U.S. patent application number 12/746343 was filed with the patent office on 2011-01-20 for protection of progenitor cells and regulation of their differentiation.
This patent application is currently assigned to Proteobioactives Pty Ltd.. Invention is credited to Peter Ghosh.
Application Number | 20110014701 12/746343 |
Document ID | / |
Family ID | 40717200 |
Filed Date | 2011-01-20 |
United States Patent
Application |
20110014701 |
Kind Code |
A1 |
Ghosh; Peter |
January 20, 2011 |
Protection of Progenitor Cells and Regulation of Their
Differentiation
Abstract
The present invention relates to the use of polysulfated
polysaccharides in combination with progenitor cells to improve the
viability of the progenitor cells including improving the
cryopreservation of the progenitor cells and provides novel
compositions, methods and uses. The present invention also relates
to the use of polysulfated polysaccharides to regulate the
proliferation and differentiation of progenitor cells.
Inventors: |
Ghosh; Peter; (Fairlight,
AU) |
Correspondence
Address: |
FOLEY HOAG, LLP;PATENT GROUP, WORLD TRADE CENTER WEST
155 SEAPORT BLVD
BOSTON
MA
02110
US
|
Assignee: |
Proteobioactives Pty Ltd.
|
Family ID: |
40717200 |
Appl. No.: |
12/746343 |
Filed: |
December 4, 2008 |
PCT Filed: |
December 4, 2008 |
PCT NO: |
PCT/AU08/01795 |
371 Date: |
September 28, 2010 |
Current U.S.
Class: |
435/374 ;
435/377 |
Current CPC
Class: |
A01N 1/0226 20130101;
A61K 31/737 20130101; A61K 35/28 20130101; A61P 19/08 20180101;
C12N 2506/1346 20130101; C12N 5/0663 20130101; C12N 2501/90
20130101; A61K 35/12 20130101; A61P 19/02 20180101; C12N 5/0655
20130101 |
Class at
Publication: |
435/374 ;
435/377 |
International
Class: |
C12N 5/07 20100101
C12N005/07 |
Foreign Application Data
Date |
Code |
Application Number |
Dec 4, 2007 |
AU |
2007906607 |
Claims
1. A composition comprising progenitor cells together with a
polysulfated polysaccharide or biologically active molecular
fragment thereof.
2. The composition of claim 1 further comprising a carrier
medium.
3. The composition of claim 2, wherein the carrier medium is a
culture medium, cryopreservation medium and/or a pharmaceutically
acceptable carrier.
4. The composition of claim 1 wherein the progenitor cell is a
chondroprogenitor cell.
5. The composition of claim 1 wherein the progenitor cell is a
Stro-1.sup.bri cell, and/or a Stro-1.sup.bri progeny cell.
6. The composition of claim 1 wherein the polysulfated
polysaccharide is selected from pentosan polysulfate chondroitin
polysulfate, chitosan polysulfate, dextran polysulfate and heparin
(high and low molecular weight) together with their
pharmaceutically acceptable salts.
7. The composition of claim 1 wherein the polysulfated
polysaccharide is selected from pentosan polysulfate, the sodium
salt of pentosan polysulfate (NaPPS), the magnesium salt of
pentosan polysulfate (MgPPS), and/or the calcium salt of pentosan
polysulfate (CaPPS).
8. The composition of claim 1 wherein the composition comprises
about 1000 to about 1.times.10.sup.10 cells; about
1.times.10.sup.5-1.times.10.sup.9 cells; about 100,000 to about
5.times.10.sup.8 cells; about 500,000 to about 2.times.10.sup.8
cells, about 1.times.10.sup.6 to about 2.times.10.sup.8 cells;
about 1.times.10.sup.6 to about 1.times.10.sup.8 cells; about
1.times.10.sup.6, 2.times.10.sup.6, 3.times.10.sup.6,
4.times.10.sup.6, 5.times.10.sup.6, 6.times.10.sup.6,
7.times.10.sup.6, 8.times.10.sup.6, 9.times.10.sup.6,
1.times.10.sup.7, 2.times.10.sup.7, 3.times.10.sup.7,
4.times.10.sup.7, 5.times.10.sup.7, 6.times.10.sup.7,
7.times.10.sup.7, 8.times.10.sup.7, 9.times.10.sup.7,
1.times.10.sup.8, 2.times.10.sup.8, 3.times.10.sup.8,
4.times.10.sup.8, 5.times.10.sup.8, 6.times.10.sup.8,
7.times.10.sup.8, 8.times.10.sup.8, or about 9.times.10.sup.8
cells.
9. The composition of claim 1 wherein the composition comprises
polysulfated polysaccharide in a concentration of about 500
ng/ml/million cells-10 mg/ml/million cells, 500 ng/ml/million
cells-2000 .mu.g/ml/million cells, 1 .mu.g/ml/million cells-1000
.mu.g/ml/million cells, or 1 .mu.g/ml/million cells-500
.mu.g/ml/million cells, 500 ng-10 .mu.g/ml/million cells, 1
.mu.g-10 .mu.g/ml/million cells, 1 .mu.g-8 .mu.g/ml/million cells,
1 .mu.g-6 .mu.g/ml/million cells, 1 .mu.g-5 .mu.g/ml/million cells,
1 .mu.g-3 .mu.g/ml/million cells, 2 .mu.g-6 .mu.g/ml/million cells,
2.5 .mu.g-5 .mu.g/ml/million cells, or 3 .mu.g-5 .mu.g/ml/million
cells, 1 .mu.g-100 .mu.g/ml/million cells, 1 .mu.g-50
.mu.g/ml/million cells, 1 .mu.g-20 .mu.g/ml/million cells, 1
.mu.g-15 .mu.g/ml/million cells, 10 .mu.g-100 .mu.g/ml/million
cells, 20 .mu.g-100 .mu.g/ml/million cells, or 50 .mu.g-100
.mu.g/ml/million cells, 1 .mu.g-1000 .mu.g/ml/million cells, 100
.mu.g-800 .mu.g/ml/million cells, 100 .mu.g-600 .mu.g/ml/million
cells, 100 .mu.g-500 .mu.g/ml/million cells, 200 .mu.g-500
.mu.g/ml/million cells, 500 ng, 1 .mu.g, 2 .mu.g, 2.5 .mu.g, 5
.mu.g, 10 .mu.g, 15 .mu.g, 20 .mu.g, 30 .mu.g, 40 .mu.g, 50 .mu.g,
60 .mu.g, 70 .mu.g, 80 .mu.g, 90 .mu.g, 100 .mu.g, 150 .mu.g, 200
.mu.g, 250 .mu.g, 300 .mu.g, 350 .mu.g, 400 .mu.g, 450 .mu.g, 500
.mu.g, 550 .mu.g, 600 .mu.g, 650 .mu.g, 700 .mu.g, 750 .mu.g, 800
.mu.g, 850 .mu.g, 900 .mu.g, 950 .mu.g, 1000 .mu.g, 1050 .mu.g,
1100 .mu.g, 1150 .mu.g, 1200 .mu.g, 1250 .mu.g, 1300 .mu.g, 1350
.mu.g, 1400 .mu.g, 1450 .mu.g, 1500 .mu.g, 1550 .mu.g, 1600 .mu.g,
1650 .mu.g, 1700 .mu.g, 1750 .mu.g, 1800 .mu.g, 1850 .mu.g, 1900
.mu.g, 1950 .mu.g, or 2000 .mu.g/ml/million cells.
10. The composition of claim 1 wherein the composition comprises
about 1.times.10.sup.6-1.times.10.sup.8 progenitor cells and 25-50
mg polysulfated polysaccharide; 1.times.10.sup.8 progenitor cells
and 25-50 mg/ml polysulfated polysaccharide.
11. The composition of claim 1 wherein the composition further
comprises one or more of the following components: organic and/or
inorganic salts; buffers proteins such as BSA or transferin; growth
factors and cytokines, including insulin like growth factor,
insulin, fibroblast like growth factors; BMP-TGF-beta super family
(eg, BMP-2, BMP-7, BMP-8, TGF beta) and fibroblast growth factor
family, IGF, FGF, EGF, PDGF, VEGF; animal sera including FBS,
new-born calf, all other mammalian species; cryopreservation agents
such as Profreeze.RTM. and CryoStor.RTM.; cryoprotectorants,
including dimethyl sulfoxide (DMSO), glycerol, trehalose, sucrose
and other sugars or dimethylacetamide; carbohydrates;
vitamins/co-factors; hormones antibiotics attachment factors; amino
acids; plasma expanders like dextran; plasma both human and other
mammalian species; plasma substitute; hyaluronan and/or hyaluronic
acid, both natural or cross linked.
12. The composition of claim 11 wherein the DMSO is present in the
range of 1-20%, 1-15%, 5-15%, 1-10%, 5%, 7.5%, 10%, 15% or 20%;
and/or the FBS is in the range of 1-50%, 1-20%, 1-10%, 5%, 7.5%,
10%, 15% or 20%.
13. The composition of claim 1 wherein the carrier medium comprises
Profreeze.RTM..
14. The composition of claim 1 wherein the composition further
comprises NC4 or a biologically active fragment thereof.
15. A method of enhancing cryopreservation of progenitor cells,
comprising exposing the progenitor cells to a polysulfated
polysaccharide or a biologically active molecular fragment
thereof.
16-17. (canceled)
18. A method of regulating the proliferation of progenitor cells,
comprising exposing a polysulfated polysaccharide or biologically
active molecular fragment thereof to a progenitor cell.
19. (canceled)
20. A method of regulating differentiation of progenitor cells by
exposing a polysulfated polysaccharide or biologically active
molecular fragment thereof to a progenitor cell, including
differentiation into chondrocytes, differentiation into osteoblasts
or differentiation into adipocytes.
21-22. (canceled)
Description
FIELD OF THE INVENTION
[0001] The present invention relates to the use of polysulfated
polysaccharides in combination with progenitor cells to improve the
viability of the progenitor cells including improving the
cryopreservation of the progenitor cells and provides novel
compositions, methods and uses. The present invention also relates
to the use of polysulfated polysaccharides to regulate the
proliferation and differentiation of progenitor cells.
BACKGROUND OF THE INVENTION
[0002] Human progenitor cells are the immature cells that give rise
to all of the different types of mature cells that make up the
organs and tissues of the adult body. The transition from
progenitor cell to mature, specialised adult cell is via a process
called differentiation.
[0003] Progenitor cells in the body take different pathways of
differentiation in response to different stimuli from their
environment. Similarly, progenitor cells in the laboratory can be
stimulated to differentiate along different pathways by exposing
them to various combinations of biochemicals. With appropriate
stimuli, progenitor cells can differentiate into, among other
tissues, blood cells, bone, cartilage, fat, blood vessels or heart
muscle. Because of this, great interest is given to the use of
progenitor cells as the basis of treatments to repair and re-grow
of a range of tissues and organs.
[0004] Progenitor cells exist in the embryo and also in adult
tissues such as bone marrow, fat, skin and dental pulp, though in
much smaller relative numbers than in the embryo. The two types of
adult progenitor cells are haematopoietic, which give rise to new
bone marrow and blood cells, and non-haematopoietic, which give
rise to solid organs and tissues, such as bone, heart and
cartilage. Haematopoietic-type adult progenitor cells can be
readily obtained from bone marrow and are already being used
clinically. However, technology related to non-haematopoietic-type
adult progenitor cells is much less developed due to the difficulty
of obtaining sufficient numbers of these cells and of growing them
in the laboratory.
[0005] In order to use progenitor cells in therapy it is necessary
to be able to successfully store the progenitor cells prior to
their use. The progenitor cells must be stored in such a way that
they are effectively preserved and their viability is maintained.
In general, the progenitor cells are cryopreserved for storage and
thawed prior to use.
[0006] Cryogenic preservation (storage below -100.degree. C.) of
cell cultures is widely used to maintain backups or reserves of
cells without the associated effort and expense of feeding and
caring for them. The success of the freezing process depends on
four critical areas, proper handling of the cultures, controlled
freezing, proper storage and an appropriate cryoprotective agent.
The last point is particularly important and a suitable agent can
assist in maintaining the viability of the cells.
[0007] In a clinical setting, it is particularly important that
following cryopreservation, the cells remain viable and any
increase in the viability of the cells will boost the effect of the
treatment.
[0008] In addition, in order for the progenitor cells to be
therapeutically effective it is necessary for them to differentiate
into the required cell type. Thus, there is also a need to develop
effective regulators of progenitor cell differentiation to ensure
that the progenitor cells differentiate into the required cell
type.
[0009] Furthermore, there is also a need to develop effective
regulators of progenitor cell proliferation. It is often desirable
for the progenitor cells to proliferate both in vitro and in
vivo.
[0010] Therefore, there remains a need for agent(s) which can
protect the progenitor cells during cryopreservation, enhance their
viability, regulate their differentiation and/or regulate their
proliferation.
SUMMARY OF THE INVENTION
[0011] The present inventors have now found that polysulfated
polysaccharides or biologically active molecular fragments thereof
can improve the viability of progenitor cells. In particular,
present inventors have found that polysulfated polysaccharides or
biologically active molecular fragments thereof can enhance
cryopreservation of progenitor cells.
[0012] The present inventors have also found that polysulfated
polysaccharides or biologically active molecular fragments thereof
can regulate the proliferation of progenitor cells.
[0013] The present inventor has also found that polysulfated
polysaccharides or biologically active molecular fragments thereof
can regulate the differentiation of progenitor cells. Regulation
may be upregulation or downregulation. It has been found that
polysulfated polysaccharides or biologically active molecular
fragments thereof can regulate differentiation into chondrocytes,
osteoblasts, and adipocytes. In particular, it has been found that
polysulfated polysaccharides or biologically active molecular
fragments thereof can induce chondrogenesis.
[0014] These findings indicate that polysulfated polysaccharides or
biologically active molecular fragments thereof can be used in
combination with progenitor cells to improve or enhance the
viability of the progenitor cells after cryopreservation and can be
used in combination with progenitor cells in in vitro and in vivo
methods and uses.
[0015] These unexpected findings therefore open up the possibility
of using the polysulfated polysaccharides or a biologically active
molecular fragment thereof in a number of new applications. For
example, by regulating differentiation, particularly
chondrogenesis, it is possible, among other things, to rebuild
cartilage and intervertebral discs, prevent the degradation of
joints and enhance the repair of avascular connective tissues.
Prior to the present invention, it was not known that the
polysulfated polysaccharides could regulate differentiation of
progenitor cells, particularly chondrogenesis. Furthermore, by
regulating proliferation, it is possible to control the production
of progenitor cells both in vitro and in vivo. While the use of
polysulfated polysaccharides in relation to osteo arthritis (OA)
treatments per se has been published, it was not previously known
that polysulfated polysaccharide have advantageous cryopreservation
properties in relation to progenitor cells or that they can
regulate differentiation and/or cell proliferation of said cells.
Therefore, this opens up new treatment avenues that were not
considered before.
[0016] As used herein a "biologically active molecular fragment" is
a portion of a molecule of the invention which maintains a defined
activity of the full-length molecule, namely in one embodiment to
be able to enhance viability, to regulate cell differentiation
and/or to regulate cell proliferation.
[0017] Accordingly, in a first embodiment, the present invention
provides a composition comprising a progenitor cell together with a
polysulfated polysaccharide or biologically active molecular
fragment thereof.
[0018] In a further embodiment, the present invention provides a
composition comprising progenitor cells, and a polysulfated
polysaccharide or biologically active molecular fragment thereof,
together with a carrier medium.
[0019] The carrier medium may be a culture medium, bioscaffold,
cryopreservation medium, physiological media and/or a
pharmaceutically acceptable carrier.
[0020] In a further embodiment, the present invention provides a
composition comprising progenitor cells and a polysulfated
polysaccharide or biologically active molecular fragment thereof,
together with a cryopreservation medium.
[0021] The composition may be used both in vitro and in vivo.
[0022] The composition can contain any number of progenitor cells.
In a further embodiment, the present invention contains about 1000
to about 1.times.10.sup.10 progenitor cells. In a further
embodiment, the present invention contains about
1.times.10.sup.5-1.times.10.sup.9 cells. In a further embodiment,
the present invention contains 100,000 to about
5.times.10.sup.8progenitor cells. In a further embodiment, the
present invention contains about 500,000 to about 2.times.10.sup.8
progenitor cells, about 1.times.10.sup.6 to about 2.times.10.sup.8
progenitor cells, or about 1.times.10.sup.6 to about
1.times.10.sup.8 progenitor cells. In a yet further embodiment, the
composition contains about 1.times.10.sup.6, 2.times.10.sup.6,
3.times.10.sup.6, 4.times.10.sup.6, 5.times.10.sup.6,
6.times.10.sup.6, 7.times.10.sup.6, 8.times.10.sup.6,
9.times.10.sup.6, 1.times.10.sup.7, 2.times.10.sup.7,
3.times.10.sup.7, 4.times.10.sup.7, 5.times.10.sup.7,
6.times.10.sup.7, 7.times.10.sup.7, 8.times.10.sup.7,
9.times.10.sup.7, 1.times.10.sup.8, 2.times.10.sup.8,
3.times.10.sup.8, 4.times.10.sup.8, 5.times.10.sup.8,
6.times.10.sup.8, 7.times.10.sup.8, 8.times.10.sup.8, or
9.times.10.sup.8 progenitor cells. In yet a further embodiment, the
composition contains about 1.times.10.sup.8 progenitor cells.
[0023] In one embodiment, the concentration of the polysulfated
polysaccharide in the composition will depend on the number of
cells in the composition. Thus, in one embodiment, the
concentration of the polysulfated polysaccharide in the composition
is from 500 ng/ml/million cells-10 mg/ml/million cells, or 500
ng/ml/million cells-2000 .mu.g/ml/million cells, 1 .mu.g/ml/million
cells-1000 .mu.g/ml/million cells, or 1 .mu.g/ml/million cells-500
.mu.g/ml/million cells.
[0024] In a further embodiment, the polysulfated polysaccharide
concentration is in the range of 500 ng-10 .mu.g/ml/million cells;
1-10 .mu.g/ml/million cells; 1 .mu.g-8 .mu.g/ml/million cells; 1
.mu.g-6 .mu.g/ml/million cells; 1-5 .mu.g/ml/million cells; 1-3
.mu.g/ml/million cells; 2 .mu.g-6 .mu.g/ml/million cells; 2.5
.mu.g-5 .mu.g/ml/million cells; or 3 .mu.g-5 .mu.g/ml/million
cells. In a further embodiment, the polysulfated polysaccharide
concentration is in the range of 1 .mu.g-100 .mu.g/ml/million
cells; 1 .mu.g-50 .mu.g/ml/million cells; 1 .mu.g -20
.mu.g/ml/million cells; 1 .mu.g-15 .mu.g/ml/million cells; 10
.mu.g-100 .mu.g/ml/million cells; 20 .mu.g-100 .mu.g/ml/million
cells; or 50 .mu.g-100 .mu.g/ml/million cells. In a further
embodiment, the polysulfated polysaccharide concentration is in the
range of 1 .mu.g-1000 .mu.g/ml/million cells; 100 .mu.g-800
.mu.g/ml/million cells; 100 .mu.g-600 .mu.g/ml/million cells; 100
.mu.g-500 .mu.g/ml/million cells; 200 .mu.g-500 .mu.g/ml/million
cells. In a further embodiment the polysulfated polysaccharide
concentration is in the range of 250 .mu.g-500 .mu.g/ml/million
cells.
[0025] In one embodiment, the polysulfated polysaccharide
concentration comprises 500 ng, 1 .mu.g, 2 .mu.g, 2.5 .mu.g, 5
.mu.g, 10 .mu.g, 15 .mu.g, 20 .mu.g, 30 .mu.g, 40 .mu.g, 50 .mu.g,
60 .mu.g, 70 .mu.g, 80 .mu.g, 90 .mu.g, 100 .mu.g, 150 .mu.g, 200
.mu.g, 250 .mu.g, 300 .mu.g, 350 .mu.g, 400 .mu.g, 450 .mu.g, 500
.mu.g, 550 .mu.g, 600 .mu.g, 650 .mu.g, 700 .mu.g, 750 .mu.g, 800
.mu.g, 850 .mu.g, 900 .mu.g, 950 .mu.g, 1000 .mu.g, 1050 .mu.g,
1100 .mu.g, 1150 .mu.g, 1200 .mu.g, 1250 .mu.g, 1300 .mu.g, 1350
.mu.g, 1400 .mu.g, 1450 .mu.g, 1500 .mu.g, 1550 .mu.g, 1600 .mu.g,
1650 .mu.g, 1700 .mu.g, 1750 .mu.g, 1800 .mu.g, 1850 .mu.g, 1900
.mu.g, 1950 .mu.g, or 2000 .mu.g/ml/million cells. In a further
embodiment, the polysulfated polysaccharide concentration comprises
polysulfated polysaccharide concentrations comprise 200
.mu.g/ml/million cells, 250 .mu.g/ml/million cells, 300
.mu.g/ml/million cells, 400 .mu.g/ml/million cells, or 500
.mu.g/ml/million cells. In a yet further embodiment, the
polysulfated polysaccharide concentration comprises 250
.mu.g/ml/million cells or 500 .mu.g/ml/million cells.
[0026] Alternatively, the concentration of the polysulfated
polysaccharide is independent of the number of cells in the
composition. Thus in a further embodiment of the present invention
the concentration of the polysulfated polysaccharide in the
composition is from 500 ng/ml-10 mg/ml; 500 ng/ml-2000 .mu.g/ml; 1
.mu.g/ml-1000 .mu.g/ml; or 1 .mu.g/ml-500 .mu.g/ml.
[0027] In a further embodiment, the polysulfated polysaccharide
concentration is in the range of 500 ng-10 .mu.g/ml; 1 .mu.g-10
.mu.g/ml; 1 .mu.g-8 .mu.g/ml; 1 .mu.g-6 .mu.g/ml; 1 .mu.g-5
.mu.g/ml; 1 .mu.g-3 .mu.g/ml; 2 .mu.g-6 .mu.g/ml; 2.5 .mu.g-5
.mu.g/ml; or 3 .mu.g-5 .mu.g/ml. In a further embodiment, the
polysulfated polysaccharide concentration is in the range of 1
.mu.g-100 .mu.g/ml; 1 .mu.g-50 .mu.g/ml; 1 .mu.g-20 .mu.g/ml; 1
.mu.g-15 .mu.g/ml; 10 .mu.g-100 .mu.g/ml; 20 .mu.g-100 .mu.g/ml; or
50 .mu.g-100 .mu.g/ml. In a further embodiment, the polysulfated
polysaccharide concentration is in the range of 1 .mu.g-1000
.mu.g/ml; 100 .mu.g-800 .mu.g/ml; 100 .mu.g-600 .mu.g/ml; 100
.mu.g-500 .mu.g/ml; 200 .mu.g-500 .mu.g/ml. In a further
embodiment, the polysulfated polysaccharide concentration is in the
range of 1 mg-1000 .mu.g/ml; 100 .mu.g-800 .mu.g/ml; 100 .mu.g-600
.mu.g/ml; 100 .mu.g-500 .mu.g/ml; 200 .mu.g-500 .mu.g/ml. In a
further embodiment, the polysulfated polysaccharide concentration
is in the range of 250 .mu.g-500 .mu.g/ml.
[0028] Further polysulfated polysaccharide concentration comprises
500 ng, 1 .mu.g, 2 .mu.g, 2.5 .mu.g, 5 .mu.g, 10 .mu.g, 15 .mu.g,
20 .mu.g, 30 .mu.g, 40 .mu.g, 50 .mu.g, 60 .mu.g, 70 .mu.g, 80
.mu.g, 90 .mu.g, 100 .mu.g, 150 .mu.g, 200 .mu.g, 250 .mu.g, 300
.mu.g, 350 .mu.g, 400 .mu.g, 450 .mu.g, 500 .mu.g, 550 .mu.g, 600
.mu.g, 650 .mu.g, 700 .mu.g, 750 .mu.g, 800 .mu.g, 850 .mu.g, 900
.mu.g, 950 .mu.g, 1000 .mu.g, 1050 .mu.g, 1100 .mu.g, 1150 .mu.g,
1200 .mu.g, 1250 .mu.g, 1300 .mu.g, 1350 .mu.g, 1400 .mu.g, 1450
.mu.g, 1500 .mu.g, 1550 .mu.g, 1600 .mu.g, 1650 .mu.g, 1700 .mu.g,
1750 .mu.g, 1800 .mu.g, 1850 .mu.g, 1900 .mu.g, 1950 .mu.g, or 2000
.mu.g/ml. Further polysulfated polysaccharide concentrations
comprise 200 .mu.g/ml, 250 .mu.g/ml, 300 .mu.g/ml, 400 .mu.g/ml, or
500 .mu.g/ml. Further polysulfated polysaccharide concentrations
comprise 250 .mu.g/ml and 500.mu.g/ml.
[0029] Further compositions contain a total polysulfated
polysaccharide content of 1 mg, 2 mg, 3 mg, 4 mg, 5 mg, 6 mg, 7 mg,
8 mg, 9 mg, 10 mg, 15 mg, 20 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg,
50 mg, 55 mg, 60 mg, 70 mg, 80 mg, 90 mg, or 100 mg. Further
compositions contain a total polysulfated polysaccharide content of
15-70 mg, 20-60 mg, or 25-50 mg.
[0030] A further embodiment comprises about
1.times.10.sup.6-1.times.10.sup.8 progenitor cells and 25-50 mg
polysulfated polysaccharide. A further embodiment contains
1.times.10.sup.8 progenitor cells and 25-50 mg/ml polysulfated
polysaccharide.
[0031] In a further embodiment, the polysulfated polysaccharide may
be administered in an amount such as to produce a concentration of
the polysulfated polysaccharide in the biological compartment of
0.01 to 100 micrograms/ml biological media, for example 5 0.1 to 50
micrograms per ml biological media, 0.1 to 50 micrograms per ml
biological media, 0.1 to 10 micrograms per ml biological media, 1
to 10 micrograms per ml biological media, 2 to 8 micrograms per ml
biological media, 4 to 6 micrograms per ml biological media, or 4,
5, or 6 micrograms per ml biological media.
[0032] By biological compartment, it is meant an area of the body
such as the intervertebral disk, muscle, synovial joints, intra
synovial tissue (meniscus, synovium), extra synovial tissue
(capsule), intra tendon, extra tendon, cardium, pericardium,
cardiac muscle, and/or intra adipose tissue, intra-ligamentum,
extra-ligamentum, intra-dermal, subdermal, intra-peritoneally,
intra-venously, intra-arterally. The biological media will depend
on the biological compartment. Biological media includes blood,
serum, plasma, synovial fluid, peritoneal fluid, serous fluid, or
adipose tissues. Thus, for example, in a further embodiment, the
polysulfated polysaccharide may be administered in an amount such
as to produce a concentration of the polysulfated polysaccharide in
the synovial joints of 1 to 10 micrograms per ml synovial
fluid.
[0033] Carrier Medium
[0034] The composition may contain a carrier medium. In one
embodiment, the carrier medium is an aqueous solution. The medium
may optionally contain further components which preserves the
normal physiological structure and functions of the cells,
particularly in relation to maintaining their environmental
osmolarity, pH, integrity and fluidity of its plasma membrane and
intra-cellular organelles.
[0035] Suitable carriers for this invention include those
conventionally used alone and in combination, e.g., water, saline,
aqueous dextrose, lactose, Ringer's solution, Krebs mammalian
Ringer solution, Earles's solution, Gey's solution, Simm's
solution, Tyrode solution, hyaluronan, physiological buffered
saline (PBS), Locke's solution, Hank's solution, Clark and Lubs
buffer, buffers; buffers composed of MES-NaOH, HEPES-NaOH,
TRICINE-NaOH, EPPS-NaOH, BICINE-NaOH,
Tris(hydroxymethyl)aminomethane-HCl, Glycine-NaOH, sodium
bicarbonte-CO.sub.2, sodium carbonate-bicarbonate, sodium
cacodylate, sodium hydrogen maleate-NaOH; culture media such as,
Eagle's medium, Dulbecco's medium or buffer, McCoy's medium,
Click's medium, Ames' medium, alpha MEM, DMEM, Ham's F12, Ham's
F10, RPMI-1640CMRL 1066, and 1415 NCTC 135; commercial specialist
cell line media eg Stemline.RTM. and Megacell.RTM. or commercial
cryopreservation agents such as Profreeze.RTM. and
CryoStor.RTM..
[0036] Thus, in one embodiment, the carrier medium is an aqueous
medium which may optionally further include one or more of the
following components: [0037] organic and/or inorganic salts; [0038]
buffers [0039] proteins such as BSA or transferin; [0040] growth
factors and cytokines, including insulin like growth factor,
insulin, fibroblast like growth factors; BMP-TGF-beta super family
(eg, BMP-2, BMP-7, BMP-8, TGF beta) and fibroblast growth factor
family, IGF, FGF, EGF, PDGF, VEGF; [0041] animal sera including
FBS, new-born calf, all other mammalian species; [0042]
cryopreservation agents such as Profreeze.RTM. and CryoStor.RTM.;
[0043] cryoprotectorants, including dimethyl sulfoxide (DMSO),
glycerol, trehalose, sucrose and other sugars or dimethylacetamide;
[0044] carbohydrates; [0045] vitamins/co-factors; [0046] hormones
[0047] antibiotics [0048] attachment factors; [0049] amino acids;
[0050] plasma expanders like dextran; [0051] plasma both human and
other mammalian species; [0052] plasma substitute; [0053]
hyaluronan and/or hyaluronic acid, both natural or cross
linked.
[0054] Thus, in one embodiment, the carrier medium comprises an
aqueous media selected from water, saline, aqueous dextrose,
lactose, a buffered solution, hyaluronan and glycols, physiological
buffered saline (PBS), Ringer's solution, Locke's solution, Hank's
solution, minimum essential medium, minimum essential medium alpha
(alpha MEM), or DMEM. In one embodiment, the carrier medium
comprises alpha MEM. In an alternative embodiment, the carrier
medium comprises DMEM. In an alternative embodiment, the carrier
medium comprises HAMS 12.
[0055] The carrier medium may additionally comprise
cryopreservation agents such as propriety preparations like
Profreeze.RTM. or CryoStor.RTM..
[0056] In an alternative embodiment, the carrier medium may
comprise cryopreservation agents such as propriety preparations
like Profreeze.RTM. or CryoStor.RTM. as the aqueous solution. In
this embodiment, the composition does not contain carriers like
water, saline, aqueous dextrose, lactose, Ringer's solution, a
buffered solution, hyaluronan, physiological buffered saline (PBS),
Locke's solution, Hank's solution, alpha MEM; DMEM; or HAMS F12 and
instead comprises a cryopreservation agents such as propriety
preparations like Profreeze.RTM. or CryoStor.RTM., optionally in
combination with one or more cryoprotectorants such as dimethyl
sulfoxide (DMSO), glycerol, trehalose, sucrose and other sugars or
dimethylacetamide. As an example, the carrier medium may comprise
or consist of Profreeze.RTM. and DMSO.
[0057] The carrier medium may act as a culture medium and may be
supplemented with organic and/or inorganic salts, carbohydrates,
vitamins, amino acids and/or other entities which fulfil the
nutritional requirements of the cell allowing them to divide and
function normally in vitro. In one embodiment, the carrier medium
further comprises serum and/or protein supplements. Thus, the
culture media may be supplemented with proteins, including but not
limited to BSA or transferin. In addition to, or instead of, the
culture medium may be supplemented with serum, for example foetal
or neonatal blood which contain growth factors, eg foetal calf
serum. Recipes for the preparation and method of use of these media
are well known to those skilled in the art. Suitable media can be
found in Adams R L P. Cell culture for Biochemists.
Elsevier/North-Holland Biomedical Press, Amsterdam, New York,
Oxford. 1980, pp 84-97 and pp 246-260. (ISBN 0-444-80199-5), and
Dawson R M C, Elliott D C, Elliott W H and Jones K M, Data for
Biochemical Research (Third Edition), Clarendon Press, Oxford,
2002, pp 417-448 (ISBN 0-19-855299-8) the contents of which are
incorporated in its entirety.
[0058] In one embodiment, the carrier medium acts as a
cryopreservation medium. Cryopreservation media for freeze-thawing
cells includes the use of the commonly known carriers and/or
culture media including the aqueous media described herein (either
alone or in combination with serum protein supplements).
Alternatively, the carrier medium may comprise or include propriety
preparations such as Profreeze.RTM. and CryoStor.RTM.. To function
as a carrier medium, in general compounds are added which protect
the cell membrane and organelles from damage by ice crystals formed
during the freeze-thawing process.
[0059] Thus, in a further embodiment, the carrier medium further
comprises one or more cryoprotectorants. Suitable agents or
cryoprotectorants include dimethyl sulfoxide (DMSO), glycerol,
sucrose and other sugars. Examples of suitable agents can be found
in Brudder S, Jaiswal N, Hainsworth S, WO9739104; Farrant, J. 1980.
General observations on cell preservation. In: M. J. Ashwood-Smith
and J. Farrant, Eds. Low Temperature Preservation in Medicine and
Biology, Pitman Medical Limited, Kent, England, p. 1-18; Frederick
V, et al. Recovery, survival and functional evaluation by
transplantation of frozen-thawed mouse germ cells. Human Reprod.
2004, 19: 948-53, Pegg D E, Principles of Cryopreservation. Methods
Mol Biol. 2007; 368: 39-57, the contents of which are incorporated
by reference. Thus, in a further embodiment, the carrier medium
further comprises an agent or cryoprotectorant selected from one or
more of dimethyl sulfoxide (DMSO), glycerol, sucrose and other
sugars. Alternative cryoprotectants include dimethylacetamide as an
alternative to glycerol, trehalose and/or sucrose. In a further
embodiment, the carrier medium comprises conventional
cryoprotectants, optionally in combination with growth factors
and/or differentiation factors. Examples of suitable carrier
mediums can be found in WO9832333, WO9739104 or WO1997/039104.
[0060] In a yet further embodiment, the carrier medium further
comprises a propriety preparations such as Profreeze.RTM. and
CryoStor.RTM.. Profreeze is sold by Lonza-BioWhittaker as freezing
medium containing components of non-animal origin. The carrier
medium may be supplemented with the agents or protectorants
discussed herein, in particular DMSO, glycerol, sucrose and other
sugars, and further in particular DMSO. In a particular embodiment,
the carrier medium includes Profreeze.RTM. CDNAO Freezing Medium,
optionally in combination with DMSO. In a further embodiment, the
carrier medium comprises Alpha MEM, Profreeze.RTM. CDNAO Freezing
Medium and DMSO.
[0061] The present invention contemplates and includes the
possibility that the carrier medium fulfils multiple requirements.
Thus, the carrier medium may function as both a culture medium and
a cryopreservation medium. Equally, the carrier medium may function
as both a cryopreservation medium and a pharmaceutically acceptable
carrier.
[0062] The carrier medium may comprise dimethylsulfoxide (DMSO)
and/or glycerol. In one embodiment, the carrier medium comprises
dimethylsulfoxide (DMSO). In a further embodiment, the composition
comprises 1-20% DMSO. In a yet further embodiment, the composition
comprises 1-15% DMSO, 5-15% DMSO, 1-10% DMSO, 5% DMSO, 7.5% DMSO,
10% DMSO, 15% DMSO or 20% DMSO. In a particular embodiment, the
DMSO is high purity grade DMSO.
[0063] Some cells may be adversely affected by prolonged contact
with DMSO. This can be reduced or eliminated by adding the DMSO to
the cell suspension at 4.degree. C. and removing it immediately
upon thawing. Alternatively, a lower concentration of DMSO can be
used.
[0064] As a further possibility the carrier medium may comprise
glycerol instead of DMSO. Thus, in an alternative embodiment, the
carrier medium may comprise glycerol. In one embodiment, the
glycerol is present at a concentration of 1-30%, 1-20%, 5-20%,
1-15%, 5-15%, 1-10% or 5-10%.
[0065] In one embodiment, the medium contains DMSO or glycerol in
combination with DMEM, HETA-Starch and/or human serum components
and/or other bulking agents.
[0066] In one embodiment, the carrier medium is acceptable for
injection and does not affect the functionality of the cells. In
one embodiment, the medium contains serum. In a further embodiment,
the medium is a serum free medium.
[0067] In one embodiment, the carrier medium contains serum, in one
embodiment human serum components. In an embodiment, the carrier
medium further comprises foetal bovine serum (FBS). In one
embodiment, the composition comprises 1-50% FBS. In a further
embodiment, the composition comprises 1-20% FBS, 1-10% FBS, 5% FBS,
30 7.5% FBS, 10% FBS, 15% FBS or 20% FBS. Alternatively, suitable
serum includes BSA, transferin and/or egg yolk proteins at the same
possible concentrations.
[0068] An example of a serum based cryopreservation medium would be
a carrier medium comprising an aqueous solution such as Ringer's
solution, physiological buffered saline (PBS), Locke's solution,
Hank's solution, alpha MEM, DMEM or HAMS F12 together with a
cryoprotectorant such as dimethyl sulfoxide (DMSO), glycerol,
trehalose, sucrose and other sugars or dimethylacetamide and serum
such as FBS.
[0069] Thus, an example serum based cryopreservation medium would
be a carrier medium comprising DMEM or alpha MEM, DMSO and serum
(using, for example, foetal bovine serum).
[0070] The carrier medium may also be serum free and/or protein
free and may be a chemically defined media. Examples of serum free
media include, KnockOut.TM. Serum Replacement, KnockOut.TM. D-MEM,
StemPro.RTM.-34 SFM.
[0071] An example of a serum-free medium would be a carrier medium
comprising an aqueous solution such as Ringer's solution,
physiological buffered saline (PBS), Locke's solution, Hank's
solution, alpha MEM, DMEM or HAMS F12 together with a
cryoprotectorant such as dimethyl sulfoxide (DMSO), glycerol,
trehalose, sucrose and other sugars or dimethylacetamide and a
cryopreservation medium such as propriety preparations like
Profreeze.RTM. or CryoStor.RTM..
[0072] Thus, an example serum based cryopreservation medium would
be a carrier medium comprising alpha MEM, DMSO and Profreeze.RTM.
or simply DMSO and Profreeze.RTM..
[0073] In one embodiment, the carrier medium comprises
Profreeze.RTM.. Profreeze.RTM. is a serum-free freezing medium and
is specifically formulated for cryopreserving cells that have been
propagated in serum-free media. This protein-free, non-animal
component medium is free of natural animal proteins and maintains
high cell viability upon recovery from frozen storage. In a further
embodiment, the carrier medium comprises Profreeze.RTM. together
with DMSO, with the DMSO optionally at 7.5 or 15%. Alternatively,
the carrier medium may include CryoStor.RTM..
[0074] In one embodiment, the medium may contain buffers. Buffers
include DMEM, phosphate buffers, or CMF-PBS. Commonly used
physiological buffers are all encompassed by the present invention.
Example buffers can be found in the literature, for example, Lelong
I H and Rebel G. pH drift of "physiological buffers" and culture
media used for cell incubation during in vitro studies. J Pharmacol
Toxicol Methods. 1998; 39: 203-210; John A Bontempo. Development of
Biopharmaceutical Parenteral Dosage Forms. in Drugs and the
Pharmaceutical Sciences. Marcel Dekker Inc, NY (ISBN:
0-8247-9981-X): pp 91-108, the contents of which are incorporated
herein by reference.
[0075] The medium may optionally further comprise saccharides
including dextran, trehalose, sucrose or dimethylacetamide
(DMA).
[0076] In one embodiment, the composition comprises progenitor
cells; polysulfated polysaccharides and a carrier medium
comprising: [0077] an aqueous medium selected from water, saline,
aqueous dextrose, lactose, Ringer's solution, a buffered solution,
hyaluronan, glycols, physiological buffered saline (PBS), Locke's
solution, Hank's solution, alpha MEM, DMEM, or HAMS F12; [0078] a
cryopreservation medium, including Profreeze.RTM. or CryoStor; and
[0079] a cryoprotectorant selected from dimethylsulfoxide (DMSO)
and/or glycerol.
[0080] In one embodiment, the cryopreservation medium is
Profreeze.RTM..
[0081] In one embodiment, the aqueous medium is alpha MEM or
DMEM.
[0082] In one embodiment the cryoprotectorant is DMSO.
[0083] In one embodiment, the aqueous medium is present in 1-99%,
about 10%, about 20%, about 30%, about 40%, about 50%, about 60%,
about 70%, about 80%, or about 90%.
[0084] In one embodiment, the cryopreservation medium is present in
1-99%, about 10%, about 20%, about 30%, about 40%, about 50%, about
60%, about 70%, about 80%, or about 90%.
[0085] In one embodiment, the cryoprotectorant is present in an
amount of 1-50%, 1-30%, 1-15%, 1-10%, 1-7.5%, 2.5%, 5%, 7.5%, 10%,
12.5%, 15%, 17.5% or 20%.
[0086] In a further embodiment, there is provided progenitor cells
together with a polysulfated polysaccharide or biologically active
molecular fragment thereof, cryopreserved in about 5 mL of
Profreeze.RTM. CDNAO Freezing Medium, 7.5% DMSO, and 50% Alpha MEM.
Cell concentrations at the time of cryopreservation may be
90.times.10.sup.6 cells/cryobags to 180.times.10.sup.6
cells/cryobag in 5 mL of freezing medium.
[0087] In yet another embodiment, the carrier medium comprises a
support matrix. The support matrix can otherwise be referred to as
biomatrix or bioscaffold.
[0088] In another embodiment, the present invention provides a
method of enhancing cryopreservation of progenitor cells,
comprising exposing the progenitor cells to a polysulfated
polysaccharide or biologically active molecular fragment
thereof.
[0089] In another embodiment, the present invention provides the
use of a polysulfated polysaccharide or biologically active
molecular fragment thereof to enhance the cryopreservation of
progenitor cells.
[0090] In another embodiment, the present invention provides a
method of improving the viability of progenitor cells, comprising
exposing a polysulfated polysaccharide or biologically active
molecular fragment thereof to the progenitor cells.
[0091] In another embodiment, the present invention provides the
use of a polysulfated polysaccharide or biologically active
molecular fragments thereof to improve the viability of progenitor
cells.
[0092] In another embodiment, the present invention provides the
use of a polysulfated polysaccharide as a cryopreservation
agent.
[0093] In a further embodiment, the present invention provides the
use of a composition as defined herein to enhance the
cryopreservation of progenitor cells. In another embodiment, the
present invention provides a method of improving the viability of
progenitor cells, comprising cryofreezing a composition as defined
herein and subsequently thawing the composition.
[0094] Thus, for the first time, it has been shown that the
addition of polysulfated polysaccharides to cryogenic media does
not have an adverse effect on the progenitor cells and does not
have a detrimental effect on their viability. In fact, the addition
of polysulfated polysaccharides to cryogenic media has been shown
to enhance viability of the progenitor cells.
[0095] Furthermore, it has been shown that the addition of
polysulfated polysaccharides to progenitor cells maintains or
improves the viability of the progenitor cells per se. Thus, in a
further embodiment there is provided the use of polysulfated
polysaccharides to maintain or improve the viability of progenitor
cells. In a further embodiment, there is provided a method of
maintaining or improving the viability of progenitor cells
comprising contacting a polysulfated polysaccharide to the
progenitor cell.
[0096] It has also been found that polysulfated polysaccharides or
biologically active molecular fragments thereof can regulate the
proliferation of progenitor cells.
[0097] Thus, in another embodiment, the present invention provides
a method of regulating the proliferation of progenitor cells,
comprising exposing a polysulfated polysaccharide or biologically
active molecular fragment thereof to a progenitor cell.
[0098] In another embodiment, the present invention provides the
use of a polysulfated polysaccharide or biologically active
molecular fragment thereof to regulate the proliferation of
progenitor cells.
[0099] In a further embodiment, the present invention provides the
use of a composition as defined herein to increase proliferation.
Thus, in another embodiment, the present invention provides a
method of regulating the proliferation of progenitor cells,
comprising using a composition as defined herein. In another
embodiment, the present invention provides the use of a composition
as defined herein to regulate the proliferation of progenitor
cells.
[0100] In one embodiment, proliferation is increased or
upregulated.
[0101] Thus, for the first time, it has been shown that the use of
polysulfated polysaccharides with progenitor cells can improve the
proliferation of the progenitor cells. The polysulfated
polysaccharides stimulate progenitor cell proliferation in a
concentration dependent manner. Polysulfated polysaccharides can
therefore be used in applications where it is desired to
proliferate the cells. For example, in vitro proliferation of
progenitor cells would be useful for expansion of the colony for
application in the field of bio-engineering. As an example, a
bioscaffold could be impregnated with a colony of progenitor cells
and perfused by a culture medium at 37.degree. C. containing
polysulfated polysaccharide(s). This would promote proliferation to
further engraft and fill the scaffold thereby providing a more
functional substitute tissue. As a further example, a pre-shaped
(tubular or hemi-spherical) bioscaffold could be seeded with
autologous or allogeneic progenitor cells and perfused with media
containing polysulfated polysaccharide(s) to eventually produce a
trachea or joint surface for transplantation in a host where these
cartilages are defective. Further information on these uses can be
found in Chen F H and Tuan R S. Mesenchymal cells in rhematic
diseases. Arthritis research and Therapy. 2008; 10: 223-239.
[0102] In vivo polysulfated polysaccharide stimulation of
proliferation would be advantageous to facilitate engraftment into
large defects (such as in joint cartilage) or compartments denuded
of viable endogenous resident cells (eg the centre of the
intervertebral disc) thereby reducing the time required for repair
and reconstitution of the defect. Since progenitor cells are also a
bountiful source of anti-inflammatory cytokines and
immunosuppressive factors (see for example Aggarwal S and Pittenger
A, Human progenitor cells modulate allogeneic immune cell
responses. Blood. 2005; 105: 1815-1822, Tyndale A, et al.
Immunomodulatory properties of progenitor cells: a review based on
an interdisciplinary meeting held at the Kennedy Institute of
Rheumatology Division, London, UK, 31 Oct. 2005. Arthritis Res
Ther. 2007; 9: 301-15; Jorgensen C, et al. Multipotent mesenchymal
stromal cells in articular disease. Best Practice and Research
Clinical Rheumatology. 2008; 22: 269 284) their proliferation at
sites of inflammation or antigenic response following injection
would increase the potential for suppression of these unwanted
cellular processes.
[0103] It has also been found that polysulfated polysaccharides can
regulate differentiation of progenitor cells. The differentiation
can be upregulated or downregulated.
[0104] In one embodiment there is provided a method of regulating
differentiation of progenitor cells by exposing a polysulfated
polysaccharide or biologically active molecular fragment thereof to
a progenitor cell.
[0105] In a further embodiment, there is provided the use of a
polysulfated polysaccharide or biologically active molecular
fragment thereof to regulate the differentiation of progenitor
cells.
[0106] The present invention regulates differentiation of
progenitor cells. The cells of the present invention can
differentiate into chondrocyte, osteoblast, and adipocyte lineages
and in one embodiment can differentiate into cell types of
different lineages, including bone, cartilage, adipose, muscle,
tendon, and stroma.
[0107] In particular, in one embodiment of the present invention,
the polysulfated polysaccharides or biologically active molecular
fragments thereof can regulate differentiation into chondrocytes.
In a further embodiment, the polysulfated polysaccharides or
biologically active molecular fragments thereof can regulate
differentiation into osteoblasts. In a yet further embodiment, the
polysulfated polysaccharides or biologically active molecular
fragments thereof can regulate differentiation into adipocytes. In
a further embodiment, the polysulfated polysaccharides or
biologically active molecular fragments thereof can regulate
differentiation into fibrochondrocytes. In a further embodiment,
the polysulfated polysaccharides or biologically active molecular
fragments thereof can regulate differentiation into tenocytes. In a
further embodiment, the polysulfated polysaccharides or
biologically active molecular fragments thereof can regulate
differentiation into cardiocytes.
[0108] In particular, it has been found that polysulfated
polysaccharides or biologically active molecular fragments thereof
can regulate and induce chondrogenesis.
[0109] In a further embodiment, the present invention regulates
chondrogenesis in progenitor cells which support chondrocyte
phenotype differentiation and survival. Therefore, in one aspect,
the present invention relates to the formation of chondrocytes or
fibrochondrocytes.
[0110] In a further embodiment the polysulfated polysaccharide
upregulates differentiation. In an alternative embodiment, the
polysulfated polysaccharide downregulates differentiation.
[0111] In one embodiment of the present invention there is provided
a method of regulating chondgrogenesis in progenitor cells
comprising applying a polysulfated polysaccharides to a progenitor
cell.
[0112] In a further embodiment there is provided the use of a
polysulfated polysaccharide to regulate chondrogenesis in
progenitor cells.
[0113] In a further embodiment there is provided the use of a
polysulfated polysaccharide to down regulate osteogenesis in
progenitor cells.
[0114] In a further embodiment there is provided the use of a
polysulfated polysaccharide to prevent osteogenesis by progenitor
cells. This method or use may find application where production of
bone would be harmful to the host such as at soft tissue sites
which require flexibility and movement for normal function eg.
muscle (heart), stroma, supportive connective tissues etc. or at
sites where bone could impinge or entrap nerve fibres/roots or
blood vessels leading to parathesis, paralysis, ischemia and
potential irreversible tissue injury.
[0115] In a further embodiment there is provided a method of
treating a cell to undergo chondrogenesis comprising contacting a
progenitor cell with an effective amount of a polysulfated
polysaccharide or a biologically active molecular fragment thereof,
for a time and under conditions that stimulate the cell to
differentiate.
[0116] Progenitor Cells
[0117] The term "progenitor cell" is intended to encompass any
multipotent cell. Thus, the term progenitor cell encompasses adult
and embrionic stem cells.
[0118] In one embodiment, the progenitor cell is a mesenchymal
progenitor cell.
[0119] In a further embodiment, the progenitor cell is an
endogenous or exogenous embryonic or adult mesenchymal or
mesenchymal progenitor cell. In a further embodiment, progenitor
cell is a multipotent stromal cell. In a further embodiment, the
cell is an adult undifferentiated mesenchymal cell.
[0120] In a further embodiment, the progenitor cell is a
chondroprogenitor cell.
[0121] In one embodiment, the progenitor cells are derived from
bone marrow. Alternatively, the progenitor cells are derived from
cartilage, synovial tissue, muscle, adipose tissue, skin, umbilical
cord, dental pulp, or other available sources.
[0122] In one embodiment the progenitor cell is a somatic cell,
such as connective tissue cells repressed from differentiation by
endogenous factors.
[0123] In a further embodiment, the progenitor cells are a
population of cells enriched for Stro-1.sup.bri, or homogeonous
Stro-1.sup.bri cells, or Stro-1.sup.bri progeny cells.
[0124] Polysulfated Polysaccharides
[0125] The polysulfated polysaccharide family can be considered to
be any naturally occurring or semi-synthetic/synthetic polysulfated
polysaccharide or a biologically active fragment thereof that
contains two or more sugar rings or carbohydrate structures to
which one or more sulfate ester groups are covalently attached as
exemplified by heparin and pentosan polysulfate.
[0126] According to one embodiment, the polysulfated polysaccharide
or biologically active fragment thereof can be selected from, but
are not limited to, naturally occurring high molecular weight
heparin, low molecular weight heparins, heparan sulfate, pentosan
polysulfate, chondroitin polysulfate, chitosan polysulfate,
dermatan polysulfate sulodexide, dextran polysulfate, polysulfated
insulin, sulfated lactobionic acid amide, sulfated bis-aldonic acid
amide, sucrose octasulfate, fucoidan-1, fucoidan-2, sulfated
beta-cyclodextrin, sulfated gamma-cyclodextrin and small sulfated
compounds including, but are not limited to, inositol
hexasulfate.
[0127] In a further embodiment, the polysulfated polysaccharides
include: pentosan polysulfate chondroitin polysulfate, chitosan
polysulfate, dextran polysulfate and heparin (high and low
molecular weight).
[0128] In a yet further embodiment, the polysulfated
polysaccharides are pentosan polysulfate, dextran polysulfate and
heparin.
[0129] In a yet further embodiment, the polysulfated
polysaccharides are pentosan polysulfate, the sodium salt of
pentosan polysulfate (NaPPS), the magnesium salt of pentosan
polysulfate (MgPPS), and/or the calcium salt of pentosan
polysulfate (CaPPS).
[0130] One particular polysulfated polysaccharide is pentosan
polysulfate (PPS) or its sodium salt. Pentosan polysulfate has been
shown to improve the viability of progenitor cells, enhance the
cryopreservation of progenitor cells, regulate the proliferation of
progenitor cells and/or regulate the differentiation of progenitor
cells. Pentosan polysulfate has been shown to upregulate
differentiation and in particular induce chondrogenesis.
[0131] An alternative polysulfated polysaccharide is dextran
polysulfate. Dextran polysulfate has been shown to downregulate or
repress differentiation and in particular downregulate or repress
chondrogenesis.
[0132] Uses
[0133] The progenitor cells of the present invention can
differentiate into a number of cell types including chondrocytes,
fibrochondrocytes, osteoblasts and adipocytes.
[0134] Since progenitor cells can differentiate into chondrocytes
or fibrochondrocytes, these cells are useful in the production of
extracellular matrix. Extracellular matrix may be suitable for
transplantation into a connective tissue defect in a subject in
need of such a treatment.
[0135] The present invention can be used to induce cartilage
repair, restoration or matrix neogenesis and attenuate its
catabolism by administering a polysulfated polysaccharide or a
biologically active molecular fragment thereof in combination with
progenitor cells.
[0136] In a further embodiment, the compositions of the present
invention can also be used as an immunosuppressant, anticatabolic
or anti-inflammatory agent. As an example, the composition of the
present invention may be used in the treatment of rheumatoid
arthritis.
[0137] The methods discussed herein can be used in vivo or in
vitro. In vivo, the inserted progenitor cells may, among other
things, rebuild cartilage in-situ. In addition, the resident
progenitor cells in the joints may also be stimulated to rebuild
cartilage in-situ thus forming an effective directed treatment.
[0138] In vitro, the present invention allows for the production of
cartilage within a biomatrix that can subsequently be implanted
into a patient. This could be used to generate cartilage to
partially or totally replace articulating joint surfaces, for the
replacement of cartilaginous/fibrocartilagenous tissues or any
other tissues that might benefit from this process which have been
injured or arise from genetic abnormalities that require surgical
correction.
[0139] The present invention also finds use with patients that may
not benefit from the medical or surgical treatments currently
available. For example, many sportspersons or individuals who have
suffered from acute injury caused by trauma may have
cartilage/fibrocartilagenous defects which are symptomatic. The
present invention provides a method that could be used to stimulate
growth of new cartilage to replace the defective tissue. This can
either be done in vivo by stimulating progenitor cell growth in the
joint in-situ or in vitro via a suitable bioscaffold which is
shaped so as to fit into the defect and subsequently inserted into
the defect; or by both in vivo and in vitro methods. Alternatively
it could be used with older patients with established joint
degeneration such as in osteoarthritis of the peripheral joints and
spine where the present invention could be used to stimulate growth
of new cartilage to replace the defective tissue and prevent
progression of osteophytes and reduce the inflammation which is
often the cause of symptoms of these disorders.
[0140] In one embodiment, the present invention has identified
compound(s) that can act as both a cryopreservation agent and as an
agent which can regulate differentiation. In a further embodiment,
the present invention has identified compound(s) that can act as
both a cryopreservation agent and as an agent which can regulate
proliferation. In a further embodiment, the present invention has
identified compound(s) that which can regulate proliferation and
regulate differentiation. In a further embodiment, the present
invention has identified compound(s) that can act as a
cryopreservation agent, as an agent which can regulate
proliferation and as an agent which can regulate proliferation.
Such multi-use compounds have not been previously found in relation
to progenitor cells.
[0141] The present invention has identified families of molecules
or their biologically active fragments that can independently or in
combination with each other enhance the cryopreservation of
progenitor cells, regulate their cell proliferation and or regulate
their differentiation; thus, these molecules can be used in
combination with progenitor cells in therapeutic treatment.
[0142] In particular, the present invention allows the progenitor
cells to differentiate into chondrocytes/fibroblasts thereby
allowing for the formation of cartilage or fibrocartilage.
Therefore, the use of progenitor cells and polysulfated
polysaccharide can be used to treat degenerative diseases, to treat
cartilage/fibrocartilage defect and/or to preventing or minimising
the progression of degenerative diseases and cartilage defects.
[0143] The present invention has identified a novel composition.
This composition has therapeutic use and can be advantageously used
either in vivo or in vitro. In one embodiment, the method is
carried out in vivo. Alternatively, the method is carried out in
vitro.
[0144] Therefore, in one embodiment of the present invention there
is provided a composition as described herein for use as a
medicament.
[0145] In a further embodiment of the present invention there is
provided a composition as described herein for use in the treatment
of any disease that is affected by a breakdown or reduction of
cartilage, including diseases of the musculoskeletal system
including rheumatoid arthritis (RA), osteoarthritis (OA), and
intervertebral disc degeneration (DD), degenerative diseases, and
method of inducing cartilage repair, restoration or matrix
neogenesis.
[0146] In a further embodiment of the present invention there is
provided a composition as described herein for use in the treatment
of any disease that is affected by a breakdown or reduction of
cartilage, including diseases of the musculoskeletal system
including rheumatoid arthritis (RA), osteoarthritis (OA), and
intervertebral disc degeneration (DD), degenerative diseases, and
method of inducing cartilage repair, restoration or matrix
neogenesis.
[0147] In a further embodiment of the present invention there is
provided a composition as described herein for use in the treatment
of any disease where the differentiation of progenitor cells via
osteogenesis is unwanted. For example, bone formation is often
unwanted for soft tissue repair such as intra-discal injection.
Leakage of the cells from a disc into the spinal canal or onto the
adjacent organs (eg oesophagus) can be disastrous. One example of
this was seen when BMP-2 was placed in the disc space to promote
spinal fusion (new bone). It was found that the use of recombinant
bone morphogenetic proteins resulted in life threatening
complications, due to ectopic bone formation adjacent to the disc
space which caused airway and neurological compression.
[0148] In a further embodiment of the present invention there is
provided a composition as described herein for use in the treatment
of a disease that is affected by a breakdown or reduction of
adipose tissue.
[0149] In a further embodiment of the present invention there is
provided the use of a composition as described herein for the
manufacture of a medicament for the treatment of any disease that
is affected by a breakdown or reduction of cartilage, including
diseases of the musculoskeletal system including rheumatoid
arthritis (RA), osteoarthritis (OA), and intervertebral disc
degeneration (DD), degenerative diseases, and method of inducing
cartilage repair, restoration or matrix neogenesis.
[0150] Therefore, according to one embodiment of the present
invention there is provided a method of treating, mitigating,
reducing or preventing any disease that is affected by a breakdown
or reduction of cartilage such as diseases of the musculoskeletal
system including rheumatoid arthritis (RA), osteoarthritis (OA),
and intervertebral disc degeneration (DD), degenerative diseases,
and method of inducing cartilage repair, restoration or matrix
neogenesis, comprising administering a therapeutically effective
amount of a composition as defined herein.
[0151] Examples of such an application would be to inject the
composition of the present invention into joints of individuals
with cartilage or disc lesions or systemically for other less
accessible sites, allowing the preparation to perfuse the tissue
and cells thereby exerting its unique biological effects.
Applications could include treating individuals who may not have
clinical defined disease (often OA or related disorders) but have
sustained a traumatic injury to joint tissues through, for example,
sport or work-related activity.
[0152] The methods and uses of the present invention could also
serve as a prophylactic method following arthroscopic or open
surgery where cartilage or meniscal excision/debridement was
necessary. It is well established that with time such post surgical
patients will generally progress to exhibit symptomatic OA
requiring medical treatment. It is not unlikely that by diminishing
cartilage degradation symptoms may also improved because of the
reduction in production of antigens which promote inflammation.
[0153] Thus, use of the compositions of the present invention
discussed herein to regulate differentiation and/or cell
proliferation of progenitor cells introduced into the patient can
be used to treat, mitigate, reduce or prevent any disease that is
affected by a breakdown or reduction of cartilage. Specific
diseases include diseases of the musculoskeletal system including
rheumatoid arthritis (RA), osteoarthritis (OA), and intervertebral
disc degeneration (DD), degenerative diseases, and method of
inducing cartilage repair, restoration or matrix neogenesis.
[0154] In one embodiment the composition is administered
intravenously. According to a yet further embodiment, the
composition is administered systemically. According to a yet
further embodiment, the composition is administered
intra-articularly. According to a yet further embodiment, the
composition is administered intra-discally. According to a yet
further embodiment, the composition is administered
systemically.
[0155] In one embodiment is the method of injecting a polysulfated
polysaccharide, in combination with progenitor cells, into the
joint(s) of the patient. The polysulfated polysaccharide helps
regulate differentiation and/or proliferation of the progenitor
cells.
[0156] It has additionally been found that polysulfated
polysaccharides of the present invention can also produce,
upregulate or stimulate the production of hyaluronan or hyaluronic
acid (HA) in the differentiated cells. The hyaluronic acid (HA) can
be produced in an animal or cell, namely an animal in vivo or in a
cell in vitro.
[0157] This unexpected finding means that the compositions of the
present invention can be used to replace HA lost in joints,
particularly synovial fluid, ether due to normal wear and tear,
degenerative diseases or other acute traumas. As synovial fluid
degenerates, its ability to protect and lubricate joints is
reduced. This degrades the joint further and can also stimulate the
production of autoantigens which causes yet further damage. In the
past, one way of overcoming or at least mitigating this problem has
been to replace the synovial fluid.
[0158] However, the present invention provides a means of
stimulating the production of hyaluronan or hyaluronic acid (HA)
without the need to replace the synovial fluid itself. The
compositions of the present invention can be contacted with
progenitor cells, which then differentiate into mesenchymal cells
(e.g. chondrocytes or fibroblasts) to increase the production of
HA. The HA is formed in situ and can be used to replace HA lost in
synovial fluid which treats, reduces or at least mitigates the
damage caused by the degenerative diseases or tissue
degradation.
[0159] Thus, according to a further embodiment, the present
invention relates to a method of producing, upregulating or
stimulating the production of hyaluronan (HA), comprising
administering a composition as defined herein.
[0160] In one embodiment of the present invention, the compositions
methods and uses can be used to treat arthritis or other
degenerative diseases. However, in an alternative embodiment, the
present invention excludes methods to treat arthritis or other
degenerative diseases. Specifically, in one aspect, the present
invention includes the use of a polysulfated polysaccharide or
biologically active molecular fragment thereof in combination with
progenitor cells to treat arthritis or other degenerative
diseases.
[0161] Thus, in one embodiment of the present invention, there is
provided a method of treating a patient suffering from diseases of
the musculoskeletal system including rheumatoid arthritis (RA),
osteoarthritis (OA), and intervertebral disc degeneration (DD);
degenerative diseases, osteoarthritis of synovial joints,
ophthalmology, prevention of post-surgical abdominal adherences,
skin treatment and repair and restoration of the function of the
extracellular matrix; or for inducing cartilage repair, restoration
or matrix neogenesis; comprising administering a composition as
defined herein, to regulate differentiation and/or proliferation of
the progenitor cells.
[0162] The patient or subject can be a human or animal patient. In
one embodiment, the patient is a mammal including a human, horse,
dog, cat, sheep, cow, or primate. In one embodiment the patient is
a human. The patient may suffer from a degenerative disease and/or
a cartilage defect. The patient may be an athlete or may have been
subjected to a trauma causing joint damage.
[0163] The present invention encompasses methods of treatment
involving polysulfated polysaccharides and progenitor cells. The
present invention also encompasses the polysulfated polysaccharides
and progenitor cells for use as a medicament; the use of the
polysulfated polysaccharides and progenitor cells in the
manufacture of a medicament for the treatments as discussed herein;
and also compositions and formulations containing the polysulfated
polysaccharides and progenitor cells.
[0164] Combination Therapies
[0165] The present invention has also identified for the first time
polypeptides or a biologically active fragment thereof which can
also regulate differentiation and cell proliferation, particularly
regulate chondrogenesis and cell proliferation. The polypeptide is
a non-collagenous NC4 domain of alpha IX collagen or a biologically
active molecular fragment thereof (hereinafter NC4). The term "a
biologically active fragment" is synonomous with the term "a
biologically active molecular fragment".
[0166] Surprisingly, this invention has discovered that while the
two separate families can exert their regulation of chondrogenesis
and cell proliferation independently when combined together they
can act synergistically, not only to increase their individual
effects but to afford greater specificity of action.
[0167] These unexpected findings opens up the possibility of using
a polysulfated polysaccharide in combination with NC4, in a number
of new applications since by regulating chondrogenesis, it is
possible, among other things, to rebuild cartilage and
intervertebral discs, prevent the degradation of joints and enhance
the repair of avascular connective tissues. Prior to the present
invention, it was not known that a combination of a polysulfated
polysaccharides and NC4 could regulate chondrogenesis and cell
proliferation, and it was certainly not known that the combination
would have a synergistic effect.
[0168] Accordingly, in a further embodiment, the present invention
provides a composition comprising progenitor cells together with a
polysulfated polysaccharide or biologically active molecular
fragment thereof and NC4 or a biologically active molecular
fragment thereof.
[0169] In a further embodiment, the composition further comprises a
carrier medium, culture medium, cryopreservation medium and/or
pharmaceutically acceptable carrier.
[0170] Thus, in a further embodiment, the present invention
provides a composition comprising progenitor cells, a polysulfated
polysaccharide or biologically active molecular fragment thereof
and NC4 or a biologically active molecular fragment thereof,
together with a carrier medium.
[0171] The carrier medium may be a culture medium, cryopreservation
medium or pharmaceutically acceptable carrier.
[0172] Any reference to the compositions of the present invention
which relate to progenitor cells and polysulfated polysaccharides
also relate to composition containing progenitor cells,
polysulfated polysaccharides and NC4, including the concentrations,
cell numbers and/or types and amounts of optional further
ingredients. In addition, the methods and uses of the compositions
as defined herein also relate to the composition including both a
polysulfated polysaccharide and NC4.
[0173] Thus, according to a further embodiment of the present
invention, there is provided a method of regulating chondrogenesis
and/or cell proliferation comprising administering a composition
comprising progenitor cells, a polysulfated polysaccharide or
biologically active molecular fragment thereof and NC4 or a
biologically active molecular fragment thereof.
[0174] Thus, in another embodiment, the present invention provides
a method of regulating the proliferation of progenitor cells,
comprising exposing a polysulfated polysaccharide or biologically
active molecular fragment thereof and NC4 or a biologically active
molecular fragment thereof to a progenitor cell.
[0175] Thus, in another embodiment, the present invention provides
a method of regulating differentiation of progenitor cells by
exposing a polysulfated polysaccharide or biologically active
molecular fragment thereof and NC4 or a biologically active
molecular fragment thereof to the progenitor cells.
[0176] In one embodiment, the biologically active molecular
fragment of NC4 has at least 65% amino acid identity to a fragment
of SEQ ID NO:1.
[0177] In a further embodiment, the biologically active molecular
fragment of NC4 has at least 65% amino acid identity to a fragment
of SEQ ID NO:2.
[0178] In a yet further embodiment, the biologically active
molecular fragment of NC4 has at least 65% amino acid identity to a
fragment of SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ
ID NO:7, SEQ ID NO 8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ
ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16,
SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID
NO:21, SEQ ID NO:22, SEQ ID NO:23, or SEQ ID NO:24.
[0179] In a further embodiment, biologically active molecular
fragment of NC4 has at least 65%, 70%, 75%, 80%, 85%, 90%, 95%,
98%, 99%, 100% amino acid identity to the frangments listed
above.
[0180] It is also possible to administer or use the compositions of
the present invention as part of a combination therapy. For example
the polysaccharide(s) of the present invention may be administered
in combination with one or more other compounds. These compounds
may be a structure modifying osteoarthritis drug (SMOADs).
[0181] The present invention extends to combination therapies for
use in the treatment of the diseases discussed herein.
Particularly, in one example, the present invention extends to the
use of a polysulfated polysaccharide in combination with a further
agent for use in the treatment of various degenerative conditions.
It should be understood that these agents can be administered at
the same time or a different time. Thus the combination therapy may
comprise the active agents being administered at the same time
either in a single formulation or in multiple formulations
administered at the same or different times. Equally, the
combination therapy may comprise the active agents being
administered in different formulations at different times. The
formulations could be administered sequentially and may be
separated by a period of time including hours, days, weeks and
months.
[0182] The present invention also extends to the use of the
polysulfated polysaccharides as discussed herein in combination
with one or more growth factors. The present invention further
extends to the methods, uses, formulations and/or compositions as
disclosed herein in combination with one or more growth factors.
Possible growth factors include insulin like growth factor,
insulin, fibroblast like growth factors; BMP-TGF-beta super family
(eg, BMP-2, BMP-7, BMP-8, TGF beta) and fibroblast growth factor
family, IGF, FGF, EGF, PDGF and VEGF.
BRIEF DESCRIPTION OF THE FIGURES
[0183] FIG. 1. The Effects of Pentosan Polysulfate (PPS) on Normal
Human MSCs Freeze/Thaw Viabilities. MSCs were rapidly thawed in a
37.degree. C. water bath and washed twice with HHF (HBSS containing
5% (v/v) Foetal Calf Serum). The cells were subsequently seeded
into multiple T-75 flasks at 8,000 cells/cm.sup.2. The cells were
grown until 70-80% confluent, trypsinised and cryopreserved at cell
concentrations of 50.times.10.sup.6/ml in Profreeze.RTM./7.5% DMSO
supplemented with PPS at the indicated concentrations. Ampoules
were retrieved from liquid nitrogen storage and rapidly thawed,
gently mixed and 10 ul samples removed at time=0, 30, 60, 90 and
120 minutes. To each cell sample, 290 ul of trypan blue was added
and cell counts/viability testing performed. PPS did not adversely
affect cell viability.
[0184] FIG. 2. Bar graph showing the viability of different numbers
of murine ATDC5 progenitor cells suspended in cryogenic media
containing 7.5% DMSO and various concentrations of Pentosan
Polysulfate (PPS) after being subjected to freeze-thawing cycle.
Cell viability was determined using the mitochondrial dehydrogenase
MTT assay.
[0185] FIG. 3. Effects of different concentrations of Pentosan
Polysulfate (PPS) on progenitor cell viability following
cryopreservation in liquid nitrogen and rapidly thawing as
described in FIG. 1. Cell viability was determined using the
mitochondrial dehydrogenase MTT assay. Data shown=Means.+-.SD
*=p<0.05 relative to control values
[0186] FIG. 4. The Effects of Pentosan Polysulfate (PPS) on Human
Progenitor cell Proliferation. Primary human progenitor cells were
cultured in 24 well plates in growth media supplemented with PPS at
the indicated concentrations. At various time intervals (day
1,3,6), the growth media was removed and replaced with phenol red
free media containing the tetrazolium salt WST-1 for 2 hours at
37.degree. C/5% CO2. WST-1 is cleaved by mitochondrial
dehydrogenase in viable cells to produce a formazan dye that can be
detected using an ELISA plate reader at a wavelength of 450 nm.
Absorbance at 450 nm for each time point is shown for all
concentrations of PPS. A statistically significant increase in
proliferation was observed on day 6 at concentrations of PPS in
excess of 1 .mu.g/ml (*p<0.01, ANOVA).
[0187] FIG. 5. A bar graph of the concentration dependent effects
of Pentosan Polysulfate (PPS) on DNA synthesis by human progenitor
cells, as determined by the incorporation of .sup.3H-Thymidine into
macromolecular DNA, after 4 day micromass cultures. *=p<0.05;
**=p<0.005 relative to controls.
[0188] FIG. 6. The Effects of Pentosan Polysulfate (PPS) on Human
progenitor cells treated with apoptotic agents. Human progenitor
cells were plated in serum-free media supplemented with PPS at the
indicated concentrations. Progenitor cell apoptosis was induced by
the addition of a combination of 30 ng/ml IL-4 plus 30,000 U/ml
IFN-gamma. Following 5 days culture, cells were harvested by
trypsinisation and viabilities assessed by Annexin V staining. A
two-fold reduction in IFN-gamma/IL-4-induced apoptosis (Annexin V
positive cells) is observed when progenitor cells are cultured at
concentrations of PPS in excess 1 ug/ml.
[0189] FIG. 7. The Effects of Pentosan Polysulfate (PPS) on Human
progenitor cell Differentiation: Mineralisation Assay. Primary
human progenitor cells were cultured in 96 wells plates in
non-osteoinductive growth media (media control) or in
osteoinductive conditions (alphaMEM supplemented with 10% FCS, 100
microM L-ascorbate-2-phosphate, dexamethasone 10.sup.-7 M and 3 mM
inorganic phosphate) in the presence of PPS at the indicated
concentrations. On day 28, the concentration of acid solubilisd
calcium per well was determined using the Cresolphthalein
Complexone method. (A) The concentration of acid solubilised
calcium per microg of DNA/well was determined following the
assessment of the total amount of DNA per well using a fluorogenic
DNA stain (Hoeshst 33258). A statistically significant decrease in
mineralised matrix formation was observed when concentrations of
PPS of 1 ug/ml and 100 ug/ml were used (*p<0.01, ANOVA). (B)
Phase-contrast photomicrographs of mineralised cultures at
.times.20 magnification.
[0190] FIG. 8. The Effects of Pentosan Polysulfate (PPS) on Human
progenitor cell Differentiation: Adipocyte Formation. Primary
progenitor cells were cultured in 96 well plates in non-adipogenic
growth media (media control) or under adipogenic conditions (0.5 mM
methylisobutylmethylxanthine, 0.5 .mu.M hydrocortisone, and 60
.mu.M indomethacin) in the presence of PPS at the indicated
concentrations. On day 28, the presence of lipid laden adipocytes
was determined using the lipophilic dye Oil Red O. The relative
amount of solubilised lipid per .mu.g of DNA/well was determined
following the assessment of the total amount of DNA per well using
a fluorogenic DNA stain (Hoeshst 33258). (A) A statistically
significant increase in adipocyte number was observed at
concentrations of PPS in excess lug/ml (*p<0.01, ANOVA). (A)
Phase-contrast photomicrographs of Oil Red O labeled adipocytes at
.times.20 magnification.
[0191] FIG. 9. Concentration dependent effects of Pentosan
Polysulfate (PPS) on Murine Progenitor Cell (progenitor cells
C3H10T1/2) biosynthesis of Proteoglycans (PGs) and DNA content when
grown in monolayer cultures. Data shown=Means.+-.SD.
[0192] FIG. 10. A bar graph of the concentration dependent effects
of Pentosan Polysulfate (PPS) on DNA synthesis by murine Progenitor
Cells (C3H10T1/2 cells) grown in monolayer cultures for 2 days as
determined by the incorporation of .sup.3H-Thymidine into
macromolecular DNA.
[0193] FIG. 11. A bar graph of the concentration dependent effects
of Pentosan Polysulfate (PPS), on the biosynthesis of Proteoglycans
(PGs) as determined by the incorporation of radioactively labelled
sulfate into the sulfated glycosaminoglycans (.sup.35S-GAG) of PGs
after 2 day monolayer cultures of human progenitor cells. The data
was expressed as .sup.35S-GAG radioactivity as decays per minute
(DPM) normalised to DNA content. *=p<0.05; **=p<0.005;
***=p<0.0005.
[0194] FIG. 12. A bar graph of the concentration dependent effects
of Pentosan Polysulfate (PPS), on the biosynthesis of Proteoglycans
(PGs) as determined by the incorporation of radioactively labelled
sulfate into the sulfated glycosaminoglycans (.sup.35S-GAG) of PGs
in 6 day pellet cultures of murine progenitor cells (ADTC-5).
*=p<0.05 relative to control.
[0195] FIG. 13. Gene Expression by ATDC5 cells of Type II collagen
and Sox-9 in 6-day pellet culture incubated with various
concentrations of PPS in Maintenance Medium (MM).
[0196] FIG. 14. A bar graph of the concentration dependent effects
of Heparin on the biosynthesis of Proteoglycans (PGs as determined
by the incorporation of radioactively labelled sulfate into the
sulfated glycosaminoglycans (.sup.35S-GAG) of PGs in 6 day pellet
cultures of murine progenitor cells (ADTC-5). Heparin does not
exhibit a chondrogenic effect over the concentration range 1.25-20
ug/mL in this cell line.
[0197] FIG. 15. Bar graphs showing the concentration dependent
effects of Pentosan Polysulfate (PPS), on the biosynthesis of
Proteoglycans (PGs) as determined by the incorporation of
radioactively labelled sulfate into the sulfated glycosaminoglycans
(.sup.35S-GAG) of PGs in 7 day pellet cultures of a murine
progenitor cells (C3H10T1-2).
[0198] FIG. 16. A bar graph showing the concentration dependent
effects of PPS on proteoglycan synthesis by murine progenitor cells
(C3H10T1-2) in micromass cultures for 6 days and 9 days. PPS was
included in the media (Ham's F12+10% FCS) and was changed every 48
hours. .sup.35S--SO.sub.4 was added 24 hours before culture
termination. Synthesis normalized to DNA content. *P<0.05,
**P<0.005, ***P<0.0005 relative to controls.
[0199] FIG. 17. Bar graphs showing the concentration dependent
effects of PPS on proteoglycan synthesis by human progenitor cells
in micromass cultures for 5 days. Data is presented as 35S-GAG
radioactivity and as a percentage of control taken as 100% .
*P<0.05 relative to control.
[0200] FIG. 18. A: Bar graph showing the Pentosan Polysulfate (PPS)
concentration dependent stimulation of type II collagen production
by human progenitor cells in micromass cultures for 10 days as
determined by scanning and digital analysis of the immuno stained
micromass cultures shown in B. (see text for details).
[0201] FIG. 19. Bar graphs showing the concentration dependent
effects of (A) Hyaluronan (Supartz.TM.) and (B) Dextran Polysulfate
on proteoglycan synthesis by human progenitor cells in micromass
cultures for 5 days. Data is presented as .sup.35S-GAG
radioactivity and as a percentage of control, taken as 100% or as
DPM/ug DNA. *P<0.05 relative to control.
[0202] FIG. 20. Shows the results of culturing primary human
progenitor cell growth media supplemented with PPS and/or
Hyaluronic acid (Supartz.TM.), at the indicated concentrations. At
various time intervals (day 3 & 5), the growth media was
removed and replaced with phenol red free media containing the
tetrazolium salt WST-1 for 2 hours at 37.degree. C./5% CO.sub.2.
Absorbance at 450 nm for each time point is shown for all
concentrations of PPS and HA. This experiment shows that HA and PPS
do not act synergistically to stimulate progenitor
proliferation.
[0203] FIG. 21. A bar graph of the concentration dependent effects
of rhNC4 (batch PBA-1202P) expressed by K. lactis, in the absence
(maintenance media, MM) and presence of insulin (10 micrograms/mL)
(differentiation media, DM), on the biosynthesis of Proteoglycans
(PGs) as determined by the incorporation of radioactively labelled
sulfate into the sulfated glycosaminoglycans (.sup.35S-GAG) of PGs
after 3 day culture with Murine ATDC5 progenitor cells. The data
was expressed as % change relative to control cultures that
contained no rhNC4. P<0.05 was statistically significant
relative to control cultures.
[0204] FIG. 22. A bar graph of the concentration dependent effects
of rhNC4 (batch PBA-1202P) expressed by K. lactis, in the absence
(maintenance media, MM) and presence of insulin (10 micrograms/mL)
(differentiation media, DM), on the biosynthesis of Proteoglycans
PGs) in pellet cultures of ATDC5 cells. Data is shown as the %
change relative to controls taken to be 100%.
[0205] FIG. 23. A bar graph of the concentration dependent effects
of rhNC4 (batch PBA-1202P) expressed by K. lactis plus Pentosan
Polysulfate (PPS) (2 micrograms/mL), in the absence (maintenance
media, MM) and presence of insulin (10 micrograms/mL)
(differentiation media, DM), on the biosynthesis of macromolecular
DNA as determined by the incorporation of radioactively labelled
.sup.3H-Thymidine after 1 day culture with Murine ATDC5 progenitor
cells. The data was expressed as % change relative to control
cultures that contained no rhNC4. P <0.05 was statistically
significant relative to control cultures.
[0206] FIG. 24. A bar graph of the concentration dependent effects
of combinations of rhNC4 (batch PBA-1202P) and Pentosan Polysulfate
(PPS) on the biosynthesis of .sup.35S-PGs by monolayer cultures of
Murine ATDC5 progenitor cells. Data is expressed relative to
control (maintenance media, MM) which was taken as 100%.
[0207] FIG. 25. RT-PCR detection of gene expression of the bone
marker Runx2, MGP, HAS3, CD44 and the housekeeping gene NADPH
expressed by Murine ATDC5 progenitor cells cultured in the presence
and absence of rhNC4 (Batch PBA-1209P) and PPS for 2 days in
monolayer cultures.
[0208] FIG. 26. RT-PCR detection of gene expression of Runx2 and
the transduction proteins, Smad 2 and Smad 4 and the housekeeping
gene NADPH expressed by Murine ATDC5 progenitor cells cultured in
the presence and absence of rhNC4 (Batch PBA-1209P) and PPS for 2
days in monolayer cultures.
[0209] FIG. 27. Chromatographic elution profiles showing the
effects of polysulfated 5 polysaccharides on the biosynthesis of
Hyaluronan (HA) and by progenitor cells by measuring the
incorporation of .sup.3H-glucosamine into HA. Superdex-S200
chromatographic profiles of media from human progenitor cells
cultured in micromass in the presence of various concentrations of
Pentosan Polysulfate (PPS) for 9 days are displayed in panels A-D.
Before Hyalase digestion the profiles of radioactivity show the
incorporation of .sup.3H-Glucosamine into both HA and PGs by the
cells but after digestion only the .sup.3H-PGs remain in the void
volume of the column. The % difference in areas under the profiles
of the digested and pre-digested samples in the void volume
fractions represents the amounts of .sup.3H-HA released into the
media by the PPS concentration specified.
[0210] FIG. 28. A bar graph of the concentration dependent effects
of rhNC4 (Batch PBA-1202P) expressed by K. lactis yeast cells in
the absence and presence of insulin (10 micrograms/mL) on DNA
synthesis as determined by the incorporation of .sup.3H-Thymidine
into macromolecular DNA, after 3 day culture with Murine ATDC5
progenitor cells. The data is expressed as % change relative to
control cultures that contained no rhNC4. P<0.01 was
statistically significant relative to control cultures.
[0211] FIG. 29 A bar graph of the concentration dependent effects
of rhNC4 (Batch PBA-1202P) expressed by K. lactis yeast cells on
Murine ATDC5 progenitor cell numbers, determined using a
hemocytometer, after 3 day culture in the absence and presence of
insulin (10 micrograms/mL). The data is expressed as % change
relative to control cultures that contained no rhNC4. P<0.01 was
statistically significant relative to control cultures.
[0212] FIG. 30. A bar graph of the kinetics of ATDC5 cell growth
induced by rhNC4 (batch PBA-1200P) (5 ug/ml) or Insulin (10 ug/ml)
relative to control over 13 days. 20,000 cells per well were seeded
at Day 0 (Start) with medium changes every 48 hrs. Insulin treated
cultures reached confluence on day 6 and PBA-1200P on day 9.
Control cultures also reached confluence on day 9 but in contrast
to cultures containing insulin or PBA-1200P ceased to undergo
replication.
[0213] FIG. 31. A bar graph of the concentration dependent effects
of rhNC4 (batch PBA-1202P) expressed by K. lactis, in the absence
(maintenance media, MM) and presence of insulin (10 micrograms/mL)
(differentiation media, DM), on the biosynthesis of Proteoglycans
(PGs) as determined by the incorporation of radioactively labelled
sulfate into the sulfated glycosaminoglycans (.sup.35S-GAG) of PGs
after 3 day culture with
[0214] Murine ATDC5 progenitor cells. The data was expressed as %
change relative to control cultures that contained no rhNC4.
P<0.05 was statistically significant relative to control
cultures. FIG. 31 shows that rhNC4 stimulated PG synthesis by the
progenitor ATDC5 cells in the presence and absence of insulin, but
more effectively at the higher concentrations in the absence of
insulin.
[0215] FIG. 32. A bar graph of the concentration dependent effects
of Pentosan Polysulfate (PPS), in the presence of insulin (10
micrograms/mL), on the biosynthesis of Proteoglycans PGs) as
determined by the incorporation of radioactively labelled sulfate
into the sulfated glycosaminoglycans (.sup.35S-GAG) of PGs after 3
day culture with Murine ATDC5 progenitor cells. The data was
expressed as .sup.35S-GAG radioactivity as counts per minute (CPM)
and decays per minute (DPM) relative to control cultures that
contained no PPS. P<0.05 was statistically significant relative
to control cultures. FIG. 32 shows the concentration dependent
stimulation of PG synthesis by Murine ATDC5 progenitor cells in the
presence of PPS.
[0216] FIG. 33. A bar graph of the concentration dependent effects
of rhNC4 (batch PBA-1202P) expressed by K. lactis plus sodium
pentosan polysulfate (PPS) (2 micrograms/mL), in the absence
(maintenance media, MM) and presence of insulin (10 micrograms/mL)
(differentiation media, DM), on the biosynthesis of
Proteoglycans
[0217] (PGs) as determined by the incorporation of radioactively
labelled glucosamine into the glycosaminoglycans (.sup.3H-GAG) of
PGs after 1 day culture with Murine ATDC5 progenitor cells. The
data was expressed as % change relative to control cultures that
contained no rhNC4. P<0.05 was statistically significant
relative to control cultures.
[0218] FIG. 34. A bar graph of the concentration dependent effects
of Pentosan Polysulfate (PPS) in the presence of insulin (10
micrograms/mL) on DNA synthesis (cell replication), as determined
by the incorporation of .sup.3H-Thymidine into macromolecular DNA
after 3 day culture with Murine ATDC5 progenitor cells. The data is
expressed as 35% change relative to control cultures that contained
no PPS.
[0219] FIG. 35. SEQ ID NO:1--Amino acid sequence for full length
human NC4 without signal peptide.
[0220] FIG. 36. SEQ ID NO:2--Amino acid sequence for truncated hNC4
obtained during 5 expression from K. lactis cultures by action of
putative by proline endopeptidase.
[0221] FIG. 37. A sequence composition between bovine human, murine
and chick NC4 sequences.
DETAILED DESCRIPTION OF THE ILLUSTRATED AND EXEMPLIFIED EMBODIMENTS
OF THE INVENTION
[0222] As used in the specification and claims, the singular form
"a", "an" and "the" include plural references unless the context
clearly dictates otherwise. For example, the term "a polypeptide"
includes a plurality of polypeptides, including mixtures
thereof.
[0223] As used herein the term "derived from" shall be taken to
indicate that a specified integer are obtained from a particular
source albeit not necessarily directly from that source.
[0224] A "composition" is intended to mean a combination of active
agent and another compound or composition, inert (for example, a
detectable agent or label) or active, such as an adjuvant.
[0225] Unless the context requires otherwise or specifically stated
to the contrary, integers, steps, or elements of the invention
recited herein as singular integers, steps or elements clearly
encompass both singular and plural forms of the recited integers,
steps or elements.
[0226] The embodiments of the invention described herein with
respect to any single embodiment shall be taken to apply mutatis
mutandis to any other embodiment of the invention described
herein.
[0227] Throughout this specification, unless the context requires
otherwise, the word. "comprise", or variations such as "comprises"
or "comprising", will be understood to imply the inclusion of a
stated step or element or integer or group of steps or elements or
integers but not the exclusion of any other step or element or
integer or group of elements or integers.
[0228] Those skilled in the art will appreciate that the invention
described herein is susceptible to variations and modifications
other than those specifically described. It is to be understood
that the invention includes all such variations and modifications.
The invention also includes all of the steps, features,
compositions and compounds referred to or indicated in this
specification, individually or collectively, and any and all
combinations or any two or more of said steps or features.
[0229] The present invention is not to be limited in scope by the
specific examples described herein. Functionally equivalent
products, compositions and methods are clearly within the scope of
the invention, as described herein.
[0230] The present invention is performed without undue
experimentation using, unless otherwise indicated, conventional
techniques of molecular biology, microbiology, virology,
recombining DNA technology, peptide synthesis in solution, solid
phase peptide synthesis, and immunology. Such procedures are
described, for example, in the following texts that are
incorporated herein by reference: [0231] 1. Sambrook, Fritsch &
Maniatis, Molecular Cloning: A Laboratory Manual, Cold Spring
Harbor Laboratories, New York, Second Edition (1989), whole of Vols
I, II, and III; [0232] 2. DNA Cloning: A Practical Approach, Vols.
I and II (D. N. Glover, ed., 1985), IRL Press, Oxford, whole of
text; [0233] 3. Oligonucleotide Synthesis: A Practical Approach (M.
J. Gait, ed., 1984) IRL Press, Oxford, whole of text, and
particularly the papers therein by Gait, pp 1-22; Atkinson et al.,
pp 35-81; Sproat et al., pp 83-115; and Wu et al., pp 135151;
[0234] 4. Nucleic Acid Hybridization: A Practical Approach (B. D.
Hames & S. J. Higgins, eds., 1985) IRL Press, Oxford, whole of
text; [0235] 5. Perbal, B., A Practical Guide to Molecular Cloning
(1984); [0236] 6. Wiinsch, E., ed. (1974) Synthese von Peptiden in
Houben-Weyls Metoden der Organischen Chemie (Miiler, E., ed.), vol.
15, 4th edn., Parts 1 and 2, 30 Thieme, Stuttgart. [0237] 7.
Handbook of Experimental Immunology, Vols. I-IV (D. M. Weir and C.
C. Blackwell, eds., 1986, Blackwell Scientific Publications)
[0238] Progenitor Cells
[0239] The present invention relates to progenitor cells. In its
broadest embodiment, the term progenitor cells is intended to
encompass any multipotent cell. Thus, the term progenitor cell
encompasses adult and embrionic stem cell.
[0240] The progenitor cell may be a mesenchymal progenitor
cell.
[0241] The progenitor cell may be an endogenous or exogenous
embryonic or adult mesenchymal or mesenchymal progenitor cell. The
progenitor cell may be a multipotent stromal cell. The progenitor
cell may be an adult undifferentiated mesenchymal cell.
[0242] The progenitor cell may be a chondroprogenitor cell.
[0243] The progenitor cells may be derived from bone marrow.
Alternatively, the progenitor cells may be derived from cartilage,
synovial tissue, muscle, adipose tissue, skin, umbilical cord,
dental pulp, or other available sources.
[0244] The progenitor cells may be a somatic cell, such as
connective tissue cells repressed from differentiation by
endogenous factors.
[0245] In a further embodiment, the progenitor cells are a
population of cells enriched for Stro-1.sup.bri, or homogeonous
Stro-1.sup.bri cells, or Stro-1.sup.bri progeny cells.
[0246] One type of progenitor cell is a mesenchymal progenitor cell
(MPC). Originally derived from bone marrow, MPCs and MPC-like cells
have been identified to exist in and can be isolated from a large
number of adult tissues, where they are postulated to carry out the
function of replacing and regenerating local cells that are lost to
normal tissue turnover, injury, or aging. These tissues include
adipose, periosteum, synovial membrane, synovial fluid (SF),
muscle, dermis, deciduous teeth, pericytes, trabecular bone,
infrapatellar fat pad, and articular cartilage.
[0247] MPCs may be defined retrospectively by a constellation of
characteristics in vitro, including a combination of phenotypic
markers and multipotential differentiation functional
properties.
[0248] Although plastic adherence serves as the most commonly used
and simple isolation procedure for mesenchymal cells, various
positive and negative surface markers (for example, Stro-1,
CD146/melanoma cell adhesion molecule, CD271/low-affinity nerve
growth factor, and stage-specific embryonic antigen-4) have also
been used to enrich MPC yield and homogeneity. In addition, a
further panel of surface markers, including CD140b
(platelet-derived growth factor receptor-D), CD340 (HER-2/erbB2),
and CD349 (frizzled-9) in conjunction with CD217 can also be used
for MPC enrichment.
[0249] Further progenitor cells include murine progenitor cells,
including cell lines C3H10T1/2 and ATDC5 or M111 progenitor cells.
C3H10T1/2 are progenitor stem cell line derived from bone marrow of
female C3H/He mouse strain with fibroblast-like morphology. ATDC5
cells are mouse embryonic derived chondroprogenitor cell line with
epithelial-like morpholology.
[0250] The C3H10T1/2 cell line was established in 1973 from 14- to
17-day-old C3H mouse embryos. These cells display fibroblastic
morphology in cell culture and are functionally similar to
mesenchymal stem cells. Inhibiting methylation in C3H10T1/2 cells
with 5-azacytidine produces stable morphological and biochemical
features of muscle, adipose, bone, or cartilage cells It is
suggested that this phenotypic alteration results from activation
of endogenous genes in response to blocking methylation. In
addition it has been shown that bone morphogenic protein 4 (BMP4),
a member of the transforming growth factor type-beta superfamily,
can induce commitment of C3H10T1/2 cells to preadipocytes that,
when subjected to an adipocyte differentiation protocol, develop
into cells of the adipocyte phenotype (Tang Qi-Qun, Otto T C, Lane
M D. Commitment of C3H10T1/2 pluripotent stem cells to the
adipocyte lineage. Pro Natl Acad Sci USA, 2004; 101:
9607-9611).
[0251] The ATDC5 cell line was originally isolated from a
differentiating culture of AT805 teratocarcinoma. ATDC5 cells
express a fibroblastic cell phenotype in a growing phase. Further
information on the ATDC5 cell line can be found in Atsumi T, Miwa
Y, Kimata K, Ikawa Y. A chondrogenic cell line derived from a
differentiating culture of AT805 teratocarcinoma cells. Cell Differ
Dev. 1990; 30: 109-16.
[0252] The progenitor cells may be a population of cells enriched
for Stro-1.sup.bri. The progenitor cells may be homogeonous
Stro-1.sup.bri cells, or Stro-1.sup.bri progeny cells.
[0253] Stro-1.sup.bri cells are cells found in bone marrow, blood,
dental pulp cells, adipose tissue, skin, spleen, pancreas, brain,
kidney, liver, heart, retina, brain, hair follicles, intestine,
lung, lymph node, thymus, bone, ligament, tendon, skeletal muscle,
dermis, and periosteum; and are typically capable of
differentiating into germ lines such as mesoderm and/or endoderm
and/or ectoderm. Thus, Stro-1.sup.bri cells are capable of
differentiating into a large number of cell types including, but
not limited to, adipose, osseous, cartilaginous, elastic, muscular,
and fibrous connective tissues. The specific lineage-commitment and
differentiation pathway which these cells enter depends upon
various influences from mechanical influences and/or endogenous
bioactive factors, such as growth factors, cytokines, and/or local
microenvironmental conditions established by host tissues.
Stro-1.sup.bri cells may thus be non-hematopoietic progenitor cells
which divide to yield daughter cells that are either stem cells or
are precursor cells which in time will irreversibly differentiate
to yield a phenotypic cell.
[0254] In a further embodiment, the Stro-1.sup.bri cells are
enriched from a sample obtained from a subject, e.g., a subject to
be treated or a related subject or an unrelated subject (whether of
the same species or different). The terms `enriched`, `enrichment`
or variations thereof are used herein to describe a population of
cells in which the proportion of one particular cell type or the
proportion of a number of particular cell types is increased when
compared with the untreated population.
[0255] In a further embodiment, the cells used in the present
invention express one or more markers individually or collectively
selected from the group consisting of TNAP.sup.+, VCAM-1.sup.+,
THY-1.sup.+, STRO-2.sup.+, CD45.sup.+, CD146.sup.+, 3G5.sup.+ or
any combination thereof.
[0256] By "individually" is meant that the invention encompasses
the recited markers or groups of markers separately, and that,
notwithstanding that individual markers or groups of markers may
not be separately listed herein the accompanying claims may define
such marker or groups of markers separately and divisibly from each
other.
[0257] By "collectively" is meant that the invention encompasses
any number or combination of the recited markers or groups of
peptides, and that, notwithstanding that such numbers or
combinations of markers or groups of markers may not be
specifically listed herein the accompanying claims may define such
combinations or sub-combinations separately and divisibly from any
other combination of markers or groups of markers.
[0258] In one embodiment, the Stro-1.sup.bri cells are additionally
one or more of TNAP.sup.+, VCAM-1.sup.+, THY-1.sup.+, STRO-2.sup.+
and/or CD146.sup.+.
[0259] A cell that is referred to as being "positive" for a given
marker it may express either a low (lo or dim) or a high (bright,
bri) level of that marker depending on the degree to which the
marker is present on the cell surface, where the terms relate to
intensity of fluorescence or other marker used in the sorting
process of the cells. The distinction of lo (or dim or dull) and
bri will be understood in the context of the marker used on a
particular cell population being sorted. A cell that is referred to
as being "negative" for a given marker is not necessarily
completely absent from that cell. This terms means that the marker
is expressed at a relatively very low level by that cell, and that
it generates a very low signal when detectably labelled or is
undetectable above background levels.
[0260] The term "bright", when used herein, refers to a marker on a
cell surface that generates a relatively high signal when
detectably labelled. Whilst not wishing to be limited by theory, it
is proposed that "bright" cells express more of the target marker
protein (for example the antigen recognised by STRO-1) than other
cells in the sample. For instance, STRO-1.sup.bri cells produce a
greater fluorescent signal, when labelled with a FITC-conjugated
STRO-1 antibody as determined by fluorescence activated cell
sorting (FACS) analysis, than non-bright cells
(STRO-1.sup.dull/dim). In one embodiment, "bright" cells constitute
at least about 0.1% of the most brightly labelled bone marrow
mononuclear cells contained in the starting sample. In other
embodiments, "bright" cells constitute at least about 0.1%, at
least about 0.5%, at least about 1%, at least about 1.5%, or at
least about 2%, of the most brightly labelled bone marrow
mononuclear cells contained in the starting sample. In a further
embodiment, STRO-1.sup.bright cells have 2 log magnitude higher
expression of STRO-1 surface expression relative to "background",
namely cells that are STRO-Y. By comparison, STRO-1.sup.dim and/or
STRO-1.sup.inertmediate cells have less than 2 log magnitude higher
expression of STRO-1 surface expression, typically about 1 log or
less than "background".
[0261] As used herein the term "TNAP" is intended to encompass all
isoforms of tissue non-specific alkaline phosphatase. For example,
the term encompasses the liver isoform (LAP), the bone isoform
(BAP) and the kidney isoform (KAP). In a further embodiment, the
TNAP is BAP. In a further embodiment, TNAP as used herein refers to
a molecule which can bind the STRO-3 antibody produced by the
hybridoma cell line deposited with ATCC on 19 Dec. 2005 under the
provisions of the Budapest Treaty under deposit accession number
PTA-7282.
[0262] Furthermore, in a further embodiment, the Stro-1.sup.bri
cells are capable of giving rise to clonogenic CFU-F.
[0263] In one embodiment, a significant proportion of the
multipotential cells are capable of differentiation into at least
two different germ lines. Non-limiting examples of the lineages to
which the multipotential cells may be committed include bone
precursor cells; hepatocyte progenitors, which are multipotent for
bile duct epithelial cells and hepatocytes; neural restricted
cells, which can generate glial cell precursors that progress to
oligodendrocytes and astrocytes; neuronal precursors that progress
to neurons; precursors for cardiac muscle and cardiomyocytes,
glucose-responsive insulin secreting pancreatic beta cell lines.
Other lineages include, but are not limited to, odontoblasts,
dentin-producing cells and chondrocytes, and precursor cells of the
following: retinal pigment epithelial cells, fibroblasts, skin
cells such as keratinocytes, dendritic cells, hair follicle cells,
renal duct epithelial cells, smooth and skeletal muscle cells,
testicular progenitors, vascular endothelial cells, tendon,
ligament, cartilage, adipocyte, fibroblast, marrow stroma, cardiac
muscle, smooth muscle, skeletal muscle, pericyte, vascular,
epithelial, glial, neuronal, astrocyte and oligodendrocyte
cells.
[0264] In another embodiment, the Stro-1.sup.bri cells are not
capable of giving rise, upon culturing, to hematopoietic cells.
[0265] In one embodiment, the cells are taken from the subject to
be treated, cultured in vitro using standard techniques and used to
obtain expanded cells for administration to the subject as an
autologous or allogeneic composition. In an alternative embodiment,
cells of one or more of the established human cell lines are used.
In another useful embodiment of the invention, cells of a non-human
animal (or if the patient is not a human, from another species) are
used.
[0266] The present invention also contemplates use of supernatant
or soluble factors obtained or derived from Stro-1.sup.bri cells
and/or progeny cells thereof (the latter also being referred to as
expanded cells) which are produced from in vitro culture in
combination with the progenitor cells. Expanded cells of the
invention may a have a wide variety of phenotypes depending on the
culture conditions (including the number and/or type of stimulatory
factors in the culture medium), the number of passages and the
like. In certain embodiments, the progeny cells are obtained after
about 2, about 3, about 4, about 5, about 6, about 7, about 8,
about 9, or about 10 passages from the parental population.
However, the progeny cells may be obtained after any number of
passages from the parental population.
[0267] The progeny cells may be obtained by culturing in any
suitable medium. The term "medium", as used in reference to a cell
culture, includes the components of the environment surrounding the
cells. Media may be solid, liquid, gaseous or a mixture of phases
and materials. Media include liquid growth media as well as liquid
media that do not sustain cell growth. Media also include
gelatinous media such as agar, agarose, gelatin and collagen
matrices. Exemplary gaseous media include the gaseous phase that
cells growing on a petri dish or other solid or semisolid support
are exposed to. The term "medium" also refers to material that is
intended for use in a cell culture, even if it has not yet been
contacted with cells. In other words, a nutrient rich liquid
prepared for bacterial culture is a medium. A powder mixture that
when mixed with water or other liquid becomes suitable for cell
culture may be termed a "powdered medium".
[0268] In an embodiment, progeny cells useful for the methods of
the invention are obtained by isolating TNAP.sup.+ STRO-1.sup.+
multipotential cells from bone marrow using magnetic beads labelled
with the STRO-3 antibody, and then culture expanding the isolated
cells (see Gronthos et al. Blood 85: 929-940, 1995 for an example
of suitable culturing conditions).
[0269] In one embodiment, such expanded cells (progeny) (optionally
at least after 5 passages) can be TNAP.sup.-, CC9.sup.+, HLA class
1.sup.+, HLA class II.sup.-, CD14.sup.-, CD19.sup.-, CD3.sup.-,
CD11a.sup.-c.sup.-, CD31.sup.-, CD86.sup.-, CD34.sup.- and/or
CD80.sup.-. However, it is possible that under different culturing
conditions to those described herein that the expression of
different markers may vary. Also, whilst cells of these phenotypes
may predominate in the expended cell population it does not mean
that there is a minor proportion of the cells do not have this
phenotype(s) (for example, a small percentage of the expanded cells
may be CC9.sup.-). In one embodiment, expanded cells still have the
capacity to differentiate into different cell types.
[0270] In one embodiment, an expended cell population used to
obtain supernatant or soluble factors, or cells per se, comprises
cells wherein at least 25%, in a further embodiment at least 50%,
of the cells are CC9+.
[0271] In another embodiment, an expanded cell population used to
obtain supernatant or soluble factors, or cells per se, comprises
cells wherein at least 40%, in a further embodiment at least 45%,
of the cells are STRO-1.sup.+.
[0272] In a further embodiment, the expanded cells may express one
or more markers collectively or individually selected from the
group consisting of LFA-3, THY-1, VCAM-1, ICAM-1, PECAM-1,
P-selectin, L-selectin, 3G5, CD49a/CD49b/CD29, CD49c/CD29,
CD49d/CD29, CD 90, CD29, CD18, CD61, integrin beta 6-19,
thrombomodulin, CD10, CD13, SCF, PDGF-R, EGF-R, IGF1-R, NGF-R,
FGF-R, Leptin-R (STRO-2=Leptin-R), RANKL, STRO-1.sup.bright and
CD146 or any combination of these markers.
[0273] In one embodiment, progeny cells derived from STRO-1.sup.bri
cells are positive for the marker Stro-1.sup.dim. These cells are
referred to as Tissue Specific Committed Cells (TSCCs) and are more
committed to differentiation than STRO-1.sup.bri cells are
therefore less able to respond inductive factors. Non-limiting
examples of the lineages to which TSCCs may be committed include
hepatocyte progenitors, which are pluripotent for bile duct
epithelial cells and hepatocytes; neural restricted cells, which
can generate glial cell precursors that progress to
oligodendrocytes and astrocytes, and neuronal precursors that
progress to neurons; precursors for cardiac muscle and
cardiomyocytes, glucose-responsive insulin secreting pancreatic
beta cell lines. Other committed precursor cells include but are
not limited to chondrocytes, osteoblasts, odontoblast,
dentin-producing and chondrocytes, and precursor cells of the
following: retinal pigment epithelial cells, fibroblasts, skin
cells such as keratinocytes, dendritic cells, hair follicle cells,
renal duct epithelial cells, smooth and skeletal muscle cells,
testicular progenitors, vascular endothelial cells, tendon,
ligament, cartilage, adipocyte, fibroblast, marrow stroma,
osteoclast and haemopoietic-supportive stroma, cardiac muscle,
smooth muscle, skeletal muscle, pericyte, vascular, epithelial,
glial, neuronal, astrocyte and oligodendrocyte cells. Precursors
include those that specifically can lead to connective tissue
particularly including adipose, areolar, osseous, cartilaginous,
elastic and fibrous connective tissues.
[0274] In another embodiment, the progeny cells are Multipotential
Expanded STRO-1.sup.+ Multipotential cells Progeny (MEMPs) as
defined and/or described in WO 2006/032092. Methods for preparing
enriched populations of STRO-1.sup.+ multipotential cells from
which progeny may be derived are described in WO 01/04268 and WO
2004/085630. In an in vitro context STRO-1.sup.+ multipotential
cells will rarely be present as an absolutely pure preparation and
will generally be present with other cells that are tissue specific
committed cells (TSCCs). WO 01/04268 refers to harvesting such
cells from bone marrow at purity levels of about 0.1% to 90%. The
population comprising progenitor cells from which progeny are
derived may be directly harvested from a tissue source, or
alternatively it may be a population that has already been expanded
ex vivo.
[0275] For example, the progeny may be obtained from a harvested,
unexpanded, population of substantially purified STRO-1.sup.+
multipotential cells, comprising at least about 0.1, 1, 5, 10, 20,
30, 40, 50, 60, 70, 80 or 95% of total cells of the population in
which they are present. This level may be achieved, for example, by
selecting for cells that are positive for at least one marker
individually or collectively selected from the group consisting of
TNAP, STRO-1.sup.bright, 3G5.sup.+, VCAM-1, THY-1, CD146 and
STRO-2.
[0276] MEMPS can be distinguished from freshly harvested
Stro-1.sup.bri cells in that they are positive for the marker
STRO-1.sup.bri and negative for the marker Alkaline phosphatase
(ALP). In contrast, freshly isolated Stro-1.sup.bri cells are
positive for both STRO-1.sup.bri and ALP. In a further embodiment
of the present invention, at least 15%, 20%, 30%, 40%, 50%, 60%,
70%, 80%, 90% or 95% of the administered cells have the phenotype
STRO-1.sup.bri , ALP.sup.-. In a further embodiment the MEMPS are
positive for one or more of the markers Ki67, CD44 and/or
CD49c/CD29, VLA-3, .alpha.3.beta.1. In yet a further embodiment the
MEMPs do not exhibit TERT activity and/or are negative for the
marker CD18.
[0277] The Stro-1.sup.bri cell starting population may be derived
from any one or more tissue types including bone marrow, dental
pulp cells, adipose tissue and skin, or perhaps more broadly from
adipose tissue, teeth, dental pulp, skin, liver, kidney, heart,
retina, brain, hair follicles, intestine, lung, spleen, lymph node,
thymus, pancreas, bone, ligament, bone marrow, tendon and skeletal
muscle.
[0278] It will be understood that in performing the present
invention, separation of cells carrying any given cell surface
marker can be effected by a number of different methods, however,
certain methods rely upon binding a binding agent (e.g., an
antibody or antigen binding fragment thereof) to the marker
concerned followed by a separation of those that exhibit binding,
being either high level binding, or low level binding or no
binding. The most convenient binding agents are antibodies or
antibody-based molecules, preferably being monoclonal antibodies or
based on monoclonal antibodies because of the specificity of these
latter agents. Antibodies can be used for both steps, however other
agents might also be used, thus ligands for these markers may also
be employed to enrich for cells carrying them, or lacking them.
[0279] The antibodies or ligands may be attached to a solid support
to allow for a crude separation. The separation techniques
preferably maximise the retention of viability of the fraction to
be collected. Various techniques of different efficacy may be
employed to obtain relatively crude separations. The particular
technique employed will depend upon efficiency of separation,
associated cytotoxicity, ease and speed of performance, and
necessity for sophisticated equipment and/or technical skill.
Procedures for separation may include, but are not limited to,
magnetic separation, using antibody-coated magnetic beads, affinity
chromatography and "panning" with antibody attached to a solid
matrix. Techniques providing accurate separation include but are
not limited to FACS. Methods for performing FACS will be apparent
to the skilled artisan.
[0280] Antibodies against each of the markers described herein are
commercially available (e.g., monoclonal antibodies against STRO-1
are commercially available from R&D Systems, USA), available
from ATCC or other depositary organization and/or can be produced
using art recognized techniques.
[0281] It is preferred that the method for isolating Stro-1.sup.bri
cells, for example, comprises a first step being a solid phase
sorting step utilising for example magnetic activated cell sorting
(MACS) recognising high level expression of STRO-1. A second
sorting step can then follow, should that be desired, to result in
a higher level of precursor cell expression. This second sorting
step might involve the use of two or more markers. The method
obtaining Stro-1.sup.bri cells might also include the harvesting of
a source of the cells before the first enrichment step using known
techniques. Thus the tissue will be surgically removed. Cells
comprising the source tissue will then be separated into a so
called single cells suspension. This separation may be achieved by
physical and or enzymatic means.
[0282] Once a suitable Stro-1.sup.bri cell population has been
obtained, it may be cultured or expanded by any suitable means to
obtain MEMPs.
[0283] In one embodiment, the cells are taken from the subject to
be treated, cultured in vitro using standard techniques and used to
obtain supernatant or soluble factors or expanded cells for
administration to the subject as an autologous or allogeneic
composition. In an alternative embodiment, cells of one or more of
the established human cell lines are used to obtain the supernatant
or soluble factors. In another useful embodiment of the invention,
cells of a non-human animal (or if the patient is not a human, from
another species) are used to obtain supernatant or soluble
factors.
[0284] The invention can be practised using cells from any
non-human animal species, including but not limited to non-human
primate cells, ungulate, canine, feline, lagomorph, rodent, avian,
and fish cells. Primate cells with which the invention may be
performed include but are not limited to cells of chimpanzees,
baboons, cynomolgus monkeys, and any other New or Old World
monkeys. Ungulate cells with which the invention may be performed
include but are not limited to cells of bovines, porcines, ovines,
caprines, equines, buffalo and bison. Rodent cells with which the
invention may be performed include but are not limited to mouse,
rat, guinea pig, hamster and gerbil cells. Examples of lagomorph
species with which the invention may be performed include
domesticated rabbits, jack rabbits, hares, cottontails, snowshoe
rabbits, and pikas. Chickens (Gallus gallus) are an example of an
avian species with which the invention may be performed.
[0285] Cells useful for the methods of the invention may be stored
before use, or before obtaining the supernatant or soluble factors.
Methods and protocols for preserving and storing of eukaryotic
cells, and in particular mammalian cells, are known in the art
(cf., for example, Pollard, J. W. and Walker, J. M. (1997) Basic
Cell Culture Protocols, Second Edition, Humana Press, Totowa, N.J.;
Freshney, R. I. (2000) Culture of Animal Cells, Fourth Edition,
Wiley-Liss, Hoboken, N.J.).
[0286] Genetically-Modified Cells
[0287] In one embodiment, the Stro-1.sup.bri cells and/or progeny
cells thereof are genetically modified, e.g., to express and/or
secrete a protein of interest, e.g., a protein providing a
therapeutic and/or prophylactic benefit, e.g., insulin, glucagon,
somatostatin, trypsinogen, chymotrypsinogen, elastase,
carboxypeptidase, pancreatic lipase or amylase or a polypeptide
associated with or causative of enhanced angiogenesis or a
polypeptide associated with differentiation of a cell into a
pancreatic cell or a vascular cell.
[0288] Methods for genetically modifying a cell will be apparent to
the skilled artisan. For example, a nucleic acid that is to be
expressed in a cell is operably-linked to a promoter for inducing
expression in the cell. For example, the nucleic acid is linked to
a promoter operable in a variety of cells of a subject, such as,
for example, a viral promoter, e.g., a CMV promoter (e.g., a CMV-IE
promoter) or a SV-40 promoter. Additional suitable promoters are
known in the art and shall be taken to apply mutatis mutandis to
the present embodiment of the invention.
[0289] In one embodiment, the nucleic acid is provided in the form
of an expression construct. As used herein, the term "expression
construct" refers to a nucleic acid that has the ability to confer
expression on a nucleic acid (e.g. a reporter gene and/or a
counter-selectable reporter gene) to which it is operably
connected, in a cell. Within the context of the present invention,
it is to be understood that an expression construct may comprise or
be a plasmid, bacteriophage, phagemid, cosmid, virus sub-genomic or
genomic fragment, or other nucleic acid capable of maintaining
and/or replicating heterologous DNA in an expressible format.
[0290] Methods for the construction of a suitable expression
construct for performance of the invention will be apparent to the
skilled artisan and are described, for example, in Ausubel et al
(In: Current Protocols in Molecular Biology. Wiley Interscience,
ISBN 047 150338, 1987) or Sambrook et al (In: Molecular Cloning:
Molecular Cloning: A Laboratory Manual, Cold Spring Harbor
Laboratories, New York, Third Edition 2001). For example, each of
the components of the expression construct is amplified from a
suitable template nucleic acid using, for example, PCR and
subsequently cloned into a suitable expression construct, such as
for example, a plasmid or a phagemid.
[0291] Vectors suitable for such an expression construct are known
in the art and/or described herein. For example, an expression
vector suitable for the method of the present invention in a
mammalian cell is, for example, a vector of the pcDNA vector suite
supplied by Invitrogen, a vector of the pCI vector suite (Promega),
a vector of the pCMV vector suite (Clontech), a pM vector
(Clontech), a pSI vector (Promega), a VP 16 vector (Clontech) or a
vector of the pcDNA vector suite (Invitrogen).
[0292] The skilled artisan will be aware of additional vectors and
sources of such vectors, such as, for example, Invitrogen
Corporation, Clontech or Promega.
[0293] Means for introducing the isolated nucleic acid molecule or
a gene construct comprising same into a cell for expression are
known to those skilled in the art. The technique used for a given
organism depends on the known successful techniques. Means for
introducing recombinant DNA into cells include microinjection,
transfection mediated by DEAE-dextran, transfection mediated by
liposomes such as by using lipofectamine (Gibco, MD, USA) and/or
cellfectin (Gibco, MD, USA), PEG-mediated DNA uptake,
electroporation and microparticle bombardment such as by using
DNA-coated tungsten or gold particles (Agracetus Inc., WI, USA)
amongst others.
[0294] Alternatively, an expression construct of the invention is a
viral vector. Suitable viral vectors are known in the art and
commercially available. Conventional viral-based systems for the
delivery of a nucleic acid and integration of that nucleic acid
into a host cell genome include, for example, a retroviral vector,
a lentiviral vector or an adeno-associated viral vector.
Alternatively, an adenoviral vector is useful for introducing a
nucleic acid that remains episomal into a host cell. Viral vectors
are an efficient and versatile method of gene transfer in target
cells and tissues. Additionally, high transduction efficiencies
have been observed in many different cell types and target
tissues.
[0295] For example, a retroviral vector generally comprises
cis-acting long terminal repeats (LTRs) with packaging capacity for
up to 6-10 kb of foreign sequence. The minimum cis-acting LTRs are
sufficient for replication and packaging of a vector, which is then
used to integrate the expression construct into the target cell to
provide long term expression. Widely used retroviral vectors
include those based upon murine leukemia virus (MuLV), gibbon ape
leukemia virus (GaLV), simian immunodeficiency virus (SrV), human
immunodeficiency virus (HIV), and combinations thereof (see, e.g.,
Buchscher et al., J Virol. 56:2731-2739 (1992); Johann et al, J.
Virol. 65:1635-1640 (1992); Sommerfelt et al, Virol. 76:58-59
(1990); Wilson et al, J. Virol. 63:274-2318 (1989); Miller et al.,
J. Virol. 65:2220-2224 (1991); PCT/US94/05700; Miller and Rosman
BioTechniques 7:980-990, 1989; Miller, A. D. Human Gene Therapy
7:5-14, 1990; Scarpa et al Virology 75:849-852, 1991; Burns et al.
Proc. Natl. Acad. Sci USA 90:8033-8037, 1993).
[0296] Various adeno-associated virus (AAV) vector systems have
also been developed for nucleic acid delivery. AAV vectors can be
readily constructed using techniques known in the art. See, e.g.,
U.S. Pat. Nos. 5,173,414 and 5,139,941; International Publication
Nos. WO 92/01070 and WO 93/03769; Lebkowski et al. Molec. Cell.
Biol. 5:3988-3996, 1988; Vincent et al. (1990) Vaccines 90 (Cold
Spring Harbor Laboratory Press); Carter Current Opinion in
Biotechnology 5:533-539, 1992; Muzyczka. Current Topics in
Microbiol, and Immunol. 158:97-129, 1992; Kotin, Human Gene Therapy
5:793-801, 1994; Shelling and Smith Gene Therapy 7:165-169, 1994;
and Zhou et al. J Exp. Med. 179:1867-1875, 1994.
[0297] Additional viral vectors useful for delivering an expression
construct of the invention include, for example, those derived from
the pox family of viruses, such as vaccinia virus and avian
poxvirus or an alphavirus or a conjugate virus vector (e.g. that
described in Fisher-Hoch et al., Proc. Natl Acad. Sci. USA
56:317-321, 1989).
[0298] In a further embodiment, the progenitor cells are a
population of cells enriched for Stro-3.sup.bri, or homogeonous
Stro-3.sup.bri cells, or Stro-3.sup.bri progeny cells.
[0299] Polysulfated Polysaccharides
[0300] The present invention also relates to the use of
polysulfated polysaccharide compounds. The polysulfated
polysaccharide family can be considered to be any naturally
occurring or semi-synthetic/synthetic polysulfated polysaccharide
or a biologically active fragment thereof that contains two or more
sugar rings or carbohydrate structures to which one or more sulfate
ester groups are covalently attached as exemplified by heparin and
pentosan polysulfate.
[0301] Examples of polysulfated polysaccharides falling within the
scope of the present invention are naturally occurring high
molecular weight heparin, low molecular weight heparins, heparan
sulfate, pentosan polysulfate, chondroitin polysulfate, chitosan
polysulfate, dermatan polysulfate sulodexide, dextran polysulfate,
polysulfated inulin, sulfated lactobionic acid amide, sulfated
bis-aldonic acid amide, sucrose octasulfate, fucoidan-1,
fucoidan-2, sulfated beta-cyclodextrin, sulfated gamma-cyclodextrin
and small sulfated compounds including, but are not limited to,
inositol hexasulfate.
[0302] A specific list of polysulfated polysaccharides are pentosan
polysulfate, calcium pentosan polysulfate, magnesium pentosan
polysulfate, sodium pentosan polysulfate, polysulfated chondroitin
and dextran polysulfate.
[0303] Further examples of the polysaccharides suitable for the
present invention include polysulfated polysaccharides,
polysulfated dextran, polysulfated cyclodextran, polysulfated
chondroitin, and pentosan polysulfate as its alkali metal or
alkaline earth metal salt, for example its calcium or sodium salt,
transition metals such as copper and zinc and noble metals such as
platinum. Further examples are polysulfated polysaccharide
derivatives of homopolysaccharides or heteropolysaccharides, which
can be linear or branched. The sugars may come from but are not
limited to pentoses or hexoses such as galactose, mannose, glucose,
rhanose, fructose, sorbose, xylose, D-arabinose, ribose,
L-arabinose, glucuronic acid and their derivatives.
[0304] The present invention also encompasses biologically active
molecular fragments of polysulfated polysaccharides or analogues or
derivatives of polysulfated polysaccharides.
[0305] One polysulfated polysaccharide is pentosan polysulfate
(PPS). The basic structure of PPS consists of pentoses, i. e.
(1.fwdarw.4) linked beta-D-xylopyranose units containing glucuronic
acid groups at statistically every 10th unit.
##STR00001##
[0306] Shown below is the structural formula of pentosan
polysulfate (PPS) isolated from beechwood hemicellulose (Fagus
silvatica). This formula shows that the linear xylan (pentosan)
backbone of pentosan polysulfate contains on average one
4-O-methyl-glucuronate side chain linked to the 2-position on every
tenth xylose (pentose) ring.
[0307] The calcium and magnesium derivatives of PPS (CaPPS or
MgPPS) is when R.dbd.SO.sub.3--Ca.sup.+1/2 or Mg.sup.+1/2. The
sodium derivative is when R.dbd.SO.sub.3--Na.
##STR00002##
[0308] Pentosan polysulfate as its calcium or sodium salt has an
average molecular weight of about 5700 Daltons and a sulphur
content of about 16%. This compound has been known since the early
1960s to be a synthetic heparinoid and an anti-thrombotic
agent.
[0309] The particular complexing ions may be selected from the
group consisting of the alkali metals, e. g. Na.sup.+, and K.sup.+,
alkaline earth metals, e. g. Ca.sup.2+, Zn.sup.2+, Mg.sup.2+,
Ba.sup.2+, as well as Ag.sup.+, Au.sup.+, Pb.sup.2+, Cu.sup.2+,
Au.sup.2+, Pd.sup.2+, Pd.sup.4+, Pt.sup.4+, Pt.sup.2+, trivalent
metal ions, and quaternary ammonium compound complexes. Examples of
the latter compounds are pyridinium chloride, tetraalkyl ammonium
chloride, choline chloride, cetylpyridinium chloride,
N-cetyl-N,N,N-trialkylammonium chloride or their derivatives. In
one particular embodiment, the calcium complex is used.
[0310] Preparation of the polysulfate polysaccharide-metal
complexes is described in detail in U.S. Pat. No. 5,668,116, the
entire disclosure of which is incorporated herein by reference.
[0311] Further information relating to polysulfate polysaccharides
and PPS can be found in WO02/41901, the entire disclosure of which
is incorporated herein by reference. Further information can also
be found in Semin Arthritis Rheum. 1999 February; 28(4):211-67
Ghosh--The pathobiology of osteoarthritis and the rationale for the
use of pentosan polysulfate for its treatment, the entire
disclosure of which is incorporated herein by reference.
[0312] In one embodiment, the polysulfated polysaccharide is
pentosan polysulfate sodium. An example of this is SP54,
manufactured by Bene Pharmachem, Germany, which is a
polysaccharide, esterified with sulphuric acid, more specifically a
pentosan polysulfate sodium. The semisynthetic production of
pentosan polysulfate sodium assures consistent and reproducible
manufacturing with a defined range of molecular weight (4000 to
6000 daltons).
[0313] A further polysulfated polysaccharide is polysulfated
chondroitin. An example of this is Arteparon.RTM. (trade mark of
Luitpold-Werk) which consists predominantly of polysulfated
chondroitin. It has been used as an antiarthritic drug. More
specifically, it is a heterogeneous semi-synthetic
glycosaminoglycan polysulfate in which the predominant (about 93%)
disaccharide repeating unit is hexuronic acid glycosidically linked
to galactosamine. Approximately four of the free hydroxyl groups of
the disaccharide repeating unit of Arteparon are esterified by
sulfate groups to give a sulphur content of about 13.0% by weight.
The commercial preparation has a molecular weight of about 10,000
Daltons.
[0314] Preparation of the polysulfate polysaccharide-metal
complexes is described in detail in U.S. Pat. No. 5,668,116, the
entire disclosure of which is incorporated herein by reference.
[0315] Further information relating to polysulfate polysaccharides
and PPS can be found in WO02/41901, the entire disclosure of which
is incorporated herein by reference. Further information can be
found in Semin Arthritis Rheum. 1999 February; 28(4):211-67
Ghosh--The pathobiology of osteoarthritis and the rationale for the
use of pentosan polysulfate for its treatment, the entire
disclosure of which is incorporated herein by reference.
[0316] In particular, the methods of manufacture, isolation and
purification together with suitable carriers compositions and
formulations are incorporated into the present application.
[0317] Further information can also be found in Ghosh P, Edelman J,
March L and Smith M. Effects of pentosan polysulfate in
osteoarthritis of the knee: A randomised, double blind,
placebo-controlled pilot study. Current Therapeutic Research, 2005,
66: 552-571, and which provides information on an OA clinical study
using PPS given by intra-muscular injection. The information on
PPS, and the methods used in the trial including the dosage regimes
and administration methods are hereby incorporated by reference
into the present application.
[0318] Non-Collagenous NC4 Domain of Alpha IX Collagen
[0319] According to a further embodiment, the polypeptide chosen is
a non-collagenous NC4 domain of alpha IX collagen or a biologically
active molecular fragment thereof. Specific information about
suitable NC4 domain polypeptides can be found in International
application PCT/AU2004/000788, the contents of which are
incorporated in their entirety.
[0320] In particular, PCT/AU2004/000788 discloses a number of
polypeptide and their sequences that can be used in the present
invention together with ways of expressing and purifying the
polypeptides. Thus, PCT/AU2004/000788 includes examples of suitable
NC4 domain polypeptides and ways of making them which are
specifically incorporated into the present specification. In
particular, the amino acid sequences as set out in page 7 lines 24
to page 8 line 6 together with the sequences as set out in FIGS.
1-7 are specifically incorporated into the present application.
Furthermore, the methods of recovering polypeptides as set out in
page 9 line 10 to page 10 line 36 are specifically incorporated
into the present application. The autolysis techniques set out in
the detailed description from page 15 together with the separating
and recovery steps set out in the detailed description from page 18
and specifically the polypeptides as set out on pages 20-24 are
incorporated into the present invention. Finally, the partial amino
acid sequence of FIG. 7 is incorporated into the present
application.
[0321] As said above, the NC4 domain is discussed in
PCT/AU2004/000788. It includes the complete amino acid sequence
predicted from the gene sequence and obtained by expression in E.
coli (see Table 1).
[0322] However, it should be noted that the protein products
obtained by expression using K. lactis consisted of the full length
human NC4 plus a truncated form (MW=24 kDa), with both forms being
glycosylated, these are also included in Table 1 and there
preparation and ID are described in the methods section. Both the
E. coli and K. lactis expressed proteins were evaluated in animal
models and in vitro assays and may be identified by the codes
AWR-01 and PBA-1200P respectively. The progenitor cells used in
these experiments was the mouse ATDC5 which is commercially
available as discussed in the methods section. The differentiated
cells used included: chondrocytes from human joint cartilage,
normal ovine and porcine cartilage and chondrocytes and synovial
fibroblasts derived from synovial tissue from OA patients
undergoing total joint replacement surgery.
[0323] In particular, the following sequences also define
polypeptides for use in the present application.
TABLE-US-00001 TABLE 1 Amino acid sequences of interest but shown
without N or O glycosylation SEQ ID NO: 1 1) hNC4: (Full length
human NC4 without signal peptide) 10 20 30 40 50 60 AVKRRPRFPV
NSNSNGGNEL CPKIRIGQDD LPGFDLISQF QVDKAASRRA IQRVVGSATL 70 80 90 100
110 120 QVAYKLGNNV DFRIPTRNLY PSGLPEEYSF LTTFRMTGST LKKNWNIWQI
QDSSGKEQVG 130 140 150 160 170 180 IKINGQTQSV VFSYKGLDGS LQTAAFSNLS
SLFDSQWHKI MIGVERSSAT LFVDCNRIES 190 200 210 220 230 240 LPIKPRGPID
IDGFAVLGKL ADNPQVSVPF ELQWMLIHCD PLRPRRETCH ELPARITPSQ TTDER SEQ ID
NO: 2 2) Truncated hNC4 (residues 6-224) obtained during expression
from K. lactis cultures by action of putative by proline
endopeptidase: 10 20 30 40 50 60 RFPVNSNSNG GNELCPKIRI GQDDLPGFDL
ISQFQVDKAA SRRAIQRVVG SATLQVAYKL 70 80 90 100 110 120 GNNVDFRIPT
RNLYPSGLPE EYSFLTTFRM TGSTLKKNWN IWQIQDSSGK EQVGIKINGQ 130 140 150
160 170 180 TQSVVFSYKG LDGSLQTAAF SNLSSLFDSQ WHKIMIGVER SSATLFVDCN
RIESLPIKPR 190 200 210 GPIDIDGFAV LGKLADNPQV SVPFELQWML IHCDPLRP 3)
Sequences underlined in bolded red which were identified by
proteomics and described in Patent Application PCT/AU2004/000788 1
Met Lys Thr Cys Trp Lys Ile Pro Val Phe Phe Phe Val Cys Ser 16 Phe
Leu Glu Pro Trp Ala Ser Ala 23 Ala Val Lys Arg Arg Pro Arg 31 Phe
Pro Val Asn Ser Asn Ser Asn Gly Gly Asn Glu Leu Cys Pro 46 Lys Ile
Arg Ile Gly Gln Asp Asp Leu Pro Gly Phe Asp Leu Ile 61 Ser Gln Phe
Gln Val Asp Lys Ala Ala Ser Arg Arg Ala Ile Gln 76 Arg Val Val Gly
Ser Ala Thr Leu Gln Val Ala Tyr Lys Leu Gly 91 Asn Asn Val Asp Phe
Arg Ile Pro Thr Arg Asn Leu Tyr Pro Ser 106 Gly Leu Pro Glu Glu Tyr
Ser Phe Leu Thr Thr Phe Arg Met Thr 121 Gly Ser Thr Leu Lys Lys Asn
Trp Asn Ile Trp Gln Ile Gln Asp 136 Ser Ser Gly Lys Glu Gln Val Gly
Ile Lys Ile Asn Gly Gln Thr 151 Gln Ser Val Val Phe Ser Tyr Lys Gly
Leu Asp Gly Ser Leu Gln 166 Thr Ala Ala Phe Ser Asn Leu Ser Ser Leu
Phe Asp Ser Gln Trp 181 His Lys Ile Met Ile Gly Val Glu Arg Ser Ser
Ala Thr Leu Phe 196 Val Asp Cys Asn Arg Ile Glu Ser Leu Pro Ile Lys
Pro Arg Gly 211 Pro Ile Asp Ile Asp Gly Phe Ala Val Leu Gly Lys Leu
Ala Asp 226 Asn Pro Gln Val Ser Val Pro Phe Glu Leu Gln Trp Met Leu
Ile 241 His Cys Asp Pro Leu Arg Pro Arg Arg Glu Thr Cys His Glu Leu
256 Pro Ala Arg Ile Thr Pro Ser Gln Thr Thr Asp Glu Arg 268
[0324] A sequence composition between bovine human, murine and
chick NC4 sequences is provided in FIG. 37. Conserved sequences are
as follows:
TABLE-US-00002 SEQ ID NO: 3 K/QSVSN/A/EFSYKG SEQ ID NO: 4
KI/LMIG/SVER/TS/T SEQ ID NO: 5 KLGNNVDFRI SEQ ID NO: 6
R/KINES/TLP/NIKPR/KG SEQ ID NO: 7 KH/N/YWS/N/TIWQIQDS/AGK/R SEQ ID
NO: 8 K/QSVSNFSYKG SEQ ID NO: 9 KIMIGVERTS SEQ ID NO: 10
RIESLPIKPRG SEQ ID NO: 11 KH/NWS/NIWQIQDSGK SEQ ID NO: 12
RIGQDDLPGFDLISQFQI/VDKA SEQ ID NO: 13 RH/NLYPN/SGLPEEYSFLTTFR SEQ
ID NO: 14 FSNLP/SSLFDSQWHKI SEQ ID NO: 15 RSSATLFVDCNRI SEQ ID NO:
16 SVSFSYKG SEQ ID NO: 17 KIMIGVERS SEQ ID NO: 18 KLGNNVDFRI SEQ ID
NO: 19 RIESLPIKPRG SEQ ID NO: 20 KHWSIWQIQDSSGK SEQ ID NO: 21
RIGQDDLPGFDLISQFQIDKA SEQ ID NO: 22 RHLYPNGLPEEYSFLTTFRM SEQ ID NO:
23 FSNKOSKFDSQWHKI SEQ ID NO: 24 RSSATLFVDCNRI
[0325] Cryopreservation
[0326] There are various techniques to cryopreserve progenitor
cells known to the person skilled in the art. One example procedure
is as follows:
[0327] Examination:
[0328] Prior to freezing, the cells should be maintained in an
actively growing state to insure maximum health and a good
recovery. Ideally, the culture medium should be changed the
previous day. Using an inverted microscope, quickly check the
general appearance of the culture. Look for signs of microbial
contamination. It is also important to examine the culture with the
unaided eye to look for small fungal colonies that may be floating
at the medium-air interface and thus not visible through the
microscope. It is best if the cultures are maintained
antibiotic-free for at least one week prior to freezing to help
uncover any cryptic (hidden) culture contaminants.
[0329] Cell Harvesting and Freezing:
[0330] Treat the cells gently during harvesting since it is very
difficult for cells damaged during harvesting to survive the
additional damage that occurs during the freezing and thawing
processes. You should be able to obtain up to 1.5.times.107 cells
from a near confluent T-75 flask (depending on cell type and degree
of confluency). This should be enough cells to set up at least
several vials at 2.times.10.sup.6 cells/vial.
[0331] 1. Using a sterile pipette, remove and discard the old
culture medium.
[0332] 2. For a T-75 flask, rinse the cell monolayer with 5 mL of
calcium- and magnesium-free phosphate buffered saline (CMF-PBS) to
remove all traces of foetal bovine serum.
[0333] 3. Add 4 to 5 mL of the trypsin solution (in CMF-PBS) to the
flask and allow cells to incubate for at least one minute.
(Prewarming of the enzyme 4 solution will decrease the exposure
period.) Withdraw about 3 mL of the trypsin solution and allow the
cells to round up and loosen.
[0334] 4. Check the progress of the enzyme treatment every few
minutes on an inverted phase contrast microscope. Once all of the
cells have rounded up, gently tap the flask to detach them from the
plastic surface. Then add 5 mL of growth medium to the cell
suspension and, using the same pipette, vigorously wash any
remaining cells from the bottom of the culture vessel.
[0335] 5. Collect the suspended cells in a 15 mL centrifuge tube
and place on ice. Take a sample for counting and then spin at
100.times.g for 5 minutes to obtain a cell pellet. While the cells
are spinning, do a viable cell count (with the trypan blue
solution) and calculate the number of cells/mL and the total cell
number.
[0336] 6. Remove the supernatant from the centrifuged cells and
resuspend the cell pellet in enough of the cryoprotective medium
containing 10% DMSO (DMSO is most often used at a final
concentration of 5 to 15% to give a final cell concentration of 1
to 2.times.106 cells/mL.
[0337] 7. Label the appropriate number of cryogenic vials with the
cell line, and the date. Then add 1.5 to 1.8 mL of the DMSO
containing cell suspension to each of the vials and seal.
[0338] 8. Place the vials in the controlled rate freezer overnight.
After 24 hours, the cells should be transferred to a liquid
nitrogen freezer for permanent storage.
[0339] 9. Record the appropriate information about the cells in
your cell repository records. Fully detail in these records the
culture's storage conditions, including all of the following
information: culture identity, passage or population doubling
level, date frozen, freezing medium and method used, number of
cells per vial, total number of vials initially frozen and the
number remaining, their locations, their expected viability and
results of all quality control tests performed (sterility,
mycoplasma, species, karyotype, etc.). Additional culture
information, especially its origin, history, growth parameters,
special characteristics and applications, is also helpful and
should be included whenever possible.
[0340] Cell Thawing and Recovery:
[0341] 1. Using appropriate safety equipment, remove the vial from
its storage location and carefully check both the label and storage
record to ensure that it is the correct culture. Place the vessel
in warm water, agitating gently until completely thawed. Rapid
thawing (60 to 90 seconds at 37.degree. C.) provides the best
recovery for most cell cultures; it reduces or prevents the
formation of damaging ice crystals within cells during
rehydration.
[0342] 2. Since some cryoprotective agents may damage cells upon
prolonged exposure, remove the agents as quickly and gently as
possible. Several approaches are used depending on both the
cryoprotective agents and characteristics of the cells: [0343] a)
Most cells recover normally if they have the cryoprotective agent
removed by a medium change within 6 to 8 hours of thawing. Transfer
the contents of the ampule or vial to a T-75 flask or other
suitable vessel containing 15 to 20 mL of culture medium and
incubate normally. As soon as a majority of the cells have attached
(usually 3 to 4 hours), remove the medium containing the now
diluted cryoprotective agent and replace with fresh medium. [0344]
b) For cells that are sensitive to cryoprotective agents, removing
the old medium is easily accomplished by gentle centrifugation.
Transfer the contents of the vial or ampule to a 15mL centrifuge
tube containing 10 mL of fresh medium and spin for 5 minutes at
100.times.g. Discard the supernatant containing the cryoprotective
agent and resuspend the cell pellet in fresh medium. Then transfer
the cell suspension to a suitable culture vessel and incubate
normally.
[0345] Support Matrix
[0346] Recent advances in biology and material science have brought
tissue engineering to the forefront of new cartilage repair
techniques. The combination of autologous cells, specifically
designed scaffolds, bioreactors, mechanical stimulations and growth
factors offer promising avenues for carilage tissue
regeneration.
[0347] Bioscaffolds Mimic Extracellular Matrix.
[0348] Current tissue-engineering strategies provide scaffolds
derived from both synthetic (e.g., polyglycolic acid) and
naturally-derived (e.g., collagen) materials to form the
cell-scaffold construct. Currently available tissue scaffold
products include small intestine submucosa (Restore.TM., porcine
SIS, DePuy Orthopaedics), (CuffPatch.TM., porcine SIS,
Organogenesis), (SIS; Cook Biotech, Inc.), reformulated collagen
scaffolds (3D Collagen Composite, BD Biosciences), acellular human
dermal collagen matrices (Graftjacket.RTM., Wright Medical
Technologies), fetal bovine dermis (TissueMend.RTM., Stryker), and
synthetic polymer scaffolds, primarily polyesters (e.g. PGA, PCL,
and PLA).
[0349] Tissue engineered scaffolds that have recently been
described including collagen scaffolds, chrondrocyte seeded
scaffolds, articular chondrocyte seeded type II collagen-GAG
scaffolds [Vickers et al, Tissue Eng. 2006 May; 12(5): 1345-55] and
composite scaffolds comprising polyethylene oxide (PEO) and
chitosan [Kuo Y C et al; J. Biomed Mater Res A. 2008 Nov. 3] An
alternate form described by Nettles D L et al., [Tissue Eng part A
2008 July; 14(7): 1133-40] is an injectable cross-linkable
elastin-like polypeptide (ELP) gel for application to cartilage
matrix repair.
[0350] The choice of matrix material is based on biocompatibility,
biodegradability, mechanical properties, cosmetic appearance and
interface properties. Potential matrices for the compositions may
be biodegradable and chemically defined calcium sulfate, tricalcium
phosphate, hydroxyapatite, polylactic acid and polyanhydrides.
Other potential materials are biodegradable and biologically well
defined, such as bone or dermal collagen. Further matrices are
comprised of pure proteins or extracellular matrix components.
Other potential matrices are nonbiodegradable and chemically
defined, such as sintered hydroxyapatite, bioglass, aluminates, or
other ceramics. Matrices may be comprised of combinations of any of
the above mentioned types of material, such as polylactic acid and
hydroxyapatite or collagen and tricalcium phosphate. The
bioceramics may be altered in composition, such as in
calcium-aluminate-phosphate and processing to alter pore size,
particle size, particle shape, and biodegradability.
[0351] In one embodiment, the scaffold is derived from a synthetic
material. In another embodiment the scaffold is derived from
naturally derived-materials. Alternatively, the scaffold is a
combination of synthetic and naturally derived materials.
[0352] In one embodiment, and as described in the examples, the
support matrix is a collagen sponge. The composition of the
invention including the cells, pentosan polysulfate optionally in
combination with a NC4 polypeptidecan be implanted or infused or
perfused into the sponge. Since sponges can be delicate to implant,
the sponge is optionally inserted into a resorbable cage.
[0353] Compositions
[0354] In all cases, the compositions and formulations as discussed
herein are suitable for the polysaccharides and/or polypeptides of
the present invention. In particular, the compositions and
formulations are suitable for polysulfated polysaccharides, in one
embodiment pentosan polysulfate, calcium pentosan polysulfate,
magnesium pentosan polysulfate and/or sodium pentosan polysulfated
alone. The compositions and formulations are also suitable for
combinations of the compounds discussed herein, for example
combinations of polysaccharides and/or polypeptides, and in
particular combinations of NC4 domain polypeptides and pentosan
polysulfate and its salts.
[0355] According to the present invention, compositions comprising
a polysaccharide and/or polypeptide as disclosed herein,
particularly polysulfated polysaccharides optionally with NC4
domain, in one embodiment pentosan polysulfate, calcium pentosan
polysulfate and/or sodium pentosan polysulfate or a fragment or
truncated form are suitable for human or animal usage in human and
veterinary medicine and will typically comprise any one or more of
a pharmaceutically acceptable diluent, carrier or excipient.
Acceptable carriers or diluents for therapeutic use are well known
in the pharmaceutical art, and are described for example in
Remington's Pharmaceutical Sciences Mack Publishing Co. (A. R.
Gennaro edit. 1985). The choice of pharmaceutical carrier excipient
or diluent can be selected with regard to the intended route of
administration and standard pharmaceutical practice. The
compositions may comprise as, or in addition to, the carrier,
excipient or diluent, any suitable binder, lubricant, suspending
agent (liposomes), coating agent, or solubilising agent.
[0356] It is well known in the art that there may be different
composition/formulation requirements dependent on the different
delivery systems. For example, polysaccharides and/or proteins
comprising a NC4 domain can be dissolved in saline. Alternatively
these compounds can be made up in a solution provided with a two
part liquid-powder that is mixed before use.
[0357] Implantable (subcutaneous) slow release capsules are often
used for contraceptives like Implanon.TM. or Depo-Provera.TM.
injections and would be useful for administration of a composition
of the present invention.
[0358] In another example, the composition of the present invention
may be formulated to be delivered using an implanted mini-pump
wherein the composition is typically administered by continuous
infusion into the desired location.
[0359] In an alternate embodiment, compositions of the invention
can be injected or otherwise implanted parenterally for example,
intravenously, subcutaneously, intra-muscularly, intra-articularly,
intra-discally or intra-dermally. In a further embodiment the
formulation is administered subcutaneously, intra-dermally or
intra-articularly.
[0360] Subcutaneous and intra-dermal formulations can also contain
one or more additional agents such as for example soft-tissue
filler substances, lidocaine (local anaesthetic), matrix
metalloproteinase inhibitors, antioxidants and anti-inflammatory
agents (corticosteroids).
[0361] Various formulations for intra-dermal delivery of a drug may
comprise one or more of the following ingredients: albumin, buffer,
buffered saline, buffered salt solution, and anesthetic (preferably
local).
[0362] The present invention extends to combination therapies for
use in the treatment of the diseases discussed herein.
Particularly, in one example, the present invention extends to the
use of a polysulfated polysaccharide and a polypeptide for use in
the treatment of various degenerative conditions. It should be
understood that these agents can be administered at the same time
or a different time. Thus the combination therapy may comprise the
active agents being administered at the same time either in a
single formulation or in multiple formulations administered at the
same or different times. Equally, the combination therapy may
comprise the active agents being administered in different
formulations at different times. The formulations could be
administered sequentially and may be separated by a period of time
including hours, days, weeks and months.
[0363] Example formulations suitable for injection into an animal,
for example intra-dermally, sub-cutaneously or intra-muscularly
include:
[0364] 1) A polysulfated polysaccharides, in one embodiment
pentosan polysulfate, calcium pentosan polysulfate and/or sodium
pentosan polysulfate together with progenitor cells dissolved in
sterile water.
[0365] 2) A polysulfated polysaccharides, in one embodiment
pentosan polysulfate, calcium pentosan polysulfate and/or sodium
pentosan polysulfated, together with progenitor cells, dissolved in
0.9% sterile saline (150 mM NaCl); +/-human albumin (0.01%-0.5%);
+/-local anaesthetic; examples e.g. bupivacaine hydrochloride
(1.25-5 mg/ml); +/-adrenaline acid tartrate (0.0045-0.0091 mg/ml);
+/-lidocaine (0.5-2%); +/-epinephrine (1:100,000-1:200,000).
[0366] 3) A polysulfated polysaccharides, in one embodiment
pentosan polysulfate, calcium pentosan polysulfate and/or sodium
pentosan polysulfate, together with progenitor cells, dissolved in
phosphate buffered saline; +/-human albumin (0.01-0.5%); +/-local
anaesthetic; 137 mM NaCl; 2.7 mM KCl; 10 mM phosphate buffer; 150
mM NaCl; 150 mM NaH.sub.2PO.sub.4/Na.sub.2HPO.sub.4.
[0367] 4) A polysulfated polysaccharides, in one embodiment
pentosan polysulfate, calcium pentosan polysulfate and/or sodium
pentosan polysulfated, together with progenitor cells, dissolved in
phosphate-citrate buffer (50 mM) +/-sodium perborate (0.03%);
+/-human albumin (0.01-0.5%); +/-local anaesthetics.
[0368] 5) A polysulfated polysaccharides, in one embodiment
pentosan polysulfate, calcium pentosan polysulfate and/or sodium
pentosan polysulfate, together with progenitor cells, dissolved in
a solution of sterile water containing carboxymethylcellulose
(2.7%) and mannitol.
[0369] 6) A polysulfated polysaccharides, in one embodiment
pentosan polysulfate, calcium pentosan polysulfate and/or sodium
pentosan polysulfate, together with progenitor cells, incorporated
into biocompatible polyalkymide hydrogels (eg Bio-Alcamid.RTM. made
by Polymekon S.r.l. (Milan, Italy).
[0370] 7) A polysulfated polysaccharides, in one embodiment
pentosan polysulfate, calcium pentosan polysulfate and/or sodium
pentosan polysulfate, together with progenitor cells, incorporated
into hylan B gel (e.g. Hylaform.RTM. Plus).
[0371] 8) A polysulfated polysaccharides, in one embodiment
pentosan polysulfate, calcium pentosan polysulfate and/or sodium
pentosan polysulfate, together with progenitor cells, incorporated
into stabilised hyaluronic acid gel (e.g. Restylane.RTM.).
[0372] 9) A polysulfated polysaccharides, in one embodiment
pentosan polysulfate, calcium pentosan polysulfate and/or sodium
pentosan polysulfate, together with progenitor cells, incorporated
into poly-L-lactic acid solution (e.g. Sculptra.RTM.).
[0373] 10) A polysulfated polysaccharides, in one embodiment
pentosan polysulfate, calcium pentosan polysulfate and/or sodium
pentosan polysulfate, together with progenitor cells, incorporated
dissolved in a solution of Krebs-Ringer's solution containing NaCl
118.1 mM; KCl 3.4 mM; CaCl.sub.2 2.5 mM; MgSO.sub.4 0.8 mM;
KH.sub.2PO.sub.4 1.2 m; NaHCO.sub.3 25.0 mM; Glucose 11.1 mM.
[0374] Formulations of the present invention also further comprise
any one or more of the following:
[0375] a steroidal anti-inflammatory drug (corticosteroid), a
calcineurin inhibitor (eg pimecrolimus, tacrolimus), a
phosphodiesterase inhibitors, a anti-histamine, a anti-microbial
agent, a antibiotic, a antibacterial agent, a ceremide, a growth
factor (eg transforming growth factors .beta.1-3, platelet derived
growth factor, fibroblast growth factor, insulin-like growth
factors I & II, epidermal growth factor, keratinocyte growth
factor, nerve growth factor), a mitogenic agent, a matrix
metalloproteinase inhibitor (eg TIMP's, Batimastat, Marimastat, and
matlystatin B), a protease inhibitor, a ECM protein, tretinoin
(Vitamin A), a antioxidant (vitamins E and C), a plant cytokinin
(kinerase), a copper-peptide complexes as well as numerous plant,
animal and mineral extracts (ie coal tar extract).
[0376] Specific formulations of the present invention comprise a
combination with a steroidal anti-inflammatory drug. Another
composition comprises a calcineurin inhibitor. Another composition
comprises an anti-histamine. Another composition comprises an
anti-microbial agent. Another composition comprises a growth
factor. Another composition comprises a protease inhibitor.
[0377] Preparation of Compositions for Administration
[0378] Liposomes
[0379] Encapsulation of proteins within liposomes are detailed for
example in U.S. Pat. Nos. 5,662,931; 5,853,755; 4,485,054;
5,780,054; 5,653,974; 6,019,999; 6,027,726; 5,739,273; 5,264,221;
5,413,804; 5,374,715.
[0380] Polymers
[0381] The polysaccharides and/or polypeptides of the present
invention, can be encapsulated within biodegradable synthetic
polymers (or derivatives) for controlled release. These polymers
(and derivatives) include for example: Poly(esters); examples are
poly(.epsilon.-caprolactone) PCL, poly(glycolic acid) PGA,
poly(L-lactic acid) PLA, poly(ethylene glycol) PEG, poly(ethylene
oxide) PEO. Poly(ester) derivatives include Poly(ester) copolymers,
Poly(ortho esters). Poly(ester) copolymers; examples are
poly(lactic acid-co-glycolic acid) PLGA, poly(D-lactic acid) PDLA,
poly(L-lactic acid) PLLA, PLA-PEG, diblock PLA/PEG, triblock
PLA/PEG/PLA. Poly(ortho esters); examples are
3,9-diethylidene-2,4,8,10-tetraoxaspiro[5.5]undecane (DETOSU)-based
poly(orthoesters). Poly(anhydrides); examples are sebacic acid
(SA), p-(carboxyphenoxy)propane (CPP), p-(carboxyphenoxy)hexane
(CPH), SA/CPP copolymers, poly(fatty acid dimer-sebacic acid),
poly(anhydride-imides), poly(anhydride-esters). Poly(amides);
examples are poly(amino acids), poly(glutamic acid), poly(aspartic
acid), poly(lactic acid-co-lysine) PLAL,
poly[N-(3-hydroxypropyl)-L-glutamine], poly(iminocarbonates),
tyrosine-derived poly(carbonates). Phosphorus-containing polymers;
ie poly(phosphazenes), poly(dichlorophosphazenes),
poly(organophosphazenes),
poly[bis(carboxylatophenoxy)-phosphazene], poly(phosphoesters),
poly(urethanes), a hyaluronan carrier.
[0382] Coupling
[0383] Polypeptide(s) and/or polysaccharide(s) can be coupled to a
collagen matrix for administration. Collagen matrix can release a
coupled drug at a constant effective concentration. Accordingly,
collagen and other ECM protein matrices can effectively be used to
administer polypeptide(s) and/or polysaccharide(s) in vivo, for
example into a tissue or space in need thereof. In one embodiment
the cross-linked collagen matrix is administered
subcutaneously.
[0384] General
[0385] Generally, the present invention relates to and/or uses
therapeutically effective amounts and/or prophylactically effective
amounts of the compositions discussed herein.
[0386] A "therapeutically effective amount" refers to an amount
effective, at dosages and for periods of time necessary, to achieve
the desired effect.
[0387] A "prophylactically effective amount" refers to an amount
effective, at dosages and for periods of time necessary, to achieve
the desired prophylactic result, such as preventing or inhibiting
cell apoptosis or tissue damage.
[0388] Polypeptides
[0389] Reference herein to "polypeptide" includes single
polypeptides, mixtures of polypeptides and also biologically active
fragments of polypeptides.
[0390] By "substantially purified polypeptide" we mean a
polypeptide that has been at least partially separated from the
lipids, nucleic acids, other polypeptides, and other contaminating
molecules with which it is associated in its native state. In one
embodiment, the substantially purified polypeptide is at least 60%
free from other components with which they are naturally
associated. In a further embodiment, the substantially purified
polypeptide is at least 75% free from other components with which
they are naturally associated. In a further embodiment, the
substantially purified polypeptide is at least 90% free from other
components with which they are naturally associated. Furthermore,
the term "polypeptide" is used interchangeably herein with the term
"protein".
[0391] The % identity of a polypeptide is determined by GAP
(Needleman and Wunsch, 1970) analysis (GCG program) with a gap
creation penalty=5, and a gap extension penalty=0.3. Unless stated
otherwise, the query sequence is at least 15 amino acids in length,
and the GAP analysis aligns the two sequences over a region of at
least 15 amino acids. The query sequence may be at least 50 amino
acids in length, and the GAP analysis aligns the two sequences over
a region of at least 50 amino acids. The query sequence may at
least 100 amino acids in length and the GAP analysis aligns the two
sequences over a region of at least 100 amino acids.
[0392] With regard to the defined polypeptides/enzymes, it will be
appreciated that % identity figures higher than those provided
above will encompass embodiments. Thus, where applicable, in light
of the minimum % identity figures, the polypeptide may comprises an
amino acid sequence which is at least 60%, 65%, 70%, 75%, 76%, 80%,
85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%,
99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or 99.9% identical
to the relevant nominated SEQ ID NO.
[0393] As used herein, the term "biologically active fragment"
refers to a portion of the defined polypeptide which still
maintains anti-arthritic or anti-inflammatory activity (whichever
is relevant). Such biologically active fragments can readily be
determined by serial deletions of the full length protein, and
testing the activity of the resulting fragment.
[0394] Amino acid sequence mutants/variants of the
polypeptides/enzymes defined herein can be prepared by introducing
appropriate nucleotide changes into a nucleic acid encoding the
polypeptide, or by in vitro synthesis of the desired polypeptide.
Such mutants include, for example, deletions, insertions or
substitutions of residues within the amino acid sequence. A
combination of deletion, insertion and substitution can be made to
arrive at the final construct, provided that the final protein
product possesses the desired characteristics.
[0395] In designing amino acid sequence mutants, the location of
the mutation site and the nature of the mutation will depend on
characteristic(s) to be modified. The sites for mutation can be
modified individually or in series, e.g., by (1) substituting first
with conservative amino acid choices and then with more radical
selections depending upon the results achieved, (2) deleting the
target residue, or (3) inserting other residues adjacent to the
located site.
[0396] Amino acid sequence deletions generally range from about 1
to 30 residues, about 1 to 10 residues and typically about 1 to 5
contiguous residues.
[0397] Substitution mutants have at least one amino acid residue in
the polypeptide molecule removed and a different residue inserted
in its place. The sites of greatest interest for substitutional
mutagenesis include sites identified as the active or binding
site(s). Other sites of interest are those in which particular
residues obtained from various strains or species are identical.
These positions may be important for biological activity. These
sites, especially those falling within a sequence of at least three
other identically conserved sites, may be substituted in a
relatively conservative manner. Such conservative substitutions are
shown in Table A.
[0398] Furthermore, if desired, unnatural amino acids or chemical
amino acid analogues can be introduced as a substitution or
addition into the polypeptides of the present invention. Such amino
acids include, but are not limited to, the D-isomers of the common
amino acids, 2,4-diaminobutyric acid, D-amino isobutyric acid,
4-aminobutyric acid, 2-aminobutyric acid, 6-amino hexanoic acid,
2-amino isobutyric acid, 3-amino propionic acid, ornithine,
norleucine, norvaline, hydroxyproline, sarcosine, citrulline,
homocitrulline, cysteic acid, t-butylglycine, t-butylalanine,
phenylglycine, cyclohexylalanine, D-alanine, fluoro-amino acids,
designer amino acids such as D-methyl amino acids, C-methyl amino
acids, N-methyl amino acids, and amino acid analogues in
general.
TABLE-US-00003 TABLE A Exemplary substitutions. Original Exemplary
Residue Substitutions Ala (A) val; leu; ile; gly Arg (R) lys Asn
(N) gln; his Asp (D) glu Cys (C) ser Gln (Q) asn; his Glu (E) asp
Gly (G) pro, ala His (H) asn; gln Ile (I) leu; val; ala Leu (L)
ile; val; met; ala; phe Lys (K) arg Met (M) leu; phe Phe (F) leu;
val; ala Pro (P) gly Ser (S) thr Thr (T) ser Trp (W) tyr Tyr (Y)
trp; phe Val (V) ile; leu; met; phe, ala
[0399] Also included within the scope of the invention are
polypeptides of the present invention which are differentially
modified during or after synthesis, e.g., by biotinylation,
benzylation, glycosylation, acetylation, phosphorylation,
amidation, derivatization by known protecting/blocking groups,
proteolytic cleavage, linkage to an antibody molecule or other
cellular ligand, etc. These modifications may serve to increase the
stability and/or bioactivity of the polypeptide of the
invention.
[0400] Polypeptides of the present invention can be produced in a
variety of ways, including production and recovery of natural
proteins, production and recovery of recombinant proteins, and
chemical synthesis of the proteins. In one embodiment, an isolated
polypeptide of the present invention is produced by culturing a
cell capable of expressing the polypeptide under conditions
effective to produce the polypeptide, and recovering the
polypeptide. One cell to culture is a recombinant cell of the
present invention. Effective culture conditions include, but are
not limited to, effective media, bioreactor, temperature, pH and
oxygen conditions that permit protein production. An effective
medium refers to any medium in which a cell is cultured to produce
a polypeptide of the present invention. Such medium typically
comprises an aqueous medium having assimilable carbon, nitrogen and
phosphate sources, and appropriate salts, minerals, metals and
other nutrients, such as vitamins. Cells of the present invention
can be cultured in conventional fermentation bioreactors, shake
flasks, test tubes, microtiter dishes, and petri plates. Culturing
can be carried out at a temperature, pH and oxygen content
appropriate for a recombinant cell. Such culturing conditions are
within the expertise of one of ordinary skill in the art.
[0401] Gene Therapy
[0402] The polynucleotides and polypeptides may be employed in
accordance with the present invention by expression of such
polypeptides in treatment modalities often referred to as "gene
therapy". Thus, for example, cells from a patient may be engineered
with a polynucleotide, such as a DNA or RNA, to encode a
polypeptide ex vivo. The engineered cells can then be provided to a
patient to be treated with the polypeptide. In this embodiment,
cells may be engineered ex vivo, for example, by the use of a
retroviral plasmid vector containing RNA encoding a polypeptide
useful for the methods of the present invention to transform said
cells. Such methods are well-known in the art and their use in the
present invention will be apparent from the teachings herein.
[0403] Further, cells may be engineered in vivo for expression of a
polypeptide in vivo by procedures known in the art. For example, a
polynucleotide useful for a method of the present invention may be
engineered for expression in a replication defective retroviral
vector or adenoviral vector or other vector (for example, poxvirus
vectors). The expression construct may then be isolated. A
packaging cell is transduced with a plasmid vector containing RNA
encoding a polypeptide useful for a method of the present
invention, such that the packaging cell now produces infectious
viral particles containing the gene of interest. These producer
cells may be administered to a patient for engineering cells in
vivo and expression of the polypeptide in vivo. These and other
methods for administering a polypeptide of the present invention
should be apparent to those skilled in the art from the teachings
of the present invention.
[0404] Retroviruses from which the retroviral plasmid vectors
hereinabove-mentioned may be derived include, but are not limited
to, Moloney Murine Leukemia Virus, Spleen Necrosis Virus, Rous
Sarcoma Virus, Harvey Sarcoma Virus, Avian Leukosis Virus, Gibbon
Ape Leukemia Virus, Human Immunodeficiency Virus, Adenovirus,
Myeloproliferative Sarcoma Virus, and Mammary Tumor Virus. In one
embodiment, the retroviral plasmid vector is derived from Moloney
Murine Leukemia Virus.
[0405] Such vectors will include one or more promoters for
expressing the polypeptide. Suitable promoters which may be
employed include, but are not limited to, the retroviral LTR; the
SV40 promoter; and the human cytomegalovirus (CMV) promoter.
Cellular promoters such as eukaryotic cellular promoters including,
but not limited to, the histone, RNA polymerase III, and
.beta.-actin promoters, can also be used. Additional viral
promoters which may be employed include, but are not limited to,
adenovirus promoters, thymidine kinase (TK) promoters, and B19
parvovirus promoters. The selection of a suitable promoter will be
apparent to those skilled in the art from the teachings contained
herein.
[0406] The nucleic acid sequence encoding the polypeptide useful
for a method of the present invention will be placed under the
control of a suitable promoter. Suitable promoters which may be
employed include, but are not limited to, adenoviral promoters,
such as the adenoviral major late promoter; or heterologous
promoters, such as the cytomegalovirus (CMV) promoter; the
respiratory syncytial virus (RSV) promoter; inducible promoters,
such as the MMT promoter, the metallothionein promoter; heat shock
promoters; the albumin promoter; the ApoAI promoter; human globin
promoters; viral thymidine kinase promoters, such as the Herpes
Simplex thymidine kinase promoter; retroviral LTRs (including the
modified retroviral LTRs herein above described); the .beta.-actin
promoter; and human growth hormone promoters. The promoter may also
be the native promoter which controls the gene encoding the
polypeptide.
[0407] The retroviral plasmid vector is employed to transduce
packaging cell lines to form producer cell lines. Examples of
packaging cells which may be transfected include, but are not
limited to, the PE501, PA317, Y-2, Y-AM, PA12, T19-14X,
VT-19-17-H2, YCRE, YCRIP, GP+E-86, GP+envAm12, and DAN cell lines
as described in Miller (1990) Human Gene Therapy, 1:5-14.
[0408] The vector may be transduced into the packaging cells
through any means known in the art. Such means include, but are not
limited to, electroporation, the use of liposomes, and CaPO.sub.4
precipitation. In one alternative, the retroviral plasmid vector
may be encapsulated into a liposome, or coupled to a lipid, and
then administered to a host.
[0409] The producer cell line will generate infectious retroviral
vector particles, which include the nucleic acid sequence(s)
encoding the polypeptides. Such retroviral vector particles may
then be employed to transduce eukaryotic cells, either in vitro or
in vivo. The transduced eukaryotic cells will express the nucleic
acid sequence(s) encoding the polypeptide. Eukaryotic cells which
may be transduced include, but are not limited to, mesenchemymal
cells, chondrocytes, embryonic stem cells, embryonic carcinoma
cells, as well as hematopoietic stem cells, hepatocytes,
fibroblasts, myoblasts, keratinocytes, endothelial cells, and
bronchial epithelial cells.
[0410] Genetic therapies in accordance with the present invention
may involve a transient (temporary) presence of the gene therapy
polynucleotide in the patient or the permanent introduction of a
polynucleotide into the patient.
[0411] Genetic therapies, like the direct administration of agents
discussed above, in accordance with the present invention may be
used alone or in conjunction with other therapeutic modalities.
[0412] Preparation and Administration of Pharmaceutical
Compositions
[0413] The amount of polysaccharide optionally with a polypeptide
to be administered may vary according to factors such as the
disease state, age, sex, and weight of the individual. Dosage
regimens may be adjusted to provide the optimum therapeutic
response. For example, a single bolus may be administered, several
divided doses may be administered over time or the dose may be
proportionally reduced or increased as indicated by the exigencies
of the therapeutic situation. It may be advantageous to formulate
parenteral compositions in dosage unit form for ease of
administration and uniformity of dosage. "Dosage unit form" as used
herein refers to physically discrete units suited as unitary
dosages for subjects to be treated; each unit containing a
predetermined quantity of active compound calculated to produce the
desired therapeutic effect in association with the required
pharmaceutical carrier.
[0414] It will be appreciated that the polysaccharide optionally
with a polypeptide may be administered in the form of a composition
comprising a pharmaceutically acceptable carrier or excipient.
[0415] As used herein "pharmaceutically acceptable carrier" or
"excipient" includes any and all solvents, dispersion media,
coatings, antibacterial and antifungal agents, isotonic and
absorption delaying agents, and the like that are physiologically
compatible. In one embodiment, the carrier is suitable for
parenteral administration. Alternatively, the carrier can be
suitable for intravenous, intraperitoneal, intramuscular,
sublingual or oral administration. Pharmaceutically acceptable
carriers include sterile aqueous solutions or dispersions and
sterile powders for the extemporaneous preparation of sterile
injectable solutions or dispersion. The use of such media and
agents for pharmaceutically active substances is well known in the
art. Except insofar as any conventional media or agent is
incompatible with the active compound, use thereof in the
pharmaceutical compositions of the invention is contemplated.
Supplementary active compounds can also be incorporated into the
compositions.
[0416] Therapeutic compositions typically should be sterile and
stable under the conditions of manufacture and storage. The
composition can be formulated as a solution, microemulsion,
liposome, or other ordered structure. The carrier can be a solvent
or dispersion medium containing, for example, water, ethanol,
polyol (for example, glycerol, propylene glycol, and liquid
polyethylene glycol, and the like), and suitable mixtures thereof.
The proper fluidity can be maintained, for example, by the use of a
coating such as lecithin, by the maintenance of the required
particle size in the case of dispersion and by the use of
surfactants. In many cases, it will be preferable to include
isotonic agents, for example, sugars, polyalcohols such as
mannitol, sorbitol, or sodium chloride in the composition.
Prolonged absorption of the injectable compositions can be brought
about by including in the composition an agent which delays
absorption, for example, monostearate salts and gelatin. Moreover,
the polysaccharide and/or polypeptide may be administered in a time
release formulation, for example in a composition which includes a
slow release polymer. The active compounds can be prepared with
carriers that will protect the compound against rapid release, such
as a controlled release formulation, including implants and
microencapsulated delivery systems. Biodegradable, biocompatible
polymers can be used, such as ethylene vinyl acetate,
polyanhydrides, polyglycolic acid, collagen, polyorthoesters,
polylactic acid and polylactic, polyglycolic copolymers (PLG). Many
methods for the preparation of such formulations are patented or
generally known to those skilled in the art.
[0417] The polysaccharide optionally with a polypeptide may be
administered in combination with an appropriate matrix, for
instance, for providing a surface for bone, cartilage, muscle,
nerve, epidermis and/or other connective tissue growth. The matrix
may be in the form of traditional matrix biomaterials. The matrix
may provide slow release of the cells, supernatant or soluble
factors.
[0418] The choice of matrix material is based on biocompatibility,
biodegradability, mechanical properties, cosmetic appearance and
interface properties. Potential matrices for the compositions may
be biodegradable and chemically defined calcium sulfate, tricalcium
phosphate, hydroxyapatite, polylactic acid and polyanhydrides.
Other potential materials are biodegradable and biologically well
defined, such as bone or dermal collagen. Further matrices are
comprised of pure proteins or extracellular matrix components.
Other potential matrices are nonbiodegradable and chemically
defined, such as sintered hydroxyapatite, bioglass, aluminates, or
other ceramics. Matrices may be comprised of combinations of any of
the above mentioned types of material, such as polylactic acid and
hydroxyapatite or collagen and tricalcium phosphate. The
bioceramics may be altered in composition, such as in
calcium-aluminate-phosphate and processing to alter pore size,
particle size, particle shape, and biodegradability.
[0419] Compositions of the invention may be prepared from one or
more polysaccharide and/or polypeptide. Additional polysaccharide
and/or polypeptide fragments or peptides can be identified by
routine experimentation in light of the present specification,
claims and figures. A method for identifying peptide fragments
having stimulatory activity is described, for example, in U.S. Pat.
No. 5,399,342.
[0420] The pharmaceutical compositions may be for human or animal
usage in human and veterinary medicine and will typically comprise
any one or more of a pharmaceutically acceptable diluent, carrier
or excipient. Acceptable carriers or diluents for therapeutic use
are well known in the pharmaceutical art, and are described for
example in Remington's Pharmaceutical Sciences Mack Publishing Co.
(A. R. Gennaro edit. 1985). The choice of pharmaceutical carrier
excipient or diluent can be selected with regard to the intended
route of administration and standard pharmaceutical practice. The
pharmaceutical compositions may comprise as, or in addition to, the
carrier, excipient or diluent, any suitable binder, lubricant,
suspending agent, coating agent, or solubilising agent.
[0421] It is well known in the art that there may be different
composition/formulation requirements dependant on the different
delivery systems.
[0422] According to the present invention non-invasive formulations
are also encompassed. For example, while the progenitor cells are
likely to be administered parerentally, eg intra-articularly, the
polysulfated polysaccharide can be administered by inhalation,
orally or intranasally, in the form of suppository or pessary,
topically in the form of a lotion, solution, cream, ointment, or
dusting powder, by use of a skin patch, orally in the form of
tablets containing excipients such as starch or lactose, or in
capsules, chewables or ovules either alone or in admixture with
excipients, or in the form of elixirs, solutions, syrups or
suspensions containing flavouring or colouring agents.
[0423] For buccal or sublingual administrations, the compositions
may be administered for example in the form of tablets or lozenges
which can be formulated in a conventional manner.
[0424] Oral formulations include such normally employed excipients
as, for example, pharmaceutical grades of mannitol, lactose,
starch, magnesium stearate, sodium saccharine, cellulose, magnesium
carbonate, and the like. These compositions take the form of
solutions, suspensions, tablets, pills, capsules, sustained release
formulations or powders and contain 10% to 95% of active
ingredient, particularly 25% to 70%. Capsules, tablets and pills
for oral administration to a patient may be provided with an
enteric coating comprising, for example, Eudragit "S", Eudragit
"L", cellulose acetate, cellulose acetate phthalate or
hydroxypropylmethyl cellulose.
[0425] Intranasal formulations are described and administration of
larthrytic collagen type II and larthrytic collagen type IX are
described for example in Lu et al (1999) Different therapeutic and
bystander effects by intranasal administration of homologous type
II and type IX collagens on the collagen-induced arthritis and
pristane-induced arthritis in rats, Clinical Immunology Vol 90 pp
119-127 (1999).
[0426] In another example, the pharmaceutical composition of the
present invention may be formulated to be delivered using a
mini-pump or by a mucosal route, for example, as a nasal spray or
aerosol for inhalation or ingestible solution.
[0427] Where the agent is to be delivered mucosally through the
gastro-intestinal mucosa, it should be able to remain stable during
transit through the gastro-intestinal tract; for example, it should
be resistant to proteolytic degradation, stable antacid, pH and
resistant to the detergent effects of bile.
[0428] In one embodiment, the polysulfated polysaccharides of the
invention are administered by a non-invasive route. In a further
embodiment, the non-invasive route comprises oral administration,
or enteral administration, nasal administration or by
inhalation.
[0429] In an alternate embodiment, compositions of the invention
can be injected parenterally for example, intravenously,
intramuscularly or subcutaneously.
[0430] For parenteral administration, the compositions may be best
used in the form of a sterile aqueous solution which may contain
other substances, for example enough salts or monosaccharides to
make the solution isotonic with blood. The preparation may also be
emulsified, or encapsulated in liposomes.
[0431] After formulation, the immuno-protective composition may be
incorporated into a sterile container which is then sealed and
stored at a low temperature, for example 4.degree. C., or it may be
freeze-dried. Lyophilisation permits long-term storage in a
stabilised form.
[0432] In one embodiment of the present invention progenitor,
particular the chondroprogenitor and even more particularly the
Stro-1.sup.bri cells and/or progeny cells thereof are administered
in the form of a composition. In one embodiment, such a composition
comprises a pharmaceutically acceptable carrier and/or
excipient.
[0433] The terms "carrier" and "excipient" refer to compositions of
matter that are conventionally used in the art to facilitate the
storage, administration, and/or the biological activity of an
active compound (see, e.g., Remington's Pharmaceutical Sciences,
16th Ed., Mac Publishing Company (1980). A carrier may also reduce
any undesirable side effects of the active compound. A suitable
carrier is, for example, stable, e.g., incapable of reacting with
other ingredients in the carrier. In one example, the carrier does
not produce significant local or systemic adverse effect in
recipients at the dosages and concentrations employed for
treatment.
[0434] Suitable carriers for this invention include those
conventionally used, e.g., water, saline, aqueous dextrose,
lactose, Ringer's solution, a buffered solution, hyaluronan and
glycols are preferred liquid carriers, particularly (when isotonic)
for solutions. Suitable pharmaceutical carriers and excipients
include starch, cellulose, glucose, lactose, sucrose, gelatin,
malt, rice, flour, chalk, silica gel, magnesium stearate, sodium
stearate, glycerol monostearate, sodium chloride, glycerol,
propylene glycol, water, ethanol, and the like.
[0435] In another example, a carrier is a media composition, e.g.,
in which a cell is grown or suspended. In a further example, such a
media composition does not induce any adverse effects in a subject
to whom it is administered.
[0436] Preferred carriers and excipients do not adversely affect
the viability of a cell.
[0437] In one example, the carrier or excipient provides a
buffering activity to maintain the cells and/or soluble factors at
a suitable pH to thereby exert a biological activity, e.g., the
carrier or excipient is phosphate buffered saline (PBS). PBS
represents an attractive carrier or excipient because it interacts
with cells and factors minimally and permits rapid release of the
cells and factors, in such a case, the composition of the invention
may be produced as a liquid for direct application to the blood
stream or into a tissue or a region surrounding or adjacent to a
tissue, e.g., by injection.
[0438] Progenitor, particular the chondroprogenitor and even more
particularly Stro-1.sup.bri cells and/or progeny cells thereof can
also be incorporated or embedded within scaffolds that are
recipient-compatible and which degrade into products that are not
harmful to the recipient. These scaffolds provide support and
protection for cells that are to be transplanted into the recipient
subjects. Natural and/or synthetic biodegradable scaffolds are
examples of such scaffolds.
[0439] A variety of different scaffolds may be used successfully in
the practice of the invention. Scaffolds include, but are not
limited to biological, degradable scaffolds. Natural biodegradable
scaffolds include collagen, fibronectin, and laminin scaffolds.
Suitable synthetic material for a cell transplantation scaffold
should be able to support extensive cell growth and cell function.
Such scaffolds may also be resorbable. Suitable scaffolds include
polyglycolic acid scaffolds, e.g., as described by Vacanti, et al.
J. Ped. Surg. 23:3-9 1988; Cima, et al. Biotechnol. Bioeng. 38:145
1991; Vacanti, et al. Plast. Reconstr. Surg. 88:753-9 1991; or
synthetic polymers such as polyanhydrides, polyorthoesters, and
polylactic acid.
[0440] In another example, the cells may be administered in a gel
scaffold (such as Gelfoam from Upjohn Company).
[0441] The cellular compositions useful for the present invention
may be administered alone or as admixtures with other cells. Cells
that may be administered in conjunction with the compositions of
the present invention include, but are not limited to, other
multipotent or pluripotent cells or stem cells, or bone marrow
cells. The cells of different types may be admixed with a
composition of the invention immediately or shortly prior to
administration, or they may be co-cultured together for a period of
time prior to administration.
[0442] In one embodiment, the composition comprises an effective
amount or a therapeutically or prophylactically effective amount of
cells. For example, the composition comprises about
1.times.10.sup.5 Stro-1.sup.bri cells/kg to about 1.times.10.sup.7
Stro-1.sup.bri cells/kg or about 1.times.10.sup.6 Stro-1.sup.bri
cells/kg to about 5.times.10.sup.6 Stro-1.sup.bri cells/kg. The
exact amount of cells to be administered is dependent upon a
variety of factors, including the age, weight, and sex of the
patient, and the extent and severity of the pancreatic dysfunction.
The same values are also applicable to the progenitor cells and
chondroprogenitor cells per se.
[0443] In some embodiments, cells are contained within a chamber
that does not permit the cells to exit into a subject's
circulation, however that permits factors secreted by the cells to
enter the circulation. In this manner soluble factors may be
administered to a subject by permitting the cells to secrete the
factors into the subject's circulation. Such a chamber may equally
be implanted at a site in a subject to increase local levels of the
soluble factors, e.g., implanted in or near a transplanted
organ.
[0444] In some embodiments of the invention, it may not be
necessary or desirable to immunosuppress a patient prior to
initiation of therapy with cellular compositions. Accordingly,
transplantation with allogeneic, or even xenogeneic, Stro-1.sup.bri
cells or progeny thereof may be tolerated in some instances.
[0445] However, in other instances it may be desirable or
appropriate to pharmacologically immunosuppress a patient prior to
initiating cell therapy. This may be accomplished through the use
of systemic or local immunosuppressive agents, or it may be
accomplished by delivering the cells in an encapsulated device. The
cells may be encapsulated in a capsule that is permeable to
nutrients and oxygen required by the cell and therapeutic factors
the cell is yet impermeable to immune humoral factors and cells.
The encapsulant may be hypoallergenic, is easily and stably
situated in a target tissue, and provides added protection to the
implanted structure. These and other means for reducing or
eliminating an immune response to the transplanted cells are known
in the art. As an alternative, the cells may be genetically
modified to reduce their immunogenicity.
[0446] Uses and Methods of Treatment
[0447] The methods, compositions, and uses of the present invention
are useful for the treatment and/or prophylaxis of diseases of the
musculoskeletal system such as rheumatoid arthritis (RA),
osteoarthritis (OA) and intervertebral disc degeneration (DD). They
can also be usefully employed in relation to cartilage regeneration
and repair.
[0448] The methods, compositions, and uses of the present invention
are also useful in that they can regulate chondrogenesis and cell
proliferation and can be used to produce, upregulate or stimulate
the production of hyaluronan (HA). These uses can be employed in
the treatment of diseases of the musculoskeletal system including
rheumatoid arthritis (RA), osteoarthritis (OA), and intervertebral
disc degeneration (DD); or treating conditions that benefit from
increased production of HA, such as for example osteoarthritis of
synovial joints, ophthalmology, prevention of post-surgical
abdominal adherences, skin treatment and repair and restoration of
the function of the extracellular matrix; or inducing cartilage
repair, restoration or matrix neogenesis.
[0449] Further uses of the present invention include producing an
extracellular matrix suitable for transplantation into a connective
tissue defect in a subject in need of such a treatment.
[0450] The methods of the present invention, can therefore be used
to treat a patient, in some embodiments a human patient, from a
number of diseases as stated above. The methods can also be used on
a prophylactic basis to prevent or minimise the onset of these
diseases.
[0451] The present invention also extends to compositions as
discussed herein for use in the treatment and/or prophylaxis of
diseases of the musculoskeletal system such as rheumatoid arthritis
(RA), osteoarthritis (OA) and intervertebral disc degeneration
(DD). They can also be usefully employed in relation to cartilage
regeneration and repair, or treating conditions that benefit from
increased production of HA, such as for example osteoarthritis of
synovial joints, ophthalmology, prevention of post-surgical
abdominal adherences, skin treatment and repair and restoration of
the function of the extracellular matrix; or inducing cartilage
repair, restoration or matrix neogenesis.
[0452] The compositions as discussed herein can also be used in
producing an extracellular matrix suitable for transplantation into
a connective tissue defect in a subject in need of such a treatment
and also for regulating chondrogenesis and cell proliferation
and/or producing, upregulating or stimulating the production of
hyaluronan (HA).
[0453] The present invention also extends to the use of
compositions as discussed herein in the manufacture of a medicament
for the treatment and/or prophylaxis of diseases of the
musculoskeletal system such as rheumatoid arthritis (RA),
osteoarthritis (OA) and intervertebral disc degeneration (DD). The
use also extends to cartilage regeneration and repair, or treating
conditions that benefit from increased production of HA, such as
for example osteoarthritis of synovial joints, ophthalmology,
prevention of post-surgical abdominal adherences, skin treatment
and repair and restoration of the function of the extracellular
matrix; or inducing cartilage repair, restoration or matrix
neogenesis.
[0454] The use of compositions as discussed herein also extends to
the manufacture of a medicament for producing an extracellular
matrix suitable for transplantation into a connective tissue defect
in a subject in need of such a treatment and for regulating
chondrogenesis and cell proliferation and/or producing,
upregulating or stimulating the production of hyaluronan (HA).
[0455] The present invention allows for the administration of the
compositions of the present invention to implant progenitor cells
into a patient which are subsequently induced to increase HA
production and/or undergo transformation into a chondrogenic
phenotype.
[0456] Examples of such an application would be to inject the
compositions of the present invention into joints of individuals
with cartilage or disc lesions or systemically for other less
accessible sites, allowing the preparation to perfuse the tissue
and cells thereby exerting its unique biological effects.
Applications could include any treating individuals who may not
have clinical defined disease (often OA or related disorders) but
have sustained a traumatic injury to joint tissues though sport or
work-related activity.
[0457] In older subjects with OA or related disorders this form of
treatment could be used instead of intra-articular HA therapy
(viscosupplementation).
[0458] It could also serve as a prophylactic method following
arthroscopic or open surgery where cartilage or meniscal
excision/debridement was necessary. It is well established that
with time such post surgical patients will generally progress to
exhibit symptomatic OA requiring medical treatment. It is not
unlikely that by diminishing cartilage degradation symptoms may
also improved because of the reduction in production of cartilage
derived auto-antigens which promote inflammation.
[0459] Compositions according to the invention that have been shown
to have activity can be further tested for safety and efficacy in
other animal models, and then proceed to clinical trials in humans,
if desired. Naturally, for veterinary applications, no clinical
trial in humans is required. Those compositions that are safe and
efficacious in animals or humans can be administered to an
appropriate subject to treat or alternatively to protect against
the diseases discussed herein. "Treatment and protection" includes
both prophylactic and therapeutic measures to prevent the onset and
appearance of diseases as discussed herein.
[0460] The treatment methods herein refers to defending against or
inhibiting a symptom, delaying the appearance of a symptom,
reducing the severity of the development of a symptom, and/or
reducing the number or type of symptoms suffered by an individual,
as compared to not administering a pharmaceutical composition
comprising a polypeptide of the invention. Accordingly, throughout
this description, it will be understood that any clinically or
statistically significant attenuation of even one symptom of a
musculoskeletal degenerative condition pursuant to the treatment
according to the present invention is within the scope of the
invention.
[0461] The following examples further illustrate aspects of the
present invention. However, they are in no way a limitation of the
teachings or disclosure of the present invention as set forth
herein.
[0462] Results and Discussion
[0463] The present invention has shown that the addition of
polysulfated polysaccharides over a wide range of concentrations to
cryogenic media such as Profreeze.RTM. and 7.5% DMSO containing
progenitor cells in both high and low numbers followed by freezing
in liquid nitrogen vapour phase and thawing at ambient temperatures
or 37.degree. C. had no detrimental effect on their viability. This
can be seen by FIGS. 1-3. Indeed, enhanced viability was seen from
these experiments, in particular FIG. 3 and also FIG. 4 which shows
that progenitor cell viability was enhanced relative to progenitor
cells frozen in cryo-preservation media not containing the
polysulfated polysaccharide.
[0464] FIG. 6 clearly shows that polysulfated polysaccharide
concentrations above 1 microgram/mL reduced apoptosis in human
progenitor cells by about 50% when these cells were incubated with
IL-4 and IFN-gamma which were known mediators of apoptosis.
[0465] It has also been shown that polysulfated polysaccharides
stimulate progenitor cell proliferation in a concentration
dependent manner. Marked stimulation of cell division, as measured
with the WST-1 mitchondral dehydrogenase cleavage assay is seen in
FIG. 4 and from incorporation of .sup.3H-Thymidine into DNA in FIG.
5 which was demonstrated over the range of 1-5 micrograms/mL in
monolayer and micromass cultures of human progenitor cells as well
as in a murine progenitor cell line in FIG. 10.
[0466] In contrast to several members of the BMP-TGF-beta super
family (eg, BMP-2, BMP-7, BMP-8) and fibroblast growth factor
family which promote differentiation of progenitor cells to
osteoblasts when cultured in osteogenic media, it was found for the
first time that polysulfated polysaccharides suppress
differentiation of progenitor cells to this cell phenotype. This
can be seen in FIG. 7 and shown downregulation of the progenitor
cell with regard to osteogenesis.
[0467] On the other hand progenitor cells cultured in adipogenic
media in the presence polysulfated polysaccharides showed
differentiated to adipocytes. Thus, polysulfated polysaccharides
act as a regulator of progenitor cell differentiation into
adipocytes. This can be seen in FIG. 8.
[0468] Under normal non-selective culture conditions incubation of
polysulfated polysaccharides with progenitor cells invariably
favoured differentiation along the chondrogenic pathway as
demonstrated by increased proteoglycan and type II collagen
synthesis. Proteoglycans and type II collagen are recognised
biosynthetic products of chondrocytes and are used as phenotypic
markers of hyaline cartilage. The chondrogenic promoting effect of
polysulfated polysaccharides was shown in the Murine MSC cell line
C3H10T1/2 in FIG. 9 and human progenitor cells in FIG. 11 when
cultured in monolayers.
[0469] Additional support was provided in pellet cultures using the
Murine ATDC5 cell line where a 25% increase of proteoglycan (PG)
synthesis relative to control culture (no polysulfated
polysaccharides) was observed at 2 micrograms/mL in FIG. 12.
[0470] Additional evidence that polysulfated polysaccharides
promoted chondrogenesis and cartilage formation was provided by
examination of gene expression by these cells after 6 days in
pellet culture, where type II collagen expression, was up-regulated
in a concentration dependent manner by polysulfated
polysaccharides. This can be seen in FIG. 13.
[0471] Interestingly, Heparin, a naturally occurring polysulfated
polysaccharide failed to significantly stimulate proteoglycan
synthesis in pellet culture over all of the concentrations
examined. This can be seen in FIG. 14. Heparin shows little
activity at the concentration of 2.5 ugrams/mL but may cause
inhibition at higher concentrations.
[0472] Using the Murine MSC line C3H10T1/2 in 7 day pellet culture
demonstrated that polysulfated polysaccharides at 10 micrograms/mL
increased proteoglycan synthesis by more than 80% of the control
values. This can be seen in FIG. 15. This finding was consistent
with the results obtained using a Murine MSC line C3H10T1/2 in
micromass cultures over 6 days which can be seen in FIG. 16. This
method of culturing progenitor cells was originally described by
Denker et al (Andrew E. Denker A E, Haas A R, Nicoll S B, Tuan R S.
Chondrogenic differentiation of murine C3H10T1/2 multipotential
progenitor cells: I. Stimulation by bone morphogenetic protein-2 in
high-density micromass cultures. Differentiation (1999) 64:67-76
1999).
[0473] Moreover, after nine days in micromass cultures a 100%
stimulation was obtained at 1 microgram/mL of polysulfated
polysaccharides also shown in FIG. 16. Human progenitor also
differentiated to chondrocytes in micromass cultures when incubated
in the presence of polysulfated polysaccharides. However in the 5
day cultures a maximum stimulation of PG synthesis of 30% was
obtained with polysulfated polysaccharides concentration of 2.5
micrograms/mL as shown in FIG. 17. The co-production of type II
collagen with PGs was confirmed in these micromass cultures using
the immuno-staining technique described by Denker et al (Andrew E.
Denker A E, Haas A R, Nicoll S B, Tuan R S. Chondrogenic
differentiation of murine C3H10T1/2 multipotential progenitor
cells: I. Stimulation by bone morphogenetic protein-2 in
high-density micromass cultures. Differentiation (1999) 64:67-76
1999).
[0474] As is evident from FIG. 18, micromass cultures of human
progenitor cells maintained in the presence of polysulfated
polysaccharides over the concentration range of 1-10 micrograms/mL
for 10 days afforded intense type II collagen staining, the maximum
levels being achieved with polysulfated polysaccharides at 5
micrograms/mL.
[0475] In similar micromass cultures undertaken with human
progenitor cells and hyaluronan (HA) a low level of .sup.35SO4
incorporation into PGs was observed in FIG. 19A. However, the
highly negatively charged Dextran Sulfate (DS) inhibited PG
synthesis over the range of 1-20 micrograms/mL (FIG. 19B). This was
a surprising result since DS has a similar molecular weight and
charge density to polysulfated polysaccharides and was therefore
expected to demonstrate similar activity on the progenitor cells.
It is believed that molecular conformation and other factors
important for effective receptor binding and protein interactions
may be playing a role.
[0476] Hyaluronan is reported to exert chondrogenic effects on
progenitor cells in alginate bead cultures (Kavalkovich K W,
Boynton R E, Murphy J M, Barry F. Chondrogenic differentiation of
human progenitor cells within an alginate layer culture system. In
vitro Cell. Dev. Biol--Animal. 38:457-466, 2002). In FIG. 20 the
effects of Pentosan Polysulfate alone and in combination with
Hyaluronan (Supartz.TM.) on human progenitor cell proliferation
using the WST-1 assay is shown for day 3 and day 5 cultures. The
results of this experiment confirmed the absence of any significant
stimulatory effect by HA alone on progenitor cell proliferation and
also demonstrate the absence of any synergist effect for the
combinations with polysulfated polysaccharides. Thus, it can be
seen that polysulfated polysaccharides are better chondrogenic
agents than HA. In addition, in contrast with NC4, HA does not
combine synergistically with polysulfated polysaccharides.
[0477] A recombinant human preparation of the non collagenous
domain of the alpha-1 chain of type IX collagen, rhNC4 was also
found to induce chondrogenesis and PG production by progenitor
cells. As is evident from FIG. 21, a concentration dependent
stimulation of PG synthesis was observed both in the absence
(maintenance media) and presence of Insulin (differentiation media)
on ATDC5 cells, maximum effects occurring at 1 microgram/mL. This
stimulatory effect of rhNC4 was also demonstrated in pellet
cultures of ATDC5 cells but in maintenance media the optimum effect
was produce at a concentration of 0.5 micrograms/mL.
[0478] The chondrogenic and mitogenic effects of rhNC4 on Murine
ADTC5 cells were observed to be enhanced when the protein was
co-cultured with polysulfated polysaccharides as can be seen in
FIGS. 23 and 24. The combination of rhNC4 and polysulfated
polysaccharides was, in contrast to HA and polysulfated
polysaccharides, synergistic as shown by a 450% stimulation of
.sup.3H-DNA synthesis in differentiation culture media at
concentrations of 1 microgram/mL of rhNC4 and 2 micrograms/mL of
polysulfated polysaccharides (FIG. 23). In terms of stimulation of
PG synthesis, 1-5 micrograms/mL rhNC4 with 5 micrograms
polysulfated polysaccharides appeared to be the most effective
combination (FIG. 24).
[0479] FIGS. 21, 33 and 23 show the outcome of experiments using
both a differentiation medium (DM) for the progenitor cells (ATDC5)
containing a growth factor (in this case insulin) and the
maintenance media (MM) which does not contain a growth factor. FIG.
21 shows the use of NC4 alone, while FIGS. 33 and 23 show the
effects of the combination of the polypeptide and the polysulfated
polysaccharide. It can be seen that the compounds of the present
invention promoted chondrogenesis in the absence of the growth
factor but also had a positive effect on the rate of chondrogenesis
in the presence of the growth factors. Therefore, the compounds of
the present invention can be used without other growth factors but
can also be used with other growth factors to promote
chondrogenesis further.
[0480] Studies of the expression of Runx 2 gene by ATDC5 cells
cultured in the presence of rhNC4 and polysulfated polysaccharides
showed a progressive down regulation of this bone marker with
increasing concentrations (FIGS. 25 and 26). By contrast one of the
genes for HA synthesis (HAS3) and the receptor for HA (CD44) were
both up regulated by these compounds (FIGS. 25 and 26). Of
particular interest was the finding of the up regulation of Smad 2
and Smad 4 by polysulfated polysaccharides alone and polysulfated
polysaccharides+rhNC4 at concentrations which were shown to
stimulate PG synthesis. Smad 4 has been reported to be a major
intracellular protein for the transactivation of the type-II
collagen promoter in progenitor cells when these cells are
activated by BMPs (Hatakeyama Y et al. Smad signaling in progenitor
and chondroprogenitor cells. J Bone Joint Surg AM. 85A Suppl 3,
13-8, 2003, Chen D, Zhao M, Munday G R, Bone morphogenetic
proteins. Growth Factors, 22: 233-41, 2004). Whilst not wishing to
be bound by theory, it is possible therefore that the
chondrogenic/proliferatatory effects of polysulfated
polysaccharides and NC4 on progenitor cells could be mediated via
the actions of BMPs, the levels of which are elevated in the
presence of these two compounds when used alone or in
combination.
[0481] Experimental Methods and Protocols
[0482] Determination of Protein Content of Samples Using the
Bicinchoninic Acid (BCA) Assay
[0483] The protein content of all samples was determined using BCA
assay (Smith P K, Krohn R I, Hermanson G T, Mallia A K, Gartner F
H, Provenzano M D, Fujimoto E K, Goeke N M, Olson B J and Klenk D
C. Anal. Biochem. 150, 76-85, 1985). Freeze dried protein samples
were directly dissolved in H2O to provide a 2.0 mg/ml solution. 20
.mu.l of each sample solution was added to a well of 96-well
plates. Just prior to assay, 50 parts of reagent 1 (0.4% NaOH; 1.7%
Na.sub.2CO.sub.3; 0.95% NaHCO.sub.3; 1.0% bicinchoninic acid; 0.16%
Na.sub.2-tartrate) was mixed with reagent 2 (4%
CuSO.sub.4.5H.sub.2O). 200 .mu.l of working reagent was added to
the sample solution. After incubation at 37.degree. C. for 60 min
the absorbance A562 was read using a Thermomax microplate reader.
Bovine serum albumin (BSA) or highly purified gelatine (Gibco) at
0-10 .mu.g/well were used to construct a standard curve. The
protein content of samples were determined from this standard
curve.
[0484] Analysis of Proteins by SDS-PAGE Electrophoresis
[0485] The method used is based on that described by Laemmli
(Laemmli UK. Clevage of structural protein during the assembly of
the head bacteriophage T4. Nature. 1970; 227:680-685). Briefly
samples were mixed 1:1 with 2.times. sample loading buffer (0.07 M
TrisHCl, 1.5% SDS, 20% glycerol, 0.2M DTT and 0.1% BPB) to achieve
the final concentrations of between 4.0-20 mg/ml. The mixture was
boiled in a water bath for 5 min. 20 .mu.l of solution were loaded
into the wells of 8-16% pre-cast Tris-glycine gel (Norvex). SeeBlue
pre-stained low molecular weight range protein markers (Norvex)
were loaded into wells on the left-hand side of the gel and
electrophoresis was performed at 125 V for 2 h. The gel was stained
in Coomassie blue R250 solution (40% ethanol, 10% acetic acid and
0.2% Coomassie R250) for 30 min and destained in a solution
containing 10% ethanol and 7.5% acetic acid for 16 h. The gel was
dried in a Bio-Rad Gelair drier.
[0486] Sulfated Glycosaminoglycan (S-GAG) Assay Using the DMMB
Dye
[0487] The sulfated glycosaminoglycan (S-GAG) concentrations in
samples were determined using a colorimetric dye binding assay
modified from that described by Farndale et al. (Farndale R W,
Buttle D J, Barrett A J. Improved quantitation and discrimination
of sulphated glycosaminoglycans by use of dimethyl methylene blue.
Biochem. et. Biophys. Acta. 1986; 883:173-177).
[0488] The assay is based on a metachromatic shift in absorption
maxima from 690 nm to 535 nm when a complex is formed between a
mixture of 1,9-dimethylmethylene blue (DMMB) and the sulfated-GAG
in the sample or in a standard solution. The dye solution was made
by adding 16 mg of 1,9-dimethylmethylene blue to 5 ml ethanol to 2
g of sodium formate and 2 ml of formic acid in a total volume of 1
liter at pH 3.5.
[0489] Chondroitin-6-sulfate (CS-C) standards (0-15 and 0-40
.mu.g/ml: 50 .mu.l) or samples (50 .mu.l) were transferred to a
microtitre plate. The dye solution (200 .mu.l) was added
immediately to each well and absorbance was measured at 540 nm,
immediately as a precipitate will form on standing. A standard
curve was plotted using the absorption of samples of known CS-C
concentration and the plate reader software. The concentration of
the S-GAG in the unknown samples were determined from the CS-C
standard curve.
[0490] Hyaluronan (HA) ELISA
[0491] Ninety six well microtiter plates (Maxisorp.RTM., Nunc) were
coated at 4.degree. C. overnight with umbilical cord HA (Sigma
Chemical Co) (100 .mu.l/well) dissolved in the coating buffer.
Uncoated areas were then blocked with 150 .mu.l/well of 1% (w/v)
BSA in phosphate buffer saline (PBS) for 60 min at 25.degree. C.
After washed with PBS-Tween, 100 .mu.l of the samples to be assayed
or standard competitor (HA Healon.RTM.: range 19.53-10,000 ng/ml)
together with Biotin conjugated-HA-binding protein (1:200) were
added. After incubation for 60 min at 25.degree. C., plates were
washed and then a peroxidase-mouse monoclonal anti-biotin
(Invitrogen) (100 .mu.l/well; 1:4,000) was added and the mixture
incubated for 60 min at 25.degree. C. The plates were washed again
and then a peroxidase substrate (Invitrogen) (100 .mu.l/well) was
added and incubated at 37.degree. C. for 10-20 minutes to allow the
color to develop. The reaction was stopped by addition of 50 .mu.l
of 4 M H2SO4. The absorbance ratio at 492/690 nm was measured using
the Titertek Multiskan M340 multiplate reader.
[0492] Semi-Quantitative RT-PCR mRNA
[0493] Total RNA was isolated from Progenitor cells according to
the manufacturer's instructions for the Aurum total RNA mini kit
(Bio-Rad, USA). The RNA was reverse transcribed with RevertAid.TM.
H Minus First Stand cDNA Synthesis Kit (Fermentas, USA). Table2 1
and 2 show the primer sequences and condition used for PCR. PCR
products were transferred to an agarose gel, and visualized by
ethidium bromide staining, and integrated densities calculated
using Scion image analysis software, normalized to the
house-keeping gene Glyceraldehydes-3-phosphate dehydrogenase
(GAPDH) to permit semi-quantitative comparisons in mRNA levels. (L.
Marchuk, P. Sciore, C. Reno, C. B. Frank, D. A. Hart. Postmortem
stability of total RNA isolated from rabbit ligament, tendon and
cartilage, Biochim Biophys Acta. 1379 (1998) 171-177. R. Boykiw, P.
Sciore, C. Reno, L. Marchuk, C. B. Frank, D. A. Hart. Altered
levels of extracellular matrix molecule mRNA in healing rabbit
ligaments, Matrix Biol. 17 (1998) 371-378.)
TABLE-US-00004 TABLE 1 Primers for Murine Reverse-Transcript PCR
Gene Product (Murine) Primer Sequence Tm Cycles Size Protocol GADPH
F: 5'CAC CAT GGA GAA GGC CGG GG 3' 55 28 418 RT130308 R: 5'GAC GGA
CAC ATT GGG GGT AT 3' SOX-9 F: 5'CTG AAG GGC TAC GAC TGG AC 3' 58
28 406 RT040308 R: 5'GAG GAG GAA TGT GGG GAG TC 3' Aggrecan F:
5'AGG AGG TGG TAC TGC TGG TG 3' 55 28 448 RT130308 R: 5'TCT CAC TCC
AGG GAA CTC GT 3' Type II F: 5'AGT CAA GGG AGA TCG TGG TG 3' 58 28
598 RT040308 Collagen R: 5'CGT CGT GCT GTC TCA AGG TA 3' ALPH F:
5'GCC CTC TCC AAG ACA TAT A 3' 55 28 372 RT130308 R: 5'CCA TGA TCA
CGT CGA TAT CC 3'
TABLE-US-00005 TABLE 2 Primers used for semi-quantitative RT-PCR
Product size Annealing (base Gene (HUMAN) temp (.degree. C.) pairs)
Sequences (5' to 3') Aggrecan 65 110 Forward: ACTTCCGCTGGTCAGATGGA
Reverse: TCTCGTGCCAGATCATCACC Collagen II 65 106 Forward:
CAACACTGCCAACGTCCAGAT Reverse: CTGCTTCGTCCAGATAGGCAAT SOX9 68 101
Forward: ACACACAGCTCACTCGACCTTG Reverse: GGAATTCTGGTTGGTCCTCTCTT
hsp 70 60 590 Forward:TTTGACAACAGGCTGGTGAACC
Reverse:GTGAAGGATCTGCGTCTGCTTGG HAS 1 65 348
Forward:CGGCCTGTTCCCCTTCTTCGTG Reverse: TCGTGTGCTACGCTGCGGACCA HAS2
51 358 Forward:CACAGCTGCTTATATTGTTG Reverse: AGTGGCTGATTTGTCTCTGC
HAS3 55 317 Forward:CAGCCTCCTCCAGCAGTTCC Reverse:
TAACCGTGGCAATGAGGAAG HYAL1 51 208 Forward: AGCTGGGAAAATACAAGAACC
Reward: TGAGCTGGATGGAGAAACTGG HYAL2 55 448 Forward:
GAGTTCGCAGCACAGCAGTTC Reward: CACCCCAGAGGATGACACCAG HYAL3 65 500
Forward: CCGCCTCCAGTGCCCTCTTCC Reward: AGCCCAGCCCCAGTAACAGTG MMP-1
68 84 Forward: CTGTTCAGGGACAGAATGTGCT Reverse:
TCGATATGCTTCACAGTTCTAGGG MMP-2 56 ~100 Forward: TCAAGTTCCCCGGCGAT
Reverse: TGTTCAGGTATTGCACTGCCA MMP-3 65 138 Forward:
TTTTGGCCATCTCTTCCTTCA Reverse: TGTGGATGCCTCTTGGGTATC MMP-9 56 ~100
Forward: TGAGAACCAATCTCACCGACAG Reverse: TGCCACCCGAGTGTAACCAT
MMP-13 65 96 Forward: TCCTCTTCTTGAGCTGGACTCATT Reverse:
CGCTCTGCAAACTGGAGGTC Human- 60 340 Forward:
CAGTACGTTTGGCAATGGAGACTGC iNOS Reverse: GGTCACATTGGAGGTGTAGAGCTTG
.quadrature.5-Integrin 55 324 Forward: CATTTCCGAGTCTGGGCCAA
Reverse: TGGAGGCTTGAGCTGAGCTT .quadrature.1-Integrin 55 452
Forward: TGTTCAGTGCAGAGCCTTCA Reverse: CTTCATACTTCGGATTGACC
Fibronectin 56 143 Forward: CAT TCA CTG ATG TGG ATG TC Extra domain
A Reverse: CAG TGT CTT CTT CAC CAT CA Fibronectin 56 129 Forward:
CCG CCA TTA ATG AGA GTG AT Extra domain B Reverse: AGT TAG TTG CGG
CAG GAG AAG Total- 60 184 Forward: GAT AAA TCA ACA GTG GGA GC
fibronectin Reverse: CCC AGA TCA TGG AGT CTT TA CD44 56 602
Forward: GATCCACCCCAATTCCATCTGTGC Reverse:
AACCGCGAGAATCAAAGCCAAGGCC ADAMTS1 60.4 ~100 Forward:
GAACAGGTGCAAGCTCATCTG Reverse: TCTACAACCTTGGGCTGCAAA ADAMTS4 56
~100 Forward: CAAGGTCCCATGTGCAACGT Reverse: CATATGCCACCACCAGTGTCT
ADAMTS5 60.4 ~100 Forward: TGTCCTGCCAGCGGATGT Reward:
ACGGAATTACTGTACGGCCTACA GAPDH 53 370 Forward: TGGTATCGTGGAAGGACTCAT
Reward: GTGGGTGTCGCTGTTGAAGTC
[0494] Separation of Peptacan Proteins/Polypeptides Using Dowex
MAC3 Cation Exchange Resin
[0495] The Dowex MAC3 resin (100 grams) (Sigma Chemical Co) was
regenerated as the hydrogen form over 24 hours using 4% HCl. By
means of a sinter-glass filter the resin was thoroughly washed
(3.times.2 L H2O) then equilibrated with 0.1 M calcium acetate
adjusted to pH 4.5. The Peptacan (10 grams) was dissolved in 0.1M
calcium acetate, pH 4.5 at a concentration of 5 mg/ml then mixed
with the resin and gently agitated for 1 hr. The solution
containing the non-bound S-GAGs and proteins was separated from the
resin by filtration and the resin washed with loading buffer
(10.times. resin volume) until no S-GAGs could be detected using
the Farndale et al assay. The resin was further washed several
time, with Milli-Q water and then equilibrated with 0.2M Na2HPO4.
The proteins bound to the resin were released by a solution of 0.2M
Na2HPO4 adjusted to pH 10.5 with NaOH. The resin was again
separated by filtration through a sinter-glass Buchner funnel, the
filtrate was collected and diafiltrated using a 1 KDa TFF membrane
(Millipore Australia Pty Ltd, Sydney, Australia) then freeze
dried.
[0496] Separation of Peptacan Proteins/Polypeptides Using the
Cetylpyridinium Chloride (CPC) Precipitation Method
[0497] Cetyl pyridinium chloride (CPC) is a water soluble
surfactant which forms strong water insoluble complexes between its
positively charged pyridinium ion and the negatively charged
sulfate groups present on the sulfated glycosaminoglycan (S-GAG)
components of Peptacans.
[0498] These water insoluble CPC-S-GAG complexes have been
extensively used over the last 40 years by many investigators to
isolate and purify S-GAGs from extracts of biological tissues or
fluids. However, we reasoned that this principle could also be used
to isolate the proteins/polypeptides present in the Peptacans,
since after precipitation and removal of the CPC-S-GAG complexes
the Peptacan proteins would be left in the filtration liquors. The
procedure used for the CPC-S-GAG precipitation step was based on
the method described by Oegema and Thompson (Oegema T R and
Thompson R C. Characterisation of a hyaluronic acid-dermatan
sulfate proteoglycan complex from dediffertiated human chondrocyte
cultures. J Biol Chem. 256:1015-1022; 1981) but modified by using
2M calcium chloride to dissociate the GAG-CPC complex and
precipitating the S-GAGs from aqueous solution with 4.times. the
aqueous volume of ethanol. The aqueous solution containing the
Peptacan proteins/polypeptides, after removal of the CPC-S-GAG
complex was extensively diafiltration using a 1000 Da cut-off
ultrafiltration membrane (YC10) or a tangental flow ultrafiltration
(TFF) cartridge of similar MW cut-off (Millipore Australia Pty Ltd,
Sydney, Australia). However, in the final stages of diafiltration
the dialysing solution was replaced by 0.001 M acetic acid to avoid
precipitation of the proteins. The diafiltrated solutions were
freeze-dried to afford the protein/polypeptides as a white
powder.
[0499] Preparation of rhNC4 Using a Bacterial System.
[0500] The gene of NC4 of human collagen IX without the 23 signal
peptide was constructed on the pGAT-2 bacterial expression vector
in-frame with the sequences for the GST fusion tag based on a
previously described method (Pihlajama T, et al. Characterization
of Recombinant Amino-terminal NC4 Domain of Human Collagen IX:
Interaction with glycosaminoglycans and cartilage oligomeric matrix
protein. J. Biol. Chem. 2004; 279: 24265-24273). The recombinant
human NC4 (rhNC4) construct was transferred into a Escherichia coli
BL21 (DE3) cell line. The fusion protein was expressed in shaker
flasks by inoculating (1:100) the cell line into the desired final
volume of LB medium supplemented with 100 microg/ml ampicillin. The
cells were grown at 37.degree. C. until absorbance at 600 nm
reached the value 0.6. The expression was induced by addition of
isopropyl-beta-D-thiogalactopyranoside (IPTG) to afford a final
concentration of 0.5 mM. The incubation was continued at 37.degree.
C. for 4-6 hrs or 16 hrs. Following centrifugation, the cell
pellets were washed by 1.times. PBS for three times and resuspended
with homogenisation buffer [0.3 M NaCl, 0.2% IGEPAL CA-630 (Sigma,
Sydney, Australia), 0.05 M sodium phosphate buffer (pH 7), 0.25
mg/ml lysozyme], then stored frozen and later homogenized on ice by
sonication. Insoluble material was removed by centrifugation at
17,000 g for 40 min at 4.degree. C. The fusion protein was
precipitated from the supernatant by adding ammonium sulphate to
30% saturation. The precipitate was collected by centrifugation at
23,000 g for 30 min at 4.degree. C. and dissolved in 1.times. PBS
(with 1% IGEPAL-CA 630). The solution was clarified by
centrifugation at 23,000 g for 30 min at 4.degree. C., and applied
to a column of glutathione-Sepharose 4 FF (Amersham Biosciences,
Sydney, Australia) at 4.degree. C. with the flow-rate of 250
.mu.l/min. In order to remove the endotoxin, 50 column volumes (CV)
of 1.times. PBS (containing 0.1% Triton X-114) was applied to
remove the unbound material and followed by washing with 20 CV of
1.times. PBS (sterile) (Reichelt P, Schwarz C and Donzeau M. Single
step protocol to purify recombinant proteins with low endotoxin
contents. Protein Expression and Purification 46: 483-488, 2006).
After equilibrated with 10 CV of the factor Xa cleavage buffer
(sterile), the recombinant NC4 (rNC4) was cleaved off from the
fused GST by overnight digestion with Factor Xa protease (Amersham
Biosciences or Promega) at room temperature. The rhNC4 solution
migrated through the column of glutathione-Sepharose with the
elution of Benzamidine Sepharose 4 FF binding buffer (50 mM
Tris-HCl, 100 mM NaCl, pH 7.4), and was subjected to further
purification using a Benzamidine Sepharose 4 FF column (Amersham
Biosciences). The flow-through rhNC4 was concentrated and desalted
by washing with dH.sub.2O in a 5K cut-off concentrator (Agilent
Technologies). Final purification was achieved by size exclusion
chromatography using a Superdex S-200 column. The size and purity
of the product was determined by SDS-PAGE analysis and western
blotting. The concentration of purified rhNC4 was determined using
the Bradford (Sigma, Sydney, Australia) or the BCA protein
assays.
[0501] Expression of Human NC4 in Yeast K. Lactis
[0502] (i) Isolation of the Collagen .alpha.1 (IX) NC4 Domain
Gene
[0503] The gene of NC4 of human collagen IX (GenBank accession
number NM.sub.--001851) without the 23 signal peptide was obtained
by reverse-transcription PCR with RNA extracted from human
chondrocytes from articular cartilage. Human chondrocytes were
seeded in alpha-MEM medium supplemented with 10% FCS. When the
cells were confluent, they were trypsinized and collected as a cell
pellet by centrifugation. Total RNA was extracted from the cell
pellet with RNeasy.RTM. Mini Kit (QiaGen Pty Ltd, Melbourne,
Australia). Reverse transcription PCR was performed with
SuperScript.TM. One-Step RT-PCR with Platinum Taq (Invitrogen,
Melbourne, Australia) according to manufacturer's instructions. The
upstream and downstream primers were KL-NC451 and KL-NC431 (Table
1), respectively. cDNA synthesis was undertaken using 1 cycle of
55.degree. C. for 30 min followed by 2 min, 94.degree. C.
pre-denaturation, and 40 cycles of PCR amplification (Denature:
94.degree. C. for 30 sec; Anneal: 55.degree. C. for 30 sec; Extend:
72.degree. C. for 1 min). The RT-PCR products were separated by
0.8% agarose gel and purified with SNAP.TM. Gel Purification
(Invitrogen, Melbourne, Australia).
[0504] (ii) Construction of the Vector for Expressing the Collagen
.alpha.1 (IX) NC4 Domain in Yeast
[0505] The K. lactis expression system (New England Biolab, USA)
was applied to generate a DNA construct for expression of the NC4
domain of the human .alpha.1 (IX) collagen (hNC4) in yeast
Kluyveromyces lactis. A group of oligonucleotide primers (Table 1)
were designed to amplify a fragment of amino acids 24-268 of the
full-length hNC4 (NCBI accession number NP.sub.--001842), which
omitted the 23-amino acid signal peptide. Table 1. Primers used for
construction of pKLAC1-NC4 expression vectors
TABLE-US-00006 TABLE 1 Primers used for construction of pKLAC1-NC4
expression vectors Name Primers KL-NC451
5'-ACTCTCGAGAAAAGAGCTGTCAAGCGTCGC-3' KL-NC431
5'-GTCAGATCTTTATCTCTCGTCGGTGGTCTG-3' KL-NC454
5'-ACTCTCGAGAAAAGAGCTGTTAAGCGTAGACCA AGATTCC-3' KL-NC433
5'-GTCAGATCTTCATTATCTCTCGTCGGTAGTCTG
GCTTGGAGTAATTCTGGCTGGCAGCTCATGGCAAGT TTCTCTCCTAGGTCTCAGTGG-3'
KL-NC438 5'-CTGAGATCTACCAGGTGGACCTCTTCCATCGGT AGTTTGAC-3' GAT2-
5'-CTGAGATCTGGTGCTGGTGCTATGACTAAGTTA GST53 CCTATACTAGGTTATTGG-3'
GAT2- 5'-ACTGTCGACTTAGTCATTAATGATCAGATTTTG GST33
GAGGATGATCTCCACC-3'
[0506] The 5'-primer KL-NC451 contained an engineered Xho I
cleavage site, and the 3'-primer KL-NC431 contained an engineered
Bgl II cleavage site. With these two primers, the hNC4 fragment
without the signal peptide was amplified by reverse transcription
PCR.
[0507] The 5'-primer KL-NC454 and the 3'-primer KL-NC433 contained
engineered Xho I and Bgl II cleavage sites, respectively. Different
from primer KL-NC451 and primer KL-NC431, KL-NC454 and KL-NC433
provided a number of gene mutations that changed the hNC4 gene
according to yeast K. lactis preferred codons but preserved the
hNC4 protein sequence unchanged.
[0508] The PCR products of hNC4 were digested by restriction
enzymes and ligated to the pKLAC1 expression vector (FIG. 1) at the
multiple cloning sites Xho I and Bgl II. The positive inserted
recombinants were sequenced to confirm that the NC4 gene insert was
correct. The correct recombinants were digested by restriction
enzyme Sac II and transformed to competent K. Lactis GG799 cells.
Yeast carbon base (YCB) medium containing 5 mM acetamide as a
source of nitrogen was used as a selective medium. Only after the
Sac II fragments of the recombinants with the target NC4 genes and
amdS gene (amdS gene present in pKLAC1) have been integrated to the
yeast chromosome DNA did the cells survive in this selective YCB
medium.
[0509] The 5'-primer GAT2-GST53 and the 3'-primer GAT2-GST33 were
designed to obtain a glutathione-S-transferase (GST) gene from the
bacterial vector pGAT-2 with some mutations for expression in yeast
K. lactis. This GST gene, which had three STOP translation codons
at the 3'-terminal, was constructed in the vector pKLAC1 multiple
cloning sites Bgl II and Sal I to form pKLAC1-GST.
[0510] The 5'-primer KL-NC454 and the 3'-primer KL-NC438 were
designed for a recombinant hNC4 that had a mutation converting the
Glu.sup.267 to Gly. This mutation provided a thrombin cleavage site
at the C-terminal of hNC4. The recombinant hNC4 was ligated to the
vector pKLAC1-GST at cloning sites Xho I and Bgl II, so that an
N-terminal GST fusion protein was obtained. After DNA sequence
confirmation, the recombinant with NC4-GST fusion protein gene was
digested with Sac II and inserted to the chromosome DNA of yeast K.
lactis GG799 cell, then screened by YCB selective medium for the
survival colonies with integrated NC4 and amdS genes.
[0511] (iii) Expression of the Collagen .alpha.1 (IX) NC4 Domain in
Yeast K. Lactis GG799 Cells
[0512] Cells from each colony that contains an integrated
expression hNC4 were harvest from an area approximately 2 mm.sup.2
by scraping with a sterile toothpick or pipette tip and resuspend
them in 2 ml of YPGal medium (10 g Yeast Extract, 20 g Bacto.TM.
Peptone, 2% Galactose) in a sterile culture tube. The cultures were
incubated with shaking (.about.250 r.p.m.) at 30.degree. C. for a
minimum of 2 days growth. Analysis of culture supernatant was
performed each day to determine the optimum growth time to achieve
maximum secretion of NC4. Larger cultures (e.g., .gtoreq.1 L) for
protein purification were inoculated 1:100 with a starter culture
grown overnight at 30.degree. C. Samples (1 ml of each culture)
were centrifuged for 1 minute at 10,000 g to pellet the cells. The
culture supernatant were transferred to a fresh microcentrifuge
tube and stored on ice. Thirty .mu.l of the unconcentrated culture
supernatant was applied to SDS-PAGE (NuPAGE 4-12% Tris-Bis Gel, MES
buffer, Invitrogen) followed by Coomassie staining (Colloidal Blue
Stain Kit, Invitrogen) and/or Western blotting.
[0513] (iv) Partial Purification of rhNC4 Protein Expressed from
Yeast K. Lactis GG799
[0514] Three-day cultures with volumes>1 L which were to used
for protein purification were filtered with Celite-512 to remove
the cells and debris. The clear aqueous filtrates were diafiltrated
and concentrated by application to a 10 KDa cut-off Tangential Flow
Filtration (TFF) membrane (Millipore Ltd, Sydney, Australia).
Following 2.times.5 volumes of 50 mM sodium phosphate buffer
(pH7.4) diafiltration, the culture medium solution was concentrated
to 1-2 L and stored at 4.degree. C. overnight or immediately
proceeded by (NH.sub.4).sub.2SO.sub.4 precipitation. Solid
(NH.sub.4).sub.2SO.sub.4 was added to the culture medium solution
to 80% saturation (0.degree. C.). The precipitate was collected by
centrifuge at 14,000 g, 30 min, 4.degree. C., and dissolved in 50
mM sodium phosphate buffer (pH7.4). The protein concentration of
purified hNC4 was determined using the Bradford or BCA (Sigma,
Sydney, Australia) assays. Additional purification of this material
was undertaken using the same methods as described herein for the
rhNC4 prepared from E. coli.
[0515] Cryopreservation of Progenitor Cells in the Presence of
Various Concentrations of Pentosan Polysulfate (PPS)
[0516] Cells were harvested and resuspended in cold serum free
culture medium at 5.0 to 20.0.times.10.sup.6 cells/ml. An equal
volume of chilled complete Profreeze.RTM.-CDM medium was added to
the chilled cell suspension containing 0, 10, 20, 50 and 100
micrograms/mL of PPS. The resulting final DMSO concentration was
7.5%, PPS concentration was 0, 5, 10, 25 and 50 micrograms/mL and
the final cell concentration was approximately 2.5 to
10.times.10.sup.6 cells/ml. The cell mixture was aliquoted into
cryopreservation ampoules (Nunc, Intermed, Denmark) and
cryopreserved in a C156 Freezing Container (Thermo Scientific,
Melbourne, 21 Australia) at -80.degree. C. for a -1.degree.
C./minute controlled cooling rate. The ampoules were then
transferred to liquid nitrogen storage (-196.degree. C.).
[0517] Thawing of Cryopreserved Samples
[0518] Cryopreserved cells were rapidly thawed for a minute in a
37.degree. C. water bath and transferred to a 10 mL polypropylene
tube. Approximately 3 mL of appropriate media was added dropwise to
the cells with constant mixing, and made up to a final volume of 10
mL. Cells were pelleted by centrifugation at 400.times.g, 4.degree.
C. for 5 minutes and the supernatant aspirated. To ensure removal
of residual DMSO, cells were washed in medium and centrifuged as
above. Cells were resuspended in final volume of 10 mL and seeded
in a 75 cm.sup.2 flask prior to incubation in a humidified
incubator at 37.degree. C. in the presence of 5% CO2.
[0519] Enumeration of Cells After Cryopreservation in the Presence
of Various Concentrations of Pentosan Polysulfate (PPS).
[0520] Aliquots of single-cell suspensions obtained after thawing
progenitor cells from the PPS containing cryopreserved vials were
diluted in an equal volume of 0.4% (w/v) trypan blue in phosphate
buffered saline (PBS). The cell counts were determined using a
haemocytometer (Neubauer Improved, Assistant, Germany) and a light
microscope (Olympus CKX41, Japan).
[0521] The results of this experiment is shown in FIG. 1. In
general, it can be seen that the addition of PPS did not have an
adverse effect on the cryopreservation of the progenitor cells.
[0522] With the exception of 30 minutes, the use of 50 .mu.g/ml PPS
enhanced the viability of the progenitor cells at all time points.
The use of 25 .mu.g/ml PPS either enhanced the viability or did not
adversely affect the viability of the progenitor cells at all time
points instead of 30 minutes. The use of 10 .mu.g/ml PPS had a
beneficial effect at time point 0 and then at 60 and 90 minutes.
The use of 5 .mu.g/ml PPS had a beneficial effect on viability at
60 minutes.
[0523] Overall, it can be seen that in general, the addition of PPS
did not have an adverse effect and may enhance the cryopreservation
of progenitor cells. The slight differences in values may be
attributable to the method used to count the cells. Because the
progenitor cells tend to clump, this may lead to errors which would
account for the apparent lower values with 5 micrograms PPS where
clumping was common.
[0524] Concentration Determined Effects of Pentosan Polysulfate
(PPS) on the Viability of Progenitor Cells Following
Cryopreservation and Thawing Using the MTT Assay
[0525] Murine Progenitor cells (cell lines C3H10T1/2 or ATDC5)
purchased from RIKEN Cell Bank (Tsukuba, Japan) or human
immunoselected Stro-1+ progenitor cells (Mesoblast Ltd, Melbourne,
Australia) were seeded at a various cell densities over the range
of 1.68.times.10.sup.5-1.0.times.10.sup.6 cells into 2 mL
screw-capped centrifuge tubes containing in DMEM+10% FBS. In
separate tubes a stock solution containing 2.times. the required
concentrations of PPS dissolved in DMEM+20% FBS and 15% DMSO were
prepared. These stock solutions were added to the cell cultures
such that the final concentration of PPS was half that of the stock
concentration and of FBS was 10% and DMSO was 7.7%. Over several
independent experiments the final concentrations of PPS in the
final solutions ranged from 0.0-100 ug/ml (see figures for
details). All concentrations of PPS used were examined in
triplicated. Cells and the cryopreservation solutions containing
the PPS were mixed gently for 5 mins and stored in liquid nitrogen.
After 3 days, the tubes were removed from liquid nitrogen and
thawed in 37.degree. C. water bath and allowed to stand at ambient
temperature for about 15 min. The cells were centrifuged down at
200 g for 5 min and the supernatant discarded. The cells were
washed with 900 ul of DMEM without phenol red, and then centrifuged
down at 200 g for 5 min. The cells were resuspended in 500 ul of 1
mg/ml MTT solution in DMEM and incubated in 37.degree. C. for 3
hours then centrifuged at 6000 g for 5 min. 300 ul of DMSO was
added to each tube to dissolved the dye crystals. 90 ul.times.3
from each tube were transferred to a 96-well plate and the
absorbance at 540 nm determined.
[0526] FIG. 2 shows a bar graph showing the viability of different
numbers of murine ATDC5 progenitor cells suspended in cryogenic
media containing 7.5% DMSO and various concentrations of Pentosan
Polysulfate (PPS) after being subjected to freeze-thawing cycle.
Cell viability was determined using the MTT assay.
[0527] FIG. 2 shows that the viability of the progenitor cells were
enhanced by the presence of PPS at all concentrations. At 100
.mu.g/ml PPS the viability was enhanced at cell counts of 0.25
million, 0.5 million and at 1.0 million cells. The same is seen
with 250 .mu.g/ml PPS. For 500 .mu.g/ml PPS, enhancement is seen
for 0.25 million and 0.5 million cells. For 1 million cells, a
concentration of 500 .mu.g/ml PPS did not appear to enhance
viability but was not detrimental to viability.
[0528] By extrapolation of these data it is may be assumed that a
dosage of 100 million of chondroprogenitor cells together with
25-50 mg PPS when subjected to a freeze-thawing cycle in an
appropriate cryoprotective medium would maintain the viability of
the cells to a level for acceptable administration to a patient in
need of such therapy.
[0529] FIG. 3 shows the effects of different concentrations of
Sodium Pentosan Polysulfate (PPS) on human progenitor cell
viability following cryopreservation at -180.degree. C. and thawing
as determined using the MTT assay. Data
shown=Means.+-.SD*=p<0.05 relative to control values.
[0530] When cryopreserving 168,000 cells, the presence of PPS
improved the viability of the cells, particularly at 1 and 2.5
.mu.g/ml PPS. With 350,000 cells, it can be seen that in general,
viability of the progenitor cells is not adversely affected by the
presence of PPS. In some cases, viability of the cells is enhanced
after thawing.
[0531] By extrapolation of these data it is may be assumed that a
dosage of 100 million human progenitor cells together with 30 mg
PPS when subjected to a freeze-thawing cycle in an appropriate
cryoprotective medium would maintain the viability of the cells to
a level for acceptable administration to a patient in need of such
therapy.
[0532] Effects of Pentosan Polysulfate (PPS) on Human Progenitor
Cells Apoptosis Induced by the Addition of a Combination of IL-4
IFN-Gamma as Determined by Flow Cytometry.
[0533] Human progenitor cells were plated in serum-free media
supplemented with PPS at concentrations of 0, 1, 2, 5 and 10
micrograms/mL. Progenitor cell apoptosis was induced by the
addition of a combination of 30 ng/ml IL-4 30,000 U/ml IFN gamma.
Following 5 days culture, cells were harvested by trypsinisation
and viabilities assessed by Annexin V staining as previously
described (Kortesidis A, A Zannettino, S Isenmann, S Shi, T Lapidot
and S Gronthos. (2005). Stromal-derived factor-1 promotes the
growth, survival, and development of human bone marrow stromal stem
cells. Blood 105:3793-3801).
[0534] The results for this experiment is shown in FIG. 6. It can
be seen that cell apoptosis is reduced for all concentrations of
PPS with the best results seen for 10 .mu.g/ml. These results
indicate that the addition of PPS into the cryopreservation medium
will reduce apoptosis on thawing.
[0535] The experiment was undertaken in a 96 well plate containing
50,000 progenitor cells/well. Without wishing to be bound by theory
it is believed that apoptosis and activation of the stress protein
cascade is a recognised sequence of cell freeze-thawing and
therefore the ability of PPS to significantly reduce this process
must be of benefit to the use of these cells following
cryopreservation and thawing as required in most cell based medical
procedures.
[0536] Effects of Sodium Pentosan Polysulfate (PPS) Alone or in
Combination with rhNC4 on the Biosynthesis of Proteoglycans
(Measured as .sup.35S-GAGs) by Progenitor Cells Grown in Monolayer
Cultures
[0537] Murine Progenitor cells (cell lines C3H10T1/2 or ATDC5)
purchased from RIKEN Cell Bank (Tsukuba, Japan) or human
immunoselected Stro-1+ Progenitor cells (Mesoblast Ltd, Melbourne,
Australia) were seeded into 50 mL plastic culture flasks containing
1:1 high glucose DMEM/Ham's F-12 medium (Invitrogen) supplemented
with 10% FBS (Sigma) and incubated at 37.degree. C., in 5%
CO.sub.2. After confluence was reached, progenitor cells were
released by trypsinization and harvested by centrifugation. Cells
were inoculated to 96-well or 24-well plates at a density of
3.times.10.sup.4 cells or 2.times.10.sup.5 cells per well. After
48-hour incubation at 37.degree. C., 5% CO.sub.2 confluent
monolayers were normally established. The medium was then changed
to defined medium, which contained different concentrations of PPS
with and without rhNC4 and 5 .mu.Ci/ml of .sup.35S-H.sub.2SO.sub.4
(PerkinElmer, USA). The experiments were generally terminated after
48 hours incubation when proteoglycan biosynthesis was determined
by measuring the incorporation of .sup.35SO.sub.4 into the
glycosaminoglycans (.sup.35S-GAGs) as described below.
[0538] (A) 96-well plates: Cultures were subjected to proteolytic
digestion with papain to release glycosaminoglycans. The papain
stock solution used contained 2.5 mg/ml papain (Sigma), 7.9 mg/ml
cysteine-HCl (Sigma) in papain digest buffer (0.1M NaAc, 5 mM EDTA,
pH6.0). 50 .mu.l of papain stock solution was added to each well.
The plate was sealed using plastic sheeting and incubated at
65.degree. C. for 2 hours. On termination, aliquots of 50 .mu.l
digested solution-per well were collected for DNA fluorometric
assay using Hoechst 33258 Dye and the method described by Kim et al
(Kim Y J, Sah R L Y, Doong J-Y H, Grodzinsky A J, Fluorometric
assay of DNA in cartilage explants using Hoechst 3358. Anal Chem.
1988; 174: 168-176).
[0539] The .sup.35SO.sub.4-GAGs in the remained solution (200 ul)
were precipitated with Cetyl Pyridinium Chloride (CPC) (Sigma).
Briefly, to each well was added 20 .mu.l of 5% CPC, followed by 10
.mu.l of 1 mg/ml Chondroitin sulfate A (CSA, Sigma) as a
co-precipitant. The .sup.35S-GAG-CPC complexes were collected by
vacuum filtration using a cell harvester (Skatron 7021). The
filters were then air-dried and discs punched into scintillation
vials. Following addition of 3 ml scintillation liquid and
vortexing the radioactivity of the .sup.35S-GAG-CPC complexes were
in the samples were measured by scintillation counting
(PerkinElmer, USA) and recorded as DPM/sample. The data then was
then normalised for DNA and expressed as .sup.35-S-GAGs/.mu.g
DNA.
[0540] (B) 24-well plates: After 48 hours incubation in the defined
media, the media per well (containing soluble .sup.35S-labelled
proteoglycans) was separated from the cells and transferred to a
2.0 ml microfuge tube. The monolayer cells remaining in the wells
were detached by trypsinization, and then separated from the
supernatant (containing matrix proteoglycans) by centrifugation at
350 g for 5 min. The supernatant was collected and combined with
the medium. 200 .mu.l of the medium and supernatant mixture was
transferred to a 96-well plate and subjected to papain digest to
release glycosaminoglycans. After papain digestion, 20 .mu.l of 5%
CPC was added to each well to precipitate the 35S-GAG followed by
10 .mu.l of 1 mg/ml CSA as a carrier. The 35S-GAG-CPC complexes
collected through the fibre filter and the radioactivity of 35S-GAG
was measured using the liquid scintillation analyser as describe
above. The cells were extracted with the RNA reagent and aliquots
used to determine gene expression and/or the DNA content was
measured by the fluorometric assay and the results expressed as
.sup.35-S-GAGs/.mu.g DNA.
[0541] FIG. 4 shows the Effects of Pentosan Polysulfate on Human
Progenitor cell Proliferation.
[0542] Primary human progenitor cells were cultured in 24 well
plates in growth media supplemented with PPS at the indicated
concentrations. At various time intervals (day 1,3,6), the growth
media was removed and replaced with phenol red free media
containing the tetrazolium salt WST-1 for 2 hours at 37.degree.
C./5% CO.sub.2. WST-1 is cleaved by mitochondrial dehydrogenase in
viable cells to produce a formazan dye that can be detected using
an ELISA plate reader at a wavelength of 450 nm. Absorbance at 450
nm for each time point is shown for all concentrations of PPS. A
statistically significant increase in proliferation was observed on
day 6 at concentrations of PPS in excess of 1 .mu.g/ml (*p<0.01,
ANOVA). FIG. 4 shows that progenitor cell viability was enhanced
relative to progenitor cells frozen in cryo-preservation media not
containing the polysulfated polysaccharide.
[0543] FIG. 9 shows the concentration dependent effects of Sodium
Pentosan Polysulfate (PPS) on Murine Progenitor cell (C3H10T1/2)
biosynthesis of Proteoglycans (PGs) and DNA content when grown in
monolayer cultures. The data shown is Means.+-.SD.
[0544] It can be seen that at all concentrations of PPS the
biosynthesis of proteoglycans is increased. This shows that the use
of polysulfated polysaccharides can induce differentiation,
especially chondrogenesis at all concentration ranges. The best
result is seen for 5-10 .mu.l/ml, with 10 .mu.l/ml being best with
regards to PG synthesis and 5 .mu.l/ml and 10 .mu.l/ml being best
with regard to DNA content.
[0545] FIG. 10 shows a bar graph of the concentration dependent
effects of Pentosan Polysulfate (PPS) on DNA synthesis by murine
Progenitor cells (C3H10T1/2 cells) grown in monolayer cultures for
2 days as determined by the incorporation of .sup.3H-Thymidine into
macromolecular DNA.
[0546] FIG. 11 shows a bar graph of the concentration dependent
effects of Pentosan Polysulfate (PPS), on the biosynthesis of
Proteoglycans PGs) as determined by the incorporation of
radioactively labelled sulfate into the sulfated glycosaminoglycans
(.sup.35S-GAG) of PGs after 2 day monolayer cultures of human
progenitor cells. The data was expressed as .sup.35S-GAG
radioactivity as decays per minute (DPM) normalised to DNA content.
*=p<0.05; **=p<0.005; ***=p<0.0005.
[0547] FIG. 21 shows a bar graph of the concentration dependent
effects of rhNC4 (batch PBA-1202P) expressed by K. lactis, in the
absence (maintenance media, MM) and presence of insulin (10
micrograms/mL) (differentiation media, DM), on the biosynthesis of
Proteoglycans (PGs) as determined by the incorporation of
radioactively labelled sulfate into the sulfated glycosaminoglycans
(.sup.35S-GAG) of PGs after 3 day culture with Murine ATDC5
progenitor cells. The data was expressed as % change relative to
control cultures that contained no rhNC4. P<0.05 was
statistically significant relative to control cultures.
[0548] FIG. 24 shows the results for the combination of PPS and
NC4. It can be seen that the effect of PPS increases with
concentration. It can also be seen that this effect is enhanced in
the presence of increasing concentrations of NC4.
[0549] The combination of 0.5 .mu.l/ml of NC4 and 5 .mu.l PPS
showed a statistically significant increase in proteoglycan
synthesis. In addition, the combination of 1 .mu.l/ml NC4 and 2
.mu.l/ml and 5 .mu.l/ml PPS showed a statistically significant
increase in proteoglycan synthesis. Furthermore, the combination of
2 .mu.l/ml NC4 together with 1 .mu.l/ml, 2 .mu.l/ml or 5 .mu.l/ml
PPS or the combination of 5 .mu.l/ml NC4 together with 1 .mu.l/ml,
2 .mu.l/ml or 5 .mu.l/ml PPS all showed a statistically significant
increase in proteoglycan synthesis.
[0550] The use of 5 .mu.l/ml NC4 or 5 .mu.l/ml PPS showed the best
results with the combination of 5 .mu.l/ml NC4 and 5 .mu.l/ml PPS
being best.
[0551] Effects of Sodium Pentosan Polysulfate (PPS) Alone or in
Combination with rhNC4 on the Biosynthesis of Proteoglycans
(Measured as .sup.35S-GAGs) by Progenitor Cells Grown in Pellet
Culture
[0552] Murine Progenitor cells (cell lines C3H10T1/2 or ATDC5)
purchased from RIKEN Cell Bank (Tsukuba, Japan) or human
immunoselected Stro-1+ Progenitor cells (Mesoblast Ltd, Melbourne,
Australia) were seeded in 2 ml screw-capped sterile centrifuge
tubes and the total volume made-up to 1 ml with DMEM-High glucose
medium containing 10% FBS. Progenitor cells were then centrifuged
at 500 g for 10 min in a swing-out rotor at room temperature. The
screw caps were loosened and the tubes placed in an incubator at
37.degree. C., in a 5% CO.sub.2/95% air moist atmosphere. The
pellets generally formed within 24 hours. Medium was changed daily
in the first two days, then once every 2-3 days thereafter. On day
5 the medium was removed and to each tube was added 1 ml with
DMEM-High glucose medium containing 10% FBS, 5.0 .mu.Ci/ml
.sup.35S-H.sub.2SO4 and various concentrations of PPS (0, 0.1, 0.5,
1.0, 2.5, 5.0, 10.0, 20.0, .mu.g/ml) (FIG. 12-15) or rhNC4 (0, 0.1,
0.5, 1.0, 2,0 .mu.g/ml) (FIG. 22). Triplicate cultures were used
for all concentration of drugs. The screw caps were loosened and
the tubes placed in an incubator at 37.degree. C., in a 5%
CO.sub.2/95% moist air atmosphere for 3 days. On day 6, 200 .mu.l
of stock papain solution [2.5 mg/ml papain, 7.9 mg/ml L-Cystein in
papain buffer (0.1 M NaAC, 5 mM EDTA, pH6.0)] was added to each
tube. The tubes were tightly capped and incubated at 65.degree. C.
for 2 hours. After papain digestion, 4 replicates of 200 .mu.l of
papain digested solution were separately transferred to a 96-well
micro-titre plate (200 .mu.l/well). The remaining solution was used
for the DNA fluorometric assays which were undertaken in triplicate
as described above. Biosynthesis of .sup.35S-GAGs was determined as
described for the monolayer cultures and the results expressed as
.sup.35-S-GAGs/.mu.g DNA.
[0553] FIG. 22 shows a bar graph of the concentration dependent
effects of rhNC4 (batch PBA-1202P) expressed by K. lactis, in the
absence (maintenance media, MM) and presence of insulin (10
micrograms/mL) (differentiation media, DM), on the biosynthesis of
Proteoglycans PGs) in pellet cultures of ATDC5 cells. Data is shown
as the % of controls taken to be 100%.
[0554] Similar experiments were undertaken using Heparin (Sigma,
Sydney, Australia) in place of PPS. These results are seen in FIG.
14. The heparin regulates differentiation by suppressing
chondrogenesis of the progenitor cells.
[0555] Effects of Sodium Pentosan Polysulfate (PPS) Alone or in
Combination with rhNC4 on the Biosynthesis DNA (Measured as
.sup.3H-Thymidine Incorporation) by Progenitor Cells Grown in 6 Day
Pellet Cultures
[0556] Murine Progenitor cells (cell lines C3H10T1/2 or ATDC5)
purchased from RIKEN Cell Bank (Tsukuba, Japan) or human
immunoselected Stro-1+ Progenitor cells (Mesoblast Ltd, Melbourne,
Australia) were seeded at a density of 3.times.10.sup.5 cells 2 ml
screw-capped centrifuge tube and topped up to 1 ml with DMEM-High
(+10% FBS). Cells were centrifuged down at 500 g for 10 min in a
swing-out centrifuge in room temperature then were incubated at
37.degree. C. in a moist atmosphere of 5% CO2/95% air for 24 hours.
The pellets were observed to be established over this time. Medium
was changed every day in the first two days, then once every 2-3
days thereafter. On day 3, the medium was removed, to each tube was
added in 640 microL of DMEM (+10% FBS), 80 microL of 50 mCi/ml
3H-Thymidine and 80 microL of rhNC4 (0, 1, 2.5, 5, 10, 25
microgramsg/ml). (FIG. 23)
[0557] All assays were undertaken in triplicated. After 3 days (66
hrs), the supernatant medium was removed and saved for the HA
ELISA. 100 microL of 1 mg/ml collagenase (dissolved in DMEM medium)
was added to each pellet tube. Tubes were incubated at 37.degree.
C. in a shaker at 180-200 rpm for 3.5 hrs. The collagenase digest
was transferred to a 96-well plate such that the contents of each
tube was divided into 4 wells. To each well was added in 200 microL
dH2O and the plate stored in -20.degree. C. for later analysis. The
collagenase digests were thawed and DNA was collected with a cell
harvestor and the filter discs placed in a scintillation tube.
Scintillation cocktail liquid (3 mL) was added and vortexed about 1
min. The radioactivity of .sup.3H-DNA in these samples was
determined using a .beta.-scintillation counter.
[0558] Effects of Sodium Pentosan Polysulfate (PPS) Alone or in
Combination with rhNC4 on the Biosynthesis of Proteoglycans
(Measured as .sup.35S-GAGs) by Progenitor Cells Grown in Micromass
Cultures
[0559] The technique used was based on that described by (Denker A
E, Haas A R, Nicoll S B and Tuan R S. Chondrogenic differentiation
of murine C3H10T1/2 multipotential progenitor cells: I. Stimulation
by bone morphogenetic protein-2 in high density micromass cultures.
Differentiation (1999); 64: 67-76). Briefly murine Progenitor cells
(cell lines C3H10T1/2 or ATDC5) purchased from RIKEN Cell Bank
(Tsukuba, Japan) or human immunoselected Stro-1+ Progenitor cells
(Mesoblast Ltd, Melbourne, Australia) Ten microlitres (10 .mu.l) of
a suspension of the progenitor cells (1.times.10.sup.7 cells/ml in
Ham's F12 medium+10% FBS) were applied to individual wells of a
24-well plates. After incubation at 37.degree. C. in a humidified
atmosphere of 5% CO2/95% air for 2-3 hours, 900 .mu.l of Ham's F12
medium (10% FBS) and 100 .mu.l of PPS solution in the same medium
were added slowly into the wells to afford final concentrations of
PPS in each of 0, 0.1, 0.5, 1.0, 2.5, 5.0, 10.0, 20.0 .mu.g/ml
alone or in combination with rhNC4 (0, 0.1, 0.5, 1.0, 2.5, 5.0,
10.0, 25.0 .mu.g/ml). Each drug concentration was repeated in
triplicate. The cells were maintained in culture for up to 10 days.
The medium with/without drugs was changed every 3 days but 24 hours
before termination of the experiment 80 .mu.l of 50 .mu.Ci/ml
.sup.35S-H.sub.2SO.sub.4 was added to achieve a final
.sup.35SO.sub.4 concentration of 5 .mu.Ci/ml. The following day,
the cells in one of the plates were trypsinized with 150 .mu.l/well
of 2.5% trypsin and separated from the medium by centrifugation at
800 g for 10 minutes, washed with 500 .mu.l of 1.times. PBS and
stored in liquid nitrogen for RNA and/or DNA extraction and
analysis. Media and supernatants were combined in one tube for each
concentration of PPS used. To the tubes was added, 200 .mu.l of
5.times. Papain solution [2.5 mg/ml Papain, 7.9 mg/ml L-Cysteine in
Papain buffer (0.1 M NaAC, 5 mM EDTA, pH6.0)] and the solution
incubated at 65.degree. C. for 2 hours. After papain digestion,
Four aliquots of 200 .mu.l of digested solution were transferred to
a 96-well plate (200 .mu.l/well). The .sup.35S-GAG released by the
digestion step were separated from the free .sup.35SO4 by adding 20
.mu.l 5% CPC and 10 .mu.l 1 mg/ml CSA with gentle shaking at 300
rpm RT for 20-30 min to precipitate the .sup.35S-GAG-CPC complexes.
The precipitates were collected by filtered through glass fibre
filters using a cell harvester. The filters were then air-dried and
discs punched to scintillation vials. 3 ml/vial scintillation
cocktail liquid was added and vortexed for 30-45 sec. The
radioactivity of .sup.35S-SO.sub.4 incorporated the
.sup.35S-GAG-CPC complexes was measured by scintillation
counting.
[0560] Immunochemical Stain of Micromass Cultures of Progenitor
Cells for Type II Collagen
[0561] Micromass cultures of progenitor cells were established in
24-well culture plates at a starting density of 8.times.10.sup.4
cells/micromass in 1 ml of DMEM (+10% FBS) with/without various
concentrations of Pentosan Polysulfate as described above. On Day-5
and Day-10 of culture, media was removed and cultures were fixed
with Histochoice MB (Amresco, Solon, Ohio, USA) for 20-30 min at
RT. The fixed cultures were washed twice in PBS (5 min each time);
p washed in PBS twice (5 min each time); bl for 20 min at RT then
washed in PBS for 5 min. The plates were then incubator. After
rinsing, first with a gentle stream of PBS, followed by washing 3
times (5 min each time) with PBS, the wells were blocked with P5
minutes. To deIgG rinsing with a gentle stream of PBS then 3.times.
washing (5 min each time) with PBS, to each micromass culture was
added 200 .mu.l of 1.times. (BCIP/Buffer+NBT) and the plates
incubated in the reaction was stopped when the purple color first
became established in the section by washing in running water.
Plates and wells were then photographed with a digital camera and
the images analysed by using Image J.RTM. software
(http://rsb.info.nih.gov/ij/) on a personal computer.
[0562] FIG. 16 shows a bar graph showing the concentration
dependent effects of PPS on proteoglycan synthesis by murine
progenitor cells (C3H10T1-2) in micromass cultures for 6 days and 9
days. PPS was included in the media (Ham's F12+10% FCS) and was
changed every 48 hours. .sup.35S-SO.sub.4 was added 24 hours before
culture termination. Synthesis normalized to DNA content.
*P<0.05, **P<0.005, ***P<0.0005.
[0563] Highly significant stimulation of uptake of 35S into newly
synthesized PG was observed over the concentration range of 1-20
micrograms/mL in the this cell line. (FIG. 16). Moreover, after
nine days in micromass cultures a 100% stimulation was obtained at
1 microgram/mL of PPS (FIG. 16).
[0564] FIG. 17 shows bar graphs showing the concentration dependent
effects of PPS on proteoglycan synthesis by human Progenitor cells
in micromass cultures for 5 days. Data is presented as 35S-GAG
radioactivity and as a percentage of control taken as 100%.
*P<0.05 relative to control. Increased proteoglycan synthesis
was seen at concentration ranges between 0.5-10 .mu.g/ml.
[0565] Human Progenitor cells also differentiated to chondrocytes
in micromass cultures when incubated in the presence of PPS.
However in the 5 day cultures a maximum stimulation of PG synthesis
of 30% was obtained with PPS concentration of 2.5 micrograms/mL
(FIG. 17).
[0566] FIG. 18 shows a bar graph showing the Pentosan Polysulfate
(PPS) concentration dependent stimulation of type II collagen
production by human Progenitor cells in micromass cultures for 10
days as determined by scanning and analysis of the immuno stained
micromass cultures shown in B. Increased Type II Collagen
production was seen at concentration ranges between 0.5-10 .mu.g/ml
with the best results seen for 5 .mu.g/ml.
[0567] These results indicate that PPS induces the progenitor cells
to differentiate into chondrocytes, as evidenced by increased
synthesis of both proteoglycans and Type II Collagen.
[0568] Similar experiments were undertaken using Hyaluronic acid
(SuperArtz (SKK, Tokyo, Japan)) and Dextran polysulfate (MW=5000)
(Sigma, Sydney, Australia) in place of PPS. These results are shown
in FIG. 19 which shows bar graphs showing the concentration
dependent effects of (A) Hyaluronan (HA) (Supartz.TM.) and (B)
Dextran Polysulfate on proteoglycan synthesis by human Progenitor
cells in micromass cultures for 5 days. Data is presented as
35S-GAG radioactivity and as a percentage of control taken as 100%
or as DPM/ug DNA. *P<0.05 relative to control. It can be seen
that HA appeared to increase synthesis of proteoglycans but not
strongly. In contrast, dextran sulfate downregulated the
differentiation of progenitor cells as is evidenced by a
concentration dependent reduction in the production of
proteoglycans.
[0569] Concentration Effects of Sodium Pentosan Polysulfate (PPS)
on the Biosynthesis DNA (Measured as .sup.3H-Thymidine
Incorporation) by Progenitor Cells Grown in 8 Day Micromass
Cultures
[0570] Ten .mu.l of progenitor cells (7.times.10.sup.6 cells/ml)
were seeded into each well of a 24-well culture plate. After
incubation at 37.degree. C. in moist 5% CO2/95% air for 2-3 hours,
900 .mu.l of DMEM-High medium (+10% FBS) and indicated
concentrations PPS dissolved in DMEM-High medium were added slowly
to the wells. The final PPS concentration were 0, 0.1, 0.5, 1.0,
2.5, 5.0, 10.0, 20.0 .mu.g/ml, respectively. Every PPS
concentration was established in triplicate. The cultures were
allowed to proceed for 3 days. On day 4, to each well of the
24-well plate was added 640 .mu.l of DMEM-High (+10% FBS), 80 .mu.l
of 10.times. PPS solution and 80 .mu.l of 10 .mu.Ci/ml
.sup.3H-Thymidine solution to produce a final .sup.3H-Thymidine
concentration of 1 .mu.Ci/ml and final PPS concentrations as
indicated. The cultures were then incubated in 37.degree. C., 5%
CO2 for a further 22 hours, the medium was removed and 200 .mu.l of
1 mg/ml Collagenase solution [Collagenase buffer: 66.7 mM NaCl, 6.7
mM KCl, 4.8 mM CaCl2.2H2O, 10 mM HEPES (pH7.4)] was added to each
well. The plate was incubated at 37.degree. C. for 2.5 hours to
release the cells. Every half an hour, the plate was shaken gently
by hand. After collagenase digestion, the cells and digestion
solution were centrifuged at 500 g for 5 min. The supernatant was
removed. The cells were gently mixed with 200 .mu.l of TE buffer
and lysed by freezing-thawing twice. After lysis, 200 .mu.l more TE
buffer was added to the cells with mixing. Aliquots of the cell
lysate was applied to a 96-well plate as four repeats (100 .mu.l
each well). The .sup.3H-DNA in the cell lysate was collected using
glass fiber filters and a cell harvester. The filters were then
air-dried and punched to scintillation vials. 3 ml/vial
scintillation cocktail liquid was added in and vortexed for 30-40
sec. The radioactivity of .sup.3H incorporated into the DNA of
proliferating cells was measured by scintillation counting.
[0571] The results are shown in FIG. 5 which shows increased
proliferation of progenitor cells in combination of PPS. It can be
seen that all concentrations of PPS increased proliferation with
the best results being seen at concentrations of 1 and 2.5
.mu.g/ml.
[0572] Concentration Effects of Sodium Pentosan Polysulfate (PPS on
the Biosynthesis of Hyaluronan (HA) by Progenitor Cells by
Measuring the Incorporation of .sup.3H-Glucosamine into HA
[0573] Human immunoselected Stro-1+ Progenitor cells (Mesoblast
Ltd, Melbourne, Australia) were established in micromass cultures
in 24 well plates using the method described above but seeding the
progenitor cells at a density of 7.times.10.sup.5 cells/well. After
24 hours in culture the media was changed and replaced with DMEM
culture medium containing 10% FCS and 25 .mu.g/ml gentamicin
containing PPS (Bene-Arzneimittel, Munich, Germany) at
concentrations of (0.0, 0.5, 1.0, 2.5 micrograms/mL) which had been
sterilised through a 0.22 .mu.m filter. The cultures were incubated
in 5% CO.sub.2/95% moist air at 37.degree. C. for 8 days with media
changes containing the indicated concentrations of PPS every 3
days. On the 8.sup.th day .sup.3H-glucosamine was added to culture
medium containing the indicated concentrations of PPS to provide a
solution containing 1.0 .mu.Ci/ml which was added to each well. The
plates were incubated for a further 24 h. At termination of the
cultures on day 9, media was collected into 5 ml capped tubes and
stored at 4.degree. C. prior to size exclusion chromatography as
described below.
[0574] Isolation and Quantitation of .sup.3H-Hyaluronan
(.sup.3H-HA) in Culture Media Using Gel Filtration
Chromatography
[0575] Two aliquots of 0.5 ml from each media sample were labelled
A and B. 20 .mu.l of 1 M acetic acid, pH 6.0 was added to all
aliquots. 50 .mu.l of reaction buffer (20 mM Na-acetate and 0.15 M
NaCl, pH 6.0) was added to aliquot A and 50 .mu.l of 5 TRU
Streptomyces hyaluronidase (HYALASE) in reaction buffer was added
to aliquot B. All samples were incubated at 60.degree. C. for 3 h
followed by boiling for 5 min to inactivate the added
hyaluronidase. The samples were stored at -20.degree. C. prior to
gel filtration.
[0576] A Gel filtration column prepacked with Superdex-S200 was
used to isolate and identify .sup.3H-HA and .sup.3H-PGs in culture
media. Media samples were routinely centrifuged at high speed on a
bench Microfuge for 10 min immediately before loading to the
column. Samples (200 .mu.l of each) were injected into the column
through sample loop and the column was eluted with PBS buffer (0.15
M NaCl, 0.05 M Na.sub.2PO.sub.4, pH 7.2) at the flow rate of 0.2
ml/l min. The column eluent was collected at 1.0 ml/fraction for
total of 186 fractions and radioactivity was determined using a
.beta.-scintillation counter.
[0577] These results are shown in FIG. 27. Analysis of the area
under the chromatographic profiles before and after digestion with
the Streptomyces hyaluronidase (HYALASE) for control cultures
containing no PPS showed that 14.3% of the .sup.3H-glucosamine was
incorporated into HA and 85.7% into the PG subunits. As is evident
from the profiles shown in 27A the molecular size of the PG-HA
aggrecan complex was larger than the PG monomers which become
liberated when the HA is digested away. Of the concentrations of
PPS examined only 0.1 micrograms/mL and 1.0 micrograms/mL showed a
substantial increases in levels of newly synthetised .sup.3H-HA. in
the culture media. The proportion of radioactivity present in the
post digestion void volume fractions of PG monomers being 50.4%
showing that 49.6% was incorporated into HA for 1 microgram/mL FIG.
27C) and 35.5% for 0.1 micrograms/mL (profile not shown). With the
lower concentration of PPS (FIG. 27B) 15.1% of radioactivity was
found in the HA fractions, while the higher concentration of 2.5
micrograms/mL only incorporated about 11% of .sup.3H-glucosamine
into HA. Although these data suggest that maximum synthesis of HA
by progenitor cells in micromass cultures occurred at the PPS
concentration of 1.0 micrograms/mL, the .sup.3H-HA levels remaining
in the micromass extracellular matrix have yet to be determined.
Since parallel studies described herein have shown that PPS
stimulates chondrogenic differentiation of progenitor cells and the
formation of cartilage proteoglycans, the extracellular matrix
surrounding the cells may represent a richer source of the newly
synthetised HA in the form of a component of the PG aggrecan
complex. Nevertheless, this is the first report which demonstrates
that PPS stimulates the biosynthesis of HA by cultured progenitor
cells.
[0578] Concentration Effects of rhNC4 (Batch PBA-1202p) Alone and
in Combination with Sodium Pentosan Polysulfate (PPS on the
Biosynthesis of Hyaluronan (HA) by Progenitor Cells by Measuring
the Incorporation of .sup.3H-Glucosamine into HA
[0579] Murine Progenitor cells (cell lines C3H10T1/2 or ATDC5)
purchased from RIKEN Cell Bank (Tsukuba, Japan) or human
immunoselected Stro-1+ Progenitor cells (Mesoblast Ltd, Melbourne,
Australia) will be established in micromass cultures as described
above or seeded at 1.5.times.10.sup.5 cells/well in 6-well culture
plates and allowed to attach for 24 h before addition of compounds.
Various concentrations of rhNC4 preparations alone and in
combination with PPS (Bene-Arzneimittel, Munich, Germany) will be
prepared in DMEM culture medium containing 10% FCS and 50 .mu.g/ml
gentamicin at double the concentration required in the cultures,
sterilised through a 0.22 .mu.m filter and then serially diluted to
give final concentrations of the drugs required for each
experiment. Aliquots of each of the test solutions will be added to
each well of 24-well culture plates. Stock .sup.3H-glucosamine will
be diluted in culture medium to give a 1.0 .mu.Ci/ml solution which
will be immediately added to each well. The plates will be
incubated for a further 24 h. At culture termination, media will be
collected into 5 ml capped tubes and stored at -20.degree. C. for
.sup.3H-HA analysis. Cells will be released by trypsinization and
centrifuged with washing. Trypsin mobilized radioactively
labelled-HA and washing will be analysed as for the media and the
cells were then used for extraction of RNA and evaluation of gene
expression as described below.
[0580] Isolation and Quantitation of .sup.3H-Hyaluronan
(.sup.3H-HA) in Cultures Using Gel Filtration Chromatography
[0581] Two aliquots of 0.5 ml from each media sample will be
labelled A and B. 20 .mu.l of 1 M acetic acid, pH 6.0 will be added
to all aliquots. 50 .mu.l of reaction buffer (20 mM Na-acetate and
0.15 M NaCl, pH 6.0) will be added to aliquot A and 50 .mu.l of 5
TRU Streptomyces hyaluronidase in reaction buffer will be added to
aliquote B. All samples will be incubated at 60.degree. C. for 3 h
followed by boiling for 5 min to inactivate the added
hyaluronidase. The samples will be store at -20.degree. C. prior to
gel filtration.
[0582] Gel filtration columns prepacked with either Superose 6 or
Superdex-S200 will be used to isolate and identify .sup.3H-HA in
culture media. Media samples will be routinely centrifuged at high
speed on a bench Microfuge for 10 min immediately before loading to
the column. Samples (200 .mu.l of each) will be injected into the
column through sample loop and the column will be eluted with PBS
buffer (0.15 M NaCl, 0.05 M Na.sub.2PO.sub.4, pH 7.2) at the flow
rate of 0.2 ml/l min. The column eluent will be collected at 0.5
ml/fraction for total of 46 fractions and radioactivity will be
determined using a .beta.-scintillation counter.
[0583] This experiment will show a concentration dependent
stimulation of HA synthesis with optimum effects over the range of
1-5 micrograms/mL of PPS alone and rhNC4 of 5-25 micrograms/mL. In
combination 2 micrograms/mL with 5-25 micrograms/mL of rhNC4 will
show synergy.
[0584] Concentration Effects of rhNC4 (Batch PBA-1202p) Alone and
in Combination with Sodium Pentosan Polysulfate (PPS on the
Biosynthesis of Hyaluronan (HA) by Progenitor Cells Using a
ELISA
[0585] Murine Progenitor cells (cell lines C3H10T1/2 or ATDC5)
purchased from RIKEN Cell Bank (Tsukuba, Japan) or human
immunoselected Stro-1+ Progenitor cells (Mesoblast Ltd, Melbourne,
Australia) will be seeded at 2.times.10.sup.5 cells/well in 24 well
culture plates and maintained in 1 ml DMEM/Ham's F-12 medium
(Invitrogen) supplemented with 10% FBS (Sigma) and incubated at
37.degree. C. in a 5% CO2/95% moist air atmosphere until the cells
reached 80% confluence. The media will then be replaced with
DMEM/Ham's F-12 containing various concentrations of the rhNC4
preparations alone and in combination with pentosan polysulfate
(Bene-Arzneimittel, Munich, Germany) and the cultures will be
maintained at 37.degree. C., in 5% CO.sub.2 for a further 24 hours.
The media in each well will be separated from the cells and
transferred to a 2.0 ml microfuge tube. The monolayer cells
remaining in the wells will be detached by trypsinization and then
separated from the supernatant by centrifugation at 350 g for 5
min. The supernatant will be collected and combined with the
medium. The combined medium and supernatant mixture (200 .mu.l)
will be assayed for hyaluronan content using the HA-ELISA as
described above. The supernatant from the cell trypsinization will
be boiled to denature and inactivate the enzyme and also assayed
for HA content using the ELISA. The HA of these fractions will be
considered to represent the HA content of the extracellular matrix
(ECM).
[0586] The results of this experiment will confirm the results
found in FIG. 27. The ELISA will demonstrate HA production by
progenitor cells in the presence of low doses (including 1-5
microgram/ml) of polysulfated polysaccharides.
[0587] Effects of Sodium Pentosan Polysulfate (PPS) on the
Differentiation of Human Progenitor Cells in an Osteogenic Media
Using in Vitro Mineralisation Assays.
[0588] The conditions necessary for the induction of human
progenitor cells to develop mineralised bone matrix in vitro have
been previously described (Gronthos S, A C Zannettino, S J Hay, S
Shi, S E Graves, A Kortesidis and P J Simmons. (2003). Molecular
and cellular characterisation of highly purified stromal stem cells
derived from human bone marrow. J Cell Sci 116:1827-1835). The
osteoinductive media consists of alpha-MEM media supplemented with
2% (v/v) FCS, 1.8 mM KH2PO4, 10-7 dexamethasone sodium phosphate,
50 IU/ml penicillin, 50 .mu.g/mL streptomycin, 1 mM Sodium
Pyruvate, 100 .mu.M L-Ascorbic acid 2-phosphate, 2 mM L-glutamine
and 10 mM HEPES buffer.
[0589] Human progenitor cells were seeded into 96-well plates at
8.times.10.sup.3 cells per well and allowed to reach .gtoreq.90%
confluence prior to the addition of osteoinductive media containing
nominated concentrations of PPS (0.0, 1.0, 5.0, 10 micrograms/mL).
Cells were cultured at 37.degree. C. in the presence of 5% CO2 for
the indicated period. The osteoinductive culture media containing
fresh compound was changed twice weekly for a period of 4
weeks.
[0590] The results from this experiments can be seen in FIG. 7A. It
shows that the presence of PPS suppressed differentiation into
osteocytes, particularly at 1 and 10 micrograms PPS/mL
[0591] Effects of Sodium Pentosan Polysulfate (PPS) on the
Differentiation of Human Progenitor Cells in an Osteogenic
Media--Analysis of in Vitro Mineral Content
[0592] Total mineral content per well in the above cultures was
assessed by measuring the calcium levels per total DNA in each
well. Cell cultures were washed three times with Ca+ and Mg+ free
PBS and left to solubilize overnight in 0.6M hydrochloric acid (100
.mu.L per well). The acid-solubilized mineral 23 was transferred to
a new 96-well plate and reacted with o-cresol-phthalein-complexone
(Thermal Electron Corporation, USA) to form a purple dye that was
measured at 570 nm using an EL 808 Ultra Microplate Reader. The
intensity of the purple dye is directly proportional to the calcium
concentration in each well. Absolute calcium concentration was
extrapolated from a calcium standard curve according to the
manufacturer's recommendations. Following this, the
acid-solubilized cultures were rinsed three times with Ca2+ and
Mg2+ free PBS and incubated in a 100 .mu.Ls of solution of 100
.mu.g/mL Proteinase K at 37.degree. C. for 2 hours. Digested
samples were vigorously pipetted and 50 .mu.L of each well was
transferred to a well of a nonfluorescent assay plate, containing
150 .mu.L diluted Hoechst 33258 (2 .mu.g/mL) in DNA assay buffer
(2M NaCl and 50 mM Sodium Phosphate). Absolute absorbance was
determined by measuring against a series of DNA standards at 350 nm
by LS55 Luminescence Spectrometer (Perkin Elmer).
[0593] The results from this experiments can be seen in FIG. 7B.
The fact that PPS cultures all appear the same as the media
indicated that no calcified deposits are present. Normally
mineralized deposits stained positively with the Alizarin Red
reagent and are formed within 4 weeks of culture of progenitor
cells under osteoinductive conditions.
[0594] Effects of Sodium Pentosan Polysulfate (PPS) on the
Differentiation of Human Progenitor Cells in an Adipogenic Media
Using in Vitro Adipogenic Assays
[0595] The conditions required for the development of lipids from
human bone marrow stromal cells in vitro have been previously
described (Gimble J. Marrow stromal adipocytes. In: Marrow stromal
cell culture. J N Beresford, Owen, M. E., ed. Cambridge University
Press, Cambridge, pp 67-87 (1998)). Briefly, human progenitor cells
were seeded into 96-well plates at a density of 8.times.10.sup.3
cells per well in complete alpha-MEM growth media and were allowed
to reach >90% confluence prior to addition of inductive media.
Cells were cultured in adipogenic-inductive media comprised of
complete alpha-MEM supplemented with 0.5 mM
3-Isobutyl-1-methyl-xanthine (IBMX), 60 microM Indomethacin, and
0.5 microM Hydrocortisone in the presence of a titration of PPS
(0.0, 1.0, 5.0, 10 micrograms/mL). The inductive media was changed
twice weekly for a period of 4 weeks. Cells were stained for the
presence of lipid using Oil Red `O`.
[0596] Oil Red `O` Staining of Lipid
[0597] Cells were cultured as described above and gently rinsed in
1.times. PBS (pH7.4) to avoid disruption of the cell monolayer.
Cells were fixed in phosphate buffered formalin for 15 minutes at
RT. The fixative was subsequently removed and lipid stained by
adding 100 microL of freshly filtered Oil Red O (3 mg/mL; MP
Biomedicals, Australia) for .gtoreq.2 hours at RT. Cells were
rinsed 3 times with RO water and counter stained with Mayer's
Haematoxylin (Lillie's modification). Haematoxylin stains were
aspirated and replaced by water and the Oil Red O positive
adipocytes examined under a light microscope and photographed with
the DP20-56 Olympus camera (Olympus, Japan).
[0598] These results are shown in FIGS. 8A and B. It can be seen
that PPS regulated the differentiation of progenitor cells into
adipocytes with upregulation seen at all concentrations.
[0599] Effects of Sodium Pentosan Polysulfate (PPS) on the
Biosynthesis of Proteoglycans (Measured as .sup.35S-GAGS) by
Progenitor Cells Grown in Collagen Sponges.
[0600] Human immunoselected Stro-1+ Progenitor cells (Mesoblast
Ltd, Melbourne, Australia) prepared as a suspension containing an
average of 100,000 cells in 100 microL of 1:1 high glucose
DMEM/Ham's F-12 medium (Invitrogen) supplemented with 10% FBS
(Sigma) will be injected using a micropipett into the centre of
blocks of prepared collagen sponges placed in the wells of a 24
well culture plate. The collagen sponges will be Sterile Gelfoams
(Pharmacia & Upjohn Co., Kalamazoo, Mich.) pre-cut before hand
to 0.5 cm.sup.3 cubes. To each well will be added 2 mL media+FBS
and the plates will be incubated at 37.degree. C., in 5%
CO.sub.2/95% air for 48 hours. The media will then be replaced with
1:1 high glucose DMEM/Ham's F-12 medium (Invitrogen) supplemented
with 10% FBS (Sigma) containing various concentrations of PPS (0,
0.1, 0.5, 1.0, 2.5, 5.0, 10.0, 25.0 .mu.g/ml) for a further 48
hours. All PPS concentrations will be cultured in triplicate. The
medium will then be changed to defined medium, which contained the
indicated concentrations of PPS and 5 .mu.Ci/ml of
.sup.35S-H.sub.2SO.sub.4 (Perkin Elmer, USA). The experiments will
be terminated after 48 hours incubation when PG biosynthesis will
be determined by measuring the incorporation of .sup.35SO.sub.4
into the PG as (.sup.35S-GAGs) released into the media and after
collagenase digestion of the sponges as described above.
[0601] This experiment will demonstrate cartilage formation within
the sponge is enhanced in the presence of polysulfated
polysaccharides at similar concentrations to those shown in vitro
and described herein. The experiment will confirm that doses of
0.5-1.0 million precursor cells are suitable cell numbers and that
concentrations of 1-10 micrograms/ml polysulfated polysaccharides
provide a beneficial effect.
[0602] Evaluation of de Novo Cartilage Formulation in an Animal
Model of Disc Regeneration and Cartilage Repair Using a Formulation
of Progenitor Cells and Pentosan Polysulfate (PPS).
[0603] Animal Protocol
[0604] Two level spinal surgeries will be undertaken at the
cervical C3/4 and C4/5 spinal levels of 12 adult Merino/Leicester
ewes which will be randomly divided into 2 groups of 6. The
procedure will require that the intervertebral discs be surgically
removed from these levels and a biodegradable implant filled by a
collagen sponge scaffold containing the progenitor cells be
implanted between the vertebral bodies previously occupied by the
discs. Apart from the different cells injected into the sponges the
only other variable in the design of the study will be whether the
cartilage end plates (CEP) is mechanically perforated prior to
insertion of the implant The duration of the study will be 12 weeks
from the time of implantation to sacrifice.
[0605] Group A (N=6)
[0606] Sterile Gelfoam Gelatin Sponges (Pharmacia & Upjohn Co.,
Kalamazoo, Mich., USA) will be cut to size using a preformed
template, then injected with 100 micro litres of Profreeze.RTM.
solution using a micro-pipette. The loaded sponge will then be
inserted into the specially modified biodegradable cage which will
be fixed within the surgically excised cervical disc spaces at the
levels indicated. The cages will be secured in place by a means of
a commercial vertebral plate.
[0607] Group B (N=6)
[0608] Sterile Gelfoam Gelatin Collagen Sponges will cut to size
using a preformed template and loaded with 100 micro litres of
Profreeze.RTM. solution containing progenitor cells (1 million
ovine progenitor cells)+10 micrograms of PPS. The loaded sponge
will then be inserted into a biodegradable cage which will be fixed
within the surgically excised cervical disc spaces at the levels
indicated. The cages will be secured in place by a means of a
commercial vertebral plate.
[0609] Evaluation of Experimental Outcomes
[0610] Lateral radiographs will be taken of all cervical spines
under induction anaesthesia at the following time points: Baseline,
Operation, 1, 2 and 3 months following implantation of the test
articles and scored for bone formation using the scoring system
shown in Table 3.
TABLE-US-00007 TABLE 3 Score Description 0 no bony fusion 1 maximum
intervertebral gap in the cranio-caudal direction of more than 5 mm
2 maximum intervertebral gap in the cranio-caudal direction of less
than 5 mm 3 complete bony fusion. The maximum intervertebral gap in
the cranio-caudal direction will be measured directly on lateral
radiographs using a ruler
[0611] Animals will also be monitored throughout the study
according to animal ethics guidelines for care of chronically
prepared sheep using the schedule shown in Table 4.
TABLE-US-00008 TABLE 4 Observation of animals following surgery
Observation Frequency/Day Duration Weight x1 Study entry Behaviour,
Posture and Activity x1 Study duration Pain and Discomfort x1 Study
duration Observation of procedural area for local x1 Minimum of
irritation/infection 3 days post surgery Decreased
activity/inability to move x1 Study duration Assessment of daily
food/water x1 Study duration consumption
[0612] Histological Analysis
[0613] Following sacrifice intact cervical spines will be dissected
from the animals and the C3/4 and C4/5 motion segments cut from the
remainder of the spine using a band saw. These two segments will
then be cut in the sagital plane into 2 sections and stored in 10%
normal buffered formalin. These sections will contain the cage with
3 mm of the superior and inferior vertebral bodies on either side.
They will then be decalcified using formic acid and then dehydrated
in ascending concentrations of ethanol under agitation. Following
clearing in xylene, tissues will be embedded in paraffin, cut and
stained with H&E, Alcian Blue, Toludine Blue, Massons
Trichrome. The Toluidine Blue stained sections will be used for the
histomorphometric analysis using quantitative image analysis to
determine optical density of proteoglycan distribution and matrix
dimensions using Image J.RTM. software
(http://rsb.info.nih.gov/ij/) on a personal computer.
[0614] Unstained paraffin sections will also be used for
immunohistochemical analysis of matrix components. They will be
pre-digested with combinations of chondroitinase ABC (0.25 U/ml) in
20 mM Tris-acetate buffer pH 8.0 for 1 h at 37.degree. C., bovine
testicular hyaluronidase 1000 U/ml for 1 h at 37.degree. C. in
phosphate buffer pH 5.0, followed by three washes in 20 mM Tris-HCl
pH 7.2 0.5M NaCl (TBS) or proteinase-K (DAKO S3020) for 6 min at
room temperature to expose antigenic epitopes. The tissues will
then be blocked for 1 h in 20% normal swine serum and probed with a
number of primary antibodies to large and small proteoglycans and
collagens (Table 5). Negative control sections will also be
processed either omitting primary antibody or substituting an
irrelevant isotype matched primary antibody for the authentic
primary antibody of interest. Commercial (DAKO) isotype matched
mouse IgG (DAKO Code X931) or IgM (DAKO Code X942) control
antibodies (as appropriate) will be used for this step. The DAKO
products X931 and X942 will be mouse monoclonal IgG.sub.1 (clone
DAK-GO1) and monoclonal IgM (clone DAK-GO8) antibodies directed
against Aspergillus niger glucose oxidase, an enzyme that is
neither present nor inducible in mammalian tissues. Horseradish
peroxidase or alkaline phosphatase conjugated secondary antibodies
will be used for the detection using 0.05% 3,3'-diaminobenzidene
dihydrochloride and 0.03% H.sub.2O.sub.2 in TBS, Nova RED,
nitroblue
tetrazolium/5-bromo-4-chloro-3-indolylphosphate/iodonitrotetrazolium
violet (NBT/BCIP/INT) or New Fuchsin as substrates. The stained
slides will be examined by bright field microscopy and photographed
using a Leica MPS 60 photomicroscope digital camera system.
TABLE-US-00009 TABLE 5 Primary antibodies to proteoglycan and
collagen core protein epitopes Primary antibody epitope Clone
(isotype) References Large Proteoglycans Aggrecan AD 11-2A9 (IgG) a
Versican 12C5 (IgG) b Collagen Type I I8H5 (IgG.sub.1) b, c Type II
II-4CII (IgG.sub.1) b, c Type IV CIV-22 (IgG.sub.1) b, c Type VI
Rabbit polyclonal b, c Type IX Mouse monoclonals D1-9 (IgG.sub.1),
d B3-1 (IgG.sub.2b) (a) Melrose, J., Little, C. B. & Ghosh, P.
Detection of aggregatable proteoglycan populations by affinity
blotting using biotinylated hyaluronan. Anal Biochem 256, 149-157
(1998). Melrose, J., Smith, S. & Ghosh, P. Differential
expression of proteoglycan epitopes by ovine intervertebral disc
cells. J Anat 197 (Pt 2), 189-198 (2000). (b) Melrose, J., Smith,
S., Ghosh, P. & Taylor, T. K. Differential expression of
proteoglycan epitopes and growth characteristics of intervertebral
disc cells grown in alginate bead culture. Cells Tissues Organs
168, 137-146 (2001). (c). Shen, B., Melrose, J., Ghosh, P. &
Taylor, F. Induction of matrix metalloproteinase-2 and -3 activity
in ovine nucleus pulposus cells grown in three-dimensional agarose
gel culture by interleukin-1beta: a potential pathway of disc
degeneration. Eur Spine J 12, 66-75 (2003). (d) Ye, X. J., Terato,
K., Nakatani, H., Cremer, M. A. & Yoo, T. J. Monoclonal
antibodies against bovine type IX collagen (LMW fragment):
production, characterization, and use for immunohistochemical
localization studies. J Histochem Cytochem 39, 265-271 (1991).
[0615] Statistics
[0616] The Student t test will be used for pair wise comparisons as
indicated. Statistical significance will be given at P less than
0.05. One-way analysis of variance (ANOVA) will be used for
multiple comparisons as indicated. Statistical significance between
the groups will be determined using the Fisher projected least
significance difference test at P less than 0.05.
[0617] This experiment will demonstrate that relative to control,
the use of polysulfated polysaccharides and progenitor cells will
result in greater (more abundant) production of cartilage in the
disk space.
[0618] In addition, in the excised disc spaces with punctured
cartilaginous end plates which had an interface with the collagen
sponges containing progenitor cells plus PPS, enhanced infiltration
of endogenous blood bourne progenitor cells will be observed
accompanied by more complete healing of the mechanically produced
cartilage defects.
[0619] It will be appreciated by persons skilled in the art that
numerous variations and/or modifications may be made to the
invention as shown in the specific embodiments without departing
from the spirit or scope of the invention as broadly described. The
present embodiments are, therefore, to be considered in all
respects as illustrative and not restrictive.
* * * * *
References