U.S. patent application number 11/662801 was filed with the patent office on 2011-02-17 for chromosomal insertion of gfp into bacteria for quality control.
Invention is credited to Peter Bergquist, Moreland Gibbs, Leonardo B. Pinheiro, Graham Vesey.
Application Number | 20110039254 11/662801 |
Document ID | / |
Family ID | 36059624 |
Filed Date | 2011-02-17 |
United States Patent
Application |
20110039254 |
Kind Code |
A1 |
Pinheiro; Leonardo B. ; et
al. |
February 17, 2011 |
Chromosomal Insertion of Gfp Into Bacteria For Quality Control
Abstract
An isolated mutated green fluorescent protein (gfp) gene for
chromosomal insertion into a bacterium, wherein the gene is capable
of being expressed in bacteria and produce sufficient fluorescence
under illumination from a UV lamp in a bacterial colony to be seen
by the naked eye. A gene cassette for inserting a gene into a
chromosome.
Inventors: |
Pinheiro; Leonardo B.; (New
South Wales, AU) ; Bergquist; Peter; (New South
Wales, AU) ; Gibbs; Moreland; (New South Wales,
AU) ; Vesey; Graham; (New South Wales, AU) |
Correspondence
Address: |
COOLEY LLP;ATTN: Patent Group
Suite 1100, 777 - 6th Street, NW
WASHINGTON
DC
20001
US
|
Family ID: |
36059624 |
Appl. No.: |
11/662801 |
Filed: |
September 12, 2005 |
PCT Filed: |
September 12, 2005 |
PCT NO: |
PCT/AU2005/001387 |
371 Date: |
October 5, 2007 |
Current U.S.
Class: |
435/5 |
Current CPC
Class: |
C07K 14/43595
20130101 |
Class at
Publication: |
435/5 |
International
Class: |
C12Q 1/70 20060101
C12Q001/70 |
Foreign Application Data
Date |
Code |
Application Number |
Sep 14, 2004 |
AU |
2004905286 |
Claims
1-24. (canceled)
25. An isolated mutated green fluorescent protein (gfp) gene having
mutations at nucleotides positions 1492, 1493 (Ser72Ala), 1737
(Met153Thr) and 1766 (Val163Ala) in the wild-type gfp gene as set
out in SEQ ID NO 1, or mutations for synonymous codons which change
the same amino acid positions (Ser72Ala, Met153Thr and
Val163Ala).
26. The isolated gene of claim 25 having a nucleic acid sequence
from bases 1524 to 2240 as set out in SEQ ID NO 4.
27. An isolated green fluorescent protein (GFP) expressed by the
mutated gfp gene according to claim 25.
28. The isolated mutant GFP according to claim 25 comprising one or
more mutations of mutant GFP01, mutant GFP02, mutant GFP03, mutant
GFP07, mutant GFP10, mutant GFP15, mutant GFP16, mutant GFP20,
mutant GFP21, mutant GFP22, mutant GFP26, mutant GFP27, mutant
GFP37, mutant GFP43, mutant GFP44, mutant GFP53, mutant GFP54, or
mutant GFP55.
29. The isolated mutant GFP according to claim 27 comprising mutant
GFP01, mutant GFP02, mutant GFP03, mutant GFP07, mutant GFP10,
mutant GFP15, mutant GFP16, mutant GFP20, mutant GFP21, mutant
GFP22, mutant GFP26, mutant GFP27, mutant GFP37, mutant GFP43,
mutant GFP44, mutant GFP53, mutant GFP54, or mutant GFP55.
30. The isolated mutant GFP according to claim 29 having an amino
acid sequence as set out in SEQ ID NO 6.
31. A bacterium or cell containing the mutated gfp gene according
to claim 25.
32. The bacterium according to claim 31 selected from the group
consisting of Acinetobacter lwoffii, Aeromonas hydrophila,
Aspergillus niger, Bacillus cereus, Bacillus subtilis,
Campylobacter coli, Campylobacter jejuni, Candida albicans,
Citrobacter freundii, Clostridium perfringens, Clostridium
sporogenes, Edwardsiella tarda, Enterobacter aerogenes,
Enterobacter cloacae, Enterococcus faecalis, Escherichia coli,
Escherichia coli 0157, Haemophilus influenzae, Klebsiella
pneumoniae, Klebsiella aerogenes, Lactobacillus acidophilus,
Lactobacillus casei, Lactobacillus fermentus, Legionella
pneumophila, Listeria innocua, Listeria ivanovii, Listeria
monocytogenes, Meth. Resist. Staph. Aureus, Neisseria gonorrhoeae,
Proteus rettgeri, Proteus mirabilis, Proteus vulgaris, Pseudomonas
aeruginosa, Pseudomonas cepacia, Pseudomonas fluorescens,
Rhodococcus equi, Salmonella abaetetuba, Saccharomyces cerevisiae,
Salmonella salford, Salmonella menston, Salmonella sofia,
Salmonella Poona, Salmonella typhimurium, Salmonella poona,
Serratia marcescens, Shigella sonnei, Staphylococcus aureus,
Staphylococcus epidermidis, Streptococcus pneumoniae, Streptococcus
pyogenes, Vibrio parahaemolyticus, Yersinia enterocolitica, and
Zygosaccharomyces rouxii.
33. The bacterium according to claim 32 being Escherichia coli,
Salmonella sp or Listeria sp.
34. The bacterium according to claim 33 wherein the Salmonella sp
is Salmonella typhimurium or Salmonella abaetetuba and the Listeria
sp is L. monocytogenes.
35. The cell according to claim 31 comprising Candida albicans,
Zygosaccharomyces rouxii or Aspergillus niger.
Description
TECHNICAL FIELD
[0001] The present invention is directed to methods for producing
labelled cells, particularly visibly fluorescent bacteria suitable
for use as quality control strains in microbiological or biological
testing.
BACKGROUND
[0002] Microbiology testing laboratories maintain in-house culture
collections of microorganisms for quality control purposes. These
microorganisms are known as quality control (QC) strains and are
used as reference standards and for quality control of the testing
methods. Samples that are known to be free of contamination are
often spiked with a QC strain and this spiked sample is then
processed through the test method. A positive result from the
spiked sample validates the testing method. The QC strains are also
used to quality control media that is used to grow microorganisms.
The media is inoculated with the QC strain and the growth is
observed.
[0003] Traditionally these quality control checks that are
performed with QC strains are qualitative. Recently, however,
regulatory authorities such as ISO have begun enforcing
quantitative quality control checks.
[0004] One problem that microbiology laboratories face is the issue
of cross contamination. Laboratories can inadvertently contaminate
a real sample with a QC strain. This results in a false positive
result, which can have enormous implications such as unnecessary
product recalls or incorrect diagnosis of disease.
[0005] In order to help with identifying instances of cross
contamination, laboratories try to use species of bacteria as QC
strains that are rarely detected in their samples. For example, in
Australia Salmonella salford is used as a QC strain because it is
rarely detected in clinical, food or environmental samples. When a
laboratory detects Salmonella, tests are performed to check that
the Salmonella detected is not Salmonella salford. If it does prove
to be Salmonella salford then the validity of the result is
questioned.
[0006] The use of rare species such as Salmonella salford as QC
stains does help to identify cross contamination problems, however,
confirming the identity of the strain that has been detected takes
time. Typically, this confirmation takes between one and three
days. In some instances, the confirmation has to be performed by a
specialist laboratory. These lengthy delays can have serious
implications. For example, a product recall may be delayed for
several days during which time consumers would be exposed to the
risk of infection.
[0007] A further problem with the use of rare species as QC strains
is that the rare species may have biochemical or physiological
properties that are different to those of the commonly isolated
organisms. For example, Salmonella salford does not grow well on
some media that are routinely used to isolate Salmonella from food,
whereas the commonly isolated Salmonella such as Salmonella
typhyimurium do grow well on these media. Salmonella salford is
therefore not a suitable QC strain for these culture media.
[0008] In an attempt to address this problem, the present inventors
hypothesized that it would be extremely useful to have QC
microorganisms that form colonies on agar plates are fluorescent
when viewed by the naked eye with illumination from a UV lamp.
[0009] The genetic modification of microorganisms with fluorescent
genes has been widely studied (GFP: Properties, Applications, and
Protocols (1998) Chalfie M, Kain S. Wiley-Liss, New York, USA). The
most commonly employed gene for a fluorescent protein is the green
fluorescent protein (GFP) gene (gfp) from the jellyfish Aequorea
Victoria. Genes encoding other fluorescent proteins have also been
isolated from other coelenterates.
[0010] Fluorescent bacteria have been created previously by
incorporating a gfp gene into a plasmid and inserting the plasmid
into the bacteria. The plasmid normally contains an antibiotic
resistant gene that allows the bacteria to be grown on antibiotic
containing media. The antibiotics kill any bacteria that do not
retain the plasmid. These plasmid-containing strains only retain
their fluorescence when grown on media that contain
antibiotics.
[0011] An advantage of plasmid-carrying strains is that several
hundred copies of the plasmid are normally present within a
bacterial single cell. This means that several hundred copies of
the fluorescence gene can be placed within each cell to create
cells that are very fluorescent.
[0012] Plasmid instability can be a major problem in culturing
bacteria, particularly if the cultures go through many generations
by passaging. The resulting effects are loss of expression of any
plasmid-encoded phenotype because of the build-up of non-productive
plasmid-free cells. Plasmid instability can be due to segregational
instability and/or structural instability. Segregational
instability is the loss of plasmid from one of the daughter cells
during cell division because of defective partitioning. Structural
instability is attributed to deletions, insertions and
rearrangements in the plasmid DNA, resulting in the loss of
expression of the encoded phenotype. Plasmid stability is
influenced by the vector and host genotypes, vector copy number,
and the origin and size of foreign DNA have been observed to affect
plasmid stability. Plasmid stability is also a function of
physiological parameters that affect the growth rate of the host
cell, which include pH, temperature, aeration rate, medium
components and heterologous protein accumulation.
[0013] Plasmid instability is undesirable in the production of
bacterial strains for quantitative QC methods, as consistent
expression of the QC phenotype is paramount. Consistent expression
could be achieved by irreversibly integrating the genes encoding
the fluorescent phenotype into the host genome to ensure long-term
stability and expression of the gene product. Ideally, only a
single copy of the marker gene should be integrated into the
bacterial chromosome as this reduces the likelihood of gene
instability resulting from homologous recombination-mediated gene
excision.
[0014] The preferred requirement of a single copy fluorescence gene
in the bacterial genome means that achieving sufficient
fluorescence maybe challenging. In comparison, the use of a plasmid
containing strain allows several hundred copies of the fluorescence
gene to be present. To ensure that a high level of fluorescence is
achieved with a single copy on the genome a transcriptional
promoter should be chosen that is powerful enough to produce
visible fluorescence.
[0015] It has been found to be difficult to incorporate genes into
a bacterial chromosome and still obtain the required selective or
characteristic genotype.
[0016] The present inventors have developed several strong
bacterial promoter systems for the expression of fluorescent
phenotypic markers in microbial cells.
SUMMARY OF INVENTION
[0017] The present inventors have devised methods which
surprisingly allow for the preparation of microorganisms that are
fluorescent even when passaged multiple times on media that does
not contain antibiotics or other selective pressures.
[0018] In a first aspect, the present invention provides an
isolated mutated green fluorescent protein (gfp) gene for insertion
into the chromosome of a bacterium, the gene is capable of being
expressed and produce sufficient fluorescence under illumination
from a UV lamp in a bacterial colony to be seen by the naked
eye.
[0019] Mutations at nucleotides positions 1492, 1493 (Ser72Ala),
1737 (Met153Thr) and 1766 (Val163Ala), as set out in FIG. 3, in the
wild-type gfp gene, or mutations for synonymous codons which change
the same amino acid positions (Ser72Ala, Met153Thr and Val163Ala),
are encompassed by the present invention.
[0020] In a preferred form, the mutated gfp gene has a nucleic acid
sequence from bases 1524 to 2240 as set out in FIG. 4 (SEQ ID NO
6).
[0021] The mutated gene can be preferably optimized for different
bacteria. The gene is particularly adapted for chromosomal
insertion and expression in bacteria.
[0022] In a second aspect, the present invention provides an
isolated green fluorescent protein (GFP) expressed by the mutated
gfp gene according to the first aspect of the present
invention.
[0023] In a third aspect, the present invention provides an
isolated mutant green fluorescent protein (GFP) capable of
producing sufficient fluorescence under illumination from a UV lamp
in a bacterial colony to be seen by the naked eye.
[0024] Preferably, the isolated mutant GFP is selected from a
protein having one or more mutations of mutant GFP01, mutant GFP02,
mutant GFP03, mutant GFP07, mutant GFP10, mutant GFP15, mutant
GFP16, mutant GFP20, mutant GFP21, mutant GFP22, mutant GFP26,
mutant GFP27, mutant GFP37, mutant GFP43, mutant GFP44, mutant
GFP53, mutant GFP54, or mutant GFP55 as defined below in Table
2.
[0025] Preferably, the isolated mutant GFP is selected from mutant
GFP01, mutant GFP02, mutant GFP03, mutant GFP07, mutant GFP10,
mutant GFP15, mutant GFP16, mutant GFP20, mutant GFP21, mutant
GFP22, mutant GFP26, mutant GFP27, mutant GFP37, mutant GFP43,
mutant GFP44, mutant GFP53, mutant GFP54, or mutant GFP55 as
defined below in Table 2.
[0026] In a preferred from, the isolated mutant GFP has an amino
acid sequence as set out in SEQ ID NO 4.
[0027] In a fourth aspect, the present invention provides an
unrepressed or constitutive gene cassette for providing a gene to a
chromosome comprising an endogenous gene under the control of the
very strong bacteriophage lambda promoter left (P.sub.L) and one or
more transposon elements. It will be appreciated that the cassette
can incorporate other suitable transcriptional promoters to allow
expression of a gene product in a cell or bacterium.
[0028] In one form, the cassette has a nucleotide sequence from 1
to 1278 and 1996 to 2007 substantially as shown in FIG. 3, wherein
the gene is inserted between positions 1728 and 1996.
[0029] In another form, the cassette has a nucleotide sequence from
1 to 1523 and 2241 to 2326 substantially as shown in FIG. 4 (SEQ ID
NO 4), wherein the gene is inserted between positions 1523 and
2241.
[0030] In a preferred form, the cassette has a nucleotide sequence
from 1 to 309 and 1027 to 1032 substantially as shown in FIG. 5
(SEQ ID NO 7), wherein the gene is inserted between positions 310
and 1026 (SEQ ID NO 8).
[0031] The cassette is suitable of inserting any gene, endogenous
or exogenous, mutant or native into the chromosome of a bacterium
or cell. Examples include but not limited to genes encoding green
fluorescent protein (gfp), red fluorescent protein, yellow
fluorescent protein or any unmodified or modified versions of known
fluorescent proteins. Examples also include genes that encode
proteins capable of catalysing the production of calorimetric or
fluorescent pigments, including but not limited to carotenoids,
indole or indirubin.
[0032] Preferably, the gene is a green fluorescent protein (gfp)
gene. More preferably, the gene is a mutant gfp gene.
[0033] The present inventors have demonstrated the suitability of
the cassette by developing bacteria having enhanced fluorescence by
inserting a green fluorescent protein (gfp) gene into the
chromosome of the bacteria. It will be appreciated that the
cassette can be used for any suitable gene to allow expression of
the gene product in a cell or bacterium.
[0034] In a fifth aspect, the present invention provides a
bacterium or cell containing a gene cassette according to the
fourth aspect of the present invention.
[0035] In a sixth aspect, the present invention provides an
unrepressed or constitutive gene cassette for providing a green
fluorescent protein (gfp) gene to a bacterium comprising a gfp gene
under the control of a strong promoter and one or more transposon
elements.
[0036] Preferably, the gene is under the control of the very strong
bacteriophage lambda promoter left (P.sub.L).
[0037] In one form, the cassette is substantially as shown in FIG.
3 (SEQ ID NO 1).
[0038] In another form, the cassette is substantially as shown in
FIG. 4 (SEQ ID NO 4).
[0039] Preferably, the cassette is as substantially as defined in
FIG. 5 (SEQ IN NO 7).
[0040] In a preferred form, the mutant gfp gene substantially as
shown in nucleotide bases 310 to 1026 of FIG. 5 (nucleotide bases
310 to 1026 of SEQ ID NO 7).
[0041] The cassette is particularly suitable for providing a mutant
green fluorescent protein to the chromosome of a bacterium.
[0042] It will be appreciated that similar results could be
achieved with other forms of GFP, possibly even the wild type GFP
would be sufficiently fluorescent when used with the gene cassette
according to the present invention.
[0043] In a seventh aspect, the present invention provides a
bacterium or cell containing the mutated GFP gene according to the
first aspect of the present invention or a gene cassette according
to the fourth aspect of the present invention.
[0044] The bacterium can be any suitable bacterium such as
Acinetobacter lwoffii, Aeromonas hydrophila, Aspergillus niger,
Bacillus cereus, Bacillus subtilis, Campylobacter coli,
Campylobacter jejuni, Candida albicans, Citrobacter freundii,
Clostridium perfringens, Clostridium sporogenes, Edwardsiella
tarda, Enterobacter aerogenes, Enterobacter cloacae, Enterococcus
faecalis, Escherichia coli, Escherichia coli 0157, Haemophilus
influenzae, Klebsiella pneumoniae, Klebsiella aerogenes,
Lactobacillus acidophilus, Lactobacillus casei, Lactobacillus
fermentus, Legionella pneumophila, Listeria innocua, Listeria
ivanovii, Listeria monocytogenes, Meth. Resist. Staph. Aureus,
Neisseria gonorrhoeae, Proteus rettgeri, Proteus mirabilis, Proteus
vulgaris, Pseudomonas aeruginosa, Pseudomonas cepacia, Pseudomonas
fluorescens, Rhodococcus equi, Salmonella abaetetuba, Saccharomyces
cerevisiae, Salmonella salford, Salmonella menston, Salmonella
sofia, Salmonella Poona, Salmonella typhimurium, Salmonella poona,
Serratia marcescens, Shigella sonnet, Staphylococcus aureus,
Staphylococcus epidermidis, Streptococcus pneumoniae, Streptococcus
pyogenes, Vibrio parahaemolyticus, Yersinia enterocolitica,
Zygosaccharomyces rouxii.
[0045] Preferably, the bacterium is Escherichia col. More
preferably, the E. coli is NCTC 9001 or NCTC 12241 as herein
defined.
[0046] Preferably, the bacterium is Salmonella sp. More preferably,
the Salmonella sp is Salmonella typhimurium or Salmonella
abaetetuba as herein defined.
[0047] Preferably, the bacterium is Listeria sp. More preferably,
the Listeria sp is L. monocytogenes.
[0048] Examples of bacteria containing a mutated GFP gene or
cassette according to the present invention have been deposited
with the Australian National Measurement Institute on 13 Sep. 2004
under Accession Nos NM04/42817, NM04/42818, NM04/42819 and
NM04/42820.
[0049] The identity of the deposited bacteria are as follows:
[0050] NM04/42817 is E. coli NCTC12241 [0051] NM04/42818 is
Salmonella abaetetuba [0052] NM04/42819 is Salmonella typhimurium
[0053] NM04/42820 is E. coli NCTC9001
[0054] The cell can be any suitable cell including prokaryotic or
eukaryotic. Examples of non-bacterial cells include fungal and
yeast cells such as Candida albicans, Zygosaccharomyces rouxii or
Aspergillus niger.
[0055] In a eighth aspect, the present invention provides a
modified bacterium containing a mutated gfp gene or cassette
selected from NM04/42817, NM04/42818, NM04/42819 or NM04/42820.
[0056] In a ninth aspect, the present invention provides use of a
bacterium according to the seventh or eighth aspects of the present
invention having fluorescence as a detectable marker.
[0057] Preferably, the use is as a laboratory QC strain.
[0058] The fluorescent bacteria are suitable for use as internal
quality controls as described in WO 01/09281, incorporated herein
by reference.
[0059] The fluorescent bacteria can be used for tracking purposes.
Examples of this use include: studies on the transport of cells
within the environment; tracking of cells within water treatment
plants; studies on gene exchange in the environment.
[0060] The fluorescent bacteria can be used to leak test biological
safety equipment such as safety cabinets and respirators.
[0061] The fluorescent bacteria can be used to test the efficiency
of any process that is designed to remove or inactivate bacteria.
Examples include water filters, UV disinfection methods, chemical
disinfection methods and heat treatment.
[0062] The fluorescent bacteria are also suitable for use in
materials testing methods. Examples of this include the testing of
water fittings to show that they do not support the growth of
microorganisms.
[0063] The fluorescent bacteria are suitable for use in a sewage
treatment process. Sewage treatment relies on the presence of
specific bacteria such as nitrifying bacteria. Adding fluorescent
nitrifying bacteria would allow accurate monitoring of cell density
of nitrifying bacteria within the sewage treatment process.
[0064] Bacteria are commonly used to control non-desirable
bacteria. Bacteria are added to a process or a product to
out-compete non-desirable bacteria. An example of this is the
control of Salmonella on chickens. Chickens are routinely treated
with Salmonella cells from a specific strain of Salmonella, known
as Salmonella sofia, that is not infectious to humans. The
Salmonella sofia colonises the chickens and out-competes more
harmful strains of Salmonella. At present there is not a simple
method to check that the chickens are colonised with Salmonella
sofia. By treating the chickens with a fluorescent form of
Salmonella sofia the level of Salmonella sofia on a chicken or on
processed chicken meat could be easily monitored by measuring
fluorescence. Fluorescence bacteria could be used for any process
that requires the monitoring of introduced bacteria.
[0065] The bacterium can be supplied as a culture or in the form of
a BioBall.TM. (BTF Pty Ltd, Australia) according to U.S. Pat. No.
6,780,581 or WO 03/020959.
[0066] The present inventors have found that the fluorescence is
substantially stable when the bacteria are passaged multiple times.
Antibiotics, for example, are not required to keep the fluorescence
gene within the bacteria.
[0067] The mutated GFP gene results in brighter fluorescence in E.
coli, for example, compared with a wildtype GFP gene expressed in a
plasmid in an equivalent strain of E coli. Not being bound by
theory, the inventors believe that brighter fluorescence may be due
to rapid maturation of the green fluorescence protein in bacteria.
As the mutations have slightly changed the structure of the
protein, it is likely that this changed structure matures more
rapidly in bacteria than the wild type GFP.
[0068] Although other mutants of the GFP gene have been made and
disclosed in the prior art, all these mutants have fluorescence
excitation and emission properties different to the wild type GFP.
The GFP mutant according to the present invention, however, has
substantially the same excitation and emission spectra as the wild
type GFP.
[0069] Although other forms of tagging bacteria on the chromosome
have been published previously, the tagging methods enable the
bacteria to grow on certain media or selective conditions.
[0070] Throughout this specification, unless the context requires
otherwise, the word "comprise", or variations such as "comprises"
or "comprising", will be understood to imply the inclusion of a
stated element, integer or step, or group of elements, integers or
steps, but not the exclusion of any other element, integer or step,
or group of elements, integers or steps.
[0071] Any discussion of documents, acts, materials, devices,
articles or the like which has been included in the present
specification is solely for the purpose of providing a context for
the present invention. It is not to be taken as an admission that
any or all of these matters form part of the prior art base or were
common general knowledge in the field relevant to the present
invention as it existed in Australia prior to development of the
present invention.
[0072] In order that the present invention may be more clearly
understood, preferred embodiments will be described with reference
to the following drawings and examples.
BRIEF DESCRIPTION OF THE DRAWINGS
[0073] FIG. 1. A. Diagrammatic representation of oligonucleotide
primer binding positions relative to the proposed gfp gene
cassette. B. Diagrammatic representation of the two PCR products
generated with oligonucleotide primer pairs as marked, for
construction of the gfp gene cassette, containing the wild-type gfp
gene, by overlap extension PCR. C. Diagrammatic representation of
the five PCR products generated with oligonucleotide primer pairs
as marked, for construction of the complete gfp gene cassette,
containing modified gfp genes, by overlap extension PCR. D.
Diagrammatic representation of the structure of the gfp gene
cassette showing the position and orientation of the clts857 and
gfp genes, and the positions of the lambda P.sub.R and P.sub.L
operators. The relative positions of the codons within gfp that are
altered by site directed mutagenesis are marked by their
corresponding amino acid changes.
[0074] FIG. 2. A. Structure of the pEntransposon-CamR plasmid and
the gfp gene cassette. Transposon arms are labeled Mu. The pBR322
origin of replication is labeled ori. B. Structure of the plasmid
generated following ligation to the gfp gene cassette into
pEntransposon-CamR at EcoRI and SalI restriction sites. Arrows
indicate relative binding positions and orientation of
oligonucleotides PENTGWF and GFPGWR used for genomic walking PCR.
C. Structure of the plasmid shown in B. following deletion of the
clts857 gene and the lambda P.sub.R promoter by digestion with
EcoRV and SmaI, followed by recircularisation by blunt-end
ligation. Arrows indicate relative binding positions and
orientation of oligonucleotides PENTGWF and GFPGWR used for genomic
walking PCR. D. Structure of the gfp gene cassette once excised
from the plasmid shown in C. Arrows indicate relative binding
positions and orientation of oligonucleotides PENTGWF and GFPGWR
used for genomic walking PCR.
[0075] FIG. 3 shows a sequence map of the gfp gene cassette (SEQ ID
NO 1) containing the wild-type gfp gene, showing the location of
the major sequence elements as depicted in FIG. 1D. Key restriction
sites are underlined. The lambda P.sub.R operators are underlined
and marked R1-R3. The lambda P.sub.L operators are underlined and
marked L1-L3. A translation of the lambda cl.sup.ts857 gene is
shown underneath the DNA sequence (running in reverse orientation
17 to 730 bp SEQ ID NO 2). A translation of the gfp gene is shown
underneath the DNA sequence (running in forward orientation 1279 to
1995 bp; SEQ ID NO 3).
[0076] FIG. 4 shows a sequence map of the gfp gene cassette (SEQ ID
NO 4) containing the modified gfp gene, after deletion of the
lambda cl.sup.ts857 gene and lambda P.sub.R promoter. Key
restriction sites are italicised. The lambda P.sub.L operators are
underlined and marked L1-L3. Transposon arms are underlined (6-54
bp and 2273-2321 bp). Codons changed by site directed mutagenesis
to generate the modified gfp gene are underlined and labelled. A
translation of the chloramphenicol resistance gene is shown
underneath the DNA sequence (278 to 937 bp; SEQ ID NO 5). A
translation of the modified gfp gene is shown underneath the DNA
sequence (1524 to 2240 bp; SEQ ID NO 6).
[0077] FIG. 5 shows a sequence map of the minimal gfp gene cassette
(SEQ ID NO 7) containing the modified gfp gene and lambda P.sub.L
promoter. Key restriction sites are italicised. The lambda P.sub.L
operators are underlined and marked L1-L3. Codons changed by site
directed mutagenesis to generate the modified gfp gene are
underlined and labelled. A translation of the modified gfp gene is
shown underneath the DNA sequence (310 to 1026 bp; SEQ ID NO
8).
MODE(S) FOR CARRYING OUT THE INVENTION
EXAMPLE 1
[0078] The following example describes the creation of a GFP
cassette, the creation of mutants of GFP that showed increased
fluorescence in a plasmid within E. coli and the chromosomal
integration of the mutant GFP and the wild type GFP into E.
coli.
Construction of a Temperature Controlled GFP Gene Cassette
[0079] In an attempt to obtain visibly detectable levels of GFP in
bacterial colonies, a gene cassette was constructed comprising a
modified gfp gene under the control of the very strong
bacteriophage lambda promoters right and left (P.sub.R and
P.sub.L), and the gene coding for lambda thermolabile cl.sup.ts857
repressor protein. The regulatory regions for the gfp gene cassette
were obtained from the controlled expression vector pJLA602
(Schauder et al., 1987 Gene 52: 279-283) by PCR. The cl.sup.ts857
repressor protein tightly represses transcription from the lambda
P.sub.R and P.sub.L promoters when grown at temperatures below
37.degree. C. Incubating growing cultures at 42.degree. C. results
in inactivation of the cl.sup.ts857 repressor protein resulting in
high level transcription of genes placed immediately downstream of
the lambda P.sub.L promoter.
[0080] The modified gfp gene was constructed by site directed
mutagenesis using overlapping sets of degenerate oligonucleotides
to reconstruct the full length gfp gene with 6 modified codons
positions. The modified sites and the selected residue alterations
were chosen for their proven ability to improve the maturation and
fluorescence of GFP in E. coli. The use of degenerate
oligonucleotide primers resulted in the creation of a library of
gfp genes that varied between 2 or 3 possible codons at each of the
6 chosen codon positions. The oligonucleotide primers are described
below and are listed in Table 1. The binding positions of all
oligonucleotide primers with respect to the gfp cassette are shown
in FIG. 1A. The PCR products generated with said primers for
reconstruction of the gfp cassette is shown in FIG. 1C. The
complete gfp cassette is shown in FIG. 1D. The wild-type gfp gene
was also placed into the cassette in the same manner for use as a
control (see FIG. 1B).
TABLE-US-00001 TABLE 1 Name Sequence SEQ ID NO gfpF0
5'-TTTTTTGAATTCTTATTTGTATAGTTCATC 9 gfpR1
5'-CTTTACTCATGGCAGTCTCCAGTTTGT 10 gfpF1
5'-GAGACTGCCATGAGTAAAGGAGAAGA 11 gfpF2
5'-ATGGTSTTCAATGCTTTKCRAGATACCCAGATCA 12 TA gfpF3
5'-AACTATATYTTTCAAAGATGACGGGA 13 gfpF4
5'-CAAACAAAAGAATGGAATCAAAGYTAACTTCAAA 14 ATTAGA gfpR0
5'-TTTTTTGAATTCTTATTTGTATAGTTCATC 15 gfpR2
5'-AAAGCATTGAASACCATAMSMGAAAGTAGTGACA 16 AGT gfpR3
5'-CTTTGAAARATATAGTTCTTTCCTGTA 17 gfpR4
5'-TTCCATTCTTTTGTTTGTCTGCCRTGATGTATAC 18 ATTGTGT gfpEnt
5'-CCAGTTTGCTCAGGCTCT 19 T7promppf1
5'-GGGGAATTCTTAATACGACTCACTATAGAAGGAG 20 ATATACATAT
GGCCTCCGAGAACGTCATCA Rfppr1 5'-GGGGGGGTCGACCTACAGGAACAGGTGGTGG 21
PENTGWF 5'-TGATCTTCCGTCACAGGT 22 GFPGWR 5'-GTAACAGCTGCTGGGATT
23
[0081] The oligonucleotides primers used for the PCR amplification
of the gfp gene cassette regulatory regions were as follows: [0082]
gfpF0, 5'-TTTTTTGAATTCTTATTTGTATAGTTCATC-3' (SEQ ID NO 9), a primer
to amplify bacteriophage lambda cl.sup.ts857/P.sub.R/P.sub.L region
from pJLA602. This primer incorporates a SalI site for directional
ligation of the cassette into a plasmid vector. [0083] gfpR1,
5'-CTTTACTCATGGCAGTCTCCAGTTTGT-3' (SEQ ID NO 10), a primer to
amplify and overlap the lambda cl.sup.ts857 repressor
gene/P.sub.R/P.sub.L with the gfp gene.
[0084] Variants of the GFP were generated by oligonucleotide
directed mutagenesis of the wild type gfp gene. Mutagenic PCR
amplifications of the GFP gene were performed using combinations of
degenerate and non-degenerate oligonucleotide primers.
[0085] For the site directed mutagenesis and PCR amplification of
the gfp gene the following oligonucleotides were used: [0086]
gfpF1, 5'-GAGACTGCCATGAGTAAAGGAGAAGA-3' (SEQ ID NO 11), a primer to
amplify and overlap lambda cl.sup.ts857/P.sub.R/P.sub.L/atpE with
the gfp gene. [0087] gfpF2,
5'-ATGGTSTTCAATGCTTTKCRAGATACCCAGATCATA-3' (SEQ ID NO 12), a
degenerate primer for the amplification and mutagenesis of gfp.
This primer introduces three possible point mutations, Ser65Ala or
Ser65Gly, Val68Leu, and Ser72Ala into the gfp gene. [0088] gfpF3,
5'-AACTATATYTTTCAAAGATGACGGGA-3' (SEQ ID NO 13), a degenerate
primer for the amplification and mutagenesis of gfp. This primer
introduces a single possible point mutation, Phe99Ser, into the gfp
gene. [0089] gfpF4, 5'-CAAACAAAAGAATGGAATCAAAGYTAACTTCAAAATTAGA-3'
(SEQ ID NO 14), a degenerate primer for amplification and
mutagenesis of gfp. This primer introduces a single possible point
mutation, Met153Thr, into the gfp gene. [0090] gfpR0 primer 5'
TTTTTTGMTTCTTATTTGTATAGTTCATC-3' (SEQ ID NO 15), a primer to
amplify the gfp gene. This primer incorporates an EcoRI restriction
site for directional ligation of the cassette into a plasmid
vector. [0091] gfpR2, 5'-AAAGCATTGAASACCATAMSMGAAAGTAGTGACAAGT-3'
(SEQ ID NO 16), a degenerate primer for the amplification and
mutagenesis of the gfp gene. This primer introduces two possible
point mutations, Ser65Ala or Ser65Gly and Val68Leu, into the gfp
gene. [0092] gfpR3 primer 5'-CTTTGAAARATATAGTTCTTTCCTGTA-3' (SEQ ID
NO 17), a degenerate primer for amplification and mutagenesis of
the gfp gene. This primer introduces a single possible point
mutation, Phe100Ser, into the gfp gene. [0093] gfpR4 primer
5'-TTCCATTCTTTTGTTTGTCTGCCRTGATGTATACATTGTGT-3' (SEQ ID NO 18), a
degenerate primer for amplification and mutagenesis of the gfp
gene. This primer introduces a single possible point mutation,
Met153Thr, into the gfp gene.
[0094] For amplification and mutagenesis of the gfp gene, plasmid
DNA from the pGFP vector (Clontech) was used as template DNA. PCR
amplification of the gfp gene, the regulatory regions and the gfp
gene segments contained 1.times. PCR Gene Amp buffer; 200 .mu.M of
each of the four deoxyribonucleotide triphosphate (dATP, dTTP,
dCTP, dGTP); 0.3 .mu.M of each oligonucleotide primer (forward and
reverse); AmpliTaq-Gold Polymerase (Applied Biosystems) and
approximately 10 ng of template DNA in a 50 .mu.l reaction volume.
PCR reactions were performed in a Gene Amp PCR system 2400 (Applied
Biosystems) programmed as follows: 95.degree. C. for 10 min,
(95.degree. C. 30 sec, 55.degree. C. 30 sec, 72.degree. C. 1 min)
repeated for 30 cycles, and a final cycle at 72.degree. C. for 5
min. PCR products originating from amplification reactions of the
regulatory regions and the four different segments of the mutant
gfp gene were visualized by agarose gel electrophoresis and the DNA
purified using a QIAquick gel extraction kit (Qiagen Inc).
[0095] Assembly of the gfp gene and regulatory regions into the gfp
gene cassette were performed by overlap extension PCR (Ho et al.,
1989 Gene 77:51-59). Optimization of PCR conditions was required
for successful assembly of the gfp gene cassette. Best results for
the assembly of gfp gene segments into an full length gene were
obtained by first performing a primerless overlap extension step
with a programmed decrease in the annealing temperature (1.degree.
C. per PCR cycle) followed by addition of oligonucleotides and a
further PCR step. The PCR reagents used were the same as that
described above, except for combining and using the 4 gfp gene
cassette segments, each at approximately 10 ng, as template DNA in
a 50 .mu.l PCR reaction. The relative positions of primers with
respect to the major elements in the GFP cassette are shown in FIG.
1A. The relative positions of PCR products amplified and used for
overlap extension reassembly of the GFP cassette are shown in FIG.
1B. The final complete GFP cassette is depicted in FIG. 1C.
[0096] A PCR for the assembly of the wild type gfp gene and the
upstream lambda regulatory regions into a single cassette was
performed as follows: a primerless overlap extension stage
(95.degree. C. for 10 min, 95.degree. C. 30 sec, 50.degree. C. down
to 35.degree. C. over 15 cycles with 1.degree. C. decrease per
cycle for 30 sec each cycle), followed by addition of primers
(gfpF0 and gfpR0) and a second PCR stage comprising 95.degree.
C.--30 sec, 55.degree. C.--30 sec, 72.degree. C.--1 min, repeated
for 30 cycles, and a final cycle at 72.degree. C. for 5 min.
[0097] A PCR for the recombination of the four mutant GFP gene
segments into a pool of selectively mutated full length gfp genes
was as follows: a primeness overlap extension stage (95.degree. C.
for 10 min, 95.degree. C. 30 sec, 50.degree. C. down to 30.degree.
C. over 20 cycles with 1.degree. C. decrease per cycle for 30 sec
each cycle), followed by addition of primers (gfpF1 and gfpR0) and
a second PCR stage of 95.degree. C. 30 sec, 55.degree. C. 30 sec,
72.degree. C. 1 min, repeated for 30 cycles. After amplifying the
assembled mutant gfp gene, a second PCR reaction was carried out
using the same conditions used for the assembly of the wild type
gfp gene, but in this case using the reassembled mutant gfp gene
and the upstream regulatory regions to reassemble the entire mutant
gfp gene cassette.
[0098] The complete sequence of the mutated gfp gene cassette,
including gene translations, promoter elements, and mutation
positions, is given in FIG. 3. Similarly, The complete sequence of
the wild-type gfp gene cassette is given in FIG. 4.
Creation of GFP Mutants
[0099] The gfp gene cassette was designed to include two unique
restriction enzyme sites, SalI at the 5'end and EcoRI at 3'end.
These restriction sites were used for direction ligation of the
mutated gfp gene cassette into the multiple cloning site of the
pEntranceposon CmR vector (Finnzymes). The pEntranceposon CmR
vector is a high copy number plasmid constructed by replacing the
multiple cloning site of the high copy number plasmid pUC19 with
the bacterial phage Mu transposon, and the chloramphenicol
resistance gene (CamR).
[0100] PCR product comprising the complete mutant gfp gene and the
plasmid vector pEntranceposon CamR were digested with SalI and
EcoRI restriction enzymes (MBI Fermentas). The digested DNA
fragments were visualized and purified from agarose gel using a
QIAquick gel Extraction kit (Qiagen). The digested mutated gfp gene
cassette and pEntranceposon CamR vector were ligated together and
transformed into E. coli DH5.alpha. to generate a library of clones
containing gfp genes randomly mutated at 6 selected positions (see
FIG. 2). Similarly, the wild type GFP gene cassette was ligated to
the digested pEntranceposon CamR vector and transformed into E.
coli DH5 alpha.
[0101] Transformed cells were plated onto Luria Bertani (LB) agar
media plates containing 25 .mu.g/ml of chloramphenicol and
incubated at 28.degree. C. After 48 hours incubation, the
incubation temperature was shifted to 42.degree. C. for two to
three hours for inactivation of the cl.sup.ts857 repressor protein
and induction of GFP expression. Colonies expressing GFP were
screened by visualization of fluorescence using a hand held
ultraviolet lamp (UV 365 nm). A number of colonies expressing GFP
appeared on the plates. Colonies originating from the mutant GFP
gene construct showed visually detectable variation in GFP
fluorescence intensity emitted from colonies and were graded
accordingly.
Sequencing the Mutant GFP Clones
[0102] Five wild type GFP transformants and 18 mutant GFP
transformants were selected following visual screening for
fluorescence. Several of the mutant GFP transformants were
significantly brighter than the wild type GFP transformants. The
selected mutant GFP clones included the brightest fluorescing
colonies as well as colonies showing intermediate and low intensity
fluorescence. Single recombinant colonies were re-streaked to new
LB plates containing 25 .mu.g/ml of chloramphenicol. These cells
were used for inoculation of 3 ml LB liquid media containing 25
.mu.g/ml of chloramphenicol. Cultures obtained after overnight
incubation at 28.degree. C. with shaking were used for plasmid DNA
extraction using QIAprep kits (Qiagen). Extracted plasmid DNA from
the selected GFP clones was then used for nucleotide sequencing of
the gfp gene cassette to determine the gfp genotype. Sequencing
reactions (Big Dye terminator chemistry Applied Biosystems Inc)
were performed using plasmid DNA extracted from GFP transformants.
The oligonucleotide primers gfpF0 and gfpR1 were used for
sequencing of the regulatory regions of GFP gene cassette, while
gfpF1 and gfpR0 primers for sequencing of the GFP gene open reading
frame within the GFP gene cassette. Sequencing results were
analyzed using the GCG Wisconsin software package version 8
(Devereux J, Haeberli P, Smithies O, 1984, Nucleic Acids Res
12:387-395). Results from the nucleotide sequencing analysis were
used for amino acid sequence alignment of wild type GFP and GFP
mutants. A summary of amino acid changes identified in the GFP
mutants is presented in Table 2.
[0103] Results from the sequencing analysis indicated that the most
frequently occurring amino acid changes, Ser at position 72 to Ala,
Met at position 153 to Thr and Val at position 163 to Ala, were
found in the GFP mutants clones showing the brightest fluorescence
intensity when visualized as colonies on plates illuminated with
ultraviolet light (UV 365 nm). These mutants were considerably
brighter than colonies that contained the wild type GFP.
[0104] The mutant gfp gene construct containing the three most
frequent amino acid changes as well as wild type GFP gene construct
were chosen for bacterial chromosomal integration experiments as
described below. This plasmid was named pENTcIGFP (See FIG.
2B).
TABLE-US-00002 TABLE 2 Modified amino acid residues Position 65 68
72 99 153 163 Ser Val Ser Phe Met Val wild type GFP Ser Val Ser Phe
Met Val mutant GFP01 Ser Val Ala Phe Thr Ala mutant GFP02 Ala Val
Ala Phe Thr Ala mutant GFP03 Ser Val Ser Phe Thr Ala mutant GFP07
Ser Val Ala Phe Thr Ala mutant GFP10 Ser Val Ser Phe Thr Ala mutant
GFP15 Ser Val Ala Phe Thr Ala mutant GFP16 Ser Leu Ala Phe Thr Ala
mutant GFP20 Ser Val Ala Phe Thr Ala mutant GFP21 Ser Leu Ala Phe
Thr Ala mutant GFP22 Ser Val Ser Phe Met Ala mutant GFP26 Ser Leu
Ala Phe Thr Ala mutant GFP27 Ser Leu Ala Ser Met Ala mutant GFP37
Ser Val Ala Phe Thr Ala mutant GFP43 Ser Val Ser Phe Thr Ala mutant
GFP44 Ser Leu Ala Ser Thr Ala mutant GFP53 Ser Leu Ala Ser Met Ala
mutant GFP54 Ser Val Ser Ser Met Val mutant GFP55 Ser Val Ser Ser
Thr Val
Integration of GFP into the Chromosome of E. Coli
[0105] Integration of the gfp gene cassette into the E. coli
DH5.alpha. genome was performed by insertion mutagenesis using
bacteriophage Mu DNA transposition complexes (Lamberg et al., 2002
Appl Environ Microbiol 68: 705-712). This system was chosen as the
transposon cassette does not include the gene encoding Mu
transposase. Transposase enzyme is added to purified transposon DNA
to form a transposition complex that is then transferred into
bacterial cells by electroporation. The transposase mediates the
integration of the transposon into the genome, effectively
resulting in irreversible integration of the transposon and any
included genes, into the bacterial chromosome.
[0106] Plasmid DNA of pEntranceposon vectors containing the GFP
gene cassette were used for BglII restriction enzyme digests. The
BglII digestion excises the transposon from the pEntranceposon
vector. Digested plasmid DNA was separated using agarose gel
electrophoresis and the pEntranceposon CamR transposon fragment
containing the gfp gene cassette purified using a QIAquick gel
Extraction kit (Qiagen Inc). Purified pEntranceposon DNA was used
for transpososome assembly reactions.
[0107] Transpososomes are stable protein DNA complexes formed by
the binding of MuA transposase protein into specific binding sites
at each end of the transposon DNA.
[0108] Transpososome formation reactions were optimized by
titration of the amount of pEntranceposon DNA against a fixed
amount of MuA transposase enzyme (Finnzymes).
[0109] Reagents for transpososome assembly reaction mixtures (20
.mu.l) included .about.6 pmol of MuA transposase, 50% glycerol, 150
mM of Tris-HCl (pH 6.0), 150 mM NaCl, 0.1 mM EDTA, and 0.025% (v/v)
Triton X-100. Transpososome reactions were performed by adding
.about.0.25 pmol to .about.1.0 pmol of pEntranceposon DNA
containing the GFP gene cassette to the mixtures followed by
incubating at 30.degree. C. for 2-3 hours. Transpososome formation
was visualized by electrophoresis on 2% agarose-TAE buffer gel
containing 80 .mu.g/ml of bovine serum albumen. Transpososome
assembly reaction samples (1 .mu.l) were loaded into the gel using
0.2 (v/v) of Ficoll 400 as loading buffer. After gel visualization,
selected transpososome complexes were used for the transformation
of electrocompetent E. coli DH5.alpha. cells.
[0110] Electrocompetent E. coli cells were prepared by growing 500
ml of culture in SOB medium at 37.degree. C. with shaking to
optical density at 600 nm of 0.8. Cells were then harvested by
centrifugation at 4.degree. C. and resuspended in 25 ml of ice-cold
10% glycerol four times consecutively, then resuspended in 1 ml of
ice-cold 10% glycerol. Aliquots of 1 .mu.l of transpososome
reactions were used for electroporation of 40 .mu.l
electro-competent E. coli cells using a Genepulser (Bio-Rad) at the
following settings: voltage 2.5 kV; capacitance 25 .mu.F;
resistance 200.OMEGA. (Bio-Rad 2-mm electrode spacing cuvettes).
After electroporation 1 ml of SOC medium was added, incubated for
90 minutes, spread onto LB plates containing 25 .mu.g/ml of
chloramphenicol and incubated at 28.degree. C. After 48 hours
incubation at 28.degree. C. cultures incubation temperature was
shifted to 42.degree. C. for two to three hours to induce GFP
expression.
[0111] The few colonies that appeared on plates originated from
integration of both mutant and wild type GFP gene cassette showed
no fluorescence when illuminated with UV lamp. To verify if the
integration of the GFP gene cassette was successful, PCR
amplification reactions using gfpF1 and gfpR0 primers were carried
using colonies growing on plates originating from
electro-transformation of both mutant and wild type GFP
transpososomes. Results were positive for the presence of the GFP
gene in the colonies. Four selected positive colonies (both mutant
and wild type GFP putative integrants) were grown overnight in
liquid media (LB+chloramphenicol). After harvesting cultures by
centrifugation, genomic DNA from .about.100 .mu.g of cell paste was
extracted using DNA extraction kit (Fast DNA, BIO 101 systems).
Genomic DNA from two different isolates originating from both
mutant and wild type GFP putative integrants were used for
nucleotide sequencing using the system of analysis as described
above. Oligonucleotide primers gfpF0 gfpR1 and gfpF1 gfpR0 were
used for sequencing of both regulatory and open reading frame
within the GFP gene cassette.
[0112] The above results confirmed the integration of intact GFP
gene cassette sequence in the genomic DNA of the putative
integrants. However, they were not visibly fluorescent when grown
under inducing conditions. It was considered that this negative
result might be due to the single copy nature of the integrated gfp
gene in combination with the non-ideal growth temperature when
inducing protein production at 42.degree. C. Usually, the lambda
cl.sup.ts857/P.sub.R/P.sub.L system is used to induce protein
production in high copy number plasmid systems, with maximum
protein yields usually obtained within 2-3 hours of switching to
42.degree. C. However, with GFP being produced from only a single
copy gene we considered that a time potentially much longer than
2-3 hours might be required to achieve visible levels of GFP, and
that the 42.degree. C. growth conditions might prevent continued
expression of GFP to visible levels. Therefore, we considered that
removal of the cl.sup.ts857 gene and the P.sub.R promoter might
allow unrepressed constitutive high-level expression of the GFP
protein from the remaining P.sub.L promoter. A simple deletion
strategy was devised to test this hypothesis (see Example 2).
EXAMPLE 2
[0113] The temperature inducible gfp gene cassette integrated in E.
coli resulted in non-fluorescing colonies. As discussed above, it
was considered that a prolonged growth at the 42.degree. C.
induction temperature may have inhibited protein production in E.
coli before detectable amounts of GFP could be produced from a
single copy gfp gene. The following procedure was devised for the
deletion of the cl.sup.ts857 gene from the plasmid to create an
unrepressed (constitutively expressed) version of gfp gene
cassette.
Generation of Unrepressed gfp Gene Cassette
[0114] Analysis of the nucleotide sequence of gfp gene cassette
revealed a unique SmaI restriction enzyme that if used in
combination with an EcoRV site in the pEntcIGFP plasmid (see FIG.
2C) would result in excision of most of the cl.sup.ts857 gene and
P.sub.R from the cassette. Excision of the cl.sup.ts857 gene would
effectively promote high-level constitutive transcription of gfp
from the P.sub.L promoter (see FIGS. 2C and 2D).
[0115] The pEntcIGFP plasmid containing the gfp gene cassette was
restriction digested with SmaI and EcoRV (MBI Fermentas). The
digested DNA was visualized by agarose gel electrophoresis and DNA
corresponding to the vector minus excised cl.sup.ts857 gene was gel
purified using a QIAquick gel extraction kit (Qiagen Inc). The
digested DNA was ligated blunt-end using T4 DNA ligase (Roche) at
14.degree. C. for 12 hr. The ligated DNA was used to transform
chemically competent E. coli DH5 alpha cells, plated onto LB plates
containing chloramphenicol and incubated overnight at 37.degree. C.
Positive colonies expressing GFP (following visual inspection under
UV light) appeared on plates originating from a ligation of the
mutant GFP gene cassette with the deleted cl.sup.ts857 repressor
gene. The positive transformants were re-streaked to individual
plates and singles colonies used for liquid cultures in LB medium
containing chloramphenicol. After incubation overnight at
37.degree. C., an aliquot from the culture was then used for
plasmid extraction using QIAprep plasmid purification kit (Qiagen).
Excision of the cl.sup.ts857 gene from the GFP gene cassette was
confirmed after analysing an EcoRI restriction enzyme digest of the
extracted plasmid by agarose gel electrophoresis. The plasmid
containing the GFP gene cassette with the deleted cl.sup.ts857 gene
was named pEntPLGFP, and the modified cassette is from herein
referred as unrepressed GFP gene cassette.
Chromosomal Integration of Unrepressed GFP Gene Cassette into E.
Coli and Salmonella Strains
[0116] Bacteriophage Mu DNA transposition complexes derived from
pEntPLGFP was used for chromosomal integration of the unrepressed
gfp gene cassette into E. coli and Salmonella strains. E. coli DH5
alpha and E. coli NCTC 12241 and E. coli NCTC 9001, and Salmonella
typhyimurium and Salmonella abaetetuba cells were transformed as
follows.
[0117] pEntPLGFP plasmid DNA was restriction digested with BglII
(see FIG. 2). The resulting two restriction fragments were
separated by gel electrophoresis and the DNA fragment comprising
the Mu transposon and unrepressed mutant gfp gene cassette purified
using a Qiaquick gel extraction kit (Qiagen).
[0118] Transpososome assembly reaction mixtures (20 .mu.l)
consisted of .about.6 pmol of MuA transposase (Finnzymes), 50%
glycerol, 150 mM of Tris-HCl (pH 6.0), 150 mM NaCl, 0.1 mM EDTA,
and 0.025% (v/v) Triton X-100, and .about.0.1 pmol to .about.0.9
pmol of pEntranceposon DNA containing the unrepressed gfp gene
cassette.
[0119] Transpososome formation reactions were incubated at
30.degree. C. for 2-3 hours, visualized on 2% agarose-TAE
electrophoresis as described above and used for the transformation
of E. coli NCTC 12241, E. coli NCTC 9001, Salmonella typhyimurium
and Salmonella abaetetuba electrocompetent cells. Electrocompetent
E. coli and Salmonella cells were all prepared and electroporated
using the method described above. After electroporation 1 ml of SOC
medium was added, incubated for 90 minutes, spread onto LB plates
containing 25 .mu.g/ml of chloramphenicol and incubated at
37.degree. C. After 12 to 16 hours of growth at 37.degree. C.,
colonies expressing the GFP protein could be easily visualized by
illumination of plates with a hand held UV light.
[0120] As the gfpF0 primer binding site was deleted from the gfp
gene cassette during deletion of the cl.sup.ts857 gene, a new
oligonucleotide primer, gfpEnt 5'-CCAGTTTGCTCAGGCTCT-3' (SEQ ID NO
19), was synthesized for PCR amplification the unrepressed gfp gene
cassette. PCR amplification of the gfp cassette using gfpEnt and
gfpR0 primers were performed using chloramphenicol resistant
colonies obtained from electro-transformation with the unrepressed
gfp cassette transpososome. Correct sized PCR products indicated
the presence of the unrepressed gfp gene cassette in all tested
colonies. Four positive colonies from each of each E. coli and
Salmonella strains were selected and grown overnight in liquid
media (LB+chloramphenicol). Genomic DNA was then extracted from the
cells using a DNA extraction kit (Fast DNA, BIO 101 systems). PCR
product amplified from genomic DNA from two different transformants
of each E. coli and Salmonella strain was used for nucleotide
sequencing. All sequencing results confirmed the presence of the
unrepressed gfp gene cassette in the genomic DNA of both E. coli
and Salmonella transformants. These transformants were clearly
fluorescent when grown on a range of agar plates and illuminated
with a UV light.
EXAMPLE 3
[0121] Identification of the Insertion Points of the Unrepressed
gfp Gene Cassette into E. Coli and Salmonella Integrant
Chromosomes
[0122] Genome walking PCR (GWPCR) was used for identification of
the insertion points of the unrepressed gfp gene cassette into E.
coli and Salmonella strains. Two genome walking primers were
designed to walk upstream and downstream of the gfp gene cassette.
Primer PENTGWF was used to genome walk from the 5' end of the gfp
gene cassette and GFPGWR to walk from the 3' end of the cassette
insertion point (See Table 1, FIGS. 2C and 2D).
[0123] Genomic walking PCRs and synthetic DNA linker assemblage
were carried out according to the method described by Morris et al,
Appl Environ Microbiol (1995) 61:2262-2269. The PENTGWF and GFPGWR
primers were used in combination with primers complementary to the
generic linker for GWPCR reactions. PCR products ranging from 300
bp to 800 bp were sequenced and results used for match searches in
bacterial genomes database for identification of gfp gene cassette
insertion points and flaking regions.
[0124] Insertion points of gfp gene cassette on the genomes of E.
coli and Salmonella integrants were identified based on the
published genome sequence data on Salmonella typhimurium and E.
coli K12. For the fluorescent E. coli EC11775 strain, the gfp gene
cassette was observed to be inserted into a gene encoding a homolog
of E. coli K12 Zinc binding periplasmic protein (ZnaP). For the
fluorescent E. coli BL21, the gfp gene cassette was inserted into a
gene encoding 16S rRNA. For the fluorescent Salmonella abaetetuba,
the gfp gene cassette was inserted into a gene homolog of S.
typhimurium ATP-dependent helicase protein (hrpA). In the
fluorescent Salmonella typhimurium, the gfp gene cassette was
inserted into the sequence of a gene encoding a common antigen
found in the outer membrane of Salmonella and other
enterobacteria.
EXAMPLE 4
Generation of Fluorescent Listeria Monocytogenes
[0125] The strategy used to generate fluorescent Listeria
monocytogens followed similar approach to that used for the E. coli
and Salmonella strains. First, the gfp gene mut1 in an E.
coli/Listeria shuttle vector pNF8 vector (Fortineau et al., 2000
Res Microbiol 151: 353-360) was replaced with our triple mutant gfp
gene (gfp mut1 is a FACS optimized GFP with shifted excitation
wavelength up to 488 nm). The gfp gene present in pEntPLGFP was
amplified by PCR using the primers detailed in Table 3.
TABLE-US-00003 TABLE 3 SEQ ID Name Sequence NO Gfpmutf1
5'-AAACGGGATCCGAAAGGAGGTTTATTAAAATGAG 24 TAAAGGAGAAGAACTT Gfpmutr1
5'-AAAAAACTGCAGTTATTTGTATAGTTCATCCATG 25 CCA
The gfpmut1F primer was designed to introduce a BamHI restriction
enzyme site and a consensus gram-positive ribosome binding site and
the reverse gfpmt1R primer was designed to introduce a PstI site in
the PCR products. The resulting PCR product and the pNF8 were
digested with BamHI and PstI restriction enzymes (MBI Fermentas),
ligated using T4 ligase (Roche) and used to transform chemically
competent E. coli DH5.alpha. cells. Recombinant cultures harbouring
the newly generated plasmid vector were recovered from selective LB
agar plates containing 150 .mu./mL of erythromycin (selective
antibiotic resistance encoded in pNF8 vector). After incubation at
30.degree. C. over 72 hr visibly green colonies appeared on plates
(GFP expression in those recombinant clones in driven by the
Listeria Pdlt promoter located just upstream of the gfp gene in the
vector). Three putative recombinant clones were streaked onto fresh
LB+erythromycin plates and single colonies used to inoculate
LB+erythromycin liquid media followed by overnight incubation at
37.degree. C. with shaking. In order to verify if the isolated pNF8
plasmid was carrying our triple mutant gfp gene and not the
original FACS optimized GFP gfp gene mut1, an aliquot of the
cultures were used for fluorescence assay measurements using a
FLUOstar fluorimeter (BMG Lab Technologies GmbH). Two different
excitation wavelengths--360 nm and 480 nnm with fixed 520 nm
emission were tested. Results showed high fluorescence from cells
bearing the original pNF8 plasmid at 480 nm and lower fluorescence
at 360 nm excitation, whereas opposite results for cells bearing
the recombined triple mutant gfp with high fluorescence at 360 nm
and lower fluorescence at 480 nm. One selected recombinant bearing
the reconstructed vector named pNFMT1 was used for inoculation of
LB liquid media containing 150 .mu.l/mL erythromycin and incubated
overnight at 37.degree. C. The culture obtained was used for
plasmid extraction using QIAprep kit (Qiagen).
[0126] L. monocytogenes electrocompetent cells were prepared by
growing 250 ml of culture in brain and heart infusion (BHI) media
containing 0.5 M of sucrose with shaking at 37.degree. C. to
optical density measured at 600 nm of 0.2. Penicillin was then
added to 10 .mu.l/ml and the culture grown to optical density
measured at 600 nm of 0.5. Cells were cooled on ice and harvested
by centrifugation at 4.degree. C. and resuspended in 100 ml of ice
cold 0.5 M sucrose in 1 mM HEPES pH 7.0 three times consecutively,
then resupended in 1 ml of ice cold 0.5 M sucrose in 1 mM HEPES pH
7.0, and stored as 50 .mu.l aliquots at -80.degree. C.
Transformation efficiency of L. monocytogenes electrocompetent
cells was evaluated using the pNFMT1 vector. Enumeration of
fluorescent L. monocytogenes colonies LB agar plates containing 150
.mu.L/mL of erythromycin indicated transformation efficiencies up
to 10 5 c.f.u. per .mu.g of pNFMT1 DNA.
[0127] The Pdlt promoter-mutant gfp gene construct present in the
pNFMT1 was excised from the vector by restriction digest using
EcoRI and Hind III restriction enzymes (MBI Fermentas). The
pEntranceposon vector (Finnzymes) was also digested with EcoRI and
Hind III restriction enzymes (MBI Fermentas). DNA corresponding to
the digested Pdlt promoter-mutant gfp gene and the digested
pEntranceposon vector were separated by agarose gel electrophoresis
and purified from gels using a QIAquick gel extraction kit
(Qiagen). The digested DNA was used for ligation using T4 ligase
(Roche) for generation of the plasmid vector pEnt-Pdlt-GFPMT1. The
pEnt-Pdlt-GFPMT1 vector was then used to transform competent E.
coli DH5.alpha. cells. Recombinant cultures harbouring the vector
pEnt-Pdlt-GFPMT1 were recovered from selective LB agar plates
containing 25 .mu.l/ml of chloramphenicol (selective antibiotic
resistance encoded in pEnt-Pdlt-GFPMT1 vector).
[0128] The pEnt-Pdlt-GFPMT1 vector was digested with BglII
restriction enzyme and the excised CamR transposon fragment
containing the Pdlt-gfp separated by agarose gel electrophoresis
and purified using a QIAquick gel Extraction kit (Qiagen Inc).
Purified CamR Pdlt-gfp transposon DNA was used for transpososome
assembly reactions. Transpososome formation reactions were
optimized by titration of the amount of CamR Pdlt-gfp gene
transposon DNA against a fixed amount of MuA transposase enzyme
(Finnzymes). Reagents for transpososome assembly reaction mixtures
(20 .mu.l) included .about.6 pmol of MuA transposase, 50% glycerol,
150 mM of Tris-HCl (pH 6.0), 150 mM NaCl, 0.1 mM EDTA, and 0.025%
(v/v) Triton X-100. Transpososome reactions were performed by
adding .about.0.25 pmol to .about.1.0 pmol of Pdlt-gfp gene
transposon DNA to the mixtures followed by incubating at 30.degree.
C. for 2-3 hours. Transpososome formation was visualized by
electrophoresis on 2% agarose-TAE buffer gel containing 80 .mu.g/ml
of bovine serum albumen. Transpososome assembly reaction samples (1
.mu.l) were loaded into the gel using 0.2 (v/v) of Ficoll 400 as
loading buffer. After gel visualization, selected transpososome
complexes were used for the transformation of L. monocytogenes
electrocompetent cells. Aliquots of 1 .mu.l of transpososome
reactions were used for electroporation of 40 .mu.l
electrocompetent L. monocytogenes cells using a Genepulser
(Bio-Rad) at the following settings: voltage 2.5 kV; capacitance 25
.mu.F; resistance 200.OMEGA. (Bio-Rad 2-mm electrode spacing
cuvettes). After electroporation 1 ml of BHI medium was added,
incubated for 90 minutes, spread onto LB plates containing 25
.mu.g/ml of chloramphenicol and incubated at 30.degree. C.
EXAMPLE 5
[0129] This section describes the expression of another fluorescent
protein, a red fluorescent protein known as DsRed2, in E. coli. The
Dsred2 was successfully integrated onto the chromosome of E. coli
but no fluorescence was visible when examined under a UV light.
E. Coli Containing Red Fluorescent Protein on a Plasmid
[0130] A gene cassette was constructed by placing T7 promoter and
ribosomal binding site upstream of starting codon of DsRed2 gene
(Clontech) using the primers T7promppf1 and Rfppr1 (see Table 1).
The cassette, herein referred to as the T7DsRed2 gene cassette, was
constructed then ligated into the pEntranceposon plasmid
(Finnzymes). This plasmid was subsequently transformed into E. coli
DH5 alpha cells.
[0131] Colonies of the plasmid containing E. coli showed a bright
red fluorescence after two days of growth on agar containing
chloramphenicol. Only weak fluorescence was observed after 24 hours
growth.
Chromosomal Integration of Red Fluorescent Protein in E. Coli
[0132] The pEntranceposon-CmR plasmid containing the T7-DsRed2 gene
cassette was digested by BglII restriction enzyme digest and the
released transposon used for MuA transpososome formation
(Finnzymes). Aliquots of the transpososome formation were used for
transformation of electrocompetent E. coli BL21 (DE3) cells and
chloramphenicol resistant transformants were recovered after
incubation on plates for 18-24 hours at 37.degree. C. Four
transformants were isolated, chromosomal DNA extracted and analyzed
for incorporation of T7DsRed2 gene into the chromosome by PCR.
Results were positive for the clones tested, indicating the
incorporation of T7DsRed2 gene into the genome of cultures. For one
of the clones nucleotide sequencing was performed and the T7DsRed2
gene sequence was confirmed to be intact. Transformants were
cultured under inducing conditions on media containing 1 mM IPTG,
an inducer of transcription from the T7 promoter. However, no
DSRed2 fluorescence could be detected from cultures when plates
were illuminated with UV light.
EXAMPLE 6
Stability of Fluorescent Strains
[0133] The fluorescence of the E. coli, Listeria and Salmonella
integrant strains were examined to ensure that these organisms
remained fluorescent when passaged multiple times.
[0134] Yeast extract broth was inoculated with each of the
fluorescent E. coli and Salmonella strains. A broth of Brain Heart
Infusion (Oxoid) was inoculated with the fluorescent Listeria
strain. The cultures were incubated with shaking at 37.degree. C.
for 24 hours. A loopfull of culture was then streaked onto nutrient
agar or in the case of Listeria onto blood agar and incubated at
37.degree. C. for 24 hours. The plates were then illuminated with a
UV light and carefully examined for the presence of non-fluorescent
colonies.
[0135] A colony from each plate was then used to inoculate another
broth and the entire process was repeated. This continued for 10
rounds of culturing.
[0136] No non-fluorescent colonies were observed. An atypical
fluorescent colony was observed with the Salmonella abatetuba
culture. The colony appeared less smooth and flatter than the
normal colonies for this strain. Biochemical analysis revealed that
it was Salmonella abatetuba but a mutant that formed atypical
colonies. It is likely that the repeated exposure to UV light
caused the mutation. The mutant was still fluorescent.
[0137] These results demonstrate that the fluorescence gene is
highly stable in these strains of bacteria.
SUMMARY
[0138] The present inventors have determined that three select
modifications to the GFP protein, namely S72A, M153T and V163A,
result is consistently higher visible expression of the protein
when expressed in E. coli in a plasmid.
[0139] It has been determined that using the unrepressed lambda
P.sub.L promoter, it is possible to constitutively express visibly
detectable levels of the modified form of GFP from a single copy of
the gfp gene integrated into the genome of 3 different strains of
E. coli and two species of Salmonella. Initial experiments
indicated that expression was stable through long periods of growth
and cell division. Precise genomic integration points were
determined for each of the E. coli and Salmonella gfp-cassette
integrants.
[0140] Detectable levels of the modified GFP were observed when
expressed in Listeria monocytogenes under the control of the
Listeria Pdlt promoter.
[0141] Detectable levels of the modified GFP were not observed when
expressed from a single copy integrated gene under the control of
the lambda ci.sup.ts857 repressor protein. Similarly, the
fluorescent protein DsRed2 could not be detected when expressed
from a single copy integrated gene under the control of a T7 RNA
polymerase/T7 promoter system.
[0142] Means for the production of cells visibly altered by
expression of a modified GFP protein have been developed that make
them useful as QC strains in microbiological testing.
[0143] It should be appreciated that this technique is applicable
to other bacterial species, and that other promoter systems and
marker genes could be used in a similar fashion to achieve visible
alteration of bacterial cells.
[0144] It will be appreciated by persons skilled in the art that
numerous variations and/or modifications may be made to the
invention as shown in the specific embodiments without departing
from the spirit or scope of the invention as broadly described. The
present embodiments are, therefore, to be considered in all
respects as illustrative and not restrictive.
Sequence CWU 1
1
2512007DNAbacterial 1aaaaaaaaaa gtcgactcag ccaaacgtct cttcaggcca
ctgactagcg ataactttcc 60ccacaacgga acaactctca ttgcatggga tcattgggta
ctgtgggttt agtggttgta 120aaaacacctg accgctatcc ctgatcagtt
tcttgaaggt aaactcatca cccccaagtc 180tggctatgca gaaatcacct
ggctcaacag cctgctcagg gtcaacgaga attaacattc 240cgtcaggaaa
gcttggcttg gagcctgttg gtgcggtcat ggaattacct tcaacctcaa
300gccagaatgc agaatcactg gcttttttgg ttgtgcttac ccatctctcc
gcatcacctt 360tggtaaaggt tctaagctta ggtgagaaca tccctgcctg
aacatgagaa aaaacagggt 420actcatactc acttctaagt gacggctgca
tactaaccgc ttcatacatc tcgtagattt 480ctctggcgat tgaagggcta
aattcttcaa cgctaacttt gagaattttt gtaagcaatg 540cggcgttata
agcatttaat gcattgatgc cattaaataa agcaccaacg cctgactgcc
600ccatccccat cttgtctgcg acagattcct gggataagcc aagttcattt
ttcttttttt 660cataaattgc tttaaggcga cgtgcgtcct caagctgctc
ttgtgttaat ggtttctttt 720ttgtgctcat acgttaaatc tatcaccgca
agggataaat atctaacacc gtgcgtgttg 780actattttac ctctggcggt
gataatggtt gcatgtacta aggaggttgt atggaacaac 840gcataaccct
gaaagattat gcaatgcgct ttgggcaaac caagacagct aaagatcaag
900aatgttgatc ttcagtgttt cgcctgtctg ttttgcaccg gaatttttga
gttctgccgt 960ttatcgcccg gggatctctc acctaccaaa caatgccccc
ctgcaaaaaa taaattcata 1020taaaaaacat acagataacc atctgcggtg
ataaattatc tctggcggtg ttgacataaa 1080taccactggc ggtgatactg
agcacatcag caggacgcac tgaccaccat gaaggtgacg 1140ctcttaaaaa
ttaagccctg aagaagggca gcattcaaag cagaaggctt tggggtgtgt
1200gatacgaaac gaagcattgg cgcctcgagt aatttaccaa cactactacg
ttttaactga 1260aacaaactgg agactgccat gagtaaagga gaagaacttt
tcactggagt tgtcccaatt 1320cttgttgaat tagatggtga tgttaatggg
cacaaatttt ctgtcagtgg agagggtgaa 1380ggtgatgcaa catacggaaa
acttaccctt aaatttattt gcactactgg aaaactacct 1440gttccatggc
caacacttgt cactactttc ksktatggts ttcaatgctt tkcragatac
1500ccagatcata tgaaacggca tgactttttc aagagtgcca tgcccgaagg
ttatgtacag 1560gaaagaacta tatytttcaa agatgacggg aactacaaga
cacgtgctga agtcaagttt 1620gaaggtgata cccttgttaa tagaatcgag
ttaaaaggta ttgattttaa agaagatgga 1680aacattcttg gacacaaatt
ggaatacaac tataactcac acaatgtata catcatygca 1740gacaaacaaa
agaatggaat caaagytaac ttcaaaatta gacacaacat tgaagatgga
1800agcgttcaac tagcagacca ttatcaacaa aatactccaa ttggcgatgg
ccctgtcctt 1860ttaccagaca accattacct gtccacacaa tctgcccttt
cgaaagatcc caacgaaaag 1920agagaccaca tggtccttct tgagtttgta
acagctgctg ggattacaca tggcatggat 1980gaactataca aataagaatt caaaaaa
20072237PRTvirus 2Gly Phe Thr Glu Glu Pro Trp Gln Ser Ala Ile Val
Lys Gly Val Val1 5 10 15Ser Cys Ser Glu Asn Cys Pro Ile Met Pro Tyr
Gln Pro Asn Leu Pro 20 25 30Gln Leu Phe Val Gln Gly Ser Asp Arg Ile
Leu Lys Lys Phe Thr Phe 35 40 45Glu Asp Gly Gly Leu Arg Ala Ile Cys
Phe Asp Gly Pro Glu Val Ala 50 55 60Gln Glu Pro Asp Val Leu Ile Leu
Met Gly Asp Pro Phe Ser Pro Lys65 70 75 80Ser Gly Thr Pro Ala Thr
Met Ser Asn Gly Glu Val Glu Leu Trp Phe 85 90 95Ala Ser Asp Ser Ala
Lys Lys Thr Thr Ser Val Trp Arg Glu Ala Asp 100 105 110Gly Lys Thr
Phe Thr Arg Leu Lys Pro Ser Phe Met Gly Ala Gln Val 115 120 125His
Ser Phe Val Pro Tyr Glu Tyr Glu Ser Arg Leu Ser Pro Gln Met 130 135
140Ser Val Ala Glu Tyr Met Glu Tyr Ile Glu Arg Ala Ile Ser Pro
Ser145 150 155 160Phe Glu Glu Val Ser Val Lys Leu Ile Lys Thr Leu
Leu Ala Ala Asn 165 170 175Tyr Ala Asn Leu Ala Asn Ile Gly Asn Phe
Leu Ala Gly Val Gly Ser 180 185 190Gln Gly Met Gly Met Lys Asp Ala
Val Ser Glu Gln Ser Leu Gly Leu 195 200 205Glu Asn Lys Lys Lys Glu
Tyr Ile Ala Lys Leu Arg Arg Ala Asp Glu 210 215 220Leu Gln Glu Gln
Thr Leu Pro Lys Lys Lys Thr Ser Met225 230 2353238PRTJellyfish 3Met
Ser Lys Gly Glu Glu Leu Phe Thr Gly Val Val Pro Ile Leu Val1 5 10
15Glu Leu Asp Gly Asp Val Asn Gly His Lys Phe Ser Val Ser Gly Glu
20 25 30Gly Glu Gly Asp Ala Thr Tyr Gly Lys Leu Thr Leu Lys Phe Ile
Cys 35 40 45Thr Thr Gly Lys Leu Pro Val Pro Trp Pro Thr Leu Val Thr
Thr Phe 50 55 60Ser Tyr Gly Val Gln Cys Phe Ser Arg Tyr Pro Asp His
Met Lys Arg65 70 75 80His Asp Phe Phe Lys Ser Ala Met Pro Glu Gly
Tyr Val Gln Glu Arg 85 90 95Thr Ile Phe Phe Lys Asp Asp Gly Asn Tyr
Lys Thr Arg Ala Glu Val 100 105 110Lys Phe Glu Gly Asp Thr Leu Val
Asn Arg Ile Glu Leu Lys Gly Ile 115 120 125Asp Phe Lys Glu Asp Gly
Asn Ile Leu Gly His Lys Leu Glu Tyr Asn 130 135 140Tyr Asn Ser His
Asn Val Tyr Ile Met Ala Asp Lys Gln Lys Asn Gly145 150 155 160Ile
Lys Val Asn Phe Lys Ile Arg His Asn Ile Glu Asp Gly Ser Val 165 170
175Gln Leu Ala Asp His Tyr Gln Gln Asn Thr Pro Ile Gly Asp Gly Pro
180 185 190Val Leu Leu Pro Asp Asn His Tyr Leu Ser Thr Gln Ser Ala
Leu Ser 195 200 205Lys Asp Pro Asn Glu Lys Arg Asp His Met Val Leu
Leu Glu Phe Val 210 215 220Thr Ala Ala Gly Ile Thr His Gly Met Asp
Glu Leu Tyr Lys225 230 23542326DNAbacteria 4agatctgaag cggcgcacga
aaaacgcgaa agcgtttcac gataaatgcg aaaacggatc 60cttttcgacc gaataaatac
ctgtgacgga agatcacttc gcagaataaa taaatcctgg 120tgtccctgtt
gataccggga agccctgggc caacttttgg cgaaaatgag acgttgatcg
180gcacgtaaga ggttccaact ttcaccataa tgaaataaga tcactaccgg
gcgtattttt 240tgagttgtcg agattttcag gagctaagga agctaaaatg
gagaaaaaaa tcactggata 300taccaccgtt gatatatccc aatggcatcg
taaagaacat tttgaggcat ttcagtcagt 360tgctcaatgt acctataacc
agaccgttca gctggatatt acggcctttt taaagaccgt 420aaagaaaaat
aagcacaagt tttatccggc ctttattcac attcttgccc gcctgatgaa
480tgctcatccg gaattacgta tggcaatgaa agacggtgag ctggtgatat
gggatagtgt 540tcacccttgt tacaccgttt tccatgagca aactgaaacg
ttttcatcgc tctggagtga 600ataccacgac gatttccggc agtttctaca
catatattcg caagatgtgg cgtgttacgg 660tgaaaacctg gcctatttcc
ctaaagggtt tattgagaat atgtttttcg tctcagccaa 720tccctgggtg
agtttcacca gttttgattt aaacgtggcc aatatggaca acttcttcgc
780ccccgttttc accatgggca aatattatac gcaaggcgac aaggtgctga
tgccgctggc 840gattcaggtt catcatgccg tttgtgatgg cttccatgtc
ggcagaatgc ttaatgaatt 900acaacagtac tgcgatgagt ggcagggcgg
ggcgtaattt ttttaaggca gttattggtg 960cccttaaacg cctggttgct
acgcctgaat aagtgataat aagcggatga atggcagaaa 1020ttcgaaagca
aattcgaccc ggtcgtcggt tcagggcagg gtcgttaaat agccgcttat
1080gtctattgct ggtttaccgg tttattgact accggaagca gtgtgaccgt
gtgcttctca 1140aatgcctgag gccagtttgc tcaggctctc cccgtggagg
taataattga cgataggatc 1200cgcggccggc cgatggggat ctctcaccta
ccaaacaatg cccccctgca aaaaataaat 1260tcatataaaa aacatacaga
taaccatctg cggtgataaa ttatctctgg cggtgttgac 1320ataaatacca
ctggcggtga tactgagcac atcagcagga cgcactgacc accatgaagg
1380tgacgctctt aaaaattaag ccctgaagaa gggcagcatt caaagcagaa
ggctttgggg 1440tgtgtgatac gaaacgaagc attggcgcct cgagtaattt
accaacacta ctacgtttta 1500actgaaacaa actggagact gccatgagta
aaggagaaga acttttcact ggagttgtcc 1560caattcttgt tgaattagat
ggtgatgtta atgggcacaa attttctgtc agtggagagg 1620gtgaaggtga
tgcaacatac ggaaaactta cccttaaatt tatttgcact actggaaaac
1680tacctgttcc atggccaaca cttgtcacta ctttctctta tggtgttcaa
tgctttgcga 1740gatacccaga tcatatgaaa cggcatgact ttttcaagag
tgccatgccc gaaggttatg 1800tacaggaaag aactatattt ttcaaagatg
acgggaacta caagacacgt gctgaagtca 1860agtttgaagg tgataccctt
gttaatagaa tcgagttaaa aggtattgat tttaaagaag 1920atggaaacat
tcttggacac aaattggaat acaactataa ctcacacaat gtatacatca
1980cggcagacaa acaaaagaat ggaatcaaag ctaacttcaa aattagacac
aacattgaag 2040atggaagcgt tcaactagca gaccattatc aacaaaatac
tccaattggc gatggccctg 2100tccttttacc agacaaccat tacctgtcca
cacaatctgc cctttcgaaa gatcccaacg 2160aaaagagaga ccacatggtc
cttcttgagt ttgtaacagc tgctgggatt acacatggca 2220tggatgaact
atacaaataa gaattctcta gatgatcagc ggccgcgatc cgttttcgca
2280tttatcgtga aacgctttcg cgtttttcgt gcgccgcttc agatct
23265219PRTvirus 5Met Glu Lys Lys Ile Thr Gly Tyr Thr Thr Val Asp
Ile Ser Gln Trp1 5 10 15His Arg Lys Glu His Phe Glu Ala Phe Gln Ser
Val Ala Gln Cys Thr 20 25 30Tyr Asn Gln Thr Val Gln Leu Asp Ile Thr
Ala Phe Leu Lys Thr Val 35 40 45Lys Lys Asn Lys His Lys Phe Tyr Pro
Ala Phe Ile His Ile Leu Ala 50 55 60Arg Leu Met Asn Ala His Pro Glu
Leu Arg Met Ala Met Lys Asp Gly65 70 75 80Glu Leu Val Ile Trp Asp
Ser Val His Pro Cys Tyr Thr Val Phe His 85 90 95Glu Gln Thr Glu Thr
Phe Ser Ser Leu Trp Ser Glu Tyr His Asp Asp 100 105 110Phe Arg Gln
Phe Leu His Ile Tyr Ser Gln Asp Val Ala Cys Tyr Gly 115 120 125Glu
Asn Leu Ala Tyr Phe Pro Lys Gly Phe Ile Glu Asn Met Phe Phe 130 135
140Val Ser Ala Asn Pro Trp Val Ser Phe Thr Ser Phe Asp Leu Asn
Val145 150 155 160Ala Asn Met Asp Asn Phe Phe Ala Pro Val Phe Thr
Met Gly Lys Tyr 165 170 175Tyr Thr Gln Gly Asp Lys Val Leu Met Pro
Leu Ala Ile Gln Val His 180 185 190His Ala Val Cys Asp Gly Phe His
Val Gly Arg Met Leu Asn Glu Leu 195 200 205Gln Gln Tyr Cys Asp Glu
Trp Gln Gly Gly Ala 210 2156238PRTJellyfish 6Met Ser Lys Gly Glu
Glu Leu Phe Thr Gly Val Val Pro Ile Leu Val1 5 10 15Glu Leu Asp Gly
Asp Val Asn Gly His Lys Phe Ser Val Ser Gly Glu 20 25 30Gly Glu Gly
Asp Ala Thr Tyr Gly Lys Leu Thr Leu Lys Phe Ile Cys 35 40 45Thr Thr
Gly Lys Leu Pro Val Pro Trp Pro Thr Leu Val Thr Thr Phe 50 55 60Ser
Tyr Gly Val Gln Cys Phe Ala Arg Tyr Pro Asp His Met Lys Arg65 70 75
80His Asp Phe Phe Lys Ser Ala Met Pro Glu Gly Tyr Val Gln Glu Arg
85 90 95Thr Ile Phe Phe Lys Asp Asp Gly Asn Tyr Lys Thr Arg Ala Glu
Val 100 105 110Lys Phe Glu Gly Asp Thr Leu Val Asn Arg Ile Glu Leu
Lys Gly Ile 115 120 125Asp Phe Lys Glu Asp Gly Asn Ile Leu Gly His
Lys Leu Glu Tyr Asn 130 135 140Tyr Asn Ser His Asn Val Tyr Ile Thr
Ala Asp Lys Gln Lys Asn Gly145 150 155 160Ile Lys Ala Asn Phe Lys
Ile Arg His Asn Ile Glu Asp Gly Ser Val 165 170 175Gln Leu Ala Asp
His Tyr Gln Gln Asn Thr Pro Ile Gly Asp Gly Pro 180 185 190Val Leu
Leu Pro Asp Asn His Tyr Leu Ser Thr Gln Ser Ala Leu Ser 195 200
205Lys Asp Pro Asn Glu Lys Arg Asp His Met Val Leu Leu Glu Phe Val
210 215 220Thr Ala Ala Gly Ile Thr His Gly Met Asp Glu Leu Tyr
Lys225 230 23571032DNAbacterial 7ggggatctct cacctaccaa acaatgcccc
cctgcaaaaa ataaattcat ataaaaaaca 60tacagataac catctgcggt gataaattat
ctctggcggt gttgacataa ataccactgg 120cggtgatact gagcacatca
gcaggacgca ctgaccacca tgaaggtgac gctcttaaaa 180attaagccct
gaagaagggc agcattcaaa gcagaaggct ttggggtgtg tgatacgaaa
240cgaagcattg gcgcctcgag taatttacca acactactac gttttaactg
aaacaaactg 300gagactgcca tgagtaaagg agaagaactt ttcactggag
ttgtcccaat tcttgttgaa 360ttagatggtg atgttaatgg gcacaaattt
tctgtcagtg gagagggtga aggtgatgca 420acatacggaa aacttaccct
taaatttatt tgcactactg gaaaactacc tgttccatgg 480ccaacacttg
tcactacttt ctcttatggt gttcaatgct ttgcgagata cccagatcat
540atgaaacggc atgacttttt caagagtgcc atgcccgaag gttatgtaca
ggaaagaact 600atatttttca aagatgacgg gaactacaag acacgtgctg
aagtcaagtt tgaaggtgat 660acccttgtta atagaatcga gttaaaaggt
attgatttta aagaagatgg aaacattctt 720ggacacaaat tggaatacaa
ctataactca cacaatgtat acatcacggc agacaaacaa 780aagaatggaa
tcaaagctaa cttcaaaatt agacacaaca ttgaagatgg aagcgttcaa
840ctagcagacc attatcaaca aaatactcca attggcgatg gccctgtcct
tttaccagac 900aaccattacc tgtccacaca atctgccctt tcgaaagatc
ccaacgaaaa gagagaccac 960atggtccttc ttgagtttgt aacagctgct
gggattacac atggcatgga tgaactatac 1020aaataagaat tc
10328238PRTJellyfish 8Met Ser Lys Gly Glu Glu Leu Phe Thr Gly Val
Val Pro Ile Leu Val1 5 10 15Glu Leu Asp Gly Asp Val Asn Gly His Lys
Phe Ser Val Ser Gly Glu 20 25 30Gly Glu Gly Asp Ala Thr Tyr Gly Lys
Leu Thr Leu Lys Phe Ile Cys 35 40 45Thr Thr Gly Lys Leu Pro Val Pro
Trp Pro Thr Leu Val Thr Thr Phe 50 55 60Ser Tyr Gly Val Gln Cys Phe
Ala Arg Tyr Pro Asp His Met Lys Arg65 70 75 80His Asp Phe Phe Lys
Ser Ala Met Pro Glu Gly Tyr Val Gln Glu Arg 85 90 95Thr Ile Phe Phe
Lys Asp Asp Gly Asn Tyr Lys Thr Arg Ala Glu Val 100 105 110Lys Phe
Glu Gly Asp Thr Leu Val Asn Arg Ile Glu Leu Lys Gly Ile 115 120
125Asp Phe Lys Glu Asp Gly Asn Ile Leu Gly His Lys Leu Glu Tyr Asn
130 135 140Tyr Asn Ser His Asn Val Tyr Ile Thr Ala Asp Lys Gln Lys
Asn Gly145 150 155 160Ile Lys Ala Asn Phe Lys Ile Arg His Asn Ile
Glu Asp Gly Ser Val 165 170 175Gln Leu Ala Asp His Tyr Gln Gln Asn
Thr Pro Ile Gly Asp Gly Pro 180 185 190Val Leu Leu Pro Asp Asn His
Tyr Leu Ser Thr Gln Ser Ala Leu Ser 195 200 205Lys Asp Pro Asn Glu
Lys Arg Asp His Met Val Leu Leu Glu Phe Val 210 215 220Thr Ala Ala
Gly Ile Thr His Gly Met Asp Glu Leu Tyr Lys225 230
235930DNAbacteria 9ttttttgaat tcttatttgt atagttcatc
301027DNAbacteria 10ctttactcat ggcagtctcc agtttgt 271126DNAbacteria
11gagactgcca tgagtaaagg agaaga 261236DNAbacteria 12atggtsttca
atgctttkcr agatacccag atcata 361326DNAbacteria 13aactatatyt
ttcaaagatg acggga 261440DNAbacteria 14caaacaaaag aatggaatca
aagytaactt caaaattaga 401530DNAbacteria 15ttttttgaat tcttatttgt
atagttcatc 301637DNAbacteria 16aaagcattga asaccatams mgaaagtagt
gacaagt 371727DNAbacteria 17ctttgaaara tatagttctt tcctgta
271841DNAbacteria 18ttccattctt ttgtttgtct gccrtgatgt atacattgtg t
411918DNAbacteria 19ccagtttgct caggctct 182064DNAbacteria
20ggggaattct taatacgact cactatagaa ggagatatac atatggcctc cgagaacgtc
60atca 642131DNAbacteria 21gggggggtcg acctacagga acaggtggtg g
312218DNAbacteria 22tgatcttccg tcacaggt 182318DNAbacteria
23gtaacagctg ctgggatt 182450DNAbacteria 24aaacgggatc cgaaaggagg
tttattaaaa tgagtaaagg agaagaactt 502537DNAbacteria 25aaaaaactgc
agttatttgt atagttcatc catgcca 37
* * * * *