U.S. patent application number 12/887843 was filed with the patent office on 2011-02-03 for use of a cytokine from the interleukin-6 family in the preparation of a composition for combined administration with interferon-alpha.
Invention is credited to Rafael Aldabe Arregui, Maria Pilar Civeira Murillo, Esther Larrea Leoz, Jes s Prieto Valtuena.
Application Number | 20110027224 12/887843 |
Document ID | / |
Family ID | 37532659 |
Filed Date | 2011-02-03 |
United States Patent
Application |
20110027224 |
Kind Code |
A1 |
Aldabe Arregui; Rafael ; et
al. |
February 3, 2011 |
USE OF A CYTOKINE FROM THE INTERLEUKIN-6 FAMILY IN THE PREPARATION
OF A COMPOSITION FOR COMBINED ADMINISTRATION WITH
INTERFERON-ALPHA
Abstract
The invention relates to the use of at least one cytokine from
the IL-6 family -gp130, preferably selected from among IL-11, the
leukaemia inhibitory factor (LIF), oncostatin M (OSM),
cardiotrophin-1, ciliary neurotrophic factor (CNTF), the
cardiotrophin-like cytokine (CLC) and combinations thereof or a DNA
sequence encoding same, in the preparation of a pharmaceutical
composition which is intended for combined administration with at
least one IFN-.alpha. or a DNA sequence encoding same, for use in
the treatment of viral diseases. The invention also relates to a
pharmaceutical composition comprising a pharmaceutically-acceptable
quantity of at least one cytokin from the IL-6 family -gp130 or a
DNA sequence encoding same and a pharmaceutically-acceptable
quantity of at least one IFN-.alpha. or a DNA sequence encoding
same, a pharmaceutical kit and a method for the treatment of viral
diseases with the combined administration of the aforementioned
cytokines and IFN-.alpha..
Inventors: |
Aldabe Arregui; Rafael;
(Pamplona (Navarra), ES) ; Larrea Leoz; Esther;
(Pamplona (Navarra), ES) ; Civeira Murillo; Maria
Pilar; (Pamplona (Navarra), ES) ; Prieto Valtuena;
Jes s; (Pamplona (Navarra), ES) |
Correspondence
Address: |
WENDEROTH, LIND & PONACK, L.L.P.
1030 15th Street, N.W.,, Suite 400 East
Washington
DC
20005-1503
US
|
Family ID: |
37532659 |
Appl. No.: |
12/887843 |
Filed: |
September 22, 2010 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11922221 |
Jul 21, 2008 |
7829077 |
|
|
PCT/ES2006/000353 |
Jun 16, 2006 |
|
|
|
12887843 |
|
|
|
|
Current U.S.
Class: |
424/85.2 |
Current CPC
Class: |
A61P 17/00 20180101;
A61P 31/22 20180101; A61P 31/12 20180101; A61K 38/212 20130101;
A61P 25/00 20180101; A61K 38/00 20130101; C07K 14/5412 20130101;
A61P 15/00 20180101; A61K 38/19 20130101; A61P 1/16 20180101; A61P
31/18 20180101; A61P 11/00 20180101; A61P 9/00 20180101; C07K
14/5415 20130101; C07K 14/5431 20130101; A61P 1/02 20180101; A61K
38/19 20130101; A61K 2300/00 20130101; A61K 38/212 20130101; A61K
2300/00 20130101 |
Class at
Publication: |
424/85.2 |
International
Class: |
A61K 38/20 20060101
A61K038/20; A61P 31/12 20060101 A61P031/12 |
Foreign Application Data
Date |
Code |
Application Number |
Jun 16, 2005 |
ES |
P200501468 |
Claims
1-45. (canceled)
46. A pharmaceutical composition comprising a pharmaceutically
acceptable quantity of at least one IL-6 family cytokine selected
from the group consisting of cardiotrophin 1 and oncostatin M, and
a pharmaceutically acceptable quantity of at least one
IFN-.alpha..
47. The pharmaceutical composition according to claim 46, wherein
the IL-6 family cytokine is the complete native cytokine.
48. The pharmaceutical composition according to claim 46, wherein
the IFN-.alpha. is selected from the group consisting of:
IFN-.alpha.-2a, IFN-.alpha.-2b, IFN-.alpha.-5, consensus
Interferon, purified IFN-.alpha., pegylated IFN-.alpha. and
combinations thereof.
49. The pharmaceutical composition according to claim 46, wherein
the IFN-.alpha. is selected from the group consisting of: pegylated
IFN-.alpha.-2b, pegylated IFN-.alpha.-2a, pegylated IFN-.alpha.-5
and combinations thereof.
50. The pharmaceutical composition according to claim 46,
additionally containing at least one excipient which is
pharmaceutically compatible with the IL-6 family cytokine, and with
the IFN-.alpha..
51. The pharmaceutical composition according to claim 46, wherein
the IL-6 family cytokine and the IFN-.alpha. are carried in
separate carrier agents.
52. A pharmaceutical kit for the treatment of a viral disease,
comprising at least: a first component which comprises at least one
IL-6 family cytokine selected from group consisting of
cardiotrophin 1 and oncostatin M, and a second component which
comprises at least one IFN-.alpha..
53. The kit according to claim 52, wherein the IL-6 family cytokine
is the complete native cytokine.
54. The kit according to claim 52, wherein the IFN-.alpha. is
selected from the group consisting of: IFN-.alpha.-2a,
IFN-.alpha.-2b, IFN-.alpha.-5, consensus interferon, purified
IFN-.alpha., pegylated IFN-.alpha. and combinations thereof.
55. The kit according to claim 52, wherein the IFN-.alpha. is
selected from the group consisting of: pegylated IFN-.alpha.-2b,
pegylated IFN-.alpha.-2a, pegylated IFN-.alpha.-5 and combinations
thereof.
56. The kit according to claim 52, wherein the first and the second
components are present in separate pharmaceutical compositions.
57. The kit according to claim 52, wherein the first and the second
components are present in the same pharmaceutical composition.
58. The kit according to claim 52, additionally comprising a third
component, which comprises one or more excipients that are
pharmaceutically compatible with the IL-6 family cytokine, and with
the IFN-.alpha..
59. The kit according to claim 52, additionally comprising a third
component, which comprises one or more carrier agents that are
pharmaceutically compatible with the IL-6 family cytokine, and with
the IFN-.alpha..
60. The kit according to claim 52, wherein the first component
additionally comprises, at least one excipient, which is
pharmaceutically acceptable and compatible with the IL-6 family
cytokine, and with the IFN-.alpha..
61. The kit according to claim 52, wherein the second component
additionally comprises, one or more excipients which are
pharmaceutically acceptable and compatible with the IL-6 family
cytokine, and with the IFN-.alpha..
62. A method for the treatment of a viral disease, which comprises
the combined administration of a therapeutically effective quantity
of at least one IL-6 family cytokine selected from the group
consisting of cardiotrophin 1 and oncostatin M, and a
therapeutically effective quantity of at least one IFN-.alpha..
63. The method according to claim 62, wherein the viral disease is
hepatitis C.
64. The method according to claim 62, wherein the IL-6 family
cytokine is the complete native cytokine.
65. The method according to claim 62, wherein the IFN-.alpha. is
selected from the group consisting of: IFN-.alpha.-2a,
IFN-.alpha.-2b, IFN-.alpha.-5, consensus Interferon, purified
IFN-.alpha., pegylated IFN-.alpha. and combinations thereof.
66. The method according to claim 62, wherein the IFN-.alpha. is
selected from the group consisting of: pegylated IFN-.alpha.-2b,
pegylated IFN-.alpha.-2a, pegylated IFN-.alpha.-5 and combinations
thereof.
67. The method according to claim 62, wherein the IL-6 family
cytokine and the IFN-.alpha. are present in the same pharmaceutical
composition that is administered to the patient.
68. The method according to claim 62, wherein the IL-6 family
cytokine and the IFN-.alpha. are administered in separate
pharmaceutical compositions.
Description
[0001] The present invention relates to the use of a cytokine in
combination with an interferon for the preparation of compositions
designed for the treatment of viral diseases.
STATE OF THE ART
[0002] The interferon (IFN) system is the first line of defense
against viral diseases in mammals. Type I interferons (which
include several IFN-.alpha. and IFN-.beta. subtypes) are molecules
with antiviral activity, which are induced in mammal cells in
response to viral infections. The action of IFN-.alpha. is mediated
by interaction with a surface cellular receptor multi-subunit,
which consists of two receptor subunits, IFN-.alpha. receptor 1
(IFNAR1) and IFNAR2. Only one IFNAR1 chain form has been
identified; and three variants of the IFNAR2 subunit have been
recognised: one that is full-length, IFRNAR2c, and two truncated
isoforms, IFNAR2b and IFNAR2a. The IFNAR2c variant is involved in
binding with ligands and the transduction of signals, whilst the
two truncated forms, IFNAR2b and IFNAR2a--which do not have
intracellular domains--, inhibit the IFN-.alpha. signal, through
competition with IFNAR2c for binding with IFN-.alpha..
[0003] The IFN-.alpha. signalling cascade is initiated when
IFN-.alpha. binds with the receptor. The binding of IFN-.alpha.
with the receptor leads to the activation of tyrosine-kinases
associated with IFNAR (Janus kinase 1 (Jak1) and tyrosine-kinase 2
(Tyk2)), which phosphorylate both subunits, IFNAR1 and IFNAR2.
Phosphorylated IFNAR1 provides a binding-point for the signal
transduction and activator of transcription 2 (STAT2), which
contains a homology-2 domain with Src, when phosphorylated by Tyk2
or Jak1. The other STATs, including STAT1, STAT3 and STATS, are
consequently recruited to the receptor for phosphorylation and
activation. The activated monomers STAT1 and STAT2 are then once
again released to the cytosol, where they form heterodimers and
bind with the interferon regulatory factor 9/Protein p48, to form
an active transcription factor complex known as
interferon-stimulated gene factor 3 (ISGF3). The complex is
translocated to the nucleus and binds with the IFN stimulation
response element (ISRE) in order to initiate the transcription of
target genes, including some antiviral and immunoregulatory
proteins. IFN-.alpha. also induces the formation of other STAT
complexes, including STAT1/STAT1, STAT1/STAT3 and STAT3/STAT3,
which bind with the activated .gamma. sequence in the promoter
regions of sensitive genes. In primary human hepatocytes,
IFN-.alpha. activates STAT1, STAT2, STAT3 and STATS, followed by
the induction of a wide variety of antiviral and proapoptotic genes
which may contribute to IFN-.alpha.'s anti-tumour and antiviral
activity in the human liver.
[0004] In contrast with IFN-.alpha., which activates STAT1, STAT2
and STAT3, in the case of type II IFN (IFN .gamma.), binding with
the receptor leads to the exclusive phosphorylation of STAT1 by
Jak1 and Jak2, and this is followed by the homodimerisation of
STAT1 and nuclear translocation of the homodimer.
[0005] Viral infections represent a great health problem throughout
the world. Among the viruses that cause chronic infections, the
viruses which cause hepatitis B (HBV) and hepatitis C (HCV) are
important as the main etiological factors of chronic viral
hepatitis and hepatic cirrhosis; these disorders affect over 500
million people throughout the world (about 300 million affected by
HBV and 200 million by HCV). HBV causes chronic infection primarily
in cases of vertical transmission and immunodepressed individuals.
On the other hand, HCV infection is noteworthy due to its tendency
to develop chronicity in most cases, which suggests that this virus
has developed particularly effective mechanisms to avoid the
interferon system. Patients suffering from chronic HCV infection,
as well as patients suffering from chronic hepatitis B, fail to
respond to interferon therapy. In chronic hepatitis B, sustained
antiviral response takes place in less than 40% of the cases [1].
In the case of chronic hepatitis C, although the majority of
patients infected with genotypes HCV 2 or 3 exhibit a sustained
virological response (SVR) after 24 or 28 weeks of combination
therapy with pegylated IFN-.alpha. and ribavirin [2], only 50% of
those infected with genotype 1 achieved SVR with this therapeutic
regime [2]. Since over 80% of patients infected with HCV in the
Western world and Asia correspond to genotype 1, more efficient
means are urgently needed in order to increase IFN-.alpha.'s
antiviral effectiveness. The underlying mechanisms of resistance to
IFN-.alpha. observed in HCV and other chronic viral diseases are
still poorly understood and there is a great need to find
therapeutic strategies with which to overcome resistance to
IFN-.alpha. therapy in these diseases.
[0006] The response to interferon-.alpha. by the cell infected with
the virus is dependent on several determining factors, including
those related to the virus and those specific ones related to the
host. Various HCV gene products have been shown to modulate the
host's response to IFN therapy and affect the severity of the viral
disease, particularly in the case of hepatic disease. It has been
noted that HCV non-structural (NS5A) and structural (E2) proteins
interact with PKR, one of the key molecules involved in the
development of an antiviral state in response to IFN [3, 4]. This
could block PKR, leading to inhibition of the IFN activity in
HCV-infected cells. On the other hand, several studies have shown
that the STAT1 signal induced by IFN-.alpha. is affected both in
transgenic mice with HCV and in liver biopsies of patients with
chronic HCV [5, 6].
[0007] It has been observed that, in HCV-infected liver samples,
and in liver cells carrying a genomic HCV replicon (full-length),
there is a marked reduction in the quantity of IFNAR2 and STAT3
mRNA. A relevant finding has been that activation of STAT1, STAT2
and STAT3 by IFN-.alpha. was blocked in liver cells containing a
full-length HCV replicon, which suggests that HCV replication may
block IFN-.alpha. signalling in the infected cells. It is also
interesting that STAT1 activation in these cells is not affected
when they were incubated with the pro-inflammatory molecule
IFN-.gamma., which suggests that the blocking of STAT1 activation
produced by HCV is specific for the type 1 IFN signalling cascade,
and does not affect the type II IFN signalling pathway.
[0008] There are other cytokines which activate the Jak-STAT
signalling pathway, particularly members of the IL-6 family, which
comprises IL-6, IL-11, leukemia-inhibiting factor (LIF), oncostatin
(OSM), cardiotrophin-1 (CT-1), ciliary neurotrophic factor (CNTF)
and cardiotrophin-like cytokine (CLC) [7]. These cytokines bind
with the plasma membrane's receptor complexes which comprise the
common gp130 transduction signal receptor chain [7]. The
transduction of signals entails the activation of the members of
the Jak tyrosine-kinase family, leading to the activation of
transcription factors STAT1 and STAT3. These cytokines potentially
activate STAT3 and, to a lesser extent, STAT1 through a common
gp130 receptor subunit. However, although it has been shown that
IL-6 induces some antiviral effects [8], this cytokine's antiviral
activity is much lower than that of interferon-.alpha..
[0009] The present invention relates to the use of an IL-6 family
interleukin, preferably cardiotrophin-1 (CT-1) or oncostatin M
(OSM):
(1) in order to enhance interferon-alpha's (IFN-.alpha.) antiviral
activity; (2) in order to overcome the resistance to interferon
observed in patients suffering from chronic viral infection, who do
not respond to IFN-.alpha. therapy (by itself or associated with
other antiviral components); (3) in order to achieve a combined
treatment of an IL-6 family interleukin, preferably CT-1 or OSM,
plus IFN-.alpha. as improved antiviral therapy for any type of
viral infection, and particularly infection with the hepatitis C
virus (HCV), wherein the preferred combination CT-1-IFN-.alpha. or
OSM-IFN-.alpha. has proven to be especially potent in the
inhibition of HCV replication. The present invention has achieved
the following objectives: (1) showing that the combination of
IFN-.alpha. with an IL-6 family interleukin, and preferably with
CT-1 and OSM, produces a more potent antiviral effect than that
induced by a cytokine (IFN or IL-6 family cytokine) alone; and (2)
showing that IFN-.alpha. associated with an IL-6 family cytokine,
particularly CT-1 or oncostatin M, is able to overcome the blocking
of the IFN-.alpha. signalling cascade (and, consequently, the
attenuation of the IFN-.alpha. effect which is produced when the
virus, preferably HCV, replicates in the infected cell).
DESCRIPTION OF THE INVENTION
[0010] The present invention relates, in the first place, to the
use of at least one IL-6 family cytokine -gp130 family--or a DNA
sequence which codes for it, in the preparation of a pharmaceutical
composition for combined administration with at least one
IFN-.alpha. or a DNA sequence which codes for it, in the treatment
of viral diseases, being said cytokine selected among
cardiotrophin-1, IL-11, leukemia-inhibiting factor, oncostatin M,
ciliary neurotrophic factor, cardiotrophin-like cytokine, and
combinations thereof; and, even more preferably, said cytokine is
cardiotrophin-1 or oncostatin M.
[0011] As used in the present invention, the "IL-6 family"
cytokine, for example, CT-1, relates to: [0012] the complete native
form of said cytokine; [0013] any active fraction of said cytokine,
that is, any partial polypeptide sequence of said cytokine which
maintains the physiological effects of the complete cytokine
claimed in the present invention; and [0014] any polypeptide
derivative of said cytokine, that is, any polypeptide sequence
which has a homology greater than 80% with said native cytokine and
maintains the physiological effects of the complete cytokine
claimed in the present invention.
[0015] The IL-6 family cytokine (whether it is complete, an active
fraction or a polypeptide derivative) may come from both the native
form and any form of recombinant cytokine, starting from any
polynucleotide form which codes for the complete cytokine, the
active fraction or the polypeptide derivative.
[0016] Moreover, within the protein of the IL-6 family, considered
complete or as an active fraction, or within the recombinant
cytokine one or several aminoacids could have been deleted,
substituted or added to the protein by any of the mentioned ways,
provided that its foreseen activity on the present invention is
maintained.
[0017] On the other hand, according to the present invention, the
IFN-.alpha. of the invention is any type of IFN-.alpha.. In a
specific embodiment, said IFN-.alpha. is selected from
IFN-.alpha.-2a, IFN-.alpha.-2b, IFN-.alpha.-5, consensus
interferon, purified IFN-.alpha., pegylated IFN-.alpha. and
combinations thereof. In another specific embodiment, the
IFN-.alpha. is selected from pegylated IFN-.alpha.-2b, pegylated
IFN-.alpha.-2a, pegylated IFN-.alpha.-5 and combinations
thereof.
[0018] The combined use of an IFN-.alpha. and an IL-6 family
cytokine is designed for the treatment of a preferably viral
disease. As an example of viral diseases which may be treated
through the combined use of interferon and an IL-6 family cytokine,
the following can be mentioned, amongst others: diseases caused by
the encephalomyocarditis virus, hepatitis B and C, HIV, cutaneous
viral infections (chicken-pox, herpes zoster, measles), respiratory
viral infections, viral infections of the central nervous system,
hepatic viral infections, viral infections of the salivary glands,
infectious mononucleosis and genital warts.
[0019] Preferably, the viral disease is hepatitis C.
[0020] Furthermore, according to the present invention, the IL-6
family cytokine--or cytokines--and the IFN-.alpha. may be
administered separately, being present in different pharmaceutical
compositions; or they may be administered jointly, being present in
the same pharmaceutical composition.
[0021] An additional object of the present invention is, therefore,
a pharmaceutical composition which comprises a pharmaceutically
acceptable quantity of at least one IL-6 family cytokine -gp130
family--, or a DNA sequence which codes for it, and a
pharmaceutically acceptable quantity of at least one IFN-.alpha.,
or a DNA sequence which codes for it.
[0022] In said pharmaceutical composition, which comprises at least
one IFN-.alpha., or a DNA sequence which codes for it, and at least
one IL-6 family cytokine, or a DNA sequence which codes for it, the
IL-6 family cytokine is preferably selected from IL-6, IL-11,
leukemia-inhibiting factor, oncostatin M, cardiotrophin-1, ciliary
neurotrophic factor, cardiotrophin-like cytokine and combinations
thereof; and even more preferably, said IL-6 family cytokine is
cardiotrophin-1 or oncostatin M.
[0023] In the pharmaceutical composition of the invention, the
IFN-.alpha. is any type of IFN-.alpha.. In a preferred embodiment,
the IFN-.alpha. has been selected from IFN-.alpha.-2a,
IFN-.alpha.-2b, IFN-.alpha.-5, consensus interferon, purified
IFN-.alpha., pegylated IFN-.alpha. and combinations thereof. In
another additional preferred embodiment, the IFN-.alpha. is
selected from pegylated IFN-.alpha.-2b, pegylated IFN-.alpha.-2a,
pegylated IFN-.alpha.-5 and combinations thereof.
[0024] In a specific embodiment, the DNA sequence that codes for
the IL-6-family cytokine (whether it is complete, an active
fraction or a polypeptide derivative) or the IFN-.alpha. is
incorporated into an expression vector, for example, a plasmid or
viral vector, which is preferably operatively binded with a control
sequence that regulates the expression of the cytokine or the
IFN-.alpha.. The construction of said expression vector with the
DNA sequence may be performed by conventional recombinant
technology methods contained in handbooks such as, for example,
"Molecular Cloning: A Laboratory Manual", by J. Sambrook, D. W.
Russel Eds. 2001, 3rd ed. Cold Spring Harbor, N.Y. These
embodiments of the pharmaceutical composition are of interest for
therapies which use gene transfer (gene therapy).
[0025] The pharmaceutical composition of the invention may further
comprise at least one excipient that is pharmaceutically compatible
with the IL-6-family cytokine, or with the DNA sequence that codes
for it, and pharmaceutically compatible with the IFN-.alpha. or the
DNA sequence that codes for it.
[0026] Furthermore, in the pharmaceutical composition, the
IL-6-family cytokine--or the DNA sequence that codes for it--and
the IFN-.alpha.--or the DNA sequence which codes for it--may be
carried in respective carrier agents.
[0027] Valid examples of the pharmaceutical composition of the
invention include, without being limited thereto, any solid
composition (for example, tablets, capsules, granules, etc.) or
liquid composition (for example, solutions, suspensions, emulsions,
etc.) for administration by any appropriate administration route,
for example, oral, nasal, parenteral, topical, transdermal, rectal,
etc.
[0028] In a specific embodiment, said pharmaceutical composition
may be in an oral administration pharmaceutical form, either solid
or liquid. Illustrative examples of oral administration
pharmaceutical forms include tablets, capsules, granulates,
solutions, suspensions, etc., and may contain the conventional
excipients, such as bonding, diluent, disintegrating, lubricant,
wetting, etc., excipients, and may be prepared by conventional
methods. The pharmaceutical composition may also be adapted for
parenteral administration, in the form of, for example, sterile
solutions, suspensions or lyophilised products, in the appropriate
dosage form; in this case, said pharmaceutical composition shall
include the adequate excipients, such as buffers, surfactant
excipients, etc. In any event, the excipients shall be selected on
the basis of the selected administration pharmaceutical form. A
review of the different pharmaceutical forms for drug
administration, for these and other potential alternative routes,
and their preparation, may be found, for example, in the book
"Tecnologia farmaceutica" ["Pharmaceutical Technology"], by J. L.
Vila Jato, 1997 Vols. I and II, Ed. Sintesis, Madrid; or in
"Handbook of Pharmaceutical Manufacturing Formulations", by S. K.
Niazi, 2004 Vols. Ito VI, CRC Press, Boca Raton.
[0029] In a specific embodiment, the pharmaceutical composition is
designed for parenteral administration, preferably subcutaneous,
intravenous, intramuscular or intraperitoneal.
[0030] In a specific embodiment of the pharmaceutical composition
of the invention, the IFN-.alpha. is in pegylated form. Some
examples for the preparation of compositions with pegylated forms
may be found in U.S. Pat. No. 5,762,923 and U.S. Pat. No.
5,766,582. It is also possible to purchase some of these pegylated
forms commercially, such as, for example, PEG-Intron (pegylated
IFN-.alpha.-2b) by Schering Corporation (Kenilworth, N.J., U.S.A.)
and PEGASYS (IFN-.alpha.-2a) by Hoffmann La Roche (Nutley, N.J.,
U.S.A.).
[0031] For application in therapy, both the IL-6-family cytokine
and the IFN-.alpha. shall preferably be in a pharmaceutically
acceptable or substantially pure form, i.e. they shall have a
pharmaceutically acceptable purity level, excluding
pharmaceutically acceptable excipients and not including material
considered to be toxic at the normal dosage levels. The purity
levels for the IL-6 family cytokine and the IFN-.alpha. are
preferably above 50%, more preferably, above 70% and more
preferably, above 90%. In a preferred embodiment, they are above
95%.
[0032] In general, the therapeutically effective quantity of the
IL-6 family cytokine and the IFN-.alpha. to be administered shall
be dependent, amongst other factors, on the individual who is to be
treated, the severity of the disease suffered by said individual,
the selected form of administration, etc. For this reason, the
doses mentioned in the present invention shall be considered solely
as guides for persons skilled in the art, and the latter shall
adjust the doses on the basis of said variables. However, the IL-6
family cytokine and the IFN-.alpha. may be administered one or more
times a day, for example, 1, 2, 3 or 4 times a day.
[0033] As an illustrative example, and without this limiting the
scope of protection, in a specific embodiment wherein
cardiotrophin-1 and IFN-.alpha.-2a (or 2b) are combined, the
typical total daily quantity of cardiotrophin-1 shall be between 1
.mu.g/kg and 10 mg/kg of body weight; and the typical total daily
quantity of IFN-.alpha.-2a is between 1.5 and 10 MIU per day or
between 40 and 300 micrograms per week of pegylated IFN-.alpha..
Normally, the dosage level will be higher during the first weeks of
treatment, with the dose being reduced in subsequent stages.
Likewise, the administration scheme may be daily, three times per
week, or also weekly. On the other hand, the cardiotrophin-1 and
the IFN-.alpha. may be administered following different
administration schemes (for example, different administration route
or different frequency).
[0034] An additional objective of the present invention is a
pharmaceutical kit for the treatment of a viral disease which
includes at least: [0035] a first component which comprises at
least one IL-6 family cytokine -gp130 family--(either complete, an
active fraction or a polypeptide derivative, as they have been
defined above) or a DNA sequence that codes for said cytokine; and
[0036] a second component which comprises at least one IFN-.alpha.
or a DNA sequence that codes for said IFN-.alpha..
[0037] The kit according to the invention preferably comprises an
IL-6 family cytokine selected from IL-6, IL-11, leukemia-inhibiting
factor, oncostatin M, cardiotrophin-1, ciliary neurotrophic factor,
cardiotrophin-like cytokine and combinations thereof, and, even
more preferably, the IL-6 family cytokine is cardiotrophin-1 or
oncostatin M.
[0038] The kit according to the invention comprises an IFN-.alpha.
of any type, preferably one selected from IFN-.alpha.-2a,
IFN-.alpha.-2b, IFN-.alpha.-5, consensus interferon, purified
IFN-.alpha., pegylated IFN-.alpha. and combinations thereof. In
another additional preferred embodiment, the IFN-.alpha. is
selected from pegylated IFN-.alpha.-2b, pegylated IFN-.alpha.-2a,
pegylated IFN-.alpha.-5 and combinations thereof.
[0039] In a specific embodiment, the DNA sequence which codes for
the IL-6 family cytokine (whether complete, an active fraction or a
polypeptide derivative) or the IFN-.alpha. in the kit is
incorporated into an expression vector.
[0040] In the kit of the present invention, the first component and
the second component may comprise, in addition, at least one
pharmaceutically acceptable excipient which is compatible with the
IL-6 family cytokine--or a DNA sequence that codes for it--and with
the IFN-.alpha.--or a DNA sequence that codes for it--.
[0041] According to the present invention, the kit defined above
may comprise the first and the second components in separate
pharmaceutical compositions; or else the first and the second
components may be present in the kit in the same pharmaceutical
composition.
[0042] This kit may also comprise a third component, which
comprises one or more excipients that are pharmaceutically
compatible with the IL-6 family cytokine--or a DNA sequence that
codes for it--and with the IFN-.alpha.--or a DNA sequence that
codes for it--.
[0043] Said third component may comprise, in addition, one or more
carrier agents which are pharmaceutically compatible with the IL-6
family cytokine--or a DNA sequence that codes for it--and with the
IFN-.alpha.--or a DNA sequence that codes for it--.
[0044] An additional object of the present invention is a method
for the treatment of a viral disease which comprises administering
in a combined manner a therapeutically effective quantity of at
least one IL-6 family -gp130 family--cytokine (whether complete, an
active fraction or a polypeptide derivative, as they have been
previously defined), or a DNA sequence that codes for it, and a
therapeutically effective quantity of at least one IFN-.alpha., or
a DNA sequence that codes for it.
[0045] In a specific embodiment, the DNA sequence that codes for
the IL-6 family cytokine or the IFN-.alpha. of the method is
incorporated into an expression vector.
[0046] In the method defined above, the viral disease may be
produced by the encephalomyocarditis virus, hepatitis B and C, HIV,
cutaneous viral infections (chicken-pox, herpes zoster, measles),
respiratory viral infections, viral infections of the central
nervous system, hepatic viral infections, viral infections of the
salivary glands, infectious mononucleosis and genital warts.
[0047] According to a preferred embodiment of the method of the
invention, the viral disease is hepatitis C.
[0048] According to the method of the invention, the IL-6 family
cytokine is preferably selected from IL-6, IL-11,
leukemia-inhibiting factor, oncostatin M, cardiotrophin-1, ciliary
neurotrophic factor, cardiotrophin-like cytokine and combinations
thereof; even more preferably, the IL-6 family cytokine is
cardiotrophin-1 or oncostatin M.
[0049] In the method defined according to the invention, the
IFN-.alpha. is any type of IFN-.alpha.. In a preferred embodiment,
it is selected from IFN-.alpha.-2a, IFN-.alpha.-2b, IFN-.alpha.-5,
consensus interferon, purified IFN-.alpha., pegylated IFN-.alpha.
and combinations thereof; in another additional preferred
embodiment, the IFN-.alpha. is selected from pegylated
IFN-.alpha.-2b, pegylated IFN-.alpha.-2a, pegylated IFN-.alpha.-5
and combinations thereof.
[0050] Furthermore, according to the method of the invention, the
latter may comprise the combined and simultaneous administration of
the interleukin family cytokine, preferably cardiotrophin-1, and
the IFN-.alpha..
[0051] In this method, the IL-6 family cytokine (whether complete,
an active fraction or a polypeptide derivative) and the IFN-.alpha.
may be present in the same pharmaceutical composition which is
administered to the patient; or else the IL-6 family cytokine and
the IFN-.alpha. may be administered in separate pharmaceutical
compositions.
[0052] The present invention shows that, when the hepatic cells
which comprise a complete HCV replicon are stimulated with
IFN-.alpha. and an IL-6 family interleukin, particularly
cardiotrophin-1 or oncostatin M:
[0053] (1) the inhibiting effect of HCV on STAT3 phosphorylation,
which takes place when the cells are incubated with IFN-.alpha.
alone or with an IL-6 family cytokine (for example, CT-1 or OSM)
alone, is overcome.
[0054] (2) there is a higher induction of interferon-sensitive
genes (ISGs), such as 2'-5'-oligoadenylate synthase (2'-5'OAS), and
higher levels of STAT1 and STAT3 than when the cells are incubated
with cytokine alone; and
[0055] (3) replication of the virus is more effectively inhibited
than when cytokine is used alone.
[0056] (4) Interaction between IFN-.alpha. and CT-1, or between
IFN-.alpha. and OSM, is of strong sinergism.
BRIEF DESCRIPTION OF THE FIGURES
[0057] FIG. 1 shows an analysis of the phosphorylation of STAT1,
STAT2 and STAT3. Huh7 cells (Huh7) and Huh7 cells containing a
complete genomic HCV replicon (Core-3') were treated for 15, 60 and
120 minutes with 50 IU/ml of IFN-.alpha.-2 (IFN-.alpha.) or with 20
ng/ml of cardiotrophin-1 (CT-1), or with a combination of
IFN-.alpha.-2 and CT-1, and the quantities of phosphorylated STAT1,
STAT2 and STAT3 present in the cellular extracts were analysed by
means of Western blot.
[0058] FIG. 2 shows a quantitative real-time RT-PCR analysis of the
STAT1, STAT3 and 2'-5'OAS mRNA present in Huh7 cells containing a
complete HCV replicon, treated for 3 days with 5 or 50 IU/ml of
IFN-.alpha.-2 (IFN 5, IFN 50), alone (-CT) or in combination with
20 ng/ml of CT-1 (+CT); and with 5 or 50 IU/ml of IFN-.alpha.-2,
alone (-OSM) or in combination with 20 ng/ml of OSM (+OSM).
Control: untreated cells.
[0059] FIG. 3 shows a quantitative real-time RT-PCR analysis of the
HCV RNA present in Huh7 cells containing a complete HCV replicon,
treated for 3 days with 5 or 50 IU/ml of IFN-.alpha.-2 or
IFN-.alpha.-5, and 20 ng/ml of CT-1 or OSM or IL-6.
[0060] FIG. 4 shows the antiviral comparative effect of the
combination IFN-.alpha.-2 or IFN-.alpha.-5 (5 U/ml) plus CT-1 or
OSM or IL-6 (20 ng/mL), by RT-PCR in real time, of the HCV RNA
present in Huh7 cells containing a complete HCV replicon treated
for 3 days with said cytokines.
[0061] FIG. 5 shows the percentage of Huh7 cells protected against
infection by the encephalomyocarditis virus. Huh7 cells were
pre-treated for 24 hours with 5 ng/ml or 50 ng/ml of CT-1 and
different quantities of IFN-.alpha.-2, and were infected with
10.sup.5 PFU of the encephalomyocarditis virus (EMCV), and, after
24 hours, the cells were dyed with crystal violet stain in order to
measure the quantity of viable cells.
EMBODIMENTS OF THE INVENTION
Experiment 1
Study of the Effect of the Combination of IFN-.alpha.-2 and CT-1 on
the Signalling Cascade in Cells that Maintain HCV Replication (FIG.
1)
[0062] In non-transfected Huh7 cells (a hepatoma cell line), the
addition of 50 IU/ml of IFN-.alpha.-2 (IFN-.alpha.-2) induced the
phosphorylation of STAT1, STAT2 and STAT3, with maximum activation
of STAT1 and STAT2 at 1 hour and 2 hours, and of STAT3 at 1 hour
(see FIG. 1A). However, in Huh7 cells transfected with a
full-length HCV replicon, a marked inhibition of STAT1, STAT2 and
STAT3 phosphorylation was observed after incubation with
IFN-.alpha.-2. Therefore, there was a complete absence of activated
STAT3 and STAT1 and a marked inhibition of STAT2 activation (see
FIG. 1A).
[0063] On the other hand, in non-transfected Huh7 cells, it was
found that the addition of 20 ng/ml of CT-1 led to the activation
of both STAT3 and STAT1 (more intensely in the case of STAT3), with
maximum values at 15 minutes and 1 hour, and a substantial decrease
at 2 hours (FIG. 1B). As expected, CT-1 did not induce any STAT2
activation. In Huh7 cells transfected with a complete HCV replicon,
the activation of STAT3 by CT-1 was substantially reduced, whilst
the phosphorylation of STAT1 was only slightly affected (FIG.
1B).
[0064] When non-transfected Huh7 cells were incubated with a
mixture of 50 IU/ml of IFN-.alpha.-2 and 20 ng/ml of CT-1, a more
intense and lasting phosphorylation of STAT3 and STAT1 was detected
than when the cells were incubated with each of the cytokines
alone. The activation of STAT2 was similar to that found with
IFN-.alpha.-2 alone. It is significant that, when the Huh7 cells
transfected with a complete HCV replicon were incubated with the
IFN-.alpha.-2 (50 IU/ml) plus CT-1 (20 ng/ml) mixture, STAT3
phosphorylation took place without any damage, with the activation
of STAT3 being not only more intense, but also more lasting than
when the non-transfected cells were incubated with IFN-.alpha.-2
alone (FIG. 1C). This fact is noteworthy, because, as has been
mentioned (and is shown in FIGS. 1A and 1B), HCV replication in
Huh7 cells seriously reduces the activation of STAT3 by both
IFN-.alpha.-2 and by CT-1 separately, and it is therefore
surprising that this blockage disappears by incubating the cells
with the two cytokines together; this opens a new prospect for a
promising strategy in the treatment of viral diseases. It must also
be noted that, when IFN-.alpha.-2 and CT-1 are combined to treat
cells with HCV replication, not only is a potent, sustained
activation of STAT3 produced, but also an activation of STAT1
similar to that found when non-transfected cells are incubated with
CT-1 alone and more intense than when non-transfected cells are
incubated with IFN-.alpha.-2 alone (compare FIGS. 1A and 1B). It is
important to note that IFN-.alpha.-2 was unable to activate STAT1
in cells with sustained HCV replication, whilst the combination of
CT-1 plus IFN-.alpha.-2 was able to very effectively activate this
important antiviral factor in cells with HCV replication. This
clearly shows that combining IFN-.alpha.-2 and CT-1 leads to an
improvement in antiviral activity, allowing for STAT2
phosphorylation, albeit at levels that are clearly lower than when
cells without HCV replication are used (see FIG. 1C).
[0065] In conclusion, when the cells with sustained HCV replication
were treated with IFN-.alpha.-2 in an isolated fashion, there was
no STAT1 and STAT3 activation, and only low levels of STAT2 were
observed. The absence of activated STAT1 and STAT3--two important
inducers of the cell's antiviral state--could prevent the formation
of the STAT1-STAT2 heterodimers, the STAT1-STAT3 heterodimers, and
the STAT1 and STAT3 homodimers, thus collapsing the cell's
antiviral defence. The use of CT-1 in combination with
IFN-.alpha.-2 allows for the formation of high levels of activated
STAT1 and STAT3, thus restoring the cell's viral resistance
mechanism.
[0066] In the experiments shown in FIG. 1, one can see that the HCV
infection not only leads to a defective activation of STAT1, but
also to a reduction in the STAT3 and STAT2 protein levels. The
studies represented in FIG. 1 show the short-term effects of
incubation with either IFN-.alpha.-2 or CT-1, or with a combination
of both. The experiments described below show that, with incubation
for 72 hours, one can observe that the combined treatment with CT-1
and IFN-.alpha.-2, or OSM and IFN-.alpha.-2, led to an increased
expression of STAT3, thus counteracting the effect of HCV in the
infected cells (see FIG. 2).
Experimental Method 1
[0067] Establishment of Huh7 cell lines carrying the full-length
HCV replicon. Huh7 cells were established which expressed the
full-length HCV replicon as has been described [9]. In sum,
pI.sub.389/Core-3'/5.1 were linearised with Scat (New England
Biolabs, USA) and were used as templates for RNA synthesis using T7
RNA polymerase (Promega, USA). 20 .mu.g of synthesised RNA were
used to electrophore 10.sup.7 Huh7 cells and, 24 hours later, 500
.mu.g/ml of G418 (Gibco, USA) were added. Twice a week, the
supplemented culture medium was replaced by G418 and, 4 weeks after
transfection, the mixed colonies resistant to G418 were collected
and used for subsequent analysis.
[0068] Western-blot analysis. Huh7 cells which either expressed the
full-length HCV replicon or not were seeded at 200,000/well in
6-well plates in D-MEM (Gibco) with 10% FCS (Gibco). 50 IU/ml of
IFN-.alpha.-2 (Intron A, Schering-Plough), or 20 ng/ml of CT-1
(R&D Systems, UK), or a combination of IFN-.alpha.-2 (50 IU/ml)
plus CT-1 (20 ng/ml) were added for different periods of time: 15
minutes, 1 hour and 2 hours. Subsequently, the Huh7 cells were
lysed in lysis buffer (60 mM Tris-HCl pH 6.8, 2% SDS, 2.5%
glycerol, 0.7 M 2-mercaptoethanol and 0.02% bromophenol blue). The
samples were resolved in SDS-polyacrylamide gels (Bio-Rad
Laboratories, CA) at 7.5% under reducing conditions. Following
electrophoresis, they were transferred to nitrocellulose membranes
(Bio-Rad Laboratories) and dyed with Ponceau red solution
(Sigma-Aldrich, Germany), in order to verify that there was an
equal load of proteins. The membranes were incubated in TBS-T (50
mM Tris-HCl (pH 7.6), 200 mM NaCl and 0.1% Tween-20) with 5%
dehydrated milk. The proteins were detected by incubation with the
specific primary antibody in TBS-T for 1 hour. The membranes were
subsequently washed in TBS-T and secondary antibody conjugated with
peroxidase was added for 1 hour. The membranes were subject to
extensive washing in TBS-T and the specific protein bands were
viewed using the "Western Lightning Chemiluminescence Reagent Plus"
chemiluminescence detection system (Perkin Elmer, USA), following
the manufacturer's instructions. Subsequently, the membranes were
autoradiographed and the bands were quantified by means of
densitometric analysis performed by means of the Molecular
Analyst/PC programme (Bio-Rad Laboratories).
[0069] Antibodies. The anti-phospho-STAT1.sup.tyr701 and
anti-phospho-STAT3.sup.tYr705 antibodies and the anti-rabbit IgG
antibody conjugated to HRP were purchased from Cell Signaling
Technology (USA). The anti-STAT3, anti-phospho-STAT1.sup.ser727,
anti-STAT2 and anti-phospho-STAT2.sup.tyr689 antibodies were
obtained from Upstate Biotechnology (USA). The anti-STAT1 antibody
was from Santa Cruz Biotechnology (Santa Cruz, Calif.). The
anti-actin antibody was from Sigma-Aldrich (Germany).
[0070] In order to determine whether the combination of an IL-6
family cytokine with IFN-.alpha. leads to a stronger antiviral
state in the cell, we performed additional experiments designed to:
a) evaluate whether the combination therapy of IFN-.alpha. plus the
IL-6 family cytokine can increase the expression of
interferon-sensitive genes more intensely than any of the cytokines
by itself; b) determine whether the combination therapy of
IFN-.alpha. plus the IL-6 family cytokine could be more potent in
inhibiting HCV replication than each cytokine separately; c)
evaluate whether the combination therapy of IFN-.alpha.-2 plus CT-1
could be more efficient in defending the cells against the
cytopathic effects of a non-HCV-related virus, and; d)
determination of the kind of interaction between IFN-.alpha. and
the IL-6 family cytokine.
Experiment 2
Evaluation of the Effect of the Combination Therapy of
Ifn-.alpha.-2 Plus CT-1, or IFN-.alpha.-2 Plus OSM, on the
Induction of Interferon-Sensitive-Genes (ISGs) (FIG. 2)
[0071] The expression of the ISGs 2'-5'OAS, STAT1 and STAT3 was
studied on Huh7 cells carrying the HCV replicon after incubation
for 72 hours with IFN-.alpha.-2 (5 or 50 IU/ml) or CT-1 (20 ng/ml),
or OSM (20 ng/ml), or IFN-.alpha.-2+OSM combined (see FIGS. 2A-2F).
We observe that, whilst CT-1 or OSM by itself were not able to
increase or weakly the expression of these ISGs, the addition of
CT-1 or OSM to low or high doses of IFN-.alpha.-2 led to a marked
increase in the expression of the ISGs, which indicates that CT-1
or OSM can significantly enhance the capacity of IFN-.alpha.-2 to
increasingly regulate antiviral genes in cells supporting viral
replication. Although the three ISGs analysed herein have
significant antiviral effects, the increase in the expression of
STAT3 by combining CT-1 or OSM and IFN-.alpha.-2 is particularly
relevant, since this factor does not only have antiviral
properties, but also exhibits a potent cytoprotection and
anti-inflammatory activity.
Experimental Method 2
[0072] Real-time RT-PCR analysis of the expression of the ISGs'
mRNA. Huh7 cells expressing the full-length HCV replicon were
seeded at 100,000/well in 6-well plates in D-MEM (Gibco), with 10%
FCS (Gibco). 50 or 5 IU/ml of IFN-.alpha.-2 by itself or in
combination with 20 ng/ml of CT-1, or with 20 ng/ml OSM, were
added. The cell culture was maintained for three days. The
supplemented culture medium was replaced daily with said cytokines.
The total RNA was obtained following the "Ultraspec RNA Isolation
System" protocol (Biotech, USA), which is based on the method
described by Chomczynski and Sacchi [10]. Two micrograms of total
RNA were treated with DNAase (Gibco-BRL, UK) prior to reverse
transcription with M-MLV Reverse Transcriptase (Gibco BRL) in the
presence of RNaseOUT (Gibco-BRL). The expression of the STATs, the
2-5OAS and the .beta.-actin was measured by means of real-time PCR
using an Icycler and the IQ SYBR Green Supermix (Bio-Rad
Laboratories, CA). 2-.mu.l aliquots of the cDNA pool were used for
each PCR, which contained specific forward and reverse direction
primers for each gene (Table 1) in a final volume of 20 .mu.l. In
order to determine the specificity of the obtained PCR products,
their dissociation temperature was analysed. The results were
normalised on the basis of the quantification of .beta.-actin in
the same sample. The quantity of each transcript was expressed
through the formula 2.sup.ct(actin)-ct(gene), with ct being the
point at which the fluorescence significantly increases above the
background fluorescence.
TABLE-US-00001 TABLE 1 Primers used in this study Forward direction
Reverse direction Gene primer (5'-3') primer (5'-3') 2'-5'OAS SEQ.
ID. NO: 1 SEQ. ID. NO: 2 TTAAGAGGCAACTCCGATGG AGCAGACTGCAAACTCACCA
STAT1 SEQ. ID. NO: 3 SEQ. ID. NO: 4 GCTATTCACAACCACTCATTCA
ACAAGATACAGCCACATAGACA STAT3.alpha. SEQ. ID. NO: 5 SEQ. ID. NO: 6
GTCCGTGGAACCATACACAA CAATGGTATTGCTGCAGGTG .beta.-actin SEQ. ID. NO:
7 SEQ. ID. NO: 8 AGCCTCGCCTTTGCCGA CTGGTGCCTGGGGCG HCV SEQ. ID. NO:
9 SEQ. ID. NO: 10 CCTGTGAGGAACTACTGTCT CTATCAGGCAGTACCACAAG
Experiment 3
Study of the Effects of the Combination of IFN-.alpha.-2 Plus an
IL-6 Family Cytokine on HCV Replication in Huh7 Cells Transfected
with the Full-Length HCV Replicon (FIG. 3)
[0073] Due to the stronger induction of ISGs observed upon
combining IFN-.alpha.-2 plus CT-1 or OSM, it was desired to analyse
whether this combination was superior to IFN-.alpha.-2 by itself,
or to the IL-6 family cytokine by itself, in the reduction of the
viral load in cells with the full-length HCV replicon. Thus, Huh7
cells carrying the HCV replicon were incubated with IFN-.alpha.
(IFN-.alpha.-2 or IFN-.alpha.-5, at 5 or 50 IU/ml) plus or minus
the IL-6 family cytokine (IL-6, CT-1, OSM; at 20 ng/ml); or with
the IL-6 family cytokines by themselves. The quantity of HCV RNA
was measured after 72 hours of culture (FIGS. 3.sup.a, 3B, 3C). In
FIG. 3, one can see that the IL-6 family cytokines: IL-6, CT-1 and
OSM by themselves have a modest antiviral effect. However, CT-1 and
OSM strongly enhanced the antiviral effect both of IFN-.alpha.-2 as
of IFN-.alpha.-5 when these cytokines were used at low (5 IU/ml) or
high (50 IU/ml) doses (FIGS. 3A and 3B). IL-6 enhanced in a weaker
way the antiviral effect, both of IFN-.alpha.-2 as of IFN-.alpha.-5
(FIG. 3C). Thus, the combination therapy of IFN-.alpha.-2 or
IFN-.alpha.-5 plus CT-1 or OSM increases the antiviral effect of
IFN-.alpha. by an approx. factor of 5 and 10 respectively. Further,
the combination therapy of IFN-.alpha.-2 or IFN-.alpha.-5 plus IL-6
enhances it in an approx. factor of 2.
[0074] In FIG. 4 it is comparatively represented the enhanced
effect of the IL-6, the CT-1 and the OSM (20 ng/mL) on the
antiviral action of the IFN-.alpha.-2 (5 U/mL) (FIG. 4A) or of the
IFN-.alpha.-5 (FIG. 4B). The higher enhancer antiviral effect of
the combinations IFN-.alpha./CT-1 and IFN-.alpha./OSM against the
combination IFN-.alpha./IL-6 is clearly observed.
Experimental Method 3
[0075] Quantitative real-time PCR analysis of HCV RNA. Huh7 cells
expressing the full-length HCV replicon were seeded at 100,000/well
in 6-well plates in D-MEM with 10% FCS. 50 or 5 IU/ml of
IFN-.alpha.-2 or IFN-.alpha.-5 by themselves, or in combination
with 20 ng/ml of CT-1 or OSM or IL-6 were added. The cell culture
was maintained for three days. The supplemented culture medium was
replaced daily with said cytokines.
[0076] The total RNA of Huh7 cells transfected with the full-length
HCV replicon was obtained following the "Ultraspec RNA Isolation
System" protocol (Biotech, USA), which is based on the method
described by Chomczynski and Sacchi [10]. Two micrograms of total
RNA were treated with DNAase (Gibco-BRL) prior to reverse
transcription with M-MLV Reverse Transcriptase (Gibco BRL) in the
presence of RNaseOUT (Gibco-BRL). The expression of the HCV RNA and
the .beta.-actin mRNA was measured by quantitative real-time PCR
using an Icycler and the IQ SYBR Green Supermix (Bio-Rad
Laboratiories). 2-.mu.l aliquots of the cDNA pool were used for
each PCR, which contained specific forward and reverse direction
primers for the 5 non-translated region of the HCV or the
.beta.-actin gene (Table 1) in a final volume of 20 .mu.l. In order
to determine the specificity of the PCR products, their
dissociation temperature was analysed. The results were normalised
on the basis of the quantification of .beta.-actin in the same
sample. The quantity of HCV RNA was expressed through the formula
2.sup.ct(actin)-ct(HCV), with ct being the point at which the
fluorescence significantly increases above the background
fluorescence.
Experiment 4
Study of the Effects of the Combination of IFN-.alpha.-2 Plus CT-1
in the Defence Against the Cytopathic Effects of the
Encephalomyocarditis Virus (EMCV) (FIG. 5)
[0077] In order to determine whether the synergic effect of
combination therapy is also produced in other viral infections
different from HCV, we analysed the protection obtained with this
treatment against the cytopathic effect of EMCV in Huh7 cells. Huh7
cells were incubated with decreasing doses of IFN-.alpha.-2, from
250 to 1 IU/ml, in the presence or absence of a low (5 ng/ml) or
high (50 ng/ml) dose of CT-1 and were infected with EMCV 24 hours
later. We observe that CT-1 by itself (at a low or high dose) had
little cytoprotection effect on the EMCV-infected cells, since the
addition of this cytokine at very low doses of IFN-.alpha.-2 did
not improve cell viability. However, CT-1, at both low and high
doses, markedly increased the protection induced by IFN-.alpha.-2
against the cytopathic effect of EMCV. This synergy was observed
upon using IFN-.alpha.-2 doses between 250 and 28 IU/ml, with the
synergy being most pronounced at IFN-.alpha.-2 doses of 83 and 28
IU/ml. These data show that the antiviral synergy of IFN-.alpha.-2
and CT-1 is not limited to HCV, but is applied to a broad range of
viral diseases.
Experimental Method 4
[0078] Cytoprotection assay of IFN-.alpha.-2 and CT-1 against EMCV
in Huh7 cells. The cytoprotection activity of IFN-.alpha.-2 and
CT-1 was determined by measuring these cytokines' capacity to
protect Huh7 cells against the cytopathic effect of the
encephalomyocarditis virus. The assay was performed on a 96-well
microtitre plate. Firstly, 2.times.10.sup.4 Huh7 cells per well
were seeded in 150 .mu.l of a medium containing serial dilutions of
IFN-.alpha.-2 by itself (from 250 to 1 IU/ml) or these serial
dilutions of IFN-.alpha.-2 plus 50 or 5 ng/ml of CT-1, and they
were incubated for 24 hours. 10.sup.5 PFU of EMC virus were added
per well and the cytopathic effect at 24 hours was measured as
follows: after eliminating the medium, the wells were washed twice
with PBS and dyed with crystal violet colouring solution (0.5% in
methanol-water 1:4 v/v). The optical density at 540 nm was read.
The results are expressed as the percentage of cells protected
against the cytopathic effect of EMCV.
Experiment 5
Study of the Effects Between IFN-.alpha. and Various Interleukin 6
Family Cytokines on HCV Replication in Huh7 Cells Transfected with
the Full-Length HCV Replicon
[0079] Due to the enhancer antiviral effect shown by the
combination of IFN-.alpha. and an IL-6 family cytokine, it was
desired to determine the kind of interaction set up in the
combination of IFN-.alpha.-2 or IFN-.alpha.-5 with the IL-6 family
cytokines: IL-6, OSM and CT-1.
[0080] Several antiviral tests were performed combining fixed
concentrations of IFN-.alpha.-2 and IFN-.alpha.-5 (5 or 50 IU/ml)
with or without IL-6, OSM and CT-1 (20 ng/mL) in Huh7 cells
transfected with the full-length HCV replicon. Mathematical
analysis on the kind of interaction set up between IFN-.alpha. and
the IL-6 family cytokines was performed by multi-variant analysis
according to the method described by T. C. Chou (11). The kind of
interaction between two substances is measured by a factor named
Interaction Index "I", where I=d1/D1+d2/D2; being d1, d2, the
inhibitors rates on the combination, and D1, D2, the rate of each
inhibitor that would effect the same effect as the combination.
Then, "I" equal to 1 means that both substances do not react
between them (additive effect); "I" lower than 1 means that the
combination is synergic; and a value of "I" larger than 1 means
that the combination is antagonist. Table 2 shows standard synergic
rates in respect to the value of "I".
TABLE-US-00002 TABLE 2 INTERACTION INDEX (I) KIND OF SYNERGISM
0.1-0.3 STRONG SYNERGISM 0.3-0.7 SYNERGISM 0.7-0.85 MODERATE
SYNERGISM 0.85-0.89 LIGHT SYNERGISM 0.90-1.10 ADDITIVE EFFECT
[0081] Interaction indexes obtained for the different combination
of IFN-.alpha. and the previously described IL-6 family cytokines
were in all cases lower than 1, thus the combination of IFN-.alpha.
(2 or 5) and such cytokines IL-6, OSM and CT-1 being synergic
(Table 3). Furthermore, the obtained data show that the synergic
effect is always remarkable higher at combinations IFN-.alpha./OSM
and IFN-.alpha./CT-1 (I<0.3 strong synergism) that at the
combination IFN-.alpha./IL-6 (I<0.7 synergism)
TABLE-US-00003 TABLE 3 CYTOKINE COMBINATION INTERACTION INDEX (I)
IFN-.alpha.-2 (5 U/mL) + OSM (20 ng/mL) 0.29 IFN-.alpha.-2 (50
U/mL) + OSM (20 ng/mL) 0.11 IFN-.alpha.-5 (5 U/mL) + OSM (20 ng/mL)
0.26 IFN-.alpha.-5 (50 U/mL) + OSM (20 ng/mL) 0.17 IFN-.alpha.-2 (5
U/mL) + CT-1 (20 ng/mL) 0.22 IFN-.alpha.-2 (50 U/mL) + CT-1 (20
ng/mL) 0.25 IFN-.alpha.-5 (5 U/mL) + CT-1 (20 ng/mL) 0.25
IFN-.alpha.-5 (50 U/mL) + CT-1 (20 ng/mL) 0.13 IFN-.alpha.-2 (5
U/mL) + IL-6 (20 ng/mL) 0.44 IFN-.alpha.-2 (50 U/mL) + IL-6 (20
ng/mL) 0.45 IFN-.alpha.-5 (5 U/mL) + IL-6 (20 ng/mL) 0.40
IFN-.alpha.-5 (50 U/mL) + IL-6 (20 ng/mL) 0.29
Experimental Method 5
[0082] Quantitative real-time PCR analysis of the HCV RNA. Huh7
cells expressing the full-length HCV replicon were seeded at
20,000/well in 24-well plates in D-MEM with 10% FCS. Different
experiments were performed; 50 or 5 IU/ml of IFN-.alpha.-2 or
IFN-.alpha.-5 with or without 20 ng/ml of CT-1, OSM or IL-6
(R&D Systems, UK) were added. The cell culture was maintained
for three days. The supplemented culture medium was replaced with
said cytokines daily.
[0083] The total RNA of Huh7 cells transfected with the full-length
HCV replicon was obtained using the Kit Nucleic Acid Purification
Lysis Solution (Applied BioSystems, Foster City, Calif.) and the
semi-automatic system ABI PRISM 6100 Nucleic Acid PrepStation
(Applied BioSystems). Two micrograms of total RNA were treated with
DNAase (Gibco-BRL) prior to reverse transcription with M-MLV
Reverse Transcriptase (Gibco BRL) in the presence of RNaseOUT
(Gibco-BRL). The expression of the HCV RNA and the .beta.-actin
mRNA was measured by quantitative real-time PCR using an Icycler
and the IQ SYBR Green Supermix (Bio-Rad Laboratiories). 2-.mu.l
aliquots of the cDNA pool were used for each PCR, which contained
specific forward and reverse direction primers for the 5
non-translated region of the HCV or the .beta.-actin gene (Table 1)
in a final volume of 20 .mu.l. In order to determine the
specificity of the PCR products, their dissociation temperature was
analysed. The results were normalised on the basis of the
quantification of 13-actin in the same sample. The quantity of HCV
RNA was expressed through the formula 2.sup.ct(actin)-ct(HCV),
being ct the point at which the fluorescence significantly
increases above the background fluorescence.
[0084] For the calculation of the Interaction Index the following
equation was applicable:
I=d1/D1+d2/D2
REFERENCES
[0085] 1. Hoofangle J H, Peters M, Mullen K D, Jones D B, Rustgi V,
Di Bisceglie A, Hallahan C, Park Y, Meschievitz C, Jones E A.
Randomized, Controlled Trial of Recombinant Human Alpha-Interferon
in Patients with Chronic Hepatitis B. Gastroenterlogy 1988;
95:1318-1325. [0086] 2. Manns M P, McHutchison J G, Gordon S C,
Rustgi V K, Shiffman M, Reindollar R, Goodman Z D, Koury K, Ling M,
Albrecth J K. Peginterferon Alfa-2b plus Ribavirin Compared with
Interferon Alfa-2b plus Ribavirin for Initial Treatment of Chronic
Hepatitis C: A Randomized Trial. Lancet 2001; 358:958-965. [0087]
3. Gale M J, Jr., Korth M J, Tang N M, Tan S L, Hopkins D A, Dever
T E, Polyak S J, Gretch D R, Katze M G. Evidence that Hepatitis C
Virus Resistance to Interferon Is Mediated through Repression of
the PKR Protein Kinase by the Nonstructural 5A Protein. Virology
1997; 230:217-227. [0088] 4. Taylor D R, Shi S T, Romano P R,
Barber G N, Lai M M Inhibition of the Interferon-Inducible Protein
Kinase PKR by HCV E2 Protein. Science 1999; 285:107-110. [0089] 5.
Blindenbacher A, Duong F H, Hunziker L, Stutvoet S T, Wang X,
Terracciano L, Moradpour D, Blum H E, Alonzi T, Tripodi M, La
Monica N, Heim M H. Expression of Hepatitis C Virus Protein
Inhibits Interferon Alpha Signalling in the Liver of Transgenic
Mice. Gastroenterology 2003; 124:1465-1475. [0090] 6. Duong F H,
Filipowicz M, Tripodi M, La Monica N, Heim M H. Hepatitis C Virus
Inhibits Interferon Signaling through Up-Regulation of Protein
Phosphatase 2A. Gastroenterology 2004; 126:263-277. [0091] 7.
Heinrich P C, Behrmann I, Muller-Newen G, Schaper F, Graeve L.
IL-6-Type Cytokine Signalling through the 130/Jak/STAT Pathway.
Biochem J 1998; 334:297-314. [0092] 8. Zhu H, Shang X, Terada N,
Liu C. STAT3 Induces Anti-Hepatitis C Viral Activity in Liver
Cells. Biochem Biophys Res Commun 2004; 324:518-528. [0093] 9.
Pietschmann T, Lohmann V, Kaul A, Krieger N, Rinck G, Rutter G,
Strand D, Bartenschlager R. Persistent and Transient Replication of
Full-Length Hepatitis C Virus Genomes in Cell Culture. J Virol
2002; 76:4008-4021. [0094] 10. Chomczynski P, Sacchi N. Single-Step
Method of RNA Isolation by Acid Guanidium
Thiocyanate-Phenol-Chloroform Extraction. Anal Biochem 1987;
162:156-159. [0095] 11. Chou T C. Synergism and Antagonism in
chemotherapy 1991; 61-102. Academic Press.
Sequence CWU 1
1
10120DNAArtificialSynthetic Construct; Synthetic Oligonucleotide
1ttaagaggca actccgatgg 20220DNAArtificialSynthetic Construct;
Synthetic Oligonucleotide 2agcagactgc aaactcacca
20322DNAArtificialSynthetic Construct; Synthetic Oligonucleotide
3gctattcaca accactcatt ca 22422DNAArtificialSynthetic Construct;
Synthetic Oligonucleotide 4acaagataca gccacataga ca
22520DNAArtificialSynthetic Construct; Synthetic Oligonucleotide
5gtccgtggaa ccatacacaa 20620DNAArtificialSynthetic Construct;
Synthetic Oligonucleotide 6caatggtatt gctgcaggtg
20717DNAArtificialSynthetic Construct; Synthetic Oligonucleotide
7agcctcgcct ttgccga 17815DNAArtificialSynthetic Construct;
Synthetic Oligonucleotide 8ctggtgcctg gggcg
15920DNAArtificialSynthetic Construct; Synthetic Oligonucleotide
9cctgtgagga actactgtct 201020DNAArtificialSynthetic Construct;
Synthetic Oligonucleotide 10ctatcaggca gtaccacaag 20
* * * * *