U.S. patent application number 12/827711 was filed with the patent office on 2011-01-06 for pesticidal proteins.
This patent application is currently assigned to Mycogen Corporation. Invention is credited to Guy A. Cardineau, Paula Diehl, Joanna Dojillo, Rod Herman, Mark Knuth, Stacey Finstad Lee, Tracy Ellis Michaels, Kenneth E. Narva, Michael R. Pollard, H. Ernest Schnepf, George E. Schwab, Lisa Stamp.
Application Number | 20110003736 12/827711 |
Document ID | / |
Family ID | 43706145 |
Filed Date | 2011-01-06 |
United States Patent
Application |
20110003736 |
Kind Code |
A1 |
Narva; Kenneth E. ; et
al. |
January 6, 2011 |
PESTICIDAL PROTEINS
Abstract
The subject invention concerns new classes of pesticidally
active proteins and the polynucleotide sequences that encode these
proteins. In preferred embodiments, these pesticidal proteins have
molecular weights of approximately 40-50 kDa and of approximately
10-15 kDa.
Inventors: |
Narva; Kenneth E.;
(Zionsville, IN) ; Schnepf; H. Ernest; (San Diego,
CA) ; Knuth; Mark; (Poway, CA) ; Pollard;
Michael R.; (Okemos, MI) ; Cardineau; Guy A.;
(Poway, CA) ; Schwab; George E.; (Encinitas,
CA) ; Michaels; Tracy Ellis; (Escondido, CA) ;
Lee; Stacey Finstad; (San Diego, CA) ; Diehl;
Paula; (Ramona, CA) ; Dojillo; Joanna; (San
Diego, CA) ; Stamp; Lisa; (La Jolla, CA) ;
Herman; Rod; (New Ross, IN) |
Correspondence
Address: |
Baker & Daniels LLP- Dow AgroSciences
300 North Meridian Street, Suite 2700
Indianapolis
IN
46204
US
|
Assignee: |
Mycogen Corporation
Indianapolis
IN
|
Family ID: |
43706145 |
Appl. No.: |
12/827711 |
Filed: |
June 30, 2010 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11824605 |
Jun 29, 2007 |
7790961 |
|
|
12827711 |
|
|
|
|
10741387 |
Dec 19, 2003 |
7247613 |
|
|
11824605 |
|
|
|
|
09643596 |
Aug 22, 2000 |
6677148 |
|
|
10741387 |
|
|
|
|
09378088 |
Aug 20, 1999 |
6372480 |
|
|
09643596 |
|
|
|
|
08844188 |
Apr 18, 1997 |
6127180 |
|
|
09378088 |
|
|
|
|
08633993 |
Apr 19, 1996 |
6083499 |
|
|
08844188 |
|
|
|
|
Current U.S.
Class: |
514/4.5 ;
530/350 |
Current CPC
Class: |
C12N 15/8286 20130101;
A01N 63/10 20200101; Y02A 40/162 20180101; C07K 2319/00 20130101;
C07K 14/325 20130101; Y02A 40/146 20180101; C07K 14/32 20130101;
A01N 37/46 20130101; A01N 63/10 20200101; A01N 63/10 20200101; A01N
63/10 20200101; A01N 2300/00 20130101; A01N 63/10 20200101; A01N
63/10 20200101; A01N 63/10 20200101; A01N 2300/00 20130101 |
Class at
Publication: |
514/4.5 ;
530/350 |
International
Class: |
A01N 37/18 20060101
A01N037/18; C07K 14/00 20060101 C07K014/00; A01P 7/04 20060101
A01P007/04 |
Claims
1. An isolated protein that has toxin activity against a corn
rootworm, wherein a polynucleotide that codes for said protein
hybridizes under stringent conditions with the full complement of a
nucleotide sequence selected from the group consisting of SEQ ID
NO: 37, SEQ ID NO:42, and SEQ ID NO:45.
2. The protein of claim 1 wherein said protein has a molecular
weight of between about 40 kDa and about 50 kDa.
3. The protein of claim 1 wherein said stringent conditions
comprise a wash in 1.times.SSPE and 0.1% SDS at room
temperature.
4. The protein of claim 1 wherein said stringent conditions
comprise a wash in 0.2.times.SSPE and 0.1% SDS at room
temperature.
5. A method of inhibiting a corn rootworm wherein said method
comprises providing said rootworm with a pesticidally active amount
of a first protein and a second protein for ingestion, wherein a
first polynucleotide that codes for said first protein hybridizes
under stringent conditions with the full complement of a nucleotide
sequence selected from the group consisting of SEQ ID NO:35, SEQ ID
NO:40, and SEQ ID NO:44, and wherein a second polynucleotide that
codes for said second protein hybridizes under stringent conditions
with the full complement of a nucleotide sequence selected from the
group consisting of SEQ ID NO:37, SEQ ID NO:42, and SEQ ID
NO:45.
6. The method of claim 5 wherein said first protein and said second
protein are provided to said rootworm by being present in a plant
that produced said first protein and said second protein.
7. The method of claim 6 wherein said protein is produced by roots
of said plant.
8. The method of claim 5 wherein said first protein has a molecular
weight of between about 10 kDa and about 15 kDa, and said second
protein has a molecular weight of between about 40 kDa and about 50
kDa.
9. The method of claim 5 wherein said first protein and said second
protein are fused together.
10. The method of claim 5 wherein said stringent conditions
comprise a wash in 1.times.SSPE and 0.1% SDS at room
temperature.
11. The method of claim 5 wherein said stringent conditions
comprise a wash in 0.2.times.SSPE and 0.1% SDS at room
temperature.
12. A method of inhibiting a corn rootworm wherein said method
comprises providing said rootworm with a pesticidally active amount
of the protein of claim 1.
13. The method of claim 12 wherein said protein is provided to said
rootworm by being present in a plant that produced said
protein.
14. The method of claim 13 wherein said protein is produced by
roots of said plant.
Description
CROSS-REFERENCE TO A RELATED APPLICATION
[0001] This application is a divisional of U.S. Ser. No.
11/824,605, filed Jun. 29, 2007, which is a divisional of U.S. Ser.
No. 10/741,387, filed Dec. 19, 2003, now U.S. Pat. No. 7,247,613,
which is a continuation-in-part of U.S. Ser. No. 09/643,596, filed
Aug. 22, 2000, now U.S. Pat. No. 6,677,148, which is a
continuation-in-part of U.S. Ser. No. 09/378,088, filed Aug. 20,
1999, now U.S. Pat. No. 6,372,480, which is a continuation-in-part
of Ser. No. 08/844,188, filed Apr. 18, 1997, now U.S. Pat. No.
6,127,180, which is a continuation-in-part of Ser. No. 08/633,993,
filed Apr. 19, 1996, which issued as U.S. Pat. No. 6,083,499 on
Jul. 4, 2000.
BACKGROUND OF THE INVENTION
[0002] Coleopterans are a significant group of agricultural pests
which cause extensive damage to crops each year. Examples of
coleopteran pests include corn rootworm and alfalfa weevils.
[0003] The alfalfa weevil, Hypera postica, and the closely related
Egyptian alfalfa weevil, Hypera brunneipennis, are the most
important insect pests of alfalfa grown in the United States, with
2.9 million acres infested in 1984. An annual sum of 20 million
dollars is spent to control these pests. The Egyptian alfalfa
weevil is the predominant species in the southwestern U.S., where
it undergoes aestivation (i.e., hibernation) during the hot summer
months. In all other respects, it is identical to the alfalfa
weevil, which predominates throughout the rest of the U.S.
[0004] The larval stage is the most damaging in the weevil life
cycle. By feeding at the alfalfa plant's growing tips, the larvae
cause skeletonization of leaves, stunting, reduced plant growth,
and, ultimately, reductions in yield. Severe infestations can ruin
an entire cutting of hay. The adults, also foliar feeders, cause
additional, but less significant, damage.
[0005] Approximately 10 million acres of U.S. corn are infested
with corn rootworm species complex each year. The corn rootworm
species complex includes the northern corn rootworm, Diabrotica
barberi, the southern corn rootworm, D. undecimpunctata howardi,
and the western corn rootworm, D. virgifera virgifera. The
soil-dwelling larvae of these Diabrotica species feed on the root
of the corn plant, causing lodging. Lodging eventually reduces corn
yield and often results in death of the plant. By feeding on
cornsilks, the adult beetles reduce pollination and, therefore,
detrimentally affect the yield of corn per plant. In addition,
adults and larvae of the genus Diabrotica attack cucurbit crops
(cucumbers, melons, squash, etc.) and many vegetable and field
crops in commercial production as well as those being grown in home
gardens.
[0006] Control of corn rootworm has been partially addressed by
cultivation methods, such as crop rotation and the application of
high nitrogen levels to stimulate the growth of an adventitious
root system. However, chemical insecticides are relied upon most
heavily to guarantee the desired level of control. Insecticides are
either banded onto or incorporated into the soil. Problems
associated with the use of some chemical insecticides are
environmental contamination and the development of resistance among
the treated insect populations.
[0007] The soil microbe Bacillus thuringiensis (B.t.) is a
Gram-positive, spore-forming bacterium characterized by parasporal
protein inclusions, which can appear microscopically as
distinctively shaped crystals. Certain strains of B.t. produce
proteins that are toxic to specific orders of pests. Certain B.t.
toxin genes have been isolated and sequenced, and recombinant
DNA-based B.t. products have been produced and approved for use. In
addition, with the use of genetic engineering techniques, new
approaches for delivering these B.t. endotoxins to agricultural
environments are under development, including the use of plants
genetically engineered with endotoxin genes for insect resistance
and the use of stabilized intact microbial cells as B.t. endotoxin
delivery vehicles (Gaertner, F. H., L. Kim [1988] TIBTECH 6:S4-S7).
Thus, isolated B.t. endotoxin genes are becoming commercially
valuable.
[0008] Commercial use of B.t. pesticides was originally limited to
a narrow range of lepidopteran (caterpillar) pests. Preparations of
the spores and crystals of B. thuringiensis subsp. kurstaki have
been used for many years as commercial insecticides for
lepidopteran pests. For example, B. thuringiensis var. kurstaki
HD-1 produces a crystalline .delta.-endotoxin which is toxic to the
larvae of a number of lepidopteran insects.
[0009] In recent years, however, investigators have discovered B.t.
pesticides with specificities for a much broader range of pests.
For example, other species of B.t., namely israelensis and
tenebrionis (a.k.a. B.t. M-7, a.k.a. B.t. san diego), have been
used commercially to control insects of the orders Diptera and
Coleoptera, respectively (Gaertner, F. H. [1989] "Cellular Delivery
Systems for Insecticidal Proteins: Living and Non-Living
Microorganisms," in Controlled Delivery of Crop Protection Agents,
R. M. Wilkins, ed., Taylor and Francis, New York and London, 1990,
pp. 245-255). See also Couch, T. L. (1980) "Mosquito Pathogenicity
of Bacillus thuringiensis var. israelensis," Developments in
Industrial Microbiology 22:61-76; Beegle, C. C., (1978) "Use of
Entomogenous Bacteria in Agroecosystems," Developments in
Industrial Microbiology 20:97-104. Krieg, A., A. M. Huger, G. A.
Langenbruch, W. Schnetter (1983) Z. ang. Ent. 96:500-508, describe
Bacillus thuringiensis var. tenebrionis, which is reportedly active
against two beetles in the order Coleoptera. These are the Colorado
potato beetle, Leptinotarsa decemlineata, and Agelastica alni.
[0010] Recently, new subspecies of B.t. have been identified, and
genes responsible for active .delta.-endotoxinproteins have been
isolated (Hofte, H., H. R. Whiteley [1989] Microbiological Reviews
52(2):242-255). Hofte and Whiteley classified B.t. crystal protein
genes into four major classes. The classes were CryI
(Lepidoptera-specific), CryII (Lepidoptera- and Diptera-specific),
CryIII (Coleoptera-specific), and CryIV (Diptera-specific). The
discovery of strains specifically toxic to other pests has been
reported. (Feitelson, J. S., J. Payne, L. Kim [1992] Bio/Technology
10:271-275).
[0011] The 1989 nomenclature and classification scheme of Hofte and
Whiteley for crystal proteins was based on both the deduced amino
acid sequence and the host range of the toxin. That system was
adapted to cover fourteen different types of toxin genes which were
divided into five major classes. As more toxin genes were
discovered, that system started to become unworkable, as genes with
similar sequences were found to have significantly different
insecticidal specificities. A revised nomenclature scheme has been
proposed which is based solely on amino acid identity (Crickmore et
al. [1996] Society for Invertebrate Pathology, 29th Annual Meeting,
3rd International Colloquium on Bacillus thuringiensis, University
of Cordoba, Cordoba, Spain, September 1-6, abstract). The mnemonic
"cry" has been retained for all of the toxin genes except cytA and
cytB, which remain a separate class. Roman numerals have been
exchanged for Arabic numerals in the primary rank, and the
parentheses in the tertiary rank have been removed. Current
boundaries represent approximately 95% (tertiary rank), 75%
(secondary rank), and 48% (primary rank) sequence identity. Many of
the original names have been retained, with the noted exceptions,
although a number have been reclassified. See also N. Crickmore, D.
R. Zeigler, J. Feitelson, E. Schnepf, J. Van Rie, D. Lereclus, J.
Baum, and D. H. Dean (1998), "Revisions of the Nomenclature for the
Bacillus thuringiensis Pesticidal Crystal Proteins," Microbiology
and Molecular Biology Reviews Vol. 62:807-813; and Crickmore,
Zeigler, Feitelson, Schnepf, Van Rie, Lereclus, Baum, and Dean,
"Bacillus thuringiensis toxin nomenclature" (1999)
http://www.biols.susx.ac.uk/Home/Neil_Crickmore/Bt/index.html. That
system uses the freely available software applications CLUSTAL W
and PHYLIP. The NEIGHBOR application within the PHYLIP package uses
an arithmetic averages (UPGMA) algorithm.
[0012] The cloning and expression of a B.t. crystal protein gene in
Escherichia coli has been described in the published literature
(Schnepf, H. E., H. R. Whiteley [1981] Proc. Natl. Acad. Sci. USA
78:2893-2897). U.S. Pat. No. 4,448,885 and U.S. Pat. No. 4,467,036
both disclose the expression of B.t. crystal protein in E.
coli.
[0013] U.S. Pat. Nos. 4,797,276 and 4,853,331 disclose B.
thuringiensis strain tenebrionis (a.k.a. M-7, a.k.a. B.t. san
diego), which can be used to control coleopteran pests in various
environments. U.S. Pat. No. 4,918,006 discloses B.t. toxins having
activity against Dipterans. U.S. Pat. No. 4,849,217 discloses B.t.
isolates which have activity against the alfalfa weevil. U.S. Pat.
No. 5,208,077 discloses coleopteran-active Bacillus thuringiensis
isolates. U.S. Pat. No. 5,632,987 discloses a 130 kDa toxin from
PS80B1 as having activity against corn rootworm. WO 94/40162, which
is related to the subject application, describes new classes of
proteins that are toxic to corn rootworm. U.S. Pat. No. 5,151,363
and U.S. Pat. No. 4,948,734 disclose certain isolates of B.t. which
have activity against nematodes.
[0014] U.S. Pat. No. 6,083,499 and WO 97/40162 disclose "binary
toxins." The subject invention is distinct from mosquitocidal
toxins produced by Bacillus sphaericus. See EP 454 485; Davidson et
al. (1990), "Interaction of the Bacillus sphaericus mosquito
larvicidal proteins," Can. J. Microbiol. 36(12):870-8; Baumann et
al. (1988), "Sequence analysis of the mosquitocidal toxin genes
encoding 51.4- and 41.9-kilodalton proteins from Bacillus
sphaericus 2362 and 2297,"J. Bacteria 170:2045-2050; Oei et al.
(1992), "Binding of purified Bacillus sphaericus binary toxin and
its deletion derivatives to Culex quinquefasciatus gut: elucidation
of functional binding domains," Journal of General Microbiology
138(7):1515-26.
BRIEF SUMMARY OF THE INVENTION
[0015] The subject invention concerns novel materials and methods
for controlling non-mammalian pests. In a preferred embodiment, the
subject invention provides materials and methods for the control of
coleopteran pests. In more preferred embodiments, the materials and
methods described herein are used to control corn rootworm, most
preferably Western corn rootworm. Lepidopteran pests (including the
European corn borer and Helicoverpa zea) can also be controlled by
the pesticidal proteins of the subject invention.
[0016] The subject invention advantageously provides
polynucleotides and pesticidal proteins encoded by the
polynucleotides. In preferred embodiments, a 40-50 kDa protein and
a 10-15 kDa protein are used together, with the proteins being
pesticidal in combination. Thus, the two classes of proteins of the
subject invention can be referred to as "binary toxins." As used
herein, the term "toxin" or "pesticidal protein" includes either
class of these proteins. The use of a 40-50 kDa protein with a
10-15 kDa protein is preferred but not necessarily required. One
class of polynucleotide sequences as described herein encodes
proteins which have a full-length molecular weight of approximately
40-50 kDa. In a specific embodiment, these proteins have a
molecular weight of about 43-47 kDa. A second class of
polynucleotides of the subject invention encodes pesticidal
proteins of about 10-15 kDa. In a specific embodiment, these
proteins have a molecular weight of about 13-14 kDa. It should be
clear that each type of toxin/gene is an aspect of the subject
invention. In a particularly preferred embodiment, a 40-50 kDa
protein of the subject invention is used in combination with a
10-15 kDa protein. Thus, the proteins of the subject invention can
be used to augment and/or facilitate the activity of other protein
toxins.
[0017] The subject invention includes polynucleotides that encode
the 40-50 kDa or the 10-15 kDa toxins, polynucleotides that encode
portions or fragments of the full length toxins that retain
pesticidal activity (preferably when used in combination), and
polynucleotides that encode both types of toxins. Novel examples of
fusion proteins (a 40-50 kDa protein and a 10-15 kDa protein fused
together) and polynucleotides that encode them are also disclosed
herein.
[0018] In some embodiments, B.t. toxins useful according to the
invention include toxins which can be obtained from the novel B.t.
isolates disclosed herein. It should be clear that, where 40-50 kDa
and 10-15 kDa toxins, for example, are used together, one type of
toxin can be obtained from one isolate and the other type of toxin
can be obtained from another isolate.
[0019] The subject invention also includes the use of variants of
the exemplified B.t. isolates and toxins which have substantially
the same coleopteran-active properties as the specifically
exemplified B.t. isolates and toxins. Such variant isolates would
include, for example, mutants. Procedures for making mutants are
well known in the microbiological art. Ultraviolet light and
chemical mutagens such as nitrosoguanidine are used extensively
toward this end.
[0020] In preferred embodiments, the subject invention concerns
plants and plant cells having at least one isolated polynucleotide
of the subject invention. Preferably, the transgenic plant cells
express pesticidal toxins in tissues consumed by the target
pests.
[0021] Alternatively, the B.t. isolates of the subject invention,
or recombinant microbes expressing the toxins described herein, can
be used to control pests. In this regard, the invention includes
the treatment of substantially intact B.t. cells, and/or
recombinant cells containing the expressed toxins of the invention,
treated to prolong the pesticidal activity when the substantially
intact cells are applied to the environment of a target pest. The
treated cell acts as a protective coating for the pesticidal
toxin.
[0022] The toxins of the subject invention are oral intoxicants
that affect an insect's midgut cells upon ingestion by the target
insect. Thus, by consuming recombinant host cells, for example,
that express the toxins, the target insect thereby contacts the
proteins of the subject invention, which are toxic to the pest.
This results in control of the target pest.
BRIEF DESCRIPTION OF THE DRAWINGS
[0023] FIG. 1 shows three exemplary 43-47 kDa pesticidal toxins as
well as a consensus sequence for these pesticidal toxins.
[0024] FIG. 2 shows the relationship of the 14 and 45 kDa sequences
of PS80JJ1 (SEQ ID NOS. 31 and 10).
[0025] FIG. 3 shows a comparison of LC.sub.50 values from the
mixing study of Example 23.
[0026] FIG. 4 shows protein alignments of the 51 and 42 kDa
Bacillus sphaericus toxins and genes and the 45 kDa 149B1 toxin and
gene.
[0027] FIG. 5 shows nucleotide sequence alignments of the 51 and 42
kDa Bacillus sphaericus toxins and genes and the 45 kDa 149B1 toxin
and gene.
BRIEF DESCRIPTION OF THE SEQUENCES
[0028] SEQ ID NO:1 is a 5-amino acid N-terminal sequence of the
approximately 45 kDa toxin of 80JJ1.
[0029] SEQ ID NO:2 is a 25-amino acid N-terminal sequence of the
approximately 45 kDa toxin of 80B1.
[0030] SEQ ID NO:3 is a 24-amino acid N-terminal sequence of the
approximately 14 kDa toxin of 80B1.
[0031] SEQ ID NO:4 is the N-terminal sequence of the approximately
47 kDa toxin from 149B1.
[0032] SEQ ID NO:5 is a 50-amino acid N-terminal amino acid
sequence for the purified approximately 14 kDa protein from
PS149B1.
[0033] SEQ ID NO:6 is the N-terminal sequence of the approximately
47 kDa toxin from 167H2.
[0034] SEQ ID NO:7 is a 25-amino acid N-terminal sequence for the
purified approximately 14 kDa protein from PS167H2.
[0035] SEQ ID NO:8 is an oligonucleotide probe for the gene
encoding the PS80B1 44.3 kDa toxin and is a forward primer for PS
and PS167H2 used according to the subject invention.
[0036] SEQ ID NO:9 is a reverse primer for PS and PS167H2 used
according to the subject invention.
[0037] SEQ ID NO:10 is the nucleotide sequence of the gene encoding
the approximately 45 kDa PS80B1 toxin.
[0038] SEQ ID NO:11 is the amino acid sequence for the
approximately 45 kDa PS80B1 toxin.
[0039] SEQ ID NO:12 is the partial nucleotide sequence of the gene
encoding the approximately 44 kDa PS149B1 toxin.
[0040] SEQ ID NO:13 is the partial amino acid sequence for the
approximately 44 kDa PS toxin.
[0041] SEQ ID NO:14 is the partial nucleotide sequence of the gene
encoding the approximately 44 kDa PS167H2 toxin.
[0042] SEQ ID NO:15 is the partial amino acid sequence for the
approximately 44 kDa PS167H2 toxin.
[0043] SEQ ID NO:16 is a peptide sequence used in primer design
according to the subject invention.
[0044] SEQ ID NO:17 is a peptide sequence used in primer design
according to the subject invention.
[0045] SEQ ID NO:18 is a peptide sequence used in primer design
according to the subject invention.
[0046] SEQ ID NO:19 is a peptide sequence used in primer design
according to the subject invention.
[0047] SEQ ID NO:20 is a nucleotide sequence corresponding to the
peptide of SEQ ID NO:16.
[0048] SEQ ID NO:21 is a nucleotide sequence corresponding to the
peptide of SEQ ID NO:17.
[0049] SEQ ID NO:22 is a nucleotide sequence corresponding to the
peptide of SEQ ID NO:18.
[0050] SEQ ID NO:23 is a nucleotide sequence corresponding to the
peptide of SEQ ID NO:19.
[0051] SEQ ID NO:24 is a reverse primer based on the reverse
complement of SEQ ID NO:22.
[0052] SEQ ID NO:25 is a reverse primer based on the reverse
complement of SEQ ID NO:23.
[0053] SEQ ID NO:26 is a forward primer based on the PS80JJ1 44.3
kDa toxin.
[0054] SEQ ID NO:27 is a reverse primer based on the PS80JJ1 44.3
kDa toxin.
[0055] SEQ ID NO:28 is a generic sequence representing a new class
of toxins according to the subject invention.
[0056] SEQ ID NO:29 is an oligonucleotide probe used according to
the subject invention.
[0057] SEQ ID NO:30 is the nucleotide sequence of the entire
genetic locus containing open reading frames of both the 14 and 45
kDa PS80JJ1 toxins and the flanking nucleotide sequences.
[0058] SEQ ID NO:31 is the nucleotide sequence of the PS80JJ1 14
kDa toxin open reading frame.
[0059] SEQ ID NO:32 is the deduced amino acid sequence of the 14
kDa toxin of PS80JJ1.
[0060] SEQ ID NO:33 is a reverse oligonucleotide primer used
according to the subject invention.
[0061] SEQ ID NO:34 is the nucleotide sequence of the entire
genetic locus containing open reading frames of both the 14 and 44
kDa PS167H2 toxins and the flanking nucleotide sequences.
[0062] SEQ ID NO:35 is the nucleotide sequence of the gene encoding
the approximately 14 kDa PS167H2 toxin.
[0063] SEQ ID NO:36 is the amino acid sequence for the
approximately 14 kDa PS167H2 toxin.
[0064] SEQ ID NO:37 is the nucleotide sequence of the gene encoding
the approximately 44 kDa PS167H2 toxin.
[0065] SEQ ID NO:38 is the amino acid sequence for the
approximately 44 kDa PS167H2 toxin.
[0066] SEQ ID NO:39 is the nucleotide sequence of the entire
genetic locus containing open reading frames of both the 14 and 44
kDa PS149B1 toxins and the flanking nucleotide sequences.
[0067] SEQ ID NO:40 is the nucleotide sequence of the gene encoding
the approximately 14 kDa PS149B1 toxin.
[0068] SEQ ID NO:41 is the amino acid sequence for the
approximately 14 kDa PS149B1 toxin.
[0069] SEQ ID NO:42 is the nucleotide sequence of the gene encoding
the approximately 44 kDa PS149B1 toxin.
[0070] SEQ ID NO:43 is the amino acid sequence for the
approximately 44 kDa PS149B1 toxin.
[0071] SEQ ID NO:44 is a maize-optimized gene sequence encoding the
approximately 14 kDa toxin of 80B1.
[0072] SEQ ID NO:45 is a maize-optimized gene sequence encoding the
approximately 44 kDa toxin of 80B1.
[0073] SEQ ID NO:46 is the DNA sequence of a reverse primer used in
Example 15, below.
[0074] SEQ ID NO:47 is the DNA sequence of a forward primer (see
Example 16).
[0075] SEQ ID NO:48 is the DNA sequence of a reverse primer (see
Example 16).
[0076] SEQ ID NO:49 is the DNA sequence of a forward primer (see
Example 16).
[0077] SEQ ID NO:50 is the DNA sequence of a reverse primer (see
Example 16).
[0078] SEQ ID NO:51 is the DNA sequence from PS131W2 which encodes
the 14 kDa protein.
[0079] SEQ ID NO:52 is the amino acid sequence of the 14 kDa
protein of PS131W2.
[0080] SEQ ID NO:53 is a partial DNA sequence from PS131W2 for the
44 kDa protein.
[0081] SEQ ID NO:54 is a partial amino acid sequence for the 44 kDa
protein of PS131W2.
[0082] SEQ ID NO:55 is the DNA sequence from PS158T3 which encodes
the 14 kDa protein.
[0083] SEQ ID NO:56 is the amino acid sequence of the 14 kDa
protein of PS158T3.
[0084] SEQ ID NO:57 is a partial DNA sequence from PS158T3 for the
44 kDa protein.
[0085] SEQ ID NO:58 is a partial amino acid sequence for the 44 kDa
protein of PS158T3.
[0086] SEQ ID NO:59 is the DNA sequence from PS158X10 which encodes
the 14 kDa protein.
[0087] SEQ ID NO:60 is the amino acid sequence of the 14 kDa
protein of PS158X10.
[0088] SEQ ID NO:61 is the DNA sequence from PS185FF which encodes
the 14 kDa protein.
[0089] SEQ ID NO:62 is the amino acid sequence of the 14 kDa
protein of PS185FF.
[0090] SEQ ID NO:63 is a partial DNA sequence from PS185FF for the
44 kDa protein.
[0091] SEQ ID NO:64 is a partial amino acid sequence for the 44 kDa
protein of PS185FF.
[0092] SEQ ID NO:65 is the DNA sequence from PS185GG which encodes
the 14 kDa protein.
[0093] SEQ ID NO:66 is the amino acid sequence of the 14 kDa
protein of PS185GG.
[0094] SEQ ID NO:67 is the DNA sequence from PS185GG for the 44 kDa
protein.
[0095] SEQ ID NO:68 is the amino acid sequence for the 44 kDa
protein of PS185GG.
[0096] SEQ ID NO:69 is the DNA sequence from PS185L12 which encodes
the 14 kDa protein.
[0097] SEQ ID NO:70 is the amino acid sequence of the 14 kDa
protein of PS185L12.
[0098] SEQ ID NO:71 is the DNA sequence from PS185W3 which encodes
the 14 kDa protein.
[0099] SEQ ID NO:72 is the amino acid sequence of the 14 kDa
protein of PS185W3.
[0100] SEQ ID NO:73 is the DNA sequence from PS186FF which encodes
the 14 kDa protein.
[0101] SEQ ID NO:74 is the amino acid sequence of the 14 kDa
protein of PS186FF.
[0102] SEQ ID NO:75 is the DNA sequence from PS187F3 which encodes
the 14 kDa protein.
[0103] SEQ ID NO:76 is the amino acid sequence of the 14 kDa
protein of PS187F3.
[0104] SEQ ID NO:77 is a partial DNA sequence from PS187F3 for the
44 kDa protein.
[0105] SEQ ID NO:78 is a partial amino acid sequence for the 44 kDa
protein of PS187F3.
[0106] SEQ ID NO:79 is the DNA sequence from PS187G1 which encodes
the 14 kDa protein.
[0107] SEQ ID NO:80 is the amino acid sequence of the 14 kDa
protein of PS187G1.
[0108] SEQ ID NO:81 is a partial DNA sequence from PS187G1 for the
44 kDa protein.
[0109] SEQ ID NO:82 is a partial amino acid sequence for the 44 kDa
protein of PS187G1.
[0110] SEQ ID NO:83 is the DNA sequence from PS187L14 which encodes
the 14 kDa protein.
[0111] SEQ ID NO:84 is the amino acid sequence of the 14 kDa
protein of PS187L14.
[0112] SEQ ID NO:85 is a partial DNA sequence from PS187L14 for the
44 kDa protein.
[0113] SEQ ID NO:86 is a partial amino acid sequence for the 44 kDa
protein of PS187L14.
[0114] SEQ ID NO:87 is the DNA sequence from PS187Y2 which encodes
the 14 kDa protein.
[0115] SEQ ID NO:88 is the amino acid sequence of the 14 kDa
protein of PS187Y2.
[0116] SEQ ID NO:89 is a partial DNA sequence from PS187Y2 for the
44 kDa protein.
[0117] SEQ ID NO:90 is a partial amino acid sequence for the 44 kDa
protein of PS187Y2.
[0118] SEQ ID NO:91 is the DNA sequence from PS201G which encodes
the 14 kDa protein.
[0119] SEQ ID NO:92 is the amino acid sequence of the 14 kDa
protein of PS201G.
[0120] SEQ ID NO:93 is the DNA sequence from PS201HH which encodes
the 14 kDa protein.
[0121] SEQ ID NO:94 is the amino acid sequence of the 14 kDa
protein of PS201HH.
[0122] SEQ ID NO:95 is the DNA sequence from PS201L3 which encodes
the 14 kDa protein.
[0123] SEQ ID NO:96 is the amino acid sequence of the 14 kDa
protein of PS201L3.
[0124] SEQ ID NO:97 is the DNA sequence from PS204C3 which encodes
the 14 kDa protein.
[0125] SEQ ID NO:98 is the amino acid sequence of the 14 kDa
protein of PS204C3.
[0126] SEQ ID NO:99 is the DNA sequence from PS204G4 which encodes
the 14 kDa protein.
[0127] SEQ ID NO:100 is the amino acid sequence of the 14 kDa
protein of PS204G4.
[0128] SEQ ID NO:101 is the DNA sequence from PS204I11 which
encodes the 14 kDa protein.
[0129] SEQ ID NO:102 is the amino acid sequence of the 14 kDa
protein of PS204111.
[0130] SEQ ID NO:103 is the DNA sequence from PS204J7 which encodes
the 14 kDa protein.
[0131] SEQ ID NO:104 is the amino acid sequence of the 14 kDa
protein of PS204J7.
[0132] SEQ ID NO:105 is the DNA sequence from PS236B6 which encodes
the 14 kDa protein.
[0133] SEQ ID NO:106 is the amino acid sequence of the 14 kDa
protein of PS236B6.
[0134] SEQ ID NO:107 is the DNA sequence from PS242K10 which
encodes the 14 kDa protein.
[0135] SEQ ID NO:108 is the amino acid sequence of the 14 kDa
protein of PS242K10.
[0136] SEQ ID NO:109 is a partial DNA sequence from PS242K10 for
the 44 kDa protein.
[0137] SEQ ID NO:110 is a partial amino acid sequence for the 44
kDa protein of PS242K10.
[0138] SEQ ID NO:111 is the DNA sequence from PS246P42 which
encodes the 14 kDa protein.
[0139] SEQ ID NO:112 is the amino acid sequence of the 14 kDa
protein of PS246P42.
[0140] SEQ ID NO:113 is the DNA sequence from PS69Q which encodes
the 14 kDa protein.
[0141] SEQ ID NO:114 is the amino acid sequence of the 14 kDa
protein of PS69Q.
[0142] SEQ ID NO:115 is the DNA sequence from PS69Q for the 44 kDa
protein.
[0143] SEQ ID NO:116 is the amino acid sequence for the 44 kDa
protein of PS69Q.
[0144] SEQ ID NO:117 is the DNA sequence from KB54 which encodes
the 14 kDa protein.
[0145] SEQ ID NO:118 is the amino acid sequence of the 14 kDa
protein of KB54.
[0146] SEQ ID NO:119 is the DNA sequence from KR1209 which encodes
the 14 kDa protein.
[0147] SEQ ID NO:120 is the amino acid sequence of the 14 kDa
protein of KR1209.
[0148] SEQ ID NO:121 is the DNA sequence from KR1369 which encodes
the 14 kDa protein.
[0149] SEQ ID NO:122 is the amino acid sequence of the 14 kDa
protein of KR1369.
[0150] SEQ ID NO:123 is the DNA sequence from KR589 which encodes
the 14 kDa protein.
[0151] SEQ ID NO:124 is the amino acid sequence of the 14 kDa
protein of KR589.
[0152] SEQ ID NO:125 is a partial DNA sequence from KR589 for the
44 kDa protein.
[0153] SEQ ID NO:126 is a partial amino acid sequence for the 44
kDa protein of KR589.
[0154] SEQ ID NO:127 is a polynucleotide sequence for a gene
designated 149B1-15-PO, which is optimized for expression in Zea
mays. This gene encodes an approximately 15 kDa toxin obtainable
from PS149B1 that is disclosed in WO 97/40162.
[0155] SEQ ID NO:128 is a polynucleotide sequence for a gene
designated 149B1-45-PO, which is optimized for expression in Zea
mays. This gene encodes an approximately 45 kDa toxin obtainable
from PS149B1 that is disclosed in WO 97/40162.
[0156] SEQ ID NO:129 is a polynucleotide sequence for a gene
designated 80B1-15-P07, which is optimized for expression in maize.
This is an alternative gene that encodes an approximately 15 kDa
toxin.
[0157] SEQ ID NO:130 is an amino acid sequence for a toxin encoded
by the gene designated 80JJ1-15-P07.
[0158] SEQ ID NO:131 is an oligonucleotide primer (15kfor1) used
according to the subject invention (see Example 20).
[0159] SEQ ID NO:132 is an oligonucleotide primer (45krev6) used
according to the subject invention (see Example 20).
[0160] SEQ ID NO:133 is the DNA sequence from PS201L3 which encodes
the 14 kDa protein.
[0161] SEQ ID NO:134 is the amino acid sequence of the 14 kDa
protein of PS201L3.
[0162] SEQ ID NO:135 is a DNA sequence from PS201L3 for the 44 kDa
protein.
[0163] SEQ ID NO:136 is an amino acid sequence for the 44 kDa
protein of PS201L3.
[0164] SEQ ID NO:137 is the DNA sequence from PS187G1 which encodes
the 14 kDa protein.
[0165] SEQ ID NO:138 is the amino acid sequence of the 14 kDa
protein of PS187G1.
[0166] SEQ ID NO:139 is the DNA sequence from PS187G1 which encodes
the 44 kDa protein.
[0167] SEQ ID NO:140 is the amino acid sequence of the 44 kDa
protein of PS187G1.
[0168] SEQ ID NO:141 is the DNA sequence from PS201HH2 which
encodes the 14 kDa protein.
[0169] SEQ ID NO:142 is the amino acid sequence of the 14 kDa
protein of PS201HH2.
[0170] SEQ ID NO:143 is a partial DNA sequence from PS201HH2 for
the 44 kDa protein.
[0171] SEQ ID NO:144 is a partial amino acid sequence for the 44
kDa protein of PS201HH2.
[0172] SEQ ID NO:145 is the DNA sequence from KR1369 which encodes
the 14 kDa protein.
[0173] SEQ ID NO:146 is the amino acid sequence of the 14 kDa
protein of KR1369.
[0174] SEQ ID NO:147 is the DNA sequence from KR1369 which encodes
the 44 kDa protein.
[0175] SEQ ID NO:148 is the amino acid sequence of the 44 kDa
protein of KR1369.
[0176] SEQ ID NO:149 is the DNA sequence from PS137A which encodes
the 14 kDa protein.
[0177] SEQ ID NO:150 is the amino acid sequence of the 14 kDa
protein of PS137A.
[0178] SEQ ID NO:151 is the DNA sequence from PS201V2 which encodes
the 14 kDa protein.
[0179] SEQ ID NO:152 is the amino acid sequence of the 14 kDa
protein of PS201V2.
[0180] SEQ ID NO:153 is the DNA sequence from PS207C3 which encodes
the 14 kDa protein.
[0181] SEQ ID NO:154 is the amino acid sequence of the 14 kDa
protein of PS207C3.
[0182] SEQ ID NO:155 is an oligonucleotide primer (F1new) for use
according to the subject invention (see Example 22).
[0183] SEQ ID NO:156 is an oligonucleotide primer (R1new) for use
according to the subject invention (see Example 22).
[0184] SEQ ID NO:157 is an oligonucleotide primer (F2new) for use
according to the subject invention (see Example 22).
[0185] SEQ ID NO:158 is an oligonucleotide primer (R2new) for use
according to the subject invention (see Example 22).
[0186] SEQ ID NO:159 is an approximately 58 kDa fusion protein.
[0187] SEQ ID NO:160 is a fusion gene encoding the protein of SEQ
ID NO:159.
[0188] SEQ ID NO:161 is primer 45 kD5' for use according to the
subject invention (see Example 27).
[0189] SEQ ID NO:162 is primer 45 kD3'rc for use according to the
subject invention (see Example 27).
[0190] SEQ ID NO:163 is primer 45 kD5'01 for use according to the
subject invention (see Example 27).
[0191] SEQ ID NO:164 is primer 45 kD5'02 for use according to the
subject invention (see Example 27).
[0192] SEQ ID NO:165 is primer 45 kD3'03 for use according to the
subject invention (see Example 27).
[0193] SEQ ID NO:166 is primer 45 kD3'04 for use according to the
subject invention (see Example 27).
DETAILED DISCLOSURE OF THE INVENTION
[0194] The subject invention concerns two new classes of
polynucleotide sequences as well as the novel pesticidal proteins
encoded by these polynucleotides. In one embodiment, the proteins
have a full-length molecular weight of approximately 40-50 kDa. In
specific embodiments exemplified herein, these proteins have a
molecular weight of about 43-47 kDa. In a second embodiment, the
pesticidal proteins have a molecular weight of approximately 10-15
kDa. In specific embodiments exemplified herein, these proteins
have a molecular weight of about 13-14 kDa.
[0195] In preferred embodiments, a 40-50 kDa protein and a 10-15
kDa protein are used together, and the proteins are pesticidal in
combination. Thus, the two classes of proteins of the subject
invention can be referred to as "binary toxins." As used herein,
the term "toxin" includes either class of pesticidal proteins. The
subject invention concerns polynucleotides which encode either the
40-50 kDa or the 10-15 kDa toxins, polynucleotides which encode
portions or fragments of the full length toxins that retain
pesticidal activity when used in combination, and polynucleotide
sequences which encode both types of toxins. In a preferred
embodiment, these toxins are active against coleopteran pests, more
preferably corn rootworm, and most preferably Western corn
rootworm. Lepidopteran pests can also be targeted.
[0196] Certain specific toxins are exemplified herein. For toxins
having a known amino acid sequence, the molecular weight is also
known. Those skilled in the art will recognize that the apparent
molecular weight of a protein as determined by gel electrophoresis
will sometimes differ from the true molecular weight. Therefore,
reference herein to, for example, a 45 kDa protein or a 14 kDa
protein is understood to refer to proteins of approximately that
size even if the true molecular weight is somewhat different.
[0197] The subject invention concerns not only the polynucleotides
that encode these classes of toxins, but also the use of these
polynucleotides to produce recombinant hosts which express the
toxins. In a further aspect, the subject invention concerns the
combined use of an approximately 40-50 kDa toxin of the subject
invention together with an approximately 10-15 kDa toxin of the
subject invention to achieve highly effective control of pests,
including coleopterans such as corn rootworm. For example, the
roots of one plant can express both types of toxins.
[0198] Thus, control of pests using the isolates, toxins, and genes
of the subject invention can be accomplished by a variety of
methods known to those skilled in the art. These methods include,
for example, the application of B.t. isolates to the pests (or
their location), the application of recombinant microbes to the
pests (or their locations), and the transformation of plants with
genes which encode the pesticidal toxins of the subject invention.
Microbes for use according to the subject invention may be, for
example, B.t., E. coli, and/or Pseudomonas. Recombinant hosts can
be made by those skilled in the art using standard techniques.
Materials necessary for these transformations are disclosed herein
or are otherwise readily available to the skilled artisan. Control
of insects and other pests such as nematodes and mites can also be
accomplished by those skilled in the art using standard techniques
combined with the teachings provided herein.
[0199] The new classes of toxins and polynucleotide sequences
provided here are defined according to several parameters. One
critical characteristic of the toxins described herein is
pesticidal activity. In a specific embodiment, these toxins have
activity against coleopteran pests. Anti-lepidopteran-active toxins
are also embodied. The toxins and genes of the subject invention
can be further defined by their amino acid and nucleotide
sequences. The sequences of the molecules within each novel class
can be identified and defined in terms of their similarity or
identity to certain exemplified sequences as well as in terms of
the ability to hybridize with, or be amplified by, certain
exemplified probes and primers. The classes of toxins provided
herein can also be identified based on their immunoreactivity with
certain antibodies and based upon their adherence to a generic
formula.
[0200] It should be apparent to a person skilled in this art that
genes encoding pesticidal proteins according to the subject
invention can be obtained through several means. The specific genes
exemplified herein may be obtained from the isolates deposited at a
culture depository as described herein. These genes, and toxins, of
the subject invention can also be constructed synthetically, for
example, by the use of a gene synthesizer.
[0201] The sequence of three exemplary 45 kDa toxins are provided
as SEQ ID NOS:11, 43, and 38.
[0202] In preferred embodiments, toxins of this class have a
sequence which conforms to the generic sequence presented as SEQ ID
NO:28. In preferred embodiments, the toxins of this class will
conform to the consensus sequence shown in FIG. 1.
[0203] With the teachings provided herein, one skilled in the art
could readily produce and use the various toxins and polynucleotide
sequences of the novel classes described herein.
[0204] Microorganisms useful according to the subject invention
have been deposited in the permanent collection of the Agricultural
Research Service Patent Culture Collection (NRRL), Northern
Regional Research Center, 1815 North University Street, Peoria,
Ill. 61604, USA. The culture repository numbers of the deposited
strains are as follows:
TABLE-US-00001 Culture Repository No. Deposit Date B.t. strain
PS80JJ1 NRRL B-18679 Jul. 17, 1990 B.t. strain PS149B1 NRRL B-21553
Mar. 28, 1996 B.t. strain PS167H2 NRRL B-21554 Mar. 28, 1996 E.
coli NM522 (pMYC2365) NRRL B-21170 Jan. 5, 1994 E. coli NM522
(pMYC2382) NRRL B-21329 Sep. 28, 1994 E. coli NM522 (pMYC2379) NRRL
B-21155 Nov. 3, 1993 E. coli NM522(pMYC2421) NRRL B-21555 Mar. 28,
1996 E. coli NM522(pMYC2427) NRRL B-21672 Mar. 26, 1997 E. coli
NM522(pMYC2429) NRRL B-21673 Mar. 26, 1997 E. coli NM522(pMYC2426)
NRRL B-21671 Mar. 26, 1997 B.t. strain PS185GG NRRL B-30175 Aug.
19, 1999 B.t. strain PS187G1 NRRL B-30185 Aug. 19, 1999 B.t. strain
PS187Y2 NRRL B-30187 Aug. 19, 1999 B.t. strain PS201G NRRL B-30188
Aug. 19, 1999 B.t. strain PS201HH2 NRRL B-30190 Aug. 19, 1999 B.t.
strain PS242K10 NRRL B-30195 Aug. 19, 1999 B.t. strain PS69Q NRRL
B-30175 Aug. 19, 1999 B.t. strain KB54A1-6 NRRL B-30197 Aug. 19,
1999 B.t. strain KR589 NRRL B-30198 Aug. 19, 1999 B.t. strain
PS185L12 NRRL B-30179 Aug. 19, 1999 B.t. strain PS185W3 NRRL
B-30180 Aug. 19, 1999 B.t. strain PS187L14 NRRL B-30186 Aug. 19,
1999 B.t. strain PS186FF NRRL B-30182 Aug. 19, 1999 B.t. strain
PS131W2 NRRL B-30176 Aug. 19, 1999 B.t. strain PS158T3 NRRL B-30177
Aug. 19, 1999 B.t. strain PS158X10 NRRL B-30178 Aug. 19, 1999 B.t.
strain PS185FF NRRL B-30182 Aug. 19, 1999 B.t. strain PS187F3 NRRL
B-30184 Aug. 19, 1999 B.t. strain PS201L3 NRRL B-30189 Aug. 19,
1999 B.t. strain PS204C3 NRRL B-30191 Aug. 19, 1999 B.t. strain
PS204G4 NRRL B-18685 Jul. 17, 1990 B.t. strain PS204I11 NRRL
B-30192 Aug. 19, 1999 B.t. strain PS204J7 NRRL B-30193 Aug. 19,
1999 B.t. strain PS236B6 NRRL B-30194 Aug. 19, 1999 B.t. strain
PS246P42 NRRL B-30196 Aug. 19, 1999 B.t. strain KR1209 NRRL B-30199
Aug. 19, 1999 B.t. strain KR1369 NRRL B-30200 Aug. 19, 1999 B.t.
strain MR1506 NRRL B-30298 Jun. 1, 2000 B.t. strain MR1509 NRRL
B-30330 Aug. 8, 2000 B.t. strain MR1510 NRRL B-30331 Aug. 8, 2000
P.f. strain MR1607 NRRL B-30332 Aug. 8, 2000
[0205] The PS80JJ1 isolate is available to the public by virtue of
the issuance of U.S. Pat. No. 5,151,363 and other patents.
[0206] A further aspect of the subject invention concerns novel
isolates and the toxins and genes obtainable from these isolates.
Novel isolates have been deposited and are included in the above
list. These isolates have been deposited under conditions that
assure that access to the cultures will be available during the
pendency of this patent application to one determined by the
Commissioner of Patents and Trademarks to be entitled thereto under
37 CFR 1.14 and 35 U.S.C. 122. The deposits are available as
required by foreign patent laws in countries wherein counterparts
of the subject application, or its progeny, are filed. However, it
should be understood that the availability of a deposit does not
constitute a license to practice the subject invention in
derogation of patent rights granted by governmental action.
[0207] Further, the subject culture deposits will be stored and
made available to the public in accord with the provisions of the
Budapest Treaty for the Deposit of Microorganisms, i.e., they will
be stored with all the care necessary to keep them viable and
uncontaminated for a period of at least five years after the most
recent request for the furnishing of a sample of a deposit, and in
any case, for a period of at least 30 (thirty) years after the date
of deposit or for the enforceable life of any patent which may
issue disclosing the cultures. The depositor acknowledges the duty
to replace the deposit(s) should the depository be unable to
furnish a sample when requested, due to the condition of the
deposit(s). All restrictions on the availability to the public of
the subject culture deposits will be irrevocably removed upon the
granting of a patent disclosing them.
[0208] Following is a table which provides characteristics of
certain B.t. isolates that are useful according to the subject
invention.
TABLE-US-00002 TABLE 1 Description of B.t. strains Crystal Approx.
MW NRRL Deposit Culture Description (kDa) Serotype Deposit Date
PS80JJ1 multiple attached 130, 90, 47, 37, 14 4a4b, sotto B-18679
Jul. 17, 1990 PS149B1 130, 47, 14 B-21553 Mar. 28, 1996 PS167H2 70,
47, 14 B-23554 Mar. 28, 1996
[0209] Other isolates of the subject invention can also be
characterized in terms of the shape and location of toxin
inclusions.
[0210] Toxins, genes, and probes. The polynucleotides of the
subject invention can be used to form complete "genes" to encode
proteins or peptides in a desired host cell. For example, as the
skilled artisan would readily recognize, some of the
polynucleotides in the attached sequence listing are shown without
stop codons. Also, the subject polynucleotides can be appropriately
placed under the control of a promoter in a host of interest, as is
readily known in the art.
[0211] As the skilled artisan would readily recognize, DNA
typically exists in a double-stranded form. In this arrangement,
one strand is complementary to the other strand and vice versa. As
DNA is replicated in a plant (for example) additional,
complementary strands of DNA are produced. The "coding strand" is
often used in the art to refer to the strand that binds with the
anti-sense strand. The mRNA is transcribed from the "anti-sense"
strand of DNA. The "sense" or "coding" strand has a series of
codons (a codon is three nucleotides that can be read
three-at-a-time to yield a particular amino acid) that can be read
as an open reading frame (ORF) to form a protein or peptide of
interest. In order to express a protein in vivo, a strand of DNA is
typically transcribed into a complementary strand of mRNA which is
used as the template for the protein. Thus, the subject invention
includes the use of the exemplified polynucleotides shown in the
attached sequence listing and/or the complementary strands. RNA and
PNA (peptide nucleic acids) that are functionally equivalent to the
exemplified DNA are included in the subject invention.
[0212] Toxins and genes of the subject invention can be identified
and obtained by using oligonucleotide probes, for example. These
probes are detectable nucleotide sequences which may be detectable
by virtue of an appropriate label or may be made inherently
fluorescent as described in International Application No. WO
93/16094. The probes (and the polynucleotides of the subject
invention) may be DNA, RNA, or PNA. In addition to adenine (A),
cytosine (C), guanine (G), thymine (T), and uracil (U; for RNA
molecules), synthetic probes (and polynucleotides) of the subject
invention can also have inosine (a neutral base capable of pairing
with all four bases; sometimes used in place of a mixture of all
four bases in synthetic probes). Thus, where a synthetic,
degenerate oligonucleotide is referred to herein, and "n" is used
generically, "n" can be G, A, T, C, or inosine. Ambiguity codes as
used herein are in accordance with standard IUPAC naming
conventions as of the filing of the subject application (for
example, R means A or G, Y means C or T, etc.)
[0213] As is well known in the art, if the probe molecule and
nucleic acid sample hybridize by forming a strong bond between the
two molecules, it can be reasonably assumed that the probe and
sample have substantial homology/similarity/identity. Preferably,
hybridization is conducted under stringent conditions by techniques
well-known in the art, as described in, for example, Keller, G. H.,
M. M. Manak (1987) DNA Probes, Stockton Press, New York, N.Y., pp.
169-170. For example, as stated therein, high stringency conditions
can be achieved by first washing with 2.times.SSC (Standard Saline
Citrate)/0.1% SDS (Sodium Dodecyl Sulfate) for 15 minutes at room
temperature. Two washes are typically performed. Higher stringency
can then be achieved by lowering the salt concentration and/or by
raising the temperature. For example, the wash described above can
be followed by two washings with 0.1.times.SSC/0.1% SDS for 15
minutes each at room temperature followed by subsequent washes with
0.1.times.SSC/0.1% SDS for 30 minutes each at 55EC. These
temperatures can be used with other hybridization and wash
protocols set forth herein and as would be known to one skilled in
the art (SSPE can be used as the salt instead of SSC, for example).
The 2.times.SSC/0.1% SDS can be prepared by adding 50 ml of
20.times.SSC and 5 ml of 10% SDS to 445 ml of water. 20.times.SSC
can be prepared by combining NaCl (175.3 g/0.150 M), sodium citrate
(88.2 g/0.015 M), and water to 1 liter, followed by adjusting pH to
7.0 with 10 N NaOH. 10% SDS can be prepared by dissolving 10 g of
SDS in 50 ml of autoclaved water, diluting to 100 ml, and
aliquotting.
[0214] Detection of the probe provides a means for determining in a
known manner whether hybridization has occurred. Such a probe
analysis provides a rapid method for identifying toxin-encoding
genes of the subject invention. The nucleotide segments which are
used as probes according to the invention can be synthesized using
a DNA synthesizer and standard procedures. These nucleotide
sequences can also be used as PCR primers to amplify genes of the
subject invention.
[0215] Hybridization characteristics of a molecule can be used to
define polynucleotides of the subject invention. Thus the subject
invention includes polynucleotides (and/or their complements,
preferably their full complements) that hybridize with a
polynucleotide exemplified herein (such as the DNA sequences
included in SEQ ID NOs:46-166).
[0216] As used herein "stringent" conditions for hybridization
refers to conditions which achieve the same, or about the same,
degree of specificity of hybridization as the conditions employed
by the current applicants. Specifically, hybridization of
immobilized DNA on Southern blots with .sup.32P-labeled
gene-specific probes was performed by standard methods (Maniatis,
T., E. F. Fritsch, J. Sambrook [1982] Molecular Cloning: A
Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring
Harbor, N.Y.). In general, hybridization and subsequent washes were
carried out under stringent conditions that allowed for detection
of target sequences (with homology to the PS80JJ1 toxin genes, for
example). For double-stranded DNA gene probes, hybridization was
carried out overnight at 20-25.degree. C. below the melting
temperature (Tm) of the DNA hybrid in 6.times.SSPE,
5.times.Denhardt's solution, 0.1% SDS, 0.1 mg/ml denatured DNA. The
melting temperature is described by the following formula (Beltz,
G. A., K. A. Jacobs, T. H. Eickbush, P. T. Cherbas, and F. C.
Kafatos [1983] Methods of Enzymology, R. Wu, L. Grossman and K.
Moldave [eds.] Academic Press, New York 100:266-285):
Tm=81.5.degree. C.+16.6 Log [Na+]+0.41(% G+C)-0.61(%
formamide)-600/length of duplex in base pairs.
[0217] Washes are typically carried out as follows: [0218] (1)
Twice at room temperature for 15 minutes in 1.times.SSPE, 0.1% SDS
(low stringency wash). [0219] (2) Once at Tm-20EC for 15 minutes in
0.2.times.SSPE, 0.1% SDS (moderate stringency wash).
[0220] For oligonucleotide probes, hybridization was carried out
overnight at 10-20EC below the melting temperature (Tm) of the
hybrid in 6.times.SSPE, 5.times.Denhardt's solution, 0.1% SDS, 0.1
mg/ml denatured DNA. Tm for oligonucleotide probes was determined
by the following formula:
Tm(.degree. C.)=2(number T/A base pairs)+4(number G/C base
pairs)
(Suggs, S. V., T. Miyake, E. H. Kawashime, M. J. Johnson, K.
Itakura, and R. B. Wallace [1981] ICN-UCLA Symp. Dev. Biol. Using
Purified Genes, D. D. Brown [ed.], Academic Press, New York,
23:683-693).
[0221] Washes were typically carried out as follows: [0222] (1)
Twice at room temperature for 15 minutes 1.times.SSPE, 0.1% SDS
(low stringency wash). [0223] (2) Once at the hybridization
temperature for 15 minutes in 1.times.SSPE, 0.1% SDS (moderate
stringency wash).
[0224] Toxins obtainable from isolates PS149B1, PS167H2, and
PS80JJ1 have been characterized as having have at least one of the
following characteristics (novel toxins of the subject invention
can be similarly characterized with this and other identifying
information set forth herein): [0225] (a) said toxin is encoded by
a nucleotide sequence which hybridizes under stringent conditions
with a nucleotide sequence selected from the group consisting of:
DNA which encodes SEQ ID NO:2, DNA which encodes SEQ ID NO:4, DNA
which encodes SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, DNA which
encodes SEQ ID NO:11, SEQ ID NO:12, DNA which encodes SEQ ID NO:13,
SEQ ID NO:14, DNA which encodes SEQ ID NO:15, DNA which encodes SEQ
ID NO:16, DNA which encodes SEQ ID NO:17, DNA which encodes SEQ ID
NO:18, DNA which encodes SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21,
SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID
NO:26, SEQ ID NO:27, DNA which encodes a pesticidal portion of SEQ
ID NO:28, SEQ ID NO:37, DNA which encodes SEQ ID NO:38, SEQ ID
NO:42, and DNA which encodes SEQ ID NO:43; [0226] (b) said toxin
immunoreacts with an antibody to an approximately 40-50 kDa
pesticidal toxin, or a fragment thereof, from a Bacillus
thuringiensis isolate selected from the group consisting of PS80JJ1
having the identifying characteristics of NRRL B-18679, PS149B1
having the identifying characteristics of NRRL B-21553, and PS167H2
having the identifying characteristics of NRRL B-21554; [0227] (c)
said toxin is encoded by a nucleotide sequence wherein a portion of
said nucleotide sequence can be amplified by PCR using a primer
pair selected from the group consisting of SEQ ID NOs:20 and 24 to
produce a fragment of about 495 bp, SEQ ID NOs:20 and 25 to produce
a fragment of about 594 bp, SEQ ID NOs:21 and 24 to produce a
fragment of about 471 bp, and SEQ ID NOs:21 and 25 to produce a
fragment of about 580 bp; [0228] (d) said toxin comprises a
pesticidal portion of the amino acid sequence shown in SEQ ID
NO:28; [0229] (e) said toxin comprises an amino acid sequence which
has at least about 60% homology with a pesticidal portion of an
amino acid sequence selected from the group consisting of SEQ ID
NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:38, and SEQ ID NO:43;
[0230] (f) said toxin is encoded by a nucleotide sequence which
hybridizes under stringent conditions with a nucleotide sequence
selected from the group consisting of DNA which encodes SEQ ID
NO:3, DNA which encodes SEQ ID NO:5, DNA which encodes SEQ ID NO:7,
DNA which encodes SEQ ID NO:32, DNA which encodes SEQ ID NO:36, and
DNA which encodes SEQ ID NO:41; [0231] (g) said toxin immunoreacts
with an antibody to an approximately 10-15 kDa pesticidal toxin, or
a fragment thereof, from a Bacillus thuringiensis isolate selected
from the group consisting of PS80JJ1 having the identifying
characteristics of NRRL B-18679, PS149B1 having the identifying
characteristics of NRRL B-21553, and PS167H2 having the identifying
characteristics of NRRL B-21554; [0232] (h) said toxin is encoded
by a nucleotide sequence wherein a portion of said nucleotide
sequence can be amplified by PCR using the primer pair of SEQ ID
NO:29 and SEQ ID NO:33; and [0233] (i) said toxin comprises an
amino acid sequence which has at least about 60% homology with an
amino acid sequence selected from the group consisting of SEQ ID
NO:3, SEQ ID NO:5, SEQ ID NO:7, pesticidal portions of SEQ ID
NO:32, pesticidal portions of SEQ ID NO:36, and pesticidal portions
of SEQ ID NO:41.
[0234] Modification of genes and toxins. The genes and toxins
useful according to the subject invention include not only the
specifically exemplified full-length sequences, but also portions
and/or fragments (including internal and/or terminal deletions
compared to the full-length molecules) of these sequences,
variants, mutants, chimerics, and fusions thereof. Proteins of the
subject invention can have substituted amino acids so long as they
retain the characteristic pesticidal activity of the proteins
specifically exemplified herein. "Variant" genes have nucleotide
sequences which encode the same toxins or which encode toxins
having pesticidal activity equivalent to an exemplified protein. As
used herein, the term "equivalent toxins" refers to toxins having
the same or essentially the same biological activity against the
target pests as the exemplified toxins. As used herein, reference
to "essentially the same" sequence refers to sequences which have
amino acid substitutions, deletions, additions, or insertions which
do not materially affect pesticidal activity. Fragments retaining
pesticidal activity are also included in this definition. Fragments
and equivalents which retain the pesticidal activity of the
exemplified toxins would be within the scope of the subject
invention.
[0235] Equivalent toxins and/or genes encoding these equivalent
toxins can be derived from wild-type or recombinant B.t. isolates
and/or from other wild-type or recombinant organisms using the
teachings provided herein. Other Bacillus species, for example, can
be used as source isolates.
[0236] Variations of genes may be readily constructed using
standard techniques for making point mutations, for example. Also,
U.S. Pat. No. 5,605,793, for example, describes methods for
generating additional molecular diversity by using DNA reassembly
after random fragmentation. Variant genes can be used to produce
variant proteins; recombinant hosts can be used to produce the
variant proteins. Fragments of full-length genes can be made using
commercially available exonucleases or endonucleases according to
standard procedures. For example, enzymes such as Bal31 or
site-directed mutagenesis can be used to systematically cut off
nucleotides from the ends of these genes. Also, genes which encode
active fragments may be obtained using a variety of restriction
enzymes. Proteases may be used to directly obtain active fragments
of these toxins.
[0237] There are a number of methods for obtaining the pesticidal
toxins of the instant invention. For example, antibodies to the
pesticidal toxins disclosed and claimed herein can be used to
identify and isolate other toxins from a mixture of proteins.
Specifically, antibodies may be raised to the portions of the
toxins which are most constant and most distinct from other B.t.
toxins. These antibodies can then be used to specifically identify
equivalent toxins with the characteristic activity by
immunoprecipitation, enzyme linked immunosorbent assay (ELISA), or
western blotting. Antibodies to the toxins disclosed herein, or to
equivalent toxins, or to fragments of these toxins, can readily be
prepared using standard procedures. The genes which encode these
toxins can then be obtained from the source microorganism.
[0238] Because of the redundancy of the genetic code, a variety of
different DNA sequences can encode the amino acid sequences
disclosed herein. It is well within the skill of a person trained
in the art to create these alternative DNA sequences encoding the
same, or essentially the same, toxins. These variant DNA sequences
are within the scope of the subject invention.
[0239] Certain toxins of the subject invention have been
specifically exemplified herein. Since these toxins are merely
exemplary of the toxins of the subject invention, it should be
readily apparent that the subject invention comprises variant or
equivalent toxins (and nucleotide sequences coding for equivalent
toxins) having the same or similar pesticidal activity of the
exemplified toxin. Equivalent toxins will have amino acid
similarity (and/or homology) with an exemplified toxin. The amino
acid identity will typically be greater than 60%, preferably
greater than 75%, more preferably greater than 80%, even more
preferably greater than 90%, and can be greater than 95%. Preferred
polynucleotides and proteins of the subject invention can also be
defined in terms of more particular identity and/or similarity
ranges. For example, the identity and/or similarity can be 49, 50,
51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67,
68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84,
85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% as
compared to a sequence exemplified herein. Unless otherwise
specified, as used herein percent sequence identity and/or
similarity of two nucleic acids is determined using the algorithm
of Karlin and Altschul (1990), Proc. Natl. Acad. Sci. USA
87:2264-2268, modified as in Karlin and Altschul (1993), Proc.
Natl. Acad. Sci. USA 90:5873-5877. Such an algorithm is
incorporated into the NBLAST and XBLAST programs of Altschul et al.
(1990), J. Mol. Biol. 215:402-410. BLAST nucleotide searches are
performed with the NBLAST program, score=100, wordlength=12, to
obtain nucleotide sequences with the desired percent sequence
identity. To obtain gapped alignments for comparison purposes,
Gapped BLAST is used as described in Altschul et al. (1997), Nucl.
Acids Res. 25:3389-3402. When utilizing BLAST and Gapped BLAST
programs, the default parameters of the respective programs (NBLAST
and XBLAST) are used. See http://www.ncbi.nih.gov. The scores can
also be calculated using the methods and algorithms of Crickmore et
al. as described in the Background section, above.
[0240] The amino acid homology will be highest in critical regions
of the toxin which account for biological activity or are involved
in the determination of three-dimensional configuration which
ultimately is responsible for the biological activity. In this
regard, certain amino acid substitutions are acceptable and can be
expected if these substitutions are in regions which are not
critical to activity or are conservative amino acid substitutions
which do not affect the three-dimensional configuration of the
molecule. For example, amino acids may be placed in the following
classes: non-polar, uncharged polar, basic, and acidic.
Conservative substitutions whereby an amino acid of one class is
replaced with another amino acid of the same type fall within the
scope of the subject invention so long as the substitution does not
materially alter the biological activity of the compound. Table 2
provides a listing of examples of amino acids belonging to each
class.
TABLE-US-00003 TABLE 2 Class of Amino Acid Examples of Amino Acids
Nonpolar Ala, Val, Leu, Ile, Pro, Met, Phe, Trp Uncharged Polar
Gly, Ser, Thr, Cys, Tyr, Asn, Gln Acidic Asp, Glu Basic Lys, Arg,
His
[0241] In some instances, non-conservative substitutions can also
be made. The critical factor is that these substitutions must not
significantly detract from the biological activity of the
toxin.
[0242] As used herein, reference to "isolated" polynucleotides
and/or "purified" toxins refers to these molecules when they are
not associated with the other molecules with which they would be
found in nature; these terms would include their use in plants.
Thus, reference to "isolated" and/or "purified" signifies the
involvement of the "hand of man" as described herein.
[0243] Synthetic genes which are functionally equivalent to the
toxins of the subject invention can also be used to transform
hosts. Methods for the production of synthetic genes can be found
in, for example, U.S. Pat. No. 5,380,831.
[0244] Transgenic hosts. The toxin-encoding genes of the subject
invention can be introduced into a wide variety of microbial or
plant hosts. In preferred embodiments, expression of the toxin gene
results, directly or indirectly, in the intracellular production
and maintenance of the pesticide proteins. When
transgenic/recombinant/transformed host cells are ingested by the
pests, the pests will ingest the toxin. This is the preferred
manner in which to cause contact of the pest with the toxin. The
result is a control (killing or making sick) of the pest.
Alternatively, suitable microbial hosts, e.g., Pseudomonas such as
P. fluorescens, can be applied to the situs of the pest, where some
of which can proliferate, and are ingested by the target pests. The
microbe hosting the toxin gene can be treated under conditions that
prolong the activity of the toxin and stabilize the cell. The
treated cell, which retains the toxic activity, then can be applied
to the environment of the target pest.
[0245] In preferred embodiments, recombinant plant cells and plants
are used. Preferred plants (and plant cells) are corn and/or
maize.
[0246] Where the B.t. toxin gene is introduced via a suitable
vector into a microbial host, and said host is applied to the
environment in a living state, certain host microbes should be
used. Microorganism hosts are selected which are known to occupy
the "phytosphere" (phylloplane, phyllosphere, rhizosphere, and/or
rhizoplane) of one or more crops of interest. These microorganisms
are selected so as to be capable of successfully competing in the
particular environment (crop and other insect habitats) with the
wild-type microorganisms, provide for stable maintenance and
expression of the gene expressing the polypeptide pesticide, and,
desirably, provide for improved protection of the pesticide from
environmental degradation and inactivation.
[0247] A large number of microorganisms are known to inhabit the
phylloplane (the surface of the plant leaves) and/or the
rhizosphere (the soil surrounding plant roots) of a wide variety of
important crops. These microorganisms include bacteria, algae, and
fungi. Of particular interest are microorganisms, such as bacteria,
e.g., genera Pseudomonas, Erwinia, Serratia, Klebsiella,
Xanthomonas, Streptomyces, Rhizobium, Rhodopseudomonas,
Methylophilius, Agrobacterium, Acetobacter, Lactobacillus,
Arthrobacter, Azotobacter, Leuconostoc, and Alcaligenes; fungi,
particularly yeast, e.g., genera Saccharomyces, Cryptococcus,
Kluyveromyces, Sporobolomyces, Rhodotorula, and Aureobasidium. Of
particular interest are such phytosphere bacterial species as
Pseudomonas syringae, Pseudomonas fluorescens, Serratia marcescens,
Acetobacter xylinum, Agrobacterium tumefaciens, Rhodopseudomonas
spheroides, Xanthomonas campestris, Rhizobium melioti, Alcaligenes
entrophus, and Azotobacter vinlandii; and phytosphere yeast species
such as Rhodotorula rubra, R. glutinis, R. marina, R. aurantiaca,
Cryptococcus albidus, C. diffluens, C. laurentii, Saccharomyces
rosei, S. pretoriensis, S. cerevisiae, Sporobolomyces roseus, S.
odorus, Kluyveromyces veronae, and Aureobasidium pollulans. Of
particular interest are the pigmented microorganisms.
[0248] A wide variety of ways are available for introducing a B.t.
gene encoding a toxin into the target host under conditions which
allow for stable maintenance and expression of the gene. These
methods are well known to those skilled in the art and are
described, for example, in U.S. Pat. No. 5,135,867, which is
incorporated herein by reference.
[0249] Treatment of cells. As mentioned above, B.t. or recombinant
cells expressing a B.t. toxin can be treated to prolong the toxin
activity and stabilize the cell. The pesticide microcapsule that is
formed comprises the B.t. toxin within a cellular structure that
has been stabilized and will protect the toxin when the
microcapsule is applied to the environment of the target pest.
Suitable host cells may include either prokaryotes or eukaryotes,
normally being limited to those cells which do not produce
substances toxic to higher organisms, such as mammals. However,
organisms which produce substances toxic to higher organisms could
be used, where the toxic substances are unstable or the level of
application sufficiently low as to avoid any possibility of
toxicity to a mammalian host. As hosts, of particular interest will
be the prokaryotes and the lower eukaryotes, such as fungi.
[0250] The cell will usually be intact and be substantially in the
proliferative form when treated, rather than in a spore form,
although in some instances spores may be employed.
[0251] Treatment of the microbial cell, e.g., a microbe containing
the B.t. toxin gene, can be by chemical or physical means, or by a
combination of chemical and/or physical means, so long as the
technique does not deleteriously affect the properties of the
toxin, nor diminish the cellular capability of protecting the
toxin. Examples of chemical reagents are halogenating agents,
particularly halogens of atomic no. 17-80. More particularly,
iodine can be used under mild conditions and for sufficient time to
achieve the desired results. Other suitable techniques include
treatment with aldehydes, such as glutaraldehyde; anti-infectives,
such as zephiran chloride and cetylpyridinium chloride; alcohols,
such as isopropyl and ethanol; various histologic fixatives, such
as Lugol iodine, Bouin's fixative, various acids and Helly's
fixative (See: Humason, Gretchen L., Animal Tissue Techniques, W.H.
Freeman and Company, 1967); or a combination of physical (heat) and
chemical agents that preserve and prolong the activity of the toxin
produced in the cell when the cell is administered to the host
environment. Examples of physical means are short wavelength
radiation such as gamma-radiation and X-radiation, freezing, UV
irradiation, lyophilization, and the like. Methods for treatment of
microbial cells are disclosed in U.S. Pat. Nos. 4,695,455 and
4,695,462, which are incorporated herein by reference.
[0252] The cells generally will have enhanced structural stability
which will enhance resistance to environmental conditions. Where
the pesticide is in a proform, the method of cell treatment should
be selected so as not to inhibit processing of the proform to the
mature form of the pesticide by the target pest pathogen. For
example, formaldehyde will crosslink proteins and could inhibit
processing of the proform of a polypeptide pesticide. The method of
treatment should retain at least a substantial portion of the
bio-availability or bioactivity of the toxin.
[0253] Characteristics of particular interest in selecting a host
cell for purposes of production include ease of introducing the
B.t. gene into the host, availability of expression systems,
efficiency of expression, stability of the pesticide in the host,
and the presence of auxiliary genetic capabilities. Characteristics
of interest for use as a pesticide microcapsule include protective
qualities for the pesticide, such as thick cell walls,
pigmentation, and intracellular packaging or formation of inclusion
bodies; survival in aqueous environments; lack of mammalian
toxicity; attractiveness to pests for ingestion; ease of killing
and fixing without damage to the toxin; and the like. Other
considerations include ease of formulation and handling, economics,
storage stability, and the like.
[0254] Growth of cells. The cellular host containing the B.t.
insecticidal gene may be grown in any convenient nutrient medium,
preferably where the DNA construct provides a selective advantage,
providing for a selective medium so that substantially all or all
of the cells retain the B.t. gene. These cells may then be
harvested in accordance with conventional ways. Alternatively, the
cells can be treated prior to harvesting.
[0255] The B.t. cells of the invention can be cultured using
standard art media and fermentation techniques. Upon completion of
the fermentation cycle the bacteria can be harvested by first
separating the B.t. spores and crystals from the fermentation broth
by means well known in the art. The recovered B.t. spores and
crystals can be formulated into a wettable powder, liquid
concentrate, granules or other formulations by the addition of
surfactants, dispersants, inert carriers, and other components to
facilitate handling and application for particular target pests.
These formulations and application procedures are all well known in
the art.
[0256] Formulations. Formulated bait granules containing an
attractant and spores and crystals of the B.t. isolates, or
recombinant microbes comprising the genes obtainable from the B.t.
isolates disclosed herein, can be applied to the soil. Formulated
product can also be applied as a seed-coating or root treatment or
total plant treatment at later stages of the crop cycle. Plant and
soil treatments of B.t. cells may be employed as wettable powders,
granules or dusts, by mixing with various inert materials, such as
inorganic minerals (phyllosilicates, carbonates, sulfates,
phosphates, and the like) or botanical materials (powdered
corncobs, rice hulls, walnut shells, and the like). The
formulations may include spreader-sticker adjuvants, stabilizing
agents, other Pesticidal additives, or surfactants. Liquid
formulations may be aqueous-based or non-aqueous and employed as
foams, gels, suspensions, emulsifiable concentrates, or the like.
The ingredients may include rheological agents, surfactants,
emulsifiers, dispersants, or polymers.
[0257] As would be appreciated by a person skilled in the art, the
pesticidal concentration will vary widely depending upon the nature
of the particular formulation, particularly whether it is a
concentrate or to be used directly. The pesticide will be present
in at least 1% by weight and may be 100% by weight. The dry
formulations will have from about 1-95% by weight of the pesticide
while the liquid formulations will generally be from about 1-60% by
weight of the solids in the liquid phase. The formulations will
generally have from about 10.sup.2 to about 10.sup.4 cells/mg.
These formulations will be administered at about 50 mg (liquid or
dry) to 1 kg or more per hectare.
[0258] The formulations can be applied to the environment of the
pest, e.g., soil and foliage, by spraying, dusting, sprinkling, or
the like.
[0259] Mutants. Mutants of the isolates of the invention can be
made by procedures well known in the art. For example, an
asporogenous mutant can be obtained through ethylmethane sulfonate
(EMS) mutagenesis of an isolate. The mutants can be made using
ultraviolet light and nitrosoguanidine by procedures well known in
the art.
[0260] A smaller percentage of the asporogenous mutants will remain
intact and not lyse for extended fermentation periods; these
strains are designated lysis minus (!). Lysis minus strains can be
identified by screening asporogenous mutants in shake flask media
and selecting those mutants that are still intact and contain toxin
crystals at the end of the fermentation. Lysis minus strains are
suitable for a cell treatment process that will yield a protected,
encapsulated toxin protein.
[0261] To prepare a phage resistant variant of said asporogenous
mutant, an aliquot of the phage lysate is spread onto nutrient agar
and allowed to dry. An aliquot of the phage sensitive bacterial
strain is then plated directly over the dried lysate and allowed to
dry. The plates are incubated at 30EC. The plates are incubated for
2 days and, at that time, numerous colonies could be seen growing
on the agar. Some of these colonies are picked and subcultured onto
nutrient agar plates. These apparent resistant cultures are tested
for resistance by cross streaking with the phage lysate. A line of
the phage lysate is streaked on the plate and allowed to dry. The
presumptive resistant cultures are then streaked across the phage
line. Resistant bacterial cultures show no lysis anywhere in the
streak across the phage line after overnight incubation at 30EC.
The resistance to phage is then reconfirmed by plating a lawn of
the resistant culture onto a nutrient agar plate. The sensitive
strain is also plated in the same manner to serve as the positive
control. After drying, a drop of the phage lysate is placed in the
center of the plate and allowed to dry. Resistant cultures showed
no lysis in the area where the phage lysate has been placed after
incubation at 30EC for 24 hours.
[0262] Following are examples which illustrate procedures for
practicing the invention. These examples should not be construed as
limiting. All percentages are by weight and all solvent mixture
proportions are by volume unless otherwise noted.
Example 1
Culturing of B.t. Isolates of the Invention
[0263] A subculture of the B.t. isolates, or mutants thereof, can
be used to inoculate the following medium, a peptone, glucose,
salts medium.
TABLE-US-00004 Bacto Peptone 7.5 g/l Glucose 1.0 g/l
KH.sub.2PO.sub.4 3.4 g/l K.sub.2HPO.sub.4 4.35 g/l Salt Solution
5.0 ml/l CaCl.sub.2 Solution 5.0 ml/l pH 7.2 Salts Solution (100
ml) MgSO.sub.4.cndot.7H.sub.2O 2.46 g MnSO.sub.4.cndot.H.sub.2O
0.04 g ZnSO.sub.4.cndot.7H.sub.2O 0.28 g FeSO.sub.4.cndot.7H.sub.2O
0.40 g CaCl.sub.2 Solution (100 ml) CaCl.sub.2.cndot.2H.sub.2O 3.66
g
[0264] The salts solution and CaCl.sub.2 solution are
filter-sterilized and added to the autoclaved and cooked broth at
the time of inoculation. Flasks are incubated at 30EC on a rotary
shaker at 200 rpm for 64 hr.
[0265] The above procedure can be readily scaled up to large
fermentors by procedures well known in the art.
[0266] The B.t. spores and/or crystals, obtained in the above
fermentation, can be isolated by procedures well known in the art.
A frequently-used procedure is to subject the harvested
fermentation broth to separation techniques, e.g.,
centrifugation.
Example 2
Activity of Sporulated Bacillus thuringiensis Cultures on Corn
Rootworm
[0267] Liquid cultures of PS 80B1, PS149B1 or PS167H2 were grown to
sporulation in shake flasks and pelleted by centrifugation. Culture
pellets were resuspended in water and assayed for activity against
corn rootworm in top load bioassays as described above. The amounts
of 14 kDa and 44.3 kDa proteins present in the culture pellets were
estimated by densitometry and used to calculate specific activity
expressed as LC.sub.50. Activity of each native B. thuringiensis
strain is presented in Table 3 (WCRW top load bioassay of B.t.
strains).
TABLE-US-00005 TABLE 3 WCRW Top Load Bioassay of B.t. Strains B.t.
strain LC.sub.50 (.PHI.g/cm.sup.2)* 95% CL Slope PS80JJ1 6 4-8 1.5
PS167H2 6 4-9 1.6 PS149B1 8 4-12 1.8 CryB cell blank 4% N/A N/A
Water blank 4% N/A N/A *Percentage mortality at top dose is
provided for controls
Example 3
Protein Purification for 45 kDa 80B1 Protein
[0268] One gram of lyophilized powder of 80B1 was suspended in 40
ml of buffer containing 80 mM Tris-Cl pH 7.8, 5 mM EDTA, 100 .mu.M
PMSF, 0.5 .mu.g/ml Leupeptin, 0.7. .mu.g/ml Pepstatin, and 40
.mu.g/ml Bestatin. The suspension was centrifuged, and the
resulting supernatant was discarded. The pellet was washed five
times using 35-40 ml of the above buffer for each wash. The washed
pellet was resuspended in 10 ml of 40% NaBr, 5 mM EDTA, 100 .mu.M
PMSF, 0.5 .mu.g/ml Leupeptin, 0.7 .mu.g/ml Pepstatin, and 40
.mu.g/ml Bestatin and placed on a rocker platform for 75 minutes.
The NaBr suspension was centrifuged, the supernatant was removed,
and the pellet was treated a second time with 40% NaBr, 5 mM EDTA,
100 .mu.M PMSF, 0.5 .mu.g/ml Leupeptin, 0.7 .mu.g/ml Pepstatin, and
40 .mu.g/ml Bestatin as above. The supernatants (40% NaBr soluble)
were combined and dialyzed against 10 mM CAPS pH 10.0, 1 mM EDTA at
4EC. The dialyzed extracts were centrifuged and the resulting
supernatant was removed. The pellet (40% NaBr dialysis pellet) was
suspended in 5 ml of H.sub.2O and centrifuged. The resultant
supernatant was removed and discarded. The washed pellet was washed
a second time in 10 ml of H.sub.2O and centrifuged as above. The
washed pellet was suspended in 1.5 ml of H.sub.2O and contained
primarily three protein bands with apparent mobilities of
approximately 47 kDa, 45 kDa, and 15 kDa when analyzed using
SDS-PAGE. At this stage of purification, the suspended 40% NaBr
dialysis pellet contained approximately 21 mg/ml of protein by
Lowry assay.
[0269] The proteins in the pellet suspension were separated using
SDS-PAGE (Laemlli, U.K. [1970]Nature 227:680) in 15% acrylamide
gels. The separated proteins were then electrophoretically blotted
to a PVDF membrane (Millipore Corp.) in 10 mM CAPS pH 11.0, 10%
MeOH at 100 V constant. After one hour the PVDF membrane was rinsed
in water briefly and placed for 3 minutes in 0.25% Coomassie blue
R-250, 50% methanol, 5% acetic acid. The stained membrane was
destained in 40% MeOH, 5% acetic acid. The destained membrane was
air-dried at room temperature (LeGendre et al. [1989] In A
Practical Guide to Protein Purification For Microsequencing, P.
Matsudaira, ed., Academic Press, New York, N.Y.). The membrane was
sequenced using automated gas phase Edman degradation (Hunkapillar,
M. W., R. M. Hewick, W. L. Dreyer, L. E. Hood [1983] Meth. Enzymol.
91:399).
[0270] The amino acid analysis revealed that the N-terminal
sequence of the 45 kDa band was as follows: Met-Leu-Asp-Thr-Asn
(SEQ ID NO:1).
[0271] The 47 kDa band was also analyzed and the N-terminal amino
acid sequence was determined to be the same 5-amino acid sequence
as SEQ ID NO:1. Therefore, the N-terminal amino acid sequences of
the 47 kDa peptide and the 45 kDa peptide were identical.
[0272] This amino acid sequence also corresponds to a sequence
obtained from a 45 kDa peptide obtained from PS80JJ1 spore/crystal
powders, using another purification protocol, with the N-terminal
sequence as follows:
Met-Leu-Asp-Thr-Asn-Lys-Val-Tyr-Glu-Ile-Ser-Asn-Leu-Ala-Asn-Gly-Leu-Tyr-T-
hr-Ser-Thr-Tyr-Leu-Ser-Leu (SEQ ID NO:2).
Example 4
Purification of the 14 kDa Peptide of PS80JJ1
[0273] 0.8 ml of the white dialysis suspension (approximately 21
mg/ml) containing the 47 kDa, 45 kDa, and 15 kDa peptides, was
dissolved in 10 ml of 40% NaBr, and 0.5 ml of 100 mM EDTA were
added. After about 18 hours (overnight), a white opaque suspension
was obtained. This was collected by centrifugation and discarded.
The supernatant was concentrated in a Centricon-30 (Amicon
Corporation) to a final volume of approximately 15 ml. The filtered
volume was washed with water by filter dialysis and incubated on
ice, eventually forming a milky white suspension. The suspension
was centrifuged and the pellet and supernatant were separated and
retained. The pellet was then suspended in 1.0 ml water
(approximately 6 mg/ml). The pellet contained substantially pure 15
kDa protein when analyzed by SDS-PAGE.
[0274] The N-terminal amino acid sequence was determined to be:
Ser-Ala-Arg-Glu-Val-His-Ile-Glu-Ile-Asn-Asn-Thr-Arg-His-Thr-Leu-Gln-Leu-G-
lu-Ala-Lys-Thr-Lys-Leu (SEQ ID NO:3).
Example 5
Bioassay of Protein
[0275] A preparation of the insoluble fraction from the dialyzed
NaBr extract of 80JJ1 containing the 47 kDa, 45 kDa, and 15 kDa
peptides was bioassayed against Western corn rootworm and were
found to exhibit significant toxin activity.
Example 6
Protein Purification and Characterization of PS149B1 45 kDa
Protein
[0276] The P1 pellet was resuspended with two volumes of deionized
water per unit wet weight, and to this was added nine volumes of
40% (w/w) aqueous sodium bromide. This and all subsequent
operations were carried out on ice or at 4-6EC. After 30 minutes,
the suspension was diluted with 36 volumes of chilled water and
centrifuged at 25,000.times.g for 30 minutes to give a pellet and a
supernatant.
[0277] The resulting pellet was resuspended in 1-2 volumes of water
and layered on a 20-40% (w/w) sodium bromide gradient and
centrifuged at 8,000.times.g for 100 minutes. The layer banding at
approximately 32% (w/w) sodium bromide (the "inclusions", or INC)
was recovered and dialyzed overnight against water using a dialysis
membrane with a 6-8 kDa MW cut-off. Particulate material was
recovered by centrifugation at 25,000.times.g, resuspended in
water, and aliquoted and assayed for protein by the method of Lowry
and by SDS-PAGE.
[0278] The resulting supernatant was concentrated 3- to 4-fold
using Centricon-10 concentrators, then dialyzed overnight against
water using a dialysis membrane with a 6-8 kDa MW cut-off.
Particulate material was recovered by centrifugation at
25,000.times.g, resuspended in water, and aliquoted and assayed for
protein by the method of Lowry and by SDS-PAGE. This fraction was
denoted as P1.P2.
[0279] The peptides in the pellet suspension were separated using
SDS-PAGE (Laemlli, U.K., supra) in 15% acrylamide gels. The
separated proteins were then electrophoretically blotted to a PVDF
membrane (Millipore Corp.) in 10 mM CAPS pH 11.0, 10% MeOH at 100 V
constant. After one hour the PVDF membrane was rinsed in water
briefly and placed for 3 minutes in 0.25% Coomassie blue R-250, 50%
methanol, 5% acetic acid. The stained membrane was destained in 40%
MeOH, 5% acetic acid. The destained membrane was air-dried at room
temperature (LeGendre et al., supra). The membrane was sequenced
using automated gas phase Edman degradation (Hunkapillar et al.,
supra).
[0280] Protein analysis indicated the presence of two major
polypeptides, with molecular weights of 47 kDa and 14 kDa.
Molecular weights were measured against standard polypeptides of
known molecular weight. This process provides only an estimate of
true molecular weight. The 47 kDa band from PS149B1 migrated on
SDS-PAGE in a manner indistinguishable from the 47 kDa protein from
PS80JJ1. Likewise, the 14 kDa band from PS149B1 migrated on
SDS-PAGE in a manner indistinguishable from 14 kDa bands from
PS167H2 and PS80JJ1. Apart from these two polypeptides, which were
estimated to account for 25-35% (47 kDa) and 35-55% (15 kDa) of the
Coomassie staining material respectively, there may be minor bands,
including those of estimated MW at 46 kDa, 130 kDa, and 70 kDa.
[0281] Protein analysis indicated that fraction INC contained a
single polypeptide with MW of 47 kDa, and that fraction P1.P2
contained a single polypeptide with MW of 14 kDa. These
polypeptides were recovered in yields greater than 50% from P1.
[0282] The N-terminal amino acid sequence for the purified 47 kDa
protein from PS149B1 is:
Met-Leu-Asp-Thr-Asn-Lys-Val-Tyr-Glu-Ile-Ser-Asn-His-Ala-Asn-Gly-Leu-Tyr-A-
la-Ala-Thr-Tyr-Leu-Ser-Leu (SEQ ID NO:4).
[0283] The N-terminal amino acid sequence for the purified 14 kDa
protein from PS149B1 is:
Ser-Ala-Arg-Glu-Val-His-Ile-Asp-Val-Asn-Asn-Lys-Thr-Gly-His-Thr-Leu-Gln-L-
eu-Glu-Asp-Lys-Thr-Lys-Leu-Asp-Gly-Gly-Arg-Trp-Arg-Thr-Ser-Pro-Xaa-Asn-Val-
-Ala-Asn-Asp-Gln-Ile-Lys-Thr-Phe-Val-Ala-Glu-Ser-Asn (SEQ ID
NO:5).
Example 7
Amino Acid Sequence for 45 kDa and 14 kDa Toxins of PS167H2
[0284] The N-terminal amino acid sequence for the purified 45 kDa
protein from PS167H2 is:
Met-Leu-Asp-Thr-Asn-Lys-Ile-Tyr-Glu-Ile-Ser-Asn-Tyr-Ala-Asn-Gly-Leu-His-A-
la-Ala-Thr-Tyr-Leu-Ser-Leu (SEQ ID NO:6).
[0285] The N-terminal amino acid sequence for the purified 14 kDa
protein from PS167H2 is:
Ser-Ala-Arg-Glu-Val-His-Ile-Asp-Val-Asn-Asn-Lys-Thr-Gly-His-Thr-Leu-Gln-L-
eu-Glu-Asp-Lys-Thr-Lys-Leu (SEQ ID NO:7).
[0286] These amino acid sequences can be compared to the sequence
obtained for the 47 kDa peptide obtained from 80JJ1 spore/crystal
powders with the N-terminal sequence (SEQ ID NO:1) and to the
sequence obtained for the 14 kDa peptide obtained from 80JJ1
spore/crystal powders with the N-terminal sequence (SEQ ID
NO:3).
[0287] Clearly, the 45-47 kDa proteins are highly related, and the
14 kDa proteins are highly related.
Example 8
Bioassay of Protein
[0288] The purified protein fractions from PS149B1 were bioassayed
against western corn rootworm and found to exhibit significant
toxin activity when combined. In fact, the combination restored
activity to that noted in the original preparation (P1). The
following bioassay data set presents percent mortality and
demonstrates this effect.
TABLE-US-00006 TABLE 4 Concentration (.mu.g/cm.sup.2) P1 INC P1 P2
INC + P1 P2 300 88, 100, 94 19 13 100 100 94, 50, 63 31 38 94 33.3
19, 19, 44 38 13 50 11.1 13, 56, 25 12 31 13 3.7 0, 50, 0 0 31 13
1.2 13, 43, 12 0 12 19 0.4 6, 12, 6 25 19 6
Example 9
Molecular Cloning, Expression, and DNA Sequence Analysis of a Novel
.delta.-Endotoxin Gene from Bacillus thuringiensis Strain
PS80JJ1
[0289] Total cellular DNA was prepared from Bacillus thuringiensis
(B.t.) cells grown to an optical density, at 600 nm, of 1.0. Cells
were pelleted by centrifugation and resuspended in protoplast
buffer (20 mg/ml lysozyme in 0.3 M sucrose, 25 mM Tris-Cl [pH 8.0],
25 mM EDTA). After incubation at 37EC for 1 hour, protoplasts were
lysed by two cycles of freezing and thawing. Nine volumes of a
solution of 0.1 M NaCl, 0.1% SDS, 0.1 M Tris-Cl were added to
complete lysis. The cleared lysate was extracted twice with
phenol:chloroform (1:1). Nucleic acids were precipitated with two
volumes of ethanol and pelleted by centrifugation. The pellet was
resuspended in TE buffer and RNase was added to a final
concentration of 50 .mu.g/ml. After incubation at 37EC for 1 hour,
the solution was extracted once each with phenol:chloroform (1:1)
and TE-saturated chloroform. DNA was precipitated from the aqueous
phase by the addition of one-tenth volume of 3 M NaOAc and two
volumes of ethanol. DNA was pelleted by centrifugation, washed with
70% ethanol, dried, and resuspended in TE buffer.
[0290] An oligonucleotide probe for the gene encoding the PS80JJ1
45 kDa toxin was designed from N-terminal peptide sequence data.
The sequence of the 29-base oligonucleotide probe was:
TABLE-US-00007 (SEQ ID NO: 8) 5N-ATG YTW GAT ACW AAT AAA GTW TAT
GAA AT-3N
[0291] This oligonucleotide was mixed at four positions as shown.
This probe was radiolabeled with .sup.32P and used in standard
condition hybridization of Southern blots of PS80JJ1 total cellular
DNA digested with various restriction endonucleases. Representative
autoradiographic data from these experiments showing the sizes of
DNA restriction fragments containing sequence homology to the 44.3
kDa toxin oligonucleotide probe of SEQ ID NO:8 are presented in
Table 5.
TABLE-US-00008 TABLE 5 RFLP of PS80JJ1 cellular DNA fragments on
Southern blots that hybridized under standard conditions with the
44.3 kDa toxin gene oligonucleotide probe (SEQ ID NO:8) Restriction
Enzyme Approximate Fragment Size (kbp) EcoRI 6.0 HindIII 8.3 KpnI
7.4 PstI 11.5 XbaI 9.1
These DNA fragments identified in these analyses contain all or a
segment of the PS80JJ1 45 kDa toxin gene. The approximate sizes of
the hybridizing DNA fragments in Table 5 are in reasonable
agreement with the sizes of a subset of the PS80JJ1 fragments
hybridizing with a PS80JJ1 45 kDa toxin subgene probe used in
separate experiments, as predicted (see Table 6, below).
[0292] A gene library was constructed from PS80JJ1 DNA partially
digested with Sau3AI. Partial restriction digests were fractionated
by agarose gel electrophoresis. DNA fragments 9.3 to 23 kbp in size
were excised from the gel, electroeluted from the gel slice,
purified on an Elutip-Dion exchange column (Schleicher and Schuell,
Keene, N. H.), and recovered by ethanol precipitation. The Sau3AI
inserts were ligated into BamHI-digested LambdaGem-11 (Promega,
Madison, Wis.). Recombinant phage were packaged and plated on E.
coli KW251 cells. Plaques were screened by hybridization with the
oligonucleotide probe described above. Hybridizing phage were
plaque-purified and used to infect liquid cultures of E. coli KW251
cells for isolation of DNA by standard procedures (Maniatis et al.,
supra).
[0293] Southern blot analysis revealed that one of the recombinant
phage isolates contained an approximately 4.8 kbp XbaI-SacI band
that hybridized to the PS80JJ1 toxin gene probe. The SacI site
flanking the PS80JJ1 toxin gene is a phage vector cloning site,
while the flanking XbaI site is located within the PS80JJ1 DNA
insert. This DNA restriction fragment was subcloned by standard
methods into pBluescript S/K (Stratagene, San Diego, Calif.) for
sequence analysis. The resultant plasmid was designated pMYC2421.
The DNA insert was also subcloned into pHTBlueII (an E. coli/B.
thuringiensis shuttle vector comprised of pBluescript S/K
[Stratagene, La Jolla, Calif.] and the replication origin from a
resident B.t. plasmid [D. Lereclus et al. (1989) FEMS Microbiology
Letters 60:211-218]) to yield pMYC2420.
[0294] An oligonucleotide probe for the gene encoding the PS80JJ1
14 kDa toxin was designed from N-terminal peptide sequence data.
The sequence of the 28-base oligonucleotide probe was:
TABLE-US-00009 (SEQ ID NO: 29) 5N GW GAA GTW CAT ATW GAA ATW AAT
AAT AC 3N.
This oligonucleotide was mixed at four positions as shown. The
probe was radiolabelled with .sup.32P and used in standard
condition hybridizations of Southern blots of PS80JJ1 total
cellular and pMYC2421 DNA digested with various restriction
endonucleases. These RFLP mapping experiments demonstrated that the
gene encoding the 14 kDa toxin is located on the same genomic EcoRI
fragment that contains the N-terminal coding sequence for the 44.3
kDa toxin.
[0295] To test expression of the PS80JJ1 toxin genes in B.t.,
pMYC2420 was transformed into the acrystalliferous (Cry-) B.t.
host, CryB (A. Aronson, Purdue University, West Lafayette, Ind.),
by electroporation. Expression of both the approximately 14 and
44.3 kDa PS80JJ1 toxins encoded by pMYC2420 was demonstrated by
SDS-PAGE analysis. Toxin crystal preparations from the recombinant
CryB[pMYC2420] strain, MR536, were assayed and found to be active
against western corn rootworm.
[0296] The PS80JJ1 toxin genes encoded by pMYC2421 were sequenced
using the ABI373 automated sequencing system and associated
software. The sequence of the entire genetic locus containing both
open reading frames and flanking nucleotide sequences is shown in
SEQ ID NO:30. The termination codon of the 14 kDa toxin gene is 121
base pairs upstream (5N) from the initiation codon of the 44.3 kDa
toxin gene (FIG. 2). The PS80JJ1 14 kDa toxin open reading frame
nucleotide sequence (SEQ ID NO:31), the 44.3 kDa toxin open reading
frame nucleotide sequence (SEQ ID NO:10), and the respective
deduced amino acid sequences (SEQ ID NO:32 and SEQ ID NO:11) are
novel compared to other toxin genes encoding pesticidal
proteins.
[0297] Thus, the nucleotide sequence encoding the 14 kDa toxin of
PS80JJ1 is shown in SEQ ID NO:31. The deduced amino acid sequence
of the 14 kDa toxin of PS80JJ1 is shown in SEQ ID NO:32. The
nucleotide sequences encoding both the 14 and 45 kDa toxins of
PS80JJ1, as well as the flanking sequences, are shown in SEQ ID
NO:30. The relationship of these sequences is shown in FIG. 2.
[0298] A subculture of E. coli NM522 containing plasmid pMYC2421
was deposited in the permanent collection of the Patent Culture
Collection (NRRL), Regional Research Center, 1815 North University
Street, Peoria, Ill. 61604 USA on Mar. 28, 1996. The accession
number is NRRL B-21555.
Example 10
RFLP and PCR Analysis of Additional Novel .delta.-Endotoxin Genes
from Bacillus thuringiensis Strains PS149B1 and PS167H2
[0299] Two additional strains active against corn rootworm, PS149B1
and PS167H2, also produce parasporal protein crystals comprised in
part of polypeptides approximately 14 and 45 kDa in size. Southern
hybridization and partial DNA sequence analysis were used to
examine the relatedness of these toxins to the 80B1 toxins. DNA was
extracted from these B.t. strains as described above, and standard
Southern hybridizations were performed using the 14 kDa toxin
oligonucleotide probe (SEQ ID NO:29) and an approximately 800 by
PCR fragment of the 80JJ1 44.3 kDa toxin gene-encoding sequence.
RFLP data from these experiments showing the sizes of DNA
restriction fragments containing sequence homology to the 44.3 kDa
toxin are presented in Table 6. RFLP data from these experiments
showing the sizes of DNA restriction fragments containing sequence
homology to the approximately 14 kDa toxin are presented in Table
7.
TABLE-US-00010 TABLE 6 RFLP of PS80JJ1, PS149B1, and PS167H2
cellular DNA fragments on Southern blots that hybridized with the
approximately 800 bp PS80JJ1 44.3 kDa toxin subgene probe under
standard conditions Strain PS80JJ1 PS149B1 PS167H2 Approximate
Restriction enzyme fragment size (kbp) EcoRI 6.4 5.7 2.6 1.3 2.8
0.6 HindIII 8.2 6.2 4.4 KpnI 7.8 10.0 11.5 PstI 12.0 9.2 9.2 8.2
XbaI 9.4 10.9 10.9 SacI 17.5 15.5 11.1 13.1 10.5 6.3
[0300] Each of the three strains exhibited unique RFLP patterns.
The hybridizing DNA fragments from PS149B1 or PS167H2 contain all
or part of toxin genes with sequence homology to the PS80B1 44.3
kDa toxin.
TABLE-US-00011 TABLE 7 Restriction fragment length polymorphisms of
PS80JJ1, PS149B1, and PS167H2 cellular DNA fragments on Southern
blots that hybridized with the PS80JJ1 14 kDa toxin oligonucleotide
probe under standard conditions Strain PS80JJ1 PS149B1 PS167H2
Approximate Restriction enzyme fragment size (kbp) EcoRI 5.6 2.7
2.7 HindIII 7.1 6.0 4.7 XbaI 8.4 11.2 11.2
[0301] Each of the three strains exhibited unique RFLP patterns.
The hybridizing DNA fragments from PS149B1 or PS167H2 contain all
or part of toxin genes with sequence homology to the PS80B1 14 kDa
toxin gene.
[0302] Portions of the toxin genes in PS or PS167H2 were amplified
by PCR using forward and reverse oligonucleotide primer pairs
designed based on the PS80JJ1 44.3 kDa toxin gene sequence. For
PS149B1, the following primer pair was used:
TABLE-US-00012 Forward: (SEQ ID NO: 8) 5N-ATG YTW GAT ACW AAT AAA
GTW TAT GAA AT-3N Reverse: (SEQ ID NO: 9) 5N-GGA TTA TCT ATC TCT
GAG TGT TCT TG-3N
For PS167H2, the same primer pair was used. These PCR-derived
fragments were sequenced using the ABI373 automated sequencing
system and associated software. The partial gene and peptide
sequences obtained are shown in SEQ ID NO:12-15. These sequences
contain portions of the nucleotide coding sequences and peptide
sequences for novel corn rootworm-active toxins present in B.t.
strains PS149B1 or PS167H2.
Example 11
Molecular Cloning and DNA Sequence Analysis of Novel
.delta.-Endotoxin Genes from Bacillus thuringiensis Strains PS and
PS167H2
[0303] Total cellular DNA was extracted from strains PS149B1 and
PS167H2 as described for PS80B1. Gene libraries of
size-fractionated Sau3A partial restriction fragments were
constructed in Lambda-Gem11 for each respective strain as
previously described. Recombinant phage were packaged and plated on
E. coli KW251 cells. Plaques were screened by hybridization with
the oligonucleotide probe specific for the 44 kDa toxin gene.
Hybridizing phage were plaque-purified and used to infect liquid
cultures of E. coli KW251 cells for isolation of DNA by standard
procedures (Maniatis et al., supra).
[0304] For PS167H2, Southern blot analysis revealed that one of the
recombinant phage isolates contained an approximately 4.0 to 4.4
kbp HindIII band that hybridized to the PS80B1 44 kDa toxin gene 5N
oligonucleotide probe (SEQ ID NO:8). This DNA restriction fragment
was subcloned by standard methods into pBluescript S/K (Stratgene,
San Diego, Calif.) for sequence analysis. The fragment was also
subcloned into the high copy number shuttle vector, pHT370
(Arantes, O., D. Lereclus [1991] Gene 108:115-119) for expression
analyses in Bacillus thuringiensis (see below). The resultant
recombinant, high copy number bifunctional plasmid was designated
pMYC2427.
[0305] The PS167H2 toxin genes encoded by pMYC2427 were sequenced
using the ABI automated sequencing system and associated software.
The sequence of the entire genetic locus containing both open
reading frames and flanking nucleotide sequences is shown in SEQ ID
NO:34. The termination codon of the 14 kDa toxin gene is 107 base
pairs upstream (5N) from the initiation codon of the 44 kDa toxin
gene. The PS167H2 14 kDa toxin coding sequence (SEQ ID NO:35), the
44 kDa toxin coding sequence (SEQ ID NO:37), and the respective
deduced amino acid sequences, SEQ ID NO:36 and SEQ ID NO:38, are
novel compared to other known toxin genes encoding pesticidal
proteins. The toxin genes are arranged in a similar manner to, and
have some homology with, the PS80JJ1 14 and 44 kDa toxins.
[0306] A subculture of E. coli NM522 containing plasmid pMYC2427
was deposited in the permanent collection of the Patent Culture
Collection (NRRL), Regional Research Center, 1815 North University
Street, Peoria, Ill. 61604 USA on 26 Mar. 1997. The accession
number is NRRL B-21672.
[0307] For PS149B1, Southern blot analysis using the PS80B1 44 kDa
oligonucleotide 5N probe (SEQ ID NO:8) demonstrated hybridization
of an approximately 5.9 kbp ClaI DNA fragment. Complete ClaI
digests of PS149B1 genomic DNA were size fractionated on agarose
gels and cloned into pHTBlueII. The fragment was also subcloned
into the high copy number shuttle vector, pHT370 (Arantes, O., D.
Lereclus [1991] Gene 108:115-119) for expression analyses in
Bacillus thuringiensis (see below). The resultant recombinant, high
copy number bifunctional plasmid was designated pMYC2429.
[0308] The PS149B1 toxin genes encoded by pMYC2429 were sequenced
using the ABI automated sequencing system and associated software.
The sequence of the entire genetic locus containing both open
reading frames and flanking nucleotide sequences is shown in SEQ ID
NO:39. The termination codon of the 14 kDa toxin gene is 108 base
pairs upstream (5N) from the initiation codon of the 44 kDa toxin
gene. The PS149B1 14 kDa toxin coding sequence (SEQ ID NO:40), the
44 kDa toxin coding sequence (SEQ ID NO:42), and the respective
deduced amino acid sequences, SEQ ID NO:41 and SEQ ID NO:43, are
novel compared to other known toxin genes encoding pesticidal
proteins. The toxin genes are arranged in a similar manner as, and
have some homology with, the PS80JJ1 and PS167H2 14 and 44 kDa
toxins. Together, these three toxin operons comprise a new family
of pesticidal toxins.
[0309] A subculture of E. coli NM522 containing plasmid pMYC2429
was deposited in the permanent collection of the Patent Culture
Collection (NRRL), Regional Research Center, 1815 North University
Street, Peoria, Ill. 61604 USA on 26 Mar. 1997. The accession
number is NRRL B-21673.
Example 12
PCR Amplification for Identification and Cloning Novel Corn
Rootworm-Active Toxin
[0310] The DNA and peptide sequences of the three novel
approximately 45 kDa corn rootworm-active toxins from PS80JJ1,
PS149B1, and PS167H2 (SEQ ID NOS. 12-15) were aligned with the
Genetics Computer Group sequence analysis program Pileup using a
gap weight of 3.00 and a gap length weight of 0.10. The sequence
alignments were used to identify conserved peptide sequences to
which oligonucleotide primers were designed that were likely to
hybridize to genes encoding members of this novel toxin family.
Such primers can be used in PCR to amplify diagnostic DNA fragments
for these and related toxin genes. Numerous primer designs to
various sequences are possible, four of which are described here to
provide an example. These peptide sequences are:
TABLE-US-00013 Asp-Ile-Asp-Asp-Tyr-Asn-Leu (SEQ ID NO: 16)
Trp-Phe-Leu-Phe-Pro-Ile-Asp (SEQ ID NO: 17)
Gln-Ile-Lys-Thr-Thr-Pro-Tyr-Tyr (SEQ ID NO: 18)
Tyr-Glu-Trp-Gly-Thr-Glu. (SEQ ID NO: 19)
The corresponding nucleotide sequences are:
TABLE-US-00014 5N-GATATWGATGAYTAYAAYTTR-3N (SEQ ID NO: 20)
5N-TGGTTTTTRTTTCCWATWGAY-3N (SEQ ID NO: 21)
5N-CAAATHAAAACWACWCCATATTAT-3N (SEQ ID NO: 22)
5N-TAYGARTGGGGHACAGAA-3N. (SEQ ID NO: 23)
Forward primers for polymerase amplification in thermocycle
reactions were designed based on the nucleotide sequences of SEQ ID
NOs:20 and 21.
[0311] Reverse primers were designed based on the reverse
complement of SEQ ID NOs:22 and 23:
TABLE-US-00015 5N-ATAATATGGWGTWGTTTTDATTTG-3N (SEQ ID NO: 24)
5N-TTCTGTDCCCCAYTCRTA-3N. (SEQ ID NO: 25)
These primers can be used in combination to amplify DNA fragments
of the following sizes (Table 8) that identify genes encoding novel
corn rootworm toxins.
TABLE-US-00016 TABLE 8 Predicted sizes of diagnostic DNA fragments
(base pairs) amplifiable with primers specific for novel corn
rootworm-active toxins Primer pair (SEQ ID NO.) DNA fragment size
(bp) 20 + 24 495 20 + 25 594 21 + 24 471 21 + 25 580
[0312] Similarly, entire genes encoding novel corn rootworm-active
toxins can be isolated by polymerase amplification in thermocycle
reactions using primers designed based on DNA sequences flanking
the open reading frames. For the PS80JJ1 44.3 kDa toxin, one such
primer pair was designed, synthesized, and used to amplify a
diagnostic 1613 by DNA fragment that included the entire toxin
coding sequence. These primers are:
TABLE-US-00017 (SEQ ID NO: 26) Forward: 5N-CTCAAAGCGGATCAGGAG-3N
(SEQ ID NO: 27) Reverse: 5N-GCGTATTCGGATATGCTTGG-3N.
For PCR amplification of the PS80JJ1 14 kDa toxin, the
oligonucleotide coding for the N-terminal peptide sequence (SEQ ID
NO:29) can be used in combination with various reverse
oligonucleotide primers based on the sequences in the PS80JJ1 toxin
gene locus. One such reverse primer has the following sequence:
TABLE-US-00018 5N CATGAGATTTATCTCCTGATCCGC 3N. (SEQ ID NO: 33)
When used in standard PCR reactions, this primer pair amplified a
diagnostic 1390 by DNA fragment that includes the entire 14 kDa
toxin coding sequence and some 3N flanking sequences corresponding
to the 121 base intergenic spacer and a portion of the 44.3 kDa
toxin gene. When used in combination with the 14 kDa forward
primer, PCR will generate a diagnostic 322 base pair DNA
fragment.
Example 13
Clone Dose-Response Bioassays
[0313] The PS80B1 toxin operon was subcloned from pMYC2421 into
pHT370 for direct comparison of bioactivity with the recombinant
toxins cloned from PS149B1 and PS167H2. The resultant recombinant,
high copy number bifunctional plasmid was designated pMYC2426.
[0314] A subculture of E. coli NM522 containing plasmid pMYC2426
was deposited in the permanent collection of the Patent Culture
Collection (NRRL), Regional Research Center, 1815 North University
Street, Peoria, Ill. 61604 USA on 26 Mar. 1997. The accession
number is NRRL B-21671.
[0315] To test expression of the PS 80B1, PS and PS167H2 toxin
genes in B.t., pMYC2426, pMYC2427 and pMYC2429 were separately
transformed into the acrystalliferous (Cry-) B.t. host, CryB (A.
Aronson, Purdue University, West Lafayette, Ind.), by
electroporation. The recombinant strains were designated MR543
(CryB [pMYC2426]), MR544 (CryB [pMYC2427]) and MR546 (CryB
[pMYC2429]), respectively. Expression of both the approximately 14
and 44 kDa toxins was demonstrated by SDS-PAGE analysis for each
recombinant strain.
[0316] Toxin crystal preparations from the recombinant strains were
assayed against western corn rootworm. Their diet was amended with
sorbic acid and SIGMA pen-strep-ampho-B. The material was
top-loaded at a rate of 50 .mu.l of suspension per cm.sup.2 diet
surface area. Bioassays were run with neonate Western corn rootworm
larvae for 4 days at approximately 25EC. Percentage mortality and
top-load LC.sub.50 estimates for the clones (pellets) are set forth
in Table 9. A dH2O control yielded 7% mortality.
TABLE-US-00019 TABLE 9 Percentage mortality at given protein
concentration (.mu.g/cm.sup.2) Sample 50 .mu.g/cm.sup.2 5
.mu.g/cm.sup.2 0.5 .mu.g/cm.sup.2 MR543 pellet 44% 19% 9% MR544
pellet 72% 32% 21% MR546 pellet 52% 32% 21%
[0317] The amounts of 14 kDa and 44.3 kDa proteins present in the
crystal preparations were estimated by densitometry and used to
calculate specific activity expressed as LC.sub.50. LC.sub.50
estimates for the clones (pellets) are set forth in Table 10 (WCRW
top load bioassay of B.t. clones).
TABLE-US-00020 TABLE 10 WCRW Top Load Bioassay of B. t. Clones B.
t. Parental B. t. Clone Strain LC.sub.50 (.PHI.g/cm.sup.2)* 95% CL
Slope MR543 PS80JJ1 37 17-366* 0.79 MR544 PS167H2 10 6-14 1.6 MR546
PS149B1 8 4-12 1.5 N/A CryB cell blank 4% N/A N/A N/A Water blank
4% N/A N/A *Percentage mortality at top dose is provided for
controls **90% CL
Example 14
Mutational Analysis of the 14 and 44 kDa Polypeptides in the
PS80JJ1 Binary Toxin Operon
[0318] Binary toxin genes of the subject invention are, in their
wild-type state, typically arranged in an operon wherein the 14 kDa
protein gene is transcribed first, followed by that of the 45 kDa
protein gene. These genes are separated by a relatively short,
non-coding region. Representative ORFs are shown in SEQ ID NO:30,
SEQ ID NO:34, and SEQ ID NO:39.
[0319] In order to investigate the contribution of the individual
14 and 44.3 kDa crystal proteins to corn rootworm activity, each
gene in the PS80JJ1 operon was mutated in separate experiments to
abolish expression of one of the proteins. The intact gene was then
expressed in B.t. and recombinant proteins were tested for activity
against corn rootworm.
[0320] First, the 44.3 kDa gene encoded on pMYC2421 was mutated by
truncation at the EcoRI site at base position 387 of the open
reading frame. This truncation and subsequent ligation with vector
sequences resulted in an open reading frame encoding an
approximately 24 kDa hypothetical fusion protein. The resulting
operon encoding the intact 14 kDa gene and the truncated 45 kDa
gene was subcloned into the high copy number shuttle vector, pHT370
(Arantes, O., D. Lereclus [1991] Gene 108:115-119) for expression
analyses in Bacillus thuringiensis. The resulting plasmid, pMYC2424
was transformed into the acrystalliferous (Cry-) B.t. host, CryB
(A. Aronson, Purdue University, West Lafayette, Ind.), by
electroporation. The resulting recombinant strain was designated
MR541. Only the 14 kDa PS80B1 protein was detectable by SDSPAGE
analysis of sporulated cultures of MR541. Mortality was not
observed for preparations of MR541 expressing only the 14 kDa
PS80B1 protein in top-load bioassays against corn rootworm.
[0321] Next, the 14 kDa gene encoded on pMYC2421 was mutated by
insertion of an oligonucleotide linker containing termination
codons in all possible reading frames at the Nrul site at base
position 11 of the open reading frame. The sequence of this linker
is 5' TGAGTAACTAGATCTATTCAATTA 3'. The linker introduces a BglII
site for confirmation of insertion by BglII restriction digestion.
Plasmid clones containing the mutagenic linker were identified with
BglII and sequenced for verification. The operon insert encoding
the 14 kDa nonsense mutations was subcloned into pHT370, resulting
in plasmid pMYC2425. This plasmid was transformed into CryB by
electroporation to yield the recombinant B.t. strain MR542. Only
the 44.3 kDa PS80B1 protein was expressed in sporulated cultures of
MR542 as shown by SDSPAGE analysis. Mortality against corn rootworm
was not observed for preparations of MR542 expressing only the 44.3
kDa PS80JJ1 protein.
Example 15
Single Gene Heterologous Expression, Purification and Bioassay of
the 14 and 44.3 kDa Polypeptides from PS in Pseudomonas
fluorescens
[0322] The 14 kDa and 44.3 kDa polypeptide genes from PS were
separately engineered into plasmid vectors by standard DNA cloning
methods, and transformed into Psuedomonas flourescens. The
recombinant Pseudomonas fluorescens strain expressing only the
PS149B1 14 kDa gene was designated MR1253. The recombinant
Pseudomonas fluorescens strain expressing only the PS149B1 44.3 kDa
gene was designated MR1256.
[0323] MR1253 and MR1256 each individually expressing one of the
two binary proteins were grown in 1 L fermentation tanks A portion
of each culture was then pelleted by centrifugation, lysed with
lysozyme, and treated with DNAse I to obtain semi-pure protein
inclusions. These inclusions were then solubilized in 50 mM Sodium
Citrate (pH 3.3) by gentle rocking at 4EC for 1 hour. The 14 kDa
protein dissolved readily in this buffer whereas the 44.3 kDa
protein was partially soluble. The solubilized fractions were then
centrifuged at 15,000.times.g for 20 minutes; and the supernatants
were retained.
[0324] The 14 kDa protein was further purified through ion-exchange
chromatography. The solubilized 14 kDa protein was bound to a
Econo-S column and eluted with a Sodium Chloride 0-1M gradient.
[0325] The chromatographically pure MR1253 (14 kDa protein) and the
Sodium Citrate (pH3.3) solubilized preparation of MR1256 (45 kDa
protein) were then tested for activity on corn rootworm
individually or together at a molar ratio of 1 to 10 (45 kDa
protein to 14 kDa protein). Observed mortality for each of the
proteins alone was not above background levels (of the
water/control sample) but 87% mortality resulted when they were
combined in the above ratio (see Table 11).
TABLE-US-00021 TABLE 11 Molar ratio load ug 45 kD/ ug 14 kD/ Total
ug CRW (45 kD to 14 kD) volume well well protein Mortality 0 to 1
100 ul 0 260 260 13 1 to 0 200 ul 260 0 260 9 1 to 10 100 ul 65 195
260 87 water 100 ul 0 0 0 11
Example 16
Identification of Additional Novel 14 kDa and 44.3 kDa Toxin Genes
by Hybridization of Total B.t. genomic DNA and by RFLP
[0326] Total genomic DNA from each isolate was prepared using the
Qiagen DNEasy 96 well tissue kit. DNA in 96-well plates was
denatured prior to blotting by adding 10 ul of each DNA sample and
10 ul of 4 M NaOH to 80 ul sterile distilled water. Samples were
incubated at 70EC for one hour after which 100 ul of 20.times.SSC
was added to each well. PS149B1 total genomic DNA was included with
each set of 94 samples as a positive hybridization control, and
cryB-total genomic DNA was included with each set of 94 samples as
a negative hybridization control. Each set of 96 samples was
applied to Magnacharge nylon membranes using two 48 well slot blot
manifolds (Hoefer Scientific), followed by two washes with
10.times.SSC. Membranes were baked at 80EC for one hour and kept
dry until used. Membranes were prehybridized and hybridized in
standard formamide solution (50% formamide, 5.times.SSPE,
5.times.Denhardt's solution, 2% SDS, 100 ug/ml single stranded DNA)
at 42EC. Membranes were washed under two conditions:
2.times.SSC/0.1% SDS at 42EC (low stringency) and
0.2.times.SSC/0.1% SDS at 65EC (moderate to high stringency).
Membranes were probed with an approximately 1.3 kilobase pair PCR
fragment of the PS149B1 44.3 kDa gene amplified from pMYC2429 using
forward primer SEQ ID NO:8 and a reverse primer with the sequence
5' GTAGAAGCAGAACAAGAAGGTATT 3' (SEQ ID NO:46). The probe was
radioactively labeled using the Prime-it II kit (Stratagene) and
32-P-dCTP, purified on Sephadex columns, denatured at 94EC and
added to fresh hybridization solution. Strains containing genes
with homology to the PS149B1 probe were identified by exposing
membranes to X-ray film.
[0327] The following strains were identified by positive
hybridization reactions: PS184M2, PS185GG, PS187G1, PS187Y2,
PS201G, PS201HH2, PS242K10, PS69Q, KB54A1-6, KR136, KR589,
PS185L12, PS185W3, PS185Z11, PS186L9, PS187L14, PS186FF, PS131W2,
PS147U2, PS158T3, PS158.times.10, PS185FF, PS187F3, PS198H3,
PS201H2, PS201L3, PS203G2, PS203J1, PS204C3, PS204G4, PS204111,
PS204J7, PS210B, PS213E8, PS223L2, PS224F2, PS236B6, PS246P42,
PS247C16, KR200, KR331, KR625, KR707, KR959, KR1209, KR1369,
KB2C-4, KB10H-5, KB456, KB42C17-13, KB45A43-3, KB54A33-1,
KB58A10-3, KB59A54-4, KB59A54-5, KB53B7-8, KB53B7-2, KB60F5-7,
KB60F5-11, KB59A58-4, KB60F5-15, KB61A18-1, KB65A15-2, KB65A15-3,
KB65A15-7, KB65A15-8, KB65A15-12, KB65A14-1, KB3F-3, T25,
KB53A71-6, KB65A11-2, KB68B57-1, KB63A5-3, and KB71A118-6.
[0328] Further identification and classification of novel toxin
genes in preparations of total genomic DNA was performed using the
.sup.32P-labeled probes and hybridization conditions described
above in this Example. Total genomic DNA was prepared as above or
with Qiagen Genomic-Tip 20/G and Genomic DNA Buffer Set according
to protocol for Gram positive bacteria (Qiagen Inc.; Valencia,
Calif.) was used in southern analysis. For Southern blots,
approximately 1-2 .mu.g of total genomic DNA from each strain
identified by slot blot analysis was digested with DraI and NdeI
enzymes, electrophoresed on a 0.8% agarose gel, and immobilized on
a supported nylon membrane using standard methods (Maniatis et
al.). After hybridization, membranes were washed under low
stringency (2.times.SSC/0.1% SDS at 42EC) and exposed to film. DNA
fragment sizes were estimated using BioRad Chemidoc system
software. Restriction fragment length polymorphisms were used to
(arbitrarily) classify genes encoding the 44 kDa toxin. These
classifications are set forth in Table 12.
TABLE-US-00022 TABLE 12 RFLP Class (45 & 14 kD) Isolate Strain
Name A 149B1 A' KR331, KR1209, KR1369 B 167H2, 242K10 C 184M2,
201G, 201HH2 D 185GG, 187Y2, 185FF1, 187F3 E 187G1 F 80JJ1, 186FF,
246P42 G 69Q H KB54A1-6 I KR136 J KR589 K 185L12, 185W3, 185Z11,
186L9, 187L14 L 147U2, 210B, KB10H-5, KB58A10-3, KB59A54-4,
KB59A54-5, KB59A58-4, KB65A14-1 M 158T3, 158X10 N 201H2, 201L3,
203G2, 203J1, 204C3, 204G4, 204I11, 204J7, 236B6 P 223L2, 224F2 P'
247C16, KB45A43-3, KB53B7-8, KB53B7-2, KB61A18-1, KB3F-3,
KB53A71-6, KB65A11- 2, KB68B57-1, KB63A5-3, KB71A118-6 Q 213E8,
KB60F5-11, KB60F5-15 R KR959 S KB2C-4, KB46, KB42C17-13 T
KB54A33-1, KB60F5-7 U T25 V KB65A15-2, KB65A15-3, KB65A15-7,
KB65A15-8, KB65A15-12
Example 17
DNA Sequencing of Additional Binary Toxin Genes
[0329] Degenerate oligonucleotides were designed to amplify all or
part of the 14 and 44.3 kDa genes from B.t. strains identified by
hybridization with the 149B1 PCR product described above. The
oligonucleotides were designed to conserved sequence blocks
identified by alignment of the 14 kDa or 44.3 kDa genes from
PS149B1, PS167H2 and PS80B1. Forward primers for both genes were
designed to begin at the ATG initiation codon. Reserve primers were
designed as close to the 3' end of each respective gene as
possible.
[0330] The primers designed to amplify the 14 kDa gene are as
follows:
TABLE-US-00023 149DEG1 (forward): (SEQ ID NO: 47) 5'-ATG TCA GCW
CGY GAA GTW CAY ATT G-3' 149DEG2 (reverse): (SEQ ID NO: 48) 5'-GTY
TGA ATH GTA TAH GTH ACA TG-3'
These primers amplify a product of approximately 340 base
pairs.
[0331] The primers designed to amplify the 44.3 kDa gene are as
follows:
TABLE-US-00024 (SEQ ID NO: 49) 149DEG3 (forward): 5'-ATG TTA GAT
ACW AAT AAA RTW TAT G-3' (SEQ ID NO: 50) 149DEG4 (reverse): 5'-GTW
ATT TCT TCW ACT TCT TCA TAH GAA G-3'
These primers amplify a product of approximately 1,100 base
pairs.
[0332] The PCR conditions used to amplify gene products are as
follows: [0333] 95EC, 1 min., one cycle [0334] 95EC, 1 min. [0335]
50EC, 2 min., this set repeated 35 cycles [0336] 72EC, 2 min.
[0337] 72EC, 10 min., one cycle
[0338] PCR products were fractionated on 1% agarose gels and
purified from the gel matrix using the Qiaexll kit (Qiagen). The
resulting purified fragments were ligated into the pCR-TOPO cloning
vector using the TOPO TA cloning kit (Invitrogen). After ligation,
one half of the ligation reaction was transformed into XL10 Gold
ultracompetant cells (Stratagene). Transformants were then screened
by PCR with vector primers 1212 and 1233. Clones containing inserts
were grown on the LB/carbenicillin medium for preparation of
plasmids using the Qiagen plasmid DNA miniprep kit (Qiagen). Cloned
PCR-derived fragments were then sequenced using Applied Biosystems
automated sequencing systems and associated software. Sequences of
additional novel binary toxin genes and polypeptides related to the
holotype 14 and 44.3 kDa toxins from PS80B1 and PS149B1 are listed
as SEQ ID NOS. 51-126. The section above, entitled "Brief
Description of the Sequences," provides a further explanation of
these sequences.
[0339] The 14 kDa-type toxins and genes from three additional B.t.
strains, PS137A, PS201V2 and PS207C3, were also sequenced using the
above procedures (with any differences noted below). PCR using the
149DEG1 (forward) and 149DEG2 (reverse) primers was performed.
These primers amplify a product of approximately 340 base pairs.
The PCR was performed with the following conditions:
[0340] 1. 95EC, 3 min.
[0341] 2. 94EC, 1 min.
[0342] 3. 42EC, 2 min.
[0343] 4. 72EC, 3 min.+5 sec./cycle
[0344] 5. Steps 2 through 4 repeated 29 times
[0345] PCR products were gel purified using the QiaQuick gel
extraction kit (Qiagen), the purified fragment was ligated into the
pCR-TOPO cloning vector using the TOPO-TA kit (Invitrogen), and
subsequently transformed into XL10-Gold Ultracompetent E. coli
cells (Strategene). Preparation of transformant DNA is described
above. Sequences of the 14 kDa toxin gene for each of the three new
strains were obtained as per above. The nucleotide and polypeptide
sequences are provided in the attached Sequence Listing as follows:
PS137A (SEQ ID NOs:149 and 150), PS201V2 (SEQ ID NOs:151 and 152),
and PS207C3 (SEQ ID NOs:153 and 154).
Example 18
PS149B1 Toxin Transgenes and Plant Transformation
[0346] Separate synthetic transgenes optimized for maize codon
usage were designed for both the 14 and 44.3 kDa toxin components.
The synthetic versions were designed to modify the guanine and
cytosine codon bias to a level more typical for plant DNA.
Preferred plant-optimized transgenes are described in SEQ ID
NOs:127-128. The promoter region used for expression of both
transgenes was the Zea mays ubiquitin promoter plus Z. mays exon 1
and Z. mays intron 1 (Christensen, A. H. et al. (1992) Plant Mol.
Biol. 18:675-689). The transcriptional terminator used for both
transgenes was the potato proteinase inhibitor II (PinII)
terminator (An, G. et al. 1989 Plant Cell 1:115-22).
[0347] Phosphinothricin acetyltransferase (PAT) was used as the
selectable marker for plant transformation. The phosphinothricin
acetyltransferase gene (pat) was isolated from the bacterium
Streptomyces viridochromogenes (Eckes P. et al., 1989). The PAT
protein acetylates phosphinothricin, or its precursor
demethylphosphinothricin, conferring tolerance to a chemically
synthesized phosphinothricin such as the herbicide
glufosinate-ammonium. Acetylation converts phosphinothricin to an
inactive form that is no longer toxic to corn plants. Glufosinate
ammonium is a broad spectrum, non-systemic, non-selective
herbicide. Regenerating corn tissue or individual corn plants
tolerant to glufosinate ammonium herbicide can be readily
identified through incorporation of PAT into regeneration medium or
by spray application of the herbicide to leaves.
[0348] The synthetic version of the pat gene was produced in order
to modify the guanine and cytosine codon bias to a level more
typical for plant DNA. The promoter for the pat gene is the CaMV
promoter of the 35S transcript from cauliflower mosiac virus
(Pietrzak et al., 1986). The transcriptional terminator is the CaMV
35 S terminator.
[0349] For transformation of maize tissue, a linear portion of DNA,
containing both the PS149B1 14 and 44.3 kDa and pat selectable
marker coding sequences, and the regulatory components necessary
for expression, was excised from a complete plasmid. This linear
portion of DNA, termed an insert, was used in the transformation
process.
[0350] Maize plants containing PS149B1 14 kDa and 44.3 kDa
transgenes were obtained by microprojectile bombardment using the
Biolistics.RTM. PDS-100He particle gun manufactured by Bio-Rad,
essentially as described by Klein et al. (1987). Immature embryos
isolated from corn ears harvested approximately 15 days after
pollination were cultured on callus initiation medium for three to
eight days. On the day of transformation, microscopic tungsten
particles were coated with purified DNA and accelerated into the
cultured embryos, where the insert DNA was incorporated into the
cell chromosome. Six days after bombardment, bombarded embryos were
transferred to callus initiation medium containing glufosinate
(Bialaphos) as the selection agent. Healthy, resistant callus
tissue was obtained and repeatedly transferred to fresh selection
medium for approximately 12 weeks. Plants were regenerated and
transferred to the greenhouse. A total of 436 regenerated plants
were obtained. Leaf samples were taken for molecular analysis to
verify the presence of the transgenes by PCR and to confirm
expression of the foreign protein by ELISA. Plants were then
subjected to a whole plant bioassay using western corn rootworm.
Positive plants were crossed with inbred lines to obtain seed from
the initial transformed plants. These plants were found to be
resistant to damage by corn rootworm in both greenhouse and field
trials.
Example 19
Further Bioassays
[0351] Protein preparations from the strains identified on Example
16 were assayed for activity against western corn rootworm using
the basic top load assay methods, as described in Example 13. The
results are shown in Table 13.
TABLE-US-00025 TABLE 13 Strain LC.sub.50 (ug/cm2) 95% Cl KB45A43-3
9.48 6.58-15.27 213'E'8 10.24 7.50-19.87 KR707 11.17
8.27-22.54.sup.# 185GG 11.53 7.51-16.81 187Y2 13.82 11.08-17.67
149B1 14.77 4.91-27.34 69Q 27.52 117.28-114.77.sup.# 167H2 31.38
19.35-47.60 KB54A33-10 32.62 24.76-83.85 185Z11 34.47 ND KB60F5-7
34.67 19.15-124.29 242K10 34.73 21.08-58.25 201G 34.90
13.20-355.18.sup.# 204J7 38.57 29.83-48.82 KB60F5-15 38.62
15.00-2.59E03 80JJ1 41.96 27.35-139.43 203J1 43.85 23.18-69.51
KR589 47.28 29.83-230.71.sup.# 201HH2 49.94 23.83-351.77 KB60F5-11
51.84 19.38-1313.75.sup.# 158X10 52.25 43.13-77.84.sup.# KB58A10-3
53.77 ND 201L3 55.01 41.01-78.96 158T3 58.07 39.59-211.13 184M2
60.54 26.57-411.88 204G4 69.09 52.32-93.83 KB59A58-4 70.35
48.90-144.90 201H2 71.11 52.40-130.35 203G2 81.93 57.13-226.33
KB59A54-4 82.03 38.50-1.63E03 204I11 88.41 62.48-173.07 236B6 89.33
64.16-158.96 KR1369 93.25 71.97-205.04.sup.# KB63A5-3 94.52
51.56-542.46 204C3 125.45 85.26-427.67.sup.# KR1209 128.14
91.57-294.56 185W3 130.61 ND KR625 160.36 ND 210B 201.26
48.51-0.14E+06.sup.# KB10H-5 214.25 87.97-8.22E+03 KB68B57-1 264.30
48.51-8.95E+04.sup.# 223L2 3.81E+02 ND KR136 7.83E+02 -- T25
1.30E+03 ND KB61A18-1 2.58E+03 ND 147U2 3.67E+03 ND KR200 2.14E+05
ND KB59A54-5 3.32E+05 ND KB3F-3 4.07E+05 ND 187G1(bs) 3.50E+07 ND
MR559 20%** n/a KB42C17-13 26%** n/a 224F2 33%** n/a KR959 41%**
n/a KB2C-4 42%** n/a 198H3 46%** n/a KR331 47%** n/a KB46 55%** n/a
KB71A118-6 71%** n/a KB53B7-2 84%** n/a 187Y2 ND n/a 185L12 ND ND
186L9 ND n/a KB54A1-6 ND n/a 187L14 ND n/a 187G1(b) nt nt 187G1(s)
nt nt
Example 20
Molecular Cloning, Expression, and DNA Sequence Analysis of a Novel
Binary Endotoxin Gene from Bacillus thuringiensis Strain
PS201L3
[0352] Genomic DNA from PS201L3 was prepared from cells grown in
shake flask culture using a Qiagen Genomic-tip 500/G kit and
Genomic DNA Buffer Set according to the protocol for Gram positive
bacteria (Qiagen Inc.; Valencia, Calif.). A gene library was
constructed from PS201L3 DNA partially digested with Sau3AI.
Partial restriction digests were fractionated by agarose gel
electrophoresis. DNA fragments 9.3 to 23 kbp in size were excised
from the gel, electroeluted from the gel slice, purified on an
Elutip-Dion exchange column (Schleicher and Schuell, Keene, N. H.),
and recovered by ethanol precipitation. The Sau3AI inserts were
ligated into BamHI-digested LambdaGem-11 (Promega, Madison, Wis.).
Recombinant phage were packaged using Gigapack III XL Packaging
Extract (Stratagene, La Jolla, Calif.) and plated on E. coli KW251
cells. Plaques were lifted onto Nytran Nylon Transfer Membranes
(Schleicher&Schuell, Keene, N. H.) and probed with a
.sup.32P-dCTP labeled gene probe for binary toxin coding sequences.
This gene probe was an approximately 1.0 kb PCR product amplified
using genomic PS201L3 DNA template and oligonucleotides "15kfor1"
and "45krev6."
[0353] The sequences of the oligonucleotides used for PCR and
sequencing follow:
TABLE-US-00026 15kfor1 (SEQ ID NO: 131) ATGTCAGCTCGCGAAGTACAC
45krev6 (SEQ ID NO: 132) GTCCATCCCATTAATTGAGGAG
[0354] The membranes were hybridized with the probe overnight at
65EC and then washed three times with 1.times.SSPE and 0.1% SDS.
Thirteen plaques were identified by autoradiography. These plaques
were subsequently picked and soaked overnight in 1 mL SM Buffer+10
.mu.L CHCl.sub.3. Phage were plated for confluent lysis on KW251
host cells; 6 confluent plates were soaked in SM and used for
large-scale phage DNA preparations. The purified phage DNA was
digested with various enzymes and run on 0.7% agarose gels. The
gels were transferred to Nytran Membranes by Southern blotting and
probed with the same PCR-amplified DNA fragment as above. An
approximately 6.0 kb hybridizing XbaI band was identified and
subcloned into pHT370, an E. coli/Bacillus thuringiensis shuttle
vector (Arantes, O., D. Lereclus [1991] Gene 108:115-119) to
generate pMYC2476. XL10 Gold Ultracompetent E. coli cells
(Stratagene) transformed with pMYC2476 were designated MR1506.
PMYC2476 was subsequently transformed into acrytalliferous CryB
cells by electroporation and selection on DM3+erythromycin (20
ug/mL) plates at 30EC. Recombinant CryB[pMYC2476] was designated
MR561.
[0355] A subculture of MR1506 was deposited in the permanent
collection of the Patent Culture Collection (NRRL), Regional
Research Center, 1815 North University Street, Peoria,
[0356] Illinois 61604 USA on Jun. 1, 2000. The accession number is
B-30298.
[0357] B.t. strain MR561 was examined for expression of the PS201L3
binary toxin proteins by immunoblotting. Cells were grown in liquid
NYS-CAA medium+erythromycin (10 ug/ml) overnight at 30EC. The
culture was then pelleted by centrifugation and a portion of the
cell pellet was resuspended and run on SDS-PAGE gels. Both 14 kDa
and 44 kDa proteins were apparent by Western Blot analysis when
probed with antibodies specific for either the PS149B1 14 kDa or 44
kDa toxins, respectively.
[0358] DNA sequencing of the toxin genes encoded on pMYC2476 was
performed using an
[0359] ABI377 automated sequencer. The DNA sequence for PS201L3 14
kDa gene is shown in SEQ ID NO:133. The deduced peptide sequence
for PS201L3 14 kDa toxin is shown in SEQ ID NO:134. The DNA
sequence for PS201L3 44 kDa gene is shown in SEQ ID NO:135. The
deduced peptide sequence for PS201L3 44 kDa toxin is shown in SEQ
ID NO:136.
[0360] The following table shows sequence similarity and identity
of binary genes and proteins from 201 L3 and 149B1. The program
BESTFIT (part of the GCG software package) was used for these
comparisons. BESTFIT uses the local homology algorithm of Smith and
Waterman (Advances in Applied Mathematics 2: 482-489 (1981)).
TABLE-US-00027 TABLE 14 201L3 vs 149B1 % similarity % identity 14
kDa nucleotide seq -- 71.1 14 kDa peptide seq 63.9 54.1 45 kDa
nucleotide seq -- 76.1 45 kDa peptide seq 70.9 62.7
Example 21
Molecular Cloning and DNA Sequence Analysis of Novel
.delta.-Endotoxin Genes from Bacillus thuringiensis Strains
PS187G1, PS201HH2 and KR1369
[0361] Total cellular DNA was prepared from Bacillus thuringensis
strains PS187G1, PS201HH2 and KR1369 grown to an optical density of
0.5-1.0 at 600 nm visible light in Luria Bertani (LB) broth. DNA
was extracted using the Qiagen Genomic-tip 500/G kit and Genomic
DNA Buffer Set according to the protocol for Gram positive bacteria
(Qiagen Inc.; Valencia, Calif.). PS187G1, PS201HH2 and KR1369
cosmid libraries were constructed in the SuperCos1 vector
(Stratragene) using inserts of PS187G1, PS201HH2 and KR1369 total
cellular DNA, respectively, partially digested with Nde II.
XL1-Blue MR cells (Stratagene) were transfected with packaged
cosmids to obtain clones resistant to carbenicillin and kanamycin.
For each strain, 576 cosmid colonies were grown in 96-well blocks
in 1 ml LB+carbenicillin (100 ug/ml)+kanamycin (50 ug/ml) at 37EC
for 18 hours and replica plated onto nylon filters for screening by
hybridization.
[0362] PCR amplicon containing approximately 1000 bp of the
PS187G1, PS201HH2 or KR1369 14 kDa and 44 kDa toxin operon was
amplified from PS187G1, PS201HH2 or KR1369 genomic DNA using
primers designed to amplify binary homologs:
TABLE-US-00028 (SEQ ID NO: 131) 15kfor1: 5'-ATG TCA GCT CGC GAA GTA
CAC-3' (SEQ ID NO: 132) 45krev6: 5'-GTC CAT CCC ATT AAT TGA GGA
G-3'
[0363] The DNA fragment was gel purified using QiaQuick extraction
(Qiagen). The probe was radiolabeled with .sup.32P-dCTP using the
Prime-It II kit (Stratgene) and used in aqueous hybridization
solution (6.times.SSPE, 5.times.Denhardt's solution, 0.1% SDS, 0.1
mg/ml denatured DNA) with the colony lift filters at 65EC for 16
hours. The colony lift filters were briefly washed 1.times. in
0.5.times.SSC/0.1% SDS at room temperature followed by two
additional washes for 10 minutes at 65EC in 0.5.times.SSC/0.1% SDS.
The filters were then exposed to X-ray film for 20 minutes (PS187G1
and PS201HH2) or for 1 hour (KR1369). One cosmid clone that
hybridized strongly to the probe was selected for further analysis
for each strain. These cosmid clones were confirmed to contain the
approximately 1000 bp 14 kDa and 44 kDa toxin gene target by PCR
amplification with the primers listed above. The cosmid clone of
PS187G1 was designated as pMYC3106; recombinant E. coli XL1-Blue MR
cells containing pMYC3106 are designated MR1508. The cosmid clone
of PS201HH2 was designated as pMYC3107; recombinant E. coli
XL1-Blue MR cells containing pMYC3107 are designated MR1509. The
cosmid clone of KR1369 was designated as pMYC3108; recombinant E.
coli XL1-Blue MR cells containing pMYC3108 are designated MR1510.
Subcultures of MR1509 and MR1510 were deposited in the permanent
collection of the Patent Culture Collection (NRRL), Regional
Research Center, 1815 North University Street, Peoria, Ill. 61604
USA on Aug. 8, 2000. The accession numbers are NRRL B-30330 and
NRRL-B 30331, respectively.
[0364] The PS187G1, PS201HH2 and KR1369 14 kDa and 44 kDa toxin
genes encoded by pMYC3106, pMYC3107 and pMYC3108, respectively,
were sequenced using the ABI377 automated sequencing system and
associated software.
[0365] The PS187G1 14 kDa and 44 kDa nucleotide and deduced
polypeptide sequences are shown as SEQ ID NOs:137-140. Both the 14
kDa and 44 kDa toxin gene sequences are complete open reading
frames. The PS187G1 14 kDa toxin open reading frame nucleotide
sequence, the 44 kDa toxin open reading frame nucleotide sequence,
and the respective deduced amino acid sequences are novel compared
to other toxin genes encoding pesticidal proteins.
[0366] The PS201HH2 14 kDa and 44 kDa nucleotide and deduced
polypeptide sequences are shown as SEQ ID NOs:141-144. The 14 kDa
toxin gene sequence is the complete open reading frame. The 44 kDa
toxin gene sequence is a partial sequence of the gene. The PS201HH2
14 kDa toxin open reading frame nucleotide sequence, the 44 kDa
toxin partial open reading frame nucleotide sequence, and the
respective deduced amino acid sequences are novel compared to other
toxin genes encoding pesticidal proteins.
[0367] The KR1369 14 kDa and 44 kDa nucleotide and deduced
polypeptide sequences are shown as SEQ ID NOs:145-148. Both the 14
kDa and 44 kDa toxin gene sequences are complete open reading
frames. The KR1369 14 kDa toxin open reading frame nucleotide
sequence, the 44 kDa toxin open reading frame nucleotide sequence,
and the respective deduced amino acid sequences are novel compared
to other toxin genes encoding pesticidal proteins.
Example 22
Construction and Expression of a Hybrid Gene Fusion Containing the
PS149B1 14 kDa and 44 kDa Binary Toxin Genes
[0368] Oligonucleotide primers were designed to the 5' and 3' ends
of both the 14 kDa and 44 kDa genes from PS149B1. These
oligonucleotides were designed to create a gene fusion by SOE-PCR
("Gene Splicing By Overlap Extension: Tailor-made Genes Using PCR,"
Biotechniques 8:528-535, May 1990). The two genes were fused
together in the reverse order found in the native binary toxin
operon (i.e. 44 kDa gene first, followed by the 14 kDa gene.)
[0369] The sequences of the olignucleotides used for SOE-PCR were
the following:
TABLE-US-00029 (SEQ ID NO: 155) F1new:
AAATATTATTTTATGTCAGCACGTGAAGTACACATTG (SEQ ID NO: 156) R1new:
tctctGGTACCttaTTAtgatttatgcccatatcgtgagg F2new: (SEQ ID NO: 157)
agagaACTAGTaaaaaggagataaccATGttagatactaataaag R2new: (SEQ ID NO:
158) CGTGCTGACATAAAATAATATTTTTTTAATTTTTTTAGTGTACTTT
[0370] Oligo "F1new" was designed to direct amplification from the
5' end of the 14 kDa gene and hybridize to the 3' end of the 44 kDa
gene. Oligo "R1new" was designed to direct amplification from the
3' end of the 14 kDa gene. This primer was designed with two stop
codons in order to ensure termination of translation. It was also
designed with a KpnI site for directional cloning into a plasmid
expression vector for Pseudomonas fluorescens. Oligo "F2new" was
designed to direct amplification from the 5' end of the 44 kDa
gene. It also includes a ribosome binding sequence and a SpeI
cloning site. Oligo "R2new" was designed to direct amplification
from the 3' end of the 44 kDa gene and hybridize to the 5' end of
the 14 kDa gene.
[0371] The two genes were first independently amplified from
PS149B1 genomic DNA; the 14 kDa gene using "F1new" and "R1new," and
the 44 kDa gene using "F2new" and "R2new." The products were then
combined in one PCR tube and amplified together using "R1new" and
"F2new." At this point, Herculase.TM. Enhanced Polymerase Blend
(Stratagene, La Jolla, Calif.) was used at a 48EC annealing
temperature to amplify a .about.1.5 kb DNA fragment containing the
gene fusion. This DNA fragment was subsequently digested using KpnI
and SpeI, fractionated on agarose gels, and purified by
electroelution. The plasmid vector was also digested with KpnI and
SpeI, fractionated on agarose gels, purified by electroelution and
treated with phosphatase. The vector and insert were then ligated
together overnight at 14EC. Ligated DNA fragments were transformed
into MB214 P.f. cells by electroporation and selection overnight on
LB+tetracycline (30 ug/mL) plates. Strains containing the gene
fusion were identified by diagnostic PCR and sequenced for
verification of successful gene splicing. One representative strain
containing the cloned gene fusion was designated MR1607; the
recombinant plasmid was designated pMYC2475.
[0372] A subculture of MR1607 was deposited in the permanent
collection of the Patent Culture Collection (NRRL), Regional
Research Center, 1815 North University Street, Peoria, Ill. 61604
USA on Aug. 8, 2000. The accession number is NRRL B-30332. MR1607
was grown and protein production was verified by SDS-PAGE and
immunoblotting. A protein band at .about.58 kDa representing the 44
kDa+14 kDa fusion product was identified when western blots were
probed with antibodies specific to either the 14 kDa toxin or the
44 kDa toxin.
[0373] The sequence of the 58 kDa fusion protein is provided in SEQ
ID NO:159. The DNA sequence for the gene fusion is provided in SEQ
ID NO:160.
Example 23
Binary Homologue Mixing Study
[0374] Growth of Homologue Strains.
[0375] Four strains were selected, one from each major binary toxin
family--149B1, 80JJ1, 201L3, and 167H2. In order to reduce time
spent purifying individual toxin proteins, the following
Pseudomonas fluorescens (P.f) clones were grown instead: MR1253 (14
kDa of 149B1) and MR1256 (44 kDa of 149B1). Similarly, B.t. clones
MR541 (expressing 14 kDa of 80JJ1), and MR542 (44 kDa of 80JJ1)
were used. B.t. strains were grown as described in Example 1.
Pellets were washed 3.times. with water and stored at -20EC until
needed. Pf strains were grown in 10 L batches in Biolafitte
fermenters using standard procedures. Pellets were stored at -80EC
until needed.
[0376] Extraction & Purification of Toxins.
[0377] Purification of 167H2, MR541, MR542, 201L3. Extractions of
cell pellets were done using 100 mM sodium citrate buffer at pH's
ranging from 3.0 to 5.5. In a typical extraction, pellets were
extracted with a buffer volume 1/10 to 1/3.times. of the original
culture volume. Pellets were suspended in the buffer and placed on
a rocking platform at 4EC for periods of time ranging from 2.5
hours to overnight. The extracts were centrifuged and supernatants
were retained. This procedure was repeated with each strain until
at least approximately 10 mg of each protein were obtained.
SDS-PAGE confirmed the presence/absence of protein toxins in the
extracts through use of the NuPAGE Bis/Tris gel system
(Invitrogen). Samples were prepared according to the manufacturer's
instructions and were loaded onto 4-12% gels and the
electrophoretograms were developed with MES running buffer. The
exception to this procedure was the sample prep of all 201L3
samples. These samples were prepared by diluting 1/2.times. with
BioRad's Laemmli sample buffer and heating at 95EC for 4 minutes.
Protein quantitation was done by laser scanning gel densitometry
with BSA as a standard (Molecular Dynamics Personal Densitometer
SI). Extracts were clarified by filtration through a 0.2 .mu.m
membrane filter and stored at 4EC.
[0378] Purification of MR1253 & MR1256. The recombinant
proteins MR1253 and MR 1256, corresponding to the 14 and 44 kDa
proteins of 149B1 respectively, were prepared as solubilized
inclusions. Inclusion bodies were prepared using standard
procedures. The inclusion bodies were solubilized in 1 mM EDTA, 50
mM sodium citrate, pH 3.5.
[0379] Purification of individual toxins, 167H2 & 201L3. All
extracts known to contain either the 14, the 44 kDa, or both were
combined. This combined extract was dialyzed against 100 mM sodium
citrate, 150 mM NaCl, pH 4. Dialysis tubing was from Pierce
(Snakeskin 10k MWCO). Samples were usually dialyzed for
approximately 6 hours and then again overnight in fresh buffer.
[0380] Extracts were then concentrated with either Centriprep 10 or
Centricon Plus-20 (Biomax-5, 5000 NMWL) centrifugal filter devices
(Millipore), quantitated for both the 14 kDa and 44 kDa proteins,
and subjected to gel filtration chromatography.
[0381] In preparation for chromatography, all samples and buffers
were filtered through a 0.2 .mu.m filter and degassed. Samples were
then applied to a HiPrep 26/60 Sephacryl S-100 gel filtration
column which had been equilibrated with two bed volumes of the
separation buffer, 100 mM sodium citrate, 150 mM NaCl, pH 4.0.
Sample volumes ranged from 5-10 ml. An AKTA purifier 100 FPLC
system (Amersham Pharmacia) controlled the runs. Chromatography was
done at ambient temperature. Buffer flow through the column during
the run was maintained at 0.7 ml/min. Proteins were detected by
monitoring UV absorbance at 280 nm. Fractions were collected and
stored at 4EC. Fractions containing either the 14 or 44 kDa protein
were pooled and checked for purity by SDS-PAGE as described
above.
[0382] For 167H2 samples, two large peaks were detected and were
well separated from each other at the baseline. SDS-PAGE of
fractions showed each peak represented one of the protein
toxins.
[0383] In the 201L3 sample, three well defined peaks and one
shoulder peak were detected. SDS-PAGE revealed that the first peak
represented a 100 kDa protein plus an 80 kDa protein. The second
peak represented the 44 kDa protein, while the shoulder peak was a
40 kDa protein. The third peak was the 14 kDa protein. Fractions
with the 44 kDa from both samples were combined as were all
fractions containing the 14 kDa.
[0384] The 149B1 proteins had been obtained individually from Pf
clones MR1253 and MR1256 and, therefore, further purification was
not necessary. Similarly, the 80B1 recombinants, MR541 and MR542
yielded the individual 14 and 44 kDa proteins thereby obviating
further purification.
[0385] Sample Preparation for wCRW LC.sub.50 Bioassay.
[0386] Dialysis. Samples of individual binary toxin proteins were
dialyzed against 6 L of 20 mM sodium citrate, pH 4.0. The first
dialysis proceeded for several hours, the samples were transferred
to fresh buffer and allowed to dialyze overnight. Finally, the
samples were transferred to fresh buffer and dialyzed several more
hours. Sources of the protein samples were either the pooled
gel-filtration fractions (167H2, 201L3), pellet extracts (MR541,
MR542), or inclusion pellet extracts (MR1253, MR1256). All samples
were filtered through 0.2 um membranes to sterilize.
[0387] Concentration. Samples were concentrated with Centricon
Plus-20 (Biomax-5, 5000 NMWL) centrifugal filter devices
(Millipore).
[0388] Quantitation. Samples were quantitated for protein as above.
To meet the requirements of the LC.sub.50 bioassay, a minimum of
6.3 mg of each toxin protein were needed at a concentration range
of 0.316-1.36 mg/ml for the various combinations. If necessary,
samples were concentrated as above, or were diluted with buffer (20
mM sodium citrate, pH 4.0) and requantitated.
[0389] Mixing of binaries/LC.sub.50 bioassay. For each of the four
strains, the 14 kDa was combined with an amount the 44 kDa of each
strain to give a 1/1 mass ratio. The top dose was 50 ug/cm.sup.2
for the mixtures, with the exception of mixtures with the 14 kDa
protein of 203J1. Top doses of mixtures with this protein were only
44 ug/cm.sup.2. For controls, each protein was submitted
individually, as was the extract buffer, 20 mM sodium citrate, pH
4.0. Native combinations were also tested (i.e. 14 kDa+44 kDa of
149B1). All toxin combinations and buffer controls were evaluated
three times by bioassay against Western corn rootworm, while
individual toxins were tested once.
[0390] The results are reported below in Table 15 (LC.sub.50
Results for Toxin Combinations) and Table 16 (Comparison of
Potencies of Strains to 149B1).
TABLE-US-00030 TABLE 15 Toxin combination Top load, ul/well
LC.sub.50 (ug/cm2) 80JJ1 14 + 80JJ1 44 96 28 (19-44 C.I.) 167H2 44
159 >Top dose 201L3 44 172 No dose response 149B1 44 78 No dose
response 167H2 14 + 167H2 44 161 19 (13-27 C.I.) 80JJ1 44 97 No
dose response 201L3 44 174 14 (10-22 C.I.) 149B1 44 80 No dose
response 201L3 14 + 201L3 44 193 No dose response 80JJ1 44 116 No
dose response 167H2 44 180 No dose response 149B1 44 99 No dose
response 149B1 14 + 149B1 44 45 10 (7-15 C.I.) 80JJ1 44 63 11 (8-16
C.I.) 167H2 44 126 8 (6-11 C.I.) 201L3 44 139 18 (13-27 C.I.)
TABLE-US-00031 TABLE 16 Comparison of potencies of strains to 149B1
Toxin combination Relative potency 149B1 14 + 149B1 44 To which all
others are compared 149B1 14 + 80JJ1 44 0.9 149B1 14 + 167H2 44 1.3
149B1 14 + 201L3 44 0.5 80JJ1 14 + 80JJ1 44 0.4 167H2 14 + 167H2 44
0.5 167H2 14 + 201L3 44 0.7
[0391] The results are also displayed graphically in FIG. 3.
[0392] Native combinations were highly active against Western corn
rootworm, except for 201L3. However, the 44 kDa of 201L3 was active
when combined with either the 14 kDa of 167H2 or 149B1. Other
active combinations were the 149B1 14 kDa with either 80JJ1 or
167H2 44 kDa, with the latter appearing to be more active than the
native 149B1 mixture. No dose response was noted for either the
individual proteins, or the buffer and water controls.
Example 24
Control of Southern Corn Rootworm with PS149B1 14-kDa Protein
[0393] A powder containing approximately 50% (wt/wt) of a 14-kDa
.delta.-endotoxin, originally discovered in Bacillus thuringiensis
strain PS149B1, was isolated from recombinant Pseudomonas
fluorescens strain (MR1253). This powder was evaluated for
insecticidal activity using the following procedure.
[0394] Artificial insect diet (R. I. Rose and J. M. McCabe (1973),
"Laboratory rearing techniques for rearing corn rootworm," J. Econ.
Entomol. 66(2): 398-400) was dispensed at .about.0.5 mL/well into
128-well bioassay trays (C-D International, Pitman, N.J.) to
produce a surface area of .about.1.5 cm2. Buffer (10-mM potassium
phosphate, pH 7.5) suspensions of the 14-kDa protein powder were
applied to the surface of the artificial insect diet at 50
.mu.L/well, and the diet surface was allowed to dry. Buffer
controls were also included in each test. A single neonate southern
corn rootworm, Diabrotica undecimpunctata howardi, was placed in
each well, and the wells were sealed with lids that were provided
with the trays. The bioassays were held for 6 days at 28EC, after
which time, the live larvae were weighed as a group for each
treatment. Percent growth inhibition was calculated by subtracting
the weight of live insects from each treatment from the weight of
live, control insects, and then dividing by the control weight.
This result was multiplied by 100 to convert the number to a
percent. Growth inhibition was calculated for each of 5 tests that
each contained 16 insects per treatment, and the growth inhibition
was averaged across tests.
[0395] Results demonstrated that the 14-kDa protein inhibited
growth of southern corn rootworms in a concentration-dependent
manner. Table 17 shows southern corn rootworm growth inhibition
with PS149B1 14-kDa protein.
TABLE-US-00032 TABLE 17 Concentration in Treatment .PHI.g
ai/cm.sup.2 % Growth Inhibition 14-kDa Protein 1 32 14-kDa Protein
3 55 14-kDa Protein 9 78 ai = active ingredient
Example 25
Control of European Corn Borer and Corn Earworm with PS149B1 Binary
Toxin
[0396] A powder containing 54% of a 14-kDa .delta.-endotoxin, and
another powder containing 37% of a 44-kDa .delta.-endotoxin, both
originally discovered in Bacillus thuringiensis strain PS149B1,
were isolated from recombinant Pseudomonas fluorescens strains
MR1253 and MR1256, respectively. Mixtures of these powders were
evaluated for insecticidal activity using the following
procedure.
[0397] Artificial insect diet (R. I. Rose and J. M. McCabe (1973),
"Laboratory rearing techniques for rearing corn rootworm," J. Econ.
Entomol. 66(2): 398-400) was dispensed at .about.0.5 mL/well into
128-well bioassay trays (C-D International, Pitman, N.J.) to
produce a surface area of .about.1.5 cm2. Buffer (10-mM potassium
phosphate, pH 7.5) suspensions of the protein powders were mixed,
and were then applied to the surface of the artificial insect diet
at 50 .mu.L/well. The diet surface was allowed to dry. Buffer
controls were also included in each test. A single neonate larvae
was placed in each well, and the wells were sealed with lids that
were provided with the trays. Tests were conducted with European
corn borer, Ostrinia nubilalis, and corn earworm, Helicoverpa zea
(both are lepidopterans). The bioassays were held for 6 days at
28EC, after which time, the live larvae were weighed as a group for
each treatment. Percent growth inhibition was calculated by
subtracting the weight of live insects in each treatment from the
weight of live, control insects, and then dividing by the control
weight. This result was multiplied by 100 to convert the number to
a percent. Growth inhibition was calculated for each of 4 tests
that each contained 14 to 16 insects per treatment, and the growth
inhibition was averaged across tests.
[0398] Results demonstrated that the 14-kDa protein inhibited
growth of European corn borers and corn earworms in a
concentration-dependent manner. Table 18 shows corn earworm (CEW)
and European corn borer (ECB) growth inhibition with PS149B1
protein mixtures.
TABLE-US-00033 TABLE 18 14-kDa protein + % Growth 44-kDa Protein
Inhibition Concentration in .PHI.g ai/cm2 CEW ECB 3.7 + 11 42 59 11
+ 33 57 77 33 + 100 61 89 ai = active ingredient
Example 26
Further Characterization of the 45 kDa Proteins and Primer Design
for Identifying Additional Polynucleotides and Proteins
[0399] The subject invention includes not only the specifically
exemplified sequences. Portions of the subject genes and toxins can
be used to identify other related genes and toxins. Thus, the
subject invention includes polynucleotides that encode proteins or
polypeptides comprising at least ten contiguous amino acids, for
example, of any of the binary-type proteins or polypeptides
included in the attached sequence listing and described herein.
Other embodiments include polynucleotides that encode, for example,
at least 20, 30, 40, 50, 60, 70, 80, 90, and 100 contiguous amino
acids of a protein exemplified herein; these numbers also apply
similarly to contiguous nucleotides of an exemplified
polynucleotide. The proteins encoded by such polynucleotides are
included in the subject invention. Likewise, polynucleotides
comprising contiguous nucleotides (that code for proteins or
polypeptides comprising peptides of these approximate sizes) are
included in the subject invention.
[0400] While still very different, the "closest" toxins to those of
the subject invention are believed to be the 51 and 42 kDa
mosquitocidal proteins of Bacillus sphaericus. Attached as FIGS. 4
and 5 are protein alignments and nucleotide sequences alignments of
the 51 and 42 kDa sphaericus toxins and genes and the 45 kDa 149B1
toxin and gene.
[0401] Two blocks of sequences are highlighted in the nucleotide
alignment to which primers could be made. An exemplary PCR primer
pair is included below, and in 5'-3' orientation (45 kD3'rc is
shown as the complement). These primers have been successfully used
to identify additional members of the 45 kDa binary family. Fully
redundant sequences and a prophetic pair are also included
below.
TABLE-US-00034 (SEQ ID NO: 161) 45kD5': GAT RAT RAT CAA TAT ATT ATT
AC. (SEQ ID NO: 162) 45kD3'rc: CAA GGT ART AAT GTC CAT CC.
[0402] The sequences would be useful as both the sequence written
and as the reverse complement (03 and 04 are complementary to 45
kD3'rc, the exemplified reverse primer).
TABLE-US-00035 (SEQ ID NO: 163) 45kD5'01: GAT GATGrTmrAk wwATTATTrC
A. (SEQ ID NO: 164) 45kD5'02: GAT GATGrTmrAT ATATTATTrC A. (SEQ ID
NO: 165) 45kD3'03: GGAwG krCdyTwdTm CCwTGTAT. (SEQ ID NO: 166)
45kD3'04: GGAwG kACryTAdTA CCTTGTAT.
[0403] Regarding the manner in which the sphaericus toxins were
identified, a BLAST (Altschul et al. (1997), "Gapped BLAST and
PSI-BLAST: a new generation of protein database search programs,"
Nucleic Acids Res. 25:3389-3402) database search using the 149B1 45
kDa protein found matches to the 42 kDa B. sphaericus crystal
inclusion protein (expectation score 3*10.sup.-14) and the 51 kDa
B. sphaericus crystal inclusion protein (expectation score
3*10.sup.-9).
[0404] An alignment of the 45 kDa 149B1 peptide sequence to the 42
kDa B. sphaericus crystal inclusion protein results in an alignment
having 26% identity over 325 residues. The alignment score is 27.2
sd above the mean score of 100 randomized alignments. A similar
analysis of the 45 kDa 149B1 peptide sequence to the 42 kDa B.
sphaericus crystal inclusion protein results in an alignment having
29% identity over 229 residues. The alignment score is 23.4 sd
above the mean score of 100 randomized alignments. Alignment scores
>10 sd above the mean of random alignments have been considered
significant (Lipman, D. J. and Pearson, W. R. (1985), "Rapid and
sensitive similarity searches," Science 227:1435-1441; Doolittle,
R. F. (1987), Of URFs and ORFs: a primer on how to analyze derived
amino acid sequences, University Science Books, Mill Valley,
Calif.).
[0405] For reference, the structurally similar Cry1Aa, Cry2Aa and
Cry3Aa protein sequences were compared in the same way. Cry2Aa vs.
Cry1Aa and Cry2Aa vs. Cry3Aa share 29% and 27% identity over 214
and 213 residues, respectively, with alignment scores 32.2 sd and
29.5 sd above the mean score of 100 randomized alignments. An
alignment of the 149B1 45 kDa protein sequence and the Cry2Aa
protein sequence resulted in an alignment score within 1 sd of the
mean of 100 randomized alignments.
[0406] The following comparisons are also noted:
TABLE-US-00036 TABLE 19 % % Average Comparison Quality Length Ratio
Gaps Similarity Identity Quality* ps149b1-45.pep x 189 325 0.612 12
35.135 26.351 39.4 .A-inverted. 5.5 S07712 ps149b1-45.pep x 161 229
0.742 9 36.019 28.910 39.3 .A-inverted. 5.2 07711 cry2aa1.pep x 182
214 0.888 6 37.688 28.643 43.5 .A-inverted. 4.3 cry1aa1.pep
cry3aa1.pep x 187 213 0.926 6 40.500 27.000 42.3 .A-inverted. 4.9
cry2aa1.pep ps149b1-45.pep x 40 28 1.429 0 42.857 35.714 41.6
.A-inverted. 5.6 cry2aa1.pep *based on 100 randomizations
[0407] For further comparison purposes, and for further primer
design, the following references are noted:
[0408] Oei et al. (1992), "Binding of purified Bacillus sphaericus
binary toxin and its deletion derivatives to Culex quinquefasciatus
gut: elucidation of functional binding domains," Journal of General
Microbiology 138(7):1515-26.
[0409] For the 51 kDa: 35-448 is active; 45-448 is not; 4-396 is
active; 4-392 is not.
[0410] For the 42 kDa: 18-370 is active, 35-370 is not; 4-358 is
active; 4-349 is not.
[0411] The work was done with GST fusions purified and cleaved with
thrombin. All truncations were assayed with == of other intact
subunit. All deletions had some loss of activity. P51deltaC56
binds, but doesn't internalize 42. P51 delta N45 doesn't bind. Only
42 kDa+51 kDa are internalized. Both N-terminal and C-terminal
non-toxic 42 kDa proteins failed to bind the 51 kDa protein or 51
kDa-receptor complex.
[0412] Davidson et al. (1990), "Interaction of the Bacillus
sphaericus mosquito larvicidal proteins," Can. J. Microbiol.
36(12):870-8. N-termini of SDS-PAGE purified proteins obtained from
B. sphaericus. S29 and N31 of 51 kDa and S9 of 42 kDa in 68-74 kDa
complexes (unreduced). S9 and S29 of 51 and N31 of 42 from 51 kDa
band (unreduced). In reduced gels the 45 kDa band had S29 and N31
of the 51 kDa and the 39 kDa band contained S9 of the 42 kDa
protein.
[0413] Baumann et al. (1988), "Sequence analysis of the
mosquitocidal toxin genes encoding 51.4- and 41.9-kilodalton
proteins from Bacillus sphaericus 2362 and 2297,"J. Bacteriol.
17:2045-2050. N-termini of 41.9 kDa at D5 from B. sphaericus
protease and I11 from chymotrypsin; C-terminus following R349 with
trypsin. Regions of enhanced similarity were identified that
correspond to many of those above. Similar sequence blocks A
through D between the 51 and 42 kDa proteins.
[0414] In summary, the sphaericus toxins discussed above are not
meant to be included in the scope of the subject invention (in
fact, they are specifically excluded). In that regard, divergent
contiguous sequences, as exemplified in the alignments (FIGS. 4 and
5) discussed above, can be used as primers to identify unique
toxins that are suggested but not specifically exemplified herein.
However, the conserved contiguous sequences, as shown in the
alignments, can also be used according to the subject invention to
identify further novel 15/45 kDa-type binary toxins (active against
corn rootworm and other pests).
Example 27
Insertion and Expression of Toxin Genes in Plants
[0415] One aspect of the subject invention is the transformation of
plants with polynucleotides of the subject invention that express
proteins of the subject invention. The transformed plants are
resistant to attack by the target pest.
[0416] The novel corn rootworm-active genes described here can be
optimized for expression in other organisms. For example, maize
optimized gene sequences encoding the 14 and 44 kDa PS80B1 toxins
are disclosed in SEQ ID NO:44 and SEQ ID NO:45, respectively.
[0417] Genes encoding pesticidal toxins, as disclosed herein, can
be inserted into plant cells using a variety of techniques which
are well known in the art. For example, a large number of cloning
vectors comprising a replication system in E. coli and a marker
that permits selection of the transformed cells are available for
preparation for the insertion of foreign genes into higher plants.
The vectors comprise, for example, pBR322, pUC series, M13 mp
series, pACYC184, etc. Accordingly, the sequence encoding the B.t.
toxin can be inserted into the vector at a suitable restriction
site. The resulting plasmid is used for transformation into E.
coli. The E. coli cells are cultivated in a suitable nutrient
medium, then harvested and lysed. The plasmid is recovered.
Sequence analysis, restriction analysis, electrophoresis, and other
biochemical-molecular biological methods are generally carried out
as methods of analysis. After each manipulation, the DNA sequence
used can be cleaved and joined to the next DNA sequence. Each
plasmid sequence can be cloned in the same or other plasmids.
Depending on the method of inserting desired genes into the plant,
other DNA sequences may be necessary. If, for example, the Ti or Ri
plasmid is used for the transformation of the plant cell, then at
least the right border, but often the right and the left border of
the Ti or Ri plasmid T-DNA, has to be joined as the flanking region
of the genes to be inserted.
[0418] The use of T-DNA for the transformation of plant cells has
been intensively researched and sufficiently described in EP 120
516; Hoekema (1985) In: The Binary Plant Vector System,
Offset-durkkerij Kanters B. V., Alblasserdam, Chapter 5; Fraley et
al., Crit. Rev. Plant Sci. 4:1-46; and An et al. (1985) EMBO J.
4:277-287.
[0419] Once the inserted DNA has been integrated in the genome, it
is relatively stable there and, as a rule, does not come out again.
It normally contains a selection marker that confers on the
transformed plant cells resistance to a biocide or an antibiotic,
such as kanamycin, G 418, bleomycin, hygromycin, or
chloramphenicol, inter alia. The individually employed marker
should accordingly permit the selection of transformed cells rather
than cells that do not contain the inserted DNA.
[0420] A large number of techniques are available for inserting DNA
into a plant host cell. Those techniques include transformation
with T-DNA using Agrobacterium tumefaciens or Agrobacterium
rhizogenes as transformation agent, fusion, injection, biolistics
(microparticle bombardment), or electroporation as well as other
possible methods. If Agrobacteria are used for the transformation,
the DNA to be inserted has to be cloned into special plasmids,
namely either into an intermediate vector or into a binary vector.
The intermediate vectors can be integrated into the Ti or Ri
plasmid by homologous recombination owing to sequences that are
homologous to sequences in the T-DNA. The Ti or Ri plasmid also
comprises the vir region necessary for the transfer of the T-DNA.
Intermediate vectors cannot replicate themselves in Agrobacteria.
The intermediate vector can be transferred into Agrobacterium
tumefaciens by means of a helper plasmid (conjugation). Binary
vectors can replicate themselves both in E. coli and in
Agrobacteria. They comprise a selection marker gene and a linker or
polylinker which are framed by the right and left T-DNA border
regions. They can be transformed directly into Agrobacteria
(Holsters et al. [1978] Mol. Gen. Genet. 163:181-187). The
Agrobacterium used as host cell is to comprise a plasmid carrying a
vir region. The vir region is necessary for the transfer of the
T-DNA into the plant cell. Additional T-DNA may be contained. The
bacterium so transformed is used for the transformation of plant
cells. Plant explants can advantageously be cultivated with
Agrobacterium tumefaciens or Agrobacterium rhizogenes for the
transfer of the DNA into the plant cell. Whole plants can then be
regenerated from the infected plant material (for example, pieces
of leaf, segments of stalk, roots, but also protoplasts or
suspension-cultivated cells) in a suitable medium, which may
contain antibiotics or biocides for selection. The plants so
obtained can then be tested for the presence of the inserted DNA.
No special demands are made of the plasmids in the case of
injection and electroporation. It is possible to use ordinary
plasmids, such as, for example, pUC derivatives.
[0421] The transformed cells grow inside the plants in the usual
manner. They can form germ cells and transmit the transformed
trait(s) to progeny plants. Such plants can be grown in the normal
manner and crossed with plants that have the same transformed
hereditary factors or other hereditary factors. The resulting
hybrid individuals have the corresponding phenotypic
properties.
[0422] In a preferred embodiment of the subject invention, plants
will be transformed with genes wherein the codon usage has been
optimized for plants. See, for example, U.S. Pat. No. 5,380,831,
which is hereby incorporated by reference. Also, advantageously,
plants encoding a truncated toxin will be used. The truncated toxin
typically will encode about 55% to about 80% of the full length
toxin. Methods for creating synthetic B.t. genes for use in plants
are known in the art.
Example 28
Cloning of B.t. Genes into Insect Viruses
[0423] A number of viruses are known to infect insects. These
viruses include, for example, baculoviruses and entomopoxviruses.
In one embodiment of the subject invention, genes encoding the
insecticidal toxins, as described herein, can be placed within the
genome of the insect virus, thus enhancing the pathogenicity of the
virus. Methods for constructing insect viruses which comprise B.t.
toxin genes are well known and readily practiced by those skilled
in the art. These procedures are described, for example, in
Merryweather et al. (Merryweather, A. T., U. Weyer, M. P. G.
Harris, M. Hirst, T. Booth, R. D. Possee (1990) J. Gen. Virol.
71:1535-1544) and Martens et al. (Martens, J. W. M., G. Honee, D.
Zuidema, J. W. M. van Lent, B. Visser, J. M. Vlak (1990) Appl.
Environmental Microbiol. 56(9):2764-2770).
[0424] All patents, patent applications, provisional applications,
and publications referred to or cited herein are incorporated by
reference in their entirety to the extent they are not inconsistent
with the explicit teachings of this specification.
[0425] It should be understood that the examples and embodiments
described herein are for illustrative purposes only and that
various modifications or changes in light thereof will be suggested
to persons skilled in the art and are to be included within the
spirit and purview of this application and the scope of the
appended claims.
Sequence CWU 1
1
16615PRTBacillus thuringiensis 1Met Leu Asp Thr Asn1
5225PRTBacillus thuringiensis 2Met Leu Asp Thr Asn Lys Val Tyr Glu
Ile Ser Asn Leu Ala Asn Gly1 5 10 15Leu Tyr Thr Ser Thr Tyr Leu Ser
Leu 20 25324PRTBacillus thuringiensis 3Ser Ala Arg Glu Val His Ile
Glu Ile Asn Asn Thr Arg His Thr Leu1 5 10 15Gln Leu Glu Ala Lys Thr
Lys Leu 20425PRTBacillus thuringiensis 4Met Leu Asp Thr Asn Lys Val
Tyr Glu Ile Ser Asn His Ala Asn Gly1 5 10 15Leu Tyr Ala Ala Thr Tyr
Leu Ser Leu 20 25550PRTBacillus
thuringiensisMISC_FEATURE(35)..(35)Undetermined amino acid 5Ser Ala
Arg Glu Val His Ile Asp Val Asn Asn Lys Thr Gly His Thr1 5 10 15Leu
Gln Leu Glu Asp Lys Thr Lys Leu Asp Gly Gly Arg Trp Arg Thr 20 25
30Ser Pro Xaa Asn Val Ala Asn Asp Gln Ile Lys Thr Phe Val Ala Glu
35 40 45Ser Asn 50625PRTBacillus thuringiensis 6Met Leu Asp Thr Asn
Lys Ile Tyr Glu Ile Ser Asn Tyr Ala Asn Gly1 5 10 15Leu His Ala Ala
Thr Tyr Leu Ser Leu 20 25725PRTBacillus thuringiensis 7Ser Ala Arg
Glu Val His Ile Asp Val Asn Asn Lys Thr Gly His Thr1 5 10 15Leu Gln
Leu Glu Asp Lys Thr Lys Leu 20 25829DNAArtificial
SequenceOligonucleotide probe for gene encoding PS80JJ1 44.3 kDa
toxin; forward primer for PS149B1 and PS167H2 8atgntngata
cnaataaagt ntatgaaat 29926DNAArtificial SequenceReverse primer for
PS149B1 and PS167H2 9ggattatcta tctctgagtg ttcttg
26101158DNABacillus thuringiensis 10atgttagata ctaataaagt
ttatgaaata agcaatcttg ctaatggatt atatacatca 60acttatttaa gtcttgatga
ttcaggtgtt agtttaatga gtaaaaagga tgaagatatt 120gatgattaca
atttaaaatg gtttttattt cctattgata ataatcaata tattattaca
180agctatggag ctaataattg taaagtttgg aatgttaaaa atgataaaat
aaatgtttca 240acttattctt caacaaactc tgtacaaaaa tggcaaataa
aagctaaaga ttcttcatat 300ataatacaaa gtgataatgg aaaggtctta
acagcaggag taggtcaatc tcttggaata 360gtacgcctaa ctgatgaatt
tccagagaat tctaaccaac aatggaattt aactcctgta 420caaacaattc
aactcccaca aaaacctaaa atagatgaaa aattaaaaga tcatcctgaa
480tattcagaaa ccggaaatat aaatcctaaa acaactcctc aattaatggg
atggacatta 540gtaccttgta ttatggtaaa tgattcaaaa atagataaaa
acactcaaat taaaactact 600ccatattata tttttaaaaa atataaatac
tggaatctag caaaaggaag taatgtatct 660ttacttccac atcaaaaaag
atcatatgat tatgaatggg gtacagaaaa aaatcaaaaa 720acaactatta
ttaatacagt aggattgcaa attaatatag attcaggaat gaaatttgaa
780gtaccagaag taggaggagg tacagaagac ataaaaacac aattaactga
agaattaaaa 840gttgaatata gcactgaaac caaaataatg acgaaatatc
aagaacactc agagatagat 900aatccaacta atcaaccaat gaattctata
ggacttctta tttatacttc tttagaatta 960tatcgatata acggtacaga
aattaagata atggacatag aaacttcaga tcatgatact 1020tacactctta
cttcttatcc aaatcataaa gaagcattat tacttctcac aaaccattcg
1080tatgaagaag tagaagaaat aacaaaaata cctaagcata cacttataaa
attgaaaaaa 1140cattatttta aaaaataa 115811385PRTBacillus
thuringiensis 11Met Leu Asp Thr Asn Lys Val Tyr Glu Ile Ser Asn Leu
Ala Asn Gly1 5 10 15Leu Tyr Thr Ser Thr Tyr Leu Ser Leu Asp Asp Ser
Gly Val Ser Leu 20 25 30Met Ser Lys Lys Asp Glu Asp Ile Asp Asp Tyr
Asn Leu Lys Trp Phe 35 40 45Leu Phe Pro Ile Asp Asn Asn Gln Tyr Ile
Ile Thr Ser Tyr Gly Ala 50 55 60Asn Asn Cys Lys Val Trp Asn Val Lys
Asn Asp Lys Ile Asn Val Ser65 70 75 80Thr Tyr Ser Ser Thr Asn Ser
Val Gln Lys Trp Gln Ile Lys Ala Lys 85 90 95Asp Ser Ser Tyr Ile Ile
Gln Ser Asp Asn Gly Lys Val Leu Thr Ala 100 105 110Gly Val Gly Gln
Ser Leu Gly Ile Val Arg Leu Thr Asp Glu Phe Pro 115 120 125Glu Asn
Ser Asn Gln Gln Trp Asn Leu Thr Pro Val Gln Thr Ile Gln 130 135
140Leu Pro Gln Lys Pro Lys Ile Asp Glu Lys Leu Lys Asp His Pro
Glu145 150 155 160Tyr Ser Glu Thr Gly Asn Ile Asn Pro Lys Thr Thr
Pro Gln Leu Met 165 170 175Gly Trp Thr Leu Val Pro Cys Ile Met Val
Asn Asp Ser Lys Ile Asp 180 185 190Lys Asn Thr Gln Ile Lys Thr Thr
Pro Tyr Tyr Ile Phe Lys Lys Tyr 195 200 205Lys Tyr Trp Asn Leu Ala
Lys Gly Ser Asn Val Ser Leu Leu Pro His 210 215 220Gln Lys Arg Ser
Tyr Asp Tyr Glu Trp Gly Thr Glu Lys Asn Gln Lys225 230 235 240Thr
Thr Ile Ile Asn Thr Val Gly Leu Gln Ile Asn Ile Asp Ser Gly 245 250
255Met Lys Phe Glu Val Pro Glu Val Gly Gly Gly Thr Glu Asp Ile Lys
260 265 270Thr Gln Leu Thr Glu Glu Leu Lys Val Glu Tyr Ser Thr Glu
Thr Lys 275 280 285Ile Met Thr Lys Tyr Gln Glu His Ser Glu Ile Asp
Asn Pro Thr Asn 290 295 300Gln Pro Met Asn Ser Ile Gly Leu Leu Ile
Tyr Thr Ser Leu Glu Leu305 310 315 320Tyr Arg Tyr Asn Gly Thr Glu
Ile Lys Ile Met Asp Ile Glu Thr Ser 325 330 335Asp His Asp Thr Tyr
Thr Leu Thr Ser Tyr Pro Asn His Lys Glu Ala 340 345 350Leu Leu Leu
Leu Thr Asn His Ser Tyr Glu Glu Val Glu Glu Ile Thr 355 360 365Lys
Ile Pro Lys His Thr Leu Ile Lys Leu Lys Lys His Tyr Phe Lys 370 375
380Lys38512834DNABacillus thuringiensis 12ggactatatg cagcaactta
tttaagttta gatgattcag gtgttagttt aatgaataaa 60aatgatgatg atattgatga
ttataactta aaatggtttt tatttcctat tgatgatgat 120caatatatta
ttacaagcta tgcagcaaat aattgtaaag tttggaatgt taataatgat
180aaaataaatg tttcgactta ttcttcaaca aattcaatac aaaaatggca
aataaaagct 240aatggttctt catatgtaat acaaagtgat aatggaaaag
tcttaacagc aggaaccggt 300caagctcttg gattgatacg tttaactgat
gaatcctcaa ataatcccaa tcaacaatgg 360aatttaactt ctgtacaaac
aattcaactt ccacaaaaac ctataataga tacaaaatta 420aaagattatc
ccaaatattc accaactgga aatatagata atggaacatc tcctcaatta
480atgggatgga cattagtacc ttgtattatg gtaaatgatc caaatataga
taaaaatact 540caaattaaaa ctactccata ttatatttta aaaaaatatc
aatattggca acgagcagta 600ggaagtaatg tagctttacg tccacatgaa
aaaaaatcat atacttatga atggggcaca 660gaaatagatc aaaaaacaac
aattataaat acattaggat ttcaaatcaa tatagattca 720ggaatgaaat
ttgatatacc agaagtaggt ggaggtacag atgaaataaa aacacaacta
780aatgaagaat taaaaataga atatagtcat gaaactaaaa taatggaaaa atat
83413278PRTBacillus thuringiensis 13Gly Leu Tyr Ala Ala Thr Tyr Leu
Ser Leu Asp Asp Ser Gly Val Ser1 5 10 15Leu Met Asn Lys Asn Asp Asp
Asp Ile Asp Asp Tyr Asn Leu Lys Trp 20 25 30Phe Leu Phe Pro Ile Asp
Asp Asp Gln Tyr Ile Ile Thr Ser Tyr Ala 35 40 45Ala Asn Asn Cys Lys
Val Trp Asn Val Asn Asn Asp Lys Ile Asn Val 50 55 60Ser Thr Tyr Ser
Ser Thr Asn Ser Ile Gln Lys Trp Gln Ile Lys Ala65 70 75 80Asn Gly
Ser Ser Tyr Val Ile Gln Ser Asp Asn Gly Lys Val Leu Thr 85 90 95Ala
Gly Thr Gly Gln Ala Leu Gly Leu Ile Arg Leu Thr Asp Glu Ser 100 105
110Ser Asn Asn Pro Asn Gln Gln Trp Asn Leu Thr Ser Val Gln Thr Ile
115 120 125Gln Leu Pro Gln Lys Pro Ile Ile Asp Thr Lys Leu Lys Asp
Tyr Pro 130 135 140Lys Tyr Ser Pro Thr Gly Asn Ile Asp Asn Gly Thr
Ser Pro Gln Leu145 150 155 160Met Gly Trp Thr Leu Val Pro Cys Ile
Met Val Asn Asp Pro Asn Ile 165 170 175Asp Lys Asn Thr Gln Ile Lys
Thr Thr Pro Tyr Tyr Ile Leu Lys Lys 180 185 190Tyr Gln Tyr Trp Gln
Arg Ala Val Gly Ser Asn Val Ala Leu Arg Pro 195 200 205His Glu Lys
Lys Ser Tyr Thr Tyr Glu Trp Gly Thr Glu Ile Asp Gln 210 215 220Lys
Thr Thr Ile Ile Asn Thr Leu Gly Phe Gln Ile Asn Ile Asp Ser225 230
235 240Gly Met Lys Phe Asp Ile Pro Glu Val Gly Gly Gly Thr Asp Glu
Ile 245 250 255Lys Thr Gln Leu Asn Glu Glu Leu Lys Ile Glu Tyr Ser
His Glu Thr 260 265 270Lys Ile Met Glu Lys Tyr 27514829DNABacillus
thuringiensis 14acatgcagca acttatttaa gtttagatga ttcaggtgtt
agtttaatga ataaaaatga 60tgatgatatt gatgactata atttaaggtg gtttttattt
cctattgatg ataatcaata 120tattattaca agctacgcag cgaataattg
taaggtttgg aatgttaata atgataaaat 180aaatgtttca acttattctt
caacaaactc gatacagaaa tggcaaataa aagctaatgc 240ttcttcgtat
gtaatacaaa gtaataatgg gaaagttcta acagcaggaa ccggtcaatc
300tcttggatta atacgtttaa cggatgaatc accagataat cccaatcaac
aatggaattt 360aactcctgta caaacaattc aactcccacc aaaacctaca
atagatacaa agttaaaaga 420ttaccccaaa tattcacaaa ctggcaatat
agacaaggga acacctcctc aattaatggg 480atggacatta ataccttgta
ttatggtaaa tgatcccaat atagataaaa acactcaaat 540caaaactact
ccatattata ttttaaaaaa atatcaatat tggcaacaag cagtaggaag
600taatgtagct ttacgtccgc atgaaaaaaa atcatatgct tatgagtggg
gtacagaaat 660agatcaaaaa acaactatca ttaatacatt aggatttcag
attaatatag attcgggaat 720gaaatttgat ataccagaag taggtggagg
tacagatgaa ataaaaacac aattaaacga 780agaattaaaa atagaatata
gccgtgaaac caaaataatg gaaaaatat 82915276PRTBacillus thuringiensis
15His Ala Ala Thr Tyr Leu Ser Leu Asp Asp Ser Gly Val Ser Leu Met1
5 10 15Asn Lys Asn Asp Asp Asp Ile Asp Asp Tyr Asn Leu Arg Trp Phe
Leu 20 25 30Phe Pro Ile Asp Asp Asn Gln Tyr Ile Ile Thr Ser Tyr Ala
Ala Asn 35 40 45Asn Cys Lys Val Trp Asn Val Asn Asn Asp Lys Ile Asn
Val Ser Thr 50 55 60Tyr Ser Ser Thr Asn Ser Ile Gln Lys Trp Gln Ile
Lys Ala Asn Ala65 70 75 80Ser Ser Tyr Val Ile Gln Ser Asn Asn Gly
Lys Val Leu Thr Ala Gly 85 90 95Thr Gly Gln Ser Leu Gly Leu Ile Arg
Leu Thr Asp Glu Ser Pro Asp 100 105 110Asn Pro Asn Gln Gln Trp Asn
Leu Thr Pro Val Gln Thr Ile Gln Leu 115 120 125Pro Pro Lys Pro Thr
Ile Asp Thr Lys Leu Lys Asp Tyr Pro Lys Tyr 130 135 140Ser Gln Thr
Gly Asn Ile Asp Lys Gly Thr Pro Pro Gln Leu Met Gly145 150 155
160Trp Thr Leu Ile Pro Cys Ile Met Val Asn Asp Pro Asn Ile Asp Lys
165 170 175Asn Thr Gln Ile Lys Thr Thr Pro Tyr Tyr Ile Leu Lys Lys
Tyr Gln 180 185 190Tyr Trp Gln Gln Ala Val Gly Ser Asn Val Ala Leu
Arg Pro His Glu 195 200 205Lys Lys Ser Tyr Ala Tyr Glu Trp Gly Thr
Glu Ile Asp Gln Lys Thr 210 215 220Thr Ile Ile Asn Thr Leu Gly Phe
Gln Ile Asn Ile Asp Ser Gly Met225 230 235 240Lys Phe Asp Ile Pro
Glu Val Gly Gly Gly Thr Asp Glu Ile Lys Thr 245 250 255Gln Leu Asn
Glu Glu Leu Lys Ile Glu Tyr Ser Arg Glu Thr Lys Ile 260 265 270Met
Glu Lys Tyr 275167PRTArtificial SequencePeptide sequence used in
primer design 16Asp Ile Asp Asp Tyr Asn Leu1 5177PRTArtificial
SequencePeptide sequence used in primer design 17Trp Phe Leu Phe
Pro Ile Asp1 5188PRTArtificial SequencePeptide sequence used in
primer design 18Gln Ile Lys Thr Thr Pro Tyr Tyr1 5196PRTArtificial
SequencePeptide sequence used in primer design 19Tyr Glu Trp Gly
Thr Glu1 52021DNAArtificial SequenceNucleotide sequence
corresponding to the peptide of SEQ ID NO16 20gatatngatg antayaaytt
n 212121DNAArtificial SequenceNucleotide sequence corresponding to
the peptide of SEQ ID NO17 21tggtttttnt ttccnatnga n
212224DNAArtificial SequenceNucleotide sequence corresponding to
the peptide of SEQ ID NO18 22caaatnaaaa cnacnccata ttat
242318DNAArtificial SequenceNucleotide sequence corresponding to
the peptide of SEQ ID NO19 23tangantggg gnacagaa
182424DNAArtificial SequenceReverse primer based on the reverse
complement of SEQ ID NO22 24ataatatggn gtngttttna tttg
242518DNAArtificial SequenceReverse primer based on the reverse
complement of SEQ ID NO23 25ttctgtnccc cantcnta 182618DNAArtificial
SequenceForward primer based on the PS80JJ1 44.3 kDa toxin
26ctcaaagcgg atcaggag 182720DNAArtificial SequenceReverse primer
based on the PS80JJ1 44.3 kDa toxin 27gcgtattcgg atatgcttgg
2028386PRTArtificial SequenceGeneric sequence representing a new
class of toxins 28Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa1 5 10 15Xaa Xaa Xaa Xaa Thr Tyr Leu Ser Leu Asp Asp
Ser Gly Val Ser Leu 20 25 30Met Xaa Lys Xaa Asp Xaa Asp Ile Asp Asp
Tyr Asn Leu Xaa Trp Phe 35 40 45Leu Phe Pro Ile Asp Xaa Xaa Gln Tyr
Ile Ile Thr Ser Tyr Xaa Ala 50 55 60Asn Asn Cys Lys Val Trp Asn Val
Xaa Asn Asp Lys Ile Asn Val Ser65 70 75 80Thr Tyr Ser Ser Thr Asn
Ser Xaa Gln Lys Trp Gln Ile Lys Ala Xaa 85 90 95Xaa Ser Ser Tyr Xaa
Ile Gln Ser Xaa Asn Gly Lys Val Leu Thr Ala 100 105 110Gly Xaa Gly
Gln Xaa Leu Gly Xaa Xaa Arg Leu Thr Asp Glu Xaa Xaa 115 120 125Xaa
Asn Xaa Asn Gln Gln Trp Asn Leu Thr Xaa Val Gln Thr Ile Gln 130 135
140Leu Pro Xaa Lys Pro Xaa Ile Asp Xaa Lys Leu Lys Asp Xaa Pro
Xaa145 150 155 160Tyr Ser Xaa Thr Gly Asn Ile Xaa Xaa Xaa Thr Xaa
Pro Gln Leu Met 165 170 175Gly Trp Thr Leu Xaa Pro Cys Ile Met Val
Asn Asp Xaa Xaa Ile Asp 180 185 190Lys Asn Thr Gln Ile Lys Thr Thr
Pro Tyr Tyr Ile Xaa Lys Lys Tyr 195 200 205Xaa Tyr Trp Xaa Xaa Ala
Xaa Gly Ser Asn Val Xaa Leu Xaa Pro His 210 215 220Xaa Lys Xaa Ser
Tyr Xaa Tyr Glu Trp Gly Thr Glu Xaa Xaa Gln Lys225 230 235 240Thr
Thr Ile Ile Asn Thr Xaa Gly Xaa Gln Ile Asn Ile Asp Ser Gly 245 250
255Met Lys Phe Xaa Xaa Pro Glu Val Gly Gly Gly Thr Xaa Xaa Ile Lys
260 265 270Thr Gln Leu Xaa Glu Glu Leu Lys Xaa Glu Tyr Ser Xaa Glu
Thr Lys 275 280 285Ile Met Xaa Lys Tyr Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa 290 295 300Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa305 310 315 320Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 325 330 335Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 340 345 350Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 355 360 365Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 370 375
380Xaa Xaa3852928DNAArtificial SequenceOligonucleotide probe
29gngaagtnca tatngaaatn aataatac 28302015DNABacillus thuringiensis
30attaatttta tggaggttga tatttatgtc agctcgcgaa gtacacattg aaataaacaa
60taaaacacgt catacattac aattagagga taaaactaaa cttagcggcg gtagatggcg
120aacatcacct acaaatgttg ctcgtgatac aattaaaaca tttgtagcag
aatcacatgg 180ttttatgaca ggagtagaag gtattatata ttttagtgta
aacggagacg cagaaattag 240tttacatttt gacaatcctt atataggttc
taataaatgt gatggttctt ctgataaacc 300tgaatatgaa gttattactc
aaagcggatc aggagataaa tctcatgtga catatactat 360tcagacagta
tctttacgat tataaggaaa atttataaaa actgtatttt ttactaaaat
420accaaaaaat acatatttat tttttggtat tttctaatat gaaatatgaa
ttataaaaat 480attaataaaa aaggtgataa aaattatgtt agatactaat
aaagtttatg aaataagcaa 540tcttgctaat ggattatata catcaactta
tttaagtctt gatgattcag gtgttagttt 600aatgagtaaa aaggatgaag
atattgatga
ttacaattta aaatggtttt tatttcctat 660tgataataat caatatatta
ttacaagcta tggagctaat aattgtaaag tttggaatgt 720taaaaatgat
aaaataaatg tttcaactta ttcttcaaca aactctgtac aaaaatggca
780aataaaagct aaagattctt catatataat acaaagtgat aatggaaagg
tcttaacagc 840aggagtaggt caatctcttg gaatagtacg cctaactgat
gaatttccag agaattctaa 900ccaacaatgg aatttaactc ctgtacaaac
aattcaactc ccacaaaaac ctaaaataga 960tgaaaaatta aaagatcatc
ctgaatattc agaaaccgga aatataaatc ctaaaacaac 1020tcctcaatta
atgggatgga cattagtacc ttgtattatg gtaaatgatt caaaaataga
1080taaaaacact caaattaaaa ctactccata ttatattttt aaaaaatata
aatactggaa 1140tctagcaaaa ggaagtaatg tatctttact tccacatcaa
aaaagatcat atgattatga 1200atggggtaca gaaaaaaatc aaaaaacaac
tattattaat acagtaggat tgcaaattaa 1260tatagattca ggaatgaaat
ttgaagtacc agaagtagga ggaggtacag aagacataaa 1320aacacaatta
actgaagaat taaaagttga atatagcact gaaaccaaaa taatgacgaa
1380atatcaagaa cactcagaga tagataatcc aactaatcaa ccaatgaatt
ctataggact 1440tcttatttat acttctttag aattatatcg atataacggt
acagaaatta agataatgga 1500catagaaact tcagatcatg atacttacac
tcttacttct tatccaaatc ataaagaagc 1560attattactt ctcacaaacc
attcgtatga agaagtagaa gaaataacaa aaatacctaa 1620gcatacactt
ataaaattga aaaaacatta ttttaaaaaa taaaaaacat aatatataaa
1680tgactgatta atatctctcg aaaaggttct ggtgcaaaaa tagtgggata
tgaaaaaagc 1740aaaagattcc taacggaatg gaacattagg ctgttaaatc
aaaaagttta ttgataaaat 1800atatctgcct ttggacagac ttctcccctt
ggagagtttg tccttttttg accatatgca 1860tagcttctat tccggcaatc
atttttgtag ctgtttgcaa ggattttaat ccaagcatat 1920ccgaatacgc
tttttgataa ccgatgtctt gttcaatgat attgtttaat attttcacac
1980gaattggcta ctgtgcggta tcctgtctcc tttat 201531360DNABacillus
thuringiensis 31atgtcagctc gcgaagtaca cattgaaata aacaataaaa
cacgtcatac attacaatta 60gaggataaaa ctaaacttag cggcggtaga tggcgaacat
cacctacaaa tgttgctcgt 120gatacaatta aaacatttgt agcagaatca
catggtttta tgacaggagt agaaggtatt 180atatatttta gtgtaaacgg
agacgcagaa attagtttac attttgacaa tccttatata 240ggttctaata
aatgtgatgg ttcttctgat aaacctgaat atgaagttat tactcaaagc
300ggatcaggag ataaatctca tgtgacatat actattcaga cagtatcttt
acgattataa 36032119PRTBacillus thuringiensis 32Met Ser Ala Arg Glu
Val His Ile Glu Ile Asn Asn Lys Thr Arg His1 5 10 15Thr Leu Gln Leu
Glu Asp Lys Thr Lys Leu Ser Gly Gly Arg Trp Arg 20 25 30Thr Ser Pro
Thr Asn Val Ala Arg Asp Thr Ile Lys Thr Phe Val Ala 35 40 45Glu Ser
His Gly Phe Met Thr Gly Val Glu Gly Ile Ile Tyr Phe Ser 50 55 60Val
Asn Gly Asp Ala Glu Ile Ser Leu His Phe Asp Asn Pro Tyr Ile65 70 75
80Gly Ser Asn Lys Cys Asp Gly Ser Ser Asp Lys Pro Glu Tyr Glu Val
85 90 95Ile Thr Gln Ser Gly Ser Gly Asp Lys Ser His Val Thr Tyr Thr
Ile 100 105 110Gln Thr Val Ser Leu Arg Leu 1153324DNAArtificial
SequenceReverse oligonucleotide primer 33catgagattt atctcctgat ccgc
24342230DNABacillus thuringiensis 34actatgacaa tgattatgac
tgctgatgaa ttagctttat caataccagg atattctaaa 60ccatcaaata taacaggaga
taaaagtaaa catacattat ttactaatat aattggagat 120attcaaataa
aagatcaagc aacatttggg gttgtttttg atccccctct taatcgtatt
180tcaggggctg aagaatcaag taagtttatt gatgtatatt atccttctga
agatagtaac 240cttaaatatt atcaatttat aaaagtagca attgattttg
atattaatga agattttatt 300aattttaata atcatgacaa tatagggata
tttaattttg ttacacgaaa ttttttatta 360aataatgaaa atgattaata
aaaaatttaa tttgtataat atgtttattt tttgaaaatt 420gaatgcatat
attaatcgag tatgtgtaat aaattttaat tttatggagg ttgatattta
480tgtcagcacg tgaagtacac attgatgtaa ataataagac aggtcataca
ttacaattag 540aagataaaac aaaacttgat ggtggtagat ggcgaacatc
acctacaaat gttgctaatg 600atcaaattaa aacatttgta gcagaatcac
atggttttat gacaggtaca gaaggtacta 660tatattatag tataaatgga
gaagcagaaa ttagtttata ttttgacaat ccttattcag 720gttctaataa
atatgatggg cattccaata aaaatcaata tgaagttatt acccaaggag
780gatcaggaaa tcaatctcat gttacgtata ctattcaaac tgtatcttca
cgatatggga 840ataattcata aaaaaatatt tttttttacg aaaataccaa
aaaaattttt ttggtatttt 900ctaatataat tcataaatat tttaataata
aaattataag aaaaggtgat aaatattatg 960ttagatacta ataaaattta
tgaaataagt aattatgcta atggattaca tgcagcaact 1020tatttaagtt
tagatgattc aggtgttagt ttaatgaata aaaatgatga tgatattgat
1080gactataatt taaggtggtt tttatttcct attgatgata atcaatatat
tattacaagc 1140tacgcagcga ataattgtaa ggtttggaat gttaataatg
ataaaataaa tgtttcaact 1200tattcttcaa caaactcgat acagaaatgg
caaataaaag ctaatgcttc ttcgtatgta 1260atacaaagta ataatgggaa
agttctaaca gcaggaaccg gtcaatctct tggattaata 1320cgtttaacgg
atgaatcacc agataatccc aatcaacaat ggaatttaac tcctgtacaa
1380acaattcaac tcccaccaaa acctacaata gatacaaagt taaaagatta
ccccaaatat 1440tcacaaactg gcaatataga caagggaaca cctcctcaat
taatgggatg gacattaata 1500ccttgtatta tggtaaatga tccaaatata
gataaaaaca ctcaaatcaa aactactcca 1560tattatattt taaaaaaata
tcaatattgg caacaagcag taggaagtaa tgtagcttta 1620cgtccgcatg
aaaaaaaatc atatgcttat gagtggggta cagaaataga tcaaaaaaca
1680actatcatta atacattagg atttcagatt aatatagatt cgggaatgaa
atttgatata 1740ccagaagtag gtggaggtac agatgaaata aaaacacaat
taaacgaaga attaaaaata 1800gaatatagcc gtgaaaccaa aataatggaa
aaatatcagg aacaatcaga gatagataat 1860ccaactgatc aatcaatgaa
ttctatagga ttcctcacta ttacttcttt agaattatat 1920cgatataatg
gttcggaaat tagtgtaatg aaaattcaaa cttcagataa tgatacttac
1980aatgtgacct cttatccaga tcatcaacaa gctctattac ttcttacaaa
tcattcatat 2040gaagaagtag aagaaataac aaatattccc aaaatatcac
tgaaaaaatt aaaaaaatat 2100tatttttaaa acataattat attttgatag
ctttttaaaa ataaagattg ttcaaagtaa 2160aatgaaagaa aatcttttat
gaaactttaa tacaataaaa gaggaatatt ttcttataag 2220tacttccttg
223035372DNABacillus thuringiensis 35atgtcagcac gtgaagtaca
cattgatgta aataataaga caggtcatac attacaatta 60gaagataaaa caaaacttga
tggtggtaga tggcgaacat cacctacaaa tgttgctaat 120gatcaaatta
aaacatttgt agcagaatca catggtttta tgacaggtac agaaggtact
180atatattata gtataaatgg agaagcagaa attagtttat attttgacaa
tccttattca 240ggttctaata aatatgatgg gcattccaat aaaaatcaat
atgaagttat tacccaagga 300ggatcaggaa atcaatctca tgttacgtat
actattcaaa ctgtatcttc acgatatggg 360aataattcat aa
37236123PRTBacillus thuringiensis 36Met Ser Ala Arg Glu Val His Ile
Asp Val Asn Asn Lys Thr Gly His1 5 10 15Thr Leu Gln Leu Glu Asp Lys
Thr Lys Leu Asp Gly Gly Arg Trp Arg 20 25 30Thr Ser Pro Thr Asn Val
Ala Asn Asp Gln Ile Lys Thr Phe Val Ala 35 40 45Glu Ser His Gly Phe
Met Thr Gly Thr Glu Gly Thr Ile Tyr Tyr Ser 50 55 60Ile Asn Gly Glu
Ala Glu Ile Ser Leu Tyr Phe Asp Asn Pro Tyr Ser65 70 75 80Gly Ser
Asn Lys Tyr Asp Gly His Ser Asn Lys Asn Gln Tyr Glu Val 85 90 95Ile
Thr Gln Gly Gly Ser Gly Asn Gln Ser His Val Thr Tyr Thr Ile 100 105
110Gln Thr Val Ser Ser Arg Tyr Gly Asn Asn Ser 115
120371152DNABacillus thuringiensis 37atgttagata ctaataaaat
ttatgaaata agtaattatg ctaatggatt acatgcagca 60acttatttaa gtttagatga
ttcaggtgtt agtttaatga ataaaaatga tgatgatatt 120gatgactata
atttaaggtg gtttttattt cctattgatg ataatcaata tattattaca
180agctacgcag cgaataattg taaggtttgg aatgttaata atgataaaat
aaatgtttca 240acttattctt caacaaactc gatacagaaa tggcaaataa
aagctaatgc ttcttcgtat 300gtaatacaaa gtaataatgg gaaagttcta
acagcaggaa ccggtcaatc tcttggatta 360atacgtttaa cggatgaatc
accagataat cccaatcaac aatggaattt aactcctgta 420caaacaattc
aactcccacc aaaacctaca atagatacaa agttaaaaga ttaccccaaa
480tattcacaaa ctggcaatat agacaaggga acacctcctc aattaatggg
atggacatta 540ataccttgta ttatggtaaa tgatccaaat atagataaaa
acactcaaat caaaactact 600ccatattata ttttaaaaaa atatcaatat
tggcaacaag cagtaggaag taatgtagct 660ttacgtccgc atgaaaaaaa
atcatatgct tatgagtggg gtacagaaat agatcaaaaa 720acaactatca
ttaatacatt aggatttcag attaatatag attcgggaat gaaatttgat
780ataccagaag taggtggagg tacagatgaa ataaaaacac aattaaacga
agaattaaaa 840atagaatata gccgtgaaac caaaataatg gaaaaatatc
aggaacaatc agagatagat 900aatccaactg atcaatcaat gaattctata
ggattcctca ctattacttc tttagaatta 960tatcgatata atggttcgga
aattagtgta atgaaaattc aaacttcaga taatgatact 1020tacaatgtga
cctcttatcc agatcatcaa caagctctat tacttcttac aaatcattca
1080tatgaagaag tagaagaaat aacaaatatt cccaaaatat cactgaaaaa
attaaaaaaa 1140tattattttt aa 115238383PRTBacillus thuringiensis
38Met Leu Asp Thr Asn Lys Ile Tyr Glu Ile Ser Asn Tyr Ala Asn Gly1
5 10 15Leu His Ala Ala Thr Tyr Leu Ser Leu Asp Asp Ser Gly Val Ser
Leu 20 25 30Met Asn Lys Asn Asp Asp Asp Ile Asp Asp Tyr Asn Leu Arg
Trp Phe 35 40 45Leu Phe Pro Ile Asp Asp Asn Gln Tyr Ile Ile Thr Ser
Tyr Ala Ala 50 55 60Asn Asn Cys Lys Val Trp Asn Val Asn Asn Asp Lys
Ile Asn Val Ser65 70 75 80Thr Tyr Ser Ser Thr Asn Ser Ile Gln Lys
Trp Gln Ile Lys Ala Asn 85 90 95Ala Ser Ser Tyr Val Ile Gln Ser Asn
Asn Gly Lys Val Leu Thr Ala 100 105 110Gly Thr Gly Gln Ser Leu Gly
Leu Ile Arg Leu Thr Asp Glu Ser Pro 115 120 125Asp Asn Pro Asn Gln
Gln Trp Asn Leu Thr Pro Val Gln Thr Ile Gln 130 135 140Leu Pro Pro
Lys Pro Thr Ile Asp Thr Lys Leu Lys Asp Tyr Pro Lys145 150 155
160Tyr Ser Gln Thr Gly Asn Ile Asp Lys Gly Thr Pro Pro Gln Leu Met
165 170 175Gly Trp Thr Leu Ile Pro Cys Ile Met Val Asn Asp Pro Asn
Ile Asp 180 185 190Lys Asn Thr Gln Ile Lys Thr Thr Pro Tyr Tyr Ile
Leu Lys Lys Tyr 195 200 205Gln Tyr Trp Gln Gln Ala Val Gly Ser Asn
Val Ala Leu Arg Pro His 210 215 220Glu Lys Lys Ser Tyr Ala Tyr Glu
Trp Gly Thr Glu Ile Asp Gln Lys225 230 235 240Thr Thr Ile Ile Asn
Thr Leu Gly Phe Gln Ile Asn Ile Asp Ser Gly 245 250 255Met Lys Phe
Asp Ile Pro Glu Val Gly Gly Gly Thr Asp Glu Ile Lys 260 265 270Thr
Gln Leu Asn Glu Glu Leu Lys Ile Glu Tyr Ser Arg Glu Thr Lys 275 280
285Ile Met Glu Lys Tyr Gln Glu Gln Ser Glu Ile Asp Asn Pro Thr Asp
290 295 300Gln Ser Met Asn Ser Ile Gly Phe Leu Thr Ile Thr Ser Leu
Glu Leu305 310 315 320Tyr Arg Tyr Asn Gly Ser Glu Ile Ser Val Met
Lys Ile Gln Thr Ser 325 330 335Asp Asn Asp Thr Tyr Asn Val Thr Ser
Tyr Pro Asp His Gln Gln Ala 340 345 350Leu Leu Leu Leu Thr Asn His
Ser Tyr Glu Glu Val Glu Glu Ile Thr 355 360 365Asn Ile Pro Lys Ile
Ser Leu Lys Lys Leu Lys Lys Tyr Tyr Phe 370 375
380392132DNABacillus thuringiensis 39gtatttcagg gggtgaagat
tcaagtaagt ttattgatgt atattatcct tttgaagata 60gtaattttaa atattatcaa
tttataaaag tagcaattga ttttgatatt aatgaagatt 120ttattaattt
taataatcat gacaatatag ggatatttaa ttttgttaca cgaaattttt
180tattaaataa tgaaaatgat gaataaaaaa tttaatttgt ttattatgtt
tattttttga 240aaattgaatg catatattaa tcgagtatgt ataataaatt
ttaattttat ggaggttgat 300atttatgtca gcacgtgaag tacacattga
tgtaaataat aagacaggtc atacattaca 360attagaagat aaaacaaaac
ttgatggtgg tagatggcga acatcaccta caaatgttgc 420taatgatcaa
attaaaacat ttgtagcaga atcaaatggt tttatgacag gtacagaagg
480tactatatat tatagtataa atggagaagc agaaattagt ttatattttg
acaatccttt 540tgcaggttct aataaatatg atggacattc caataaatct
caatatgaaa ttattaccca 600aggaggatca ggaaatcaat ctcatgttac
gtatactatt caaaccacat cctcacgata 660tgggcataaa tcataacaaa
taatttttta cgaaaatacc aaaaaataaa tattttttgg 720tattttctaa
tataaattac aaatatatta ataataaaat tataagaaaa ggtgataaag
780attatgttag atactaataa agtttatgaa ataagcaatc atgctaatgg
actatatgca 840gcaacttatt taagtttaga tgattcaggt gttagtttaa
tgaataaaaa tgatgatgat 900attgatgatt ataacttaaa atggttttta
tttcctattg atgatgatca atatattatt 960acaagctatg cagcaaataa
ttgtaaagtt tggaatgtta ataatgataa aataaatgtt 1020tcgacttatt
cttcaacaaa ttcaatacaa aaatggcaaa taaaagctaa tggttcttca
1080tatgtaatac aaagtgataa tggaaaagtc ttaacagcag gaaccggtca
agctcttgga 1140ttgatacgtt taactgatga atcctcaaat aatcccaatc
aacaatggaa tttaacttct 1200gtacaaacaa ttcaacttcc acaaaaacct
ataatagata caaaattaaa agattatccc 1260aaatattcac caactggaaa
tatagataat ggaacatctc ctcaattaat gggatggaca 1320ttagtacctt
gtattatggt aaatgatcca aatatagata aaaatactca aattaaaact
1380actccatatt atattttaaa aaaatatcaa tattggcaac gagcagtagg
aagtaatgta 1440gctttacgtc cacatgaaaa aaaatcatat acttatgaat
ggggcacaga aatagatcaa 1500aaaacaacaa ttataaatac attaggattt
caaatcaata tagattcagg aatgaaattt 1560gatataccag aagtaggtgg
aggtacagat gaaataaaaa cacaactaaa tgaagaatta 1620aaaatagaat
atagtcatga aactaaaata atggaaaaat atcaagaaca atctgaaata
1680gataatccaa ctgatcaatc aatgaattct ataggatttc ttactattac
ttccttagaa 1740ttatatagat ataatggctc agaaattcgt ataatgcaaa
ttcaaacctc agataatgat 1800acttataatg ttacttctta tccaaatcat
caacaagctt tattacttct tacaaatcat 1860tcatatgaag aagtagaaga
aataacaaat attcctaaaa gtacactaaa aaaattaaaa 1920aaatattatt
tttaaatatt gaaattagaa attatctaaa acaaaacgaa agataattta
1980atctttaatt atttgtaaga taatcgtatt ttatttgtat taatttttat
acaatataaa 2040gtaatatctg tacgtgaaat tggtttcgct tcaatatcta
atctcatctc atgtattaca 2100tgcgtaatac cttcttgttc tgcttctaca ag
213240372DNABacillus thuringiensis 40atgtcagcac gtgaagtaca
cattgatgta aataataaga caggtcatac attacaatta 60gaagataaaa caaaacttga
tggtggtaga tggcgaacat cacctacaaa tgttgctaat 120gatcaaatta
aaacatttgt agcagaatca aatggtttta tgacaggtac agaaggtact
180atatattata gtataaatgg agaagcagaa attagtttat attttgacaa
tccttttgca 240ggttctaata aatatgatgg acattccaat aaatctcaat
atgaaattat tacccaagga 300ggatcaggaa atcaatctca tgttacgtat
actattcaaa ccacatcctc acgatatggg 360cataaatcat aa
37241123PRTBacillus thuringiensis 41Met Ser Ala Arg Glu Val His Ile
Asp Val Asn Asn Lys Thr Gly His1 5 10 15Thr Leu Gln Leu Glu Asp Lys
Thr Lys Leu Asp Gly Gly Arg Trp Arg 20 25 30Thr Ser Pro Thr Asn Val
Ala Asn Asp Gln Ile Lys Thr Phe Val Ala 35 40 45Glu Ser Asn Gly Phe
Met Thr Gly Thr Glu Gly Thr Ile Tyr Tyr Ser 50 55 60Ile Asn Gly Glu
Ala Glu Ile Ser Leu Tyr Phe Asp Asn Pro Phe Ala65 70 75 80Gly Ser
Asn Lys Tyr Asp Gly His Ser Asn Lys Ser Gln Tyr Glu Ile 85 90 95Ile
Thr Gln Gly Gly Ser Gly Asn Gln Ser His Val Thr Tyr Thr Ile 100 105
110Gln Thr Thr Ser Ser Arg Tyr Gly His Lys Ser 115
120421241DNABacillus thuringiensismisc_feature(18)..(18)Any
nucleotide 42wcdmtkdvrm wahkcmdndb ygtrawbmkg cwtkctgyhd cywagmawtd
cvnwmhasrt 60nchhtmsnwr manrgarcrr nwrgarhatg ttagatacta ataaagttta
tgaaataagc 120aatcatgcta atggactata tgcagcaact tatttaagtt
tagatgattc aggtgttagt 180ttaatgaata aaaatgatga tgatattgat
gattataact taaaatggtt tttatttcct 240attgatgatg atcaatatat
tattacaagc tatgcagcaa ataattgtaa agtttggaat 300gttaataatg
ataaaataaa tgtttcgact tattcttcaa caaattcaat acaaaaatgg
360caaataaaag ctaatggttc ttcatatgta atacaaagtg ataatggaaa
agtcttaaca 420gcaggaaccg gtcaagctct tggattgata cgtttaactg
atgaatcctc aaataatccc 480aatcaacaat ggaatttaac ttctgtacaa
acaattcaac ttccacaaaa acctataata 540gatacaaaat taaaagatta
tcccaaatat tcaccaactg gaaatataga taatggaaca 600tctcctcaat
taatgggatg gacattagta ccttgtatta tggtaaatga tccaaatata
660gataaaaata ctcaaattaa aactactcca tattatattt taaaaaaata
tcaatattgg 720caacgagcag taggaagtaa tgtagcttta cgtccacatg
aaaaaaaatc atatacttat 780gaatggggca cagaaataga tcaaaaaaca
acaattataa atacattagg atttcaaatc 840aatatagatt caggaatgaa
atttgatata ccagaagtag gtggaggtac agatgaaata 900aaaacacaac
taaatgaaga attaaaaata gaatatagtc atgaaactaa aataatggaa
960aaatatcaag aacaatctga aatagataat ccaactgatc aatcaatgaa
ttctatagga 1020tttcttacta ttacttcctt agaattatat agatataatg
gctcagaaat tcgtataatg 1080caaattcaaa cctcagataa tgatacttat
aatgttactt cttatccaaa tcatcaacaa 1140gctttattac ttcttacaaa
tcattcatat gaagaagtag aagaaataac aaatattcct 1200aaaagtacac
taaaaaaatt aaaaaaatat tatttttaav v 124143383PRTBacillus
thuringiensis 43Met Leu Asp Thr Asn Lys Val Tyr Glu Ile Ser Asn His
Ala Asn Gly1 5 10 15Leu Tyr Ala Ala Thr Tyr Leu Ser Leu Asp Asp Ser
Gly Val Ser Leu 20 25 30Met Asn Lys Asn Asp Asp Asp Ile Asp Asp Tyr
Asn Leu Lys Trp Phe 35 40 45Leu Phe Pro Ile Asp Asp Asp Gln Tyr Ile
Ile Thr Ser Tyr Ala Ala 50 55 60Asn Asn Cys Lys Val Trp Asn Val Asn
Asn Asp Lys Ile Asn Val Ser65 70 75 80Thr Tyr Ser Ser Thr Asn Ser
Ile
Gln Lys Trp Gln Ile Lys Ala Asn 85 90 95Gly Ser Ser Tyr Val Ile Gln
Ser Asp Asn Gly Lys Val Leu Thr Ala 100 105 110Gly Thr Gly Gln Ala
Leu Gly Leu Ile Arg Leu Thr Asp Glu Ser Ser 115 120 125Asn Asn Pro
Asn Gln Gln Trp Asn Leu Thr Ser Val Gln Thr Ile Gln 130 135 140Leu
Pro Gln Lys Pro Ile Ile Asp Thr Lys Leu Lys Asp Tyr Pro Lys145 150
155 160Tyr Ser Pro Thr Gly Asn Ile Asp Asn Gly Thr Ser Pro Gln Leu
Met 165 170 175Gly Trp Thr Leu Val Pro Cys Ile Met Val Asn Asp Pro
Asn Ile Asp 180 185 190Lys Asn Thr Gln Ile Lys Thr Thr Pro Tyr Tyr
Ile Leu Lys Lys Tyr 195 200 205Gln Tyr Trp Gln Arg Ala Val Gly Ser
Asn Val Ala Leu Arg Pro His 210 215 220Glu Lys Lys Ser Tyr Thr Tyr
Glu Trp Gly Thr Glu Ile Asp Gln Lys225 230 235 240Thr Thr Ile Ile
Asn Thr Leu Gly Phe Gln Ile Asn Ile Asp Ser Gly 245 250 255Met Lys
Phe Asp Ile Pro Glu Val Gly Gly Gly Thr Asp Glu Ile Lys 260 265
270Thr Gln Leu Asn Glu Glu Leu Lys Ile Glu Tyr Ser His Glu Thr Lys
275 280 285Ile Met Glu Lys Tyr Gln Glu Gln Ser Glu Ile Asp Asn Pro
Thr Asp 290 295 300Gln Ser Met Asn Ser Ile Gly Phe Leu Thr Ile Thr
Ser Leu Glu Leu305 310 315 320Tyr Arg Tyr Asn Gly Ser Glu Ile Arg
Ile Met Gln Ile Gln Thr Ser 325 330 335Asp Asn Asp Thr Tyr Asn Val
Thr Ser Tyr Pro Asn His Gln Gln Ala 340 345 350Leu Leu Leu Leu Thr
Asn His Ser Tyr Glu Glu Val Glu Glu Ile Thr 355 360 365Asn Ile Pro
Lys Ser Thr Leu Lys Lys Leu Lys Lys Tyr Tyr Phe 370 375
38044360DNAArtificial SequenceMaize-optimized gene sequence
encoding the approximately 14 kDa toxin of 80JJ1 44atgtccgccc
gcgaggtgca catcgagatc aacaacaaga cccgccacac cctccagctc 60gaggacaaga
ccaagctctc cggcggcagg tggcgcacct ccccgaccaa cgtggcccgc
120gacaccatca agacgttcgt ggcggagtcc cacggcttca tgaccggcgt
cgagggcatc 180atctacttct ccgtgaacgg cgacgccgag atctccctcc
acttcgacaa cccgtacatc 240ggctccaaca agtgcgacgg ctcctccgac
aagcccgagt acgaggtgat cacccagtcc 300ggctccggcg acaagtccca
cgtgacctac accatccaga ccgtgtccct ccgcctctga 360451158DNAArtificial
SequenceMaize-optimized gene sequence encoding the approximately 44
kDa toxin of 80JJ1 45atgctcgaca ccaacaaggt gtacgagatc tccaacctcg
ccaacggcct ctacacctcc 60acctacctct ccctcgacga ctccggcgtg tccctcatgt
ccaagaagga cgaggacatc 120gacgactaca acctcaagtg gttcctcttc
ccgatcgaca acaaccagta catcatcacc 180tcctacggcg ccaacaactg
caaggtgtgg aacgtgaaga acgacaagat caacgtgtcc 240acctactcct
ccaccaactc cgtgcagaag tggcagatca aggccaagga ctcctcctac
300atcatccagt ccgacaacgg caaggtgctc accgcgggcg tgggccagtc
cctcggcatc 360gtgcgcctca ccgacgagtt cccggagaac tccaaccagc
aatggaacct caccccggtg 420cagaccatcc agctcccgca gaagccgaag
atcgacgaga agctcaagga ccacccggag 480tactccgaga ccggcaacat
caacccgaag accaccccgc agctcatggg ctggaccctc 540gtgccgtgca
tcatggtgaa cgactccaag atcgacaaga acacccagat caagaccacc
600ccgtactaca tcttcaagaa atacaagtac tggaacctcg ccaagggctc
caacgtgtcc 660ctcctcccgc accagaagcg cagctacgac tacgagtggg
gcaccgagaa gaaccagaag 720accaccatca tcaacaccgt gggcctgcag
atcaacatcg actcggggat gaagttcgag 780gtgccggagg tgggcggcgg
caccgaggac atcaagaccc agctcaccga ggagctgaag 840gtggagtact
ccaccgagac caagatcatg accaagtacc aggagcactc cgagatcgac
900aacccgacca accagccgat gaactccatc ggcctcctca tctacacctc
cctcgagctg 960taccgctaca acggcaccga gatcaagatc atggacatcg
agacctccga ccacgacacc 1020tacaccctca cctcctaccc gaaccacaag
gaggcgctgc tgctgctgac caaccactcc 1080tacgaggagg tggaggagat
caccaagatc ccgaagcaca ccctcatcaa gctcaagaag 1140cactacttca agaagtga
11584624DNAArtificial SequenceDNA sequence of a reverse primer
46gtagaagcag aacaagaagg tatt 244725DNAArtificial SequenceDNA
sequence of a forward primer 47atgtcagcwc gygaagtwca yattg
254823DNAArtificial SequenceDNA sequence of a reverse primer
48gtytgaathg tatahgthac atg 234925DNAArtificial SequenceDNA
sequence of a forward primer 49atgttagata cwaataaart wtatg
255029DNAArtificial SequenceDNA sequence of a reverse primer
50gtwatttctt cwacttcttc atahgaatg 2951341DNAArtificial SequenceDNA
sequence from PS131W2 which encodes the 14 kDa protein 51atgtcaggtc
gagaagtaca tattgaaata aacaataaaa cacgtcatac attacaatta 60gaggataaaa
ctaaacttag cggcggtaga tggcgaacat cacctacaaa tgttgctcgt
120gatacaatta aaacatttgt agcagaatca catggtttta tgacaggagt
agaaggtatt 180atatatttta gtgtaaacgg agacgcagaa attagtttac
attttgacaa tccttatata 240ggttctaata aatgtgatgg ttcttctgat
aaacctgaat atgaagttat tactcaaagc 300ggatcaggag ataaatctca
tgtaacatat actattcaga c 34152113PRTBacillus thuringiensis 52Met Ser
Gly Arg Glu Val His Ile Glu Ile Asn Asn Lys Thr Arg His1 5 10 15Thr
Leu Gln Leu Glu Asp Lys Thr Lys Leu Ser Gly Gly Arg Trp Arg 20 25
30Thr Ser Pro Thr Asn Val Ala Arg Asp Thr Ile Lys Thr Phe Val Ala
35 40 45Glu Ser His Gly Phe Met Thr Gly Val Glu Gly Ile Ile Tyr Phe
Ser 50 55 60Val Asn Gly Asp Ala Glu Ile Ser Leu His Phe Asp Asn Pro
Tyr Ile65 70 75 80Gly Ser Asn Lys Cys Asp Gly Ser Ser Asp Lys Pro
Glu Tyr Glu Val 85 90 95Ile Thr Gln Ser Gly Ser Gly Asp Lys Ser His
Val Thr Tyr Thr Ile 100 105 110Gln531103DNABacillus thuringiensis
53atgttagata caaataaagt ttatgaaata agcaatcttg ctaatggatt atatacatcm
60acttatttaa gtcttgatga ttcaggtgtt agtttaatga gtaaaaagga tgaagatatt
120gatgattaca atttaaaatg gtttttattt cctattgata ataatcaata
tattattaca 180agctatggag ctaataattg taaagtttgg aatgttaaaa
atgataaaat aaatgtttca 240acttattctt caacaaactc tgtacaaaaa
tggcaaataa aagctaaaga ttcttcatat 300ataatacaaa gtgataatgg
aaaggtctta acagcaggag taggtcaatc tcttggaata 360gtacgcctaa
ctgatgaatt tccagagaat tctaaccaac aatggaattt aactcctgta
420caaacaattc aactcccaca aaaacctaaa atagatgaaa aattaaaaga
tcatcctgaa 480tattcagaaa ccggaaatat aaatcctaaa acaactcctc
aattaatggg atggacatta 540gtaccttgta ttatggtaaa tgattcaaaa
atagataaaa acactcaaat taaaactact 600ccatattata tttttaaaaa
atataaatac tggaatctag caaaaggaag taatgtatct 660ttacttccac
atcaaaaaag atcatatgat tatgaatggg gtacagaaaa aaatcaaaaa
720acamctatta ttaatacagt aggattgcaa attaatatag actcaggaat
gaaatttgaa 780gtaccagaag taggaggagg tacagaagac ataaaaacac
aattaactga agaattaaaa 840gttgaatata gcactgaaac caaaataatg
acgaaatatc aagaacactc agagatagat 900aatccaacta atcaaccaat
gaattctata ggacttctta tttacacttc tttagaatta 960tatcgatata
acggtacaga aattaagata atggacatag aaacttcaga tcatgatact
1020tacactctta cttcttatcc aaatcataaa gaagcattat tacttctcac
aaaccattca 1080tatgaagaag tagaagaaat aac 110354367PRTBacillus
thuringiensisMISC_FEATURE(242)..(242)Undetermined in the deduced
amino acid sequence 54Met Leu Asp Thr Asn Lys Val Tyr Glu Ile Ser
Asn Leu Ala Asn Gly1 5 10 15Leu Tyr Thr Ser Thr Tyr Leu Ser Leu Asp
Asp Ser Gly Val Ser Leu 20 25 30Met Ser Lys Lys Asp Glu Asp Ile Asp
Asp Tyr Asn Leu Lys Trp Phe 35 40 45Leu Phe Pro Ile Asp Asn Asn Gln
Tyr Ile Ile Thr Ser Tyr Gly Ala 50 55 60Asn Asn Cys Lys Val Trp Asn
Val Lys Asn Asp Lys Ile Asn Val Ser65 70 75 80Thr Tyr Ser Ser Thr
Asn Ser Val Gln Lys Trp Gln Ile Lys Ala Lys 85 90 95Asp Ser Ser Tyr
Ile Ile Gln Ser Asp Asn Gly Lys Val Leu Thr Ala 100 105 110Gly Val
Gly Gln Ser Leu Gly Ile Val Arg Leu Thr Asp Glu Phe Pro 115 120
125Glu Asn Ser Asn Gln Gln Trp Asn Leu Thr Pro Val Gln Thr Ile Gln
130 135 140Leu Pro Gln Lys Pro Lys Ile Asp Glu Lys Leu Lys Asp His
Pro Glu145 150 155 160Tyr Ser Glu Thr Gly Asn Ile Asn Pro Lys Thr
Thr Pro Gln Leu Met 165 170 175Gly Trp Thr Leu Val Pro Cys Ile Met
Val Asn Asp Ser Lys Ile Asp 180 185 190Lys Asn Thr Gln Ile Lys Thr
Thr Pro Tyr Tyr Ile Phe Lys Lys Tyr 195 200 205Lys Tyr Trp Asn Leu
Ala Lys Gly Ser Asn Val Ser Leu Leu Pro His 210 215 220Gln Lys Arg
Ser Tyr Asp Tyr Glu Trp Gly Thr Glu Lys Asn Gln Lys225 230 235
240Thr Xaa Ile Ile Asn Thr Val Gly Leu Gln Ile Asn Ile Asp Ser Gly
245 250 255Met Lys Phe Glu Val Pro Glu Val Gly Gly Gly Thr Glu Asp
Ile Lys 260 265 270Thr Gln Leu Thr Glu Glu Leu Lys Val Glu Tyr Ser
Thr Glu Thr Lys 275 280 285Ile Met Thr Lys Tyr Gln Glu His Ser Glu
Ile Asp Asn Pro Thr Asn 290 295 300Gln Pro Met Asn Ser Ile Gly Leu
Leu Ile Tyr Thr Ser Leu Glu Leu305 310 315 320Tyr Arg Tyr Asn Gly
Thr Glu Ile Lys Ile Met Asp Ile Glu Thr Ser 325 330 335Asp His Asp
Thr Tyr Thr Leu Thr Ser Tyr Pro Asn His Lys Glu Ala 340 345 350Leu
Leu Leu Leu Thr Asn His Ser Tyr Glu Glu Val Glu Glu Ile 355 360
36555341DNABacillus thuringiensis 55atgtcagctc gtgaagtaca
tattgatgta aataataaga caggtcatac attacaatta 60gaagataaaa caaaacttga
tggtggtaga tggcgaacat cacctacaaa tgttgctaat 120gatcaaatta
aaacatttgt agcagaatca catggtttta tgacaggtac agaaggtcat
180atatattata gtataaatgg agaagcagaa attagtttat attttgataa
tccttattca 240ggttctaata aatatgatgg ggattccaat aaacctcaat
atgaagttac tacccaagga 300ggatcaggaa atcaatctca tgtaacatat
acgattcaaa c 34156113PRTBacillus thuringiensis 56Met Ser Ala Arg
Glu Val His Ile Asp Val Asn Asn Lys Thr Gly His1 5 10 15Thr Leu Gln
Leu Glu Asp Lys Thr Lys Leu Asp Gly Gly Arg Trp Arg 20 25 30Thr Ser
Pro Thr Asn Val Ala Asn Asp Gln Ile Lys Thr Phe Val Ala 35 40 45Glu
Ser His Gly Phe Met Thr Gly Thr Glu Gly His Ile Tyr Tyr Ser 50 55
60Ile Asn Gly Glu Ala Glu Ile Ser Leu Tyr Phe Asp Asn Pro Tyr Ser65
70 75 80Gly Ser Asn Lys Tyr Asp Gly Asp Ser Asn Lys Pro Gln Tyr Glu
Val 85 90 95Thr Thr Gln Gly Gly Ser Gly Asn Gln Ser His Val Thr Tyr
Thr Ile 100 105 110Gln 571103DNABacillus
thuringiensismisc_feature(1028)..(1028)Unknown 57atgttagata
ctaataaagt ttatgaaata agtaatcatg ctaatggact atatgcagca 60acttatttaa
gtttagatga ttcaggtgtt agtttaatga ataaaaatga tgatgatatt
120gatgattaca acttaaaatg gtttttattt cctattgatg atgatcaata
tattattaca 180agctatgcag caaataattg taaagtttgg aatgttaata
atgataaaat aaatgtttcg 240acttattctt taacaaattc aatacaaaaa
tggcaaataa aagctaatgg ttcttcatat 300gtaatacaaa gtgataatgg
aaaagtctta acagcaggaa ccggtcaagc tcttggattg 360atacgtttaa
ctgatgaatc ttcaaataat cccaatcaac aatggaattt aacttctgta
420caaacaattc aacttccaca aaaacctata atagatacaa aattaaaaga
ttatcccaaa 480tattcaccaa ctggaaatat agataatgga acatctcctc
aattaatggg atggacatta 540gtaccttgta ttatggtaaa tgatccaaat
atagataaaa atactcaaat taaaactact 600ccatattata ttttaaaaaa
atatcaatat tggcaacgag cagtaggaag taatgtagct 660ttacgtccac
atgaaaaaaa atcatatact tatgaatggg gaacagaaat agatcaaaaa
720acaacaatca taaatacatt aggatttcaa atcaatatag attcaggaat
gaaatttgat 780ataccagaag taggtggagg tacagatgaa ataaaaacac
aactaaatga agaattaaaa 840atagaatata gtcgtgaaac taaaataatg
gaaaaatatc aagaacaatc tgaaatagat 900aatccaactg atcaaccaat
gaattctata ggatttctta ctattacttc tttagaatta 960tatagatata
atggctcaga aattcgtata atgcaaattc aaacctcaga taatgatact
1020tataatgnta cttcttatcc agatcatcaa caagctttat tacttcttac
aaatcattca 1080tatgaagaac tagaagaaat aac 110358367PRTBacillus
thuringiensisMISC_FEATURE(343)..(343)Undetermined in the deduced
amino acid sequence 58Met Leu Asp Thr Asn Lys Val Tyr Glu Ile Ser
Asn His Ala Asn Gly1 5 10 15Leu Tyr Ala Ala Thr Tyr Leu Ser Leu Asp
Asp Ser Gly Val Ser Leu 20 25 30Met Asn Lys Asn Asp Asp Asp Ile Asp
Asp Tyr Asn Leu Lys Trp Phe 35 40 45Leu Phe Pro Ile Asp Asp Asp Gln
Tyr Ile Ile Thr Ser Tyr Ala Ala 50 55 60Asn Asn Cys Lys Val Trp Asn
Val Asn Asn Asp Lys Ile Asn Val Ser65 70 75 80Thr Tyr Ser Leu Thr
Asn Ser Ile Gln Lys Trp Gln Ile Lys Ala Asn 85 90 95Gly Ser Ser Tyr
Val Ile Gln Ser Asp Asn Gly Lys Val Leu Thr Ala 100 105 110Gly Thr
Gly Gln Ala Leu Gly Leu Ile Arg Leu Thr Asp Glu Ser Ser 115 120
125Asn Asn Pro Asn Gln Gln Trp Asn Leu Thr Ser Val Gln Thr Ile Gln
130 135 140Leu Pro Gln Lys Pro Ile Ile Asp Thr Lys Leu Lys Asp Tyr
Pro Lys145 150 155 160Tyr Ser Pro Thr Gly Asn Ile Asp Asn Gly Thr
Ser Pro Gln Leu Met 165 170 175Gly Trp Thr Leu Val Pro Cys Ile Met
Val Asn Asp Pro Asn Ile Asp 180 185 190Lys Asn Thr Gln Ile Lys Thr
Thr Pro Tyr Tyr Ile Leu Lys Lys Tyr 195 200 205Gln Tyr Trp Gln Arg
Ala Val Gly Ser Asn Val Ala Leu Arg Pro His 210 215 220Glu Lys Lys
Ser Tyr Thr Tyr Glu Trp Gly Thr Glu Ile Asp Gln Lys225 230 235
240Thr Thr Ile Ile Asn Thr Leu Gly Phe Gln Ile Asn Ile Asp Ser Gly
245 250 255Met Lys Phe Asp Ile Pro Glu Val Gly Gly Gly Thr Asp Glu
Ile Lys 260 265 270Thr Gln Leu Asn Glu Glu Leu Lys Ile Glu Tyr Ser
Arg Glu Thr Lys 275 280 285Ile Met Glu Lys Tyr Gln Glu Gln Ser Glu
Ile Asp Asn Pro Thr Asp 290 295 300Gln Pro Met Asn Ser Ile Gly Phe
Leu Thr Ile Thr Ser Leu Glu Leu305 310 315 320Tyr Arg Tyr Asn Gly
Ser Glu Ile Arg Ile Met Gln Ile Gln Thr Ser 325 330 335Asp Asn Asp
Thr Tyr Asn Xaa Thr Ser Tyr Pro Asp His Gln Gln Ala 340 345 350Leu
Leu Leu Leu Thr Asn His Ser Tyr Glu Glu Leu Glu Glu Ile 355 360
36559340DNABacillus thuringiensis 59atgtcagcag gtgaagtaca
tattgatgca aataataaga caggtcatac attacaatta 60gaagataaaa caaaacttga
tggtggtaga tggcgaacat cacctacaaa tgttgctaat 120gatcaaatta
aaacatttgt agcagaatca catggtttta tgacaggtac agaaggtcat
180atatattata gtataaatgg agaagcagaa attagtttat attttgataa
tccttattca 240ggttctaata aatatgatgg ggattccaat aaacctcaat
atgaagttac tacccaagga 300ggatcaggaa atcaatctca tgttacttat
acaattcaaa 34060113PRTBacillus thuringiensis 60Met Ser Ala Gly Glu
Val His Ile Asp Ala Asn Asn Lys Thr Gly His1 5 10 15Thr Leu Gln Leu
Glu Asp Lys Thr Lys Leu Asp Gly Gly Arg Trp Arg 20 25 30Thr Ser Pro
Thr Asn Val Ala Asn Asp Gln Ile Lys Thr Phe Val Ala 35 40 45Glu Ser
His Gly Phe Met Thr Gly Thr Glu Gly His Ile Tyr Tyr Ser 50 55 60Ile
Asn Gly Glu Ala Glu Ile Ser Leu Tyr Phe Asp Asn Pro Tyr Ser65 70 75
80Gly Ser Asn Lys Tyr Asp Gly Asp Ser Asn Lys Pro Gln Tyr Glu Val
85 90 95Thr Thr Gln Gly Gly Ser Gly Asn Gln Ser His Val Thr Tyr Thr
Ile 100 105 110Gln 61340DNABacillus thuringiensis 61tgtcagcacg
tgaagtacat attgaaataa acaataaaac acgtcataca ttacaattag 60aggataaaac
taaacttagc ggcggtagat ggcgaacatc acctacaaat gttgctcgtg
120atacaattaa aacatttgta gcagaatcac atggttttat gacaggagta
gaaggtatta 180tatattttag tgtaaacgga gacgcagaaa ttagtttaca
ttttgacaat ccttatatag 240gttctaataa atgtgatggt tcttctgata
aacctgaata tgaagttatt actcaaagcg 300gatcaggaga taaatctcat
gtgacatata cgattcagac 34062112PRTBacillus thuringiensis 62Ser Ala
Arg Glu Val His Ile Glu Ile Asn Asn Lys Thr Arg His Thr1 5 10 15Leu
Gln Leu Glu Asp Lys
Thr Lys Leu Ser Gly Gly Arg Trp Arg Thr 20 25 30Ser Pro Thr Asn Val
Ala Arg Asp Thr Ile Lys Thr Phe Val Ala Glu 35 40 45Ser His Gly Phe
Met Thr Gly Val Glu Gly Ile Ile Tyr Phe Ser Val 50 55 60Asn Gly Asp
Ala Glu Ile Ser Leu His Phe Asp Asn Pro Tyr Ile Gly65 70 75 80Ser
Asn Lys Cys Asp Gly Ser Ser Asp Lys Pro Glu Tyr Glu Val Ile 85 90
95Thr Gln Ser Gly Ser Gly Asp Lys Ser His Val Thr Tyr Thr Ile Gln
100 105 110631114DNABacillus thuringiensis 63atgttagata ctaataaaat
ttatgaaata agcaatcttg ctaatggatt atatacatca 60acttatttaa gtcttgatga
ttcaggtgtt agtttaatga gtaaaaagga tgaagatatt 120gatgattaca
atttaaaatg gtttttattt cctattgata ataatcaata tattattaca
180agctatggag ctaataattg taaagtttgg aatgttaaaa atgataaaat
aaatgtttca 240acttattctt caacaaactc tgtacaaaaa tggcaaataa
aagctaaaga ttcttcatat 300ataatacaaa gtgataatgg aaaggtctta
acagcaggag taggtcaatc tcttggaata 360gtacgcctaa ctgatgaatt
tccagagaat tctaaccaac aatggaattt aactcctgta 420caaacaattc
aactcccaca aaaacctaaa atagatgaaa aattaaaaga tcatcctgaa
480tattcagaaa ccggaaatat aaatcctaaa acaactcctc aattaatggg
atggacatta 540gtaccttgta ttatggtaaa tgattcaaaa atagataaaa
acactcaaat taaaactact 600ccatattata tttttaaaaa atataaatac
tggaatctag caaaaggaag taatgtatct 660ttacttccac atcaaaaaag
atcatatgat tatgaatggg gtacagaaaa aaatcaaaaa 720acaactatta
ttaatacagt aggattgcaa attaatatag attcaggaat gaaatttgaa
780gtaccagaag taggaggagg tacagaagac ataaaaacac aattaactga
agaattaaaa 840gttgaatata gcactgaaac caaaataatg acgaaatatc
aagaacactc agagatagat 900aatccaacta atcaaccaat gaattctata
ggacttctta tttatacttc tttagaatta 960tatcgatata acggtacaga
aattaagata atggacatag aaacttcaga tcatgatact 1020tacactctta
cttcttatcc aaatcataaa gaagcattat tacttctcac aaaccattct
1080tatgaagaac tagaacaaat tacaagggcg aatt 111464371PRTBacillus
thuringiensis 64Met Leu Asp Thr Asn Lys Ile Tyr Glu Ile Ser Asn Leu
Ala Asn Gly1 5 10 15Leu Tyr Thr Ser Thr Tyr Leu Ser Leu Asp Asp Ser
Gly Val Ser Leu 20 25 30Met Ser Lys Lys Asp Glu Asp Ile Asp Asp Tyr
Asn Leu Lys Trp Phe 35 40 45Leu Phe Pro Ile Asp Asn Asn Gln Tyr Ile
Ile Thr Ser Tyr Gly Ala 50 55 60Asn Asn Cys Lys Val Trp Asn Val Lys
Asn Asp Lys Ile Asn Val Ser65 70 75 80Thr Tyr Ser Ser Thr Asn Ser
Val Gln Lys Trp Gln Ile Lys Ala Lys 85 90 95Asp Ser Ser Tyr Ile Ile
Gln Ser Asp Asn Gly Lys Val Leu Thr Ala 100 105 110Gly Val Gly Gln
Ser Leu Gly Ile Val Arg Leu Thr Asp Glu Phe Pro 115 120 125Glu Asn
Ser Asn Gln Gln Trp Asn Leu Thr Pro Val Gln Thr Ile Gln 130 135
140Leu Pro Gln Lys Pro Lys Ile Asp Glu Lys Leu Lys Asp His Pro
Glu145 150 155 160Tyr Ser Glu Thr Gly Asn Ile Asn Pro Lys Thr Thr
Pro Gln Leu Met 165 170 175Gly Trp Thr Leu Val Pro Cys Ile Met Val
Asn Asp Ser Lys Ile Asp 180 185 190Lys Asn Thr Gln Ile Lys Thr Thr
Pro Tyr Tyr Ile Phe Lys Lys Tyr 195 200 205Lys Tyr Trp Asn Leu Ala
Lys Gly Ser Asn Val Ser Leu Leu Pro His 210 215 220Gln Lys Arg Ser
Tyr Asp Tyr Glu Trp Gly Thr Glu Lys Asn Gln Lys225 230 235 240Thr
Thr Ile Ile Asn Thr Val Gly Leu Gln Ile Asn Ile Asp Ser Gly 245 250
255Met Lys Phe Glu Val Pro Glu Val Gly Gly Gly Thr Glu Asp Ile Lys
260 265 270Thr Gln Leu Thr Glu Glu Leu Lys Val Glu Tyr Ser Thr Glu
Thr Lys 275 280 285Ile Met Thr Lys Tyr Gln Glu His Ser Glu Ile Asp
Asn Pro Thr Asn 290 295 300Gln Pro Met Asn Ser Ile Gly Leu Leu Ile
Tyr Thr Ser Leu Glu Leu305 310 315 320Tyr Arg Tyr Asn Gly Thr Glu
Ile Lys Ile Met Asp Ile Glu Thr Ser 325 330 335Asp His Asp Thr Tyr
Thr Leu Thr Ser Tyr Pro Asn His Lys Glu Ala 340 345 350Leu Leu Leu
Leu Thr Asn His Ser Tyr Glu Glu Leu Glu Gln Ile Thr 355 360 365Arg
Ala Asn 37065360DNABacillus thuringiensis 65atgtcagctc gcgaagtaca
cattgaaata aacaataaaa cacgtcatac attacaatta 60gaggataaaa ctaaacttag
cggcggtaga tggcgaacat cacctacaaa tgttgctcgt 120gatacaatta
aaacatttgt agcagaatca catggtttta tgacaggagt agaaggtatt
180atatatttta gtgtaaacgg agacgcagaa attagtttac attttgacaa
tccttatata 240ggttctaata aatgtgatgg ttcttctgat aaacctgaat
atgaagttat tactcaaagc 300ggatcaggag ataaatctca tgtgacatat
actattcaga cagtatcttt acgattataa 36066119PRTBacillus thuringiensis
66Met Ser Ala Arg Glu Val His Ile Glu Ile Asn Asn Lys Thr Arg His1
5 10 15Thr Leu Gln Leu Glu Asp Lys Thr Lys Leu Ser Gly Gly Arg Trp
Arg 20 25 30Thr Ser Pro Thr Asn Val Ala Arg Asp Thr Ile Lys Thr Phe
Val Ala 35 40 45Glu Ser His Gly Phe Met Thr Gly Val Glu Gly Ile Ile
Tyr Phe Ser 50 55 60Val Asn Gly Asp Ala Glu Ile Ser Leu His Phe Asp
Asn Pro Tyr Ile65 70 75 80Gly Ser Asn Lys Cys Asp Gly Ser Ser Asp
Lys Pro Glu Tyr Glu Val 85 90 95Ile Thr Gln Ser Gly Ser Gly Asp Lys
Ser His Val Thr Tyr Thr Ile 100 105 110Gln Thr Val Ser Leu Arg Leu
115671158DNABacillus thuringiensis 67atgttagata ctaataaagt
ttatgaaata agcaatcttg ctaatggatt atatacatca 60acttatttaa gtcttgatga
ttcaggtgtt agtttaatga gtaaaaagga tgaagatatt 120gatgattaca
atttaaaatg gtttttattt cctattgata ataatcaata tattattaca
180agctatggag ctaataattg taaagtttgg aatgttaaaa atgataaaat
aaatgtttca 240acttattctt caacaaactc tgtacaaaaa tggcaaataa
aagctaaaga ttcttcatat 300ataatacaaa gtgataatgg aaaggtctta
acagcaggag taggtcaatc tcttggaata 360gtacgcctaa ctgatgaatt
tccagagaat tctaaccaac aatggaattt aactcctgta 420caaacaattc
aactcccaca aaaacctaaa atagatgaaa aattaaaaga tcatcctgaa
480tattcagaaa ccggaaatat aaatcctaaa acaactcctc aattaatggg
atggacatta 540gtaccttgta ttatggtaaa tgattcaaaa atagataaaa
acactcaaat taaaactact 600ccatattata tttttaaaaa atataaatac
tggaatctag caaaaggaag taatgtatct 660ttacttccac atcaaaaaag
atcatatgat tatgaatggg gtacagaaaa aaatcaaaaa 720acaactatta
ttaatacagt aggattgcaa attaatatag attcaggaat gaaatttgaa
780gtaccagaag taggaggagg tacagaagac ataaaaacac aattaactga
agaattaaaa 840gttgaatata gcactgaaac caaaataatg acgaaatatc
aagaacactc agagatagat 900aatccaacta atcaaccaat gaattctata
ggacttctta tttatacttc tttagaatta 960tatcgatata acggtacaga
aattaagata atggacatag aaacttcaga tcatgatact 1020tacactctta
cttcttatcc aaatcataaa gaagcattat tacttctcac aaaccattcg
1080tatgaagaag tagaagaaat aacaaaaata cctaagcata cacttataaa
attgaaaaaa 1140cattatttta aaaaataa 115868385PRTBacillus
thuringiensis 68Met Leu Asp Thr Asn Lys Val Tyr Glu Ile Ser Asn Leu
Ala Asn Gly1 5 10 15Leu Tyr Thr Ser Thr Tyr Leu Ser Leu Asp Asp Ser
Gly Val Ser Leu 20 25 30Met Ser Lys Lys Asp Glu Asp Ile Asp Asp Tyr
Asn Leu Lys Trp Phe 35 40 45Leu Phe Pro Ile Asp Asn Asn Gln Tyr Ile
Ile Thr Ser Tyr Gly Ala 50 55 60Asn Asn Cys Lys Val Trp Asn Val Lys
Asn Asp Lys Ile Asn Val Ser65 70 75 80Thr Tyr Ser Ser Thr Asn Ser
Val Gln Lys Trp Gln Ile Lys Ala Lys 85 90 95Asp Ser Ser Tyr Ile Ile
Gln Ser Asp Asn Gly Lys Val Leu Thr Ala 100 105 110Gly Val Gly Gln
Ser Leu Gly Ile Val Arg Leu Thr Asp Glu Phe Pro 115 120 125Glu Asn
Ser Asn Gln Gln Trp Asn Leu Thr Pro Val Gln Thr Ile Gln 130 135
140Leu Pro Gln Lys Pro Lys Ile Asp Glu Lys Leu Lys Asp His Pro
Glu145 150 155 160Tyr Ser Glu Thr Gly Asn Ile Asn Pro Lys Thr Thr
Pro Gln Leu Met 165 170 175Gly Trp Thr Leu Val Pro Cys Ile Met Val
Asn Asp Ser Lys Ile Asp 180 185 190Lys Asn Thr Gln Ile Lys Thr Thr
Pro Tyr Tyr Ile Phe Lys Lys Tyr 195 200 205Lys Tyr Trp Asn Leu Ala
Lys Gly Ser Asn Val Ser Leu Leu Pro His 210 215 220Gln Lys Arg Ser
Tyr Asp Tyr Glu Trp Gly Thr Glu Lys Asn Gln Lys225 230 235 240Thr
Thr Ile Ile Asn Thr Val Gly Leu Gln Ile Asn Ile Asp Ser Gly 245 250
255Met Lys Phe Glu Val Pro Glu Val Gly Gly Gly Thr Glu Asp Ile Lys
260 265 270Thr Gln Leu Thr Glu Glu Leu Lys Val Glu Tyr Ser Thr Glu
Thr Lys 275 280 285Ile Met Thr Lys Tyr Gln Glu His Ser Glu Ile Asp
Asn Pro Thr Asn 290 295 300Gln Pro Met Asn Ser Ile Gly Leu Leu Ile
Tyr Thr Ser Leu Glu Leu305 310 315 320Tyr Arg Tyr Asn Gly Thr Glu
Ile Lys Ile Met Asp Ile Glu Thr Ser 325 330 335Asp His Asp Thr Tyr
Thr Leu Thr Ser Tyr Pro Asn His Lys Glu Ala 340 345 350Leu Leu Leu
Leu Thr Asn His Ser Tyr Glu Glu Val Glu Glu Ile Thr 355 360 365Lys
Ile Pro Lys His Thr Leu Ile Lys Leu Lys Lys His Tyr Phe Lys 370 375
380Lys38569341DNABacillus thuringiensis 69atgtcagcac gagaagtaca
cattgatgta aataataaga caggtcatac attacaatta 60gaagataaaa caaaacttga
tggtggtaga tggcgaacat cacctacaaa tgttgctaat 120gatcaaatta
aaacatctgt agcagaatca aatggtttta tgacaggtac agaaggtact
180atatattata gtataaatgg agaagcagaa attagtttat attttgacaa
tccttttgca 240ggttctaata aatatgatgg acattccaat aaatctcaat
atgaaattat tacccaagga 300ggatcaggaa atcaatctca tgttacttat
acaattcaga c 34170113PRTBacillus thuringiensis 70Met Ser Ala Arg
Glu Val His Ile Asp Val Asn Asn Lys Thr Gly His1 5 10 15Thr Leu Gln
Leu Glu Asp Lys Thr Lys Leu Asp Gly Gly Arg Trp Arg 20 25 30Thr Ser
Pro Thr Asn Val Ala Asn Asp Gln Ile Lys Thr Ser Val Ala 35 40 45Glu
Ser Asn Gly Phe Met Thr Gly Thr Glu Gly Thr Ile Tyr Tyr Ser 50 55
60Ile Asn Gly Glu Ala Glu Ile Ser Leu Tyr Phe Asp Asn Pro Phe Ala65
70 75 80Gly Ser Asn Lys Tyr Asp Gly His Ser Asn Lys Ser Gln Tyr Glu
Ile 85 90 95Ile Thr Gln Gly Gly Ser Gly Asn Gln Ser His Val Thr Tyr
Thr Ile 100 105 110Gln71340DNABacillus thuringiensis 71atgtcagcag
gcgaagttca tattgatgta aataataaga caggtcatac attacaatta 60gaagataaaa
caaaacttga tggtggtaga tggcgaacat cacctacaaa tgttgctaat
120gatcaaatta aaacatttgt agcagaatca aatggtttta tgacaggtac
agaaggtact 180atatattata gtataaatgg agaagcagaa attagtttat
attttgacaa tccttttgca 240ggttctaata aatatgatgg acattccaat
aaatctcaat atgaaattat tacccaagga 300ggatcaggaa atcaatctca
tgtaacgtat acaattcaaa 34072113PRTBacillus thuringiensis 72Met Ser
Ala Gly Glu Val His Ile Asp Val Asn Asn Lys Thr Gly His1 5 10 15Thr
Leu Gln Leu Glu Asp Lys Thr Lys Leu Asp Gly Gly Arg Trp Arg 20 25
30Thr Ser Pro Thr Asn Val Ala Asn Asp Gln Ile Lys Thr Phe Val Ala
35 40 45Glu Ser Asn Gly Phe Met Thr Gly Thr Glu Gly Thr Ile Tyr Tyr
Ser 50 55 60Ile Asn Gly Glu Ala Glu Ile Ser Leu Tyr Phe Asp Asn Pro
Phe Ala65 70 75 80Gly Ser Asn Lys Tyr Asp Gly His Ser Asn Lys Ser
Gln Tyr Glu Ile 85 90 95Ile Thr Gln Gly Gly Ser Gly Asn Gln Ser His
Val Thr Tyr Thr Ile 100 105 110Gln73340DNABacillus thuringiensis
73atgtcagctc gcgaagtwca tattgaaata aacaataaaa cacgtcatac attacaatta
60gaggataaaa ctaaacttag cggcggtaga tggcgaacat cacctacaaa tgttgctcgt
120gatacaatta aaacatttgt agcagaatca catggtttta tgacaggagt
agaaggtatt 180atatatttta gtgtaaacgg agacgcagaa attagtttac
attttgacaa tccttatata 240ggttctaata aatgtgatgg ttcttctgat
aaacctgaat atgaagttat tactcaaagc 300ggatcaggag ataaatctca
tgtgacatat accattcaaa 34074113PRTBacillus thuringiensis 74Met Ser
Ala Arg Glu Val His Ile Glu Ile Asn Asn Lys Thr Arg His1 5 10 15Thr
Leu Gln Leu Glu Asp Lys Thr Lys Leu Ser Gly Gly Arg Trp Arg 20 25
30Thr Ser Pro Thr Asn Val Ala Arg Asp Thr Ile Lys Thr Phe Val Ala
35 40 45Glu Ser His Gly Phe Met Thr Gly Val Glu Gly Ile Ile Tyr Phe
Ser 50 55 60Val Asn Gly Asp Ala Glu Ile Ser Leu His Phe Asp Asn Pro
Tyr Ile65 70 75 80Gly Ser Asn Lys Cys Asp Gly Ser Ser Asp Lys Pro
Glu Tyr Glu Val 85 90 95Ile Thr Gln Ser Gly Ser Gly Asp Lys Ser His
Val Thr Tyr Thr Ile 100 105 110Gln75341DNABacillus thuringiensis
75atgtcagctc gcgaagttca tattgaaata aataataaaa cacgtcatac attacaatta
60gaggataaaa ctaaacttac cagtggtaga tggcgaacat cacctacaaa tgttgctcgt
120gatacaatta aaacatttgt agcagaatca catggtttta tgacaggaat
agaaggtatt 180atatatttta gcgtaaacgg agaagcagaa attagtttac
attttgacaa tccttatgta 240ggttctaata aatatgatgg ttcttctgat
aaagctgcat acgaagttat tgctcaaggt 300ggatcagggg atatatctca
tgtaacttat acaattcaaa c 34176113PRTBacillus thuringiensis 76Met Ser
Ala Arg Glu Val His Ile Glu Ile Asn Asn Lys Thr Arg His1 5 10 15Thr
Leu Gln Leu Glu Asp Lys Thr Lys Leu Thr Ser Gly Arg Trp Arg 20 25
30Thr Ser Pro Thr Asn Val Ala Arg Asp Thr Ile Lys Thr Phe Val Ala
35 40 45Glu Ser His Gly Phe Met Thr Gly Ile Glu Gly Ile Ile Tyr Phe
Ser 50 55 60Val Asn Gly Glu Ala Glu Ile Ser Leu His Phe Asp Asn Pro
Tyr Val65 70 75 80Gly Ser Asn Lys Tyr Asp Gly Ser Ser Asp Lys Ala
Ala Tyr Glu Val 85 90 95Ile Ala Gln Gly Gly Ser Gly Asp Ile Ser His
Val Thr Tyr Thr Ile 100 105 110Gln771175DNABacillus thuringiensis
77atgttagata ctaataaagt ttatgaaata agcaatcatg ctaatggatt atatacatca
60acttatttaa gtctggatga ttcaggtgtt agtttaatgg gtcaaaatga tgaggatata
120gatgaatmca atttaaagtg gttcttattt ccaatagata ataatcaata
tattattaca 180agctatggag cgaataattg taaagtttgg aatgttaaaa
atgataaagt aaatgtttca 240acgtattctc caacaaactc agtacaaaaa
tggcaaataa aagctaaaaa ttcttcatat 300ataatacaaa gtgagaatgg
aaaagtctta acagcaggaa taggtcaatc tcctggaata 360gtacgcttaa
ccgatgaatc atcagagagt tctaaccaac aatggaattt aatccctgta
420caaacaattt cactcccaca aaaacctaaa atagataaaa aattaaaaga
tcatcctgaa 480tattcagaaa ccggaaatat agctactgga acaattcctc
aattaatggg atggacatta 540gtaccttgta ttatggtaaa tgatccaaaa
atagataaaa acactcaaat taaaactact 600ccatattata tttttaaaaa
atatcaatac tggaaacgag caataggaag taatgtatct 660ttacttccac
atcaaaaaaa atcatatgat tatgagtggg gtacagaaga aaatcaaaaa
720acaactatta ttaatacagt aggatttcaa attaatgtag attcaggaat
gaagtttgag 780gtaccagaag taggaggagg tacagaagaa ataaaaacac
aattaaatga agaattaaaa 840gttgaatata gcactgacac caaaataatg
aaaaaatatc aagaacactc agagatagat 900aatccaacta atcaaacaat
gaattctata ggatttctta cttttacttc tttagaatta 960tatcgatata
acggttcgga aattcgtata atgagaatgg aaacttcaga taatgatact
1020tatactctga cctcttatcc aaatcataga gaagcattat tacttctcac
aaatcattca 1080tatcaagaag tacmagaaat tacaagggcg aattcttgca
gatatccatc acactggcgg 1140gccggtcgag ccttgcatct agaggggccc caatt
117578391PRTBacillus
thuringiensisMISC_FEATURE(43)..(43)Undetermined in the deduced
amino acid sequence 78Met Leu Asp Thr Asn Lys Val Tyr Glu Ile Ser
Asn His Ala Asn Gly1 5 10 15Leu Tyr Thr Ser Thr Tyr Leu Ser Leu Asp
Asp Ser Gly Val Ser Leu 20 25 30Met Gly Gln Asn Asp Glu Asp Ile Asp
Glu Xaa Asn Leu Lys Trp Phe 35 40 45Leu Phe Pro Ile Asp Asn Asn Gln
Tyr Ile Ile Thr Ser Tyr Gly Ala 50 55 60Asn Asn Cys Lys Val Trp Asn
Val Lys Asn Asp Lys Val Asn Val Ser65 70 75 80Thr Tyr Ser Pro Thr
Asn Ser Val Gln Lys Trp Gln Ile Lys
Ala Lys 85 90 95Asn Ser Ser Tyr Ile Ile Gln Ser Glu Asn Gly Lys Val
Leu Thr Ala 100 105 110Gly Ile Gly Gln Ser Pro Gly Ile Val Arg Leu
Thr Asp Glu Ser Ser 115 120 125Glu Ser Ser Asn Gln Gln Trp Asn Leu
Ile Pro Val Gln Thr Ile Ser 130 135 140Leu Pro Gln Lys Pro Lys Ile
Asp Lys Lys Leu Lys Asp His Pro Glu145 150 155 160Tyr Ser Glu Thr
Gly Asn Ile Ala Thr Gly Thr Ile Pro Gln Leu Met 165 170 175Gly Trp
Thr Leu Val Pro Cys Ile Met Val Asn Asp Pro Lys Ile Asp 180 185
190Lys Asn Thr Gln Ile Lys Thr Thr Pro Tyr Tyr Ile Phe Lys Lys Tyr
195 200 205Gln Tyr Trp Lys Arg Ala Ile Gly Ser Asn Val Ser Leu Leu
Pro His 210 215 220Gln Lys Lys Ser Tyr Asp Tyr Glu Trp Gly Thr Glu
Glu Asn Gln Lys225 230 235 240Thr Thr Ile Ile Asn Thr Val Gly Phe
Gln Ile Asn Val Asp Ser Gly 245 250 255Met Lys Phe Glu Val Pro Glu
Val Gly Gly Gly Thr Glu Glu Ile Lys 260 265 270Thr Gln Leu Asn Glu
Glu Leu Lys Val Glu Tyr Ser Thr Asp Thr Lys 275 280 285Ile Met Lys
Lys Tyr Gln Glu His Ser Glu Ile Asp Asn Pro Thr Asn 290 295 300Gln
Thr Met Asn Ser Ile Gly Phe Leu Thr Phe Thr Ser Leu Glu Leu305 310
315 320Tyr Arg Tyr Asn Gly Ser Glu Ile Arg Ile Met Arg Met Glu Thr
Ser 325 330 335Asp Asn Asp Thr Tyr Thr Leu Thr Ser Tyr Pro Asn His
Arg Glu Ala 340 345 350Leu Leu Leu Leu Thr Asn His Ser Tyr Gln Glu
Val Xaa Glu Ile Thr 355 360 365Arg Ala Asn Ser Cys Arg Tyr Pro Ser
His Trp Arg Ala Gly Arg Ala 370 375 380Leu His Leu Glu Gly Pro
Gln385 39079341DNABacillus thuringiensis 79atgtcagcag gtgaagttca
tattgaaata aataataaaa cacgtcatac attacaatta 60gaggataaaa ctaaacttac
cagtggtaga tggcgaacat cacctacaaa tgttgctcgt 120gatacaatta
aaacatttgt agcagaatca catggtttta tgacaggaat agaaggtatt
180atatatttta gcgtaaacgg agaagcagaa attagtttac attttgacaa
tccttatgta 240ggttctaata aatatgatgg ttcttctgat aaagctgcat
acgaagttat tgctcaaggt 300ggatcagggg atatatctca tctaacatat
acaattcaaa c 34180113PRTBacillus thuringiensis 80Met Ser Ala Gly
Glu Val His Ile Glu Ile Asn Asn Lys Thr Arg His1 5 10 15Thr Leu Gln
Leu Glu Asp Lys Thr Lys Leu Thr Ser Gly Arg Trp Arg 20 25 30Thr Ser
Pro Thr Asn Val Ala Arg Asp Thr Ile Lys Thr Phe Val Ala 35 40 45Glu
Ser His Gly Phe Met Thr Gly Ile Glu Gly Ile Ile Tyr Phe Ser 50 55
60Val Asn Gly Glu Ala Glu Ile Ser Leu His Phe Asp Asn Pro Tyr Val65
70 75 80Gly Ser Asn Lys Tyr Asp Gly Ser Ser Asp Lys Ala Ala Tyr Glu
Val 85 90 95Ile Ala Gln Gly Gly Ser Gly Asp Ile Ser His Leu Thr Tyr
Thr Ile 100 105 110Gln811410DNABacillus thuringiensis 81atgttagata
ctaataaaat ttatgaaata agcaatcatg ctaatggatt atatacatca 60acttatttaa
gtctggatga ttcaggtgtt agtttaatgg gtcaaaatga tgaggatata
120gatgaataca atttaaagtg gttcttattt ccaatagata ataatcaata
tattattaca 180agctatggag cgaataattg taaagtttgg aatgttaaaa
atgataaagt aaatgtttca 240acgtattctc caacaaactc agtacaaaaa
tggcaaataa aagctaaaaa ttcttcatat 300ataatacaaa gtgagaatgg
aaaagtctta acagcaggaa taggtcaatc tcttggaata 360gtacgcttaa
ccgatgaatc atcagagagt tctaaccaac aatggaattt aatccctgta
420caaacaattt cactcccaca aaaacctaaa atagataaaa aattaaaaga
tcatcctgaa 480tattcagaaa ccggaaatat agctactgga acaattcctc
aattaatggg atggacatta 540gtaccttgta ttatggtaaa tgatccaaaa
ataggtaaaa acactcaaat taaaactact 600ccatattata tttttaaaaa
atatcaatac tggaaacgag caataggaag taatgtatct 660ttacttccac
atcaaaaaaa atcatatgat tatgagtggg gtacagaaga aaatcaaaaa
720acaactatta ttaatacagt aggatttcaa attaatgtag attcaggaat
gaagtttgag 780gtaccagaag taggaggagg tacagaagaa ataaaaacac
aattaaatga agaattaaaa 840gttgaatata gcactgacac caaaataatg
aaaaaatatc aagaacactc agagatagat 900aatccaacta atcaaacaac
gaattctata ggatttctta cttttacttc tttagaatta 960tatcgatata
acggttcgga aattcgtata atgagaatgg aaacttcaga taatgatact
1020tatactctga cctcttatcc aaatcataga gaagcattat tacttctcac
aaatcattct 1080tatcaagaag taagccgaat tccagcacac tggcggccgt
tactagtgga tccgagctcg 1140gtaccaagct tggcgtaatc atggtcatag
stgtttcctg tgtgaaattg ttatccgctc 1200acaattccac acaacatacg
agccggaagc ataaagtgta aagcctgggg tgcctaatga 1260gtgagctaac
tcacattaat tgcgttgcgc tcactgcccg ctttccagtc gggaaacctg
1320tcgtgccagc tgcattaatg aatcggccaa cgcgcgggga gaggcggttt
gcgtattggg 1380cgctcttccg cttcctcgct cactgactcg
141082462PRTBacillus
thuringiensisMISC_FEATURE(389)..(389)Undetermined in the deduced
amino acid sequence 82Met Leu Asp Thr Asn Lys Ile Tyr Glu Ile Ser
Asn His Ala Asn Gly1 5 10 15Leu Tyr Thr Ser Thr Tyr Leu Ser Leu Asp
Asp Ser Gly Val Ser Leu 20 25 30Met Gly Gln Asn Asp Glu Asp Ile Asp
Glu Tyr Asn Leu Lys Trp Phe 35 40 45Leu Phe Pro Ile Asp Asn Asn Gln
Tyr Ile Ile Thr Ser Tyr Gly Ala 50 55 60Asn Asn Cys Lys Val Trp Asn
Val Lys Asn Asp Lys Val Asn Val Ser65 70 75 80Thr Tyr Ser Pro Thr
Asn Ser Val Gln Lys Trp Gln Ile Lys Ala Lys 85 90 95Asn Ser Ser Tyr
Ile Ile Gln Ser Glu Asn Gly Lys Val Leu Thr Ala 100 105 110Gly Ile
Gly Gln Ser Leu Gly Ile Val Arg Leu Thr Asp Glu Ser Ser 115 120
125Glu Ser Ser Asn Gln Gln Trp Asn Leu Ile Pro Val Gln Thr Ile Ser
130 135 140Leu Pro Gln Lys Pro Lys Ile Asp Lys Lys Leu Lys Asp His
Pro Glu145 150 155 160Tyr Ser Glu Thr Gly Asn Ile Ala Thr Gly Thr
Ile Pro Gln Leu Met 165 170 175Gly Trp Thr Leu Val Pro Cys Ile Met
Val Asn Asp Pro Lys Ile Gly 180 185 190Lys Asn Thr Gln Ile Lys Thr
Thr Pro Tyr Tyr Ile Phe Lys Lys Tyr 195 200 205Gln Tyr Trp Lys Arg
Ala Ile Gly Ser Asn Val Ser Leu Leu Pro His 210 215 220Gln Lys Lys
Ser Tyr Asp Tyr Glu Trp Gly Thr Glu Glu Asn Gln Lys225 230 235
240Thr Thr Ile Ile Asn Thr Val Gly Phe Gln Ile Asn Val Asp Ser Gly
245 250 255Met Lys Phe Glu Val Pro Glu Val Gly Gly Gly Thr Glu Glu
Ile Lys 260 265 270Thr Gln Leu Asn Glu Glu Leu Lys Val Glu Tyr Ser
Thr Asp Thr Lys 275 280 285Ile Met Lys Lys Tyr Gln Glu His Ser Glu
Ile Asp Asn Pro Thr Asn 290 295 300Gln Thr Thr Asn Ser Ile Gly Phe
Leu Thr Phe Thr Ser Leu Glu Leu305 310 315 320Tyr Arg Tyr Asn Gly
Ser Glu Ile Arg Ile Met Arg Met Glu Thr Ser 325 330 335Asp Asn Asp
Thr Tyr Thr Leu Thr Ser Tyr Pro Asn His Arg Glu Ala 340 345 350Leu
Leu Leu Leu Thr Asn His Ser Tyr Gln Glu Val Ser Arg Ile Pro 355 360
365Ala His Trp Arg Pro Leu Leu Val Asp Pro Ser Ser Val Pro Ser Leu
370 375 380Ala Ser Trp Ser Xaa Phe Pro Val Asn Cys Tyr Pro Leu Thr
Ile Pro385 390 395 400His Asn Ile Arg Ala Gly Ser Ile Lys Cys Lys
Ala Trp Gly Ala Val 405 410 415Ser Leu Thr Leu Ile Ala Leu Arg Ser
Leu Pro Ala Phe Gln Ser Gly 420 425 430Asn Leu Ser Cys Gln Leu His
Ile Gly Gln Arg Ala Gly Arg Gly Gly 435 440 445Leu Arg Ile Gly Arg
Ser Ser Ala Ser Ser Leu Thr Asp Ser 450 455 46083340DNABacillus
thuringiensis 83tgtcagcacg tgaagtacat attgatgtaa ataataagac
aggtcataca ttacaattag 60aagataaaac aaaacttgat ggtggtagat ggcgaacatc
acctacaaat gttgctaatg 120atcaaattaa aacatttgta gcagaatcaa
atggttttat gacaggtaca gaaggtacta 180tatattatag tataaatgga
gaagcagaaa ttagtttata ttttgacaat ccttttgcag 240gttctaataa
atatgatgga cattccaata aatctcaata tgaaattatt acccaaggag
300gatcaggaaa tcaatctcat gtgacatata ctattcaaac 34084112PRTBacillus
thuringiensis 84Ser Ala Arg Glu Val His Ile Asp Val Asn Asn Lys Thr
Gly His Thr1 5 10 15Leu Gln Leu Glu Asp Lys Thr Lys Leu Asp Gly Gly
Arg Trp Arg Thr 20 25 30Ser Pro Thr Asn Val Ala Asn Asp Gln Ile Lys
Thr Phe Val Ala Glu 35 40 45Ser Asn Gly Phe Met Thr Gly Thr Glu Gly
Thr Ile Tyr Tyr Ser Ile 50 55 60Asn Gly Glu Ala Glu Ile Ser Leu Tyr
Phe Asp Asn Pro Phe Ala Gly65 70 75 80Ser Asn Lys Tyr Asp Gly His
Ser Asn Lys Ser Gln Tyr Glu Ile Ile 85 90 95Thr Gln Gly Gly Ser Gly
Asn Gln Ser His Val Thr Tyr Thr Ile Gln 100 105
110851114DNABacillus thuringiensis 85atgttagata ctaataaagt
ttatgaaata agcaatcatg ctaatggact atatgcagca 60acttatttaa gtttagatga
ttcaggtgtt agtttaatga ataaaaatga tgatgatatt 120gatgattata
acttaaaatg gtttttattt cctattgatg atgatcaata tattattaca
180agctatgcag caaataattg taaagtttgg aatgttaata atgataaaat
aaatgtttcg 240acttattctt caacaaattc aatacaaaaa tggcaaataa
aagctaatgg ttcttcatat 300gtaatacaaa gtgataatgg aaaagtctta
acagcaggaa ccggtcaagc tcttggattg 360atacgtttaa ctgatgaatc
ctcaaataat cccaatcaac aatggaattt aacttctgta 420caaacaattc
aacttccacg aaaacctata atagatacaa aattaaaaga ttatcccaaa
480tattcaccaa ctggaaatat agataatgga acatctcctc aattaatggg
atggacatta 540gtaccttgta ttatggtaaa tgatccaaat atagataaaa
atactcaaat taaaactact 600ccatattata ttttaaaaaa atatcaatat
tggcaacgag cagtaggaag taatgtagct 660ttacgtccac atgaaaaaaa
atcatatact tatgaatggg gcacagaaat agatcaaaaa 720acaacaatta
taaatacatt aggatttcaa atcaatatag attcaggaat gaaatttgat
780ataccagaag taggtggagg tacagatgaa ataaaaacac aactaaatga
agaattaaaa 840atagaatata gtcatgaaac taaaataatg gaaaaatatc
aagaacaatc tgaaatagat 900aatccaactg atcaatcaat gaattctata
ggatttctta ctattacttc cttagaatta 960tatagatata atggctcaga
aattcgtata atgcaaattc aaacctcaga taatgatact 1020tataatgtta
cttcttatcc aaatcatcaa caagctttat tacttcttac aaatcattca
1080tatgaagaag ttgaagaaat aacaagggcg aatt 111486371PRTBacillus
thuringiensis 86Met Leu Asp Thr Asn Lys Val Tyr Glu Ile Ser Asn His
Ala Asn Gly1 5 10 15Leu Tyr Ala Ala Thr Tyr Leu Ser Leu Asp Asp Ser
Gly Val Ser Leu 20 25 30Met Asn Lys Asn Asp Asp Asp Ile Asp Asp Tyr
Asn Leu Lys Trp Phe 35 40 45Leu Phe Pro Ile Asp Asp Asp Gln Tyr Ile
Ile Thr Ser Tyr Ala Ala 50 55 60Asn Asn Cys Lys Val Trp Asn Val Asn
Asn Asp Lys Ile Asn Val Ser65 70 75 80Thr Tyr Ser Ser Thr Asn Ser
Ile Gln Lys Trp Gln Ile Lys Ala Asn 85 90 95Gly Ser Ser Tyr Val Ile
Gln Ser Asp Asn Gly Lys Val Leu Thr Ala 100 105 110Gly Thr Gly Gln
Ala Leu Gly Leu Ile Arg Leu Thr Asp Glu Ser Ser 115 120 125Asn Asn
Pro Asn Gln Gln Trp Asn Leu Thr Ser Val Gln Thr Ile Gln 130 135
140Leu Pro Arg Lys Pro Ile Ile Asp Thr Lys Leu Lys Asp Tyr Pro
Lys145 150 155 160Tyr Ser Pro Thr Gly Asn Ile Asp Asn Gly Thr Ser
Pro Gln Leu Met 165 170 175Gly Trp Thr Leu Val Pro Cys Ile Met Val
Asn Asp Pro Asn Ile Asp 180 185 190Lys Asn Thr Gln Ile Lys Thr Thr
Pro Tyr Tyr Ile Leu Lys Lys Tyr 195 200 205Gln Tyr Trp Gln Arg Ala
Val Gly Ser Asn Val Ala Leu Arg Pro His 210 215 220Glu Lys Lys Ser
Tyr Thr Tyr Glu Trp Gly Thr Glu Ile Asp Gln Lys225 230 235 240Thr
Thr Ile Ile Asn Thr Leu Gly Phe Gln Ile Asn Ile Asp Ser Gly 245 250
255Met Lys Phe Asp Ile Pro Glu Val Gly Gly Gly Thr Asp Glu Ile Lys
260 265 270Thr Gln Leu Asn Glu Glu Leu Lys Ile Glu Tyr Ser His Glu
Thr Lys 275 280 285Ile Met Glu Lys Tyr Gln Glu Gln Ser Glu Ile Asp
Asn Pro Thr Asp 290 295 300Gln Ser Met Asn Ser Ile Gly Phe Leu Thr
Ile Thr Ser Leu Glu Leu305 310 315 320Tyr Arg Tyr Asn Gly Ser Glu
Ile Arg Ile Met Gln Ile Gln Thr Ser 325 330 335Asp Asn Asp Thr Tyr
Asn Val Thr Ser Tyr Pro Asn His Gln Gln Ala 340 345 350Leu Leu Leu
Leu Thr Asn His Ser Tyr Glu Glu Val Glu Glu Ile Thr 355 360 365Arg
Ala Asn 37087341DNABacillus thuringiensis 87atgtcagctg gcgaagttca
tattgaaata aacaataaaa cacgtcatac attacaatta 60gaggataaaa ctaaacttag
cggcggtaga tggcgaacat cacctacaaa tgttgctcgt 120gatacaatta
aaacatttgt agcagaatca catggtttta tgacaggagt agaaggtatt
180atatatttta gtgtaaacgg agacgcagaa attagtttac attttgacaa
tccttatata 240ggttctaata aatgtgatgg ttcttctgat aaacctgaat
atgaagttat tactcaaagc 300ggatcaggag ataaatctca tgtcacttat
acaattcaaa c 34188113PRTBacillus thuringiensis 88Met Ser Ala Gly
Glu Val His Ile Glu Ile Asn Asn Lys Thr Arg His1 5 10 15Thr Leu Gln
Leu Glu Asp Lys Thr Lys Leu Ser Gly Gly Arg Trp Arg 20 25 30Thr Ser
Pro Thr Asn Val Ala Arg Asp Thr Ile Lys Thr Phe Val Ala 35 40 45Glu
Ser His Gly Phe Met Thr Gly Val Glu Gly Ile Ile Tyr Phe Ser 50 55
60Val Asn Gly Asp Ala Glu Ile Ser Leu His Phe Asp Asn Pro Tyr Ile65
70 75 80Gly Ser Asn Lys Cys Asp Gly Ser Ser Asp Lys Pro Glu Tyr Glu
Val 85 90 95Ile Thr Gln Ser Gly Ser Gly Asp Lys Ser His Val Thr Tyr
Thr Ile 100 105 110Gln891186DNABacillus thuringiensis 89atgttagata
caaataaagt ttatgaaata agcaatcttg ctaatggatt atatacatca 60acttatttaa
gtcttgatga ttcaggtgtt agtttaatga gtaaaaagga tgaagatatt
120gatgattaca atttaaaatg gtttttattt cctattgata ataatcaata
tattattaca 180agctatggag ctaataattg taaagtttgg aatgttaaaa
atgataaaat aaatgtttca 240acttattctt caacaaactc tgtacaaaaa
tggcaaataa aagctaaaga ttcttcatat 300ataatacaaa gtgataatgg
aaaggtctta acagcaggag taggtcaatc tcttggaata 360gtacgcctaa
ctgatgaatt tccagagaat tctaaccaac aatggaattt aactcctgta
420caaacaattc aactcccaca aaaacctaaa atagatgaaa aattaaaaga
tcatcctgaa 480tattcagaaa ccggaaatat aaatcctaaa acaactcctc
aattaatggg atggacatta 540gtaccttgta ttatggtaaa tgattcaaaa
atagataaaa acactcaaat taaaactact 600ccatattata tttttaaaaa
atataaatac tggaatctag caaaaggaag taatgtatct 660ttacttccac
atcaaaaaag atcatatgat tatgaatggg gtacagaaaa aaatcaaaaa
720acaactatta ttaatacagt aggattgcaa attaatatag attcaggaat
gaaatttgaa 780gtaccagaag taggaggagg tacagaagac ataaaaacac
aattaactga agaattaaaa 840gttgaatata gcactgaaac caaaataatg
acgaaatatc aagaacactc agagatagat 900aatccaacta atcaaccaat
gaattctata ggacttctta tttatacttc tttagaatta 960tatcgatata
acggrcagaa attaagataa tggacataga aacttcagat catgatactt
1020acactcttac ttcttatcca aatcataaag aagcattatt acttctcaca
aaccattctt 1080atgaagaagt agaagaaatt acaagggcga attccagcac
actggcggcc gttactagtg 1140gatccgagct cggtaccaag cttggcgtgt
caggtcaaag ggttca 118690392PRTBacillus thuringiensis 90Met Leu Asp
Thr Asn Lys Val Tyr Glu Ile Ser Asn Leu Ala Asn Gly1 5 10 15Leu Tyr
Thr Ser Thr Tyr Leu Ser Leu Asp Asp Ser Gly Val Ser Leu 20 25 30Met
Ser Lys Lys Asp Glu Asp Ile Asp Asp Tyr Asn Leu Lys Trp Phe 35 40
45Leu Phe Pro Ile Asp Asn Asn Gln Tyr Ile Ile Thr Ser Tyr Gly Ala
50 55 60Asn Asn Cys Lys Val Trp Asn Val Lys Asn Asp Lys Ile Asn Val
Ser65 70 75 80Thr Tyr Ser Ser Thr Asn Ser Val Gln Lys Trp Gln Ile
Lys Ala Lys 85 90 95Asp Ser Ser Tyr Ile Ile Gln Ser Asp Asn Gly Lys
Val Leu Thr Ala 100 105 110Gly Val Gly Gln Ser Leu Gly Ile Val Arg
Leu Thr Asp Glu Phe Pro 115 120 125Glu Asn Ser Asn Gln Gln Trp Asn
Leu Thr Pro
Val Gln Thr Ile Gln 130 135 140Leu Pro Gln Lys Pro Lys Ile Asp Glu
Lys Leu Lys Asp His Pro Glu145 150 155 160Tyr Ser Glu Thr Gly Asn
Ile Asn Pro Lys Thr Thr Pro Gln Leu Met 165 170 175Gly Trp Thr Leu
Val Pro Cys Ile Met Val Asn Asp Ser Lys Ile Asp 180 185 190Lys Asn
Thr Gln Ile Lys Thr Thr Pro Tyr Tyr Ile Phe Lys Lys Tyr 195 200
205Lys Tyr Trp Asn Leu Ala Lys Gly Ser Asn Val Ser Leu Leu Pro His
210 215 220Gln Lys Arg Ser Tyr Asp Tyr Glu Trp Gly Thr Glu Lys Asn
Gln Lys225 230 235 240Thr Thr Ile Ile Asn Thr Val Gly Leu Gln Ile
Asn Ile Asp Ser Gly 245 250 255Met Lys Phe Glu Val Pro Glu Val Gly
Gly Gly Thr Glu Asp Ile Lys 260 265 270Thr Gln Leu Thr Glu Glu Leu
Lys Val Glu Tyr Ser Thr Glu Thr Lys 275 280 285Ile Met Thr Lys Tyr
Gln Glu His Ser Glu Ile Asp Asn Pro Thr Asn 290 295 300Gln Pro Met
Asn Ser Ile Gly Leu Leu Ile Tyr Thr Ser Leu Glu Leu305 310 315
320Tyr Arg Tyr Asn Gly Gln Lys Leu Arg Trp Thr Lys Leu Gln Ile Met
325 330 335Ile Leu Thr Leu Leu Leu Leu Ile Gln Ile Ile Lys Lys His
Tyr Tyr 340 345 350Phe Ser Gln Thr Ile Leu Met Lys Lys Lys Lys Leu
Gln Gly Arg Ile 355 360 365Pro Ala His Trp Arg Pro Leu Leu Val Asp
Pro Ser Ser Val Pro Ser 370 375 380Leu Ala Cys Gln Val Lys Gly
Phe385 39091341DNABacillus thuringiensis 91atgtcagcag ccgaagtaca
tattgaaata ataaatcata caggtcatac cttacaaatg 60gataaaagaa ctagacttgc
acatggtgaa tggattatta cacccgtgaa tgttccaaat 120aattcttctg
atttatttca agcaggttct gatggagttt tgacaggagt agaaggaata
180ataatttata ctataaatgg agaaatagaa attaccttac attttgacaa
tccttatgca 240ggttctaata aatattctgg acgttctagt gatgatgatt
ataaagttat aactgaagca 300agagcagaac atagagctaa taatcatgat
catgtaactt a 34192113PRTBacillus thuringiensis 92Met Ser Ala Ala
Glu Val His Ile Glu Ile Ile Asn His Thr Gly His1 5 10 15Thr Leu Gln
Met Asp Lys Arg Thr Arg Leu Ala His Gly Glu Trp Ile 20 25 30Ile Thr
Pro Val Asn Val Pro Asn Asn Ser Ser Asp Leu Phe Gln Ala 35 40 45Gly
Ser Asp Gly Val Leu Thr Gly Val Glu Gly Ile Ile Ile Tyr Thr 50 55
60Ile Asn Gly Glu Ile Glu Ile Thr Leu His Phe Asp Asn Pro Tyr Ala65
70 75 80Gly Ser Asn Lys Tyr Ser Gly Arg Ser Ser Asp Asp Asp Tyr Lys
Val 85 90 95Ile Thr Glu Ala Arg Ala Glu His Arg Ala Asn Asn His Asp
His Val 100 105 110Thr93341DNABacillus thuringiensis 93atgtcagatc
gcgaagtaca tattgaaata ataaatcata caggtcatac cttacaaatg 60gataaaagaa
ctagacttgc acatggtgaa tggattatta cacccgtgaa tgttccaaat
120aattcttctg atttatttca agcaggttct gatggagttt tgacaggagt
agaaggaata 180ataatttata ctataaatgg agaaatagaa attaccttac
attttgacaa tccttatgca 240ggttctaata aatattctgg acgttctagt
gatgatgatt ataaagttat aactgaagca 300agagcagaac atagagctaa
taatcatgat catgtaactt a 34194113PRTBacillus thuringiensis 94Met Ser
Asp Arg Glu Val His Ile Glu Ile Ile Asn His Thr Gly His1 5 10 15Thr
Leu Gln Met Asp Lys Arg Thr Arg Leu Ala His Gly Glu Trp Ile 20 25
30Ile Thr Pro Val Asn Val Pro Asn Asn Ser Ser Asp Leu Phe Gln Ala
35 40 45Gly Ser Asp Gly Val Leu Thr Gly Val Glu Gly Ile Ile Ile Tyr
Thr 50 55 60Ile Asn Gly Glu Ile Glu Ile Thr Leu His Phe Asp Asn Pro
Tyr Ala65 70 75 80Gly Ser Asn Lys Tyr Ser Gly Arg Ser Ser Asp Asp
Asp Tyr Lys Val 85 90 95Ile Thr Glu Ala Arg Ala Glu His Arg Ala Asn
Asn His Asp His Val 100 105 110Thr95353DNABacillus thuringiensis
95atgtcagcac gtgaagtaca tattgaaata ataaatcata caggtcatac cttacaaatg
60gataaaagaa ctagacttgc acatggtgaa tggattatta cacccgtgaa tgttccaaat
120aattcttctg atttatttca agcaggttct gatggagttt tgacaggagt
agaaggaata 180ataatttata ctataaatgg agaaatagaa attaccttac
attttgacaa tccttatgca 240ggttctaata aatattctgg acgttctagt
gatgatgatt ataaagttat aactgaagca 300agagcagaac atagagctaa
taatcatgat catgtaacat atacgattca aac 35396117PRTBacillus
thuringiensis 96Met Ser Ala Arg Glu Val His Ile Glu Ile Ile Asn His
Thr Gly His1 5 10 15Thr Leu Gln Met Asp Lys Arg Thr Arg Leu Ala His
Gly Glu Trp Ile 20 25 30Ile Thr Pro Val Asn Val Pro Asn Asn Ser Ser
Asp Leu Phe Gln Ala 35 40 45Gly Ser Asp Gly Val Leu Thr Gly Val Glu
Gly Ile Ile Ile Tyr Thr 50 55 60Ile Asn Gly Glu Ile Glu Ile Thr Leu
His Phe Asp Asn Pro Tyr Ala65 70 75 80Gly Ser Asn Lys Tyr Ser Gly
Arg Ser Ser Asp Asp Asp Tyr Lys Val 85 90 95Ile Thr Glu Ala Arg Ala
Glu His Arg Ala Asn Asn His Asp His Val 100 105 110Thr Tyr Thr Ile
Gln 11597353DNABacillus thuringiensis 97atgtcagctc gtgaagtaca
tattgaaata ataaatcata caggtcatac cttacaaatg 60gataaaagaa ctagacttgc
acatggtgaa tggattatta cacccgtgaa tgttccaaat 120aattcttctg
atttatttca agcaggttct gatggagttt tgacaggagt agaaggaata
180ataatttata ctataaatgg agaaatagaa attaccttac attttgacaa
tccttatgca 240ggttctaata aatattctgg acgttctagt gatgatgatt
ataaagttat aactgaagca 300agagcagaac atagagctaa taatcatgat
catgtgacat atacaattca aac 35398117PRTBacillus thuringiensis 98Met
Ser Ala Arg Glu Val His Ile Glu Ile Ile Asn His Thr Gly His1 5 10
15Thr Leu Gln Met Asp Lys Arg Thr Arg Leu Ala His Gly Glu Trp Ile
20 25 30Ile Thr Pro Val Asn Val Pro Asn Asn Ser Ser Asp Leu Phe Gln
Ala 35 40 45Gly Ser Asp Gly Val Leu Thr Gly Val Glu Gly Ile Ile Ile
Tyr Thr 50 55 60Ile Asn Gly Glu Ile Glu Ile Thr Leu His Phe Asp Asn
Pro Tyr Ala65 70 75 80Gly Ser Asn Lys Tyr Ser Gly Arg Ser Ser Asp
Asp Asp Tyr Lys Val 85 90 95Ile Thr Glu Ala Arg Ala Glu His Arg Ala
Asn Asn His Asp His Val 100 105 110Thr Tyr Thr Ile Gln
11599353DNABacillus thuringiensis 99atgtcaggtc gcgaagttca
tattgaaata ataaatcata caggtcatac cttacaaatg 60gataaaagaa ctagacttgc
acatggtgaa tggattatta cacccgtgaa tgttccaaat 120aattcttctg
atttatttca agcaggttct gatggagttt tgacaggagt agaaggaata
180ataatttata ctataaatgg agaaatagaa attaccttac attttgacaa
tccttatgca 240ggttctaata aatattctgg acgttctagt gatgatgatt
ataaagttat aactgaagca 300agagcagaac atagagctaa taatcatgat
catgtaacat atacgattca aac 353100117PRTBacillus thuringiensis 100Met
Ser Gly Arg Glu Val His Ile Glu Ile Ile Asn His Thr Gly His1 5 10
15Thr Leu Gln Met Asp Lys Arg Thr Arg Leu Ala His Gly Glu Trp Ile
20 25 30Ile Thr Pro Val Asn Val Pro Asn Asn Ser Ser Asp Leu Phe Gln
Ala 35 40 45Gly Ser Asp Gly Val Leu Thr Gly Val Glu Gly Ile Ile Ile
Tyr Thr 50 55 60Ile Asn Gly Glu Ile Glu Ile Thr Leu His Phe Asp Asn
Pro Tyr Ala65 70 75 80Gly Ser Asn Lys Tyr Ser Gly Arg Ser Ser Asp
Asp Asp Tyr Lys Val 85 90 95Ile Thr Glu Ala Arg Ala Glu His Arg Ala
Asn Asn His Asp His Val 100 105 110Thr Tyr Thr Ile Gln
115101353DNABacillus thuringiensis 101atgtcagctc gtgaagtaca
tattgaaata ataaatcata caggtcatac cttacaaatg 60gataaaagaa ctagacttgc
acatggtgaa tggattatta cacccgtgaa tgttccaaat 120aattcttctg
atttatttca agcaggttct gatggagttt tgacaggagt agaaggaata
180ataatttata ctataaatgg agaaatagaa attaccttac attttgacaa
tccttatgca 240ggttctaata aatattctgg acgttctagt gatgatgatt
ataaagttat aactgaagca 300agagcagaac atagagctaa taatcatgat
catgttacgt atacaattca aac 353102117PRTBacillus thuringiensis 102Met
Ser Ala Arg Glu Val His Ile Glu Ile Ile Asn His Thr Gly His1 5 10
15Thr Leu Gln Met Asp Lys Arg Thr Arg Leu Ala His Gly Glu Trp Ile
20 25 30Ile Thr Pro Val Asn Val Pro Asn Asn Ser Ser Asp Leu Phe Gln
Ala 35 40 45Gly Ser Asp Gly Val Leu Thr Gly Val Glu Gly Ile Ile Ile
Tyr Thr 50 55 60Ile Asn Gly Glu Ile Glu Ile Thr Leu His Phe Asp Asn
Pro Tyr Ala65 70 75 80Gly Ser Asn Lys Tyr Ser Gly Arg Ser Ser Asp
Asp Asp Tyr Lys Val 85 90 95Ile Thr Glu Ala Arg Ala Glu His Arg Ala
Asn Asn His Asp His Val 100 105 110Thr Tyr Thr Ile Gln
115103353DNABacillus thuringiensis 103atgtcaggtc gcgaagtaga
tattgaaata ataaatcata caggtcatac cttacaaatg 60gataaaagaa ctagacttgc
acatggtgaa tggattatta cacccgtgaa tgttccaaat 120aattcttctg
atttatttca agcaggttct gatggagttt tgacaggagt agaaggaata
180ataatttata ctataaatgg agaaatagaa attaccttac attttgacaa
tccttatgca 240ggttctaata aatattctgg acgttctagt gatgatgatt
ataaagttat aactgaagcg 300agagcagaac atagagctaa taatcatgat
catgtaacat atactattca gac 353104117PRTBacillus thuringiensis 104Met
Ser Gly Arg Glu Val Asp Ile Glu Ile Ile Asn His Thr Gly His1 5 10
15Thr Leu Gln Met Asp Lys Arg Thr Arg Leu Ala His Gly Glu Trp Ile
20 25 30Ile Thr Pro Val Asn Val Pro Asn Asn Ser Ser Asp Leu Phe Gln
Ala 35 40 45Gly Ser Asp Gly Val Leu Thr Gly Val Glu Gly Ile Ile Ile
Tyr Thr 50 55 60Ile Asn Gly Glu Ile Glu Ile Thr Leu His Phe Asp Asn
Pro Tyr Ala65 70 75 80Gly Ser Asn Lys Tyr Ser Gly Arg Ser Ser Asp
Asp Asp Tyr Lys Val 85 90 95Ile Thr Glu Ala Arg Ala Glu His Arg Ala
Asn Asn His Asp His Val 100 105 110Thr Tyr Thr Ile Gln
115105353DNABacillus thuringiensis 105atgtcagcac gtgaagtaca
tattgaaata ataaatcata caggtcatac cttacaaatg 60gataaaagaa ctagacttgc
acatggtgaa tggattatta cacccgtgaa tgttccaaat 120aattcttctg
atttatttca agcaggttct gatggagttt tgacaggagt agaaggaata
180ataatttata ctataaatgg agaaatagaa attaccttac attttgacaa
tccttatgca 240ggttctaata aatattctgg acgttctagt gatgatgatt
ataaagttat aactgaagca 300agagcagaac atagagctaa taatcatgat
catgtaacat ataccattca aac 353106117PRTBacillus thuringiensis 106Met
Ser Ala Arg Glu Val His Ile Glu Ile Ile Asn His Thr Gly His1 5 10
15Thr Leu Gln Met Asp Lys Arg Thr Arg Leu Ala His Gly Glu Trp Ile
20 25 30Ile Thr Pro Val Asn Val Pro Asn Asn Ser Ser Asp Leu Phe Gln
Ala 35 40 45Gly Ser Asp Gly Val Leu Thr Gly Val Glu Gly Ile Ile Ile
Tyr Thr 50 55 60Ile Asn Gly Glu Ile Glu Ile Thr Leu His Phe Asp Asn
Pro Tyr Ala65 70 75 80Gly Ser Asn Lys Tyr Ser Gly Arg Ser Ser Asp
Asp Asp Tyr Lys Val 85 90 95Ile Thr Glu Ala Arg Ala Glu His Arg Ala
Asn Asn His Asp His Val 100 105 110Thr Tyr Thr Ile Gln
115107341DNABacillus thuringiensis 107atgtcaggtc gcgaagttca
tattgatgta aataataaga caggtcatac attacaatta 60gaagataaaa caagacttga
tggtggtaga tggcgaacat cacctacaaa tgttgctaat 120gatcaaatta
aaacatttgt agcagaatca catggtttta tgacaggtac agaaggtact
180atatattata gtataaatgg agaagcagaa attagtttat attttgacaa
tccttattca 240ggttctaata aatatgatgg gcattccaat aaaaatcaat
atgaagttat tacccaagga 300ggatcaggaa atcaatctca tctgacgtat
acaattcaaa c 341108113PRTBacillus thuringiensis 108Met Ser Gly Arg
Glu Val His Ile Asp Val Asn Asn Lys Thr Gly His1 5 10 15Thr Leu Gln
Leu Glu Asp Lys Thr Arg Leu Asp Gly Gly Arg Trp Arg 20 25 30Thr Ser
Pro Thr Asn Val Ala Asn Asp Gln Ile Lys Thr Phe Val Ala 35 40 45Glu
Ser His Gly Phe Met Thr Gly Thr Glu Gly Thr Ile Tyr Tyr Ser 50 55
60Ile Asn Gly Glu Ala Glu Ile Ser Leu Tyr Phe Asp Asn Pro Tyr Ser65
70 75 80Gly Ser Asn Lys Tyr Asp Gly His Ser Asn Lys Asn Gln Tyr Glu
Val 85 90 95Ile Thr Gln Gly Gly Ser Gly Asn Gln Ser His Leu Thr Tyr
Thr Ile 100 105 110Gln1091114DNABacillus thuringiensis
109atgttagata ctaataaagt atatgaaata agtaattatg ctaatggatt
acatgcagca 60acttatttaa gtttagatga ttcaggtgtt agtttaatga ataaaaatga
tgatgatatt 120gatgactata atttaaggtg gtttttattt cctattgatg
ataatcaata tattattaca 180agctacgcag cgaataattg taaggtttgg
aatgttaata atgataaaat aaatgtttca 240acttattctt caacaaactc
gatacagaaa tggcaaataa aagctaatgc ttcttcgtat 300gtaatacaaa
gtaataatgg gaaagttcta acagcaggaa ccggtcaatc tcttggatta
360atacgtttaa cggatgaatc accagataat cccaatcaac aatggaattt
aactcctgta 420caaacaattc aactcccacc aaaacctaca atagatacaa
agttaaaaga ttaccccaaa 480tattcacaaa ctggcaatat agacaaggga
acacctcctc aattaatggg atggacatta 540ataccttgta ttatggtaaa
tgatccaaat atagataaaa acactcaaat caaaactact 600ccatattata
ttttaaaaaa atatcaatat tggcaacaag cagtaggaag taatgtagct
660ttacgtccgc atgaaaaaaa atcatatgct tatgagtggg gtacagaaat
agatcaaaaa 720acaactatca ttaatacatt aggatttcag attaatatag
attcgggaat ggaatttgat 780ataccagaag taggtggagg tacagatgaa
ataaaaacac aattaaacga agaattaaaa 840atagaatata gccgtgaaac
caaaataatg gaaaaatatc aggaacaatc agagatagat 900aatccaactg
atcaatcaat gaattctata ggattcctca ctattacttc tttagaatta
960tatcgatata atggttcgga aattagtgta atgaaaattc aaacttcaga
taatgatact 1020tacaatgtga cctcttatcc agatcatcaa caagctctat
tacttcttac aaatcattca 1080tatgaacaag tacaagaaat aacaagggcg aatt
1114110371PRTBacillus thuringiensis 110Met Leu Asp Thr Asn Lys Val
Tyr Glu Ile Ser Asn Tyr Ala Asn Gly1 5 10 15Leu His Ala Ala Thr Tyr
Leu Ser Leu Asp Asp Ser Gly Val Ser Leu 20 25 30Met Asn Lys Asn Asp
Asp Asp Ile Asp Asp Tyr Asn Leu Arg Trp Phe 35 40 45Leu Phe Pro Ile
Asp Asp Asn Gln Tyr Ile Ile Thr Ser Tyr Ala Ala 50 55 60Asn Asn Cys
Lys Val Trp Asn Val Asn Asn Asp Lys Ile Asn Val Ser65 70 75 80Thr
Tyr Ser Ser Thr Asn Ser Ile Gln Lys Trp Gln Ile Lys Ala Asn 85 90
95Ala Ser Ser Tyr Val Ile Gln Ser Asn Asn Gly Lys Val Leu Thr Ala
100 105 110Gly Thr Gly Gln Ser Leu Gly Leu Ile Arg Leu Thr Asp Glu
Ser Pro 115 120 125Asp Asn Pro Asn Gln Gln Trp Asn Leu Thr Pro Val
Gln Thr Ile Gln 130 135 140Leu Pro Pro Lys Pro Thr Ile Asp Thr Lys
Leu Lys Asp Tyr Pro Lys145 150 155 160Tyr Ser Gln Thr Gly Asn Ile
Asp Lys Gly Thr Pro Pro Gln Leu Met 165 170 175Gly Trp Thr Leu Ile
Pro Cys Ile Met Val Asn Asp Pro Asn Ile Asp 180 185 190Lys Asn Thr
Gln Ile Lys Thr Thr Pro Tyr Tyr Ile Leu Lys Lys Tyr 195 200 205Gln
Tyr Trp Gln Gln Ala Val Gly Ser Asn Val Ala Leu Arg Pro His 210 215
220Glu Lys Lys Ser Tyr Ala Tyr Glu Trp Gly Thr Glu Ile Asp Gln
Lys225 230 235 240Thr Thr Ile Ile Asn Thr Leu Gly Phe Gln Ile Asn
Ile Asp Ser Gly 245 250 255Met Glu Phe Asp Ile Pro Glu Val Gly Gly
Gly Thr Asp Glu Ile Lys 260 265 270Thr Gln Leu Asn Glu Glu Leu Lys
Ile Glu Tyr Ser Arg Glu Thr Lys 275 280 285Ile Met Glu Lys Tyr Gln
Glu Gln Ser Glu Ile Asp Asn Pro Thr Asp 290 295 300Gln Ser Met Asn
Ser Ile Gly Phe Leu Thr Ile Thr Ser Leu Glu Leu305 310 315 320Tyr
Arg Tyr Asn Gly Ser Glu Ile Ser Val Met Lys Ile Gln Thr Ser 325 330
335Asp Asn Asp Thr Tyr Asn Val Thr Ser Tyr Pro Asp His Gln Gln Ala
340 345 350Leu
Leu Leu Leu Thr Asn His Ser Tyr Glu Gln Val Gln Glu Ile Thr 355 360
365Arg Ala Asn 370111341DNABacillus thuringiensis 111atgtcagctc
gtgaagtaca tattgaaata aacaataaaa cacgtcatac attacaatta 60gaggataaaa
ctaaacttag cggcggtaga tggcgaacat cacctacaaa tgttgctcgt
120gatacaatta aaacatttgt agcagaatca catggtttta tgacaggagt
agaaggtatt 180atatatttta gtgtaaacgg agacgcagaa attagtttac
attttgacaa tccttatata 240ggttctaata aatgtgatgg ttcttctgat
aaacctgaat atgaagttat tactcaaagc 300ggatcaggag ataaatctca
tgttacatat acaattcaga c 341112113PRTBacillus thuringiensis 112Met
Ser Ala Arg Glu Val His Ile Glu Ile Asn Asn Lys Thr Arg His1 5 10
15Thr Leu Gln Leu Glu Asp Lys Thr Lys Leu Ser Gly Gly Arg Trp Arg
20 25 30Thr Ser Pro Thr Asn Val Ala Arg Asp Thr Ile Lys Thr Phe Val
Ala 35 40 45Glu Ser His Gly Phe Met Thr Gly Val Glu Gly Ile Ile Tyr
Phe Ser 50 55 60Val Asn Gly Asp Ala Glu Ile Ser Leu His Phe Asp Asn
Pro Tyr Ile65 70 75 80Gly Ser Asn Lys Cys Asp Gly Ser Ser Asp Lys
Pro Glu Tyr Glu Val 85 90 95Ile Thr Gln Ser Gly Ser Gly Asp Lys Ser
His Val Thr Tyr Thr Ile 100 105 110Gln113360DNABacillus
thuringiensis 113atgtcagctc gcgaagtaca cattgaaata aacaataaaa
cacgtcatac attacaatta 60gaggataaaa ctaaacttag cggcggtaga tggcgaacat
cacctacaaa tgttgctcgt 120gatacaatta aaacatttgt agcagaatca
catggtttta tgacaggagt agaaggtatt 180atatatttta gtgtaaacgg
agacgcagaa attagtttac attttgacaa tccttatata 240ggttctaata
aatgtgatgg ttcttctgat aaacctgaat atgaagttat tactcaaagc
300ggatcaggag ataaatctca tgtgacatat actattcaga cagtatcttt
acgattataa 360114119PRTBacillus thuringiensis 114Met Ser Ala Arg
Glu Val His Ile Glu Ile Asn Asn Lys Thr Arg His1 5 10 15Thr Leu Gln
Leu Glu Asp Lys Thr Lys Leu Ser Gly Gly Arg Trp Arg 20 25 30Thr Ser
Pro Thr Asn Val Ala Arg Asp Thr Ile Lys Thr Phe Val Ala 35 40 45Glu
Ser His Gly Phe Met Thr Gly Val Glu Gly Ile Ile Tyr Phe Ser 50 55
60Val Asn Gly Asp Ala Glu Ile Ser Leu His Phe Asp Asn Pro Tyr Ile65
70 75 80Gly Ser Asn Lys Cys Asp Gly Ser Ser Asp Lys Pro Glu Tyr Glu
Val 85 90 95Ile Thr Gln Ser Gly Ser Gly Asp Lys Ser His Val Thr Tyr
Thr Ile 100 105 110Gln Thr Val Ser Leu Arg Leu
1151151158DNABacillus thuringiensis 115atgttagata ctaataaagt
ttatgaaata agcaatcttg ctaatggatt atatacatca 60acttatttaa gtcttgatga
ttcaggtgtt agtttaatga gtaaaaagga tgaagatatt 120gatgattaca
atttaaaatg gtttttattt cctattgata ataatcaata tattattaca
180agctatggag ctaataattg taaagtttgg aatgttaaaa atgataaaat
aaatgtttca 240acttattctt caacaaactc tgtacaaaaa tggcaaataa
aagctaaaga ttcttcatat 300ataatacaaa gtgataatgg aaaggtctta
acagcaggag taggtgaatc tcttggaata 360gtacgcctaa ctgatgaatt
tccagagaat tctaaccaac aatggaattt aactcctgta 420caaacaattc
aactcccaca aaaacctaaa atagatgaaa aattaaaaga tcatcctgaa
480tattcagaaa ccggaaatat aaatcctaaa acaactcctc aattaatggg
atggacatta 540gtaccttgta ttatggtaaa tgattcagga atagataaaa
acactcaaat taaaactact 600ccatattata tttttaaaaa atataaatac
tggaatctag caaaaggaag taatgtatct 660ttacttccac atcaaaaaag
atcatatgat tatgaatggg gtacagaaaa aaatcaaaaa 720acatctatta
ttaatacagt aggattgcaa attaatatag attcaggaat gaaatttgaa
780gtaccagaag taggaggagg tacagaagac ataaaaacac aattaactga
agaattaaaa 840gttgaatata gcactgaaac caaaataatg acgaaatatc
aagaacactc agagatagat 900aatccaacta atcaaccaat gaattctata
ggacttctta tttatacttc tttagaatta 960tatcgatata acggtacaga
aattaagata atggacatag aaacttcaga tcatgatact 1020tacactctta
cttcttatcc aaatcataaa gaagcattat tacttctcac aaaccattcg
1080tatgaagaag tagaagaaat aacaaaaata cctaagcata cacttataaa
attgaaaaaa 1140cattatttta aaaaataa 1158116385PRTBacillus
thuringiensis 116Met Leu Asp Thr Asn Lys Val Tyr Glu Ile Ser Asn
Leu Ala Asn Gly1 5 10 15Leu Tyr Thr Ser Thr Tyr Leu Ser Leu Asp Asp
Ser Gly Val Ser Leu 20 25 30Met Ser Lys Lys Asp Glu Asp Ile Asp Asp
Tyr Asn Leu Lys Trp Phe 35 40 45Leu Phe Pro Ile Asp Asn Asn Gln Tyr
Ile Ile Thr Ser Tyr Gly Ala 50 55 60Asn Asn Cys Lys Val Trp Asn Val
Lys Asn Asp Lys Ile Asn Val Ser65 70 75 80Thr Tyr Ser Ser Thr Asn
Ser Val Gln Lys Trp Gln Ile Lys Ala Lys 85 90 95Asp Ser Ser Tyr Ile
Ile Gln Ser Asp Asn Gly Lys Val Leu Thr Ala 100 105 110Gly Val Gly
Glu Ser Leu Gly Ile Val Arg Leu Thr Asp Glu Phe Pro 115 120 125Glu
Asn Ser Asn Gln Gln Trp Asn Leu Thr Pro Val Gln Thr Ile Gln 130 135
140Leu Pro Gln Lys Pro Lys Ile Asp Glu Lys Leu Lys Asp His Pro
Glu145 150 155 160Tyr Ser Glu Thr Gly Asn Ile Asn Pro Lys Thr Thr
Pro Gln Leu Met 165 170 175Gly Trp Thr Leu Val Pro Cys Ile Met Val
Asn Asp Ser Gly Ile Asp 180 185 190Lys Asn Thr Gln Ile Lys Thr Thr
Pro Tyr Tyr Ile Phe Lys Lys Tyr 195 200 205Lys Tyr Trp Asn Leu Ala
Lys Gly Ser Asn Val Ser Leu Leu Pro His 210 215 220Gln Lys Arg Ser
Tyr Asp Tyr Glu Trp Gly Thr Glu Lys Asn Gln Lys225 230 235 240Thr
Ser Ile Ile Asn Thr Val Gly Leu Gln Ile Asn Ile Asp Ser Gly 245 250
255Met Lys Phe Glu Val Pro Glu Val Gly Gly Gly Thr Glu Asp Ile Lys
260 265 270Thr Gln Leu Thr Glu Glu Leu Lys Val Glu Tyr Ser Thr Glu
Thr Lys 275 280 285Ile Met Thr Lys Tyr Gln Glu His Ser Glu Ile Asp
Asn Pro Thr Asn 290 295 300Gln Pro Met Asn Ser Ile Gly Leu Leu Ile
Tyr Thr Ser Leu Glu Leu305 310 315 320Tyr Arg Tyr Asn Gly Thr Glu
Ile Lys Ile Met Asp Ile Glu Thr Ser 325 330 335Asp His Asp Thr Tyr
Thr Leu Thr Ser Tyr Pro Asn His Lys Glu Ala 340 345 350Leu Leu Leu
Leu Thr Asn His Ser Tyr Glu Glu Val Glu Glu Ile Thr 355 360 365Lys
Ile Pro Lys His Thr Leu Ile Lys Leu Lys Lys His Tyr Phe Lys 370 375
380Lys385117341DNABacillus thuringiensis 117atgtcagcac gccaacttca
tattgatgta aataataaga caggtcatac attacaatta 60gaagataaaa caaaacttga
tggtggtaga tggcgaacat cacctacaaa tgttgctaat 120gatcaaatta
aaacatttgt agcagaatca catggtttta tgacaggtac agaaggtact
180atatattata gtataaatgg agaagcagaa attagtttat attttgacaa
tccttattca 240ggttctaata aatatgatgg gcattctaat aaaaatcaat
atgaagttat tacccaagga 300ggatcaggaa atcaatctca tgtgacttat
acgattcaca c 341118113PRTBacillus thuringiensis 118Met Ser Ala Arg
Gln Leu His Ile Asp Val Asn Asn Lys Thr Gly His1 5 10 15Thr Leu Gln
Leu Glu Asp Lys Thr Lys Leu Asp Gly Gly Arg Trp Arg 20 25 30Thr Ser
Pro Thr Asn Val Ala Asn Asp Gln Ile Lys Thr Phe Val Ala 35 40 45Glu
Ser His Gly Phe Met Thr Gly Thr Glu Gly Thr Ile Tyr Tyr Ser 50 55
60Ile Asn Gly Glu Ala Glu Ile Ser Leu Tyr Phe Asp Asn Pro Tyr Ser65
70 75 80Gly Ser Asn Lys Tyr Asp Gly His Ser Asn Lys Asn Gln Tyr Glu
Val 85 90 95Ile Thr Gln Gly Gly Ser Gly Asn Gln Ser His Val Thr Tyr
Thr Ile 100 105 110His119341DNABacillus thuringiensis 119atgtcaggtc
gtgaagttca tattgatgta aataataaga caggtcatac attacaatta 60gaagataaaa
caaaacttga tggtggtaga tggcgaacat cacctacaaa tgttgctaat
120gatcaaatta aaacatttgt agcagaatca catggtttta tgacaggtac
agaaggtact 180atatattata gtataaatgg agaagcagaa attagtttat
attttgataa tccttattca 240ggttctaata aatatgatgg gcattccaat
aaacctcaat atgaagttac tacccaagga 300ggatcaggaa atcaatctca
tgtaacgtat actattcaaa c 341120113PRTBacillus thuringiensis 120Met
Ser Gly Arg Glu Val His Ile Asp Val Asn Asn Lys Thr Gly His1 5 10
15Thr Leu Gln Leu Glu Asp Lys Thr Lys Leu Asp Gly Gly Arg Trp Arg
20 25 30Thr Ser Pro Thr Asn Val Ala Asn Asp Gln Ile Lys Thr Phe Val
Ala 35 40 45Glu Ser His Gly Phe Met Thr Gly Thr Glu Gly Thr Ile Tyr
Tyr Ser 50 55 60Ile Asn Gly Glu Ala Glu Ile Ser Leu Tyr Phe Asp Asn
Pro Tyr Ser65 70 75 80Gly Ser Asn Lys Tyr Asp Gly His Ser Asn Lys
Pro Gln Tyr Glu Val 85 90 95Thr Thr Gln Gly Gly Ser Gly Asn Gln Ser
His Val Thr Tyr Thr Ile 100 105 110Gln121341DNABacillus
thuringiensis 121atgtcaggtc gcgaagttga cattgatgta aataataaga
caggtcatac attacaatta 60gaagataaaa caaaacttga tggtggtaga tggcgaacat
cacctacaaa tgttgctaat 120gatcaaatta aaacatttgt agcagaatca
catggtttta tgacaggtac agaaggtact 180atatattata gtataaatgg
agaagcagaa attagtttat attttgataa tccttattca 240ggttctaata
aatatgatgg gcattccaat aaacctcaat atgaagttac tacccaagga
300ggatcaggaa atcaatctca tgtcacatat acgattcaaa c
341122113PRTBacillus thuringiensis 122Met Ser Gly Arg Glu Val Asp
Ile Asp Val Asn Asn Lys Thr Gly His1 5 10 15Thr Leu Gln Leu Glu Asp
Lys Thr Lys Leu Asp Gly Gly Arg Trp Arg 20 25 30Thr Ser Pro Thr Asn
Val Ala Asn Asp Gln Ile Lys Thr Phe Val Ala 35 40 45Glu Ser His Gly
Phe Met Thr Gly Thr Glu Gly Thr Ile Tyr Tyr Ser 50 55 60Ile Asn Gly
Glu Ala Glu Ile Ser Leu Tyr Phe Asp Asn Pro Tyr Ser65 70 75 80Gly
Ser Asn Lys Tyr Asp Gly His Ser Asn Lys Pro Gln Tyr Glu Val 85 90
95Thr Thr Gln Gly Gly Ser Gly Asn Gln Ser His Val Thr Tyr Thr Ile
100 105 110Gln123341DNABacillus thuringiensis 123atgtcagcac
gtgaagtaga tattgatgta aataataaga caggtcatac attacaatta 60gaagataaaa
caaaacttga tggtggtaga tggcgaacat cacctacaaa tgttgctaat
120gatcaaatta aaacatttgt agcagaatca catggtttta tgacaggtac
agaaggtact 180atatattata gtataaatgg agaagcagaa attagtttat
attttgataa tccttattca 240ggttctaata aatatgatgg gcattccaat
aaacctcaat atgaagttac tacccaagga 300ggatcaggaa atcaatctca
tgtaacgtat acgattcaaa c 341124113PRTBacillus thuringiensis 124Met
Ser Ala Arg Glu Val Asp Ile Asp Val Asn Asn Lys Thr Gly His1 5 10
15Thr Leu Gln Leu Glu Asp Lys Thr Lys Leu Asp Gly Gly Arg Trp Arg
20 25 30Thr Ser Pro Thr Asn Val Ala Asn Asp Gln Ile Lys Thr Phe Val
Ala 35 40 45Glu Ser His Gly Phe Met Thr Gly Thr Glu Gly Thr Ile Tyr
Tyr Ser 50 55 60Ile Asn Gly Glu Ala Glu Ile Ser Leu Tyr Phe Asp Asn
Pro Tyr Ser65 70 75 80Gly Ser Asn Lys Tyr Asp Gly His Ser Asn Lys
Pro Gln Tyr Glu Val 85 90 95Thr Thr Gln Gly Gly Ser Gly Asn Gln Ser
His Val Thr Tyr Thr Ile 100 105 110Gln1251103DNABacillus
thuringiensis 125atgttagata ctaataaagt ttatgaaata agtaatcatg
ctaatggact atatgcagca 60acttatttaa gtttagatga ttcaggtgtt agtttaatga
ataaaaatga tgatgatatt 120gatgattata acttaaaatg gtttttattt
cctattgatg atgatcaata tattattaca 180agctatgcag caaataattg
taaagtttgg aatgttaata atgataaaat aaatgtttcg 240acttattctt
caacaaattc aatacaaaaa tggcaaataa aagctaatgg ttcttcatat
300gtaatacaaa gtgataatgg aaaagtctta acagcaggaa ccggtcaagc
tcttggattg 360atacgtttaa ctgatgaatc ctcaaataat cccaatcaac
aatggaattt aacttctgta 420caaacaattc aacttccaca aaaacctata
atagatacaa aattaaaaga ttatcccaaa 480tattcaccaa ctggaaatat
agataatgga acatctcctc aattaatggg atggacatta 540gtaccttgta
ttatggtaaa tgatccaaat atagataaaa atactcaaat taaaactact
600ccatattata ttttaaaaaa atatcaatat tggcaacgag cagtaggaag
taatgtagct 660ttacgtccac atgaagaaaa atcatatact tatgaatggg
gaacagaaat agatcaaaaa 720acaacaatca taaatacatt aggatttcaa
atcaatatag attcaggaat gaaatttgat 780ataccagaag taggtggagg
tacagatgaa ataaaaacac aactaaatga agaattaaaa 840atagaatata
gtcgtgaaac taaaataatg gaaaaatatc aagaacaatc tgaaatagat
900aatccaactg atcaaccaat gaattctata ggatttctta ctattacttc
tttagaatta 960tatagatata atggctcaga aattcgtata atgcaaattc
aaacctcaga taatgatact 1020tataatgtta cttcttatcc agatcatcaa
caagctttat tacttcttac aaatcattca 1080tatgaagaac ttgaagaaat tag
1103126367PRTBacillus thuringiensis 126Met Leu Asp Thr Asn Lys Val
Tyr Glu Ile Ser Asn His Ala Asn Gly1 5 10 15Leu Tyr Ala Ala Thr Tyr
Leu Ser Leu Asp Asp Ser Gly Val Ser Leu 20 25 30Met Asn Lys Asn Asp
Asp Asp Ile Asp Asp Tyr Asn Leu Lys Trp Phe 35 40 45Leu Phe Pro Ile
Asp Asp Asp Gln Tyr Ile Ile Thr Ser Tyr Ala Ala 50 55 60Asn Asn Cys
Lys Val Trp Asn Val Asn Asn Asp Lys Ile Asn Val Ser65 70 75 80Thr
Tyr Ser Ser Thr Asn Ser Ile Gln Lys Trp Gln Ile Lys Ala Asn 85 90
95Gly Ser Ser Tyr Val Ile Gln Ser Asp Asn Gly Lys Val Leu Thr Ala
100 105 110Gly Thr Gly Gln Ala Leu Gly Leu Ile Arg Leu Thr Asp Glu
Ser Ser 115 120 125Asn Asn Pro Asn Gln Gln Trp Asn Leu Thr Ser Val
Gln Thr Ile Gln 130 135 140Leu Pro Gln Lys Pro Ile Ile Asp Thr Lys
Leu Lys Asp Tyr Pro Lys145 150 155 160Tyr Ser Pro Thr Gly Asn Ile
Asp Asn Gly Thr Ser Pro Gln Leu Met 165 170 175Gly Trp Thr Leu Val
Pro Cys Ile Met Val Asn Asp Pro Asn Ile Asp 180 185 190Lys Asn Thr
Gln Ile Lys Thr Thr Pro Tyr Tyr Ile Leu Lys Lys Tyr 195 200 205Gln
Tyr Trp Gln Arg Ala Val Gly Ser Asn Val Ala Leu Arg Pro His 210 215
220Glu Glu Lys Ser Tyr Thr Tyr Glu Trp Gly Thr Glu Ile Asp Gln
Lys225 230 235 240Thr Thr Ile Ile Asn Thr Leu Gly Phe Gln Ile Asn
Ile Asp Ser Gly 245 250 255Met Lys Phe Asp Ile Pro Glu Val Gly Gly
Gly Thr Asp Glu Ile Lys 260 265 270Thr Gln Leu Asn Glu Glu Leu Lys
Ile Glu Tyr Ser Arg Glu Thr Lys 275 280 285Ile Met Glu Lys Tyr Gln
Glu Gln Ser Glu Ile Asp Asn Pro Thr Asp 290 295 300Gln Pro Met Asn
Ser Ile Gly Phe Leu Thr Ile Thr Ser Leu Glu Leu305 310 315 320Tyr
Arg Tyr Asn Gly Ser Glu Ile Arg Ile Met Gln Ile Gln Thr Ser 325 330
335Asp Asn Asp Thr Tyr Asn Val Thr Ser Tyr Pro Asp His Gln Gln Ala
340 345 350Leu Leu Leu Leu Thr Asn His Ser Tyr Glu Glu Leu Glu Glu
Ile 355 360 365127369DNAArtificial SequencePolynucleotide sequence
for a gene designated 149B1-15-PO, which is optimized for
expression in Zea mays 127atgtccgccc gcgaggtgca catcgacgtg
aacaacaaga ccggccacac cctccagctg 60gaggacaaga ccaagctcga cggcggcagg
tggcgcacct ccccgaccaa cgtggccaac 120gaccagatca agaccttcgt
ggccgaatcc aacggcttca tgaccggcac cgagggcacc 180atctactact
ccatcaacgg cgaggccgag atcagcctct acttcgacaa cccgttcgcc
240ggctccaaca aatacgacgg ccactccaac aagtcccagt acgagatcat
cacccagggc 300ggctccggca accagtccca cgtgacctac accatccaga
ccacctcctc ccgctacggc 360cacaagtcc 3691281149DNAArtificial
SequencePolynucleotide sequence for a gene designated 149B1-45-PO,
which is optimized for expression in Zea mays 128atgctcgaca
ccaacaaggt gtacgagatc agcaaccacg ccaacggcct ctacgccgcc 60acctacctct
ccctcgacga ctccggcgtg tccctcatga acaagaacga cgacgacatc
120gacgactaca acctcaagtg gttcctcttc ccgatcgacg acgaccagta
catcatcacc 180tcctacgccg ccaacaactg caaggtgtgg aacgtgaaca
acgacaagat caacgtgtcc 240acctactcct ccaccaactc catccagaag
tggcagatca aggccaacgg ctcctcctac 300gtgatccagt ccgacaacgg
caaggtgctc accgccggca ccggccaggc cctcggcctc 360atccgcctca
ccgacgagtc ctccaacaac ccgaaccagc aatggaacct gacgtccgtg
420cagaccatcc agctcccgca gaagccgatc atcgacacca agctcaagga
ctacccgaag 480tactccccga ccggcaacat cgacaacggc acctccccgc
agctcatggg ctggaccctc 540gtgccgtgca tcatggtgaa
cgacccgaac atcgacaaga acacccagat caagaccacc 600ccgtactaca
tcctcaagaa gtaccagtac tggcagaggg ccgtgggctc caacgtcgcg
660ctccgcccgc acgagaagaa gtcctacacc tacgagtggg gcaccgagat
cgaccagaag 720accaccatca tcaacaccct cggcttccag atcaacatcg
acagcggcat gaagttcgac 780atcccggagg tgggcggcgg taccgacgag
atcaagaccc agctcaacga ggagctcaag 840atcgagtact cccacgagac
gaagatcatg gagaagtacc aggagcagtc cgagatcgac 900aacccgaccg
accagtccat gaactccatc ggcttcctca ccatcacctc cctggagctc
960taccgctaca acggctccga gatccgcatc atgcagatcc agacctccga
caacgacacc 1020tacaacgtga cctcctaccc gaaccaccag caggccctgc
tgctgctgac caaccactcc 1080tacgaggagg tggaggagat caccaacatc
ccgaagtcca ccctcaagaa gctcaagaag 1140tactacttc
1149129357DNAArtificial SequencePolynucleotide sequence for a gene
designated 80JJ1-15-PO7, which is optimized for expression in maize
129atgtccgccc gcgaggtgca catcgagatc aacaacaaga cccgccacac
cctccagctc 60gaggacaaga ccaagctctc cggcggcagg tggcgcacct ccccgaccaa
cgtggcccgc 120gacaccatca agacgttcgt ggcggagtcc cacggcttca
tgaccggcgt cgagggcatc 180atctacttct ccgtgaacgg cgacgccgag
atctccctcc acttcgacaa cccgtacatc 240ggctccaaca agtccgacgg
ctcctccgac aagcccgagt acgaggtgat cacccagtcc 300ggctccggcg
acaagtccca cgtgacctac accatccaga ccgtgtccct ccgcctc
357130119PRTArtificial SequenceAmino acid sequence for a toxin
encoded by the gene designated 80JJ1-15-PO7 130Met Ser Ala Arg Glu
Val His Ile Glu Ile Asn Asn Lys Thr Arg His1 5 10 15Thr Leu Gln Leu
Glu Asp Lys Thr Lys Leu Ser Gly Gly Arg Trp Arg 20 25 30Thr Ser Pro
Thr Asn Val Ala Arg Asp Thr Ile Lys Thr Phe Val Ala 35 40 45Glu Ser
His Gly Phe Met Thr Gly Val Glu Gly Ile Ile Tyr Phe Ser 50 55 60Val
Asn Gly Asp Ala Glu Ile Ser Leu His Phe Asp Asn Pro Tyr Ile65 70 75
80Gly Ser Asn Lys Ser Asp Gly Ser Ser Asp Lys Pro Glu Tyr Glu Val
85 90 95Ile Thr Gln Ser Gly Ser Gly Asp Lys Ser His Val Thr Tyr Thr
Ile 100 105 110Gln Thr Val Ser Leu Arg Leu 11513121DNAArtificial
SequenceOligonucleotide primer (15kfor1) 131atgtcagctc gcgaagtaca c
2113222DNAArtificial SequenceOligonucleotide primer (45krev6)
132gtccatccca ttaattgagg ag 22133399DNABacillus thuringiensis
133atgtcagcac gtgaagtaca cattgaaata ataaatcata caggtcatac
cttacaaatg 60gataaaagaa ctagacttgc acatggtgaa tggattatta cacccgtgaa
tgttccaaat 120aattcttctg atttatttca agcaggttct gatggagttt
tgacaggagt agaaggaata 180ataatttata ctataaatgg agaaatagaa
attcccttac attttgacaa tccttatgca 240ggttctaata aatattctgg
acgttctagt gatgatgatt ataaagttat aactgaagca 300agagcagaac
atagagctaa taatcatgat catgtaacat atacagttca aagaaacata
360tcacgatata ccaataaatt atgttctaat aactcctaa 399134132PRTBacillus
thuringiensis 134Met Ser Ala Arg Glu Val His Ile Glu Ile Ile Asn
His Thr Gly His1 5 10 15Thr Leu Gln Met Asp Lys Arg Thr Arg Leu Ala
His Gly Glu Trp Ile 20 25 30Ile Thr Pro Val Asn Val Pro Asn Asn Ser
Ser Asp Leu Phe Gln Ala 35 40 45Gly Ser Asp Gly Val Leu Thr Gly Val
Glu Gly Ile Ile Ile Tyr Thr 50 55 60Ile Asn Gly Glu Ile Glu Ile Pro
Leu His Phe Asp Asn Pro Tyr Ala65 70 75 80Gly Ser Asn Lys Tyr Ser
Gly Arg Ser Ser Asp Asp Asp Tyr Lys Val 85 90 95Ile Thr Glu Ala Arg
Ala Glu His Arg Ala Asn Asn His Asp His Val 100 105 110Thr Tyr Thr
Val Gln Arg Asn Ile Ser Arg Tyr Thr Asn Lys Leu Cys 115 120 125Ser
Asn Asn Ser 1301351164DNABacillus thuringiensis 135atgatagaaa
ctaataagat atatgaaata agcaataaag ctaatggatt atatgcaact 60acttatttaa
gttttgataa ttcaggtgtt agtttattaa ataaaaatga atctgatatt
120aatgattata atttgaaatg gtttttattt cctattgata ataatcagta
tattattaca 180agttatggag taaataaaaa taaggtttgg actgctaatg
gtaataaaat aaatgttaca 240acatattccg cagaaaattc agcacaacaa
tggcaaataa gaaacagttc ttctggatat 300ataatagaaa ataataatgg
gaaaatttta acggcaggaa caggccaatc attaggttta 360ttatatttaa
ctgatgaaat acctgaagat tctaatcaac aatggaattt aacttcaata
420caaacaattt cacttccttc acaaccaata attgatacaa cattagtaga
ttaccctaaa 480tattcaacga ccggtagtat aaattataat ggtacagcac
ttcaattaat gggatggaca 540ctcataccat gtattatggt atacgataaa
acgatagctt ctacacacac tcaaattaca 600acaacccctt attatatttt
gaaaaaatat caacgttggg tacttgcaac aggaagtggt 660ctatctgtac
ctgcacatgt caaatcaact ttcgaatacg aatggggaac agacacagat
720caaaaaacca gtgtaataaa tacattaggt tttcaaatta atacagatac
aaaattaaaa 780gctactgtac cagaagtagg tggaggtaca acagatataa
gaacacaaat cactgaagaa 840cttaaagtag aatatagtag tgaaaataaa
gaaatgcgaa aatataaaca aagctttgac 900gtagacaact taaattatga
tgaagcacta aatgctgtag gatttattgt tgaaacttca 960ttcgaattat
atcgaatgaa tggaaatgtc cttataacaa gtataaaaac tacaaataaa
1020gacacctata atacagttac ttatccaaat cataaagaag ttttattact
tcttacaaat 1080cattcttatg aagaagtaac agcactaact ggcatttcca
aagaaagact tcaaaatctt 1140aaaaacaatt ggaaaaaaag ataa
1164136387PRTBacillus thuringiensis 136Met Ile Glu Thr Asn Lys Ile
Tyr Glu Ile Ser Asn Lys Ala Asn Gly1 5 10 15Leu Tyr Ala Thr Thr Tyr
Leu Ser Phe Asp Asn Ser Gly Val Ser Leu 20 25 30Leu Asn Lys Asn Glu
Ser Asp Ile Asn Asp Tyr Asn Leu Lys Trp Phe 35 40 45Leu Phe Pro Ile
Asp Asn Asn Gln Tyr Ile Ile Thr Ser Tyr Gly Val 50 55 60Asn Lys Asn
Lys Val Trp Thr Ala Asn Gly Asn Lys Ile Asn Val Thr65 70 75 80Thr
Tyr Ser Ala Glu Asn Ser Ala Gln Gln Trp Gln Ile Arg Asn Ser 85 90
95Ser Ser Gly Tyr Ile Ile Glu Asn Asn Asn Gly Lys Ile Leu Thr Ala
100 105 110Gly Thr Gly Gln Ser Leu Gly Leu Leu Tyr Leu Thr Asp Glu
Ile Pro 115 120 125Glu Asp Ser Asn Gln Gln Trp Asn Leu Thr Ser Ile
Gln Thr Ile Ser 130 135 140Leu Pro Ser Gln Pro Ile Ile Asp Thr Thr
Leu Val Asp Tyr Pro Lys145 150 155 160Tyr Ser Thr Thr Gly Ser Ile
Asn Tyr Asn Gly Thr Ala Leu Gln Leu 165 170 175Met Gly Trp Thr Leu
Ile Pro Cys Ile Met Val Tyr Asp Lys Thr Ile 180 185 190Ala Ser Thr
His Thr Gln Ile Thr Thr Thr Pro Tyr Tyr Ile Leu Lys 195 200 205Lys
Tyr Gln Arg Trp Val Leu Ala Thr Gly Ser Gly Leu Ser Val Pro 210 215
220Ala His Val Lys Ser Thr Phe Glu Tyr Glu Trp Gly Thr Asp Thr
Asp225 230 235 240Gln Lys Thr Ser Val Ile Asn Thr Leu Gly Phe Gln
Ile Asn Thr Asp 245 250 255Thr Lys Leu Lys Ala Thr Val Pro Glu Val
Gly Gly Gly Thr Thr Asp 260 265 270Ile Arg Thr Gln Ile Thr Glu Glu
Leu Lys Val Glu Tyr Ser Ser Glu 275 280 285Asn Lys Glu Met Arg Lys
Tyr Lys Gln Ser Phe Asp Val Asp Asn Leu 290 295 300Asn Tyr Asp Glu
Ala Leu Asn Ala Val Gly Phe Ile Val Glu Thr Ser305 310 315 320Phe
Glu Leu Tyr Arg Met Asn Gly Asn Val Leu Ile Thr Ser Ile Lys 325 330
335Thr Thr Asn Lys Asp Thr Tyr Asn Thr Val Thr Tyr Pro Asn His Lys
340 345 350Glu Val Leu Leu Leu Leu Thr Asn His Ser Tyr Glu Glu Val
Thr Ala 355 360 365Leu Thr Gly Ile Ser Lys Glu Arg Leu Gln Asn Leu
Lys Asn Asn Trp 370 375 380Lys Lys Arg385137341DNABacillus
thuringiensis 137atgtcagcag gtgaagttca tattgaaata aataataaaa
cacgtcatac attacaatta 60gaggataaaa ctaaacttac cagtggtaga tggcgaacat
cacctacaaa tgttgctcgt 120gatacaatta aaacatttgt agcagaatca
catggtttta tgacaggaat agaaggtatt 180atatatttta gcgtaaacgg
agaagcagaa attagtttac attttgacaa tccttatgta 240ggttctaata
aatatgatgg ttcttctgat aaagctgcat acgaagttat tgctcaaggt
300ggatcagggg atatatctca tctaacatat acaattcaaa c
341138113PRTBacillus thuringiensis 138Met Ser Ala Gly Glu Val His
Ile Glu Ile Asn Asn Lys Thr Arg His1 5 10 15Thr Leu Gln Leu Glu Asp
Lys Thr Lys Leu Thr Ser Gly Arg Trp Arg 20 25 30Thr Ser Pro Thr Asn
Val Ala Arg Asp Thr Ile Lys Thr Phe Val Ala 35 40 45Glu Ser His Gly
Phe Met Thr Gly Ile Glu Gly Ile Ile Tyr Phe Ser 50 55 60Val Asn Gly
Glu Ala Glu Ile Ser Leu His Phe Asp Asn Pro Tyr Val65 70 75 80Gly
Ser Asn Lys Tyr Asp Gly Ser Ser Asp Lys Ala Ala Tyr Glu Val 85 90
95Ile Ala Gln Gly Gly Ser Gly Asp Ile Ser His Leu Thr Tyr Thr Ile
100 105 110Gln1391158DNABacillus thuringiensis 139atgttagata
ctaataaaat ttatgaaata agcaatcatg ctaatggatt atatacatca 60acttatttaa
gtctggatga ttcaggtgtt agtttaatgg gtcaaaatga tgaggatata
120gatgaataca atttaaagtg gttcttattt ccaatagata ataatcaata
tattattaca 180agctatggag cgaataattg taaagtttgg aatgttaaaa
atgataaagt aaatgtttca 240acgtattctc caacaaactc agtacaaaaa
tggcaaataa aagctaaaaa ttcttcatat 300ataatacaaa gtgagaatgg
aaaagtctta acagcaggaa taggtcaatc tcttggaata 360gtacgcttaa
ccgatgaatc atcagagagt tctaaccaac aatggaattt aatccctgta
420caaacaattt cactcccaca aaaacctaaa atagataaaa aattaaaaga
tcatcctgaa 480tattcagaaa ccggaaatat agctactgga acaattcctc
aattaatggg atggacatta 540gtaccttgta ttatggtaaa tgatccaaaa
ataggtaaaa acactcaaat taaaactact 600ccatattata tttttaaaaa
atatcaatac tggaaacgag caataggaag taatgtatct 660ttacttccac
atcaaaaaaa atcatatgat tatgagtggg gtacagaaga aaatcaaaaa
720acaactatta ttaatacagt aggatttcaa attaatgtag attcaggaat
gaagtttgag 780gtaccagaag taggaggagg tacagaagaa ataaaaacac
aattaaatga agaattaaaa 840gttgaatata gcactgacac caaaataatg
aaaaaatatc aagaacactc agagatagat 900aatccaacta atcaaacaac
gaattctata ggatttctta cttttacttc tttagaatta 960tatcgatata
acggttcgga aattcgtata atgagaatgg aaacttcaga taatgatact
1020tatactctga cctcttatcc aaatcataga gaagcattat tacttctcac
aaatcattct 1080tatcaagaag taagccgaat tccagcacac tggcggccgt
tactagtgga tccgagctcg 1140gtaccaagct tggcgtaa 1158140385PRTBacillus
thuringiensis 140Met Leu Asp Thr Asn Lys Ile Tyr Glu Ile Ser Asn
His Ala Asn Gly1 5 10 15Leu Tyr Thr Ser Thr Tyr Leu Ser Leu Asp Asp
Ser Gly Val Ser Leu 20 25 30Met Gly Gln Asn Asp Glu Asp Ile Asp Glu
Tyr Asn Leu Lys Trp Phe 35 40 45Leu Phe Pro Ile Asp Asn Asn Gln Tyr
Ile Ile Thr Ser Tyr Gly Ala 50 55 60Asn Asn Cys Lys Val Trp Asn Val
Lys Asn Asp Lys Val Asn Val Ser65 70 75 80Thr Tyr Ser Pro Thr Asn
Ser Val Gln Lys Trp Gln Ile Lys Ala Lys 85 90 95Asn Ser Ser Tyr Ile
Ile Gln Ser Glu Asn Gly Lys Val Leu Thr Ala 100 105 110Gly Ile Gly
Gln Ser Leu Gly Ile Val Arg Leu Thr Asp Glu Ser Ser 115 120 125Glu
Ser Ser Asn Gln Gln Trp Asn Leu Ile Pro Val Gln Thr Ile Ser 130 135
140Leu Pro Gln Lys Pro Lys Ile Asp Lys Lys Leu Lys Asp His Pro
Glu145 150 155 160Tyr Ser Glu Thr Gly Asn Ile Ala Thr Gly Thr Ile
Pro Gln Leu Met 165 170 175Gly Trp Thr Leu Val Pro Cys Ile Met Val
Asn Asp Pro Lys Ile Gly 180 185 190Lys Asn Thr Gln Ile Lys Thr Thr
Pro Tyr Tyr Ile Phe Lys Lys Tyr 195 200 205Gln Tyr Trp Lys Arg Ala
Ile Gly Ser Asn Val Ser Leu Leu Pro His 210 215 220Gln Lys Lys Ser
Tyr Asp Tyr Glu Trp Gly Thr Glu Glu Asn Gln Lys225 230 235 240Thr
Thr Ile Ile Asn Thr Val Gly Phe Gln Ile Asn Val Asp Ser Gly 245 250
255Met Lys Phe Glu Val Pro Glu Val Gly Gly Gly Thr Glu Glu Ile Lys
260 265 270Thr Gln Leu Asn Glu Glu Leu Lys Val Glu Tyr Ser Thr Asp
Thr Lys 275 280 285Ile Met Lys Lys Tyr Gln Glu His Ser Glu Ile Asp
Asn Pro Thr Asn 290 295 300Gln Thr Thr Asn Ser Ile Gly Phe Leu Thr
Phe Thr Ser Leu Glu Leu305 310 315 320Tyr Arg Tyr Asn Gly Ser Glu
Ile Arg Ile Met Arg Met Glu Thr Ser 325 330 335Asp Asn Asp Thr Tyr
Thr Leu Thr Ser Tyr Pro Asn His Arg Glu Ala 340 345 350Leu Leu Leu
Leu Thr Asn His Ser Tyr Gln Glu Val Ser Arg Ile Pro 355 360 365Ala
His Trp Arg Pro Leu Leu Val Asp Pro Ser Ser Val Pro Ser Leu 370 375
380Ala385141399DNABacillus thuringiensis 141atgtcagatc gcgaagtaca
tattgaaata ataaatcata caggtcatac cttacaaatg 60gataaaagaa ctagacttgc
acatggtgaa tggattatta cacccgtgaa tgttccaaat 120aattcttctg
atttatttca agcaggttct gatggagttt tgacaggagt agaaggaata
180ataatttata ctataaatgg agaaatagaa attaccttac attttgacaa
tccttatgca 240ggttctaata aatattctgg acgttctagt gatgatgatt
ataaagttat aactgaagca 300agagcagaac atagagctaa taatcatgat
catgtaacat atacagttca aagaaacata 360tcacgatata ccaataaatt
atgttctaat aactcctaa 399142132PRTBacillus thuringiensis 142Met Ser
Asp Arg Glu Val His Ile Glu Ile Ile Asn His Thr Gly His1 5 10 15Thr
Leu Gln Met Asp Lys Arg Thr Arg Leu Ala His Gly Glu Trp Ile 20 25
30Ile Thr Pro Val Asn Val Pro Asn Asn Ser Ser Asp Leu Phe Gln Ala
35 40 45Gly Ser Asp Gly Val Leu Thr Gly Val Glu Gly Ile Ile Ile Tyr
Thr 50 55 60Ile Asn Gly Glu Ile Glu Ile Thr Leu His Phe Asp Asn Pro
Tyr Ala65 70 75 80Gly Ser Asn Lys Tyr Ser Gly Arg Ser Ser Asp Asp
Asp Tyr Lys Val 85 90 95Ile Thr Glu Ala Arg Ala Glu His Arg Ala Asn
Asn His Asp His Val 100 105 110Thr Tyr Thr Val Gln Arg Asn Ile Ser
Arg Tyr Thr Asn Lys Leu Cys 115 120 125Ser Asn Asn Ser
130143871DNABacillus thuringiensis 143atgatagaaa ctaataagat
atatgaaata agcaataaag ctaatggatt atatgcaact 60acttatttaa gttttgataa
ttcaggtgtt agtttattaa ataaaaatga atctgatatt 120aatgattata
atttgaaatg gtttttattt cctattgata ataatcagta tattattaca
180agttatggag taaataaaaa taaggtttgg actgctaatg gtaataaaat
aaatgttaca 240acatattccg cagaaaattc agcacaacaa tggcaaataa
gaaacagttc ttctggatat 300ataatagaaa ataataatgg gaaaatttta
acggcaggaa caggccaatc attaggttta 360ttatatttaa ctgatgaaat
acctgaagat tctaatcaac aatggaattt aacttcaata 420caaacaattt
cacttccttc acaaccaata attgatacaa cattagtaga ttaccctaaa
480tattcaacga ccggtagtat aaattataat ggtacagcac ttcaattaat
gggatggaca 540ctcataccat gtattatggt atacgataaa acgatagctt
ctacacacac tcaaattaca 600acaacccctt attatatttt gaaaaaatat
caacgttggg tacttgcaac aggaagtggt 660ctatctgtac ctgcacatgt
caaatcaact ttcgaatacg aatggggaac agacacagat 720caaaaaacca
gtgtaataaa tacattaggt tttcaaatta atacagatac aaaattaaaa
780gctactgtac cagaagtagg tggaggtaca acagatataa gaacacaaat
cactgaagaa 840cttaaagtag aatatagtag tgaaaataaa g
871144290PRTBacillus thuringiensis 144Met Ile Glu Thr Asn Lys Ile
Tyr Glu Ile Ser Asn Lys Ala Asn Gly1 5 10 15Leu Tyr Ala Thr Thr Tyr
Leu Ser Phe Asp Asn Ser Gly Val Ser Leu 20 25 30Leu Asn Lys Asn Glu
Ser Asp Ile Asn Asp Tyr Asn Leu Lys Trp Phe 35 40 45Leu Phe Pro Ile
Asp Asn Asn Gln Tyr Ile Ile Thr Ser Tyr Gly Val 50 55 60Asn Lys Asn
Lys Val Trp Thr Ala Asn Gly Asn Lys Ile Asn Val Thr65 70 75 80Thr
Tyr Ser Ala Glu Asn Ser Ala Gln Gln Trp Gln Ile Arg Asn Ser 85 90
95Ser Ser Gly Tyr Ile Ile Glu Asn Asn Asn Gly Lys Ile Leu Thr Ala
100 105 110Gly Thr Gly Gln Ser Leu Gly Leu Leu Tyr Leu Thr Asp Glu
Ile Pro 115 120 125Glu Asp Ser Asn Gln Gln Trp Asn Leu Thr Ser Ile
Gln Thr Ile Ser 130 135 140Leu Pro Ser Gln Pro Ile Ile Asp Thr Thr
Leu Val Asp Tyr Pro Lys145 150 155 160Tyr Ser Thr Thr Gly Ser Ile
Asn Tyr Asn Gly Thr Ala Leu Gln Leu 165 170 175Met Gly Trp Thr Leu
Ile Pro
Cys Ile Met Val Tyr Asp Lys Thr Ile 180 185 190Ala Ser Thr His Thr
Gln Ile Thr Thr Thr Pro Tyr Tyr Ile Leu Lys 195 200 205Lys Tyr Gln
Arg Trp Val Leu Ala Thr Gly Ser Gly Leu Ser Val Pro 210 215 220Ala
His Val Lys Ser Thr Phe Glu Tyr Glu Trp Gly Thr Asp Thr Asp225 230
235 240Gln Lys Thr Ser Val Ile Asn Thr Leu Gly Phe Gln Ile Asn Thr
Asp 245 250 255Thr Lys Leu Lys Ala Thr Val Pro Glu Val Gly Gly Gly
Thr Thr Asp 260 265 270Ile Arg Thr Gln Ile Thr Glu Glu Leu Lys Val
Glu Tyr Ser Ser Glu 275 280 285Asn Lys 290145372DNABacillus
thuringiensis 145atgtcagcac gtgaagtaca cattgatgta aataataaga
caggtcatac attacaatta 60gaagataaaa caaaacttga tggtggtaga tggcgaacat
cacctacaaa tgttgctaat 120gatcaaatta aaacatttgt agcagaatca
catggtttta tgacaggtac agaaggtact 180atatattata gtataaatgg
agaagcagaa attagtttat attttgataa tccttattca 240ggttctaata
aatatgatgg gcattccaat aaacctcaat atgaagttac tacccaagga
300ggatcaggaa atcaatctca tgttacgtat actattcaaa ctgcatcttc
acgatatggg 360aataactcat aa 372146123PRTBacillus thuringiensis
146Met Ser Ala Arg Glu Val His Ile Asp Val Asn Asn Lys Thr Gly His1
5 10 15Thr Leu Gln Leu Glu Asp Lys Thr Lys Leu Asp Gly Gly Arg Trp
Arg 20 25 30Thr Ser Pro Thr Asn Val Ala Asn Asp Gln Ile Lys Thr Phe
Val Ala 35 40 45Glu Ser His Gly Phe Met Thr Gly Thr Glu Gly Thr Ile
Tyr Tyr Ser 50 55 60Ile Asn Gly Glu Ala Glu Ile Ser Leu Tyr Phe Asp
Asn Pro Tyr Ser65 70 75 80Gly Ser Asn Lys Tyr Asp Gly His Ser Asn
Lys Pro Gln Tyr Glu Val 85 90 95Thr Thr Gln Gly Gly Ser Gly Asn Gln
Ser His Val Thr Tyr Thr Ile 100 105 110Gln Thr Ala Ser Ser Arg Tyr
Gly Asn Asn Ser 115 1201471152DNABacillus thuringiensis
147atgttagata ctaataaagt ttatgaaata agtaatcatg ctaatggact
atatgcagca 60acttatttaa gtttagatga ttcaggtgtt agtttaatga ataaaaatga
tgatgatatt 120gatgattata acttaaaatg gtttttattt cctattgatg
atgatcaata tattattaca 180agctatgcag caaataattg taaagtttgg
aatgttaata atgataaaat aaatgtttcg 240acttattctt caacaaattc
aatacaaaaa tggcaaataa aagctaatgg ttcttcatat 300gtaatacaaa
gtgataatgg aaaagtctta acagcaggaa ccggtcaagc tcttggattg
360atacgtttaa ctgatgaatc ctcaaataat cccaatcaac aatggaattt
aacttctgta 420caaacaattc aacttccaca aaaacctata atagatacaa
aattaaaaga ttatcccaaa 480tattcaccaa ctggaaatat agataatgga
acatctcctc aattaatggg atggacatta 540gtaccttgta ttatggtaaa
tgatccaaat atagataaaa atactcaaat taaaactact 600ccatattata
ttttaaaaaa atatcaatat tggcaacgag cagtaggaag taatgtagct
660ttacgtccac atgaaaaaaa atcatatact tatgaatggg gaacagaaat
agatcaaaaa 720acaacaatca taaatacatt aggatttcaa atcaatatag
attcaggaat gaaatttgat 780ataccagaag taggtggagg tacagatgaa
ataaaaacac aactaaatga agaattaaaa 840atagaatata gtcgtgaaac
taaaataatg gaaaaatatc aagaacaatc tgaaatagat 900aatccaactg
atcaaccaat gaattctata ggatttctta ctattacttc tttagaatta
960tatagatata atggctcaga aattcgtata atgcaaattc aaacctcaga
taatgatact 1020tataatgtta cttcttatcc agatcatcaa caagctttat
tacttcttac aaatcattca 1080tatgaagaag tagaagaaat aacaaatatt
cctaaaagta cactaaaaaa attaaaaaaa 1140tattattttt aa
1152148383PRTBacillus thuringiensis 148Met Leu Asp Thr Asn Lys Val
Tyr Glu Ile Ser Asn His Ala Asn Gly1 5 10 15Leu Tyr Ala Ala Thr Tyr
Leu Ser Leu Asp Asp Ser Gly Val Ser Leu 20 25 30Met Asn Lys Asn Asp
Asp Asp Ile Asp Asp Tyr Asn Leu Lys Trp Phe 35 40 45Leu Phe Pro Ile
Asp Asp Asp Gln Tyr Ile Ile Thr Ser Tyr Ala Ala 50 55 60Asn Asn Cys
Lys Val Trp Asn Val Asn Asn Asp Lys Ile Asn Val Ser65 70 75 80Thr
Tyr Ser Ser Thr Asn Ser Ile Gln Lys Trp Gln Ile Lys Ala Asn 85 90
95Gly Ser Ser Tyr Val Ile Gln Ser Asp Asn Gly Lys Val Leu Thr Ala
100 105 110Gly Thr Gly Gln Ala Leu Gly Leu Ile Arg Leu Thr Asp Glu
Ser Ser 115 120 125Asn Asn Pro Asn Gln Gln Trp Asn Leu Thr Ser Val
Gln Thr Ile Gln 130 135 140Leu Pro Gln Lys Pro Ile Ile Asp Thr Lys
Leu Lys Asp Tyr Pro Lys145 150 155 160Tyr Ser Pro Thr Gly Asn Ile
Asp Asn Gly Thr Ser Pro Gln Leu Met 165 170 175Gly Trp Thr Leu Val
Pro Cys Ile Met Val Asn Asp Pro Asn Ile Asp 180 185 190Lys Asn Thr
Gln Ile Lys Thr Thr Pro Tyr Tyr Ile Leu Lys Lys Tyr 195 200 205Gln
Tyr Trp Gln Arg Ala Val Gly Ser Asn Val Ala Leu Arg Pro His 210 215
220Glu Lys Lys Ser Tyr Thr Tyr Glu Trp Gly Thr Glu Ile Asp Gln
Lys225 230 235 240Thr Thr Ile Ile Asn Thr Leu Gly Phe Gln Ile Asn
Ile Asp Ser Gly 245 250 255Met Lys Phe Asp Ile Pro Glu Val Gly Gly
Gly Thr Asp Glu Ile Lys 260 265 270Thr Gln Leu Asn Glu Glu Leu Lys
Ile Glu Tyr Ser Arg Glu Thr Lys 275 280 285Ile Met Glu Lys Tyr Gln
Glu Gln Ser Glu Ile Asp Asn Pro Thr Asp 290 295 300Gln Pro Met Asn
Ser Ile Gly Phe Leu Thr Ile Thr Ser Leu Glu Leu305 310 315 320Tyr
Arg Tyr Asn Gly Ser Glu Ile Arg Ile Met Gln Ile Gln Thr Ser 325 330
335Asp Asn Asp Thr Tyr Asn Val Thr Ser Tyr Pro Asp His Gln Gln Ala
340 345 350Leu Leu Leu Leu Thr Asn His Ser Tyr Glu Glu Val Glu Glu
Ile Thr 355 360 365Asn Ile Pro Lys Ser Thr Leu Lys Lys Leu Lys Lys
Tyr Tyr Phe 370 375 380149354DNABacillus thuringiensis
149atgtcagctc gcgaagttca tattgaaata ataaatcata caggtcatac
cttacaaatg 60gataaaagaa ctagacttgc acatggtgaa tggattatta cacccgtgaa
tgttccaaat 120aattcttctg atttatttca agcaggttct gatggagttt
tgacaggagt agaaggaata 180ataatttata ctataaatgg agaaatagaa
attaccttac attttgacaa tccttatgca 240ggttctaata aatattctgg
acgttctagt gatgatgatt ataaagttat aactgaagca 300agagcagaac
atagagctaa taatcatgat catgtgacat atacaattca aaca
354150113PRTBacillus thuringiensis 150Met Ser Ala Arg Glu Val His
Ile Glu Ile Ile Asn His Thr Gly His1 5 10 15Thr Leu Gln Met Asp Lys
Arg Thr Arg Leu Ala His Gly Glu Trp Ile 20 25 30Ile Thr Pro Val Asn
Val Pro Asn Asn Ser Ser Asp Leu Phe Gln Ala 35 40 45Gly Ser Asp Gly
Val Leu Thr Gly Val Glu Gly Ile Ile Ile Tyr Thr 50 55 60Ile Asn Gly
Glu Ile Glu Ile Thr Leu His Phe Asp Asn Pro Tyr Ala65 70 75 80Gly
Ser Asn Lys Tyr Ser Gly Arg Ser Ser Asp Asp Asp Tyr Lys Val 85 90
95Ile Thr Glu Ala Arg Ala Glu His Arg Ala Asn Asn His Asp His Val
100 105 110Thr 151353DNABacillus thuringiensis 151atgtcagctc
gtgaagttca tattgaaata ataaatcata caggtcatac cttacaaatg 60gataaaagaa
ctagacttgc acatggtgaa tggattatta cacccgtgaa tgttccaaat
120aattcttctg atttatttca agcaggttct gatggagttt tgacaggagt
agaaggaata 180ataatttata ctataaatgg agaaatagaa attaccttac
attttgacaa tccttatgca 240ggttctaata aatattctgg acgttctagt
gatgatgatt ataaagttat aactgaagca 300agagcagaac atagagctaa
taatcatgat catgtaacat atacaattca aac 353152113PRTBacillus
thuringiensis 152Met Ser Ala Arg Glu Val His Ile Glu Ile Ile Asn
His Thr Gly His1 5 10 15Thr Leu Gln Met Asp Lys Arg Thr Arg Leu Ala
His Gly Glu Trp Ile 20 25 30Ile Thr Pro Val Asn Val Pro Asn Asn Ser
Ser Asp Leu Phe Gln Ala 35 40 45Gly Ser Asp Gly Val Leu Thr Gly Val
Glu Gly Ile Ile Ile Tyr Thr 50 55 60Ile Asn Gly Glu Ile Glu Ile Thr
Leu His Phe Asp Asn Pro Tyr Ala65 70 75 80Gly Ser Asn Lys Tyr Ser
Gly Arg Ser Ser Asp Asp Asp Tyr Lys Val 85 90 95Ile Thr Glu Ala Arg
Ala Glu His Arg Ala Asn Asn His Asp His Val 100 105
110Thr153353DNABacillus thuringiensis 153atgtcagcac gcgaagtaga
tattgaaata ataaatcata caggtcatac cttacaaatg 60gataaaagaa ctagacttgc
acatggtgaa tggattatta cacccgtgaa tgttccaaat 120aattcttctg
atttatttca agcaggttct gatggagttt tgacaggagt agaaggaata
180ataatttata ctataaatgg agaaatagaa attaccttac attttgacaa
tccttatgca 240ggttctaata aatattctgg acgttctagt gatgatgatt
ataaagttat aactgaagca 300agagcagaac atagagctaa taatcatgat
catgtgactt atacaattca aac 353154113PRTBacillus thuringiensis 154Met
Ser Ala Arg Glu Val Asp Ile Glu Ile Ile Asn His Thr Gly His1 5 10
15Thr Leu Gln Met Asp Lys Arg Thr Arg Leu Ala His Gly Glu Trp Ile
20 25 30Ile Thr Pro Val Asn Val Pro Asn Asn Ser Ser Asp Leu Phe Gln
Ala 35 40 45Gly Ser Asp Gly Val Leu Thr Gly Val Glu Gly Ile Ile Ile
Tyr Thr 50 55 60Ile Asn Gly Glu Ile Glu Ile Thr Leu His Phe Asp Asn
Pro Tyr Ala65 70 75 80Gly Ser Asn Lys Tyr Ser Gly Arg Ser Ser Asp
Asp Asp Tyr Lys Val 85 90 95Ile Thr Glu Ala Arg Ala Glu His Arg Ala
Asn Asn His Asp His Val 100 105 110Thr15537DNAArtificial
SequenceOligonucleotide primer (F1new) 155aaatattatt ttatgtcagc
acgtgaagta cacattg 3715640DNAArtificial SequenceOligonucleotide
primer (R1new) 156tctctggtac cttattatga tttatgccca tatcgtgagg
4015745DNAArtificial SequenceOligonucleotide primer (F2new)
157agagaactag taaaaaggag ataaccatgt tagatactaa taaag
4515846DNAArtificial SequenceOligonucleotide primer (R2new)
158cgtgctgaca taaaataata tttttttaat ttttttagtg tacttt
46159506PRTArtificial SequenceApproximately 58 kDa fusion protein
159Met Leu Asp Thr Asn Lys Val Tyr Glu Ile Ser Asn His Ala Asn Gly1
5 10 15Leu Tyr Ala Ala Thr Tyr Leu Ser Leu Asp Asp Ser Gly Val Ser
Leu 20 25 30Met Asn Lys Asn Asp Asp Asp Ile Asp Asp Tyr Asn Leu Lys
Trp Phe 35 40 45Leu Phe Pro Ile Asp Asp Asp Gln Tyr Ile Ile Thr Ser
Tyr Ala Ala 50 55 60Asn Asn Cys Lys Val Trp Asn Val Asn Asn Asp Lys
Ile Asn Val Ser65 70 75 80Thr Tyr Ser Ser Thr Asn Ser Ile Gln Lys
Trp Gln Ile Lys Ala Asn 85 90 95Gly Ser Ser Tyr Val Ile Gln Ser Asp
Asn Gly Lys Val Leu Thr Ala 100 105 110Gly Thr Gly Gln Ala Leu Gly
Leu Ile Arg Leu Thr Asp Glu Ser Ser 115 120 125Asn Asn Pro Asn Gln
Gln Trp Asn Leu Thr Ser Val Gln Thr Ile Gln 130 135 140Leu Pro Gln
Lys Pro Ile Ile Asp Thr Lys Leu Lys Asp Tyr Pro Lys145 150 155
160Tyr Ser Pro Thr Gly Asn Ile Asp Asn Gly Thr Ser Pro Gln Leu Met
165 170 175Gly Trp Thr Leu Val Pro Cys Ile Met Val Asn Asp Pro Asn
Ile Asp 180 185 190Lys Asn Thr Gln Ile Lys Thr Thr Pro Tyr Tyr Ile
Leu Lys Lys Tyr 195 200 205Gln Tyr Trp Gln Arg Ala Val Gly Ser Asn
Val Ala Leu Arg Pro His 210 215 220Glu Lys Lys Ser Tyr Thr Tyr Glu
Trp Gly Thr Glu Ile Asp Gln Lys225 230 235 240Thr Thr Ile Ile Asn
Thr Leu Gly Phe Gln Ile Asn Ile Asp Ser Gly 245 250 255Met Lys Phe
Asp Ile Pro Glu Val Gly Gly Gly Thr Asp Glu Ile Lys 260 265 270Thr
Gln Leu Asn Glu Glu Leu Lys Ile Glu Tyr Ser His Glu Thr Lys 275 280
285Ile Met Glu Lys Tyr Gln Glu Gln Ser Glu Ile Asp Asn Pro Thr Asp
290 295 300Gln Ser Met Asn Ser Ile Gly Phe Leu Thr Ile Thr Ser Leu
Glu Leu305 310 315 320Tyr Arg Tyr Asn Gly Ser Glu Ile Arg Ile Met
Gln Ile Gln Thr Ser 325 330 335Asp Asn Asp Thr Tyr Asn Val Thr Ser
Tyr Pro Asn His Gln Gln Ala 340 345 350Leu Leu Leu Leu Thr Asn His
Ser Tyr Glu Glu Val Glu Glu Ile Thr 355 360 365Asn Ile Pro Lys Ser
Thr Leu Lys Lys Leu Lys Lys Tyr Tyr Phe Met 370 375 380Ser Ala Arg
Glu Val His Ile Asp Val Asn Asn Lys Thr Gly His Thr385 390 395
400Leu Gln Leu Glu Asp Lys Thr Lys Leu Asp Gly Gly Arg Trp Arg Thr
405 410 415Ser Pro Thr Asn Val Ala Asn Asp Gln Ile Lys Thr Phe Val
Ala Glu 420 425 430Ser Asn Gly Phe Met Thr Gly Thr Glu Gly Thr Ile
Tyr Tyr Ser Ile 435 440 445Asn Gly Glu Ala Glu Ile Ser Leu Tyr Phe
Asp Asn Pro Phe Ala Gly 450 455 460Ser Asn Lys Tyr Asp Gly His Ser
Asn Lys Ser Gln Tyr Glu Ile Ile465 470 475 480Thr Gln Gly Gly Ser
Gly Asn Gln Ser His Val Thr Tyr Thr Ile Gln 485 490 495Thr Thr Ser
Ser Arg Tyr Gly His Lys Ser 500 5051601521DNAArtificial
SequenceFusion gene encoding the protein of SEQ ID NO159
160atgttagata ctaataaagt ttatgaaata agcaatcatg ctaatggact
atatgcagca 60acttatttaa gtttagatga ttcaggtgtt agtttaatga ataaaaatga
tgatgatatt 120gatgattata acttaaaatg gtttttattt cctattgatg
atgatcaata tattattaca 180agctatgcag caaataattg taaagtttgg
aatgttaata atgataaaat aaatgtttcg 240acttattctt caacaaattc
aatacaaaaa tggcaaataa aagctaatgg ttcttcatat 300gtaatacaaa
gtgataatgg aaaagtctta acagcaggaa ccggtcaagc tcttggattg
360atacgtttaa ctgatgaatc ctcaaataat cccaatcaac aatggaattt
aacttctgta 420caaacaattc aacttccaca aaaacctata atagatacaa
aattaaaaga ttatcccaaa 480tattcaccaa ctggaaatat agataatgga
acatctcctc aattaatggg atggacatta 540gtaccttgta ttatggtaaa
tgatccaaat atagataaaa atactcaaat taaaactact 600ccatattata
ttttaaaaaa atatcaatat tggcaacgag cagtaggaag taatgtagct
660ttacgtccac atgaaaaaaa atcatatact tatgaatggg gcacagaaat
agatcaaaaa 720acaacaatta taaatacatt aggatttcaa atcaatatag
attcaggaat gaaatttgat 780ataccagaag taggtggagg tacagatgaa
ataaaaacac aactaaatga agaattaaaa 840atagaatata gtcatgaaac
taaaataatg gaaaaatatc aagaacaatc tgaaatagat 900aatccaactg
atcaatcaat gaattctata ggatttctta ctattacttc cttagaatta
960tatagatata atggctcaga aattcgtata atgcaaattc aaacctcaga
taatgatact 1020tataatgtta cttcttatcc aaatcatcaa caagctttat
tacttcttac aaatcattca 1080tatgaagaag tagaagaaat aacaaatatt
cctaaaagta cactaaaaaa attaaaaaaa 1140tattatttta tgtcagcacg
tgaagtacac attgatgtaa ataataagac aggtcataca 1200ttacaattag
aagataaaac aaaacttgat ggtggtagat ggcgaacatc acctacaaat
1260gttgctaatg atcaaattaa aacatttgta gcagaatcaa atggttttat
gacaggtaca 1320gaaggtacta tatattatag tataaatgga gaagcagaaa
ttagtttata ttttgacaat 1380ccttttgcag gttctaataa atatgatgga
cattccaata aatctcaata tgaaattatt 1440acccaaggag gatcaggaaa
tcaatctcat gttacgtata ctattcaaac cacatcctca 1500cgatatgggc
ataaatcata a 152116123DNAArtificial SequencePrimer 45kD5'
161gatratratc aatatattat tac 2316220DNAArtificial SequencePrimer
45kD3'rc 162caaggtarta atgtccatcc 2016324DNAArtificial
SequencePrimer 45kD5'01 163gatgatgrtm rakwwattat trca
2416424DNAArtificial Sequenceprimer 45kD5'02 164gatgatgrtm
ratatattat trca 2416523DNAArtificial SequencePrimer 45kD3'03
165ggawgkrcdy twdtmccwtg tat 2316623DNAArtificial Sequenceprimer
45kD3'04 166ggawgkacry tadtaccttg tat 23
* * * * *
References