U.S. patent application number 12/906651 was filed with the patent office on 2011-02-10 for treatments for flaviviridae virus infection.
This patent application is currently assigned to Schering Corporation. Invention is credited to Boris Feld, Hung Le, Bruce A. Malcolm, Robert Palermo, Xiao Tong.
Application Number | 20110033422 12/906651 |
Document ID | / |
Family ID | 36944331 |
Filed Date | 2011-02-10 |
United States Patent
Application |
20110033422 |
Kind Code |
A1 |
Malcolm; Bruce A. ; et
al. |
February 10, 2011 |
TREATMENTS FOR FLAVIVIRIDAE VIRUS INFECTION
Abstract
The present invention provides methods for treating infections,
in a host, by viruses belonging to the Flaviviridae family, such as
HCV, comprising administering an Ara-C homologue to the host.
Inventors: |
Malcolm; Bruce A.; (Paoli,
PA) ; Palermo; Robert; (Seattle, WA) ; Tong;
Xiao; (Short Hills, NJ) ; Feld; Boris; (New
Milford, NJ) ; Le; Hung; (Rockaway, NJ) |
Correspondence
Address: |
MERCK;PATENT DEPARTMENT (K-6-1, 1990)
2000 GALLOPING HILL ROAD
KENILWORTH
NJ
07033-0530
US
|
Assignee: |
Schering Corporation
|
Family ID: |
36944331 |
Appl. No.: |
12/906651 |
Filed: |
October 18, 2010 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12412967 |
Mar 27, 2009 |
7816339 |
|
|
12906651 |
|
|
|
|
11365008 |
Mar 1, 2006 |
7524831 |
|
|
12412967 |
|
|
|
|
60658006 |
Mar 2, 2005 |
|
|
|
Current U.S.
Class: |
424/85.7 ;
514/49 |
Current CPC
Class: |
A61K 31/7072 20130101;
A61K 31/7072 20130101; A61K 38/212 20130101; A61P 31/12 20180101;
A61K 38/212 20130101; A61K 2300/00 20130101; A61K 2300/00
20130101 |
Class at
Publication: |
424/85.7 ;
514/49 |
International
Class: |
A61K 38/21 20060101
A61K038/21; A61K 31/7068 20060101 A61K031/7068; A61P 31/12 20060101
A61P031/12 |
Claims
1. A method for treating an infection by a virus which is a member
of the Flaviviridae family of viruses, in a mammalian host,
comprising administering to said host a therapeutically effective
amount of a compound represented by structural formula IV
##STR00077## or a pharmaceutically acceptable salt thereof or a
pharmaceutical composition thereof which composition comprises a
pharmaceutically acceptable carrier; wherein R.sup.3 and R.sup.4
are independently --OH or a pharmaceutically acceptable leaving
group, wherein R.sup.5 is --OH, a straight or branched chain
C.sub.9 to C.sub.24 alkylphosphate or a straight or branched chain
C.sub.9 to C.sub.24 alkenylphosphate group or a pharmaceutically
acceptable leaving group and wherein R.sup.1 and R.sup.2 are
independently C.sub.1 to C.sub.10 alkyl or wherein R.sup.1 and
R.sup.2 taken together with N form a C.sub.3 to C.sub.7 ring
represented by the following structural formula: ##STR00078##
wherein n and m are independently 0, 1, 2 or 3 and Q is CH.sub.2,
NR, O, S, SO or SO.sub.2; and R is independently H, C.sub.1 to
C.sub.6 alkyl or C.sub.1 to C.sub.6 acyl or wherein R.sup.1 and
R.sup.2, taken together with the N, are represented by the
structural formula: ##STR00079## and wherein said pharmaceutically
acceptable leaving groups groups are capable of being converted to
--OH, -phosphate, --F or --CH.sub.3 when the compound of structural
formula IV is administered in vivo and are independently
represented by structural formula ##STR00080## wherein Y.dbd.H,
CH.sub.3, CH.sub.3CH.sub.2--, CH.sub.3CH.sub.2CH.sub.2--,
Me.sub.2CH--, Me.sub.2CH.sub.2CH.sub.2--, CH.sub.3CH.sub.2CH(Me)--,
PhCH.sub.2--, HOOCCH.sub.2CH.sub.2--, HSCH.sub.2--, HOOCCH.sub.2--,
MeSCH.sub.2CH.sub.2--, HOCH.sub.2--, ##STR00081##
H.sub.2N(CH.sub.2).sub.4--, or CH.sub.3CH(OH)--, or a
pharmaceutically acceptable salt thereof, or Y, taken together with
the alpha-carbon and N, form ##STR00082## or wherein the
pharmaceutically acceptable leaving groups are capable of being
converted to --OH, -phosphate, --F or --CH.sub.3 when the compound
of structural formula IV is administered in vivo and are
independently represented by a structural formula selected from the
group consisting of: ##STR00083## in association with one or more
further chemotherapeutic agents.
2. The method of claim 1 wherein the further chemotherapeutic agent
is: a ribonucleoside analogue, an IMPDH inhibitor, an
N-glycosylation inhibitor, an N3 protease inhibitor, an NS5B
inhibitor, an immunomodulatory compound, a CTP synthase inhibitor,
a thiazolidine derivative, a benzanilide, a phenanthrenequinone, a
helicase inhibitor, a polymerase inhibitor, an antisense
phosphothioate oligodeoxynucleotide, an IRES-dependent translation
inhibitor, a nuclease resistant ribozyme, a
1-amino-alkyloyclohexane, an alkyl lipid, an antioxidant, squalene,
amantadine, a bile acid, N-(phosphonoacetyl)-L-aspartic acid, a
benzenedicarboxamide, a polyadenylic acid, 2',3' dideoxyinosine, or
a benzimidazole.
3. The method of claim 1 wherein the further chemotherapeutic agent
is one or more members selected from the group consisting of:
gemcitabine, VX497, mycophenolate mofetil, EICAR, tiazofurin,
deoxynojirimycin, N-nonyl-deoxynojirimycin, n-butyl
deoxynojirimycin albumin-interferon alpha, BILN-2061, thymalfasin,
isatoribine, NM283, NM107, ##STR00084## gliotoxin, RD3-4082,
RD3-4078, ##STR00085## RD4-6205, cerulenin, ceplene, amantadine,
IDN-6556, naphthoquinone, 2-methylnaphthoquinone,
2-hydroxynaphthoquinone, 5-hydroxynaphthoquinone,
5,8-dihydroxynaphthoquinone, alkannin, or shikonin,
1-amino-1,3,5-trimethylcyclohexane;
1-amino-1(trans),3(trans),5-trimethylcyclohexane;
1-amino-1(cis),3(cis),5-trimethylcyclohexane;
1-amino-1,3,3,5-tetramethylcyclohexane;
1-amino-1,3,3,5,5-pentamethylcyclohexane;
1-amino-1,3,5,5-tetramethyl-3-ethylcyclohexane;
1-amino-1,5,5-trimethyl-3,3-diethylcyclohexane;
1-amino-1,5,5-trimethyl-cis-3-ethylcyclohexane;
1-amino-(1S,5S)cis-3-ethyl-1,5,5-trimethylcyclohexane;
1-amino-1,5,5-trimethyl-trans-3-ethylcyclohexane;
1-amino-(1R,5S)trans-3-ethyl-1,5,5-trimethylcyclohexane;
1-amino-1-ethyl-3,3,5,5-tetramethylcyclohexane;
1-amino-1-propyl-3,3,5,5-tetramethylcyclohexane;
N-methyl-1-amino-1,3,3,5,5-pentamethylcyclohexane;
N-ethyl-1-amino-1,3,3,5,5-pentamethylcyclohexane;
N-(1,3,3,5,5-pentamethylcyclohexyl)pyrrolidine,
d-.alpha.-tocopherol, tauroursodeoxycholic acid, chenodeoxycholic
acid, ursodeoxycholic acid, free bile acid;
1,1'-[1,4-phenylenebis(methylene)]bis(4,4'-trans-(4,5,6,7,8,9-hexahydro)
benzimidazoyl)piperidine;
1,1'-[1,4-phenylenebis(methylene)]bis(4,4'-benzimidazoyl)piperidine;
N,N'-4-[(2-benzimidazole)phenyl]-1,4-butanedicarboxamide;
N,N'-4-[(2-benzimidazole)phenyl]-1,6-hexanedicarboxamide;
N,N'-4-[(2-benzimidazole)phenyl]-1,8-octanedicarboxamide;
N,N'-4-[(2-benzimidazole)phenyl]-1,9-nonanedicarboxamide;
N,N'-4-[(2-benzimidazole)phenyl]-1,10-decanedicarboxamide;
N,N'-4-[(2-benzimidazole)phenyl]-1,4-butenedicarboxamide;
2',3'-dideoxyinosine ##STR00086## VX-950, viramidine and
levovirin.
4. The method claim 1 wherein the virus is hepatitis C virus, the
host is human and the compound represented by structural formula IV
is ##STR00087##
5. The method claim 2 wherein the virus is hepatitis C virus, the
host is human and the compound represented by structural formula IV
is ##STR00088##
6. The method claim 3 wherein the virus is hepatitis C virus, the
host is human and the compound represented by structural formula IV
is ##STR00089##
7. The method claim 4 wherein the further chemotherapeutic agent is
one or more members selected from the group consisting of:
ribavirin, interferon alfa-2a, interferon alfa-2b, PEGylated
Interferon alfa-2a, and PEGylated Interferon alfa-2b.
8. The method claim 5 wherein the further chemotherapeutic agent is
one or more members selected from the group consisting of:
ribavirin, interferon alfa-2a, interferon alfa-2b, PEGylated
Interferon alfa-2a, and PEGylated Interferon alfa-2b.
9. The method claim 6 wherein the further chemotherapeutic agent is
one or more members selected from the group consisting of:
ribavirin, interferon alfa-2a, interferon alfa-2b, PEGylated
Interferon alfa-2a, and PEGylated Interferon alfa-2b.
10. The method of claim 1 wherein the host is administered the
compound represented by structural formula IV following
transplantation of a liver into said host or transfusion of blood
into said host.
11. The method of claim 1 wherein the compound represented by
structural formula IV is selected from the group consisting of:
##STR00090## ##STR00091## ##STR00092## ##STR00093##
##STR00094##
12. A composition represented by structural formula IV ##STR00095##
or a pharmaceutically acceptable salt thereof or a pharmaceutical
composition thereof which composition comprises a pharmaceutically
acceptable carrier; wherein R.sup.3 and R.sup.4 are independently
--OH or a pharmaceutically acceptable leaving group, wherein
R.sup.5 is a straight or branched chain C.sub.9 to C.sub.24
alkylphosphate or a straight or branched chain C.sub.9 to C.sub.24
alkenylphosphate group and wherein R.sup.1 and R.sup.2 are
independently C.sub.1 to C.sub.10 alkyl or wherein R.sup.1 and
R.sup.2 taken together with N form a C.sub.3 to C.sub.7 ring
represented by the following structural formula: ##STR00096##
wherein n and m are independently 0, 1, 2 or 3 and Q is CH.sub.2,
NR, O, S, SO or SO.sub.2; and R is independently H, C.sub.1 to
C.sub.6 alkyl or C.sub.1 to C.sub.6 acyl or wherein R.sup.1 and
R.sup.2, taken together with the N, are represented by the
structural formula: ##STR00097## and wherein said pharmaceutically
acceptable leaving groups are capable of being converted to --OH,
-phosphate, --F or --CH.sub.3 when the compound of structural
formula IV is administered in vivo and are independently
represented by the structural formula ##STR00098## wherein Y.dbd.H,
CH.sub.3, CH.sub.3CH.sub.2--, CH.sub.3CH.sub.2CH.sub.2--,
Me.sub.2CH--, Me.sub.2CH.sub.2CH.sub.2--, CH.sub.3CH.sub.2CH(Me)--,
PhCH.sub.2--, HOOCCH.sub.2CH.sub.2--, HSCH.sub.2--, HOOCCH.sub.2--,
MeSCH.sub.2CH.sub.2--, HOCH.sub.2--, ##STR00099##
--H.sub.2N(CH.sub.2).sub.4--, or CH.sub.3CH(OH)--, or a
pharmaceutically acceptable salt thereof, or Y, taken together with
the alpha-carbon and N, form ##STR00100## or wherein said
pharmaceutically acceptable leaving groups are capable of being
converted to --OH, -phosphate, --F or --CH.sub.3 when the compound
of structural formula IV is administered in vivo and are
independently represented by a structural formula selected from the
group consisting of: ##STR00101## in association with one or more
further chemotherapeutic agents.
13. A composition which is represented by a structural formula
selected from the group consisting of: ##STR00102## ##STR00103##
##STR00104## in association with one or more further
chemotherapeutic agents.
14. The composition of claim 12 wherein the further
chemotherapeutic agent is: a ribonucleoside analogue, an IMPDH
inhibitor, an N-glycosylation inhibitor, an N3 protease inhibitor,
an NS5B inhibitor, an immunomodulatory compound, a CTP synthase
inhibitor, a thiazolidine derivative, a benzanilide, a
phenanthrenequinone, a helicase inhibitor, a polymerase inhibitor,
an antisense phosphothioate oligodeoxynucleotide, an IRES-dependent
translation inhibitor, A nuclease resistant ribozyme, a
1-amino-alkyloyclohexane, an alkyl lipid, antioxidants, squalene,
amantadine, a bile acid, N-(phosphonoacetyl)-L-aspartic acid, a
benzenedicarboxamide, a polyadenylic acid derivative, 2',3'
dideoxyinosine, or a benzimidazole.
15. The composition of claim 12 wherein the further
chemotherapeutic agent is one or more members selected from the
group consisting of: gemcitabine, VX497, mycophenolate mofetil,
EICAR, tiazofurin, deoxynojirimycin, N-nonyl-deoxynojirimycin,
n-butyl deoxynojirimycin albumin-interferon alpha, BILN-2061,
thymalfasin, isatoribine, NM283, NM107, ##STR00105## gliotoxin,
RD3-4082, RD3-4078, ##STR00106## RD4-6205, cerulenin, ceplene,
amantadine, IDN-6556, naphthoquinone, 2-methylnaphthoquinone,
2-hydroxynaphthoquinone, 5-hydroxynaphthoquinone,
5,8-dihydroxynaphthoquinone, alkannin, or shikonin,
1-amino-1,3,5-trimethylcyclohexane;
1-amino-1(trans),3(trans),5-trimethylcyclohexane;
1-amino-1(cis),3(cis),5-trimethylcyclohexane;
1-amino-1,3,3,5-tetramethylcyclohexane;
1-amino-1,3,3,5,5-pentamethylcyclohexane;
1-amino-1,3,5,5-tetramethyl-3-ethylcyclohexane;
1-amino-1,5,5-trimethyl-3,3-diethylcyclohexane;
1-amino-1,5,5-trimethyl-cis-3-ethylcyclohexane;
1-amino-(1S,5S)cis-3-ethyl-1,5,5-trimethylcyclohexane;
1-amino-1,5,5-trimethyl-trans-3-ethylcyclohexane;
1-amino-(1R,5S)trans-3-ethyl-1,5,5-trimethylcyclohexane;
1-amino-1-ethyl-3,3,5,5-tetramethylcyclohexane;
1-amino-1-propyl-3,3,5,5-tetramethylcyclohexane;
N-methyl-1-amino-1,3,3,5,5-pentamethylcyclohexane;
N-ethyl-1-amino-1,3,3,5,5-pentamethylcyclohexane;
N-(1,3,3,5,5-pentamethylcyclohexyl)pyrrolidine,
d-.alpha.-tocopherol, tauroursodeoxycholic acid, chenodeoxycholic
acid, ursodeoxycholic acid, free bile acid;
1,1'-[1,4-phenylenebis(methylene)]bis(4,4'-trans-(4,5,6,7,8,9-hexahydro)
benzimidazoyl)piperidine;
1,1'-[4-phenylenebis(methylene)]bis(4,4'-benzimidazoyl)piperidine;
N,N'-4-[(2-benzimidazole)phenyl]-1,4-butanedicarboxamide;
N,N'-4-[(2-benzimidazole)phenyl]-1,6-hexanedicarboxamide;
N,N'-4-[(2-benzimidazole)phenyl]-1,8-octanedicarboxamide;
N,N'-4-[(2-benzimidazole)phenyl]-1,9-nonanedicarboxamide;
N,N'-4-[(2-benzimidazole)phenyl]-1,10-decanedicarboxamide;
N,N'-4-[(2-benzimidazole)phenyl]-1,4-butenedicarboxamide;
2',3'-dideoxyinosine, ##STR00107## VX-950, viramidine and
levovirin.
16. The composition of claim 12 wherein the further
chemotherapeutic agent one or more members selected from the group
consisting of: ribavirin, interferon alfa-2a, interferon alfa-2b,
PEGylated Interferon alfa-2a, and PEGylated Interferon alfa-2b.
17. The composition of claim 13 wherein the further
chemotherapeutic agent one or more members selected from the group
consisting of: ribavirin, interferon alfa-2a, interferon alfa-2b,
PEGylated Interferon alfa-2a, and PEGylated Interferon alfa-2b.
Description
[0001] This application is a continuation of U.S. patent
application Ser. No. 12/412,967, filed Mar. 7, 2009; which is a
continuation of U.S. patent application Ser. No. 11/365,008, filed
Mar. 1, 2006; which claims the benefit of U.S. provisional patent
application No. 60/658,006, filed Mar. 2, 2005; each of which is
herein incorporated by reference in its entirety.
FIELD OF THE INVENTION
[0002] The present invention comprises methods for treating or
preventing a viral infection in subject.
BACKGROUND OF THE INVENTION
[0003] Viruses belonging to the Flaviviridae family include the
hepatitis C virus (HCV). The Flavivirus genus includes more than 68
members separated into groups on the basis of serological
relatedness. Clinical symptoms vary and include fever, encephalitis
and hemorrhagic fever. Flaviviruses of global concern that are
associated with human disease include the dengue hemorrhagic fever
viruses (DHF), yellow fever virus, shock syndrome and Japanese
encephalitis virus.
[0004] Examples of antiviral agents that have been identified as
active against the flavivirus or pestiviruses include: [0005] (1)
Interferon and ribavirin; [0006] (2) Substrate-based NS3 protease
inhibitors (WO 98/22496); [0007] (3) Non-substrate-based inhibitors
such as 2,4,6-trihydroxy-3-nitro-benzamide derivatives (Sudo K. et
al., Biochemical and Biophysical Research Communications,
238:643-647 (1997); Sudo K., et al. Antiviral Chemistry and
Chemotherapy, 9:186 (1998)), including RD3-4082 and RD3-4078, the
former substituted on the amide with a 14 carbon chain and the
latter processing a para-phenoxyphenyl group; [0008] (4)
Thiazolidine derivatives, which show relevant inhibition in a
reverse-phase HPLC assay with an NS3/4A fusion protein and NS5A/5B
substrate (Sudo K. et al., Antiviral Research, 32: 9-18 (1996)),
especially compound RD-1-6250, possessing a fused cinnamoyl moiety
substituted with a long alkyl chain, RD4 6205 and RD4 6193; [0009]
(5) Thiazolidines and benzanilides, identified in Kakiuchi N. et
al. J. FEBS Letters 421, 217-220; and Takeshita N. et al.
Analytical Biochemistry, 247: 242-246 1997); [0010] (6) A
phenanthrenequinone, which possesses activity against protease in a
SDS-PAGE and autoradiography assay and is isolated from the
fermentation culture broth of Streptomyces sp., Sch 68631 (Chu M.
et al., Tetrahedron Letters, 37: 7229-7232 (1996)), and Sch 351633,
isolated from the fungus Penicillium griscofuluum, which
demonstrates activity in a scintillation proximity assay; [0011]
(7) Selective NS3 inhibitors based on the macromolecule elgin c,
isolated from leech (Qasim M. A. et al., Biochemistry, 36:
1598-1607 (1997)); [0012] (8) Helicase inhibitors (U.S. Pat. No.
5,633,358); [0013] (9) Polymerase inhibitors, such as nucleotide
analogues, gliotoxin (Ferrari E. et al. Journal of Virology,
73:1649-1654 (1999)), and the natural product cerulenin (Lohmann V.
et al., Virology, 249: 108-118 (1998)); [0014] (10) Antisense
phosphorothioate oligodeoxynucleotides (S-ODN) complementary to
sequence stretches in the 5' non-coding region (NCR) of the virus,
or nucleotides 326-348 comprising the 3' end of the NCR and
nucleotides 371-388 located in the core coding region of the HCV
RNA; [0015] (11) Inhibitors of IRES-dependent translation; [0016]
(12) Nuclease-resistant ribozymes; and [0017] (13) Miscellaneous
compounds including 1-amino-alkyloyclohexanes (U.S. Pat. No.
6,034,134 to Gold et al.), alkyl lipids (U.S. Pat. No. 5,922,757 to
Chojkier at al.), vitamin E and other antioxidants (U.S. Pat. No.
5,922,757 to Chojkier et al.), squalene, amantadine, bile acids
(U.S. Pat. No. 5,846,964 to Ozeki et al.),
N-(phosphonoacetyl)-L-aspartic acid, (U.S. Pat. No. 5,830,905 to
Diana et al.), benzenedicarboxamides (U.S. Pat. No. 5,633,388 to
Diana at al.), polyadenylic acid derivatives (U.S. Pat. No.
5,496,546 to Wang at al.), 2',3' dideoxyinosine (U.S. Pat. No.
5,026,687 to Yarchoan et al.), and benzimidazoles (U.S. Pat. No.
5,891,874 to Colacino et al.).
[0018] Although there are several treatments available for
flaviviral infections, some flaviviral infections fail to respond
adequately to currently available treatments. Hence, there is a
need to provide additional, effective methods for treating and/or
preventing such an infection comprising administration of various
analogues of Ara-C.
[0019] Ara-C
##STR00001##
an arabinofuranosylcytosine nucleoside analogue, and prodrug
analogues of Ara-C, including fosteabine
(1-.beta.-D-arabinofuranosylcytosine-5'-stearylphosphate; YNK01),
have been used effectively to treat acute myelogenous leukemia and
lymphocytic leukemias (Gahrton et al., Adv. Cancer Res. 40:255-329
(1983); Keating et al., JAMA 248:2481-2486 (1982); Plunkett et al.,
Semin. Oncol. 20:50-63 (1993); Maloisel, et al., Leukemia 16(4):
573-80 (2002); Kuhr et al., Leuk. Res. 24(7): 583-587 (2000); Inaba
et al., Gan To Kagaku Ryoho. 21(4): 535-538 (1994)).
[0020] Moreover, Ara-C homologues, including
N.sup.4-(dialkylamino)methylene derivatives of 2'-dC have been
shown in the past to be effective in the treatment of infections
from retroviruses, including HIV (see e.g., Kerr et al., J. Med.
Chem. 35:1996-2001 (1992); Kerr et al., J. Pharm Sci. 83(4):
582-586 and U.S. Pat. Nos. 5,051,498 and 5,886,162).
[0021] This invention addresses the need to identify additional,
effective methods for treating or preventing Flaviviridae
infections by providing methods using ara-C analogue compounds for
the effective treatment or prevention of Flaviviridae virus (e.g.,
hepatitis C virus) infections.
SUMMARY OF THE INVENTION
[0022] The present invention provides a method for (i) treating a
host infected with a virus which is a member of the Flaviviridae
family of viruses (e.g., hepatitis C virus) or for (ii) preventing
infection of a host, with a virus which is a member of the
Flaviviridae family of viruses (e.g., hepatitis C virus), for
example, following, transplantation of a liver into said host or
transfusion of blood into said host, which comprises administering
to said host a therapeutically effective amount of a compound of
formula I:
##STR00002##
or a pharmaceutically acceptable salt thereof; wherein R.sup.2' and
R.sup.3' are independently --OH or a pharmaceutically acceptable
leaving group which is capable of being converted into --OH, F or
--CH.sub.3 when the compound represented by formula I is
administered in vivo, and R.sup.5' is a straight or branched chain
C.sub.9 to C.sub.24 alkylphosphate or a straight or branched chain
C.sub.9 to C.sub.24 alkenylphosphate group or a pharmaceutically
acceptable leaving group which is capable of being converted into
--OH or phosphate when the compound represented by formula I is
administered in vivo.
[0023] In an embodiment of the invention, the compound represented
by structural formula I is administered to a host in association
with any other anti-viral agent as set forth in the "Pharmaceutical
Compositions" section below, for example, an interferon-alfa or a
pegylated interferon-alfa; including, but not limited to interferon
alfa-2a, interferon alfa-2b, interferon alfa-2c, interferon alfa
n-1, interferon alfa n-3, consensus interferon, pegylated
interferon alfa-2a, pegylated interferon alfa-2b, pegylated
interferon alfa-2c, pegylated interferon alfa n-1, pegylated
interferon alfa n-3, pegylated consensus interferon or
albumin-interferon-alpha.
[0024] In an embodiment, a compound comprising structural formula I
is administered to the host in association with ribavirin and/or a
pegylated or unpegylated interferon.
[0025] Triple combination therapies are also within the scope of
the invention wherein a compound represented by structural formula
I is administered to a host in association with ribavirin and one
or more of the interferons (pegylated or unpegylated) mentioned
herein (e.g., pegylated or unpegylated interferon alfa-2a or
pegylated or unpegylated interferon alfa-2b).
[0026] In an embodiment of the invention, in a compound comprising
structural formula I, R.sup.2'.dbd.R.sup.3'.dbd.--OH; R.sup.5' is a
C.sub.16 to C.sub.20 alkylphosphate group; R.sup.5' is a C.sub.18
to C.sub.20 alkylphosphate group; R.sup.5' is a C.sub.18 to
C.sub.20 alkenylphosphate group; or R.sup.5' is
--OPO.sub.3H--C.sub.18H.sub.37.
[0027] The present invention also provides a method for (i)
treating a host having hepatitis C virus infection (e.g., chronic
infection or acute infection) or for (ii) preventing infection of a
host, with hepatitis C virus, for example, following
transplantation of a liver into said host or transfusion of blood
into said host that comprises administering, to the host, a
therapeutically effective amount of a compound represented by
structural formula II:
##STR00003##
or a pharmaceutically acceptable salt thereof; in association with
a therapeutically effective amount of an interferon for a treatment
time period sufficient to eradicate detectable hepatitic C
virus-RNA and to maintain no detectable hepatitic C virus -RNA for
at least twelve weeks after the end of the treatment time period;
wherein R.sup.2' and R.sup.3' are independently --OH or a
pharmaceutically acceptable leaving group which is capable of being
converted to --OH, F or --CH.sub.3 when the compound represented by
formula II is administered in vivo.
[0028] In an embodiment of the invention, a compound represented by
structural formula II is administered to a host in association with
any other anti-viral agent as set forth in the "Pharmaceutical
Compositions" section below, for example, pegylated or unpegylated
interferon alfa, e.g. selected from the group consisting of
pegylated interferon alfa-2a, pegylated interferon alfa-2b,
pegylated interferon alfa-2c, pegylated interferon alfa n-1,
pegylated interferon alfa n-3, pegylated consensus interferon,
interferon alfa-2a, interferon alfa-2b, interferon alfa-2c,
interferon alfa n-1, interferon alfa n-3, consensus interferon and
albumin-interferon-alpha.
[0029] In another embodiment of the invention a compound
represented by structural formula II is administered to a host in
association with ribavirin and/or a pegylated or unpegylated
interferon.
[0030] Triple combination therapies are also within the scope of
the invention wherein a compound represented by structural formula
II is administered to a host in association with ribavirin and one
or more of the interferons (pegylated or unpegylated) mentioned
herein (e.g., pegylated or unpegylated interferon alfa-2a or
pegylated or unpegylated interferon alfa-2b).
[0031] A further embodiment of the invention comprises
administering a compound comprising structural formula II to a host
wherein, in structural formula II,
R.sup.2'.dbd.R.sup.3'.dbd.--OH.
[0032] Yet another embodiment of the invention comprises methods
wherein the host who is administered a compound comprising a
structural formula II is infected with multiple hepatitis C virus
genotypes (e.g., genotype 1 and/or genotype 2 and/or genotype
3).
[0033] The present invention provides a method for (i) treating a
host having hepatitis C virus infection (e.g., chronic infection or
acute infection) or for (ii) preventing infection of a host, with
hepatitis C virus, for example, following transplantation of a
liver into said host or transfusion of blood into said host that
comprises administering to the patient a therapeutically effective
amount of a compound represented by structural formula III
(fosteabine;
1-.beta.-D-arabinofuranosylcytosine-5'-stearylphosphate;
YNK01):
##STR00004##
or a pharmaceutically acceptable salt thereof; optionally in
association with a therapeutically effective amount of any other
anti-viral agent as set forth in the "Pharmaceutical Compositions"
section below, for example, unpegylated or pegylated interferon
alfa (e.g., unpegylated or pegylated interferon alfa-2a,
unpegylated or pegylated interferon alfa-2b, unpegylated or
pegylated interferon alfa-2c, unpegylated or pegylated interferon
alfa n-1, unpegylated or pegylated interferon alfa n-3 or
unpegylated or pegylated consensus interferon) for a treatment time
period sufficient to eradicate detectable hepatitis C virus-RNA and
to maintain no detectable hepatitis C virus-RNA for at least twelve
weeks after the end of the treatment time period.
[0034] In one embodiment of the present invention, the pegylated
interferon alfa that is administered to the host in association
with a compound represented by structural formula III is a
pegylated interferon alfa-2b wherein the amount of pegylated
interferon alfa-2b that is administered in the treatment time
period is about 0.5 to 1.5 micrograms per kilogram body weight of
pegylated interferon alfa-2b protein per week on a weekly basis for
at least twenty-four weeks.
[0035] In another embodiment of the invention, pegylated interferon
alfa that is administered in association with compound represented
by structural formula III is a pegylated interferon alfa-2b,
wherein the pegylated interferon alfa-2b is administered on a
weekly basis for about forty-eight weeks.
[0036] Triple combination therapies are also within the scope of
the invention wherein a compound represented by structural formula
III is administered to a host in association with ribavirin and one
or more of the interferons (pegylated or unpegylated) mentioned
herein (e.g., pegylated or unpegylated interferon alfa-2a or
pegylated or unpegylated interferon alfa-2b).
[0037] The present invention provides a method for treating a host
infected with a virus which is a member of the Flaviviridae family
of viruses (e.g., hepatitis C virus) or for preventing the
infection, comprising administering to said host a therapeutically
effective amount of a compound represented by formula IV
##STR00005##
or a pharmaceutically acceptable salt thereof; wherein R.sup.3 and
R.sup.4 are independently --OH or a pharmaceutically acceptable
leaving group which is capable of being converted to phosphate,
--OH, F or --CH.sub.3 when the compound represented by formula IV
is administered in vivo, wherein R.sup.5 is --OH, a straight or
branched chain C.sub.9 to C.sub.24 alkylphosphate (e.g.,
--OPO.sub.3--C.sub.18H.sub.37) or a straight or branched chain
C.sub.9 to C.sub.24 alkenylphosphate group or a pharmaceutically
acceptable leaving group which is capable of being converted into
--OH, phosphate, F or --CH.sub.3 when the compound represented by
formula IV is administered in vivo; and wherein R.sup.1 and R.sup.2
are independently C.sub.1 to C.sub.13 alkyl or wherein R.sup.1 and
R.sup.2 taken together with N form a C.sub.3 to C.sub.7 ring
represented by the following structural formula:
##STR00006##
wherein n and m are independently 0, 1, 2 or 3 and Q is CH.sub.2,
NR, O, S, SO or SO.sub.2; and R is independently H, C.sub.1 to
C.sub.6 alkyl or C.sub.1 to C.sub.6 acyl or wherein R.sup.1 and
R.sup.2, taken together with the N, are represented by the
structural formula:
##STR00007##
[0038] In an embodiment of the invention, the compound represented
by structural formula IV is administered in association with
interferon-alfa, pegylated interferon-alfa or
albumin-interferon-alpha, an interferon-alfa selected from the
group consisting of interferon alfa-2a, interferon alfa-2b,
interferon alfa-2c, interferon alfa n-1, interferon alfa n-3 and
consensus interferon, a pegylated interferon-alfa selected from the
group consisting of pegylated interferon alfa-2a, pegylated
interferon alfa-2b, pegylated interferon alfa-2c, pegylated
interferon alfa n-1, pegylated interferon alfa n-3, or pegylated
consensus interferon or any combination thereof.
[0039] In an embodiment of the invention, the compound represented
by formula IV is further administered in association with
ribavirin.
[0040] In an embodiment of the invention, in the compound of
structural formula IV, R.sup.3.dbd.R.sup.4.dbd.R.sup.5.dbd.--OH;
R.sup.1 and R.sup.2 are C.sub.1-C.sub.5 alkyl; R.sup.1 and R.sup.2
are isopropyl; R.sup.1 and R.sup.2 taken together with N are
represented by the structural formula:
##STR00008##
wherein n and m are independently 0, 1, 2 or 3 and Q is CH.sub.2,
NR, O, S, SO or SO.sub.2; and R is independently H, C.sub.1 to
C.sub.6 alkyl or C.sub.1 to C.sub.6 acyl; or R.sup.1 and R.sup.2
taken together with N are represented by the following structural
formula:
##STR00009##
[0041] The present invention provides a method for treating a host
having a hepatitis C virus infection or for preventing the
infection that comprises administering, to the host, a
therapeutically effective amount of a compound represented by
structural formula V:
##STR00010##
or a pharmaceutically acceptable salt thereof; in association with
a therapeutically effective amount of an interferon for a treatment
time period sufficient to eradicate detectable hepatitic C
virus-RNA and to maintain no detectable hepatitic C virus RNA for
at least twelve weeks after the end of the treatment time period;
wherein R.sup.5 is --OH, a straight or branched chain C.sub.9 to
C.sub.24 alkylphosphate (e.g., --OPO.sub.3--C.sub.18H.sub.37) or a
straight or branched chain C.sub.9 to C.sub.24 alkenylphosphate
group or a pharmaceutically acceptable leaving group which is
capable of being converted into --OH, phosphate, F or --CH.sub.3
when the compound represented by formula V is administered in vivo,
and wherein R.sup.1 and R.sup.2 are independently C.sub.1 to
C.sub.10 alkyl or wherein R.sup.1 and R.sup.2 taken together with N
form a C.sub.3 to C.sub.7 ring represented by the following
structural formula:
##STR00011##
wherein n and m are independently 0, 1, 2 or 3 and Q is CH.sub.2,
NR, O, S, SO or SO.sub.2; and R is independently H, C.sub.1 to
C.sub.6 alkyl or C.sub.1 to C.sub.6 acyl or wherein R.sup.1 and
R.sup.2, taken together with the N, are represented by the
structural formula:
##STR00012##
[0042] In an embodiment of the invention, the interferon that is
administered is pegylated interferon alfa and is selected from the
group consisting of pegylated interferon alfa-2a, pegylated
interferon alfa-2b, pegylated interferon alfa-2c, pegylated
interferon alfa n-1, pegylated interferon alfa n-3, pegylated
consensus interferon, interferon alfa-2a, interferon alfa-2b,
interferon alfa-2c, interferon alfa n-1, interferon alfa n-3 and
consensus interferon.
[0043] In an embodiment of the invention, the compound represented
by formula V is administered in association with ribavirin. In an
embodiment of the invention, R.sup.5.dbd.--OH.7
[0044] In an embodiment of the invention, the host is infected with
multiple hepatitis C virus genotypes (e.g., hepatitis C virus
genotype 1 and/or hepatitis C virus genotype 2 and/or hepatitis C
virus genotype 3).
[0045] The present invention provides a method for treating a host
having a hepatitis C virus infection or for preventing the
infection that comprises administering to the host a
therapeutically effective amount of a compound represented by a
structural formula selected from the group consisting of:
##STR00013## ##STR00014## ##STR00015## ##STR00016##
##STR00017##
or a pharmaceutically acceptable salt thereof.
[0046] In an embodiment of the invention, a compound selected from
structural formulas VI-XXIII is administered to the host in
association with any other anti-viral agent as set forth in the
"Pharmaceutical Compositions" section below, for example, one or
more members selected from the group consisting of pegylated
interferon alfa-2a, pegylated interferon alfa-2b, pegylated
interferon alfa-2c, pegylated interferon alfa n-1, pegylated
interferon alfa n-3, pegylated consensus interferon, interferon
alfa-2a, interferon alfa-2b, interferon alfa-2c, interferon alfa
n-1, interferon alfa n-3 and consensus interferon.
[0047] In an embodiment of the invention, a compound selected from
structural formulas VI-XXIII is administered to the host in
association ribavirin.
[0048] The present invention provides a method for preventing
infection of a host, with a virus which is a member of the
Flaviviridae family of viruses (e.g., hepatitis C virus), following
transplantation of a liver into said host or transfusion of blood
into said host or for treating the infection in the host comprising
administering to said host a therapeutically effective amount of a
compound represented by structural formula IV:
##STR00018##
or a pharmaceutically acceptable salt thereof; wherein R.sup.3 and
R.sup.4 are independently --OH or a pharmaceutically acceptable
leaving group which is capable of being converted to phosphate,
--OH, F or --CH.sub.3 when the compound represented by formula IV
is administered in vivo, wherein R.sup.5 is --OH, a straight or
branched chain C.sub.9 to C.sub.24 alkylphosphate (e.g.,
--OPO.sub.3--C.sub.18H.sub.37) or a straight or branched chain
C.sub.9 to C.sub.24 alkenylphosphate group or a pharmaceutically
acceptable leaving group which is capable of being converted into
--OH, phosphate, F or --CH.sub.3 when the compound represented by
formula IV is administered in vivo and wherein R.sup.1 and R.sup.2
are independently C.sub.1 to C.sub.10 alkyl or wherein R.sup.1 and
R.sup.2 taken together with N form a C.sub.3 to C.sub.7 ring
represented by the following structural formula:
##STR00019##
wherein n and m are independently 0, 1, 2 or 3 and Q is CH.sub.2,
NR, O, S, SO or SO.sub.2; and R is independently H, C.sub.1 to
C.sub.6 alkyl or C.sub.1 to C.sub.6 acyl or wherein R.sup.1 and
R.sup.2, taken together with the N, are represented by the
structural formula:
##STR00020##
[0049] In an embodiment of the invention, the compound represented
by formula IV is administered in association with any other
anti-viral agent as set forth in the "Pharmaceutical Compositions"
section below, for example, interferon-alfa, pegylated
interferon-alfa, albumin-interferon-alpha, interferon alfa-2a,
interferon alfa-2b, interferon alfa-2c, interferon alfa n-1,
interferon alfa n-3, consensus interferon, pegylated interferon
alfa-2a, pegylated interferon alfa-2b, pegylated interferon
alfa-2c, pegylated interferon alfa n-1, pegylated interferon alfa
n-3, or pegylated consensus interferon.
[0050] In an embodiment of the invention, the compound represented
by formula IV is administered in association with ribavirin.
[0051] In an embodiment of the invention, in the compound
represented by formula IV: R.sup.3.dbd.R.sup.4.dbd.--OH;
R.sup.3.dbd.R.sup.4.dbd.R.sup.5.dbd.--OH; R.sup.1 and R.sup.2 are
C.sub.1-C.sub.5 alkyl; R.sup.1 and R.sup.2 are isopropyl; R.sup.1
and R.sup.2 taken together with N are represented by the structural
formula:
##STR00021##
wherein n and m are independently 0, 1, 2 or 3 and Q is CH.sub.2,
NR, O, S, SO or SO.sub.2; and R is independently H, C.sub.1 to
C.sub.6 alkyl or C.sub.1 to C.sub.9 acyl; or R.sup.1 and R.sup.2
taken together with N are represented by the following structural
formula:
##STR00022##
[0052] The present invention provides a composition represented by
formula IV
##STR00023##
or a pharmaceutically acceptable salt thereof; wherein R.sup.3 and
R.sup.4 are independently --OH or a pharmaceutically acceptable
leaving group which is capable of being converted to phosphate,
--OH, --F or --CH.sub.3 when the compound represented by formula IV
is administered in vivo, wherein R.sup.5 is --OH, a straight or
branched chain C.sub.9 to C.sub.24 alkylphosphate or a straight or
branched chain C.sub.9 to C.sub.24 alkenylphosphate group or a
pharmaceutically acceptable leaving group which is capable of being
converted into --OH, phosphate, F or --CH.sub.3 when the compound
represented by formula IV is administered in vivo and wherein
R.sup.1 and R.sup.2 are independently C.sub.1 to C.sub.10 alkyl or
wherein R.sup.1 and R.sup.2 taken together with N form a C.sub.3 to
C.sub.7 ring represented by the following structural formula:
##STR00024##
wherein n and m are independently 0, 1, 2 or 3 and Q is CH.sub.2,
NR, O, S, SO or SO.sub.2; and R is independently H, C.sub.1 to
C.sub.6 alkyl or C.sub.1 to C.sub.6 acyl or wherein R.sup.1 and
R.sup.2, taken together with the N, are represented by the
structural formula:
##STR00025##
optionally in association with any other anti-viral agent as set
forth in the "Pharmaceutical Compositions" section below, for
example, one or more members selected from the group consisting of
pegylated interferon alfa-2a, pegylated interferon alfa-2b,
pegylated interferon alfa-2c, pegylated interferon alfa n-1,
pegylated interferon alfa n-3, pegylated consensus interferon,
interferon alfa-2a, interferon alfa-2b, interferon alfa-2c,
interferon alfa n-1, interferon alfa n-3 and consensus interferon.
In an embodiment of the invention, the compound is represented by a
structural formula selected from the group consisting of:
##STR00026## ##STR00027## ##STR00028##
[0053] The present invention also provides a compound of formula
I:
##STR00029##
or a pharmaceutically acceptable salt thereof; wherein R.sup.2' and
R.sup.3' are independently --OH or a pharmaceutically acceptable
leaving group which is capable of being converted into --OH, F or
--CH.sub.3 when the compound represented by formula I is
administered in vivo, and R.sup.5' is a straight or branched chain
C.sub.9 to C.sub.24 alkylphosphate or a straight or branched chain
C.sub.9 to C.sub.24 alkenylphosphate group or a pharmaceutically
acceptable leaving group which is capable of being converted into
--OH or phosphate when the compound represented by formula I is
administered in vivo; in association with any other anti-viral
agent as set forth in the "Pharmaceutical Compositions" section
below, for example, one or more members selected from the group
consisting of pegylated interferon alfa-2a, pegylated interferon
alfa-2b, pegylated interferon alfa-2c, pegylated interferon alfa
n-1, pegylated interferon alfa n-3, pegylated consensus interferon,
interferon alfa-2a, interferon alfa-2b, interferon alfa-2c,
interferon alfa n-1, interferon alfa n-3 and consensus interferon.
In an embodiment, the compound represented by structural formula I
is represented by the following structural formula:
##STR00030##
DETAILED DESCRIPTION OF THE INVENTION
[0054] The present invention provides compositions and methods for
treating or preventing an infection by a virus which is a member of
the Flaviviridae family in a host. For example, the present
invention includes, but is not limited to methods for treating or
preventing infections caused by members of the Hepacivirus genus
which includes the hepatitis C virus (HCV). HCV includes several
types, subtypes and isolates:
[0055] hepatitis C virus (isolate 1)
[0056] hepatitis C virus (isolate BK)
[0057] hepatitis C virus (isolate EC1)
[0058] hepatitis C virus (isolate EC10)
[0059] hepatitis C virus (isolate HC-J2)
[0060] hepatitis C virus (isolate HC-J5)
[0061] hepatitis C virus (isolate HC-J6)
[0062] hepatitis C virus (isolate HC-J7)
[0063] hepatitis C virus (isolate HC-J8)
[0064] hepatitis C virus (isolate HC-JT)
[0065] hepatitis C virus (isolate HCT18)
[0066] hepatitis C virus (isolate HCT27)
[0067] hepatitis C virus (isolate HCV-476)
[0068] hepatitis C virus (isolate HCV-KF)
[0069] hepatitis C virus (isolate Hunan)
[0070] hepatitis C virus (isolate Japanese)
[0071] hepatitis C virus (isolate Taiwan)
[0072] hepatitis C virus (isolate TH)
[0073] hepatitis C virus isolate H
[0074] hepatitis C virus type 1 [0075] hepatitis C virus type 1a
[0076] hepatitis C virus strain H77 [0077] hepatitis C virus type
1b [0078] hepatitis C virus type 1c [0079] hepatitis C virus type
1d [0080] hepatitis C virus type 1e [0081] hepatitis C virus type
1f
[0082] hepatitis C virus type 10
[0083] hepatitis C virus type 2 [0084] hepatitis C virus type 2a
[0085] hepatitis C virus type 2b [0086] hepatitis C virus type 2c
[0087] hepatitis C virus type 2d [0088] hepatitis C virus type
2f
[0089] hepatitis C virus type 3 [0090] hepatitis C virus type 3a
[0091] hepatitis C virus type 3b [0092] hepatitis C virus type
3g
[0093] hepatitis C virus type 4 [0094] hepatitis C virus type 4a
[0095] hepatitis C virus type 4c [0096] hepatitis C virus type 4d
[0097] hepatitis C virus type 4f [0098] hepatitis C virus type 4h
[0099] hepatitis C virus type 4k
[0100] hepatitis C virus type 5 [0101] hepatitis C virus type
5a
[0102] hepatitis C virus type 6 [0103] hepatitis C virus type
6a
[0104] hepatitis C virus type 7 [0105] hepatitis C virus type 7a
[0106] hepatitis C virus type 7b
[0107] hepatitis C virus type 8 [0108] hepatitis C virus type
8a
[0109] The present invention also includes methods for treating or
preventing infection caused by members of the Flavivirus genus. The
Flavivirus genus includes Yellow fever virus; Tick-borne viruses
such as the Gadgets Gully virus, Kadam virus, Kyasanur Forest
disease virus, Langat virus, Omsk hemorrhagic fever virus, Powassan
virus, Royal Farm virus, Karshi virus, Tick-borne encephalitis
virus, Neudoerfl virus, Sofjin virus, Louping ill virus and the
Negishi virus; seabird tick-borne viruses such as the Meaban virus,
Saumarez Reef virus, and the Tyuleniy virus; mosquito-borne viruses
such as the Aroa virus, Bussuquara virus, lguape virus and the
Naranjal virus; Dengue viruses such as the Dengue virus and the
Kedougou virus; Japanese encephalitis viruses such as the
Cacipacore virus, Koutango virus, Japanese encephalitis virus,
Murray Valley encephalitis virus, Alfuy virus, St. Louis
encephalitis virus, Usutu virus, West Nile virus, Kunjin virus and
the Yaounde virus; Kokobera viruses such as the Kokobera virus and
the Stratford virus; Ntaya viruses such as the Bagaza virus, Ilheus
virus, Rocio virus, Israel turkey meningoencephalomyelitis virus,
Ntaya virus and the Tembusu virus; Spondweni viruses such as the
Zika virus and the Spondweni virus; Yellow fever viruses such as
the Banzi virus, Bouboui virus, Edge Hill virus, Jugra virus,
Saboya virus, Potiskum virus, Sepik virus, Uganda S virus,
Wesselsbron virus and the Yellow fever virus; Entebbe viruses such
as the Entebbe bat virus, Sokoluk virus, and the Yokose virus;
Modoc viruses such as the Apoi virus, Cowbone Ridge virus, Jutiapa
virus, Modoc virus, Sal Vieja virus and the San Perlita virus; Rio
Bravo viruses such as the Bukalasa bat virus, Carey Island virus,
Dakar bat virus, Montana myotis leukoencephalitis virus, Phnom Penh
bat virus, Batu Cave virus, Rio Bravo virus, Tamana bat virus, and
the Cell fusing agent virus.
[0110] The present invention includes methods for treating or
preventing infection caused by members of the Pestivirus genus. The
Pestivirus genus includes, Border disease virus (sheep), Bovine
viral diarrhea virus 1, Bovine viral diarrhea virus 2, Classical
swine fever virus, and Hog cholera virus.
[0111] Moreover, the present invention includes methods for
treating or preventing infections caused by Hepatitis G virus or
Hepatitis GB virus-A, B or C.
[0112] A "host", "subject" or "patient" may be any organism, such
as a mammal (e.g., primate, dog, cat, cow, horse, pig, goat, rat,
mouse, bird), preferably a human.
[0113] A person suffering from chronic hepatitis C infection may
exhibit one or more of the following signs or symptoms:
(a) elevated ALT, (b) positive test for anti-HCV antibodies, (c)
presence of HCV as demonstrated by a positive test for HCV-RNA, (d)
clinical stigmata of chronic liver disease, (e) hepatocelluar
damage.
[0114] A patient or host suffering from an infection by a
Flaviviridae virus, such as HCV (e.g., a chronic or acute HCV
infection), can be treated by administering to the patient a
compound represented by structural formula I:
##STR00031##
or a pharmaceutically acceptable salt thereof.
[0115] R.sup.2' and R.sup.3' are independently --OH or a
pharmaceutically acceptable leaving group which is capable of being
converted to phosphate, --OH, --F or --CH.sub.3 when the compound
represented by formula I is administered in vivo.
[0116] R.sup.5' is a straight or branched chain C.sub.9 to C.sub.24
alkylphosphate (e.g., C.sub.9, C.sub.10, C.sub.11, C.sub.12,
C.sub.13, C.sub.14, C.sub.15, C.sub.16, C.sub.17, C.sub.18,
C.sub.19, C.sub.20, C.sub.21, C.sub.22, C.sub.23 or C.sub.24
alkylphosphate, including C.sub.16 to C.sub.20 alkylphosphate or
C.sub.18 to C.sub.20 alkylphosphate) or straight or branched chain
C.sub.9 to C.sub.24 alkenylphosphate (e.g., C.sub.9, C.sub.10,
C.sub.11, C.sub.12, C.sub.13, C.sub.14, C.sub.15, C.sub.16,
C.sub.17, C.sub.18, C.sub.19, C.sub.20, C.sub.21, C.sub.22,
C.sub.23 or C.sub.24 alkenylphosphate, including C.sub.18 to
C.sub.20 alkenylphosphate) group or a pharmaceutically acceptable
leaving group which is capable of being converted to --OH or
phosphate when the compound represented by formula I is
administered in vivo.
[0117] For example, the compound can be represented by structural
formula II:
##STR00032##
[0118] The compound represented by structural formula II is also
known as Fosteabine and as YNK01. Fosteabine is an orally active
derivative of cytarabine which is sold by Nippon Kayaku Co. Ltd.
(Tokyo, Japan).
[0119] Furthermore, a patient suffering from an infection by a
flaviviridae virus, such as HCV (e.g., a chronic HCV infection),
can be treated by administering to the patient a compound
represented by structural formula IV:
##STR00033##
or a pharmaceutically acceptable salt thereof.
[0120] R.sup.3 and R.sup.4 are independently --OH or a
pharmaceutically acceptable leaving group which is capable of being
converted to --F, --CH.sub.3--OH or phosphate when the compound
represented by formula IV is administered in vivo, wherein R.sup.5
is --OH, a straight or branched chain C.sub.9 to C.sub.24
alkylphosphate (e.g., --OPO.sub.3--C.sub.18H.sub.37 or as described
above) or a straight or branched chain C.sub.9 to C.sub.24
alkenylphosphate group (e.g., as described above) or a
pharmaceutically acceptable leaving group which is capable of being
converted into --OH, phosphate, F or --CH.sub.3 when the compound
represented by formula IV is administered in vivo and wherein
R.sup.1 and R.sup.2 are independently C.sub.1 to C.sub.10 alkyl or
R.sup.1 and R.sup.2 taken together with the N form a C.sub.3 to
C.sub.7 ring represented by the following structural formula:
##STR00034##
wherein n and m are independently 0, 1, 2 or 3 and Q is CH.sub.2,
NR, S, SO or SO.sub.2 and R is independently H, C.sub.1 to C.sub.6
alkyl or acyl. Such compounds are discussed for example, in Kerr et
al., J. Pharm Sci. 83(4):582-586 (1994). In an embodiment of the
invention, a compound represented by structural formula VI, VII,
VIII, IX, X, XI, XII, XIII, XIV, XV, XVI, XVI, XVII, XVIII, XIX,
XX, XXI, XXII or XXIII:
##STR00035## ##STR00036## ##STR00037## ##STR00038##
##STR00039##
can be administered to a host suffering from a Flaviviridae (e.g.,
HCV) infection (e.g., chronic HCV infection).
[0121] A compound represented by a structural formula selected from
I-XXIII can also be administered to a patient in association with
one or more other anti-viral agents such as pegylated or
unpegylated interferon alfa-2a, pegylated or unpegylated interferon
alfa-2b, pegylated or unpegylated interferon alfa-2c, pegylated or
unpegylated interferon alfa n-1, pegylated or unpegylated
interferon alfa n-3 or pegylated or unpegylated consensus
interferon.
[0122] "Phosphate" refers to --O--PO.sub.3H.sub.2 or any of its
corresponding ions.
[0123] The term "alkyl" as used herein means straight and branched
carbon chains of one to twenty four carbons (e.g., C.sub.1,
C.sub.2, C.sub.3, C.sub.4, C.sub.5, C.sub.6, C.sub.7, C.sub.8,
C.sub.9, C.sub.10, C.sub.11, C.sub.12, C.sub.13, C.sub.14,
C.sub.15, C.sub.16, C.sub.17, C.sub.18, C.sub.19, C.sub.20,
C.sub.21, C.sub.22, C.sub.23 or C.sub.24).
[0124] "Alkylphosphate" is --O--PO.sub.3H-alkyl or any of its
corresponding ions.
[0125] The term "alkenyl" or "alkene" as used herein means straight
and branched chain alkyl groups containing at least one
carbon-carbon double bond and two to twenty four carbons (e.g.,
C.sub.2, C.sub.3, C.sub.4, C.sub.5, C.sub.6, C.sub.7, C.sub.8,
C.sub.9, C.sub.10, C.sub.11, C.sub.12, C.sub.13, C.sub.14,
C.sub.15, C.sub.16, C.sub.17, C.sub.18, C.sub.19, C.sub.20,
C.sub.21, C.sub.22, C.sub.23 or C.sub.24).
[0126] "Alkenylphosphate" is --O--PO.sub.3H-alkene or any of its
corresponding ions.
[0127] The term "aryl" represents a carbocyclic group (e.g.,
monocyclic or multicyclic) containing from 6 to 15 carbon atoms and
having at least one aromatic ring (e.g., phenyl ring or naphthyl
ring).
[0128] As used herein, the term "heteroaryl" refers to an aryl
group having one or more heteroatoms in the aromatic rings (e.g.,
N, O or S).
[0129] The term "arylalkyl" or "aralkyl" as used herein means an
alkyl group substituted by an aryl group.
[0130] The term "cycloalkyl" as used herein means carbocyclic rings
of three to twelve carbons, preferably three to seven carbons and
more preferably three to six carbons optionally substituted by one
or more double bonds.
[0131] "Acyl" means a radical of a carboxylic acid having the
formula. alkyl-C(O)--, aryl-C(O)--, aralkyl-C(O)--,
(C.sub.3-C.sub.7)cycloalkyl-C(O)--,
(C.sub.3-C.sub.7)cycloalkyl-(C.sub.1-C.sub.6)alkyl-C(O)--, and
heteroaryl-C(O)--, wherein alkyl, aralkyl and heteroaryl are as
defined herein; aryl is phenyl or naphthyl; and aralkyl is
aryl-(C.sub.1-C.sub.6)alkyl, wherein aryl is as defined above.
[0132] Methyl is --CH.sub.3. Ethyl is --CH.sub.2--CH.sub.3,
n-propyl is --CH.sub.2CH.sub.2CH.sub.3. i-propyl is
--CH--(CH.sub.3).sub.2. n-butyl is
--CH.sub.2CH.sub.2CH.sub.2CH.sub.3.
[0133] The term "pharmaceutically acceptable leaving group" refers
to a leaving group which, when administered to a host in accordance
with the invention, is non-toxic and includes amino acids residues,
carbohydrate residues, peptide residues and cholesterol
residues
##STR00040##
For example, an amino acid pharmaceutically acceptable leaving
group can be a natural or unnatural .alpha.-amino acid residue:
##STR00041## [0134] wherein Y.dbd.H, CH.sub.3; CH.sub.3CH.sub.2--;
CH.sub.3CH.sub.2CH.sub.2--; Me.sub.2CH--;
Me.sub.2CH.sub.2CH.sub.2--; CH.sub.3CH.sub.2CH(Me)--PhCH.sub.2--;
HOOCCH.sub.2CH.sub.2--; HSCH.sub.2--; HOOCCH.sub.2--;
MeSCH.sub.2CH.sub.2--; HOCH.sub.2--;
##STR00042##
[0134] or Y is H.sub.2N(CH.sub.2).sub.4-- or CH.sub.3CH(OH)--; or a
pharmaceutically acceptable salt thereof; or Y taken together with
the .alpha. carbon and N form
##STR00043##
or a pharmaceutically acceptable salt thereof. A pharmaceutically
acceptable peptide residue leaving group can be, for example, a
combination of two or more of the amino acids set forth above
(e.g., dipeptide or tripeptide). Furthermore, a pharmaceutically
acceptable carbohydrate residue leaving group can be, for example,
a monosaccharide such as glucose
##STR00044##
or galactose
##STR00045##
or a combination of two or more monosaccharides such as lactose
##STR00046##
or sucrose
##STR00047##
Synthesis of the compounds of the invention, comprising such
leaving groups can be done by any practitioner of ordinary skill in
the art (see, for example, Protective Groups in Organic Synthesis,
by Theodora W. Greene, Peter G. M. Wuts; John Wiley & Sons,
Inc. New York (1991)).
[0135] In a liver transplantation procedure, the donor liver can
come from a living donor (i.e., living donor liver transplantation
(LDLT)) wherein a portion of the donor's liver is removed and
introduced into the recipient. Alternatively, the transplant can be
from a deceased donor wherein the entire liver is removed and
transplanted.
[0136] The scope of the present invention also includes compounds
represented by structural formula IV:
##STR00048##
or a pharmaceutically acceptable salt thereof; wherein R.sup.3 and
R.sup.4 are independently --OH or a pharmaceutically acceptable
leaving group which is capable of being converted to phosphate,
--OH, F or --CH.sub.3 when the compound represented by formula IV
is administered in vivo, wherein R.sup.5 is a straight or branched
chain C.sub.9 to C.sub.24 alkylphosphate (e.g.,
--OPO.sub.3--C.sub.18H.sub.37) or a straight or branched chain
C.sub.9 to C.sub.24 alkenylphosphate group and wherein R.sup.1 and
R.sup.2 are independently C.sub.1 to C.sub.10 alkyl or wherein
R.sup.1 and R.sup.2 taken together with N form a C.sub.3 to C.sub.7
ring represented by the following structural formula:
##STR00049##
wherein n and m are independently 0, 1, 2 or 3 and Q is CH.sub.2,
NR, O, S, SO or SO.sub.2; and R is independently H, C.sub.1 to
C.sub.6 alkyl or C.sub.1 to C.sub.6 acyl or wherein R.sup.1 and
R.sup.2, taken together with the N, are represented by the
structural formula:
##STR00050##
along with pharmaceutical compositions thereof which further
comprise a pharmaceutically acceptable carrier. Also within the
scope of the present invention is any compound represented by a
structural formula selected from the group consisting of XV-XXIII
along with pharmaceutically acceptable salts thereof and
pharmaceutical compositions thereof further comprising a
pharmaceutically acceptable carrier.
[0137] The scope of the present invention also includes
compositions comprising a compound represented by structural
formula I:
##STR00051##
or a pharmaceutically acceptable salt thereof; wherein R.sup.2' and
R.sup.3' are independently --OH or a pharmaceutically acceptable
leaving group which is capable of being converted into phosphate,
--OH, F or --CH.sub.3 when the compound represented by formula I is
administered in vivo, and R.sup.5' is a straight or branched chain
C.sub.9 to C.sub.24 alkylphosphate or a straight or branched chain
C.sub.9 to C.sub.24 alkenylphosphate group or a pharmaceutically
acceptable leaving group which is capable of being converted into
--OH or phosphate when the compound represented by formula I is
administered in vivo) in association with one or more other
anti-viral substances (e.g., a kit), for example, any other
anti-viral agent disclosed under the "Pharmaceutical Compositions"
section below, including, but by no means limited to, ribavirin,
PEG-interferon alfa-2a, PEG-interferon alfa-2b, interferon alfa-2a
or interferon alfa-2b or any other anti-viral substance described
infra; along with pharmaceutical compositions thereof further
comprising a pharmaceutically acceptable carrier or a compound
represented by structural formula IV:
##STR00052##
or a pharmaceutically acceptable salt thereof; wherein R.sup.3 and
R.sup.4 are independently --OH or a pharmaceutically acceptable
leaving group which is capable of being converted to phosphate,
--OH, F or --CH.sub.3 when the compound represented by formula IV
is administered in vivo, wherein R.sup.5 is --OH, a straight or
branched chain C.sub.9 to C.sub.24 alkylphosphate (e.g.,
--OPO.sub.3--C.sub.18H.sub.37) or a straight or branched chain
C.sub.9 to C.sub.24 alkenylphosphate group or a pharmaceutically
acceptable leaving group which is capable of being converted into
--OH, phosphate, F or --CH.sub.3 when the compound represented by
formula IV is administered in vivo; and wherein R.sup.1 and R.sup.2
are independently C.sub.1 to C.sub.10 alkyl or wherein R.sup.1 and
R.sup.2 taken together with N form a C.sub.3 to C.sub.7 ring
represented by the following structural formula:
##STR00053##
wherein n and m are independently 0, 1, 2 or 3 and Q is CH.sub.2,
NR, O, S, SO or SO.sub.2; and R is independently H, C.sub.1 to
C.sub.6 alkyl or C.sub.1 to C.sub.6 acyl or wherein R.sup.1 and
R.sup.2, taken together with the N, are represented by the
structural formula:
##STR00054##
[0138] (e.g., any compound represented by a structural formula
selected from VI-XXIII) optionally in association with one or more
further anti-viral substances (e.g., a kit) for example, any other
anti-viral agent disclosed under the "Pharmaceutical Compositions"
section below including, but by no means limited to, ribavirin,
PEG-interferon alfa-2a, PEG-interferon alfa-2b, interferon alfa-2a
or interferon alfa-2b or any other anti-viral substance described
infra; along with pharmaceutical compositions thereof further
comprising a pharmaceutically acceptable carrier.
Pharmaceutical Compositions
[0139] The present invention includes methods for using a
pharmaceutical composition comprising a compound of the present
invention (e.g., compound represented by a formula selected from
I-XXIII) and a pharmaceutically acceptable carrier for treating a
Flaviviridae infection. The pharmaceutical compositions may be
prepared by any methods well known in the art of pharmacy; see,
e.g., Gilman, et al., (eds.) (1990), The Pharmacological Bases of
Therapeutics, 8th Ed., Pergamon Press; A. Gennaro (ed.),
Remington's Pharmaceutical Sciences, 18th Edition, (1990), Mack
Publishing Co., Easton, Pa.; Avis, et al., (eds.) (1993)
Pharmaceutical Dosage Forms: Parenteral Medications Dekker, New
York; Lieberman, et al., (eds.) (1990) Pharmaceutical Dosage Forms:
Tablets Dekker, New York; and Lieberman, et al., (eds.) (1990),
Pharmaceutical Dosage Forms: Disperse Systems Dekker, New York.
[0140] A pharmaceutical composition containing a compound of the
present invention (e.g., represented by a formula selected from
I-XXIII) can be prepared using conventional pharmaceutically
acceptable excipients and additives and conventional techniques.
Such pharmaceutically acceptable excipients and additives include
non-toxic compatible fillers, binders, disintegrants, buffers,
preservatives, anti-oxidants, lubricants, flavorings, thickeners,
coloring agents, emulsifiers and the like. All routes of
administration are contemplated including, but not limited to,
parenteral (e.g., subcutaneous, intravenous, intraperitoneal,
intramuscular) and non-parenteral (e.g., oral, transdermal,
intranasal, intraocular, sublingual, inhalation, rectal and
topical).
[0141] Unit forms of administration include oral forms such as
tablets, capsules, powders, cachets, granules and solutions or
suspensions, sublingual and buccal forms of administration,
aerosols, implants, subcutaneous, intramuscular, intravenous,
intranasal, intraocular, subcutaneous or rectal forms of
administration.
[0142] When a solid composition is prepared in the form of tablets,
e.g., a wetting agent such as sodium lauryl sulfate can be added to
micronized or non-micronized compounds and mixed with a
pharmaceutical vehicle such as silica, gelatin starch, lactose,
magnesium stearate, talc, gum arabic or the like. The tablets can
be coated with sucrose, various polymers, or other appropriate
substances. Tablets can be treated so as to have a prolonged or
delayed activity and so as to release a predetermined amount of
active principle continuously or at predetermined intervals, e.g.,
by using ionic resins and the like.
[0143] A preparation in the form of gelatin capsules may be
obtained, e.g., by mixing a compound of the present invention
(e.g., represented by a formula selected from I-XXIII) with a
diluent, such as a glycol or a glycerol ester, and incorporating
the resulting mixture into soft or hard gelatin capsules.
[0144] A preparation in the form of a syrup or elixir can contain a
compound of the present invention (e.g., represented by a formula
selected from I-XXIII), e.g., with a sweetener, methylparaben and
propylparaben as antiseptics, flavoring agents and an appropriate
color.
[0145] Water-dispersible powders or granules can contain a compound
of the present invention (e.g., represented by a formula selected
from I-XXIII) mixed, e.g., with dispersants, wetting agents or
suspending agents, such as polyvinylpyrrolidone, as well as with
sweeteners and/or other flavoring agents.
[0146] Rectal administration may be provided by using suppositories
which may be prepared, e.g., with binders melting at the rectal
temperature, for example cocoa butter or polyethylene glycols.
[0147] Parenteral, intranasal or intraocular administration may be
provided by using, e.g., aqueous suspensions, isotonic saline
solutions or sterile and injectable solutions containing
pharmacologically compatible dispersants and/or solubilizers, for
example, propylene glycol or polyethylene glycol.
[0148] Thus, to prepare an aqueous solution for intravenous
injection, it is possible to use a co-solvent, e.g., an alcohol
such as ethanol or a glycol such as polyethylene glycol or
propylene glycol, and a hydrophilic surfactant such as Tween.RTM.
80. An oily solution injectable intramuscularly can be prepared,
e.g., by solubilizing the active principle with a triglyceride or a
glycerol ester.
[0149] Topical administration can be provided by using, e.g.,
creams, ointments or gels.
[0150] Transdermal administration can be provided by using patches
in the form of a multilaminate, or with a reservoir, containing an
a compound of the invention (e.g., represented by a formula
selected from I-XXIII) and an appropriate solvent.
[0151] Administration by inhalation can be provided by using, e.g.,
an aerosol containing sorbitan trioleate or oleic acid, for
example, together with trichlorofluoromethane,
dichlorofluoromethane, dichlorotetrafluoroethane or any other
biologically compatible propellant gas; it is also possible to use
a system containing a compound of the present invention (e.g.,
represented by a formula selected from I-XXIII), by itself or
associated with an excipient, in powder form.
[0152] A compound of the present invention (e.g., represented by a
formula selected from I-XXIII) can also be formulated as
microcapsules or microspheres, e.g., liposomes, optionally with one
or more carriers or additives.
[0153] Implants are among the prolonged release forms which can be
used in the case of chronic treatments. They can be prepared in the
form of an oily suspension or in the form of a suspension of
microspheres in an isotonic medium.
[0154] Methods of the present invention can include administration
of a compound of the present invention (e.g., represented by a
formula selected from I-XXIII) in association with, for example,
one or more other anti-viral agents. The administration and dosage
of such agents is typically as according to the schedule listed in
the product information sheet of the approved agents, in the
Physicians' Desk Reference 2003 (Physicians' Desk Reference, 57th
Ed); Medical Economics Company; ISBN: 1563634457; 57th edition
(November 2002), as well as therapeutic protocols well known in the
art. Furthermore, the present invention includes compositions
comprising a compound represented by structural formula IV (e.g.,
as described herein) in association with one or more other
anti-viral agents (e.g., any of those described herein); in an
embodiment of the invention, the compound represented by structural
formula IV is a compound represented by a structural formula
selected from the group consisting of formulas VI-XXIII.
[0155] Suitable other anti-viral agents include, but are not
limited to, pegylated or unpegylated interferon alfa-2a, pegylated
or unpegylated interferon alfa-2b, pegylated or unpegylated
interferon alfa-2c, pegylated or unpegylated interferon alfa n-1,
pegylated or unpegylated interferon alfa n-3 and pegylated,
unpegylated consensus interferon or albumin-interferon-alpha.
[0156] The term "interferon alpha" as used herein means the family
of highly homologous species-specific proteins that inhibit viral
replication and cellular proliferation and modulate immune
response. Typical suitable interferon-alphas include, but are not
limited to, recombinant interferon alpha-2b, recombinant interferon
alpha-2a, recombinant interferon alpha-2c, alpha 2 interferon,
interferon alpha-n1 (INS), a purified blend of natural alpha
interferons, a consensus alpha interferon such as those described
in U.S. Pat. Nos. 4,897,471 and 4,695,623 (especially Examples 7, 8
or 9 thereof), or interferon alpha-n3, a mixture of natural alpha
interferons.
[0157] Interferon alfa-2a is sold as ROFERON-A.RTM. by Hoffmann-La
Roche (Nutley, N.J.).
[0158] Interferon alfa-2b is sold as INTRON-A.RTM. by Schering
Corporation (Kenilworth, N.J.). Interferon alfa-2b is also sold, in
combination with ribavirin, as REBETRON.RTM. by Schering
Corporation (Kenilworth, N.J.). The manufacture of interferon alpha
2b is described, for example, in U.S. Pat. No. 4,530,901.
[0159] Interferon alfa-n3 is a mixture of natural interferons sold
as ALFERON N INJECTION.RTM. by Hemispherx Biopharma, Inc.
(Philadelphia, Pa.).
[0160] Interferon alfa-n1 (INS) is a mixture of natural interferons
sold as WELLFERON.RTM. by Glaxo-Smith-Kline (Research Triangle
Park, N.C.).
[0161] Consensus interferon is sold as INFERGEN.RTM. by Intermune,
Inc. (Brisbane, Calif.).
[0162] Interferon alfa-2c is sold as BEROFOR.RTM. by Boehringer
Ingelheim Pharmaceutical, Inc. (Ridgefield, Conn.).
[0163] A purified blend of natural interferons is sold as
SUMIFERON.RTM. by Sumitomo; Tokyo, Japan.
[0164] Pegylated interferon alpha may also be administered in
association with a compound of the invention (e.g., represented by
a formula selected from I-XXIII). The term "pegylated interferon
alpha" as used herein means polyethylene glycol modified conjugates
of interferon alpha, preferably interferon alpha-2a and alpha-2b.
The preferred polyethylene-glycol-interferon alpha-2b conjugate is
PEG 12000-interferon alpha-2b. The phrases "12,000 molecular weight
polyethylene glycol conjugated interferon alpha" and "PEG 12000-IFN
alpha" as used herein include conjugates such as are prepared
according to the methods of International Application No. WO
95/13090 and containing urethane linkages between the interferon
alpha-2a or -2b amino groups and polyethylene glycol having an
average molecular weight of 12000. The pegylated interferon alpha,
PEG 12000-IFN-alpha-2b is available from Schering-Plough Research
Institute, Kenilworth, N.J.
[0165] The preferred PEG 12000-interferon alpha-2b can be prepared
by attaching a PEG polymer to the epsilon amino group of a lysine
residue in the interferon alpha-2b molecule. A single PEG 12000
molecule can be conjugated to free amino groups on an IFN alpha-2b
molecule via a urethane linkage. This conjugate is characterized by
the molecular weight of PEG 12000 attached. The PEG 12000-IFN
alpha-2b conjugate can be formulated as a lyophilized powder for
injection.
[0166] Pegylated interferon alfa-2b is sold as PEG-INTRON.RTM. by
Schering Corporation (Kenilworth, N.J.).
[0167] Pegylated interferon-alfa-2a is sold as PEGASYS.RTM. by
Hoffmann-La Roche (Nutley, N.J.).
[0168] Other interferon alpha conjugates can be prepared by
coupling an interferon alpha to a water-soluble polymer. A
non-limiting list of such polymers include other polyalkylene oxide
homopolymers such as polypropylene glycols, polyoxyethylenated
polyols, copolymers thereof and block copolymers thereof. As an
alternative to polyalkylene oxide-based polymers, effectively
non-antigenic materials such as dextran, polyvinylpyrrolidones,
polyacrylamides, polyvinyl alcohols, carbohydrate-based polymers
and the like can be used. Such interferon alpha-polymer conjugates
are described, for example, in U.S. Pat. No. 4,766,106, U.S. Pat.
No. 4,917,888, European Patent Application No. 0 236 987 or 0 593
868 or International Publication No. WO 95/13090.
[0169] Pharmaceutical compositions of pegylated interferon alpha
suitable for parenteral administration can be formulated with a
suitable buffer, e.g., Tris-HCl, acetate or phosphate such as
dibasic sodium phosphate/monobasic sodium phosphate buffer, and
pharmaceutically acceptable excipients (e.g., sucrose), carriers
(e.g. human plasma albumin), toxicity agents (e.g., NaCl),
preservatives (e.g., thimerosol, cresol or benzyl alcohol), and
surfactants (e.g., tween or polysorbates) in sterile water for
injection. The pegylated interferon alpha can be stored as
lyophilized powders under refrigeration at 2.degree.-8.degree. C.
The reconstituted aqueous solutions are stable when stored between
2.degree. and 8.degree. C. and used within 24 hours of
reconstitution. See for example U.S. Pat. Nos. 4,492,537; 5,762,923
and 5,766,582. The reconstituted aqueous solutions may also be
stored in prefilled, multi-dose syringes such as those useful for
delivery of drugs such as insulin. Typical, suitable syringes
include systems comprising a prefilled vial attached to a pen-type
syringe such as the NOVOLET.RTM. Novo Pen available from Novo
Nordisk or the REDIPEN.RTM., available from Schering Corporation,
Kenilworth, N.J. Other syringe systems include a pen-type syringe
comprising a glass cartridge containing a diluent and lyophilized
pegylated interferon alpha powder in a separate compartment.
[0170] In an embodiment of the invention, one or more other
anti-viral substances may be administered with one or more
compounds of the invention (e.g., represented by a structural
formula selected from I-XXIII). For example, a compound of the
invention (e.g., represented by a formula selected from I-XXIII)
may be administered with interferon-alfa, pegylated interferon-alfa
or albumin-interferon.
[0171] Other types of compounds which may be administered with a
compound of the invention (e.g., represented by a structural
formula selected from I-XXIII) include ribonucleoside analogues,
IMPDH inhibitors, N-glycosylation inhibitors, N3 protease
inhibitors, NS5B inhibitors, immunomodulatory compounds and CTP
synthase inhibitors, thiazolidine derivatives, benzanilides,
phenanthrenequinones, helicase inhibitors, polymerase inhibitors,
antisense phosphothioate oligodeoxynucleotides, IRES-dependent
translation inhibitors, nuclease resistant ribozymes,
1-amino-alkyloyclohexanes, alkyl lipids, antioxidants, squalene,
amantadine, bile acids, N-(phosphonoacetyl)-L-aspartic acid,
benzenedicarboxamides, polyadenylic acid derivatives, 2',3'
dideoxyinosine and benzimidazoles.
[0172] In an embodiment of the present invention, ribavirin (
##STR00055##
1-.beta.-D-ribofuranosyl-1H-1,2,4-triazole-3-carboxamide) is
administered in association with a compound of the present
invention (e.g., represented by a formula selected from I-XXIII).
Ribavirin is sold as REBETOL.RTM. by Schering Corporation;
Kenilworth, N.J. Its manufacture and formulation is described, for
example, in U.S. Pat. No. 4,211,771. A combination of ribavirin and
recombinant interferon alfa-2b (REBETRON.RTM.; Schering
Corporation; Kenilworth, N.J.) may also be administered in
association with a compound of the invention (e.g., represented by
a formula selected from I-XXIII).
[0173] In another embodiment of the invention, gemcitabine
##STR00056##
is administered in association with a compound of the present
invention (e.g., represented by a formula selected from I-XXIII).
Gemcitabine is sold as GEMZAR.RTM. by Eli Lilly and Co.
(Indianapolis, Ind.).
[0174] A further embodiment of the present invention comprises
administering a compound of the invention (e.g., represented by a
formula selected from I-XXIII) in association with VX497 (
##STR00057##
Vertex Pharmaceuticals; Cambridge, Mass.).
[0175] An embodiment of the invention comprises administering
mycophenolate mofetil (MMF; 2-morpholinoethyl
(E)-6-(1,3-dihydro-4-hydroxy-6-methoxy-7-methyl-3-oxo-5-isobenzofuranyl)--
4-methyl-4-hexenoate) in association with a compound of the
invention (e.g., represented by a formula selected from I-XXIII).
MMF is sold as CellCept.RTM. by Roche Laboratories; Nutley,
N.J.
[0176] Another embodiment comprises administering EICAR
##STR00058##
(5-ethynyl-1-beta-D-ribofuranosylimidazole-4-carboxamide; Balzarini
et al., J. Biol. Chem. 268(33): 24591-24598 (1993)) in association
with a compound of the invention (e.g., represented by a formula
selected from I-XXIII).
[0177] An embodiment of the present invention comprises
administering tiazofurin (
##STR00059##
Balzarini et al., J. Biol. Chem. 268(33): 24591-24598 (1993)) in
association with a compound of the invention (e.g., represented by
a formula selected from I-XXIII).
[0178] Another embodiment of the invention comprises administering
deoxynojirimycin and/or derivatives thereof, such as
N-nonyl-deoxynojirimycin (De Clercq et al., Mini Rev Med. Chem.
2(2):163-75 (2002)) or n-butyl deoxynojirimycin (nB-DNJ; Ouzounov
at al., Antiviral Res. 55(3):425-35 (2002)), in association with a
compound of the invention (e.g., represented by a formula selected
from I-XXIII).
[0179] In one embodiment, a compound of the present invention
(e.g., represented by a formula selected from I-XXIII) is
administered in association with albumin-interferon alpha
(ALBUFERON.TM.). Albumin-interferon alpha is interferon-a fused to
human serum albumin. ALBUFERON.TM. is available from Human Genome
Sciences, Rockville, Md. ALBUFERON.TM. has been shown to be
effective for treatment of hepatitis C virus infections (Blaire et
al., J. Pharm and Exp. Therap. 303(2): 540-548 (2002)).
[0180] In another embodiment, BILN-2061 (
##STR00060##
Lamarre et al., Nature 426(6963):129-31 (2003)), is administered in
association with a compound of the present invention (e.g.,
represented by a formula selected from I-XXIII).
[0181] In another embodiment, thymalfasin (e.g., ZADAXIN.TM.) is
administered in association with a compound of the invention (e.g.,
represented by a formula selected from I-XXIII). ZADAXIN.TM. is
available from SciClone Pharmaceuticals International, Ltd., San
Mateo, Calif.
[0182] In yet another embodiment, isatoribine
##STR00061##
ANA245;
5-Amino-3-beta-D-ribofuranosylthiazolo(4,5-d)pyrimidine-2,7(3H,6H-
)-dione monohydrate; Thiazolo(4,5-d)pyrimidine-2,7(3H,4H)-dione,
5-amino-3-beta-D-ribofuranosyl-, monohydrate) is administered in
association with a compound of the invention (e.g., represented by
a formula selected from I-XXIII).
[0183] In another embodiment, a compound of the invention (e.g.,
represented by a formula selected from I-XXIII) is administered in
association with an NS5B inhibitor such as NM283 or NM107 (Idenix
Pharmaceuticals; Cambridge, Mass.).
[0184] In another embodiment, a compound of the invention (e.g.,
represented by a formula selected from I-XXIII) is administered in
association with SCH68631(
##STR00062##
Chu et al., Tetrahedron Letters 37(40): 7229-7232 (1996)) or
SCH351633 (
##STR00063##
[0185] Biorg. Med. Chem. Lett. 9(14): 1949-1952 (1999)).
[0186] In a further embodiment, a compound of the invention (e.g.,
represented by a formula selected from I-XXIII) is administered in
association with any of the P.sub.1 variants of Elgin c disclosed
in Qasim et al., Biochemistry 36: 1598-1607 (1997).
[0187] In yet another embodiment, a compound of the invention
(e.g., represented by a formula selected from I-XXIII) is
administered in association
with gliotoxin (
##STR00064##
Ferrari et al., J. Virology 73(2): 1649-1654 (1999)).
[0188] Other embodiments of the invention include administering a
compound of the present invention (e.g., represented by a formula
selected from I-XXIII) in association with RD3-4082 (
##STR00065##
Sudo at al., Anti-viral Chem. & Chemother. 9: 186 (1998)) or
with RD3-4078
##STR00066##
(Sudo at al., Anti-viral Chem. & Chemother. 9: 186 (1998)) or
any other protease inhibitor disclosed in Sudo et al.
[0189] A further embodiment of the invention comprises
administering a compound of the present invention (e.g.,
represented by a structural formula selected from I-XXIII) in
association with
##STR00067##
Kakiuchi et al., FEBS Letters 421: 217-220 (1998)) or any other
proteinase inhibitor disclosed in Kakiuchi et al.
[0190] Another embodiment of the present invention comprises
administering a compound of the present invention (e.g.,
represented by a structural formula selected from I-XXIII) in
association with RD4-6205 (
##STR00068##
Sudo et al., Biochem. Biophys. Res. Comm. 238: 643-647 (1997)) or
any other protease inhibitor disclosed in Sudo at al.
[0191] An embodiment of the present invention comprises
administering a compound of the present invention (e.g.,
represented by a structural formula selected from I-XXIII) in
association with cerulenin
##STR00069##
(CAS Registry No. 17397-89-6; Lohmann et al., Virology 249: 108-118
(1998)) or any other HCV RNA-dependent RNA polymerase (RdRp)
inhibitor disclosed in Lohmann et al.
[0192] An embodiment of the present invention comprises
administering a compound of the present invention (e.g.,
represented by a structural formula selected from I-XXIII) in
association with ceplene (
##STR00070##
2-(1H-Imidazol-4-yl)ethanamine dihydrochloride).
[0193] Yet another embodiment of the present invention comprises
administering a compound of the present invention (e.g.,
represented by a structural formula selected from I-XXIII) in
association with amantadine
##STR00071##
[0194] A further embodiment of the present invention comprises
administering a compound of the present invention (e.g.,
represented by a structural formula selected from I-XXIII) in
association with IDN-6556
##STR00072##
[0195] Yet another embodiment of the present invention comprises
administering a compound of the present invention (e.g.,
represented by a structural formula selected from I-XXIII) in
association with naphthoquinone, 2-methylnaphthoquinone,
2-hydroxynaphthoquinone, 5-hydroxynaphthoquinone,
5,8-dihydroxynaphthoquinone, alkannin or shikonin (Takeshita et
al., Analytical Biochem. 247: 242-246 (1997)).
[0196] A further embodiment of the present invention comprises
administering a compound of the present invention (e.g.,
represented by a structural formula selected from I-XXIII) in
association with 1-amino-1,3,5-trimethylcyclohexane,
1-amino-1(trans),3(trans),5-trimethylcyclohexane,
1-amino-1(cis),3(cis),5-trimethylcyclohexane,
1-amino-1,3,3,5-tetramethylcyclohexane,
1-amino-1,3,3,5,5-pentamethylcyclohexane,
1-amino-1,3,5,5-tetramethyl-3-ethylcyclohexane,
1-amino-1,5,5-trimethyl-3,3-diethylcyclohexane,
1-amino-1,5,5-trimethyl-cis-3-ethylcyclohexane,
1-amino-(1S,5S)cis-3-ethyl-1,5,5-trimethylcyclohexane,
1-amino-1,5,5-trimethyl-trans-3-ethylcyclohexane,
1-amino-(1R,5S)trans-3-ethyl-1,5,5-trimethylcyclohexane,
1-amino-1-ethyl-3,3,5,5-tetramethylcyclohexane,
1-amino-1-propyl-3,3,5,5-tetramethylcyclohexane,
N-methyl-1-amino-1,3,3,5,5-pentamethylcyclohexane,
N-ethyl-1-amino-1,3,3,5,5-pentamethylcyclohexane, or
N-(1,3,3,5,5-pentamethylcyclohexyl)pyrrolidine or any other
1-aminoalkylcyclohexane N-methyl-D-aspartate (NMDA) inhibitors
disclosed in U.S. Pat. No. 6,034,134.
[0197] A further embodiment of the present invention comprises
administering a compound of the present invention (e.g.,
represented by a structural formula selected from I-XXIII) in
association with d-.alpha.-tocopherol or any other anti-HCV
compound disclosed in U.S. Pat. No. 5,922,757.
[0198] Another embodiment of the present invention comprises
administering a compound of the present invention (e.g.,
represented by a structural formula selected from I-XXIII) in
association with tauroursodeoxycholic acid, chenodeoxycholic acid,
ursodeoxycholic acid or free bile acid or any other bile acid HCV
inhibitor disclosed in U.S. Pat. No. 5,846,964.
[0199] Another embodiment of the present invention comprises
administering a compound of the present invention (e.g.,
represented by a structural formula selected from I-XXIII) in
association with 1,1'-[1,4-phenylenebis
(methylene)]bis(4,4'-trans-(4,5,6,7,8,9-hexahydro)
benzimidazoyl)piperidine,
1,1'-[1,4-phenylenebis(methylene)]bis(4,4'-benzimidazoyl)piperidine
or any other anti-HCV compound disclosed in U.S. Pat. No.
5,830,905.
[0200] Another embodiment of the present invention comprises
administering a compound of the present invention (e.g.,
represented by a structural formula selected from I-XXIII) in
association with
N,N'-4-[(2-benzimidazole)phenyl]-1,4-butanedicarboxamide,
N,N'-4-[(2-benzimidazole)phenyl]-1,6-hexanedicarboxamide,
N,N'-4-[(2-benzimidazole)phenyl]-1,8-octanedicarboxamide,
N,N'-4-[(2-benzimidazole)phenyl]-1,9-nonanedicarboxamide,
N,N'-4-[(2-benzimidazole)phenyl]-1,10-decanedicarboxamide or
N,N'-4-[(2-benzimidazole)phenyl]-1,4-butenedicarboxamide or any
other carboxamide HCV inhibitor disclosed in U.S. Pat. No.
5,633,388.
[0201] Another embodiment of the present invention comprises
administering a compound of the present invention (e.g.,
represented by a structural formula selected from I-XXIII) in
association with any of the polyadenylic acid (5') derivatives
disclosed in U.S. Pat. No. 5,496,546.
[0202] A further embodiment of the present invention comprises
administering a compound of the present invention (e.g.,
represented by a structural formula selected from I-XXIII) in
association with 2',3'-dideoxyinosine (U.S. Pat. No.
5,026,687).
[0203] An embodiment of the present invention comprises
administering a compound of the present invention (e.g.,
represented by a structural formula selected from I-XXIII) in
association with
##STR00073##
or any other benzimidazole disclosed in U.S. Pat. No.
5,891,874.
[0204] An additional embodiment of the invention comprises
administering VX-950 (
##STR00074##
Lin et al., J. Biol. Chem. 279(17): 17508-17514 (2004)) in
association with a compound of the present invention (e.g.,
represented by a structural formula selected from I-XXIII).
[0205] Another embodiment of the present invention comprises
administering a compound of the present invention (e.g.,
represented by a structural formula selected from I-XXIII) in
association with viramidine
##STR00075##
or levovirin
##STR00076##
[0206] Combinations of the invention include a compound of the
present invention (e.g., represented by a structural formula
selected from I-XXIII) "in association" with one or more additional
anti-viral agents (e.g., ribavirin, interferon alfa-2a or 2b, or
pegylated interferon alfa-2a or 2b). The term "in association"
indicates that the components of the combinations of the invention
can be formulated into a single composition for simultaneous
delivery or formulated separately into two or more compositions
(e.g., a kit). Furthermore, each component of a combination of the
invention can be administered to a subject at a different time than
when the other component is administered; for example, each
administration may be given non-simultaneously (e.g., separately or
sequentially) at several intervals over a given period of time.
Moreover, the separate components may be administered to a subject
by the same or by a different route (e.g., orally, intravenously,
subcutaneously).
[0207] The present invention further comprises compositions
comprising a compound of the present invention (e.g., represented
by structural formula selected from I-XXIII) in association with
one or more anti-viral agents discussed above (e.g., pegylated
interferon alfa-2a or 2b or ribavirin) along with pharmaceutical
compositions thereof.
Dosage and Administration
[0208] Typical protocols for the therapeutic administration of such
substances are well known in the art. Pharmaceutical composition of
the invention may be administered, for example, by any parenteral
(e.g., subcutaneous injection, intramuscular injection, intravenous
injection) or non-parenteral route (e.g., orally, nasally).
[0209] Pills and capsules of the invention can be administered
orally. Injectable compositions can be administered with medical
devices known in the art; for example, by injection with a
hypodermic needle including the REDIPEN.RTM. or the NOVOLET.RTM.
Novo Pen discussed above.
[0210] Injectable pharmaceutical compositions of the invention may
also be administered with a needleless hypodermic injection device;
such as the devices disclosed in U.S. Pat. Nos. 5,399,163;
5,383,851; 5,312,335; 5,064,413; 4,941,880; 4,790,824 or
4,596,556.
[0211] Compounds of the invention can be administered, for example,
three times a day, twice a day, once a day, three times weekly,
twice weekly or once weekly.
[0212] In an embodiment, the daily dose of a compound of the
present invention (e.g., represented by a formula selected from
I-XXIII) or of any other anti-viral agent administered in
association with a compound of the invention (e.g., represented by
a formula selected from I-XXIII) is, where possible, administered
accordance with the Physicians' Desk Reference 2003 (Physicians'
Desk Reference, 57th Ed); Medical Economics Company; ISBN:
1563634457; 57th edition (November 2002). The proper dosage can,
however, be altered by a clinician to compensate for particular
characteristics of the subject receiving the therapy depending, for
example, on the potency of the compound administered, side-effects,
age, weight, medical condition, overall health and response.
[0213] The term "therapeutically effective amount" means that
amount of a therapeutic agent or substance (e.g., compound
represented by structural formula selected from I-XXIII, interferon
or ribavirin) that will elicit a biological or medical response of
a tissue, system, subject or host that is being sought by the
administrator (such as a researcher, doctor or veterinarian) which
includes alleviation of the symptoms of Flaviviridae virus (e.g.,
HCV) infection and the prevention, slowing or halting of
progression of Flaviviridae virus (e.g., HCV) infection and its
symptom(s) to any degree including prevention of the infection of a
host with a Flaviviridae virus (e.g., HCV) following transplant of
a liver into said host. For example, in one embodiment, a
"therapeutically effective dosage" of a compound of the invention
(e.g., represented by a structural formula selected from I-XXIII)
or a combination including another anti-viral agent (e.g.,
ribavirin and/or pegylated or unpegylated inferferon alfa-2a or 2b)
results in the eradication of detectable Flaviviridae Viral RNA
(e.g., HCV RNA) for any period of time, for example, 12 or more
weeks (e.g., 24 weeks). Detection of viral RNA in a host can be
done easily using conventional well-known methods in the art. See
also the Physicians' Desk Reference ("PDR") for the therapeutically
effective dose and dosage regimens approved by the U.S. Federal
Food and Drug Administration.
[0214] In an embodiment, a therapeutically effective dosage or
amount of a compound represented by a structural formula selected
from I-III is about 20 mg/day to about 800 mg per day; about 20
mg/day to about 600 mg per day; about 20 mg/day to about 400 mg per
day; about 20 mg/day to about 100 mg per day; about 60 mg/day to
about 800 mg per day; about 60 mg/day to about 600 mg per day;
about 60 mg/day to about 400 mg per day; about 60 mg/day to about
200 mg per day; or about 60 mg/day to about 100 mg per day. For
example, a compound of the invention (e.g., represented by a
formula selected from I-III) can be administered in a dosage form
containing from about 20 mg to about 800 mg of the compound (e.g.,
20 mg, 50 mg, 100 mg, 200 mg, 400 mg, 600 mg or 800 mg).
[0215] In an embodiment, a therapeutically effective amount or
dosage a compound represented by a structural formula of any of
IV-XXIII is about 80 mg/day to about 1200 mg per day; about 80
mg/day to about 120 mg per day; about 80 mg/day to about 400 mg per
day; about 80 mg/day to about 600 mg per day; or about 80 mg/day to
about 1000 mg per day. For example, a compound of the invention
(e.g., represented by a formula selected from IV-XXIII) can be
administered in a dosage form containing from about 20 mg to about
1200 mg of the compound (e.g., 20 mg, 80 mg, 120 mg, 400 mg, 600
mg, 1000 mg or 1100 mg).
[0216] As discussed herein, methods of the present invention can
include administering a compound comprising a structural formula
selected from I-XXIII along with pegylated or unpegylated
interferon alfa-2a, pegylated or unpegylated interferon alfa-2b,
pegylated or unpegylated interferon alfa-2c, pegylated or
unpegylated interferon alfa n-1, pegylated or unpegylated
interferon alfa n-3, unpegylated pegylated consensus interferon,
ribavirin or any combination thereof.
[0217] In an embodiment, a therapeutically effective dosage of
interferon alfa-2b (e.g., INTRON-A.RTM.), particularly for the
treatment of chronic hepatitis C is 3 million IU (international
units) three times a week (TIW) administered subcutaneously or
intramuscularly. In patients tolerating therapy with normalization
of serum alanine aminotransferase (ALT) at 16 weeks of treatment,
INTRON A.RTM. therapy should be extended to 18 to 24 months (72 to
96 weeks) at 3 million IU TIW to improve the sustained response
rate.
[0218] If severe adverse reactions develop during INTRON A.RTM.
treatment, the dose should be modified (50% reduction) or therapy
should be discontinued as indicated below. If intolerance persists
after dose adjustment, INTRON A.RTM. therapy should be
discontinued.
[0219] In an embodiment, the recommended dose of PEG-interferon
alfa-2b (e.g., PEG-INTRON.RTM.) regimen is from about 0.5 to about
1.5 .mu.g/kg/week, preferably 1.0 .mu.g/kg/week for one year.
[0220] In an embodiment, a therapeutically effective dosage of
interferon alfa-2a (e.g., ROFERON-A.RTM.), particularly for the
treatment of chronic hepatitis C, is 3 MIU three times a week (TIW)
administered subcutaneously or intramuscularly for 12 months (48 to
52 weeks). As an alternative, patients may be treated with an
induction dose of 6 MIU TIW for the first 3 months (12 weeks)
followed by 3 MIU TIW for 9 months (36 weeks).
[0221] Patients who tolerate and partially or completely respond to
therapy with ROFERON-A.RTM. but relapse following its
discontinuation may be re-treated. Re-treatment with either 3 MIU
TIW or with 6 MIU TIW for 6 to 12 months may be considered.
[0222] In an embodiment, a temporary dose reduction by 50% is
recommended in patients who do not tolerate the prescribed dose of
ROFERON-A.RTM.. If adverse events resolve, treatment with the
original prescribed dose can be re-initiated. In patients who
cannot tolerate the reduced dose, cessation of therapy, at least
temporarily, is recommended.
[0223] In an embodiment, the recommended dose of PEG-interferon
alfa-2a (e.g., PEGASYS.RTM.) monotherapy is 180 .mu.g (1.0 mL) once
weekly for 48 weeks by subcutaneous (SC) administration in the
abdomen or thigh.
[0224] In an embodiment, a therapeutically effective dosage of
consensus interferon alfa (e.g., INFERGEN.RTM.), particularly for
treatment of chronic HCV infection, is 9 mcg TIW administered SC as
a single injection for 24 weeks. At least 48 hours should elapse
between doses of INFERGEN.RTM..
[0225] In an embodiment, patients who tolerated previous interferon
therapy and did not respond or relapsed following its
discontinuation may be subsequently treated with 15 mcg of
INFERGEN.RTM. TIW administered SC as a single injection for up to
48 weeks.
[0226] In an embodiment, for patients who experience a severe
adverse reaction on INFERGEN.RTM., dosage should be withheld
temporarily. If the adverse reaction does not become tolerable,
therapy should be discontinued. Dose reduction to 7.5 mcg may be
necessary following an intolerable adverse event.
[0227] If adverse reactions continue to occur at the reduced
dosage, the physician may discontinue treatment or reduce dosage
further. However, decreased efficacy may result from continued
treatment at dosages below 7.5 mcg.
[0228] During subsequent treatment for 48 weeks with 15 mcg of
INFERGEN.RTM., up to 36% of patients required dose reductions in 3
mcg increments.
[0229] In an embodiment, a therapeutically effective does of
albumin-interferon-alpha (e.g., ALBUFERON.RTM.) is about 120 mcg or
about 180 mcg or about 240 mcg or about 320 mcg or about 400 mcg or
about 500 mcg per day subcutaneously.
[0230] In an embodiment, a therapeutically effective dose of
ribavirin (e.g., REBETROL.RTM.) depends on the patient's body
weight. In an embodiment, the recommended dose of REBETOL.RTM. is
provided, below, in Table 1.
TABLE-US-00001 TABLE 1 Recommended Dosing Body weight REBETOL
Capsules </=75 kg 2 .times. 200-mg capsules AM, 3 .times. 200-mg
capsules PM daily p.o. >75 kg 3 .times. 200 mg capsules AM, 3
.times. 200 mg capsules PM daily p.o.
[0231] In an embodiment, the recommended duration of treatment with
ribavirin (e.g., REBETOL.RTM.) for patients previously untreated
with interferon is 24 to 48 weeks. The duration of treatment should
be individualized to the patient depending on baseline disease
characteristics, response to therapy, and tolerability of the
regimen. After 24 weeks of treatment, virologic response should be
assessed. Treatment discontinuation should be considered in any
patient who has not achieved an HCV RNA below the limit of
detection of the assay by 24 weeks.
[0232] In an embodiment, in patients who relapse following
interferon therapy, the recommended duration of treatment with
ribavirin (e.g., REBETOL.RTM.) is 24 weeks.
[0233] REBETOL.RTM. may be administered without regard to food, but
should be administered in a consistent manner with respect to food
intake.
[0234] In an embodiment, a combination of interferon alfa-2b and
ribavirin (e.g., REBETRON.RTM.) is administered in association with
a compound of the invention (e.g., represented by a formula
selected from I-XXIII).
[0235] In an embodiment, the recommended duration of REBETRON.RTM.
treatment for patients previously untreated with interferon is 24
to 48 weeks. The duration of treatment should be individualized to
the patient depending on baseline disease characteristics, response
to therapy, and tolerability of the regimen. After 24 weeks of
treatment, virologic response should be assessed. Treatment
discontinuation should be considered in any patient who has not
achieved an HCV RNA below the limit of detection of the assay by 24
weeks. In patients who relapse following interferon therapy, the
recommended duration of treatment is 24 weeks.
[0236] In an embodiment, the recommended dosage of a combination of
ribavirin (e.g., REBETROL.RTM.) and interferon alfa-2b (e.g.,
INTRON-A.RTM.) depends on patient body weigh. In an embodiment, the
adult dosage regimen is set forth below in Table 2:
TABLE-US-00002 TABLE 2 Recommended Adult Dosing Body weight REBETOL
Capsules INTRON A Injection </=75 kg 2 .times. 200-mg capsules
AM, 3 million IU 3 times 3 .times. 200-mg capsules PM weekly s.c.
daily p.o. >75 kg 3 .times. 200-mg capsules AM, 3 million IU 3
times 3 .times. 200-mg capsules PM weekly s.c. daily p.o.
[0237] In an embodiment, the pediatric dosage regimen, for the
combination, is set forth below in Table 3:
TABLE-US-00003 TABLE 3 Pediatric Dosing Body weight REBETOL
Capsules INTRON A Injection 25-36 kg 1 .times. 200-mg capsule AM 3
million IU/m.sup.2 3 times 1 .times. 200-mg capsule PM weekly s.c.
daily p.o. 37-49 kg 1 .times. 200-mg capsule AM 3 million
IU/m.sup.2 3 times 2 .times. 200-mg capsules PM weekly s.c. daily
p.o. 50-61 kg 2 .times. 200-mg capsules AM 3 million IU/m.sup.2 3
times 2 .times. 200-mg capsules PM weekly s.c. daily p.o. >61 kg
Refer to adult dosing table Refer to adult dosing table
[0238] In an embodiment, dosage modification of
REBETOL.RTM./INTRON-A.RTM. treatment is indicated when adverse
reactions are observed in the patient. For example, in patients
with a history of stable cardiovascular disease, a permanent dose
reduction is required if the patient's hemoglobin decreases by
>/=2 g/dL during any 4-week period. In addition, for these
cardiac history patients, if the patient's hemoglobin remains
<12 g/dL after 4 weeks on a reduced dose, the patient should
discontinue combination REBETOL.RTM. ANTRON-A.RTM. therapy.
[0239] In an embodiment, it is recommended that a patient whose
hemoglobin level falls below 10 g/dL have his/her REBETOL.RTM. dose
reduced to 600 mg daily (1.times.200-mg capsule AM, 2.times.200-mg
capsules PM). A patient whose hemoglobin level falls below 8.5 g/dL
should be permanently discontinued from REBETOL.RTM./INTRON A.RTM.
therapy.
[0240] In an embodiment, when administered in combination with
REBETOL.RTM., the recommended dose of PEG-Intron.RTM. is 1.5
micrograms/kg/week. The recommended dose of REBETOL.RTM. is 800
mg/day in 2 divided doses: two capsules (400 mg) with breakfast and
two capsules (400 mg) with dinner. REBETOL.RTM. should not be used
in patients with creatinine clearance<50 mL/min.
[0241] Ideally, though not necessarily, an infected host who is
administered a composition of the invention will, eventually,
exhibit no detectable HCV RNA is his body for a period of time
(e.g., 12 or more weeks).
[0242] The term "no detectable HCV-RNA" in the context of the
present invention means that there is less than about 100 copies of
HCV-RNA per ml of serum of the patient as measured by quantitative,
multi-cycle reverse transcriptase PCR (rtPCT) methodology. Such PCR
based assays are conventional and very well known in the art. In
general, rtPCR is performed by isolating the RNA from a specimen,
reverse-transcribing it to generate cDNAs, amplifying specific
nucleic acid sequences by PCR, and then using a variety of methods
to detect the amplified sequences (Urdea et al., Clin. Chem.
43:1507-1511 (1997)).
[0243] In one embodiment, a method of the present invention, when
administered to a host infected with a Flaviviridae virus, will
exhibit a sustained virologic response. The term "sustained
virologic response" as used in the context of the present invention
means that there is no detectable HCV-RNA in the serum of patients
treated in accordance with the present invention for at least 24
weeks after the end of the combined therapy treatment. Preferably,
the period of sustained virologic response is at least one year--or
longer--after the end of treatment.
EXAMPLES
[0244] The following examples are intended to exemplify and further
clarify what is the present invention and should not be construed
to limit the present invention.
Example 1
Production of Ara-C-5'-stearylphosphate (III) and
Ara-C-5'-stearylphosphate monosodium salt
[0245] To 6.4 g (10 mmol) of N.sup.4, O.sup.2',
O.sup.3'-triacetyl-Ara-C-5'-phosphate tri-n-butyl ammonium salt, 5
g of stearyl alcohol, 30 ml of pyridine and 8 g of
p-toluenesulfonyl chloride were added and the mixture was
maintained at 40.degree. C. for 3 hours. Then, the reaction mixture
was extracted after adding 50 ml of water and 50 ml of
chloroform.
[0246] Deacetylation of the triacetyl compound in the chloroform
solution was carried out by adding 20 ml of aqueous ammonia and
ethanol thereto and the deacetylated compound was extracted with
water.
[0247] After collecting the aqueous layer, the aqueous layer was
adjusted to pH 2.5 by adding conc. hydrochloric acid, and the
precipitated Ara-C-5'-stearylphosphate was collected by filtration.
After adding 20 ml of water to the thus obtained precipitates and
adjusting the solution to pH 10.5 by an aqueous 1N solution of
sodium hydroxide, 80 ml of ethanol were added to the solution. By
collecting the generated precipitate through filtration,
Ara-C-5'-stearylphosphate monosodium salt (.alpha.-type) was
obtained in wet state, and by drying the wet material in the same
manner as in Example 2, 4.20 g of Ara-C-5'-stearylphosphate
monosodium salt (.alpha.-type) of m.p. 221.degree. C.
(decomposition) were obtained.
[0248] The purity of the thus obtained product was 99.62% by liquid
chromatography and E.sub.1 cm.sup.1% (273 nm, 0.1N NaOH) was 151.4.
This procedure is taken from U.S. Pat. No. 4,812,560.
Example 2
Production of Ara-C-5'-stearylphosphate monosodium salt
[0249] Into 1.5 liters of water 500 g of Ara-C-5'-stearylphosphate
were added and after adjusting the pH of the mixture to 10.8 by
sodium hydroxide while stirring the mixture, 6 liters of ethanol
were added to the mixture. After allowing the mixture to cool for
16 hours, the thus formed precipitate was collected by
centrifugation to obtain Ara-C-5'-stearylphosphate monosodium salt
in wet state.
[0250] By drying the thus obtained wet salt at 30.degree. C. under
reduced pressure, 332 g of amorphous (.alpha.-type)
Ara-C-5'-stearylphosphate monosodium salt of m.p. 223.degree. C.
(decomposition) were obtained.
[0251] The purity of the thus obtained product was 99.5% according
to liquid chromatography and E.sub.1 cm.sup.1% (273 nm, 0.1N NaOH)
was 152. 3.
[0252] The same result as above was obtained when acetone, methyl
ethyl ketone, tetrahydrofurane or dioxane was added instead of
ethanol to precipitate the monosodium salt. This procedure is taken
from U.S. Pat. No. 4,812,560.
Example 3
Production of Ara-C-5'-stearylphosphate monosodium salt
[0253] To 2.40 g of Ara-C-5'-stearylphosphate (a dried material), 6
ml of water were added and, after adjusting the mixture to pH 12.0
with aqueous 1N solution of sodium hydroxide, 30 ml of ethanol were
added to the mixture and the mixture was stirred for 3 hours at
55.degree. C. After cooling the mixture for 16 hours by standing,
the precipitate was collected by filtration and dried for 10 hours
at 30.degree. C. under a reduced pressure to obtain 1.83 g of
Ara-C-5'-stearylphosphate monosodium salt (.alpha.-type) of m.p.
220.degree. C. (decomposition). The purity of the thus obtained
product was 99.5% according to liquid chromatography and E.sub.1
cm.sup.1% (273 nlm, 0.1N NaOH) was 150.9. This procedure is taken
from U.S. Pat. No. 4,812,560.
Example 4
Production of Ara-C-5'-stearylphosphate monosodium salt
[0254] To 2.40 g of Ara-C-5'-stearylphosphate, 10 ml of water were
added and, after adjusting the mixture to pH 10.0 by sodium
hydroxide while stirring, the mixture, the thus formed solution was
condensed to dryness under a reduced pressure to obtain 2.30 g of
Ara-C-5'-stearylphosphate monosodium salt (.alpha.-type).
[0255] The melting point of the thus obtained product was
219.8.degree. C. (decomposition), the purity thereof was 99.1% by
liquid chromatography and E.sub.1 cm.sup.1% (273 nm, 0.1N NaOH) was
152.6. This procedure is taken from U.S. Pat. No. 4,812,560.
Example 5
Ara-C-5'-stearylphosphate monosodium salt monohydrate
[0256] To 10 g of Ara-C-5'-stearylphosphate, 30 ml of water were
added and, after adjusting the pH of the mixture to 10.5 by 5N
sodium hydroxide, 50 ml of ethanol were added to the thus formed
solution with stirring at about 40.degree. C. to precipitate the
monosodium salt.
[0257] The mixture was heated to 65.degree. C. and after adding the
seed crystal of Ara-C-5'-stearylphosphate monosodium salt
monohydrate .beta.-type), the mixture was maintained with stirring
while keeping the temperature for 5 hours to form crystals. After
microscopically confirming the completion of crystallization, 20 ml
of ethanol were added to the mixture and the mixture was gradually
cooled.
[0258] After one night, the crystals were filtrated and by drying
under a reduced pressure 8.9 g of Ara-C-5'-stearylphosphate
monosodium salt monohydrate (crystals of .beta.-type) of m.p.
220.degree. C. (decomposition) were obtained.
[0259] The purity of the thus obtained product was 99.7% by liquid
chromatography and E.sub.1 cm.sup.1% (273 nm, 0.1N NaOH) was 153.0.
This procedure is taken from U.S. Pat. No. 4,812,560.
Example 6
Synthesis of N.sup.4-[(Dimethylamino)methylene]arabinocytidine
(VI)
[0260] Ara-C (300 mg, 1.23 mmol) in DMF (5 mL) was reacted with
dimethylformamide dimethyl acetal (1.7 g, 14.2 mmol). On
evaporation and crystallization from a minimum amount of ethanol,
white crystals of N.sup.4-[(Dimethylamino)methylene]arabinocytidine
were obtained (371 mg, 100%).
[0261] This procedure is taken from Kerr et al., J. Pharm. Sci.
83(4): 582-586 (1994).
Example 7
Synthesis of N.sup.4-[(Diethylamino)methylene]arabinocytidine
(VII)
[0262] Ara-C (500 mg, 2.05 mmol) in DMF (2 mL) was reacted with
diethylformamide dimethyl acetal (2.16 g, 14.7 mmol). After
evaporation, the recrystallization of the residue from a variety of
solvents proved difficult. The residue was finally crystallized
from a solution of 4% MeOH in CH.sub.2Cl.sub.2, to give
N.sup.4-[(Diethylamino)methylene]arabinocytidine as fine colorless,
whitish crystals (601 mg, 90%).
[0263] This procedure is taken from Kerr et al., J. Pharm. Sci.
83(4): 582-586 (1994).
Example 8
Synthesis of N.sup.4-[(Dipropylamino)methylene]arabinocytidine
(VIII)
[0264] Ara-C (85 mg, 0.35 mmol) in DMF (2 mL) was reacted with
dipropylformamide dimethyl acetal (0.9 g, 5.14 mmol). Evaporation
and crystallization from ethanol-ethyl acetate gave
N.sup.4-[(Dipropylamino)methylene]arabinocytidine (104 mg,
85%).
[0265] This procedure is taken from Kerr et al., J. Pharm. Sci.
83(4): 582-586 (1994).
Example 9
Synthesis of N.sup.4-[(Dibutylamino)methylene]arabinocytidine
(IX)
[0266] Ara-C (85 mg, 0.35 mmol) in DMF (2 mL) is reacted with
dibutylformamide dimethyl acetal (0.9 g, 5.14 mmol). Evaporation
and crystallization from ethanol-ethyl acetate gave
N.sup.4-[(Dibutylamino)methylene]arabinocytidine (104 mg, 85%).
Example 10
Synthesis of N.sup.4-[(Diisopropylamino)methylene]arabinocytidine
(X)
[0267] Ara-C (500 mg, 2.05 mmol) in DMF (10 mL) was reacted with
diisopropylformamide dimethyl acetal (2.3 g, 13.2 mmol). After
evaporation, the residue was crystallized from ethanol-ether to
give pale lemon-colored crystals of
N.sup.4-[(Diisopropylamino)methylene]arabinocytidine (723 mg,
93%).
[0268] This procedure is taken from Kerr et al., J. Pharm. Sci.
83(4): 582-586 (1994).
Example 11
Synthesis of N.sup.4-[Piperidinomethylene]arabinocytidine (XI)
[0269] Ara-C (500 mg, 2.05 mmol) in DMF (10 mL) was reacted with
N-(dimethoxy methyl)piperidine (2.7 g, 16.8 mmol) for several hours
at room temperature. The contents were evaporated and the residue
chromatographed over silica gel using 1-6% MeOH in
CH.sub.2Cl.sub.2. The desired fractions were collected and
evaporated. The foam obtained was recrystallized from a mixture of
ethanol, CH.sub.2Cl.sub.2, and ethyl acetate to give
N.sup.4-[Piperidinomethylene]arabinocytidine (594 mg, 85%).
[0270] This procedure is taken from Kerr et al., J. Pharm. Sci.
83(4): 582-586 (1994).
Example 12
Synthesis of N.sup.4-[Morpholinomethylene]arabinocytidine (XII)
[0271] Ara-C (100 mg, 0.41 mmol) in DMF (5 mL) was reacted with
N-(dimethoxymethyl)morpholine (1.35 g, 9.3 mmol). Evaporation and
subsequent crystallization from ethyl acetate-ether gave
N.sup.4-[Morpholinomethylene]arabinocytidine (130 mg, 93%).
[0272] This procedure is taken from Kerr et al., J. Pharm. Sci.
83(4): 582-586 (1994).
Example 13
Synthesis of N.sup.4-[Pyrrolidinomethylene]arabinocytidine
(XIII)
[0273] Ara-C (100 mg, 0.41 mmol) in DMF (5 mL) was reacted with
N-(dimethoxymethyl)pyrrolidine (0.9 g, 6.2 mmol). Evaporation and
subsequent crystallization from ethyl acetate-ether gave
N.sup.4-[Pyrrolidinomethylene]arabinocytidine (119 mg, 89%).
[0274] This procedure is taken from Kerr et al., J. Pharm. Sci.
83(4): 582-586 (1994).
Example 14
Synthesis of N.sup.4-[Dimethylpiperidinomethylene]arabinocytidine
(XIV)
[0275] Ara-C (500 mg, 2.05 mmol) in DMF (10 mL) is reacted with
N-(dimethoxy methyl)dimethyl piperidine (2.7 g, 16.8 mmol) for
several hours at room temperature. The contents are evaporated and
the residue chromatographed over silica gel using 1-6% MeOH in
CH.sub.2Cl.sub.2. The desired fractions are collected and
evaporated. The foam obtained is recrystallized from a mixture of
ethanol, CH.sub.2Cl.sub.2, and ethyl acetate to give
N.sup.4-[Dimethylpiperidinomethylene]arabinocytidine.
Example 15
Dose Response and Cell Toxicity Assay
[0276] This example demonstrates the ability of various compounds
of the invention to inhibit the ability of cells to maintain and
replicate a replicon. The example also evaluates the toxicity level
of the various compounds on the cells.
[0277] Cell Culture. Cells of the luciferase replicon cell line
(Vrolijk et al., J. Virol. Methods 110:201-209 (2003)) was grown in
Dulbecco's minimal essential medium (DMEM) supplemented with 2 mM
glutamine, non-essential amino acids (NEAA), 10 mM HEPES, 0.075%
sodium bicarbonate, 100 U/ml penicillin and 100 .mu.g/mL
streptomycin, and 10% fetal bovine serum. To maintain the selection
for replicon, 0.3 mg/mL of G418 were added to the culture
media.
[0278] Dose-Response and Luciferase Assays. Replicon cells were
seeded at 5000 cells/well in 96-well collagen I-coated Biocoat
plates (Becton Dickinson; Palo Alto, Calif.). Twenty-four hrs
post-seeding, compounds (see Table 1 below) were added to replicon
cells. The final concentration of DMSO was 0.5%, fetal bovine serum
was 10%, and G418 was not added. The cells were incubated with the
compounds for 2 days, at which point the cells were washed with PBS
and lysed in 40 .mu.l Glo Lysis Buffer (Promega; Madison, Wis.). 20
.mu.l of lysates were mixed with 100 .mu.l Luciferase Assay Reagent
(Promega) and read on a Microtiter Plate Luminometer MLX (DYNEX
Technologies; Chantilly, Va.). The fold of reduction in luciferase
signal compared to no compound control was plotted against drug
concentration and fitted to the sigmoid dose response model using
PRISM software (Graphpad Software Inc.; San Diego, Calif.).
[0279] Taqman Assay Method. Replicon cells were seeded at 4000
cells/well in 96-well collagen 1-coated Biocoat Plates (Becton
Dickinson). Twenty-four hours post-seeding, compounds were added to
replicon cells. The final concentration of DMSO was 0.5%, fetal
bovine serum was 10%, and no G418 was added. Cells were incubated
with compounds for 2 days, at which point the cells were washed
with PBS and lysed in 1.times.cell lysis buffer (Ambion). The
replicon RNA level was measured using real time PCR (Taqman assay).
The amplicon was located in NS5B. The PCR primers were 5B.2F,
ATGGACAGGCGCCCTGA; 5B.2R, TTGATGGGCAGCTTGGTTTC; the probe sequence
was FAM-labeled CACGCCATGCGCTGCGG. GADPH RNA was used as an
endogenous control and was amplified in the same reaction as NS5B
(multiplex PCR) using primers and VIC-labeled probe recommended by
the manufacturer (PE Applied Biosystem). The real-time RT-PCR
reactions were run on the ABI PRISM 7900HT Sequence Detection
System using the following program: 48.degree. C. for 30 minutes,
95.degree. C. for 10 minutes, 40 cycles of 95.degree. C. for 15
seconds, 60.degree. C. for 1 minute. The .DELTA.CT values
(CT.sub.5B-CT.sub.GADPH) were plotted against drug concentration
and fitted to the sigmoid dose response model using SAS system (SAS
Institute, Inc.) or PRISM software (Graphpad Software, Inc.). IC50
was the drug dose response necessary to achieve an increase of 1 in
.DELTA.CT over the projected baseline. IC90 was the drug dose
response necessary to achieve an increase of 3.2 over the baseline.
All Taqman reagents were from PE Applied Biosystem.
[0280] Cell toxicity assay. The toxicity of compounds on the
replicon cells were measured by MTS assay following manufacturer's
instructions (Promega). Briefly, 20 .mu.l of CellTiter
96.RTM.AQueous One Solution Reagent were added to each well of the
96-well plate containing 100 .mu.l of culture medium. The plates
were incubated for 30-60 minutes before reading OD by DYNEX
MRX.
TABLE-US-00004 TABLE 4 Dose response and cell-toxicity assay
results. Compound IC50 (.mu.M) IC90 EC50 EC90 CC50 TI X >10
>10 0.03 2 >10 >300 XI >10 >10 0.07 8 >10 >100
XII >10 >10 0.02 1.5 >10 >500 XIII >10 >10 0.09 5
>10 >100 Cytarabine ~10 >10 0.05 4 >10 >200
Ribavirin 40-100 not reached 20 80 ~500 ~25 IC50: drug dose
necessary to reach a 2-fold decrease in replicon RNA level. IC90:
drug dose necessary to reach a 10-fold decrease in replicon RNA
level EC50: drug dose necessary to reach a 2-fold decrease in
luciferase signal. EC90: drug dose necessary to reach a 10-fold
reduction in luciferase signal. CC50: drug dose necessary to reduce
the MTS signal to 50% of that of no drug control TI: CC50/EC50 in
5-2 cells. All units are .mu.M.
[0281] The present invention is not to be limited in scope by the
specific embodiments described herein. Indeed, various
modifications of the invention in addition to those described
herein will become apparent to those skilled in the art from the
foregoing description. Such modifications are intended to fall
within the scope of the appended claims.
[0282] Patents, patent applications, publications, product
descriptions, and protocols are cited throughout this application,
the disclosures of which are incorporated herein by reference in
their entireties for all purposes.
Sequence CWU 1
1
3117DNAArtificial SequencePrimer 5B.2F 1atggacaggc gccctga
17220DNAArtificial SequencePrimer 5B.2R 2ttgatgggca gcttggtttc
20317DNAArtificial SequenceRT-PCR probe 3cacgccatgc gctgcgg 17
* * * * *