U.S. patent application number 12/879119 was filed with the patent office on 2011-01-13 for promoters for expression in modified vaccinia virus ankara.
This patent application is currently assigned to BAVARIAN NORDIC A/S. Invention is credited to SONJA LEYRER.
Application Number | 20110008792 12/879119 |
Document ID | / |
Family ID | 34442836 |
Filed Date | 2011-01-13 |
United States Patent
Application |
20110008792 |
Kind Code |
A1 |
LEYRER; SONJA |
January 13, 2011 |
PROMOTERS FOR EXPRESSION IN MODIFIED VACCINIA VIRUS ANKARA
Abstract
The invention concerns promoters, in particular for the
expression of genes and/or coding sequences in vaccinia viruses
such as Modified vaccinia virus Ankara (MVA). The invention further
concerns expression cassettes comprising said promoter, vectors
comprising said expression cassettes as well as pharmaceutical
compositions and vaccines.
Inventors: |
LEYRER; SONJA; (MUNICH,
DE) |
Correspondence
Address: |
LAW OFFICE OF SALVATORE ARRIGO
1050 CONNECTICUT AVE. NW, 10TH FLOOR
WASHINGTON
DC
20036
US
|
Assignee: |
BAVARIAN NORDIC A/S
Kvistgaard
DK
|
Family ID: |
34442836 |
Appl. No.: |
12/879119 |
Filed: |
September 10, 2010 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10580206 |
May 23, 2006 |
7816508 |
|
|
PCT/EP2004/012125 |
Oct 27, 2004 |
|
|
|
12879119 |
|
|
|
|
Current U.S.
Class: |
435/6.16 |
Current CPC
Class: |
A61P 31/16 20180101;
A61P 35/00 20180101; A61K 48/00 20130101; C07K 14/005 20130101;
A61K 39/285 20130101; A61P 31/10 20180101; A61K 2039/5256 20130101;
A61K 39/12 20130101; A61P 31/22 20180101; C12N 2710/24143 20130101;
A61P 31/14 20180101; A61P 31/12 20180101; A61P 31/04 20180101; C12N
15/86 20130101; A61P 31/20 20180101; A61P 31/00 20180101 |
Class at
Publication: |
435/6 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68 |
Foreign Application Data
Date |
Code |
Application Number |
Nov 24, 2003 |
DK |
PA 2003 01730 |
Jan 17, 2004 |
EP |
04000943.3 |
Claims
1-22. (canceled)
23. A method for determining whether a derivative of SEQ ID NO:2,
SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:9,
SEQ ID NO:10, SEQ ID NO:11, or SEQ ID NO:12 is active as a vaccinia
virus promoter comprising: (a) cloning a derivative of one of SEQ
ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID
NO:9, SEQ ID NO:10, SEQ ID NO:11, or SEQ ID NO:12 upstream of a
reporter gene in a plasmid construct; (b) introducing the
expression cassette into a target cell; and (c) detecting
expression of the reporter gene in the target cell.
24. The method of claim 23, wherein the derivative has one or more
nucleotide substitutions.
25. The method of claim 23, wherein the derivative has one or more
nucleotide insertions
26. The method of claim 23, wherein the derivative has one or more
nucleotide deletions.
27. The method of claim 23, wherein the derivative is a derivative
of SEQ ID NO:2
28. The method of claim 23, wherein the derivative is a derivative
of SEQ ID NO:3.
29. The method of claim 23, wherein the derivative is a derivative
of SEQ ID NO:4.
30. The method of claim 23, wherein the derivative is a derivative
of SEQ ID NO:6.
31. The method of claim 23, wherein the derivative is a derivative
of SEQ ID NO:8.
32. The method of claim 23, wherein the derivative is a derivative
of SEQ ID NO:9.
33. The method of claim 23, wherein the derivative is a derivative
of SEQ ID NO:10.
34. The method of claim 23, wherein the derivative is a derivative
of SEQ ID NO:11.
35. The method of claim 23, wherein the derivative is a derivative
of SEQ ID NO:12.
36. The method of claim 23, wherein the reporter gene is a
.beta.-glucuronidase (GUS) gene.
37. The method of claim 23, wherein the cell is a baby hamster
kidney cell.
38. The method of claim 23, wherein the cell is a chicken embryo
fibroblast cell.
39. The method of claim 23, wherein the cell is a human cell.
40. The method of claim 23, wherein the cell is incubated with
AraC.
41. The method of claim 23, wherein the cell is incubated without
AraC.
42. The method of claim 23, wherein the cell is infected with MVA.
Description
[0001] The invention concerns promoters, in particular for the
expression of genes and/or coding sequences in vaccinia viruses
such as Modified vaccinia virus Ankara (MVA). The invention further
concerns expression cassettes comprising said promoter, vectors
comprising said expression cassettes as well as pharmaceutical
compositions and vaccines.
BACKGROUND OF THE INVENTION
[0002] Recombinant poxviruses are widely used to express foreign
antigens in infected cells. Moreover, recombinant poxviruses are
currently tested as very promising vaccines to induce an immune
response against the foreign antigen expressed from the poxvirus
vector. Most popular are avipoxviruses on the one side and vaccinia
viruses, in particular Modified vaccinia virus Ankara (MVA) on the
other side. MVA is related to vaccinia virus, a member of the
genera Orthopoxvirus in the family of Poxviridae. MVA has been
generated by 516 serial passages on chicken embryo fibroblasts of
the Ankara strain of vaccinia virus (CVA) (for review see Mayr, A.,
et al, Infection 3, 6-14 [1975]). As a consequence of these
long-term passages the resulting MVA virus deleted about 31
kilobases of its genomic sequence and, therefore, was described as
highly host cell restricted to avian cells (Meyer, H. et al., J.
Gen. Virol. 72, 1031-1038 [1991]). It was shown, in a variety of
animal models that the resulting MVA was significantly avirulent
(Mayr, A. & Danner, K. [1978] Dev. Biol. Stand. 41: 225-34).
Additionally, this MVA strain has been tested in clinical trials as
vaccine to immunize against the human smallpox disease (Mayr et
al., Zbl. Bakt. Hyg. I, Abt. Org. B 167, 375-390 [1987], Stickl et
al., Dtsch. med. Wschr. 99, 2386-2392[1974]).
[0003] U.S. Pat. No. 5,736,368 and U.S. Pat. No. 6,051,410 disclose
recombinant vaccinia virus strain Wyeth that expresses HIV antigens
and proteins. U.S. Pat. No. 5,747,324 discloses a recombinant
vaccinia virus strain NYCBH expressing lentivirus genes. EP 0 243
029 discloses a recombinant vaccinia virus strain Western Reserve
expressing human retrovirus genes. WO 02/42480 discloses
particularly safe and attenuated MVA strains. Recombinant MVA are
disclosed inter alia in WO 98/13500 and WO 03/048184.
[0004] For the expression of heterologous genes in pox viruses only
a few promoters are known to the person skilled in the art, such as
the 30K and 40K promoters (see e.g. U.S. Pat. No. 5,747,324), a
strong synthetic early/late promoter (see e.g. Sutter et al.,
Vaccine (1994) 12, 1032-40), the P7.5 promoter (see e.g. Endo et
al., J. Gen. Virol. (1991) 72, 699-703) and the promoter derived
from the cowpox virus A-type inclusion (ATI) gene (Li et al., J.
Gen. Virol. (1998) 79, 613). All of these promoters have been used
in recombinant vaccinia viruses to express heterologous genes and
were shown to express said genes resulting in the production of the
protein encoded by the heterologous gene. Since only a few
promoters are available for the expression of genes in vaccinia
virus expression systems there is general need for alternative
promoters in vaccinia viruses. In addition, all of the promoters
known so far are rather strong late promoters, i.e. useful for the
expression of genes after the replication of the vaccinia virus
vector has occurred. For some application it is desirable to have
promoters allowing the expression of genes immediately after the
infection of the cells, i.e. there is a need for vaccinia virus
early promoters.
[0005] Moreover, as pointed out above, MVA is a very promising
virus for the expression of heterologous genes due to its improved
safety profile. However, all promoters known so far for the
expression of heterologous genes in MVA were derived from other
vaccinia viruses or are synthetic promoters for the expression in
other vaccinia virus. Thus, there is also a need for promoters
optimized for the expression in MVA.
DETAILED DESCRIPTION OF THE INVENTION
[0006] The invention concerns promoters derived from the genome of
Modified vaccinia virus Ankara (MVA). MVA promoters were not yet
known in the art.
[0007] In particular the invention concerns a promoter comprising
or consisting of a nucleotide sequence selected from the group
comprising:
(i) the nucleotide sequence of anyone of the following SEQ ID NO: 1
to 6:
TABLE-US-00001 (SEQ ID NO: 1)
5'TCTGCAATATTGTTATCGTAATTGGAAAAATAGTGTTCGAGTGAGTTG
GATTATGTGAGTATTGGATTGTATATTTTATTTTATATTTTATATTTTGT
AGTAAGAATAGAATGCTAATGTCAAGTTTATTCCAATAGATGTCTTATTA
AAAAACATATATAATAAATAACA 3' (SEQ ID NO: 2)
5'GATAAAAATTTAAAGTGTAAATATAACTATTATTTTATAGTTGTAATA
AAAAGGGAAATTTGATTGTATACTTTCGGTTCTTTAAAAGAAACTGACTT GATAAAA 3' (SEQ
ID NO: 3) 5'GCATTTCATCTTTCTCCAATACTAATTCAAATTGTTAAATAAATAATG
GATAGTATAAATAGTTATTAGTGATAAAATAGTAAAAATAATTATTAGAA
TAAGAGTGTAGTATCATAGATAACTCTCTTCTATAAAA 3' (SEQ ID NO: 4)
5'GATCTATAAAGGTAGACCTAATCGTCTCGGATGACCATATATTTATTT
TCAGTTTTATTATACGCATAAATAGTAAAAAATATGTTAGGTTTACAAAA 3' (SEQ ID NO:
5) 5'GGTAAACTTTAAGACATGTGTGTTATACTAAGATGGTTGGCTTATTCC
ATAGTAGCTTGTGGAATTTATAAACTTATGATAGTAAAACTAGTACCCAA
TATGTAAAGATGAAAAAGTAAATTACTATTAACGCCGTCGGTATTCGTTC ATCCATTCAGTT 3'
(SEQ ID NO: 6) 5'-ATTTCTCGGTAGCACATCAAATGATGTTACCACTTTTCTTAGCATGC
TTAACTTGACTAAATATTCATAACTAATTTTTATTAATGATACAAAAACG
AAATAAAACTGCATATTATACACTGGTTAACGCCCTTATAGGCTCTAACC ATTTTCAAG 3'
(ii) subsequences of the sequence according to anyone of SEQ ID:
No. 1 to 6 (iii) sequences having one or more nucleotide
substitutions, deletions and/or insertions with respect to the
sequences as defined in (i) or (ii).
[0008] SEQ ID NO: 1 to 6 are naturally part of the MVA genome and
are located upstream of the reading frames A42R, J6R, F6R, I2R, C7L
and B9R, respectively.
[0009] The promoters according to the present invention are
preferably active as vaccinia virus promoters or active as
promoters in vaccinia virus infected cells. The vaccinia virus is
preferably MVA, in particular one of the MVA strains as specified
below. "Active as vaccinia virus promoter" means that the promoter
is able to direct the expression of a gene to which it is operably
linked in a vaccinia virus after infection of cells with said
virus. The cells are preferably cells that allow late and/or early
expression of the vaccinia virus. "A promoter active in vaccinia
virus infected cells" includes also the situation in which the
promoter is not part of a vaccinia virus genome, e.g. part of a
plasmid or a non-vaccinia virus viral genome; in such a situation
the promoter according to the present invention is active if the
cell comprising the promoter also comprises a vaccinia virus
genome, e.g. if the cell is infected with a vaccinia virus. Under
these circumstances the viral RNA polymerase recognizes the
promoter according to the present invention and the expression of
the gene/coding sequence that is linked to the promoter is
activated.
[0010] According to the present invention it is possible to use
anyone of the promoters as specified in SEQ ID NO: 1 to SEQ ID NO:
6. The promoter that is actually used to direct the expression of
the gene/coding sequence may consist of anyone of SEQ ID NO: 1 to
SEQ ID NO: 6 or the actually used promoter may be a larger
structure that comprises anyone of SEQ ID NO: 1 to SEQ ID NO: 6.
Alternatively it is within the scope of the present invention to
use a derivative of these promoters, which may be a subsequence of
the sequences as defined in anyone of SEQ. ID NO: 1 to 6. The term
"subsequence of the sequences according to anyone of SEQ ID NO: 1
to 6" refers to shorter fragments of anyone of SEQ ID NO: 1 to 6
that are still active as a promoter, in particular as promoter in
vaccinia virus or in vaccinia virus infected cells. Again, the
vaccinia virus is preferably MVA, such as one of the strains to
specified below. A typical subsequence of anyone of SEQ ID NO:1 to
SEQ ID NO: 6 has a length of at least 15 nucleotides, more
preferably of at least 20 nucleotides, even more preferably of at
least 25 nucleotides, most preferably of at least 30 nucleotides of
anyone of the sequences of SEQ ID NO:1 to SEQ ID NO: 6.
[0011] A preferred subsequence of SEQ ID NO:1 is SEQ ID NO:7. A
preferred subsequence of SEQ ID NO: 2 is SEQ ID NO: 8. Preferred
subsequences and/or derivatives of said subsequences of SEQ ID NO:
3 are SEQ ID NO: 9 and SEQ ID NO: 10. Preferred subsequences of SEQ
ID NO: 4 are SEQ ID NO: 11 and SEQ ID NO: 12. The sequences of SEQ
ID NO: 6 to 12 are given in the example section.
[0012] The derivative of the promoter comprising or consisting of a
nucleotide sequence of anyone of SEQ ID NO: 1 to 6 or subsequences
thereof, in particular the derivative of the nucleotide sequence of
SEQ ID NO: 7 to SEQ ID NO: 12 can also be a sequence that has one
or more nucleotide substitutions, deletions and/or insertions with
respect to any one of the sequences of SEQ ID NO:1 to 6 or
subsequences thereof, in particular of the nucleotide sequences of
SEQ ID NO: 7 to SEQ ID NO: 12. The derivatives according to the
present invention are still active as a promoter, in particular as
vaccinia virus promoter in a vaccinia virus or in vaccinia virus
infected cells, more preferably as MVA promoter in MVA or in MVA
infected cells. A sequence having one or more nucleotide
substitutions is a sequence in which one or more nucleotides of the
sequence according to anyone of SEQ ID NO: 1 to 6 or subsequences
thereof, such as the sequences according to anyone of SEQ ID NO: 7
to 12 are substituted by different nucleotides. A sequence having
one or more nucleotide insertions is a sequence in which one or
more nucleotides are inserted at one or more locations anyone of
SEQ ID NO: 1 to 6 or subsequences thereof, in particular of the
nucleotide sequences of SEQ ID NO: 7 to SEQ ID NO: 12. A sequence
having one or more nucleotide deletions is a sequence in which one
or more nucleotides of the sequence according anyone of SEQ ID NO:
1 to 6 or subsequences thereof, in particular of the nucleotide
sequences of SEQ ID NO: 7 to SEQ ID NO: 12 are deleted. In the
derivatives according to the present invention deletions,
substitutions and insertions may be combined in one sequence.
[0013] An example of an derivative of a subsequence according to
the present invention is SEQ ID NO: 10, which is a subsequence of
SEQ ID NO: 3 having in addition one nucleotide exchange with
respect to the corresponding nucleotide sequence in SEQ ID NO:
3.
[0014] Preferably the derivative has a homology of at least 40%,
more preferably of at least 60%, even more preferably of at least
80%, most preferably of at least 90% when compared to anyone of the
sequence of SEQ ID NO: 1 to SEQ ID NO: 6 or subsequences thereof,
in particular of the sequences according to anyone of SEQ ID NO: 7
to SEQ ID NO: 12. According to the most preferred embodiment not
more than 10 nucleotides, even more preferably not more than 5
nucleotides are substituted, deleted and/or inserted in the
sequence of anyone of SEQ ID NO: 7 to SEQ ID NO: 12.
[0015] A bundle of prior art documents allows the person skilled in
the art to predict which derivatives or subsequences of anyone of
SEQ ID NO: 1 to 12 still have the biological activity of being
active as a vaccinia virus promoter, in particular as a promoter
active in MVA. In this context reference is made to Chakrarbarti et
al., Biotechniques (1997) 23, 1094-1097 and Davison and Moss, J.
Mol. Biol. (1989) 210, 771-784. Moreover, whether a fragment is
still active as a vaccinia virus promoter, in particular as a MVA
promoter can easily be evaluated by a person skilled in the art. In
particular the sequence derivative can be cloned upstream of a
reporter gene in a plasmid construct. Said construct may be
transfected into a eukaryotic cell or cell line, such as CEF or BHK
cells that has been infected with MVA. The expression of the
reporter gene is determined and compared to the expression of the
reporter gene controlled by the promoter according to anyone of SEQ
ID NO: 1 to 6. A derivative according to the present invention is a
derivative having a promoter activity in said test system of at
least 10%, preferably of at least 30%, more preferably of at least
50%, even more preferably of at least 70%, most preferably of at
least 90% compared to the activity of the promoter sequence of
anyone of SEQ ID NO: 1 to 6. Also those derivatives of anyone of
SEQ ID NO: 1 to 12 are within the scope of the present invention
that have a higher promoter activity.
[0016] The promoters according to the present invention are
particularly suitable for the expression of coding sequences in
MVA.
[0017] The promoter according to SEQ ID NO: 1 has a very strong
activity, in particular as late promoter although it can also be
used as early promoter. The same considerations apply for the
corresponding subsequences such as the sequence of SEQ ID NO: 7,
which is, however, particularly useful as late promoter.
[0018] The promoter according to SEQ ID NO: 2 also has a rather
strong activity, in particular as late promoter. It can also be
used as early promoter. The same considerations apply for the
corresponding subsequences, such as the sequence of SEQ ID NO: 8,
which is, however, particularly useful as late promoter.
[0019] The promoter according to SEQ ID NO: 3 is particularly
useful as early promoter and has the highest early promoter
activity of all promoters tested. However, it can also be used as
late promoters. The same considerations apply for the corresponding
subsequences, such as the sequences of SEQ ID NO: 9 and 10,
respectively. Of these subsequences SEQ ID NO: 9 is particularly
useful as early promoter and SEQ ID NO: 10 is particularly useful
as late promoter.
[0020] The promoter according to SEQ ID NO: 4 is particularly
useful if it is intended to express a linked coding sequence early
and late since this promoter has a rather high activity under early
as well as late conditions. The same considerations apply for the
corresponding subsequences, such as the sequences of SEQ ID NO: 11
and 12, respectively. Of these subsequences SEQ ID NO: 11 is
particularly useful as early promoter and SEQ ID NO: 12 is
particularly useful as late promoter.
[0021] The promoters according to SEQ ID NO: 5 and 6 are
particularly useful if it is intended to express linked coding
sequences in rather low amounts. This is sometimes desirably if the
linked coding sequence encodes a toxic gene product and/or if it is
intended to induce a high avidity immune response.
[0022] The term "early promoter" refers to promoters that are
active in vaccinia virus or vaccinia virus infected cells, before
viral DNA replication has occurred. Methods are known to the person
skilled in the art how it can be checked whether a promoter is an
early promoter. In particular, the promoter of interest can be
inserted upstream of a reporter gene. The construct comprising the
promoter and the reporter gene are introduced into cells that are
infected with a vaccinia virus. In order to assess for the activity
as early promoter the cells are incubated with a substance that
inhibits the DNA replication such as AraC. DNA replication is a
prerequisite for the late promoter activity. Thus, any promoter
activity that is measured in this assay system is due to elements
active as early promoter. Consequently, the term "late promoter"
refers to any promoters that are active after DNA replication has
taken place. The late activity can also be measured by methods
known to the person skilled in the art. For the sake of simplicity
the term "late promoter" as used in the present application refers
to the activity of a promoter that is determined if no substance is
added that blocks DNA replication.
[0023] According to a further embodiment the present invention
refers to an expression cassette comprising the promoter according
to the present invention and a coding sequence, wherein the
expression of the coding sequence is controlled by said promoter.
The expression cassette is preferably not an expression cassette
that occurs naturally in the genome of a vaccinia virus. Thus, if
the promoter according to the present invention is a promoter that
naturally occurs in the genome of the vaccinia virus the sequence
to which the promoter is linked is preferably different from the
sequence to which the promoter is naturally linked in the vaccinia
virus genome. In other words, if the promoter according to the
present invention is identical to a naturally occurring promoter
the coding sequence the expression of which is controlled by the
promoter and/or the sequences located between the promoter and the
coding sequence are different from the corresponding sequences to
which said promoter is naturally linked. The term "different" in
this context refers to sequences that show at least one nucleotide
difference in said sequence. Preferably it is the coding sequence
which has at least one nucleotide difference. According to other
alternatives the homology between the coding sequence in the
expression cassette and the sequence to which the promoter is
naturally linked is less than 90%, less than 80%, less than 70%,
less than 60%, less than 50%, less than 40% or even less than 20%.
Most preferably the coding sequence that is controlled by the
promoter according to the present invention codes for a
peptide/protein having a difference of at least one amino acid
compared to the naturally occurring protein encoded by said coding
sequence. By way of example the expression cassette is not the
expression cassette comprising the naturally occurring vaccinia
virus C7L promoter directing the expression of the naturally
occurring C7L gene, e.g. the expression cassette is not the
expression cassette disclosed in WO2004/015118 comprising the C7L
promoter and the C7L coding sequence.
[0024] On the other hand, if the sequence which should be expressed
is a naturally occurring vaccinia virus sequence the promoter that
is used to express said sequence is different from the promoter
that is directs the expression of the coding sequence in the
natural context. According to this alternative the nucleotide
sequence of the promoter differs in at least one nucleotide from
the sequence of the naturally occurring vacciniavirus promoter.
According to other alternatives the homology between the promoter
according to the present invention that controls the expression of
the vaccinia virus sequence and the naturally occurring promoter
linked to the vaccinia virus sequence is less than 90%, less than
80%, less than 70%, less than 60%, less than 50% or even less than
40%.
[0025] Preferably the coding sequence may code for at least one
antigenic epitope or antigen, therapeutic peptides or proteins,
antisense RNA or ribozymes. If the coding sequence encodes an
antigenic epitope or antigen the expression cassette may be used to
express said antigen after introduction of said expression cassette
in cells in an organism, e.g. a mammalian animal including a human.
The presentation of said antigen/epitope may elicit an immune
response in the organism that may lead to a vaccination of the
organism against the agent from which the antigen/epitope is
derived. More specifically the epitope/antigen may be part of a
larger amino acid sequence such as a polyepitope, peptide or
protein. Preferably the coding sequence codes for at least one
antigenic epitope or antigen, therapeutic peptides or proteins,
antisense RNA or ribozymes which are not encoded by a vaccinia
virus genome.
[0026] Examples for such polyepitopes, peptides or proteins may be
polyepitopes, peptides or proteins derived from (i) viruses, in
particular viruses other than vaccinia viruses, such as HIV, HTLV,
Herpesvirus, Denguevirus, Poliovirus, measles virus, mumps virus,
rubella virus, Hepatitis viruses and so on, (ii) bacteria, (iii)
fungi, (iv) tumor related polypeptides/proteins such as tumor
related antigens.
[0027] Alternatively the coding sequence may encode a therapeutic
compound such as interleukins, interferons, ribozymes or
enzymes.
[0028] In more general terms the invention concerns any nucleic
acid sequence comprising the promoter according to the present
invention and/or the expression cassette according to the present
invention. The nucleic acid may be RNA, e.g. if the promoter is
part of a retroviral genome. More preferably the nucleic acid is
DNA. The DNA may be any type of DNA such as linear, circular,
single stranded or double stranded DNA.
[0029] According to a further embodiment the promoter and/or
expression cassette according to the present invention may be part
of a vector. The term "vector" refers to any vectors known to the
person skilled in the art. A vector can be a plasmid vector such as
pBR322 or a vector of the pUC series. More preferably the vector is
a virus vector. In the context of the present invention the term
"viral vector" or "virus vector" refers to an infectious virus
comprising a viral genome. In this case the DNA of the present
invention is part of the viral genome of the respective viral
vector. The recombinant viral genome is packaged and the obtained
recombinant vectors can be used for the infection of cells and cell
lines, in particular for the infection of living animals including
humans. Typical virus vectors that may be used according to the
present invention are adenoviral vectors, retroviral vectors or
vectors on the basis of the adeno associated virus 2 (AAV2). Most
preferred are poxyiral vectors. The poxvirus may be preferably a
canarypox virus, a fowlpoxvirus or a vaccinia virus.
[0030] More preferred is modified vaccinia virus Ankara (MVA)
(Sutter, G. et al. [1994], Vaccine 12: 1032-40; Antoine, G. et al.
[1998], Virology 244: 365-396). The term "MVA" as used in the
present application refers to any MVA strain known in the prior
art. An example for an MVA strain is deposit VR-1508, deposited at
the American Type Culture collection (ATCC), Manassas, Va. 20108,
USA. Further examples for MVA virus strains used according to the
present invention are strains MVA 572 and 575 deposited at the
European Collection of Animal Cell Cultures (ECACC), Salisbury (UK)
with the deposition number ECACC V94012707 and ECACC V00120707,
respectively, MVA-BN with the deposition number ECACC
V00083008.
[0031] The most preferred MVA-strain is MVA-BN or a derivative
thereof. The features of MVA-BN, the description of biological
assays allowing to evaluate whether a MVA strain is MVA-BN or a
derivative thereof and methods allowing to obtain MVA-BN or a
derivative thereof are disclosed in WO 02/42480. The content of
this application is included in the present application by
reference. In particular, reference is made to the definition of
the properties of vaccinia virus according to the invention as
described in WO 02/42480, such as the properties of MVA and the
properties and definitions of the derivates of MVA-BN. Said
reference also discloses how MVA and other vaccinia viruses can be
propagated. Briefly, eukaryotic cells are infected with the virus.
The eukaryotic cells are cells that are susceptible to infection
with the respective poxvirus and allow replication and production
of infectious virus. For MVA an example for this type of cells are
chicken embryo fibroblasts (CEF) and BHK cells (Drexler I., Heller
K., Wahren B., Erfle V. and Sutter G. "Highly attenuated modified
vaccinia Ankara replicates in baby hamster kidney cells, a
potential host for virus propagation, but not in various human
transformed and primary cells" J. Gen. Virol. (1998), 79, 347-352).
CEF cells can be cultivated under conditions known to the person
skilled in the art. Preferably the CEF cells are cultivated in
serum-free medium in stationary flasks or roller bottles. The
incubation preferably takes place 48 to 96 hours at 37.degree.
C..+-.2.degree. C. For the infection MVA is preferably used at a
multiplicity of infection (MOI) of 0.05 to 1 TCID.sub.50 and the
incubation preferably takes place 48 to 72 hours at 37.degree.
C..+-.2.degree. C.
[0032] Methods are known to the person skilled in the art how the
expression cassette or the promoter according to the present
invention can be inserted into a viral genome, in particular into
the genome of a vaccinia virus, most preferably into the genome of
MVA. By way of example, the expression cassette or the promoter or
derivative thereof according to the present invention may be
inserted into the genome of MVA by homologous recombination. To
this end a nucleic acid is transfected into a permissive cell line
such as CEF or BHK cells, wherein the nucleic acid comprises the
expression cassette or the promoter or derivative thereof according
to the present invention flanked by nucleotide stretches that are
homologous to the region of the MVA genome in which the expression
cassette or the promoter or derivative thereof according to the
present invention is to be inserted. The cells are infected by MVA
and in the infected cells homologous recombination occurs between
the nucleic acid and the viral genome. Alternatively it is also
possible to first infect the cells with MVA and then to transfect
the nucleic acid into the infected cells. Again recombination
occurs in the cells. The recombinant MVA is then selected by
methods known in the prior art. The construction of recombinant MVA
is not restricted to this particular method. Instead, any suitable
method known to the person skilled in the art may be used to this
end.
[0033] The expression cassette or the promoter according to the
present invention may be introduced into any suitable part of the
vector, in particular into a viral, genome. In case of vaccinia
viruses the insertion may be made into non-essential parts of the
viral genome or into an intergenic region of the viral genome. The
term "intergenic region" refers preferably to those parts of the
viral genome located between two adjacent genes that do not
comprise coding sequences. If the vector is MVA the insertion may
also be made into a naturally occurring deletion site of the viral
genome. The term "naturally occurring deletion site" refers to
those parts of the viral genome that are deleted with respect to
the genome of the vaccinia virus Copenhagen strain. However, the
insertion sites are not restricted to these preferred insertion
sites in the vaccinia virus genome and the MVA genome, since it is
within the scope of the present invention that the expression
cassette may be inserted anywhere in the viral genome as long as it
is possible to obtain recombinants that can be amplified and
propagated in at least one cell culture system, such as Chicken
Embryo Fibroblasts (CEF cells).
[0034] The promoter according to the present invention may be used
to express a gene that is already part of the vector, e.g. the
genome of MVA. Such a gene may be a gene that is naturally part of
the viral genome or a foreign gene that has already been inserted
into the vector. In these cases the promoter according to the
present invention is inserted upstream of the gene in the vector,
the expression of which is to be controlled by the promoter. A MVA
vector comprising an expression cassette according to the present
invention can also be made by replacing anyone of the open reading
frames A42R, J6R, F6R, I2R, C7L and B9R by a coding sequence the
expression of which is to be controlled by the promoter naturally
controlling the expression of anyone of said open reading frames.
Thus, by way of example the A42R coding sequence or parts thereof
may be replaced by the coding sequence, which is to be expressed.
In the resulting construct said coding sequence is controlled by a
promoter according to the present invention, namely by the promoter
sequence according to SEQ ID NO: 1 and SEQ ID NO: 7. These
expression cassettes are also within the scope of the present
invention.
[0035] According to a further embodiment the invention concerns the
vector according to the present invention as vaccine or medicament.
In more general term the invention relates to a vaccine or
pharmaceutical composition comprising an expression cassette, a DNA
or a vector according to the present invention. Methods are known
to the person skilled in the art how the vaccine or pharmaceutical
composition can be administered to the animal or human body. In
case of DNA and plasmid vectors the DNA and the vector can simply
be administered by injection. If the vector is a viral vector such
as a vaccinia virus vector, in particular a MVA vector it may also
be administered to the animal or human body according to the
knowledge of the person skilled in the art, e.g. by intra venous,
intra muscular, intra nasal, intra dermal or subcutaneous
administration. Further details on the amount of virus administered
are given below.
[0036] The pharmaceutical composition or the vaccine may generally
include one or more pharmaceutical acceptable and/or approved
carriers, additives, antibiotics, preservatives, adjuvants,
diluents and/or stabilizers in addition to the promoter, expression
cassette or vector according to the present invention. Such
auxiliary substances can be water, saline, glycerol, ethanol,
wetting or emulsifying agents, pH buffering substances, or the
like. Suitable carriers are typically large, slowly metabolized
molecules such as proteins, polysaccharides, polylactic acids,
polyglycollic acids, polymeric amino acids, amino acid copolymers,
lipid aggregates, or the like.
[0037] For the preparation of pharmaceutical compositions or
vaccines, the DNA, expression cassette or vector according to the
present invention, in particular a recombinant vaccinia virus such
as recombinant MVA is converted into a physiologically acceptable
form. For vaccinia viruses, in particular MVA this can be done
based on the experience in the preparation of poxvirus vaccines
used for vaccination against smallpox (as described by Stickl, H.
et al. [1974] Dtsch. med. Wschr. 99, 2386-2392). For example, the
purified virus is stored at -80.degree. C. with a titre of
5.times.10.sup.8 TCID.sub.50/ml formulated in about 10 mM Tris, 140
mM NaCl pH 7.4. For the preparation of vaccine shots, e.g.,
10.sup.1-10.sup.9 particles of the recombinant virus according to
the present invention are lyophilized in phosphate-buffered saline
(PBS) in the presence of 2% peptone and 1% human albumin in an
ampoule, preferably a glass ampoule. Alternatively, the vaccine
shots can be produced by stepwise freeze-drying of the virus in a
formulation. This formulation can contain additional additives such
as mannitol, dextran, sugar, glycine, lactose or
polyvinylpyrrolidone or other additives such as antioxidants or
inert gas, stabilizers or recombinant proteins (e.g. human serum
albumin) suitable for in vivo administration. A typical virus
containing formulation suitable for freeze-drying comprises 10 mM
Tris-buffer, 140 mM NaCl, 18.9 g/l Dextran (MW 36000-40000), 45 g/l
Sucrose, 0.108 g/l L-glutamic acid mono potassium salt monohydrate
pH 7.4. The glass ampoule is then sealed and can be stored between
4.degree. C. and room temperature for several months. However, as
long as no need exists the ampoule is stored preferably at
temperatures below -20.degree. C.
[0038] For vaccination or therapy the lyophilisate or the
freeze-dried product can be dissolved in 0.1 to 0.5 ml of an
aqueous solution, preferably water, physiological saline or Tris
buffer, and administered either systemically or locally, i.e. by
parenteral, intramuscular or any other path of administration know
to the skilled practitioner. The mode of administration, the dose
and the number of administrations can be optimized by those skilled
in the art in a known manner.
[0039] Thus, according to a related embodiment the invention
relates to a method for affecting, preferably inducing an
immunological response in a living animal body including a human
comprising administering the expression cassette, the DNA, the
vector, the pharmaceutical composition or the vaccine according to
the present invention to the animal or human to be treated. If the
vaccine is a vaccinia virus, in particular MVA a typical vaccine
shot for humans comprises at least 10.sup.2, preferably at least
10.sup.4, more preferably at least 10.sup.6, even more preferably
10.sup.7 or 10.sup.8 TCID.sub.50 (tissue culture infectious dose)
of the virus.
[0040] If the vaccine is a recombinant MVA, in particular
recombinant MVA-BN and its derivatives that the virus may be used
for prime-boost administration. Thus, the invention further relates
to a method, wherein the vector is MVA, in particular MVA-BN and
its derivatives, and wherein said vector or the composition or the
vaccine comprising said vector is administered to an animal,
including a human in need thereof, in therapeutically effective
amounts in a first inoculation ("priming inoculation") and in a
second inoculation ("boosting inoculation").
[0041] The invention further concerns a method for introducing a
coding sequence into a target cell comprising the introduction of
the vector, the expression cassette or of the DNA according to the
present invention into the target cell. If the vector is a vaccinia
virus, in particular MVA such as MVA-BN the target cell may be a
cell in which the virus is able to replicate such as CEF or BHK
cells or a cell that can be infected by MVA, but in which the virus
does not replicate (such as all types of human cells for
MVA-BN).
[0042] The invention further relates to a method for producing a
peptide, protein and/or virus comprising the infection of a host
cell with a virus vector according to the present invention,
followed by the cultivation of the infected host cell under
suitable conditions, and further followed by the isolation and/or
enrichment of the peptide and/or protein and/or viruses produced by
said host cell. If it is intended to produce, i.e. amplify the
virus according to the present invention the cell has to be a cell
in which the virus is able to replicate. For vaccinia viruses, in
particular MVA suitable cells are CEF or BHK cells. If it is
intended to produce a peptide/protein encoded by the virus vector
according to the present invention the cell may be any cell that
can be infected by the virus vector and that allows the expression
of the virus encoded proteins/peptides.
[0043] The invention further relates to a method for producing a
peptide, protein and/or virus comprising the transfection of a cell
with the expression cassette, the DNA or the plasmid vector
according to the present invention, followed by the infection of
the cell with a vaccinia virus. The infected host cell is
cultivated under suitable conditions. A further step comprises the
isolation and/or enrichment of the peptide and/or protein and/or
viruses produced by said host cell. The step of infecting the cells
with a vaccinia virus may be made before or after the step of
transfection of the cells.
[0044] The invention further relates to cells comprising a
promoter, DNA, expression cassette or vector according to the
present invention. In particular the invention relates to cells
infected with the virus vector according to the present
invention.
SHORT DESCRIPTION OF THE FIGURES
[0045] FIG. 1: GUS Activity after Expression by Different
Promoters
[0046] Cells were infected with MVA-BN and transfected with the
appropriate plasmids. After 48 hours the cells were extracted and
the GUS activity was determined indirectly by measuring the
extinction at 415 nm after an enzymatic reaction, which causes the
development of yellow colour. Zex=negative control (MVA-BN infected
cells).
[0047] FIG. 2: GUS Activity after Early and Early/Late
Expression
[0048] Cells were infected with MVA-BN and transfected with the
appropriate plasmids. After 24 hours cells were extracted and the
GUS activity was determined indirectly by measuring the extinction
at 415 nm after an enzymatic reaction, which causes the development
of yellow colour. Zex=negative control (MVA-BN infected cells). For
that enzymatic reaction, samples without AraC (early+late)
expression had to be incubated for 5 hours, the one with AraC
(early expression) had to be incubated over night in order to
obtain a color reaction.
[0049] FIG. 3: GUS Activity after Expression by Different
Promoters
[0050] Cells were infected with MVA-BN and transfected with the
appropriate plasmids. After 24 hours the cells were extracted and
the GUS activity was determined indirectly by measuring the
extinction at 415 nm after an enzymatic reaction, which causes the
development of yellow colour. Control=negative control (MVA-BN
infected cells).
EXAMPLES
[0051] The following example(s) will further illustrate the present
invention. It will be well understood by a person skilled in the
art that the provided example(s) in no way may be interpreted in a
way that limits the applicability of the technology provided by the
present invention to this example(s).
Example 1
Analysis of Promoters to Express Coding Sequences in the MVA-BN
Genome
1.1 Aim of the Experiment
[0052] It was the aim of this analysis to identify promoters that
are suitable to express coding sequences in the MVA genome,
preferably coding sequences that are heterologous to the natural
MVA genome. Especially for the insertion of two or more genes in a
single insertion site it is advantageous to use different promoters
for expression of the single genes in order to reduce the risk of
recombination events, which could result in deletion of one of the
foreign genes. Furthermore it is desirable to have promoters of
different strength in order to have the possibility to express the
foreign genes inserted in recombinant MVA-BN in variable amounts,
depending on the strength of the promotor. 11 putative promoters
were isolated in total. These putative promoter sequences were
cloned in a plasmid backbone (pBSKS+). In order to analyse their
potential activity, the promoters were fused to the GUS (E. coli
.beta.-Glucuronidase) reporter gene. BHK (baby hamster kidney)
cells were infected with MVA-BN and transfected with the plasmids
containing the putative promoters fused to the GUS gene. If the
promoter was functional, GUS was expressed and could be quantified
by an enzymatic reaction of GUS. As positive control and as
reference the well-characterized Vaccinia virus promoter's p7.5 and
Ps were fused to GUS and analysed in parallel. By measurement of
the GUS expression the putative promoters were screened on
activity, strength and early/late expression. The early/late
expression was checked by adding AraC (Arabinosid Cytosine) to the
culture media. The promoters, which are shown to be functional,
namely the Ps, p7.5, 7.5L and ATI promoter which were known in the
prior art as well as the newly identified promoter sequences that
are naturally involved in the expression control of the MVA ORF's,
A42L, B9R, C7L, F6R, I2R, J6R preferably can be used for the
expression of foreign genes in recombinant MVA constructs
(recMVA-BN).
1.2 Material
[0053] Cells: BHK cells Virus: MVA-BN standard crude stock
(7.5.times.10.sup.7 TCID.sub.50) DNA: pAB-GUS (Ps promoter+GUS)
[0054] pBNX71 (pBluescript+Vaccinia virus pr7.5+GUS) [0055] pBNX73
(pBluescript+Cowpox virus ATI promoter+GUS) [0056] pBN81
(pBluescript+modified H5R promoter+GUS1) [0057] pBN61
(pBluescript+MVA B1R promoter+GUS) [0058] pBN62 (pBluescript+MVA
B2R promoter+GUS) [0059] pBN63 (pBluescript+MVA B3R promoter+GUS)
[0060] pBN60 (pBluescript+MVA A30R promoter+GUS) [0061] pBN82
(pBluescript+Vaccinia virus 7.5 L promoter+GUS) [0062] pBN83
(pBluescript+MVA C7L promoter (SEQ ID NO: 5+GUS) [0063] pBNX49
(pBluescript+MVA A42R promoter (SEQ ID NO: 1+GUS) [0064] pBNX69
(pBluescript+MVA I2R promoter (SEQ ID NO: 4)+GUS) [0065] pBNX72
(pBluescript+MVA K5L promoter+GUS) [0066] pBNX83 (pBluescript+MVA
F6R promoter (SEQ ID NO: 3)+GUS) [0067] pBNX84 (pBluescript+MVA B9R
promoter (SEQ ID NO: 6+GUS) [0068] pBNX85 (pBluescript+MVA J6R
promoter (SEQ ID NO:2)+GUS) Transfection kit: Effectene
transfection kit (Qiagen) Media and Supplements: DMEM (Gibco BRL)
with 10% FCS (Gibco BRL) Chemicals and Buffers: Lysisbuffer
(PBS+0.1% Triton+1 mM protease inhibitor) AraC (Sigma, Cat. No.
C1768) GUS substrate 1 mM (p-Nitrophenyl-beta-(D)-glucuronide;
Sigma, Cat. No. N 1627) Stop solution 2.5 M
(2-amino-2-methyl-1,3-propandiol; Sigma, Cat. No. A 9754)
1.3 Methods
Seeding of Cells
[0069] 5.times.10.sup.5 BHK cells were seeded per transfection
reaction in a well of a 6-well-plate and maintained in DMEM/10% FCS
over night at 37.degree. C. and 5% CO.sub.2.
[0070] Infection/transfection Cells were infected with MVA-BN (moi
0.1) in 0.5 ml DMEM/10% FCS per well and incubated for 1 h at room
temperature on a shaker. Transfection was performed as described in
the manufacturers protocol. 2 .mu.g plasmid were diluted in buffer
EB (100 .mu.l total volume). After addition of 3.2 .mu.l enhancer
solution the solution was mixed and incubated for 5 min. at room
temperature. Then 10 .mu.l Effectene reagent was added, suspension
was mixed and incubated for 10 min. at room temperature. The
virus-suspension was removed from the cells and 1.6 ml DMEM/10% FCS
were added. 0.6 ml DMEM/10% FCS were added to the DNA Effectene
mixture and dropped on the cells while rotating the culture plate.
Cells were then incubated 7, 24 or 48 hours dependent on the
analysis. For the analysis of early/late expression AraC was added
to the medium during infection and transfection (40 .mu.g/ml).
Harvesting of the Cells
[0071] Medium was removed from cells and 0.5 ml of Lysis buffer was
added. After shaking 15 min. at RT, cells were scraped in the Lysis
buffer, transferred to a 1.5 ml reaction tube and vortexed
vigorously. Lysed cells were centrifuged for 1 min. at 500 rcf and
4.degree. C., the clear supernatant was transferred to a fresh vial
and stored at -20.degree. C. until use.
Determination of GUS Activity
[0072] 10 .mu.l of cell extract (=protein out of 2.times.10.sup.4
cells) was added to 1 ml pre-warmed substrate solution (37.degree.
C.) and incubated at 37.degree. C. until a yellow colour was
developed. Samples were then placed on ice immediately and 0.4 ml
stop solution was added. The Extinction at 415 nm was determined
and equated with the GUS activity as extinction values between 0.05
and 2.0 are in a linear range. The substrate solution was used as
reference and a cell extract of MVA-BN infected cells was used as
negative control.
1.4 Experiments and Results
Experiment 1: Determination of Function of Putative Promoters
[0073] For the first experiment all plasmids, which contain a
putative MVA promoter or a well-characterized promoter fused to the
GUS gene, were analysed. Cells were infected with MVA-BN (moi 0.1)
and transfected with the corresponding plasmid. Cells were
harvested after 48 hours, lysed and GUS activity was determined.
This experiment was performed in order to determine, which
promoters are functional. The results are shown in FIG. 1. The
negative control (extract from MVA-BN infected cells) clearly
showed no GUS activity (Zex; extinction 0.001). The
well-characterized strong synthetic Ps promoter was shown to be
very efficient (Ps; extinction 0.87) as there was a high amount of
GUS detectable after 48 hours of expression. The also well-known
naturally occurring Vaccinia virus pr7.5 promoter did show also a
quite high activity (p7.5; extinction 0.41). Also the late portion
of pr7.5 (7.5L; extinction 0.25) shows a clearly detectable
activity. The Cowpox ATI promoter clearly showed to be very
efficient for the expression of foreign genes by MVA-BN (ATI;
extinction 0.76). For the putative promoter regions of the MVA-BN
genome, it was shown that A42R (A42; extinction 0.48), B9R (B9;
extinction 0.06), C7L (C7; extinction 0.055), F6R (F6; extinction
0.208), I2R (I2; extinction 0.130) and J6R (J6; extinction 0.290)
are functional promoters. The promoters, which clearly showed to be
active (extinction>0.05) in the first preliminary experiment,
were characterized in more detail (Experiment 2).
Experiment 2: Characterization of Expression of Promoters
[0074] The promoters, which did show activity in experiment 1 were
characterized on their pattern of expression. For that purpose, the
cells infected with MVA-BN and transfected with the corresponding
plasmid were incubated with AraC. AraC inhibits the DNA
replication, which is an essential prerequisite for the late
expression of genes during the MVA replication cycle. In parallel
the same experiment was performed without addition of AraC.
Infected and transfected cells were harvested after 24 hours and
the GUS activity was determined in triplicate. FIG. 2 shows the
average extinction of each sample.
[0075] After incubation without AraC (-AraC) for 24 hours, the
total GUS expression (early+late) is clearly detectable for all
promoters (FIG. 2: right columns). The strength of the newly
identified promoters in declining succession is: I2R (I2)>A42R
(A42)>F6R (F6)>J6R (J6)>B9R (B9)=C7L (C7).
[0076] The promoters B9, C7 and J6 were shown to be mainly involved
in the late expression during the life cycle of MVA, as incubation
with AraC (+AraC), which inhibits late expression, results in an
expression-level of GUS comparable to that of the negative control
(Zex). Although the C7L promoter appeared to be rather weak several
hints exist, that it plays an important role during early
expression.
[0077] The promoters A42R, I2R and F6R clearly show a very
efficient early expression. As for the determination of the early
expression the samples had to be incubated over night in order to
get a detectable color reaction. These results cannot be compared
to the values of the early+late expression (FIG. 2: -AraC) directly
as they only were incubated for 5 hours. The promoters, which did
show early expression were analysed again after 7 hours of
expression and the results after 24 hours could be confirmed (data
not shown).
1.5 Conclusion
[0078] It was clearly shown, that promoters of different strength
could be obtained and that there is now a spectrum of different
promoters available, which show different expression patterns
dependent on the incubation period and on the possibility of MVA-BN
to replicate. If early+late expression is preferred, promoters
A42R, I2R and F6R are preferably used. If the early expression
should be avoided (e.g. for foreign genes, which contain the stop
signal TTTTTNT for early expression), the promoters B9R, J6R or C7L
are preferably used.
Example 2
Analysis of Minimal Promoter Elements Derived from Seq Id NO: 1 to
4
[0079] In example 1 several sequences have been identified that are
particularly suitable to express foreign genes in the MVA genome.
In order to check whether shorter fragments fulfill the same
purpose additional experiments were carried out. Shorter fragments
of SEQ ID NO 1 to 4 were isolated by PCR and cloned in a plasmid
backbone (pBSKS+). In total 6 putative minimal promoters were
tested. In order to analyse their potential activity, the promoters
were fused to the GUS reporter gene. BHK cells were infected with
MVA-BN and transfected with the plasmids containing the putative
minimal promoters fused to the GUS gene. By measurement of the GUS
expression the putative promoters were screened on activity and
strength of expression (see example 1). As positive control and as
reference the well-characterized Vaccinia virus late promoter Ps
was fused to GUS and analysed in parallel. The minimal promoter
elements of about 30 bp can be used for the expression of foreign
genes in recombinant MVA constructs (recMVA-BN) without the risk of
homologous recombination between the homolgous sequences of the
original and the additionally cloned promoter.
2.1 Material and Method
[0080] If not indicated otherwise the materials and methods used in
example 2 correspond to the methods in example 1. PCR was made
according to standard techniques.
2.2 Experiments and Results
Fusion of Promoters to GUS Gene by PCR
[0081] The PCR reactions resulted in the fusion of the following
minimal promoter sequences to the GUS gene:
TABLE-US-00002 SEQ ID NO: 7 ("A42 short late")
TCTTATTAAAAAACATATATAATAAATAACA SEQ ID NO: 8 ("J6R short late")
GATAAAAATTTAAAGTGTAAATATAACTAT SEQ ID NO: 9 ("F6R short early)
AGAGTGTAGTATCATAGATAACTCTCTTCTATAAAAT SEQ ID NO: 10 ("F6R short
late") ATTGTTAAATAAATAATGGATAGTATAAAT SEQ ID NO: 11 ("I2R short
early") AGTAAAAAATATGTTAGGTTTACAAAA SEQ ID NO: 12 ("I2R short
late") ATTTATTTTCAGTTTTATTATACGCATAAAT
[0082] All putative minimal promoters fused to the GUS gene were
cloned in pBSKS+ and sequenced.
Determination of Function of the Putative Minimal Promoters
[0083] In order to analyse functionality of the putative minimal
promoter elements the BHK cells were infected with MVA-BN (moi 1.0)
and transfected with the corresponding plasmid. Cells were
harvested after 24 hours, lysed and GUS activity was determined
(FIG. 3).
[0084] The negative control (extract from MVA-BN infected cells)
clearly showed no GUS activity (control; average extinction
0.00167). The well-characterized strong synthetic Ps promoter was
shown to be very efficient (Ps; average extinction 2.05267) as
there was a high amount of GUS detectable after 24 hours of
expression. For the putative promoter minimal promoter elements of
the MVA-BN genome, it was shown that all of F6R short early, F6R
short late, I2R short early, I2R short late, A42R short late and
J6R short late are functional promoters.
[0085] In total six functional minimal promoter elements were
isolated. Two are suitable for the weaker early transcription (I2R
short early: average extinction 0.06933; F6R short early: average
extinction 0.189) and four are suitable for late expression of
different levels (F6R short late: average extinction: 0.09833; I2R
short late: average extinction 0.391; J6R short late: average
extinction: 0.80167 and A42R short late: average extinction
2.07).
2.3 Conclusion
[0086] It was clearly shown, that promoters of different strength
could be isolated and that there is now a spectrum of different
promoters available. If early expression is preferred, the minimal
promoter F6R short early or I2R short early are preferably used. If
the late expression is preferred and early expression should be
avoided (e.g. for foreign genes, which contain the stop signal
TTTTTNT for early expression), the minimal promoter elements F6R
short late, I2R short late, J6R short late and A42R short late are
preferably used.
Sequence CWU 1
1
121171DNAModified Vaccinia Virus Ankara 1tctgcaatat tgttatcgta
attggaaaaa tagtgttcga gtgagttgga ttatgtgagt 60attggattgt atattttatt
ttatatttta tattttgtag taagaataga atgctaatgt 120caagtttatt
ccaatagatg tcttattaaa aaacatatat aataaataac a 1712105DNAModified
Vaccinia Virus Ankara 2gataaaaatt taaagtgtaa atataactat tattttatag
ttgtaataaa aagggaaatt 60tgattgtata ctttcggttc tttaaaagaa actgacttga
taaaa 1053136DNAModified Vaccinia Virus Ankara 3gcatttcatc
tttctccaat actaattcaa attgttaaat aaataatgga tagtataaat 60agttattagt
gataaaatag taaaaataat tattagaata agagtgtagt atcatagata
120actctcttct ataaaa 136498DNAModified Vaccinia Virus Ankara
4gatctataaa ggtagaccta atcgtctcgg atgaccatat atttattttc agttttatta
60tacgcataaa tagtaaaaaa tatgttaggt ttacaaaa 985160DNAModified
Vaccinia Virus Ankara 5ggtaaacttt aagacatgtg tgttatacta agatggttgg
cttattccat agtagcttgt 60ggaatttata aacttatgat agtaaaacta gtacccaata
tgtaaagatg aaaaagtaaa 120ttactattaa cgccgtcggt attcgttcat
ccattcagtt 1606156DNAModified Vaccinia Virus Ankara 6atttctcggt
agcacatcaa atgatgttac cacttttctt agcatgctta acttgactaa 60atattcataa
ctaattttta ttaatgatac aaaaacgaaa taaaactgca tattatacac
120tggttaacgc ccttataggc tctaaccatt ttcaag 156731DNAModified
Vaccinia Virus Ankara 7tcttattaaa aaacatatat aataaataac a
31830DNAModified Vaccinia Virus Ankara 8gataaaaatt taaagtgtaa
atataactat 30937DNAModified Vaccinia Virus Ankara 9agagtgtagt
atcatagata actctcttct ataaaat 371030DNAModified Vaccinia Virus
Ankara 10attgttaaat aaataatgga tagtataaat 301127DNAModified
Vaccinia Virus Ankara 11agtaaaaaat atgttaggtt tacaaaa
271231DNAModified Vaccinia Virus Ankara 12atttattttc agttttatta
tacgcataaa t 31
* * * * *