U.S. patent application number 12/889564 was filed with the patent office on 2011-02-17 for acetylcholinesterase (ache)-derived peptide as an inducer of granulocytopoiesis, uses and methods thereof.
This patent application is currently assigned to YISSUM RESEARCH DEVELOPMENT COMPANY OF THE HEBREW UNIVERSITY OF JERUSALEM. Invention is credited to Varda Deutsch, Dan Grisaru, Chava Perry, Marjorie Pick, Hermona Soreq.
Application Number | 20110039791 12/889564 |
Document ID | / |
Family ID | 34073848 |
Filed Date | 2011-02-17 |
United States Patent
Application |
20110039791 |
Kind Code |
A1 |
Soreq; Hermona ; et
al. |
February 17, 2011 |
ACETYLCHOLINESTERASE (ACHE)-DERIVED PEPTIDE AS AN INDUCER OF
GRANULOCYTOPOIESIS, USES AND METHODS THEREOF
Abstract
The present invention describes the use of an AChE-R-derived
peptide, also known as ARP, as an inducer of hemopoietic cell
differentiation and expansion, specifically for the granulocytic
population. In addition, the use of ARP as an inducer of
thrombopoietin and pro-inflammatory cytokines is also presented.
ARP may further be used in the pre-transplant priming of
hematopoietic stem cells. Other uses and methods utilizing ARP are
also described herein.
Inventors: |
Soreq; Hermona; (Jerusalem,
IL) ; Grisaru; Dan; (Herzliya, IL) ; Deutsch;
Varda; (Jerusalem, IL) ; Perry; Chava; (Ramat
Gan, IL) ; Pick; Marjorie; (Jerusalem, IL) |
Correspondence
Address: |
Fleit Gibbons Gutman Bongini & Bianco PL
21355 EAST DIXIE HIGHWAY, SUITE 115
MIAMI
FL
33180
US
|
Assignee: |
YISSUM RESEARCH DEVELOPMENT COMPANY
OF THE HEBREW UNIVERSITY OF JERUSALEM
Jerusalem
IL
Medical Research Fund at the Tel Aviv Sourasky Medical
Center
Tel Aviv
IL
|
Family ID: |
34073848 |
Appl. No.: |
12/889564 |
Filed: |
September 24, 2010 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10589116 |
May 1, 2007 |
7838493 |
|
|
PCT/IL05/00185 |
Feb 10, 2005 |
|
|
|
12889564 |
|
|
|
|
Current U.S.
Class: |
514/21.3 ;
435/375 |
Current CPC
Class: |
A61P 7/00 20180101; A61P
19/02 20180101; A61P 37/04 20180101; A61K 38/465 20130101; A61P
37/00 20180101; A61P 37/06 20180101; C12Y 301/01007 20130101; A61P
29/00 20180101 |
Class at
Publication: |
514/21.3 ;
435/375 |
International
Class: |
A61K 38/16 20060101
A61K038/16; C12N 5/00 20060101 C12N005/00; A61P 37/00 20060101
A61P037/00; A61P 29/00 20060101 A61P029/00; A61P 19/02 20060101
A61P019/02 |
Foreign Application Data
Date |
Code |
Application Number |
Feb 12, 2004 |
IL |
160376 |
Claims
1. A method of inducing production of granulocytes in a subject in
need thereof, comprising administering a therapeutically-effective
amount of an acetylcholinesterase (AChE)-derived peptide, or
functional fragments, derivatives, or a composition thereof to said
subject, wherein said AChE-derived peptide is denoted by SEQ ID
NO:1.
2. A method of treatment of conditions that trigger low cell count
of granulocytes, comprising administering a
therapeutically-effective amount of an acetylcholinesterase
(AChE)-derived peptide, or functional fragments, derivatives, or a
composition thereof to a subject in need, wherein said AChE-derived
peptide is denoted by SEQ ID NO:1.
3. A method of inducing blood cells to produce cytokines,
comprising obtaining said cells from a subject in need of
cytokine-producing blood cells, isolating immature cells, and
contacting said cells with an acetylcholinesterase (AChE)-derived
peptide, or functional fragments, derivatives, or a composition
thereof, wherein said AChE-derived peptide is denoted by SEQ ID
NO:1.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] The instant application is a divisional of application Ser.
No. 10/589,116, filed on May 1, 2007, which is the U.S. national
stage application of International Application No.
PCT/IL2005/000185, filed on Feb. 10, 2005, the entire disclosures
of which are herein incorporated by reference.
FIELD OF THE INVENTION
[0002] The present invention relates generally to the field of
hematopoiesis and more specifically to the effect of an
AChE-derived peptide on different hematopoietic
sub-populations.
BACKGROUND OF THE INVENTION
[0003] All publications mentioned throughout this application are
fully incorporated herein by reference, including all references
cited therein.
[0004] Mammalian hematopoietic stem cells develop during
embryogenesis and differentiate into the different hematopoietic
lineages. After birth, the capacity of myeloid cells to respond to
external and/or internal stimuli by the finely tuned production of
pro-inflammatory and anti-inflammatory cytokines is gradually
acquired, in parallel with the establishment of fully mature
lymphocytic immune responses. Interestingly, the responses of both
myeloid and lymphoid cell lineages are subject to acetylcholine
(ACh) modulation [Kawashima, K., and T. Fujii (2000) Pharmacol.
Ther. 86:29-48; Tracey, K. J. (2002) Nature 420:853-9], which
involves the .alpha.7 nicotinic ACh receptor [Wang, H. et al.
(2003) Nature 421:384-8] and are known to be impaired under
psychological stress [Miller, G. E. et al. (2002) Health Psychol
21:531-41]. However, the putative protein(s) mediating these
developmental and stress-induced processes is yet unknown.
[0005] Post-stress leukocytosis, i.e. overproduction of white blood
cells (WBC), was first described over 50 years ago. Elevated WBC
counts occur after diverse stress insults, e.g. shock, blood loss,
in post-partum mothers, following space flight or bacterial
infection [Delgado, I. et al. (1994) Gynecol. Obstet. Invest. 38:
227-235; Reizenstein, P. (1979) Br. J. Haematol. 43: 329-334;
Stowe, R. P. et al. (1999) J. Leukoc. Biol. 65: 179-186; Toft, P.
et al. (1994) Apmis 102: 43-48; Wanahita, A. et al. (2002) Clin.
Infect. Dis. 34: 1585-1592]. The initiation of WBC overproduction
has been attributed to the elevated serum levels of cortisol,
causing both enhanced proliferation and facilitated WBC maturation,
predominantly toward the granulocytic lineage [Abramson, N. and
Melton, B. (2000) Am. Fam. Physician 62: 2053-2060]. However, the
increased levels of cortisol, e.g. following the stressful event of
delivery, recede within a few hours [Tuimala, R. et al. (1976) Br.
J. Obstet. Gynaecol. 83: 707-710], and cannot account for the
prolongation of leukocytosis, especially since the lifespan of
granulocytes is extremely short, with 50% of the granulocytes being
replaced by the bone marrow daily [Abo, T. and Kawamura, T. (2002)
Ther. Apher. 6: 348-357]. The signaling pathways controlling this
process therefore remain largely unknown.
[0006] Granulocytosis depends upon the production of
pro-inflammatory/hematopoietic cytokines which in peripheral
tissues is regulated by acetylcholine (ACh) [Borovikova, L. V. et
al. (2000) Nature 405: 458-462; Tracey, K. J. (2002) id ibid.].
Under normal conditions, ACh activates .alpha.7 ACh nicotinic
receptors on macrophages to attenuate pro-inflammatory cytokine
secretion at the post-transcriptional level [Wang, H. (2003) id
ibid.]. To determine whether post-stress ACh levels can account for
the prolonged granulocytosis effect independently of cortisol, and
to delineate the cascade of events that enables this process, the
inventors studied circulating acetylcholinesterase (AChE). Agents
performing this reaction can further be used to control the
production of cytokines in patients with failure of such
responses.
[0007] Hence, inflammation is an example of inducible
hematopoiesis, which occurs whenever there is an increased demand
for mature blood cells. Upon activation of the inflammatory
response, pro-inflammatory cytokines are secreted by cells of the
immune system, and induce accelerated production of hematopoietic
cells. Lipopolysaccharide (LPS), the main cell wall component of
gram-negative bacteria, is an endotoxin that induces an acute
inflammatory response, initiating a signal transduction cascade
that leads to the release of inflammatory cytokines, which include
tumor necrosis factor (TNF)-.alpha., IL-1.beta., IL-6 and IL-8.
These cytokines activate the mobilization of hematopoietic cells
from the bone marrow (BM) and set in motion the migration of
leukocytes from blood vessel walls, increasing their numbers in the
circulation [Lagasse E, Weissman I L. (1996) J. Immunol. Methods
197:139-150]. The net result of this process is an immediate and
dramatic increase in the number of circulating peripheral blood
(PB) cells, needed to mount the immune response. This results in a
compensatory decrease in cell numbers until more cells are produced
in the BM [Nagata Y, et al. (1997) Thromb Haemost. 77:808-814].
[0008] Many factors are involved in abating the inflammatory
response allowing hemostasis to return. Acetylcholine (ACh), is one
of the recently discovered factors that attenuates the
pro-inflammatory cytokine secretion by activating nicotinic
receptors on macrophages at the post-transcriptional level [Wang H.
et al. (2003) Nature 421:384-388]. Circulating acetylcholinesterase
(AChE) controls the levels of ACh, suggesting promotion of the
inflammatory process under AChE excess [Pick M. et al. (2004) Ann.
NY Acad. Sci. 1018:85-95]. AChE has three variant forms, --Synaptic
(S), Erythrocytic (E) and Readthrough (R), is ubiquitously
expressed in hematopoietic cell lineages especially in
megakaryocytes (Mks) and erythrocytes [Kawashima K, and Fujii T.
(2000) Pharmacol. Ther. 86:29-48; Lev-Lehman E. et al. (1997) Blood
89:3644-3653; Grisaru D. et al. (2001) Molecular Medicine 7:93-105]
and is thought to be a potential growth factor for hematopoiesis
[Grisaru (2001) id ibid.; Deutsch V. et al. (2002) Exp. Hematol.
30:1153-1161].
[0009] AChE-R is expressed in multiple embryonic and tumor cells,
where it displays morphogenic functions, but it is rarely found in
healthy and unstressed adult tissues [Grisaru (1999a) id ibid.;
Karpel (1994) id ibid.; Soreq, H. and S. Seidman (2001) Nat. Rev.
Neurosci. 2:294-302; Grisaru, D. et al. (1999b) Mol. Cell Biol.
19:788-795] or human sera [Brenner et al. (2003) FASEB J.
17(2):214-22]. Cortisol induces AChE-R production in cultured CD34+
blood cell progenitors [Grisaru (2001) id ibid.], while ARP.sub.26,
a synthetic peptide designed to mimic the cleavable C-terminal
sequence of AChE-R, promotes hematopoietic proliferation in vitro
[Grisaru (2001) id ibid.].
[0010] The up regulation of AChE expression during megakaryopoiesis
was initially reported in rats, where the fraction of AChE-positive
BM cells increased following induction of thrombocytopenia [Jackson
C W. (1973) Blood 42:413-421]. Functional involvement of this
enzyme was indicated by suppression of AChE synthesis, which
induced transient decreases in murine megakaryocyte progenitors
[Lev-Lehman (1997) id ibid.].
[0011] Platelet production is a self-regulated process primarily
induced by thrombocytopenia where a drastic reduction in platelets
stimulates the production of thrombopoietin (TPO). Subsequently, as
platelet counts return to normal, TPO is effectively cleared from
the circulation, by means of binding to its receptor, c-mpl, and
uptake into platelets and megakaryocytes. TPO is the main
physiological growth factor for megakaryocyte proliferation,
differentiation and platelet production. Nevertheless,
c-mpl.sup.-/- and TPO.sup.-/-knockout mice have a residual 10% of
normally functioning megakaryocytes and platelets, which cannot be
attributed to IL-6, IL-11 or leukemia inhibitory factor (LIF),
which are also known to induce megakaryocyte differentiation
[Ishibashi T. et al. (1989) Proc. Natl. Acad. Sci. USA 86:
5953-5957; Teramura M., et al. (1996) Cancer Chemother. Pharmacol.
38:Suppl:S99-102; Nakashima K. et al. (1998) Semin. Hematol. 35:
210-221; Gainsford T. et al. (2000) Blood 95: 528-534] suggesting
the involvement of other factor(s) in this process.
[0012] Pancytopenia and prolonged thrombocytopenia are significant
clinical problems for patients undergoing BM transplantation.
Engraftment of transplanted BM is usually accomplished within 2 to
3 weeks, during which period the patient is susceptible to
life-threatening infections and bleeding. Platelet recovery after
autologous stem cells or cord blood (CB) transplantation is
significantly delayed (up to 6 weeks post transplant) due to lack
of sufficient megakaryocyte precursors in the grafts. The paucity
of megakaryocyte progenitor cells in grafts, and not inferior
levels of TPO, is the cause for delayed platelet recovery observed
post cord blood and autologous transplantation [Kuter D. J. (2002)
Transfusion 42:279-283; Kanamaru S. et al. (2000) Stem Cells
18:190-195].
[0013] Thus, within their individual microenvironment, blood cells
receive a plethora of external stimuli which influence
transcription and processing of many reactive molecules. Particular
alternatively spliced AChE variants may be candidates to exert both
enzymatic and non-catalytic functions on these cells. The
expression of AChE-S in blood cells has been associated with
terminal differentiation [Chan, R. Y. Y. et al. (1998) J. Biol.
Chem. 273:9727-9733] and apoptosis [Zhang, X. J. et al. (2002) Cell
Death Differ. 9:790-800]. In contrast, AChE-R and the synthetic
peptide ARP were associated with stem myeloid cell proliferation
[Grisaru (2001) id ibid.; Deutsch et al. (2002) id ibid.].
[0014] The present inventors performed a comprehensive study to
correctly evaluate the potential contribution of AChE towards
differentiation, proliferative or apoptotic events in
hematopoiesis, and in inflammatory responses under stress stimuli,
specific variants were identified, their levels quantified and
their subcellular localization (i.e. on the cell surface and/or
intracellular) determined in specific blood cell lineages.
[0015] The inventors considered, as a working hypothesis,
circulating AChE-R to be a modulator of sustained granulocytosis
effects in hematopoietic progenitors. To find out whether AChE-R
and/or ARP are associated with post-stress granulocytosis and
cytokine production, the inventors initiated a study aimed at
delineating the in vivo and ex vivo regulation of AChE-R production
in stress-induced myelopoietic processes.
[0016] Thus, an aim of the present invention is to provide novel
uses for an AChE-derived peptide, as an agent capable of inducing
granulopoiesis, as demonstrated in the following Examples.
[0017] It is another aim of the present invention to provide a
method for the treatment of conditions that induce a low
granulocytic cell count, administering said AChE-derived peptide,
and compositions thereof, to a subject in need.
[0018] Further, the present invention provides methods of
evaluating lymphocytic activity, based on the expression of the
different AChE forms on lymphocytes.
[0019] Other purposes and advantages of the invention will appear
as the description proceeds.
SUMMARY OF THE INVENTION
[0020] The inventors have demonstrated that overproduction and
C-terminal cleavage of the stress-induced AChE-R isoform induced
granulocytosis.
[0021] In this view, in a first aspect, the present invention
provides the use of an AChE-derived peptide, ARP.sub.26, and any
functional fragments thereof, as an agent for the induction of the
production of granulocytes, or for the enrichment of the
granulocytic cell population, wherein said peptide is denoted by
SEQ ID NO:1. The peptide used by the invention comprises the
following amino acid sequence:
TABLE-US-00001 N'-GMQGPAGSGWEEGSGSPPGVTPLFSP-C'
[0022] Said peptide may also be an agent for the induction of
repopulation and/or rematuration of granulocytic cell populations,
preferably in a subject in need.
[0023] In another aspect, the present invention comprises the use
of an AChE-derived peptide as an agent for ex vivo or in vitro
manipulation of cells to induce granulocyte cell differentiation,
wherein said peptide is denoted by SEQ ID NO:1.
[0024] The AChE-derived peptide denoted by SEQ ID NO:1, or any
functional fragments thereof, are also to be used as an agent for
pre-transplant priming of hematopoietic stem cells.
[0025] A further use of the AChE-derived peptide ARP.sub.26, or any
functional fragments thereof, is as an inducer of pro-inflammatory
cytokines and/or as an inducer of TPO.
[0026] In a further aspect, the present invention provides the use
of an AChE-derived peptide, or any functional fragments thereof, in
the preparation of a pharmaceutical composition for the treatment
and/or prevention of conditions that trigger low granulocyte count,
wherein said peptide is denoted by SEQ ID NO:1. Said composition
may also be used in pre-transplant priming of hematopoietic stem
cells. Said conditions may be, for example, leucopenia, acute
myeloid leukemia (AML), and particularly neutropenia.
[0027] In an even further aspect, the present invention provides a
method of treatment of conditions that induce leucopenia,
comprising the steps of administering a therapeutically effective
amount of an AChE-derived peptide or a composition thereof to a
subject in need, wherein said AChE-derived peptide is denoted by
SEQ ID NO:1.
[0028] The invention also refers to an in vivo method for the
prevention and/or treatment of conditions wherein lymphocyte
activity is reduced, such as chronic stress, autoimmune diseases,
inflammation, rheumatoid arthritis, multiple sclerosis (MS),
amyotrophic lateral sclerosis (ALS), fibromyalgia, multiple
chemical sensitivity, post-irradiation, chemotherapy in a subject
in need, comprising administering a therapeutically-effective
amount of an AChE-derived peptide, or any functional fragments
thereof, to an individual suffering or prone to said conditions,
wherein said peptide is denoted by SEQ ID NO:1.
[0029] The present invention also discloses a method for detecting
changes in the activity of lymphocytes, comprising measuring the
expression of AChE-R on the surface of lymphocytes.
[0030] The invention provides an ex vivo or in vitro method of
prevention and/or treatment of conditions wherein lymphocyte
activity is reduced, such as chronic stress, autoimmune diseases,
inflammation, rheumatoid arthritis, multiple sclerosis (MS),
amyotrophic lateral sclerosis (ALS), fibromyalgia, multiple
chemical sensitivity, post-irradiation, chemotherapy in a subject
in need, comprising obtaining blood from said subject, isolating
immature cells and contacting said cells with an AChE-derived
peptide, or any functional fragments thereof, wherein said peptide
is denoted by SEQ ID NO:1.
[0031] In addition, a method of priming of hematopoietic stem cells
pre-transplant is presented, comprising obtaining said cells,
isolating from said cells an immature, CD34+ rich population, and
exposing said cell population to an AChE-derived peptide, its
functional fragments or derivates, or compositions comprising
thereof, wherein said peptide is denoted by SEQ ID NO:1. Most
importantly, said cells may be obtained from the subject in need of
said transplant or from another donor.
[0032] Lastly, the invention also provides a method of inducing
adult blood cells to produce cytokines, comprising obtaining said
cells from a subject in need of cytokine-producing blood cells,
isolating immature cells and contacting said cells with an
AChE-derived peptide, wherein said peptide is denoted by SEQ ID
NO:1. This method is particularly advantageous for patients with
neutropenia.
BRIEF DESCRIPTION OF THE FIGURES
[0033] FIG. 1A-1D: Flow cytometric approach to AChE splice
variants.
[0034] FIG. 1A: C-terminal amino acid sequence unique to the human
AChE-S variant; SEQ ID NO:2.
[0035] FIG. 1B: C-terminal amino acid sequence unique to the human
AChE-R variant; SEQ ID NO:1. The sequences in A and B share a
similar core domain. Note that ASP, but not ARP, includes a
C-terminal cysteine residue (asterisk) that enables AChE-S
multimerization).
[0036] A scFv-myc tagged antibody selected against the C-terminal
sequence of AChE-S from a phage display library (anti-ASP1) and a
polyclonal antibody produced against synthetic ARP (drawings)
enabled specific detection of each of these variants.
[0037] FIG. 1C: Flow cytometric sub-classification of hematopoietic
cells using anti-CD45. Shown are adult peripheral blood cells
divided into lymphocytes, monocytes, granulocytes and red blood
cells, depending on their expression of CD45. Each dot corresponds
to one cell.
[0038] FIG. 1D: Anti-ASP1 scFv purity was verified by gel
electrophoresis. Elution from Ni-NTA column with 250 mM imidazole,
revealed 30-kDa band (arrow). Abbreviations: S. Sc., side scatter;
fr., fraction.
[0039] FIG. 2A-2C: Enzymatic AChE activity in hematopoietic blood
cells.
[0040] FIG. 2A: Cytochemical staining reveals acetylthiocholine
hydrolysis activity (brown-gray) in all cell lineages (arrows) from
all three sources.
[0041] FIG. 2B: Counterstaining with May-Gruenwald's/Giemsa
highlights the different characteristic morphologies of the smeared
cells. Note gray color of cytochemically positive cells
(arrows).
[0042] FIG. 2C: Quantitation of cell positive for AChE activity for
each blood cell group and arbitrary measurement of brown intensity
n=30 cells.
[0043] Abbreviations: L, lymphocytes; G, granulocytes; R, red blood
cells; M, monocytes; pos., positive; int., intensity.
[0044] FIG. 3: Cell surface and intracellular AChE-S and -R
labeling in post-partum peripheral blood cell populations.
[0045] AChE-S and AChE-R were detected using an anti-ASP scFv
antibody with a myc tag and anti-myc FITC or a polyclonal rabbit
antibody and anti-rabbit FITC, respectively. Positive cells (solid
line) were defined by a shift to the right as compared to the
control (dashed line) histogram. This figure represents one of 15
reproducible analyses.
[0046] Abbreviations: C, Cytoplasmic; S, Surface; rbc, red blood
cells; gran., granulocytes; mono., monocytes; lymph., lymphocytes;
ce. no., cell number; Fluor. Int., Fluorescence Intensity.
[0047] FIG. 4A-4C: Immunochemical analyses of cord blood cell
lysates. AChE-S and -R epitopes were detected in 0.83 mg/ml protein
extracts from the three different sub-populations of cord
blood.
[0048] FIG. 4A: Plasmon resonance traces reflected interactions of
anti-ASP1 scFv antibody with extracts of granulocytes (G);
lymphocytes (L); monocytes (M) and red blood cells (R). Real time
interaction (x-axis) is expressed in RU (y-axis).
[0049] FIG. 4B: Shown are the relative contents of AChE-S and -R
expressed as RU between the respective antibodies and their
epitopes in the different cell lysates, standardized to the amount
of total protein in the extract (top) or the number of lysed cells
(bottom).
[0050] FIG. 4C: Immunoblot using the phage anti-ASP1 and lysates of
the noted cell populations. AChE-S and its various cleaved products
are labeled. PC12 cells known to express AChE-S were used as a
positive control.
[0051] Abbreviations: T., time; prot., protein; ce., cells.
[0052] FIG. 5A-5B: Development- and stress-associated expression of
AChE variants within blood cell populations.
[0053] Positive cell fractions were quantified by flow cytometry
and divided into cells with the corresponding variants in the
cytosol and on the surface of the noted cell populations. Columns
present the percent of positive cells in 15 samples from each
source (mean.+-.standard error of the mean). Nonspecific signals
were subtracted. Solid and crosshatched bars represent cytoplasmic
and surface expressions, respectively.
[0054] FIG. 5A: AChE-S
[0055] FIG. 5B: AChE-R
[0056] Abbreviations: R, red blood cells; G, granulocytes; M,
monocytes; L, lymphocytes; Pos., positive; ce., cells; tot., total;
c., cytoplasmic; s., surface; C.B., cord blood; Ad. B., adult
blood; PPB; post-partum blood.
[0057] FIG. 6A-6B: Surface AChE-R on lymphocyte subpopulations.
[0058] FIG. 6A: Surface AChE-R was detected in T and B lymphocyte
sub-populations on all three sources analyzed. Shown are cells from
adult peripheral blood. Upper panel is surface AChE-R expression on
T cells and lower expression on CD19+CD45+ B lymphocyte. Background
staining (dashed curve) and surface AChE-R staining (bold curve).
Insert: B cells were defined by their high expression of the pan-B
marker CD19 (y-axis) and CD45 (x-axis). T cells were labeled with
the pan-T marker CD3 together with CD45.
[0059] FIG. 6B: Surface AChE-R contents on lymphocyte
sub-populations. An average of ten samples from each source of
cells were used. Shown are mean percent values of cells expressing
surface AChE-R, and the mean fluorescent intensity
(MFI).+-.standard error of the mean. Significant differences values
(t-test, p<0.05) are marked by an asterisk.
[0060] Abbreviations: C, cord blood; A, adult peripheral blood; P,
post-delivery peripheral blood.
[0061] Abbreviations: Ce. co., cell count; fluor. U.; fluorescence
units; pos., positive.
[0062] FIG. 7A-7E: Spatiotemporal shifts in embryonic AChE mRNAs
within blood cell forming tissues.
[0063] FIG. 7A: Schematic of the human ACHE gene and its
alternative mRNAs. The core of human AChE is encoded by three
exons, and parts of additional regions encode the variant-specific
C-terminal sequences. Transcription begins at E1, and E2 encodes a
leader sequence that does not appear in any mature protein. In
addition to a proximal promoter (red line adjacent to E1), a distal
enhancer region (the other red line) is rich in potential
regulatory sequences, some of which are shown as wedges.
[0064] FIG. 7B: Sagital section of a human embryo showing the
hematopoietic organs--AGM (aorta-gonad-mesonephros, blue), LIV
(liver; green), SPL (spleen; red), and BM (bone marrow; brown).
[0065] FIG. 7C: Scheme of gestational shifts in hematopoietic
processes shows the relative levels of blood cell formation in the
various hematopoietic organs throughout human gestation [Tavassoli,
M. (1991) Blood Cells 17:269-281]. Ages for which in situ
hybridization was performed are marked by gray columns.
[0066] FIG. 7D: Representative in situ hybridization in liver
micrographs from human fetuses at the noted gestational ages.
Selective probes for each of the alternative human AChE mRNA
transcripts showed increased expression (red precipitate) of AChE-R
mRNA at 16 weeks of gestation, at the same time when the liver
changes from erythropoiesis to myelopoiesis.
[0067] FIG. 7E: Line colors representing (as in 7C) spatiotemporal
changes in labeling intensity and standard error of the mean (SEM)
for each probe and organ, expressed as percentage of red pixels in
each slide [Grisaru (1999a) id ibid.]. Note that AChE mRNA
expression increases parallel to active hematopoiesis in the
examined organs (N=4-6 tests for each organ in each gestational
age). mRNA peaks in the liver at 16 weeks, coinciding with a shift
in fetal liver hematopoiesis, from erythropoiesis to myelopoiesis
[Porcellini, A. et al. (1983) Int. J. Cell Cloning, 1: 92-104].
[0068] Abbreviations: G. a., gestational age; wk., weeks; r.p., red
pixels.
[0069] FIG. 8A-8G: Parturition-induced transient increases in
cortisol and sustained increases in catalytically active plasma
AChE- and AChE-R-positive granulocytes.
[0070] FIG. 8A: Serum cortisol levels were higher than normal in
the pre- and intra-partum periods. Note the significant decrease
post-partum.
[0071] FIG. 8B: Plasma catalytic activity of AChE shows stable
increase during the entire peri-partum period.
[0072] FIG. 8C: Alternative splicing of the ACHE gene.
[0073] FIG. 8D: Cortisol levels in patients during parturition
(N=20) were significantly higher than in controls (Cont N=48),
reflecting the stress of parturition.
[0074] FIG. 8E: Cortisol levels show direct correlation to
increases in white blood cells (WBC) during parturition.
[0075] FIG. 8F: Increase in serum cortisol.
[0076] FIG. 8G: Intra-partum AChE-R-positive granulocytes (Gran)
increases as a function of the increase in serum cortisol.
[0077] Asterisks indicate statistical significance.
[0078] Abbreviations: cort., cortisol; act., activity; ce.,
cells.
[0079] FIG. 9A-9D: Peri-partum blood profile.
[0080] Shown are blood profile changes in patients before (PRE),
during (INTRA) and following (POST) delivery. Dotted areas
represent normal blood count ranges.
[0081] FIG. 9A: WBC counts increase during labor (above normal
range) and decrease post-partum, albeit remaining above normal.
Hemoglobin levels (Hgb) decrease below normal range during and
after delivery. Platelet (Plat) counts remain stable (at normal
range) during the entire period.
[0082] FIG. 9B: Sustained leukocytosis correlates with elevation in
granulocyte (Gran), but not monocyte (Mono) or lymphocyte (Lymph)
counts which remained within normal range. Asterisks indicate
statistically significant differences (N=16 patients).
[0083] FIG. 9C: Shown are CD15 and CD33 labeling on AChE-R positive
granulocytes (upper panel) and CD14 and CD33 in monocytes (lower
panel). Note decreases in CD15 expression in intra-partum
granulocytes and decreases in post-partum monocytes.
[0084] FIG. 9D: The significant intra- and post-partum increase in
AChE-R positive granulocytes, but not monocytes or lymphocytes, may
explain the stable serum activity. Immunoblots (insert) of serum
proteins from 3 patients demonstrate AChE-R presence. Luminiscence
analysis of the AChE-R blot (upper insert) shows stable presence of
AChE-R in the serum of women during the peri-partum period.
[0085] Abbreviations: Tot., total; MFI, Mean Fluorescence
Intensity; Gran., granulocytes; momo., monocytes; exp., expression;
ce., cells.
[0086] FIG. 10: Stress induced AChE-R in white blood cells
correlates with presence of active AChE-R in the plasma.
[0087] The figure shows a direct correlation between AChE-R
expression in all types of white blood cells (granulocytes,
monocytes and lymphocytes) and its activity in the plasma of
post-partum mothers.
[0088] FIG. 11A-11E: ARP.sub.26 operates as an inducer of ACHE gene
expression and potentiates myeloid expansion in vivo.
[0089] FIG. 11A: Structure of the AChE-R isoform with the stress
induced cleavage (arrow) of the C-terminus (ARP).
[0090] FIG. 11B: Human cord blood CD34.sup.+ cells treated for 24
hours with the noted doses of ARP.sub.26 as the sole growth factor
were subjected to in situ hybridization with probes selective for
each of the noted AChE mRNA splice variants. Shown are
representative micrographs of the cells. Lower panels: Cytochemical
staining for AChE catalytic activity in the presence of 10.sup.-5 M
iso-OMPA, a selective inhibitor of butyrylcholinesterase (center)
and nuclear staining with DAPI (bottom). Note intensified brown
precipitates of AChE reaction product, mainly under 2 nM of
ARP.sub.26.
[0091] FIG. 11C: Average labeling densities for 10-20 individual
cells. Note the concomitant increases in all transcripts, peaking
at 2 nM ARP, and the limited variance between cells.
[0092] FIG. 11D-11E: Flow cytometric analysis of CD34+-derived
hematopoietic cells after 2 weeks in liquid culture. Incubation
with ARP.sub.26, but not with cortisol, ASP.sub.40 or PBAN,
increased the total number of cells. FIG. 11D: The expansion index
(the number of viable cells/ml culture divided by the number of
seeded cells) was considerably higher following incubation with
ARP.sub.26. FIG. 11E: The percentage of immature stem cells (left
column), committed myeloid cells (middle column) and mature myeloid
cells (right column) that developed in the presence of each
supplement is indicated by numbers on the relevant dot plots.
Unlabeled cells appear as black dots and double-labeled ones as
green dots. Note similar patterns under the influence of cortisol
and ARP.sub.26, but not of the ASP.sub.40 and PBAN negative control
peptides.
[0093] Abbreviations: pix., pixels; c.e.i., cell expansion index;
treat., treatment; I.S.C., immature stem cells; com. My., committed
myeloid; mat. my., mature myeloid; fluoresce., fluorescence; u.,
units; cont., control; iso., isotype; cort., cortisol.
[0094] FIG. 12A-12C: ARP induces cytokine elevation in WBC.
[0095] FIG. 12A: Plasma cytokine levels in intra-partum patients
and matched controls, measured by a particle-based flow cytometry
immunoassay (human inflammation cytometric bead array kit, BD
Bioscience, Palo Alto, Calif.). Note elevation of IL-12, IL-6, and
IL-1.beta. under post-partum conditions (N=15 in each group).
[0096] FIG. 12B: The proposed concept involves stress-induced
elevation of plasma cortisol, which promotes AChE-R overproduction
in peripheral mononuclear cells. C-terminal cleavage of AChE-R
yields ARP, which amplifies AChE-R overproduction independently of
cortisol. Accumulation of AChE-R potentiates ACh hydrolysis,
alleviating the nicotinic .alpha.7 AChE control over
pro-inflammatory cytokine production and resulting in elevated
TNF.alpha. and IL-6 (fluorescence intensity). Inset: Fluorescence
profiles of IL-6 and TNF.alpha.-positive cells from ARP-treated
(top) and control culture (bottom).
[0097] FIG. 12C: To test causal relationship between elevated
AChE-R and cytokine plasma levels adult peripheral mononuclear
cells (N=3) were incubated for 24 hours with or without 2 nM
ARP.sub.26. Note significant increases in IL-6, IL-10 and
TNF.alpha. levels, but not the anti-inflammatory cytokine IL-12,
following ARP.sub.26 treatment. Asterisks denote statistically
significant differences compared to control.
[0098] Abbreviations: Fluor., fluorescence.
[0099] FIG. 13A-13B: Expression pattern of transcription factors
pivotal for hematopoiesis following inflammatory stress.
[0100] FIG. 13A: Relevant hematopoiesis related transcription
factors binding sites on the ACHE promoter.
[0101] FIG. 13B: Shown are expression of transcription factors
pivotal for hematopoiesis in bone marrow extracts from FVB/N
(dashed line) and TgR mice (solid line) (n=25), at different time
points post LPS injection. Asterisks denote significant differences
and results are presented as mean+SD (p<0.02, n=10), by real
time RT-PCR. levels of transcription factors levels in While the
response pattern to LPS of LMO2, GATA1, RUNX1 and STAT5 was similar
in both FVB/N and TgR mice, PU.1 levels decreased significantly in
FVB/N but not in TGR mice bone marrow, in response to LPS. At 72 h
post LPS injection, PU.1 levels recovered and even reached higher
than base-line values in FVB/N mice, but showed some decrease in
TgR mice.
[0102] Abbreviations: No., none; Fo. Dif., fold difference.
[0103] FIG. 14A-14B: Rapid post-LPS hematopoietic recovery in TgR
mice.
[0104] FIG. 14A: Immunophenotyping of the hematopoietic progenitors
and the relevant transcription factors during the
differentiation.
[0105] FIG. 14B: Shown are WBC counts in FVB/N (dashed line) and
TgR mice (solid line) (n=25). Results of morphological examination
of TgR and FVB/N mice peripheral blood smears, at different time
points post LPS injection. Asterisks denote significant differences
and results are presented as mean+SD (p<0.02, n=10).
[0106] Peripheral blood immunophenotyping revealed that while FVB/N
mice had a significant decrease in GR1+ (granulocyte) cells, in
response to LPS injection, the number of GR1+ remained unchanged in
TgR mice and was significantly higher than FVB/N by 72 h post LPS
injection. Both FVB/N and TgR mice had decreased CD11b+ (monocytic)
cell counts 24 h post LPS injection, although the decrease was
steeper in TgR as compared to FVB/N mice. CD11b+ cell counts
recovered almost completely by 72 h post LPS injection in both
FVB/N and TgR mice, TgR mice attaining higher Cd11b+ counts,
although not reaching a statistically significant value.
[0107] Asterisks denote significant differences and results are
presented as mean+SD.
[0108] Abbreviations: pos. ce., positive cells; no., none.
[0109] FIG. 15A-15C: Transgene facilitation of hematopoietic
regulators.
[0110] FIG. 15A: Schematic of the proposed mechanism, which shows
how a stress-induced switch from production of AChE-S to the -R
variant results in hematopoietic progenitor cell expansion towards
the megakaryocyte lineage and increased platelet counts.
[0111] FIG. 15B: Human (h) AChE-R DNA construct inserted into the
FVB/N mouse genome for generating the TgR transgenic mice. hAChE-R
cDNA-derived 100 base pair product was successfully amplified in
bone marrow DNA of TgR (5.sup.th and 6.sup.th lanes, after the
marker--M), but not TgS or FVB/N mice (n=12, left arrow). A mouse
actin product (130 base pair, right arrow) appeared in all 3 tested
lines, FVB/N, TgR and TgS.
[0112] FIG. 15C: Levels of the pro-inflammatory cytokine IL-6
(pg/ml) and the AChE catalytic activity (activity per minute per
gram of protein) in PB of TgR and FVB/N mice. Asterisks denote
significant differences and results are presented as mean.+-.SD
(p<0.01, n=10).
[0113] Abbreviations: h., human; m. act., mouse actin; PB,
peripheral blood.
[0114] FIG. 16A-16D: Shorter post-LPS hematopoietic recovery in TgR
mice.
[0115] Graphs show RBC.times.10.sup.9 (FIG. 16A),
WBC.times.10.sup.6 (FIG. 16B) and platelet (Plts.times.10.sup.6)
(FIG. 16C) counts per ml of FVB/N (dashed line) and TgR mice (solid
line) (n=25) peripheral blood.
[0116] FIG. 16D: Results of morphological examination of TgR and
FVB/N mice peripheral blood smears, at different time points post
LPS injection as indicated. Asterisks denote significant
differences and results are presented as mean.+-.SD of
WBC.times.10.sup.6 per ml of blood (p<0.02, n=10).
[0117] Abbreviations: T. po., time post; gran., granulocytes;
mono., monocytes; lymph., lymphocytes.
[0118] FIG. 17A-17B: Changes in TPO levels in response to LPS
injection.
[0119] Thrombopoietin (TPO) levels were measured in bone marrow
(BM) cell lysates (FIG. 17A) and plasma (FIG. 17B) from TgR and
FVB/N mice. Asterisks denote significantly different values.
Results are presented as mean.+-.SD (p<0.04, n=10).
[0120] Abbreviations: po., post; ce. ly., cell lysates; plas.,
plasma.
[0121] FIG. 18A-18C: Facilitated progenitor cells potential in TgR
mice. Committed colony-forming units of megakaryocyte (CFU-Mk, FIG.
18A), granulocytic/monocytic (CFU-GM, FIG. 18B) and multi-potential
(CFU-GEMM, FIG. 18C) progenitors were quantified in a semisolid
colony formation assay. Asterisks denote significantly different
values. Assays were set up in triplicates from bone marrow
preparations from 4 separate mice per time point. Values represent
mean.+-.SD.
[0122] Abbreviations: T. po., time post.
[0123] FIG. 19A-19F: AChE-R, RACK1 and PKC.epsilon. expression in
megakaryocytes.
[0124] Bone marrow smears were stained with May-Grunwald (FIG. 19A)
and specific antibodies to detect AChE-R (FIG. 19B), RACK1 (FIG.
19C) and PKC.epsilon. (FIG. 19D). The .alpha. symbol represents
"anti", meaning the antibody against that specific protein was used
in the respective staining.
[0125] FIG. 19E: Illustration of the putative interaction between
the three proteins.
[0126] FIG. 19F: Population distributions of Mk labeling
intensities for AChE-R, RACK1 and PKC.epsilon.. White bars
represent FVB/N and grey, TgR mice BM labeling intensities. Note
the shift to the right, indicating increased levels of these 3
proteins in Mks from TgR as compared with FVB/N mice. n=50 cells
per labeling experiment.
[0127] Abbreviations: Hist., histochemistry; ce., cells.
[0128] FIG. 20A-20B: Enhanced human cell engraftment with
ARP.sub.26. 100,000 human CB CD34.sup.+ cells were injected into
the tail vein of pre-irradiated NOD/SCID mice with no priming of
cells (none, white diamond symbol), or following priming of cells
with ARP.sub.26 for 2-4 hours and injection with human ARP.sub.26
(black square symbol) or ASP.sub.40 (gray triangle symbol). Bone
marrow was harvested 6 weeks post-transplantation.
[0129] FIG. 20A: CD34.sup.+, CD45.sup.+ and CD41.sup.+ human cells
were detected using flow cytometry and monoclonal antibodies, n=12,
16 and 8 mice, respectively.
[0130] FIG. 20B: Quantitative real time PCR using human TNF.alpha.
as the probe to detect human DNA in the mouse bone marrow.
Sensitivity limit was 10%. n=12, 16 and 8 mice respectively.
Asterisks denote significant differences. Lines represent mean
values.
[0131] FIG. 21A-21B: Pre-cultured CD34.sup.+ cells expanded with
ARP.sub.26 and improve platelet counts.
[0132] FIG. 21A: 100,000 human CD34+ cells were injected together
with 1-200,000 CD34+ cells cultured for 10 days with no supplement
(control), 2 nM ARP.sub.26, 2 nM ASP.sub.40 or human TPO/SCF (T/S).
Antibodies to human CD45.sup.+, CD34.sup.+ and CD41.sup.+ were used
to quantify engraftment in BM (n=6).
[0133] FIG. 21B: Human platelets per mL of mouse blood were
quantified using anti CD41, specific for human platelets. The mean
differences between groups were large (denoted by lines). n=6.
[0134] Abbreviations: ctrl., control; T/S, TPO/SCF; po., post; wk.,
weeks; BM, bone marrow; PB, peripheral blood.
DETAILED DESCRIPTION OF THE INVENTION
[0135] The inventors originally described the ARP peptide as a
peptide capable of inducing stem cell survival and expansion. In
addition, ARP was shown to be capable of promoting myeloid and
megakaryocytic differentiation [IL 130224, Inventors' co-pending US
Patent Application 2003-0036632, Grisaru (2001) id ibid.].
[0136] In the present invention, the inventors demonstrate that
overproduction and C-terminal cleavage of the stress-induced AChE-R
isoform induced granulocytosis.
[0137] Effective growth and expansion of any defined hematopoietic
cell population involve three milestones: the first, survival of
stem cells, the second, proliferation of lineage-committed
progenitor cells, and the third, expansion and maturation of
terminally differentiated cells. The expansion of
terminally-differentiated functionally-specific progeny requires
sufficient progenitor proliferation prior to maturation, which
depends on the size of the stem cell pool. There are growth factors
or cytokines that function exclusively on each one of the levels
mentioned above. For example, the stem cell factor (SCF) protects
stem cells from apoptosis and supports their survival. Alone SCF
does not cause the proliferation of stem or progenitor cells. Most
of the clinically used hematopoietic cytokines drive proliferation
of lineage committed progenitors such as G-CSF, GM-CSF,
erythropoietin and thrombopoietin, and work in synergy with SCF, in
vitro. The ideal growth factor would be a molecule capable of
maintaining the survival of stem cells and with activity for the
stimulation of committed progenitor proliferation of at least one
or more lineage, while also being capable of deriving terminal
differentiation. The results described in the present invention
define ARP as such a growth and differentiation factor, being able
to support survival of hematopoietic stem cells, as previously
described [IL 130224, Inventors' co-pending US Patent Application
2003-0036632, Grisaru (2001) id ibid.], while driving proliferation
of myeloid cells and inducing their terminal differentiation,
specifically of the granulocytic lineage, and particularly
neutrophils.
[0138] Thus, it is an object of the present invention to provide
the use of an AChE-R-derived peptide as an inducer of
granulocytopoiesis. Yet another object of the invention is to
provide methods and compositions for the prevention and/or
treatment of conditions leading to low white blood cell count in
general, and particularly leucopenia, and more particularly
neutropenia. In addition, such treatments may increase cytokine
production in patients who have lost the capacity to induce the
same in response to external stimuli. These include, for example,
aged patients in whom cytokine levels cannot be induced anymore
because their cholinergic control over such cell population is
desensitized. These and other objects of the present invention will
become apparent as the description proceeds.
[0139] The peptide used by the invention comprises the following
amino acid sequence:
TABLE-US-00002 (SEQ ID NO: 1) N'-GMQGPAGSGWEEGSGSPPGVTPLFSP-C'.
[0140] Said peptide is also denoted herein as ARP, or
ARP.sub.26.
[0141] The peptide of the invention may be isolated as a cleavage
product of AChE-R. Alternatively, the peptide is a synthetic
peptide, synthesized through the means of producing synthetic
peptides known in the art.
[0142] Any functional derivatives and functional fragments of the
above-defined peptide may be used in the invention. The terms
functional derivatives and functional fragments used herein mean
the peptide, or any fragment thereof, with any insertions,
deletions, substitutions and modifications, which is capable of
inducing granulocyte cell differentiation and/or cytokine
production, particularly TPO and pro-inflammatory cytokines like
TNF.alpha., IL-6 and IL-1.beta..
[0143] Further, the peptide of the invention may be extended at the
N-terminus and/or C-terminus with various identical or different
amino acid residues. As an example for such extension, the peptide
may be extended at the N-terminus and/or C-terminus thereof with
identical or different amino acid residue/s which may be naturally
occurring or synthetic amino acid residue/s. One example for a
synthetic amino acid residue is D-alanine. An additional example
for such an extension may be provided by peptides extended both at
the N-terminus and/or C-terminus with a cysteine residue.
[0144] Another example may be the incorporation of an N-terminal
lysyl-palmitoyl tail, the lysine serving as linker and the palmitic
acid as a hydrophobic anchor.
[0145] In addition, the peptide may be extended by aromatic amino
acid residue/s, which may be naturally occurring or synthetic amino
acid residue/s. A preferred aromatic amino acid residue may be
tryptophan. Alternatively, the peptide can be extended at the
N-terminus and/or C-terminus thereof with amino acids present in
corresponding positions of the amino acid sequence of the naturally
occurring C-terminal region of AChE-R.
[0146] Nonetheless, according to the invention, the peptide to be
used in the invention may be extended at the N-terminus and/or
C-terminus thereof with various identical or different organic
moieties which are not naturally occurring or synthetic amino
acids. As an example for such extension, the peptide may be
extended at the N-terminus and/or C-terminus thereof with an
N-acetyl group.
[0147] The lack of structure of linear peptides renders them
vulnerable to proteases in human serum and acts to reduce their
affinity for target sites, because only few of the possible
conformations may be active. Therefore, it is desirable to optimize
the peptide structure, for example by creating different
derivatives of the peptide of the invention. In order to improve
peptide structure, the peptide of the invention can be coupled
through its N-terminus to a lauryl-cysteine (LC) residue and/or
through its C-terminus to a cysteine (C) residue.
[0148] The peptide of the invention, as well as derivatives thereof
may be positively charged, negatively charged or neutral and may be
in the form of a dimer, a multimer or in a constrained
conformation. A constrained conformation can be attained by
internal bridges, short-range cyclizations, extension or other
chemical modification.
[0149] The inventors have demonstrated, in the following Examples,
how peripheral cholinergic stress responses, in particular
overproduction and C-terminal cleavage of the stress-induced AChE-R
variant, resulted in long-lasting granulocytosis, likely
independent of elevated cortisol levels.
[0150] The presence of a functional glucocorticoid response element
in the upstream ACHE promoter [Grisaru et al. (2001) id ibid.],
combined with the transient post-partum increase in serum cortisol
[Mastorakos, G. and Ilias, I. (2000) Ann. NY Acad. Sci. 900:
95-106] could explain the initial transcriptional enhancement of
ACHE gene expression in hematopoietic cells. However, the transient
nature of cortisol elevation also implies that a different
transcriptional enhancing signal(s) should extend this response
after the first few hours. That ARP.sub.26 by itself elevated ACHE
gene expression in CD34+ progenitors provided a tentative
explanation for this prolonged induction, suggesting that the
overproduced cleavable AChE-R can regulate its own production.
These results suggest that ARP may be used, in vivo and in vitro,
for the induction of AChE-R expression, or for re-adjusting the
ratio between AChE-S and AChE-R.
[0151] The dose-dependent pattern of this effect further indicates
that either too high or too low concentrations of ARP.sub.26 fail
to induce AChE-R mRNA accumulation, suggesting strict dependence of
the splice shift process on previously produced AChE-R amounts
which, in turn, reflects splicing regulation of the pre-AChE mRNA
transcript in hematopoietic cells. ASP.sub.40, the C-terminal
peptide of AChE-S (denoted by SEQ ID NO:2), failed to induce such
effects (FIG. 11D-11E), supporting the specificity of the effect of
ARP on prolonged granulocytosis. Vis-a-vis the results obtained in
Example 12, ARP may be used to treat hematopoietic stem cells ex
vivo, driving the cells to the granulocytic differentiation
pathway.
[0152] In addition, the present findings demonstrate increased
thrombopoiesis in response to the stress-induced AChE-R protein and
attribute part of the thrombopoietic process to ARP, and to its
interaction with the scaffold protein RACK1 and PKC.epsilon.. This
has allowed the inventors to extend the concept of what has been
defined by others as "The inflammatory reflex" [Tracey (2002) id
ibid.] to the realm of thrombopoiesis.
[0153] The effects exerted by AChE-R on the proliferation and
maturation of granulocytes could be due to both the catalytic and
the non-catalytic properties of AChE-R as well as to the
function(s) of its cleavable C-terminal peptide, ARP. The stable
AChE hydrolytic activity throughout the peri-partum period,
together with the increased AChE-R content in granulocytes point to
the possibility that granulocytes may be the source of soluble
blood AChE. This idea is reinforced by the presence of AChE-R in
the serum of peri-partum women (FIG. 9A-9B). At the catalytic
level, AChE-R excess should lead to reduced ACh concentrations in
the post-partum serum. This, in turn, would alleviate the control
over macrophage production of pro-inflammatory cytokines,
increasing the concentration of such cytokines and inducing further
proliferative and cell activation signals [Borovikova, L. V. et al.
(2000) Nature 405: 458-462; Tracey, K. J. (2002) Nature 420:
853-859; Wang, H. et al. (2003) Nature 421: 384-388]. The existence
of nicotinic [Wang (2003) id ibid.] and muscarinic
[Hellstrom-Lindahl, E., and Nordberg, A. (1996) J. Neuroimmunol.
68:139-144; Mita, Y. et al. (1996) Eur. J. Pharmacol. 297:
121-127]. ACh receptors on myeloid cells suggests reduced
cholinergic input to those cells as well, when under stress. Others
report no direct cholinergic effects on peripheral blood cells
[Tracey (2002) id ibid.]. However, the current study shows such
effects for ARP.sub.26, thus adding AChE-R production following
transient increases in cortisol, and the reduced anti-inflammatory
action of ACh, as additional steps to the pathway leading to
protracted post-stress granulocytosis.
[0154] At the non-catalytic level, the present findings suggest the
induction of signal transduction processes by the C-terminal
peptide cleaved from AChE-R, likely through its interaction with
PKC.beta.II and its scaffold protein RACK1 [Inventors' co-pending
US Patent Application 2003-0036632]. The reported involvement of
PKC signaling in myeloid cell activation [Bassini, A. et al. (1999)
Blood 93: 1178-1188] potentially implicates this interaction in the
maturation and/or activation of granulocytes in the post-partum
blood.
[0155] Interestingly, the inventors have shown that, during human
fetal development, AChE-R mRNA expression was observed only in the
developing liver for a limited time window (FIG. 7). The transient
increase in AChE-R mRNA paralleled the period of fetal liver
myelopoiesis, supporting the notion that AChE-R is physiologically
relevant for in vivo myelopoiesis.
[0156] The induced AChE-R excess (Example 7) might be perceived as
an adaptive response, facilitating the production of
pro-inflammatory cytokines to protect the body from post-partum
conditions, such as infections. This assumption is further
supported by the increased production of pro-inflammatory cytokines
by mononuclear cells in the presence of the synthetic peptide
ARP.sub.26. The question emerges, therefore, which signal(s)
terminates this granulocytosis response. Because of the circular
nature of the proposed cascade process, it might be terminated
either at the periphery or in the brain, highlighting the close
inter-relationships characteristic of long-lasting mammalian stress
responses [Kiecolt-Glaser, J. K. et al. (2003) Proc. Natl. Acad.
Sci. USA 100: 9090-9095]. It is tempting to speculate that,
similarly to what happens within the central nervous system,
chronically elevated AChE induces a secondary feedback response of
excess ACh production in the periphery [Erb, C. et al. (2001) J.
Neurochem. 77: 638-646]. Re-balanced ACh levels can then suppress
the production of pro-inflammatory cytokines in macrophages [Tracey
(2002) id ibid.], terminating the granulocytosis process.
IL-1.beta. was shown to induce ACHE gene expression in
phaeochromocytoma cells [Li, Y. et al. (2000) J. Neurosci. 20:
149-155], suggesting that reduced IL-1.beta. levels could
reciprocally decrease AChE-R (and, therefore, its cleavage product)
levels back to normal, retrieving peripheral cholinergic
homeostasis.
[0157] Thus, essentially, the ARP peptide may be used as an inducer
of pro-inflammatory cytokines, particularly TNF.alpha., IL-6 and
IL-1.beta..
[0158] The development of transgenic mice overexpressing AChE-R
allowed the inventors to further comprehend the cholinergic effect
on the inflammatory response. The presence of AChE-R at high levels
apparently does not affect the basal status of the hematopoietic
system. However it serves as an enhancer to rapid recovery of the
system following an inflammatory challenge.
[0159] At least two mechanisms, not necessarily mutually exclusive,
could be implicated in that. One through the induction of
pro-inflammatory cytokines, as mentioned above. Two through the
induction of the putative oncogene Spi-1 (PU.1) protein product, a
hematopoietic-specific Ets factor essential for myeloid and
lymphocyte development, which has also been implicated in
LPS-induced signaling [Busslinger, M. (2004) Ann. Rev. Immunol. 22:
55-79]. As shown in Example 16 below (and FIG. 13A-13B), PU.1 was
over-expressed in bone marrow of TgR, as compared to strain matched
FVB/N mice, and probably explains why, when exposed to mild
inflammatory stress, TgR mice WBC counts recovered faster than
FVB/N's, which was attributed to steady levels of granulocytes that
were altered by the insult, as well as to an exceptional recovery
of monocytes in TgR peripheral blood, likely due to the high PU.1
levels that directed hematopoietic progenitors towards the myeloid
lineage. Moreover, AChE-R-induced PU.1 over-expression may also
provide a potential mechanism for the prolonged
parturition-associated leukocytosis.
[0160] Therefore, at the molecular level, ARP, functional fragments
or derivatives thereof of compositions comprising the same, may be
used for inducing the expression of PU.1. At a physiological level,
ARP may be used for boosting the hematopoietic system post-partum.
In events of post-partum hemorrhage, for example, where the
mother's body loses immense amounts of blood, while still needing
to function properly in order to care for the newborn baby, ARP may
be used for hematopoietic recovery.
[0161] In addition, the present findings point at a previously
unperceived option for ex vivo augmentation of post-transplantation
thrombopoiesis.
[0162] TPO levels are tightly controlled under normal conditions,
and increase only when megakaryocyte and platelet production is
needed. The current study found a significant increase in TPO
levels as well as higher platelet counts in TgR mice
over-expressing the stress-induced AChE-R splice variant, as
compared to the strain matched FVB/N mice. LPS administration
induced a rapid fall in platelet counts in both TgR and FVB/N
control mice, however, platelet recovery was considerably faster in
TgR mice than in strain-matched controls. Moreover, TgR mice showed
faster WBC recovery than controls following LPS-induced
inflammation and maintained normal RBC values while control FVB/N
mice became pancytopenic for at least 72 hrs post-LPS injection.
These differences may be attributed to the augmented capacity of
TgR BM progenitors to proliferate and differentiate into
pluripotent CFU-GEMM, CFU-GM, and CFU-Mk. Although the inventors'
previous reports had indicated the connection between ARP and the
megakaryocytic lineage [IL 130224, Inventors' co-pending US Patent
Application 2003-0036632, Grisaru (2001) id ibid.], it was not
predictable that this connection could also be attributed to the
capacity of ARP to enhance TPO circulating levels, as demonstrated
in the present invention.
[0163] In principle, the AChE-R effect is double bladed. First, it
can reduce ACh levels, that way maintaining the production of
pro-inflammatory cytokines with growth factor capacities in
response to inflammatory signals. Second, it interacts
intracellularly with partner proteins, inducing signal transduction
pathways and promoting cell proliferation, likely through the
AChE-R partner protein RACK1 binding to PKC .epsilon. [Perry (2004)
id ibid.]. PKC .epsilon. was shown to induce megakaryocytic
differentiation in HEL and K562 cells [Racke (2001) id ibid.] and
in primary human hematopoietic stem cells [Oshevski S. et al.
(1999) Biochem. Biophys. Res. Commun. 263:603-609; Marchisio M. et
al. (1999) Anat. Rec. 255:7-14]. Moreover, TPO increases PKC
.epsilon. expression in mouse megakaryocytes [Rojnuckarin P. et al.
(2001) J. Biol. Chem. 276:41014-41022], whereas blocking PKC
activation inhibits platelet formation [Rojnuckarin P. et al.
(2001) Blood 97:154-161].
[0164] Thus, the elevated levels of AChE-R and PKC .epsilon. in
megakaryocytes from TgR mice as well as the higher plasma TPO
levels in these mice supports the notion of a cholinergic promotion
of thrombopoietic signal transduction both through the hydrolytic
and the non-enzymatic features of AChE-R, involving two signaling
pathways, which may engage PKC.epsilon. as well.
[0165] The present findings give support to ARP as an inducer of
TPO. The inventors had previously described how ARP was able to
induce CD34+ cell expansion in combination with various growth
factors, particularly GM-CSF and TPO [Deutsch et al. (2002) id
ibid.]. However, it was nor clear at the time that ARP by itself
could induce the expression of TPO, and increase the levels of
circulating TPO. In addition, the present invention shows the
effect of ARP on peripheral blood mononuclear cells from adults,
besides its influence on CD34+ populations.
[0166] Lack of proliferating megakaryocytic progenitors in BM
grafts, allo-immunization and refractoriness to platelet
transfusions impede recovery of patients with severe
thrombocytopenia post bone marrow transplantation. Unfortunately,
TPO, the physiological regulator of thrombopoiesis has not been
clinically effective due to the paucity of megakaryocyte
progenitors in the grafts [Kanamaru (2000) id ibid.]. MGDF, the
pegylated form of TPO, was retracted due to immunogenicity in
healthy donors who developed anti-TPO antibodies and became
severely thrombocytopenic [Basser R. L. et al. (2002) Blood
99:2599-2602].
[0167] Thus, it is very desirable to find a drug that may more
effectively supply TPO for these patients. Hence, administration of
a therapeutically effective amount of ARP, its functional fragments
or derivatives, or compositions comprising thereof, may be one way
of inducing TPO production and consequently increasing the number
of megakaryocytic progenitors and platelets.
[0168] As mentioned throughout the present specification, said
therapeutic effective amount, or dosage, is dependent on severity
and responsiveness of the disease state to be treated, with the
course of treatment lasting from several days to several months, or
until a cure is effected or a diminution of the disease state is
achieved. The therapeutic effective dosage may be determined by
various methods, including generating an empirical dose-response
curve, predicting potency and efficacy of a congener by using
quantitative structure activity relationships (QSAR) methods or
molecular modeling, and other methods used in the pharmaceutical
sciences. Optimal dosing schedules may also be calculated from
measurements of drug accumulation in the body of the patient.
Persons of ordinary skill can easily determine optimum dosages,
dosing methodologies and repetition rates. In general, the dosage
may be given once or more daily, weekly, or monthly. Persons of
ordinary skill in the art can easily estimate repetition rates for
dosing based on the patient's response to the active agent.
[0169] Increasing the numbers of megakaryocyte precursors in a
graft of hematopoietic precursor cells should shorten the extended
period of severe thrombocytopenia, promoting successful engraftment
of long term repopulation of stem cells, the appropriate targets
for endogenous or exogenous TPO.
[0170] In a further aspect, the present invention provides the use
of an AChE-derived peptide or its functional fragments or
derivatives, in the preparation of a pharmaceutical composition for
any one of the treatment and/or prevention of conditions that
trigger low granulocyte count, such as leucopenia, and particularly
neutropenia, and in pre-transplant priming of hematopoietic stem
cells, wherein said peptide is denoted by SEQ ID NO:1.
[0171] The preparation of pharmaceutical compositions is well known
in the art and has been described in many articles and textbooks,
see e.g., Gennaro A. R. ed. (1990) Remington's Pharmaceutical
Sciences, Mack Publishing Company, Easton, Pa., and especially
pages 1521-1712 therein. Essentially the preparation of
compositions involves admixing the ARP peptide with
pharmaceutically acceptable carriers, diluents or excipients, and
further optionally with desirable additives.
[0172] Blood cell inflammatory and immune processes involve a
finely tuned balance between myeloid cell activation, proliferation
and differentiation. Reduced AChE-R densities on the cell surface
of B lymphocytes under stress should further increase the chances
of ACh to activate these cells by interacting with their ACh
receptors [Wang (2003) id ibid.]. The development and
stress-induced changes in ACHE gene expression of myeloid cells are
hence likely to facilitate the hematopoietic responses to external
stimuli.
[0173] In an even further aspect, the present invention provides a
method of treatment of conditions that induce leucopenia,
comprising the steps of administering a therapeutically-effective
amount of an AChE-derived peptide or a composition thereof to a
subject in need, wherein said AChE-derived peptide is denoted by
SEQ ID NO:1. Leucopenia includes any condition in which the number
of white blood cells is reduced. One particular condition is
neutropenia.
[0174] As mentioned herein, administration of the peptide of the
invention, its functional fragments or derivatives, or compositions
comprising thereof, is preferably via intravenous. Administration
directly into the bone marrow cavity may also be advisable, in
order to maximize the contact between ARP and hematopoietic
progenitors. Intraperitoneal and intradermal administrations may
also be comtemplated.
[0175] Thus, the invention also refers to an in vivo method for the
prevention and/or treatment of conditions wherein lymphocyte
activity is reduced, such as chronic stress, autoimmune diseases,
inflammation, rheumatoid arthritis, multiple sclerosis (MS),
amyotrophic lateral sclerosis (ALS), fibromyalgia, multiple
chemical sensitivity, post-irradiation, chemotherapy in a subject
in need, comprising administering a therapeutically-effective
amount of an AChE-derived peptide, its functional fragments or
derivatives, or compositions comprising thereof, to an individual
suffering or prone to said conditions, wherein said peptide is
denoted by SEQ ID NO:1.
[0176] Said method may also be accomplished in vitro or ex vivo,
similarly to what is described below, through admixing isolated
immature blood cells (preferably enriched for the CD34+
population), with ARP for a pre-determined amount of time, which
should be sufficient for increasing the number of committed
hematopoietic progenitor cells, and especially for cells of the
granulocytic and megakaryocytic lineages.
[0177] As used herein in the specification and in the claims
section below, the term "treat" or treating and their derivatives
includes substantially inhibiting, slowing or reversing the
progression of a condition, substantially ameliorating clinical
symptoms of a condition or substantially preventing the appearance
of clinical symptoms of a condition.
[0178] As shown in Example 5, B lymphocytes in post-delivery
mothers lose most of their surface AChE-R, but maintain high levels
of cytoplasmic AChE-R expression, an unprecedented response pattern
unique to these cells. This result suggests that the changing
pattern of AChE molecules in lymphocytes might reflect a change in
lymphocytic activity in response to variations in cholinergic
stimuli, under stress situations. Thus, the AChE peptide might be a
potent regulator of lymphocytes activity, in vivo, ex vivo and in
vitro.
[0179] In addition, the invention refers to a method for inducing a
shift in the activity of lymphocytes in vitro or ex vivo,
comprising contacting an AChE-derived peptide with lymphocytes for
a suitable period of time.
[0180] Hence also, the present invention discloses a method for
detecting changes in the activity of lymphocytes, comprising
measuring the expression of AChE-R on the surface of
lymphocytes.
[0181] As shown in Example 23, priming CB CD34.sup.+ cells with
ARP.sub.26 increased significantly the number of human CD45.sup.+
cells found in the mouse BM six weeks post transplant. Quantitative
PCR analysis confirmed larger content of the human TNF.alpha. gene
(as a marker for human-originating cells) in mice transplanted with
ARP.sub.26-primed cells. Additionally, incubating CB CD34.sup.+
cells for 10 days with 2 nM ARP.sub.26 improved the recovery from
thrombocytopenia in NOD/SCID mice. As shown previously, CD34.sup.+
cells placed in culture usually loose their ability for long-term
engraft due to differentiation and commitment manifested by the
acquisition of the CD38 marker [Guenechea (1999) id ibid.; Li K.
(1999) id ibid.]. Nevertheless, these cells produce more AChE-R
[Grisaru (2001) id ibid.] and can hence support megakaryopoiesis
when mixed with immature CD34.sup.+ providing a clear engraftment
advantage of CD45.sup.+, CD34.sup.+ and CD41.sup.+ megakaryocyte
human cells. The current study proposes a novel strategy to
facilitate thrombopoiesis, which involves exposing stem cells to
ARP, its functional fragments or derivatives, or a composition
comprising thereof, for a pre-determined period of time sufficient
for increasing the number of granulocytic and megakaryocytic
progenitors. This exposure may be in vivo, through administration
of the peptide to a subject in need, or in vitro/ex vivo. When in
vitro/ex vivo said exposure involves obtaining hematopoietic cell
precursors and admixing said precursor cells with ARP, at
concentrations in a range between 0.2 nM up to 100 nM of ARP,
preferably between 1 nM and 20 nM of ARP, for a period of between
at least 24 hours up to 15 days. Exposed cells may be recovered
after 3, 6, 8, 10 or 12 days of incubation with the ARP peptide,
its functional fragments or derivatives or compositions comprising
thereof. The exposure may be performed by culturing said cells in
the presence of ARP. Said treatment aims at improving stem cell
engraftment and shortening post-transplant thrombocytopenia.
[0182] In addition, the above treatment, or method of priming of
hematopoietic stem cells pre-transplant, is also useful for
treating a subject in need of granulocytes.
[0183] It should be noted that such a pre-transplant priming method
may be performed in cells from the subject in need of said
transplant, or in cells from another subject, preferably
immunocompatible with the host. Thus, the pre-transplant priming
may be performed in autologous transplantations or in allogeneic
transplantations. In case of allogeneic transplantations, adequate
immunocompatible matching host-donor pairs shall be evaluated by
the medical professional in care of the patient.
[0184] Lastly, the invention also provides an ex vivo method of
inducing adult blood cells to produce cytokines, comprising
obtaining said cells from a subject in need of cytokine-producing
blood cells, isolating immature cells and contacting said cells
with an AChE-derived peptide, wherein said peptide is denoted by
SEQ ID NO:1.
[0185] Thus, cells may be treated as described above, by admixing
with or culturing in the presence of ARP, its functional fragments
or compositions comprising thereof, but now with the goal of
inducing the production of cytokines. These may be, for example,
TPO, or pro-inflammatory cytokines, such as TNF.alpha., IL-6 or
IL-1.beta..
[0186] This method is particularly advantageous for patients with
neutropenia.
[0187] Neutropenia is a decrease in circulating neutrophils in the
peripheral blood. The absolute neutrophil count (ANC) defines
neutropenia. ANC is found by multiplying the percentage of bands
and neutrophils on a differential by the total white blood cell
count. An abnormal ANC is fewer than 1500 cells per mm.sup.3.
Neutropenia can be present (though it is relatively uncommon) in
normal healthy individuals, notably in blacks and Yemenite
Jews.
[0188] Causes of neutropenia from disease can be categorized as
resulting from decreased production of white blood cells,
destruction of white blood cells after they are produced, or
pooling of white blood cells (accumulation of the white blood cells
out of the circulation).
[0189] Diseases causing decreased production of white blood cells
include drug toxicity, vitamin deficiencies, and medical diseases
such as blood diseases, infections (virus diseases, tuberculosis,
typhoid), abnormalities of the bone marrow disorders, or be cyclic
(varying in severity week to week, month to month, perhaps related
to biorhythms). Several leukemias may also result in neutropenia.
Destruction of white blood cells can occur as a result of
antibodies attacking the cells (such as in Felty's syndrome) or
from drugs stimulating the immune system to attack the cells.
[0190] Disclosed and described, it is to be understood that this
invention is not limited to the particular examples, process steps,
and materials disclosed herein as such process steps and materials
may vary somewhat. It is also to be understood that the terminology
used herein is used for the purpose of describing particular
embodiments only and not intended to be limiting since the scope of
the present invention will be limited only by the appended claims
and equivalents thereof.
[0191] It must be noted that, as used in this specification and the
appended claims, the singular forms "a", "an" and "the" include
plural referents unless the content clearly dictates otherwise.
[0192] Throughout this specification and the claims which follow,
unless the context requires otherwise, the word "comprise", and
variations such as "comprises" and "comprising", will be understood
to imply the inclusion of a stated integer or step or group of
integers or steps but not the exclusion of any other integer or
step or group of integers or steps.
[0193] The following Examples are representative of techniques
employed by the inventors in carrying out aspects of the present
invention. It should be appreciated that while these techniques are
exemplary of preferred embodiments for the practice of the
invention, those of skill in the art, in light of the present
disclosure, will recognize that numerous modifications can be made
without departing from the spirit and intended scope of the
invention.
EXAMPLES
Experimental Procedures
Tissue and Cell Preparations:
[0194] Cord Blood (CB) cells were retrieved from umbilical cords of
newborns of uncomplicated full-term pregnancies, as described
[Grisaru (2001) id ibid.], in anti-coagulant citrate dextrose
solution formula A-supplemented bags (Baxter, Deerfield, Ill.).
[0195] Peripheral blood from adult healthy women and from mothers
within the first 24 hours post-delivery was obtained from discarded
samples of routine blood examinations. [0196] Only healthy,
medication-free patients and neonates and only pregnancies which
were uneventful up to term were included in this study. [0197]
Paraffin-embedded sections from electively aborted normal human
embryos were prepared as previously described [Grisaru (1999b) id
ibid.]. [0198] Peripheral mononuclear and CD34+ cells were enriched
to 85% by separation on gelatin and Ficol-Hypaque gradients
followed by CD34 immune magnetic beads (Dynal, Great Neck, N.Y.),
essentially as described [Grisaru (2001) id ibid.; Pick, M. et al.
(1998) Br. J. Haematol. 103:639-650]. Alternatively, CD34.sup.+
stem cells were purified using a CD34.sup.+ progenitor cell
isolation kit (PE, Miltenyi Biotec GmbH, Gladbach, Germany),
according to manufacturer's instructions.
[0199] The use of human material in this study was approved by the
Tel Aviv Sourasky Medical Center Ethics Committee according to the
regulations of the Helsinki accords.
Animal Models:
[0200] Transgenic Mice
[0201] All animal experiments were approved by the animal ethics
committee of The Hebrew University. Transgenic (TgR) mice
expressing human AChE-R were generated by injecting a DNA construct
including the proximal CMV promoter-enhancer followed by exons 2,
3, 4, pseudointron 4' and exon 5 of the human ACHE gene (GenBank
Accession No. M55040) and an SV40 polyadenylation signal, into
fertilized eggs of FVB/N mice [Sternfeld et al. (1998b) J.
Neurosci. 18: 1240-1249]. This transgene presented unimpaired
mendelian inheritance over 5 generations [Sternfeld, M. et al.
(1998a) J. Physiol. Paris 92: 249-255].
[0202] To generate acute inflammation, 5 .mu.g LPS of E. coli
origin (Sigma, St Louis, Mich.) was injected intraperitoneally (IP)
in 400 .mu.l of phosphate buffered saline (PBS, Biological
Industries, Beth Haemek, Israel). Peripheral blood was drawn from
the retroorbital vein of TgS and FVB/N mice, collected in EDTA
(7.5%) tubes. Marrow cells were harvested from the mouse femur
bones with a 26 G needle pre-washed with heparin, and kept in
phosphate-buffered saline (PBS).
[0203] NOD/SCID mice: Non-obese diabetic SCID (NOD/SCID) mice were
maintained under defined flora conditions in the animal facility at
the Weizmann Institute of Science (Rehovot, Israel) in sterile
intra-ventilated cages (IVC; Techniplast, Buguggiate, Italy). Mice
were sub-lethally irradiated with 375 cGy at 67 cGy/min from a
.sup.60Co source and 24 hrs later were transplanted with 100,000
human cord blood CD34.sup.+ cells by intravenous injection in 400
.mu.l of Hank's Balanced Salt solution (HBSS, Biological
Industries, Beit Haemek, Israel). Mice were sacrificed between 2
and 6 weeks post transplant, samples of PB (orbital bleed) and BM
(femur bone) were removed and human engraftment assessed.
Variant-Specific Antibodies
[0204] Monoclonal human antibody fragments were selected from a
phage display library, using ASP, a synthetic peptide with the
C-terminal sequence unique to human AChE-S, as target for
selection. The 90% pure anti-ASP1 antibody was obtained as soluble
single-chain Fv (scFv) including a myc tag and a His6 tail
[Flores-Flores, C. et al. (2002) J. Neural Transm.
62(suppl):165-179]. Polyclonal affinity-purified rabbit antibodies
directed towards the C-terminal sequence unique to human AChE-R
(ARP) were obtained after repeated rabbit challenges with a
glutathione S-transferase-ARP fusion protein (FIG. 1) [Sternfeld,
M. et al. (2000) Proc. Natl. Acad. Sci. U.S.A. 97:8647-52].
Detecting AChE Variants
[0205] 2.times.10.sup.6 cells (50 .mu.l) were incubated (30
minutes, 4.degree. C.) with anti-CD45-PerCP (20 .mu.l, 0.4 .mu.g;
BD Bioscience, San Jose, Calif.) and scFv purified anti-ASP1 (5
.mu.l, 1 .mu.g) or rabbit anti-human polyclonal anti-ARP (5 .mu.l,
1.4 .mu.g), washed with 15 ml 1% BSA in phosphate-buffered saline
(PBS), and centrifuged (600.times.g, 5 minutes, 4.degree. C.).
Secondary antibodies were added to 50 .mu.l of resuspended cells
(30 minutes, 4.degree. C.), anti-c-myc FITC for detecting anti-ASP
(5 .mu.l, 1 .mu.g; Caltag, Burlingame, Calif.) or anti-rabbit-FITC
for detecting anti-ARP (3 .mu.l, 3 .mu.g; Zymed, San Francisco,
Calif.). Cells were washed as above, and red blood cells were lysed
with 1 ml of 1:10 diluted FACS lysis buffer (BD Bioscience, Palo
Alto, Calif.; 12 minutes, 4.degree. C.). Non-specific staining was
evaluated by incubating with FITC-labeled secondary antibodies and
anti-CD45-PerCP only. Surface AChE-R expression was detected on
lymphocytes by double-staining with anti-CD19-APC (5 .mu.l, 1
.mu.g; Caltag) to identify B cells or anti-CD3-APC (5 .mu.l, 1
.mu.g; Caltag) to identify T cells. Intracellular proteins were
detected in permeabilized cells (IntraStain, Dako, Glostrup,
Denmark). Cytochemical staining of catalytically active AChE was
performed as previously reported [Lev-Lehman, E. et al. (1997)
Blood 89:3644-53].
Flow Cytometric Immunophenotyping and AChE-R Detection
[0206] To detect AChE-R, cells were incubated with CD45-PerCP (BD
Bioscience, Palo Alto, Calif.), followed by permeabilization using
the Intrastain Kit (Dako, Glostrup, Denmark), staining with rabbit
anti-human ARP.sub.26 antibodies [Sternfeld, M. et al. (2000) id
ibid.], and detection with FITC-conjugated goat anti-rabbit Fab
antibody (Jackson Laboratory, Bar Harbor, Me.). Mean fluorescence
intensity (MFI) served as a measure of AChE-R content in analyzed
cells. When multiplied by the percent fractions of AChE-R-positive
cells, the MFI values reflected the total content of AChE-R in the
analyzed blood cell samples. Myeloid markers of maternal blood
cells were analyzed by the following combination of monoclonal
antibodies: anti-CD15-FITC (Dako, Glostrup Denmark), anti-CD33-PE
(BD Bioscience, Palo Alto, Calif.), anti-CD45-PerCP (BD Bioscience,
Palo Alto, Calif.) and anti-CD14-APC (Caltag, Burlingame, Calif.).
Corresponding MFI values reflected the amount of receptor on the
surface of granulocytes and monocytes. Expanded CD34+ cells were
analyzed by 4-color flow cytometry with FITC-conjugated anti-CD15
and PE-conjugated anti-CD33, PerCP-conjugated anti-CD34, and
APC-conjugated anti-CD38 (all antibodies purchased from BD
Bioscience, Palo Alto, Calif.) using a FACSCalibur with CellQuest
software (BD Bioscience, Palo Alto, Calif.). Relevant isotype
control antibodies were used to detect non-specific background
fluorescence. The total number of expanded cells for each lineage
was calculated by multiplying their relative proportions by the
number of viable cells in each culture.
[0207] Immunophenotyping of hematopoietic population in mouse bone
marrow (BM) and peripheral blood (PB) used the following antibody
panels: 1) Gr.1-FITC (clone RB6-8C5, Caltag Laboratories,
Burlingame, Calif.), CD11b-PE or -APC (clone M1/70.15, Caltag),
CD45-TC (Clone YW62.3, Caltag) to detect the myeloid lineage; 2)
CD19-FITC (Clone 6D5, Caltag), CD4-PE (Clone CT-CD4, Caltag),
CD3-APC (Clone CT-CD3, Caltag) to detect the lymphoid lineage.
Solubilization of Cellular Antigens:
[0208] Cord red blood cells were isolated by centrifugation
(600.times.g, 20 minutes). The plasma and upper layer of cell
sediment were removed. Leukocytes were isolated on Ficoll-Hypaque
(Pharmacia, Peapack, N.J.). Granulocytes found below the
Ficoll-Hypaque layer were isolated and remaining red blood cells
were lysed (BD Bioscience, Palo Alto, Calif.). Mononuclear cells
found above the Ficoll-Hypaque, containing monocytes and
lymphocytes were washed in 1% BSA-PBS (600.times.g, 5 minutes,
4.degree. C.), re-suspended in 10 ml of Iscove's modified Dulbecco
medium (IMDM, Biological Industries, Beit Haemek, Israel)
supplemented with 10% fetal calf serum (Biological Industries, Beit
Haemek, Israel) and incubated (90 minutes, 37.degree. C., 100%
humidity, 5% CO.sub.2), allowing monocytes to adhere. Non-adherent
cells containing highly enriched lymphocytes were washed with 1%
BSA-PBS and adherent monocytes were scraped and washed in 1%
BSA-PBS. Cell populations, all above 95% pure (tested with
antibodies specific for the population and flow cytometry), were
washed with PBS and re-suspended in high salt detergent buffer (300
mM NaCl, 0.5% Triton X-100, 50 mM Tris HCl, pH 7.6), including the
protease inhibitor cocktail Complete Mini (Roche Molecular
Biochemicals, Mannheim, Germany). After 1 hour shaking at 4.degree.
C., samples were centrifuged (10 minutes, 10,000.times.g, 4.degree.
C.). Supernatants were stored at -80.degree. C. for further
analysis. Protein concentration was determined using a Lowry assay
kit with albumin as protein standard (Bio-Rad, Hercules,
Calif.).
Immunoblots:
[0209] Anti-ASP1 antibody displayed on the phage surface
[Flores-Flores (2002) id ibid.] was used. The pellet of separated
cells was resuspended in 10 ml of denaturing buffer (2% SDS, 50 mM
Tris HCl, pH 6.8). Soluble cell lysates (6 .mu.g of protein) or
plasma samples (to detect AChE-R in circulation, total of 20 .mu.g
protein) were run on 4-20% polyacrylamide gels and electroblotted.
Membranes were blocked (10% BSA, PBS, 0.5% Tween 20, 18 hours,
4.degree. C.), and incubated with the phage carrying the anti-ASP1
antibody (2.6.times.10.sup.8 transforming units/ml, blocking
buffer, 2 h at room temp.) or anti-human ARP.sub.26 antibodies
[Sternfeld (2000) id ibid.]. Following washes (PBS-0.5% Tween20),
membranes were incubated with horseradish
peroxidase/anti-M13-conjugated or anti-rabbit antibody (Amersham
Pharmacia Biotech, Little Chalfont, UK) for 1 hour at room
temperature, and diluted 1:10000 in 5% BSA-PBS, 0.1% Tween20.
Peroxidase activity was detected using an ECL kit from Amersham.
Blots were analyzed using the luminescence tool of Adobe Photoshop
7.0 ME (Adobe Systems, Inc., San Jose, Calif.).
Surface Plasmon Resonance (SPR):
[0210] SPR measurements (BIAcore 3000 System, Uppsala, Sweden) used
the anti-ASP1 scFv and anti-ARP antibodies immobilized on a CM5
sensor chip through their primary amine groups [Johnsson, B. et al.
(1991) Anal. Biochem. 198:268-77]. The matrix was activated with 70
.mu.l of 0.4 M N-ethyl-N'-(dimethyl-aminopropyl)-carbodiimide and
0.1 M N-hydroxysuccinimide, and 200 .mu.g/ml of the particular
antibody in 10 mM sodium acetate, pH 3.5, were injected at a flow
rate of 10 .mu.l/min in 10 mM HEPES, pH 4.0, 150 mM NaCl, 3.4 mM
EDTA and 0.005% polysorbate 20 to reach surface density of between
3000 to 6000 resonance units (RU). Remaining activated carboxyl
groups were blocked by injecting 70 .mu.l of 1 M ethanolamine
hydrochloride. Cord blood cell extracts in high salt detergent
buffer were brought to 0.83 mg protein/ml in 10 mM HEPES pH 4.0
with 150 mM NaCl, 3.4 mM EDTA, 0.005% polysorbate 20. Carboxymethyl
dextran was added to avoid non-specific binding of protein to the
surface matrix. 60 .mu.l extract doses were injected through the
flowcell to which the antibody was immobilized and through a
reference surface (to which no antibody was immobilized) for 2
minutes. A 10 .mu.l pulse of 2 M NaCl achieved regeneration of the
antibody in the flowcell. Data management involved multi-parameter
Student's t-test statistics with p values<0.05 considered
significantly different.
Cell Counts and Serum Tests
[0211] Plasma was separated from blood samples used for cell counts
with the Coulter Gen-S analyzer (Beckman Coulter, Miami, Fla.).
Plasma cortisol levels were measured by eletrochemiluminescence
immunoassay (ECLA) and analyzed by Elecsys 1010/2010 and modular
analytics E170 (Roche, Indianapolis, Ind.). AChE activity was
determined in the plasma by a standard colorimetric assay in the
presence of 10.sup.-5 iso-OMPA, a selective inhibitor of
butyrylcholinesterase (BChE). Mononuclear cells (2.5.times.10.sup.6
cells/mL) from healthy adult women were cultured for 24 hours in
the presence or absence of the noted peptides. The supernatant was
collected following centrifugation (4300 rpm, 10 min) and
filtration (0.2 .mu.m). Cytokine levels, including TNF.alpha.,
IL-1.beta., IL-6, IL-10 and IL-12p-70, in the plasma and cell
supernatants were assessed by flow cytometry (BD Bioscience, San
Jose, Calif.) using a particle-based immunoassay (CBA kit, BD
Bioscience, Palo Alto, Calif.). Data acquisition and analysis
utilized CellQuest and Microsoft Excel software (BD Bioscience,
Palo Alto, Calif.).
In Situ Hybridization
[0212] In situ hybridization procedures were performed on freshly
isolated cells using 5'-biotinylated, 2'-O-methylated AChE cRNA
probes complementary to 3'-alternative human ACHE exons as
previously described [Grisaru (2001) id ibid.]. Labeling intensity
was assessed as the percent cytoplasmic red pixels and normalized
by subtraction of background signals. Confocal microscopic scans of
the cells were obtained using a MRC-1024 Bio-Rad confocal
microscope (Hemel Hempsted Herts., UK). ANOVA and t-test were used
for statistical calculations.
RT-PCR and Real Time RT-PCR
[0213] Total RNA was purified from bone marrow with the RNeasy kit
(Qiagen), followed by treatment with DNase I (Qiagen) according to
manufacturer's protocol. RNA quality was confirmed by
electrophoresis on agarose gel, and analysis of OD ratios at 260 nm
versus 280 nm--all values were between 1.8 and 2.1. cDNA was
prepared from this RNA using the Improm II kit (Promega, Madison,
Wis.). For each reaction, 2.4 .mu.l of 25 mM MgCl.sub.2, 4 .mu.l of
X5 buffer, 1 .mu.l reverse transcriptase, 1 .mu.l dNTP mix (10 mM
of each), 1 .mu.l random hexamers (of 50 .mu.M stock, Sigma), 0.5
.mu.l RNase inhibitor (20U, Promega) and 2 .mu.l sample RNA (200
ng/.mu.l) were mixed with diethyl pyrocarbonate (DEPC) water to a
final volume of 20 .mu.l. The reverse transcription reaction was 45
minutes at 42.degree. C., 5 minutes at 90.degree. C., and then the
samples were left at 4.degree. C.
[0214] Experiments with real-time quantitative PCR were performed
with the Lightcycler.TM. system (Roche, Switzerland) and SYBR Green
PCR Master Mix (Applied Biosystems). Primers for Ikaros1 and mCtBP
were designed using the Lightcycler.TM. sequence-detection software
(Roche, Switzerland). Primer sequences for mFOG, mGATA1,
Runx1/AML1, PU1, .beta.-globin, STAT5, and the housekeeping gene
.beta. actin (SEQ ID NOS:3-14), as well as amplification
conditions, are listed in Table 1. Purity of the PCR products was
verified by a melting curve analysis using the Lightcycler.TM.
system, and by agarose gel analysis.
TABLE-US-00003 TABLE 1 Primer sequences used for Real Time PCR
Annealing Primer Sequence temperature GATA1 + 5'-3' TCTTCTCTCCCACTG
65.degree. C. (SEQ ID NO: 3) GGAGCCCT GATA1 - 5'-3' CTTCTTGGGCCGGAT
(SEQ ID NO: 4) GAGAGGCC LMO2 + 5'-3' TGGATGAGGTGCTGC 65.degree. C.
(SEQ ID NO: 5) AGATA LMO2 - 5'-3' CCCATTGATCTTGGT (SEQ ID NO: 6)
CCACT RUNX1/AML1 + 5'-3' ACTTCCTCTGCTCCG 65.degree. C. (SEQ ID NO:
7) TGCTA RUNX1/AML1 - 5'-3' GTCCACTGTGATTTT (SEQ ID NO: 8) GATGGC
PU.1 + 5'-3' GATGGAGAAAGCCAT 55.degree. C. (SEQ ID NO: 9) AGCGA
PU.1 - 5'-3' TTGTGCTTGGACGAG (SEQ ID NO: 10) AACTG STAT5b + 5'-3'
GGGACTCAATAGATC 65.degree. C. (SEQ ID NO: 11) TTGATAATCC STAT 5b -
5'-3' AACTGAGCTTGGATC (SEQ ID NO: 12) CGCAGGCTCT Actin + 5'-3'
CAATTCCATCATGAA 65.degree. C. (SEQ ID NO: 13) GTGTGAC Actin - 5'-3'
ATCTTGATCTTCATG (SEQ ID NO: 14)
[0215] For quantification of transcript levels, the target
concentrations at which each transcript was amplifying at the log
linear range was tested, using serial dilutions of cDNA
preparations (1:1, 1:3, 1:9, 1:81, where 1:1 corresponds to a
concentration of 400 ng/ul at the reaction mix). The efficiencies
for all targets were very similar (amplification of .about.n
.sup.1.8 per PCR cycle) when RT products were diluted 1:5.
Amplification reactions were performed in a final volume of 10
.mu.l containing 1 .mu.l of 5-fold diluted RT reaction product, 1
.mu.l SYBR Green PCR Master Mix, 10 .mu.M primer, and nuclease-free
water.
Acetylthiocholine Hydrolyzing Activity (AThCh)
[0216] Mouse plasma samples were separated from the nucleated cell
fraction by centrifugation at 4300 rpm (2000.times.g, 20 min)
sterilized through a 0.2 .mu.m pore size filter and stored in
aliquots at -70.degree. C. until use. BM cells were washed with PBS
(Sigma) and re-suspended in low salt detergent buffer (300 mM NaCl,
0.5% Triton X-100, 50 mM Tris HCl, pH 7.6), containing protease
inhibitor cocktail (Roche Molecular Biochemicals). AThCh activity
was as previously described [Kaufer (1998) id ibid.].
Ex Vivo Expansion of Hematopoietic Progenitor Cells:
[0217] For cell priming experiments 100,000 fresh CB CD34.sup.+
cells were supplemented with 2 nM of peptide, ARP.sub.26 [Grisaru
(2001) id ibid.], ASP.sub.40 [Grisaru (2001) id ibid.] or no
supplement for 2 hours and injected into mice. For 10 day cultures
CB CD34.sup.+ cells were expanded in liquid cultures in the
presence of one of the following growth supplements: ARP.sub.26 (2
nM, synthetic peptide), ASP.sub.40 (2 nM, synthetic peptide),
rhu-TPO (1 ng/mL) (R&D) together with rhu-SCF (50 ng/mL;
Genzyme Diagnostic, Cambridge, Mass., USA) or no supplement
(control). ARP.sub.26, and ASP.sub.40 were synthetically produced.
PBAN (a negative control insect peptide) [Nijholt (2003) id ibid.]
were also used for cell explansion. Liquid cultures were initiated
and maintained in 24-well tissue culture plates (1.times.10.sup.5
cells/well in 1 mL). Cells were grown for 10 days at 37.degree. C.
in 5% CO.sub.2 in a fully humidified atmosphere in IMDM
supplemented with 5% autologous plasma. At 3-day intervals,
cultures were supplemented with the same growth factor(s) and cells
were counted by trypan blue exclusion and diluted to maintain
cultures at concentrations no higher then 100,000 cells/mL [Pick M.
et al. (2002) Exp. Hematol. 30:1079]. Cultured cells were injected
into NOD/SCID mice at a concentration of 100,000 or -200,000
together with 100,000 unexpanded CD34.sup.+ cells per mouse as
indicated.
Progenitor Colony Assays
[0218] GM-CFU: mouse BM cells were cultured at 2.times.10.sup.5
cells per 35 mm tissue culture dish (Corning Inc., NY) in IMDM
(Biological Industries, Beit Haemek, Israel) supplemented with 0.8%
methyl cellulose (Sigma-Aldrich Corp., St. Louis, Mo.), 10% FCS
(Biological Industries, Beit Haemek, Israel) and 5.times.10.sup.-4
M 2-beta-mercaptoethanol (2-ME) (Sigma), 5 ng/mL recombinant
mouse-granulocyte macrophage--colony stimulating factor
(rmo-GM-CSF, R&D Systems Inc., Minneapolis, Minn.), 10 ng/mL
rmo--stem cell factor (rmo-SCF, R & D), 3 U/mL
rhu-erythropoietin (rhu-EPO, R & D Systems Inc., Minneapolis,
Minn.) and rmo-Interleukin-3 (rmo-IL-3, R & D) in 5% CO.sub.2
at 37.degree. C. Colonies of more than 40 cells were counted at day
10.
[0219] BFU-E: 2.times.10.sup.5 BM cells per 35 mm dish were
cultured in Alpha-MEM (Biological Industries, Beit Haemek, Israel)
supplemented with 0.8% methyl cellulose, 10% FCS, 10% bovine serum
albumin (BSA, Boehringer Ingelheim GmbH, Germany) and
5.times.10.sup.-4 M 2-ME, 3 U/mL rhu-EPO and 10 ng/mL rmo-SCF. Red
cell clusters were counted at day 12 of incubation in 5% CO.sub.2
at 37.degree. C.
[0220] CFU-Mk: 2.times.10.sup.5 BM cells per 35 mm dish were
cultured in McCoy's Medium (Biological Industries, Beit Haemek,
Israel) supplemented with 0.3% agar (Difco, Mich.), 10% FCS and
10.sup.-4 M 2-ME, 2 ng/mL rmo--thrombopoietin (rmo-TPO, R&D
Systems Inc., Minneapolis, Minn.) and 10 ng/mL rmo-SCF in 5%
CO.sub.2 at 37.degree. C. for 10 days. Plates were placed into an
oven for 2 hrs at 45.degree. C. with Whatmann No. 1 filter paper
discs carefully placed over the agar layer. The filter paper was
then gently removed and plates incubated with AChE substrate (10 mg
acetylthiocholine iodide dissolved in 15 mL of 0.1M dibasic sodium
phosphate, 1 mL of 0.5 M sodium citrate, 2 mL 30 mM cupric sulfate
and 2 ml 5 mM potassium ferricyanide) for up to 24 hrs at room
temperature or until colonies turned brown in color.
Quantification of Cytokine Levels
[0221] Mouse TPO, EPO, Tumor necrosis factor-alpha (TNF-.alpha. and
IL-6 levels in plasma of TgR and FVB/N mice were determined using
Quantikine murine enzyme-linked immunosorbent assay (ELISA) kits
(R&D), according to the manufacture's instructions.
Immunhistochemistry
[0222] BM cell smears were fixed for 15' with methanol, washed 3
times with PBS and then 3 times with 100 mM glycine to quench
auto-fluorescence. Blocking buffer included 1% donkey (Santa Cruz
Biotechnology Inc., Santa Cruz, Ca), or 1% goat serum (Santa Cruz)
for 30 min at room temperature. Antibodies against human AChE-R
(Rabbit, 0.6 ug/slide) [Sternfeld M. et al. (2000) Proc. Natl.
Acad. Sci. USA 97:8647-8652], PKC .epsilon. (mouse, 0.5 ug/slide)
(BD Biosciences, Palo Alto, Calif.) and RACK1 (mouse, 0.25
ug/slide) (BD Bioscience, Palo Alto, Calif.) were incubated for 60'
with blocking buffer. TBST (Tris buffered saline with 0.2% Tween
20) was used to wash slides after each antibody incubation. For
detection, biotin-SP-conjugated AffiniPure goat anti mouse IgM or
donkey anti rabbit IgG (1:200, Jackson ImmunoResearch Laboratories
Inc., West Grove, PN) and Cy3.TM. conjugated streptavidin (1:200,
Jackson ImmunoResearch Laboratories Inc., West Grove, PN) were each
incubated for 30 min at room temperature. May-Grunwald staining was
performed to morphologically identify megakaryocytes.
Detection of Human Cells Engraftment in NOD/SCID Mice
[0223] NOD/SCID mice were sacrificed 2 to 6 weeks
post-transplantation and PB and BM were analyzed following lysis of
mature RBCs with FACS lysis buffer (BD Bioscience, Palo Alto,
Calif.). 5.times.10.sup.6 cells were incubated with human
antibodies anti-CD41a-FITC (Beckman/Coulter, Fullerton, Calif.),
anti-CD34-PE (BD Bioscience, Palo Alto, Calif.) and anti-CD45 PerCP
(BD Bioscience, Palo Alto, Calif.) (30 min, 4.degree. C.). To
follow human platelet engraftment, PB of NOD/SCID mice was stained
with anti-human CD41a-FITC and anti-mouse CD41a-PE (BD Bioscience,
Palo Alto, Calif.), and a specific platelet gate was placed at
acquisition.
[0224] At least 500,000 events per sample were acquired with a BD
FACS Calibur (BD Bioscience, Palo Alto, Calif.). Data analysis used
Cell Quest and Cell Quest Pro software (BD Bioscience, Palo Alto,
Calif.). Matched isotype controls for all antibodies were used to
detect background fluorescence (supplied by Caltag and BD
Bioscience, Palo Alto, Calif.). All human antibodies were
pre-tested on naive-untransplanted mice to test for any
cross-reactivity. To detect human-originated cells, BM DNA was
extracted (QIAprep Spin Miniprep Kit, Qiagen) according to
manufacturer instructions. DNA samples (100 ng, 2 .mu.l) were
incubated in 10 .mu.l containing 1 .mu.l Light Cycler.TM. DNA
master hybridization probe (Roche Molecular Biochemicals), 1 .mu.l
primers (5 .mu.M sense and 5 .mu.M antisense), 1 .mu.l probes (5
.mu.M anchor and 5 .mu.M sensor), 1.2 .mu.l MgCl.sub.2 (3 mM) and
nuclease-free water. TNF.alpha. primer and probe sequences are
listed below in Table 2 (SEQ ID NOS:15-20). PCR involved 45 cycles
(95.degree. C. for 10 sec, 65.degree. C. for 7 sec, and 72.degree.
C. for 20 sec). Standard curves were generated by mixing
mononuclear cells (MNCs) from human CB together with mouse BM,
total number of cells being 5.times.10.sup.6 per concentration with
mixtures of 0, 0.5, 1, 2, 5, 10, 20, 40, 60, 80 and 100% human
cells. The human probe and primer were found negative in naive
mice.
TABLE-US-00004 TABLE 2 DNA sequence of primers and probes for
TNF.alpha.. Name 5'-3' sequence Sequence Name Human sense
AGGAACAGCACAGGCCTTAGTG SEQ ID NO: 15 Human AAGACCCCTTCCAGATAGATGG
SEQ ID NO: 16 antisense Human probe GCCCCTCCACCCATGTGCTCC- SEQ ID
NO: 17 FLAC-RED640 CACCCACCACCATCAGCCGCATC SEQ ID NO: 18 Mouse
sense GGCTTTCCGAATTCACTGGAC SEQ ID NO: 19 Mouse CCCCGGCCTTCCAAATAAA
SEQ ID NO: 20 antisense FL-sensor, AC-.anchor *Nucleotide sequences
are based on human and mouse TNF .alpha. genes (Gen Bank Accession
Numbers M26331 and Y00467, respectively) [Nitsche A. et al. (2001)
Haematologica 86:693-699].
Example 1
Evaluating AChE Splice Variants in Hematopoietic Cell
Populations
[0225] Cytochemical staining of smeared blood cell preparations
revealed acetylthiocholine-hydrolysing AChE in blood cells from the
newborn, adult and post-partum sources. Particularly prominent
intracellular staining was observed in adult and post-partum
granulocytes, whereas enzyme activity on the cell surface was
clearly observed on lymphocytes, granulocytes and monocytes from
adult blood, compatible with the inventors' previous findings
[Lev-Lehman (1997) id ibid.], but only on granulocytes from
post-partum mothers. FIG. 2A portrays representative micrographs
(one cell from 30 analyzed) of this staining, and FIG. 2B includes
activity staining combined with morphology.
[0226] To attribute enzyme activities to specific AChE variants and
explore their surface-cytoplasmic localization, flow cytometry was
used, which combines physical characteristics of these cells with
specific surface antigens. CD45, a glycosylated trans-membrane
phosphatase which is expressed on the membrane of granulocytes,
monocytes and lymphocytes at different intensities, but not in
erythrocytes [Craig, W. et al (1994) Br. J. Haematol. 88:24-30; Xu,
Z. and Weiss, A. (2002) Nat. Immunol. 3: 764-71]. CD45 was used to
identify these blood cell populations from several human sources,
which included adult non-pregnant women, adult women post-partum
and cord blood from their newborns.
[0227] Antibodies directed to the unique C-terminal sequences of
human AChE-S [Flores-Flores (2002) id ibid.] and AChE-R [Sternfeld
(2000) id ibid.] were used in conjunction with CD45 labeling to
analyze the expression of the corresponding variants or fragments
thereof in the sub-classified blood cell populations. Flow
cytometry measurements using naive or permeabilized cells enabled
distinction between cell surface and intra-cellular localization of
these variants (FIG. 2C). Quantitative values were expressed as
either percent positive cells (expression levels) within each
population or mean fluorescence intensities of the positive
fraction, which reflected content of the corresponding variant
protein in each population (see below).
[0228] In blood cells from post-partum mothers, this analysis
expectedly showed very low to undetectable levels of AChE-S and -R
on the surface and in the cytoplasm of red blood cells (RBCs),
compatible with AChE-E being the variant that is present and active
in these cells. Increased fluorescence, measured by a shift in
histogram patterns compared to background, reflected the presence
of substantial AChE-S and -R levels in all of the CD45+
populations. The levels of expression of the AChE-S and AChE-R
variants in post-partum peripheral blood granulocytes and monocytes
was higher (both on the surface and in the cytoplasm) than in
lymphocytes, which showed low levels on the surface, and somewhat
higher levels in the cytoplasm (FIG. 3). The surface-cytoplasmic
distribution of enzymatically active AChE within blood cells thus
presented lineage-specific differences that were altered both
during development and following the stress of childbirth.
Example 2
Differential Concentrations of AChE Variants within Specific Blood
Cell Types
[0229] An independent quantification of AChE variant levels within
specific blood cell types was obtained using the BIAcore
technology, based on measuring the interaction of proteins in cell
homogenates with antibodies covalently linked to a carboxymethyl
dextran matrix adherent to the surface of a gold leaf sensor
[Johnsson (1991) id ibid.]. Increases in the refractive index of
this sensor were monitored in real time as the changes in surface
plasmon resonance (SPR) angle (FIG. 4A). Non-specific SPR signals
obtained in the absence of antibodies were subtracted, and protein
levels were standardized either to the amount of total protein or
to the number of lysed cells in each preparation, irrespective of
their cellular localization (FIG. 4B).
[0230] Because cord blood lysates were examined at only one
antibody concentration and one lysate concentration, the BIAcore
measurements could only reflect relative antigen interaction with
the antibodies, but not absolute affinity values. These relative
amounts of each variant were compared within specific cell types
and between the four hematopoietic cell groups. When applied to
newborn cord blood cell extracts, larger signals were detected for
AChE-S than for -R. Decreasing concentrations (reflected in
resonance units, RU/mg protein) of AChE-S occurred in the order of
granulocytes>lymphocytes>monocytes>red blood cells. A
different decreasing order,
lymphocytes>monocytes>granulocytes>red blood cells, was
calculated per cell, suggesting that the high granulocyte
concentration of AChE-S reflected the high total protein content.
AChE-R signals, which were generally lower, presented similar
decreasing orders in both measures
(lymphocytes>monocytes>granulocytes>red blood cells, FIG.
4B). The BIAcore and flow cytometry methods revealed distinct R:S
ratios, e.g. for granulocytes from cord blood (FIGS. 3, 4), perhaps
due to different properties of the two antibodies.
[0231] A third evaluation approach involved immunoblot analysis of
the corresponding cell homogenates using the AChE-S specific ASP
antibody displayed on phage surface (FIG. 4C). This analysis
demonstrated several immunopositive protein bands in granulocytes
and lymphocytes, most of which of smaller size then the predicted
full protein. A single rapidly migrating band appeared in red blood
cells, with fainter, similarly migrating band in myeloid cells.
These bands likely reflect proteolytic breakdown products (or
fragments) of the ACHE-S protein in blood cells. Additionally, or
alternatively, the cleaved C-terminus of AChE-S [Grisaru (1991) id
ibid.] or an immunocompatible variant could be exposed in cell
homogenates but not in intact cells.
Example 3
Distinct Splice Variations in Development and Stress
[0232] Calculating the AChE-S/AChE-R distributions as percent of
positive cells in each lineage revealed distinct splice variations
in development and stress. Most cell populations included
significant fractions of cells positive for both cytoplasmic and
surface AChE-S and -R variants, with significantly higher numbers
of AChE-R expressing cells in all adult myeloid cell populations
than in fetal cells (FIG. 5). The number of granulocytes expressing
cytoplasmic AChE-R was significantly higher in post-partum blood
(p<0.05), reminiscent of the increase in AChE-R seen in brain
neurons under stress [Kaufer (1998) id ibid.; Meshorer et al.
(2002) id ibid.; Soreq and Seidman (2001) id ibid.]. However,
AChE-S, which is known to adhere to the membranes of brain neurons
was expressed on the surface and in the cytoplasm of significantly
more blood cells in post-partum mothers than in non-pregnant women
(Students t-test, p<0.05). In addition, post-partum lymphocytes
displayed a paradoxical decrease in surface AChE-R. The
localization of AChE-R to the cell surface, which was rather
surprising in view of its hydrophilic C-terminal peptide, may
reflect interaction with as yet unknown protein variant(s) [Birikh
(2003) id ibid.].
Example 4
Surface and Cytoplasmic AChE-S and AChE-R Contents in Peripheral
Blood Cells
[0233] High fluorescence intensity from comparative flow cytometry
confirmed the increased protein content of the AChE-R variant
compared to AChE-S of all cell types and sources tested. AChE-R
protein content of granulocytes, which comprise 70 to 80% of the
white blood cell compartment, were significantly higher in
post-partum mothers compared to cord blood cells (Table 3),
reflecting a strikingly different splicing pattern for AChE
pre-mRNA in fetal blood cells than in adult cells under the
post-partum stimulus. Cytoplasmic increases in AChE-R content,
observed as larger mean fluorescence intensity values, occurred
under stress in all cell lineages. Stress-induced increases in cell
surface AChE-R appeared in granulocytes and monocytes, but not in
red blood cells. In lymphocytes, cell surface AChE-R increased
8-fold from newborns to adults but declined under stress (Table
3).
TABLE-US-00005 TABLE 3 AChE variant contents in blood cells Mean
Fluorescence Intensity (MFI).sup.a % of blood AChE-S AChE-R
leukocytes.sup.b Cytoplasmic Surface Cytoplasmic Surface RBCs CB NA
4.7 .+-. 1.6 1.4 .+-. 0.1 6.9 .+-. 0.3 4.1 .+-. 0.4 APB NA 4.8 .+-.
0.6 1.4 .+-. 0.3 5.0 .+-. 0.3 4.7 .+-. 2.1 PPB NA 4.5 .+-. 0.4 4.7
.+-. 0.1 18.5 .+-. 1.2 5.8 .+-. 0.6 granulocytes CB 39-63 30.1 .+-.
15.1 19.4 .+-. 3.3 57.9 .+-. 2.7 42.8 .+-. 3.4 APB 43-65 11.1 .+-.
0.5 6.1 .+-. 0.3 32.9 .+-. 3.9 62.9 .+-. 3.5 PPB 69-82 9.1 .+-. 0.4
30.1 .+-. 0.4 96 .+-. 3 138 .+-. 10 monocytes CB 6-12 21.3 .+-. 0.1
22.3 .+-. 3.9 42.7 .+-. 3.0 29.1 .+-. 1.7 APB 6-12 10.3 .+-. 0.3
9.5 .+-. 0.7 17.8 .+-. 1.7 27.1 .+-. 6.4 PPB 6-12 14.7 .+-. 0.8
21.3 .+-. 0.7 57.5 .+-. 2.6 72 .+-. 5.8 lymphocytes CB 42-62 10.4
.+-. 1.3 9.7 .+-. 1.7 16.1 .+-. 0.5 24 .+-. 2 APB 21-46 4.8 .+-.
0.3 2.2 .+-. 0.1 8.2 .+-. 0.7 183 .+-. 11 PPB 13-23 5.7 .+-. 0.3
10.4 .+-. 0.2 25.7 .+-. 1.1 37 .+-. 2 .sup.aAverage of 15
measurements for each population expressed as mean .+-. standard
error are presented. .sup.bProportions of white blood cells
expressed by peripheral blood leukocyte populations. Significantly
different MFI values as compared with the other two sources
according to t-test (p < 0.05) analysis are presented in bold
face type.
Example 5
Development and Stress-Induced Changes in Lymphocytic AChE
Variants
[0234] Previous reports attributed lymphocytes' AChE activity to T
cells and described its increases with mitogenic stimulation
[Szelenyi et al. (1987) Immunol. Lett. 16: 49-54]. Activity was
also observed in the thymus [Topilko and Caillou (1985) Blood 66:
891-5], but B lymphocytes displayed very low levels of AChE, which
decreased with maturation [Szelenyi et al. (1982) Br. J. Haematol.
50: 241-5]. In the present study, CD3+ T cells presented low
expression of surface AChE-R in all samples while CD19+ B cells
expression was significantly higher (FIG. 6A), suggesting that
AChE-R may be relevant for antibody production. Due to the majority
of T cells (about 9:1 to B cells, FIG. 6A, inset), their small
signals contributed significantly to the total lymphocyte output.
Nevertheless, B cells displayed a significant increase in
fluorescence intensity from newborn cord blood to adults and
post-delivery blood cells, with no change between the latter two
fractions (FIG. 6B). Larger lymphocyte fractions expressed surface
AChE-R in separate T and B cell populations, likely due to the high
background staining in the T lymphocyte fraction (FIG. 6A).
[0235] In conclusion, considerably more myeloid cells of the
post-partum mothers expressed AChE-S and AChE-R than in either
control women or newborns. In contrast, B lymphocytes lost their
surface AChE-R with development and under stress.
Example 6
Fetal AChE-R mRNA Expression Coincides with Myelopoiesis
[0236] The in vivo expression of alternative AChE mRNA transcripts
(FIG. 7A) was studied by in situ hybridization using
paraffin-embedded human fetal sections from different gestational
ages (FIG. 7A). AChE mRNAs were observed in the
aorta-gonad-mesonephric region (AGM), liver, spleen and bone
marrow, consistent with the spatiotemporal shifts of hematopoietic
embryogenesis and the migration of fetal hematopoiesis through the
various blood forming tissues (FIG. 7C). Clear changes occurred in
developing liver, with distinct labeling intensities for each of
the AChE mRNA transcripts at different gestational ages (FIG. 7D).
At 9 weeks gestation, when the liver and spleen are initiating
definitive hematopoiesis, the erythrocytic AChE-E mRNA transcript
was prominently displayed in the AGM, liver and spleen. Significant
levels of the synaptic transcript (AChE-S mRNA) were found at this
time in the AGM region and liver, but not in spleen, while the
AChE-R mRNA variant was barely detectable in all hematopoietic
tissues. At 16 weeks, during accelerated myelopoiesis, AChE-S was
elevated in both liver and spleen in agreement with findings of
others [Chan (1998) id ibid.]. A decrease in AChE-E mRNA concurrent
with an increase in AChE-R mRNA was observed in the liver,
suggesting a splicing shift (FIG. 7E). Subsequent decreases in all
AChE mRNA variants were observed until 25 weeks. These changes were
concomitant with the switch from primitive hematopoiesis, which is
exclusively erythrocytic, to definitive hematopoiesis of all
lineages. These results suggest that AChE-R overproduction is
causally associated with myelopoiesis in vivo.
Example 7
Intra-Partum Cortisol Escalation Associates with Increased
Granulocytic AChE-R Expression
[0237] Cortisol levels were predictably elevated intra-partum as
compared to an age matched population of 48 control Caucasian women
(36.6.+-.4.2 vs. 21.3.+-.11.2 .mu.g/dL, p<0.001; FIG. 8A).
Intra-partum serum cortisol levels showed direct correlation with
WBC counts (Pearson correlation; R=0.55, p=0.04; FIG. 8E). This was
accompanied by elevated expression of AChE-R in the cytoplasm of
mature WBC as detected by flow cytometry (p=0.009; FIG. 8F).
Direct, significant correlation of cortisol levels with the
fraction of AChE-R positive granulocytes (R=0.72, p=0.003; FIG.
8G), but not monocytes or lymphocytes, was consistent with the
predicted role of AChE-R in post-partum granulocytosis.
Example 8
Sustained Peri-Partum Granulocytosis
[0238] To explore the relevance of cholinergic changes for
intra-partum granulocytosis, the peri-partum hematopoietic changes
in blood samples was studied. Sixteen patients with premature
rupture of membranes at term (PROM, rupture of membranes without
uterine contractions) were followed, from admission through
delivery and post-partum periods (27.08.+-.14.22 and 61.82.+-.15.99
hours post admission, respectively). WBC counts in these patients
were higher than the pre-delivery average and increased
significantly intra-partum (P<0.0001; FIG. 9A). Hemoglobin
levels maintained normal to low range before delivery and decreased
significantly intra- and post-partum (P=0.01), compared to the
baseline values, reflecting blood loss during labor. Platelet
counts remained stable and in the normal range during the entire
study period (FIG. 9A). Although WBC counts decreased post-partum,
they remained significantly above normal ranges (P=0.01)),
reflecting increased granulocyte counts (intra-partum: P<0.0001;
post-partum: P=0.02). Monocyte and lymphocyte counts remained in
the low normal range (FIG. 9B). In vivo parturition was therefore
considered appropriate for assessing the effects of a transient
stressful event on granulocytosis.
Example 9
Granulocytic AChE-R Expression Maintains High Post-Partum
Levels
[0239] Cortisol levels were high pre-partum (30.6.+-.8.2 vs.
21.3.+-.11.2 .mu.g/dL in age-matched control population,
P<0.001), increased intra-partum (32.1.+-.12.2 .mu.g/dL;
P<0.001 compared to matched controls), and decreased
significantly post-partum (27.2.+-.10.6 .mu.g/dL, P=0.05 compared
to the intra-partum values; FIG. 8A) to levels that are not
statistically different than those of the matched control
population. Serum AChE activity increased as compared to controls
(21.6.+-.7.2 vs. 5.5.+-.1.9 nmole/min/mg protein; p<0.001) and
remained significantly elevated during the entire period (FIG. 8B).
A significant increase was observed in the number of granulocytes
expressing cytoplasmic AChE-R, both intra- and post-partum as
compared to pre-partum (from 1.7.+-.0.6.times.10.sup.3 cells/.mu.L
to 5.2.+-.0.5 and 4.9.+-.0.4.times.10.sup.3 cells/.mu.L,
respectively, P=0.05; FIG. 9D). This pattern of expression was not
reflected in monocytes or lymphocytes (FIG. 9D), consistent with
the idea that AChE-R may have a selective role in the prolongation
of peri-partum granulocytosis. High serum levels of AChE-R were
found throughout the peri-partum period (FIG. 9D), supporting the
notion that serum AChE activity reflected sustainable AChE-R
levels, facilitating parturition anxiety [Sklan, E. H. et al.
(2004) Proc. Natl. Acad. Sci. USA 101(15): 5512-5517].
Example 10
Parturition Effects on Myeloid Markers
[0240] To determine the effect of parturition on the myeloid
lineage, applied flow cytometry to study the expression of CD15 (a
marker of granulocytes), CD 33 (a marker of early myeloid cells)
and CD14 (which is expressed on myeloid cells and is often used as
a marker of monocytes) on peripheral blood WBC. CD15 expression on
granulocytes decreased significantly in intra-partum samples
(535.+-.287 vs. 294.+-.129 MFI, P=0.03; FIG. 9C-9D) and its
post-partum levels returned to baseline, while CD33 expression did
not change significantly over the entire period. This may represent
a cumulative effect of rapid production and release of early
myeloid cells from the bone marrow on the one hand, accompanied by
their rapid maturation on the other hand. Additionally, CD14
expression on monocytes did not vary, while post-partum CD33
expression decreased significantly (145.+-.89 vs. 91.+-.40 MFI,
P=0.05; FIG. 9C-9D).
Example 11
Leukocyte AChE-R Contents Positively Associate with Plasma AChE
Activity
[0241] Total AChE-R contents in blood cells were evaluated by
multiplying the mean fluorescence intensity (MFI) per the percent
of positive cells expressing AChE-R in each cell type
(granulocytes, monocytes and lymphocytes) detected by flow
cytometry. In each type of circulating WBC, AChE-R contents
correlated with AChE activity in the post-partum plasma (for
granulocytes R=0.984, p<0.0001; for monocytes R=0.962,
p<0.0001; and for lymphocytes R=0.917, p<0.0001; FIG. 10).
Plasma AChE activity levels thus reflected AChE-R production in
each type of leukocyte.
Example 12
ARP.sub.26 Enhances Endogenous ACHE Gene Expression
[0242] Assuming a turnover number of 1.times.10.sup.4 molecules of
ACh hydrolyzed/second/AChE subunit, and based on the inventors'
previous findings [Cohen (2003) id ibid.], up to one-half of the
AChE-R is C-terminally cleaved in vivo to yield ARP, the AChE-R
C-terminal peptide. Therefore, the measured rates of ACh hydrolysis
in the serum of post-partum mothers predicted a peptide
concentration in the range of 5-30 nM. It was further hypothesized
that comparable peptide concentrations are found in the bone
marrow, and the potential ex vivo effects of ARP.sub.26 at 0.2, 2.0
and 20 nM on CD34+ progenitors. In situ hybridization followed by
confocal quantification of the three AChE mRNA variants revealed
increased levels of all AChE mRNA transcripts 24 hours following
the addition of ARP.sub.26 to the medium. This was accompanied by
increased cytochemically stainable cellular ACh hydrolytic activity
reflecting accumulated AChE protein in the ARP.sub.26-treated
cultured cells (FIG. 11C). The enhanced activity under
physiologically relevant concentrations of ARP.sub.26 reflected an
increase in endogenous AChE, since the synthetic peptide has no
enzymatic capacity. It also provided a possible explanation for the
sustained AChE activity in peri-partum sera, since it occurred with
2 nM ARP.sub.26 and to a similar extent in mammals exposed to
stress-associated cortisol levels [Grisaru (2001) id ibid.].
Example 13
ARP.sub.26 Potentiates Myelopoiesis in Liquid Cultures
[0243] To test the long-term effect of ARP.sub.26 on myelopoietic
expansion, flow cytometry was used to monitor the development of
phenotypically distinct cell populations from human CD34+
hematopoietic stem cells incubated with ARP.sub.26 over a 2-week
period. Peptide controls (ASP.sub.40 and PBAN) were used to explore
the specificity of this response. FIGS. 11D-11E and Table 4 present
the resultant cell growth and changes in the populations that
emerged from a typical CD34+ culture. Incubation with ARP.sub.26,
but not with cortisol, ASP.sub.40 or PBAN, increased the total
number of cells. A larger fraction of committed progenitors
(CD34+CD38+) emerged in the presence of cortisol at stress levels
(1.2 .mu.M) as compared to a physiologically relevant concentration
of ARP.sub.26 (FIG. 11D-11E); however, the expansion index (the
number of viable cells/ml culture divided by the number of seeded
cells) was considerably higher following incubation with ARP.sub.26
(Table 4a). Increases were observed along the entire myelopoietic
differentiation pathway (CD34+CD33+, CD33+CD15-, CD33+CD15+ and
CD33-CD15+, Table 4b), supporting the notion that ARP.sub.26 tilts
hematopoiesis towards the myeloid lineage in a cortisol-independent
process, and particularly expanding the population of mature
CD33-CD15+ granulocytes (see column CD33-CD15+, Table 4b), inducing
increased growth of early GEMM progenitors and producing
specifically large numbers of mature granulocytes. These findings
demonstrate that the ARP.sub.26-induced myelopoiesis in fact leads
to an enrichment of the granulocytic population.
TABLE-US-00006 TABLE 4a ARP.sub.26 promotes ex vivo cell expansion
of cultured CD34+ cells Cell type Cell expansion Treatment
index.sup.a Control 0.59 .+-. 0.76 Cortisol, 1.2 .mu.M 1.55 .+-.
0.07 ARP.sub.26, 2 nM 5.29 .+-. 2.52* ASP.sub.40, 2 nM 1.9 .+-.
0.61 PBAN, 2 nM 1.85 .+-. 0.96 .sup.aThe number of viable cells/ml
culture at day 14 divided by the number of seeded cells (50,000).
*P < 0.001
TABLE-US-00007 TABLE 4b The effect of various conditions on
cultured CD34+ cells. - The numbers represent actual cell counts
.times. 10.sup.3 of each cell type detected Cell type CD34+ CD34+
CD33+ CD33- Cell CD38+ CD33+ CD15- CD33+ CD15+ expansion Committed
Committed Immature CD15+ Mature Treatment index.sup.a progenitors
myeloids myeloids Granulocytes granulocytes Control 1.2 0.5 0.5 1.4
2.1 4.3 Cortisol 1.6 11.0 10.6 13.0 28.5 15.4 (1.2 nM) ARP.sub.26
(2 nM) 11.4 29.1 31.9 94.6 64.4 220.6 ASP (2 nM) 2.0 2.5 0.4 0.5
1.9 4.2 PBAN (2 nM) 2.1 0 0.1 0.2 0.9 1.8 .sup.aExpansion index is
a ratio of the number of viable cell/ml culture at day 14 divided
by the number of cells seeded (50,000).
Example 14
AChE-R Supports Pro-Inflammatory Cytokine Release from Mononuclear
Cells
[0244] Next, the putative mechanism(s) enabling the long term
effects of ARP.sub.26 was addressed. The elevated AChE-R contents
and AChE activity in the post-partum blood predicted peripherally
reduced ACh levels, and the suppressed cholinergic control over the
production of pro-inflammatory cytokines by macrophages. The levels
of several inflammation/stress-associated cytokines in the plasma
of intra-partum mothers were compared to those of non-pregnant
women. Elevation was observed for IL-1.beta., IL-6 and TNF.alpha.,
all known to have pro-inflammatory and hematopoietic roles, in the
post-partum mothers [Hanada and Yoshimura (2002) Cytokine Growth
Factor Rev. 13: 413-421; Wilson et al. (2002) J. Am. Geriatr. Soc.
50: 2041-2056] (FIG. 12A). To examine whether this increase could
be causally related with AChE-R overexpression in peripheral white
blood cells, 2.5.times.10.sup.6 mononuclear cells per mL from adult
women controls were incubated with 2 nM ARP (FIG. 12B). Significant
increases were observed in the secretion from these cell cultures
of IL-1.beta., IL-6 and TNF.alpha. 24 hours later, but there was no
change in the release of the anti-inflammatory cytokine IL-8 from
cells incubated with ARP.sub.26 as compared with control cells
(FIG. 12A and data not shown). Thus, the post-partum AChE-R
overexpression in peripheral nucleated blood cells could be
causally associated with selective elevation of pro-inflammatory
cytokines.
Example 15
AChE-R Excess is Associated with Impaired Response to LPS
[0245] In order to understand the mechanisms of the hematopoietic
effect of prolonged exposure to AChE-R, the transgenic AChE-R (TgR)
mouse model was used. Basal levels of white blood cell counts (WBC)
were similar in both TgR and FVB/N mice (FIG. 14A-14B). Manual
differential of WBC sub-populations showed similar distributions
into granulocytes, monocytes and lymphocytes in TgR and FVB/N mice
(FIG. 14A-14B). These findings may reflect an equilibrium state of
the hematopoietic system reached by the TgR mice. Therefore it was
demanding to expose these mice to an acute stressful event.
[0246] LPS was injected intra-peritoneally (IP) in order to induce
acute inflammation WBC counts dropped in both FVB/N and TgR mice.
However, counts recovered much faster in TgR mice to reach
significantly higher levels than those of FVB/N mice by 72 hr post
LPS injection (p<0.02, n=10, FIG. 14B). Peripheral blood
immunophenotyping revealed that while FVB/N mice had a significant
decrease in GR1.sup.+ (granulocyte) cells, in response to LPS
injection, the number of GR1.sup.+ remained unchanged in TgR mice
and was significantly higher than FVB/N by 72 h post LPS injection.
Both FVB/N and TgR mice had decreased CD11b+ (monocytic) cell
counts 24 h post LPS injection, although the decrease was steeper
in TgR as compared to FVB/N mice. CD11b+ cell counts recovered
almost completely by 72 h post LPS injection in both FVB/N and TgR
mice, TgR mice attaining higher Cd11b+counts, although not reaching
a statistically significant value. These data suggest that the
early recovery in WBC counts in TgR in response to inflammatory
stress, results from both their ability to maintain stable
granulocyte counts, in spite of the LPS suppressive effects, as
well as to a rapid renovation of the monocyte pool.
Example 16
PU.1 Transcription Factor is Involved in the Inflammatory
Response
[0247] To further understand TgR peripheral cell response to
inflammatory stress, the dexpression pattern of transcription
factors pivotal for hematopoiesis in bone marrow extracts from
FVB/N and TgR mice was evaluated, through real time RT-PCR (FIG.
13).
[0248] While the response pattern of LMO2, GATA1, RUNX1 and STAT5
to LPS was similar in both FVB/N and TgR mice, PU.1 levels
decreased significantly in FVB/N, but not in TgR mice bone marrow,
in response to LPS. At 72 h post LPS injection, PU.1 levels
recovered and even reached higher than base-line values in FVB/N
mice, but showed only some decrease in TgR mice.
Example 17
AChE-R is Expressed in Bone Marrow and Blood of TgR Mice
[0249] The inventors' previous reports suggest that a
stress-induced switch from production of AChE-S to the -R variant
elevates soluble AChE-R levels [Pick (2004) id ibid.]. Thus, it was
hypothesized that this shift may reduce circulating ACh and the
nicotinic .alpha.7 ACh control over pro-inflammatory cytokine
production [Tracey K. J. (2002) id ibid.], driving hematopoietic
progenitor cell expansion, as previously described [Grisaru (2001)
id ibid.] (FIG. 16A). TgR mice were then used as a model of chronic
splicing shift towards the AChE-R, over the AChE-S transcript.
Using DNA primers specific for human AChE intron 4, human AChE-R
mRNA was detected in the BM of TgR mice but not in strain-matched
FVB/N mice or in the TgS mice over-expressing the AChE-S variant,
(FIG. 16B), reconfirming the continued activity of the transgene in
hematopoietic cells.
Example 18
AChE-R Excess is Associated with Elevated Basal and Post-Stress
Platelet Counts
[0250] As mentioned before, basal levels of WBC were similar in TgR
and FVB/N mice (FIGS. 14A-14B and 17B). Basal levels of
thrombopoietin (TPO) were similar in both TgR and FVB/N mice (FIG.
17A), whereas platelet counts were significantly higher in TgR mice
(894.+-.87 Vs 1051.+-.160.times.10.sup.9/mL, p<0.001, n=25, FIG.
17C). Since manual differential of WBC sub-populations showed
similar distributions into granulocytes, monocytes and lymphocytes
in TgR and FVB/N mice (FIGS. 14A-14B and 17B), the results with the
platelets reflect selective thrombocytosis under chronic AChE-R
overexpression.
[0251] After ip LPS injection RBC counts predictably dropped up to
72 hrs post-LPS (FIG. 16) (in control FVB/N but not TgR mice. WBC
dropped in both strains, but counts recovered considerably faster
in TgR mice reaching significantly higher levels than those of
FVB/N control mice by 72 hr post LPS injection (p<0.02, n=10,
FIGS. 16B and 16D). Platelet counts in FVB/N control mice dropped
significantly, as expected, to thrombocytopenic levels between 24
and 72 hrs, while in TgR mice the platelet counts were only
slightly reduced and returned to normal values within 72 hrs
(p<0.001, n=10, FIG. 16C).
Example 19
AChE-R Over-Expression Modulates TPO and Inflammatory Cytokine
Levels
[0252] To further study the observation of elevated platelet counts
in TgR mice, TPO concentrations were measured in the plasma and BM
cell extracts from TgR and FVB/N mice. TPO concentrations were
significantly higher in both BM and plasma of TgR mice (p=0.013,
0.04 respectively, compared to FVB/N control mice (FIGS. 17A and
17B), consistent with the notion that these mice can serve as a
model of chronic inflammation [Stohlawetz (1999) id ibid.; Kaser A.
et al. (2001) Blood 98: 2720-2725; Zahorec R. (2001) Bratisl. Lek.
Listy. 102:5-14]. TgR mice BM had higher TPO levels 24 hrs post LPS
injection (p=0.002) followed by lower TPO levels at 72 hrs (p=0.02,
n=10, FIG. 3A), as compared with FVB/N mice. In plasma, the high
basal TPO levels were maintained 24 hrs post LPS injection (p=0.01,
n=10). However, at this time point the FVB/N mice plasma TPO levels
were significantly higher than TgR mice possibly due to
corresponding dramatic drop in platelet numbers (FIG. 17B). TPO
levels decreased slightly but remained elevated in both mouse
strains at 72 hrs (FIG. 17B).
Example 20
AChE-R Over-Expression is Associated with Modified Inflammatory
Cytokine Levels
[0253] To study the possible effects of AChE-R in the inflammatory
reaction, the inventors measured the levels of inflammatory
cytokines in plasma and BM extracts of TgR and FVB/N mice. IL-6,
but not TNF.alpha. levels were found to be significantly elevated
in the plasma of TgR mice as was AThCh hydrolyzing activity
compared with FVB/N control mice, suggesting that AChE catalytic
activity might be involved in modified inflammatory control (FIG.
15C).
[0254] The inflammatory response of TgR mice was further evaluated
by measuring the levels of TNF.alpha. and IL-6, in bone marrow cell
extracts and plasma, and at different time points post injection of
LPS. TgR mice showed significantly higher plasma levels of
TNF.alpha. 2 hrs post LPS injection (34.+-.231 pg/mL, p<0.04,
n=10) but significantly lower levels in BM, as compared to FVB/N
mice (120.+-.66 Vs 334.+-.81, p<0.01, n=10) (Table 5A) possibly
because the main production TNF.alpha. is in peripheral blood. IL-6
levels were comparable in both TgR and FVB/N mice after LPS
injection (Table 5A), indicating again a pre-existing active
inflammatory state in the TgR strain.
TABLE-US-00008 TABLE 5A Inflammatory cytokine levels post LPS
TNF.alpha. (pg/ml) .sup.a IL-6 (pg/ml) .sup.a plasma BM Plasma BM
TgR 834 .+-. 231 120 .+-. 66 1418 .+-. 62 507 .+-. 135 FVB/N 538
.+-. 217 334 .+-. 81 1378 .+-. 40 498 .+-. 331 P 0.04 0.01 NS NS
.sup.a TNF.alpha. and IL-6 levels were measured 2 hours post-LPS
injection.
[0255] In addition to their high baseline AChE catalytic activity
(FIG. 15C), TgR mice responded to LPS injections by a further
significant increase in bone marrow AChE catalytic activity 24 hrs
post LPS injection (p=0.0004, n=10), but not at other time points
(Table 5B).
TABLE-US-00009 TABLE 5B AThCh hydrolysing activity/min/mg of
protein post LPS BM Plasma LPS (hrs post) LPS (hrs post) 24 72 24
72 TgR 14.2 .+-. 4.3 13.1 .+-. 1.8 31.7 .+-. 12.8 7.7 .+-. 0.4
FVB/N 6.3 .+-. 1.9 11.0 .+-. 0.7 27.0 .+-. 13.1 9.3 .+-. 1.0 P
0.00004 NS NS NS Note: AChE catalytic activity assessed by its
AThCh hydrolyzing activity/mim/mg protein was measured in plasma
and bone marrow extracts of LPS-injected mice (n = 10) Shown are
average concentrations .+-. SD in plasma or BM proteins.
Example 21
Enhanced Proliferative Potential in Bone Marrow Progenitors from
TgR Mice
[0256] The proliferating potential of BM progenitor cells was
evaluated by clonogenic assays using growth factors to support the
development of the specific hematopoietic lineages. Colonies were
classified as colony forming units--megakaryocyte (CFU-Mk),
CFU-granulocyte/macrophage (CFU-GM) or
CFU-granulocyte/erythrocyte/monocyte/megakaryocyte (CFU-GEMM) and
were counted 10 to 14 days after plating. TgR mice showed
significantly higher baseline numbers of CFU-Mk, -GM and -GEMM
hematopoietic progenitor cells as compared to FVB/N controls
(p.ltoreq.0.003, n=12, FIGS. 18A-21C). Following LPS injection, TgR
mice maintained significantly higher number of megakaryocyte
progenitors (p<0.0002, n=12, FIG. 18A). In FVB/N mice, the
number of CFU-GM, was significantly elevated at 24 hr post-LPS, a
response previously described [Peterson (1992) id ibid.; Yokochi
(1985) id ibid.] (p=0.01, n=12, FIG. 18B) but decreased noticeably
by 48 hr, while TgR CFU-GM numbers decreased 48 hr post LPS
injection but remained significantly higher than FVB/N (p=0.03,
n=12, FIG. 18B). The increase in CFU-GM in TgR mice was less
dramatic than in FVB/N control mice perhaps caused by fatigue of
myeloid progenitor cells due to chronic exposure to ACHE-R. TgR and
FVB/N mice showed similar post-LPS numbers of multipotential
CFU-GEMM (NS, n=12, FIG. 18C).
Example 22
AChE-R Over-Expression Associates with Elevated Megakaryocytic
PKC.epsilon.
[0257] AChE-R was reported to interact with the scaffold protein
RACK1 and with its target, protein kinase C .beta.II (PKC .beta.II)
[Birikh K. R. et al. (2003) Proc. Natl. Acad. Sci. USA 100:283-288;
WO 00/73427] or PKC .epsilon. [Perry C. et al. (2004) Neoplasia
6(3):279-86]. PKC.epsilon. has been implicated in the programming
of megakaryocytic lineage commitment and potentiates the
transcription factor GATA-1 [Racke F. K. et al. (2001) J. Biol.
Chem. 276:522-528]. To study a potential AChE-R/PKC.epsilon./RACK1
interaction in megakaryocytes, AChE-R, PKC.epsilon. and RACK1 were
detected in BM smears of TgR and FVB/N mice (FIG. 19A-19F).
[0258] Megakaryocytes were detected in BM smears by the
May-Grunwald staining (FIG. 19A). TgR megakaryocytes predictably
expressed higher AChE-R labeling then megakaryocytes from FVB/N
mice (212.3.+-.15.0 Vs 130.9.+-.18.3 luminescence units,
p<10.sup.-11, n=50, FIGS. 19B, 19F and Table 3). Intriguingly,
RACK1 labeling intensity was discernable, although insignificantly
elevated in TgR megakaryocytes, as compared to FVB/N mice
(162.3.+-.49.2 Vs 153.4.+-.21.0, NS, n=50, FIGS. 19C, 19F and Table
6). No differences in the number of PKC .epsilon.-labeled
megakaryocytes were detected in TgR mice (data no shown),
nevertheless, the intensity of PKC .epsilon. labeling was
significantly higher as compared to FVB/N mice (187.7.+-.22.2 Vs
160.9.+-.19.7 luminescence units, p<10.sup.-5, n=50, FIGS. 19D,
19F and Table 6). Thus, AChE-R interaction with RACK1 and with
PKC.epsilon. emerged as a putative mechanism for increased
intracellular signaling in TgR megakaryocytes.
TABLE-US-00010 TABLE 6 Luminescence intensity of human AChE-R,
RACK1 and PKC.epsilon. in megakaryocytes. Antibody FVBN TgR p
values No Antibody 116.8 .+-. 8.7 122.4 .+-. 11.8 NS Hu AChE-R
130.94 .+-. 18.26 212.3 .+-. 15.0 1 .times. 10.sup.-11 RACK1 153.4
.+-. 21.0 162.3 .+-. 49.2 NS PKC.epsilon. 160.9 .+-. 19.7 187.8
.+-. 22.7 3 .times. 10.sup.-6
[0259] Note: Luminescence levels (from 1, low luminescence to 220,
bright) were determined using a upright Zeiss microscope,
ImagePro.TM. image capture and Adobe Photoshop V 5.5 analysis for
each megakaryocyte stained in the bone marrow smears (n=50 per
antibody). NS=Not significant. Background staining was detected by
incubation with no primary antibody.
Example 23
AChE-R Potentiates Engraftment Potential in NOD/SCID Mice
[0260] TgR mice elevated platelet counts and increased
megakaryocyte growth potential was suggestive to determine whether
AChE-R, or its cleavable peptide ARP, can improve engraftment of
transplanted BM cells and recovery from thrombocytopenia in a
NOD/SCID mouse transplantation model. Human CB CD34.sup.+ cells
were primed for 2 hrs prior to injection with ARP.sub.26, a
synthetic peptide comprised of 26 amino acids of the C-terminal
sequence of AChE-R or ASP.sub.40 a 43 amino acid sequence of the C
terminus of AChE-S.
[0261] The ARP concentration chosen (2 nM) was previously
determined to be maximal for stimulating hematopoietic stem cell
proliferation [Deutsch (2002) id ibid.] Human CB CD34+ cells
(1.times.10.sup.5) were injected into mice 24 hours post
irradiation. Cells were either primed and supplemented with
ARP.sub.26 or primed and supplemented with ASP.sub.40 or untreated
(control). Mice were sacrificed 6 weeks post-transplantation and
single cell suspensions from BM extracted from the femur bones
assessed for the presence of human hematopoietic cells Monoclonal
antibodies against human CD45, CD34 and CD41 were used to assess
engraftment efficacy of the transplanted human cells. Fractions of
human CD34.sup.+ cells in the BM of NOD/SCID mice post transplant
were similar in all groups (FIG. 20A). However, significantly more
human CD45.sup.+ cells were found in the BM of NOD/SCID mice
injected with ARP.sub.26 together with ARP.sub.26-primed CD34.sup.+
cells (p=0.02, n=12, 16 and 8 mice, respectively, FIG. 20A).
Fractions of human megakaryocytes (CD41.sup.+) were higher in the
BM of NOD/SCID mice that received ARP.sub.26-primed cells as
compared with ASP.sub.40-primed or non-primed human cells (p=0.03,
n=12, 16 and 8 mice, respectively, FIG. 20A). These results
demonstrate a significantly better engraftment of transplanted
primed human CD34.sup.+ cells when injected with ARP.sub.26 as
compared with non-ARP.sub.26 treated cells.
[0262] Quantitative PCR with human specific probes was used to
assess the relative presence of human DNA in the BM of NOD/SCID
mice. Significant differences could be observed between mice
transplanted with ARP.sub.26-primed CD34.sup.+ cells as compared to
cells primed with ASP.sub.40 or non-primed cells (p=0.015, FIG.
20B).
Example 24
Transplantation of Cells Expanded Ex Vivo with ARP.sub.26 Increased
Human Platelet Production in NOD/SCID Mice
[0263] In an attempt to improve platelet recovery in NOD/SCID mice
the number of committed megakaryocyte progenitor cells in the stem
cell graft were expanded ex-vivo. CD34.sup.+ cells were incubated
for 10 days in medium supplemented with 10% plasma and one of the
following combinations: ARP.sub.26, (2 nM) ASP.sub.43 (2 nM), TPO
(10 ng/ml) and SCF (50 ng) (growth factors optimal for
megakaryocyte commitment) or no growth factor supplement (control).
CD34+ cells are known to differentiate in culture producing many
committed progenitors, but have reduced capacity for long-term
engraftment in NOD/SCID mice. Therefore, freshly isolated
CD34.sup.+ cells are needed to enable long-term engraftment
[Guenechea G. et al. (1999) Blood 93:1097-1105; Li K. et al. (1999)
Br. J. Haematol. 104:178-185]. For this reason a mixture of
cultured CD34.sup.+ cells (between 1-2.times.10.sup.5) was injected
together with 100,000 fresh CB CD34.sup.+ cells. The cultured
CD34.sup.+ cells, being more mature were expected to facilitate the
capacity for early platelet production. Early engraftment (2-3
weeks post-transplant) and late engraftment (4 and 6 weeks
post-transplant) were analyzed. Incubating CD34.sup.+ cells with
ARP.sub.26, ASP.sub.40 or TPO and SCF did not augment engraftment
of human CD45.sup.+, CD34.sup.+ or CD41.sup.+ cells (FIG. 21A)
however, it enabled to test whether the injected differentiated
cells affected platelet production. Full blood cell counts were
performed on the transplanted NOD/SCID mice and the presence of
human platelets monitored. Although significant differences were
not found, probably due to the small sample number of mice (n=6),
NOD/SCID mice that received cells expanded with ARP.sub.26 yielded
higher human platelet numbers, both early (between 2 and 3 weeks
post-transplant) (mean=1.26 control Vs 3.29 ARP.sub.26 expanded Vs
0.94 ASP.sub.40 expanded Vs 1.61.times.10.sup.6/ml TPO/SCF expanded
group, FIG. 21B) and at the late transplanted stage (mean=5.85
control Vs 17.70 ARP.sub.26 expanded Vs 6.39 ASP.sub.40 expanded Vs
3.44.times.10.sup.6/ml TPO/SCF expanded group, FIG. 21B). These
observations were compatible with the hypothesis that the injected
differentiated megakaryocytes facilitated platelet production in
the engrafted mice and that the enhanced AChE-R production by these
cells support a shift towards megakaryocytopoiesis, which
culminated in higher platelet counts at the later test time.
Sequence CWU 1
1
20126PRTHomo sapiens 1Gly Met Gln Gly Pro Ala Gly Ser Gly Trp Glu
Glu Gly Ser Gly Ser1 5 10 15Pro Pro Gly Val Thr Pro Leu Phe Ser Pro
20 25240PRTHomo sapiens 2Asp Thr Leu Asp Glu Ala Glu Arg Gln Trp
Lys Ala Glu Phe His Arg1 5 10 15Trp Ser Ser Tyr Met Val His Trp Lys
Asn Gln Phe Asp His Tyr Ser 20 25 30Lys Gln Asp Arg Cys Ser Asp Leu
35 40323DNAArtificial SequencePrimer sequences-GATA1+ 3tcttctctcc
cactgggagc cct 23423DNAArtificial SequencePrimer sequences-GATA1-
4cttcttgggc cggatgagag gcc 23520DNAArtificial SequencePrimer
sequences-LM02+ 5tggatgaggt gctgcagata 20620DNAArtificial
SequencePrimer Sequences-LM02- 6cccattgatc ttggtccact
20720DNAArtificial SequencePrimer sequence - RUNX1/AML1+
7acttcctctg ctccgtgcta 20821DNAArtificial SequencePrimer
sequence-RUNX1/AML1- 8gtccactgtg attttgatgg c 21920DNAArtificial
SequencePrimer sequence-PU.1+ 9gatggagaaa gccatagcga
201020DNAArtificial SequencePrimer sequence-PU.1- 10ttgtgcttgg
acgagaactg 201125DNAArtificial SequencePrimer sequence-STAT5b+
11gggactcaat agatcttgat aatcc 251225DNAArtificial SequencePrimer
sequence-STAT 5b- 12aactgagctt ggatccgcag gctct 251322DNAArtificial
SequencePrimer sequence-Actin + 13caattccatc atgaagtgtg ac
221420DNAArtificial SequencePrimer sequence-Actin - 14atcttgatct
tcatggtgct 201522DNAArtificial SequencePrimer Human sense TNF alfa
15aggaacagca caggccttag tg 221622DNAArtificial SequencePrimer Human
antisense TNF alfa 16aagacccctt ccagatagat gg 221721DNAArtificial
SequenceProbe Human TNF alfa (sensor) 17gcccctccac ccatgtgctc c
211823DNAArtificial SequenceProbe Human TNF alfa (anchor)
18cacccaccac catcagccgc atc 231921DNAArtificial SequencePrimer
Mouse sense TNF alfa 19ggctttccga attcactgga c 212019DNAArtificial
SequencePrimer Mouse antisense TNF alfa 20ccccggcctt ccaaataaa
19
* * * * *