U.S. patent application number 11/992731 was filed with the patent office on 2011-02-03 for interleukin-1 conjugates and uses thereof.
This patent application is currently assigned to Cytos Biotechnology AG. Invention is credited to Martin Bachmann, Gunther Spohn, Alain Tissot.
Application Number | 20110027220 11/992731 |
Document ID | / |
Family ID | 37497973 |
Filed Date | 2011-02-03 |
United States Patent
Application |
20110027220 |
Kind Code |
A1 |
Bachmann; Martin ; et
al. |
February 3, 2011 |
Interleukin-1 Conjugates and Uses Thereof
Abstract
The present invention is related to the fields of molecular
biology, virology, immunology and medicine. The invention provides
a composition comprising an ordered and repetitive antigen array,
wherein the antigen is an IL-1 protein, an IL-1 mutein or an IL-1
fragment. More specifically, the invention provides a composition
comprising a virus-like particle, and at least one IL-1 protein,
IL-1 mutein or at least one IL-1 fragment linked thereto. The
invention also provides a process for producing the composition.
The compositions of the invention are useful in the production of
vaccines for the treatment of inflammatory diseases, and chronic
autoimmune diseases, genetic diseases and cardiovascular diseases.
The composition of the invention efficiently induces immune
responses, in particular antibody responses. Furthermore, the
compositions of the invention are particularly useful to
efficiently induce self-specific immune responses within the
indicated context.
Inventors: |
Bachmann; Martin; (Seuzach,
CH) ; Spohn; Gunther; (Zurich, CH) ; Tissot;
Alain; (Zurich, CH) |
Correspondence
Address: |
STERNE, KESSLER, GOLDSTEIN & FOX P.L.L.C.
1100 NEW YORK AVENUE, N.W.
WASHINGTON
DC
20005
US
|
Assignee: |
Cytos Biotechnology AG
Schlieren
CH
|
Family ID: |
37497973 |
Appl. No.: |
11/992731 |
Filed: |
September 28, 2006 |
PCT Filed: |
September 28, 2006 |
PCT NO: |
PCT/EP2006/066866 |
371 Date: |
October 25, 2010 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60721106 |
Sep 28, 2005 |
|
|
|
Current U.S.
Class: |
424/85.2 ;
530/351 |
Current CPC
Class: |
C07K 14/545 20130101;
A61P 25/08 20180101; A61P 1/04 20180101; A61P 9/10 20180101; C07K
2319/00 20130101; A61P 19/10 20180101; A61P 29/00 20180101; A61P
37/02 20180101; A61P 25/28 20180101; C07K 14/005 20130101; C12N
7/00 20130101; A61K 38/00 20130101; A61P 19/02 20180101; A61P 19/08
20180101; A61P 25/00 20180101; A61P 17/04 20180101; A61P 19/00
20180101; A61P 37/00 20180101; A61P 17/06 20180101; A61P 25/16
20180101; A61P 19/06 20180101; A61P 37/08 20180101; A61P 29/02
20180101; A61P 37/06 20180101; C12N 2795/18122 20130101; A61K
2039/6075 20130101; A61P 9/00 20180101; A61K 2039/5258 20130101;
C12N 2795/18123 20130101 |
Class at
Publication: |
424/85.2 ;
530/351 |
International
Class: |
A61K 39/00 20060101
A61K039/00; C07K 14/54 20060101 C07K014/54; A61P 25/00 20060101
A61P025/00; A61P 19/00 20060101 A61P019/00; A61P 19/06 20060101
A61P019/06; A61P 9/10 20060101 A61P009/10; A61P 37/08 20060101
A61P037/08; A61P 29/00 20060101 A61P029/00 |
Claims
1. A composition comprising: (a) a virus-like particle (VLP) with
at least one first attachment site; and (b) at least one antigen
with at least one second attachment site; wherein said at least one
antigen is an IL-1 beta mutein, and wherein (a) and (b) are linked
through said at least one first and said at least one second
attachment site.
2. (canceled)
3. The composition of claim 1, wherein said IL-1 beta mutein is
derived from a human.
4.-13. (canceled)
14. The composition of claim 1, wherein said VLP comprises, or
alternatively consists of, recombinant coat proteins, mutants or
fragments thereof, of an RNA bacteriophage.
15. The composition of claim 1, wherein said VLP is a VLP of an RNA
bacteriophage.
16. The composition of claim 14, wherein said RNA bacteriophage is
an RNA bacteriophage selected from Q.beta. and AP205.
17. The composition of claim 1, wherein said first attachment site
is linked to said second attachment site via at least one covalent
non-peptide bond.
18. The composition of claim 1, wherein said first attachment site
an amino group of a lysine.
19. The composition of claim 1, wherein said second attachment site
a sulfhydryl group of a cysteine.
20. The composition of claim 1, wherein said first attachment site
is not a sulfhydryl group, or wherein said linkage of said VLP and
said at least one antigen, does not comprise a disulfide bond.
21. (canceled)
22. The composition of claim 1, wherein only one of said second
attachment sites associates with said first attachment site through
at least one non-peptide covalent bond leading to a single and
uniform type of binding of said IL-1 beta mutein to said virus-like
particle, wherein said only one second attachment site that
associates with said first attachment site is a sulfhydryl group,
and wherein said IL-1 beta mutein and said virus-like particle
interact through said association to form an ordered and repetitive
antigen array.
23. The composition of claim 1, wherein said antigen is fused to
the N- or the C-terminus of the coat protein, mutants or fragments
thereof, of AP205.
24. The composition of claim 1 further comprising a linker, wherein
said linker is associated to the IL-1 beta mutein by way of at
least one covalent bond, and wherein said linker comprises, or
alternatively consists of, said second attachment site.
25. The composition of claim 1, wherein said IL-1 beta mutein is a
mutein of SEQ ID NO:64.
26. (canceled)
27. A vaccine comprising, or alternatively consisting of, the
composition of claim 1.
28.-31. (canceled)
32. A method of treating a disease in an animal, said method
comprising administering the composition of claim 1 or the vaccine
of claim 27 to said animal, wherein said disease is selected from
the group consisting of: (a) vascular diseases; (b) inherited
IL-1-dependent inflammatory diseases; (c) chronic autoimmune
inflammatory diseases; (d) bone and cartilage degenerative
diseases; (e) allergic diseases; and (f) neurological disease.
33.-37. (canceled)
38. The composition of claim 1, wherein said IL-1 beta mutein
comprises or consist of a polypeptide having an amino acid sequence
selected from the group consisting of SEQ ID NO:131 to SEQ ID
NO:140.
39. The composition of claim 1, wherein said IL-1 beta mutein
comprises or alternatively consists of hIL-1.beta..sub.116-269
(D145K) (SEQ-ID NO:136).
40. The composition of claim 14, wherein said coat proteins have
the amino acid sequence of SEQ ID NO:3.
41. The composition of claim 15, wherein said RNA bacteriophage is
bacteriophage Q.beta..
42. The method of claim 32, wherein said disease is selected from
the group consisting of: (a) atherosclerosis; (b) familial
Mediterranean fever (FMF); (c) systemic onset juvenile idiopathic
arthritis or rheumatoid arthritis; (d) gout or osteoarthritis; and
(e) multiple sclerosis.
Description
FIELD OF THE INVENTION
[0001] The present invention is in the fields of medicine, public
health, immunology, molecular biology and virology. The invention
provides compositions comprising a virus-like particle (VLP) or a
virus particle and at least one antigen, wherein said antigen is an
Interleukin-1 (IL-1) protein, an IL-1 fragment or peptide or an
IL-1 mutein covalently linked to the VLP or the virus particle. The
invention also provides a process for producing the compositions.
The compositions of this invention are useful in the production of
vaccines for the treatment of various human disorders, including
rheumatoid arthritis osteoarthritis and others. The compositions of
the invention hereby induce efficient immune responses, in
particular antibody responses.
RELATED ART
[0002] IL-1 is a potent proinflammatory cytokine produced by
various cell types, including macrophages, dendritic cells, B-cells
and T-cells (Dinarello C. A., 1991. Blood 77(8):1627-1652). It
consists of two molecular species, IL-1.alpha. and IL-1.beta.,
which share only limited sequence identity but exert similar
biological activities through binding to IL-1 receptor type I
(IL-1RI) (Dinarello C. A. et al., 1997, Cytokine & Growth
Factor Rev. 8:253). Both IL-1 molecules also bind to a second IL-1
receptor (IL-1RII), which lacks the intracellular signalling
domain, and is believed to play a regulatory role as a decoy
receptor (Dinarello C. A. et al., 1997, Cytokine & Growth
Factor Rev. 8:253). In addition, a third member of the IL-1 family,
the IL-1 receptor antagonist (IL-1ra), binds to both receptors
without exerting any agonistic activity. IL-1ra together with IL-1
RII and the shed forms of IL-1RI and IL-1RII counteract the
activity of IL-1.alpha. and IL-1.beta. and ensure a tight
regulation of the inflammatory response.
[0003] A dysregulation of the IL-1-mediated inflammatory response
is observed in many human disorders, including rheumatoid
arthritis, inflammatory bowel disease, kidney diseases,
osteoporosis and others. In each of these diseases either
overproduction of IL-1 and/or underproduction of IL-1ra predisposes
to the development of disease (Arend W. P., 2002, Cytokine &
Growth Factor Reviews 13:323-340). A recombinant version of IL-1ra
(anakinra, Kineret.RTM.) is efficacious in reducing inflammation
and preventing tissue damage in several inflammatory disorders, but
the need for high systemic concentrations and the short half life
of the drug require frequent (daily) administrations of high doses
(.about.100 mg), resulting in high cost of goods and potential
patient compliance problems (Kineret.RTM. prescribing information,
Amgen; Granowitz E. V. et al. 1992, Cytokine 4:353). In addition, a
large proportion of patients develop antibodies against
Kineret.RTM., which potentially neutralize the biological activity
of the drug (Fleischmann R. M., et al., 2003, Arthritis Rheum
46:2287).
[0004] New therapeutic techniques therefore focus on active
immunization strategies, which induce the production of
IL-1-neutralizing antibodies by the immune system of the patient.
Svenson and co-workers (2000, J. Immunol. Methods 236:1-8)
immunized mice with recombinant IL-1.alpha. chemically crosslinked
to purified protein derivative of tuberculin (PPD), and observed
the induction of antibodies which neutralized the biological
activity of IL-1.alpha.. This strategy relies on the delivery of
T-cell help to autoreactive B-cells by physical linkage of the
self-antigen to a foreign antigen.
[0005] U.S. Pat. No. 6,093,405 discloses a method of reducing the
level of a circulating cytokine by immunization with an immunogenic
composition containing the chemically or physically inactivated
cytokine itself. Whereas in this method native cytokines are
rendered immunogenic by physical or chemical treatment, the present
invention discloses a method for making native cytokines
immunogenic by presenting them in a highly repetitive fashion on
the surface of VLPs. WO2003/084979 furthermore describes the use of
immunogenic compounds containing cytokine-derived peptides of 5-40
amino acids length for the treatment of diseases associated with an
overproduction of cytokines.
SUMMARY OF THE INVENTION
[0006] We have, now, surprisingly found that the inventive
compositions and vaccines, respectively, comprising at least one
IL-1 molecule, are not only capable of inducing immune responses
against IL-1, and hereby in particular antibody responses, but are,
furthermore, capable of neutralizing the pro-inflammatory activity
of IL-1 in vivo. In addition we have surprisingly found that IL-1
molecule, when covalently linked to the VLP in accordance with the
invention, can protect from inflammation and from clinical signs of
arthritis in a mouse model of rheumatoid arthritis. Moreover, we
have found that the inventive compositions protected mice better
from the development of arthritis symptoms than the recombinant
IL-1 receptor antagonist Kineret.RTM., which is approved for the
treatment of human rheumatoid arthritis (Example 7). Furthermore,
we surprisingly found that compositions of the invention were able
to inhibit the development of atherosclerotic symptoms, when
injected into genetically susceptible mice (Example 4) and
therefore are an efficient treatment for atherosclerosis.
Furthermore, we demonstrated that IL-1.alpha. is involved in the
pathogenesis of atherosclerosis.
[0007] Thus, in the first aspect, the present invention provides a
composition which comprises (a) a virus-like particle (VLP) with at
least one first attachment site; and (b) at least one antigen with
at least one second attachment site, wherein said at least one
antigen an IL-1 molecule, preferably selected from the group
consisting of IL-1 protein, IL-1 mature fragment, IL-1 peptide and
IL-1 mutein, wherein (a) and (b) are linked through said at least
one first and said at least one second attachment site, preferably
to form an ordered and repetitive antigen array. In preferred
embodiments of the invention, the virus-like particles suitable for
use in the present invention comprises recombinant protein,
preferably recombinant coat protein, mutants or fragments thereof,
of a virus, preferably of an RNA bacteriophage. In one preferred
embodiment, the inventive composition comprises at least one IL-1
mature fragment, preferably comprising the biological activity of
IL-1. Thus, the present invention uses the presentation of the
self-antigen in a highly repetitive fashion on virus-like particles
to stimulate autoreactive B-cells.
[0008] In another aspect, the present invention provides a vaccine
composition.
[0009] Furthermore, the present invention provides a method to
administering the vaccine composition to a human or an animal,
preferably a mammal. The inventive vaccine composition is capable
of inducing strong immune response, in particular antibody
response, typically and preferably without the presence of at least
one adjuvant. Thus, in one preferred embodiment, the vaccine is
devoid of an adjuvant. The avoidance of using adjuvant may reduce a
possible occurrence of unwanted inflammatory T cell responses.
[0010] In one preferred embodiment, the VLP is a VLP of an RNA
bacteriophage. In a further preferred embodiment said RNA
bacteriophage is an RNA bacteriophage selected from the group
consisting of: Q.beta., fr, GA and AP205. In a further preferred
embodiment said VLP of an RNA bacteriophage comprised by the
composition and the vaccine composition, respectively, is
recombinantly produced in a host and the VLP of an RNA
bacteriophage is essentially free of host RNA, preferably host
nucleic acid. It is advantageous to reduce, or preferably to
eliminate, the amount of host RNA to avoid unwanted T cell
responses as well as other unwanted side effects, such as
fever.
[0011] In one aspect, the present invention provides a method of
treating a disease selected from the group consisting of: (a)
vascular diseases; (b) inherited IL-1-dependent inflammatory
diseases; (c) chronic autoimmune inflammatory diseases; (d) bone
and cartilage degenerative diseases; (e) allergic diseases; and (f)
neurological disease; in which diseases IL-1 protein mediates, or
contributes to the condition, wherein the method comprises
administering the inventive composition or the invention vaccine
composition, respectively, to an animal, preferably human.
Diseases, in which IL-1 protein mediates, or contributes to the
condition, are, for example, atherosclerosis, familial
Mediterranean fever, rheumatoid arthritis, osteoarthritis, and
allergy.
[0012] In a further aspect, the present invention provides a
pharmaceutical composition comprising the inventive composition and
an acceptable pharmaceutical carrier.
[0013] In again a further aspect, the present invention provides
for a method of producing the composition of the invention
comprising (a) providing a VLP with at least one first attachment
site; (b) providing at least one antigen, wherein said antigen is
an IL-1 molecule, an IL-1 protein, an IL-1 mature fragment, an IL-1
peptide or an IL-1 mutein, with at least one second attachment
site; and (c) combining said VLP and said at least one antigen to
produce said composition, wherein said at least one antigen and
said VLP are linked through said at least one first and said at
least one second attachment sites.
BRIEF DESCRIPTION OF THE DRAWINGS
[0014] FIG. 1: Coupling of mIL-1.beta..sub.119-269 protein to
Q.beta. capsid protein
[0015] Proteins were analyzed on a 12% SDS-polyacrylamide gel under
reducing conditions. The gel was stained with Coomassie Brilliant
Blue. Molecular weights of marker proteins are given in kDa on the
left margin, identities of protein bands are indicated on the right
margin. Lane 1: Pre stained protein marker (New England Biolabs).
Lane 2: derivatized Q.beta. capsid protein. Lane 3: free reduced
mIL-1.beta..sub.119-269 protein. Lane 4:
Q.beta.-mIL-1.beta..sub.119-269 coupling reaction.
[0016] FIG. 2: Coupling of mIL-1.alpha..sub.117-270 protein to
Q.beta. capsid protein
[0017] Proteins were analyzed on a 12% SDS-polyacrylamide gel under
reducing conditions. The gel was stained with Coomassie Brilliant
Blue. Molecular weights of marker proteins are given in kDa on the
left margin, identities of protein bands are indicated on the right
margin. Lane 1: Prestained protein marker (New England Biolabs).
Lane 2: derivatized Q.beta. capsid protein. Lane 3: free reduced
mIL-1.alpha..sub.117-270 protein. Lane 4:
Q.beta.-mIL-1.alpha..sub.117-270 coupling reaction.
DETAILED DESCRIPTION OF THE INVENTION
[0018] Unless defined otherwise, all technical and scientific terms
used herein have the same meanings as commonly understood by one of
ordinary skill in the art to which this invention belongs.
[0019] Adjuvant: The term "adjuvant" as used herein refers to
non-specific stimulators of the immune response or substances that
allow generation of a depot in the host which when combined with
the vaccine and pharmaceutical composition, respectively, of the
present invention may provide for an even more enhanced immune
response. Preferred adjuvants are complete and incomplete Freund's
adjuvant, aluminum containing adjuvant, preferably aluminium
hydroxide, and modified muramyldipeptide. Further preferred
adjuvants are mineral gels such as aluminum hydroxide, surface
active substances such as lysolecithin, pluronic polyols,
polyanions, peptides, oil emulsions, keyhole limpet hemocyanins,
dinitrophenol, and human adjuvants such as BCG (Bacille Calmette
Guerin) and Corynebacterium parvum. Such adjuvants are also well
known in the art. Further adjuvants that can be administered with
the compositions of the invention include, but are not limited to,
Monophosphoryl lipid immunomodulator, AdjuVax 100a, QS-21, QS-18,
CRL1005, Aluminum salts (Alum), MF-59, OM-174, OM-197, OM-294, and
Virosomal adjuvant technology. The adjuvants can also comprise a
mixture of these substances. VLP have been generally described as
an adjuvant. However, the term "adjuvant", as used within the
context of this application, refers to an adjuvant not being the
VLP used for the inventive compositions, rather it relates to an
additional, distinct component.
[0020] Antigen: As used herein, the term "antigen" refers to a
molecule capable of being bound by an antibody or a T-cell receptor
(TCR) if presented by MHC molecules. The term "antigen", as used
herein, also refers to T-cell epitopes. An antigen is additionally
capable of being recognized by the immune system and/or being
capable of inducing a humoral immune response and/or cellular
immune response leading to the activation of B- and/or
T-lymphocytes. This may, however, require that, at least in certain
cases, the antigen contains or is linked to a Th cell epitope and
is given in adjuvant. An antigen can have one or more epitopes (B-
and T-epitopes). The specific reaction referred to above is meant
to indicate that the antigen will preferably react, typically in a
highly selective manner, with its corresponding antibody or TCR and
not with the multitude of other antibodies or TCRs which may be
evoked by other antigens. Antigens as used herein may also be
mixtures of several individual antigens.
[0021] epitope: The term epitope refers to continuous or
discontinuous portions of an antigen, preferably a polypeptide,
wherein said portions can be specifically bound by an antibody or
by a T-cell receptor within the context of an MHC molecule. With
respect to antibodies, specific binding excludes non-specific
binding but does not necessarily exclude cross-reactivity. An
epitope typically comprise 5-10 amino acids in a spatial
conformation which is unique to the antigenic site.
[0022] Specific binding (antibody/antigen): Within this
application, antibodies are defined to be specifically binding if
they bind to the antigen with a binding affinity (Ka) of 10.sup.6
M.sup.-1 or greater, preferably 10.sup.7 M.sup.-1 or greater, more
preferably 10.sup.8 M.sup.-1 or greater, and most preferably
10.sup.9 M.sup.-1 or greater. The affinity of an antibody can be
readily determined by one of ordinary skill in the art (for example
by Scatchard analysis, by ELISA or by Biacore analysis).
[0023] Specific binding (IL-1/IL-1 receptor): The interaction
between a receptor and a receptor ligand can be characterized by
biophysical methods generally known in the art, including, for
example, ELISA or Biacore analysis. An IL-1 molecule is regarded as
capable of specifically binding an IL-1 receptor, when the binding
affinity (Ka) of said IL-1 to said IL-1 receptor is at least
10.sup.5 M.sup.-1, preferably at least 10.sup.6M.sup.-1, more
preferably at least 10.sup.7 M.sup.-1, still more preferably at
least 10.sup.8 M.sup.-1, and most preferably at least 10.sup.9
M.sup.-1; wherein preferably said IL-1 receptor is an IL-1 receptor
from mouse or human, most preferably human. Further preferably,
said IL-1 receptor comprises or more preferably consists of any one
of the sequences SEQ ID NO:166 to SEQ ID NO:169, most preferably
said IL-1 receptor comprises or preferably consists of any one of
the sequences SEQ ID NO:166 and SEQ ID NO:167.
[0024] Associated: The terms "associated" or "association" as used
herein refer to all possible ways, preferably chemical
interactions, by which two molecules are joined together. Chemical
interactions include covalent and non-covalent interactions.
Typical examples for non-covalent interactions are ionic
interactions, hydrophobic interactions or hydrogen bonds, whereas
covalent interactions are based, by way of example, on covalent
bonds such as ester, ether, phosphoester, amide, peptide,
carbon-phosphorus bonds, carbon-sulfur bonds such as thioether, or
imide bonds.
[0025] Attachment Site, First: As used herein, the phrase "first
attachment site" refers to an element which is naturally occurring
with the VLP or which is artificially added to the VLP, and to
which the second attachment site may be linked. The first
attachment site preferably is a protein, a polypeptide, an amino
acid, a peptide, a sugar, a polynucleotide, a natural or synthetic
polymer, a secondary metabolite or compound (biotin, fluorescein,
retinol, digoxigenin, metal ions, phenylmethylsulfonylfluoride), or
a chemically reactive group such as an amino group, a carboxyl
group, a sulfhydryl group, a hydroxyl group, a guanidinyl group,
histidinol group, or a combination thereof. A preferred embodiment
of a chemically reactive group being the first attachment site is
the amino group of an amino acid, preferably of lysine. The first
attachment site is located, typically on the surface, and
preferably on the outer surface of the VLP. Multiple first
attachment sites are present on the surface, preferably on the
outer surface of virus-like particle, typically in a repetitive
configuration. In a preferred embodiment the first attachment site
is associated with the VLP, through at least one covalent bond,
preferably through at least one peptide bond. In a further
preferred embodiment the first attachment site is naturally
occurring with the VLP. Alternatively, in a preferred embodiment
the first attachment site is artificially added to the VLP.
[0026] Attachment Site, Second: As used herein, the phrase "second
attachment site" refers to an element which is naturally occurring
with or which is artificially added to the IL-1 molecule and to
which the first attachment site may be linked. The second
attachment site of the IL-1 molecule preferably is a protein, a
polypeptide, a peptide, an amino acid, a sugar, a polynucleotide, a
natural or synthetic polymer, a secondary metabolite or compound
(biotin, fluorescein, retinol, digoxigenin, metal ions,
phenylmethylsulfonylfluoride), or a chemically reactive group such
as an amino group, a carboxyl group, a sulfhydryl group, a hydroxyl
group, a guanidinyl group, histidinol group, or a combination
thereof. A preferred embodiment of a chemically reactive group
being the second attachment site is the sulfhydryl group,
preferably of an amino acid cysteine. The term "IL-1 molecule with
at least one second attachment site" refers, therefore, to a
construct comprising the IL-1 molecule and at least one second
attachment site. However, in particular for a second attachment
site, which is not naturally occurring within the IL-1 molecule,
such a construct typically and preferably further comprises a
"linker". In another preferred embodiment the second attachment
site is associated with the IL-1 molecule through at least one
covalent bond, preferably through at least one peptide bond. In a
further embodiment, the second attachment site is naturally
occurring within the IL-1 molecule. In another further preferred
embodiment, the second attachment site is artificially added to the
IL-1 molecule through a linker, wherein said linker comprises or
alternatively consists of a cysteine. Preferably the linker is
fused to the IL-1 molecule by a peptide bond.
[0027] Coat protein: The term "coat protein" and the
interchangeably used term "capsid protein" within this application,
refers to a viral protein, preferably a subunit of a natural capsid
of a virus, preferably of a RNA-phage, which is capable of being
incorporated into a virus capsid or a VLP.
[0028] IL-1 molecule: The term "IL-1 molecule" or shortly "IL-1",
as used herein, refers to any polypeptide having an amino acid
sequence having at least 80%, preferably at least 90%, more
preferably at least 95%, even more preferably at least 99% and most
preferably 100% sequence identity with any one of the sequences
selected from the group consisting of SEQ ID NO:36 to SEQ ID
NO:116, SEQ ID NO:130 to SEQ ID NO:140 and SEQ ID NO:163 to SEQ ID
NO:165. The term "IL-1-molecule", as used herein, preferably refers
to any IL-1 protein, IL-1 fragment, IL-1 mature fragment, IL-1
peptide or IL-1 mutein comprising or alternatively consisting of a
polypeptide having an amino acid sequence having at least 80%,
preferably at least 90%, more preferably at least 95%, even more
preferably at least 99% and most preferably 100% sequence identity
with any one of the sequences selected from the group consisting of
SEQ ID NO:36 to SEQ ID NO:116, SEQ ID NO:130 to SEQ ID NO:140 and
SEQ ID NO:163 to SEQ ID NO:165. The term IL-1 molecule, as used
herein, also typically and preferably refers to orthologs of IL-1
proteins of any animal species. An IL-1 molecule is preferably, but
not necessarily, capable of binding to the IL-1 receptor and
further preferably comprises biological activity.
[0029] IL-1 alpha molecule: The term "IL-1 alpha molecule" or
shortly "IL-1 alpha", as used herein, refers to an IL-1 alpha
protein, IL-1 alpha fragment, IL-1 alpha mature fragment, IL-1
alpha peptide or IL-1 alpha mutein comprising or alternatively
consisting of an polypeptide having an amino acid sequence having
at least 80%, preferably at least 90%, more preferably at least
95%, even more preferably at least 99% and most preferably 100%
sequence identity with any one of the sequences selected from the
group consisting of SEQ ID NO:36 to 48, SEQ ID NO:63, SEQ ID NO:65,
SEQ ID NO:67 to SEQ ID B0:88, and SEQ ID NO:163. A specifically
preferred embodiment of IL-1 alpha is human IL-1 alpha 119-271 (SEQ
ID NO:63).
[0030] IL-1 beta molecule: The term "IL-1 beta molecule" or shortly
"IL-1 beta", as used herein, refers to an IL-1 beta protein, IL-1
beta fragment, IL-1 beta mature fragment, IL-1 beta peptide or IL-1
beta mutein comprising or alternatively consisting of an
polypeptide having an amino acid sequence having at least 80%,
preferably at least 90%, more preferably at least 95%, even more
preferably at least 99% and most preferably 100% sequence identity
with any one of the sequences selected from the group consisting of
SEQ ID NO:49 to SEQ ID NO:62, SEQ ID NO:64, SEQ ID NO:66, SEQ ID
NO:89 to SEQ ID NO:116, SEQ ID NO:130 to SEQ ID NO:140, SEQ ID
NO:164, and SEQ ID NO:165. A specifically preferred embodiment of
IL-1 beta is human IL-1 beta 117-269 (SEQ ID NO:64).
[0031] IL-1 protein: The term "IL-1 protein", as used herein,
refers to a naturally occurring protein, wherein said naturally
occurring protein has an amino acid sequence having at least 80%,
preferably at least 90%, more preferably at least 95%, even more
preferably at least 99% and most preferably 100% sequence identity
with any one of SEQ ID NO:36 to SEQ ID NO:62; or wherein said
naturally occurring protein is capable of binding the IL-1 receptor
and preferably comprises biological activity. The term "IL-1
protein", as used herein, preferably refers to a naturally
occurring protein, wherein said naturally occurring protein has an
amino acid sequence having at least 80%, preferably at least 90%,
more preferably at least 95%, even more preferably at least 99% and
most preferably 100% sequence identity with any one of SEQ ID NO:36
to SEQ ID NO:62; and wherein said naturally occurring protein is
capable of binding the IL-1 receptor and preferably comprises
biological activity. Typically and preferably, the term "IL-1
protein", as used herein, refers to at least one naturally
occurring protein, wherein said protein is capable of binding the
IL-1 receptor and comprises biological activity, and wherein
further said protein comprises or alternatively consists of a
polypeptide having an amino acid sequence having at least 80%,
preferably at least 90%, more preferably at least 95%, even more
preferably at least 99% and most preferably 100% sequence identity
with any one of SEQ ID NO:36 to SEQ ID NO:62. Accordingly, the term
"IL-1 alpha protein" relates to an IL-1 protein comprising or
alternatively consisting of a polypeptide having an amino acid
sequence having at least 80%, preferably at least 90%, more
preferably at least 95%, even more preferably at least 99% and most
preferably 100% sequence identity with any one of SEQ ID NO:36 to
SEQ ID NO:48, whereas the term "IL-1 beta protein" relates to an
IL-1 protein comprising or alternatively consisting of a
polypeptide having an amino acid sequence having at least 80%,
preferably at least 90%, more preferably at least 95%, even more
preferably at least 99% and most preferably 100% sequence identity
with any one of SEQ ID NO:49 to SEQ ID NO:62.
[0032] IL-1 fragment: The term "IL-1 fragment", as used herein,
relates to a polypeptide comprising a consecutive stretch of an
IL-1 protein, wherein said polypeptide is at least 50, preferably
at least 100, most preferably at least 150 amino acids in length.
Typically and preferably said IL-1 fragment is at most 300, more
preferably at most 250, and most preferably at most 200 amino acids
in length. Typically and preferably, IL-1 fragments are capable of
binding the IL-1 receptor and further preferably comprises
biological activity. Accordingly, the terms "IL-1 alpha fragment"
and "IL-1 beta fragment" relate to an IL-1 fragment as defined,
wherein said IL-1 protein is an IL-1 alpha protein or an IL-1 beta
protein, respectively.
[0033] IL-1 mature fragment: The term "IL-1 mature fragment", as
used herein, relates to a IL-1 fragment, wherein said IL-1 fragment
is a naturally occurring maturation product of an IL-1 protein.
Accordingly, the terms "IL-1 alpha mature fragment" and "IL-1 beta
mature fragment", as used herein relate to IL-1 mature fragments as
defined, wherein said IL-1 protein is an IL-1 alpha protein or an
IL-1 beta protein, respectively. Preferred embodiments of IL-1
alpha mature fragments are SEQ ID NO:63, SEQ ID NO:65 and SEQ ID
NO:163. Preferred embodiments of IL-1 beta mature fragments are SEQ
ID NO:64, SEQ ID NO:66, SEQ ID NO:130, SEQ ID NO:164, and SEQ ID
NO:165.
[0034] Preferred IL-1 alpha mature fragments comprise or preferably
consist of an amino acid sequence selected from the group
consisting of: (a) human IL-1 alpha 119-271 (SEQ ID NO:63); (b)
mouse IL-1 alpha 117-270 (SEQ ID NO:65); (c) mouse IL-1 alpha
117-270s (SEQ ID NO:163); and (e) an amino acid sequence which is
at least 80%, or preferably at least 90%, more preferably at least
95%, or most preferably at least 99% identical with any one of SEQ
ID NO:63, SEQ ID NO:65 and SEQ ID NO:163.
[0035] Preferred IL-1 beta mature fragments comprise or preferably
consist of an amino acid sequence selected from the group
consisting of: (a) human IL-1 beta 117-269 (SEQ ID NO:64); (b)
human IL-1 beta 116-269 (SEQ ID NO:165); (c) mouse IL-1 beta
119-269 (SEQ ID NO:66); (d) mouse IL-1 beta 119-269s (SEQ ID
NO:164); and (e) an amino acid sequence which is at least 80%, or
preferably at least 90%, more preferably at least 95%, or most
preferably at least 99% identical with any one of SEQ ID NO:64, SEQ
ID NO:66, SEQ ID NO:164 and SEQ ID NO:165.
[0036] IL-1 peptide: The term "IL-1 peptide", as used herein,
relates to a polypeptide comprising a consecutive stretch of a
naturally occurring protein, wherein said protein is capable of
binding the IL-1 receptor and preferably comprises biological
activity, wherein said polypeptide is 4 to 49, preferably 6 to 35,
most preferably 10 to 25 amino acids in length. The IL-1 peptide
may be, but typically is not, capable of binding the IL-1 receptor
and typically has no biological activity. Accordingly, the terms
"IL-1 alpha peptide" and "IL-1 beta peptide", as used herein relate
to IL-1 peptides as defined, wherein said naturally occurring
protein is an IL-1 alpha protein or an IL-1 beta protein,
respectively. Preferred IL-1 peptides are SEQ ID NO:82 to SEQ ID
NO:116.
[0037] IL-1 mutein: The term "IL-1 mutein" as used herein comprise
or preferably consist of any polypeptide derived from an IL-1
molecule, preferably from an IL-1 alpha or an IL-1 beta protein, an
IL-1 alpha or an IL-1 beta fragment, an IL-1 alpha or an IL-1 beta
mature fragment or an IL-1 alpha or an IL-1 beta peptide, wherein
preferably said polypeptide exhibits reduced biological activity as
compared to the IL-1 molecule it is derived from. Accordingly, IL-1
alpha muteins and IL-1 beta muteins are IL-1 muteins as defined,
wherein said polypeptide is derived from an IL-1 alpha molecule or
an IL-1 beta molecule, respectively.
[0038] In preferred IL-1 muteins, said biological activity is less
than 80%, more preferably less than 60%, still more preferably less
than 40%, still more preferably less than 20% of the biological
activity of the IL-1 molecule it is derived from. Further preferred
IL-1 muteins are derived from an IL-1 mature fragment, wherein the
biological activity of said IL-1 mutein is less than 80%, more
preferably less than 60%, still more preferably less than 40%,
still more preferably less than 20% of the biological activity of
the IL-1 mature fragment said IL-1 mutein is derived from. Very
preferred IL-1 muteins do not exhibit biological activity. Further
preferably, but not necessarily, IL-1 muteins are capable of
specifically binding an IL-1 receptor. Very preferred are IL-1
muteins derived from (i) an IL-1 protein, preferably from SEQ ID
NO:36 to SEQ ID NO:62; or (ii) more preferably of an IL-1 mature
fragment, preferably from any one of SEQ ID NO:63 to SEQ ID NO:66,
SEQ ID NO:130, and SEQ ID NO:163 to SEQ ID NO:165.
[0039] IL-1 muteins useful in the context have been described in
Kamogashira et al. (1988) J. Biochem. 104:837-840; Gehrke et al.
(1990) The Journal of Biological Chemistry 265(11):5922-5925; Conca
et al. (1991) The Journal of Biological Chemistry
266(25):16265-16268; Ju et al. (1991) PNAS 88:2658-2662; Auron et
al. (1992) Biochemistry 31:6632-6638; Guinet et al. (1993) Eur. J.
Biochem 211:583-590; Camacho (1993) Biochemistry 32:8749-8757;
Baumann (1993) Journal of Receptor Research 13(1-4):245-262; Simon
(1993) The Journal of Biological Chemistry 268(13):9771-9779; and
Simoncsits (1994) Cytokine 6(2):206-214, the disclosure of which is
incorporated herein by reference.
[0040] Preferred IL-1 muteins comprise or preferably consist of a
polypeptide having an amino acid sequence which differs from the
amino acid sequence of an IL-1 protein, an IL-1 fragment, an IL-1
mature fragment or an IL-1 peptide in 1 to 10, preferably 1 to 6,
more preferably 1 to 5, still more preferably 1 to 4, still more
preferably 1 to 3, still more preferably 1 to 2, and most
preferably in exactly 1 amino acid residue(s), wherein preferably
said amino acid residue(s) are (i) deleted from said polypeptide,
(ii) inserted into said polypeptide, (iii) exchanged by another
amino acid residue, or (iv) any combination of (i) to (iii). In a
preferred embodiment, said amino acid residues are in one
consecutive stretch. Further preferred IL-1 muteins comprise or
preferably consist of a polypeptide having an amino acid sequence
which differs from the amino acid sequence of an IL-1 protein, an
IL-1 fragment, or an IL-1 mature fragment, preferably of an IL-1
mature fragment, in 1 to 10, preferably 1 to 6, more preferably 1
to 5, still more preferably 1 to 4, still more preferably 1 to 3,
still more preferably 1 to 2, and most preferably in exactly 1
amino acid residue(s), wherein preferably said amino acid
residue(s) are (i) deleted from said polypeptide, (ii) inserted
into said polypeptide, (iii) exchanged by another amino acid
residue, or (iv) any combination of (i) to (iii).
[0041] Further preferred IL-1 muteins comprise or more preferably
consist of a polypeptide having an amino acid sequence which
differs from the amino acid sequence of any one of SEQ ID NO:36 to
SEQ ID NO:48 or SEQ ID NO:49 to SEQ ID NO:62 in 1 to 10, preferably
1 to 6, more preferably 1 to 5, still more preferably 1 to 4, still
more preferably 1 to 3, still more preferably 1 to 2, and most
preferably in exactly 1 amino acid residue(s), wherein preferably
said amino acid residue(s) are (i) deleted from said polypeptide,
(ii) inserted into said polypeptide, (iii) exchanged by another
amino acid residue, or (iv) any combination of (i) to (iii).
Further preferred IL-1 muteins comprise or preferably consist of a
polypeptide having an amino acid sequence which differs from the
amino acid sequence selected from the group consisting of (i) any
one of SEQ ID NO:63, SEQ ID NO:65, and SEQ ID NO:163, most
preferably SEQ ID NO:63; or (ii) of any one selected from the group
consisting of SEQ ID NO:64, SEQ ID NO:66, SEQ ID NO:130, SEQ ID
NO:164, and SEQ ID NO:165, most preferably SEQ ID NO:64 in 1 to 10,
preferably 1 to 6, more preferably 1 to 5, still more preferably 1
to 4, still more preferably 1 to 3, still more preferably 1 to 2,
and most preferably in exactly 1 amino acid residue(s), wherein
preferably said amino acid residue(s) are (i) deleted from said
polypeptide, (ii) inserted into said polypeptide, (iii) exchanged
by another amino acid residue, or (iv) any combination of (i) to
(iii).
[0042] Further preferred IL-1 muteins are IL-1 alpha muteins,
wherein said IL-1 alpha muteins comprise or more preferably consist
of a polypeptide having an amino acid sequence which differs from
the amino acid sequence of any one of SEQ ID NO:36 to SEQ ID NO:48
in 1 to 6, preferably 1 to 5, more preferably 1 to 4, still more
preferably 1 to 3, still more preferably 1 to 2, and most
preferably in exactly 1 amino acid residue(s), wherein preferably
said amino acid residue(s) are (i) deleted from said polypeptide,
(ii) inserted into said polypeptide, (iii) exchanged by another
amino acid residue, or (iv) any combination of (i) to (iii).
Further preferred IL-1 alpha muteins comprise or preferably consist
of a polypeptide having an amino acid sequence which differs from
the amino acid sequence selected from the group consisting of (i)
any one of SEQ ID NO:63, SEQ ID NO:65, and SEQ ID NO:163, most
preferably SEQ ID NO:63, in 1 to 6, preferably 1 to 5, more
preferably 1 to 4, still more preferably 1 to 3, still more
preferably 1 to 2, and most preferably in exactly 1 amino acid
residue(s), wherein preferably said amino acid residue(s) are (i)
deleted from said polypeptide, (ii) inserted into said polypeptide,
(iii) exchanged by another amino acid residue, or (iv) any
combination of (i) to (iii). Very preferred IL-1 alpha muteins
comprise or preferably consist of a polypeptide having an amino
acid sequence which differs from the amino acid sequence of SEQ ID
NO:63 in 1 to 10, preferably 1 to 6, more preferably 1 to 5, still
more preferably 1 to 4, still more preferably 1 to 3, still more
preferably 1 to 2, and most preferably in exactly 1 amino acid
residue(s), wherein preferably said amino acid residue(s) are (i)
deleted from said polypeptide, (ii) inserted into said polypeptide,
(iii) exchanged by another amino acid residue, or (iv) any
combination of (i) to (iii).
[0043] Further preferred IL-1 muteins are IL-1 beta muteins,
wherein said IL-1 beta muteins comprise or more preferably consist
of a polypeptide having an amino acid sequence which differs from
the amino acid sequence of any one of SEQ ID NO:49 to SEQ ID NO:62
in 1 to 6, preferably 1 to 5, more preferably 1 to 4, still more
preferably 1 to 3, still more preferably 1 to 2, and most
preferably in exactly 1 amino acid residue(s), wherein preferably
said amino acid residue(s) are (i) deleted from said polypeptide,
(ii) inserted into said polypeptide, (iii) exchanged by another
amino acid residue, or (iv) any combination of (i) to (iii).
Further preferred IL-1 beta muteins comprise or preferably consist
of a polypeptide having an amino acid sequence which differs from
the amino acid sequence selected from the group consisting of SEQ
ID NO:64, SEQ ID NO:66, SEQ ID NO:130, SEQ ID NO:164, and SEQ ID
NO:165, most preferably SEQ ID NO:64, in 1 to 6, preferably 1 to 5,
more preferably 1 to 4, still more preferably 1 to 3, still more
preferably 1 to 2, and most preferably in exactly 1 amino acid
residue(s), wherein preferably said amino acid residue(s) are (i)
deleted from said polypeptide, (ii) inserted into said polypeptide,
(iii) exchanged by another amino acid residue, or (iv) any
combination of (i) to (iii). Very preferred IL-1 beta muteins
comprise or preferably consist of a polypeptide having an amino
acid sequence which differs from the amino acid sequence of SEQ ID
NO:64 in 1 to 10, preferably 1 to 6, more preferably 1 to 5, still
more preferably 1 to 4, still more preferably 1 to 3, still more
preferably 1 to 2, and most preferably in exactly 1 amino acid
residue(s), wherein preferably said amino acid residue(s) are (i)
deleted from said polypeptide, (ii) inserted into said polypeptide,
(iii) exchanged by another amino acid residue, or (iv) any
combination of (i) to (iii). Still more preferred IL-1 beta muteins
comprise or preferably consist of a polypeptide having an amino
acid sequence selected from any one of the group consisting of SEQ
ID NO:131 to SEQ ID NO:140.
[0044] Agonistic effect/biological activity of the IL-1: The terms
"biological activity" or "biologically active" as used herein with
respect to IL-1 refer to the ability of the IL-1 molecule to induce
the production of IL-6 after systemical administration into
animals, preferably as outlined in Example 2E and in Example 3E. By
biological activity of the IL-1 molecule is also meant the ability
to induce the proliferation of thymocytes (Epps et al., Cytokine
9(3):149-156 (1997), D10.G4.1 T helper cells (Orencole and
Dinarello, Cytokine 1(1):14-22 (1989), or the ability to induce the
production of IL-6 from MG64 or HaCaT cells (Boraschi et al., J.
Immunol. 155:4719-4725 (1995) or fibroblasts (Dinarello et al.,
Current Protocols in Immunology 6.2.1-6-2-7 (2000)), or the
production of IL-2 from EL-4 thymoma cells (Simon et al., J.
Immunol. Methods 84 (1-2):85-94 (1985)), or the ability to inhibit
the growth of the human melanoma cell line A375 (Nakai et al.,
Biochem. Biophys. Res. Commun. 154:1189-1196 (1988)).
[0045] Linked: The terms "linked" or "linkage" as used herein,
refer to all possible ways, preferably chemical interactions, by
which the at least one first attachment site and the at least one
second attachment site are joined together. Chemical interactions
include covalent and non-covalent interactions. Typical examples
for non-covalent interactions are ionic interactions, hydrophobic
interactions or hydrogen bonds, whereas covalent interactions are
based, by way of example, on covalent bonds such as ester, ether,
phosphoester, amide, peptide, carbon-phosphorus bonds,
carbon-sulfur bonds such as thioether, or imide bonds. In certain
preferred embodiments the first attachment site and the second
attachment site are linked through at least one covalent bond,
preferably through at least one non-peptide bond, and even more
preferably through exclusively non-peptide bond(s). The term
"linked" as used herein, however, shall not only refer to a direct
linkage of the at least one first attachment site and the at least
one second attachment site but also, alternatively and preferably,
an indirect linkage of the at least one first attachment site and
the at least one second attachment site through intermediate
molecule(s), and hereby typically and preferably by using at least
one, preferably one, heterobifunctional cross-linker. In other
preferred embodiments the first attachment site and the second
attachment site are linked through at least one covalent bond,
preferably through at least one peptide bond, and even more
preferably through exclusively peptide bond(s). In a very preferred
embodiment the first attachment site and the second attachment site
are linked exclusively by peptide bounds, preferably by genetic
fusion, either directly, or, preferably, via an amino acid linker.
In a further preferred embodiment the second attachment site is
linked to the C-terminus of said first attachment site exclusively
by peptide bounds, preferably by genetic fusion.
[0046] Linker: A "linker", as used herein, either associates the
second attachment site with the IL-1 molecule or already comprises,
essentially consists of, or consists of the second attachment site.
Preferably, a "linker", as used herein, already comprises the
second attachment site, typically and preferably--but not
necessarily--as one amino acid residue, preferably as a cysteine
residue. A "linker" as used herein is also termed "amino acid
linker", in particular when a linker according to the invention
contains at least one amino acid residue. Thus, the terms "linker"
and "amino acid linker" are interchangeably used herein. However,
this does not imply that such a linker consists exclusively of
amino acid residues, even if a linker consisting of amino acid
residues is a preferred embodiment of the present invention. The
amino acid residues of the linker are, preferably, composed of
naturally occurring amino acids or unnatural amino acids known in
the art, all-L or all-D or mixtures thereof. Further preferred
embodiments of a linker in accordance with this invention are
molecules comprising a sulfhydryl group or a cysteine residue and
such molecules are, therefore, also encompassed within this
invention. Further linkers useful for the present invention are
molecules comprising a C1-C6 alkyl-, a cycloalkyl such as a
cyclopentyl or cyclohexyl, a cycloalkenyl, aryl or heteroaryl
moiety. Moreover, linkers comprising preferably a C1-C6 alkyl-,
cycloalkyl-(C5, C6), aryl- or heteroaryl-moiety and additional
amino acid(s) can also be used as linkers for the present invention
and shall be encompassed within the scope of the invention.
Association of the linker with the IL-1 molecule is preferably by
way of at least one covalent bond, more preferably by way of at
least one peptide bond. In the context of linkage by genetic
fusion, a linker may be absent or preferably is an amino acid
linker, more preferably an amino acid linker consisting exclusively
of amino acid residues. Very preferred linkers for genetic fusion
are flexible amino acid linkers. In the context of linkage by
genetic fusion linkers preferred consist of 1 to 20, more
preferably of 2 to 15, still more preferably of 2 to 10, still more
preferably of 2 to 5, and most preferably of 3 amino acids. Very
preferred linkers for genetic fusion comprise or preferably consist
of GSG (SEQ ID NO:189).
[0047] Ordered and repetitive antigen array: As used herein, the
term "ordered and repetitive antigen array" generally refers to a
repeating pattern of antigen or, characterized by a typically and
preferably high order of uniformity in spatial arrangement of the
antigens with respect to virus-like particle, respectively. In one
embodiment of the invention, the repeating pattern may be a
geometric pattern. Certain embodiments of the invention, such as
antigens coupled to the VLP of RNA bacteriophages, are typical and
preferred examples of suitable ordered and repetitive antigen
arrays which, moreover, possess strictly repetitive paracrystalline
orders of antigens, preferably with spacing of 1 to 30 nanometers,
preferably 2 to 15 nanometers, even more preferably 2 to 10
nanometers, even again more preferably 2 to 8 nanometers, and
further more preferably 1.6 to 7 nanometers.
[0048] Packaged: The term "packaged" as used herein refers to the
state of a polyanionic macromolecule or immunostimulatory
substances in relation to the VLP. The term "packaged" as used
herein includes binding that may be covalent, e.g., by chemically
coupling, or non-covalent, e.g., ionic interactions, hydrophobic
interactions, hydrogen bonds, etc. The term also includes the
enclosement, or partial enclosement, of a polyanionic
macromolecule. Thus, the polyanionic macromolecule or
immunostimulatory substances can be enclosed by the VLP without the
existence of an actual binding, in particular of a covalent
binding. In preferred embodiments, the at least one polyanionic
macromolecule or immunostimulatory substances is packaged inside
the VLP, most preferably in a non-covalent manner. In case said
immunostimulatory substances is nucleic acid, preferably a DNA, the
term packaged implies that said nucleic acid is not accessible to
nucleases hydrolysis, preferably not accessible to DNAse hydrolysis
(e.g. DNaseI or Benzonase), wherein preferably said accessibility
is assayed as described in Examples 11-17 of WO2003/024481 A2.
[0049] Polypeptide: The term "polypeptide" as used herein refers to
a molecule composed of monomers (amino acids) linearly linked by
amide bonds (also known as peptide bonds). It indicates a molecular
chain of amino acids and does not refer to a specific length of the
product. Thus, peptides, dipeptides, tripeptides, oligopeptides and
proteins are included within the definition of polypeptide.
Post-translational modifications of the polypeptide, for example,
glycosylations, acetylations, phosphorylations, and the like are
also encompassed.
[0050] Recombinant VLP: The term "recombinant VLP", as used herein,
refers to a VLP that is obtained by a process which comprises at
least one step of recombinant DNA technology. The term "VLP
recombinantly produced", as used herein, refers to a VLP that is
obtained by a process which comprises at least one step of
recombinant DNA technology. Thus, the terms "recombinant VLP" and
"VLP recombinantly produced" are interchangeably used herein and
should have the identical meaning.
[0051] Virus particle: The term "virus particle" as used herein
refers to the morphological form of a virus. In some virus types it
comprises a genome surrounded by a protein capsid; others have
additional structures (e.g., envelopes, tails, etc.).
[0052] Virus-like particle (VLP), as used herein, refers to a
non-replicative or non-infectious, preferably a non-replicative and
non-infectious virus particle, or refers to a non-replicative or
non-infectious, preferably a non-replicative and non-infectious
structure resembling a virus particle, preferably a capsid of a
virus. The term "non-replicative", as used herein, refers to being
incapable of replicating the genome comprised by the VLP. The term
"non-infectious", as used herein, refers to being incapable of
entering the host cell. Preferably a virus-like particle in
accordance with the invention is non-replicative and/or
non-infectious since it lacks all or part of the viral genome or
genome function. In one embodiment, a virus-like particle is a
virus particle, in which the viral genome has been physically or
chemically inactivated. Typically and more preferably a virus-like
particle lacks all or part of the replicative and infectious
components of the viral genome. A virus-like particle in accordance
with the invention may contain nucleic acid distinct from their
genome. A typical and preferred embodiment of a virus-like particle
in accordance with the present invention is a viral capsid such as
the viral capsid of the corresponding virus, bacteriophage,
preferably RNA bacteriophage. The terms "viral capsid" or "capsid",
refer to a macromolecular assembly composed of viral protein
subunits. Typically, there are 60, 120, 180, 240, 300, 360 and more
than 360 viral protein subunits. Typically and preferably, the
interactions of these subunits lead to the formation of viral
capsid or viral-capsid like structure with an inherent repetitive
organization, wherein said structure is, typically, spherical or
tubular. For example, the capsids of RNA bacteriophages or HBcAgs
have a spherical form of icoshedral symmetry. The term "capsid-like
structure" as used herein, refers to a macromolecular assembly
composed of viral protein subunits resembling the capsid morphology
in the above defined sense but deviating from the typical
symmetrical assembly while maintaining a sufficient degree of order
and repetitiveness. One common feature of virus particle and
virus-like particle is its highly ordered and repetitive
arrangement of its subunits.
[0053] Virus-like particle of an RNA bacteriophage: As used herein,
the term "virus-like particle of an RNA bacteriophage" refers to a
virus-like particle comprising, or preferably consisting
essentially of or consisting of coat proteins, mutants or fragments
thereof, of an RNA bacteriophage. In addition, virus-like particle
of an RNA bacteriophage resembling the structure of an RNA
bacteriophage, being non replicative and/or non-infectious, and
lacking at least the gene or genes encoding for the replication
machinery of the RNA bacteriophage, and typically also lacking the
gene or genes encoding the protein or proteins responsible for
viral attachment to or entry into the host. This definition should,
however, also encompass virus-like particles of RNA bacteriophages,
in which the aforementioned gene or genes are still present but
inactive, and, therefore, also leading to non-replicative and/or
non-infectious virus-like particles of an RNA bacteriophage.
Preferred VLPs derived from RNA bacteriophages exhibit icoshedral
symmetry and consist of 180 subunits (monomers). Preferred methods
to render a virus-like particle of an RNA bacteriophage non
replicative and/or non-infectious is by physical, chemical
inactivation, such as UV irradiation, formaldehyde treatment,
typically and preferably by genetic manipulation.
[0054] One, a, or an: when the terms "one", "a", or "an" are used
in this disclosure, they mean "at least one" or "one or more"
unless otherwise indicated.
[0055] The amino acid sequence identity of polypeptides can be
determined conventionally using known computer programs such as the
Bestfit program. When using Bestfit or any other sequence alignment
program, preferably using Bestfit, to determine whether a
particular sequence is, for instance, 95% identical to a reference
amino acid sequence, the parameters are set such that the
percentage of identity is calculated over the full length of the
reference amino acid sequence and that gaps in homology of up to 5%
of the total number of amino acid residues in the reference
sequence are allowed. This aforementioned method in determining the
percentage of identity between polypeptides is applicable to all
proteins, polypeptides or a fragment thereof disclosed in this
invention.
[0056] This invention provides compositions and methods for
enhancing immune responses against IL-1 in an animal or in human.
Compositions of the invention comprise: (a) a core particle with at
least one first attachment site, wherein said core particle is a
virus-like particle (VLP) or a virus particle; and (b) at least one
antigen with at least one second attachment site, wherein the at
least one antigen is an IL-1 molecule, preferably selected from the
group consisting of IL-1 protein, IL-1 mature fragment, IL-1
peptide and IL-1 mutein, wherein (a) and (b) are covalently linked
through the at least one first and the at least one second
attachment site. Preferably, said IL-1 molecule is linked to the
core particle, so as to form an ordered and repetitive antigen-VLP
array. In preferred embodiments of the invention, at least 20,
preferably at least 30, more preferably at least 60, again more
preferably at least 120 and further more preferably at least
1801IL-1 molecules are linked to the core particle.
[0057] Any virus known in the art having an ordered and repetitive
structure may be selected as a VLP or a virus particle of the
invention. Illustrative DNA or RNA viruses, the coat or capsid
protein of which can be used for the preparation of VLPs have been
disclosed in WO 2004/009124 on page 25, line 10-21, on page 26,
line 11-28, and on page 28, line 4 to page 31, line 4. These
disclosures are incorporated herein by way of reference.
[0058] Virus or virus-like particle can be produced and purified
from virus-infected cell cultures. The resulting virus or
virus-like particle for vaccine purpose should be preferably
non-replicative or non-infectious, more preferably non-replicative
and non-infectious. UV irradiation, chemical treatment, such as
with formaldehyde or chloroform, are the general methods known to
skilled person in the art to inactivate virus.
[0059] In one preferred embodiment, the core particle is a virus
particle, and wherein preferably said virus particle is a
bacteriophage, and wherein further preferably said bacteriophage is
an RNA bacteriophage, and wherein even further preferably said RNA
bacteriophage is an RNA bacteriophage selected from Q.beta., fr, GA
or AP205.
[0060] In one preferred embodiment, the core particle is a VLP. In
a further preferred embodiment, the VLP is a recombinant VLP.
Almost all commonly known viruses have been sequenced and are
readily available to the public. The gene encoding the coat protein
can be easily identified by a skilled artisan. The preparation of
VLPs by recombinantly expressing the coat protein in a host is
within the common knowledge of a skilled artisan.
[0061] In one preferred embodiment, the virus-like particle
comprises, or alternatively consists of recombinant proteins,
mutants or fragments thereof, of a virus selected form the group
consisting of: a) RNA bacteriophages; b) bacteriophages; c)
Hepatitis B virus, preferably its capsid protein (Ulrich, et al.,
Virus Res. 50:141-182 (1998)) or its surface protein (WO 92/11291);
d) measles virus (Warnes, et al., Gene 160:173-178 (1995)); e)
Sindbis virus; f) rotavirus (U.S. Pat. No. 5,071,651 and U.S. Pat.
No. 5,374,426); g) foot-and-mouth-disease virus (Twomey, et al.,
Vaccine 13:1603 1610, (1995)); h) Norwalk virus (Jiang, X., et al.,
Science 250:1580 1583 (1990); Matsui, S. M., et al., J. Clin.
Invest. 87:1456 1461 (1991)); i) Alphavirus; j) retrovirus,
preferably its GAG protein (WO 96/30523); k) retrotransposon Ty,
preferably the protein pI; l) human Papilloma virus (WO 98/15631);
m) Polyoma virus; n) Tobacco mosaic virus; and o) Flock House
Virus.
[0062] VLP comprising more than one different recombinant proteins
is generally referred, in this application, as mosaic VLP. In one
embodiment, the VLP is a mosaic VLP, wherein said mosaic VLP
comprises, or consists of, more than one recombinant protein,
preferably of two recombinant proteins, most preferably of two
recombinant capsid proteins, mutants or fragments thereof.
[0063] The term "fragment of a recombinant protein" or the term
"fragment of a coat protein", as used herein, is defined as a
polypeptide, which is of at least 70%, preferably at least 80%,
more preferably at least 90%, even more preferably at least 95% the
length of the wild-type recombinant protein, or coat protein,
respectively and which preferably retains the capability of forming
VLP. Preferably, the fragment is obtained by at least one internal
deletion, at least one truncation or at least one combination
thereof. Further preferably, the fragment is obtained by at most 5,
4, 3 or 2 internal deletions, by at most 2 truncations or by
exactly one combination thereof.
[0064] The term "fragment of a recombinant protein" or "fragment of
a coat protein" shall further refer to a polypeptide, which has at
least 80%, preferably 90%, even more preferably 95% amino acid
sequence identity with the "fragment of a recombinant protein" or
"fragment of a coat protein", respectively, as defined above and
which is preferably capable of assembling into a virus-like
particle.
[0065] The term "mutant coat protein" refers to a polypeptide
having an amino acid sequence derived from the wild type
recombinant protein, or coat protein, respectively, wherein the
amino acid sequence is at least 80%, preferably at least 85%, 90%,
95%, 97%, or 99% identical to the wild type sequence and preferably
retains the ability to assemble into a VLP.
[0066] In one preferred embodiment, the virus-like particle of the
invention is of Hepatitis B virus. The preparation of Hepatitis B
virus-like particles has been disclosed, inter alia, in WO
00/32227, WO 01/85208 and in WO 01/056905. All three documents are
explicitly incorporated herein by way of reference. Other variants
of HBcAg suitable for use in the practice of the present invention
have been disclosed in page 34-39 of WO 01/056905.
[0067] In one further preferred embodiment of the invention, a
lysine residue is introduced into the HBcAg polypeptide, to mediate
the linking of IL-1 molecule to the VLP of HBcAg. In preferred
embodiments, VLPs and compositions of the invention are prepared
using a HBcAg comprising, or alternatively consisting of, amino
acids 1-144, or 1-149, 1-185 of SEQ ID NO:1, which is modified so
that the amino acids at positions 79 and 80 are replaced with a
peptide having the amino acid sequence of (SEQ ID NO:170). This
modification changes the SEQ ID NO:1 to SEQ ID NO:2. In further
preferred embodiments, the cysteine residues at positions 48 and
110 of SEQ ID NO:2, or its corresponding fragments, preferably
1-144 or 1-149, are mutated to serine. The invention further
includes compositions comprising Hepatitis B core protein mutants
having above noted corresponding amino acid alterations. The
invention further includes compositions and vaccines, respectively,
comprising HBcAg polypeptides which comprise, or alternatively
consist of, amino acid sequences which are at least 80%, 85%, 90%,
95%, 97% or 99% identical to SEQ ID NO:2.
[0068] In one preferred embodiment of the invention, the virus-like
particle of the invention comprises, consists essentially of, or
alternatively consists of, recombinant coat proteins, mutants or
fragments thereof, of an RNA bacteriophage. Preferably, the RNA
bacteriophage is selected from the group consisting of a)
bacteriophage Q.beta.; b) bacteriophage R17; c) bacteriophage fr;
d) bacteriophage GA; e) bacteriophage SP; t) bacteriophage MS2; g)
bacteriophage M11; h) bacteriophage MX1; i) bacteriophage NL95; k)
bacteriophage 12; l) bacteriophage PP7 and m) bacteriophage
AP205.
[0069] In one preferred embodiment of the invention, the
composition comprises coat protein, mutants or fragments thereof,
of RNA bacteriophages, wherein the coat protein has amino acid
sequence selected from the group consisting of: (a) SEQ ID NO:3
referring to Q.beta. CP; (b) a mixture of SEQ ID NO:3 and SEQ ID
NO:4 (Q.beta. A1 protein); (c) SEQ ID NO:5 (R17 capsid protein);
(d) SEQ ID NO:6 (fr capsid protein); (e) SEQ ID NO:7 (GA capsid
protein); (f) SEQ ID NO:8 (SP capsid protein); (g) a mixture of SEQ
ID NO:8 and SEQ ID NO:9; (h) SEQ ID NO:10 (MS2 capsid protein); (i)
SEQ ID NO:11 (M11 capsid protein); (j) SEQ ID NO:12 (MX1 capsid
protein); (k) SEQ ID NO:13 (NL95 capsid protein); (l) SEQ ID NO:14
(f2 capsid protein); (m) SEQ ID NO:15 (PP7 capsid protein); and (n)
SEQ ID NO:21 (AP205 capsid protein).
[0070] In one preferred embodiment of the invention, the VLP is a
mosaic VLP comprising or alternatively consisting of more than one
amino acid sequence, preferably two amino acid sequences, of coat
proteins, mutants or fragments thereof, of an RNA
bacteriophage.
[0071] In one very preferred embodiment, the VLP comprises or
alternatively consists of two different coat proteins of an RNA
bacteriophage, said two coat proteins have an amino acid sequence
of CP Q.beta. (SEQ ID NO: 3) and CP Q.beta. A1 (SEQ ID NO:4), or of
CP SP (SEQ ID NO:8) and CP SP A1 (SEQ ID NO:9).
[0072] In preferred embodiments of the present invention, the
virus-like particle of the invention comprises, or alternatively
consists essentially of, or alternatively consists of recombinant
coal proteins, mutants or fragments thereof, of the
RNA-bacteriophage Q.beta., fr, AP205 or GA.
[0073] In one preferred embodiment, the VLP of the invention is a
VLP of RNA bacteriophage Q.beta.. The capsid or virus-like particle
of Q.beta. showed an icoshedral phage-like capsid structure with a
diameter of 25 nm and T=3 quasi symmetry. The capsid contains 180
copies of the coat protein, which are linked in covalent pentamers
and hexamers by disulfide bridges (Golmohammadi, R. et al.,
Structure 4:543-5554 (1996)), leading to a remarkable stability of
the Q.beta. capsid. Capsids or VLPs made from recombinant Q.beta.
coat protein may contain, however, subunits not linked via
disulfide bonds to other subunits within the capsid, or
incompletely linked. The capsid or VLP of Q.beta. shows unusual
resistance to organic solvents and denaturing agents. Surprisingly,
we have observed that DMSO and acetonitrile concentrations as high
as 30%, and guanidinium concentrations as high as 1 M do not affect
the stability of the capsid. The high stability of the capsid or
VLP of Q.beta. is an advantageous feature, in particular, for its
use in immunization and vaccination of mammals and humans in
accordance of the present invention.
[0074] Further preferred virus-like particles of RNA
bacteriophages, in particular of Q.beta. and fr in accordance of
this invention are disclosed in WO 02/056905, the disclosure of
which is herewith incorporated by reference in its entirety.
Particular example 18 of WO 02/056905 gave detailed description of
preparation of VLP particles from Q.beta..
[0075] In another preferred embodiment, the VLP of the invention is
a VLP of RNA bacteriophage AP205. Assembly-competent mutant forms
of AP205 VLPs, including AP205 coat protein with the substitution
of proline at amino acid 5 to threonine, may also be used in the
practice of the invention and leads to other preferred embodiments
of the invention. WO 2004/007538 describes, in particular in
Example 1 and Example 2, how to obtain VLP comprising AP205 coat
proteins, and hereby in particular the expression and the
purification thereto. WO 2004/007538 is incorporated herein by way
of reference. AP205 VLPs are highly immunogenic, and can be linked
with IL-1 molecule to typically and preferably generate vaccine
constructs displaying the IL-1 molecule oriented in a repetitive
manner.
[0076] In one preferred embodiment, the VLP of the invention
comprises or consists of a mutant coat protein of a virus,
preferably an RNA bacteriophage, wherein the mutant coat protein
has been modified by removal of at least one lysine residue by way
of substitution and/or by way of deletion. In another preferred
embodiment, the VLP of the invention comprises or consists of a
mutant coat protein of a virus, preferably an RNA bacteriophage,
wherein the mutant coat protein has been modified by addition of at
least one lysine residue by way of substitution and/or by way of
insertion. The deletion, substitution or addition of at least one
lysine residue allows varying the degree of coupling, i.e. the
amount of IL-1 molecule per subunits of the VLP of a virus,
preferably of an RNA bacteriophages, in particular, to match and
tailor the requirements of the vaccine.
[0077] In one preferred embodiment, the compositions and vaccines
of the invention have an antigen density being from 0.5 to 4.0. The
term "antigen density", as used herein, refers to the average
number of IL-1 molecules which is linked per subunit, preferably
per coat protein, of the VLP, and hereby preferably of the VLP of
an RNA bacteriophage. Thus, this value is calculated as an average
over all the subunits of the VLP, preferably of the VLP of the RNA
bacteriophage, in the composition or vaccines of the invention.
[0078] VLPs or capsids of Q.beta. coat protein display a defined
number of lysine residues on their surface, with a defined topology
with three lysine residues pointing towards the interior of the
capsid and interacting with the RNA, and four other lysine residues
exposed to the exterior of the capsid. Preferably, the at least one
first attachment site is a lysine residue, pointing to or being on
the exterior of the VLP.
[0079] Q.beta. mutants, of which exposed lysine residues are
replaced by arginines can be used for the present invention. Thus,
in another preferred embodiment of the present invention, the
virus-like particle comprises, consists essentially of or
alternatively consists of mutant Q.beta. coat proteins. Preferably
these mutant coat proteins comprise or alternatively consist of an
amino acid sequence selected from the group of a) Q.beta.-240 (SEQ
ID NO:16, Lys13-Arg of SEQ ID NO: 3) b) O.beta.-243 (SEQ ID NO:17,
Asn10-Lys of SEQ ID NO:3); c) Q.beta.-250 (SEQ ID NO:18, Lys2-Arg
of SEQ ID NO:3) d) Q.beta.-251 (SEQ ID NO:19, Lys16-Arg of SEQ ID
NO:3); and e) Q.beta.-259 (SEQ ID NO:20, Lys2-Arg, Lys16-Arg of SEQ
ID NO:3). The construction, expression and purification of the
above indicated Q.beta. mutant coat proteins, mutant Q.beta. coat
protein VLPs and capsids, respectively, are described in WO
02/056905. In particular is hereby referred to Example 18 of above
mentioned application.
[0080] In another preferred embodiment of the present invention,
the virus-like particle comprises, or alternatively consists
essentially of, or alternatively consists of mutant coat protein of
Q.beta., or mutants or fragments thereof, and the corresponding A1
protein. In a further preferred embodiment, the virus-like particle
comprises, or alternatively consists essentially of, or
alternatively consists of mutant coat protein with amino acid
sequence SEQ ID NO:16, 17, 18, 19, or 20 and the corresponding A1
protein.
[0081] Further RNA bacteriophage coat proteins have also been shown
to self-assemble upon expression in a bacterial host (Kastelein, R
A. et al., Gene 23:245-254 (1983), Kozlovskaya, T M. et al., Dokl.
Akad. Nauk SSSR 287:452-455 (1986), Adhin, M R. et al., Virology
170:238-242 (1989), Priano, C. et al., J. Mol. Biol. 249:283-297
(1995)). In particular the biological and biochemical properties of
GA (Ni, CZ., et al., Protein Sci. 5:2485-2493 (1996), Tars, K et
al., J. Mol. Biol. 271:759-773 (1997)) and of fr (Pushko P. et al.,
Prot. Eng. 6:883-891 (1993), Liljas, L et al. J. Mol. Biol.
244:279-290, (1994)) have been disclosed. The crystal structure of
several RNA bacteriophages has been determined (Golmohammadi, R. et
al., Structure 4:543-554 (1996)). Using such information, surface
exposed residues can be identified and, thus, RNA bacteriophage
coat proteins can be modified such that one or more reactive amino
acid residues can be inserted by way of insertion or substitution.
Another advantage of the VLPs derived from RNA bacteriophages is
their high expression yield in bacteria that allows production of
large quantities of material at affordable cost.
[0082] In one preferred embodiment, the composition of the
invention comprises at least one antigen, preferably one to four,
more preferably one to three, still more preferably one to two and
most preferably exactly one antigen, wherein said antigen is an
IL-1 molecule, preferably an IL-1 protein, an IL-1 fragment, an
IL-1 mature fragment, an IL-1 peptide or an IL-1 mutein, wherein
said IL-1 molecule preferably comprises or even more preferably
consists of a polypeptide having an amino acid sequence having at
least 80%, preferably at least 90%, more preferably at least 95%,
even more preferably at least 99% and most preferably 100% sequence
identity with any one of SEQ ID NO:36 to SEQ ID NO:116, SEQ ID
NO:130 to SEQ ID NO:140 and SEQ ID NO:163 to SEQ ID NO:165.
[0083] In a further preferred embodiment said antigen is an IL-1
molecule derived from an organism selected from the group
consisting of: (a) humans; (b) primates; (c) rodents; (d) horses;
(e) sheep; (f) cat; (g) cattle; (h) pig; (i) rabbit; (j) dog; (k)
mouse; and (l) rat. Most preferably said IL-1 molecule is derived
from humans, preferably comprising or even more preferably
consisting of a polypeptide having at least 80%, preferably at
least 90%, more preferably at least 95%, even more preferably at
least 99% and most preferably 100% sequence identity with any one
of the sequences selected from the group consisting of SEQ ID
NO:36, SEQ ID NO:49, SEQ ID NO:63, SEQ ID NO:64, any one of SEQ ID
NO:67 to 110, and one of SEQ ID NO:130-140, and SEQ ID NO:165.
[0084] In a further preferred embodiment said IL-1 molecule derived
from rat or mouse, preferably mouse, wherein said IL-1 molecule
preferably comprises or even more preferably consists of a
polypeptide having an amino acid sequence having at least 80%,
preferably at least 90%, more preferably at least 95%, even more
preferably at least 99% and most preferably 100% sequence identity
with any one of SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:53, SEQ ID
NO:54, SEQ ID NO:65, SEQ ID NO:66, any one of SEQ ID NO:111 to SEQ
ID NO:116, SEQ ID NO:163, and SEQ ID NO:164.
[0085] In a further preferred embodiment IL-1 molecule is an IL-1
alpha molecule, preferably an IL-1 alpha protein, an IL-1 alpha
fragment, an IL-1 alpha mature fragment, an IL-1 alpha peptide or
an IL-1 alpha mutein, wherein said IL-1 alpha molecule preferably
comprises or even more preferably consists of a polypeptide having
an amino acid sequence having at least 80%, preferably at least
90%, more preferably at least 95%, even more preferably at least
99% and most preferably 100% sequence identity with any one of the
sequences selected from the group consisting of SEQ ID NO:36 to 48,
SEQ ID NO:63, SEQ ID NO:65, SEQ ID NO:67 to 88, and SEQ ID NO:165.
Specifically preferred embodiments of IL-1 alpha molecules are
human IL-1 alpha molecules, preferably human IL-1 alpha proteins,
human IL-1 alpha fragments or human IL-1 alpha mature fragments,
wherein said IL-1 alpha molecules preferably comprise or even more
preferably consist of a polypeptide having an amino acid sequence
having at least 80%, preferably at least 90%, more preferably at
least 95%, even more preferably at least 99% and most preferably
100% sequence identity with any one of SEQ ID NO:36, SEQ ID NO:63,
and SEQ ID NO:163, most preferably SEQ ID NO:63.
[0086] In a further preferred embodiment said IL-1 molecule is an
IL-1 beta molecule, preferably an IL-1 beta protein, an IL-1 beta
fragment, an IL-1 beta mature fragment, an IL-1 beta peptide or an
IL-1 beta mutein, wherein said IL-1 beta molecule preferably
comprises or even more preferably consists of a polypeptide having
an amino acid sequence having at least 80%, preferably at least
90%, more preferably at least 95%, even more preferably at least
99% and most preferably 100% sequence identity with any one of the
sequences selected from the group consisting of SEQ ID NO:49 to 62,
SEQ ID NO:64, SEQ ID NO:66, SEQ ID NO:89 to 116, SEQ ID NO:130 to
SEQ ID NO:140, SEQ ID NO:164, and SEQ ID NO:165. Specifically
preferred embodiments of IL-1 beta molecules are human IL-1 beta
molecules, preferably human IL-1 beta proteins, human IL-1 beta
fragments or human IL-1 beta mature fragments, wherein said IL-1
beta molecules preferably comprises or even more preferably
consists of a polypeptide having an amino acid sequence having at
least 80%, preferably at least 90%, more preferably at least 95%,
even more preferably at least 99% and most preferably 100% sequence
identity with any one of SEQ ID NO:49, SEQ ID NO:64, SEQ ID NO:130
to SEQ ID NO:140 and SEQ ID NO:165, most preferably SEQ ID
NO:64.
[0087] In a further preferred embodiment said IL-1 molecule is an
IL-1 protein, an IL-1 fragment or, preferably, an IL-1 mature
fragment, wherein said IL-1 protein, IL-1 fragment or IL-1 mature
fragment preferably are capable of binding to the IL-1 receptor
and, still more preferably, additionally also comprise biological
activity.
[0088] In a further preferred embodiment said IL-1 molecule is an
IL-1 protein, wherein said IL-1 protein preferably comprises or
even more preferably consists of a polypeptide having an amino acid
sequence having at least 80%, preferably at least 90%, more
preferably at least 95%, even more preferably at least 99% and most
preferably 100% sequence identity with any one of SEQ ID NO:36 to
SEQ ID NO:62.
[0089] In a further preferred embodiment said IL-1 protein is an
IL-1 alpha protein, wherein said IL-1 alpha protein preferably
comprises or even more preferably consists of a polypeptide having
an amino acid sequence having at least 80%, preferably at least
90%, more preferably at least 95%, even more preferably at least
99% and most preferably 100% sequence identity with any one of the
sequences selected from the group consisting of SEQ ID NO:36 to SEQ
ID NO:48. Most preferably said IL-1 alpha protein is a human IL-1
alpha protein, wherein said human IL-1 alpha protein preferably
comprises or even more preferably consists of a polypeptide having
least 80%, preferably at least 90%, more preferably at least 95%,
even more preferably at least 99% and most preferably 100% sequence
identity with SEQ ID NO:36.
[0090] In a further preferred embodiment said IL-1 protein is an is
an IL-1 beta protein, wherein said IL-1 beta protein preferably
comprises or even more preferably consists of a polypeptide having
an amino acid sequence having at least 80%, preferably at least
90%, more preferably at least 95%, even more preferably at least
99% and most preferably 100% sequence identity with any one of the
sequences selected from the group consisting of SEQ ID NO:49 to SEQ
ID NO:62. Most preferably said IL-1 beta protein is a human IL-1
beta protein, wherein said human IL-1 beta protein preferably
comprises or even more preferably consists of a polypeptide having
least 80%, preferably at least 90%, more preferably at least 95%,
even more preferably at least 99% and most preferably 100% sequence
identity with SEQ ID NO:49.
[0091] In a further preferred embodiment said IL-1 molecule is an
IL-1 fragment, preferably an IL-1 mature fragment, and wherein said
IL-1 fragment or said IL-1 mature fragment preferably is derived
from mouse or human, most preferably human. Preferably said IL-1
fragment or said IL-1 mature fragment comprises or even more
preferably consists of a polypeptide having an amino acid sequence
having at least 80%, preferably at least 90%, more preferably at
least 95%, even more preferably at least 99% and most preferably
100% sequence identity with any one of SEQ ID NO:63 to SEQ ID
NO:66, SEQ ID NO:130, and SEQ ID NO:163 to SEQ ID NO:165.
[0092] In a further preferred embodiment said IL-1 mature fragment
is an IL-1 alpha mature fragment, wherein said IL-1 alpha mature
fragment preferably comprises biological activity and wherein
further said IL-1 alpha mature fragment preferably comprises or
even more preferably consists of a polypeptide having an amino acid
sequence having at least 80%, preferably at least 90%, more
preferably at least 95%, even more preferably at least 99% and most
preferably 100% sequence identity with any one of SEQ ID NO:63 or
SEQ ID NO:65, most preferably SEQ ID NO:63.
[0093] In a further preferred embodiment said IL-1 mature fragment
is an IL-1 beta mature fragment, wherein said IL-1 beta mature
fragment preferably comprises biological activity and wherein
further said IL-1 beta mature fragment preferably comprises or even
more preferably consists of a polypeptide having an amino acid
sequence having at least 80%, preferably at least 90%, more
preferably at least 95%, even more preferably at least 99% and most
preferably 100% sequence identity with any one of SEQ ID NO:64, SEQ
ID NO:66, and SEQ ID NO:130, most preferably SEQ ID NO:64.
[0094] In a further preferred embodiment said IL-1 molecule is an
IL-1 peptide, wherein said IL-1 peptide is derived from mouse, rat
or human, most preferably human. Preferably said IL-1 peptide
comprises or even more preferably consists of a polypeptide having
an amino acid sequence having at least 80%, preferably at least
90%, more preferably at least 95%, even more preferably at least
99% and most preferably 100% sequence identity with any one of SEQ
ID NO:67 to SEQ ID NO:116.
[0095] In a further preferred embodiment said IL-1 molecule is an
IL-1 mutein, wherein preferably said IL-1 mutein comprises reduced
or more preferably no biological activity, and wherein further said
IL-1 mutein is capable of binding the IL-1 receptor. In a further
preferred embodiment said IL-1 mutein comprises or preferably
consists of a polypeptide having an amino acid sequence which
differs from the amino acid sequence of an IL-1 mature fragment in
1 to 3, more preferably in 1 to 2, and most preferably in exactly 1
amino acid residue. In a further preferred embodiment said IL-1
mutein is an IL-1 beta mutein, preferably a human IL-1 beta mutein,
most preferably a human IL-1 beta mutein selected from SEQ ID
NO:131 to SEQ ID NO:140.
[0096] The present invention provides for a method of producing the
composition of the invention comprising (a) providing a VLP with at
least one first attachment site; (b) providing at least one
antigen, wherein said antigen is an IL-1 molecule, an IL-1 protein,
an IL-1 fragment, preferably an IL-1 mature fragment, an IL-1
peptide or an IL-1 mutein, with at least one second attachment
site; and (c) combining said VLP and said at least one antigen to
produce said composition, wherein said at least one antigen and
said VLP are linked through the first and the second attachment
sites. In a preferred embodiment, the provision of the at least one
antigen, i.e. IL-1 molecule, an IL-1 protein, an IL-1 fragment,
preferably an IL-1 mature fragment, an IL-1 peptide or an IL-1
mutein, with the at least one second attachment site is by way of
expression, preferably by way of expression in a bacterial system,
preferably in E. coli. Usually a purification tag, such as His tag,
Myc tag, Fe tag or HA tag is added to facilitate the purification
process. In another approach particularly the IL-1 peptides or IL-1
muteins with no longer than 50 amino acids are chemically
synthesized.
[0097] In one preferred embodiment of the invention, the VLP with
at least one first attachment site is linked to the IL-1 molecule
with at least one second attachment site via at least one peptide
bond. A gene encoding an IL-1 molecule, preferably an IL-1 mature
fragment, is in-frame ligated, either internally or preferably to
the N- or the C-terminus to the gene encoding the coat protein of
the VLP. Fusion may also be effected by inserting sequences of the
IL-1 into a mutant coat protein where part of the coat protein
sequence has been deleted, that are further referred to as
truncation mutants. Truncation mutants may have N- or C-terminal,
or internal deletions of part of the sequence of the coat protein.
For example for the specific VLP HBcAg, amino acids 79-80 are
replaced with a foreign epitope. The fusion protein shall
preferably retain the ability of assembly into a VLP upon
expression which can be examined by electromicroscopy.
[0098] Flanking amino acid residues may be added to increase the
distance between the coat protein and foreign epitope. Glycine and
serine residues are particularly favored amino acids to be used in
the flanking sequences. Such a flanking sequence confers additional
flexibility, which may diminish the potential destabilizing effect
of fusing a foreign sequence into the sequence of a VLP subunit and
diminish the interference with the assembly by the presence of the
foreign epitope.
[0099] In other embodiments, the at least one IL-1 molecule,
preferably the IL-1 mature fragment can be fused to a number of
other viral coat protein, as way of examples, to the C-terminus of
a truncated form of the A1 protein of Q.beta. (Kozlovska, T. M., et
al., Intervirology 39:9-15 (1996)), or being inserted between
position 72 and 73 of the CP extension. As another example, the
IL-1 can be inserted between amino acid 2 and 3 of the fr CP,
leading to a IL-1-fr CP fusion protein (Pushko P. et al., Prot.
Eng. 6:883-891 (1993)). Furthermore, IL-1 can be fused to the
N-terminal protuberant .beta.-hairpin of the coat protein of RNA
bacteriophage MS-2 (WO 92/13081). Alternatively, the IL-1 can be
fused to a capsid protein of papillomavirus, preferably to the
major capsid protein L1 of bovine papillomavirus type 1 (BPV-1)
(Chackerian, B. et al., Proc. Natl. Acad. Sci. USA 96:2373-2378
(1999), WO 00/23955). Substitution of amino acids 130-136 of BPV-1
L1 with an IL-1 is also an embodiment of the invention. Further
embodiments of fusing an IL-1 molecule to coat protein, mutants or
fragments thereof, to a coat protein of a virus have been disclosed
in WO 2004/009124 page 62 line 20 to page 68 line 17 and herein are
incorporated by way of reference.
[0100] U.S. Pat. No. 5,698,424 describes a modified coat protein of
bacteriophage MS-2 capable of forming a capsid, wherein the coat
protein is modified by an insertion of a cysteine residue into the
N-terminal hairpin region, and by replacement of each of the
cysteine residues located external to the N-terminal hairpin region
by a non-cysteine amino acid residue. The inserted cysteine may
then be linked directly to a desired molecular species to be
presented such as an epitope or an antigenic protein.
[0101] We note, however, that the presence of an exposed free
cysteine residue in the capsid may lead to oligomerization of
capsids by way of disulfide bridge formation. Moreover, attachment
between capsids and antigenic proteins by way of disulfide bonds
are labile, in particular, to sulfhydryl-moiety containing
molecules, and are, furthermore, less stable in serum than, for
example, thioether attachments (Martin F J. and Papahadjopoulos D.
(1982) Irreversible Coupling of Immunoglobulin Fragments to
Preformed Vesicles. J. Biol. Chem. 257: 286-288).
[0102] Therefore, in a further very preferred embodiment of the
present invention, the association or linkage of the VLP and the at
least one antigen, i.e. IL-1 molecule, does not comprise a
disulfide bond. Further preferred hereby, the at least one second
attachment comprise, or preferably is, a sulfhydryl group.
Moreover, in again a very preferred embodiment of the present
invention, the association or linkage of the VLP and the at least
one IL-1 molecule does not comprise a sulphur-sulphur bond. Further
preferred hereby, the at least one second attachment comprise, or
preferably is, a sulfhydryl group. In a further very preferred
embodiment, said at least one first attachment site is not or does
not comprise a sulfhydryl group. In again a further very preferred
embodiment, said at least one first attachment site is not or does
not comprise a sulfhydryl group of a cysteine.
[0103] In a further preferred embodiment said at least one first
attachment comprises an amino group and said second attachment
comprises a sulfhydryl group.
[0104] In a further preferred embodiment only one of said second
attachment sites associates with said first attachment site through
at least one non-peptide covalent bond leading to a single and
uniform type of binding of said IL-1 molecule to said core
particle, wherein said only one second attachment site that
associates with said first attachment site is a sulfhydryl group,
and wherein said IL-1 molecule and said core particle interact
through said association to form an ordered and repetitive antigen
array.
[0105] In another preferred embodiment, an IL-1 molecule,
preferably an IL-1 protein, more preferably an IL-1 mature
fragment, still more preferably an IL-1 mature fragment comprising
or consisting of amino acid sequenced SEQ ID NO:63 to SEQ ID NO:66,
most preferably SEQ ID NO:63 or SEQ ID NO:64, is fused to either
the N- or the C-terminus, preferably the C-terminus, of a coat
protein, mutants or fragments thereof, of RNA bacteriophage AP205.
VLPs comprising fusion proteins of coat protein of bacteriophage
AP205 with an antigen are generally disclosed in WO2006/032674A 1
which is incorporated herein by reference. In one further preferred
embodiment, the fusion protein further comprises a linker, wherein
said linker is fused to the coat protein, fragments or mutants
thereof, of AP205 and the IL-1 molecule. In a further preferred
embodiment said IL-1 molecule is fused to the C-terminus of said
coat protein, fragments or mutants thereof, of AP205 via said
linker.
[0106] It has been found that IL-1 molecules, in particular IL-1
proteins and IL-1 fragments comprising at least 100 and up to 300
amino acids, typically and preferably about 140 to 160 amino acids,
and most preferably about 155 amino acids, can be fused to coat
protein of bacteriophages, preferably to coat protein of AP205,
while maintaining the ability of the coat protein to self assemble
into a VLP.
[0107] Given the large size of IL-1 proteins, IL-1 fragments and
IL-1 mature fragments and also for steric reasons, an expression
system producing mosaic VLPs comprising AP205 coat proteins fused
to an IL-1 molecule as well as wt coat protein subunits was
constructed. In this system, suppression of the stop codon yields
the AP205-IL-1 coat protein fusion, while proper termination yields
the wt AP205 coat protein. Both proteins are produced
simultaneously in the cell and assemble into a mosaic VLP. The
advantage of such a system is that large proteins can be displayed
without interfering with the assembly of the VLP. As the level of
incorporation of AP205-IL-1 fusion protein into the mosaic VLP is
depending on the level of suppression, AP205-IL-1 is expressed in
E. coli cells already containing a plasmid overexpressing a
suppressor t-RNA. For opal suppression, plasmid pISM3001 (Smiley,
B. K., Minion, F. C. (1993) Enhanced readthrough of opal (UGA) stop
codons and production of Mycoplasma pneumoniae P1 epitopes in
Escherichia coli. Gene 134, 33-40), which encodes a suppressor
t-RNA recognizing the opal stop codon and introducing Trp is used.
Suppression of amber termination can be increased by use of plasmid
pISM579, which overexpresses a suppressor t-RNA recognizing the
amber stop codon and introducing Trp as well. Plasmid pISM579 was
generated by excising the trpT176 gene from pISM3001 with
restriction endonuclease EcoRI and replacing it by an EcoRI
fragment from plasmid pMY579 (gift of Michael Yarus) containing an
amber t-RNA suppressor gene. This t-RNA suppressor gene is a mutant
of trpT175 (Raftery L A. Et al. (1984) J. Bacteriol. 158:849-859),
and differs from trpT at three positions: G33, A24 and T35.
Expression of the AP205-interleukin-1alpha fusion protein in an E.
coli strain with amber suppression (supE or glnV) such as E. coli
JM109 may generate a proportion of AP205-IL-1 fusion proteins with
a Gln instead of Trp introduced at the amber stop codon, in
addition to AP205-IL-1 fusion proteins with a Trp introduced at the
amber stop codon. The identity of the amino acid translated at the
stop codon may therefore depend on the combination of suppressor
t-RNA overexpressed, and strain phenotype. As described by Miller J
H et al. ((1983) J. Mol. Biol. 164: 59-71) and as is well known in
the art, the efficiency of suppression is context dependent. In
particular, the codon 3' of the stop codon and the first base 3'
from the stop codon are particularly important. For example, stop
codons followed by a purine base are in general well
suppressed.
[0108] Thus, in a preferred embodiment said VLP is a mosaic VLP,
wherein said mosaic VLP comprises or preferably consists of at
least one, preferably one, first polypeptide and of at least one,
preferably one, second polypeptide, wherein said first polypeptide
is a recombinant capsid protein, mutant or fragments thereof; and
wherein said second polypeptide is a genetic fusion product of a
recombinant capsid protein, mutant or fragments thereof, preferably
of said first polypeptide, with an IL-1 molecule. In a further
preferred embodiment said first polypeptide is a recombinant capsid
protein of bacteriophage AP205 or a mutant or fragment thereof. In
a further preferred embodiment said first polypeptide is selected
from SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23. In a very preferred
embodiment said first polypeptide is SEQ ID NO:21. Mosaic VLPs of
bacteriophage AP205 comprising an antigen are generally disclosed
in WO2006/032674A1, in particular in paragraph 107 of said
publication. In a further preferred embodiment said second
polypeptide is a genetic fusion product of a recombinant capsid
protein, mutant or fragments thereof, preferably of said first
polypeptide, with an IL-1 molecule, wherein said IL-1 molecule is
fused to the C-terminus of said recombinant capsid protein, mutant
or fragments thereof, preferably via an amino acid linker. In a
further preferred embodiment said IL-1 molecule comprises or
preferably consists of 100 to 300 amino acids, typically and
preferably about 140 to 160 amino acids, and most preferably about
155 amino acids. In a very preferred embodiment, the molar ratio of
said first polypeptide and said second polypeptide in said mosaic
VLP is 10:1 to 5:1, preferably 8:1 to 6:1, most preferably about
7:1.
[0109] In one preferred embodiment of the present invention, the
composition comprises or alternatively consists essentially of a
virus-like particle with at least one first attachment site linked
to at least one antigen, i.e. an IL-1 molecule, with at least one
second attachment site via at least one covalent bond, wherein
preferably the covalent bond is a non-peptide bond. In a preferred
embodiment of the present invention, the first attachment site
comprises, or preferably is, an amino group, preferably the amino
group of a lysine residue. In another preferred embodiment of the
present invention, the second attachment site comprises, or
preferably is, a sulfhydryl group, preferably a sulfhydryl group of
a cysteine.
[0110] In a very preferred embodiment of the invention, the at
least one first attachment site is an amino group, preferably an
amino group of a lysine residue and the at least one second
attachment site is a sulfhydryl group, preferably a sulfhydryl
group of a cysteine.
[0111] In one preferred embodiment of the invention, the IL-1
molecule is linked to the VLP by way of chemical cross-linking,
typically and preferably by using a heterobifunctional
cross-linker. In preferred embodiments, the hetero-bifunctional
cross-linker contains a functional group which can react with the
preferred first attachment sites, preferably with the amino group,
more preferably with the amino groups of lysine residue(s) of the
VLP, and a further functional group which can react with the
preferred second attachment site, i.e. a sulfhydryl group,
preferably of cysteine(s) residue inherent of, or artificially
added to the IL-1 molecule, and optionally also made available for
reaction by reduction. Several hetero-bifunctional cross-linkers
are known to the art. These include the preferred cross-linkers
SMPH (Pierce), Sulfo-MBS, Sulfo-EMCS, Sulfo-GMBS, Sulfo-SIAB,
Sulfo-SMPB, Sulfo-SMCC, SVSB, SIA and other cross-linkers available
for example from the Pierce Chemical Company, and having one
functional group reactive towards amino groups and one functional
group reactive towards sulfhydryl groups. The above mentioned
cross-linkers all lead to formation of an amide bond after reaction
with the amino group and a thioether linkage with the sulfhydryl
groups. Another class of cross-linkers suitable in the practice of
the invention is characterized by the introduction of a disulfide
linkage between the IL-1 molecule and the VLP upon coupling.
Preferred cross-linkers belonging to this class include, for
example, SPDP and Sulfo-LC-SPDP (Pierce).
[0112] In a preferred embodiment, the composition of the invention
further comprises a linker. Engineering of a second attachment site
onto the IL-1 molecule is achieved by the association of a linker,
preferably containing at least one amino acid suitable as second
attachment site according to the disclosures of this invention.
Therefore, in a preferred embodiment of the present invention, a
linker is associated to the IL-1 molecule by way of at least one
covalent bond, preferably, by at least one, preferably one peptide
bond. Preferably, the linker comprises, or alternatively consists
of, the second attachment site. In a further preferred embodiment,
the linker comprises a sulfhydryl group, preferably of a cysteine
residue. In another preferred embodiment, the amino acid linker is
a cysteine residue.
[0113] The selection of a linker will be dependent on the nature of
the IL-1 molecule, on its biochemical properties, such as pI,
charge distribution and glycosylation. In general, flexible amino
acid linkers are favored. In a further preferred embodiment of the
present invention, the linker consists of amino acids, wherein
further preferably the linker consists of at least one and at most
25, preferably at most 20, more preferably at most 15 amino acids.
In an again preferred embodiment of the invention, the amino acid
linker contains 1 to 10 amino acids. Preferred embodiments of the
linker are selected from the group consisting of: (a) CGG (SEQ ID
NO:171); (b) N-terminal gamma 1-linker, preferably CGDKTHTSPP (SEQ
ID NO:172); (c) N-terminal gamma 3-linker, preferably
CGGPKPSTPPGSSGGAP (SEQ ID NO:173); (d) Ig hinge regions; (e)
N-terminal glycine linkers, preferably GCGGGG (SEQ ID NO:174); (f)
(G)kC(G)n with n=0-12 and k=0-5 (SEQ ID NO:175); (g) N-terminal
glycine-serine linkers, preferably (GGGGS)n, n=1-3 (SEQ ID NO:176)
with one further cysteine; (h) (G)kC(G)m(S)l(GGGGS)n with n=0-3,
k=0-5, m=0-10, 1=0-2 (SEQ ID NO:177); (i) GGC (SEQ ID NO:178); (k)
GGC-NH2 (SEQ ID NO:179); (l) C-terminal gamma 1-linker, preferably
DKTHTSPPCG (SEQ ID NO:180); (m) C-terminal gamma 3-linker,
preferably PKPSTPPGSSGGAPGGCG (SEQ ID NO:181); (n) C-terminal
glycine linkers, preferably GGGGCG (SEQ ID NO:182)); (o) (G)nC(G)k
with n=0-12 and k=0-5 (SEQ ID NO:183); (p) C-terminal
glycine-serine linkers, preferably (SGGGG)n n=1-3 (SEQ ID NO:184)
with one further cysteine; (q) (G)m(S)l(GGGGS)n(G)oC(G)k with
n=0-3, k=0-5, m=0-10, 1=0-2, and o=0-8 (SEQ ID NO:185). In a
further preferred embodiment the linker is added to the N-terminus
of the IL-1 molecule. In another preferred embodiment of the
invention, the linker is added to the C-terminus of IL-1
molecule.
[0114] Preferred linkers according to this invention are glycine
linkers (G)n further containing a cysteine residue as second
attachment site, such as N-terminal glycine linker (GCGGGG, SEQ ID
NO:174) and C-terminal glycine linker (GGGGCG, SEQ ID NO:182).
Further preferred embodiments are C-terminal glycine-lysine linker
(GGKKGC, SEQ ID NO:186) and N-terminal glycine-lysine linker
(CGKKGG, SEQ ID NO:187), GGCG (SEQ ID NO:188) and GGC (SEQ ID
NO:178) or GGC-NH2 (SEQ ID NO:179, "NH2" stands for amidation)
linkers at the C-terminus of the peptide or CGG (SEQ ID NO:171) at
its N-terminus. In general, glycine residues will be inserted
between bulky amino acids and the cysteine to be used as second
attachment site, to avoid potential steric hindrance of the bulkier
amino acid in the coupling reaction.
[0115] Linking of the IL-1 molecule to the VLP by using a
hetero-bifunctional cross-linker according to the preferred methods
described above, allows coupling of the IL-1 molecule to the VLP in
an oriented fashion. Other methods of linking the IL-1 molecule to
the VLP include methods wherein the IL-1 molecule is cross-linked
to the VLP, using the carbodiimide EDC, and NHS. The IL-1 molecule
may also be first thiolated through reaction, for example with
SATA, SATP or iminothiolane. The IL-1 molecule, after deprotection
if required, may then be coupled to the VLP as follows. After
separation of the excess thiolation reagent, the IL-1 molecule is
reacted with the VLP, previously activated with a
hetero-bifunctional cross-linker comprising a cysteine reactive
moiety, and therefore displaying at least one or several functional
groups reactive towards cysteine residues, to which the thiolated
IL-1 molecule can react, such as described above. Optionally, low
amounts of a reducing agent are included in the reaction mixture.
In further methods, the IL-1 molecule is attached to the VLP, using
a homo-bifunctional cross-linker such as glutaraldehyde, DSG,
BM[PEO]4, BS3, (Pierce) or other known homo-bifunctional
cross-linkers with functional groups reactive towards amine groups
or carboxyl groups of the VLP.
[0116] In other embodiments of the present invention, the
composition comprises or alternatively consists essentially of a
virus-like particle linked to IL-1 molecule via chemical
interactions, wherein at least one of these interactions is not a
covalent bond.
[0117] Linking of the VLP to the IL-1 molecule can be effected by
biotinylating the VLP and expressing the IL-1 molecule as a
streptavidin-fusion protein.
[0118] One or several antigen molecules, i.e. IL-1 molecules, can
be attached to one subunit of the VLP, preferably of RNA
bacteriophage coat proteins, preferably through the exposed lysine
residues of the coat proteins of RNA bacteriophage VLP, if
sterically allowable. A specific feature of the VLPs of RNA
bacteriophage and in particular of the Q.beta. coat protein VLP is
thus the possibility to couple several antigens per subunit. This
allows for the generation of a dense antigen array.
[0119] In very preferred embodiments of the invention, the IL-1
molecule is linked via a cysteine residue, having been added to
either the N-terminus or the C-terminus of, or a natural cysteine
residue within an IL-1 molecule, to lysine residues of coat
proteins of the VLPs of RNA bacteriophage, and in particular to the
coat protein of Q.beta..
[0120] As described above, four lysine residues are exposed on the
surface of the VLP of Q.beta. coat protein. Typically and
preferably these residues are derivatized upon reaction with a
cross-linker molecule. In the instance where not all of the exposed
lysine residues can be coupled to an antigen, the lysine residues
which have reacted with the cross-linker are left with a
cross-linker molecule attached to the c-amino group after the
derivatization step. This leads to disappearance of one or several
positive charges, which may be detrimental to the solubility and
stability of the VLP. By replacing some of the lysine residues with
arginines, as in the disclosed Q.beta. coat protein mutants, we
prevent the excessive disappearance of positive charges since the
arginine residues do not react with the preferred cross-linkers.
Moreover, replacement of lysine residues by arginine residues may
lead to more defined antigen arrays, as fewer sites are available
for reaction to the antigen.
[0121] Accordingly, exposed lysine residues were replaced by
arginines in the following Q.beta. coat protein mutants:
Q.beta.-240 (Lys13-Arg; SEQ ID NO:16), Q.beta.-250 (Lys 2-Arg,
Lys13-Arg; SEQ ID NO:18), Q.beta.-259 (Lys 2-Arg, Lys16-Arg; SEQ ID
NO:20) and Q.beta.-251; (Lys16-Arg, SEQ ID NO:19). In a further
embodiment, we disclose a Q.beta. mutant coat protein with one
additional lysine residue Q.beta.-243 (Asn 10-Lys; SEQ ID NO:17),
suitable for obtaining even higher density arrays of antigens.
[0122] In one preferred embodiment of the invention, the VLP of an
RNA bacteriophage is recombinantly produced by a host and wherein
said VLP is essentially free of host RNA, preferably host nucleic
acids. In one further preferred embodiment, the composition further
comprises at least one polyanionic macromolecule bound to,
preferably packaged in or enclosed in, the VLP. In a still further
preferred embodiment, the polyanionic macromolecule is polyglutamic
acid and/or polyaspartic acid.
[0123] In another preferred embodiment, the composition further
comprises at least one immunostimulatory substance bound to,
preferably packaged in or enclosed in, the VLP. In a still further
preferred embodiment, the immunostimulatory substance is a nucleic
acid, preferably DNA, most preferably an unmethylated CpG
containing oligonucleotide.
[0124] Essentially free of host RNA, preferably host nucleic acids:
The term "essentially free of host RNA, preferably host nucleic
acids" as used herein, refers to the amount of host RNA, preferably
host nucleic acids, comprised by the VLP, which amount typically
and preferably is less than 30 .mu.g, preferably less than 20
.mu.g, more preferably less than 10 .mu.g, even more preferably
less than 8 .mu.g, even more preferably less than 6 .mu.g, even
more preferably less than 4 .mu.g, most preferably less than 2
.mu.g, per mg of the VLP. Host, as used within the afore-mentioned
context, refers to the host in which the VLP is recombinantly
produced. Conventional methods of determining the amount of RNA,
preferably nucleic acids, are known to the skilled person in the
art. The typical and preferred method to determine the amount of
RNA, preferably nucleic acids, in accordance with the present
invention is described in Example 17 of WO2006/037787A2. Identical,
similar or analogous conditions are, typically and preferably, used
for the determination of the amount of RNA, preferably nucleic
acids, for inventive compositions comprising VLPs other than
Q.beta.. The modifications of the conditions eventually needed are
within the knowledge of the skilled person in the art. The numeric
value of the amounts determined should typically and preferably be
understood as comprising values having a deviation of .+-.10%,
preferably having a deviation of .+-.5%, of the indicated numeric
value.
[0125] Polyanionic macromolecule: The term "polyanionic
macromolecule", as used herein, refers to a molecule of high
relative molecular mass which comprises repetitive groups of
negative charge, the structure of which essentially comprises the
multiple repetition of units derived, actually or conceptually,
from molecules of low relative molecular mass. A polyanionic
macromolecule should have a molecular weight of at least 2000
Dalton, more preferably of at least 3000 Dalton and even more
preferably of at least 5000 Dalton. The term "polyanionic
macromolecule" as used herein, typically and preferably refers to a
molecule that is not capable of activating toll-like receptors.
Thus, the term "polyanionic macromolecule" typically and preferably
excludes Toll-like receptors ligands, and even more preferably
furthermore excludes immunostimulatory substances such as Toll-like
receptors ligands, immunostimulatory nucleic acids, and
lipopolysaccharides (LPS). More preferably the term "polyanionic
macromolecule" as used herein, refers to a molecule that is not
capable of inducing cytokine production. Even more preferably the
term "polyanionic macromolecule" excludes immunostimulatory
substances. The term "immunostimulatory substance", as used herein,
refers to a molecule that is capable of inducing and/or enhancing
immune response specifically against the antigen comprised in the
present invention.
[0126] Host RNA, preferably host nucleic acids: The term "host RNA,
preferably host nucleic acids" or the term "host RNA, preferably
host nucleic acids, with secondary structure", as used herein,
refers to the RNA, or preferably nucleic acids, that are originally
synthesized by the host. The RNA, preferably nucleic acids, may,
however, undergo chemical and/or physical changes during the
procedure of reducing or eliminating the amount of RNA, preferably
nucleic acids, typically and preferably by way of the inventive
methods, for example, the size of the RNA, preferably nucleic
acids, may be shortened or the secondary structure thereof may be
altered. However, even such resulting RNA or nucleic acids is still
considered as host RNA, or host nucleic acids.
[0127] Methods to determine the amount of RNA and to reduce the
amount of RNA comprised by the VLP have disclosed in US provisional
application filed by the same assignee on Oct. 5, 2004 and thus the
entire application is incorporated herein by way of reference.
Reducing or eliminating the amount of host RNA, preferably host
nucleic, minimizes or reduces unwanted T cell responses, such as
inflammatory T cell response and cytotoxic T cell response, and
other unwanted side effects, such as fever, while maintaining
strong antibody response specifically against IL-1.
[0128] In one preferred embodiment, this invention provides a
method of preparing the inventive compositions and VLP of an
RNA-bacteriophage the invention, wherein said VLP is recombinantly
produced by a host and wherein said VLP is essentially free of host
RNA, preferably host nucleic acids, comprising the steps of a)
recombinantly producing a virus-like particle (VLP) with at least
one first attachment site by a host, wherein said VLP comprises
coat proteins, variants or fragments thereof, of a
RNA-bacteriophage; b) disassembling said virus-like particle to
said coat proteins, variants or fragments thereof, of said
RNA-bacteriophage; c) purifying said coat proteins, variants or
fragments thereof; d) reassembling said purified coat proteins,
variants or fragments thereof, of said RNA-bacteriophage to a
virus-like particle, wherein said virus-like particle is
essentially free of host RNA, preferably host nucleic acids; and e)
linking at least one antigen of the invention with at least one
second attachment site to said VLP obtained from step d). In a
further preferred embodiment, the reassembling of said purified
coat proteins, variants or fragments thereof, is effected in the
presence of at least one polyanionic macromolecule.
[0129] In one aspect, the invention provides a vaccine comprising
the composition of the invention. In one preferred embodiment, the
IL-1 molecule which is linked to the VLP in the vaccine composition
may be of animal, preferably mammal or human origin. In preferred
embodiments, the IL-1 of the invention is of human, bovine, dog,
cat, mouse, rat, pig or horse origin.
[0130] In one preferred embodiment, the vaccine composition further
comprises at least one adjuvant. The administration of the at least
one adjuvant may hereby occur prior to, contemporaneously or after
the administration of the inventive composition. The term
"adjuvant" as used herein refers to non-specific stimulators of the
immune response or substances that allow generation of a depot in
the host which when combined with the vaccine and pharmaceutical
composition, respectively, of the present invention may provide for
an even more enhanced immune response.
[0131] In another preferred embodiment, the vaccine composition is
devoid of adjuvant.
[0132] An advantageous feature of the present invention is the high
immunogenicity of the composition, even in the absence of
adjuvants. The absence of an adjuvant, furthermore, minimizes the
occurrence of unwanted inflammatory T-cell responses representing a
safety concern in the vaccination against self antigens. Thus, the
administration of the vaccine of the invention to a patient will
preferably occur without administering at least one adjuvant to the
same patient prior to, contemporaneously or after the
administration of the vaccine.
[0133] The invention further discloses a method of immunization
comprising administering the vaccine of the present invention to an
animal or a human. The animal is preferably a mammal, such as cat,
sheep, pig, horse, bovine, dog, rat, mouse and particularly human.
The vaccine may be administered to an animal or a human by various
methods known in the art, but will normally be administered by
injection, infusion, inhalation, oral administration, or other
suitable physical methods. The conjugates may alternatively be
administered intramuscularly, intravenously, transmucosally,
transdermally, intranasally, intraperitoneally or subcutaneously.
Components of conjugates for administration include sterile aqueous
(e.g., physiological saline) or non-aqueous solutions and
suspensions. Examples of non-aqueous solvents are propylene glycol,
polyethylene glycol, vegetable oils such as olive oil, and
injectable organic esters such as ethyl oleate. Carriers or
occlusive dressings can be used to increase skin permeability and
enhance antigen absorption.
[0134] Vaccines of the invention are said to be "pharmacologically
acceptable" if their administration can be tolerated by a recipient
individual. Further, the vaccines of the invention will be
administered in a "therapeutically effective amount" (i.e., an
amount that produces a desired physiological effect). The nature or
type of immune response is not a limiting factor of this
disclosure. Without the intention to limit the present invention by
the following mechanistic explanation, the inventive vaccine might
induce antibodies which bind to IL-1 and thus reducing its
concentration and/or interfering with its physiological or
pathological function.
[0135] In one aspect, the invention provides a pharmaceutical
composition comprising the composition as taught in the present
invention and an acceptable pharmaceutical carrier. When vaccine of
the invention is administered to an individual, it may be in a form
which contains salts, buffers, adjuvants, or other substances which
are desirable for improving the efficacy of the conjugate. Examples
of materials suitable for use in preparation of pharmaceutical
compositions are provided in numerous sources including Remington's
Pharmaceutical Sciences (Osol, A, ed., Mack Publishing Co.,
(1990)).
[0136] The invention teaches a process for producing the
composition of the invention comprising the steps of (a) providing
a VLP with at least one first attachment site; (b) providing a IL-1
molecule with at least one second attachment site, and (c)
combining said VLP and said IL-1 molecule to produce a composition,
wherein said IL-1 molecule and said VLP are linked through the
first and the second attachment sites.
[0137] In a further preferred embodiment, the step of providing a
VLP with at least one first attachment site comprises further
steps: (a) disassembling said virus-like particle to said coat
proteins, mutants or fragments thereof, of said RNA-bacteriophage;
(b) purifying said coat proteins, mutants or fragments thereof; (c)
reassembling said purified coat proteins, mutants or fragments
thereof, of said RNA-bacteriophage to a virus-like particle,
wherein said virus-like particle is essentially free of host RNA,
preferably host nucleic acids. In a still further preferred
embodiment, the reassembling of said purified coat proteins is
effected in the presence of at least one polyanionic
macromolecule.
[0138] The invention provides a method of using the compositions of
the invention for treating and/or attenuating diseases or
conditions in which IL-1 exerts an important pathological function
in an animal or in human.
[0139] The invention further provides for use of the compositions
of the invention or the vaccine of the invention or the
pharmaceutical composition of the invention for the manufacture of
a medicament for treatment of a disease in an animal, preferably
dog, cat horse or human, most preferably human, wherein said
disease is preferably selected from the group consisting of: (a)
vascular diseases, preferably coronary artery disease,
atherosclerosis and vasculitis, most preferably atherosclerosis;
(b) inherited IL-1-dependent inflammatory diseases, preferably
Familial Mediterranean Fever (FMF), Familial Cold Autoinflammatory
Syndrome (FCAS) Neonatal Onset Multisystem Inflammatory Disease
(NOMID) and Muckle Wells Syndrome, most preferably Familial
Mediterranean Fever (FMF); (c) chronic autoimmune inflammatory
diseases, preferably rheumatoid arthritis, systemic onset juvenile
idiopathic arthritis, adult onset Still's disease, psoriasis,
Crohn's disease and ulcerative colitis, most preferably rheumatoid
arthritis; (d) bone and cartilage degenerative diseases, preferably
gout, osteoporosis and osteoarthritis, most preferably
osteoarthritis; (e) allergic diseases, preferably contact
hypersensitivity, type 1 hypersensitivity and allergy, most
preferably allergy; and (f) neurological diseases, preferably
Alzheimer's disease, epilepsy, Parkinson's disease and multiple
sclerosis, most preferably multiple sclerosis.
[0140] The invention further provides for use of the compositions
of the invention or the vaccine of the invention or the
pharmaceutical composition of the invention for the manufacture of
a medicament for treatment of a disease in an animal, preferably
dog, cat horse or human, most preferably human, wherein said
disease is a vascular disease, preferably coronary artery disease,
atherosclerosis and vasculitis, most preferably atherosclerosis,
and wherein said at least one antigen comprised by said
composition, said vaccine or said pharmaceutical composition is an
IL-1 alpha molecule of the invention, preferably an IL-1 alpha
mature fragment, most preferably SEQ ID NO:63 or a mutein
thereof.
[0141] The invention further provides for use of the compositions
of the invention or the vaccine of the invention or the
pharmaceutical composition of the invention for the manufacture of
a medicament for treatment of a disease in an animal, preferably
dog, cat horse or human, most preferably human, wherein said
disease is selected from the group consisting of: (a) inherited
IL-1-dependent inflammatory diseases, preferably Familial
Mediterranean Fever (FMF), Familial Cold Autoinflammatory Syndrome
(FCAS) Neonatal Onset Multisystem Inflammatory Disease (NOMID) and
Muckle Wells Syndrome, most preferably Familial Mediterranean Fever
(FMF); (b) chronic autoimmune inflammatory diseases, preferably
rheumatoid arthritis, systemic onset juvenile idiopathic arthritis,
adult onset Still's disease, psoriasis, Crohn's disease and
ulcerative colitis, most preferably rheumatoid arthritis; (c) bone
and cartilage degenerative diseases, preferably gout, osteoporosis
and osteoarthritis, most preferably osteoarthritis; (d) allergic
diseases, preferably contact hypersensitivity, type 1
hypersensitivity and allergy, most preferably allergy; and (e)
neurological diseases, preferably Alzheimer's disease, epilepsy,
Parkinson's disease and multiple sclerosis, most preferably
multiple sclerosis, and wherein said at least one antigen comprised
by said composition, said vaccine or said pharmaceutical
composition is an IL-1 beta molecule, preferably an IL-1 beta
mature fragment, most preferably SEQ ID NO:64 or a mutein
thereof.
[0142] The invention further provides for use of the compositions
of the invention or the vaccine of the invention or the
pharmaceutical composition of the invention for the manufacture of
a medicament for treatment of a disease in an animal, preferably
dog, cat horse or human, most preferably human, wherein said
disease is an inherited IL-1-dependent inflammatory diseases,
preferably Familial Mediterranean Fever (FMF); and wherein said at
least one antigen comprised by said composition, said vaccine or
said pharmaceutical composition is an IL-1 beta molecule,
preferably an IL-1 beta mature fragment, most preferably SEQ ID
NO:64 or a mutein thereof.
[0143] The invention further provides for use of the compositions
of the invention or the vaccine of the invention or the
pharmaceutical composition of the invention for the manufacture of
a medicament for treatment of a disease in an animal, preferably
human, wherein said disease is a vascular disease, preferably
atherosclerosis.
[0144] The invention further provides for use of the compositions
of the invention or the vaccine of the invention or the
pharmaceutical composition of the invention for the manufacture of
a medicament for treatment of a disease in an animal, preferably
human, wherein said disease is an inherited IL-1-dependent
inflammatory diseases, preferably familial Mediterranean fever
(FMF).
[0145] The invention further provides for use of the compositions
of the invention or the vaccine of the invention or the
pharmaceutical composition of the invention for the manufacture of
a medicament for treatment of a disease in an animal, preferably
human, wherein said disease is a chronic autoimmune inflammatory
diseases, preferably rheumatoid arthritis.
[0146] The invention further provides for use of the compositions
of the invention or the vaccine of the invention or the
pharmaceutical composition of the invention for the manufacture of
a medicament for treatment of a disease in an animal, preferably
human, wherein said disease is a bone and cartilage degenerative
diseases, preferably osteoarthritis.
[0147] The invention further provides for use of the compositions
of the invention or the vaccine of the invention or the
pharmaceutical composition of the invention for the manufacture of
a medicament for treatment of a disease in an animal, preferably
human, wherein said disease is a neurological disease, preferably
multiple sclerosis.
[0148] The invention further provides a method of treating a
disease, the method comprising administering the composition of the
invention, the vaccine of the invention or the pharmaceutical
composition of the invention to an animal, preferably dog, cat
horse or human, most preferably human, wherein said disease is
preferably selected from the group consisting of: (a) vascular
diseases, preferably coronary artery disease, atherosclerosis and
vasculitis, most preferably atherosclerosis; (b) inherited
IL-1-dependent inflammatory diseases, preferably Familial
Mediterranean Fever (FMF), Familial Cold Autoinflammatory Syndrome
(FCAS) Neonatal Onset Multisystem Inflammatory Disease (NOMID) and
Muckle Wells Syndrome, most preferably Familial Mediterranean Fever
(FMF); (c) chronic autoimmune inflammatory diseases, preferably
rheumatoid arthritis, systemic onset juvenile idiopathic arthritis,
adult onset Still's disease, psoriasis, Crohn's disease and
ulcerative colitis, most preferably rheumatoid arthritis; (d) bone
and cartilage degenerative diseases, preferably gout, osteoporosis
and osteoarthritis, most preferably osteoarthritis; (e) allergic
diseases, preferably contact hypersensitivity, type 1
hypersensitivity and allergy, most preferably allergy; and (f)
neurological diseases, preferably Alzheimer's disease, epilepsy,
Parkinson's disease and multiple sclerosis, preferably multiple
sclerosis.
[0149] The invention further provides a method of treating a
disease, the method comprising administering the composition of the
invention, the vaccine of the invention or the pharmaceutical
composition of the invention to an animal, preferably dog, cat
horse or human, most preferably human, wherein said disease is a
vascular diseases, preferably coronary artery disease,
atherosclerosis and vasculitis, most preferably atherosclerosis,
and wherein said at least one antigen comprised by said
composition, said vaccine or said pharmaceutical composition is an
IL-1 alpha molecule, preferably an IL-1 alpha mature fragment, most
preferably SEQ ID NO:63 or a mutein thereof.
[0150] The invention further provides a method of treating a
disease, the method comprising administering the composition of the
invention, the vaccine of the invention or the pharmaceutical
composition of the invention to an animal, preferably dog, cat
horse or human, most preferably human, wherein said disease is
preferably selected from the group consisting of: (a) inherited
IL-1-dependent inflammatory diseases, preferably Familial
Mediterranean Fever (FMF), Familial Cold Autoinflammatory Syndrome
(FCAS) Neonatal Onset Multisystem Inflammatory Disease (NOMID) and
Muckle Wells Syndrome, most preferably Familial Mediterranean Fever
(FMF); (b) chronic autoimmune inflammatory diseases, preferably
rheumatoid arthritis, systemic onset juvenile idiopathic arthritis,
adult onset Still's disease, psoriasis, Crohn's disease and
ulcerative colitis, most preferably rheumatoid arthritis; (c) bone
and cartilage degenerative diseases, preferably gout, osteoporosis
and osteoarthritis, most preferably osteoarthritis; (d) allergic
diseases, preferably contact hypersensitivity, type 1
hypersensitivity and allergy, most preferably allergy; and (e)
neurological diseases, preferably Alzheimer's disease, epilepsy,
Parkinson's disease and multiple sclerosis, most preferably
multiple sclerosis, and wherein said at least one antigen comprised
by said composition, said vaccine or said pharmaceutical
composition is an IL-1 beta molecule, preferably an IL-1 beta
mature fragment, most preferably SEQ ID NO:64 or a mutein
thereof.
[0151] The invention further provides a method of treating a
disease, the method comprising administering the composition of the
invention, the vaccine of the invention or the pharmaceutical
composition of the invention to an animal, preferably dog, cat
horse or human, most preferably human, wherein said disease is an
inherited IL-1-dependent inflammatory diseases, preferably Familial
Mediterranean Fever (FMF); and wherein said at least one antigen
comprised by said composition, said vaccine or said pharmaceutical
composition is an IL-1 beta molecule, preferably an IL-1 beta
mature fragment, most preferably SEQ ID NO:64 or a mutein
thereof.
[0152] The invention further provides a method of treating a
disease, the method comprising administering the composition of the
invention, the vaccine of the invention or the pharmaceutical
composition of the invention to an animal, preferably human,
wherein said disease is a vascular disease, preferably
atherosclerosis.
[0153] The invention further provides a method of treating a
disease, the method comprising administering the composition of the
invention, the vaccine of the invention or the pharmaceutical
composition of the invention to an animal, preferably human,
wherein said disease is an inherited IL-1-dependent inflammatory
diseases, preferably familial Mediterranean fever (FMF).
[0154] The invention further provides a method of treating a
disease, the method comprising administering the composition of the
invention, the vaccine of the invention or the pharmaceutical
composition of the invention to an animal, preferably human,
wherein said disease is a chronic autoimmune inflammatory diseases,
preferably rheumatoid arthritis. The invention further provides a
method of treating a disease, the method comprising administering
the composition of the invention, the vaccine of the invention or
the pharmaceutical composition of the invention to an animal,
preferably human, wherein said disease is a bone and cartilage
degenerative diseases, preferably osteoarthritis.
[0155] All references cited herein are incorporated entirely by
reference.
EXAMPLES
Example 1
Cloning, Expression and Purification of Murine
IL1.alpha..sub.117-270 and IL-1.beta..sub.119-269
[0156] The nucleotide sequence encoding amino acids 117-270 of
murine IL-1.alpha. was amplified by PCR from a cDNA library of
TNF.alpha.-activated murine macrophages using oligonucleotides
IL1.alpha.1 (5'-ATATATGCTAGCCCCTTACACCTACCAGAGTGATTTG-3'; SEQ ID
NO:24) and IL1.alpha.2 (5'-ATATATCTCGAGTGATATCTGGAAGTCTGTCATA
GAG-3'; SEQ ID NO:25). Using the same cDNA library, the nucleotide
sequence encoding amino acids 119-269 of the murine IL-1.beta.
precursor was amplified with oligonucleotides IL1.beta.1
(5'-ATATATGCTAGCCCCCATTAGACAGCTGCACTACAGG-3'; SEQ ID NO:26) and
IL1.beta.2 (5'-ATATATCTCGAGGGAAGACACAGATTCCATGGTGAAG-3'; SEQ ID NO:
27). Both DNA fragments were digested with NheI and XhoI, and
cloned into the expression vector pModEC1 (SEQ ID NO:29)
[0157] The vector pModEC1 (SEQ ID NO:29) is a derivative of
pET22b(+) (Novagen Inc.), and was constructed in two steps. In a
first step the multiple cloning site of pET22b(+) was changed by
replacing the original sequence between the NdeI and XhoI sites
with the annealed oligos primerMCS-1F
(5'-TATGGATCCGGCTAGCGCTCGAGGGTTTA AACGGCGGCCGCAT-3'; SEQ ID NO:30)
and primerMCS-1R (5'-TCGAATGCGGCCG
CCGTTTAAACCCTCGAGCGCTAGCCGGATCCA-3'; SEQ ID NO:31) (annealing in 15
mM TrisHCl pH 8 buffer). The resulting plasmid was termed pMod00,
and had NdeI, BamHI, NheI, XhoI, PmeI and NotI restriction sites in
its multiple cloning site. The annealed pair of oligos
Bamhis6-EK-Nhe-F (5'-GATCCACACCACCACCACCACCACGG
TTCTGGTGACGACGATGACAAAGCGCTAGCCC-3'; SEQ ID NO:32) and
Bamhis6-EKNhe-R (5'-TCGAGGGCTAGCGCTTTGTCATCGTCGTCACCAGAACCGTGGT
GGTGGTGGTGGTGTG-3'; SEQ ID NO:33) and the annealed pair of
oligo1F-C-glycine-linker
(5'-TCGAGGGTGGTGGTGGTGGTTGCGGTTAATAAGTTTAAACGC-3'; SEQ ID NO:34)
and oligo1R-C-glycine-linker (5'-GGCCGCGTTTAAACTTATTA
ACCGCAACCACCACCACCACCC-3'; SEQ ID NO:35) were ligated together into
the BamHI-NotI digested pMod00 plasmid to obtain pModEC1, which
encodes an N-terminal hexahistidine tag, an enterokinase cleavage
site and a C-terminal glycine linker containing one cysteine
residue.
[0158] The cloning of the above mentioned fragments into pModEC1
gave rise to plasmids pModEC1-His-EK-mIL1.alpha..sub.117-270 and
pModEC1-His-EK-mIL1.beta..sub.119-269, respectively. These plasmids
encode fusion proteins consisting of an N-terminal His-tag, an
enterokinase cleavage site, the mature murine IL-1.alpha. or
IL-1.beta., respectively, and a C-terminal cysteine-containing
linker (GGGGGCG, SEQ ID NO:28). For expression, Escherichia coli
BL21 cells harbouring either plasmid were grown at 37.degree. C. to
an OD at 600 nm of 1.0 and then induced by addition of
isopropyl-.beta.-D-thiogalactopyranoside at a concentration of 1
mM. Bacteria were grown for 4 more hours at 37.degree. C.,
harvested by centrifugation and resuspended in 80 ml lysis buffer
(10 mM Na.sub.2HPO.sub.4, 30 mM NaCl, pH 7.0). Cells were then
disrupted by sonication and cellular DNA and RNA were digested by
30 min incubation at room temperature with 64 .mu.l 2 M MgCl.sub.2
and 10 .mu.l Benzonase. Cellular debris was removed by
centrifugation (SS34 rotor, 20000 rpm, 4.degree. C., 60 min), and
the cleared lysate was applied to a Ni.sup.2+-NTA agarose column
(Qiagen, Hilden, Germany). After extensive washing of the column
with washing buffer (50 mM NaH.sub.2PO.sub.4, 300 mM NaCl, 20 mM
Imidazol, pH 8.0) the proteins were eluted with elution buffer (50
mM NaH.sub.2PO.sub.4, 300 mM NaCl, 200 mM Imidazol, pH 8.0).
Purified proteins were dialysed against PBS pH 7.2, flash-frozen in
liquid nitrogen and stored at -80.degree. C. until further use.
Example 2
A. Coupling of Mouse IL-1.beta..sub.119-269 to Q.beta. Virus-like
Particles
[0159] A solution containing 1.3 mg/ml of the purified murine
IL-1.beta..sub.119-269 protein from EXAMPLE 1 (SEQ ID NO:66) in PBS
pH 7.2 was incubated for 60 min at room temperature with an
equimolar amount of TCEP for reduction of the C-terminal cysteine
residue.
[0160] A solution of 6 ml of 2 mg/ml Q.beta. capsid protein in PBS
pH 7.2 was then reacted for 60 min at room temperature with 131
.mu.l of a SMPH solution (65 mM in DMSO). The reaction solution was
dialysed at 4.degree. C. against three 3 l changes of 20 mM HEPES,
150 mM NaCl pH 7.2 over 24 hours. Seventy-five .mu.l of the
derivatized and dialyzed Q.beta. solution was mixed with 117 .mu.l
H.sub.2O and 308 .mu.l of the purified and pre-reduced mouse
IL-1.beta..sub.119-269 protein and incubated over night at
15.degree. C. for chemical crosslinking. Uncoupled protein was
removed by tangential flow filtration against PBS using cellulose
ester membranes with a molecular weight cutoff of 300.000 Da.
[0161] Coupled products were analyzed on a 12% SDS-polyacrylamide
gel under reducing conditions. The Coomassie stained gel is shown
in FIG. 1. Several bands of increased molecular weight with respect
to the Q.beta. capsid monomer are visible, clearly demonstrating
the successful cross-linking of the mouse IL-1.beta..sub.119-269
protein to the Q.beta. capsid.
B. Immunization of Mice with Mouse IL-1.beta..sub.119-269 Protein
Coupled to Q.beta. Capsid (Q.beta.-mIL-1.beta..sub.119-269)
[0162] Five female balb/c mice were immunized with
Q.beta.-mIL-1.beta..sub.119-269 (SEQ ID NO:66). Fifty .mu.g of
total protein were diluted in PBS to 200 .mu.l and injected
subcutaneously (100 .mu.l on two ventral sides) on day 0 and day
21. Mice were bled retroorbitally on day 0, 21, and 35, and sera
were analyzed using mouse IL-1.beta..sub.119-269-specific
ELISA.
C. ELISA
[0163] ELISA plates were coated with mouse IL1.beta..sub.119-269
protein at a concentration of 1.mu.g/ml. The plates were blocked
and then incubated with serially diluted mouse sera from day 0, 21,
and 35. Bound antibodies were detected with enzymatically labeled
anti-mouse IgG antibody. Antibody titers of mouse sera were
calculated as the average of those dilutions which led to half
maximal optical density at 450 nm. The average anti-mouse
IL-1.beta..sub.119-269 titer was 1:22262 at day 21 and 1:309276 at
day 35. This demonstrates that immunization with Q.beta. coupled to
the mouse IL-1.beta..sub.119-269 protein could overcome
immunological tolerance and produce high titer antibodies which
recognize specifically IL-1.beta..sub.119-269.
D. In Vitro Neutralization of IL-1.beta.
[0164] Sera of mice immunized with Q.beta.-mIL-1.beta..sub.119-269
(SEQ ID NO:66) were then tested for their ability to inhibit the
binding of mouse IL-1.beta. protein to its receptor. ELISA plates
were therefore coated with a recombinant mIL-1receptor1-hFc fusion
protein at a concentration of 1 .mu.g/ml, and co-incubated with
serial dilutions of sera from mice which had been immunized either
with mouse IL-1.beta..sub.119-269 coupled to Q.alpha. capsid or
with mouse IL-1.alpha..sub.117-270 coupled to Q.beta. capsid and
100 ng/ml of mouse IL-1.beta..sub.119-269. Binding of
IL-1.beta..sub.119-269 to the immobilized mIL-1receptor1-hFc fusion
protein was detected with a biotinylated anti-mouse IL-1.beta.
antibody and horse radish peroxidase conjugated streptavidin. All
sera from mice immunized against murine IL-1.beta..sub.119-269
inhibited completely the binding of mouse IL-1.beta..sub.119-269 to
its receptor at concentrations of %, whereas sera from mice
immunized against mouse IL-1.alpha..sub.117-270 did not show any
inhibitory effect even at the highest concentration used (3.3%).
These data demonstrate that immunization with mouse
IL-1.beta..sub.119-269 coupled to Q.beta. capsid can yield
antibodies which are able to neutralize the interaction of mouse
IL-1.beta..sub.119-269 and its receptor.
E. In Vivo Neutralization of IL-1.beta.
[0165] The in vivo neutralizing capacity of the antibodies raised
by immunization with Q.beta.-mIL-1.beta..sub.119-269 was
investigated next. Four female balb/c mice were therefore immunized
twice at days 0 and 14 with Q.beta.-mIL-1.beta..sub.119-269 and
four mice were immunized at the same time with Q.beta. capsid
alone. At day 21 all mice were injected intravenously with 1 .mu.g
free IL-1.beta..sub.119-269. As readout of the inflammatory
activity of the injected IL-1.beta..sub.119-269, serum samples were
analysed 3 h after injection for the relative increase in the
concentration of the pro-inflammatory cytokine IL-6.
Q.beta.-immunized mice showed an average increase in the serum IL-6
concentration of 1.01.+-.0.61 ng/ml, whereas mice immunized with
Q.beta.-mIL-1.beta..sub.119-269 showed an average increase of only
0.11.+-.0.30 ng/ml (p=0.04). As a control on day 28 all mice were
injected with 1 .mu.g mIL-1.alpha.. Three hours after injection
mice immunized with Q.beta. carrier alone showed an average
increase in serum IL-6 concentrations of 40.24.+-.8.06 ng/ml, while
mice immunized with Q.beta.-mIL-1.beta..sub.119-269 showed an
increase of 57.98.+-.29.92 ng/ml (p=0.30). These data indicate that
the antibodies produced by immunization with
Q.beta.-mIL-1.beta..sub.119-269 were able to neutralize
specifically and efficiently the pro-inflammatory activity of
IL-1.beta..
F. Efficacy of Q.beta.-mIL-1.beta..sub.119-269 in a Mouse Model of
Rheumatoid Arthritis
[0166] The efficacy of Q.beta.-mIL-1.beta..sub.119-269 immunization
was tested in the murine collagen-induced arthritis model (CIA).
This model reflects most of the immunological and histological
aspects of human rheumatoid arthritis and is therefore routinely
used to assay the efficacy of anti-inflammatory agents. Male DBA/1
mice were immunized subcutaneously three times (days 0, 14 and 28)
with 50 .mu.g of either Q.beta.-mIL-1.beta..sub.119-269 (n=8) or
Q.beta. alone (n=8), and then injected intradermally at day 42 with
200 .mu.g bovine type II collagen mixed with complete Freund's
adjuvant. After a booster injection of 200 .mu.g bovine type II
collagen mixed with incomplete Freund's adjuvant at day 63 mice
were examined on a daily basis for the development of arthritis
symptoms.
[0167] A clinical score ranging from 0 to 3 was assigned to each
limb according to the degree of reddening and swelling observed,
and ankle thickness of all hind limbs was measured. The clinical
score was assigned over 3 consecutive weeks to each limb according
to the following definitions: 0 normal, 1 mild erythema and/or
swelling of digits/paw, 2 erythema and swelling extending over
whole paw/joint, 3 strong swelling, deformation of paw/joint,
stiffness. Cumulative clinical scores of individual mice were
calculated as the sum of clinical scores of all four limbs,
resulting in a possible maximal cumulative score per mouse of
12.
[0168] Two weeks after the second collagen injection
Q.beta.-immunized mice showed an average cumulative clinical score
of 4.44, while Q.beta.-mIL-1.beta..sub.119-269-immunized mice
showed an average score of only 1.06. Moreover, the average
increase in hind ankle thickness was 18% for Q.beta.-immunized mice
and only 1% for mice which had been immunized with
Q.beta.-mIL-1.beta..sub.119-269. As an additional readout of the
inflammatory reaction, serum levels of IL-6 were determined 1 week
after the second collagen injection. Q.beta.-immunized mice had an
average IL-6 serum concentration of 1.92.+-.0.36 while
Q.beta.-mIL-1.beta..sub.119-269-immunized mice had an average IL-6
concentration of only 0.79.+-.0.16 (p=0.01). Taken together, these
data show that immunization with Q.beta.-mIL-1.beta..sub.119-269
strongly protects mice from inflammation and clinical signs of
arthritis in the CIA model.
Example 3
A. Coupling of Mouse IL-1.alpha..sub.117-270 to Q.beta. Virus-like
Particles
[0169] A solution containing 1.8 mg/ml of the purified
IL-1.alpha..sub.117-270 protein from EXAMPLE 1 (SEQ ID NO:65) in
PBS pH 7.2 was incubated for 60 min at room temperature with an
equimolar amount of TCEP for reduction of the C-terminal cysteine
residue.
[0170] A solution of 6 ml of 2 mg/ml Q.beta. capsid protein in PBS
pH 7.2 was then reacted for 60 minutes at room temperature with 131
.mu.l of a SMPH solution (65 mM in DMSO). The reaction solution was
dialyzed at 4.degree. C. against three 3 l changes of 20 mM HEPES,
150 mM NaCl pH 7.2 over 24 hours. Seventy-five .mu.l of the
derivatized and dialyzed Q.beta. solution was mixed with 192 .mu.l
H.sub.2O and 233 .mu.l of the purified and pre-reduced mouse
IL-1.alpha..sub.117-270 protein and incubated over night at
15.degree. C. for chemical crosslinking. Uncoupled protein was
removed by tangential flow filtration against PBS using cellulose
ester membranes with a molecular weight cutoff of 300.000 Da.
[0171] Coupled products were analyzed on a 12% SDS-polyacrylamide
gel under reducing conditions. The Coomassie stained gel is shown
in FIG. 2. Several bands of increased molecular weight with respect
to the Q.beta. capsid monomer are visible, clearly demonstrating
the successful cross-linking of the mouse IL-1.alpha..sub.117-270
protein to the Q.beta. capsid.
B. Immunization of Mice with Mouse IL-1.alpha..sub.117-270 Protein
Coupled to Q.beta. capsid (Q.beta.-mIL-1.alpha..sub.117-270)
[0172] Five female balb/c mice were immunized with
Q.beta.-mIL-1.alpha..sub.117-270. Fifty .mu.g of total protein were
diluted in PBS to 200 .mu.l and injected subcutaneously (100 .mu.l
on two ventral sides) on day 0 and day 21. Mice were bled
retroorbitally on day 0, 21, and 35, and sera were analyzed using
mouse IL-1.alpha..sub.117-270-specific ELISA.
C. ELISA
[0173] ELISA plates were coated with mouse IL-1.alpha..sub.117-270
protein at a concentration of 1.mu.g/ml. The plates were blocked
and then incubated with serially diluted mouse sera from day 0, 21,
and 35. Bound antibodies were detected with enzymatically labeled
anti-mouse IgG antibody. Antibody titers of mouse sera were
calculated as the average of those dilutions which led to half
maximal optical density at 450 nm. The average anti-mouse
IL-1.alpha..sub.117-270 titer was 1:9252 at day 21 and 1:736912 at
day 35. This demonstrates that immunization with Q.beta. coupled to
the mouse IL-1.alpha..sub.117-270 protein could overcome
immunological tolerance and produce high titer antibodies which
recognize specifically IL-1.alpha..sub.117-270
D. In Vitro Neutralization of IL-1.alpha.
[0174] Sera of mice immunized with Q.beta.-mIL-1.alpha..sub.117-270
were then tested for their ability to inhibit the binding of mouse
IL-1.alpha. protein to its receptor. ELISA plates were therefore
coated with a recombinant mIL-1 receptor1-hFc fusion protein at a
concentration of 1 .mu.g/ml, and co-incubated with serial dilutions
of sera from mice which had been immunized either with mouse
IL-1.alpha..sub.117-270 coupled to Q.beta. capsid or with mouse
IL-1.beta..sub.119-269 coupled to Q.beta. capsid and 5 ng/ml of
mouse IL-1.alpha..sub.117-270. Binding of IL-1.alpha..sub.117-270
to the immobilized mIL-1receptor1-hFc fusion protein was detected
with a biotinylated anti-mouse IL-1.alpha. antibody and horse
radish peroxidase conjugated streptavidin. All sera from mice
immunized against murine IL-1.alpha..sub.117-270 inhibited
completely the binding of mouse IL-1.alpha..sub.117-270 to its
receptor at concentrations of .gtoreq.0.4%, whereas sera from mice
immunized against mouse IL-1.beta..sub.119-269 did not show a
significant inhibitory effect even at the highest concentration
used (3.3%). These data demonstrate that immunization with mouse
IL-1.alpha..sub.117-270 coupled to Q.beta. capsid can yield
antibodies which are able to neutralize specifically the
interaction of mouse IL-1.alpha..sub.117-270 and its receptor.
E. In Vivo Neutralization of IL-1.alpha.
[0175] The in vivo neutralizing capacity of the antibodies raised
by immunization with Q.beta.-mIL-1.alpha..sub.117-270 was
investigated next. Four female balb/c mice were therefore immunized
twice at days 0 and 14 with Q.beta.-mIL-1.alpha..sub.117-270 and
four mice were immunized at the same time with Q.beta. capsid
alone. At day 21 all mice were injected intravenously with 1 .mu.g
free IL-1.alpha..sub.117-270. As readout of the inflammatory
activity of the injected IL-1.alpha..sub.117-270, serum samples
were analysed 3 h after injection for the relative increase in the
concentration of the pro-inflammatory cytokine IL-6.
Q.beta.-immunized mice showed an average increase in the serum IL-6
concentration of 8.16.+-.2.33 ng/ml, whereas mice immunized with
Q.beta.-mIL-1.alpha..sub.117-270 showed an average increase of only
0.15.+-.0.27 ng/ml (p=0.0005). As a control on day 28 all mice were
injected with 1 .mu.g mIL-1.beta.. Three hours after injection mice
immunized with Q.beta. carrier alone showed an average increase in
serum IL-6 concentrations of 9.52.+-.7.33 ng/ml, while mice
immunized with Q.beta.-mIL-1.alpha..sub.117-270 showed an increase
of 21.46.+-.27.36 ng/ml (p=0.43). These data indicate that the
antibodies produced by immunization with
Q.beta.-mIL-1.alpha..sub.117-270 were able to neutralize
specifically and efficiently the pro-inflammatory activity of
IL-1.alpha..
F. Efficacy of Q.beta.-mIL-1.alpha..sub.117-270 in a Mouse Model of
Rheumatoid Arthritis
[0176] The efficacy of Q.beta.-mIL-1.alpha..sub.117-270
immunization was tested in the murine collagen-induced arthritis
model (CIA). This model reflects most of the immunological and
histological aspects of human rheumatoid arthritis and is therefore
routinely used to assay the efficacy of anti-inflammatory agents.
Male DBA/1 mice were immunized subcutaneously three times (days 0,
14 and 28) with 50 .mu.g of either Q.beta.-mIL-1.alpha..sub.117-270
(n=8) or Q.beta. alone (n=8), and then injected intradermally at
day 42 with 200 .mu.g bovine type II collagen mixed with complete
Freund's adjuvant. After a booster injection of 200 .mu.g bovine
type II collagen mixed with incomplete Freund's adjuvant at day 63
mice Were examined on a daily basis for the development of
arthritis symptoms. A clinical score as defined in EXAMPLE 2F was
assigned to each limb according to the degree of reddening and
swelling observed, and ankle thickness of all hind limbs was
measured. Two weeks after the second collagen injection
Q.beta.-immunized mice showed an average cumulative clinical score
of 4.44, while Q.beta.-mIL-1.alpha..sub.117-270-immunized mice
showed an average score of only 2.31. Moreover, the average
increase in hind ankle thickness was 18% for Q.beta.-immunized mice
and only 7% for mice which had been immunized with
Q.beta.-mIL-1.alpha..sub.117-270. As an additional readout of the
inflammatory reaction, serum levels of IL-6 were determined 1 week
after the second collagen injection. Q.beta.-immunized mice had an
average IL-6 serum concentration of 1.92.+-.0.36 while
Q.beta.-mIL-1.alpha..sub.117-270-immunized mice had an average IL-6
concentration of only 0.94.+-.0.48. Taken together, these data show
that immunization with Q.beta.-mIL-1.alpha..sub.117-270 protects
mice from inflammation and clinical signs of arthritis in the CIA
model.
Example 4
Efficacy of Q.beta.-mIL-1.alpha..sub.117-270 in a Mouse Model of
Atherosclerosis
[0177] Seven to eight weeks old male Apoe.sup.-/- mice (The Jackson
Laboratory, Bar Harbor Me.) were injected subcutaneously with
either 50 .mu.g Q.beta.-mIL-1.alpha..sub.117-270 vaccine (n=13) or
with 50 .mu.g Q.beta. (n=12) on day 0, 14, 28, 56, 105 and 133 (5
animals, 3 in the Q.beta.-mIL-1.alpha..sub.117-270 and 2 in the
Q.beta. groups were received their second boost on day 33). The
mice were fed initially with a normal chow diet, which was replaced
on day 21 by a western diet (20% fat, 0.15% cholesterol, Provimi
Kliba A G, Switzerland). Mice were bled at regular intervals
throughout the experiment and the antibody response against
IL-1alpha was measured in the sera. Sacrifice was on clay 159, and
the aorta were isolated and prepared essentially as described
(Tangirala R. K. et al. (1995) J. Lipid. Res. 36: 2320-2328). In
addition, hearts were removed and snap-frozen in liquid nitrogen
for subsequent histologic preparation essentially as described by
Paigen B. et al. (Atherosclerosis 1987; 68:231-240) and Zhou X. et
al. (Arterioscler Thromb Vase Bial 2001; 21:108-114). The animals
were bled by cardiac puncture and perfused with cold PBS. The aorta
was then exposed, as much as possible of the adventitia removed in
situ, and the aorta finally sectioned 2 mm from the heart. The
heart was sectioned in the middle, and the upper part was
immediately frozen in Hank's balanced salt solution in a plastic
tube in liquid nitrogen. Serial sections (7 .mu.m thickness) were
cut in a cryostat through the origin of the aorta and harvested
upon appearance of at least two valve cusps, until disappearance of
the last valve cusps. Sections were fixed in formalin, stained with
oil red O, and plaque load was evaluated in 4-7 sections (3
sections in one animal of the Q.beta. group) per mouse by
quantitative image analysis. An average plaque area was computed
for each animal from the plaque area of each section used for the
evaluation. An average group plaque area was computed for the
Q.beta.-mIL-1.alpha..sub.117-270 and Q.beta. group respectively.
Statistical analysis was performed with a Student t-test. P<0.05
was considered statistically significant.
[0178] For the evaluation of atherosclerosis in the whole aorta,
these were further cleaned from residual adventitia on a glass
petri dish filled with cold PBS, and the arch was sectioned 5 mm
down from the left sub-clavian artery. The aorta were cut
longitudinally, pinned out on a black wax surface and fixed
overnight in 4% formalin. They were then stained overnight in oil
red O. The plaques were quantified with an imaging software (Motic
Image Plus 2.0) on digital photographs. The plaque load was
expressed as the sum of the surface of all plaques of the aorta
taken up to the iliac bifurcation, divided by the total surface of
the aorta measured up to the iliac bifurcation, in percentage. The
difference in mean or median of the plaque load between the
Q.beta.-mIL-1.alpha..sub.117-270 and Q.beta. group was
analyzed.
[0179] The antibody response was measured in a classical ELISA,
with recombinant IL-1 alpha coated on the ELISA plate. Binding of
specific antibodies was detected using a goat anti-mouse HRP
conjugate. The titers against IL-1alpha were calculated as the
reciprocal of the serum dilution giving half-maximal binding in the
assay. Specificity of the response was assessed by measuring
pre-immune serum. The pre-immune titer was below the lowest serum
dilution used in the assay, and was assigned this lowest-serum
dilution value. The results of the measurement of the antibody
response in the Q.beta.-mIL-1.alpha..sub.117-270 immunized animals
are shown in Table 1, and clearly demonstrate that immunization
against murine IL-1 alpha coupled to Q.beta. led to a strong and
sustained specific antibody response against IL-1 alpha, since
nearly no titer was detectable in the preimmune (d0) sera.
Furthermore, induction of an antibody response specific for IL-1
alpha led to a reduction of 37% in plaque area at the aortic origin
in the Q.beta.-mIL-1.alpha..sub.117-270 group compared to the
Q.beta. group (292803.+-.21272 .mu.m.sup.2 vs. 464694.+-.36545
.mu.m.sup.2, p=0.0005). In addition, a reduction of 31% in median
plaque load in whole aortas prepared "en face" (5.7 vs. 8.3,
p=0.06) was observed.
[0180] These data demonstrate that induction of anti-IL 1alpha
antibodies by the Q.beta.-mIL-1.alpha..sub.117-270 vaccine
inhibited the development of atherosclerosis and therefore that the
Q.beta.-mIL-1.alpha..sub.117-270 vaccine is an effective treatment
for atherosclerosis. Furthermore, these data demonstrate that IL-1
alpha is involved in the pathogenesis of atherosclerosis.
TABLE-US-00001 TABLE 1 Geometric mean anti-IL1alpha antibody titer
in Apoe.sup.-/- mice immunized with Qb- IL1alpha (geometric mean
titer .+-. standard error of the mean) d0 d21 d28* d56 d84 d105
d159 Geomean .+-. <10000 225400 .+-. 93385 167867 .+-. 121345
522864 .+-. 106887 712061 .+-. 144922 621687 .+-. 184389 805370
.+-. 155764 SEM 0 *For 5 animals, the values are from day 33.
Example 5
Protection from TNBS-induced Inflammatory Bowel Disease by
Immunization with Q.beta.-mIL-1.alpha..sub.117-270 and/or
Q.beta.-mIL-1.beta..sub.119-269
[0181] Eight weeks old male SJL mice (5 per group) are injected
subcutaneously three times at two week intervals with either 50
.mu.g of Q.beta.-mIL-1.alpha..sub.117-270 or 50 .mu.g
Q.beta.-mIL-1.beta..sub.119-269, or a mixture of 50 .mu.g each of
Q.beta.-mIL-1.alpha..sub.117-270 and
Q.beta.-mIL-1.beta..sub.119-269. As a control 5 mice are injected
at the same regimen with Q.beta. VLPs alone. Two weeks after the
last immunization, all mice are slightly anesthetized with
Isoflurane, and 1 mg of trinitrobenesulfonic acid (TNBS) in 100
.mu.l 50% ethanol is administered intrarectally via a polyethylene
catheter at a distance of 4 cm of the anus. Body weight is recorded
daily as readout of disease progression, and 7 days after TNBS
administration all mice are sacrificed. The colon of each mouse is
removed, a specimen of colon located 2 cm proximal to the anus is
fixed in PBS-buffered formalin, and the degree of inflammation is
graded semi-quantitatively on hematoxylin- and eosin-stained
colonic cross-sections according to Neurath M. F. et al. (JEM
(1995), 182:1281-1290).
[0182] Immunization with either Q.beta.-mIL-1.alpha..sub.117-270 or
Q.beta.-mIL-1.beta..sub.119-269 alone, or with a combination of
Q.beta.-mIL-1.alpha..sub.117-270 and
Q.beta.-mIL-1.beta..sub.119-269 reduces the TNBS-induced weight
loss, as compared to Q.beta.-immunized mice. Furthermore,
histological examination of colonic cross-sections reveals, that
Q.beta.-mIL-1.alpha..sub.117-270 and/or
Q.beta.-mIL-1.beta..sub.119-269-immunized mice display a markedly
reduced infiltration of inflammatory cells into the colonic tissue
when compared to Q.beta.-immunized mice.
Example 6
Amelioration of Endotoxin-hypersensitivity in Mice Carrying a
Truncated Version of the MEFV Gene by Immunization with
Q.beta.-mIL-1.beta..sub.119-269
[0183] Familial Mediterranean Fever is a recessively inherited
inflammatory disorder characterized by recurrent fever as well as
peritonitis, serositis, arthritis and skin rashes. Affected
individuals carry a missense mutation in the MEFV gene, leading to
expression of a truncated pyrin protein. Mice carrying a similar
mutation in the MEFV gene show an increased caspase-1 activity,
leading to overproduction of mature IL-1.beta. and increased
hypothermia and lethality after LPS administration. Eight weeks old
homozygote pyrin-truncation mice (5 per group) are immunized three
times at two weeks intervals with 50 .mu.g of
Q.beta.-mIL-1.beta..sub.119-269 or 50 .mu.g of Q.beta. VLPs alone.
Two weeks after the last immunization all mice are injected
intraperitoneally with a mixture 20 mg D-Galactosamine and 0.01
.mu.g/g LPS. Q.beta.-mIL-1.beta..sub.119-269-immunized mice show a
markedly reduced hypothermia and a reduced lethality in response to
LPS administration, when compared to Q.beta.-immunized
controls.
Example 7
Comparison of Q.beta.-mIL-1.alpha..sub.117-279 and
Q.beta..sub.119-269 Immunization to Kineret.RTM. Treatment in a
Mouse Model of Rheumatoid Arthritis
[0184] Kineret.RTM. (Anakinra, Amgen) is a recombinant version of
the human IL-1 receptor antagonist, which is approved for the
treatment of human rheumatoid arthritis. In order to reach a
clinical benefit, relatively high amounts (100 mg) have to be
applied via subcutaneous injection on a daily basis. The
collagen-induced arthritis model was used to compare the efficacy
of .beta.-mIL-1.alpha..sub.117-270 and
Q.beta.-mIL-1.beta..sub.119-269 immunization with daily
applications of different doses of Kineret.RTM.. Male DBA/1 mice
were immunized subcutaneously three times (days 0, 14 and 28) with
50 .mu.g of either .beta.-mIL-1.alpha..sub.117-270 (n=8),
Q.beta.-mIL-1.beta..sub.119-269 (n=8) or Q.beta. alone (n=32), and
then injected intradermally on day 42 with 200 .mu.g bovine type II
collagen mixed with complete Freund's adjuvant. From day 42 on,
mice immunized with Q.beta.-mIL-1.alpha..sub.117-270 and
.beta.-mIL-1.beta..sub.119-269, and one group of Q.beta.-immunized
mice (n=8) received daily intraperitoneal injections of 200 .mu.l
PBS, while three additional Q.beta.-immunized groups received daily
intraperitoneal injections of either 37.5 .mu.g (n=8), 375 .mu.g
(n=8), or 3.75 mg (n=8) Kineret.RTM.. A daily injection of 37.5
.mu.g Kineret.RTM. per mouse corresponds roughly to a dose of 1.5
mg/kg, which is in the range of the recommended efficacious amount
for humans (100 mg). All mice were boosted on day 63 by intradermal
injection of 200 .mu.g bovine type II collagen mixed with
incomplete Freund's adjuvant, and examined on a daily basis for the
development of arthritis symptoms.
[0185] Four weeks after the second collagen injection,
Q.beta.-immunized control mice showed an average cumulative
clinical score (as defined in EXAMPLE 2F) of 3.75, while
Q.beta.-mIL-1.alpha..sub.117-270- and
Q.beta.-mIL-1.beta..sub.119-269-immunized mice showed average
scores of only 0.81 and 1.44, respectively (see Table 2). Mice
treated with 37.5 .mu.g or 375 .mu.g Kineret.RTM. reached an
average score of 2.44 and 2.63, respectively, while mice treated
with 3.75 mg Kineret.RTM. remained largely asymptomatic, reaching a
maximal score of only 0.19.
[0186] As an additional readout of the inflammatory reaction, the
hind ankle thickness of all animals was measured on a regular
basis. Four weeks after the second collagen injection
Q.beta.-immunized control mice showed an average increase in hind
ankle thickness of 16%, while
.beta.-mIL-1.alpha..sub.117-270-immunized mice showed an increase
of 2% and Q.beta.-mIL-1.beta..sub.119-269-immunized mice showed an
increase of 6%. Mice treated with either 37.5 .mu.g or 375 .mu.g
Kineret.RTM. showed an average increase of 13% and 10%,
respectively, while mice treated with 3.75 mg Kineret.RTM. showed
no increase in hind ankle thickness at all.
[0187] In conclusion we surprisingly found that three injections of
either Q.beta.-mIL-1.alpha..sub.117-270 or
Q.beta.-mIL-1.beta..sub.119-269 protected mice better from the
development of arthritis symptoms than daily injections of
Kineret.RTM. in amounts corresponding to the human dose or even the
ten-fold human dose. Only application of the 100-fold human dose of
Kineret.RTM. showed an increased benefit with respect to
Q.beta.-mIL-1.alpha..sub.117-270 or Q.beta.-mIL-1.beta..sub.119-269
vaccination.
TABLE-US-00002 TABLE 2 clinical disease symptoms in
collagen-induced arthritis model. Average increase in average
clinical hind ankle thickness Treatment score day 91 (%) day 63-91
3x Q.beta. s.c. + PBS i.p. (200 .mu.l/day) 3.75 16 3x
Q.beta.-mIL-1.alpha..sub.117-270 s.c. + PBS 0.81 2 i.p. (200
.mu.l/day) 3x Q.beta.-mIL-1.beta..sub.119-269 s.c. + PBS 1.44 6
i.p. (200 .mu.l/day) 3x Q.beta. s.c. + Kineret .RTM. i.p. 2.44 13
(37.5 .mu.g/day) 3x Q.beta. s.c. + Kineret .RTM. i.p. 2.63 10 (375
.mu.g/day) 3x Q.beta. s.c. + Kineret .RTM. i.p. 0.19 0 (3.75
mg/day)
Example 8
A. Cloning, Expression, and Purification of Virus-like Particles
Consisting of AP205 Coat Protein Genetically Fused to Mouse
IL-1.alpha..sub.117-270 (AP205_mIL-1.alpha..sub.117-270)
[0188] Given the large size of interleukin-1 alpha and for steric
reasons, an expression system producing so called mosaic particles,
comprising AP205 coat proteins fused to interleukin-1 alpha as well
as wt coat protein subunits was constructed. In this system,
suppression of the stop codon yields the AP205-interleukin-1 alpha
coat protein fusion, while proper termination yields the wt AP205
coat protein. Both proteins are produced simultaneously in the cell
and assemble into a mosaic virus-like particle. Two intermediary
plasmids, pAP590 and pAP592, encoding the AP205 coat protein gene
terminated by the suppressor codons TAG (amber, pAP590) or TGA
(opal, pAP592) were made. A linker sequence encoding the tripeptide
Gly-Ser-Gly (SEQ ID NO:189) was added downstream and in frame of
the coat protein gene. Kpn2I and HindIII sites were added for
cloning sequences encoding foreign amino acid sequences at the
C-terminus of the Gly-Ser-Gly amino acid linker, C-terminal to the
AP205 coat protein. The resulting constructs were: AP590 (SEQ ID
NO:117): AP205 coat protein gene--amber--codon-GSG(Kpn2I-HincIII);
and AP592 (SEQ ID NO:118): AP205 coat protein gene--opal
codon--GSG(Kpn2I-HindIII). For construction of plasmid pAP590, a
PCR fragment obtained with oligonucleotides pl.44
(5'-NNCCATGGCAAATAAGCCAATGCAACCG-3'; SEQ ID NO:119) and pINC-36
(5'-GTAAGCTTAGATGCATTATCCGGA TCCCTAAGCAGTAGTATCAGACGATACG-3';
SEQ-ID NO:120) was digested with NcoI and HindIII, and cloned into
vector pQb 185, which had been digested with the same restriction
enzymes. pQb185 is a vector derived from pGEM vector. Expression of
the cloned genes in this vector is controlled by the trp promoter
(Kozlovska, T. M. et al., Gene 137:133-37 (1993)). Similarly,
plasmid pAP592 was constructed by cloning a NcoI/HindIII-digested
PCR fragment obtained with oligonucleotides pl.44 and pINC-40
(5'-GTAAGCTTAGATGCATTATCCGGATCCTCAAGCAGTAGTA TCAGACGATACG-3';
SEQ-ID NO:121) into the same vector.
[0189] The sequence encoding amino acids 117-270 of murine
IL-1.alpha. was amplified by PCR from plasmid
pModEC1-His-EK-mIL1.alpha..sub.117-270 (see EXAMPLE 1), using
primers pINC-34 (5'-GGTCCGGAGCGCTAGCCCCTTACAC-3'; SEQ ID NO:122)
and pINC-35 (5'-GTAAGCTTATGCATTATGATATCTGGAAGTCTGTCATAGA-3'; SEQ ID
NO:123), which added Kpn2I and HindIII restriction sites to the 5'
and 3' ends, respectively. The obtained DNA fragment was digested
with Kpn2I and HindIII and cloned into both vector pAP590, creating
plasmid pAP594 (amber suppression), and into vector pAP592,
creating plasmid pAP596 (opal suppression), respectively.
[0190] For expression of mosaic AP205 VLPs displaying murine
IL-1.alpha. on their surface, E. coli JM109 cells containing
plasmid pISM 579 or pISM 3001 were transformed with plasmid pAP594
or pAP596, respectively. Plasmid pISM579 was generated by excising
the trpT176 gene from pISM3001 with restriction endonuclease EcoRI
and replacing it by an EcoRI fragment from plasmid pMY579 (gift of
Michael Yarus) containing an amber t-RNA suppressor gene. This
t-RNA suppressor gene is a mutant of trpT175 (Raftery L A. Et al.
(1984) J. Bacteriol. 158:849-859), and differs from trpT at three
positions: G33, A24 and T35. Five milliliters of LB liquid medium
containing 20 .mu.g/ml ampicillin and 10 .mu.g/ml kanamycin were
inoculated with a single colony, and incubated at 37.degree. C. for
16-24 h without shaking. The prepared inoculum was diluted
50.times. with M9 medium containing 20 .mu.g/ml ampicillin and 10
.mu.g/ml Kanamycin and incubated at 37.degree. C. overnight on a
shaker. Cells were harvested by centrifugation.
[0191] Cells (1 g, transformed with plasmid pAP594 and containing
pISM579) were lysed by ultrasonication in lysis buffer (20 mM
Tris-HCl, 5 mM EDTA, 150 mM NaCl, pH 7.8, 0.1% Tween 20). The
lysate was cleared by centrifugation, and the cell debris were
washed with lysis buffer. Pooled supernatant were loaded on a
Sepharose CL-4B column eluted in TEN buffer (20 mM Tris-HCl, 5 mM
EDTA, 150 mM NaCl, pH 7.8). The presence of capsids in the cleared
lysate and wash supernatant was confirmed by agarose gel
electrophoresis (1% TAE, ethidium bromide stained gel and UV
detection). Two peaks eluted from the column as determined by
SDS-PAGE or UV-spectrometric analysis of light scattering at 310
nm. Fractions of the second peak, containing the capsids, were
pooled and loaded on a Sepharose CL-6B column. Peak fractions from
the CL-6B column were pooled and concentrated using a centrifugal
filter unit (Amicon Ultra 15 MWCO 30000, Millipore). The protein
was purified further by one additional round of gel filtration on a
CL-4B column, and the resulting peak fractions were pooled and
concentrated on a centrifugal filter unit as above. The buffer was
exchanged to 10 mM Hepes, pH 7.5, and glycerol was added to a final
concentration of 50%.
[0192] Purification of AP205_mIL-1.alpha..sub.117-270 from plasmid
pAP596 was performed essentially as described for pAP594 above,
with the inclusion of an additional sucrose gradient purification
step after the last CL-4B column. The protein was layered on a
gradient prepared with the following sucrose solutions: 9 ml
36.degree. A), 3 ml 30%, 6 ml 25%, 8 ml 20.degree. A, 6 ml 15%, 6
ml 10% and 3 ml 5% sucrose. Fractions were identified by UV
spectroscopy, and pooled fractions containing the capsids were
concentrated on a centrifugal filter unit as above, and the buffer
exchanged to 10 mM Hepes, pH 7.5. Glycerol was finally added to a
final concentration of 50%.
B. Immunization of Mice with AP205_mIL-1.alpha..sub.117-270
[0193] Four female balb/c mice were immunized with
AP205_-mIL-1.alpha..sub.117-270. Twentyfive .mu.g of total protein
were diluted in PBS to 200 .mu.l and injected subcutaneously (100
.mu.l on two ventral sides) on day 0, day 14, and day 28. Mice were
bled retroorbitally on days 0, 14, 28 and 35, and sera were
analyzed using mouse IL-1.alpha..sub.117-270-specific ELISA.
C. ELISA
[0194] ELISA plates were coated with mouse IL-1.alpha..sub.117-270
protein at a concentration of 1 .mu.g/ml. The plates were blocked
and then incubated with serially diluted mouse sera from days 14,
28 and 35. Bound antibodies were detected with enzymatically
labeled anti-mouse IgG antibody. Antibody titers of mouse sera were
calculated as the average of those dilutions which led to half
maximal optical density at 450 nm. The average anti-mouse
IL-1.alpha..sub.117-270 titer was 1:4412 at day 14, 1:27955 on day
28 and 1:34824 on day 35. This demonstrates that immunization with
AP205_mIL-1.alpha..sub.117-270 could overcome immunological
tolerance and produce high titer antibodies which recognize
specifically IL-1.alpha..sub.117-270.
D. In Vitro Neutralization of IL-1.alpha.
[0195] Sera of mice immunized with AP205_mIL-1.alpha..sub.117-270
were tested for their ability to inhibit the binding of mouse
IL-1.alpha. protein to its receptor. ELISA plates were therefore
coated with a recombinant mIL-1 receptor1-hFc fusion protein at a
concentration of 1 .mu.g/ml, and co-incubated with serial dilutions
of sera from mice which had been immunized either with
AP205_mIL-1.alpha..sub.117-270 or with AP205 alone and 100 ng/ml of
mouse IL-1.alpha..sub.117-270. Binding of mIL-1.alpha..sub.117-270
to the immobilized mIL-1 receptor1-hFc fusion protein was detected
with a biotinylated anti-mouse IL-1.alpha. antibody and horse
radish peroxidase conjugated streptavidin. All sera from mice
immunized AP205_mIL-1.alpha..sub.117-270 inhibited completely the
binding of mouse IL-1.alpha..sub.117-270 to its receptor at
concentrations of .gtoreq.3.3%, whereas sera from mice immunized
with AP205 did not show a significant inhibitory effect at any
concentration used. These data demonstrate that immunization with
AP205_mIL-1.alpha..sub.117-270 can yield antibodies which are able
to neutralize specifically the interaction of mouse
IL-1.alpha..sub.117-270 with its receptor.
E. In Vivo Neutralization of IL-1.alpha.
[0196] The in vivo neutralizing capacity of the antibodies raised
by immunization with AP205_mIL-1.alpha..sub.117-270 was
investigated next. Four female balb/c mice were therefore immunized
three times on days 0, 14, and 28 with
AP205_mIL-1.alpha..sub.117-270 and four mice were immunized at the
same time with AP205 alone. On day 42 all mice were injected
intravenously with 1 .mu.g of free murine IL-1.alpha..sub.117-270.
As readout of the inflammatory activity of the injected
IL-1.alpha..sub.117-270, serum samples were withdrawn before and 3
h after injection and analyzed for the relative increase in the
concentration of the pro-inflammatory cytokine IL-6.
AP205-immunized mice showed an average increase in the serum IL-6
concentration of 12.92.+-.3.95 ng/ml, whereas mice immunized with
AP205_mIL-1.alpha..sub.117-270 showed an average increase of only
0.06.+-.0.05 ng/ml (p<0.01). These data indicate that the
antibodies produced by immunization with
AP205_mIL-1.alpha..sub.117-270 were able to neutralize specifically
and efficiently the pro-inflammatory activity of IL-1.alpha..
F. Efficacy of AP205_mIL-1.alpha..sub.117-270 in a Mouse Model of
Rheumatoid Arthritis
[0197] The efficacy of AP205_mIL-1.alpha..sub.117-270-immunization
was tested in the murine collagen-induced arthritis model (CIA).
Male DBA/1 mice were immunized subcutaneously three times (days 0,
14 and 28) with 50 .mu.g of either AP205_mIL-1.alpha..sub.117-270
(n=8) or AP205 alone (n=8), and then injected intradermally on day
42 with 200 .mu.g bovine type II collagen mixed with complete
Freund's adjuvant. After a booster injection of 200 .mu.g bovine
type II collagen mixed with incomplete Freund's adjuvant on day 63,
mice were examined on a daily basis for the development of
arthritis symptoms. A clinical score ranging from 0 to 3 was
assigned to each limb according to the degree of reddening and
swelling observed, and ankle thickness of all hind limbs was
measured. Four weeks after the second collagen injection
Q13-immunized mice showed an average cumulative clinical score of
5.81, while AP205_mIL-1.alpha..sub.117-270-immunized mice showed an
average score of only 2.06. Moreover, the average increase in hind
ankle thickness was 19% for AP205-immunized mice and only 9% for
mice which had been immunized with AP205_mIL-1.alpha..sub.117-270.
Taken together, these data show that immunization with
AP205_mIL-1.alpha..sub.117-270 strongly protects mice from
inflammation and clinical signs of arthritis in the CIA model.
Example 9
A. Cloning and Expression of Virus-Like Particles Consisting of
AP205 Coat Protein Genetically Fused to Mouse
IL-1.beta..sub.119-269 (AP205_mIL-1.beta..sub.119-269)
[0198] Cloning, expression and purification of virus-like particles
consisting of AP205 coat protein genetically fused to mouse
IL-1.beta..sub.119-269 is carried out essentially as described for
AP205_mIL-1.alpha..sub.117-270 in EXAMPLE 8. The sequence of murine
interleukin 1 beta was amplified from plasmid
pModEC1-His-EK-mIL1.beta..sub.119-269 coding for murine interleukin
1 beta using primers pINC-75
(5'-GATCCGGAGGTGGTGTCCCCATTAGACAGCT-3', SEQ ID NO:192) and pINC-77
(5'-GTAAGCTTAGGAAGACACAGATTCCAT-3', SEQ ID NO:193). These primers
amplify a murine interleukin-1 beta gene with 5' Kpn2I and 3' Hind
III sites, and encoding additionally the amino acid sequence
Gly-Gly at the N-terminus of murine interleukin 1 beta. The
obtained mur-IL-1.beta. fragment was digested with Kpn2I and
HindIII and cloned in the same restriction sites into vector pAP590
(amber suppression) creating plasmid pAP630. E. coli. JM109
containing plasmid pISM 579, providing amber suppression, was
transformed with plasmid pAP630.5 ml of LB liquid medium with 20
.mu.g/ml ampicillin and 10 .mu.g/ml kanamycin were inoculated with
a single colony, and incubated at 37.degree. C. for 16-24 h without
shaking. The prepared inoculum was diluted 50.times. with M9 medium
containing 20 .mu.g/ml ampicillin and 10 .mu.g/ml kanamycin and
incubated at 37.degree. C. overnight on a shaker. Cells were
harvested by centrifugation.
B. Cloning and Expression of Virus-like Particles Consisting of
AP205 Coat Protein Genetically Fused to Human
IL-1.beta..sub.116-269 (AP205_hIL-1.beta..sub.116-269)
[0199] The sequence of human interleukin 1 beta was amplified from
plasmid pET42T-hIL-1.beta..sub.116-269 coding for human interleukin
1 beta using primers pINC-74 (5'-GA TCC GGA GGT GGT GCC CCT GTA CGA
TCA CTG AAC TG-3', SEQ ID NO:194) and pINC-76
(5'-GTATGCATTAGGAAGACACAAATTGCATGGTGAAGTC-3, SEQ ID NO:195),
introducing a 5' Kpn2 I and 3' Mph1103I site, respectively. The
obtained human-IL-1.beta. fragment was digested with Kpn2I and
Mph1103I and cloned in the same restriction sites into vector
pAP590 (amber suppression) creating plasmid pAP649. E. coli JM109
containing plasmid pISM 579 (providing amber suppression), was
transformed with plasmid pAP649.5 ml of LB liquid medium with 20
.mu.g/ml ampicillin and 10 .mu.g/ml canamicin were inoculated with
a single colony, and incubated at 37.degree. C. for 16-24 h without
shaking. The prepared inoculum was diluted 50.times. with M9 medium
containing 20 .mu.g/ml ampicillin and 10 .mu.g/ml kanamycin and
incubated at 37.degree. C. overnight on a shaker. Cells were
harvested by centrifugation.
C. Immunization of Mice with AP205_mIL-1.beta..sub.119-269
[0200] Four female balb/c mice are immunized with
AP205_mIL-1.beta..sub.119-269. Twentyfive .mu.g of total protein
are diluted in PBS to 200 .mu.l and injected subcutaneously (100
.mu.l on two ventral sides) on day 0, day 14, and day 28. Mice are
bled retroorbitally on days 0, 14, 28 and 35, and sera are analyzed
using mouse mIL-1.beta..sub.119-269-specific ELISA.
D. ELISA
[0201] ELISA plates are coated with mouse IL-1.beta..sub.119-269
protein at a concentration of 1 .mu.g/ml. The plates are blocked
and then incubated with serially diluted mouse sera from days 0,
14, 28, and 35. Bound antibodies are detected with enzymatically
labeled anti-mouse IgG antibody. Antibody titers of mouse sera are
calculated as the average of those dilutions which lead to half
maximal optical density at 450 nm. Immunization with
AP205_mIL-1.beta..sub.119-269 yields a high specific anti-mouse
IL-1.beta..sub.119-269 titer. This demonstrates that immunization
with AP205_mIL-1.beta..sub.119-269 can overcome immunological
tolerance and produce high titer antibodies which recognize
specifically IL-1.beta..sub.119-269.
E. In vitro Neutralization of IL-1.beta.
[0202] Sera of mice immunized with AP205_mIL-1.beta..sub.119-269
are then tested for their ability to inhibit the binding of mouse
IL-1.beta. protein to its receptor. ELISA plates are therefore
coated with a recombinant mIL-1receptor1-hFc fusion protein at a
concentration of 1 .mu.g/ml, and co-incubated with serial dilutions
of sera from mice immunized either with
AP205_mIL-1.beta..sub.119-269 or with AP205 alone, and 100 ng/ml of
mouse IL-1.beta..sub.119-269. Binding of IL-1.beta..sub.119-269 to
the immobilized mIL-1 receptor1-hFc fusion protein is detected with
a biotinylated anti-mouse IL-1.beta. antibody and horse radish
peroxidase conjugated streptavidin. All sera from mice immunized
with AP205_mIL-1.beta..sub.119-269 strongly inhibit the binding of
mouse IL-1.beta..sub.119-269 to its receptor, whereas sera from
mice immunized with AP205 alone do not show any inhibitory effect.
These data demonstrate that immunization with
AP205_mIL-1.beta..sub.119-269 can yield antibodies which are able
to neutralize the interaction of mouse IL-1.beta..sub.119-269 and
its receptor.
F. In Vivo Neutralization of IL-1.beta.
[0203] The in vivo neutralizing capacity of the antibodies raised
by immunization with AP205_mIL-1.beta..sub.119-269 is investigated
next. Four female balb/c mice are therefore immunized three times
on days 0, 14, and 28 with AP205_mIL-1.beta..sub.119-269 and four
mice are immunized at the same time with AP205 alone. On day 35 all
mice are injected intravenously with 1 .mu.g of free
mIL-1.beta..sub.119-269. As readout of the inflammatory activity of
the injected mIL-1.beta..sub.119-269, serum samples are withdrawn
before and 3 h after injection and analysed for the relative
increase in the concentration of the pro-inflammatory cytokine
IL-6. AP205-immunized mice show a strong increase in serum IL-6
concentrations, whereas mice immunized with
AP205_mIL-1.beta..sub.119-269 show only a very mild increase. These
data indicate that the antibodies produced by immunization with
AP205_mIL-1.beta..sub.119-269 are able to neutralize specifically
and efficiently the pro-inflammatory activity of IL-1.beta..
G. Efficacy of AP205_mIL-1.beta..sub.119-269 in a Mouse Model of
Rheumatoid Arthritis
[0204] The efficacy of AP205_mIL-1.beta..sub.119-269-immunization
is tested in the murine collagen-induced arthritis model (CIA).
Male DBA/1 mice are immunized subcutaneously three times (days 0,
14 and 28) with 50 .mu.g of either AP205_mIL-1.beta..sub.119-269
(n=8) or AP205 alone (n=8), and then injected intradermally on day
42 with 200 .mu.g bovine type II collagen mixed with complete
Freund's adjuvant. After a booster injection of 200 .mu.g bovine
type II collagen mixed with incomplete Freund's adjuvant on day 63
mice are examined on a daily basis for the development of arthritis
symptoms. A clinical score ranging from 0 to 3 is assigned to each
limb according to the degree of reddening and swelling observed,
and ankle thickness of all hind limbs is measured. Four weeks after
the second collagen injection
AP205_mIL-1.beta..sub.119-269-immunized mice show a strongly
reduced average clinical score when compared to AP205-immunized
mice. Moreover, AP205_mIL-1.beta..sub.119-269-immunized mice
display only a minor increase in hind ankle thickness, while
AP205-immunized mice show a strong increase in hind ankle
thickness. Taken together, these data show that immunization with
AP205_mIL-1.beta..sub.119-269 strongly protects mice from
inflammation and clinical signs of arthritis in the CIA model.
Example 10
A Cloning, Expression and Purification of human
IL-1.beta..sub.116-269
[0205] The nucleotide sequence encoding amino acids 116-269 of
human IL-1.beta. (hIL-1.beta..sub.116-269) was amplified by PCR
from a cDNA library of human liver tissue using oligonucleotides
HIL-1 (5'-ATATATGATATCCCTGTACGATCACTGAACTGCACG-3'; SEQ ID NO:124)
and HIL-2 (5'-ATATATCTCGAGGGAAGACA CAAATTGCATGGTGAAG-3'; SEQ ID
NO:125), digested with XhoI and EcoRV and cloned into the
expression vector pET42T(+).
[0206] Plasmid pET-42T(+) was constructed by replacing the whole
region between the T7 promoter and the T7 terminator of pET-42a(+)
(Novagen) in two steps by new linker sequences, which facilitate
the expression of a protein of interest as a fusion with a
C-terminal tag (SEQ ID NO:190) comprising a His-tag and a cysteine
containing linker. In a first step plasmid pET-42a(+) was digested
with the restriction enzymes NdeI and AvrII, liberating a 958 bp
fragment between the T7 promoter and T7 terminator composed of a
GST-tag, S-tag, two His-tags and the multiple cloning site. The
residual 4972 bp fragment containing the vector backbone of
pET-42a(+) was isolated and ligated to the annealed complementary
oligonucleotides 42-1 (5'-TATGGATATCGAATTCAAGCTICTGCAGCTGCTCGAGTAA
TTGATTAC-3'; SEQ ID NO:126) and 42-2 (5'-CTAGGTAATC AATTACTCGA
GCAGCTGCAGAAGCTTGAATTCGATATCCA-3'; SEQ-ID NO:127), giving rise to
plasmid pET-42S(+). In the second step plasmid pET-42S(+) was
linearized by digestion with restriction enzymes XhoI and AvrII,
and ligated to the complementary annealed oligonucleotides 42T-l
(5'-TCGAGCACCACCACCACCACCACGGIGGTT GCTAATAATAATTGATTAATAC-3'; SEQ
ID NO:128) and 42T-2
(5'-CTAGGTATTAATCAATTATTATTAGCAACCACCGTGGTGGTGGIGGTGGTGC-3'; SEQ ID
NO:129), resulting in plasmid pET-42T(+).
[0207] The cloning of the above mentioned fragment
hIL-1.beta..sub.116-269 into pET-42T(+) gave rise to plasmid
pET42T-hIL-1.beta..sub.116-269. This plasmid encodes a fusion
protein corresponding to the mature human IL-1.beta. and a His-tag
and a C-terminal cysteine-containing linker (GGC, SEQ ID NO:178).
Thus, the fusion protein consists of SEQ ID NO:190 C-terminally
fused to SEQ ID NO:165. The original alanine residue at position
117 of human IL-1.beta. was changed to isoleucine in this fusion
protein. Expression and purification of the human
IL-1.beta..sub.116-269 protein was performed essentially as
described for the murine mIL1.beta..sub.119-269 protein in EXAMPLE
1.
B Cloning, Expression and Purification of Human
IL-1.beta..sub.116-269 Muteins
[0208] By site directed mutagenesis of the plasmid
pET42T-hIL-1.beta..sub.116-269, expression vectors for ten
different mutant human IL-1.beta..sub.116-269 fusion proteins were
constructed. To this aim the Quik-Change.RTM. Site directed
mutagenesis kit (Stratagene) was used according to the
manufacturer's instructions. The expression vectors for these
mutant IL-1.beta..sub.119-269 proteins are listed in Table 3
together with the oligonucleotide pairs used for their
construction. Expression and purification of the different human
IL-1.beta..sub.116-269 muteins was performed as described in
EXAMPLE 1.
TABLE-US-00003 TABLE 3 Overview over IL-1 muteins, expression
vectors and oligonucleotides used for their construction. mutein
sequence (without Expression vector purification tag)
Oligonucleotide pair pET42T-hIL-1.beta..sub.116-269
hIL-1.beta..sub.116-269(R4D) R4D-1 (5'-CATATGGATA TCCCTGTAGA (R4D)
(SEQ-ID NO: 131) CTCACTGAAC TGCACGCTC-3'; SEQ-ID NO: 143); R4D-2
(5'-GAGCGTGCAG TTCAGTGAGT CTACAGGGAT ATCCATATG-3'; SEQ-ID NO: 144)
pET42T-hIL-1.beta..sub.116-269 hIL-1.beta..sub.116-269(L6A) L6A-1
(5'-GATATCCCTG TACGATCAGC (L6A) (SEQ-ID NO: 132) TAACTGCACG
CTCCGGGAC-3'; SEQ-ID NO: 145); L6A-2 (5'-GTCCCGGAGC GTGCAGTTAG
CTGATCGTAC AGGGATATC-3'; SEQ-ID NO: 146)
pET42T-hIL-1.beta..sub.116-269 hIL-1.beta..sub.116-269(T9G) T9G-1
(5'-GTACGATCAC TGAACTGCGG (T9G) (SEQ-ID NO: 133) TCTCCGGGAC
TCACAGC-3'; SEQ-ID NO: 147) T9G-2 (5'-GCTGTGAGTC CCGGAGACCG
CAGTTCAGTG ATCGTAC-3'; SEQ-ID NO: 148)
pET42T-hIL-1.beta..sub.116-269 hIL-1.beta..sub.116-269(R11G) R11G-1
(5'-GAACTGCACG CTCGGGGACT CACAGC-3'; (R11G) (SEQ-ID NO: 134) SEQ-ID
NO: 149) R11G-2 (5'-GCTGTGAGTC CCCGAGCGTG CAGTTC-3'; SEQ-ID NO:
150) pET42T-hIL-1.beta..sub.116-269 hIL-1.beta..sub.116-269(D54R)
D54R-1 (5'- (D54R) (SEQ-ID NO: 135)
CAAGGAGAAGAAAGTAATCGCAAAATACCTGTGGC CTTG-3'; SEQ-ID NO: 151 D54R-2
(5'- CAAGGCCACAGGTATTTTGCGATTACTTTCTTCTCCT TG-3'; SEQ-ID NO: 152)
pET42T-hIL-1.beta..sub.116-269 hIL-1.beta..sub.116-269(D145K)
D145K-1 (5'- (D145K) (SEQ-ID NO: 136)
GCGGCCAGGATATAACTAAATTCACCATGCAATTTG TGTC-3'; SEQ-ID NO: 161)
D145K-2 (5'- GACACAAATTGCATGGTGAATTTAGTTATATCCTGG CCGC-3'; SEQ-ID
NO: 162) pET42T-hIL-1.beta..sub.116-269 hIL-1.beta..sub.116-269
EE-1 (5'- (.DELTA.EE.sup.50,51) (.DELTA.EE.sup.50,51)
CATGTCCTTTGTACAAGGAAGTAATGACAAAATACC (SEQ-ID NO: 137) TGTG-3';
SEQ-ID NO: 153) EE-2 (5'- CACAGGTATTTTGTCATTACTTCCTTGTACAAAGGAC
ATG-3'; SEQ-ID NO: 154) PET42T-hIL-1.beta..sub.116-269
h1L-1.beta..sub.116-269 SND-1 (5'- (.DELTA.SND.sup.52-54)
(.DELTA.SND.sup.52-54) CTTTGTACAAGGAGAAGAAAAAATACCTGTGGCCTT (SEQ-ID
NO: 138) G-3'; SEQ-ID NO: 155) SND-2 (5'-
CAAGGCCACAGGTATTTTTTCTTCTCCTTGTACAAAG- 3'; SEQ-ID NO: 156)
pET42T-hIL-1.beta..sub.116-269 hIL-1.beta..sub.116-269 K6365S-1
(5'- (K63S/K65S) (K63S/K65S) GTGGCCTTGGGCCTCAGCGAAAGCAATCTGTACCTG
(SEQ-ID NO: 139) TCCTG-3'; SEQ-ID NO: 157) K6365S-2 (5'-
CAGGACAGGTACAGATTGCTTTCGCTGAGGCCCAAG GCCAC-3'; SEQ-ID NO: 158)
pET42T-hIL-1.beta..sub.116-269 hIL-1.beta..sub.116-269 QE-1 (5'-
(Q126A/E128A) (Q126A/E128A) GTACATCAGCACCTCTGCAGCAGCAAACATGCCCGT
(SEQ-ID NO: 140) CTTC-3'; SEQ-ID NO: 159) QE-2 (5'-
GAAGACGGGCATGTTTGCTGCTGCAGAGGTGCTGAT GTAC-3'; SEQ-ID NO: 160)
Example 11
Biological Activity of Human IL-1.beta..sub.116-269 and Human
IL-1.beta..sub.116-269 Muteins
[0209] Three female C3H/HeJ mice per group are injected
intravenously with 10 .mu.g of either the wild type human
IL-1.beta..sub.119-269 protein or one of the human
IL-1.beta..sub.119-269 protein muteins of EXAMPLE 10. Serum samples
are withdrawn before and 3 h after injection and analysed for the
relative increase in the concentration of the pro-inflammatory
cytokine IL-6. Mice injected with the wild type human
IL-1.beta..sub.119-269 protein show a strong increase in serum IL-6
concentrations, whereas mice injected with either of the human
IL-1.beta..sub.119-269 mutein proteins show only a mild increase or
no increase at all.
Example 12
A. Coupling of Human IL-1.beta..sub.116-269 and Human
IL-1.beta..sub.116-269 Muteins to Q.beta. Virus-Like Particles
[0210] Chemical cross-linking of the wild type human
IL-1.beta..sub.119-269 protein and the human IL-1.beta..sub.119-269
muteins of EXAMPLE 10 to Q.beta. virus-like particles was performed
essentially as described in EXAMPLE 2A.
B. Immunization of mice with human IL-1.beta..sub.116-269 and human
IL-1.beta..sub.116-269 muteins coupled to Q.beta. capsid
[0211] Four female balb/c mice per group were immunized with
Q.beta. coupled to either the wild type hIL-1.beta..sub.116-269
protein or one of the hIL-1.beta..sub.116-269 mutein proteins.
Fifty .mu.g of total protein were diluted in PBS to 200 .mu.l and
injected subcutaneously (100 .mu.l on two ventral sides) on day 0,
14 and 28. Mice were bled retroorbitally on day 35, and sera were
analyzed using ELISAs specific for either for the respective human
IL-1.beta..sub.116-269 mutein used as immunogen, or the wild type
human IL-1.beta..sub.116-269 protein.
C ELISA
[0212] ELISA plates were coated either with the wild type
hIL-1.beta..sub.116-269 protein or the respective
hIL-1.beta..sub.116-269 mutein at a concentration of 1 .mu.g/ml.
The plates were blocked and then incubated with serially diluted
mouse sera from day 35. Bound antibodies were detected with
enzymatically labeled anti-mouse IgG antibody. Antibody titers of
mouse sera were calculated as the average of those dilutions which
led to half maximal optical density at 450 nm, and are shown in
Table 4.
TABLE-US-00004 TABLE 4 Anti- hIL-1.beta..sub.116-269 (wild type and
mutein)-specific IgG titers raised by immunization with
Q.beta.-hIL-1.beta..sub.116-269 or Q.beta.-hIL-1.beta..sub.116-269
mutein vaccines. Average anti- Average anti-
hIL-1.beta..sub.116-269 hIL-1.beta..sub.116-269 wild type IgG
mutein IgG Vaccine titer (.+-.SD) titer (.+-.SD)
Q.beta.-hIL-1.beta..sub.116-269 253325 .+-. 184813 --/--
Q.beta.-hIL-1.beta..sub.116-269 (R4D) 231879 .+-. 115475 160666
.+-. 79478 Q.beta.-hIL-1.beta..sub.116-269 (L6A) 120224 .+-. 7658
89377 .+-. 17965 Q.beta.-hIL-1.beta..sub.116-269 (T9G) 261249 .+-.
153716 224809 .+-. 131823 Q.beta.-hIL-1.beta..sub.116-269 (R11G)
278342 .+-. 50296 279290 .+-. 47232 Q.beta.-hIL-1.beta..sub.116-269
(D54R) 269807 .+-. 122351 206516 .+-. 90998
Q.beta.-hIL-1.beta..sub.116-269 (D145K) 78365 .+-. 26983 93241 .+-.
28856 Q.beta.-hIL-1.beta..sub.116-269 (.DELTA.EE.sup.50.51) 287625
.+-. 143835 229862 .+-. 140169 Q.beta.-hIL-1.beta..sub.116-269
(.DELTA.SND.sup.52-54) 68895 .+-. 14267 106116 .+-. 25295
Q.beta.-hIL-1.beta..sub.116-269 (K63S/K65S) 403712 .+-. 402594
244552 .+-. 173597 Q.beta.-hIL-1.beta..sub.116-269 (Q126A/ 195165
.+-. 71436 170434 .+-. 86831 E128A)
[0213] Q.beta.-hIL-1.beta..sub.116-269-immunization induced high
titers of IgG antibodies against hIL-1.beta..sub.116-269. Moreover,
vaccination with either of the Q.beta.-hIL-1.beta..sub.116-269
mutein vaccines induced high IgG titers against both the respective
hIL-1.beta..sub.116-269 mutein used as immunogen, and the wild type
hIL-1.beta..sub.116-269 protein.
D. In Vitro Neutralization of Human IL-1.beta.
[0214] Sera of mice immunized with Q.beta. coupled to either wild
type hIL-1.beta..sub.116-269 protein or to one of the
hIL-1.beta..sub.116-269 muteins were tested for their ability to
inhibit the binding of human IL-1.beta. protein to its receptor.
ELISA plates were therefore coated with a recombinant human IL-1
receptor1-hFc fusion protein at a concentration of 1 .mu.g/ml, and
co-incubated with serial dilutions of the above mentioned sera and
100 ng/ml of hIL-1.beta..sub.116-269 protein. Binding of
hIL-1.beta..sub.116-269 to the immobilized human IL-1receptor1-hFc
fusion protein was detected with a biotinylated anti-human
IL-1.beta. antibody and horse radish peroxidase conjugated
streptavidin. All sera raised against
Q.beta.-hIL-1.beta..sub.116-269 mutein vaccines completely
inhibited the binding of 100 ng/ml wild type
hIL-1.beta..sub.116-269 to hIL-1RI at serum concentrations
.gtoreq.3.3%.
E. In Vivo Neutralization of IL-1.beta.
[0215] The in vivo neutralizing capacity of the antibodies raised
by immunization with Q.beta. coupled to either wild type
hIL-1.beta..sub.116-269 protein or to one of the
hIL-1.beta..sub.116-269 muteins is investigated. Three female
C3H/HeJ mice per group are therefore immunized three times on days
0, 14, and 28 with 50 .mu.g of either vaccine. On day 35 all
immunized mice are injected intravenously with 1 .mu.g of free wild
type hIL-1.beta..sub.116-269. As a control three naive mice are
injected at the same time with the same amount of wild type
hIL-1.beta..sub.116-269. As readout of the inflammatory activity of
the injected hIL-1.beta..sub.116-269, serum samples are withdrawn
immediately before and 3 h after injection and analysed for the
relative increase in the concentration of the pro-inflammatory
cytokine IL-6. Whereas naive mice show a strong increase in serum
IL-6 concentrations 3 h after injection of hIL-1.beta..sub.116-269,
all mice immunized with Q.beta. coupled to the wild type
hIL-1.beta..sub.116-269 protein or to one of the
hIL-1.beta..sub.116-269 muteins do not show any increase in serum
IL-6, indicating that the injected hIL-1.beta..sub.116-269 is
efficiently neutralized by the antibodies induced by the
vaccines.
Example 13
Amelioration of MSU-induced Inflammation by Immunization with
Q.beta.-mIL-1.beta..sub.119-269
[0216] Gout is a painful inflammatory disorder caused by the
precipitation of monosodium urate (MSU) crystals in joints and
periarticular tissues. MSU crystals have been shown to activate the
so called NALP3 inflammasome, resulting in the production of active
IL-1.beta., which is mainly responsible for initiating and
promoting the inflammatory response characteristic of the disease.
C57BL/6 mice (5 per group) are immunized subcutaneously three times
at two weeks intervals with 50 .mu.g
Q.beta.-mIL-1.beta..sub.119-269 or 50 .mu.g of Q.beta. VLPs alone.
One week after the last immunization all mice are challenged
intraperitoneally with 1.5 mg MSU crystals. Six hours after the
challenge mice are sacrificed and neutrophil numbers as well as the
concentrations of the neutrophil chemoattractants KC and MIP-2 are
measured in peritoneal exudates.
Q.beta.-mIL-1.beta..sub.119-269-immunized mice show markedly
reduced neutrophilia and MIP-2 and KC concentrations, when compared
to Q.beta.-immunized controls.
Example 14
Amelioration of Experimental Autoimmune Encephalitis by
Immunization with Q.beta.-mIL1.beta..sub.119-269
[0217] In a mouse model for multiple sclerosis, C57BL/6 mice (8 per
group) are immunized subcutaneously three times at two week
intervals with 50 .mu.g Q.beta.-mIL-1.beta..sub.116-269 or 50 .mu.g
of Q.beta. VLPs alone. One week after the last immunization all
mice are injected subcutaneously with 100 .mu.g MOG peptide
(MEVGWYRSPFSRVVHLYRNGK, SEQ ID NO:191) mixed with complete Freund's
adjuvant. On the same day and two days later all mice are injected
intraperitoneally with 400 ng of pertussis toxin. Mice are scored
on a daily basis for development of neurological symptoms according
to the following scheme: 0, no clinical disease; 0.5, end of tail
limp; 1, tail completely limp; 1.5, limp tail and hind limb
weakness (unsteady gait and poor grip of hind legs); 2, unilateral
partial hind limb paralysis; 2.5, bilateral partial hind limb
paralysis; 3, complete bilateral hind limb paralysis; 3.5, complete
bilateral hind limb paralysis and unilateral front limb paralysis;
4, total paralysis of hind and front limbs.
Q.beta.-mIL-1.beta..sub.119-269-immunized mice show clearly reduced
clinical symptoms when compared to Q.beta.-immunized mice.
Sequence CWU 1
1
1951185PRTHepatitis B virus 1Met Asp Ile Asp Pro Tyr Lys Glu Phe
Gly Ala Thr Val Glu Leu Leu1 5 10 15Ser Phe Leu Pro Ser Asp Phe Phe
Pro Ser Val Arg Asp Leu Leu Asp 20 25 30Thr Ala Ser Ala Leu Tyr Arg
Glu Ala Leu Glu Ser Pro Glu His Cys 35 40 45Ser Pro His His Thr Ala
Leu Arg Gln Ala Ile Leu Cys Trp Gly Glu 50 55 60Leu Met Thr Leu Ala
Thr Trp Val Gly Asn Asn Leu Glu Asp Pro Ala65 70 75 80Ser Arg Asp
Leu Val Val Asn Tyr Val Asn Thr Asn Met Gly Leu Lys 85 90 95Ile Arg
Gln Leu Leu Trp Phe His Ile Ser Cys Leu Thr Phe Gly Arg 100 105
110Glu Thr Val Leu Glu Tyr Leu Val Ser Phe Gly Val Trp Ile Arg Thr
115 120 125Pro Pro Ala Tyr Arg Pro Pro Asn Ala Pro Ile Leu Ser Thr
Leu Pro 130 135 140Glu Thr Thr Val Val Arg Arg Arg Asp Arg Gly Arg
Ser Pro Arg Arg145 150 155 160Arg Thr Pro Ser Pro Arg Arg Arg Arg
Ser Gln Ser Pro Arg Arg Arg 165 170 175Arg Ser Gln Ser Arg Glu Ser
Gln Cys 180 1852188PRTHepatitis B virus 2Met Asp Ile Asp Pro Tyr
Lys Glu Phe Gly Ala Thr Val Glu Leu Leu1 5 10 15Ser Phe Leu Pro Ser
Asp Phe Phe Pro Ser Val Arg Asp Leu Leu Asp 20 25 30Thr Ala Ala Ala
Leu Tyr Arg Asp Ala Leu Glu Ser Pro Glu His Cys 35 40 45Ser Pro His
His Thr Ala Leu Arg Gln Ala Ile Leu Cys Trp Gly Asp 50 55 60Leu Met
Thr Leu Ala Thr Trp Val Gly Thr Asn Leu Glu Asp Gly Gly65 70 75
80Lys Gly Gly Ser Arg Asp Leu Val Val Ser Tyr Val Asn Thr Asn Val
85 90 95Gly Leu Lys Phe Arg Gln Leu Leu Trp Phe His Ile Ser Cys Leu
Thr 100 105 110Phe Gly Arg Glu Thr Val Leu Glu Tyr Leu Val Ser Phe
Gly Val Trp 115 120 125Ile Arg Thr Pro Pro Ala Tyr Arg Pro Pro Asn
Ala Pro Ile Leu Ser 130 135 140Thr Leu Pro Glu Thr Thr Val Val Arg
Arg Arg Asp Arg Gly Arg Ser145 150 155 160Pro Arg Arg Arg Thr Pro
Ser Pro Arg Arg Arg Arg Ser Gln Ser Pro 165 170 175Arg Arg Arg Arg
Ser Gln Ser Arg Glu Ser Gln Cys 180 1853132PRTBacteriophage Qbeta
3Ala Lys Leu Glu Thr Val Thr Leu Gly Asn Ile Gly Lys Asp Gly Lys1 5
10 15Gln Thr Leu Val Leu Asn Pro Arg Gly Val Asn Pro Thr Asn Gly
Val 20 25 30Ala Ser Leu Ser Gln Ala Gly Ala Val Pro Ala Leu Glu Lys
Arg Val 35 40 45Thr Val Ser Val Ser Gln Pro Ser Arg Asn Arg Lys Asn
Tyr Lys Val 50 55 60Gln Val Lys Ile Gln Asn Pro Thr Ala Cys Thr Ala
Asn Gly Ser Cys65 70 75 80Asp Pro Ser Val Thr Arg Gln Ala Tyr Ala
Asp Val Thr Phe Ser Phe 85 90 95Thr Gln Tyr Ser Thr Asp Glu Glu Arg
Ala Phe Val Arg Thr Glu Leu 100 105 110Ala Ala Leu Leu Ala Ser Pro
Leu Leu Ile Asp Ala Ile Asp Gln Leu 115 120 125Asn Pro Ala Tyr
1304329PRTBacteriophage Qbeta 4Met Ala Lys Leu Glu Thr Val Thr Leu
Gly Asn Ile Gly Lys Asp Gly1 5 10 15Lys Gln Thr Leu Val Leu Asn Pro
Arg Gly Val Asn Pro Thr Asn Gly 20 25 30Val Ala Ser Leu Ser Gln Ala
Gly Ala Val Pro Ala Leu Glu Lys Arg 35 40 45Val Thr Val Ser Val Ser
Gln Pro Ser Arg Asn Arg Lys Asn Tyr Lys 50 55 60Val Gln Val Lys Ile
Gln Asn Pro Thr Ala Cys Thr Ala Asn Gly Ser65 70 75 80Cys Asp Pro
Ser Val Thr Arg Gln Ala Tyr Ala Asp Val Thr Phe Ser 85 90 95Phe Thr
Gln Tyr Ser Thr Asp Glu Glu Arg Ala Phe Val Arg Thr Glu 100 105
110Leu Ala Ala Leu Leu Ala Ser Pro Leu Leu Ile Asp Ala Ile Asp Gln
115 120 125Leu Asn Pro Ala Tyr Trp Thr Leu Leu Ile Ala Gly Gly Gly
Ser Gly 130 135 140Ser Lys Pro Asp Pro Val Ile Pro Asp Pro Pro Ile
Asp Pro Pro Pro145 150 155 160Gly Thr Gly Lys Tyr Thr Cys Pro Phe
Ala Ile Trp Ser Leu Glu Glu 165 170 175Val Tyr Glu Pro Pro Thr Lys
Asn Arg Pro Trp Pro Ile Tyr Asn Ala 180 185 190Val Glu Leu Gln Pro
Arg Glu Phe Asp Val Ala Leu Lys Asp Leu Leu 195 200 205Gly Asn Thr
Lys Trp Arg Asp Trp Asp Ser Arg Leu Ser Tyr Thr Thr 210 215 220Phe
Arg Gly Cys Arg Gly Asn Gly Tyr Ile Asp Leu Asp Ala Thr Tyr225 230
235 240Leu Ala Thr Asp Gln Ala Met Arg Asp Gln Lys Tyr Asp Ile Arg
Glu 245 250 255Gly Lys Lys Pro Gly Ala Phe Gly Asn Ile Glu Arg Phe
Ile Tyr Leu 260 265 270Lys Ser Ile Asn Ala Tyr Cys Ser Leu Ser Asp
Ile Ala Ala Tyr His 275 280 285Ala Asp Gly Val Ile Val Gly Phe Trp
Arg Asp Pro Ser Ser Gly Gly 290 295 300Ala Ile Pro Phe Asp Phe Thr
Lys Phe Asp Lys Thr Lys Cys Pro Ile305 310 315 320Gln Ala Val Ile
Val Val Pro Arg Ala 3255129PRTBacteriophage R17 5Ala Ser Asn Phe
Thr Gln Phe Val Leu Val Asn Asp Gly Gly Thr Gly1 5 10 15Asn Val Thr
Val Ala Pro Ser Asn Phe Ala Asn Gly Val Ala Glu Trp 20 25 30Ile Ser
Ser Asn Ser Arg Ser Gln Ala Tyr Lys Val Thr Cys Ser Val 35 40 45Arg
Gln Ser Ser Ala Gln Asn Arg Lys Tyr Thr Ile Lys Val Glu Val 50 55
60Pro Lys Val Ala Thr Gln Thr Val Gly Gly Val Glu Leu Pro Val Ala65
70 75 80Ala Trp Arg Ser Tyr Leu Asn Met Glu Leu Thr Ile Pro Ile Phe
Ala 85 90 95Thr Asn Ser Asp Cys Glu Leu Ile Val Lys Ala Met Gln Gly
Leu Leu 100 105 110Lys Asp Gly Asn Pro Ile Pro Ser Ala Ile Ala Ala
Asn Ser Gly Ile 115 120 125Tyr 6130PRTBacteriophage fr 6Met Ala Ser
Asn Phe Glu Glu Phe Val Leu Val Asp Asn Gly Gly Thr1 5 10 15Gly Asp
Val Lys Val Ala Pro Ser Asn Phe Ala Asn Gly Val Ala Glu 20 25 30Trp
Ile Ser Ser Asn Ser Arg Ser Gln Ala Tyr Lys Val Thr Cys Ser 35 40
45Val Arg Gln Ser Ser Ala Asn Asn Arg Lys Tyr Thr Val Lys Val Glu
50 55 60Val Pro Lys Val Ala Thr Gln Val Gln Gly Gly Val Glu Leu Pro
Val65 70 75 80Ala Ala Trp Arg Ser Tyr Met Asn Met Glu Leu Thr Ile
Pro Val Phe 85 90 95Ala Thr Asn Asp Asp Cys Ala Leu Ile Val Lys Ala
Leu Gln Gly Thr 100 105 110Phe Lys Thr Gly Asn Pro Ile Ala Thr Ala
Ile Ala Ala Asn Ser Gly 115 120 125Ile Tyr 1307130PRTBacteriophage
GA 7Met Ala Thr Leu Arg Ser Phe Val Leu Val Asp Asn Gly Gly Thr
Gly1 5 10 15Asn Val Thr Val Val Pro Val Ser Asn Ala Asn Gly Val Ala
Glu Trp 20 25 30Leu Ser Asn Asn Ser Arg Ser Gln Ala Tyr Arg Val Thr
Ala Ser Tyr 35 40 45Arg Ala Ser Gly Ala Asp Lys Arg Lys Tyr Ala Ile
Lys Leu Glu Val 50 55 60Pro Lys Ile Val Thr Gln Val Val Asn Gly Val
Glu Leu Pro Gly Ser65 70 75 80Ala Trp Lys Ala Tyr Ala Ser Ile Asp
Leu Thr Ile Pro Ile Phe Ala 85 90 95Ala Thr Asp Asp Val Thr Val Ile
Ser Lys Ser Leu Ala Gly Leu Phe 100 105 110Lys Val Gly Asn Pro Ile
Ala Glu Ala Ile Ser Ser Gln Ser Gly Phe 115 120 125Tyr Ala
1308132PRTBacteriophage SP 8Met Ala Lys Leu Asn Gln Val Thr Leu Ser
Lys Ile Gly Lys Asn Gly1 5 10 15Asp Gln Thr Leu Thr Leu Thr Pro Arg
Gly Val Asn Pro Thr Asn Gly 20 25 30Val Ala Ser Leu Ser Glu Ala Gly
Ala Val Pro Ala Leu Glu Lys Arg 35 40 45Val Thr Val Ser Val Ala Gln
Pro Ser Arg Asn Arg Lys Asn Phe Lys 50 55 60Val Gln Ile Lys Leu Gln
Asn Pro Thr Ala Cys Thr Arg Asp Ala Cys65 70 75 80Asp Pro Ser Val
Thr Arg Ser Ala Phe Ala Asp Val Thr Leu Ser Phe 85 90 95Thr Ser Tyr
Ser Thr Asp Glu Glu Arg Ala Leu Ile Arg Thr Glu Leu 100 105 110Ala
Ala Leu Leu Ala Asp Pro Leu Ile Val Asp Ala Ile Asp Asn Leu 115 120
125Asn Pro Ala Tyr 1309329PRTBacteriophage SP 9Ala Lys Leu Asn Gln
Val Thr Leu Ser Lys Ile Gly Lys Asn Gly Asp1 5 10 15Gln Thr Leu Thr
Leu Thr Pro Arg Gly Val Asn Pro Thr Asn Gly Val 20 25 30Ala Ser Leu
Ser Glu Ala Gly Ala Val Pro Ala Leu Glu Lys Arg Val 35 40 45Thr Val
Ser Val Ala Gln Pro Ser Arg Asn Arg Lys Asn Phe Lys Val 50 55 60Gln
Ile Lys Leu Gln Asn Pro Thr Ala Cys Thr Arg Asp Ala Cys Asp65 70 75
80Pro Ser Val Thr Arg Ser Ala Phe Ala Asp Val Thr Leu Ser Phe Thr
85 90 95Ser Tyr Ser Thr Asp Glu Glu Arg Ala Leu Ile Arg Thr Glu Leu
Ala 100 105 110Ala Leu Leu Ala Asp Pro Leu Ile Val Asp Ala Ile Asp
Asn Leu Asn 115 120 125Pro Ala Tyr Trp Ala Ala Leu Leu Val Ala Ser
Ser Gly Gly Gly Asp 130 135 140Asn Pro Ser Asp Pro Asp Val Pro Val
Val Pro Asp Val Lys Pro Pro145 150 155 160Asp Gly Thr Gly Arg Tyr
Lys Cys Pro Phe Ala Cys Tyr Arg Leu Gly 165 170 175Ser Ile Tyr Glu
Val Gly Lys Glu Gly Ser Pro Asp Ile Tyr Glu Arg 180 185 190Gly Asp
Glu Val Ser Val Thr Phe Asp Tyr Ala Leu Glu Asp Phe Leu 195 200
205Gly Asn Thr Asn Trp Arg Asn Trp Asp Gln Arg Leu Ser Asp Tyr Asp
210 215 220Ile Ala Asn Arg Arg Arg Cys Arg Gly Asn Gly Tyr Ile Asp
Leu Asp225 230 235 240Ala Thr Ala Met Gln Ser Asp Asp Phe Val Leu
Ser Gly Arg Tyr Gly 245 250 255Val Arg Lys Val Lys Phe Pro Gly Ala
Phe Gly Ser Ile Lys Tyr Leu 260 265 270Leu Asn Ile Gln Gly Asp Ala
Trp Leu Asp Leu Ser Glu Val Thr Ala 275 280 285Tyr Arg Ser Tyr Gly
Met Val Ile Gly Phe Trp Thr Asp Ser Lys Ser 290 295 300Pro Gln Leu
Pro Thr Asp Phe Thr Gln Phe Asn Ser Ala Asn Cys Pro305 310 315
320Val Gln Thr Val Ile Ile Ile Pro Ser 32510130PRTBacteriophage MS2
10Met Ala Ser Asn Phe Thr Gln Phe Val Leu Val Asp Asn Gly Gly Thr1
5 10 15Gly Asp Val Thr Val Ala Pro Ser Asn Phe Ala Asn Gly Val Ala
Glu 20 25 30Trp Ile Ser Ser Asn Ser Arg Ser Gln Ala Tyr Lys Val Thr
Cys Ser 35 40 45Val Arg Gln Ser Ser Ala Gln Asn Arg Lys Tyr Thr Ile
Lys Val Glu 50 55 60Val Pro Lys Val Ala Thr Gln Thr Val Gly Gly Val
Glu Leu Pro Val65 70 75 80Ala Ala Trp Arg Ser Tyr Leu Asn Met Glu
Leu Thr Ile Pro Ile Phe 85 90 95Ala Thr Asn Ser Asp Cys Glu Leu Ile
Val Lys Ala Met Gln Gly Leu 100 105 110Leu Lys Asp Gly Asn Pro Ile
Pro Ser Ala Ile Ala Ala Asn Ser Gly 115 120 125Ile Tyr
13011133PRTBacteriophage M11 11Met Ala Lys Leu Gln Ala Ile Thr Leu
Ser Gly Ile Gly Lys Lys Gly1 5 10 15Asp Val Thr Leu Asp Leu Asn Pro
Arg Gly Val Asn Pro Thr Asn Gly 20 25 30Val Ala Ala Leu Ser Glu Ala
Gly Ala Val Pro Ala Leu Glu Lys Arg 35 40 45Val Thr Ile Ser Val Ser
Gln Pro Ser Arg Asn Arg Lys Asn Tyr Lys 50 55 60Val Gln Val Lys Ile
Gln Asn Pro Thr Ser Cys Thr Ala Ser Gly Thr65 70 75 80Cys Asp Pro
Ser Val Thr Arg Ser Ala Tyr Ser Asp Val Thr Phe Ser 85 90 95Phe Thr
Gln Tyr Ser Thr Val Glu Glu Arg Ala Leu Val Arg Thr Glu 100 105
110Leu Gln Ala Leu Leu Ala Asp Pro Met Leu Val Asn Ala Ile Asp Asn
115 120 125Leu Asn Pro Ala Tyr 13012133PRTBacteriophage MX1 12Met
Ala Lys Leu Gln Ala Ile Thr Leu Ser Gly Ile Gly Lys Asn Gly1 5 10
15Asp Val Thr Leu Asn Leu Asn Pro Arg Gly Val Asn Pro Thr Asn Gly
20 25 30Val Ala Ala Leu Ser Glu Ala Gly Ala Val Pro Ala Leu Glu Lys
Arg 35 40 45Val Thr Ile Ser Val Ser Gln Pro Ser Arg Asn Arg Lys Asn
Tyr Lys 50 55 60Val Gln Val Lys Ile Gln Asn Pro Thr Ser Cys Thr Ala
Ser Gly Thr65 70 75 80Cys Asp Pro Ser Val Thr Arg Ser Ala Tyr Ala
Asp Val Thr Phe Ser 85 90 95Phe Thr Gln Tyr Ser Thr Asp Glu Glu Arg
Ala Leu Val Arg Thr Glu 100 105 110Leu Lys Ala Leu Leu Ala Asp Pro
Met Leu Ile Asp Ala Ile Asp Asn 115 120 125Leu Asn Pro Ala Tyr
13013330PRTBacteriophage NL95 13Met Ala Lys Leu Asn Lys Val Thr Leu
Thr Gly Ile Gly Lys Ala Gly1 5 10 15Asn Gln Thr Leu Thr Leu Thr Pro
Arg Gly Val Asn Pro Thr Asn Gly 20 25 30Val Ala Ser Leu Ser Glu Ala
Gly Ala Val Pro Ala Leu Glu Lys Arg 35 40 45Val Thr Val Ser Val Ala
Gln Pro Ser Arg Asn Arg Lys Asn Tyr Lys 50 55 60Val Gln Ile Lys Leu
Gln Asn Pro Thr Ala Cys Thr Lys Asp Ala Cys65 70 75 80Asp Pro Ser
Val Thr Arg Ser Gly Ser Arg Asp Val Thr Leu Ser Phe 85 90 95Thr Ser
Tyr Ser Thr Glu Arg Glu Arg Ala Leu Ile Arg Thr Glu Leu 100 105
110Ala Ala Leu Leu Lys Asp Asp Leu Ile Val Asp Ala Ile Asp Asn Leu
115 120 125Asn Pro Ala Tyr Trp Ala Ala Leu Leu Ala Ala Ser Pro Gly
Gly Gly 130 135 140Asn Asn Pro Tyr Pro Gly Val Pro Asp Ser Pro Asn
Val Lys Pro Pro145 150 155 160Gly Gly Thr Gly Thr Tyr Arg Cys Pro
Phe Ala Cys Tyr Arg Arg Gly 165 170 175Glu Leu Ile Thr Glu Ala Lys
Asp Gly Ala Cys Ala Leu Tyr Ala Cys 180 185 190Gly Ser Glu Ala Leu
Val Glu Phe Glu Tyr Ala Leu Glu Asp Phe Leu 195 200 205Gly Asn Glu
Phe Trp Arg Asn Trp Asp Gly Arg Leu Ser Lys Tyr Asp 210 215 220Ile
Glu Thr His Arg Arg Cys Arg Gly Asn Gly Tyr Val Asp Leu Asp225 230
235 240Ala Ser Val Met Gln Ser Asp Glu Tyr Val Leu Ser Gly Ala Tyr
Asp 245 250 255Val Val Lys Met Gln Pro Pro Gly Thr Phe Asp Ser Pro
Arg Tyr Tyr 260 265 270Leu His Leu Met Asp Gly Ile Tyr Val Asp Leu
Ala Glu Val Thr Ala 275 280 285Tyr Arg Ser Tyr Gly Met Val Ile Gly
Phe Trp Thr Asp Ser Lys Ser 290 295 300Pro Gln Leu Pro Thr Asp Phe
Thr Arg Phe Asn Arg His Asn Cys Pro305 310 315 320Val Gln Thr Val
Ile Val Ile Pro Ser Leu 325 33014129PRTBacteriophage f2 14Ala Ser
Asn Phe Thr Gln Phe Val Leu Val Asn Asp Gly Gly Thr Gly1 5 10 15Asn
Val Thr Val Ala Pro Ser Asn Phe Ala Asn Gly Val Ala Glu Trp
20 25 30Ile Ser Ser Asn Ser Arg Ser Gln Ala Tyr Lys Val Thr Cys Ser
Val 35 40 45Arg Gln Ser Ser Ala Gln Asn Arg Lys Tyr Thr Ile Lys Val
Glu Val 50 55 60Pro Lys Val Ala Thr Gln Thr Val Gly Gly Val Glu Leu
Pro Val Ala65 70 75 80Ala Trp Arg Ser Tyr Leu Asn Leu Glu Leu Thr
Ile Pro Ile Phe Ala 85 90 95Thr Asn Ser Asp Cys Glu Leu Ile Val Lys
Ala Met Gln Gly Leu Leu 100 105 110Lys Asp Gly Asn Pro Ile Pro Ser
Ala Ile Ala Ala Asn Ser Gly Ile 115 120 125Tyr
15128PRTBacteriophage PP7 15Met Ser Lys Thr Ile Val Leu Ser Val Gly
Glu Ala Thr Arg Thr Leu1 5 10 15Thr Glu Ile Gln Ser Thr Ala Asp Arg
Gln Ile Phe Glu Glu Lys Val 20 25 30Gly Pro Leu Val Gly Arg Leu Arg
Leu Thr Ala Ser Leu Arg Gln Asn 35 40 45Gly Ala Lys Thr Ala Tyr Arg
Val Asn Leu Lys Leu Asp Gln Ala Asp 50 55 60Val Val Asp Cys Ser Thr
Ser Val Cys Gly Glu Leu Pro Lys Val Arg65 70 75 80Tyr Thr Gln Val
Trp Ser His Asp Val Thr Ile Val Ala Asn Ser Thr 85 90 95Glu Ala Ser
Arg Lys Ser Leu Tyr Asp Leu Thr Lys Ser Leu Val Ala 100 105 110Thr
Ser Gln Val Glu Asp Leu Val Val Asn Leu Val Pro Leu Gly Arg 115 120
12516132PRTBacteriophage Qbeta 16Ala Lys Leu Glu Thr Val Thr Leu
Gly Asn Ile Gly Arg Asp Gly Lys1 5 10 15Gln Thr Leu Val Leu Asn Pro
Arg Gly Val Asn Pro Thr Asn Gly Val 20 25 30Ala Ser Leu Ser Gln Ala
Gly Ala Val Pro Ala Leu Glu Lys Arg Val 35 40 45Thr Val Ser Val Ser
Gln Pro Ser Arg Asn Arg Lys Asn Tyr Lys Val 50 55 60Gln Val Lys Ile
Gln Asn Pro Thr Ala Cys Thr Ala Asn Gly Ser Cys65 70 75 80Asp Pro
Ser Val Thr Arg Gln Lys Tyr Ala Asp Val Thr Phe Ser Phe 85 90 95Thr
Gln Tyr Ser Thr Asp Glu Glu Arg Ala Phe Val Arg Thr Glu Leu 100 105
110Ala Ala Leu Leu Ala Ser Pro Leu Leu Ile Asp Ala Ile Asp Gln Leu
115 120 125Asn Pro Ala Tyr 13017132PRTBacteriophage Qbeta 17Ala Lys
Leu Glu Thr Val Thr Leu Gly Lys Ile Gly Lys Asp Gly Lys1 5 10 15Gln
Thr Leu Val Leu Asn Pro Arg Gly Val Asn Pro Thr Asn Gly Val 20 25
30Ala Ser Leu Ser Gln Ala Gly Ala Val Pro Ala Leu Glu Lys Arg Val
35 40 45Thr Val Ser Val Ser Gln Pro Ser Arg Asn Arg Lys Asn Tyr Lys
Val 50 55 60Gln Val Lys Ile Gln Asn Pro Thr Ala Cys Thr Ala Asn Gly
Ser Cys65 70 75 80Asp Pro Ser Val Thr Arg Gln Lys Tyr Ala Asp Val
Thr Phe Ser Phe 85 90 95Thr Gln Tyr Ser Thr Asp Glu Glu Arg Ala Phe
Val Arg Thr Glu Leu 100 105 110Ala Ala Leu Leu Ala Ser Pro Leu Leu
Ile Asp Ala Ile Asp Gln Leu 115 120 125Asn Pro Ala Tyr
13018132PRTBacteriophage Qbeta 18Ala Arg Leu Glu Thr Val Thr Leu
Gly Asn Ile Gly Arg Asp Gly Lys1 5 10 15Gln Thr Leu Val Leu Asn Pro
Arg Gly Val Asn Pro Thr Asn Gly Val 20 25 30Ala Ser Leu Ser Gln Ala
Gly Ala Val Pro Ala Leu Glu Lys Arg Val 35 40 45Thr Val Ser Val Ser
Gln Pro Ser Arg Asn Arg Lys Asn Tyr Lys Val 50 55 60Gln Val Lys Ile
Gln Asn Pro Thr Ala Cys Thr Ala Asn Gly Ser Cys65 70 75 80Asp Pro
Ser Val Thr Arg Gln Lys Tyr Ala Asp Val Thr Phe Ser Phe 85 90 95Thr
Gln Tyr Ser Thr Asp Glu Glu Arg Ala Phe Val Arg Thr Glu Leu 100 105
110Ala Ala Leu Leu Ala Ser Pro Leu Leu Ile Asp Ala Ile Asp Gln Leu
115 120 125Asn Pro Ala Tyr 13019132PRTBacteriophage Qbeta 19Ala Lys
Leu Glu Thr Val Thr Leu Gly Asn Ile Gly Lys Asp Gly Arg1 5 10 15Gln
Thr Leu Val Leu Asn Pro Arg Gly Val Asn Pro Thr Asn Gly Val 20 25
30Ala Ser Leu Ser Gln Ala Gly Ala Val Pro Ala Leu Glu Lys Arg Val
35 40 45Thr Val Ser Val Ser Gln Pro Ser Arg Asn Arg Lys Asn Tyr Lys
Val 50 55 60Gln Val Lys Ile Gln Asn Pro Thr Ala Cys Thr Ala Asn Gly
Ser Cys65 70 75 80Asp Pro Ser Val Thr Arg Gln Lys Tyr Ala Asp Val
Thr Phe Ser Phe 85 90 95Thr Gln Tyr Ser Thr Asp Glu Glu Arg Ala Phe
Val Arg Thr Glu Leu 100 105 110Ala Ala Leu Leu Ala Ser Pro Leu Leu
Ile Asp Ala Ile Asp Gln Leu 115 120 125Asn Pro Ala Tyr
13020132PRTBacteriophage Qbeta 20Ala Arg Leu Glu Thr Val Thr Leu
Gly Asn Ile Gly Lys Asp Gly Arg1 5 10 15Gln Thr Leu Val Leu Asn Pro
Arg Gly Val Asn Pro Thr Asn Gly Val 20 25 30Ala Ser Leu Ser Gln Ala
Gly Ala Val Pro Ala Leu Glu Lys Arg Val 35 40 45Thr Val Ser Val Ser
Gln Pro Ser Arg Asn Arg Lys Asn Tyr Lys Val 50 55 60Gln Val Lys Ile
Gln Asn Pro Thr Ala Cys Thr Ala Asn Gly Ser Cys65 70 75 80Asp Pro
Ser Val Thr Arg Gln Lys Tyr Ala Asp Val Thr Phe Ser Phe 85 90 95Thr
Gln Tyr Ser Thr Asp Glu Glu Arg Ala Phe Val Arg Thr Glu Leu 100 105
110Ala Ala Leu Leu Ala Ser Pro Leu Leu Ile Asp Ala Ile Asp Gln Leu
115 120 125Asn Pro Ala Tyr 13021131PRTBacteriophage AP205 21Met Ala
Asn Lys Pro Met Gln Pro Ile Thr Ser Thr Ala Asn Lys Ile1 5 10 15Val
Trp Ser Asp Pro Thr Arg Leu Ser Thr Thr Phe Ser Ala Ser Leu 20 25
30Leu Arg Gln Arg Val Lys Val Gly Ile Ala Glu Leu Asn Asn Val Ser
35 40 45Gly Gln Tyr Val Ser Val Tyr Lys Arg Pro Ala Pro Lys Pro Glu
Gly 50 55 60Cys Ala Asp Ala Cys Val Ile Met Pro Asn Glu Asn Gln Ser
Ile Arg65 70 75 80Thr Val Ile Ser Gly Ser Ala Glu Asn Leu Ala Thr
Leu Lys Ala Glu 85 90 95Trp Glu Thr His Lys Arg Asn Val Asp Thr Leu
Phe Ala Ser Gly Asn 100 105 110Ala Gly Leu Gly Phe Leu Asp Pro Thr
Ala Ala Ile Val Ser Ser Asp 115 120 125Thr Thr Ala
13022131PRTBacteriophage AP205 22Met Ala Asn Lys Thr Met Gln Pro
Ile Thr Ser Thr Ala Asn Lys Ile1 5 10 15Val Trp Ser Asp Pro Thr Arg
Leu Ser Thr Thr Phe Ser Ala Ser Leu 20 25 30Leu Arg Gln Arg Val Lys
Val Gly Ile Ala Glu Leu Asn Asn Val Ser 35 40 45Gly Gln Tyr Val Ser
Val Tyr Lys Arg Pro Ala Pro Lys Pro Glu Gly 50 55 60Cys Ala Asp Ala
Cys Val Ile Met Pro Asn Glu Asn Gln Ser Ile Arg65 70 75 80Thr Val
Ile Ser Gly Ser Ala Glu Asn Leu Ala Thr Leu Lys Ala Glu 85 90 95Trp
Glu Thr His Lys Arg Asn Val Asp Thr Leu Phe Ala Ser Gly Asn 100 105
110Ala Gly Leu Gly Phe Leu Asp Pro Thr Ala Ala Ile Val Ser Ser Asp
115 120 125Thr Thr Ala 13023131PRTBacteriophage AP205 23Met Ala Asn
Lys Pro Met Gln Pro Ile Thr Ser Thr Ala Asp Lys Ile1 5 10 15Val Trp
Ser Asp Pro Thr Arg Leu Ser Thr Thr Phe Ser Ala Ser Leu 20 25 30Leu
Arg Gln Arg Val Lys Val Gly Ile Ala Glu Leu Asn Asn Val Ser 35 40
45Gly Gln Tyr Val Ser Val Tyr Lys Arg Pro Ala Pro Lys Pro Glu Gly
50 55 60Cys Ala Asp Ala Cys Val Ile Met Pro Asn Glu Asn Gln Ser Ile
Arg65 70 75 80Thr Val Ile Ser Gly Ser Ala Glu Asn Leu Ala Thr Leu
Lys Ala Glu 85 90 95Trp Glu Thr His Lys Arg Asn Val Asp Thr Leu Phe
Ala Ser Gly Asn 100 105 110Ala Gly Leu Gly Phe Leu Asp Pro Thr Ala
Ala Ile Val Ser Ser Asp 115 120 125Thr Thr Ala 1302437DNAartificial
sequencePCR primer 24atatatgcta gccccttaca cctaccagag tgatttg
372537DNAartificial sequencePCR primer 25atatatctcg agtgatatct
ggaagtctgt catagag 372637DNAartificial sequencePCR primer
26atatatgcta gcccccatta gacagctgca ctacagg 372737DNAartificial
sequencePCR primer 27atatatctcg agggaagaca cagattccat ggtgaag
37287PRTartificial sequencesynthesized sequence 28Gly Gly Gly Gly
Gly Cys Gly1 5295473DNAartificial sequenceCloning Vector
29acatcgtata acgttactgg tttcacattc accaccctga attgactctc ttccgggcgc
60tatcatgcca taccgcgaaa ggttttgcgc cattcgatgg tgtccgggat ctcgacgctc
120tcccttatgc gactcctgca ttaggaagca gcccagtagt aggttgaggc
cgttgagcac 180cgccgccgca aggaatggtg catgcaagga gatggcgccc
aacagtcccc cggccacggg 240gcctgccacc atacccacgc cgaaacaagc
gctcatgagc ccgaagtggc gagcccgatc 300ttccccatcg gtgatgtcgg
cgatataggc gccagcaacc gcacctgtgg cgccggtgat 360gccggccacg
atgcgtccgg cgtagaggat cgagatctcg atcccgcgaa attaatacga
420ctcactatag gggaattgtg agcggataac aattcccctc tagaaataat
tttgtttaac 480tttaagaagg agatatacat atggatccac accaccacca
ccaccacggt tctggtgacg 540acgatgacaa agcgctagcc ctcgagggtg
gtggtggtgg ttgcggttaa taagtttaaa 600cgcggccgca tgcaccacca
ccaccaccac tgagatccgg ctgctaacaa agcccgaaag 660gaagctgagt
tggctgctgc caccgctgag caataactag cataacccct tggggcctct
720aaacgggtct tgaggggttt tttgctgaaa ggaggaacta tatccggatt
ggcgaatggg 780acgcgccctg tagcggcgca ttaagcgcgg cgggtgtggt
ggttacgcgc agcgtgaccg 840ctacacttgc cagcgcccta gcgcccgctc
ctttcgcttt cttcccttcc tttctcgcca 900cgttcgccgg ctttccccgt
caagctctaa atcgggggct ccctttaggg ttccgattta 960gtgctttacg
gcacctcgac cccaaaaaac ttgattaggg tgatggttca cgtagtgggc
1020catcgccctg atagacggtt tttcgccctt tgacgttgga gtccacgttc
tttaatagtg 1080gactcttgtt ccaaactgga acaacactca accctatctc
ggtctattct tttgatttat 1140aagggatttt gccgatttcg gcctattggt
taaaaaatga gctgatttaa caaaaattta 1200acgcgaattt taacaaaata
ttaacgttta caatttcagg tggcactttt cggggaaatg 1260tgcgcggaac
ccctatttgt ttatttttct aaatacattc aaatatgtat ccgctcatga
1320gacaataacc ctgataaatg cttcaataat attgaaaaag gaagagtatg
agtattcaac 1380atttccgtgt cgcccttatt cccttttttg cggcattttg
ccttcctgtt tttgctcacc 1440cagaaacgct ggtgaaagta aaagatgctg
aagatcagtt gggtgcacga gtgggttaca 1500tcgaactgga tctcaacagc
ggtaagatcc ttgagagttt tcgccccgaa gaacgttttc 1560caatgatgag
cacttttaaa gttctgctat gtggcgcggt attatcccgt attgacgccg
1620ggcaagagca actcggtcgc cgcatacact attctcagaa tgacttggtt
gagtactcac 1680cagtcacaga aaagcatctt acggatggca tgacagtaag
agaattatgc agtgctgcca 1740taaccatgag tgataacact gcggccaact
tacttctgac aacgatcgga ggaccgaagg 1800agctaaccgc ttttttgcac
aacatggggg atcatgtaac tcgccttgat cgttgggaac 1860cggagctgaa
tgaagccata ccaaacgacg agcgtgacac cacgatgcct gcagcaatgg
1920caacaacgtt gcgcaaacta ttaactggcg aactacttac tctagcttcc
cggcaacaat 1980taatagactg gatggaggcg gataaagttg caggaccact
tctgcgctcg gcccttccgg 2040ctggctggtt tattgctgat aaatctggag
ccggtgagcg tgggtctcgc ggtatcattg 2100cagcactggg gccagatggt
aagccctccc gtatcgtagt tatctacacg acggggagtc 2160aggcaactat
ggatgaacga aatagacaga tcgctgagat aggtgcctca ctgattaagc
2220attggtaact gtcagaccaa gtttactcat atatacttta gattgattta
aaacttcatt 2280tttaatttaa aaggatctag gtgaagatcc tttttgataa
tctcatgacc aaaatccctt 2340aacgtgagtt ttcgttccac tgagcgtcag
accccgtaga aaagatcaaa ggatcttctt 2400gagatccttt ttttctgcgc
gtaatctgct gcttgcaaac aaaaaaacca ccgctaccag 2460cggtggtttg
tttgccggat caagagctac caactctttt tccgaaggta actggcttca
2520gcagagcgca gataccaaat actgtccttc tagtgtagcc gtagttaggc
caccacttca 2580agaactctgt agcaccgcct acatacctcg ctctgctaat
cctgttacca gtggctgctg 2640ccagtggcga taagtcgtgt cttaccgggt
tggactcaag acgatagtta ccggataagg 2700cgcagcggtc gggctgaacg
gggggttcgt gcacacagcc cagcttggag cgaacgacct 2760acaccgaact
gagataccta cagcgtgagc tatgagaaag cgccacgctt cccgaaggga
2820gaaaggcgga caggtatccg gtaagcggca gggtcggaac aggagagcgc
acgagggagc 2880ttccaggggg aaacgcctgg tatctttata gtcctgtcgg
gtttcgccac ctctgacttg 2940agcgtcgatt tttgtgatgc tcgtcagggg
ggcggagcct atggaaaaac gccagcaacg 3000cggccttttt acggttcctg
gccttttgct ggccttttgc tcacatgttc tttcctgcgt 3060tatcccctga
ttctgtggat aaccgtatta ccgcctttga gtgagctgat accgctcgcc
3120gcagccgaac gaccgagcgc agcgagtcag tgagcgagga agcggaagag
cgcctgatgc 3180ggtattttct ccttacgcat ctgtgcggta tttcacaccg
catatatggt gcactctcag 3240tacaatctgc tctgatgccg catagttaag
ccagtataca ctccgctatc gctacgtgac 3300tgggtcatgg ctgcgccccg
acacccgcca acacccgctg acgcgccctg acgggcttgt 3360ctgctcccgg
catccgctta cagacaagct gtgaccgtct ccgggagctg catgtgtcag
3420aggttttcac cgtcatcacc gaaacgcgcg aggcagctgc ggtaaagctc
atcagcgtgg 3480tcgtgaagcg attcacagat gtctgcctgt tcatccgcgt
ccagctcgtt gagtttctcc 3540agaagcgtta atgtctggct tctgataaag
cgggccatgt taagggcggt tttttcctgt 3600ttggtcactg atgcctccgt
gtaaggggga tttctgttca tgggggtaat gataccgatg 3660aaacgagaga
ggatgctcac gatacgggtt actgatgatg aacatgcccg gttactggaa
3720cgttgtgagg gtaaacaact ggcggtatgg atgcggcggg accagagaaa
aatcactcag 3780ggtcaatgcc agcgcttcgt taatacagat gtaggtgttc
cacagggtag ccagcagcat 3840cctgcgatgc agatccggaa cataatggtg
cagggcgctg acttccgcgt ttccagactt 3900tacgaaacac ggaaaccgaa
gaccattcat gttgttgctc aggtcgcaga cgttttgcag 3960cagcagtcgc
ttcacgttcg ctcgcgtatc ggtgattcat tctgctaacc agtaaggcaa
4020ccccgccagc ctagccgggt cctcaacgac aggagcacga tcatgcgcac
ccgtggggcc 4080gccatgccgg cgataatggc ctgcttctcg ccgaaacgtt
tggtggcggg accagtgacg 4140aaggcttgag cgagggcgtg caagattccg
aataccgcaa gcgacaggcc gatcatcgtc 4200gcgctccagc gaaagcggtc
ctcgccgaaa atgacccaga gcgctgccgg cacctgtcct 4260acgagttgca
tgataaagaa gacagtcata agtgcggcga cgatagtcat gccccgcgcc
4320caccggaagg agctgactgg gttgaaggct ctcaagggca tcggtcgaga
tcccggtgcc 4380taatgagtga gctaacttac attaattgcg ttgcgctcac
tgcccgcttt ccagtcggga 4440aacctgtcgt gccagctgca ttaatgaatc
ggccaacgcg cggggagagg cggtttgcgt 4500attgggcgcc agggtggttt
ttcttttcac cagtgagacg ggcaacagct gattgccctt 4560caccgcctgg
ccctgagaga gttgcagcaa gcggtccacg ctggtttgcc ccagcaggcg
4620aaaatcctgt ttgatggtgg ttaacggcgg gatataacat gagctgtctt
cggtatcgtc 4680gtatcccact accgagatat ccgcaccaac gcgcagcccg
gactcggtaa tggcgcgcat 4740tgcgcccagc gccatctgat cgttggcaac
cagcatcgca gtgggaacga tgccctcatt 4800cagcatttgc atggtttgtt
gaaaaccgga catggcactc cagtcgcctt cccgttccgc 4860tatcggctga
atttgattgc gagtgagata tttatgccag ccagccagac gcagacgcgc
4920cgagacagaa cttaatgggc ccgctaacag cgcgatttgc tggtgaccca
atgcgaccag 4980atgctccacg cccagtcgcg taccgtcttc atgggagaaa
ataatactgt tgatgggtgt 5040ctggtcagag acatcaagaa ataacgccgg
aacattagtg caggcagctt ccacagcaat 5100ggcatcctgg tcatccagcg
gatagttaat gatcagccca ctgacgcgtt gcgcgagaag 5160attgtgcacc
gccgctttac aggcttcgac gccgcttcgt tctaccatcg acaccaccac
5220gctggcaccc agttgatcgg cgcgagattt aatcgccgcg acaatttgcg
acggcgcgtg 5280cagggccaga ctggaggtgg caacgccaat cagcaacgac
tgtttgcccg ccagttgttg 5340tgccacgcgg ttgggaatgt aattcagctc
cgccatcgcc gcttccactt tttcccgcgt 5400tttcgcagaa acgtggctgg
cctggttcac cacgcgggaa acggtctgat aagagacacc 5460ggcatactct gcg
54733043DNAartificial sequencePCR primer 30tatggatccg gctagcgctc
gagggtttaa acggcggccg cat 433145DNAartificial sequencePCR primer
31tcgaatgcgg ccgccgttta aaccctcgag cgctagccgg atcca
453258DNAartificial sequencePCT primer 32gatccacacc accaccacca
ccacggttct ggtgacgacg atgacaaagc gctagccc 583358DNAartificial
sequencePCR primer 33tcgagggcta gcgctttgtc atcgtcgtca ccagaaccgt
ggtggtggtg gtggtgtg 583442DNAartificial sequencePCR primer
34tcgagggtgg tggtggtggt tgcggttaat aagtttaaac gc
423542DNAartificial sequencePCR primer 35ggccgcgttt aaacttatta
accgcaacca ccaccaccac cc 4236271PRTHomo sapiens 36Met Ala Lys Val
Pro Asp Met Phe Glu Asp Leu Lys Asn Cys Tyr Ser1 5 10 15Glu Asn Glu
Glu Asp Ser Ser Ser Ile Asp His Leu Ser Leu Asn Gln 20 25 30Lys Ser
Phe Tyr His Val Ser Tyr Gly Pro Leu His Glu Gly Cys Met 35 40 45Asp
Gln Ser Val Ser Leu Ser Ile Ser Glu Thr Ser Lys Thr Ser Lys 50 55
60Leu Thr Phe Lys Glu Ser Met Val Val Val Ala Thr Asn Gly Lys Val65
70 75
80Leu Lys Lys Arg Arg Leu Ser Leu Ser Gln Ser Ile Thr Asp Asp Asp
85 90 95Leu Glu Ala Ile Ala Asn Asp Ser Glu Glu Glu Ile Ile Lys Pro
Arg 100 105 110Ser Ser Pro Phe Ser Phe Leu Ser Asn Val Lys Tyr Asn
Phe Met Arg 115 120 125Ile Ile Lys Tyr Glu Phe Ile Leu Asn Asp Ala
Leu Asn Gln Ser Ile 130 135 140Ile Arg Ala Asn Asp Gln Tyr Leu Thr
Ala Ala Ala Leu His Asn Leu145 150 155 160Asp Glu Ala Val Lys Phe
Asp Met Gly Ala Tyr Lys Ser Ser Lys Asp 165 170 175Asp Ala Lys Ile
Thr Val Ile Leu Arg Ile Ser Lys Thr Gln Leu Tyr 180 185 190Val Thr
Ala Gln Asp Glu Asp Gln Pro Val Leu Leu Lys Glu Met Pro 195 200
205Glu Ile Pro Lys Thr Ile Thr Gly Ser Glu Thr Asn Leu Leu Phe Phe
210 215 220Trp Glu Thr His Gly Thr Lys Asn Tyr Phe Thr Ser Val Ala
His Pro225 230 235 240Asn Leu Phe Ile Ala Thr Lys Gln Asp Tyr Trp
Val Cys Leu Ala Gly 245 250 255Gly Pro Pro Ser Ile Thr Asp Phe Gln
Ile Leu Glu Asn Gln Ala 260 265 27037271PRTMacaca mulatta 37Met Ala
Lys Val Pro Asp Met Phe Glu Asp Leu Lys Asn Cys Tyr Ser1 5 10 15Glu
Asn Glu Glu Asp Ser Ser Ser Ile Asp His Leu Ser Leu Asn Gln 20 25
30Lys Ser Phe Tyr Asp Val Ser Tyr Gly Pro Leu His Glu Gly Cys Met
35 40 45Asp Gln Ser Val Ser Leu Ser Ile Ser Glu Ile Ser Lys Thr Ser
Lys 50 55 60Leu Thr Phe Lys Gln Ser Met Val Val Val Ser Thr Asn Gly
Lys Val65 70 75 80Leu Lys Lys Arg Arg Leu Ser Leu Ser Gln Ser Ile
Thr Asp Asn Asn 85 90 95Leu Glu Ala Ile Ala Asn Asp Ser Glu Glu Glu
Ile Ile Lys Pro Arg 100 105 110Ser Ala Pro Phe Ser Phe Leu Ser Asn
Met Thr Tyr His Phe Ile Arg 115 120 125Ile Ile Lys His Glu Phe Ile
Leu Asn Asp Thr Leu Asn Gln Thr Ile 130 135 140Ile Arg Ala Asn Asp
Gln His Leu Thr Ala Ala Ala Ile His Asn Leu145 150 155 160Asp Glu
Ala Val Lys Phe Asp Met Gly Ala Tyr Thr Ser Ser Lys Asp 165 170
175Asp Thr Lys Val Pro Val Ile Leu Arg Ile Ser Lys Thr Gln Leu Tyr
180 185 190Val Ser Ala Gln Asp Glu Asp Gln Pro Val Leu Leu Lys Glu
Met Pro 195 200 205Glu Ile Asn Lys Thr Ile Thr Gly Ser Glu Thr Asn
Phe Leu Phe Phe 210 215 220Trp Glu Thr His Gly Thr Lys Asn Tyr Phe
Ile Ser Val Ala His Pro225 230 235 240Asn Leu Phe Ile Ala Thr Lys
His Asp Asn Trp Val Cys Leu Ala Lys 245 250 255Gly Leu Pro Ser Ile
Thr Asp Phe Gln Ile Leu Glu Asn Gln Ala 260 265 27038270PRTEquus
caballus 38Met Ala Lys Val Pro Asp Leu Phe Glu Asp Leu Lys Asn Cys
Tyr Ser1 5 10 15Glu Asn Glu Asp Tyr Ser Ser Glu Ile Asp His Leu Ser
Leu Thr Gln 20 25 30Lys Ser Phe Tyr Asp Ala Ser Tyr Asp Pro Leu Pro
Glu Asp Cys Met 35 40 45Asp Thr Phe Met Ser Leu Ser Thr Ser Glu Thr
Ser Lys Thr Ser Lys 50 55 60Leu Asn Phe Lys Glu Ser Val Val Leu Val
Ala Ala Asn Gly Lys Thr65 70 75 80Leu Lys Lys Arg Arg Leu Ser Leu
Asn Gln Phe Ile Thr Asn Asp Asp 85 90 95Leu Glu Ala Ile Ala Asn Asp
Pro Glu Glu Gly Ile Ile Arg Pro Arg 100 105 110Ser Val His Tyr Asn
Phe Gln Ser Asn Thr Lys Tyr Asn Phe Met Arg 115 120 125Ile Val Asn
His Gln Cys Thr Leu Asn Asp Ala Leu Asn Gln Ser Val 130 135 140Ile
Arg Asp Thr Ser Gly Gln Tyr Leu Ala Thr Ala Ala Leu Asn Asn145 150
155 160Leu Asp Asp Ala Val Lys Phe Asp Met Gly Ala Tyr Thr Ser Glu
Glu 165 170 175Asp Ser Gln Leu Pro Val Thr Leu Arg Ile Ser Lys Thr
Arg Leu Phe 180 185 190Val Ser Ala Gln Asn Glu Asp Glu Pro Val Leu
Leu Lys Glu Met Pro 195 200 205Asp Thr Pro Lys Thr Ile Lys Asp Glu
Thr Asn Leu Leu Phe Phe Trp 210 215 220Glu Arg His Gly Ser Lys Asn
Tyr Phe Lys Ser Val Ala His Pro Lys225 230 235 240Leu Phe Ile Ala
Thr Lys Gln Gly Lys Leu Val His Met Ala Arg Gly 245 250 255Gln Pro
Ser Ile Thr Asp Phe Gln Ile Leu Asp Asn Gln Phe 260 265
27039268PRTOvis aries 39Met Ala Lys Val Pro Asp Leu Phe Glu Asp Leu
Lys Asn Cys Tyr Ser1 5 10 15Glu Asn Glu Asp Tyr Ser Ser Glu Ile Asp
His Leu Ser Leu Asn Gln 20 25 30Lys Ser Phe Tyr Asp Ala Ser Tyr Glu
Pro Leu Arg Glu Asp His Met 35 40 45Asn Lys Phe Met Ser Leu Asp Thr
Ser Glu Thr Ser Lys Thr Ser Arg 50 55 60Leu Ser Phe Lys Glu Asn Val
Val Met Met Thr Ala Asn Gly Lys Ile65 70 75 80Leu Lys Lys Arg Arg
Leu Ser Leu Asn Gln Phe Ile Thr Asp Asp Asp 85 90 95Leu Glu Ala Ile
Ala Asn Asp Thr Glu Glu Glu Ile Ile Lys Pro Arg 100 105 110Ser Ala
His Tyr Ser Phe Gln Ser Asn Val Lys Tyr Asn Phe Met Arg 115 120
125Val Ile His Gln Glu Cys Ile Leu Asn Asp Ala Leu Asn Gln Ser Ile
130 135 140Ile Arg Asp Met Ser Gly Pro Tyr Leu Thr Ala Ala Thr Leu
Asn Asn145 150 155 160Leu Glu Glu Ala Val Lys Phe Asp Met Val Ala
Tyr Val Ser Glu Glu 165 170 175Asp Ser Gln Leu Pro Val Thr Leu Arg
Ile Ser Lys Thr Gln Leu Phe 180 185 190Val Ser Ala Gln Asn Glu Asp
Glu Pro Val Leu Leu Lys Glu Met Pro 195 200 205Glu Thr Pro Lys Ile
Ile Lys Asp Glu Thr Asn Leu Leu Phe Phe Trp 210 215 220Glu Lys His
Gly Ser Met Asp Tyr Phe Lys Ser Val Ala His Pro Lys225 230 235
240Leu Phe Ile Ala Thr Lys Gln Glu Lys Leu Val His Met Ala Ser Gly
245 250 255Pro Pro Ser Ile Thr Asp Phe Gln Ile Leu Glu Lys 260
26540270PRTFelis catus 40Met Ala Lys Val Pro Asp Leu Phe Glu Asp
Leu Lys Asn Cys Tyr Ser1 5 10 15Glu Asn Glu Glu Tyr Ser Ser Glu Ile
Asp His Leu Thr Leu Asn Gln 20 25 30Lys Ser Phe Tyr Asp Ala Ser Tyr
Asp Pro Leu His Glu Asp Cys Thr 35 40 45Asp Lys Phe Met Ser Pro Ser
Thr Ser Glu Thr Ser Lys Thr Pro Gln 50 55 60Leu Thr Leu Lys Lys Ser
Val Val Met Val Ala Ala Asn Gly Lys Ile65 70 75 80Leu Lys Lys Arg
Arg Leu Ser Leu Asn Gln Phe Leu Thr Ala Asp Asp 85 90 95Leu Glu Ala
Ile Ala Asn Glu Val Glu Glu Glu Ile Met Lys Pro Arg 100 105 110Ser
Val Ala Pro Asn Phe Tyr Ser Ser Glu Lys Tyr Asn Tyr Gln Lys 115 120
125Ile Ile Lys Ser Gln Phe Ile Leu Asn Asp Asn Leu Ser Gln Ser Val
130 135 140Ile Arg Lys Ala Gly Gly Lys Tyr Leu Ala Ala Ala Ala Leu
Gln Asn145 150 155 160Leu Asp Asp Ala Val Lys Phe Asp Met Gly Ala
Tyr Thr Ser Lys Glu 165 170 175Asp Ser Lys Leu Pro Val Thr Leu Arg
Ile Ser Lys Thr Arg Leu Phe 180 185 190Val Ser Ala Gln Asn Glu Asp
Glu Pro Val Leu Leu Lys Glu Met Pro 195 200 205Glu Thr Pro Lys Thr
Ile Arg Asp Glu Thr Asn Leu Leu Phe Phe Trp 210 215 220Glu Arg His
Gly Ser Lys Asn Tyr Phe Lys Ser Val Ala His Pro Lys225 230 235
240Leu Phe Ile Ala Thr Gln Glu Glu Gln Leu Val His Met Ala Arg Gly
245 250 255Leu Pro Ser Val Thr Asp Phe Gln Ile Leu Glu Thr Gln Ser
260 265 27041268PRTBos taurus 41Met Ala Lys Val Pro Asp Leu Phe Glu
Asp Leu Lys Asn Cys Tyr Ser1 5 10 15Glu Asn Glu Asp Tyr Ser Ser Glu
Ile Asp His Leu Ser Leu Asn Gln 20 25 30Lys Ser Phe Tyr Asp Ala Ser
Tyr Glu Pro Leu Arg Glu Asp Gln Met 35 40 45Asn Lys Phe Met Ser Leu
Asp Thr Ser Glu Thr Ser Lys Thr Ser Lys 50 55 60Leu Ser Phe Lys Glu
Asn Val Val Met Val Ala Ala Ser Gly Lys Ile65 70 75 80Leu Lys Lys
Arg Arg Leu Ser Leu Asn Gln Phe Ile Thr Asp Asp Asp 85 90 95Leu Glu
Ala Ile Ala Asn Asn Thr Glu Glu Glu Ile Ile Lys Pro Arg 100 105
110Ser Ala His Tyr Ser Phe Gln Ser Asn Val Lys Tyr Asn Phe Met Arg
115 120 125Val Ile His Gln Glu Cys Ile Leu Asn Asp Ala Leu Asn Gln
Ser Ile 130 135 140Ile Arg Asp Met Ser Gly Pro Tyr Leu Thr Ala Thr
Thr Leu Asn Asn145 150 155 160Leu Glu Glu Ala Val Lys Phe Asp Met
Val Ala Tyr Val Ser Glu Glu 165 170 175Asp Ser Gln Leu Pro Val Thr
Leu Arg Ile Ser Lys Thr Gln Leu Phe 180 185 190Val Ser Ala Gln Asn
Glu Asp Glu Pro Val Leu Leu Lys Glu Met Pro 195 200 205Glu Thr Pro
Lys Ile Ile Lys Asp Glu Thr Asn Leu Leu Phe Phe Trp 210 215 220Glu
Lys His Gly Ser Met Asp Tyr Phe Lys Ser Val Ala His Pro Lys225 230
235 240Leu Phe Ile Ala Thr Lys Gln Glu Lys Leu Val His Met Ala Ser
Gly 245 250 255Pro Pro Ser Ile Thr Asp Phe Gln Ile Leu Glu Lys 260
26542270PRTSus scrofa 42Met Ala Lys Val Pro Asp Leu Phe Glu Asp Leu
Lys Asn Cys Tyr Ser1 5 10 15Glu Asn Glu Glu Tyr Ser Ser Asp Ile Asp
His Leu Ser Leu Asn Gln 20 25 30Lys Ser Phe Tyr Asp Ala Ser Tyr Glu
Pro Leu Pro Gly Asp Gly Met 35 40 45Asp Lys Phe Met Pro Leu Ser Thr
Ser Lys Thr Ser Lys Thr Ser Arg 50 55 60Leu Asn Phe Lys Asp Ser Val
Val Met Ala Ala Ala Asn Gly Lys Ile65 70 75 80Leu Lys Lys Arg Arg
Leu Ser Leu Asn Gln Phe Ile Thr Asp Asp Asp 85 90 95Leu Glu Ala Ile
Ala Asn Asp Thr Glu Glu Glu Ile Ile Lys Pro Arg 100 105 110Ser Ala
Thr Tyr Ser Phe Gln Ser Asn Met Lys Tyr Asn Phe Met Arg 115 120
125Val Ile Asn His Gln Cys Ile Leu Asn Asp Ala Arg Asn Gln Ser Ile
130 135 140Ile Arg Asp Pro Ser Gly Gln Tyr Leu Met Ala Ala Val Leu
Asn Asn145 150 155 160Leu Asp Glu Ala Val Lys Phe Asp Met Ala Ala
Tyr Thr Ser Asn Asp 165 170 175Asp Ser Gln Leu Pro Val Thr Leu Arg
Ile Ser Glu Thr Arg Leu Phe 180 185 190Val Ser Ala Gln Asn Glu Asp
Glu Pro Val Leu Leu Lys Glu Leu Pro 195 200 205Glu Thr Pro Lys Thr
Ile Lys Asp Glu Thr Ser Leu Leu Phe Phe Trp 210 215 220Glu Lys His
Gly Asn Met Asp Tyr Phe Lys Ser Ala Ala His Pro Lys225 230 235
240Leu Phe Ile Ala Thr Arg Gln Glu Lys Leu Val His Met Ala Pro Gly
245 250 255Leu Pro Ser Val Thr Asp Phe Gln Ile Leu Glu Asn Gln Ser
260 265 27043268PRTOryctolagus cuniculus 43Met Ala Lys Val Pro Asp
Leu Phe Glu Asp Leu Lys Asn Cys Phe Ser1 5 10 15Glu Asn Glu Glu Tyr
Ser Ser Ala Ile Asp His Leu Ser Leu Asn Gln 20 25 30Lys Ser Phe Tyr
Asp Ala Ser Tyr Glu Pro Leu His Glu Asp Cys Met 35 40 45Asn Lys Val
Val Ser Leu Ser Thr Ser Glu Thr Ser Val Ser Pro Asn 50 55 60Leu Thr
Phe Gln Glu Asn Val Val Ala Val Thr Ala Ser Gly Lys Ile65 70 75
80Leu Lys Lys Arg Arg Leu Ser Leu Asn Gln Pro Ile Thr Asp Val Asp
85 90 95Leu Glu Thr Asn Val Ser Asp Pro Glu Glu Gly Ile Ile Lys Pro
Arg 100 105 110Ser Val Pro Tyr Thr Phe Gln Arg Asn Met Arg Tyr Lys
Tyr Leu Arg 115 120 125Ile Ile Lys Gln Glu Phe Thr Leu Asn Asp Ala
Leu Asn Gln Ser Leu 130 135 140Val Arg Asp Thr Ser Asp Gln Tyr Leu
Arg Ala Ala Pro Leu Gln Asn145 150 155 160Leu Gly Asp Ala Val Lys
Phe Asp Met Gly Val Tyr Met Thr Ser Lys 165 170 175Glu Asp Ser Ile
Leu Pro Val Thr Leu Arg Ile Ser Gln Thr Pro Leu 180 185 190Phe Val
Ser Ala Gln Asn Glu Asp Glu Pro Val Leu Leu Lys Glu Met 195 200
205Pro Glu Thr Pro Arg Ile Ile Thr Asp Ser Glu Ser Asp Ile Leu Phe
210 215 220Phe Trp Glu Thr Gln Gly Asn Lys Asn Tyr Phe Lys Ser Ala
Ala Asn225 230 235 240Pro Gln Leu Phe Ile Ala Thr Lys Pro Glu His
Leu Val His Met Ala 245 250 255Arg Gly Leu Pro Ser Met Thr Asp Phe
Gln Ile Ser 260 26544265PRTCanis familiaris 44Met Ala Lys Val Pro
Asp Leu Phe Glu Asp Leu Lys Asn Cys Tyr Ser1 5 10 15Glu Asn Glu Glu
Tyr Ser Ser Glu Ile Asp His Leu Ser Leu Asn Gln 20 25 30Lys Ser Phe
Tyr Asp Met Ser Cys Asp Pro Leu His Glu Asp Cys Met 35 40 45Ser Leu
Ser Thr Ser Glu Ile Ser Lys Thr Ser Gln Leu Thr Phe Lys 50 55 60Glu
Asn Val Val Val Val Ala Ala Asn Gly Lys Ile Leu Lys Lys Arg65 70 75
80Arg Leu Ser Leu Ser Gln Phe Ile Thr Asp Asp Asp Leu Glu Gly Ile
85 90 95Ala Asn Asp Thr Glu Glu Val Ile Met Lys Pro Arg Ser Val Ala
Tyr 100 105 110Asn Phe His Asn Asn Glu Lys Tyr Asn Tyr Ile Arg Ile
Ile Lys Ser 115 120 125Gln Phe Ile Leu Asn Asp Asn Leu Asn Gln Ser
Ile Val Arg Gln Thr 130 135 140Gly Gly Asn Tyr Leu Met Thr Ala Ala
Leu Gln Asn Leu Asp Asp Ala145 150 155 160Val Lys Phe Asp Met Gly
Ala Tyr Thr Ser Glu Asp Ser Lys Leu Pro 165 170 175Val Thr Leu Arg
Ile Ser Lys Thr Arg Leu Phe Val Ser Ala Gln Asn 180 185 190Glu Asp
Glu Pro Val Leu Leu Lys Glu Met Pro Glu Thr Pro Lys Thr 195 200
205Ile Arg Asp Glu Thr Asn Leu Leu Phe Phe Trp Glu Arg His Gly Ser
210 215 220Lys His Tyr Phe Lys Ser Val Ala Gln Pro Lys Leu Phe Ile
Ala Thr225 230 235 240Gln Glu Arg Lys Leu Val His Met Ala Arg Gly
Gln Pro Ser Ile Thr 245 250 255Asp Phe Arg Leu Leu Glu Thr Gln Pro
260 26545270PRTMus musculus 45Met Ala Lys Val Pro Asp Leu Phe Glu
Asp Leu Lys Asn Cys Tyr Ser1 5 10 15Glu Asn Glu Asp Tyr Ser Ser Ala
Ile Asp His Leu Ser Leu Asn Gln 20 25 30Lys Ser Phe Tyr Asp Ala Ser
Tyr Gly Ser Leu His Glu Thr Cys Thr 35 40 45Asp Gln Phe Val Ser Leu
Arg Thr Ser Glu Thr Ser Lys Met Ser Asn 50 55 60Phe Thr Phe Lys Glu
Ser Arg Val Thr Val Ser Ala Thr Ser Ser Asn65 70 75 80Gly Lys Ile
Leu Lys Lys Arg Arg Leu Ser Phe Ser Glu Thr Phe Thr 85 90 95Glu Asp
Asp Leu Gln Ser Ile Thr His Asp Leu Glu Glu
Thr Ile Gln 100 105 110Pro Arg Ser Ala Pro Tyr Thr Tyr Gln Ser Asp
Leu Arg Tyr Lys Leu 115 120 125Met Lys Leu Val Arg Gln Lys Phe Val
Met Asn Asp Ser Leu Asn Gln 130 135 140Thr Ile Tyr Gln Asp Val Asp
Lys His Tyr Leu Ser Thr Thr Trp Leu145 150 155 160Asn Asp Leu Gln
Gln Glu Val Lys Phe Asp Met Tyr Ala Tyr Ser Ser 165 170 175Gly Gly
Asp Asp Ser Lys Tyr Pro Val Thr Leu Lys Ile Ser Asp Ser 180 185
190Gln Leu Phe Val Ser Ala Gln Gly Glu Asp Gln Pro Val Leu Leu Lys
195 200 205Glu Leu Pro Glu Thr Pro Lys Leu Ile Thr Gly Ser Glu Thr
Asp Leu 210 215 220Ile Phe Phe Trp Lys Ser Ile Asn Ser Lys Asn Tyr
Phe Thr Ser Ala225 230 235 240Ala Tyr Pro Glu Leu Phe Ile Ala Thr
Lys Glu Gln Ser Arg Val His 245 250 255Leu Ala Arg Gly Leu Pro Ser
Met Thr Asp Phe Gln Ile Ser 260 265 27046270PRTRattus norvegicus
46Met Ala Lys Val Pro Asp Leu Phe Glu Asp Leu Lys Asn Cys Tyr Ser1
5 10 15Glu Asn Glu Glu Tyr Ser Ser Ala Ile Asp His Leu Ser Leu Asn
Gln 20 25 30Lys Ser Phe Tyr Asp Ala Ser Tyr Gly Ser Leu His Glu Asn
Cys Thr 35 40 45Asp Lys Phe Val Ser Leu Arg Thr Ser Glu Thr Ser Lys
Met Ser Thr 50 55 60Phe Thr Phe Lys Glu Ser Arg Val Val Val Ser Ala
Thr Ser Asn Lys65 70 75 80Gly Lys Ile Leu Lys Lys Arg Arg Leu Ser
Phe Asn Gln Pro Phe Thr 85 90 95Glu Asp Asp Leu Glu Ala Ile Ala His
Asp Leu Glu Glu Thr Ile Gln 100 105 110Pro Arg Ser Ala Pro His Ser
Phe Gln Asn Asn Leu Arg Tyr Lys Leu 115 120 125Ile Arg Ile Val Lys
Gln Glu Phe Ile Met Asn Asp Ser Leu Asn Gln 130 135 140Asn Ile Tyr
Val Asp Met Asp Arg Ile His Leu Lys Ala Ala Ser Leu145 150 155
160Asn Asp Leu Gln Leu Glu Val Lys Phe Asp Met Tyr Ala Tyr Ser Ser
165 170 175Gly Gly Asp Asp Ser Lys Tyr Pro Val Thr Leu Lys Val Ser
Asn Thr 180 185 190Gln Leu Phe Val Ser Ala Gln Gly Glu Asp Lys Pro
Val Leu Leu Lys 195 200 205Glu Ile Pro Glu Thr Pro Lys Leu Ile Thr
Gly Ser Glu Thr Asp Leu 210 215 220Ile Phe Phe Trp Glu Lys Ile Asn
Ser Lys Asn Tyr Phe Thr Ser Ala225 230 235 240Ala Phe Pro Glu Leu
Leu Ile Ala Thr Lys Glu Gln Ser Gln Val His 245 250 255Leu Ala Arg
Gly Leu Pro Ser Met Ile Asp Phe Gln Ile Ser 260 265
27047152PRTGorilla gorilla 47Lys Asn Cys Tyr Ser Glu Asn Glu Glu
Asp Ser Ser Ser Ile Asp His1 5 10 15Leu Ser Leu Asn Gln Lys Ser Phe
Tyr His Val Thr Tyr Gly Pro Leu 20 25 30His Glu Gly Cys Met Asp Gln
Ser Val Ser Leu Ser Ile Ser Glu Thr 35 40 45Ser Lys Thr Ser Lys Leu
Thr Phe Lys Glu Ser Met Val Val Val Ala 50 55 60Thr Asn Gly Lys Val
Leu Lys Lys Arg Arg Leu Ser Leu Ser Gln Ser65 70 75 80Ile Thr Asp
Asp Asp Leu Glu Ala Ile Ala Asn Asp Ser Glu Glu Glu 85 90 95Ile Ile
Lys Pro Arg Ser Ala Pro Phe Ser Phe Leu Ser Asn Val Lys 100 105
110Tyr Asn Phe Met Arg Ile Ile Lys Asn Glu Phe Ile Leu Asn Asp Ala
115 120 125Leu Asn Gln Ser Ile Ile Arg Ala Asn Asp Gln Tyr Leu Thr
Ala Ala 130 135 140Ala Leu His Asn Leu Asp Glu Ala145
15048204PRTCavia porcellus 48Phe Glu Asp Leu Lys Asn Cys Tyr Ser
Glu Asn Glu Glu Tyr Ala Ser1 5 10 15Ala Ile Asp His Leu Ser Leu Asn
Gln Lys Ser Phe Tyr Asp Thr Asn 20 25 30Tyr Asp Pro Leu His Glu Asn
Arg Val Asp Glu Pro Val Ser Pro Asn 35 40 45Pro Tyr Glu Asn Ser Glu
Glu Ser Asn Phe Thr Leu Glu Asp Ser Ser 50 55 60Asp Ser Ser Ala Val
Val Leu Thr Ser Ala His Gly Glu Val Leu Lys65 70 75 80Lys Arg Arg
Leu Ser Leu Asn Gln Thr Met Ser Asn Glu Asp Leu Glu 85 90 95Ala Ile
Ala Asn Asp Ser Glu Glu Glu Ile Ile Glu Pro Trp Ser Val 100 105
110Pro Tyr Ser Phe Gln Ser Asn Leu Lys Phe Lys Tyr Gln Arg Ser Ile
115 120 125Lys Lys Gly Ala Val Ile Thr Asp Ala Met His Gln Ser Leu
Ile Arg 130 135 140Glu Ser Asn Gly Gln His Leu Lys Ala Met His Val
Val Asp Arg Lys145 150 155 160His Glu Val Lys Phe Asp Ile Asp Gly
Tyr Val Ser Thr Ala Thr Arg 165 170 175Ile Arg Pro Val Thr Leu Lys
Ile Ser Lys Thr Gln Leu Tyr Val Cys 180 185 190Ala Gln Glu Glu Gly
Gln Pro Val Leu Leu Lys Glu 195 20049269PRTHomo sapiens 49Met Ala
Glu Val Pro Glu Leu Ala Ser Glu Met Met Ala Tyr Tyr Ser1 5 10 15Gly
Asn Glu Asp Asp Leu Phe Phe Glu Ala Asp Gly Pro Lys Gln Met 20 25
30Lys Cys Ser Phe Gln Asp Leu Asp Leu Cys Pro Leu Asp Gly Gly Ile
35 40 45Gln Leu Arg Ile Ser Asp His His Tyr Ser Lys Gly Phe Arg Gln
Ala 50 55 60Ala Ser Val Val Val Ala Met Asp Lys Leu Arg Lys Met Leu
Val Pro65 70 75 80Cys Pro Gln Thr Phe Gln Glu Asn Asp Leu Ser Thr
Phe Phe Pro Phe 85 90 95Ile Phe Glu Glu Glu Pro Ile Phe Phe Asp Thr
Trp Asp Asn Glu Ala 100 105 110Tyr Val His Asp Ala Pro Val Arg Ser
Leu Asn Cys Thr Leu Arg Asp 115 120 125Ser Gln Gln Lys Ser Leu Val
Met Ser Gly Pro Tyr Glu Leu Lys Ala 130 135 140Leu His Leu Gln Gly
Gln Asp Met Glu Gln Gln Val Val Phe Ser Met145 150 155 160Ser Phe
Val Gln Gly Glu Glu Ser Asn Asp Lys Ile Pro Val Ala Leu 165 170
175Gly Leu Lys Glu Lys Asn Leu Tyr Leu Ser Cys Val Leu Lys Asp Asp
180 185 190Lys Pro Thr Leu Gln Leu Glu Ser Val Asp Pro Lys Asn Tyr
Pro Lys 195 200 205Lys Lys Met Glu Lys Arg Phe Val Phe Asn Lys Ile
Glu Ile Asn Asn 210 215 220Lys Leu Glu Phe Glu Ser Ala Gln Phe Pro
Asn Trp Tyr Ile Ser Thr225 230 235 240Ser Gln Ala Glu Asn Met Pro
Val Phe Leu Gly Gly Thr Lys Gly Gly 245 250 255Gln Asp Ile Thr Asp
Phe Thr Met Gln Phe Val Ser Ser 260 26550193PRTPan troglodytes
50Met Leu Val Pro Cys Pro Gln Thr Phe Gln Glu Asn Asp Leu Ser Thr1
5 10 15Phe Phe Pro Phe Ile Phe Glu Glu Glu Pro Ile Phe Phe Asp Thr
Trp 20 25 30Glu Asn Glu Ala Tyr Val His Asp Ala Pro Val Arg Ser Leu
Asn Cys 35 40 45Thr Leu Arg Asp Ser Gln Gln Lys Ser Leu Val Met Ser
Gly Pro Tyr 50 55 60Glu Leu Lys Ala Leu His Leu Gln Gly Gln Asp Met
Glu Gln Gln Val65 70 75 80Val Phe Ser Met Ser Phe Val Gln Gly Glu
Glu Ser Asn Asp Lys Ile 85 90 95Pro Val Ala Leu Gly Leu Lys Glu Lys
Asn Leu Tyr Leu Ser Cys Val 100 105 110Leu Lys Asp Asp Lys Pro Thr
Leu Gln Leu Glu Ser Val Asp Pro Lys 115 120 125Asn Tyr Pro Lys Lys
Lys Met Glu Lys Arg Phe Val Phe Asn Lys Ile 130 135 140Glu Ile Asn
Asn Lys Leu Glu Phe Glu Ser Ala Gln Phe Pro Asn Trp145 150 155
160Tyr Ile Ser Thr Ser Gln Ala Glu Asn Met Pro Val Phe Leu Gly Gly
165 170 175Thr Lys Gly Gly Gln Asp Ile Thr Asp Phe Thr Met Gln Phe
Val Ser 180 185 190Ser51269PRTMacaca mulatta 51Met Ala Glu Val Pro
Glu Leu Ala Ser Glu Met Met Ala Tyr Tyr Ser1 5 10 15Gly Asn Glu Asp
Asp Leu Phe Phe Asp Val Asp Gly Pro Lys Gln Met 20 25 30Lys Cys Ser
Phe Gln Asp Leu Asp Leu Cys Pro Leu Gly Gly Gly Ile 35 40 45Gln Leu
Gln Ile Ser His Glu His Tyr Asn Glu Gly Phe Arg Gln Ala 50 55 60Val
Ser Val Val Val Ala Met Glu Lys Leu Arg Lys Met Leu Val Pro65 70 75
80Cys Pro Gln Ile Phe Gln Asp Asn Asp Leu Ser Thr Leu Ile Pro Phe
85 90 95Ile Phe Glu Glu Glu Pro Val Phe Leu Asp Thr Arg Asn Asn Asp
Ala 100 105 110Cys Val His Asp Ala Pro Val Arg Ser Leu His Cys Thr
Leu Arg Asp 115 120 125Ala Gln Leu Lys Ser Leu Val Met Ser Gly Pro
Tyr Glu Leu Lys Ala 130 135 140Leu His Leu Gln Gly Gln Asp Leu Glu
Gln Gln Val Val Phe Ser Met145 150 155 160Ser Phe Val Gln Gly Glu
Glu Ser Asn Asp Lys Ile Pro Val Ala Leu 165 170 175Gly Leu Lys Ala
Lys Asn Leu Tyr Leu Ser Cys Val Leu Lys Asp Asp 180 185 190Lys Pro
Thr Leu Gln Leu Glu Ser Val Asp Pro Lys Asn Tyr Pro Lys 195 200
205Lys Lys Met Glu Lys Arg Phe Val Phe Asn Lys Ile Glu Ile Asn Asn
210 215 220Lys Leu Glu Phe Glu Ser Ala Gln Phe Pro Asn Trp Tyr Ile
Ser Thr225 230 235 240Ser Gln Ala Glu Asn Met Pro Val Phe Leu Gly
Gly Thr Arg Gly Gly 245 250 255Gln Asp Ile Thr Asp Phe Thr Met Gln
Phe Val Ser Ser 260 26552268PRTOryctolagus cunicullus 52Met Ala Thr
Val Pro Glu Leu Thr Ser Glu Met Met Ala Tyr His Ser1 5 10 15Gly Asn
Glu Asn Asp Leu Phe Phe Glu Ala Asp Gly Pro Asn Tyr Met 20 25 30Lys
Ser Cys Phe Gln Asp Leu Asp Leu Cys Cys Pro Asp Glu Gly Ile 35 40
45Gln Leu Arg Ile Ser Cys Gln Pro Tyr Asn Lys Ser Phe Arg Gln Val
50 55 60Leu Ser Val Val Val Ala Leu Glu Lys Leu Arg Gln Lys Ala Val
Pro65 70 75 80Cys Pro Gln Ala Phe Gln Asp Asp Gly Leu Arg Thr Phe
Phe Ser Leu 85 90 95Ile Phe Glu Glu Glu Pro Val Leu Cys Asn Thr Trp
Asp Asp Tyr Ser 100 105 110Leu Glu Cys Asp Ala Val Arg Ser Leu His
Cys Arg Leu Gln Asp Ala 115 120 125Gln Gln Lys Ser Leu Val Leu Ser
Gly Thr Tyr Glu Leu Lys Ala Leu 130 135 140His Leu Asn Ala Glu Asn
Leu Asn Gln Gln Val Val Phe Ser Met Ser145 150 155 160Phe Val Gln
Gly Glu Glu Ser Asn Asp Lys Ile Pro Val Ala Leu Gly 165 170 175Leu
Arg Gly Lys Asn Leu Tyr Leu Ser Cys Val Met Lys Asp Asp Lys 180 185
190Pro Thr Leu Gln Leu Glu Ser Val Asp Pro Asn Arg Tyr Pro Lys Lys
195 200 205Lys Met Glu Lys Arg Phe Val Phe Asn Lys Ile Glu Ile Lys
Asp Lys 210 215 220Leu Glu Phe Glu Ser Ala Gln Phe Pro Asn Trp Tyr
Ile Ser Thr Ser225 230 235 240Gln Thr Glu Tyr Met Pro Val Phe Leu
Gly Asn Asn Ser Gly Gly Gln 245 250 255Asp Leu Ile Asp Phe Ser Met
Glu Phe Val Ser Ser 260 26553269PRTMus musculus 53Met Ala Thr Val
Pro Glu Leu Asn Cys Glu Met Pro Pro Phe Asp Ser1 5 10 15Asp Glu Asn
Asp Leu Phe Phe Glu Val Asp Gly Pro Gln Lys Met Lys 20 25 30Gly Cys
Phe Gln Thr Phe Asp Leu Gly Cys Pro Asp Glu Ser Ile Gln 35 40 45Leu
Gln Ile Ser Gln Gln His Ile Asn Lys Ser Phe Arg Gln Ala Val 50 55
60Ser Leu Ile Val Ala Val Glu Lys Leu Trp Gln Leu Pro Val Ser Phe65
70 75 80Pro Trp Thr Phe Gln Asp Glu Asp Met Ser Thr Phe Phe Ser Phe
Ile 85 90 95Phe Glu Glu Glu Pro Ile Leu Cys Asp Ser Trp Asp Asp Asp
Asp Asn 100 105 110Leu Leu Val Cys Asp Val Pro Ile Arg Gln Leu His
Tyr Arg Leu Arg 115 120 125Asp Glu Gln Gln Lys Ser Leu Val Leu Ser
Asp Pro Tyr Glu Leu Lys 130 135 140Ala Leu His Leu Asn Gly Gln Asn
Ile Asn Gln Gln Val Ile Phe Ser145 150 155 160Met Ser Phe Val Gln
Gly Glu Pro Ser Asn Asp Lys Ile Pro Val Ala 165 170 175Leu Gly Leu
Lys Gly Lys Asn Leu Tyr Leu Ser Cys Val Met Lys Asp 180 185 190Gly
Thr Pro Thr Leu Gln Leu Glu Ser Val Asp Pro Lys Gln Tyr Pro 195 200
205Lys Lys Lys Met Glu Lys Arg Phe Val Phe Asn Lys Ile Glu Val Lys
210 215 220Ser Lys Val Glu Phe Glu Ser Ala Glu Phe Pro Asn Trp Tyr
Ile Ser225 230 235 240Thr Ser Gln Ala Glu His Lys Pro Val Phe Leu
Gly Asn Asn Ser Gly 245 250 255Gln Asp Ile Ile Asp Phe Thr Met Glu
Ser Val Ser Ser 260 26554268PRTRattus norvegicus 54Met Ala Thr Val
Pro Glu Leu Asn Cys Glu Ile Ala Ala Phe Asp Ser1 5 10 15Glu Glu Asn
Asp Leu Phe Phe Glu Ala Asp Arg Pro Gln Lys Ile Lys 20 25 30Asp Cys
Phe Gln Ala Leu Asp Leu Gly Cys Pro Asp Glu Ser Ile Gln 35 40 45Leu
Gln Ile Ser Gln Gln His Leu Asp Lys Ser Phe Arg Lys Ala Val 50 55
60Ser Leu Ile Val Ala Val Glu Lys Leu Trp Gln Leu Pro Met Ser Cys65
70 75 80Pro Trp Ser Phe Gln Asp Glu Asp Pro Ser Thr Phe Phe Ser Phe
Ile 85 90 95Phe Glu Glu Glu Pro Val Leu Cys Asp Ser Trp Asp Asp Asp
Asp Leu 100 105 110Leu Val Cys Asp Val Pro Ile Arg Gln Leu His Cys
Arg Leu Arg Asp 115 120 125Glu Gln Gln Lys Cys Leu Val Leu Ser Asp
Pro Cys Glu Leu Lys Ala 130 135 140Leu His Leu Asn Gly Gln Asn Ile
Ser Gln Gln Val Val Phe Ser Met145 150 155 160Ser Phe Val Gln Gly
Glu Thr Ser Asn Asp Lys Ile Pro Val Ala Leu 165 170 175Gly Leu Lys
Gly Leu Asn Leu Tyr Leu Ser Cys Val Met Lys Asp Gly 180 185 190Thr
Pro Thr Leu Gln Leu Glu Ser Val Asp Pro Lys Gln Tyr Pro Lys 195 200
205Lys Lys Met Glu Lys Arg Phe Val Phe Asn Lys Ile Glu Val Lys Thr
210 215 220Lys Val Glu Phe Glu Ser Ala Gln Phe Pro Asn Trp Tyr Ile
Ser Thr225 230 235 240Ser Gln Ala Glu His Arg Pro Val Phe Leu Gly
Asn Ser Asn Gly Arg 245 250 255Asp Ile Val Asp Phe Thr Met Glu Pro
Val Ser Ser 260 26555268PRTEquus caballus 55Met Ala Ala Val Pro Asp
Thr Ser Asp Met Met Thr Tyr Cys Ser Gly1 5 10 15Asn Glu Asn Asp Leu
Phe Phe Glu Glu Asp Gly Pro Lys Gln Met Lys 20 25 30Gly Ser Phe Gln
Asp Leu Asp Leu Ser Ser Met Gly Asn Gly Gly Ile 35 40 45Gln Leu Gln
Phe Ser His Gln Leu Tyr Asn Lys Thr Phe Lys His Val 50 55 60Val Ser
Ile Ile Val Ala Met Glu Lys Leu Lys Lys Ile Pro Val Pro65 70 75
80Cys Ser Gln Ala Phe Gln Asp Asp Asp Leu Arg Ser Leu Phe Ser Val
85 90 95Ile Phe Glu Glu Glu Pro Ile Ile Cys Asp Asn Trp Asp Asp Asp
Tyr 100 105 110Val Cys Asp Ala Ala Val His Ser Val Asn Cys Arg
Leu Arg Asp Ile 115 120 125Tyr His Lys Ser Leu Val Leu Ser Gly Ala
Cys Glu Leu Gln Ala Val 130 135 140His Leu Asn Gly Glu Asn Thr Asn
Gln Gln Val Val Phe Cys Met Ser145 150 155 160Phe Val Gln Gly Glu
Glu Glu Thr Asp Lys Ile Pro Val Ala Leu Gly 165 170 175Leu Lys Glu
Lys Asn Leu Tyr Leu Ser Cys Gly Met Lys Asp Gly Lys 180 185 190Pro
Thr Leu Gln Leu Glu Thr Val Asp Pro Asn Thr Tyr Pro Lys Arg 195 200
205Lys Met Glu Lys Arg Phe Val Phe Asn Lys Met Glu Ile Lys Gly Asn
210 215 220Val Glu Phe Glu Ser Ala Met Tyr Pro Asn Trp Tyr Ile Ser
Thr Ser225 230 235 240Gln Ala Glu Lys Lys Pro Val Phe Leu Gly Asn
Thr Arg Gly Gly Arg 245 250 255Asp Ile Thr Asp Phe Ile Met Glu Ile
Thr Ser Ala 260 26556267PRTFelis catus 56Met Ala Pro Val Pro Glu
Leu Thr Ser Glu Met Met Ala Tyr Tyr Ser1 5 10 15Asp Glu Asn Asp Leu
Phe Phe Glu Ala Asp Gly Pro Glu Lys Met Lys 20 25 30Gly Ser Leu Gln
Asn Leu Ser His Ser Phe Leu Gly Asp Glu Gly Ile 35 40 45Gln Leu Gln
Ile Ser His Gln Pro Asp Asn Lys Ser Leu Arg His Ala 50 55 60Val Ser
Val Ile Val Ala Met Glu Lys Leu Lys Lys Ile Ser Phe Ala65 70 75
80Cys Ser Gln Pro Leu Gln Asp Glu Asp Leu Lys Ser Leu Phe Cys Cys
85 90 95Ile Phe Glu Glu Glu Pro Ile Ile Cys Asp Thr Trp Asp Asp Gly
Phe 100 105 110Val Cys Asp Ala Ala Ile Gln Ser Gln Asp Tyr Thr Phe
Arg Asp Ile 115 120 125Ser Gln Lys Ser Leu Val Leu Ser Gly Ser Tyr
Glu Leu Arg Ala Leu 130 135 140His Leu Asn Gly Gln Asn Met Asn Gln
Gln Val Val Phe Arg Met Ser145 150 155 160Phe Val His Gly Glu Glu
Asn Ser Lys Lys Ile Pro Val Val Leu Cys 165 170 175Ile Lys Lys Asn
Asn Leu Tyr Leu Ser Cys Val Met Lys Asp Gly Lys 180 185 190Pro Thr
Leu Gln Leu Glu Met Leu Asp Pro Lys Val Tyr Pro Lys Lys 195 200
205Lys Met Glu Lys Arg Phe Val Phe Asn Lys Thr Glu Ile Lys Gly Asn
210 215 220Val Glu Phe Glu Ser Ser Gln Phe Pro Asn Trp Tyr Ile Ser
Thr Ser225 230 235 240Gln Ala Glu Glu Met Pro Val Phe Leu Gly Asn
Thr Lys Gly Gly Gln 245 250 255Asp Ile Thr Asp Phe Ile Met Glu Ser
Ala Ser 260 26557267PRTSus scrofa 57Met Ala Thr Val Pro Glu Pro Ala
Lys Glu Val Met Ala Asn Asn Gly1 5 10 15Asp Asn Asn Asn Asp Leu Leu
Phe Glu Ala Asp Gly Pro Lys Glu Met 20 25 30Lys Cys Arg Thr Gln Asn
Leu Asp Leu Ser Pro Leu Gly Asp Gly Ser 35 40 45Ile Gln Leu Gln Ile
Ser His Gln Leu Cys Asn Glu Ser Ser Arg Pro 50 55 60Met Val Ser Val
Ile Val Ala Lys Glu Glu Pro Met Asn Pro Ser Ser65 70 75 80Gln Val
Val Cys Asp Asp Asp Pro Lys Ser Ile Phe Ser Ser Val Phe 85 90 95Glu
Glu Glu Pro Ile Val Leu Glu Lys His Ala Asn Gly Phe Leu Cys 100 105
110Asp Ala Thr Pro Val Gln Ser Val Asp Cys Lys Leu Gln Asp Lys Asp
115 120 125Glu Lys Ala Leu Val Leu Ala Gly Pro His Glu Leu Lys Ala
Leu His 130 135 140Leu Leu Lys Gly Asp Leu Lys Arg Glu Val Val Phe
Cys Met Ser Phe145 150 155 160Val Gln Gly Asp Asp Ser Asp Asp Lys
Ile Pro Val Thr Leu Gly Ile 165 170 175Lys Gly Lys Asn Leu Tyr Leu
Ser Cys Val Met Lys Asp Asp Thr Pro 180 185 190Thr Leu Gln Leu Glu
Asp Val Asp Pro Lys Ser Tyr Pro Lys Arg Asp 195 200 205Met Glu Lys
Arg Phe Val Phe Tyr Lys Thr Glu Ile Lys Asn Arg Val 210 215 220Glu
Phe Glu Ser Ala Leu Tyr Pro Asn Trp Tyr Ile Ser Thr Ser Gln225 230
235 240Ala Glu Gln Lys Pro Val Phe Leu Gly Asn Ser Lys Gly Arg Gln
Asp 245 250 255Ile Thr Asp Phe Thr Met Glu Val Leu Ser Pro 260
26558266PRTCavia porcellus 58Met Ala Ala Val Pro Glu Leu Ser Ser
Glu Val Thr Ala Tyr His Ser1 5 10 15Asp Glu Asn Glu Leu Phe Phe Glu
Val Asp Gly Pro Asn Lys Met Gln 20 25 30Tyr Cys Phe Gln Asp Arg Asp
Leu Cys Ser Leu Asp Glu Gly Ile Lys 35 40 45Leu Gln Ile Ser His Gln
His Phe Asn Lys Ser Phe Arg Gln Thr Val 50 55 60Ser Leu Ile Val Ala
Val Glu Lys Leu Arg Lys Lys Leu Ala Pro Cys65 70 75 80Thr Trp Ala
Phe Gln Asp Asp Asp Leu Arg Pro Leu Leu Pro Phe Ile 85 90 95Phe Glu
Glu Glu Pro Ile Val Cys Asp Thr Trp Asp Glu Glu Tyr Glu 100 105
110Ser Asp Thr Pro Val Pro Ser Arg Asn Cys Thr Leu His Asp Ile Gln
115 120 125His Lys Arg Leu Val Leu Ser Asp Pro Cys Glu Leu Lys Ala
Leu His 130 135 140Leu Asn Gly Asp Asn Leu Asn Arg Gln Val Val Phe
Ser Met Ser Phe145 150 155 160Val Gln Gly Glu Arg Ser Asp Asn Lys
Met Pro Val Ala Leu Gly Leu 165 170 175Lys Gly Lys Asn Leu Tyr Leu
Ser Cys Val Met Lys Asp Gly Lys Pro 180 185 190Val Leu Gln Leu Glu
Ser Val Asp Gly Lys Gln Tyr Pro Lys Lys Lys 195 200 205Met Glu Lys
Arg Phe Val Phe Asn Lys Ile Thr Ser Lys Ser Thr Val 210 215 220Glu
Phe Glu Ser Ala Gln Phe Pro Asn Trp Tyr Ile Ser Thr Ser Gln225 230
235 240Ala Glu His Lys Pro Val Phe Leu Gly Asn Asn Asn Gly Gln Asp
Ile 245 250 255Ile Asp Phe Lys Leu Glu Leu Val Ser Ser 260
26559266PRTBos taurus 59Met Ala Thr Val Pro Glu Pro Ile Asn Glu Met
Met Ala Tyr Tyr Ser1 5 10 15Asp Glu Asn Glu Leu Leu Phe Glu Ala Asp
Asp Pro Lys Gln Met Lys 20 25 30Ser Cys Ile Gln His Leu Asp Leu Gly
Ser Met Gly Asp Gly Asn Ile 35 40 45Gln Leu Gln Ile Ser His Gln Phe
Tyr Asn Lys Ser Phe Arg Gln Val 50 55 60Val Ser Val Ile Val Ala Met
Glu Lys Leu Arg Asn Ser Ala Tyr Ala65 70 75 80His Val Phe His Asp
Asp Asp Leu Arg Ser Ile Leu Ser Phe Ile Phe 85 90 95Glu Glu Glu Pro
Val Ile Phe Glu Thr Ser Ser Asp Glu Phe Leu Cys 100 105 110Asp Ala
Pro Val Gln Ser Ile Lys Cys Lys Leu Gln Asp Arg Glu Gln 115 120
125Lys Ser Leu Val Leu Ala Ser Pro Cys Val Leu Lys Ala Leu His Leu
130 135 140Leu Ser Gln Glu Met Asn Arg Glu Val Val Phe Cys Met Ser
Phe Val145 150 155 160Gln Gly Glu Glu Arg Asp Asn Lys Ile Pro Val
Ala Leu Gly Ile Lys 165 170 175Asp Lys Asn Leu Tyr Leu Ser Cys Val
Lys Lys Gly Asp Thr Pro Thr 180 185 190Leu Gln Leu Glu Glu Val Asp
Pro Lys Val Tyr Pro Lys Arg Asn Met 195 200 205Glu Lys Arg Phe Val
Phe Tyr Lys Thr Glu Ile Lys Asn Thr Val Glu 210 215 220Phe Glu Ser
Val Leu Tyr Pro Asn Trp Tyr Ile Ser Thr Ser Gln Ile225 230 235
240Glu Glu Arg Pro Val Phe Leu Gly His Phe Arg Gly Gly Gln Asp Ile
245 250 255Thr Asp Phe Arg Met Glu Thr Leu Ser Pro 260
26560266PRTOvis aries 60Met Ala Thr Val Pro Glu Pro Ile Asn Glu Val
Met Ala Tyr Tyr Ser1 5 10 15Asp Glu Asn Glu Leu Leu Phe Glu Val Asp
Gly Pro Lys Gln Met Lys 20 25 30Ser Cys Thr Gln His Leu Asp Leu Gly
Ser Met Gly Asp Gly Asn Ile 35 40 45Gln Leu Gln Ile Ser His Gln Leu
Tyr Asn Lys Ser Phe Arg Gln Val 50 55 60Val Ser Val Ile Val Ala Met
Glu Lys Leu Arg Ser Arg Ala Tyr Glu65 70 75 80His Val Phe Arg Asp
Asp Asp Leu Arg Ser Ile Leu Ser Phe Ile Phe 85 90 95Glu Glu Glu Pro
Val Ile Phe Glu Thr Ser Ser Asp Glu Leu Leu Cys 100 105 110Asp Ala
Ala Val Gln Ser Val Lys Cys Lys Leu Gln Asp Arg Glu Gln 115 120
125Lys Ser Leu Val Leu Asp Ser Pro Cys Val Leu Lys Ala Leu His Leu
130 135 140Pro Ser Gln Glu Met Ser Arg Glu Val Val Phe Cys Met Ser
Phe Val145 150 155 160Gln Gly Glu Glu Arg Asp Asn Lys Ile Pro Val
Ala Leu Gly Ile Arg 165 170 175Asp Lys Asn Leu Tyr Leu Ser Cys Val
Lys Lys Gly Asp Thr Pro Thr 180 185 190Leu Gln Leu Glu Glu Val Asp
Pro Lys Val Tyr Pro Lys Arg Asn Met 195 200 205Glu Lys Arg Phe Val
Phe Tyr Lys Thr Glu Ile Lys Asn Thr Val Glu 210 215 220Phe Glu Ser
Val Leu Tyr Pro Asn Trp Tyr Ile Ser Thr Ser Gln Ile225 230 235
240Glu Glu Lys Pro Val Phe Leu Gly Arg Phe Arg Gly Gly Gln Asp Ile
245 250 255Thr Asp Phe Arg Met Glu Thr Leu Ser Pro 260
26561267PRTGallus gallus 61Met Ala Phe Val Pro Asp Leu Asp Val Leu
Glu Ser Ser Ser Leu Ser1 5 10 15Glu Glu Thr Phe Tyr Gly Pro Ser Cys
Leu Cys Leu Gln Lys Lys Pro 20 25 30Arg Leu Asp Ser Glu His Thr Thr
Val Asp Val Gln Val Thr Val Arg 35 40 45Lys Gly Arg Gly Ala Arg Ser
Phe Arg Arg Ala Ala Val Leu Val Val 50 55 60Ala Met Thr Lys Leu Leu
Arg Arg Pro Arg Ser Arg Asp Phe Ala Asp65 70 75 80Ser Asp Leu Ser
Ala Leu Leu Glu Glu Val Phe Glu Pro Val Thr Phe 85 90 95Gln Arg Leu
Glu Ser Ser Tyr Ala Gly Ala Pro Ala Phe Arg Tyr Thr 100 105 110Arg
Ser Gln Ser Phe Asp Ile Phe Asp Ile Asn Gln Lys Cys Phe Val 115 120
125Leu Glu Ser Pro Thr Gln Leu Val Ala Leu His Leu Gln Gly Pro Ser
130 135 140Ser Ser Gln Lys Val Arg Leu Asn Ile Ala Leu Tyr Arg Pro
Arg Gly145 150 155 160Pro Arg Gly Ser Ala Gly Thr Gly Gln Met Pro
Val Ala Leu Gly Ile 165 170 175Lys Gly Tyr Lys Leu Tyr Met Ser Cys
Val Met Ser Gly Thr Glu Pro 180 185 190Thr Leu Gln Leu Glu Glu Ala
Asp Val Met Arg Asp Ile Asp Ser Val 195 200 205Glu Leu Thr Arg Phe
Ile Phe Tyr Arg Leu Asp Ser Pro Thr Glu Gly 210 215 220Thr Thr Arg
Phe Glu Ser Ala Ala Phe Pro Gly Trp Phe Ile Cys Thr225 230 235
240Ser Leu Gln Pro Arg Gln Pro Val Gly Ile Thr Asn Gln Pro Asp Gln
245 250 255Val Asn Ile Ala Thr Tyr Lys Leu Ser Gly Arg 260
26562127PRTCanis familiaris 62Gly Pro Gly Gly Ser Asn Val Lys Cys
Cys Cys Gln Asp Leu Asn His1 5 10 15Ser Ser Leu Val Asp Glu Gly Ile
Gln Leu Gln Val Ser His Gln Leu 20 25 30Cys Asn Lys Ser Leu Arg His
Phe Val Ser Val Ile Val Ala Leu Glu 35 40 45Lys Leu Lys Lys Pro Cys
Pro Gln Val Leu Gln Glu Asp Asp Leu Lys 50 55 60Ser Ile Phe Cys Tyr
Ile Phe Glu Glu Glu Pro Ile Ile Cys Lys Thr65 70 75 80Asp Ala Asp
Asn Phe Met Ser Asp Ala Ala Met Gln Ser Val Asp Cys 85 90 95Lys Leu
Gln Asp Ile Ser His Lys Tyr Leu Val Leu Ser Asn Ser Tyr 100 105
110Glu Leu Arg Ala Leu His Leu Asn Gly Glu Asn Val Asn Lys Ala 115
120 12563153PRTHomo sapiens 63Leu Ser Asn Val Lys Tyr Asn Phe Met
Arg Ile Ile Lys Tyr Glu Phe1 5 10 15Ile Leu Asn Asp Ala Leu Asn Gln
Ser Ile Ile Arg Ala Asn Asp Gln 20 25 30Tyr Leu Thr Ala Ala Ala Leu
His Asn Leu Asp Glu Ala Val Lys Phe 35 40 45Asp Met Gly Ala Tyr Lys
Ser Ser Lys Asp Asp Ala Lys Ile Thr Val 50 55 60Ile Leu Arg Ile Ser
Lys Thr Gln Leu Tyr Val Thr Ala Gln Asp Glu65 70 75 80Asp Gln Pro
Val Leu Leu Lys Glu Met Pro Glu Ile Pro Lys Thr Ile 85 90 95Thr Gly
Ser Glu Thr Asn Leu Leu Phe Phe Trp Glu Thr His Gly Thr 100 105
110Lys Asn Tyr Phe Thr Ser Val Ala His Pro Asn Leu Phe Ile Ala Thr
115 120 125Lys Gln Asp Tyr Trp Val Cys Leu Ala Gly Gly Pro Pro Ser
Ile Thr 130 135 140Asp Phe Gln Ile Leu Glu Asn Gln Ala145
15064153PRTHomo sapiens 64Ala Pro Val Arg Ser Leu Asn Cys Thr Leu
Arg Asp Ser Gln Gln Lys1 5 10 15Ser Leu Val Met Ser Gly Pro Tyr Glu
Leu Lys Ala Leu His Leu Gln 20 25 30Gly Gln Asp Met Glu Gln Gln Val
Val Phe Ser Met Ser Phe Val Gln 35 40 45Gly Glu Glu Ser Asn Asp Lys
Ile Pro Val Ala Leu Gly Leu Lys Glu 50 55 60Lys Asn Leu Tyr Leu Ser
Cys Val Leu Lys Asp Asp Lys Pro Thr Leu65 70 75 80Gln Leu Glu Ser
Val Asp Pro Lys Asn Tyr Pro Lys Lys Lys Met Glu 85 90 95Lys Arg Phe
Val Phe Asn Lys Ile Glu Ile Asn Asn Lys Leu Glu Phe 100 105 110Glu
Ser Ala Gln Phe Pro Asn Trp Tyr Ile Ser Thr Ser Gln Ala Glu 115 120
125Asn Met Pro Val Phe Leu Gly Gly Thr Lys Gly Gly Gln Asp Ile Thr
130 135 140Asp Phe Thr Met Gln Phe Val Ser Ser145 15065183PRTMus
musculus 65Met Asp Pro His His His His His His Gly Ser Gly Asp Asp
Asp Asp1 5 10 15Lys Ala Leu Ala Pro Tyr Thr Tyr Gln Ser Asp Leu Arg
Tyr Lys Leu 20 25 30Met Lys Leu Val Arg Gln Lys Phe Val Met Asn Asp
Ser Leu Asn Gln 35 40 45Thr Ile Tyr Gln Asp Val Asp Lys His Tyr Leu
Ser Thr Thr Trp Leu 50 55 60Asn Asp Leu Gln Gln Glu Val Lys Phe Asp
Met Tyr Ala Tyr Ser Ser65 70 75 80Gly Gly Asp Asp Ser Lys Tyr Pro
Val Thr Leu Lys Ile Ser Asp Ser 85 90 95Gln Leu Phe Val Ser Ala Gln
Gly Glu Asp Gln Pro Val Leu Leu Lys 100 105 110Glu Leu Pro Glu Thr
Pro Lys Leu Ile Thr Gly Ser Glu Thr Asp Leu 115 120 125Ile Phe Phe
Trp Lys Ser Ile Asn Ser Lys Asn Tyr Phe Thr Ser Ala 130 135 140Ala
Tyr Pro Glu Leu Phe Ile Ala Thr Lys Glu Gln Ser Arg Val His145 150
155 160Leu Ala Arg Gly Leu Pro Ser Met Thr Asp Phe Gln Ile Ser Leu
Glu 165 170 175Gly Gly Gly Gly Gly Cys Gly 18066180PRTMus musculus
66Met Asp Pro His His His His His His Gly Ser Gly Asp Asp Asp Asp1
5 10 15Lys Ala Leu Ala Pro Ile Arg Gln Leu His Tyr Arg Leu Arg Asp
Glu 20 25 30Gln Gln Lys Ser Leu Val Leu Ser Asp Pro Tyr Glu Leu Lys
Ala Leu 35 40 45His Leu Asn Gly Gln Asn Ile Asn Gln Gln Val Ile Phe
Ser Met Ser 50 55 60Phe Val Gln Gly Glu Pro Ser Asn Asp Lys Ile Pro
Val Ala Leu Gly65 70 75 80Leu Lys Gly Lys Asn Leu Tyr Leu Ser Cys
Val
Met Lys Asp Gly Thr 85 90 95Pro Thr Leu Gln Leu Glu Ser Val Asp Pro
Lys Gln Tyr Pro Lys Lys 100 105 110Lys Met Glu Lys Arg Phe Val Phe
Asn Lys Ile Glu Val Lys Ser Lys 115 120 125Val Glu Phe Glu Ser Ala
Glu Phe Pro Asn Trp Tyr Ile Ser Thr Ser 130 135 140Gln Ala Glu His
Lys Pro Val Phe Leu Gly Asn Asn Ser Gly Gln Asp145 150 155 160Ile
Ile Asp Phe Thr Met Glu Ser Val Ser Ser Leu Glu Gly Gly Gly 165 170
175Gly Gly Cys Gly 1806712PRTHomo sapiens 67Met Arg Ile Ile Lys Tyr
Glu Phe Ile Leu Asn Asp1 5 10686PRTHomo sapiens 68Arg Ile Ile Lys
Tyr Glu1 56910PRTHomo sapiens 69Tyr Glu Phe Ile Leu Asn Asp Ala Leu
Asn1 5 107012PRTHomo sapiens 70Asn Asp Ala Leu Asn Gln Ser Ile Ile
Arg Ala Asn1 5 107110PRTHomo sapiens 71Thr Ala Ala Ala Leu His Asn
Leu Asp Glu1 5 107212PRTHomo sapiens 72Thr Ala Ala Ala Leu His Asn
Leu Asp Glu Ala Val1 5 107310PRTHomo sapiens 73Ala Val Lys Phe Asp
Met Gly Ala Tyr Lys1 5 107411PRTHomo sapiens 74Ala Tyr Lys Ser Ser
Lys Asp Asp Ala Lys Ile1 5 107531PRTHomo sapiens 75Ser Ser Lys Asp
Asp Ala Lys Ile Thr Val Ile Leu Arg Ile Ser Lys1 5 10 15Thr Gln Leu
Tyr Val Thr Ala Gln Asp Glu Asp Gln Pro Val Leu 20 25 307613PRTHomo
sapiens 76Val Ile Leu Arg Ile Ser Lys Thr Gln Leu Tyr Val Thr1 5
107722PRTHomo sapiens 77Val Ile Leu Arg Ile Ser Lys Thr Gln Leu Tyr
Val Thr Ala Gln Asp1 5 10 15Glu Asp Gln Pro Val Leu 207820PRTHomo
sapiens 78Thr Gln Leu Tyr Val Thr Ala Gln Asp Glu Asp Gln Pro Val
Leu Leu1 5 10 15Lys Glu Met Pro 207921PRTHomo sapiens 79Pro Val Leu
Leu Lys Glu Met Pro Glu Ile Pro Lys Thr Ile Thr Gly1 5 10 15Ser Glu
Thr Asn Leu 208014PRTHomo sapiens 80Glu Met Pro Glu Ile Pro Lys Thr
Ile Thr Gly Ser Glu Thr1 5 108112PRTHomo sapiens 81Lys Thr Ile Thr
Gly Ser Glu Thr Asn Leu Leu Phe1 5 108221PRTHomo sapiens 82Pro Lys
Thr Ile Thr Gly Ser Glu Thr Asn Leu Leu Phe Phe Trp Glu1 5 10 15Thr
His Gly Thr Lys 208310PRTHomo sapiens 83Gly Ser Glu Thr Asn Leu Leu
Phe Phe Trp1 5 108412PRTHomo sapiens 84Leu Phe Ile Ala Thr Lys Gln
Asp Tyr Trp Val Cys1 5 108513PRTHomo sapiens 85Phe Ile Ala Thr Lys
Gln Asp Tyr Trp Val Cys Leu Ala1 5 108618PRTHomo sapiens 86Ile Ala
Thr Lys Gln Asp Tyr Trp Val Cys Leu Ala Gly Gly Pro Pro1 5 10 15Ser
Ile875PRTHomo sapiens 87Lys Gln Asp Tyr Trp1 5887PRTHomo sapiens
88Gln Ile Leu Glu Asn Gln Ala1 5896PRTHomo sapiens 89Ala Pro Val
Arg Ser Leu1 59012PRTHomo sapiens 90Ala Pro Val Arg Ser Leu Asn Cys
Thr Leu Arg Asp1 5 109110PRTHomo sapiens 91Leu Asn Cys Thr Leu Arg
Asp Ser Gln Gln1 5 109212PRTHomo sapiens 92Arg Asp Ser Gln Gln Lys
Ser Leu Val Met Ser Gly1 5 109312PRTHomo sapiens 93Lys Ala Leu His
Leu Gln Gly Gln Asp Met Glu Gln1 5 109414PRTHomo sapiens 94Lys Ala
Leu His Leu Gln Gly Gln Asp Met Glu Gln Gln Val1 5 109510PRTHomo
sapiens 95Gln Val Val Phe Ser Met Ser Phe Val Gln1 5 109611PRTHomo
sapiens 96Phe Val Gln Gly Glu Glu Ser Asn Asp Lys Ile1 5
109732PRTHomo sapiens 97Gly Glu Glu Ser Asn Asp Lys Ile Pro Val Ala
Leu Gly Leu Lys Glu1 5 10 15Lys Asn Leu Tyr Leu Ser Cys Val Leu Lys
Asp Asp Lys Pro Thr Leu 20 25 309813PRTHomo sapiens 98Val Ala Leu
Gly Leu Lys Glu Lys Asn Leu Tyr Leu Ser1 5 109923PRTHomo sapiens
99Val Ala Leu Gly Leu Lys Glu Lys Asn Leu Tyr Leu Ser Cys Val Leu1
5 10 15Lys Asp Asp Lys Pro Thr Leu 2010021PRTHomo sapiens 100Lys
Asn Leu Tyr Leu Ser Cys Val Leu Lys Asp Asp Lys Pro Thr Leu1 5 10
15Gln Leu Glu Ser Val 2010120PRTHomo sapiens 101Pro Thr Leu Gln Leu
Glu Ser Val Asp Pro Lys Asn Tyr Pro Lys Lys1 5 10 15Lys Met Glu Lys
2010213PRTHomo sapiens 102Glu Ser Val Asp Pro Lys Asn Tyr Pro Lys
Lys Lys Met1 5 1010312PRTHomo sapiens 103Lys Asn Tyr Pro Lys Lys
Lys Met Glu Lys Arg Phe1 5 1010410PRTHomo sapiens 104Lys Lys Lys
Met Glu Lys Arg Phe Val Phe1 5 1010518PRTHomo sapiens 105Lys Lys
Lys Met Glu Lys Arg Phe Val Phe Asn Lys Ile Glu Ile Asn1 5 10 15Asn
Lys10614PRTHomo sapiens 106Trp Tyr Ile Ser Thr Ser Gln Ala Glu Asn
Met Pro Val Phe1 5 1010715PRTHomo sapiens 107Tyr Ile Ser Thr Ser
Gln Ala Glu Asn Met Pro Val Phe Leu Gly1 5 10 1510822PRTHomo
sapiens 108Ile Ser Thr Ser Gln Ala Glu Asn Met Pro Val Phe Leu Gly
Gly Thr1 5 10 15Lys Gly Gly Gln Asp Ile 201096PRTHomo sapiens
109Gln Ala Glu Asn Met Pro1 51107PRTHomo sapiens 110Thr Met Gln Phe
Val Ser Ser1 511112PRTMus musculus 111Val Pro Ile Arg Gln Leu His
Tyr Arg Leu Arg Asp1 5 1011214PRTMus musculus 112Lys Ala Leu His
Leu Asn Gly Gln Asn Ile Asn Gln Gln Val1 5 1011315PRTMus musculus
113Tyr Ile Ser Thr Ser Gln Ala Glu His Lys Pro Val Phe Leu Gly1 5
10 1511420PRTRattus norvegicus 114Asn Leu Tyr Leu Ser Cys Val Met
Lys Asp Gly Thr Pro Thr Leu Gln1 5 10 15Leu Glu Ser Val
2011520PRTRattus norvegicus 115Pro Thr Leu Gln Leu Glu Ser Val Asp
Pro Lys Gln Tyr Pro Lys Lys1 5 10 15Lys Met Glu Lys
2011622PRTRattus norvegicus 116Ile Ser Thr Ser Gln Ala Glu His Arg
Pro Val Phe Leu Gly Asn Ser1 5 10 15Asn Gly Arg Asp Ile Val
20117421DNAartificial sequencesynthesized sequence 117atggcaaata
agccaatgca accgatcaca tctacagcaa ataaaattgt gtggtcggat 60ccaactcgtt
tatcaactac attttcagca agtctgttac gccaacgtgt taaagttggt
120atagccgaac tgaataatgt ttcaggtcaa tatgtatctg tttataagcg
tcctgcacct 180aaaccggaag gttgtgcaga tgcctgtgtc attatgccga
atgaaaacca atccattcgc 240acagtgattt cagggtcagc cgaaaacttg
gctaccttaa aagcagaatg ggaaactcac 300aaacgtaacg ttgacacact
cttcgcgagc ggcaacgccg gtttgggttt ccttgaccct 360actgcggcta
tcgtatcgtc tgatactact gcttagggat ccggataatg catctaagct 420t
421118421DNAartificial sequencesynthesized sequence 118atggcaaata
agccaatgca accgatcaca tctacagcaa ataaaattgt gtggtcggat 60ccaactcgtt
tatcaactac attttcagca agtctgttac gccaacgtgt taaagttggt
120atagccgaac tgaataatgt ttcaggtcaa tatgtatctg tttataagcg
tcctgcacct 180aaaccggaag gttgtgcaga tgcctgtgtc attatgccga
atgaaaacca atccattcgc 240acagtgattt cagggtcagc cgaaaacttg
gctaccttaa aagcagaatg ggaaactcac 300aaacgtaacg ttgacacact
cttcgcgagc ggcaacgccg gtttgggttt ccttgaccct 360actgcggcta
tcgtatcgtc tgatactact gcttgaggat ccggataatg catctaagct 420t
42111928DNAartificial sequencesynthesized sequence 119nnccatggca
aataagccaa tgcaaccg 2812052DNAartificial sequencesynthesized
sequence 120gtaagcttag atgcattatc cggatcccta agcagtagta tcagacgata
cg 5212152DNAartificial sequencesynthesized sequence 121gtaagcttag
atgcattatc cggatcctca agcagtagta tcagacgata cg 5212225DNAartificial
sequencesynthesized sequence 122ggtccggagc gctagcccct tacac
2512340DNAartificial sequencesynthesized sequence 123gtaagcttat
gcattatgat atctggaagt ctgtcataga 4012436DNAartificial
sequencesynthesized sequence 124atatatgata tccctgtacg atcactgaac
tgcacg 3612537DNAartificial sequencesynthesized sequence
125atatatctcg agggaagaca caaattgcat ggtgaag 3712648DNAartificial
sequencesynthesized sequence 126tatggatatc gaattcaagc ttctgcagct
gctcgagtaa ttgattac 4812750DNAartificial sequencesynthesized
sequence 127ctaggtaatc aattactcga gcagctgcag aagcttgaat tcgatatcca
5012852DNAartificial sequencesynthesized sequence 128tcgagcacca
ccaccaccac cacggtggtt gctaataata attgattaat ac 5212952DNAartificial
sequencesynthesized sequence 129ctaggtatta atcaattatt attagcaacc
accgtggtgg tggtggtggt gc 52130166PRTHomo sapiens 130Met Asp Ile Pro
Val Arg Ser Leu Asn Cys Thr Leu Arg Asp Ser Gln1 5 10 15Gln Lys Ser
Leu Val Met Ser Gly Pro Tyr Glu Leu Lys Ala Leu His 20 25 30Leu Gln
Gly Gln Asp Met Glu Gln Gln Val Val Phe Ser Met Ser Phe 35 40 45Val
Gln Gly Glu Glu Ser Asn Asp Lys Ile Pro Val Ala Leu Gly Leu 50 55
60Lys Glu Lys Asn Leu Tyr Leu Ser Cys Val Leu Lys Asp Asp Lys Pro65
70 75 80Thr Leu Gln Leu Glu Ser Val Asp Pro Lys Asn Tyr Pro Lys Lys
Lys 85 90 95Met Glu Lys Arg Phe Val Phe Asn Lys Ile Glu Ile Asn Asn
Lys Leu 100 105 110Glu Phe Glu Ser Ala Gln Phe Pro Asn Trp Tyr Ile
Ser Thr Ser Gln 115 120 125Ala Glu Asn Met Pro Val Phe Leu Gly Gly
Thr Lys Gly Gly Gln Asp 130 135 140Ile Thr Asp Phe Thr Met Gln Phe
Val Ser Ser Leu Glu His His His145 150 155 160His His His Gly Gly
Cys 165131155PRTHomo sapiens 131Met Asp Ile Pro Val Asp Ser Leu Asn
Cys Thr Leu Arg Asp Ser Gln1 5 10 15Gln Lys Ser Leu Val Met Ser Gly
Pro Tyr Glu Leu Lys Ala Leu His 20 25 30Leu Gln Gly Gln Asp Met Glu
Gln Gln Val Val Phe Ser Met Ser Phe 35 40 45Val Gln Gly Glu Glu Ser
Asn Asp Lys Ile Pro Val Ala Leu Gly Leu 50 55 60Lys Glu Lys Asn Leu
Tyr Leu Ser Cys Val Leu Lys Asp Asp Lys Pro65 70 75 80Thr Leu Gln
Leu Glu Ser Val Asp Pro Lys Asn Tyr Pro Lys Lys Lys 85 90 95Met Glu
Lys Arg Phe Val Phe Asn Lys Ile Glu Ile Asn Asn Lys Leu 100 105
110Glu Phe Glu Ser Ala Gln Phe Pro Asn Trp Tyr Ile Ser Thr Ser Gln
115 120 125Ala Glu Asn Met Pro Val Phe Leu Gly Gly Thr Lys Gly Gly
Gln Asp 130 135 140Ile Thr Asp Phe Thr Met Gln Phe Val Ser Ser145
150 155132155PRTHomo sapiens 132Met Asp Ile Pro Val Arg Ser Ala Asn
Cys Thr Leu Arg Asp Ser Gln1 5 10 15Gln Lys Ser Leu Val Met Ser Gly
Pro Tyr Glu Leu Lys Ala Leu His 20 25 30Leu Gln Gly Gln Asp Met Glu
Gln Gln Val Val Phe Ser Met Ser Phe 35 40 45Val Gln Gly Glu Glu Ser
Asn Asp Lys Ile Pro Val Ala Leu Gly Leu 50 55 60Lys Glu Lys Asn Leu
Tyr Leu Ser Cys Val Leu Lys Asp Asp Lys Pro65 70 75 80Thr Leu Gln
Leu Glu Ser Val Asp Pro Lys Asn Tyr Pro Lys Lys Lys 85 90 95Met Glu
Lys Arg Phe Val Phe Asn Lys Ile Glu Ile Asn Asn Lys Leu 100 105
110Glu Phe Glu Ser Ala Gln Phe Pro Asn Trp Tyr Ile Ser Thr Ser Gln
115 120 125Ala Glu Asn Met Pro Val Phe Leu Gly Gly Thr Lys Gly Gly
Gln Asp 130 135 140Ile Thr Asp Phe Thr Met Gln Phe Val Ser Ser145
150 155133155PRTHomo sapiens 133Met Asp Ile Pro Val Arg Ser Leu Asn
Cys Gly Leu Arg Asp Ser Gln1 5 10 15Gln Lys Ser Leu Val Met Ser Gly
Pro Tyr Glu Leu Lys Ala Leu His 20 25 30Leu Gln Gly Gln Asp Met Glu
Gln Gln Val Val Phe Ser Met Ser Phe 35 40 45Val Gln Gly Glu Glu Ser
Asn Asp Lys Ile Pro Val Ala Leu Gly Leu 50 55 60Lys Glu Lys Asn Leu
Tyr Leu Ser Cys Val Leu Lys Asp Asp Lys Pro65 70 75 80Thr Leu Gln
Leu Glu Ser Val Asp Pro Lys Asn Tyr Pro Lys Lys Lys 85 90 95Met Glu
Lys Arg Phe Val Phe Asn Lys Ile Glu Ile Asn Asn Lys Leu 100 105
110Glu Phe Glu Ser Ala Gln Phe Pro Asn Trp Tyr Ile Ser Thr Ser Gln
115 120 125Ala Glu Asn Met Pro Val Phe Leu Gly Gly Thr Lys Gly Gly
Gln Asp 130 135 140Ile Thr Asp Phe Thr Met Gln Phe Val Ser Ser145
150 155134155PRTHomo sapiens 134Met Asp Ile Pro Val Arg Ser Leu Asn
Cys Thr Leu Gly Asp Ser Gln1 5 10 15Gln Lys Ser Leu Val Met Ser Gly
Pro Tyr Glu Leu Lys Ala Leu His 20 25 30Leu Gln Gly Gln Asp Met Glu
Gln Gln Val Val Phe Ser Met Ser Phe 35 40 45Val Gln Gly Glu Glu Ser
Asn Asp Lys Ile Pro Val Ala Leu Gly Leu 50 55 60Lys Glu Lys Asn Leu
Tyr Leu Ser Cys Val Leu Lys Asp Asp Lys Pro65 70 75 80Thr Leu Gln
Leu Glu Ser Val Asp Pro Lys Asn Tyr Pro Lys Lys Lys 85 90 95Met Glu
Lys Arg Phe Val Phe Asn Lys Ile Glu Ile Asn Asn Lys Leu 100 105
110Glu Phe Glu Ser Ala Gln Phe Pro Asn Trp Tyr Ile Ser Thr Ser Gln
115 120 125Ala Glu Asn Met Pro Val Phe Leu Gly Gly Thr Lys Gly Gly
Gln Asp 130 135 140Ile Thr Asp Phe Thr Met Gln Phe Val Ser Ser145
150 155135155PRTHomo sapiens 135Met Asp Ile Pro Val Arg Ser Leu Asn
Cys Thr Leu Arg Asp Ser Gln1 5 10 15Gln Lys Ser Leu Val Met Ser Gly
Pro Tyr Glu Leu Lys Ala Leu His 20 25 30Leu Gln Gly Gln Asp Met Glu
Gln Gln Val Val Phe Ser Met Ser Phe 35 40 45Val Gln Gly Glu Glu Ser
Asn Arg Lys Ile Pro Val Ala Leu Gly Leu 50 55 60Lys Glu Lys Asn Leu
Tyr Leu Ser Cys Val Leu Lys Asp Asp Lys Pro65 70 75 80Thr Leu Gln
Leu Glu Ser Val Asp Pro Lys Asn Tyr Pro Lys Lys Lys 85 90 95Met Glu
Lys Arg Phe Val Phe Asn Lys Ile Glu Ile Asn Asn Lys Leu 100 105
110Glu Phe Glu Ser Ala Gln Phe Pro Asn Trp Tyr Ile Ser Thr Ser Gln
115 120 125Ala Glu Asn Met Pro Val Phe Leu Gly Gly Thr Lys Gly Gly
Gln Asp 130 135 140Ile Thr Asp Phe Thr Met Gln Phe Val Ser Ser145
150 155136155PRTHomo sapiens 136Met Asp Ile Pro Val Arg Ser Leu Asn
Cys Thr Leu Arg Asp Ser Gln1 5 10 15Gln Lys Ser Leu Val Met Ser Gly
Pro Tyr Glu Leu Lys Ala Leu His 20 25 30Leu Gln Gly Gln Asp Met Glu
Gln Gln Val Val Phe Ser Met Ser Phe 35 40 45Val Gln Gly Glu Glu Ser
Asn Asp Lys Ile Pro Val Ala Leu Gly Leu 50 55 60Lys Glu Lys Asn Leu
Tyr Leu Ser Cys Val Leu Lys Asp Asp Lys Pro65 70 75 80Thr Leu Gln
Leu Glu Ser Val Asp Pro Lys Asn Tyr Pro Lys Lys Lys 85 90 95Met Glu
Lys Arg Phe Val Phe Asn Lys Ile Glu Ile Asn Asn Lys Leu 100 105
110Glu Phe Glu Ser Ala Gln Phe Pro Asn Trp Tyr Ile Ser Thr Ser Gln
115 120 125Ala Glu Asn Met Pro Val Phe Leu Gly Gly Thr Lys Gly Gly
Gln Asp 130 135 140Ile Thr Lys Phe Thr Met Gln Phe Val Ser Ser145
150 155137153PRTHomo sapiens 137Met Asp Ile Pro Val Arg Ser Leu Asn
Cys Thr
Leu Arg Asp Ser Gln1 5 10 15Gln Lys Ser Leu Val Met Ser Gly Pro Tyr
Glu Leu Lys Ala Leu His 20 25 30Leu Gln Gly Gln Asp Met Glu Gln Gln
Val Val Phe Ser Met Ser Phe 35 40 45Val Gln Gly Ser Asn Asp Lys Ile
Pro Val Ala Leu Gly Leu Lys Glu 50 55 60Lys Asn Leu Tyr Leu Ser Cys
Val Leu Lys Asp Asp Lys Pro Thr Leu65 70 75 80Gln Leu Glu Ser Val
Asp Pro Lys Asn Tyr Pro Lys Lys Lys Met Glu 85 90 95Lys Arg Phe Val
Phe Asn Lys Ile Glu Ile Asn Asn Lys Leu Glu Phe 100 105 110Glu Ser
Ala Gln Phe Pro Asn Trp Tyr Ile Ser Thr Ser Gln Ala Glu 115 120
125Asn Met Pro Val Phe Leu Gly Gly Thr Lys Gly Gly Gln Asp Ile Thr
130 135 140Asp Phe Thr Met Gln Phe Val Ser Ser145 150138152PRTHomo
sapiens 138Met Asp Ile Pro Val Arg Ser Leu Asn Cys Thr Leu Arg Asp
Ser Gln1 5 10 15Gln Lys Ser Leu Val Met Ser Gly Pro Tyr Glu Leu Lys
Ala Leu His 20 25 30Leu Gln Gly Gln Asp Met Glu Gln Gln Val Val Phe
Ser Met Ser Phe 35 40 45Val Gln Gly Glu Glu Lys Ile Pro Val Ala Leu
Gly Leu Lys Glu Lys 50 55 60Asn Leu Tyr Leu Ser Cys Val Leu Lys Asp
Asp Lys Pro Thr Leu Gln65 70 75 80Leu Glu Ser Val Asp Pro Lys Asn
Tyr Pro Lys Lys Lys Met Glu Lys 85 90 95Arg Phe Val Phe Asn Lys Ile
Glu Ile Asn Asn Lys Leu Glu Phe Glu 100 105 110Ser Ala Gln Phe Pro
Asn Trp Tyr Ile Ser Thr Ser Gln Ala Glu Asn 115 120 125Met Pro Val
Phe Leu Gly Gly Thr Lys Gly Gly Gln Asp Ile Thr Asp 130 135 140Phe
Thr Met Gln Phe Val Ser Ser145 150139155PRTHomo sapiens 139Met Asp
Ile Pro Val Arg Ser Leu Asn Cys Thr Leu Arg Asp Ser Gln1 5 10 15Gln
Lys Ser Leu Val Met Ser Gly Pro Tyr Glu Leu Lys Ala Leu His 20 25
30Leu Gln Gly Gln Asp Met Glu Gln Gln Val Val Phe Ser Met Ser Phe
35 40 45Val Gln Gly Glu Glu Ser Asn Asp Lys Ile Pro Val Ala Leu Gly
Leu 50 55 60Ser Glu Ser Asn Leu Tyr Leu Ser Cys Val Leu Lys Asp Asp
Lys Pro65 70 75 80Thr Leu Gln Leu Glu Ser Val Asp Pro Lys Asn Tyr
Pro Lys Lys Lys 85 90 95Met Glu Lys Arg Phe Val Phe Asn Lys Ile Glu
Ile Asn Asn Lys Leu 100 105 110Glu Phe Glu Ser Ala Gln Phe Pro Asn
Trp Tyr Ile Ser Thr Ser Gln 115 120 125Ala Glu Asn Met Pro Val Phe
Leu Gly Gly Thr Lys Gly Gly Gln Asp 130 135 140Ile Thr Asp Phe Thr
Met Gln Phe Val Ser Ser145 150 155140155PRTHomo sapiens 140Met Asp
Ile Pro Val Arg Ser Leu Asn Cys Thr Leu Arg Asp Ser Gln1 5 10 15Gln
Lys Ser Leu Val Met Ser Gly Pro Tyr Glu Leu Lys Ala Leu His 20 25
30Leu Gln Gly Gln Asp Met Glu Gln Gln Val Val Phe Ser Met Ser Phe
35 40 45Val Gln Gly Glu Glu Ser Asn Asp Lys Ile Pro Val Ala Leu Gly
Leu 50 55 60Lys Glu Lys Asn Leu Tyr Leu Ser Cys Val Leu Lys Asp Asp
Lys Pro65 70 75 80Thr Leu Gln Leu Glu Ser Val Asp Pro Lys Asn Tyr
Pro Lys Lys Lys 85 90 95Met Glu Lys Arg Phe Val Phe Asn Lys Ile Glu
Ile Asn Asn Lys Leu 100 105 110Glu Phe Glu Ser Ala Gln Phe Pro Asn
Trp Tyr Ile Ser Thr Ser Ala 115 120 125Ala Ala Asn Met Pro Val Phe
Leu Gly Gly Thr Lys Gly Gly Gln Asp 130 135 140Ile Thr Asp Phe Thr
Met Gln Phe Val Ser Ser145 150 15514139DNAartificial
sequencesynthesized sequence 141atatatcata tgctgagcaa tgtgaaatac
aactttatg 3914237DNAartificial sequencesynthesized sequence
142atatatctcg agcgcctggt tttccagtat ctgaaag 3714339DNAartificial
sequencesynthesized sequence 143catatggata tccctgtaga ctcactgaac
tgcacgctc 3914439DNAartificial sequencesynthesized sequence
144gagcgtgcag ttcagtgagt ctacagggat atccatatg 3914539DNAartificial
sequencesynthesized sequence 145gatatccctg tacgatcagc taactgcacg
ctccgggac 3914639DNAartificial sequencesynthesized sequence
146gtcccggagc gtgcagttag ctgatcgtac agggatatc 3914737DNAartificial
sequencesynthesized sequence 147gtacgatcac tgaactgcgg tctccgggac
tcacagc 3714837DNAartificial sequencesynthesized sequence
148gctgtgagtc ccggagaccg cagttcagtg atcgtac 3714926DNAartificial
sequencesynthesized sequence 149gaactgcacg ctcggggact cacagc
2615026DNAartificial sequencesynthesized sequence 150gctgtgagtc
cccgagcgtg cagttc 2615139DNAartificial sequencesynthesized sequence
151caaggagaag aaagtaatcg caaaatacct gtggccttg 3915239DNAartificial
sequencesynthesized sequence 152caaggccaca ggtattttgc gattactttc
ttctccttg 3915340DNAartificial sequencesynthesized sequence
153catgtccttt gtacaaggaa gtaatgacaa aatacctgtg 4015440DNAartificial
sequencesynthesized sequence 154cacaggtatt ttgtcattac ttccttgtac
aaaggacatg 4015537DNAartificial sequencesynthesized sequence
155ctttgtacaa ggagaagaaa aaatacctgt ggccttg 3715637DNAartificial
sequencesynthesized sequence 156caaggccaca ggtatttttt cttctccttg
tacaaag 3715741DNAartificial sequencesynthesized sequence
157gtggccttgg gcctcagcga aagcaatctg tacctgtcct g
4115841DNAartificial sequencesynthesized sequence 158caggacaggt
acagattgct ttcgctgagg cccaaggcca c 4115940DNAartificial
sequencesynthesized sequence 159gtacatcagc acctctgcag cagcaaacat
gcccgtcttc 4016040DNAartificial sequencesynthesized sequence
160gaagacgggc atgtttgctg ctgcagaggt gctgatgtac 4016140DNAartificial
sequencesynthesitzed sequence 161gcggccagga tataactaaa ttcaccatgc
aatttgtgtc 4016240DNAartificial sequencesynthesized sequence
162gacacaaatt gcatggtgaa tttagttata tcctggccgc 40163154PRTMus
musculus 163Pro Tyr Thr Tyr Gln Ser Asp Leu Arg Tyr Lys Leu Met Lys
Leu Val1 5 10 15Arg Gln Lys Phe Val Met Asn Asp Ser Leu Asn Gln Thr
Ile Tyr Gln 20 25 30Asp Val Asp Lys His Tyr Leu Ser Thr Thr Trp Leu
Asn Asp Leu Gln 35 40 45Gln Glu Val Lys Phe Asp Met Tyr Ala Tyr Ser
Ser Gly Gly Asp Asp 50 55 60Ser Lys Tyr Pro Val Thr Leu Lys Ile Ser
Asp Ser Gln Leu Phe Val65 70 75 80Ser Ala Gln Gly Glu Asp Gln Pro
Val Leu Leu Lys Glu Leu Pro Glu 85 90 95Thr Pro Lys Leu Ile Thr Gly
Ser Glu Thr Asp Leu Ile Phe Phe Trp 100 105 110Lys Ser Ile Asn Ser
Lys Asn Tyr Phe Thr Ser Ala Ala Tyr Pro Glu 115 120 125Leu Phe Ile
Ala Thr Lys Glu Gln Ser Arg Val His Leu Ala Arg Gly 130 135 140Leu
Pro Ser Met Thr Asp Phe Gln Ile Ser145 150164151PRTMus musculus
164Pro Ile Arg Gln Leu His Tyr Arg Leu Arg Asp Glu Gln Gln Lys Ser1
5 10 15Leu Val Leu Ser Asp Pro Tyr Glu Leu Lys Ala Leu His Leu Asn
Gly 20 25 30Gln Asn Ile Asn Gln Gln Val Ile Phe Ser Met Ser Phe Val
Gln Gly 35 40 45Glu Pro Ser Asn Asp Lys Ile Pro Val Ala Leu Gly Leu
Lys Gly Lys 50 55 60Asn Leu Tyr Leu Ser Cys Val Met Lys Asp Gly Thr
Pro Thr Leu Gln65 70 75 80Leu Glu Ser Val Asp Pro Lys Gln Tyr Pro
Lys Lys Lys Met Glu Lys 85 90 95Arg Phe Val Phe Asn Lys Ile Glu Val
Lys Ser Lys Val Glu Phe Glu 100 105 110Ser Ala Glu Phe Pro Asn Trp
Tyr Ile Ser Thr Ser Gln Ala Glu His 115 120 125Lys Pro Val Phe Leu
Gly Asn Asn Ser Gly Gln Asp Ile Ile Asp Phe 130 135 140Thr Met Glu
Ser Val Ser Ser145 150165155PRTMus musculus 165Met Asp Ile Pro Val
Arg Ser Leu Asn Cys Thr Leu Arg Asp Ser Gln1 5 10 15Gln Lys Ser Leu
Val Met Ser Gly Pro Tyr Glu Leu Lys Ala Leu His 20 25 30Leu Gln Gly
Gln Asp Met Glu Gln Gln Val Val Phe Ser Met Ser Phe 35 40 45Val Gln
Gly Glu Glu Ser Asn Asp Lys Ile Pro Val Ala Leu Gly Leu 50 55 60Lys
Glu Lys Asn Leu Tyr Leu Ser Cys Val Leu Lys Asp Asp Lys Pro65 70 75
80Thr Leu Gln Leu Glu Ser Val Asp Pro Lys Asn Tyr Pro Lys Lys Lys
85 90 95Met Glu Lys Arg Phe Val Phe Asn Lys Ile Glu Ile Asn Asn Lys
Leu 100 105 110Glu Phe Glu Ser Ala Gln Phe Pro Asn Trp Tyr Ile Ser
Thr Ser Gln 115 120 125Ala Glu Asn Met Pro Val Phe Leu Gly Gly Thr
Lys Gly Gly Gln Asp 130 135 140Ile Thr Asp Phe Thr Met Gln Phe Val
Ser Ser145 150 155166569PRTHomo sapiens 166Met Lys Val Leu Leu Arg
Leu Ile Cys Phe Ile Ala Leu Leu Ile Ser1 5 10 15Ser Leu Glu Ala Asp
Lys Cys Lys Glu Arg Glu Glu Lys Ile Ile Leu 20 25 30Val Ser Ser Ala
Asn Glu Ile Asp Val Arg Pro Cys Pro Leu Asn Pro 35 40 45Asn Glu His
Lys Gly Thr Ile Thr Trp Tyr Lys Asp Asp Ser Lys Thr 50 55 60Pro Val
Ser Thr Glu Gln Ala Ser Arg Ile His Gln His Lys Glu Lys65 70 75
80Leu Trp Phe Val Pro Ala Lys Val Glu Asp Ser Gly His Tyr Tyr Cys
85 90 95Val Val Arg Asn Ser Ser Tyr Cys Leu Arg Ile Lys Ile Ser Ala
Lys 100 105 110Phe Val Glu Asn Glu Pro Asn Leu Cys Tyr Asn Ala Gln
Ala Ile Phe 115 120 125Lys Gln Asn Leu Pro Val Ala Gly Asp Gly Gly
Leu Val Cys Pro Tyr 130 135 140Met Glu Phe Phe Lys Asn Glu Asn Asn
Glu Leu Pro Lys Leu Gln Trp145 150 155 160Tyr Lys Asp Cys Lys Pro
Leu Leu Leu Asp Asn Ile His Phe Ser Gly 165 170 175Val Lys Asp Arg
Leu Ile Val Met Asn Val Ala Glu Lys His Arg Gly 180 185 190Asn Tyr
Thr Cys His Ala Ser Tyr Thr Tyr Leu Gly Lys Gln Tyr Pro 195 200
205Ile Thr Arg Val Ile Glu Phe Ile Thr Leu Glu Glu Asn Lys Pro Thr
210 215 220Arg Pro Val Ile Val Ser Pro Ala Asn Glu Thr Met Glu Val
Asp Leu225 230 235 240Gly Ser Gln Ile Gln Leu Ile Cys Asn Val Thr
Gly Gln Leu Ser Asp 245 250 255Ile Ala Tyr Trp Lys Trp Asn Gly Ser
Val Ile Asp Glu Asp Asp Pro 260 265 270Val Leu Gly Glu Asp Tyr Tyr
Ser Val Glu Asn Pro Ala Asn Lys Arg 275 280 285Arg Ser Thr Leu Ile
Thr Val Leu Asn Ile Ser Glu Ile Glu Ser Arg 290 295 300Phe Tyr Lys
His Pro Phe Thr Cys Phe Ala Lys Asn Thr His Gly Ile305 310 315
320Asp Ala Ala Tyr Ile Gln Leu Ile Tyr Pro Val Thr Asn Phe Gln Lys
325 330 335His Met Ile Gly Ile Cys Val Thr Leu Thr Val Ile Ile Val
Cys Ser 340 345 350Val Phe Ile Tyr Lys Ile Phe Lys Ile Asp Ile Val
Leu Trp Tyr Arg 355 360 365Asp Ser Cys Tyr Asp Phe Leu Pro Ile Lys
Ala Ser Asp Gly Lys Thr 370 375 380Tyr Asp Ala Tyr Ile Leu Tyr Pro
Lys Thr Val Gly Glu Gly Ser Thr385 390 395 400Ser Asp Cys Asp Ile
Phe Val Phe Lys Val Leu Pro Glu Val Leu Glu 405 410 415Lys Gln Cys
Gly Tyr Lys Leu Phe Ile Tyr Gly Arg Asp Asp Tyr Val 420 425 430Gly
Glu Asp Ile Val Glu Val Ile Asn Glu Asn Val Lys Lys Ser Arg 435 440
445Arg Leu Ile Ile Ile Leu Val Arg Glu Thr Ser Ser Phe Ser Trp Leu
450 455 460Gly Gly Ser Ser Glu Glu Gln Ile Ala Met Tyr Asn Ala Leu
Val Gln465 470 475 480Asp Gly Ile Lys Val Val Leu Leu Glu Leu Glu
Lys Ile Gln Asp Tyr 485 490 495Glu Lys Met Pro Glu Ser Ile Lys Phe
Ile Lys Gln Lys His Gly Ala 500 505 510Ile Arg Trp Ser Gly Asp Phe
Thr Gln Gly Pro Gln Ser Ala Lys Thr 515 520 525Arg Phe Trp Lys Asn
Val Arg Tyr His Met Pro Val Gln Arg Arg Ser 530 535 540Pro Ser Ser
Lys His Gln Leu Leu Ser Pro Ala Thr Lys Glu Lys Leu545 550 555
560Gln Arg Glu Ala His Val Pro Leu Gly 565167398PRTHomo sapiens
167Met Leu Arg Leu Tyr Val Leu Val Met Gly Val Ser Ala Phe Thr Leu1
5 10 15Gln Pro Ala Ala His Thr Gly Ala Ala Arg Ser Cys Arg Phe Arg
Gly 20 25 30Arg His Tyr Lys Arg Glu Phe Arg Leu Glu Gly Glu Pro Val
Ala Leu 35 40 45Arg Cys Pro Gln Val Pro Tyr Trp Leu Trp Ala Ser Val
Ser Pro Arg 50 55 60Ile Asn Leu Thr Trp His Lys Asn Asp Ser Ala Arg
Thr Val Pro Gly65 70 75 80Glu Glu Glu Thr Arg Met Trp Ala Gln Asp
Gly Ala Leu Trp Leu Leu 85 90 95Pro Ala Leu Gln Glu Asp Ser Gly Thr
Tyr Val Cys Thr Thr Arg Asn 100 105 110Ala Ser Tyr Cys Asp Lys Met
Ser Ile Glu Leu Arg Val Phe Glu Asn 115 120 125Thr Asp Ala Phe Leu
Pro Phe Ile Ser Tyr Pro Gln Ile Leu Thr Leu 130 135 140Ser Thr Ser
Gly Val Leu Val Cys Pro Asp Leu Ser Glu Phe Thr Arg145 150 155
160Asp Lys Thr Asp Val Lys Ile Gln Trp Tyr Lys Asp Ser Leu Leu Leu
165 170 175Asp Lys Asp Asn Glu Lys Phe Leu Ser Val Arg Gly Thr Thr
His Leu 180 185 190Leu Val His Asp Val Ala Leu Glu Asp Ala Gly Tyr
Tyr Arg Cys Val 195 200 205Leu Thr Phe Ala His Glu Gly Gln Gln Tyr
Asn Ile Thr Arg Ser Ile 210 215 220Glu Leu Arg Ile Lys Lys Lys Lys
Glu Glu Thr Ile Pro Val Ile Ile225 230 235 240Ser Pro Leu Lys Thr
Ile Ser Ala Ser Leu Gly Ser Arg Leu Thr Ile 245 250 255Pro Cys Lys
Val Phe Leu Gly Thr Gly Thr Pro Leu Thr Thr Met Leu 260 265 270Trp
Trp Thr Ala Asn Asp Thr His Ile Glu Ser Ala Tyr Pro Gly Gly 275 280
285Arg Val Thr Glu Gly Pro Arg Gln Glu Tyr Ser Glu Asn Asn Glu Asn
290 295 300Tyr Ile Glu Val Pro Leu Ile Phe Asp Pro Val Thr Arg Glu
Asp Leu305 310 315 320His Met Asp Phe Lys Cys Val Val His Asn Thr
Leu Ser Phe Gln Thr 325 330 335Leu Arg Thr Thr Val Lys Glu Ala Ser
Ser Thr Phe Ser Trp Gly Ile 340 345 350Val Leu Ala Pro Leu Ser Leu
Ala Phe Leu Val Leu Gly Gly Ile Trp 355 360 365Met His Arg Arg Cys
Lys His Arg Thr Gly Lys Ala Asp Gly Leu Thr 370 375 380Val Leu Trp
Pro His His Gln Asp Phe Gln Ser Tyr Pro Lys385
390 395168576PRTMus musculus 168Met Glu Asn Met Lys Val Leu Leu Gly
Leu Ile Cys Leu Met Val Pro1 5 10 15Leu Leu Ser Leu Glu Ile Asp Val
Cys Thr Glu Tyr Pro Asn Gln Ile 20 25 30Val Leu Phe Leu Ser Val Asn
Glu Ile Asp Ile Arg Lys Cys Pro Leu 35 40 45Thr Pro Asn Lys Met His
Gly Asp Thr Ile Ile Trp Tyr Lys Asn Asp 50 55 60Ser Lys Thr Pro Ile
Ser Ala Asp Arg Asp Ser Arg Ile His Gln Gln65 70 75 80Asn Glu His
Leu Trp Phe Val Pro Ala Lys Val Glu Asp Ser Gly Tyr 85 90 95Tyr Tyr
Cys Ile Val Arg Asn Ser Thr Tyr Cys Leu Lys Thr Lys Val 100 105
110Thr Val Thr Val Leu Glu Asn Asp Pro Gly Leu Cys Tyr Ser Thr Gln
115 120 125Ala Thr Phe Pro Gln Arg Leu His Ile Ala Gly Asp Gly Ser
Leu Val 130 135 140Cys Pro Tyr Val Ser Tyr Phe Lys Asp Glu Asn Asn
Glu Leu Pro Glu145 150 155 160Val Gln Trp Tyr Lys Asn Cys Lys Pro
Leu Leu Leu Asp Asn Val Ser 165 170 175Phe Phe Gly Val Lys Asp Lys
Leu Leu Val Arg Asn Val Ala Glu Glu 180 185 190His Arg Gly Asp Tyr
Ile Cys Arg Met Ser Tyr Thr Phe Arg Gly Lys 195 200 205Gln Tyr Pro
Val Thr Arg Val Ile Gln Phe Ile Thr Ile Asp Glu Asn 210 215 220Lys
Arg Asp Arg Pro Val Ile Leu Ser Pro Arg Asn Glu Thr Ile Glu225 230
235 240Ala Asp Pro Gly Ser Met Ile Gln Leu Ile Cys Asn Val Thr Gly
Gln 245 250 255Phe Ser Asp Leu Val Tyr Trp Lys Trp Asn Gly Ser Glu
Ile Glu Trp 260 265 270Asn Asp Pro Phe Leu Ala Glu Asp Tyr Gln Phe
Val Glu His Pro Ser 275 280 285Thr Lys Arg Lys Tyr Thr Leu Ile Thr
Thr Leu Asn Ile Ser Glu Val 290 295 300Lys Ser Gln Phe Tyr Arg Tyr
Pro Phe Ile Cys Val Val Lys Asn Thr305 310 315 320Asn Ile Phe Glu
Ser Ala His Val Gln Leu Ile Tyr Pro Val Pro Asp 325 330 335Phe Lys
Asn Tyr Leu Ile Gly Gly Phe Ile Ile Leu Thr Ala Thr Ile 340 345
350Val Cys Cys Val Cys Ile Tyr Lys Val Phe Lys Val Asp Ile Val Leu
355 360 365Trp Tyr Arg Asp Ser Cys Ser Gly Phe Leu Pro Ser Lys Ala
Ser Asp 370 375 380Gly Lys Thr Tyr Asp Ala Tyr Ile Leu Tyr Pro Lys
Thr Leu Gly Glu385 390 395 400Gly Ser Phe Ser Asp Leu Asp Thr Phe
Val Phe Lys Leu Leu Pro Glu 405 410 415Val Leu Glu Gly Gln Phe Gly
Tyr Lys Leu Phe Ile Tyr Gly Arg Asp 420 425 430Asp Tyr Val Gly Glu
Asp Thr Ile Glu Val Thr Asn Glu Asn Val Lys 435 440 445Lys Ser Arg
Arg Leu Ile Ile Ile Leu Val Arg Asp Met Gly Gly Phe 450 455 460Ser
Trp Leu Gly Gln Ser Ser Glu Glu Gln Ile Ala Ile Tyr Asn Ala465 470
475 480Leu Ile Gln Glu Gly Ile Lys Ile Val Leu Leu Glu Leu Glu Lys
Ile 485 490 495Gln Asp Tyr Glu Lys Met Pro Asp Ser Ile Gln Phe Ile
Lys Gln Lys 500 505 510His Gly Val Ile Cys Trp Ser Gly Asp Phe Gln
Glu Arg Pro Gln Ser 515 520 525Ala Lys Thr Arg Phe Trp Lys Asn Leu
Arg Tyr Gln Met Pro Ala Gln 530 535 540Arg Arg Ser Pro Leu Ser Lys
His Arg Leu Leu Thr Leu Asp Pro Val545 550 555 560Arg Asp Thr Lys
Glu Lys Leu Pro Ala Ala Thr His Leu Pro Leu Gly 565 570
575169410PRTMus musculus 169Met Phe Ile Leu Leu Val Leu Val Thr Gly
Val Ser Ala Phe Thr Thr1 5 10 15Pro Thr Val Val His Thr Gly Lys Val
Ser Glu Ser Pro Ile Thr Ser 20 25 30Glu Lys Pro Thr Val His Gly Asp
Asn Cys Gln Phe Arg Gly Arg Glu 35 40 45Phe Lys Ser Glu Leu Arg Leu
Glu Gly Glu Pro Val Val Leu Arg Cys 50 55 60Pro Leu Ala Pro His Ser
Asp Ile Ser Ser Ser Ser His Ser Phe Leu65 70 75 80Thr Trp Ser Lys
Leu Asp Ser Ser Gln Leu Ile Pro Arg Asp Glu Pro 85 90 95Arg Met Trp
Val Lys Gly Asn Ile Leu Trp Ile Leu Pro Ala Val Gln 100 105 110Gln
Asp Ser Gly Thr Tyr Ile Cys Thr Phe Arg Asn Ala Ser His Cys 115 120
125Glu Gln Met Ser Val Glu Leu Lys Val Phe Lys Asn Thr Glu Ala Ser
130 135 140Leu Pro His Val Ser Tyr Leu Gln Ile Ser Ala Leu Ser Thr
Thr Gly145 150 155 160Leu Leu Val Cys Pro Asp Leu Lys Glu Phe Ile
Ser Ser Asn Ala Asp 165 170 175Gly Lys Ile Gln Trp Tyr Lys Gly Ala
Ile Leu Leu Asp Lys Gly Asn 180 185 190Lys Glu Phe Leu Ser Ala Gly
Asp Pro Thr Arg Leu Leu Ile Ser Asn 195 200 205Thr Ser Met Asp Asp
Ala Gly Tyr Tyr Arg Cys Val Met Thr Phe Thr 210 215 220Tyr Asn Gly
Gln Glu Tyr Asn Ile Thr Arg Asn Ile Glu Leu Arg Val225 230 235
240Lys Gly Thr Thr Thr Glu Pro Ile Pro Val Ile Ile Ser Pro Leu Glu
245 250 255Thr Ile Pro Ala Ser Leu Gly Ser Arg Leu Ile Val Pro Cys
Lys Val 260 265 270Phe Leu Gly Thr Gly Thr Ser Ser Asn Thr Ile Val
Trp Trp Leu Ala 275 280 285Asn Ser Thr Phe Ile Ser Ala Ala Tyr Pro
Arg Gly Arg Val Thr Glu 290 295 300Gly Leu His His Gln Tyr Ser Glu
Asn Asp Glu Asn Tyr Val Glu Val305 310 315 320Ser Leu Ile Phe Asp
Pro Val Thr Arg Glu Asp Leu His Thr Asp Phe 325 330 335Lys Cys Val
Ala Ser Asn Pro Arg Ser Ser Gln Ser Leu His Thr Thr 340 345 350Val
Lys Glu Val Ser Ser Thr Phe Ser Trp Ser Ile Ala Leu Ala Pro 355 360
365Leu Ser Leu Ile Ile Leu Val Val Gly Ala Ile Trp Met Arg Arg Arg
370 375 380Cys Lys Arg Arg Ala Gly Lys Thr Tyr Gly Leu Thr Lys Leu
Arg Thr385 390 395 400Asp Asn Gln Asp Phe Pro Ser Ser Pro Asn 405
4101705PRTartificial sequencesynthesized sequence 170Gly Gly Lys
Gly Gly1 51713PRTartificial sequencesynthesized sequence 171Cys Gly
Gly117210PRTartificial sequencesynthesized sequence 172Cys Gly Asp
Lys Thr His Thr Ser Pro Pro1 5 1017317PRTartificial
sequencesynthesized sequence 173Cys Gly Gly Pro Lys Pro Ser Thr Pro
Pro Gly Ser Ser Gly Gly Ala1 5 10 15Pro1746PRTartificial
sequencesynthesized sequence 174Gly Cys Gly Gly Gly Gly1
51753PRTartificial sequencesynthesized sequence 175Gly Cys
Gly11765PRTartificial sequencesynthesized sequence 176Gly Gly Gly
Gly Ser1 51779PRTartificial sequencesynthesized sequence 177Gly Cys
Gly Ser Gly Gly Gly Gly Ser1 51783PRTartificial sequencesynthesized
sequence 178Gly Gly Cys11793PRTartificial sequencesynthesized
sequence 179Gly Gly Cys118010PRTartificial sequencesynthesized
sequence 180Asp Lys Thr His Thr Ser Pro Pro Cys Gly1 5
1018118PRTartificial sequencesynthesized sequence 181Pro Lys Pro
Ser Thr Pro Pro Gly Ser Ser Gly Gly Ala Pro Gly Gly1 5 10 15Cys
Gly1826PRTartificial sequencesynthesized sequence 182Gly Gly Gly
Gly Cys Gly1 51833PRTartificial sequencesynthesized sequence 183Gly
Cys Gly11845PRTartificial sequencesynthesized sequence 184Ser Gly
Gly Gly Gly1 518510PRTartificial sequencesynthesized sequence
185Gly Ser Gly Gly Gly Gly Ser Gly Cys Gly1 5 101866PRTartificial
sequencesynthesized sequence 186Gly Gly Lys Lys Gly Cys1
51876PRTartificial sequencesynthesized sequence 187Cys Gly Lys Lys
Gly Gly1 51884PRTartificial sequencesynthesized sequence 188Gly Gly
Cys Gly11893PRTartificial sequencesynthesized sequence 189Gly Ser
Gly119011PRTartificial sequencesynthesized sequence 190Leu Glu His
His His His His His Gly Gly Cys1 5 1019121PRTartificial
sequencesynthesized sequence 191Met Glu Val Gly Trp Tyr Arg Ser Pro
Phe Ser Arg Val Val His Leu1 5 10 15Tyr Arg Asn Gly Lys
2019231DNAartificial sequencesynthesized sequence 192gatccggagg
tggtgtcccc attagacagc t 3119327DNAartificial sequencesynthesized
sequence 193gtaagcttag gaagacacag attccat 2719437DNAartificial
sequencesynthesized sequence 194gatccggagg tggtgcccct gtacgatcac
tgaactg 3719537DNAartificial sequencesynthesized sequence
195gtatgcatta ggaagacaca aattgcatgg tgaagtc 37
* * * * *