U.S. patent application number 12/828624 was filed with the patent office on 2011-01-27 for means and methods for the specific inhibition of genes in cells and tissue of the cns and/or eye.
Invention is credited to Frank GOHRING, Ralf Wilhelm SCHULTE.
Application Number | 20110021605 12/828624 |
Document ID | / |
Family ID | 47711411 |
Filed Date | 2011-01-27 |
United States Patent
Application |
20110021605 |
Kind Code |
A1 |
SCHULTE; Ralf Wilhelm ; et
al. |
January 27, 2011 |
MEANS AND METHODS FOR THE SPECIFIC INHIBITION OF GENES IN CELLS AND
TISSUE OF THE CNS AND/OR EYE
Abstract
Described is a method for the specific modulation of the
expression of target genes in cells and/or tissues of the CNS
and/or eye, wherein a composition comprising one or more doubled
stranded oligoribonucleotides (dsRNA) is introduced into the cell,
tissue or organism outside the blood-brain or blood-retina
barriers. Furthermore, a method for the identification and
validation of the function of a gene is provided, wherein the
method provides a test cell, test tissue or test organism, which
allow information to be gained on the function of the target gene.
In addition, compositions and kits are described useful for those
methods. In particular, components and methods for the diagnostic
use and/or therapy of disorders related to the CNS and/or eye are
provided which are based on RNA interference.
Inventors: |
SCHULTE; Ralf Wilhelm;
(Munich, DE) ; GOHRING; Frank; (Wurzburg,
DE) |
Correspondence
Address: |
PEPPER HAMILTON LLP
ONE MELLON CENTER, 50TH FLOOR, 500 GRANT STREET
PITTSBURGH
PA
15219
US
|
Family ID: |
47711411 |
Appl. No.: |
12/828624 |
Filed: |
July 1, 2010 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10511656 |
Apr 18, 2005 |
|
|
|
PCT/EP03/04002 |
Apr 16, 2003 |
|
|
|
12828624 |
|
|
|
|
60431173 |
Dec 5, 2002 |
|
|
|
Current U.S.
Class: |
514/44A ;
435/6.1; 800/9 |
Current CPC
Class: |
A61P 37/00 20180101;
A61P 25/32 20180101; A61P 25/00 20180101; G01N 33/6893 20130101;
C12N 15/1136 20130101; G01N 2500/00 20130101; C12N 2320/12
20130101; A61K 38/1709 20130101; A01K 2217/075 20130101; G01N
2800/28 20130101; G01N 2800/16 20130101; C12N 2320/32 20130101;
A61P 25/04 20180101; C12N 15/111 20130101; A61P 25/22 20180101;
A61P 25/06 20180101; A61P 25/16 20180101; A61P 25/28 20180101; G01N
33/6896 20130101; A61P 27/02 20180101; C12N 2310/14 20130101; A61P
25/20 20180101; A61P 43/00 20180101; A61K 31/713 20130101; A61P
25/24 20180101; C12N 2320/30 20130101; A01K 2217/00 20130101; G01N
33/5091 20130101; A61P 9/10 20180101; C12N 15/113 20130101; A61P
9/00 20180101 |
Class at
Publication: |
514/44.A ; 435/6;
800/9 |
International
Class: |
A61K 31/7052 20060101
A61K031/7052; C12Q 1/68 20060101 C12Q001/68; A01K 67/00 20060101
A01K067/00; A61P 25/00 20060101 A61P025/00; A61P 27/02 20060101
A61P027/02 |
Foreign Application Data
Date |
Code |
Application Number |
Apr 18, 2002 |
EP |
EP02008761.5 |
Claims
1-47. (canceled)
48. A method of delivering one or more oligoribonucleotides across
the blood-brain or the blood-retina barrier comprising introducing
a composition comprising one or more double-stranded
oligoribonucleotides (dsRNA) into a cell, tissue or organism
outside the blood-brain or blood-retina barriers, wherein said
dsRNA is trafficked across said blood-brain or blood-retina
barrier.
49. The method of claim 48, wherein said method results in the
provision of a test cell, test tissue or test organism, which can
be maintained under conditions allowing the degradation of the
corresponding mRNA of one or more of target genes by RNA
interference.
50. The method of claim 49 further comprising identifying or
validating the function of a gene, further comprising comparing a
resulting phenotype produced in the test cell, test tissue or test
organism with that of a suitable control, wherein the function of
the gene is identified or validated.
51. The method of claim 48, wherein the introduced dsRNS inhibits
expression of a target gene that is expressed behind the
blood-brain or blood-retina barrier.
52. The method of claim 51, wherein one or more of said target
genes encode a cellular mRNA.
53. The method of claim 48, wherein the cells, or tissues are
cells, or tissues of the eye.
54. The method of claim 48, wherein said cells or tissues are cells
or tissues of the inner segment of the eye ball.
55. The method of claim 54, wherein said cells are retinal
cells.
56. The method of claim 55, wherein said cells are cells of the
retinal pigment epithelium (RPE) or neurosensory retina cells.
57. The method of claim 48, wherein one or more of said target
genes are predominantly expressed in said cell or tissue.
58. The method of claim 48, wherein the expression of one or more
of said target genes is specific for said cell or tissue.
59. The method of claim 48, wherein said dsRNA molecules are
between 21 and 23 nucleotides in length.
60. The method of claim 48, wherein said dsRNA molecules contain a
terminal 3'-hydroxyl group.
61. The method of claim 48, wherein said dsRNA molecules are
chemically synthesized.
62. The method of claim 48, wherein said dsRNA molecules represent
an analogue of naturally occurring RNA.
63. The method of claim 62, wherein said dsRNA analogues differ
from a corresponding naturally occurring RNA by addition, deletion,
substitution or modification of one or more nucleotides.
64. The method of claim 48, wherein said dsRNA molecules inhibit
target genes by posttranscriptional silencing.
65. The method of claim 48, wherein said dsRNA molecules are
encoded by a vector.
66. The method of claim 65, wherein the expression of said dsRNA is
under control of a cell or tissue specific promoter.
67. The method of claim 48, wherein the dsRNA molecules are bound
to other molecules, combined with one or more suitable carriers, or
any combination thereof.
68. The method of claim 67, wherein the carrier is selected from a
micellar structure and a viral coat protein.
69. The method of claim 67, wherein the dsRNA is bound to molecules
selected from the group consisting of cationic porphyrins, cationic
polyamines, polymeric DNA-binding cations, fusogenic peptides, and
any combination thereof.
70. The method of claim 67, wherein the dsRNA molecules are
delivered continuously to the target cells or target tissues over a
defined period of time after application.
71. The method of claim 48, wherein said composition is introduced
by a method selected from the group consisting of iontophoresis,
retrobulbar application, systemic application, topical application
to the eye, or a combination of any thereof.
72. The method of claim 48, wherein the cells, tissues or organism
is a vertebrate.
73. The method of claim 48, wherein the cells, tissues or organism
is mammalian.
74. The method of claim 48, wherein the cells, tissues or organism
are human.
75. The method of claim 48, wherein the dsRNA contains two
symmetrical 3' overhangs of two nucleotides in length.
76. The method of claim 75, wherein the overhangs comprise
2'-deoxy-thymidine.
77. The method of claim 51, wherein the inhibition of target gene
expression treats a retinal disease.
78. The method of claim 51, wherein the inhibition of target gene
expression treats a degenerative retinal disease.
79. The method of claim 78, wherein the degenerative retinal
disease is selected from the group consisting of: primary
detachment of the retina, retinoblastoma, retinal astrocytoma,
angiomatosis retinae, Coats disease, Eales disease, retinopathia
centralis serosa, ocular albinism, retinitis pigmentosa, retinitis
punctata albescens, Usher's syndrome, Leber's congenital amaurosis,
cone dystrophy, vitelliforme macular degeneration, juvenile
retinoschisis, North Carolina macular dystrophy, Sorsby
fundus-dystrophy, Doyne's honeycombs, retinal dystrophy, Morbus
Stargardt, Wagner's vitreoretinal degeneration and age-dependent
macular degeneration.
80. The method of claim 78, wherein the degenerative retinal
disease is age-dependent macular degeneration.
81. The method of claim 68, wherein the micellar structure is a
liposome.
82. The method of claim 68, wherein the viral coat protein is
derived from a virus selected from the group consisting of a
cytomegalovirus, an adeno-associated virus and an adenovirus.
Description
[0001] The present invention relates to the specific modulation of
the expression of genes in cells and tissues of the CNS and/or the
eye. In particular, the present invention relates to the use of one
or more double-stranded oligoribonucleotides (dsRNA) for the
preparation of a composition for the specific modulation of the
expression of one or more target genes in cells and/or tissues of
the CNS and/or eye of a subject, wherein said composition is
designed to be applied outside the blood-brain or blood-retina
bathers. The instant invention further relates to methods for the
identification and validation, respectively, of the function of a
gene comprising the mentioned use of dsRNA for providing a test
cell, test tissue or test organism and comparing the resulting
phenotype with that of a suitable control, thus allowing
information on the function of the gene to be gained. In addition,
the present invention relates to cells, tissue and non-human
organisms obtainable by the method of the invention, wherein said
organisms preferably display of phenotype of a CNS or eye disease.
Furthermore, the present invention relates to the use of RNA
interference technique for the diagnosis and/or therapy of
disorders related to CNS and/or eye and to method of identification
and isolation of drugs capable of specific modulation of the
expression of a target gene in cells and/or tissues of the eye
making use of the afore-mentioned methods.
[0002] Several documents are cited throughout the text of this
specification. Each of the documents cited herein (including any
manufacturer's specifications, instructions, etc.) are hereby
incorporated herein by reference; however, there is no admission
that any document cited is indeed prior art as to the present
invention.
[0003] The human eye is an organ of extraordinary complexity, the
specific function of particular structures and tissues of which are
coordinated in such a way as to ensure optimal process of seeing,
from impact of the light ray on the lens to transformation into
electrical impulses and the transmission into the areas of the
brain responsible for conscious perception. Particularly, tissues
at the back of the eye such as the multi-layer retina, in which
functionally highly specialized types of cells mediate the
transformation of light energy to electrical impulses, and also the
retinal pigment epithelium (RPE) are characterized by an extremely
high metabolic activity. The active supply of photoreceptors with
nutrients from the blood circulation and the simultaneous removal
and processing of degradation products of the visual process, takes
place via the RPE, which in turn is separated from the blood
vessels of the choriocapillaris by Bruch's membrane. The exchange
of substances via the RPE and Bruch's membrane is controlled and
specific, and on the basis of this functional analogy to the
blood-brain barrier one refers to a blood-retina barrier in this
case.
[0004] The activity of numerous, often specifically expressed genes
is necessary for controlling and carrying out the phototransduction
process in the cells of the retina and the metabolic exchange
across the blood-retina barrier, and furthermore also for
maintaining the structure and functional integrity of numerous
components of the tissues of the back of the eye. This unique and
highly developed system is therefore very susceptible to numerous
genetic defects, expressed in a broad phenotypical range of retinal
diseases.
[0005] Like the human central nervous system the human eye is an
organ characterized by high complexity and the coordinated
functioning of numerous specific structures and tissues. Both are
protected by barriers (tear secretion, enzymes, transport
mechanisms, blood-retina and blood-CNS barrier) against harmful
environmental influences. Like the blood-brain barrier, the
blood-retina barrier also represents a physiological barrier for
the uptake of medication by the inner part of the eye, and makes
pharmacological therapy of ocular diseases very difficult
indeed--if at all possible--at the present state of technology.
[0006] Medication currently available on the market for the
treatment of disorders of the CNS including opthalmological
diseases is therefore almost exclusively available for treatment of
clinical symptoms often associated with side effects due to the
high doses necessary. A causal therapy of the CNS, and particularly
of the back sections of the eye, was not possible apart from the
injections. Furthermore, the current state of information on the
complex molecular metabolic interrelationship underlying the
etiology of retinal diseases of multi-factorial origin is only
limited. Consequently, medicaments available on the market are
suitable to treat the symptoms of such diseases only.
[0007] In view of the need of therapeutic means for the treatment
of diseases related to CNS and/or the eye, the technical problem of
the present invention is to provide means and methods for the
identification and modulation of genes involved in disorders of the
CNS and/or the eye.
[0008] More specifically, the technical problem of present
invention is to provide non-invasive methods for the controlled
modulation of target genes and gene products in the mammalian CNS
and/or eye while overcoming the blood-brain and/or blood retina
barrier without injuring it.
[0009] This is also relevant for example, for the application of
so-called single-stranded antisense oligonucleotides for the
inhibition of expression of target genes, whose application to the
eye necessitates intravitreal injection. Overcoming the
blood-retina barrier thus represents a technical problem in the
therapy of ocular diseases by specific inhibition of protein
expression in the eye tissue.
[0010] The solution to said technical problem is achieved by
providing the embodiments characterized in the claims, and
described further below.
[0011] Thus, the present invention relates to the use of one or
more double-stranded oligoribonucleotides (dsRNA) for the
preparation of a composition for the specific modulation of the
expression of one or more target genes in cells and/or tissues of
the CNS and/or eye of a subject, wherein said composition is
designed to be applied outside the blood-brain or blood-retina
barriers. Likewise, the present invention relates to a method for
the specific modulation of the expression of target genes in cells
and/or tissues of the CNS and/or eye, wherein a composition
comprising one or more double-stranded oligoribonucleotides (dsRNA)
is introduced into a cell, tissue or organism outside the
blood-brain or blood-retina barriers; wherein preferably said
method results in the provision of a non-human organism comprising
cells and/or tissue containing said dsRNA, and wherein said
organism or the corresponding test cells or tissue are maintained
under conditions allowing the degradation of the corresponding mRNA
of one or more target genes by RNA interference.
[0012] The present invention is based on the surprising finding
that in contrast to wide-spread professional opinion active
substances of the invention are able to cross the blood-retina
barrier as a physiological barrier, enabling a systemic or local
application on the outer side of the eye for specific treatment of
a disease in the back of the eye.
[0013] Due to the high similarity in function as well as cellular
and molecular architecture of the blood-retina and blood-brain
barrier the methods and pharmaceutical compositions provided by the
present invention are also be expected to cross the blood-brain
barrier and thereby applicable to the treatment of diseases of the
CNS.
[0014] Thus, the present invention provides improved methods as
well as components for the treatment of CNS and/or eye
diseases.
[0015] The fundamental idea of the present invention concerns a
method for the specific inhibition of the expression of target
genes in cells and tissues of the CNS and/or eye, by [0016]
delivery of one or more double-stranded oligoribonucleotides
(dsRNA) outside the blood-retina or blood-brain barrier, [0017] the
double-stranded oligoribonucleotides (dsRNA) crossing the
respective barrier and modulation of the expression of the
corresponding mRNA of one or more target genes by RNA
interference.
[0018] Hence, in accordance with the present invention the
compositions comprising a dsRNA capable of modulating a target gene
or gene product in the CNS or the eye are preferably designed to be
administered without any substantial, i.e. substantially effective
amount of delivery-enhancing agents facilitating passage of
compounds through the blood-brain barrier and/or without the
necessity of applying invasive methods and devices; see, e.g.,
those compounds, methods and devices described in US2002183683 and
WO03/000018.
[0019] The method for specific inhibition of genes by
double-stranded oligoribonucleotides (dsRNA) is known from WO
01/75164. The disclosure of this application is hereby incorporated
by reference into the present description. This application
describes that double-stranded oligoribonucleotides (dsRNA) induce
specific degradation of mRNA after delivery to the target cells.
The specificity of this process is mediated by the complementarity
of one of the two dsRNA strands to the mRNA of the target gene. The
process of gene-specific, post-transcriptional switching off of
genes by dsRNA molecules is referred to as RNA interference (RNAi).
This term was originally developed by Fire and co-workers to
describe the observation that delivery of dsRNA molecules to the
threadworm Caenorhabditis elegans blocks gene expression (Fire et
al., 1999). Subsequently, RNAi could also be demonstrated in
plants, protozoa, insects (Kasschau and Carrington 1998) and
recently also in mammalian cells (Caplen et al., 2001; Elbashir et
al., 2001). The mechanism by which RNAi suppresses gene expression
is not yet fully understood. Studies of non-mammalian cells have
shown that dsRNA molecules are transformed into small interfering
RNA molecules (siRNA molecules) by endogenous ribonucleases
(Bernstein et al., 2001; Grishok et al., 2001; Hamilton and
Baulcombe, 1999; Knight and Bass, 2001; Zamore et al., 2000). The
21 to 23 by long siRNA molecules are thus the actual mediators of
the degradation of the mRNA of the target gene. For the specific
inhibition of a target gene, it suffices that a double-stranded
oligoribonucleotide exhibits a sequence of 21 to 23 nucleotides
(base pairs) in length identical to the target gene; see, e.g.,
Elbashir et al., Methods 26 (2002), 199-213 and Martinez et al.,
Cell 110 (2002), 563-574
[0020] The technical problem of a targeted application of active
substances to the CNS and the eye, particularly to the back of the
eye is due to the structure of the human eye and brain, whose
barriers prevent active substance from reaching the target tissue.
Current treatments are associated with considerable side effects
and expected to have long-term consequences. Direct application,
e.g. by injection into the back of the eye, is very unpleasant for
the person concerned, especially when repeated or chronic treatment
is necessary. Furthermore, direct application into the bulb is
associated with considerable side effects and the medium-term
occurrence of secondary disorders respectively, such as cataract
and glaucoma. Systemic application on the other hand generally
gives rise to side effects outside the target organs eye and
brain--often without significant quantities of active substance
being detectable in the target tissue. Even with sufficient target
specificity, which would minimize the risk of unwanted side effects
of systemic application, this method of application remains
inefficient, since the target tissue and target cells are located
beyond the blood-brain or blood-retina barrier and the active
substance is not able to reach its site of activity because of the
stringent activity of this barrier. This problem has been solved by
the present invention.
[0021] Medication for the treatment of opthalmological diseases
currently on the market is almost exclusively available for
treatment of clinical symptoms of the front of the eye, since the
relatively easy application of eye drops is possible in this case.
A causal therapy, particularly of the back sections of the eye, is
not possible with conventional pharmaceutical compositions apart
from the injections associated with side effects described
earlier.
[0022] CNS related disorders are currently treated mainly by
systemic application. In some cases surgery or stimulation by
implanted probes, as for example in Parkinson disease, can relieve
the symptoms but do not treat the cause of the disease.
[0023] As a solution to this technical problem the present
invention provides a method for the specific intervention in
diseases of the CNS or the back of the eye on a molecular level,
without requiring direct application to the target tissue. The
present invention opens up comprehensively the broad not yet or
only unsatisfactorily addressable therapeutic field of diseases of
the CNS, the inner eye and the back of the eye, in particular the
inner segment of the eye ball. The intervention is based on an
inhibition of genes expressed specifically or predominantly in the
target tissues of CNS or the eye, respectively, characterized by
the ability of the required active substances to cross the
blood-brain and/or the blood-retina barrier, allowing systemic or
local application outside the respective barrier.
[0024] Examples for CNS disorders are, for example, Alzheimer's
disease, Parkinson disease, depression, bipolar disorder,
schizophrenia, amnesia, migraine-headache, stroke, insomnia,
alcohol abuse, anxiety, obsessive compulsive disorder, cerebral
acquired human immuno-deficiency syndrome, chronic pain and many
others.
[0025] The compositions of the invention may be administered
locally or systemically e.g., intravenously. Preparations for
parenteral administration include sterile aqueous or non-aque-ous
solutions, suspensions, and emulsions. Examples of non-aqueous
solvents are propylene glycol, polyethylene glycol, vegetable oils
such as olive oil, and injectable organic esters such as ethyl
oleate. Aqueous carriers include water, alcoholic/aqueous
solutions, emulsions or suspensions, including saline and buffered
media. Parenteral vehicles include sodium chloride solution,
Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's,
or fixed oils. Intravenous vehicles include fluid and nutrient
replenishers, electrolyte replenishers (such as those based on
Ringer's dextrose), and the like. Preservatives and other additives
may also be present such as, for example, antimicrobials,
anti-oxidants, chelating agents, and inert gases and the like.
Furthermore, the pharmaceutical composition of the invention may
comprise further agents such as interleukins or interferons
depending on the intended use of the pharmaceutical
composition.
[0026] In accordance with the present invention the pharmaceutical
compositions are administered to a subject in an effective dose of
between about 0.1 .mu.g to about 10 mg units/day and/or units/kg
body weigth, preferably between about 0.1 and 2.0 mg. The
appropiate dose can also be determined as descibed further below
and in the examples.
[0027] In a preferred embodiment the use according to the present
invention is directed to the treatment of a discorder such as of
the CNS described above. Most preferably, the disorder to be
treated is related to eye. Such disorders include chorioretinitis
and herpes retinitis, which may be considered as acquired forms of
retinal disease, the majority of retinal disease disorders are
reduced to a genetic predisposition. These include for example
primary retinal detachment (ablatio retinae), retinal blastoma,
retinal astrocytoma (Bourneville-Pringle), angiomatosis retinae
(Hippel-Lindau), Coat's disease (exudative retinitis), Eale's
disease, central serous retinopathy, ocular albinism, retinitis
pigmentosa, retinitis punctata albescens, Usher syndrome, Leber's
congenital amaurosis, cone dystrophy, vitelliform macular
degeneration (Best's disease), juvenile retinoschisis, North
Carolina macular dystrophy, Sorsby's fundus dystrophy, Doyne's
honey comb retinal dystrophy (Malattia Leventinese), Stargardt's
disease, Wagner vitreoretinal degeneration or Age-related macular
degeneration (AMD) as well as single-gene retinopathies like Morbus
Best or Morbus Stargardt. Various genetic defects are known which
lead or predispose to this wide range of eye disease
phenotypes.
[0028] Therefore, in a preferred embodiment of the methods and uses
of the present invention cells of the retinal pigment epithelium
(RPE), neurosensory retina and/or choriodea are particularly
preferred. In a particularly embodiment of the present invention,
the disorder to be treated is wet age-related macular degeneration
(AMD) or diabetic retinopathy.
[0029] The following description deals with AMD as example for a
complex eye disease with a genetic component. The example shall
illustrate the associated technical problems with reference to the
study of molecular causes and the development of diagnostic and
pharmacological intervention strategies.
[0030] AMD, which can be thought as a sub-type of retinal
degeneration, is the most common cause of visual morbidity in the
developed world with a prevalence increasing from 9% in persons
over 52 years to more than 25% in persons over the age of 75
(Paetkau et al. 1978, Leibowitz et al. 1980, Banks and Hutton 1981,
Ghafour et al. 1983, Hyman 1987, Hyman et al. 1983, Grey et al.
1989, Yap and Weatherill 1989, Heiba et al. 1994).
[0031] AMD is a complex disease caused by exogenous as well as
endogenous factors (Meyers and Zachary 1988; Seddon et al. 1997).
In addition to environmental factors, several personal risk factors
such as hypermetropia, light slcin and iris colour, elevated serum
cholesterol levels, hypertension or cigarette smoking have been
suggested (Hyman et al. 1983, Klein et al. 1993, Sperduto and
Hiller 1986, The Eye Disease Case-Control Study Group 1992,
Bressler and Bressler 1995). A genetic component for AMD has been
documented by several groups (Gass 1973, Piguet et al. 1993,
Silvestri et al. 1994) and has lead to the hypothesis that the
disease may be triggered by environmental/individual factors in
those persons who are genetically predisposed. The number of genes
which, when mutated, can confer susceptibility to AMD is not known
but may be numerous.
[0032] With recent physical approaches for the treatment of AMD
such as laser photocoagulation, photodynamic therapy (using
verteprofin, trade name Visudyn.RTM., Novartis), irradiation or
surgical therapies, success was only achieved with a moderate
percentage of the patients. genetic heterogeneity make it difficult
to apply conventional approaches for the identification of genes
predisposing to AMD. Due to the complexity of the clinical
phenotype, it may be assumed that the number of genes is large,
which, when mutated contribute to AMD susceptibility.
[0033] Hence, the methods, uses and compositions of the present
invention described herein represent an important improvement and
alternative therapeutic intervention for the treatment of this
particular disease as well as of others. For those embodiments the
pharmaceutical compositions are preferably designed to be effective
in (and applied to) the posterior segment of the eye, preferably in
a form designed to be applied outside the retinal region of the
blood-retina barrier.
[0034] As mentioned before, the compound used in accordance with
the present invention is dsRNA, which usually substantially
consists of ribonucleotides which preferbly contain a portion of
double-stranded oligoribonucleotides (dsRNA). Desirably, the region
of the double stranded RNA that is present in a double stranded
conformation includes at least 5, 10, 20, 30, 50, 75, 100 or 200.
Preferably, the double stranded region includes between 15 and 30
nucleotides, most preferably 20 to 25 and particularly preferred 21
to 23 nucleotides. Secondary structure prediction and in vitro
accessibility of mRNA as tools in the selection of target sites is
described for example in Amarzguioui, Nucleic Acids Res. 28 (2000),
4113-4124. Minimising the secondary structure of DNA targets by
incorporation of a modified deoxynucleoside: implications for
nucleic acid analysis by hybridisation is described in Nguyen,
Nucleic Acids Res. 28 (2000), 3904-3909.
[0035] The dsRNA molecule can also contain a terminal 3'-hydroxyl
group and may represent an analogue of naturally occurring RNA,
differing from the nucleotide sequence of said gene or gene product
by addition, deletion, substitution or modification of one or more
nucleotides. General processes of introducing an RNA into a living
cell to inhibit gene expression of a target gene in that cell
comprising RNA with double-stranded structure, i.e. dsRNA or RNAi
are known to the person skilled in the art and are described, for
in WO99/32619, WO01/68836, WO01/77350, WO00/44895, WO02/055692 and
WO02/055693, the disclosure content of which is hereby incorporated
by reference.
[0036] Preferably, the target gene subject of the RNA interference
is predominantly or more preferably specifically expressed in said
cell and/or tissue of the CNS and/or eye.
[0037] Another technical problem consists in the identification of
genes, which cause CNS and retinal diseases as well as in the
validation of these genes as targets for diagnosis and for
pharmacological intervention. Conventional experimental strategies
are often difficult to apply. The low penetration and/or incidence
or the occurrence of symptoms only late in life, as for AMD, which
is generally diagnosed in the 7.sup.th decade of life, hampers the
identification of genes involved in the etiology. Positional
cloning is often not possible since linkage studies lead to
conflicting results or are altogether impossible due to the small
number of patients and afflicted families. Similarly, linkage
studies might be inconclusive when the group of patients to be
studied includes individuals who suffer from a disorder different
to the disease whose etiology is to be elucidated. This might
happen if two or more disorders have identical or very similar
symptoms, which are difficult to diagnose differentially as is the
case for many CNS disorders. Schizophrenia e.g. is thought to be
caused by several different etiologies with a large number of genes
involved.
[0038] Hence, in a further aspect the present invention relates to
a method for the specific modulation of the expression of target
genes in cells and/or tissues of the CNS and/or eye, wherein a
composition comprising one or more double-stranded
oligoribonucleotides (dsRNA) is introduced into a cell, tissue or
organism outside the blood-brain or blood-retina barriers. These
cells, tissues or organisms can on one hand be used for the
validation of identified target genes and on the other hand for the
identification of such target genes itself by the following steps:
[0039] degradation of the corresponding mRNA of one or more target
genes [0040] providing and maintenance of a test cell or test
tissue, in which the corresponding mRNA of one or more target genes
is/are degraded, and preferably [0041] observation and comparison
of the generated phenotype of the produced test cell or test tissue
with that of a suitable control cell or control tissue, in order to
obtain information on the functions of the genes.
[0042] In a preferred embodiment and as described in the examples
this means that the test cell or tissue provided is derived from
the animal to which the composition mentioned above has been
applied to. Assaying the test cell or tissue can thus be done in
vivo or in vitro, for example after the subject cells or tissue
have been isolated from the animal, in particular, mammalian
animals are preferred.
[0043] Means and methods for identifying nucleotide acid sequences
that modulate the function of a cell, the expression of a gene in a
cell, or the biological activity of a target polypeptide in a cell,
which are based on a sole cell culture based method are described
for example in EP 1 229 134 A2. However, the technical details
concerning selection of doubled stranded RNA, RNA expression
vectors, etc. can be obtained from the prior art such as mentioned
European patent application EP 1 229 134 A2 and adapted to the
method of the invention, which is performed on the basis of an
animal system, i.e. wherein the test cell or the test tissue is
preferably comprised in a non-human animal, at least when applying
the one or more double stranded RNA molecules. Target gene function
can be followed by observing a responsive change in the phenotype
of said cell, tissue or animal, when appying the dsRNA, wherein
said phenotype is preferably related to a disorder of the CNS
and/or eye.
[0044] In a preferred embodiment of the present invention, the use
or method described earlier said specific modulation of the
expression being an inhibition of target gene expression. Said one
or more of said target genes preferably encode a cellular mRNA. As
mentioned before, the target cells and/or tissues are cells and/or
tissues of the eye.
[0045] In a embodiment of the present invention said cells or
tissues are cells or tissues of the inner segment of the eye ball,
preferably retinal cells, and particularly preferred cells of the
retinal pigment epithelium (RPE) or neurosensory retina cells.
[0046] Furthermore, the present invention relates to a drug or
pharmaceutical composition, which contains one or more
double-stranded oligoribonucleotides (dsRNA), that by means of RNA
interference, inhibits the expression of the corresponding mRNA of
one or more target genes, whose restricted functions cause an eye
disease, and which are applied outside the blood-retina barrier,
particularly outside the eye.
[0047] At the same time, the side effects associated with direct
application, e.g. by injection, based on the structure of the human
eye and which are very unpleasant for the persons concerned
especially on repeated or chronic treatment, and associated with
long-term consequences such as e.g. cataract and glaucoma, are
reduced in accordance with the invention. Double-stranded
oligoribonucleotides (dsRNA) are used in the present invention,
which cross the blood-retina barrier after application, in order to
elicit inhibition of the target genes in the target cells by RNA
interference of the corresponding mRNA molecules. The present
invention includes further a drug of dsRNA molecules for the
specific treatment of genetically caused eye diseases. The present
invention opens up the broad so far not or only unsatisfactorily
addressable therapeutic field of diseases of the inner eye and the
back of the eye.
[0048] Based on the specific functions of the cells of retinal
tissue and the RPE, it is presumed that genes, whose aberrant
function cause diseases in the back of the eye, are specifically
expressed in the tissues and cells of the back of the eye, thus
representing preferred targets for drug interventions. The effect
of modulating gene expression will be maximal with no or very
little side effects if genes are targeted that are specifically
expressed in the tissue of brain and/or eye. Therefore the present
invention includes embodiments of the uses or methods described
above, wherein one or more of said target genes are predominantly
expressed in said cell and/or tissue, or wherein the expression of
one or more of said target genes is specific for said cell and/or
tissue.
[0049] The solution of the technical problem underlying the present
invention consists of the provision of a method for the specific
inhibition of genes, whose aberrant functions are causally
associated with CNS or eye diseases of monogenic or multifactorial
origin. AMD for example may be taken as one form of degenerative
retinal disease.
[0050] As mentioned before, for the specific inhibition of a target
gene, it suffices that a double-stranded oligoribonucleotide
comprises a sequence of 21 to 23 nucleotides (base pairs) in length
identical or substantial identical to the target gene. The use or
method described above, wherein said dsRNA molecules are between 21
and 23 nucleotides in length is therefore a preferred embodiment of
the invention. Said dsRNA molecules can contain a terminal
3'-hydroxyl group, have been chemically synthesized and/or
represent an analogue of naturally occurring RNA. Said dsRNA
analogues can also differ from the corresponding naturally
occurring RNA by addition, deletion, substitution or modification
of one or more nucleotides. In a preferred embodiment said dsRNA
molecules inhibit the corresponding target genes by
"posttranscriptional silencing".
[0051] The central idea of the present invention is surprising in
so far as dsRNA molecules of a length of 21 to 23 nucleotides, are
able to cross the blood-retina barrier, and specifically inactivate
target genes in the tissues of the back of the eye, after systemic
application, for example by intravenous injection. This overcoming
the blood-retina barrier is all the more remarkable, because no
experiment could demonstrate overcoming this bather by dsRNA so
far. Due to the high similarity in function as well as cellular and
molecular architecture of the blood-retina and blood-brain barrier
the methods and pharmaceutical compositions provided by the present
invention will also be able to cross the blood-brain barrier and
thereby applicable to the treatment of diseases of the CNS.
[0052] The nucleotides can not only be applied as "naked" dsRNA,
preferred are embodiments, wherein said dsRNA molecules are encoded
by a vector.
[0053] Vectors and recombinant nucleic acid molecules that encode
dsRNA or appropriate engineered RNA precursors that expressed in a
cell are processed by the cell to produce target small interfering
RNAs (siRNAs) that selectively silence target genes (by cleaning
specific mRNAs) using the cells own RNA interference (RNAi) as
described in the literature, for example in WO 03/006477.
Appropriate regulatory sequences with which expression can be
selectively controlled both temporarily and specially i.e., at
particular times and/or in particular tissue, organs or cells are
known to the persons skilled in the art and are also described
inter alia in WO 03/006477, that disclosure content or which is
hereby incorporated by reference.
[0054] Particularly preferred are those, wherein the expression of
said dsRNA is under control of a cell and/or tissue specific
promoter. Vectors that can be used in accordance with the teaching
of the present invention are known to the person skilled in the
art; see, e.g., heritable and inducible genetic interference by
double-stranded RNA encoded by transgenes described in Tavemarakis
et al., Nat. Genet. 24 (2000), 180-183. Further vectors and methods
for gene transfer and generation of transgenic animals are
described in the prior art; see, e.g., adeno-associated virus
related vectors described in Qing et al., Virol. 77 (2003),
2741-2746; human immunodeficiency virus type 2 (HIV-2)
vector-mediated in vivo gene transfer into adult rabbit retina
described in Cheng et al. Curt Eye Res. 24 (2002), 196-201,
long-term transgene expression in the RPE after gene transfer with
a high-capacity adenoviral vector described in Kreppel et al.,
Invest. Opthalmol. Vis. Sci. 43 (2002), 1965-1970 and non-invasive
observation of repeated adenoviral GFP gene delivery to the
anterior segment of the monkey eye in vivo described in Borras et
al., J. Gene Med. 3 (2001), 437-449.
[0055] CNS gene transfer has also been described in Leone et al.,
Curr. Opin. Mol. Ther. 1 (1999), 487-492.
[0056] Additionally, the dsRNAs can be introduced into the cells or
tissues bound to other molecules and/or combined with one or more
suitable carriers. Such a carrier can be a micellar structure,
preferably a liposome, a coat protein, derived from a virus such as
the cytomegalovirus (CMV) or produced synthetically,
adeno-associated virus (AAV) or adenovirus. The dsRNA can also be
bound to cationic porphyrins, cationic polyamines, polymeric
DNA-binding cations or fusogenic peptides. Packaging of the dsRNA
into coat proteins or liposomes and/or associating it with carriers
will not only improve the targeting but also elongate the
half-life. Preferred are carriers and/or the dsRNA-binding
molecules, selected such that the dsRNA molecules are delivered
continuously to the target cells or target tissues over a defined
period of time after application. Thereby peak concentrations of
dsRNA, which might lead to side effects or simply be ineffective,
can be avoided. Also preferred are carriers that are specific for
the cells and/or tissues defined above. Such carriers are well
known to the person skilled in the art; see, e.g., Adams et al., J.
Biomater. Sci. Polym. Ed. 13 (2002), 991-1006, for the effects of
acyl chain length on the micelle properties; Dass, J. Pharm.
Pharmacol. 54 (2002), 3-27, for cationic liposomes and
cyclodextrins; Yang and Hsieh, Pharm. Res. 18 (2001), 922-927, for
protamine sulfate enhancing the transduction efficiency of
recombinant adeno-associated virus-mediated gene delivery.
[0057] The method described in this invention is distinguished from
the prior art by the fact that it could be shown for the first time
that dsRNA molecules, preferably of the length specified above, can
be detected inside the eye after systemic or local application
outside the eyeball. The detection is based on the specific
inhibition of specified target genes in cells or tissues of the
inner eye by RNA interference.
[0058] Needless to say that in the above-described screening
methods, induction of an interferon response may not desired as
this could lead to cell death, anti-proliferation and possibly to
prevention of gene silencing. Means and Methods how to prevent an
interferon response during gene silencing are known to the persons
skilled in the art, and are described inter alia in example 7 of EP
1 229 134 A2, the disclosure content of which is hereby
incorporated by reference.
[0059] In a preferred embodiment of the methods and uses of the
present invention the composition is in a form designed to be
introduced into the cells or tissue of the CNS or eye by a suitable
carrier, characterized by the application occurring outside the
blood-CNS and/or blood-retina bathers, for instance as eye drops.
It can also be administered systemically, iontophoretically or by
retrobulbar injection.
[0060] Iontophoresis has been defined as the active introduction of
ionised molecules into tissues by means of an electric current. The
technique has been used to enhance drug delivery into tissues
underlying the donor electrode (e.g. skin) as well as to the
general blood circulation, thus providing systemic delivery of a
drug to the entire body. Iontophoresis devices require at least two
electrodes, both being in electrical contact with some portion of a
biological membrane surface of the body. One electrode commonly
referred to as the "donor" or "active" electrode, is the electrode
from which the biologically active substance, such as a drug or
prodrug, is delivered into the body. Another electrode having an
opposite polarity functions to complete the electric circuit
between the body and the electrical power source. This electrode is
commonly referred to as the "receptor" or "passive" electrode.
During iontophoresis, an electrical potential is applied over the
electrodes, in order to create an electrical current to pass
through the drug solution and the adjacent tissue. Iontophoresis
has been described for the treatment of blood-vessel related
disorders (e.g. restenosis), bladder, uterus, urethra and prostate
disorders. U.S. Pat. Nos. 6,219,557; 5,588,961; 5,843,016;
5,486,160; 5,222,936; 5,232,441; 5,401,239 and 5,728,068 disclose
different types of iontophoresis catheters for insertion into
hollow, tubular organs (bladder, urethra and prostate) or into
blood vessels. US 2002183683 suggests the method for delivery of
active substances into the CNS.
[0061] In any of the uses or methods described herein the subject
or organism can be a vertebrate, preferably a mammal or a human.
The described methods can be applied to cells and/or tissues of
vertebrate origin and particularly of mammalian origin. Human cells
and/or tissues are preferred.
[0062] The current knowledge about pathological metabolic
interrelationships based on restricted or lacking function of a
single or a number of causative genes, such as for AMD or other
retinal disease patterns, is not sufficient for the medical
treatment of such diseases. Suitable animal or cell culture models
for such diseases are not available, due to the complexity of the
disorders and the lack of simple methods for intervention and
manipulation of the eye or the CNS
[0063] Using the methods provided by this invention, animal models
may easily be generated, which reproduce the symptoms of diseases
of the inner eye and/or CNS of predominantly genetic origin. These
animal models are suitable to initiate the development of specific
pharmaceutical products for opthalmology and CNS-related diseases
and can be used in the validation of products.
[0064] The method, illustrated below by examples of the procedure
thus, is suitable for the provision of cell culture as well as
animal models with which targets, whose restricted function cause
diseases of the eye and/or the CNS, can be identified and
validated. The method is moreover suitable for the specific
intervention in eye diseases on a molecular level, without
necessitating direct application to the back of the eye. The
specificity of RNAi for the inhibition of genes expressed
specifically in target cells minimizes the risk of unwanted side
effects.
[0065] In a still further embodiment, the present invention relates
to a transgenic non-human animal which due to the presence of one
or more dsRNA molecules, displays an aberrant expression of one or
more target genes, and which obtained by the methods described
above, especially when said animal reproduces a disorder of the CNS
and/or the eye.
[0066] A method for the production of a transgenic non-human
animal, which is also encompassed by the present invention, for
example transgenic mouse, comprises introduction of a
polynucleotide or targeting vector encoding said polypeptide into a
germ cell, an embryonic cell, stem cell or an egg or a cell derived
therefrom. The non-human animal can be used in accordance with a
screening method of the invention described herein. Production of
transgenic embryos and screening of those can be performed, e.g.,
as described by A. L. Joyner Ed., Gene Targeting, A Practical
Approach (1993), Oxford University Press. A general method for
making transgenic non-human animals is described in the art, see
for example WO 94/24274. For making transgenic non-human organisms
(which include homologously targeted non-human animals), embryonal
stem cells (ES cells) are preferred. Murine ES cells, such as AB-1
line grown on mitotically inactive SNL76/7 cell feeder layers
(McMahon and Bradley, Cell 62: 1073-1085 (1990)) essentially as
described (Robertson, E. J. (1987) in Teratocarcinomas and
Embryonic Stem Cells: A Practical Approach. E. J. Robertson, ed.
(Oxford: IRL Press), p. 71-112) may be used for homologous gene
targeting. Other suitable ES lines include, but are not limited to,
the E14 line (Hooper et al., Nature 326: 292-295 (1987)), the D3
line (Doetschman et al., J. Embryol. Exp. Morph. 87: 27-45 (1985)),
the CCE line (Robertson et al., Nature 323: 445-448 (1986)), the
AK-7 line (Zhuang et al., Cell 77: 875-884 (1994)). The success of
generating a mouse line from ES cells bearing a specific targeted
mutation depends on the pluripotence of the ES cells (i.e., their
ability, once injected into a host developing embryo, such as a
blastocyst or morula, to participate in embryogenesis and
contribute to the germ cells of the resulting animal). The
blastocysts containing the injected ES cells are allowed to develop
in the uteri of pseudopregnant nonhuman females and are born as
chimeric mice. The resultant transgenic mice are chimeric for cells
having either the recombinase or reporter loci and are backcrossed
and screened for the presence of the correctly targeted transgene
(s) by PCR or Southern blot analysis on tail biopsy DNA of
offspring so as to identify transgenic mice heterozygous for either
the recombinase or reporter locus/loci.
[0067] It might be also desirable to inactivate target gene
expression or function at a certain stage of development and/or
life of the transgenic animal. This can be achieved by using, for
example, tissue specific (see supra), developmental and/or cell
regulated and/or inducible promoters which drive the expression of,
e.g., an antisense or ribozyme directed against the RNA transcript
encoding the target gene mRNA; see also supra. A suitable inducible
system is for example tetracycline-regulated gene expression as
described, e.g., by Gossen and Bujard (Proc. Natl. Acad. Sci. 89
USA (1992), 5547-5551) and Gossen et al. (Trends Biotech. 12
(1994), 58-62). Similar, the expression of a mutant target gene may
be controlled by such regulatory elements. Preferably, the presence
of the transgenes in cells of the transgenic animals leads to to
various physiological, developmental and/or morphological changes,
preferably to conditions related to disorders of the CNS and/or eye
such as those described above.
[0068] For the method of the present invention, in particular,
mammlian animals are preferred, especially mice and rats.
Corresponding animal systems that can be adapted in accordance with
the present invention are known to person skilled in the art; see,
e.g., molecular biological approaches to neurological disorders
including knockout and transgenic mouse models described in Shibata
et al., Neuropathology 22 (2002), :337-349. However, the widely
used zebra fish may also be used since this model system has also
been shown to provide valuable predicitve results; see, e.g. Gerlai
et al., Pharmacol. Biochem. Behay. 67 (2000), 773-782.
[0069] In another embodiment of the present invention, said
transgenic non-human animal is used for a process in the discovery
of drugs for the treatment of a disorder of the CNS and/or the
eye.
[0070] Preferred non-human transgenic animals are mammals, for
example mice. Particularly preferred are transgenic organisms,
especially if the organism displays the phenotype of an eye
disease. The phenotype of a disease of the inner segment of the eye
ball, a retinal disease and particularly a degenerative retinal
disease is preferred. The organism can be for example mouse, rat or
zebra fish; se supra.
[0071] A preferred embodiment of this invention is a pharmaceutical
composition useful for the treatment of disease as defined above,
comprising a composition disclosed in the description of this
invention. Also included in the embodiments of this invention is a
diagnostic composition useful for detecting a gene or gene
expression involved in diseases of the CNS and/or eye, comprising a
composition as defined in the description or a cell, tissue or an
organism described above.
[0072] In contrast to the cited literature in which the use of
siRNA and other RNA based molecules is described for cell culture
only, experiments performed in accordance with the present
invention surprisingly demonstrate that dsRNA molecules of a length
of 21 to 23 nucleotides are capable of, after systemic application,
for example by intravenous injection, to cross the blood-retina
barrier, and specifically inactivate target genes in the tissues of
the back of the eye. This overcoming the blood-retina barrier is
all the more remarkable, because no experiment could demonstrate
overcoming the blood-brain barrier by dsRNA so far. The methods and
uses of the invention, explained below by means of examples, are
thus suitable for the provision of animal models with which
targets, the restricted function of which causing diseases of the
eye, can be identified and validated. Those methods are moreover
suitable for the specific intervention in CNS and eye diseases on a
molecular level, without necessitating direct application to the
site of, for example affected cells or tissue. The specificity of
selected inhibitors such as preferably RNAi for the inhibition of
genes expressed specifically in target cells minimizes the risk of
unwanted side effects.
[0073] The dosage regimen of the pharmaceutical compositions in all
of the above described methods and uses of the present invention
will be determined by the attending physician and clinical factors.
As is well known in the medical arts, dosages for any one patient
depends upon many factors, including the patient's size, body
surface area, age, the particular compound to be administered, sex,
time and route of administration, general health, and other drugs
being administered concurrently. A typical dose can be, for
example, in the range of 0.001 .mu.g to 10 mg (or of nucleic acid
for expression or for inhibition of expression in this range);
however, doses below or above this exemplary range are envisioned,
especially considering the aforementioned factors. Generally, the
regimen as a regular administration of the pharmaceutical
composition should be in the range of 0.01 .mu.g to 10 mg units per
day. If the regimen is a continuous infusion, it should also be in
the range of 0.01 .mu.g to 10 mg units per kilogram of body weight
per minute, respectively. Progress can be monitored by periodic
assessment. Dosages will vary but a preferred dosage for
intravenous administration of nucleics acids is from approximately
10.sup.6 to 10.sup.12 copies of the nucleic acid molecule.
[0074] Therapeutic or diagnostic compositions of the invention are
administered to an individual in an effective dose sufficient to
treat or diagnose disorders in which modulation of a target gene or
gene product is indicated. The effective amount may vary according
to a variety of factors such as the individual's condition, weight,
sex and age. Other factors include the mode of administration. The
pharmaceutical compositions may be provided to the individual by a
variety of routes such as by intracoronary, intraperitoneal,
subcutaneous, intravenous, transdermal, intrasynovial,
intramuscular or oral routes. In addition, co-administration or
sequential administration of other agents may be desirable.
[0075] A therapeutically effective dose refers to that amount of
compounds described in accordance with the present invention needed
to ameliorate the symptoms or condition. Therapeutic efficacy and
toxicity of such compounds can be determined by standard
pharmaceutical procedures in cell cultures or experimental animals,
e.g., ED50 (the dose therapeutically effective in 50% of the
population) and LD50 (the dose lethal to 50% of the population).
The dose ratio between therapeutic and toxic effects is the
therapeutic index, and it can be expressed as the ratio,
LD50/ED50.
[0076] Additionally the present invention provides a method for the
identification and isolation of a drug capable of specific
modulation of the expression of a target gene in cells and/or
tissues of the eye, comprising the steps: [0077] contacting a cell
or tissue or a non-human organism described above with a compound
to be screened and; [0078] determining if the compound antagonizes
or agonizes the effect of said one or more double-stranded
oligoribonucleotides (dsRNA) molecule
[0079] Preferred is an embodiment, which further comprises
comparing the non-human organism treated with said compound--or the
test cell or tissue--with a non-treated control, wherein reversion
or amelioration of the phenotype as defined above is indicative for
suitable drug or lead compound for a drug for the treatment of a
disease related to the eye.
[0080] The test substances which can be tested and identified
according to a method of the invention may be expression libraries,
e.g., cDNA expression libraries, peptides, proteins, nucleic acids,
antibodies, small organic compounds, hormones, peptidomimetics,
PNAs, aptamers or the like (Milner, Nature Medicine 1 (1995),
879-880; Hupp, Cell 83 (1995), 237-245; Gibbs, Cell 79 (1994),
193-198 and references cited supra). The test substances to be
tested also can be so called "fast seconds" of known drugs. The
invention also relates to further contacting the test cells with a
second test substance or mixture of test substances in the presence
of the first test substance.
[0081] As mentioned above, the present invention provides
convenient in vivo assays for identifying and obtaining drugs
capable of modulating the gene activity, thereby being useful as a
therapeutic agent for the treatment of diseases related to CNS
disorders including (e.g.) Schizophrenia, Parkinson's Disease,
Alzheimer's Disease, and eye diseases such as those described
above. In accordance with this, the present invention provides also
a use for compounds which have been known in the art, properly also
known to be able to modulate target gene activity but which
hitherto have not been suggested for medical use because of the
lack of knowledge of phenotypic responses of an organism evoked by
target gene activity or the lack of it.
[0082] One embodiment of this invention comprises a method for the
production of a drug or prodrug identified by such a screening as a
modulator or a derivative thereof, particularly if the substance
has hitherto not been known as a drug for the treatment of a
disorder of the CNS or the eye.
[0083] Substances are metabolized after their in vivo
administration in order to be eliminated either by excretion or by
metabolism to one or more active or inactive metabolites (Meyer, J.
Pharmacokinet. Biopharm. 24 (1996), 449-459). Thus, rather than
using the actual compound or drug identified and obtained in
accordance with the methods of the present invention a
corresponding formulation as a pro-drug can be used which is
converted into its active form in the patient by his/her
metabolism. Precautionary measures that may be taken for the
application of pro-drugs and drugs are described in the literature;
see, for review, Ozama, J. Toxicol. Sci. 21 (1996), 323-329.
[0084] Furthermore, the present invention relates to the use of a
compound identified, isolated and/or produced by any of these
methods for the preparation of a composition for the treatment of
said CNS and eye disorders. As a method for treatment the
identified substance or the composition containing it can be
administered to a subject suffering from such a disorder. Compounds
identified, isolated and/or produced by the method described above
can also be used as lead compounds in drug discovery and
preparation of drugs or prodrugs.
[0085] The various steps recited above are generally known in the
art. For example, computer programs for implementing these
techniques are available; e.g., Rein, Computer-Assisted Modeling of
Receptor-Ligand Interactions (Alan Liss, New York, 1989). Methods
for the preparation of chemical derivatives and analogues are well
known to those skilled in the art and are described in, for
example, Beilstein, Handbook of Organic Chemistry, Springer edition
New York Inc., 175 Fifth Avenue, New York, N.Y. 10010 U.S.A. and
Organic Synthesis, Wiley, New York, USA. Furthermore,
peptidomimetics and/or computer aided design of appropriate
derivatives and analogues can be used, for example, according to
the methods described above. Methods for the lead generation in
drug discovery also include using proteins and detection methods
such as mass spectrometry (Cheng et al. J. Am. Chem. Soc. 117
(1995), 8859-8860) and some nuclear magnetic resonance (NMR)
methods (Fejzo et al., Chem. Biol. 6 (1999), 755-769; Lin et al.,
J. Org. Chem. 62 (1997), 8930-8931). They may also include or rely
on quantitative structure-action relationship (QSAR) analyses
(Kubinyi, J. Med. Chem. 41 (1993), 2553-2564, Kubinyi, Pharm.
Unserer Zeit 23 (1994), 281-290) combinatorial biochemistry,
classical chemistry and others (see, for example, Holzgrabe and
Bechtold, Pharm. Acta Helv. 74 (2000), 149-155). Furthermore,
examples of carriers and methods of formulation may be found in
Remington's Pharmaceutical Sciences.
[0086] The present invention also relates to the use of a component
selected from the group consisting of a composition, nucleic acid,
non-human organism, host cell, cell line, tissue, organ, drug,
carrier and/or vector for the specific modulation of expression of
one or more target genes in cells and/or tissue of the CNS and/or
eye, wherein said component comprises one or more dsRNA molecules
which are applicable outside the blood-brain barrier or the retinal
region of the blood-retina barrier. One or more of the components
mentioned above can be part of a kit for use in a method as defined
herein above. The invention further relates to the use of the any
one of these methods, cells or non-human organism in drug discovery
or target gene isolation and/or validation as well as the use of
RNA interference and the nucleic acid, non-human organism, host
cell, cell line, tissue, organ, carrier and/or vector utilized for
the diagnosis and/or therapy of disorders related to the CNS and/or
eye.
[0087] The present invention also relates to kit compositions
containing specific reagents such as those described herein-before.
Kits containing oligonucleotides, dsRNA or vectors may be prepared.
Such kits are used to detect for example the function of a target
gene. Such characterization is useful for a variety of purposes
including but not limited to forensic analyses, diagnostic
applications, and epidemiological studies in accordance with the
above-described methods of the present invention. The recombinant
RNA molecules for example lend themselves to the formulation of
kits suitable for the detection and typing of the target gene. Such
a kit would typically comprise a compartmentalized carrier suitable
to hold in close confinement at least one container. The carrier
would further comprise reagents such as recombinant protein or
antibodies suitable for detecting the expression or activity of the
target gene or gene product. The carrier may also contain a means
for detection such as labeled antigen or enzyme substrates or the
like.
[0088] These and other embodiments are disclosed and included in
the present description and in the examples. Literature regarding
the materials, methods, applications and components, which can be
used in accordance with the invention, may be obtained from public
libraries and data bases, for example by using electronic devices.
The public data base `Medline` may for instance be used, which is
supported by the National Center for Biotechnology Information
and/or the National Library of Medicine at the National Institutes
of Health. Other data bases and Internet addresses, such as the
European Bioinformatics Institute (EBI), which is part of the
European Molecular Biology Laboratory (EMBL), are known to the
person skilled in the art, and can be found by using Internet
search engines. A survey of patent information in biotechnology and
a summary of relevant sources for patent information, which are
useful for a retrospective search and current awareness are
described in Berks, TIBTECH 12 (1994), 352-364.
[0089] The disclosure above describes the present invention in
general. A more comprehensive understanding of the invention may be
gained by reference to the following specific examples and FIGURE,
which are merely provided for illustrative purposes and are not
intended to limit the scope of the invention. The contents of all
cited references (including literature references, granted patents,
published patent applications as quoted in the text and
manufacturer's descriptions and specifications, etc.) are hereby
incorporated explicitly by reference; this is however no admission
that any one of these documents is indeed prior art as to the
present invention.
[0090] Unless stated otherwise, the present invention may be
carried out by making use of conventional techniques of cell
biology, cell culture, molecular biology, transgenetic biology,
microbiology, recombinant DNA and RNA technology, which belong to
the skill of the person skilled in the art. For a comprehensive
description of such techniques in the literature, see for example:
Molecular Cloning A Laboratory Manual, 2nd Ed., ed. by Sambrook,
Fritsch and Maniatis (Cold Spring Harbor Laboratory Press: 1989);
DNA Cloning, Volumes I and II (D. N. Glover ed., 1985);
Oligonucleotide Synthesis (M. J. Gait ed., 1984); Mullis et al.
U.S. Pat. No. 4,683,195; Nucleic Acid Hybridization (B. D. Hames
& S. J. Higgins eds. 1984); Transcription And Translation (B.
D. Hames & S. J. Higgins eds. 1984); Culture Of Animal Cells
(R. L Freshney, Alan R. Liss, Inc., 1987); Immobilized Cells And
Enzymes (IRL Press, 1986); B. Perbal, A Practical Guide To
Molecular Cloning (1984); the treatise, Methods In Enzymology
(Academic Press, Inc., N.Y.); Gene Transfer Vectors For Mammalian
Cells (J. H. Miller and M. P. Calos eds., 1987, Cold Spring Harbor
Laboratory); Methods In Enzymology, Vols. 154 and 155 (Wu et al.
eds.), Immunochemical Methods In Cell And Molecular Biology (Mayer
and Walker, eds., Academic Press, London, 1987); Handbook Of
Experimental Immunology, Volumes I-IV (D. M. Weir and C. C.
Blackwell, eds., 1986).
[0091] The FIGURE shows:
[0092] FIG. 1: eGFP-expression in retina and retinal pigment
epithel (RPE) of systemically dsRNA-treated FVB.CG-TG(GFPU)5NAGY
mice. The FIGURE shows eGFP-expression in eye paraffin sections of
dsRNA-treated FVB.Cg-Tg(GFPU)5Nagy mice. Expression in retina and
retinal pigment epithel (RPE) of systemically dsRNA-treated
FVB.CG-TG(GFPU)5NAGY mice is highest in the buffer control,
slightly decreased in mice treated with non-silencing dsRNA and
clearly decreased in eGFP-specific dsRNA treated mice (buffer
control >200 .mu.g/kg BW non-silencing dsRNA >100 .mu.g/kg BW
eGFP-specific dsRNA >200 .mu.g/kg BW eGFP-specific dsRNA).
EXAMPLES
[0093] As an example, inhibition of the expression of green
fluorescent protein (eGFP) in the retinal pigment epithelium (RPE)
and the retina of transgenic mice (FVB.Cg-Tg(GFPU)5Nagy, The
Jackson Laboratory) by dsRNA molecules is analyzed.
[0094] Example 1 describes specific post transcriptional gene
silencing by dsRNA of the target gene eGFP in the mouse animal
model, during which the optimal dsRNA concentration for post
transcriptional gene silencing on systemic application is to be
determined (experimental procedure 1, results see table 1 and FIG.
1). The procedure involves the in vivo treatment of transgenic
mice, which express the enhanced form of green fluorescent protein
(eGFP) in their body cells, by systemic application of dsRNA
oligoribonucleotide molecules against the target gene eGFP. Control
animals are also treated systemically with non-silencing dsRNA
molecules. For the purpose of post transcriptional gene silencing,
the animals not under analgesic or anesthetic influence receive
daily i.v. tail vein injections (1.sup.st day of treatment: day 0,
final day of treatment: day 20) of 100 or 200 .mu.g eGFP-specific
dsRNA/kg body weight (BW) and the control group of 200 .mu.g
non-silencing dsRNA/kg BW. A control group of animals treated with
buffer (daily i.v. injection of 0.1 ml buffer into the tail vein)
is also kept. Each group of experimental animals consists of 8
animals, the maximum injection volume/injection being 0.1 ml. On
day 21, the animals are sacrificed by CO.sub.2 inhalation. The
expression of green fluorescent protein in the eye of the mice is
examined immunohistologically (spontaneous eGFP fluorescence:
fluorescence microscopic evaluation; eGFP-specific
immunofluorescence staining: fluorescence microscopic
evaluation).
[0095] Example 2 describes specific post transcriptional gene
silencing by dsRNA of the target gene eGFP in the mouse animal
model, during which the optimal time of efficacy (=the point in
time at which the gene silencing effect is maximal) after a single
systemic i.v. dsRNA injection into the tail vein, of post
transcriptional gene silencing for systemic application is to be
determined (Experimental procedure 2). The procedure involves the
in vivo treatment of transgenic mice, which express the enhanced
form of green fluorescent protein (eGFP) in their body cells, by
systemic application of dsRNA oligoribonucleotide molecules against
the target gene eGFP. The control animals are also treated
systemically with non-silencing dsRNA molecules. For the purpose of
post transcriptional gene silencing, the animals not under
analgesic or anesthetic influence receive a single i.v. tail vein
injection on day 0 of 200 .mu.g eGFP-specific dsRNA/kg body weight
(BW) and the control group of 200 .mu.g non-silencing dsRNA/kg BW.
Each group of experimental animals consists of 8 animals, the
maximum injection volume/injection being 0.1 ml. The animals are
sacrificed by CO.sub.2 inhalation on day 2, 3, 5, and 10 after i.v.
injection.
[0096] The expression of green fluorescent protein in the eye of
the mice is examined immunohistologically (spontaneous eGFP
fluorescence: fluorescence microscopic evaluation; eGFP-specific
immunofluorescence staining: fluorescence microscopic
evaluation).
[0097] Example 3 describes specific post transcriptional gene
silencing by dsRNA of the target gene eGFP in the mouse animal
model, during which the optimal dsRNA concentration for post
transcriptional gene silencing on local (retrobulbar) application
is to be determined (Experimental procedure 3). The procedure
involves the in vivo treatment of transgenic mice, which express
the enhanced form of green fluorescent protein (eGFP) in their body
cells, by retrobulbar application of dsRNA oligoribonucleotide
molecules against the target gene eGFP. Control animals also
receive a retrobulbar injection with non-silencing dsRNA molecules
or buffer. For the purpose of post transcriptional gene silencing,
the animals under analgesic and anesthetic influence receive a
single retrobulbar injection (1.sup.st day of treatment: day 0) of
200 .mu.g eGFP-specific dsRNA/kg body weight (BW) and the control
groups of 200 .mu.g non-silencing dsRNA/kg BW or buffer. Each group
of experimental animals consists of 3-8 animals, the maximum
injection volume/injection being 0.005 ml. The retrobulbar dsRNA
injection is carried out both on the left and right eye. On day 3
or day 6, the animals are sacrificed by CO.sub.2 inhalation.
[0098] The expression of green fluorescent protein in the eye of
the mice is examined immunohistologically (spontaneous eGFP
fluorescence: fluorescence microscopic evaluation; eGFP-specific
immunofluorescence staining: fluorescence microscopic
evaluation).
[0099] Example 4 describes specific post transcriptional gene
silencing by dsRNA of the target gene eGFP in the mouse animal
model, during which the optimal time of efficacy (=the point in
time at which the gene silencing effect is maximal) after a single
retrobulbar dsRNA injection, of post transcriptional gene silencing
for local (retrobulbar) application is to be determined
(Experimental procedure 4). The procedure involves the in vivo
treatment of transgenic mice, which express the enhanced form of
green fluorescent protein (eGFP) in their body cells, by
retrobulbar injection of dsRNA oligoribonucleotide molecules
against the target gene eGFP. Control animals also receive
retrobulbar application of non-silencing dsRNA molecules or buffer.
For the purpose of post transcriptional gene silencing, the animals
under analgesic and anesthetic influence receive a single
retrobulbar injection on day 0 of 200 .mu.g eGFP-specific dsRNA/kg
body weight (BW) and the control groups of 200 .mu.g non-silencing
dsRNA/kg BW or buffer. Each group of experimental animals consists
of 8 animals, the maximum injection volume/injection being 0.005
ml. The retrobulbar dsRNA injection is carried out both on the left
and right eye. The animals are sacrificed by CO.sub.2 inhalation on
day 2, 3, 5, and 10 after retrobulbar injection.
[0100] The expression of green fluorescent protein in the eye of
the mice is examined immunohistologically (spontaneous eGFP
fluorescence: fluorescence microscopic evaluation; eGFP-specific
immunofluorescence staining: fluorescence microscopic
evaluation).
[0101] Example 5 describes specific post transcriptional gene
silencing by dsRNA of the target gene eGFP in the mouse animal
model, during which the optimal dsRNA activity for post
transcriptional gene silencing on repeated local (retrobulbar)
application is to be determined (Experimental procedure 5). The
procedure involves the in vivo treatment of transgenic mice, which
express the enhanced form of green fluorescent protein (eGFP) in
their body cells, by retrobulbar application of dsRNA
oligoribonucleotide molecules against the target gene eGFP. Control
animals also receive a retrobulbar injection of non-silencing dsRNA
molecules or buffer. For the purpose of post transcriptional gene
silencing, the animals under analgesic and anesthetic influence
receive a retrobulbar injection on days 0, 7 and 14 (1.sup.st day
of treatment: day 0, final day of treatment: day 14) of 200 ng
eGFP-specific dsRNA/kg body weight (BW) and the control group of
200 .mu.g non-silencing dsRNA/kg BW or 0.005 ml buffer. Each group
of experimental animals consists of 8 animals, the maximum
injection volume/injection being 0.005 ml. The retrobulbar dsRNA
injection is carried out both on the left and right eye. On day 15,
the animals are sacrificed by CO.sub.2 inhalation. The expression
of green fluorescent protein in the eye of the mice is examined
immunohistologically (spontaneous eGFP fluorescence: fluorescence
microscopic evaluation; eGFP-specific immunofluorescence staining:
fluorescence microscopic evaluation).
dsRNA Constructs and Plasmids:
[0102] For the design of the dsRNA molecules, sequences of the type
AA(N19)TT (where N represents any nucleotide) were selected from
the sequence of the target mRNA, in order to obtain 21 nucleotide
(nt) long sense and antisense strands with symmetrical 3'-overhangs
of two nucleotides in length. In the 3'-overhangs,
2'-deoxy-thymidine was used instead of uridine. In order to ensure
that the dsRNA molecules are exclusively directed against the
target gene, the chosen dsRNA sequences are tested against the
mouse genome in a BLAST analysis. The 21-nt RNA molecules are
synthesized chemically and purified. For the duplex formation, 100
.mu.g of the sense and antisense oligoribonucleotides each are
mixed in 10 mM Tris/HCl, 20 mM NaCl (pH 7.0) and heated to
95.degree. C. and cooled to room temperature over a period of 18
hours. The dsRNA molecules are precipitated from ethanol and
resuspended in sterile buffer (100 mM potassium acetate, 30 mM
HEPES-KOH, 2 mM magnesium acetate, pH 7.4). The integrity and
double strand character of the dsRNA are verified by
gelelectrophoresis. Alternatively, the dsRNA molecules are obtained
from commercial suppliers. The sequences of the target genes and
the corresponding dsRNA molecules are as follows:
TABLE-US-00001 GFP dsRNA DNA target 5' G CAA GCT GAC CCT GAA GTT CA
sequence: (SEQ ID NO 1) Coding region, 121-141 relative to the
first nucleotide of the start codon (Acc. No. U55761) dsRNA (sense)
5' r(GCA AGC UGA CCC UGA AGU U) (SEQ ID NO 2) dsRNA 5' r(AA CUU CAG
GGU CAG CUU GC) (antisense) (SEQ ID NO 3) non-silencing dsRNA,
control DNA target 5' AATTCTCCGAACGTGTCACGT sequence: (SEQ ID NO 4)
dsRNA (sense) 5' r(UUCUCCGAACGUGUCACGU)d(TT) (SEQ ID NO 5) dsRNA 5'
r(ACGUGACACGUUCGGAGAA)d(TT) (antisense) (SEQ ID NO 6)
Analgesia and Anesthesia of the Mice:
[0103] For systemic application, the animals are immobilized and
the dsRNAs are injected i.v. in the tail vein (maximal injection
volume: 0.1 ml), where analgesia or anesthesia are refrained from,
since this would put more stress on the animals than the i.v.
injection itself. For retrobulbar injection (maximal injection
volume: 0.005 ml) the animals are however subjected to short-term
isofluorane inhalation anaesthesia and provided with Metamizole
sodium for analgesic purposes. The animals are then kept in their
accustomed animal cage surroundings. After completion of in vivo
diagnosis (the end of each animal experiment is stated respectively
in example 1-5) the animals are killed by CO.sub.2 inhalation,
enucleated and the eyes are studied histologically
(immunohistology).
Study of eGFP Expression in Retinal Pigment Epithelium and
Retina:
[0104] After removal, the eyes are fixed in 4% formalin/PBS
solution for 24 hours. Using standard methods, the fixed samples
are subsequently dehydrated in a series of increasing alcohol and
embedded in paraffin. With the aid of a microtome, standard 5 to 12
.mu.m serial slices are produced, stretched in a heated water bath
and transferred to a polylysin-coated cover slip. The sections are
then dried in an incubator for 2 hours at a temperature of
52.degree. C. The dried sections are deparaffinated in xylol,
transferred to a decreasing series of alcohol followed by Tris/HCl
pH 7.4. After blocking, the sections are incubated for 2 hours with
primary anti-eGFP antiserum (polyclonal goat anti-eGFP antiserum,
Santa Cruz No. sc-5384). Detection occurs by means of
immunofluorescence staining by using a Cyt-conjugated rabbit
anti-goat IgG (Dianova, No. 305-225-045). The samples are embedded
and then mounted for microscopy with an Eclipse TE-2000-S
microscope (Nikon), equipped with a 20.times. and 40.times./1.3
objective. The spontaneous, eGFP-specific fluorescence in
deparaffinated, untreated sections is analyzed using a fluorescence
microscope.
Experimental Procedures
Experimental Procedure 1
[0105] Systemic siRN application. Determination of optimal dsRNA
concentration for post transcriptional gene silencing.
TABLE-US-00002 Number of Group Substance animals Control animals
Buffer 8 Negative control non-silencing 8 200 .mu.g dsRNA/ dsRNA kg
BW 200 .mu.g dsRNA/ eGFP-specific 8 kg BW dsRNA 100 .mu.g dsRNA/
eGFP-specific 8 kg BW dsRNA Animals per 32 experiment
For results see FIG. 1
Experimental Procedure 2
[0106] Systemic siRNA application for the determination of the
optimal time of efficacy of post transcriptional gene silencing
(=point in time at which the gene silencing effect is maximal after
single systemic dsRNA i.v. injection in the tail vein) on day
0.
TABLE-US-00003 Experiment Number of Group Substance ended after
animals Negative control (8 non-silencing 2, 3, 5, 10 days 32
animals per point in dsRNA time) 200 .mu.g dsRNA/ eGFP-specific 2
days 8 kg BW dsRNA 200 .mu.g dsRNA/ eGFP-specific 3 days 8 kg BW
dsRNA 200 .mu.g dsKNA/ eGFP-specific 5 days 8 kg BW dsRNA 200 .mu.g
dsRNA/ eGFP-specific 10 days 8 kg BW dsRNA Animals per 64
experiment
Experimental Procedure 3
[0107] Retrobulbar siRNA application. Determination of optimal
dsRNA concentration for post transcriptional gene silencing.
[0108] Single retrobulbar siRNA injection on day 0, experiment end
on day 3 or day 6 (BW=body weight).
TABLE-US-00004 Number of Group Left eye Right eye animals Negative
control non-silencing non silencing day 3: 4 200 .mu.g dsRNA/ ds
RNA dsRNA day 6: 4 kg BW total: 8 Control buffer buffer day 3: 3
day 6: 3 total: 6 200 .mu.g dsRNA/ eGFP-specific eGFP-specific day
3: 8 kg BW dsRNA dsRNA day 6: 8 total: 16 Animals per 30
experiment
Experimental Procedure 4
[0109] Retrobulbar dsRNA injection for the determination of the
optimal time of efficacy of post transcriptional gene silencing
(=point in time at which the gene silencing effect is maximal after
single retrobulbar dsRNA application on day 0).
TABLE-US-00005 Experiment Number of Group Left eye Right eye ended
after animals Negative control (8 non-silencing non-silencing 2, 3,
5, 10 days 32 animals per point in dsRNA dsRNA time) 200 .mu.g
dsRNA/ eGFP-specific eGFP-specific 2 days 8 kg BW dsRNA dsRNA 200
.mu.g dsRNA/ eGFP-specific eGFP-specific 3 days 8 kg BW dsRNA dsRNA
200 .mu.g dsRNA/ eGFP-specific eGFP-specific 5 days 8 kg BW dsRNA
dsRNA 200 .mu.g dsRNA/ eGFP-specific eGFP-specific 10 days 8 kg BW
dsRNA dsRNA Animals per 64 experiment
Experimental Procedure 5
[0110] Repeated retrobulbar dsRNA injection for the determination
of post transcriptional gene silencing.
[0111] Retrobulbar injection of 200 .mu.g dsRNA/kg BW on day 0, 7,
14; on day 15 histolog. evaluation.
TABLE-US-00006 Number of Group Left eye Right eye Injection on day
animals Negative control (8 non-silencing non-silencing 0, 7, 14 24
animals per point in dsRNA dsRNA time) 200 .mu.g dsRNA/
eGFP-specific eGFP-specific 0, 7, 14 24 kg BW dsRNA dsRNA Animals
per 48 experiment
REFERENCES
[0112] Cited literature, the disclosure content of which is hereby
incorporated by reference in the present description: [0113]
Allikmets R. A photoreceptor cell-specific ATP-binding transporter
gene (ABCR) is mutated in recessive Stargardt macular dystrophy.
Nat. Genet. 17(1):122 (1997). [0114] Banks C N, Hutton W K.
Blindness in New South Wales: an estimate of the prevalence and
some of the contributing causes. Aust J Opthalmol 9:285-288 (1981).
[0115] Bernstein E, Caudy A A, Hammond S M, Hannon G J. Role for a
bidentate ribonuclease in the initiation step of RNA interference.
Nature 409(6818):363-6 (2001). [0116] Bressler N M, Bressler S B.
Preventative opthalmology. Age-related macular degeneration.
Opthalmology 102:1206-1211 (1995). [0117] Caplen N. J., Parrish S.,
Imani F., Fire A., and Morgan R. A. Specific inhibition of gene
expression by small double-stranded RNAs in invertebrate and
vertebrate systems. Proc. Natl. Acad. Sci. 09:9742-9747 (2001).
[0118] Elbashir S. M., Harborth J., Lendeckel W., Yalcin A., Weber
K., and Tuschel T. Duplexes of 21-nucleotide RNAs mediate RNA
interference in cultured mammalian cells. Nature 411: 494-498
(2001). [0119] Fire A., Xu S., Montgomery M. K., Kostas S. A.,
Driver S. E., and Mello C. C. Potent and specific genetic
interference by double-stranded RNA in Coenorhabditis elegans.
Nature 391:806-811 (1998). [0120] Gass J D. Drusen and disciform
macular detachment and degeneration. Arch Opthalmol 90:206-217
(1973). [0121] Ghafour I M, Allan D, Foulds W S. Common causes of
blindness and visual handicap in the west of Scotland. Br J
Opthalmol 67: 209-213 (1983). [0122] Grey R H, Burns-Cox C J,
Hughes A. Blind and partial sight registration in Avon. Br J
Opthalmol 73:88-94 (1989). [0123] Grishok A, Pasquinelli A E, Conte
D, Li N, Parrish S, Ha I, Baillie D L, Fire A, Ruvkun G, Mello C C.
Genes and mechanisms related to RNA interference regulate
expression of the small temporal RNAs that control C. elegans
developmental timing. Cell 106(1):23-34 (2001). [0124] Hamel C P,
Tsilou E, Pfeffer B A, Hooks J J, Detrick B, Redmond T M. Molecular
cloning and expression of RPE65, a novel retinal pigment
epithelium-specific microsomal protein that is
post-transcriptionally regulated in vitro. J Biol. Chem.
268(21):15751-7 (1993). [0125] Hamilton A J and Baulcombe D C. A
species of small antisense RNA in posttranscriptional gene
silencing in plants. Science 286: 950-952 (1999). [0126] Heiba I M,
Elston R C, Klein B E, Klein R. Sibling correlations and
segregation analysis of age-related maculopathy: the Beaver Dam Eye
Study. Genet Epidemiol 11:51-67 (1994). [0127] Hyman L G,
Lilienfeld A M, Ferris F L, Fine S L. Senile macular degeneration:
a case-control study. Am J Epidemiol 118:213-227 (1983). [0128]
Hyman L. Epidemiology of eye disease in the elderly. Eye 1: 330-341
(1987). [0129] Illing M., Molday L. L., Molday R. S. The 220-kDa
rim protein of retinal rod outer segments is a member of the ABC
transporter superfamily. J Biol. Chem. 11; 272(15):10303-10 (1997).
[0130] Kasschau K D and Carrington J C. A counterdefensive strategy
of plant viruses: suppression of posttranscriptional gene
silencing. Cell 95:461-470 (1998). [0131] Klein R, Klein B E,
Franke T. The relationship of cardiovascular disease and its risk
factors to age-related maculopathy. The Beaver Dam Eye Study.
Opthalmology 100:406-414 (1993). [0132] Knight S W and Bass B L. A
role for the RNase III enzyme DCR-1 in RNA interference and germ
line development in Caenorhabditis elegans. Science 2: 2269-2271
(2001). [0133] Leibowitz H M, Krueger D E, Maunder L R, Milton R C,
Kini M M, Kahn H A, Nickerson R J, Pool J, Colton T L, Ganley J P,
Loewenstein J I, Dawber T R. The Framingham Eye Study monograph: An
opthalmological and epidemiological study of cataract, glaucoma,
diabetic retinopathy, macular degeneration, and visual acuity in a
general population of 2631 adults, 1973-1975. Sury Opthalmol
24(Suppl): 335-610 (1980). [0134] Lewis R. A., Shroyer N. F., Singh
N, Allikmets R., Hutchinson A., Li Y., Lupski J. R., Leppert M.,
Dean M. Genotype/Phenotype analysis of a photoreceptor-specific
ATP-binding cassette transporter gene, ABCR, in Stargardt disease.
Am I Hum Genet. 1999 February; 64(2):422-34 (1999). [0135] Meyers S
M, Zachary A A. Monozygotic twins with age-related macular
degeneration. Arch Opthalmol 106:651-653 (1988). [0136] Okabe, M,
Ikawa, M, Kominami, K, Nakanishi, T. and Nishimune, Y. `Green mice`
as a source of ubiquitous green cells. FEBS Letters 407:313-9
(1997). [0137] Paetkau M E, Boyd T A, Grace M, Bach-Mills J,
Winship B. Senile disciform macular degeneration and smoking. Can J
Opthalmol 13:67-71 (1978). [0138] Piguet B, Wells J A, Palmvang I
B, Wormald R, Chisholm I R, Bird AC. Age-related Bruch's membrane
change: a clinical study of the relative role of heredity and
environment. Br J Ophthalmol 77:400-403 (1993). [0139] Schuler G D.
Pieces of the puzzle: expressed sequence tags and the catalog of
human genes. J Mol. Med. 75(10):694-8 (1997) [0140] Seddon J M,
Ajani U A, Mitchel B D. Familial aggregation of age-related
maculopathy. Am J Opthalmol 123: 199-206 (1997). [0141] Seeliger M.
W., Grimm C., Stahlberg F., Friedburg C., Jaissle G., Zrenner E.,
Guo H., Reme C. E., Humphries P., Hoffmann F., Biel M., Fariss R.
N., Redmond T. M., Wenzel A. New views on RPE65 deficiency: the rod
system is the source of vision in a mouse model of Leber congenital
amaurosis. Nat. Genet. 29(1):70-4 (2001). [0142] Silvestri G,
Johnston P B, Hughes A E. Is genetic predisposition an important
risk factor in age-related macular degeneration? Eye 8:564-568
(1994). [0143] Sperduto R D, Hiller R. Systemic hypertension and
age-related maculopathy in the Framingham Study. Arch Opthalmol
104:216-219 (1986). [0144] The Eye Disease Case-Control Study
Group. Risk factors for neovascular age-related macular. Arch
Opthalmol 110:1701-1708 (1992). [0145] Yap M, Weatherill J. Causes
of blindness and partial sight in the Bradford Metropolitan
District from 1980 to 1985. Ophthalmic Physiol Opt 9:289-292
(1989). [0146] Zamore P D, Tuschl T, Sharp P A, Bartel D P. RNAi:
double-stranded RNA directs the ATP-dependent cleavage of mRNA at
21 to 23 nucleotide intervals. Cell 101: 25-33 (2000).
Sequence CWU 1
1
6121DNAartificial sequenceMeans and Methods for the Specific
Inhibition of Genes in Cells and Tissue of the CNS and/or Eyes
1gcaagctgac cctgaagttc a 21219RNAArtificial SequenceGFP dsRNA sense
strand 2gcaagcugac ccugaaguu 19319RNAArtificial SequenceGFP dsRNA
antisense strand 3aacuucaggg ucagcuugc 19421DNAArtificial
Sequencenon-silencing control target sequence 4aattctccga
acgtgtcacg t 21521DNA/RNAArtificial Sequencenon-silencing control
dsRNA sense strand 5uucuccgaac gugucacgut t 21621DNA/RNAArtificial
Sequencenon-silencing control dsRNA antisense strand 6acgugacacg
uucggagaat t 21
* * * * *