polypeptide including an
amino acid sequence which is at least 60% homologous, more
preferably 70% homologous and most preferably 80% homologous with
an amino acid sequence shown in one or more of SEQ ID Nos: 2, 12 or
14. Nucleic acids encoding peptides, particularly peptides having
an activity of a RAPT1 protein, and comprising an amino acid
sequence which is at least about 90%, more preferably at least
about 95%, and most preferably at least about 98-99% homologous
with a sequence shown in either SEQ ID No: 2, 12 or 14 are also
within the scope of the invention, as of course are proteins which
are identical to the aforementioned sequence listings. In one
embodiment, the nucleic acid is a cDNA encoding a peptide having at
least one activity of a subject RAP-binding protein. Preferably,
the nucleic acid is a cDNA molecule comprising at least a portion
of the nucleotide sequence represented in one of SEQ ID Nos: 2, 12
or 14. A preferred portion of these cDNA molecules includes the
coding region of the gene. For instance, a recombinant RAP-BP gene
can include nucleotide sequences of a PCR fragment generated by
amplifying the coding sequences for one of the RAP-BP clones of
ATCC deposit No: 75787.
[0077] The nucleotide sequence shown in SEQ ID No: 23 encodes a
biologically active portion of the human rap-UBC enzyme.
Accordingly, in one embodiment of the present invention, the
nucleic acid is a cDNA encoding a peptide including an amino acid
sequence substantially homologous to that portion of the rap-UBC
protein represented by SEQ ID No: 24. Preferably, the nucleic acid
is a cDNA molecule comprising at least a portion of the nucleotide
sequence shown in SEQ ID No: 23. Preferred nucleic acids encode a
peptide comprising an amino acid sequence which is at least 60%
homologous, more preferably 70% homologous and most preferably 80%
homologous with an amino acid sequence shown in SEQ ID No: 24.
Nucleic acids encoding polypeptides, particularly those having a
ubiquitin conjugating activity, and comprising an amino acid
sequence which is at least about 90%, more preferably at least
about 95%, and most preferably at least about 98-99% homologous
with a sequence shown in SEQ ID No: 24 are also within the scope of
the invention.
[0078] In a further embodiment of the invention, the recombinant
RAP-BP genes can further include, in addition to the amino acid
sequence shown in SEQ ID No. 2, 12 or 24, additional nucleotide
sequences which encode amino acids at the C-terminus and N-terminus
of the protein though not shown in those sequence listings. For
instance, the recombinant RAPT1 gene can include nucleotide
sequences of a PCR fragment generated by amplifying the RAPT1
coding sequence of pIC524 using sets of primers such described in
Example 4. Additionally, in light of the present disclosure, it
will be possible using no more than routine experimentation to
isolate from, for example, a cDNA library, the remaining 5'
sequences of RAPT1, such as by RACE PCR using primers designed from
the present sequences. In particular, the invention contemplates a
recombinant RAPT1 gene encoding the full-length RAPT1 protein. Yet
another embodiment of the invention includes nucleic acids that
encode isoforms of the mouse or human RAPT1, especially isoforms
(e.g. splicing variants, allelic variants, etc.) that are capable
of binding with the FKBP12/rapamycin complex. Such isoforms, as
well as other members of the larger family of RAP-binding proteins,
can be isolated using the drug-dependent interaction trap assays
described in further detail below.
[0079] Another aspect of the invention provides a nucleic acid that
hybridizes under high or low stringency conditions to a nucleic
acid which encodes a peptide having at least a portion of an amino
acid sequence represented by one of SEQ ID Nos.: 2, 12, 14 or 24.
Appropriate stringency conditions which promote DNA hybridization,
for example, 6.0.times. sodium chloride/sodium citrate (SSC) at
about 45.degree. C., followed by a wash of 2.0.times.SSC at
50.degree. C., are known to those skilled in the art or can be
found in Current Protocols in Molecular Biology, John Wiley &
Sons, N.Y. (1989), 6.3.1-6.3.6. For example, the salt concentration
in the wash step can be selected from a low stringency of about
2.0.times.SSC at 50.degree. C. to a high stringency of about
0.2.times.SSC at 50.degree. C. In addition, the temperature in the
wash step can be increased from low stringency conditions at room
temperature, about 22.degree. C., to high stringency conditions at
about 65.degree. C.
[0080] Nucleic acids having a sequence which differs from the
nucleotide sequence shown in any of SEQ ID Nos: 1, 11, 13 or 23 due
to degeneracy in the genetic code are also within the scope of the
invention. Such nucleic acids encode functionally equivalent
peptides (i.e., a peptide having a biological activity of a
RAP-binding protein) but that differ in sequence from the appended
sequence listings due to degeneracy in the genetic code. For
example, a number of amino acids are designated by more than one
triplet. Codons that specify the same amino acid, or synonyms (for
example, CAU and CAC each encode histidine) may result in "silent"
mutations which do not affect the amino acid sequence of the
RAP-binding protein. However, it is expected that DNA sequence
polymorphisms that do lead to changes in the amino acid sequences
of the subject RAP-binding proteins will exist among vertebrates.
One skilled in the art will appreciate that these variations in one
or more nucleotides (up to about 3-5% of the nucleotides) of the
nucleic acids encoding polypeptides having an activity of a
RAP-binding protein may exist among individuals of a given species
due to natural allelic variation. Any and all such nucleotide
variations and resulting amino acid polymorphisms are within the
scope of this invention.
[0081] The present invention also provides nucleic acid encoding
only a portion of a RAPT1 protein, such as the rapamycin-binding
domain. As used herein, a fragment of a nucleic acid encoding such
a portion of a RAP-binding protein refers to a nucleotide sequence
having fewer nucleotides than the nucleotide sequence encoding the
entire amino acid sequence of a full-length RAP-binding protein,
yet which still includes enough of the coding sequence so as to
encode a polypeptide which is capable of binding to an
FKBP/rapamycin complex. Moreover, nucleic acid fragments within the
scope of the invention include those fragments capable of
hybridizing under high or low stringency conditions with nucleic
acids from other vertebrate species, particularly other mammals,
and can be used in screening protocols to detect homologs, of the
subject RAP-binding proteins. Nucleic acids within the scope of the
invention may also contain linker sequences, modified restriction
endonuclease sites and other sequences useful for molecular
cloning, expression or purification of recombinant peptides derived
from RAP-binding proteins.
[0082] As indicated by the examples set out below, a nucleic acid
encoding a RAP-binding protein may be obtained from mRNA present in
any of a number of cells from a vertebrate organism, particularly
from mammals, e.g. mouse or human. It should also be possible to
obtain nucleic acids encoding RAP-binding proteins from genomic DNA
obtained from both adults and embryos. For example, a gene encoding
a RAP-binding protein can be cloned from either a cDNA or a genomic
library in accordance with protocols herein described, as well as
those generally known in the art. For instance, a cDNA encoding a
RAPT1 protein, particularly other isoforms of the RAPT1 proteins
represented by either SEQ ID No. 2 or 12, can be obtained by
isolating total mRNA from a mammalian cell, e.g. a human cell,
generating double stranded cDNAs from the total mRNA, cloning the
cDNA into a suitable plasmid or bacteriophage vector, and isolating
RAPT1 clones using any one of a number of known techniques, e.g.
oligonucleotide probes or western blot analysis. Genes encoding
proteins related to the subject RAP-binding proteins can also be
cloned using established polymerase chain reaction techniques in
accordance with the nucleotide sequence information provided by the
invention. The nucleic acid of the invention can be DNA or RNA.
[0083] Another aspect of the invention relates to the use of the
isolated nucleic acid in "antisense" therapy. As used herein,
"antisense" therapy refers to administration or in situ generation
of oligonucleotide probes or their derivatives which specifically
hybridizes (e.g. binds) under cellular conditions, with the
cellular mRNA and/or genomic DNA encoding a RAP-binding protein so
as to inhibit expression of that protein, as for example by
inhibiting transcription and/or translation. The binding may be by
conventional base pair complementarity, or, for example, in the
case of binding to DNA duplexes, through specific interactions in
the major groove of the double helix. In general, "antisense"
therapy refers to the range of techniques generally employed in the
art, and includes any therapy which relies on specific binding to
oligonucleotide sequences.
[0084] An antisense construct of the present invention can be
delivered, for example, as an expression plasmid which, when
transcribed in the cell, produces RNA which is complementary to at
least a unique portion of the cellular mRNA which encodes a
RAP-binding protein. Alternatively, the antisense construct can be
an oligonucleotide probe which is generated ex vivo and which, when
introduced into the cell causes inhibition of expression by
hybridizing with the mRNA and/or genomic sequences of a RAP-BP
gene. Such oligonucleotide probes are preferably modified
oligonucleotides which are resistant to endogenous nucleases, e.g.
exonucleases and/or endonucleases, and is therefore stable in vivo.
Exemplary nucleic acid molecules for use as antisense
oligonucleotides are phosphoramidate, phosphothioate and
methylphosphonate analogs of DNA (see also U.S. Pat. Nos.
5,176,996; 5,264,564; and 5,256,775). Additionally, general
approaches to constructing oligomers useful in antisense therapy
have been reviewed, for example, by van der Krol et al. (1988)
Biotechniques 6:958-976; and Stein et al. (1988) Cancer Res
48:2659-2668.
[0085] Accordingly, the modified oligomers of the invention are
useful in therapeutic, diagnostic, and research contexts. In
therapeutic applications, the oligomers are utilized in a manner
appropriate for antisense therapy in general. For such therapy, the
oligomers of the invention can be formulated for a variety of loads
of administration, including systemic and topical or localized
administration. Techniques and formulations generally may be found
in Remmington's Pharmaceutical Sciences, Meade Publishing Co.,
Easton, Pa. For systemic administration, injection is preferred,
including intramuscular, intravenous, intraperitoneal, and
subcutaneous for injection, the oligomers of the invention can be
formulated in liquid solutions, preferably in physiologically
compatible buffers such as Hank's solution or Ringer's solution. In
addition, the oligomers may be formulated in solid form and
redissolved or suspended immediately prior to use. Lyophilized
forms are also included.
[0086] Systemic administration can also be by transmucosal or
transdermal means, or the compounds can be administered orally. For
transmucosal or transdermal administration, penetrants appropriate
to the barrier to be permeated are used in the formulation. Such
penetrants are generally known in the art, and include, for
example, for transmucosal administration bile salts and fusidic
acid derivatives. In addition, detergents may be used to facilitate
permeation. Transmucosal administration may be through nasal sprays
or using suppositories. For oral administration, the oligomers are
formulated into conventional oral administration forms such as
capsules, tablets, and tonics. For topical administration, the
oligomers of the invention are formulated into ointments, salves,
gels, or creams as generally known in the art.
[0087] In addition to use in therapy, the oligomers of the
invention may be used as diagnostic reagents to detect the presence
or absence of the target DNA or RNA sequences to which they
specifically bind. Such diagnostic tests are described in further
detail below.
[0088] Likewise, the antisense constructs of the present invention,
by antagonizing the normal biological activity of a RAP-binding
protein, can be used in the manipulation of tissue, e.g. tissue
proliferation and/or differentiation, both for in vivo and ex vivo
tissue culture systems.
[0089] This invention also provides expression vectors containing a
nucleic acid encoding a RAP-binding protein of the present
invention, operably linked to at least one transcriptional
regulatory sequence. Operably linked is intended to mean that the
nucleotide sequence is linked to a regulatory sequence in a manner
which allows expression of the nucleotide sequence. Regulatory
sequences are art-recognized and are selected to direct expression
of a recombinant RAP-binding protein. Accordingly, the term
transcriptional regulatory sequence includes promoters, enhancers
and other expression control elements. Such regulatory sequences
are described in Goeddel; Gene Expression Technology: Methods in
Enzymology 185, Academic Press, San Diego, Calif. (1990). For
instance, any of a wide variety of expression control
sequences-sequences that control the expression of a DNA sequence
when operatively linked to it may be used in these vectors to
express DNA sequences encoding the RAP-binding proteins of this
invention. Such useful expression control sequences, include, for
example, the early and late promoters of SV40, adenovirus or
cytomegalovirus immediate early promoter, the lac system, the trp
system, the TAC or TRC system, T7 promoter whose expression is
directed by T7 RNA polymerase, the major operator and promoter
regions of phage lambda, the control regions for fd coat protein,
the promoter for 3-phosphoglycerate kinase or other glycolytic
enzymes, the promoters of acid phosphatase, e.g., Pho5, the
promoters of the yeast .alpha.-mating factors, the polyhedron
promoter of the baculovirus system and other sequences known to
control the expression of genes of prokaryotic or eukaryotic cells
or their viruses, and various combinations thereof. It should be
understood that the design of the expression vector may depend on
such factors as the choice of the host cell to be transformed
and/or the type of protein desired to be expressed. Moreover, the
vector's copy number, the ability to control that copy number and
the expression of any other proteins encoded by the vector, such as
antibiotic markers, should also be considered. In one embodiment,
the expression vector includes a recombinant gene encoding a
polypeptide which mimics or otherwise agonizes the action of a
RAP-binding protein, or alternatively, which encodes a polypeptide
that antagonizes the action of an authentic RAP-binding protein.
Such expression vectors can be used to transfect cells and thereby
produce polypeptides, including fusion proteins, encoded by nucleic
acids as described herein.
[0090] Moreover, the gene constructs of the present invention can
also be used as a part of a gene therapy protocol to deliver
nucleic acids encoding either an agonistic or antagonistic form of
one or more of the subject RAP-binding proteins. Thus, another
aspect of the invention features expression vectors for in vivo
transfection and expression of a RAP-binding protein in particular
cell types so as to reconstitute the function of, or alternatively,
abrogate the function of one or more of the subject RAP-binding
proteins in a cell in which that protein or other transcriptional
regulatory proteins to which it bind are misexpressed. For example,
gene therapy can be used to deliver a gene encoding a
rapamycin-insensitive RAP-binding protein in order to render a
particular tissue or cell-type resistant to rapamycin induced
cell-cycle arrest.
[0091] Expression constructs of the subject RAP-binding proteins,
and mutants thereof, may be administered in any biologically
effective carrier, e.g. any formulation or composition capable of
effectively delivering the RAP-BP gene to cells in vivo. Approaches
include insertion of the subject gene in viral vectors including
recombinant retroviruses, adenovirus, adeno-associated virus, and
herpes simplex virus-1, or recombinant bacterial or eukaryotic
plasmids. Viral vectors transfect cells directly; plasmid DNA can
be delivered with the help of, for example, cationic liposomes
(lipofectin) or derivatized (e.g. antibody conjugated), polylysine
conjugates, gramacidin S, artificial viral envelopes or other such
intracellular carriers, as well as direct injection of the gene
construct or CaPO.sub.4 precipitation carried out in vivo. It will
be appreciated that because transduction of appropriate target
cells represents the critical first step in gene therapy, choice of
the particular gene delivery system will depend on such factors as
the phenotype of the intended target and the route of
administration, e.g. locally or systemically. Furthermore, it will
be recognized that the particular gene construct provided for in
vivo transduction of RAP-BP expression are also useful for in vitro
transduction of cells, such as in diagnostic assays.
[0092] A preferred approach for in vivo introduction of nucleic
acid into a cell is by use of a viral vector containing nucleic
acid, e.g. a cDNA, encoding the particular form of the RAP-binding
protein desired. Infection of cells with a viral vector has the
advantage that a large proportion of the targeted cells can receive
the nucleic acid. Additionally, molecules encoded within the viral
vector, e.g., by a cDNA contained in the viral vector, are
expressed efficiently in cells which have taken up viral vector
nucleic acid.
[0093] Retrovirus vectors and adeno-associated virus vectors are
generally understood to be the recombinant gene delivery system of
choice for the transfer of exogenous genes in vivo, particularly
into humans. These vectors provide efficient delivery of genes into
cells, and the transferred nucleic acids are stably integrated into
the chromosomal DNA of the host. A major prerequisite for the use
of retroviruses is to ensure the safety of their use, particularly
with regard to the possibility of the spread of wild-type virus in
the cell population. The development of specialized cell lines
(termed "packaging cells") which produce only replication-defective
retroviruses has increased the utility of retroviruses for gene
therapy, and defective retroviruses are well characterized for use
in gene transfer for gene therapy purposes (for a review see
Miller, A. D. (1990) Blood 76:271). Thus, recombinant retrovirus
can be constructed in which part of the retroviral coding sequence
(gag, pol, env) has been replaced by nucleic acid encoding one of
the subject receptors rendering the retrovirus replication
defective.
[0094] The replication defective retrovirus is then packaged into
virions which can be used to infect a target cell through the use
of a helper virus by standard techniques. Protocols for producing
recombinant retroviruses and for infecting cells in vitro or in
vivo with such viruses can be found in Current Protocols in
Molecular Biology, Ausubel, F. M. et al. (eds.) Greene Publishing
Associates, (1989), Sections 9.10-9.14 and other standard
laboratory manuals. Examples of suitable retroviruses include pLJ,
pZIP, pWE and pEM which are well known to those skilled in the art.
Examples of suitable packaging virus lines for preparing both
ecotropic and amphotropic retroviral systems include .psi.Crip,
.psi.Cre, .psi.2 and .psi.Am. Retroviruses have been used to
introduce a variety of genes into many different cell types,
including lymphocytes, in vitro and/or in vivo (see for example
Eglitis, et al. (1985) Science 230:1395-1398; Danos and Mulligan
(1988) Proc. Natl. Acad. Sci. USA 85:6460-6464; Wilson et al.
(1988) Proc. Natl. Acad. Sci. USA 85:3014-3018; Armentano et al.
(1990) Proc. Natl. Acad. Sci. USA 87:6141-6145; Huber et al. (1991)
Proc. Natl. Acad. Sci. USA 88:8039-8043; Ferry et al. (1991) Proc.
Natl. Acad. Sci. USA 88:8377-8381; Chowdhury et al. (1991) Science
254:1802-1805; van Beusechem et al. (1992) Proc. Natl. Acad. Sci.
USA 89:7640-7644; Kay et al. (1992) Human Gene Therapy 3:641-647;
Dai et al. (1992) Proc. Natl. Acad. Sci. USA 89:10892-10895; Hwu et
al. (1993) J. Immunol. 150:4104-4115; U.S. Pat. No. 4,868,116; U.S.
Pat. No. 4,980,286; PCT Application WO 89/07136; PCT Application WO
89/02468; PCT Application WO 89/05345; and PCT Application WO
92/07573).
[0095] Furthermore, it has been shown that it is possible to limit
the infection spectrum of retroviruses and consequently of
retroviral-based vectors, by modifying the viral packaging proteins
on the surface of the viral particle (see, for example PCT
publications WO93/25234 and WO94/06920). For instance, strategies
for the modification of the infection spectrum of retroviral
vectors include: coupling antibodies specific for cell surface
antigens to the viral env protein (Roux et al. (1989) PNAS
86:9079-9083; Julan et al. (1992) J. Gen Virol 73:3251-3255; and
Goud et al. (1983) Virology 163:251-254); or coupling cell surface
receptor ligands to the viral env proteins (Neda et al. (1991) J
Biol Chem 266:14143-14146). Coupling can be in the form of the
chemical cross-linking with a protein or other variety (e.g.
lactose to convert the env protein to an asialoglycoprotein), as
well as by generating fusion proteins (e.g. single-chain
antibody/env fusion proteins). This technique, while useful to
limit or otherwise direct the infection to certain tissue types,
can also be used to convert an ecotropic vector in to an
amphotropic vector.
[0096] Moreover, use of retroviral gene delivery can be further
enhanced by the use of tissue- or cell-specific transcriptional
regulatory sequences which control expression of the RAP-BP gene of
the retroviral vector.
[0097] Another viral gene delivery system useful in the present
invention utilizes adenovirus-derived vectors. The genome of an
adenovirus can be manipulated such that it encodes and expresses a
gene product of interest but is inactivated in terms of its ability
to replicate in a normal lytic viral life cycle. See for example
Berkner et al. (1988) BioTechniques 6:616; Rosenfeld et al. (1991)
Science 252:431-434; and Rosenfeld et al. (1992) Cell 68:143-155.
Suitable adenoviral vectors derived from the adenovirus strain Ad
type 5 dl324 or other strains of adenovirus (e.g., Ad2, Ad3, Ad7
etc.) are well known to those skilled in the art. Recombinant
adenoviruses can be advantageous in certain circumstances in that
they are not capable of infecting nondividing cells and can be used
to infect a wide variety of cell types. Furthermore, the virus
particle is relatively stable and amenable to purification and
concentration, and as above, can be modified so as to affect the
spectrum of infectivity. Additionally, introduced adenoviral DNA
(and foreign DNA contained therein) is not integrated into the
genome of a host cell but remains episomal, thereby avoiding
potential problems that can occur as a result of insertional
mutagenesis in situations where introduced DNA becomes integrated
into the host genome (e.g., retroviral DNA). Moreover, the carrying
capacity of the adenoviral genome for foreign DNA is large (up to 8
kilobases) relative to other gene delivery vectors (Berkner et al.
cited supra; Haj-Ahmand and Graham (1986) J. Virol. 57:267). Most
replication-defective adenoviral vectors currently in use and
therefore favored by the present invention are deleted for all or
parts of the viral E1 and E3 genes but retain as much as 80% of the
adenoviral genetic material (see, e.g., Jones et al. (1979) Cell
16:683; Berkner et al., supra; and Graham et al. in Methods in
Molecular Biology, E. J. Murray, Ed. (Humana, Clifton, N.J., 1991)
vol. 7. pp. 109-127). Expression of the inserted RAP-BP gene can be
under control of, for example, the E1A promoter, the major late
promoter (MLP) and associated leader sequences, the E3 promoter, or
exogenously added promoter sequences.
[0098] Yet another viral vector system useful for delivery of the
subject RAP-BP gene is the adeno-associated virus (AAV).
Adeno-associated virus is a naturally occurring defective virus
that requires another virus, such as an adenovirus or a herpes
virus, as a helper virus for efficient replication and a productive
life cycle. (For a review see Muzyczka et al. Curr. Topics in
Micro. and Immunol. (1992) 158:97-129). It is also one of the few
viruses that may integrate its DNA into non-dividing cells, and
exhibits a high frequency of stable integration (see for example
Flotte et al. (1992) Am. J. Respir. Cell. Mol. Biol. 7:349-356;
Samulski et al. (1989) J. Virol. 63:3822-3828; and McLaughlin et
al. (1989) J. Virol. 62:1963-1973). Vectors containing as little as
300 base pairs of AAV can be packaged and can integrate. Space for
exogenous DNA is limited to about 4.5 kb. An AAV vector such as
that described in Tratschin et al. (1985) Mol. Cell. Biol.
5:3251-3260 can be used to introduce DNA into cells. A variety of
nucleic acids have been introduced into different cell types using
AAV vectors (see for example Hermonat et al. (1984) Proc. Natl.
Acad. Sci. USA 81:6466-6470; Tratschin et al. (1985) Mol. Cell.
Biol. 4:2072-2081; Wondisford et al. (1988) Mol. Endocrinol.
2:32-39; Tratschin et al. (1984) J. Virol. 51:611-619; and Flotte
et al. (1993) J. Biol. Chem. 268:3781-3790).
[0099] In addition to viral transfer methods, such as those
illustrated above, non-viral methods can also be employed to cause
expression of an RAP-binding protein in the tissue of an animal.
Most nonviral methods of gene transfer rely on normal mechanisms
used by mammalian cells for the uptake and intracellular transport
of macromolecules. In preferred embodiments, non-viral gene
delivery systems of the present invention rely on endocytic
pathways for the uptake of the subject RAP-BP gene by the targeted
cell. Exemplary gene delivery systems of this type include
liposomal derived systems, poly-lysine conjugates, and artificial
viral envelopes.
[0100] In a representative embodiment, a gene encoding one of the
subject RAP-binding proteins can be entrapped in liposomes bearing
positive charges on their surface (e.g., lipofectins) and
(optionally) which are tagged with antibodies against cell surface
antigens of the target tissue (Mizuno et al. (1992) No Shinkei Geka
20:547-551; PCT publication WO91/06309; Japanese patent application
1047381; and European patent publication EP-A-43075). For example,
lipofection of cells can be carried out using liposomes tagged with
monoclonal antibodies against any cell surface antigen present on,
for example, T-cells.
[0101] In clinical settings, the gene delivery systems for the
therapeutic RAP-BP gene can be introduced into a patient by any of
a number of methods, each of which is familiar in the art. For
instance, a pharmaceutical preparation of the gene delivery system
can be introduced systemically, e.g. by intravenous injection, and
specific transduction of the protein in the target cells occurs
predominantly from specificity of transfection provided by the gene
delivery vehicle, cell-type or tissue-type expression due to the
transcriptional regulatory sequences controlling expression of the
receptor gene, or a combination thereof. In other embodiments,
initial delivery of the recombinant gene is more limited with
introduction into the animal being quite localized. For example,
the gene delivery vehicle can be introduced by catheter (see U.S.
Pat. No. 5,328,470) or by stereotactic injection (e.g. Chen et al.
(1994) PNAS 91: 3054-3057).
[0102] The pharmaceutical preparation of the gene therapy construct
can consist essentially of the gene delivery system in an
acceptable diluent, or can comprise a slow release matrix in which
the gene delivery vehicle is imbedded. Alternatively, where the
complete gene delivery system can be produced intact from
recombinant cells, e.g. retroviral vectors, the pharmaceutical
preparation can comprise one or more cells which produce the gene
delivery system.
[0103] Another aspect of the present invention concerns recombinant
RAP-binding proteins which are encoded by genes derived from
eukaryotic cells, e.g. mammalian cells, e.g. cells from humans,
mice, rats, rabbits, or pigs. The term "recombinant protein" refers
to a protein of the present invention which is produced by
recombinant DNA techniques, wherein generally DNA encoding, for
example, the RAPT1 protein, is inserted into a suitable expression
vector which is in turn used to transform a host cell to produce
the heterologous protein. Moreover, the phrase "derived from", with
respect to a recombinant gene encoding the recombinant RAP-binding
protein, is meant to include within the meaning of "recombinant
protein" those proteins having an amino acid sequence of a native
RAP-binding protein, or an amino acid sequence similar thereto,
which is generated by mutation so as to include substitutions
and/or deletions relative to a naturally occurring form of the
RAP-binding protein of a organism. Recombinant RAPT1 proteins
preferred by the present invention, in addition to those having an
amino acid sequence of a native RAPT1 protein, comprise amino acid
sequences which are at least 70% homologous, more preferably 80%
homologous and most preferably 90% homologous with an amino acid
sequence shown in one of SEQ ID No: 2, 12 or 14. A polypeptide
having a biological activity of a RAPT1 protein and which comprises
an amino acid sequence that is at least about 95%, more preferably
at least about 98%, and most preferably are identical to a sequence
represented in one of SEQ ID No: 2, 12 or 14 are also within the
scope of the invention.
[0104] Likewise, preferred embodiments of recombinant rap-UBC
proteins include an amino acid sequence which is at least 70%
homologous, more preferably 80% homologous, and most preferably 90%
homologous with an amino acid sequence represented by SEQ ID No.
24. Recombinant rap-UBC proteins which are identical, or
substantially identical (e.g. 95 to 98% homologous) with an amino
acid sequence of SEQ ID No. 24 are also specifically contemplated
by the present invention.
[0105] In addition, the invention expressly encompasses recombinant
RAPT1 proteins produced from the ATCC deposited clones described in
Example 4, e.g. from ATCC deposit number 75787, as well as
recombinant ubiquitin-conjugating enzymes produced from ATCC
deposit number 75786, described in Example 5.
[0106] The present invention further pertains to recombinant forms
of the subject RAP-binding proteins which are evolutionarily
related to a RAP-binding protein represented in one of SEQ ID No:
2, 12 or 24, that is, not identical, yet which are capable of
functioning as an agonist or an antagonist of at least one
biological activity of a RAP-binding protein. The term
"evolutionarily related to", with respect to amino acid sequences
of recombinant RAP-binding proteins, refers to proteins which have
amino acid sequences that have arisen naturally, as well as to
mutational variants which are derived, for example, by recombinant
mutagenesis.
[0107] Another aspect of the present invention pertains to methods
of producing the subject RAP-binding proteins. For example, a host
cell transfected with a nucleic acid vector directing expression of
a nucleotide sequence encoding the subject RAPT1 protein or rap-UBC
can be cultured under appropriate conditions to allow expression of
the peptide to occur. The peptide may be secreted and isolated from
a mixture of cells and medium containing the recombinant protein.
Alternatively, the peptide may be retained cytoplasmically, as the
naturally occurring forms of the subject RAP-binding proteins are
believed to be, and the cells harvested, lysed and the protein
isolated. A cell culture includes host cells, media and other
byproducts. Suitable media for cell culture are well known in the
art. The recombinant RAP-binding proteins can be isolated from cell
culture medium, host cells, or both using techniques known in the
art for purifying proteins including ion-exchange chromatography,
gel filtration chromatography, ultrafiltration, electrophoresis,
and immunoaffinity purification with antibodies specific for a
RAP-binding protein. In one embodiment, the RAP-binding protein is
a fusion protein containing a domain which facilitates its
purification, such as a RAPT1-GST fusion protein or a rapUBC-GST
fusion protein.
[0108] The present invention also provides host cells transfected
with a RAP-BP gene for expressing a recombinant form of a
RAP-binding protein. The host cell may be any prokaryotic or
eukaryotic cell. Thus, a nucleotide sequence derived from the
cloning of the RAP-binding proteins of the present invention,
encoding all or a selected portion of a protein, can be used to
produce a recombinant form of a RAP-BP via microbial or eukaryotic
cellular processes. Ligating a polynucleotide sequence into a gene
construct, such as an expression vector, and transforming or
transfecting host cells with the vector are standard procedures
used in producing other well-known proteins, e.g. insulin,
interferons, p53, myc, cyclins and the like. Similar procedures, or
modifications thereof, can be employed to prepare recombinant
RAP-binding proteins, or portions thereof, by microbial means or
tissue-culture technology in accord with the subject invention.
Host cells suitable for expression of a recombinant RAP-binding
protein can be selected, for example, from amongst eukaryotic
(yeast, avian, insect or mammalian) or prokaryotic (bacterial)
cells.
[0109] The recombinant RAP-BP gene can be produced by ligating
nucleic acid encoding a RAP-binding protein, or a portion thereof,
into a vector suitable for expression in either prokaryotic cells,
eukaryotic cells, or both. Expression vectors for production of
recombinant forms of RAP-binding proteins include plasmids and
other vectors. For instance, suitable vectors for the expression of
a RAP-BP include plasmids of the types: pBR322-derived plasmids,
pEMBL-derived plasmids, pEX-derived plasmids, pBTac-derived
plasmids and pUC-derived plasmids for expression in prokaryotic
cells, such as E. coli.
[0110] A number of vectors exist for the expression of recombinant
proteins in yeast. For instance, YEP24, YIPS, YEP51, YEP52, pYES2,
and YRP17 are cloning and expression vehicles useful in the
introduction of genetic constructs into S. cerevisiae (see, for
example, Broach et al. (1983) in Experimental Manipulation of Gene
Expression, ed. M. Inouye Academic Press, p. 83, incorporated by
reference herein). These vectors can replicate in E. coli due the
presence of the pBR322 ori, and in S. cerevisiae due to the
replication determinant of the yeast 2 micron plasmid. In addition,
drug resistance markers such as ampicillin can be used.
[0111] Preferred mammalian expression vectors contain prokaryotic
sequences to facilitate the propagation of the vector in bacteria,
and one or more eukaryotic transcription regulatory sequences that
cause expression of a recombinant RAP-BP gene in eukaryotic cells.
The pcDNAI/amp, pcDNAI/neo, pRc/CMV, pSV2 gpt, pSV2 neo, pSV2-dhfr,
pTk2, pRSVneo, pMSG, pSVT7, pko-neo and pHyg derived vectors are
examples of mammalian expression vectors suitable for transfection
of eukaryotic cells. Some of these vectors are modified with
sequences from bacterial plasmids, such as pBR322, to facilitate
replication and drug resistance selection in both prokaryotic and
eukaryotic cells. Alternatively, derivatives of viruses such as the
bovine papilloma virus (BPV-1), or Epstein-Barr virus (pHEBo,
pREP-derived and p205) can be used for transient expression of
proteins in eukaryotic cells. Examples of other viral (including
retroviral) expression systems can be found above in the
description of gene therapy delivery systems.
[0112] In some instances, it may be desirable to express a
recombinant RAP-binding protein by the use of a baculovirus
expression system (see, for example, Current Protocols in Molecular
Biology, eds. Ausubel et al. John Wiley & Sons: 1992). Examples
of such baculovirus expression systems include pVL-derived vectors
(such as pVL1392, pVL1393 and pVL941), pAcUW-derived vectors (such
as pAcUW1), and pBlueBac-derived vectors (such as the .beta.-gal
containing pBlueBac III).
[0113] The various methods employed in the preparation of the
plasmids and transformation of host organisms are well known in the
art. For other suitable expression systems for both prokaryotic and
eukaryotic cells, as well as general recombinant procedures, see
Molecular Cloning A Laboratory Manual, 2nd Ed., ed. by Sambrook,
Fritsch and Maniatis (Cold Spring Harbor Laboratory Press: 1989)
Chapters 16 and 17.
[0114] When expression of a portion of one of the subject
RAP-binding proteins is desired, i.e. a trunction mutant, such as
the RAPT1 polypeptides of SEQ ID Nos.2, 12 or 14, it may be
necessary to add a start codon (ATG) to the oligonucleotide
fragment containing the desired sequence to be expressed. It is
well known in the art that a methionine at the N-terminal position
can be enzymatically cleaved by the use of the enzyme methionine
aminopeptidase (MAP). MAP has been cloned from E. coli (Ben-Bassat
et al. (1987) J. Bacteriol. 169:751-757) and Salmonella typhimurium
and its in vitro activity has been demonstrated on recombinant
proteins (Miller et al. (1987) PNAS 84:2718-1722). Therefore,
removal of an N-terminal methionine, if desired, can be achieved
either in vivo by expressing RAP-BP-derived polypeptides in a host
which produces MAP (e.g., E. coli or CM89 or S. cerevisiae), or in
vitro by use of purified MAP (e.g., procedure of Miller et al.,
supra).
[0115] Alternatively, the coding sequences for the polypeptide can
be incorporated as a part of a fusion gene so as to be covalently
linked in-frame with a second nucleotide sequence encoding a
different polypeptide. This type of expression system can be
useful, for instance, where it is desirable to produce an
immunogenic fragment of a RAP-binding protein. For example, the VP6
capsid protein of rotavirus can be used as an immunologic carrier
protein for portions of the RAPT1 polypeptide, either in the
monomeric form or in the form of a viral particle. The nucleic acid
sequences corresponding to the portion of the RAPT1 protein to
which antibodies are to be raised can be incorporated into a fusion
gene construct which includes coding sequences for a late vaccinia
virus structural protein to produce a set, of recombinant viruses
expressing fusion proteins comprising a portion of the protein
RAPT1 as part of the virion. It has been demonstrated with the use
of immunogenic fusion proteins utilizing the Hepatitis B surface
antigen fusion proteins that recombinant Hepatitis B virions can be
utilized in this role as well. Similarly, chimeric constructs
coding for fusion proteins containing a portion of an RAPT1 protein
and the poliovirus capsid protein can be created to enhance
immunogenicity of the set of polypeptide antigens (see, for
example, EP Publication No. 0259149; and Evans et al. (1989) Nature
339:385; Huang et al. (1988) J. Virol. 62:3855; and Schlienger et
al. (1992). J. Virol. 66:2). The subject ubiquitin-conjugating
enzyme can be manipulated as an immunogen in like fashion.
[0116] The Multiple Antigen Peptide system for peptide-based
immunization can also be utilized, wherein a desired portion of a
RAP-binding protein is obtained directly from organo-chemical
synthesis of the peptide onto an oligomeric branching lysine core
(see, for example, Posnett et al. (1988) JBC 263:1719 and Nardelli
et al. (1992) J. Immunol. 148:914). Antigenic determinants of the
RAP-binding proteins can also be expressed and presented by
bacterial cells.
[0117] In addition to utilizing fusion proteins to enhance
immunogenicity, it is widely appreciated that fusion proteins can
also facilitate the expression and purification of proteins, such
as any one of the RAP-binding proteins of the present invention.
For example, a RAP-binding protein can be generated as a
glutathione-S-transferase (GST) fusion protein. Such GST fusion
proteins can simplify purification of a RAP-binding protein, as for
example by affinity purification using glutathione-derivatized
matrices (see, for example, Current Protocols in Molecular Biology,
eds. Ausabel et al. (N.Y.: John Wiley & Sons, 1991)). In
another embodiment, a fusion gene coding for a purification leader
sequence, such as a peptide leader sequence comprising a
poly-(His)/enterokinase cleavage sequence, can be added to the
N-terminus of the desired portion of a RAP-binding protein in order
to permit purification of the poly(His)-fusion protein by affinity
chromatography using a Ni.sup.2+ metal resin. The purification
leader sequence can then be subsequently removed by treatment with
enterokinase (e.g., see Hochuli et al. (1987) J. Chromatography
411:177; and Janknecht et al. PNAS 88:8972).
[0118] Techniques for making fusion genes are known to those
skilled in the art. Essentially, the joining of various DNA
fragments coding for different polypeptide sequences is performed
in accordance with conventional techniques, employing blunt-ended
or stagger-ended termini for ligation, restriction enzyme digestion
to provide for appropriate termini, filling-in of cohesive ends as
appropriate, alkaline phosphatase treatment to avoid undesirable
joining, and enzymatic ligation. In another embodiment, the fusion
gene can be synthesized by conventional techniques including
automated DNA synthesizers. Alternatively, PCR amplification of
gene fragments can be carried out using anchor primers which give
rise to complementary overhangs between two consecutive gene
fragments which are subsequently annealed to generate a chimeric
gene sequence (see, for example, Current Protocols in Molecular
Biology, eds. Ausubel et al. John Wiley & Sons: 1992).
[0119] The present invention also makes available purified, or
otherwise isolated forms of the subject RAP-binding proteins which
is isolated from, or otherwise substantially free of other cellular
proteins, especially FKBP or other rapamycin binding proteins, as
well as ubiquitin and ubiquitin-dependent enzymes, signal
transduction, and cell-cycle regulatory proteins, which may be
normally associated with the RAP-binding protein. The term
"substantially free of other cellular or viral proteins" (also
referred to herein as "contaminating proteins") or "substantially
pure or purified preparations" are defined as encompassing
preparations of RAP-binding proteins having less than 20% (by dry
weight) contaminating protein, and preferably having less than 5%
contaminating protein. Functional forms of the subject RAP-binding
proteins can be prepared, for the first time, as purified
preparations by using recombinant proteins as described herein.
Alternatively, the subject RAP-binding proteins can be isolated by
affinity purification using, for example, matrix bound
FKBP/rapamycin protein. By "purified", it is meant, when referring
to a peptide or DNA or RNA sequence, that the indicated molecule is
present in the substantial absence of other biological
macromolecules, such as other proteins (particularly FK506 binding
proteins, as well as other contaminating proteins). The term
"purified" as used herein preferably means at least 80% by dry
weight, more preferably in the range of 95-99% by weight, and most
preferably at least 99% by weight, of biological macromolecules of
the same type present (but water, buffers, and other small
molecules, especially molecules having a molecular weight of less
than 5000, can be present). The term "pure" as used herein
preferably has the same numerical limits as "purified" immediately
above. "Isolated" and "purified" do not encompass either natural
materials in their native state or natural materials that have been
separated into components (e.g., in an acrylamide gel) but not
obtained either as pure (e.g. lacking contaminating proteins, or
chromatography reagents such as denaturing agents and polymers,
e.g. acrylamide or agarose) substances or solutions.
[0120] Furthermore, isolated peptidyl portions of the subject
RAP-binding proteins can also be obtained by screening peptides
recombinantly produced from the corresponding fragment of the
nucleic acid encoding such peptides. In addition, fragments can be
chemically synthesized using techniques known in the art such as
conventional Merrifield solid phase f-Moc or t-Boc chemistry. For
example, a RAP-binding protein of the present invention may be
arbitrarily divided into fragments of desired length with no
overlap of the fragments, or preferably divided into overlapping
fragments of a desired length. The fragments can be produced
(recombinantly or by chemical synthesis) and tested to identify
those peptidyl fragments which can function as either agonists or
antagonists of a RAP-binding protein activity, such as by
microinjection assays or in vitro protein binding assays. In an
illustrative embodiment, peptidyl portions of a RAP-binding
protein, such as RAPT1 or rapUBC, can be tested for
FKBP/rapamycin-binding activity.
[0121] It will also be possible to modify the structure of a
RAP-binding protein for such purposes as enhancing therapeutic or
prophylactic efficacy, or stability (e.g., ex vivo shelf life and
resistance to proteolytic degradation in vivo). Such modified
peptides, when designed to retain at least one activity of the
naturally-occurring form of the protein, are considered functional
equivalents of the RAP-binding protein described in more detail
herein. Such modified peptide can be produced, for instance, by
amino acid substitution, deletion, or addition.
[0122] For example, it is reasonable to expect that an isolated
replacement of a leucine with an isoleucine or valine, an aspartate
with a glutamate, a threonine with a serine, or a similar
replacement of an amino acid with a structurally related amino acid
(i.e. conservative mutations) will not have a major effect on the
folding of the protein, and may or may not have much of an effect
on the biological activity of the resulting molecule. Conservative
replacements are those that take place within a family of amino
acids that are related in their side chains. Genetically encoded
amino acids are can be divided into four families: (1)
acidic=aspartate, glutamate; (2) basic=lysine, arginine, histidine;
(3) nonpolar=alanine, valine, leucine, isoleucine, proline,
phenylalanine, methionine, tryptophan; and (4) uncharged
polar=glycine, asparagine, glutamine, cysteine, serine, threonine,
tyrosine. Phenylalanine, tryptophan, and tyrosine are sometimes
classified jointly as aromatic amino acids. In similar fashion, the
amino acid repertoire can be grouped as (1) acidic=aspartate,
glutamate; (2) basic=lysine, arginine histidine, (3)
aliphatic=glycine, alanine, valine, leucine, isoleucine, serine,
threonine, with serine and threonine optionally be grouped
separately as aliphatic-hydroxyl; (4) aromatic=phenylalanine,
tyrosine, tryptophan; (5) amide=asparagine, glutamine; and (6)
sulfur-containing=cysteine and methionine (see, for example,
Biochemistry, 2nd ed., Ed. by L. Stryer, W H Freeman and Co.:
1981). Alternatively, amino acid replacement can be based on steric
criteria, e.g. isosteric replacements, without regard for polarity
or charge of amino acid sidechains. Whether a change in the amino
acid sequence of a peptide results in a functional RAP-BP homolog
(e.g. functional in the sense that it acts to mimic or antagonize
the wild-type form) can be readily determined by assessing the
ability of the variant peptide to produce a response in cells in a
fashion similar to the wild-type RAP-BP or competitively inhibit
such a response. Peptides in which more than one replacement has
taken place can readily be tested in the same manner.
[0123] This invention further contemplates a method of generating
sets of combinatorial mutants of RAP-binding proteins, e.g. of
RAPT1 proteins and/or rap-UBC enzymes, as well as truncation
mutants, thereof and is especially useful for identifying variant
sequences (e.g RAP-BP homologs) that are functional in regulating
rapamycin-mediated effects, as well as other aspects of cell growth
or differentiation. In similar fashion, RAP-BP homologs can be
generated by the present combinatorial approach which are
antagonists in that they are able to interfere with the normal
cellular functions of authentic forms of the protein.
[0124] One purpose for screening such combinatorial libraries is,
for example, to isolate novel RAP-BP homologs from the library
which function in the capacity as one of either an agonists or an
antagonist of the biological activities of the wild-type
("authentic") protein, or alternatively, which possess novel
biological activities all together. To illustrate, RAPT1 homologs
can be engineered by the present method to provide homologs which
are unable to bind to the FKBP/rapamycin complex, yet still retain
at least a portion of the normal cellular activity associated with
authentic RAPT1. Thus, combinatorially-derived homologs can be
generated to provide rapamycin-resistance. Such proteins, when
expressed from recombinant DNA constructs, can be used in gene
therapy protocols.
[0125] Likewise, mutagenesis can give rise to RAP-BP homologs which
have intracellular half-lives dramatically different than the
corresponding wild-type protein. For example, the altered protein
can be rendered either more stable or less stable to proteolytic
degradation or other cellular process which result in destruction
of, or otherwise inactivation of, the authentic RAP-binding
protein. Such homologs, and the genes which encode them, can be
utilized to alter the envelope of expression of a particular RAP-BP
by modulating the half-life of the protein. For instance, a short
half-life can give rise to more transient RAPT1 biological effects
and, when part of an inducible expression system, can allow tighter
control of recombinant RAPT1 levels within the cell. As above, such
proteins, and particularly their recombinant nucleic acid
constructs, can be used in gene therapy protocols.
[0126] In an illustrative embodiment of this method, the amino acid
sequences for a population of RAP-BP homologs, or other related
proteins, are aligned, preferably to promote the highest homology
possible. Such a population of variants can include, for example,
RAPT1 homologs from one or more species, e.g. a sequence alignment
of the mouse and human RAPT1 proteins represented by SEQ ID Nos. 2
and 12, or different RAP-BP isoforms from the same species, e.g.
different human RAPT1 isoforms. Amino acids which appear at each
position of the sequence alignment can be selected to create a
degenerate set of combinatorial sequences.
[0127] In a preferred embodiment, the combinatorial RAP-BP library
is produced by way of a degenerate library of genes encoding a
library of polypeptides which each include at least a portion of
potential RAP-BP sequences, e.g. the portion of RAPT1 represented
by SEQ ID No:2 or 12, or the portion of rap-UBC represented by SEQ
ID No. 24. A mixture of synthetic oligonucleotides can be
enzymatically ligated into gene sequences such that the degenerate
set of potential RAP-BP sequences are expressible as individual
polypeptides, or alternatively, as a set of larger fusion proteins
(e.g. for phage display) containing the RAP-BP sequence library
therein.
[0128] There are many ways by which the library of RAP-BP homologs
can be generated from a degenerate oligonucleotide sequence. For
instance, chemical synthesis of a degenerate gene sequence can be
carried out in an automated DNA synthesizer, and the synthetic
genes then ligated into an appropriate gene for expression. The
purpose of a degenerate set of RAP-BP genes is to provide, in one
mixture, all of the sequences encoding the desired set of potential
RAP-BP sequences. The synthesis of degenerate oligonucleotides is
well known in the art (see, for example, Narang, S A (1983)
Tetrahedron 39:3; Itakura et al. (1981) Recombinant DNA, Proc 3rd
Cleveland Sympos. Macromolecules, ed. A G Walton, Amsterdam:
Elsevier pp 273-289; Itakura et al. (1984) Annu. Rev. Biochem.
53:323; Itakura et al. (1984) Science 198:1056; Ike et al. (1983)
Nucleic Acid Res. 11:477. Such techniques have been employed in the
directed evolution of other proteins (see, for example, Scott et
al. (1990) Science 249:386-390; Roberts et al. (1992) PNAS
89:2429-2433; Devlin et al. (1990) Science 249: 404-406; Cwirla et
al. (1990) PNAS 87: 6378-6382; as well as U.S. Pat. Nos. 5,223,409,
5,198,346, and 5,096,815).
[0129] Alternatively, other forms of mutagenesis can be utilized to
generate a combinatorial library. For example, RAP-BP homologs
(both agonist and antagonist forms) can be generated and isolated
from a library generated by using, for example, alanine scanning
mutagenesis and the like (Ruf et al. (1994) Biochemistry
33:1565-1572; Wang et al. (1994)J. Biol. Chem. 269:3095-3099;
Balint et al. (1993) Gene 137:109-118; Grodberg et al. (1993) Eur.
J Biochem. 218:597-601; Nagashima et al. (1993) J. Biol. Chem.
268:2888-2892; Lowman et al. (1991) Biochemistry 30:10832-10838;
and Cunningham et al. (1989) Science 244:1081-1085), by linker
scanning mutagenesis (Gustin et al. (1993) Virology 193:653-660;
Brown et al. (1992) Mol. Cell. Biol. 12:2644-2652; McKnight et al.
(1982) Science 232:316); by saturation mutagenesis (Meyers et al.
(1986) Science 232:613); by PCR mutagenesis (Leung et al.
(1989)Method Cell Mol Biol 1:11-19); or by random mutagenesis
(Miller et al. (1992) A Short Course in Bacterial Genetics, CSHL
Press, Cold Spring Harbor, N.Y.; and Greener et al. (1994)
Strategies in Mol Biol 7:32-34).
[0130] A wide range of techniques are known in the art for
screening gene products of variegated gene libraries made by
combinatorial mutagenesis, especially for identifying individual
gene products having a certain property. Such techniques will be
generally adaptable for rapid screening of the gene libraries
generated by the combinatorial mutagenesis of, for example, RAPT1
homologs. The most widely used techniques for screening large gene
libraries typically comprises cloning the gene library into
replicable expression vectors, transforming appropriate cells with
the resulting library of vectors, and expressing the combinatorial
genes under conditions in which detection of a desired activity
facilitates relatively easy isolation of the vector encoding the
gene whose product was detected. Each of the illustrative assays
described below are amenable to high through-put analysis as
necessary to screen large numbers of degenerate RAP-BP sequences
created by combinatorial mutagenesis techniques.
[0131] In one screening assay, the candidate RAP-BP gene products
are displayed on the surface of a cell or viral particle, and the
ability of particular cells or viral particles to bind the
FKBP12/rapamycin complex via this gene product is detected in a
"panning assay". For instance, the degenerate RAP-BP gene library
can be cloned into the gene for a surface membrane protein of a
bacterial cell, and the resulting fusion protein detected by
panning protocols (see, for example, Ladner et al., WO 88/06630;
Fuchs et al. (1991) Bio/Technology 9:1370-1371; and Goward et al.
(1992) TIBS 18:136-140). In a similar fashion, fluorescently
labeled molecules which bind the RAP-binding protein, such as
fluorescently labeled rapamycin or FKBP12/rapamycin complexes, can
be used to score for potentially functional RAP-BP homologs. Cells
can be visually inspected and separated under a fluorescence
microscope, or, where the morphology of the cell permits, separated
by a fluorescence-activated cell sorter.
[0132] In an alternate embodiment, the gene library is expressed as
a fusion protein on the surface of a viral particle. For instance,
in the filamentous phage system, foreign peptide sequences can be
expressed on the surface of infectious phage, thereby conferring
two significant benefits. First, since these phage can be applied
to affinity matrices at very high concentrations, a large number of
phage can be screened at one time. Second, since each infectious
phage displays the combinatorial gene product on its surface, if a
particular phage is recovered from an affinity matrix in low yield,
the phage can be amplified by another round of infection. The group
of almost identical E. coli filamentous phages M13, fd, and fl are
most often used in phage display libraries, as either of the phage
gIII or gVIII coat proteins can be used to generate fusion proteins
without disrupting the ultimate packaging of the viral particle
(Ladner et al. PCT publication WO-90/02909; Garrard et al., PCT
publication WO 92/09690; Marks et al. (1992) J. Biol. Chem.
267:16007-16010; Griffiths et al. (1993) EMBO J 12:725-734;
Clackson et al. (1991) Nature 352:624-628; and Barbas et al. (1992)
PNAS 89:4457-4461). In an illustrative embodiment, the recombinant
phage antibody system (RPAS, Pharmacia Catalog number 27-9400-01)
can be easily modified for use in expressing and screening RAP-BP
combinatorial libraries, and the RAP-BP phage library can be panned
on glutathione-immobilized FKBP-GST/rapamycin complexes. Successive
rounds of reinfection, phage amplification, and panning will
greatly enrich for homologs which retain FKBP/rapamycin binding and
which can be subsequently screened for further biological
activities in order to discern between agonists and
antagonists.
[0133] Homologs of the human and mouse RAP-binding proteins can
also be generated through the use of interaction trap assays to
screen combinatorial libraries of RAP-BP mutants. As described in
Example 10 below, the same two hybrid assay used to screen cDNA
libraries for proteins which interact with FK506-binding proteins
in a drug-dependent manner can also be used to sort through
combinatorial libraries of, for example, RAPT1 mutants, to find
both agonistic and antagonistic forms. By controlling the
sensitivity of the assay for interactions, e.g. through the
manipulation of the strength of the promoter sequence used to drive
expression of the reporter construct, the assay can be generated to
favor agonistic forms of RAPT1 with tighter binding affinities for
rapamycin then the authentic form of the protein. Alternatively, as
described in Example 10, the assay can be used to select for RAPT1
homologs which are now unable to bind rapamycin complexes and hence
are versions of the RAPT1 protein which can render a cell
insensitive to treatment with that macrolide.
[0134] The invention also provides for reduction of the
rapamycin-binding domains of the subject RAP-binding proteins to
generate mimetics, e.g. peptide or non-peptide agents, which are
able to disrupt binding of a polypeptide of the present invention
with an FKBP/rapamycin complex. Thus, such mutagenic techniques as
described above are also useful to map the determinants of
RAP-binding proteins which participate in interactions involved in,
for example, binding to an FKBP/rapamycin complex. To illustrate,
the critical residues of a RAP-binding protein which are involved
in molecular recognition of FKBP/rapamycin can be determined and
used to generate RAP-BP-derived peptidomimetics that competitively
inhibit binding of the RAP-BP to rapamycin complexes. By employing,
for example, scanning mutagenesis to map the amino acid residues of
a particular RAP-binding protein involved in binding FKBP/rapamycin
complexes, peptidomimetic compounds can be generated which mimic
those residues in binding to the rapamycin complex, and which, by
inhibiting binding of the RAP-BP to FKBP/rapamycin, can interfere
with the function of rapamycin in cell-cycle arrest. For instance,
non-hydrolyzable peptide analogs of such residues can be generated
using retro-inverse peptides (e.g., see U.S. Pat. Nos. 5,116,947
and 5,218,089; and Pallai et at (1983) Int J Pept Protein Res
21:84-92) benzodiazepine (e.g., see Freidinger et al. in Peptides:
Chemistry and Biology, G. R. Marshall ed., ESCOM Publisher: Leiden,
Netherlands, 1988), azepine (e.g., see Huffman et al. in Peptides:
Chemistry and Biology, G. R. Marshall ed., ESCOM Publisher: Leiden,
Netherlands, 1988), substituted gama lactam rings (Garvey et al. in
Peptides: Chemistry and Biology, G. R. Marshall ed., ESCOM
Publisher: Leiden, Netherlands, 1988), keto-methylene
pseudopeptides (Ewenson et al. (1986) J Med Chem 29:295; and
Ewenson et al. in Peptides: Structure and Function (Proceedings of
the 9th American Peptide Symposium) Pierce Chemical Co. Rockland,
Ill., 1985), .beta.-turn dipeptide cores (Nagai et al. (1985)
Tetrahedron Lett 26:647; and Sato et al. (1986) J Chem Soc Perkin
Trans 1:1231), and .beta.-aminoalcohols (Gordon et al. (1985)
Biochem Biophys Res Commun 126:419; and Dann et al. (1986) Biochem
Biophys Res Commun 134:71). Utilizing side-by-side assays,
peptidomimetics can be designed to specifically inhibit the
interaction of human RAPT1 (or other mammalian homologs) with the
FKBP12/rapamycin complex in mammalian cells, but which do not
substantially affect the interaction of the yeast protein TOR1 or
TOR2 with the FKB1/rapamycin complex. Such a peptide analog could
be used in conjunction with rapamycin treatment of mycotic
infections to protect the host mammal from rapamycin side-effects,
such as immunosuppression, without substantially reducing the
efficacy of rapamycin as an anti-fungal agent.
[0135] Another aspect of the invention pertains to an antibody
specifically reactive with one or more of the subject RAP-binding
proteins. For example, by using immunogens derived from a
RAP-binding protein, anti-protein/anti-peptide antisera or
monoclonal antibodies can be made by standard protocols (See, for
example, Antibodies: A Laboratory Manual ed. by Harlow and Lane
(Cold Spring Harbor Press: 1988)). A mammal, such as a mouse, a
hamster or rabbit can be immunized with an immunogenic form of the
peptide (e.g., a full length RAP-binding protein or an antigenic
fragment which is capable of eliciting an antibody response).
Techniques for conferring immunogenicity on a protein or peptide
include conjugation to carriers or other techniques well known in
the art. An immunogenic portion of the subject RAP-binding proteins
can be administered in the presence of adjuvant. The progress of
immunization can be monitored by detection of antibody titers in
plasma or serum. Standard ELISA or other immunoassays can be used
with the immunogen as antigen to assess the levels of antibodies.
In a preferred embodiment, the subject antibodies are
immunospecific for antigenic determinants of the RAP-binding
proteins of the present invention, e.g. antigenic determinants of a
protein represented in one of SEQ ID Nos: 2, 12 or 24 or a closely
related human or non-human mammalian homolog thereof. For instance,
a favored anti-RAP-BP antibody of the present invention does not
substantially cross react (i.e. react specifically) with a protein
which is less than 90 percent homologous to one of SEQ ID Nos: 2,
12 or 24; though antibodies which do not substantially cross react
with a protein which is less than 95 percent homologous with one of
SEQ ID Nos: 2, 12 or 24, or even less than 98-99 percent homologous
with one of SEQ ID Nos: 2; 12 or 24, are specifically contemplated.
By "not substantially cross react", it is meant that the antibody
has a binding affinity for a non-homologous protein (e.g. a yeast
TOR1 or TOR2 protein) which is less than 10 percent, more
preferably less than 5 percent, and even more preferably less than
1 percent, of the binding affinity for a protein represented one of
SEQ ID Nos: 2, 12 or 24.
[0136] Following immunization, anti-RAP-BP antisera can be obtained
and, if desired, polyclonal anti-RAP-BP antibodies isolated from
the serum. To produce monoclonal antibodies, antibody producing
cells (lymphocytes) can be harvested from an immunized animal and
fused by standard somatic cell fusion procedures with immortalizing
cells such as myeloma cells to yield hybridoma cells. Such
techniques are well known in the art, an include, for example, the
hybridoma technique (originally developed by Kohler and Milstein,
(1975) Nature, 256: 495-497), the human B cell hybridoma technique
(Kozbar et al., (1983) Immunology Today, 4: 72), and the
EBV-hybridoma technique to produce human monoclonal antibodies
(Cole et al., (1985) Monoclonal Antibodies and Cancer Therapy, Alan
R. Liss, Inc. pp. 77-96). Hybridoma cells can be screened
immunochemically for production of antibodies specifically reactive
with a RAP-binding protein of the present invention and monoclonal
antibodies isolated from a culture comprising such hybridoma
cells.
[0137] An antibody preparation of this invention prepared from a
polypeptide as described above can be in dry form as obtained by
lyophilization. However, the antibodies are normally used and
supplied in an aqueous liquid composition in serum or a suitable
buffer such as PBS.
[0138] The term antibody as used herein is intended to include
fragments thereof which are also specifically reactive with one of
the subject RAP-binding protein. Antibodies can be fragmented using
conventional techniques, including recombinant engineering, and the
fragments screened for utility in the same manner as described
above for whole antibodies. For example, F(ab').sub.2 fragments can
be generated by treating antibody with pepsin. The resulting
F(ab').sub.2 fragment can be treated to reduce disulfide bridges to
produce Fab' fragments. The antibody of the present invention is
further intended to include bispecific and chimeric molecules
having an anti-RAP-BP portion.
[0139] Both monoclonal and polyclonal antibodies (Ab) directed
against a RAP-binding protein can be used to block the action of
that protein and allow the study of the role of a particular
RAP-binding protein in, for example, cell-cycle regulation
generally, or in the etiology of proliferative and/or
differentiative disorders specifically, or in the mechanism of
action of rapamycin, e.g. by microinjection of anti-RAP-BP
antibodies into cells.
[0140] Antibodies which specifically bind RAP-BP epitopes can also
be used in immunohistochemical staining of tissue samples in order
to evaluate the abundance and pattern of expression of each of the
subject RAP-binding proteins. Anti-RAP-BP antibodies can be used
diagnostically in immuno-precipitation and immuno-blotting to
detect and evaluate RAP-BP levels in tissue or bodily fluid as part
of a clinical testing procedure. For instance, such measurements as
the level of free RAP-BP to RAP-BP/FKBP/drug complexes can be
useful in predictive valuations of the efficacy of a particular
rapamycin analog, and can permit determination of the efficacy of a
given treatment regimen for an individual. The level of a
RAP-binding protein can be measured in cells found in bodily fluid,
such as in cells from samples of blood, or can be measured in
tissue, such as produced by biopsy.
[0141] Another application of the subject antibodies is in the
immunological screening of cDNA libraries constructed in expression
vectors such as .lamda.gt11, .lamda.gt18-23, .lamda.ZAP, and
.lamda.ORF8. Messenger libraries of this type, having coding
sequences inserted in the correct reading frame and orientation,
can produce fusion proteins. For instance, .lamda.gt11 will produce
fusion proteins whose amino termini consist of .beta.-galactosidase
amino acid sequences and whose carboxy termini consist of a foreign
polypeptide. Antigenic epitopes of a RAP-binding protein can then
be detected with antibodies, as, for example, reacting
nitrocellulose filters lifted from infected plates with anti-RAP-BP
antibodies. Phage, scored by this assay, can then be isolated from
the infected plate. Thus, the presence of RAP-BP homologs can be
detected and cloned from other animals, and alternate isoforms
(including splicing variants) can be detected and cloned from human
sources.
[0142] Moreover, the nucleotide sequence determined from the
cloning of the subject RAP-binding proteins from a human cell line
will further allow for the generation of probes designed for use in
identifying homologs in other human cell types, as well as RAP-BP
homologs (e.g. orthologs) from other mammals. For example, by
identifying highly conserved nucleotides sequence through
comparison of the mammalian RAPT1 genes with the yeast TOR genes,
it will be possible to design degenerate primers for isolating
RAPT1 homologs from virtually any eukaryotic cell. For instance,
alignment of the mouse RAPT1 gene sequence and the yeast DRR-1 and
TOR2 sequences, we have determined that optimal primers for
isolating RAPT1 homologs from other mammalian homologs, as well as
from pathogenic fungi, include the primers
GRGAYTTRAWBGABGCHYAMGAWTGG, CAAGCBTGGGAYMTYMTYTAYTATMAYGTBTTCAG,
and GAYYBGARTTGGCTG-TBCCHGG.
[0143] Accordingly, the present invention also provides a
probe/primer comprising a substantially purified oligonucleotide,
which oligonucleotide comprises a region of nucleotide sequence
that hybridizes under stringent conditions to at least 10
consecutive nucleotides of sense or anti-sense sequence of one of
SEQ ID Nos: 1, 11 or 23, or naturally occurring mutants thereof. In
preferred embodiments, the probe/primer further comprises a label
group attached thereto and able to be detected, e.g. the label
group is selected from the group consisting of radioisotopes,
fluorescent compounds, enzymes, and enzyme co-factors. Such probes
can also be used as a part of a diagnostic test kit for identifying
transformed cells, such as for measuring a level of a RAP-BP
nucleic acid in a sample of cells from a patient; e.g. detecting
mRNA encoding a RAP-BP mRNA level; e.g. determining whether a
genomic RAP-BP gene has been mutated or deleted.
[0144] In addition, nucleotide probes can be generated which allow
for histological screening of intact tissue and tissue samples for
the presence of a RAP-BP mRNA. Similar to the diagnostic uses of
anti-RAP-BP antibodies, the use of probes directed to RAP-BP mRNAs,
or to genomic RAP-BP sequences, can be used for both predictive and
therapeutic evaluation of allelic mutations which might be manifest
in, for example, neoplastic or hyperplastic disorders (e.g.
unwanted cell growth) or abnormal differentiation of tissue. Used
in conjunction with an antibody immunoassays, the nucleotide probes
can help facilitate the determination of the molecular basis for a
developmental disorder which may involve some abnormality
associated with expression (or lack thereof) of a RAP-binding
protein. For instance, variation in synthesis of a RAP-binding
protein can be distinguished from a mutation in the genes coding
sequence.
[0145] Thus, the present invention provides a method for
determining if a subject is at risk for a disorder characterized by
unwanted cell proliferation or abherent control of differentiation.
In preferred embodiments, the subject method can be generally
characterized as comprising detecting, in a tissue sample of the
subject (e.g. a human patient), the presence or absence of a
genetic lesion characterized by at least one of (i) a mutation of a
gene encoding one of the subject RAP-binding proteins or (ii) the
mis-expression of a RAP-BP gene. To illustrate, such genetic
lesions can be detected by ascertaining the existence of at least
one of (i) a deletion of one or more nucleotides from a RAP-BP
gene, (ii) an addition of one or more nucleotides to such a RAP-BP
gene, (iii) a substitution of one or more nucleotides of a RAP-BP
gene, (iv) a gross chromosomal rearrangement of one of the RAP-BP
genes, (v) a gross alteration in the level of a messenger RNA
transcript of a RAP-BP gene, (vi) the presence of a non-wild type
splicing pattern of a messenger RNA transcript of a RAP-BP gene,
and (vii) a non-wild type level of a RAP-binding protein. In one
aspect of the invention there is provided a probe/primer comprising
an oligonucleotide containing a region of nucleotide sequence which
is capable of hybridizing to a sense or antisense sequence of one
of SEQ ID Nos: 1, 11 or 23, or naturally occurring mutants thereof,
or 5' or 3' flanking sequences or intronic sequences naturally
associated with the subject RAP-BP genes. The probe is exposed to
nucleic acid of a tissue sample; and the hybridization of the probe
to the sample nucleic acid is detected. In certain embodiments,
detection of the lesion comprises utilizing the probe/primer in a
polymerase chain reaction (PCR) (see, e.g., U.S. Pat. Nos.
4,683,195 and 4,683,202) or, alternatively, in a ligation chain
reaction (LCR) (see, e.g., Landegran et al. (1988) Science,
241:1077-1080; and NaKazawa et al. (1944) PNAS 91:360-364) the
later of which can be particularly useful for detecting point
mutations in the RAP-BP gene. Alternatively, immunoassays can be
employed to determine the level of RAP-binding protein and/or its
participation in protein complexes, particularly transcriptional
regulatory complexes such as those involving FKBP/rapamycin.
[0146] Also, by inhibiting endogenous production of a particular
RAP-binding protein, anti-sense techniques (e.g. microinjection of
antisense molecules, or transfection with plasmids whose
transcripts are anti-sense with regard to a RAP-BP mRNA or gene
sequence) can be used to investigate role of each of the subject
RAP-BP in growth and differentiative events, such as those giving
rise to Wilm's tumor, as well as normal cellular functions of each
of the subject RAP-binding proteins, e.g. in regulation of
transcription. Such techniques can be utilized in cell culture, but
can also be used in the creation of transgenic animals.
[0147] Furthermore, by making available purified and recombinant
RAP-binding proteins, the present invention provides for the
generation of assays which can be used to screen for drugs which
are either agonists or antagonists of the cellular function of each
of the subject RAP-binding proteins, or of their role in the
pathogenesis of proliferative and differentiative disorders. For
instance, an assay can be generated according to the present
invention which evaluates the ability of a compound to modulate
binding between a RAP-binding protein and an FK506-binding protein.
In particular, such assays can be used to design and screen novel
rapamycin analogs, as well as test completely unrelated compounds
for their ability to mediate formation of FKBP/RAP-BP complexes.
Such assays can be used to generate more potent anti-proliferative
agents having a similar mechanism of action as rapamycin, e.g.
rapamycin analogs. A variety of assay formats will suffice and, in
light of the present inventions, will be comprehended by skilled
artisan.
[0148] One aspect of the present invention which facilitates the
generation of drug screening assays, particularly the
high-throughout assays described below, is the identification of
the rapamycin binding domain of RAPT1-like proteins. For instance,
the present invention provides portions of the RAPT1-like proteins
which are easier to manipulate than the full length protein. The
full length protein is, because of its size, more difficult to
express as a recombinant protein or a fusion protein which would
retain rapamycin-binding activity, and may very well be insoluble.
Accordingly, the present invention provides soluble polypeptides
which include a soluble portion of a RAPT1-like polypeptide that
binds to said FKBP/rapamycin complex, such as the rapamycin-binding
domain represented by an amino acid sequence selected from the
group consisting Val26-Tyr160 of SEQ ID No. 2, Val1272-Tyr1444 of
SEQ ID No. 12, Val41-Tyr173 of SEQ ID No. 14, Val1-Tyr133 of SEQ ID
No. 16, and Val1-Arg133 of SEQ ID No. 18.
[0149] For instance, RAPT1 polypeptides useful in the subject
screening assays may be represented by the general formula X-Y-Z, Y
represents an amino acid sequence of a rapamycin-binding domain
within residues 1272 to 1444 of SEQ ID No. 12, X is absent, or
represents all or a C-terminal portion of the amino acid sequence
between residues 1000 and 1444 of SEQ ID No. 12 not represented by
Y, and Z is absent, or represents all or a N-terminal portion of
the amino acid sequence between residues 1272 and 1809 of SEQ ID
No. 12 not represented by Y. Preferably, the polypeptide includes
only about 50 to 200 residues of RAPT1 protein sequence. Similar
polypeptides can be generated for other RAPT1-like proteins.
[0150] Moreover, the same formula can also be used to designate a
fusion protein, wherein Y represents a rapamycin-binding domain
within residues 1272 to 1444 of SEQ ID No. 12, X is absent or
represents a polypeptide from 1 to about 500 amino acid residues of
SEQ ID No. 12 immediately N-terminal to the rapamycin-binding
domain, and Z is absent or represents from 1 to about 365 amino
acid residues of SEQ ID No. 2 immediately C-terminal to the
rapamycin-binding domain.
[0151] In many drug screening programs which test libraries of
compounds and natural extracts, high throughput assays are
desirable in order to maximize the number of compounds surveyed in
a given period of time. Assays which are performed in cell-free
systems, such as may be derived with purified or semi-purified
proteins, are often preferred as "primary" screens in that they can
be generated to permit rapid development and relatively easy
detection of an alteration in a molecular target when contacted
with a test compound. Moreover, the effects of cellular toxicity
and/or bioavailability of the test compound can be generally
ignored in the in vitro system, the assay instead being focused
primarily on the effect of the drug on the molecular target as may
be manifest in an alteration of binding affinity with other
proteins or change in enzymatic properties of the molecular target.
Accordingly, in an exemplary screening assay of the present
invention, the compound of interest (the "drug") is contacted with
a mixture generated from an isolated and purified RAP-binding
protein, such as RAPT1 or rapUBC, and an FK506-binding protein.
Detection and quantification of drug-dependent FKBP/RAP-BP
complexes provides a means for determining the compound's efficacy
for mediating complex formation between the two proteins. The
efficacy of the compound can be assessed by generating dose
response curves from data obtained using various concentrations of
the test compound. Moreover, a control assay can also be performed
to provide a baseline for comparison. In the control assay,
isolated and purified RAP-BP is added to a composition containing
the FK506-binding protein, and the formation of FKBPRAP-BP
complexes is quantitated in the absence of the test compound.
[0152] Complex formation between the RAP-binding protein and an
FKBP/drug complex may be detected by a variety of techniques. For
instance, modulation in the formation of complexes can be
quantitated using, for example, detectably labelled proteins (e.g.
radiolabelled, fluorescently labelled, or enzymatically labelled),
by immunoassay, or by chromatographic detection.
[0153] Typically, it will be desirable to immobilize either the
FK506-binding protein or the RAP-binding protein to facilitate
separation of drug-dependent protein complexes from uncomplexed
forms of one of the proteins, as well as to accommodate automation
of the assay. In an illustrative embodiment, a fusion protein can
be provided which adds a domain that permits the protein to be
bound to an insoluble matrix. For example,
glutathione-S-transferase/FKBP (FKBP-GST) fusion proteins can be
adsorbed onto glutathione sepharose beads (Sigma Chemical, St.
Louis, Mo.) or glutathione derivatized microtitre plates, which are
then combined with the RAP-binding protein, e.g. an
.sup.35S-labeled RAP-binding protein, and the test compound and
incubated under conditions conducive to complex formation (see, for
instance, Example 9). Following incubation, the beads are washed to
remove any unbound RAP-BP, and the matrix bead-bound radiolabel
determined directly (e.g. beads placed in scintillant), or in the
supernatant after the FKBP/RAP-BP complexes are dissociated, e.g.
when microtitre plates are used. Alternatively, after washing away
unbound protein, the complexes can be dissociated from the matrix,
separated by SDS-PAGE gel, and the level of RAP-BP found in the
matrix-bound fraction quantitated from the gel using standard
electrophoretic techniques.
[0154] Other techniques for immobilizing proteins on matrices are
also available for use in the subject assay. For instance, the
FK506-binding protein can be immobilized utilizing conjugation of
biotin and streptavidin. Biotinylated FKBP can be prepared from
biotin-NHS (N-hydroxy-succinimide) using techniques well known in
the art (e.g., biotinylation kit, Pierce Chemicals, Rockford,
Ill.), and immobilized in the wells of streptavidin-coated 96 well
plates (Pierce Chemical). Alternatively, antibodies reactive with
the FKBP can be derivatized to the wells of the plate, and FKBP
trapped in the wells by antibody conjugation. As above,
preparations of a RAP-binding protein and a test compound are
incubated in the FKBP-presenting wells of the plate, and the amount
of FKBP/RAP-BP complex trapped in the well can be quantitated.
Exemplary methods for detecting such complexes, in addition to
those described above for the GST-immobilized complexes, include
immunodetection of complexes using antibodies reactive with the
RAP-binding protein, or which are reactive with the FK506-binding
protein and compete for binding with the RAP-BP; as well as
enzyme-linked assays which rely on detecting an enzymatic activity
associated with the RAP-binding protein. In the instance of the
latter, the enzymatic activity can be endogenous, such as a kinase
(RAPT1) or ubiquitin ligase (rapUBC) activity, or can be an
exogenous activity chemically conjugated or provided as a fusion
protein with the RAP-binding protein. To illustrate, the
RAP-binding protein can be chemically cross-linked with alkaline
phosphatase, and the amount of RAP-BP trapped in the complex can be
assessed with a chromogenic substrate of the enzyme, e.g.
paranitrophenyl phosphate. Likewise, a fusion protein comprising
the RAP-BP and glutathione-S-transferase can be provided, and
complex formation quantitated by detecting the GST activity using
1-chloro-2,4-dinitrobenzene (Habig et al (1974) J Biol Chem
249:7130).
[0155] For processes which rely on immunodetection for quantitating
one of the proteins trapped in the complex, antibodies against the
protein, such as the anti-RAP-BP antibodies described herein, can
be used. Alternatively, the protein to be detected in the complex
can be "epitope tagged" in the form of a fusion protein which
includes, in addition to the RAP-BP or FKBP sequence, a second
polypeptide for which antibodies are readily available (e.g. from
commercial sources). For instance, the GST fusion proteins
described above can also be used for quantification of binding
using antibodies against the GST moiety. Other useful epitope tags
include myc-epitopes (e.g., see Ellison et al. (1991) J Biol Chem
266:21150-21157) which includes a 10-residue sequence from c-myc,
as well as the pFLAG system (International Biotechnologies, Inc.)
or the pEZZ-protein A system (Pharamacia, N.J.).
[0156] Additionally, the subject RAP-binding proteins can be used
to generate a drug-dependent interaction trap assay, as described
in the examples below, for detecting agents which induce complex
formation between a RAP-binding protein and an FK506-binding
protein. As described below, the interaction trap assay relies on
reconstituting in vivo a functional transcriptional activator
protein from two separate fusion proteins, one of which comprises
the DNA-binding domain of a transcriptional activator fused to an
FK506-binding protein (see also U.S. Pat. No. 5,283,317; PCT
publication WO94/10300; Zervos et al. (1993) Cell 72:223-232;
Madura et al. (1993) J Biol Chem 268:12046-12054; Bartel et al.
(1993) Biotechniques 14:920-924; and Iwabuchi et al. (1993)
Oncogene 8:1693-1696). The second fusion protein comprises a
transcriptional activation domain (e.g. able to initiate RNA
polymerase transcription) fused to one of the subject RAP-binding
proteins. When the FKBP and RAP-binding protein interact in the
presence of an agent such as rapamycin, the two domains of the
transcriptional activator protein are brought into sufficient
proximity as to cause transcription of a reporter gene. In addition
to the LexA interaction trap described in the examples below, yet
another illustrative embodiment comprises Saccharomyces cerevisiae
YPB2 cells transformed simultaneously with a plasmid encoding a
GAL4 db-FKBP fusion (db: DNA binding domain) and with a plasmid
encoding the GAL4 activation domain (GAL4ad) fused to a subject
RAP-BP. Moreover, the strain is transformed such that the
GAL4-responsive promoter drives expression of a phenotypic marker.
For example, the ability to grow in the absence of histidine can
depends on the expression of the HIS3 gene. When the HIS3 gene is
placed under the control of a GAL4-responsive promoter, relief of
this auxotrophic phenotype indicates that a functional GAL4
activator has been reconstituted through the drug-dependent
interaction of FKBP and the RAP-BP. Thus, agent able to promote
RAP-BP interaction with an FKBP will result in yeast cells able to
grow in the absence of histidine. Commercial kits which can be
modified to develop two-hybrid assays with the subject RAP-binding
proteins are presently available (e.g., MATCHMAKER kit, ClonTech
catalog number K1605-1, Palo Alto, Calif.).
[0157] In a preferred embodiment, assays which employ the subject
mammalian RAP-binding proteins can be used to identify rapamycin
mimetics that have therapeutic indexes more favorable than
rapamycin. For instance, rapamycin-like drugs can be identified by
the present invention which have enhanced tissue-type or cell-type
specificity relative to rapamycin. To illustrate, the subject
assays can be used to generate compounds which preferentially
inhibit IL-2 mediated proliferation/activation of lymphocytes
without substantially interfering with other tissues, e.g.
hepatocytes. Likewise, similar assays can be used to identify
rapamycin-like drugs which inhibit proliferation of yeast cells or
other lower eukaryotes, but which have a substantially reduced
effect on mammalian cells, thereby improving therapeutic index of
the drug as an anti-mycotic agent relative to rapamycin.
[0158] In one embodiment, the identification of such compounds is
made possible by the use of differential screening assays which
detect and compare drug-mediated formation of two or more different
types of FKBP/RAP-BP complexes. To illustrate, the assay can be
designed for side-by-side comparison of the effect of a test
compound on the formation of tissue-type specific FKBP/RAPT1
complexes. Given the diversity of FKBPs, and the substantial
likelihood that RAPT1 represents a single member of a larger family
of related proteins, it is probable that different functional
FKBP/RAPT1 complexes exist and, in certain instances, are localized
to particular tissue or cell types. As described in PCT publication
WO93/23548, entitled "Method of Detecting Tissue-Specific FK506
Binding Protein Messenger RNAs and Uses Thereof", the tissue
distribution of FKBPs can vary from one species of the protein to
the next. Thus, test compounds can be screened for agents able to
mediate the tissue-specific formation of only a subset of the
possible repertoire of FKBP/RAPT1 complexes. In an exemplary
embodiment, an interaction trap assay can be derived using two or
more different bait proteins, e.g. FKBP12 (SEQ ID Nos. 5 and 6),
FKBP25 (GenBank Accession M90309), or FKBP52 (Genbank Accession
M88279), while the fish protein is constant in each, e.g. a human
RAPT1 construct. Running the ITS side-by-side permits the detection
of agents which have a greater effect (e.g. statistically
significant on the formation of one of the FKBP/RAPT1 complexes
than on the formation of the other FKBP complexes.
[0159] In similar fashion, differential screening assays can be
used to exploit the difference in drug-mediated formation of
mammalian FKBP/RAP-BP complexes and yeast FKBP/TOR complexes in
order to identify agents which display a statistically significant
increase in specificity for the yeast complexes relative to the
mammalian complexes. Thus, lead compounds which act specifically on
pathogens, such as fungus involved in mycotic infections, can be
developed. By way of illustration, the present assays can be used
to screen for agents which may ultimately be useful for inhibiting
at least one fungus implicated in such mycosis as candidiasis,
aspergillosis, mucormycosis, blastomycosis, geotrichosis,
cryptococcosis, chromoblastomycosis, coccidioidomycosis,
conidiosporosis, histoplasmosis, maduromycosis, rhinosporidosis,
nocaidiosis, para-actinomycosis, penicilliosis, monoliasis, or
sporotrichosis. For example, if the mycotic infection to which
treatment is desired is candidiasis, the present assay can comprise
comparing the relative effectiveness of a test compound on
mediating formation of a mammalian FKBP/RAPT1 complex with its
effectiveness towards mediating such complexes formed from genes
cloned from yeast selected from the group consisting of Candida
albicans, Candida stellatoidea, Candida tropicalis, Candida
parapsilosis, Candida krusei, Candida pseudotropicalis, Candida
quillermondii, or Candida rugosa. Likewise, the present assay can
be used to identify anti-fungal agents which may have therapeutic
value in the treatment of aspergillosis by making use of the
subject drug-dependent interaction trap assays derived from FKBP
and TOR genes cloned from yeast such as Aspergillus fumigatus,
Aspergillus flavus, Aspergillus niger, Aspergillus nidulans, or
Aspergillus terreus. Where the mycotic infection is mucormycosis,
the complexes can be derived from yeast such as Rhizopus arrhizus,
Rhizopus oryzae, Absidia corymbifera, Absidia ramosa, or Mucor
pusillus. Sources of other rapamycin dependent complexes for
comparison with a mammalian FKBP/RAPT1 complex includes the
pathogen Pneumocystis carinii. Exemplary FK506-binding proteins
from human pathogens and other lower eukaryotes are provided by,
for example, GenBank Accession numbers: M84759 (Candida albican);
U01195, U01198, U01197, U01193, U01188, U01194, U01199 (Neisseria
spp.); and M98428 (Streptomyces chrysomallus).
[0160] In an exemplary embodiment, the differential screening assay
can be generated using at least the rapamycin-binding domain of the
Candida albican RAPT1 protein (see Example 11) and a Candida
FK506-binding protein (such as RBP1, GenBank No. M84759, see also
Ferrara et al. (1992) Gene 113:125-127), or a yeast FK506-binding
protein (see Example 8 and FIG. 3). Comparison of formation of
human RAPT1 complexes and Candida RAPT1 complexes provides a means
for identifying agents which are more selective for the formation
of caRAPT1 complexes and, accordingly, likely to be more specific
as anti-mycotic agents relative to rapamycin.
[0161] Furthermore, inhibitors of the enzymatic activity of each of
the subject RAP-binding proteins can be identified using assays
derived from measuring the ability of an agent to inhibit catalytic
conversion of a substrate by the subject proteins. For example, the
ability of the subject RAPT1 proteins to phosphorylate a
phosphatidylinositol substrate, such as
phosphatidylinositol-4,5-biphosphate (PIP2), in the presence and
absence of a candidate inhibitor, can be determined using standard
enzymatic assays. Likewise, the ability of the subject
ubiquitin-conjugating enzyme to accept ubiquitin (e.g. from an
E1:Ub conjugate) or subsequently transfer ubiquitin to a substrate
protein, can be readily ascertained in the presence and absence of
a candidate inhibitor. Exemplary assays in which the rapUBC enzyme
of the present invention can be used are set forth in U.S. patent
application Ser. No. 08/176,937, entitled "Assay and Reagents for
Detecting Inhibitors of Ubiquitin-dependent Degradation of Cell
Cycle Regulatory Proteins"; the specification of which was filed
Jan. 4, 1994, and U.S. patent application Ser. No. 08/247,904,
entitled "Human Ubiquitin Conjugating Enzyme", the specification of
which was filed May 23, 1994.
[0162] Another aspect of the present invention concerns transgenic
animals which are comprised of cells (of that animal) which contain
a transgene of the present invention and which preferably (though
optionally) express an exogenous RAP-binding protein in one or more
cells in the animal. The RAP-BP transgene can encode the wild-type
form of the protein, or can encode homologs thereof, including both
agonists and antagonists, as well as antisense constructs designed
to inhibit expression of the endogenous gene. In preferred
embodiments, the expression of the transgene is restricted to
specific subsets of cells, tissues or developmental stages
utilizing, for example, through the use of cis-acting sequences
that control expression in the desired pattern. In the present
invention, such mosaic expression of the subject RAP-binding
proteins can be essential for many forms of lineage analysis and
can additionally provide a means to assess the effects of
loss-of-function mutations, which deficiency might grossly alter
development in small patches of tissue within an otherwise normal
embryo. Toward this and, tissue-specific regulatory sequences and
conditional regulatory sequences can be used to control expression
of the transgene in certain spatial patterns. Moreover, temporal
patterns of expression can be provided by, for example, conditional
recombination systems or prokaryotic transcriptional regulatory
sequences.
[0163] Genetic techniques which allow for the expression of
transgenes can be regulated via site-specific genetic manipulation
in vivo are known to those skilled in the art. For instance,
genetic systems are available which allow for the regulated
expression of a recombinase that catalyzes the genetic
recombination a target sequence. As used herein, the phrase "target
sequence" refers to a nucleotide sequence that is genetically
recombined by a recombinase. The target sequence is flanked by
recombinase recognition sequences and is generally either excised
or inverted in cells expressing recombinase activity. Recombinase
catalyzed recombination events can be designed such that
recombination of the target sequence results in either the
activation or repression of expression of a subject RAP-binding
protein. For example, excision of a target sequence which
interferes with the expression of a recombinant RAP-BP gene can be
designed to activate expression of that gene. This interference
with expression of the protein can result from a variety of
mechanisms, such as spatial separation of the gene from a promoter
element or an internal stop codon. Moreover, the transgene can be
made wherein the coding sequence of the gene is flanked by
recombinase recognition sequences and is initially transfected into
cells in a 3' to 5' orientation with respect to the promoter
element. In such an instance, inversion of the target sequence will
reorient the subject gene by placing the 5' end of the coding
sequence in an orientation with respect to the promoter element
which allow for promoter driven transcriptional activation.
[0164] In an illustrative embodiment, either the cre/loxP
recombinase system of bacteriophage P1 (Lakso et al. (1992) PNAS
89:6232-6236; Orban et al. (1992) PNAS 89:6861-6865) or the FLP
recombinase system of Saccharomyces cerevisiae (O'Gorman et al.
(1991) Science 251:1351-1355; PCT publication WO 92/15694) can be
used to generate in vivo site-specific genetic recombination
systems. Cre recombinase catalyzes the site-specific recombination
of an intervening target sequence located between loxP sequences.
loxP sequences are 34 base pair nucleotide repeat sequences to
which the Cre recombinase binds and are required for Cre
recombinase mediated genetic recombination. The orientation of loxP
sequences determines whether the intervening target sequence is
excised or inverted when Cre recombinase is present (Abremski et
al. (1984) J. Biol. Chem. 259:1509-1514); catalyzing the excision
of the target sequence when the loxP sequences are oriented as
direct repeats and catalyzes inversion of the target sequence when
loxP sequences are oriented as inverted repeats.
[0165] Accordingly, genetic recombination of the target sequence is
dependent on expression of the Cre recombinase. Expression of the
recombinase can be regulated by promoter elements which are subject
to regulatory control, e.g., tissue-specific, developmental
stage-specific, inducible or repressible by externally added
agents. This regulated control will result in genetic recombination
of the target sequence only in cells where recombinase expression
is mediated by the promoter element. Thus, the activation
expression of a RAP-binding protein can be regulated via regulation
of recombinase expression.
[0166] Use of the cre/loxP recombinase system to regulate
expression of a recombinant RAP-binding protein, such as RAPT1 or
rapUBC, requires the construction of a transgenic animal containing
transgenes encoding both the Cre recombinase and the subject
protein. Animals containing both the Cre recombinase and the
recombinant RAP-BP genes can be provided through the construction
of "double" transgenic animals. A convenient method for providing
such animals is to mate two transgenic animals each containing a
transgene, e.g., the RAP-BP gene in one animal and recombinase gene
in the other.
[0167] One advantage derived from initially constructing transgenic
animals containing a transgene in a recombinase-mediated
expressible format derives from the likelihood that the subject
protein will be deleterious upon expression in the transgenic
animal. In such an instance, a founder population, in which the
subject transgene is silent in all tissues, can be propagated and
maintained. Individuals of this founder population can be crossed
with animals expressing the recombinase in, for example, one or
more tissues. Thus, the creation of a founder population in which,
for example, an antagonistic RAP-BP transgene is silent will allow
the study of progeny from that founder in which disruption of
cell-cycle regulation in a particular tissue or at developmental
stages would result in, for example, a lethal phenotype.
[0168] Similar conditional transgenes can be provided using
prokaryotic promoter sequences which require prokaryotic proteins
to be simultaneous expressed in order to facilitate expression of
the transgene. Exemplary promoters and the corresponding
trans-activating prokaryotic proteins are given in U.S. Pat. No.
4,833,080. Moreover, expression of the conditional transgenes can
be induced by gene therapy-like methods wherein a gene encoding the
trans-activating protein, e.g. a recombinase or a prokaryotic
protein, is delivered to the tissue and caused to be expressed
using, for example, one of the gene therapy constructs described
above. By this method, the RAP-BP transgene could remain silent
into adulthood and its expression "turned on" by the introduction
of the trans-activator.
[0169] In an exemplary embodiment, the "transgenic non-human
animals" of the invention are produced by introducing transgenes
into the germline of the non-human animal. Embryonal target cells
at various developmental stages can be used to introduce
transgenes. Different methods are used depending on the stage of
development of the embryonal target cell. The zygote is the best
target for micro-injection. In the mouse, the male pronucleus
reaches the size of approximately 20 micrometers in diameter which
allows reproducible injection of 1-2 pl of DNA solution. The use of
zygotes as a target for gene transfer has a major advantage in that
in most cases the injected DNA will be incorporated into the host
gene before the first cleavage (Brinster et al. (1985) PNAS
82:4438-4442). As a consequence, all cells of the transgenic
non-human animal will carry the incorporated transgene. This will
in general also be reflected in the efficient transmission of the
transgene to offspring of the founder since 50% of the germ cells
will harbor the transgene. Microinjection of zygotes is the
preferred method for incorporating transgenes in practicing the
invention.
[0170] Retroviral infection can also be used to introduce a RAP-BP
transgene into a non-human animal. The developing non-human embryo
can be cultured in vitro to the blastocyst stage. During this time,
the blastomeres can be targets for retroviral infection (Jaenich,
R. (1976) PNAS 73:1260-1264). Efficient infection of the
blastomeres is obtained by enzymatic treatment to remove the zona
pellucida (Manipulating the Mouse Embryo, Hogan eds. (Cold Spring
Harbor Laboratory Press, Cold Spring Harbor, 1986). The viral
vector system used to introduce the transgene is typically a
replication-defective retrovirus carrying the transgene (Jahner et
al. (1985) PNAS 82:6927-6931; Van der Putten et al. (1985) PNAS
82:6148-6152). Transfection is easily and efficiently obtained by
culturing the blastomeres on a monolayer of virus-producing cells
(Van der Putten, supra; Stewart et al. (1987) EMBO J. 6:383-388).
Alternatively, infection can be performed at a later stage. Virus
or virus-producing cells can be injected into the blastocoele
(Jahner et al. (1982) Nature 298:623-628). Most of the founders
will be mosaic for the transgene since incorporation occurs only in
a subset of the cells which formed the transgenic non-human animal.
Further, the founder may contain various retroviral insertions of
the transgene at different positions in the genome which generally
will segregate in the offspring. In addition, it is also possible
to introduce transgenes into the germ line by intrauterine
retroviral infection of the midgestation embryo (Jahner et al.
(1982) supra).
[0171] A third type of target cell for transgene introduction is
the embryonal stem cell (ES). ES cells are obtained from
pre-implantation embryos cultured in vitro and fused with embryos
(Evans et al. (1981) Nature 292:154-156; Bradley et al. (1984)
Nature 309:255-258; Gossler et al. (1986) PNAS 83: 9065-9069; and
Robertson et al. (1986) Nature 322:445-448). Transgenes can be
efficiently introduced into the ES cells by DNA transfection or by
retrovirus-mediated transduction. Such transformed ES cells can
thereafter be combined with blastocysts from a non-human animal.
The ES cells thereafter colonize the embryo and contribute to the
germ line of the resulting chimeric animal. For review see
Jaenisch, R. (1988) Science 240:1468-1474.
[0172] Methods of making knock-out or disruption transgenic animals
are also generally known. See, for example, Manipulating the Mouse
Embryo, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor,
N.Y., 1986). Recombinase dependent knockouts can also be generated,
e.g. by homologous recombination to insert recombinase target
sequences, such that tissue specific and/or temporal control of
inactivation of a RAP-BP gene can be controlled as above.
[0173] Another aspect of the present invention concerns a novel in
vivo method for the isolation of genes encoding proteins which
physically interact with a "bait" protein/drug complex. The method
relies on detecting the reconstitution of a transcriptional
activator in the presence of the drug, particularly wherein the
drug is a non-peptidyl small organic molecule (e.g. <2500K),
e.g. a macrolide, e.g. rapamycin, FK506 or cyclosporin. In
particular, the method makes use of chimeric genes which express
hybrid proteins. The first hybrid comprises the DNA-binding domain
of a transcriptional activator fused to the bait protein. The
second hybrid protein contains a transcriptional activation domain
fused to a "fish" protein, e.g. a test protein derived from a cDNA
library. If the fish and bait proteins are able to interact in a
drug-dependent manner, they bring into close proximity the two
domains of the transcriptional activator. This proximity is
sufficient to cause transcription of a reporter gene which is
operably linked to a transcriptional regulatory site responsive to
the transcriptional activator, and expression of the marker gene
can be detected and used to score for the interaction of the bait
protein/drug complex with another protein.
[0174] One advantage of this method is that a multiplicity of
proteins can, be simultaneously tested to determine whether any
interact with the drug/protein complex. For example, a DNA fragment
encoding the DNA-binding domain can be fused to a DNA fragment
encoding the bait protein in order to provide one hybrid. This
hybrid is introduced into the cells carrying the marker gene, and
the cells are contacted with a drug which is known to bind the bait
protein. For the second hybrid, a library of plasmids can be
constructed which may include, for example, total mammalian
complementary DNA (cDNA) fused to the DNA sequence encoding the
activation domain. This library is introduced into the cells
carrying the first hybrid. If any individual plasmid from the test
library encodes a protein that is capable of interacting with the
drug/protein complex, a positive signal may be obtained by
detecting expression of the reporter gene. In addition, when the
interaction between the drug complex and a novel protein occurs,
the gene for the newly identified protein is readily available.
[0175] As illustrated herein, the present interaction trap system
is a valuable tool in the identification of novel genes encoding
proteins which act at a point in a given signal transduction
pathway that is directly upstream or downstream from a particular
protein/drug complex. For example, the subject assay can be used to
identify the immediate downstream targets of an FKBP/rapamycin
complex, or of an FKBP/FK506 complex, or of a
cyclophilin/cyclosporin complex. Proteins that interact in a
drug-dependent manner with one of such complexes may be identified,
and these proteins can be of both diagnostic and therapeutic
value.
[0176] A first chimeric gene is provided which is capable of being
expressed in the host cell, preferably a yeast cell, most
preferably Saccharomyces cerevisiae or Schizosaccharomyces pombe.
The host cell contains a detectable gene having a binding site for
the DNA-binding domain of the transcriptional activator, such that
the gene expresses a marker protein when the marker gene is
transcriptionally activated. Such activation occurs when the
transcriptional activation domain of a transcriptional activator is
brought into sufficient proximity to the DNA-binding domain of the
transcriptional activator. The first chimeric gene may be present
in a chromosome of the host cell. The gene encodes a chimeric
protein which comprises a DNA-binding domain that recognizes the
binding site on the marker gene in the host cell and a bait protein
which is to be tested for drug-mediated interaction with a second
test protein or protein fragment.
[0177] A second chimeric gene is provided which is capable of being
expressed in the host cell. In one embodiment, both the first and
the second chimeric genes are introduced into the host cell in the
form of plasmids. Preferably, however, the first chimeric gene is
present in a chromosome of the host cell and the second chimeric
gene is introduced into the host cell as part of a plasmid. The
second chimeric gene contains a DNA sequence that encodes a second
hybrid protein. The second hybrid protein contains a
transcriptional activation domain. The second hybrid protein also
contains a second test protein or a protein fragment which is to be
tested for interaction with the first test protein or protein
fragment. Preferably, the DNA-binding domain of the first hybrid
protein and the transcriptional activation domain of the second
hybrid protein are derived from transcriptional activators having
separate DNA-binding and transcriptional activation domains. These
separate DNA-binding and transcriptional activation domains are
also known to be found in the yeast GAL4 protein, and are also
known to be found in the yeast GCN4 and ADR1 proteins. Many other
proteins involved in transcription also have separable binding and
transcriptional activation domains which make them useful for the
present invention. In another embodiment, the DNA-binding domain
and the transcriptional activation domain may be from different
transcriptional activators. The second hybrid protein is preferably
encoded on a library of plasmids that contain genomic, cDNA or
synthetically generated DNA sequences fused to the DNA sequence
encoding the transcriptional activation domain.
[0178] The drug-mediated interaction between the first test protein
and the second test protein in the host cell, therefore, causes the
transcriptional activation domain to activate transcription of the
detectable gene. The method is carried out by introducing the first
chimeric gene and the second chimeric gene into the host cell, and
contacting the cell with the drug of interest. The host cell is
subjected to conditions under which the first hybrid protein and
the second hybrid protein are expressed in sufficient quantity for
the detectable gene to be activated. The cells are then tested for
drug-dependent expression of the detectable gene.
[0179] Thus, interactions between a first test protein and a
library of proteins can be tested in the presence of the drug of
interest, in order to determine which members of the library are
involved in the formation of drug-dependent complexes between the
first and second protein. For example, the bait protein may be a
protein which binds FK506, rapamycin, or cyclosporin, e.g. can be
an FKBP or cyclophilin. The second test protein may be derived from
a cDNA library.
EXEMPLIFICATION
[0180] The invention now being generally described, it will be more
readily understood by reference to the following examples which are
included merely for purposes of illustration of certain aspects and
embodiments of the present invention, and are not intended to limit
the invention.
Example 1
Construction of the Bait Plasmids for the 2-Hybrid Screen
A. LexA-FKBP12 Bait:
[0181] The bait protein and fish protein constructs used in the
present drug-dependent interaction trap are essentially the same as
constructs used for other 2 hybrid assays (see, for example, U.S.
Pat. No. 5,283,317; Zervos et al. (1993) Cell 72:223-232; Madura et
al. (1993) J Biol Chem 268:12046-12054; Bartel et al. (1993)
Biotechniques 14:920-924; and Iwabuchi et al. (1993) Oncogene
8:1693-1696). Using the following oligonucleotides:
TABLE-US-00001 coding strand (SEQ ID No: 3) G GGT TTG GAA TTC CTA
ATA ATG TCT GTA CAA GTA GAA ACC non-coding strand (SEQ ID No: 4)
GGG TTT CGG GAT CCC GTC ATT CCA GTT TTA GAA G
PCR amplification was carried out from a lymphocyte cDNA library to
isolated the coding sequence for the FKBP12 protein. The sequence
of the human FKBP12 cloned was confirmed as:
TABLE-US-00002 (SEQ ID No: 5)
ATGTCCGTACAAGTAGAAACCATCTcCCCAGGAGACGGGCGCACCTTc
CCCAAGCGCGGCCAGACCTGCGTGGTGCACTACACCGGgATGCTTGAA
GATGGAAAGAAATTTGATTCCTCCCGTGACCGTAACAAGCCCTTTAAG
TTtATgCTAGGCaAGCAGGAGGTGATCCGAGGCTGGGAAGAagGGGTT
GcCCAGATGAGTGTGGgTCAGCGTGCCAAaCTgACTAtAtCTCcAGaT
tATgCcTATGgTGCCACTGGGCAccCAGGCATCATCCCACCACATGCC
ACTCTCGTCTTCGATGTGGAGCTTCTAAAACTGGAATGA
[0182] The resulting PCR product containing the human FKBP12 coding
sequences was then digested with EcoRI and BamHI, and cloned into
the EcoRI+BamHI sites of pBTM116 creating an in-frame fusion
between LexA and FKBP12. The resulting plasmid is referred to below
as plC504.
B. LexA-(gly).sub.6-FKBP12 Bait:
[0183] In order to generate an in frame fusion between LexA and
FKBP12 separated by six glycine residues, the coding sequence from
human FKBP12 was cloned by PCR as above, except that the sense
oligonucleotide provided an additional 18 nucleotides which
inserted 6 glycines in the open reading frame of the fusion
protein. The oligos used for PCR were:
TABLE-US-00003 coding strand (SEQ ID No: 7) TCG CCG GAA TTC GGG GGC
GGA GGT GGA GGA GTA CAA GTA GAA ACC ATC non-coding strand (SEQ ID
No: 8) GGG TTT CGG GAT CCC GTC ATT CCA GTT TTA GAA G
[0184] The PCR product containing the human FKBP12 coding sequences
was then digested with EcoRI and BamHI and cloned into the
EcoRI+BamHI sites of pBTM116 as above. The resulting plasmid is
referred to below as plC506.
Example 2
Construction of the FKBP12 Deletion Strain
[0185] A 1.8 kb HindIII-EcoRI yeast genomic fragment containing
FKB1 (the S. Cerveisia homolog of FKBP12) was cloned into the
HindIII+EcoRI sites of pSP72 (Promega).
[0186] A one-step PCR strategy was used to create a precise
deletion of the FKB 1 coding sequences extending from the ATG start
codon to the TGA stop codon. Simultaneously a unique BamHI site was
introduced in lieu of the FKB 1 coding sequences. The oligos used
to generate the FKB1 deletion and introduction of the unique BamHI
site were:
TABLE-US-00004 (SEQ ID No: 9)
CGCGGATCCGCGCATTATTACTTGTTTTGATTGATTTTTTG (SEQ ID No: 10)
CGCGGATCCGCGTAAAAGCAAAGTACTATCAATTGAGCCG
[0187] The yeast ADE2 gene on a 3.6 kb BamHI fragment was then
cloned into the unique BamHI site of the plasmid described above to
generate the plasmid pVB172. Flanking the ADE2 disruption marker of
pVB172 in the 5' and 3' noncoding sequence of FKB1 are XhoI sites.
pVB172 was digested with XhoI to release a linear fragment
containing ADE2 flanked by FKBI noncoding sequences. This linear
fragment was used to transform yeast strain L40 (Mat a his3
.DELTA.200 trp1-901 leu2-3,112 ade2 LYS2::(lexAop)4-HIS3
URA3::(lexAop).sub.8-lacZ GAL4 gal80) selecting for adenine
prototrophy.
[0188] ADE+ yeast transformants were tested for rapamycin
resistance to confirm that the wild type FKB1 allele was replaced
by ADE2. This disruption allele of FKB1 is designated
L40-fkb1-2.
Example 3
Cloning Of Mammalian Rapamycin Target Genes
[0189] We used the drug-dependent interaction trap described in
Example 1 above, with the LexA binding-domain fusion constructs as
bait to detect interaction with clones from cDNA libraries
containing VP16 activation-domain fusions. The reporters used as
"read-outs" signaling interaction in this system are the S.
cerevisiae HIS3 and the E. coli LacZ genes. The yeast strain L40,
the bait vector plasmid pBTM116 and the mouse embryonic PCR library
in the vector pVP16 were used to construct the cDNA fusion protein
library
[0190] The strain L40-fkb1-2, described above in Example 2, was
transformed with each of two bait plasmids, plC504, encoding the
LexA-FKBP12 fusion protein, or p10506, encoding the
LexA-(gly)6-FKBP12 fusion protein. The transformants,
L40-fkb1-2/p10504 (named ICY99) and L40-fkb1-2/plC506 (named
ICY101) were maintained on yeast media lacking tryptophan which
selects for cells harboring the bait plasmid.
[0191] A mouse embryo PCR library in pVP16 (designated pSH10.5),
which was generated by standard protocols using random-primed
synthesis of 10.5 day-post-coital CD1 mouse embryo polyA+ RNA and
size-selected for inserts between 350 bp and 700 bp in length, was
used to transform the yeast ICY99 and ICY101. The transformed yeast
cells were plated onto media lacking tryptophan and leucine.
Approximately 10.sup.7 transformants from each strain were pooled,
thoroughly mixed, and stored frozen in aliquots in 50% glycerol at
-80.degree. C.
[0192] Prior to screening, cells were thawed, grown for 5 hours in
liquid medium, and plated onto selective medium. Approximately
1.5.times.10.sup.7 ICY99/pSH10.5 cells were plated onto
phosphate-buffered (pH7) synthetic agar medium containing (i) all
amino acids except tryptophan, leucine and histidine, (ii)
Rapamycin at 125 ng/ml, (iii) the chromogenic substrate X-gal at
100 ng/ml, and (iv) 2% glucose as carbon source, at a plating
density of approximately 10.sup.6 per 15 cm plate. An identical
protocol was used for screening ICY101/pSH10.5 transformants,
except that a lower concentration of rapamycin was used, at 15.6
ng/ml.
[0193] Colonies which both grew on the selective medium and were
blue were picked for further testing. These represent cells which
do not require histidine for growth and which are expressing the
.beta.-galactosidase reporter. Candidate colonies appeared between
4-11 days after plating, and the blue color ranged from very light
blue to deep blue. They were then subjected to the following
tests.
i) Rapamycin-Dependence
[0194] Each candidate was streaked onto media lacking histidine and
containing either 125 ng/ml (for ICY99/pSH10.5 candidates), 15.6
ng/ml (for ICY101/pSH10.5 candidates) rapamycin, or no rapamycin
(for both). Candidate clones which grew in the presence of
rapamycin and failed to grow on media without rapamycin were chosen
for the next test.
[0195] For the ICY99/pSH10.5 screen, out of 107 His+ and LacZ+
candidates screened, 24 were rapamycin-dependent for growth on
medium lacking histidine. For the ICY101/pSH10.5 screen, 20 out of
101 His+ and LacZ+ candidates screened were
rapamycin-dependent.
ii) Plasmid-Linkage
[0196] To eliminate false positives caused by chromosomal
mutations, each candidate was grown in non-selective medium (YPD)
to permit loss of the bait (Trp+) and the cDNA (Leu+) plasmids.
Cells which had lost the bait plasmid (Trp-), the cDNA plasmid
(Leu-) or both plasmids (Trp- and Leu-), as well as those which had
retained both plasmids (Trp+ and Leu+), were streaked onto media
containing rapamycin but lacking histidine. Those candidates for
which only the derivatives containing both plasmids (Trp+ and Leu+)
grew, while the other three derivatives did not, were chosen for
further analysis.
[0197] For the ICY99/pSH10.5 screen, 23 out of 24 passed the test.
For the ICY101/pSH10.5 screen, all 20 passed the test.
iii) Positive and Negative Interaction with Control Baits
[0198] Whereas the previous test asked if the interaction
disappears when either or both members of the interaction (bait and
fish constructs) are lost, the present test asks if the candidate
cDNA plasmid (Leu+) can confer interaction when transformed into
yeast strains harboring various baits. DNA samples were prepared
from each candidate and used to transform E. coli strain B290
(auxotrophic for tryptophan and leucine). Since the yeast TRP1 and
LEU2 genes can complement the bacterial auxotrophies, respectively,
B290 cells containing the bait plasmid are Trp+ and can grow on
medium lacking tryptophan, while B290 cells containing the cDNA
plasmid are Leu+ and can grow on medium lacking leucine. Plasmid
DNA samples were each containing a different bait: i) ICY99, the
original strain used in the screen, containing the LexA::FKBP12
bait fusion; ii) ICY101, containing the LexA::(gly).sub.6::FKBP12
bait fusion, and iii) ICY102, containing a LexA fusion bait
irrelevant for the present study and which serves as a negative
control. The ideal candidate clone should confer His+ and LacZ+ to
ICY99 and ICY101 in a rapamycin-dependent manner, but not to
ICY102.
[0199] For the ICY99/pSH10.5 screen, 11 out of the 23 candidates
fulfilled the above criteria. For the ICY101/pSH10.5 screen, 10 out
of the 20 candidates fulfilled the above criteria.
[0200] The cDNA inserts of these candidate clones were sequenced in
both strands using the ABI fluorescent sequencing system. All 11
candidates from the ICY99/pSH10.5 screen, and at least 4 out of 10
of the candidates from the ICY101/pSH10.5 screen contain
overlapping fragments of an identical sequence. The 14 clones
represent at least 5 independent cloning events from the library as
judged by the insert/vector boundaries of each clone. The longest
and the shortest inserts differ by approximately 70 bp at the
amino-terminus and about 10 bp at the amino-terminus. The partial
nucleotide sequence, and corresponding amino acid sequence,
isolated from the mouse rapamycin/FKBP 12 binding protein (RAPT1),
is given in SEQ ID No: 1 and SEQ ID No: 2, respectively.
[0201] Surprisingly, a search of the GenBank database using the
program BLAST, revealed that the peptide encoded by the above
sequence shares some homology, though less than 60 percent absolute
homology, to the S. cerevisiae TOR1 (and DRR1) and TOR2 gene
products previously isolated from yeast.
Example 4
Cloning of Human Homologs of Rapamycin Target Genes
[0202] Having isolated a partial sequence for the gene encoding a
rapamycin-target-protein from a mouse library, we proceeded to
isolate the human gene using the mouse sequence as a probe. The
plasmid clone plC99.1.5, containing the longest insert of the RAPT1
clone, was chosen as probe for hybridization. The insert (500 bp)
was separated from plasmid DNA by digestion with Not I restriction
endonuclease followed by agarose gel electrophoresis and fragment
purification. The fragment was radiolabelled with
.alpha.P.sup.32-labeled dCTP by random-incorporation with the
Klenow fragment of DNA polymerase. The radiolabelled DNA probe was
isolated away from free nucleotides by a G50 column,
alkali-denatured, and added to the hybridization mix at
2.times.10.sup.6 cpm/ml.
[0203] Approximately 3.times.10.sup.6 phage of a human B cell cDNA
library in .lamda.-pACT (FIG. 1) were screened by filter
hybridization using the probe described above, in 30% formamide,
5.times.SSC, 5.times.Denhardts, 20 .mu.g/ml denatured salmon sperm
DNA, and 1% SDS, at 37.degree. C. Following hybridization, the
filters were washed at 0.5.times.SSC and 0.1% SDS, at 50.degree. C.
These represent conditions of medium stringency appropriate for
mouse-to-human cross-species hybridizations. A number of positive
plaques were obtained, and several were analyzed. A number of the
isolated clones turned out to be various 3' fragments of the same
gene, or very closely related genes, which, after sequence
analysis, was determined to be the human RAPT1 gene. The clone
containing the longest coding sequence fragment, comprising what is
believed to be roughly half the full-length protein (C-terminus)
and including the FKBP/rapamycin binding site and the putative
PI-kinase activity, is designated as plasmid pIC524. A deposit of
the pACT plasmid form of pIC524 was made with the American Type
Culture Collection (Rockville, Md.) on May 27, 1994, under the
terms of the Budapest Treaty. ATCC Accession number 75787 has been
assigned to the deposit.
[0204] FIG. 1 is a map of the human RAPT1 clone of pIC524 (inserted
at the XhoI site). The insert is approximately 3.74 kb in length,
and nucleotide RAPT1 coding sequence from the insert has been
obtained and is represented by nucleotide residues 2401-5430 of SEQ
ID No. 11. The corresponding amino acid sequence is represented by
residues His801-Trp1809 of SEQ ID No. 12. The region of the human
RAPT1 clone corresponding to the mouse RAPT1 fragment is greater
than 95% homologous at the amino acid level and 90% homologous at
the nucleotide level. In addition to the pIC524 clone, further 5'
sequence of the human RAPT1 gene was obtained from other
overlapping clones, with the additional sequence of the 3' end of
the .about.5.4 kb partial gene given in SEQ ID No. 11. Furthermore,
SEQ ID No. 19 provides additional 3' non-coding sequence (obtained
from another clone) which flanks the RAPT1 coding sequence.
[0205] It will be evident to those skilled in the art that, given
the present sequence information, PCR primers can be designed to
amplify all, or certain fragments of the RAPT1 gene sequence
provided in pIC524. For example, the primers TGAAGATACCCCACCAA-ACCC
(SEQ ID No. 21) and TGCACAGTTGAAGTGAAC (SEQ ID No. 22) correspond
to pACT sequences flanking the XhoI site, and can be used to PCR
amplify the entire RAPT1 sequence from pIC524. Alternatively,
primers based on the nucleic acid sequence of SEQ ID No. 11 can be
used to amplify fragments of the RAPT1 gene in pIC524. The PCR
primers can be subsequently sub-cloned into expression vectors, and
used to produce recombinant forms of the subject RAPT1 protein.
Thus, the present provides recombinant RAPT1 proteins encoded by
recombinant genes comprising RAPT1 nucleotide sequences from ATCC
deposit number 75787. Moreover, it is clear that primer/probes can
be generated which include even those portion of pIC524 not yet
sequenced by simply providing PCR primers based on the known
sequences.
[0206] Furthermore, our preliminary data indicate that other
proteins which are related to RAPT1, e.g. RAPT1 homologs, were also
obtained from the present assay, suggesting that RAPT1 is a member
of a larger family of related proteins.
Example 5
Cloning of Novel Human Ubiquitin Conjugating Enzyme
[0207] Constructs similar to those described above for the
drug-dependent interaction trap assay were used to screen a WI38
(mixed G.sub.0 and dividing fibroblast) cDNA library (Clonetech,
Palo Alto Calif.) in pGADGH (XhoI insert, Clonetech). Briefly, the
two hybrid assay was carried out as above, using GAL4 constructs
instead of LexA, and in an HF7C yeast cell (Clonetech) in which
FKB1 gene was disrupted (see Example 1). Of the clones isolated, a
novel human ubiquitin-conjugating enzyme (rap-UBC) has been
identified. A deposit of the pGADGH plasmid (clone "SMR4-15") was
made with the American Type Culture Collection (Rockville, Md.) on
May 27, 1994, under the terms of the Budapest Treaty. ATCC
Accession number 75786 has been assigned to the deposit. The insert
is approximately 1 kB.
[0208] The sequence of the 5' portion of the SMR4-15 insert is
given by SEQ ID No. 23 (nucleotide) and SEQ ID No. 24 (amino acid)
and comprises a substantial portion of the coding region for
rap-UBC, including the active site cysteine: The sequence for the
3' portion of the clone is provided by SEQ ID No. 25. As described
above, primers based on the nucleic acid sequence of SEQ ID No. 23
(and 25) can be used to amplify fragments of the rap-UBC gene from
SMR4-15. The PCR primers can be subsequently sub-cloned into
expression vectors, and used to produce recombinant forms of the
subject enzyme. Thus, the present provides recombinant rap-UBC
proteins encoded by recombinant genes comprising rap-UBC nucleotide
sequences from ATCC deposit number 75786.
Example 6
Construction of the Serine-to-Argenine mRAPT1 Mutation
[0209] The smallest mRAPT1 clone that interacted with the
FKBP12/rapamycin complex was 399 bp, defingin a rapamycin binding
domain. The RAPT1 binding domain corresponds to a region in yeast
TOR1/TOR2 located immediately upstream, but outside of the lipid
kinase consensus sequence. This region contains the serine residue
which when mutated in yeast TOR1 confers resistance to rapamycin
(Cafferkey et al. (1993) Mol Cell Biol 13:6012-6023). A mouse RAPT1
serine-to-argenine mutation was constructed by oligonucleotide
mutagenesis. Coding and noncoding strand oligonucleotides
containing the mutations were: GAAGAGGCAAGACGCTTGTAC (SEQ ID NO:26)
and GTACAAGCGTCTTGCC-TCTTC (SEQ ID NO:27). PCR reactions were
performed using these oligonucleotides in combination with
oligonucleotides GAGTTTGAGCAGATGTTTA (SEQ ID NO:28) and the M13
universal primer which are sequences in the pVP16 vector, 5' and 3'
of the mRAPT1 insert, respectively. pVP16 containing mRAPT1 was
used as the template for PCR. The PCR product, digested with BamHI
and EcoRI, was cloned into the BamHI and EcoRI sites in pVP16. The
resulting clone was sequenced to verify that the clone contained
the serine-to-argenine mutation and no others.
[0210] The smallest mRAPT1 clone that interacted with the
FKBP12/rapamycin complex was 399 bp, defining the RAPT1 binding
domain. The RAPT1 binding domain corresponds to a region in yeast
TOR located immediately upstream, but outside of the lipid kinase
consensus sequence. This region contains the serine residue which
when mutated in yeast TOR1 (also called DRR1) confers resistance to
rapamycin (Cafferkey et al. (1993) Mol. Cell. Biol. 13:6012-6023;
Helliwell et al. (1994) Mol. Cell. Biol. 5:105-118). The
corresponding mutation was constructed in mRAPT1. The
serine-to-argenine mutation abolishes interaction of mRAPT1 with
the FKBP12/rapamycin complex (see FIG. 3), activating neither HIS3
nor lacZ expression on the two-hybrid assay, indicating that the
serine is involved in the association of the FKBP12/rapamycin
complex with mRAPT1.
Example 7
Northern Analysis
[0211] The multiple tissue Northern blots (containing 2 .mu.g of
human RNA per lane) were obtained from Clonetech Labs., Inc.
Hybridizations were at 42.degree. C. in 5.times.SSPE,
5.times.Denhardt's, 30% formamide, 1% SDS and 200 .mu.g/ml
denatured salmon sperm DNA. Washes were at 0.1.times.SSC and 0.1%
SDS at 55.degree. C. The blot was exposed for 5 days prior to
autoradiography. The levels of RNA loaded in each lane were
independently monitored by hybridizing the same blots with a human
G3PDH probe and were found to be similar in all lanes, with the
exception of skeletal muscle, which had approximately 2-3 fold the
signal.
[0212] RAPT1 specifies a single transcript of approximately 9 kb
that is present in all tissues examined, exhibiting the highest
levels in testis. The transcript is sufficient to encode a protein
equivalent to the size of yeast TOR which is 284 kDa. Assuming that
RAPT1 is of similar size, a small fragment of 133 amino acids has
been cloned from within a large protein, but which fragment is
sufficient to bind FKBP12/rapamycin complex.
Example 8
High Throughput Assay Based on the Two-Hybrid System for
Identifying Novel Rapamycin Analogs
[0213] To develop a high throughput screen based on the two-hybrid
system, we devised a procedure to quantitate protein-protein
interaction mediated by a small molecule. Since protein-protein
interaction in the two-hybrid system stimulates transcription of
the lacZ reporter gene, the assay utilizes a substrate of
.beta.-galactosidase (the lacZ gene product lacZ gene product)
which when cleaved produces a chemiluminescent signal that can be
quantitated. This assay can be performed in microtiter plates,
allowing thousands of compounds to be screened per week. The assay
includes the following steps: [0214] 1. Inoculate yeast cells from
a single colony into 50 ml of growth medium, synthetic complete
medium lacking leucine and tryptophan (Sherman, F. (1991) Methods
Enzymol. 194:3-20). Incubate the flask overnight at 30.degree. C.
with shaking (.about.200 rpm). [0215] 2. Dilute the overnight
culture to a final A.sub.600 of 0.02 in growth medium and incubate
overnight as described in step 1. [0216] 3. Dilute the second
overnight culture to a final A.sub.600 of 0.5 in growth medium.
Using a Quadra 96 pipettor (TomTec, Inc.), dispense 135 .mu.l
aliquots of the cell suspension into wells of a round bottom
microtiter plate pre-loaded with 15 .mu.l/well of the compound to
be tested at various concentrations. (The compounds are dissolved
in 5% dimethyl sulfoxide, so that the final DMSO concentration
added to cells is 0.5% which does not perturb yeast cell growth.)
Cover microtiter plates and incubate at 30.degree. C. for 4 hr with
shaking at 300 rpm. [0217] 4. Centrifuge microtiter plate for 10 mM
at 2000 rpm. Remove the supernatant with the Quadra 96 pipettor and
wash with 225 .mu.l phosphate buffered saline. [0218] 5. Dispense
100 .mu.l of lysis buffer (100 mM.sub.2HPO.sub.4 pH 7.8; 0.2%
Triton X-100; 1.0 mM ditiothriotol) into each well, cover, and
incubate for 30 min at room temperature with shaking at 300 rpm.
[0219] 6. Dispense into each well of a Microfluor plate (Dynatech
Laboratories, Chantilly, Va.), 50 .mu.l of the chemiluminescent
substrate, Galacton Plus.TM. (Tropix, Inc., Bedford, Mass.) in
diluent (100 mM Na.sub.2HPO.sub.4, 1 mM MgCl2, pH 8.0). To these
wells, transfer 20 .mu.l of cell lysate and incubate in the dark
for 60 min at room temperature. [0220] 7. Add to each well 75 .mu.l
of Emeral.TM. accelerator. Cover plate and count in a Topcount
scintillation counter (Packard, Inc.) for 0.01 min/well.
[0221] The rapamycin target proteins, isolated as described above,
were incorporated into the quantitative assay, as was a variety of
FKBPs. The FKBPs included in the screen were human FKBP12 and that
from pathogenic fungi, FKBP13 (Jin et al. (1991) Proc. Natl. Acad.
Sci. 88:6677) and FKBP25 (Jin et al. (1992) J. Biol. Chem.
267:2942; Galat et al. (1992) Biochem. 31:2427-2434). Yeast strains
containing different FKBP-target pairs can be tested against
libraries of rapamycin and FK506 analogs. Such a screen can yield
different classes of compounds including (i) target-specific
compounds, those that mediate interaction between a specific target
and more than one FKBP, (ii) FKBP-specific compounds, those that
mediate interaction between a particular FKBP and more than one
target and, most ideally, (iii) FKBP/target-specific compounds,
those that mediate interaction between a particular FKBP and
target. The protein interactions mediated by the test compounds and
measured in this assay can be correlated with immunosuppressive,
antifungal, antiproliferative and toxicity profiles, as well as
their Ki's for inhibition of FKBP PPIase activity.
[0222] Using the quantitative chemiluminescence assay described
above, the interaction of human LexA-FKBP12 and VP16-RAPT1 was
analyzed in the presence and absence of rapamycin. Interaction
between FKBP12- and RAPT1 was measured as a function of drug
concentration. Addition of rapamycin from 0 to 500 ng/ml increased
.beta.-galactosidase activity approximately one thousand-fold. This
effect was specific for rapamycin; FK506 over the same
concentration range did not increase .beta.-galactosidase activity
significantly over background levels. If lexA-da, a control
construct, is substituted for the lexA-FKBP12, .beta.-galactosidase
activity does not increase as a function of rapamycin addition. The
basal levels of .beta.-galactosidase in the negative controls are
0.1 percent of the maximum levels detected in the yeast strain
containing the FKBP12 and RAPT1 constructs, grown in media
containing 500 ng/ml rapamycin. These results, illustrated in FIG.
2, indicate that protein interactions mediated by a small molecule
in the two-hybrid system can be quantitated and assayed in a
microtiter format that can be used for high throughput screening.
Employing various FKBPs and RAPT1 proteins in the two-hybrid format
(FIG. 3) rapamycin-mediated interactions were measured in this
quantitative assay.
Example 9
In Vitro Protein Interactions Mediated by Rapamycin
[0223] Drug-mediated interactions of FK506-binding proteins and the
RAPT1 proteins is analyzed in vitro using purified FKBP12 fused to
glutathione-S-transferase (GST) and .sup.35S labeled RAPT1 proteins
prepared by in vitro transcription and translation. For this
purpose FKBP12 is fused in the frame of GST in pGEX (Pharmacia,
Piscataway, N.J.). GST-FKBP12 fusion proteins are expressed and
purified from E. coli (Vojtek et al. (1993) Cell 74:205-214). RAPT1
coding sequences are cloned behind the CMV and T7 promoters in the
mammalian expression vector, pX (Superti-Furga et al. (1991) J.
Immunol. Meths. 151:237-244). RAPT1 sequences are transcribed from
the T7 promoter and translated in vitro using commercially
available reagents (Promega, Madison, Wis.) in a reaction
containing .sup.35S-methionine. For in vitro binding (Toyoshima et
al. (1994) Cell 78:67-74), 5 to 20 .mu.A of the in vitro
transcription/translation reactions are added to 200 .mu.l of
binding buffer (20 mM HEPES[pH7.4], 150 mM NaCl, 10% glycerol,
0.05% NP-40). After addition of 10 .mu.l of GST-FKBP12 bound to
glutathione-agarose beads, the reaction is incubated at 4.degree.
C. for 2 hr with rotation. Various contractions of drug are added
to reactions, such as 0.1 to 10-fold that of FKBP12 on a molar
basis. No drug is added to control reactions. The agarose beads are
then precipitated and washed four times with binding buffer. Bound
proteins isolated by boiling in Laemmli sample buffer, resolved on
4-20% gradient SDS polyacrylamide gels, and visualized by
autoradiography. Detection of .sup.35S-labelled RAPT1 protein from
binding reactions containing drug demonstrates direct binding to
FKBP12 as a function of drug.
Example 10
Effect of RAPT1 Mutations on Complex Formation and Rapamycin
Sensitivity
[0224] To more particularly map the rapamycin-binding domain of
RAPT1 requires the isolation of mutants that fail to bind to a
FKBP/rapamycin complex. As described in the Examples above,
association with the FKBP/rapamycin can be tested in the LexA
two-hybrid system in which FKBP12 is expressed as a fusion to LexA
and RAPT1 proteins are expressed as fusions to the VP16 activation
domain. Accordingly, a library of mutant RAPT1 proteins is
generated by mutagenizing coding sequences through PCR-generated
random mutagenesis (Cadwell and Joyce (1992) PCR Methods Appl
2:28-33). The 5' and 3' oligos for PCR contain BamH1 and EcoRI
restriction sites, respectively, that allow subsequent cloning of
the PCR products into pVP16 creating an in-frame fusion. In
addition, the 3' oligo contains a 27 bp HA epitope sequence
followed by an in frame stop codon. The addition of the HA epitope
tag to the C-terminal end of the fusion proteins allows the
characterization of the mutant RAPT1 proteins (see below).
[0225] Upon completion of the mutagenesis, the EcoR1-BamHI digested
PCR products are inserted into pVP16. The library of mutant RAPT1
proteins is amplified by transformation into E. coli. To identify
those mutations that impair the ability of a RAPT1 to interact with
an FKBP/rapamycin complex, the mutagenized RAPT1 library is
introduced into a yeast strain containing the LexA-FKBP bait
protein. Each transformed cell carries one individual mutant RAPT1
fused to the transcriptional activator VP16. Interaction between
the FKBP and wild type RAPT1 occurs when cells are grown in media
containing rapamycin, inducing lacZ expression and turning colonies
blue on X-GAL indicator plates. Colonies in which the interaction
between an FKBP/rapamycin complex and the RAPT1 mutant is impaired
are light blue or white. Two classes of mutations can produce this
phenotype: nonsense mutations resulting in truncated version of
RAPT1 or sense mutations that affect the binding of RAPT1 to the
FKBP/rapamycin complex. To distinguish between these two types of
mutations, total protein extracts made from these colonies is
subjected to Western blot analysis using an anti-HA antibody.
Nonsense mutations that give rise to shorter, truncated proteins do
not contain the HA epitope at their C-terminus and thus are not be
detected by the anti-HA antibody. Conversely, full-length proteins
with an incorporated sense mutations are detected with this
antibody.
[0226] The library plasmids from the light blue or white colonies
that express full-length RAPT1 protein with the HA epitope are
rescued by retransformation into E Coli. The position of the
mutation is determined by sequence analysis, and the phenotype
verified by retransformation of these plasmids back into the yeast
strain containing LexA-FKBP12.
[0227] Mutants that retest can also be cloned into the mammalian
expression vector, pX. pX-RAPT1 or pX lacking RAPT1 sequences, are
then introduced into the lymphoid (CTLL and Kit225) and nonlymphoid
cells (MG63 and RH30) sensitive to rapamycin. The effect of the
mutation on rapamycin sensitivity is measured in terms of
inhibition of DNA synthesis monitored by BrdU incorporation.
Mutants that confer resistance of rapamycin by virtue of being
unable to bind to the FKBP12/rapamycin complex indicate which
mutations mediate drug sensitivity in lymphoid and nonlymphoid
cells. Of particular interest is whether different RAPT1s mediate
drug sensitivity in different cell types.
Example 11
Cloning of a RAPT1-like Polypeptide from Candida albican
[0228] In order to clone homologs of the RAPT1 genes from human
pathogen Candida, degenerate oligonucleotides based on the
conserved regions of the RAPT1 and TOR proteins were designed and
used to amplify C. albicans cDNA in .lamda.ZAP (strain 3153A). The
amplification consisted of 30 cycles of 94.degree. C. for 1 minute,
55.degree. C. for 1 minute and 72.degree. C. for 1 minute with the
PCR amplimers GGNAARGCNCAYCCNCARGC and ATNGCNGGRTAYTGYTGDATNTC. The
PCR reactions were separated on a 2.5% low melting agarose gel,
that identified a sizable fragment. The fragment was eluted and
cloned into pCRII (TA cloning system, Invitrogen corporation).
[0229] The C. albicans DNA probes were .sup.32P-labeled by nick
translation and used on Southern blots to confirm the species
identity of the fragments and to further screen C. albicans cDNA
libraries. Sequencing of the larger cDNAs confirmed the identity of
the clones. The partial sequence of a C. albicans RAPT1-like
polypeptide, with the open-reading frame designated, is provided by
SEQ ID Nos. 13 and 14.
[0230] All of the above-cited references and publications are
hereby incorporated by reference.
EQUIVALENTS
[0231] Those skilled in the art will recognize, or be able to
ascertain using no more than routine experimentation, many
equivalents to the specific embodiments of the invention described
herein. Such equivalents are intended to be encompassed by the
following claims.
Sequence CWU 1 SEQUENCE LISTING <160> NUMBER OF SEQ ID
NOS: 35 <210> SEQ ID NO 1 <211> LENGTH: 486 <212>
TYPE: DNA <213> ORGANISM: Mouse <220> FEATURE:
<221> NAME/KEY: CDS <222> LOCATION: (1)...(486)
<400> SEQUENCE: 1 ctc acc cgt cac aat gca gcc aac aag atc ttg
aag aac atg tgt gaa 48 Leu Thr Arg His Asn Ala Ala Asn Lys Ile Leu
Lys Asn Met Cys Glu 1 5 10 15 cac agc aac acg ctg gtc cag cag gcc
atg atg gtg agt gaa gag ctg 96 His Ser Asn Thr Leu Val Gln Gln Ala
Met Met Val Ser Glu Glu Leu 20 25 30 att cgg gta gcc atc ctc tgg
cat gag atg tgg cat gaa ggc ctg gaa 144 Ile Arg Val Ala Ile Leu Trp
His Glu Met Trp His Glu Gly Leu Glu 35 40 45 gag gca tct cgc ttg
tac ttt ggg gag agg aac gtg aaa ggc atg ttt 192 Glu Ala Ser Arg Leu
Tyr Phe Gly Glu Arg Asn Val Lys Gly Met Phe 50 55 60 gag gtg ctg
gag ccc ctg cat gct atg atg gaa cgg ggt ccc cgg act 240 Glu Val Leu
Glu Pro Leu His Ala Met Met Glu Arg Gly Pro Arg Thr 65 70 75 80 ctg
aag gaa aca tcc ttt aat cag gca tat ggc cga gat tta atg gag 288 Leu
Lys Glu Thr Ser Phe Asn Gln Ala Tyr Gly Arg Asp Leu Met Glu 85 90
95 gca caa gaa tgg tgt cga aag tac atg aag tcg ggg aac gtc aag gac
336 Ala Gln Glu Trp Cys Arg Lys Tyr Met Lys Ser Gly Asn Val Lys Asp
100 105 110 ctc acg caa gcc tgg gac ctc tac tat cac gtg ttc aga cgg
atc tca 384 Leu Thr Gln Ala Trp Asp Leu Tyr Tyr His Val Phe Arg Arg
Ile Ser 115 120 125 aag cag cta ccc cag ctc aca tcc ctg gag ctg cag
tat gtg tcc ccc 432 Lys Gln Leu Pro Gln Leu Thr Ser Leu Glu Leu Gln
Tyr Val Ser Pro 130 135 140 aaa ctt ctg atg tgc cga gac ctt gag ttg
gct gtg cca gga aca tac 480 Lys Leu Leu Met Cys Arg Asp Leu Glu Leu
Ala Val Pro Gly Thr Tyr 145 150 155 160 gac ccc 486 Asp Pro
<210> SEQ ID NO 2 <211> LENGTH: 162 <212> TYPE:
PRT <213> ORGANISM: Mouse <400> SEQUENCE: 2 Leu Thr Arg
His Asn Ala Ala Asn Lys Ile Leu Lys Asn Met Cys Glu 1 5 10 15 His
Ser Asn Thr Leu Val Gln Gln Ala Met Met Val Ser Glu Glu Leu 20 25
30 Ile Arg Val Ala Ile Leu Trp His Glu Met Trp His Glu Gly Leu Glu
35 40 45 Glu Ala Ser Arg Leu Tyr Phe Gly Glu Arg Asn Val Lys Gly
Met Phe 50 55 60 Glu Val Leu Glu Pro Leu His Ala Met Met Glu Arg
Gly Pro Arg Thr 65 70 75 80 Leu Lys Glu Thr Ser Phe Asn Gln Ala Tyr
Gly Arg Asp Leu Met Glu 85 90 95 Ala Gln Glu Trp Cys Arg Lys Tyr
Met Lys Ser Gly Asn Val Lys Asp 100 105 110 Leu Thr Gln Ala Trp Asp
Leu Tyr Tyr His Val Phe Arg Arg Ile Ser 115 120 125 Lys Gln Leu Pro
Gln Leu Thr Ser Leu Glu Leu Gln Tyr Val Ser Pro 130 135 140 Lys Leu
Leu Met Cys Arg Asp Leu Glu Leu Ala Val Pro Gly Thr Tyr 145 150 155
160 Asp Pro <210> SEQ ID NO 3 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
<400> SEQUENCE: 3 gggtttggaa ttcctaataa tgtctgtaca agtagaaacc
40 <210> SEQ ID NO 4 <211> LENGTH: 34 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide <400>
SEQUENCE: 4 gggtttcggg atcccgtcat tccagtttta gaac 34 <210>
SEQ ID NO 5 <211> LENGTH: 348 <212> TYPE: DNA
<213> ORGANISM: Homo sapiens <220> FEATURE: <221>
NAME/KEY: CDS <222> LOCATION: (14)...(325) <400>
SEQUENCE: 5 ggaattccta ata atg tcc gta caa gta gaa acc atc tcc cca
gga gac 49 Met Ser Val Gln Val Glu Thr Ile Ser Pro Gly Asp 1 5 10
ggg cgc acc ttc ccc aag cgc ggc cag acc tgc gtg gtg cac tac acc 97
Gly Arg Thr Phe Pro Lys Arg Gly Gln Thr Cys Val Val His Tyr Thr 15
20 25 ggg atg ctt gaa gat gga aag aaa ttt gat tcc tcc cgt gac cgt
aac 145 Gly Met Leu Glu Asp Gly Lys Lys Phe Asp Ser Ser Arg Asp Arg
Asn 30 35 40 aag ccc ttt aag ttt atg cta ggc aag cag gag gtg atc
cga ggc tgg 193 Lys Pro Phe Lys Phe Met Leu Gly Lys Gln Glu Val Ile
Arg Gly Trp 45 50 55 60 gaa gaa ggg gtt gcc cag atg agt gtg ggt cag
cgt gcc aaa ctg act 241 Glu Glu Gly Val Ala Gln Met Ser Val Gly Gln
Arg Ala Lys Leu Thr 65 70 75 ata tct cca gat tat gcc tat ggt gcc
act ggg cac cca ggc atc atc 289 Ile Ser Pro Asp Tyr Ala Tyr Gly Ala
Thr Gly His Pro Gly Ile Ile 80 85 90 cca cca cat gcc act ctc gtc
ttc gat gtg gag ctt ctaaaactgg 335 Pro Pro His Ala Thr Leu Val Phe
Asp Val Glu Leu 95 100 aatgacggga tcc 348 <210> SEQ ID NO 6
<211> LENGTH: 104 <212> TYPE: PRT <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 6 Met Ser Val Gln Val Glu Thr
Ile Ser Pro Gly Asp Gly Arg Thr Phe 1 5 10 15 Pro Lys Arg Gly Gln
Thr Cys Val Val His Tyr Thr Gly Met Leu Glu 20 25 30 Asp Gly Lys
Lys Phe Asp Ser Ser Arg Asp Arg Asn Lys Pro Phe Lys 35 40 45 Phe
Met Leu Gly Lys Gln Glu Val Ile Arg Gly Trp Glu Glu Gly Val 50 55
60 Ala Gln Met Ser Val Gly Gln Arg Ala Lys Leu Thr Ile Ser Pro Asp
65 70 75 80 Tyr Ala Tyr Gly Ala Thr Gly His Pro Gly Ile Ile Pro Pro
His Ala 85 90 95 Thr Leu Val Phe Asp Val Glu Leu 100 <210>
SEQ ID NO 7 <211> LENGTH: 48 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide <400>
SEQUENCE: 7 tcgccggaat tcgggggcgg aggtggagga gtacaagtag aaaccatc 48
<210> SEQ ID NO 8 <211> LENGTH: 34 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide <400>
SEQUENCE: 8 gggtttcggg atcccgtcat tccagtttta gaag 34 <210>
SEQ ID NO 9 <211> LENGTH: 41 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide <400>
SEQUENCE: 9 cgcggatccg cgcattatta cttgttttga ttgatttttt g 41
<210> SEQ ID NO 10 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide <400>
SEQUENCE: 10 cgcggatccg cgtaaaagca aagtactatc aattgagccg 40
<210> SEQ ID NO 11 <211> LENGTH: 5430 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <220> FEATURE:
<221> NAME/KEY: CDS <222> LOCATION: (1)...(5427)
<400> SEQUENCE: 11 ttg gag cac agt ggg att gga aga atc aaa
gag cag agt gcc cgc atg 48 Leu Glu His Ser Gly Ile Gly Arg Ile Lys
Glu Gln Ser Ala Arg Met 1 5 10 15 ctg ggg cac ctg gtc tcc aat gcc
ccc cga ctc atc cgc ccc tac atg 96 Leu Gly His Leu Val Ser Asn Ala
Pro Arg Leu Ile Arg Pro Tyr Met 20 25 30 gag cct att ctg aag gca
tta att ttg aaa ctg aaa gat cca gac cct 144 Glu Pro Ile Leu Lys Ala
Leu Ile Leu Lys Leu Lys Asp Pro Asp Pro 35 40 45 gat cca aac cca
ggt gtg atc aat aat gtc ctg gca aca ata gga gaa 192 Asp Pro Asn Pro
Gly Val Ile Asn Asn Val Leu Ala Thr Ile Gly Glu 50 55 60 ttg gca
cag gtt agt ggc ctg gaa atg agg aaa tgg gtt gat gaa ctt 240 Leu Ala
Gln Val Ser Gly Leu Glu Met Arg Lys Trp Val Asp Glu Leu 65 70 75 80
ttt att atc atc atg gac atg ctc cag gat tcc tct ttg ttg gcc aaa 288
Phe Ile Ile Ile Met Asp Met Leu Gln Asp Ser Ser Leu Leu Ala Lys 85
90 95 agg cag gtg gct ctg tgg acc ctg gga cag ttg gtg gcc agc act
ggc 336 Arg Gln Val Ala Leu Trp Thr Leu Gly Gln Leu Val Ala Ser Thr
Gly 100 105 110 tat gta gta gag ccc tac agg aag tac cct act ttg ctt
gag gtg cta 384 Tyr Val Val Glu Pro Tyr Arg Lys Tyr Pro Thr Leu Leu
Glu Val Leu 115 120 125 ctg aat ttt ctg aag act gag cag aac cag ggt
aca cgc aga gag gcc 432 Leu Asn Phe Leu Lys Thr Glu Gln Asn Gln Gly
Thr Arg Arg Glu Ala 130 135 140 atc cgt gtg tta ggg ctt tta ggg gct
ttg gat cct tac aag cac aaa 480 Ile Arg Val Leu Gly Leu Leu Gly Ala
Leu Asp Pro Tyr Lys His Lys 145 150 155 160 gtg aac att ggc atg ata
gac cag tcc cgg gat gcc tct gct gtc agc 528 Val Asn Ile Gly Met Ile
Asp Gln Ser Arg Asp Ala Ser Ala Val Ser 165 170 175 ctg tca gaa tcc
aag tca agt cag gat tcc tct gac tat agc act agt 576 Leu Ser Glu Ser
Lys Ser Ser Gln Asp Ser Ser Asp Tyr Ser Thr Ser 180 185 190 gaa atg
ctg gtc aac atg gga aac ttg cct ctg gat gag ttc tac cca 624 Glu Met
Leu Val Asn Met Gly Asn Leu Pro Leu Asp Glu Phe Tyr Pro 195 200 205
gct gtg tcc atg gtg gcc ctg atg cgg atc ttc cga gac cag tca ctc 672
Ala Val Ser Met Val Ala Leu Met Arg Ile Phe Arg Asp Gln Ser Leu 210
215 220 tct cat cat cac acc atg gtt gtc cag gcc atc acc ttc atc ttc
aag 720 Ser His His His Thr Met Val Val Gln Ala Ile Thr Phe Ile Phe
Lys 225 230 235 240 tcc ctg gga ctc aaa tgt gtg cag ttc ctg ccc cag
gtc atg ccc acg 768 Ser Leu Gly Leu Lys Cys Val Gln Phe Leu Pro Gln
Val Met Pro Thr 245 250 255 ttc ctt aat gtc att cga gtc tgt gat ggg
gcc atc cgg gaa ttt ttg 816 Phe Leu Asn Val Ile Arg Val Cys Asp Gly
Ala Ile Arg Glu Phe Leu 260 265 270 ttc cag cag ctg gga atg ttg gtg
tcc ttt gtg aag agc cac atc aga 864 Phe Gln Gln Leu Gly Met Leu Val
Ser Phe Val Lys Ser His Ile Arg 275 280 285 cct tat atg gat gaa ata
gtc acc ctc atg aga gaa ttc tgg gtc atg 912 Pro Tyr Met Asp Glu Ile
Val Thr Leu Met Arg Glu Phe Trp Val Met 290 295 300 aac acc tca att
cag agc acg atc att ctt ctc att gag caa att gtg 960 Asn Thr Ser Ile
Gln Ser Thr Ile Ile Leu Leu Ile Glu Gln Ile Val 305 310 315 320 gta
gct ctt ggg ggt gaa ttt aag ctc tac ctg ccc cag ctg atc cca 1008
Val Ala Leu Gly Gly Glu Phe Lys Leu Tyr Leu Pro Gln Leu Ile Pro 325
330 335 cac atg ctg cgt gtc ttc atg cat gac aac agc cca ggc cgc att
gtc 1056 His Met Leu Arg Val Phe Met His Asp Asn Ser Pro Gly Arg
Ile Val 340 345 350 tct atc aag tta ctg gct gca atc cag ctg ttt ggc
gcc aac ctg gat 1104 Ser Ile Lys Leu Leu Ala Ala Ile Gln Leu Phe
Gly Ala Asn Leu Asp 355 360 365 gac tac ctg cat tta ctg ctg cct cct
att gtt aag ttg ttt gat gcc 1152 Asp Tyr Leu His Leu Leu Leu Pro
Pro Ile Val Lys Leu Phe Asp Ala 370 375 380 cct gaa gct cca ctg cca
tct cga aag gca gcg cta gag act gtg gac 1200 Pro Glu Ala Pro Leu
Pro Ser Arg Lys Ala Ala Leu Glu Thr Val Asp 385 390 395 400 cgc ctg
acg gag tcc ctg gat ttc act gac tat gcc tcc cgg atc att 1248 Arg
Leu Thr Glu Ser Leu Asp Phe Thr Asp Tyr Ala Ser Arg Ile Ile 405 410
415 cac cct att gtt cga aca ctg gac cag agc cca gaa ctg cgc tcc aca
1296 His Pro Ile Val Arg Thr Leu Asp Gln Ser Pro Glu Leu Arg Ser
Thr 420 425 430 gcc atg gac acg ctg tct tca ctt gtt ttt cag ctg ggg
aag aag tac 1344 Ala Met Asp Thr Leu Ser Ser Leu Val Phe Gln Leu
Gly Lys Lys Tyr 435 440 445 caa att ttc att cca atg gtg aat aaa gtt
ctg gtg cga cac cga atc 1392 Gln Ile Phe Ile Pro Met Val Asn Lys
Val Leu Val Arg His Arg Ile 450 455 460 aat cat cag cgc tat gat gtg
ctc atc tgc aga att gtc aag gga tac 1440 Asn His Gln Arg Tyr Asp
Val Leu Ile Cys Arg Ile Val Lys Gly Tyr 465 470 475 480 aca ctt gct
gat gaa gag gag gat cct ttg att tac cag cat cgg atg 1488 Thr Leu
Ala Asp Glu Glu Glu Asp Pro Leu Ile Tyr Gln His Arg Met 485 490 495
ctt agg agt ggc caa ggg gat gca ttg gct agt gga cca gtg gaa aca
1536 Leu Arg Ser Gly Gln Gly Asp Ala Leu Ala Ser Gly Pro Val Glu
Thr 500 505 510 gga ccc atg aag aaa ctg cac gtc agc acc atc aac ctc
caa aag gcc 1584 Gly Pro Met Lys Lys Leu His Val Ser Thr Ile Asn
Leu Gln Lys Ala 515 520 525 tgg ggc gct gcc agg agg gtc tcc aaa gat
gac tgg ctg gaa tgg ctg 1632 Trp Gly Ala Ala Arg Arg Val Ser Lys
Asp Asp Trp Leu Glu Trp Leu 530 535 540 aga cgg ctg agc ctg gag ctg
ctg aag gac tca tca tcg ccc tcc ctg 1680 Arg Arg Leu Ser Leu Glu
Leu Leu Lys Asp Ser Ser Ser Pro Ser Leu 545 550 555 560 cgc tcc tgc
tgg gcc ctg gca cag gcc tac aac ccg atg gcc agg gat 1728 Arg Ser
Cys Trp Ala Leu Ala Gln Ala Tyr Asn Pro Met Ala Arg Asp 565 570 575
ctc ttc aat gct gca ttt gtg tcc tgc tgg tct gaa ctg aat gaa gat
1776 Leu Phe Asn Ala Ala Phe Val Ser Cys Trp Ser Glu Leu Asn Glu
Asp 580 585 590 caa cag gat gag ctc atc aga agc atc gag ttg gcc ctc
acc tca caa 1824 Gln Gln Asp Glu Leu Ile Arg Ser Ile Glu Leu Ala
Leu Thr Ser Gln 595 600 605 gac atc gct gaa gtc aca cag acc ctc tta
aac ttg gct gaa ttc atg 1872 Asp Ile Ala Glu Val Thr Gln Thr Leu
Leu Asn Leu Ala Glu Phe Met 610 615 620 gaa cac agt gac aag ggc ccc
ctg cca ctg aga gat gac aat ggc att 1920 Glu His Ser Asp Lys Gly
Pro Leu Pro Leu Arg Asp Asp Asn Gly Ile 625 630 635 640 gtt ctg ctg
ggt gag aga gct gcc aag tgc cga gca tat gcc aaa gca 1968 Val Leu
Leu Gly Glu Arg Ala Ala Lys Cys Arg Ala Tyr Ala Lys Ala 645 650 655
cta cac tac aaa gaa ctg gag ttc cag aaa ggc ccc acc cct gcc att
2016 Leu His Tyr Lys Glu Leu Glu Phe Gln Lys Gly Pro Thr Pro Ala
Ile 660 665 670 cta gaa tct ctc atc agc att aat aat aag cta cag cag
ccg gag gca 2064 Leu Glu Ser Leu Ile Ser Ile Asn Asn Lys Leu Gln
Gln Pro Glu Ala 675 680 685 gcg gcc gga gtg tta gaa tat gcc atg aaa
cac ttt gga gag ctg gag 2112 Ala Ala Gly Val Leu Glu Tyr Ala Met
Lys His Phe Gly Glu Leu Glu 690 695 700 atc cag gct acc tgg tat gag
aaa ctg cac gag tgg gag gat gcc ctt 2160 Ile Gln Ala Thr Trp Tyr
Glu Lys Leu His Glu Trp Glu Asp Ala Leu 705 710 715 720 gtg gcc tat
gac aag aaa atg gac acc aac aag gac gac cca gag ctg 2208 Val Ala
Tyr Asp Lys Lys Met Asp Thr Asn Lys Asp Asp Pro Glu Leu 725 730 735
atg ctg ggc cgc atg cgc tgc ctc gag gcc ttg ggg gaa tgg ggt caa
2256 Met Leu Gly Arg Met Arg Cys Leu Glu Ala Leu Gly Glu Trp Gly
Gln 740 745 750 ctc cac cag cag tgc tgt gaa aag tgg acc ctg gtt aat
gat gag acc 2304 Leu His Gln Gln Cys Cys Glu Lys Trp Thr Leu Val
Asn Asp Glu Thr 755 760 765 caa gcc aag atg gcc cgg atg gct gct gca
gct gca tgg ggt tta ggt 2352 Gln Ala Lys Met Ala Arg Met Ala Ala
Ala Ala Ala Trp Gly Leu Gly 770 775 780 cag tgg gac agc atg gaa gaa
tac acc tgt atg atc cct cgg gac acc 2400 Gln Trp Asp Ser Met Glu
Glu Tyr Thr Cys Met Ile Pro Arg Asp Thr 785 790 795 800 cat gat ggg
gca ttt tat aga gct gtg ctg gca ctg cat cag gac ctc 2448 His Asp
Gly Ala Phe Tyr Arg Ala Val Leu Ala Leu His Gln Asp Leu 805 810 815
ttc tcc ttg gca caa cag tgc att gac aag gcc agg gac ctg ctg gat
2496 Phe Ser Leu Ala Gln Gln Cys Ile Asp Lys Ala Arg Asp Leu Leu
Asp 820 825 830 gct gaa tta act gca atg gca gga gag agt tac agt cgg
gca tat ggg 2544 Ala Glu Leu Thr Ala Met Ala Gly Glu Ser Tyr Ser
Arg Ala Tyr Gly 835 840 845 gcc atg gtt tct tgc cac atg ctg tcc gag
ctg gag gag gtt atc cag 2592 Ala Met Val Ser Cys His Met Leu Ser
Glu Leu Glu Glu Val Ile Gln 850 855 860 tac aaa ctt gtc ccc gag cga
cga gag atc atc cgc cag atc tgg tgg 2640 Tyr Lys Leu Val Pro Glu
Arg Arg Glu Ile Ile Arg Gln Ile Trp Trp 865 870 875 880 gag aga ctg
cag ggc tgc cag cgt atc gta gag gac tgg cag aaa atc 2688 Glu Arg
Leu Gln Gly Cys Gln Arg Ile Val Glu Asp Trp Gln Lys Ile 885 890 895
ctt atg gtg cgg tcc ctt gtg gtc agc cct cat gaa gac atg aga acc
2736 Leu Met Val Arg Ser Leu Val Val Ser Pro His Glu Asp Met Arg
Thr 900 905 910 tgg ctc aag tat gca agc ctg tgc ggc aag agt ggc agg
ctg gct ctt 2784 Trp Leu Lys Tyr Ala Ser Leu Cys Gly Lys Ser Gly
Arg Leu Ala Leu 915 920 925 gct cat aaa act tta gtg ttg ctc ctg gga
gtt gat ccg tct cgg caa 2832 Ala His Lys Thr Leu Val Leu Leu Leu
Gly Val Asp Pro Ser Arg Gln 930 935 940 ctt gac cat cct ctg cca aca
gtt cac cct cag gtg acc tat gcc tac 2880 Leu Asp His Pro Leu Pro
Thr Val His Pro Gln Val Thr Tyr Ala Tyr 945 950 955 960 atg aaa aac
atg tgg aag agt gcc cgc aag atc gat gcc ttc cag cac 2928 Met Lys
Asn Met Trp Lys Ser Ala Arg Lys Ile Asp Ala Phe Gln His 965 970 975
atg cag cat ttt gtc cag acc atg cag caa cag gcc cag cat gcc atc
2976 Met Gln His Phe Val Gln Thr Met Gln Gln Gln Ala Gln His Ala
Ile 980 985 990 gct act gag gac cag cag cat aag cag gaa ctg cac aag
ctc atg gcc 3024 Ala Thr Glu Asp Gln Gln His Lys Gln Glu Leu His
Lys Leu Met Ala 995 1000 1005 cga tgc ttc ctg aaa ctt gga gag tgg
cag ctg aat cta cag ggc atc 3072 Arg Cys Phe Leu Lys Leu Gly Glu
Trp Gln Leu Asn Leu Gln Gly Ile 1010 1015 1020 aat gag agc aca atc
ccc aaa gtg ctg cag tac tac agc gcc gcc aca 3120 Asn Glu Ser Thr
Ile Pro Lys Val Leu Gln Tyr Tyr Ser Ala Ala Thr 1025 1030 1035 1040
gag cac gac cgc agc tgg tac aag gcc tgg cat gcg tgg gca gtg atg
3168 Glu His Asp Arg Ser Trp Tyr Lys Ala Trp His Ala Trp Ala Val
Met 1045 1050 1055 aac ttc gaa gct gtg cta cac tac aaa cat cag aac
caa gcc cgc gat 3216 Asn Phe Glu Ala Val Leu His Tyr Lys His Gln
Asn Gln Ala Arg Asp 1060 1065 1070 gag aag aag aaa ctg cgt cat gcc
agc ggg gcc aac atc acc aac gcc 3264 Glu Lys Lys Lys Leu Arg His
Ala Ser Gly Ala Asn Ile Thr Asn Ala 1075 1080 1085 acc act gcc gcc
acc acg gcc gcc act gcc acc acc act gcc agc acc 3312 Thr Thr Ala
Ala Thr Thr Ala Ala Thr Ala Thr Thr Thr Ala Ser Thr 1090 1095 1100
gag ggc agc aac agt gag agc gag gcc gag agc acc gag aac agc ccc
3360 Glu Gly Ser Asn Ser Glu Ser Glu Ala Glu Ser Thr Glu Asn Ser
Pro 1105 1110 1115 1120 acc cca tcg ccg ctg cag aag aag gtc act gag
gat ctg tcc aaa acc 3408 Thr Pro Ser Pro Leu Gln Lys Lys Val Thr
Glu Asp Leu Ser Lys Thr 1125 1130 1135 ctc ctg atg tac acg gtg cct
gcc gtc cag ggc ttc ttc cgt tcc atc 3456 Leu Leu Met Tyr Thr Val
Pro Ala Val Gln Gly Phe Phe Arg Ser Ile 1140 1145 1150 tcc ttg tca
cga ggc aac aac ctc cag gat aca ctc aga gtt ctc acc 3504 Ser Leu
Ser Arg Gly Asn Asn Leu Gln Asp Thr Leu Arg Val Leu Thr 1155 1160
1165 tta tgg ttt gat tat ggt cac tgg cca gat gtc aat gag gcc tta
gtg 3552 Leu Trp Phe Asp Tyr Gly His Trp Pro Asp Val Asn Glu Ala
Leu Val 1170 1175 1180 gag ggg gtg aaa gcc atc cag att gat acc tgg
cta cag gtt ata cct 3600 Glu Gly Val Lys Ala Ile Gln Ile Asp Thr
Trp Leu Gln Val Ile Pro 1185 1190 1195 1200 cag ctc att gca aga att
gat acg ccc aga ccc ttg gtg gga cgt ctc 3648 Gln Leu Ile Ala Arg
Ile Asp Thr Pro Arg Pro Leu Val Gly Arg Leu 1205 1210 1215 att cac
cag ctt ctc aca gac att ggt cgg tac cac ccc cag gcc ctc 3696 Ile
His Gln Leu Leu Thr Asp Ile Gly Arg Tyr His Pro Gln Ala Leu 1220
1225 1230 atc tac cca ctg aca gtg gct tct aag tct acc acg aca gcc
cgg cac 3744 Ile Tyr Pro Leu Thr Val Ala Ser Lys Ser Thr Thr Thr
Ala Arg His 1235 1240 1245 aat gca gcc aac aag att ctg aag aac atg
tgt gag cac agc aac acc 3792 Asn Ala Ala Asn Lys Ile Leu Lys Asn
Met Cys Glu His Ser Asn Thr 1250 1255 1260 ctg gtc cag cag gcc atg
atg gtg agc gag gag ctg atc cga gtg gcc 3840 Leu Val Gln Gln Ala
Met Met Val Ser Glu Glu Leu Ile Arg Val Ala 1265 1270 1275 1280 atc
ctc tgg cat gag atg tgg cat gaa ggc ctg gaa gag gca tct cgt 3888
Ile Leu Trp His Glu Met Trp His Glu Gly Leu Glu Glu Ala Ser Arg
1285 1290 1295 ttg tac ttt ggg gaa agg aac gtg aaa ggc atg ttt gag
gtg ctg gag 3936 Leu Tyr Phe Gly Glu Arg Asn Val Lys Gly Met Phe
Glu Val Leu Glu 1300 1305 1310 ccc ttg cat gct atg atg gaa cgg ggc
ccc cag act ctg aag gaa aca 3984 Pro Leu His Ala Met Met Glu Arg
Gly Pro Gln Thr Leu Lys Glu Thr 1315 1320 1325 tcc ttt aat cag gcc
tat ggt cga gat tta atg gag gcc caa gag tgg 4032 Ser Phe Asn Gln
Ala Tyr Gly Arg Asp Leu Met Glu Ala Gln Glu Trp 1330 1335 1340 tgc
agg aag tac atg aaa tca ggg aat gtc aag gac ctc acc caa gcc 4080
Cys Arg Lys Tyr Met Lys Ser Gly Asn Val Lys Asp Leu Thr Gln Ala
1345 1350 1355 1360 tgg gac ctc tat tat cat gtg ttc cga cga atc tca
aag cag ctg cct 4128 Trp Asp Leu Tyr Tyr His Val Phe Arg Arg Ile
Ser Lys Gln Leu Pro 1365 1370 1375 cag ctc aca tcc tta gag ctg caa
tat gtt tcc cca aaa ctt ctg atg 4176 Gln Leu Thr Ser Leu Glu Leu
Gln Tyr Val Ser Pro Lys Leu Leu Met 1380 1385 1390 tgc cgg gac ctt
gaa ttg gct gtg cca gga aca tat gac ccc aac cag 4224 Cys Arg Asp
Leu Glu Leu Ala Val Pro Gly Thr Tyr Asp Pro Asn Gln 1395 1400 1405
cca atc att cgc att cag tcc ata gca ccg tct ttg caa gtc atc aca
4272 Pro Ile Ile Arg Ile Gln Ser Ile Ala Pro Ser Leu Gln Val Ile
Thr 1410 1415 1420 tcc aag cag agg ccc cgg aaa ttg aca ctt atg ggc
agc aac gga cat 4320 Ser Lys Gln Arg Pro Arg Lys Leu Thr Leu Met
Gly Ser Asn Gly His 1425 1430 1435 1440 gag ttt gtt ttc ctt cta aaa
ggc cat gaa gat ctg cgc cag gat gag 4368 Glu Phe Val Phe Leu Leu
Lys Gly His Glu Asp Leu Arg Gln Asp Glu 1445 1450 1455 cgt gtg atg
cag ctc ttc ggc ctg gtt aac acc ctt ctg gcc aat gac 4416 Arg Val
Met Gln Leu Phe Gly Leu Val Asn Thr Leu Leu Ala Asn Asp 1460 1465
1470 cca aca tct ctt cgg aaa aac ctc agc atc cag aga tac gct gtc
atc 4464 Pro Thr Ser Leu Arg Lys Asn Leu Ser Ile Gln Arg Tyr Ala
Val Ile 1475 1480 1485 cct tta tcg acc aac tcg ggc ctc att ggc tgg
gtt ccc cac tgt gac 4512 Pro Leu Ser Thr Asn Ser Gly Leu Ile Gly
Trp Val Pro His Cys Asp 1490 1495 1500 aca ctg cac gcc ctc atc cgg
gac tac agg gag aag aag aag atc ctt 4560 Thr Leu His Ala Leu Ile
Arg Asp Tyr Arg Glu Lys Lys Lys Ile Leu 1505 1510 1515 1520 ctc aac
atc gag cat cgc atc atg ttg cgg atg gct ccg gac tat gac 4608 Leu
Asn Ile Glu His Arg Ile Met Leu Arg Met Ala Pro Asp Tyr Asp 1525
1530 1535 cac ttg act ctg atg cag aag gtg gag gtg ttt gag cat gcc
gtc aat 4656 His Leu Thr Leu Met Gln Lys Val Glu Val Phe Glu His
Ala Val Asn 1540 1545 1550 aat aca gct ggg gac gac ctg gcc aag ctg
ctg tgg ctg aaa agc ccc 4704 Asn Thr Ala Gly Asp Asp Leu Ala Lys
Leu Leu Trp Leu Lys Ser Pro 1555 1560 1565 agc tcc gag gtg tgg ttt
gac cga aga acc aat tat acc cgt tct tta 4752 Ser Ser Glu Val Trp
Phe Asp Arg Arg Thr Asn Tyr Thr Arg Ser Leu 1570 1575 1580 gcg gtc
atg tca atg gtt ggg tat att tta ggc ctg gga gat aga cac 4800 Ala
Val Met Ser Met Val Gly Tyr Ile Leu Gly Leu Gly Asp Arg His 1585
1590 1595 1600 cca tcc aac ctg atg ctg gac cgt ctg agt ggg aag atc
ctg cac att 4848 Pro Ser Asn Leu Met Leu Asp Arg Leu Ser Gly Lys
Ile Leu His Ile 1605 1610 1615 gac ttt ggg gac tgc ttt gag gtt gct
atg acc cga gag aag ttt cca 4896 Asp Phe Gly Asp Cys Phe Glu Val
Ala Met Thr Arg Glu Lys Phe Pro 1620 1625 1630 gag aag att cca ttt
aga cta aca aga atg ttg acc aat gct atg gag 4944 Glu Lys Ile Pro
Phe Arg Leu Thr Arg Met Leu Thr Asn Ala Met Glu 1635 1640 1645 gtt
aca ggc ctg gat ggc aac tac aga atc aca tgc cac aca gtg atg 4992
Val Thr Gly Leu Asp Gly Asn Tyr Arg Ile Thr Cys His Thr Val Met
1650 1655 1660 gag gtg ctg cga gag cac aag gac agt gtc atg gcc gtg
ctg gaa gcc 5040 Glu Val Leu Arg Glu His Lys Asp Ser Val Met Ala
Val Leu Glu Ala 1665 1670 1675 1680 ttt gtc tat gac ccc ttg ctg aac
tgg agg ctg atg gac aca aat acc 5088 Phe Val Tyr Asp Pro Leu Leu
Asn Trp Arg Leu Met Asp Thr Asn Thr 1685 1690 1695 aaa ggc aac aag
cga tcc cga acg agg acg gat tcc tac tct gct ggc 5136 Lys Gly Asn
Lys Arg Ser Arg Thr Arg Thr Asp Ser Tyr Ser Ala Gly 1700 1705 1710
cag tca gtc gaa att ttg gac ggt gtg gaa ctt gga gag cca gcc cat
5184 Gln Ser Val Glu Ile Leu Asp Gly Val Glu Leu Gly Glu Pro Ala
His 1715 1720 1725 aag aaa acg ggg acc aca gtg cca gaa tct att cat
tct ttc att gga 5232 Lys Lys Thr Gly Thr Thr Val Pro Glu Ser Ile
His Ser Phe Ile Gly 1730 1735 1740 gac ggt ttg gtg aaa cca gag gcc
cta aat aag aaa gct atc cag att 5280 Asp Gly Leu Val Lys Pro Glu
Ala Leu Asn Lys Lys Ala Ile Gln Ile 1745 1750 1755 1760 att aac agg
gtt cga gat aag ctc act ggt cgg gac ttc tct cat gat 5328 Ile Asn
Arg Val Arg Asp Lys Leu Thr Gly Arg Asp Phe Ser His Asp 1765 1770
1775 gac act ttg gat gtt cca acg caa gtt gag ctg ctc atc aaa caa
gcg 5376 Asp Thr Leu Asp Val Pro Thr Gln Val Glu Leu Leu Ile Lys
Gln Ala 1780 1785 1790 aca tcc cat gaa aac ctc tgc cag tgc tat att
ggc tgg tgc cct ttc 5424 Thr Ser His Glu Asn Leu Cys Gln Cys Tyr
Ile Gly Trp Cys Pro Phe 1795 1800 1805 tgg taa 5430 Trp <210>
SEQ ID NO 12 <211> LENGTH: 1809 <212> TYPE: PRT
<213> ORGANISM: Homo sapiens <400> SEQUENCE: 12 Leu Glu
His Ser Gly Ile Gly Arg Ile Lys Glu Gln Ser Ala Arg Met 1 5 10 15
Leu Gly His Leu Val Ser Asn Ala Pro Arg Leu Ile Arg Pro Tyr Met 20
25 30 Glu Pro Ile Leu Lys Ala Leu Ile Leu Lys Leu Lys Asp Pro Asp
Pro 35 40 45 Asp Pro Asn Pro Gly Val Ile Asn Asn Val Leu Ala Thr
Ile Gly Glu 50 55 60 Leu Ala Gln Val Ser Gly Leu Glu Met Arg Lys
Trp Val Asp Glu Leu 65 70 75 80 Phe Ile Ile Ile Met Asp Met Leu Gln
Asp Ser Ser Leu Leu Ala Lys 85 90 95 Arg Gln Val Ala Leu Trp Thr
Leu Gly Gln Leu Val Ala Ser Thr Gly 100 105 110 Tyr Val Val Glu Pro
Tyr Arg Lys Tyr Pro Thr Leu Leu Glu Val Leu 115 120 125 Leu Asn Phe
Leu Lys Thr Glu Gln Asn Gln Gly Thr Arg Arg Glu Ala 130 135 140 Ile
Arg Val Leu Gly Leu Leu Gly Ala Leu Asp Pro Tyr Lys His Lys 145 150
155 160 Val Asn Ile Gly Met Ile Asp Gln Ser Arg Asp Ala Ser Ala Val
Ser 165 170 175 Leu Ser Glu Ser Lys Ser Ser Gln Asp Ser Ser Asp Tyr
Ser Thr Ser 180 185 190 Glu Met Leu Val Asn Met Gly Asn Leu Pro Leu
Asp Glu Phe Tyr Pro 195 200 205 Ala Val Ser Met Val Ala Leu Met Arg
Ile Phe Arg Asp Gln Ser Leu 210 215 220 Ser His His His Thr Met Val
Val Gln Ala Ile Thr Phe Ile Phe Lys 225 230 235 240 Ser Leu Gly Leu
Lys Cys Val Gln Phe Leu Pro Gln Val Met Pro Thr 245 250 255 Phe Leu
Asn Val Ile Arg Val Cys Asp Gly Ala Ile Arg Glu Phe Leu 260 265 270
Phe Gln Gln Leu Gly Met Leu Val Ser Phe Val Lys Ser His Ile Arg 275
280 285 Pro Tyr Met Asp Glu Ile Val Thr Leu Met Arg Glu Phe Trp Val
Met 290 295 300 Asn Thr Ser Ile Gln Ser Thr Ile Ile Leu Leu Ile Glu
Gln Ile Val 305 310 315 320 Val Ala Leu Gly Gly Glu Phe Lys Leu Tyr
Leu Pro Gln Leu Ile Pro 325 330 335 His Met Leu Arg Val Phe Met His
Asp Asn Ser Pro Gly Arg Ile Val 340 345 350 Ser Ile Lys Leu Leu Ala
Ala Ile Gln Leu Phe Gly Ala Asn Leu Asp 355 360 365 Asp Tyr Leu His
Leu Leu Leu Pro Pro Ile Val Lys Leu Phe Asp Ala 370 375 380 Pro Glu
Ala Pro Leu Pro Ser Arg Lys Ala Ala Leu Glu Thr Val Asp 385 390 395
400 Arg Leu Thr Glu Ser Leu Asp Phe Thr Asp Tyr Ala Ser Arg Ile Ile
405 410 415 His Pro Ile Val Arg Thr Leu Asp Gln Ser Pro Glu Leu Arg
Ser Thr 420 425 430 Ala Met Asp Thr Leu Ser Ser Leu Val Phe Gln Leu
Gly Lys Lys Tyr 435 440 445 Gln Ile Phe Ile Pro Met Val Asn Lys Val
Leu Val Arg His Arg Ile 450 455 460 Asn His Gln Arg Tyr Asp Val Leu
Ile Cys Arg Ile Val Lys Gly Tyr 465 470 475 480 Thr Leu Ala Asp Glu
Glu Glu Asp Pro Leu Ile Tyr Gln His Arg Met 485 490 495 Leu Arg Ser
Gly Gln Gly Asp Ala Leu Ala Ser Gly Pro Val Glu Thr 500 505 510 Gly
Pro Met Lys Lys Leu His Val Ser Thr Ile Asn Leu Gln Lys Ala 515 520
525 Trp Gly Ala Ala Arg Arg Val Ser Lys Asp Asp Trp Leu Glu Trp Leu
530 535 540 Arg Arg Leu Ser Leu Glu Leu Leu Lys Asp Ser Ser Ser Pro
Ser Leu 545 550 555 560 Arg Ser Cys Trp Ala Leu Ala Gln Ala Tyr Asn
Pro Met Ala Arg Asp 565 570 575 Leu Phe Asn Ala Ala Phe Val Ser Cys
Trp Ser Glu Leu Asn Glu Asp 580 585 590 Gln Gln Asp Glu Leu Ile Arg
Ser Ile Glu Leu Ala Leu Thr Ser Gln 595 600 605 Asp Ile Ala Glu Val
Thr Gln Thr Leu Leu Asn Leu Ala Glu Phe Met 610 615 620 Glu His Ser
Asp Lys Gly Pro Leu Pro Leu Arg Asp Asp Asn Gly Ile 625 630 635 640
Val Leu Leu Gly Glu Arg Ala Ala Lys Cys Arg Ala Tyr Ala Lys Ala 645
650 655 Leu His Tyr Lys Glu Leu Glu Phe Gln Lys Gly Pro Thr Pro Ala
Ile 660 665 670 Leu Glu Ser Leu Ile Ser Ile Asn Asn Lys Leu Gln Gln
Pro Glu Ala 675 680 685 Ala Ala Gly Val Leu Glu Tyr Ala Met Lys His
Phe Gly Glu Leu Glu 690 695 700 Ile Gln Ala Thr Trp Tyr Glu Lys Leu
His Glu Trp Glu Asp Ala Leu 705 710 715 720 Val Ala Tyr Asp Lys Lys
Met Asp Thr Asn Lys Asp Asp Pro Glu Leu 725 730 735 Met Leu Gly Arg
Met Arg Cys Leu Glu Ala Leu Gly Glu Trp Gly Gln 740 745 750 Leu His
Gln Gln Cys Cys Glu Lys Trp Thr Leu Val Asn Asp Glu Thr 755 760 765
Gln Ala Lys Met Ala Arg Met Ala Ala Ala Ala Ala Trp Gly Leu Gly 770
775 780 Gln Trp Asp Ser Met Glu Glu Tyr Thr Cys Met Ile Pro Arg Asp
Thr 785 790 795 800 His Asp Gly Ala Phe Tyr Arg Ala Val Leu Ala Leu
His Gln Asp Leu 805 810 815 Phe Ser Leu Ala Gln Gln Cys Ile Asp Lys
Ala Arg Asp Leu Leu Asp 820 825 830 Ala Glu Leu Thr Ala Met Ala Gly
Glu Ser Tyr Ser Arg Ala Tyr Gly 835 840 845 Ala Met Val Ser Cys His
Met Leu Ser Glu Leu Glu Glu Val Ile Gln 850 855 860 Tyr Lys Leu Val
Pro Glu Arg Arg Glu Ile Ile Arg Gln Ile Trp Trp 865 870 875 880 Glu
Arg Leu Gln Gly Cys Gln Arg Ile Val Glu Asp Trp Gln Lys Ile 885 890
895 Leu Met Val Arg Ser Leu Val Val Ser Pro His Glu Asp Met Arg Thr
900 905 910 Trp Leu Lys Tyr Ala Ser Leu Cys Gly Lys Ser Gly Arg Leu
Ala Leu 915 920 925 Ala His Lys Thr Leu Val Leu Leu Leu Gly Val Asp
Pro Ser Arg Gln 930 935 940 Leu Asp His Pro Leu Pro Thr Val His Pro
Gln Val Thr Tyr Ala Tyr 945 950 955 960 Met Lys Asn Met Trp Lys Ser
Ala Arg Lys Ile Asp Ala Phe Gln His 965 970 975 Met Gln His Phe Val
Gln Thr Met Gln Gln Gln Ala Gln His Ala Ile 980 985 990 Ala Thr Glu
Asp Gln Gln His Lys Gln Glu Leu His Lys Leu Met Ala 995 1000 1005
Arg Cys Phe Leu Lys Leu Gly Glu Trp Gln Leu Asn Leu Gln Gly Ile
1010 1015 1020 Asn Glu Ser Thr Ile Pro Lys Val Leu Gln Tyr Tyr Ser
Ala Ala Thr 1025 1030 1035 1040 Glu His Asp Arg Ser Trp Tyr Lys Ala
Trp His Ala Trp Ala Val Met 1045 1050 1055 Asn Phe Glu Ala Val Leu
His Tyr Lys His Gln Asn Gln Ala Arg Asp 1060 1065 1070 Glu Lys Lys
Lys Leu Arg His Ala Ser Gly Ala Asn Ile Thr Asn Ala 1075 1080 1085
Thr Thr Ala Ala Thr Thr Ala Ala Thr Ala Thr Thr Thr Ala Ser Thr
1090 1095 1100 Glu Gly Ser Asn Ser Glu Ser Glu Ala Glu Ser Thr Glu
Asn Ser Pro 1105 1110 1115 1120 Thr Pro Ser Pro Leu Gln Lys Lys Val
Thr Glu Asp Leu Ser Lys Thr 1125 1130 1135 Leu Leu Met Tyr Thr Val
Pro Ala Val Gln Gly Phe Phe Arg Ser Ile 1140 1145 1150 Ser Leu Ser
Arg Gly Asn Asn Leu Gln Asp Thr Leu Arg Val Leu Thr 1155 1160 1165
Leu Trp Phe Asp Tyr Gly His Trp Pro Asp Val Asn Glu Ala Leu Val
1170 1175 1180 Glu Gly Val Lys Ala Ile Gln Ile Asp Thr Trp Leu Gln
Val Ile Pro 1185 1190 1195 1200 Gln Leu Ile Ala Arg Ile Asp Thr Pro
Arg Pro Leu Val Gly Arg Leu 1205 1210 1215 Ile His Gln Leu Leu Thr
Asp Ile Gly Arg Tyr His Pro Gln Ala Leu 1220 1225 1230 Ile Tyr Pro
Leu Thr Val Ala Ser Lys Ser Thr Thr Thr Ala Arg His 1235 1240 1245
Asn Ala Ala Asn Lys Ile Leu Lys Asn Met Cys Glu His Ser Asn Thr
1250 1255 1260 Leu Val Gln Gln Ala Met Met Val Ser Glu Glu Leu Ile
Arg Val Ala 1265 1270 1275 1280 Ile Leu Trp His Glu Met Trp His Glu
Gly Leu Glu Glu Ala Ser Arg 1285 1290 1295 Leu Tyr Phe Gly Glu Arg
Asn Val Lys Gly Met Phe Glu Val Leu Glu 1300 1305 1310 Pro Leu His
Ala Met Met Glu Arg Gly Pro Gln Thr Leu Lys Glu Thr 1315 1320 1325
Ser Phe Asn Gln Ala Tyr Gly Arg Asp Leu Met Glu Ala Gln Glu Trp
1330 1335 1340 Cys Arg Lys Tyr Met Lys Ser Gly Asn Val Lys Asp Leu
Thr Gln Ala 1345 1350 1355 1360 Trp Asp Leu Tyr Tyr His Val Phe Arg
Arg Ile Ser Lys Gln Leu Pro 1365 1370 1375 Gln Leu Thr Ser Leu Glu
Leu Gln Tyr Val Ser Pro Lys Leu Leu Met 1380 1385 1390 Cys Arg Asp
Leu Glu Leu Ala Val Pro Gly Thr Tyr Asp Pro Asn Gln 1395 1400 1405
Pro Ile Ile Arg Ile Gln Ser Ile Ala Pro Ser Leu Gln Val Ile Thr
1410 1415 1420 Ser Lys Gln Arg Pro Arg Lys Leu Thr Leu Met Gly Ser
Asn Gly His 1425 1430 1435 1440 Glu Phe Val Phe Leu Leu Lys Gly His
Glu Asp Leu Arg Gln Asp Glu 1445 1450 1455 Arg Val Met Gln Leu Phe
Gly Leu Val Asn Thr Leu Leu Ala Asn Asp 1460 1465 1470 Pro Thr Ser
Leu Arg Lys Asn Leu Ser Ile Gln Arg Tyr Ala Val Ile 1475 1480 1485
Pro Leu Ser Thr Asn Ser Gly Leu Ile Gly Trp Val Pro His Cys Asp
1490 1495 1500 Thr Leu His Ala Leu Ile Arg Asp Tyr Arg Glu Lys Lys
Lys Ile Leu 1505 1510 1515 1520 Leu Asn Ile Glu His Arg Ile Met Leu
Arg Met Ala Pro Asp Tyr Asp 1525 1530 1535 His Leu Thr Leu Met Gln
Lys Val Glu Val Phe Glu His Ala Val Asn 1540 1545 1550 Asn Thr Ala
Gly Asp Asp Leu Ala Lys Leu Leu Trp Leu Lys Ser Pro 1555 1560 1565
Ser Ser Glu Val Trp Phe Asp Arg Arg Thr Asn Tyr Thr Arg Ser Leu
1570 1575 1580 Ala Val Met Ser Met Val Gly Tyr Ile Leu Gly Leu Gly
Asp Arg His 1585 1590 1595 1600 Pro Ser Asn Leu Met Leu Asp Arg Leu
Ser Gly Lys Ile Leu His Ile 1605 1610 1615 Asp Phe Gly Asp Cys Phe
Glu Val Ala Met Thr Arg Glu Lys Phe Pro 1620 1625 1630 Glu Lys Ile
Pro Phe Arg Leu Thr Arg Met Leu Thr Asn Ala Met Glu 1635 1640 1645
Val Thr Gly Leu Asp Gly Asn Tyr Arg Ile Thr Cys His Thr Val Met
1650 1655 1660 Glu Val Leu Arg Glu His Lys Asp Ser Val Met Ala Val
Leu Glu Ala 1665 1670 1675 1680 Phe Val Tyr Asp Pro Leu Leu Asn Trp
Arg Leu Met Asp Thr Asn Thr 1685 1690 1695 Lys Gly Asn Lys Arg Ser
Arg Thr Arg Thr Asp Ser Tyr Ser Ala Gly 1700 1705 1710 Gln Ser Val
Glu Ile Leu Asp Gly Val Glu Leu Gly Glu Pro Ala His 1715 1720 1725
Lys Lys Thr Gly Thr Thr Val Pro Glu Ser Ile His Ser Phe Ile Gly
1730 1735 1740 Asp Gly Leu Val Lys Pro Glu Ala Leu Asn Lys Lys Ala
Ile Gln Ile 1745 1750 1755 1760 Ile Asn Arg Val Arg Asp Lys Leu Thr
Gly Arg Asp Phe Ser His Asp 1765 1770 1775 Asp Thr Leu Asp Val Pro
Thr Gln Val Glu Leu Leu Ile Lys Gln Ala 1780 1785 1790 Thr Ser His
Glu Asn Leu Cys Gln Cys Tyr Ile Gly Trp Cys Pro Phe 1795 1800 1805
Trp <210> SEQ ID NO 13 <211> LENGTH: 1794 <212>
TYPE: DNA <213> ORGANISM: C. albicans <400> SEQUENCE:
13 ttggtttacc ctttgacagt tgctattact tccgaatcaa cgagccgtaa
aaaggcagct 60 caatccatta ttgaaaaaat gcgagtacat tctcctagct
tggtggatca agcagaatta 120 gtgagtcgag aactcatccg agttgcagtt
ttatggcacg aacaatggca cgatgctttg 180 gaagatgcta gcaggttttt
ctttggtgaa cacaacacag aaaagatgtt tgaaacattg 240 gaaccattac
atcaaatgtt gcaaaaggga ccagaaacga tgagggaaca agcctttgca 300
aatgcttttg gcagggagtt gacagatgca tacgagtggg tgctcaactt tagaagaact
360 aaagacataa ccaatttgaa tcaagcatgg gatatatact acaatgtctt
tagaagagta 420 agcaaacagg tgcagctgtt agctagtctt gagttgcagt
atgtatctcc ggacttagag 480 catgctcaag atttggaatt ggctgtacca
ggtacttacc aagcaggcaa acctgtgatc 540 agaataatca aatttgatcc
tactttttcg attatttcat ctaaacaaag accgagaaaa 600 ttatcgtgca
gaggaagtga tggtaaagac taccaatatg cgttgaaagg acatgaagat 660
atcagacaag ataacttagt gatgcaattg tttggtttgg ttaatacgtt gttggtaaat
720 gatccggtat gtttcaagag acatttggat atacaacaat atcctgctat
tccattatca 780 ccaaaagtgg gattgcttgg ttgggttcca aatagtgaca
ctttccatgt attgatcaaa 840 ggctatcgcg aatcaagaag tataatgttg
aatattgaac acaggctttt gttgcaaatg 900 gcacctgatt atgatttctt
gacattattg caaaaagttg aagtgttcac aagtgcaatg 960 gataattgta
agggacagga tttgtacaaa gtgttatggc tcaaatctaa atcatccgag 1020
gcgtggttgg accgtagaac aacatacacg agatcattag ctgtaatgtc tatggttggg
1080 tatatattag gtttggggga taggcaccca tcaaatttga tgttggaccg
tattactggg 1140 aaagtcatcc atattgattt cggagactgt tttgaagcag
caatattacg tgagaagtat 1200 ccagagagag ttccgtttag attgacgaga
atgcttaatt atgccatgga agttagtgga 1260 atagagggct cgttcagaat
cacatgtgaa catgttatga gggtgttgcg tgataataaa 1320 gagtctttaa
tggcaatatt agaggccttt gcttacgatc ccttgataaa ttgggggttt 1380
gatttcccaa caaaggcgtt ggctgaatca acgggtatac gtgttccaca agtcaacact
1440 gcagaattat tacgcagagg acagattgac gaaaaagaag ctgtaagatt
gcaaaagcaa 1500 aatgaattgg aaataagaaa cgctagagct gcattagtgt
tgaaacgtat taccgataag 1560 ttaactggta acgatatcaa acggttgaga
ggattagatg tgcctactca agtcgataaa 1620 ttgattcaac aagccaccag
tgttgagaat ttgtgtcagc attacattgg ttggtgttcg 1680 tgttggtagg
ttgattatcg tcatgtgtcg ataagtatgg tattgtggta actattttat 1740
aaagggaaat attaaagaat tgtatattat taaaaaaaaa aaaaaaaact cgag 1794
<210> SEQ ID NO 14 <211> LENGTH: 562 <212> TYPE:
PRT <213> ORGANISM: C. albicans <400> SEQUENCE: 14 Leu
Val Tyr Pro Leu Thr Val Ala Ile Thr Ser Glu Ser Thr Ser Arg 1 5 10
15 Lys Lys Ala Ala Gln Ser Ile Ile Glu Lys Met Arg Val His Ser Pro
20 25 30 Ser Leu Val Asp Gln Ala Glu Leu Val Ser Arg Glu Leu Ile
Arg Val 35 40 45 Ala Val Leu Trp His Glu Gln Trp His Asp Ala Leu
Glu Asp Ala Ser 50 55 60 Arg Phe Phe Phe Gly Glu His Asn Thr Glu
Lys Met Phe Glu Thr Leu 65 70 75 80 Glu Pro Leu His Gln Met Leu Gln
Lys Gly Pro Glu Thr Met Arg Glu 85 90 95 Gln Ala Phe Ala Asn Ala
Phe Gly Arg Glu Leu Thr Asp Ala Tyr Glu 100 105 110 Trp Val Leu Asn
Phe Arg Arg Thr Lys Asp Ile Thr Asn Leu Asn Gln 115 120 125 Ala Trp
Asp Ile Tyr Tyr Asn Val Phe Arg Arg Val Ser Lys Gln Val 130 135 140
Gln Leu Leu Ala Ser Leu Glu Leu Gln Tyr Val Ser Pro Asp Leu Glu 145
150 155 160 His Ala Gln Asp Leu Glu Leu Ala Val Pro Gly Thr Tyr Gln
Ala Gly 165 170 175 Lys Pro Val Ile Arg Ile Ile Lys Phe Asp Pro Thr
Phe Ser Ile Ile 180 185 190 Ser Ser Lys Gln Arg Pro Arg Lys Leu Ser
Cys Arg Gly Ser Asp Gly 195 200 205 Lys Asp Tyr Gln Tyr Ala Leu Lys
Gly His Glu Asp Ile Arg Gln Asp 210 215 220 Asn Leu Val Met Gln Leu
Phe Gly Leu Val Asn Thr Leu Leu Val Asn 225 230 235 240 Asp Pro Val
Cys Phe Lys Arg His Leu Asp Ile Gln Gln Tyr Pro Ala 245 250 255 Ile
Pro Leu Ser Pro Lys Val Gly Leu Leu Gly Trp Val Pro Asn Ser 260 265
270 Asp Thr Phe His Val Leu Ile Lys Gly Tyr Arg Glu Ser Arg Ser Ile
275 280 285 Met Leu Asn Ile Glu His Arg Leu Leu Leu Gln Met Ala Pro
Asp Tyr 290 295 300 Asp Phe Leu Thr Leu Leu Gln Lys Val Glu Val Phe
Thr Ser Ala Met 305 310 315 320 Asp Asn Cys Lys Gly Gln Asp Leu Tyr
Lys Val Leu Trp Leu Lys Ser 325 330 335 Lys Ser Ser Glu Ala Trp Leu
Asp Arg Arg Thr Thr Tyr Thr Arg Ser 340 345 350 Leu Ala Val Met Ser
Met Val Gly Tyr Ile Leu Gly Leu Gly Asp Arg 355 360 365 His Pro Ser
Asn Leu Met Leu Asp Arg Ile Thr Gly Lys Val Ile His 370 375 380 Ile
Asp Phe Gly Asp Cys Phe Glu Ala Ala Ile Leu Arg Glu Lys Tyr 385 390
395 400 Pro Glu Arg Val Pro Phe Arg Leu Thr Arg Met Leu Asn Tyr Ala
Met 405 410 415 Glu Val Ser Gly Ile Glu Gly Ser Phe Arg Ile Thr Cys
Glu His Val 420 425 430 Met Arg Val Leu Arg Asp Asn Lys Glu Ser Leu
Met Ala Ile Leu Glu 435 440 445 Ala Phe Ala Tyr Asp Pro Leu Ile Asn
Trp Gly Phe Asp Phe Pro Thr 450 455 460 Lys Ala Leu Ala Glu Ser Thr
Gly Ile Arg Val Pro Gln Val Asn Thr 465 470 475 480 Ala Glu Leu Leu
Arg Arg Gly Gln Ile Asp Glu Lys Glu Ala Val Arg 485 490 495 Leu Gln
Lys Gln Asn Glu Leu Glu Ile Arg Asn Ala Arg Ala Ala Leu 500 505 510
Val Leu Lys Arg Ile Thr Asp Lys Leu Thr Gly Asn Asp Ile Lys Arg 515
520 525 Leu Arg Gly Leu Asp Val Pro Thr Gln Val Asp Lys Leu Ile Gln
Gln 530 535 540 Ala Thr Ser Val Glu Asn Leu Cys Gln His Tyr Ile Gly
Trp Cys Ser 545 550 555 560 Cys Trp <210> SEQ ID NO 15
<211> LENGTH: 399 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 15 gttagtcacg agttgatcag
agtagccgtt ctatggcacg aattatggta tgaaggactg 60 gaagatgcga
gccgccaatt tttcgttgaa cataacatag aaaaaatgtt ttctacttta 120
gaacctttac ataaacactt aggcaatgag cctcaaacgt taagtgaggt atcgtttcag
180 aaatcatttg gtagagattt gaacgatgcc tacgaatggt tgaataacta
caaaaagtca 240 aaagacatca ataatttgaa ccaagcttgg gatatttatt
ataacgtctt cagaaaaata 300 acacgtcaaa taccacagtt acaaacctta
gacttacagc atgtttctcc ccagcttctg 360 gctactcatg atctcgaatt
ggctgttcct gggacatat 399 <210> SEQ ID NO 16 <211>
LENGTH: 133 <212> TYPE: PRT <213> ORGANISM: Homo
sapiens <400> SEQUENCE: 16 Val Ser His Glu Leu Ile Arg Val
Ala Val Leu Trp His Glu Leu Trp 1 5 10 15 Tyr Glu Gly Leu Glu Asp
Ala Ser Arg Gln Phe Phe Val Glu His Asn 20 25 30 Ile Glu Lys Met
Phe Ser Thr Leu Glu Pro Leu His Lys His Leu Gly 35 40 45 Asn Glu
Pro Gln Thr Leu Ser Glu Val Ser Phe Gln Lys Ser Phe Gly 50 55 60
Arg Asp Leu Asn Asp Ala Tyr Glu Trp Leu Asn Asn Tyr Lys Lys Ser 65
70 75 80 Lys Asp Ile Asn Asn Leu Asn Gln Ala Trp Asp Ile Tyr Tyr
Asn Val 85 90 95 Phe Arg Lys Ile Thr Arg Gln Ile Pro Gln Leu Gln
Thr Leu Asp Leu 100 105 110 Gln His Val Ser Pro Gln Leu Leu Ala Thr
His Asp Leu Glu Leu Ala 115 120 125 Val Pro Gly Thr Tyr 130
<210> SEQ ID NO 17 <211> LENGTH: 399 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 17
gtcagccacg aattgatacg tatggcggtg ctttggcatg agcaatggta tgagggtctg
60 gatgacgcca gtaggcagtt ttttggagaa cataataccg aaaaaatgtt
tgctgcttta 120 gagcctctgt acgaaatgct gaagagagga ccggaaactt
tgagggaaat atcgttccaa 180 aattcttttg gtagggactt gaatgacgct
tacgaatggc tgatgaatta caaaaaatct 240 aaagatgtta gtaatttaaa
ccaagcgtgg gacatttact ataatgtttt caggaaaatt 300 ggtaaacagt
tgccacaatt acaaactctt gaactacaac atgtgtcgcc aaaactacta 360
tctgcgcatg atttggaatt ggctgtcccc gggacccgt 399 <210> SEQ ID
NO 18 <211> LENGTH: 133 <212> TYPE: PRT <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 18 Val Ser His Glu Leu
Ile Arg Met Ala Val Leu Trp His Glu Gln Trp 1 5 10 15 Tyr Glu Gly
Leu Asp Asp Ala Ser Arg Gln Phe Phe Gly Glu His Asn 20 25 30 Thr
Glu Lys Met Phe Ala Ala Leu Glu Pro Leu Tyr Glu Met Leu Lys 35 40
45 Arg Gly Pro Glu Thr Leu Arg Glu Ile Ser Phe Gln Asn Ser Phe Gly
50 55 60 Arg Asp Leu Asn Asp Ala Tyr Glu Trp Leu Met Asn Tyr Lys
Lys Ser 65 70 75 80 Lys Asp Val Ser Asn Leu Asn Gln Ala Trp Asp Ile
Tyr Tyr Asn Val 85 90 95 Phe Arg Lys Ile Gly Lys Gln Leu Pro Gln
Leu Gln Thr Leu Glu Leu 100 105 110 Gln His Val Ser Pro Lys Leu Leu
Ser Ala His Asp Leu Glu Leu Ala 115 120 125 Val Pro Gly Thr Arg 130
<210> SEQ ID NO 19 <211> LENGTH: 531 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: 59, 64,
72, 74, 89, 94, 101, 137, 158, 175, 190, 201, 207, 210, 213, 218,
234, 243, 257, 283, 286, 289, 292, 314, 325, 328, 335, 352, 361,
380, 384, 390, 393, 403, 411, 413, 427, 432, 435, 440, 443, 450,
452, 460, 465, 480, 482, 486 <223> OTHER INFORMATION: n =
A,T,C or G <221> NAME/KEY: misc_feature <222> LOCATION:
492, 515 <223> OTHER INFORMATION: n = A,T,C or G <400>
SEQUENCE: 19 tgaccctcac cccttccacc tatcccaaaa acctcactgg gtctgtggac
aaacaacana 60 aatnttttcc ananaggccc caaatgagnc ccangggtct
ntcttccatc agacccagtg 120 attctgcgac tcacacnctt caattcaaga
cctgaccnct agtagggagg tttantcaga 180 tcgctggcan cctcggctga
ncagatncan agnggggntc gctgttcagt gggnccaccc 240 tcnctggcct
tcttcancag gggtctggga tgttttcagt ggnccnaana cnctgtttag 300
agccagggct cagnaaacag aaaanctntc atggnggttc tggacacagg gnaggtctgg
360 nacatattgg ggattatgan cagnaccaan acnccactaa atnccccaag
nanaaagtgt 420 aaccatntct anacnccatn ttntatcagn anaaattttn
ttccnataaa tgacatcagn 480 antttnaaca tnaaaaaaaa aaaaaaaaaa
aaaanaaaaa aaaaaaaaaa a 531 <210> SEQ ID NO 20 <211>
LENGTH: 231 <212> TYPE: DNA <213> ORGANISM: Homo
sapiens <400> SEQUENCE: 20 gcgtataacg cgtttggaat cactacaggg
atgtttaata ccactacaat ggatgatgta 60 tataactatc tattcgatga
tgaagatacc ccaccaaacc caaaaaaaga gatctggaat 120 tcggatcctc
gagagatcta tgaatcgtag atactgaaaa accccgcaag ttcacttcaa 180
ctgtgcatcg tgcaccatct caatttcttt catttataca tcgttttgcc t 231
<210> SEQ ID NO 21 <211> LENGTH: 21 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide <400>
SEQUENCE: 21 tgaagatacc ccaccaaacc c 21 <210> SEQ ID NO 22
<211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: oligonucleotide <400> SEQUENCE: 22 tgcacagttg
aagtgaac 18 <210> SEQ ID NO 23 <211> LENGTH: 662
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: 27, 373, 443, 461, 483, 485, 507, 583, 588, 593, 605,
606, 607, 612, 624, 625, 626, 627, 628, 630, 631, 632, 635, 639,
646, 652, 659, 661 <223> OTHER INFORMATION: n = A,T,C or G
<400> SEQUENCE: 23 accaaaccca aaaaaagaga tcctagnaac
tagtggatcc cccgggctgc aggaattcgg 60 tacgagtcgc cctcagcaga
ctcgcccagg agaggaaagc atggaggaaa gaccacccat 120 ttggtttcgt
ggctgtccca acaaaaaatc ccgatggcac gatgaacctc atgaactggg 180
agtgcgccat tccaggaaag aaagggactc cgtgggaagg aggcttgttt aaactacgga
240 tgcttttcaa agatgattat ccatcttcgc caccaaaatg taaattcgaa
ccaccattat 300 ttcacccgaa tgtgtaccct tcggggacag tgtgcctgtc
catcttagag gaggacaagg 360 actggagggc agncatcaca atcaaacagg
atcctattag gaatacagga actttctaaa 420 tgaaccaaat atccaagacc
agntcaagca gagggctaca ngatttactg ccaaaacaga 480 gtngngtacg
agaaagggtc cgagcanagc cagaagtttg ggcctcatta gcagggacct 540
ggtggatcgt caaaggaggt ttggttggga agacttgttc aanatttngg aanttaagtt
600 gtccnnnaac tngcgggggg gggnnnnncn nnttnccant tccctncccc
cngtttttng 660 nt 662 <210> SEQ ID NO 24 <211> LENGTH:
119 <212> TYPE: PRT <213> ORGANISM: Homo sapiens
<220> FEATURE: <221> NAME/KEY: VARIANT <222>
LOCATION: 105 <223> OTHER INFORMATION: Xaa = Any Amino Acid
<400> SEQUENCE: 24 Val Arg Val Ala Leu Ser Arg Leu Ala Gln
Glu Arg Lys Ala Trp Arg 1 5 10 15 Lys Asp His Pro Phe Gly Phe Val
Ala Val Pro Thr Lys Asn Pro Asp 20 25 30 Gly Thr Met Asn Leu Met
Asn Trp Glu Cys Ala Ile Pro Gly Lys Lys 35 40 45 Gly Thr Pro Trp
Glu Gly Gly Leu Phe Lys Leu Arg Met Leu Phe Lys 50 55 60 Asp Asp
Tyr Pro Ser Ser Pro Pro Lys Cys Lys Phe Glu Pro Pro Leu 65 70 75 80
Phe His Pro Asn Val Tyr Pro Ser Gly Thr Val Cys Leu Ser Ile Leu 85
90 95 Glu Glu Asp Lys Asp Trp Arg Ala Xaa Ile Thr Ile Lys Gln Asp
Pro 100 105 110 Ile Arg Asn Thr Gly Thr Phe 115 <210> SEQ ID
NO 25 <211> LENGTH: 207 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: 112, 148, 158, 171, 178, 182,
191, 194, 203, 204 <223> OTHER INFORMATION: n = A,T,C or G
<400> SEQUENCE: 25 ccctccctcc tgccgctcct ctctagaacc
ttctagaacc tgggctgtgc tgcttttgag 60 cctcagaccc cagggcagca
tctcggttct gcgccacttc ctttgtgttt anatggcgtt 120 ttgtctgtgt
tgctgtttag agtagatnaa ctgtttanat aaaaaaaaaa naaaattnac 180
tngagggggc ntgnaggcat gcnnaac 207 <210> SEQ ID NO 26
<211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: oligonucleotide <400> SEQUENCE: 26 gaagaggcaa
gacgcttgta c 21 <210> SEQ ID NO 27 <211> LENGTH: 21
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 27 gtacaagcgt cttgcctctt c 21 <210> SEQ
ID NO 28 <211> LENGTH: 19 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide <400> SEQUENCE: 28
gagtttgagc agatgttta 19 <210> SEQ ID NO 29 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
oligonucleotide <221> NAME/KEY: misc_feature <222>
LOCATION: 3, 9, 15 <223> OTHER INFORMATION: n = A,T,C or G
<400> SEQUENCE: 29 ggnaargcnc ayccncargc 20 <210> SEQ
ID NO 30 <211> LENGTH: 23 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide <221> NAME/KEY:
misc_feature <222> LOCATION: 3, 6, 21 <223> OTHER
INFORMATION: n = A,T,C or G <400> SEQUENCE: 30 atngcnggrt
aytgytgdat ntc 23 <210> SEQ ID NO 31 <211> LENGTH: 26
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
<400> SEQUENCE: 31 grgayttraw bgabgchyam gawtgg 26
<210> SEQ ID NO 32 <211> LENGTH: 35 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide <400>
SEQUENCE: 32 caagcbtggg aymtymtyta ytatmaygtb ttcag 35 <210>
SEQ ID NO 33 <211> LENGTH: 22 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide <400>
SEQUENCE: 33 gayybgartt ggctgtbcch gg 22 <210> SEQ ID NO 34
<211> LENGTH: 327 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 34 atgtccgtac aagtagaaac
catctcccca ggagacgggc gcaccttccc caagcgcggc 60 cagacctgcg
tggtgcacta caccgggatg cttgaagatg gaaagaaatt tgattcctcc 120
cgtgaccgta acaagccctt taagtttatg ctaggcaagc aggaggtgat ccgaggctgg
180 gaagaagggg ttgcccagat gagtgtgggt cagcgtgcca aactgactat
atctccagat 240 tatgcctatg gtgccactgg gcacccaggc atcatcccac
cacatgccac tctcgtcttc 300 gatgtggagc ttctaaaact ggaatga 327
<210> SEQ ID NO 35 <211> LENGTH: 31 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide <400>
SEQUENCE: 35 gagatctgga attcggatcc tcgagagatc t 31
1 SEQUENCE LISTING <160> NUMBER OF SEQ ID NOS: 35 <210>
SEQ ID NO 1 <211> LENGTH: 486 <212> TYPE: DNA
<213> ORGANISM: Mouse <220> FEATURE: <221>
NAME/KEY: CDS <222> LOCATION: (1)...(486) <400>
SEQUENCE: 1 ctc acc cgt cac aat gca gcc aac aag atc ttg aag aac atg
tgt gaa 48 Leu Thr Arg His Asn Ala Ala Asn Lys Ile Leu Lys Asn Met
Cys Glu 1 5 10 15 cac agc aac acg ctg gtc cag cag gcc atg atg gtg
agt gaa gag ctg 96 His Ser Asn Thr Leu Val Gln Gln Ala Met Met Val
Ser Glu Glu Leu 20 25 30 att cgg gta gcc atc ctc tgg cat gag atg
tgg cat gaa ggc ctg gaa 144 Ile Arg Val Ala Ile Leu Trp His Glu Met
Trp His Glu Gly Leu Glu 35 40 45 gag gca tct cgc ttg tac ttt ggg
gag agg aac gtg aaa ggc atg ttt 192 Glu Ala Ser Arg Leu Tyr Phe Gly
Glu Arg Asn Val Lys Gly Met Phe 50 55 60 gag gtg ctg gag ccc ctg
cat gct atg atg gaa cgg ggt ccc cgg act 240 Glu Val Leu Glu Pro Leu
His Ala Met Met Glu Arg Gly Pro Arg Thr 65 70 75 80 ctg aag gaa aca
tcc ttt aat cag gca tat ggc cga gat tta atg gag 288 Leu Lys Glu Thr
Ser Phe Asn Gln Ala Tyr Gly Arg Asp Leu Met Glu 85 90 95 gca caa
gaa tgg tgt cga aag tac atg aag tcg ggg aac gtc aag gac 336 Ala Gln
Glu Trp Cys Arg Lys Tyr Met Lys Ser Gly Asn Val Lys Asp 100 105 110
ctc acg caa gcc tgg gac ctc tac tat cac gtg ttc aga cgg atc tca 384
Leu Thr Gln Ala Trp Asp Leu Tyr Tyr His Val Phe Arg Arg Ile Ser 115
120 125 aag cag cta ccc cag ctc aca tcc ctg gag ctg cag tat gtg tcc
ccc 432 Lys Gln Leu Pro Gln Leu Thr Ser Leu Glu Leu Gln Tyr Val Ser
Pro 130 135 140 aaa ctt ctg atg tgc cga gac ctt gag ttg gct gtg cca
gga aca tac 480 Lys Leu Leu Met Cys Arg Asp Leu Glu Leu Ala Val Pro
Gly Thr Tyr 145 150 155 160 gac ccc 486 Asp Pro <210> SEQ ID
NO 2 <211> LENGTH: 162 <212> TYPE: PRT <213>
ORGANISM: Mouse <400> SEQUENCE: 2 Leu Thr Arg His Asn Ala Ala
Asn Lys Ile Leu Lys Asn Met Cys Glu 1 5 10 15 His Ser Asn Thr Leu
Val Gln Gln Ala Met Met Val Ser Glu Glu Leu 20 25 30 Ile Arg Val
Ala Ile Leu Trp His Glu Met Trp His Glu Gly Leu Glu 35 40 45 Glu
Ala Ser Arg Leu Tyr Phe Gly Glu Arg Asn Val Lys Gly Met Phe 50 55
60 Glu Val Leu Glu Pro Leu His Ala Met Met Glu Arg Gly Pro Arg Thr
65 70 75 80 Leu Lys Glu Thr Ser Phe Asn Gln Ala Tyr Gly Arg Asp Leu
Met Glu 85 90 95 Ala Gln Glu Trp Cys Arg Lys Tyr Met Lys Ser Gly
Asn Val Lys Asp 100 105 110 Leu Thr Gln Ala Trp Asp Leu Tyr Tyr His
Val Phe Arg Arg Ile Ser 115 120 125 Lys Gln Leu Pro Gln Leu Thr Ser
Leu Glu Leu Gln Tyr Val Ser Pro 130 135 140 Lys Leu Leu Met Cys Arg
Asp Leu Glu Leu Ala Val Pro Gly Thr Tyr 145 150 155 160 Asp Pro
<210> SEQ ID NO 3 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide <400>
SEQUENCE: 3 gggtttggaa ttcctaataa tgtctgtaca agtagaaacc 40
<210> SEQ ID NO 4 <211> LENGTH: 34 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide <400>
SEQUENCE: 4 gggtttcggg atcccgtcat tccagtttta gaac 34 <210>
SEQ ID NO 5 <211> LENGTH: 348 <212> TYPE: DNA
<213> ORGANISM: Homo sapiens <220> FEATURE: <221>
NAME/KEY: CDS <222> LOCATION: (14)...(325) <400>
SEQUENCE: 5 ggaattccta ata atg tcc gta caa gta gaa acc atc tcc cca
gga gac 49 Met Ser Val Gln Val Glu Thr Ile Ser Pro Gly Asp 1 5 10
ggg cgc acc ttc ccc aag cgc ggc cag acc tgc gtg gtg cac tac acc 97
Gly Arg Thr Phe Pro Lys Arg Gly Gln Thr Cys Val Val His Tyr Thr 15
20 25 ggg atg ctt gaa gat gga aag aaa ttt gat tcc tcc cgt gac cgt
aac 145 Gly Met Leu Glu Asp Gly Lys Lys Phe Asp Ser Ser Arg Asp Arg
Asn 30 35 40 aag ccc ttt aag ttt atg cta ggc aag cag gag gtg atc
cga ggc tgg 193 Lys Pro Phe Lys Phe Met Leu Gly Lys Gln Glu Val Ile
Arg Gly Trp 45 50 55 60 gaa gaa ggg gtt gcc cag atg agt gtg ggt cag
cgt gcc aaa ctg act 241 Glu Glu Gly Val Ala Gln Met Ser Val Gly Gln
Arg Ala Lys Leu Thr 65 70 75 ata tct cca gat tat gcc tat ggt gcc
act ggg cac cca ggc atc atc 289 Ile Ser Pro Asp Tyr Ala Tyr Gly Ala
Thr Gly His Pro Gly Ile Ile 80 85 90 cca cca cat gcc act ctc gtc
ttc gat gtg gag ctt ctaaaactgg 335 Pro Pro His Ala Thr Leu Val Phe
Asp Val Glu Leu 95 100 aatgacggga tcc 348 <210> SEQ ID NO 6
<211> LENGTH: 104 <212> TYPE: PRT <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 6 Met Ser Val Gln Val Glu Thr
Ile Ser Pro Gly Asp Gly Arg Thr Phe 1 5 10 15 Pro Lys Arg Gly Gln
Thr Cys Val Val His Tyr Thr Gly Met Leu Glu 20 25 30 Asp Gly Lys
Lys Phe Asp Ser Ser Arg Asp Arg Asn Lys Pro Phe Lys 35 40 45 Phe
Met Leu Gly Lys Gln Glu Val Ile Arg Gly Trp Glu Glu Gly Val 50 55
60 Ala Gln Met Ser Val Gly Gln Arg Ala Lys Leu Thr Ile Ser Pro Asp
65 70 75 80 Tyr Ala Tyr Gly Ala Thr Gly His Pro Gly Ile Ile Pro Pro
His Ala 85 90 95 Thr Leu Val Phe Asp Val Glu Leu 100 <210>
SEQ ID NO 7 <211> LENGTH: 48 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide <400>
SEQUENCE: 7 tcgccggaat tcgggggcgg aggtggagga gtacaagtag aaaccatc 48
<210> SEQ ID NO 8 <211> LENGTH: 34 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide <400>
SEQUENCE: 8 gggtttcggg atcccgtcat tccagtttta gaag 34 <210>
SEQ ID NO 9 <211> LENGTH: 41 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide <400>
SEQUENCE: 9 cgcggatccg cgcattatta cttgttttga ttgatttttt g 41
<210> SEQ ID NO 10 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide <400>
SEQUENCE: 10 cgcggatccg cgtaaaagca aagtactatc aattgagccg 40
<210> SEQ ID NO 11 <211> LENGTH: 5430 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <220> FEATURE:
<221> NAME/KEY: CDS <222> LOCATION: (1)...(5427)
<400> SEQUENCE: 11 ttg gag cac agt ggg att gga aga atc aaa
gag cag agt gcc cgc atg 48 Leu Glu His Ser Gly Ile Gly Arg Ile Lys
Glu Gln Ser Ala Arg Met 1 5 10 15 ctg ggg cac ctg gtc tcc aat gcc
ccc cga ctc atc cgc ccc tac atg 96 Leu Gly His Leu Val Ser Asn Ala
Pro Arg Leu Ile Arg Pro Tyr Met 20 25 30 gag cct att ctg aag gca
tta att ttg aaa ctg aaa gat cca gac cct 144 Glu Pro Ile Leu Lys Ala
Leu Ile Leu Lys Leu Lys Asp Pro Asp Pro 35 40 45 gat cca aac cca
ggt gtg atc aat aat gtc ctg gca aca ata gga gaa 192 Asp Pro Asn Pro
Gly Val Ile Asn Asn Val Leu Ala Thr Ile Gly Glu 50 55 60 ttg gca
cag gtt agt ggc ctg gaa atg agg aaa tgg gtt gat gaa ctt 240 Leu Ala
Gln Val Ser Gly Leu Glu Met Arg Lys Trp Val Asp Glu Leu 65 70 75 80
ttt att atc atc atg gac atg ctc cag gat tcc tct ttg ttg gcc aaa 288
Phe Ile Ile Ile Met Asp Met Leu Gln Asp Ser Ser Leu Leu Ala Lys 85
90 95 agg cag gtg gct ctg tgg acc ctg gga cag ttg gtg gcc agc act
ggc 336 Arg Gln Val Ala Leu Trp Thr Leu Gly Gln Leu Val Ala Ser Thr
Gly 100 105 110 tat gta gta gag ccc tac agg aag tac cct act ttg ctt
gag gtg cta 384 Tyr Val Val Glu Pro Tyr Arg Lys Tyr Pro Thr Leu Leu
Glu Val Leu 115 120 125 ctg aat ttt ctg aag act gag cag aac cag ggt
aca cgc aga gag gcc 432 Leu Asn Phe Leu Lys Thr Glu Gln Asn Gln Gly
Thr Arg Arg Glu Ala 130 135 140 atc cgt gtg tta ggg ctt tta ggg gct
ttg gat cct tac aag cac aaa 480 Ile Arg Val Leu Gly Leu Leu Gly Ala
Leu Asp Pro Tyr Lys His Lys 145 150 155 160 gtg aac att ggc atg ata
gac cag tcc cgg gat gcc tct gct gtc agc 528 Val Asn Ile Gly Met Ile
Asp Gln Ser Arg Asp Ala Ser Ala Val Ser 165 170 175 ctg tca gaa tcc
aag tca agt cag gat tcc tct gac tat agc act agt 576 Leu Ser Glu Ser
Lys Ser Ser Gln Asp Ser Ser Asp Tyr Ser Thr Ser 180 185 190 gaa atg
ctg gtc aac atg gga aac ttg cct ctg gat gag ttc tac cca 624 Glu Met
Leu Val Asn Met Gly Asn Leu Pro Leu Asp Glu Phe Tyr Pro 195 200 205
gct gtg tcc atg gtg gcc ctg atg cgg atc ttc cga gac cag tca ctc 672
Ala Val Ser Met Val Ala Leu Met Arg Ile Phe Arg Asp Gln Ser Leu 210
215 220 tct cat cat cac acc atg gtt gtc cag gcc atc acc ttc atc ttc
aag 720 Ser His His His Thr Met Val Val Gln Ala Ile Thr Phe Ile Phe
Lys 225 230 235 240 tcc ctg gga ctc aaa tgt gtg cag ttc ctg ccc cag
gtc atg ccc acg 768 Ser Leu Gly Leu Lys Cys Val Gln Phe Leu Pro Gln
Val Met Pro Thr 245 250 255 ttc ctt aat gtc att cga gtc tgt gat ggg
gcc atc cgg gaa ttt ttg 816 Phe Leu Asn Val Ile Arg Val Cys Asp Gly
Ala Ile Arg Glu Phe Leu 260 265 270 ttc cag cag ctg gga atg ttg gtg
tcc ttt gtg aag agc cac atc aga 864 Phe Gln Gln Leu Gly Met Leu Val
Ser Phe Val Lys Ser His Ile Arg 275 280 285 cct tat atg gat gaa ata
gtc acc ctc atg aga gaa ttc tgg gtc atg 912 Pro Tyr Met Asp Glu Ile
Val Thr Leu Met Arg Glu Phe Trp Val Met 290 295 300 aac acc tca att
cag agc acg atc att ctt ctc att gag caa att gtg 960 Asn Thr Ser Ile
Gln Ser Thr Ile Ile Leu Leu Ile Glu Gln Ile Val 305 310 315 320 gta
gct ctt ggg ggt gaa ttt aag ctc tac ctg ccc cag ctg atc cca 1008
Val Ala Leu Gly Gly Glu Phe Lys Leu Tyr Leu Pro Gln Leu Ile Pro 325
330 335 cac atg ctg cgt gtc ttc atg cat gac aac agc cca ggc cgc att
gtc 1056 His Met Leu Arg Val Phe Met His Asp Asn Ser Pro Gly Arg
Ile Val 340 345 350 tct atc aag tta ctg gct gca atc cag ctg ttt ggc
gcc aac ctg gat 1104 Ser Ile Lys Leu Leu Ala Ala Ile Gln Leu Phe
Gly Ala Asn Leu Asp 355 360 365 gac tac ctg cat tta ctg ctg cct cct
att gtt aag ttg ttt gat gcc 1152 Asp Tyr Leu His Leu Leu Leu Pro
Pro Ile Val Lys Leu Phe Asp Ala 370 375 380 cct gaa gct cca ctg cca
tct cga aag gca gcg cta gag act gtg gac 1200 Pro Glu Ala Pro Leu
Pro Ser Arg Lys Ala Ala Leu Glu Thr Val Asp 385 390 395 400 cgc ctg
acg gag tcc ctg gat ttc act gac tat gcc tcc cgg atc att 1248 Arg
Leu Thr Glu Ser Leu Asp Phe Thr Asp Tyr Ala Ser Arg Ile Ile 405 410
415 cac cct att gtt cga aca ctg gac cag agc cca gaa ctg cgc tcc aca
1296 His Pro Ile Val Arg Thr Leu Asp Gln Ser Pro Glu Leu Arg Ser
Thr 420 425 430 gcc atg gac acg ctg tct tca ctt gtt ttt cag ctg ggg
aag aag tac 1344 Ala Met Asp Thr Leu Ser Ser Leu Val Phe Gln Leu
Gly Lys Lys Tyr 435 440 445 caa att ttc att cca atg gtg aat aaa gtt
ctg gtg cga cac cga atc 1392 Gln Ile Phe Ile Pro Met Val Asn Lys
Val Leu Val Arg His Arg Ile 450 455 460 aat cat cag cgc tat gat gtg
ctc atc tgc aga att gtc aag gga tac 1440 Asn His Gln Arg Tyr Asp
Val Leu Ile Cys Arg Ile Val Lys Gly Tyr 465 470 475 480 aca ctt gct
gat gaa gag gag gat cct ttg att tac cag cat cgg atg 1488 Thr Leu
Ala Asp Glu Glu Glu Asp Pro Leu Ile Tyr Gln His Arg Met 485 490 495
ctt agg agt ggc caa ggg gat gca ttg gct agt gga cca gtg gaa aca
1536 Leu Arg Ser Gly Gln Gly Asp Ala Leu Ala Ser Gly Pro Val Glu
Thr 500 505 510 gga ccc atg aag aaa ctg cac gtc agc acc atc aac ctc
caa aag gcc 1584 Gly Pro Met Lys Lys Leu His Val Ser Thr Ile Asn
Leu Gln Lys Ala 515 520 525 tgg ggc gct gcc agg agg gtc tcc aaa gat
gac tgg ctg gaa tgg ctg 1632 Trp Gly Ala Ala Arg Arg Val Ser Lys
Asp Asp Trp Leu Glu Trp Leu 530 535 540 aga cgg ctg agc ctg gag ctg
ctg aag gac tca tca tcg ccc tcc ctg 1680 Arg Arg Leu Ser Leu Glu
Leu Leu Lys Asp Ser Ser Ser Pro Ser Leu 545 550 555 560 cgc tcc tgc
tgg gcc ctg gca cag gcc tac aac ccg atg gcc agg gat 1728 Arg Ser
Cys Trp Ala Leu Ala Gln Ala Tyr Asn Pro Met Ala Arg Asp 565 570 575
ctc ttc aat gct gca ttt gtg tcc tgc tgg tct gaa ctg aat gaa gat
1776 Leu Phe Asn Ala Ala Phe Val Ser Cys Trp Ser Glu Leu Asn Glu
Asp 580 585 590 caa cag gat gag ctc atc aga agc atc gag ttg gcc ctc
acc tca caa 1824 Gln Gln Asp Glu Leu Ile Arg Ser Ile Glu Leu Ala
Leu Thr Ser Gln 595 600 605 gac atc gct gaa gtc aca cag acc ctc tta
aac ttg gct gaa ttc atg 1872 Asp Ile Ala Glu Val Thr Gln Thr Leu
Leu Asn Leu Ala Glu Phe Met 610 615 620 gaa cac agt gac aag ggc ccc
ctg cca ctg aga gat gac aat ggc att 1920 Glu His Ser Asp Lys Gly
Pro Leu Pro Leu Arg Asp Asp Asn Gly Ile 625 630 635 640 gtt ctg ctg
ggt gag aga gct gcc aag tgc cga gca tat gcc aaa gca 1968 Val Leu
Leu Gly Glu Arg Ala Ala Lys Cys Arg Ala Tyr Ala Lys Ala 645 650 655
cta cac tac aaa gaa ctg gag ttc cag aaa ggc ccc acc cct gcc att
2016 Leu His Tyr Lys Glu Leu Glu Phe Gln Lys Gly Pro Thr Pro Ala
Ile 660 665 670 cta gaa tct ctc atc agc att aat aat aag cta cag cag
ccg gag gca 2064 Leu Glu Ser Leu Ile Ser Ile Asn Asn Lys Leu Gln
Gln Pro Glu Ala 675 680 685 gcg gcc gga gtg tta gaa tat gcc atg aaa
cac ttt gga gag ctg gag 2112 Ala Ala Gly Val Leu Glu Tyr Ala Met
Lys His Phe Gly Glu Leu Glu 690 695 700 atc cag gct acc tgg tat gag
aaa ctg cac gag tgg gag gat gcc ctt 2160 Ile Gln Ala Thr Trp Tyr
Glu Lys Leu His Glu Trp Glu Asp Ala Leu 705 710 715 720 gtg gcc tat
gac aag aaa atg gac acc aac aag gac gac cca gag ctg 2208 Val Ala
Tyr Asp Lys Lys Met Asp Thr Asn Lys Asp Asp Pro Glu Leu 725 730 735
atg ctg ggc cgc atg cgc tgc ctc gag gcc ttg ggg gaa tgg ggt caa
2256 Met Leu Gly Arg Met Arg Cys Leu Glu Ala Leu Gly Glu Trp Gly
Gln 740 745 750 ctc cac cag cag tgc tgt gaa aag tgg acc ctg gtt aat
gat gag acc 2304 Leu His Gln Gln Cys Cys Glu Lys Trp Thr Leu Val
Asn Asp Glu Thr 755 760 765 caa gcc aag atg gcc cgg atg gct gct gca
gct gca tgg ggt tta ggt 2352 Gln Ala Lys Met Ala Arg Met Ala Ala
Ala Ala Ala Trp Gly Leu Gly 770 775 780 cag tgg gac agc atg gaa gaa
tac acc tgt atg atc cct cgg gac acc 2400 Gln Trp Asp Ser Met Glu
Glu Tyr Thr Cys Met Ile Pro Arg Asp Thr 785 790 795 800 cat gat ggg
gca ttt tat aga gct gtg ctg gca ctg cat cag gac ctc 2448 His Asp
Gly Ala Phe Tyr Arg Ala Val Leu Ala Leu His Gln Asp Leu 805 810 815
ttc tcc ttg gca caa cag tgc att gac aag gcc agg gac ctg ctg gat
2496 Phe Ser Leu Ala Gln Gln Cys Ile Asp Lys Ala Arg Asp Leu Leu
Asp 820 825 830 gct gaa tta act gca atg gca gga gag agt tac agt cgg
gca tat ggg 2544 Ala Glu Leu Thr Ala Met Ala Gly Glu Ser Tyr Ser
Arg Ala Tyr Gly 835 840 845 gcc atg gtt tct tgc cac atg ctg tcc gag
ctg gag gag gtt atc cag 2592 Ala Met Val Ser Cys His Met Leu Ser
Glu Leu Glu Glu Val Ile Gln 850 855 860 tac aaa ctt gtc ccc gag cga
cga gag atc atc cgc cag atc tgg tgg 2640 Tyr Lys Leu Val Pro Glu
Arg Arg Glu Ile Ile Arg Gln Ile Trp Trp 865 870 875 880 gag aga ctg
cag ggc tgc cag cgt atc gta gag gac tgg cag aaa atc 2688 Glu Arg
Leu Gln Gly Cys Gln Arg Ile Val Glu Asp Trp Gln Lys Ile 885 890 895
ctt atg gtg cgg tcc ctt gtg gtc agc cct cat gaa gac atg aga acc
2736 Leu Met Val Arg Ser Leu Val Val Ser Pro His Glu Asp Met Arg
Thr 900 905 910 tgg ctc aag tat gca agc ctg tgc ggc aag agt ggc agg
ctg gct ctt 2784 Trp Leu Lys Tyr Ala Ser Leu Cys Gly Lys Ser Gly
Arg Leu Ala Leu 915 920 925 gct cat aaa act tta gtg ttg ctc ctg gga
gtt gat ccg tct cgg caa 2832 Ala His Lys Thr Leu Val Leu Leu Leu
Gly Val Asp Pro Ser Arg Gln 930 935 940 ctt gac cat cct ctg cca aca
gtt cac cct cag gtg acc tat gcc tac 2880 Leu Asp His Pro Leu Pro
Thr Val His Pro Gln Val Thr Tyr Ala Tyr 945 950 955 960 atg aaa aac
atg tgg aag agt gcc cgc aag atc gat gcc ttc cag cac 2928 Met Lys
Asn Met Trp Lys Ser Ala Arg Lys Ile Asp Ala Phe Gln His 965 970 975
atg cag cat ttt gtc cag acc atg cag caa cag gcc cag cat gcc atc
2976 Met Gln His Phe Val Gln Thr Met Gln Gln Gln Ala Gln His Ala
Ile 980 985 990 gct act gag gac cag cag cat aag cag gaa ctg cac aag
ctc atg gcc 3024
Ala Thr Glu Asp Gln Gln His Lys Gln Glu Leu His Lys Leu Met Ala 995
1000 1005 cga tgc ttc ctg aaa ctt gga gag tgg cag ctg aat cta cag
ggc atc 3072 Arg Cys Phe Leu Lys Leu Gly Glu Trp Gln Leu Asn Leu
Gln Gly Ile 1010 1015 1020 aat gag agc aca atc ccc aaa gtg ctg cag
tac tac agc gcc gcc aca 3120 Asn Glu Ser Thr Ile Pro Lys Val Leu
Gln Tyr Tyr Ser Ala Ala Thr 1025 1030 1035 1040 gag cac gac cgc agc
tgg tac aag gcc tgg cat gcg tgg gca gtg atg 3168 Glu His Asp Arg
Ser Trp Tyr Lys Ala Trp His Ala Trp Ala Val Met 1045 1050 1055 aac
ttc gaa gct gtg cta cac tac aaa cat cag aac caa gcc cgc gat 3216
Asn Phe Glu Ala Val Leu His Tyr Lys His Gln Asn Gln Ala Arg Asp
1060 1065 1070 gag aag aag aaa ctg cgt cat gcc agc ggg gcc aac atc
acc aac gcc 3264 Glu Lys Lys Lys Leu Arg His Ala Ser Gly Ala Asn
Ile Thr Asn Ala 1075 1080 1085 acc act gcc gcc acc acg gcc gcc act
gcc acc acc act gcc agc acc 3312 Thr Thr Ala Ala Thr Thr Ala Ala
Thr Ala Thr Thr Thr Ala Ser Thr 1090 1095 1100 gag ggc agc aac agt
gag agc gag gcc gag agc acc gag aac agc ccc 3360 Glu Gly Ser Asn
Ser Glu Ser Glu Ala Glu Ser Thr Glu Asn Ser Pro 1105 1110 1115 1120
acc cca tcg ccg ctg cag aag aag gtc act gag gat ctg tcc aaa acc
3408 Thr Pro Ser Pro Leu Gln Lys Lys Val Thr Glu Asp Leu Ser Lys
Thr 1125 1130 1135 ctc ctg atg tac acg gtg cct gcc gtc cag ggc ttc
ttc cgt tcc atc 3456 Leu Leu Met Tyr Thr Val Pro Ala Val Gln Gly
Phe Phe Arg Ser Ile 1140 1145 1150 tcc ttg tca cga ggc aac aac ctc
cag gat aca ctc aga gtt ctc acc 3504 Ser Leu Ser Arg Gly Asn Asn
Leu Gln Asp Thr Leu Arg Val Leu Thr 1155 1160 1165 tta tgg ttt gat
tat ggt cac tgg cca gat gtc aat gag gcc tta gtg 3552 Leu Trp Phe
Asp Tyr Gly His Trp Pro Asp Val Asn Glu Ala Leu Val 1170 1175 1180
gag ggg gtg aaa gcc atc cag att gat acc tgg cta cag gtt ata cct
3600 Glu Gly Val Lys Ala Ile Gln Ile Asp Thr Trp Leu Gln Val Ile
Pro 1185 1190 1195 1200 cag ctc att gca aga att gat acg ccc aga ccc
ttg gtg gga cgt ctc 3648 Gln Leu Ile Ala Arg Ile Asp Thr Pro Arg
Pro Leu Val Gly Arg Leu 1205 1210 1215 att cac cag ctt ctc aca gac
att ggt cgg tac cac ccc cag gcc ctc 3696 Ile His Gln Leu Leu Thr
Asp Ile Gly Arg Tyr His Pro Gln Ala Leu 1220 1225 1230 atc tac cca
ctg aca gtg gct tct aag tct acc acg aca gcc cgg cac 3744 Ile Tyr
Pro Leu Thr Val Ala Ser Lys Ser Thr Thr Thr Ala Arg His 1235 1240
1245 aat gca gcc aac aag att ctg aag aac atg tgt gag cac agc aac
acc 3792 Asn Ala Ala Asn Lys Ile Leu Lys Asn Met Cys Glu His Ser
Asn Thr 1250 1255 1260 ctg gtc cag cag gcc atg atg gtg agc gag gag
ctg atc cga gtg gcc 3840 Leu Val Gln Gln Ala Met Met Val Ser Glu
Glu Leu Ile Arg Val Ala 1265 1270 1275 1280 atc ctc tgg cat gag atg
tgg cat gaa ggc ctg gaa gag gca tct cgt 3888 Ile Leu Trp His Glu
Met Trp His Glu Gly Leu Glu Glu Ala Ser Arg 1285 1290 1295 ttg tac
ttt ggg gaa agg aac gtg aaa ggc atg ttt gag gtg ctg gag 3936 Leu
Tyr Phe Gly Glu Arg Asn Val Lys Gly Met Phe Glu Val Leu Glu 1300
1305 1310 ccc ttg cat gct atg atg gaa cgg ggc ccc cag act ctg aag
gaa aca 3984 Pro Leu His Ala Met Met Glu Arg Gly Pro Gln Thr Leu
Lys Glu Thr 1315 1320 1325 tcc ttt aat cag gcc tat ggt cga gat tta
atg gag gcc caa gag tgg 4032 Ser Phe Asn Gln Ala Tyr Gly Arg Asp
Leu Met Glu Ala Gln Glu Trp 1330 1335 1340 tgc agg aag tac atg aaa
tca ggg aat gtc aag gac ctc acc caa gcc 4080 Cys Arg Lys Tyr Met
Lys Ser Gly Asn Val Lys Asp Leu Thr Gln Ala 1345 1350 1355 1360 tgg
gac ctc tat tat cat gtg ttc cga cga atc tca aag cag ctg cct 4128
Trp Asp Leu Tyr Tyr His Val Phe Arg Arg Ile Ser Lys Gln Leu Pro
1365 1370 1375 cag ctc aca tcc tta gag ctg caa tat gtt tcc cca aaa
ctt ctg atg 4176 Gln Leu Thr Ser Leu Glu Leu Gln Tyr Val Ser Pro
Lys Leu Leu Met 1380 1385 1390 tgc cgg gac ctt gaa ttg gct gtg cca
gga aca tat gac ccc aac cag 4224 Cys Arg Asp Leu Glu Leu Ala Val
Pro Gly Thr Tyr Asp Pro Asn Gln 1395 1400 1405 cca atc att cgc att
cag tcc ata gca ccg tct ttg caa gtc atc aca 4272 Pro Ile Ile Arg
Ile Gln Ser Ile Ala Pro Ser Leu Gln Val Ile Thr 1410 1415 1420 tcc
aag cag agg ccc cgg aaa ttg aca ctt atg ggc agc aac gga cat 4320
Ser Lys Gln Arg Pro Arg Lys Leu Thr Leu Met Gly Ser Asn Gly His
1425 1430 1435 1440 gag ttt gtt ttc ctt cta aaa ggc cat gaa gat ctg
cgc cag gat gag 4368 Glu Phe Val Phe Leu Leu Lys Gly His Glu Asp
Leu Arg Gln Asp Glu 1445 1450 1455 cgt gtg atg cag ctc ttc ggc ctg
gtt aac acc ctt ctg gcc aat gac 4416 Arg Val Met Gln Leu Phe Gly
Leu Val Asn Thr Leu Leu Ala Asn Asp 1460 1465 1470 cca aca tct ctt
cgg aaa aac ctc agc atc cag aga tac gct gtc atc 4464 Pro Thr Ser
Leu Arg Lys Asn Leu Ser Ile Gln Arg Tyr Ala Val Ile 1475 1480 1485
cct tta tcg acc aac tcg ggc ctc att ggc tgg gtt ccc cac tgt gac
4512 Pro Leu Ser Thr Asn Ser Gly Leu Ile Gly Trp Val Pro His Cys
Asp 1490 1495 1500 aca ctg cac gcc ctc atc cgg gac tac agg gag aag
aag aag atc ctt 4560 Thr Leu His Ala Leu Ile Arg Asp Tyr Arg Glu
Lys Lys Lys Ile Leu 1505 1510 1515 1520 ctc aac atc gag cat cgc atc
atg ttg cgg atg gct ccg gac tat gac 4608 Leu Asn Ile Glu His Arg
Ile Met Leu Arg Met Ala Pro Asp Tyr Asp 1525 1530 1535 cac ttg act
ctg atg cag aag gtg gag gtg ttt gag cat gcc gtc aat 4656 His Leu
Thr Leu Met Gln Lys Val Glu Val Phe Glu His Ala Val Asn 1540 1545
1550 aat aca gct ggg gac gac ctg gcc aag ctg ctg tgg ctg aaa agc
ccc 4704 Asn Thr Ala Gly Asp Asp Leu Ala Lys Leu Leu Trp Leu Lys
Ser Pro 1555 1560 1565 agc tcc gag gtg tgg ttt gac cga aga acc aat
tat acc cgt tct tta 4752 Ser Ser Glu Val Trp Phe Asp Arg Arg Thr
Asn Tyr Thr Arg Ser Leu 1570 1575 1580 gcg gtc atg tca atg gtt ggg
tat att tta ggc ctg gga gat aga cac 4800 Ala Val Met Ser Met Val
Gly Tyr Ile Leu Gly Leu Gly Asp Arg His 1585 1590 1595 1600 cca tcc
aac ctg atg ctg gac cgt ctg agt ggg aag atc ctg cac att 4848 Pro
Ser Asn Leu Met Leu Asp Arg Leu Ser Gly Lys Ile Leu His Ile 1605
1610 1615 gac ttt ggg gac tgc ttt gag gtt gct atg acc cga gag aag
ttt cca 4896 Asp Phe Gly Asp Cys Phe Glu Val Ala Met Thr Arg Glu
Lys Phe Pro 1620 1625 1630 gag aag att cca ttt aga cta aca aga atg
ttg acc aat gct atg gag 4944 Glu Lys Ile Pro Phe Arg Leu Thr Arg
Met Leu Thr Asn Ala Met Glu 1635 1640 1645 gtt aca ggc ctg gat ggc
aac tac aga atc aca tgc cac aca gtg atg 4992 Val Thr Gly Leu Asp
Gly Asn Tyr Arg Ile Thr Cys His Thr Val Met 1650 1655 1660 gag gtg
ctg cga gag cac aag gac agt gtc atg gcc gtg ctg gaa gcc 5040 Glu
Val Leu Arg Glu His Lys Asp Ser Val Met Ala Val Leu Glu Ala 1665
1670 1675 1680 ttt gtc tat gac ccc ttg ctg aac tgg agg ctg atg gac
aca aat acc 5088 Phe Val Tyr Asp Pro Leu Leu Asn Trp Arg Leu Met
Asp Thr Asn Thr 1685 1690 1695 aaa ggc aac aag cga tcc cga acg agg
acg gat tcc tac tct gct ggc 5136 Lys Gly Asn Lys Arg Ser Arg Thr
Arg Thr Asp Ser Tyr Ser Ala Gly 1700 1705 1710 cag tca gtc gaa att
ttg gac ggt gtg gaa ctt gga gag cca gcc cat 5184 Gln Ser Val Glu
Ile Leu Asp Gly Val Glu Leu Gly Glu Pro Ala His 1715 1720 1725 aag
aaa acg ggg acc aca gtg cca gaa tct att cat tct ttc att gga 5232
Lys Lys Thr Gly Thr Thr Val Pro Glu Ser Ile His Ser Phe Ile Gly
1730 1735 1740 gac ggt ttg gtg aaa cca gag gcc cta aat aag aaa gct
atc cag att 5280 Asp Gly Leu Val Lys Pro Glu Ala Leu Asn Lys Lys
Ala Ile Gln Ile 1745 1750 1755 1760 att aac agg gtt cga gat aag ctc
act ggt cgg gac ttc tct cat gat 5328 Ile Asn Arg Val Arg Asp Lys
Leu Thr Gly Arg Asp Phe Ser His Asp 1765 1770 1775 gac act ttg gat
gtt cca acg caa gtt gag ctg ctc atc aaa caa gcg 5376 Asp Thr Leu
Asp Val Pro Thr Gln Val Glu Leu Leu Ile Lys Gln Ala 1780 1785 1790
aca tcc cat gaa aac ctc tgc cag tgc tat att ggc tgg tgc cct ttc
5424 Thr Ser His Glu Asn Leu Cys Gln Cys Tyr Ile Gly Trp Cys Pro
Phe 1795 1800 1805 tgg taa 5430 Trp <210> SEQ ID NO 12
<211> LENGTH: 1809 <212> TYPE: PRT <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 12 Leu Glu His Ser Gly
Ile Gly Arg Ile Lys Glu Gln Ser Ala Arg Met 1 5 10 15 Leu Gly His
Leu Val Ser Asn Ala Pro Arg Leu Ile Arg Pro Tyr Met 20 25 30 Glu
Pro Ile Leu Lys Ala Leu Ile Leu Lys Leu Lys Asp Pro Asp Pro 35 40
45 Asp Pro Asn Pro Gly Val Ile Asn Asn Val Leu Ala Thr Ile Gly Glu
50 55 60 Leu Ala Gln Val Ser Gly Leu Glu Met Arg Lys Trp Val Asp
Glu Leu 65 70 75 80 Phe Ile Ile Ile Met Asp Met Leu Gln Asp Ser Ser
Leu Leu Ala Lys 85 90 95 Arg Gln Val Ala Leu Trp Thr Leu Gly Gln
Leu Val Ala Ser Thr Gly 100 105 110 Tyr Val Val Glu Pro Tyr Arg Lys
Tyr Pro Thr Leu Leu Glu Val Leu 115 120 125 Leu Asn Phe Leu Lys Thr
Glu Gln Asn Gln Gly Thr Arg Arg Glu Ala 130 135 140 Ile Arg Val Leu
Gly Leu Leu Gly Ala Leu Asp Pro Tyr Lys His Lys 145 150 155 160 Val
Asn Ile Gly Met Ile Asp Gln Ser Arg Asp Ala Ser Ala Val Ser 165 170
175 Leu Ser Glu Ser Lys Ser Ser Gln Asp Ser Ser Asp Tyr Ser Thr Ser
180 185 190 Glu Met Leu Val Asn Met Gly Asn Leu Pro Leu Asp Glu Phe
Tyr Pro 195 200 205
Ala Val Ser Met Val Ala Leu Met Arg Ile Phe Arg Asp Gln Ser Leu 210
215 220 Ser His His His Thr Met Val Val Gln Ala Ile Thr Phe Ile Phe
Lys 225 230 235 240 Ser Leu Gly Leu Lys Cys Val Gln Phe Leu Pro Gln
Val Met Pro Thr 245 250 255 Phe Leu Asn Val Ile Arg Val Cys Asp Gly
Ala Ile Arg Glu Phe Leu 260 265 270 Phe Gln Gln Leu Gly Met Leu Val
Ser Phe Val Lys Ser His Ile Arg 275 280 285 Pro Tyr Met Asp Glu Ile
Val Thr Leu Met Arg Glu Phe Trp Val Met 290 295 300 Asn Thr Ser Ile
Gln Ser Thr Ile Ile Leu Leu Ile Glu Gln Ile Val 305 310 315 320 Val
Ala Leu Gly Gly Glu Phe Lys Leu Tyr Leu Pro Gln Leu Ile Pro 325 330
335 His Met Leu Arg Val Phe Met His Asp Asn Ser Pro Gly Arg Ile Val
340 345 350 Ser Ile Lys Leu Leu Ala Ala Ile Gln Leu Phe Gly Ala Asn
Leu Asp 355 360 365 Asp Tyr Leu His Leu Leu Leu Pro Pro Ile Val Lys
Leu Phe Asp Ala 370 375 380 Pro Glu Ala Pro Leu Pro Ser Arg Lys Ala
Ala Leu Glu Thr Val Asp 385 390 395 400 Arg Leu Thr Glu Ser Leu Asp
Phe Thr Asp Tyr Ala Ser Arg Ile Ile 405 410 415 His Pro Ile Val Arg
Thr Leu Asp Gln Ser Pro Glu Leu Arg Ser Thr 420 425 430 Ala Met Asp
Thr Leu Ser Ser Leu Val Phe Gln Leu Gly Lys Lys Tyr 435 440 445 Gln
Ile Phe Ile Pro Met Val Asn Lys Val Leu Val Arg His Arg Ile 450 455
460 Asn His Gln Arg Tyr Asp Val Leu Ile Cys Arg Ile Val Lys Gly Tyr
465 470 475 480 Thr Leu Ala Asp Glu Glu Glu Asp Pro Leu Ile Tyr Gln
His Arg Met 485 490 495 Leu Arg Ser Gly Gln Gly Asp Ala Leu Ala Ser
Gly Pro Val Glu Thr 500 505 510 Gly Pro Met Lys Lys Leu His Val Ser
Thr Ile Asn Leu Gln Lys Ala 515 520 525 Trp Gly Ala Ala Arg Arg Val
Ser Lys Asp Asp Trp Leu Glu Trp Leu 530 535 540 Arg Arg Leu Ser Leu
Glu Leu Leu Lys Asp Ser Ser Ser Pro Ser Leu 545 550 555 560 Arg Ser
Cys Trp Ala Leu Ala Gln Ala Tyr Asn Pro Met Ala Arg Asp 565 570 575
Leu Phe Asn Ala Ala Phe Val Ser Cys Trp Ser Glu Leu Asn Glu Asp 580
585 590 Gln Gln Asp Glu Leu Ile Arg Ser Ile Glu Leu Ala Leu Thr Ser
Gln 595 600 605 Asp Ile Ala Glu Val Thr Gln Thr Leu Leu Asn Leu Ala
Glu Phe Met 610 615 620 Glu His Ser Asp Lys Gly Pro Leu Pro Leu Arg
Asp Asp Asn Gly Ile 625 630 635 640 Val Leu Leu Gly Glu Arg Ala Ala
Lys Cys Arg Ala Tyr Ala Lys Ala 645 650 655 Leu His Tyr Lys Glu Leu
Glu Phe Gln Lys Gly Pro Thr Pro Ala Ile 660 665 670 Leu Glu Ser Leu
Ile Ser Ile Asn Asn Lys Leu Gln Gln Pro Glu Ala 675 680 685 Ala Ala
Gly Val Leu Glu Tyr Ala Met Lys His Phe Gly Glu Leu Glu 690 695 700
Ile Gln Ala Thr Trp Tyr Glu Lys Leu His Glu Trp Glu Asp Ala Leu 705
710 715 720 Val Ala Tyr Asp Lys Lys Met Asp Thr Asn Lys Asp Asp Pro
Glu Leu 725 730 735 Met Leu Gly Arg Met Arg Cys Leu Glu Ala Leu Gly
Glu Trp Gly Gln 740 745 750 Leu His Gln Gln Cys Cys Glu Lys Trp Thr
Leu Val Asn Asp Glu Thr 755 760 765 Gln Ala Lys Met Ala Arg Met Ala
Ala Ala Ala Ala Trp Gly Leu Gly 770 775 780 Gln Trp Asp Ser Met Glu
Glu Tyr Thr Cys Met Ile Pro Arg Asp Thr 785 790 795 800 His Asp Gly
Ala Phe Tyr Arg Ala Val Leu Ala Leu His Gln Asp Leu 805 810 815 Phe
Ser Leu Ala Gln Gln Cys Ile Asp Lys Ala Arg Asp Leu Leu Asp 820 825
830 Ala Glu Leu Thr Ala Met Ala Gly Glu Ser Tyr Ser Arg Ala Tyr Gly
835 840 845 Ala Met Val Ser Cys His Met Leu Ser Glu Leu Glu Glu Val
Ile Gln 850 855 860 Tyr Lys Leu Val Pro Glu Arg Arg Glu Ile Ile Arg
Gln Ile Trp Trp 865 870 875 880 Glu Arg Leu Gln Gly Cys Gln Arg Ile
Val Glu Asp Trp Gln Lys Ile 885 890 895 Leu Met Val Arg Ser Leu Val
Val Ser Pro His Glu Asp Met Arg Thr 900 905 910 Trp Leu Lys Tyr Ala
Ser Leu Cys Gly Lys Ser Gly Arg Leu Ala Leu 915 920 925 Ala His Lys
Thr Leu Val Leu Leu Leu Gly Val Asp Pro Ser Arg Gln 930 935 940 Leu
Asp His Pro Leu Pro Thr Val His Pro Gln Val Thr Tyr Ala Tyr 945 950
955 960 Met Lys Asn Met Trp Lys Ser Ala Arg Lys Ile Asp Ala Phe Gln
His 965 970 975 Met Gln His Phe Val Gln Thr Met Gln Gln Gln Ala Gln
His Ala Ile 980 985 990 Ala Thr Glu Asp Gln Gln His Lys Gln Glu Leu
His Lys Leu Met Ala 995 1000 1005 Arg Cys Phe Leu Lys Leu Gly Glu
Trp Gln Leu Asn Leu Gln Gly Ile 1010 1015 1020 Asn Glu Ser Thr Ile
Pro Lys Val Leu Gln Tyr Tyr Ser Ala Ala Thr 1025 1030 1035 1040 Glu
His Asp Arg Ser Trp Tyr Lys Ala Trp His Ala Trp Ala Val Met 1045
1050 1055 Asn Phe Glu Ala Val Leu His Tyr Lys His Gln Asn Gln Ala
Arg Asp 1060 1065 1070 Glu Lys Lys Lys Leu Arg His Ala Ser Gly Ala
Asn Ile Thr Asn Ala 1075 1080 1085 Thr Thr Ala Ala Thr Thr Ala Ala
Thr Ala Thr Thr Thr Ala Ser Thr 1090 1095 1100 Glu Gly Ser Asn Ser
Glu Ser Glu Ala Glu Ser Thr Glu Asn Ser Pro 1105 1110 1115 1120 Thr
Pro Ser Pro Leu Gln Lys Lys Val Thr Glu Asp Leu Ser Lys Thr 1125
1130 1135 Leu Leu Met Tyr Thr Val Pro Ala Val Gln Gly Phe Phe Arg
Ser Ile 1140 1145 1150 Ser Leu Ser Arg Gly Asn Asn Leu Gln Asp Thr
Leu Arg Val Leu Thr 1155 1160 1165 Leu Trp Phe Asp Tyr Gly His Trp
Pro Asp Val Asn Glu Ala Leu Val 1170 1175 1180 Glu Gly Val Lys Ala
Ile Gln Ile Asp Thr Trp Leu Gln Val Ile Pro 1185 1190 1195 1200 Gln
Leu Ile Ala Arg Ile Asp Thr Pro Arg Pro Leu Val Gly Arg Leu 1205
1210 1215 Ile His Gln Leu Leu Thr Asp Ile Gly Arg Tyr His Pro Gln
Ala Leu 1220 1225 1230 Ile Tyr Pro Leu Thr Val Ala Ser Lys Ser Thr
Thr Thr Ala Arg His 1235 1240 1245 Asn Ala Ala Asn Lys Ile Leu Lys
Asn Met Cys Glu His Ser Asn Thr 1250 1255 1260 Leu Val Gln Gln Ala
Met Met Val Ser Glu Glu Leu Ile Arg Val Ala 1265 1270 1275 1280 Ile
Leu Trp His Glu Met Trp His Glu Gly Leu Glu Glu Ala Ser Arg 1285
1290 1295 Leu Tyr Phe Gly Glu Arg Asn Val Lys Gly Met Phe Glu Val
Leu Glu 1300 1305 1310 Pro Leu His Ala Met Met Glu Arg Gly Pro Gln
Thr Leu Lys Glu Thr 1315 1320 1325 Ser Phe Asn Gln Ala Tyr Gly Arg
Asp Leu Met Glu Ala Gln Glu Trp 1330 1335 1340 Cys Arg Lys Tyr Met
Lys Ser Gly Asn Val Lys Asp Leu Thr Gln Ala 1345 1350 1355 1360 Trp
Asp Leu Tyr Tyr His Val Phe Arg Arg Ile Ser Lys Gln Leu Pro 1365
1370 1375 Gln Leu Thr Ser Leu Glu Leu Gln Tyr Val Ser Pro Lys Leu
Leu Met 1380 1385 1390 Cys Arg Asp Leu Glu Leu Ala Val Pro Gly Thr
Tyr Asp Pro Asn Gln 1395 1400 1405 Pro Ile Ile Arg Ile Gln Ser Ile
Ala Pro Ser Leu Gln Val Ile Thr 1410 1415 1420 Ser Lys Gln Arg Pro
Arg Lys Leu Thr Leu Met Gly Ser Asn Gly His 1425 1430 1435 1440 Glu
Phe Val Phe Leu Leu Lys Gly His Glu Asp Leu Arg Gln Asp Glu 1445
1450 1455 Arg Val Met Gln Leu Phe Gly Leu Val Asn Thr Leu Leu Ala
Asn Asp 1460 1465 1470 Pro Thr Ser Leu Arg Lys Asn Leu Ser Ile Gln
Arg Tyr Ala Val Ile 1475 1480 1485 Pro Leu Ser Thr Asn Ser Gly Leu
Ile Gly Trp Val Pro His Cys Asp 1490 1495 1500 Thr Leu His Ala Leu
Ile Arg Asp Tyr Arg Glu Lys Lys Lys Ile Leu 1505 1510 1515 1520 Leu
Asn Ile Glu His Arg Ile Met Leu Arg Met Ala Pro Asp Tyr Asp 1525
1530 1535 His Leu Thr Leu Met Gln Lys Val Glu Val Phe Glu His Ala
Val Asn
1540 1545 1550 Asn Thr Ala Gly Asp Asp Leu Ala Lys Leu Leu Trp Leu
Lys Ser Pro 1555 1560 1565 Ser Ser Glu Val Trp Phe Asp Arg Arg Thr
Asn Tyr Thr Arg Ser Leu 1570 1575 1580 Ala Val Met Ser Met Val Gly
Tyr Ile Leu Gly Leu Gly Asp Arg His 1585 1590 1595 1600 Pro Ser Asn
Leu Met Leu Asp Arg Leu Ser Gly Lys Ile Leu His Ile 1605 1610 1615
Asp Phe Gly Asp Cys Phe Glu Val Ala Met Thr Arg Glu Lys Phe Pro
1620 1625 1630 Glu Lys Ile Pro Phe Arg Leu Thr Arg Met Leu Thr Asn
Ala Met Glu 1635 1640 1645 Val Thr Gly Leu Asp Gly Asn Tyr Arg Ile
Thr Cys His Thr Val Met 1650 1655 1660 Glu Val Leu Arg Glu His Lys
Asp Ser Val Met Ala Val Leu Glu Ala 1665 1670 1675 1680 Phe Val Tyr
Asp Pro Leu Leu Asn Trp Arg Leu Met Asp Thr Asn Thr 1685 1690 1695
Lys Gly Asn Lys Arg Ser Arg Thr Arg Thr Asp Ser Tyr Ser Ala Gly
1700 1705 1710 Gln Ser Val Glu Ile Leu Asp Gly Val Glu Leu Gly Glu
Pro Ala His 1715 1720 1725 Lys Lys Thr Gly Thr Thr Val Pro Glu Ser
Ile His Ser Phe Ile Gly 1730 1735 1740 Asp Gly Leu Val Lys Pro Glu
Ala Leu Asn Lys Lys Ala Ile Gln Ile 1745 1750 1755 1760 Ile Asn Arg
Val Arg Asp Lys Leu Thr Gly Arg Asp Phe Ser His Asp 1765 1770 1775
Asp Thr Leu Asp Val Pro Thr Gln Val Glu Leu Leu Ile Lys Gln Ala
1780 1785 1790 Thr Ser His Glu Asn Leu Cys Gln Cys Tyr Ile Gly Trp
Cys Pro Phe 1795 1800 1805 Trp <210> SEQ ID NO 13 <211>
LENGTH: 1794 <212> TYPE: DNA <213> ORGANISM: C.
albicans <400> SEQUENCE: 13 ttggtttacc ctttgacagt tgctattact
tccgaatcaa cgagccgtaa aaaggcagct 60 caatccatta ttgaaaaaat
gcgagtacat tctcctagct tggtggatca agcagaatta 120 gtgagtcgag
aactcatccg agttgcagtt ttatggcacg aacaatggca cgatgctttg 180
gaagatgcta gcaggttttt ctttggtgaa cacaacacag aaaagatgtt tgaaacattg
240 gaaccattac atcaaatgtt gcaaaaggga ccagaaacga tgagggaaca
agcctttgca 300 aatgcttttg gcagggagtt gacagatgca tacgagtggg
tgctcaactt tagaagaact 360 aaagacataa ccaatttgaa tcaagcatgg
gatatatact acaatgtctt tagaagagta 420 agcaaacagg tgcagctgtt
agctagtctt gagttgcagt atgtatctcc ggacttagag 480 catgctcaag
atttggaatt ggctgtacca ggtacttacc aagcaggcaa acctgtgatc 540
agaataatca aatttgatcc tactttttcg attatttcat ctaaacaaag accgagaaaa
600 ttatcgtgca gaggaagtga tggtaaagac taccaatatg cgttgaaagg
acatgaagat 660 atcagacaag ataacttagt gatgcaattg tttggtttgg
ttaatacgtt gttggtaaat 720 gatccggtat gtttcaagag acatttggat
atacaacaat atcctgctat tccattatca 780 ccaaaagtgg gattgcttgg
ttgggttcca aatagtgaca ctttccatgt attgatcaaa 840 ggctatcgcg
aatcaagaag tataatgttg aatattgaac acaggctttt gttgcaaatg 900
gcacctgatt atgatttctt gacattattg caaaaagttg aagtgttcac aagtgcaatg
960 gataattgta agggacagga tttgtacaaa gtgttatggc tcaaatctaa
atcatccgag 1020 gcgtggttgg accgtagaac aacatacacg agatcattag
ctgtaatgtc tatggttggg 1080 tatatattag gtttggggga taggcaccca
tcaaatttga tgttggaccg tattactggg 1140 aaagtcatcc atattgattt
cggagactgt tttgaagcag caatattacg tgagaagtat 1200 ccagagagag
ttccgtttag attgacgaga atgcttaatt atgccatgga agttagtgga 1260
atagagggct cgttcagaat cacatgtgaa catgttatga gggtgttgcg tgataataaa
1320 gagtctttaa tggcaatatt agaggccttt gcttacgatc ccttgataaa
ttgggggttt 1380 gatttcccaa caaaggcgtt ggctgaatca acgggtatac
gtgttccaca agtcaacact 1440 gcagaattat tacgcagagg acagattgac
gaaaaagaag ctgtaagatt gcaaaagcaa 1500 aatgaattgg aaataagaaa
cgctagagct gcattagtgt tgaaacgtat taccgataag 1560 ttaactggta
acgatatcaa acggttgaga ggattagatg tgcctactca agtcgataaa 1620
ttgattcaac aagccaccag tgttgagaat ttgtgtcagc attacattgg ttggtgttcg
1680 tgttggtagg ttgattatcg tcatgtgtcg ataagtatgg tattgtggta
actattttat 1740 aaagggaaat attaaagaat tgtatattat taaaaaaaaa
aaaaaaaact cgag 1794 <210> SEQ ID NO 14 <211> LENGTH:
562 <212> TYPE: PRT <213> ORGANISM: C. albicans
<400> SEQUENCE: 14 Leu Val Tyr Pro Leu Thr Val Ala Ile Thr
Ser Glu Ser Thr Ser Arg 1 5 10 15 Lys Lys Ala Ala Gln Ser Ile Ile
Glu Lys Met Arg Val His Ser Pro 20 25 30 Ser Leu Val Asp Gln Ala
Glu Leu Val Ser Arg Glu Leu Ile Arg Val 35 40 45 Ala Val Leu Trp
His Glu Gln Trp His Asp Ala Leu Glu Asp Ala Ser 50 55 60 Arg Phe
Phe Phe Gly Glu His Asn Thr Glu Lys Met Phe Glu Thr Leu 65 70 75 80
Glu Pro Leu His Gln Met Leu Gln Lys Gly Pro Glu Thr Met Arg Glu 85
90 95 Gln Ala Phe Ala Asn Ala Phe Gly Arg Glu Leu Thr Asp Ala Tyr
Glu 100 105 110 Trp Val Leu Asn Phe Arg Arg Thr Lys Asp Ile Thr Asn
Leu Asn Gln 115 120 125 Ala Trp Asp Ile Tyr Tyr Asn Val Phe Arg Arg
Val Ser Lys Gln Val 130 135 140 Gln Leu Leu Ala Ser Leu Glu Leu Gln
Tyr Val Ser Pro Asp Leu Glu 145 150 155 160 His Ala Gln Asp Leu Glu
Leu Ala Val Pro Gly Thr Tyr Gln Ala Gly 165 170 175 Lys Pro Val Ile
Arg Ile Ile Lys Phe Asp Pro Thr Phe Ser Ile Ile 180 185 190 Ser Ser
Lys Gln Arg Pro Arg Lys Leu Ser Cys Arg Gly Ser Asp Gly 195 200 205
Lys Asp Tyr Gln Tyr Ala Leu Lys Gly His Glu Asp Ile Arg Gln Asp 210
215 220 Asn Leu Val Met Gln Leu Phe Gly Leu Val Asn Thr Leu Leu Val
Asn 225 230 235 240 Asp Pro Val Cys Phe Lys Arg His Leu Asp Ile Gln
Gln Tyr Pro Ala 245 250 255 Ile Pro Leu Ser Pro Lys Val Gly Leu Leu
Gly Trp Val Pro Asn Ser 260 265 270 Asp Thr Phe His Val Leu Ile Lys
Gly Tyr Arg Glu Ser Arg Ser Ile 275 280 285 Met Leu Asn Ile Glu His
Arg Leu Leu Leu Gln Met Ala Pro Asp Tyr 290 295 300 Asp Phe Leu Thr
Leu Leu Gln Lys Val Glu Val Phe Thr Ser Ala Met 305 310 315 320 Asp
Asn Cys Lys Gly Gln Asp Leu Tyr Lys Val Leu Trp Leu Lys Ser 325 330
335 Lys Ser Ser Glu Ala Trp Leu Asp Arg Arg Thr Thr Tyr Thr Arg Ser
340 345 350 Leu Ala Val Met Ser Met Val Gly Tyr Ile Leu Gly Leu Gly
Asp Arg 355 360 365 His Pro Ser Asn Leu Met Leu Asp Arg Ile Thr Gly
Lys Val Ile His 370 375 380 Ile Asp Phe Gly Asp Cys Phe Glu Ala Ala
Ile Leu Arg Glu Lys Tyr 385 390 395 400 Pro Glu Arg Val Pro Phe Arg
Leu Thr Arg Met Leu Asn Tyr Ala Met 405 410 415 Glu Val Ser Gly Ile
Glu Gly Ser Phe Arg Ile Thr Cys Glu His Val 420 425 430 Met Arg Val
Leu Arg Asp Asn Lys Glu Ser Leu Met Ala Ile Leu Glu 435 440 445 Ala
Phe Ala Tyr Asp Pro Leu Ile Asn Trp Gly Phe Asp Phe Pro Thr 450 455
460 Lys Ala Leu Ala Glu Ser Thr Gly Ile Arg Val Pro Gln Val Asn Thr
465 470 475 480 Ala Glu Leu Leu Arg Arg Gly Gln Ile Asp Glu Lys Glu
Ala Val Arg 485 490 495 Leu Gln Lys Gln Asn Glu Leu Glu Ile Arg Asn
Ala Arg Ala Ala Leu 500 505 510 Val Leu Lys Arg Ile Thr Asp Lys Leu
Thr Gly Asn Asp Ile Lys Arg 515 520 525 Leu Arg Gly Leu Asp Val Pro
Thr Gln Val Asp Lys Leu Ile Gln Gln 530 535 540 Ala Thr Ser Val Glu
Asn Leu Cys Gln His Tyr Ile Gly Trp Cys Ser 545 550 555 560 Cys Trp
<210> SEQ ID NO 15 <211> LENGTH: 399 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 15
gttagtcacg agttgatcag agtagccgtt ctatggcacg aattatggta tgaaggactg
60 gaagatgcga gccgccaatt tttcgttgaa cataacatag aaaaaatgtt
ttctacttta 120 gaacctttac ataaacactt aggcaatgag cctcaaacgt
taagtgaggt atcgtttcag 180 aaatcatttg gtagagattt gaacgatgcc
tacgaatggt tgaataacta caaaaagtca 240 aaagacatca ataatttgaa
ccaagcttgg gatatttatt ataacgtctt cagaaaaata 300
acacgtcaaa taccacagtt acaaacctta gacttacagc atgtttctcc ccagcttctg
360 gctactcatg atctcgaatt ggctgttcct gggacatat 399 <210> SEQ
ID NO 16 <211> LENGTH: 133 <212> TYPE: PRT <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 16 Val Ser His Glu Leu
Ile Arg Val Ala Val Leu Trp His Glu Leu Trp 1 5 10 15 Tyr Glu Gly
Leu Glu Asp Ala Ser Arg Gln Phe Phe Val Glu His Asn 20 25 30 Ile
Glu Lys Met Phe Ser Thr Leu Glu Pro Leu His Lys His Leu Gly 35 40
45 Asn Glu Pro Gln Thr Leu Ser Glu Val Ser Phe Gln Lys Ser Phe Gly
50 55 60 Arg Asp Leu Asn Asp Ala Tyr Glu Trp Leu Asn Asn Tyr Lys
Lys Ser 65 70 75 80 Lys Asp Ile Asn Asn Leu Asn Gln Ala Trp Asp Ile
Tyr Tyr Asn Val 85 90 95 Phe Arg Lys Ile Thr Arg Gln Ile Pro Gln
Leu Gln Thr Leu Asp Leu 100 105 110 Gln His Val Ser Pro Gln Leu Leu
Ala Thr His Asp Leu Glu Leu Ala 115 120 125 Val Pro Gly Thr Tyr 130
<210> SEQ ID NO 17 <211> LENGTH: 399 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 17
gtcagccacg aattgatacg tatggcggtg ctttggcatg agcaatggta tgagggtctg
60 gatgacgcca gtaggcagtt ttttggagaa cataataccg aaaaaatgtt
tgctgcttta 120 gagcctctgt acgaaatgct gaagagagga ccggaaactt
tgagggaaat atcgttccaa 180 aattcttttg gtagggactt gaatgacgct
tacgaatggc tgatgaatta caaaaaatct 240 aaagatgtta gtaatttaaa
ccaagcgtgg gacatttact ataatgtttt caggaaaatt 300 ggtaaacagt
tgccacaatt acaaactctt gaactacaac atgtgtcgcc aaaactacta 360
tctgcgcatg atttggaatt ggctgtcccc gggacccgt 399 <210> SEQ ID
NO 18 <211> LENGTH: 133 <212> TYPE: PRT <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 18 Val Ser His Glu Leu
Ile Arg Met Ala Val Leu Trp His Glu Gln Trp 1 5 10 15 Tyr Glu Gly
Leu Asp Asp Ala Ser Arg Gln Phe Phe Gly Glu His Asn 20 25 30 Thr
Glu Lys Met Phe Ala Ala Leu Glu Pro Leu Tyr Glu Met Leu Lys 35 40
45 Arg Gly Pro Glu Thr Leu Arg Glu Ile Ser Phe Gln Asn Ser Phe Gly
50 55 60 Arg Asp Leu Asn Asp Ala Tyr Glu Trp Leu Met Asn Tyr Lys
Lys Ser 65 70 75 80 Lys Asp Val Ser Asn Leu Asn Gln Ala Trp Asp Ile
Tyr Tyr Asn Val 85 90 95 Phe Arg Lys Ile Gly Lys Gln Leu Pro Gln
Leu Gln Thr Leu Glu Leu 100 105 110 Gln His Val Ser Pro Lys Leu Leu
Ser Ala His Asp Leu Glu Leu Ala 115 120 125 Val Pro Gly Thr Arg 130
<210> SEQ ID NO 19 <211> LENGTH: 531 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: 59, 64,
72, 74, 89, 94, 101, 137, 158, 175, 190, 201, 207, 210, 213, 218,
234, 243, 257, 283, 286, 289, 292, 314, 325, 328, 335, 352, 361,
380, 384, 390, 393, 403, 411, 413, 427, 432, 435, 440, 443, 450,
452, 460, 465, 480, 482, 486 <223> OTHER INFORMATION: n =
A,T,C or G <221> NAME/KEY: misc_feature <222> LOCATION:
492, 515 <223> OTHER INFORMATION: n = A,T,C or G <400>
SEQUENCE: 19 tgaccctcac cccttccacc tatcccaaaa acctcactgg gtctgtggac
aaacaacana 60 aatnttttcc ananaggccc caaatgagnc ccangggtct
ntcttccatc agacccagtg 120 attctgcgac tcacacnctt caattcaaga
cctgaccnct agtagggagg tttantcaga 180 tcgctggcan cctcggctga
ncagatncan agnggggntc gctgttcagt gggnccaccc 240 tcnctggcct
tcttcancag gggtctggga tgttttcagt ggnccnaana cnctgtttag 300
agccagggct cagnaaacag aaaanctntc atggnggttc tggacacagg gnaggtctgg
360 nacatattgg ggattatgan cagnaccaan acnccactaa atnccccaag
nanaaagtgt 420 aaccatntct anacnccatn ttntatcagn anaaattttn
ttccnataaa tgacatcagn 480 antttnaaca tnaaaaaaaa aaaaaaaaaa
aaaanaaaaa aaaaaaaaaa a 531 <210> SEQ ID NO 20 <211>
LENGTH: 231 <212> TYPE: DNA <213> ORGANISM: Homo
sapiens <400> SEQUENCE: 20 gcgtataacg cgtttggaat cactacaggg
atgtttaata ccactacaat ggatgatgta 60 tataactatc tattcgatga
tgaagatacc ccaccaaacc caaaaaaaga gatctggaat 120 tcggatcctc
gagagatcta tgaatcgtag atactgaaaa accccgcaag ttcacttcaa 180
ctgtgcatcg tgcaccatct caatttcttt catttataca tcgttttgcc t 231
<210> SEQ ID NO 21 <211> LENGTH: 21 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide <400>
SEQUENCE: 21 tgaagatacc ccaccaaacc c 21 <210> SEQ ID NO 22
<211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: oligonucleotide <400> SEQUENCE: 22 tgcacagttg
aagtgaac 18 <210> SEQ ID NO 23 <211> LENGTH: 662
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: 27, 373, 443, 461, 483, 485, 507, 583, 588, 593, 605,
606, 607, 612, 624, 625, 626, 627, 628, 630, 631, 632, 635, 639,
646, 652, 659, 661 <223> OTHER INFORMATION: n = A,T,C or G
<400> SEQUENCE: 23 accaaaccca aaaaaagaga tcctagnaac
tagtggatcc cccgggctgc aggaattcgg 60 tacgagtcgc cctcagcaga
ctcgcccagg agaggaaagc atggaggaaa gaccacccat 120 ttggtttcgt
ggctgtccca acaaaaaatc ccgatggcac gatgaacctc atgaactggg 180
agtgcgccat tccaggaaag aaagggactc cgtgggaagg aggcttgttt aaactacgga
240 tgcttttcaa agatgattat ccatcttcgc caccaaaatg taaattcgaa
ccaccattat 300 ttcacccgaa tgtgtaccct tcggggacag tgtgcctgtc
catcttagag gaggacaagg 360 actggagggc agncatcaca atcaaacagg
atcctattag gaatacagga actttctaaa 420 tgaaccaaat atccaagacc
agntcaagca gagggctaca ngatttactg ccaaaacaga 480 gtngngtacg
agaaagggtc cgagcanagc cagaagtttg ggcctcatta gcagggacct 540
ggtggatcgt caaaggaggt ttggttggga agacttgttc aanatttngg aanttaagtt
600 gtccnnnaac tngcgggggg gggnnnnncn nnttnccant tccctncccc
cngtttttng 660 nt 662 <210> SEQ ID NO 24 <211> LENGTH:
119 <212> TYPE: PRT <213> ORGANISM: Homo sapiens
<220> FEATURE: <221> NAME/KEY: VARIANT <222>
LOCATION: 105 <223> OTHER INFORMATION: Xaa = Any Amino Acid
<400> SEQUENCE: 24 Val Arg Val Ala Leu Ser Arg Leu Ala Gln
Glu Arg Lys Ala Trp Arg 1 5 10 15 Lys Asp His Pro Phe Gly Phe Val
Ala Val Pro Thr Lys Asn Pro Asp 20 25 30 Gly Thr Met Asn Leu Met
Asn Trp Glu Cys Ala Ile Pro Gly Lys Lys 35 40 45 Gly Thr Pro Trp
Glu Gly Gly Leu Phe Lys Leu Arg Met Leu Phe Lys 50 55 60 Asp Asp
Tyr Pro Ser Ser Pro Pro Lys Cys Lys Phe Glu Pro Pro Leu 65 70 75 80
Phe His Pro Asn Val Tyr Pro Ser Gly Thr Val Cys Leu Ser Ile Leu 85
90 95 Glu Glu Asp Lys Asp Trp Arg Ala Xaa Ile Thr Ile Lys Gln Asp
Pro 100 105 110 Ile Arg Asn Thr Gly Thr Phe 115 <210> SEQ ID
NO 25
<211> LENGTH: 207 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: 112, 148, 158, 171, 178, 182, 191, 194, 203,
204 <223> OTHER INFORMATION: n = A,T,C or G <400>
SEQUENCE: 25 ccctccctcc tgccgctcct ctctagaacc ttctagaacc tgggctgtgc
tgcttttgag 60 cctcagaccc cagggcagca tctcggttct gcgccacttc
ctttgtgttt anatggcgtt 120 ttgtctgtgt tgctgtttag agtagatnaa
ctgtttanat aaaaaaaaaa naaaattnac 180 tngagggggc ntgnaggcat gcnnaac
207 <210> SEQ ID NO 26 <211> LENGTH: 21 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: oligonucleotide <400>
SEQUENCE: 26 gaagaggcaa gacgcttgta c 21 <210> SEQ ID NO 27
<211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 27 gtacaagcgt cttgcctctt c 21
<210> SEQ ID NO 28 <211> LENGTH: 19 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide <400>
SEQUENCE: 28 gagtttgagc agatgttta 19 <210> SEQ ID NO 29
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: oligonucleotide <221> NAME/KEY: misc_feature
<222> LOCATION: 3, 9, 15 <223> OTHER INFORMATION: n =
A,T,C or G <400> SEQUENCE: 29 ggnaargcnc ayccncargc 20
<210> SEQ ID NO 30 <211> LENGTH: 23 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide <221>
NAME/KEY: misc_feature <222> LOCATION: 3, 6, 21 <223>
OTHER INFORMATION: n = A,T,C or G <400> SEQUENCE: 30
atngcnggrt aytgytgdat ntc 23 <210> SEQ ID NO 31 <211>
LENGTH: 26 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
oligonucleotide <400> SEQUENCE: 31 grgayttraw bgabgchyam
gawtgg 26 <210> SEQ ID NO 32 <211> LENGTH: 35
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
<400> SEQUENCE: 32 caagcbtggg aymtymtyta ytatmaygtb ttcag 35
<210> SEQ ID NO 33 <211> LENGTH: 22 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide <400>
SEQUENCE: 33 gayybgartt ggctgtbcch gg 22 <210> SEQ ID NO 34
<211> LENGTH: 327 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 34 atgtccgtac aagtagaaac
catctcccca ggagacgggc gcaccttccc caagcgcggc 60 cagacctgcg
tggtgcacta caccgggatg cttgaagatg gaaagaaatt tgattcctcc 120
cgtgaccgta acaagccctt taagtttatg ctaggcaagc aggaggtgat ccgaggctgg
180 gaagaagggg ttgcccagat gagtgtgggt cagcgtgcca aactgactat
atctccagat 240 tatgcctatg gtgccactgg gcacccaggc atcatcccac
cacatgccac tctcgtcttc 300 gatgtggagc ttctaaaact ggaatga 327
<210> SEQ ID NO 35 <211> LENGTH: 31 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide <400>
SEQUENCE: 35 gagatctgga attcggatcc tcgagagatc t 31
* * * * *