U.S. patent application number 12/885185 was filed with the patent office on 2011-02-03 for modified chimeric polypeptides with improved pharmacokinetic properties.
This patent application is currently assigned to REGENRON PHARMACEUTICALS, INC.. Invention is credited to Samuel Davis, Nicholas J. Papadopoulos, George D. Yancopoulos.
Application Number | 20110028698 12/885185 |
Document ID | / |
Family ID | 30447765 |
Filed Date | 2011-02-03 |
United States Patent
Application |
20110028698 |
Kind Code |
A1 |
Papadopoulos; Nicholas J. ;
et al. |
February 3, 2011 |
Modified Chimeric Polypeptides with Improved Pharmacokinetic
Properties
Abstract
Modified chimeric polypeptides with improved pharmacokinetics
are disclosed. Specifically, modified chimeric Flt1 receptor
polypeptides that have been modified in such a way as to improve
their pharmacokinetic profile are disclosed. Also disclosed are
methods of making and using the modified polypeptides including but
not limited to using the modified polypeptides to decrease or
inhibit plasma leakage and/or vascular permeability in a
mammal.
Inventors: |
Papadopoulos; Nicholas J.;
(Lagrangeville, NY) ; Davis; Samuel; (New York,
NY) ; Yancopoulos; George D.; (Yorktown Heights,
NY) |
Correspondence
Address: |
REGENERON PHARMACEUTICALS, INC
777 OLD SAW MILL RIVER ROAD
TARRYTOWN
NY
10591
US
|
Assignee: |
REGENRON PHARMACEUTICALS,
INC.
TARRYTOWN
NY
|
Family ID: |
30447765 |
Appl. No.: |
12/885185 |
Filed: |
September 17, 2010 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12715128 |
Mar 1, 2010 |
|
|
|
12885185 |
|
|
|
|
12102681 |
Apr 14, 2008 |
7704500 |
|
|
12715128 |
|
|
|
|
11016097 |
Dec 17, 2004 |
7374757 |
|
|
12102681 |
|
|
|
|
10009852 |
Dec 6, 2001 |
7070959 |
|
|
PCT/US00/14142 |
May 23, 2000 |
|
|
|
11016097 |
|
|
|
|
60138133 |
Jun 8, 1999 |
|
|
|
Current U.S.
Class: |
530/391.1 |
Current CPC
Class: |
C07K 2319/30 20130101;
C07K 16/22 20130101; C07K 14/71 20130101; C07H 21/04 20130101; C12N
15/09 20130101; A61P 43/00 20180101; C07K 2319/00 20130101; C07K
19/00 20130101; A61K 38/00 20130101; C12N 15/10 20130101 |
Class at
Publication: |
530/391.1 |
International
Class: |
C07K 16/00 20060101
C07K016/00 |
Claims
1-51. (canceled)
52. A chimeric polypeptide consisting essentially of the amino acid
sequence of Ig-like domain 2 of an extracellular domain of a first
VEGF receptor and the amino acid sequence of Ig-like domain 3 of an
extracellular domain of a second VEGF receptor operably linked to
an immunoglobulin domain.
53. The chimeric polypeptide of claim 52, wherein one Ig-like
domain is from flt-1 and one Ig-like domain is from KDR.
54. The chimeric polypeptide of claim 52, wherein the Ig-like
domain 2 is from flt-1.
55. The chimeric polypeptide of claim 53, wherein the Ig-like
domain 2 is from flt-1.
56. The chimeric polypeptide of claim 52, wherein the Ig-like
domain 3 is from KDR.
57. The chimeric polypeptide of claim 53, wherein the Ig-like
domain 3 is from KDR.
58. The chimeric polypeptide of claim 52, wherein the Ig-like
domain 2 is from flt-1 and the Ig-like domain 3 is from KDR.
59. The chimeric polypeptide of claim 52, wherein the
immunoglobulin domain is a heavy chain of IgG.
60. The chimeric polypeptide of claim 53, wherein the
immunoglobulin domain is a heavy chain of IgG.
61. The chimeric polypeptide of claim 54, wherein the
immunoglobulin domain is a heavy chain of IgG.
62. The chimeric polypeptide of claim 55, wherein the
immunoglobulin domain is a heavy chain of IgG.
63. The chimeric polypeptide of claim 56, wherein the
immunoglobulin domain is a heavy chain of IgG.
64. The chimeric polypeptide of claim 57, wherein the
immunoglobulin domain is a heavy chain of IgG.
65. The chimeric polypeptide of claim 58, wherein the
immunoglobulin domain is a heavy chain of IgG.
66. The chimeric polypeptide of claim 52, wherein the
immunoglobulin domain is the Fc domain of IgG.
67. The chimeric polypeptide of claim 53, wherein the
immunoglobulin domain is the Fc domain of IgG.
68. The chimeric polypeptide of claim 54, wherein the
immunoglobulin domain is the Fc domain of IgG.
69. The chimeric polypeptide of claim 55, wherein the
immunoglobulin domain is the Fc domain of IgG.
70. The chimeric polypeptide of claim 56, wherein the
immunoglobulin domain is the Fc domain of IgG.
71. The chimeric polypeptide of claim 57, wherein the
immunoglobulin domain is the Fc domain of IgG.
72. The chimeric polypeptide of claim 58, wherein the
immunoglobulin domain is the Fc domain of IgG.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of U.S. Ser. No.
12/102,681 filed 14 Apr. 2008, which is a divisional of U.S. Ser.
No. 11/016,097, filed 17 Dec. 2004, now U.S. Pat. No. 7,374,757,
which is a divisional of U.S. Ser. No. 10/009,852, filed 6 Dec.
2001, now U.S. Pat. No. 7,070,959, which is a national stage
application of International Application No. PCT/US00/14142, filed
May 23, 2000, which claims priority of U.S. Provisional Application
No. 60/138,133, filed Jun. 8, 1999. The disclosures of these
publications are hereby incorporated by reference into this
application in their entireties.
FIELD OF THE INVENTION
[0002] The field of this invention is modified polypeptides with
improved pharmacokinetics. Specifically, the field of this
invention relates to Flt1 receptor polypeptides that have been
modified in such a way as to improve their pharmacokinetic profile.
The field of this invention also relates to methods of making and
using the modified polypeptides including but not limited to using
the modified polypeptides to decrease or inhibit plasma leakage
and/or vascular permeability in a mammal.
BACKGROUND
[0003] The ability of polypeptide ligands to bind to cells and
thereby elicit a phenotypic response such as cell growth, survival,
cell product secretion, or differentiation is often mediated
through transmembrane receptors on the cells. The extracellular
domain of such receptors (i.e. that portion of the receptor that is
displayed on the surface of the cell) is generally the most
distinctive portion of the molecule, as it provides the protein
with its ligand binding characteristic. Binding of a ligand to the
extracellular domain generally results in signal transduction which
transmits a biological signal to intracellular targets. Often, this
signal transduction acts via a catalytic intracellular domain. The
particular array of sequence motifs of this catalytic intracellular
domain determines its access to potential kinase substrates
(Mohammadi, et al., 1990, Mol. Cell. Biol. 11:5068-5078; Fantl, et
al., 1992, Cell 69:413-413). Examples of receptors that transduce
signals via catalytic intracellular domains include the receptor
tyrosine kinases (RTKs) such as the Trk family of receptors which
are generally limited to cells of the nervous system, the cytokine
family of receptors including the tripartate CNTF receptor complex
(Stahl & Yancopoulos, 1994, J. Neurobio. 25:1454-1466) which is
also generally limited to the cells of the nervous system,
G-protein coupled receptors such as the .beta..sub.2-adrenergic
receptor found on, for instance, cardiac muscle cells, and the
multimeric IgE high affinity receptor Fc.epsilon.RI which is
localized, for the most part, on mast cells and basophils (Sutton
& Gould, 1993, Nature 366:421-428).
[0004] All receptors identified so far appear to undergo
dimerization, multimerization, or some related conformational
change following ligand binding (Schlessinger, J., 1988, Trend
Biochem. Sci. 13:443-447; Ullrich & Schlessinger, 1990, Cell
61:203-212; Schlessinger & Ullrich, 1992, Neuron 9:383-391) and
molecular interactions between dimerizing intracellular domains
lead to activation of catalytic function. In some instances, such
as platelet-derived growth factor (PDGF), the ligand is a dimer
that binds two receptor molecules (Hart, et al., 1988, Science,
240:1529-1531; Heldin, 1989, J. Biol. Chem. 264:8905-8912) while,
for example, in the case of epidermal growth factor (EGF), the
ligand is a monomer (Weber, et al., 1984, J. Biol. Chem.
259:14631-14636). In the case of the Fc.epsilon.RI receptor, the
ligand, IgE, exists bound to Fc.epsilon.RI in a monomeric fashion
and only becomes activated when antigen binds to the
IgE/Fc.epsilon.RI complex and cross-links adjacent IgE molecules
(Sutton & Gould, 1993, Nature 366:421-428).
[0005] Often, the tissue distribution of a particular receptor
within higher organisms provides insight into the biological
function of the receptor. The RTKs for some growth and
differentiation factors, such as fibroblast growth factor (FGF),
are widely expressed and therefore appear to play some general role
in tissue growth and maintenance. Members of the Trk RTK family
(Glass & Yancopoulos, 1993, Trends in Cell Biol. 3:262-268) of
receptors are more generally limited to cells of the nervous
system, and the Nerve Growth Factor family consisting of nerve
growth factor (NGF), brain-derived neurotrophic factor (BDNF),
neurotrophin-3 (NT-3) and neurotrophin-4/5 (NT-4/5), which bind the
Trk RTK family receptors, promote the differentiation of diverse
groups of neurons in the brain and periphery (Lindsay, R. M, 1993,
in Neurotrophic Factors, S. E. Loughlin & J. H. Fallon, eds.,
pp. 257-284, San Diego, Calif., Academic Press). Fc.epsilon.RI is
localized to a very limited number of types of cells such as mast
cells and basophils. Mast cells derive from bone marrow pluripotent
hematopoietic stem cell lineage, but complete their maturation in
the tissue following migration from the blood stream (See Janeway
& Travers, 1996, in Immunobiology, 2d. Edition, M. Robertson
& E. Lawrence, eds., pp. 1:3-1:4, Current Biology Ltd., London,
UK, Publisher) and are involved in the allergic response.
[0006] Many studies have demonstrated that the extracellular domain
of a receptor provides the specific ligand binding characteristic.
Furthermore, the cellular environment in which a receptor is
expressed may influence the biological response exhibited upon
binding of a ligand to the receptor. For example, when a neuronal
cell expressing a Trk receptor is exposed to a neurotrophin which
binds to that receptor, neuronal survival and differentiation
results. When the same receptor is expressed by a fibroblast,
exposure to the neurotrophin results in proliferation of the
fibroblast (Glass, et al., 1991, Cell 66:405-413).
[0007] A class of cell-derived dimeric mitogens with selectivity
for vascular endothelial cells has been identified and designated
vascular endothelial cell growth factor (VEGF). VEGF has been
purified from conditioned growth media of rat glioma cells (Conn et
al., 1990, Proc. Natl. Acad. Sci. U.S.A., 87. pp 2628-2632); and
conditioned growth media of bovine pituitary follicle stellate
cells (Ferrara and Henzel, 1989, Biochem. Biophys. Res. Comm., 161,
pp. 851-858; Gozpadorowicz et al., 1989, Proc. Natl. Acad. Sci.
U.S.A., 86, pp. 7311-7315 and conditioned growth medium from human
0937 cells (Connolly, D. T. et al. 1989, Science, 246, pp.
1309-1312). VEGF is a dimer with an apparent molecular mass of
about 46 kDa with each subunit having an apparent molecular mass of
about 23 kDa. VEGF has some structural similarities to platelet
derived growth factor (PDGF), which is a mitogen for connective
tissue cells but not mitogenic for vascular endothelial cells from
large vessels.
[0008] The membrane-bound tyrosine kinase receptor, known as Flt,
was shown to be a VEGF receptor (DeVries, C. et al., 1992, Science,
255, pp. 989-991). The Flt receptor specifically binds VEGF which
induces mitogenesis. Another form of the VEGF receptor, designated
KDR, is also known to bind VEGF and induce mitogenesis. The partial
cDNA sequence and nearly full length protein sequence of KDR is
known as well (Terman, B. I. et al., 1991 Oncogene 6, pp.
1677-1683; Terman, B. I. et al., 1992 Biochem. Biophys. Res. Comm.
187, pp. 1579-1586).
[0009] Persistent angiogenesis may cause or exacerbate certain
diseases such as psoriasis, rheumatoid arthritis, hemangiomas,
angiofibromas, diabetic retinopathy and neovascular glaucoma. An
inhibitor of VEGF activity would be useful as a treatment for such
diseases and other VEGF-induced pathological angiogenesis and
vascular permeability conditions, such as tumor vascularization.
The present invention relates to a VEGF inhibitor that is based on
the VEGF receptor Flt1.
[0010] Plasma leakage, a key component of inflammation, occurs in a
distinct subset of microvessels. In particular, in most organs
plasma leakage occurs specifically in the venules. Unlike
arterioles and capillaries, venules become leaky in response to
numerous inflammatory mediators including histamine, bradykinin,
and serotonin. One characteristic of inflammation is the plasma
leakage that results from intercellular gaps that form in the
endothelium of venules. Most experimental models of inflammation
indicate that these intercellular gaps occur between the
endothelial cells of postcapillary and collecting venules (Baluk,
P., et al., Am. J. Pathol., 1998, 152:1463-76). It has been shown
that certain lectins may be used to reveal features of focal sites
of plasma leakage, endothelial gaps, and finger-like processes at
endothelial cell borders in inflamed venules (Thurston, G., et al.,
Am. J. Physiol., 1996, 271: H2547-62). In particular, plant lectins
have been used to visualize morphological changes at endothelial
cell borders in inflamed venules of, for example, the rat trachea.
Lectins, such as conconavalin A and ricin, that bind focally to
inflamed venules reveal regions of the subendothelial vessel wall
exposed by gaps that correspond to sites of plasma leakage
(Thurston, G., et al., Am J. Physiol., 1996, 271: H2547-62).
[0011] The properties of the microvessels are dynamic. Chronic
inflammatory diseases, for example, are associated with
microvascular remodeling, including angiogenesis and microvessel
enlargement. Microvessels can also remodel by acquiring abnormal
phenotypic properties. In a murine model of chronic airway
inflammation, airway capillaries acquire properties of venules,
including widened vessel diameter, increased immunoreactivity for
von Willebrand factor, and increased immunoreactivity for
P-selectin. In addition, these remodeled vessels leak in response
to inflammatory mediators, whereas vessels in the same position in
the airways of normal mice do not.
[0012] Certain substances have been shown to decrease or inhibit
vascular permeability and/or plasma leakage. For example, mystixins
are synthetic polypeptides that have been reported to inhibit
plasma leakage without blocking endothelial gap formation (Baluk,
P., et al., J. Pharmacol. Exp. Ther., 1998, 284: 693-9). Also, the
beta 2-adrenergic receptor agonist formoterol reduces microvascular
leakage by inhibiting endothelial gap formation (Baluk, P. and
McDonald, D. M., Am. J. Physiol., 1994, 266:L461-8).
[0013] The angiopoietins and members of the vascular endothelial
growth factor (VEGF) family are the only growth factors thought to
be largely specific for vascular endothelial cells. Targeted gene
inactivation studies in mice have shown that VEGF is necessary for
the early stages of vascular development and that Ang-1 is required
for later stages of vascular remodeling.
[0014] U.S. Pat. No. 6,011,003, issued Jan. 4, 2000, in the name of
Metris Therapeutics Limited, discloses an altered, soluble form of
FLT polypeptide being capable of binding to VEGF and thereby
exerting an inhibitory effect thereon, the polypeptide comprising
five or fewer complete immunoglobulin domains.
[0015] U.S. Pat. No. 5,712,380, issued Jan. 27, 1998 and assigned
to Merck & Co., discloses vascular endothelial cell growth
factor (VEGF) inhibitors that are naturally occurring or
recombinantly engineered soluble forms with or without a C-terminal
transmembrane region of the receptor for VEGF.
[0016] Also assigned to Merck & Co. is PCT Publication No. WO
98/13071, published Apr. 2, 1998, which discloses gene therapy
methodology for inhibition of primary tumor growth and metastasis
by gene transfer of a nucleotide sequence encoding a soluble
receptor protein which binds to VEGF.
[0017] PCT Publication No. WO 97/44453, published Nov. 27, 1997, in
the name of Genentech, Inc., discloses novel chimeric VEGF receptor
proteins comprising amino acid sequences derived from the vascular
endothelial growth factor (VEGF) receptors Flt1 and KDR, including
the murine homologue to the human KDR receptor FLK1, wherein said
chimeric VEGF receptor proteins bind to VEGF and antagonize the
endothelial cell proliferative and angiogenic activity thereof.
[0018] PCT Publication No. WO 97/13787, published Apr. 17, 1997, in
the name of To a Gosei Co., LTD., discloses a low molecular weight
VEGF inhibitor usable in the treatment of diseases accompanied by
neovascularization such as solid tumors. A polypeptide containing
the first immunoglobulin-like domain and the second
immunoglobulin-like domain in the extracellular region of a VEGF
receptor FLT but not containing the sixth immunoglobulin-like
domain and the seventh immunoglobulin-like domain thereof shows a
VEGF inhibitory activity.
[0019] Sharifi, J. et al., 1998, The Quarterly Jour. of Nucl. Med.
42:242-249, disclose that because monoclonal antibodies (MAbs) are
basic, positively charged proteins, and mammalian cells are
negatively charged, the electrostatic interactions between the two
can create higher levels of background binding resulting in low
tumor to normal organ ratios. To overcome this effect, the
investigators attempted to improve MAb clearance by using various
methods such as secondary agents as well as chemical and charge
modifications of the MAb itself.
[0020] Jensen-Pippo, et al., 1996, Pharmaceutical Research
13:102-107, disclose that pegylation of a therapeutic protein,
recombinant human granulocyte colony stimulating factor
(PEG-G-CSF), results in an increase in stability and in retention
of in vivo bioactivity when administered by the intraduodenal
route.
[0021] Tsutsumi, et al., 1997, Thromb Haemost. 77:168-73, disclose
experiments wherein the in vivo thrombopoietic activity of
polyethylene glycol-modified interleukin-6 (MPEG-IL-6), in which
54% of the 14 lysine amino groups of IL-6 were coupled with PEG,
was compared to that of native IL-6.
[0022] Yang, et al., 1995, Cancer 76:687-94, disclose that
conjugation of polyethylene glycol to recombinant human
interleukin-2 (IL-2) results in a compound, polyethylene
glycol-modified IL-2 (PEG-IL-2) that retains the in vitro and in
vivo activity of IL-2, but exhibits a markedly prolonged
circulating half-life.
[0023] R. Duncan and F. Spreafico, Clin. Pharmacokinet., 27:
290-306, 296 (1994) review efforts to improve the plasma half-life
of asparaginase by conjugating polyethylene glycol.
[0024] PCT International Publication No. WO 99/03996 published Jan.
28, 1999 in the name of Regeneron Pharmaceuticals, Inc. and The
Regents of The University of California describes modified human
noggin polypeptides having deletions of regions of basic amino
acids. The modified human noggin polypeptides are described as
retaining biological activity while having reduced affinity for
heparin and superior pharmacokinetics in animal sera as compared to
the unmodified human noggin.
SUMMARY OF THE INVENTION
[0025] The present invention is directed to VEGF antagonists with
improved pharmacokinetic properties. A preferred embodiment is an
isolated nucleic acid molecule encoding a fusion polypeptide
capable of binding a VEGF polypeptide comprising (a) a nucleotide
sequence encoding a VEGF receptor component operatively linked to
(b) a nucleotide sequence encoding a multimerizing component,
wherein the VEGF receptor component is the only VEGF receptor
component of the fusion polypeptide and wherein the nucleotide
sequence of (a) consists essentially of a nucleotide sequence
encoding the amino acid sequence of Ig domain 2 of the
extracellular domain of a first VEGF receptor and a nucleotide
sequence encoding the amino acid sequence of Ig domain 3 of the
extracellular domain of a second VEGF receptor.
[0026] In a further embodiment, the isolated nucleic acid of the
first VEGF receptor is Flt1.
[0027] In a further embodiment, the isolated nucleic acid of the
second VEGF receptor is Flk1.
[0028] In yet another embodiment, the isolated nucleic acid of the
second VEGF receptor is Flt4.
[0029] In another preferred embodiment, the nucleotide sequence
encoding Ig domain 2 of the extracellular domain of the first VEGF
receptor is upstream of the nucleotide sequence encoding Ig domain
3 of the extracellular domain of the second VEGF receptor.
[0030] In still another preferred embodiment, the nucleotide
sequence encoding Ig domain 2 of the extracellular domain of the
first VEGF receptor is downstream of the nucleotide sequence
encoding Ig domain 3 of the extracellular domain of the second VEGF
receptor.
[0031] In a preferred embodiment of the invention, the
multimerizing component comprises an immunoglobulin domain. In
another embodiment, the immunoglobulin domain is selected from the
group consisting of the Fc domain of IgG or the heavy chain of
IgG.
[0032] Preferred embodiments include an isolated nucleic acid
molecule comprising a nucleotide sequence encoding a modified Flt1
receptor fusion polypeptide, wherein the coding region of the
nucleic acid molecule consists of a nucleotide sequence selected
from the group consisting of (a) the nucleotide sequence set forth
in FIG. 13A-D (SEQ ID NO:3); (b) the nucleotide sequence set forth
in FIG. 14A-C (SEQ ID NO:5); (c) the nucleotide sequence set forth
in FIG. 15A-C (SEQ ID NO:7); (d) the nucleotide sequence set forth
in FIG. 16A-D (SEQ ID NO:9); (e) the nucleotide sequence set forth
in FIG. 21A-C (SEQ ID NO:11); (f) the nucleotide sequence set forth
in FIG. 22A-C (SEQ ID NO:13); (g) the nucleotide sequence set forth
in FIG. 24A-C; and (SEQ ID NO:15); and (h) a nucleotide sequence
which, as a result of the degeneracy of the genetic code, differs
from the nucleotide sequence of (a), (b), (c), (d), (e), (f), or
(g) and which encodes a fusion polypeptide molecule having the
biological activity of the modified Flt1 receptor fusion
polypeptide.
[0033] In a further embodiment of the invention, a fusion
polypeptide is encoded by the isolated nucleic acid molecules
described above.
[0034] A preferred embodiment is a composition capable of binding a
VEGF molecule to form a nonfunctional complex comprising a multimer
of the fusion polypeptide.
[0035] Also preferred is a composition wherein the multimer is a
dimer.
[0036] In yet another embodiment, the composition is in a
carrier.
[0037] Another embodiment is a vector which comprises the nucleic
acid molecules described above, including an expression vector
comprising a the nucleic acid molecules described wherein the
nucleic acid molecule is operatively linked to an expression
control sequence.
[0038] Other included embodiments are a host-vector system for the
production of a fusion polypeptide which comprises the expression
vector, in a suitable host cell; the host-vector system wherein the
suitable host cell is a bacterial cell, yeast cell, insect cell, or
mammalian cell; the host-vector system wherein the suitable host
cell is E. coli; the host-vector system wherein the suitable host
cell is a COS cell; the host-vector system wherein the suitable
host cell is a CHO cell.
[0039] Another embodiment of the invention is a method of producing
a fusion polypeptide which comprises growing cells of the
host-vector system under conditions permitting production of the
fusion polypeptide and recovering the fusion polypeptide so
produced.
[0040] Additional embodiments include a fusion polypeptide encoded
by the nucleic acid sequence set forth in FIG. 10A-D (SEQ ID NO:1)
or FIG. 24A-C (SEQ ID NO:15), which has been modified by
acetylation or pegylation wherein the acetylation is accomplished
with at least about a 100 fold molar excess of acetylation reagent
or wherein acetylation is accomplished with a molar excess of
acetylation reagent ranging from at least about a 10 fold molar
excess to about a 100 fold molar excess or wherein the pegylation
is 10K or 20K PEG.
[0041] A preferred embodiment includes a method of decreasing or
inhibiting plasma leakage in a mammal comprising administering to
the mammal the fusion polypeptide described above, including
embodiments wherein the mammal is a human, the fusion polypeptide
is acetylated or the fusion polypeptide is pegylated.
[0042] A preferred embodiment of the invention is a method of
blocking blood vessel growth in a human comprising administering an
effective amount of the fusion polypeptide described above.
[0043] Also preferred is a method of inhibiting VEGF receptor
ligand activity in a mammal comprising administering to the mammal
an effective amount of the fusion polypeptide described above.
Preferred embodiments of these methods are wherein the mammal is a
human.
[0044] Further embodiments of the methods of the invention include
attenuation or prevention of tumor growth in a human; attenuation
or prevention of edema in a human, especially wherein the edema is
brain edema; attenuation or prevention of ascites formation in a
human, especially wherein the ascites is ovarian cancer-associated
ascites.
[0045] Preferred embodiments of the invention include a fusion
polypeptide capable of binding a VEGF polypeptide comprising (a) a
VEGF receptor component operatively linked to (b) a multimerizing
component, wherein the VEGF receptor component is the only VEGF
receptor component in the fusion polypeptide and consists
essentially of the amino acid sequence of Ig domain 2 of the
extracellular domain of a first VEGF receptor and the amino acid
sequence of Ig domain 3 of the extracellular domain of a second
VEGF receptor. In a further embodiment of the fusion polypeptide,
the first VEGF receptor is Flt1. In yet a further embodiment of the
fusion polypeptide, the second VEGF receptor is Flk1. Still another
embodiment of the fusion polypeptide is one in which the second
VEGF receptor is Flt4.
[0046] Preferred embodiments include a fusion polypeptide wherein
amino acid sequence of Ig domain 2 of the extracellular domain of
the first VEGF receptor is upstream of the amino acid sequence of
Ig domain 3 of the extracellular domain of the second VEGF receptor
and a fusion polypeptide wherein the amino acid sequence of Ig
domain 2 of the extracellular domain of the first VEGF receptor is
downstream of the amino acid sequence of Ig domain 3 of the
extracellular domain of the second VEGF receptor.
[0047] In yet another embodiment, the fusion polypeptide
multimerizing component comprises an immunoglobulin domain
including an embodiment wherein the immunoglobulin domain is
selected from the group consisting of the Fc domain of IgG or the
heavy chain of IgG.
[0048] Preferred embodiments include a fusion polypeptide
comprising an amino acid sequence of a modified Flt1 receptor,
wherein the amino acid sequence selected from the group consisting
of (a) the amino acid sequence set forth in FIG. 13A-D (SEQ ID
NO:4); (b) the amino acid sequence set forth in FIG. 14A-C (SEQ ID
NO:6); (c) the amino acid sequence set forth in FIG. 15A-C (SEQ ID
NO:8); (d) the amino acid sequence set forth in FIG. 16A-D (SEQ ID
NO:10); (e) the amino acid sequence set forth in FIG. 21A-C (SEQ ID
NO:12); (f) the amino acid sequence set forth in FIG. 22A-C (SEQ ID
NO:14); and (g) the amino acid sequence set forth in FIG. 24A-C
(SEQ ID NO:16).
BRIEF DESCRIPTION OF THE FIGURES
[0049] FIG. 1. IEF gel analysis of unmodified and acetylated
Flt1(1-3)-Fc proteins. Unmodified Flt1(1-3)-Fc protein is unable to
enter the gel due to its >9.3 pl, whereas acetylated
Flt1(1-3)-Fc is able to enter the gel and equilibrate at pl
5.2.
[0050] FIG. 2. Binding of unmodified Flt1(1-3)-Fc and acetylated
Flt1(1-3)-Fc proteins to MATRIGEL.RTM. coated plates. Unmodified
Flt1(1-3)-Fc proteins binds extensive to extracellular matrix
components in MATRIGEL.RTM., whereas acetylated Flt1(1-3)-Fc does
not bind.
[0051] FIG. 3. Binding of unmodified Flt1(1-3)-Fc, acetylated
Flt1(1-3)-Fc, and pegylated Flt1(1-3)-Fc in a BIACORE.TM.-based
assay
[0052] FIG. 4. Binding of unmodified Flt1(1-3)-Fc, acetylated
Flt1(1-3)-Fc, and pegylated Flt1(1-3)-Fc to VEGF in an ELISA-based
assay. Both pegylated and acetylated Flt1(1-3)-Fc proteins bind to
VEGF with affinities approaching that of unmodified
Flt1(1-3)-Fc.
[0053] FIG. 5. Pharmacokinetic profiles of unmodified Flt1(1-3)-Fc,
acetylated Flt1(1-3)-Fc, and pegylated Flt1(1-3)-Fc.
[0054] FIG. 6A-B. IEF gel analysis of unmodified and
step-acetylated Flt1(1-3)-Fc proteins. Unmodified Flt1(1-3)-Fc
protein is unable to enter the gel due to its >9.3 pl, whereas
most of the step-acetylated Flt1(1-3)-Fc samples (30-100 fold
excess samples) were able to migrate into the gel and equilibrate
at pls ranging between 4.55-8.43, depending on the degree of
acetylation.
[0055] FIG. 7. Binding of unmodified Flt1(1-3)-Fc and
step-acetylated Flt1(1-3)-Fc proteins to MATRIGEL.RTM. coated
plates.
[0056] FIG. 8. Binding of unmodified Flt1(1-3)-Fc and
step-acetylated Flt1(1-3)-Fc in a BIACORE.TM.-based assay.
[0057] FIG. 9. Pharmacokinetic profiles of unmodified Flt1(1-3)-Fc
and step-acetylated Flt1(1-3)-Fc.
[0058] FIG. 10A-D. Nucleic acid (SEQ ID NO:1) and deduced amino
acid sequence (SEQ ID NO:2) of Flt1(1-3)-Fc.
[0059] FIG. 11. Schematic diagram of the structure of Flt1.
[0060] FIG. 12A-B. Hydrophilicity analysis of the amino acid
sequences of Ig domain 2 and Ig domain 3 of Flt1.
[0061] FIG. 13A-D. Nucleic acid (SEQ ID NO:3) and deduced amino
acid sequence (SEQ ID NO:4) of Mut1: Flt1(1-3.sub..DELTA.B)-Fc.
[0062] FIG. 14A-C. Nucleic acid (SEQ ID NO:5) and deduced amino
acid sequence (SEQ ID NO:6) of Mut2: Flt1(2-3.sub..DELTA.B)-Fc.
[0063] FIG. 15A-C. Nucleic acid (SEQ ID NO:7) and deduced amino
acid sequence (SEQ ID NO:8) of Mut3: Flt1(2-3)-Fc.
[0064] FIG. 16A-D. Nucleic acid (SEQ ID NO:9) and deduced amino
acid sequence (SEQ ID NO:10) of Mut4: Flt1(1-3.sub.R->N)-Fc.
[0065] FIG. 17. Binding of unmodified Flt1(1-3)-Fc, basic region
deletion mutant Flt1(1-3)-Fc, and Flt1(1-3).sub.R->N mutant
proteins in a BIACORE.TM.-based assay.
[0066] FIG. 18. Binding of unmodified Flt1(1-3)-Fc, Mut1:
Flt1(1-3.sub..DELTA.B)-Fc, Mut2: Flt1(2-3.sub..DELTA.B)-Fc, and
Flt1(2-3) mutant proteins to MATRIGEL.RTM. coated plates.
[0067] FIG. 19. Binding of unmodified Flt1(1-3)-Fc, Mut1:
Flt1(1-3.sub..DELTA.B)-Fc, Mut2: Flt1(2-3.sub..DELTA.B)-Fc, and
Flt1(2-3) mutant proteins in an ELISA-based assay.
[0068] FIG. 20. Pharmacokinetic profiles of unmodified
Flt1(1-3)-Fc, Mut1: Flt1(1-3.sub..DELTA.B)-Fc, Mut2:
Flt1(2-3.sub..DELTA.B)-Fc, and Flt1(2-3) mutant proteins
[0069] FIG. 21A-C. Nucleotide (SEQ ID NO:11) and deduced amino acid
sequence (SEQ ID NO:12) of the modified Flt1 receptor termed
Flt1D2.Flk1D3.Fc.DELTA.C1(a).
[0070] FIG. 22A-C. Nucleotide (SEQ ID NO:13) and deduced amino acid
sequence (SEQ ID NO:14) of the modified Flt1 receptor termed
Flt1D2.VEGFR3D3.Fc.DELTA.C1(a).
[0071] FIG. 23. Extracellular Matrix (ECM) Assay. The results of
this assay demonstrate that the Flt1D2.Flk1D3.Fc.DELTA.C1(a) and
Flt1D2.VEGFR3D3.Fc.DELTA.C1(a) proteins are considerably less
sticky to the ECM as compared to the Flt1(1-3)-Fc protein.
[0072] FIG. 24A-C. Nucleotide (SEQ ID NO:15) and deduced amino acid
sequence (SEQ ID NO:16) of the modified Flt1 receptor termed
VEGFR1R2-Fc.DELTA.C1(a).
[0073] FIG. 25A-C. Phosphorylation assay. At a 1.5 molar excess of
either Flt1(1-3)-Fc, Flt1(1-3)-Fc (A40) or transient
Flt1D2Flk1D3.Fc.DELTA.C1(a) there is complete blockage of receptor
stimulation by these three modified Flt1 receptors as compared to
control media challenge. In contrast, transient
Flt1D2VEGFR3D3.Fc.DELTA.C1(a) does not show significant blockage at
this molar excess, as compared with VEGF positive control
challenge. Similar results are seen in FIG. 25B, where the modified
Flt receptors are in a 3-fold molar excess to VEGF165 ligand. In
FIG. 25C, where the modified Flt1 receptors are in a 6-fold molar
excess to VEGF165 ligand, transient Flt1D2VEGFR3D3.Fc.DELTA.C1(a)
can now be shown to be partially blocking VEGF165-induced
stimulation of cell-surface receptors.
[0074] FIG. 26A-B. Phosphorylation assay. Detection by Western blot
of tyrosine phosphorylated VEGFR2(Flk1) by VEGF165 ligand
stimulation shows that cell-surface receptors are not
phosphorylated by challenge samples which have VEGF165 preincubated
with 1 and 2 fold molar excess (FIG. 26A) or 3 and 4 fold molar
excess (FIG. 26B) of either transient Flt1D2Flk1D3.Fc.DELTA.C1(a),
stable Flt1D2Flk1D3.Fc.DELTA.C1(a), or transient
VEGFR1R2-Fc.DELTA.C1(a). At all modified Flt1 receptor
concentrations tested there is complete binding of VEGF165 ligand
during the preincubation, resulting in no detectable stimulation of
cell-surface receptors by unbound VEGF165 as compared to control
media challenge.
[0075] FIG. 27. MG/R2 Cell proliferation assay. The following
modified Flt receptors Flt1(1-3)-Fc, Flt1D2.Flk1D3.Fc.DELTA.C1(a)
and Flt1D2.VEGFR3D3.Fc.DELTA.C1(a), plus an irrelevant receptor
termed Tie2-Fc as a negative control, were titrated from 40 nM to
20 .mu.M and incubated on the cells for 1 hr at 37.degree. C. Human
recombinant VEGF165 in defined media was then added to all the
wells at a concentration of 1.56 nM. The negative control receptor
Tie2-Fc does not block VEGF165-induced cell proliferation at any
concentration whereas Flt1D2.Flk1D3.Fc.DELTA.C1(a) blocks 1.56 nM
VEGF165 with a half maximal dose of 0.8 nM. Flt1(1-3)-Fc and
Flt1D2.VEGFR3D3.Fc.DELTA.C1(a) are less effective in blocking
VEGF165 in this assay with a half maximal dose of -2 nM. VEGF165
alone gives a reading of 1.2 absorbance units and the background is
0.38 absorbance units.
[0076] FIG. 28. BIACORE.TM. analysis of Binding Stoichiometry.
Binding stoichiometry was calculated as a molar ratio of bound
VEGF165 to the immobilized Flt1D2Flk1D3.Fc.DELTA.C1(a) or
VEGFR1R2-Fc.DELTA.C1(a), using the conversion factor of 1000 RU
equivalent to 1 ng/ml. The results indicated binding stoichiometry
of one VEGF165 dimeric molecule per one Flt1D2Flk1D3.Fc.DELTA.C1(a)
or VEGFR1R2-Fc.DELTA.C1(a) molecule.
[0077] FIGS. 29-30. Size Exclusion Chromatography Stoichiometry.
Flt1D2Flk1D3.Fc.DELTA.C1(a) or VEGFR1R2-Fc.DELTA.C1(a) at a
concentration of 1 nM (estimated to be 1000 times higher than the
KD of the Flt1D2Flk1D3.Fc.DELTA.C1(a) or
VEGFR1R2-Fc.DELTA.C1(a)VEGF165 interaction) were mixed with varied
concentrations of VEGF165. After incubation, concentrations of the
free Flt1D2Flk1D3.Fc.DELTA.C1(a) in solution were measured. The
data shows that the addition of 1 nM VEGF165 into the
Flt1D2Flk1D3.Fc.DELTA.C1(a) solution completely blocks
Flt1D2Flk1D3.Fc.DELTA.C1(a) binding to the VEGF165 surface. This
result suggested the binding stoichiometry of one VEGF165 molecule
per one Flt1D2Flk1D3.Fc.DELTA.C1(a) molecule.
[0078] FIG. 31. Size Exclusion Chromatography (SEC) under native
conditions. Peak #1 represents the
Flt1D2Flk1D3.Fc.DELTA.C1(a)/VEGF165 complex and peak #2 represents
unbound VEGF165. Fractions eluted between 1.1 and 1.2 ml were
combined and guanidinium hydrochloride (GuHCl) was added to a final
concentration 4.5 M to dissociate the complex.
[0079] FIG. 32. Size Exclusion Chromatography (SEC) under
dissociative conditions. To separate the components of the
receptor-ligand complex and to determine their molar ratio, 50
.mu.l of dissociated complex was loaded onto a SUPEROSE.TM. 12 PC
3.2/30 equilibrated in 6 M GuHCl and eluted. Peak #1 represents
Flt1D2Flk1D3.Fc.DELTA.C1(a) and peak #2 represents VEGF165.
[0080] FIGS. 33-35. Size Exclusion Chromatography (SEC) with
On-Line Light Scattering. Size exclusion chromatography column with
a MiniDawn on-line light scattering detector (Wyatt Technology,
Santa Barbara, Calif.) and refractive index (R1) detectors
(Shimadzu, Kyoto, Japan) was used to determine the molecular weight
(MW) of the receptor-ligand complex. As shown in FIG. 33, the
elution profile shows two peaks. Peak #1 represents the
receptor-ligand complex and peak #2 represents the unbound VEGF165.
MW was calculated from LS and R1 signals. The same procedure was
used to determine MW of the individual components of the
receptor-ligand complex. The results of these determinations are as
follows: MW of the Flt1D2Flk1D3.Fc.DELTA.C1(a)/VEGF165 complex at
the peak position is 157 300 (FIG. 33), the MW of VEGF165 at the
peak position is 44 390 (FIG. 34) and the MW of R1R2 at the peak is
113 300 (FIG. 35).
[0081] FIG. 36. Peptide mapping and glycosylation analysis. The
disulfide structures and glycosylation sites in
Flt1D2.Flk1D3.Fc.DELTA.C1(a) (SEQ ID NO:12) were determined by a
peptide mapping method. There are a total of ten cysteines in
Flt1D2.Flk1D3.Fc.DELTA.C1(a); six of them belong to the Fc region.
Cys27 is disulfide bonded to Cys76. Cys121 is disulfide bonded to
Cys182. The first two cysteines in the Fc region (Cys211 and
Cys214) form an intermolecular disulfide bond with the same two
cysteines in another Fc chain. However, it can not be determined
whether disulfide bonding is occurring between same cysteines
(Cys211 to Cys211, for example) or between Cys211 and Cys214.
Cys216 is disulfide bonded to Cys306. Cys352 is disulfide bonded to
Cys410. There are five possible N-linked glycosylation sites in
Flt1D2.Flk1D3.Fc.DELTA.C1(a) (SEQ ID NO:12) and are found to be
glycosylated to varying degrees. Complete glycosylation is observed
at Asn33, Asn193, and Asn282. Partial glycosylation is observed on
Asn65 and Asn120. Sites of glycosylation are highlighted by
underline in the figure.
[0082] FIG. 37. Pharmacokinetics of Flt1(1-3)-Fc (A40),
Flt1D2.Flk1D3.Fc.DELTA.C1(a) and VEGFR1R2-Fc.DELTA.C1(a). Balb/c
mice were injected subcutaneously with 4 mg/kg of Flt1(1-3)-Fc
(A40), CHO transiently expressed Flt1D2.Flk1D3.Fc.DELTA.C1(a), CHO
stably expressed Flt1D2.Flk1D3.Fc.DELTA.C1(a), and CHO transiently
expressed VEGFR1R2-Fc.DELTA.C1(a). The mice were tail bled at 1, 2,
4, 6, 24 hrs, 2 days, 3 days and 6 days after injection. The sera
were assayed in an ELISA designed to detect Flt1(1-3)-Fc (A40),
Flt1D2.Flk1D3.Fc.DELTA.C1(a) or VEGFR1R2-Fc.DELTA.C1(a). The
T.sub.max for Flt1(1-3)-Fc (A40) was at 6 hrs while the T.sub.max
for the transient and stable Flt1D2.Flk1D3.Fc.DELTA.C1(a) and the
transient VEGFR1R2-Fc.DELTA.C1(a) was 24 hrs. The C.sub.max for
Flt1(1-3)-Fc (A40) was 8 .mu.g/ml, For both transients
(Flt1D2.Flk1D3.Fc.DELTA.C1(a) and VEGFR1R2-Fc.DELTA.C1(a)) the
C.sub.max was 18 .mu.g/ml and the C.sub.max for the stable
VEGFR1R2-Fc.DELTA.C1(a) was 30 .mu.g/ml.
[0083] FIG. 38. Pharmacokinetics of Flt1(1-3)-Fc (A40),
Flt1D2.Flk1D3.Fc.DELTA.C1(a) and Flt1D2.VEGFR3D3.Fc.DELTA.C1(a).
Balb/c mice were injected subcutaneously with 4 mg/kg of
Flt1(1-3)-Fc (A40), CHO transiently expressed
Flt1D2.Flk1D3.Fc.DELTA.C1(a) and CHO transiently expressed
Flt1D2.VEGFR3D3.Fc.DELTA.C1(a). The mice were tail bled at 1, 2, 5,
6, 7, 8, 12, 15 and 20 days after injection. The sera were assayed
in an ELISA designed to detect Flt1(1-3)-Fc,
Flt1D2.Flk1D3.Fc.DELTA.C1(a) and Flt1D2.VEGFR3D3.Fc.DELTA.C1(a).
Flt1(1-3)-Fc (A40) could no longer be detected in the serum after
day 5 whereas Flt1D2.Flk1D3.Fc.DELTA.C1(a) and
Flt1D2.VEGFR3D3.Fc.DELTA.C1(a) were detectable for 15 days or
more.
[0084] FIG. 39. The ability of Flt1D2.Flk1D3.Fc.DELTA.C1(a) to
inhibit HT-1080 fibrosarcoma tumor growth In Vivo. Every other day
or 2 times per week treatment of SCID mice with
Flt1D2.Flk1D3.Fc.DELTA.C1(a) at 25 mg/Kg significantly decreases
the growth of subcutaneous HT-1080 fibrosarcoma tumors.
[0085] FIG. 40. The ability of Flt1D2.Flk1D3.Fc.DELTA.C1(a) to
inhibit C6 glioma tumor growth in vivo. Every other day or 2 times
a week treatment of SCID mice with Flt1D2.Flk1D3.Fc.DELTA.C1(a)
significantly decreases the growth of subcutaneous C6 glioma tumors
at doses as low as 2.5 mg/Kg.
[0086] FIG. 41. VEGF-induced uterine hyperpermeability.
[0087] FIGS. 42A-B. Assessment of corpus luteum angiogenesis using
progesterone as a readout.
DETAILED DESCRIPTION OF THE INVENTION
[0088] It has been a long standing problem in the art to produce a
receptor based VEGF antagonist that has a pharmacokinetic profile
that is appropriate for consideration of the antagonist as a
therapeutic candidate. Applicants describe herein, for the first
time, a chimeric polypeptide molecule, capable of antagonizing VEGF
activity, that exhibits improved pharmacokinetic properties as
compared to other known receptor-based VEGF antagonists. The
chimeric polypeptide molecules described herein thus provide for
the first time appropriate molecules for use in therapies in which
antagonism of VEGF is a desired result.
[0089] The present invention provides for novel chimeric
polypeptide molecules formed by fusing a modified extracellular
ligand binding domain of the Flt1 receptor to the Fc region of
IgG.
[0090] The extracellular ligand binding domain is defined as the
portion of a receptor that, in its native conformation in the cell
membrane, is oriented extracellularly where it can contact with its
cognate ligand. The extracellular ligand binding domain does not
include the hydrophobic amino acids associated with the receptor's
transmembrane domain or any amino acids associated with the
receptor's intracellular domain. Generally, the intracellular or
cytoplasmic domain of a receptor is usually composed of positively
charged or polar amino acids (i.e. lysine, arginine, histidine,
glutamic acid, aspartic acid). The preceding 15-30, predominantly
hydrophobic or apolar amino acids (i.e. leucine, valine,
isoleucine, and phenylalanine) comprise the transmembrane domain.
The extracellular domain comprises the amino acids that precede the
hydrophobic transmembrane stretch of amino acids. Usually the
transmembrane domain is flanked by positively charged or polar
amino acids such as lysine or arginine. von Heijne has published
detailed rules that are commonly referred to by skilled artisans
when determining which amino acids of a given receptor belong to
the extracellular, transmembrane, or intracellular domains (See von
Heijne, 1995, BioEssays 17:25-30). Alternatively, websites on the
Internet have become available to provide protein chemists with
information about making predictions about protein domains.
[0091] The present invention provides for the construction of
nucleic acid molecules encoding chimeric polypeptide molecules that
are inserted into a vector that is able to express the chimeric
polypeptide molecules when introduced into an appropriate host
cell. Appropriate host cells include, but are not limited to,
bacterial cells, yeast cells, insect cells, and mammalian cells.
Any of the methods known to one skilled in the art for the
insertion of DNA fragments into a vector may be used to construct
expression vectors encoding the chimeric polypeptide molecules
under control of transcriptional/translational control signals.
These methods may include in vitro recombinant DNA and synthetic
techniques and in vivo recombinations (genetic recombination) (See
Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold
Spring Harbor Laboratory; Current Protocols in Molecular Biology,
Eds. Ausubel, et al., Greene Publ. Assoc., Wiley-Interscience,
NY).
[0092] Expression of nucleic acid molecules encoding the chimeric
polypeptide molecules may be regulated by a second nucleic acid
sequence so that the chimeric polypeptide molecule is expressed in
a host transformed with the recombinant DNA molecule. For example,
expression of the chimeric polypeptide molecules described herein
may be controlled by any promoter/enhancer element known in the
art. Promoters which may be used to control expression of the
chimeric polypeptide molecules include, but are not limited to, the
long terminal repeat as described in Squinto et al., (1991, Cell
65:1-20); the SV40 early promoter region, the CMV promoter, the
M-MuLV 5' terminal repeat the promoter contained in the 3' long
terminal repeat of Rous sarcoma virus, the herpes thymidine kinase
promoter, the regulatory sequences of the metallothionine gene;
prokaryotic expression vectors such as the .beta.-lactamase
promoter, or the tac promoter; promoter elements from yeast or
other fungi such as the Gal 4 promoter, the ADH (alcohol
dehydrogenase) promoter, PGK (phosphoglycerol kinase) promoter,
alkaline phosphatase promoter, and the following animal
transcriptional control regions, which exhibit tissue specificity
and have been utilized in transgenic animals: elastase I gene
control region which is active in pancreatic acinar cells; insulin
gene control region which is active in pancreatic beta cells,
immunoglobulin gene control region which is active in lymphoid
cells, mouse mammary tumor virus control region which is active in
testicular, breast, lymphoid and mast cells, albumin gene control
region which is active in liver, alpha-fetoprotein gene control
region which is active in liver; alpha 1-antitrypsin gene control
region which is active in the liver, beta-globin gene control
region which is active in myeloid cells; myelin basic protein gene
control region which is active in oligodendrocyte cells in the
brain; myosin light chain-2 gene control region which is active in
skeletal muscle, and gonadotropic releasing hormone gene control
region which is active in the hypothalamus.
[0093] Thus, according to the invention, expression vectors capable
of being replicated in a bacterial or eukaryotic host comprising
chimeric polypeptide molecule-encoding nucleic acid as described
herein, are used to transfect the host and thereby direct
expression of such nucleic acids to produce the chimeric
polypeptide molecules, which may then be recovered in a
biologically active form. As used herein, a biologically active
form includes a form capable of binding to VEGF.
[0094] Expression vectors containing the chimeric nucleic acid
molecules described herein can be identified by three general
approaches: (a) DNA-DNA hybridization, (b) presence or absence of
"marker" gene functions, and (c) expression of inserted sequences.
In the first approach, the presence of a foreign gene inserted in
an expression vector can be detected by DNA-DNA hybridization using
probes comprising sequences that are homologous to the inserted
chimeric polypeptide molecule sequences. In the second approach,
the recombinant vector/host system can be identified and selected
based upon the presence or absence of certain "marker" gene
functions (e.g., thymidine kinase activity, resistance to
antibiotics, transformation phenotype, occlusion body formation in
baculovirus, etc.) caused by the insertion of foreign genes in the
vector. For example, if the chimeric polypeptide molecule DNA
sequence is inserted within the marker gene sequence of the vector,
recombinants containing the insert can be identified by the absence
of the marker gene function. In the third approach, recombinant
expression vectors can be identified by assaying the foreign gene
product expressed by the recombinant. Such assays can be based, for
example, on the physical or functional properties of the chimeric
polypeptide molecules.
[0095] Cells of the present invention may transiently or,
preferably, constitutively and permanently express the chimeric
polypeptide molecules.
[0096] The chimeric polypeptide molecules may be purified by any
technique which allows for the subsequent formation of a stable,
biologically active chimeric polypeptide molecule.
[0097] In one embodiment of the invention, the nucleotide sequence
encoding the first component is upstream of the nucleotide sequence
encoding the second component. In another embodiment of the
invention, the nucleotide sequence encoding the first component is
downstream of the nucleotide sequence encoding the second
component. Further embodiments of the invention may be prepared in
which the order of the first, second and third fusion polypeptide
components are rearranged. For example, if the nucleotide sequence
encoding the first component is designated 1, the nucleotide
sequence encoding the second component is designated 2, and the
nucleotide sequence of the third component is designated 3, then
the order of the components in the isolated nucleic acid of the
invention as read from 5' to 3' may be any of the following six
combinations: 1, 2, 3; 1, 3, 2; 2, 1, 3; 2, 3, 1; 3, 1, 2; or 3, 2,
1.
[0098] The present invention also has diagnostic and therapeutic
utilities. In particular embodiments of the invention, methods of
detecting aberrancies in the function or expression of the chimeric
polypeptide molecules described herein may be used in the diagnosis
of disorders. In other embodiments, manipulation of the chimeric
polypeptide molecules or agonists or antagonists which bind the
chimeric polypeptide molecules may be used in the treatment of
diseases. In further embodiments, the chimeric polypeptide molecule
is utilized as an agent to block the binding of a binding agent to
its target.
[0099] By way of example, but not limitation, the method of the
invention may be useful in treating clinical conditions that are
characterized by vascular permeability, edema or inflammation such
as brain edema associated with injury, stroke or tumor; edema
associated with inflammatory disorders such as psoriasis or
arthritis, including rheumatoid arthritis; asthma; generalized
edema associated with burns; ascites and pleural effusion
associated with tumors, inflammation or trauma; chronic airway
inflammation; capillary leak syndrome; sepsis; kidney disease
associated with increased leakage of protein; and eye disorders
such as age related macular degeneration and diabetic
retinopathy.
[0100] An amino acid sequence analysis of Flt1(1-3)-Fc revealed the
presence of an unusually high number (46) of the basic amino acid
residue lysine. An IEF analysis of Flt1(1-3)-Fc showed that this
protein has pl greater than 9.3, confirming the prediction that the
protein is very basic. It was hypothesized that the basic nature of
Flt1(1-3)-Fc protein was causing it to bind to extracellular matrix
components and that this interaction might be the cause of the
extremely short detectable circulating serum half-life exhibited by
Flt1(1-3)-Fc when injected into mice. In order to test this
hypothesis, Flt1(1-3)-Fc protein was acetylated at the lysine
residues to reduce the basic charge. Acetylated Flt1(1-3)-Fc was
then tested in the assays described infra.
[0101] The following examples are offered by way of illustration
and not by way of limitation.
EXAMPLES
Example 1
Expression of Flt1(1-3)-Fc Protein in CHO K1 Cells
[0102] Using standard molecular biology techniques (see e.g.,
Molecular Cloning, A Laboratory Manual (Sambrook, et al., Cold
Spring Harbor Laboratory), Current Protocols in Molecular Biology
(Eds. Ausubel, et al., Greene Publ. Assoc., Wiley-Interscience,
NY), the gene encoding Flt1(1-3)-Fc was inserted into the
expression vector pEE14.1 (Lonza Biologics, plc) at a multiple
cloning site downstream of the CMV promoter. CHO K1 cells were
transfected with the pEE14.1/Flt1(1-3)-Fc DNA construct using
lipofectamine (Gaithersburg, Md.). The transfected CHO K1 cells
were grown in glutamine-free DMEM (JRH, Kansas City, Mo.)
containing 25 .mu.M methionine sulfoximine (MSX) from Sigma Inc.,
St. Louis, Mo., and high recombinant protein expressors were
obtained by screening the CHO K1 cell supernatants from over 100
hand-picked colony isolates using a standard immunoassay which
captures and detects human Fc. The selected hand-picked clone was
amplified in the presence of 100 .mu.M MSX followed by a second
round of screening of the amplified clones. The highest producing
clone had a specific productivity of recombinant Flt1(1-3)-Fc
protein of 55 .mu.g/cell/day.
[0103] The selected clone was expanded in 225 cm.sup.2 T-flasks
(Corning, Acton, Mass.) and then into 8.5 L roller bottles
(Corning, Acton, Mass.) using the cell culture media described
supra. Cells were removed from the roller bottles by standard
trypsinization and put into 3.5 L of suspension medium. The
suspension medium is comprised of glutamine-free ISCHO medium
(Irvine Scientific, Santa Ana, Calif.) containing 5% fetal bovine
serum (FBS from HYCLONE.TM. Labs, Logan, Utah), 100 .mu.M MSX and
GS supplement (JRH Scientific, Kansas City, Mo.) in a 5 L Celligen
bioreactor (New Brunswick Scientific, New Brunswick, N.J.) at a
density of 0.3.times.10.sup.6 cells/mL. After the cells reached a
density of 3.6.times.10.sup.6/mL and were adapted to suspension
they were transferred to a 60 L bioreactor (ABEC, Allentown, Pa.)
at a density of 0.5.times.10.sup.6 cells/mL in 20 L of ISCHO medium
with 5% fetal bovine serum. After two days an additional 20 L of
ISCHO+5% fetal bovine serum was added to the bioreactor. The cells
were allowed to grow for an additional two days reaching a final
density of 3.1.times.10.sup.6 cells/mL, and a final Flt1(1-3)-Fc
concentration at harvest was 95 mg/L. At harvest the cells were
removed by tangential flow filtration using 0.45 .mu.m Prostak
Filters (Millipore, Inc., Bedford, Mass.).
Example 2
Purification of Flt1(1-3)-Fc Protein Obtained from CHO K1 Cells
[0104] Flt1(1-3)-Fc protein was initially purified by affinity
chromatography. A Protein A column was used to bind, with high
specificity, the Fc portion of the molecule. This affinity-purified
protein was then concentrated and passed over a SEC column. The
protein was then eluted into the formulation buffer. The following
describes these procedures in detail.
[0105] Materials and Methods. All chemicals were obtained from J.
T. Baker, Phillipsburg, N.J. with the exception of PBS, which was
obtained as a 10.times. concentrate from Life Technologies,
Gaithersburg, Md. Protein A Fast Flow and SUPERDEX.TM. 200
preparation grade resins were obtained from Pharmacia, Piscataway,
N.J. Equipment and membranes for protein concentration were
obtained from Millipore, Bedford, Mass.
[0106] Approximately 40 L of 0.45 .mu.m-filtered CHO conditioned
media containing Flt1(1-3)-Fc protein was applied to a 290 mL
Protein A Fast Flow column (10 cm diameter) that had been
equilibrated with PBS. The column was washed with PBS containing
350 mM NaCl and 0.02% CHAPS and the bound protein was eluted with
20 mM Citric Acid containing 10 mM Na.sub.2HPO.sub.4. The single
peak in the elution was collected and its pH was raised to
neutrality with 1 M NaOH. The eluate fractions was concentrated to
approximately 9 mg/mL using 10K regenerated cellulose membranes by
both tangential flow filtration and by stirred cell concentration.
To remove aggregates and other contaminants, the concentrated
protein was applied to a column packed with SUPERDEX.TM. 200
preparation grade resin (10 cm.times.55 cm) and run in PBS
containing 5% glycerol. The main peak fractions were pooled,
sterile filtered, aliquoted and stored at -80.degree. C.
Example 3
Acetylation of Flt1(1-3)-Fc Protein
[0107] Two milligrams of Flt1(1-3)-Fc protein were acetylated as
described in the instruction manual provided with the
sulfo-NHS-acetate modification kit (Pierce Chemical Co., Rockford,
Ill.).
Example 4
Characterization of acetylated Flt1(1-3)-Fc Protein
[0108] IEF analysis: Flt1(1-3)-Fc and acetylated Flt1(1-3)-Fc were
analyzed by standard IEF analysis. As shown in FIG. 1, Flt1(1-3)-Fc
protein is not able to migrate into the gel and therefore must have
a pl greater than 9.3, the highest pl in the standard. However,
acetylated Flt1(1-3)-Fc is able to migrate into the gel and
equilibrate at a pl of approximately 5.2. This result demonstrates
that acetylation reduces the net positive charge of the protein and
therefore its pl considerably.
[0109] Binding to extracellular matrix components. To test for
binding to extracellular matrix components, Flt1(1-3)-Fc and
acetylated Flt1(1-3)-Fc where tested in an assay designed to mimic
the interaction with extracellular matrix components. In this
assay, 96-well tissue culture plates are coated with MATRIGEL.RTM.
(Biocoat MATRIGEL.RTM. matrix thin layer 96 well plate, Catalog
#40607, Becton Dickinson Labware, Bedford, Mass.). The plates are
incubated with varying concentrations of either Flt1(1-3)-Fc,
acetylated Flt1(1-3)-Fc, or rTie2-Fc (an irrelevant control)
protein are added to the wells. The plates are incubated for 1-2
hours at either room temperature or 37.degree. C. degrees and then
detection of bound proteins is accomplished by adding a secondary
alkaline phosphatase-conjugated anti-human Fc antibody to the
wells. Finally, alkaline phosphatase substrate is added to the
wells and optical density is measured. FIG. 2 shows the results of
this assay. Like the irrelevant control protein rTie2-Fc,
acetylated Flt1(1-3)-Fc does not exhibit any binding to the
MATRIGEL.RTM. coated plate, whereas the non-acetylated Flt1(1-3)-Fc
protein exhibits significant binding. This result indicates that
acetylation of basic amino acid residues is an effective way to
interfere with the charge interactions that exist between
positively charged proteins and the negatively charged
extracellular matrix components they are exposed to in vivo.
Example 5
Pegylation of Flt1(1-3)-Fc Protein
[0110] Although pegylation (polyethylene glycol--PEG) of proteins
has been shown to increase their in vivo potency by enhancing
stability and bioavailability while minimizing immunogenicity (see
references cited supra), it is counter-intuitive that pegylating
molecules that are too large to be filtered by the kidney glomeruli
would improve their pharmacokinetic properties. Without being bound
by theory, Applicants postulated that pegylation of the
Flt1(1-3)-Fc molecules could improve the pharmacokinetic
properties, possibly not by altering the positive charge or by
decreasing the pl of Flt1(1-3)-Fc, but rather by physically
shielding the positive charges from interacting with the
extracellular matrix. Applicants decided to attempt to improve the
pharmacokinetic properties of Flt1(1-3)-Fc molecules by attaching
strands of 20K PEGs as described infra.
[0111] Materials and Methods. Purified Flt1(1-3)-Fc derived from
CHO cells (see supra) was used in the following pegylation
experiments. Functionalized PEGs were obtained from Shearwater
Polymers, Huntsville, Ala.; Bicine from Sigma, St Louis, Mo.;
SUPEROSE.TM. 6 column from Pharmacia, Piscataway, N.J.; PBS as a
10.times. concentrate from Life Technologies, Gaithersburg, Md.;
Glycerol from J. T. Baker, Phillipsburg, N.J.; and Bis-Tris precast
gels from Novex, Calif.
[0112] 20K PEG strands functionalized with amine-specific terminal
moieties were used in small-scale reaction studies that were set-up
to evaluate different reaction conditions in which the PEG:protein
stoichiometry was varied. Based on these reactions and the analyses
of samples on standard SDS-PAGE, Flt1(1-3)-Fc at a concentration of
1.5 mg/mL was reacted at pH 8.1 with 20K SPA-PEG (PEG succinimidyl
propionate) molecules at a PEG-to-Flt1(1-3)-Fc monomer molar ratio
of 1:6. The reaction was allowed to proceed at 8.degree. C.
overnight. For initial purification, the reaction products were
applied to a 10 mm.times.30 cm SUPEROSE.TM. 6 column equilibrated
with PBS containing 5% Glycerol. The column appeared to separate
pegylated Flt1(1-3)-Fc molecules based on the extent of pegylation.
Fractions corresponding to what appeared to be primarily
mono-pegylated and di-pegylated dimeric Flt1(1-3)-Fc, as judged by
banding patterns on reducing and non-reducing SDS-PAGE gels were
pooled. The protein concentration was determined by measuring
absorbance at 280 nm. The pegylated Flt1(1-3)-Fc protein was
sterile filtered, aliquoted and stored at -40.degree. C.
Example 6
Binding of Unmodified, Acetylated, and Pegylated Flt1(1-3)-Fc in a
BIACORE.TM.-Based Assay
[0113] Unmodified, acetylated, and pegylated Flt1(1-3)-Fc proteins
were tested in a BIACORE.TM.-based assay to evaluate their ability
to bind to the Flt1 ligand, VEGF. In this assay, unmodified
Flt1(1-3)-Fc protein was immobilized on the surface of a
BIACORE.TM. chip and a sample containing 0.2 .mu.g/ml VEGF and
either unmodified Flt1(1-3)-Fc, acetylated Flt1(1-3)-Fc or
pegylated Flt1(1-3)-Fc (each at 25 .mu.g/ml) was passed over the
Flt1(1-3)-Fc-coated chip. To minimize the effects of non-specific
binding, the bound samples were washed with a 0.5 M NaCl wash. In
one sample, unmodified Flt1(1-3)-Fc was mixed with heparin. Heparin
is a negatively charged molecule and the Flt1(1-3)-Fc protein is a
positively charged molecule, so when the two molecules are mixed
together, they should interact through their respective charges.
This essentially neutralizes Flt1(1-3)-Fc's inherent positive
charge making the molecule behave as if it has been chemically or
genetically modified so as to reduce its charge and its tendency to
bind via charge interactions. As shown in FIG. 3, acetylated
(columns 13-16), pegylated (columns 17-20), and heparin-treated
Flt1(1-3)-Fc (columns 21-24) are each able to completely compete
with the BIACORE.TM. chip-bound Flt1(1-3)-Fc for VEGF binding as
compared to control (columns 1-4) and irrelevant protein (columns
5-8). Unmodified Flt1(1-3)-Fc (columns 5-6) appeared to only
partially compete with BIACORE.TM. chip-bound Flt1(1-3)-Fc for VEGF
binding. However, washing the bound samples with 0.5 M NaCl
(columns 7-8) resulted in a binding profile similar to the modified
forms of Flt1(1-3)-Fc, indicating that the unmodified protein was
exhibiting non-specific binding to the chip that could be
eliminated by the salt wash.
Example 7
Binding of Unmodified, Acetylated, and Pegylated Flt1(1-3)-Fc in an
ELISA-Based Assay
[0114] Unmodified, acetylated, and pegylated Flt1(1-3)-Fc proteins
were tested in a standard ELISA-based assay to evaluate their
ability to bind the Flt1 receptor ligand VEGF. As shown in FIG. 4,
both pegylated and acetylated Flt1(1-3)-Fc proteins are capable of
binding to VEGF, demonstrating that modifying the protein either by
pegylation or acetylation does not destroy its ability to bind its
ligand.
Example 8
Pharmacokinetic Analysis of Unmodified Flt1(1-3)-Fc, Acetylated
Flt1(1-3)-Fc, and Pegylated Flt1(1-3)-Fc
[0115] In vivo experiments were designed to assess the
pharmacokinetic profiles of unmodified Flt1(1-3)-Fc, acetylated
Flt1(1-3)-Fc, and pegylated Flt1(1-3)-Fc protein. Balb/c mice
(23-28 g; 3 mice/group) were injected subcutaneously with 4 mg/kg
of unmodified, acetylated, or pegylated Flt1(1-3)-Fc. The mice were
tail bled at 1, 2, 4, 6, 24 hours, 2 days, and 3 days after
injection of protein. The sera were assayed in a standard
ELISA-based assay designed to detect Flt1(1-3)-Fc protein. Briefly,
the assay involves coating an ELISA plate with VEGF, binding the
unmodified, acetylated, or pegylated Flt1(1-3)-Fc-containing sera,
and reporting with an anti-Fc antibody linked to alkaline
phosphatase. As shown in FIG. 5, the T.sub.max for all of the
Flt1(1-3)-Fc proteins was between the 6 hour and 24 hour time
points. The C.sub.max for the different proteins was as follows:
Unmodified: 0.06 .mu./ml -0.15 .mu.g/ml; acetylated: 1.5
.mu./ml-4.0 .mu./ml; and pegylated: approximately 5 .mu.g/ml.
Example 9
Step-acetylation of Flt1(1-3)-Fc
[0116] To determine what minimal amount of acetylation is necessary
to eliminate binding to extracellular matrix components, an
experiment was designed that acetylated the Flt1(1-3)-Fc protein in
a step-wise fashion by using increasing amounts of molar excess of
acetylation reagent in the acetylation reaction mixture. The range
of molar excess was as follows: 0, 10, 20, 30, 40, 50, 60, 70, 80,
90, and 100 moles of acetylation reagent per 1 mole of Flt1(1-3)-Fc
monomer. The reactions were performed as detailed in the
instruction manual provided with the sulfo-NHS-Acetate modification
kit (Pierce Chemical Co., Rockford, Ill.).
Example 10
Characterization of step-acetylated Flt1(1-3)-Fc
[0117] IEF analysis Unmodified Flt1(1-3)-Fc and step-acetylated
Flt1(1-3)-Fc proteins were analyzed by standard IEF analysis. As
shown in FIG. 6A-B, unmodified Flt1(1-3)-Fc protein was not able to
migrate into the gel due to its extremely high pl (greater than
9.3). However, most of the step-acetylated Flt1(1-3)-Fc samples
(30-100 fold molar excess samples) were able to migrate into the
gel and equilibrate at pls ranging between 4.55-8.43, depending on
the degree of acetylation of the protein. This result demonstrates
that acetylation can change the positive charge of the protein in a
dose-dependent manner and that reduction of the pl can be
controlled by controlling the degree of acetylation.
[0118] Binding of step-acetylated Flt1(1-3)-Fc to extracellular
matrix components. To test for binding to extracellular matrix
components, Flt1(1-3)-Fc and step-acetylated Flt1(1-3)-Fc where
tested in the above-described assay designed to mimic the
interaction with extracellular matrix components. Varying
concentrations of either unmodified Flt1(1-3)-Fc, step-acetylated
Flt1(1-3)-Fc (10, 20, and 30 fold molar excess samples), or
rTie2-Fc (an irrelevant control) protein were added to the wells.
The plates were incubated for 1-2 hours at room temperature or
37.degree. C. and then detection of bound proteins was accomplished
by adding a secondary alkaline phosphatase-conjugated anti-human Fc
antibody to the wells. Alkaline phosphatase substrate was
subsequently added to the wells and optical density measured. FIG.
7 shows the results of this assay. Like the irrelevant control
protein rTie2-Fc, step-acetylated Flt1(1-3)-Fc (20 and 30 fold
molar excess samples) did not exhibit any significant binding to
the MATRIGEL.RTM. coated plate, whereas the non-acetylated
Flt1(1-3)-Fc protein exhibited significant binding. The binding is
saturable, indicating that the Flt1(1-3)-Fc protein may be binding
to specific sites, rather than a more general charge-mediated
interaction that might not be saturable. The 10 fold molar excess
sample showed reduced binding, but the degree of acetylation was
not enough to completely block binding to extracellular matrix
components. The 20 fold molar excess and higher samples displayed
no detectable binding, despite the fact that by IEF analysis (FIG.
6A-B) the lower molar excess samples still had a large net positive
charge. This result demonstrates that it is not necessary to
completely acetylate all available basic amino acids in order to
eliminate binding to extracellular matrix components.
[0119] Binding of step-acetylated Flt1(1-3)-Fc in a
BIACORE.TM.-based assay. Unmodified and step-acetylated
Flt1(1-3)-Fc proteins where tested in a BIACORE.TM.-based assay to
evaluate their ability to bind to the Flt1 ligand, VEGF. In this
assay, unmodified Flt1(1-3)-Fc protein (0.5, 1.0, or 5.0 .mu.g/ml)
was immobilized on the surface of a BIACORE.TM. chip and a solution
containing 0.2 .mu.g/ml VEGF and either unmodified Flt1(1-3)-Fc (at
either 0.5, 1.0, or 5.0 .mu.g/ml) or 10 different step-acetylated
Flt1(1-3)-Fc samples (at 0.5, 1.0, or 5.0 .mu.g/ml each) were
passed over the Flt1(1-3)-Fc-coated chip. As shown in FIG. 8, at a
sub-stoichiometric ratio (0.5 .mu.g/ml of either unmodified
Flt1(1-3) or step-acetylated Flt1(1-3)-Fc vs. 0.2 .mu.g/ml VEGF),
there is not enough Flt1(1-3)-Fc (either unmodified or
step-acetylated) in the solution to completely bind the VEGF. At
1.0 .mu.g/ml, which approximates a 1:1 stoichiometric ratio, both
unmodified and step-acetylated Flt1(1-3)-Fc are better able to
compete for VEGF binding, but there is still insufficient
Flt1(1-3)-Fc protein (either unmodified or step-acetylated) to
completely bind the available VEGF. However, at 5.0 .mu.g/ml, which
is several times greater than a 1:1 stoichiometric ratio, both the
Flt1(1-3)-Fc and the step-acetylated Flt1(1-3)-Fc proteins are able
to bind the VEGF, regardless of the degree of acetylation. This
clearly demonstrates that acetylation does not alter Flt1(1-3)-Fc's
ability to bind VEGF.
[0120] Pharmacokinetic analysis of step-acetylated Flt1(1-3)-Fc. In
vivo experiments were designed to assess the pharmacokinetic
profiles of unmodified Flt1(1-3)-Fc and step-acetylated
Flt1(1-3)-Fc protein. Balb/c mice (23-28 g) were injected
subcutaneously with 4 mg/kg of unmodified or 10, 20, 40, 60 and 100
fold molar excess samples of step-acetylated Flt1(1-3)-Fc (3 mice
for unmodified, 10, 20 and 40 fold molar excess samples and 2 mice
for 60 and 100 fold molar excess samples). The mice were tail bled
at 1, 2, 4, 6, 24 hours, 2 days and 3 days after injection. The
sera were assayed in an ELISA-based assay designed to detect
Flt1(1-3)-Fc (described supra). FIG. 9 details the results of this
study. The T.sub.max for all of the Flt1(1-3)-Fc proteins tested
was at the 6 hour time point but the C.sub.max was as follows:
Unmodified Flt1(1-3)-Fc: 0.06 .mu.g/ml; 10 fold molar excess
sample: -0.7 .mu.g/ml, 20 fold molar excess sample-2 .mu.g/ml, 40
fold molar excess sample-4 .mu.g/ml, 60 fold molar excess sample-2
.mu.g/ml, 100 fold molar excess sample-1 .mu.g/ml. This results
demonstrates that acetylation or pegylation of Flt1(1-3)-Fc
significantly improves its pharmacokinetic profile.
Example 11
Construction of Flt1(1-3)-Fc Basic Region Deletion Mutant
Designated Mut1: Flt1(1-3.sub..DELTA.B)-Fc
[0121] Based on the observation that acetylated Flt1(1-3)-Fc, which
has a pl below 6, has much better pharmacokinetics than the highly
positive unmodified Flt1(1-3)-Fc (pl>9.3), it was asked whether
the difference in pharmacokinetics could be attributed to the net
charge of the protein, which made it stick to negatively charged
extracellular matrix components, or whether there were perhaps
specific locations on the surface of the Flt1(1-3)-Fc protein that
constituted specific binding sites for extracellular matrix
components. For example, many proteins are known to have heparin
binding sites, often consisting of a cluster of basic residues.
Sometimes these residues are found in a cluster on the primary
sequence of the protein; some of the literature has identified
"consensus sequences" for such heparin binding sites (see for
example Hileman, et al., 1998, Bioessays 20(2):156-67). In other
cases, the known crystal structure of a protein reveals a cluster
of positively charged residues on the surface of a protein, but the
residues come from different regions of the primary sequence and
are only brought together when the protein folds into its tertiary
structure. Thus it is difficult to deduce whether an isolated amino
acid residue forms part of a cluster of basic residues on the
surface of the protein. However, if there is a cluster of
positively charged amino acid residues in the primary sequence, it
is not unreasonable to surmise that the residues are spatially
close to one another and might therefore be part of an
extracellular matrix component binding site. Flt1 receptor has been
studied extensively and various domains have been described (see
for example Tanaka et al., 1997, Jpn. J. Cancer Res. 88:867-876).
Referring to the nucleic acid and amino acid sequence set forth in
FIG. 10A-D of this application, one can identify the signal
sequence for secretion which is located at the beginning of the
sequence and extends to the glycine coded for by nucleotides 76-78.
The mature protein begins with Ser-Lys-Leu-Lys, starting at
nucleotide 79 of the nucleic acid sequence. Flt1 Ig domain 1
extends from nucleotide 79 to 393, ending with the amino acids
Ser-Asp-Thr. Flt1 Ig domain 2 extends from nucleotide 394 to 687
(encoding Gly-Arg-Pro to Asn-Thr-Ile), and Flt1 Ig domain 3 extends
from nucleotides 688 to 996 (encoding Ile-Asp-Val to Asp-Lys-Ala).
There is a bridging amino acid sequence, Gly-Pro-Gly, encoded by
nucleotides 997-1005, followed by the nucleotide sequence encoding
human Fc (nucleotides 1006-1701 or amino acids Glu-Pro-Lys to
Pro-Gly-Lys-stop).
[0122] A more detailed analysis of the Flt1 amino acid sequence
reveals that there is a cluster, namely, amino acid residues
272-281 (KNKRASVRR) of FIG. 10A-D, in which 6 out of 10 amino acid
residues are basic. This sequence is located in Flt1 Ig domain 3 of
the receptor (see FIG. 11), which is not itself essential for
binding of VEGF ligand, but which confers a higher affinity binding
to ligand. An alignment of the sequence of Ig domain 3 with that of
Ig domain 2 reveals that in this region, there is very poor
alignment between the two Ig domains, and that there are about 10
additional amino acids in Ig domain 3. An analysis of the
hydrophilicity profiles (MACVECTOR.TM. computer software) of these
two domains clearly indicates the presence of a hydrophilic region
in the protein (FIG. 12A-B). These observations raised the
possibility that the actual three dimensional conformation of Flt1
Ig domain 3 allowed for some type of protrusion that is not in Flt1
Ig domain 2. To test this hypothesis, the 10 additional amino acids
were deleted and the resulting protein was tested to see whether
the deletion would affect the pharmacokinetics favorably without
seriously compromising the affinity of the receptor for VEGF. This
DNA construct, which was constructed using standard molecular
biology techniques in the mammalian expression vector pMT21
(Genetics Institute, Inc., Cambridge, Mass.), is referred to as
Mut1 Flt1(1-3.sub..DELTA.B)-Fc. The Mut1: Flt1(1-3.sub..DELTA.B)-Fc
construct was derived from Flt1(1-3)-Fc by deletion of nucleotides
814-843 (set forth in FIG. 10A-D), which deletes the highly basic
10-amino acid residue sequence
Lys-Asn-Lys-Arg-Ala-Ser-Val-Arg-Arg-Arg from Flt1 Ig domain 3.
[0123] The final DNA construct was sequence-verified using an ABI
373A DNA sequencer and Taq Dideoxy Terminator Cycle Sequencing Kit
(Applied Biosystems, Inc., Foster City, Calif.). The sequence of
Mut1: Flt1(1-3.sub..DELTA.B)-Fc is set forth in FIG. 13A-D.
Example 12
Construction of Flt1(1-3)-Fc Basic Region Deletion Mutant
Designated Mut2: Flt1(2-3.sub..DELTA.B)-Fc
[0124] A second deletion mutant construct, designated Mut2:
Flt1(2-3.sub..DELTA.B)-Fc, was derived from the Mut1:
Flt1(1-3.sub..DELTA.B)-Fc construct by deletion of Flt1 Ig domain 1
encoded by nucleotides 79-393 (see FIG. 10A-D); for convenience,
nucleotides 73-78 (TCA GGT) were changed to TCC GGA. This
introduced a restriction site (BspE1) without altering the
associated amino acid sequence, Ser-Gly. This DNA construct, which
was constructed using standard molecular biology techniques in the
mammalian expression vector pMT21, was also sequence-verified using
an ABI 373A DNA sequencer and Taq Dideoxy Terminator Cycle
Sequencing Kit. The sequence of Mut2: Flt1(2-3.sub..DELTA.B)-Fc is
set forth in FIG. 14A-C.
Example 13
Construction of Flt1(1-3)-Fc Deletion Mutant Designated Mut3:
Flt1(2-3)-Fc
[0125] A third deletion mutate construct, designated Mut3:
Flt1(2-3)-Fc, was constructed the same way as the Mut2:
Flt1(2-3.sub..DELTA.B)-Fc construct, except that Flt1 Ig domain 3
was left intact (the basic region amino acids were not deleted).
The construct was constructed using standard molecular biology
techniques and the final construct was sequence-verified as
described supra. The sequence of Mut3: Flt1(2-3)-Fc is set forth in
FIG. 15A-C.
Example 14
Construction of Flt(1-3)-Fc Basic Region N-glycosylation Mutant
Designated Mut4: Flt1(1-3.sub.R->N)-Fc
[0126] A final construct was made in which a N-glycosylation site
was introduced into the middle of the basic region of Flt1 Ig
domain 3. This construct was designated Mut4:
Flt1(1-3.sub.R->N)-Fc and was made by changing nucleotides
824-825 from GA to AC, consequently changing the coded Arg residue
(AGA) into an Asn residue (AAC) (see FIG. 10A-D). The resulting
amino acid sequence is therefore changed from Arg-Ala-Ser to
Asn-Ala-Ser, which matches the canonical signal (Asn-Xxx-Ser/Thr)
for the addition of a N-glycosylation site at the Asn residue. The
sequence of Mut4: Flt1(1-3.sub.R->N)-Fc is set forth in FIG.
16A-D.
Example 15
Characterization of Acetylated Flt1(1-3)-Fc, Mut1:
Flt1(1-3.sub..DELTA.B)-Fc, and Mut4Flt1(1-3.sub.R->N)-Fc
Mutants
[0127] Binding to extracellular matrix components. To determine
whether the three modified proteins were more or less likely to
have improved pharmacokinetic properties, MATRIGEL.RTM. coated
96-well dishes (as described supra) were incubated with varying
concentrations of the mutant proteins and detected with anti-human
Fc/alkaline-phosphatase conjugated antibodies. As shown in FIG. 18,
this experiment showed that while the unmodified Flt1(1-3)-Fc
protein could bind avidly to these wells, the Mut3: Flt1(2-3)-Fc
protein bound somewhat more weakly, the Mut1:
Flt1(1-3.sub..DELTA.B)-Fc protein bound more weakly still, and the
Mut2: Flt1(2-3.sub..DELTA.B)-Fc protein showed the best profile,
binding more weakly than any of the other mutant proteins. The
Mut4: Flt1(1-3.sub.R->N)-Fc glycosylation mutant protein showed
only marginal benefit on the MATRIGEL.RTM. assay. These results
confirm the hypothesis that a linear sequence of positive amino
acids can be deleted from the primary sequence resulting in a
decrease in charge interaction with extracellular matrix
components.
[0128] Binding of Mut1: Flt1(1-3.sub..DELTA.B)-Fc and Mut4:
Flt1(1-3.sub.R->N)-Fc in a BIACORE.TM.-based assay. Unmodified
and acetylated Flt1(1-3)-Fc and genetically modified Mut1:
Flt1(1-3.sub..DELTA.B)-Fc and Mut4: Flt1(1-3.sub.R->N)-Fc
proteins where tested in a BIACORE.TM.-based assay to evaluate
their ability to bind to the Flt1 ligand, VEGF. In this assay,
unmodified Flt1(1-3)-Fc protein (0.25, 0.5, or 1.0 .mu.g/ml) was
immobilized on the surface of a BIACORE.TM. chip and a solution
containing 0.1 .mu.g/ml VEGF and either purified or COS cell
supernatant containing unmodified Flt1(1-3)-Fc (at approximately
(0.25, 0.5, or 1.0 .mu.g/ml), purified acetylated Flt1(1-3)-Fc (at
(0.25, 0.5, or 1.0 .mu.g/ml), COS cell supernatant containing Mut1:
Flt1(1-3.sub..DELTA.B)-Fc (at approximately (0.25, 0.5, or 1.0
.mu.g/ml), or COS cell supernatant containing Mut4:
Flt1(1-3.sub.R->N)-Fc (at approximately (0.25, 0.5, or 1.0
.mu.g/ml) were passed over the Flt1(1-3)-Fc-coated chip. As shown
in FIG. 17, at the sub-stoichiometric ratio (0.25 .mu.g/ml
Flt1(1-3)-Fc of unmodified, acetylated or genetically modified
samples vs. 0.1 .mu.g/ml VEGF), there is insufficient Flt1(1-3)-Fc
protein to block binding of VEGF to the Flt1(1-3)-Fc immobilized on
the BIACORE.TM. chip. At 0.5 .mu.g/ml of unmodified, acetylated or
genetically modified Flt1(1-3)-Fc proteins, the stoichiometric
ratio approximates 1:1 and there is an increased ability to block
VEGF binding to the BIACORE.TM. chip. At 1.0 .mu.g/ml of
unmodified, acetylated or genetically modified Flt1(1-3)-Fc
proteins, which is approximately a 10:1 stoichiometric ratio, the
Flt1(1-3)-Fc proteins are able to block binding of VEGF to the
BIACORE.TM. chip, but they are not equivalent. Unmodified,
acetylated, and Mut1: Flt1(1-3.sub..DELTA.B)-Fc are essentially
equal in their ability to block VEGF binding, whereas Mut4:
Flt1(1-3.sub.R->N)-Fc is somewhat less efficient at blocking
binding. These results confirm the hypothesis that it is possible
to reduce the non-specific binding of a positively charged molecule
by genetically removing a linear sequence of predominantly
negatively charged amino acids. Binding of Mut1:
Flt1(1-3.sub..DELTA.B)-Fc, Mut2: Flt1(2-3.sub..DELTA.B)-Fc, Mut3:
Flt1(2-3)-Fc, and in an ELISA-based assay. To determine whether the
three mutant proteins could bind the Flt1 ligand VEGF, binding
experiments were done in which 96-well plates coated with VEGF were
incubated with varying concentrations of the respective mutant
protein, and after washing, the amount bound was detected by
incubating with an alkaline phosphatase conjugated anti-human Fc
antibody and quantitated colorimetrically by the addition of an
appropriate alkaline phosphatase substrate. As shown in FIG. 19,
this experiment showed that all the mutant proteins could bind VEGF
similarly, at the concentrations tested.
Example 16
Pharmacokinetic Analysis of Acetylated Flt1(1-3)-Fc, Mut1:
Flt1(1-3.sub..DELTA.B)-Fc, and Unmodified Flt1(1-3)-Fc
[0129] In vivo experiments were designed to assess the
pharmacokinetic profiles of unmodified Flt1(1-3)-Fc, Mut1:
Flt1(1-3.sub..DELTA.B)-Fc, and 40 fold molar excess acetylated
Flt1(1-3)-Fc protein. Balb/c mice (25-30 g) were injected
subcutaneously with 4 mg/kg of unmodified Flt1(1-3)-Fc, 40 fold
molar excess acetylated Flt1(1-3)-Fc, and Mut1:
Flt1(1-3.sub..DELTA.B)-Fc proteins (4 mice each). These mice were
tail bled at 1, 2, 4, 6, 24 hours, 2 days, 3 days, and 5 days after
injection. The sera were assayed in an ELISA designed to detect
Flt1(1-3)-Fc protein which involves coating an ELISA plate with
VEGF, binding the Flt1(1-3)-Fc and reporting with an anti-Fc
antibody linked to alkaline phosphatase. As shown in FIG. 20, the
C.sub.max for these reagents was as follows: Unmodified
Flt1(1-3)-Fc--0.15 .mu.g/ml; 40 fold molar excess acetylated
Flt1(1-3)-Fc--1.5 .mu.g/ml; and Mut1:
Flt1(1-3.sub..DELTA.B)-Fc--0.7 .mu.g/ml.
Example 17
Modified Flt1 Receptor Vector Construction
[0130] The rationale for constructing modified versions of the Flt1
receptor (also known as VEGFR1) was based on the observation that
the protein sequence of Flt1 was highly basic, and was therefore
likely to stick to extracellular matrix (ECM). The highly basic
nature of Flt1 probably explains why unmodified Flt1(1-3)-Fc
(described supra) has poor pharmacokinetics that make it difficult
to use as a therapeutic agent. As described supra, the chemically
modified form of 40 fold molar excess acetylated Flt1(1-3)-Fc,
hereinafter termed A40, exhibited a greatly improved
pharmacokinetic (PK) profile over the non-acetylated Flt1(1-3)-Fc.
Therefore, attempts were made to engineer DNA molecules that could
be used to recombinantly express modified forms of a Flt1 receptor
molecule that would possess the improved PK profile exhibited by
A40 and still maintain the ability to bind tightly to VEGF.
[0131] It is known in the literature that the first Ig domain of
Flt1 (which has a net charge of +5 at neutral pH) is not essential
for tight binding to VEGF, so this domain was deleted. The third Ig
domain (having a net charge of +11) is not essential for binding,
but confers higher affinity for VEGF than the second Ig domain, so
instead of deleting it entirely, it was replaced with the
equivalent domains of the Flt1 receptor relatives Flk1 (also known
as VEGFR2) and Flt4 (also known as VEGFR3). These chimeric
molecules (denoted R1R2 (Flt1.D2.Flk1D3.Fc.DELTA.C1(a) and
VEGFR1R2-Fc.DELTA.C1(a)) and R1R3 (Flt1D2.VEGFR3D3-Fc.DELTA.C1(a)
and VEGFR1R3-Fc.DELTA.C1(a)) respectively, wherein R1 and Flt1D2=Ig
domain 2 of Flt1 (VEGFR1); R2 and Flk1D3=Ig domain 3 of Flk1
(VEGFR2); and R3 and VEGFR3D3=Ig domain 3 of Flt4 (VEGFR3)) were
much less sticky to ECM, as judged by an in vitro ECM binding assay
as described infra, had greatly improved PK as described infra. In
addition, these molecules were able to bind VEGF tightly as
described infra and block phosphorylation of the native Flk1
receptor expressed in endothelial cells as described infra.
[0132] Construction of the expression plasmid
pFlt1D2.Flk1D3.Fc.DELTA.C1(a). Expression plasmids
pMT21.Flt1(1-3).Fc (6519 bp) and pMT21.Flk-1(1-3).Fc (5230 bp) are
plasmids that encode ampicillin resistance and Fc-tagged versions
of Ig domains 1-3 of human Flt1 and human Flk1, respectively. These
plasmids were used to construct a DNA fragment consisting of a
fusion of Ig domain 2 of Flt1 with Ig domain 3 of Flk1, using PCR
amplification of the respective Ig domains followed by further
rounds of PCR to achieve fusion of the two domains into a single
fragment. For Ig domain 2 of Flt1, the 5' and 3' amplification
primers were as follows: 5': bsp/flt1D2
(5'-GACTAGCAGTCCGGAGGTAGACCTTTCGTAGAGATG-3') (SEQ ID NO:18)3':
Flt1D2-Flk1D3.as (5'-CGGACTCAGAACCACATCTATGATTGTATTGGT-3') (SEQ ID
NO:19)
[0133] The 5' amplification primer encodes a BspE1 restriction
enzyme site upstream of Ig domain 2 of Flt1, defined by the amino
acid sequence GRPFVEM (SEQ ID NO:20) (corresponding to amino acids
27-33 of FIG. 21A-C). The 3' primer encodes the reverse complement
of the 3' end of Flt1 Ig domain 2 fused directly to the 5'
beginning of Flk1 Ig domain 3, with the fusion point defined as
TIID (SEQ ID NO:37) of Flt1 (corresponding to amino acids 123-126
of FIG. 21A-21C) and continuing into VVLS (SEQ ID NO:38)
(corresponding to 127-130 of FIG. 21A-21C) of Flk1.
[0134] For Ig domain 3 of Flk1, the 5' and 3' amplification primers
were as follows: 5': Flt1D2-Flk1D3.s
(5'-ACAATCATAGATGTGGTTCTGAGTCCGTCTCATGG-3') (SEQ ID NO:21)-3':
Flk1D3/apa/srf.as (5'-GATAATGCCCGGGCCCTTTTCATGGACCCTGACAAATG-3')
(SEQ ID NO:22).
[0135] The 5' amplification primer encodes the end of Flt1 Ig
domain 2 fused directly to the beginning of Flk1 Ig domain 3, as
described above. The 3' amplification primer encodes the end of
Flk1 Ig domain 3, defined by the amino acids VRVHEK (SEQ ID NO:23)
(corresponding to amino acids 223-228 of FIG. 21A-C), followed by a
bridging sequence that includes a recognition sequence for the
restriction enzyme Srf1, and encodes the amino acids GPG. The
bridging sequence corresponds to amino acids 229-231 of FIG.
21A-C.
[0136] After a round of PCR amplification to produce the individual
domains, the products were combined in a tube and subjected to a
further round of PCR with the primers bsp/flt1D2 and
Flk1D3/apa/srf.as (described supra) to produce the fusion product.
This PCR product was subsequently digested with the restriction
enzymes BspEI and SmaI and the resulting 614 bp fragment was
subcloned into the BspEI to SrfI restriction sites of the vector
pMT21/.DELTA.B2.Fc, to create the plasmid pMT21/Flt1D2.Flk1D3.Fc.
The nucleotide sequence of the Flt1D2-Flk1D3 gene fusion insert was
verified by standard sequence analysis. This plasmid was then
digested with the restriction enzymes EcoRI and SrfI and the
resulting 702 bp fragment was transferred into the EcoRI to SrfI
restriction sites of the plasmid pFlt1(1-3)B2-Fc.DELTA.C1(a) to
produce the plasmid pFlt1D2.Flk1D3.Fc.DELTA.C1(a). The complete DNA
and deduced amino acid sequences of the
Flt1D2.Flk1D3.Fc.DELTA.C1(a) chimeric molecule is set forth in FIG.
21A-C.
[0137] Construction of the expression plasmid
pFlt1D2VEGFR3D3Fc.DELTA.C1(a). The expression plasmid
pMT21.Flt1(1-3).Fc (6519 bp) encodes ampicillin resistance and an
Fc-tagged version of Ig domains 1-3 of human Flt1 receptor. This
plasmid was used to produce a DNA fragment containing Ig domain 2
of Flt1 by PCR. RNA from the cell line HEL921.7 was used to produce
Ig domain 3 of Flk1, using standard RT-PCR methodology. A further
round of PCR amplification was used to achieve fusion of the two Ig
domains into a single fused fragment. For Ig domain 2 of Flt1, the
5' and 3' amplification primers were as follows: 5': bsp/flt1D2
(5'-GACTAGCAGTCCGGAGGTAGACC-TTTCGTAGAGATG-3') (SEQ ID NO:24)-3':
Flt1 D2.VEGFR3D3.as (TTCCTGGGCAACAGCTGGAT ATCTATGATTGTATTGGT) (SEQ
ID NO:25).
[0138] The 5' amplification primer encodes a BspE1 restriction site
upstream of Ig domain 2 of Flt1, defined by the amino acid sequence
GRPFVEM (SEQ ID NO:20) (corresponding to amino acids 27-33 of FIG.
22A-C). The 3' amplification primer encodes the reverse complement
of the end of Flt1 Ig domain 2 fused directly to the beginning of
VEGFR3 Ig domain 3, with the fusion point defined as TIID (SEQ ID
NO:37) of Flt1 (corresponding to amino acids 123-126 of FIG. 22A-C)
and continuing into IQLL (SEQ ID NO:26) of VEGFR3 (corresponding to
amino acids 127-130 of FIG. 22A-C).
[0139] For Ig domain 3 of VEGFR3, the 5' and 3' primers used for
RT-PCR were as follows: 5': R3D3.s
(ATCCAGCTGTTGCCCAGGAAGTCGCTGGAGCTGCTGGTA) (SEQ ID NO:27) 3':
R3D3.as (ATTTTCATGCACAATGACCTCGGTGCTCTCCCGAAATCG) (SEQ ID
NO:28).
[0140] Both the 5' and 3' amplification primers match the sequence
of VEGFR3. The 296 bp amplification product of this RT-PCR reaction
was isolated by standard techniques and subjected to a second round
of PCR to add suitable sequences to allow for fusion of the Flt1D2
with the Flk1D3 domains and fusion of the Flk1D3 and Fc domains via
a GPG bridge (see below). The amplification primers were as
follows:
5':Flt1D2.VEGFR3D3.s(TCATAGATATCCAGCTGTTGCCCAGGAAGT-CGCTGGAG) (SEQ
ID NO:29).sub.3': VEGFR3D3/srf.as
(GATAATGCCCGGGCCATTTTCATGCACA-ATGACCTCGGT) (SEQ ID NO:30).
[0141] The 5' amplification primer encodes the 3' end of Flt1 Ig
domain 2 fused directly to the beginning (5' end) of VEGFR3 Ig
domain 3, as described above. The 3' amplification primer encodes
the 3' end of VEGFR3 Ig domain 3, defined by the amino acids VIVHEN
(SEQ ID NO:31) (corresponding to amino acids 221-226 of FIG.
22A-C), followed by a bridging sequence that includes a recognition
sequence for Srf1, and encodes the amino acids GPG. The bridging
sequence corresponds to amino acids 227-229 of FIG. 22A-C.
[0142] After one round (for Flt1 Ig domain 2) or two rounds (for
Flt41 g domain 3) of PCR to produce the individual Ig domains, the
PCR products were combined in a tube and subjected to a further
round of PCR amplification with the amplification primers bsp/flt1
D2 and VEGFR3D3/srf.as described supra, to produce the fusion
product. This PCR product was subsequently digested with the
restriction enzymes BspEI and SmaI and the resulting 625 bp
fragment was subcloned into the BspEI to SrfI restriction sites of
the vector pMT21/Flt1.DELTA.B2.Fc (described supra), to create the
plasmid pMT21/Flt1D2.VEGFR3D3.Fc. The sequence of the
Flt1D2-VEGFR3D3 gene fusion insert was verified by standard
sequence analysis. This plasmid was then digested with the
restriction enzymes EcoRI and SrfI and the resulting 693 bp
fragment was subcloned into the EcoRI to SrfI restriction sites of
the plasmid pFlt1(1-3).DELTA.B2-Fc.DELTA.C1(a) to produce the
plasmid designated pFlt1D2.VEGFR3D3.Fc.DELTA.C1(a). The complete
DNA deduced amino acid sequence of the
Flt1D2.VEGFR3D3.Fc.DELTA.C1(a) chimeric molecule is set forth in
FIG. 22A-C.
Example 18
Extracellular Matrix Binding (ECM) Binding Assay
[0143] ECM-coated plates (Becton Dickinson catalog #35-4607) were
rehydrated with warm DME supplemented with glutamine (2 mM), 100 U
penicillin, 100 U streptomycin, and 10% BCS for at least 1 hr
before adding samples. The plates were then incubated for 1 hr at
room temperature with varying concentrations of
Flt1D2.Flk1D3.Fc.DELTA.C1(a) and Flt1D2.VEGFR3D3.Fc.DELTA.C1(a)
starting at 10 nM with subsequent 2-fold dilutions in PBS plus 10%
BCS. The plates were then washed 3 times with PBS plus 0.1%
Triton-X and incubated with alkaline phosphatase-conjugated
anti-human Fc antibody (Promega, 1:4000 in PBS plus 10% BCS) for 1
hr at room temperature. The plates were then washed 4 times with
PBS 0.1% Triton-X and alkaline phosphatase buffer/pNPP solution
(Sigma) was added for color development. Plates were read at
I=405-570 nm. The results of this experiment are shown in FIG. 23
and demonstrate that the Flt1D2.Flk1D3.Fc.DELTA.C1(a) and
Flt1D2.VEGFR3D3.Fc.DELTA.C1(a) proteins are considerably less
sticky to the ECM as compared to the Flt1(1-3)-Fc protein.
Example 19
Transient Expression of pFlt1D2.Flk1D3.Fc.DELTA.C1(a) in CHO-K1
(E1A) cells
[0144] A large scale (2 L) culture of E. coli DH10B cells carrying
the pFlt1D2.Flk1D3.Fc.DELTA.C1(a) plasmid described supra in
Example 17 was grown overnight in Terrific Broth (TB) plus 100
.mu.g/ml ampicillin. The next day, the plasmid DNA was extracted
using a QIAgen ENDOFREE.TM. Megaprep kit following the
manufacturer's protocol. The concentration of the purified plasmid
DNA was determined by standard techniques using a UV
spectrophotometer and fluorometer. The plasmid DNA was verified by
standard restriction enzyme digestion of aliquots using the
restriction enzymes EcoRI plus NotI and AseI. All restriction
enzyme digest fragments corresponded to the predicted sizes when
analyzed on a 1% agarose gel.
[0145] Forty 15 cm petri plates were seeded with CHO-K1/E1A cells
at a density of 4.times.10.sup.6 cells/plate. Plating media was
Gibco Ham's F-12 supplemented with 10% HYCLONE.TM. Fetal Bovine
Serum (FBS), 100 U penicillin/100 U streptomycin and glutamine (2
mM). The following day each plate of cells was transfected with 6
.mu.g of the pFlt1D2.Flk1D3.Fc.DELTA.C1(a) plasmid DNA using Gibco
Optimem and Gibco Lipofectamine in 12 ml volume, following the
manufacturer's protocol. Four hours after adding the transfection
mix to the cells, 12 ml/plate of Optimem supplemented with 10% FBS
was added. Plates were incubated at 37.degree. C. in a 5% CO.sub.2
incubator overnight. The following day the media was removed from
each plate and 25 ml expression media (Gibco CHO-S-SFM II
supplemented with glutamine (2 mM) and 1 mM sodium butyrate) was
added. The plates were incubated at 37.degree. C. for 3 days. After
3 days of incubation, the media was aspirated from each plate and
centrifuged at 400 rpm in a swinging bucket rotor to pellet cells.
The supernatant was decanted into sterile 1 L bottles and
purification of the expressed protein was performed as described
infra.
Example 20
Construction pVEGFR1R2-Fc.DELTA.C1(a) Expression Vector
[0146] The pVEGFR1R2.Fc.DELTA.C1(a) expression plasmid was
constructed by insertion of DNA encoding amino acids SDT
(corresponding to amino acids 27-29 of FIG. 24A-C) between
Flt1d2-Flk1d3-Fc.DELTA.C1(a) amino acids 26 and 27 of FIG. 21A-C
(GG) and removal of DNA encoding amino acids GPG corresponding to
amino acids 229-231. The SDT amino acid sequence is native to the
Flt1 receptor and was added back in to decrease the likelihood of
heterogeneous N-terminal processing. The GPG (bridging sequence)
was removed so that the Flt1 and Flk1 Ig domains were fused
directly to one another. The complete DNA and deduced amino acid
sequences of the pVEGFR1R2.Fc.DELTA.C1(a) chimeric molecule is set
forth in FIG. 24A-C.
Example 21
Cell Culture Process Used to Produce Modified Flt1 Receptors
[0147] Cell Culture Process Used to Produce
Flt1D2.Flk1D3.Fc.DELTA.C1(a). The process for production of
Flt1D2.Flk1D3.Fc.DELTA.C1(a) protein using the expression plasmid
pFlt1D2.Flk1D3.Fc.DELTA.C1(a) described supra in Example 1 involves
suspension culture of recombinant Chinese hamster ovary (CHO
K1/E1A) cells which constitutively express the protein product. The
cells are grown in bioreactors and the protein product is isolated
and purified by affinity and size exclusion chromatography. The
process is provided in greater detail below.
[0148] Cell Expansion. Two confluent T-225 cm.sup.2 flasks
containing the Flt1D2.Flk1D3.Fc.DELTA.C1(a) expressing cell line
were expanded by passaging cells into eight T-225 cm.sup.2 flasks
in medium (GMEM+10% serum, GIBCO) and incubated at 37.degree. C.
and 5% CO.sub.2. When the flasks approached confluence
(approximately 3 to 4 days) the cells were detached using trypsin.
Fresh medium was added to protect the cells from further exposure
to the trypsin. The cells were centrifuged and resuspended in fresh
medium then transferred to eight 850 cm.sup.2 roller bottles and
incubated at 37.degree. C. and 5% CO.sub.2 until confluent.
[0149] Suspension Culture in Bioreactors. Cells grown in roller
bottles were trypsinized to detach them from the surface and washed
with suspension culture medium. The cells are aseptically
transferred to a 5 L bioreactor (New Brunswick Celligen Plus) where
the cells are grown in 3.5 L of suspension culture. The suspension
culture medium was a glutamine-free low glucose modification of
IS-CHO (Irvine Scientific) to which 5% fetal bovine serum
(HYCLONE.TM.), GS supplement (Life Technologies) and 25 .mu.M
methionine sulfoximine (Sigma) was added. The pH was controlled at
7.2 by addition of carbon dioxide to the inlet gas or by addition
of a liquid solution of sodium carbonate to the bioreactor.
Dissolved oxygen level was maintained at 30% of saturation by
addition of oxygen or nitrogen to the inlet gas and temperature
controlled at 37.degree. C. When a density of 4.times.10.sup.6
cells/mL was reached the cells were transferred to a 40 L
bioreactor containing the same medium and setpoints for controlling
the bioreactor. The temperature setpoint was reduced to 34.degree.
C. to slow cell growth and increase the relative rate of protein
expression.
[0150] Cell Culture Process Used to Produce
Flt1D2.VEGFR3D3.Fc.DELTA.C1(a). The same methodologies as described
supra for Flt1D2.Flk1D3.Fc.DELTA.C1(a) were used to produce
Flt1D2.VEGFR3D3.Fc.DELTA.C1(a).
Example 22
Harvest and Purification of Modified Flt1 Receptors
[0151] Harvest and Purification of Flt1D2.Flk1D3.Fc.DELTA.C1(a).
The product protein was aseptically harvested from the bioreactor
while retaining cells using Millipore Prostak tangential-flow
filtration modules and a low-shear mechanical pump (Fristam). Fresh
medium was added to the bioreactor to replace that removed during
the harvest filtration. Approximately 40 L of harvest filtrate was
then loaded onto a 400 mL column containing Protein A SEPHAROSE.TM.
resin (Amersham Pharmacia). After loading the resin was washed with
buffer containing 10 mM sodium phosphate, 500 mM sodium chloride,
pH 7.2 to remove any unbound contaminating proteins.
Flt1D2.Flk1D3.Fc.DELTA.C1(a) protein was eluted with a pH 3.0
citrate buffer. The eluted protein was neutralized by addition of
Tris base and frozen at -20.degree. C.
[0152] Several frozen lots of Flt1D2.Flk1D3.Fc.DELTA.C1(a) protein
from the Protein A step above were thawed, pooled and concentrated
using a Millipore 30 kD nominal molecular weight cutoff (NMWCO)
tangential flow filtration membrane. The protein was transferred to
a stirred cell concentrator (Millipore) and further concentrated to
30 mg/mL using a 30 kD NMWCO membrane. The concentrated protein was
loaded onto a size exclusion column packed with SUPERDEX.TM. 200
resin (Amersham Pharmacia) that was equilibrated with phosphate
buffered saline plus 5% glycerol. The same buffer was used to run
the column. The fractions corresponding to
Flt1D2.Flk1D3.Fc.DELTA.C1(a) dimer were pooled, sterile filtered
through a 0.22 micron filter, aliquoted and frozen.
[0153] Harvest and Purification of Flt1D2.VEGFR3D3.Fc.DELTA.C1(a).
The same methodologies as described supra for
Flt1D2.Flk1D3.Fc.DELTA.C1(a) were used to harvest and purify
Flt1D2.VEGFR3D3.Fc.DELTA.C1(a).
Example 23
Phosphorylation Assay for Transiently Expressed VEGFR2
[0154] Primary human umbilical vein endothelial cells (HUVECs),
passage 4-6, were starved for 2 hrs in serum-free DME high glucose
media. Samples containing 40 ng/ml (1 nM) human VEGF165, which is a
ligand for the VEGF receptors Flt1, Flk1 and Flt4(VEGFR3) were
prepared and were preincubated for 1 hr at room temperature with
varying amounts of the modified Flt1 receptors Flt1(1-3)-Fc,
Flt1(1-3)-Fc (A40), Flt1D2Flk1D3.Fc.DELTA.C1(a) and
Flt1D2VEGFR3D3.Fc.DELTA.C1(a) in serum-free DME-high glucose media
containing 0.1% BSA. Cells were challenged for 5 minutes with the
samples prepared above +/-VEGF165, followed by whole cell lysis
using complete lysis buffer. Cell lysates were immunoprecipitated
with an antibody directed against the C-terminus of VEGFR2
receptor. The immunoprecipitated lysates were loaded onto 4-12%
SDS-PAGE Novex gel and then transferred to PVDF membrane using
standard transfer methodologies. Detection of phosphorylated VEGFR2
was done by immunoblotting with the anti-phospho Tyrosine mAb
called 4G10 (UBI) and developed using ECL-reagent (Amersham). FIGS.
25A-C and 26A-B show the results of this experiment. FIG. 25A-C
reveals that detection by Western blot of tyrosine phosphorylated
VEGFR2(Flk1) by VEGF165 ligand stimulation shows that cell-surface
receptors are phosphorylated to varying levels depending on which
modified Flt1 receptor is used during the preincubations with VEGF.
As is seen in FIG. 25A, at a 1.5 molar excess of either
Flt1(1-3)-Fc, Flt1(1-3)-Fc (A40) or transient
Flt1D2Flk1D3.Fc.DELTA.C1(a) there is complete blockage of receptor
stimulation by these three modified Flt1 receptors as compared to
control media challenge. In contrast, transient
Flt1D2VEGFR3D3.Fc.DELTA.C1(a) does not show significant blockage at
this molar excess, as compared with VEGF positive control
challenge. Similar results are seen in FIG. 25B, where the modified
Flt receptors are in a 3-fold molar excess to VEGF165 ligand. In
FIG. 25C, where the modified Flt1 receptors are in a 6-fold molar
excess to VEGF165 ligand, transient Flt1D2VEGFR3D3.Fc.DELTA.C1(a)
can now be shown to be partially blocking VEGF165-induced
stimulation of cell-surface receptors.
[0155] In FIG. 26A-26B, detection by Western blot of tyrosine
phosphorylated VEGFR2(Flk1) by VEGF165 ligand stimulation shows
that cell-surface receptors are not phosphorylated by challenge
samples which have VEGF165 preincubated with 1 and 2 fold molar
excess (FIG. 26A) or 3 and 4 fold molar excess (FIG. 26B) of either
transient Flt1D2Flk1D3.Fc.DELTA.C1(a), stable
Flt1D2Flk1D3.Fc.DELTA.C1(a), or transient VEGFR1R2-Fc.DELTA.C1(a).
At all modified Flt1 receptor concentrations tested there is
complete binding of VEGF165 ligand during the preincubation,
resulting in no detectable stimulation of cell-surface receptors by
unbound VEGF165 as compared to control media challenge.
Example 24
Cell Proliferation Bioassay
[0156] The test cell population is MG87 cells that have been stably
transfected with a expression plasmid that contains a DNA insert
encoding the VEGFR2(Flk1) extracellular domain fused to the TrkB
intracellular kinase domain, thus producing a chimeric molecule.
The reason the TrkB intracellular kinase domain was used rather
than the native VEGFR2(Flk1) intracellular kinase domain is that
the intracellular kinase domain of VEGFR2(Flk1) does not cause a
strong proliferative response when stimulated by VEGF165 in these
cells. It is known that MG87 cells containing full length TrkB
receptor give a robust proliferative response when stimulated with
BDNF, so the TrkB intracellular kinase domain was engineered to
replace the intracellular kinase domain of VEGFR2(Flk1) to take
advantage of this proliferative response capability.
[0157] Five thousand cells/well were plated in a 96 well plate and
allowed to settle for 2 hrs at 37.degree. C. The following modified
Flt receptors Flt1(1-3)-Fc, Flt1D2.Flk1D3.Fc.DELTA.C1(a) and
Flt1D2.VEGFR3D3.Fc.DELTA.C1(a), plus an irrelevant receptor termed
Tie2-Fc as a negative control, were titrated from 40 nM to 20 .mu.M
and incubated on the cells for 1 hr at 37.degree. C. Human
recombinant VEGF165 in defined media was then added to all the
wells at a concentration of 1.56 nM. The plates were incubated for
72 hrs at 37.degree. C. and then MTS (Owen's reagent, Promega)
added and the plates were incubated for an additional for 4 hrs.
Finally, the plates were read on a spectrophotometer at 450/570 nm.
The results of this experiment are shown in FIG. 27. The control
receptor Tie2-Fc does not block VEGF165-induced cell proliferation
at any concentration whereas Flt1D2.Flk1D3.Fc.DELTA.C1(a) blocks
1.56 nM VEGF165 with a half maximal dose of 0.8 nM. Flt1(1-3)-Fc
and Flt1D2.VEGFR3D3.Fc.DELTA.C1(a) are less effective in blocking
VEGF165 in this assay with a half maximal dose of .about.2 nM.
VEGF165 alone gives a reading of 1.2 absorbance units and the
background is 0.38 absorbance units.
Example 25
Binding Stoichiometry of Modified Flt Receptors to VEGF165
[0158] BIACORE.TM. Analysis. The stoichiometry of
Flt1D2Flk1D3.Fc.DELTA.C1(a) and VEGFR1R2-Fc.DELTA.C1(a) interaction
with human VEGF165 was determined by measuring either the level of
VEGF saturation binding to the Flt1D2Flk1D3.Fc.DELTA.C1(a) or
VEGFR1R2-Fc.DELTA.C1(a) surfaces or measuring concentration of
VEGF165 needed to completely prevent binding of
Flt1D2Flk1D3.Fc.DELTA.C1(a) or VEGFR1R2-Fc.DELTA.C1(a) to VEGF
BIACORE.TM. chip surface.
[0159] Modified Flt receptors Flt1D2Flk1D3.Fc.DELTA.C1(a) and
VEGFR1R2-Fc.DELTA.C1(a), were captured with an anti-Fc specific
antibody that was first immobilized on a BIACORE.TM. chip using
amine-coupling chemistry. A blank antibody surface was used as a
negative control. VEGF165 was injected at a concentration of 1 nM,
10 nM, and 50 nM over the Flt1D2Flk1D3.Fc.DELTA.C1(a) and
VEGFR1R2-Fc.DELTA.C1(a) surfaces at 10 .mu.l/min for one hour. A
real-time binding signal was recorded and saturation binding was
achieved at the end of each injection. Binding stoichiometry was
calculated as a molar ratio of bound VEGF165 to the immobilized
Flt1D2Flk1D3.Fc.DELTA.C1(a) or VEGFR1R2-Fc.DELTA.C1(a), using the
conversion factor of 1000 RU equivalent to 1 ng/ml. The results
indicated binding stoichiometry of one VEGF165 dimeric molecule per
one Flt1D2Flk1D3.Fc.DELTA.C1(a) or VEGFR1R2-Fc.DELTA.C1(a) molecule
(FIG. 28).
[0160] In solution, Flt1D2Flk1D3.Fc.DELTA.C1(a) or
VEGFR1R2-Fc.DELTA.C1(a) at a concentration of 1 nM (estimated to be
1000 times higher than the KD of the Flt1D2Flk1D3.Fc.DELTA.C1(a) or
VEGFR1R2-Fc.DELTA.C1(a)/VEGF165 interaction) were mixed with varied
concentrations of VEGF165. After one hour incubation,
concentrations of the free Flt1D2Flk1D3.Fc.DELTA.C1(a) in solution
were measured as a binding signal to an amine-coupled VEGF165
surface. A calibration curve was used to convert the
Flt1D2Flk1D3.Fc.DELTA.C1(a) BIACORE.TM. binding signal to its molar
concentration. The data showed that the addition of 1 nM VEGF165
into the Flt1D2Flk1D3.Fc.DELTA.C1(a) solution completely blocked
Flt1D2Flk1D3.Fc.DELTA.C1(a) binding to the VEGF165 surface. This
result suggested the binding stoichiometry of one VEGF165 molecule
per one Flt1D2Flk1D3.Fc.DELTA.C1(a) molecule (FIG. 29 and FIG. 30).
When the concentration of Flt1D2Flk1D3.Fc.DELTA.C1(a) was plotted
as a function of added concentration of VEGF165, the slope of the
linear portion was -1.06 for Flt1D2Flk1D3.Fc.DELTA.C1 (a) and -1.07
for VEGFR1R2-Fc.DELTA.C1(a). The magnitude of the slope, very close
to negative one, was indicative that one molecule of VEGF165 bound
to one molecule of either Flt1D2Flk1D3.Fc.DELTA.C1(a) or
VEGFR1R2-Fc.DELTA.C1(a).
[0161] Size Exclusion Chromatography. Flt1D2Flk1D3.Fc.DELTA.C1(a)
was mixed with a 3-fold excess of VEGF165 and the receptor-ligand
complex was purified using a Pharmacia SUPEROSE.TM. 6 size
exclusion chromatography column. The receptor-ligand complex was
then incubated in a buffer containing 6 M guanidine hydrochloride
in order to dissociate it into its component proteins.
Flt1D2Flk1D3.Fc.DELTA.C1(a) was separated from VEGF165 using
SUPEROSE.TM. 6 size exclusion chromatography column run in 6 M
guanidium chloride. In order to determine complex stoichiometry,
several injections of Flt1D2Flk1D3.Fc.DELTA.C1(a) and VEGF165 were
made and peak height or peak integrated intensity was plotted as a
function of the concentration of injected protein. The calibration
was done under condition identical to one used in separating
components of Flt1D2Flk1D3.Fc.DELTA.C1(a)/VEGF complex.
Quantification of the Flt1D2Flk1D3.Fc.DELTA.C1(a)/VEGF complex
composition was based on the calibration curves. FIG. 28 shows the
ratio of VEGF165 to Flt1D2Flk1D3.Fc.DELTA.C1(a) in a complex to be
1:1.
Example 26
Determination of the Binding Stoichiometry of
Flt1D2Flk1D3.Fc.DELTA.C1(a)/VEGF165 Complex by Size Exclusion
Chromatography
[0162] Flt1D2Flk1D3.Fc.DELTA.C1(a)/VEGF165 Complex Preparation.
VEGF165 (concentration=3.61 mg/ml) was mixed with CHO cell
transiently expressed Flt1D2.Flk1D3.Fc.DELTA.C1(a)
(concentration=0.9 mg/ml) in molar ratio of 3:1
(VEGF165:Flt1D2.Flk1D3.Fc.DELTA.C1(a)) and incubated overnight at
4.degree. C.
[0163] Size Exclusion Chromatography (SEC) under native conditions.
To separate the complex from excess of unbound VEGF165, 50 .mu.l of
the complex was loaded on a Pharmacia SUPEROSE.TM. 12 PC 3.2/30
which was equilibrated in PBS buffer. The sample was eluted with
the same buffer at flow rate 40 .mu.l/min. at room temperature. The
results of this SEC are shown in FIG. 31. Peak #1 represents the
complex and peak #2 represents unbound VEGF165. Fractions eluted
between 1.1 and 1.2 ml were combined and guanidinium hydrochloride
(GuHCl) was added to a final concentration 4.5 M to dissociate the
complex.
[0164] Size Exclusion Chromatography (SEC) under dissociative
conditions. To separate the components of the receptor-ligand
complex and to determine their molar ratio, 50 .mu.l of dissociated
complex as described supra was loaded onto a SUPEROSE.TM. 12 PC
3.2/30 equilibrated in 6 M GuHCl and eluted with the same solution
at a flow rate 40 p|/min at room temperature. The results of this
SEC are shown in FIG. 32. Peak #1 represents
Flt1D2Flk1D3.Fc.DELTA.C1(a) and peak #2 represents VEGF165.
[0165] Calculation of Flt1D2Flk1D3.Fc.DELTA.C1(a):VEGF165 Complex
Stoichiometry. The stoichiometry of the receptor-ligand complex was
determined from the peak area or the peak height of the components.
Concentrations of VEGF165 and Flt1D2Flk1D3.Fc.DELTA.C1(a)
corresponding to the peak height or peak area, respectively, were
obtained from the standard curves for VEGF165 and
Flt1D2Flk1D3.Fc.DELTA.C1(a). To obtain a standard curve, four
different concentrations (0.04 mg/ml-0.3 mg/ml) of either component
were injected onto a Pharmacia SUPEROSE.TM. 12 PC 3.2/30 column
equilibrated in 6 M guanidinium chloride and eluted with the same
solution at flow rate 40 p|/min at room temperature. The standard
curve was obtained by plotting peak area or peak height vs protein
concentration. The molar ratio of
VEGF165:Flt1D2Flk1D3.Fc.DELTA.C1(a) determined from the peak area
of the components was 1.16. The molar ratio of
VEGF165:Flt1D2Flk1D3.Fc.DELTA.C1(a) determined from the peak height
of the components was 1.10.
Example 27
Determination of the Stoichiometry of the
Flt1D2Flk1D3.Fc.DELTA.C1(a)/VEGF165 Complex by Size Exclusion
Chromatography with On-Line Light Scattering
[0166] Complex preparation. VEGF165 was mixed with CHO transiently
expressed Flt1D2.Flk1D3.Fc.DELTA.C1(a) protein in molar ratio of
3:1 (VEGF165:Flt1D2Flk1D3.Fc.DELTA.C1(a)) and incubated overnight
at 4.degree. C.
[0167] Size Exclusion Chromatography (SEC) with On-Line Light
Scattering. Size exclusion chromatography column with a MiniDawn
on-line light scattering detector (Wyatt Technology, Santa Barbara,
Calif.) and refractive index (R1) detectors (Shimadzu, Kyoto,
Japan) was used to determine the molecular weight (MW) of the
receptor-ligand complex. Samples were injected onto a SUPEROSE.TM.
12 HR 10/30 column (Pharmacia) equilibrated in PBS buffer and
eluted with the same buffer at flow rate 0.5 ml/min. at room
temperature. As shown in FIG. 33, the elution profile shows two
peaks. Peak #1 represents the receptor-ligand complex and peak #2
represents the unbound VEGF165. MW was calculated from LS and R1
signals. The same procedure was used to determine MW of the
individual components of the receptor-ligand complex. The results
of these determinations are as follows: MW of the
Flt1D2Flk1D3.Fc.DELTA.C1(a)/VEGF165 complex at the peak position is
157 300 (FIG. 33), the MW of VEGF165 at the peak position is 44 390
(FIG. 34) and the MW of R1R2 at the peak is 113 300 (FIG. 35).
[0168] These data indicated that the stoichiometry of the
Flt1D2Flk1D3.Fc.DELTA.C1(a)/VEGF complex is 1:1 as its corresponds
to the sum of molecular weights for Flt1D2Flk1D3.Fc.DELTA.C1(a) and
VEGF165. Importantly, this method conclusively proved that the
Flt1D2Flk1D3.Fc.DELTA.C1(a)/VEGF165 complex was indeed composed of
only one molecule of VEGF165 ligand and only one molecule of the
Flt1D2Flk1D3.Fc.DELTA.C1(a).
Example 28
Peptide Mapping of Flt1D2.Flk1D3.Fc.DELTA.C1(a)
[0169] The disulfide structures and glycosylation sites in
Flt1D2.Flk1D3.Fc.DELTA.C1(a) were determined by a peptide mapping
method. In this method, the protein was first cleaved with trypsin.
Tryptic fragments were analyzed and identified by HPLC coupled with
mass spectrometry, in addition to an N-terminal sequencing
technique. Reduction of the tryptic digest was employed to help
identify disulfide-bond-containing fragments. Treatment of the
tryptic digest with PNGase F (Glyko, Novato, Calif.) was employed
to help identify fragments with N-linked glycosylation sites. The
results are summarized in the accompanying FIG. 36.
[0170] There are a total of ten cysteines in
Flt1D2.Flk1D3.Fc.DELTA.C1(a); six of them belong to the Fc region.
Cys27 has been confirmed to be disulfide bonded to Cys76. Cys121 is
confirmed to be disulfide bonded to Cys182. The first two cysteines
in the Fc region (Cys211 and Cys214) form an intermolecular
disulfide bond with the same two cysteines in another Fc chain.
However, because these two cysteines can not be separated
enzymatically from each other, it can not be determined whether
disulfide bonding is occurring between same cysteines (Cys211 to
Cys211, for example) or between Cys211 and Cys214. Cys216 is
confirmed to be disulfide bonded to Cys306. Cys352 is confirmed to
be disulfide bonded to Cys410.
[0171] There are five possible N-linked glycosylation sites in
Flt1D2.Flk1D3.Fc.DELTA.C1(a). All five of them are found to be
glycosylated to varying degrees. Complete glycosylation was
observed at Asn33 (amino acid sequence NIT), Asn193 (amino acid
sequence NST), and Asn282 (amino acid sequence NST). In addition,
partial glycosylation is observed on Asn65 and Asn120. Sites of
glycosylation are highlighted by underline in the FIG. 36.
Example 29
Pharmacokinetic Analysis of Modified Flt Receptors
[0172] Pharmacokinetic analysis of Flt1(1-3)-Fc (A40),
Flt1D2.Flk1D3.Fc.DELTA.C1(a) and VEGFR1R2-Fc.DELTA.C1(a). Balb/c
mice (25-30 g) were injected subcutaneously with 4 mg/kg of
Flt1(1-3)-Fc (A40), CHO transiently expressed
Flt1D2.Flk1D3.Fc.DELTA.C1(a), CHO stably expressed
Flt1D2.Flk1D3.Fc.DELTA.C1(a), and CHO transiently expressed
VEGFR1R2-Fc.DELTA.C1(a). The mice were tail bled at 1, 2, 4, 6, 24
hrs, 2 days, 3 days and 6 days after injection. The sera were
assayed in an ELISA designed to detect Flt1(1-3)-Fc (A40),
Flt1D2.Flk1D3.Fc.DELTA.C1(a) or VEGFR1R2-Fc.DELTA.C1(a). The ELISA
involves coating an ELISA plate with VEGF165, binding the detect
Flt1(1-3)-Fc (A40), Flt1D2.Flk1D3.Fc.DELTA.C1(a) or
VEGFR1R2-Fc.DELTA.C1(a) and reporting with an anti-Fc antibody
linked to horse radish peroxidase. The results of this experiments
are shown in FIG. 37. The T.sub.max for Flt1(1-3)-Fc (A40) was at 6
hrs while the T.sub.max for the transient and stable
Flt1D2.Flk1D3.Fc.DELTA.C1(a) and the transient
VEGFR1R2-Fc.DELTA.C1(a) was 24 hrs. The C.sub.max for Flt1(1-3)-Fc
(A40) was 8 .mu.g/ml. For both transients
(Flt1D2.Flk1D3.Fc.DELTA.C1(a) and VEGFR1R2-Fc.DELTA.C1(a)) the
C.sub.max was 18 .mu.g/ml and the C.sub.max for the stable
VEGFR1R2-Fc.DELTA.C1(a) was 30 .mu.g/ml.
[0173] Pharmacokinetic analysis of Flt1(1-3)-Fc (A40),
Flt1D2.Flk1D3.Fc.DELTA.C1(a) and Flt1D2.VEGFR3D3.Fc.DELTA.C1(a).
Balb/c mice (25-30 g) were injected subcutaneously with 4 mg/kg of
Flt1(1-3)-Fc (A40), CHO transiently expressed
Flt1D2.Flk1D3.Fc.DELTA.C1(a) and CHO transiently expressed
Flt1D2.VEGFR3D3.Fc.DELTA.C1(a). The mice were tail bled at 1, 2, 5,
6, 7, 8, 12, 15 and 20 days after injection. The sera were assayed
in an ELISA designed to detect Flt1(1-3)-Fc,
Flt1D2.Flk1D3.Fc.DELTA.C1(a) and Flt1D2.VEGFR3D3.Fc.DELTA.C1(a).
The ELISA involves coating an ELISA plate with VEGF 165, binding
the Flt1(1-3)-Fc, Flt1D2.Flk1D3.Fc.DELTA.C1(a) or
Flt1D2.VEGFR3D3.Fc.DELTA.C1(a) and reporting with an anti-Fc
antibody linked to horse radish peroxidase. Flt1(1-3)-Fc (A40)
could no longer be detected in the serum after day 5 whereas,
Flt1D2.Flk1D3.Fc.DELTA.C1(a) and Flt1D2.VEGFR3D3.Fc.DELTA.C1(a)
were detectable for 15 days or more. The results of this experiment
are shown in FIG. 38.
Example 30
Ability of Flt1D2.Flk1D3.Fc.DELTA.C1(a) to Inhibit Tumor Growth In
Vivo
[0174] To evaluate the ability of Flt1D2.Flk1D3.Fc.DELTA.C1(a) to
inhibit tumor growth in vivo a model in which tumor cell
suspensions are implanted subcutaneously on the right flank of male
severe combined immunodeficiency (SCID) mice was employed. Two cell
lines, the human HT-1080 fibrosarcoma cell line (ATCC accession no.
CCL-121) and the rat C6 glioma cell line (ATCC accession no.
CCL-107), each of which exhibit distinctly different morphologies
and growth characteristics, were used in the assay. The first dose
of Flt1D2.Flk1D3.Fc.DELTA.C1(a) (at 25 mg/Kg or as indicated in
FIGS. 39 and 40) was given on the day of tumor implantation.
Animals subsequently received subcutaneous injections of
Flt1(1-3)-Fc (A40), Flt1D2.Flk1D3.Fc.DELTA.C1(a) or vehicle either
every other day (Ea)) or two times per week (2.times./wk) for a
period of 2 weeks. After 2 weeks, animals were perfused with
fixative, tumors were removed and samples were blinded. Tumor
volume was determined by measuring the length and width of visible
subcutaneous tumors. Both of Flt1(1-3)-Fc (A40) and
Flt1D2.Flk1D3.Fc.DELTA.C1(a) significantly reduced the growth of
tumors formed by HT-1080 and C6 cells. The results of these
experiments are shown in FIG. 39 and FIG. 40.
Example 31
Effect of VEGF165 and Modified Flt Receptors in Female Reproductive
System
[0175] The stereotypic pattern of vascular remodeling which occur
in the uterus and ovary over the course of the reproductive cycle
has been well characterized, making these tissues particularly well
suited to the study of mechanisms which regulate angiogenesis,
vascular remodeling and vascular regression. Indeed, in situ
hybridization studies in the reproductive tissues provided the
first clear evidence that VEGF acts as a mediator of physiological
angiogenesis in mature rodents, as well as humans and non-human
primates. As cyclic angiogenesis and vascular remodeling are
prominent features of the normal ovary and uterus, it is not
surprising that abnormal blood vessel growth and/or vascular
dysfunction have been found to characterize many pathological
conditions which affect these organs. Furthermore, these pathogenic
vascular abnormalities are thought to be caused or perpetuated by
the dysregulated expression of one or more angiogenic or
anti-angiogenic factors, most prominently VEGF.
[0176] For example, abnormal angiogenesis is characteristic of
polycystic ovary disease, endometriosis and endometrial carcinoma,
and in each case VEGF is over expressed in the affected tissue.
Overexpression of VEGF is also thought to play a pathogenic role in
the establishment of systemic vascular hyperpermeability in ovarian
hyperstimulation syndrome. In addition, VEGF has been implicated as
the permeability factor responsible for the production of ascites
associated with ovarian carcinoma and other. Agents which
effectively neutralize the biological actions of VEGF can
reasonably be anticipated to be of therapeutic benefit in the above
and related conditions.
[0177] Angiogenesis and vascular remodeling are also hallmarks of
blastocyst implantation and placental development. VEGF is strongly
expressed both in the maternal decidua and in embryonic
trophoblasts, where it is thought to first stimulate expansion and
hyperpermeability of the uterine vasculature during the
peri-implantation period and subsequently mediate formation of both
the maternal and embryonic components of the placental vasculature.
VEGF is also required for luteal angiogenesis and associated
progesterone secretion necessary to prepare the uterus for
implantation. Thus, agents which inhibit the biological actions of
VEGF may prove to be useful as contraceptive agents (by preventing
implantation), or as an abortifacients in the early stages of
gestation. The latter application might find particular use as a
non-surgical intervention for the termination of ectopic
pregnancies.
[0178] While the expression of VEGF receptors is largely confined
to the vascular endothelium in normal reproductive tissues, Flt1 is
also expressed by trophoblasts in the placenta in both humans and
animals where it has been proposed to play a role in trophoblast
invasion. Interestingly, both Flt1 and KDR (Flk1) are expressed by
choriocarcinoma cell line BeWo, and VEGF has been shown to promote
DNA synthesis and tyrosine phosphorylation of MAP kinase in these
cells. Furthermore, primary and metastatic ovarian carcinomas not
only to express high levels of VEGF, but--in addition to the
vascular endothelium--the tumor cells themselves express KDR and/or
Flt1. These findings suggest that VEGF may not only be critically
involved in the generation and maintenance of tumor vasculature,
but that at least in some tumors of reproductive origin VEGF may
subserve an autocrine role, directly supporting the survival and
proliferation of the tumor cells. Thus agents which block the
actions of VEGF may have particularly beneficial applications to
the treatment of tumors of reproductive origin.
[0179] Assessment of VEGF-Induced Uterine Hyperpermeability.
Pregnant mare's serum gonadotrophin (PMSG) was injected
subcutaneously (5 IU) to induce ovulation in prepubertal female
rats. This results in a surge of estradiol after 2 days which in
turn causes an induction of VEGF in the uterus. It is reported that
this induction results in hyperpermeability of the uterus and an
increase in uterine wet weight 6 hrs. later and, therefore, could
potentially be blocked by the modified Flt receptors Flt1(1-3)-Fc
(A40), Flt1D2.Flk1D3.Fc.DELTA.C1(a) and
Flt1D2.VEGFR3D3.Fc.DELTA.C1(a). In this in vivo model, the normal
weight of the rat uterus is about 50 mg and this can be induced to
300-350 mg by PMSG. Desiccation of the tissue reveals that this is
all water weight. Subcutaneous injection of Flt1(1-3)-Fc (A40),
Flt1D2.Flk1D3.Fc.DELTA.C1(a) and Flt1D2.VEGFR3D3.Fc.DELTA.C1(a) at
25 mg/kg at 1 hr after PMSG injection results in about a 50%
inhibition of the increase in uterine wet weight. Increasing the
dose of modified Flt receptor does not further reduce the increase
in wet weight suggesting that there is a VEGF-independent component
to this model. The results of this experiment are shown in FIG.
41.
[0180] Assessment of corpus luteum angiogenesis using progesterone
as a readout. Pregnant mare's serum gonadotrophin (PMSG) is
injected subcutaneously (5 IU) to induce ovulation in prepubertal
female rats. This results in a fully functioning corpus luteum
containing a dense network of blood vessels after 4 days that
allows for the secretion of progesterone into the blood stream in
order to prepare the uterus for implantation. The induction of
angiogenesis in the corpus luteum requires VEGF; therefore,
blocking VEGF would result in a lack of new blood vessels and thus
a lack of progesterone secreted into the blood stream. In this in
vivo model, resting levels of progesterone are about 5 ng/ml and
this can be induced to a level of 25-40 ng/ml after PMSG.
Subcutaneous injection of Flt1(1-3)-Fc (A40) or
Flt1D2.Flk1D3.Fc.DELTA.C1(a) at 25 mg/kg or 5 mg/kg at 1 hr after
PMSG injection results in a complete inhibition of the progesterone
induction on day 4. The results of this experiment are shown in
FIG. 42A-B.
Example 33
Pharmacokinetic Analysis of Flt1(1-3)-Fc (A40) and Pegylated
Flt1(1-3)-Fc
[0181] Flt1(1-3)-Fc was PEGylated with either 10 kD PEG or 20 kD
PEG and tested in balb/c mice for their pharmacokinetic profile.
Both PEGylated forms of Flt1(1-3)-Fc were found to have much better
PK profiles than Flt1(1-3)-Fc (A40), with the T.sub.max occurring
at 24 hrs for the PEGylated molecules as opposed to 6 hrs for
Flt1(1-3)-Fc (A40).
Example 34
VEGF165 ELISA to Test Affinity of Modified Flt1 Receptor
Variants
[0182] Ten pM of VEGF165 was incubated overnight at room
temperature with modified Flt1 receptor variants ranging from 160
.mu.M to 0.1 .mu.M. The modified Flt1 receptor variants used in
this experiment were Flt1(1-3)-Fc, Flt1(1-3)-Fc (A40), transiently
expressed Flt1D2Flk1D3.Fc.DELTA.C1(a), transiently expressed
Flt1D2VEFGFR3D3-Fc.DELTA.C1(a), Flt1-(1-3)-Fc,
Flt1(1-3.sub.R->C)-Fc and Tie2-Fc. Flt1(1-3.sub.NAS)-Fc is a
modified version of Flt1(1-3)-Fc in which the highly basic amino
acid sequence KNKRASVRRR (SEQ ID NO:32) is replaced by NASVNGSR
(SEQ ID NO:33), resulting in the incorporation of two new
glycosylation sites and a net reduction of five positive charges,
both with the purpose of reducing the unfavorable effects of this
sequence on PK. Flt1(1-3.sub.R->c)-Fc is a modification in which
a single arginine (R) residue within the same basic amino acid
sequence is changed to a cysteine (C) (KNKRASVRRR (SEQ D
NO:36)->KNKCASVRRR (SEQ ID NO:34)) to allow for pegylation at
that residue, which could then shield the basic region from
exerting its unfavorable effects on PK. After incubation the
solution was transferred to a plate containing a capture antibody
for VEGF165 (R&D). The amount of free VEGF165 was then
determined using an antibody to report free VEGF165. This showed
that the modified Flt1 receptor variant with the highest affinity
for VEGF165 (determined as the lowest amount of free VEGF165) was
Flt1D2Flk1D3.Fc.DELTA.C1(a), followed by Flt1(1-3)-Fc and
Flt1(1-3)-Fc (A40) and then by Flt1(1-3.sub.R->C)-Fc,
Flt1(1-3.sub.NAS)-Fc and Flt1D2VEFGFR3D3-Fc.DELTA.C1(a). Tie2Fc has
no affinity for VEGF165.
Sequence CWU 1
1
3811704DNAHomo sapiensCDS(1)...(1701) 1atggtcagct actgggacac
cggggtcctg ctgtgcgcgc tgctcagctg tctgcttctc 60acaggatcta gttcaggttc
aaaattaaaa gatcctgaac tgagtttaaa aggcacccag 120cacatcatgc
aagcaggcca gacactgcat ctccaatgca ggggggaagc agcccataaa
180tggtctttgc ctgaaatggt gagtaaggaa agcgaaaggc tgagcataac
taaatctgcc 240tgtggaagaa atggcaaaca attctgcagt actttaacct
tgaacacagc tcaagcaaac 300cacactggct tctacagctg caaatatcta
gctgtaccta cttcaaagaa gaaggaaaca 360gaatctgcaa tctatatatt
tattagtgat acaggtagac ctttcgtaga gatgtacagt 420gaaatccccg
aaattataca catgactgaa ggaagggagc tcgtcattcc ctgccgggtt
480acgtcaccta acatcactgt tactttaaaa aagtttccac ttgacacttt
gatccctgat 540ggaaaacgca taatctggga cagtagaaag ggcttcatca
tatcaaatgc aacgtacaaa 600gaaatagggc ttctgacctg tgaagcaaca
gtcaatgggc atttgtataa gacaaactat 660ctcacacatc gacaaaccaa
tacaatcata gatgtccaaa taagcacacc acgcccagtc 720aaattactta
gaggccatac tcttgtcctc aattgtactg ctaccactcc cttgaacacg
780agagttcaaa tgacctggag ttaccctgat gaaaaaaata agagagcttc
cgtaaggcga 840cgaattgacc aaagcaattc ccatgccaac atattctaca
gtgttcttac tattgacaaa 900atgcagaaca aagacaaagg actttatact
tgtcgtgtaa ggagtggacc atcattcaaa 960tctgttaaca cctcagtgca
tatatatgat aaagcaggcc cgggcgagcc caaatcttgt 1020gacaaaactc
acacatgccc accgtgccca gcacctgaac tcctgggggg accgtcagtc
1080ttcctcttcc ccccaaaacc caaggacacc ctcatgatct cccggacccc
tgaggtcaca 1140tgcgtggtgg tggacgtgag ccacgaagac cctgaggtca
agttcaactg gtacgtggac 1200ggcgtggagg tgcataatgc caagacaaag
ccgcgggagg agcagtacaa cagcacgtac 1260cgtgtggtca gcgtcctcac
cgtcctgcac caggactggc tgaatggcaa ggagtacaag 1320tgcaaggtct
ccaacaaagc cctcccagcc cccatcgaga aaaccatctc caaagccaaa
1380gggcagcccc gagaaccaca ggtgtacacc ctgcccccat cccgggatga
gctgaccaag 1440aaccaggtca gcctgacctg cctggtcaaa ggcttctatc
ccagcgacat cgccgtggag 1500tgggagagca atgggcagcc ggagaacaac
tacaagacca cgcctcccgt gctggactcc 1560gacggctcct tcttcctcta
cagcaagctc accgtggaca agagcaggtg gcagcagggg 1620aacgtcttct
catgctccgt gatgcatgag gctctgcaca accactacac gcagaagagc
1680ctctccctgt ctccgggtaa atga 17042567PRTHomo sapiens 2Met Val Ser
Tyr Trp Asp Thr Gly Val Leu Leu Cys Ala Leu Leu Ser 1 5 10 15Cys
Leu Leu Leu Thr Gly Ser Ser Ser Gly Ser Lys Leu Lys Asp Pro 20 25
30Glu Leu Ser Leu Lys Gly Thr Gln His Ile Met Gln Ala Gly Gln Thr
35 40 45Leu His Leu Gln Cys Arg Gly Glu Ala Ala His Lys Trp Ser Leu
Pro 50 55 60Glu Met Val Ser Lys Glu Ser Glu Arg Leu Ser Ile Thr Lys
Ser Ala65 70 75 80Cys Gly Arg Asn Gly Lys Gln Phe Cys Ser Thr Leu
Thr Leu Asn Thr 85 90 95Ala Gln Ala Asn His Thr Gly Phe Tyr Ser Cys
Lys Tyr Leu Ala Val 100 105 110Pro Thr Ser Lys Lys Lys Glu Thr Glu
Ser Ala Ile Tyr Ile Phe Ile 115 120 125Ser Asp Thr Gly Arg Pro Phe
Val Glu Met Tyr Ser Glu Ile Pro Glu 130 135 140Ile Ile His Met Thr
Glu Gly Arg Glu Leu Val Ile Pro Cys Arg Val145 150 155 160Thr Ser
Pro Asn Ile Thr Val Thr Leu Lys Lys Phe Pro Leu Asp Thr 165 170
175Leu Ile Pro Asp Gly Lys Arg Ile Ile Trp Asp Ser Arg Lys Gly Phe
180 185 190Ile Ile Ser Asn Ala Thr Tyr Lys Glu Ile Gly Leu Leu Thr
Cys Glu 195 200 205Ala Thr Val Asn Gly His Leu Tyr Lys Thr Asn Tyr
Leu Thr His Arg 210 215 220Gln Thr Asn Thr Ile Ile Asp Val Gln Ile
Ser Thr Pro Arg Pro Val225 230 235 240Lys Leu Leu Arg Gly His Thr
Leu Val Leu Asn Cys Thr Ala Thr Thr 245 250 255Pro Leu Asn Thr Arg
Val Gln Met Thr Trp Ser Tyr Pro Asp Glu Lys 260 265 270Asn Lys Arg
Ala Ser Val Arg Arg Arg Ile Asp Gln Ser Asn Ser His 275 280 285Ala
Asn Ile Phe Tyr Ser Val Leu Thr Ile Asp Lys Met Gln Asn Lys 290 295
300Asp Lys Gly Leu Tyr Thr Cys Arg Val Arg Ser Gly Pro Ser Phe
Lys305 310 315 320Ser Val Asn Thr Ser Val His Ile Tyr Asp Lys Ala
Gly Pro Gly Glu 325 330 335Pro Lys Ser Cys Asp Lys Thr His Thr Cys
Pro Pro Cys Pro Ala Pro 340 345 350Glu Leu Leu Gly Gly Pro Ser Val
Phe Leu Phe Pro Pro Lys Pro Lys 355 360 365Asp Thr Leu Met Ile Ser
Arg Thr Pro Glu Val Thr Cys Val Val Val 370 375 380Asp Val Ser His
Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp385 390 395 400Gly
Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr 405 410
415Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp
420 425 430Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys
Ala Leu 435 440 445Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys
Gly Gln Pro Arg 450 455 460Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser
Arg Asp Glu Leu Thr Lys465 470 475 480Asn Gln Val Ser Leu Thr Cys
Leu Val Lys Gly Phe Tyr Pro Ser Asp 485 490 495Ile Ala Val Glu Trp
Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys 500 505 510Thr Thr Pro
Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser 515 520 525Lys
Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser 530 535
540Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys
Ser545 550 555 560Leu Ser Leu Ser Pro Gly Lys 56531674DNAHomo
sapiensCDS(1)...(1671) 3atggtcagct actgggacac cggggtcctg ctgtgcgcgc
tgctcagctg tctgcttctc 60acaggatcta gttcaggttc aaaattaaaa gatcctgaac
tgagtttaaa aggcacccag 120cacatcatgc aagcaggcca gacactgcat
ctccaatgca ggggggaagc agcccataaa 180tggtctttgc ctgaaatggt
gagtaaggaa agcgaaaggc tgagcataac taaatctgcc 240tgtggaagaa
atggcaaaca attctgcagt actttaacct tgaacacagc tcaagcaaac
300cacactggct tctacagctg caaatatcta gctgtaccta cttcaaagaa
gaaggaaaca 360gaatctgcaa tctatatatt tattagtgat acaggtagac
ctttcgtaga gatgtacagt 420gaaatccccg aaattataca catgactgaa
ggaagggagc tcgtcattcc ctgccgggtt 480acgtcaccta acatcactgt
tactttaaaa aagtttccac ttgacacttt gatccctgat 540ggaaaacgca
taatctggga cagtagaaag ggcttcatca tatcaaatgc aacgtacaaa
600gaaatagggc ttctgacctg tgaagcaaca gtcaatgggc atttgtataa
gacaaactat 660ctcacacatc gacaaaccaa tacaatcata gatgtccaaa
taagcacacc acgcccagtc 720aaattactta gaggccatac tcttgtcctc
aattgtactg ctaccactcc cttgaacacg 780agagttcaaa tgacctggag
ttaccctgat gaaattgacc aaagcaattc ccatgccaac 840atattctaca
gtgttcttac tattgacaaa atgcagaaca aagacaaagg actttatact
900tgtcgtgtaa ggagtggacc atcattcaaa tctgttaaca cctcagtgca
tatatatgat 960aaagcaggcc cgggcgagcc caaatcttgt gacaaaactc
acacatgccc accgtgccca 1020gcacctgaac tcctgggggg accgtcagtc
ttcctcttcc ccccaaaacc caaggacacc 1080ctcatgatct cccggacccc
tgaggtcaca tgcgtggtgg tggacgtgag ccacgaagac 1140cctgaggtca
agttcaactg gtacgtggac ggcgtggagg tgcataatgc caagacaaag
1200ccgcgggagg agcagtacaa cagcacgtac cgtgtggtca gcgtcctcac
cgtcctgcac 1260caggactggc tgaatggcaa ggagtacaag tgcaaggtct
ccaacaaagc cctcccagcc 1320cccatcgaga aaaccatctc caaagccaaa
gggcagcccc gagaaccaca ggtgtacacc 1380ctgcccccat cccgggatga
gctgaccaag aaccaggtca gcctgacctg cctggtcaaa 1440ggcttctatc
ccagcgacat cgccgtggag tgggagagca atgggcagcc ggagaacaac
1500tacaagacca cgcctcccgt gctggactcc gacggctcct tcttcctcta
cagcaagctc 1560accgtggaca agagcaggtg gcagcagggg aacgtcttct
catgctccgt gatgcatgag 1620gctctgcaca accactacac gcagaagagc
ctctccctgt ctccgggtaa atga 16744557PRTHomo sapiens 4Met Val Ser Tyr
Trp Asp Thr Gly Val Leu Leu Cys Ala Leu Leu Ser 1 5 10 15Cys Leu
Leu Leu Thr Gly Ser Ser Ser Gly Ser Lys Leu Lys Asp Pro 20 25 30Glu
Leu Ser Leu Lys Gly Thr Gln His Ile Met Gln Ala Gly Gln Thr 35 40
45Leu His Leu Gln Cys Arg Gly Glu Ala Ala His Lys Trp Ser Leu Pro
50 55 60Glu Met Val Ser Lys Glu Ser Glu Arg Leu Ser Ile Thr Lys Ser
Ala65 70 75 80Cys Gly Arg Asn Gly Lys Gln Phe Cys Ser Thr Leu Thr
Leu Asn Thr 85 90 95Ala Gln Ala Asn His Thr Gly Phe Tyr Ser Cys Lys
Tyr Leu Ala Val 100 105 110Pro Thr Ser Lys Lys Lys Glu Thr Glu Ser
Ala Ile Tyr Ile Phe Ile 115 120 125Ser Asp Thr Gly Arg Pro Phe Val
Glu Met Tyr Ser Glu Ile Pro Glu 130 135 140Ile Ile His Met Thr Glu
Gly Arg Glu Leu Val Ile Pro Cys Arg Val145 150 155 160Thr Ser Pro
Asn Ile Thr Val Thr Leu Lys Lys Phe Pro Leu Asp Thr 165 170 175Leu
Ile Pro Asp Gly Lys Arg Ile Ile Trp Asp Ser Arg Lys Gly Phe 180 185
190Ile Ile Ser Asn Ala Thr Tyr Lys Glu Ile Gly Leu Leu Thr Cys Glu
195 200 205Ala Thr Val Asn Gly His Leu Tyr Lys Thr Asn Tyr Leu Thr
His Arg 210 215 220Gln Thr Asn Thr Ile Ile Asp Val Gln Ile Ser Thr
Pro Arg Pro Val225 230 235 240Lys Leu Leu Arg Gly His Thr Leu Val
Leu Asn Cys Thr Ala Thr Thr 245 250 255Pro Leu Asn Thr Arg Val Gln
Met Thr Trp Ser Tyr Pro Asp Glu Ile 260 265 270Asp Gln Ser Asn Ser
His Ala Asn Ile Phe Tyr Ser Val Leu Thr Ile 275 280 285Asp Lys Met
Gln Asn Lys Asp Lys Gly Leu Tyr Thr Cys Arg Val Arg 290 295 300Ser
Gly Pro Ser Phe Lys Ser Val Asn Thr Ser Val His Ile Tyr Asp305 310
315 320Lys Ala Gly Pro Gly Glu Pro Lys Ser Cys Asp Lys Thr His Thr
Cys 325 330 335Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser
Val Phe Leu 340 345 350Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile
Ser Arg Thr Pro Glu 355 360 365Val Thr Cys Val Val Val Asp Val Ser
His Glu Asp Pro Glu Val Lys 370 375 380Phe Asn Trp Tyr Val Asp Gly
Val Glu Val His Asn Ala Lys Thr Lys385 390 395 400Pro Arg Glu Glu
Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu 405 410 415Thr Val
Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys 420 425
430Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys
435 440 445Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro
Pro Ser 450 455 460Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu Thr
Cys Leu Val Lys465 470 475 480Gly Phe Tyr Pro Ser Asp Ile Ala Val
Glu Trp Glu Ser Asn Gly Gln 485 490 495Pro Glu Asn Asn Tyr Lys Thr
Thr Pro Pro Val Leu Asp Ser Asp Gly 500 505 510Ser Phe Phe Leu Tyr
Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln 515 520 525Gln Gly Asn
Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn 530 535 540His
Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys545 550
55551359DNAHomo sapiensCDS(1)...(1356) 5atggtcagct actgggacac
cggggtcctg ctgtgcgcgc tgctcagctg tctgcttctc 60acaggatcta gttccggagg
tagacctttc gtagagatgt acagtgaaat ccccgaaatt 120atacacatga
ctgaaggaag ggagctcgtc attccctgcc gggttacgtc acctaacatc
180actgttactt taaaaaagtt tccacttgac actttgatcc ctgatggaaa
acgcataatc 240tgggacagta gaaagggctt catcatatca aatgcaacgt
acaaagaaat agggcttctg 300acctgtgaag caacagtcaa tgggcatttg
tataagacaa actatctcac acatcgacaa 360accaatacaa tcatagatgt
ccaaataagc acaccacgcc cagtcaaatt acttagaggc 420catactcttg
tcctcaattg tactgctacc actcccttga acacgagagt tcaaatgacc
480tggagttacc ctgatgaaat tgaccaaagc aattcccatg ccaacatatt
ctacagtgtt 540cttactattg acaaaatgca gaacaaagac aaaggacttt
atacttgtcg tgtaaggagt 600ggaccatcat tcaaatctgt taacacctca
gtgcatatat atgataaagc aggcccgggc 660gagcccaaat cttgtgacaa
aactcacaca tgcccaccgt gcccagcacc tgaactcctg 720gggggaccgt
cagtcttcct cttcccccca aaacccaagg acaccctcat gatctcccgg
780acccctgagg tcacatgcgt ggtggtggac gtgagccacg aagaccctga
ggtcaagttc 840aactggtacg tggacggcgt ggaggtgcat aatgccaaga
caaagccgcg ggaggagcag 900tacaacagca cgtaccgtgt ggtcagcgtc
ctcaccgtcc tgcaccagga ctggctgaat 960ggcaaggagt acaagtgcaa
ggtctccaac aaagccctcc cagcccccat cgagaaaacc 1020atctccaaag
ccaaagggca gccccgagaa ccacaggtgt acaccctgcc cccatcccgg
1080gatgagctga ccaagaacca ggtcagcctg acctgcctgg tcaaaggctt
ctatcccagc 1140gacatcgccg tggagtggga gagcaatggg cagccggaga
acaactacaa gaccacgcct 1200cccgtgctgg actccgacgg ctccttcttc
ctctacagca agctcaccgt ggacaagagc 1260aggtggcagc aggggaacgt
cttctcatgc tccgtgatgc atgaggctct gcacaaccac 1320tacacgcaga
agagcctctc cctgtctccg ggtaaatga 13596452PRTHomo sapiens 6Met Val
Ser Tyr Trp Asp Thr Gly Val Leu Leu Cys Ala Leu Leu Ser 1 5 10
15Cys Leu Leu Leu Thr Gly Ser Ser Ser Gly Gly Arg Pro Phe Val Glu
20 25 30Met Tyr Ser Glu Ile Pro Glu Ile Ile His Met Thr Glu Gly Arg
Glu 35 40 45Leu Val Ile Pro Cys Arg Val Thr Ser Pro Asn Ile Thr Val
Thr Leu 50 55 60Lys Lys Phe Pro Leu Asp Thr Leu Ile Pro Asp Gly Lys
Arg Ile Ile65 70 75 80Trp Asp Ser Arg Lys Gly Phe Ile Ile Ser Asn
Ala Thr Tyr Lys Glu 85 90 95Ile Gly Leu Leu Thr Cys Glu Ala Thr Val
Asn Gly His Leu Tyr Lys 100 105 110Thr Asn Tyr Leu Thr His Arg Gln
Thr Asn Thr Ile Ile Asp Val Gln 115 120 125Ile Ser Thr Pro Arg Pro
Val Lys Leu Leu Arg Gly His Thr Leu Val 130 135 140Leu Asn Cys Thr
Ala Thr Thr Pro Leu Asn Thr Arg Val Gln Met Thr145 150 155 160Trp
Ser Tyr Pro Asp Glu Ile Asp Gln Ser Asn Ser His Ala Asn Ile 165 170
175Phe Tyr Ser Val Leu Thr Ile Asp Lys Met Gln Asn Lys Asp Lys Gly
180 185 190Leu Tyr Thr Cys Arg Val Arg Ser Gly Pro Ser Phe Lys Ser
Val Asn 195 200 205Thr Ser Val His Ile Tyr Asp Lys Ala Gly Pro Gly
Glu Pro Lys Ser 210 215 220Cys Asp Lys Thr His Thr Cys Pro Pro Cys
Pro Ala Pro Glu Leu Leu225 230 235 240Gly Gly Pro Ser Val Phe Leu
Phe Pro Pro Lys Pro Lys Asp Thr Leu 245 250 255Met Ile Ser Arg Thr
Pro Glu Val Thr Cys Val Val Val Asp Val Ser 260 265 270His Glu Asp
Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 275 280 285Val
His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr 290 295
300Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu
Asn305 310 315 320Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala
Leu Pro Ala Pro 325 330 335Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly
Gln Pro Arg Glu Pro Gln 340 345 350Val Tyr Thr Leu Pro Pro Ser Arg
Asp Glu Leu Thr Lys Asn Gln Val 355 360 365Ser Leu Thr Cys Leu Val
Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val 370 375 380Glu Trp Glu Ser
Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro385 390 395 400Pro
Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 405 410
415Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val
420 425 430Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu
Ser Leu 435 440 445Ser Pro Gly Lys 45071389DNAHomo
sapiensCDS(1)...(1386) 7atggtcagct actgggacac cggggtcctg ctgtgcgcgc
tgctcagctg tctgcttctc 60acaggatcta gttccggagg tagacctttc gtagagatgt
acagtgaaat ccccgaaatt 120atacacatga ctgaaggaag ggagctcgtc
attccctgcc gggttacgtc acctaacatc 180actgttactt taaaaaagtt
tccacttgac actttgatcc ctgatggaaa acgcataatc 240tgggacagta
gaaagggctt catcatatca aatgcaacgt acaaagaaat agggcttctg
300acctgtgaag caacagtcaa tgggcatttg tataagacaa actatctcac
acatcgacaa 360accaatacaa tcatagatgt ccaaataagc acaccacgcc
cagtcaaatt acttagaggc 420catactcttg tcctcaattg tactgctacc
actcccttga acacgagagt tcaaatgacc 480tggagttacc ctgatgaaaa
aaataagaga gcttccgtaa ggcgacgaat tgaccaaagc 540aattcccatg
ccaacatatt ctacagtgtt cttactattg acaaaatgca gaacaaagac
600aaaggacttt atacttgtcg tgtaaggagt ggaccatcat tcaaatctgt
taacacctca 660gtgcatatat atgataaagc aggcccgggc gagcccaaat
cttgtgacaa aactcacaca 720tgcccaccgt gcccagcacc tgaactcctg
gggggaccgt cagtcttcct cttcccccca 780aaacccaagg acaccctcat
gatctcccgg acccctgagg tcacatgcgt ggtggtggac 840gtgagccacg
aagaccctga ggtcaagttc aactggtacg tggacggcgt ggaggtgcat
900aatgccaaga caaagccgcg ggaggagcag tacaacagca cgtaccgtgt
ggtcagcgtc 960ctcaccgtcc tgcaccagga ctggctgaat ggcaaggagt
acaagtgcaa ggtctccaac 1020aaagccctcc cagcccccat cgagaaaacc
atctccaaag ccaaagggca gccccgagaa 1080ccacaggtgt acaccctgcc
cccatcccgg gatgagctga ccaagaacca ggtcagcctg 1140acctgcctgg
tcaaaggctt ctatcccagc gacatcgccg tggagtggga gagcaatggg
1200cagccggaga acaactacaa gaccacgcct cccgtgctgg actccgacgg
ctccttcttc 1260ctctacagca agctcaccgt ggacaagagc aggtggcagc
aggggaacgt cttctcatgc 1320tccgtgatgc atgaggctct gcacaaccac
tacacgcaga agagcctctc cctgtctccg 1380ggtaaatga 13898462PRTHomo
sapiens 8Met Val Ser Tyr Trp Asp Thr Gly Val Leu Leu Cys Ala Leu
Leu Ser 1 5 10 15Cys Leu Leu Leu Thr Gly Ser Ser Ser Gly Gly Arg
Pro Phe Val Glu 20 25 30Met Tyr Ser Glu Ile Pro Glu Ile Ile His Met
Thr Glu Gly Arg Glu 35 40 45Leu Val Ile Pro Cys Arg Val Thr Ser Pro
Asn Ile Thr Val Thr Leu 50 55 60Lys Lys Phe Pro Leu Asp Thr Leu Ile
Pro Asp Gly Lys Arg Ile Ile65 70 75 80Trp Asp Ser Arg Lys Gly Phe
Ile Ile Ser Asn Ala Thr Tyr Lys Glu 85 90 95Ile Gly Leu Leu Thr Cys
Glu Ala Thr Val Asn Gly His Leu Tyr Lys 100 105 110Thr Asn Tyr Leu
Thr His Arg Gln Thr Asn Thr Ile Ile Asp Val Gln 115 120 125Ile Ser
Thr Pro Arg Pro Val Lys Leu Leu Arg Gly His Thr Leu Val 130 135
140Leu Asn Cys Thr Ala Thr Thr Pro Leu Asn Thr Arg Val Gln Met
Thr145 150 155 160Trp Ser Tyr Pro Asp Glu Lys Asn Lys Arg Ala Ser
Val Arg Arg Arg 165 170 175Ile Asp Gln Ser Asn Ser His Ala Asn Ile
Phe Tyr Ser Val Leu Thr 180 185 190Ile Asp Lys Met Gln Asn Lys Asp
Lys Gly Leu Tyr Thr Cys Arg Val 195 200 205Arg Ser Gly Pro Ser Phe
Lys Ser Val Asn Thr Ser Val His Ile Tyr 210 215 220Asp Lys Ala Gly
Pro Gly Glu Pro Lys Ser Cys Asp Lys Thr His Thr225 230 235 240Cys
Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe 245 250
255Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro
260 265 270Glu Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro
Glu Val 275 280 285Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His
Asn Ala Lys Thr 290 295 300Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr
Tyr Arg Val Val Ser Val305 310 315 320Leu Thr Val Leu His Gln Asp
Trp Leu Asn Gly Lys Glu Tyr Lys Cys 325 330 335Lys Val Ser Asn Lys
Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser 340 345 350Lys Ala Lys
Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro 355 360 365Ser
Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val 370 375
380Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn
Gly385 390 395 400Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val
Leu Asp Ser Asp 405 410 415Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr
Val Asp Lys Ser Arg Trp 420 425 430Gln Gln Gly Asn Val Phe Ser Cys
Ser Val Met His Glu Ala Leu His 435 440 445Asn His Tyr Thr Gln Lys
Ser Leu Ser Leu Ser Pro Gly Lys 450 455 46091704DNAHomo
sapiensCDS(1)...(1701) 9atggtcagct actgggacac cggggtcctg ctgtgcgcgc
tgctcagctg tctgcttctc 60acaggatcta gttcaggttc aaaattaaaa gatcctgaac
tgagtttaaa aggcacccag 120cacatcatgc aagcaggcca gacactgcat
ctccaatgca ggggggaagc agcccataaa 180tggtctttgc ctgaaatggt
gagtaaggaa agcgaaaggc tgagcataac taaatctgcc 240tgtggaagaa
atggcaaaca attctgcagt actttaacct tgaacacagc tcaagcaaac
300cacactggct tctacagctg caaatatcta gctgtaccta cttcaaagaa
gaaggaaaca 360gaatctgcaa tctatatatt tattagtgat acaggtagac
ctttcgtaga gatgtacagt 420gaaatccccg aaattataca catgactgaa
ggaagggagc tcgtcattcc ctgccgggtt 480acgtcaccta acatcactgt
tactttaaaa aagtttccac ttgacacttt gatccctgat 540ggaaaacgca
taatctggga cagtagaaag ggcttcatca tatcaaatgc aacgtacaaa
600gaaatagggc ttctgacctg tgaagcaaca gtcaatgggc atttgtataa
gacaaactat 660ctcacacatc gacaaaccaa tacaatcata gatgtccaaa
taagcacacc acgcccagtc 720aaattactta gaggccatac tcttgtcctc
aattgtactg ctaccactcc cttgaacacg 780agagttcaaa tgacctggag
ttaccctgat gaaaaaaata agaacgcttc cgtaaggcga 840cgaattgacc
aaagcaattc ccatgccaac atattctaca gtgttcttac tattgacaaa
900atgcagaaca aagacaaagg actttatact tgtcgtgtaa ggagtggacc
atcattcaaa 960tctgttaaca cctcagtgca tatatatgat aaagcaggcc
cgggcgagcc caaatcttgt 1020gacaaaactc acacatgccc accgtgccca
gcacctgaac tcctgggggg accgtcagtc 1080ttcctcttcc ccccaaaacc
caaggacacc ctcatgatct cccggacccc tgaggtcaca 1140tgcgtggtgg
tggacgtgag ccacgaagac cctgaggtca agttcaactg gtacgtggac
1200ggcgtggagg tgcataatgc caagacaaag ccgcgggagg agcagtacaa
cagcacgtac 1260cgtgtggtca gcgtcctcac cgtcctgcac caggactggc
tgaatggcaa ggagtacaag 1320tgcaaggtct ccaacaaagc cctcccagcc
cccatcgaga aaaccatctc caaagccaaa 1380gggcagcccc gagaaccaca
ggtgtacacc ctgcccccat cccgggatga gctgaccaag 1440aaccaggtca
gcctgacctg cctggtcaaa ggcttctatc ccagcgacat cgccgtggag
1500tgggagagca atgggcagcc ggagaacaac tacaagacca cgcctcccgt
gctggactcc 1560gacggctcct tcttcctcta cagcaagctc accgtggaca
agagcaggtg gcagcagggg 1620aacgtcttct catgctccgt gatgcatgag
gctctgcaca accactacac gcagaagagc 1680ctctccctgt ctccgggtaa atga
170410567PRTHomo sapiens 10Met Val Ser Tyr Trp Asp Thr Gly Val Leu
Leu Cys Ala Leu Leu Ser 1 5 10 15Cys Leu Leu Leu Thr Gly Ser Ser
Ser Gly Ser Lys Leu Lys Asp Pro 20 25 30Glu Leu Ser Leu Lys Gly Thr
Gln His Ile Met Gln Ala Gly Gln Thr 35 40 45Leu His Leu Gln Cys Arg
Gly Glu Ala Ala His Lys Trp Ser Leu Pro 50 55 60Glu Met Val Ser Lys
Glu Ser Glu Arg Leu Ser Ile Thr Lys Ser Ala65 70 75 80Cys Gly Arg
Asn Gly Lys Gln Phe Cys Ser Thr Leu Thr Leu Asn Thr 85 90 95Ala Gln
Ala Asn His Thr Gly Phe Tyr Ser Cys Lys Tyr Leu Ala Val 100 105
110Pro Thr Ser Lys Lys Lys Glu Thr Glu Ser Ala Ile Tyr Ile Phe Ile
115 120 125Ser Asp Thr Gly Arg Pro Phe Val Glu Met Tyr Ser Glu Ile
Pro Glu 130 135 140Ile Ile His Met Thr Glu Gly Arg Glu Leu Val Ile
Pro Cys Arg Val145 150 155 160Thr Ser Pro Asn Ile Thr Val Thr Leu
Lys Lys Phe Pro Leu Asp Thr 165 170 175Leu Ile Pro Asp Gly Lys Arg
Ile Ile Trp Asp Ser Arg Lys Gly Phe 180 185 190Ile Ile Ser Asn Ala
Thr Tyr Lys Glu Ile Gly Leu Leu Thr Cys Glu 195 200 205Ala Thr Val
Asn Gly His Leu Tyr Lys Thr Asn Tyr Leu Thr His Arg 210 215 220Gln
Thr Asn Thr Ile Ile Asp Val Gln Ile Ser Thr Pro Arg Pro Val225 230
235 240Lys Leu Leu Arg Gly His Thr Leu Val Leu Asn Cys Thr Ala Thr
Thr 245 250 255Pro Leu Asn Thr Arg Val Gln Met Thr Trp Ser Tyr Pro
Asp Glu Lys 260 265 270Asn Lys Asn Ala Ser Val Arg Arg Arg Ile Asp
Gln Ser Asn Ser His 275 280 285Ala Asn Ile Phe Tyr Ser Val Leu Thr
Ile Asp Lys Met Gln Asn Lys 290 295 300Asp Lys Gly Leu Tyr Thr Cys
Arg Val Arg Ser Gly Pro Ser Phe Lys305 310 315 320Ser Val Asn Thr
Ser Val His Ile Tyr Asp Lys Ala Gly Pro Gly Glu 325 330 335Pro Lys
Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro 340 345
350Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys
355 360 365Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val
Val Val 370 375 380Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn
Trp Tyr Val Asp385 390 395 400Gly Val Glu Val His Asn Ala Lys Thr
Lys Pro Arg Glu Glu Gln Tyr 405 410 415Asn Ser Thr Tyr Arg Val Val
Ser Val Leu Thr Val Leu His Gln Asp 420 425 430Trp Leu Asn Gly Lys
Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu 435 440 445Pro Ala Pro
Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg 450 455 460Glu
Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys465 470
475 480Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser
Asp 485 490 495Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn
Asn Tyr Lys 500 505 510Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser
Phe Phe Leu Tyr Ser 515 520 525Lys Leu Thr Val Asp Lys Ser Arg Trp
Gln Gln Gly Asn Val Phe Ser 530 535 540Cys Ser Val Met His Glu Ala
Leu His Asn His Tyr Thr Gln Lys Ser545 550 555 560Leu Ser Leu Ser
Pro Gly Lys 565111453DNAHomo sapiensCDS(69)...(1442) 11aagcttgggc
tgcaggtcga tcgactctag aggatcgatc cccgggcgag ctcgaattcg 60caaccaccat
ggtcagctac tgggacaccg gggtcctgct gtgcgcgctg ctcagctgtc
120tgcttctcac aggatctagt tccggaggta gacctttcgt agagatgtac
agtgaaatcc 180ccgaaattat acacatgact gaaggaaggg agctcgtcat
tccctgccgg gttacgtcac 240ctaacatcac tgttacttta aaaaagtttc
cacttgacac tttgatccct gatggaaaac 300gcataatctg ggacagtaga
aagggcttca tcatatcaaa tgcaacgtac aaagaaatag 360ggcttctgac
ctgtgaagca acagtcaatg ggcatttgta taagacaaac tatctcacac
420atcgacaaac caatacaatc atagatgtgg ttctgagtcc gtctcatgga
attgaactat 480ctgttggaga aaagcttgtc ttaaattgta cagcaagaac
tgaactaaat gtggggattg 540acttcaactg ggaataccct tcttcgaagc
atcagcataa gaaacttgta aaccgagacc 600taaaaaccca gtctgggagt
gagatgaaga aatttttgag caccttaact atagatggtg 660taacccggag
tgaccaagga ttgtacacct gtgcagcatc cagtgggctg atgaccaaga
720agaacagcac atttgtcagg gtccatgaaa agggcccggg cgacaaaact
cacacatgcc 780caccgtgccc agcacctgaa ctcctggggg gaccgtcagt
cttcctcttc cccccaaaac 840ccaaggacac cctcatgatc tcccggaccc
ctgaggtcac atgcgtggtg gtggacgtga 900gccacgaaga ccctgaggtc
aagttcaact ggtacgtgga cggcgtggag gtgcataatg 960ccaagacaaa
gccgcgggag gagcagtaca acagcacgta ccgtgtggtc agcgtcctca
1020ccgtcctgca ccaggactgg ctgaatggca aggagtacaa gtgcaaggtc
tccaacaaag 1080ccctcccagc ccccatcgag aaaaccatct ccaaagccaa
agggcagccc cgagaaccac 1140aggtgtacac cctgccccca tcccgggatg
agctgaccaa gaaccaggtc agcctgacct 1200gcctggtcaa aggcttctat
cccagcgaca tcgccgtgga gtgggagagc aatgggcagc 1260cggagaacaa
ctacaagacc acgcctcccg tgctggactc cgacggctcc ttcttcctct
1320atagcaagct caccgtggac aagagcaggt ggcagcaggg gaacgtcttc
tcatgctccg 1380tgatgcatga ggctctgcac aaccactaca cgcagaagag
cctctccctg tctccgggta 1440aatgagcggc cgc 145312458PRTHomo sapiens
12Met Val Ser Tyr Trp Asp Thr Gly Val Leu Leu Cys Ala Leu Leu Ser 1
5 10 15Cys Leu Leu Leu Thr Gly Ser Ser Ser Gly Gly Arg Pro Phe Val
Glu 20 25 30Met Tyr Ser Glu Ile Pro Glu Ile Ile His Met Thr Glu Gly
Arg Glu 35 40 45Leu Val Ile Pro Cys Arg Val Thr Ser Pro Asn Ile Thr
Val Thr Leu 50 55 60Lys Lys Phe Pro Leu Asp Thr Leu Ile Pro Asp Gly
Lys Arg Ile Ile65 70 75 80Trp Asp Ser Arg Lys Gly Phe Ile Ile Ser
Asn Ala Thr Tyr Lys Glu 85 90 95Ile Gly Leu Leu Thr Cys Glu Ala Thr
Val Asn Gly His Leu Tyr Lys 100 105 110Thr Asn Tyr Leu Thr His Arg
Gln Thr Asn Thr Ile Ile Asp Val Val 115 120 125Leu Ser Pro Ser His
Gly Ile Glu Leu Ser Val Gly Glu Lys Leu Val 130 135 140Leu Asn Cys
Thr Ala Arg Thr Glu Leu Asn Val Gly Ile Asp Phe Asn145 150 155
160Trp Glu Tyr Pro Ser Ser Lys His Gln His Lys Lys Leu Val Asn Arg
165 170 175Asp Leu Lys Thr Gln Ser Gly Ser Glu Met Lys Lys Phe Leu
Ser Thr 180 185 190Leu Thr Ile Asp Gly Val Thr Arg Ser Asp Gln Gly
Leu Tyr Thr Cys 195 200 205Ala Ala Ser Ser Gly Leu Met Thr Lys Lys
Asn Ser Thr Phe Val Arg 210 215 220Val His Glu Lys Gly Pro Gly Asp
Lys Thr His Thr Cys Pro Pro Cys225 230 235 240Pro Ala Pro Glu Leu
Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro 245 250 255Lys Pro Lys
Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys 260 265 270Val
Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp 275 280
285Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu
290 295 300Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr
Val Leu305 310 315 320His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys
Cys Lys Val Ser Asn 325 330 335Lys Ala Leu Pro Ala Pro Ile Glu Lys
Thr Ile Ser Lys Ala Lys Gly 340 345 350Gln Pro Arg Glu Pro Gln Val
Tyr Thr Leu Pro Pro Ser Arg Asp Glu 355 360 365Leu Thr Lys Asn Gln
Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr 370 375 380Pro Ser Asp
Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn385 390 395
400Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe
405 410 415Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln
Gly Asn 420 425 430Val Phe Ser Cys Ser Val Met His Glu Ala Leu His
Asn His Tyr Thr 435 440 445Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys
450 455131444DNAHomo sapiensCDS(69)...(1433) 13aagcttgggc
tgcaggtcga tcgactctag aggatcgatc cccgggcgag ctcgaattcg 60caaccaccat
ggtcagctac tgggacaccg gggtcctgct gtgcgcgctg ctcagctgtc
120tgcttctcac aggatctagt tccggaggta gacctttcgt agagatgtac
agtgaaatcc 180ccgaaattat acacatgact gaaggaaggg agctcgtcat
tccctgccgg gttacgtcac 240ctaacatcac tgttacttta aaaaagtttc
cacttgacac tttgatccct gatggaaaac 300gcataatctg ggacagtaga
aagggcttca tcatatcaaa tgcaacgtac aaagaaatag 360ggcttctgac
ctgtgaagca acagtcaatg ggcatttgta taagacaaac tatctcacac
420atcgacaaac caatacaatc atagatatcc agctgttgcc caggaagtcg
ctggagctgc 480tggtagggga gaagctggtc ctcaactgca ccgtgtgggc
tgagtttaac tcaggtgtca 540cctttgactg ggactaccca gggaagcagg
cagagcgggg taagtgggtg cccgagcgac 600gctcccaaca gacccacaca
gaactctcca gcatcctgac catccacaac gtcagccagc 660acgacctggg
ctcgtatgtg tgcaaggcca acaacggcat ccagcgattt cgggagagca
720ccgaggtcat tgtgcatgaa aatggcccgg gcgacaaaac tcacacatgc
ccaccgtgcc 780cagcacctga actcctgggg ggaccgtcag tcttcctctt
ccccccaaaa cccaaggaca 840ccctcatgat ctcccggacc cctgaggtca
catgcgtggt ggtggacgtg agccacgaag 900accctgaggt caagttcaac
tggtacgtgg acggcgtgga ggtgcataat gccaagacaa 960agccgcggga
ggagcagtac aacagcacgt accgtgtggt cagcgtcctc accgtcctgc
1020accaggactg gctgaatggc aaggagtaca agtgcaaggt ctccaacaaa
gccctcccag 1080cccccatcga gaaaaccatc tccaaagcca aagggcagcc
ccgagaacca caggtgtaca 1140ccctgccccc atcccgggat gagctgacca
agaaccaggt cagcctgacc tgcctggtca 1200aaggcttcta tcccagcgac
atcgccgtgg agtgggagag caatgggcag ccggagaaca 1260actacaagac
cacgcctccc gtgctggact ccgacggctc cttcttcctc tatagcaagc
1320tcaccgtgga caagagcagg tggcagcagg ggaacgtctt ctcatgctcc
gtgatgcatg 1380aggctctgca caaccactac acgcagaaga gcctctccct
gtctccgggt aaatgagcgg 1440ccgc 144414455PRTHomo sapiens 14Met Val
Ser Tyr Trp Asp Thr Gly Val Leu Leu Cys Ala Leu Leu Ser 1 5 10
15Cys Leu Leu Leu Thr Gly Ser Ser Ser Gly Gly Arg Pro Phe Val Glu
20 25 30Met Tyr Ser Glu Ile Pro Glu Ile Ile His Met
Thr Glu Gly Arg Glu 35 40 45Leu Val Ile Pro Cys Arg Val Thr Ser Pro
Asn Ile Thr Val Thr Leu 50 55 60Lys Lys Phe Pro Leu Asp Thr Leu Ile
Pro Asp Gly Lys Arg Ile Ile65 70 75 80Trp Asp Ser Arg Lys Gly Phe
Ile Ile Ser Asn Ala Thr Tyr Lys Glu 85 90 95Ile Gly Leu Leu Thr Cys
Glu Ala Thr Val Asn Gly His Leu Tyr Lys 100 105 110Thr Asn Tyr Leu
Thr His Arg Gln Thr Asn Thr Ile Ile Asp Ile Gln 115 120 125Leu Leu
Pro Arg Lys Ser Leu Glu Leu Leu Val Gly Glu Lys Leu Val 130 135
140Leu Asn Cys Thr Val Trp Ala Glu Phe Asn Ser Gly Val Thr Phe
Asp145 150 155 160Trp Asp Tyr Pro Gly Lys Gln Ala Glu Arg Gly Lys
Trp Val Pro Glu 165 170 175Arg Arg Ser Gln Gln Thr His Thr Glu Leu
Ser Ser Ile Leu Thr Ile 180 185 190His Asn Val Ser Gln His Asp Leu
Gly Ser Tyr Val Cys Lys Ala Asn 195 200 205Asn Gly Ile Gln Arg Phe
Arg Glu Ser Thr Glu Val Ile Val His Glu 210 215 220Asn Gly Pro Gly
Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro225 230 235 240Glu
Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys 245 250
255Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val
260 265 270Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr
Val Asp 275 280 285Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg
Glu Glu Gln Tyr 290 295 300Asn Ser Thr Tyr Arg Val Val Ser Val Leu
Thr Val Leu His Gln Asp305 310 315 320Trp Leu Asn Gly Lys Glu Tyr
Lys Cys Lys Val Ser Asn Lys Ala Leu 325 330 335Pro Ala Pro Ile Glu
Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg 340 345 350Glu Pro Gln
Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys 355 360 365Asn
Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp 370 375
380Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr
Lys385 390 395 400Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe
Phe Leu Tyr Ser 405 410 415Lys Leu Thr Val Asp Lys Ser Arg Trp Gln
Gln Gly Asn Val Phe Ser 420 425 430Cys Ser Val Met His Glu Ala Leu
His Asn His Tyr Thr Gln Lys Ser 435 440 445Leu Ser Leu Ser Pro Gly
Lys 450 455151377DNAHomo sapiensCDS(1)...(1374) 15atggtcagct
actgggacac cggggtcctg ctgtgcgcgc tgctcagctg tctgcttctc 60acaggatcta
gttccggaag tgataccggt agacctttcg tagagatgta cagtgaaatc
120cccgaaatta tacacatgac tgaaggaagg gagctcgtca ttccctgccg
ggttacgtca 180cctaacatca ctgttacttt aaaaaagttt ccacttgaca
ctttgatccc tgatggaaaa 240cgcataatct gggacagtag aaagggcttc
atcatatcaa atgcaacgta caaagaaata 300gggcttctga cctgtgaagc
aacagtcaat gggcatttgt ataagacaaa ctatctcaca 360catcgacaaa
ccaatacaat catagatgtg gttctgagtc cgtctcatgg aattgaacta
420tctgttggag aaaagcttgt cttaaattgt acagcaagaa ctgaactaaa
tgtggggatt 480gacttcaact gggaataccc ttcttcgaag catcagcata
agaaacttgt aaaccgagac 540ctaaaaaccc agtctgggag tgagatgaag
aaatttttga gcaccttaac tatagatggt 600gtaacccgga gtgaccaagg
attgtacacc tgtgcagcat ccagtgggct gatgaccaag 660aagaacagca
catttgtcag ggtccatgaa aaggacaaaa ctcacacatg cccaccgtgc
720ccagcacctg aactcctggg gggaccgtca gtcttcctct tccccccaaa
acccaaggac 780accctcatga tctcccggac ccctgaggtc acatgcgtgg
tggtggacgt gagccacgaa 840gaccctgagg tcaagttcaa ctggtacgtg
gacggcgtgg aggtgcataa tgccaagaca 900aagccgcggg aggagcagta
caacagcacg taccgtgtgg tcagcgtcct caccgtcctg 960caccaggact
ggctgaatgg caaggagtac aagtgcaagg tctccaacaa agccctccca
1020gcccccatcg agaaaaccat ctccaaagcc aaagggcagc cccgagaacc
acaggtgtac 1080accctgcccc catcccggga tgagctgacc aagaaccagg
tcagcctgac ctgcctggtc 1140aaaggcttct atcccagcga catcgccgtg
gagtgggaga gcaatgggca gccggagaac 1200aactacaaga ccacgcctcc
cgtgctggac tccgacggct ccttcttcct ctacagcaag 1260ctcaccgtgg
acaagagcag gtggcagcag gggaacgtct tctcatgctc cgtgatgcat
1320gaggctctgc acaaccacta cacgcagaag agcctctccc tgtctccggg taaatga
137716458PRTHomo sapiens 16Met Val Ser Tyr Trp Asp Thr Gly Val Leu
Leu Cys Ala Leu Leu Ser 1 5 10 15Cys Leu Leu Leu Thr Gly Ser Ser
Ser Gly Ser Asp Thr Gly Arg Pro 20 25 30Phe Val Glu Met Tyr Ser Glu
Ile Pro Glu Ile Ile His Met Thr Glu 35 40 45Gly Arg Glu Leu Val Ile
Pro Cys Arg Val Thr Ser Pro Asn Ile Thr 50 55 60Val Thr Leu Lys Lys
Phe Pro Leu Asp Thr Leu Ile Pro Asp Gly Lys65 70 75 80Arg Ile Ile
Trp Asp Ser Arg Lys Gly Phe Ile Ile Ser Asn Ala Thr 85 90 95Tyr Lys
Glu Ile Gly Leu Leu Thr Cys Glu Ala Thr Val Asn Gly His 100 105
110Leu Tyr Lys Thr Asn Tyr Leu Thr His Arg Gln Thr Asn Thr Ile Ile
115 120 125Asp Val Val Leu Ser Pro Ser His Gly Ile Glu Leu Ser Val
Gly Glu 130 135 140Lys Leu Val Leu Asn Cys Thr Ala Arg Thr Glu Leu
Asn Val Gly Ile145 150 155 160Asp Phe Asn Trp Glu Tyr Pro Ser Ser
Lys His Gln His Lys Lys Leu 165 170 175Val Asn Arg Asp Leu Lys Thr
Gln Ser Gly Ser Glu Met Lys Lys Phe 180 185 190Leu Ser Thr Leu Thr
Ile Asp Gly Val Thr Arg Ser Asp Gln Gly Leu 195 200 205Tyr Thr Cys
Ala Ala Ser Ser Gly Leu Met Thr Lys Lys Asn Ser Thr 210 215 220Phe
Val Arg Val His Glu Lys Asp Lys Thr His Thr Cys Pro Pro Cys225 230
235 240Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro
Pro 245 250 255Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu
Val Thr Cys 260 265 270Val Val Val Asp Val Ser His Glu Asp Pro Glu
Val Lys Phe Asn Trp 275 280 285Tyr Val Asp Gly Val Glu Val His Asn
Ala Lys Thr Lys Pro Arg Glu 290 295 300Glu Gln Tyr Asn Ser Thr Tyr
Arg Val Val Ser Val Leu Thr Val Leu305 310 315 320His Gln Asp Trp
Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn 325 330 335Lys Ala
Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly 340 345
350Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu
355 360 365Leu Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly
Phe Tyr 370 375 380Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly
Gln Pro Glu Asn385 390 395 400Asn Tyr Lys Thr Thr Pro Pro Val Leu
Asp Ser Asp Gly Ser Phe Phe 405 410 415Leu Tyr Ser Lys Leu Thr Val
Asp Lys Ser Arg Trp Gln Gln Gly Asn 420 425 430Val Phe Ser Cys Ser
Val Met His Glu Ala Leu His Asn His Tyr Thr 435 440 445Gln Lys Ser
Leu Ser Leu Ser Pro Gly Lys 450 45517430PRTHomo sapiens 17Gly Arg
Pro Phe Val Glu Met Tyr Ser Glu Ile Pro Glu Ile Ile His 1 5 10
15Met Thr Glu Gly Arg Glu Leu Val Ile Pro Cys Arg Val Thr Ser Pro
20 25 30Asn Ile Thr Val Thr Leu Lys Lys Phe Pro Leu Asp Thr Leu Ile
Pro 35 40 45Asp Gly Lys Arg Ile Ile Trp Asp Ser Arg Lys Gly Phe Ile
Ile Ser 50 55 60Asn Ala Thr Tyr Lys Glu Ile Gly Leu Leu Thr Cys Glu
Ala Thr Val65 70 75 80Asn Gly His Leu Tyr Lys Thr Asn Tyr Leu Thr
His Arg Gln Thr Asn 85 90 95Thr Ile Ile Asp Val Val Leu Ser Pro Ser
His Gly Ile Glu Leu Ser 100 105 110Val Gly Glu Lys Leu Val Leu Asn
Cys Thr Ala Arg Thr Glu Leu Asn 115 120 125Val Gly Ile Asp Phe Asn
Trp Glu Tyr Pro Ser Ser Lys His Gln His 130 135 140Lys Lys Leu Val
Asn Arg Asp Leu Lys Thr Gln Ser Gly Ser Glu Met145 150 155 160Lys
Lys Phe Leu Ser Thr Leu Thr Ile Asp Gly Val Thr Arg Ser Asp 165 170
175Gln Gly Leu Tyr Thr Cys Ala Ala Ser Ser Gly Leu Met Thr Lys Lys
180 185 190Asn Ser Thr Phe Val Arg Val His Glu Lys Gly Pro Gly Asp
Lys Thr 195 200 205His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu
Gly Gly Pro Ser 210 215 220Val Phe Leu Phe Pro Pro Lys Pro Lys Asp
Thr Leu Met Ile Ser Arg225 230 235 240Thr Pro Glu Val Thr Cys Val
Val Val Asp Val Ser His Glu Asp Pro 245 250 255Glu Val Lys Phe Asn
Trp Tyr Val Asp Gly Val Glu Val His Asn Ala 260 265 270Lys Thr Lys
Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val 275 280 285Ser
Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr 290 295
300Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys
Thr305 310 315 320Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln
Val Tyr Thr Leu 325 330 335Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn
Gln Val Ser Leu Thr Cys 340 345 350Leu Val Lys Gly Phe Tyr Pro Ser
Asp Ile Ala Val Glu Trp Glu Ser 355 360 365Asn Gly Gln Pro Glu Asn
Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp 370 375 380Ser Asp Gly Ser
Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser385 390 395 400Arg
Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala 405 410
415Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Pro Gly Lys 420 425
4301836DNAArtificial SequenceSynthetic 18gactagcagt ccggaggtag
acctttcgta gagatg 361933DNAArtificial SequenceSynthetic
19cggactcaga accacatcta tgattgtatt ggt 33207PRTHomo sapiens 20Gly
Arg Pro Phe Val Glu Met 1 52135DNAArtificial SequenceSynthetic
21acaatcatag atgtggttct gagtccgtct catgg 352238DNAArtificial
SequenceSynthetic 22gataatgccc gggccctttt catggaccct gacaaatg
38236PRTHomo sapiens 23Val Arg Val His Glu Lys 1 52436DNAArtificial
SequenceSynthetic 24gactagcagt ccggaggtag acctttcgta gagatg
362538DNAArtificial SequenceSynthetic 25ttcctgggca acagctggat
atctatgatt gtattggt 38264PRTHomo sapiens 26Ile Gln Leu Leu
12739DNAArtificial SequenceSynthetic 27atccagctgt tgcccaggaa
gtcgctggag ctgctggta 392839DNAArtificial SequenceSynthetic
28attttcatgc acaatgacct cggtgctctc ccgaaatcg 392938DNAArtificial
SequenceSynthetic 29tcatagatat ccagctgttg cccaggaagt cgctggag
383039DNAArtificial SequenceSynthetic 30gataatgccc gggccatttt
catgcacaat gacctcggt 39316PRTHomo sapiens 31Val Ile Val His Glu Asn
1 53210PRTArtificial SequenceSynthetic 32Lys Asn Lys Arg Ala Ser
Val Arg Arg Arg 1 5 10338PRTArtificial SequenceSynthetic 33Asn Ala
Ser Val Asn Gly Ser Arg 1 53410PRTArtificial SequenceSynthetic
34Lys Asn Lys Cys Ala Ser Val Arg Arg Arg 1 5 10354PRTHomo sapiens
35Ser Lys Leu Lys 1369PRTHomo sapiens 36Lys Asn Lys Arg Ala Ser Val
Arg Arg 1 5374PRTHomo sapiens 37Thr Ile Ile Asp 1384PRTHomo sapiens
38Val Val Leu Ser 1
* * * * *