U.S. patent application number 12/663840 was filed with the patent office on 2011-02-17 for human pluripotent stem cells induced from undifferentiated stem cells derived from a human postnatal tissue.
Invention is credited to Tetsuya Ishikawa, Hldeki Masaki, Kazuhiro Sakurada, Shunichi Takahashi.
Application Number | 20110039332 12/663840 |
Document ID | / |
Family ID | 39253880 |
Filed Date | 2011-02-17 |
United States Patent
Application |
20110039332 |
Kind Code |
A1 |
Sakurada; Kazuhiro ; et
al. |
February 17, 2011 |
HUMAN PLURIPOTENT STEM CELLS INDUCED FROM UNDIFFERENTIATED STEM
CELLS DERIVED FROM A HUMAN POSTNATAL TISSUE
Abstract
To establish human pluripotent stem cells having properties
close to human ES cells comprising the genome of the patient per se
that can circumvent immunological rejection of transplanted cells
from cells derived from a postnatal human tissue. It was found that
human pluripotent stem cells can be induced by introducing three
genes of Oct3/4, Sox2 and KIf 4, or three genes of Oct3/4, Sox2 and
KIf 4 plus the c-Myc gene or a histone deacetylase (HDAC) inhibitor
to undifferentiated stem cells present in various human postnatal
tissues in which each gene of Tert, Nanog, Oct3/4 and Sox2 has not
undergone epigenetic inactivation.
Inventors: |
Sakurada; Kazuhiro;
(Yakohama-shi, JP) ; Masaki; Hldeki; (Tokyo,
JP) ; Ishikawa; Tetsuya; (Tokyo, JP) ;
Takahashi; Shunichi; (Kobe, JP) |
Correspondence
Address: |
WILSON, SONSINI, GOODRICH & ROSATI
650 PAGE MILL ROAD
PALO ALTO
CA
94304-1050
US
|
Family ID: |
39253880 |
Appl. No.: |
12/663840 |
Filed: |
November 20, 2007 |
PCT Filed: |
November 20, 2007 |
PCT NO: |
PCT/EP2007/010019 |
371 Date: |
October 26, 2010 |
Current U.S.
Class: |
435/366 |
Current CPC
Class: |
A61P 3/10 20180101; C12N
2510/00 20130101; C12N 2501/602 20130101; C12N 2501/606 20130101;
C12N 2501/604 20130101; C12N 2799/027 20130101; A61P 25/28
20180101; C12N 2501/603 20130101; C12N 15/85 20130101; C12N 5/0696
20130101 |
Class at
Publication: |
435/366 |
International
Class: |
C12N 5/071 20100101
C12N005/071; C12N 5/0735 20100101 C12N005/0735 |
Foreign Application Data
Date |
Code |
Application Number |
Jun 15, 2007 |
JP |
2007-159382 |
Claims
1. A human pluripotent stem cell having an in vitro long-term
self-renewal ability and the pluripotency of differentiating into
ectoderm, mesoderm and endoderm, that was induced from an
undifferentiated stem cell present in a human postnatal tissue in
which each gene of Tert, Nanog, Oct3/4 and Sox2 has not undergone
epigenetic inactivation.
2. The human pluripotent stem cell according to claim 1 induced
from an undifferentiated stem cell present in a human postnatal
tissue, wherein said undifferentiated stem cell present in the
human postnatal tissue was subjected to a primary culture or a
second subculture, or a subculture in a low serum
concentration.
3. The human pluripotent stem cell according to claim 1 induced by
the forced expression of each of three genes of Oct3/4, Sox2 and
Klf4 in an undifferentiated stem cell present in a human postnatal
tissue, wherein said undifferentiated stem cell present in the
human postnatal tissue was subjected to a primary culture or a
second subculture or to a subculture in a low serum
concentration.
4. The human pluripotent stem cell according to claim 1 induced by
the forced expression of each of four genes of Oct3/4, Sox2, Klf4
and c-Myc in an undifferentiated stem cell present in a human
postnatal tissue, wherein said undifferentiated stem cell present
in the human postnatal tissue was subjected to a primary culture or
a second subculture or to a subculture in a low serum
concentration.
5. The human pluripotent stem cell according to claim 1 induced by
combining the forced expression of each of three genes of Oct3/4,
Sox2 and Klf4 and a histone deacetylase inhibitor treatment in an
undifferentiated stem cell present in a human postnatal tissue,
wherein said undifferentiated stem cell present in the human
postnatal tissue was subjected to a primary culture or a second
subculture or to a subculture in a low serum concentration.
6. The human pluripotent stem cell according to claim 1 induced by
combining the forced expression of each of three genes of Oct3/4,
Sox2 and Klf4 and a MS-275 treatment in an undifferentiated stem
cell present in a human postnatal tissue, wherein said
undifferentiated stem cell present in the human postnatal tissue
was subjected to a primary culture or a second subculture or to a
subculture in a low serum concentration.
7. The human pluripotent stem cell according to any one of claims 2
to 6 wherein FGF-2 is further used in the culture of said
undifferentiated stem cell.
8. The human pluripotent stem cell according to any one of claims 2
to 6 wherein PDGF and FGF are further used in the culture of said
undifferentiated stem cell.
9. The human pluripotent stem cell according to any one of claims 2
to 8 wherein the culture of said undifferentiated stem cell is
further conducted in a lower density.
10. The human pluripotent stem cell according to any one of claims
1 to 9 wherein said human pluripotent stem cell is positive for
Nanog.
11. The human pluripotent stem cell according to any one of claims
1 to 10 wherein said human pluripotent stem cell is positive for
alkaline phosphatase staining.
12. The human pluripotent stem cell according to any one of claims
1 to 11 wherein said human pluripotent stem cell is positive for
Tert.
13. The human pluripotent stem cell according to any one of claims
1 to 12 wherein said human pluripotent stem cell comes to have
teratoma-forming potential when it is transplanted into a test
animal.
14. The human pluripotent stem cell according to any one of claims
1 to 13 wherein said human postnatal tissue is a tissue immediately
after birth.
15. The human pluripotent stem cell according to any one of claims
1 to 13 wherein said human postnatal tissue is a tissue immediately
after birth and is a tissue derived from a neonatal tissue or an
umbilical cord tissue.
16. The human pluripotent stem cell according to any one of claims
1 to 13 wherein said human postnatal tissue is a tissue immediately
after birth and is a tissue derived from a neonatal skin or a blood
vessel derived from the umbilical cord.
17. The human pluripotent stem cell according to any one of claims
1 to 16 wherein said human pluripotent stem cell further has an in
vitro potential of differentiating into a primordial germ cell.
18. An undifferentiated stem cell present in a human postnatal
tissue, in which each gene of Tert, Nanog, Oct3/4 and Sox2 has not
undergone epigenetic inactivation and which can be induced into a
human pluripotent stem cell having an in vitro long-term
self-renewal ability and the pluripotency of differentiating into
ectoderm, mesoderm and endoderm by the forced expression of each of
three genes of Oct3/4, Sox2 and Klf4.
19. An undifferentiated stem cell present in a human postnatal
tissue, in which each gene of Tert, Nanog, Oct3/4 and Sox2 has not
undergone epigenetic inactivation and which can be induced into a
human pluripotent stem cell having an in vitro long-term
self-renewal ability and the pluripotency of differentiating into
ectoderm, mesoderm and endoderm by the forced expression of each of
four genes of Oct3/4, Sox2, Klf4 and c-Myc.
20. An undifferentiated stem cell present in a human postnatal
tissue, in which each gene of Tert, Nanog, Oct3/4 and Sox2 has not
undergone epigenetic inactivation and which can be induced into a
human pluripotent stem cell having an in vitro long-term
self-renewal ability and the pluripotency of differentiating into
ectoderm, mesoderm and endoderm by combining the forced expression
of each of three genes of Oct3/4, Sox2 and Klf4 and a histone
deacetylase inhibitor treatment.
21. An undifferentiated stem cell present in a human postnatal
tissue, in which each gene of Tert, Nanog, Oct3/4 and Sox2 has not
undergone epigenetic inactivation and which can be induced into a
human pluripotent stem cell having an in vitro long-term
self-renewal ability and the pluripotency of differentiating into
ectoderm, mesoderm and endoderm by combining the forced expression
of each of three genes of Oct3/4, Sox2 and Klf4 and a MS-275
treatment.
22. The undifferentiated stem cell present in a human postnatal
tissue according to any one of claims 18 to 21, wherein said human
postnatal tissue is a tissue immediately after birth.
23. The undifferentiated stem cell present in a human postnatal
tissue according to any one of claims 18 to 21, wherein said human
postnatal tissue is a tissue immediately after birth and is a
tissue derived from a neonatal tissue or an umbilical cord
tissue.
24. The undifferentiated stem cell present in a human postnatal
tissue according to any one of claims 18 to 21, wherein said human
postnatal tissue is a tissue immediately after birth and is a
tissue derived from a neonatal skin or a blood vessel of the
umbilical cord.
25. The undifferentiated stem cell present in a human postnatal
tissue according to any one of claims 18 to 24, wherein said human
pluripotent stem cell further has an in vitro potential of
differentiating into a primordial germ cell.
26. A method of inducing a human pluripotent stem cell wherein an
undifferentiated stem cell present in a human postnatal tissue, in
which each gene of Tert, Nanog, Oct3/4 and Sox2 has not undergone
epigenetic inactivation, is subjected to a primary culture or a
second subculture or to a third or fourth subculture in a low serum
concentration at 0 to 5%, and then each of three genes of Oct3/4,
Sox2 and Klf4 is subjected to forced expression.
27. The method of inducing a human pluripotent stem cell according
to claim 26, wherein each of four genes comprising each of three
genes of Oct3/4, Sox2 and Klf4 plus c-MYc is subjected to forced
expression.
28. The method of inducing a human pluripotent stem cell according
to claim 26, wherein the forced expression of each of three genes
of Oct3/4, Sox2 and Klf4 is combined with a histone deacetylase
inhibitor treatment.
29. The method of inducing a human pluripotent stem cell according
to claim 26, wherein the forced expression of each of three genes
of Oct3/4, Sox2 and Klf4 is combined with a MS-275 treatment.
30. The method of inducing a human pluripotent stem cell according
to any one of claims 26 to 29, wherein said undifferentiated stem
cell is cultured in the presence of FGF-2.
31. The method of inducing a human pluripotent stem cell according
to any one of claims 26 to 29, wherein said undifferentiated stem
cell is cultured in the presence of PDGF and EGF
32. The method of inducing a human pluripotent stem cell according
to any one of claims 26 to 31, wherein said human postnatal tissue
is a tissue immediately after birth.
33. The method of inducing a human pluripotent stem cell according
to any one of claims 26 to 31, wherein said human postnatal tissue
is a tissue immediately after birth and is a tissue derived from a
neonatal tissue or an umbilical cord tissue.
34. The method of inducing a human pluripotent stem cell according
to any one of claims 26 to 31, wherein said human postnatal tissue
is a tissue immediately after birth and is a tissue derived from a
neonatal skin or a blood vessel of the umbilical cord.
35. A method of culturing a human pluripotent stem cell according
to any one of claims 1 to 17 in a culture medium comprising an
inhibitor of Rho associated kinase as an active ingredient.
36. The human pluripotent stem cell according to anyone of claims 1
to 17 on which cell surface antigens SSEA-3, SSEA-4, TRA-1-60,
TRA-1-81, CD9, CD24, and CD90 are expressed.
Description
TECHNICAL FIELD
[0001] The present invention relates to human pluripotent stem
cells induced from stem cells present in a human postnatal tissue
and its inducing method.
BACKGROUND ART
[0002] With the rapid aging of the society, diseases associated
with tissue degeneration and tissue injury are rapidly increasing.
Said diseases include cerebral infarction, myocardial infarction
and renal failure that develop in an age-dependent manner due to
the metabolic syndrome, Alzheimer's disease, Parkinson's disease
and osteoporosis that are induced by age-related internal changes
of the tissue, and the like. Type I diabetes, multiple sclerosis
and rheumatoid arthritis induced by autoimmune diseases as well as
burns and spinal injuries induced by wounds are also diseases
characterized by tissue degeneration and tissue injury. As methods
of treating such diseases resulting from tissue degeneration and
injury, various regenerative medical techniques are being developed
now.
[0003] Regenerative medicine is roughly divided into two methods:
the induced regeneration method in which endogenous stem cells in
patients are activated with a drug etc., and the cell replacement
therapy in which stem cells or somatic cells induced from stem
cells or tissues are transplanted. Specifically, in diseases
accompanied by chronic inflammation and diseases in elderly
individuals, the induced regeneration method does not work well due
to reduced function of stem cells from the patient per se, and thus
the development of the cell replacement therapy is imperative. In
order to treat diseases resulting from tissue degeneration and
injury by a cell replacement therapy, a large amount of stem cells
or somatic cells induced from stem cells generally need to be
prepared as materials for transplantation. For this purpose, stem
cells that can differentiate into various tissues and that can
self-replicate for a long time are indispensable for the
development of a cell replacement therapy.
[0004] As stem cells that satisfy these conditions, there have been
reported ES cells or EG cells that can be induced from fertilized
eggs or primordial germ cells. However, in order to perform the
cell replacement therapy safely and efficiently, it is necessary to
prepare ES cells or EG cells comprising the genome of the patient
per se that can circumvent the immunological rejection of
transplanted cells.
[0005] As a method of preparing ES cells comprising the genome of
the patient per se, a method of nuclear transplantation in which
the nucleus of an egg is replaced with that of a somatic cell of
the recipient has been investigated in animals such as mice.
However, the success rate of nuclear transplantation is still low,
and no success has been made in humans. Separately, there is a
report on establishment of the iPS (induced pluripotent stem) cells
having a property close to that of ES cells by introducing four
genes of Oct3/4, Sox2, Klf4 and c-Myc into fibroblasts derived from
mouse skin (Cell 126: 1-14, Aug. 25, 2006). However, the rate of
iPS induction is low, and it has not been successful in humans.
DISCLOSURE OF THE INVENTION
Problems to be Solved by the Invention
[0006] Thus, it is an object of the present invention to establish
human pluripotent stem cells from cells derived from a human
postnatal tissue, said stem cells having properties close to that
of ES cells and comprising the genome of the patient per se thereby
circumventing immunological rejection of transplanted cells.
Means to Solve the Problems
[0007] The present inventors have found that human pluripotent stem
cells can be induced by introducing three genes of Oct3/4, Sox2 and
Klf4 or three genes of Oct3/4, Sox2 and Klf4 plus the c-Myc gene or
a histone deacetylase (HDAC) inhibitor into undifferentiated stem
cells present in a human postnatal tissue in which each gene of
Tert, Nanog, Oct3/4 and Sox2 has not undergone epigenetic
inactivation. Furthermore, we have discovered a method of
efficiently inducing human pluripotent stem cells by introducing
three genes of Oct3/4, Sox2 and Klf4 or three genes of Oct3/4, Sox2
and Klf4 plus the c-Myc gene or a histone deacetylase inhibitor
into undifferentiated stem cells after the undifferentiated stem
cells were amplified by a primary culture or a second subculture,
or a subculture in a low density and low subculturing in a culture
medium comprising a low-concentration serum.
[0008] Human postnatal tissues are preferably tissues immediately
after birth (various tissues of neonates), umbilical cord tissues
(the umbilical cord, cord blood), the amnion, the placenta etc.,
and more preferably various neonatal tissues and umbilical cord
tissues. Post-natal tissues include tissues of various timings
during the period from the birth of an individual to its death. The
undifferentiated stem cells refer to stem cells in which at least
four genes of Nanog, Oct3/4, Sox2 and Tert have not undergone
epigenetic modification by heterochromatin formation due to DNA
methylation or histone modification, among the primordial cells in
the tissue of somatic stem cells established in vitro, such as
mesenchymal stem cells (Science, 1999, April 2; 284 (5411): 143-7)
and MAPCs (multipotent adult progenitor cells) (Stem Cell Rev.
2005; 1(1): 53-9), and MIAMI (marrow-isolated adult multilineage
inducible) cells (J. Cell Sci. 2004 Jun. 15; 117 (Pt 14):
2971-81).
[0009] ES cell-like pluripotent stem cells refer to cells having an
in vitro long-term self-renewal ability and the pluripotency of
differentiating into three germ layers, and said pluripotent stem
cells may form teratoma when transplanted into a test animal such
as mouse. The present invention is thought to provide a useful
technique for the cell replacement therapy for the treatment of
diseases resulting from tissue degeneration or injury.
[0010] After extensive and intensive investigation on methods of
establishing ES cell-like pluripotent stem cells from human
postnatal tissues, the present inventors have obtained the
following three major findings:
[0011] (1) Among the cells derived from human postnatal tissues,
cells that can be transformed into ES cell-like pluripotent stem
cells by introducing four genes of Oct3/4, Sox2, Klf4 and c-Myc are
undifferentiated stem cells in which each gene of Tert, Nanog,
Oct3/4 and Sox2 has not undergone epigenetic inactivation;
[0012] (2) Undifferentiated stem cells in which each gene of Tert,
Nanog, Oct3/4 and Sox2 has not undergone epigenetic inactivation
are mostly present in postnatal tissues immediately after birth
(various neonatal tissues), cord tissues (the umbilical cord, cord
blood), the amnion, the placenta and the like; and
[0013] (3) When cultured under a high-concentration serum or
subcultured for a long time even under a low serum concentration,
undifferentiated stem cells in which each gene of Tert, Nanog,
Oct3/4 and Sox2 has not undergone epigenetic inactivation lose its
property of being transformed into ES cell-like pluripotent stem
cells by the introduction of four genes of Oct3/4, Sox2, Klf4 and
c-Myc. By applying said findings, we have completed the present
invention that establishes ES cell-like pluripotent stem cells
efficiently from human tissue-derived cells.
[0014] Since the c-Myc gene has a risk of inducing cancer, we have
then investigated its alternatives, and have found that by adding a
histone deacetylase inhibitor in stead of the c-Myc gene to
undifferentiated stem cells in mice, ES cell-like pluripotent stem
cells can be induced from undifferentiated stem cells in which the
Tert, Nanog, Oct3/4 and Sox2 genes have not undergone epigenetic
inactivation present in postnatal tissues, and thus, it is expected
that, in the case of humans as well, by adding a histone
deacetylase inhibitor in stead of the c-Myc gene to
undifferentiated stem cells in which the Tert, Nanog, Oct3/4 and
Sox2 genes have not undergone epigenetic inactivation, they could
be transformed into ES cell-like pluripotent stem cells.
[0015] Furthermore, it was found, in mice, that transformation into
ES cell-like pluripotent stem cells can be effected by introducing
only three genes of Oct3/4, Sox2 and Klf4 except the c-Myc gene to
undifferentiated stem cells, and thus it is expected in the case of
humans as well, by adding three genes of Oct3/4, Sox2 and Klf4 to
undifferentiated stem cells in which the Tert, Nanog, Oct3/4 and
Sox2 genes have not undergone epigenetic inactivation,
transformation into ES cell-like pluripotent stem cells could be
effected.
[0016] Thus, the present invention provides the following (1) to
(35):
[0017] (1) A human pluripotent stem cell having an in vitro
long-term self-renewal ability and the pluripotency of
differentiating into ectoderm, mesoderm and endoderm, that was
induced from an undifferentiated stem cell present in a human
postnatal tissue in which each gene of Tert, Nanog, Oct3/4 and Sox2
has not undergone epigenetic inactivation.
[0018] (2) The human pluripotent stem cell according to the above
(1) induced from an undifferentiated stem cell present in a human
postnatal tissue, wherein said undifferentiated stem cell present
in the human postnatal tissue was subjected to a primary culture or
a second subculture, or a subculture in a low serum
concentration.
[0019] (3) The human pluripotent stem cell according to the above
(1) induced by the forced expression of each of three genes of
Oct3/4, Sox2 and Klf4 in an undifferentiated stem cell present in a
human postnatal tissue, wherein said undifferentiated stem cell
present in the human postnatal tissue was subjected to a primary
culture or a second subculture or to a subculture in a low serum
concentration.
[0020] (4) The human pluripotent stem cell according to the above
(1) induced by the forced expression of each of four genes of
Oct3/4, Sox2, Klf4 and c-Myc in an undifferentiated stem cell
present in a human postnatal tissue, wherein said undifferentiated
stem cell present in the human postnatal tissue was subjected to a
primary culture or a second subculture or to a subculture in a low
serum concentration.
[0021] (5) The human pluripotent stem cell according to the above
(1) induced by combining the forced expression of each of three
genes of Oct3/4, Sox2 and Klf4 and a histone deacetylase inhibitor
treatment in an undifferentiated stem cell present in a human
postnatal tissue, wherein said undifferentiated stem cell present
in the human postnatal tissue was subjected to a primary culture or
a second subculture or to a subculture in a low serum
concentration.
[0022] (6) The human pluripotent stem cell according to the above
(1) induced by combining the forced expression of each of three
genes of Oct3/4, Sox2 and Klf4 and a MS-275 treatment in an
undifferentiated stem cell present in a human postnatal tissue,
wherein said undifferentiated stem cell present in the human
postnatal tissue was subjected to a primary culture or a second
subculture or to a subculture in a low serum concentration.
[0023] (7) The human pluripotent stem cell according to any one of
the above (2) to (6) wherein FGF-2 is further used in the culture
of said undifferentiated stem cell.
[0024] (8) The human pluripotent stem cell according to any one of
the above (2) to (6) wherein PDGF and FGF are further used in the
culture of said undifferentiated stem cell.
[0025] (9) The human pluripotent stem cell according to any one of
the above (2) to (8) wherein the culture of said undifferentiated
stem cell is further conducted in a lower density.
[0026] (10) The human pluripotent stem cell according to any one of
the above (1) to (9) wherein said human pluripotent stem cell is
positive for Nanog.
[0027] (11) The human pluripotent stem cell according to any one of
the above (1) to (10) wherein said human pluripotent stem cell is
positive for alkaline phosphatase staining.
[0028] (12) The human pluripotent stem cell according to any one of
the above (1) to (11) wherein said human pluripotent stem cell is
positive for Tert.
[0029] (13) The human pluripotent stem cell according to any one of
the above (1) to (12) wherein said human pluripotent stem cell
comes to have teratoma-forming potential when it is transplanted
into a test animal.
[0030] (14) The human pluripotent stem cell according to any one of
the above (1) to (13) wherein said human postnatal tissue is a
tissue immediately after birth.
[0031] (15) The human pluripotent stem cell according to any one of
the above (1) to (13) wherein said human postnatal tissue is a
tissue immediately after birth and is a tissue derived from a
neonatal tissue or an umbilical cord tissue.
[0032] (16) The human pluripotent stem cell according to any one of
the above (1) to (13) wherein said human postnatal tissue is a
tissue immediately after birth and is a tissue derived from a
neonatal skin or a blood vessel derived from the umbilical
cord.
[0033] (17) The human pluripotent stem cell according to any one of
the above (1) to (16) wherein said human pluripotent stem cell
further has an in vitro potential of differentiating into a
primordial germ cell.
[0034] (18) An undifferentiated stem cell present in a human
postnatal tissue, in which each gene of Tert, Nanog, Oct3/4 and
Sox2 has not undergone epigenetic inactivation and which can be
induced into a human pluripotent stem cell having an in vitro
long-term self-renewal ability and the pluripotency of
differentiating into ectoderm, mesoderm and endoderm by the forced
expression of each of three genes of Oct3/4, Sox2 and Klf4.
[0035] (19) An undifferentiated stem cell present in a human
postnatal tissue, in which each gene of Tert, Nanog, Oct3/4 and
Sox2 has not undergone epigenetic inactivation and which can be
induced into a human pluripotent stem cell having an in vitro
long-term self-renewal ability and the pluripotency of
differentiating into ectoderm, mesoderm and endoderm by the forced
expression of each of four genes of Oct3/4, Sox2, Klf4 and
c-Myc.
[0036] (20) An undifferentiated stem cell present in a human
postnatal tissue, in which each gene of Tert, Nanog, Oct3/4 and
Sox2 has not undergone epigenetic inactivation and which can be
induced into a human pluripotent stem cell having an in vitro
long-term self-renewal ability and the pluripotency of
differentiating into ectoderm, mesoderm and endoderm by combining
the forced expression of each of three genes of Oct3/4, Sox2 and
Klf4 and a histone deacetylase inhibitor treatment.
[0037] (21) An undifferentiated stem cell present in a human
postnatal tissue, in which each gene of Tert, Nanog, Oct3/4 and
Sox2 has not undergone epigenetic inactivation and which can be
induced into a human pluripotent stem cell having an in vitro
long-term self-renewal ability and the pluripotency of
differentiating into ectoderm, mesoderm and endoderm by combining
the forced expression of each of three genes of Oct3/4, Sox2 and
Klf4 and a MS-275 treatment.
[0038] (22) The undifferentiated stem cell present in a human
postnatal tissue according to any one of the above (18) to (21),
wherein said human postnatal tissue is a tissue immediately after
birth.
[0039] (23) The undifferentiated stem cell present in a human
postnatal tissue according to any one of the above (18) to (21),
wherein said human postnatal tissue is a tissue immediately after
birth and is a tissue derived from a neonatal tissue or an
umbilical cord tissue.
[0040] (24) The undifferentiated stem cell present in a human
postnatal tissue according to any one of the above (18) to (21),
wherein said human postnatal tissue is a tissue immediately after
birth and is a tissue derived from a neonatal skin or a blood
vessel of the umbilical cord.
[0041] (25) The undifferentiated stem cell present in a human
postnatal tissue according to any one of the above (18) to (24),
wherein said human pluripotent stem cell further has an in vitro
potential of differentiating into a primordial germ cell.
[0042] (26) A method of inducing a human pluripotent stem cell
wherein an undifferentiated stem cell present in a human postnatal
tissue, in which each gene of Tert, Nanog, Oct3/4 and Sox2 has not
undergone epigenetic inactivation, is subjected to a primary
culture or a second subculture or to a third or fourth subculture
in a low serum concentration at 0 to 5%, and then each of three
genes of Oct3/4, Sox2 and Klf4 is subjected to forced
expression.
[0043] (27) The method of inducing a human pluripotent stem cell
according to the above (26), wherein each of four genes comprising
each of three genes of Oct3/4, Sox2 and Klf4 plus c-Myc is
subjected to forced expression.
[0044] (28) The method of inducing a human pluripotent stem cell
according to the above (26), wherein the forced expression of each
of three genes of Oct3/4, Sox2 and Klf4 is combined with a histone
deacetylase inhibitor treatment.
[0045] (29) The method of inducing a human pluripotent stem cell
according to the above (26), wherein the forced expression of each
of three genes of Oct3/4, Sox2 and Klf4 is combined with a MS-275
treatment.
[0046] (30) The method of inducing a human pluripotent stem cell
according to any one of the above (26) to (29), wherein said
undifferentiated stem cell is cultured in the presence of
FGF-2.
[0047] (31) The method of inducing a human pluripotent stem cell
according to any one of the above (26) to (29), wherein said
undifferentiated stem cell is cultured in the presence of PDGF and
EGF
[0048] (32) The method of inducing a human pluripotent stem cell
according to any one of the above (26) to (31), wherein said human
postnatal tissue is a tissue immediately after birth.
[0049] (33) The method of inducing a human pluripotent stem cell
according to any one of the above (26) to (31), wherein said human
postnatal tissue is a tissue immediately after birth and is a
tissue derived from a neonatal tissue or an umbilical cord
tissue.
[0050] (34) The method of inducing a human pluripotent stem cell
according to any one of the above (26) to (31), wherein said human
postnatal tissue is a tissue immediately after birth and is a
tissue derived from a neonatal skin or a blood vessel of the
umbilical cord.
[0051] (35) A method of culturing a human pluripotent stem cell
according to any one of the above (1) to (17) in a culture medium
comprising an inhibitor of Rho associated kinase as an active
ingredient.
[0052] (36) The human pluripotent stem cell according to anyone of
the above (1) to (17) on which cell surface antigens SSEA-3,
SSEA-4, TRA-1-60, TRA-1-81, CD9, CD24, and CD90 are expressed.
[0053] The undifferentiated stem cells of the present invention
present in a human postnatal tissue refer to stem cells that have
not undergone epigenetic modification by heterochromatin formation
due to DNA methylation or histone modification of at least four
genes of Nanog, Oct3/4, Sox2 and Tert among the primordial cells in
the tissue of various somatic stem cells established in vitro, such
as mesenchymal stem cells, MAPCs and MIAMI cells. When human
pluripotent stem cells are induced from undifferentiated stem cells
present in a human postnatal tissue, each gene of Tert, Nanog,
Oct3/4 and Sox2 is activated (expressed).
[0054] Mesenchymal stem cells refer to those cells having the
potential of differentiating into mesenchymal cells (bone,
cartilage, fat) among the cells (interstitial cells) obtained as
nonhematopoietic cells that are adherent to a plastic culture tray
when tissues of bone marrow, fat, muscle, skin etc. are cultured in
a culture medium containing a high-concentration serum (5% or
more). Thus, mesenchymal stem cells are the cells obtained by the
above culturing, and thus their properties are different from those
of the undifferentiated cells (stem cells in which at least four
genes of Nanog, Oct3/4, Sox2 and Tert have not undergone epigenetic
modification by heterochromatin formation due to DNA methylation or
histone modification, among the primordial cells in the tissue of
somatic stem cells established in vitro, such as mesenchymal stem
cells, MAPCs and MIAMI cells) immediately after isolation from
human postnatal tissues.
[0055] However, even under the condition of culturing mesenchymal
stem cells, MAPCs and MIAMI cells, a very small number of the
undifferentiated cells can be maintained depending on the culture
conditions of a small passage number or low-density culturing. As
the human postnatal tissues of the present invention, there can be
mentioned each tissue at various timings during the period from the
birth of an individual to its death (bone marrow fluid, muscle,
adipose tissue, peripheral blood, skin, skeletal muscle etc.) and
tissues concomitant to birth such as cord tissues (umbilical cord,
cord blood), the amnion, the placenta and the like, preferably
there can be mentioned tissues (bone marrow fluid, muscle, adipose
tissue, peripheral blood, skin, skeletal muscle etc.) immediately
after birth such as various neonatal tissues, and more preferably
there can be mentioned various neonatal tissues such as neonatal
skin and cord tissues (umbilical cord, cord blood) such as tissues
derived from cord-derived blood vessels.
[0056] Undifferentiated stem cells present in the human postnatal
tissues of the present invention can be cultured for a certain
period from a primary culture in a culture medium containing or not
containing a low concentration serum (preferably 2% or less) and to
which cell growth factors (PDGF, EGF, FGF-2 etc.) have been added
or not added, and have properties different from those of
mesenchymal stem cells that are characterized by a long time
culturing in the serum (concentrations exceeding 5%).
[0057] As the above cell growth factors, there can be mentioned
FGF-2, PDGF, EGF, IGF, insulin, TGFb-1, activin A, noggin, BDNF,
NGF, NT-1, NT-2, NT-3 and the like, and the addition of FGF-2 alone
or the addition of both PDGF and EGF is preferred. The above FGF-2
stands for basic fibroblast growth factor, PDGF stands for
platelet-derived growth factor, EGF stands for epidermal growth
factor, IGF stands for insulin-like growth factor, TGF .beta.-1
stands for transforming growth factor .beta.-1, BDNF stands for
brain-derived neurotrophic factor, NGF stands for nerve growth
factor, NT-1 stands for neurotrophin-1, NT-2 stands for
neurotrophin-2, and NT-3 stands for neurotrophin-3.
[0058] The above primary culture represents immediately after
isolation from a human, the primary culture cells subcultured once
represent the second subculture, the primary culture cells
subcultured twice represent the third subculture, and the primary
culture cells subcultured three times represent the fourth
subculture. Culturing for a certain period from the above primary
culture generally means from the primary culture to the fourth
subculture, preferably from the primary culture to the second
subculture.
[0059] Human pluripotent stem cells induced from undifferentiated
stem cells present in a human postnatal tissue in which the Tert,
Nanog, Oct3/4 and Sox2 genes have not undergone epigenetic
inactivation represent stem cells that have a long-term
self-renewal ability under the condition for culturing human ES
cells and an in vitro pluripotency of differentiating into
ectoderm, mesoderm and endoderm under the condition for inducing in
vitro differentiation of human ES cells, and the above human
pluripotent stem cells may further have a potential of
differentiating into primordial germ cells under the condition for
inducing in vitro differentiation of human ES cells. Also human
pluripotent stem cells of the present invention induced from
undifferentiated stem cells present in a human postnatal tissue in
which the Tert, Nanog, Oct3/4 and Sox2 genes have not undergone
epigenetic inactivation may be stem cells that have an ability of
forming teratoma when transplanted into a test animal such as
mouse.
[0060] The low concentration serum encompassed by the present
invention is generally serum at a concentration of 5% or less,
preferably serum at a concentration of 2% or less, and the low
density as used herein is a concentration of about 10% or less.
[0061] As the method of alkaline phosphatase staining, the
following method may be mentioned. Thus, after removing the culture
liquid from each well, the cells are fixed in a 10% formaldehyde
solution at room temperature for 2 to 5 minutes, washed with a
phosphate buffer etc., a solution of nitroblue tetrazolium
chloride/5-bromo-4-chloro-3'-indolyl phosphate p-toluidine salt
(hereinafter referred to as the NBT/BCIP solution), a chromogenic
substrate of alkaline phosphatase, is added, and reacted at room
temperature for 20-30 minutes.
[0062] The human pluripotent stem cells were expressed cell surface
antigens SSEA-3, SSEA-4, TRA-1-60, TRA-1-81, CD9, CD24, and CD90,
and ES cell marker genes Nanog, Oct3/4, TDGF1, Dnmt3b, GABRB3,
GDF3, Zfp42, ALP, CD9, and Thy-1. The promoter regions of Nanog and
Oct3/4 in the human pluripotent stem cells were demethylated
compared to the parental fibroblasts. The human pluripotent stem
cells carries at least a single copy of Oct3/4, Sox2, Klf4, and
c-Myc transgene. The induced human pluripotent stem cells and the
parental cells (undifferentiated stem cell present in a human
postnatal tissue) had almost the same SNP genotype each other, and
HLA type of the induced human pluripotent stem cell was completely
identical to that of the parental cell (undifferentiated stem cell
present in a human postnatal tissue).
[0063] A histone deacetylase inhibitor and MS-275 and a treatment
method using them are as describe later:
[0064] The method of forced expression as used herein comprises a
method for external expression in which a gene is expressed by
introducing it with a vector etc. and a method for internal
expression in which internal expression is promoted by the
stimulation of a drug etc. Furthermore, forced expression as used
herein also encompasses a method in which the genes of Oct3/4,
Sox2, Klf4 and c-Myc are extracellularly expressed, and then the
proteins produced of Oct3/4, Sox2, Klf4 and c-Myc are introduced
directly into the cell using a method for introducing protein. As
the method for introducing protein, there can be mentioned in case
of a method that employs a commercially available carrier reagent
(Chariot, BioPorter, GenomONE), the PTD (protein transduction
domain) fusion protein method, the electroporation method, the
microinjection method and the like. The external expression method
in which each gene of Oct3/4, Sox2, Klf4 and c-Myc is introduced
into a vector etc. for forced expression is as follows:
[0065] The present invention will now be explained in detail
below.
1. A Method of Separating a Cell Fraction that Contains
Undifferentiated Stem Cells from Human Postnatal Bone Marrow
[0066] As a method of obtaining the undifferentiated stem cells of
the present invention present in human postnatal tissue from human
bone marrow, the following method may be mentioned.
[0067] In order to harvest a bone marrow fluid from human bone
marrow, the donor is given a general anesthetic, then placed on a
prone position, and from the posterior border of the ilium, a
needle called the bone marrow collection needle is stuck directly
into the skin to lead the needle through the iliac surface to the
bone marrow, and the liquid of the bone marrow is aspirated with a
syringe. In order to obtain undifferentiated stem cells from the
bone marrow fluid, the mononuclear cell fraction separated by
density centrifugation is collected. The collected cell fraction,
as crude purified cells containing the undifferentiated stem cells,
is cultured according to the method described in 6, and used for
the induction of human pluripotent stem cells of the present
invention.
2. A Method of Separating a Fraction that Contains Undifferentiated
Stem Cells from Human Postnatal Skin
[0068] As a method of obtaining the undifferentiated stem cells of
the present invention present in human postnatal tissue from human
skin, the following method may be mentioned.
[0069] From the back of a human knee or the buttock, a skin tissue
containing the epidermis and the dermis is harvested. This skin
tissue is immersed in 0.6% trypsin (manufactured by
Invitrogen)/DMEM (Dulbecco's Modified Eagle's Medium)/F-12
(manufactured by Invitrogen)/1% antibiotics, antimycotics
(manufactured by Invitrogen) with the inner side of the skin facing
downward, and treated at 37.degree. C. for 30 minutes.
[0070] After the skin tissue is turned over to scrub slighly the
inner side with tweezers, the skin tissue is finely cut into about
1 mm.sup.2 sections using scissors, which are then centrifuged at
1200 rpm and room temperature for 10 minutes. The supernatant is
removed, and to the tissue precipitate is added 25 ml of 0.1%
trypsin/DMEM/F-12/1% antibiotics, antimycotics, and stirred using a
stirrer at 37.degree. C. and 200-300 rpm for 40 minutes. After
confirming the tissue precipitate was fully digested, 3 ml fetal
bovine serum (FBS) (manufactured by JRH) is added, and filtered
sequentially with gauze (Type I manufactured by PIP), a 100 .mu.m
nylon filter (manufactured by FALCON) and a 40 .mu.m nylon filter
(manufactured by FALCON). After centrifuging at 1200 rpm and room
temperature for 10 minutes to remove the supernatant, DMEM/F-12/1%
antibiotics, antimycotics is added to wash the precipitate, and
then centrifuged at 1200 rpm and room temperature for 10 minutes.
The cell faction thus obtained may be cultured according to the
method described in 6. below as crude purified cells containing
undifferentiated stem cells, and used for the induction of human
pluripotent stem cells of the present invention.
3. A Method of Separating a Fraction that Contains Undifferentiated
Stem Cells from a Human Postnatal Skeletal Muscle
[0071] As a method of obtaining the undifferentiated stem cells of
the present invention present in human postnatal tissue from human
skeletal muscle, the following method may be mentioned.
[0072] After the epidermis and a connective tissue containing
muscle such as a lateral head of biceps brachii muscle and a
sartorius muscle of the leg is cut and the muscle is excised, it is
sutured. The whole muscle obtained is minced with scissors or a
scalpel, and then suspended in DMEM (high glucose) containing 0.06%
collagenase type IA (manufactured by SIGMA) and 10% FBS, and
incubated at 37.degree. C. for 2 hours.
[0073] By centrifugation, cells are collected from the minced
muscle, and suspended in DMEM (high glucose) containing 10% FBS.
After passing the suspension through a microfilter with a pore size
of 40 .mu.m and then a microfilter with a pore size of 20 .mu.m,
the cell fraction obtained may be cultured according to the method
described in 6. below as crude purified cells containing
undifferentiated stem cells, and used for the induction of human
pluripotent stem cells of the present invention.
4. A Method of Separating a Cell Fraction that Contains
Undifferentiated Stem Cells from a Human Postnatal Adipose
Tissue
[0074] As a method of obtaining the undifferentiated stem cells of
the present invention present in human postnatal tissue from human
postnatal adipose tissue, the following method may be
mentioned.
[0075] Cells derived from adipose tissue for use in the present
invention may be isolated by various methods known to a person
skilled in the art. For example, such a method is described in U.S.
Pat. No. 6,153,432, which is incorporated herein in its entirety. A
preferred source of adipose tissue is omental adipose tissue. In
humans, adipose cells are typically isolated by fat aspiration.
[0076] In one method of isolating cells derived from adipose cells,
adipose tissue is treated with 0.01% to 0.5%, preferably 0.04% to
0.2%, and most preferably about 0.1% collagenase, 0.01% to 0.5%,
preferably 0.04%, and most preferably about 0.2% trypsin and/or 0.5
ng/ml to 10 ng/ml dispase, or an effective amount of hyaluronidase
or DNase (DNA digesting enzyme), and about 0.01 to about 2.0 mM,
preferably about 0.1 to about 1.0 mM, most preferably 0.53 mM
concentration of ethylenediaminetetraacetic acid (EDTA) at 25 to
50.degree. C., preferably 33 to 40.degree. C., and most preferably
37.degree. C. for 10 minutes to 3 hours, preferably 30 minutes to 1
hour, and most preferably 45 minutes.
[0077] Cells are passed through nylon or a cheese cloth mesh filter
of 20 microns to 800 microns, more preferably 40 microns to 400
microns, and most preferably 70 microns. Then the cells in the
culture medium are subjected to differential centrifugation
directly or using Ficoll or Percoll or another particle gradient.
The cells are centrifuged at 100 to 3000.times.g, more preferably
200 to 1500.times.g, most preferably 500.times.g for 1 minute to 1
hours, more preferably 2 to 15 minutes and most preferably 5
minutes, at 4 to 50.degree. C., preferably 20 to 40.degree. C. and
more preferably about 25.degree. C.
[0078] The adipose tissue-derived cell fraction thus obtained may
be cultured according to the method described in 6. below as crude
purified cells containing undifferentiated stem cells, and used for
the induction of human pluripotent stem cells of the present
invention.
5. A Method of Separating a Cell Fraction that Contains
Undifferentiated Stem Cells from a Human Postnatal Peripheral Blood
or Human Cord Blood
[0079] As a method of obtaining the undifferentiated stem cells of
the present invention present in human postnatal tissue from human
postnatal peripheral blood or human cord blood, the following
method may be mentioned.
[0080] First, from the vein or cord blood, about 50 ml to 500 ml of
blood is harvested to collect cells, and mononuclear cells are
collected by the Ficoll-Hypaque method [Kanof, M. E. and Smith, P.
D. 1993 Isolation of whole mononuclear cells from peripheral blood.
in Current Protocols in Immunology (J. E. Coligan, A. M. Kruisbeek,
D. H. Margulies, E. M. Shevack, and W. Strober, eds.), pp.
7.1.1.-7.1.5, John Wiley & Sons, New York].
[0081] Then, about 1.times.10.sup.7 to 1.times.10.sup.8 human
peripheral blood mononuclear cells are suspended in a RPMI 1640
medium (manufactured by Invitrogen) (hereinafter referred to as an
essential medium for culturing peripheral blood stem cells)
containing 10% fetal bovine serum (manufactured by JRH
Biosciences), 100 .mu.g/ml streptomycin and 100 units/ml penicillin
(manufactured by Invitrogen), and after washing twice, the cells
are recovered. The recovered cells are suspended again in the
essential medium for culturing peripheral blood stem cells, which
is then plated in a 100 mm plastic culture dish at 1.times.10.sup.7
cells/dish, and incubated in a 37.degree. C. incubator under a
condition of 8% CO.sub.2. After 10 hours, suspended cells are
removed and the attached cells are only harvested by pipetting.
[0082] The peripheral blood-derived or cord blood-derived adherent
cell fraction thus obtained may be cultured according to the method
described in 6. below as crude purified cells containing
undifferentiated stem cells, and used for the induction of human
pluripotent stem cells of the present invention.
6. A Method of Culturing Undifferentiated Stem Cells Present in a
Human Postnatal Tissue
[0083] Examples of culture media useful in culturing the
undifferentiated stem cells of the present invention present in a
human postnatal tissue include the ES medium [40% Dulbecco's
Modified Eagle's Medium (DMEM), 40% F12 medium, 2 mM L-glutamine,
1% non-essential amino acids, 0.1 mM .beta.-mercaptoethanol (the
above are manufactured by SIGMA), 20% Knockout Serum Replacement
(manufactured by Invitrogen), 10 .mu.g/ml gentamycin (manufactured
by Invitrogen)] (hereinafter referred to as the ES medium), the
MAPC medium [60% Dulbecco's Modified Eagle's Medium-low glucose
(manufactured by Invitrogen), 40% MCDB 201 (manufactured by
Invitrogen), 1.times.ITS medium supplement (manufactured by SIGMA),
1.times. linolenic acid albumin (manufactured by SIGMA), 1 nM
dexamethasone (manufactured by SIGMA), 10.sup.-4 M ascorbic acid
(manufactured by SIGMA), 10 .mu.g/ml gentamycin (manufactured by
Invitrogen), 2% fetal bovine serum (manufactured by Invitrogen)]
(hereinafter referred to as the MAPC medium), the FBM medium
(manufactured by Lonza) [MCDB202 modified medium, 2% fetal bovine
serum, 5 .mu.g/ml insulin, 50 .mu.g/ml gentamycin, 50 ng/ml
amphotericin-B] (hereinafter referred to as the FBM medium), and
the like.
[0084] As "growth factors, cytokines, hormones" to be added to the
above culture medium, there can be mentioned FGF-2, PDGF, EGF, IGF,
insulin, TGFb-1, activin A, Noggin, BDNF, NGF, NT-1, NT-2, NT-3 and
the like.
[0085] In order to induce human pluripotent stem cells of the
present invention efficiently form the undifferentiated stem cells
of the present invention present in a human postnatal tissue,
preferably the cell fraction obtained by the above methods 1. to 5.
is cultured in a medium containing the above additives for about 1
to 12 days at a low density of about 10.sup.3 cells/cm.sup.2 to
10.sup.4 cells/cm.sup.2.
7. A Method of Inducing Human Pluripotent Stem Cells from
Undifferentiated Stem Cells Present in a Human Postnatal Tissue
[0086] In order to induce the human pluripotent stem cells of the
present invention from the undifferentiated stem cells of the
present invention present in a human postnatal tissue cultured
according to the method described in 6., it is necessary to
introduce the c-Myc gene or a histone deacetylase inhibitor, in
addition to the three genes of Oct3/4, Sox2 and Klf4, to the
undifferentiated stem cells of the present invention present in a
human postnatal tissue cultured according to the method described
in 6.
[0087] As virus vectors that can be used for introducing a gene
into the undifferentiated stem cells of the present invention
present in a human postnatal tissue, there can be mentioned
retrovirus vectors (including lentivirus vectors), adenovirus
vectors and the like, and preferably adenovirus vectors are used to
introduce a mouse-derived cationic amino acid transporter (mCAT)
gene, and then a retrovirus vector is used to introduce the Oct3/4,
Sox2, Klf4 and c-Myc genes.
[0088] As virus vector plasmids, there can be mentioned pMXs,
pMXs-IB, pMXs-puro, pMXs-neo (pMXs-IB is a vector carrying the
blasticidin-resistant gene in stead of the puromycin-resistant gene
of pMXs-puro) [Experimental Hematology, 2003, 31 (11): 1007-14],
MFG [Proc. Natl. Acad. Sci. U.S.A. 92, 6733-6737 (1995)], pBabePuro
[Nucleic Acids Research 18, 3587-3596 (1990)], LL-CG, CL-CG, CS-CG,
CLG [Journal of Virology 72: 8150-8157 (1998)] and the like as the
retrovirus system, and pAdexl [Nucleic Acids Res. 23: 3816-3821
(1995)] and the like as the adenovirus system.
[0089] As packaging cells, any cells may be used that can supply a
lacking protein of a recombinant virus vector plasmid deficient in
at least one gene encoding a protein required for virus packaging.
For example, there can be used HEK-293 cells derived from human
kidney, packaging cells based on a mouse fibroblast NIH3T3, and the
like.
[0090] As proteins to be supplied by packaging cells, there can be
used retrovirus-derived proteins such as gag, pol, and env in the
case of retrovirus vectors, HIV-derived proteins such as gag, pol,
env, vpr, vpu, vif, tat, rev, and nef in the case of lentivirus
vectors, and adenovirus-derived proteins such as E1A and E1B in the
case of adenovirus vectors.
[0091] By introducing any of the above recombinant virus vector
plasmid into the above packaging cells, recombinant virus vectors
can be produced. As methods of introducing the above virus vector
plasmid into the above packaging cells, various gene introduction
methods are known including, but not limited to, the calcium
phosphate method [Kokai (Japanese Unexamined Patent Publication)
No. 2-227075], the lipofection method [Proc. Natl. Acad. Sci.
U.S.A. 84: 7413 (1987)], the electroporation method and the like,
and any suitable method may be used from the known gene
introduction methods.
[0092] As histone acetylase inhibitors, there can be mentioned
those described in the following A to E, and among them MS-275 is
preferred.
[0093] A. Trichostatin A and its analogs, for example: trichostatin
A (TSA); and trichostatin C (Koghe et al. 1998, Biochem. Pharmacol.
56: 1359-1364).
[0094] B. Peptides, for example: oxamflatin
[(2E)-5-[3-[(phenylsulfonyl)aminophenyl]-pent-2-ene-4-inohydroxamic
acid (Kim et al., Oncogene 18: 2461-2470 (1999)); Trapoxin A
(cyclo-(L-phenylalanyl-L-phenylalanyl-D-pipecolinyl-L-2-amino-8-oxo-9,10--
epoxy-decanoyl (Kijima et al., J. Biol. Chem. 268: 22429-22435
(1993)); FR901228, depsipeptide (Nakajima et al., Ex. Cell RES.
241: 126-133 (1998)); FR225497, cyclic tetrapeptide (H. Mori et
al., PCT International Patent Publication WO 00/08048 (Feb. 17,
2000)); apicidin, cyclic tetrapeptide
[cyclo-(N--O-methyl-L-tryptophanyl-L-isoleucinyl-D-pipecolinyl-L-2-amino--
8-oxodecanoyl)] (Darkin-Rattray et al., Proc. Natl. Acad. Sci.
U.S.A. 93: 13143-13147 (1996); apicidin Ia, apicidin Ib, apicidin
Ic, apicidin IIa, and apicidin IIb (P. Dulski et al., PCT
International Patent Publication WO 97/11366); HC-toxin, cyclic
tetrapeptide (Bosch et al., Plant Cell 7: 1941-1950 (1995));
WF27082, cyclic tetrapeptide (PCT International Patent Publication
WO 98/48825); and chlamydocin (Bosch et al., supra).
[0095] C. Hybrid polar compounds (HPC) based on hydroxamic acid,
for example: salicyl hydroxamic acid (SBHA) (Andrews et al.,
International J. Parasitology 30: 761-8 (2000)); suberoylanilide
hydroxamic acid (SAHA) (Richon et al., Proc. Natl. Acad. Sci.
U.S.A. 95: 3003-7 (1998)); azelaic bishydroxamic acid (ABHA)
(Andrews et al., supra); azelaic-1-hydroxamate-9-anilide (AAHA)
(Qiu et al., Mol. Biol. Cell 11: 2069-83 (2000)); M-carboxy
cinnamic acid bishydroxamide (CBHA) (Ricon et al., supra);
6-(3-chlorophenylureido) carpoic hydroxamic acid, 3-Cl-UCHA)
(Richon et al., supra); MW2796 (Andrews et al., supra); and MW2996
(Andrews et al., supra).
[0096] D. Short chain fatty acid (SCFA) compounds, for example:
sodium butyrate (Cousens et al., J. Biol. Chem. 254: 1716-23
(1979)); isovalerate (McBain et al., Biochem. Pharm. 53: 1357-68
(1997)); valproic acid; valerate (McBain et al., supra); 4-phenyl
butyric acid (4-PBA) (Lea and Tulsyan, Anticancer RESearch 15:
879-3 (1995)); phenyl butyric acid (PB) (Wang et al., Cancer
RESearch 59: 2766-99 (1999)); propinate (McBain et al., supra);
butylamide (Lea and Tulsyan, supra); isobutylamide (Lea and
Tulsyan, supra); phenyl acetate (Lea and Tulsyan, supra);
3-bromopropionate (Lea and Tulsyan, supra); tributyrin (Guan et
al., Cancer RESearch 60: 749-55 (2000)); arginine butyrate;
isobutyl amide; and valproate.
[0097] E. Benzamide derivatives, for example: MS-275
[N-(2-aminophenyl)-4-[N-(pyridine-3-yl-methoxycarbonyl)aminomethyl]benzam-
ide] (Saito et al., Proc. Natl. Acad. Sci. U.S.A. 96: 4592-7
(1999)); and a 3'-amino derivative of MS-275 (Saito et al., supra);
and CI-994.
[0098] A histone deacetylase inhibitor treatment may be carried
out, for example, as follows:
[0099] The concentration of the histone deacetylase inhibitor used
depends on a particular inhibitor, but is preferably 0.001 nM to
about 10 mM, and more preferably about 0.01 nM to about 1000 nM.
The effective amount or the dosage of a histone deacetylase
inhibitor is defined as the amount of the histone deacetylase
inhibitor that does not significantly decrease the survival rate of
cells, specifically undifferentiated stem cells. Cells are exposed
for 1 to 5 days or 1 to 3 days. The exposure period may be less
than one day. In a specific embodiment, cells are cultured for
about 1 to 5 days, and then exposed to an effective amount of a
histone deacetylase inhibitor. However, the histone deacetylase
inhibitor may be added at the start of culturing. Within such a
time frame, a gene-carrying vehicle such as a vector containing a
nucleic acid encoding three genes (Oct3/4, Sox2 and Klf4) is
introduced into cultured cells by a known method.
8. A Method of Culturing Human Pluripotent Stem Cells Induced From
Undifferentiated Stem Cells Present in a Human Postnatal Tissue
[0100] Examples of culture media useful for culturing human
pluripotent stem cells induced from undifferentiated stem cells
present in a human postnatal tissue of the present invention
include, but not limited to, the ES medium, and a culture medium
suitable for culturing human ES cells such as MEF-conditioned ES
medium (hereinafter referred to as the MEF-conditioned ES medium)
which is a supernatant obtained by adding 10 ng/ml FGF-2 to the ES
medium and then mouse embryonic fibroblasts (hereinafter referred
to as MEF) were added thereto and cultured for 24 hours to obtain
the supernatant.
[0101] As "growth factors, cytokines, hormones" to be added to the
above culture media, there can be mentioned ingredients involved in
the growth and maintenance of human ES cells including FGF-2,
TGFb-1, activin A, Nanoggin, BDNF, NGF, NT-1, NT-2, NT-3 and the
like. The addition of Y-27632 (Calbiochem; water soluble) or
Fasudil (HA1077: Calbiochem), an inhibitor of Rho associated kinase
(Rho associated coiled coil-containing protein kinase) is also
useful for culturing the human pluripotent stem cells of the
present invention.
[0102] In order to culture and grow human pluripotent stem cells
induced from the undifferentiated stem cells of the present
invention present in a human postnatal tissue, it is preferred that
the cells are subcultured every 5 to 7 days in a culture medium
containing the above additives on a MEF-covered plastic culture
dish or a matrigel-coated plastic culture dish to 1:3 to 1:6 or
plated at 10.sup.3 cells/cm.sup.2 to 3.times.10.sup.4
cells/cm.sup.2.
9. A Method of Storing Human Pluripotent Stem Cells Induced From
Undifferentiated Stem Cells Present in a Human Postnatal Tissue for
a Long Time
[0103] In order to store human pluripotent stem cells induced from
the undifferentiated stem cells of the present invention present in
a human postnatal tissue for a long time, the following method may
be mentioned.
[0104] After suspending the cells in the Cryopreservation Medium
For Primate ES Cells (manufactured by ReproCELL), they are rapidly
frozen in liquid nitrogen, and stored in a liquid nitrogen storage
vessel for a long time.
10. A Method of Treating Diseases Using Human Pluripotent Stem
Cells Induced from Undifferentiated Stem Cells Present in a Human
Postnatal Tissue
[0105] In order to apply human pluripotent stem cells induced from
the undifferentiated stem cells of the present invention present in
a human postnatal tissue to treatment of diseases, the following
method may be mentioned.
[0106] In order to apply human pluripotent stem cells induced from
the undifferentiated stem cells of the present invention present in
a human postnatal tissue to treatment of diseases caused by
degeneration or insufficient functions of various tissues, it is
desirable to harvest a tissue from an individual who wishes a
future treatment, and to construct a cell bank system for storing
stably undifferentiated stem cells present in a human postnatal
tissue or the human pluripotent stem cells of the present invention
induced from the undifferentiated stem cells.
[0107] Since undifferentiated stem cells present in a human
postnatal tissue are detected at high rates in young individuals,
preferred undifferentiated stem cells for the cell bank are cord
blood, the umbilical cord, the placenta, skin obtained from
neonates and the like. Even in adults, undifferentiated stem cells
for the cell bank may be harvested from the bone marrow, adipose
tissue, peripheral blood, skin and the like depending on the
physical status of the donor. The undifferentiated stem cells of
the present invention obtained from each donor may be stored frozen
as they are, or may be transformed into human pluripotent stem
cells according to the above-mentioned method of the present
invention prior to storing frozen.
[0108] The undifferentiated stem cells of the present invention or
the human pluripotent stem cells of the present invention thus
stored may be used for the treatment of the donor per se or of
immunohistologically compatible recipients as well. In treatment,
depending on the amount of cell replacement required for the
treatment of the subject disease, the human pluripotent stem cells
of the present invention must be subcultured according to the
method of the above 8. The required number of the human pluripotent
stem cells of the present invention obtained by subculturing can be
used for the treatment of various diseases by a method described
below.
[0109] Diseases of the central nervous system using the human
pluripotent stem cells of the present invention include Parkinson's
disease, Alzheimer's disease, multiple sclerosis, cerebral
infarction, spinal injury and the like. For the treatment of
Parkinson's disease, a therapeutic method is possible in which
human pluripotent stem cells are differentiated into
dopamine-acting neurons and then transplanted into the striate body
of the patient with Parkinson's disease. Differentiation into
dopamine-acting neurons can be effected by coculturing the PA6 cell
which is a mouse stromal cell line and the human pluripotent stem
cells of the present invention under a serum-free condition. For
the treatment of Alzheimer's disease, cerebral infarction and
spinal injury, a therapeutic method in which the human pluripotent
stem cells of the present invention are induced to differentiate
into neural stem cells followed by transplantation into the injured
site is effective.
[0110] In order to induce differentiation from the human
pluripotent stem cells of the present invention to neural stem
cells, three methods may be mentioned. In a first method, the human
pluripotent stem cells of the present invention are cultured in
suspension to form an embryoid body, and the embryoid body obtained
is cultured in a serum-free medium containing FGF-2 for use in the
culture of neural stem cells. In a second method, the human
pluripotent stem cells of the present invention are cocultured with
the PA6 cell which is a mouse stromal cell line, and then cultured
in a serum-free medium containing FGF-2 for use in the culture of
neural stem cells.
[0111] In a third method, the human pluripotent stem cells of the
present invention are transferred to a serum-free medium containing
FGF-2 to directly induce differentiation. In the treatment of
multiple sclerosis, treatment can be effected by further inducing
the differentiation of neural stem cells induced from the human
pluripotent stem cells of the present invention into
oligodendrocytes or progenitors of oligodendrocytes, which are then
transplanted to the injured site. As a method of inducing
oligodendrocytes or progenitors of oligodendrocytes from neural
stem cells induced from the human pluripotent stem cells of the
present invention, there can be mentioned a method of culturing
said neural stem cells in the presence of a fusion protein between
a soluble interleukin-6 receptor and interleukin-6.
[0112] The human pluripotent stem cells of the present invention
can be used for the treatment of hepatic diseases such as
hepatitis, cirrhosis and liver failure. In order to treat these
diseases, the human pluripotent stem cells of the present invention
are preferably differentiated to hepatic cells or hepatic stem
cells, and then are transplanted. Hepatic cells or hepatic stem
cells may be obtained by culturing the human pluripotent stem cells
of the present invention in the presence of activin A for 5 days,
and then culturing in the presence of the hepatocyte growth factor
(HGF) for about a week to obtain hepatic cell or hepatic stem
cells.
[0113] The human pluripotent stem cells of the present invention
can be used for the treatment of pancreatic diseases such as type I
diabetes mellitus. In the case of type I diabetes mellitus, the
human pluripotent stem cells of the present invention are
preferably differentiated to pancreatic beta cells, and then are
transplanted to the pancreas. The human pluripotent stem cells of
the present invention can be differentiated to pancreatic beta
cells in following six steps of culturing: (1) culturing in the
presence of a serum-free medium, activin A and Wnt protein for 1 to
2 days; (2) culturing in the presence of 0.2% FBS and activin A for
1 to 2 days; (3) culturing in the presence of 2% FBS, FGF-10 and
KAAD-cyclopamine (keto-N-aminoethylaminocaproyl
dihydrocinnamoylcyclopamine) for 2 to 4 days; (4) culturing in the
presence of 1% B27 (manufactured by Invitrogen), FGF-10,
KAAD-cyclopamine and retinoic acid for 2 to 4 days; (5) culturing
in the presence of 1% B27, gamma secretase inhibitor and extendin-4
for 2 to 3 days; (6) culturing in the presence of 1% B27,
extendin-4, IGF-1 and HGF for 3 days.
[0114] The human pluripotent stem cells of the present invention
can be used for the treatment of heart failure associated with
ischemic heart diseases. In treating heart failure, the human
pluripotent stem cells of the present invention are preferably
differentiated into cardiac muscle cells prior to transplanting to
the injured site. By adding noggin to the medium from three days
before forming an embryoid body, cardiac muscle cells can be
obtained from the human pluripotent stem cells of the present
invention in about 2 weeks after forming the embryoid body.
EFFECT OF THE INVENTION
[0115] The present invention provides for the first time human
pluripotent stem cells induced from undifferentiated stem cells
present in a human postnatal tissue and having an in vitro
long-term self-renewal ability and the pluripotency of
differentiating into ectoderm, mesoderm and endoderm, and further
said human pluripotent stem cells may have a potential of
differentiating into primordial germ cells.
[0116] Cells in a tissue that was lost in diseases etc. can be
supplied by inducing human pluripotent cells from the
undifferentiated stem cells harvested from a patient by using the
induction method of the present invention, followed by inducing to
differenciate into a necessary cell depending on diseases and then
transplanting the cells to the patient. The undifferentiated stem
cells of the present invention present in a human postnatal tissue
can be used to search drugs that promote the induction from said
undifferentiated stem cells to human pluripotent stem cells by
using markers such as Tert, Nanog, Sox2, Oct3/4 and alkaline
phosphatase that direct the induction to human pluripotent stem
cells. Said drugs can be used in stead of gene introduction and can
enhance the induction efficiency of human pluripotent stem
cells.
BRIEF DESCRIPTION OF DRAWINGS
[0117] FIG. 1: Four genes of Oct3/4, Sox2, Klf4 and c-Myc were
introduced into cells established under a low serum condition from
mononuclear cells derived from a human adult bone marrow, and RNA
was extracted from the colonies obtained, and the amount expressed
of the human Nanog and human Tert genes was demonstrated by
quantitative PCR. Fibroblasts and mesenchymal stem cells in which
the four genes were not introduced were used as the control in the
experiment. The amount expressed of the gene was expressed by a
relative value in which the amount expressed was normalized by the
amount expressed of the human HPRT gene, and by setting as one the
amount expressed of the gene in alkaline phosphatase-positive
colonies induced from a neonatal skin fibroblast established by
example 6. It was confirmed that the expression of Nanog and Tert
was significantly high in colonies in which four genes were
introduced and which were positive for alkaline phosphatase.
[0118] FIG. 2: Four genes of Oct3/4, Sox2, Klf4 and c-Myc were
introduced into the primary culture fibroblasts derived from a
neonatal skin, RNA was extracted from the colonies obtained, and
the amount expressed of the human Nanog and human Tert genes was
demonstrated by quantitative PCR. Its parental fibroblasts and
mesenchymal stem cells in which four genes were not introduced were
used as the control in the experiment. The amount expressed of
genes was normalized by the amount expressed of the human HPRT
gene, and further was expressed by a relative value by setting as
one the amount expressed of the gene in alkaline
phosphatase-positive colonies induced from a neonatal skin
fibroblast established by example 6. It was confirmed that the
expression of Nanog and Tert was significantly high in colonies in
which four genes were introduced and which were positive for
alkaline phosphatase.
[0119] FIG. 3: After three gene introduction and treatment with
MS-275 (0.1 or 1.0 .mu.M), a histone deacetylase (HDAC) inhibitor
by using cells derived from a mouse bone marrow established under a
low serum condition, RNA was extracted from the colonies obtained,
and the amount expressed of Nanog was demonstrated by quantitative
PCR. From the cells in which three genes were introduced and which
were treated with a histone deacetylase inhibitor, alkaline
phosphatase-positive cell group (colonies) was formed, and it was
confirmed that the expression of Nanog in these colonies was
significantly higher than the alkaline phosphatase-negative
colonies.
[0120] In the figure, W1, W2, W3, W4, W5 and W6 represent the
number of each well of the 6-well plate used in Example 12.
[0121] FIG. 4: Figure shows the characterization of human iPS clone
1-8. a-e, Morphology of its parental fibroblast (lot. 5F0438) (a),
human iPS clone 1-8 cells cultured on MEF feeder cells (b), human
iPS clone 1-8 cells in mTeSR1 medium (c), clone 2-4 cells (d), and
clone 3-2 cells (e) in mTeSR1 medium. f-g, Growth curve of clone
1-8. Arrows indicate the dates of examinations. Square indicates
the period for counting cell numbers to estimate cell proliferation
rate. h, Multicolor karyogram image indicates normal karyotype of
iPS clone 1-8 derived cell at day 101.
[0122] FIG. 5: Figure shows characterization of transcription
factor, cell surface antigens and alkaline phosphatase activity in
human iPS clone 1-8 cell. a-h, Immunohistochemical staining of
human iPS cells (clone 1-8) with Nanog (a), SSEA-3 (b), SSEA-4 (c),
TRA-1-60 (d), TRA-1-81 (e), CD9 (f), CD24 (g), Thy-1 (also called
CD90) (h). Green fluorescent staining indicates that human iPS
clone 1-8 expresses all of these surface antigens. i, Alkaline
phosphatase staining indicates that iPS clone 1-8 is alkaline
phosphatase positive.
[0123] FIG. 6: Figure shows gene expression analysis of human iPS
clone 1-8 cells. a, RT-PCR analysis of hES marker gene expression
in clone 1-8 and its parental fibroblast (NeoFB). Genes were
detected at 30 cycles except for CYP26A1 (35 cycles). b, Silencing
of four transgenes in clone 1-8. Crude fibroblasts obtained on 17
days after gene transduction were used as control. "exo" primer
sets selectively detected exogenous expression and "total" primer
sets included endogenous expression.
[0124] FIG. 7: Figure shows global gene expression analysis of
human iPS clonel-8 cells. Scatter plots show comparison of global
gene expression between human iPS clone-1-8 cells cultured in mTeSR
and H14 hES cells with MEFs (GSM151741 from public database
GEO)(a), or between clone 1-8 and its parental fibroblasts (b).
Symbols of ES cell specific genes were pointed with lines in both
scatter plots. Expression intensity was shown in colorimetric order
from red (high) to green (low).
[0125] FIG. 8: Figure shows global gene expression analysis by gene
trees. Cells were clustered in the gene tree based on a set of
genes by the International Stem Cell Initiative (except PTF1A
because of no array in the chip). Samples were designated 1-8 mTeSR
for clone-1-8 cultured in mTeSR, 1-8CM for clone 1-8 cultured in
MEF-conditioned medium, 5F0438 for the parental fibroblasts, hES1,
hES2, hES3 (GSM194307, GSM194308, GSM194309) for Sheff 4 line
cultured on MEF, hES4, hES5 (GSM194313, GSM194314) for Sheff 4 line
cultured on matrigel, hES6, hES7 (GSM151739, GSM151741) for H14
line cultured on MEF, Fibroblasts1 for GSM96262, Fibroblasts2 for
GSM96263, and Fibroblasts3 for GSM96264, respectively. Expression
intensity was shown in colorimetric order from red (high) to green
(low).
[0126] FIG. 9: Figure shows global gene expression analysis by gene
trees. Cells were clustered in the gene tree based on a set of
genes correlated with Nanog gene expression in human ES cells
(seven GEO data) between the ratio of 0.99 and 1 when compared with
fibroblasts (three GEO data). Samples were designated 1-8 mTeSR for
clone-1-8 cultured in mTeSR, 1-8CM for clone 1-8 cultured in
MEF-conditioned medium, 5F0438 for the parental fibroblasts, hES1,
hES2, hES3 (GSM194307, GSM194308, GSM194309) for Sheff 4 line
cultured on MEF, hES4, hES5 (GSM194313, GSM194314) for Sheff 4 line
cultured on matrigel, hES6, hES7 (GSM151739, GSM151741) for H14
line cultured on MEF, Fibroblasts1 for GSM96262, Fibroblasts2 for
GSM96263, and Fibroblasts3 for GSM96264, respectively. Expression
intensity was shown in colorimetric order from red (high) to green
(low).
[0127] FIG. 10: The parts of the Oct3/4 promoter including the
distal enhancer (Oct3/4-Z1) and the proximal promoter region
(Oct3/4-Z2) and the parts of the Nanog promoter including the
proximal promoter region (Nanog-Z1, -Z2) were analyzed for the
methylation of CpG (a). Ratio of methylation on CpG shown by circle
is indicated by the percentage (b).
[0128] FIG. 11: Figure shows teratoma that was derived from human
iPS-1-8 mTeSR cells cultured for 94 days. Human iPS-1-8 mTeSR cells
were injected into SCID mouse testes and analyzed 56 days after
injection. a, HE and alcian blue staining of formaldehyde fixed
teratoma tissues. The teratomas contained tissues representative of
the three germ layers. ne: neural epitherium, ca: cartilage, et:
endodermal tract. b-d, tissues originated from transplant were
distinguished from host tissues by HuNu staining. Nestin expressing
neural epitherium (b), Collagen II expressing chondrocyte (c),
alpha-fetoprotein expressing endodermal tract (d).
[0129] FIG. 12: Figure shows teratoma formation. Teratoma 1 (T-1)
was derived from human iPS-1-8 mTeSR cells cultured for 94 days.
The human iPS-1-8 mTeSR cells were injected into SCID mouse testes
and analyzed 56 days after injection. Teratoma 2 (T-2) was derived
from human iPS-1-8 mTeSR cells cultured for 102 days. The human
iPS-1-8 mTeSR cells were injected into SCID mouse testes and
analyzed 48 days after injection. In teratoma-1 (T-1), smooth
muscle cells (positive for .alpha.-SMA) and secretary epithelium
(positive for MUC-1) were observed in addition to three germ layers
observed in FIG. 11.
[0130] FIG. 13: Figure shows teratoma formation. Teratoma 3 (T3)
was derived from human iPS-1-8 mTeSR cells cultured for 114 days.
Human iPS-1-8 mTeSR cells were injected into SCID mouse testis and
analyzed 42 days after injection. Three germ layers similar to
FIGS. 11 and 12 were observed.
[0131] T-F1 and F2 figure shows teratoma that were derived from
freeze-thawed iPS-1-8 mTeSR cells cultured for 134 days (passage
19). Human iPS-1-8 mTeSR cells were injected into SCID mouse testes
and analyzed 46 days (T-F1) and 48 days (T-F2) after injection.
Tissues consisting of three germ layers were observed. Melanocytes
were also observed in T-F2 experiment. Pluripotency were maintained
even via freezing and thawing.
[0132] FIG. 14: Figure shows the existence of four transgenes in
human iPS clone 1-8. Oct3/4, Sox2, and Klf4 transgenes were
detected by Southern blot analysis. Human iPS clone-1-8 was
estimated to have approximately ten copies of both Oct3/4
transgenes and Sox2 transgenes, and a single copy of Klf4
transgene. Genomic PCR proved c-Myc transduction. Primer set was
designed to include whole second intron. Black arrows indicate the
position of transgene. White arrow indicates the position of
endogenous c-Myc.
[0133] FIG. 15: Figure shows hES maker gene expression profile in
ALP positive colonies induced by four genes (Oct4, Sox2, Klf4 and
c-Myc). Colonies were stained for alkaline phosphatase at 17 days
post 4 genes transduction. All ALP(+) colonies were dissected and
determined their hES marker gene expressions. a, the number of
colonies expressing Nanog, TDGF1, Dnmt3b, Zfp42, FoxD3, TERT,
CYP26A1, and GDF3. b, morphologies of octa-positive colonies. c-d,
the number of hES cell marker genes categorized by individual
experiments.
[0134] FIG. 16-FIG. 22: Figure shows morphologies of four gene
(Oct4, Sox2, Klf4 and c-Myc) induced colonies categorized by gene
expression profile of ES cell related 8 genes (Nanog, TDGF1,
Dnmt3b, Zfp42, FoxD3, TERT, CYP26A1, and GDF3) as well as alkaline
phosphatase activity. Circles indicate the picked-up colony.
BEST MODE FOR CARRYING OUT THE INVENTION
[0135] Undifferentiated stem cells present in a human postnatal
tissues are undifferentiated stem cells which are present in human
postnatal skin, bone marrow, adipose tissue, skeletal muscle
tissue, and peripheral blood, and tissues concomitant to birth such
as placenta, umbilical cord and cord blood and in which the Tert,
Nanog, Oct3/4 and Sox2 genes have not undergone epigenetic
inactivation, and, by using a combination of induced expression of
the three genes of Oct3/4, Sox2 and Klf4 and the induced expression
of c-Myc or the addition of a histone deacetylase inhibitor, can
induce human pluripotent stem cells having a long-term self-renewal
ability and the pluripotency of differentiating into ectoderm,
mesoderm and endoderm. The above human pluripotent stem cells may
further have a potential of differentiating into primordial germ
cells.
[0136] Undifferentiated stem cells present in a human postnatal
tissue can be cultured using a plastic culture dish. When a 2%
serum is used, PDGF and EGF or FGF-2 may be added to the culture
medium, to which IGF or insulin may further be added. In this case,
when a culture medium containing serum is used for a long term
culture, properties of undifferentiated stem cells present in a
human postnatal tissue may change, and thus it is important to
limit the serum concentration to 2% or less and the number of
passages to about twice. When a 2% low concentration serum is used,
the MAPC medium or the FBM medium, for example, is used as the
culture medium. As the culture condition, an incubator at
37.degree. C. and 5% CO.sub.2 is used similarly to common culture
cells. It is also possible to use low concentration oxygen, for
example a 3% oxygen concentration. Culture plates are preferably
coated with fibronectin etc.
[0137] The human pluripotent stem cells of the present invention
induced from undifferentiated stem cells present in a human
postnatal tissue may be cultured using a plastic culture dish. In
the primary culture, cells after the four genes of Oct3/4, Sox2,
Klf4 and c-Myc were introduced therein are cultured in a
MEF-conditioned human ES cell medium to which 10 ng/ml bFGF and 10
ng/ml activin A had been added, and the medium is changed every 1
to 2 days. The pluripotent stem cells induced are detached with
dispase, collagenase, trypsin or the like, and subcultured. When
MEF is used as a supporting layer after the primary culture, the
induced human pluripotent stem cells are plated on a MEF-covered
plastic culture dish, and cultured in a human ES cell medium
supplemented with 10 ng/ml bFGF. When the supporting cells are not
used, the induced human pluripotent stem cells are plated on a
matrigel-coated plastic culture dish, and cultured in a
MEF-conditioned human ES cell medium supplemented with 10 ng/ml
bFGF and 10 ng/ml activin A. In either of the culture methods, the
medium is changed every 1 to 2 days.
[0138] In order to induce the human pluripotent stem cells of the
present invention from undifferentiated stem cells present in a
human postnatal tissue in which each gene of Tert, Nanog, Oct3/4
and Sox2 has not undergone epigenetic inactivation, the following
method may be used. First, an adenovirus vector is constructed
carrying cDNA having the sequence of coding region of the
mouse-derived cationic amino acid transporter (mCAT) gene (see
Example 2, Table 1), which is then introduced into the packaging
cell based on the HEK293 cell to prepare a virus solution of the
adenovirus vector. The virus solution is added at a multiplicity of
infection (m.o.i.: the ratio of the number of virus particles to
the number of cells) of 1 to 20 to undifferentiated stem cells
present in a human postnatal tissue in which each gene of Tert,
Nanog, Oct3/4 and Sox2 has not undergone epigenetic inactivation,
and thus undifferentiated stem cells expressing mCAT are
prepared.
[0139] Then, a retrovirus vector carrying cDNA encoding human
Oct3/4, a retrovirus vector carrying cDNA encoding human Sox2, a
retrovirus vector carrying cDNA encoding human Klf4, and a
retrovirus vector carrying cDNA encoding human c-Myc are
constructed (Table 1), and then each of them is introduced into the
packaging cell capable of producing an ecotropic recombinant virus
constructed based on the HEK293 cell to prepare a virus solution of
retrovirus vectors.
[0140] To the undifferentiated stem cells in which mCAT has been
expressed using an adenovirus vector and in which each of the Tert,
Nanog, Oct3/4 and Sox2 genes has not undergone epigenetic
inactivation, four types of retrovirus vectors each carrying the
four genes (coding regions) of Oct3/4, Sox2, Klf4 and c-Myc,
respectively, are added at a m.o.i. of 1 to 200 per virus vector to
establish the induction of the human pluripotent stem cells of the
present invention.
[0141] To the undifferentiated stem cells in which mCAT has been
expressed using an adenovirus vector and in which each of the Tert,
Nanog, Oct3/4 and Sox2 genes has not undergone epigenetic
inactivation, three types of virus vectors each carrying the genes
(coding regions) of Oct3/4, Sox2 and Klf4, respectively, at a
m.o.i. of 1 to 200 per virus vector, as well as MS-275 at a final
concentration of 10 nM to 100 preferably 100 nM to 1 .mu.M, are
added to establish the induction of the human pluripotent stem
cells of the present invention.
[0142] It is preferred that the human pluripotent stem cells of the
present invention after being suspended in the Cryopreservation
Medium For Primate ES Cells (manufactured by ReproCELL), preferably
are rapidly frozen in liquid nitrogen, and stored in a liquid
nitrogen storage vessel.
[0143] It is preferred that the pluripotent stem cells of the
present invention that were stored frozen are rapidly thawed by
suspending in a medium that had been warmed to 37.degree. C.,
removing the medium from the suspension by centrifugation, and then
suspending again in a fresh medium to start culturing.
[0144] The following explains a method in which, by applying the
present invention, siRNA and a compound that inhibit the induction
from undifferentiated stem cells present in a human postnatal
tissue in which the Tert, Nanog, Oct3/4 and Sox2 genes have not
undergone epigenetic inactivation to human pluripotent stem cells
are searched using a high throughput screening system.
[0145] siRNA represents a double stranded RNA that comprises about
19 base pairs which is part of the sequence of a gene, and that has
an effect of inhibiting the translation of the gene to the protein
due to RNA interference. When siRNA of a gene is introduced into a
cell, only the function carried by the protein can be specifically
deleted. Thus, by using a whole genome siRNA library in a specific
cell, the state in which the function of only one gene among all
the genes was deleted can be observed individually for every
gene.
[0146] Thus, by using the above siRNA library, it is possible to
identify a gene that inhibits the induction from a undifferentiated
stem cell present in a human postnatal tissue in which the Tert,
Nanog, Oct3/4 and Sox2 genes have not undergone epigenetic
inactivation to a human pluripotent stem cell. By developing an
inhibitor of the gene using this method, it is possible to induce
human pluripotent stem cells from undifferentiated stem cells
present in a human postnatal tissue.
[0147] As the siRNA library, those in which four siRNA's are
synthesized for each gene of a total of about 25,000 human genes,
mixed in equal amounts, and dispensed in a 384-well culture plate
are used, and subjected to screening (manufactured by Qiagen).
Details of it are as follows. Four siRNA's synthesized for each
gene are mixed in equal amounts, and 2.5 pmol each is dispensed in
each well of a 384-well culture plate. In order to cover all of
about 25,000 genes, seventy three 384-well culture plates are
needed. To predetermined wells of each plate, 2.5 pmol each of the
positive and negative control siRNAs is dispensed in order to
determine the introduction efficiency of siRNA into the cell and to
correct for efficiency of each plate. The final concentration of
siRNA is 50 nM.
[0148] After siRNA was prepared, a primary screening is conducted.
As methods of detecting the activation of genes that could be an
index for differentiation into the pluripotent stem cells of the
present invention such as Tert, Nanog, Oct3/4 and Sox2 in the cell
to be targeted, there are the promoter reporter assay of the gene
of interest [as the reporter gene, EGFP (enhanced green
fluorescence protein), luciferase etc.], the immunocytochemical
staining method to said gene product, and the like.
[0149] For transfection of siRNA to the cell, the lipofection
method may be used. To each well of a total of 73 plates in which
siRNA has been dispensed, 0.1 .mu.l of LipofectAMINE RNAiMax
(manufactured by Invitrogen) in 10 .mu.l of Opti-MEM (manufactured
by Invitrogen) is dispensed. Ten minutes later, target cells
prepared at 20 to 25 cells/.mu.l in up to 40 .mu.l of the medium
are dispended to every well on the 73 plates to introduce siRNA
into the cell. The number of cells and the amount of the medium are
determined as appropriate depending on the cell used for
screening.
[0150] In conducting a reporter assay, cells in which a reporter
system has been permanently integrated with a retrovirus vector
(including lentivirus) or cells 1 to 7 days after infection with an
adenovirus vector carrying the reporter system of interest are used
for cells such as adult stem cells for which gene introduction by
the lipofection method or the calcium phosphate method is
difficult. When the reporter system of the present invention is
applied to cultured lined cells such as HEK293 cells and Hela
cells, the reporter system should be introduced one day in advance
or simultaneously with siRNA by a gene introduction method suitable
for respective cells.
[0151] The entire 73 plates to which transfection reagents and
cells have been dispensed are cultured in a culturing equipment
maintained at 37.degree. C. and 5% CO.sub.2 for 2 to 7 days. The
culturing time may vary as appropriate depending on the type of the
cell, the gene to be detected, and the like.
[0152] As a method of selecting siRNA that promotes the induction
from undifferentiated stem cells present in a human postnatal
tissue to human pluripotent stem cells, alkaline phosphatase
staining can be used. As the alkaline phosphatase staining method,
the following method can be mentioned. After removing the culture
liquid from each well, cells are fixed in a 10% formaldehyde
solution at room temperature for 2 to 5 minutes, washed with a
phosphate buffer etc., and a chromogenic substrate of alkaline
phosphatase, nitroblue tetrazolium
chloride/5-bromo-4-chloro-3'-indolyl phosphatase para-toluidine
salt solution (hereinafter referred to as the NBT/BCIP solution) is
added and reacted at room temperature for 20 to 30 minutes.
[0153] Also when a compound library is used, the method used is
conducted similarly to the above screening used for siRNA. The
compound in stead of siRNA is spotted in each well, the cell is
dispensed and cultured, and similarly determined. The transfection
procedure is not necessary.
EXAMPLES
Example 1
Preparation of Retrovirus Vector
[0154] The retrovirus vector plasmids for the four genes of
Oct3/4-pMx, Sox2-pMx, Klf4-pMx and c-Myc-pMx constructed as in
Table 1 were introduced into the packaging cell, the Plat-E cell
[Experimental Hematology, 2003, 31 (11): 1007-14], using Fugene HD
(manufactured by Roche). During 24 to 48 hours after retrovirus
vector introduction, the medium was replaced with a medium suitable
for the cell to which gene is to be introduced. After culturing the
Plat-E cell to which retrovirus vector was introduced for more than
4 hours, the supernatant was recovered and passed through a filter
of 45 .mu.m in diameter (manufactured by Millipore). By the above
procedure, the retrovirus vector solutions of the four genes
(Oct3/4, Sox2, Klf4 and c-Myc) were prepared.
[0155] The retrovirus vector plasmids for the three genes of
Oct3/4-pMx, Sox2-pMx, Klf4-pMx and c-Myc-pMx were introduced into
the packaging cell, the Plat-E cell, using Fugene HD (manufactured
by Roche). During 24 to 48 hours after retrovirus vector
introduction, the medium was replaced with a medium suitable for
the cell to which gene is to be introduced. After culturing the
Plat-E cell to which retrovirus vector was introduced for more than
4 hours, the supernatant was recovered and passed through a filter
of 45 .mu.m in diameter (manufactured by Millipore). By the above
procedure, the retrovirus vector solution of the three genes
(Oct3/4, Sox2 and Klf4) were prepared.
Example 2
Preparation of Adenovirus Vector
[0156] According to the present invention, it was necessary to
introduce genes including an oncogene (c-Myc) into human cells by
retrovirus vector in order to induce pluripotent stem cells. In
this case, when a gene is introduced into human cells using an
amphotropic retrovirus vector which can infect into human cells,
there is a risk of infection to human cells other than the cells of
interest. Thus, in preparation for safe experiment, an ecotropic
retrovirus vector that infect the rodent cells but not human cells
and an adenovirus vector carrying gene encoding its receptor which
is mouse-derived cationic amino acid transporter 1 (mCAT1) were
combined and used in gene introduction into the human cells.
[0157] First, an adenovirus vector carrying cDNA having the
sequence of coding region of the mouse-derived cationic amino acid
transporter (mCAT1) gene was constructed. Specifically, Adeno-X
Expression System 1 kit (manufactured by TakaraBio Clontech) was
used. In Adeno-X Expression System 1 kit, based on the experimental
method attached to the kit by TakaraBio, the mCAT1 gene was
subcloned into the multi-cloning site of a vector called
pShuttle.
[0158] Subsequently, an expression cassette was excised by the
PI-Sce I site and the I-Ceu I site, cleavage sites on both ends of
the expression cassette of pShuttle, and a DNA fragment containing
the desired gene was inserted in between the PI-Sce I site and the
I-Ceu I site in the Adeno-X Viral DNA in the above kit, which was
then treated with a restriction enzyme Swa I to remove adenovirus
DNA for which integration was unsuccessful. After the plasmid was
transformed into an E. coli DH5 strain, whether the desired gene
was correctly introduced into adenovirus DNA or not was confirmed
by restriction enzyme treatment, PCR etc. The plasmid was prepared
in large quantities, and cleaved with the Pac I restriction enzyme.
Using the recombinant adenovirus DNA thus obtained, the gene was
introduced into the HEK293 cells (MicroBix) plated in six wells
using Lipofectamin 2000 (manufactured by Invitrogen), and two weeks
later when the cell exhibited a cytopathic effect (CPE), the cells
were collected as they are in the medium.
[0159] Subsequently, after the cell suspension was subjected to
freezing and thawing for three times, the cells were disrupted, and
virus particles present in the cells were allowed to release into
the liquid. The virus suspension thus prepared was added to one 100
mm plastic culture dish equivalent of HEK293 cells
(5.times.10.sup.6 cells) to infect the cells, the virus was
propagated. Furthermore, after virus was prepared in large
quantities using four 150 mm plate equivalent of HEK293 cells,
virus was purified using the Adenovirus Purification kit
(manufactured by Clontech), and stored frozen at -80.degree. C.
[0160] The titer (plaque forming units, PFU) of the mCAT1
adenovirus vector was determined using the Adeno-X Rapid Titer kit.
On a 24-well plate, HEK293 low cells were plated at a concentration
of 5.times.10.sup.4 cells/500 .mu.l per well. Fifty .mu.l of
serially diluted (from 10.sup.-2 to 10.sup.-7) virus vector was
mixed with 500 .mu.l of the medium, and then used to infect the
cells. After culturing at 5% CO.sub.2 and 37.degree. C. for 48
hours, the medium was aspirated off, the cells were dried for 5
minutes, and then using 500 .mu.l of cold 100% methanol the cells
were fixed by allowing to stand at -20.degree. C. for 10 minutes.
After aspirating off methanol, the wells were washed three times
with 500 .mu.l of phosphate buffer containing 1% bovine serum
albumin. A mouse anti-Hexon antibody was diluted 1000-fold with
phosphate buffer containing 1% bovine serum albumin, and 250 .mu.l
each of it was added to wells.
[0161] After allowing to stand at 37.degree. C. for 1 hour, the
antibody solution was removed, and the wells were washed three
times with 500 .mu.l of phosphate buffer containing 1% bovine serum
albumin. Horseradish peroxidase-labelled rat anti-mouse
immunoglobulin antibody was diluted 500-fold with phosphate buffer
containing 1% bovine serum albumin, and 250 .mu.l was added to
wells. After allowing to stand at 37.degree. C. for 1 hour, the
antibody solution was removed, and washed three times with 500
.mu.l of phosphate buffer containing 1% bovine serum albumin. 250
.mu.l of the DAB (diaminobenzidine) solution (10-fold DAB
concentrate was diluted with a stable peroxidase buffer) was added
to wells, and was allowed to stand at room temperature for 10
minutes. After aspirating off DAB, 500 .mu.l of phosphate buffer
was added. Using a 20.times. objective lens, the number of brown
positive cells in six viewing fields was counted.
[0162] Radius of a standard 20.times. objective lens: 0.5 mm
[0163] Area in one viewing field: 7.853.times.10.sup.-3
cm.sup.2
[0164] Area of a well: 2 cm.sup.2
[0165] Viewing field of a well: 2 cm.sup.2/7.853.times.10.sup.3
cm.sup.2=254.7 viewing fields
[0166] (32/6).times.254.7/(0.55.times.10.sup.-5)=2.5.times.10.sup.8
ifu (infection unit)/ml
Example 3
Alkaline Phosphatase Staining
[0167] Staining for confirming alkaline phosphatase activity which
is a characteristic of pluripotent stem cells was conducted in the
following manner. After removing the culture medium, a 10% formalin
neutral buffer solution was added to wells, and cells were fixed at
room temperature for 5 minutes. After washing with a phosphate
buffer etc., a chromogenic substrate of alkaline phosphatase, 1
step NBT/BCIP (manufactured by Pierce) was added and reacted at
room temperature for 20 to 30 minutes. Cells having alkaline
phosphatase activity were all stained blue violet.
Example 4
Determination Gene Expression of a Colony by Quantitative PCR
[0168] The expression of target gene of each colony including an
alkaline phosphatase-positive colonies was determined using
quantitative PCR in the following manner. Colonies developed by the
induction of pluripotent stem cells were harvested, and RNA was
extracted using the Recoverall total nucleic acid isolation kit for
FFPE (manufactured by Ambion). After synthesizing cDNA from the
extracted RNA, the target gene was amplified using the Taqman
Preamp mastermix (manufactured by Applied Biosystems).
[0169] As the primers for quantitative PCR, the Taqman gene
exprESsion assay (manufactured by Applied Biosystems) was used. The
following shows the name of the target gene and the product code of
each primer. Human Hprt: Hs99999909_m1, human Nanog: Hs02387400_g1,
human Tert: Hs00162669_m1, Mouse Hprt: Mm01545399_m1, mouse Nanog:
Ma02019550_s1.
[0170] As the positive control for quantitative PCR, cDNA extracted
from mesenchymal stem cells established by the following manner was
used.
[0171] One vial (2.5.times.10.sup.7 cells) of human bone
marrow-derived mononuclear cells (hBMMNCs (manufactured by Lonza),
Lot 060175A: female, 21 years old, black) was thawed in a
37.degree. C. water bath, and suspended in 10 ml of the MSCGM
medium (a growth medium for mesenchymal cells) (manufactured by
Lonza). In order to remove DMSO in the frozen solution, this was
centrifuged at 300 g and 4.degree. C. for seven minutes and the
supernatant was removed. The cell mass thus obtained was
resuspended in 10 ml of MSCGM medium, and plated on a 100 mm plate
at a concentration of 10.sup.5 cells/cm.sup.2 and cultured at
37.degree. C. Seven days later, the medium was changed. At this
time, the suspended cells in the old medium were collected by
centrifuging at 300 g and 4.degree. C. for five minutes, and were
returned to the cells together with the fresh medium. On day 13
when the adherent cells became confluent, the supernatant was
removed, non-adherent cells were washed off with a phosphate
buffer, and adherent cells were collected by detaching with a 0.05%
trypsin-EDTA solution and plated at a concentration of 3000
cells/cm.sup.2. RNA was collected from the cells of the third
subculture, and cDNA was synthesized.
Example 5
Induction of Human Pluripotent Stem Cells from Undifferentiated
Stem Cells Present in a Postnatal Human Adult Bone Marrow
Tissue
[0172] From human adult bone marrow-derived cells (trade name:
Human Bone Marrow-Derived Mononuclear Cell) containing
undifferentiated stem cells present in a postnatal human adult bone
marrow tissue, the cells were established under the low serum (2%)
and the high serum (10%) culture conditions, and were used in the
experiment for inducing pluripotent stem cells. Thus, one vial each
(2.5.times.10.sup.7 cells) of frozen human bone marrow-derived
mononuclear cells (hBMMNCs (manufactured by Lonza), Lot 060809B:
female, 20 years old, white/and hBMMNCs (manufactured by Lonza),
Lot 060470B: female, 20 years old, black) was thawed in a
37.degree. C. water bath, and suspended in 10 ml of the MAPC medium
for use in the low serum culture. In order to remove DMSO in the
frozen solution, this was centrifuged at 300 g and 4.degree. C. for
seven minutes and the supernatant was removed.
[0173] The cell mass thus obtained was resuspended, and plated at a
concentration of 10.sup.5 cells/cm.sup.2 on a 100 mm plate coated
with 10 ng/ml fibronectin. Growth factors [10 ng/ml PDGF-BB
(manufactured by Peprotech), 10 ng/ml EGF (manufactured by
Peprotech), 10 ng/ml IGF-1 (manufactured by Peprotech)] were added.
Three days later, growth factors were only added. Seven days later,
the suspended cells and the medium were collected except the
adherent cells, and centrifuged at 300 g and 4.degree. C. for five
minutes. After the supernatant was removed, the cells were
resuspended in a fresh medium. The cell suspension was returned to
the original 10 cm dish, and growth factors were added thereto. On
day 10 when the adherent cells became confluent, the supernatant
was removed, non-adherent cells were washed off with a phosphate
buffer, and adherent cells were collected by detaching with a 0.05%
trypsin-EDTA solution, and using a cell banker (manufactured by
Juji Field), the primary culture was stored frozen.
[0174] Using the human bone marrow-derived mononuclear cell of the
same lot, the cells were established using a MSCGM medium
(manufactured by Lonza) containing 10% FBS under the high serum
condition. The Human Bone Marrow-Derived Mononuclear Cells were
plated at a concentration of 10.sup.5 cells/cm.sup.2 in a 100 mm
plate to which 10 ml of the MSCGM medium had been added, and
cultured at 37.degree. C. Seven days later, the suspended cells and
the medium were collected except the adherent cells, and
centrifuged at 300 g and 4.degree. C. for five minutes, and after
the supernatant was removed, the cells were resuspended in a fresh
medium. The cell suspension was returned to the original 10 cm
dish, and culturing was continued. On day 13 when the adherent
cells became confluent, the supernatant was removed, non-adherent
cells were washed off with a phosphate buffer. Adherent cells were
collected by detaching with a 0.05% trypsin-EDTA solution, and
using a cell banker (manufactured by Juji Field), the primary
culture was stored frozen.
[0175] One vial each of the human bone marrow-derived primary
culture cells that were established under the high serum and the
low serum conditions and stored frozen was thawed in a 37.degree.
C. incubator. Two ml of the medium used for the establishment was
added to the cells respectively, and the cells were plated at a
concentration of 10.sup.4 cells/cm.sup.2 on a 6-well plastic
culture dish of which bottom had been coated with matrigel
(manufactured by Becton Dickinson) at a concentration of 20
.mu.g/cm.sup.2 and cultured for 14 hours (a second subculture
cells). Fourteen hours later, the medium was removed, and the mCAT1
adenovirus vector prepared in Example 2 at an amount equivalent to
a m.o.i. of 10 in 500 .mu.l of the Hank's balanced salt solution
per well was added, and were infected at room temperature for 30
minutes.
[0176] Two ml each of the medium used for establishment was added
to each well, and cultured at 37.degree. C. Forty eight hours after
the introduction of the mCAT-1 adenovirus vector, the medium of
each well was replaced with 2 ml of the retrovirus vector solution
(polybrene at a final concentration of 4 .mu.g/ml was added) of
four genes (Oct3/4, Sox2, Klf4, c-Myc) which were prepared in
Example 1, and cultured at 37.degree. C. for 14 hours. The virus
supernatant was removed and replaced with the MEF-conditioned ES
medium. Then medium change with the MEF-conditioned ES medium was
continued every two days. On examining fourteen days after the
introduction of the four genes, one typical colony was found in the
low serum condition group of Lot 060809B that exhibits a
characteristics of the induced pluripotent stem cells. Said colony
was composed of markedly smaller cells than the surrounding cells.
In addition to the pluripotent stem cell-like colony, a plurality
of colonies were observed in both the low serum group and the high
serum group, but they were not stained with alkaline
phosphatase.
[0177] In order to isolate the pluripotent stem cell-like colonies,
the wells were washed with the Hank's balanced salt solution, and
then colonies were surrounded by a cloning ring (manufactured by
Iwaki) to the bottom of which silicone grease had been applied. One
hundred .mu.l of the Detachment Medium For Primate ES Cells
(manufactured by ReproCELL) was added in the ring and cultured at
37.degree. C. for 10 to 20 minutes. The cell suspension in the ring
containing the detached colony was added to 2 ml of the
MEF-conditioned ES medium, and plated in one well of a MEF-coated
24-well plate. After culturing at 37.degree. C. for 8 to 14 hours,
the medium was changed, and subsequently medium change was
continued every two days, and 8 days later a second subculture was
carried out.
[0178] The medium was removed, washed with the Hank's balanced salt
solution, the Detachment Medium For Primate ES Cells (manufactured
by ReproCELL) was added, cultured at 37.degree. C. for 10 minutes,
and 2 ml of the medium was added to stop the reaction. The cell
suspension was transferred to a centrifuge tube, and centrifuged at
4.degree. C. and 200 g for 5 minutes to remove the supernatant. The
cells were resuspended in the MEF-conditioned ES medium, and plated
in 4 wells of the MEF-coated 24-well plate. Medium change was
continued every 2 days, and seven days after the second subculture,
the cells were subjected to alkaline phosphatase staining, and the
cloned colony-derived cells were stained blue violet.
[0179] Furthermore, by quantitative PCR, it was confirmed that
Nanog and Tert were expressed by the colony of alkaline phosphatase
activity-positive pluripotent stem cells. When compared to the
mesenchymal stem cells established in Example 4, the amount
expressed of Nanog was as much as 30-fold higher. The expression of
Tert was noted only in said pluripotent stem cells, and not in the
mesenchymal stem cells. In the cells that did not form colonies
despite the introduction of the four genes, Nanog or Tert was not
expressed (FIG. 1).
[0180] From the foregoing, when human adult bone marrow-derived
cells were used, the pluripotent stem cells were obtained from the
low serum culture group but not at all from the high serum culture
group (Lot 060809B and Lot 060470B) (Table 2). Also, culturing
under the low serum condition was suitable for the maintenance of
the undifferentiated cells.
Example 6
Induction of Human Pluripotent Stem Cells from Undifferentiated
Stem Cells Present in Human Neonatal Skin
[0181] Using cells (trade name: Neonatal Normal Human Skin
Fibroblasts, primary culture) derived from a human neonatal tissue,
a human tissue immediately after birth, the induction of human
pluripotent stem cells from undifferentiated stem cells present in
the skin of a human neonate was attempted.
[0182] One vial of the frozen Neonatal Normal Human Skin
Fibroblasts (primary culture, manufactured by Lonza, Lot 5F0438)
was thawed in a 37.degree. C. incubator, and was suspended in the
MCDB202 modified medium, a medium containing 2% fetal bovine serum,
5 .mu.g/ml insulin, 50 .mu.g/ml gentamycin, 50 ng/ml amphotericin-B
(FBM medium, manufactured by Lonza) to obtain 12 ml of a cell
suspension. Two ml each of the cell suspension was plated on a
6-well plastic culture dish of which bottom had been coated with
matrigel (manufactured by Becton Dickinson) at a concentration of
20 .mu.g/cm.sup.2 (second subculture cells).
[0183] Fourteen hours later, the medium was removed, and the mCAT1
adenovirus vector prepared in Example 2 at an amount equivalent to
a m.o.i. of 5 in 500 .mu.l of the Hank's balanced salt solution per
well was added, and was infected at room temperature for 30
minutes. To each well, 2 ml of the FBM medium was added
respectively, and cultured at 37.degree. C. Forty eight hours after
the introduction of the mCAT-1 adenovirus vector, the medium of
each well was replaced with 2 ml of the retrovirus vector solution
(polybrene at a final concentration of 4 .mu.g/ml was added) of the
four genes (Oct3/4, Sox2, Klf4 and c-Myc) prepared in Example 1,
and cultured at 37.degree. C. for 4 hours.
[0184] The virus supernatant was removed and replaced with the
MEF-conditioned ES medium. Then medium change with the
MEF-conditioned ES medium was continued every two days, and
fourteen days after the introduction of the four genes, one well of
the 6-well plate was subjected to alkaline phosphatase staining. As
a result, six pluripotent stem cell-like alkaline
phosphatase-positive colonies were obtained. Alkaline
phosphatase-positive colonies were composed of markedly smaller
cells than the neonatal normal human skin fibroblasts.
[0185] Subsequently, by quantitative PCR, it was confirmed that
Nanog and Tert were expressed by the colonies of alkaline
phosphatase activity-positive pluripotent stem cells. When compared
to the mesenchymal stem cells established under the high serum
(10%) culture condition in Example 5, the neonatal normal human
skin fibroblasts before the introduction of the four genes did not
express Nanog, whereas in the case of the cells after the
introduction of the four genes, 9-fold as much in the cells that
are not forming colonies and 18-fold as much expression of Nanog in
the alkaline phosphatase activity-positive colonies were observed
(FIG. 2). On the other hand, the expression of Tert was only noted
in the alkaline phosphatase activity-positive colonies. From this,
the pluripotent stem cells are defined by the characteristics of
alkaline phosphatase activity-positive and Nanog-positive and
Tert-positive. Also, the neonatal normal human skin fibroblasts
were confirmed to be the cells that have a relatively high
efficiency of inducing the pluripotent stem cells and that can
express Nanog by the introduction of the four genes.
[0186] Colonies of the pluripotent stem cells were isolated in the
following manner. On day 17 after gene introduction, six colonies
with a characteristic shape were selected from the remaining wells.
After washing the wells with the Hank's balanced salt solution,
colonies were surrounded by a cloning ring (manufactured by Iwaki)
to the bottom of which silicone grease had been applied. One
hundred .mu.l of the Detachment Medium For Primate ES Cells
(manufactured by ReproCELL) was added in the ring and cultured at
37.degree. C. for 20 minutes. The cell suspension in the ring
containing the detached colonies was added to 2 ml of the
MEF-conditioned ES medium, and plated in one well of a MEF-coated
24-well plate. After culturing at 37.degree. C. for 14 hours, the
medium was changed, and subsequently medium change was continued
every two days, and 8 days later a second subculture was carried
out. The medium was removed, the cells were washed with the Hank's
balanced salt solution, the Detachment Medium For Primate ES Cells
was added and cultured at 37.degree. C. for 10 minutes, and 2 ml of
the medium was added to stop the reaction.
[0187] The cell suspension was transferred to a centrifuge tube,
and centrifuged at 4.degree. C. and 200 g for 5 minutes, and the
supernatant was removed. The cells were resuspended in the
MEF-conditioned ES medium, and plated on four wells of a MEF-coated
24-well plate. Seven days after the second subculture, in a
subculturing method described below, the cells were plated on a 60
mm plastic culture dish of which bottom had been coated with
matrigel at a concentration of 20 .mu.g/cm.sup.2. Further eight
days later (37 days after the introduction of the four genes), a
third subculture was conducted, and plated on two matrigel-coated
60 mm plastic culture dishes, and part of it was used in alkaline
phosphatase staining and RNA extraction. The result confirmed that
the cells derived from the cloned colonies are alkaline phosphatase
activity-positive and are expressing Nanog and Tert at high rate,
thereby endorsing that they are pluripotent stem cells.
[0188] The induced pluripotent stem cells were subcultured every 5
to 7 days for maintenance and growth. From the plastic culture dish
on which subculturing is to be conducted, the medium was removed,
the cells were washed with the Hank's balanced salt solution,
dispase or the Detachment Medium For Primate ES Cells was added,
and cultured at 37.degree. C. for 5 to 10 minutes. When more than
half of the colonies were detached, the ES medium was added to stop
the reaction, and the cell suspension was transferred to a
centrifuge tube. When colonies precipitated on the bottom of the
tube, the supernatant was removed, and the ES medium was added
again for suspension. After examining the size of the colonies, any
extremely large ones were divided into appropriate sizes by slowly
pipetting. Appropriately sized colonies were plated on a
matrigel-coated plastic culture dish with a base area of about 3 to
6 times that before subculture. The colony-derived pluripotent stem
cells are being grown and maintained now.
[0189] As shown in Table 2, the Neonatal Normal Human Skin
Fibroblasts in the lot (Lot 5F0474) other than the above lot 5F0438
exhibited a favorable induction of pluripotent stem cells. From
comparison to Example 5, cells derived from young individuals or
cells of which culturing time is short were thought to be suitable
for the induction of the pluripotent stem cells.
[0190] From the above results, when cells derived from human
neonatal tissue that is a human postnatal tissue containing
undifferentiated cells were subjected to a second subculture in a
culture medium containing 2% serum, it was possible to induce the
pluripotent stem cells.
Example 7
Induction of Human Pluripotent Stem Cells from Undifferentiated
Stem Cells Present in a Human Adult Skin
[0191] Then, using human adult tissue-derived cells (trade name:
Adult Normal Human Skin Fibroblasts, primary culture) containing
undifferentiated stem cells present in a human adult skin, the
induction of pluripotent stem cells of the present invention was
carried out.
[0192] One vial each of the frozen Adult Normal Human Skin
Fibroblasts (primary culture, manufactured by Lonza, Lot 6F3535: 28
years old, female, white, Lot 6F4026: 39 year old, female, white)
was thawed in a 37.degree. C. incubator, suspended in the FBM
medium, and 12 ml of the cell suspension was obtained,
respectively. Two ml each of the cell suspensions was plated on a
6-well plastic culture dish of which bottom had been coated with
matrigel at a concentration of 20 .mu.g/cm.sup.2 (second subculture
cells).
[0193] Fourteen hours later, the medium was removed, and the mCAT1
adenovirus vector prepared in Example 2 at an amount equivalent to
a m.o.i. of 5 in 500 .mu.l of the Hank's balanced salt solution per
well was added, and was infected at room temperature for 30
minutes. To each well, 2 ml of the FBM medium was added, and
cultured at 37.degree. C. Forty eight hours after the introduction
of the mCAT-1 adenovirus vector, the medium of each well was
replaced with 2 ml of the retrovirus vector solution (polybrene at
a final concentration of 4 .mu.g/ml was added) of the four genes
(Oct3/4, Sox2, Klf4 and c-Myc) prepared in Example 1, and cultured
at 37.degree. C. for 4 hours. The virus supernatant was removed and
replaced with the MEF-conditioned ES medium. Then medium change
with the MEF-conditioned ES medium was continued every two days,
and thirteen days after the introduction of the four genes,
alkaline phosphatase staining was carried out. As a result, two
pluripotent stem cell-like alkaline phosphatase-positive colonies
per well were obtained from the Lot 6F3535, whereas no alkaline
phosphatase-positive colonies were obtained from the Lot 6F4242
(Table 2).
[0194] From comparison to Example 6, the neonate-derived cells
among the skin fibroblasts had a higher efficiency of inducing the
pluripotent stem cells. Also, among the Adult Normal Human Skin
Fibroblasts, cells derived from younger donors had a higher
transformation efficiency. From the foregoing, it was demonstrated
that the efficiency of inducing the pluripotent stem cells
decreases in an age-dependent manner.
Example 8
Examination Using Neonatal Normal Human Skin Fibroblasts of the
Third Subculture
[0195] One vial of frozen Neonatal Normal Human Skin Fibroblasts
(primary culture, manufactured by Lonza, Lot 5F0439) was thawed in
a 37.degree. C. incubator, suspended in the FBM medium, and plated
on two 100 mm plastic culture dishes (a second subculture). After
culturing for six days until a 70 to 90% confluence could be
obtained, the cells were detached using a 0.025% trypsin-EDTA
solution (manufactured by Lonza), centrifuged at 4.degree. C. and
200 g for 5 minutes, and the supernatant was removed. The second
subcultured cells collected were stored frozen using the cell
banker.
[0196] The frozen second subculture cells were thawed in a
37.degree. C. incubator, suspended in 12 ml of the FBM medium,
centrifuged at 4.degree. C. and 200 g for 5 minutes, and the
supernatant was removed. The cells were suspended, and plated at a
concentration of 10.sup.4 cell/cm.sup.2 on a 100 mm plastic culture
dish of which bottom had been coated with matrigel at a
concentration of 20 .mu.g/cm.sup.2 (a third subculture). Fourteen
hours later, the medium was removed, and the mCAT1 adenovirus
vector prepared in Example 2 at an amount equivalent to a m.o.i. of
5 in 2 ml of the Hank's balanced salt solution was added, and was
infected at room temperature for 30 minutes. To each well, 10 ml of
the FBM medium was added, and cultured at 37.degree. C.
[0197] Forty eight hours after the introduction of the mCAT-1
adenovirus vector, the medium was removed, and replaced with 10 ml
of the retrovirus vector solution (polybrene at a final
concentration of 4 .mu.g/ml was added) of the four genes (Oct3/4,
Sox2, Klf4 and c-Myc) prepared in Example 1, and cultured at
37.degree. C. for 4 hours. The virus supernatant was removed and
replaced with the MEF-conditioned ES medium. Then medium change
with the MEF-conditioned ES medium was continued every two days,
and fourteen days after the introduction of the four genes,
alkaline phosphatase staining was carried out. As a result, five
pluripotent stem cell-like alkaline phosphatase-positive colonies
were obtained. By calculating based on the area of the bottom, this
indicates that 0.83 colony per well of the 6-well plate was
obtained (Table 2).
[0198] From comparison to Example 6, it was demonstrated that the
efficiency of inducing the pluripotent stem cells decreases with
the prolonged culture period.
Example 9
Induction of Human Pluripotent Stem Cells from Undifferentiated
Stem Cells Present in the Umbilical Cord (1)
[0199] Using the cells (trade name: Normal Human Umbilical Vein
Endothelial Cells, primary culture) derived from a human umbilical
cord, a human tissue immediately after birth, the induction of the
human pluripotent stem cells of the present invention from
undifferentiated stem cells present in the umbilical cord was
attempted.
[0200] One vial of the frozen Normal Human Umbilical Vein
Endothelial Cells (primary culture, manufactured by Lonza) was
thawed in a 37.degree. C. incubator, and suspended in the
Endothelial Cell Medium kit-2 manufactured by Lonza (2% serum)
(hereinafter referred to as EBM-2) to obtain 12 ml of the cell
suspension. About 10.sup.5/2 ml/well each of the cell suspension
was plated to a 6-well plastic culture dish of which bottom had
been coated with matrigel at a concentration of 20 .mu.g/cm.sup.2
(second subculture). Six hours later, the medium was removed, and
the mCAT1 adenovirus vector prepared in Example 2 at an amount
equivalent to a m.o.i. of 5 in 500 .mu.l of the Hank's balanced
salt solution per well was added, and infected at room temperature
for 30 minutes.
[0201] 2.5 ml each of the EBM-2 medium was added to each well, and
cultured at 37.degree. C. Forty eight hours after the introduction
of the mCAT-1 adenovirus vector, the medium of each well was
replaced with 2 ml each of the retrovirus vector solutions
(polybrene at a final concentration of 5 .mu.g/ml was added) of the
four genes (Oct3/4, Sox2, Klf4 and c-Myc) prepared in Example 1,
and cultured at 37.degree. C. for 4 hours. The virus supernatant
was removed and replaced with the MEF-conditioned ES medium. Then
medium change with the MEF-conditioned ES medium was continued
every two days. Twelve days after the introduction of the four
genes, colonies were confirmed.
[0202] Thirteen days after the introduction of the four genes, the
induced colonies were stained with alkaline phosphatase
activity.
[0203] From the above results, when cells derived from human
umbilical cord that is a human tissue immediately after birth
containing undifferentiated cells were subjected to a second
subculture in a culture medium containing 2% serum, it was possible
to induce the pluripotent stem cells.
Example 10
Induction of Human Pluripotent Stem Cells from Undifferentiated
Stem Cells Present in the Umbilical Cord (2)
[0204] As described below, using the cells (trade name: Normal
Human Umbilical Artery Smooth Muscle Cells, the third subculture)
derived from a human umbilical cord, a human tissue immediately
after birth, the induction of the human pluripotent stem cells of
the present invention from undifferentiated stem cells present in
the umbilical cord was attempted.
[0205] One vial of the frozen Normal Human Umbilical Artery Smooth
Muscle Cells (the third culture, manufactured by Lonza) was thawed
in a 37.degree. C. incubator, and suspended in the Smooth Muscle
Cell Medium kit-2 manufactured by Lonza (5% serum) (hereinafter
referred to as SmGM-2) to obtain 12 ml of the cell suspension.
About 10.sup.5/2 ml/well each of the cell suspension was plated to
a 6-well plastic culture dish (manufactured by Becton Dickinson) of
which bottom had been coated with matrigel (manufactured by Becton
Dickinson) at a concentration of 20 .mu.g/cm.sup.2 (the fourth
subculture). One day later, the medium was removed, and the mCAT1
adenovirus vector at an amount equivalent to a m.o.i. of 1.25 to 5
in 500 .mu.l of the Hank's balanced salt solution per well was
added, and infected at room temperature for 30 minutes. 2.5 ml each
of the SmGM-2 medium was added to each well, and cultured at
37.degree. C.
[0206] Forty eight hours after the introduction of the mCAT-1
adenovirus vector, the medium of each well was replaced with 2 ml
each of the retrovirus vector solutions (polybrene at a final
concentration of 5 .mu.g/ml was added) of the four genes (Oct3/4,
Sox2, Klf4 and c-Myc) prepared in Example 1, and cultured at
37.degree. C. for 4 hours. The virus supernatant was removed and
replaced with the MEF-conditioned ES medium. Then medium change
with the MEF-conditioned ES medium was continued every two days.
Thirteen days after the introduction of the four genes, colonies
were confirmed. However, the induced colonies were not stained with
alkaline phosphatase activity.
[0207] From the above results, it was revealed that though the
cells derived from human umbilical cord which is a human tissue
immediately after birth contains undifferentiated cells present in
the umbilical cord, when the cells were subjected to a fourth
subculture in a culture medium containing 5% serum, the induction
of the pluripotent stem cells was extremely difficult.
Example 11
Induction of Mouse Pluripotent Stem Cells from Undifferentiated
Stem Cells Present in a Mouse Postnatal Tissue
[0208] Using mouse bone marrow-derived cells, a mouse postnatal
tissue, the induction of pluripotent stem cells of the present
invention from undifferentiated stem cells present in a mouse
postnatal tissue was attempted.
[0209] Femurs and tibias were extracted from 4 to 6 week-old mice
(c57BL/6N lineage, 4-week-old, female) taking utmost care not to
bring in any other tissue. By soaking the collected bone in 70%
ethanol for a short period of time, the cells that attached to the
outside of the bone were killed to prevent the contamination of
cells other than the bone marrow. After ethanol treatment, the bone
was immediately transferred to IMDM (Iscove's Modified Dulbecco's
Medium) (manufactured by SIGMA) to prevent the effect of the cells
inside of the bone marrow. The outside of each bone was wiped with
Kimwipe to remove the connective tissue. All of the treated bone
was transferred to a mortar having IMDM, and was smashed with a
pestle. After washing several times with IMDM, the bone was cut
into pieces with scissors. After further washing with IMDM several
times, bone fragments were transferred to centrifuge tubes.
[0210] After removing IMDM, 10 ml per five mice of IMDM containing
0.2% collagenase I (manufactured by SIGMA) was added, and shaken at
37.degree. C. for 1 hour. After shaking, the suspension was stirred
several times using a Pipetman, and then the supernatant was
transferred to another tube, to which an equal amount of cold 10%
FBS-containing IMDM was added to stop the enzyme reaction. The bone
fragments after enzyme treatment were transferred to a mortar
containing cold 10% FBS-containing IMDM, and smashed again with a
pestle, and after stirring several times, the supernatant was
collected. The cell suspension thus collected was filtered by
sequentially passing through a Nylon mesh of 70 .mu.m and 40 .mu.m
in diameter. The cell suspension was centrifuged at 4.degree. C.
and 600 g for 7 minutes, and cells derived from the mouse deep bone
marrow were collected.
[0211] The cells derived from mouse deep bone marrow were suspended
in the MAPC medium, and plated at a concentration of 10.sup.5
cells/cm.sup.2. For plating of cells, a dish previously coated with
a phosphate buffer containing 10 ng/ml fibronectin (Becton
Dickinson) was used. To the medium, growth factors [10 ng/ml
PDGF-BB (manufactured by Peprotech), 10 ng/ml EGF (manufactured by
Peprotech), 1000 units/ml LIF (manufactured by Chemicon)] were
added at the time of use. Three days after plating, growth factors
were only added without changing the medium. Six days later,
non-adherent cells were washed off with the phosphate buffer, and
adherent cells were collected by detaching with a 0.05%
trypsin-EDTA solution (manufactured by Invitrogen), and using a
cell banker (manufactured by Juji Field), the cells were stored
frozen as the primary culture.
[0212] The primary culture cells that had been stored frozen were
thawed in a 37.degree. C. water bath, and suspended in 10 ml of the
MAPC medium that is a medium containing 2% FBS. In order to remove
DMSO in the frozen solution, it was centrifuged at 4.degree. C. and
300 g for 7 minutes, and the supernatant was removed. The cell mass
obtained was resuspended, and plated at a concentration of
2.5.times.10.sup.3 cells/cm.sup.2 on a 12-well plastic plate having
the bottom which had been gelatin-coated with 0.1%
gelatin/phosphate buffer, and 2 ml each of the MAPC medium was
added (the second subculture).
[0213] Eight to 14 hours later, the medium was removed, and 2 ml
each of the four gene retrovirus vector solution prepared as in
Example 1 was added thereto and cultured at 37.degree. C. for 4 to
14 hours. Then the virus solution was removed, and replaced with
the mouse ES medium [the ES medium to which a final concentration
of 0.3% FBS (manufactured by Invitrogen), 1000 units/ml LIF
(manufactured by Chemicon), and 0.1 mM 2-mercaptoethanol were
added]. Then medium change with the mouse ES medium was continued
every three days, and 5 to 7 days after the introduction of the
four genes, said pluripotent stem cells formed colonies comprising
mouse ES cell-like small cells. The colonies of the induced
pluripotent stem cells were stained blue violet by alkaline
phosphatase activity.
[0214] From the remaining wells of the 12-well plate, the mouse
pluripotent stem cells were subcultured, and subculture was
continued to a gelatin-coated 100 mm plate. From the seventh
subculture cells, RNA was extracted using the RNeasy mini kit
(manufactured by QIAGEN) and cDNA was synthesized. Using the cDNA,
quantitative PCR was conducted to confirm the expression of
Nanog.
[0215] The mouse pluripotent stem cells of the seventh subculture
were subcutaneously transplanted to the back of three syngeneic
C57BL/6N mice at 3.times.10.sup.5 cells/mouse, and 38 days later
the teratoma that formed was extracted. Teratoma was formed in all
three mice. From the extracted teratoma, slices were prepared, and
differentiation potential into three germ layers was analyzed by
immunological staining and histological staining (HE stain, alcian
blue stain). As a result, MAP2-positive cells (the nervous system)
and GFAP-positive cells (the nervous system) as the ectodermic
system, skeletal muscle cells (myocytes) and cartilage tissues as
the mesodermic system, and intestinal tract tissues as the
endodermic system were observed.
[0216] In order to maintain and grow the mouse pluripotent stem
cells, they were subcultured every 3 to 4 days. The medium was
removed from the plastic culture dish in which subculture is
carried out, washed with phosphate buffer, a 0.05% trypsin-EDTA
solution was added, and cultured at 37.degree. C. for 5 minutes.
When the cells detached, the ES medium was added to stop the
reaction, and the cell suspension was transferred to a centrifuge
tube. By centrifuging at 200 g for 5 minutes, the supernatant was
removed, and after suspending the precipitate in the mouse ES
medium, the cells were plated in a gelatin-coated plate at a
concentration of 10.sup.4 cells/cm.sup.2. The pluripotent stem
cells induced from the cells derived from the mouse bone marrow
cultured in low serum in the same subculture method could be
cultured for a long time.
[0217] As described above, pluripotent stem cells were induced from
the postnatal mouse bone marrow-derived cells established under the
low serum condition.
Example 12
Induction of Mouse Pluripotent Stem Cells by the Introduction of
Three Genes and Histone Deacetylase Inhibitor Treatment
[0218] Using cells derived from mouse bone marrow that is a mouse
postnatal tissue, the induction of pluripotent stem cells was
carried out with the introduction of three genes and histone
deacetylase inhibitor treatment.
[0219] The primary culture cells derived from mouse bone marrow
containing undifferentiated stem cells that had been stored frozen
after preparing in a manner similar to Example 11 were plated at a
concentration of 5.times.10.sup.3 cells/cm.sup.2 on a 24-well
plastic plate (manufactured by Becton Dickinson) having the bottom
which had been gelatin-coated with a 0.1% gelatin/phosphate buffer,
and 2 ml each of the MAPC medium was added.
[0220] Eight hours later, the medium was removed, 2 ml each of the
three gene (human Oct3/4, Sox2 and Klf4) retrovirus vector solution
prepared as in Example 1 were added, and after further adding
MS-275, a histone deacetylase inhibitor, at a final concentration
of 1 or 0.1 .mu.M, they were cultured at 37.degree. C. for 14
hours. Then after removing the virus solution, 2 ml each of the
MAPC medium containing MS-275, a histone deacetylase inhibitor, at
a final concentration of 1 or 0.1 .mu.M was added. Three days
later, the medium was replaced with the mouse ES medium [a final
concentration of 0.3% FBS (manufactured by Invitrogen), 1000
units/ml LIF (manufactured by Chemicon) and 0.1 mM
2-mercaptoethanol were added to the ES medium at the time of
use].
[0221] Medium change with the mouse ES medium was continued every 2
to 3 days. Twelve days after the introduction of three genes (human
Oct3/4, Sox2 and Klf4) retrovirus vector, the cells were
subcultured from each well of the 24-well plastic plate to each
well of a 6-well plastic plate. A portion of it was also cultured
in a 24-well plastic plate. Fifteen days after said three gene
introduction and MS-275 treatment, the pluripotent stem cells
formed colonies composed of mouse ES cell-like small cells. The
colonies of said pluripotent stem cells were stained blue violet by
alkaline phosphatase activity.
[0222] Then, the amount expressed of the Nanog gene was confirmed
by quantitative PCR, and the expression of mouse Nanog of colonies
of pluripotent stem cells having alkaline phosphatase activity was
confirmed (FIG. 3).
[0223] Eighteen days after said three gene introduction and MS-275
treatment, the pluripotent stem cells were subcultured from each
well of the 6-well plate to a gelatin-coated 100 mm plate.
Subculture was continued similarly.
[0224] Twenty nine days after said three gene introduction and
MS-275 treatment, the mouse pluripotent stem cells were
subcutaneously transplanted to the back of syngeneic C57BL/6N mice
at 2.times.10.sup.7 cells/mouse, and 34 days later the teratoma
that formed was extracted. From the extracted teratoma, slices were
prepared, and differentiation potential into three germ layers was
analyzed by immunological and histological staining (HE stain,
alcian blue stain). As a result, GFAP-positive cells (the nervous
system) and keratin producing cells (skin cells) as the ectodermic
system, smooth muscle actin-positive cells (smooth muscle cells),
bone tissues and cartilage tissues as the mesodermic system, and
intestinal tract tissues (endodermal epithelium positive for MUC-1)
as the endodermic system were observed.
Example 13
Induction of Mouse Pluripotent Stem Cells by the Introduction of
Three Genes
[0225] Then, using cells derived from mouse bone marrow that is a
mouse postnatal tissue, the induction of mouse pluripotent stem
cells was carried out with the introduction of three genes.
[0226] The primary culture cells derived from mouse bone marrow
containing undifferentiated stem cells that had been stored frozen
after preparing in Example 11 were plated at a concentration of
1.times.10.sup.4 cells/cm.sup.2 on a 24-well plastic plate
(manufactured by Becton Dickinson) having the bottom which had been
gelatin-coated with a 0.1% gelatin/phosphate buffer solution, and 2
ml each of the MAPC medium was added.
[0227] Two days later, the medium was removed, 2 ml each of the
three gene (human Oct3/4, Sox2 and Klf4) retrovirus vector solution
prepared as in Example 1 were added, and after culturing at
37.degree. C. for 1 day, the virus solution was removed, and 2 ml
each of the MAPC medium was added. Three days later, the medium was
replaced with the mouse ES medium [a final concentration of 0.3%
FBS (manufactured by Invitrogen), 1000 units/ml LIF (manufactured
by Chemicon) and 0.1 mM 2-mercaptoethanol were added to the ES
medium at the time of use]. Then medium change with the mouse ES
medium was continued every 2 to 3 days. Eleven days after the
introduction of three gene (human Oct3/4, Sox2 and Klf4) retrovirus
vector, the cells were subcultured from each well of the 24-well
plastic plate to each well of a 6-well plastic plate.
[0228] Then medium change with the mouse ES medium was continued
every 2 to 3 days. Nineteen days after said three gene
introduction, the pluripotent stem cells formed colonies composed
of mouse ES cell-like small cells. In order to confirm the alkaline
phosphatase activity, the medium was removed and then a 10%
formalin neutral buffer solution was added to wells, and fixed at
room temperature for 5 minutes. After washing with a phosphate
buffer etc., the 1 step NBT/BCIP solution (manufactured by Pierce)
comprising a chromogenic substrate of alkaline phosphatase was
added and reacted at room temperature for 20 to 30 minutes. The
colonies of said pluripotent stem cells were stained blue violet by
alkaline phosphatase activity.
[0229] Then, the amount expressed of the Nanog gene was confirmed
by quantitative PCR, and the expression of mouse Nanog of colonies
of pluripotent stem cells having alkaline phosphatase activity was
confirmed.
[0230] Using cells derived from mouse bone marrow that is a mouse
postnatal tissue, the induction of pluripotent stem cells was
carried out with the introduction of three genes.
[0231] The primary culture cells derived from mouse bone marrow
containing undifferentiated stem cells that had been stored frozen
after preparing in Example 11 were plated at a concentration of
1.times.10.sup.4 cells/cm.sup.2 on a 6-well plastic plate
(manufactured by Becton Dickinson) the bottom of which had been
gelatin-coated with a 0.1% gelatin/phosphate buffer solution, and
the MAPC medium was added in 2 ml portions.
[0232] Two days later, the medium was removed, the three gene
(human Oct3/4, Sox2 and Klf4) retrovirus vector solution prepared
as in Example 1 were added in 2 ml portions, and after culturing at
37.degree. C. for 1 day, the virus solution was removed, and the
MAPC medium was added in 2 ml portions. Three days later, the
medium was replaced with the mouse ES medium [a final concentration
of 0.3% FBS (manufactured by Invitrogen), 1000 units/ml LIF
(manufactured by Chemicon) and 0.1 mM 2-mercaptoethanol were added
to the ES medium at the time of use]. Medium change with the mouse
ES medium was continued every 2 to 3 days. Nine days after the
introduction of three gene (human Oct3/4, Sox2 and Klf4) retrovirus
vector, the cells were subcultured from each well of the 6-well
plastic plate to each well of a 10 cm plastic dish.
[0233] Medium change with the mouse ES medium was continued every 2
to 3 days. Seven days after said three gene introduction, the
pluripotent stem cells formed colonies composed of mouse ES
cell-like small cells. In order to confirm the alkaline phosphatase
activity, the medium was removed and then a 10% formalin neutral
buffer solution was added to wells, and fixed at room temperature
for 5 minutes. After washing with a phosphate buffer etc., the 1
step NBT/BCIP (manufactured by Pierce), a chromogenic substrate of
alkaline phosphatase, was added and reacted at room temperature for
20 to 30 minutes. The colonies of said pluripotent stem cells were
stained blue violet by alkaline phosphatase activity.
[0234] Then, the amount expressed of the Nanog gene was confirmed
by quantitative PCR, and the expression of mouse Nanog of colonies
of pluripotent stem cells having alkaline phosphatase activity was
confirmed.
[0235] Forty nine days after said three gene introduction, the
mouse pluripotent stem cells were subcutaneously transplanted on
the back of syngeneic C57BL/6N mice at 2.times.10.sup.7
cells/mouse, and 13 and 17 days later the teratoma that formed was
extracted. Slices were prepared from the extracted teratoma, and
differentiation potential into three germ layers was analyzed by
immunological and histological staining (HE stain, alcian blue
stain). As a result, GFAP-positive cells (the nervous system) and
keratin producing cells as the ectodermic system, smooth muscle
actin-positive cells (smooth muscle cells), bone tissues and
cartilage tissues as the mesodermic system, and intestinal tract
tissues (endodermal epithelium positive for MUC-1) as the
endodermic system were observed.
[0236] Likewise, after said three gene introduction, the mouse
pluripotent stem cells which were single-sorted based on GFP and
SSEA-1 positive with FACSAria, were subcutaneously transplanted on
the back of syngeneic C57BL/6N mice at 2.times.10.sup.7
cells/mouse, and 13 and 14 days later the teratoma that formed was
extracted. Slices were prepared from the extracted teratoma, and
differentiation potential into three germ layers was analyzed by
immunological and histological staining (HE stain, alcian blue
stain). As a result, neural tube derived cells positive for GFAP,
Nestin or Neurofilament as ectodermic system and cartilage tissues
as the mesodermic system, and intestinal tract tissues (endodermal
epithelium positive for MUC-1 and alpha-fetoprotein) as the
endodermic system were observed.
[0237] From the above results, pluripotent stem cell were obtained
by the forced expression of each of three genes of Oct3/4, Sox2,
and Klf4 in undifferentiated stem cell present in a postnatal
tissue. The pluripotent stem cells showed an in vitro long-term
self-renewal ability, and were expressed ES cell marker, Nanog
expression and alkaline phosphatase activity, and the ability of
differentiation of tissues derivative from all three germ layers
(ectoderm, mesoderm and endoderm).
Example 14
Long Term Expansion and Characterization of Human Induced
Pluripotent Stem Cells
[0238] Human induced pluripotent stem (iPS) cell line generated
from neonatal human skin fibroblasts (lot # 5F0438) in Example
which was termed iPS-1 was further sub-cloned with cloning cylinder
and 0.25% trypsin-EDTA as described in Example 6. Nine sub-clones
which were termed human iPS-1-1, 1-2, 1-3, 1-4, 1-5, 1-6, 1-7, 1-8
and 1-9 were obtained. One of nine sub clones, termed human iPS-1-8
clone, was successfully expanded on MEF feeder cells in human ES
medium supplemented with 0.1 mM 2-mercaptoethanol and 10 ng/ml bFGF
or in mTeSR1 defined medium (Stem cell Technologies) on matrigel
(Invitrogen)-coated culture dishes. Medium was changed for human
iPS-1-8 clone culture everyday and usually treated with 5 to 20
.mu.M of Y-27632 (Calbiochem) to avoid cell apoptosis triggered by
the passaging procedures. For the passage to continue the culture,
human induced pluripotent stem cells were washed with Hanks's
balanced solution, incubated in 0.25% trypsin-EDTA (Gibco) at
37.degree. C. for 3 minutes, and then added the culture medium to
terminate the trypsin activity. Human induced pluripotent stem
cells were centrifuged at 300.times.g at room temperature or
4.degree. C. for 5 minutes and the supernatant was removed.
Precipitated human induced pluripotent stem cells were re-suspended
into culture medium. The pluripotent stem cells were usually split
into new culture dishes using 1:4 to 1:6 splits. Human iPS-1-8
clone was frozen using Cell freezing solution for ES cells
(Reprocell) according to the manufacture's manual.
[0239] Human iPS-1-8 clone was morphologically indistinguishable
from typical human ES cell colonies that consist of small, round,
and compact cells with defined edges when cultured on mitomycin-C
treated mouse embryonic fibroblasts (MEFs) (FIG. 4). Human iPS-1-8
clone actively proliferated in mTeSR1 medium. Human iPS-1-8 clone
derived cells cultured in mTeSR1 medium was termed human iPS-1-8
mTeSR cells. Human iPS-1-8 clone was able to be passaged more than
30 times, and cultured for more than half year after four factor
infections (FIGS. 4f,g). Human iPS-1-8 mTeSR cells were able to be
stored in liquid nitrogen and re-cultured in mTeSR medium in the
presence of 5 to 20 .mu.M of Y-27632. Population doubling time of
human iPS-1-8 mTeSR cells was approximately 48.5 hours when
analyzed between passages 19 to 26 which correspond to days 123 to
148 after four factor infection.
[0240] Karyotype analysis of long-term cultured human iPS-1-8 clone
(1-8 mTeSR) was performed using giemsa stain and multicolor-FISH
analysis. Human iPS cells were pretreated with 0.02 .mu.g/ml
colecemid for 2 hours, followed by incubation with 0.075 M KCl for
20 minutes, and then fixed with Carnoy's fixative. For
multicolor-FISH analysis, cells were hybridized with the multicolor
FISH probe (Cambio) and analyzed under DMRA2 fluorescent microscope
(Leica). Human iPS-1-8 mTeSR cells mainly maintained a normal
karyotype (46XY) after long-term culture in mTeSR (68%) without any
chromosomal translocation or deletion (FIG. 4h, Table 3).
[0241] For alkaline phosphatase staining, cells were fixed with 10%
formalin neutral buffer solution (Wako) at room temperature for 5
minutes, washed with PBS, and incubated with alkaline phosphatase
substrate 1 step NBT/BCIP (Pierce) at room temperature for 20-30
minutes. Cells having alkaline phosphatase activity were stained in
blue violet. For immunocytochemistry, cultured cells were fixed
with 10% formaldehyde for 10 minutes and blocked with 0.1%
gelatin/PBS at room temperature for 1 hour. The cells were
incubated overnight at 4.degree. C. with primary antibodies against
SSEA-3 (MC-631; Chemicon), SSEA-4 (MC813-70; Chemicon) TRA-1-60
(abcam), TRA-1-81 (abcam), CD9 (M-L13; R&D systems), CD24
(ALB9; abcam), CD90 (5E10; BD bioscience), or Nanog (R&D
systems). For Nanog staining, cells were permeabilized with 0.1%
Triton X-100/PBS before blocking. The cells were washed with PBS
for three times, and then incubated with AlexaFluor 488-conjugated
secondary antibodies (Molecular Probes) and Hoechst 33258 at room
temperature for 1 hour. After further washing, fluorescence was
detected with an Axiovert 200M microscope (Carl Zeiss).
[0242] Human iPS-1-8 mTeSR cells were positive for alkaline
phosphatase (hereinafter referred to as "ALP") activity and the
glycolipid antigens SSEA-3 and SSEA-4, the keratin sulfate antigens
TRA-1-60 and TRA-1-81, and the protein antigens CD9, CD24, Thy-1
(CD90) staining (FIG. 5).
[0243] Total RNA was isolated from human iPS-1-8 clone, its
parental fibroblasts, and crude fibroblasts obtained on 17 days
after gene transduction by using RNeasy (Qiagen). cDNA was
synthesized by SuperScript III (Invitrogen). Gene expressions were
detected by PCR using Extaq (Takara). Sequences of the primers were
described in Table 4.
[0244] Human iPS-1-8 clone expressed human ES marker genes Nanog,
TERT, Sa114, Zfp42, GDF3, Dnmt3b, TDGF1, GABRB3, and CYP26A1 though
the parental fibroblasts expressed none of those marker genes (FIG.
6a). In contrast to crude fibroblasts, human iPS-1-8 clone
down-regulated forced expression of four genes (FIG. 6b).
[0245] Human iPS cells cultured in both mTeSR on matrigel
.quadrature.1-8 mTeSR.quadrature. and MEF-conditioned medium on
matrigel (1-8CM) and its parental fibroblasts (5F0438) were
analyzed for global gene expression. The microarray study was
carried out using the Affymetrix Human Genome U133 Plus 2.0 gene
expression arrays (Affymetrix, Santa Clara, Calif.). The
GeneChip.RTM. Human Genome U133 Plus 2.0 Array provides
comprehensive coverage of the transcribed human genome on a single
array and analyzes the expression level of over 47,000 transcripts
and variants, including 38,500 well-characterized human genes.
Briefly, total RNA was extracted from cells with RNAeasy (Qiagen).
Biotin-labelled cRNA was reverse transcribed from 1 .mu.g of total
RNA according to Affymetrix technical protocols. Fifteen micrograms
of cRNA was fragmented and hybridized to a Affymetrix U133 plus 2
GeneChip arrays at 45.degree. C. for 16 hours and then washed and
stained using the Affimetrix Fluidics (Affymetrix). The assays were
scanned in the Affimetrix GCS3000 scanner, and the image obtained
were analyzed using the GCOS software. Data from this experiment
and GEO were investigated with the GeneSpring 7.3.1. software.
[0246] For scatter plot analyses, human induced pluripotent stem
cell clone-1-8, cultured in mTeSR on matrigel (1-8 mTeSR) and its
parental fibroblasts (5F0438) were analyzed based on a set of
21,080 genes with present flag call (P<0.04) or marginal flag
call (0.04.quadrature. P<0.06) for both clone 1-8 and H14 hES
line which is data from GEO (GSM151741), were used as a
representative of human ES cells for comparison.
[0247] For cluster analysis, DNA microarray data for clone-1-8
cultured in mTeSR (1-8 mTeSR), clone 1-8 cultured in
MEF-conditioned medium (1-8CM) and its parental fibroblasts
(5F0438) were compared with DNA microarray data for Sheff 4 line
cultured on MEF (hES1:GSM194307, hES2: GSM194308, hES3: GSM194309),
Sheff 4 line cultured on matrigel (hES4: GSM194313, hES5:
GSM194314), H14 line cultured on MEF (hES6: GSM151739, hES7:
GSM151741), and three fibroblasts (GSM96262 for Fibroblasts1,
GSM96263 for Fibroblasts2 and GSM96264 for Fibroblasts3).
[0248] The global gene expression profile of the human iPS cell
line (clone 1-8) and its parental fibroblasts were analyzed.
Cluster analysis using the gene set defined by the International
Stem Cell Initiative revealed that the human iPS cell line 1-8
clustered with human ES cell lines but separated from the parental
fibroblasts (FIG. 8). Although the pearson correlation coefficient
was 0.675 between human ES cell lines sheff4 and H14, the
coefficient was 0.835 between human iPS cell line 1-8 and human ES
cell line H14 (FIG. 8). This analysis indicate that human iPS cell
line 1-8 had a similar gene expression pattern to the human ES cell
lines H14. Scatter plot analysis between indicate that the human ES
cell marker genes, Nanog, Oct3/4, TDGF1, Dnmt3b, GABRB3, GDF3,
Zfp42, ALP, CD9, and Thy-1 showed high correlation between human
iPS cell line and human ES cell line H14 (FIG. 7a). In contrast,
clonel-8 was different from the parental neonatal fibroblasts (FIG.
7b). This was confirmed by the cluster analysis using the
nanog-related genes. Pearson correlation coefficient was 0.908
between human iPS cell line 1-8 and human ES cell line H14 and
0.100 between human iPS cell line 1-8 and its parental fibroblasts
(FIG. 9). These analysis reveal that human iPS cell line is
indistinguishable from human ES cell line in gene expression.
[0249] The promoter regions of Nanog and Oct3/4 were analyzed for
methylation of individual CpG sites. Ten nanograms of
bisulfite-treated genomic DNA was PCR-amplified with primers
containing a T7-promoter and transcripts treated with RNase A. As
fragments originating from a methylated CpG sequence contained a G
instead of an A-base, they had a 16 Da higher molecular weight than
those resulting from the corresponding non-methylated CpG. This
mass difference was detected using a MALDI-TOF mass spectrometer
(Autoflex, Bruker Daltonics). The spectra produced by the mass
spectrometer were analyzed using the EpiTYPER (Sequenom). The
percentage methylation of individual CpG sites was calculated using
the area under the peak of the signal from the unmethylated and
methylated fragments. The percentage methylation of individual CpG
sites were calculated using the area under the peak of the signal
from the unmethylated and methylated fragments. Table 9 lists up
locations and sizes in genome corresponding to amplicon using for
methylation analyses. Table 10 lists up the primer sets using for
methylation analyses. The Oct3/4 proximal promoter including
conserved region 1 (CR1), the Oct3/4 promoter distal enhancer
including CR4 and the Nanog proximal promoter including Oct3/4 and
Sox2 binding sites were examined (FIG. 10a). As shown in FIG. 10b,
cytosine-phosphate-guanosine (CpG) dinucleotides in these regions
are demethylated in clone 1-8 derived cells compared to the
parental fibroblasts.
[0250] Human iPS-1-8 mTeSR cell-suspension (0.5 to 2.times.10.sup.6
cells/mouse) was injected into the medulla of left testis of 7 to 8
week old SCID mice (CB17, Oriental Yeast) using a Hamilton syringe.
After 6 to 8 weeks, the teratomas were excised under perfusion with
PBS followed with 10% buffered formalin, and subjected to the
histological analysis. Human iPS-1-8 mTeSR cells gave rise to
teratomas 4 to 8 weeks after transplantation into testes of SCID
mice.
[0251] Teratomas were embedded in the mounting medium, and
sectioned at 10 .mu.m on a cryostat. Serial sections were stained
with hematoxylin-eosin (HE) to visualize the general morphology.
For the detection of cartilage, alcian blue staining was employed
or combined with HE.
[0252] For immunostaining, sections were treated with Immunoblock
(Dainippon-Sumitomo) for 30 minutes to block non-specific binding.
Slides were incubated with the following primary antibodies: anti
Nestin polyclonal antibody (PRB-570C, COVANCE, 1:300), anti Type II
collagen polyclonal antibody (LB-1297, LSL, 1:200), anti Smooth
muscle actin polyclonal antibody (RB-9010--R7, LAB VISION, 1:1),
anti .alpha.-Fetoprotein polyclonal antibody (A0008, DAKO, 1:500),
anti MUC-1 polyclonal antibody (RB-9222-P0, LAB VISION, 1:100), and
anti Human nuclei monoclonal antibody (HuNu) (MAB1281, CHEMICON,
1:300). For Type II collagen, before the treatment with primary
antibody a section was incubated with Hyaluronidase (25 mg/mL) for
30 minutes. Localization of antigens was visualized by using
appropriate secondary antibodies (Alexa fluor 594 and 688,
Molecular Probes, 1:600). Nuclei were stained with DAPI.
Immunostained teratoma sections were analyzed under a fluorescence
microscope (Axio Imager Z1, Zeiss).
[0253] Teratomas of human iPS-1-8 mTeSR cells contained tissues
representative of three germ layers, neuroectoderm, mesoderm, and
endoderm. FIG. 11 shows teratoma that was derived from human
iPS-1-8 mTeSR cells cultured for 94 days (T1). Human iPS-1-8 mTeSR
cells were injected into SCID mouse testes and analyzed 56 days
after injection. HE and alcian blue staining of teratoma tissues
reveled that teratomas contained neural epitherium (positive for
nestin) cartilage (positive for collagen II), endodermal tract
(alpha-fetoprotein). Human iPS-1-8 mTeSR cell derived tissues were
distinguished from host tissues by HuNu staining. In T1 teratoma,
smooth muscle cells (positive for alpha-SMA) and secretary
epithelium (positive for MUC-1) were also observed (FIG. 12). Human
iPS-1-8 mTeSR cells which were cultured for 102 days and 114 days,
were injected into SCID mouse testes and analyzed 48 days and 42
days (T3) after injection, respectively (T2, FIG. 12, T3, FIG. 13).
Tissues representative of three germ layers, neuroectoderm,
mesoderm and endoderm, were observed. To confirm whether human iPS
can be cryopreserved, human iPS-1-8 mTeSR cells were frozen down,
stored in liquid nitrogen and recultured. These cells were injected
into SCID mouse testes and analyzed 46 days (T-F1) and 48 days
(T-F2) after injection. Tissues representative of three germ
layers, neuroectoderm, mesoderm and endoderm, were observed.
Melanocytes were also observed in the T-F2 teratoma (FIG. 13).
Thus, pluripotency was maintained via freezing and thawing.
[0254] Both southern blot analysis and genomic PCR analysis
indicated human iPS-1-8 clone carried four transgenes. In southern
blot analysis cDNA fragments were prepared by restriction enzyme
digestion (XhoI for POU5F1, NotI for Sox2, PstI for KIF4) from the
corresponding pMX vector plasmids. These fragments were purified as
[32P]-labeled probes with agarose gel electrophoresis and a
QIAquick gel extraction kit (QIAGEN). Genomic DNA was prepared from
the human iPS clone 1-8 and its parental fibroblasts. Five .mu.g of
each genomic DNA was digested with KpnI (POU5F1, Sox2, and Klf4).
Fragments were separated on a 0.8% agarose gel, blotted onto
HybondXL membrane (GE Healthcare), and hybridized with
[32P]-labeled probes. Human iPS clone-1-8 was shown to carry
approximately ten copies of both Oct3/4 transgenes and Sox2
transgenes, and a single copy of Klf4 transgene (FIG. 14). In
genomic PCR analysis, primer set indicated as c-Myc-total in Table
4 was designed so that the amplicon included whole second intron of
c-Myc. Thus, amplicon size of the transgene (338 bp) was smaller
than amplicon of endogene (1814 bp). Vector plasmid and the
parental fibroblast genome, crude cultured fibroblast genome
obtained from 17 days culture post infection were used as a control
template. The genomic PCR confirmed clone-1-8 cells carries c-Myc
transgene (FIG. 14).
[0255] SNP genotyping was performed with the use of the GeneChip
Human Mapping 500K Array Set (Affymetrix) according to the
manufacture's protocol. Human iPS-1-8 mTeSR cells cultured in mTeSR
on matrigel, its parental fibroblasts (5F0438), and fibroblast
(5F0416) derived from a different donor were analyzed for this
assay. The array set includes a StyI and a NspI chip. Two aliquots
of 250 ng of DNA each were digested with NspI and StyI,
respectively. Each enzyme preparation was hybridized to the
corresponding SNP array (262,000 and 238,000 on the NspI and StyI
array respectively). The 93% call rate threshold at P=0.33 (dynamic
Model algorithm confidence threshold) with the Dynamic Model
algorithm138 was used in individual assays.
[0256] To confirm whether human iPS-1-8 mTeSR cells were generated
from fibroblasts (5F0438), we compared SNP genotyping between human
iPS-1-8 mTeSR cells and the employed fibroblasts (Table 5). SNPs of
human iPS-1-8 mTeSR cells were consistent to that of parental cells
in 464,069 (99.17%) of 467,946 of called SNPs and different from
that of parental cells in 3,877 (0.83%) of them. In contrast, SNPs
of human iPS-1-8 mTeSR cells were consistent to that of unrelated
donor cells (5F0416) only in 284,950 (60.50%) of 470,960 of called
SNPs and different from that of the unrelated cells in 186,010
(39.50%) of them. Thus, human iPS-1-8 clone (1-8 mTeSR) and
parental cells had almost the same SNP genotype each other,
strongly suggesting that both cells were originated from a single
donor.
[0257] HLA DNA typing was performed by utilizing hybridization of
PCR-amplified DNA with sequence specific oligonucleotide probes
(SSOP) (Luminex). Assays were performed to determine the HLA-A,
HLA-B, HLA-Cw, HLA-DR, HLA-DQ, HLA-DP and Bw loci according to
manufacturer's instructions. Human iPS cells are promising
materials in cell transplantation therapies, they would overcome
immune rejection, because human iPS cells can be directly generated
from patients' cells and must be the identical HLA type. To
actually prove the HLA issue, we carried out HLA typing of human
iPS-1-8 clone (1-8 mTeSR), parental cells (5F0438), and unrelated
fibroblasts (5F0416). As expected, HLA type of iPS-1-8 clone was
completely identical to that of 5F0438 but not 5F0416 (Table
6).
[0258] From the foregoing, human pluripotent stem cell were
obtained by the forced expression of each of four genes of Oct3/4,
Sox2, Klf4, and c-Myc in undifferentiated stem cell present in a
human postnatal tissue. The human pluripotent stem cells showed an
in vitro long-term self-renewal ability and the pluripotency of
differentiation into ectoderm, mesoderm and endoderm. The human
pluripotent stem cells were expressed cell surface antigens SSEA-3,
SSEA-4, TRA-1-60, TRA-1-81, CD9, CD24, and CD90, and ES cell marker
genes Nanog, Oct3/4, TDGF1, Dnmt3b, GABRB3, GDF3, Zfp42, ALP, CD9,
and Thy-1. The promoter regions of Nanog and Oct3/4 in the human
pluripotent stem cells were demethylated compared to the parental
fibroblasts. The human pluripotent stem cells carries at least a
single copy of Oct3/4, Sox2, Klf4, and c-Myc transgene. The induced
human pluripotent stem cells and the parental cells
(undifferentiated stem cell present in a human postnatal tissue)
had almost the same SNP genotype each other, and HLA type of the
induced human pluripotent stem cell was completely identical to
that of the parental cell (undifferentiated stem cell present in a
human postnatal tissue).
Example 15
Gene Expression Profile of Primary Culture of 4 Genes Introduced
Neonatal Fibroblast
[0259] Two lots of neonatal fibroblasts (5F0416 and 5F0474) were
seeded at 10.sup.3 cells/cm.sup.2 or 10.sup.4 cells/cm.sup.2 into
35 mm diameter wells of 6 well plates and cultured in FBM
supplemented with FGM-2 SingleQuots (manufactured by Lonza) before
the four genes transduction. Cells were infected with
mCAT1-adenovirus vectors at 2.times.10.sup.5 ifu/well and then
infected with the retroviral vectors carrying four genes as
described in Example 6. Eight wells were prepared for this study (2
different lot and 2 different densities in duplicate).
[0260] Seventeen days post 4-gene infection, cells were fixed and
stained for alkaline phosphatase (ALP) as described in Example 3.
In total, 163 ALP positive (+) colonies were observed in four
independent experiments. All 163 ALP (+) colonies and 18
ALP-negative (ALP (-)) colonies were dissected, and total RNA from
these colonies were extracted using a RecoverAll Total Nucleic Acid
Isolation kit (manufactured by Ambion). After the cDNA preparation,
genes of interest were amplified using Taqman preamp (manufactured
by Applied Biosystems). Real-time quantitative PCR was performed
with ABI PRISM 7900HT (manufactured by Applied Biosystems) using
PCR primer sets (manufactured by Applied Biosystems, Nanog,
Hs02387400_g1, Dnmt3b, Hs00171876_m1, FoxD3, Hs00255287_s1, Zfp42,
Hs01938187_s1, TDGF1, Hs02339499_g1, TERT, Hs00162669_m1, GDF3,
Hs00220998_m1, CYP26A1, Hs00175627_m1, GAPDH, Hs99999905_m1) to
determine gene expression of human ES cell markers in colonies.
Eight genes (Nanog, TDGF1, Dnmt3b Zfp42 FoxD3, GDF3, CYP26A1 and
TERT genes) which were reported to express in human ES cells were
selected as a pluripotent stem cell marker genes. A standard curves
was generated for each primer pair. All expression values were
normalized against GAPDH.
[0261] It is known that mouse ES cells and mouse iPS cells form
multilayered/aggregated colonies. Thus we first analyzed the mouse
ES cell like aggregated colonies which were induced by ectopic
expression of four gene in human fibroblasts (e.g. colony #1-2-F
and #1-2-B in FIG. 22). However, these colonies are all ALP (-).
Next we analyzed the Nanog gene expression in colonies. Nanog gene
expression was observed in 161 out of 163 ALP positive colonies and
16 out of 18 ALP negative colonies. On the other hand expression of
TERT and CYP26A1 genes were observed only in 26 and 24 colonies out
of 163 ALP positive colonies respectively (FIG. 15a). Genes such as
Nanog, TDGF, and Dnmt3b which are well know to be close association
with the pluripotent state in human ES cells, and to be strongly
downregulated upon their differentiation had higher tendency to be
induced by the four gene transduction.
[0262] ALP positive colonies can be categorized into 40 groups
based on the gene expression pattern of the eight human marker
genes (Table 7). When colonies are categorized by the total number
of eight marker genes expression, the distribution of colony number
followed a normal distribution suggesting the presence of a
stochastic process in the colony induction (FIGS. 15c,d). In
addition the efficiency of human ES cell marker gene expression in
human fibroblasts was affected by the donor difference.
[0263] Quantitative gene expression analysis of colonies formed 17
days after infection indicated that the transgenes c-Myc and Oct4
showed high expression in all the analyzed colonies (Table 11). In
addition endogenous Nanog expression was very high in most of the
ALP positive colonies, including cells lacking expression of one or
more of the eight human ES cell marker genes (Table 11). These
results indicate that the process of pluripotent stem cell
induction from human skin fibroblasts is slower than that described
for mouse iPS cell generation. Only 4 out of 163 ALP positive
colonies were positive for Nanog, TDGF1, Dnmt3b, Zfp42, FoxD3,
GDF3, Cyp26a1 and TERT (octa-positive coloniy). Cells in these
octa-positive colonies showed common features: 1) small size with
the high nucleus to cytoplasm ratio and 2) formation of small
monolayer colonies within the space between fibroblasts (FIG. 15c).
These features are consistent to the feature of human ES cells.
However, these three features were also observed in some of ALP (+)
colonies which lacked one or more ES cell marker expression. In
addition, the large colony with these three features lack ALP
expression (FIG. 22 colony #7-1-1). ALP (+) colonies with
fibroblastic feature (colony #5-1-7, #3-1-214, #3-2-233, #3-1-212,
#3-1-215, #5-1-4 in FIGS. 16-22 and Table 7, 11) usually lacked one
or more ES cell marker gene expressions.
[0264] These results indicate that induced pluripotent stem cells
can be isolated from small monolayer colonies comprising small
cells with high nucleus to cytoplasm ratio not from fibroblastic
colonies, defused colonies or multilayered colonies. Table 8
summarizes all of experiments and results on the ALP positive
colony number using human neonatal fibroblasts.
Example 16
Generation of Human iPS-2-4 Clone from Human Neonatal Skin
Fibroblasts
[0265] Adenovirus vector plasmids for mCAT1 were transfected into
29310 cells. The mCAT1-adenoviruses were isolated from these cells
by three freeze-thaw cycles, purified using Adenovirus purification
kit (Clontech) and stored at -80.degree. C. The titer of the vector
stocks was determined by Adeno-X rapid titer kit (Clontech).
[0266] The replication deficient MMLV derived retrovirus vector pMx
was used for the ectopic expression of human Oct3/4, Sox-2, c-Myc
and Klf4. Recombinant retroviruses were generated by transfecting
vectors to the Plat-E packaging system (Morita et al., 2000)
followed by incubation in FBM (Lonza) supplemented with FGM-2
SingleQuots (Lonza). Between 24 and 48 hours after the
transfection, supernatant from the Plat-E culture was collected
several times at intervals of at least 4 hours and passed through a
0.45 .mu.m filter.
[0267] For MEF-conditioned medium (MEF-CM) preparation, human ES
medium (DMEM/F12 (Gibco) supplemented with 20% Knockout Serum
Replacement (KSR, Invitrogen), 2 mM L-glutamine (Sigma), 1.times.
nonessential amino acids (Sigma), 10 .mu.g/ml gentamycin), 10 ng/ml
bFGF was conditioned on mitomycin-C treated MEF (Reprocell) for
20-24 hours, harvested, filtered through a 0.45 .mu.m filter and
supplemented with 0.1 mM 2-mercaptoethanol (Sigma) and 10 ng/ml
bFGF before use.
[0268] Using cells (trade name: Neonatal Normal Human Skin
Fibroblasts, primary culture) derived from a human neonatal tissue,
a human tissue immediately after birth, the induction of human
pluripotent stem cells from undifferentiated stem cells present in
the skin of a human neonate was attempted.
[0269] Human neonatal dermal fibroblasts (Lonza; lot 5F0416) were
cultured in FBM supplemented with FGM-2 SingleQuots. Three days
before the 4 gene introduction, fibroblasts were seeded at 10.sup.3
cells/cm.sup.2 into 6 well plates. Eighteen hours later, the cells
were mixed with the mCAT1 adenovirus vector solution in 500 .mu.l
Hanks' balanced salt solution, and incubated at room temperature
for 30 min. The cells were then added to 2 ml of medium and
cultured for 48 hrs. Subsequently, the cells were incubated in 2 ml
of the retrovirus/polybrene solution (mixture of equal volumes of
the retrovirus vector suspension for each of the four genes
(Oct3/4, Sox2, Klf4 and c-Myc) prepared in Example 1, supplemented
with 5 .mu.g/ml of polybrene) at 37.degree. C. for 4 hrs to
overnight. The virus supernatant was replaced with the
MEF-conditioned ES medium. Then medium was changed every days.
[0270] On day 33 after gene introduction, a colony with a
characteristic shape was picked with forceps from a well. The
picked colony was transferred into a matigel-coated well in a
24-well plate and maintained in mTeSR defined medium supplemented
with 10 .mu.M Y-27632. Fourteen hours later the medium was changed.
Medium change was continued every days. At day 54 after the
infection a second culture was carried out. At day 67, human
iPS-2-4 clone was sub-cloned and designated as human iPS-2-4
sub-clone.
[0271] For passaging, medium was removed, and the cells were washed
with the Hank's balanced salt solution followed by the treatment
with 0.25% trysin-EDTA at 37.degree. C. for 3 minutes. Fresh medium
was added to stop the reaction. The cell suspension was centrifuged
at 4.degree. C. and 200.times.g for 5 minutes, and the supernatant
was removed. The cells were resuspended in mTeSR defined medium
supplemented with 10 .mu.M Y-27632 and plated.
[0272] Human iPS-2-4 sub-clone was successfully expanded in mTeSR1
defined medium (Stem cell Technologies) on matrigel
(Invitrogen)-coated culture dishes. We termed cells derived from
the sub-clone iPS-2-4 and cultured in mTeSR1 medium as human
iPS-2-4 mTeSR cells. Medium was changed for human iPS-2-4 mTeSR
cell culture everyday and usually treated with Y-27632 (Calbiochem)
to avoid cell apoptosis after passaging. For passaging, cells were
washed with Hanks's balanced solution, incubated in 0.25%
trypsin-EDTA (Gibco) at 37.degree. C. for 3 minutes, and then added
the culture medium. Cells were centrifuged at 300.times.g at room
temperature or 4.degree. C. for 5 minutes and the supernatant was
removed. The cells were re-suspended into culture medium. Human
iPS-2-4 mTeSR cells were morphologically indistinguishable from
typical human ES cells and human iPS-1-8 mTeSR cells consisting of
small, round, and high nucleus to cytoplasm ratio cells with
defined edges.
[0273] Fifty nine days post 4-gene infection, a part of cells were
fixed and stained for alkaline phosphatase (ALP) as described in
Example 3. Colonies consisting of cells were positive for ALP and
Total RNA from colonies were extracted using a RecoverAll Total
Nucleic Acid Isolation kit (manufactured by Ambion). After the cDNA
preparation, genes of interest were amplified using Taqman preamp
(manufactured by Applied Biosystems). Real-time quantitative PCR
was performed with ABI PRISM 7900HT (manufactured by Applied
Biosystems) using PCR primer sets (manufactured by Applied
Biosystems, Nanog, Hs02387400_g1, Dnmt3b, Hs00171876_m1, FoxD3,
Hs00255287_s1, Zfp42, Hs01938187_s1, TDGF1, Hs02339499_g1, TERT,
Hs00162669_m1, GDF3, Hs00220998_m1, CYP26A1, Hs00175627_m1, GAPDH,
Hs99999905_m1) to determine gene expression of human ES cell
markers in colonies. Conle-2-4 showed ES cell marker gene
expressions (Table 12).
[0274] From the above results, human pluripotent stem cell were
obtained by the forced expression of each of four genes of Oct3/4,
Sox2, Klf4, and c-Myc in undifferentiated stem cell present in a
human postnatal tissue. The human pluripotent stem cells showed an
in vitro long-term self-renewal ability, and were expressed ES cell
marker genes Nanog, Oct3/4, TDGF1, Dnmt3b, GABRB3, GDF3, Zfp42,
ALP, CD9, and Thy-1.
Example 17
Generation of Human iPS-3-2 Clone from Human Neonatal Skin
Fibroblasts
[0275] According to Example 16, human neonatal dermal fibroblasts
(Lonza; lot 5F0438) were cultured in FBM supplemented with FGM-2
SingleQuots. Three days before the 4 gene introduction, fibroblasts
were seeded at 10.sup.3 cells/cm.sup.2 into 6 well plates. Eighteen
hours later, the cells were mixed with the mCAT1 adenovirus vector
solution in 500 .mu.l Hanks' balanced salt solution, and incubated
at room temperature for 30 min. The cells were then added to 2 ml
of medium and cultured for 48 hrs. Subsequently, the cells were
incubated in 2 ml of the retrovirus/polybrene solution (mixture of
equal volumes of the retrovirus vector suspension for each of the
four genes (Oct3/4, Sox2, Klf4 and c-Myc) prepared in Example 1,
supplemented with 5 .mu.g/ml of polybrene) at 37.degree. C. for 4
hrs to overnight. The virus supernatant was replaced with the
MEF-conditioned ES medium. Then medium was changed every days. On
day 21 after gene introduction, a colony with a characteristic
shape was directly picked with forceps from one of dishes. The
picked colony was transferred into a matigel-coated well in a
24-well plate and maintained in mTeSR defined medium supplemented
with 10 .mu.M Y-27632.
[0276] Fourteen hours later the medium was changed. Medium change
was continued every days. 40 days after the infection, a second
subcloning was carried out, and cells were successfully expanded in
mTeSR1 defined medium (Stem cell Technologies) on matrigel
(Invitrogen)-coated culture dishes. Medium was changed everyday and
usually treated with Y-27632 (Calbiochem) to avoid cell apoptosis
after passaging. For passaging, cells were washed with Hanks's
balanced solution, incubated in 0.25% trypsin-EDTA (Gibco) at
37.degree. C. for 5 minutes, and then added the culture medium.
Cells were centrifuged at 300.times.g at room temperature for 5
minutes and the supernatant was removed. The cells were
re-suspended into culture medium.
[0277] Cells were morphologically indistinguishable from typical
human ES cells, human iPS-1-8 mTeSR cells, and human iPS-2-4 mTeSR
cells that consist of small, round, and high nucleus to cytoplasm
ratio cells with defined edges. Thus we termed this clone as human
iPS-3-2 clone. Human iPS-3-2 clone actively proliferated in mTeSR1
medium. We termed these cells derived from human iPS-3-2 clone
which culture in mTeSR1 medium as human iPS-3-2 mTeSR cells.
[0278] Forty eight days post 4-gene infection, cells were fixed and
stained for alkaline phosphatase (ALP) as described in Example 3.
Total RNA from colonies were extracted using a RecoverAll Total
Nucleic Acid Isolation kit (manufactured by Ambion). After the cDNA
preparation, genes of interest were amplified using Taqman preamp
(manufactured by Applied Biosystems). Real-time quantitative PCR
was performed with ABI PRISM 7900HT (manufactured by Applied
Biosystems) using PCR primer sets (manufactured by Applied
Biosystems, Nanog, Hs02387400_g1, Dnmt3b, Hs00171876_m1, FoxD3,
Hs00255287_s1, Zfp42, Hs01938187_s1, TDGF1, Hs02339499_g1, TERT,
Hs00162669_m1, GDF3, Hs00220998_m1, CYP26A1, Hs00175627_m1, GAPDH,
Hs99999905_m1) to determine gene expression of human ES cell
markers in colonies. Conle-3-2 showed ES cell marker gene
expressions (Table 12).
[0279] From the above results, human pluripotent stem cell were
obtained by the forced expression of each of four genes of Oct3/4,
Sox2, Klf4, and c-Myc in undifferentiated stem cell present in a
human postnatal tissue. The human pluripotent stem cells showed an
in vitro long-term self-renewal ability, and were expressed ES cell
marker genes Nanog, Oct3/4, TDGF1, Dnmt3b, GABRB3, GDF3, Zfp42,
ALP, CD9, and Thy-1.
Table 1 shows the name of gene, the NCBI number, the virus vector
in which said gene was inserted, insert size, the restriction site
at the 5'-end, the restriction site at the 3'-end, the length of
the translated region, the length of the 3'-untranslated region,
clone ID, and the supplier of the four genes or the three genes and
the receptor of mouse ecotropic retrovirus vector (mCAT:
mouse-derived cationic amino acid transporter) used in
Examples.
TABLE-US-00001 TABLE 1 Construction data Gene- Name inserted 5'-end
3'-end Length of 3'- of virus Insert restriction restriction
translated untranslated gene NCBI No. vector size site site region
region Clone ID Supplier human NM_002701 pMXs-puro 1411 EcoRI Xho1
1083 274 6578897 Open Oct3/4 Biosystems human BC013923 pMXs-neo
1172 EcoRI Xho1 954 143 2823424 Open Sox2 Biosystems human BC058901
pMXs-IB 1876 EcoRI Xho1 1365 473 6012670 Open c-Myc Biosystems
human BC029923 pMXs-IB 1591 EcoRI EcoRI 1413 38 5111134 Open Klf4
Biosystems mCAT1 NM_007513 Adeno-X 2032 BssS1 BssS1 1869 132
A830015N05 RIKEN FANTOM clone
[0280] Table 2 summarizes the number of alkaline
phosphatase-positive colonies of Examples 4 to 7. For cell type,
the number of subculture is attached. The day of four gene
introduction is a day when a retrovirus vector was infected. Lot
No. is that of Lonza products. Age of donors is based on the donor
information of Lonza products. The number of colonies is the number
of colonies composed of alkaline phosphatase-positive small cells
per 10 cm.sup.2.
TABLE-US-00002 TABLE 2 Examples 5 to 8 and 10, Number of alkaline
phosphatase (ALP)-positive colonies formed by gene introduction No.
of passages at Serum the time of Cell concentration gene Date of
gene Date of ALP Colony Example Cell type Donor age Lot No. (%)
introduction introduction staining count* 8 Neonatal skin
fibroblast Neonate 5F0439 2 3 2007/3/20 2007/4/3 0.8 6 Neonatal
skin fibroblast Neonate 5F0438 2 2 2007/4/15 2007/4/29 6.0 6
Neonatal skin fibroblast Neonate 5F0438 2 2 2007/5/5 2007/5/16 6.0
6 Neonatal skin fibroblast Neonate 5F0474 2 2 2007/5/5 2007/5/16
4.0 6 Neonatal skin fibroblast Neonate 5F0438 2 2 2007/5/12
2007/5/26 7.0 6 Neonatal skin fibroblast Neonate 5F0474 2 2
2007/5/12 2007/5/26 9.5 7 Adult skin fibroblast 28 6F3535 2 2
2007/5/5 2007/5/16 2.0 7 Adult skin fibroblast 39 6F4026 2 2
2007/5/5 2007/5/16 0.0 5 Adult BM-derived cell (low 20 060470B 2 2
2007/3/20 2007/4/3 0.0 serum) 5 Adult BM-derived cell (low 20
060809B 2 2 2007/3/26 2007/4/9 0.0 serum) 5 Adult BM-derived cell
(low 20 060809B 2 2 2007/4/15 2007/4/29 0.2 serum) 5 Adult
BM-derived cell (low 20 060809B 2 2 2007/5/5 2007/5/19 0.0 serum) 5
Adult BM-derived mesenchymal 20 060809B 10 2 2007/3/20 2007/4/3 0.0
stem cell (high serum) 5 Adult BM-derived mesenchymal 20 060470B 10
2 2007/3/26 2007/4/9 0.0 stem cell (high serum) 10 Neonatal
umbilical cord artery Neonate 5F0442 5 4 2007/5/11 2007/5/24 0.0
smooth muscle cell *The number of colonies composed of alkaline
phosphatase-positive small cells per 10 cm.sup.2. "BM" in Table 2
means "Bone Marrow".
Table 3 summarizes the distribution of the karyotype of clone 1-8
at day 101. After the Giemsa stain, chromosome numbers were
counted. 67 of 100 cells showed normal karyotype.
TABLE-US-00003 TABLE 3 karyotype analysis Chromosome no. Cell no 44
1 45 22 46 67 47 7 48 1 89 1 136 1
One hundred cells were analyzed in human iPS cells (clone 1-8
mTeSR) Table 4 shows primer sequences used in FIG. 6 and FIG.
14.
TABLE-US-00004 TABLE 4 Primer Sequences for RT-PCR Forward primer
sequence Reverse primer sequence HPRT AGTCTGGCTTATATCCAACACTTCG
GACTTTGCTTTCCTTGGTCAGG Nanog TACCTCAGCCTCCAGCAGAT
TGCGTCACACCATTGCTATT TERT AGCCAGTCTCACCTTCAACCGC
GGAGTAGCAGAGGGAGGCCG Sall4 AAACCCCAGCACATCAACTC GTCATTCCCTGGGTGGTTC
Zfp42 TTGGAGTGCAATGGTGTGAT TCTGTTCACACAGGCTCCAG GDF3
GGCGTCCGCGGGAATGTACTTC TGGCTTAGGGGTGGTCTGGCC Dnmt3b
GCAGCGACCAGTCCTCCGACT AACGTGGGGAAGGCCTGTGC TDGF1
ACAGAACCTGCTGCCTGAAT AGAAATGCCTGAGGAAAGCA GABRB3
CTTGACAATCGAGTGGCTGA TCATCCGTGGTGTAGCCATA CYP26A1
AACCTGCACGACTCCTCGCACA AGGATGCGCATGGCGATTCG Oct4-total
GAGAAGGAGAAGCTGGAGCA AATAGAACCCCCAGGGTGAG Oct4-exo
AGTAGACGGCATCGCAGCTTGG GGAAGCTTAGCCAGGTCCGAGG Sox2-total
CAGGAGAACCCCAAGATGC GCAGCCGCTTAGCCTCG Sox2-exo ACACTGCCCCTCTCACACAT
CGGGACTATGGTTGCTGACT Klf4-total ACCCTGGGTCTTGAGGAAGT
ACGATCGTCTTCCCCTCTTT Klf4-exo CTCACCCTTACCGAGTCGGCG
GCAGCTGGGGCACCTGAACC c-Myc-total TCCAGCTTGTACCTGCAGGATCTGA
CCTCCAGCAGAAGGTGATCCAGACT c-Myc-exo AGTAGACGGCATCGCAGCTTGG
CCTCCAGCAGAAGGTGATCCAGACT
Table 5 summarizes SNP genotyping of human iPS clone 1-8 and
fibroblasts (5F0438 and 5F04156) which were analyzed using the
GeneChip Human Mapping 500K Array Set. SNPs of clone 1-8 were
consistent to that of parental cells in 464,069 (99.17%) of 467,946
of called SNPs and different from that of parental cells in 3,877
(0.83%) of them. In contrast, SNPs of clone 1-8 mTeSR were
consistent to that of unrelated donor cells (5F0416) only in
284,950 (60.50%) of 470,960 of called SNPs and different from that
of the unrelated cells in 186,010 (39.50%) of them.
TABLE-US-00005 TABLE 5 SNP genotyping 500K_Set Number of total
500,568 SNP Number of called SNP human iPS-1-8 484,393 96.77% neoFB
(5F0438) 480,249 95.94% neoFB (5F0416) 485,626 97.01% human iPS-1-8
vs. neoFB (5F0438) Called SNP in both samples 467,946 ratio
Consistent SNP 464,069 99.17% different SNP 3,877 0.83% No called
SNP in neither 32,622 human iPS-1-8 vs. neoFB (5F0416) Called SNP
in both samples 470,960 ratio Consistent SNP 284,950 60.50%
different SNP 186,010 39.50% No called SNP in neither 29,608
Table 6 The HLA-A, HLA-B, HLA-Cw and HLA-DR types of human iPS1-8
(1-8 mTeSR) and fibroblasts (5F0438 and 5F0416) were classified
using hybridization of PCR-amplified DNA with sequence specific
oligonucleotide probes (SSOP) (Luminex).
TABLE-US-00006 TABLE 6 HLA genotyping ID A allele B allele Cw
allele DRB1 allele DQB1 allele DPB1 allele 5F0438 *0101/ *0206/
*3801/09 *3905 *0602/ *0702/ *0802 *1104/43/ *0301/ *0402 *0402/
*0501 5F0416 *0201/ -- *1501/ *5101/ *0303/ *0401/ *0401/33/38
*0801/26 *0302/ *0402 *0201 *0301/ 1-8(5F0438) *0101/ *0206/
*3801/09 *3905 *0602/ *0702/ *0802 *1104/43/ *0301/ *0402 *0402/
*0501 ID HLA-A HLA-B HLA-Cw HLA-DR HLA-DQ HLA-DP Bw 5F0438 A1 A2
B38 B39 Cw6 Cw7 DR8.2 DR11 DQ7 DQ4 DP4 DP5 4/6 5F0416 A2 -- B62 B51
Cw9 Cw4 DR4.1 DR8.1 DQ8 DQ4 DP2 DP3 4/6 1-8(5F0438) A1 A2 B38 B39
Cw6 Cw7 DR8.2 DR11 DQ7 DQ4 DP4 DP5 4/6
Table 7 summarized hES cell marker gene expression patterns in
colonies. Colonies were stained for alkaline phosphatase at 17 days
post 4 genes transduction. All ALP (+) colonies and 18 ALP (-)
colonies were dissected and determined their hES marker gene
expression by RT-PCR. Each colony was categorized and counted the
number. "+" represents gene expression, and "-" represents no
detection by a 40 cycle RT-PCR using amplified cDNA samples.
TABLE-US-00007 TABLE 7 Gene expression patterns in ALP(+) and
ALP(-) colonies No. of Group gene No. of No. expressed Nanog TDGF1
Dnmt3b Zfp42 FoxD3 GDF3 CYP26A1 TERT colony Gene expression
patterns in ALP(+) colonies 1 8 + + + + + + + + 4 2 7 + + + + + + +
- 7 3 7 + + + + + + - + 11 4 7 + + + + + - + + 1 5 6 + + + + + + -
- 25 6 6 + + + + + - + - 4 7 6 + + + + + - - + 3 8 6 + + + + - + -
+ 2 9 6 + + + + - + + - 3 10 6 + + + - + + + - 1 11 6 + + + - - + +
+ 1 12 5 + + + + + - - - 22 13 5 + + + + - + - - 9 14 5 + + + + - -
+ - 2 15 5 + + + - + + - - 4 16 5 + + + - + - + - 2 17 5 + + + - -
+ + - 1 18 5 + + - + + + - - 2 19 5 + + - + + - - + 1 20 4 + + + +
- - - - 9 21 4 + + + - + - - - 3 22 4 + + + - - + - - 5 23 4 + + -
+ + - - - 7 24 4 + - + + + - - - 1 25 4 + - + - + + - - 2 26 4 + -
- + + + - - 1 27 3 + + + - - - - - 1 28 3 + + - + - - - - 3 29 3 +
+ - - + - - - 4 30 3 + + - - - - - + 1 31 3 + - + + - - - - 1 32 3
+ - + - + - - - 2 33 3 + - + - - + - - 1 34 3 + - - + + - - - 1 35
3 + - - - + + - - 1 36 2 + + - - - - - - 4 37 2 + - + - - - - - 5
38 2 + - - + - - - - 2 39 1 + - - - - - - - 2 40 0 - - - - - - - -
2 Gene expression patterns in ALP(-) colonies 41 6 + + + + + - + -
1 42 6 + + - + + + - + 1 43 5 + + + + + - - - 3 44 5 + + - + + - -
+ 6 45 4 + + + - + - - - 1 46 4 + + - + + - - - 1 47 4 + + + - - -
- + 1 48 2 + - - - - - - + 1 49 1 + - - - - - - - 1 50 1 - + - - -
- - - 1 51 0 - - - - - - - - 1
Table 8 summarizes the number of alkaline phosphatase-positive
colonies of the experiments using neonatal fibroblasts. The date of
four gene introduction is a day when a retrovirus vector was
infected. The donor indicates lot number of Lonza products. The
number of colonies is the number of colonies composed of alkaline
phosphatase-positive small cells per 10 cm.sup.2. ND: not
determined.
TABLE-US-00008 TABLE 8 List of experiments experimental conditions
ALP staining date of 4 gene cell density number of transduction
donor (cell.quadrature./cm.sup.2) date colony (/10 cm.sup.2) notes
2007/3/20 5F0439 1 .times. 10.sup.4 2007/4/3 0.8 2007/4/15 5F0438 1
.times. 10.sup.4 2007/4/29 6.0 iPS clone#1-8 2007/5/5 5F0438 1
.times. 10.sup.4 2007/5/16 6.0 5F0474 1 .times. 10.sup.4 4.0
2007/5/12 5F0438 1 .times. 10.sup.4 2007/5/26 7.0 5F0474 1 .times.
10.sup.4 9.5 2007/5/26 5F0474 1 .times. 10.sup.4 2007/6/9 13.3
2007/6/8 5F0416 1 .times. 10.sup.3 2007/6/22 19.0 5F0416 1 .times.
10.sup.4 17.5 5F0474 1 .times. 10.sup.4 14.0 2007/7/20 5F0416 1
.times. 10.sup.3 2007/8/6 3.0 5F0416 1 .times. 10.sup.4 9.0
2007/8/10 5F0416 1 .times. 10.sup.3 2007/8/27 21.0 ALP(+) colony
5F0416 1 .times. 10.sup.4 21.5 classification 5F0474 1 .times.
10.sup.3 17.0 5F0474 1 .times. 10.sup.4 19.5 2007/8/17 5F0416 1
.times. 10.sup.3 ND iPS clone #2-4 5F0416 1 .times. 10.sup.4 ND
5F0474 1 .times. 10.sup.3 ND 5F0474 1 .times. 10.sup.4 ND 2007/8/31
5F1195 1 .times. 10.sup.3 ND 2007/9/14 5F0438 1 .times. 10.sup.3 ND
iPS clone #3-2
Table 9 lists up locations and sizes in genome corresponding to
amplicons using for methylation analyses of the promoter regions of
Nanog and Oct3/4. Columns A, B and C indicate amplicon name,
locations and sizes in genome corresponding to amplicons,
respectively.
TABLE-US-00009 TABLE 9 Promoter regions in methylation analysis
amplicon location in genome corresponding size of name to amplicon
amplicon Nanog-z1 chr12: 7832645-7832959 315 Nanog-z2 chr12:
7832877-7833269 393 Oct3/4-z1 chr6: 31248581-31249029 449 Oct3/4-z2
chr6_qbl_hap2: 2388299-2388525 227
Table 10 lists up the primer sets using for methylation analyses of
the promoter regions of Nanog and Oct3/4. Columns A and B indicate
names of primers and sequences of primers (capital for
gene-specific sequences, lower case for tag sequences),
respectively.
TABLE-US-00010 TABLE 10 Primer sequences for methylation analyses
sequences of primers (capital names of for gene-specific sequences,
primers lower case for tag sequences) Nanog-z1-L
aggaagagagGGAATTTAAGGTGTATGTATTTTTTAT TTT Nanog-z1-R
cagtaatacgactcactatagggagaaggctATAACC CACCCCTATAATCCCAATA
Nanog-z2-L aggaagagagGTTAGGTTGGTTTTAAATTTTTGAT Nanog-z2-R
cagtaatacgactcactatagggagaaggctTTTATA ATAAAAACTCTATCACCTTAAACC
Oct3/4-z1-L aggaagagagTAGTAGGGATTTTTTGGATTGGTTT Oct3/4-z1-R
cagtaatacgactcactatagggagaaggctAAAACT TTTCCCCCACTCTTATATTAC
Oct3/4-z2-L aggaagagagGGTAATAAAGTGAGATTTTGTTTTAA AAA Oct3/4-z2-R
cagtaatacgactcactatagggagaaggctCCACCC ACTAACCTTAACCTCTAA
Table 11 summarizes relative mRNA expression in ALP positive
colonies of Examples 15. Numbers of colonies are corresponding to
FIG. 15-22. Colony #5-2-32, #5-2-49, #5-2-51, #7-2-37 expressed all
analyzed human ES cell markers. In contrast, fibroblastic colonies
#3-1-212, #3-1-215, #5-1-4 expressed only Nanog though it highly
expressed transgenes.
TABLE-US-00011 TABLE 11 Relative mRNA expression of ES cell markers
in ALP positive colonies Nanog GDF3 CYP26A1 Group Sample ALP mean
SD mean SD mean SD iPS 1-8 ALP(+) 1.0 1.0 1.0 1 #5-2-32 ALP(+) 9.3
.+-. 1.5 4.8 .+-. 0.3 27.2 .+-. 12.5 1 #5-2-49 ALP(+) 15.9 .+-. 5.7
242.9 .+-. 78.8 3.0 .+-. 0.3 1 #5-2-51 ALP(+) 27.1 .+-. 2.2 419.2
.+-. 24.7 73.5 .+-. 8.2 1 #7-2-37 ALP(+) 36.9 .+-. 7.8 171.3 .+-.
20.0 110.1 .+-. 15.4 3 #1-1-5 ALP(+) 21.0 .+-. 2.4 59.2 .+-. 10.2
0.0 .+-. 0.0 3 #1-1-11 ALP(+) 127.6 .+-. 6.0 259.7 .+-. 3.9 0.0
.+-. 0.0 3 #1-1-19 ALP(+) 32.6 .+-. 8.4 34.0 .+-. 5.0 0.0 .+-. 0.0
3 #1-2-28 ALP(+) 9.5 .+-. 1.0 3.4 .+-. 0.9 0.0 .+-. 0.0 3 #3-1-218
ALP(+) 141.5 .+-. 64.3 328.8 .+-. 54.1 0.0 .+-. 0.0 3 #3-2-226
ALP(+) 78.0 .+-. 16.6 188.2 .+-. 3.8 0.0 .+-. 0.0 3 #5-2-41 ALP(+)
55.5 .+-. 12.2 151.3 .+-. 21.2 0.0 .+-. 0.0 3 #5-2-44 ALP(+) 0.1
.+-. 0.1 0.1 .+-. 0.1 0.0 .+-. 0.0 3 #5-2-46 ALP(+) 10.9 .+-. 2.6
67.9 .+-. 12.3 0.0 .+-. 0.0 3 #5-2-50 ALP(+) 0.1 .+-. 0.0 0.4 .+-.
0.1 0.0 .+-. 0.0 3 #7-2-26 ALP(+) 51.5 .+-. 14.4 126.4 .+-. 1.1 0.0
.+-. 0.0 4 #5-1-2 ALP(+) 0.7 .+-. 0.1 0.0 .+-. 0.0 5.0 .+-. 7
#3-2-227 ALP(+) 14.6 .+-. 1.1 0.0 .+-. 0.0 0.0 .+-. 0.0 7 #5-1-13
ALP(+) 20.1 .+-. 5.9 0.0 .+-. 0.0 0.0 .+-. 0.0 7 #7-2-31 ALP(+) 1.1
.+-. 0.4 0.0 .+-. 0.0 0.0 .+-. 0.0 8 #3-1-210 ALP(+) 103.4 .+-.
11.7 195.3 .+-. 17.7 0.0 .+-. 0.0 8 #3-1-211 ALP(+) 50.8 .+-. 3.6
291.3 .+-. 43.9 0.0 .+-. 0.0 11 #1-1-20 ALP(+) 50.3 .+-. 14.5 34.3
.+-. 3.6 10.4 .+-. 2.0 12 #5-1-20 ALP(+) 9.3 .+-. 0.5 0.0 .+-. 0.0
0.0 .+-. 0.0 19 #3-2-233 ALP(+) 126.4 .+-. 65.3 0.0 .+-. 0.0 0.0
.+-. 0.0 23 #5-1-16 ALP(+) 3.7 .+-. 1.3 0.0 .+-. 0.0 0.0 .+-. 0.0
23 #5-1-18 ALP(+) 1.9 .+-. 0.3 0.0 .+-. 0.0 0.0 .+-. 0.0 23 #7-2-46
ALP(+) 17.4 .+-. 5.1 0.0 .+-. 0.0 0.0 .+-. 0.0 28 #3-1-215 ALP(+)
2.2 .+-. 0.3 0.0 .+-. 0.0 0.0 .+-. 0.0 29 #3-1-212 ALP(+) 1.9 .+-.
0.3 0.0 .+-. 0.0 0.0 .+-. 0.0 29 #5-1-4 ALP(+) 1.4 .+-. 0.2 0.0
.+-. 0.0 0.0 .+-. 0.0 30 #3-2-228 ALP(+) 5.6 .+-. 2.9 0.0 .+-. 0.0
0.0 .+-. 0.0 42 #305-2-28 ALP(-) 0.5 .+-. 0.1 0.1 .+-. 0.0 .+-. 0.0
44 #5-1-3 ALP(-) 0.8 .+-. 0.2 0.0 .+-. 0.0 1.6 .+-. 0.3 44 #5-1-23
ALP(-) 6.9 .+-. 1.1 0.0 .+-. 0.0 0.0 .+-. 0.0 44 #5-1-24 ALP(-) 7.2
.+-. 2.0 0.0 .+-. 0.0 0.0 .+-. 0.0 44 #5-2-25 ALP(-) 0.2 .+-. 0.1
0.0 .+-. 0.0 0.0 .+-. 0.0 44 #5-2-36 ALP(-) 2.5 .+-. 0.5 0.0 .+-.
0.0 0.0 .+-. 0.0 44 #7-2-40 ALP(-) 3.4 .+-. 0.9 0.0 .+-. 0.0 0.0
.+-. 0.0 47 #7-1-21 ALP(-) 0.2 .+-. 0.1 0.0 .+-. 0.0 0.0 .+-. 0.0
48 #F ALP(-) 0.6 .+-. 0.3 0.0 .+-. 0.0 0.0 .+-. 0.0 49 #I ALP(-)
2.1 .+-. 0.6 0.0 .+-. 0.0 226.0 .+-. 17.7 50 #B ALP(-) 0.0 .+-. 0.0
0.0 .+-. 0.0 0.0 .+-. 0.0 51 #H ALP(-) 2.1 .+-. 0.6 0.0 .+-. 0.0
226.0 .+-. 17.7 TERT Myc Oct4 Group mean SD mean SD mean SD 1.0 1.0
1.0 1 0.2 .+-. 0.0 1121.1 .+-. 25.3 39.3 .+-. 1.5 1 3.7 .+-. 0.5
1106.3 .+-. 51.8 770.6 .+-. 9.3 1 2.5 .+-. 0.1 1329.4 .+-. 272.1
101.6 .+-. 5.1 1 6.2 .+-. 1.1 566.9 .+-. 22.1 30.9 .+-. 2.4 3 0.12
.+-. 0.09 436 .+-. 12 25.0 .+-. 1.2 3 0.6 .+-. 0.3 59.2 .+-. 1.2
9.1 .+-. 0.1 3 1.1 .+-. 446.9 .+-. 15.8 14.9 .+-. 0.1 3 1.6 .+-.
0.1 1052.8 .+-. 129.5 17.1 .+-. 0.3 3 7.0 .+-. 0.7 9796.2 .+-.
275.5 324.2 .+-. 29.8 3 67.6 .+-. 7.1 9714.4 .+-. 15.7 258.7 .+-.
13.3 3 5.2 .+-. 0.1 285.3 .+-. 49.6 24.8 .+-. 3.2 3 1.1 .+-. 0.0
13065.1 .+-. 769.8 241.8 .+-. 0.7 3 4.4 .+-. 0.8 171.5 .+-. 2.3
578.7 .+-. 13.4 3 0.7 .+-. 0.5 3176.2 .+-. 751.2 233.4 .+-. 17.7 3
2.5 .+-. 0.3 1446.0 .+-. 421.7 33.8 .+-. 2.6 4 0.5 .+-. 0.2 6049.2
.+-. 396.9 3.8 .+-. 0.3 7 40.0 .+-. 5.7 27086.4 .+-. 3870.8 530.6
.+-. 84.1 7 1.9 .+-. 1.0 9125.8 .+-. 883.7 7.5 .+-. 0.7 7 20.6 .+-.
0.6 8344.9 .+-. 2054.5 6.7 .+-. 0.5 8 18.1 .+-. 1.8 95692.9 .+-.
5109.8 2843.9 .+-. 113.9 8 20.2 .+-. 2.9 29701.1 .+-. 4821.3 483.1
.+-. 13.9 11 1.3 .+-. 0.1 533.8 .+-. 24.8 30.2 .+-. 1.2 12 0.0 .+-.
0.0 16848.2 .+-. 1742.0 4.7 .+-. 0.2 19 28.7 .+-. 4.9 23614.4 .+-.
388.9 310.9 .+-. 19.2 23 0.0 .+-. 0.0 2927.9 .+-. 412.5 130.3 .+-.
10.1 23 0.0 .+-. 0.0 19433.2 .+-. 297.0 4.2 .+-. 0.5 23 0.0 .+-.
0.0 1959.8 .+-. 379.9 8.5 .+-. 0.7 28 0.0 .+-. 0.0 6065.6 .+-.
704.9 3.4 .+-. 0.3 29 0.0 .+-. 0.0 4572.6 .+-. 303.7 7.4 .+-. 0.1
29 0.0 .+-. 0.0 53755.3 .+-. 10897.7 22.9 .+-. 3.0 30 807.1 .+-.
13.4 25595.8 .+-. 2002.8 414.9 .+-. 22.6 42 0.0 .+-. 0.0 5873.2
.+-. 156.2 226.3 .+-. 12.9 44 0.5 .+-. 0.2 8698.4 .+-. 492.3 58.7
.+-. 2.6 44 0.7 .+-. 0.1 9350.1 .+-. 201.0 2.1 .+-. 0.1 44 7.3 .+-.
1.8 26133.6 .+-. 3528.5 8.0 .+-. 0.1 44 0.5 .+-. 0.1 5211.8 .+-.
618.7 370.7 .+-. 7.8 44 0.5 .+-. 0.1 8971.8 .+-. 110.3 266.6 .+-.
21.4 44 11.8 .+-. 3.4 9748.3 .+-. 530.0 7.3 .+-. 0.1 47 14.6 .+-.
1.9 7681.0 .+-. 286.9 261.0 .+-. 26.0 48 8.2 .+-. 0.6 53887.9 .+-.
1343.2 13.3 .+-. 1.2 49 0.0 .+-. 0.0 906.4 .+-. 231.6 7.2 .+-. 0.2
50 0.0 .+-. 0.0 4461.3 .+-. 589.3 5.2 .+-. 0.4 51 0.0 .+-. 0.0
906.4 .+-. 231.6 7.2 .+-. 0.2
Table 12 summarizes relative mRNA expression in clone-2-4 and 3-2.
Total RNA was extracted from clones 2-4 and 3-2. Expression of ES
cell marker genes were determined by qRT-PCR as described in
Example 16 and 17. Both clone-2-4 and -3-2 showed ES cell marker
gene expression. All expression values were normalized against
human iPS clone-1-8 (day94).
TABLE-US-00012 TABLE 12 relative mRNA expression in clone-2-4 and
3-2. #3-2_day48 #2-4_day59 #1-8_day82 #1-8_day94 Nanog 4.21 .+-.
1.11 2.88 .+-. 0.43 2.41 1.00 .+-. 0.24 TERT 1.52 .+-. 0.50 1.94
.+-. 0.14 0.69 1.00 .+-. 0.70 GDF3 6.42 .+-. 0.16 6.65 .+-. 0.05
0.92 1.00 .+-. 0.49 CYP26A1 72.45 .+-. 14.92 49.12 .+-. 0.06 62.50
1.00 .+-. 0.01 TDGF1 2.55 .+-. 0.10 3.53 .+-. 0.05 3.53 1.00 .+-.
0.01 Dnmt3b 2.66 .+-. 0.04 0.96 .+-. 0.02 0.91 1.00 .+-. 0.01 Foxd3
1.16 .+-. 0.08 0.59 .+-. 0.17 1.14 1.00 .+-. 0.18 Zfp42 0.98 .+-.
0.15 0.76 .+-. 0.01 2.44 1.00 .+-. 0.02 Myc 6.14 .+-. 0.58 4.58
.+-. 0.16 3.82 1.00 .+-. 0.05 Oct3/4 2.00 .+-. 0.07 1.08 .+-. 0.01
1.33 1.00 .+-. 0.00
INDUSTRIAL APPLICABILITY
[0281] Cells in a tissue that was lost in diseases etc. can be
supplied by inducing human pluripotent cells from the
undifferentiated stem cells harvested from a patient by using the
induction method of the present invention, followed by inducing to
differenciate into a necessary cell depending on diseases and then
transplanting the cells to the patient. The undifferentiated stem
cells of the present invention present in a human postnatal tissue
can be used to search drugs that promote the induction from said
undifferentiated stem cells to human pluripotent stem cells by
using markers such as Tert, Nanog, Sox2, Oct3/4 and alkaline
phosphatase that direct the induction to human pluripotent stem
cells. Said drugs can be used in stead of gene introduction and can
enhance the induction efficiency of human pluripotent stem cells.
Sequence CWU 1
1
45125DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 1agtctggctt atatccaaca cttcg 25222DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
2gactttgctt tccttggtca gg 22320DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 3tacctcagcc tccagcagat
20420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 4tgcgtcacac cattgctatt 20522DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
5agccagtctc accttcaacc gc 22620DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 6ggagtagcag agggaggccg
20720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 7aaaccccagc acatcaactc 20819DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
8gtcattccct gggtggttc 19920DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 9ttggagtgca atggtgtgat
201020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 10tctgttcaca caggctccag 201122DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
11ggcgtccgcg ggaatgtact tc 221221DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 12tggcttaggg gtggtctggc c
211321DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 13gcagcgacca gtcctccgac t 211420DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
14aacgtgggga aggcctgtgc 201520DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 15acagaacctg ctgcctgaat
201620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 16agaaatgcct gaggaaagca 201720DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
17cttgacaatc gagtggctga 201820DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 18tcatccgtgg tgtagccata
201922DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 19aacctgcacg actcctcgca ca 222020DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
20aggatgcgca tggcgattcg 202120DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 21gagaaggaga agctggagca
202220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 22aatagaaccc ccagggtgag 202322DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
23agtagacggc atcgcagctt gg 222422DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 24ggaagcttag ccaggtccga gg
222519DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 25caggagaacc ccaagatgc 192617DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
26gcagccgctt agcctcg 172720DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 27acactgcccc tctcacacat
202820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 28cgggactatg gttgctgact 202920DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
29accctgggtc ttgaggaagt 203020DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 30acgatcgtct tcccctcttt
203121DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 31ctcaccctta ccgagtcggc g 213220DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
32gcagctgggg cacctgaacc 203325DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 33tccagcttgt acctgcagga tctga
253425DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 34cctccagcag aaggtgatcc agact 253522DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
35agtagacggc atcgcagctt gg 223625DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 36cctccagcag aaggtgatcc
agact 253740DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 37aggaagagag ggaatttaag gtgtatgtat
tttttatttt 403856DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 38cagtaatacg actcactata gggagaaggc
tataacccac ccctataatc ccaata 563935DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
39aggaagagag gttaggttgg ttttaaattt ttgat 354061DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
40cagtaatacg actcactata gggagaaggc ttttataata aaaactctat caccttaaac
60c 614135DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 41aggaagagag tagtagggat tttttggatt ggttt
354258DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 42cagtaatacg actcactata gggagaaggc taaaactttt
cccccactct tatattac 584339DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 43aggaagagag ggtaataaag
tgagattttg ttttaaaaa 394455DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 44cagtaatacg actcactata
gggagaaggc tccacccact aaccttaacc tctaa 554516DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 45cttttgcatt acaatg 16
* * * * *