U.S. patent application number 12/818016 was filed with the patent office on 2010-12-23 for th1-associated micrornas and their use for tumor immunotherapy.
This patent application is currently assigned to The University of Pittsburgh - Of the Commonwealth System of Higher Education. Invention is credited to Gary Kohanbash, Hideho Okada, Kotaro Sasaki.
Application Number | 20100322909 12/818016 |
Document ID | / |
Family ID | 43354573 |
Filed Date | 2010-12-23 |
United States Patent
Application |
20100322909 |
Kind Code |
A1 |
Okada; Hideho ; et
al. |
December 23, 2010 |
TH1-ASSOCIATED MICRORNAS AND THEIR USE FOR TUMOR IMMUNOTHERAPY
Abstract
Described herein is the identification of miRNAs (miRs) that are
up-regulated in Th1 cells compared to Th2 cells (referred to herein
as Th1-associated miRs). In particular, the miR-17-92 gene cluster
was found to exhibit significantly greater expression in Th1 cells.
Over-expression of miR-17-92 in T cells promotes the Th1 phenotype.
Thus, the use of Th1-associated miRs for cancer immunotherapy is
described. Provided herein are isolated T cells containing a
heterologous nucleic acid molecule encoding a Th1-associated miR,
such as the miR17-92 gene cluster, or a portion thereof. In some
embodiments, the T cell is a tumor antigen (TA)-specific T cell,
such as a TA-specific CTL. Further provided is a method of treating
cancer in a subject by selecting a subject with cancer and
administering to the subject an isolated T cell as disclosed
herein. Also provided is a method of treating a subject with cancer
by transfecting isolated T cells obtained from the subject with a
heterologous nucleic acid molecule encoding a Th1-associated miR
and administering the transfected T cells to the subject. In some
embodiments of the method, the heterologous nucleic acid molecule
encodes the miR-17-92 transcript or a portion thereof. In some
embodiments, the isolated T cell is a TA-specific T cell, such as a
CTL.
Inventors: |
Okada; Hideho; (Pittsburgh,
PA) ; Kohanbash; Gary; (Pittsburgh, PA) ;
Sasaki; Kotaro; (Pittsburgh, PA) |
Correspondence
Address: |
KLARQUIST SPARKMAN, LLP
121 SW SALMON STREET, SUITE 1600
PORTLAND
OR
97204
US
|
Assignee: |
The University of Pittsburgh - Of
the Commonwealth System of Higher Education
|
Family ID: |
43354573 |
Appl. No.: |
12/818016 |
Filed: |
June 17, 2010 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
61187903 |
Jun 17, 2009 |
|
|
|
Current U.S.
Class: |
424/93.21 ;
435/325 |
Current CPC
Class: |
C12N 2510/00 20130101;
C12N 5/0636 20130101; C12N 2310/141 20130101; C12N 15/113 20130101;
A61P 35/00 20180101; A61K 2035/124 20130101; A61K 35/17
20130101 |
Class at
Publication: |
424/93.21 ;
435/325 |
International
Class: |
A61K 35/12 20060101
A61K035/12; C12N 5/0783 20100101 C12N005/0783; A61P 35/00 20060101
A61P035/00 |
Goverment Interests
ACKNOWLEDGMENT OF GOVERNMENT SUPPORT
[0002] This invention was made with government support under grant
number NS055140 awarded by the National Institutes of Health. The
government has certain rights in the invention.
Claims
1. An isolated T cell comprising a heterologous nucleic acid
molecule encoding the miR-17-92 transcript or a portion thereof,
wherein the portion comprises the coding sequence for miR-17-5p,
miR-17-3p, miR-18a, miR19a, miR-20a, miR19b-1 or miR-92a-1.
2. The isolated T cell of claim 1, wherein the portion comprises
the coding sequence for: (i) miR-17-5p, miR-17-3p, miR-18a and
miR19a; (ii) miR-20a, miR19b-1 and miR-92a-1; or (iii) miR-17-5p
and miR-17-3p.
3. The isolated T cell of claim 1, wherein the heterologous nucleic
acid molecule comprises a vector.
4. The isolated T cell of claim 3, wherein the vector is a viral
vector.
5. The isolated T cell of claim 3, wherein the viral vector is a
lentiviral vector.
6. The isolated T cell of claim 1, wherein the T cell is a tumor
antigen (TA)-specific cytotoxic T lymphocyte (CTL).
7. The isolated T cell of claim 6, wherein the TA is a
glioma-associated antigen.
8. The isolated T cell of claim 1, wherein the miR-17-92 transcript
or portion thereof is a human miR-17-92 transcript or portion
thereof.
9. A composition comprising the isolated T cell of claim 1 and a
pharmaceutically acceptable carrier.
10. A method of treating a subject with cancer, comprising (i)
selecting a subject with cancer; and (ii) administering to the
subject the isolated T cell of claim 1, thereby treating the
subject with cancer.
11. The method of claim 10, wherein the isolated T cell comprises a
heterologous nucleic acid molecule encoding a portion of the
miR-17-92 transcript, wherein the portion comprises the coding
sequence for: (i) miR-17-5p, miR-17-3p, miR-18a and miR19a; (ii)
miR-20a, miR19b-1 and miR-92a-1; or (iii) miR-17-5p and
miR-17-3p.
12. The method of claim 11, wherein the heterologous nucleic acid
molecule comprises a vector.
13. The isolated T cell of claim 12, wherein the vector is a
plasmid vector.
14. The isolated T cell of claim 13, wherein the vector is a viral
vector.
15. The method of claim 10, wherein the T cell administered to the
subject is a tumor antigen (TA)-specific cytotoxic T lymphocyte
(CTL).
16. The method of claim 15, wherein the subject has a glioma and
the TA is a glioma-associated antigen.
17. The method of claim 10, wherein administering to the subject
the isolated T cell comprises: (i) isolating T cells from the
subject; (ii) transfecting the isolated T cells with a heterologous
nucleic acid molecule encoding the miR-17-92 transcript or a
portion thereof, wherein the portion comprises the coding sequence
for miR-17-5p, miR-17-3p, miR-18a, miR19a, miR-20a, miR19b-1 or
miR-92a-1; and (iii) administering to the subject the isolated T
cells transfected with the miR-17-92 transcript or portion thereof,
thereby treating the subject with cancer.
18. The method of claim 10, wherein the miR-17-92 transcript or
portion thereof is a human the miR-17-92 transcript or portion
thereof.
19. A method of treating a subject with cancer, comprising: (i)
selecting a subject with cancer; (ii) isolating T cells from the
subject; (iii) transfecting the isolated T cells with a
heterologous nucleic acid molecule encoding the miR-17-92
transcript or a portion thereof, wherein the portion comprises the
coding sequence for miR-17-5p, miR-17-3p, miR-18a, miR19a, miR-20a,
miR19b-1 or miR-92a-1; and (iv) administering to the subject the
isolated T cells transfected with the miR-17-92 transcript or
portion thereof, thereby treating the subject with cancer.
20. The method of claim 19, wherein the isolated T cells
administered to the subject are TA-specific CTLs.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit of U.S. Provisional
Application No. 61/187,903, filed on Jun. 17, 2009, which is herein
incorporated by reference in its entirety.
FIELD
[0003] This disclosure concerns microRNAs (miRs) that are
differentially expressed in Th1 versus Th2 cells. This disclosure
further relates to expression of such differentially expressed miRs
in T cells as a means for tumor immunotherapy.
BACKGROUND
[0004] Preclinical studies involving immunotherapeutic strategies
for central nervous system (CNS) tumors, such as glioblastoma
multiforme (GBM), have demonstrated that tumor-specific T helper
type-1 (Th1) and T cytotoxic type-1 (Tc1) cells, but not type-2
counterparts, can efficiently traffic into CNS tumor sites and
mediate effective therapeutic efficacy, recruited via the type-1
chemokine CXCL10 (Nishimura et al., Cancer Res 2006, 66:4478-4487;
Fujita et al., J Immunol 2008, 180:2089-2098; Fujita et al., Cancer
Res 2009, 69:1587-1595) and the integrin receptor, very late
antigen (VLA)-4 (Sasaki et al., The Journal of Immunology 2008,
181:104-108; Sasaki et al., Eur J Immunol 2008, 38:2865-2873; Zhu
et al., J Transl Med 2007, 5:10; Sasaki et al., Cancer Res 2007,
67:6451-6458). Despite the importance of the type-1 T cell
response, cancers, including GBMs, secrete numerous type-2
cytokines (Roussel et al., Clin Exp Immunol 1996, 105:344-352;
Weller and Fontana, Brain Res 1995, 21:128-151; Nitta et al., Brain
Res 1994, 649:122-128) that promote tumor proliferation (Jarnicki
et al., J Immunol 2006, 177:896-904; Prokopchuk et al., Br J Cancer
2005, 92:921-928) and immune escape (Seo et al., Immunology 2001,
103:449-457). Hence, the strategic skewing of existing type-2 to
type-1 immunity in glioma patients may be critical for the
development of more effective immunotherapy.
[0005] MicroRNAs (miRs) are a novel class of endogenous small
single-stranded RNA molecules which are 18-24 nucleotides in length
(Hammond, Cancer Chemother Pharmacol 2006, 58 Suppl 1:s63-68).
Mature miRs repress mRNA encoded protein translation and are highly
conserved between species, including viruses, plants and animals
(Elmen Nature 2008, 452:896-899). There are over 700 miRs
identified in the human genome that collectively are predicted to
regulate two-thirds of all mRNA transcripts (Hammond, Cancer
Chemother Pharmacol 2006, 58 Suppl 1:s63-68). Findings over the
past several years strongly support a role for miRs in the
regulation of crucial biological processes, such as cellular
proliferation (Cheng et al., Nucleic Acids Res 2005, 33:1290-1297),
apoptosis (Xu et al., Trends Genet 2004, 20:617-624), development
(Karp and Ambros, Science 2005, 310:1288-1289), differentiation
(Chen et al., Science 2004, 303:83-86), metabolism (Poy et al.,
Nature 2004, 432:226-230), and immune regulation (Thai et al.,
Science 2007, 316:604-608; O'Connell et al., Proc Natl Acad Sci USA
2007, 104:1604-1609). A recent study demonstrated that miR-222 and
miR-339 in cancer cells down-regulate the expression of an
intercellular cell adhesion molecule (ICAM)-1, thereby regulating
the susceptibility of cancer cells to cytotoxic T lymphocytes
(CTLs) (Ueda et al., Proc Natl Acad Sci USA 2009, 106:10746-10751).
This is among the first reports to demonstrate the role of miR in
cancer immunosurveillance.
SUMMARY
[0006] Disclosed herein is the identification of miRNAs (miRs) that
are up-regulated in Th1 cells compared to Th2 cells (referred to
herein as Th1-associated miRs). Over-expression of Th1-associated
miRs in T cells is demonstrated herein to promote the Th1
phenotype, which is critical for effective anti-tumor immune
responses.
[0007] Thus, provided herein are isolated T cells containing a
heterologous nucleic acid molecule encoding a Th1-associated miR.
In some embodiments, the Th1-associated miR is the miR17-92 gene
cluster, or a portion thereof. In some embodiments, the T cell is a
tumor antigen-specific T cell. Further provided is a method of
treating cancer in a subject by selecting a subject with cancer and
administering to the subject an isolated T cell as disclosed
herein.
[0008] Also provided is a method of treating a subject with cancer
by (i) selecting a subject with cancer; (ii) isolating T cells from
the subject; (iii) transfecting the isolated T cells with a
heterologous nucleic acid molecule encoding a Th1-associated miR;
and (iv) administering to the subject the isolated T cells
transfected with the nucleic acid molecule encoding the
Th1-associated miR. In some embodiments of the method, the
heterologous nucleic acid molecule encodes the miR-17-92 transcript
or a portion thereof. In some embodiments, the isolated T cell is a
TA-specific T cell, such as a CTL.
[0009] The foregoing and other objects, features, and advantages of
the invention will become more apparent from the following detailed
description, which proceeds with reference to the accompanying
figures.
BRIEF DESCRIPTION OF THE DRAWINGS
[0010] FIG. 1: Microarray analysis demonstrates up-regulation of
miR-17-92 in Th1 cells. (A) Intracellular interferon (IFN)-.gamma.
vs. interleukin (IL)-4 expression of Th1 and T helper type-2 (Th2)
cells induced from mouse CD4.sup.+ splenic T cells in vitro. (B)
Differentially expressed miRs were analyzed by hierarchical
clustering of the log 2 value of Th1/Th2 pair of miR microarray
signal. (C) miRs were ranked by relative fold expression in Th1/Th2
cells. Arrows indicate members of the miR-17-92 cluster or paralog
clusters. miRs with a relative expression of >2.35-fold in Th1
are shown. (B and C) hsa- and mmu- indicate human and mouse miR
probes, respectively. Hsa-probes can hybridize with most mouse miR
due to the high homology and mmu-signals are shown only when murine
miR has a unique sequence compared to its human counterpart. (D)
Ideogram of mouse chromosome 14 showing the location and order of
the miR-17-92 cluster (adapted from NCBI Blast).
[0011] FIG. 2: Enhanced expression of miRs from the miR-17-92
cluster in Th1 cells. Data represent relative expression of mature
miRs in Th1 compared with Th2 cells. SNO202 was used as the
internal control and .DELTA..DELTA.C.sub.T method was used to
examine expression relative to the Th2 cell value. Relative
expression is shown for (A) miR-17-92 cluster members or (B)
representative paralog cluster members, miR-106a and miR-106b.
Error Bars indicate standard deviation of the triplicate samples.
Each experiment was repeated at least 3 times. Up-regulation in Th1
vs. Th2 is significant in (A) with p<0.01 for miR-92 and
p<0.0001 for all other miRs and in (B) with p<0.001 for
miR-106a and p<0.05 for miR106b using the student t test.
[0012] FIG. 3: Modulation of miR-17-92 expression by IL-4
signaling. (A) Immuno-magnetically isolated mouse splenic CD4.sup.+
T cells were cultured with 5 .mu.g/ml plated anti-CD3, feeder cells
and 100 U/ml hIL-2 ("neutral" condition). Anti-IL-4 (2.5 .mu.g/ml)
or isotype control monoclonal antibody (mAb) was added to the
appropriate wells and cultured for 5 days prior to extraction of
total RNA. Statistical analysis was carried out using the student t
test. The blockade of IL-4 significantly up-regulated miR-17-5p and
miR-92 (p<0.001 and p<0.005, respectively). (B) CD4.sup.+ T
cells were cultured with anti-CD3, feeder cells, and hIL-2 and
varying amounts of IL-4 for 5 days. Total RNA was extracted and
analyzed by RT-PCR for miR-17-5p expression. The dose dependent
decrease of miR-17-92 expression was analyzed using post test for
linear trend and was significant (p<0.001). (C) Th1 and Th2
cells were induced from splenic CD4.sup.+ T cells isolated from
either wild-type or STAT6.sup.-/- mice. Total RNA was extracted and
RT-PCR was performed using specific primers against miR-17-5p and
miR-92. Columns represent the mean of triplicates from one of 2 two
experiments with similar results, and error bars represent standard
deviations. STAT6.sup.-/- cells demonstrated significantly higher
levels of miR-17-5p and miR-92 compared with wild type (WT) cells
in both Th1 and Th2 conditions (p<0.001) using the student t
test.
[0013] FIG. 4: Tumor bearing conditions down-regulate miR-17-5p
expression in T cells. Splenocytes (SPCs) were harvested from
C57BL/6 or STAT6.sup.-/- mice bearing day 15 subcutaneous B16
melanoma (T+) or control non-tumor bearing mice (T-). (A) CD4.sup.+
and CD8.sup.+ T cells were isolated by immuno-magnetic bead
separation, and evaluated for miR17-5p expression. (B)
1.times.10.sup.6 CD4.sup.+ cells from WT mice were briefly
stimulated with anti-CD3 mAb for 6 hours. Concentration of
IFN-.gamma. secreted in culture media was evaluated by specific
enzyme-linked immunosorbent assay (ELISA). (C) CD4.sup.+ T cells
were isolated from healthy donor-derived peripheral blood
mononuclear cells (PBMC) and stimulated with 5 .mu.g/ml plated
anti-CD3 feeder cells (irradiated PBMC) and 100 IU/ml hIL-2 in the
presence or absence of hIL-4 (10 ng/ml) for 5 days prior to
extraction of total RNA. (D) Non-stimulated CD4.sup.+ and CD8.sup.+
T cells were isolated by immuno-magnetic beads from PBMC derived
from healthy donors (n=6) or patients with GBM (n=8) and miR-17-5p
expression was analyzed by RT-PCR. Data in (A), (B) and (C) are
representative of two identical experiments with similar results.
Columns represent the mean of triplicates from a single experiment
and error bars represent standard deviation. "*" indicates
p<0.01 and "**" indicates p<0.05 between the two groups using
the student t test.
[0014] FIG. 5: T cells from miR-17-92 transgenic mice demonstrate
enhanced Th1 phenotype. Splenic CD4.sup.+ T cells were
immuno-magnetically isolated from miR-17-92 transgenic (TG)/TG or
control animals. (A) miR-17-5p expression was analyzed in total RNA
extracted from these freshly isolated cells. (B) Flow analysis was
carried out on these freshly isolated cells for surface expression
of CD49d, a subunit composing VLA-4. The grey-shaded region
represents CD4.sup.+ T cells isolated from control wild type
animals and the unshaded region with the solid line represents
CD4.sup.+ T cells from miR-17-92 TG/TG mice. Dotted lines represent
samples stained with isotype control Rat IgG2b. As the background
staining with the isotype IgG2b was equally very low in the two
cell types, the corresponding histograms are barely distinguishable
from each other. (C) Isolated cells were stimulated in Th1 skewing
condition for 9 days and 5.times.10.sup.6 cells were then plated in
fresh media for 24 hours, at which point supernatant was collected
and analyzed for IFN-.gamma. by ELISA. Both in (A) and (C) values
in the two groups were statistically different with p<0.01 using
the student t test.
[0015] FIG. 6: Ectopic expression of miR-17-92 cluster members in
the human Jurkat T cell line confers increased IL-2 production and
resistance to AICD. Jurkat cells were transduced by either one of
the following pseudotyped lentivirus vectors: 1) control vector
encoding green fluorescent protein (GFP); 2) the 17-92-1 expression
vector encoding miR-17, miR-18 and miR-19a; or 3) the 17-92-2
expression vector encoding miR-20, miR-19b-1 and miR-92a-1. (A)
Transduced Jurkat cells (5.times.10.sup.4) in the triplicate wells
were stimulated with phorbol 12-myristate 13-acetate (PMA; 10
ng/ml) and ionomycin (500 nM) overnight and supernatant was
harvested and tested for the presence of IL-2 by specific ELISA.
The figure shows mean values and standard deviations of the amount
of IL-2 released from each group. Statistical analysis was carried
out using the student t test, and a significant (p<0.005)
increase of IL-2 production was confirmed in both 17-92-1 and the
17-92-2 transduced groups compared with the control group. (B)
Transduced Jurkat cells were treated with the activation-induced
cell death (AICD) inducing condition (10 .mu.g/ml anti-CD3 mAb) or
in complete media (No Tx) for 24 hours. Then, the relative numbers
of viable cells were evaluated by 4 hour WST-1 assays. The figure
shows mean values and standard deviations of 8 wells/group, each
containing 5.times.10.sup.5 cells. For each group, the relative
optical density readings at 450 nm of AICD-treated cells compared
with control Jurkat cells without AICD-treatment is indicated. "*"
indicates p<0.05 between the two groups using student t
test.
[0016] FIG. 7: Inhibition of tumor growth in miR-17-92 TG mice.
C57BL/6-background miR-17-92-TG or control Lck-Cre mice received
(A) subcutaneous (s.c.) challenge with B16 melanoma cells
(1.times.10.sup.5/mouse) and the tumor size was measured on day 15
as square area; or (B) intracranial (i.c.) inoculation of syngeneic
GL261 glioma cells (1.times.10.sup.5/mouse) and were followed for
symptom-free survival.
[0017] FIG. 8: Transgenic expression of miR-17-92 TG in T cells
promotes T cell infiltration in GL261 glioma. C57BL/6-background
miR-17-92-TG or control Lck-Cre mice bearing i.c. GL261 glioma
(n=4/group) were sacrificed on day 23, and brain infiltrating
leukocytes (BILs) were harvested and pooled for the same groups,
then subjected to flow-cytometric analyses of CD4.sup.+ VLA-4.sup.+
cells. Numbers in each histogram indicate percentages of
corresponding cells in leukocyte-gated populations.
SEQUENCE LISTING
[0018] The nucleic acid sequences listed in the accompanying
sequence listing are shown using standard letter abbreviations for
nucleotide bases, as defined in 37 C.F.R. 1.822. The Sequence
Listing is submitted as an ASCII text file, created on Jun. 17,
2010, 4.91 KB, which is incorporated by reference herein. In the
accompanying sequence listing:
[0019] SEQ ID NO: 1 is the nucleic acid sequence of the precursor
form (stem-loop) of hsa-miR-17.
[0020] SEQ ID NO: 2 is the nucleic acid sequence of mature
hsa-miR-17-5p.
[0021] SEQ ID NO: 3 is the nucleic acid sequence of mature
hsa-miR-17-3p.
[0022] SEQ ID NO: 4 is the nucleic acid sequence of the precursor
form (stem-loop) of mmu-miR-17.
[0023] SEQ ID NO: 5 is the nucleic acid sequence of mature
mmu-miR-17-5p.
[0024] SEQ ID NO: 6 is the nucleic acid sequence of mature
mmu-miR-17-3p.
[0025] SEQ ID NO: 7 is the nucleic acid sequence of the precursor
form (stem-loop) of hsa-miR-18a.
[0026] SEQ ID NO: 8 is the nucleic acid sequence of mature
hsa-miR-18a.
[0027] SEQ ID NO: 9 is the nucleic acid sequence of the precursor
form (stem-loop) of mmu-miR-18a.
[0028] SEQ ID NO: 10 is the nucleic acid sequence of mature
mmu-miR-18a.
[0029] SEQ ID NO: 11 is the nucleic acid sequence of the precursor
form (stem-loop) of hsa-miR-19a.
[0030] SEQ ID NO: 12 is the nucleic acid sequence of mature
hsa-miR-19a.
[0031] SEQ ID NO: 13 is the nucleic acid sequence of the precursor
form (stem-loop) of mmu-miR-19a.
[0032] SEQ ID NO: 14 is the nucleic acid sequence of mature
mmu-miR-19a.
[0033] SEQ ID NO: 15 is the nucleic acid sequence of the precursor
form (stem-loop) of hsa-miR-20a.
[0034] SEQ ID NO: 16 is the nucleic acid sequence of mature
hsa-miR-20a.
[0035] SEQ ID NO: 17 is the nucleic acid sequence of the precursor
form (stem-loop) of mmu-miR-20a.
[0036] SEQ ID NO: 18 is the nucleic acid sequence of mature
mmu-miR-20a.
[0037] SEQ ID NO: 19 is the nucleic acid sequence of the precursor
form (stem-loop) of hsa-miR-19b-1.
[0038] SEQ ID NO: 20 is the nucleic acid sequence of mature
hsa-miR-19b.
[0039] SEQ ID NO: 21 is the nucleic acid sequence of the precursor
form (stem-loop) of mmu-miR-19b-1.
[0040] SEQ ID NO: 22 is the nucleic acid sequence of mature
mmu-miR-19b.
[0041] SEQ ID NO: 23 is the nucleic acid sequence of the precursor
form (stem-loop) of hsa-miR-92a-1.
[0042] SEQ ID NO: 24 is the nucleic acid sequence of mature
hsa-miR-92a.
[0043] SEQ ID NO: 25 is the nucleic acid sequence of the precursor
form (stem-loop) of mmu-miR-92a-1.
[0044] SEQ ID NO: 26 is the nucleic acid sequence of mature
mmu-miR-92a.
DETAILED DESCRIPTION
I. Introduction
[0045] Type-1 T cells are critical for effective anti-tumor immune
responses. MicroRNAs (miRs) are a large family of small regulatory
RNAs that control diverse aspects of cell function, including
immune regulation. Disclosed herein is the identification of miRs
differentially regulated between type-1 and type-2 T cells, and a
determination of how the expression of such miRs is regulated.
[0046] MicroRNA microarray analyses was performed on in vitro
differentiated murine T helper type-1 (Th1) and T helper type-2
(Th2) cells to identify differentially expressed miRs. Quantitative
RT-PCR was used to confirm the differential expression levels.
WST-1, ELISA and flow cytometry were also used to evaluate the
survival, function and phenotype of cells, respectively. Mice
transgenic for the identified miRs were employed to determine the
biological impact of miR-17-92 expression in T cells.
[0047] The initial miR microarray analyses revealed that the
miR-17-92 cluster is one of the most significantly over-expressed
miRs in murine Th1 cells when compared with Th2 cells. RT-PCR
confirmed that the miR-17-92 cluster expression was consistently
higher in Th1 cells than Th2 cells. Disruption of IL-4 signaling
through either IL-4 neutralizing antibody or knockout of STAT6
reversed the miR-17-92 cluster suppression in Th2 cells.
Furthermore, T cells from tumor bearing mice and glioma patients
had decreased levels of miR-17-92 when compared with cells from
non-tumor bearing counterparts. CD4.sup.+ T cells derived from
miR-17-92 transgenic mice demonstrated superior type-1 phenotype
with increased IFN-.gamma. production and VLA-4 expression when
compared with counterparts derived from wild type mice.
[0048] Human Jurkat T cells ectopically expressing increased levels
of miR-17-92 cluster members demonstrated increased IL-2 production
and resistance to AICD. Over-expression of miR-17-92 in primary T
cells also renders these cells resistant to AICD. The inventors
further demonstrate herein that miR-17-92 transgenic mice (which
over-express miR-17-92 in T cells) exhibit significantly smaller
tumors and/or greater length of survival following tumor challenge
with either B16 melanoma cells or GL261 glioma cells.
[0049] The type-2-skewing tumor microenvironment induces the
down-regulation of miR-17-92 expression in T cells, thereby
diminishing the persistence of tumor-specific T cells and tumor
control. Thus, genetic engineering of T cells to express miR-17-92
represents a promising approach for cancer immunotherapy.
II. Abbreviations
[0050] AA anaplastic astrocytomas
[0051] AICD activation-induced cell death
[0052] APC antigen presenting cell
[0053] BIL brain infiltrating lymphocytes
[0054] CNS central nervous system
[0055] CTL cytotoxic T lymphocyte
[0056] ELISA enzyme-linked immunosorbent assay
[0057] GBM glioblastoma multiforme
[0058] GFP green fluorescent protein
[0059] i.c. intracranial
[0060] IFN interferon
[0061] IL interleukin
[0062] i.v. intravenous
[0063] mAb monoclonal antibody
[0064] MACS magnetic activated cell separation
[0065] MHC major histocompatibility complex
[0066] miR microRNA
[0067] PBMC peripheral blood mononuclear cells
[0068] PMA phorbol 12-myristate 13-acetate
[0069] rh recombinant human
[0070] rm recombinant mouse
[0071] RNA ribonucleic acid
[0072] RT-PCR reverse transcriptase polymerase chain reaction
[0073] s.c. subcutaneous
[0074] SPC splenocyte
[0075] STAT signal transducer and activator of transcription
[0076] TA tumor antigen
[0077] Th1 T helper type-1
[0078] Th2 T helper type-2
[0079] Tc1 T cytotoxic type-1
[0080] Tc2 T cytotoxic type-2
[0081] TG transgenic
[0082] VLA very late antigen
[0083] WT wild type
II. Terms and Methods
[0084] Unless otherwise noted, technical terms are used according
to conventional usage. Definitions of common terms in molecular
biology may be found in Benjamin Lewin, Genes V, published by
Oxford University Press, 1994 (ISBN 0-19-854287-9); Kendrew et al.
(eds.), The Encyclopedia of Molecular Biology, published by
Blackwell Science Ltd., 1994 (ISBN 0-632-02182-9); and Robert A.
Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive
Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN
1-56081-569-8).
[0085] In order to facilitate review of the various embodiments of
the disclosure, the following explanations of specific terms are
provided:
[0086] Administration: The introduction of a composition (such as a
T cell) into a subject by a chosen route. For example, if the
chosen route is intravenous, the composition is administered by
introducing the composition into a vein of the subject.
[0087] Antigen: A compound, composition, or substance that can
stimulate the production of antibodies or a T cell response in an
animal, including compositions that are injected or absorbed into
an animal. An antigen reacts with the products of specific humoral
or cellular immunity, including those induced by heterologous
immunogens. The term "antigen" includes all related antigenic
epitopes. "Epitope" or "antigenic determinant" refers to a site on
an antigen to which B and/or T cells respond.
[0088] Antigen-presenting cell (APC): A cell that can present
antigen bound to MHC class I or class II molecules to T cells. APCs
include, but are not limited to, monocytes, macrophages, dendritic
cells, B cells, T cells and Langerhans cells. A T cell that can
present antigen to other T cells (including CD4+ and/or CD8+ T
cells) is an antigen presenting T cell (T-APC).
[0089] Chemotherapeutic agents: Any chemical agent with therapeutic
usefulness in the treatment of diseases characterized by abnormal
cell growth. Such diseases include tumors, neoplasms, and cancer as
well as diseases characterized by hyperplastic growth such as
psoriasis. In some cases, a chemotherapeutic agent is a radioactive
compound. One of skill in the art can readily identify a
chemotherapeutic agent of use (e.g., see Slapak and Kufe,
Principles of Cancer Therapy, Chapter 86 in Harrison's Principles
of Internal Medicine, 14th edition; Perry et al., Chemotherapy, Ch.
17 in Abeloff, Clinical Oncology 2.sup.nd ed., .COPYRGT. 2000
Churchill Livingstone, Inc; Baltzer, L., Berkery, R. (eds):
Oncology Pocket Guide to Chemotherapy, 2nd ed. St. Louis,
Mosby-Year Book, 1995; Fischer, D. S., Knobf, M. F., Durivage, H.
J. (eds): The Cancer Chemotherapy Handbook, 4th ed. St. Louis,
Mosby-Year Book, 1993). Combination chemotherapy is the
administration of more than one agent to treat cancer.
[0090] Cytotoxic T lymphocyte (CTL): CTLs are a sub-group of T
lymphocytes that are capable of inducing the death of infected
cells or tumor cells, or cells that are otherwise damaged or
dysfunctional. Most CTLs express CD8 and T-cell receptors (TCRs)
that can recognize a specific antigenic peptide bound to Class I
MHC molecules.
[0091] Glioma: A cancer of the brain that begins in glial cells
(cells that surround and support nerve cells). Malignant gliomas
are the most common type of primary brain tumor, and glioblastoma
multiforme (GBM) is the most common and most malignant of the glial
tumors. Other common malignant gliomas include anaplastic gliomas,
including anaplastic astrocytomas.
[0092] Isolated: An "isolated" biological component (such as a
nucleic acid molecule, protein, or cell) has been substantially
separated or purified away from other biological components in the
cell, blood or tissue of the organism, or the organism itself, in
which the component naturally occurs, such as other chromosomal and
extra-chromosomal DNA and RNA, proteins and cells. Nucleic acid
molecules and proteins that have been "isolated" include those
purified by standard purification methods. The term also embraces
nucleic acid molecules and proteins prepared by recombinant
expression in a host cell as well as chemically synthesized nucleic
acid molecules and proteins.
[0093] Major histocompatibility complex (MHC): Generic designation
meant to encompass the histocompatibility antigen systems described
in different species, including the human leukocyte antigens
("HLA"). The term "motif" or "epitope" refers to the pattern of
residues in a peptide of defined length, usually about 8 to about
11 amino acids, which is recognized by a particular MHC allele. The
peptide motifs or epitopes are typically different for each MHC
allele and differ in the pattern of the highly conserved residues
and negative binding residues.
[0094] MicroRNA (miR): MicroRNAs (also known as miRNAs and miRs)
are short RNA sequences expressed from longer transcripts found in
the genomes of animals, plants and viruses and at least one
single-celled eukaryote (Molnar et al., Nature 447:1126-1129, 2007;
Zhao et al., Genes Dev. 21:1190-1203, 2007). MicroRNAs regulate the
expression of target genes by binding to complementary sites in the
target gene transcripts to cause translational repression or
transcript degradation (Pillai et al., Trends Cell Biol.
17:118-126, 2007). These small RNA molecules have been implicated
in a number of biological processes related to development, cell
proliferation, apoptosis, metabolism, morphogenesis and disease
(particularly cancer) (Kloosterman and Plasterk, Dev. Cell
11:441-450, 2006).
[0095] A gene encoding a microRNA is transcribed to form a primary
transcript microRNA (pri-miRNA), which is processed to form a short
stem-loop molecule, termed a precursor microRNA (pre-miRNA),
followed by endonucleolytic cleavage to form the mature microRNA.
Mature microRNAs are approximately 21-23 nucleotides in length and
are partially complementary to the 3'UTR of one or more target
messenger RNAs (mRNAs).
[0096] A nomenclature scheme has been well established for
microRNAs (Griffiths-Jones et al., Nucleic Acids Res. 34:D140-D144,
2006; Ambros et al., RNA 9:277-279, 2003; Griffiths-Jones, Nucleic
Acids Res. 32:D109-D111, 2004). For example, a microRNA name
includes a three or four letter species prefix, such as "hsa" for
Homo sapiens, and a numeric suffix, such as "150," resulting in a
complete name of "hsa-miR-150." Mature miRNA sequences expressed
from more than one hairpin precursor molecule are distinguished by
"-1" and "-2" (such as miR-6-1 and miR-6-2). Related hairpin loci
expressing related mature microRNA sequences have lettered suffixes
(such as miR-181a and miR-181b). In some cases, mature miRNAs from
both the 5' and 3' arms of the hairpin precursor are identified,
which are designated "3p" or "5p" (such as miR-768-3p and
miR-768-5p). Viral microRNA names relate to the locus from which
the microRNA is derived (for example, ebv-miR-BART1 is from the
Epstein-Barr virus BART locus).
[0097] MicroRNA gene product sequences are well described
throughout the scientific and patent literature and are available
online through miRBase (www.mirbase.org), provided by the
University of Manchester (previously provided by the Sanger
Institute). The miRBase registry provides the nucleotide sequences
of all published animal, plant and viral microRNAs (Griffiths-Jones
et al., Nucleic Acids Res. 36:D154-D158, 2008). Provided by miRBase
are the sequences of precursor microRNAs (stem-loop miRNAs), mature
miRNAs and minor microRNA species (miR*). Precursor miRNAs
predominantly express one species of miRNA, referred to as the
mature miRNA. However, minor miRNA sequences have also been
detected and are referred to as miR*.
[0098] miR-17-92 gene cluster: Refers to the miR-17-92 transcript
encoded by mouse chromosome 14 and human chromosome 13, or any
homologous miR transcript in another species. The miR-17-92
transcript is the precursor for seven mature miRs: miR-17-5p,
miR-17-3p, miR-18a, miR-19a, miR-20, miR-19b and miR-92. This miR
cluster is homologous to the miR-106a cluster on the X chromosome
and the miR-106-b-25 cluster on chromosome 5. In total, these three
clusters contain 15 miR stem-loops, giving rise to 14 distinct
mature miRs that fall into 5 miR families. Each member of these
families has the identical seed region (the region of the miR that
is important for binding to the 3'UTR of a target mRNA). As used
herein, miR-17-92, miR-17-5p, miR-17-3p, miR-18a, miR-19a, miR-20,
miR-19b and miR-92 refer to the respective miRs from any species
that encodes these miRs. In some embodiments, the miR is a human
miR. In other embodiments, the miR is a mouse miR. Exemplary miR
sequences can be obtained from miRBase. In particular examples, the
precursor and mature forms of human (hsa-) and mouse (mmu-)
miR-17-5p, miR-17-3p, miR-18a, miR-19a, miR-20, miR-19b and miR-92
are set forth as SEQ ID NOs: 1-26, as listed below (miRBase
accession numbers are listed next to the name of each miR):
TABLE-US-00001 hsa-mir-17 precursor, MI0000071 (SEQ ID NO: 1)
GUCAGAAUAAUGUCAAAGUGCUUACAGUGCAGGUAGUGAUAUGUGCAUC
UACUGCAGUGAAGGCACUUGUAGCAUUAUGGUGAC hsa-miR-17 (hsa-miR-17-5p),
MIMAT0000070 (SEQ ID NO: 2) CAAAGUGCUUACAGUGCAGGUAG hsa-miR-17*
(hsa-miR-17-3p), MIMAT0000071 (SEQ ID NO: 3) ACUGCAGUGAAGGCACUUGUAG
mmu-mir-17 precursor, MI0000687 (SEQ ID NO: 4)
GUCAGAAUAAUGUCAAAGUGCUUACAGUGCAGGUAGUGAUGUGUGCAUC
UACUGCAGUGAGGGCACUUGUAGCAUUAUGCUGAC mmu-miR-17 (mmu-miR-17-5p),
MIMAT0000649 (SEQ ID NO: 5) CAAAGUGCUUACAGUGCAGGUAG mmu-miR-17*
(mmu-miR-17-3p), MIMAT0000650 (SEQ ID NO: 6) ACUGCAGUGAGGGCACUUGUAG
hsa-mir-18a precursor, MI0000072 (SEQ ID NO: 7)
UGUUCUAAGGUGCAUCUAGUGCAGAUAGUGAAGUAGAUUAGCAUCUACU
GCCCUAAGUGCUCCUUCUGGCA hsa-miR-18a, MIMAT0000072 (SEQ ID NO: 8)
UAAGGUGCAUCUAGUGCAGAUAG mmu-mir-18a precursor, MI0000567 (SEQ ID
NO: 9) UGCGUGCUUUUUGUUCUAAGGUGCAUCUAGUGCAGAUAGUGAAGUAGAC
UAGCAUCUACUGCCCUAAGUGCUCCUUCUGGCAUAAGAAGUUAUGUC mmu-miR-18a,
MIMAT0000528 (SEQ ID NO: 10) UAAGGUGCAUCUAGUGCAGAUAG hsa-mir-19a
precursor, MI0000073 (SEQ ID NO: 11)
GCAGUCCUCUGUUAGUUUUGCAUAGUUGCACUACAAGAAGAAUGUAGUU
GUGCAAAUCUAUGCAAAACUGAUGGUGGCCUGC hsa-miR-19a, MIMAT0000073 (SEQ ID
NO: 12) UGUGCAAAUCUAUGCAAAACUGA mmu-mir-19a precursor, MI0000688
(SEQ ID NO: 13) GCAGCCCUCUGUUAGUUUUGCAUAGUUGCACUACAAGAAGAAUGUAGUU
GUGCAAAUCUAUGCAAAACUGAUGGUGGCCUGC mmu-miR-19a, MIMAT0000651 (SEQ ID
NO: 14) UGUGCAAAUCUAUGCAAAACUGA hsa-mir-20a precursor, MI0000076
(SEQ ID NO: 15) GUAGCACUAAAGUGCUUAUAGUGCAGGUAGUGUUUAGUUAUCUACUGCA
UUAUGAGCACUUAAAGUACUGC hsa-miR-20a, MIMAT0000075 (SEQ ID NO: 16)
UAAAGUGCUUAUAGUGCAGGUAG mmu-mir-20a precursor, MI0000568 (SEQ ID
NO: 17) GUGUGAUGUGACAGCUUCUGUAGCACUAAAGUGCUUAUAGUGCAGGUAG
UGUGUAGCCAUCUACUGCAUUACGAGCACUUAAAGUACUGCCAGCUGUA GAACUCCAG
mmu-miR-20a, MIMAT0000529 (SEQ ID NO: 18) UAAAGUGCUUAUAGUGCAGGUAG
hsa-mir-19b-1 precursor, MI0000074 (SEQ ID NO: 19)
CACUGUUCUAUGGUUAGUUUUGCAGGUUUGCAUCCAGCUGUGUGAUAUU
CUGCUGUGCAAAUCCAUGCAAAACUGACUGUGGUAGUG hsa-miR-19b, MIMAT0000074
(SEQ ID NO: 20) UGUGCAAAUCCAUGCAAAACUGA mmu-mir-19b-1 precursor,
MI0000718 (SEQ ID NO: 21)
CACUGGUCUAUGGUUAGUUUUGCAGGUUUGCAUCCAGCUGUAUAAUAUU
CUGCUGUGCAAAUCCAUGCAAAACUGACUGUGGUGGUG mmu-miR-19b, MIMAT0000513
(SEQ ID NO: 22) UGUGCAAAUCCAUGCAAAACUGA hsa-mir-92a-1 precursor,
MI0000093 (SEQ ID NO: 23)
CUUUCUACACAGGUUGGGAUCGGUUGCAAUGCUGUGUUUCUGUAUGGUA
UUGCACUUGUCCCGGCCUGUUGAGUUUGG hsa-miR-92a, MIMAT0000092 (SEQ ID NO:
24) UAUUGCACUUGUCCCGGCCUGU mmu-mir-92a-1 precursor, MI0000719 (SEQ
ID NO: 25) CUUUCUACACAGGUUGGGAUUUGUCGCAAUGCUGUGUUUCUCUGUAUGG
UAUUGCACUUGUCCCGGCCUGUUGAGUUUGG mmu-miR-92a, MIMAT0000539 (SEQ ID
NO: 26) UAUUGCACUUGUCCCGGCCUG
[0099] Open reading frame (ORF): A series of nucleotide triplets
(codons) coding for amino acids without any internal termination
codons. These sequences are usually translatable into a
peptide.
[0100] Operably linked: A first nucleic acid sequence is operably
linked with a second nucleic acid sequence when the first nucleic
acid sequence is placed in a functional relationship with the
second nucleic acid sequence. For instance, a promoter is operably
linked to a coding sequence if the promoter affects the
transcription or expression of the coding sequence. Generally,
operably linked DNA sequences are contiguous and, where necessary
to join two protein-coding regions, in the same reading frame.
[0101] Patient: As used herein, the term "patient" includes human
and non-human animals. The preferred patient for treatment is a
human. "Patient" and "subject" are used interchangeably herein.
[0102] Pharmaceutically acceptable vehicles: The pharmaceutically
acceptable carriers (vehicles) useful in this disclosure are
conventional. Remington's Pharmaceutical Sciences, by E. W. Martin,
Mack Publishing Co., Easton, Pa., 15th Edition (1975), describes
compositions and formulations suitable for pharmaceutical delivery
of one or more therapeutic compounds, molecules or agents.
[0103] In general, the nature of the carrier will depend on the
particular mode of administration being employed. For instance,
parenteral formulations usually comprise injectable fluids that
include pharmaceutically and physiologically acceptable fluids such
as water, physiological saline, balanced salt solutions, aqueous
dextrose, glycerol or the like as a vehicle. For solid compositions
(for example, powder, pill, tablet, or capsule forms), conventional
non-toxic solid carriers can include, for example, pharmaceutical
grades of mannitol, lactose, starch, or magnesium stearate. In
addition to biologically-neutral carriers, pharmaceutical
compositions to be administered can contain minor amounts of
non-toxic auxiliary substances, such as wetting or emulsifying
agents, preservatives, and pH buffering agents and the like, for
example sodium acetate or sorbitan monolaurate.
[0104] Preventing, treating or ameliorating a disease: "Preventing"
a disease refers to inhibiting the full development of a disease.
"Treating" refers to a therapeutic intervention that ameliorates a
sign or symptom of a disease or pathological condition after it has
begun to develop. "Ameliorating" refers to the reduction in the
number or severity of signs or symptoms of a disease.
[0105] Promoter: A promoter is an array of nucleic acid control
sequences that directs transcription of a nucleic acid. A promoter
includes necessary nucleic acid sequences near the start site of
transcription, such as in the case of a polymerase II type promoter
(a TATA element). A promoter also optionally includes distal
enhancer or repressor elements which can be located as much as
several thousand base pairs from the start site of transcription.
Both constitutive and inducible promoters are included (see e.g.,
Bitter et al., Methods in Enzymology 153:516-544, 1987).
[0106] Sequence identity/similarity: The identity/similarity
between two or more nucleic acid sequences, or two or more amino
acid sequences, is expressed in terms of the identity or similarity
between the sequences. Sequence identity can be measured in terms
of percentage identity; the higher the percentage, the more
identical the sequences are. Sequence similarity can be measured in
terms of percentage similarity (which takes into account
conservative amino acid substitutions); the higher the percentage,
the more similar the sequences are. Homologs or orthologs of
nucleic acid or amino acid sequences possess a relatively high
degree of sequence identity/similarity when aligned using standard
methods. This homology is more significant when the orthologous
proteins or cDNAs are derived from species which are more closely
related (such as human and mouse sequences), compared to species
more distantly related (such as human and C. elegans
sequences).
[0107] Methods of alignment of sequences for comparison are well
known in the art. Various programs and alignment algorithms are
described in: Smith & Waterman, Adv. Appl. Math. 2:482, 1981;
Needleman & Wunsch, J. Mol. Biol. 48:443, 1970; Pearson &
Lipman, Proc. Natl. Acad. Sci. USA 85:2444, 1988; Higgins &
Sharp, Gene, 73:237-44, 1988; Higgins & Sharp, CABIOS 5:151-3,
1989; Corpet et al., Nuc. Acids Res. 16:10881-90, 1988; Huang et
al. Computer Appls. in the Biosciences 8, 155-65, 1992; and Pearson
et al., Meth. Mol. Bio. 24:307-31, 1994. Altschul et al., J. Mol.
Biol. 215:403-10, 1990, presents a detailed consideration of
sequence alignment methods and homology calculations.
[0108] The NCBI Basic Local Alignment Search Tool (BLAST) (Altschul
et al., J. Mol. Biol. 215:403-10, 1990) is available from several
sources, including the National Center for Biological Information
(NCBI) and on the internet, for use in connection with the sequence
analysis programs blastp, blastn, blastx, tblastn and tblastx.
Additional information can be found at the NCBI web site.
[0109] Subject: Living multi-cellular vertebrate organisms, a
category that includes human and non-human mammals.
[0110] T Cell: A white blood cell critical to the immune response.
T cells include, but are not limited to, CD4.sup.+ T cells and
CD8.sup.+ T cells. A CD4.sup.+ T lymphocyte is an immune cell that
carries a marker on its surface known as "cluster of
differentiation 4" (CD4). These cells, also known as helper T
cells, help orchestrate the immune response, including antibody
responses as well as killer T cell responses. CD8.sup.+ T cells
carry the "cluster of differentiation 8" (CD8) marker. In some
embodiments, a CD8+ T cell is a cytotoxic T lymphocyte (CTL).
[0111] Th1-associated miR: Refers to any miR that is preferentially
expressed in Th1 versus Th2 cells and/or promotes the Th1 phenotype
when expressed (or over-expressed) in T cells. In some embodiments
herein, the Th1-associated miR is the miR-17-92 gene cluster, or a
portion thereof. In some embodiments, the Th1-associated miR is any
one of the miR's listed in FIG. 1C. In other embodiments, the
Th1-associated miR is miR-155 or miR-181a.
[0112] Therapeutically effective amount: A quantity of a specified
composition, pharmaceutical or therapeutic agent sufficient to
achieve a desired effect in a subject, or in a cell, being treated
with the agent. The effective amount of the agent will be dependent
on several factors, including, but not limited to the subject being
treated, the disease or condition being treated, and the manner of
administration of the therapeutic composition.
[0113] Transduce, Transform, or Transfect: To introduce a nucleic
acid molecule into a cell, such as a vector encoding a miR. These
terms encompass all techniques by which a nucleic acid molecule can
be introduced into a cell, including but not limited to,
transduction with viral vectors, transfection with plasmid vectors,
and introduction of naked DNA by electroporation and particle gun
acceleration. A transfected or transformed cell is a cell into
which has been introduced a nucleic acid molecule by molecular
biology techniques, such as a transformed T cell that includes a
recombinant promoter operably linked to a reporter nucleic acid
molecule. In some examples, the nucleic acid molecule becomes
stably replicated by the cell, for example by incorporation of the
nucleic acid molecule into the cellular genome, or by episomal
replication. In other examples, the nucleic acid molecule is
transiently expressed in the cell.
[0114] Tumor or cancer antigen: A cancer or tumor antigen is an
antigen that can stimulate tumor-specific T-cell immune responses.
Exemplary tumor antigens include, but are not limited to, RAGE-1,
tyrosinase, MAGE-1, MAGE-2, NY-ESO-1, Melan-A/MART-1, glycoprotein
(gp) 75, gp100, beta-catenin, PRAME, MUM-1, WT-1, CEA, and PR-1.
Additional tumor antigens are known in the art (for example see
Novellino et al., Cancer Immunol. Immunother. 54(3):187-207, 2005)
and are described below.
[0115] Tumor, cancer, neoplasia and malignancy: A neoplasm is an
abnormal growth of tissue or cells that results from excessive cell
division. Neoplastic growth can produce a tumor. The amount of a
tumor in an individual is the "tumor burden" which can be measured
as the number, volume, or weight of the tumor. A tumor that does
not metastasize is referred to as "benign." A tumor that invades
the surrounding tissue and/or can metastasize is referred to as
"malignant." Malignant tumors are also referred to as "cancer."
[0116] Hematologic cancers are cancers of the blood or bone marrow.
Examples of hematological (or hematogenous) cancers include
leukemias, including acute leukemias (such as acute lymphocytic
leukemia, acute myelocytic leukemia, acute myelogenous leukemia and
myeloblastic, promyelocytic, myelomonocytic, monocytic and
erythroleukemia), chronic leukemias (such as chronic myelocytic
(granulocytic) leukemia, chronic myelogenous leukemia, and chronic
lymphocytic leukemia), polycythemia vera, lymphoma, Hodgkin's
disease, non-Hodgkin's lymphoma (indolent and high grade forms),
multiple myeloma, Waldenstrom's macroglobulinemia, heavy chain
disease, myelodysplastic syndrome, hairy cell leukemia and
myelodysplasia. In some cases, lymphomas are considered solid
tumors.
[0117] Solid tumors are abnormal masses of tissue that usually do
not contain cysts or liquid areas. Solid tumors can be benign or
malignant. Different types of solid tumors are named for the type
of cells that form them (such as sarcomas, carcinomas, and
lymphomas). Examples of solid tumors, such as sarcomas and
carcinomas, include fibrosarcoma, myxosarcoma, liposarcoma,
chondrosarcoma, osteosarcoma, and other sarcomas, synovioma,
mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma,
colon carcinoma, lymphoid malignancy, pancreatic cancer, breast
cancer, lung cancers, ovarian cancer, prostate cancer,
hepatocellular carcinoma, squamous cell carcinoma, basal cell
carcinoma, adenocarcinoma, sweat gland carcinoma, medullary thyroid
carcinoma, papillary thyroid carcinoma, pheochromocytomas sebaceous
gland carcinoma, papillary carcinoma, papillary adenocarcinomas,
medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma,
hepatoma, bile duct carcinoma, choriocarcinoma, Wilms' tumor,
cervical cancer, testicular tumor, seminoma, bladder carcinoma,
melanoma, and CNS tumors (such as a glioma (such as brainstem
glioma and mixed gliomas), glioblastoma (also known as glioblastoma
multiforme) astrocytoma, CNS lymphoma, germinoma, medulloblastoma,
Schwannoma craniopharyogioma, ependymoma, pinealoma,
hemangioblastoma, acoustic neuroma, oligodendroglioma, menangioma,
neuroblastoma, retinoblastoma and brain metastasis).
[0118] Vector: A vector is a nucleic acid molecule allowing
insertion of foreign nucleic acid without disrupting the ability of
the vector to replicate and/or integrate in a host cell. A vector
can include nucleic acid sequences that permit it to replicate in a
host cell, such as an origin of replication. A vector can also
include one or more selectable marker genes and other genetic
elements. An expression vector is a vector that contains the
necessary regulatory sequences to allow transcription and
translation of inserted gene or genes. In some embodiments herein,
the vector is a plasmid vector. In other embodiments, the vector is
a viral vector. In some examples, the viral vector is a lentiviral
vector.
[0119] Unless otherwise explained, all technical and scientific
terms used herein have the same meaning as commonly understood by
one of ordinary skill in the art to which this disclosure belongs.
The singular terms "a," "an," and "the" include plural referents
unless context clearly indicates otherwise. Similarly, the word
"or" is intended to include "and" unless the context clearly
indicates otherwise. Hence "comprising A or B" means including A,
or B, or A and B. It is further to be understood that all base
sizes or amino acid sizes, and all molecular weight or molecular
mass values, given for nucleic acids or polypeptides are
approximate, and are provided for description. Although methods and
materials similar or equivalent to those described herein can be
used in the practice or testing of the present disclosure, suitable
methods and materials are described below. All publications, patent
applications, patents, and other references mentioned herein are
incorporated by reference in their entirety. In addition all
GenBank accession numbers and miRBase accession numbers are herein
incorporated by reference as they appear in the database on Jun.
17, 2010. In case of conflict, the present specification, including
explanations of terms, will control. In addition, the materials,
methods, and examples are illustrative only and not intended to be
limiting.
III. Overview of Several Embodiments
[0120] Disclosed herein is the identification of miRs
differentially regulated between type-1 and type-2 T cells.
MicroRNA microarray analyses was performed on in vitro
differentiated Th1 and Th2 cells to identify differentially
expressed miRs. The miR microarray analyses identified the
miR-17-92 cluster as one of the most significantly over-expressed
miRs in Th1 cells when compared with Th2 cells. A number of
additional miRs preferentially expressed in Th1 cells (referred to
herein as "Th1-associated miRs") are listed in FIG. 1C.
[0121] It is demonstrated herein that T cells from tumor bearing
mice and glioma patients have decreased levels of miR-17-92 when
compared with cells from non-tumor bearing counterparts. CD4.sup.+
T cells derived from miR-17-92 transgenic mice demonstrated
superior type-1 phenotype with increased IFN-.gamma. production and
VLA-4 expression when compared with counterparts derived from wild
type mice. In addition, T cells ectopically expressing increased
levels of miR-17-92 cluster members demonstrated increased IL-2
production and resistance to AICD. It is further demonstrated that
miR-17-92 transgenic mice (which over-express miR-17-92 in T cells)
exhibit significantly smaller tumors and/or greater length of
survival following tumor challenge with either B16 melanoma cells
or GL261 glioma cells. Thus, genetic engineering of T cells to
express miR-17-92, or other Th1-associated miRs, is contemplated
herein as new approach for cancer immunotherapy.
[0122] Provided is an isolated T cell comprising a heterologous
nucleic acid molecule encoding at least one, at least two, at least
three, at least four, at least five, at least six or at least seven
Th1-associated miRs. In some embodiments, the heterologous nucleic
acid molecule encodes the miR-17-92 transcript, or a portion
thereof. In particular embodiments, the portion of the miR-17-92
transcript comprises the coding sequence for miR-17-5p, miR-17-3p,
miR-18a, miR19a, miR-20a, miR19b-1 or miR-92a-1, or any combination
of thereof. In specific examples, the portion comprises or consists
of the coding sequence for (i) miR-17-5p, miR-17-3p, miR-18a and
miR19a; (ii) miR-20a, miR19b-1 and miR-92a-1; or (iii) miR-17-5p
and miR-17-3p.
[0123] In some embodiments, the Th1-associated miR is selected from
miR-142-3p, miR-92, miR-20a, miR-106a, miR-30c, miR-19a, miR-20b,
let-7g, miR-19b, miR-17-5p, miR-195, miR-93, miR-26a, miR-93,
let-7i, miR-21, let-7f, let-7c, miR-106b, miR-98, miR-155 and
miR-181a.
[0124] In some embodiments, the heterologous nucleic acid molecule
comprises a vector. The vector can be any vector suitable for
transfection or transduction of T cells. Such vectors have been
well described in the art and are well known to those of skill. In
some embodiments, the vector is a plasmid vector. In other
embodiments, the vector is a viral vector. In some examples, the
viral vector is a lentiviral vector.
[0125] In some embodiments, the isolated T cell is a tumor antigen
(TA)-specific T cell, such as a cytotoxic T lymphocyte (CTL).
Methods of isolating and/or producing TA-specific T cells are known
in the art and are described in further detail in the sections
below. Any method capable of isolating or generating sufficient
numbers of TA-specific T cells for cancer immunotherapy is
contemplated for use with the compositions and methods disclosed
herein. In some embodiments, the T cell is engineered to express a
molecule (such as a chimeric antigen receptor, antibody or fragment
thereof) that specifically binds a tumor antigen. In some
embodiments, the TA-specific T cell is generated by culturing the T
cells ex vivo in the presence of antigen presenting cells
expressing the tumor antigen. In other embodiments, the TA-specific
T cells are TA-specific T cells isolated from a subject (such as
tumor-infiltrating T cells).
[0126] In some embodiments, the TA is a glioma-associated antigen.
However, any TA can be selected. The selection of TA is at least in
part dependent on the type of cancer that is to be treated by
administration of the TA-specific T cell expressing the
Th1-associated miR.
[0127] Further provided are compositions comprising a
pharmaceutically acceptable carrier and an isolated T cell
transfected with a heterologous nucleic acid molecule encoding a
Th1-associated miR, such as one or more of the miRs of the miR17-92
gene cluster. In some embodiments, the T cell is an TA-specific T
cell, such as a TA-specific CTL.
[0128] Also provided is a method of treating a subject with cancer
by (i) selecting a subject with cancer; and (ii) administering to
the subject an isolated T cell transfected with a heterologous
nucleic acid molecule encoding a Th1-associated miR, such as one or
more of the miRs of the miR17-92 gene cluster, thereby treating the
subject with cancer.
[0129] In some embodiments of the method, the isolated T cell
comprises a heterologous nucleic acid molecule encoding a portion
of the miR-17-92 transcript, wherein the portion of the miR-17-92
transcript comprises the coding sequence for miR-17-5p, miR-17-3p,
miR-18a, miR19a, miR-20a, miR19b-1 or miR-92a-1, or any combination
of 1, 2, 3, 4, 5, 6, or 7 miRs thereof. In specific examples, the
portion comprises or consists of the coding sequence for (i)
miR-17-5p, miR-17-3p, miR-18a and miR19a; (ii) miR-20a, miR19b-1
and miR-92a-1; or (iii) miR-17-5p and miR-17-3p. In some
embodiments, the Th1-associated miR is selected from miR-142-3p,
miR-92, miR-20a, miR-106a, miR-30c, miR-19a, miR-20b, let-7g,
miR-19b, miR-17-5p, miR-195, miR-93, miR-26a, miR-93, let-7i,
miR-21, let-7f, let-7c, miR-106b, miR-98, miR-155 and miR-181a.
[0130] In some embodiments, the heterologous nucleic acid molecule
comprises a vector, such as a plasmid vector, or a viral vector
(for example, a lentiviral vector). In some embodiments, the T cell
administered to the subject is a TA-specific CTL. The subject can
have any type of cancer for which a TA is specifically expressed by
the tumor cells (and is either not expressed by normal cells or is
expressed at significantly reduced levels compared to tumor cells).
In some embodiments, the subject has a glioma and the TA is a
glioma-associated antigen.
[0131] Further provided is a method of treating a subject with
cancer by (i) selecting a subject with cancer; (ii) isolating T
cells from the subject; (iii) transfecting the isolated T cells
with a heterologous nucleic acid molecule encoding at least one, at
least two, at least three, at least four, at least five, at least
six or at least seven Th1-associated miRs; and (iv) administering
to the subject the isolated T cells transfected with the
Th1-associated miR or miRs, thereby treating the subject with
cancer. In some embodiments of the method, the Th1-associated miR
is the miR-17-92 transcript, or a portion thereof. In some
examples, the portion comprises the coding sequence for miR-17-5p,
miR-17-3p, miR-18a, miR19a, miR-20a, miR19b-1 or miR-92a-1, or any
combination of 1, 2, 3, 4, 5, 6 or 7 miRs thereof. In some
embodiments, the Th1-associated miR is selected from miR-142-3p,
miR-92, miR-20a, miR-106a, miR-30c, miR-19a, miR-20b, let-7g,
miR-19b, miR-17-5p, miR-195, miR-93, miR-26a, miR-93, let-7i,
miR-21, let-7f, let-7c, miR-106b, miR-98, miR-155 and miR-181a. In
some embodiments, the heterologous nucleic acid molecule comprises
a vector, such as a plasmid vector, or a viral vector (for example,
a lentiviral vector). In some embodiments, the T cell administered
to the subject is a TA-specific CTL. The subject can have any type
of cancer for which a TA is specifically expressed by the tumor
cells (and is either not expressed by normal cells or is expressed
at significantly reduced levels compared to tumor cells). In some
embodiments, the subject has a glioma and the TA is a
glioma-associated antigen.
[0132] In particular embodiments, the miR used is a miR from the
species being treated. In some examples, the miR is a human miR,
such as hsa-miR-17-5p, hsa-miR-17-3p, hsa-miR-18a, hsa-miR-19a,
hsa-miR-20a, hsa-miR-19b, hsa-miR-92. In other examples, the miR is
a mouse miR, such as mmu-miR-17-5p, mmu-miR-17-3p, mmu-miR-18a,
mmu-miR-19a, mmu-miR-20a, mmu-miR-19b, mmu-miR-92. In particular
examples, the human or mouse miRs comprise or consist of one of the
sequences set forth in SEQ ID NO: 1 (precursor hsa-miR-17), SEQ ID
NO: 2 (hsa-miR-17-5p), SEQ ID NO: 3 (hsa-miR-17-3p), SEQ ID NO: 4
(precursor mmu-miR-17), SEQ ID NO: 5 (mmu-miR-17-5p), SEQ ID NO: 6
(mmu-miR-17-3p), SEQ ID NO: 7 (precursor hsa-miR-18a), SEQ ID NO: 8
(hsa-miR-18a), SEQ ID NO: 9 (precursor mmu-miR-18a), SEQ ID NO: 10
(mmu-miR-18a), SEQ ID NO: 11 (precursor hsa-miR-19a), SEQ ID NO: 12
(hsa-miR-19a), SEQ ID NO: 13 (precursor mmu-miR-19a), SEQ ID NO: 14
(mmu-miR-19a), SEQ ID NO: 15 (precursor hsa-miR-20a), SEQ ID NO: 16
(hsa-miR-20a), SEQ ID NO: 17 (precursor mmu-miR-20a), SEQ ID NO: 18
(mmu-miR-20a), SEQ ID NO: 19 (precursor hsa-miR-19b-1), SEQ ID NO:
20 (hsa-miR-19b), SEQ ID NO: 21 (precursor mmu-miR-19b-1), SEQ ID
NO: 22 (mmu-miR-19b), SEQ ID NO: 23 (precursor hsa-miR-92a-1), SEQ
ID NO: 24 (hsa-miR-92a), SEQ ID NO: 25 (precursor mmu-miR-92a-1),
SEQ ID NO: 26 (mmu-miR-92a). In some embodiments, the sequence of
the human or mouse miR is at least 85%, at least 90%, at least 95%,
or at least 99% identical to any one of the sequences set forth in
SEQ ID NOs: 1-26.
[0133] In some embodiments of the treatment methods provided
herein, the subject is further treated with a second (or
additional) anti-cancer agent, such as a chemotherapeutic agent. In
other embodiments, the subject is further treated with radiation
therapy. In other embodiments, the subject is further treated by
surgical removal of the tumor, or a portion thereof. Suitable
combinations of treatments can be determined by a physician based
on the type and severity of cancer and general health of the
subject. Exemplary anti-cancer agents and treatment options are
discussed in greater detail below.
IV. Use of miRs for Tumor Immunotherapy
[0134] A. Selection of miRs
[0135] The studies disclosed herein were driven by an effort to
understand the potential roles of miRs in anti-tumor immunity.
Thus, miRs differentially expressed in Th1 and Th2 cells were
examined. FIG. 1C provides a list of miRs that exhibit a
significant difference in expression between Th1 and Th2 cells.
[0136] i. miR17-92 Cluster
[0137] The miR microarray and RT-PCR analyses disclosed herein
revealed that of all analyzed miRs, members of the miR-17-92
cluster (miR-17-92) are of the most significantly over-expressed
miRs in Th1 cells when compared with Th2 cells. The miR-17-92
transcript encoded by mouse chromosome 14 (and human chromosome 13)
is the precursor for 7 mature miRs (miR-17-5p, miR-17-3p, miR-18a,
miR-19a, miR-20a, miR-19b and miR-92) (Xiao et al., Nat Immunol
2008, 9:405-414; Xiao and Rajewsky, Cell 2009, 136:26-36). This
cluster is also homologous to the miR-106a-363 cluster on the X
chromosome and the miR-106b-25 cluster on chromosome 5. Together,
these three clusters contain 15 miR stem-loops, giving rise to 14
distinct mature miRs that fall into 5 miR families. The members in
each family have identical seed regions. This genomic organization
is highly conserved in all vertebrates for which complete genome
sequences are available (Tanzer and Stadler, Journal of Molecular
Biology 2004, 339:327-335).
[0138] miRs in the miR-17-92 cluster are amplified in various tumor
types, including B cell lymphoma and lung cancer, and promote
proliferation and confer anti-apoptotic function in tumors, thereby
promoting tumor-progression (He et al., Nature 2005, 435:828-833;
Hayashita et al., Cancer Res 2005, 65:9628-9632; Matsubara et al.,
Oncogene 2007, 26:6099-6105; Lawrie, Expert Opin Biol Ther 2007,
7:1363-1374; Rinaldi et al., Leuk Lymphoma 2007, 48:410-412).
Knockout and transgenic studies of the miR-17-92 cluster in mice
have demonstrated the importance of this cluster in mammalian
biology (Xiao and Rajewsky, Cell 2009, 136:26-36). Transgenic mice
with miR-17-92 overexpressed in lymphocytes develop
lymphoproliferative disorder and autoimmunity but not cancer (Xiao
et al., Nat Immunol 2008, 9:405-414). These findings demonstrate a
critical role for miR-17-92 cluster in T cell biology.
[0139] It is demonstrated herein that miR-17-92 is up-regulated in
Th1 cells when compared with Th2 cells. IL-4 and STAT6 signaling
mediate the down-regulation of miR-17-92. Tumor-bearing host
conditions also suppress the miR-17-92 cluster expression in T
cells, which is associated with a loss in ability to produce
IFN-.gamma.. This led to the hypothesis that miR-17-92 cluster
overexpression would enhance type-1 responses. Indeed, it is
demonstrated herein that type-1 T cells derived from miR-17-92
transgenic mice have a more pronounced type 1 phenotype including
enhanced IFN-.gamma. production and increased VLA-4 expression when
compared with control type-1 T cells. These findings suggest that
miR-17-92 plays a critical role in type-1 adaptive immunity.
Accordingly, the use of miR-17-92 over-expression in T cells for
cancer immunotherapy is disclosed herein.
[0140] ii. miR-155
[0141] Human mir-155 resides in the non-coding BIC transcript,
located on chromosome 21 (Weber, FEBS J. 272:59-73, 2005). The
mature form differs from that in mouse at a single position.
miR-155 is processed from the BIC transcript in humans, and
exhibits elevated expression in lymphoma samples (Eis et al., Proc
Natl Acad Sci USA 102:3627-3632, 2005). Previous studies have shown
that miR-155 over-expression in hematopoietic cells induces
malignancy (Costinean et al., Proc Natl Acad Sci USA 103:7024-7029,
2006) or myeloproliferative disorder in mice and is associated with
human acute myeloid leukemia (O'Connell et al., J Exp Med
205:585-894, 2008). miR-155 also plays an important role in innate
and adaptive immune responses (Tili et al., Nat Clin Pract Rheum
4:534-4541, 2008; Xiao and Rajewsky, Cell 136: 26-36, 2009). It has
also been suggested that miR-155 is important for differentiation
of Th1 and Th2 cells. Disruption of miR-155 in naive T cells
results in polarized differentiation preferentially into Th2 cells,
with substantial production of Th2 cytokines (Rodriguez et al.,
Science 316:608-611, 2007; Thai et al., Science 316:604-608, 2007).
In addition, a recent study demonstrated that activation of T cells
up-regulates miR-155 and over-expression of miR-155 in activated
CD4+ T cells promotes Th1 differentiation through the regulation of
IFN-.gamma.R.alpha. chain (Banerjee et al., Eur J Immunol
40:225-231, 2010; Okada et al., Int J Biochem Cell Biol, on-line
publication Feb. 6, 2010). Thus, miR-155 is contemplated herein as
a Th1-associated miR for use in cancer immunotherapy.
[0142] iii. miR-181a
[0143] Human miR-181a, cloned by Dostie et al. (RNA 9:180-186,
2003), is predicted to be expressed from two genomic hairpin loci,
hsa-mir-181a-1 and hsa-mir-181a-2. A miRNA from the 3' arm of this
hairpin, named miR-213, was predicted by computational methods
using conservation with mouse and Fugu rubripes sequences, and
validated in zebrafish (Lim et al., Science 299:1540, 2003).
Subsequent cloning and Northern evidence shows that the 3' mature
sequence is the biogenesis byproduct miR-181a*.
[0144] Previous studies have demonstrated that miR-181a augments
the sensitivity of TCR-mediated T cell responses to peptide
antigens. Regulation of T cell sensitivity by miR-181a enables
mature T cells to abnormally recognize antagonists, the inhibitor
peptide antisense, as agonists. In addition, miR-181a
over-expression amplifies the strength and sensitivity of
TCR-mediated activation (Li et al., Cell 129:147-161, 2007; Okada
et al., Int J Biochem Cell Biol, on-line publication Feb. 6, 2010).
Thus, miR-181a is contemplated herein as a Th1-associated miR for
use in cancer immunotherapy.
[0145] iv. Other Differentially Expressed Th1-Associated miRs
[0146] Any miR that exhibits significantly greater expression in
Th1 cells compared with Th2 cells is contemplated for use in the
disclosed compositions and methods. FIG. 1C provides an exemplary
list of such differentially expressed miRs. Th1-associated miRs
include, but are not limited to, miR-142-3p, miR-92, miR-20a,
miR-106a, miR-30c, miR-19a, miR-20b, let-7g, miR-19b, miR-17-5p,
miR-195, miR-93, miR-26a, miR-93, let-7i, miR-21, let-7f, let-7c,
miR-106b and miR-98.
[0147] B. Tumor Immunotherapy
[0148] T cell immune responses are classified into distinct
effector cell types based on their cytokine-secreting profiles.
Type-2 T cells include Th2 and cytotoxic T 2 (Tc2), which
preferentially secrete IL-4, IL-5, and IL-10, whereas type-1 T
cells (Th1 and Tc1) predominantly secrete IFN-.gamma.. The
inventors' prior work has demonstrated that tumor-specific Th1 and
Tc1, but not Th2 or Tc2, can efficiently traffic into CNS tumor
sites and mediate effective therapeutic efficacy via the type-1
chemokine CXCL10 and an integrin receptor VLA-4. Despite the
importance of the type-1 T cell response, cancers, including GBMs,
secrete numerous type-2 and regulatory T cell (Treg)-inducing
cytokines that promote tumor proliferation and immune escape. Thus,
the strategic skewing of existing type-2/Treg to type-1 immunity in
glioma patients (as well patients with other types of cancer) is
critical for the development of more effective immunotherapy. In
particular, the inventors propose it will be possible to generate
genetically modified tumor-specific T cells ex vivo that are
resistant to tumor-mediated immune suppression and possess robust
anti-tumor type-1 functions. As disclosed herein, miR-17-92, when
expressed in TA-specific T cells, has the potential to confer
resistance to tumor-derived immunosuppressive factors and to
improve type-1 reactivity in adoptively transferred T cells.
[0149] Although the effective expansion of tumor-reactive T cells
by vaccination or in vitro expansion relies on the presence of
sufficient TA-specific T cell precursors, the number and the
avidity of self-reactive (i.e., TA-specific) T cells are typically
low after the negative selection. Other barriers to develop
effective immunotherapy for cancer include the poor persistence of
TA-reactive T cells in cancer-bearing hosts. Thus, effective
immunotherapy should employ strategies to improve the expansion of
TA-specific T cells with the improved persistence and sensitivity
to recognize TAs. As discussed herein, it is hypothesized that
miR-17-92 has unique biological properties to overcome each of
these challenges when effectively expressed in TA-specific T
cells.
[0150] Any tumor type against which tumor antigen-specific CTLs are
or can be generated is contemplated as a potential target of
Th1-associated miR-transfected T cell immunotherapy. In some
embodiments, the tumor is a CNS tumor. The CNS provides tumors an
"immunologically privileged" status. A number of cellular and
molecular mechanisms underlying the unique immuno-suppression of
the CNS tumors have been delineated. These challenges underscore
the need to develop new therapies to augment the host immune
response to malignant gliomas. In the course of such work, however,
it has become clear that this "privileged" status is not absolute.
As demonstrated in cases of paraneoplastic cerebellar degeneration
and experimental allergic encephalomyelitis, which resembles the
pathology of multiple sclerosis, exposure of CNS-derived T cell
antigens to the systemic immune system can induce specific T cell
responses that recognize and attack immune targets located in the
CNS. The presence of lymphocytes within the tumor can be a positive
prognostic indicator of survival for patients with malignant
gliomas. However, such naturally existing T cell response is not
potent enough to mediate regression of gliomas.
[0151] Malignant gliomas are the most common type of primary brain
tumor and a significant public health problem, with more than
12,000 new cases diagnosed each year in the United States.
Glioblastoma multiforme (GBM) is by far the most common and most
malignant of the glial tumors. Other common malignant gliomas
include anaplastic gliomas, including anaplastic astrocytomas (AA).
Patients with GBM or AA have a median survival of approximately 15
months, or 24 to 36 months, respectively. In addition, low-grade
gliomas often progress to more malignant gliomas when they recur.
No current treatment is curative because these tumors grow
aggressively and invasively in the CNS. No significant advancements
in the treatment of GBM have occurred in the past 25 years except
for chemotherapy with temozolomide (TMZ) combined with
radiotherapy, which demonstrated a limited prolongation of
survival. The efficacy and safety of novel anti-angiogenic agents
and a variety of targeted kinase inhibitors are controversial, and
these concerns call for the strong need to develop novel
efficacious and safe therapeutic modalities for these tumors.
[0152] Currently, a major challenge for immunotherapy of
progressive malignant glioma is systemic suppression of immunity
due to chemo-/radiotherapy, and tumor-elaboration of
immunosuppressive substances, such as TGF-.beta. and IL-10, which
are known to suppress proliferation of T cells. While active
immunization with glioma-associated antigen epitopes relies on
intact host-immune reactivity, recent studies in melanoma patients
demonstrated that passive immunization via intravenous adoptive
transfer of tumor-reactive, ex vivo activated T cells may instead
take advantage of conditions induced by preceding non-myeloablative
but lympho-depleting chemotherapy regimens. This strategy may be
particularly suitable for patients with malignant gliomas since the
clinical use of chemotherapeutic agents is rapidly becoming a part
of standard care in these patients.
[0153] Thus, the idea to generate genetically-modified
tumor-specific T cells ex vivo, which are resistant to
tumor-mediated immune suppression and possess the robust anti-tumor
responses, as a means to elicit potent anti-tumor immune responses,
is disclosed herein.
[0154] Although the treatment of glioma is exemplified herein, any
type of cancer can be treated using the disclosed compositions and
methods. Both hematological and solid cancers can be treated. Thus,
in some embodiments, the hematological (or hematogenous) cancer is
a leukemia, such as an acute leukemia (e.g., acute lymphocytic
leukemia, acute myelocytic leukemia, acute myelogenous leukemia or
myeloblastic, promyelocytic, myelomonocytic, monocytic or
erythroleukemia), a chronic leukemia (such as chronic myelocytic
(granulocytic) leukemia, chronic myelogenous leukemia, or chronic
lymphocytic leukemia), polycythemia vera, lymphoma, Hodgkin's
disease, non-Hodgkin's lymphoma (indolent or high grade forms),
multiple myeloma, Waldenstrom's macroglobulinemia, heavy chain
disease, myelodysplastic syndrome, hairy cell leukemia or
myelodysplasia. In some cases, lymphomas are considered solid
tumors.
[0155] In some embodiments, the cancer is a solid tumor. Solid
tumors can be benign or malignant. Examples of solid tumors, such
as sarcomas and carcinomas, include fibrosarcoma, myxosarcoma,
liposarcoma, chondrosarcoma, osteosarcoma, and other sarcomas,
synovioma, mesothelioma, Ewing's tumor, leiomyosarcoma,
rhabdomyosarcoma, colon carcinoma, lymphoid malignancy, pancreatic
cancer, breast cancer, lung cancers, ovarian cancer, prostate
cancer, hepatocellular carcinoma, squamous cell carcinoma, basal
cell carcinoma, adenocarcinoma, sweat gland carcinoma, medullary
thyroid carcinoma, papillary thyroid carcinoma, pheochromocytomas
sebaceous gland carcinoma, papillary carcinoma, papillary
adenocarcinomas, medullary carcinoma, bronchogenic carcinoma, renal
cell carcinoma, hepatoma, bile duct carcinoma, choriocarcinoma,
Wilms' tumor, cervical cancer, testicular tumor, seminoma, bladder
carcinoma, melanoma, and CNS tumors (such as a glioma (such as
brainstem glioma and mixed gliomas), glioblastoma (also known as
glioblastoma multiforme) astrocytoma, CNS lymphoma, germinoma,
medulloblastoma, Schwannoma craniopharyogioma, ependymoma,
pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma,
menangioma, neuroblastoma, retinoblastoma and brain
metastasis).
V. Transduction of T Cells with Th1-Associated miRs and Adoptive
Transfer Thereof
[0156] Methods are disclosed herein for the treatment of a subject
with cancer, such as a subject with a CNS tumor (for example,
glioblastoma). The methods include the administration of a
therapeutically effective amount of cytotoxic T lymphocytes (CTLs)
over-expressing a Th1-associated miR (such as the miR-17-92 gene
cluster or a portion thereof). In some embodiments, the CTLs are
specific for an antigen of interest, such as a tumor antigen
(TA-specific CTLs). By purifying and/or generating a purified
population of selected TA-specific T cells from a subject ex vivo,
transfecting the TA-specific CTLs with a heterologous nucleic acid
encoding a Th1-associated miR (such as miR17-92) and introducing a
therapeutic amount of these cells to the subject, the immune
response of the recipient is enhanced, thereby treating the subject
with cancer.
[0157] In some embodiments of the methods disclosed herein, the
isolated T cells transfected with a Th1-associated miR were
isolated from the subject to be treated (autologous T cells). In
some examples, the autologous T cells are TA-specific CTLs. For
example, TA-specific T cells can be isolated from the tumor of a
subject (referred to as tumor-infiltrating T lymphocytes). In other
examples, T cells can be isolated from a subject (such as from the
blood) and subjected to particular ex vivo culture conditions to
produce a population of TA-specific CTLs. In yet other examples, T
cells can be isolated from the subject to be treated and then
engineered to express chimeric antigen receptors that specifically
bind a tumor antigen.
[0158] Methods of isolating T cells are routine in the art. For
example, blood cells (such as PBMCs) can be obtained from the
subject, such as by using leukapheresis. If desired, non-T cell
subpopulations (such as dendritic cells) can be depleted from the
PBMCs prior to introducing nucleic acid molecules encoding a
selected miR, such as miR-17-92. The isolated cells can be
cryopreserved until needed.
[0159] In some embodiments, the T cells isolated from a subject are
engineered to express a chimeric antigen receptor. Methods of
engineering T cells to express chimeric antigen receptors have been
described and are well known to those of skill in the art (see, for
example, PCT Publication Nos. WO 2005/02383; WO 2006/060878;
WO2010/025177 and WO 2009/126789; and U.S. Pat. No. 6,410,319, each
of which is herein incorporated by reference). The engineered T
cells are further transfected with a vector encoding a
Th1-associated miR (such as the miR-17-92 gene cluster, or a
portion thereof). A therapeutically effective amount of the
antigen-specific engineered T cells transfected with the
Th1-associated miR is administered to the recipient, thereby
producing an immune response to the antigen of interest in the
recipient.
[0160] In one example disclosed herein, the method includes
isolating T cells from the subject to be treated and contacting the
isolated T cells with a population of antigen presenting cells
(APCs) from the subject that are presenting an antigen of interest,
thereby producing a population of isolated T cells that recognize
an antigen of interest. The population of activated T cells is
transfected with a vector encoding a Th1-associated miR (such as
the miR-17-92 gene cluster, or a portion thereof). A
therapeutically effective amount of the TA-specific T cells
transfected with the Th1-associated miR is administered to the
subject, producing an immune response to the antigen of interest in
the subject, thereby treating the subject with cancer.
[0161] To increase the number of antigen-specific T cells,
proliferation of the cells can be stimulated, for example by
incubation in the presence of a cytokine, such as IL-2, IL-7, IL-12
and IL-15. The amount of cytokine added is sufficient to stimulate
production and proliferation of T cells, and can be determined
using routine methods. In some examples, the amount of IL-2, IL-7,
IL-12, or IL-15 added is about 0.1-100 IU/mL, such as at least 1
IU/mL, at least 10 IU/mL, or at least 20 IU/mL.
[0162] Tumor antigens are proteins that are produced by tumor cells
that elicit an immune response, particularly T-cell mediated immune
responses. The isolated T cells can be specific for any tumor
antigen. The selection of tumor antigen will depend on the
particular type of cancer to be treated. Tumor antigens are well
known in the art and include, for example, a glioma-associated
antigen, carcinoembryonic antigen (CEA), .beta.-human chorionic
gonadotropin, alphafetoprotein (AFP), lectin-reactive AFP,
thyroglobulin, RAGE-1, MN-CA IX, human telomerase reverse
transcriptase, RU1, RU2 (AS), intestinal carboxyl esterase, mut
hsp70-2, M-CSF, prostase, prostate-specific antigen (PSA), PAP,
NY-ESO-1, LAGE-1a, p53, prostein, PSMA, Her2/neu, survivin and
telomerase, prostate-carcinoma tumor antigen-1 (PCTA-1), MAGE,
ELF2M, neutrophil elastase, ephrinB2, CD22, insulin growth factor
(IGF)-I, IGF-II, IGF-I receptor and mesothelin. A list of exemplary
tumor antigens and their associated tumors are shown below in Table
1.
TABLE-US-00002 TABLE 1 Exemplary tumors and their tumor antigens
Tumor Tumor Associated Target Antigens Acute myelogenous leukemia
Wilms tumor 1 (WT1), preferentially expressed antigen of melanoma
(PRAME), PR1, proteinase 3, elastase, cathepsin G Chronic
myelogenous leukemia WT1, PRAME, PR1, proteinase 3, elastase,
cathepsin G Myelodysplastic syndrome WT1, PRAME, PR1, proteinase 3,
elastase, cathepsin G Acute lymphoblastic leukemia PRAME Chronic
lymphocytic leukemia Survivin Non-Hodgkin's lymphoma Survivin
Multiple myeloma NY-ESO-1 Malignant melanoma MAGE, MART,
Tyrosinase, PRAME GP100 Breast cancer WT1, herceptin, epithelial
tumor antigen (ETA) Lung cancer WT1 Ovarian cancer CA-125 Prostate
cancer PSA Pancreatic cancer CA19-9, RCAS1 Colon cancer CEA Renal
cell carcinoma (RCC) Fibroblast growth factor 5 Germ cell tumors
AFP
[0163] A nucleic acid encoding the selected Th1-associated miR
(such as a plasmid vector or viral vector encoding the miR) can be
introduced into the isolated T cells, thus resulting in transformed
T cells. Methods for transduction of such vectors into T cells are
routine in the art.
[0164] In some embodiments, the nucleic acid molecule encoding the
Th1-associated miR is a vector encoding the selected miR. A number
of different plasmid and viral vectors have been described and are
well known in the art. In some embodiments of the methods, the
vector is a non-viral vector (for example, a plasmid). In other
embodiments, the vector is a viral vector (for example, an
adenoviral, adeno-associated viral, retroviral or lentiviral
vector). Suitable vectors are well known in the art.
[0165] Retrovirus, including lentivirus, vectors can also be used
with the methods described herein. Lentiviruses include, but are
not limited to, human immunodeficiency virus (such as HIV-1 and
HIV-2), feline immunodeficiency virus, equine infectious anemia
virus and simian immunodeficiency virus. Other retroviruses
include, but are not limited to, human T-lymphotropic virus, simian
T-lymphotropic virus, murine leukemia virus, bovine leukemia virus
and feline leukemia virus. Methods of generating retrovirus and
lentivirus vectors and their uses have been well described in the
art (see, for example, U.S. Pat. Nos. 7,211,247; 6,979,568;
7,198,784; 6,783,977; and 4,980,289, each of which is herein
incorporated by reference).
[0166] In addition, adenovirus vectors can be first, second, third
and/or fourth generation adenoviral vectors or gutless adenoviral
vectors. Adenovirus vectors can be generated to very high titers of
infectious particles; infect a great variety of cells; efficiently
transfer genes to cells that are not dividing; and are seldom
integrated in the host genome, which avoids the risk of cellular
transformation by insertional mutagenesis (Douglas and Curiel,
Science and Medicine, March/April 1997, pages 44-53; Zern and
Kresinam, Hepatology 25(2), 484-491, 1997). Representative
adenoviral vectors are described by Stratford-Perricaudet et al.
(J. Clin. Invest. 90: 626-630, 1992); Graham and Prevec (In Methods
in Molecular Biology: Gene Transfer and Expression Protocols 7:
109-128, 1991); and Barr et al. (Gene Therapy, 2:151-155, 1995),
which are herein incorporated by reference.
[0167] Adeno-associated virus (AAV) vectors can also be used.
Methods of generating AAV vectors, administration of AAV vectors
and their use are well known in the art (see, for example, U.S.
Pat. No. 6,951,753; U.S. Patent Application Publication Nos.
2007-036757, 2006-205079, 2005-163756, 2005-002908; and PCT
Publication Nos. WO 2005/116224 and WO 2006/119458).
[0168] Administration of a therapeutic amount of tumor
antigen-specific T cells over-expressing a Th1-associated miR can
be used to treat a primary tumor, to prevent recurrence of the
tumor in the subject, or to treat a relapse of the tumor.
[0169] A therapeutically effective amount of TA-specific T cells
engineered to express a Th1-associated miR is administered to the
subject. Specific, non-limiting examples of a therapeutically
effective amount of isolated T cells include cells administered at
a dose of about 1.times.10.sup.5 cells per kilogram of subject to
about 1.times.10.sup.9 cells per kilogram of subject, such as from
about 1.times.10.sup.6 cells per kilogram to about 1.times.10.sup.8
cells per kilogram, such as from about 5.times.10.sup.6 cells per
kilogram to about 7.5.times.10.sup.7 cells per kilogram, such as at
about 2.5.times.10.sup.7 cells per kilogram, or at about
5.times.10.sup.7 cells per kilogram.
[0170] Isolated TA-specific T cells engineered to express a
Th1-associated miR can be administered in single or multiple doses
as determined by a clinician. For example, the cells can be
administered at intervals of approximately one week, two weeks,
four weeks, one month or two months depending on the response
desired and the response obtained. In some examples, once the
desired response is obtained, no further TA-specific T cells are
administered. However, if the recipient displays one or more
symptoms associated with the presence or growth of a tumor, a
therapeutically effective amount of TA-specific T cells can be
administered at that time. The administration can be local or
systemic.
[0171] The purified antigen-specific T cells disclosed herein can
be administered with a pharmaceutically acceptable carrier, such as
saline. Other therapeutic agents can be administered before,
during, or after administration of the TA-specific T cells
engineered to express a Th1-associated miR, depending on the
desired effect (as discussed in greater detail below).
VI. Combination Treatment Methods
[0172] Th1-associated miR-transfected T cell immunotherapy can be
used alone or can be accompanied by administration of other
anti-cancer agents or therapeutic treatments (such as surgical
resection of a tumor or radiation therapy). Any suitable
anti-cancer agent can be administered to a patient as part of a
treatment regimen that includes T cell immunotherapy. Exemplary
anti-cancer agents include, but are not limited to,
chemotherapeutic agents, such as, for example, mitotic inhibitors,
alkylating agents, anti-metabolites, intercalating antibiotics,
growth factor inhibitors, cell cycle inhibitors, enzymes,
topoisomerase inhibitors, anti-survival agents, biological response
modifiers, anti-hormones (e.g. anti-androgens) and
anti-angiogenesis agents. Other anti-cancer treatments include
radiation therapy and antibodies that specifically target cancer
cells.
[0173] Examples of alkylating agents include nitrogen mustards
(such as mechlorethamine, cyclophosphamide, melphalan, uracil
mustard or chlorambucil), alkyl sulfonates (such as busulfan),
nitrosoureas (such as carmustine, lomustine, semustine,
streptozocin, or dacarbazine).
[0174] Examples of antimetabolites include folic acid analogs (such
as methotrexate), pyrimidine analogs (such as 5-FU or cytarabine),
and purine analogs, such as mercaptopurine or thioguanine.
[0175] Examples of natural products include vinca alkaloids (such
as vinblastine, vincristine, or vindesine), epipodophyllotoxins
(such as etoposide or teniposide), antibiotics (such as
dactinomycin, daunorubicin, doxorubicin, bleomycin, plicamycin, or
mitocycin C), and enzymes (such as L-asparaginase).
[0176] Examples of miscellaneous agents include platinum
coordination complexes (such as cis-diamine-dichloroplatinum II
also known as cisplatin), substituted ureas (such as hydroxyurea),
methyl hydrazine derivatives (such as procarbazine), and
adrenocrotical suppressants (such as mitotane and
aminoglutethimide).
[0177] Examples of hormones and antagonists include
adrenocorticosteroids (such as prednisone), progestins (such as
hydroxyprogesterone caproate, medroxyprogesterone acetate, and
magestrol acetate), estrogens (such as diethylstilbestrol and
ethinyl estradiol), antiestrogens (such as tamoxifen), and
androgens (such as testerone proprionate and fluoxymesterone).
[0178] Examples of many of the most commonly used chemotherapy
drugs include Adriamycin, Alkeran, Ara-C, BiCNU, Busulfan, CCNU,
Carboplatinum, Cisplatinum, Cytoxan, Daunorubicin, DTIC, 5-FU,
Fludarabine, Hydrea, Idarubicin, Ifosfamide, Methotrexate,
Mithramycin, Mitomycin, Mitoxantrone, Nitrogen Mustard, Taxol (or
other taxanes, such as docetaxel), Velban, Vincristine, VP-16,
while some more newer drugs include Gemcitabine (Gemzar),
Herceptin, Irinotecan (Camptosar, CPT-11), Leustatin, Navelbine,
Rituxan STI-571, Taxotere, Topotecan (Hycamtin), Xeloda
(Capecitabine), Zevelin and calcitriol.
[0179] Non-limiting examples of immunomodulators that can be used
include AS-101 (Wyeth-Ayerst Labs.), bropirimine (Upjohn), gamma
interferon (Genentech), GM-CSF (granulocyte macrophage colony
stimulating factor; Genetics Institute), IL-2 (Cetus or
Hoffman-LaRoche), human immune globulin (Cutter Biological), IMREG
(from Imreg of New Orleans, La.), SK&F 106528, and TNF (tumor
necrosis factor; Genentech).
[0180] Another treatment for cancer is surgical treatment, for
example surgical resection of the tumor or a portion of it. Another
example of a treatment is radiotherapy, for example administration
of radioactive material or energy (such as external beam therapy)
to the tumor site to help eradicate the tumor or shrink it prior to
surgical resection.
[0181] When used in combination with T cell immunotherapy, the
additional treatment methods described above can be administered or
performed prior to, at the same time, or following T cell
immunotherapy as appropriate for the particular patient, the cancer
to be treated and the specific combination of therapies.
[0182] The following examples are provided to illustrate certain
particular features and/or embodiments. These examples should not
be construed to limit the disclosure to the particular features or
embodiments described.
Examples
Example 1
Materials and Methods
[0183] This example describes the experimental procedures used for
the studies described in Example 2.
Reagents
[0184] RPMI 1640, FBS, L-glutamine, sodium pyruvate,
2-mercaptoethanol, nonessential amino acids, and
penicillin/streptomycin were obtained from Invitrogen Life
Technologies. Recombinant murine (rm) IL-12 was purchased from Cell
Sciences Technologies. RmIL-4, recombinant human (rh) IL-4 and
rhIL-2 were purchased from PeproTech. Purified mAbs against IL-12
(C15.6), IFN-.gamma. (R4-6A2), IL-4 (11B11), CD3 (145-2C11), CD4
(RM4-5), CD8 (53-6.7) and CD49d (R1-2) were all purchased from BD
Pharmingen. Purified mAbs against CD3 (UCHT1), CD28 (CD28.2) and
IL-4 (MP4-25D2) were purchased from Biolegend. RT-PCR reagents and
primers were purchased from Applied Biosystems and analyzed on a
BioRad IQ5. WST-1 reagent was purchased from Roche. For isolation
of T cells, immuno-magnetic isolation kits from Miltenyi Biotec
were used. All reagents and vectors for lentiviral production were
purchased from System Biosciences with the exception of
LIPOFECTAMINE.TM. 2000, which was from Invitrogen.
Mice
[0185] C57BL/6 mice and C57BL/6 background STAT6 deficient mice
(B6.129S2[C]-Stat6.sup.tm1Gru/J), both 5-9 weeks of age, were
purchased from The Jackson Laboratory. C57BL/6-background miR-17-92
transgenic (TG) mice
(C57BL/6-Gt[ROSA]26Sor.sup.tm3(CAG-MIRN17-92,-EGFP)Rsky/J; The
Jackson Laboratory) were maintained as breeding colonies and bred
to C57BL/6-background mice transgenic for Cre recombinase gene
under the control of the Lck promoter
(B6.Cg-Tg[Lck-cre]548J.times.m/J, the Jackson Laboratory) to obtain
mice in which T cells expressed miR-17-92 at high levels (miR-17-92
TG/TG). For mouse tumor experiments, C57BL/6 mice and C57BL/6
background STAT6.sup.-/- mice received subcutaneous injection of
1.times.10.sup.6 B16 tumor cells resuspended in PBS into the right
flank. On day 15 following tumor inoculation, mice were sacrificed
and splenic T cells were isolated.
T Cells from Healthy Donors and Patients with GBM
[0186] To determine the impact of IL-4, healthy donor-derived
CD4.sup.+ T cells were isolated with immunomagnetic separation and
stimulated with 100 IU/ml rhIL-2, anti-CD3 and anti-CD28 mAbs (1
.mu.g/ml for each) in the presence or absence of rhIL-4 (10 ng/ml).
RT-PCR analyses were performed with both healthy donor- and
patient-derived T cells to determine the expression of miR-17-92 as
described in the relevant section.
Th1 and Th2 Cell Culture
[0187] Th1 and Th2 cells were differentiated from
immunomagnetically-separated CD4.sup.+ splenic T cells. Magnetic
activated cell separation (MACS) was carried out using positive
selection. Briefly, spleens were minced in complete media,
resuspended in red blood cell lysis buffer and stained with
immunomagnetically labeled anti-CD4 antibody. Cells were then
washed and placed through the magnetic column in 500 .mu.l of MACS
buffer. The column was then washed 3 times with buffer and then
removed from the magnet and labeled cells were extracted in 3 ml of
MACS buffer.
[0188] For differentiation of T cells, purified CD4.sup.+ cells
were stimulated in 48-well plates with anti-CD3 mAb (5 .mu.g/ml) in
the presence of irradiated C57BL/6 spleen cells (3000 Rad) as
feeder cells. RmIL-12 (4 ng/ml), rmIFN-.gamma. (4 ng/ml), anti-IL-4
mAb (10 .mu.g/ml) and rhIL-2 (100 IU/ml) were added for Th1
development. Th2 cells were generated from the same CD4.sup.+ cell
precursors stimulated with anti-CD3 mAb and feeder cells in the
presence of rmIL-4 (50 ng/ml), two anti-IFN-.gamma. mAbs (10
.mu.g/ml), anti-IL-12 mAb (10 .mu.g/ml) and rhIL-2 (100 IU/mL).
After 10 days, cells were stained for IL-4 and IFN-.gamma. to
confirm differentiation. Neutral cell culture included anti-CD3,
feeder cells and rhIL-2. For studies involving IL-4 blockade, 12.5
ng/ml anti-human IL-4 mAb (Biolegend) was used in human experiments
and 2.5 .mu.g/ml anti-mouse IL-4 mAb (11B11) in murine studies.
IFN-.gamma. and IL-4 in the culture supernatants were measured
using specific ELISA kits (R&D Systems). For FACs analysis,
cells were incubated with mAb at 4.degree. C. for 30 minutes,
washed twice in staining buffer, and fixed in 500 .mu.l of 2%
paraformaldehyde in PBS. Cells were stored in the dark at 4.degree.
C. until analysis. Flow cytometry was carried out on the Coulter XL
four-color flow cytometer.
miR Microarray
[0189] Total RNA was isolated from Th1 and Th2 cells using the
TRIZOL.TM. reagent and quality was confirmed with an A260/A280
ratio greater than 1.85. Two .mu.g of total RNA was labeled with
either Hy5 (red; Th1) or Hy3 (green; Th2) fluorescent dyes using
miRCURY.TM. LNA microRNA labeling kit (Exiqon, Woburn, Mass.)
according to the manufacturer's protocol. Labeled miR samples in
duplicate were co-hybridized on miR array slides, a custom spotted
miR array V4P4 containing duplicated 713 human, mammalian and viral
mature antisense microRNA species (miRBase, version 9.1) plus 2
internal controls with 7 serial dilutions printed in house
(Immunogenetics Laboratory, Department of Transfusion Medicine,
Clinical Center, National Institutes of Health) (Ren et al.,
Journal of Translational Medicine 2009, 7:20). After washing, raw
intensity data were obtained by scanning the chips with GENEPIX.TM.
scanner Pro 4.0 and were normalized by median over entire array.
Differentially expressed miRs were defined by mean (n=2) fold
change (Th1/Th2 signal intensity)>2.
Quantitative RT-PCR
[0190] Total RNA was extracted using the Qiagen RNEASY.TM. kit and
quality was confirmed with a A260/A280 ration greater than 1.85.
RNA was subjected to RT-PCR analysis using the TAQMAN.TM. microRNA
Reverse Transcription Kit, microRNA Assays (Applied Biosystems),
and the Real-Time thermocycler iQ5 (Bio-Rad). The small nucleolar
SNO202 was used as the housekeeping small RNA reference gene for
all murine samples and RNU43 for human samples. All reactions were
done in triplicate and relative expression of RNAs was calculated
using the .DELTA..DELTA.C.sub.T method (Livak and Schmittgen,
Methods 2001, 25:402-408).
WST-1 Proliferation Assay
[0191] For WST-1 proliferation assays, 1.times.10.sup.4 cells were
cultured in a 96-well plate for 24-48 hours in 100 .mu.l of
complete media. Then, 10 .mu.l of WST-1 reagent was added to each
well. Cells were incubated at 37.degree. C., 5% CO.sub.2 for 4
hours, and placed on a shaker for 1 minute. The plates were then
read on a micro plate reader with a wavelength of 420 nm and a
reference at 620 nm.
Assays Using Jurkat Lymphoma Cells Transduced with miR-17-92
[0192] Jurkat human T cell leukemia cells (American Type Culture
Collection) were transduced by either one of the following
pseudotyped lentiviral vectors: 1) control vector encoding GFP; 2)
the 17-92-1 expression vector encoding miR-17, miR-18 and miR-19;
or 3) the 17-92-2 expression vector encoding miR-20, miR-19b-1, and
miR-92a-1. All vectors were purchased from SBI. Lentiviral
particles were produced by co-transfecting confluent 293TN cells
(SBI) with pPACK-H1 Lentivirus Packaging Kit (SBI) and the miR
containing expression vectors (SBI) noted above using
LIPOFECTAMINE.TM. 2000 reagent (Invitrogen). Supernatant was
collected after 48 hour incubation at 37.degree. C. with 5%
CO.sub.2 and placed at 4.degree. C. with PEG-it Virus Concentration
Solution (SBI) for 24 hrs. Supernatants/PEG solutions were then
centrifuged and the pellet was resuspended in a reduced volume of
media as viral stock. Jurkat cells were further resuspended in the
viral stock together with polybrene (8 .mu.g/ml) for 24 hours.
Fresh media was then added to the cells and transduction efficiency
was evaluated by GFP expressing cells. For IL-2 production,
transduced
[0193] Jurkat cells were stimulated with phorbol 12-myristate
13-acetate (PMA; 10 ng/ml) and ionomycin (500 nM) overnight and
supernatant was assayed for IL-2 by a human IL-2 ELISA kit. For
AICD, cells were treated with 10 .mu.g/ml purified anti-CD3 mAb
(UCHT1) from Biolegend for 24 hours and then cell viability was
measured using WST-1 reagent.
Statistical Methods
[0194] All statistical analyses were carried out on Graphpad Prism
software. The statistical significance of differences between
groups was determined using student t-test. Differences were
considered significant when p<0.05. A post test for linear trend
was used to determine linear trend and p<0.05 was considered to
be significant.
Example 2
miR-17-92 Expression in Differentiated T Cells
[0195] This example describes results demonstrating that (i)
expression of the miR17-92 cluster is greater in Th1 cells compared
to Th2 cells; (ii) the IL-4R/STAT6 signaling pathway regulates
expression of miR-17-92; and (iii) over-expression of miR-17-92 in
T cells promotes a Th1 phenotype and render cells resistant to
AICD.
miR17-92 and its Paralogs are Overexpressed in Th1 Cells Compared
with Th2 Cells
[0196] To identify differentially expressed miRs between Th1 and
Th2 cells, miR microarray analysis was performed. From mouse
splenic CD4.sup.+ T cells, Th1 and Th2 cells were generated as
described in Example 1. These T cells exhibited expected cytokine
profiles with Th1 cells dominantly producing IFN-.gamma., but not
IL-4, while Th2 cells produced mostly IL-4 (FIG. 1A). Total RNA was
extracted from these T cells, and analyzed for differential miR
expression by miR microarray for 714 miRs (FIG. 1B). Hierarchical
clustering of differentially expressed miRs revealed distinct miR
expression profiles between the Th1 and Th2 cells. Eleven of the
miRs from the miR-17-92 cluster and its paralogs were expressed at
higher levels in Th1 cells than in Th2 cells. Next, the miRs
preferentially expressed in Th1 cells were ranked according to the
fold difference of expression when compared with Th2 cells (FIG.
1C). Interestingly, members of miRs in the miR-17-92 clusters were
identified as the most differentially expressed of all miRs in Th1
cells compared to Th2 cells. Since miR-17-92 clusters appear to be
transcribed as single polycistronic transcripts (FIG. 1D), it was
expected that all the miRs from the miR-17-92 cluster would be
consistently expressed at higher levels in Th1 cells than in Th2
cells, which was confirmed by RT-PCR analysis (FIG. 2A).
[0197] The miR-17-92 cluster has 2 paralog clusters: miR-106a-363
and miR-106b-25. These paralog clusters target similar mRNAs as the
miR-17-92 cluster due to high sequence homology (Mendell, Cell
2008, 133:217-222). To establish if these paralog miR clusters are
also overexpressed in the Th1 vs. Th2 cells, RT-PCR was performed
for miRs in each of these clusters. Representative for these
paralog clusters are miR-106a and miR106b (FIG. 2B). These data
demonstrate that the paralog clusters of miRs were also
up-regulated in Th1 cells over Th2.
Neutralization of Endogenous IL-4 Up-Regulates miR-17-92 Cluster
miRs in T-Cells
[0198] In order to identify factors that contribute to the
differential expression of miR-17-92 cluster miRs between Th1 and
Th2 cells, it was investigated whether a prototypical type-2
inducing cytokine, IL-4, would affect miR-17-92 expression in
CD4.sup.+ T cells. Neutralization of endogenous IL-4 by specific
mAb against IL-4 up-regulated miR-17-92 cluster miRs in CD4.sup.+ T
cells stimulated with IL-2 without addition of Th1-inducing factors
IL-12 or IFN-.gamma., by approximately 50% (FIG. 3A). The anti-IL-4
mAb also up-regulated miR-17-92 in Th2 culture conditions as well.
To determine whether there is an IL-4 dose-dependent suppression of
miR-17-92 cluster, CD4.sup.+ T cells were treated with increasing
doses of IL-4 at 0, 10, 50 or 100 ng/ml and miR-17-5p expression
was measured by RT-PCR (FIG. 3B). miR-17-92 suppression was a
dose-dependent phenomenon.
Up-Regulated miR-17-92 Expression in STAT6-Deficient T Cells
[0199] To further elucidate the effect of IL-4 signaling on
miR-17-92 cluster expression, CD4.sup.+ T cells were cultured under
Th1 or Th2 skewing conditions from mice deficient of the critical
IL-4 signaling molecule, STAT6 (Sasaki et al., The Journal of
Immunology 2008, 181:104-108; Eguchi et al., GeneTher 2005,
12:733-741). Both Th1 and Th2 cultured cells induced from
STAT6-deficient mice showed higher levels of miR-17-5p expression
compared with corresponding WT Th cells, suggesting a novel
critical role of IL-4R/STAT6-signaling in the down-regulation of
miR-17 expression (FIG. 3C).
Suppression of miR-17-92 may Occur in Cancer-Bearing Hosts
[0200] These data led to the hypothesize that suppression of
miR-17-92 would occur in cancer-bearing hosts where tumor-derived
factors likely promote Th2-skewed immune responses and secretion of
IL-4 (Roussel et al., Clin Exp Immunol 1996, 105:344-352). Indeed,
CD4.sup.+ and CD8.sup.+ SPCs derived from wild type C57BL/6 mice
bearing B16 subcutaneous tumors expressed lower levels of miR-17-5p
when compared with those derived from non-tumor bearing mice (FIG.
4A). Interestingly, the tumor bearing condition did not suppress
miR-17-5p expression by CD4.sup.+ T cells in STAT6.sup.-/- mice.
Furthermore, CD8.sup.+ T cells in STAT6.sup.-/- mice demonstrated
enhanced levels of miR-17-5p expression when these mice bore B16
tumors compared with non-tumor bearing mice. When wild type
CD4.sup.+ T cells were stimulated with anti-CD3 mAb in vitro for 24
hours, the CD4.sup.+ T cells from tumor-bearing mice produced lower
levels of IFN-.gamma. when compared with ones from non-tumor
bearing wild type mice (FIG. 4B). These data suggest that
tumor-associated immunosuppression may involve the down-regulation
of miR-17-92 through a STAT6 dependant pathway.
[0201] It was next evaluated whether the observed IL-4-mediated and
tumor-induced suppression of miR-17-92 are relevant in human T
cells. When healthy donor-derived CD4.sup.+ T cells were stimulated
with rhIL-2, anti-CD3 and anti-CD28 mAbs, consistent with the mouse
data, addition of rhIL-4 in the cultures suppressed expression of
miR-17-5p (FIG. 4C). Moreover, CD4.sup.+ T cells obtained from
patients with GBM exhibited significantly decreased levels of
miR-17-5p when compared with ones from healthy donors (FIG. 4D).
Thus, both IL-4 and GBM-bearing conditions suppress miR-17-5p
expression in CD4.sup.+ T cells. Although not statistically
significant, CD8.sup.+ T cells demonstrated a trend towards
decreased levels of miR-17-5p expression in GBM patients when
compared with healthy donors (FIG. 4D).
T Cells Derived from miR-17-92 Transgenic Mice Display Enhanced
Type-1 Phenotype
[0202] The data discussed above strongly suggest GBM-associated
factors and a type-2 promoting cytokine (IL-4) down-regulate
miR-17-92 in T cells. miR-17-92 is expected to play pivotal roles
in T cell functions. Experiments were therefore carried out to
determine whether ectopic expression of miR-17-92 would promote the
type-1 phenotype of T cells. As detailed in Example 1, mice that
overexpress miR-17-92 specifically in T cells (miR-17-92 TG/TG)
were generated. CD4.sup.+ splenocytes were isolated from these mice
and the expression of miR-17-5p was evaluated (FIG. 5A). CD4.sup.+
cells from TG/TG mice displayed a greater than 15-fold increase in
miR-17-p5 expression as compared with controls. These cells also
expressed elevated levels of CD49d, which is a subunit of a type-1
T cell marker VLA-4 (FIG. 5B). Although CD49d (also known as
.alpha.4-integrin) can form heterodimers with both .beta.1 (CD29)
and .beta.7 integrins, .alpha.4.beta.7 complexes were not expressed
by either Th1 cells or Th2 cells, suggesting that CD49d is a
suitable surrogate for VLA-4 expression levels (Sasaki et al., The
Journal of Immunology 2008, 181:104-108; Sasaki et al., Eur J
Immunol 2008, 38:2865-2873; Zhu et al., J Transl Med 2007, 5:10;
Sasaki et al., Cancer Res 2007, 67:6451-6458). miR-17-92-TG/TG
CD4.sup.+ cells also demonstrated enhanced ability to produce
IFN-.gamma. upon stimulation (FIG. 5C). Similar data were obtained
with CD8.sup.+ T cells isolated from these TG/TG mice. These
findings suggest that miR-17-92 promotes the type-1 phenotype in
differentiating T cells.
Ectopic Expression of miR-17-92 Promotes IL-2 Production and
Resistance Against Activation-Induced Cell Death (AICD) in Jurkat
Cells
[0203] miR-17-92 is expected to play pivotal roles in T cell
survival as well as functions. To evaluate these aspects, Jurkat
cells were transduced with lentiviral vectors encoding GFP and
either the miR-17-92-1 expression vector encoding miR-17, miR-18
and miR-19a, or the 17-92-2 expression vector encoding miR-20,
miR-19b, and miR-92. The control vector encodes GFP, but not miRs.
Transduced Jurkat cells were stimulated with PMA and ionomycin
overnight before the supernatants were assayed for IL-2 production
by ELISA (FIG. 6A). Transduction of either miR-vector promoted IL-2
production in Jurkat cells.
[0204] AICD and chemotherapy-induced suppression of T cells
represent major obstacles for efficient T cell-based cancer
immunotherapy (Kennedy and Celis, Immunological Reviews 2008,
222:129-144; Brenner et al., Critical Reviews in
Oncology/Hematology 2008, 66:52-64). It was next examined whether
transfection of Jurkat cells with miR-17-92 renders T cells
resistant to AICD. AICD was induced by cultivation of Jurkat cells
in the presence of 10 .mu.g/ml anti-CD3 mAb, which is
hyper-stimulatory and used as a standard method to induce AICD
(Jiang et al., Clin Exp Med 2009). As demonstrated in (FIG. 6B),
the growth of control Jurkat cells was significantly suppressed by
nearly 25% in the AICD inducing condition compared with the same
cells with the regular (growth-promoting) dose of anti-CD3 mAb (1
.mu.g/ml). In contrast, the growth of Jurkat cells transduced with
either miR-17-92-1 or miR-17-92-2 was not significantly altered by
the high dose (10 .mu.g/ml) of anti-CD3 mAb, suggesting that the
miR-17-92 transfection confers T cells with substantial resistance
against AICD. These findings point to a potential utility for
miR-17-92 transfected T cells in cancer immunotherapy.
Summary of Results
[0205] Attaining effective tumor immunity is a major goal of modern
biologic therapy, limited by the tumor microenvironment and
profound regulatory mechanisms limiting T cell and NK cell
effectors. It is demonstrated herein that the type-2-skewing tumor
microenvironment induces down-regulation of miR-17-92 expression in
T cells, thereby hampering anti-tumor T cell responses. It also
suggests that development of immunotherapy using
miR-17-92-transduced T cells is warranted based on these findings
demonstrating that ectopic expression of miR-17-92 in T cells leads
to improved type-1 functions, including increased VLA-4 expression
and IFN-.gamma. production.
[0206] Blockade of endogenous IL-4 by inhibitory mAb or disruption
of STAT6 signaling was sufficient to up-regulate miR-17-92 in T
cells (FIG. 3). These findings suggest that STAT6 may negatively
regulate miR-17-92 expression in T cells. Several transcription
factors have been identified that regulate expression of this miR
cluster, including the E2 transcription factor (E2F) family members
(Woods et al., J Biol Chem 2007, 282:2130-2134; Sylvestre et al., J
Biol Chem 2007, 282:2135-2143), c-Myc (O'Donnell et al., Nature
2005, 435:839-843), STAT3 (Brock et al., Circ Res 2009,
104:1184-1191), as well as the sonic hedgehog pathway (Northcott et
al., Cancer Res 2009, 69:3249-3255; Uziel et al., Proc Natl Acad
Sci USA 2009, 106:2812-2817). With regard to the effects of
IL-4/STAT6 signaling on Th1 vs. Th2 functions, the inventors have
recently demonstrated that STAT6.sup.-/- Th2 cells exhibit Th1
phenotype with increased surface expression of VLA-4 (Sasaki et
al., Journal of Immunotherapy 2009, 32:793-802). These observations
have led to the hypothesis that STAT6-regulated miR-17-92 may
contribute to the promotion of type-1 T cell functions.
[0207] These findings indicate that the tumor-bearing host
down-regulates miR-17-92 in T cells (FIGS. 3 and 4). Interestingly,
not only are STAT6.sup.-/- T cells resistant to tumor-induced
inhibition of miR-17-5p, but CD8.sup.+ T cells in tumor bearing
STAT6.sup.-/- mice exhibited higher levels of miR-17-5p when
compared with CD8.sup.+ T cells obtained from non-tumor bearing
STAT6.sup.-/- mice. In addition to IL-4, other tumor-derived
factors are likely to be involved in these events.
[0208] While tumor bearing mice demonstrated decreased levels of
miR-17-92 in both CD4.sup.+ and CD8.sup.+ cells, human GBM patients
exhibited a statistically significant decrease of miR-17-92 in
CD4.sup.+ cells but not in CD8.sup.+ cells (FIG. 4). However, there
is a trend towards lower miR-17-92 expression in GBM
patient-derived CD8.sup.+ cells compared with those obtained from
healthy donors. The type-1 vs. type-2 differentiation appears to be
more distinct for CD4.sup.+ T cells than for CD8.sup.+ cells (Ehi
et al., Oncol Rep 2008, 19:601-607; Tatsumi et al., Cancer Res
2003, 63:4481-4489), and this may also be the case for
miR-17-92.
[0209] Messages encoding proteins that are targeted by miR-17-92
cluster miRs include: E2F1, E2F2, E2F3 (O'Donnell et al., Nature
2005, 435:839-843; Brock et al., Circ Res 2009, 104:1184-1191), P21
(Inomata et al., Blood 2009, 113:396-402), anti-angiogenic
thrombospondin-1 and connective tissue growth factor (Dews et al.,
Nat Genet 2006, 38:1060-1065), proapoptotic Bim, and phosphatase
and tensin homolog (PTEN) (Xiao et al., Nat Immunol 2008,
9:405-414). These proteins are all involved in cell cycle
regulation or apoptotic cell death, further supporting the
importance of miR-17-92 cluster in T cell biology. In fact, Bim and
PTEN are down-regulated in T cells overexpressing miR-17-92 (Xiao
et al., Nat Immunol 2008, 9:405-414). Furthermore, TGF-.beta.
receptor II (TGFBRII) is one of the established targets of
miR-17-92 (Volinia et al., Proc Natl Acad Sci USA 2006,
103:2257-2261).
[0210] The findings demonstrating increased IFN-y production from
miR-17-92 TG/TG T cells compared with control cells suggest that
miR-17-92 promotes the type-1 skewing of T cells (FIGS. 5 and 6C).
As miR-17-92 targets hypoxia-inducible factor (HIF)-1.alpha. in
lung cancer cells (Taguchi et al., Cancer Res 2008, 68:5540-5545),
enhanced miR-17-92 expression in activated T cells may promote the
type-1 function of T cells at least partially through
down-regulation of HIF-1.alpha.. Although HIF-1 expression provides
an important adaptation mechanism of cells to low oxygen tension
(Sitkovsky and Lukashev, Nat Rev Immunol 2005, 5:712-721; Semenza,
Current Opinion in Genetics & Development 1998, 8:588-594), it
does not appear to be critical for survival of T cells, unlike its
apparent role in macrophages (Cramer et al., Cell 2003,
112:645-657). T cells do not depend on HIF-1.alpha. for survival to
the same degree as macrophages since activated T cells produce ATP
by both glycolysis and oxidative phosphorylation (Brand and
Hermfisse, FASEB J 1997, 11:388-395). Rather, HIF-1.alpha. in T
cells appears to play an anti-inflammatory and tissue-protecting
role by negatively regulating T cell functions (Sitkovsky and
Lukashev, Nat Rev Immunol 2005, 5:712-721; Neumann et al., Proc
Natl Acad Sci USA 2005, 102:17071-17076; Eltzschig et al., Blood
2004, 104:3986-3992). Indeed, T cell-targeted disruption of
HIF-1.alpha. leads to increased IFN-.gamma. secretion and/or
improved effector functions (Kojima et al., Proc Natl Acad Sci USA
2002, 99:2170-2174; Lukashev et al., J Immunol 2006, 177:4962-4965;
Guo et al., Int Arch Allergy Immunol 2009, 149:98-102; Thiel et
al., PLoS One 2007, 2:e853). Although available data on gene
expression profiles in Th1 and Th2 cells do not suggest
differential expression of HIF-1.alpha. mRNA between these cell
populations (Nagai et al., Int Immunol 2001, 13:367-376), as is
often the case in miR-mediated gene expression regulation,
miR-17-92 may still regulate HIF-1.alpha. protein expression at
post-transcriptional levels. These data collectively suggest that
miR-17-92 expression in activated T cells promotes the type-1
function of T cells at least partially through down-regulation of
HIF-1.alpha..
[0211] The human Jurkat T cell line with ectopic expression of
miR-17-92 cluster members demonstrate increased IL-2 production and
improved viability following treatment with the AICD condition
(FIG. 6). The Jurkat cell line was established from the peripheral
blood of a T cell leukemia patient in the 1970s. This cell line is
often used to recapitulate what would happen in humans T cells as
the line retains many T cell properties, such as CD4, a T cell
receptor, and ability to produce IL-2 (Abraham and Weiss, Nat Rev
Immunol 2004, 4:301-308). For these reasons, Jurkat cells were for
the experiments disclosed herein.
[0212] miRs in the miR-17-92 clusters are amplified in various
tumor types including B cell lymphoma and lung cancer, and promote
proliferation and confer anti-apoptotic function in tumors, thereby
promoting tumor-progression and functioning as oncogenes (He et
al., Nature 2005, 435:828-833; Hayashita et al., Cancer Res 2005,
65:9628-9632; Matsubara et al., Oncogene 2007, 26:6099-6105;
Lawrie, Expert Opin Biol Ther 2007, 7:1363-1374; Rinaldi et al.,
Leuk Lymphoma 2007, 48:410-412). However, miR-17-92 by itself may
not be responsible for oncogenesis as transgenic mice with
miR-17-92 overexpressed in lymphocytes develop lymphoproliferative
disorder and autoimmunity but not cancer (Xiao et al., Nat Immunol
2008, 9:405-414). miR-17-92 may cooperate with other oncogenes to
promote the oncogenic process. Transgenic mice overexpressing both
miR-17-92 and c-Myc in lymphocytes develop early onset
lymphomagenesis disorders (He et al., Nature 2005, 435:828-833). On
the other hand, knockout studies of the miR-17-92 cluster in mice
have demonstrated the importance of this cluster in mammalian
biology. While knockout of the miR-17-92 cluster results in
immediate post-natal death of all progeny, knockout of either or
both the miR-106a or miR-106b clusters are viable without an
apparent phenotype (Ventura et al., Cell 2008, 132:875-886).
However knock out of the miR-17-92 cluster together with miR-106a
or 106b cluster results in embryonic lethality (Xiao and Rajewsky,
Cell 2009, 136:26-36).
[0213] During lymphocyte development, miR-17-92 miRs are highly
expressed in progenitor cells, with the expression level decreasing
2- to 3-fold following maturation (Xiao et al., Nat Immunol 2008,
9:405-414). In addition, the inventors have evaluated relative
expression of miR-17-92 in a variety of Th cells as well as naive
CD4.sup.+ cells. Naive CD4.sup.+ cells express miR-17-92 at the
highest level among the cell populations examined. Albeit lower
than that in naive CD4.sup.+ cells, Th1 cells express miR-17-92 at
higher levels than T neutral (anti-CD3, feeder cells and IL-2) and
Th17 cells, and Th2 cells consistently exhibit the lowest levels of
miR-17-92 among the populations tested.
Example 3
Inhibition of Tumor Growth in miR-17-92 TG Mice
[0214] This example supports the methods of engineering tumor
antigen (TA)-specific CTLs to express the miR-17-92 cluster that
provide potent and durable antitumor activity by potentiating
TA-specific type-1 CTL functions. This example describes studies in
which C57BL/6-background mice that overexpress miR-17-92 in T cells
(miR-17-92-TG mice) or control Lck-Cre mice were challenged with
two different tumor systems (FIGS. 7A-7B).
[0215] First, mice received s.c. challenge with B16 melanoma cells
(1.times.10.sup.5/mouse) and were sacrificed on day 15 following
tumor challenge because the size of most tumors exceeded 2 cm.sup.2
in control mice. As shown in FIG. 7A, tumors in miR-17-92-TG mice
were significantly smaller than those that developed in control
mice (p=0.0034 by student-t test, n=9 and 10 for control and
miR-17-92-TG mice, respectively).
[0216] As a second model, mice received i.c. inoculation of GL261
glioma cells (1.times.10.sup.5/mouse) and were followed for
symptom-free survival. As shown in FIG. 7B, all control mice died
by day 25 after the tumor inoculation (median 23 days), whereas the
survival of miR-17-92-TG mice was significantly longer than that of
control mice (median 31 days; p=0.0426 by Logrank test), and 2 of 7
mice were still alive 50 days following tumor inoculation.
[0217] The results of these in vivo studies demonstrate that
overexpression of miR-17-92 in T cells significantly inhibits tumor
growth and/or tumor induced death.
Example 4
miR-17-92-TG T Cells Infiltrate Gliomas More Intensively Than
Control T Cells
[0218] The glioma experiment described in Example 3 and depicted in
FIG. 7B was repeated by challenging miR-17-92-TG or control Lck-Cre
mice (n=4/group) with i.c. inoculation of syngeneic GL261 glioma
cells, with the exception that these mice were sacrificed on day 23
to evaluate the immunological microenvironment of the glioma sites
by flow-cytometric evaluation of brain-infiltrating leukocytes
(BILs). As shown in FIG. 8, BILs were stained for T cell marker CD3
as well as VLA-4 as a critical homing receptor to the brain tumor
sites (Sasaki et al., J Immunol 181:104-108, 2008; Sasaki et al.,
Eur J Immunol 38:2865-2873, 2008; Sasaki et al., Cancer Res
67:6451-6458, 2007; Zhu et al., J Transl Med 5:10, 2007).
[0219] Interestingly, tumors in miR-17-92-TG mice were infiltrated
more heavily by CD3.sup.+VLA-4.sup.+ cells compared with control
mice. Enumeration of CD3.sup.+VLA-4.sup.+ cells by multiplying the
total number of leukocyte-gated BILs and the percentage of this
population revealed 1.3.times.10.sup.4/mouse in the control mice
compared with 6.4.times.10.sup.4/mouse in miR-17-92-TG mice. As
transgenic expression of miR-17-92 in miR-17-92-TG mice is
restricted in their T cells owing to Lck-Cre system, these results
suggest that transgenic expression of miR-17-92 in T cells promotes
trafficking of T cells to glioma sites, thereby promoting
anti-tumor immunity.
Example 5
miR-17-92 Expression Confers T Cell Resistance to AICD of Primary
Mouse T Cells
[0220] AICD represents major obstacles for efficient T cell-based
cancer immunotherapy. Example 2 describes results in a T cell line
(Jurkat) demonstrating that miR-17-92 overexpression confers
resistance to AICD. It was next examined whether transgenic
miR-17-92 expression confers primary T cells resistant to AICD.
AICD was induced by cultivation of miR-17-92 TG Tc1 or control TG
Tc1 in the presence of 10 .mu.g/ml anti-CD3 mAb. The number of
control Tc1 cells was significantly reduced by nearly 45% in the
AICD inducing condition compared with the same cells with the
regular (growth-promoting) dose of anti-CD3 mAb (1 .mu.g/ml). In
contrast, the number of T cells transgenic with miR-17-92 was not
significantly altered by the high dose (10 .mu.g/ml) of anti-CD3
mAb, suggesting that the miR-17-92 transfection confers T cells
with substantial resistance against AICD.
Example 6
T Cells Over-Expressing miR17-92 for Cancer Immunotherapy
[0221] This example illustrates methods to further demonstrate
miR-17-19b over-expression can promote proliferation of
adoptively-transferred tumor-antigen specific T cells in situ and
exert potent anti-tumor response in vivo. This method also provides
an example of how to perform cancer immunotherapy.
[0222] The efficiency of T cell-adoptive transfer therapy largely
depends upon the persistence and proliferation of transferred T
cells in vivo, and this has been the rate-limiting step for
development of successful immunotherapy. Tumor-induced type-2
deviation and other immuno-suppression mechanisms appear to induce
inactivation and death of anti-tumor T cells. In order to sustain
effective proliferation of adoptively-transferred tumor-specific
Tc1 cells, genetically engineered miR-17-19b over-expressing Tc1
and Tc2 are generated and adoptively transferred into intracranial
GL261-bearing mice.
[0223] Using a Hamilton syringe, 1.times.10.sup.5 GL261 glioma
cells are stereotactically injected through an entry site at the
bregma, 3 mm to the right of sagittal suture and 4 mm below the
surface of the skull of anesthetized mice using a stereotactic
frame (Kopf). The miR-17 or control backbone vector are infected
into Tc1 and Tc2 cells. On day 10, five mice per group receive an
i.v. injection with 2.times.10.sup.7 miR-17 or control
vector-transfected Tc1 cells that have been cultured for 9 days
with 100 U/ml of hIL-2. Mice are closely monitored for any
neurological signs, or any signs of weakness or malaise, which are
considered to be endpoints. When endpoints are observed, the mice
are sacrificed. The survival of mice is analyzed using the Kaplan
Mayer method. As a means of immunological monitoring, blood is
drawn from mice treated with engineered Tc1 cells, then serum
IFN-.gamma. and IL-4 levels are assessed by ELISA.
[0224] In another set of experiments, mice are given BrdU in the
drinking water for 5 days after i.v. transfer of engineered Tc1
cells. At day 6 after adoptive-transfer, mice are sacrificed and
BILs are isolated as described previously (Nishimura et al., Cancer
Res. 66:4478-4487, 2006). BILs are stained extracellularly with
PE-gp100.sub.25-33.sup.-H-2D.sup.b-tetramer permeabilized using the
CYTOFIX/CYTOPERM.TM. kit (BD Biosciences), and stained with
FITC-anti-BrdU mAb. It is anticipated that miR-17-19b-transfected
Tc1 cells will demonstrate higher proliferation levels than
control-transfected Tc1 cells after encountering the tumor-antigens
in situ.
[0225] To eliminate concerns for development of lymphoma by the
stable gene-transfer of miR-17, normal tumor-free C57BL/6 mice (5
mice/group) receive i.v. transfer of 2.times.10.sup.7 miR-17- or
control-transfected Tc1 cells per mouse. Mice have blood (50 .mu.l)
drawn from the tail vein, and are then monitored for the presence
of leukemia by blood smear analysis at 5, 10, 20 and 40 weeks after
the adoptive-transfer. Mice are also observed for any changes in
physical appearance and demeanor including weakness, hunch back,
weight-loss and general malaise. Mice demonstrating any of the
signs above, or those surviving longer than 120 days, are
sacrificed. Lymphoid (cervical, axillary, and inguinal, mesenteric
lymph-nodes, spleen) and non-lymphoid (brain, kidney, liver,
bone-marrow, intestine) organs are harvested. To this end,
hematoxylin and eosin (H&E) staining is employed to examine the
presence of malignancies.
[0226] The treatment methods described herein can easily be adapted
for other species or subjects, such as humans.
[0227] In view of the many possible embodiments to which the
principles of the disclosed invention may be applied, it should be
recognized that the illustrated embodiments are only preferred
examples of the invention and should not be taken as limiting the
scope of the invention. Rather, the scope of the invention is
defined by the following claims. We therefore claim as our
invention all that comes within the scope and spirit of these
claims.
Sequence CWU 1
1
26184RNAHomo sapiens 1gucagaauaa ugucaaagug cuuacagugc agguagugau
augugcaucu acugcaguga 60aggcacuugu agcauuaugg ugac 84223RNAHomo
sapiens 2caaagugcuu acagugcagg uag 23322RNAHomo sapiens 3acugcaguga
aggcacuugu ag 22484RNAMus musculus 4gucagaauaa ugucaaagug
cuuacagugc agguagugau gugugcaucu acugcaguga 60gggcacuugu agcauuaugc
ugac 84523RNAMus musculus 5caaagugcuu acagugcagg uag 23622RNAMus
musculus 6acugcaguga gggcacuugu ag 22771RNAHomo sapiens 7uguucuaagg
ugcaucuagu gcagauagug aaguagauua gcaucuacug cccuaagugc 60uccuucuggc
a 71823RNAHomo sapiens 8uaaggugcau cuagugcaga uag 23996RNAMus
musculus 9ugcgugcuuu uuguucuaag gugcaucuag ugcagauagu gaaguagacu
agcaucuacu 60gcccuaagug cuccuucugg cauaagaagu uauguc 961023RNAMus
musculus 10uaaggugcau cuagugcaga uag 231182RNAHomo sapiens
11gcaguccucu guuaguuuug cauaguugca cuacaagaag aauguaguug ugcaaaucua
60ugcaaaacug augguggccu gc 821223RNAHomo sapiens 12ugugcaaauc
uaugcaaaac uga 231382RNAMus musculus 13gcagcccucu guuaguuuug
cauaguugca cuacaagaag aauguaguug ugcaaaucua 60ugcaaaacug augguggccu
gc 821423RNAMus musculus 14ugugcaaauc uaugcaaaac uga 231571RNAHomo
sapiens 15guagcacuaa agugcuuaua gugcagguag uguuuaguua ucuacugcau
uaugagcacu 60uaaaguacug c 711623RNAHomo sapiens 16uaaagugcuu
auagugcagg uag 2317107RNAMus musculus 17gugugaugug acagcuucug
uagcacuaaa gugcuuauag ugcagguagu guguagccau 60cuacugcauu acgagcacuu
aaaguacugc cagcuguaga acuccag 1071823RNAMus musculus 18uaaagugcuu
auagugcagg uag 231987RNAHomo sapiens 19cacuguucua ugguuaguuu
ugcagguuug cauccagcug ugugauauuc ugcugugcaa 60auccaugcaa aacugacugu
gguagug 872023RNAHomo sapiens 20ugugcaaauc caugcaaaac uga
232187RNAMus musculus 21cacuggucua ugguuaguuu ugcagguuug cauccagcug
uauaauauuc ugcugugcaa 60auccaugcaa aacugacugu gguggug 872223RNAMus
musculus 22ugugcaaauc caugcaaaac uga 232378RNAHomo sapiens
23cuuucuacac agguugggau cgguugcaau gcuguguuuc uguaugguau ugcacuuguc
60ccggccuguu gaguuugg 782422RNAHomo sapiens 24uauugcacuu gucccggccu
gu 222580RNAMus musculus 25cuuucuacac agguugggau uugucgcaau
gcuguguuuc ucuguauggu auugcacuug 60ucccggccug uugaguuugg
802621RNAMus musculus 26uauugcacuu gucccggccu g 21
* * * * *