U.S. patent application number 12/921729 was filed with the patent office on 2011-03-03 for socs3 expression promoter, drug and food containing the same and method of promoting the expression of socs3.
This patent application is currently assigned to Q.P. CORPORATION. Invention is credited to Akira Asari, Tomoyuki Kanemitsu, Toshihide Sato.
Application Number | 20110053887 12/921729 |
Document ID | / |
Family ID | 41696323 |
Filed Date | 2011-03-03 |
United States Patent
Application |
20110053887 |
Kind Code |
A1 |
Kanemitsu; Tomoyuki ; et
al. |
March 3, 2011 |
SOCS3 EXPRESSION PROMOTER, DRUG AND FOOD CONTAINING THE SAME AND
METHOD OF PROMOTING THE EXPRESSION OF SOCS3
Abstract
A SOCS3 expression promoter includes hyaluronic acid having an
average molecular weight of 500,000 or more and/or a salt thereof
as an active ingredient.
Inventors: |
Kanemitsu; Tomoyuki;
(Fuchu-shi, JP) ; Sato; Toshihide; (Fuchu-shi,
JP) ; Asari; Akira; (Musashino-shi, JP) |
Assignee: |
Q.P. CORPORATION
Shibuya-ku, Tokyo
JP
|
Family ID: |
41696323 |
Appl. No.: |
12/921729 |
Filed: |
August 20, 2009 |
PCT Filed: |
August 20, 2009 |
PCT NO: |
PCT/US09/54491 |
371 Date: |
October 28, 2010 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
61090438 |
Aug 20, 2008 |
|
|
|
Current U.S.
Class: |
514/54 ; 428/402;
536/55.1 |
Current CPC
Class: |
H04W 56/0005 20130101;
H04W 56/0045 20130101; H04W 56/00 20130101; A61P 19/02 20180101;
Y10T 428/2982 20150115 |
Class at
Publication: |
514/54 ;
536/55.1; 428/402 |
International
Class: |
A61K 31/728 20060101
A61K031/728; C08B 37/08 20060101 C08B037/08; A61P 19/02 20060101
A61P019/02 |
Foreign Application Data
Date |
Code |
Application Number |
Aug 18, 2009 |
US |
12543304 |
Claims
1. A SOCS3 expression promoter comprising hyaluronic acid having an
average molecular weight of 500,000 or more and/or a salt thereof
as an active ingredient.
2. The SOCS3 expression promoter according to claim 1, wherein the
hyaluronic acid and/or a salt thereof has an average particle
diameter of 50 to 500 micrometers.
3. A drug comprising the SOCS3 expression promoter according to
claim 1 as an active ingredient.
4. The drug according to claim 3, the drug being orally
administered.
5. A food comprising the SOCS3 expression promoter according to
claim 1.
6. A method of promoting expression of SOCS3 in a human or an
animal other than a human, the method comprising orally
administering hyaluronic acid having an average molecular weight of
500,000 or more and/or a salt thereof to a human or an animal other
than a human.
7. A pleiotrophin expression inhibitor comprising hyaluronic acid
having an average molecular weight of 500,000 or more and/or a salt
thereof as an active ingredient.
8. The pleiotrophin expression inhibitor according to claim 7,
wherein the hyaluronic acid and/or a salt thereof has an average
particle diameter of 50 to 500 micrometers.
9. A drug comprising the pleiotrophin expression inhibitor
according to claim 7 as an active ingredient.
10. The drug according to claim 9, the drug being orally
administered.
11. A food comprising the pleiotrophin expression inhibitor
according to claim 7.
12. A method of inhibiting expression of pleiotrophin in a human or
an animal other than a human, the method comprising orally
administering hyaluronic acid having an average molecular weight of
500,000 or more and/or a salt thereof to a human or an animal other
than a human.
13. The drug according to claim 3, the drug being used to treat a
knee joint or relieve knee pain.
14. The food according to claim 5, the food being used to treat a
knee joint or relieve knee pain.
15. (canceled)
16. (canceled)
17. The drug according to claim 9, the drug being used to treat a
knee joint or relieve knee pain.
18. The food according to claim 11, the food being used to treat a
knee joint or relieve knee pain.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a U.S. National Stage Application of
International application No. PCT/JP2009/054491, filed Mar. 10,
2009 and published in the Japanese language on Sep. 17, 2009 as
WO/2009/113512. This application claims the benefit of Japanese
Application No. 2008-060930, filed Mar. 11, 2008, Japanese
Application No. 2008-062032, filed Mar. 12, 2008 and Japanese
Application No. 2008-263610, filed Oct. 10, 2008. The disclosures
of the above applications are incorporated herein by reference.
TECHNICAL FIELD
[0002] The present invention relates to a SOCS3 expression
promoter, a drug and a food containing the same, and a method of
promoting expression of SOCS3.
[0003] The invention also relates to a pleiotrophin expression
inhibitor, a drug and a food containing the same, and a method of
inhibiting expression of pleiotrophin.
BACKGROUND ART
[0004] In recent years, the number of patients who suffer
inflammatory diseases has increased due to a rapid change in eating
habits and life style. Examples of inflammatory diseases include
autoimmune diseases. The term "autoimmune disease" is a generic
name for diseases accompanying a symptom in which the immune system
that recognizes and eliminates foreign matter such as bacteria,
viruses, and tumors makes an overactive response to and attacks
normal cells and tissues. Autoimmune diseases are considered to be
caused by abnormalities in immunocompetent cells such as T-cells,
B-cells, and macrophages.
[0005] The symptoms of most of the autoimmune diseases are chronic
and refractory. In Japan, many autoimmune diseases are included in
specific diseases for which medical expenses are paid by the
government. The treatment method differs depending on the disease.
Since immunopathy is the cause of autoimmune diseases, steroids and
an immunosuppressive drug are used as first-line drugs for many
diseases. However, since these drugs cause side effects, an
immunopathy-improving drug that causes little side effects has been
desired.
[0006] WO2002-074318 discloses that high-molecular-weight
hyaluronic acid suppresses expression of interleukin 12 that
promotes inflammation. Interleukin 12 is a cytokine that promotes
inflammation in autoimmune diseases. However, since autoimmune
diseases develop various symptoms in various areas, it is difficult
to achieve an overall improvement of autoimmune diseases by
controlling a single cytokine.
[0007] Further examples of inflammatory diseases include arthritis.
Autoimmune arthritis is one of the autoimmune diseases. It has been
reported that suppressor of cytokine signaling 3 (SOCS3) that
adjusts signaling through a cytokine significantly reduced
destruction of bones that is observed in autoimmune arthritis for
this autoimmune arthritis (Takanori Shouda, Takafumi Yoshida,
Toshikatsu Hanada, Toru Wakioka, Masanobu Oishi, Kanta Miyoshi,
Setsuro Komiya, Ken-ichiro Kasai, Yasushi Hanakawa, Koji Hashimoto,
Kensei Nagata, and Akihiko Yoshimura, "Induction of the cytokine
signal regulator SOCS3/CIS3 as a therapeutic strategy for treating
inflammatory arthritis", J. Clin. Invest., Vol. 108, No. 12, pp.
1781-1788, December 2001). The above document suggests that
cytokine signaling is inhibited due to promotion of expression of
SOCS3 so that autoimmune arthritis may be improved. It is
considered that SOCS3 is strongly expressed in chronic inflammatory
diseases such as human colitis or arthritis (Hiromi Takagi,
Takahito Sanada, Yasumasa Minoda, and Akihiko Yoshimura, "Control
of cytokines and Toll-like receptor signals by SOCS", Nippon
Rinsho, Vol. 62, No. 12 (2004-12), pp. 2189-2196).
[0008] It has also been reported that SOCS3 indirectly controls
Toll-like receptors in innate immune cells (Andrea Baetz, Markus
Frey, Klaus Heeg, and Alexander H. Dalpke, "Suppressor of Cytokine
Signaling (SOCS) Proteins Indirectly Regulate Toll-like Receptor
Signaling in Innate Immune Cells", J. Biol. Chem., Vol. 279, Issue
52, pp. 54708-54715, Dec. 24, 2004).
[0009] Therefore, it is considered that inflammatory diseases can
be treated or prevented by promoting expression of SOCS3. However,
regulation of expression of SOCS3 in inflammatory diseases has not
been extensively studied.
DISCLOSURE OF THE INVENTION
[0010] Accordingly, an object of the invention is to provide a
SOCS3 expression promoter that achieves an overall improvement in
inflammatory diseases, a drug and a food containing the same, and a
method of promoting expression of SOCS3.
[0011] Another object of the invention is to provide a pleiotrophin
expression inhibitor that achieves an overall improvement in
inflammatory diseases, a drug and a food containing the same, and a
method of inhibiting expression of pleiotrophin.
[0012] The inventors of the invention conducted extensive studies
on expression of SOCS3, and found that expression of SOCS3 is
promoted via intake of hyaluronic acid having an average molecular
weight of 500,000 or more and/or a salt thereof. This finding has
led to the completion of the invention.
[0013] According to one aspect of the invention, there is provided
a SOCS3 expression promoter comprising hyaluronic acid having an
average molecular weight of 500,000 or more and/or a salt thereof
as an active ingredient.
[0014] According to another aspect of the invention, there is
provided a drug comprising the above SOCS3 expression promoter as
an active ingredient. In this case, the hyaluronic acid and/or a
salt thereof may have an average particle diameter of 50 to 500
micrometers. The above drug may be orally administered (taken). The
above drug may be used to treat a knee joint or relieve knee
pain.
[0015] According to another aspect of the invention, there is
provided a food comprising the above SOCS3 expression promoter.
[0016] According to another aspect of the invention, there is
provided a method of promoting expression of SOCS3 in a human or an
animal other than a human, the method comprising orally
administering hyaluronic acid having an average molecular weight of
500,000 or more and/or a salt thereof to a human or an animal other
than a human.
[0017] According to another aspect of the invention, there is
provided a pleiotrophin expression inhibitor comprising hyaluronic
acid having an average molecular weight of 500,000 or more and/or a
salt thereof as an active ingredient.
[0018] According to another aspect of the invention, there is
provided a drug comprising the above pleiotrophin expression
inhibitor as an active ingredient. In this case, the hyaluronic
acid and/or a salt thereof may have an average particle diameter of
50 to 500 micrometers. The above drug may be orally administered
(taken). The above drug may be used to treat a knee joint or
relieve knee pain.
[0019] According to another aspect of the invention, there is
provided a food comprising the above pleiotrophin expression
inhibitor.
[0020] According to another aspect of the invention, there is
provided a method of inhibiting expression of pleiotrophin in a
human or an animal other than a human, the method comprising orally
administering hyaluronic acid having an average molecular weight of
500,000 or more and/or a salt thereof to a human or an animal other
than a human.
[0021] According to another aspect of the invention, there is
provided a method of treating the knee joint of a human or an
animal other than a human, the method comprising orally
administering hyaluronic acid having an average molecular weight of
500,000 or more and/or a salt thereof to a human or an animal other
than a human.
[0022] According to a further aspect of the invention, there is
provided a method of relieving knee pain of a human or an animal
other than a human, the method comprising orally administering
hyaluronic acid having an average molecular weight of 500,000 or
more and/or a salt thereof to a human or an animal other than a
human.
[0023] According to the above SOCS3 expression promoter and method
of promoting expression of SOCS3, expression of SOCS3 can be
promoted via oral intake of hyaluronic acid having an average
molecular weight of 500,000 or more and/or a salt thereof to
achieve an overall improvement in inflammatory diseases. According
to the above pleiotrophin expression inhibitor and method of
inhibiting expression of pleiotrophin, expression of pleiotrophin
can be inhibited via oral intake of hyaluronic acid having an
average molecular weight of 500,000 or more and/or a salt thereof
to achieve an overall improvement in inflammatory diseases.
[0024] Therefore, a drug and a food for improving inflammatory
diseases that cause no or only a slight side effect can be
provided, and hyaluronic acid and/or a salt thereof is expected to
be utilized in various fields.
BRIEF DESCRIPTION OF THE DRAWINGS
[0025] FIG. 1 shows an electrophoresis photograph showing
expression of SOCS3 genes using RT-PCR (Example 1). The photograph
shows the results for the distilled water intake group, the sample
A intake group, and the sample B intake group (from left to
right).
[0026] FIG. 2 shows a photograph of the surface of the epithelium
of the small intestine of the mouse that orally took hyaluronic
acid or a salt thereof (Example 1).
[0027] FIG. 3 shows a photograph of the surface of the epithelium
of the large intestine of the mouse that orally took hyaluronic
acid or a salt thereof (Example 1).
[0028] FIG. 4 shows a photograph of the surface of the epithelium
of the large intestine of the mouse that orally took hyaluronic
acid or a salt thereof (after double staining) (Example 1).
[0029] FIG. 5 shows a photograph of the cervical lymph node of the
mouse that orally took distilled water or the hyaluronic acid
sample (Example 1).
[0030] FIG. 6 shows an electrophoresis photograph showing
expression of SOCS3 genes using RT-PCR (Example 2). The photograph
shows the results for no addition, the sample A, and the sample B
(from left to right).
[0031] FIG. 7 shows the results (soft X-ray photography score) that
indicate that narrowing of the fissure of the knee joint of the STR
mouse that was orally administered the hyaluronic acid of Test
Example 4 or 5 was significantly suppressed as compared with the
control (distilled water) (Example 10). No significant difference
was observed between Comparative Test Example 2 (chondroitin
sulfate) and the control.
[0032] FIG. 8 shows a soft X-ray photograph (Example 10). A white
arrow indicates the joint fissure. In FIG. 8, while narrowing of
the joint fissure occurred in the control group (A), narrowing of
the joint fissure of Test Example 4 (B) and Test Example 5 (C)
(hyaluronic acid was orally administered) was suppressed. No
significant difference was observed between Comparative Test
Example 2 (D) and the control.
[0033] FIG. 9 is illustrative of the method of evaluating the
cartilage of the knee joint using the India ink method (Example
10). The method shown in FIG. 9 evaluates roughening of the surface
of the cartilage.
[0034] FIG. 10 shows evaluation of the cartilage of the knee joint
using the India ink method (Example 10). FIG. 10 shows the
cartilage roughening index that indicates that roughening of the
cartilage was significantly suppressed in Test Example 4 or 5
(hyaluronic acid was orally administered) as compared with the
control. No significant difference was observed between Comparative
Test Example 2 and the control.
[0035] FIG. 11 shows a photograph of the surface of the cartilage
of the knee joint stained by the India ink method (Example 10). In
FIG. 11, while the surface of the cartilage was stained with the
India ink in the control group (A), the staining area of Test
Example 4 (B) and Test Example 5 (C) (hyaluronic acid was orally
administered) was small (i.e., roughening of the cartilage was
suppressed). The surface of the cartilage was stained in
Comparative Test Example 2 (D) in the same manner as in the
control. A white arrow indicates the ligament, which was not
counted.
[0036] FIG. 12 shows the results (knee joint synovial membrane
evaluation score) that indicate that activation of the synovial
membrane and cell growth were suppressed in Test Example 4 or 5
(hyaluronic acid was orally administered) as compared with the
control. No significant difference in synovial membrane evaluation
score was observed between Comparative Test Example 2 and the
control.
BEST MODE FOR CARRYING OUT THE INVENTION
[0037] A SOCS3 expression promoter, a drug and a food containing
the SOCS3 expression promoter, a method of promoting expression of
SOCS3, a pleiotrophin expression inhibitor, a drug and a food
containing the pleiotrophin expression inhibitor, and a method of
inhibiting expression of pleiotrophin according to embodiments of
the invention are described below.
[0038] Note that the unit "%" used herein refers to "mass %".
1. SOCS3 Expression Promoter, Drug and Food Containing the Same,
and Method of Promoting Expression of SOCS3
1.1. SOCS3 Expression Promoter
[0039] A SOCS3 expression promoter according to one embodiment of
the invention includes hyaluronic acid having an average molecular
weight of 500,000 or more and/or a salt thereof as an active
ingredient.
[0040] The term "hyaluronic acid" used herein refers to a
polysaccharide that includes at least one repeating unit formed of
glucuronic acid and N-acetylglucosamine. The hyaluronic acid salt
is not particularly limited. The hyaluronic acid salt is preferably
an edible salt or a pharmaceutically acceptable salt. Examples of
the hyaluronic acid salt include a sodium salt, a potassium salt, a
calcium salt, a zinc salt, a magnesium salt, an ammonium salt, and
the like of hyaluronic acid.
[0041] The hyaluronic acid and/or a salt thereof used for the SOCS3
expression promoter according to one embodiment of the invention
has an average molecular weight of 500,000 or more, preferably
600,000 or more, more preferably 500,000 to 1,600,000, and still
more preferably 600,000 to 1,600,000. If the average molecular
weight of the hyaluronic acid and/or a salt thereof is less than
500,000, the symptom of an inflammatory disease may not be
improved, or the functions of the immune system may decrease. If
the average molecular weight of the hyaluronic acid and/or a salt
thereof is more than 1,600,000, the hyaluronic acid and/or a salt
thereof may not exhibit a sufficient effect, or it may be difficult
to mix the hyaluronic acid and/or a salt thereof with a food or the
like due to low solubility.
[0042] The average molecular weight used herein is measured as
follows.
[0043] Specifically, about 0.05 g of purified hyaluronic acid is
weighed, and dissolved in a 0.2 mol/l sodium chloride solution to
prepare a 100 mL of the resulting solution. A 0.2 mol/l sodium
chloride solution is added to 8 mL, 12 mL, or 16 mL of the
resulting solution to prepare each of the total amount of 20 mL
solutions. The each 20 mL solution and the resulting solution are
used as sample solutions. The specific viscosity of each of the
sample solutions and a 0.2 mol/l sodium chloride solution is
measured at 30.0.+-.0.1.degree. C. by the viscosity measurement
method (first method (capillary viscosity measurement method)) of
the general tests of Japanese Pharmacopoeia (14th edition) (see
expression (1)), and the reduced viscosity at each concentration is
calculated (see expression (2)). The reduced viscosity (vertical
axis) and the dry matter concentration (g/100 mL) (horizontal axis)
are plotted on a graph, and the limiting viscosity is calculated
from the intersection point of a straight line that connects each
point and the vertical axis. The limiting viscosity thus calculated
is substituted into the Laurent's formula ((3)) to calculate the
average molecular weight (T. C. Laurent, M. Ryan, and A.
Pietruszkiewicz, B. B. A., 42, 476-485 (1960)).
Specific viscosity=[(falling time of sample solution)/(falling time
of 0.2 mol/l sodium chloride solution)]-1 (1)
Reduced viscosity=specific viscosity/(dry matter concentration
(g/100 mL)) (2)
Limiting viscosity=3.6.times.10.sup.-4M.sup.0.78 (3)
M: average molecular weight
[0044] The hyaluronic acid included in the SOCS3 expression
promoter according to one embodiment of the invention is basically
a di- or higher saccharide that includes at least one disaccharide
unit in which the 1-position of beta-D-glucuronic acid is bonded to
the 3-position of beta-D-N-acetylglucosamine, and is basically
formed by beta-D-glucuronic acid and beta-D-N-acetylglucosamine.
The hyaluronic acid may be a saccharide in which a plurality of
disaccharide units are bonded, derivative thereof that includes a
hydrolyzable protecting group (e.g., acyl group), or the like. The
saccharide may be an unsaturated saccharide. Examples of the
unsaturated saccharide include non-reducing end saccharides, a
saccharide in which an unsaturated bond is formed between the
4-position carbon atom and the 5-position carbon atom of glucuronic
acid, and the like.
[0045] The hyaluronic acid and/or a salt thereof may be extracted
from a natural product (e.g., living tissues such as cockscomb,
umbilical cord, skin, or joint fluid), may be obtained by culturing
microorganisms or animal cells (e.g., fermentation using
Streptococcus microorganisms), or may be chemically or
enzymatically synthesized, for example.
[0046] The hyaluronic acid used for the SOCS3 expression promoter
according to one embodiment of the invention may be a commercially
available product, or may be produced by the following production
method 1 or 2.
1.1.1. Production Method 1 (Extraction from Cockscomb)
[0047] First, a cockscomb is subjected to a heat treatment. This
heat treatment is performed to thermally denature proteins or
inactivate enzymes contained in the cockscomb. The heat treatment
may be performed by an arbitrary method. The heat treatment may be
efficiently performed by immersing the cockscomb in hot water. The
heating temperature and the heating time are not particularly
limited insofar as proteins contained in the cockscomb are
denatured, or enzymes contained in the cockscomb are inactivated.
When using a hot water heating method, the raw material may be
immersed in hot water at 60 to 100.degree. C. for 20 to 90
minutes.
[0048] When using a frozen cockscomb, the frozen cockscomb may be
directly subject to the heat treatment. Note that it is preferable
to slowly defrost the frozen cockscomb with running water or the
like, and then subject the cockscomb to the heat treatment. This
makes it possible to easily obtain a material of constant
quality.
[0049] A paste is prepared using the cockscomb subjected to the
heat treatment. This improves the yield of hyaluronic acid. A paste
is easily prepared by thinly cutting the cockscomb subjected to the
heat treatment using a cutting machine, or cutting the cockscomb
subjected to the heat treatment using a chopper, for example. A
paste may be prepared by adding freshwater to the cockscomb in an
amount about 1 to 5 times the amount of the cockscomb, and
homogenizing the mixture for 10 to 60 minutes using a homogenizer
to finely crush/grind the cockscomb, for example. Note that a
high-speed stirrer or a mill may be used instead of a
homogenizer.
[0050] The cockscomb paste is then subjected to an acid treatment
or an alkali treatment by adding acid (e.g., hydrochloric acid or
sulfuric acid) or alkali (sodium hydroxide or potassium hydroxide)
to reduce the molecular weight of the hyaluronic acid so that the
resulting hyaluronic acid has an average molecular weight of
500,000 or more. The molecular weight of the hyaluronic acid may be
adjusted by appropriately adjusting the concentration of acid or
alkali, the amount of acid or alkali, the treatment time, and the
like. It is preferable to use the alkali treatment that allows the
molecular weight of the hyaluronic acid to be easy controlled. When
using the alkali treatment, an alkaline solution having a
concentration of 10 to 30% is added to the cockscomb paste in an
amount of about 1 to 5% based on the amount of cockscomb. The
cockscomb is treated at 25 to 70.degree. C. for about 15 to 90
minutes, and neutralized with hydrochloric acid or the like to
adjust the molecular weight of the hyaluronic acid, for
example.
[0051] The raw material of which the molecular weight has been
adjusted is then subjected to a protease treatment. An arbitrary
commercially available protease may be used for the protease
treatment. Examples of the protease include pepsin, trypsin,
papain, bromelain, and the like. The protease is preferably added
in an amount of 0.01 to 1% based on the amount of cockscomb. The
protease treatment temperature is 35 to 65.degree. C., and the
protease treatment time is 1 to 10 hours.
[0052] Crude hyaluronic acid is preparatively isolated from the
resulting product, and purified to obtain hyaluronic acid having a
purity of 90% or more and an average molecular weight of 500,000 or
more.
[0053] The hyaluronic acid may be isolated and purified by a normal
method. For example, a solid is removed by filtering the raw
material subjected to the protease treatment to obtain a filtrate
containing crude hyaluronic acid. Note that the raw material
subjected to the protease treatment may be treated with activated
carbon before filtering the raw material in order to achieve
deodorization or decolorization or remove hydrolyzed proteins.
After dissolving salt in the filtrate, ethanol is added to the
solution to precipitate hyaluronic acid, and the precipitate is
preparatively isolated. After the addition of aqueous ethanol
having an ethanol concentration of about 80 to 95 vol %, the
precipitate is washed with aqueous ethanol using a homogenizer, and
the precipitate is preparatively isolated. After repeating the
washing operation about 2 to 10 times, the precipitate is again
preparatively isolated and dried to obtain a hyaluronic acid of
Production Example 1.
1.1.2. Production Method 2 (Microorganism Fermentation)
[0054] Activated carbon is added to a culture solution of
hyaluronic acid-producing Streptococcus Zoopidemicus to effect
deodorization and decolorization, followed by filtration. After
dissolving salt in the filtrate, ethanol is added to the solution
to precipitate hyaluronic acid, and the precipitate is
preparatively isolated. After the addition of aqueous ethanol
having an ethanol concentration of about 80 to 95 vol %, the
precipitate is washed with aqueous ethanol using a homogenizer, and
the precipitate is preparatively isolated. After repeating the
washing operation about 2 to 10 times, the precipitate is again
preparatively isolated and dried to obtain hyaluronic acid (average
molecular weight: 500,000 or more) of Production Example 2.
[0055] It suffices that the hyaluronic acid used in the invention
have a purity that allows the hyaluronic acid to be used for a drug
or food. The purity of the hyaluronic acid is preferably 90% or
more, and more preferably 95% or more. The purity of the hyaluronic
acid used herein refers to a value calculated by subtracting the
content of impurities other than the hyaluronic acid from 100%.
Examples of impurities include hydrolyzed proteins, fats (crude
fats), chondroitin sulfate, and the like. The purity of hyaluronic
acid obtained from a cockscomb (raw material) is calculated by the
following expression (4).
Purity (%) of hyaluronic acid=100-hydrolyzed protein content
(%)-crude fat content (%)-chondroitin sulfate content (%) (4)
[0056] In the expression (4), the hydrolyzed protein content (%) is
a value determined by the Lowry method, the crude fat content (%)
is a value determined in accordance with New Food Analysis Methods
(Korin Publishing Co., Ltd.), "Chapter 1--General and related
ingredients, 1-4 Lipids, 1-4-2 Ether extraction method", and the
chondroitin sulfate content (%) is a value determined by the
following method.
[0057] Specifically, the hyaluronic acid is dried. 50 mg of the
hyaluronic acid is accurately weighed. Purified water is added to
the hyaluronic acid so that the total amount of the solution is 100
mL to obtain a test solution. 4 mL of the test solution is put into
a test tube. After the addition of 1 mL of a 0.5 mol/l sulfuric
acid, the components are mixed. The mixture is heated for 10
minutes in a water bath, and then cooled. After the addition of 0.2
mL of 0.04 mol/l cetyltrimethylammonium bromide to the resulting
solution, the components are mixed, and allowed to stand at room
temperature for one hour. The absorbance at a wavelength of 660 nm
(path length: 10 mm) is then measured.
[0058] The resulting absorbance data is applied to a calibration
curve of chondroitin sulfate to determine the chondroitin sulfate
content (o) in the purified hyaluronic acid. The calibration curve
is prepared as follows. A chondroitin sulfate A sodium salt derived
from whale cartilage (special grade (SG) manufactured by Seikagaku
Corporation) is dried (under reduced pressure, phosphorus
pentaoxide, 60.degree. C., 5 hours), and accurately weighed.
Purified water is added to the chondroitin sulfate A sodium salt to
prepare a solution that contains the chondroitin sulfate A sodium
salt in an amount of 10, 20, 30, or 40 micrograms/mL. After the
addition of 1 mL of a 0.5 mol/l sulfuric acid, the components are
mixed. After the addition of 1 mL of 0.04 mol/l
cetyltrimethylammonium bromide, the components are mixed, and
allowed to stand at room temperature for one hour. The absorbance
is then measured in the same manner as described above. The
absorbance (vertical axis) and the corresponding concentration
(micrograms/mL) of the chondroitin sulfate A sodium salt solution
(horizontal axis) are plotted on a graph to obtain a calibration
curve.
[0059] A promotion effect on expression of SOCS3 in the cells or
tissues of a human or an animal other than a human may be confirmed
by known biochemical analysis such as detection or quantitative
determination of SOCS3 genes using northern blotting, a DNA array,
a DNA chip, or the like, or detection or quantitative determination
of SOCS3 using western blotting, ELISA, affinity chromatography, or
the like.
[0060] The SOCS3 expression promoter according to one embodiment of
the invention normally includes the hyaluronic acid having an
average molecular weight of 500,000 or more and/or a salt thereof
in an amount of 0.1 mass % or more, and preferably 0.5 to 100 mass
%.
[0061] The hyaluronic acid and/or a salt thereof preferably has an
average particle diameter of 50 to 500 micrometers, more preferably
80 to 500 micrometers, and still more preferably 200 to 500
micrometers.
[0062] If the hyaluronic acid having an average molecular weight of
500,000 or more (preferably 600,000 or more, and more preferably
600,000 to 1,600,000) and/or a salt thereof (hereinafter may be
referred to as "hyaluronic acid") has an average particle diameter
of 50 to 500 micrometers, the powdery hyaluronic acid and/or a salt
thereof that has been orally administered is dissolved in gastric
juices at an appropriate rate. This suppresses hydrolysis of the
hyaluronic acid in gastric juices so that the hyaluronic acid is
absorbed through the intestine while maintaining a given molecular
weight, and reaches the affected area. If the average particle
diameter of the hyaluronic acid is less than 50 micrometers, the
hyaluronic acid may be promptly dissolved and hydrolyzed in gastric
juices so that the molecular weight of the hyaluronic acid may
decrease. Hyaluronic acid having a reduced molecular weight (e.g.,
500,000 or less) may not improve the symptom of an inflammatory
disease, or decrease the functions of the immune system. If the
average particle diameter of the hyaluronic acid is more than 500
micrometers, the hyaluronic acid may not be completely dissolved in
the body, so that the amount of absorption may decrease as compared
with the intake. As a result, a sufficient effect for improving the
symptom of an inflammatory disease may not be obtained.
[0063] The average particle diameter of the hyaluronic acid and/or
a salt thereof used herein refers to a value measured by a laser
diffraction-scattering method. The average particle diameter of the
hyaluronic acid and/or a salt thereof may be adjusted by grinding,
sieving, or the like.
1.2. Drug
[0064] A drug according to one embodiment of the invention includes
the SOCS3 expression promoter according to one embodiment of the
invention as an active ingredient. Specifically, the drug according
to one embodiment of the invention may include the SOCS3 expression
promoter according to one embodiment of the invention in an amount
of 5 to 100 mass %.
[0065] The drug according to one embodiment of the invention
promotes expression of SOCS3 in a human or an animal other than a
human by oral administration of the hyaluronic acid having an
average molecular weight of 500,000 or more and/or a salt thereof
to a human or an animal other than a human. This improves the
symptom of a patient (human or animals other than human) with an
inflammatory disease (e.g., a pathological condition selected from
the group consisting of rheumatoid arthritis (RA); asthma; an
allergic disorder (e.g., rhinitis); a vascular disease; thrombosis
or adverse platelet aggregation; reocclusion after thrombolysis;
reperfusion injury; an inflammatory skin disease (e.g., psoriasis,
eczema, contact dermatitis, or atopic dermatitis); diabetes (e.g.,
insulin-dependent diabetes mellitus or autoimmune diabetes);
multiple sclerosis; systemic lupus erythematosus (SLE); an
inflammatory intestinal disease (e.g., ulcerative colitis, Crohn's
disease (local enteritis), or pouchitis (e.g., intestinal disease
after proctocolectomy and eoanal anastomosis); an intestinal
disease related to a coeliac disease, non-tropical sprue, or
serologic reaction-negative arthropathy, or a disease in which
leukocyte infiltration to the gastrointestinal tract is involved
(e.g., lymphocytic or collagenous colitis or eosinophilic
gastroenteritis); a disease related to leukocyte infiltration to
epithelial tissues (e.g., skin, urinary tract, airway, or joint
synovial membrane); pancreatitis; mastitis (mammary gland);
hepatitis; cholecystitis; cholangitis or pericholangitis (tissues
around the bile duct and the liver); bronchitis; sinusitis;
inflammatory lung disease that causes interstitial fibrosis such as
hypersensitivity pneumonia; a collagen disease; sarcoidosis;
osteoporosis; osteoarthrosis; atherosclerosis; a neoplastic disease
including neoplasm metastasis or cancerous growth; injury (injury
recovery enhancement); retinodialysis or allergic conjunctivitis;
an eye disease (e.g., autoimmune or uveitis); Sjogren syndrome;
(chronic or acute) rejection after organ transplant; a
host-versus-graft or graft-versus-host disease; intimal
hyperplasia; arteriosclerosis (including graft arteriosclerosis);
post-operative reinfarction or restenosis (e.g., after percutaneous
transluminal angioplasty (PTCA) or percutaneous transluminal
coronary recanalization); nephritis; tumor angiogenesis; malignant
tumor; multiple myeloma; myeloma-induced bone resorption;
septicemia; central nervous system injury (e.g., stroke, traumatic
brain injury, or spinal cord injury); and Meniere's disease). In
particular, an autoimmune disease such as rheumatoid arthritis (RA)
or a collagen disease, and arthritis such as knee osteoarthritis
can be significantly improved, and knee pain can be relieved by the
drug according to one embodiment of the invention. Examples of an
animal other than a human include mammals other than a human.
[0066] An inflammatory disease can be improved by orally
administering the hyaluronic acid having an average molecular
weight of 500,000 or more and/or a salt thereof to a human or an
animal other than a human, while preventing pain, tumescence,
oedema, rubor, heat sensation, heaviness, or numbness that may
occur when employing local administration, for example.
1.3. Food
[0067] A food according to one embodiment of the invention includes
the SOCS3 expression promoter according to one embodiment of the
invention. Specifically, the food according to one embodiment of
the invention may include the SOCS3 expression promoter according
to one embodiment of the invention in an amount of 0.1 to 100 mass
%.
[0068] Since a patient with the above inflammatory disease can
comfortably take the food (food or drink) according to one
embodiment of the invention over a long time, the symptom of the
inflammatory disease can be relieved or improved as the treatment
or an adjunct in the treatment of the inflammatory disease.
[0069] A mechanism by which expression of SOCS3 is promoted by oral
administration of the hyaluronic acid and/or a salt thereof is not
necessarily clarified. Since hyaluronic acid was observed on the
surface of the epithelium of the intestine of the mouse that was
orally administered the hyaluronic acid or a salt thereof (refer to
FIGS. 2 and 3), and the localization of TLR-4 (i.e., a receptor on
the surface of the intestinal epithelium coincided with the
localization of the hyaluronic acid (refer to FIG. 4), it is
estimated that the hyaluronic acid and/or a salt thereof promotes
expression of SOCS3 through the receptor on the surface of the
intestinal epithelium.
[0070] The drug according to one embodiment of the invention may
include raw materials other than the hyaluronic acid and/or a salt
thereof (i.e., SOCS3 expression promoter) insofar as the effects of
the invention are not impaired. Examples of the raw materials other
than the hyaluronic acid and/or a salt thereof include water, a
diluting agent, an antioxidant, a preservative, a humectant, a
viscous agent, a buffer, an adsorbent, a solvent, an emulsifying
agent, a stabilizer, a surfactant, a lubricant, a water-soluble
polymer, a sweetener, a flavoring substance, an acidifier, an
alcohol, and the like.
[0071] The dosage form of the drug according to one embodiment of
the invention is not particularly limited. When orally
administering the drug, the drug may be in the form of an oral drug
such as a solid preparation (e.g., tablet, powder, subtle granules,
granules, capsule, or pill) or a liquid preparation such as a
mixture, a suspension, a syrup, or an emulsion.
[0072] The food according to one embodiment of the invention
includes the hyaluronic acid and/or a salt thereof (i.e., SOCS3
expression promoter) as an active ingredient. The form of the food
is not particularly limited. Examples of the form of the food
include general foods such as gum, candy, gummy candy, troches,
jelly beverages, rice products, bread, retort (canned) foods,
frozen foods, daily dishes, dry foods, seasonings such as
mayonnaise, beverages, cakes, desserts, and supplements, and
general foods for specified health use for which use of health
claims is allowed. Among these, supplements are preferable from the
viewpoint of convenience.
[0073] Examples of the form of the supplements include a solid
(e.g., tablet, powder, subtle granules, granules, or capsule (hard
capsule or soft capsule), a liquid, a suspension, a jelly, syrup,
and the like.
[0074] Expression of SOCS3 is promoted, and the symptom of an
inflammatory disease is relieved by oral intake of the above food.
The above food may be added to or mixed in a meal of a patient with
an inflammatory disease.
[0075] The food according to one embodiment of the invention may be
added to an arbitrary food or drink. In order to alleviate the
symptom of an inflammatory disease, it is desirable to continuously
take the SOCS3 expression promoter according to one embodiment of
the invention. Therefore, it is desirable to add the SOCS3
expression promoter according to one embodiment of the invention to
a daily food or drink.
[0076] Since the hyaluronic acid and/or a salt thereof is a
biological substance, it is considered that intake of a large
amount of hyaluronic acid and/or a salt thereof does not cause side
effects or causes side effects to only a small extent. The
hyaluronic acid and/or a salt thereof may be administered as a drug
in an amount of 10 to 1000 mg/day, and preferably 100 to 500
mg/day. The hyaluronic acid and/or a salt thereof may be
administered one or more times per day depending on the condition.
The hyaluronic acid and/or a salt thereof may be taken as a food in
an amount of 1 to 1000 mg/day, and preferably 15 to 300 mg/day.
When producing a drink that contains the hyaluronic acid and/or a
salt thereof according to the present invention, the drink may
contain the SOCS3 expression promoter in an amount of 0.001 to 1 wt
%, and preferably 0.01 to 0.5 wt %.
2. Pleiotrophin Expression Inhibitor, Drug and Food Containing the
Same, and Method of Inhibiting Expression of Pleiotrophin
[0077] A pleiotrophin expression inhibitor according to one
embodiment of the invention includes the above hyaluronic acid
and/or a salt thereof as an active ingredient. Specifically, the
hyaluronic acid and/or a salt thereof included in the pleiotrophin
expression inhibitor according to one embodiment of the invention
has an average molecular weight of 500,000 or more, and may be the
same as the hyaluronic acid and/or a salt thereof illustrated in
the section entitled "SOCS3 expression promoter".
[0078] It has been reported that expression of pleiotrophin is
promoted by the onset of autoimmune encephalomyelitis (Liu X,
Mashour G A, Webster H F, Kurtz A, "Basic FGF and FGF receptor1 are
expressed in microglia during experimental autoimmune
encephalomyelitis: temporally distinct expression of midkine and
pleiotrophin", Glia., 24, pp. 390-397, 1998). It has also been
reported that expression of pleiotrophin is promoted by the onset
of an inflammatory disease such as rheumatism (Pufe T, Bartscher M,
Petersen W, Tillmann B, Mentlein R, "Expression of pleiotrophin, an
embryonic growth and differentiation factor, in rheumatoid
arthritis", Arthritis Rheum., 48, pp. 660-667, 2003).
[0079] Since the pleiotrophin expression inhibitor according to one
embodiment of the invention includes the hyaluronic acid having an
average molecular weight of 500,000 or more and/or a salt thereof
as an active ingredient, expression of pleiotrophin can be
inhibited by oral administration of the pleiotrophin expression
inhibitor, for example.
[0080] Inhibition of expression of pleiotrophin may be evaluated by
the degree of expression of pleiotrophin genes determined using a
DNA array (refer to the examples described later), for example.
[0081] Examples of a drug and a food including the pleiotrophin
expression inhibitor according to one embodiment of the invention
and the amount of the pleiotrophin expression inhibitor include
those described above in connection with the drug and the food
including the SOCS3 expression promoter.
[0082] A method of inhibiting expression of pleiotrophin according
to one embodiment of the invention includes orally administering
the hyaluronic acid having an average molecular weight of 500,000
or more and/or a salt to a human or an animal other than a
human.
3. Knee Pain-Relieving Agent
[0083] The drug or the food according to one embodiment of the
invention may be used to relieve knee pain. The hyaluronic acid
and/or a salt thereof may be the same as those described above.
3.1. Background
[0084] The number of persons who suffer knee pain due to aging or
obesity has increased. Knee pain occurs due to various causes. In
particular, knee osteoarthritis (i.e., inflammation occurs in the
knee due to wear of the cartilage that functions as a knee joint
cushion, and the joint may be deformed with the progress of the
disease) is a serious problem.
[0085] A person who suffers knee osteoarthritis initially feels a
pain when moving the knee (e.g., standing up), and also feels a
pain when walking on level ground or sleeping. This imposes
significant restrictions on life and daily activities.
[0086] Knee osteoarthritis is treated by utilizing an
antiphlogistic analgesic that suppresses pain due to inflammation,
or injecting sodium hyaluronate into the joint.
Muscle-strengthening therapy or physiotherapy (e.g., hyperthermia
therapy) may also be used. However, when relief of the symptom
cannot be expected by such conservative medical management, a
surgical procedure such as osteotomy or joint replacement surgery
is employed. The patients are mentally and physically burdened by
these measures.
[0087] Therefore, it is desired to relieve or reduce the pain due
to knee osteoarthritis by oral intake of a drug or a food. U.S.
Pat. No. 6,607,745 discloses a method of relieving joint pain, etc.
due to knee osteoarthritis by orally administering hyaluronic acid,
a salt thereof, or a digest thereof in an amount of 0.1 to 400
micrograms/kg. However, U.S. Pat. No. 6,607,745 does not discloses
the molecular weight of effective hyaluronic acid or a salt
thereof, and an outcome when administering the hyaluronic acid or a
salt thereof.
3.2. Method of Relieving Knee Pain
[0088] The inventors of the invention orally administered a given
amount of hyaluronic acid having a given molecular weight or a salt
thereof to subjects suffering knee pain. The inventors observed a
change in subjective symptom based on a medical index, and found
that pain and stiffness significantly decreased within four weeks.
The inventors further found that the daily life, daily activities,
and health conditions are also improved. These findings have led to
the completion of the invention.
[0089] A knee pain-relieving agent according to one embodiment of
the invention includes hyaluronic acid having an average molecular
weight of 500,000 or more and/or a salt thereof as an active
ingredient. The term "knee pain" includes pain due to knee
osteoarthritis. A method of relieving knee pain according to one
embodiment of the invention includes orally administering
hyaluronic acid having an average molecular weight of 500,000 or
more and/or a salt thereof (e.g., in an amount of 60 to 300
mg/day).
[0090] Knee pain can be relieved while improving the daily life and
activities by orally administering a given amount of the knee
pain-relieving agent according to one embodiment of the invention
that includes the hyaluronic acid having a given molecular weight
and/or a salt thereof as an active ingredient and is contained in a
drug or a food.
[0091] The knee pain-relieving agent according to one embodiment of
the invention may be used in an arbitrary manner. For example, the
knee pain-relieving agent may be used in the form of a powder,
granules, a high-concentration liquid, a low-concentration liquid,
or the like. It is preferable that the knee pain-relieving agent be
a dry product rather than a liquid product from the viewpoint of
the stability of the molecular weight of the hyaluronic acid or a
salt thereof. The content of the hyaluronic acid or a salt thereof
in the knee pain-relieving agent according to one embodiment of the
invention may be appropriately determined depending on the form of
the knee pain-relieving agent and the amount of the knee
pain-relieving agent added to a drug or a food.
[0092] The knee pain-relieving agent according to one embodiment of
the invention may optionally include an extender, a binder, a
lubricant, a preservative, an antioxidant, an essence, a sweetener,
an acidifier, a diluting agent, and the like. The knee
pain-relieving agent may also include vitamins such as vitamin C,
vitamin B2, vitamin B12, and vitamin E, nutritional ingredients
such as nucleic acid, chondroitin sulfate, and collagen, and
minerals such as iron and zinc.
[0093] A drug or a food that includes the knee pain-relieving agent
according to one embodiment of the invention may have the same
composition as that of the drug or the food that includes the above
SOCS3 expression promoter.
4. Knee Joint Treatment
[0094] The drug or the food according to one embodiment of the
invention may be used to treat a knee joint. The above hyaluronic
acid and/or a salt thereof may be used for the drug or the
food.
4.1. Background
[0095] WO00/53194, JP-A-2002-348243, JP-A-2004-181121,
WO2005/040224, JP-A-11-60609, JP-A-2003-160464, and JP-A-10-43286
disclose use of hyaluronic acid or a salt thereof as a knee joint
therapeutic agent. However, the technologies disclosed in these
documents relate to a knee joint treatment injection (i.e., a joint
preparation that contains hyaluronic acid or a salt thereof as an
active ingredient is injected into the knee joint), or an
engineered cartilage.
[0096] Therefore, it is desired to relieve or reduce the pain due
to knee osteoarthritis by oral intake of a drug or a food. U.S.
Pat. No. 6,607,745, JP-A-2004-166616, JP-T-2003-530072, and
JP-A-2007-314531 disclose using hyaluronic acid as a food material
as a component that is considered to be effective for knee pain as
a health food or a supplement.
[0097] However, U.S. Pat. No. 6,607,745 merely discloses a
functional effect that knee pain is reduced by intake.
JP-A-2004-166616 discloses the blood chondroitin sulfate
concentration and NTx (type 1 collagen crosslinked N-telopeptide)
before and after administration. Specifically, JP-A-2004-166616
merely discloses a biochemical change in parameter that does not
suggest efficacy on knee osteoarthritis. JP-T-2003-530072 discloses
that hyaluronic acid is considered to be effective for treating
knee pain, but does not disclose clinical efficacy achieved by
hyaluronic acid. JP-A-2007-314531 merely discloses the effect of
hyaluronic acid on chondrocytes determined by an in vitro
cellular-level test.
4.2. Knee Joint Treatment
[0098] The inventors orally administered the hyaluronic acid or a
salt thereof to an STR/OrtCrlj mouse ("STR mouse") (i.e., a mouse
that spontaneously develops knee osteoarthritis), and
anatomicopathologically observed the knee joint of the hind limb. A
decrease in joint fissure, roughening of the cartilage, and
degeneration of the knee joint synovial membrane were suppressed in
a soft X-ray photograph. Specifically, it was found that the knee
joint disease (particularly cartilage involvement due to knee
osteoarthritis) was suppressed. This finding has led to the
completion of the invention.
[0099] An oral therapeutic agent for a knee joint according to one
embodiment of the invention includes the hyaluronic acid and/or a
salt thereof as an active ingredient. An oral therapeutic agent for
knee osteoarthritis according to one embodiment of the invention
includes the hyaluronic acid and/or a salt thereof as an active
ingredient. An oral therapeutic agent for knee joint cartilage
according to one embodiment of the invention includes the
hyaluronic acid and/or a salt thereof as an active ingredient. An
oral therapeutic agent for a knee joint synovial membrane according
to one embodiment of the invention includes the hyaluronic acid
and/or a salt thereof as an active ingredient. A method of
relieving knee pain according to one embodiment of the invention
includes orally administering hyaluronic acid having an average
molecular weight of 500,000 or more and/or a salt thereof (e.g., in
an amount of 60 to 300 mg/day).
[0100] A knee joint disease can be treated by orally administering
a given amount of the therapeutic agent for a knee joint according
to one embodiment of the invention that includes the hyaluronic
acid and/or a salt thereof as an active ingredient and is contained
in a drug or a food. Daily life and activities can be improved by
thus relieving pain, and facilitating walking and movement.
[0101] A drug or a food that includes the therapeutic agent for a
knee joint according to one embodiment of the invention may have
the same composition as that of the drug or the food that includes
the above SOCS3 expression promoter.
5. Examples
[0102] The invention is further described below by way of examples.
Note that the invention is not limited to the following
examples.
[0103] In the following examples, the average particle diameter of
a powder refers to a value measured by dispersing the powder in
ethanol, and measuring the average particle diameter using an
instrument "SALD-2000A" (manufactured by Shimadzu Corporation).
5.1. Example 1
[0104] In Example 1, the hyaluronic acid according to the invention
was administered to an MRL mouse via drinking water, and the
effects of the SOCS3 expression promoter including the hyaluronic
acid and/or a salt thereof according to the invention on expression
of SOCS3 genes were investigated. The MRL mouse is a mouse model
that spontaneously develops an autoimmune disease (e.g.,
rheumatism). Various symptoms occur due to the autoimmune
disease.
[0105] Twelve MRL lpr/lpr (SPF) female mice (14 weeks old, weight:
about 27 to 37 g, Charles River Laboratories Japan, Inc.) were used
for experiments. The mice were kept in a room set at a temperature
of 22.+-.3.degree. C. and a relative humidity of 50.+-.20%, and fed
a rat-mouse solid feed "CE-2" (Clea Japan, Inc.). A test material
was prepared by diluting hyaluronic acid (hereinafter may be
referred to as "hyaluronic acid sample") produced by the above
production method with distilled water (see Table 1), and given to
the mice (voluntary intake). The details of the test material are
given below.
First group: distilled water ("Otsuka Distilled Water" manufactured
by Otsuka Pharmaceutical Factory, Inc.) Second group:
low-molecular-weight (hyaluronic acid having an average molecular
weight of 2000 that was produced by Production Method 1 (average
molecular weight range: 400 to 20,000, average particle diameter:
67 micrometers), sample A) Third group: high-molecular-weight
(hyaluronic acid having an average molecular weight of 900,000 that
was produced by Production Method 2 (average molecular weight
range: 600,000 to 1,600,000, average particle diameter: 75
micrometers), sample B)
[0106] The test material was aseptically prepared at room
temperature using a clean bench. The concentration of the test
material was adjusted to a given value using distilled water for
injection. The test material was kept cold before use.
TABLE-US-00001 TABLE 1 Intake of Dosage of Concen- drinking
hyaluronic Test tration water acid Number of Group material (mg/ml)
(ml/mouse/day) (mg/kg) mice 1 Distilled -- 6 -- 6 water 2 Sample A
1.1 6 200 6 3 Sample B 1.1 6 200 6
[0107] The dosage of the hyaluronic acid sample was set to 200
mg/kg/day at which the hyaluronic acid sample was expected to
exhibit an effect by drinking water administration. The water
intake of each mouse was preliminarily determined to be 6 mL/day.
Since the weight of the MRL mouse was about 33 g, the concentration
of the sample A and the sample B was set to 1.1 mg/mL.
[0108] The MRL mouse is known to spontaneously develop adenopathy
or the like. In this example, the sample was administered from the
initial stage (14 weeks old) of the pathological condition. The
administration period was set to 28 days that was considered to be
appropriate for evaluating the efficacy by drinking water
administration.
[0109] The mice were euthanized after conducting the intake test
for 28 days, and the small intestine, the large intestine, and the
cervical lymph node were removed. The samples were subjected to (1)
confirmation of expression of SOCS3 genes using a DNA array, (2)
confirmation of expression of SOCS3 genes using RT-PCR, (3)
localization of the hyaluronic acid in the intestine, and (4)
measurement of the weight of the cervical lymph node.
(1) Confirmation of Expression of SOCS3 Genes Using DNA Array
[0110] A sample (about 1 cm) including the Peyer's patch was
collected from the removed large intestine, and subjected to a DNA
array using a GeneChip Mouse Genome 430 2.0 Array (manufactured by
AFFYMETRIX) to evaluate expression of SOCS3 genes.
[0111] Preparation of the target subjected to the DNA array,
hybridization, and analysis of the DNA array were performed in
accordance with the GeneChip Eukaryotic Target Preparation &
Hybridization Manual (AFFYMETRIX). Specifically, a cDNA of the RNA
in the sample was synthesized. The double-stranded cDNA was
purified using a GeneChip Sample Cleanup Module Kit (manufactured
by AFFYMETRIX). The double-stranded cDNA was labeled with biotin
using a GeneChip Expression 3'-Amplification Reagents for IVT
Labeling Kit (manufactured by AFFYMETRIX). The biotin-labeled cRNA
was purified and fragmented using a GeneChip Expression Sample
Cleanup Module Kit (manufactured by AFFYMETRIX). A hybridization
control was added to the sample using a GeneChip Eukaryotic
Hybridization Control Kit (manufactured by AFFYMETRIX). A
hybridization operation was performed at 45.degree. C. and 60 rpm
for 16 hours using a GeneChip Hybridization Oven 640 (manufactured
by AFFYMETRIX). The sample was washed and stained with
streptavidin-phycoerythrin (molecular probe) using a GeneChip
Fluidic Station 450 (manufactured by AFFYMETRIX). The resulting DNA
array was scanned using a laser scanner (GeneChip Scanner 3000 7G
(manufactured by AFFYMETRIX)). The resulting image was analyzed
using dedicated software (GeneChip Operating Software ver. 1.4
(manufactured by AFFYMETRIX)). Enhancement of expression of SOCS3
genes was observed in the sample B intake group.
[0112] The gene sequences of the probes fixed on the DNA array are
given below (sequence ID No. 1 to No. 11). The probe information is
available at the following website.
https://www.affymetrix.com/site/login/login.affx
TABLE-US-00002 (sequence ID No. 1) (5') TCACTTTTATAAAAATCCACCTCCA
(3') (sequence ID No. 2) (5') GAGGCTGTCTGAAGATGCTTGAAAA (3')
(sequence ID No. 3) (5') GAAGATGCTTGAAAAACTCAACCAA (3') (sequence
ID No. 4) (5') GATGCTTGAAAAACTCAACCAAATC (3') (sequence ID No. 5)
(5') TTGAAAAACTCAACCAAATCCCAGT (3') (sequence ID No. 6) (5')
TCAACCAAATCCCAGTTCAACTCAG (3') (sequence ID No. 7) (5')
CAACCAAATCCCAGTTCAACTCAGA (3') (sequence ID No. 8) (5')
ACCAAATCCCAGTTCAACTCAGACT (3') (sequence ID No. 9) (5')
CAAATCCCAGTTCAACTCAGACTTT (3') (sequence ID No. 10) (5')
TCAACTCAGACTTTGCACATATATT (3') (sequence ID No. 11) (5')
ACTCAGACTTTGCACATATATTTAT (3')
[0113] The results for expression of SOCS3 genes are summarized in
Table 2. In Table 2, the expression relative ratio of each group
refers to the fluorescence intensity of each group with respect to
the fluorescence intensity of the distilled water intake group. The
DNA array fluorescence intensity (average value) refers to the
average value of the fluorescence intensities of the probes having
sequence ID No. 1 to No. 11.
TABLE-US-00003 TABLE 2 DNA array fluorescence intensity (average
Expression relative value) ratio Distilled water 701.5 1 intake
group Sample A intake group 325.6 0.5 Sample B intake group 1323.2
1.9
[0114] As shown in Table 2, expression of SOCS3 genes of the group
that was administered the sample B (hyaluronic acid having an
average molecular weight of 900,000) was approximately doubled as
compared with that of the distilled water intake group. On the
other hand, expression of SOCS3 genes was inhibited in the group
that was administered the sample A (hyaluronic acid having an
average molecular weight of 2000). This suggests that expression of
SOCS3 is promoted by oral intake of the hyaluronic acid sample
having an average molecular weight of 500,000 or more.
(2) Confirmation of Expression of SOCS3 Genes Using RT-PCR
[0115] A sample including the Peyer's patch was collected from the
removed large intestine, and the mRNA was extracted. The mRNA was
subjected to RT-PCR using a OneStep RT-PCR Kit (manufactured by
QIAGEN) to evaluate expression of SOCS3 genes. A cDNA of the mRNA
in the sample was synthesized by reverse transcription, and
amplified by a PCR reaction. Specifically, the mRNA was subjected
to reverse transcription at 50.degree. C. for 30 minutes, and
subjected to PCR initial activation at 95.degree. C. for 15
minutes. The DNA was then denatured at 92.degree. C. for 30
seconds, annealed at 60.degree. C. for 30 seconds, and extended at
72.degree. C. for 30 seconds. The above operation was performed in
30 cycles (the final extension was performed at 72.degree. C. for
10 minutes) to effect DNA amplification. The sample was subjected
to electrophoresis using a 1.5% agarose/TAE buffer, and stained
with ethidium bromide. Oligonucleotides having a gene sequence
shown by the following sequence ID No. 12 or No. 13 were used as
primers.
TABLE-US-00004 (5') TAGACTTCACGGCTGCCAAC (3') (sequence ID No. 12)
(5') TCGCTTTTGGAGCTGAAGGT (3') (sequence ID No. 13)
[0116] The results for expression of SOCS3 genes are summarized in
Table 3. The electrophoresis results are shown in FIG. 1. In Table
3, the relative optical intensity refers to the average value of
the relative optical intensities of the probes having sequence ID
No. 12 and No. 13.
TABLE-US-00005 TABLE 3 Relative optical Expression relative
intensity ratio Distilled water 181256 1 intake group Sample A
intake group 189489 1.0 Sample B intake group 235407 1.3
[0117] As shown in Table 3 and FIG. 1, expression of SOCS3 genes of
the group that was administered the sample B (hyaluronic acid
having an average molecular weight of 900,000) was approximately
1.3 times that of the distilled water intake group. On the other
hand, expression of SOCS3 genes of the group that was administered
the sample A (hyaluronic acid having an average molecular weight of
2000) was almost equal to that of the distilled water intake group.
This suggests that expression of SOCS3 is promoted by oral intake
of the hyaluronic acid sample having an average molecular weight of
500,000 or more.
(3) Localization of Hyaluronic Acid in Intestine
[0118] Localization of the hyaluronic acid was determined using the
large intestine and the small intestine removed from the mice.
(3-1) Staining of Hyaluronic Acid in Large Intestine/Small
Intestine Epithelium
[0119] A large intestine specimen of the MRL mouse was cut to a
thickness of 6 micrometers, and air-dried for 30 minutes. The
sample was immersed in 10% neutral buffered formalin solution for
30 minutes, removed, and washed with PBS for 5 minutes. After
repeating the washing step three times, the sample was immersed in
a 100 mM acetate buffer (pH: 6.0) at 37.degree. C. for 15 minutes
(pretreatment). The pretreated sample was immersed in a 100 mM
acetate buffer (pH: 6.0) containing a hyaluronidase (200 TRU/mL)
(derived from actinomyces, manufactured by Amano Enzyme Inc.) for
60.degree. C. for 120 minutes to fragment the hyaluronic acid. The
sample was then washed with PBS for 5 minutes. The washing step was
performed three times. The sample was then treated with a
Streptavidin-biotin Blocking Kit (manufactured by VECTOR) to block
endogenous biotin. Specifically, the sample was immersed in a
streptavidin solution at room temperature for 15 minutes, and
washed with PBS for 5 minutes. The washing step was performed three
times. The sample was immersed in a biotin solution for 15 minutes,
and washed with PBS for 5 minutes. The washing step was performed
three times. After blocking endogenous biotin, the sample was
immersed in 1% BSA/PBS for 60 minutes. The sample was then immersed
in a 1 microgram/mL solution (1% BSA/PBS) of HABP-Biotin
(manufactured by Seikagaku Corporation) at 4.degree. C. overnight,
and washed with PBS for 5 minutes. The washing step was performed
three times.
[0120] The sample was allowed to come in contact with Streptavidin
HRP at room temperature for 60 minutes, and washed with PBS for 5
minutes. The washing step was performed three times. The sample was
then allowed to come in contact with DAB. The sample was then
washed with distilled water, and color development was checked.
(3-2) Double Staining of Hyaluronic Acid and Receptor (TLR-4) in
Large Intestine Epithelium
(Staining of Hyaluronic Acid)
[0121] The large intestine epithelium sample was subjected to the
process described in (3-1) up to the HABP-Biotin treatment. The
sample was immersed in a 1600-fold diluted solution (1% BSA/PBS) of
AlexaFluor488 (manufactured by Molecular Probe) at room temperature
for 60 minutes while shading.
(Staining of TLR-4)
[0122] The following procedure was performed while shading.
Specifically, the sample after staining the hyaluronic acid was
washed with PBS for 5 minutes. The washing step was performed three
times. The sample was then immersed in 10% donkey serum/PBS for
minutes (blocking). The sample was then immersed in an anti-TLR-4
antibody (4 micrograms/mL) (10% donkey serum/PBS) at 4.degree. C.
overnight, and washed with PBS for 5 minutes. The washing step was
performed three times. The sample was then immersed in a 400-fold
diluted solution (10% donkey serum/PBS) of AlexaFluor594
(manufactured by Molecular Probe) at room temperature for 60
minutes. The sample was then washed with PBS for 5 minutes. The
washing step was performed three times.
(Photographing Method)
[0123] The sample was photographed using a Leica DMI4000B at 488 nm
(HA) and 594 nm (TLR-4) to determine localization of HA and
TLR-4.
[0124] As shown in FIGS. 2 and 3, the hyaluronic acid was present
on the surface of the epithelium of the small intestine and the
large intestine of the group that was administered the sample B
(hyaluronic acid having an average molecular weight of 900,000)
(arrows shown in FIGS. 2 and 3 indicate the hyaluronic acid). As a
result of double staining of the hyaluronic acid and TLR-4 on the
surface of the epithelium of the bowel, it was found that
localization of the hyaluronic acid was similar to localization of
TLR-4 (refer to FIG. 4). Therefore, it is estimated that the
hyaluronic acid is bonded to the hyaluronan receptor present on the
surface of the epithelium of the bowel by oral intake of the
hyaluronic acid sample having an average molecular weight of
500,000 or more, so that expression of SOCS3 is promoted, and
expression of pleiotrophin is inhibited.
(4) Measurement of Weight of Cervical Lymph Node
[0125] The removed cervical lymph node was subjected to weight
measurement, and photographed. Table 4 shows the measurement
results for the weight of the cervical lymph node, FIG. 5 shows a
photograph of the cervical lymph node, FIG. 2 shows a photograph of
the surface of the epithelium of the small intestine, and FIG. 3
shows a photograph of the surface of the epithelium of the large
intestine.
TABLE-US-00006 TABLE 4 Weight of cervical lymph node (mg) Weight
relative (average value) ratio Distilled water 1262.6 1 intake
group Sample A intake group 1096.4 0.9 Sample B intake group 812.8
0.6
[0126] As shown in Table 4, the weight of the cervical lymph node
of the group that was administered the sample B (hyaluronic acid
having an average molecular weight of 900,000) was 60% of that of
the distilled water intake group (i.e., a significant decrease was
observed (p=0.05, Fisher's multiple comparison test)). On the other
hand, the weight of the cervical lymph node of the group that was
administered the sample A (hyaluronic acid having an average
molecular weight of 2000) did not significantly decrease as
compared with the distilled water intake group. As is clear from
FIG. 5, enlargement of the cervical lymph node was suppressed in
the group that was administered the sample B (hyaluronic acid
having an average molecular weight of 900,000). Therefore, it is
estimated that expression of SOCS3 was promoted by oral intake of
the hyaluronic acid sample having an average molecular weight of
500,000 or more, so that the symptom of the inflammatory disease
(autoimmune disease) was relieved.
5.2. Example 2
[0127] In Example 2, the effects of the SOCS3 expression promoter
including the hyaluronic acid and/or a salt thereof according to
the invention on expression of SOCS3 genes were investigated using
HT29 cells (i.e., human large intestine epithelial cell
strain).
[0128] The HT29 cells were cultured under the following
conditions.
[0129] The sample A or the sample B used in Example 1 was added to
the medium so that the hyaluronate concentration in the medium was
100 ng/mL. After culturing the HT29 cells for 24 hours, the sample
was subjected to RT-PCR in the same manner as in Example 1.
Oligonucleotides having a gene sequence shown by the following
sequence ID No. 14 or No. 15 were used as primers. The number of
amplification cycles was 38.
TABLE-US-00007 (5') GCCACCTACTGAACCCTCCT (3') (sequence ID No. 14)
(5') ACGGTCTTCCGACAGAGATG (3') (sequence ID No. 15)
[0130] The results are shown in FIG. 6.
[0131] As is clear from the results shown in FIG. 6, expression of
SOCS3 was promoted by culturing the HT29 cells in the presence of
the hyaluronic acid having an average molecular weight of 900,000.
On the other hand, expression of SOCS3 was not promoted as compared
with the control in the presence of the hyaluronic acid having an
average molecular weight of 2000. The above results suggest that
expression of SOCS3 in the large intestine epithelial cells is
promoted in the presence of the hyaluronic acid having an average
molecular weight of 500,000 or more and/or a salt thereof.
5.3. Example 3
[0132] A soft capsule was produced according to the following
formulation using the sample B of Example 1 (hyaluronic acid having
an average molecular weight of 900,000) as a SOCS3 expression
promoter.
<Formulation>
[0133] SOCS3 expression promoter (sample B of Example 1): 20%
Olive oil: 50%
Beeswax: 10%
[0134] Medium-chain triglyceride: 10% Emulsifying agent: 10%
(Total: 100%)
5.4. Example 4
[0135] A powdered drug (granules) was produced according to the
following formulation using the sample B of Example 1 (hyaluronic
acid having an average molecular weight of 900,000) as a SOCS3
expression promoter.
<Formulation>
[0136] SOCS3 expression promoter (sample B of Example 1): 10%
Lactose: 60%
[0137] Corn starch: 25% Hydroxypropylmethyl cellulose: 5%
(Total: 100%)
5.5. Example 5
[0138] A tablet was produced according to the following formulation
using the sample B of Example 1 (hyaluronic acid having an average
molecular weight of 900,000) as a SOCS3 expression promoter.
<Formulation>
[0139] SOCS3 expression promoter (sample B of Example 1): 25%
Lactose: 24%
[0140] Crystalline cellulose: 20% Corn starch: 15%
Dextrin: 10%
[0141] Emulsifying agent: 5% Silicon dioxide: 1%
(Total: 100%)
5.6. Example 6
[0142] Expression of pleiotrophin genes was evaluated using the
sample evaluated in Example 1 in the same manner as in Example 1
(evaluation of expression of SOCS3 genes using a DNA array).
[0143] The gene sequences of the probes fixed on the DNA array are
given below (sequence ID No. 16 to No. 26). The probe information
is available at the following website.
https://www.affymetrix.com/site/login/login.affx
TABLE-US-00008 (sequence ID No. 16) (5') AATGTATACCATAGTACCAGTAGGG
(3') (sequence ID No. 17) (5') AGGAAGTTGAACTCTGTAGTACATA (3')
(sequence ID No. 18) (5') GATTGAGGTAAGTTTTTTGGTGTTG (3') (sequence
ID No. 19) (5') GTGATATTTCACATTTAAATCTTTT (3') (sequence ID No. 20)
(5') ATGTTTTCTCTTGTGCATCAATTTA (3') (sequence ID No. 21) (5')
GTGCATCAATTTAAATGTTACAACC (3') (sequence ID No. 22) (5')
AACCATGTAAACTACTTCTCTTGTT (3') (sequence ID No. 23) (5')
AAACTACTTCTCTTGTTAGATAGAT (3') (sequence ID No. 24) (5')
GATAGATTTTCACCTAGACTTTTTT (3') (sequence ID No. 25) (5')
AGAGGCAGAGCAACGATGTAGTGAA (3') (sequence ID No. 26) (5')
AACATGAAATCCTTTCACTTTGGCA (3')
TABLE-US-00009 TABLE 5 DNA array fluorescence intensity (average
Expression relative value) ratio Distilled water 395 1 intake group
Sample A intake group 247 0.6 Sample B intake group 199.5 0.5
[0144] In Table 5, the fluorescence intensity (average value)
determined by the DNA array refers to the average value of the
fluorescence intensities of the probes having sequence ID No. 16 to
No. 25.
[0145] As shown in Table 5, expression of pleiotrophin was
suppressed by intake of the sample B.
5.7. Example 7
[0146] It is expected that cytokine signaling is inhibited due to
promotion of expression of SOCS3 so that expression of inflammatory
cytokines is inhibited. Therefore, expression of inflammatory
cytokines shown in Table 6 was investigated by a cytokine array
using the large intestine of the mouse that was administered the
hyaluronic acid according to the invention (sample Bused in Example
1).
[0147] A RayBio Mouse Cytokine Antibody Array 3 (manufactured by
RayBiotech) was used. Expression of the inflammatory cytokines
shown in Table 6 was investigated using 10 microliters of a blood
serum collected from the mouse in Example 1. Specifically, the
blood serum was caused to come in contact with a carrier on a glass
slide that was bonded to antibody to various cytokines of mouse. An
antigen-antibody reaction thus occurred between the cytokine in the
blood serum and the antibody. After allowing a mouse anti-cytokine
antibody (secondary antibody) labeled with biotin to come in
contact with the carrier, a streptavidin-fluorescent dye was added
and bonded to the secondary antibody. The fluorescence intensity
was then measured to evaluate expression of each cytokine. The
fluorescence intensity was calculated as an expression ratio with
respect to a positive control. The results are shown in Table
6.
TABLE-US-00010 TABLE 6 Distilled water Sample B intake Normal mouse
intake group group IL-10 5.46 3.81 6.89 MCP-5 n.d. 6.87 4.53 MIP-2
19.02 27.75 14.05 P-Selectin 150.22 129.35 64.76 RANTES 15.03 44.92
28.79 SCF n.d. 2.41 n.d. VEGF n.d. 3.31 2.15 IL-10:
Anti-inflammatory cytokine P-Selectin: Promotes infiltration of
lymphocytes and leukocytes SCF: Relates to arthritis synovial
membrane VEGF: Initial arthritis maeker
[0148] According to Examples 1 and 2, it was found that expression
of SOCS3 is promoted by intake of the sample B so that an
inflammatory disease can be relieved. According to this example,
expression of IL-10 (anti-inflammatory cytokine) was promoted by
intake of the hyaluronic acid (sample B) according to the
invention. These results suggest that expression of SOCS3 is
promoted or expression of pleiotrophin is inhibited by intake of
the sample B so that expression of the anti-inflammatory cytokine
(IL-10) is promoted (i.e., an inflammatory disease is
relieved).
[0149] As shown in Table 6, expression of the inflammatory
cytokines (MCP-5, MIP-2, P-Selectin, RANTES, SCF, and VEGF)
decreased by intake of the hyaluronic acid (sample B) according to
the invention. These results suggest that inflammation was
suppressed (expression of the inflammatory cytokines was inhibited)
by intake of the hyaluronic acid (sample B) according to the
invention.
5.8. Example 8
[0150] When hyaluronic acid is dissolved in low-pH gastric juices,
the molecular weight of the hyaluronic acid may decrease due to
hydrolysis as compared with the molecular weight of the hyaluronic
acid before oral intake, so that the effect of improving an
inflammatory disease (e.g., gonarthritis) may decrease. Therefore,
it is estimated that the effect of treating gonarthritis increases
as the water solubility of hyaluronic acid decreases.
[0151] In this example, the difference in solubility of hyaluronic
acid due to the difference in average particle diameter was
evaluated.
5.8.1. Evaluation Method
[0152] The dissolution rate of hyaluronic acid having an average
molecular weight of 800,000, but having a different average
particle diameter in an artificial gastric juice was evaluated.
Specifically, hyaluronic acid having an average molecular weight of
800,000 was sieved to obtain hyaluronic acid particles having an
average particle diameter shown in Table 7.
[0153] Hyaluronic acid having an average molecular weight of
800,000 was sieved using a sieve 1 (65 meshes (pore diameter: 208
micrometers)), a sieve 2 (150 meshes (pore diameter: 104
micrometers)), and a sieve 3 (250 meshes (pore diameter: 61
micrometers)).
[0154] Particles that passed through the sieve 1 but did not pass
through the sieve 2 were used in Test Example 1, particles that
passed through the sieve 2 but did not pass through the sieve 3
were used in Test Example 2, particles that did not pass through
the sieve 1 were used in Test Example 3, and particles that passed
through the sieve 3 were used in Comparative Test Example 1.
[0155] Hyaluronic acid having an average molecular weight of 8000
was sieved in the same manner as described above to obtain
hyaluronic acid particles having an average particle diameter shown
in Table 8 (the particles of Reference Examples 1 to 4 were
obtained in the same manner as the particles of Test Examples 1 to
3 and Comparative Test Example 1, respectively).
[0156] 0.3 g of the hyaluronic acid was added to 100 mL of an
artificial gastric juice (0.2% NaCl aqueous solution, pH: 1.2). The
mixture was stirred to measure the time (dissolution time) until
the hyaluronic acid particles were completely dissolved (naked eye
observation). Tables 7 and 8 show the dissolution time of the
hyaluronic acid particles of Test Examples 1 to 3, Comparative Test
Example 1, and Reference Examples 1 to 4.
TABLE-US-00011 TABLE 7 Comparative Test Test Test Test Example 1
Example 2 Example 3 Example 1 Average 148 75 353 48 particle
diameter (micrometers) Dissolution 177 175 380 65 time (min)
TABLE-US-00012 TABLE 8 Reference Reference Reference Reference
Example 1 Example 2 Example 3 Example 4 Average 154 71 368 41
particle diameter (micrometers) Dissolution 5 6 21 4 time (min)
5.8.2. Evaluation Results
[0157] As is clear from the above results, the solubility of the
hyaluronic acid particles of Test Examples 1 to 3 (average particle
diameter: 50 to 500 micrometers) in gastric juices was lower than
that of the hyaluronic acid particles of Comparative Test Example
(average particle diameter: less than 50 micrometers). The
solubility of the hyaluronic acid particles of Test Examples 1 and
3 (average particle diameter: 80 to 500 micrometers) was lower than
that of the hyaluronic acid particles of Test Example 2, and the
solubility of the hyaluronic acid particles of Test Example 3
(average particle diameter: 200 to 500 micrometers) was lower than
that of the hyaluronic acid particles of Test Example 1.
Specifically, the hyaluronic acid particles of Test Examples 1 to 3
having an average particle diameter of 50 to 500 micrometers) were
hydrolyzed (reduced in molecular weight) in gastric juices to only
a small extent as compared with the hyaluronic acid particles of
Comparative Test Example 1 having an average particle diameter of
less than 50 micrometers.
[0158] In Reference Examples 1 to 4 in which the average molecular
weight of the hyaluronic acid was 8000, a sufficient correlation
was not observed between the average particle diameter and the
dissolution rate. Specifically, the solubility of the hyaluronic
acid having an average molecular weight of 500,000 or more in
gastric juices varies depending on the average particle diameter,
while the solubility of the hyaluronic acid having an average
molecular weight of less than 500,000 in gastric juices does not
vary depending on the average particle diameter. Note that the
hyaluronic acid having an average molecular weight of less than
500,000 has a small effect of treating inflammatory diseases as
compared with the hyaluronic acid having an average molecular
weight of 500,000 or more (refer to Example 1).
[0159] As described above, it is estimated that hyaluronic acid
having an average molecular weight of 500,000 or more and an
average particle diameter of 200 to 500 micrometers is hydrolyzed
(reduced in molecular weight) in gastric juices to only a small
extent, and is absorbed through the bowel and reaches the affected
area while maintaining the molecular weight, so that an excellent
effect of treating inflammatory diseases is achieved.
5.9. Example 9
[0160] In Example 9, hyaluronic acid having an average molecular
weight of 1,000,000 (i.e., within the range of 600,000 to
1,200,000) and an average particle diameter of 205 micrometers was
orally administered to fifteen men and women with a subjective
symptom of knee pain in an amount of 240 mg/day in the form of a
soft capsule. The condition of each subject was evaluated before
intake, after four weeks of intake, and after eight weeks of intake
using the Japanese Knee Osteoarthritis Measure (JKOM) questionnaire
and the Japanese Orthopaedic Association (JOA) score.
5.9.1. Test Product and Amount of Intake
[0161] Hyaluronic acid having an average molecular weight of
1,000,000 was obtained by Production Method 2. After adjusting the
average particle diameter of the hyaluronic acid to 205
micrometers, soft capsules containing 48 mg of the hyaluronic acid
were produced. The subjects took five soft capsules (hyaluronic
acid: 240 mg) every day.
5.9.2. Subjects and Number of Subjects
[0162] The subjects consisted of fifteen Japanese men and women
(age: 50 to 70) with a subjective symptom of knee pain during
resting and exercise. Note that the subjects were persons who had a
low
[0163] JOA score, and had a grade of 1 to 3 for one of the legs
according to the Kellgren-Lawrence knee osteoarthritis
classification (X-ray knee osteoarthritis evaluation method;
classified into grades 0 to 4 depending on the progress of the
symptom of the joint).
5.9.3. Evaluation Method and Evaluation Results
[0164] The condition of each subject was evaluated by the following
method before intake, after four weeks of intake, and after eight
weeks of intake.
5.9.3.1. JKOM Questionnaire
[0165] The condition of each subject was evaluated based on the
score for criterion 1 (degree of knee pain) (visual analog scale
(VAS)) and the sum of the points for criteria 2 to 5 in the JKOM
questionnaire.
<Criterion 1: Degree of Knee Pain>
[0166] The degree of knee pain was indicated by the 40-stage score
("No pain"=1, "Most acute pain ever experienced"=40).
<Sum of Points for Criteria 2 to 5>
[0167] The total points (0 to 100 points) of four items (25
questions in total) were calculated in Table 9.
TABLE-US-00013 TABLE 9 JKOM questionnaire criteria (II to V) Item
Question Criteria II. 1. Do you feel knee "No stiffness": 0,
"Slightly Knee stiffness these few days stiff": 1, "Moderately pain
or when getting up in the stiff": 2, "Stiff": 3, "Very stiffness
morning? stiff": 4 (32 2. Do you feel knee pain "No pain": 0,
"Slightly points) these few days when getting pain": 1, "Moderately
pain": up in the morning? 2, "Feels pain": 3, "Feels acute pain": 4
3. Do you wake up feeling "No": 0, "Occasionally": 1, knee pain
these few days? "Sometimes": 2, "Frequently": 3, "Every night": 4
4. Do you feel knee pain "No pain": 0, "Slightly these few days
when walking pain": 1, "Moderately pain": on level ground? 2,
"Feels pain": 3, "Feels acute pain": 4 5. Do you feel knee pain "No
pain": 0, "Slightly these few days when going pain": 1, "Moderately
pain": up the stairs? 2, "Feels pain": 3, "Feels acute pain": 4 6.
Do you feel knee pain "No pain": 0, "Slightly these few days when
going pain": 1, "Moderately pain": down the stairs? 2, "Feels
pain": 3, "Feels acute pain": 4 7. Do you feel knee pain "No pain":
0, "Slightly these few days when pain": 1, "Moderately pain":
squatting down or standing 2, "Feels pain": 3, "Feels up? acute
pain": 4 8. Do you feel knee pain "No pain": 0, "Slightly these few
days when pain": 1, "Moderately pain": standing? 2, "Feels pain":
3, "Feels acute pain": 4 III. 9. Do you have difficulty "No
difficulty": 0, Condition in going up or down the "Somewhat
difficult": 1, in daily stairs these few days? "Moderately
difficult": 2, life "Difficult": 3, "Very (40 difficult": 4 points)
10. Do you have difficulty "No difficulty": 0, in squatting down or
"Somewhat difficult": 1, standing up these few days? "Moderately
difficult": 2, "Difficult": 3, "Very difficult": 4 11. Do you have
difficulty "No difficulty": 0, in standing up these few "Somewhat
difficult": 1, days when using a "Moderately difficult": 2,
Western-style toilet? "Difficult": 3, "Very difficult": 4 12. Do
you have difficulty "No difficulty": 0, in changing your clothes
"Somewhat difficult": 1, these few days? "Moderately difficult": 2,
"Difficult": 3, "Very difficult": 4 13. Do you have difficulty "No
difficulty": 0, in pulling on or off your "Somewhat difficult": 1,
socks these few days? "Moderately difficult": 2, "Difficult": 3,
"Very difficult": 4 14. How long can you walk on "30 minutes or
more": 0, "15 level ground these few days minutes or more": 1,
"Around without taking a rest? home": 2, "Inside home": 3,
"Difficult": 4 15. Do you use a stick these "No": 0,
"Occasionally": 1, few days? "Sometimes": 2, "Frequently": 3,
"Always": 4 16. Do you have difficulty "No difficulty": 0, in
shopping these few days? "Somewhat difficult": 1, "Moderately
difficult": 2, "Difficult": 3, "Very difficult": 4 17. Do you have
difficulty "No difficulty": 0, in doing easy housework "Somewhat
difficult": 1, (e.g., clearing the table "Moderately difficult": 2,
or sorting out room) these "Difficult": 3, "Very few days?
difficult": 4 18. Do you have difficulty "No difficulty": 0, in
doing hard housework "Somewhat difficult": 1, (e.g., using a
cleaner or "Moderately difficult": 2, moving bedding) these few
"Difficult": 3, "Very days? difficult": 4 IV. 19. Did you go to "A
few time a week": 0, "Once Dairy entertainments or a a week": 2,
"Once a month": 3, acvtivites department store within "No": 4 etc.
this month? (20 20. Did you have difficulty "No difficulty": 0,
points) in daily activities (e.g., "Somewhat difficult": 1, lesson,
association with "Moderately difficult": 2, friends) within this
month "Difficult": 3, "Very due to knee pain? difficult": 4 21. Did
you limit daily "No": 0, "Occasionally activities (e.g., lesson,
limited": 1, "Sometimes association with friends) limited": 2,
"Frequently within this month due to limited": 3, "Limited": 4 knee
pain? 22. Did you give up going "No": 0, "Occasionally": 1, out to
the neighborhood "Sometimes": 2, within this month due to
"Frequently": 3, "Almost knee pain? always": 4 23. Did you give up
"No": 0, "Occasionally": 1, visiting a faraway place "Sometimes":
2, within this month due to "Frequently": 3, "Almost knee pain?
always": 4 V. 24. Do you think you are "Absolutely yes": 0, "Yes":
Health healthy this month? 1, "Yes and no": 2, "No": 3, condition
"Absolutely no": 4 (8 25. Do you think that your "No": 0, "Affected
to some points) knee condition adversely extent": 1, "Affected to
affects your health within medium extent": 2, this month?
"Affected": 3, "Affected to large extent": 4 Total -- -- of I to V
(100 points)
5.9.3.2. JKOM Questionnaire Results
[0168] As shown in Table 10, the score for criterion 1 (degree of
knee pain) and the sum of the points for criteria 2 to 5
significantly decreased after eight weeks of intake with a risk
rate of less than 1%.
TABLE-US-00014 TABLE 10 JKOM questionnaire results Before After
four After eight Item intake weeks weeks 1. Degree of knee pain
15.6 .+-. 9.2 10.8 .+-. 8.5 8.1 .+-. 5.8** 2. Knee pain or 8.4 .+-.
4.9 5.5 .+-. 3.1* 4.3 .+-. 2.9** stiffness 3. Condition in daily
4.9 .+-. 5.2 2.6 .+-. 3.5 2.2 .+-. 3.3* life 4. Daily activities
4.7 .+-. 3.2 2.3 .+-. 1.4** 2.4 .+-. 1.5** etc. 5. Health condition
2.7 .+-. 1.8 2.2 .+-. 1.4 2.1 .+-. 1.5* Total (2 to 5) 20.8 .+-.
13.2 12.7 .+-. 7.8** 11.0 .+-. 7.6** Average value .+-. standard
deviation n = 15 *p < 0.05 **p < 0.01
5.9.3.3. JOA Questionnaire
[0169] The condition of each subject was evaluated by the total JOA
score (four items) shown in Table 11.
TABLE-US-00015 TABLE 11 JOA score criteria Pain Can walk 1 km or
more. No or occasional pain. 30 (walking Can walk 2 km or more, but
feel pain. 25 ability) Can walk 200 m or more and less than 500 m,
20 but feel pain. Can walk 200 m or more and less than 500 m, 15
but feel pain. Can walk inside room or walk less than 100 m, 10 but
feel pain. Cannot walk. 5 Cannot stand up. 0 Pain Can go up and
down the stairs. Feels no pain 25 (ability of without using a
handrail. stepping Can go up and down the stairs, but feels pain 20
stairs) without using a handrail. Feels pain even when using a
handrail, but feel 15 no pain when slowly going up and down the
stairs. Feels pain even when slowly going up and down 10 the stairs
without using a handrail, but feels no pain slowly going up and
down the stairs using a handrail. Feels pain even when slowly going
up and down 5 the stairs using a handrail. Cannot go up and down
the stairs. 0 Bend angle, Can sit straight. 35 high Cannot sit
straight, but can sit sidewise or 30 stiffness, cross-legged. and
high 110.degree. or more 25 contracture 75.degree. or more 20
35.degree. or more 10 Less than 35.degree. or stiffness/contracture
0 Tumescence None 10 Occasionally requires aspiration. 5 Frequently
requires aspiration. 0 Total -- Total score
5.9.3.4. JOA Questionnaire Results
[0170] As shown in Table 12, the total JOA score significantly
decreased after eight weeks of intake with a risk rate of less than
1%.
TABLE-US-00016 TABLE 12 JOA questionnaire results Before After four
After eight Item intake weeks weeks Pain (walking ability) 23.7
.+-. 5.8 27.7 .+-. 3.7* 28.0 .+-. 4.6* Pain (ability of 15.4 .+-.
6.8 18.3 .+-. 6.7* 19.7 .+-. 6.9** stepping stairs) Bend angle,
high 32.3 .+-. 3.2 33.3 .+-. 2.4 33.7 .+-. 2.3* stiffness, and high
contracture Tumescence 6.7 .+-. 2.4 8.3 .+-. 2.4* 8.7 .+-. 2.3*
Total 77.7 .+-. 10.7 87.7 .+-. 8.2** 90.0 .+-. 9.4** Average value
.+-. standard deviation n = 15 *p < 0.05 **p < 0.01
[0171] As described above, the JKOM score (points) and the JOA
score significantly decreased with a risk rate of less than 1% by
orally administering the hyaluronic acid having an average
molecular weight of 1,000,000 and an average particle diameter of
205 micrometers to fifteen men and women with a subjective symptom
of knee pain in an amount of 240 mg/day in the form of a soft
capsule.
[0172] It was thus confirmed that knee pain can be relieved via
oral intake of a supplement that includes hyaluronic acid having an
average molecular weight of 500,000 or more and an average particle
diameter of 50 to 500 micrometers as an active ingredient.
[0173] Hyaluronic acid having an average molecular weight of
1,200,000 (i.e., within the range of 800,000 to 1,600,000) and an
average particle diameter of 80 micrometers was orally administered
to fifteen men and women with a subjective symptom of knee pain in
an amount of 120 mg/day in the form of a soft capsule. As a result,
the JKOM score significantly decreased after eight weeks of intake
with a risk rate of less than 1%.
[0174] The JOA questionnaire was omitted in this test. It was thus
confirmed that knee pain can be relieved by hyaluronic acid (knee
pain-relieving agent) having an average molecular weight of
1,200,000 and an average particle diameter of 80 micrometers.
[0175] As described above, knee pain could by relieved by orally
administering the knee pain-relieving agent of Example 8 including
hyaluronic acid having an average molecular weight of 500,000 or
more (i.e., 600,000 to 1,600,000) and an average particle diameter
of 50 to 500 micrometers or a salt thereof as the main component to
patients who mainly suffered knee pain for eight weeks in an amount
of 120 to 240 mg/day. The JKOM score and the JOA score
significantly decreased with a risk rate of less than 1%.
Therefore, the knee pain-relieving agent and a drug or a food that
contains the knee pain-relieving agent are effective for relieving
knee pain.
5.10. Example 10
[0176] In Example 10, each hyaluronic acid was dissolved in
drinking water, and administered to STR mice via drinking water.
Drinking water to which the hyaluronic acid was not added was used
as a control, and drinking water in which chondroitin sulfate was
dissolved was used as a positive control. The mice were euthanized
after 17 weeks of administration, and both hind limbs were used as
autopsy samples. As autopsy items, (1) narrowing of fissures in a
soft X-ray photograph of the knee joint, (2) roughening of the
surface of the knee joint cartilage, and (3) alteration of the
synovial membrane of the knee joint were evaluated.
5.10.1. Test Product and Amount of Intake
[0177] As Test Example 4, hyaluronic acid having an average
molecular weight of 900,000 (average molecular weight: 600,000 to
1,600,000, average particle diameter: 159 micrometers) was obtained
by extraction from a cockscomb according to Production Method
1.
[0178] As Test Example 5, hyaluronic acid having an average
molecular weight of 700,000 (average molecular weight: 500,000 to
1,200,000, average particle diameter: 211 micrometers) was obtained
by microbial fermentation according to Production Method 2.
[0179] The resulting hyaluronic acid was added to drinking water in
an amount of 1.1 mg/mL. Each mouse took drinking water in an amount
of 7.5 mL/day (i.e., the amount of intake of the hyaluronic acid
was 200 mg/kg/day.
[0180] Chondroitin sulfate (average molecular weight: about 30,000)
was used as Comparative Test Example 2. Chondroitin sulfate was
added to drinking water in an amount of 12.5 mg/mL. Each mouse took
drinking water in an amount of 7.5 mL/day (i.e., the amount of
intake of chondroitin sulfate was 1000 mg/kg/day.
[0181] Otsuka Distilled Water was used as drinking water. The test
product was aseptically prepared on a clean bench, and kept cold
after the preparation. The above distilled water was used for a
control group.
5.10.2. Test Animals and Test Conditions
[0182] STR/OrtCrlj mice (male, 22 weeks old, Charles River
Laboratories Japan, Inc.) were preliminarily kept for 15 days, and
healthy mice with no abnormalities were subjected to the test.
[0183] The mice were kept at a room temperature of 19 to 25.degree.
C. and a relative humidity of 30 to 70% in a individual ventilation
cage (IVC) (seven mice/cage).
[0184] The mice were fed a rat-mouse solid feed "Quick Fat"
(manufactured by Clea Japan, Inc.) (voluntary intake). The mice
took drinking water containing the test product.
5.10.3. Intake Period
[0185] The intake experiments were performed for 17 weeks when the
mice were at the age of 22 to 39 weeks old.
5.10.4. Evaluation Method and Evaluation Results
[0186] The following items were evaluated by autopsy after 17 weeks
of intake. The mice were anesthetized with ether, and subjected to
laparotomy. After collecting the blood, the mice were exsanguinated
to death. Both hind limbs were then removed. The limbs were
collected together with the head of the femur so that fissures did
not occur in the bones, and fixed with 10% neutral buffered
formalin to prepare a soft X-ray photography evaluation sample and
a histopathological sample.
5.10.4.1. Evaluation of Narrowing of Fissures in Soft X-Ray
Photography of Knee Joint
[0187] A soft X-ray photograph was taken at a distance from the
bulb of 50 cm, a voltage of 26 to 28 kvp, a current of 3 to 4 mA,
and an irradiation time of 45 seconds. The soft X-ray photograph of
the knee joint was evaluated.
[0188] Specifically, whether or not some or all of the joint
fissures disappeared (i.e., whether or not narrowing of the joint
fissures occurred) was evaluated. A case where a change did not
occur as compared with the photograph of the joint of a healthy
mouse was evaluated as "0", a case where a change occurred to only
a small extent as compared with the photograph of the joint of a
healthy mouse was evaluated as "0.5", a case where a change
occurred to some extent as compared with the photograph of the
joint of a healthy mouse was evaluated as "1", a case where a
change occurred to a medium extent as compared with the photograph
of the joint of a healthy mouse was evaluated as "2", and a case
where a change occurred to a large extent as compared with the
photograph of the joint of a healthy mouse was evaluated as
"3".
[0189] A blind evaluation was employed. The evaluation results are
shown in FIG. 7.
[0190] The soft X-ray photography score of Test Examples 4 and 5
was significantly lower than that of the control group. On the
other hand, no significant difference was observed between
Comparative Test Example 2 and the control group. The presence or
absence of a significant difference was determined by the
Kolmogorov-Smirnov (KS) test with a risk rate of less than 1%.
[0191] FIG. 8 shows the soft X-ray photography of the 39-weeks-old
STR mouse of each group.
[0192] As shown in FIG. 8, the joint fissure of Test Example 4 (B)
and Test Example 5 (C) was wider than that of the control group (A)
(i.e., narrowing of the joint fissure was suppressed). On the other
hand, no difference was observed for Comparative Test Example 2
(D).
5.10.4.2. Evaluation of Roughening of Surface of Knee Joint
Cartilage
[0193] Roughening of the surface of the knee joint cartilage was
evaluated by the India ink method.
[0194] Specifically, an India ink was applied to the surface of the
thighbone cartilage of the hind limb sample fixed with formalin.
After washing the thighbone cartilage in a physiological saline
solution, the thighbone cartilage was photographed. The India ink
remains in an area in which the cartilage is roughened. The
cartilage area (number of pixels) was measured using an NIH image
(see FIG. 9). The number of lattice intersection points (excluding
the ligament) in an area in which the India ink remained was
counted by a Weigel's point counting method.
[0195] A value obtained by dividing the number of lattice
intersection points by the cartilage area was used as a cartilage
roughening index.
[0196] The evaluation results are shown in FIG. 10.
[0197] The cartilage roughening index of Test Examples 4 and 5 was
significantly smaller than that of the control group. On the other
hand, the cartilage roughening index of Comparative Test Example 2
was smaller to only a small extent than that of the control group
(i.e., no significant difference was observed). The average value
and the standard error were calculated from the resulting data. The
presence or absence of a significant difference was determined with
a risk rate of less than 1% by performing the non-parametric or
parametric Tukey multiple comparison test.
[0198] FIG. 11 shows the photograph of the surface of the thighbone
cartilage of the 39-weeks-old STR mouse of each group to which the
India ink was applied.
[0199] As shown in FIG. 11, the staining area of Test Example 4 (B)
and Test Example 5 (C) was smaller than that of the control group
(A) (i.e., roughening of the surface of the knee joint cartilage
was suppressed). On the other hand, only a small difference in
staining area was observed between Comparative Test Example 2 (D)
and the control group (A).
5.10.4.3. Evaluation of Alteration of Synovial Membrane of Knee
Joint
[0200] The hind limb fixed with 10% neutral buffered formalin was
delimed using 10% EDTA, embedded in paraffin, and sliced. A
hematoxylin-eosine-stained sample was then prepared, and the
synovial membrane on each side of the patella was
histopathologically examined. "Normal" was evaluated as "0",
"Synoviocytes activation" was evaluated as "1", "Synoviocytes
activation and slight growth" was evaluated as "2", and
"Synoviocytes activation and serious growth" was evaluated as "3".
The synovial membrane evaluation score was then calculated.
[0201] The evaluation results are shown in FIG. 12.
[0202] The synovial membrane evaluation index of Test Examples 4
and 5 was significantly lower than that of the control group. On
the other hand, no difference was observed between Comparative Test
Example 2 and the control group. The average value and the standard
error were calculated from the resulting data. The presence or
absence of a significant difference was determined with a risk rate
of less than 5% by performing the non-parametric or parametric
Tukey multiple comparison test. No significant difference was
observed between each group.
[0203] According to the histopathological examination of the
synovial membrane, slight growth of the synoviocytes was
significantly observed in the control group and Comparative Test
Example 2. On the other hand, the growth of the synoviocytes was
clearly suppressed in Test Examples 4 and 5 although activation of
the synoviocytes was observed.
[0204] As is clear from the results of the soft X-ray photography
of the knee joint and the histopathological of both hind limbs,
narrowing of fissures in the knee joint, roughening of the surface
of the knee joint cartilage, and alteration of the synovial
membrane of the knee joint were suppressed by orally administering
hyaluronic acid extracted from a cockscomb (average molecular
weight: 600,000 to 1,600,000) and having an average particle
diameter of 50 to 500 micrometers or hyaluronic acid obtained by
microbial fermentation (average molecular weight: 500,000 to
1,200,000) and having an average particle diameter of 50 to 500
micrometers to the STR mice (i.e., a mouse model that spontaneously
develops knee osteoarthritis) for 17 weeks.
[0205] According to Test Examples 4 and 5, the knee joint
therapeutic agent according to one embodiment of the invention
including the hyaluronic acid or a salt thereof as an active
ingredient significantly improved the knee joint soft X-ray
photography score and the knee joint cartilage roughening index of
the knee osteoarthritis model animals with a risk rate of less than
1%. The patella synovial membrane score was improved although a
significant difference was not observed. Therefore, the knee joint
therapeutic agent according to one embodiment of the invention is
effective for treating knee osteoarthritis, the cartilage of the
knee joint, and the synovial membrane of the knee joint. A drug or
a food that includes the knee joint therapeutic agent is effective
for histopathologically improving the knee joint, and is effective
for treating, preventing, or relieving diseases in the field of
orthopedics.
Sequence CWU 1
1
26125DNAArtificial Sequenceprobe 1tcacttttat aaaaatccac ctcca
25225DNAArtificial Sequenceprobe 2gaggctgtct gaagatgctt gaaaa
25325DNAArtificial Sequenceprobe 3gaagatgctt gaaaaactca accaa
25425DNAArtificial Sequenceprobe 4gatgcttgaa aaactcaacc aaatc
25525DNAArtificial Sequenceprobe 5ttgaaaaact caaccaaatc ccagt
25625DNAArtificial Sequenceprobe 6tcaaccaaat cccagttcaa ctcag
25725DNAArtificial Sequenceprobe 7caaccaaatc ccagttcaac tcaga
25825DNAArtificial Sequenceprobe 8accaaatccc agttcaactc agact
25925DNAArtificial Sequenceprobe 9caaatcccag ttcaactcag acttt
251025DNAArtificial Sequenceprobe 10tcaactcaga ctttgcacat atatt
251125DNAArtificial Sequenceprobe 11actcagactt tgcacatata tttat
251220DNAArtificial Sequenceprimer 12tagacttcac ggctgccaac
201320DNAArtificial Sequenceprimer 13tcgcttttgg agctgaaggt
201420DNAArtificial Sequenceprimer 14gccacctact gaaccctcct
201520DNAArtificial Sequenceprimer 15acggtcttcc gacagagatg
201625DNAArtificial Sequenceprobe 16aatgtatacc atagtaccag taggg
251725DNAArtificial Sequenceprobe 17aggaagttga actctgtagt acata
251825DNAArtificial Sequenceprobe 18gattgaggta agttttttgg tgttg
251925DNAArtificial Sequenceprobe 19gtgatatttc acatttaaat ctttt
252025DNAArtificial Sequenceprobe 20atgttttctc ttgtgcatca attta
252125DNAArtificial Sequenceprobe 21gtgcatcaat ttaaatgtta caacc
252225DNAArtificial Sequenceprobe 22aaccatgtaa actacttctc ttgtt
252325DNAArtificial Sequenceprobe 23aaactacttc tcttgttaga tagat
252425DNAArtificial Sequenceprobe 24gatagatttt cacctagact ttttt
252525DNAArtificial Sequenceprobe 25agaggcagag caacgatgta gtgaa
252625DNAArtificial Sequenceprobe 26aacatgaaat cctttcactt tggca
25
* * * * *
References