U.S. patent application number 12/828739 was filed with the patent office on 2011-03-17 for cdna construct of salmonidae alphavirus.
This patent application is currently assigned to Institut National de la Recherche Agronomique. Invention is credited to Michel Bremont, Monique LEBERRE, Coralie Moriette.
Application Number | 20110064767 12/828739 |
Document ID | / |
Family ID | 35809739 |
Filed Date | 2011-03-17 |
United States Patent
Application |
20110064767 |
Kind Code |
A1 |
LEBERRE; Monique ; et
al. |
March 17, 2011 |
CDNA CONSTRUCT OF SALMONIDAE ALPHAVIRUS
Abstract
The invention concerns recombinant DNA's comprising c NDA of
genomic RNA of a Salmonidae alphavirus preceded by a spacer
sequence, under the control of a suitable promoter. Said
recombinant DNA's are useful for obtaining expression vectors,
producing recombinant Salmonidae alphavirus, and for obtaining
vaccines.
Inventors: |
LEBERRE; Monique;
(Montigny-le Bretonneux, FR) ; Moriette; Coralie;
(Le Perreux Sur Marne, FR) ; Bremont; Michel;
(Choisy Le Roi, FR) |
Assignee: |
Institut National de la Recherche
Agronomique
Paris
FR
|
Family ID: |
35809739 |
Appl. No.: |
12/828739 |
Filed: |
July 1, 2010 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11993676 |
Jul 8, 2008 |
|
|
|
PCT/FR2006/001405 |
Jun 21, 2006 |
|
|
|
12828739 |
|
|
|
|
Current U.S.
Class: |
424/204.1 ;
435/235.1; 435/91.1 |
Current CPC
Class: |
C12N 2770/36121
20130101; C12N 15/1131 20130101; C12N 2770/36134 20130101; A61P
31/14 20180101; C12N 7/00 20130101; C12N 2770/36122 20130101; A61K
2039/552 20130101; A61K 2039/53 20130101; C12N 2310/127 20130101;
A61K 39/12 20130101; A61P 37/02 20180101; C12N 2310/121 20130101;
C07K 14/005 20130101; C12N 2770/36151 20130101; A61P 31/20
20180101; C12N 15/86 20130101; A61P 31/12 20180101 |
Class at
Publication: |
424/204.1 ;
435/235.1; 435/91.1 |
International
Class: |
A61K 39/12 20060101
A61K039/12; C12N 7/00 20060101 C12N007/00; A61P 31/14 20060101
A61P031/14; C12P 19/34 20060101 C12P019/34 |
Foreign Application Data
Date |
Code |
Application Number |
Jun 21, 2005 |
FR |
0506275 |
Claims
1. A method for preparing a Salmonidae alphavirus RNA replicon,
comprising introducing a recombinant DNA in to a host cell and
culturing said host cell, wherein the recombinant DNA is derived
from a genome of a Salmonidae alphavirus and comprises: a
transcription promoter and, downstream of said promoter and under
transcriptional control thereof; a spacer sequence of at least 5
nucleotides; and a cDNA of a genomic RNA of a Salmonidae
alphavirus, and the spacer sequence is defined by general formula
(I): TABLE-US-00005 (SEQ ID NO: 29) 5'
X.sub.1CTGANGARX.sub.2B.sub.2X'.sub.2YGAAAX.sub.3B.sub.3X'.sub.3TH
3' (I)
in which A, T, G, and C have their usual meaning; H represents C, T
or A; R represents A or G; Y represents C or T; N represents A, T,
G or C; X.sub.1 represents an oligonucleotide of at least 3
nucleotides, preferably from 6 to 10 nucleotides, of sequence
complementary to that of the 5' end of the genome of said
alphavirus; X.sub.2 represents an oligonucleotide of at least 3
nucleotides, preferably from 3 to 5 nucleotides, of any sequence;
B.sub.2 represents an oligonucleotide of 4 or 5 nucleotides, of any
sequence; X'.sub.2 represents an oligonucleotide complementary to
X.sub.2; X.sub.3 represents an oligonucleotide of at least 2
nucleotides, preferably of 6 to 10 nucleotides, of any sequence;
B.sub.3 represents an oligonucleotide of 4 to 5 nucleotides, of any
sequence; X'.sub.3 represents an oligonucleotide complementary to
X.sub.3.
2. A Salmonidae alphavirus RNA replicon obtained by the method
according to claim 1.
3. A method for preparing a recombinant Salmonidae alphavirus,
comprising introducing a recombinant DNA or an RNA replicon into a
host cell in which all structural proteins of said alphavirus that
are required for encapsidation are expressed, and culturing said
host cell wherein the recombinant DNA is derived from a genome of a
Salmonidae alphavirus and comprises: a transcription promoter and,
downstream of said promoter and under transcriptional control
thereof; a spacer sequence of at least 5 nucleotides; and a cDNA of
a genomic RNA of a Salmonidae alphavirus, and the spacer sequence
is defined by general formula (I): TABLE-US-00006 (SEQ ID NO: 29)
5'
X.sub.1CTGANGARX.sub.2B.sub.2X'.sub.2YGAAAX.sub.3B.sub.3X'.sub.3TH
3' (I)
in which A, T, G, and C have their usual meaning; H represents C, T
or A; R represents A or G; Y represents C or T; N represents A, T,
G or C; X.sub.1 represents an oligonucleotide of at least 3
nucleotides, preferably from 6 to 10 nucleotides, of sequence
complementary to that of the 5' end of the genome of said
alphavirus; X.sub.2 represents an oligonucleotide of at least 3
nucleotides, preferably from 3 to 5 nucleotides, of any sequence;
B.sub.2 represents an oligonucleotide of 4 or 5 nucleotides, of any
sequence; X'.sub.2 represents an oligonucleotide complementary to
X.sub.2; X.sub.3 represents an oligonucleotide of at least 2
nucleotides, preferably of 6 to 10 nucleotides, of any sequence;
B.sub.3 represents an oligonucleotide of 4 to 5 nucleotides, of any
sequence; X'.sub.3 represents an oligonucleotide complementary to
X.sub.3, or introducing the RNA replicon according to claim 5 into
a host cell in which all structural proteins of said alphavirus
that are required for encapsidation are expressed, and culturing
said host cell.
4. The method according to claim 3, wherein all genetic information
for the expression of said structural proteins is carried by said
recombinant DNA or said RNA replicon.
5. The method according to claim 3, wherein all or part of genetic
information for the expression of said structural proteins is
provided in trans by the host cell.
6. A recombinant Salmonidae alphavirus obtained by a method
according to claim 3.
7. A method for obtaining a vaccine, incorporating a recombinant
Salmonidae alphavirus according to claim 6 into the vaccine.
8. A vaccine comprising a Salmonidae alphavirus RNA replicon
according to claim 2.
9. A vaccine comprising a recombinant Salmonidae alphavirus
according to claim 6.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a divisional application of prior U.S.
patent application Ser. No. 11/993,676, the disclosure of which is
incorporated by reference in its entirety. U.S. Ser. No. 11/993,676
is National Stage of PCT/FR2006/001405 filed on Jun. 21, 2006 which
claims the benefit of priority from prior French Patent Application
No. 05 06275, filed Jun. 21, 2005, the entire contents of which is
incorporated herein by reference.
[0002] The present invention relates to the obtaining of infectious
cDNAs of Salmonidae alphavirus, and to the uses of these cDNAs.
[0003] Alphaviruses are enveloped, positive-strand RNA viruses of
the Togaviridae family.
[0004] Two representatives of Salmonidae alphaviruses are currently
known: the sleeping disease virus (SDV), which is pathogenic for
trout, and the pancreas disease virus (PDV), which is pathogenic
for salmon. These two viruses, which are genetically very close,
have been assigned to the alphavirus family on the basis of the
similarity of the organization of their genome with that of the
known alphaviruses; however, their nucleotide sequence, and also
the polypeptide sequence which is deduced therefrom, exhibit only a
low degree of homology with the other alphaviruses (VILLOING et
al., J. Virol. 74, 173-183, 2000; WESTON et al., Virology, 256,
188-195, 1999; WESTON et al., J. Virol. 76, 6155-63, 2002); they
are therefore considered to represent an alphavirus subgroup
different from the mammalian alphaviruses.
[0005] The alphavirus genome encodes 2 polyproteins: the 5' portion
of the coding sequence, which represents approximately two thirds
thereof, encodes a polyprotein which, after proteolytic cleavage,
gives the nonstructural proteins (nsP) nsP1, nsP2, nsP3 and nsP4,
involved in replication of the virus; the end third of the genome
encodes a polyprotein whose proteolytic cleavage produces the
structural proteins (Struct): the capsid protein (C) and 2 envelope
glycoproteins (E3-E2 and 6K-E1). The coding regions for the nsPs
and the Structs are separated by a noncoding region called junction
region (J). Two noncoding regions are also present at the 5' and 3'
ends of the genome. This genome also has a cap at the 5' end and a
polyA tail at the 3' end (STAUSS and STRAUSS, Microbiol. Rev., 58,
491-562, 1994).
[0006] In the Salmonidae alphaviruses, this genomic organization is
conserved: the main differences with the genome of the other
alphaviruses are, in addition to the low coding sequence homology,
the size of the 5' and 3' noncoding regions, which are shorter in
the Salmonidae alphaviruses.
[0007] The pathologies caused by SDV and PDV currently constitute
an increasing problem for salmon farming. These viruses are now
becoming endemic in Europe and have made their appearance on the
North American continent.
[0008] The method of protecting the Salmonidae against these viral
agents lies in the use of vaccines. Immunization can be carried out
in various ways, depending on the species and the age of the fish
to be immunized. It may be carried out, for example, by balneation.
This immunization approach, which is very effective and relatively
inexpensive, is the method of choice for immunization with live
attenuated viruses. The immunization can also be carried out by
injection of live attenuated viruses, or of inactivated viruses.
Although it is more expensive than immunization by balneation, this
method can be used for immunizing fish of 10 grams or more, and is
thus in particular suitable for the immunization of species such as
sea trout or salmon. Advantageously, it is also possible to combine
a primary immunization by balneation in the presence of live
attenuated viruses with a booster immunization by injection of live
attenuated viruses or of inactivated viruses.
[0009] Manipulation of the genome of RNA viruses, in particular in
order to generate attenuated strains, requires the availability of
an infectious cDNA system, i.e. of a complete DNA copy of the RNA
genome of these viruses (approximately 12000 bases), capable of
being transcribed in a host cell so as to generate a viral RNA that
can replicate in this cell.
[0010] Conventionally, in order to produce an infectious cDNA for
alphaviruses, the cDNA of the complete viral genome, fused at the
5' end to an SP6 or T7 promoter sequence, is cloned into a plasmid.
This plasmid construct is cleaved at the 3' end with a restriction
enzyme, and then used in an in vitro transcription system in order
to synthesize a genomic RNA using SP6 or T7 RNA polymerase. This
RNA is transfected into cells sensitive to the virus in question.
After a few days, newly formed virus is released into the culture
supernatant. It has thus been possible to obtain infectious cDNAs
for a large number of alphaviruses, for example for SV (Sindbis
virus; RICE et al., J. Virol, 61, 3809-3819, 1987), SFV (Semliki
Forest Virus; LILJESTROM et al., J. Virol, 65, 4107-4113, 1991),
the VEE virus (Venezuelan equine encephalitis virus; DAVIS et al.,
Virology, 171, 189-204, 1989) and the EEE virus (eastern equine
encephalitis virus; SCHOEPP et al., Virology, 302, 299-309,
2002).
[0011] However, in the case of Salmonidae alphaviruses, the
attempts made to generate an infectious cDNA using this approach
have failed.
[0012] The inventors have discovered that this problem can be
solved by introducing a random additional sequence, acting as a
spacer, between the SP6 or T7 promoter and the start of the viral
genome. The addition of this sequence makes it possible to
generate, in vitro, a genomic RNA which, by transfection into fish
cells, allows the synthesis of the nonstructural proteins.
[0013] To generate an infectious RNA, the inventors have replaced
the random sequence acting as spacer with a hammerhead ribozyme
sequence. They have observed that the RNA neosynthesized from this
construct is accurately cleaved at the first nucleotide of the
genomic RNA of the alphavirus. The RNA thus obtained has the
ability to synthesize the nsP proteins, to be replicated, to allow
the synthesis of a subgenomic RNA encoding the structural proteins,
and, finally, to be encapsidated so as to generate infectious viral
neoparticles.
[0014] The inventors have also used this construct to insert a
heterologous sequence, under the control of the subgenomic promoter
of SDV. They have observed that this sequence is expressed in the
cells infected with the construct, and that the viral genome
comprising this sequence can be encapsidated normally in the viral
particles.
[0015] A subject of the present invention is a recombinant DNA
derived from the genome of a Salmonidae alphavirus, and comprising:
[0016] a transcription promoter and, downstream of said promoter
and under transcriptional control thereof; [0017] a spacer sequence
of at least 5 nucleotides, preferably from 10 to 100 nucleotides;
[0018] the cDNA of the genomic RNA of a Salmonidae alphavirus.
[0019] The transcription promoter may be any promoter recognized by
an RNA polymerase expressed in the host cell. It may, for example,
be a bacteriophage promoter, such as the T7 promoter, the T3
promoter or the SP6 promoter; in this case, the recombinant DNA in
accordance with the invention must be used in combination with a
construct expressing an RNA polymerase which recognizes this
promoter.
[0020] A promoter recognized by an endogenous RNA polymerase of the
host cell, in particular by RNA polymerase II, may also be used. It
may be a viral promoter, for example one of those normally used for
the expression of heterologous genes in mammalian cells, such as
the CMV (cytomegalovirus) promoter, the RSV (Rous Sarcoma Virus)
promoter, the SV40 early promoter, the MoMLV (Moloney Murine
Leukemia Virus) promoter, etc; it may also be a eukaryotic
promoter, for example a fish promoter, such as that described by
ALONSO et al. (Vaccine, 21, 1591-100, 2003).
[0021] The function of the spacer sequence is to distance the
promoter from the start of the alphavirus genome; its sequence is
not therefore essential for the implementation of the present
invention. As regards its length, the inventors have observed that
a sequence of 6 nucleotides can confer sufficient spacing.
Generally, it will be preferred to use a longer sequence, of
approximately 10 to 100 nucleotides, and preferably from 50 to 100
nucleotides.
[0022] Highly advantageously, a spacer sequence which allows the
insertion of a hammerhead ribozyme at the 5' end of the genomic RNA
will be used.
[0023] Hammerhead ribozymes are small ribozymes (generally of
approximately 40 to 80 nucleotides) which have in common a
secondary structure made up of 3 helices, the size and the sequence
of which can vary, connected by a conserved central core which is
essential for the catalytic activity (RUFFNER et al., Biochemistry,
29, 10695-10702, 1990).
[0024] A sequence which allows the insertion of a hammerhead
ribozyme at the 5' end of the genomic RNA of a Salmonidae
alphavirus can be defined by general formula (I) herein after:
TABLE-US-00001 (SEQ ID NO: 25) 5'
X.sub.1CTGANGARX.sub.2B.sub.2X'.sub.2YGAAAX.sub.3B.sub.3X'.sub.3TH
3' (I)
in which A, T, G, and C have their usual meaning; H represents C, T
or A; R represents A or G; Y represents C or T; N represents A, T,
G or C; X.sub.1 represents an oligonucleotide of at least 3
nucleotides, preferably from 6 to 10 nucleotides, of sequence
complementary to that of the 5' end of the genome of said
alphavirus; X.sub.2 represents an oligonucleotide of at least 3
nucleotides, preferably from 3 to 5 nucleotides, of any sequence;
B.sub.2 represents an oligonucleotide of 4 or 5 nucleotides, of any
sequence; X'.sub.2 represents an oligonucleotide complementary to
X.sub.2; X.sub.3 represents an oligonucleotide of at least 2
nucleotides, preferably of 6 to 10 nucleotides, of any sequence;
B.sub.3 represents an oligonucleotide of 4 to 5 nucleotides, of any
sequence; X'.sub.3 represents an oligonucleotide complementary to
X.sub.3.
[0025] In order to ensure correct termination of the alphavirus RNA
when a bacteriophage promoter is used, the recombinant DNA in
accordance with the invention will also comprise, conventionally,
the transcription terminator which corresponds to the promoter
used. When a promoter recognized by an endogenous RNA polymerase of
the host cell is used, a polyA tail, fused to the 3' end of the
viral genome, is used.
[0026] The recombinant DNAs in accordance with the invention can be
readily constructed from the cDNA obtained by reverse transcription
of the genomic RNA of the Salmonidae alphavirus chosen. If desired,
various modifications can be made to this cDNA, according to the
use envisioned for the recombinant DNA in accordance with the
invention. This may, for example, involve the introduction of one
or more restriction sites, the deletion of portions of the viral
genome, in particular of portions not required for its replication
(for example, all or part of the region encoding the structural
proteins), the duplication of viral sequences, the insertion of
heterologous sequences, etc. It may also involve mutations whose
effects on the properties of these alphaviruses, for example on
their infectious capacity, their pathogenicity of their
antigenicity, it is desired to test.
[0027] The expressions "cDNA of the genomic RNA of a Salmonidae
alphavirus" or "cDNA of a Salmonidae alphavirus", used here, should
be interpreted as encompassing both the cDNA obtained by reverse
transcription of the genomic RNA of said alphavirus, and the cDNA
modified as indicated above.
[0028] The present invention thus makes it possible to carry out
the manipulation of the Salmonidae alphavirus genome, with a view
to various applications, and to produce, in large amounts and
reproducibly, the Salmonidae alphaviruses thus obtained.
[0029] The present invention makes it possible in particular to
construct, from Salmonidae alphaviruses, expression vectors of
structure similar to those already constructed from other
alphaviruses (for review, cf., for example, FROLOV et al., Proc.
Natl. Acad. Sci. USA, 93, 11371-11377, 1996). These expression
vectors may be of two main types: [0030] vectors capable of
replicating, of expressing the heterologous sequence which is
inserted therein, and of becoming encapsidated so as to produce new
viral particles. These vectors are generally obtained from the
complete genome of an alphavirus by inserting into the latter the
heterologous sequence of interest placed under the control of a
copy of the subgenomic promoter; [0031] vectors capable of
replicating and of expressing the heterologous sequence which is
inserted therein, but incapable of producing new viral particles.
These vectors are generally obtained by replacing the region of the
alphavirus genome encoding the structural proteins with the
heterologous sequence of interest. The encapsidation of the virus
can only take place if the structural proteins are provided in
trans in the host cells, for example due to the introduction into
said cells of helper vectors expressing these proteins, or due to
the use, as host cells, of cell lines stably transformed with
expression cassettes expressing these proteins.
[0032] Recombinant DNAs in accordance with the invention can thus
be used for the expression of a heterologous sequence of interest
under the control of a subgenomic promoter of a Salmonidae
alphavirus. In this case, the Salmonidae alphavirus cDNA insert
contains one or more expression cassette(s), each of which
contains: a copy of said subgenomic promoter and, downstream of
said subgenomic promoter and under the transcriptional control
thereof, a heterologous sequence that it is desired to express, or
a cloning site for the insertion of this sequence.
[0033] The subgenomic promoter of alphaviruses is recognized by the
nsP complex, and controls the transcription of the genes encoding
the structural proteins. In Salmonidae alphaviruses, this promoter
is located in the region of the genome comprising the end of the
sequence encoding nsp4, and the junction region (in the case of
SDV, this promoter is located in the region corresponding to
nucleotides 7686-7846 of the genome, comprising the last 124
nucleotides of the sequence encoding nsp4, and the junction
region).
[0034] The heterologous sequence may be a sequence encoding a
protein of interest, or else a sequence transcribed into an RNA of
interest, for example an antisense RNA or an interfering RNA.
[0035] A subject of the present invention is also a method for
obtaining an RNA of a Salmonidae alphavirus, characterized in that
it comprises the introduction of a construct in accordance with the
invention into an appropriate host cell, and the culturing of said
host cell.
[0036] The host cells that can be used in the context of the
present invention are preferably fish cells; by way of nonlimiting
examples, mention will be made of BF-2 (ATCC CCL-91), CHSE214 (ATCC
CCL55) or RTG-2 (ATCC CRL-1681) cells. If necessary, these cells
are transformed, transiently or stably, with a construct expressing
an RNA polymerase which recognizes the promoter used for the
construction of the recombinant DNA in accordance with the
invention.
[0037] The subject of the present invention is also a method for
obtaining a Salmonidae alphavirus RNA replicon, characterized in
that it comprises the introduction, into an appropriate host cell,
of a recombinant DNA in accordance with the invention in which the
spacer sequence is a hammerhead ribozyme sequence defined by
general formula (I), and the culturing of said host cell.
[0038] The term: "RNA replicon" here defines an RNA molecule
capable of replicating autonomously in a host cell.
[0039] For the production of recombinant alphaviruses, it is
necessary for all of the structural proteins required for
encapsidation to also be expressed in the host cell. This
expression can be carried out in cis (all the genetic information
required for the expression of these proteins is carried by the
alphavirus RNA replicon), or else in trans (the alphavirus RNA
replicon does not carry all the genetic information required for
the expression of these proteins, and the genetic information that
is missing is provided by the host cell).
[0040] If the recombinant DNA in accordance with the invention
contains all the genetic information required for encapsidation,
the RNA replicon produced can be encapsidated in the host cell, so
as to produce recombinant Salmonidae alphaviruses capable of
penetrating into other cells, of replicating their genome and of
becoming encapsidated in said cells autonomously. Such viruses are
defined here as "infectious viruses".
[0041] If the recombinant DNA in accordance with the invention does
not contain all the genetic information required for encapsidation
(in particular if it lacks all or part of the region encoding the
structural proteins), the RNA replicon produced cannot become
encapsidated in the host cell, unless said cell provides, in trans,
the genetic information for complementing the deficient
encapsidation function (for example, if it is transformed,
transiently or stably, with a construct expressing the missing
structural proteins). In the latter case, recombinant Salmonidae
alphaviruses can be produced in this host cell. They are capable of
penetrating into other cells and of replicating their genome in
said cells, but may become encapsidated therein only if, like the
initial host cell, said cells can trans-complement the deficient
encapsidation function. Such viruses are defined here as "abortive
viruses".
[0042] The subject of the present invention is also the
transcripts, and also the Salmonidae alphavirus RNA replicons and
the infectious or abortive recombinant Salmonidae alphaviruses,
that can be obtained, as described above, from the recombinant DNAs
in according to the invention.
[0043] The present invention encompasses more particularly the RNA
replicons, and the recombinant Salmonidae alphaviruses, that can be
obtained from recombinant DNAs in accordance with the invention in
which one or more modifications have been introduced, as indicated
above, into the cDNA of the alphavirus.
[0044] The recombinant expression DNAs, the RNA expression
replicons and the recombinant expression Salmonidae alphaviruses in
accordance with the invention can be used to obtain vaccines, for
example to obtain attenuated or inactivated Salmonidae alphavirus
vaccinal strains.
[0045] A subject of the present invention is also the vaccines
comprising a recombinant DNA, an RNA replicon or a recombinant
Salmonidae alphavirus in accordance with the invention, or that can
be obtained therefrom. These vaccines can be used in particular for
protecting Salmonidae against alphavirus infections.
[0046] The present invention will be understood more clearly from
the further description which follows, which refers to nonlimiting
examples illustrating the obtaining of a recombinant DNA, of RNA
replicons and of recombinant viruses in accordance with the
invention, from SDV.
EXAMPLES
Viruses and Cells
[0047] The viruses used in the examples which follow are derived
from the S49P strain of SDV, previously described (CASTRIC et al.,
Bulletin of the European Association of Fish Pathologists, 17,
27-30, 1997).
[0048] These viruses are propagated on monolayer cultures of BF-2
cells, cultured at 10.degree. C. in Eagle's minimum essential
medium (EMEM, Sigma FRANCE) buffered at pH 7.4 with Tris-HC1 and
supplemented with 10% fetal calf serum. In order to obtain a better
yield during the transfections, the BF-2 cells used are derived
from subclones selected on the basis of their ability to be
efficiently transfected.
[0049] This selection was carried out as follows:
[0050] BF-2 cells were cultured in a 96-well plate, at a rate of
one cell per well. After one month, 24 of the clones thus obtained
were selected randomly, and amplified in two 12-well plates. Each
of these clones was transfected with a test plasmid (pcDNA3-G),
obtained by insertion of the sequence encoding the glycoprotein G
of the VHSV virus (Viral Haemorrhagic Septicaemia Virus) into the
vector pcDNA3 (InVitrogen), downstream of the CMV promoter and of
the T7 promoter. The efficiency of the transfection was determined
by evaluating the level of expression of the glycoprotein G under
the control of the CMV promoter, by immuno-fluorescence, using an
antibody directed against this protein.
[0051] The eleven clones in which the fluorescence was the
strongest were selected and amplified. Each of these clones was
again tested, as indicated above, for its ability to be transfected
with pcDNA3-G, but, this time, after prior infection with vTF7-3
(FUERST et al., Proc. Natl. Acad. Sci. USA 83, 8122-8126, 1986),
and by evaluating the level of expression of the glycoprotein G
under the control of the T7 promoter. Finally, 5 clones were
selected for their ability to be infected with vTF7-3, combined
with their ability to be transfected efficiently.
Amplification Primers:
[0052] The sequences of the primers used in the examples which
follow are indicated in Table I hereinafter.
TABLE-US-00002 TABLE 1 Restriction SEQ Primer Sequence (5'-3')*
site ID NO: P1 CCGAATTCGTTAAATCCAAAAGCATACATATATCAATGATGC EcoRI 1
P2 CCCGGGGCGGCCCCAAGGTCGAGAACTGAGTTG SmaI 2 P3
CCCCGGGAGGAGTGACCGACTACTGCGTGAAGAAG SmaI 3 P4
GGTCTAGAGTATGATGCAGAAAATATTAAGG XbaI 4 P5
CCTCTAGACCAACCATGTTTCCCATGCAATTCACC XbaI 5 P6
CCGCGGCCGCATTGAAAATTTTAAAAACCAATAGATGACTCA NotI 6 5'RIBO
GGATCCTGGATTTATCCTGATGAGTCCGTGAGGACGAAACTATAGGAAAGGAATTCCTATAGTC
BamHI 7 GATAAATCCAAAAGC 3'RIBO
GCCGGCGGAAGGGTTAGCTGTGAGATTTTGCATCATTGATATATGTATGCTTTTGGATTTATCG
NaeI 8 ACTATAGGAATTCCTT 5'SanD1 CCTCGTCAGCGGGACCCATAATGCC SanDI 9
3'.DELTA.XbalBlpl CCGCTGAGCGGTTGGTTGAGAGTATGATGC BlpI 10 5'GFP
CCAACCGCTGAGCATGGTGAGCAAGGGCGAGG BlpI 11 3'GFP
GTGGCTAACGGCAGGTGATTCACGCTTAAGCTCGAGATCTGAGTCCG -- 12 5'nsp4
GCGTGAATCACCTGCCGTTAGCCACAATGGCGATGGCCACGCTCG -- 13 3'Jun
CCATGCTGAGCGGTTGGTTGAGAGTATGATGC BlpI 14 nsP4-F
CCATGCTGAGCGGTTGGTTGAGAGTATGATGC -- 15 5'ProGFP
ATCGATGAACGATATCGGCCGCCGCTACACGCTATGGCG EcoV 16 3'ProGFP
CCGGAATGCTAGCTTAAGCTCGAGATCTGAGTCCG NheI 17 3'UTR
CGAGCTTAAGCTAGCATTCCGGTATACAAATCGC NheI 18 T7t
GGCTAGGTCGGCGGCCGCAAAAAACCCCTCAAGACCCG NotI 19 GSP1
CCGCCGAGTCGCTCCAGTTGGCG -- 20 GSP2 CGGGTTCTCCAGGACGTCCTTCAAG -- 21
5'RACEseq GGCGGCGGCATGGTCGTTGGACGACCGG -- 22 Cap-R
GGCGGCGGCATGGTCGTTGGACGACCGG -- 23 GFP-R TTAAGCTCGAGATCTGAGTCCGGAC
-- 24 The restriction sites are underlined. The sequences in
italics are part of the nsP4 sequence and the sequences indicated
in bold are part of the GFP sequence.
Example 1
Cloning of the Complete SDV Genome
[0053] A whole SDV cDNA construct, pBS-VMS, was obtained from cDNA
fragments (numbered 1 to 3) covering the complete SDV genome,
obtained from the previously published sequence (VILLOING et al.,
2000; WESTON et al., 2002, mentioned above; GENBANK accession
number: NC.sub.--003433.1/GI:19352423). Each fragment was amplified
by reverse transcription followed by PCR (RT-PCR) using the SDV
genomic RNA as template. The RNA was extracted using the QIAamp
viral RNA purification kit (Qiagen), from the PEG-concentrated
supernatants of SDV-infected cells. The primers (P1 to P6) used for
the reverse transcription and the PCR amplification are given in
Table 1.
[0054] The cDNA fragments obtained were ligated to one another and
assembled at the multiple cloning site of the pBlueScript plasmid
using the EcoRI, SmaI, XbaI and NotI restriction sites. The plasmid
obtained is represented in FIG. 1.
[0055] As indicated in FIG. 1, an XbaI restriction site was
introduced artificially so as to facilitate subsequent cloning
steps. The sequencing of the pBS-VMS construct demonstrated 42
variations compared with the published sequence. These variations
are listed in table II hereinafter, and indicated by the letters (a
to x) on the pBS-VMS construct represented in FIG. 1. The sequences
in FIG. 1 are disclosed as SEQ ID NO: 26 and 30, respectively, in
order of appearance.
[0056] Among them, 8 chance mutations were corrected as follows:
various portions of the SDV RNA genome corresponding to the regions
of the cDNA genome containing the mutations were re-amplified by
RT-PCR. Each PCR product was sequenced and, if its sequence was
correct, was inserted in place of its homolog into the pBS-VMS
construct using the appropriate restriction sites and standard
technology (SAMBROOK et al., Molecular cloning: a laboratory
manual, 2nd ed. Cold Spring Harbor Laboratory Press. Cold Spring
Harbor, N.Y., 1989). With the exception of the XbaI restriction
site, the final pBS-VMS construct contains an exact cDNA copy of
the SDV RNA genome.
TABLE-US-00003 TABLE II Position (nt) Nucleotide* Amino acid* 5'UTR
2 a T? A nsP1 35 b T? A L? Q 1123 c G? A D? N 1519 d G? A G? R 1531
d C? A L? I nsP2 1958 C? A A? D 2345 G? A G? E 2477 A? G E? G 2669
T? C L? P 3728 e G? C R? P 3934 f CG? GT R? V 3938 f G? T R? L 3941
f C? T S? F nsP3 5084 C? T P? L 5095 A? G I? V nsP4 6107 g T? C L?
P 6392 T? A F? Y 6471 h A? C E? D 6505 i A? G K? E 7467 j A? C E? D
jun 7836 CA? AG Capsid 8337 k T? A F? I 8383 l T? A V? D 8415 m T?
A C? S 8469 n G? T G? W 8482 o A? C N? T 8486 o T? -- Frameshift
8490 o G? -- 8504 p T? G 8506 p T? C 8510 p T? A 8539 q G? --
8553-55 r CcA? GcC P? A 8556 r T? A F? I E2 9310 s C? T T? M 9937 t
T? G L? W 6K 10422 u GCG? AGC A? S E1 10858 A? G E? G 11709 v A? G
R? G 11722 w A? -- Frameshift 11739 w T? -- 11751 x G? -- *The
first position corresponds to the published sequence; the second
position corresponds to the cDNA sequence determined in the present
study. The accidental mutations that were corrected are indicated
in bold. The letters (a-x) refer to FIG. 1
Example 2
Construction of a Genomic RNA Allowing the Synthesis of the
Nonstructural SDV Proteins in Fish Cells, and of an SDV Replicon
Expressing GFP and Luciferase
[0057] The SDV cDNA insert was transferred from pBS-VMS into a
vector pcDNA3 (Stratagene) between the EcoRI and NotI restriction
sites, downstream of the cytomegalovirus (CMV) immediate early (IE)
promoter and of a T7 RNA polymerase promoter. The resulting
construct was called pSDV.
[0058] The region of the cDNA encoding the structural proteins was
removed by digestion with XbaI, one site of which is in the
junction region and the other of which is in the multiple cloning
site of pDNA3, downstream of the cDNA. The construct was
autoligated to give the plasmid p-nsP, represented in FIG. 2A).
[0059] The plasmid p-nsP was then linearized with XbaI in order to
insert, downstream of the region encoding the nonstructural
proteins, a sequence encoding GFP or luciferase (LUC) preceded by
the end of the junction region and.sup.2 followed by the 3'
untranslated end of SDV fused to a poly (A) tail. The artificial
XbaI site of the junction region was removed by interchanging a
SanDI/BlpI fragment. The reading frame of GFP or that of luciferase
is bordered by two unique restriction sites: an EcoRV site and a
BlPI site. In these final constructs, called p-nsp-GFP and
p-nsp-LUC, the CMV/T7 promoter combination is separated from the 5'
end of the SDV genome by 61 nucleotides belonging to the multiple
cloning site of pcDNA3. These constructs are represented in FIG.
2B.
[0060] In order to evaluate the functionality of these constructs
for the expression of the GFP and LUC reporter genes, each of them
was used to transfect BF-2 cells, which were incubated at
10.degree. C., in culture plate wells (6.times.10.sup.5
cells/well), and the luciferase activity and GFP activity were
measured daily.
[0061] To measure the luciferase activity, the transfected cells
were harvested before measurement, washed with PBS, and lysed with
75 .mu.l of 1.times. lysis buffer (25 mM Tris-phosphate (pH 7.8), 2
mM DTT, 2 mM 1,2-diaminocyclohexane-N,N,N',N'-tetraacetic acid, 10%
glycerol, 1% Triton X-100). The lysates are clarified by low-speed
centrifugation, and the proteins are quantified by the Bradford
method, in order to normalize the samples.
[0062] 50 .mu.l of luciferase reagent (Promega) are added to
aliquots of the clarified lysates.
[0063] In the case of GFP, the expression in the transfected cells
is directly monitored by observation under a microscope in UV
light.
[0064] The expression of the nonstructural proteins is detected by
immunofluorescence from the day after transfection onward. On the
other hand, respective of the time-after transfection, neither
luciferase activity nor GFP fluorescence is detected.
[0065] The results are given in table III below.
TABLE-US-00004 TABLE III Expression of Plasmid nonstructural GFP
Luciferase construct proteins expression expression p-nsP-GFP +++ -
p-nsP-LUC +++ -
[0066] These results indicate that the viral RNA was transcribed,
but that no expression of the GFP or luciferase reporter genes,
which are placed under the control of the SDV 26 Subgenomic
promoter, is observed.
[0067] This makes it possible to suppose that the replicative viral
complex is not functional due to the fact that the 5' end is not
strictly identical to that of the SDV genome.
Use of a Ribozyme as Spacer:
[0068] A hammerhead ribozyme sequence (HH sequence) was fused to
the first nucleotide of the 5' end of the SDV cDNA genome, in the
following way: a HindIII fragment of p-nsP, containing the first
two Kb of SDV cDNA was removed and subcloned into a plasmid pUC19,
to give the construct pUC-SDV HindIII. A BamHI/NaeI fragment
containing the 5' end of the SDV genome was removed from this
construct, and was replaced with a synthetic DNA fragment generated
by hybridization of two partially complementary oligonucleotides of
79 and 80 nucleotides comprising the sequence of the hammerhead
ribozyme fused to the 5' end of the SDV genome, and filling using
the T4 DNA polymerase Klenow fragment. The sequence of these
oligonucleotides (5'RIBO and 3'RIBO) is given in table I.
[0069] The sequence of the hammerhead ribozyme is represented in
FIG. 3A; the BamHI and NaeI sites and the T7 promoter are
underlined. The ribozyme cleavage site and the start of the SDV
genome are indicated by arrows. The nucleotide and protein
sequences in FIG. 3A are disclosed as SEQ ID NO: 27 and 28,
respectively in order of appearance.
[0070] After digestion with the appropriate restriction enzymes,
the synthetic DNA fragment was inserted into the plasmid pUC-SDV
HindIII, to give the construct pUC-HH-SDV HindIII. The modified
HindIII fragment was recovered from this construct and reinserted
into the plasmid p-nsP, to give the construct pHH-nsP.
[0071] The resulting construct pHH-nsP was then linearized with
XbaI and modified in the same way as in the case of p-nsP:
insertion, downstream of the region encoding the nonstructural
proteins, of a sequence encoding GFP or luciferase (LUC) bordered
by the BlpI and EcoRV sites, preceded by the end of the junction
region and followed by the 3' untranslated end of SDV fused to a
poly (A) tail, correction of the artificial XbaI site. The final
constructs are called pHH-nsP-GFP and pHH-nsP-LUC. The steps for
obtaining these constructs are given in FIG. 3B.
[0072] The functionality of these constructs was evaluated in the
same way as for the constructs p-nsP-GFP and p-nsP-LUC.
[0073] The results are illustrated in FIG. 4.
[0074] A significant luciferase activity is detected from 2 days
after infection onward, and increses up to 9 days after
transfection (FIG. 4A). GFP expression is demonstrated 4 days after
transfection, and is optimal, as for luciferase, after 9 days (FIG.
4B).
[0075] These results indicate that the SDV replicase complex (nsP1,
nsP2, nsP3 and nsP4) expressed from the pHH-nsP-LUC or -GFP vectors
is biologically active and is capable of replicating and of
transcribing a subgenomic RNA containing the reporter genes. These
data also show that the cleavage of the 5' end of the SDV genome
was effectively carried out by the hammerhead ribozyme.
Example 3
Construction of an Infectious Recombinant cDNA of SDV
[0076] An infectious SDV cDNA clone was constructed in the
following way:
[0077] The region encoding the structural proteins of SDV was
inserted between the BlpI and EcoRV sites of pHH-nsP-LUC, as a
replacement for the sequence encoding luciferase, to give the
construct pHH-SDV.
[0078] This construct was also modified by insertion of a T7
terminator (T7t): the pHH-SDV vector was linearized by digestion
with the NotI restriction enzyme, and blunt-end ligated with a
BlpI/NheI fragment of the vector pET-14b (Novagen) containing a T7
terminator (prior to the ligation, the ends of the two fragments
were filled using the T4 DNA polymerase Klenow fragment). The
resulting construct is called pHH-SDV-T7t. The steps for obtaining
this construct are shown schematically in FIG. 5.
[0079] This construct was used to transfect BF-2 cells infected
with the recombinant vaccinia virus vTF7-3, which expresses the T7
RNA polymerase (FUERST et al., 1986, mentioned above). The BF-2
cells (approximately 1.2.times.10.sup.6 cells/well) are cultured in
12-well plates and infected with vTF7-3 (multiplicity of
infection=5). After 1 hour of adsorption at 37.degree. C., the
cells are washed twice, and transfected with 1.6 .mu.g of pSDV,
using the Lipofectamine 2000 reagent, according to the
manufacturer's instructions (Invitrogen). The cells are incubated
for 7 hours at 37.degree. C. and washed with MEM medium before
being transferred to 10.degree. C. and incubated at this
temperature for 7 or 10 days. In certain experiments, transfections
were carried out according to the same protocol, but without prior
infection of the cells with vTF7-3.
[0080] 7 days and 10 days after transfection, the cells are fixed
with a 1/1 alcohol/acetone mixture at 20.degree. C. for 15 minutes,
and incubated with an assortment of monoclonal antibodies directed
against structural or nonstructural proteins of SDV, said
antibodies being diluted to 1/1000 in PBS-Tween. After incubation
for 45 minutes at ambient temperature, the cells are washed and
incubated with an anti-mouse immunoglobulin antibody (Biosys,
France). After washing, the cells are examined with a m microscope
under UV light.
[0081] In parallel, the supernatants are recovered, clarified by
centrifugation at 10 000.times.g in a microcentrifuge, and used to
infect fresh BF-2 cells, cultured at 10.degree. C. as a monolayer
in 24-well plates. The cells thus infected are analyzed by
immunofluorescence as described above.
[0082] The results observed 7 days after transfection are shown in
FIG. 6A: some small loci appear; they are greater in size 10 days
after infection, which probably reflects a cell-to-cell infection
by the recombinant SDV.
[0083] The recombinant SDV has a BlpI restriction site, which is
absent from the wild-type virus. In order to verify that the virus
produced by the infected cells is indeed the recombinant SDV, the
RNA is extracted from the cells infected with the recombinant SDV,
after the first passage, and used as a template to carry out an
RT-PCR using the primers NsP4-F and CapR, bordering the BlpI site.
The position of these primers is indicated in FIG. 6C. An RT-PCR is
also carried out, with the same primers, using RNA extracted from
cells infected with the wild-type virus.
[0084] The amplification products are digested with BlpI, and their
restriction profiles are compared. The results are shown in FIG.
6B. In the absence of BlpI (-BlpI), a fragment of 1326 nucleotides
is observed with the recombinant SDV, as with the wild-type virus.
After digestion with BlpI (+BlpI), this fragment remains intact in
the case of the wild-type virus, and gives a fragment of 990
nucleotides and a fragment of 336 nucleotides in the case of the
recombinant SDV.
Example 4
In Vivo Infection with the Recombinant SDV
[0085] In order to verify the infectious capacity of the
recombinant SDV, 50 healthy young rainbow trout (Oncorhynchus
mykiss) were infected by immersion for 2 hours in an aquarium
filled with water at 10.degree. C., containing 5.times.10.sup.4
PFU/ml of wild-type SDV or of recombinant SDV, obtained from
infected BF-2 cells. The aquarium is then made up to 30 liters with
fresh water. Fish used as control are treated under the same
conditions, with culture medium in place of the viral
suspension.
[0086] 3 weeks after infection, some fish were sacrificed and
homogenates of organs of each fish were used to infect BF-2 cells.
Analysis of these cells by immuno-fluorescence, as described in
example 3 above, shows the presence of virus in the cells infected
with the organ homogenates from fish infected with the wild-type
SDV or with the recombinant SDV (results not shown).
[0087] All the fish sacrificed were positive for SDV, the viral
titer being approximately 10.sup.7 PFU/ml for the wild-type SDV as
for the recombinant SDV.
Example 5
Construction of an Infectious Recombinant SDV Expressing a
Heterologous Gene
[0088] In order to produce an infectious recombinant virus
expressing GFP, the infectious cDNA pHH-SDV-T7t is modified in two
different ways, in order to insert an additional expression
cassette expressing GFP.
1) Construction of the Infectious cDNA pHH-SDV-GFPfirst
[0089] The pHH-nsP-GFP construct is used as template to generate
two separate PCR amplification products: the "GFP PCR product is
obtained using the 5'GFP and 3'GFP primers (table 1); the
"subgenomic SDV PCR" is obtained using the 5'nsP4(77-6-7750) and
3'Jun primers (table 1). Since the exact location and the minimum
size of the SDV subgenomic promoter have not yet been determined, a
fragment of approximately 100 nucleo-tides, containing the end of
the sequence of nsP4 and the junction region, was used. The SDV
subgenomic promoter is then ligated, by PCR, in a position 3' of
the sequence encoding GFP, by mixing the two products derived from
the first amplification and using the 5'GFP and 3'Jun primers.
[0090] The resulting amplification product (GFP-SDVPro) is digested
with BlpI and inserted into the pHH-SDV-T7t construct, digested
beforehand with BlpI, so as to obtain the infectious cDNA
pHH-SDV-GFPfirst.
2) Construction of the Infectious cDNA pHH-SDV-GFPsecond
[0091] In this construct, the GFP expression cassette is inserted
downstream of the structural genes.
[0092] Two PCR amplification products are generated: [0093] the SDV
subgenomic promoter fused to GFP (product PCR1), using as primers
5'ProGFP and 3'ProGFP (table 1), and as matrix the pHH-nsP-GFP
construct; [0094] the 3'untranslated region of SDV fused to a
poly(A) tail and to the T7 promoter (product PCR2), using as
primers 3'UTR and T7t (table 1), and as template the pHHSDV-T7t
construct.
[0095] The PCR1 and PCR2 products are assembled by PCR using the
5'ProGFP and T7t primers. The PCR amplification product is digested
with EcoRV and Noti, and inserted into the pHH-SDV construct
digested with the same enzymes, so as to obtain the infectious cDNA
pHH-SDV-GFPsecond.
[0096] These two constructs are shown schematically in FIG. 7A.
[0097] These constructs are used to transfect BF-2 cells infected
with vTF7, and the GFP expression is monitored daily. The results
are shown in FIG. 7B.
[0098] The GFP expression is detectable starting from 7 days after
transfection for the two pHH-SDV-GFP constructs. However, a more
intense expression of GFP is observed when the GFP gene is located
downstream of the structural protein genes in the genome.
[0099] During the cloning of the GFP gene into pSDV in order to
obtain the pHH-SDV-GFPfirst construct, a plasmid
(pHH-SDV-GFP.sub.3) suspected of containing 3 GFP cassettes was
selected.
[0100] This plasmid is shown schematically in FIG. 8A.
[0101] An RT-PCR using the nsP4-F and GFP-R primers (table 1) made
it possible to confirm that effectively 3 GFP cassettes were
present in the pHHSDV-GFP.sub.3 plasmid.
[0102] The results of this RT-PCR are represented in FIG. 8B.
Together, these three GFP cassettes represent a DNA fragment of 2.7
Kb.
[0103] This construct was transfected into BF-2 cells infected with
vTF7-3, and the appearance of loci of infected cells after 9 days
confirmed the functionality of this construct.
[0104] These results show that SDV can contain a heterologous
nucleic acid which is more than 20% longer than the wild-type virus
genome.
Sequence CWU 1
1
30142DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 1ccgaattcgt taaatccaaa agcatacata tatcaatgat gc
42233DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 2cccggggcgg ccccaaggtc gagaactgag ttg
33335DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 3ccccgggagg agtgaccgac tactgcgtga agaag
35431DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 4ggtctagagt atgatgcaga aaatattaag g
31535DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 5cctctagacc aaccatgttt cccatgcaat tcacc
35642DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 6ccgcggccgc attgaaaatt ttaaaaacca atagatgact ca
42779DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 7ggatcctgga tttatcctga tgagtccgtg aggacgaaac
tataggaaag gaattcctat 60agtcgataaa tccaaaagc 79880DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
8gccggcggaa gggttagctg tgagattttg catcattgat atatgtatgc ttttggattt
60atcgactata ggaattcctt 80925DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 9cctcgtcagc gggacccata atgcc
251030DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 10ccgctgagcg gttggttgag agtatgatgc
301132DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 11ccaaccgctg agcatggtga gcaagggcga gg
321247DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 12gtggctaacg gcaggtgatt cacgcttaag ctcgagatct
gagtccg 471345DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 13gcgtgaatca cctgccgtta gccacaatgg
cgatggccac gctcg 451432DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 14ccatgctgag cggttggttg
agagtatgat gc 321525DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 15ggcggcttcc tgttactcga cacgg
251639DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 16atcgatgaac gatatcggcc gccgctacac gctatggcg
391735DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 17ccggaatgct agcttaagct cgagatctga gtccg
351834DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 18cgagcttaag ctagcattcc ggtatacaaa tcgc
341938DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 19ggctaggtcg gcggccgcaa aaaacccctc aagacccg
382023DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 20ccgccgagtc gctccagttg gcg 232125DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
21cgggttctcc aggacgtcct tcaag 252228DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
22ggcggcggca tggtcgttgg acgaccgg 282328DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
23ccttcagcat agtcatggcc ttctttgg 282425DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
24ttaagctcga gatctgagtc cggac 252565DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 25nnnnnnnnnn ctgangarnn nnnnnnnnnn nnnygaaann
nnnnnnnnnn nnnnnnnnnn 60nnnth 652612DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 26atactctcaa cc 1227172DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
27taatacgact cactataggg agacccaagc ttggtaccga gctccctagg tggatttatc
60ctgatgagtc cgtgaggacg aaactatagg aaaggaattc ctatagtcga taaatccaaa
120agcatacata tatcaatgat gcaaaatctc acagctaacc cttccgccgg ca
1722812PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 28Met Met Leu Asn Leu Thr Ala Asn Pro Ser Ala
Gly1 5 102936DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 29nnnctganga rnnnnnnnnn
nnygaaannn nnnnnn 363012DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 30atactctaga cc
12
* * * * *