Method For Protecting Plants From Stress And Senescence

Fluhr; Robert ;   et al.

Patent Application Summary

U.S. patent application number 12/863986 was filed with the patent office on 2010-12-30 for method for protecting plants from stress and senescence. Invention is credited to Robert Fluhr, Moshe Sagi.

Application Number20100333237 12/863986
Document ID /
Family ID40548603
Filed Date2010-12-30

View All Diagrams
United States Patent Application 20100333237
Kind Code A1
Fluhr; Robert ;   et al. December 30, 2010

METHOD FOR PROTECTING PLANTS FROM STRESS AND SENESCENCE

Abstract

The present invention relates to regulation of ureide levels for optimal plant survival during nutrient remobilization such as occurs during normal growth, dark stress and senescence. Plants can be genetically engineered or selected using a suitable gene marker to have enhanced ureide accumulation. The present invention further provides methods of protecting plants, or extending the shelf life of fresh plant produce by application of exogenous ureides.


Inventors: Fluhr; Robert; (Rehovot, IL) ; Sagi; Moshe; (Lehavim, IL)
Correspondence Address:
    FENNEMORE CRAIG
    3003 NORTH CENTRAL AVENUE, SUITE 2600
    PHOENIX
    AZ
    85012
    US
Family ID: 40548603
Appl. No.: 12/863986
Filed: February 1, 2009
PCT Filed: February 1, 2009
PCT NO: PCT/IL2009/000120
371 Date: September 8, 2010

Related U.S. Patent Documents

Application Number Filing Date Patent Number
61024930 Jan 31, 2008

Current U.S. Class: 800/298 ; 514/263.33; 514/390; 514/563
Current CPC Class: A01N 43/50 20130101; A01N 47/28 20130101; A01N 3/00 20130101; C12N 15/8269 20130101; A01N 43/90 20130101; C12N 15/8271 20130101; C12N 15/8243 20130101
Class at Publication: 800/298 ; 514/263.33; 514/390; 514/563
International Class: A01H 5/00 20060101 A01H005/00; A01N 43/90 20060101 A01N043/90; A01N 43/50 20060101 A01N043/50; A01N 37/30 20060101 A01N037/30; A01P 15/00 20060101 A01P015/00

Claims



1. A method for protecting plants or plant parts from a stress related process comprising applying to the plant or plant part a composition comprising an amount of at least one ureide effective to decrease or delay the stress related process.

2. The method according to claim 1 wherein the composition comprises 0.001-10 mM ureide.

3. The method according to claim 2 wherein the composition comprises 0.01-10 mM ureide.

4. The method according to claim 2 wherein the composition comprises 0.1-0.5 mM ureide.

5. The method according to claim 1 wherein the stress related process is selected from the group consisting of: chlorophyll degradation, oxidative stress, senescence, premature senescence or any combination thereof.

6. The method of claim 1 wherein the plant parts are selected from fruit, vegetables cut branches and flowers.

7. The method of claim 1 wherein the plants are leafy produce.

8. The method of claim 1 wherein the plants or plant parts are detached from the ground.

9. The method of claim 1 wherein the at least one ureide is selected from uric acid, allantoin or an allantoate.

10. The method of claim 1 wherein the mode of application is selected from the group consisting of spraying; at least partially immersing the plant or plant part in the composition; and adding the composition to the plant root or plant part medium.

11. (canceled)

12. (canceled)

13. A plant having enhanced ureide production wherein the plant comprises a genetic variant of at least one enzyme in the pathway of ureide production from xanthine and wherein the genetic variant is selected using a probe specific for the at least one enzyme expression or encoding gene.

14. A plant having enhanced ureide production wherein the plant comprises a genetic variant of at least one enzyme in the pathway of ureide utilization and wherein the genetic variant is selected using a probe specific for the at least one enzyme expression or encoding gene.

15. A plant having enhanced ureide accumulation wherein the plant comprises a genetic variant of at least one enzyme in the pathway of ureide production from xanthine and wherein the genetic variant is selected using a probe specific for the at least one enzyme expression or encoding gene.

16. A plant having enhanced ureide accumulation wherein the plant comprises a genetic variant of at least one enzyme in the pathway of ureide utilization.

17. (canceled)

18. (canceled)

19. (canceled)

20. A transgenic plant comprising at least one cell transformed with at least one polynucleotide encoding an enzyme in the pathway of ureide production from xanthine.

21. The plant of claim 20, wherein said plant produces elevated concentration of ureide compared to a corresponding non-transgenic plant.

22. A transgenic plant comprising at least one cell transformed with at least one polynucleotide encoding an enzyme in the pathway of ureide utilization.

23. The plant of claim 22, wherein said plant accumulates elevated concentration of ureide compared to a corresponding non-transgenic plant.

24. The plant of claim 16 wherein the ureide is selected from allantoin or an allantoate.

25. The plant of claim 18 wherein the ureide is selected from allantoin or an allantoate.
Description



FIELD OF THE INVENTION

[0001] The present invention relates to the field of plant survival and adaptation to environmental stress as well as to the preservation of fresh plant produce. Particularly, the present invention relates to the role of ureides in protecting plants and/or plant produce from senescence or stress related damages.

BACKGROUND OF THE INVENTION

[0002] The remobilization of plant resources during stress facilitates environmental adaptation. The definitive example of such metabolite reallocation in a leaf is delineated by leaf senescence. In addition to natural aging, many environmental factors such as temperature, drought, nutrient supply, pathogen attack and light conditions can hasten senescence. For example, dark-induced stress is characterized by leaf yellowing, due to the breakdown of chlorophyll and general chloroplast degradation. Metabolic changes during senescence are associated with the transition from nutrient assimilation to metabolite turnover that is accelerated by catabolic activities. For example, in legumes, the catabolic products of purine, the ureides, can provide the plant with readily transportable metabolites that excel in a high nitrogen to carbon ratio. It has been suggested that the carbon nitrogen ratio generated in energy-conserving purine catabolism may be critical for the plants survival under stress conditions.

[0003] Little is known about the control of purine catabolism in leaves. Purine catabolism starts with the conversion of adenosine monophosphate (AMP) to inosine monophosphate (IMP) by AMP deaminase (AMPD, E.C.3.5.4.6) that leads by multiple pathways to the production of oxypurines such as xanthine and hypoxanthine. However, further degradation of xanthine to urate requires the activity of the pivotal enzyme, xanthine dehydrogenase (XDH, EC 1.1.1.204). Urate is further metabolized to the ureide, allantoin, through urate oxidase (UO) and transthyretin-like protein (TLP). In Arabidopsis, allantoinase (ALN, E.C. 3.5.2.5.) converts allantoin to allantoate, followed by allantoate amidinohydrolase (AAH, E.C. 3.5.3.9.), that converts allantoate to ureidoglycolate and ammonia. A putative ureidoglycolate lyase converts ureidoglycolate to the basic metabolic building blocks, glyoxylate and urea.

[0004] XDH contains molybdenum cofactor (MoCo), FAD and NADPH binding domains. The second oxygen in the mono-oxo-MoCo is replaced by a sulfur ligand. When using xanthine/hypoxanthine or NADH as substrates the sulfo-MoCo form of XDH can generate superoxide radicals. In contrast, the desulfo-MoCo form of XDH shows only FAD dependent activity and generats superoxide radical only in the presence of NADH.

[0005] Among the two XDH encoding genes detected in the Arabidopsis genome (AtXDH1 and AtXDH2), only AtXDH1 responds to environmental stimuli. A specific function of XDH in aging is not clear, although in both mammalian heart and in plants the activity of XDH is enhanced with age.

[0006] Nowhere in the background art is it taught or suggested that ureide metabolism can be regulated to increase plant resistance to stress. Exogenous application of ureides or enhanced endogenous accumulation of ureides for plant protection and, for example, extension of shelf life of produce has not been previously known or suggested in the art.

SUMMARY OF THE INVENTION

[0007] The present invention provides compositions and methods for protecting plants or plant produce from stress and senescence. The present invention further provides compositions and methods for extending the shelf life of plant fresh produce including vegetables, fruit, cut branches and flowers. In particular, the present invention provides compositions and methods for protecting harvested agricultural produce from premature senescence and senescence.

[0008] It is now disclosed that elevated levels of ureides protect plants from the deleterious effects of senescence and stress. Without wishing to be bound by any theory or mechanism of action, the protection is likely to result from alleviating oxidative stress by scavenging reactive oxygen species. The present invention also identifies the enzymes and enzyme variants that regulate the production of ureides in plants.

[0009] The present invention is based in part on the use of experimental models of plant senescence and stress such as extended dark treatment in order to induce metabolite remobilization processes. It is now disclosed for the first time that both dark-induced stress and increased age induced accumulation of the ureides, including allantoin and allantoate, in wild-type leaves. In contrast, under these conditions, in xanthine dehydrogenase-1 (XDH1) compromised plants, xanthine but no ureides accumulated, and accelerated senescence and mortality rates were observed. Thus, a protective role for xanthine dehydrogenase and ureides in senescence was demonstrated.

[0010] Unexpectedly, this protection can also be achieved by the exogenous application of ureides to plants or to parts thereof. In particular, the present invention provides compositions and methods comprising exogenous ureides for post-harvest protection of plant fresh produce from senescence and premature senescence.

[0011] According to the principles of the invention it is possible to utilize any method that increases cellular ureides at critical times and levels to produce more hardy plants. Plants suffer damage from oxidative stress during drought, cold and other environmental abuse. Without wishing to be bound by any theory or mechanism of action it is envisaged that enhancing the scavenger pathways, specifically through the presence of higher levels of uriedes, yields plants that are protected from damage such as damage caused by environmental stress.

[0012] According to a first aspect, the present invention provides a method for protecting plants or plant parts from a stress related process, comprising applying to the plant or plant part a composition comprising an amount of at least one ureide effective in decreasing or delaying the stress related process. According to certain embodiments stress related processes include, among others, chlorophyll degradation, oxidative stress, senescence, premature senescence or any combination thereof.

[0013] According to certain embodiments the composition comprises 0.001-10 mM ureide, typically 0.01-10 mM ureide, more typically 0.1 mM-0.5 mM ureide. The composition may comprise 0.1 mM ureide or 0.5 mM ureide or any amount in the above specified ranges.

[0014] According to some embodiments the plant parts are selected from fruit, vegetables, cut branches and flowers. Other harvested plant parts may be also be treated. Plants may include, among others, legumes, herbs and root vegetables or leafy produce (for example, parsley). As used herein, the term "harvest" refers to the gathering of agricultural plant products, including picking (e.g. fruit), detaching from the ground (e.g. leafy crops such as lettuce, spinach and parsley), cutting (e.g. branches, including ornamental branches) and the like.

[0015] According to certain embodiments the ureide is selected from allantoin or allantoate.

[0016] According to some embodiments applying the composition to plants includes spraying the plants or plant parts with the composition. According to other embodiments applying includes adding the composition to the plant's root or plant's branch medium. According to further embodiments, the composition is applied by at least partially immersing the plant or plant part in the composition. A combination of applying methods may also be used according to embodiments of the invention.

[0017] Elevated ureide amounts within a plant cell may be achieved by selecting a variant plant or genetically engineering the plant to produce or accumulate higher ureide concentration as compared to a wild type plant. The selected or engineered plants can overexpress enzymes involved in the production pathway of ureides, or have decreased expression levels of ureide utilization enzymes such that ureide is accumulated. The selection for the plant may include using a probe specific for at least one enzyme related to the production or accumulation of ureides and/or selecting a mutant having enhanced purine turnover.

[0018] Thus, according to another aspect the present invention provides a plant having enhanced ureide production wherein the plant comprises a genetic variant of at least one enzyme in the pathway of ureide production from a xanthine.

[0019] According to another aspect, the present invention provides a plant having enhanced ureide accumulation wherein the plant comprises a genetic variant of at least one enzyme in the pathway of ureide utilization.

[0020] According to a further aspect the present invention provides a transgenic plant comprising at least one cell transformed with at least one polynucleotide encoding an enzyme in the pathway of ureide production from a xanthine. According to certain embodiments, the transgenic plant produces elevated concentration of ureide compared to a corresponding non-transgenic plant.

[0021] According to yet additional aspect the present invention provides a transgenic plant comprising at least one cell transformed with at least one polynucleotide encoding an enzyme in the pathway of ureide utilization. According to certain embodiments, the transgenic plant accumulates elevated concentration of ureide compared to a corresponding non-transgenic plant.

[0022] These and other embodiments of the present invention will become apparent in conjunction with the figures, description and claims that follow.

BRIEF DESCRIPTION OF THE FIGURES

[0023] FIG. 1 demonstrates XDH expression in Arabidopsis wild type and Atxdh1 modified plants. FIG. 1a shows Atxdh1 and Atxdh2 relative expression monitored by quantitative real-time RT-PCR analysis using wild-type (Col, left panel) and XDH compromised plants (KO, SALK.sub.--148364 Atxdh1 T-DNA insertion line; and Ri, three xdh RNA interference lines, right panel). FIG. 1b shows XDH-dependent NADH oxidase and FIG. 1c shows XDH-dependent hypoxanthine/xanthine dehydrogenase activities in wild type (Col, left panel) and KO (XDH compromised plants, right panel) leaf extracts. The O.sub.2.sup.- generated in-gel was measured using NBT as electron acceptor and presented relative to day 0 or, during the recovery period, relative to day 6 in the dark. Each lane contained 200 .mu.g of soluble proteins. FIG. 1d demonstrates O.sub.2.sup.- generating activity of XDH in leaf extracts of wild-type and XDH compromised plants. Plants were treated and sampled as described above. Kinetics was assayed using epinephrine as electron acceptor and hypoxanthine/xanthine as substrate following by adenochrome absorbance. Values are means.+-.SE (n=6).

[0024] FIG. 2 demonstrates the responses of wild-type and XDH compromised Arabidopsis plants to dark stress. FIG. 2a shows wild-type (Col) and XDH compromised plants (KO, SALK.sub.--148364; Ri, xdh1 RNA interference) during 6 day dark treatment and subsequent 9 days recovery. FIG. 2b shows survival rates of wild-type and XDH compromised plants 15 days after exposure to the conditions described in FIG. 2a. Error bars indicate SE (n=12). FIG. 2c shows leaves of control untreated and dark-treated plants and XDH compromised plants excised before (0) and 6 days after (6) exposure to dark. FIG. 2d demonstrates the damage level of leaves shown in FIG. 2c calculated as described in the experimental procedures. Bars show means.+-.SEM (n=6). FIG. 2e shows chlorophyll content in leaves sampled over a 6 day dark treatment. Error bars indicate SE (n=6). FIG. 2f shows total soluble protein content in leaves sampled over a 6 day dark treatment. Error bars indicate SE (n=6). FIG. 2g demonstrates the progress in cell death over a 4 day dark treatment as indicated by staining with trypan-blue. At least 8 leaves were examined for each condition, and representative fields having the same magnification are shown.

[0025] FIG. 3 demonstrates relative transcript expression of selected senescence and chlorophyll degradation-related genes. Transcripts were monitored by quantitative real-time RT-PCR analysis using wild-type (Col) and XDH compromised plants (KO, SALK.sub.--148364, Atxdh1 T-DNA insertion line and Ri, mean of 3 independent xdh1 RNA interference lines). Plants were sampled before being placed in the dark (0) and over a dark period of six days. The transcript expressions of each treated line was compared to the untreated line after normalization to the Arabidopsis EF-1.alpha. gene product (At5g60390) and presented as relative expression. Values are means.+-.SEM (n=6).

[0026] FIG. 4 shows Nitroblue tetrazolium (NBT)-O.sub.2.sup.- generation in wild type (Col) and xdh1 RNA interference (Ri) plants in response to dark treatment. FIG. 4a demonstrates superoxide level as visualized by NBT staining of rosette leaves in the absence or presence of allopurinol (+Allo) or diphenylene iodonium (+DPI). FIG. 4b shows quantitative analysis of NBT-O.sub.2.sup.- production in leaves in response to dark treatment. NBT-O.sub.2.sup.- generation was quantified in stained leaves by scanning. Upper insert: total relative NBT-O.sub.2.sup.+ generation; middle insert: relative NBT-O.sub.2.sup.+ generation by XDH obtained by subtraction of +Allo from -Allo leaf scan values; lower insert: relative NBT-O.sub.2.sup.+ generation by non-XDH source, obtained by subtraction of +DPI from +Allo leaf scan values. Data are means.+-.SE (n=8).

[0027] FIG. 5 shows analysis of the purine metabolites, xanthine, allantoin and allantoate, in response to dark stress. Xanthine (FIG. 5a), Allantoin (FIG. 5b) and Allantoate (FIG. 5c) were determined in rosette leaves of wild-type (Col) and XDH1 compromised plants (KO, SALK.sub.--148364; Ri, xdh1 RNA interference) after being kept in dark for 6 days and transferred to 16 h light/8 h dark regime for recovery during additional 9 days. Values are means.+-.SEM (n=6).

[0028] FIG. 6 demonstrates transcript expression levels of Arabidopsis purine catabolism genes, AMP deaminase (AMPD), allantoinase (ALN) and allantoate amidinohydrolase (AAH) during dark stress and subsequent recovery period. Quantitative analysis of transcripts by real-time RT-PCR was performed using wild-type (Col) and XDH compromised plants (KO, SALK.sub.--148364 Atxdh1 T-DNA insertion line; Ri, means of three xdh RNA interference lines) kept in the dark for 6 days and transferred to a 16 h light/8 h dark regime for recovery during additional 9 days. The expressions of each dark treated line was compared to the untreated line after normalization to the Arabidopsis EF-1.alpha. gene product (At5g60390) and is presented as the relative expression on day 0 or, for the recovery period, compared to the value of the dark treated line after 6 days in dark. Values are means.+-.SEM (n=3).

[0029] FIG. 7 demonstrates the influence of aging on leaf phenotype, purine metabolite level and transcript expression in wild type and XDH1 compromised plants. FIG. 7a shows 75 days old wild type (Col) and xdh1 RNA interference (Ri) plants and their representative leaves (left and middle panels). The transcript expression of SAG12 measured by quantitative real-time RT-PCR and normalized to the EF-1.alpha. transcript (At5g60390) is shown at the right panel. Values are means.+-.SEM (n=6). Data for Ri lines are means of 3 independent lines. FIG. 7b shows concentration of the purine metabolites xanthine (left panel), allantoin (middle panel) and allantoate (right panel), measured in rosette leaves, in response to plant age. Values are means.+-.SEM (n=6). FIG. 7c demonstrates transcript expression of Arabidopsis purine catabolism genes using wild-type (Col) and three independent Ri plants. The transcript expressions are relative to the level at 30 days and normalized to the EF-1.alpha. transcript (At5g60390). Values are means.+-.SEM (n=3).

[0030] FIG. 8 demonstrates the responses of Arabidopsis wild-type (Col) and xdh RNA interference (Ri) plants to application of the purine catabolites: xanthine, allantoin and allantoate. FIG. 8a: xanthine (1 mM) in the presence or absence of allopurinol (1 mM, +/-Allo), was applied for 48 h to leaf discs placed in the dark and photographed 24 h after being transferred to 16 h light/8 h dark regime (left upper panel). Remaining chlorophyll, xanthine, allantoin and allantoate were determined in leaf discs sampled at the beginning of the experiment (light) or after 72 h (as described above) without xanthine (dark). FIG. 8b: allantoin or allantoate (0.1 mM) in the presence or absence of allopurinol (1 mm, +/-Allo) was applied to leaf discs for 2 h in the dark after keeping the discs in the dark for 48 h. Discs were photographed 24 h after being transferred to 16 h light/8 h dark regime (left upper panel). Leaf discs were washed twice before sampling for xanthine, allantoin and allantoate determination (right and bottom panels). Bars show mean.+-.SEM (n=16).

[0031] FIG. 9 shows reactive oxygen species (ROS) accumulation in the presence of allantoin and allantoate in Arabidopsis wild-type (Col) and xdh1 RNA interference (Ri) lines. FIG. 9a left panel:: leaf discs removed from Col plants placed for 24 h in the dark in the presence or absence of allantoin or allantoate (0.1 mM) and then washed and treated with H.sub.2O.sub.2 (0, 20, 50 mM) for an additional 6 h in the dark. Right panel: remaining chlorophyll determined 24 h after the disc were transferred to a 16 h light/8 h dark regime. Bars show mean.+-.SEM (n=16). FIG. 9b shows H.sub.2O.sub.2 production in leaf discs of Col and Ri plants treated with allantoin or allantoate (0.1 mM) visualized by staining with 3,3'-diaminobenzidine (DAB) (left panel). Total H.sub.2O.sub.2 relative production (right insert) was quantified in leave discs kept in the dark for 24 h and then treated with allantoin or allantoate for additional 2 h in the dark, using DAB staining Results are from two independent experiments. Error bars indicate SE (n=16). The lower case letters (a, b) indicate P<0.001 for the differences within treatment between ecotypes. Capital letters (A, B) indicate P<0.001 for the differences within ecotypes between treatments. FIG. 9c demonstrates the influence of allantoin or allantoate (0.1 mM) on O.sub.2 production in leaf discs of Col and Ri plants. Leaf discs were treated and analyzed as in FIG. 9b above. Total relative superoxide production was quantified in leaf discs from 2 independent experiments. Error bars indicate SE (n=16).

[0032] FIG. 10 shows transcript expression of the Arabidopsis Cys protease senescence-associated gene 12 (SAG12), during 6 days of dark stress. Quantitative analysis of transcript by real-time RT-PCR was performed using wild-type (Col) and three independent RNA interference (Ri) lines. Plants were sampled before dark application (0) and over the six days dark period. The expressions of each treated line were compared to those of the untreated line after normalization to the Arabidopsis EF-1.alpha. gene product (At5g60390) and data are presented as relative expression. Values are means.+-.SEM (n=6). Data for Ri lines are means of 3 independent lines.

[0033] FIG. 11 shows transcript expression of the Arabidopsis molybdenum cofactor sulfurase gene, ABA3, in wild type (Col) plants after exposure to dark stress for six days. Transcript Analysis was performed as described in FIG. 10 above.

[0034] FIG. 12 shows transcript expression of Arabidopsis purine catabolism genes, encoding urate oxidase (UO) and transthyretin-like protein (TLP), is wild type (Col) plants exposed to dark stress of 6 days and subsequent recovery period of 16 h light/8 h dark regime for 9 days. Quantitative analysis of transcripts was performed by real-time RT-PCR compared to the untreated plant after normalization to the Arabidopsis EF-1.alpha. gene product (At5g60390). Data are presented as relative expression compared to day 0 or, for the recovery period, compared to the value of the dark treated plant after 6 days in the dark. Values are means.+-.SEM (n=3).

[0035] FIG. 13 shows diurnal fluctuation of allantoin in rosette leaves of wild-type (Col) Arabidopsis plants. Values are means.+-.SEM (n=6).

[0036] FIG. 14 relates to the influence of allantoin application on senescence in parsley leaf discs exposed to dark stress. Parsley leaf discs were kept for 2 days in the light and then transferred to the dark for additional 2 days with or without the addition of 0 to 10 mM allantoin. CL-control undetached leaves in the light.

[0037] FIG. 15 demonstrates the response of tomato to extended dark stress and recovery in light thereafter. FIG. 15a shows the allantoin level in the 1st, 3rd and 5th leaf of wild type tomato plants over a period of 12 days in the dark and 10 days of recovery in the light. FIG. 15b shows that application of 0.1 mM and 0.5 mM allantoin delays chlorophyll degradation in tomato leave discs (treated as in FIG. 14).

DETAILED DESCRIPTION OF THE INVENTION

[0038] The present invention provides compositions and methods for protecting plants and parts thereof from senescence and stress related processes. The present invention further provides compositions and methods for extending the shelf life of plant fresh produce including, but not limited to, herbs, vegetables, cut branches, fruit and flowers. Without wishing to be bound by any theory or mechanism of action, shelf life extension of the fresh produce according to the teachings of the present invention may be attributed to protection of the harvested material from processes such as senescence, premature senescence and stress related processes.

[0039] According to certain embodiments, the present invention relates to regulation of ureide levels for optimal plant survival during nutrient remobilization such as occurs during normal growth, dark stress, senescence and other plant processes.

[0040] According to some embodiments, plants can be genetically engineered or selected using a suitable gene marker to achieve enhanced ureide production and/or accumulation.

[0041] According to some embodiments the present invention identifies enzymes and enzyme variants that regulate the production of ureides in plants.

[0042] The present invention is based in part on the use of experimental models of plant senescence and stress such as extended dark treatment in order to induce metabolite remobilization processes. It is now disclosed for the first time that both dark-induced stress and increased age induce accumulation of ureides, including allantoin and allantoate, in wild-type leaves. In contrast under these conditions, in XDH1-compromised plants, xanthine but no ureides accumulate, and accelerated senescence and mortality rates are observed. Thus, a protective role for AtXDH1 and ureides in senescence is demonstrated.

[0043] Unexpectedly, this protection can also be achieved by the exogenous application of ureides. In particular, the present invention provides compositions and methods comprising exogenous ureides for protection of picked or harvested agricultural produce from processes, such as senescence and premature senescence.

[0044] According to a first aspect, the present invention provides a method for protecting plants, plant parts or harvested plant produce from aging (for example, senescence or premature senescence). According to one embodiment, the method comprises applying to the plant(s) or plant part(s) a composition comprising an amount of at least one ureide effective to decrease or delay the senescence of the plant or plant parts. According to some embodiments the ureide is selected form allantoin or an allantoate.

[0045] According to one embodiment plants or plant parts may be selected from harvested herbs, fruits, vegetables and flowers.

[0046] In particular, the present invention provides compositions and methods for protecting harvested agricultural produce from typically stress related processes such as senescence and premature senescence. Picked flowers and leafy crops such as lettuce, spinach, parsley and many others typically begin to undergo senescence immediately after they are picked. This process is typically accelerated during storage of the plant produce. Typically, this means that the green leafy tissue yellows and its nutritional and marketing value may decrease. Embodiments of the present invention thus disclose that the exogenous application of ureides slows this progress and extends plant produce shelf life.

[0047] Methods, according to some embodiments of the invention, may comprise applying, such as by applying to the root or cut branches medium or spraying, a composition which includes an appropriate amount of ureides onto the produce or immersing or partially immersing the produce in a suspension or other appropriate form of composition containing ureides or purine metabolites such as uric acid. Any suitable application method, such as, but not limited to, the methods listed here, may be used alone or in combination. According to some embodiments any solution comprising ureides in the range of 1 .mu.M-10 mM may be used. Typically a solution in a range of 0.01-10 mM, or 0.1-10 mM is used. Any concentration of ureides in the specified ranges may be used. According to one embodiment 0.1 mM ureide, 0.5 mM ureide or any concentration of ureides in this range may be used. Compositions having other concentrations may also be used with embodiments of the invention.

[0048] As exemplified hereinbelow application of exogenous ureides protects plants and plant parts from senescence and stress related processes.

[0049] According to another aspect of the invention ureide accumulation may be enhanced in genetically engineered plants. In the alternative, plants may be genetically engineered to achieve enhanced and optimal ureide production. Expression of enzymes specifically required in the pathway of ureide production may be optimized, according to one embodiment of the invention, in order to achieve ureide accumulation. According to further aspects the present invention provides a plant selected for enhanced ureide production. According to one aspect a genetically modified plant can be obtained by enhancing expression levels of enzymes involved in the production pathway of ureides thereby increasing ureide production. According to another aspect a genetically modified plant can be obtained by decreasing expression levels of ureide utilization enzymes by genetic engineering thereby increasing ureide accumulation.

[0050] According to another aspect the desired plant can be selected using a probe specific for at least one enzyme related to the production or accumulation of ureides. According to one embodiment the desired plant can be selected using a probe specific for XDH encoding gene or XDH enzyme expression.

[0051] According to one embodiment a genetically modified plant is selected for mutations for enhanced purine turnover. A specific controlling element may up and down regulate purine catabolic pathways synchronously, i.e. up regulate the enzymes that make ureides and simultaneously down-regulate the enzymes that can breakdown the ureides. Such selection can be done by various known mutational methods e.g., subjecting plants to mutagenesis as in enhancer trap methods, irradiation, chemical mutagenesis, insertional mutagenesis and other appropriate methods. According to one embodiment an enhancer is inserted randomly in the genome and the resultant lines are screened for changes in ureide levels. According to various embodiments generic lines may be used for screening of ureide production.

[0052] According to another aspect identification of transcripts relevant to the ureide metabolism (production or degradation) can be used to perform large scale screening for natural variations in ureide levels in plants in response to stress. According to a particular embodiment the natural variants in ureide levels are screened during or after extended dark periods.

[0053] It should be understood that composition and/or methods according to embodiments of the invention may be used alone or in combination to achieve results according to the invention. For example, several different concentrations and/or different ureides may be applied to plant, plant parts or crops, according to embodiments of the invention. Genetic engineering and/or screening methods may be used in combination with methods of applying ureides to plants. Any combination of the methods and/or compounds disclosed herein, which achieves protection of plants through the ureide metabolic pathway, is disclosed herein.

[0054] The remobilization of metabolites during stress and senescence plays an important role in optimal plant adaptation to the environment. The plant molybdenum-cofactor (MoCo) and flavin containing enzyme, xanthine dehydrogenase (XDH; EC 1.2.1.37) are pivotal for purine remobilization and catalyze the conversion of the purine catabolic products, hypoxanthine and xanthine to uric acid that is subsequently degraded to the ureides, allantoin and allantoate. The present invention now shows that in wild-type plants, conditions of extended darkness or increasing leaf age cause induction of transcripts related to purine catabolism, that in turn result in marked accumulation of the purine catabolic products, allantoin and allantoate. In contrast, Arabidopsis mutants of XDH, Atxdh1, accumulated xanthine and showed premature senescence symptoms as exemplified by enhanced chlorophyll degradation, extensive cell death and up-regulation of senescence-related transcripts. When dark-treated mutant lines were re-exposed to light, they showed elevated levels of reactive oxygen species (ROS) and higher mortality rate compared to wild-type plants. Unexpectedly, the level of ROS and mortality could be attenuated by the addition of allantoin and allantoate suggesting that these metabolites can act as scavengers of reactive oxygen species. The present invention highlights a yet unrecognized need for the controlled maintenance of ureide levels, for example, as mediated by AtXDH1 activity during dark stress and aging and point to the dual functionality of ureides as efficient stores of nitrogen and as cellular protectants. Thus, regulation of ureide levels by regulating Atxdh1 expression has general implications for optimal plant survival during nutrient remobilization such as occurs during normal growth, dark stress and senescence.

XDH1 Activity Moderates Pre-Mature Senescence Induced by Dark Stress

[0055] Extended dark treatment implies complete lack of new photosynthesis that imposes a stress which requires remobilization of leaf resources. In this sense, extended dark initiates molecular events that are reminiscent of leaf senescence. The progression of senescence must be orderly so that the accumulation of deleterious compounds or physiological states of enhanced labile cellular state is avoided. It is shown here that XDH1 activity is required for normal remobilization to succeed, as in its absence, not only will direct purine catabolism be compromised, but the rate of chlorophyll, soluble protein degradation (FIGS. 2e and 2f) and cell death are all accelerated.

[0056] The value of extended dark treatments as a signal that stimulates synchronized metabolic remobilization in the plant was discerned by examining transcript induction profiles of genes that are known to be induced during senescence. For example, the WRKY53 transcription factor (which was shown to control early events of senescence and oxidative stress response (Miao Y. et al., 2004 Plant Mol Biol 55, 853-867). The protease regulator, ERD1 encodes caseinolytic protease regulatory subunit, and may be related to posttranslational modification processes, as it was shown to be involved in the degradation of chloroplast proteins subjected to artificial senescence related to ABA, ethylene and SO.sub.2 (Brychkova G. et al., 2007 Plant J 50, 696-709; Weaver L. M. et al., 1998 Plant Mol Biol 37, 455-469). Similarly, chlorophyll degradation (Gepstein S. 2004 Genome Biology 5, 212; Pruzinska A. et al., 2005 Plant Physiol 139, 52-63) and up-regulation of related transcripts such as ACD1 and SGN1 (Park S. Y. et al., 2007 Plant Cell 19, 1649-1664; Tanaka R. et al., 2003 Plant Cell Physiol 44, 1266-1274), during the extended dark period are indicative of leaf senescence. The up-regulation of the chlorophyll-degradation related transcripts and chlorophyll degradation itself is a hallmark of compromised XDH1 activity (FIG. 2e and FIG. 3, lower panels). Thus, as indicated by these marker genes, the presence of XDH1 activity affords wild-type plants protection from the onset of program cell death-like process during the dark stress.

XDH Activity in Response to Dark Stress

[0057] XDH possesses a MoCo sulfurated-dependent hypoxanthine/xanthine-O2-generating activity and a FAD dependent NADH-OT-generated activity (Sagi M. et al., 1999 Plant Physiol 120, 571-578; Sagi M. et al., 2002 Plant J 31, 305-317; Yesbergenova Z. et al., 2005 Plant J 42, 862-876). The xanthine-dependent superoxide generating activity was more enhanced in extended dark than the NADH-dependent activity (FIGS. 1b-1d and FIG. 4b middle panel). This indicates that modification processes involving the MoCo-domain are likely taking place during the dark-derived remobilization. Difference between MoCo and FAD dependent activities of XDH may result from interconversion of the sulfo- and desulfo-MoCo forms of XDH. The terminal sulfuration step carried out by the MoCo-sulfurase enzymes FLACCA in tomato and ABA3 in Arabidopsis were hypothesized to provide an efficient way to regulate XDH activities by sulfuration (Sagi et al., 1999, ibid; Sagi et al., 2002 ibid). XDH commonly contains significant portions of desulfo-forms, which while inactive in hypoxanthine/xanthine oxidases (Harrison R. 2002 Free Radic Biol Med 33, 774-797), are active as NADH oxidases (Yesbergenova et al., 2005, ibid). Thus, the enhancement in hypoxanthine/xanthine oxidase activity observed in dark-induced stress may result from enhanced sulfuration status of the XDH MoCo domain. Consistent with this scenario, it is noted that the ABA3 transcript was significantly enhanced during dark stress (about 3-fold; FIG. 11).

Role of Purine Catabolism in Dark Stress and Recovery

[0058] Mutation in AtXDH1 or application of allopurinol to wild type plants led to xanthine accumulation during dark stress (FIGS. 5a and 8a, 8b). The degree of tissue damage that appears in plants during the dark and especially during the subsequent light treatment may be due to direct or indirect sensitivity to excess xanthine, leading to chlorophyll degradation, especially in the absence of active AtXDH1 in the treated leaves (FIG. 8a). However, the higher chlorophyll degradation that appeared in mutant leaves containing high level of xanthine was significantly alleviated by the addition of allantoin and allantoate implying that ureides protected leaves from dark induced chlorophyll degradation in spite of xanthine accumulation (FIG. 8b). Thus, ureides accumulation may contribute to the cell normal growth pattern through a critical physiological state brought upon by metabolite remobilization. Hence, ureides represent both favorable N--C ratio as well as molecules with an intrinsic ability to scavenge ROS excess. Such excess may be encountered during re-exposure of leaves to light in which photosystem imbalance may be the end result of enhanced protein turnover that results in transient light-dependent ROS production.

[0059] A coordinated rise in transcripts level involved in ureide production (AMPD, XDH1, UO and TLP) and a concomitant decrease in transcripts level of enzymes that utilize ureides (ALN and AAH) was detected. Thus, dark stress ureides accumulation is at least in part under transcriptional control and is likely to result from the difference in activities involved in ureides formation versus the activities that process them.

[0060] The data presented in the present invention have highlighted a complete and functional purine remobilization pathway that occurs in the extended absence of light but the implications are not restricted to conditions of environmental stress. Rapid XDH1 up-regulation (FIGS. 1a and 1c) and a mild increase in ureide levels in normal diurnal light dark transitions (22%; FIG. 13) are noted. The diurnal cycling of ureide levels indicates that extended dark treatment accentuates a normal response. In this respect, the physiological and molecular components of dark-induced stress are shown here to be reminiscent of normal leaf aging and senescence. Indeed in dark stress and senescence similar levels of ureides accumulation was shown (FIGS. 5 and 7).

[0061] Senescence and dark-induced senescence are associated with modulation of ROS production (Guo F. Q. and Crawford N.M. 2005 Plant Cell 17, 3436-3450; Pastori G. M. and Del Rio L. A. 1997 Plant Physiol 113, 411-418). Thus, without wishing to be bound by any particular theory opr mechanism of action, ureides may serve a dual function in senescence as transportable metabolites for further biosynthetic pathways and at the same time as cellular protectants from ROS. The results herein show that purine catabolism, aging and extended dark induce similar senescence programs. In both cases, the transition from nutrient assimilation to metabolite turnover occurs due to the acceleration of purine catabolic recycling activities in which AtXDH1 plays a pivotal role.

[0062] Examples of specific experiments carried out on specific plants are presented herein in order to more fully illustrate certain embodiments of the invention. They should in no way, however, be construed as limiting the broad scope of the invention. One skilled in the art can readily devise many variations and modifications of the principles disclosed herein without departing from the scope of the invention.

EXAMPLES

Experimental Procedures

Plant Materials, Growth Conditions and Dark Treatment

[0063] Arabidopsis thaliana (ecotype Columbia) and its isogenic Atxdh1 compromised plants were grown in a growth room under 16 h light/8 h dark, 22.degree. C., 75-85% relative humidity, light intensity of 100 .mu.mol m.sup.-2 s.sup.-1 as described before (Brychkova G. et al., 2007, ibid). Atxdh1 compromised plants included homozygous T-DNA inserted line [SALK.sub.--148364 (obtained from the Arabidopsis Biological Research Center, Colombus, Ohio, USA)] and 3 independent homozygous xdh RNA interference lines described before (Yesbergenova et al., 2005, ibid). For dark treatment, four-week-old plants grown in peat were transferred from the growth room to a dark room. Samples were collected every day during 15 min, under dim light (40 .mu.mol m-2 s-1), as a mix of fully expanded rosette leaves taken from 5 plants. After 6 days in the dark, plants were transferred to the growth room and survival rate of plants were determined 9 days later. Average and S.E. of survival rate was calculated from 12 independent experiments with at least 30 plants for each treatment. For aging measurements plants were grown in a growth room as described above and samples were collected from 30, 45, 60 and 75 day old plants as a mix of fully expanded rosette leaves taken from 5 plants.

Cell Death Measurements, Determination of Chlorophyll and Leaf Damage Level

[0064] Cell death was visualized in leaves sampled from dark stressed and control unstressed plants, by lactophenol-trypan blue staining followed by destaining in saturated chloral hydrate (Koch E. and Slusarenko A. 1990 Plant Cell 2, 437-445). Total chlorophyll content was measured in extracts of the fully expanded leaves as described before (Brychkova et al., 2007, ibid). The values for remaining chlorophyll content in leaf discs were determined as the amount of chlorophyll per disc divided by the amount of chlorophyll per untreated control and expressed as a percentage. The severity of leaf damage after dark stress was as follows: 1, no damage; 2, <30%; 3, 30-50%; 4, >50% of the leaf area damaged. The average leaf damage was then multiplied by the total number of damaged leaves to determine the damage level. Means.+-.SEM for each treatment are presented.

Preparation of RNA and Quantitative Real-Time RT-PCR

[0065] For quantitative analysis of transcripts expression, total RNA, RT reaction and quantitative RT-PCR reactions with specific primers (see Table 1 hereinbelow) were performed as describes in Brychkova et al. (2007, ibid). Reactions normalized with UBQ10 (At4g05320) and Elongation factor 1-.alpha. (At5g60390) as housekeeping genes revealed similar results and thus only results based on the later housekeeping gene are presented.

TABLE-US-00001 TABLE 1 List of primers used for quantitative real-time PCR with Arabidopsis thaliana Length of PCR Tran- PCR product Primer script SGN1 Forward 189 (StayGreen1; GATTGTTCCCGTTGCAAGGTTGTTT At4g22920) (SEQ ID NO: 1) Reverse TGCAACTGAGAGTTGTTTATGGATTGAG (SEQ ID NO: 2) SRG1 forward 191 (senescence- AAGAGTGGGGATTTTTCCAGCTTGT related gene 1; (SEQ ID NO: 3) At1g17020) reverse TGCCCAATCTAGTTTCTGATCTTCTGA (SEQ ID NO: 4) UBQ10 forward 192 (Ubiquitine10; TTTGTTAAGACTCTCACCGGAAAGACA At4g05320) (SEQ ID NO: 5) reverse GAGGGTGGATTCCTTCTGGATATTGTA (SEQ ID NO: 6) UO (Urate forward 187 oxidase; CACTGTTTATGTGAAAGCCAAGGAATG At2g26230) (SEQ ID NO: 7) reverse CCCAAGCTTAAAACCATGTAAATGTGG (SEQ ID NO: 8) TLP forward 185 (transthyretin- CCATGCGTTAAAGGAAAGGTATGAAAA like protein; (SEQ ID NO: 9) AT5g58220) reverse TGATTCTCAGACGATCTTGAGGTTTTG (SEQ ID NO: 10) WRKY53 forward 158 (WRKY DNA- TCAAAGAAAAGAAAGATGTTACCAAAGTGG binding protein (SEQ ID NO: 11) 53; At4g23810), reverse GTGCATCTGTAATAACTCCTTGGGAAT (SEQ ID NO: 12) XDH1 (xanthine forward 200 dehydrogenase TGATGTTGGACAAATAGAAGGAGCGTTT 1; At4g34890) (SEQ ID NO: 13) reverse TATTCGGATTCCCCTTGAGAAGCGAAACA (SEQ ID NO: 14) XDH2 (xanthine Forward 202 dehydrogenase TGATATTGGACAAATAGAAGGAGCGTTT 2; At4g34900) (SEQ ID NO: 15) reverse TGCATTTGGATTACCCTTGAGAAGAGAAA (SEQ ID NO: 16) XERO1/TAS14 forward 165 (dehydrin; AGACTCACCAACAGCTTGACCAATTT At3g50980) (SEQ ID NO: 17) reverse CACCTAGTCCATCATCCGAGCTAGAG (SEQ ID NO: 18) SGN1 Forward 189 (StayGreen1; GATTGTTCCCGTTGCAAGGTTGTTT At4g22920) (SEQ ID NO: 19) Reverse TGCAACTGAGAGTTGTTTATGGATTGAG (SEQ ID NO: 20) SRG1 forward 191 (senescence- AAGAGTGGGGATTTTTCCAGCTTGT related gene 1; (SEQ ID NO: 21) At1g17020) reverse TGCCCAATCTAGTTTCTGATCTTCTGA (SEQ ID NO: 22) UBQ10 forward 192 (Ubiquitine10; TTTGTTAAGACTCTCACCGGAAAGACA At4g05320) (SEQ ID NO: 23) reverse GAGGGTGGATTCCTTCTGGATATTGTA (SEQ ID NO: 24) UO (Urate forward 187 oxidase; CACTGTTTATGTGAAAGCCAAGGAATG At2g26230) (SEQ ID NO: 25) reverse CCCAAGCTTAAAACCATGTAAATGTGG (SEQ ID NO: 26) TLP forward 185 (transthyretin- CCATGCGTTAAAGGAAAGGTATGAAAA like protein; (SEQ ID NO: 27) AT5g58220) reverse TGATTCTCAGACGATCTTGAGGTTTTG (SEQ ID NO: 28) WRKY53 (WRKY forward 158 DNA-binding TCAAAGAAAAGAAAGATGTTACCAAAGTGG protein 53; (SEQ ID NO: 29) At4g23810), reverse GTGCATCTGTAATAACTCCTTGGGAAT (SEQ ID NO: 30) XDH1 (xanthine forward 200 dehydrogenase TGATGTTGGACAAATAGAAGGAGCGTTT 1; At4g34890) (SEQ ID NO: 31) reverse TATTCGGATTCCCCTTGAGAAGCGAAACA (SEQ ID NO: 32) XDH2 (xanthine Forward 202 dehydrogenase TGATATTGGACAAATAGAAGGAGCGTTT 2; At4g34900) (SEQ ID NO: 33) reverse TGCATTTGGATTACCCTTGAGAAGAGAAA (SEQ ID NO: 34) XERO1/TAS14 forward 165 (dehydrin; AGACTCACCAACAGCTTGACCAATTT At3g50980) (SEQ ID NO: 35) reverse CACCTAGTCCATCATCCGAGCTAGAG (SEQ ID NO: 36)

Histochemical Staining for O.sub.2.sup.- and H.sub.2O.sub.2 Detection

[0066] Nitroblue tetrazolium (NBT) O.sub.2.sup.- staining of leaves was performed essentially according to Jabs T. et al. (1996 Science 273, 1853-1856) and Fryer M. J. et al. (2002 J Exp Bot 53, 1249-1254). Leaves were incubated for 10 h in the dark overnight and then placed in 96% ethanol, boiled for 10 min and photographed. Application of allantoin and allantoate and O.sub.2'' and H.sub.2O.sub.2 measurement was carried out on 7 mm leaf discs removed from 4-week-old Col wild-type and Atxdh1 mutant plants. Discs were placed in the dark for 24 h on moistened filter papers. Thereafter, 0.1 mM allantoin or allantoate in pH 7.5 solution was added to the filter papers for additional 2 h. For NBT-O.sub.2.sup.- staining, leaf discs were washed twice and immersed in 0.8 mM NBT solution added to the filter papers for 2 h in the light and then boiled in 96% ethanol for 10 min and photographed. For DAB-H.sub.2O.sub.2 staining leaf discs subjected to the procedure described above for NBT were immersed in solution containing 1 mg ml.sup.-1 3,3'-diaminobenzidine (DAB) in pH 5.0, for 2 h in the light as described before (Sagi M. et al., 2004 Plant Cell 16, 616-628). Leaf discs were photographed after boiling in 96% ethanol for 10 min. NBT and DAB stained leaves and leaf discs were quantified using NIH Image Software (Version 1.6).

Protein Extraction, Fractionation and Total Soluble Protein Determination in-Gel and Kinetic Assay of ROS-Generating Activities of XDH

[0067] Extracts of XDH for assay by native gel electrophoresis (PAGE) were prepared as described by Sagi M. et al. (1998 Plant Science 135, 125-135) and Yesbergenova et al. (2005, ibid). Kinetic O.sub.2.sup.- generating activities of XDH were assayed spectrophotometrically by measuring the oxidation of epinephrine to adrenochrome at 480 nm as described previously in Sagi M. and Fluhr R. (2001 Plant Physiol 126, 1281-1290). The reaction medium contained 6.2 .mu.g of protein extract, 1 mM epinephrine in 50 mM Tris-HCl buffer (pH 8.5) and 1 mM hypoxanthine/xanthine. Reaction medium without hypoxanthine/xanthine was used as control. Six samples were analyzed and averaged for each data points. Means.+-.SEM for each treatment are presented.

Ureides, Hypoxanthine and Xanthine Determination

[0068] Ureides were extracted from leaves with 80% ethanol and determined according to Vogels G. D. and Van Der Drift C. (1970 Anal Biochem 33, 143-157) using allantoic acid and allantoin as references. Six samples were analyzed and averaged for each data points. For hypoxanthine and xanthine determination, leaves were extracted with 40 mM NaOH and diluted four times by Tris-HCl 0.1 M, pH 7.5. Hypoxanthine/xanthine were determined by high performance liquid chromatography (HPLC) using a 100.times.2.1 mm ID, ODS-Hypersil (5 .mu.m) column. The mobile phase was a 10 mM NaOH/0.1 mM Tris-HCl, pH 5.0, similar to that used by Corpas F. J. et al., (1997 J Plant Physiol 151, 246-250). The hypoxanthine and xanthine were detected using standards retention time and UV absorption spectra ratio at 249 nm and 267 nm. A modified protocol to detect xanthine via the xanthine oxidase assay was used (Mohanty J. G. et al., 1997 Journal of Immunological Methods 202, 133-141). The reaction mixture modified from Yesbergenova et al., (2005 ibid), contained 0.4 U ml.sup.-1 HRP, 40 mU ml.sup.-1 buttermilk xanthine oxidase (Fluka), 3.4 mM 3,5-dichloro-2-hydroxobenzene sulphonate and 0.85 mM 4-aminoantipyrine in Tris-HCl 0.1 M, pH 7.5.

Example 1

XDH Expression During Dark-Induced Stress and its Subsequent Recovery

[0069] XDH1 expression was examined under extended dark treatment that imposes major remobilization of cellular components. To this end, wild type Col plants and Atxdh1-compromised plants (RNA interference lines Ri5, Ri7 and Ri10; T-DNA insertion line, KO) impaired in XDH1 activity (Yesbergenova et al., 2005, ibid), were exposed to 6 days continuous dark followed by a `recovery` period of 9 days under normal diurnal light regime (16 h light/8 h dark). The level of XDH1 transcript was found to increase continuously in the dark reaching a peak (>20 fold induction) in 24 h (FIG. 1a, left panel). The results imply that dark induction of XDH occurs as part of a normal diurnal physiological response although it rises to higher levels during the extended dark period. Upon return to light on the 7th d the transcript level rapidly decreased (FIG. 1a, left panel). In contrast, XDH2 transcript was unchanged during the dark treatment although it was slightly enhanced during the recovery period in both Col and the modified plants (FIG. 1a, right panel).

Example 2

XDH Superoxide Activity Parallels XDH Expression

[0070] To ascertain whether potential enzymatic performance parallels the measured transcript changes, the in-gel activities of superoxide generation by XDH were tested using NADH and hypoxanthine/xanthine substrates (Yesbergenova et al., 2005, ibid). NADH-dependent activity exhibited at most a 1.5-fold enhancement in O.sub.2.sup.- production during the dark period (FIG. 1b, left panel), whereas the hypoxanthine/xanthine-dependent activity increased immediately in the dark to nearly 3-fold levels at its maximum (FIG. 1c, left panel). No NADH-dependent or hypoxanthine/xanthine-dependent XDH activities were detected in Atxdh1 mutants (FIGS. 1b and c, right panels; data not shown for RNAi plants) even during the recovery period where XDH2 transcript was observed to increase (FIG. 1a). This could indicate that XDH2 activity or abundance is very low and demonstrates that typically XDH1 plays a role in dark stress adaptation. The results of the in-gel assay could be confirmed in a direct crude leaf extract assay using epinephrine as electron acceptor (Yesbergenova et al., 2005, ibid; FIG. 1d). In this case, at least a 2-fold increase in XDH activity could be detected in wild type leaves while mutant lines showed no or negligible activity. In all, while the exact fold level changes in activity differ according to the procedure used, the measured activities followed the general rise and fall in transcript levels.

Example 3

Mutation in XDH1 Accelerates Premature Senescence in Dark-Induced Stressed Plants

[0071] Reference is now made to FIG. 2, in which responses of wild-type and XDH compromised Arabidopsis plants to dark stress is shown. In FIG. 2a, wild-type (Col) and XDH compromised plants (KO, SALK.sub.--148364; Ri, xdh1 RNA interference) were tested during 6 day dark treatment and subsequent 9 days recovery. FIG. 2b shows survival rates of wild-type and XDH compromised plants 15 days after being exposed to the conditions described above. Leaves from control untreated and dark-treated Col and Atxdh1 compromised plants were excised before (0) and 6 d after (6) exposure to dark. FIG. 2d shows damage level of leaves. FIG. 2e shows chlorophyll content in leaves over a 6 d dark treatment FIG. 2f shows total soluble protein content in leaves over a 6 d dark treatment.

[0072] Wild type Col and XDH1-compromised lines were examined more closely during the dark treatment. Rosette leaves of the mutant plants impaired in XDH1 expression were distinctly more yellow than wild type leaves (FIG. 2a, c). Quantitative analysis showed a rapid fall in residual chlorophyll levels of 30% and 50% in wild type and mutant leaves, respectively (FIG. 2e). The yellowing was accompanied by a reduction in soluble proteins, another hallmark of senescence (FIG. 2f). Atxdh1-compromised leaves compared to wild type leaves showed a higher damage rate (FIG. 2d) and accumulation of many more dead cells as ascertained by trypan blue staining (FIG. 2g). The plants were then returned to a normal diurnal cycle and their subsequent recovery was followed for an additional 9 days period. Wild-type plants showed an 80% survival rate as compared to 20 to 45% for the mutant lines (FIG. 2b). The results imply that XDH1-dependent processes are important for plant adaptation to extended dark treatment and subsequent recovery in normal light.

Example 4

Senescence and Chlorophyll Degradation-Associated Gene Expression in Atxdh1 Down-Regulated Plants

[0073] Reference is now made to FIG. 3 in which transcripts were monitored by quantitative real-time RT-PCR analysis using wild-type (Col), XDH compromised plants (KO, SALK.sub.--148364, Atxdh1 T-DNA insertion line) and Ri (mean of 3 independent XDH1 RNA interference lines).

[0074] Enhanced dark-induced leaf yellowing in the mutant lines (such as that described in FIG. 2) may be indicative of hastened senescence. To examine this at the molecular level, the expression of early and late senescence-associated gene classes was monitored. Dark stress led to more rapid and enhanced accumulation of the early senescence transcripts, WRKY53 (senescence-related regulatory gene) and ERD1/SAG15 (senescence-associated gene) (Brychkova et al., 2007, ibid; Buchanan-Wollaston V. et al., 2005 Plant J 42, 567-585; Miao Y. et al., 2004, ibid) in Atxdh1 mutant leaves compared to wild type leaves (FIG. 3, upper panels). Marker genes that emphasize late processes in senescence are SRG1 (senescence related gene1, a member of Fe(II)/ascorbate oxidase gene family) and XERO1/TAS14 (dehydrin; Alsheikh M. K. et al., 2005 Plant Cell Environ 28, 1114-1122; Brychkova et al., 2007, ibid; Canard D. et al., 1996 Plant Physiol 112, 705-715; Weaver L. M. et al., 1998, ibid). After 6 days they were induced 390-fold in Col wild type plants and were yet 2-6-fold higher in the mutant lines (FIG. 3, middle panels). Similarly, the transcript level of the Cys protease senescence-associated gene 12 (SAG12), a common marker of leaf senescence (Gepstein et al., 2003 Plant J 36, 629-642), exhibited earlier and higher expression in Atxdh1 compromised plants (see FIG. 10).

[0075] The chlorophyll-degradation gene ACD1 (accelerated cell death1) is involved in senescence-associated chlorophyll breakdown (Tanaka et al., 2003, ibid) while SGN1 (stay-green protein1) is involved in chlorophyll catabolism during development (Park et al., 2007, ibid). The transcript levels of these genes were rapidly induced already after 1 day in darkness and were maintained at higher levels in Atxdh1 mutants in comparison to those of Col plants (FIG. 3, lower panels). These results indicate that the presence of AtXDH1 plays an important role in impeding symptoms and molecular events indicative of pre-mature senescence in response to dark-induced stress.

Example 5

XDH and Non-XDH Superoxide Generating Activities

[0076] Reference is now made to FIG. 4 which shows quantitative analysis of NBT-O.sub.2.sup.- production in leaves in response to dark treatment. Plant XDH reactions can use as electron receptors molecular oxygen yielding O.sub.2.sup.-, or if available, non-reduced NAD.sup.+ (Hesberg C. et al., 2004 J Biol Chem 279, 13547-13554; Nguyen J. 1986 Physiologie Vegetale 24, 263-281; Yesbergenova et al., 2005, ibid). The resultant superoxide may further impinge on the physiology of dark-induced stress. In an attempt to illuminate the situation in vivo, reactive oxygen species (ROS) sources were estimated during dark treatment by the differential use of 2 inhibitors, allopurinol and diphenylene iodonium (DPI). The XDH inhibitor allopurinol is converted to alloxanthine, which remains tightly attached to the substrate-binding pocket in the MoCo domain, thereby preventing further substrate turnover (Harrison 2002, ibid; Hesberg et al., 2004, ibid). In contrast, DPI is a suicide inhibitor of flavin-containing enzymes and can be used to estimate both XDH and e.g. NADPH oxidase activities (Sagi and Fluhr, 2001, ibid; Yesbergenova et al., 2005, ibid). To this end, rosette leaves of dark-treated plants were examined by NBT infiltration for the detection of superoxides (Fryer et al., 2002, ibid). During dark treatment wild-type leaves had a basal level of total superoxide that remained within .+-.15% of the light control (not shown). In contrast, mutant leaves showed .about.30% lower total levels of NBT reduction, indicating that XDH activity has a measurable contribution to the redox milieu of the plant as has been observed previously (Yesbergenova et al., 2005 ibid). The addition of the XDH inhibitor, allopurinol, gives an independent measure of XDH-dependent superoxide activity. As shown in FIG. 4b (middle panel) a nearly 3-fold increase in XDH-dependent superoxide production was obtained in the dark on day 3. In contrast, no such rise was detected in XDH mutant plants. An estimate of the residual XDH activity, due to either partial allopurinol inhibition or of O.sub.2.sup.- production by a non-XDH source such as NADPH oxidase activity was obtained by simultaneous subtraction of +DPI from +allopurinol leaf scan values (FIG. 4b, lower panel). In this case O.sub.2.sup.- production rose in the mutant plants during the dark (i.e. the DPI inhibited activities) more than in the wild type plants. Thus, in XDH compromised plants other sources of ROS can, in part, compensate in the dark for the loss of ROS supplied by XDH. Taken together, the XDH activity measured by superoxide production increased in vivo in the dark and makes a significant contribution to the leaf redox milieu.

Example 6

Dark Treatment Modifies Accumulation of Purine Metabolites

[0077] Reference is now made to FIG. 5 in which analysis of the purine metabolites, xanthine, allantoin and allantoate, in response to dark stress, is shown. It was examined whether the detected changes in XDH1 activity impinge on the accumulation of xanthine and/or ureides during the dark treatment and the subsequent recovery in the light. In wild type (Col) plants the xanthine level did not change during dark treatment over the low basal level (FIG. 5a). However, the basal level of xanthine content in Atxdh1 mutants was more than 10-fold higher than in Col plants although hypoxanthine levels remained below the detection limits. The xanthine level significantly increased in Atxdh1 mutant leaves upon dark treatment reaching over 10-fold the basal level in mutant plants and 100-fold the level detected in wild type plants. This level was only slightly reduced during the recovery period (FIG. 5a), indicating that potential XDH2 activity can play a typically minor role in the control of this xanthine pool. Thus, the presence of the XDH1 mutation unmasks a transient but significant increase in purine catabolic flux that occurs during the dark.

[0078] XDH activity produces urate which is rapidly converted to the ureides, allantoin and allantoate (Nguyen, 1986, ibid; Sagi et al., 1998 ibid). Unexpectedly, their levels were found to be significantly enhanced in wild type Col leaves upon exposing plants to dark treatment (5-fold; FIGS. 5b, 5c, dark). The accumulation may suggest that in wild type plants the downstream processing of ureides is transiently blocked. Interestingly, transfer of dark-treated wild type plants to the light after 6 days in the dark resulted in the gradual reduction of ureides that started after the first day and reached a basal level on the 9th day in the light (day 15, FIGS. 5b and 5c, recovery). In Atxdh1 mutant leaves, basal levels of allantoin and allantoate were detected and were similar to wild type levels. Their presence may represent XDH2 activity, residual XDH1 activity or represent an alternative pathway to ureide biosynthesis. Importantly, the level of allantoin and allantoate in Atxdh1 mutant leaves remained low during dark stress, or upon recovery (FIGS. 5b, 5c). The results indicate that AtXDH1 activity plays a pivotal role in dark-induced purine catabolism by facilitating the production of ureides.

Example 7

Dark-Induced Stress Modifies Transcript Levels of Genes Involved in Purine Catabolism Up-Stream and Down-Stream to XDH

[0079] Reference is now made to FIG. 6 which shows quantitative analysis of transcripts by real-time RT-PCR performed using wild-type (Col) and XDH compromised plants (KO, SALK.sub.--148364 Atxdh1 T-DNA insertion line; Ri, means of three XDH RNA interference lines) after being kept in the dark for 6 days and transferred to a 16 h light/8 h dark regime for recovery during additional 9 days. The rise in ureide levels implies a bottleneck in their remobilization during the extended dark period, which should be reflected in an increase or decrease of transcripts in the catabolic pathway. AMPD, catalyzing the conversion of AMP to IMP, is the first committed step in purine catabolism (Zrenner R. et al., 2006 Annu Rev Plant Biol 57, 805-836). Upon transfer to dark, AMPD transcript expression level rapidly rises in both Col and Atxdh1 mutants and falls upon exposure to light (FIG. 6, upper panel). In addition, transcript expression of the peroxisomal enzymes UO and TLP, thought to be involved in ureides production (Reumann S. et al., 2007 Plant Cell, tpc.107.050989), followed similar pattern of transcript induction during dark stress and subsequent recovery period, as exhibited by AMPD and XDH1 (FIG. 12). In contrast, ALN that converts allantoin to allantoate and AAH that converts allantoate to ureidoglycolate were enhanced on day one of the dark treatment but then declined significantly to below the basal level on the 4th and 6th day. The latter reduction coincides with the timing of the increase in ureides accumulation. Upon re-exposure to light the transcripts again returned to near basal levels (FIG. 6, middle and lower panels). Thus, transcripts upstream and downstream from ureide biosynthesis were regulated reciprocally. The result is consistent with the observed rise in ureide levels and indicates that a transcriptional component exists in the control of allantoin and allantoate accumulation during dark treatment (FIG. 5).

Example 8

Purine Remobilization is Also Reflected in Leaf Age

[0080] Reference is made to FIG. 7, which shows the influence of aging on leaf phenotype, purine metabolite level and transcript expression in wild type and Atxdh1 compromised plants.

[0081] Dark treatment stimulates remobilization of metabolites which should in part mimic processes that occur during aging. To examine this, transcripts related to ureides synthesis were examined in wild type and XDH1 mutant plants over the entire plant life. With increasing age, rosette leaves of XDH mutant plants yellowed earlier than wild-type Col plants and exhibited a significantly higher fold level of the SAG12 transcript (FIG. 7a). The transcripts level of enzymes leading to allantoin and allantoate production in wild type plants, AMPD, XDH1, UO and TLP were elevated with age. In contrast, a concomitant reduction was observed in the transcript level of allantoin and allantoate utilization enzymes, ALN and AAH (FIG. 7c). Consistent with these observations, the XDH mutant showed age-dependent accumulation of xanthine and wild type plants showed gradual accumulation of the ureides allantoin and allantoate (FIG. 7b). Interestingly, the levels of xanthine and ureides that accumulate with plant age were similar to the accumulation detected during acute dark stress (FIG. 5) and may indicate the catabolic capacity of purine metabolism.

Example 9

Role of Xanthine and Ureides in Cellular Protection During Dark-Induced Stress

[0082] Reference is made to FIG. 8 which shows responses of Arabidopsis wild-type (Col) and xdh RNA interference (Ri) plants to application of the purine catabolites: xanthine, allantoin and allantoate. The dark-induced loss of chlorophyll and the accelerated cell death during recovery may be due to the accumulation of excess oxypurines (FIG. 5a) or to the lack of a protective environment provided by ureides (FIGS. 5b and 5c) or both. To examine this directly, leaf discs cut from Col and Atxdh mutants rosette leaves were treated with xanthine for 48 h in the dark and were sampled after 24 h in the light. Application of 1 mM xanthine (in the range of the calculated xanthine level that accumulates in dark-treated mutant plants) caused a reduction in chlorophyll which was exacerbated in the presence of allopurinol in both wild type and mutant Ri lines (FIG. 8a). Interestingly, Col leaf discs that exhibited the lowest chlorophyll degradation contained enhanced allantoin and allantoate levels (FIG. 8a). The observations indicate that ureides may protect chlorophyll from degradation during dark treatment and the recovery period. To elucidate the role of allantoin and allantoate directly, leaf discs were treated with 0.1 mM allantoin or allantoate. In this case, both types of ureides protected the treated leaf discs from chlorophyll degradation after 48 h dark treatment (FIG. 8b). Importantly, the protection by the ureides was afforded in spite of the significant accumulation of xanthine in allopurinol-treated Col plants and Atxdh mutants (FIG. 8b). These results suggest that chlorophyll degradation resulting from dark-induced stress and subsequent light period is due to the lack of accumulation of ureides that likely overcome a negative role of xanthine or other dark-induced components.

[0083] Reference is also made to FIG. 14 showing that allantoin application prevents leaf spoilage in Parsley. Parsley leaf discs were kept for 2 days in the light and then for 2 days in the dark with or without the addition of 0 to 10 mM allantoin. Undetached leaves kept in the light served as control (CL). The influence of allantoin application on senescence in parsley was examined by measuring the chlorophyll content relative to the content in the control undeteched leaves. In this particular case application of 0.1-0.5 mM allantoin was particularly effective in preventing the chlorophyll loss.

[0084] Reference is further made to FIG. 15, which shows the response of tomato to extended dark stress and recovery in light thereafter and the effect of application of exogenous allantoin on leaf chlorophyll content. Allantoin level in the 1.sup.st, 3.sup.rd and 5.sup.th leave of wild type tomato plants was measured during 12 days in the dark and during 10 days of recovery in the light thereafter. FIG. 15a show that exposing tomato plants to dark stress increases the allantoin level in the leaves. FIG. 15b shows that application of allantoin to tomato leaf discs kept in the dark for 2 days and then transferred to the light for additional two days delayed the chlorophyll degradation.

[0085] These results show that application of 0.1-10 mM allantoin protects leaves from chlorophyll degradation and yellowing. According to one embodiment 0.1 mM of allantoin, 0.5 mM of allantoin or any concentration of allantoin in this range are sufficient to prevent yellowing.

Example 10

A Role for Ureides as Cellular Scavengers

[0086] Reference is made to FIG. 9, which shows ROS accumulation in the presence of allantoin and allantoate in Arabidopsis wild-type (Col) and xdh1 RNA interference (Ri) lines. ROS accumulation has been shown to initiate chlorophyll degradation (Rentel M. C. et al., 2004 Nature 427, 858-861) and the enhanced chlorophyll degradation in leaves in the absence of XDH may result from ROS production during dark stress (FIG. 4; Guo and Crawford 2005 ibid). In light of the protective effect afforded by the ureides application, it is possible that they act as cellular protectants through ROS scavenging. To investigate the effect of ureides on chlorophyll integrity and cellular scavenging capability, leaf discs were treated with allantoin and allantoate and examined for chlorophyll, H.sub.2O.sub.2 and superoxide levels. Remaining chlorophyll was examined after the addition of 0.1 mM allantoin or allantoate for 24 h and subsequent application of 20 or 50 mM H.sub.2O.sub.2 for 6 h. The treated discs showed a significant increase in remaining chlorophyll (26 to 31% for 20 mM H.sub.2O.sub.2 and 32 to 36% for 50H.sub.2O.sub.2 mM, respectively; FIG. 9a) indicating that ureides can protect leaves from ROS.

[0087] The concomitant accumulation of internal ROS as H.sub.2O.sub.2 was examined by application of 3,3'-diaminobenzidine (DAB). Mutant Ri lines showed 50% more DAB staining after 24 h dark treatment (FIG. 9b). When the discs were treated with allantoin or allantoate a significant 2-fold reduction in DAB staining intensity was observed. NBT staining for the presence of superoxide revealed reduced staining in Ri lines (FIG. 9c) that had been described previously for whole leaves (FIG. 4). The addition of allantoin/allantoate significantly reduced staining in the Col lines but not the Ri lines. The results indicate that the presence of ureides diminishes H.sub.2O.sub.2 accumulation and are correlated with the observation of reduced chlorophyll degradation.

Sequence CWU 1

1

36125DNAArtificial SequenceSynthetic primer 1gattgttccc gttgcaaggt tgttt 25228DNAArtificial SequenceSynthetic primer 2tgcaactgag agttgtttat ggattgag 28325DNAArtificial SequenceSynthetic primer 3aagagtgggg atttttccag cttgt 25427DNAArtificial SequenceSynthetic primer 4tgcccaatct agtttctgat cttctga 27527DNAArtificial SequenceSynthetic primer 5tttgttaaga ctctcaccgg aaagaca 27627DNAArtificial SequenceSynthetic primer 6gagggtggat tccttctgga tattgta 27727DNAArtificial SequenceSynthetic primer 7cactgtttat gtgaaagcca aggaatg 27827DNAArtificial SequenceSynthetic primer 8cccaagctta aaaccatgta aatgtgg 27927DNAArtificial SequenceSynthetic primer 9ccatgcgtta aaggaaaggt atgaaaa 271027DNAArtificial SequenceSynthetic primer 10tgattctcag acgatcttga ggttttg 271130DNAArtificial SequenceSynthetic primer 11tcaaagaaaa gaaagatgtt accaaagtgg 301227DNAArtificial SequenceSynthetic primer 12gtgcatctgt aataactcct tgggaat 271328DNAArtificial SequenceSynthetic primer 13tgatgttgga caaatagaag gagcgttt 281429DNAArtificial SequenceSynthetic primer 14tattcggatt ccccttgaga agcgaaaca 291528DNAArtificial SequenceSynthetic primer 15tgatattgga caaatagaag gagcgttt 281629DNAArtificial SequenceSynthetic primer 16tgcatttgga ttacccttga gaagagaaa 291726DNAArtificial SequenceSynthetic primer 17agactcacca acagcttgac caattt 261826DNAArtificial SequenceSynthetic primer 18cacctagtcc atcatccgag ctagag 261925DNAArtificial SequenceSynthetic primer 19gattgttccc gttgcaaggt tgttt 252028DNAArtificial SequenceSynthetic primer 20tgcaactgag agttgtttat ggattgag 282125DNAArtificial SequenceSynthetic primer 21aagagtgggg atttttccag cttgt 252227DNAArtificial SequenceSynthetic primer 22tgcccaatct agtttctgat cttctga 272327DNAArtificial SequenceSynthetic primer 23tttgttaaga ctctcaccgg aaagaca 272427DNAArtificial SequenceSynthetic primer 24gagggtggat tccttctgga tattgta 272527DNAArtificial SequenceSynthetic primer 25cactgtttat gtgaaagcca aggaatg 272627DNAArtificial SequenceSynthetic primer 26cccaagctta aaaccatgta aatgtgg 272727DNAArtificial SequenceSynthetic primer 27ccatgcgtta aaggaaaggt atgaaaa 272827DNAArtificial SequenceSynthetic primer 28tgattctcag acgatcttga ggttttg 272930DNAArtificial SequenceSynthetic primer 29tcaaagaaaa gaaagatgtt accaaagtgg 303027DNAArtificial SequenceSynthetic primer 30gtgcatctgt aataactcct tgggaat 273128DNAArtificial SequenceSynthetic primer 31tgatgttgga caaatagaag gagcgttt 283229DNAArtificial SequenceSynthetic primer 32tattcggatt ccccttgaga agcgaaaca 293328DNAArtificial SequenceSynthetic primer 33tgatattgga caaatagaag gagcgttt 283429DNAArtificial SequenceSynthetic primer 34tgcatttgga ttacccttga gaagagaaa 293526DNAArtificial SequenceSynthetic primer 35agactcacca acagcttgac caattt 263626DNAArtificial SequenceSynthetic primer 36cacctagtcc atcatccgag ctagag 26

* * * * *

Patent Diagrams and Documents
D00000
D00001
D00002
D00003
D00004
D00005
D00006
D00007
D00008
D00009
D00010
D00011
D00012
D00013
S00001
XML
US20100333237A1 – US 20100333237 A1

uspto.report is an independent third-party trademark research tool that is not affiliated, endorsed, or sponsored by the United States Patent and Trademark Office (USPTO) or any other governmental organization. The information provided by uspto.report is based on publicly available data at the time of writing and is intended for informational purposes only.

While we strive to provide accurate and up-to-date information, we do not guarantee the accuracy, completeness, reliability, or suitability of the information displayed on this site. The use of this site is at your own risk. Any reliance you place on such information is therefore strictly at your own risk.

All official trademark data, including owner information, should be verified by visiting the official USPTO website at www.uspto.gov. This site is not intended to replace professional legal advice and should not be used as a substitute for consulting with a legal professional who is knowledgeable about trademark law.

© 2024 USPTO.report | Privacy Policy | Resources | RSS Feed of Trademarks | Trademark Filings Twitter Feed