U.S. patent application number 12/855433 was filed with the patent office on 2011-03-10 for process for amplifying nucleic acids.
This patent application is currently assigned to RIKEN. Invention is credited to Yoshihide HAYASHIZAKI, Yasumasa MITANI, Yuko SHIBATA, Akio YAMANE.
Application Number | 20110059868 12/855433 |
Document ID | / |
Family ID | 32211625 |
Filed Date | 2011-03-10 |
United States Patent
Application |
20110059868 |
Kind Code |
A1 |
MITANI; Yasumasa ; et
al. |
March 10, 2011 |
PROCESS FOR AMPLIFYING NUCLEIC ACIDS
Abstract
The present invention relates to a process for synthesizing or
amplifying efficiently a nucleic acid comprising a target nucleic
acid sequence. In the process according to the present invention, a
primer comprising in its 3'-end portion a sequence (Ac') which
hybridizes a sequence (A) in the 3'-end portion of the target
nucleic acid sequence, and in the 5'-side of said sequence (Ac') a
sequence (B') which hybridizes the complementary sequence (Bc) of a
sequence (B) positioned in the 5'-side of said sequence (A) on the
target nucleic acid sequence, wherein {X-(Y-Y')}/X is in the range
of -1.00 to 1.00, in which X denotes the number of bases in said
sequence (Ac'), Y denotes the number of bases in the region flanked
by said sequences (A) and (B) in the target nucleic acid sequence,
and Y' denotes the number of bases in an intervening sequence
between said sequences (Ac') and (B') (Y' may be zero).
Inventors: |
MITANI; Yasumasa;
(Hiroshima-ken, JP) ; YAMANE; Akio;
(Hiroshima-ken, JP) ; SHIBATA; Yuko; (Ibaraki-ken,
JP) ; HAYASHIZAKI; Yoshihide; (Ibaraki-ken,
JP) |
Assignee: |
RIKEN
Wako-shi
JP
KABUSHIKI KAISHA DNAFORM
Yokohama-shi
JP
|
Family ID: |
32211625 |
Appl. No.: |
12/855433 |
Filed: |
August 12, 2010 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10532975 |
Apr 28, 2005 |
7803579 |
|
|
PCT/JP03/13556 |
Oct 29, 2003 |
|
|
|
12855433 |
|
|
|
|
Current U.S.
Class: |
506/16 ;
536/24.33 |
Current CPC
Class: |
C12Q 2525/301 20130101;
C12Q 1/6844 20130101; C12Q 1/6844 20130101 |
Class at
Publication: |
506/16 ;
536/24.33 |
International
Class: |
C40B 40/06 20060101
C40B040/06; C07H 21/04 20060101 C07H021/04 |
Foreign Application Data
Date |
Code |
Application Number |
Oct 29, 2002 |
JP |
2002-314776 |
Claims
1-17. (canceled)
18. A primer for synthesizing a nucleic acid complementary to a
target nucleic acid sequence in a template nucleic acid, comprising
in its 3'-end portion a sequence (Ac') which hybridizes a sequence
(A) in the 3'-end portion of the target nucleic acid sequence, and
in the 5'-side of said sequence (Ac') a sequence (B') which
hybridizes the complementary sequence (Bc) of a sequence (B)
positioned in the 5'-side of said sequence (A) on the target
nucleic acid sequence, wherein in the absence of an intervening
sequence between said sequences (Ac') and (B'), (X-Y)/X is in the
range of -1.00 to 1.00, in which X denotes the number of bases in
said sequence (Ac'), and Y denotes the number of bases in the
region flanked by said sequences (A) and (B) on the target nucleic
acid sequence, and in the presence of an intervening sequence
between said sequences (Ac') and (B'), {X-(Y-Y')}/X is in the range
of -1.00 to 1.00, in which X and Y have the same meanings as above,
and Y' denotes the number of bases in said intervening
sequence.
19. A kit for synthesizing a nucleic acid complementary to a target
nucleic acid sequence in a template nucleic acid, comprising the
primer according to claim 18.
20. A primer set for amplifying a target nucleic acid sequence in a
double-stranded template nucleic acid, which comprises: (a) a first
primer comprising in its 3'-end portion a sequence (Ac') which
hybridizes a sequence (A) in the 3'-end portion of the target
nucleic acid sequence in the first strand of the double-stranded
template nucleic acid, and in the 5'-side of said sequence (Ac') a
sequence (B') which hybridizes the complementary sequence (Bc) of a
sequence (B) positioned in the 5'-side of said sequence (A) on said
target nucleic acid sequence, wherein in the absence of an
intervening sequence between said sequences (Ac') and (B'), (X-Y)/X
is in the range of -1.00 to 1.00, in which X denotes the number of
bases in said sequence (Ac'), and Y denotes the number of bases in
the region flanked by said sequences (A) and (B) on the target
nucleic acid sequence, and in the presence of an intervening
sequence between said sequences (Ac') and (B'), {X-(Y-Y')}/X is in
the range of -1.00 to 1.00, in which X and Y have the same meanings
as above, and Y' denotes the number of bases in said intervening
sequence; and (b) a second primer comprising in its 3'-end portion
a sequence (Cc') which hybridizes a sequence (C) in the 3'-end
portion of the target nucleic acid sequence in the second strand of
the double-stranded template nucleic acid, and in the 5'-side of
said sequence (Cc') a sequence (D') which hybridizes the
complementary sequence (Dc) of a sequence (D) positioned in the
5'-side of said sequence (C) on said target nucleic acid sequence,
wherein in the absence of an intervening sequence between said
sequences (Cc') and (D'), (X-Y)/X is in the range of -1.00 to 1.00,
in which X denotes the number of bases in said sequence (Cc'), and
Y denotes the number of bases in the region flanked by said
sequences (C) and (D) on the target nucleic acid sequence, and in
the presence of an intervening sequence between said sequences
(Cc') and (D'), {X-(Y-Y')}/X is in the range of -1.00 to 1.00, in
which X and Y have the same meanings as above, and Y' denotes the
number of bases in said intervening sequence.
21. A kit for amplifying a target nucleic acid sequence in a
double-stranded template nucleic acid, comprising the primer set
according to claim 20.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a Division of application Ser. No.
10/532,975, filed Apr. 28, 2005, which is a U.S. National Stage of
PCT/JP03/13856, filed Oct. 29, 2003, which applications are
incorporated herein by reference.
BACKGROUND OF THE INVENTION
[0002] 1. Field of the Invention
[0003] The present invention relates to a process for synthesizing
a nucleic acid sequence, which is useful in the field of genetic
engineering, as well as a process for amplifying it. More
particularly, the present invention relates to a process for
synthesizing a nucleic acid sequence with use of strand
displacement reaction, and to a process for amplifying it.
[0004] 2. Background Art
[0005] In the field of genetic engineering, there is known an assay
based on the complementation of nucleic acids as a method which is
capable of directly analyzing genetic features. In such assay, if
an aimed gene is present only in a small amount in a sample, it is
necessary to previously amplify the aimed gene itself generally due
to the difficulty of its detection.
[0006] The amplification of the aimed gene (amplification of
nucleic acid) is primarily carried out by enzymatic methods with
use of DNA polymerase. Such enzymatic methods include, for example,
the polymerase chain reaction method (PCR method; U.S. Pat. Nos.
4,683,195, 4,683,202 and 4,800,159), and the reverse transcription
PCR method which is the combination of the PCR method and the
reverse transcriptase method (RT-PCR method; Trends in
Biotechnology, 10, 146-1521 1992). These methods is intended to
make capable of amplifying the aimed gene from DNA or RNA by
repeating the three step reactions of the dissociation
(denaturation) of a double-stranded nucleic acid as a template into
a single-stranded nucleic acid, the annealing of a primer to the
single-stranded nucleic acid and the synthesis (extension) of a
complementary strand from a primer. These methods require the
repetition of three steps in total in which the reaction solution
is adjusted to a temperature suitable for each reaction in the
three steps described above.
[0007] There is known the shuttle PCR method as an improvement in
the amplification method of nucleic acids described above ("Recent
Trends of the PCR method", TANPAKUSHITSU KAKUSAN KOSO (Proteins,
Nucleic Acids and Enzymes), KYORITSU SHUPPAN CO., LTD., Vol. 41(5),
425-428 (1996)). In the shuttle PCR method, two steps of the
annealing of a primer and the extension among the three-step
reactions in the PCR method are carried out at the same
temperature, so that the aimed gene can be amplified by the
reactions of two steps in total. Furthermore, EP Laid-Open
Publication No. 0320308 discloses the ligase chain reaction method
(LCR method), in which a known gene sequence is amplified by
two-step temperature cycling (repeated reactions with heating and
cooling).
[0008] In the methods described above, it is necessary to use a
thermal cycler which can control temperature strictly in an
extensive range. In addition, these reactions are carried out at
two or three temperature conditions and require time for adjusting
respective reaction temperatures, so that the more increased the
cycles, the longer the time required for it.
[0009] In order to solve the aforementioned problems, methods for
amplifying nucleic acids which can be conducted under an isothermal
condition have been developed. Such methods include, for example,
the strand displacement amplification (SDA) method and the
self-sustained sequence replication (3SR) method described in
Japanese Patent Publication No. 7/114718, the nucleic acid sequence
based amplification (NASBA) method and the transcription-mediated
amplification (TMA) method described in Japanese Patent No.
2650159, the Q beta replicase method described in Japanese Patent
No. 2710159, a variety of the improved SDA methods described in
U.S. Pat. No. 5,824,517, International Publications WO99/09211 or
WO95/25180, the LAMP (Loop-Mediated Isothermal Amplification)
method described in International Publication WO00/28082, the ICAN
(Isothermal and Chimeric primer-initiated Amplification of Nucleic
acids) method described in International Publication WO02/16639,
and the like. The reactions of all steps involved in the isothermal
amplification of nucleic acids proceed simultaneously in reaction
mixtures maintained at a constant temperature.
[0010] In the SDA method, it is possible to amplify the aimed
nucleic acid (and its complementary strand) in a sample by the
displacement of a double strand mediated by DNA polymerases and
restriction endonucleases. This method involves four primers, of
which the two primers must be designed to include the recognition
sites of the restriction endonucleases. In addition, this method
requires as a substrate for the synthesis of nucleic acids modified
deoxynucleotide triphosphates such as a deoxynucleotide
triphosphate in which the oxygen atom of the phosphate group at the
alpha-position of the triphosphate moiety has been substituted by a
sulfur atom (S). This method requires high running cost.
Furthermore, in this method, modified nucleotides such as
alpha-S-displaced deoxynucleotides are included in the amplified
nucleic acid fragment, so that when the amplified fragment is
subjected to the restriction enzyme fragment length polymorphism
(RFLP) assay, it cannot be broken with the restriction enzyme and
thus such assay cannot be practiced in some cases.
[0011] The SDA method described in U.S. Pat. No. 5,824,517 requires
a chimeric primer comprising RNA and DNA, in which DNA is in the
3'-end side. Such chimeric primer composed of RNA and DNA requires
high cost of its synthesis, and RNA containing primers also require
professional knowledge for its handling. In addition, the improved
SDA method described in International Publication WO99/09211
requires a restriction enzyme which generates a 5'-protruding end,
and the improved SDA method described in International Publication
WO95/25180 requires at least two primer pairs, so that these
methods also require high running cost.
[0012] The ICAN method requires a chimeric primer comprising RNA
and DNA, in which RNA is in the 3'-end side, and an RNase H for
cutting the RNA moiety at the 3'-end of the primer, so that
reagents required for the method cost a great deal. Thus, this
method requires high running cost particularly in genetic tests on
a large amount of samples.
[0013] The LAMP method requires four primers, which recognize six
regions to amplify the aimed genes. That is, in this method, the
first primer anneals a template strand to cause extension, and a
stem-loop structure is formed at the 5'-end portion of the extended
strand due to the constitution of the first primer. The extended
strand is next separated from the template strand by the strand
displacement reaction of the second primer which is designed in the
upper-stream of the first primer. Similar reactions occur
repeatedly also on the other strand of the double-stranded nucleic
acid, and thus the target nucleic acid is amplified. Therefore, the
mechanism of the amplification reactions is complicated, and the
six regions must be selected, so that it becomes difficult to
design primers. In addition, the two of four primers are required
to be comparatively long chain primers, and thus the synthesis and
purification of the primers is expensive and takes a lot of
time.
[0014] Therefore, there is a need for a process for amplifying
nucleic acids, which can be practiced with a low running cost and
the nucleic acid fragment thus obtained can be further used for
genetic engineering treatments. Particularly, it is desired to have
an isothermal nucleic acid amplification method in which
amplification can be conducted quickly with a pair of primers.
SUMMARY OF THE INVENTION
[0015] The present inventors have found that a nucleic acid having
a nucleic acid sequence complementary to a target nucleic acid
sequence can be synthesized by using a primer designed in such a
way that it is capable of forming a stem-loop structure by the
extension of the primer and satisfies additional specific
requirements, and that a target nucleic acid can be amplified
efficiently by using two such primers. The present invention is
based on these findings.
[0016] Accordingly, it is an object of the present invention to
provide a process for synthesizing or amplifying efficiently a
nucleic acid having a target nucleic acid sequence, as well as a
primer and a primer set for use therein.
[0017] The process for synthesizing a nucleic acid according to the
present invention is a process for synthesizing a nucleic acid
complementary to a target nucleic acid sequence in a template
nucleic acid, which comprises the steps of:
(a) providing a primer comprising in its 3'-end portion a sequence
(Ac') which hybridizes a sequence (A) in the 3'-end portion of the
target nucleic acid sequence, and in the 5'-side of said sequence
(Ac') a sequence (B') which hybridizes the complementary sequence
(Bc) of a sequence (B) positioned in the 5'-side of said sequence
(A) on the target nucleic acid sequence, wherein
[0018] in the absence of an intervening sequence between said
sequences (Ac') and (B'), (X-Y)/X is in the range of -1.00 to 1.00,
in which X denotes the number of bases in said sequence (Ac'), and
Y denotes the number of bases in the region flanked by said
sequences (A) and (B) on the target nucleic acid sequence, and
[0019] in the presence of an intervening sequence between said
sequences (Ac') and (B'), {X-(Y-Y')}/X is in the range of -1.00 to
1.00, in which X and Y have the same meanings as above, and Y'
denotes the number of bases in said intervening sequence;
(b) providing a template nucleic acid; (c) annealing said primer to
said template nucleic acid and synthesizing a complementary nucleic
acid comprising the complementary sequence of said target nucleic
acid sequence by primer extension reaction; (d) hybridizing the
sequence (B') positioned in the 5'-side of the complementary
nucleic acid synthesized in the step (c) with the sequence (Bc) on
the same complementary nucleic acid, thereby allowing the portion
of said sequence (A) on the template nucleic acid to be
single-stranded; and (e) annealing another primer having the same
sequence as said primer to the single-stranded sequence (A) portion
of the template nucleic acid from the step (d) and conducting
strand displacement reaction, thereby displacing the complementary
nucleic acid synthesized in the step (c) by the complementary
nucleic acid newly synthesized with said another primer.
[0020] The process for amplifying a nucleic acid according to the
present invention is a process for amplifying a target nucleic acid
sequence in a double-stranded template nucleic acid, which
comprises the steps of:
(a) providing a first primer comprising in its 3'-end portion a
sequence (Ac') which hybridizes a sequence (A) in the 3'-end
portion of the target nucleic acid sequence in the first strand of
the double-stranded template nucleic acid, and in the 5'-side of
said sequence (Ac') a sequence (B') which hybridizes the
complementary sequence (Bc) of a sequence (B) positioned in the
5'-side of said sequence (A) on said target nucleic acid sequence,
wherein
[0021] in the absence of an intervening sequence between said
sequences (Ac') and (B'), (X-Y)/X is in the range of -1.00 to 1.00,
in which X denotes the number of bases in said sequence (Ac'), and
Y denotes the number of bases in the region flanked by said
sequences (A) and (B) on the target nucleic acid sequence, and
[0022] in the presence of an intervening sequence between said
sequences (Ac') and (B'), {X-(Y-Y')}/X is in the range of -1.00 to
1.00, in which X and Y have the same meanings as above, and Y'
denotes the number of bases in said intervening sequences;
(b) providing a second primer comprising in its 3'-end portion a
sequence (Cc') which hybridizes a sequence (C) in the 3'-end
portion of the target nucleic acid sequence in the second strand of
the double-stranded template nucleic acid, and in the 5'-side of
said sequence (Cc') a sequence (D') which hybridizes the
complementary sequence (Dc) of a sequence (D) positioned in the
5'-side of said sequence (C) on said target nucleic acid sequence,
wherein
[0023] in the absence of an intervening sequence between said
sequences (Cc') and (D'), (X-Y)/X is in the range of -1.00 to 1.00,
in which X denotes the number of bases in said sequence (Cc'), and
Y denotes the number of bases in the region flanked by said
sequences (C) and (D) on the target nucleic acid sequence, and
[0024] in the presence of an intervening sequence between said
sequences (Cc') and (D'), {X-(Y-Y')}/X is in the range of -1.00 to
1.00, in which X and Y have the same meanings as above, and Y'
denotes the number of bases in said intervening sequence;
(c) providing a double-stranded template nucleic acid consisting of
the first and second template nucleic acids; (d) annealing said
first and second primers to said first and second template nucleic
acids, respectively, and synthesizing the first and second
complementary nucleic acids comprising the complementary sequence
of said target nucleic acid by the primer extension reaction,
respectively; (e) hybridizing the sequences (B') and (D')
positioned in the 5'-side of the first and second complementary
nucleic acids synthesized in the step (d) with the sequences (Bc)
and (Dc) on the same complementary nucleic acids, respectively, and
thereby allowing the portions of said sequences (A) and (C) on the
first and second template nucleic acids to be single-stranded,
respectively; and (f) annealing another primers having the same
sequence as said primers to the single-stranded sequence (A) and
(C) portions of the first and second template nucleic acids from
the step (e) and conducting strand displacement reaction, thereby
displacing the first and second complementary nucleic acids
synthesized in the step (d) by the complementary nucleic acids
newly synthesized with said another primers.
[0025] Furthermore, the primer according to the present invention
is a primer for synthesizing a nucleic acid complementary to a
target nucleic acid sequence in a template nucleic acid, comprising
in its 3'-end portion a sequence (Ac') which hybridizes a sequence
(A) in the 3'-end portion of the target nucleic acid sequence, and
in the 5'-side of said sequence (Ac') a sequence (B') which
hybridizes the complementary sequence (Bc) of a sequence (B)
positioned in the 5'-side of said sequence (A) on the target
nucleic acid sequence, wherein
[0026] in the absence of an intervening sequence between said
sequences (Ac') and (B'), (X-Y)/X is in the range of -1.00 to 1.00,
in which X denotes the number of bases in said sequence (Ac'), and
Y denotes the number of bases in the region flanked by said
sequences (A) and (B) on the target nucleic acid sequence, and
[0027] in the presence of an intervening sequence between said
sequences (Ac') and (B'), {X-(Y-Y')}/X is in the range of -1.00 to
1.00, in which X and Y have the same meanings as above, and Y'
denotes the number of bases in said intervening sequence.
[0028] The primer set according to the present invention is a
primer set for amplifying a target nucleic acid sequence in a
double-stranded template nucleic acid, which comprises:
(a) a first primer comprising in its 3'-end portion a sequence
(Ac') which hybridizes a sequence (A) in the 3'-end portion of the
target nucleic acid sequence in the first strand of the
double-stranded template nucleic acid, and in the 5'-side of said
sequence (Ac') a sequence (B') which hybridizes the complementary
sequence (Bc) of a sequence (B) positioned in the 5'-side of said
sequence (A) on said target nucleic acid sequence, wherein
[0029] in the absence of an intervening sequence between said
sequences (Ac') and (B'), (X-Y)/X is in the range of -1.00 to 1.00,
in which X denotes the number of bases in said sequence (Ac'), and
Y denotes the number of bases in the region flanked by said
sequences (A) and (B) on the target nucleic acid sequence, and
[0030] in the presence of an intervening sequence between said
sequences (Ac') and (B'), {X-(Y-Y')}/X is in the range of -1.00 to
1.00, in which X and Y have the same meanings as above, and Y'
denotes the number of bases in said intervening sequence; and (b) a
second primer comprising in its 3'-end portion a sequence (Cc')
which hybridizes a sequence (C) in the 3'-end portion of the target
nucleic acid sequence in the second strand of the double-stranded
template nucleic acid, and in the 5'-side of said sequence (Cc') a
sequence (D') which hybridizes the complementary sequence (Dc) of a
sequence (D) positioned in the 5'-side of said sequence (C) on said
target nucleic acid sequence, wherein
[0031] in the absence of an intervening sequence between said
sequences (Cc') and (D'), (X-Y)/X is in the range of -1.00 to 1.00,
in which X denotes the number of bases in said sequence (Cc'), and
Y denotes the number of bases in the region flanked by said
sequences (C) and (D) on the target nucleic acid sequence, and
[0032] in the presence of an intervening sequence between said
sequences (Cc') and (D'), {X-(Y-Y')}/X is in the range of -1.00 to
1.00, in which X and Y have the same meanings as above, and Y'
denotes the number of bases in said intervening sequence.
[0033] According to the present invention, it is possible to
synthesize continuously the target DNA under an isothermal
condition by using DNA or RNA as a template and an oligonucleotide
primer. According to the present invention, it is also possible to
amplify continuously the target DNA under an isothermal condition
by using DNA or RNA as a template and a pair of oligonucleotide
primers. Thus, the process according to the present invention
requires no special apparatuses such as a thermal cycler and no
time for the setting of temperature, and thus exhibits an excellent
effect that amplified products can be obtained in a short time.
Moreover, the DNA fragment amplified according to the present
invention can be treated with restriction enzymes and thus can be
employed in the field of genetic tests such as restriction enzyme
fragment length polymorphism or detection of mutation.
BRIEF DESCRIPTION OF THE DRAWINGS
[0034] FIG. 1 shows the schematic diagram of the process for
amplifying nucleic acids according to the present invention.
[0035] FIG. 2 shows the positions of sequences of a primer used for
the amplification of a human STS DYS237 gene in the 5'-side and the
3'-side.
[0036] FIG. 3 shows the positions of a primer used for the
amplification of an sY160 gene in the 5'-side and 3'-side.
[0037] FIG. 4 shows the positions of a primer used for the
amplification of an M13mp18RT DNA in the 5'-side and 3'-side.
[0038] FIG. 5 shows the amplification of a human STS DYS237 gene
under a variety of conditions.
[0039] FIG. 6 shows the amplification of a human STS DYS237 gene
under a variety of conditions.
[0040] FIG. 7 shows the amplification of a human STS DYS237 gene
under a variety of conditions.
[0041] FIG. 8 shows the amplification of an sY160 gene under a
variety of conditions.
[0042] FIG. 9 shows the amplification of an M13mp18RT DNA gene
under a variety of conditions.
[0043] FIG. 10 shows the amplification of an M13mp18RT DNA gene
under a variety of conditions.
[0044] FIG. 11 shows electrophoresis patterns obtained by the
treatment of an amplification product from a human STS DYS237 gene
with restriction enzymes.
[0045] FIG. 12 shows electrophoresis patterns obtained by the
treatment of an amplification product from an sY160 gene with
restriction enzymes.
[0046] FIG. 13 shows electrophoresis patterns obtained by the
treatment of an amplification product from an M13mp18RT DNA with
restriction enzymes.
[0047] FIG. 14 shows the amplification of a human STS DYS237 gene
in the presence of a variety of melting temperature adjusting
agents.
DETAILED DESCRIPTION OF THE INVENTION
[0048] The mechanism of the synthesis of a nucleic acid according
to the present invention is schematically illustrated in FIG. 1.
First, the sequence of a target nucleic acid in a nucleic acid as a
template is determined, and then the sequence (A) of the 3'-end
portion and the sequence (B) positioned in the 5'-side of said
sequence (A) on the target nucleic acid sequence are determined.
The primer according to the invention comprises a sequence (Ac'),
and further comprises a sequence (B') in the 5'-side thereof. The
sequence (Ac') hybridizes the sequence (A). The sequence (B')
hybridizes the complementary sequence (Bc) of the sequence (B).
[0049] In this connection, the primer according to the present
invention may comprise an intervening sequence between said
sequences (Ac') and (B'), the intervening sequence per se having no
influence on the reaction. The annealing of the primer to a
template nucleic acid will result in a state in which sequence
(Ac') in the primer has hybridized the sequence (A) of the target
nucleic acid (FIG. 1(a)). A nucleic acid comprising the
complementary sequence of the target nucleic acid is synthesized by
the primer extension reaction in this state. Then, the sequence
(B') positioned in the 5'-end side of the nucleic acid thus
synthesized hybridizes the sequence in the same nucleic acid to
form a stem-loop structure in the 5'-end side of the synthesized
nucleic acid. As a result thereof, the sequence (A) on the template
nucleic acid becomes a single strand, to which another primer
having the same sequence as the previous primer hybridizes (FIG.
1(b)). The nucleic acid synthesized previously is then separated
from the template nucleic acid at the same time as the extension
reaction from the newly hybridized primer by the strand
displacement reaction (FIG. 1(c)).
[0050] In the aforementioned reaction mechanism, the phenomenon of
the hybridization of the sequence (B') to the sequence (Bc) is
caused by the presence of a complementary region on the same
strand. Generally, the dissociation of a double-stranded nucleic
acid to single strands begins from a comparatively unstable part
such as its terminal or the like. The double-stranded nucleic acid
produced by the extension reaction with the primer described above
is in an equilibrium state between the dissociation and bonding of
a base pair in the terminal moiety at comparatively high
temperature and maintains a double strand as a whole. If a strand
complementary to the dissociated terminal moiety in such situation
is present in the same strand, a stem-loop structure can be formed
as a metastable state. While such stem-loop structure is not
present stably, the same primer immediately binds to the sequence
(A) on the template nucleic acid as the complementary strand moiety
which has been exposed by the formation of the structure, and the
extension reaction with a polymerase causes the liberation of the
previously synthesized strand and the production of a new
double-stranded nucleic acid at the same time.
[0051] By repeating the reactions described above, it is possible
to synthesize a nucleic acid complementary to the sequence of the
target nucleic acid in the template nucleic acid in a large amount.
It is also possible to synthesize nucleic acids in the same manner
with a complementary strand of the template nucleic acid described
above as a template. Thus, it is possible to amplify the target
nucleic acid in the double-stranded template nucleic acid according
to the invention.
[0052] The process for synthesizing a nucleic acid according to the
invention comprises the steps of:
(a) providing a primer comprising in its 3'-end portion a sequence
(Ac') which hybridizes a sequence (A) in the 3'-end portion of the
target nucleic acid sequence, and in the 5'-side of said sequence
(Ac') a sequence (B') which hybridizes the complementary sequence
(Bc) of a sequence (B) positioned in the 5'-side of said sequence
(A) on the target nucleic acid sequence, wherein
[0053] in the absence of an intervening sequence between said
sequences (Ac') and (B'), (X-Y)/X is in the range of -1.00 to 1.00,
in which X denotes the number of bases in said sequence (Ac'), and
Y denotes the number of bases in the region flanked by said
sequences (A) and (B) on the target nucleic acid sequence, and
[0054] in the presence of an intervening sequence between said
sequences (Ac') and (B'), {X-(Y-Y')}/X is in the range of -1.00 to
1.00, in which X and Y have the same meanings as above, and Y'
denotes the number of bases in said intervening sequence;
(b) providing a template nucleic acid; (c) annealing said primer to
said template nucleic acid and synthesizing a complementary nucleic
acid comprising the complementary sequence of said target nucleic
acid sequence by primer extension reaction; (d) hybridizing the
sequence (B') positioned in the 5'-side of the complementary
nucleic acid synthesized in the step (c) with the sequence (Bc) on
the same complementary nucleic acid, thereby allowing the portion
of said sequence (A) on the template nucleic acid to be
single-stranded; and (e) annealing another primer having the same
sequence as said primer to the single-stranded sequence (A) portion
of the template nucleic acid from the step (d) and conducting
strand displacement reaction, thereby displacing the complementary
nucleic acid synthesized in the step (c) by the complementary
nucleic acid newly synthesized with said another primer.
[0055] The term "hybridize" herein means that a part of a primer
according to the invention hybridizes a target nucleic acid under a
stringent condition, but not nucleic acids other than the target
nucleic acid. The stringent condition may be determined depending
on factors such as the melting temperatures Tm (.degree. C.) of the
double strand of the primer according to the invention and its
complementary strand and the salt concentrations of hybridization
solutions, and the teachings of the references, such as, for
example, 3. Sambrook, E. F. Frisch, T. Maniatis; Molecular Cloning
2nd edition, Cold Spring Harbor Laboratory (1989) which is
incorporated herein by reference. For example, it is possible to
specifically hybridize a primer to a target nucleic acid by
hybridization at a little lower temperature than the melting
temperature used. Such primer can be designed with commercially
available primer construction softwares such as Primer 3 (Whitehead
Institute for Biomedical Research). According to the preferred
embodiments of the invention, a primer hybridizing a certain target
nucleic acid comprises the all or a part of a nucleic acid molecule
complementary to the target nucleic acid.
[0056] The primer according to the invention provided in the step
(a) described above is constructed in such a way that it is capable
of annealing to a template nucleic acid in the step (C), and
providing the hybridization of the sequences (B) and (Bc) in the
step (d) and a single-stranded sequence (A) to which another primer
having the same sequence can anneal. The construction of the
primers for conducting preferably these steps is described in more
details in the following.
[0057] In order to conduct efficient annealing of a new primer in
the step (e) described above, it is necessary to allow the portion
of said sequence (A) on the template nucleic acid to be
single-stranded by the formation of the stem-loop structure in the
step (d) of the complementary nucleic acid synthesized in the step
(c). Thus, it is important to determine (X-Y)/X which is the ratio
of the difference (X-Y) to X, in which X denotes the number of
bases in said sequence (Ac'), and Y denotes the number of bases in
the region flanked by said sequences (A) and (B) in the target
nucleic acid sequence. In this connection, it is not necessary to
allow also a portion which is positioned in the 5'-side of the
sequence (A) on the template nucleic acid and which does not affect
the hybridization of the primer to be single-stranded. In addition,
the efficient annealing of the new primer in the step (e) described
above requires the efficient formation of the stem-loop structure
in the step (d) on the complementary nucleic acid synthesized in
the step (c). It is also important for the efficient formation of
the stem-loop structure, that is, the efficient hybridization of
the sequence (B') and the sequence (Bc), to adjust the distance
(X+Y) between the sequences (B') and (Bc). Generally, the optimal
temperature for the primer extension reaction is up to about
72.degree. C., and thus it is difficult to dissociate the long
region of the extended strand at such lower temperature. It is thus
believed more preferred for the efficient hybridization of the
sequence (B') to the sequence (Bc) to have lesser number of bases
between both sequences. On the other hand, it is believed more
preferred for the hybridization of the sequence (B') to the
sequence (Bc) to allow the portion of the sequence (A) on the
template nucleic acid to be single-stranded, to have more number of
bases between both sequences.
[0058] From the viewpoint described above, in the absence of an
intervening sequence between said sequences (Ac') and (B'), the
primer according to the invention is designed in such fashion that
(X-Y)/X is in the range of -1.00 or more, preferably 0.00 or more,
more preferably 0.05 or more, and even more preferably 0.10 or
more, and in the range of 1.00 or less, preferably 0.75 or less,
more preferably 0.50 or less, and even more preferably 0.25 or
less. Moreover, (X+Y) is preferably in the range of 15 or more,
more preferably 20 or more, even more preferably 30 or more, and
preferably in the range of 50 or less, more preferably 48 or less,
and even more preferably 42 or less.
[0059] Also, in the presence of an intervening sequence between
said sequences (Ac') and (B'), the primer according to the
invention is designed in such fashion that {X-(Y-Y')}/X is in the
range of -1.00 or more, preferably 0.00 or more, more preferably
0.05 or more, even more preferably 0.10 or more, and in the range
of 1.00 or less, preferably 0.75 or less, more preferably 0.50 or
less, and even more preferably 0.25 or less. Moreover, (X+Y+Y') is
preferably in the range of 15 or more, more preferably 20 or more,
even more preferably 30 or more, and preferably in the range of 100
or less, more preferably 75 or less, and even more preferably 50 or
less.
[0060] The primer according to the invention is composed of
deoxynucleotides and/or ribonucleotides, and has a strand length in
which base pair bonding with the target nucleic acid can be
conducted while required specificity is maintained under the given
condition. The primer according to the invention has a strand
length in the range of preferably 15-100 nucleotides, and more
preferably 30-60 nucleotides. Also, the sequences (Ac') and (B')
have the lengths preferably in the range of 5-50 nucleotides, and
more preferably 10-30 nucleotides, respectively. If necessary, an
intervening sequence having itself no influence on the reaction may
be inserted between said sequences (Ac') and (B').
[0061] In the present invention, the term "ribonucleotide" (also
referred to as merely "N") means a ribonucleotide triphosphate and
includes, for example, ATP, UTP, CTP, GTP, and the like. Moreover,
the ribonucleotides includes derivatives thereof such as, for
example, alpha-thio-ribonucleotides in which the oxygen atom of
alpha-position of the phosphate group substituted by a sulfur
atom.
[0062] In addition, the primers according to the invention include
oligonucleotide primers composed of unmodified deoxynucleotides
and/or modified deoxynucleotides, as well as oligonucleotideprimers
composed of unmodified ribonucleotides and/or modified
ribonucleotides, chimeric oligonucleotide primers containing
unmodified deoxynucleotides and/or modified deoxynucleotides and
unmodified ribonucleotides and/or modified ribonucleotides, and the
like.
[0063] The primers according to the invention can be synthesized by
any methods which can be used for the synthesis of
oligonucleotides, such as the phosphate triesterification method,
the H-phosphonate method, the thiophosphonate method, and the like.
The primers according to the invention can be easily obtained by
the synthetic methods such as, for example, the phosphoamidite
method with use of a DNA synthesizer model 394 (ABI, Applied
Biosystem Inc.).
[0064] The DNA polymerases used in the process for synthesizing
nucleic acids according to the invention may be those having strand
displacement activities (strand displacement ability), and either
of normal temperature, mesophilic or thermoduric polymerases may be
successfully used. Also, the DNA polymerases may be either one of
natural products or variants having been artificially varied.
Furthermore, the DNA polymerases are preferably those having
substantially no 5'->3' exonuclease activities. Such DNA
polymerases include, for example, a variant of a DNA polymerase
derived from thermophilic bacillus bacteria such as Bacillus
stearothermophilus (referred to hereinafter as B. st) and Bacillus
caldotenax (referred to hereinafter as B. ca) of which the
5'.fwdarw.3' exonuclease activity has been deleted, the Klenow
fragment of an E. coli DNA polymerase I, and the like. The DNA
polymerases used in the process for synthesizing nucleic acids
according to the invention further include Vent DNA polymerase,
Vent (Exo-) DNA polymerase, DeepVent DNA polymerase, DeepVent
(Exo-) DNA polymerase, cD29 phage DNA polymerase, MS-2 phage DNA
polymerase, Z-Taq DNA polymerase, Pfu DNA polymerase, Pfu turbo DNA
polymerase, KOD DNA polymerase, 9.degree. Nm DNA polymerase,
Therminater DNA polymerase, and the like.
[0065] The other reagents which may be used in the process for
synthesizing nucleic acids according to the invention include
catalysts such as magnesium chloride, magnesium acetate, magnesium
sulfate, and the like; substrates such as dNTP mix, and the like;
and buffers such as Tris-HCl buffer, Tricine buffer, phosphate Na
buffer, phosphate K buffer, and the like. In addition, there may be
used additives such as dimethyl sulfoxide, and betaine
(N,N,N-trimethylglycine), acidic materials described in
International Publication WO99/54455, cationic complexes, and the
like.
[0066] The nucleic acids used as a template in the process for
synthesizing nucleic acids according to the invention may be either
DNA or RNA. These nucleic acids can be isolated from samples
derived from organisms such as blood, tissues, cells as well as
animals or plants, or from microorganisms which have been separated
from foodstuffs, soils, drainage, and the like.
[0067] The template nucleic acid can be isolated by optional
methods including, for example, dissolution treatment with surface
active agents, sonification, shaking agitation with glass beads,
and a method with a French press. Also, in the presence of
endonuclease, it is preferred to purify the nucleic acid isolated.
The nucleic acid can be purified by the methods such as for example
phenol extraction, chromatography, ion-exchange, gel
electrophoresis, density-dependent centrifugation, and the
like.
[0068] More particularly, it is possible to use either of
double-stranded nucleic acids such as a genomic DNA or a PCR
fragment isolated by the methods described above or single-stranded
nucleic acids such as a cDNA prepared by reverse transcription from
whole RNA or mRNA. The double-stranded nucleic acid can be
optimally used by forming a single strand by the denaturing of
it.
[0069] Enzymes used in the reverse transcription reaction are not
particularly limited except that the enzymes have a cDNA
synthesizing activity from RNA as a template, and include reverse
transcriptases derived from a variety of sources such as avian
myeloblastosis virus derived reverse transcriptase (AMV RTase),
Rous related virus-2 reverse transcriptase (RAV-2 RTase), Moloney
murine leukemia virus derived reverse transcriptase (MMLV RTase),
and the like. In addition, it is possible to use a DNA polymerase
having also a reverse transcription activity. It is also possible
to use Thermus bacteria derived DNA polymerase (TthDNA polymerase
and the like), Bacillus bacteria derived DNA polymerase, and the
like. Particularly preferred enzymes include, for example,
thermophilic Bacillus bacteria derived DNA polymerases such as B.
st derived DNA polymerase, and B. ca derived DNA polymerases (Bca
DNA polymerases) such as BcaBEST DNA polymerase, Bca (exo-) DNA
polymerase, and the like. By way of example, the Bca DNA polymerase
requires no manganese ion in the reaction, and it is possible to
synthesize cDNA while suppressing the formation of the secondary
structure of a template RNA under high temperature conditions.
[0070] Furthermore, in the process for synthesizing nucleic acids
according to the invention, it is possible to conduct the reverse
transcription reaction from whole RNA or mRNA and the DNA
polymerase reaction in the presence of cDNA as a template with a
polymerase such as BcaBEST DNA polymerase, Bca(exo-) DNA
polymerase, and the like. Also, the DNA polymerase may be combined
with a reverse transcriptase such as MMLV reverse transcriptase,
and the like.
[0071] In the process for synthesizing nucleic acids according to
the invention, while it is possible to use the template nucleic
acid, even if it is a double-stranded nucleic acid, directly in the
reaction, it is also possible to carry out efficiently the
annealing of a primer to the template nucleic acid after it is
denatured into a single strand, if necessary. Heating to about
95.degree. C. is a preferred denaturation method. The other
denaturation methods also include the denaturation of nucleic acids
by ascending pH, but in this case it is necessary to descend pH in
order to hybridize the primer to the target nucleic acid.
[0072] According to the preferred embodiment of the present
invention, the double-stranded nucleic acid obtained in the step
(e) is used repeatedly in the step (d). That is to say, the
double-stranded nucleic acid obtained in the step (e) has the same
structure as those obtained in the step (c), and thus it is
directly used in the step (d). It is thus possible to produce in a
large scale a nucleic acid complementary to the target nucleic acid
sequence in the template nucleic acid.
[0073] One of the features of the process for synthesizing nucleic
acids according to the invention is the practicability in an
isothermal condition. Thus, according to the invention, there is
provided a process for synthesizing a nucleic acid complementary to
a target nucleic acid sequence in a template nucleic acid,
comprising a step of providing a solution for synthesizing nucleic
acids which comprises the template nucleic acid and the primer
according to the invention, and a step of isothermally incubating
the nucleic acid synthesizing solution. In this connection, the
term "isothermally" means that temperature is maintained at about
constant temperature so as the enzyme and the primer to be
substantially functional.
[0074] The process for synthesizing nucleic acids according to the
invention can be carried out by maintaining the temperature in the
range in which the activity of the enzyme used is maintained. Also,
in order to anneal the primer to the target nucleic acid in the
process for synthesizing nucleic acids according to the invention,
the reaction temperature is preferably set in the vicinity of the
melting temperature (Tm) of the primer or less, and the level of
stringency is preferably set in view of the melting temperature
(Tm) of the primer. Thus, the temperature is preferably in the
range of about 20- about 75.degree. C., more preferably in the
range of about 35- about 65.degree. C.
[0075] In the process for synthesizing nucleic acids according to
the invention, it is possible to amplify the target nucleic acid
sequence in a double-stranded nucleic acid by using the
double-stranded nucleic acid as a template and a primer set
comprising the two primers according to the invention designed for
each of the strands. Thus, according to the invention, there is
provided a process for amplifying a target nucleic acid sequence in
a double-stranded template nucleic acid, which comprises the steps
of:
(a) providing a first primer comprising in its 3'-end portion a
sequence (Ac') which hybridizes a sequence (A) in the 3'-end
portion of the target nucleic acid sequence in the first strand of
the double-stranded template nucleic acid, and in the 5'-side of
said sequence (Ac') a sequence (B') which hybridizes the
complementary sequence (Bc) of a sequence (B) positioned in the
5'-side of said sequence (A) on said target nucleic acid sequence,
wherein
[0076] in the absence of an intervening sequence between said
sequences (Ac') and (B'), (X-Y)/X is in the range of -1.00 to 1.00,
in which X denotes the number of bases in said sequence (Ac'), and
Y denotes the number of bases in the region flanked by said
sequences (A) and (B) on the target nucleic acid sequence, and
[0077] in the presence of an intervening sequence between said
sequences (Ac') and (B'), {X-(Y-Y')}/X is in the range of -1.00 to
1.00, in which X and Y have the same meanings as above, and Y'
denotes the number of bases in said intervening sequence;
(b) providing the second primer comprising in its 3'-end portion a
sequence (Cc') which hybridizes a sequence (C) in the 3'-end
portion of the target nucleic acid sequence in the second strand of
the double-stranded template nucleic acid, and in the 5'-side of
said sequence (Cc') a sequence (D') which hybridizes the
complementary sequence (Dc) of a sequence (D) positioned in the
5'-side of said sequence (C) on said target nucleic acid sequence,
wherein
[0078] in the absence of an intervening sequence between said
sequences (Cc') and (D'), (X-Y)/X is in the range of -1.00 to 1.00,
in which X denotes the number of bases in said sequence (Cc'), and
Y denotes the number of bases in the region flanked by said
sequences (C) and (D) on the target nucleic acid sequence, and
[0079] in the presence of an intervening sequence between said
sequences (Cc') and (D'), {X-(Y-Y')}/X is in the range of -1.00 to
1.00, in which X and Y have the same meanings as above, and Y'
denotes the number of bases in said intervening sequence;
(c) providing a double-stranded template nucleic acid consisting of
the first and second template nucleic acids; (d) annealing said
first and second primers to said first and second template nucleic
acids, respectively, and synthesizing the first and second
complementary nucleic acids comprising the complementary sequence
of said target nucleic acid by the primer extension reaction,
respectively; (e) hybridizing the sequences (B') and (D')
positioned in the 5'-side of the first and second complementary
nucleic acids synthesized in the step (d) with the sequences (Bc)
and (Dc) on the same complementary nucleic acids, respectively, and
thereby allowing the portions of said sequences (A) and (C) on the
first and second template nucleic acids to be single-stranded,
respectively; and (f) annealing another primers having the same
sequence as said primers to the single-stranded sequence (A) and
(C) portions of the first and second template nucleic acids from
the step (e) and conducting strand displacement reaction, thereby
displacing the first and second complementary nucleic acids
synthesized in the step (d) by the complementary nucleic acids
newly synthesized with said another primers.
[0080] In this connection, the details on the design of the
primers, the reaction conditions and the like are the same as
described above on the process for synthesizing nucleic acids
according to the invention.
[0081] According to the preferred embodiments of the invention, the
double-stranded nucleic acid obtained by the step (f) in the
process for amplifying nucleic acids according to the invention is
used repeatedly in the step (e). That is to say, the
double-stranded nucleic acid obtained by the step (f) has the same
structure as those obtained in the step (d), and thus it is
directly used in the step (e).
[0082] According to the other preferred embodiments, the first and
second complementary nucleic acids obtained as single-stranded
nucleic acids by the step (f) are used repeatedly as the second and
first template nucleic acids, respectively, in the step (d). That
is, the first complementary nucleic acid obtained by the step (f)
is used as the second template nucleic acid in the step (d), and
the second complementary nucleic acid obtained by the step (f) is
used as the first template nucleic acid in the step (d).
[0083] The process for amplifying nucleic acids according to the
invention can be practiced isothermally in the similar manner to
the process for synthesizing nucleic acids according to the
invention. Thus, according to the invention, there is provided a
process for amplifying a target nucleic acid sequence in a
double-stranded template nucleic acid, comprising a step of
providing a solution for amplifying a nucleic acid which comprises
the double-stranded template nucleic acid and the primer set
according to the invention, and a step of isothermally incubating
the solution for amplifying the nucleic acid. In this connection,
the term "isothermally" means that temperature is maintained at
about constant temperature so as the enzyme and the primer to be
substantially functional. The details on the temperature conditions
are the same as described above on the process for synthesizing
nucleic acids according to the invention.
[0084] The process for amplifying the nucleic acid according to the
invention can be carried out optimally as the process for
amplifying a nucleic acid which comprises a step of preparing cDNA
from RNA even in the case of its use as a template by using a DNA
polymerase having reverse transcriptase activity such as BcaBEST
DNA polymerase. The step of preparing cDNA from RNA may be
conducted independently, and the product may be used in the process
for amplifying a nucleic acid according to the invention.
[0085] In the process for synthesizing a nucleic acid and the
process for amplifying a nucleic acid according to the invention, a
melting temperature adjusting agent can be added to the reaction
solution in order to enhance the synthetic efficiency or
amplification efficiency of the nucleic acid. The melting
temperature (Tm) of the nucleic acid is generally determined by the
particular nucleotide sequence of a double strand forming portion
in the nucleic acid. The melting temperature (Tm) can be changed by
adding a melting temperature adjusting agent in the reaction
solution, and thus the strength of the double strand formation in
the nucleic acid can be adjusted at a fixed temperature. Many
melting temperature adjusting agents frequently employed have an
effect of lowering melting temperatures. The melting temperature of
double strand forming portion between two nucleic acids can be
lowered, and in other words, the strength of forming the double
strand can be reduced by adding such melting temperature adjusting
agent. Thus, the addition of such melting temperature adjusting
agent into a reaction solution in the process for synthesizing a
nucleic acid and the process for amplifying a nucleic acid
according to the invention can efficiently change the
double-stranded portion into a single strand in a nucleic acid
region which is rich in GC for forming a strong double strand or in
a region in which a complicated secondary structure is formed.
Thus, the completion of the extension reaction with a primer makes
easy the hybridization of the next primer on the aimed region, and
the synthetic efficiency and amplification efficiency of a nucleic
acid can be enhanced. The melting temperature adjusting agent used
in the invention and its concentration in a reaction solution is
appropriately selected by a person skilled in the art in
consideration of the other reaction conditions which affect
hybridization such as salt concentration, reaction temperature, and
the like. Thus, the melting temperature adjusting agents include
preferably, but not limited to, dimethyl sulfoxide (DMSO), betaine,
formamide or glycerol, or any combinations thereof, and more
preferably dimethyl sulfoxide (DMSO).
[0086] Furthermore, it is also possible to add an enzyme
stabilizing agent to the reaction solution in the process for
synthesizing nucleic acids and the process for amplifying nucleic
acids according to the invention. As a result, the enzyme in the
reaction mixture is stabilized, and the synthetic efficiency and
amplification efficiency of nucleic acids can be enhanced. The
enzyme stabilizing agents used in the present invention may be any
one which is known in the art and includes glycerol without
limitation thereto.
[0087] In addition, it is also possible to add a reagent for
enhancing the heat resistance of enzymes such as DNA polymerase or
reverse transcriptase to the reaction solution in the process for
synthesizing nucleic acids and the process for amplifying nucleic
acids according to the invention. As a result, the enzyme in the
reaction mixture is stabilized, and the synthetic efficiency and
amplification efficiency of nucleic acids can be enhanced. Such
reagent may be any one which is known in the art and includes
trehalose without limitation thereto.
[0088] In the process for synthesizing nucleic acids and the
process for amplifying nucleic acids according to the invention,
the synthesis reaction or the amplification reaction are repeated
until the enzyme is inactivated or one of the reagents such as the
primers has been exhausted.
[0089] In the process for synthesizing nucleic acids and the
process for amplifying nucleic acids according to the invention, it
is also possible to use a nucleic acid as a template nucleic acid.
The term "non-natural nucleotide" herein means a nucleotide which
contains bases other than the bases contained in natural
nucleotides (adenine, guanine, cytosine, and thymine or uracil) and
is incorporated into a nucleic acid sequence, and includes for
example xanthosines, diaminopyridines, isoG, isoC (Proc. Natl.
Acad. Sci. USA 92, 6329-6333, 1995), and the like. Target nucleic
acids containing non-natural nucleotides are generally amplified
with nucleic acid amplifying enzymes having no heat resistance. On
the other hand, the process for synthesizing nucleic acids and the
process for amplifying nucleic acids according to the invention can
be conducted isothermally for example at about 50.degree. C., so
that the nucleic acid amplifying enzymes such as DNA polymerase
will not be inactivated so often as compared with the conventional
PCR method. Thus, the process for synthesizing nucleic acids and
the process for amplifying nucleic acids according to the invention
can also be effectively employed for the amplification of
non-natural nucleotide-containing target nucleic acids in which the
nucleic acid-amplifying enzymes having no heat resistance are used.
Enzymes used for the amplification of nucleic acids containing
non-natural nucleotides may be the ones which are capable of
amplifying such target nucleic acids without any further
limitations, and preferably include a Y188L/E478Q mutated HIV I
reverse transcriptase, an AMV reverse transcriptase, a Klenow
fragment of a DNA polymerase, a 9.degree. N DNA polymerase, a
HotPub DNA polymerase, and the like (see Michael Sismour 1 et al.,
Biochemistry 42(28), 8598, 2003/U.S. Pat. No. 6,617,106; Michael 3.
Lutz et al., Bioorganic & Medical Chemistry Letters 8,
1149-1152, 1998; etc.). Moreover, it is also possible to add
materials for improving the heat resistance of nucleic
acid-amplifying enzymes, such as trehalose, to a reaction solution,
and thus non-natural nucleotide-containing target nucleic acids can
be amplified more efficiently.
[0090] It is possible to prepare quickly a single-stranded nucleic
acid for immobilizing on a DNA chip, a single-stranded DNA probe
for determining the base sequence or a megaprimer for the long
chain PCR method by using the process for synthesizing nucleic
acids or the process for amplifying nucleic acids according to the
invention. For instance, it is possible to selectively amplify only
a sense sequence or an antisense sequence according to objects by
using the process for synthesizing nucleic acids or the process for
amplifying nucleic acids according to the invention. Therefore, the
process for synthesizing nucleic acids or the process for
amplifying nucleic acids according to the invention are also useful
as the process for producing the sense or antisense sequence of a
certain target nucleic acid.
[0091] Amplified products obtained by the process for synthesizing
nucleic acids or the process for amplifying nucleic acids according
to the invention can be detected by any appropriate methods. One of
the methods is the detection of an amplified product having a
specific size by the conventional gel electrophoresis. According to
this method, the amplified product can be detected with fluorescent
materials such as ethidium bromide, SYBR Green, and the like. In
another method, the product can also be detected by hybridizing a
labeled probe having a label such as biotin with the product.
Biotin can be detected by binding with fluorescent-labeled avidin
or with avidin bound to an enzyme such as peroxidase.
[0092] Also, the amplified product obtained by the process for
synthesizing nucleic acids or the process for amplifying nucleic
acids according to the invention can be detected with an
immunochromatograph. In this method, it is devised to employ a
chromatographic medium with a macroscopically detectable label
(immunochromatography technique). Hybridization of the amplified
fragment and the labeled probe, and immobilization of a capturing
probe, which is capable of hybridizing with the other different
sequences in the amplified fragment, on the chromatographic medium
makes it possible to trap the product at the immobilized part and
to detect it in the chromatographic medium. As a consequence,
macroscopically simple detection of the product can be
conducted.
[0093] Further, in the process for synthesizing nucleic acids or
the process for amplifying nucleic acids according to the
invention, a primer immobilized on beads can be used for confirming
the agglutination of the beads due to the synthesis or
amplification of a nucleic acid and thus detecting the synthetic or
amplification product. Also, in order to synthesize or amplify a
plurality of target nucleic acids, each primer designed with regard
to each of the target nucleic acids can be immobilized on beads,
which are different in color, shape or the like and thus can be
distinguished from one another, for the reaction of synthesizing or
amplifying nucleic acids in a reaction solution involving these
beads. In such case, whether the respective target nucleic acids is
present or not is recognized by confirming the presence or absence
of the agglutination of respective beads.
[0094] Furthermore, in the process for synthesizing nucleic acids
or the process for amplifying nucleic acids according to the
invention, a primer immobilized on an array such as e.g. DNA chip
can be used for confirming the agglutinated nucleic acids produced
on the array due to the synthesis or amplification of a nucleic
acid and thus detecting the synthetic or amplification product.
Also, in order to synthesize or amplify a plurality of target
nucleic acids, each primer designed with regard to each of the
target nucleic acids can be immobilized on an array, which can be
distinguished from one another, for the reaction of synthesizing or
amplifying nucleic acids in a reaction solution involving the
array. In such case, whether the respective target nucleic acids is
present or not is recognized by confirming the presence or absence
of the agglutinated nucleic acid at the corresponding positions on
the array. It is also possible to use an intercalater in place of
the confirmation of the agglutinated nucleic acid.
[0095] The amplified fragment obtained by the process for
amplifying a nucleic acid according to the invention is composed of
ordinary bases, and thus can be subcloned into an appropriate
vector by using a restriction enzyme site within the amplified
fragment. In addition, it is also possible to carry out treatment
with restriction enzymes such as RFLP, which can be employed widely
in the field of genetic test as well. Also, since the amplified
fragment obtained by the process for amplifying a nucleic acid
according to the invention is composed of ordinary bases, the
incorporation of the promoter sequence of an RNA polymerase into
the amplified fragment makes it possible to synthesize an RNA
directly from the amplified fragment, and the RNA can also be used
as an RNA probe.
[0096] Furthermore, in the process for synthesizing nucleic acids
or the process for amplifying nucleic acids according to the
invention, a base labeled with biotin or a fluorescent material can
be used in place of an ordinary dNTP to prepare a DNA probe labeled
with biotin or the fluorescent material.
[0097] The single-stranded nucleic acid prepared by the process for
synthesizing nucleic acids or the process for amplifying nucleic
acids according to the invention can be used as a DNA fragment
immobilized on the DNA chip. That is to say, the process for
synthesizing nucleic adds or the process for amplifying nucleic
acids according to the invention can be applied also to the method
for preparing a DNA strand immobilized in the preparation of a DNA
chip. It is also possible to prepare a DNA chip by preliminarily
immobilizing the 5'-end of a primer on the DNA chip, on which the
synthesis or amplification of a nucleic acid is carried out. It is
also possible to conduct the real time detection together with the
synthesis or amplification of a nucleic acid on the DNA chip by
preliminarily adding a fluorescent labeling probe prior to the
synthesis or amplification of a nucleic acid.
[0098] In order to practice the process for synthesizing nucleic
acids or the process for amplifying nucleic acids according to the
invention, reagents involved in the process can be combined to make
a kit. Thus, the kit according to the invention comprises a primer
or a primer set according to the invention. Also, the process for
synthesizing nucleic acids or the process for amplifying nucleic
acids according to the invention has an advantage that the process
requires no primers other than the primer or the primer set
according to the invention. Thus, according to the preferred
embodiments of the invention, the kit according to the invention
comprises no primer ingredients other than the primer or the primer
set according to the invention. The kit according to the invention
may further include reagents, reaction vessels, instructions
described above, and the like.
EXAMPLES
[0099] The invention is further described more particularly in the
following examples, which should not be construed in any way as
restrictions on the invention.
Example 1
[0100] In this example, the amplification of a human STS DYS237
gene was attempted with Human DNA (Clontech) as a template. Primers
employed were as follows. These primers were synthesized by the
consignment to ESPEC OLIGO SERVICE CORP.
[0101] The features of the primers used in the experiment were
described below. The relationships of respective primers to the
template were as illustrated in FIG. 2. In this connection,
underlined parts in the following sequences represent 3'-end
regions common to each of sense primers and antisense primers,
respectively.
[0102] Primer set 1: a combination of primers comprising solely
sequences annealing to the template (20mer);
TABLE-US-00001 SY153L: GCATCCTCATTTTATGTCCA; (SEQ ID NO: 1) SY153R:
CAACCCAAAAGCACTGAGTA. (SEQ ID NO: 2)
[0103] Primer set 2: a combination of primers in which after
annealing of sequences placed in the 3'-end side of the respective
primers (20mer: sequences identical to those in Primer set 1) to
the template and extension reaction, a sequence in the 5'-end side
(13mer) is hybridized with a region starting from a base downstream
of the 3'-end portion of the respective primers on a strand
extended from the primer;
TABLE-US-00002 SY153LP13-0: AAGTCTCTGATGTGCATCCTCATTTTATGTCCA; (SEQ
ID NO: 3) SY153RP13-0: AGAACTCGCTTTACAACCCAAAAGCACTGAGTA. (SEQ ID
NO: 4)
[0104] Primer set 3: a combination of primers in which after
annealing of sequences placed in the 3'-end side of the respective
primers (20mer: sequences identical to those in Primer set 1) to
the template and extension reaction, a sequence in the 5'-end side
(13mer) is hybridized with a region starting from six bases
downstream of the 3'-end portion of the respective primers on a
strand extended from the primer;
TABLE-US-00003 SY153LP13-5: GTATTAAGTCTCTGCATCCTCATTTTATGTCCA; (SEQ
ID NO: 5) SY1535P13-5: CACTAAGAACTCGCAACCCAAAAGCACTGAGTA. (SEQ ID
NO: 6)
[0105] Primer set 4: a combination of primers in which after
annealing of sequences placed in the 3'-end side of the respective
primers (20mer: sequences identical to those in Primer set 1) to
the template and extension reaction, a sequence in the 5'-end side
(13mer) is hybridized with a region starting from 11 bases
downstream of the 3'-end portion of the respective primers on a
strand extended from the primer;
TABLE-US-00004 SY153LP13-10: GTTCAGTATTAAGGCATCCTCATTTTATGTCCA;
(SEQ ID NO: 7) SY153RP13-10: AGCATCACTAAGACAACCCAAAAGCACTGAGTA.
(SEQ ID NO: 8)
[0106] Primer set 5: a combination of primers in which after
annealing of sequences placed in the 3'-end side of the respective
primers (20mer: sequences identical to those in Primer set 1) to
the template and extension reaction, a sequence in the 5'-end side
(13mer) is hybridized with a region starting from 16 bases
downstream of the 3'-end portion of the respective primers on a
strand extended from the primer;
TABLE-US-00005 SY153LP13-15: CATTTGTTCAGTAGCATCCTCATTTTATGTCCA;
(SEQ ID NO: 9) SY153RP13-15: CTTGCAGCATCACCAACCCAAAAGCACTGAGTA.
(SEQ ID NO: 10)
[0107] Primer set 6: a combination of primers in which after
annealing of sequences placed in the 3'-end side of the respective
primers (20mer: sequences identical to those in Primer set 1) to
the template and extension reaction, a sequence in the 5'-end side
(10mer) is hybridized with a region starting from 21 bases
downstream of the 3'-end portion of the respective primers on a
strand extended from the primer;
TABLE-US-00006 SY153LP10: GGCATTTGTTGCATCCTCATTTTATGTCCA; (SEQ ID
NO: 11) SY153RP10: ATCTTGCAGCCAACCCAAAAGCACTGAGTA. (SEQ ID NO:
12)
[0108] Primer set 7: a combination of primers in which after
annealing of sequences placed in the 3'-end side of the respective
primers (20mer: sequences identical to those in Primer set 1) to
the template and extension reaction, a sequence in the 5'-end side
(13mer) is hybridized with a region starting from 21 bases
downstream of the 3'-end portion of the respective primers on a
strand extended from the primer;
TABLE-US-00007 SY153LP13: TGTGGCATTTGTTGCATCCTCATTTTATGTCCA; (SEQ
ID NO: 13) SY153RP13: AACATCTTGCAGCCAACCCAAAAGCACTGAGTA. (SEQ ID
NO: 14)
[0109] Primer set 8: a combination of primers in which after
annealing of sequences placed in the 3'-end side of the respective
primers (20mer: sequences identical to those in Primer set 1) to
the template and extension reaction, a sequence in the 5'-end side
(16mer) is hybridized with a region starting from 21 bases
downstream of the 3'-end portion of the respective primers on a
strand extended from the primer;
TABLE-US-00008 (SEQ ID NO: 15) SY153LP16:
TTATGTGGCATTTGTTGCATCCTCATTTTATGTCCA; (SEQ ID NO: 16) SY153RP16:
CTTAACATCTTGCAGCCAACCCAAAAGCACTGAGTA.
[0110] Primer set 9: a combination of primers in which after
annealing of sequences placed in the 3'-end side of the respective
primers (20mer: sequences identical to those in Primer set 1) to
the template and extension reaction, a sequence in the 5'-end side
(22mer) is hybridized with a region starting from 21 bases
downstream of the 3'-end portion of the respective primers on a
strand extended from the primer;
TABLE-US-00009 SY153LP22: (SEQ ID NO: 17)
TTACCTTTATGTGGCATTTGTTGCATCCTCATTTTATGTCCA; SY153RP22: (SEQ ID NO:
18) ATTTAACTTAACATCTTGCAGCCAACCCAAAAGCACTGAGTA.
[0111] Primer set 10: a combination of primers in which after
annealing of sequences placed in the 3'-end side of the respective
primers (20mer: sequences identical to those in Primer set 1) to
the template and extension reaction, a sequence in the 5'-end side
(25mer) is hybridized with a region starting from 21 bases
downstream of the 3'-end portion of the respective primers on a
strand extended from the primer;
TABLE-US-00010 SY153LP25: (SEQ ID NO: 19)
TCATTACCTTTATGTGGCATTTGTTGCATCCTCATTTTATGTCCA; SY153RP25: (SEQ ID
NO: 20) AAGATTTAACTTAACATCTTGCAGCCAACCCAAAAGCACTGAGTA.
[0112] Primer set 11: a combination of primers in which after
annealing of sequences placed in the 3'-end side of the respective
primers (20mer: sequences identical to those in Primer set 1) to
the template and extension reaction, a sequence in the 5'-end side
(28mer) is hybridized with a region starting from 21 bases
downstream of the 3'-end portion of the respective primers on a
strand extended from the primer;
TABLE-US-00011 SY153LP28: (SEQ ID NO: 21)
CAGTCATTACCTTTATGTGGCATTTGTTGCATCCTCATTTTATGTCCA; SY153RP28: (SEQ
ID NO: 22) AAGAAGATTTAACTTAACATCTTGCAGCCAACCCAAAAGCACTGAGTA.
[0113] A reaction mixture (25 .mu.l) of Tris-HCl (20 mM, pH8.8),
KCl (10 mM), (NH.sub.4).sub.2SO.sub.4 (10 mM), MgSO.sub.4 (2 mM),
Triton X-100 (0.1%), dNTP (0.4 mM), a primer pair (100 .mu.mol,
resp.), a template DNA (100 ng), and Bst DNA polymerase (8U; NEW
ENGLAND BioLabs) was prepared, and incubated at 60.degree. C. for
20, 40, or 60 minutes.
[0114] A 5 .mu.l portion of each mixture was subjected to
electrophoresis in 3% NuSieve GTG Agarose (manufactured by
BioWhittaker Molecular Applications (BMA); purchased from Takara
Bio Inc.; "NuSieve" is the registered trademark of BMA). Results
are shown in FIGS. 5, 6 and 7. Samples in respective lanes in these
figures are shown in the following Tables 1-3.
TABLE-US-00012 TABLE 1 Explanation of lanes of electrophoretic
photograms in FIG. 5 Lane Primer Template Reaction Time (min.) 1
DNA size marker (20 bp ladder) 2 Primer set 1 Yes 20 3 Primer set 1
Yes 40 4 Primer set 1 Yes 60 5 Primer set 1 No 60 6 Primer set 2
Yes 20 7 Primer set 2 Yes 40 8 Primer set 2 Yes 60 9 Primer set 2
No 60 10 Primer set 3 Yes 20 11 Primer set 3 Yes 40 12 Primer set 3
Yes 60 13 Primer set 3 No 60 14 Primer set 4 Yes 20 15 Primer set 4
Yes 40 16 Primer set 4 Yes 60 17 Primer set 4 No 60 18 Primer set 5
Yes 20 19 Primer set 5 Yes 40 20 Primer set 5 Yes 60 21 Primer set
5 No 60
TABLE-US-00013 TABLE 2 Explanation of lanes of electrophoretic
photograms in FIG. 6 Lane Primer Template Reaction Time (min.) 1
DNA size marker (20 bp ladder) 2 Primer set 6 Yes 20 3 Primer set 6
Yes 40 4 Primer set 6 Yes 60 5 Primer set 6 No 60 6 Primer set 7
Yes 20 7 Primer set 7 Yes 40 8 Primer set 7 Yes 60 9 Primer set 7
No 60 10 Primer set 8 Yes 20 11 Primer set 8 Yes 40 12 Primer set 8
Yes 60 13 Primer set 8 No 60 14 Primer set 9 Yes 20 15 Primer set 9
Yes 40 16 Primer set 9 Yes 60 17 Primer set 9 No 60 18 Primer set
10 Yes 20 19 Primer set 10 Yes 40 20 Primer set 10 Yes 60 21 Primer
set 10 No 60
TABLE-US-00014 TABLE 3 Explanation of lanes of electrophoretic
photograms in FIG. 7 Lane Primer Template Reaction Time (min.) 1
DNA size marker (20 bp ladder) 2 Primer set 11 Yes 20 3 Primer set
11 Yes 40 4 Primer set 11 Yes 60 5 Primer set 11 No 60
[0115] In Lanes 5, 9, 13, 17 and 21 of respective Figures, no bands
other than those of stained unreacted primers were observed due to
the addition of no template.
[0116] In Lanes 2 and 3 of FIG. 5, bands of an unreacted primer and
a template having a high molecular size were confirmed because of
the addition of a template. However, no amplified products were
confirmed because of insufficient reaction time. As shown in Lane 4
of FIG. 5, in the sample having a template added thereto and
reacted for 60 minutes were obtained an amplified product, which
was in the form of a ladder in the low size region and of a smear
in the high size region. In Lanes 2-5 of FIG. 5, Primer set 1
containing solely an oligonucleotide (20mer) which anneals to a
template was used and no synthetic reaction occurred, so that no
amplified products as the object were obtained.
[0117] In Lane 6 and the subsequent lanes of FIG. 5, there is shown
the results of amplifications with a primer set in which after
annealing of sequences placed in the 3'-end side of the respective
primers (20mer: sequences identical to those in Primer set 1) to
the template, a sequence in the 5'-end side is hybridized with a
region starting from bases downstream of the 3'-end portion of the
respective primers on the extended strand of the primers.
[0118] As shown in Lanes 8 and 12 of FIG. 5, when Primer sets 2 or
3 were used, it was possible to obtain the aimed amplification
product in a reaction time of 60 minutes. Of the low size bands,
the band in the vicinity of ca. 160 by is an expected product of
the synthetic reaction of the invention.
[0119] Further, as shown in Lanes 15 and 16 of FIG. 5, Lanes 3, 4,
7, 8, 11, 12, 15, 16, 19 and 20 of FIG. 6, and Lanes 3 and 4 of
FIG. 7, it was possible to obtain the aimed amplification product
in a reaction time of 40 minutes or more when Primer sets 4, 6, 7,
8, 9, 10 and 11 were used. Of the low size bands, the band in the
vicinity of ca. 160 bp is an expected product of the synthetic
reaction of the invention.
[0120] In addition, as shown in Lanes 18-20 of FIG. 5, it was
possible to obtain the aimed amplification product in a reaction
time of 20 minutes or more when Primer set 5 was used. Of the low
size bands, the band in the vicinity of ca. 160 by is an expected
product of the synthetic reaction of the invention.
[0121] When the distance between the region corresponding to the
sequence in the 3'-end side of the primer on the extended strand of
the primer and the region with which the sequence in the 5'-end
side hybridizes is comparatively small as in Primer sets 2 and 3,
it is considered that a long reaction time is required because most
of the sequence on a template having the same sequence to which the
next primer is to be annealed remains as a double strand and the
subsequent annealing hardly occurs.
[0122] Also, when the distance between the region corresponding to
the sequence in the 3'-end side of the primer on the extended
strand of the primer and the region with which the sequence in the
5'-end side hybridizes is comparatively large as in Primer sets
6-11, it is considered that a comparatively long reaction time is
required because the folding efficiency of the sequence in the
5'-end side of each primer is lowered.
[0123] On the other hand, when the distance between the region
corresponding to the sequence in the 3'-end side of the primer on
the extended strand of the primer and the region with which the
sequence in the 5'-end side hybridizes is not excessively small or
excessively large as in Primer set 5, it is considered that the
most efficient amplification can be performed in the invention.
Example 2
[0124] In this example, the amplification of an sY160 gene was
attempted with Human DNA (Clontech) as a template. Primers employed
were as follows. These primers were synthesized by the consignment
to ESPEC OLIGO SERVICE CORP.
[0125] The features of the primers used in the experiment were
described below. The relationships of respective primers to the
template were as illustrated in FIG. 3. In this connection,
underlined parts in the following sequences represent 3'-end
regions common to each of sense primers and antisense primers,
respectively.
[0126] Primer set 12: a combination of a sense primer in which
after annealing of a sequence placed in the 3'-end side of a primer
(20mer) to the template and extension reaction, a sequence in the
5'-end side (13mer) is hybridized with a region starting from 27
bases downstream of the 3'-end portion of the primer on a strand
extended from the primer, and an antisense primer in which after
annealing of a sequence placed in the 3'-end side of a primer
(20mer) to the template and extension reaction, a sequence in the
5'-end side (13mer) is hybridized with a region starting from 21
bases downstream of the 3'-end portion of the primer on a strand
extended from the primer;
TABLE-US-00015 SY160LP13: ATTCGATTCCGTTTACGGGTCTCGAATGGAATA; (SEQ
ID NO: 23) SY160RP13: CTAAATCGAATGGTCATTGCATTCCTTTCCATT. (SEQ ID
NO: 24)
[0127] Primer set 13: a combination of a sense primer in which
after annealing of a sequence placed in the 3'-end side of a primer
(20mer: sequence identical to that in Primer set 12) to the
template and extension reaction, a sequence in the 5'-end side
(13mer) is hybridized with a region starting from 27 bases
downstream of the 3'-end portion of the primer on a strand extended
from the primer, and an antisense primer in which after annealing
of a sequence placed in the 3'-end side of a primer (20mer:
sequence identical to that in Primer set 12) to the template and
extension reaction, a sequence in the 5'-end side (16mer) is
hybridized with a region starting from 21 bases downstream of the
3'-end portion of the primer on a strand extended from the
primer;
TABLE-US-00016 (SEQ ID NO: 25) SY160LP16:
GACATTCGATTCCGTTTACGGGTCTCGAATGGAATA; (SEQ ID NO: 26) SY160RP16:
GAACTAAATCGAATGGTCATTGCATTCCTTTCCATT.
[0128] A reaction mixture (25 .mu.l) of Tris-HCl (20 mM, pH8.8),
KCl (10 mM), (NH.sub.4).sub.2SO.sub.4 (10 mM), MgSO.sub.4 (2 mM),
Triton X-100 (0.1%), dNTP (0.4 mM), a primer pair (100 .mu.mol,
resp.), a template DNA (100 ng), and Bst DNA polymerase (8U; NEW
ENGLAND BioLabs) was prepared, and incubated at 60.degree. C. for
60 or 90 minutes.
[0129] A 5 .mu.l portion of each mixture was subjected to
electrophoresis in 3% NuSieve GTG Agarose (manufactured by
BioWhittaker Molecular Applications (BMA); purchased from Takara
Bio Inc.; "NuSieve" is the registered trademark of BMA). Results
are shown in FIG. 8. Samples in respective lanes in these figures
are shown in the following Table 4.
TABLE-US-00017 TABLE 4 Explanation of lanes of electrophoretic
photograms in FIG. 8 Lane Primer Template Reaction Time (min.) 1
DNA size marker (20 bp ladder) 2 Primer set 12 Yes 60 3 Primer set
12 Yes 90 4 Primer set 12 No 90 5 Primer set 13 Yes 60 6 Primer set
13 Yes 90 7 Primer set 13 No 90
[0130] In Lanes 4 and 7, no bands other than those of stained
unreacted primers were observed due to the addition of no
template.
[0131] In Lanes 2 and 5, bands of an unreacted primer and a
template having a high molecular size were confirmed because of the
addition of a template. However, no amplified products were
confirmed because of insufficient reaction time. As shown in Lane 3
and 6, in the sample having a template added thereto and reacted
for 90 minutes were obtained an aimed amplified product in a
satisfactory amount. Of the low size bands, the one in the vicinity
of ca. 260 by is an expected product of the synthetic reaction of
the invention.
Example 3
[0132] In this example, the amplification of an M13mp18RF DNA
(phage vector; TAKARA BIO INC.) was attempted with the same DNA as
a template. Primers employed were as follows. These primers were
synthesized by the consignment to ESPEC OLIGO SERVICE CORP.
[0133] The features of the primers used in the experiment were
described below. The relationships of respective primers to the
template were as illustrated in FIG. 4. In this connection,
underlined parts in the following sequences represent 3'-end
regions common to each of sense primers and antisense primers,
respectively.
[0134] Primer set 14: a combination of a sense primer in which
after annealing of a sequence placed in the 3'-end side of a primer
(24mer) to the template and extension reaction, a sequence in the
5'-end side (24mer) is hybridized with a region starting from 51
bases downstream of the 3'-end portion of the primer on a strand
extended from the primer, and an antisense primer in which after
annealing of a sequence placed in the 3'-end side of a primer
(22mer) to the template and extension reaction, a sequence in the
5'-end side (25mer) is hybridized with a region starting from 54
bases downstream of the 3'-end portion of the primer on a strand
extended from the primer;
TABLE-US-00018 M13BIP: (SEQ ID NO: 27)
CGACTCTAGAGGATCCCCGGGTACTGTTGTGTGGAATTGTGAGCGGAT; M13FIP: (SEQ ID
NO: 28) ACAACGTCGTGACTGGGAAAACCCTGTGCGGGCCTCTTCGCTATTAC.
[0135] Primer set 15: a combination of a sense primer in which
after annealing of a sequence placed in the 3'-end side of a primer
(24mer: sequence identical to that in Primer set 14) to the
template and extension reaction, a sequence in the 5'-end side
(13mer) is hybridized with a region starting from one base
downstream of the 3'-end portion of the primer on a strand extended
from the primer, and an antisense primer in which after annealing
of a sequence placed in the 3'-end side of a primer (22mer:
sequence identical to that in Primer set 14) to the template and
extension reaction, a sequence in the 5'-end side (13mer) is
hybridized with a region starting from one base downstream of the
3'-end portion of the primer on a strand extended from the
primer;
TABLE-US-00019 (SEQ ID NO: 29) M13F2L13-0:
GTGTGAAATTGTTTGTTGTGTGGAATTGTGAGCGGAT; (SEQ ID NO: 30) M13R2L13-0:
TTCGCCAGCTGGCGTGCGGGCCTCTTCGCTATTAC.
[0136] Primer set 16: a combination of a sense primer in which
after annealing of a sequence placed in the 3'-end side of a primer
(24mer: sequence identical to that in Primer set 14) to the
template and extension reaction, a sequence in the 5'-end side
(13mer) is hybridized with a region starting from seven bases
downstream of the 3'-end portion of the primer on a strand extended
from the primer, and an antisense primer in which after annealing
of a sequence placed in the 3'-end side of a primer (22mer:
sequence identical to that in Primer set 14) to the template and
extension reaction, a sequence in the 5'-end side (13mer) is
hybridized with a region starting from seven bases downstream of
the 3'-end portion of the primer on a strand extended from the
primer;
TABLE-US-00020 (SEQ ID NO: 31) M13F2L13-6:
TTTCCTGTGTGAATGTTGTGTGGAATTGTGAGCGGAT; (SEQ ID NO: 32) M13R2L13-6:
CCCCCTTTCGCCAGTGCGGGCCTCTTCGCTATTAC.
[0137] Primer set 17: a combination of a sense primer in which
after annealing of a sequence placed in the 3'-end side of a primer
(24mer: sequence identical to that in Primer set 14) to the
template and extension reaction, a sequence in the 5'-end side
(13mer) is hybridized with a region starting from 13 bases
downstream of the 3'-end portion of the primer on a strand extended
from the primer, and an antisense primer in which after annealing
of a sequence placed in the 3'-end side of a primer (22mer:
sequence identical to that in Primer set 14) to the template and
extension reaction, a sequence in the 5'-end side (13mer) is
hybridized with a region starting from 13 bases downstream of the
3'-end portion of the primer on a strand extended from the
primer;
TABLE-US-00021 M13F2L13-12: (SEQ ID NO: 33)
TAGCTGTTTCCTGTGTTGTGTGGAATTGTGAGCGGAT; M13R2L13-12: (SEQ ID NO: 34)
AGCACATCCCCCTGTGCGGGCCTCTTCGCTATTAC.
[0138] Primer set 18: a combination of a sense primer in which
after annealing of a sequence placed in the 3'-end side of a primer
(24mer: sequence identical to that in Primer set 14) to the
template and extension reaction, a sequence in the 5'-end side
(13mer) is hybridized with a region starting from 19 bases
downstream of the 3'-end portion of the primer on a strand extended
from the primer, and an antisense primer in which after annealing
of a sequence placed in the 3'-end side of a primer (22mer:
sequence identical to that in Primer set 14) to the template and
extension reaction, a sequence in the 5'-end side (13mer) is
hybridized with a region starting from 19 bases downstream of the
3'-end portion of the primer on a strand extended from the
primer;
TABLE-US-00022 M13F2L13-18: (SEQ ID NO: 35)
TGGTCATAGCTGTTGTTGTGTGGAATTGTGAGCGGAT; Ml3R2L13-18: (SEQ ID NO: 36)
CCTTGCAGCACATGTGCGGGCCTCTTCGCTATTAC.
[0139] Primer set 19: a combination of a sense primer in which
after annealing of a sequence placed in the 3'-end side of a primer
(24mer: sequence identical to that in Primer set 14) to the
template and extension reaction, a sequence in the 5'-end side
(13mer) is hybridized with a region starting from 25 bases
downstream of the 3'-end portion of the primer on a strand extended
from the primer, and an antisense primer in which after annealing
of a sequence placed in the 3'-end side of a primer (22mer:
sequence identical to that in Primer set 14) to the template and
extension reaction, a sequence in the 5'-end side (13mer) is
hybridized with a region starting from 23 bases downstream of the
3'-end portion of the primer on a strand extended from the
primer;
TABLE-US-00023 (SEQ ID NO: 37) M13F2L13:
TAATCATGGTCATTGTTGTGTGGAATTGTGAGCGGAT; (SEQ ID NO: 38) M13R3L13:
TCGCCTTGCAGCAGTGCGGGCCTCTTCGCTATTAC.
[0140] Primer set 20: a combination of a sense primer in which
after annealing of a sequence placed in the 3'-end side of a primer
(24mer: sequence identical to that in Primer set 14) to the
template and extension reaction, a sequence in the 5'-end side
(23mer) is hybridized with a region starting from 25 bases
downstream of the 3'-end portion of the primer on a strand extended
from the primer, and an antisense primer in which after annealing
of a sequence placed in the 3'-end side of a primer (22mer:
sequence identical to that in Primer set 14) to the template and
extension reaction, a sequence in the 5'-end side (23mer) is
hybridized with a region starting from 23 bases downstream of the
3'-end portion of the primer on a strand extended from the
primer;
TABLE-US-00024 M13F2L23: (SEQ ID NO: 39)
CTCGAATTCGTAATCATGGTCATTGTTGTGTGGAATTGTGAGCGGAT; M13R3L23: (SEQ ID
NO: 40) CCCAACTTAATCGCCTTGCAGCAGTGCGGGCCTCTTCGCTATTAC.
[0141] A reaction mixture (25 .mu.l) of Tris-HCl (20 mM, pH8.8),
KCl (10 mM), (NH.sub.4).sub.2SO.sub.4 (10 mM), MgSO.sub.4 (2 mM),
Triton X-100 (0.1%), dNTP (0.4 mM), a primer pair (100 .mu.mol,
resp.), a template DNA (0.05 .mu.g), and Bst DNA polymerase (8U;
NEW ENGLAND BioLabs) was prepared, and incubated at 65.degree. C.
for 20-120 minutes.
[0142] A 5 .mu.l portion of each mixture was subjected to
electrophoresis in 3% NuSieve GTG Agarose (manufactured by BMA;
purchased from Takara Bio Inc.; "NuSieve" is the registered
trademark of BMA). Results are shown in FIGS. 9 and 10. Samples in
respective lanes in these figures are shown in the following Tables
5 and 6.
TABLE-US-00025 TABLE 5 Explanation of lanes of electrophoretic
photograms in FIG. 9 Lane Primer Template Reaction Time (min.) 1
DNA size marker (20 bp ladder) 2 Primer set 14 Yes 60 3 Primer set
14 Yes 90 4 Primer set 14 Yes 120 5 Primer set 14 No 120 6 Primer
set 15 Yes 60 7 Primer set 15 Yes 90 8 Primer set 15 Yes 120 9
Primer set 15 No 120 10 Primer set 16 Yes 20 11 Primer set 16 Yes
40 12 Primer set 16 Yes 60 13 Primer set 16 No 60 14 Primer set 17
Yes 20 15 Primer set 17 Yes 40 16 Primer set 17 Yes 60 17 Primer
set 17 No 60 18 Primer set 18 Yes 20 19 Primer set 18 Yes 40 20
Primer set 18 Yes 60 21 Primer set 18 No 60
TABLE-US-00026 TABLE 6 Explanation of lanes of electrophoretic
photograms in FIG. 10 Lane Primer Template Reaction Time (min.) 1
DNA size marker (20 bp ladder) 2 Primer set 19 Yes 20 3 Primer set
19 Yes 40 4 Primer set 19 Yes 60 5 Primer set 19 No 60 6 Primer set
20 Yes 20 7 Primer set 20 Yes 40 8 Primer set 20 Yes 60 9 Primer
set 20 No 60
[0143] In Lanes 5, 9, 13, 17 and 21 of respective Figures, no bands
other than those of stained unreacted primers were observed due to
the addition of no template.
[0144] In Lanes 2 and 3 of FIG. 5, amplified products were obtained
in a reaction time of 90 minutes or more. These products, however,
was amplified product in the form of ladder which was different
from the product of aimed size. Primer set 14 is used for the
amplification reaction in these lanes. The distance between the
region corresponding to the sequence in the 3'-end side of the
primer on the extended strand of the primer and the region with
which the sequence in the 5'-end side hybridizes is 50 nucleotides
in the sense primers and 53 nucleotides in the antisense primers.
Thus, when the distance between the region corresponding to the
sequence in the 3'-end side of the primer on the extended strand of
the primer and the region with which the sequence in the 5'-end
side hybridizes becomes excessively large as in Primer set 5, it is
considered that the aimed amplification products were not obtained
because the folding efficiency of the sequence in the 5'-end side
of each primer is lowered significantly and the synthetic reaction
according to the invention hardly occurs.
[0145] As shown in Lane 7 of FIG. 9, when Primer set 15 was used,
it was possible to obtain the aimed amplification product in a
reaction time of 90 minutes. Of the low size bands, the band in the
vicinity of ca. 240 by is an expected product of the synthetic
reaction of the invention.
[0146] Further, as shown in Lanes 12 and 16 of FIG. 9, and Lanes 4
and 8 of FIG. 10, it was possible to obtain the aimed amplification
product in a reaction time of 60 minutes when Primer sets 16, 17,
19 and 20 were used. Of the low size bands, the band in the
vicinity of ca. 240 by is an expected product of the synthetic
reaction of the invention.
[0147] In addition, as shown in Lane 19 of FIG. 9, it was possible
to obtain the aimed amplification product in a reaction time of 40
minutes or more when Primer set 18 was used. Of the low size bands,
the band in the vicinity of ca. 240 by is an expected product of
the synthetic reaction of the invention.
[0148] When the distance between the region corresponding to the
sequence in the 3'-end side of the primer on the extended strand of
the primer and the region with which the sequence in the 5'-end
side hybridizes is small as in Primer set 15, it is considered that
a long reaction time is required because most of the sequence on a
template having the same sequence to which the next primer is to be
annealed remains as a double strand and the subsequent annealing
hardly occurs.
[0149] Also, when the distance between the region corresponding to
the sequence in the 3'-end side of the primer on the extended
strand of the primer and the region with which the sequence in the
5'-end side hybridizes is large as in Primer sets 6-11, it is
considered that a comparatively long reaction time is required
because the folding efficiency of the sequence in the 5'-end side
of each primer is lowered.
[0150] On the other hand, when the distance between the region
corresponding to the sequence in the 3'-end side of the primer on
the extended strand of the primer and the region with which the
sequence in the 5'-end side hybridizes is not excessively small or
excessively large as in Primer set 18, it is considered that the
most efficient amplification can be performed in the invention.
Example 4
[0151] Of the amplified products obtained in Examples 1-3, the
amplified products which were believed to have the highest
amplification efficiency were digested with restriction enzymes. A
1 .mu.l portion of the reaction mixture which contained the
amplified products obtained with Primer set 5 described in Example
1 was digested with a restriction enzyme MboII, a 1 .mu.l portion
of the reaction mixture which contained the amplified products
obtained with Primer set 12 described in Example 2 was digested
with a restriction enzyme Bst XI, and a 1 .mu.l portion of the
reaction mixture which contained the amplified products obtained
with Primer set 18 described in Example 3 was digested with a
restriction enzyme Pst I. Digestion with restriction enzymes was
carried out at a temperature of 37.degree. C. for 3 hours.
[0152] Each of the digestion mixtures was subjected to
electrophoresis in 3% NuSieve GTG Agarose (manufactured by BMA;
purchased from TAKARA BIO INC.; "NuSieve" is the registered
trademark of BMA). Results are shown in FIGS. 11, 12 and 13. Sizes
of fragments digested with respective restriction enzymes which are
speculated from the respective base sequences are shown in the side
of the electrophoretic photograms. It was confirmed from the change
of the most part of the undigested bands into the bands having
speculated sizes after digestion that the aimed amplified products
are obtained.
Example 5
Effects of a Variety of Melting Temperature Adjusting Agents
[0153] Amplification reaction was conducted with the addition of a
variety of melting temperature adjusting agents into amplification
reaction mixtures in order to examine the effects of the melting
temperature adjusting agents on amplification efficiency. In the
same manner as in Example 1, amplification of a human STS DYS237
gene was attempted by using Human DNA (Clontech) as a template. The
primer used was Primer set 5 (SEQ ID NO: 9 and SEQ ID NO.: 10)
which showed the most preferred amplification efficiency in Example
1.
[0154] A reaction mixture (25 .mu.l) of Tris-HCl (20 mM, pH8.8),
KCl (10 mM), (NH.sub.4).sub.2SO.sub.4 (10 mM), MgSO.sub.4 (8 mM),
Triton X-100 (0.1%), dNTP (1.4 mM), the primer pair (1600 nM,
resp.), the template DNA, and Bst DNA polymerase (16U; NEW ENGLAND
BioLabs) was prepared. The template DNA was added in a
concentration of 100 ng, 10 ng, or 0 ng. To this reaction mixture,
6% DMSO, 0.5 M betaine, 4% formamide, or 10% glycerol as the final
concentration was added. The mixture was incubated at 60.degree. C.
for 90 minutes.
[0155] After amplification, reaction mixture was subjected to
electrophoresis in the same manner as in Example 1. Results are
shown in FIG. 14. Samples in respective lanes in FIG. 14 are shown
in the following Table 7.
TABLE-US-00027 TABLE 7 Explanation of lanes of electrophoretic
photograms in FIG. 14 Melting Temperature Lanes Adjusting Agents
Amounts of Template 1 DNA size marker (20 bp ladder) 2 6% DMSO 100
ng 3 0.5 M Betaine 100 ng 4 4% Formamide 100 ng 5 10% Glycerol 100
ng 6 None 100 ng 7 6% DMSO 10 ng 8 0.5 M Betaine 10 ng 9 4%
Formamide 10 ng 10 10% Glycerol 10 ng 11 None 10 ng 12 6% DMSO 1 ng
13 0.5 M Betaine 1 ng 14 4% Formamide 1 ng 15 10% Glycerol 1 ng 16
None 1 ng 17 6% DMSO None 18 0.5 M Betaine None 19 4% Formamide
None 20 10% Glycerol None 21 None None 22 DNA size marker (20 bp
ladder)
[0156] In FIG. 14, the band in the vicinity of ca. 160 by is an
amplified product expected by the synthetic reaction of the
invention. As apparent from FIG. 14, when 100 ng of the template
DNA was used, the amplified products were obtained irrespective of
the presence or absence of the melting temperature adjusting
agents. On the other hand, when 10 ng of the template DNA was used,
the amplified products were obtained only in the presence of the
melting temperature adjusting agents. Moreover, when 1 ng of the
template DNA was used, the bands of the amplified products were
confirmed only in the presence of the melting temperature adjusting
agents, and particularly, the most distinct bands of the amplified
products were confirmed in the presence of DMSO (6%) as the melting
temperature adjusting agent.
[0157] It is believed from the above-described results that
amplification efficiency is improved by the addition of the melting
temperature adjusting agents such as DMSO, betaine, formamide or
glycerol to the reaction mixture, and particularly, the preferred
amplification efficiency is obtained by the addition of DMSO.
Sequence CWU 1
1
43120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 1gcatcctcat tttatgtcca 20220DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
2caacccaaaa gcactgagta 20333DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 3aagtctctga tgtgcatcct
cattttatgt cca 33433DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 4agaactcgct ttacaaccca aaagcactga gta
33533DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 5gtattaagtc tctgcatcct cattttatgt cca
33633DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 6cactaagaac tcgcaaccca aaagcactga gta
33733DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 7gttcagtatt aaggcatcct cattttatgt cca
33833DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 8agcatcacta agacaaccca aaagcactga gta
33933DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 9catttgttca gtagcatcct cattttatgt cca
331033DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 10cttgcagcat caccaaccca aaagcactga gta
331130DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 11ggcatttgtt gcatcctcat tttatgtcca
301230DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 12atcttgcagc caacccaaaa gcactgagta
301333DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 13tgtggcattt gttgcatcct cattttatgt cca
331433DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 14aacatcttgc agccaaccca aaagcactga gta
331536DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 15ttatgtggca tttgttgcat cctcatttta tgtcca
361636DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 16cttaacatct tgcagccaac ccaaaagcac tgagta
361742DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 17ttacctttat gtggcatttg ttgcatcctc attttatgtc ca
421842DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 18atttaactta acatcttgca gccaacccaa aagcactgag ta
421945DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 19tcattacctt tatgtggcat ttgttgcatc ctcattttat
gtcca 452045DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 20aagatttaac ttaacatctt gcagccaacc
caaaagcact gagta 452148DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 21cagtcattac ctttatgtgg
catttgttgc atcctcattt tatgtcca 482248DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
22aagaagattt aacttaacat cttgcagcca acccaaaagc actgagta
482333DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 23attcgattcc gtttacgggt ctcgaatgga ata
332433DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 24ctaaatcgaa tggtcattgc attcctttcc att
332536DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 25gacattcgat tccgtttacg ggtctcgaat ggaata
362636DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 26gaactaaatc gaatggtcat tgcattcctt tccatt
362748DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 27cgactctaga ggatccccgg gtactgttgt gtggaattgt
gagcggat 482847DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 28acaacgtcgt gactgggaaa accctgtgcg
ggcctcttcg ctattac 472937DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 29gtgtgaaatt gtttgttgtg
tggaattgtg agcggat 373035DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 30ttcgccagct ggcgtgcggg
cctcttcgct attac 353137DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 31tttcctgtgt gaatgttgtg
tggaattgtg agcggat 373235DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 32ccccctttcg ccagtgcggg
cctcttcgct attac 353337DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 33tagctgtttc ctgtgttgtg
tggaattgtg agcggat 373435DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 34agcacatccc cctgtgcggg
cctcttcgct attac 353537DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 35tggtcatagc tgttgttgtg
tggaattgtg agcggat 373635DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 36ccttgcagca catgtgcggg
cctcttcgct attac 353737DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 37taatcatggt cattgttgtg
tggaattgtg agcggat 373835DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 38tcgccttgca gcagtgcggg
cctcttcgct attac 353947DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 39ctcgaattcg taatcatggt
cattgttgtg tggaattgtg agcggat 474045DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
40cccaacttaa tcgccttgca gcagtgcggg cctcttcgct attac 4541140DNAHomo
sapiens 41agcatcctca ttttatgtcc aacatcagag acttaatact gaacaaatgc
cacataaagg 60taatgactgt tgaagaagat ttaacttaac atcttgcagc atcactaaga
actcgcttta 120tactcagtgc ttttgggttg 14042240DNAHomo
sapiensmodified_base(48)a, c, t, g, unknown or other 42gctacgggtc
tcgaatggaa taaaaatata tggaatggaa tgcaatgnaa cggaatcgaa 60tgtcatagaa
tgtaatgcaa tgcaaaaaca tggaatccaa aatcattgac tggaaaggct
120gggtgtcgaa aggaattgac tccaatggaa tggaatcgaa tggaatggaa
gtgaatagaa 180tcgaactaaa tcgaatggaa tggaattgat aggaacggaa
tggaaaggaa tgcaatgatt 24043300DNAArtificial SequenceDescription of
Artificial Sequence Synthetic phage vector sequence 43cactcattag
gcaccccagg ctttacactt tatgcttccg gctcgtatgt tgtgtggaat 60tgtgagcgga
taacaatttc acacaggaaa cagctatgac catgattacg aattcgagct
120cggtacccgg ggatcctcta gagtcgacct gcaggcatgc aagcttggca
ctggccgtcg 180ttttacaacg tcgtgactgg gaaaaccctg gcgttaccca
acttaatcgc cttgcagcac 240atcccccttt cgccagctgg cgtaatagcg
aagaggcccg caccgatcgc ccttcccaac 300
* * * * *