U.S. patent application number 12/797157 was filed with the patent office on 2011-01-13 for system for detecting polynucleotides.
This patent application is currently assigned to INVESTIGEN. Invention is credited to K. YEON CHOI, HEATHER KOSHINSKY, MICHAEL S. ZWICK.
Application Number | 20110008905 12/797157 |
Document ID | / |
Family ID | 34193014 |
Filed Date | 2011-01-13 |
United States Patent
Application |
20110008905 |
Kind Code |
A1 |
KOSHINSKY; HEATHER ; et
al. |
January 13, 2011 |
SYSTEM FOR DETECTING POLYNUCLEOTIDES
Abstract
The present invention relates to methods for detecting the
presence or amount of a target polynucleotide. A polynucleotide,
target nucleic acid analog, and dye are combined to form a mixture.
The optical property of the dye is observed after the mixture is
exposed to a stimulating means. Optionally, after the stimulating
means is employed, the mixture is compared to a reference value
characteristic of the rate of change in the optical property of the
dye in a similar mixture containing a known amount of a target
polynucleotide/nucleic acid analog hybrid to determine a relative
rate of change in the optical property. The change in a property of
the mixture after exposure thereof to a stimulating means or the
relative rate of change in the optical property of dye in the
mixture is correlated with the presence or amount of the specified
target polynucleotide in the sample.
Inventors: |
KOSHINSKY; HEATHER; (EL
CERRITO, CA) ; ZWICK; MICHAEL S.; (VACAVILLE, CA)
; CHOI; K. YEON; (ST. PAUL, MN) |
Correspondence
Address: |
BRINKS HOFER GILSON & LIONE
P.O. BOX 10395
CHICAGO
IL
60610
US
|
Assignee: |
INVESTIGEN
|
Family ID: |
34193014 |
Appl. No.: |
12/797157 |
Filed: |
June 9, 2010 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11285025 |
Nov 21, 2005 |
7745119 |
|
|
12797157 |
|
|
|
|
PCT/US2004/016118 |
May 20, 2004 |
|
|
|
11285025 |
|
|
|
|
60471827 |
May 20, 2003 |
|
|
|
Current U.S.
Class: |
436/94 |
Current CPC
Class: |
C12Q 1/6816 20130101;
Y02A 50/52 20180101; Y02A 50/30 20180101; Y10T 436/143333 20150115;
C12Q 1/6816 20130101; C12Q 2565/107 20130101; C12Q 2525/113
20130101; C12Q 2525/107 20130101; C12Q 1/6816 20130101; C12Q
2545/113 20130101; C12Q 2527/125 20130101 |
Class at
Publication: |
436/94 |
International
Class: |
G01N 33/53 20060101
G01N033/53 |
Claims
1.-16. (canceled)
17. A kit comprising: (a) a low pH dye reagent comprising a
carbocyanine dye; and (b) a non-ionic detergent.
18.-20. (canceled)
21. The kit of claim 17, wherein the carbocyanine dye is
3,3'-diethylthiacarbocyanine.
22. The kit of claim 17, further comprising a nucleic acid analog
stock solution.
23. The kit of claim 23, wherein the nucleic acid analog stock
solution is a peptide nucleic acid (PNA) stock solution.
24. The kit of claim 17, further comprising a vehicle to facilitate
hybridization of a nucleic acid analog to a target
polynucleotide.
25. The kit of claim 17, wherein the non-ionic detergent is Tween
80.
26. The kit of claim 17, further comprising an anti-microbial
agent.
27. The kit of claim 17, further comprising a diluting buffer.
28. The kit of claim 17, further comprising a source of light
stimulus.
29. The kit of claim 17, further comprising at least one
polynucleotide manipulating component.
30. The kit of claim 17, further comprising at least one kit
component selected from the group consisting of chemical-resistant
disposal bags, tubes, diluents, gloves, scissors, marking pens, and
eye protection.
31. A kit comprising: (a) a low pH dye reagent comprising a
carbocyanine dye, an antimicrobial agent, and Tween 80; (b) a
diluting solution comprising EDTA; (c) a nucleic acid analog stock
solution comprising PNA and EDTA; and (d) control DNA.
32. The kit of claim 31, wherein the carbocyanine dye is
3,3'-diethylthiacarbocyanine.
Description
RELATED APPLICATIONS
[0001] The present application is a continuation in part of
International Application No. PCT/US2004/016118, filed May 20,
2004, which claims the benefit of U.S. Provisional Application No.
60/471,827, filed May 20, 2003, each of which is incorporated
herein by reference in its entirety.
FIELD OF THE INVENTION
[0002] The present invention relates to the field of nucleic
acid-based diagnostics. More particularly, the present invention
relates to methods, compositions, and assay systems for detecting
polynucleotides.
BACKGROUND OF THE INVENTION
[0003] There is a great need to identify and quantify
polynucleotides. Current methods of identifying target
polynucleotides such as those associated with pathogens, pathogen
infection, human genes associated with diseases and disorders,
genetically modified organisms (GMOs), biowarfare agents, food
applications, water applications, environmental applications,
veterinary applications, and agricultural applications presently
rely on methods such as the polymerase chain reaction (PCR), NASBA,
TMA, or bDNA. These methods require skilled personnel and
specialized equipment. Accordingly, there is a great need for
convenient and economical methods of detection, identification, and
quantification of target polynucleotides. This invention meets this
and other needs.
SUMMARY OF THE INVENTION
[0004] In one aspect, the present invention relates to methods for
detecting the presence or amount of a target polynucleotide in a
sample. In a further aspect, one method includes the following
steps:
[0005] A nucleic acid analog that binds a target nucleic acid
sequence of the target polynucleotide in a sequence specific
manner, and a dye for which the rate of change in an optical
property is different in the presence and absence of a target
polynucleotide/nucleic acid analog hybrid, are combined to produce
a mixture.
[0006] In another aspect, a method includes the following steps:
peptide nucleic acid (PNA) that binds a target nucleic acid
sequence of the target polynucleotide in a sequence specific
manner, and a dye for which the rate of change in an optical
property is different in the presence and absence of a target
polynucleotide/PNA hybrid, are combined to produce a mixture. The
rate of change in the optical property of the dye in the mixture is
compared to a reference value characteristic of the rate of change
in the optical property of the dye in a similar mixture containing
a known amount of a target polynucleotide/PNA hybrid to determine a
relative rate of change in the optical property. The relative rate
of change in the optical property of dye in the mixture is
correlated with the presence or amount of the specified target
polynucleotide in a sample.
[0007] In other aspects, the nucleic acid analog may be a locked
nucleic acid (LNA), threose nucleic acid (TNA), or metal linked
nucleic acid.
[0008] The rate of change in the optical property of the dye may be
different in the presence and absence of a target
polynucleotide/nucleic acid analog hybrid and when the mixture is
provided with a light stimulus, for example.
[0009] The sample may include a tissue, collection of cells, cell
lysate, purified polynucleotide, or isolated polynucleotide, virus,
environmental sample, industrial sample, medical sample, food
sample, agricultural sample, veterinary sample, agro-livestock
sample, water sample, soil sample, air sample, sample associated
with bio-warfare agent, or sample associated with agro-warfare
agent. The sample may also include a body part, or a fluid from a
body, such as blood, sputum, or semen; among preferable body parts
or fluids included in the sample are those associated with
forensics studies of crime scenes and the like.
[0010] In one aspect, the target polynucleotide may be DNA,
preferably DNA obtained directly or indirectly from an organism or
a synthetic DNA. In some variations, the target polynucleotide may
be obtained from total cellular DNA or a fraction thereof, such as
nuclear DNA, mitochondrial DNA, ribosomal DNA, or chloroplast DNA,
or viral DNA, or plasmid DNA, or artificial DNA, or epigenomic DNA,
or epigenetic DNA, or in vitro amplified DNA, or chimeric DNA.
[0011] In another aspect, the target polynucleotide may be RNA,
preferably RNA obtained directly or indirectly from an organism or
a synthetic RNA. In some variations, the RNA may be total cellular
RNA or a fraction thereof, such as ribosomal RNA (rRNA), messenger
RNA (mRNA), or transfer RNA (tRNA), or armored RNA, or viral RNA,
or micro RNA, or siRNA, or artificial RNA, or chimeric RNA.
[0012] The target polynucleotide may be obtained from an organism.
In one embodiment, the organism may be a human. In another
embodiment, the organism may be a pathogen. In a further
embodiment, the target polynucleotide may be from a pathogen, such
as a virus, bacterium, or fungus. Non-limiting examples of such
viruses or bacteria include Bacillus anthracis, Clostridium
botulinu, Brucellae, Vibrio cholera, Clostridium perfringes, Ebola
virus, Yersinia pesits, Coxiella burnetii, Smallpox virus,
hepatitis C virus, hepatitis B virus, and human immunodeficiency
virus.
[0013] The nucleic acid analog may be partially complementary to
the target nucleic acid sequence. Alternatively, the nucleic acid
analog may be exactly complementary to the target nucleic acid
sequence.
[0014] The nucleic acid analog may be greater than about 4 nucleic
acid bases in length and/or less than about 24 nucleic acid bases
in length. Preferably, the nucleic acid analog is about 5 or more
nucleic acid bases in length; more preferably, the nucleic acid
analog is at least about 7 or more, about 8 or more, about 9 or
more, about 10 or more, or about 11 or more nucleic acid bases in
length. In a further variation, the nucleic acid analog may also be
about 12 nucleic acid bases in length; more preferably, the nucleic
acid analog is about 14 nucleic acid bases in length, or about 16,
or about 18, or about 20, or about 22 nucleic acid bases in length.
Nucleic acid analogs that are in excess of about 24 nucleic acid
bases in length are also usefully employed in the context of the
present invention. In particular, such larger preferred nucleic
acid analogs include, without limitation, those that have about 28,
or about 32, or about 36, or about 40 nucleic acid bases in
length.
[0015] The nucleic acid analog or target polynucleotide may be
immobilized on a solid substrate. Immobilization may be via a
non-covalent interaction that relies on any of van der Waals,
hydrogen bond, or hydrophobic-related forces, such as occurs
between biotin and streptavidin. In a further variation, the
nucleic acid analog may be covalently linked to a binding agent
that is specific for a particular ligand, as in biotin and
streptavidin. In still a further variation, the non-covalent
interaction may be an antigen/antibody interaction. The nucleic
acid analog or target polynucleotide may also be covalently bonded
to the solid substrate.
[0016] In a further aspect, the dye is a cyanine dye. Examples of
cyanine dyes are a 3,3'-diethylthiacarbocyanine iodide (Sigma,
Milwaukee), 3,3'-diethylthiadicarbocyanine iodide (Sigma,
Milwaukee), and 3,3'-diethylthiatricarbocyanine iodide (Sigma,
Milwaukee).
[0017] The dye may have a higher rate of change in the optical
property in the presence of nucleic acid analog/target
polynucleotide hybrid than in the absence of a nucleic acid
analog/target polynucleotide hybrid. Alternatively, the dye may
have a lower rate of change in the optical property in the presence
of nucleic acid analog/target polynucleotide hybrid than in the
absence of a nucleic acid analog/target polynucleotide hybrid.
[0018] The rate of change in the optical property of the dye may be
determined by measuring an optical property of the dye. Examples of
such optical properties include color, absorbance, fluorescence,
reflectance, or chemiluminescence. The optical property may be
determined at one or more times.
[0019] In another aspect, the optical property of the dye is
measured at multiple times. In a further aspect, the optical
property is measured at a single time.
[0020] In a further aspect, the invention is directed to a method
of detecting an organism in a sample by detecting the presence or
amount of a target polynucleotide in the sample wherein the
presence or amount of the target polynucleotide identifies the
presence or amount of the organism.
[0021] In a further aspect, the invention is directed to a method
of detecting a class of organisms in a sample by detecting the
presence or amount of a target polynucleotide in the sample wherein
the presence or amount of the target polynucleotide identifies the
presence or amount of the class of organism.
[0022] In another aspect, the invention is directed to a method of
detecting a strain of an organism in a sample by detecting the
presence or amount of a target polynucleotide in the sample,
wherein the presence or amount of the target polynucleotide
identifies the presence or amount of the strain.
[0023] In a further aspect, the invention is directed to a method
of detecting a genetically modified organism (GMO) in a sample by
detecting the presence or amount of a target polynucleotide in the
sample, wherein the presence or amount of the target polynucleotide
identifies the presence or amount of the genetically modified
organism.
[0024] The present invention is also directed to a method of
detecting the presence of a disease state in a subject by detecting
the presence or amount of a target polynucleotide, wherein the
presence or amount of the target polynucleotide identifies the
disease state.
[0025] The present invention is also directed to a method of
detecting the presence of genetic variation in a subject by
detecting the presence or amount of a target polynucleotide,
wherein the presence or amount of the target polynucleotide
identifies the genetic variation.
[0026] In another aspect, the present invention is directed to
detecting infection of a host by a pathogen, where the presence or
amount of a target polynucleotide, wherein the target nucleic acid
is a ribonucleic acid (RNA), and wherein the presence or amount of
the target polynucleotide identifies infection of the host by the
pathogen.
[0027] In another aspect, the invention is directed to a method of
detecting a single nucleotide polymorphism (SNP) in a sample by
detecting the presence or amount of a target polynucleotide in the
sample, wherein the presence or amount of the target polynucleotide
identifies the presence or amount of the SNP.
[0028] In another aspect, the invention is directed to a method of
detecting a genetic sequence or control sequence (that has been
added) in a sample by detecting the presence or amount of a target
polynucleotide in the sample, wherein the presence or amount of the
target polynucleotide identifies the presence or amount of the
genetic sequence.
[0029] In another aspect, the invention is directed to a method of
detecting an in vitro amplified sequence in a sample by detecting
the presence or amount of a target polynucleotide in the sample,
wherein the presence or amount of the target polynucleotide
identifies the presence or amount of the in vitro amplified
sequence.
[0030] In another aspect, the invention is directed to a method of
detecting base pair changes in a sample by detecting the presence
or amount of a target polynucleotide in the sample, wherein the
presence or amount of the target polynucleotide identifies the
presence or amount of the base pair changes.
[0031] The invention is also directed to a method of detecting a
target polynucleotide in two or more samples by detecting the
target polynucleotide in a first sample at a first site of a
multi-site device using a first nucleic acid analog molecule, and
detecting the target polynucleotide in a second sample at a second
site of a multi-site device using a second nucleic acid analog
molecule. In one variation, the nucleic acid analog molecules are
immobilized on a solid substrate. The method includes detecting two
or more target polynucleotide sequences in two or more samples.
Alternatively, the samples may be immobilized on a solid
substrate.
[0032] The present invention is also directed to kits for detecting
a target polynucleotide. The kit may include one or more of a
sample that includes a target polynucleotide, one or more nucleic
acid analogs at least partially complementary to a target nucleic
acid sequence of the target polynucleotide, and one or more dyes.
Optionally, the kit may include a source of stimulus. Optionally,
the kit may include filters for a light source. The kit may include
instructions for using the kit. The sample included with the kit is
preferably a sample that includes a known amount of a target
polynucleotide that can be employed as a standard and for
determining a relative rate of change of a mixture, as further
characterized herein.
BRIEF DESCRIPTION OF THE DRAWINGS
[0033] FIG. 1 depicts a schematic of a version of the assay system
using a PNA.
[0034] FIG. 2 shows the structural difference between a DNA
molecule and a sample PNA molecule.
[0035] FIG. 3 is a schematic representation of a light activated
PNA-based assay system.
[0036] FIG. 4 depicts a light activated assay reaction.
[0037] FIG. 5 depicts the time course of
3,3'-diethylthiacarbocyanine iodide dye emission after exposure to
PNA and light stimulus for different concentrations of target
polynucleotide.
[0038] FIG. 6 depicts the percent change in
3,3'-diethylthiacarbocyanine iodide dye emission for different DNA
concentrations.
[0039] FIG. 7 compares the percent change in
3,3'-diethylthiacarbocyanine iodide emission in a test sample in
which different wavelength ranges of light stimulus were used for
stimulation.
[0040] FIG. 8 compares the percent change in dye emission in a
sample of DNA from GMO soy and DNA from non-GMO soy.
[0041] FIG. 9 depicts assay sensitivity with varying test DNA
concentrations using a mixed wavelength light source. Each line
depicts the percent change in emission of the dye after exposure to
a light stimulus at varying DNA concentrations. The PNA was
CACTGCTGCCTCCCCGTAG-Lys [SEQ ID NO:1]. The polynucleotide sequence
was 5' CTACGGGAGGCAGCAGTG 3' [SEQ ID NO:2].
[0042] FIG. 10 depicts the time at which a 20% change in
3,3'-diethylthiacarbocyanine iodide emission occurs at different
target polynucleotide concentrations.
[0043] FIG. 11 depicts the percent change in dye emission in a
sample of DNA and samples with varying concentrations of RNA.
[0044] FIG. 12 compares the percent change in emission over time
for 3,3'-diethylthiacarbocyanine iodide in a sample containing PNA
and either DNA in the absence of a deli wash background or in the
presence of deli wash background.
[0045] FIG. 13 depicts the addition of PNA "wedges".
[0046] FIGS. 14A-D compares the emission after application of
different lights with different peak wavelengths for a series of
samples.
[0047] FIG. 15 depicts immobilized reactions over time using a
universal bacteria PNA probe.
[0048] FIG. 16 depicts human SRY detection.
[0049] FIG. 17 depicts a schematic representation of light
activated, surface immobilized detection of nucleic acid
analogs.
[0050] FIGS. 18A-D depict different schemes for introducing
polynucleotide/nucleic acid analog hybrids.
[0051] FIG. 19 depicts the effect of light stimulus with different
peak wavelengths.
[0052] FIG. 20 depicts the detection of different concentrations of
soy DNA.
[0053] FIG. 21 depicts the percent change in optical property
versus the number of genomes of GMO positive soy.
[0054] FIG. 22 depicts the effect of different concentrations of
TWEEN.RTM. 20.
[0055] FIG. 23 depicts the percent change in emission for different
concentrations of TWEEN.RTM. 20.
[0056] FIG. 24 compares a reaction using PNA probes to a reaction
using LNA probes in a liquid format with different concentrations
of TWEEN.RTM. 20.
[0057] FIG. 25 depicts the percent change in emission using PNAs
versus LNAs.
[0058] FIG. 26 depicts the detection of hepatitis C virus using
different quantities of viral RNA.
[0059] FIG. 27 depicts the emission of reactions with different
amounts of HCV RNA one minute after exposure to light stimulus.
[0060] FIG. 28 depicts the percent change in emission using
bacteria and nucleic acid analogs that are either HCV or bacterial
specific.
[0061] FIG. 29 depicts the percent change in emission using short
nucleic acid analogs or short nucleic acid analogs put
together.
DETAILED DESCRIPTION OF THE INVENTION
[0062] The present invention provides methods, compositions and
assay systems for detecting a polynucleotide having a target
nucleic acid sequence using nucleic acid analogs.
I. GENERAL TECHNIQUES
[0063] The practice of the present invention employs, unless
otherwise indicated, conventional techniques of molecular biology
(including recombinant techniques), microbiology, cell biology,
biochemistry, immunology, protein kinetics, and mass spectroscopy,
which are within the skill of the art. Such techniques are
explained fully in the literature, such as, SAMBROOK ET AL.,
MOLECULAR CLONING: A LABORATORY MANUAL (3d ed., Cold Spring Harbor
Press 2000); SAMBROOK ET AL., MOLECULAR CLONING: A LABORATORY
MANUAL (3d ed., Cold Spring Harbor Press 1989); OLIGONUCLEOTIDE
SYNTHESIS (M. J. Gait, ed., 1984); METHODS IN MOLECULAR BIOLOGY (a
series of volumes directed at molecular biology protocols that is
published by Humana Press, Totowa, N.J.); CELL BIOLOGY: A
LABORATORY NOTEBOOK (J. E. Cellis, ed., Academic Press 1998);
ANIMAL CELL CULTURE (R. I. Freshney, ed., 1987); J. P. MATHER AND
P. E. ROBERTS, INTRODUCTION TO CELL AND TISSUE CULTURE (Plenum
Press 1998); Cell AND TISSUE CULTURE: LABORATORY PROCEDURES (A.
Doyle, J. B. Griffiths, and D. G. Newell, eds., J. Wiley and Sons
1993-8); METHODS IN ENZYMOLOGY (a series of volumes directed at
enzymology protocols that is published by Academic Press, Inc.);
HANDBOOK OF EXPERIMENTAL IMMUNOLOGY (D. M. Weir and C. C.
Blackwell, eds.); GENE TRANSFER VECTORS FOR MAMMALIAN CELLS (J. M.
Miller and M. P. Calos, eds., 1987); CURRENT PROTOCOLS IN MOLECULAR
BIOLOGY (F. M. Ausubel et al., eds., 1987 including supplements
through May 1, 2004); PCR: THE POLYMERASE CHAIN REACTION (Mullis et
al., eds., 1994); CURRENT PROTOCOLS IN IMMUNOLOGY (J. E. Coligan et
al., eds., 1991); and SHORT PROTOCOLS IN MOLECULAR BIOLOGY (F. M.
Ausubel et al., eds., Wiley and Sons, 1999); all of which are
respectively incorporated herein by reference in their entireties.
Furthermore, procedures employing commercially available assay kits
and reagents typically are used according to manufacturer-defined
protocols unless otherwise noted.
II. DEFINITIONS
[0064] The term "target nucleic acid sequence" generally refers to
a nucleic acid sequence detected using the methods, compositions
and assay systems of the invention. All or part of the target
nucleic acid sequence may bind with a nucleic acid analog molecule
by sequence-specific hybridization. The target nucleic acid
sequence may be of any length, but is typically less than about 1
Kb in length, less than about 500 bases in length, less than about
24 bases in length, or less than about 12 bases in length. In a
further embodiment, the target nucleic acid sequence can be about
10, about 12, about 14, or about 18 bases in length. In other
embodiments, the target nucleic acid can be at least about 4, at
least about 5, at least about 6, at least about 7, at least about
8, at least about 9, at least about 10, at least about 12, at least
about 14, at least about 15, at least about 18, at least about 20,
at least about 25, at least about 30, at least about 35, at least
about 40, at least about 45, or at least about 50 bases in length.
The target nucleic acid sequence of the invention may include
protein coding sequence and/or non-coding sequences (e.g.,
regulatory sequences, introns, etc).
[0065] The term "polynucleotide" refers to a polymeric form of
nucleotides of any length, either deoxyribonucleotides or
ribonucleotides, or analogs thereof. The following are non-limiting
examples of polynucleotides: a gene or gene fragment, exons,
introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA,
ribozymes, cDNA, recombinant polynucleotides, branched
polynucleotides, plasmids, vectors, nucleic acid probes, primers,
and amplified DNA. A polynucleotide may contain modified
nucleotides, such as methylated nucleotides and nucleotide analogs.
The sequence of nucleotides may be interrupted by non-nucleotide
components. A polynucleotide may be further modified before or
after polymerization, such as by conjugation with a labeling
component. The polynucleotide may be an amplified region of a
longer polynucleotide.
[0066] The term "target polynucleotide" refers to a polynucleotide
that includes a target nucleic acid sequence.
[0067] The term "nucleic acid analog" includes any nucleic acid
analog having one or more bases that differ from guanine,
thymidine, adenosine, cytosine, or uracil, and/or having one or
more differences in a phosphoribose of an RNA backbone or
phosphodeoxyribose of a DNA backbone. "Nucleic acid analogs"
include, but are not limited to, peptide nucleic acids (PNAs),
locked nucleic acids (LNA), such as those disclosed in TRENDS IN
BIOTECHNOLOGY 21:74-81 (2003), metal-linked nucleic acids, modified
polynucleotides such as anthraquinone-modified (as disclosed in
Yamana et al., NUCLEIC ACIDS RES. SUPPL. 2003:89-90 (2003), threose
nucleic acids (TNAs), such as those disclosed in Chaput et al., J.
AMER. CHEM. SOC., 125, 856-857 (2003), and chimeric nucleic
acids.
[0068] The term "peptide nucleic acid," or "PNA," includes any
nucleic acid analog in which the deoxyribose phosphate backbone of
a nucleic acid has been replaced by a synthetic peptide-like
backbone, including, for example, N-(2-amino-ethyl)-glycine units,
such as, without limitation, that depicted in FIG. 2 hereof (also,
see Nielsen et al., Science 254:1497-500 (1991), and those
disclosed in U.S. Pat. Nos. 5,786,461, 6,357,163, 6,107,470,
5,773,571, 6,441,130, 6,451,968, 6,228,982, 5,641,625, 5,766,855,
5,736,336, 5,719,262, 5,714,331, 5,719,262, and 6,414,112. The
purine and pyrimidine bases may be attached by any covalent
linkage, including, for example, methylene carbonyl linkages. As
used herein, PNA molecules can have additional atoms between the
PNA backbone and nucleobase. These analogs include, for example,
D-lysine chains, cyclic structures such as cyclopentane or
pyrrolidine rings, and/or chiral substitutents, including PNA
molecules described in U.S. Pat. No. 6,403,763, U.S. Patent
Application 2003/0162699, and U.S. Patent Application 2003/0157500.
The PNA backbone may include substitutions or extensions in the
peptide backbone. PNAs may include peptide-based nucleic acid
mimics (PENAMS), such as those disclosed, for example, in U.S. Pat.
No. 5,705,333, atoms having unusual chiral centers, such as
D-chiral centers and quasi-chiral centers, and atom substitutions
in the PNA backbone.
[0069] The terms "nucleic acid analog/polynucleotide hybrid" and
"polynucleotide/nucleic acid analog hybrid" are synonymous and
refer to a nucleic acid analog and polynucleotide hybridized in a
sequence-specific manner.
[0070] The terms "PNA/polynucleotide hybrid" and
"polynucleotide/PNA hybrid" are synonymous and refer to a PNA and
polynucleotide hybridized in a sequence-specific manner.
[0071] By "complementary" it is meant that the single-stranded
nucleic acid analog molecule has the ability to bind
polynucleotides in a base-specific manner. The nucleic acid analog
molecule may be synthesized to bind a target polynucleotide, such
as a full-length polynucleotide strand or a part thereof. A nucleic
acid analog molecule that is "complementary" may have one or more
single base pair mismatches, additions, and/or deletions, but is
still capable of binding the target polynucleotide under the
selected hybridization conditions. In one embodiment, complementary
sequences may hybridize through Watson-Crick (A-T or A-U and C-G).
In a further embodiment, complementary sequences may hybridize
through Hoogstein base pairing between the nucleic acid analog and
polynucleotide nucleobases.
[0072] By "exactly complementary" it is meant that the
single-stranded nucleic acid analog molecule has the ability to
bind a target nucleic acid sequence and contains no mis-matches. A
nucleic acid analog molecule is not exactly complementary to a
target polynucleotide if there is a single base-pair mismatch
between the nucleic acid analog and the target polynucleotide.
[0073] The term "rate" refers to a change (e.g., of a property of a
composition or compound). A rate may be described in terms of a
specific rate constant. A rate may be determined by making
measurements over a period of time. A rate may be described by
making measurements, determined by measurements at two different
time points in a process (e.g., before and after a specific
stimulus, addition of a component, etc.), or by making measurements
at least three, at least four, or at least five, timepoints. A rate
may be expressed in quantitative or qualitative terms (e.g. a
change is "fast" or "slow"). A rate may be determined by comparing
a property or compound to a reference value, or by other
methods.
[0074] As used herein, the term "relative rate" refers to the rate
of one process compared to the rate of another process. A "relative
rate" may be approximate (e.g. the rate of one process may be
"faster" or "slower" than the rate of another process) or
qualitative (e.g. comparing measured rate constants of two
processes).
[0075] As used herein, the term "dye" refers to a compound that has
a measurable optical property or that may be converted to a
compound with a measurable optical property. Measurable optical
properties include, but are not limited to color, absorbance,
fluorescence, reflectance, and chemiluminescence. The dye may
exhibit the optical property under certain conditions, such as
binding a polynucleotide/nucleic acid analog hybrid, or failing to
bind a polynucleotide/nucleic acid analog hybrid.
[0076] "Armored RNA.TM." refers to an RNA that is ribonuclease
resistant due to the encapsidation of the RNA by bacteriophage
proteins. "Armored RNA.TM." is further described, for example, in
U.S. Pat. Nos. 6,399,307, 6,214,982, 5,939,262, 5,919,625, and
5,677,124.
[0077] "Non-specific carrier polynucleotide" as used herein refers
to non-target polynucleotide molecules that increase the binding
affinity of nucleic acid analogs with specific target
polynucleotides and/or enhances the sensitivity of assay
system.
[0078] As used herein, the term "nucleic acid analog binding site"
refers to the point of attachment of one or more nucleic acid
analog molecules to a solid support.
[0079] As used herein, the term "PNA binding site" refers to the
point of attachment of one or more PNA molecules to a solid
support.
[0080] "Sample" refers to a liquid sample of any type (e.g. blood,
serum, water, or urine), and/or a solid sample of any type (e.g.
cells, food, water, air, dirt, or grain), and/or an airborne sample
of any type.
[0081] The term "subject" refers to a multicellular organism, such
as an animal, such as a vertebrate, preferably a mammal. A
particularly preferred subject addressed in the context of the
present invention is a human. Another preferred subject is a plant,
inclusive of monocots and dicots.
[0082] The term "pathogen" refers to any agent causing a disease,
disorder and/or pathological condition and/or symptoms. By way of
example, the pathogen may be an organism (or its associated toxin)
found in nature, or created in a laboratory, that causes disease in
or development of a pathological condition or symptom in,
incapacitates, debilitates and/or kills an organism. Pathogens
include, but are not limited to, virus, bacteria, fungi, protozoa,
eukaryotes, and/or prokaryotes, as well as biological weapons
agents, infectious diseases, water borne pathogens, and food
pathogens.
[0083] The term "biological weapons agent" refers to any organism
(or its associated toxin) found in nature or created in the
laboratory that is used for the primary purpose of causing disease
in, incapacitating, or killing another living organism. Examples of
biological weapons agents include, but are not limited to,
pathogenic bacteria, fungi, protozoa, rickettsiae, and viruses.
[0084] As used herein, the term "infection" refers to the presence
of a pathogen in a host. The infection may be dormant or virulent.
In one embodiment, the presence of the pathogen is indicated by an
alteration in host polynucleotide and/or polypeptide expression.
Infection may occur through such routes including, but not limited
to, airborne droplets, direct contact, animal or insect vectors,
and contaminated food or drink.
[0085] As used herein, the term "host response polynucleotide"
refers to a polynucleotide that is altered, or a polynucleotide for
which the expression is altered, in a host in response to a
stimulus, such as infection, and/or contact by a pathogen.
[0086] The term "host" as used herein refers to animals and plants.
The animal may be a mammal. Examples of mammals include humans,
non-human primates, farm animals, sport animals, mice, and rats.
Examples of plants include, but are not limited to, agricultural
crops.
III. METHODS OF DETECTING POLYNUCLEOTIDES
[0087] The present application provides methods, compositions and
assay systems for detecting a polynucleotide having a target
nucleic acid sequence using nucleic acid analogs. In one
embodiment, (i) a sample that contains or may contain, is believed
to contain, or is expected not to contain a target polynucleotide,
(ii) a nucleic acid analog that binds a target nucleic acid
sequence of the polynucleotide in a sequence-specific manner, and
(iii) a dye for which the rate of change in an optical property is
different in the presence and absence of a polynucleotide/nucleic
acid analog hybrid or whose optical property is affected by the
content and/or conditions of the present invention, are combined to
produce a mixture. The mixture may further include a non-specific
carrier polynucleotide such as, but not limited to, non-specific
plant DNA, yeast DNA, salmon sperm DNA or tRNA. The rate of change
in the optical property of the dye in the mixture is compared to a
reference value characteristic of the rate of change in the optical
property of the dye in a similar mixture containing a known amount
(including a zero amount) of a polynucleotide/nucleic acid analog
hybrid to determine a relative rate of change in the optical
property. In an alternative method for understanding a result when
using this embodiment, the optical property of the mixture once
fully constituted is compared before and after the exposure of the
mixture to a stimulus means, as further described below. The
relative rate of change in the optical property of dye in the
mixture or the change in the optical property before and after (or
the mixture's optical property after) exposure to the stimulus
means is correlated with the presence or amount of the target
polynucleotide in a sample to determine the presence or amount of
target polynucleotide in the sample wherein the amount of target
polynucleotide may be an approximate amount.
[0088] In one aspect, the present application provides methods,
compositions and assay systems for detecting a polynucleotide
having a target nucleic acid sequence using peptide nucleic acid
(PNA) molecules. In one embodiment, (i) a sample that may contain
or contains, is believed to contain, or is expected not to contain
a target polynucleotide, (ii) a peptide nucleic acid (PNA) that
binds a target nucleic acid sequence of the polynucleotide in a
sequence specific manner, and (iii) a dye for which the rate of
change in an optical property is different in the presence and
absence of a polynucleotide/PNA hybrid or whose optical property is
affected by the content and/or conditions of the present invention
are combined to produce a mixture. The mixture may further include
a non-specific carrier polynucleotide such as, but not limited to,
non-specific plant DNA, yeast DNA, salmon sperm DNA or tRNA. The
rate of change in the optical property of the dye in the mixture is
compared to a reference value characteristic of the rate of change
in the optical property of the dye in a similar mixture containing
a known amount (including a zero amount) of a polynucleotide/PNA
hybrid to determine a relative rate of change in the optical
property. In an alternative method for understanding a result when
using this embodiment, the optical property of the mixture once
fully constituted is compared before and after the exposure of the
mixture to a stimulus means, as further described below. The
relative rate of change in the optical property of dye in the
mixture or the change in the optical property before and after
exposure to the stimulus means is correlated with the presence or
amount of the specified polynucleotide in a sample to determine the
presence or amount of target polynucleotide in the sample, wherein
the amount of polynucleotide may be an approximate amount.
[0089] A reference value can be a value characteristic of a
property of a composition or compound having a known
characteristic. For example, in various embodiments, a reference
value can be determined using a mixture that does not contain a
polynucleotide/nucleic acid hybrid; contains some amount (e.g., a
known amount) of a polynucleotide/nucleic acid hybrid; contains a
zero amount of a polynucleotide/nucleic acid hybrid; or is a
reaction mixture from which one or more components (e.g., a nucleic
acid analog, a target polynucleotide, or a dye) has been omitted.
Further nonlimiting examples of reference values include a value
characteristic of an optical property of a mixture that has not
been exposed to light stimulus, or, in an alternative embodiment,
an optical property of a mixture that has been exposed to light
stimulus. The aforementioned examples are for illustration and are
not intended to limit the invention, and other examples will be
apparent to the practitioner guided by this disclosure. It will be
appreciated that a reference value may be, but need not necessarily
be, empirically determined (for example, if it is known that the
optical properties of composition containing a dye do not change,
or change minimally, in the absence of target
polynucleotide/nucleic acid analog hybrid, the reference value may
be calculated or inferred and not measured). The reference value
may be a constant. Although in some cases it may be convenient to
assay a "control" sample concurrently with test samples, it is not
necessary to do so. A reference value can be determined at one time
point, and the value recorded to comparison at later time points.
It will be understood that the aforementioned examples are for
illustration and not limitation. A variety of reference values are
described throughout the specification.
[0090] In one aspect, the reference value is characteristic of the
rate of change in the optical property of the dye in a similar
mixture containing no polynucleotide/nucleic acid analog hybrid. In
one embodiment, the reference value may be characterized by the
optical property of the dye prior to the combination of all the
components in the mixture. In another embodiment, the reference
value may be a standard value. For embodiments in which the mixture
is exposed to light stimulus, the reference value may be
characteristic of the optical property of the dye prior to applying
light stimulus. It will be clearly understood that the reference
value need not be determined simultaneously with the optical
property of the dye in the sample, nucleic acid analog, and dye
mixture. In addition it is understood that the reference value may
a constant.
[0091] Reference to a specific example will assist in the
understanding of the invention. A liquid-based version of this
method using PNA is illustrated in Example 1 and FIG. 4. Ten .mu.M
of a PNA molecule complementary to the cauliflower mosaic virus 35S
promoter ("35S PNA"), and 1 .mu.M 35S promoter DNA (35S DNA) were
mixed in a microfuge tube and 150 .mu.lA4 dye was added. The tube
was exposed to a light stimulus and over the course of 1 minute the
color change was observed (FIG. 4); a change in the optical
property of the dye. In the control tubes, the target
polynucleotide was absent and the color remained pink even after 24
hours (without light stimulus), indicating a very slow rate of
change in the optical property. Little change in an optical
property (in this case color change) is observed in the tubes where
the 35S PNA is either absent (Tube 3) or does not have a specific
target (Tube 1).
[0092] A further example using a PNA probe is illustrated in FIG.
1. A) A membrane strip with discrete addresses of PNA sequences
complementary to one or more target polynucleotide sequence is
placed in the lysis/hybridization tube 1. B) A sample is added to
the lysis/hybridization buffer and the mixture is heated to
95.degree. C. for 3 minutes and C) cooled to room temperature. D)
The strip is transferred to a fresh tube (tube 2), which contains
washing buffer for incubation. Unbound DNA, RNA, and other cellular
debris are removed. E) The strip is transferred to a fresh tube
(tube 3) containing the detection dye and allowed to incubate for
approximately 1 minute. F) The strip is briefly washed in washing
buffer (tube 4) to remove residual unbound dye. G) Based on the
pattern of hybridization the presence of specific target
polynucleotides can be determined by the change of an optical
property. The change of an optical property may include, for
example, alteration, breakdown or conversion of the dye. By a
comparison with a card of known patterns the presence and identity
of the substance can be determined.
[0093] A further example is illustrated in FIG. 22. Ten .mu.M of a
PNA molecule complementary to a target nucleic acid sequence and 1
.mu.M target polynucleotide were mixed in a microfuge tube. Two
.mu.M of dye and various amounts of a detergent (namely, TWEEN.RTM.
20; purchased from Sigma-Aldrich Corporation, St. Louis, Mo.) were
added. The tubes were exposed to a light stimulus and over the
course of 10 minutes the change in optical properties was observed
(FIG. 22). When greater than 1.0% TWEEN.RTM. 20 is present, less of
a change in the optical property is observed for samples containing
dye or probe as compared to the sample containing the target
polynucleotide/nucleic acid analog hybrid. When the sample
containing the target polynucleotide/nucleic acid hybrid is exposed
to light stimulus, the fluorescence (or other optical property) of
the dye changes. The presence or amount of a target polynucleotide
is detected by observing the change in the fluorescence (or other
optical property). It will be appreciated that the presence or
amount of target polynucleotide can be accomplished by a single
measurement. The amount of target polynucleotide may be an
approximate amount.
[0094] In a further embodiment, a plurality of nucleic acid analog
sequence can be combined in the mixture to detect a plurality of
target polynucleotides by multiplexing. Multiplex reactions
involving known nucleic acid assay systems may be found at, for
example, U.S. Pat. No. 5,582,989.
[0095] Without intending to be bound to a particular mechanism or
theory, in one aspect the nucleic acid analog/polynucleotide hybrid
may mediate a reaction involving the dye, for example, a chemical
reaction. Mediating a reaction includes, for example, accelerating,
such as in the presence of a catalyst, or decelerating, such as
under reduced temperature. In one aspect the nucleic acid
analog/polynucleotide hybrid may catalyze a chemical reaction
involving the dye. The dye binds to the minor groove of the nucleic
acid analog/polynucleotide hybrids, which acts as a catalytic site.
Application of a light stimulus adds energy to the mixture and
causes a change in the optical property of the dye in the nucleic
acid analog/polynucleotide hybrid at a faster rate than in the
absence of a nucleic acid analog/polynucleotide hybrid.
3,3'-diethylthiacarbocyanine iodide, for example, turns clear on
application of a light stimulus. The higher rate of change in an
optical property of the dye corresponds to an increased presence of
target polynucleotide in the sample.
[0096] Without intending to be bound to a particular mechanism or
theory, one theory by which a change in a property of a mixture
comprising the sample, polynucleotide, nucleic acid analog and dye
may occur is via a chemical reaction that alters the dye. The
resultant change in the property of the mixture may be observed as
a decrease in a property of the mixture as the dye is converted to
a different chemical entity. Alternatively, the resultant change
may be observed as an increase in a property. In the context of
such a chemical reaction, there may be other properties of the
mixture that indicate such a chemical reaction has occurred.
Indicators include, for example, a change in the pH of the mixture,
the detection of a new chemical entity, or a fragment thereof, a
change in a secondary reaction, the formation of a precipitate, the
dissolution of a precipitate, a change in conductivity, ionic
strength, dipole moment, viscosity, temperature, or transparency of
the mixture. One skilled in the art can look towards inherent
properties of a given mixture and/or such a chemical reaction that
takes place in the context of the mixture for identifying one of
these or other properties by which to measure a change that is then
correlated to the detection of a target entity.
[0097] The following sections describe aspects of the invention in
further detail.
[0098] A. Designing Nucleic Acid Analog Sequences
[0099] For use in the present invention, nucleic acid analogs may
be designed to be complementary, but possibly including some
mismatched bases, or exactly complementary to a nucleic acid
sequence in a target polynucleotide. In one embodiment, the nucleic
acid analog is greater than about 4 nucleotides in length and less
than about 24 nucleic acid bases in length excluding linkers, amino
acids and labels. In other embodiments, the nucleic acid analog may
be from about 5 to about 100, from about 8 to about 60, or from
about 10 to about 25 nucleic acid bases in length. In another
embodiment, the nucleic acid analog may be about 6, about 8, about
10, about 12, about 14, or about 18 nucleic acid bases in length,
excluding linkers, amino acids and labels. In other embodiments,
the target nucleic acid can be at least 4, at least 5, at least 6,
at least 7, at least 8, at least 9, at least 10, at least 12, at
least 14, at least 15, at least 18, at least 20, at least 25, at
least 30, at least 35, at least 40, at least 45, or at least 50
bases in length. Nucleic acid analogs may be designed to have a
portion that is non-complementary to the target polynucleotide,
such as a sequence that hangs off the end of the
polynucleotide.
[0100] The sequence of the nucleic acid analog molecules may be
designed in a variety of ways. By way of example, and not
limitation, the nucleic acid analog molecules may be designed to
have sequences based on known primers used for PCR-based
amplification and detection of specific target sequences. The
nucleic acid analog molecule may also be designed to be
complementary or exactly complementary to any target nucleic acid
sequence of the polynucleotide. By way of example, the sequence of
the nucleic acid analog molecule may be based on the sequence of
PCR primers used to detect polynucleotides associated with
pathogens, the presence of a pathogen in a host, a disease gene, or
genetic condition. The nucleic acid analog molecule may also be
complementary or exactly complementary to all or part of the
sequence encoding the active or functional domains of a protein or
the intact protein and or non-coding sequences (e.g., regulatory
sequences, introns, etc.).
[0101] In one embodiment, nucleic acid analogs can be used to
distinguish between polynucleotides having an exactly complementary
sequence and one with a single base mismatch. For example and
without limitation, nucleic acid analogs for use in the invention
may be designed to detect single nucleotide polymorphisms (SNPs).
Nucleic acid analog/polynucleotide hybridization is affected by
base mismatches. According to the methods of the invention, upon
the addition of a dye, a single base mismatch between a target
sequence (e.g., a SNP) and a nucleic acid analog results in a
different rate of change in optical property of the dye compared to
a nucleic acid analog that does not have the mismatch. The
identification of SNPs for diagnosis and other methods is well
known in the art.
[0102] In another embodiment, the nucleic acid analog may be
designed to detect the presence or amount of a class of organisms.
By class of organisms, it is meant that all organisms have one or
more sequences that are complementary to, or exactly complementary
to, a nucleic acid analog sequence. Such classes of organisms can
be distinguished from other organisms based on the complementarity
to nucleic acid sequences.
[0103] In another embodiment, the nucleic acid analog molecule has
a purine content of less than about 60%, including a maximum of 4
purine bases or three guanine bases in a row. Purine-rich nucleic
acid analog molecules tend to aggregate and have low solubility in
aqueous solutions. The nucleic acid analog molecules are selected
to preferably minimize or avoid self-complementary sequences with
inverse repeats, hairpins and palindromes since these types of
probes are prone to aggregate.
[0104] Nucleic acid analog molecules may hybridize to
polynucleotides in either orientation, but an anti-parallel
orientation is preferred. Anti-parallel is the preferred
configuration for antisense and DNA probe-type applications. When
the orientation of the nucleic acid analog is anti-parallel, the
N-terminal of the nucleic acid analog probe is equivalent to the
5'-end of the DNA. Both N' and 5' are used herein.
[0105] One of skill in the art, guided by this disclosure, will
recognize that in addition to nucleic acid analogs specifically
listed herein, other nucleic acid analogs (including nucleic acid
analogs discovered or developed in the future) may be used in the
methods of the invention. Nucleic acid analogs that form a
polynucleotide/nucleic acid analog hybrid under the assay
conditions described herein are suitable for the present methods,
and affect the rate of change in an optical property.
[0106] Nucleic acid analogs suitable for use in the methods can be
identified using any of a variety of screening methods. In one
method, for example and not limitation, a sample containing a
candidate nucleic acid analog, optionally at varying
concentrations, is combined with a polynucleotide having a
complementary sequence under conditions under which a nucleic acid
analog/polynucleotide hybrid is formed. In an embodiment, a dye is
then added. The rate of change in optical property of the dye is
then determined. This rate is compared to a reference value
characteristic of the rate of change in optical property of the dye
in the absence of a nucleic acid analog/polynucleotide hybrid. In a
further embodiment, the reference value is characteristic of the
absence of polynucleotide. In a still further embodiment, the
reference value is characteristic of the presence of target
polynucleotide (single stranded or double stranded). It will be
recognized that the order of addition is not critical and
components can be added in other orders.
[0107] In another embodiment, the reference value is characteristic
of a non-zero concentration of polynucleotide. In this embodiment,
nucleic acid analogs/polynucleotide hybrids result in a different
rate of change in optical property over time compared to a
reference value (e.g., the presence of double-stranded
polynucleotide but absence of nucleic acid analog/polynucleotide
hybrid) are selected for use in the claimed methods. The relative
rate of change in the optical property is correlated with the
presence or amount of specific polynucleotide.
[0108] B. Peptide Nucleic Acids (PNAs)
[0109] In one aspect, the nucleic acid analogs are PNAs. The PNA
hybridizes to all or part of a target nucleic acid sequence in a
target polynucleotide by sequence specific hybridization.
Alternatively, the conditions may be varied such that a single base
pair change can be distinguished.
[0110] PNA molecules can hybridize rapidly to target
polynucleotides. PNA hybridization to polynucleotides is
independent of salt concentration (Demidov et al., BIOCHEM.
PHARMACOL. 48:1310-3 (1994)). PNAs are resistant to nuclease and
protease attack, and bind to polynucleotides more specifically than
conventional DNA probes. Short probes can be used with great
sequence specificity (Ray and Norden, FASEB J. 14:1041-60 (2000)).
Furthermore, PNA/polynucleotide hybrids have higher thermal
stability than the corresponding DNA/polynucleotide hybrids, and
the melting point of PNA/polynucleotide hybrids is relatively
insensitive to ionic strength, showing equal thermal stability
under low (<10 mM NaCl) and moderate (500 mM NaCl) salt
concentrations. This ability of PNA/polynucleotide hybrids to form
under low salt conditions is significant because the internal
structure of dsRNA and rRNA is significantly destabilized at salt
concentrations below 200 mM. Therefore, assay conditions can be
chosen that favor the disruption of the target nucleic acid while
still promoting strong hybridization of PNA molecules (Stefano and
Hyldig-Nielsen, Diagnostic Applications of PNA oligomers, in
DIAGNOSTIC GENE DETECTION AND QUANTIFICATION TECHNOLOGIES 19-39
(Minden ed., 1997). PNA/polynucleotide hybridization is severely
affected by base mismatches and PNA molecules can maintain sequence
discrimination up to the level of a single mismatch.
[0111] PNA molecules may be purchased, for example, from Eurogentec
(UK), Bio-Synthesis (Louisville, Tex.), and Applied Biosystems Inc.
(Foster City, Calif.), or synthesized by methods known in the
art.
[0112] C. Hybridization Conditions
[0113] Generally, the design and/or choice of hybridization
conditions is governed by several parameters, such as, but not
limited to, the degree of complementarity of the nucleic acid
analog molecule to the target polynucleotide, the length of the of
the nucleic acid analog molecule to be utilized and the target
polynucleotide itself. Preferred hybridization conditions allow for
one or more of the following: efficient binding of nucleic acid
analogs to target polynucleotides, minimization of RNA or DNA
secondary structure, minimization of RNA degradation and either
discrimination of one or more base pair changes or inclusion of one
or more base pair changes.
[0114] Hybridization reactions can be performed under conditions of
different "stringency". Conditions that effect stringency of a
hybridization reaction are widely known and published in the art.
See, for example, Sambrook et al. (2000), supra. Examples of
relevant conditions include but are not limited to, salt
concentrations, pH (buffers) and temperature. Hybridization
conditions utilizing lower salt concentrations generally enhance
double stranded DNA instability and promote PNA/polynucleotide
stability. Examples of buffers that may be used include, but are
not limited to, Na.sub.3PO.sub.4, NaHSO.sub.4, K.sub.2HPO.sub.4,
K.sub.2SO.sub.4, or CaSO.sub.4. By way of example, the molarity of
the buffers may range between about 0.5 mM and about 0.5 M and have
a pH between about 4 to about 10, or between about 7 to about 10,
such as about 7.0 or about 7.5. By way of example, Na.sub.3PO.sub.4
may be used at between about 0.5 mM and about 0.5 M, such as for
example, 2.5 mM, and at a pH between about 4 to about or between
about 7 to about 10, such as about 7 or about 7.5.
[0115] Examples of sample conditions include but are not limited to
(in order of increasing stringency): incubation temperatures of
about 25.degree. C., about 37.degree. C., about 50.degree. C. and
about 68.degree. C.; buffer concentrations of about 10.times.SSC,
about 6.times.SSC, about 4.times.SSC, about 1.times.SSC, about
0.1.times.SSC (where 1.times.SSC is 0.15 M NaCl and mM of any
buffer as described herein) and their equivalents using other
buffer systems; formamide concentrations of 0%, about 25%, about
50%, and about 75%; incubation times from about 5 minutes to about
24 hours; 1, 2, or more washing steps; wash incubation times of
about 1, about 2, or about 15 minutes; and wash solutions of about
6.times.SSC, about 1.times.SSC, about 0.1.times.SSC, or deionized
water. In a preferred embodiment hybridization and wash conditions
are done at high stringency. By way of example hybridization may be
performed at about 50% formamide and about 4.times.SSC followed by
washes of about 2.times.SSC/formamide at about 50.degree. C. and
with about 1.times.SSC.
[0116] Buffers may contain ions or other compounds, or different
buffering capacity. Alternatively a component in the buffer may
have a stabilization capacity; such as neomycin or other
aminoglycosides, that stabilizes triplex DNA, (Arya et al., J. AM.
CHEM. Soc. 125:3733-44 (2003)) or naphthalene diimides that enhance
triplex stability (Gianolio and McLaughlin, BIOORG. MED. CHEM.
9:2329-34 (2001)), or naphthylquinoline dimers (Keppler et al.,
FEBS LETT. 447:223-6 (1999)).
[0117] D. Dyes
[0118] The presence or amount of a polynucleotide may be determined
by using one or more dyes for which the rate of change in an
optical property is different in the presence of a nucleic acid
analog/polynucleotide hybrid compared to the a known concentration
of nucleic acid analog/polynucleotide hybrid. In one aspect, the
optical property may be a change in color, absorbance,
fluorescence, reflectance, or chemiluminescence. The optical
property may also be measured at a single or multiple times during
an assay.
[0119] The rate of change in an optical property of the dye may be
compared to a reference value characteristic of the rate of change
in the optical property of the dye in a mixture containing a known
amount of a nucleic acid analog/polynucleotide hybrid or
polynucleotide/PNA hybrid to determine a relative rate of change in
the optical property. The reference value may be a qualitative or
approximate value (e.g. the presence or absence of color).
Alternatively, the reference value may be a numerical value. As
another example, the reference value may be measured or determined
before, during, or after the determination of the rate of change in
the optical property of the dye for the sample. In a further
example, the reference value may be a constant, such as a rate
constant. The reference value may also be the rate of change in the
optical property of dye in the absence of a target polynucleotide
or polynucleotide/nucleic acid analog hybrids or nucleic acid
analog (i.e., the known amount of a nucleic acid
analog/polynucleotide hybrid is zero) or in the presence of nucleic
acid analog of different sequence composition.
[0120] In some cases, the dye has a higher rate of change in the
optical property in the presence of nucleic acid
analog/polynucleotide hybrid than a reference value characteristic
of the absence of a nucleic acid analog/polynucleotide hybrid. The
presence or amount of the polynucleotide can thus be detected by an
increase in the relative rate of change in the optical property
compared to a reference value. Examples of dyes in which an optical
property changes more rapidly in the presence of a nucleic acid
analog/DNA hybrid include carbocyanine dyes, which are multi-ring
aromatic compounds. These dyes absorb intensely in the visible
range and bind preferentially to nucleic acid analog/polynucleotide
hybrids in solution, changing color upon binding, Wilhelmsson et
al., NUCLEIC ACID RES. 30:E3 (2002)). Examples of cyanine dyes
include but are not limited to 3,3'-diethylthiacyanine iodide
(Sigma, Milwaukee), 3,3'-diethylthiacarbocyanine iodide,
3,3'-diethylthiadicarbocyanine iodide, and
3,3'-diethylthiatricarbocyanine iodide.
[0121] In one embodiment, the dye is 3,3'-diethylthiacyanine
iodide.
[0122] In one embodiment, the dye is 3,3'-diethylthiacarbocyanine
iodide.
[0123] In one embodiment, the dye is 3,3'-diethylthiadicarbocyanine
iodide.
[0124] In one embodiment, the dye is
3,3'-diethylthiatricarbocyanine iodide.
[0125] In one exemplary embodiment, under assay conditions
described herein, 3,3'-diethylthiacarbocyanine turns from hot pink
to clear with light stimulus in the presence of target nucleic
acids and complementary PNA. In the absence of target nucleic acids
the rate of change of the dye is slower. Light stimulus also
decreases the fluorescent emission of the dye in the presence of
target nucleic acids and complementary PNA. In the absence of light
stimulus the dye immediately turns from hot pink to dull pink in
the presence of target nucleic acids, and the fluorescent emission
of the dye immediately decreases in the presence of target nucleic
acids.
[0126] Under assay conditions described herein,
3,3'-diethylthiadicarbocyanine turns from blue to purple in the
presence of target nucleic acids.
[0127] Under assay conditions described herein,
3,3-diethylthiatricarbocyanine remains aqua blue in the presence of
target nucleic acids and turns clear in the absence of target
nucleic acids.
[0128] In other cases, the dye has a lower rate of change in the
optical property in the presence of nucleic acid
analog/polynucleotide hybrid than in the absence of a nucleic acid
analog/polynucleotide hybrid. The presence or amount of the
polynucleotide can thus be detected by a decrease in the relative
rate of change in the optical property compared to a reference
value characteristic of the rate in the absence of a nucleic acid
analog/polynucleotide hybrid.
[0129] Dyes may be selected from, for example, molecules that
associate with nucleic acids in any of a variety of ways. Useful
dyes include minor groove binders, major groove binders,
intercalators and other polynucleotide-binding molecules,
derivatives thereof, and conjugates thereto. Some dyes useful in
the methods of the invention bind the minor groove of nucleic acid
analog/polynucleotide hybrids. These dyes include carbocyanine
dyes; such as 3,3'-diethylthiacarbocyanine iodide,
3,3'-diethylthiadicarbocyanine iodide, and
3,3'-diethylthiatricarbocyanine iodide. Examples include, but are
not limited to, ethidium bromide (Fiebig et al., PROC. NATL. ACAD.
SCI. USA 96:1187-92 (1999)), flourescein, phenothiazine dyes, such
as methylene blue (Wagner, TRANSFUS. MED. REV. 16:61-66 (2002)),
DAPI (Kapuscinski, J. BIOTECH. HISTOCHEM. 70:220-233 (1995)),
thiazole orange (Boger et al., BIOORG. MED. CHEM. 9:2511-18 (2001);
Carreon et al., ORG. LETT. 6:517-519 (2004)), Hoechst 33258
(Adhikary et al., NUCLEIC ACIDS RES 31:2178-86 (2003), Maiti et
al., BIOCHEM. BIOPHYS. RES. COMMUN. 310:505-512 (2003), Morozkin et
al., ANAL. BIOCHEM. 322:48-50 (2003), Tanious et al., J. AM. CHEM.
SOC. 126:143-153 (2004), Tawar et al., BIOCHEMISTRY 18:13339-46
(2003)), SYBR Green II (Morozkin et al., supra), BEBO, BETO, BOXTO,
BO, BO-PRO, TO-PRO, YO-PRO (Karlsson et al., NUCLEIC ACIDS RES.
31:6227-34, (2003), Eriksson et al., NUCLEIC ACIDS RES. 31:6235-42
(2003)), PicoGreen (Tolun and Myers, NUCLEIC ACIDS RES. 31:e111
(2003)), TO-PRO-3 (Sovenyhazy et al., NUCLEIC ACIDS RES. 31:2561-9
(2003)), biscyanine dye (Schaberle et al., BIOPHYS. ACTA
1621:183-191 (2003)), methyl green-pyronin Y (Prento et al.,
BIOTECH. HISTOCHEM. 78:27-33 (2003)), ethidium bromide and acridine
orange (Johnson et al., J. BIOMOL. STRUCT. DYN. 20:677-686 (2003),
Lauretti et al., J. VIROL. METHODS 114:29-35 (2003), Luedtke et
al., BIOCHEMISTRY 42:11391-403 (2003)), neutral red (Wang et al.,
BIOPHYS. CHEM. 104:239-48 (2003)), BO (Karlsson et al., BIOORG.
MED. CHEM. 11:1035-40 (2003)), mono- and bis-lexitropsins and
pentamidine (Puckowska et al., EUR. J. MED. CHEM. 39:99-105
(2004)), 2-(methylthio) phenylsalicylaldimine Schiff base copper
(II) (Reddy et al., J. INORG. BIOCHEM. 98:377-86 (2004)), a
bifunctional platinum (II) complex (Ma and Che, CHEMISTRY 9:6133-44
(2003)), bis(9-aminoacridine-4-carboxamides) (Wakelin et al., J.
MED. CHEM. 46:5791-802 (2003)), bisimidazoacridones (Tarasov et
al., PHOTOCHEM. PHOTOBIOL. 78:313-22 (2003)), parallel or
anitparallel carboxamide minor groove binders (Boutorine et al.,
NUCLEOSIDES NUCLEOTIDES NUCLEIC ACIDS 22:1267-72 (2003)),
conjugates of oligo (2'-O-methylribonucleotides) with minor groove
binders (Novopashina et al., NUCLEOSIDES NUCLEOTIDES NUCLEIC ACIDS
22:1179-82 (2003)), pyrrole-imidazole polyamines (Briehn et al.,
CHEMISTRY 9:2110-22 (2003), Dervan et al., CURR. OPIN. STRUCT.
BIOL. 13:284-299 (2003), Reddy et al., J. AM. CHEM. SOC.
125:7843-48 (2003), Renneberg et al., J. AM. CHEM. SOC. 125:5707-16
(2003)), pyrrole (Huang et al., BIOORG. CHEM. 28:324-37 (2000)),
bispyrrole (Carrasco et al., CHEMBIOCHEM. 3:50-61 (2003)),
ruthenium complex (Kuwabara et al., ANAL. BIOCHEM. 314:30-37
(2003)), thallium (Ouameur et al., J. BIOMOL. STRUCT. DYN.
20:561-565 (2003)), aromatic diamidine (Nguyen et al., J. AM. CHEM.
SOC. 124:13680-81 (2002)), chartreusin (Barcelo et al., NUCLEIC
ACIDS RES. 30:4567-73 (2002)), platinum complex (Silverman et al.,
J. BIOL. CHEM. 277:49743-49 (2002)),
S-3-nitro-2-pyridinesulfenyl-N-acetyl-cysteine (Shim et al., ORG.
BIOMOL. CHEM. 2:915-21 (2004)), methylsulfonate esters (Varadaraj
an et al., BIOCHEMISTRY 42:14318-27 (2003)), peptide
bis-intercalator (Guelev et al., CHEM. BIOL. 8:415-25 (2001)),
metallointercalators (Proudfoot et al., BIOCHEMISTRY 40:4867-78
(2001), 2,2'-binaphthalene (Kondo et al., BIOORG. MED. CHEM. LETT.
14:1641-43 (2004)), intercalating nucleic acid (Christensen et al.,
NUCLEIC ACIDS RES. 30:4918-25 (2002), Nielsen et al., BIOCONJUG.
CHEM. 15:260-9 (2004)), ruthenium (II) complex (Liu et al., INORG.
CHEM. 43:1799-806 (2004)), cyclic polyamine neotrien/copper (II)
complex (Biver et al., J. INORG. BIOCHEM. 98:33-40 (2004)),
2,6-disulfonic acid anthraquinone (Wong et al., ANAL. CHEM.
75:3845-52 (2003)), ferrocenyl anthracene, ferrocenyl, and other
naphthalene diimdie derivatives (Gianolio et al., supra; Takanaka
et al., NUCLEIC ACIDS RES. SUPPL. 2002:291-2 (2002), Tok et al.,
BIOORG. MED. CHEM. LETT. 11:2987-91 (2001)), doxorubicin (Patolsky
et al., ANGREW. CHEM. INT. ED. ENGL. 41:3398-402 (2002); Xiao et
al., CHEM. COMMUN. (CAMB.) 7:1540-41 (2003)), acridin-9-ylthiourea
(Baruch et al., NUCLEIC ACIDS RES. 31:4138-46 (2003)), naphthalene
diimide (Nojima et al., NUCLEIC ACIDS RES. SUPPL. 2001:105-6
(2001), M. E. Numez et al., BIOCHEMISTRY 39:6190-99 (2000)),
mitoxantrone (Wang et al., ACTA A. MOL. BIOMOL. SPECTROSC.
59:949-56 (2003)), cryptolepine and neocryptolepine (Guittat et
al., BIOCHIMIE. 85:535-47 (2003)), iminodiacetic acid-linked
polyamides (Woods et al., J. AM CHEM. SOC. 124:10676-82 (2002a)),
dendritic polyamine conjugates (Brana et al., EUR. J. MED. CHEM.
37:541-51 (2002)), bis-intercalator delta-delta [mu-C49
cpdppz)(2)-(phen) (4)Ru(2)] (Onfelt et al., J. AM CHEM. SOC.
123:3630-37 (2001); Onfelt et al., MUTAGENESIS 17:317-20 (2002)),
ditercalinium (Berge et al., NUCLEIC ACIDS RES. 30:2980-86 (2002)),
8-methoxypsoralen (Arabzadeh et al., INT. J. PHARM. 237:47-55
(2002)), daunomycin and ellipticine (Reha et al., J. AM CHEM. SOC.
124:3366-76 (2002)), 1,4,5,8-naphthalene tetracarboxylic diimide
(Guelev et al., J. AM CHEM. SOC. 124:2864-65 (2002)), cryptolepine
(Lisgarten et al., NAT. STRUCT. BIOL. 9:57-60 (2002)), AMAC (Ferry
et al., J. CHROMATOGR. B. BIOMED. SCI. APPL. 763:149-56 (2001)),
(-)-6-[[(aminoalkyl)oxy]methyl]-4-demethoxy-6,7-dideoxydaunomcinones(1)
(Dienes et al., J. ORG. CHEM. 61:6958-6970 (1996)), NLCQ-1
(Papadopoulou et al., ONCOL. RES. 12:325-33 (2000)), YOYO-1 (Wong
et al., BIOCHIM. BIOPHYS. ACTA 1527:61-72 (2001)), DACA (Hicks et
al., J. PHARMACOL. EXP. THER. 297:1088-98 (2001)), cyclometalated
Rh(III) (Kisko et al., INORG. CHEM. 39:4942-49 (2000)), CI-958
(Dees et al., CLIN. CANCER RES. 6:3885-94 (2000)), pyrazoloacridine
(Pelley et al., CANCER CHEMOTHER. PHARMACOL. 46:251-4 (2000)),
cis-dichloroplatinum (II) complexes (Perrin et al., J. INORG.
BIOCHEM. 81:111-7 (2000)), imidazoacridinones (Mazerski et al.,
ACTA BIOCHIM. POL. 47:65-78 (2000)), carbazole (Sajewicz et al., J.
APPL. TOXICOL. 20:305-12 (2000)),
5,11-dimethyl-5H-indole[2,3-b]quinoline (Osiadacz et al., BIOORG.
MED. CHEM. 8:937-43 (2000)), YOYO-3, netropsin, SN6999, A3 and
SN6113 (Kirschstein et al., J. MOL. RECOGNIT. 13:157-63 (2000)),
oxazole yellow (Inoue et al., BIOORG. MED. CHEM. 7:1207-11 (1999)),
5,6-chrysenequinone diimine complexes of rhodium (E) (Jackson et
al., BIOCHEMISTRY 39:6176-82 (2000)), Nile blue (Chen et al.,
ANALYST. 124:901-6 (1999)), usambarensine (Dassonneville et al.,
ANTICANCER RES. 19:5245-50 (1999)), 3-methosybenzanthrone (Yang et
al., SPECTOCHIM. ACTA A MOL. BIOMOL. SPECTROSC. 55A:2719-27
(1999)), 1,8-dihydroxyanthraquinones (Mueller et al., BIOCHIM.
BIOPHYS. ACTA 1428:406-14 (1999)), cyclopropapyrroloindole (Dempcy
et al., NUCLEIC ACIDS RES. 27:2931-37 (1999)), anthracene
(Ostaszewski et al., BIOORG. MED. CHEM. LETT. 8:2995-6 (1998)),
pyrrolizines and imidazoles (Atwell et al., J. MED. CHEM.
41:4744-54 (1998)), anthracycline complexes (Milano et al., Radiat.
Re. 150:101-14 (1998)), heterodimers such athizole orange-thiazole
blue, thiazole orange-ethidium and flourescein-ethidium (Benson et
al., NUCLEIC ACIDS RES. 21:5720-26 (1993a); Benson et al., NUCLEIC
ACIDS RES. 21:5727-35 (1993b)). In addition companies (e.g.
Molecular Probes) sell many types of nucleic acid stains that may
be compatible with the system. Other classes of cyanine dyes and
state reactive dyes may be found in JOURNAL OF THE AMERICAN
CHEMICAL SOCIETY 125:4132-4145 (2003) and BIOCONJUGATE CHEMISTRY
13:387-391 (2002). Examples of additional dyes include, but are not
limited to, ternary copper(II) complexes (Dhar et al., J. AM CHEM.
SOC. 125:12118-24 (2003)), di stamycin A (Hiraku et al., NUCLEIC
ACIDS RES. SUPPL. 2002:95-96 (2002); Woods et al., BIOORG. MED.
CHEM. LETT. 12:2647-50 (2002b), indolo [2,3-b]-quinolizinium
bromide (Viola et al., CHEMBIOCHEM. 3:550-8 (2002)), ecteinascidins
(Anthoney et al., AM. J. PHARMACOGENOMICS 1:67-81 (2001)), metal
amines (Barry et al., INORG. CHEM. 41:7159-69 (2002)), or
2-phenylquinoline-carbohydrate hybrids (Toshima et al., ANGELA.
CHEM. INT. ED. ENGL. 38:3733-3735 (1999)). In some embodiments, the
dye is not a compound that promotes cleavage.
[0130] Dyes may also include malachite green, red biarsenical dye
and flourescein. In some embodiments, the dye is not malachite
green, red biarsenical dye or flourescein.
[0131] One of skill in the art will recognize that dyes may be
screened to identify those dyes that may be used in the present
methods. Dyes that bind nucleic acid analog/polynucleotide hybrids
and exhibit a change in an optical property over time, optionally
after being provided with a stimulus, may be readily identified and
selected.
[0132] One of skill in the art, guided by this disclosure, will
recognize that in addition to the dyes listed herein, other dyes
(including dyes discovered or developed in the future) may be used
in the methods of the invention. Dyes for which the rate of change
in an optical property is different in the presence and absence of
a target polynucleotide/nucleic acid analog hybrid under the assay
conditions described herein are suitable for the present
methods.
[0133] Suitable dyes can be identified using any of a variety of
screening methods. For example and not limitation, a sample
containing a nucleic acid analog is combined with a polynucleotide
having a complementary sequence under conditions under which a
nucleic acid analog/polynucleotide hybrid is formed. In an
embodiment, the candidate dye is then added, optionally at varying
concentrations. The order of addition is not critical and
components can be added in other orders. The rate of change in
optical property over time is then determined. This rate is
compared to a reference value characteristic of the rate of change
in optical property of the dye in the absence of a nucleic acid
analog/polynucleotide hybrid. In one embodiment, the reference
value is characteristic of the absence of polynucleotide. In one
embodiment, the reference value is characteristic of the presence
of polynucleotide (single stranded or double stranded). In another
embodiment, the reference value is characteristic of a non-zero
concentration of polynucleotide. Dyes that exhibit a different rate
of change in optical property over time compared to a reference
value are selected for use in the claimed methods. The relative
rate of change in the optical property is correlated with the
presence or amount of specific polynucleotide.
[0134] E. Stimulus
[0135] The stimulus to the mixture that includes the nucleic acid
analog that specifically binds a target polynucleotide, and a
sample that may include a target polynucleotide, can be any form of
energy that can trigger a chemical reaction of the substrate, such
as a dye. Stimulus means usefully employed in the present invention
include appropriate wavelengths of the visible and invisible light
spectrum, heat, and the like. Preferred stimulus means include
light as further set forth herein below. The stimulus means is
provided to a sample, nucleic acid analog, and dye mixture either
concurrently with the production of the mixture, or at a specified
time after the production of the mixture. The stimulus causes a
change in the rate of change in an optical property of the dye.
[0136] The stimulus, such as a light stimulus, may be applied to a
mixture of the sample, nucleic acid analog, and dye in a continuous
manner or over a discrete time period. The change in the optical
property of the mixture may be observed while or after the mixture
is exposed to the stimulus. The resultant change of the optical
property in response to the stimulus does not substantially alter
upon removal of the stimulus.
[0137] The light stimulus may be in the visible spectrum or outside
the visible spectrum. The light stimulus may be white light of a
number of wavelengths. Alternatively, the light stimulus may be a
specific wavelength, or range of wavelengths. The light stimulus
may also have a specific intensity.
[0138] Light sources are known in the art. Different light sources
result in different reaction rates because of differences in
intensity or wavelengths of the light sources. Examples of light
sources, in ascending order of reaction rate, include Sylvania Cool
White T8-CW, General Electric T8-050, and Fritz Aurora 50/50. Other
light sources include a Sylvania dulux S9W CF.sub.9DS/blue and a
Osram F9TT/50K, which both result in faster light stimulated
reaction rates than the General Electric T8-C50. Other examples of
light sources include LEDs, including for example, Hebei 520 PG0C,
540IB7C and the Xenon USHIO UXL-553 lamp.
[0139] Those of skill in the art will recognize the optimal light
stimulus may be determined without undue experimentation for a
specific dye, or a specific nucleic acid analog, polynucleotide,
and dye mixture. A single set of temperature and concentration
conditions can be tested for a specific mixture.
IV. FORMING A TARGET POLYNUCLEOTIDE/NUCLEIC ACID ANALOG HYBRID
[0140] Assays for detection of target polynucleotides can be
carried out using a variety of hybridization schemes. In one
format, the polynucleotide sequence may be identified by
hybridization of a target polynucleotide directly to a nucleic acid
analog to form a target polynucleotide/nucleic acid analog
hybrid.
[0141] In one format, the nucleic acid analog may be PNA. PNA/PNA
has a distance or pitch that is different from the DNA/DNA distance
or pitch and from the PNA/DNA distance or pitch. The detailed
structure of PNA/PNA and PNA/DNA duplex hybrids have been solved by
NMR and X-ray crystallography. A PNA/PNA duplex hybrid has a very
wide and deep major groove and a very narrow and shallow minor
groove, and the duplex has a very large pitch of 18 base pairs per
turn and a large pitch height (57.6 .ANG.). A canonical B-form
helix seen for a DNA/DNA duplex hybrid has a pitch of 10 base pairs
per turn and 34 .ANG. of pitch height, whereas a PNA/DNA duplex
hybrid has a pitch of 13 base pairs per turn and 42 .ANG. of pitch
height. Because base pairs in a PNA/DNA duplex hybrid possess a
different geometry compared with DNA double helices, the strength
of the stacking interaction of PNA/DNA duplex hybrids is expected
to be different from that of DNA/DNA duplex hybrids. CD spectra of
10, 12, and 16 mer PNA/DNA duplex hybrids suggest different base
configuration for these duplex hybrids.
[0142] Depending on the dye and its binding site, a nucleic
analog/polynucleotide hybrid can affect whether the reaction
proceeds. For example, dyes that bind the major or minor groove of
a hybrid may require the hybrid to contain a certain number of base
pairs in order to bind effectively. The minimum number of base
pairs can be determined easily by those of ordinary skill in the
art.
[0143] In one aspect, a target nucleic acid analog molecule is
complementary to a partially complementary nucleic acid analog. The
nucleic acid analog hybridizes to both a nucleic acid analog
molecule and a target polynucleotide, as depicted in FIG. 18A. This
may be accomplished in a one step or multistep process. In a one
step process, the target polynucleotide and nucleic acid analogs
are combined in a single step. In a multistep process, the target
polynucleotide and nucleic acid analogs are combined
sequentially.
[0144] In a further aspect, the presence of a target polynucleotide
may be detected by forming branched reaction crucifix form
structure, an example of which is depicted in FIG. 18B. In this
format, a target polynucleotide is hybridized to two intermediate
polynucleotides that are partially complementary to the target
polynucleotide. The intermediate polynucleotides form a branched
structure that hybridizes to a target polynucleotide and a primary
nucleic acid analog molecule. The target hybridizing regions of the
intermediate polynucleotides may be designed to be too short for a
dye to bind the nucleic acid analog molecule separately, but large
enough to bind the nucleic acid analog molecules when hybridized.
The rate of optical change of a dye may be then determined. In one
embodiment, the single nucleic acid analog molecule may be a
universal nucleic acid analog that is used for all assays, and
optimized for effective changes in the optical property of a dye.
The universal nucleic acid analog could be used for any target
nucleic acid, and the intermediate sequences could be varied. This
scheme can be adapted to a format using an immobilized nucleic acid
analog.
[0145] In another format, multiple nucleic acid analog molecules
form a nucleic acid analog/polynucleotide hybrid with adjacent
regions of a target polynucleotide. In this format, each nucleic
acid analog molecule is too short for a dye to bind and result in a
change in the rate of optical property of the dye, but multiple
nucleic acid analog molecules may provide a large enough region for
a rate of change in optical property to result. As depicted in FIG.
18C, a target polynucleotide as a single molecule may be bound to
form a nucleic acid analog/polynucleotide duplex by three separate
nucleic acid analog molecules that hybridize to adjacent sequences.
If the center nucleic acid analog molecule cannot hybridize as in
FIG. 18D, however, then a change in optical property may not be
observed. In this format, one of the nucleic acid analog molecules
may be immobilized.
V. QUANTIFYING THE AMOUNT OF A TARGET POLYNUCLEOTIDE
[0146] The methods, compositions, and assay systems may be used to
quantify the amount of target polynucleotide in a sample. In one
embodiment, the amount of a target polynucleotide may be detected
by establishing serial dilutions of the nucleic acid analog
molecule, adding various amounts of the target polynucleotide
samples, and comparing the samples to controls of known
concentrations. In another embodiment, the amount of a target
polynucleotide may be detected by establishing serial dilutions of
the target polynucleotide, adding various amounts of the nucleic
acid analog molecules, and comparing the samples to controls of
known concentrations.
[0147] Alternatively, the amount of a target polynucleotide can be
detected by measuring the kinetics of the assay based on time.
Measurements of the dye in the combined mixture are taken at
regular intervals after preparation of the mixture, or after
application of light stimulus. The dye may be detected at distinct
times after combination of the mixture, or after application of the
light stimulus. The time may be any time period, for example the
total time for the change in optical property, or the time required
for the optical property to have changed by a certain percentage,
such as, but not limited to, about 20%. The reactions can be frozen
(further change stopped), for example with the addition of solvents
such as 20% methanol, 15% isopropanol, 15% DMSO, or 10%
butanol.
[0148] The reaction can also include a range of buffers and
solvents. These buffers and solvents include phosphate buffers,
water, 0.1% SDS, 0.1% Triton.RTM. X, 0.1% TWEEN.RTM. 20, 0.05%
TWEEN.RTM. 80, 3% butanol, 10% methanol, 10% isopropanol, 10% DMSO,
1.times. blood lysis buffer (0.15 M NH.sub.4Cl, 10 mM NaHCO.sub.3,
0.1 mM EDTA pH 7.4), sucrose lysis buffer (0.32 M sucrose, 10 mM
Tris, 1% Triton.RTM. X-100, 5 mM MgCl.sub.2), and 5 mM phosphate
buffer (pH 5.5) with 0.05% TWEEN.RTM. 80).
[0149] The quantity of polynucleotide in a sample may be determined
after exposure to the light stimulus. The change in the optical
property of the dye may be measured following pre-exposure to the
light stimulus for the starting optical property. Measurements may
be taken at distinct times (for example, taken at 30 second
intervals) after exposure to the light stimulus. The reactions can
be frozen (further change stopped) as described above.
[0150] Changes in the sample due to exposure to the light stimulus
can be observed in several ways. The change in the optical property
may be observed as a change in color, absorbance, fluorescence,
reflectance, chemiluminescence, or a combination thereof.
Alternatively, the change in optical property can be read using a
reader. This change is measured using a spectrophotometer, such as
Tecan Genios or a Tecan Safire. Specific wavelengths may be
observed, for example by a filter. A positive control expresses a
change in absorbance faster than a negative test. It can be
measured as a difference in the rate of change, or the difference
in the change at a set time. If fluorescent properties are
observed, the light stimulus (excitation stimulus) provided to the
sample is at a higher energy (lower wavelength) than the observed
emission. The excitation may be at, for example, 535 nm and the
emission may be read at 590 nm. The fluorescence may be measured as
a difference in the rate of change or the difference in the change
at a set time.
[0151] In addition the mixture may have a change that occurs before
exposure to the light stimulus. This difference may be observed in
either a spectrophotometric system, a fluorescence emission system,
or a chemiluminescent system.
VI. ASSAY FORMATS
[0152] A. Liquid-Based Assay System
[0153] As demonstrated in Examples 1-4, the methods and assay
system for detecting a target polynucleotide may be liquid-based.
The sample, a nucleic acid analog that binds a target nucleic acid
sequence of the polynucleotide in a sequence specific manner, and a
dye for which the rate of change in the optical property is
different in the presence and absence of a nucleic acid
analog/polynucleotide hybrid, are combined to produce a mixture in
liquid solution. The rate of change in the optical property of the
dye in the mixture is compared to a reference value characteristic
of the rate of change in the optical property of the dye in a
similar mixture containing a known amount of a nucleic acid
analog/polynucleotide hybrid to determine a relative rate of change
in the optical property. The relative rate of change in the optical
property of dye in the mixture correlates to the presence or amount
of the specified polynucleotide in a sample to determine the
presence or amount of polynucleotide in the sample.
[0154] The method and assay system may also be prepared in any
vessel, such as microfuge tubes, test tubes, and chips that hold a
liquid by surface tension. The methods and assay system may also be
prepared in multiwell plates. The plates may contain any number of
wells. In one format, 96 well plates are used. In another format,
384 plates are used. When the assay format is in a microwell
format, the liquid is retained in each well of a microtiter
plate.
[0155] B. Solid Support-Based Assay System
[0156] The methods and assay system may be solid based (e.g. one or
more components are immobilized on a solid support). Most often,
the nucleic acid analog or target polynucleotide is immobilized.
There are many types of solid supports that the nucleic acid analog
or target polynucleotide molecules may be attached to, including
but not limited to: cast membranes (nitrocellulose, nylon),
ceramic, track-etched membranes (TEM), polyvinylidenedifloride,
latex, paramagnetic beads, plastic supports of all types, glass;
powdered silica or alumina on a support matrix. If a grid pattern
is used, the nucleic acid analog molecule/solid support forms a
microarray. In another variation, the nucleic acid analog or target
polynucleotide molecules may be covalently modified to include a
linking moiety, such as a biotin or amide linkage, which binds to
membranes. In a further variation, the nucleic acid analog or
target polynucleotide molecules may be immobilized via sequence
specific hybridization to one or more sequences.
[0157] FIG. 17 depicts a schematic representation of light stimulus
activated, surface immobilized detection of polynucleotides
captured by nucleic acid analogs. A) Streptavidin well. B)
Biotinylated nucleic acid analogs are added to the well and allowed
to attach to the support. C) The well is washed and excess nucleic
acid analogs are removed. D) Sample polynucleotide is added and
specific sequence target attaches to the complementary nucleic acid
analogs. E) Nonspecific and excess polynucleotide is washed off. F)
Dye mixture is added and exposed to the light stimulus.
[0158] Any means of attaching a nucleic acid analog molecule to a
support is contemplated by the instant invention. In one aspect,
the nucleic acid analog molecule may be attached directly to a
membrane. The nucleic acid analog may be a PNA (e.g., A Giger et
al., NUCLEOTIDES AND NUCLEOSIDES 17:1717-1724 (1998)). A solution
of nucleic acid analog molecules (in water) is simply applied to a
charged or chemically modified filter and allied to air dry. The
filter is then used for hybridization.
[0159] In another aspect, a biotin labeled nucleic acid analog
molecule may be attached to a streptavidin-coated surface, such as
a bead or well (see, e.g., Chandler et al., ANAL. BIOCHEM.
283:241-249 (2000)). Biotin labeled nucleic acid analog molecules
mixed with streptavidin-labeled latex or polycarbonate beads. The
Biotin binds strongly with streptavidin, allowing the nucleic acid
analog molecule to bind to the bead in a unidirectional fashion.
The beads are then applied to a non-charged membrane with a mesh
size 25-30% greater that the diameter of the bead. Beads become
trapped in the mesh, hence making a localized area of "attached
nucleic acid analog molecules." Direct synthesis of nucleic acid
analog molecules on a solid support such as a polypropylene
membrane may be accomplished using standard
9-fluorenylmethoxycarboyl (Fmoc) protein synthesis chemistry (see,
e.g., S. Matysiak et al., BIOTECHNIQUES 31:896-904 (2001)) or tBoc
protein synthesis chemistry (Nielsen, 1991, supra).
[0160] In another aspect, the nucleic acid analog molecules may be
fixed to a glass or other solid support by applying a solution
containing nucleic acid analog molecules in water directly to the
glass or other support and letting it air dry.
[0161] In one variation, the nucleic acid analog molecule is
designed to produce a net positive charge, and may bind a
negatively charged membrane. For example, a positively charged
lysine or glycine at a 5' or 3' end of the nucleic acid analog
molecule may be used to attach the nucleic acid analog molecule to
a negatively changed nylon membrane. The negatively charged
membrane repels any nucleic acid that is not complementary and/or
exactly complementary to the nucleic acid analog, thus minimizing
non-specific binding.
[0162] Any target polynucleotide, or group of target
polynucleotides, may be detected by the solid support-based system.
In this case, a solid support contains multiple nucleic acid analog
molecules immobilized on a solid support. A control nucleic acid
analog that does not form nucleic acid analog/polynucleotide hybrid
molecules, may be included on the solid support.
[0163] The solid support-based assay system may be used to detect
at least one target polynucleotide. In other variations, the solid
support-based system detects or measures the expression of at least
about 8, at least about 10, at least about 20, at least about 30,
at least about 40, at least about 50, or at least about 60
different target polynucleotides. In another variation, the solid
support-based system detects and distinguishes expression of 60 or
more target polynucleotides.
[0164] As an example, and not for limitation, a solid support-based
version of this assay using a membrane as a solid support is
depicted in FIG. 3. The assay detects the presence of a target
polynucleotide. The system allows small amounts of specific target
polynucleotide to be identified and/or quantified within minutes,
and gives a visual signal (e.g. rate of pink color changes to
clear) without the need for extensive equipment. After sample
lysis, hybridization, and introduction of the dye, a light stimulus
is provided, and the rate of change of the colored pattern on the
membrane is observed. The rate of change in the pattern of the
colored bands on the membrane allows the user to easily determine
the presence and identity of target polynucleotides. Optionally,
the method or a variation thereof may be performed on a small
battery operated hand-held device. In an automated robotic version
all steps can be performed by a machine without human
intervention.
[0165] The solid support based assay system may be in a microtiter
plate arrangement. Any microtiter plate known in the art may be
used. The assay components may remain liquid in such an assay
system. In one format, 96-well plates are used. In another format,
384-well plates are used. When the assay is in a microtiter format,
all components except for those bound to the solid surface remain
in solution in each well of a microtiter plate.
VII. TARGET POLYNUCLEOTIDES AND SOURCES OF TARGET
POLYNUCLEOTIDES
[0166] The target polynucleotide may be any polynucleotide,
including naturally occurring, synthetic, and amplified. Other
types of polynucleotides may be single or double stranded.
Non-limiting examples of target polynucleotides include DNA, RNA,
regulatory RNA, mRNA, regulatory microRNA, siRNA, artificial RNA,
and chimeric RNA. Other non-limiting examples of target
polynucleotides include epigenomic DNA, epigenetic DNA, in vitro
amplified DNA, and chimeric DNA. The target polynucleotide may
contain SNPs that are identified or quantitated by the methods
disclosed herein.
[0167] The methods, systems, and assays described herein have a
variety of uses. Non-limiting examples of these uses include
detecting and quantifying organisms, pathogens, such as foodborne
pathogens, environmental pathogens, waterborne pathogens, or
pathogens implicated in agroterrorism. Other non-limiting uses
include disease diagnosis such as sexually transmitted disease
diagnosis, detection of genes conferring anti-biotic resistance,
detection of genes conferring a predisposition for drug responses,
detection of genes implicated in an effective drug response,
detection of genetically modified organisms, and detection of
non-indigenous flora or fauna. Additional non-limiting applications
include agricultural applications and veterinary applications.
[0168] Examples, for illustration and not for limitation, are
described below.
[0169] A. Pathogens
[0170] In one aspect, the invention relates to methods,
compositions and assay systems for detecting the presence of a
pathogen and/or the infection of a host by a pathogen. Generally,
the presence of a pathogen and/or the presence of a pathogen in a
host is detected by analysis of target polynucleotides in a sample.
More specifically, the invention relates to methods, compositions
of matter and assay systems for analyzing target polynucleotides by
sequence specific hybridization to a nucleic acid analog molecule
and addition of the dye to form a mixture. The rate of dye change
in optical property is then observed to detect the presence or
quantity of the target polynucleotide.
[0171] Examples of pathogens or presence of the pathogen in a host
that may be detected by the methods and assay systems includes, but
is not limited to, Staphylococcus epidermidis, Escherichia coli,
methicillin-resistant Staphylococcus aureus (MSRA), Staphylococcus
aureus, Staphylococcus hominis, Enterococcus faecalis, Pseudomonas
aeruginosa, Staphylococcus capitis, Staphylococcus warneri,
Klebsiella pneumoniae, Haemophilus influnzae, Staphylococcus
simulans, Streptococcus pneumoniae and Candida albicans.
[0172] Additional examples include, but are not limited to,
Bacillus anthracis (Anthrax), Clostridium botulinum (Botulism),
Brucellae (Brucellosis), Vibrio cholera (Cholera), Clostridium
perfringens (gas gangrene, Clostridial myonecrosis, enteritis
necroticans), Ebola virus (Ebola Hemorrhagic Fever), Yersinia
pesits (Plague), Coxiella burnetii (Q Fever), and Smallpox virus
(Smallpox). In a preferred variation, infection by Bacillus
anthracis is detected.
[0173] Examples of host response polynucleotides for Bacillus
anthracis include, but are not limited to, those disclosed by M.
Mock and T. Mignot (CELL MICROBIOL. 5:15-23 (2003)) and D. S. Reed
et al. (CYTOMETRY 49:1-7 (2002)), or are easily obtained by methods
known in the art.
[0174] Pathogens may be distinguished from other pathogens based on
their target polynucleotides. Specific pathogens have specific
target polynucleotides that are not found in other pathogens.
Nucleic acid analog molecules are designed to be complementary or
exactly complementary to one or more target polynucleotides that
identify a specific pathogen. When contacted with the target
polynucleotides of the pathogen, the nucleic acid analog molecule
hybridizes to the polynucleotides containing the target
polynucleotide, but not to polynucleotides that do not contain the
target polynucleotide. Specific pathogens that contain a target
polynucleotide may thus be distinguished from pathogens that do not
contain the target polynucleotide.
[0175] In addition, different strains of the same pathogen may be
distinguished. Different strains of the same pathogen have
different polynucleotide sequences. Frequently, the differences are
as few as a single nucleotide. Nucleic acid analog molecules are
designed to be complementary or exactly complementary to one or
more target polynucleotides that identify a specific strain of
pathogen. When contacted with the target polynucleotides of the
pathogen, the nucleic acid analog molecule hybridizes to the
polynucleotides containing the target polynucleotide, but not to
polynucleotides that do not contain the target polynucleotide. When
the target polynucleotide is specific to a specific pathogen
strain, nucleic acid analog molecules hybridize to the target
polynucleotides contained in the pathogen strain, and do not
hybridize to target polynucleotides of the different strain.
[0176] Examples of pathogens of clinical importance and the
references for the PCR-based detection are listed below. Nucleic
acid analog molecules may be designed to have the sequence of
specific pathogen PCR primer sequences, and can be used in
combination in many of the embodiments of the invention described
herein.
[0177] In one embodiment, the pathogen may be Staphylococcus
epidermidis. Nucleic acid analogs may be designed to have sequences
or fragments of sequences similar or identical to PCR primers used
to identify Staphylococcus epidermidis. Examples of these PCR
primers are disclosed in the art (see, e.g., P. Francois et al., J.
CLIN. MICROBIOL. 41:254-60 (2003); F. Fitzpatrick et al., J. HOSP.
INFECT. 52:212-8 (2002); and J. Yugueros et al., J. CLIN.
MICROBIOL. 38:4351-5 (2000).
[0178] The pathogen may be Escherichia coli. Nucleic acid analogs
may be designed to have sequences or fragments of sequences similar
or identical to PCR primers used to identify Escherichia coli.
Examples of these PCR primers are disclosed in the art (see, e.g.,
L. C. Heller et al., APPL. ENVIRON. MICROBIOL. 69:1844-6 (2003); H.
Rahman, INDIAN J. MED. RES. 115:251-4 (2002); and E. Frahm and U.
Obst., J. MICROBIOL. METHODS 52:123-31 (2003)).
[0179] The pathogen may be methicillin-resistant Staphylococcus
aureus (MSRA). Nucleic acid analogs may be designed to have
sequences or fragments of sequences similar or identical to PCR
primers used to identify Staphylococcus aureus (MSRA). Examples of
these PCR primers are disclosed in the art (see, e.g., W. B. van
Leeuwen et al., J. CLIN. MICROBIOL. 37:3029-30 (1999); P. Francois
et al., J CLIN. MICROBIOL. 41:254-60 (2003); and M. Tsuruoka and I.
Karube, COMB. CHEM. HIGH THROUGHPUT SCREEN 6:225-34 (2003)).
[0180] The pathogen may be Candida. Nucleic acid analogs may be
designed to have sequences or fragments of sequences similar or
identical to PCR primers used to identify Candida. Examples of
these PCR primers are disclosed in the art (see, e.g., S. Ahmad et
al., J. CLIN. MICROBIOL. 40:2483-9 (2002); and U. H. Tirodker et
al., J. PERINATOL. 23:117-22 (2003)).
[0181] The pathogen may be Candida albicans. Nucleic acid analogs
may be designed to have sequences or fragments of sequences similar
or identical to PCR primers used to identify Candida albicans.
Examples of these PCR primers are disclosed in the art (see, e.g.,
P. L. White et al., J. MED. MICROBIOL. 52:229-38 (2003); M.
Grijalva et al., HEART 89:263-8 (2003); and B. Willinger et al., J.
CLIN. MICROBIOL. 41:581-5 (2003)).
[0182] The pathogen may be Staphylococcus aureus. Nucleic acid
analogs may be designed to have sequences or fragments of sequences
similar or identical to PCR primers used to identify Staphylococcus
aureus. Examples of these PCR primers are disclosed in the art
(see, e.g., P. D. Francois et al., J. CLIN. MICROBIOL. 41:254-60
(2003); C. Palomares et al., DIAGN. MICROBIOL. INFECT. DIS.
45:183-9 (2003); and J. Xu et al., J. APPL. MICROBIOL. 94:197-206
(2003)).
[0183] The pathogen may be Staphylococcus hominis. Nucleic acid
analogs may be designed to have sequences or fragments of sequences
similar or identical to PCR primers used to identify Staphylococcus
hominis. Examples of these PCR primers are disclosed in the art
(see, e.g., R. Marsou et al., PATHOL. BIOL. (PARIS) 49:205-15
(2001); J. Yugueros et al., J. CLIN. MICROBIOL. 38:4351-5 (2000);
and M. Wieser and H. J. Busse, INT. J. SYST. EVOL. MICROBIOL.
50:1087-93 (2000)).
[0184] The pathogen may be Enterococcus faecalis. Nucleic acid
analogs may be designed to have sequences or fragments of sequences
similar or identical to PCR primers used to identify Enterococcus
faecalis. Examples of these PCR primers are disclosed in the art
(see, e.g., C. R. Hudson et al., LETT. APPL. MICROBIOL. 36:245-50
(2003); S. M. Donabedian et al., J. CLIN. MICROBIOL. 41:1109-13
(2003); and V. Gauduchon et al., J. CLIN. MICROBIOL. 41:763-6
(2003)).
[0185] The pathogen may be Pseudomonas aeriginosa. Nucleic acid
analogs may be designed to have sequences or fragments of sequences
similar or identical to PCR primers used to identify Pseudomonas
aeriginosa. Examples of these PCR primers are disclosed in the art
(see, e.g., M. E. Corbella et al., APPL. ENVIRON. MICROBIOL.
69:2269-75 (2003); G. Agarwal et al., INDIAN J. MED. RES. 116:
73-81 (2002); and W. Dabrowski et al., FEMS MICROBIOL. LETT.
218:51-7 (2003)).
[0186] The pathogen may be Staphylococcus capitis. Nucleic acid
analogs may be designed to have sequences or fragments of sequences
similar or identical to PCR primers used to identify Staphylococcus
capitis. Examples of these PCR primers are disclosed in the art
(see, e.g., M. Wieser and H. J. Busse, INT. J. SYST. EVOL.
MICROBIOL. 50:1087-93 (2000); and F. Martineau et al., J. CLIN.
MICROBIOL. 34:2888-93 (1996)).
[0187] The pathogen may be Staphylococcus warneri. Nucleic acid
analogs may be designed to have sequences or fragments of sequences
similar or identical to PCR primers used to identify Staphylococcus
warneri. Examples of these PCR primers are disclosed in the art
(see, e.g., M. Wieser and H. J. Busse, supra; and T. Sashihara et
al., BIOSCI. BIOTECHNOL. BIOCHEM. 64:2420-8 (2000)).
[0188] The pathogen may be Klebsiella pneumoniae. Nucleic acid
analogs may be designed to have sequences or fragments of sequences
similar or identical to PCR primers used to identify Klebsiella
pneumoniae. Examples of these PCR primers are disclosed in the art
(see, e.g., F. J. Perez-Perez and N. D. Hanson, J. CLIN. MICROBIOL.
40:2153-62 (2002); C. D. Steward et al., J. CLIN. MICROBIOL.
39:2864-72 (2001); and J. S. Carter and D. J. Kemp, SEX TRANSM.
INFECT. 76:134-6 (2000)).
[0189] The pathogen may be Haemophilus influenzae. Nucleic acid
analogs may be designed to have sequences or fragments of sequences
similar or identical to PCR primers used to identify Haemophilus
influnzae. Examples of these PCR primers are disclosed in the art
(see, e.g., S. Shoma et al., J. HEALTH POPUL. NUTR. 19:268-74
(2001); C. E. Corless et al., J. CLIN. MICROBIOL. 39:1553-8 (2001);
and J. S. Carter and D. J. Kemp., supra.
[0190] The pathogen may be Staphylococcus simulans. Nucleic acid
analogs may be designed to have sequences or fragments of sequences
similar or identical to PCR primers used to identify Staphylococcus
simulans. Examples of these PCR primers are disclosed in the art
(see, e.g., J. Yugueros et al., J. CLIN. MICROBIOL. 38:4351-5
(2000); and P. Szweda et al., PROTEIN EXPR. PURIF. 22:467-71
(2001)).
[0191] The pathogen may be Streptococcus pneumoniae. Nucleic acid
analogs may be designed to have sequences or fragments of sequences
similar or identical to PCR primers used to identify Streptococcus
pneumoniae. Examples of these PCR primers are disclosed in the art
(see, e.g., J. Xu et al., J. APPL. MICROBIOL. 94:197-206 (2003); O.
Greiner et al., J. CLIN. MICROBIOL. 39:3129-34 (2001); and P. E.
Corless, supra.
[0192] The pathogen may be Coronavirus, an RNA virus, for the
detecting SARS. The sequence of coronavirus may be found, for
example at the Center for Disease Control website. Examples of
these target polynucleotides are disclosed in the art (see, e.g.,
T. G. Ksiazek et al., N. ENGL. J. MED. 348:1953-66 (2003); C.
Drosten et al., N. ENGL. J. MED. 348:1967-1976 (2003)).
[0193] The pathogen may be Bordetella pertussis, or whooping cough.
Examples of these target polynucleotides are disclosed in the art
(Doucet-Populaire et al., ARCH. PEDIATR. 9:1145-52 (2002); J. R.
Lingappa et al., J. CLIN. MICROBIOL. 40:2908-12 (2002).
[0194] The pathogen may be Phytophthora ramorum (the cause of
sudden oak death). Examples of these target polynucleotides are
disclosed in the art (see, e.g., L. Levy and V. Mavrodieva,
Evaluation of the PCR Detection and DNA isolation methods for use
in the Phytophthora ramorum, in 2003 NATIONAL PILOT SURVEY,
available at the Purdue University website; B. A. McPherson et al.,
Sudden Oak Death in California, 2003 Home & Landscape,
available at the University of California at Davis website).
[0195] The pathogen may be norwalk virus. Examples of these target
polynucleotides are disclosed in the art (see, e.g., A. S. Khan et
al., J. CLIN. MICROBIOL. 32:318-22 (1994); B. L. Herwaldt et al.,
J. CLIN. MICROBIOL. 32:861-6 (1994)).
[0196] The pathogen may be HIV. Nucleic acid analogs may be
designed to have sequences or fragments of sequences similar or
identical to PCR primers used to identify HIV. Examples of these
PCR primers are disclosed in the art (see, e.g., K. M. Smith et
al., J. NEUROVIROL. 6:164-71 (2000); R. Cuchacovich et al., RHEUM.
DIS. CLIN. NORTH AM. 29:1-20 (2003); P. Cunningham et al. J. CLIN.
VIROL. 26:163-9 (2003).
[0197] The pathogen may be Mycobacterium tuberculosis. Nucleic acid
analogs may be designed to have sequences or fragments of sequences
similar or identical to PCR primers used to identify tuberculosis.
Examples of these PCR primers are disclosed in the art (see, e.g.,
M. J. Tones et al., DIAGN. MICROBIOL. INFECT. DIS. 45:207-12
(2003); B. Bhattacharya et al., TROP. MED. INT. HEALTH 8:150-7
(2003); M. Kafwabulula et al., INT. J. TUBERC. LUNG DIS. 6:732-7
(2002)).
[0198] In another embodiment, nucleic acid analogs are designed
that bind to target polynucleotides common to an entire group of
pathogens. For example, nucleic acid analogs may be designed to
detect bacteria (BP6), gram positive bacteria (BP19), gram negative
bacteria (BP3), and Fungi (FP8). Examples of the sequences of the
nucleic acid analogs for BP6, BP19, BP3, and FP8 are shown
below.
TABLE-US-00001 BP6 oI2018 5'gaaSSMYcYaacacYtagcact [SEQ ID NO: 3]
oI2019 5'tacaaMgagYYgcWagacSgYgaS [SEQ ID NO: 4] BP19 oI2021 5'
gcagYWaacgcattaagcact [SEQ ID NO: 5] oI2022 5'acgacacgagctgacgacaa
[SEQ ID NO: 6] BP3 oI2003 5' tctagctggtctgagaggatgac [SEQ ID NO: 7]
oI2004 5' gagttagccggtgcttcttct [SEQ ID NO: 8] FP8 OI2055 5'
cctgcggcttaatttgactca [SEQ ID NO: 9] OI2057 5'tagcgacgggcggtgtgta
[SEQ ID NO: 10]
[0199] The nucleic acid analogs can be used in clinical
applications for the diagnosis of the microbial cause of sepsis or
in other applications where the microbial content of products in
important in evaluating their shelf-life and stability or other
products where the sterility is being assessed.
[0200] Target polynucleotides may be specific to ribosomal RNA
sequences, such as 16S RNA in E. coli. Ribosomal RNA contains
specific sequences that are characteristic to their organism. By
using nucleic acid analog sequences that are complementary or
exactly complementary to a target polynucleotide characteristic of
the ribosomal RNA sequence, pathogens may be identified based on
their ribosomal RNA sequences. Ribosomal RNA sequences
characteristic of different pathogens or strains of pathogens, may
be found, for example, at (D. J. Patel et al., J. MOL. BIOL.
272:645-664 (1997)).
[0201] B. Host Response Polynucleotides
[0202] The target nucleotide may also be a host response
polynucleotide. After a host is infected with a pathogen, host
genes may be differentially expressed in response to the pathogen
to produce a pattern of mRNA expression (gene expression profile).
The host genes whose pattern of expression correlates with
infection by a specific pathogen are referred to as "diagnostic
marker genes" for that agent. The mRNA is typically derived from
white blood cells in the sample. Methods of identifying a host
response and altered gene expression profiles may be found, for
example, in 1) R. Das et al., PROCEEDINGS: 21ST ARMY SCI. CON.
1998:61-62 (1998); and C. Mendis et al., MOL. BIOL. CELL.
9:450_(1998).
[0203] Methods for gene expression profiling have been developed to
diagnose various medical conditions, as described, for example, in
U.S. Pat. No. 5,723,290 to Eberwine et al., U.S. Pat. No. 6,218,122
to Friend et al., WO 99/10536 to Yarramilli et al., and WO 99/57130
to Prashar et al. Briefly, the method involves obtaining the level
of mRNA expression in selected cells associated with a selected
condition and comparing the relative levels obtained with
established controls. A diagnosis is then made based upon the
comparison of the mRNA expression levels. The mRNA is isolated from
cells by any one of a variety of techniques well known in the art,
but in general, lyse the cells and then enrich for or purify RNA.
Gene expression profiles are then produced by any means known in
the art, including, but not limited to the methods disclosed by:
Prashar et al. in WO 97/05286; Liang et al. in SCIENCE 257:967-971
(1992); Ivanova et al. in NUCLEIC ACIDS RES. 23:2954-2959 (1995);
and Prashar et al. in PROC. NATL. ACAD. SCI. USA 93: 659-663
(1996). These techniques typically produce gene expression profiles
using northern analysis, FRET detection, hybridization to an
oligonucleotide array, hybridization to a cDNA array, cDNA
sequencing, cDNA fingerprinting, and the like. Oftentimes, the gene
expression profile refers to a representation of the expression of
mRNA species such as may be found in an autoradiograph of labeled
cDNA fragments produced from total cellular mRNA separated on the
basis of size by slab gel electrophoresis, capillary gel
electrophoresis, HPLC, and other separation methods.
[0204] The assay systems and methods of this invention provide an
alternative way to assess mRNA expression. As further described
below, levels of mRNA expression (i.e., gene expression profiles)
are compared, or alternatively alterations in mRNA expression from
diagnostic marker genes are detected by assaying for hybridization
of host response mRNAs to their complementary or exactly
complementary nucleic acid analogs.
[0205] C. Foodborne and Environmental Pathogens
[0206] Any foodborne or environmental pathogens may be detected by
the present invention. Foodborne pathogens include, but are not
limited to, Listeria, Campylobacter, E. coli and Salmonella. The
nucleic acid analog methods disclosed herein readily allow the
detection of specific foodborne pathogens. For example, Listeria
may be readily distinguished from Salmonella. Further, specific
strains of foodborne pathogens, such as specific strains of L.
monocytogenes, may be detected.
[0207] Any target polynucleotide associated with foodborne
pathogens may be identified by the methods of the present
invention. Target polynucleotides that characterize specific
pathogens and strains of pathogens may be identified, as discussed
above. The method may be used to detect target polynucleotides
associated with Listeria, Campylobacter, E. coli and Salmonella.
For example, specific Listeria genes that may be identified by the
methods disclosed herein include hly (listeriolysin O) and iap
(invasion associated protein) genes and mRNA (HLYPNA and IAPPNA,
respectively).
[0208] Target polynucleotides having polynucleotide sequences
corresponding to Salmonella spp may be detected. Sequences specific
to Salmonella spp are known in the art (see, e.g., F. J.
Perez-Perez, supra; S. D. Oliveira et al., LETT. APPL. MICROBIOL.
36:217-21 (2003); and C. M. Strapp et al., J. FOOD PROT. 66:182-7
(2003)).
[0209] In another embodiment, target polynucleotides having
polynucleotide sequences corresponding to Escherichia coli may be
detected. Sequences specific to Escherichia coli are known in the
art (see, e.g., L. C. Heller et al., APPL. ENVIRON. MICROBIOL.
69:1844-6 (2003); H. Rahman, INDIAN J. MED. RES. 115:251-4 (2002);
and E. Frahm and U. Obst, J. MICROBIOL. METHODS 52:123-31
(2003)).
[0210] In another embodiment, target polynucleotides having
polynucleotide sequences corresponding to Campylobacter spp. may be
detected. Sequences specific to Campylobacter spp. are known in the
art (see, e.g., J. S. Carter and D. J. Kemp, supra; Y. Moreno et
al., APPL. ENVIRON. MICROBIOL. 69:1181-6 (2003); and D. D. Bang et
al., MOL. CELL PROBES 16:359-69 (2002)).
[0211] In a further embodiment, target polynucleotides having
polynucleotide sequences corresponding to Bacillus spp. may be
detected. Sequences specific to Bacillus spp. are known in the art
(see, e.g., V. Mantynen and K. Lindstrom, APPL. ENVIRON. MICROBIOL.
64:1634-9 (1998); H. Schraft and M. W. Griffiths, APPL. ENVIRON.
MICROBIOL. 61:98-102 (1995); and B. E. Ley et al., EUR. J. CLIN.
MICROBIOL. INFECT. DIS. 17:247-53 (1998)).
[0212] The target polynucleotides having sequences corresponding to
Pseudomonas spp. may also be detected. Sequences specific to
Pseudomonas spp. are known in the art (see, e.g., J. Xu et al., J.
APPL. MICROBIOL. 94:197-206 (2003); B. E. Ley et al., Eur. J. CLIN.
MICROBIOL. INFECT. DIS. 17:247-53 (1998); and K. Johnsen et al.,
APPL. ENVIRON. MICROBIOL. 65:1786-8 (1999).
[0213] The target polynucleotides may also have polynucleotide
sequences corresponding to Enterococcus spp. may be detected.
Sequences specific to Enterococcus spp. are known in the art (see,
e.g., C. R. Hudson et al., LETT. APPL. MICROBIOL. 36:245-50 (2003);
S. M. Donabedian et al., J. CLIN. MICROBIOL. 41:1109-13 (2003); and
S. B. Vakulenko et al., ANTIMICROB. AGENTS CHEMOTHER. 47:1423-6
(2003)).
[0214] Target polynucleotides may also have polynucleotide
sequences corresponding to E. coli 0157. Sequences specific to E.
coli 0157 are known in the art (see, e.g., T. M. Pan et al., J.
FORMOS. MED. ASSOC. 101:661-4 (2002); D. J. Bopp et al., J. CLIN.
MICROBIOL. 41:174-80 (2003); A. M. Ibekweand C. M. Grieve, J. APPL.
MICROBIOL. 94:421-31 (2003)).
[0215] Target polynucleotides may have polynucleotide sequences
corresponding to Listeria spp. and L. monocytogenes. Sequences
specific to Listeria spp. and. L. monocytogenes are known in the
art (see, e.g., D. Volokhov et al., J. CLIN. MICROBIOL. 40:4720-8
(2002); L. Cocolin et al. APPL. ENVIRON. MICROBIOL. 68:6273-82
(2002); A. E. Shearer et al., J. FOOD PROT. 64:788-95 (2001); A.
Bubert et al., APPL. ENVIRON. MICROBIOL. 65:4688-92 (1999); Y. S.
Jung et al., J. FOOD PROT. 66:237-41 (2003); and D. Pangallo et
al., NEW MICROBIOL. 24:333-9 (2001)).
[0216] The target polynucleotides having polynucleotide sequences
corresponding to coliforms may be detected. Sequences specific to
coliforms are known in the art (see, e.g., N. Casas and E. Sunen,
MICROBIOL. RES. 157:169-7 (2002); E. Schvoerer et al., RES.
MICROBIOL. 152:179-86 (2001); A. E. Bernhard and K. G. Field, APPL.
ENVIRON. MICROBIOL. 66:1587-94 (2000)).
[0217] In another embodiment, target polynucleotides having
polynucleotide sequences corresponding to Vibrio cholerae and V.
parahaemolyticus may be detected. Sequences specific to Vibrio
cholerae and V. parahaemolyticus are known in the art (see, e.g.,
M. L. Myers et al., APPL. ENVIRON. MICROBIOL. 69:2194-200 (2003);
G. M. Blackstone et al., J. MICROBIOL. METHODS. 53:149-155 (2003);
and W. J. Lyon, APPL. ENVIRON. MICROBIOL. 67:4685-93 (2001)).
[0218] In a further embodiment, target polynucleotides having
polynucleotide sequences corresponding to molds may be detected.
Sequences specific to molds are known in the art (see, e.g., G. Zur
et al., J. FOOD PROT. 2002 September; 65 (9):1433-40; L. Jimenez et
al., J. MICROBIOL. METHODS 41:259-65 (2000); and N. Vanittanalcom
et al., J. CLIN. MICROBIOL. 40:1739-42 (2002)).
[0219] The target polynucleotides may have polynucleotide sequences
corresponding to Legionella. Sequences specific to Legionella are
known in the art (see, e.g., S. Aoki et al., J. MED. MICROBIOL.
52:325-9 (2003); R. B. Raggam et al., MED. MICROBIOL. IMMUNOL.
(Berl) 191:119-25 (2002); and S. Alexiou-Daniel et al., CLIN.
MICROBIOL. INFECT. 4:144-148 (1998)).
[0220] Host response mRNA may also be detected in response to
infection by foodborne pathogens.
[0221] D. Waterborne Pathogens
[0222] The methods disclosed herein also provide a rapid and
sensitive diagnostic test for the presence and enumeration of
waterborne pathogens. Waterborne pathogens include bacteria,
viruses, and protozoans. Examples of water-borne pathogens include
Enterococci, E. coli, Bacillus spp., Pseudomonas spp.,
Cryptosporidium, and Giardia. Waterborne pathogens may be obtained
from any water sample, including, but not limited to, swimming
pools, aquatic parks, wells, home drinking water, reservoirs,
beaches, lakes, oceans, fish and shellfish farms, agricultural
water, dialysis water, medication reconstitution water, water
treatment facilities, cruise ships, space shuttle effluent, and
bottled water.
[0223] The methods disclosed herein readily allow the detection of
water-borne pathogens. By way of example, specific strains may be
detected. For example, specific strains of Enterococci that be can
be detected over other strains include Enterococci avium, E.
casseliflavus, E. cecorum, E. columbae, E. dispar, E. durans, E.
faecium, E. faecalis, E. gallinarum, E. hirae, E. malodoratus, E.
mundtii, E. pseudovium, E. raffinosus, E. saccharolyticus, and E.
sulfurous.
[0224] Any polynucleotide associated with waterborne pathogens may
be identified by the methods of the present invention. The method
may be used to detect genes associated with Enterococcus spp., E.
coli, Bacillus spp., and Psuedomonas spp., which have been
described (re Escherichia coli: L. C. Heller et al., APPL. ENVIRON.
MICROBIOL. 69:1844-6 (2003); H. Rahman, INDIAN J. MED. RES.
115:251-4 (2002); and E. Frahm and U. Obst, J. MICROBIOL. METHODS
52:123-31. Re Bacillus spp.: V. Mantynen and K. Lindstrom, APPL.
ENVIRON. MICROBIOL. 64:1634-9 (1998); H. Schaft and M. W.
Griffiths, APPL. ENVIRON. MICROBIOL. 61:98-102 (1995); and B. E.
Ley et al., Eur. J. CLIN. MICROBIOL. INFECT. DIS. 17 (4):247-53,
(1998). Re Pseudomonas spp.: J. Xu et al., J. APPL. MICROBIOL.
94:197-206 (2003); B. E. Ley et al., supra; and K. Johnsen et al.,
APPL. ENVIRON. MICROBIOL. 65:1786-8 (1999). Re Enterococcus spp.:
C. R. Hudson et al., LETT. APPL. MICROBIOL. 36:245-50 (2003); S. M.
Donabedian et al., J. CLIN. MICROBIOL. 41:1109-13 (2003); and S. B.
Vakulenko et al., ANTIMICROB. AGENTS CHEMOTHER. 47:1423-6 (2003).
For example, specific Enterococci genes that may be identified by
the methods disclosed herein include 16S ribosomal RNA sequences
that are conserved in Enterococci.
[0225] Host response mRNA may also be detected in response to
infection by waterborne pathogens.
[0226] E. Agroterrorism
[0227] Nucleic acid analogs may be designed to have the sequences
of primers used for PCR-based detection of specific pathogens
implicated in agroterrorism. Examples of pathogens of clinical
importance and the references for the PCR-based detection are
listed below. Nucleic acid analogs may be designed to have the
sequence of specific PCR primer sequences, and can be used in
combination in many of the embodiments of the invention described
herein.
[0228] Nucleic acid analogs may be designed, for example, to have
the sequences of primers, or fragments thereof, used for PCR-based
detection of Toxoplasma gondii. Toxoplasma gondii has very low host
specificity, and probably infects almost any mammal. It has also
been reported from birds, and has been found in virtually every
country of the world. Like most of the Apicomplexa, Toxoplasma is
an obligate intracellular parasite. In most humans infected with
Toxoplasma, the disease is asymptomatic. However, under some
conditions, toxoplasmosis can cause serious pathology, including
hepatitis, pneumonia, blindness, and severe neurological disorders.
Primers used in PCR-based detection of Toxoplasma gondii are known
in the art (see, e.g., T. V. Aspinall et al., INT. J. PARASITOL.
32:1193-9 (2002); T. V. Aspinall, INT. J. PARASITOL. 33:97-103
(2003); I. Fuentes, J. CLIN. MICROBIOL. 39:1566-70 (2001); and M.
R. Warnekulasuriya et al., INT J. FOOD MICROBIOL. 45:211-5
(1998)).
[0229] In another embodiment, nucleic acid analogs may be designed
to have the sequences of primers, or fragments thereof, used for
PCR-based detection of Shingella spp, a gram negative bacterium.
Primers used in PCR-based detection of Shingella spp are known in
the art (A. B. Hartman et al., J. CLIN. MICROBIOL. 41:1023-32
(2003); K. A. Lampel and P. A. Orlandi, METHODS MOL. BIOL.
179:235-44 (2002); R. F. Wang et al., J. APPL. MICROBIOL. 83:727-36
(1997); and K. A. Lampel et al., APPL. ENVIRON. MICROBIOL.
56:1536-40 (1990)).
[0230] In a further embodiment, nucleic acid analogs may be
designed to have the sequences of primers, or fragments thereof,
used for PCR-based detection of Cyclospora cayetanensis. Cyclospora
cayetanensis is a parasite composed of one cell, too small to be
seen without a microscope. The first known human cases of illness
caused by Cyclospora infection (i.e., cyclosporiasis) were reported
in 1979. Cases began being reported more often in the mid-1980s. In
the last several years, outbreaks of cyclosporiasis have been
reported in the United States and Canada. Cyclospora is spread by
ingestion of water or food that was contaminated with infected
stool. Outbreaks of cyclosporiasis have been linked to various
types of fresh produce. Cyclospora needs time (days or weeks) after
being passed in a bowel movement to become infectious. Therefore,
it is unlikely that Cyclospora is passed directly from one person
to another.
[0231] Primers used in PCR-based detection of Cyclospora
cayetanensis are known in the art (see, e.g., M. L. Eberhard et
al., ARCH. PATHOL. LAB. MED. 121:792-7 (1997); N. J. Pieniazek et
al., EMERG. INFECT. DIS. 2:357-9 (1996); W. Quintero-Betancourt et
al., J. MICROBIOL. METHODS 49:209-24 (2002); and M. Varma et al.,
J. MICROBIOL. METHODS 53:27-36 (2003)).
[0232] F. Disease Diagnostics
[0233] The methods disclosed herein also provide a rapid and
sensitive diagnostic test for the presence of genes (e.g., disease
alleles) or altered expression of genes. The detected gene
sequences may be implicated in genetic diseases, disorders, and
predispositions. One example of target polynucleotides includes
specific genomic sequences, including mutations, polymorphisms,
additions and deletions. Another example of target polynucleotides
is polynucleotide sequences that have altered gene expression
(e.g., up-regulated or down-regulated expression) in a specific
disease or disorder. Examples of disease and disorder-related genes
include, but are not limited to, genes implicated in cancer, cystic
fibrosis, and Down's syndrome, and disease-associated polymorphisms
and mutations. Hereditary hemachromatosis, factor 11 and factor V,
and HLA genotypes for tissue transplants may also be
identified.
[0234] Nucleic acid analogs may be designed to have the sequences
of primers, or fragments thereof, used for PCR-based detection of
target polynucleotides implicated in cancer, or altered cell
proliferation. Target polynucleotides corresponding to genes
implicated in cancer, or altered cell proliferation, may be
detected. Numerous genes implicated in cancer are known in the
art.
[0235] In one embodiment, nucleic acid analogs may be designed to
have the sequences of primers, or fragments thereof, used for
PCR-based detection of pancreatic cancer. Primers used in PCR-based
detection of pancreatic cancer, such as loss of DPC4, are known in
the art (see, e.g., V. M. Barbera et al., BIOCHEM. BIOPHYS. ACTA
1502:283-96 (2000); D. Bartsch et al., CANCER LETT. 139:43-9
(1999); and D. Bartsch et al., ONCOGENE 18:2367-71 (1999)).
[0236] In another embodiment, nucleic acid analogs may be designed
to have the sequences of primers, or fragments thereof, used for
PCR-based detection of cervical cancer. Primers used in PCR-based
detection of cervical cancer. Target polynucleotides corresponding
to all or part of the genes associated with cervical cancer may
also be identified (see, e.g., (H. X. Si et al., INT. J. CANCER 103
(4):496-500 (2003); and P. E. Castle et al., J. MED. VIROL.
68:417-23 (2002)).
[0237] Nucleic acid analogs may be designed to have the sequences
of primers, or fragments thereof, used for PCR-based detection of
breast cancer. Primers used in PCR-based detection of breast
cancer. Target polynucleotides may be selected to have sequences
corresponding to all or part of the genes associated with breast
cancer (see, e.g., C. J. Min et al., CANCER RES. 58:4581-4 (1998);
M. R. Abbaszadegan et al., GENET. TEST 1:171-80 (1997); and G.
Tamura et al., PATHOL. INT. 44:34-8 (1994)).
[0238] Nucleic acid analogs may be designed to have the sequences
of primers, or fragments thereof, used for PCR-based detection of
melanoma. Primers used in PCR-based detection of melanoma. Target
polynucleotides may be selected to have sequences corresponding to
all or part of the genes associated with melanoma. For example,
target polynucleotides may include mutations in CDKN2 (see, e.g.,
M. L. Gonzalgo et al., Cancer Res 57:5336-47 (1997); J. Chan et
al., Mol. Carcinog. 31:16-26 (2001); and P. M. Pollock et al.,
Cancer Res 61:1154-61 (2001)).
[0239] In addition, nucleic acid analogs may be designed to have
the sequences of primers, or fragments thereof, used for PCR-based
detection of colorectal cancer. Primers used in PCR-based detection
of colorectal cancer. Target polynucleotides may be selected to
have sequences corresponding to all or part of the genes associated
with colorectal cancer (see, e.g., S. Coli et al., J. EXP. CLIN.
CANCER RES. 21:555-62 (2002); R. Shtoyerman-Chen et al., GENET.
TEST 5:141-6 (2001); and W. M. Smith et al., GENET. TEST 2:43-53
(1998)).
[0240] Nucleic acid analogs may be designed to have the sequences
of primers, or fragments thereof, used for PCR-based detection of
retinoblastoma. Primers used in PCR-based detection of
retinoblastoma. Target polynucleotides may be selected to have
sequences corresponding to all or part of the genes associated with
retinoblastoma (see, e.g., I. Acikbas et al., UROL. INT. 68:189-92
(2002); G. Tamura et al., PATHOL. INT. 44:34-8 (1994); and D.
Lohmann et al., HUM. GENET. 89:49-53 (1992).
[0241] In a further embodiment, nucleic acid analogs may be
designed to have the sequences of primers, or fragments thereof,
used for PCR-based detection of hemopheilia. Primers used in
PCR-based detection of hemophelia. Target polynucleotides may be
selected to have sequences corresponding to genes associated with
hemophelia (see, e.g., P. M. Mannucci, HEMATOLOGY (Am. Soc.
Hematol. Educ. Program):1-9 (2002); and M. Citron et al., HUM.
MUTAT. 20:267-74 (2002)).
[0242] Target polynucleotides that have sequences corresponding to
genes associated with phenylketylurea (PKU) may be selected (see,
e.g., N. Pronina et al., HUM. MUTAT. 21:398-9 (2003); H. Sueoka et
al., GENET. TEST 4:249-56 (2000); and R. C. Eisensmith et al.,
PRENAT. DIAGN. 14:1113-8 (1994)). R. L. Alford et al., AM. J. MED.
GENET. 66:281-6 (1996); C. L. Vnencak-Jones, METHODS MOL. BIOL.
217:101-8 (2003); and I. Panagopoulos et al., HUM. MUTAT. 13:232-6
(1999)).
[0243] Target polynucleotides that have sequences corresponding to
genes associated with Huntington's Disease may be selected, for
example, due to increased CAG repeats (see, e.g., R. L. Alford et
al., supra; C. L. Vnencak-Jones, supra; and I. Panagopoulos et al.,
supra).
[0244] Target polynucleotides that have sequences corresponding to
genes associated with Tay-Sach's Disease may be selected (see,
e.g., J. E. Rice et al., PRENA. DIAGN. 22:1130-4 (2002); S. Tamasu
et al., KOBE J. MED. SCI. 45:259-70 (1999) and K. Sermon et al.,
HUM. REPROD. 10:2214-7 (1995)).
[0245] Target polynucleotides that have sequences corresponding to
genes associated with Multiple Schlorosis (MS) may be selected
(see, e.g., S. Lauwers et al., J. PHARM. BIOMED. ANAL. 29:659-68
(2002); H. Perron et al., PROC. NATL. ACAD. SCI. USA 94:7583-8
(1997); and B. S. Kuhne et al., BIOTECHNIQUES 33:1078, 1080-2, 1084
passim (2002)).
[0246] Target polynucleotides may be selected to have sequences
corresponding to genes associated with Burkitt's lymphoma (see,
e.g., Y. Wu, ZHONGHUA ZHONG LIU ZA ZHI 24:348-52 (2002); K. Basso
et al., AM. J. PATHOL. 155:1479-85 (1999); and M. Asada et al.,
JPN. J. CANCER RES. 82:848-53 (1991)).
[0247] Target polynucleotides may be selected to have sequences
corresponding to genes associated with cystic fibrosis (see, e.g.,
R. Tomaiuolo et al., CLIN. CHEM. LAB. MED. 41:26-32 (2003); M. C.
Gonzalez-Gonzalez et al., PRENAT. DIAGN. 22:946-8 (2002); and C.
Corbetta et al., J. MED. SCREEN 9:60-3 (2002)).
[0248] Target polynucleotides may be selected to have sequences
corresponding to genes associated with juvenile onset diabetes
(see, e.g., I. Knerr et al., PEDIATR. RES. 46:57-60 (1999); S.
Lauwers et al., J. PHARM. BIOMED. ANAL. 29:659-68 (2002); and K.
Salminen et al., J. MED. VIROL. 69:91-8 (2003)).
[0249] Target polynucleotides may be selected to have sequences
corresponding to genes associated with Parkinson's disease (see,
e.g., J. Hoenicka et al., ARCH. NEUROL. 59:966-70 (2002); C. B.
Lucking et al., METHODS MOL. BIOL. 217:13-26 (2003); W. D. Le et
al., NAT. GENET. 33:85-9 (2003); and T. Foroud et al., NEUROLOGY
60:796-801 (2003)).
[0250] Target polynucleotides may be selected to have sequences
corresponding to genes associated with Alzheimer's Disease (see,
e.g., G. A. Maresh et al., J. NEUROCHEM. 67:1132-44 (1996); and M.
J. Smith et al., NEUROREPORT. 10:503-7 (1999)).
[0251] Target polynucleotides may be selected to have sequences
corresponding to genes associated with thrombosis (see, e.g. J.
Sanders Sevall, MOL. CELL. PROBES 14:249-53 (2000); A.
Ferreira-Gonzalez et al., J. CLIN. LAB. ANAL. 11:328-35 (1997); I.
Warshawsky et al., DIAGN. MOL. PATHOL. 11:152-6 (2002)).
[0252] Target polynucleotides may be selected to have sequences
corresponding to genes associated with susceptibility to
tuberculosis (see, e.g., R. Bellamy, GENES IMMUN. 4:4-11 (2003); A.
A. Awomoyi et al., J. INFECT. DIS. 186:1808-14 (2002); R. Bellamy,
Int. J. Tuberc. LUNG DIS. 6:747 (2002)).
[0253] Target polynucleotides may be selected to have sequences
corresponding to genes associated with human immunodeficiency virus
(HIV) (see, e.g., I. Ifergan et al., AIDS16:2340-2 (2002); and M.
Farzan et al., CELL 96:667-76 (1999)). The methods herein also
provide a rapid and sensitive diagnostic test for the presence of
genes or altered expression of genes in other kinds of genetic
analysis. For example, the may be used to determine the identity of
human samples, for example in paternity tests, forensics, or in
matching related or unrelated organ donors. Diagnostics may also be
conducted in non-human samples, such as to identify cattle
lineages.
[0254] G. Sexually Transmitted Diseases
[0255] The nucleic acid analogs may be designed to have the
sequences, or fragments of the sequences, of primers used for
PCR-based detection of pathogens that cause sexually transmitted
diseases (STDs). Examples of STDs of clinical importance and the
references for the PCR-based detection are listed below. Nucleic
acid analogs may be designed to have the sequence of specific PCR
primer sequences, and can be used in combination in many of the
embodiments of the invention described herein.
[0256] In one embodiment, the nucleic acid analogs are designed to
have the sequences of primers used for PCR-based detection of
chlamydia. Many such primers are known in the art (see, e.g., E. H.
Koumans et al., J. CLIN. MICROBIOL. 41:1507-11 (2003); M.
Puolakkainen et al., J. CLIN. MICROBIOL. 36:1489-93 (1998); F.
Betsou et al., J. CLIN. MICROBIOL. 41:1274-6 (2003); J. Knox et
al., SEX. TRANSM. DIS. 29:647-54 (2002); T. Mygind et al., BMC
MICROBIOL. 2:17 (2002)).
[0257] In another embodiment, the nucleic acid analogs are designed
to have the sequences of primers used for PCR-based detection of
Treponema pallidum. Examples of primers used to identify Treponema
pallidum by PCR based assays are known in the art (see, e.g., A.
Centurion-Lara et al., J. CLIN. MICROBIOL. 35:1348-52 (1997); A. A.
Martin et al., DIAGN. MICROBIOL. INFECT. DIS. 40:163-6 (2001); S.
L. Orton et al., Prevalence of circulating Transfusion 42:94-9
(2002).
[0258] In another embodiment, the nucleic acid analogs are designed
to have the sequences of primers used for PCR-based detection of
HIV. Examples of primers used to identify HIV by PCR based assays
are known in the art (see, e.g., L. Gibney et al., SEX TRANSM
INFECT 77:344-50 (2001); A. Spinillo et al., BJOG 108:634-41
(2001)).
[0259] In a further embodiment, the nucleic acid analogs are
designed to have the sequences of primers used for PCR-based
detection of human papillomavirus (HPV). Examples of primers used
to identify HPV by PCR-based assays are known in the art (see,
e.g., R. L. Winer et al., AM. J. EPIDEMIOL. 157:218-26 (2003); J.
E. Levi et al., J. CLIN. MICROBIOL. 40:3341-5 (2002); M. Skerlev et
al., CLIN. DERMATOL. 20:173-8 (2002)).
[0260] In another embodiment, the nucleic acid analogs are designed
to have the sequences of primers used for PCR-based detection of
Neisseria gonorrhoeae. Examples of primers used to identify
Neisseria gonorrhoeae by PCR based assays are known in the art
(see, e.g., Mgone et al., SEX TRANSM DIS 29:775-9 (2002); J. P.
Gomes et al., ACTA TROP 80:261-4 (2001); D. J. Diemert et al., J.
CLIN. MICROBIOL. 40:4056-9 (2002)).
[0261] In another embodiment, the nucleic acid analogs are designed
to have the sequences of primers used for PCR-based detection of
genital herpes. Examples of primers used to identify genital gerpes
by PCR based assays are known in the art (see, e.g., M. H. Wolff et
al., INTERVIROLOGY 45:20-3 (2002); A. Wald, CURR. CLIN. TOP.
INFECT. DIS. 22:166-80 (2002); A. Scoular, SEX. TRANSM. INFECT.
78:160-5 (2002)).
[0262] The nucleic acid analogs may also be designed to have the
sequences of primers used for PCR-based detection of Trichomonas
vanginalis. Examples of primers used to identify Trichomonas
vanginalis by PCR based assays are known in the art (see, e.g., K.
A. Wendel et al., CLIN. INFECT. DIS. 35:576-80 (2002); K. A. Wendel
et al., SEX TRANSM INFECT 79:151-153 (2003)).
[0263] Finally, the nucleic acid analogs may also be designed to
detect general STDs. Examples of primers used to identify STDs by
PCR based assays are known in the art (see, e.g., S.
Mitrani-Rosenbaum et al., AM. J. OBSTET. GYNECOL. 171:784-90
(1994)).
[0264] H. Antibiotic Resistance
[0265] The methods, compositions, and assay systems may be used to
detect the presence or change in expression of genes conferring
antibiotic resistance. The target polynucleotide may correspond to
genes that confer antibiotic resistance to a pathogen.
Alternatively, the target polynucleotide may correspond to a gene
in a host having an altered metabolism that may affect the efficacy
of the antibiotic.
[0266] Examples of genes expressing antibiotic resistance can be
found in the following references. Examples are provide but not
limited to the examples provided. Genes encoding such as Beta
Lactamases convey resistance to antibiotics including, but not
limited to, penicillian, errythromycin, cefotaxime, ampicillin,
piperacillin, cefoperazone, ceftazidime, cefepime, moxalactam,
imipenem (see, e.g., D. M. Livermore, CLIN. MICROBIOL. REVIEWS
8:557-584 (1995); P. Hsuch et al., J. CLIN. MICROBIOL. 37:221-224
(1999); L. Setchanova et al., J. CLIN. MICROBIOL. 37:638-648
(1999); T. A. Wichelhaus et al., J. CLIN. MICROBIOL. 37:690-693
(1999); and G. A. Jacoby, EUR. J. CLIN. MICROBIOL. INFECT. DIS.
13:2-11 (1994)).
[0267] Other non-limiting examples of antibiotic confering genes
include quinolones resistance genes, which convey resistance to
antibiotics such as ceprofloxacin, ofloxacin, norfloxacin,
enoxacin, sparfloxacin (see, e.g., E. E. C. Margerrison et al., J.
BACTERIOL. 174:1596-1603 (1992); P. H. McWhinney et al.,
ANTIMICROB. AGENTS. CHEMOTHER. 37:2493-2495 (1993); and H. Yoshida
et al., J. BACTERIOL. 172:6942-6949 (1990)).
[0268] Additional examples of antibiotic resistance genes include
glycopeptide resistance genes, which convey resistance to
antibiotics such as vancomycin and teicoplanin (see, e.g., C. H.
Tremlett et al., J. CLIN. MICROBIOL. 37:818-820 (1999) and M.
Arthur et al., GENE 154:87-92 (1995)) aminoglycoside resistance
genes which convey resistance to antibiotics such as tobramycin,
gentamicin, strepomycin, kanamycin, amikacin (M. Galimand et al.,
ANTIMICROB. AGENTS CHEMOTHER. 37:1456-1462 (1993); T. Lambert et
al., ANTIMICROB. AGENTS CHEMOTHER. 38:702-706 (1994); and K. J.
Shaw et al., ANTIMICROB. AGENTS CHEMOTHER. 37:708-714 (1993).
[0269] In some cases there are particular types of resistance that
are of high concern. These include methicillin resistant
Staphylococcus aureus (see, e.g., T. Ito et al., DRUG RESIST UPDATE
6:41-52 (2003); M. Kuroda et al., LANCET 357:1225-40 (2001); and R.
A. Skurray et al., CIBA FOUND. SYMP. 207:167-83 (1997)).
[0270] Other antibiotic resistance conferring genes that may be
detected include tuberculosis antibiotic resistance genes (see,
e.g., I. Mokrousov et al., J. CLIN. MICROBIOL. 40:2509-12 (2002);
G. Gong et al., DIAGN. CYTOPATHOL. 26:228-31 (2002); D. Garcia de
Viedma et al., J. CLIN. MICROBIOL. 40:988-95 (2002)).
[0271] I. Genetic Screening for a Predisposition for Drug
Responses
[0272] The methods, compositions, and assay systems may be used to
detect genes conferring a predisposition to drug responses. The
target polynucleotide may correspond to any polynucleotide sequence
that confers a predisposition to the drug response. The target
polynucleotide may correspond to sequences involved in
predisposition to drugs that affect the cardiovascular system (see,
e.g., C. Dudley et al., J. HYPERTENS. 14:259-62 (1996); P. R. Lima
et al., BLOOD 90:2810-8 (1997); T. Sakaeda et al., PHARM. RES.
18:1400-4 (2001)). The target polynucleotide may also correspond to
genes and other polynucleotide sequences implicated a
predisposition to psychiatric drugs (see, e.g., D. Nikoloff et al.,
PHARMACOGENOMICS J. 2:400-7 (2002); L. Bertilsson et al., ACTA
PSYCHIATR. SCAND. SUPPL. 391:14-21 (1997); S. Chen et al., CLIN.
PHARMACOL. Ther. 60:522-34 (1996)). The target polynucleotide may
also correspond to gene sequences, or other polynucleotide
sequences, corresponding to a predisposition to respond to
analgesic drugs (see, e.g., M. J. Torres-Galvan et al., ANN.
ALLERGY ASTHMA. IMMUNOL. 87:506-10 (2001)).
[0273] J. Genes Implicated in Effective Drug Response
[0274] The methods, compositions, and assays of the instant
invention may be used in genetic testing is used a potential
indication of a reaction to medication. The methods, compositions,
and assays may be used to determine if a current treatment is
working, or whether a resistance (or tolerance) is developing. Gene
expression testing could be used to determine whether a tumor is
becoming, or will become, resistant to a treatment. Gene based
diagnostic testing may also includes pre-screening the likelihood
of developing a disease or disorder in the future, pre-screening
for genetic pre-disposition certain types of cancer, and
identifying genetic polymorphisms.
[0275] Nucleic acid analogs may be designed to detect the presence
and expression of specific genes. In one aspect, the methods may be
used to determine the expression level of enzymes that can
metabolize the associated drug. Polymorphic enzymes alter the
effects of the drug and thus alter their ability to be used as a
treatment. Genetic polymorphisms in the genes that influence the
response of the associated drug, and thus affect the drugs ability
to be used as a treatment, may be detected.
[0276] In one embodiment, nucleic acid analogs are designed to
detect the sequences, or fragments of the sequences, encoding
Cytochrome CYP2D6. Cytochrome CYP2D6 can metabolize Debrisoquin,
which is used to treat antihypertension. Elevated expression of
CYP2D6 indicates resistance to Debrisoquin (see, e.g., A. Mahgoub
et al., LANCET 2:584-6 (1977); and A. Wennerholm et al.,
PHARMACOGENETICS 9:707-14 (1999)).
[0277] The presence or expression of Cytochrome CYP2D6 may be used
to determine resistance to Sparteine, which is used to treat
post-operative pain (see, e.g., M. Eichelbaum et al., EUR. J. CLIN.
PHARMACOL. 16:183-7 (1979); F. Broly et al., PHARMACOGENETICS
5:373-84 (1995)).
[0278] The presence or expression of Cytochrome CYP2D6 may be used
to determine resistance to Nortriptyline which is used to treat
depression or cardiovascular disease (see, e.g., P. Dalen et al.,
CLIN. PHARMACOL. THER. 63:444-52 (1998); Q. Y. Yue et al., CLIN.
PHARMACOL. THER. 64:384-90 (1998)).
[0279] The presence or expression of Cytochrome P459 may be used to
determine altered codeine metabolism (see, e.g., S. H. Sindrup et
al., Pharmacogenetics 5:335-46 (1995); O. Mortimer et al., CLIN.
PHARMACOL. THER. 47:27-35 (1990)).
[0280] In another embodiment, nucleic acid analogs are designed to
detect the sequences, or fragments of the sequences, encoding
Cytochrome CYP2C9. Cytochrome CYP2C9 can metabolize Warfarin which
is used as an anticoagulant (see, e.g., G. P. Aithal et al., LANCET
353:717-9 (1999); R. Loebstein et al., CLIN. PHARMACOL. THER.
70:159-64 (2001)).
[0281] Cytochrome CYP2C9 can also metabolize Phenyloin, which is
used to treat brain injury (see, e.g., J. van der Weide et al.,
PHARMACOGENETICS 11:287-91 (2001); R. Brandolese et al., CLIN.
PHARMACOL. THER. 70:391-4 (2001)).
[0282] In addition, Cytochrome CYP2C19 can metabolize Omeprazole
which I used to treat acid-reflux disease (see, e.g., J. D. Balian
et al., CLIN. PHARMACOL. THER. 57:662-9 (1995); G. Tybring et al.,
CLIN. PHARMACOL. THER. 62:129-37 (1997)).
[0283] In a further embodiment, nucleic acid analogs are designed
to detect the sequences, or fragments of the sequences, encoding
dihydropyrimidine dehydrogenase. Dihydropyrimidine dehydrogenase
can metabolize Fluorouracil, which is used to treat antineoplastic
diseases (various cancer treatments) (see, e.g, M. Tuchman et al.,
N. ENGL. J. MED. 313:245-9 (1985); R. B. Diasio et al., J. CLIN.
INVEST. 81:47-51 (1988)).
[0284] Nucleic acid analogs may also be designed to detect the
sequences, or fragments of the sequences, encoding
butyrylcholinesterase. Butyrylcholinesterase can metabolize
Succinylcholine which is used as a muscle relaxant (see, e.g., O.
Lockridge, PHARMACOL. THER. 47:35-60 (1990); and F. Ceppa et al.,
CLIN. CHEM. LAB. MED. 40:799-801 (2002).
[0285] Nucleic acid analogs may also be designed to detect the
sequences, or fragments of the sequences, encoding
N-Acetyltransferase 2. N-Acetyltransferase 2 can metabolize
Isoniazid which is used to treat tuberculosis (see, e.g., Y. Furet
et al., THERAPIE 57:427-31 (2002); T. Kita et al., BIOL. PHARM.
BULL. 24:544-9 (2001); and Hiratsuka, M. Yakugaku Zasshi
122(7):451-63, (2002)).
[0286] N-Acetyltransferase 2 can also metabolize Hydralazine which
is used to treat antihypertension (see, e.g., J. A. Timbrell et al.
CLIN. PHARMACOL. THER. 28:350-5 (1980); and P. Zschieschang et al.,
PHARMACOGENETICS 12:559-63 (2002)).
[0287] N-Acetyltransferase 2 can metabolize Procainamide, which is
used to treat antiarrhythmia (see, e.g., M. M. Reidenberg et al.,
CLIN. PHARMACOL. THER. 17:722-30 (1975); and D. Hickman et al.,
BIOCHEM. PHARMACOL. 50:697-703 (1995)).
[0288] In another aspect, nucleic acid analogs may also be designed
to detect the sequences, or fragments of the sequences, encoding
uridine disphosphate-glucuronosyltransferase 1A1. Uridine
disphosphate-glucuronosyltransferase 1A1 can metabolize Irinotecan
which is used to treat colorectal cancer (see, e.g., L. Iyer et
al., CLIN. PHARMACOL. THER. 65:576-82 (1999); Y. Ando et al., ANN.
ONCOL. 9:845-7 (1998)).
[0289] Uridine disphosphate-glucuronosyltransferase 1A1 can also
metabolize Bilirubin which is used to treat Gilbert's syndrome, a
mild liver disorder (see, e.g., P. J. Bosma et al., N. ENGL. J.
MED. 333:1171-5 (1995); Y. H. Kim et al., TAEHAN KAN HAKHOE CHI.
8:132-8 (2002)).
[0290] Nucleic acid analogs may also be designed to detect the
sequences, or fragments of the sequences, encoding thiopurine
S-methyltransferase. Thiopurine S-methyltransferase can metabolize
Mercaptopurine which is used to treat Crohn's disease (see, e.g.,
R. M. Weinshilboum, XENOBIOTICA 22:1055-71 (1992); and A.
Wennerholm et al., PHARMACOGENETICS 9:707-14 (1999)).
[0291] Thiopurine S-methyltransferase can also metabolize
Azathioprine which is also used to treat Crohn's disease (see,
e.g., B. A. Kaskas et al., GUT 52:140-2 (2003); and C. A. Marra et
al., J. RHEUMATOL. 29:2507-12 (2002)).
[0292] Nucleic acid analogs may also be designed to detect the
sequences, or fragments of the sequences, encoding catechol
O-methyltransferase. Catechol O-methyltransferase can metabolize
Levodopa, which is used to treat Parkinson's disease (see, e.g., D.
K. Reilly et al. CLIN. PHARMACOL. THER. 28(2):278-86, (1980); and
A. Wennerholm et al. PHARMACOGENETICS 9(6):707-14, (1999)).
[0293] Nucleic acid analogs may also be designed to detect the
genetic polymorphisms associated with drug resistance. In one
embodiment, the nucleic acid analogs may be designed to detect ACE
polymorphisms which can influence the response of the ACE inhibitor
antihypertensice, used to treat heart failure (see, e.g., P.
Jacobsen et al., KIDNEY INT. 53:1002-6 (1998); M. Kohno et al., AM.
J. MED. 106:544-9 (1999)).
[0294] ACE polymorphisms can also influence the response of
Fluvastatin used to treat Coronary atherosclerosis (see, e.g., A.
J. Marian et al., J. AM. COLL. CARDIOL. 35:89-95 (2000); Y. Bosse
et al., CLIN. GENET. 62:45-52 (2002)).
[0295] In another embodiment, the nucleic acid analogs may be
designed to detect Arachidonate 5-lipoxygenase polymorphisms, which
can influence the response of Leukotriene inhibitors used as
anti-inflammatories (see e.g. S. J. Fowler et al., EUR. J. CLIN.
PHARMACOL. 58:187-90 (2002); and T. Koshino et al., MOL. CELL.
BIOL. RES. COMMUN. 2:32-5 (1999)).
[0296] The nucleic acid analogs may be designed to detect
B2-Adrenergic receptor polymorphisms which can influence the
response of B2-Agonists used to treat asthma and pulmonary disease
(see e.g. S. B. Liggett, AM. J. RESPIR. CRIT. CARE MED.
161:S197-201 (2000); V. Dishy et al., N. ENGL. J. MED. 345:1030-5
(2001).
[0297] The nucleic acid analogs may also be designed to detect
Bradykinin B2 receptor polymorphisms which can influence the
response of ACE-inhibitor used to treat heart failure (see e.g. S.
Mukae et al., HYPERTENSION 36:127-31 (2000); S. Mukae et al., J.
HUM. HYPERTENS. 16:857-63 (2002)).
[0298] The nucleic acid analogs may be designed to detect Dopamine
receptors (D2, D3, D4) polymorphisms which can influence the
response of Antipsychotics (see e.g. M. J. Arranz et al., LANCET
355:1615-6 (2000); V. S. Basile et al., NEUROPSYCHOPHARMACOLOGY
21:17-27 (1999)).
[0299] Nucleic acid analogs may also be designed to detect Estrogen
receptor-a polymorphisms which can influence the response of
Conjugated estrogens and are used in Hormone-replacement therapy
for menopause, osteoporosis (see e.g. D. M. Herrington et al., N.
ENGL. J. MED. 346:967-74 (2002); B. Ongphiphadhanakul et al., CLIN.
ENDOCRINOL. (OXF.) 52:581-5 (2000)).
[0300] The nucleic acid analogs may also be designed to detect
Glycoprotein nia subunit of glycoprotein IIb/IIIa polymorphisms,
which can influence the response of Aspirin or glycoprotein
IIb/IIIa inhibitors used to treat myocardial infarction (see e.g.,
A. D. Michelson et al., CIRCULATION 101:1013-8 (2000); G. Andrioli
et al., BR. J. HAEMATOL. 110:911-8 (2000)).
[0301] In a further embodiment, the nucleic acid analogs may be
designed to detect Serotonin(5-hydroxytryptamine) transporter
polymorphisms which can influence the response of Antidepressants
used to treat Alzheimer's disease and depression (see e.g. D. K.
Kim et al., NEUROREPORT. 11:215-9 (2000); and E. Smeraldi et al.,
MOL. PSYCHIATRY 3:508-11 (1998)).
[0302] The nucleic acid analogs may be designed to detect adducin
polymorphisms which can influence the response of Diuretics used to
treat myocardial infarction, hypertension (see, e.g., M. T.
Sciarrone et al., HYPERTENSION 41:398-403 (2003); B. M. Psaty et
al., J. AMER. MED. ASSN. 287:1680-9 (2002)).
[0303] The nucleic acid analogs may further be designed to detect
apolipoprotein E(APOE) polymorphisms which can influence the
response of Statins used to treat coronary arterial disease,
cholesterol, atherosclerosis (see, e.g., J. M. Ordovas et al.,
ATHEROSCLEROSIS 113:157-66 (1995); L. U. Gerdes et al., CIRCULATION
101:1366-71 (2000)).
[0304] APOE polymorphisms which can influence the response of
Tacrine used to treat Alzheimer's disease (see, e.g., J. Poirier et
al., PROC. NATL. ACAD. SCI. U.S.A. 92:12260-4 (1995)); J. Poirier,
MOL. DIAGN. 4:335-41 (1999); H. Soininen et al., NEUROSCI. LETT.
187:79-82 (1995)).
[0305] In another embodiment, the nucleic acid analogs may be
designed to detect HLA polymorphisms which can influence the
response of Abacavir used as an antiviral and to treat HIV (see,
e.g., S. Mallal et al., LANCET 359:727-32 (2002); and S.
Hetherington et al., LANCET 359:1121-2 (2002)).
[0306] The nucleic acid analogs may also be designed to detect
Cholesterol ester transfer protein (CETP) polymorphisms which can
influence the response of Statins used to treat coronary related
disease, cholestrol, and atherosclerosis (see, e.g., J. A.
Kuivenhoven et al., N. ENGL. J. MED. 338:86-93 (1998); P. Rump et
al., NUTR. METAB. CARDIOVASC. DIS. 12:317-24 (2002); and F. V. van
Venrooij et al., DIABETES CARE 26:1216-23 (2003)).
[0307] In another embodiment, the nucleic acid analogs may be
designed to detect Ion Channel associated polymorphisms which can
influence the response of Erythromycin, an antibiotic used to treat
bacterial infections (see, e.g., F. Sesti et al. PROC. NATL. ACAD.
SCI. USA 97:10613-8 (2000); G. W. Abbott et al., CELL 97:175-87
(1999)).
[0308] The nucleic acid analogs may further be designed to detect
Methylguanine methyltransferase polymorphisms which can influence
the response of Carmustine used to treat glioma (see, e.g., M.
Esteller et al., N. ENGL. J. MED. 343:1350-4 (2000); S. L. Gerson,
J. CLIN. ONCOL. 20:2388-99 (2002)).
[0309] Nucleic acid analogs may be designed to detect Parkin
polymorphisms which can influence the response of Levodopa used to
treat Parkinson's disease (see, e.g., C. B. Lucking et al., N.
ENGL. J. MED. 342:1560-7 (2000); V. Bonifati et al., NEUROL. SCI.
22:51-2 (2001)).
[0310] Nucleic acid analogs may be designed to detect Prothrombin
and factor V polymorphisms which can influence the response of oral
contraceptives and indicate potential risk for development of
thrombosis (see, e.g., J. Tassin et al., BRAIN 123:1112-21 (2000);
I. Martinelli et al., N. ENGL. J. MED. 338:1793-7 (1998); and I.
Martinelli et al., ARTERIOSCLER. THROMB. VASE. BIOL. 19:700-3
(1999)).
[0311] The nucleic acid analogs may also be designed to detect
Stromelysin-1 polymorphisms which can influence the response of
Statin used to treat atherosclerosis (see, e.g., C. Legnani et al.,
EUR. HEART J. 23:984-90 (2002); S. B. Liggett, AM. J. RESPIR. CRIT.
CARE MED. 161:S197-201 (2000); S. E. Humphries et al.,
ATHEROSCLEROSIS 139:49-56 (1998)). S. Humphries et al. EUR. HEART
J. 23:721-5, (2002); and M. P. de Maat et al., AM. J. CARDIOL.
83:852-6 (1999)).
[0312] K. Genetically Modified Organisms
[0313] The methods disclosed herein also provide a rapid and
sensitive diagnostic test for the presence genetically modified
organisms (GMOs). Examples of GMOs include, but are not limited to,
organisms in which one or more genes have been modified, added, or
deleted. GMOs may be characterized by the presence of one or more
specific gene, absence of one or more specific genes, specific
alteration, or altered expression of one or more specific genes.
Nucleic acid analogs may be designed to complement target
polynucleotides characteristic of the GMOs. The presence and number
of GMOs may be measured using the methods of the reaction.
[0314] L. Non-Indigenous Fluora and Fauna
[0315] The methods disclosed herein also provide a rapid and
sensitive diagnostic test for the presence and enumeration of
non-indigenous fluora and fauna. Organisms that are not indigenous
to a particular region present environmental and biological hazards
to indigenous fluora and fauna. Nucleic acid analogs may be
designed to complement target polynucleotides characteristic of the
non-indigenous fluora and fauna. The presence and number of
non-indigenous fluora and fauna may be measured using the methods
of the reaction.
[0316] M. Agricultural Applications
[0317] The methods disclosed herein also provide a rapid and
sensitive diagnostic test for the presence and enumeration of
specific plants and plant varieties. Nucleic acid analogs may be
designed to complement target polynucleotides characteristic of the
specific plants or plant varieties. The presence and number of the
plants and varieties may be measured using the methods of the
reaction.
[0318] N. Veterinary Applications
[0319] The methods, compositions, and assays disclosed herein also
provide a rapid and sensitive diagnostic test in veterinary
applications. Nucleic acid analogs may be designed to complement
target polynucleotides that correspond to animal based infections
or to genetic diseases or disorders.
[0320] In one embodiment, the methods, compositions, and assays may
be used to detect the presence of or infection by rabies virus.
Nucleic acid analogs may be designed to have the sequences of
primers used for PCR-based detection of rabies. Examples of primers
used to identify rabies virus by PCR based assays are known in the
art (see, e.g., M. Ito et al., J. CLIN. VIROL. 26:317-30 (2003); E.
M. Black et al., J. VIROL. METHODS 105:25-35 (2002); D. David et
al., VET. MICROBIOL. 87:111-8 (2002); M. Ito et al., J. VET. MED.
SCI. 63:1309-13 (2001).
[0321] In another embodiment, the methods, compositions, and assays
may be used to detect Porcine Stress Syndrome. Porcine Stress
Syndrome is caused by a mutation of the ryanodine-receptor
(RYR-1)-gene-homozygous or heterozygous. Nucleic acid analogs may
be designed to have the sequences of primers used for PCR-based
detection of Porcine Stress Syndrome. Examples of primers used to
identify Porcine Stress Syndrome by PCR based assays are known in
the art (see, e.g., S. H. Lee et al., ANIM. GENET. 33:237-9 (2002),
H. Bu et al., ZHONGGUO XIU FU CHONG JIAN WAI KE ZA ZHI. 14:311-4
(2000).
[0322] The methods, compositions, and assays may be used to detect
Hyperkalemic Periodic Paralysis Disease (HyPP). HyPP is a genetic
disease in American Quarter horses or crossbreds. Data imply that
HyPP is inherited as a codominant genetic defect, because the
homozygotes showed more severe clinical signs of disease than
heterozygotes. Nucleic acid analogs may be designed to have the
sequences of primers used for PCR-based detection of HyPP.
[0323] In another embodiment, the methods, compositions, and assays
may be used to detect FeCV (Feline Coronavirus). Nucleic acid
analogs may be designed to have the sequences of primers used for
PCR-based detection of Feline Coronavirus. Examples of primers used
to identify Feline Coronavirus by PCR based assays are known in the
art (see, e.g., M. Kennedy M et al., J. VET. DIAGN. INVEST.
14:520-2 (2002); D. D. Addie et al., VET. REC. 148:649-53 (2001);
A. A. Herrewegh et al., VIROLOGY 234:349-63 (1997).
[0324] In another embodiment, the methods, compositions, and assays
may be used to detect the presence of or infection by FIP virus, a
mutant of the ubiquitous feline enteric coronavirus (FECV). Nucleic
acid analogs may be designed to have the sequences of primers used
for PCR-based detection of FIP virus. Examples of primers used to
identify HP virus by PCR based assays are known in the art (see,
e.g., D. A. Gunn-Moore et al., VET. MICROBIOL. 62:193-205 (1998);
M. Kennedy et al., VET. MICROBIOL. 81:227-34 (2001).
[0325] The methods, compositions, and assays may also be used to
detect the presence of or infection by Equine infectious anemia
virus (EIAV). Nucleic acid analogs may be designed to have the
sequences of primers used for PCR-based detection of EIAV. Examples
of primers used to identify EIAV by PCR based assays are known in
the art (see, e.g., R. F. Cook et al., J. VIROL. METHODS 105:171-9
(2002); J. L. Langemeier et al., J. CLIN. MICROBIOL. 34:1481-7
(1996); M. M. Nagarajan et al., J. VIROL. METHODS 94:97-109.
[0326] The methods, compositions, and assays may also be used to
detect the presence of or infection by Brucella ovis. Nucleic acid
analogs may be designed to have the sequences of primers used for
PCR-based detection of Brucella ovis. Examples of primers used to
identify Brucella ovis by PCR based assays are known in the art
(see, e.g., L. Manterola L et al., VET. MICROBIOL. 92:65-72 (2003);
M. E. Hamdy et al., VET. J. 163:299-305 (2002); B. J. Bricker et
al., J. CLIN. MICROBIOL. 32:2660-6 (1994).
[0327] The foregoing examples are only exemplary. Target
polynucleotides may include polynucleotides corresponding to other
antibiotic resistant conferring genes known in the art.
VIII. KITS
[0328] In one aspect, the present application provides a kit for
detecting target polynucleotides. A kit may include one or more
reagents useful in the present invention, for example, dyes,
nucleic acid analogs, sources of light stimulus, buffers, standards
used for controls, keys showing positives and negatives of control
samples for interpreting reaction results. Optionally, one or more
buffers are provided. Preferably the kit includes instructions for
performing a method. The kits may further include suitable
packaging of the respective compositions, instructions, and/or
other optional components as disclosed below.
[0329] A. Dyes
[0330] The kits provided herein include one or more dyes.
[0331] The dyes can be provided in pre-packages amounts, or can be
provided in a single tube from which aliquots can be
apportioned.
[0332] The dyes may be further packaged in any suitable packaging
for segregation from other components of the kit and to facilitate
dispensing of the composition.
[0333] B. Nucleic Acid Analogs
[0334] The kits may also include one or more nucleic acid
analogs.
[0335] The nucleic acid analog may be any nucleic acid analog, as
described herein. In one embodiment, the nucleic acid analog is an
LNA. In another embodiment, the nucleic acid analog is a PNA.
[0336] The nucleic acid analog may have any sequence that is
complementary or fully complementary to a target nucleic acid
sequence. The sequence may be any sequence known in the art. In one
embodiment, the nucleic acid analog has a sequence disclosed
herein.
[0337] The nucleic acid analog may be provided in any suitable
container, and may be pre-aliquoted into usable amounts, or in a
single tube to be apportioned. The container may be further
packaged in any suitable packaging for segregation from other
components of the kit and to facilitate dispensing of the cleansing
composition. In another embodiment, two or more the nucleic acid
analog sequences may be contained in the same package.
[0338] The kits may also include a vehicle to facilitate effective
hybridization of the nucleic acid analog to the target
polynucleotide, such as salmon sperm DNA.
[0339] C. Source of Light Stimulus
[0340] The kits may optionally further include a source of light
stimulus. Non-limiting examples of light sources include the
Sylvania Cool White T8-CW, General Electric T8-050, and Fritz
Aurora 50/50, a Sylvania dulux S9W CF9DS/blue, an Osram F9TT/50K,
and LEDs including Hebei 520 PGOC, 540IB7C and the Xenon USHIO
UXL-553 lamp.
[0341] D. Polynucleotide Manipulating Components
[0342] The kits may also include components used to manipulate
polynucleotides, such as buffers, enzymes, columns, and other
materials.
[0343] The buffers, enzymes, columns, and other materials can
include those that are used to lyse cells or extract DNA or RNA
from a cell. The buffers, enzymes, columns, and other materials can
also include components used to manipulate polynucleotides,
including DNA and RNA. Such components include, for example, those
disclosed in Molecular Cloning: A Laboratory Manual, third edition
(Sambrook et al., 2000) Cold Spring Harbor Press, or any other
reference disclosed herein.
[0344] E. Instructions.
[0345] Kits may further include instructions for performing the
methods described herein. Instructions may be included as a
separate insert and/or as part of the packaging or container, e.g.,
as a label affixed to a container or as writing or other
communication integrated as part of a container. The instructions
may inform the user of methods for application and/or removal of
the contents of the kit, precautions and methods concerning
handling of materials, expected results, warnings concerning
improper use, and the like.
[0346] F. Additional Optional Components of the Kits.
[0347] Kits may further contain components useful in the practicing
the methods disclosed herein. Exemplary additional components
include chemical-resistant disposal bags, tubes, diluent, gloves,
scissors, marking pens and eye protection.
EXAMPLES
[0348] The following non-limiting examples serve to more fully
describe the manner of using the above-described invention. It is
understood that these examples in no way serve to limit the scope
of this invention, but rather are presented for illustrative
purposes.
[0349] All nucleic acid analog and DNA stock solutions in the
following Examples were made in water unless otherwise noted. The
stock dye was made in methanol or DMSO.
Example 1
Liquid-Based Assay System for Detection of PNA Polynucleotide
Binding
[0350] The formation of a PNA/polynucleotide complex resulted in a
color change of the indicator dye. Cauliflower mosaic virus 35S
promoter DNA was used as the specific target polynucleotide. The
dye was 3,3'-diethylthiacarbocyanine (Sigma, Milwaukee).
[0351] In a test tube, 15 .mu.M PNA molecules complementary to
cauliflower mosaic virus 35S promoter (35SPNA) was added to 5 .mu.M
35S promoter DNA (35SDNA). The PNA sequence was CCCACCCACGAGG-LYS
[SEQ ID NO:11]. 150 .mu.M dye in 5 mM phosphate buffer, pH 7.5, was
added. The 35SPNA, and dye, are present in excess in the
system.
[0352] The color change indicated the presence of the
polynucleotide.
[0353] The liquid based system was tested using 1 .mu.l of 2.5 mM
dye diluted in a 50 .mu.l total volume of 5 mM PO.sub.4 reaction
buffer. The system and methods were tested and successful in the pH
range of 4-10, however the system performed better in systems above
the pH of 5. At time zero reactions across the 4-10 pH range looked
nearly identical to each other but less vibrant than controls
lacking the PNA/target polynucleotide hybrid. Upon exposure to
light stimulus, the reactions began to become clear. Upon further
exposure to light stimulus reactions with PNA/polynucleotide hybrid
became completely clear at the same rate between pH 6-10. Reactions
with PNA/polynucleotide hybrid from pH 4-5 had residual shades of
pink.
[0354] A number of buffers at 10 mM concentrations have been used.
Some of the buffers were tested with various pHs. NaPO.sub.4
buffers were tested up to 0.5 M concentration. Buffers and salts
which performed optimally include NaPO.sub.4, NaHSO.sub.4,
K.sub.2HPO.sub.4, K.sub.2SO.sub.4, and CaSO.sub.4. Buffers and
salts which did not allow successful performance of the methods
include Na Citrate, NaCl, CaH.sub.2PO.sub.4, FeSO.sub.4, and
MgSO.sub.4. The method also may use pure water, 0.1% SDS, 0.1%
Triton.RTM. X-100, 0.1% TWEEN.RTM. 20, 3% butanol, 10% methanol,
10% isopropanol, or 10% DMSO, 1.times. blood lysis buffer (0.15 M
NH.sub.4Cl, 10 mM NaHCO.sub.3, 0.1 mM EDTA) pH 7.4 or sucrose lysis
buffer (0.32 M sucrose, 10 mM Tris, 1% Triton.RTM. X-100, 5 mM
MgCl.sub.2).
[0355] Sodium phosphate buffer was tested at pH 4, 5, 5. 5, 6, 7,
8, 9, 10. All other buffers were tested at pH 7.5. Sodium phosphate
buffer pH 7 gave the fastest reaction.
[0356] 300 target polynucleotides per microliter of reaction were
detected. Concentrations of 1.5.times.10.sup.14 target
polynucleotides/reaction/50 .mu.L; 10.sup.8 amplified target
polynucleotides/reaction/50 .mu.L were also detected.
Example 2
Determination of the Effect of PNA Molecules on PCR Reactions
[0357] This Example shows the effects of various PNA molecules on
PCR reactions. The PCR components were as follows:
TABLE-US-00002 Final Component Volume Concentration Water 38 .mu.L
N/A Upstream primer, 50 .mu.M 0.5 .mu.L 0.5 .mu.M Downstream
primer, 50 .mu.M 0.5 .mu.L 0.5 .mu.M MgCl.sub.2, 25 mM 3 .mu.L 1.5
mM 10.times. Reaction Buffer (Promega) 5 .mu.L 1X PCR Nucleotide
Mix (Promega), 10 mM 1 .mu.L 800 .mu.M each dNTP Taq DNA Polymerase
in Storage Buffer B 0.5 .mu.L 0.05 U/.mu.L (Promega), 5 U/.mu.L BSA
0.5 .mu.L 10 mg/mL
[0358] The primer sequences were as follows:
TABLE-US-00003 Primer Primer Sequence OI 17 5'GCTCCTACAAATGCCATCA
[SEQ: 12) OI 18 5'GATAGTGGGATTGTGCGTCA [SEQ: 13) PNA
5'CCCACCCACGAGGAACATC [SEQ: 14)
Thermal Cycler Program (MJ Research PTC-200)
TABLE-US-00004 [0359] 95.degree. for 1 minute 42 cycles of:
94.degree. for 10 seconds 53.degree. for 10 seconds 72.degree. for
20 seconds Hold at 4.degree.
[0360] The following samples were analyzed by PCR to determine if
PNA molecules inhibit PCR reactions;
[0361] 1. 1 .mu.L Bt/RR corn DNA (Bt/RR corn has been genetically
modified))
[0362] 2. 1 .mu.l Bt/RR corn DNA, 1 .mu.L PNA (100 mM)
[0363] 3. 1 .mu.l Bt/RR corn DNA, 5 .mu.L PNA (100 mM)
[0364] 4. 1 .mu.L, Water
[0365] The PCR results were visualized using 2% TBEE agarose gel
electrophoresis.
[0366] The following samples were analyzed to determine whether the
presence of PNA inhibits PCR. In addition, the effects of PNA and
methanol on PCR performance were determined.
[0367] 1. 1 .mu.L Bt/RR corn DNA
[0368] 2. 1 .mu.L Bt/RR corn DNA, 1 .mu.L PNA (100 mM)
[0369] 3. 1 .mu.L BIRR corn DNA, 5 .mu.L PNA (100 mM)
[0370] 4. 1 .mu.L Bt/RR corn DNA, 1 .mu.L methanol
[0371] 5. 1 .mu.L Bt/RR corn DNA, 5 .mu.L methanol
[0372] 6. 1 .mu.L Water
[0373] The PCR results were visualized using 2% TBEE agarose gel
electrophoresis.
[0374] The results indicate that PNA did not inhibit PCR when 1
.mu.L PNA was added to the reaction (Tube 2). PNA did inhibit PCR
when 5 .mu.L PNA was added to the reaction (Tube 3). Methanol did
not inhibit PCR when 1 .mu.L PNA was added to the reaction (Tube
4). Methanol did inhibit PCR when 5 .mu.L PNA was added to the
reaction (Tube 5).
Example 3
[0375] The time course of light stimulated change in an optical
property of 3,3'-diethylthiacarbocyanine iodide for different
concentrations of DNA molecule was determined for a specific target
polynucleotide sequence, and PNA sequence.
[0376] The target polynucleotide was 5' CTACGGGAGGCAGCAGTG 3' [SEQ
ID NO:2] and complementary the PNA molecule was
CACTGCTGCCTCCCCGTAG-Lys [SEQ ID NO:1]. The target polynucleotide
concentrations were those that are listed in the legend of FIG. 5.
The PNA concentration was 14.4 pmole/reaction. The dye
concentration was 6 nmole/reaction.
[0377] FIG. 5 depicts the time course of
3,3'-diethylthiacarbocyanine iodide dye emission after exposure to
light stimulus for different concentrations of DNA. Assay
sensitivity with varying test DNA concentration using mixed
wavelength light source to stimulate the change. Varying
concentrations of polynucleotide (in this case, DNA) are depicted
in the Figure legend. Legend represents the final DNA amount in
each reaction. ( ) represents samples containing probe and dye
only; (.DELTA.) represents samples containing dye only; (x)
represents samples containing buffer only.
[0378] FIG. 6 depicts the percent change in emission at different
DNA concentrations. The dye had a higher rate of change of emission
at higher DNA concentrations. By comparing the rate of change in an
optical property of the dye at higher PNA concentrations to the
rate of change in an optical property at lower PNA concentrations
(or in the absence of PNA), the presence of the target
polynucleotide was detected and could be quantitated as shown in
FIG. 10. Polynucleotide concentrations are the same as depicted in
the legend of FIG. 5.
Example 4
[0379] This example illustrates that rates of change in optical
properties of dyes can differ for different wavelengths of light
stimulus.
[0380] A target polynucleotide having the sequence 5'
CTACGGGAGGCAGCAGTG 3' [SEQ ID NO:2] at 20 pmole/reaction and the
PNA molecule having the sequence CACTGCTGCCTCCCCGTAG-Lys [SEQ ID
NO:1] at 14.4 pmole/reaction were combined with
3,3'-diethylthiacarbocyanine iodide dye to form a mixture. The
mixture was then exposed to the light stimulus produced by
different light spectrum over 10 minutes, and the percent change in
dye emission was measured over time.
[0381] FIG. 7 depicts the results of this experiment. White light
stimulus was generated using the Fritz Aurora 50/50 bulb, and
generated wavelengths from 350 nm to 700 nm. Blue light stimulus
was generated using the Aurora bulb in conjunction with a blue
filter with most light energy transmitted at a peak of
approximately 460 nm. Green light stimulus was generated using the
Aurora bulb in conjunction with a green filter with most light
energy transmitted at a peak of approximately 510 nm. Red light
stimulus was generated using the Aurora bulb in conjunction with a
red filter with most light energy transmitted at a peak of
approximately 720 nm.
[0382] White light stimulus resulted in the greatest percent change
in emission. Blue and green wavelengths resulted in initially
slower percent changes in emission. Red wavelengths showed a very
slow percent change in emission.
Example 5
[0383] This Example demonstrates that the methods may also be used
to detect differences in nucleic acid sequence.
[0384] Two samples were prepared. The first sample contained a
mixture of PNA complementary to a GMO sequence found in GMO soy
polynucleotide, GMO soy polynucleotide, and
3,3'-diethylhiacarbocyanine iodide. The second sample contained a
mixture of PNA complementary to a GMO sequence found in GMO soy
polynucleotide, non-GMO soy polynucleotide, and
3,3'-diethylthiacarbocyanine iodide. Upon exposure to light
stimulus, rate of change in emission over time was observed for
both samples. The soy polynucleotides were obtained from soy leaf
for both mixtures. In both mixtures, 1 .mu.L of isolated DNA was
used in a 100 .mu.L reaction volume resulting in a DNA
concentration of 0.25 ng/.mu.L, reaction.
[0385] The resulting rate of change in emission over time is
depicted in FIG. 8. The percent change in emission of
3,3'-diethylhialcarbocyanine iodide was measured over time for a
sample containing 3,3'-diethylthiacarbocyanine iodide, a PNA
molecule complementary to a region of genetically modified organism
(GMO) soy 35S polynucleotide, and either a genetically modified
organism (GMO) soy polynucleotide or non-GMO polynucleotide. The
change in emission of the dye results from the hybridization of the
PNA to the GMO soy, and not to the non-GMO soy. The method detected
the GMO soy, but not the non-GMO soy. The present methods provide
means to detect differences in polynucleotide sequences present in
DNA.
Example 6
[0386] This example shows that the quantity of polynucleotide in a
sample may be determined by measuring the rate of change in an
optical property of the dye in a sample having an unknown
polynucleotide concentration and correlating the rate of change in
the optical property to a curve of known rates of change in the
optical property. The time may be fixed and the change may be
measured at a particular time of reaction. The determination of the
rate may also include determining the change in optical property at
a single time and correlating the change in optical property to the
concentration of one or more samples having a known
concentration.
[0387] The time necessary for a 20% change in emission at a series
of polynucleotide concentrations was calculated. The target
polynucleotide sequence was 5' CTACGGGAGGCAGCAGTG 3' [SEQ ID NO:2]
and the PNA molecule sequence was CACTGCTGCCTCCCCGTAG-Lys [SEQ ID
NO:1]. The time required for a 20% reduction as a function of
target polynucleotide concentration is depicted in FIG. 10. The
data correspond to the percent change data in FIG. 6. For one
version of the assay, the point at which there is a 20% change in
emission is measured for a sample having an unknown concentration.
The quantity of polynucleotide in a given sample may be determined
by extrapolating to a standard curve.
Example 7
[0388] This example demonstrates the target polynucleotide may be
RNA.
[0389] A PNA, RNA, and 3,3'-diethylthiacarbocyanine iodide dye were
combined. The target RNA sequence was 5' CUACGGGAGGCAGCAGUG 3' [SEQ
ID NO:15] and the PNA sequence was a universal bacterial PNA probe
having the complementary sequence to the RNA sequence. The mixtures
were exposed to light stimulus, and the percent change in emission
of the dye over time was measured, and compared to a sample
including a DNA polynucleotide sequence instead of an RNA
polynucleotide sequence.
[0390] The resulting percent change in the optical property over
time is depicted in FIG. 11. Comparison of 20 pmole of target DNA
per reaction (solid square), 20 pmole of target RNA per reaction
(solid circle), 10 pmole/reaction of target RNA (solid triangle),
and 2 pmole/reaction of target RNA (open circle). The Y-axis
represents the percent change in fluorescence with time compared to
probe and dye alone. RNA polynucleotides produced a change in
emission of the dye over time. The presence of RNA was detected
based on the rate of change in the optical property of the dye.
Example 8
[0391] This example demonstrates that the method works in the
presence of a contaminating background.
[0392] The percent change in emission over time for
3,3'-diethylthiacarbocyanine iodide in a sample in a contaminating
background of deli meat juices was determined.
3,3'-diethylthiacarbocyanine iodide dye, and a PNA molecule were
prepared. The target polynucleotide sequence was 5'
CTACGGGAGGCAGCAGTG 3' [SEQ ID NO:2] and the PNA sequence was
CACTGCTGCCTCCCCGTAG-Lys [SEQ ID NO:1].
[0393] The results are depicted in FIG. 12. Percent changes in
(.box-solid., solid square) an uncontaminated, clean system and in
samples contaminated with background of 1 .mu.L, 2 .mu.L, and 4
.mu.L (open symbols) of deli meat wash are depicted (open symbols).
The example demonstrates that the presence of a polynucleotide was
detected in a contaminated background.
Example 9
[0394] FIG. 13 depicts the addition of PNA "wedges" in the system.
Biotinylated PNA (5' bio-oo-gatagtgggattgtgcgt [SEQ ID NO:16]) is
attached to a streptavidin well then reacted with a polynucleotide.
After hybridization, the dye is added the system exposed to light
stimulus and the percent change determined over time. The
polynucleotide may be a synthesized polynucleotide or an amplicon
polynucleotide. "Test a" represents 35S PNA 5'
bio-oo-gatagtgggattgtgcgt [SEQ ID NO:16] and a 195 by amplicon
target polynucleotide. "Test a+1" includes both the 35S PNA 5'
bio-oo-gatagtgggattgtgcgt [SEQ ID NO:16] with 195 by amplicon
target polynucleotide and PNA 5' tcttctttttccacg-LYS [SEQ ID
NO:17]. "Test/a+2" includes 35S PNA 5' bio-oo-gatagtgggattgtgcgt
[SEQ ID NO:16] with a 195 by amplicon target polynucleotide and PNA
5' tcttctttttccacg-LYS [SEQ ID NO:17]. "Test/a+b" includes 35S PNA
5' bio-oo-gatagtgggattgtgcgt [SEQ ID NO:16] with a 195 by amplicon
target polynucleotide, 5' tcttctttttccacg-LYS [SEQ ID NO:17] and 5'
tcacatcaatccact-LYS [SEQ ID NO:18]. "Test/a+b pre" includes 35S PNA
5' bio-oo-gatagtgggattgtgcgt [SEQ ID NO:16] with a 195 by amplicon
target polynucleotide, 5' tcttctttttccacg-LYS [SEQ ID NO:17] and 5'
tcacatcaatccact-LYS [SEQ ID NO:18] where 5' tcttctttttccacg-LYS
[SEQ ID NO:17] and 5' tcacatcaatccact-LYS [SEQ ID NO:18] are
incubated with the amplicon target polynucleotide before
hybridization with the attached PNA. "Test/o" represents 35S PNA 5'
bio-oo-gatagtgggattgtgcgt [SEQ ID NO:16] with a complementary
polynucleotide. The linker-oo- was 8-amino-3,6-dioxaoctanoic acid.
In this and other embodiments, linkers can be any chemical linking
group known in the art. The addition of nucleic acid analogs to
different sites on the target polynucleotide can alter the rate of
change.
Example 10
[0395] This Example depicts the rate of change in an optical
property of the dye when exposed to different wavelengths.
[0396] FIG. 14 depicts the comparison of exposure to light stimulus
of different wavelengths for a series of samples. A mixture of
target polynucleotide, PNA, and 3,3'-diethylthiacarbocyanine iodide
dye was prepared, and a change in an optical property of the dye
was observed. The target polynucleotide was 5' CTACGGGAGGCAGCAGTG
3' [SEQ ID NO:2] and the PNA molecule was CACTGCTGCCTCCCCGTAG-Lys
[SEQ ID NO:1].
[0397] FIG. 14 a)-d) depict the dye emission over time at a series
of wavelengths as follows: a) mixed light; b) mixed light through
blue filter, 460 nm peak; c) mixed light through a green filter,
510 nm peak; d) mixed light through a red filter 720 nm peak. For
each of a)-d), (.box-solid.) depicts a positive control or test
sample; (.quadrature.) depicts the PNA probe only; (open triangle)
depicts the 3,3'-diethylthiacarbocyanine iodide dye only; (x)
depicts a buffer background. Percent change calculated from
emission values is depicted in FIG. 7.
Example 11
[0398] This example shows that the methods may be used in a solid
based format by preparing a PNA/polynucleotide hybrid either before
or after binding to a solid support.
[0399] A universal bacterial PNA probe, and its complementary
polynucleotide, were used in these experiments. The target
polynucleotide was 5' CTACGGGAGGCAGCAGTG 3' [SEQ ID NO:2] and the
PNA molecule was 5' bio-CACTGCTGCCTCCCCGTAG 3' [SEQ ID NO: 1]. In a
first sample, a biotinylated PNA probe was immobilized to well by
streptavidin-biotin binding. The polynucleotide and
3,3'-diethylthiacarbocyanine iodide dye were then added. The sample
was exposed to light stimulus, and the percent change in
fluorescent emission of the dye was measured.
[0400] In a second sample, a biotinylated probe and a target
polynucleotide were allowed to hybridize together to form a
PNA/polynucleotide hybrid. The PNA/polynucleotide hybrid was then
added to a streptavidin-coated well, and the hybrid was allowed to
bind to the well surface.
[0401] FIG. 15 depicts the percent change in emission over time
observed in the first and second samples. In test 1 (.box-solid.),
the probe-bio immobilized to well by streptavidin-biotin binding
before reacting to the target DNA and dye. In test 2 ( ), the PNA
molecule and target was allowed to hybridize together in solution
before adding to the well. Y-axis represents the percent change in
fluorescence with time compared to probe alone.
Example 12
[0402] This example demonstrates that the methods may be used to
identify and/or quantify a target polynucleotide obtained from a
blood sample.
[0403] Human blood was collected into EDTA tubes by venipuncture.
10 .mu.L of male blood and 10 .mu.L of female blood were added into
a microfuge tube containing 180 .mu.L of lysis buffer that was 6 M
guanidinium thiocyanate; 20 mM EDTA; 10 mM Tris-HCl (pH 6.5); 40
g/L Triton.RTM. X-100; 10 g/L dithiothreitol. Prior to its addition
to the blood the buffer was heated at 60.degree. C. until
dissolved. 10 .mu.L of female blood was added into a microfuge tube
containing 190 .mu.L of the same lysis buffer. The reactions were
allowed to incubate at room temperature for 10 minutes.
[0404] The reactions were centrifuged for 5 mins at 4000 rpm.
Supernatant was discarded, and the pellet and wash with 500 .mu.L
of the lysis buffer. The pellet was centrifuged again for 2 mins at
max speed. The supernatant was discarded, and the supernatant was
washed with 500 .mu.L of wash buffer (25% ethanol; 25% isopropanol;
100 mM NaCl; 10 mM Tris-HCl (pH 8.0)). The reactions were
centrifuged for 2 mins at maximum speed, and the supernatant was
discarded. The reactions were washed twice with 5 mM phosphate
buffer used in the PNA hybridization reaction. After the final
rinse, reactions were resuspended with 200 .mu.L of 5 mM phosphate
buffer.
[0405] The following table shows the test conditions for reaction
in microwell. 2.5 .mu.L, of whole blood was used in a 50 .mu.L
reaction volume. This equates to 300 targets/.mu.L of reaction and
100 ng of DNA total. PNA sequence 5' Bio-OO-TGAGTGTGTGGCTTTCG 3'
[SEQ ID NO:19].
TABLE-US-00005 Test Neg control No PNA control Sample 48 .mu.L of
test 48 .mu.L of negative 48 .mu.L of negative PNA 1 .mu.L 1 .mu.L
0 Dye 1 .mu.L 1 .mu.L 1 .mu.L
[0406] Emission data was collected using a Genios spectrophotometer
at an excitation wavelength of 535 nm and an emission wavelength of
590 nm. After an initial zero minute read, the samples were exposed
to light stimulus from the Aurora 50/50 for 30 seconds. The
fluorescence was measured every 30 seconds for 10 minutes.
[0407] FIG. 16 shows that the sample of target male blood, depicted
by (.box-solid.), was detected by the assay, but the female blood
depicted by (.quadrature.) as a negative control was not
detected.
Example 14
[0408] A number of nucleic acid sequences were or can be used to
detect target polynucleotides. These sequences are listed
below.
TABLE-US-00006 PNA name Seq PPI2101bio 5' bio-oo-tgagtgtgtggctttcg
huSRY [SEQ ID NO: 19] PPI2024 5' cactgctgcctcccgtag-LYS 16S [SEQ ID
NO: 1] PPI2024bio 5' bio-OO-actgctgcctcccgtag [SEQ ID NO: 20]
PPI2025bio4 5' bio-OOOO-tgcctcccgtag [SEQ ID NO: 21] PPI2025bio6 5'
bio-OOOOOO-tgcctcccgta [SEQ ID NO: 22] PPI2025bio8 5'
bio-OOOOOOOO-tgcctcccgta [SEQ ID NO: 22] PPI2025bio10 5'
bio-OOOOOOOOOO-tgcctcccgtag [SEQ ID NO: 21] PPI2025 UL 5'
tgcctcccgtag [SEQ ID NO: 21] PPI18bio 5' bio-oo-gatagtgggattgtgcgt
35S [SEQ ID NO: 16] PPI359 5' cccacccacgagg-LYS [SEQ ID NO: 11]
PPI485 5' tcttctttttccacg-LYS [SEQ ID NO: 17] PPI486
5'tcacatcaatccact-LYS [SEQ ID NO: 18] PPI2202
bio-(O).sub.10-ctcattgatggt HIV [SEQ ID NO: 23] PPI911
bio-(O).sub.10-cgcagaccacta HCV [SEQ ID NO: 24]
Example 15
[0409] FIG. 19 depicts the effect of exposure to different
wavelengths of light stimulus.
[0410] A mixture including 16S PNA (5' cactgctgcctcccgtag-LYS) [SEQ
ID NO: 1), a polynucleotide (5' ctacgggaggcagcagtg) [SEQ ID NO:2],
and 3,3'-diethylthiacarbocyanine iodide dye were exposed to a white
light stimulus having all visible wavelengths, a blue light source
(peak light energy transmission 460 nm), green light source (peak
light energy transmission 510 nm), a red light source (peak light
energy transmission 720 nm), and no light stimulus exposure. Light
source for the mixed light was an Aurora 50/50 from FITZ. For the
light sources blue, green or red, filters were placed on the Aurora
50/50. Reading was done on a Safire multiwell plate reader
(produced by Tecan).
[0411] Mixtures exposed to light stimulus resulted in a different
rate of change in an optical property of the dye compared to a
reference value. Mixtures that were not exposed to light stimulus
resulted in no measurable change over the time measurement.
Different wavelengths resulted in different rates of change in
optical properties. This example shows that light radiation may be
used to cause different rates of change in an optical property of a
dye.
Example 16
[0412] The PNA was immobilized on a solid substrate, and the amount
of DNA was detected based on the change in rate of fluorescence of
a dye.
[0413] The following reactants were used in this example: a) 10
.mu.M probe-BIO (from Example 14); b) 2 mM dye
Diethylthiacarbocyanine iodide (100 mM stock in DMSO; 2 mM working
concentration in 5 mM buffer); c) 5 mM buffer (pH 5.5) (1 mL of 100
mM Na.sub.2HPO.sub.4.7H.sub.2O+24 mL of 100 mM
Na.sub.2H.sub.2PO.sub.4.H.sub.2O+475 mL H.sub.2O pH to 5.5); d)
1.times.PBS+0.05% TWEEN.RTM. 20 (PBST) (1.times.PBS=0.137 M
NaCl+2.68 mM KCl+4.3 mM NaH.sub.2PO.sub.4+1.47 mM
KH.sub.2PO.sub.4); e) Streptavidin microtiter plates (NUNC); and f)
test samples containing or lacking a target polynucleotide.
[0414] The number of wells was calculated. Each well was prepared
by pre-washing wells 3.times. with 200 .mu.L 1.times.PBST. 1 .mu.L
of PNA probe was used in 50 .mu.L total reaction. 3 .mu.L it of
probe was added to 147 .mu.L PBST.
[0415] The PNA probes were attached to the solid surface of
microtiter wells. The mixture was incubated 1 hour at room
temperature shaking gently.
TABLE-US-00007 +control Test sample Probe only Buffer only 50 .mu.L
50 .mu.L 50 .mu.L 50 .mu.L buffer
[0416] The wells were then washed 3.times. with 100 .mu.L of PBST.
The liquid was removed. The wells were then washed 3.times. with 5
mM phosphate buffer. For a positive control, 1 .mu.L of the
reaction was added in 49 .mu.L of 5 mM phosphate buffer, then added
to the positive control, well. 1 .mu.L of the sample was diluted in
49 .mu.L of phosphate buffer then added to the test sample well. To
probe and buffer only wells, 50 .mu.t of phosphate buffer was
added. All wells were incubated for 30 minutes at room temperature
with gentle shaking. The wells were washed 5.times. with 100 .mu.L
of phosphate buffer as described above.
[0417] A dye solution was made by using 1 .mu.L it of 2 mM dye to
49 .mu.L of phosphate buffer/well. The dye solution was added to
all wells except the negative control buffer only well. 50 .mu.IL
of phosphate buffer was added to the buffer only well.
[0418] The fluorescence of the dye was observed. An initial
fluorescence reading was detected prior to providing exposure to
light stimulus from an Aurora 50/50 light source. Excitation was at
535 nm and emission at 590 nm was observed every 2 minutes using a
Genios multiwell plate reader.
Example 17
[0419] A. The following protocol was followed using a liquid PNA
sample.
[0420] Sufficient wells for the number of samples to be tested plus
3 for controls were prepared. The DNA or RNA was isolated.
[0421] Each test reaction contained: 1 .mu.L PNA probe, 47 .mu.L
buffer (5 mM 2 mL 100 mM Na.sub.2HPO.sub.4.7H.sub.2O+48 mL
NaH.sub.2PO.sub.4.H.sub.2O/L (pH 5.5)), and 1 .mu.L test sample.
The samples were loaded into a Greiner 96-well strip plates
(#705070).
[0422] The probe, dye and buffer were combined to form a mixture,
and the wells were set up as follows:
TABLE-US-00008 +control Test sample PNA only Buffer only 1 .mu.L +
control 1 .mu.L sample 1 .mu.L buffer 50 .mu.L buffer
[0423] 49 .mu.L of the mixture was added to all wells EXCEPT buffer
only well. The solution was gently mixed.
[0424] The absorbance or fluorescence without exposure to a light
stimulus was determined at the following wavelengths: absorbance:
562 nm; fluorescence emission: 590 nm; and fluorescence excitation
535 nm.
[0425] The samples were exposed to light stimulus using an Aurora
50/50 and the absorbance or fluorescence was determined after every
30 seconds of exposure to a light stimulus.
[0426] B. The following protocol was conducted using PNA molecules
that were immobilized on a solid surface.
[0427] The following items were used in the protocol: a) 10 .mu.M
PNA (ABI); b) 2 mM 3,3'-diethylthiacarbocyanine iodide
(Sigma-Aldrich, catalog #173738) dye; c) 5 mM 1.times.PBS (0.137 M
NaCl, 2.68 mM KCl, 4.3 mM NaH.sub.2PO.sub.4, 1.47 mM
KH.sub.2PO.sub.4)+0.05% TWEEN.RTM. 20; d) 1.times.PBS (0.137 M
NaCl, 2.68 mM KCl, 4.3 mM NaH.sub.2PO.sub.4) 1.47 mM
KH.sub.2PO.sub.4)+0.05% TWEEN.RTM. 20; e) test samples including a
target polynucleotide; and f) Streptavidin-coated plates (Nuncbrand
Immobilizer.TM. (Catalog No. 436014)).
[0428] In one variation, the PNA was immobilized before introducing
the polynucleotide samples. Enough wells were prepared for samples
(n) to be tested plus 3 extra wells for controls by washing
3.times. with 300 .mu.L of 1.times.PBST. The DNA or RNA to be
tested was isolated. The biotinylated PNA was immobilized to the
streptavidin-coated wells by adding 1 .mu.L of 10 .mu.M PNA stock
into 49 .mu.L of PBST.
[0429] A PNA master mix was made that included (n +2) (where "n" is
the number of wells) times 1 .mu.L of a 2 mM PNA stock, and (n +2)
X 49 .mu.L of PBST. 50 .mu.L of PNA mix was then added to all wells
EXCEPT buffer only well.
[0430] The mixture was covered and incubated for 1 hour at room
temperature on a gentle shaker.
[0431] Each well was washed 3.times. with 200 .mu.L of PBST, then
3.times. with 5 mM phosphate buffer, and the nucleic acid samples
were added to the immobilized probe. 1 .mu.L of sample was added to
49 .mu.L of 5 mM phosphate buffer.
[0432] Wells were prepared as diagramed below:
TABLE-US-00009 Test +control PNA only Buffer only Test sample 1
.mu.L 1 .mu.L 0 0 5 mM phosphate buffer 49 .mu.L 49 .mu.L 50 .mu.L
50 .mu.L
[0433] The wells were covered at room temperature for 30 minutes
and incubated by gentle shaking. Each well was then washed with 100
.mu.L 5 mM phosphate buffer 6.times.. A dye solution was prepared
by adding 1 .mu.L, of 2 mM dye solution to 49 .mu.L of 5 mM
phosphate buffer per sample. 50 .mu.L of 5 mM phosphate buffer was
added to the buffer only well.
[0434] An initial read absorbance or fluorescence was detected
prior to exposure to a light stimulus at the following wavelengths:
absorbance of 562 nm; fluorescence emission of 590 nm, and
fluorescent excitation of 535 nm.
[0435] Samples were exposed to light stimulus at the using an
Aurora 50/50. The Aurora 50/50 can also be used with different
colored filters (blue, green, red) to define the range of light of
interest.
[0436] In another variation, PNA was immobilized and target
polynucleotides were hybridized at the same time. Enough wells for
samples (n) were prepared, along with 3 extra wells for controls by
washing 3.times. with 300 .mu.L, of 1.times.PBST. The DNA or RNA
was isolated.
[0437] A mixture of PNA probe and sample was prepared as diagramed
below:
TABLE-US-00010 Test +control PNA only Buffer only PNA 1 .mu.L 1
.mu.L 1 .mu.L 0 Test sample 1 .mu.L 1 .mu.L 0 0 5 mM phosphate
buffer 48 .mu.L 48 .mu.L 49 .mu.L 50 .mu.L
[0438] The mixture was incubate covered for 10-120 minutes
(dependent on application) at room temperature gently shaking. The
mixture was washed 6.times. with 100 .mu.L 5 mM phosphate buffer. A
dye was prepared as described above. 50 .mu.L of the solution was
added to each well except the buffer only well.
Example 18
[0439] The following protocol was conducted using plant DNA.
[0440] The line was RR 2701 soy. The DNA used was from a purified
DNA extraction that contained 62 ng/.mu.L. Samples were serial
diluted from 62 ng/.mu.L to 0.062 ng/.mu.L. One .mu.L of this
dilution was used in a 50 .mu.L reaction.
[0441] A streptavidin plate was washed 3.times. with 400 .mu.L of
Phosphate buffered saline buffer (PBS) (+0.5% TWEEN.RTM. (PBST)) at
room temperature (RT). All washing, loading and unloading was done
using a pipette. To wash, 400 .mu.L of solution was added directly
to the well. The solution was then sucked off using the same
pipette and tip.
[0442] PNA bio-18 (35S) was diluted 1/10 in water (i.e., 1 .mu.L of
PNA stock to 9 .mu.L water) (BIO-OO-GATAGTGGGATTGTGCGT [SEQ ID
NO:16], where OO are two linkers.) 1 .mu.L of the diluted PNA was
added per 49 .mu.L of PBST. A master mix was made to include all
wells to be bound plus one well in excess. Thus if we were to bind
10 wells enough mix was made for 11 wells. (114 of the diluted
PNA+539 .mu.L PBST). 50 .mu.L of this mix was added to each well.
The plate was incubated 1 hour at room temperature ("RT") with
gentle shaking on an orbital shaker. DNA was prepared by making
serial dilutions (1/10, 1/100, 1/1000) of each DNA sample in water
in micro-PCR tubes. Tubes were placed in a thermal cycler and a
denature program was run (95.degree. C. for 5 min). Upon completion
tubes were placed on ice until needed. After incubation the plate
was washed 3.times. with PBST as described above. The plate was
then washed 3.times. with 5 mM PO.sub.4 buffer (pH 5.7) as
described above. One .mu.L of DNA or diluted DNA sample was added
to each well, (GM or non GM DNA, one sample per well). 49 .mu.L of
PO.sub.4 buffer was added. Plate was gently mixed and incubated 30
min at RT with gentle shaking on an orbital shaker. After
incubation the plate was washed 5.times. with PO.sub.4 buffer as
described above. 1 .mu.L of 3,3'-diethylthiacarbocyanine iodide (3
mM) was added to 49 .mu.L of PO.sub.4 buffer (A master mix was made
to include all wells plus enough for one more well). 50 .mu.L of
dye/buffer was added to each well using a pipette. The plate was
then placed in Tecan scanner to monitor fluorescence of the
reaction at 535 nm excitation and 590 nm emission. An initial read
was conducted at time zero. The plate was then exposed to light
stimulus and read in intervals of 1 minute. Data as analyzed in
Excel and plotted based on percent change vs time using the
equation 100-(sample/PNA dye only).times.100.
[0443] FIG. 20 depicts the detection of different concentrations of
soy DNA. These are indicated by the +. Soy DNA that did not contain
the GMO sequence was close to background levels. These are
indicated by the -. The method was able to detect 0.0625 ng GMO soy
DNA, which corresponds to approximately 21 genomes. FIG. 21 depicts
the percent change in optical property versus the number of genomes
of GMO positive soy and wild type soy that does not contain the PNA
target sequence.
Example 19
[0444] The following reaction shows detection of a target
polynucleotide in phosphate buffer alone and with various
TWEEN.RTM. 20 concentrations. Similar experiments were done with
other nonionic detergents including NP-40 and Triton.RTM.
X-100.
[0445] The following items were used in the protocol: a) 10 .mu.M
PNA (ABI); b) 2 mM 3,3'-diethylthiacarbocyanine iodide
(Sigma-Aldrich, catalog #173738) dye; c) 5 mM buffer (pH 5.5) (2 mL
100 mM Na.sub.2HPO.sub.4.7H.sub.2O+48 mL
NaH.sub.2PO.sub.4.H.sub.2O/L); d) test samples.
[0446] Enough wells were prepared for the number of samples to be
tested plus 3 for controls. The DNA or RNA was isolated. Each test
reaction contained: 1 .mu.L probe, 47, .mu.L buffer, and 1 .mu.L
sample to form a mixture.
TABLE-US-00011 +control Test sample PNA only Buffer only 1 .mu.L +
control 1 .mu.L sample 1 .mu.L buffer 50 .mu.L buffer
[0447] To all wells EXCEPT buffer only well, add 49 .mu.L of
mixture was added, and the solution was mixed gently.
[0448] An initial fluorescence measurement was made without
exposure to a light stimulus at an emission setting at 590 nm and
an excitation setting at 535 nm. The samples were exposed to light
stimulus using an Aurora 50/50 and the absorbance and/or
fluorescence was measured after every 60 seconds of exposure to a
light stimulus. The standard 5 mM phosphate buffer (pH 5.5) was
used and compared with reactions in phosphate buffer containing
0.05%, 0.1%. 0.5%. 1.0%, 1.5%, and 2% TWEEN.RTM. 20.
[0449] FIG. 22 depicts the emission using different concentrations
of TWEEN.RTM.. (.box-solid.) represents the reaction with target
DNA, (.quadrature.) represents probe alone, (.DELTA.) represents
dye in buffer, and (*) represents buffer alone.
[0450] FIG. 23 depicts the % change in emission for different
concentrations of TWEEN.RTM..
Example 20
[0451] This example demonstrates that the reaction can use nucleic
acid analogs other than PNAs. The present reaction uses locked
nucleic acids (LNAs). Various concentrations of TWEEN.RTM. 20 in
the phosphate buffer were also tested.
[0452] The following LNA sequences were used:
TABLE-US-00012 LNA-A TG.sup.mC.sup.mCt.sup.mC.sup.mC.sup.mCGTAG.
[SEQ ID NO: 25 LNA-B tGc.sup.mCt.sup.mCc.sup.mCgTaG. [SEQ ID NO:
26] LNA-C tGccTcc.sup.mCgtAg. [SEQ ID NO: 27]
[0453] Lower case letter represent DNA, upper case letters
represent LNA and .sup.m represents methylation of the following
C.
[0454] Reactions were conducted in liquid form in accordance with
the methods disclosed in Example 19, above.
[0455] FIG. 24 compares the raw data with PNA probes and with LNA
probes in the liquid reaction. Standard reaction in phosphate
buffer was compared to various concentrations of TWEEN.RTM. 20
added to the phosphate buffer. Solid symbols represent test
reaction while open symbols are the respective probes only.
(.box-solid., .quadrature.) PNA; (.diamond-solid., .diamond.)
LNA-A; (.tangle-solidup., .DELTA.) LNA-B; ( , .smallcircle.)
LNA-C.
[0456] FIG. 25 depicts the percent change in emission using PNAs
versus LNAs. (.box-solid.) represents the percent change in the
reaction when compared to the PNA probe alone. (.diamond-solid.)
represents the percent change in the LNA-A test reaction when
compared to the LNA-A probe and dye alone. (.tangle-solidup.)
represents the percent change in the LNA-B test reaction when
compared to the LNA-B probe alone. ( ) represents the percent
change in the LNA-C test reaction when compared to the LNA-C probe
alone.
Example 21
[0457] The assay method may also be used to detect hepatitis C
virus. Using standard methods hepatitis C virus RNA was isolated
from plasma that had a known amount of hepatitis C virus present.
Using this isolated RNA reactions were conducted in liquid form in
accordance with the methods disclosed in Example 19, above.
[0458] FIG. 26 depicts the detection of hepatitis C virus probe
using different quantities of plasma. The rate of change of optical
property is different for viruses even in very low copy
numbers.
[0459] The copy number of hepatitis C virus can also be
quantitated. FIG. 27 depicts the emission of the dye obtained when
different number of hepatitis C virus RNA were introduced into the
assay. Lower numbers of virus RNA in the system generally have
lower fluorescent emissions after one minute.
Example 22
[0460] This example demonstrates that the methods may be used to
identify and/or quantify a target polynucleotide in bacteria.
[0461] 500 .mu.L of bacterium (either E. coli or Bacillus cereus)
culture grown overnight in TSB (tryptic soy broth) was pelleted by
spinning for 5 minutes at 6000 rpm then resuspended in 500 .mu.L of
phosphate buffer then set at room temperature for 5 minutes. After
this the PNA (either 5'bio-oo-gatagtgggattgtgcgt [SEQ ID NO:16] for
the 35S sequence or 5' Bio-OO-TGAGTGTGTGGCTITCG 3' [SEQ ID NO:19]
for the non-specific HCV negative control sequence) and dye was
added to the system, exposed to light stimulus and readings
taken.
[0462] The following table shows the test conditions for reaction
in microwell with a 50 .mu.L reaction volume.
TABLE-US-00013 P/O Probe Dye Bacteria Bacteria test only only test
dye PNA 5 .mu.L 5 .mu.L 5 .mu.L Oligo 5 .mu.L Bacterial culture 43
.mu.L 43 .mu.L Dye 2 .mu.L 2 .mu.L 2 .mu.L 2 .mu.L 2 .mu.L
Phosphate buffer 38 .mu.L 43 .mu.L 48 .mu.L 5 .mu.L
[0463] Emission data was collected using a Genios spectrophotometer
at an excitation wavelength of 535 nm and an emission wavelength of
590 nm. After an initial zero minute read, the samples were exposed
to light stimulus from the Aurora 50/50 light for 60 seconds. The
fluorescence was measured every 60 seconds for 10 minutes.
[0464] FIG. 28 depicts the rate of change in the fluorescence
compared to the absence of a nucleic acid analog/polynucleotide
hybrid for each sample. The sample of target E. coli or B. cereus,
was detected by the 16S PNA probe in the assay (closed diamond and
closed triangle, respectively, but target E. coli or B. cereus, was
not detected by the viral HCV PNA probe in the assay (x, and +,
respectively. The (black square) shows the positive control with
oligocomplementary to the 16S sequence as the target
polynucleotide.
Example 23
[0465] Oligonucleotides (5' tgtgaacgca 3' [SEQ ID NO:31] and 5'
tgcgttcaca 3' [SEQ ID NO: 32]) were mixed in annealing buffer (10
mM Tris, pH 7.5-8.0, 50 mM NaCl, 1 mM EDTA) to 10 mM and heated at
95.degree. C. for 10 minutes in a thermal cycler. After heating the
oligo mixture was allowed to cool at room temperature for 1 hour.
One microliter of this mix was used per reaction.
[0466] PNAs N Bio-OO-gatagtgggattgtgcgt C [SEQ ID NO:33] and N
tcacatcaatccact-lys C [SEQ ID NO:34] were used mixed of
individually at 10 mM in reaction buffer (5 mM PO.sub.4+0.05%
TWEEN.RTM.). One microliter of each mix was used per reaction.
[0467] 10 mM, 3,3'-diethylthiacarbocyanine dye stock was diluted to
4 mM in reaction buffer. One microliter of this mix was used per
reaction.
Example 24
[0468] This example illustrates that rates of change in optical
properties of dyes can differ for different dyes and different
concentrations.
[0469] The dyes used were 3,3'-diethylthiacarbocyanine (DiSC3) or
3,3'-diethylthiadicarbocyanine (DiSC5) (Sigma, Milwaukee). The
target polynucleotide and the PNA molecule are 15mers. The target
polynucleotide has a sequence of 5' AGTGGATTGATGTGA 3' [SEQ ID
NO:28]. The PNA molecule has a sequence of 5' TCACATCAATCCACT-LYS
[SEQ ID NO:18].
[0470] The samples were run in 50 .mu.L volume in PCR tubes
according to the following procedure. Sample "A and C" contained
buffer. Sample "B and D" contained 4 pmoles PNA and 4 pmoles of the
target polynucleotide in buffer. All samples were heated to
95.degree. C., and then cooled to room temperature.
3,3'-diethylthiadicarbocyanine was added to tubes A and B. The dye
was added to each sample at a final concentration of 9 .mu.M,
forming a light blue solution. 3,3'-diethylthiacarbocyanine was
added to tubes C and D. The dye was added to each sample at a final
concentration of 9 .mu.M, forming a pink solution. The tubes were
exposed to a light stimulus for 140 seconds and observed in 20
second intervals, during which time the Sample D rapidly changed in
color from pink to clear. Sample A, B and C remained unchanged in
color.
[0471] The samples were then heated to 95.degree. C. for 2 minutes,
and observed for 100 seconds in 20 second intervals as the samples
cooled to room temperature. No color change was observed in Samples
A, B, C or D. The samples were again heated again to 95.degree. C.
for 2 minutes, and observed for 100 seconds in 20 second intervals
as the sample cooled to room temperature. No color change was
observed in Samples A, B, C or D.
[0472] Sample C, containing the dye and buffer, showed no color
change when exposed to the light stimulus or during the
heating/cooling cycles, indicating the dye is stable under these
conditions. Sample D, containing PNA, the target nucleotide, and
the dye, changed in color from pink to clear upon exposure to the
light stimulus. The pink color did not return as a result of the
heating/cooling cycles. Sample A and B also did not change color
during the light exposure or heating/cooling cycles.
Example 25
[0473] This example illustrates that the methods may be used to
identify or quantify a target polynucleotide.
[0474] All reaction use:
[0475] A. 100 mM PNA probe stock in H.sub.2O. Dilute 1/50 (2 .mu.M)
and use 2 .mu.L per 50 .mu.L reaction (4 pmoles).
[0476] B (1) 100 mM DNA oligo stock in H.sub.2O. Dilute 1/50 (2
.mu.M) and use 2 .mu.L per 50 .mu.L reaction (4 pmoles); or (2)
Genomic DNA is used at approximately 2 ng (or less) per
reaction.
[0477] C. 5 mM phosphate (pH 5.5)+TWEEN.RTM. 80 (0.05%) buffer.
[0478] D. 7.5 mM 3,3'-diethylthiacarbocyanine iodide stock in DMSO.
3 .mu.L is diluted to 15 .mu.M with 1500 .mu.L of phosphate (pH
5.5)+TWEEN.RTM. 80 (0.05%) buffer and stored in the dark until
use.
[0479] E. Molecular grade water.
[0480] F. Costar, white with white bottom 384-well microtiter
plate.
[0481] G. Light source (ballast) with 15 W Aurora 50/50 fluorescent
bulb.
[0482] H. Fluorescent plate reader and computer.
[0483] Calculate the number of wells required and prepare enough
reagent for triplicate plus 3 for controls in triplicate (PNA only,
DNA only, Dye only). Dilute DNA oligo and PNA probe 1/50 (100 .mu.M
diluted to 2 .mu.L). Or, dilute genomic DNA to 2 ng/.mu.L.
[0484] Each test reaction will contain:
TABLE-US-00014 PNA probe 2 .mu.L DNA oligo or genomic DNA 2 .mu.L
water 16 .mu.L phosphate + TWEEN .RTM. 80 Buffer/dye 30 .mu.L total
volume 50 .mu.L
[0485] To each reaction well in the microtiter plate add 16 .mu.L
of water. The "dye only" well gets 20 .mu.L of water. "PNA only"
and "DNA only" each get 18 .mu.L of water. To the appropriate well
add 2 .mu.L of DNA oligo (2 .mu.M) or genomic DNA. To the
appropriate wells add 2 .mu.L of probe (2 .mu.M).
[0486] Cover the wells with tape and mix the plate in the plate
reader for 5 seconds. Allow the reactions to sit for at least 10
minutes (this allows time for hybridization of the PNA probe to its
complementary target). In a 2 mL tube, add 3 .mu.L of 7.5 mM dye
stock to 1500 .mu.L of 5 mM phosphate+ TWEEN.RTM. 80 buffer. Mix
well. With lights dimmed, add 30 .mu.L of phosphate+ TWEEN.RTM. 80
buffer/dye to each well.
[0487] Place the microtiter plate in the plate reader with the
parameters of gain of 49, 1 second shake, emission 535 nm and
excitation 590 nm and take an initial read at time zero. Expose
samples to light using aurora 50/50 and read fluorescence in 2
minute intervals for 30-40 minutes. Graph the data as a function of
the decrease in fluorescence verse time.
Example 26
[0488] This experiment demonstrates the use of two adjacent ends of
two larger PNAs that share homology with a 12mer oligo does drive a
reaction where two 6mer overlaps do not drive a reaction.
[0489] In this experiment PNAs bio-GATAGTGGGATTGTGCGT [SEQ ID
NO:17] and TCTCTTTTTCCACG-lys [SEQ ID NO:18] were diluted in water
to 10 uM working stock. Oligos 5' AGAAGAACGCAC 3' [SEQ ID NO:29]
and 5' GTGCGTTCTTCT 3' [SEQ ID NO:30] were diluted in water in the
same tube to a 10 .mu.M working stock. The tube was heated for 5
minutes and allowed to cool to room temperature for 10 minutes. A
dye stock of 10 mM DiSc3 in DMSO was diluted to a 2 mM working
stock in phosphate buffer+0.05% TWEEN.RTM. 20. Buffer used was
phosphate buffer+0.05% TWEEN.RTM. 20.
[0490] Reactions were set up by making a dye/buffer working stock
by adding 1 .mu.L of 2 mM dye to 46 .mu.L of phosphate buffer+0.05%
TWEEN.RTM. 20. This was made up as n+2 for excess. 47 .mu.L of the
mix as added to a well of a 96 well microtiter plate (clear). To
well one, 1 .mu.L of PNA bio-GATAGTGGGATTGTGCGT [SEQ ID NO:17] and
1 .mu.L of the double stranded oligo and 1 .mu.L of water was
added. To well 2, 1 .mu.L of PNA TCTCTTITTCCACG-lys [SEQ ID NO:18]
and 1 .mu.L of the double stranded oligo and 1 .mu.L of water was
added. To well 3, 1 .mu.L of each PNA was added and 1 .mu.L of
oligo was added.
[0491] An initial fluorescence measurement was made without
exposure to a light stimulus at an emission setting at 590 nm and
an excitation setting at 535 nm. The samples were exposed to light
stimulus using an Aurora 50/50 and the fluorescence was measured
after every 30 seconds of exposure to a light stimulus.
[0492] FIG. 29 depicts the percent change in fluorescent intensity
of the reactions. Well 3 which contained both PNA (diamonds), shows
a rapid rate for change where both PNAs bind next to each other
forming a 12 by sequence of homology. Wells 1 (triangle) and 2
(squares), each of which only contain one PNA (6 by sequence of
homology) do not produce a change in fluorescence over
background.
Example 27
[0493] This experiment is to demonstrate the sensitivity of the
assay using serial diluted polynucleotide target.
[0494] In this experiment PNA CACTGCTGCCTCCCCGTAG-Lys [SEQ ID NO:1]
designed to target bacterial 16S ribosomal DNA was diluted in water
to a 10 .mu.M working stock. The polynucleotide sequence was 5'
CTACGGGAGGCAGCAGTG 3' [SEQ ID NO:2]. The polynucleotide was serial
diluted to produce reactions that have final amounts per reaction
of 200 fmoles, 2 fmoles, 200 amoles, 20 amoles, 10 amoles, 5
amoles, 2 amoles, 1 amoles and 0.5 amoles. A dye stock of 10 mM
DiSc3 in DMSO was diluted to a 2 mM working stock in phosphate
buffer+0.05% TWEEN.RTM. 20. Buffer used was phosphate buffer+0.05%
TWEEN.RTM. 20.
[0495] Reactions were set up by making a dye/buffer working stock
by adding 1 .mu.L of 2 mM dye and 1 .mu.L of 10 uM PNA working
stock to 47 .mu.L of phosphate buffer+0.05% TWEEN.RTM. 20. This was
made up as n+2 for excess. 49 .mu.L of the mix as added to each
well of a 96 well microtiter plate (clear). To each test well, 1
.mu.L of the appropriate serial diluted oligo target was added. To
the control dye/PNA well, 1 .mu.L of water was added.
[0496] Using a fluorescent plate reader an initial fluorescence
measurement was made without exposure to a light stimulus (time
zero) at an excitation setting of 535 nm and an emission setting at
590 nm. The samples were exposed to light stimulus using an Aurora
50/50 and the fluorescence was measured after every minute of
exposure to a light stimulus for 30 seconds.
[0497] FIG. 9 depicts the percent change in fluorescent intensity
of the reactions, showing that higher concentrations of target have
a greater percent change than reactions with less target. With this
specific PNA and target, down to 200 fM of target could be
detected.
[0498] All publications, patents, and patent applications cited
herein are hereby incorporated by reference in their entirety for
all purposes to the same extent as if each individual publication,
patent, or patent application were specifically and individually
indicated to be so incorporated by reference. Although the
foregoing invention has been described in some detail by way of
illustration and example for purposes of clarity of understanding,
it is readily apparent to those of ordinary skill in the art in
light of the teachings of this invention that certain changes and
modifications may be made thereto without departing from the spirit
and scope of the disclosure.
Sequence CWU 1
1
34119DNAArtificial SequencePNA for 16S 1cactgctgcc tccccgtag
19218DNAArtificial Sequencetarget polynucleotide 2ctacgggagg
cagcagtg 18322DNAArtificial Sequencenucleic acid analog to detect
bacteria 3gaassmycya acacytagca ct 22424DNAArtificial
Sequencenucleic acid analog to detect bacteria 4tacaamgagy
ygcwagacsg ygas 24521DNAArtificial Sequencenucleic acid analog to
detect gram positive bacteria 5gcagywaacg cattaagcac t
21620DNAArtificial Sequencenucleic acid analog to detect gram
positive bacteria 6acgacacgag ctgacgacaa 20723DNAArtificial
Sequencenucleic acid analog to detect gram negative bacteria
7tctagctggt ctgagaggat gac 23821DNAArtificial Sequencenucleic acid
analog to detect gram negative bacteria 8gagttagccg gtgcttcttc t
21921DNAArtificial Sequencenucleic acid analog to detect Fungi
9gagttagccg gtgcttcttc t 211019DNAArtificial Sequencenucleic acid
analog to detect Fungi 10tagcgacggg cggtgtgta 191113DNAArtificial
SequencePNA for cauliflower mosaic virus 35S promoter 11cccacccacg
agg 131219DNAArtificial Sequenceprimer 12gctcctacaa atgccatca
191320DNAArtificial Sequenceprimer 13gatagtggga ttgtgcgtca
201419DNAArtificial SequencePNA 14cccacccacg aggaacatc
191518RNAArtificial Sequencetarget RNA sequence 15cuacgggagg
cagcagug 181618DNAArtificial SequencePNA for cauliflower mosaic
virus 35S promoter 16gatagtggga ttgtgcgt 181715DNAArtificial
SequencePNA for cauliflower mosaic virus 35S promoter 17tcttcttttt
ccacg 151815DNAArtificial SequencePNA for cauliflower mosaic virus
35S promoter 18tcacatcaat ccact 151917DNAArtificial SequencePNA for
huSRY 19tgagtgtgtg gctttcg 172017DNAArtificial SequencePNA for 16S
20actgctgcct cccgtag 172112DNAArtificial SequencePNA for 16S
21tgcctcccgt ag 122211DNAArtificial SequencePNA for 16S
22tgcctcccgt a 112312DNAArtificial SequencePNA for HIV 23ctcattgatg
gt 122412DNAArtificial SequencePNA for HCV 24cgcagaccac ta
122512DNAArtificial SequenceLNA sequence 25tgcctcccgt ag
122612DNAArtificial SequenceLNA 26tgcctcccgt ag 122712DNAArtificial
SequenceLNA 27tgcctcccgt ag 122815DNAArtificial Sequencetarget
polynucleotide 28agtggattga tgtga 152912DNAArtificial
Sequenceprimer 29agaagaacgc ac 123012DNAArtificial Sequenceprimer
30gtgcgttctt ct 123110DNAArtificial Sequenceprimer 31tgtgaacgca
103210DNAArtificial Sequenceprimer 32tgcgttcaca 103318DNAArtificial
SequencePNA 33gatagtggga ttgtgcgt 183415DNAArtificial SequencePNA
34tcacatcaat ccact 15
* * * * *