U.S. patent application number 12/802536 was filed with the patent office on 2010-12-16 for methods and compositions for controlling efficacy of rna silencing.
This patent application is currently assigned to UNIVERSITY OF MASSACHUSETTS. Invention is credited to Guiliang Tang, Phillip D. Zamore.
Application Number | 20100317105 12/802536 |
Document ID | / |
Family ID | 33551539 |
Filed Date | 2010-12-16 |
United States Patent
Application |
20100317105 |
Kind Code |
A1 |
Zamore; Phillip D. ; et
al. |
December 16, 2010 |
Methods and compositions for controlling efficacy of RNA
silencing
Abstract
Based at least in part on an understanding of the mechanisms by
which small RNAs (e.g., naturally-occurring miRNAs) mediate RNA
silencing in plants, rules have been established for determining,
for example, the degree of complementarity required between an
RNAi-mediating agent and its target, i.e., whether mismatches are
tolerated, the number of mismatches tolerated, the effect of the
position of the mismatches, etc. Such rules are useful, in
particular, in the design of improved RNAi-mediating agents which
allow for more exact control of the efficacy of RNA silencing.
Inventors: |
Zamore; Phillip D.;
(Northboro, MA) ; Tang; Guiliang; (Worcester,
MA) |
Correspondence
Address: |
LAHIVE & COCKFIELD, LLP;FLOOR 30, SUITE 3000
ONE POST OFFICE SQUARE
BOSTON
MA
02109
US
|
Assignee: |
UNIVERSITY OF MASSACHUSETTS
BOSTON
MA
|
Family ID: |
33551539 |
Appl. No.: |
12/802536 |
Filed: |
June 7, 2010 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10859337 |
Jun 2, 2004 |
7459547 |
|
|
12802536 |
|
|
|
|
60475386 |
Jun 2, 2003 |
|
|
|
Current U.S.
Class: |
435/366 ;
435/320.1; 435/325; 536/24.5 |
Current CPC
Class: |
Y02A 40/146 20180101;
C12N 15/113 20130101; C12N 2310/335 20130101; A61P 43/00 20180101;
C12N 15/111 20130101; C12N 15/8261 20130101; C12N 2310/14 20130101;
C12N 15/8218 20130101; C12N 2320/50 20130101 |
Class at
Publication: |
435/366 ;
536/24.5; 435/320.1; 435/325 |
International
Class: |
C07H 21/02 20060101
C07H021/02; C12N 15/63 20060101 C12N015/63; C12N 5/10 20060101
C12N005/10 |
Goverment Interests
GOVERNMENT RIGHTS
[0002] This invention was made at least in part with government
support under grant no. GM62862-01 awarded by the National
Institutes of Health. The government may have certain rights in
this invention.
Claims
1.-11. (canceled)
12. An RNAi agent comprising an antisense strand that is
complementary to a target sequence selected from an mRNA expressed
in a mammalian cell or plant cell, wherein at least one nucleotide
within 5 or fewer nucleotides from the 3' end of the antisense
strand is substituted with a nucleotide which forms a G:U wobble
base pair when the antisense strand is base paired with the target
sequence.
13. The RNAi agent of claim 12, wherein the at least one
substitution is an A.fwdarw.G substitution, the G forming a G:U
wobble base pair with a U in the target mRNA sequence.
14. The RNAi agent of claim 13, wherein the at least one
substitution is a C.fwdarw.U substitution, the U forming a G:U
wobble base pair with a G in the target mRNA sequence.
15.-16. (canceled)
17. The RNAi agent of claim 12, wherein at least two nucleotides
within 5 or fewer nucleotides from the 3' end of the antisense
strand are substituted.
18.-20. (canceled)
21. The RNAi agent of claim 12, wherein at least three, four or
five nucleotides are substituted within 5 or fewer nucleotides from
the 3' end of the antisense strand.
22. The RNAi agent of claim 12, wherein the agent is chemically
synthesized.
23. The RNAi agent of claim 12, wherein the agent is chemically
synthesized.
24. The RNAi agent of claim 12, wherein the agent is derived from
an engineered precursor.
25.-26. (canceled)
27. A composition comprising the RNAi agent of claim 12, formulated
to facilitate entry of the agent into a cell.
28. A pharmaceutical composition comprising the RNAi agent of claim
12.
29. An engineered pre-miRNA comprising the RNAi agent of claim
12.
30. A vector encoding the pre-miRNA of claim 29.
31. A pri-miRNA comprising the pre-miRNA of claim 30.
32. A vector encoding the pre-miRNA of claim 31.
33. A small hairpin RNA (shRNA) comprising nucleotide sequence
identical to the RNAi agent of claim 12.
34. A vector encoding the shRNA of claim 33.
35. A cell comprising the vector of claim 32 or 34.
36. The cell of claim 35, which is a mammalian cell.
37. The cell of claim 36, which is a human cell.
38. A transgene encoding the shRNA of claim 33.
39.-44. (canceled)
45. The RNAi agent of claim 12, wherein the RNAi agent is a small
interfering RNA (siRNA).
46. The RNAi agent of claim 45, wherein the at least one
substitution is an A.fwdarw.G substitution, the G forming a G:U
wobble base pair with a U in the target mRNA sequence.
47. The RNAi agent of claim 45, wherein the at least one
substitution is a C.fwdarw.U substitution, the U forming a G:U
wobble base pair with a G in the target mRNA sequence.
48. The RNAi agent of claim 12, wherein the RNAi agent is a
microRNA (miRNA).
49. The RNAi agent of claim 48, wherein the RNAi agent is a plant
miRNA.
50. The RNAi agent of claim 48, wherein the RNAi agent is an animal
miRNA.
51. The RNAi agent of claim 24, wherein the engineered precursor is
a miRNA precursor (pre-miRNA).
52. The RNAi agent of claim 51, wherein the pre miRNA is encoded by
a vector.
53. The RNAi agent of claim 24, wherein the engineered precursor is
a small hairpin RNA (shRNA) comprising a stem portion comprising
the antisense strand.
54. The RNAi agent of claim 53, wherein the at least one
substitution is an A.fwdarw.G substitution, the G forming the G:U
wobble base pair with a U in the target mRNA sequence.
55. The RNAi agent of claim 53, wherein the at least one
substitution is a C.fwdarw.U substitution, the U forming the G:U
wobble base pair with a G in the target mRNA sequence.
56. The RNAi agent of claim 53, wherein the shRNA is encoded by a
vector.
57. The RNAi agent of claim 12, wherein the cell is a mammalian
cell.
58. The RNAi agent of claim 12, wherein the cell is a human
cell.
59. The RNAi agent of claim 12, wherein the cell is a plant
cell.
60. The RNAi agent of claim 12, wherein the mRNA specifies the
amino acid sequence of a cellular protein.
61. The RNAi agent of claim 12, wherein the mRNA specifies the
amino acid sequence of an extracellular protein.
62. The RNAi agent of claim 12, wherein the mRNA specifies the
amino acid sequence of a pathogen-associated protein.
63. The RNAi agent of claim 62, wherein the pathogen-associated
protein is a viral protein.
64. The RNAi agent of claim 62, wherein the pathogen-associated
protein is expressed by a host of a pathogen.
65. The RNAi agent of claim 62, wherein the mRNA specifies the
amino acid sequence of an endogenous protein.
66. The RNAi agent of claim 12, wherein the mRNA specifies the
amino acid sequence of a heterologous protein expressed in a
recombinant cell or a genetically altered organism.
67. The RNAi agent of claim 12, wherein the mRNA specifies the
amino acid sequence of a protein encoded by a transgene.
68. The RNAi agent of claim 12, wherein the mRNA specifies the
amino acid sequence of a protein encoded by a pathogen genome which
is capable of infecting a cell or an organism from which the cell
is derived.
Description
RELATED APPLICATIONS
[0001] This patent application claims the benefit of U.S.
Provisional Patent Application Ser. No. 60/475,386, entitled
"Methods and Compositions for Controlling Efficacy of RNA
Silencing", filed Jun. 2, 2003. The entire contents of the
above-referenced provisional patent applications are incorporated
herein by this reference.
BACKGROUND OF THE INVENTION
[0003] RNA interference (RNAi) in animals and basal eukaryotes,
quelling in fungi, and posttranscriptional gene silencing (PTGS) in
plants are examples of a broad family of phenomena collectively
called RNA silencing (Kooter et al. 1999; Li and Ding 2001; Matzke
et al. 2001; Vaucheret et al. 2001; Waterhouse et al. 2001; Hannon
2002; Plasterk 2002). The unifying features of RNA silencing
phenomena are the production of small (21-26 nt) RNAs that act as
specificity determinants for down-regulating gene expression
(Hamilton and Baulcombe 1999; Hammond et al. 2000; Parrish et al.
2000; Zamore et al. 2000; Djikeng et al. 2001; Parrish and Fire
2001; Tijsterman et al. 2002) and the requirement for one or more
members of the Argonaute family of proteins (or PPD proteins, named
for their characteristic PAZ and Piwi domains) (Tabara et al. 1999;
Fagard et al. 2000; Hammond et al. 2001; Hutvagner and Zamore 2002;
Kennerdell et al. 2002; Martinez et al. 2002a; Pal-Bhadra et al.
2002; Williams and Rubin 2002).
[0004] Small RNAs are generated in animals by members of the Dicer
family of double-stranded RNA (dsRNA)-specific endonucleases
(Bernstein et al. 2001; Billy et al. 2001; Grishok et al. 2001;
Ketting et al. 2001). Dicer family members are large, multidomain
proteins that contain putative RNA helicase, PAZ, two tandem
ribonuclease III (RNase III), and one or two dsRNA-binding domains.
The tandem RNase III domains are believed to mediate
endonucleolytic cleavage of dsRNA into small interfering RNAs
(siRNAs), the mediators of RNAi. In Drosophila and mammals, siRNAs,
together with one or more Argonaute proteins, form a protein-RNA
complex, the RNA-induced silencing complex (RISC), which mediates
the cleavage of target RNAs at sequences with extensive
complementarity to the siRNA (Hammond et al. 2000, 2001; Zamore et
al. 2000; Elbashir et al. 2001a,b,c; Nykanen et al. 2001; Hutvagner
and Zamore 2002; Martinez et al. 2002a).
[0005] In addition to Dicer and Argonaute proteins, RNA-dependent
RNA polymerase (RdRP) genes are required for RNA silencing in
Caenorhabditis elegans (Smardon et al. 2000; Sijen et al: 2001),
Neurospora crassa (Cogoni and Macino 1999), and Dictyostelium
discoideum (Martens et al. 2002), but likely not for RNAi in
Drosophila or mammals (Celotto and Graveley 2002; Chiu and Rana
2002; Holen et al. 2002; Martinez et al. 2002b; Schwarz et al.
2002; Roignant et al. 2003). In plants, PTGS initiated by
transgenes that overexpress an endogenous mRNA also requires a
putative RdRP, SGS2 (SDE1; Dalmay et al. 2000; Mourrain et al.
2000), although transgenes designed to generate dsRNA bypass this
requirement (Beclin et al. 2002). Similarly, silencing induced by
viruses replicating through a dsRNA intermediate (virus-induced
gene silencing, VIGS) does not require SGS2 (Dalmay et al.
2000).
[0006] Dicer in animals and CARPEL FACTORY (CAF, a Dicer homolog)
in plants also generate microRNAs (miRNAs), 20-24-nt,
single-stranded noncoding RNAs thought to regulate endogenous mRNA
expression (Lee et al. 1993; Reinhart et al. 2000, 2002; Grishok et
al. 2001; Hutvagner et al. 2001; Ketting et al. 2001;
Lagos-Quintana et al. 2001, 2002; Lau et al. 2001; Lee and Ambros
2001; Mourelatos et al. 2002; Park et al. 2002). miRNAs are
produced by Dicer cleavage of stem-loop precursor RNA transcripts
(pre-miRNAs); the miRNA can reside on either the 5' or 3' side of
the double-stranded stem (Lee et al. 1993; Pasquinelli et al. 2000;
Lagos-Quintana et al. 2001; Lau et al. 2001; Lee and Ambros 2001).
In animals, pre-miRNAs are transcribed as longer primary
transcripts (pri-miRNAs) that are processed in the nucleus into
compact, folded structures (pre-miRNAs), then exported to the
cytoplasm, where they are cleaved by Dicer to yield mature miRNAs
(Lee et al.,2002). Animal miRNAs are only partially complementary
to their target mRNAs; this partial complementarity has been
proposed to cause miRNAs to repress translation of their targets,
rather than direct target cleavage by the RNAi pathway (for review,
see Ruvkun 2001; Hutvagner and Zamore 2002). Plant miRNAs have far
greater complementarity to cellular mRNAs and have been proposed to
mediate target RNA cleavage via an RNAi-like mechanism (Llave et
al. 2002b; Rhoades et al. 2002).
SUMMARY OF THE INVENTION
[0007] The present invention is based, at least in part, on the
finding that extracts of wheat germ recapitulate many of the key
features of RNA silencing in plants. Using this in vitro system, it
is shown that in plants, ATP-dependent, Dicer-like enzymes cleave
dsRNA into small RNAs that have the structure of siRNAs. Unlike
Drosophila embryos or mammalian cells, plants convert dsRNA into
two distinct classes of siRNAs, long and short siRNAs Inhibitor
studies indicate that a different Dicer-like enzyme generates each
siRNA class. Furthermore, a wheat RdRP activity can synthesize
dsRNA using exogenous single-stranded RNA as a template without an
exogenous primer, and that this dsRNA is preferentially converted
into long siRNAs.
[0008] Wheat germ extracts also contain an endogenous RISC
programmed with a miRNA which can direct efficient cleavage of the
wild-type Arabidopsis PHAVOLUTA (PHV) mRNA sequence, but not that
of a previously described dominant PHV mutant. Interestingly, exact
complementarity between the miRNA and target mRNA is not necessary
for the miRNA to direct efficient target cleavage. An siRNA
containing three mismatches with its target mRNA, was found to be
at least as potent as an siRNA with perfect complementarity to the
same target sequence, demonstrating that mismatches per se do not
block target cleavage. Rather, the specific position and sequence
of siRNA:target RNA mismatches determine if they permit or disrupt
RNAi. It is proposed that three or four mismatches between an miRNA
(or the guide strand of an siRNA duplex) and its target RNA,
properly placed so as to still permit mRNA cleavage, facilitates
the release of cleaved target RNA from the RISC complex, thereby
increasing the rate of enzyme turnover. In particular, the
efficiency of cleavage is greater when a G:U base pair, referred to
also as a G:U wobble, is present near the 5' or 3' end of the
complex formed between the miRNA and the target. Understanding the
natural mechanism by which miRNAs efficiently mediate RNAi in
plants allows for the design of improved RNAi agents for use in
mediating RNAi not only in plants, but in eukaryotes (in
particular, in mammals).
[0009] Accordingly, the present invention features methods of
enhancing the efficacy of an RNAi agent comprising substituting a
at least one terminal nucleotide with a nucleotide that does not
form a Watson-Crick base pair with the corresponding nucleotide in
a target mRNA. The invention also provides compositions comprising
RNAi agents, e.g., siRNAs, pre-miRNA, shRNAs, having nucleotide
substitutions for enhanced efficacy of RNAi, as well as vectors,
transgenes and cells comprising the RNAi agents. Further featured
is a Dicer-like enzyme, an extract comprising the enzyme, and
methods for their use. Kits for use in mediating RNAi comprising
the compositions of the invention are provided. Therapeutic methods
and pharmaceutical compositions are also provided.
[0010] Other features and advantages of the invention will be
apparent from the following detailed description and claims.
BRIEF DESCRIPTION OF THE DRAWINGS
[0011] FIG. 1. Arabidopsis thaliana small RNAs form two distinct
size classes. (A) Size distribution of small RNA clones. (B)
Sequence composition of the 5' ends of cloned small RNA as a
function of length.
[0012] FIG. 2. dsRNA is cleaved into two discrete classes of bona
fide siRNAs in plant extracts. (A) Upon incubation in wheat germ
extract, 32P-dsRNA was cleaved into small RNAs in a highly
processive reaction, as in fly embryo lysate. (B) 32P-dsRNA was
cleaved in wheat germ extract into two sizes of small RNAs,
.about.21-nt and 24-25-nt long, relative to synthetic
5'-32P-radiolabeled RNA markers. (C) 32P-dsRNA was cleaved in
cauliflower extract into two sizes of small RNAs. (D) Efficient
production of small RNAs in wheat germ extract required ATP. ATP,
creatine phosphate, and creatine kinase were included (+ATP) or
omitted ([-] ATP) from the reaction. (E) Small RNAs produced in
vitro in wheat germ extract are double-stranded. 32P-dsRNA was
incubated in wheat germ extract or Drosophila embryo lysate,
deproteinized at room temperature without organic extraction, then
analyzed by gel filtration on a Superdex 200 HR column. The peak
positions of double- and single-stranded synthetic siRNA standards
are indicated. (F) Scheme for detecting 3' overhanging ends on
small RNAs by nuclease protection. (G) Small RNAs produced by
incubation of 32P-dsRNA in wheat germ extract have .about.2-nt 3'
overhanging ends and a central double-stranded body,
characteristics of the products of Dicer cleavage. Brackets
indicate the nuclease digestion products. The positions of
5'-32P-radiolabeled size markers are indicated at left.
3'-phosphorylated markers were generated by reacting synthetic RNAs
one base longer than indicated with periodate, followed by
[beta]-elimination, yielding an RNA one base shorter, but bearing a
3'-phosphate in place of a hydroxyl.
[0013] FIG. 3. The two classes of plant siRNAs are produced by
different enzymes. (A,B) 32P-dsRNA was incubated in either
Drosophila embryo lysate or wheat germ extract for 3 hours in the
presence of increasing concentrations of 21-nt or 25-nt siRNA
duplexes, then analyzed by denaturing gel electrophoresis and
quantified. The siRNA concentration is presented in micromoles
nucleotide per liter to permit comparison of the different lengths
of siRNA duplex used. The relative efficiency of the reactions was
determined by fitting the data to a single exponential and
comparing the rate constant. (A) 21-nt siRNA duplexes (filled
circles) are more efficient inhibitors of Drosophila Dicer than
25-nt siRNA duplexes (open circles). (B) Production of 25-nt siRNAs
in wheat germ extract (squares) was inhibited more efficiently by a
25-nt synthetic siRNA duplex (red symbols) than by a 21-nt siRNA
duplex (black symbols), but production of the 21-nt siRNAs
(circles) was not inhibited by either synthetic siRNA duplex. (C)
dsRNA competitor inhibited the production of both 25-nt (black
squares) and 21-nt (red circles) siRNAs in wheat germ extract.
Production of siRNAs in Drosophila embryo lysate (blue circles) was
also inhibited by dsRNA competitor, but to a lower extent, perhaps
reflecting a higher concentration of Dicer in Drosophila embryo
lysate than in wheat germ extract.
[0014] FIG. 4. Wheat germ extract contains an RdRP activity.
Single-stranded RNA of the indicated size and cap structure was
incubated in wheat germ extract for 3 hours in the presence of ATP,
CTP, GTP, and .alpha.-32P-UTP. The products of the reaction were
analyzed by denaturing polyacrylamide gel electrophoresis.
[0015] FIG. 5. Characterization of the wheat RdRP activity. (A)
Wheat germ extract, but not Drosophila embryo lysate, contains an
RdRP activity that can extend a primer. The arrowhead indicates the
primer extension product produced when an antisense 21-nt RNA
primer, but not a sense primer, was incubated in the wheat germ
extract with a 592-nt single-stranded RNA. The primers correspond
to nucleotides 511-532 of the RNA template. (B) RdRP-dependent
production of small RNAs in wheat germ extract. Increasing
concentrations of a 2.7-kb Photinus pyralis (Pp) luciferase mRNA
triggered production of 32P-radiolabeled small RNAs in wheat germ
extract when ribonucleotide triphosphates (including
.alpha.-32P-UTP), but not when 3'-deoxy GTP and 3'-deoxy CTP were
included in the reaction. (C) Production of newly synthesized small
RNAs was more efficiently inhibited by a 25-nt synthetic siRNA
duplex (open circles) than by a 21-nt synthetic siRNA duplex (open
squares).
[0016] FIG. 6. miR165/166 in wheat germ extract. (A) A wheat
ortholog of miR165 or miR166 is present in wheat germ extract.
Quantitative Northern hybridization analysis using synthetic miR165
RNA concentration standards, antisense miR165 RNA, and total RNA
prepared from 30 .mu.L of wheat germ extract or Drosophila embryo
lysate. (B) Quantitation of the data in A. Closed circles,
synthetic miR165 standards; open circle, RNA extracted from 30
.mu.L of wheat germ extract. The line shows a linear fit of the
four highest concentration standards. (C) Schematic of the RNA
targets, indicating the sequences of the miR165/166-complementary
regions of wild-type PHV and mutant phv mRNAs, miR165, miR166, and
the siRNA antisense strands used in FIG. 7C.
[0017] FIG. 7. An endogenous wheat nuclease efficiently cleaves
wild-type but not mutant PHV target RNAs. (A) When incubated in
wheat germ extract, 5'-radiolabeled target RNA containing wild-type
PHV sequences was cleaved within the PHV sequences complementary to
miR165 and miR166. In contrast, a dominant G.fwdarw.A mutant target
RNA was cleaved inefficiently. (B) Quantification of the data in A.
(Circles) Wild-type PHV sequences; (squares) mutant sequences;
(filled symbols) full-length target RNA; (open symbols) 5' cleavage
product. The difference in cleavage rates is .about.14-fold. (C)
Analysis of PHV cleavage in an in vitro RNAi reaction programmed
with siRNA duplexes and Drosophila embryo lysate. The identity of
the antisense strand of the siRNA duplex and the RNA target used is
indicated above the gel and described in FIG. 6C.
[0018] FIG. 8. Quantification of the fraction of target mRNA
cleaved by siRNA having perfect complementarity to target versus
siRNA having two mismatched with target (miR 165 siRNA).
DETAILED DESCRIPTION OF THE INVENTION
[0019] The present invention is based, at least in part, on the
discovery that extracts of wheat germ, introduced for the study of
translation and protein translocation in the 1970s (Roberts and
Paterson 1973), recapitulate many of the key features of RNA
silencing in plants. Using this in vitro system, the instant
inventors have shown that in plants, ATP-dependent, Dicer-like
enzymes cleave dsRNA into small RNAs that have the structure of
siRNAs. Unlike Drosophila embryos or mammalian cells, plants
convert dsRNA into two distinct classes of siRNAs, long (e.g.,
21-22 nucleotides) and short (e.g., 24-25 nucleotides) siRNAs.
Inhibitor studies indicate that a second Dicer-like enzyme
functions in plants to generate each siRNA class. The instant
inventors have also shown that a wheat RdRP activity can synthesize
dsRNA using exogenous single-stranded RNA as a template without an
exogenous primer, and that this dsRNA is preferentially converted
into long siRNAs.
[0020] Finally, it is demonstrated that wheat germ extracts contain
an endogenous RISC programmed with a miRNA. This endogenous miRNA
complex has sufficient sequence information to direct efficient
cleavage of the wild-type Arabidopsis PHA VOLUTA (PHV) mRNA
sequence, but not that of a previously described dominant PHV
mutant that perturbs leaf development. Based on an understanding of
the mechanism by which miRNAs direct RNAi in plants, new siRNAs can
be designed for regulating RNAi in plants. More importantly, siRNAs
can be designed, for example, based on the sequence of various
eukaryotic miRNAs, such siRNAs having utility in mediating RNAi in
mammals, and particularly, in humans.
[0021] Accordingly, in one aspect, the instant invention provides a
method of enhancing the efficacy of an RNAi agent, involving
substituting at least one terminal nucleotide of the RNAi agent
with a nucleotide which does not form a Watson-Crick base pair with
the corresponding nucleotide in a target mRNA, such that efficacy
is enhanced.
[0022] In one embodiment, the substituted nucleotide forms a G:U
wobble base pair with the target mRNA. In one preferred embodiment,
the substitution is an A.fwdarw.G substitution, the G forming a G:U
wobble base pair with a U in the corresponding target mRNA. In
another preferred embodiment, the substitution is a C.fwdarw.U
substitution, the U forming a G:U wobble base pair with a G in the
corresponding target mRNA.
[0023] In one embodiment, the terminal nucleotide is within 5 or
fewer nucleotides from the 5' end of the RNAi agent. In a related
embodiment, the terminal nucleotide is within 5 or fewer
nucleotides from the 3' end of the RNAi agent.
[0024] In one embodiment, at least two terminal nucleotides are
substituted. In preferred embodiments, the two terminal nucleotides
substituted are at the 5' end of the RNAi agent or at the 3' end of
the RNAi agent. In another preferred embodiment, a first terminal
nucleotide substituted is at the 5' end of the RNAi agent and a
second terminal nucleotide substituted is at the 3' end of the RNAi
agent.
[0025] In one embodiment, at least three, four or five terminal
nucleotides are substituted.
[0026] In another aspect, the instant invention provides a RNAi
agent having at least one terminal nucleotide of the RNAi agent
substituted with a nucleotide which forms a G:U wobble base pair
with the corresponding nucleotide in a target mRNA.
[0027] In one embodiment of this aspect of the invention, the
substitution is an A.fwdarw.G substitution, the G forming a G:U
wobble base pair with a U in the corresponding target mRNA. In
another embodiment, the substitution is a C.fwdarw.U, substitution,
the U forming a G:U wobble base pair with a G in the corresponding
target mRNA.
[0028] In other embodiments, the terminal nucleotide is within 5 or
fewer nucleotides from the 5' end of the RNAi agent or from the 3'
end of the RNAi agent.
[0029] In yet other embodiments, at least two terminal nucleotides
are substituted. In preferred embodiments, the two terminal
nucleotides substituted are at the 5' end of the RNAi agent or at
the 3' end of the RNAi agent. In other preferred embodiments, a
first terminal nucleotide substituted is at the 5' end of the RNAi
agent and a second terminal nucleotide substituted is at the 3' end
of the RNAi agent.
[0030] In other embodiments, at least three, four or five terminal
nucleotides are substituted.
[0031] In various embodiments of this aspect of the invention, the
RNAi agent is chemically synthesized, enzymatically synthesized, or
derived from an engineered precursor.
[0032] In another aspect, the instant invention provides a method
of enhancing silencing of a target mRNA, comprising contacting a
cell having an RNAi pathway with the RNAi agent of any one of the
preceding claims under conditions such that silencing is
enhanced.
[0033] In yet another aspect, the instant invention provides a
method of enhancing silencing of a target mRNA in a subject,
comprising administering to the subject a pharmaceutical
composition comprising the RNAi agent of any one of the preceding
claims such that silencing is enhanced.
[0034] In certain embodiments of the invention, compositions are
provided comprising the RNAi agents of the invention formulated to
facilitate entry of the agent into a cell. Pharmaceutical
compositions comprising the RNAi agents of the invention are also
provided.
[0035] In other embodiments, the instant invention provides
engineered pre-miRNA comprising the RNAi agent of any one of the
preceding claims, and vectors encoding the pre-miRNA.
[0036] In related embodiments, the instant invention provides a
pri-miRNA comprising the pre-miRNA of the invention, and a vector
encoding the pri-miRNA.
[0037] In yet other embodiments, the invention provides a small
hairpin RNA (shRNA) comprising nucleotide sequence identical to any
of the RNAi agents of the instant invention, a vector encoding the
shRNA, and a transgene encoding the shRNA.
[0038] The instant invention further provides a cell, e.g., a
mammalian cell, preferably a human cell, comprising the vectors of
the invention 35.
[0039] In another aspect, the instant invention provides an
isolated Arabidopsis thaliana Dicer-like enzyme capable of cleaving
a long dsRNA substrate into short, 24-25 nucleotide dsRNA products,
the activity of said enzyme being inhibited in the presence of said
dsRNA products. In a related aspect, the instant invention provides
a method of generating a RNAi agent. 24-25 nucleotides in length,
comprising incubating a dsRNA substrate with the enzyme of the
invention, such that the agent is generated. Also provided is an
Arabidopsis thaliana cell-free extract comprising the enzyme of the
invention. In a related aspect, a method is provided of generating
a RNAi agent 24-25 nucleotides in length, comprising incubating a
dsRNA substrate with the extract of the invention, such that the
agent is generated.
[0040] In a certain embodiment of the instant invention, a kit is
provided for use in mediating RNAi, comprising the enzyme or the
extract of the invention, and instructions for use.
[0041] So that the invention may be more readily understood,
certain terms are first defined.
[0042] The term "nucleoside" refers to a molecule having a purine
or pyrimidine base covalently linked to a ribose or deoxyribose
sugar. Exemplary nucleosides include adenosine, guanosine,
cytidine, uridine and thymidine. Additional exemplary nucleosides
include inosine, 1-methyl inosine, pseudouridine,
5,6-dihydrouridine, ribothymidine, .sup.2N-methylguanosine and
.sup.2,2N,N-dimethylguanosine (also referred to as "rare"
nucleosides). The term "nucleotide" refers to a nucleoside having
one or more phosphate groups joined in ester linkages to the sugar
moiety. Exemplary nucleotides include nucleoside monophosphates,
diphosphates and triphosphates. The terms "polynucleotide" and
"nucleic acid molecule" are used interchangeably herein and refer
to a polymer of nucleotides joined together by a phosphodiester
linkage between 5' and 3' carbon atoms.
[0043] The term "RNA" or "RNA molecule" or "ribonucleic acid
molecule" refers to a polymer of ribonucleotides. The term "DNA" or
"DNA molecule" or deoxyribonucleic acid molecule" refers to a
polymer of deoxyribonucleotides. DNA and RNA can be synthesized
naturally (e.g., by DNA replication or transcription of DNA,
respectively). RNA can be post-transcriptionally modified. DNA and
RNA can also be chemically synthesized. DNA and RNA can be
single-stranded (i.e., ssRNA and ssDNA, respectively) or
multi-stranded (e.g., double stranded, i.e., dsRNA and dsDNA,
respectively). "mRNA" or "messenger RNA" is single-stranded RNA
that specifies the amino acid sequence of one or more polypeptide
chains. This information is translated during protein synthesis
when ribosomes bind to the mRNA.
[0044] As used herein, the term "small interfering RNA" ("siRNA")
(also referred to in the art as "short interfering RNAs") refers to
an RNA (or RNA analog) comprising between about 10-50 nucleotides
(or nucleotide analogs) which is capable of directing or mediating
RNA interference. Preferably, an siRNA comprises between about
15-30 nucleotides or nucleotide analogs, more preferably between
about 16-25 nucleotides (or nucleotide analogs), even more
preferably between about 18-23 nucleotides (or nucleotide analogs),
and even more preferably between about 19-22 nucleotides (or
nucleotide analogs) (e.g., 19, 20, 21 or 22 nucleotides or
nucleotide analogs). The term "short" siRNA refers to a siRNA
comprising .about.21 nucleotides (or nucleotide analogs), for
example, 19, 20, 21 or 22 nucleotides. The term "long" siRNA refers
to a siRNA comprising .about.24-25 nucleotides, for example, 23,
24, 25 or 26 nucleotides. Short siRNAs may, in some instances,
include fewer than 19 nucleotides, e.g., 16, 17 or 18 nucleotides,
provided that the shorter siRNA retains the ability to mediate
RNAi. Likewise, long siRNAs may, in some instances, include more
than 26 nucleotides, provided that the longer siRNA retains the
ability to mediate RNAi absent further processing, e.g., enzymatic
processing, to a short siRNA.
[0045] The term "nucleotide analog" or "altered nucleotide" or
"modified nucleotide" refers to a non-standard nucleotide,
including non-naturally occurring ribonucleotides or
deoxyribonucleotides. Preferred nucleotide analogs are modified at
any position so as to alter certain chemical properties of the
nucleotide yet retain the ability of the nucleotide analog to
perform its intended function. Examples of positions of the
nucleotide which may be derivitized include the 5 position, e.g.,
5-(2-amino)propyl uridine, 5-bromo uridine, 5-propyne uridine,
5-propenyl uridine, etc.; the 6 position, e.g., 6-(2-amino)propyl
uridine; the 8-position for adenosine and/or guanosines, e.g.,
8-bromo guanosine, 8-chloro guanosine, 8-fluoroguanosine, etc.
Nucleotide analogs also include deaza nucleotides, e.g.,
7-deaza-adenosine; O- and N-modified (e.g., alkylated, e.g.,
N6-methyl adenosine, or as otherwise known in the art) nucleotides;
and other heterocyclically modified nucleotide analogs such as
those described in Herdewijn, Antisense Nucleic Acid Drug Dev.,
2000 Aug. 10(4):297-310.
[0046] Nucleotide analogs may also comprise modifications to the
sugar portion of the nucleotides. For example the 2' OH-group may
be replaced by a group selected from H, OR, R, F, Cl, Br, I, SH,
SR, NH.sub.2, NHR, NR.sub.2, COOR, or OR, wherein R is substituted
or unsubstituted C.sub.1-C.sub.6 alkyl, alkenyl, alkynyl, aryl,
etc. Other possible modifications include those described in U.S.
Pat. Nos. 5,858,988, and 6,291,438.
[0047] The phosphate group of the nucleotide may also be modified,
e.g., by substituting one or more of the oxygens of the phosphate
group with sulfur (e.g., phosphorothioates), or by making other
substitutions which allow the nucleotide to perform its intended
function such as described in, for example, Eckstein, Antisense
Nucleic Acid Drug Dev. 2000 Apr. 10(2):117-21, Rusckowski et al.
Antisense Nucleic Acid Drug Dev. 2000 Oct. 10(5):333-45, Stein,
Antisense Nucleic Acid Drug Dev. 2001 Oct. 11(5): 317-25, Vorobjev
et al. Antisense Nucleic Acid Drug Dev. 2001 Apr. 11(2):77-85, and
U.S. Pat. No. 5,684,143. Certain of the above-referenced
modifications (e.g., phosphate group modifications) preferably
decrease the rate of hydrolysis of, for example, polynucleotides
comprising said analogs in vivo or in vitro.
[0048] The term "oligonucleotide" refers to a short polymer of
nucleotides and/or nucleotide analogs. The term "RNA analog" refers
to a polynucleotide (e.g., a chemically synthesized polynucleotide)
having at least one altered or modified nucleotide as compared to a
corresponding unaltered or unmodified RNA but retaining the same or
similar nature or function as the corresponding unaltered or
unmodified RNA. As discussed above, the oligonucleotides may be
linked with linkages which result in a lower rate of hydrolysis of
the RNA analog as compared to an RNA molecule with phosphodiester
linkages. For example, the nucleotides of the analog may comprise
methylenediol, ethylene diol, oxymethylthio, oxyethylthio,
oxycarbonyloxy, phosphorodiamidate, phophoroamidate, and/or
phosphorothioate linkages. Preferred RNA analogues include sugar-
and/or backbone-modified ribonucleotides and/or
deoxyribonucleotides. Such alterations or modifications can further
include addition of non-nucleotide material, such as to the end(s)
of the RNA or internally (at one or more nucleotides of the RNA).
An RNA analog need only be sufficiently similar to natural RNA that
it has the ability to mediate (mediates) RNA interference.
[0049] As used herein, the term "RNA interference" ("RNAi") refers
to a selective intracellular degradation of RNA. RNAi occurs in
cells naturally to remove foreign RNAs (e.g., viral RNAs). Natural
RNAi proceeds via fragments cleaved from free dsRNA which direct
the degradative mechanism to other similar RNA sequences.
Alternatively, RNAi can be initiated by the hand of man, for
example, to silence the expression of target genes.
[0050] A RNAi agent having a strand which is "sequence sufficiently
complementary to a target mRNA sequence to direct target-specific
RNA interference (RNAi)" means that the strand has a sequence
sufficient to trigger the destruction of the target mRNA by the
RNAi machinery or process.
[0051] The term "phosphorylated" means that at least one phosphate
group is attached to a chemical (e.g., organic) compound. Phosphate
groups can be attached, for example, to proteins or to sugar
moieties via the following reaction: free hydroxyl group+phosphate
donor.fwdarw.phosphate ester linkage. The term "5' phosphorylated"
is used to describe, for example, polynucleotides or
oligonucleotides having a phosphate group attached via ester
linkage to the C5 hydroxyl of the 5' sugar (e.g., the 5' ribose or
deoxyribose, or an analog of same). Mono-, di-, and triphosphates
are common. Also intended to be included within the scope of the
instant invention are phosphate group analogs which function in the
same or similar manner as the mono-, di-, or triphosphate groups
found in nature (see e.g., exemplified analogs.)
[0052] As used herein, the term "isolated RNA" (e.g., "isolated
siRNA" or "isolated siRNA precursor") refers to RNA molecules which
are substantially free of other cellular material, or culture
medium when produced by recombinant techniques, or substantially
free of chemical precursors or other chemicals when chemically
synthesized.
[0053] The term "in vitro" has its art recognized meaning, e.g.,
involving purified reagents or extracts, e.g., cell extracts. The
term "in vivo" also has its art recognized meaning, e.g., involving
living cells, e.g., immortalized cells, primary cells, cell lines,
and/or cells in an organism.
[0054] As used herein, the term "transgene" refers to any nucleic
acid molecule, which is inserted by artifice into a cell, and
becomes part of the genome of the organism that develops from the
cell. Such a transgene may include a gene that is partly or
entirely heterologous (i.e., foreign) to the transgenic organism,
or may represent a gene homologous to an endogenous gene of the
organism. The term "transgene" also means a nucleic acid molecule
that includes one or more selected nucleic acid sequences, e.g.,
DNAs, that encode one or more engineered RNA precursors, to be
expressed in a transgenic organism, e.g., animal, which is partly
or entirely heterologous, i.e., foreign, to the transgenic animal,
or homologous to an endogenous gene of the transgenic animal, but
which is designed to be inserted into the animal's genome at a
location which differs from that of the natural gene. A transgene
includes one or more promoters and any other DNA, such as introns,
necessary for expression of the selected micleic acid sequence, all
operably linked to the selected sequence, and may include an
enhancer sequence.
[0055] A gene "involved" in a disorder includes a gene, the normal
or aberrant expression or function of which effects or causes a
disease or disorder or at least one symptom of said disease or
disorder
[0056] The phrase "examining the function of a gene in a cell or
organism" refers to examining or studying the expression, activity,
function or phenotype arising therefrom.
[0057] Various methodologies of the instant invention include step
that involves comparing a value, level, feature, characteristic,
property, etc., to a "suitable control", referred to
interchangeably herein as an "appropriate control". A "suitable
control" or "appropriate control" is any control or standard
familiar to one of ordinary skill in the art useful for comparison
purposes. In one embodiment, a "suitable control" or "appropriate
control" is a value, level, feature, characteristic, property,
etc., determined prior to performing an RNAi methodology, as
described herein. For example, a transcription rate, mRNA level,
translation rate, protein level, biological activity, cellular
characteristic or property, genotype, phenotype, etc., can be
determined prior to introducing a RNAi agent of the invention into
a cell or organism. In another embodiment, a "suitable control" or
"appropriate control" is a value, level, feature, characteristic,
property, etc. determined in a cell or organism, e.g., a control or
normal cell or organism, exhibiting, for example, normal traits. In
yet another embodiment, a "suitable control" or "appropriate
control" is a predefined value, level, feature, characteristic,
property, etc.
[0058] Various aspects of the invention are described in further
detail in the following subsections.
[0059] I. RNA Molecules
[0060] The present invention features "RNAi agents", methods of
making said RNAi agents and methods (e.g., research and/or
therapeutic methods) for using said RNAi agents. The RNAi agents
can be siRNA molecules, precursor molecules (e.g., engineered
precursor molecules) that are processed into siRNA molecules, or
molecules (e.g., DNA molecules) that encode, for example, precursor
molecules (e.g., engineered precursor molecules)
[0061] Exemplary siRNA molecules have a length from about 10-50 or
more nucleotides. Preferably, siRNA molecule has a length from
about 15-45 or 15-30 nucleotides. More preferably, the siRNA
molecule has a length from about 16-25 or 18-23 nucleotides. The
siRNA molecules of the invention further comprise at least one
strand that has a sequence that is "sufficiently complementary" to
a target mRNA sequence to direct target-specific RNA interference
(RNAi), as defined herein, i.e., the strand has a sequence
sufficient to trigger the destruction of the target mRNA by the
RNAi machinery or process. Such a strand can be referred to as an
antisense strand in the context of a ds-siRNA molecule. The siRNA
molecule can be designed such that every residue is complementary
to a residue in the target molecule. Preferably, however, the siRNA
molecule is designed such that modified base pairing, in
particular, G:U base pairing (i.e., G:U "wobble" base pairing)
occurs between the strand of the siRNA molecule mediating RNAi and
the target mRNA.
[0062] In further embodiments, substitutions can be made within the
molecule to increase stability and/or enhance processing activity
of said molecule. Substitutions can be made within the strand or
can be made to residues a the ends of the strand. Preferably,
however, substitutions are not made in the central portion of the
strand as the sequence of this portion of the strand has been
determined to be essential to effecting cleavage of the
corresponding target mRNA. The 5'-terminus is, most preferably,
phosphorylated (i.e., comprises a phosphate, diphosphate, or
triphosphate group). The 3' end of an siRNA can be a hydroxyl group
although there is no requirement for a 3' hydroxyl group when the
active agent is a ss-siRNA molecule.
[0063] The target RNA cleavage reaction guided by siRNAs is highly
sequence specific. In general, siRNA containing a nucleotide
sequences identical to a portion of the target gene are preferred
for inhibition. However, 100% sequence identity between the siRNA
and the target gene is not required to practice the present
invention. Thus the invention has the advantage of being able to
tolerate sequence variations that might be expected due to genetic
mutation, strain polymorphism, or evolutionary divergence. For
example, siRNA sequences with insertions, deletions, and single
point mutations relative to the target sequence have also been
found to be effective for inhibition. Alternatively, siRNA
sequences with nucleotide analog substitutions or insertions can be
effective for inhibition.
[0064] Moreover, not all positions of a siRNA contribute equally to
target recognition. Mismatches in the center of the siRNA are most
critical and essentially abolish target RNA cleavage. In contrast,
the 3' nucleotides of the siRNA do not contribute significantly to
specificity of the target recognition. In particular, residues 3'
of the siRNA sequence which is complementary to the target RNA
(e.g., the guide sequence), are not critical for target RNA
cleavage.
[0065] Sequence identity may determined by sequence comparison and
alignment algorithms known in the art. To determine the percent
identity of two nucleic acid sequences (or of two amino acid
sequences), the sequences are aligned for optimal comparison
purposes (e.g., gaps can be introduced in the first sequence or
second sequence for optimal alignment). The nucleotides (or amino
acid residues) at corresponding nucleotide (or amino acid)
positions are then compared. When a position in the first sequence
is occupied by the same residue as the corresponding position in
the second sequence, then the molecules are identical at that
position. The percent identity between the two sequences is a
function of the number of identical positions shared by the
sequences (i.e., % homology=# of identical positions/total # of
positions.times.100), optionally penalizing the score for the
number of gaps introduced and/or length of gaps introduced.
[0066] The comparison of sequences and determination of percent
identity between two sequences can be accomplished using a
mathematical algorithm. In one embodiment, the alignment generated
over a certain portion of the sequence aligned having sufficient
identity but not over portions having low degree of identity (i.e.,
a local alignment). A preferred, non-limiting example of a local
alignment algorithm utilized for the comparison of sequences is the
algorithm of Karlin and Altschul (1990) Proc. Natl. Acad. Sci. USA
87:2264-68, modified as in Karlin and Altschul (1993) Proc. Natl.
Acad. Sci. USA 90:5873-77. Such an algorithm is incorporated into
the BLAST programs (version 2.0) of Altschul, et al. (1990) J. Mol.
Biol. 215:403-10.
[0067] In another embodiment, the alignment is optimized by
introducing appropriate gaps and percent identity is determined
over the length of the aligned sequences (i.e., a gapped
alignment). To obtain gapped alignments for comparison purposes,
Gapped BLAST can be utilized as described in Altschul et al.,
(1997) Nucleic Acids Res. 25(17):3389-3402. In another embodiment,
the alignment is optimized by introducing appropriate gaps and
percent identity is determined over the entire length of the
sequences aligned (i.e., a global alignment). A preferred,
non-limiting example of a mathematical algorithm utilized for the
global comparison of sequences is the algorithm of Myers and
Miller, CABIOS (1989). Such an algorithm is incorporated into the
ALIGN program (version 2.0) which is part of the GCG sequence
alignment software package. When utilizing the ALIGN program for
comparing amino acid sequences, a PAM120 weight residue table, a
gap length penalty of 12, and a gap penalty of 4 can be used.
[0068] Greater than 90% sequence identity, e.g., 91%, 92%, 93%,
94%, 95%, 96%, 97%, 98%, 99% or even 100% sequence identity,
between a strand of the RNAi agent and the portion of the target
gene is preferred. Alternatively, the RNAi agent may be defined
functionally as a nucleotide sequence (or oligonucleotide sequence)
that is capable of hybridizing with a portion of the target gene
transcript (e.g., 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA,
50.degree. C. or 70.degree. C. hybridization for 12-16 hours;
followed by washing). Additional preferred hybridization conditions
include hybridization at 70.degree. C. in 1.times.SSC or 50.degree.
C. in 1.times.SSC, 50% formamide followed by washing at 70.degree.
C. in 0.3.times.SSC or hybridization at 70.degree. C. in
4.times.SSC or 50.degree. C. in 4.times.SSC, 50% formamide followed
by washing at 67.degree. C. in 1.times.SSC. The hybridization
temperature for hybrids anticipated to be less than 50 base pairs
in length should be 5-10.degree. C. less than the melting
temperature (Tm) of the hybrid, where Tm is determined according to
the following equations. For hybrids less than 18 base pairs in
length, Tm(.degree. C.)=2(# of A+T bases)+4(# of G+C bases). For
hybrids between 18 and 49 base pairs in length, Tm(.degree.
C.)=81.5+16.6 (log 10[Na+])+0.41 (% G+C)-(600/N), where N is the
number of bases in the hybrid, and [Na+] is the concentration of
sodium ions in the hybridization buffer ([Na+] for
1.times.SSC=0.165 M). Additional examples of stringency conditions
for polynucleotide hybridization are provided in Sambrook, J., E.
F. Fritsch, and T. Maniatis, 1989, Molecular Cloning: A Laboratory
Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor,
N.Y., chapters 9 and 11, and Current Protocols in Molecular
Biology, 1995, F. M. Ausubel et al., eds., John Wiley & Sons,
Inc., sections 2.10 and 6.3-6.4, incorporated herein by reference.
The length of the identical nucleotide sequences may be at least
about 10, 12, 15, 17, 20, 22, 25, 27, 30, 32, 35, 37, 40, 42, 45,
47 or 50 bases.
[0069] In a preferred aspect, the RNA molecules of the present
invention are modified to improve stability in serum or in growth
medium for cell cultures. In order to enhance the stability, the
3'-residues may be stabilized against degradation, e.g., they may
be selected such that they consist of purine nucleotides,
particularly adenosine or guanosine nucleotides. Alternatively,
substitution of pyrimidine nucleotides by modified analogues, e.g.,
substitution of uridine by 2'-deoxythymidine is tolerated and does
not affect the efficiency of RNA interference. For example, the
absence of a 2' hydroxyl may significantly enhance the nuclease
resistance of the RNA agents in tissue culture medium.
[0070] In an especially preferred embodiment of the present
invention the RNA molecule may contain at least one modified
nucleotide analogue. The nucleotide analogues may be located at
positions where the target-specific activity, e.g., the RNAi
mediating activity is not substantially effected, e.g., in a region
at the 5'-end and/or the 3'-end of the RNA molecule. Particularly,
the ends may be stabilized by incorporating modified nucleotide
analogues.
[0071] Preferred nucleotide analogues include sugar- and/or
backbone-modified ribonucleotides (i.e., include modifications to
the phosphate-sugar backbone). For example, the phosphodiester
linkages of natural RNA may be modified to include at least one of
a nitrogen or sulfur heteroatom. In preferred backbone-modified
ribonucleotides the phosphoester group connecting to adjacent
ribonucleotides is replaced by a modified group, e.g., of
phosphothioate group. In preferred sugar-modified ribonucleotides,
the 2' OH-group is replaced by a group selected from H, OR, R,
halo, SH, SR, NH.sub.2, NHR, NR.sub.2 or ON, wherein R is
C.sub.1-C.sub.6 alkyl, alkenyl or alkynyl and halo is F, Cl, Br or
I.
[0072] Also preferred are nucleobase-modified ribonucleotides,
i.e., ribonucleotides, containing at least one non-naturally
occurring nucleobase instead of a naturally occurring nucleobase.
Bases may be modified to block the activity of adenosine deaminase.
Exemplary modified nucleobases include, but are not limited to,
uridine and/or cytidine modified at the 5-position, e.g.,
5-(2-amino)propyl uridine, 5-bromo uridine; adenosine and/or
guanosines modified at the 8 position, e.g., 8-bromo guanosine;
deaza nucleotides, e.g., 7-deaza-adenosine; O- and N-alkylated
nucleotides, e.g., N6-methyl adenosine are suitable. It should be
noted that the above modifications may be combined.
[0073] RNA may be produced enzymatically or by partial/total
organic synthesis, any modified nibonucleotide can be introduced by
in vitro enzymatic or organic synthesis. In one embodiment, a RNAi
agent is prepared chemically. Methods of synthesizing RNA molecules
are known in the art, in particular, the chemical synthesis methods
as de scribed in Verma and Eckstein (1998) Annul Rev. Biochem.
67:99-134. In another embodiment, a RNAi agent is prepared
enzymatically. For example, a ds-siRNA can be prepared by enzymatic
processing of a long ds RNA having sufficient complementarity to
the desired target mRNA. Processing of long ds RNA can be
accomplished in vitro, for example, using appropriate cellular
lysates and ds-siRNAs can be subsequently purified by gel
electrophoresis or gel filtration. ds-siRNA can then be denatured
according to art-recognized methodologies. In an exemplary
embodiment, RNA can be purified from a mixture by extraction with a
solvent or resin, precipitation, electrophoresis, chromatography,
or a combination thereof. Alternatively, the RNA may be used with
no or a minimum of purification to avoid losses due to sample
processing. Alternatively, the single-stranded RNAs can also be
prepared by enzymatic transcription from synthetic DNA templates or
from DNA plasmids isolated from recombinant bacteria. Typically,
phage RNA polymerases are used such as T7, T3 or SP6 RNA polymerase
(Milligan and Uhlenbeck (1989) Methods Enzymol. 180:51-62). The RNA
may be dried for storage or dissolved in an aqueous solution. The
solution may contain buffers or salts to inhibit annealing, and/or
promote stabilization of the single strands.
[0074] In one embodiment, the target mRNA of the invention
specifies the amino acid sequence of a cellular protein (e.g., a
nuclear, cytoplasmic, transmembrane, or membrane-associated
protein). In another embodiment, the target mRNA of the invention
specifies the amino acid sequence of an extracellular protein
(e.g., an extracellular matrix protein or secreted protein). As
used herein, the phrase "specifies the amino acid sequence" of a
protein means that the mRNA sequence is translated into the amino
acid sequence according to the rules of the genetic code. The
following classes of proteins are listed for illustrative purposes:
developmental proteins (e.g., adhesion molecules, cyclin kinase
inhibitors, Wnt family members, Pax family members, Winged helix
family members, Hox family members, cytokines/lymphokines and their
receptors, growth/differentiation factors and their receptors,
neurotransmitters and their receptors); oncogene-encoded proteins
(e.g., ABLI, BCLI, BCL2, BCL6, CBFA2, CBL, CSFIR, ERBA, ERBB,
EBRB2, ETSI, ETSI, ETV6, FGR, FOS, FYN, HCR, HRAS, JUN, KRAS, LCK,
LYN, MDM2, MLL, MYB, MYC, MYCLI, MYCN, NRAS, PIM I, PML, RET, SRC,
TALI, TCL3, and YES); tumor suppressor proteins (e.g., APC, BRCA1,
BRCA2, MADH4, MCC, NF I, NF2, RB I, TP53, and WTI); and enzymes
(e.g., ACC synthases and oxidases, ACP desaturases and
hydroxylases, ADP-glucose pyrophorylases, ATPases, alcohol
dehydrogenases, amylases, amyloglucosidases, catalases, cellulases,
chalcone synthases, chitinases, cyclooxygenases, decarboxylases,
dextriinases, DNA and RNA polymerases, galactosidases, glucanases,
glucose oxidases, granule-bound starch synthases, GTPases,
helicases, hernicellulases, integrases, inulinases, invertases,
isomerases, kinases, lactases, lipases, lipoxygenases, lysozymes,
nopaline synthases, octopine synthases, pectinesterases,
peroxidases, phosphatases, phospholipases, phosphorylases,
phytases, plant growth regulator synthases, polygalacturonases,
proteinases and peptidases, pullanases, recombinases, reverse
transcriptases, RUBISCOs, topoisomerases, and xylanases).
[0075] In a preferred aspect of the invention, the target mRNA
molecule of the invention specifies the amino acid sequence of a
protein associated with a pathological condition. For example, the
protein may be a pathogen-associated protein (e.g., a viral protein
involved in immunosuppression of the host, replication of the
pathogen, transmission of the pathogen, or maintenance of the
infection), or a host protein which facilitates entry of the
pathogen into the host, drug metabolism by the pathogen or host,
replication or integration of the pathogen's genome, establishment
or spread of infection in the host, or assembly of the next
generation of pathogen. Alternatively, the protein may be a
tumor-associated protein or an autoimmune disease-associated
protein.
[0076] In one embodiment, the target mRNA molecule of the invention
specifies the amino acid sequence of an endogenous protein (i.e., a
protein present in the genome of a cell or organism). In another
embodiment, the target mRNA molecule of the invention specified the
amino acid sequence of a heterologous protein expressed in a
recombinant cell or a genetically altered organism. In another
embodiment, the target mRNA molecule of the invention specified the
amino acid sequence of a protein encoded by a transgene (i.e., a
gene construct inserted at an ectopic site in the genome of the
cell). In yet another embodiment, the target mRNA molecule of the
invention specifies the amino acid sequence of a protein encoded by
a pathogen genome which is capable of infecting a cell or an
organism from which the cell is derived.
[0077] By inhibiting the expression of such proteins, valuable
information regarding the function of said proteins and therapeutic
benefits which may be obtained from said inhibition may be
obtained.
[0078] In one embodiment, RNAi agents are synthesized either in
vivo, in situ, or in vitro. Endogenous RNA polymerase of the cell
may mediate transcription in vivo or in situ, or cloned RNA
polymerase can be used for transcription in vivo or in vitro. For
transcription from a transgene in vivo or an expression construct,
a regulatory region (e.g., promoter, enhancer, silencer, splice
donor and acceptor, polyadenylation) may be used to transcribe the
RNAi agent. Inhibition may be targeted by specific transcription in
an organ, tissue, or cell type; stimulation of an environmental
condition (e.g., infection, stress, temperature, chemical
inducers); and/or engineering transcription at a developmental
stage or age. A transgenic organism that expresses an RNAi agent
from a recombinant construct may be produced by introducing the
construct into a zygote, an embryonic stem cell, or another
multipotent cell derived from the appropriate organism.
[0079] II. Short Hairpin RNAs (shRNAs)
[0080] In certain featured embodiments, the instant invention
features shRNAs which can be processed into siRNAs, for example, by
a cell's endogenous RNAi machinery. In contrast to short siRNA
duplexes, short hairpin RNAs (shRNAs) mimics the natural precursors
of miRNAs and enters at the top of the RNAi pathway. For this
reason, shRNAs are believed to mediate RNAi more efficiently by
being fed through the entire natural RNAi pathway.
[0081] 1. Engineered RNA Precursors that Generate siRNAs
[0082] Naturally-occurring miRNA precursors (pre-miRNA) have a
single strand that forms a duplex stem including two portions that
are generally complementary, and a loop, that connects the two
portions of the stem. In typical pre-miRNAs, the stem includes one
or more bulges, e.g., extra nucleotides that create a single
nucleotide "loop" in one portion of the stem, and/or one or more
unpaired nucleotides that create a gap in the hybridization of the
two portions of the stem to each other. Short hairpin RNAs, or
engineered RNA precursors, of the invention are artificial
constructs based on these naturally occurring pre-miRNAs, but which
are engineered to deliver desired siRNAs.
[0083] In shRNAs, or engineered precursor RNAs, of the instant
invention, one portion of the duplex stem is a nucleic acid
sequence that is complementary (or anti-sense) to the target mRNA.
Thus, engineered RNA precursors include a duplex stem with two
portions and a loop connecting the two stem portions. The two stem
portions are about 18 or 19 to about 25, 30, 35, 37, 38, 39, or 40
or more nucleotides in length. When used in mammalian cells, the
length of the stem portions should be less than about 30
nucleotides to avoid provoking non-specific responses like the
interferon pathway. In non-mammalian cells, the stem can be longer
than 30 nucleotides. In fact, the stem can include much larger
sections complementary to the target mRNA (up to, and including the
entire mRNA). The two portions of the duplex stem must be
sufficiently complementary to hybridize to form the duplex stem.
Thus, the two portions can be, but need not be, fully or perfectly
complementary. In addition, the two stem portions can be the same
length, or one portion can include an overhang of 1, 2, 3, or 4
micleotides. The overhanging nucleotides can include, for example,
uracils (Us), e.g., all Us. The loop in the shRNAs or engineered
RNA precursors may differ from natural pre-miRNA sequences by
modifying the loop sequence to increase or decrease the number of
paired nucleotides, or replacing all or part of the loop sequence
with a tetraloop or other loop sequences. Thus, the loop in the
shRNAs or engineered RNA precursors can be 2, 3, 4, 5, 6, 7, 8, 9,
or more, e.g., 15 or 20, or more nucleotides in length.
[0084] shRNAs of the invention include the sequences of the desired
siRNA duplex. The desired siRNA duplex, and thus both of the two
stem portions in the engineered RNA precursor, are selected by
methods known in the art. These include, but are not limited to,
selecting an 18, 19, 20, 21 nucleotide, or longer, sequence from
the target gene mRNA sequence from a region 100 to 200 or 300
nucleotides on the 3' side of the start of translation. In general,
the sequence can be selected from any portion of the mRNA from the
target gene, such as the 5' UTR (untranslated region), coding
sequence, or 3' UTR. This sequence can optionally follow
immediately after a region of the target gene containing two
adjacent AA nucleotides. The last two nucleotides of the 21 or so
nucleotide sequence can be selected to be UU (so that the
anti-sense strand of the siRNA begins with UU). This 21 or so
nucleotide sequence is used to create one portion of a duplex stem
in the engineered RNA precursor. This sequence can replace a stem
portion of a wild-type pre-stRNA sequence, e.g., enzymatically, or
is included in a complete sequence that is synthesized. For
example, one can synthesize DNA oligonucleotides that encode the
entire stem-loop engineered RNA precursor, or that encode just the
portion to be inserted into the duplex stem of the precursor, and
using restriction enzymes to build the engineered RNA precursor
construct, e.g., from a wild-type pre-stRNA.
[0085] Engineered RNA precursors include in the duplex stem the
21-22 or so nucleotide sequences of the siRNA desired to be
produced in vivo. Thus, the stem portion of the engineered RNA
precursor includes at least 18 or 19 nucleotide pairs corresponding
to the sequence of an exonic portion of the gene whose expression
is to be reduced or inhibited. The two 3' nucleotides flanking this
region of the stem are chosen so as to maximize the production of
the siRNA from the engineered RNA precursor, and to maximize the
efficacy of the resulting siRNA in targeting the corresponding mRNA
for destruction by RNAi in vivo and in vitro.
[0086] Another defining feature of these engineered RNA precursors
is that as a consequence of their length, sequence, and/or
structure, they do not induce sequence non-specific responses, such
as induction of the interferon response or apoptosis, or that they
induce a lower level of such sequence non-specific responses than
long, double-stranded RNA (>150 bp) that has been used to induce
RNAi. For example, the interferon response is triggered by dsRNA
longer than 30 base pairs.
[0087] 2. Transgenes Encoding Engineered RNA Precursors
[0088] The new engineered RNA precursors can be synthesized by
standard methods known in the art, e.g., by use of an automated DNA
synthesizer (such as are commercially available from Biosearch,
Applied Biosystems, etc.). These synthetic, engineered RNA
precursors can be used directly as described below or cloned into
expression vectors by methods known in the field. The engineered
RNA precursors should be delivered to cells in vitro or in vivo in
which it is desired to target a specific mRNA for destruction. A
number of methods have been developed for delivering DNA or RNA to
cells. For example, for in vivo delivery, molecules can be injected
directly into a tissue site or administered systemically. In vitro
delivery includes methods known in the art such as electroporation
and lipofection.
[0089] To achieve intracellular concentrations of the nucleic acid
molecule sufficient to suppress expression of endogenous mRNAs, one
can use, for example, a recombinant DNA construct in which the
oligonucleotide is placed under the control of a strong Pol III
(e.g., U6 or Pol III H1-RNA promoter) or Pol II promoter. The use
of such a construct to transfect target cells in vitro or in vivo
will result in the transcription of sufficient amounts of the
engineered RNA precursor to lead to the production of an siRNA that
can target a corresponding mRNA sequence for cleavage by RNAi to
decrease the expression of the gene encoding that mRNA. For
example, a vector can be introduced in vivo such that it is taken
up by a cell and directs the transcription of an engineered RNA
precursor. Such a vector can remain episomal or become
chromosomally integrated, as long as it can be transcribed to
produce the desired stRNA precursor.
[0090] Such vectors can be constructed by recombinant DNA
technology methods known in the art. Vectors can be plasmid, viral,
or other vectors known in the art such as those described herein,
used for replication and expression in mammalian cells or other
targeted cell types. The nucleic acid sequences encoding the
engineered RNA precursors can be prepared using known techniques.
For example, two synthetic DNA oligonucleotides can be synthesized
to create a novel gene encoding the entire engineered RNA
precursor. The DNA oligonucleotides, which will pair, leaving
appropriate `sticky ends` for cloning, can be inserted into a
restriction site in a plasmid that contains a promoter sequence
(e.g., a Pol II or a Pol III promoter) and appropriate terminator
sequences 3' to the engineered RNA precursor sequences (e.g., a
cleavage and polyadenylation signal sequence from SV40 or a Pol III
terminator sequence).
[0091] The invention also encompasses genetically engineered host
cells that contain any of the foregoing expression vectors and
thereby express the nucleic acid molecules of the invention in the
host cell. The host cells can be cultured using known techniques
and methods (see, e.g., Culture of Animal Cells (R. I. Freshney,
Alan R. Liss, Inc. 1987); Molecular Cloning, Sambrook et al. (Cold
Spring Harbor Laboratory Press, 1989)).
[0092] Successful introduction of the vectors of the invention into
host cells can be monitored using various known methods. For
example, transient transfection can be signaled with a reporter,
such as a fluorescent marker, such as Green Fluorescent Protein
(GFP). Stable transfection can be indicated using markers that
provide the transfected cell with resistance to specific
environmental factors (e.g., antibiotics and drugs), such as
hygromycin B resistance, e.g., in insect cells and in mammalian
cells.
[0093] 3. Regulatory Sequences
[0094] The expression of the engineered RNA precursors is driven by
regulatory sequences, and the vectors of the invention can include
any regulatory sequences known in the art to act in mammalian
cells, e.g., human or murine cells; in insect cells; in plant
cells; or other cells. The term regulatory sequence includes
promoters, enhancers, and other expression control elements. It
will be appreciated that the appropriate regulatory sequence
depends on such factors as the future use of the cell or transgenic
animal into which a sequence encoding an engineered RNA precursor
is being introduced, and the level of expression of the desired RNA
precursor. A person skilled in the art would be able to choose the
appropriate regulatory sequence. For example, the transgenic
animals described herein can be used to determine the role of a
test polypeptide or the engineered RNA precursors in a particular
cell type, e.g., a hematopoietic cell. In this case, a regulatory
sequence that drives expression of the transgene ubiquitously, or a
hematopoietic-specific regulatory sequence that expresses the
transgene only in hematopoietic cells, can be used. Expression of
the engineered RNA precursors in a hematopoietic cell means that
the cell is now susceptible to specific, targeted RNAi of a
particular gene. Examples of various regulatory sequences are
described below.
[0095] The regulatory sequences can be inducible or constitutive.
Suitable constitutive regulatory sequences include the regulatory
sequence of a housekeeping gene such as the .alpha.-actin
regulatory sequence, or may be of viral origin such as regulatory
sequences derived from mouse mammary tumor virus (MMTV) or
cytomegalovirus (CMV).
[0096] Alternatively, the regulatory sequence can direct transgene
expression in specific organs or cell types (see, e.g., Lasko et
al., 1992, Proc. Natl. Acad. Sci. USA 89:6232). Several
tissue-specific regulatory sequences are known in the art including
the albumin regulatory sequence for liver (Pinkert et al., 1987,
Genes Dev. 1:268276); the endothelin regulatory sequence for
endothelial cells (Lee, 1990, J. Biol. Chem. 265:10446-50); the
keratin regulatory sequence for epidermis; the myosin light chain-2
regulatory sequence for heart (Lee et al., 1992, J. Biol. Chem.
267:15875-85), and the insulin regulatory sequence for pancreas
(Bucchini et al., 1986, Proc. Natl. Acad. Sci. USA 83:2511-2515),
or the vav regulatory sequence for hematopoietic cells (Oligvy et
al., 1999, Proc. Natl. Acad. Sci. USA 96:14943-14948). Another
suitable regulatory sequence, which directs constitutive expression
of transgenes in cells of hematopoietic origin, is the murine MHC
class I regulatory sequence (Morello et al., 1986, EMBO J.
5:1877-1882). Since NMC expression is induced by cytokines,
expression of a test gene operably linked to this regulatory
sequence can be upregulated in the presence of cytokines.
[0097] In addition, expression of the transgene can be precisely
regulated, for example, by using an inducible regulatory sequence
and expression systems such as a regulatory sequence that is
sensitive to certain physiological regulators, e.g., circulating
glucose levels, or hormones (Docherty et al., 1994, FASEB J.
8:20-24). Such inducible expression systems, suitable for the
control of transgene expression in cells or in mammals such as
mice, include regulation by ecdysone, by estrogen, progesterone,
tetracycline, chemical inducers of dimerization, and
isopropyl-beta-D1-thiogalactopyranoside (IPTG) (collectively
referred to as "the regulatory molecule"). Each of these expression
systems is well described in the literature and permits expression
of the transgene throughout the animal in a manner controlled by
the presence or absence of the regulatory molecule. For a review of
inducible expression systems, see, e.g., Mills, 2001, Genes Devel.
15:1461-1467, and references cited therein.
[0098] The regulatory elements referred to above include, but are
not limited to, the cytomegalovirus hCMV immediate early gene, the
early or late promoters of SV40 adenovirus (Bernoist et al.,
Nature, 290:304, 1981), the tet system, the lac system, the trp
system, the TAC system, the TRC system, the major operator and
promoter regions of phage A, the control regions of fd coat
protein, the promoter for 3-phosphoglycerate kinase, the promoters
of acid phosphatase, and the promoters of the yeast .alpha.-mating
factors. Additional promoters include the promoter contained in the
3' long terminal repeat of Rous sarcoma virus (Yamamoto et al.,
Cell 22:787-797, 1988); the herpes thymidine kinase promoter
(Wagner et al., Proc. Natl. Acad. Sci. USA 78:1441, 1981); or the
regulatory sequences of the metallothionein gene (Brinster et al.,
Nature 296:39, 1988).
[0099] 4. Assay for Testing Engineered RNA Precursors
[0100] Drosophila embryo lysates can be used to determine if an
engineered RNA precursor was, in fact, the direct precursor of a
mature stRNA or siRNA. This lysate assay is described in Tuschl et
al., 1999, supra, Zamore et al., 2000, supra, and Hutvdgner et al.
2001, supra. These lysates recapitulate RNAi in vitro, thus
permitting investigation into whether the proposed precursor RNA
was cleaved into a mature stRNA or siRNA by RNAi-like mechanism.
Briefly, the precursor RNA is incubated with Drosophila embryo
lysate for various times, and then assayed for the production of
the mature siRNA or stRNA by primer extension or Northern
hybridization. As in the in vivo setting, mature RNA accumulates in
the cell-free reaction. Thus, an RNA corresponding to the proposed
precursor can be shown to be converted into a mature stRNA or siRNA
duplex in the Drosophila embryo lysate.
[0101] Furthermore, an engineered RNA precursor can be functionally
tested in the Drosophila embryo lysates. In this case, the
engineered RNA precursor is incubated in the lysate in the presence
of a 5' radiolabeled target mRNA in a standard in vitro RNAi
reaction for various lengths of time. The target mRNA can be 5'
radiolabeled using guanylyl transferase (as described in Tuschl et
al., 1999, supra and references therein) or other suitable methods.
The products of the in vitro reaction are then isolated and
analyzed on a denaturing acrylamide or agarose gel to determine if
the target mRNA has been cleaved in response to the presence of the
engineered RNA precursor in the reaction. The extent and position
of such cleavage of the mRNA target will indicate if the
engineering of the precursor created a pre-siRNA capable of
mediating sequence-specific RNAi.
[0102] III. Methods of Introducing RNAs, Vectors, and Host
Cells
[0103] Physical methods of introducing nucleic acids include
injection of a solution containing the RNA, bombardment by
particles covered by the RNA, soaking the cell or organism in a
solution of the RNA, or electroporation of cell membranes in the
presence of the RNA. A viral construct packaged into a viral
particle would accomplish both efficient introduction of an
expression construct into the cell and transcription of RNA encoded
by the expression construct. Other methods known in the art for
introducing nucleic acids to cells may be used, such as
lipid-mediated carrier transport, chemical-mediated transport, such
as calcium phosphate, and the like. Thus the RNA may be introduced
along with components that perform one or more of the following
activities: enhance RNA uptake by the cell, inhibit annealing of
single strands, stabilize the single strands, or other-wise
increase inhibition of the target gene.
[0104] RNA may be directly introduced into the cell (i.e.,
intracellularly); or introduced extracellularly into a cavity,
interstitial space, into the circulation of an organism, introduced
orally, or may be introduced by bathing a cell or organism in a
solution containing the RNA. Vascular or extravascular circulation,
the blood or lymph system, and the cerebrospinal fluid are sites
where the RNA may be introduced.
[0105] The cell with the target gene may be derived from or
contained in any organism. The organism may a plant, animal,
protozoan, bacterium, virus, or fungus. The plant may be a monocot,
dicot or gymnosperm; the animal may be a vertebrate or
invertebrate. Preferred microbes are those used in agriculture or
by industry, and those that are pathogenic for plants or animals.
Fungi include organisms in both the mold and yeast morphologies.
Plants include arabidopsis; field crops (e.g., alfalfa, barley,
bean, corn, cotton, flax, pea, rape, nice, rye, safflower, sorghum,
soybean, sunflower, tobacco, and wheat); vegetable crops (e.g.,
asparagus, beet, broccoli, cabbage, carrot, cauliflower, celery,
cucumber, eggplant, lettuce, onion, pepper, potato, pumpkin,
radish, spinach, squash, taro, tomato, and zucchini); fruit and nut
crops (e.g., almond, apple, apricot, banana, black-berry,
blueberry, cacao, cherry, coconut, cranberry, date, faJoa, filbert,
grape, grapefruit, guava, kiwi, lemon, lime, mango, melon,
nectarine, orange, papaya, passion fruit, peach, peanut, pear,
pineapple, pistachio, plum, raspberry, strawberry, tangerine,
walnut, and watermelon); and ornamentals (e.g., alder, ash, aspen,
azalea, birch, boxwood, camellia, carnation, chrysanthemum, elm,
fir, ivy, jasmine, juniper, oak, palm, poplar, pine, redwood,
rhododendron, rose, and rubber). Examples of vertebrate animals
include fish, mammal, cattle, goat, pig, sheep, rodent, hamster,
mouse, rat, primate, and human; invertebrate animals include
nematodes, other worms, drosophila, and other insects.
[0106] The cell having the target gene may be from the germ line or
somatic, totipotent or pluripotent, dividing or non-dividing,
parenchyma or epithelium, immortalized or transformed, or the like.
The cell may be a stem cell or a differentiated cell. Cell types
that are differentiated include adipocytes, fibroblasts, myocytes,
cardiomyocytes, endothelium, neurons, glia, blood cells,
megakaryocytes, lymphocytes, macrophages, neutrophils, eosinophils,
basophils, mast cells, leukocytes, granulocytes, keratinocytes,
chondrocytes, osteoblasts, osteoclasts, hepatocytes, and cells of
the endocrine or exocrine glands.
[0107] Depending on the particular target gene and the dose of
double stranded RNA material delivered, this process may provide
partial or complete loss of function for the target gene. A
reduction or loss of gene expression in at least 50%, 60%, 70%,
80%, 90%, 95% or 99% or more of targeted cells is ,exemplary.
Inhibition of gene expression refers to the absence (or observable
decrease) in the level of protein and/or mRNA product from a target
gene. Specificity refers to the ability to inhibit the target gene
without manifest effects on other genes of the cell. The
consequences of inhibition can be confirmed by examination of the
outward properties of the cell or organism (as presented below in
the examples) or by biochemical techniques such as RNA solution
hybridization, nuclease protection, Northern hybridization, reverse
transcription, gene expression monitoring with a microarray,
antibody binding, enzyme linked immunosorbent assay (ELISA),
Western blotting, radioimmunoassay (RIA), other immunoassays, and
fluorescence activated cell analysis (FACS).
[0108] For RNA-mediated inhibition in a cell line or whole
organism, gene expression is conveniently assayed by use of a
reporter or drug resistance gene whose protein product is easily
assayed. Such reporter genes include acetohydroxyacid synthase
(AHAS), alkaline phosphatase (AP), beta galactosidase (LacZ), beta
glucoronidase (GUS), chloramphenicol acetyltransferase (CAT), green
fluorescent protein (GFP), horseradish peroxidase (HRP), luciferase
(Luc), nopaline synthase (NOS), octopine synthase (OCS), and
derivatives thereof. Multiple selectable markers are available that
confer resistance to ampicillin, bleomycin, chloramphenicol,
gentamycin, hygromycin, kanamycin, lincomycin, methotrexate,
phosphinothricin, puromycin, and tetracyclin. Depending on the
assay, quantitation of the amount of gene expression allows one to
determine a degree of inhibition which is greater than 10%, 33%,
50%, 90%, 95% or 99% as compared to a cell not treated according to
the present invention. Lower doses of injected material and longer
times after administration of RNAi agent may result in inhibition
in a smaller fraction of cells (e.g., at least 10%, 20%, 50%, 75%,
90%, or 95% of targeted cells). Quantitation of gene expression in
a cell may show similar amounts of inhibition at the level of
accumulation of target mRNA or translation of target protein. As an
example, the efficiency of inhibition may be determined by
assessing the amount of gene product in the cell; mRNA may be
detected with a hybridization probe having a nucleotide sequence
outside the region used for the inhibitory double-stranded RNA, or
translated polypeptide may be detected with an antibody raised
against the polypeptide sequence of that region.
[0109] The RNA may be introduced in an amount which allows delivery
of at least one copy per cell. Higher doses (e.g., at least 5, 10,
100, 500 or 1000 copies per cell) of material may yield more
effective inhibition; lower doses may also be useful for specific
applications.
[0110] IV. Methods of Treatment:
[0111] The present invention provides for both prophylactic and
therapeutic methods of treating a subject at risk of (or
susceptible to) a disorder or having a disorder associated with
aberrant or unwanted target gene expression or activity.
"Treatment", or "treating" as used herein, is defined as the
application or administration of a therapeutic agent (e.g., a RNA
agent or vector or transgene encoding same) to a patient, or
application or administration of a therapeutic agent to an isolated
tissue or cell line from a patient, who has a disease or disorder,
a symptom of disease or disorder or a predisposition toward a
disease or disorder, with the purpose to cure, heal, alleviate,
relieve, alter, remedy, ameliorate, improve or affect the disease
or disorder, the symptoms of the disease or disorder, or the
predisposition toward disease.
[0112] With regards to both prophylactic and therapeutic methods of
treatment, such treatments may be specifically tailored or
modified, based on knowledge obtained from the field of
pharmacogenomics. "Pharmacogenomics", as used herein, refers to the
application of genomics technologies such as gene sequencing,
statistical genetics, and gene expression analysis to drugs in
clinical development and on the market. More specifically, the term
refers the study of how a patient's genes determine his or her
response to a drug (e.g., a patient's "drug response phenotype", or
"drug response genotype"). Thus, another aspect of the invention
provides methods for tailoring an individual's prophylactic or
therapeutic treatment with either the target gene molecules of the
present invention or target gene modulators according to that
individual's drug response genotype. Pharmacogenomics allows a
clinician or physician to target prophylactic or therapeutic
treatments to patients who will most benefit from the treatment and
to avoid treatment of patients who will experience toxic
drug-related side effects.
[0113] 1. Prophylactic Methods
[0114] In one aspect, the invention provides a method for
preventing in a subject, a disease or condition associated with an
aberrant or unwanted target gene expression or activity, by
administering to the subject a therapeutic agent (e.g., an RNAi
agent or vector or transgene encoding same). Subjects at risk for a
disease which is caused or contributed to by aberrant or unwanted
target gene expression or activity can be identified by, for
example, any or a combination of diagnostic or prognostic assays as
described herein. Administration of a prophylactic agent can occur
prior to the manifestation of symptoms characteristic of the target
gene aberrancy, such that a disease or disorder is prevented or,
alternatively, delayed in its progression. Depending on the type of
target gene aberrancy, for example, a target gene, target gene
agonist or target gene antagonist agent can be used for treating
the subject. The appropriate agent can be determined based on
screening assays described herein.
[0115] 2. Therapeutic Methods
[0116] Another aspect of the invention pertains to methods of
modulating target gene expression, protein expression or activity
for therapeutic purposes. Accordingly, in an exemplary embodiment,
the modulatory method of the invention involves contacting a cell
capable of expressing target gene with a therapeutic agent (e.g.,
an RNAi agent or vector or transgene encoding same) that is
specific for the target gene or protein (e.g., is specific for the
mRNA encoded by said gene or specifying the amino acid sequence of
said protein) such that expression or one or more of the activities
of target protein is modulated. These modulatory methods can be
performed in vitro (e.g., by culturing the cell with the agent) or,
alternatively, in vivo (e.g., by administering the agent to a
subject). As such, the present invention provides methods of
treating an individual afflicted with a disease or disorder
characterized by aberrant or unwanted expression or activity of a
target gene polypeptide or nucleic acid molecule. Inhibition of
target gene activity is desirable in situations in which target
gene is abnormally unregulated and/or in which decreased target
gene activity is likely to have a beneficial effect.
[0117] 3. Pharmacogenomics
[0118] The therapeutic agents (e.g., an RNAi agent or vector or
transgene encoding same) of the invention can be administered to
individuals to treat (prophylactically or therapeutically)
disorders associated with aberrant or unwanted target gene
activity. In conjunction with such treatment, pharmacogenomics
(i.e., the study of the relationship between an individual's
genotype and that individual's response to a foreign compound or
drug) may be considered. Differences in metabolism of therapeutics
can lead to severe toxicity or therapeutic failure by altering the
relation between dose and blood concentration of the
pharmacologically active drug. Thus, a physician or clinician may
consider applying knowledge obtained in relevant pharmacogenomics
studies in determining whether to administer a therapeutic agent as
well as tailoring the dosage and/or therapeutic regimen of
treatment with a therapeutic agent.
[0119] Pharmacogenomics deals with clinically significant
hereditary variations in the response to drugs due to altered drug
disposition and abnormal action in affected persons. See, for
example, Eichelbaum, M. et al. (1996) Clin. Exp. Pharmacol.
Physiol. 23(10-11): 983-985 and Linder, M. W. et al. (1997) Clin.
Chem. 43(2):254-266. In general, two types of pharmacogenetic
conditions can be differentiated. Genetic conditions transmitted as
a single factor altering the way drugs act on the body (altered
drug action) or genetic conditions transmitted as single factors
altering the way the body acts on drugs (altered drug metabolism).
These pharmacogenetic conditions can occur either as rare genetic
defects or as naturally-occurring polymorphisms. For example,
glucose-6-phosphate dehydrogenase deficiency (G6PD) is a common
inherited enzymopathy in which the main clinical complication is
haemolysis after ingestion of oxidant drugs (anti-malarials,
sulfonamides, analgesics, nitrofurans) and consumption of fava
beans.
[0120] One pharmacogenomics approach to identifying genes that
predict drug response, known as "a genome-wide association", relies
primarily on a high-resolution map of the human genome consisting
of already known gene-related markers (e.g., a "bi-allelic" gene
marker map which consists of 60,000-100,000 polymorphic or variable
sites on the human genome, each of which has two variants.). Such a
high-resolution genetic map can be compared to a map of the genome
of each of a statistically significant number of patients taking
part in a Phase II/III drug trial to identify markers associated
with a particular observed drug response or side effect.
Alternatively, such a high resolution map can be generated from a
combination of some ten-million known single nucleotide
polymorphisms (SNPs) in the human genome. As used herein, a "SNP"
is a common alteration that occurs in a single nucleotide base in a
stretch of DNA. For example, a SNP may occur once per every 1000
bases of DNA. A SNP may be involved in a disease process, however,
the vast majority may not be disease-associated. Given a genetic
map based on the occurrence of such SNPs, individuals can be
grouped into genetic categories depending on a particular pattern
of SNPs in their individual genome. In such a manner, treatment
regimens can be tailored to groups of genetically similar
individuals, taking into account traits that may be common among
such genetically similar individuals.
[0121] Alternatively, a method termed the "candidate gene approach"
can be utilized to identify genes that predict drug response.
According to this method, if a gene that encodes a drugs target is
known (e.g., a target gene polypeptide of the present invention),
all common variants of that gene can be fairly easily identified in
the population and it can be determined if having one version of
the gene versus another is associated with a particular drug
response.
[0122] As an illustrative embodiment, the activity of drug
metabolizing enzymes is a major determinant of both the intensity
and duration of drug action. The discovery of genetic polymorphisms
of drug metabolizing enzymes (e.g., N-acetyltransferase 2 (NAT 2)
and cytochrome P450 enzymes CYP2D6 and CYP2C19) has provided an
explanation as to why some patients do not obtain the expected drug
effects or show exaggerated drug response and serious toxicity
after taking the standard and safe dose of a drug. These
polymorphisms are expressed in two phenotypes in the population,
the extensive metabolizer (EM) and poor metabolizer (PM). The
prevalence of PM is different among different populations. For
example, the gene coding for CYP2D6 is highly polymorphic and
several mutations have been identified in PM, which all lead to the
absence of functional CYP2D6. Poor metabolizers of CYP2D6 and CYP2C
19 quite frequently experience exaggerated drug response and side
effects when they receive standard doses. If a metabolite is the
active therapeutic moiety, PM show no therapeutic response, as
demonstrated for the analgesic effect of codeine mediated by its
CYP2D6-formed metabolite morphine. The other extreme are the so
called ultra-rapid metabolizers who do not respond to standard
doses. Recently, the molecular basis of ultra-rapid metabolism has
been identified to be due to CYP2D6 gene amplification.
[0123] Alternatively, a method termed the "gene expression
profiling" can be utilized to identify genes that predict drug
response. For example, the gene expression of an animal dosed with
a therapeutic agent of the present invention can give an indication
whether gene pathways related to toxicity have been turned on.
[0124] Information generated from more than one of the above
pharmacogenomics approaches can be used to determine appropriate
dosage and treatment regimens for prophylactic or therapeutic
treatment an individual. This knowledge, when applied to dosing or
drug selection, can avoid adverse reactions or therapeutic failure
and thus enhance therapeutic or prophylactic efficiency when
treating a subject with a therapeutic agent, as described
herein.
[0125] Therapeutic agents can be tested in an appropriate animal
model. For example, an RNAi agent (or expression vector or
transgene encoding same) as described herein can be used in an
animal model to determine the efficacy, toxicity, or side effects
of treatment with said agent. Alternatively, a therapeutic agent
can be used in an animal model to determine the mechanism of action
of such an agent. For example, an agent can be used in an animal
model to determine the efficacy, toxicity, or side effects of
treatment with such an agent. Alternatively, an agent can be used
in an animal model to determine the mechanism of action of such an
agent.
[0126] V. Pharmaceutical Compositions
[0127] The invention pertains to uses of the above-described agents
for therapeutic treatments as described infra. Accordingly, the
modulators of the present invention can be incorporated into
pharmaceutical compositions suitable for administration. Such
compositions typically comprise the nucleic acid molecule, protein,
antibody, or modulatory compound and a pharmaceutically acceptable
carrier. As used herein the language "pharmaceutically acceptable
carrier" is intended to include any and all solvents, dispersion
media, coatings, antibacterial and antifungal agents, isotonic and
absorption delaying agents, and the like, compatible with
pharmaceutical administration. The use of such media and agents for
pharmaceutically active substances is well known in the art. Except
insofar as any conventional media or agent is incompatible with the
active compound, use thereof in the compositions is contemplated.
Supplementary active compounds can also be incorporated into the
compositions.
[0128] A pharmaceutical composition of the invention is formulated
to be compatible with its intended route of administration.
Examples of routes of administration include parenteral, e.g.,
intravenous, intradermal, subcutaneous, intraperitoneal,
intramuscular, oral (e.g., inhalation), transdermal (topical), and
transmucosal administration. Solutions or suspensions used for
parenteral, intradermal, or subcutaneous application can include
the following components: a sterile diluent such as water for
injection, saline solution, fixed oils, polyethylene glycols,
glycerine, propylene glycol or other synthetic solvents;
antibacterial agents such as benzyl alcohol or methyl parabens;
antioxidants such as ascorbic acid or sodium bisulfite; chelating
agents such as ethylenediaminetetraacetic acid; buffers such as
acetates, citrates or phosphates and agents for the adjustment of
tonicity such as sodium chloride or dextrose. pH can be adjusted
with acids or bases, such as hydrochloric acid or sodium hydroxide.
The parenteral preparation can be enclosed in ampoules, disposable
syringes or multiple dose vials made of glass or plastic.
[0129] Pharmaceutical compositions suitable for injectable use
include sterile aqueous solutions (where water soluble) or
dispersions and sterile, powders for the extemporaneous preparation
of sterile injectable solutions or dispersion. For intravenous
administration, suitable carriers include physiological saline,
bacteriostatic water, Cremophor EL.TM. (BASF, Parsippany, N.J.) or
phosphate buffered saline (PBS). In all cases, the composition must
be sterile and should be fluid to the extent that easy
syringability exists. It must be stable under the conditions of
manufacture and storage and must be preserved against the
contaminating action of microorganisms such as bacteria and fungi.
The carrier can be a solvent or dispersion medium containing, for
example, water, ethanol, polyol (for example, glycerol, propylene
glycol, and liquid polyetheylene glycol, and the like), and
suitable mixtures thereof. The proper fluidity can be maintained,
for example, by the use of a coating such as lecithin, by the
maintenance of the required particle size in the case of dispersion
and by the use of surfactants. Prevention of the action of
microorganisms can be achieved by various antibacterial and
antifungal agents, for example, parabens, chlorobutanol, phenol,
ascorbic acid, thimerosal, and the like. In many cases, it will be
preferable to include isotonic agents, for example, sugars,
polyalcohols such as manitol, sorbitol, sodium chloride in the
composition. Prolonged absorption of the injectable compositions
can be brought about by including in the composition an agent which
delays absorption, for example, aluminum monostearate and
gelatin.
[0130] Sterile injectable solutions can be prepared by
incorporating the active compound in the required amount in an
appropriate solvent with one or a combination of ingredients
enumerated above, as required, followed by filtered sterilization.
Generally, dispersions are prepared by incorporating the active
compound into a sterile vehicle which contains a basic dispersion
medium and the required other ingredients from those enumerated
above. In the case of sterile powders for the preparation of
sterile injectable solutions, the preferred methods of preparation
are vacuum drying and freeze-drying which yields a powder of the
active ingredient plus any additional desired ingredient from a
previously sterile-filtered solution thereof.
[0131] Oral compositions generally include an inert diluent or an
edible carrier. They can be enclosed in gelatin capsules or
compressed into tablets. For the purpose of oral therapeutic
administration, the active compound can be incorporated with
excipients and used in the form of tablets, troches, or capsules.
Oral compositions can also be prepared using a fluid carrier for
use as a mouthwash, wherein the compound in the fluid carrier is
applied orally and swished and expectorated or swallowed.
Pharmaceutically compatible binding agents, and/or adjuvant
materials can be included as part of the composition. The tablets,
pills, capsules, troches and the like can contain any of the
following ingredients, or compounds of a similar nature: a binder
such as microcrystalline cellulose, gum tragacanth or gelatin; an
excipient such as starch or lactose, a disintegrating agent such as
alginic acid, Primogel, or corn starch; a lubricant such as
magnesium stearate or Sterotes; a glidant such as colloidal silicon
dioxide; a sweetening agent such as sucrose or saccharin; or a
flavoring agent such as peppermint, methyl salicylate, or orange
flavoring.
[0132] For administration by inhalation, the compounds are
delivered in the form of an aerosol spray from pressured container
or dispenser which contains a suitable propellant, e.g., a gas such
as carbon dioxide, or a nebulizer.
[0133] Systemic administration can also be by transmucosal or
transdermal means. For transmucosal or transdermal administration,
penetrants appropriate to the barrier to be permeated are used in
the formulation. Such penetrants are generally known in the art,
and include, for example, for transmucosal administration,
detergents, bile salts, and fusidic acid derivatives. Transmucosal
administration can be accomplished through the use of nasal sprays
or suppositories. For transdermal administration, the active
compounds are formulated into ointments, salves, gels, or creams as
generally known in the art.
[0134] The compounds can also be prepared in the form of
suppositories (e.g., with conventional suppository bases such as
cocoa butter and other glycerides) or retention enemas for rectal
delivery.
[0135] In one embodiment, the active compounds are prepared with
carriers that will protect the compound against rapid elimination
from the body, such as a controlled release formulation, including
implants and microencapsulated delivery systems. Biodegradable,
biocompatible polymers can be used, such as ethylene vinyl acetate,
polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and
polylactic acid. Methods for preparation of such formulations will
be apparent to those skilled in the art. The materials can also be
obtained commercially from Alza Corporation and Nova
Pharmaceuticals, Inc. Liposomal suspensions (including liposomes
targeted to infected cells with monoclonal antibodies to viral
antigens) can also be used as pharmaceutically acceptable carriers.
These can be prepared according to methods known to those skilled
in the art, for example, as described in U.S. Pat. No.
4,522,811.
[0136] It is especially advantageous to formulate oral or
parenteral compositions in dosage unit form for ease of
administration and uniformity of dosage. Dosage unit form as used
herein refers to physically discrete units suited as unitary
dosages for the subject to be treated; each unit containing a
predetermined quantity of active compound calculated to produce the
desired therapeutic effect in association with the-required
pharmaceutical carrier. The specification for the dosage unit forms
of the invention are dictated by and directly dependent on the
unique characteristics of the active compound and the particular
therapeutic effect to be achieved, and the limitations inherent in
the art of compounding such an active compound for the treatment of
individuals.
[0137] Toxicity and therapeutic efficacy of such compounds can be
determined by standard pharmaceutical procedures in cell cultures
or experimental animals, e.g., for determining the LD50 (the dose
lethal to 50% of the population) and the ED50 (the dose
therapeutically effective in 50% of the population). The dose ratio
between toxic and therapeutic effects is the therapeutic index and
it can be expressed as the ratio LD50/ED50. Compounds that exhibit
large therapeutic indices are preferred. Although compounds that
exhibit toxic side effects may be used, care should be taken to
design a delivery system that targets such compounds to the site of
affected tissue in order to minimize potential damage to uninfected
cells and, thereby, reduce side effects.
[0138] The data obtained from the cell culture assays and animal
studies can be used in formulating a range of dosage for use in
humans. The dosage of such compounds lies preferably within a range
of circulating concentrations that include the ED50 with little or
no toxicity. The dosage may vary within this range depending upon
the dosage form employed and the route of administration utilized.
For any compound used in the method of the invention, the
therapeutically effective dose can be estimated initially from cell
culture assays. A dose may be formulated in animal models to
achieve a circulating plasma concentration range that includes the
EC50 (i.e., the concentration of the test compound which achieves a
half-maximal response) as determined in cell culture. Such
information can be used to more accurately determine useful doses
in humans. Levels in plasma may be measured, for example, by high
performance liquid chromatography.
[0139] The pharmaceutical compositions can be included in a
container, pack, or dispenser together with instructions for
administration.
[0140] VI. Transgenic Organisms
[0141] Engineered RNA precursors of the invention can be expressed
in transgenic animals. These animals represent a model system for
the study of disorders that are caused by, or exacerbated by,
overexpression or underexpression (as compared to wildtype or
normal) of nucleic acids (and their encoded polypeptides) targeted
for destruction by the RNAi agents, e.g., siRNAs and shRNAs, and
for the development of therapeutic agents that modulate the
expression or activity of nucleic acids or polypeptides targeted
for destruction.
[0142] Transgenic animals can be farm animals (pigs, goats, sheep,
cows, horses, rabbits, and the like), rodents (such as rats, guinea
pigs, and mice), non-human primates (for example, baboons, monkeys,
and chimpanzees), and domestic animals (for example, dogs and
cats). Invertebrates such as Caenorhabditis elegans or Drosophila
can be used as well as non-mammalian vertebrates such as fish
(e.g., zebrafish) or birds (e.g., chickens).
[0143] Engineered RNA precursors with stems of 18 to 30 nucleotides
in length are preferred for use in mammals, such as mice. A
transgenic founder animal can be identified based upon the presence
of a transgene that encodes the new RNA precursors in its genome,
and/or expression of the transgene in tissues or cells of the
animals, for example, using PCR or Northern analysis. Expression is
confirmed by a decrease in the expression (RNA or protein) of the
target sequence.
[0144] A transgenic founder animal can be used to breed additional
animals carrying the transgene. Moreover, transgenic animals
carrying a transgene encoding the RNA precursors can further be
bred to other transgenic animals carrying other transgenes. In
addition, cells obtained from the transgenic founder animal or its
offspring can be cultured to establish primary, secondary, or
immortal cell lines containing the transgene.
[0145] 1. Procedures for Making Transgenic, Non-Human Animals
[0146] A number of methods have been used to obtain transgenic,
non-human animals, which are animals that have gained an additional
gene by the introduction of a transgene into their cells (e.g.,
both the somatic and germ cells), or into an ancestor's germ line.
In some cases, transgenic animals can be generated by commercial
facilities (e.g., The Transgenic Drosophila Facility at Michigan
State University, The Transgenic Zebrafish Core Facility at the
Medical College of Georgia (Augusta, Georgia), and Xenogen
Biosciences (St. Louis, Mo.). In general, the construct containing
the transgene is supplied to the facility for generating a
transgenic animal.
[0147] Methods for generating transgenic animals include
introducing the transgene into the germ line of the animal. One
method is by microinjection of a gene construct into the pronucleus
of an early stage embryo (e.g., before the four-cell stage; Wagner
et al., 1981, Proc. Natl. Acad. Sci. USA 78:5016; Brinster et al.,
1985, Proc. Natl. Acad. Sci. USA 82:4438). Alternatively, the
transgene can be introduced into the pronucleus by retroviral
infection. A detailed procedure for producing such transgenic mice
has been described (see e.g., Hogan et al., MP1 ulating the Mouse
ErnbnLo. Cold Spring Harbour Laboratory, Cold Spring Harbour, N.Y.
(1986); U.S. Pat. No. 5,175,383 (1992)). This procedure has also
been adapted for other animal species (e.g., Hammer et al., 1985,
Nature 315:680; Murray et al., 1989, Reprod. Fert. Devl. 1:147;
Pursel et al., 1987, Vet. Immunol. Histopath. 17:303; Rexroad et
al., 1990, J. Reprod. Fert. 41 (suppl): 1 19; Rexroad et al., 1989,
Molec. Reprod. Devl. 1:164; Simons et al., 1988, BioTechnology
6:179; Vize et al., 1988, J. Cell. Sci. 90:295; and Wagner, 1989,
J. Cell. Biochem. 13B (suppl): 164).
[0148] In brief, the procedure involves introducing the transgene
into an animal by microinjecting the construct into the pronuclei
of the fertilized mammalian egg(s) to cause one or more copies of
the transgene to be retained in the cells of the developing
mammal(s). Following introduction of the transgene construct into
the fertilized egg, the egg may be incubated in vitro for varying
amounts of time, or reimplanted a in surrogate host, or both. One
common method is to incubate the embryos in vitro for about 1-7
days, depending on the species, and then reimplant them into the
surrogate host. The presence of the transgene in the progeny of the
transgenically manipulated embryos can be tested by Southern blot
analysis of a segment of tissue.
[0149] Another method for producing germ-line transgenic animals is
through the use of embryonic stem (ES) cells. The gene construct
can be introduced into embryonic stem, cells by homologous
recombination (Thomas et al., 1987, Cell 51:503; Capecchi, Science
1989, 244:1288; Joyner et al., 1989, Nature 338:153) in a
transcriptionally active region of the genome. A suitable construct
can also be introduced into embryonic stem cells by DNA-mediated
transfection, such as by 17 electroporation (Ausubel et al.,
Current Protocols in Molecular Biology, John Wiley & Sons,
1987). Detailed procedures for culturing embryonic stem cells
(e.g., ES-D3@ ATCC #CCL-1934, ES-E14TG2a, ATCC #CCL-1821, American
Type Culture Collection, Rockville, AM) and methods of making
transgenic animals from embryonic stem cells can be found in
Teratocarcinomas and Embi3Lonic Stem Cells, A Practical Approach,
ed. E. J. Robertson (IRL Press, 1987). In brief, the ES cells are
obtained from pre-implantation embryos cultured in vitro (Evans et
al., 1981, Nature 292:154-156). Transgenes can be efficiently
introduced into ES cells by DNA transfection or by
retrovirus-mediated transduction. The resulting transformed ES
cells can thereafter be combined with blastocysts from a non-human
animal. The ES cells colonize the embryo and contribute to the germ
line of the resulting chimeric animal.
[0150] In the above methods, the transgene can be introduced as a
linear construct, a circular plasmid, or a viral vector, which can
be incorporated and inherited as a transgene integrated into the
host genome. The transgene can also be constructed to permit it to
be inherited as an extrachromosomal plasmid (Gassmann et al., 1995,
Proc. Natl. Acad. Sci. USA 92:1292). A plasmid is a DNA molecule
that can replicate autonomously in a host.
[0151] The transgenic, non-human animals can also be obtained by
infecting or transfecting cells either in vivo (e.g., direct
injection), ex vivo (e.g., infecting the cells outside the host and
later reimplanting), or in vitro (e.g., infecting the cells outside
host), for example, with a recombinant viral vector carrying a gene
encoding the engineered RNA precursors. Examples of suitable viral
vectors include recombinant retroviral vectors (Valerio et al.,
1989, Gene 84:419; Scharfinan et al., 1991, Proc. Natl. Acad. Sci.
USA 88:462; Miller and Buttimore, 1986, Mol. Cell. Biol. 6:2895),
recombinant adenoviral vectors (Freidman et al., 1986, Mol. Cell.
Biol. 6:3791; Levrero et al., 1991, Gene 101: 195), and recombinant
Herpes simplex viral vectors (Fink et al., 1992, Human Gene Therapy
3:11). Such methods are also useful for introducing constructs into
cells for uses other than generation of transgenic animals.
[0152] Other approaches include insertion of transgenes encoding
the new engineered RNA precursors into viral vectors including
recombinant adenovirus, adenoassociated virus, and herpes simplex
virus-1, or recombinant bacterial or eukaryotic plasmids. Viral
vectors transfect cells directly. Other approaches include
delivering the transgenes, in the form of plasmid DNA, with the
help of, for example, cationic liposomes (lipofectin) or
derivatized (e.g., antibody conjugated) polylysine conjugates,
gramacidin S, artificial viral envelopes, or other such
intracellular carriers, as well as direct injection of the
transgene construct or CaPO.sub.4 precipitation carried out in
vivo. Such methods can also be used in vitro to introduce
constructs into cells for uses other than generation of transgenic
animals.
[0153] Retrovirus vectors and adeno-associated virus vectors can be
used as a recombinant gone delivery system for the transfer of
exogenous genes in vivo or in vitro. These vectors provide
efficient delivery of genes into cells, and the transferred nucleic
acids are stably integrated into the chromosomal DNA of the host.
The development of specialized cell lines (termed "packaging
cells") which produce only replication-defective retroviruses has
increased the utility of retroviruses for gene therapy, and
defective retroviruses are characterized for use in gene transfer
for gene therapy purposes (for a review see Miller, 1990, Blood
76:271). A replication defective retrovirus can be packaged into
virions which can be used to infect a target cell through the use
of a helper virus by standard techniques. Protocols for producing
recombinant retroviruses and for infecting cells in vitro or in
vivo with such viruses can be found in Current Protocols in
Molecular Biology, Ausubel, F. M. et al., (eds.) Greene Publishing
Associates, (1989), Sections 9 9.14 and other standard laboratory
manuals.
[0154] Examples of suitable retroviruses include pLJ, pZIP, pWE and
pEM which are known to those skilled in the art. Examples of
suitable packaging virus lines for preparing both ecotropic and
amphotropic retroviral systems include Psi-Crip, PsiCre, Psi-2 and
Psi-Am. Retroviruses have been used to introduce a variety of genes
into many different cell types, including epithelial cells, in
vitro and/or in vivo (see for example Eglitis, et al., 1985,
Science 230:1395-1398; Danos and Mulligan, 1988, Proc. Natl. Acad.
Sci. USA 85:6460-6464; Wilson et al., 1988, Proc. Natl. Acad. Sci.
USA 85:3014-3018; Armentano et al., 1990, Proc. Natl. Acad. Sci.
USA 87:61416145; Huber et al., 1991, Proc. Natl. Acad. Sci. USA
88:8039-8043; Ferry et al., 1991, Proc. Natl. Acad. Sci. USA
88:8377-8381; Chowdhury et al., 1991, Science 254:1802-1805; van
Beusechem. et al., 1992, Proc. Natl. Acad. Sci. USA 89:7640-19; Kay
et al., 1992, Human Gene Therapy 3:641-647; Dai et al., 1992, Proc.
Natl. Acad. Sci. USA 89:10892-10895; Hwu et al., 1993, J. Immunol.
150:4104-4115; U.S. Pat. No. 4,868,116; U.S. Pat. No. 4,980,286;
PCT Application WO 89/07136; PCT Application WO 89/02468; PCT
Application WO 89/05345; and PCT Application WO 92/07573).
[0155] In another example, recombinant retroviral vectors capable
of transducing and expressing genes inserted into the genome of a
cell can be produced by transfecting the recombinant retroviral
genome into suitable packaging cell lines such as PA317 and
Psi-CRIP (Comette et al., 1991, Human Gene Therapy 2:5-10; Cone et
al., 1984, Proc. Natl. Acad. Sci. USA 81:6349). Recombinant
adenoviral vectors can be used to infect a wide variety of cells
and tissues in susceptible hosts (e.g., rat, hamster, dog, and
chimpanzee) (Hsu et al., 1992, J. Infectious Disease, 166:769), and
also have the advantage of not requiring mitotically active cells
for infection. Another viral gene delivery system useful in the
present invention also utilizes adenovirus-derived vectors. The
genome of an adenovirus can be manipulated such that it encodes and
expresses a gene product of interest but is inactivated in terms of
its ability to replicate in a normal lytic viral life cycle. See,
for example, Berkner et al. (1988, BioTechniques 6:616), Rosenfeld
et al. (1991, Science 252:431-434), and Rosenfeld et al. (1992,
Cell 68:143-155). Suitable adenoviral vectors derived from the
adenovirus strain Ad type 5 d1324 or other strains of adenovirus
(e.g., Ad2, AO, Ad7 etc.) are known to those skilled in the art.
Recombinant adenoviruses can be advantageous in certain
circumstances in that they are not capable of infecting nondividing
cells and can be used to infect a wide variety of cell types,
including epithelial cells (Rosenfeld et al., 1992, cited supra).
Furthermore, the virus particle is relatively stable and amenable
to purification and concentration, and as above, can be modified to
affect the spectrum of infectivity. Additionally, introduced
adenoviral DNA (and foreign DNA contained therein) is not
integrated into the genome of a host cell but remains episomal,
thereby avoiding potential problems that can occur as a result of
insertional mutagenesis hz situ where introduced DNA becomes
integrated into the host genome (e.g., retroviral DNA). Moreover,
the carrying capacity of the adenoviral genome for foreign DNA is
large (up to 8 kilobases) relative to other gene delivery vectors
(Berkner et al. cited supra; Haj-Ahmand and Graham, 1986, J. Virol.
57:267).
[0156] Yet another viral vector system useful for delivery of the
subject transgenes is the adeno-associated virus (AAV).
Adeno-associated virus is a naturally occurring defective virus
that requires another virus, such as an adenovirus or a herpes
virus, as a helper virus for efficient replication and a productive
life cycle. For a review, see Muzyczka et al. (1992, Curr. Topics
in Micro. and Immunol. 158:97-129). It is also one of the few
viruses that may integrate its DNA into non-dividing cells, and
exhibits a high frequency of stable integration (see for example
Flotte et al. (1992, Am. J. Respir. Cell. Mol. Biol. 7:349-356;
Samulski et al., 1989, J. Virol. 63:3822-3828; and McLaughlin et
al. (1989, J. Virol. 62:1963-1973). Vectors containing as little as
300 base pairs of AAV can be packaged and can integrate. Space for
exogenous DNA is limited to about 4.5 kb. An. AAV vector such as
that described in Tratschin et al. (1985) MoL Cell. Biol.
5:3251-3260 can be used to introduce DNA into cells. A variety of
nucleic acids have been introduced into different cell types using
AAV vectors (see for example Hennonat et al. (1984) Proc. Nad.
Acad. Sci. USA 8 1:64666470; Tratschin et al. (1985) Mol. Cell.
BioL 4:2072-2081; Wondisford et al. (1988) MoL EndocrinoL 2:32-39;
Tratschin et al. (1984) J ViroL 51:611-619; and Flotte et al.
(1993) J BioL Chem. 268:3781-3790).
[0157] In addition to viral transfer methods, such as those
illustrated above, non-viral methods can also be employed to cause
expression of an shRNA or engineered RNA precursor of the invention
in the tissue of an animal. Most non-viral methods of gene transfer
rely on nominal mechanisms used by mammalian cells for the uptake
and intracellular transport of macromolecules. In preferred
embodiments, non-viral gene delivery systems of the present
invention rely on endocytic pathways for the uptake of the subject
gene of the invention by the targeted cell. Exemplary gene delivery
systems of this type include liposomal derived systems, poly-lysine
conjugates, and artificial viral envelopes. Other embodiments
include plasmid injection systems such as are described in Meuli et
al., (2001) J Invest. DerinatoL, 116(1):131-135; Cohen et al.,
(2000) Gene Ther., 7(22):1896-905; and Tam et al., (2000) Gene
Ther., 7(21):186774.
[0158] In a representative embodiment, a gene encoding an shRNA or
engineered RNA precursor of the invention can be entrapped in
liposomes bearing positive charges on their surface (e.g.,
lipofectins) and (optionally) which are tagged with antibodies
against cell surface antigens of the target tissue (Mizuno et al.,
(1992) No Shinkei Geka, 20:547-55 1; PCT publication WO91/06309;
Japanese patent application 10473 8 1; and European patent
publication EP-A-43 075).
[0159] Animals harboring the transgene can be identified by
detecting the presence of the transgene in genomic DNA (e.g., using
Southern analysis). In addition, expression of the shRNA or
engineered RNA precursor can be detected directly (e.g., by
Northern analysis). Expression of the transgene can also be
confirmed by detecting a decrease in the amount of protein
corresponding to the targeted sequence. When the transgene is under
the control of an inducible or developmentally regulated promoter,
expression of the target protein is decreased when the transgene is
induced or at the developmental stage when the transgene is
expressed, respectively.
2. Clones of Transgenic Animals
[0160] Clones of the non-human transgenic animals described herein
can be produced according to the methods described in Wilmut et al.
((1997) Nature, 385:810-813) and PCT publication Nos. WO 97/07668
and WO 97/07669. In brief, a cell, e.g., a somatic cell from the
transgenic animal, can be isolated and induced to exit the growth
cycle and enter the G0 phase to become quiescent. The quiescent
cell can then be fused, e.g., through the use of electrical pulses,
to an enucleated oocyte from an animal of the same species from
which the quiescent cell is isolated. The reconstructed oocyte is
then cultured such that it develops into a morula or blastocyte and
is then transferred to a pseudopregnant female foster animal.
Offspring borne of this female foster animal will be clones of the
animal from which the cell, e.g., the somatic cell, was
isolated.
[0161] Once the transgenic animal is produced, cells of the
transgenic animal and cells from a control animal are screened to
determine the presence of an RNA precursor nucleic acid sequence,
e.g., using polymerase chain reaction (PCR). Alternatively, the
cells can be screened to determine if the RNA precursor is
expressed (e.g., by standard procedures such as Northern blot
analysis or reverse transcriptase-polymerase chain reaction
(RT-PCR); Sambrook et al., Molecular Cloning--A Laboratory Manual,
(Cold Spring Harbor Laboratory, 1989)).
[0162] The transgenic animals of the present invention can be
homozygous or heterozygous, and one of the benefits of the
invention is that the target mRNA is effectively degraded even in
heterozygotes. The present invention provides for transgenic
animals that carry a transgene of the invention in all their cells,
as well as animals that carry a transgene in some, but not all of
their cells. That is, the invention provides for mosaic animals.
The transgene can be integrated as a single transgene or in
concatatners, e.g., head-to-head tandems or head-to-tail
tandems.
[0163] For a review of techniques that can be used to generate and
assess transgenic animals, skilled artisans can consult Gordon (IwL
Rev. CytoL 1 1 5:171-229, 1989), and may obtain additional guidance
from, for example: Hogan et al. "Manipulating the Mouse Embryo"
(Cold Spring Harbor Press, Cold Spring Harbor, N.Y., 1986;
Krimpenfort et al., BiolTechnology 9:86, 1991; Palmiter et al.,
Cell 41:343, 1985; Kraemer et al., "Genetic Manipulation of the
Early Mammalian Embryo," Cold Spring Harbor Press, Cold Spring
Harbor, N.Y., 1985; Hammer et al., Nature 315:680, 1985; Purcel et
al., Science, 244:1281, 1986; Wagner et al., U.S. Pat. No.
5,175,385; and Krimpenfort et al., U.S. Pat. No. 5,175,384.
3. Transgenic Plants
[0164] Among the eukaryotic organisms featured in the invention are
plants containing an exogenous nucleic acid that encodes an
engineered RNA precursor of the invention.
[0165] Accordingly, a method according to the invention comprises
making a plant having a nucleic acid molecule or construct, e.g., a
transgene, described herein. Techniques for introducing exogenous
micleic acids into monocotyledonous and dicotyledonous plants are
known in the art, and include, without limitation,
Agrobacterium-mediated transformation, viral vector-mediated
transformation, electroporation and particle gun transformation,
see, e.g. U.S. Pat. Nos. 5,204,253 and 6,013,863. If a cell or
tissue culture is used as the recipient tissue for transformation,
plants can be regenerated from transformed cultures by techniques
known to those skilled in the art. Transgenic plants can be entered
into a breeding program, e.g., to introduce a nucleic acid encoding
a polypeptide into other lines, to transfer the nucleic acid to
other species or for further selection of other desirable traits.
Alternatively, transgenic plants can be propagated vegetatively for
those species amenable to such techniques. Progeny includes
descendants of a particular plant or plant line. Progeny of a plant
include seeds formed on F1, F2, F3, and subsequent generation
plants, or seeds formed on BQ, BC2, BC3, and subsequent generation
plants. Seeds produced by a transgenic plant can be grown and then
selfed (or outcrossed and selfed) to obtain seeds homozygous for
the nucleic acid encoding a novel polypeptide.
[0166] A suitable group of plants with which to practice the
invention include dicots, such as safflower, alfalfa, soybean,
rapeseed (high erucic acid and canola), or sunflower. Also suitable
are monocots such as corn, wheat, rye, barley, oat, rice, millet,
amaranth or sorghum. Also suitable are vegetable crops or root
crops such as potato, broccoli, peas, sweet corn, popcorn, tomato,
beans (including kidney beans, lima beans, dry beans, green beans)
and the like. Also suitable are fruit crops such as peach, pear,
apple, cherry, orange, lemon, grapefruit, plum, mango and palm.
Thus, the invention has use over a broad range of plants, including
species from, the genera Anacardium, Arachis, Asparagus, Atropa,
Avena, Brassica, Citrus, Citrullus, Capsicum, Carthamus, Cocos,
Coffea, Cucumis, Cucurbita, Daucus, Elaeis, Fragaria, Glycine,
Gossypium, Helianthus, Heterocallis, Hordeum, Hyoscyalnus, Lactuca,
Linum, Lolium, Lupinus, Lycopersicon, Malus, Manihot, Majorana,
Medicago, Nicotiana, Olea, Oryza, Panicum, Pannesetum, Persea,
Phaseolus, Pistachia, Pisum, Pyrus, Prunus, Raphanus, Ricinus,
Secale, Senecio, Sinapis, Solanum, Sorghum, Theobromus, Trigonella,
Triticum, Vicia, Vitis, Vigna and Zea.
[0167] The skilled artisan will appreciate that the enumerated
organisms are also useful for practicing other aspects of the
invention, e.g., as host cells, as described supra.
[0168] The nucleic acid molecules of the invention can be expressed
in plants in a cell- or tissue-specific manner according to the
regulatory elements chosen to include in a particular nucleic acid
construct present in the plant. Suitable cells, tissues, and organs
in which to express a chimeric polypeptide of the invention
include, without limitation, egg cell, central cell, synergid cell,
zygote, ovule primordia, nucellus, integuments, endothelium, female
gametophyte cells, embryo, axis, cotyledons, suspensor, endosperm,
seed coat, ground meristem, vascular bundle, cambium, phloem,
cortex, shoot or root apical meristems, lateral shoot or root
meristems, floral meristem, leaf primordia, leaf mesophyll cells,
and leaf epidermal cells, e.g., epidermal cells involved in
fortning the cuticular layer. Also suitable are cells and tissues
grown in liquid media or on semi-solid media.
4. Transgenic Fungi
[0169] Other eukaryotic organisms featured in the invention are
fungi containing an exogenous nucleic acid molecule that encodes an
engineered RNA precursor of the invention. Accordingly, a method
according to the invention comprises introducing a nucleic acid
molecule or construct as described herein into a fungus. Techniques
for introducing exogenous nucleic acids into many fungi are known
in the art, see, e.g., U.S. Pat. Nos. 5,252,726 and 5,070,020.
Transformed fungi can be cultured by techniques known to those
skilled in the art. Such fungi can be used to introduce a nucleic
acid encoding a polypeptide into other fungal strains, to transfer
the nucleic acid to other species or for further, selection of
other desirable, traits.
[0170] A suitable group of fungi with which to practice the
invention include fission yeast and budding yeast, such as
Saccharomyces cereviseae, S. pombe, S. carlsbergeris and Candida
albicans. Filamentous fungi such as Aspergillus spp. and
Penicillium spp. are also useful.
[0171] VII. Knockout and/or Knockdown Cells or Organisms
[0172] A further preferred use for the RNAi agents of the present
invention (or vectors or transgenes encoding same) is a functional
analysis to be carried out in eukaryotic cells, or eukaryotic
non-human organisms, preferably mammalian cells or organisms and
most preferably human cells, e.g., cell lines such as HeLa or 293
or rodents, e.g., rats and mice. By administering a suitable RNAi
agent which is sufficiently complementary to a target mRNA sequence
to direct target-specific RNA interference, a specific knockout or
knockdown phenotype can be obtained in a target cell, e.g., in cell
culture or in a target organism.
[0173] Thus, a further subject matter of the invention is a
eukaryotic cell or a eukaryotic non-human organism exhibiting a
target gene-specific knockout or knockdown phenotype comprising a
fully or at least partially deficient expression of at least one
endogeneous target gene wherein said cell or organism is
transfected with at least one vector comprising DNA encoding a RNAi
agent capable of inhibiting the expression of the target gene. It
should be noted that the present invention allows a target-specific
knockout or knockdown of several different endogeneous genes due to
the specificity of the RNAi agent.
[0174] Gene-specific knockout or knockdown phenotypes of cells or
non-human organisms, particularly of human cells or non-human
mammals may be used in analytic to procedures, e.g., in the
functional and/or phenotypical analysis of complex physiological
processes such as analysis of gene expression profiles and/or
proteomes. Preferably the analysis is carried out by high
throughput methods using oligonucleotide based chips.
[0175] Using RNAi based knockout or knockdown technologies, the
expression of an endogeneous target gene may be inhibited in a
target cell or a target organism. The endogeneous gene may be
complemented by an exogenous target nucleic acid coding for the
target protein or a variant or mutated form of the target protein,
e.g., a gene or a DNA, which may optionally be fused to a further
nucleic acid sequence encoding a detectable peptide or polypeptide,
e.g., an affinity tag, particularly a multiple affinity tag.
[0176] Variants or mutated forms of the target gene differ from the
endogeneous target gene in that they encode a gene product which
differs from the endogeneous gene product on the amino acid level
by substitutions, insertions and/or deletions of single or multiple
amino acids. The variants or mutated forms may have the same
biological activity as the endogeneous target gene. On the other
hand, the variant or mutated target gene may also have a biological
activity, which differs from the biological activity of the
endogeneous target gene, e.g., a partially deleted activity, a
completely deleted activity, an enhanced activity etc. The
complementation may be accomplished by compressing the polypeptide
encoded by the endogeneous nucleic acid, e.g., a fusion protein
comprising the target protein and the affinity tag and the double
stranded RNA molecule for knocking out the endogeneous gene in the
target cell. This compression may be accomplished by using a
suitable expression vector expressing both the polypeptide encoded
by the endogenous nucleic acid, e.g., the tag-modified target
protein and the double stranded RNA molecule or alternatively by
using a combination of expression vectors. Proteins and protein
complexes which are synthesized de novo in the target cell will
contain the exogenous gene product, e.g., the modified fusion
protein. In order to avoid suppression of the exogenous gene
product by the RNAi agent, the nucleotide sequence encoding the
exogenous nucleic acid may be altered at the DNA level (with or
without causing mutations on the amino acid level) in the part of
the sequence which so is homologous to the RNAi agent.
Alternatively, the endogeneous target gene may be complemented by
corresponding nucleotide sequences from other species, e.g., from
mouse.
[0177] VIII. Functional Genomics and/or Proteomics
[0178] Preferred applications for the cell or organism of the
invention is the analysis of gene expression profiles and/or
proteomes. In an especially preferred embodiment an analysis of a
variant or mutant form of one or several target proteins is carried
out, wherein said variant or mutant forms are reintroduced into the
cell or organism by an exogenous target nucleic acid as described
above. The combination of knockout of an endogeneous gene and
rescue by using mutated, e.g., partially deleted exogenous target
has advantages compared to the use of a knockout cell. Further,
this method is particularly suitable for identifying functional
domains of the targeted protein. In a further preferred embodiment
a comparison, e.g., of gene expression profiles and/or proteomes
and/or phenotypic characteristics of at least two cells or
organisms is carried out. These organisms are selected from: (i) a
control cell or control organism without target gene inhibition,
(ii) a cell or organism with target gene inhibition and (iii) a
cell or organism with target gene inhibition plus target gene
complementation by an exogenous target nucleic acid.
[0179] Furthermore, the RNA knockout complementation method may be
used for is preparative purposes, e.g., for the affinity
purification of proteins or protein complexes from eukaryotic
cells, particularly mammalian cells and more particularly human
cells. In this embodiment of the invention, the exogenous target
nucleic acid preferably codes for a target protein which is fused
to art affinity tag. This method is suitable for functional
proteome analysis in mammalian cells, particularly human cells.
[0180] Another utility of the present invention could be a method
of identifying gene function in an organism comprising the use of
an RNAi agent to inhibit the activity of a target gene of
previously unknown function. Instead of the time consuming and
laborious isolation of mutants by traditional genetic screening,
functional genomics would envision determining the function of
uncharacterized genes by employing the invention to reduce the
amount and/or alter the timing of target gene activity. The
invention could be used in determining potential targets for
pharmaceutics, understanding normal and pathological events
associated with development, determining signaling pathways
responsible for postnatal development/aging, and the like. The
increasing speed of acquiring nucleotide sequence information from
genomic and expressed gene sources, including total sequences for
the yeast, D. melanogaster, and C. elegans genomes, can be coupled
with the invention to determine gene function in an organism (e.g.,
nematode). The preference of different organisms to use particular
codons, searching sequence databases for related gene products,
correlating the linkage map of genetic traits with the physical map
from which the nucleotide sequences are derived, and artificial
intelligence methods may be used to define putative open reading
frames from the nucleotide sequences acquired in such sequencing
projects. A simple assay would be to inhibit gene expression
according to the partial sequence available from an expressed
sequence tag (EST). Functional alterations in growth, development,
metabolism, disease resistance, or other biological processes would
be indicative of the normal role of the EST's gene product.
[0181] The ease with which RNA can be introduced into an intact
cell/organism containing the target gene allows the present
invention to be used in high throughput screening (HTS). Solutions
containing RNAi agents that are capable of inhibiting the different
expressed genes can be placed into individual wells'positioned on a
microtiter plate as an ordered array, and intact cells/organisms in
each well can be assayed for any changes or modifications in
behavior or development due to inhibition of target gene activity.
The amplified RNA can be fed directly to, injected into, the
cell/organism containing the target gene. Alternatively, the RNAi
agent can be produced from a vector, as described herein. Vectors
can be injected into, the cell/organism containing the target gene.
The function of the target gene can be assayed from the effects it
has on the cell/organism when gene activity is inhibited. This
screening could be amenable to small subjects that can be processed
in large number, for example: arabidopsis, bacteria, drosophila,
fungi, nematodes, viruses, zebrafish, and tissue culture cells
derived from mammals. A nematode or other organism that produces a
colorimetric, fluorogenic, or luminescent signal in response to a
regulated promoter (e.g., transfected with a reporter gene
construct) can be assayed in an HTS format.
[0182] The present invention may be useful in allowing the
inhibition of essential genes. Such genes may be required for cell
or organism viability at only particular stages of development or
cellular compartments. The functional equivalent of conditional
mutations may be produced by inhibiting activity of the target gene
when or where it is not required for viability. The invention
allows addition of RNAi agents at specific times of development and
locations in the organism without introducing permanent mutations
into the target genome.
[0183] IX. Screening Assays
[0184] The methods of the invention are also suitable for use in
methods to identify and/or characterize potential pharmacological
agents, e.g., identifying new pharmacological agents from a
collection of test substances and/or characterizing mechanisms of
action and/or side effects of known pharmacological agents.
[0185] Thus, the present invention also relates to a system for
identifying and/or characterizing pharmacological agents acting on
at least one target protein comprising: (a) a eukaryotic cell or a
eukaryotic non-human organism capable of expressing at least one
endogeneous target gene coding for said so target protein, (b) at
least one RNA agent capable of inhibiting the expression of said at
least one endogeneous target gene, and (c) a test substance or a
collection of test substances wherein pharmacological properties of
said test substance or said collection are to be identified and/or
characterized. Further, the system as described above preferably
comprises: (d) at least one exogenous target nucleic acid coding
for the target protein or a variant or mutated form of the target
protein wherein said exogenous target nucleic acid differs from the
endogeneous target gene on the nucleic acid level such that the
expression of the exogenous target nucleic acid is substantially
less inhibited by the RNA agent than the expression of the
endogeneous target gene.
[0186] The test compounds of the present invention can be obtained
using any of the numerous approaches in combinatorial library
methods known in the art, including: biological libraries;
spatially addressable parallel solid phase or solution phase
libraries; synthetic library methods requiring deconvolution; the
"one-bead one-compound" library method; and synthetic library
methods using affinity chromatography selection. The biological
library approach is limited to peptide libraries, while the other
four approaches are applicable to peptide, non-peptide oligomer or
small molecule libraries of compounds (Lani, K. S. (1997)
Anticancer Drug Des. 12:145).
[0187] Examples of methods for the synthesis of molecular libraries
can be found in the art, for example in: DeWitt et al. (1993) Proc.
Natl. Acad. Sci. U.S.A. 90:6909; Erb et al. (1994) Proc. Natl.
Acad. Sci. USA 91:11422; Zuckermann et al. (1994). J. Med. Chem.
37:2678; Cho et al. (1993) Science 261:1303; Carrell et al. (1994)
Angew. Chem. Int. Ed. Engl. 33:2059; Carell et al. (1994) Angew.
Chem. Int. Ed. Engl. 33:2061; and in Gallop et al. (1994) J. Med.
Chem. 37:1233.
[0188] Libraries of compounds may be presented in solution (e.g.,
Houghten (1992) Biotechniques 13:412-421), or on beads (Lam (1991)
Nature 354:82-84), chips (Fodor (1993) Nature 364:555-556),
bacteria (Ladner U.S. Pat. No. 5,223,409), spores (Ladner USP 409),
plasmids (Cull et al. (1992) Proc Natl Acad Sci USA 89:1865-1869)
or on phage (Scott and Smith (1990) Science 249:386-390); (Devlin
(1990) Science 249:404-406); (Cwirla et al. (1990) Proc. Natl.
Acad. Sci. 87:6378-6382); (Felici (1991) J. Mol. Biol.
222:301-310); (Ladner supra.)).
[0189] In a preferred embodiment, the library is a natural product
library, e.g., a library produced by a bacterial, fungal, or yeast
culture. In another preferred embodiment, the library is a
synthetic compound library.
[0190] This invention is further illustrated by the following
examples which should not be construed as limiting. The contents of
all references, patents and published patent applications cited
throughout this application are incorporated herein by
reference.
Examples
Materials and Methods
Lysate Preparation
[0191] Fly embryo lysates were prepared as previously described
(Tuschl et al. 1999). Wheat germ extracts were prepared from frozen
or vacuum-packed raw wheat germ (e.g., Fearn Nature Fresh Raw Wheat
Germ, Bread and Circus) as described (Erickson and Blobel 1983).
The extract was centrifuged at 14,500 g at 4.degree. C. for 25 min;
the supernatant was then frozen in aliquots in liquid nitrogen and
stored at -80.degree. C. For cauliflower extract, the outer layer
of fresh cauliflower (Shaws Supermarket) was harvested with a razor
blade and ground to a powder under liquid nitrogen in a mortar and
pestle, then homogenized with 3 mL of 1.times. lysis buffer (100 mM
potassium acetate, 30 mM HEPES-KOH at pH 7.4, 2 mM magnesium
acetate) containing 5 mM dithiothreitol (DTT) and 1 mg/mL Pefabloc
SC (Boehringer Mannheim) per gram of plant tissue. The extract was
centrifuged, and the supernatant was stored as described for the
Drosophila embryo lysate.
Analysis of dsRNA Processing
[0192] For analysis of dsRNA processing, 5 nM internally
.alpha.-32P-UTP-labeled dsRNA was incubated in a 10-.mu.L reaction
containing 5 .mu.L of Drosophila embryo lysate (Tuschl et al. 1999)
or wheat germ extract, 100 .mu.M GTP, 500 .mu.M ATP, 10 mM creatine
phosphate, 10 .mu.g/mL creatine phosphokinase, 5 mM DTT, and 0.1
U/.mu.L RNasin (Promega) at 25.degree. C. for 3 h. Reactions were
stopped by the addition of 2.times. proteinase K buffer [200 mM
Tris-HCl at pH 7.5, 25 mM EDTA, 300 mM NaCl, 2% (w/v) sodium
dodecyl sulfate] and deproteinized with .about.2 mg/mL proteinase K
at 65.degree. C. for 15 min. Products were precipitated with 3
volumes cold ethanol and analyzed by electrophoresis in a 15%
polyacrylamide sequencing gel.
Gel Filtration and RNAse Protection
[0193] Internally .alpha.-32P-UTP-labeled dsRNAs were incubated in
wheat germ extract, then deproteinized at room temperature with
proteinase K (1 h) and RNA-precipitated with 3 volumes of cold
ethanol. The RNA was resuspended in 1.times. lysis buffer and
analyzed by gel filtration as described (Nykanen et al. 2001). For
RNase protection, the RNA products of a 10-.mu.L wheat germ extract
reaction were deproteinized at room temperature and analyzed by
RNAse protection essentially as described (Sambrook et al. 1989).
Briefly, the siRNA pellets were dissolved in 10 .mu.L of RNAse
digestion buffer (300 mM NaCl, 10 mM Tris-HCl at pH 7.4, and 5 mM
EDTA at pH 7.5) containing 10 mM [beta]-glycerophosphate, 5 mM ATP,
0-6.6 U of RNAse A, and 0-1.1 U of RNAse T1. For control
experiments, 5'-32P-radiolabeled synthetic, double-stranded siRNAs
were mixed with the products of a wheat germ reaction performed
with unlabeled dsRNA and coprecipitated with 3 volumes of cold
ethanol. RNAse protection was at 25.degree. C. for 1 h, stopped by
adding 0.6 .mu.L of 10% SDS and 0.3 .mu.L of 20 mg/mL
proteinase
[0194] K, then incubated at 25.degree. C. for 1 h. The reactions
were then adjusted to 200 .mu.L with 2.times. PK buffer containing
0.2 mg/mL Glycogen (Roche), extracted with an equal volume of
phenol/chloroform/isoamylalcohol (25:24:1; v/v/v), precipitated
with 3 volumes of cold ethanol, and analyzed in a 15% sequencing
polyacrylamide gel.
Synthetic siRNAs Used as Inhibitors
[0195] The 21-nt siRNA inhibitor comprised CGUACGCGGAAUAC
UUCGA(5-Iodo-U)U annealed with UCGAAGUAUUCCGCGUACGUG; the 25-mer
comprised AUCACGUACGCGGAAUACUUCGA(5-Iodo-U)U annealed with
UCGAAGUAUUCCGCGUACGUGAUUG. The 5-Iodo-U nucleotides were included
to facilitate studies not presented here, and we have no evidence
they enhance the effectiveness of the siRNAs as inhibitors.
Analysis of RdRP Activity
[0196] Assays were performed in a final volume of 10 .mu.L
containing 5 .mu.L of lysate, 100 .mu.M GTP, 100 .mu.M CTP, 500
.mu.M ATP, 20 .mu.M UTP, 5 .mu.Ci of .alpha.-32P-UTP (25 Ci/mmole),
10 mM creatine phosphate, 10 .mu.g/mL creatine phosphokinase, 5 mM
DTT, 0.2 U/.mu.L Super-RNasin (Ambion), and 7-methyl-G- or A-capped
RNAs. After incubation at 25.degree. C. for 3 h, the reaction was
deproteinized with proteinase K in 200 .mu.L of 2.times. proteinase
K buffer at 65.degree. C. for 15 min. After
phenol/chloroform/isoamylalcohol extraction, the aqueous phase was
precipitated with 3 volumes of cold ethanol, resuspended in 10
.mu.L of 2.times. formamide loading buffer as described (Sambrook
et al. 1989), and resolved on 10% or 15% polyacrylamide sequencing
gels. For primed assays, capped RNAs were preincubated with
single-stranded 21-nt RNA primers or siRNA duplexes at room
temperature for 10 min before the remaining reaction components
were added.
Arabidopsis PHV, PHB, and Mutant PHV Target RNAs
[0197] Arabidopsis PHV and PHB cDNA sequences containing the
miR165/166 complementary sequences were amplified from an
Arabidopsis flower cDNA library (CD4-6) by polymerase chain
reaction (PCR) using the following primer pairs: 5'-PHV primer,
GCGTAATACGACTCACTATAGGCGCCGGAACAAGTTG AAG (SEQ ID NO:7), and 3'-PHV
primer, GACAGTCACGGAACCAAGATG (SEQ ID NO:8); or 5'-PHB primer,
GCGTAATACGACTCACTATAGGTGAGTCTGTGGTCGTGAGTG (SEQ ID NO:9), and
3'-PHB primer, GCTGCTGCTAAAGTCGTAGGA (SEQ ID NO:10). The
Arabidopsis G [right-arrow]. A mutant phv template was initially
amplified using the 5'-PHV primer and
CCACTGCAGTTGCGTGAAACAGCTACGATACCAATAGAATCCGGATCAGGC TTCATCCC (SEQ
ID NO:11). This PCR product was diluted 100-fold, then reamplified
with the 5'-PHV primer and
GACAGTCACGGAACCAAGATGGACGATCTTTGAGGATTTCAGCGACCTTCAT
GGGTTCTAAACTCACGAGGCCACAGGCACGTGCTGCTATTCCACTGCAGTTG CGTGAAACAGC
(SEQ ID NO:12). In vitro RNA transcription and cap labeling were as
described (Tuschl et al. 1999; Zamore et al. 2000).
In Vitro RNAi in Fly Embryo Lysate and Wheat Germ Extract
[0198] For RNAi in Drosophila embryo lysate, four siRNA duplexes
were chemically synthesized (Dharmacon), annealed, and incubated in
a standard RNAi reaction (Zamore et al. 2000). The sequences of
siRNAs (sense and antisense strands) corresponding to miR165,
miR166, PHV, and mutant phv target positions were miR165,
UCGGACCAGGCUUCAUCCCCC (SEQ ID NO:13) and GGGAUGAAGCCUGGUCCGAGG (SEQ
ID NO:14); miR166, UCGGACCAGGCUUCAUUCCCC (SEQ ID NO:15) and
GGAAUGAAGCCUGGUCCGAGA (SEQ ID NO:16); PHV, CCGGACCAGGCUUCAUCCCAA
(SEQ ID NO:17) and GGGAUGAAGCCUGGUCCGGAU (SEQ ID NO:18); and mutant
phv, CCGGAUCAGGCUUCAUCCCAA (SEQ ID NO:19) and GGGAUGAAGCCUGAUCCGGAU
(SEQ ID NO:20). Wheat germ extract target cleavage reactions were
as standard Drosophila in vitro RNAi reactions, except that no
exogenous siRNAs were added.
Total RNA Isolation and Northern Analysis
[0199] Total RNA was isolated from lysates, and Northern analysis
was performed as described (Hutvagner and Zamore 2002).
5'-32P-radioalabeled synthetic miR165 antisense siRNA (above) was
used as probe.
Overview of Examples I-VI
[0200] The data presented in Examples I-VI demonstrate that
extracts of wheat germ, introduced for the study of translation and
protein translocation in the 1970s (Roberts and Paterson 1973),
recapitulate many of the key features of RNA silencing in plants.
Using this in vitro system, it is shown that in plants,
ATP-dependent, Dicer-like enzymes cleave dsRNA into small RNAs that
have the structure of siRNAs. Unlike Drosophila embryos or
mammalian cells, plants convert dsRNA into two distinct classes of
siRNAs, long and short siRNAs. Inhibitor studies indicate that a
different Dicer-like enzyme generates each siRNA class.
[0201] The data further demonstrate that a wheat RdRP activity can
synthesize dsRNA using exogenous single-stranded RNA as a template
without an exogenous primer, and that this dsRNA is preferentially
converted into long siRNAs.
[0202] Finally, it is demonstrated that wheat germ extracts contain
an endogenous RISC programmed with a miRNA. This endogenous miRNA
complex can direct efficient cleavage of the wild-type Arabidopsis
PHAVOLUTA (PHV) mRNA sequence, but not that of a previously
described dominant PHV mutant that perturbs leaf development. This
finding supports the view that in plants miRNAs direct RNAi and
explains the molecular basis for the dominant PHV mutation in
Arabidopsis. Interestingly, exact complementarity between the miRNA
and target mRNA is not necessary for the miRNA to direct efficient
target cleavage. In fact, it is demonstrated that the efficiency of
cleavage is greater when a G:U base pair, referred to also as a G:U
wobble, is present near the 5' or 3' end of the complex formed
between the miRNA and the target.
[0203] Understanding the natural mechanism by which miRNAs
efficiency mediate RNAi in plants allows for the design of improved
RNAi agents for use in mediating RNAi not only in plants, but in
eukaryotes (in particular, in mammals).
Example I
Two Distinct Classes of Small RNAs Derived from dsRNA in Plant
Extracts
[0204] Two distinct classes of small RNAs are produced in
transgenic plants bearing silenced transgenes (Hamilton et al.
2002; Mallory et al. 2002). To test if the production of these two
classes of small RNAs was a normal feature of plant biology or a
specialized response to foreign DNA, the length distribution of a
nonredundant set of 423 endogenous small RNAs cloned from
Arabidopsis thaliana was examined. (For he sequences of 143 of the
small RNAs see Llave et al. 2002a; Reinhart et al. 2002). Excluded
from this analysis are cloned fragments of tRNA and rRNA. Included
in the set are known and predicted miRNAs, as well as small RNAs of
unknown function corresponding to intragenic regions or to mRNA
sequences in either the sense or antisense orientation. The
distribution of lengths within this set was bimodal, with peaks at
21 and 24 nt (FIG. 1A). In contrast, the length distribution of
cloned small RNAs from C. elegans forms a single broad peak (Lau et
al. 2001). The two classes of green fluorescent protein
(GFP)-derived small RNAs were proposed to be siRNAs with distinct
RNA silencing functions: the .about.21-mers to direct
posttranscriptional silencing via mRNA degradation and the
.about.24-mers to trigger systemic, silencing and the methylation
of homologous DNA (Hamilton et al. 2002). Analysis of the two
classes of endogenous small RNAs indicates that each class has a
distinct sequence bias, with a 5'-uridine predominating in the
shorter class and a 5'-adenosine in the longer class (FIG. 1B). The
5' sequence bias of the short class is produced by the inclusion in
the data set of miRNAs, which in plants and animals typically begin
with uridine (Lagos-Quintana et al. 2001, 2002; Lau et al. 2001;
Lee and Ambros 2001; Reinhart et al. 2002). Thus, the non-miRNA
small RNAs in the shorter class display no 5' sequence bias,
whereas a 5'-adenosine is overrepresented in the longer class. The
two classes are either generated by different enzymes, function
in_separate effector complexes, or both.
Example II
Plant Small RNAs are Bona Fide siRNAs
[0205] Although the small RNAs that correlate with the
posttranscriptional silencing of homologous target mRNAs were first
discovered in plants (Hamilton and Baulcombe 1999), they have not
yet been shown to be the direct products of endonucleolytic
cleavage of long dsRNA. To begin to test if small RNAs are, in
fact, siRNAs, we prepared plant extracts and monitored them for
Dicer-like activity. When uniformly 32P-radiolabeled dsRNA was
incubated in wheat germ extract, it was efficiently cleaved into
small RNAs (FIG. 2A). As reported previously for extracts of
Drosophila (Zamore et al. 2000) and for purified Drosophila
(Bernstein et al. 2001) and human Dicer (Billy et al. 2001), no
intermediate products were detected in the conversion of dsRNA into
small RNAs. Unlike the fly and human Dicer reactions, two discrete
size classes, one .about.21-nt and the other 24-25-nt long, were
produced from the dsRNA upon incubation in wheat germ extract (FIG.
2B). The ratio of wheat 24-25-mers to .about.21-mers in 14 separate
reactions was 4.+-.1.7, similar to the roughly 2.5-fold excess of
longer small RNA sequences cloned from Arabidopsis. (The 2.5-fold
excess of long to short, cloned endogenous small RNAs
underestimates the ratio, because it includes miRNAs, which are
predominantly short.). Silencing-related small RNAs have thus far
only been demonstrated in vivo for dicots, and wheat is a monocot.
Extracts of the dicot cauliflower, a member of the mustard family
like Arabidopsis, also converted dsRNA into two discrete sizes of
small RNAs, .about.21 and .about.24 nt (FIG. 2C). In both
Drosophila) and C. elegans, Dicer requires ATP for efficient
production of both siRNAs (Zamore et al. 2000; Bernstein et al.
2001; Nykanen et al. 2001) and miRNAs (Hutvagner et al. 2001;
Ketting et al. 2001). Consistent with the idea that both classes of
small RNAs are produced by plant orthologs of Dicer, efficient
production of both the .about.21-nt and the .about.24-nt small RNAs
in wheat germ extract required ATP (FIG. 2D).
[0206] Although small, silencing-associated RNAs in plants are
commonly called siRNAs, and synthetic siRNA duplexes initiate plant
RNA silencing (Klahre et al. 2002), plant small RNAs have not been
demonstrated to be double-stranded RNAs with 2-nt, 3' overhanging
ends and 3'-hydroxyl termini. Such attributes reflect the unique
production of siRNAs by members of the Dicer family of ribonuclease
III enzymes. To determine if the small RNAs generated from dsRNA in
wheat germ extracts were bona fide siRNAs, we analyzed their
structure. Uniformly 32P-radiolabeled dsRNA was incubated in wheat
germ extract, deproteinized, and fractionated by gel filtration to
resolve single-stranded from double-stranded siRNA (Nykanen et al.
2001). Both classes of small RNA products of the in vitro wheat
germ reaction comigrated with a synthetic siRNA duplex and with
Drosophila siRNA duplexes generated by processing dsRNA in
Drosophila embryo lysate (FIG. 2E). Therefore, the small RNAs
generated by incubating dsRNA in wheat germ extract are
double-stranded.
[0207] Next, we examined the end structure of the small RNAs.
Treatment of 5'-32P-radiolabeled, synthetic siRNA duplexes with the
single-stranded RNA-specific nucleases T1 and RNase A removes the
2-nt, 3' overhanging ends typical of siRNAs, generating 1-nt and
2-nt shorter RNAs. In a denaturing polyacrylamide gel, such
nuclease products of siRNAs migrate faster, because they contain
3'-phosphates (diagramed in FIG. 2F). When synthetic 25-nt duplexes
with 2-nt, 3' overhangs were digested with T1 and RNase A, the
expected 24-nt and 23-nt, 3' phosphorylated products were generated
(FIG. 2G). The small RNAs produced by incubation of dsRNA in the
wheat germ extract are a mixture of .about.21-nt and 24-25-nt
species. Digestion of this mixture with single-stranded nucleases
produced a faster-migrating population of RNA species whose length
distribution is consistent with the original mixture having the
single-stranded overhangs and double-stranded body characteristic
of siRNAs (FIG. 2G). Both size classes of small RNAs produced upon
incubation of dsRNA in wheat germ extract have 2',3'-hydroxyl and
5' monophosphate termini (data not shown). In sum, the small RNAs
have all the hallmarks of the products of Dicer-mediated cleavage
of dsRNA. It is concluded that they are bona fide siRNAs.
Example III
Different Dicer-Like Enzymes Produce Each Class of siRNA
[0208] There are at least two mechanisms by which long dsRNA could
be converted in plants into distinct size classes of small RNAs.
Local dsRNA sequence might determine siRNA length, irrespective of
which Dicer ortholog cleaves the dsRNA. In this case, we anticipate
that the two classes of small RNAs would have distinct sequence
compositions. Instead, only the 5' ends of the two classes show
sequence bias (FIG. 1B). An alternative explanation is that
different Dicer orthologs produce each class. Both the Arabidopsis
and rice genomes encode at least four different Dicer-like
proteins, including the Arabidopsis protein CARPEL FACTORY/SHORT
INTEGUMENTS-1 (CAF). The number of wheat Dicer orthologs is
presently unknown, because the hexaploid wheat genome remains to be
sequenced.
[0209] Drosophila Dicer binds tightly to siRNAs (P. D. Zamore and
B. Haley, unpubl.). Therefore, we reasoned that different Dicer
orthologs might be differentially inhibited by their products,
siRNAs. We tested the ability of 21-nt and 25-nt synthetic siRNA
duplexes to inhibit the production of siRNAs in Drosophila embryo
lysates and the production of the two distinct classes of siRNA in
wheat germ extract. Drosophila Dicer produces siRNAs 21-22 nt long.
Drosophila Dicer was inhibited more strongly by a 21-nt siRNA
duplex than by a 25-mer (FIG. 3A). Conversely, production of
24-25-nt siRNAs by wheat germ extract was inhibited more strongly
by an .about.25-nt synthetic siRNA duplex competitor than a 21-mer
(FIG. 3B). These results are consistent with the idea that the
authentic siRNA product of Dicer should bind more strongly to its
active site than an siRNA of an inauthentic length. Surprisingly,
production of the .about.21-nt siRNAs was completely refractory to
inhibition by either 21-nt or 25-nt synthetic siRNA duplexes, at
siRNA concentrations as high as 800 nM (FIG. 3B). The simplest
explanation for these data is that a different Dicer-like enzyme
generates each class of siRNA and that the enzyme responsible for
producing the 24-25-nt siRNAs is strongly inhibited by its siRNA
product, whereas the enzyme that produces the .about.21-nt siRNAs
is not inhibited by siRNA product at the concentrations tested. An
alterative explanation is that the concentration of the enzyme that
produces the .about.21-mers is higher than the highest
concentration of inhibitor we tested, 800 nM. For this to be true,
the enzyme would need to be present at micromolar concentration in
the extract, which seems unlikely, as it would then correspond to
.about.1% of total protein. The finding that production of both
classes of siRNAs were equally and strongly inhibited by long dsRNA
competitor (FIG. 3C) also supports an argument against this view.
If the enzyme that generates the 21-mers were present in the
extract at very high concentration, its activity should not have
been competed by the same concentrations of long dsRNA competitor
that saturate the enzyme that produces the 24-25-nt products. It is
concluded that each class of siRNA is produced by the
ATP-dependent, endonucleolytic cleavage of dsRNA by a different
Dicer ortholog.
Example IV
An RNA-dependent RNA Polymerase Activity in Wheat Germ Extracts
[0210] Genetic evidence implicates an RNA-dependent RNA polymerase
(RdRP) in PTGS triggered by transgenes expressing sense mRNA
(S-PTGS; Dalmay et al. 2000; Mourrain et al. 2000). Plant RdRPs
have been proposed to generate dsRNA from aberrantly expressed
single-stranded RNA, thereby leading to the production of siRNAs
that silence that RNA (Vaucheret et al. 2001). No direct
biochemical evidence has yet been presented demonstrating that such
a pathway is plausible.
[0211] Wheat germ extracts contain an RdRP activity (FIG. 4).
Increasing concentrations of single-stranded RNA were incubated
with the extract and ribonucleotide triphosphates, including
[alpha]-32P-UTP. Single-stranded RNA ranging from 77 to 501 nt,
either bearing a 7-methyl-G(5')ppp(5')G or an A(5')ppp(5') cap
structure, all led to the incorporation of 32P into RNA with
approximately the same length as the exogenous, nonradioactive
single-stranded RNA (FIG. 4). These radioactive RNAs correspond to
bona fide complementary RNA (cRNA) generated by an RdRP that copied
the single-stranded RNA by initiating RNA synthesis at the extreme
3' end of the exogenous template RNA (data not shown). In theory,
these newly radioactive RNAs could have arisen by transfer of
radiolabel to the input RNA itself. This type of label transfer had
previously been observed when similar experiments were performed
using Drosophila embryo lysates, but not with wheat germ extract.
Instead, the 32P-RNA represents newly synthesized cRNA produced by
a wheat enzyme using exogenous single-stranded RNA as a template in
the absence of an exogenous nucleic acid primer
[0212] In addition to copying single-stranded RNA into
approximately full-length cRNA, RdRPs have also been reported to
extend primers, using single-stranded RNA as a template (e.g.,
Schiebel et al. 1998). The RdRP activity or activities in wheat
germ extract could similarly extend a 32P-radiolabeled primer (FIG.
5A), but only when the RNA primer was complementary (antisense) to
the template RNA. Under identical conditions, no such
primer-extension activity was detected in lysates of syncitial
blastoderm Drosophila embryos, despite earlier reports to the
contrary (Lipardi et al. 2001). RNA-dependent, RNA-primer-extension
activity was detected, however, when wheat and fly extracts are
mixed (FIG. 5A). In neither Drosophila embryo lysate nor wheat germ
extract can we detect primer extension of a single-stranded RNA
template using a 21-nt siRNA duplex rather than a 21-nt antisense
primer.
[0213] It is proposed that aberrant single-stranded RNA triggers
silencing in plants when it serves as a template for the production
of cRNA, generating dsRNA, which can then be cleaved by Dicer into
siRNA duplexes. These data suggest that such copying does not
require primers, but is triggered merely by an exceptionally high
concentration of single-stranded RNA. To test if high
concentrations of single-stranded mRNA could lead to the production
of siRNAs, the RdRP reactions were repeated using a 2.7-kb
single-stranded firefly luciferase mRNA. Increasing concentrations
of the mRNA were incubated in either wheat germ extract or
Drosophila embryo lysate in the presence of ATP, CTP, GTP, and
[alpha]-32P-UTP, and examined for the production of 21-25-nt
radioactive RNAs. FIG. 5B (left) shows that when the incubations
were performed in wheat germ lysates, a single class of small RNA,
.about.24 nt long, was produced with increasing concentrations of
the exogenous, single-stranded template RNA. No such radioactive
product was observed in Drosophila embryo lysates, but it is noted
that these lysates contain endogenous UTP, which may preclude
detection of 32P small RNAs. To test if the radiolabeled
.about.24-nt products were generated by the de novo synthesis of
RNA, the experiment was repeated, replacing CTP and GTP with
3'-deoxy CTP and 3'-deoxy GTP, inhibitors of RNA synthesis. In the
presence of these inhibitors, no radioactive small RNAs were
observed in the wheat reaction (FIG. 5B, right). Thus,
single-stranded RNA can trigger in wheat germ extract the de novo
synthesis of .about.24-nt small RNAs.
[0214] Notably, the production of 21-nt RNAs was not detected in
this assay. The assay should have detected such 21-nt small RNAs if
they were present at 1/10 the concentration of the .about.24-mers,
but we would be unlikely to detect them far below this threshold.
Experiments with double-stranded RNA suggest that the 21-mers are
produced in wheat at about 1/4 the rate of the 24-25-nt small RNAs
(FIG. 2). Thus, the production of dsRNA by the RdRP activity may be
coupled to the production of the longer class of small RNAs. It is
noted that such coupling does not imply that production of
.about.24-nt siRNAs from exogenous dsRNA requires the participation
of an RdRP. It is proposed that dsRNA generated by RdRP copying of
single-stranded RNA is preferentially processed by a wheat Dicer
ortholog that produces long siRNAs, perhaps because the two
proteins are physically linked.
[0215] The question of whether the .about.24-nt RNAs synthesized in
the RdRP reactions are actual products of Dicer cleavage of dsRNA
was next addressed. Production of wheat 24-25-nt siRNAs from
32P-radiolabeled dsRNA is efficiently inhibited by synthetic siRNA
duplexes; 25-nt synthetic siRNA duplexes are more potent inhibitors
than 21-nt duplexes (FIG. 3B). Therefore, an experiment was
conducted to determine if production of the .about.24-nt small RNAs
in the RdRP reactions was similarly inhibited by synthetic siRNA
duplexes. FIG. 5C shows that the production of .about.24-nt small
RNAs in the
[0216] RdRP reactions programmed with a 2.7-kb single-stranded RNA
template was inhibited by synthetic siRNA duplexes. Like the
production of 24-25-nt siRNAs from exogenous dsRNA, production of
the de novo synthesized .about.24-mers was inhibited to a greater
extent by 25-nt synthetic siRNA duplexes than by 21-nt duplexes
(FIG. 5C). Half-maximal inhibition of small RNA production in the
RdRP-dependent reactions occurred at roughly the same concentration
of synthetic siRNA duplex as inhibition of the processing of 32P
dsRNA (cf. FIGS. 5C and 3B). It is concluded that in wheat germ
extract, exogenous single-stranded RNA provides the template for
the synthesis of cRNA by an RdRP and that the resulting
template-RNA:cRNA hybrid is then preferentially cleaved into
.about.24-nt siRNAs by a Dicer-like enzyme.
Example V
miRNAs Act as siRNAs in Plants
[0217] In addition to siRNAs, another class of small RNAs,
microRNAs (miRNAs), has been detected in plants (Llave et al.
2002a; Park et al. 2002; Reinhart et al. 2002). Like their animal
counterparts, plant miRNAs are generated by a Dicer family member,
CAF. miRNAs are encoded in stem-loop precursor RNAs that are
cleaved by CAF into 21-24-nt single-stranded small RNAs (Park et
al. 2002; Reinhart et al. 2002). Exogenous miRNA precursors were
not faithfully processed into mature miRNAs in wheat germ extract
(data not shown). Instead, in vitro transcribed pre-miRNAs were
cleaved into small RNAs too long to correspond to authentic, mature
miRNAs. Perhaps the Dicer ortholog responsible for miRNA maturation
in wheat--presumably wheat CAF--is absent from wheat germ extracts.
In Arabidopsis, CAF transcripts that encode a protein with a
nuclear localization signal have been reported, suggesting that CAF
protein may be nuclear (Jacobsen et al. 1999). Because wheat germ
extracts are essentially cytoplasm, nuclear CAF might not be
present in the extract.
[0218] Plant miRNAs differ from animal miRNAs in that there are
corresponding mRNA sequences in the Arabidopsis and rice genomes
with significant complementarity to miRNA sequences (Llave et al.
2002a,b; Reinhart et al. 2002; Rhoades et al. 2002). The high
degree of complementarity between 14 recently analyzed plant miRNAs
and specific families of developmentally important plant mRNAs led
to the proposal that plant miRNAs direct developmentally controlled
mRNA destruction (Rhoades et al. 2002). That is, after the plant
miRNAs are generated by the cleavage of pre-miRNAs by CAF, they
enter the RNAi pathway and function as siRNAs. In contrast, animal
miRNAs are thought to act as translational repressors (for review,
see Ruvkun 2001). An untested feature of this proposal is that an
RNAi-like pathway in plants tolerates the three to four mismatches
sometimes observed between an miRNA and its predicted mRNA
target.
[0219] If plant miRNAs are endogenous mediators of RNAi, then wheat
germ extracts should contain miRNA-programmed complexes that
specify endonucleolytic cleavage of corresponding target RNAs. In
particular, miR165 has been proposed to down-regulate PHV and
PHABULOSA (PHB) mRNA expression in Arabidopsis by an RNAi-like
mechanism (Rhoades et al. 2002). PHV and PHB encode
homeodomain-leucine zipper transcription factors implicated in the
perception of radial position in the shoot tissues that give rise
to leaves (McConnell and Barton 1998; McConnell et al. 2001).
Dominant phv and phb mutations alter a single amino acid
(glycine.fwdarw.glutamic acid) in the sterol/lipid-binding domain
of the proteins, suggesting that the mutant phenotype results from
a change in the function of PHV and PHB (McConnell and Barton 1998;
McConnell et al. 2001). However, the discovery of plant miRNAs
complementary to this site in PHV led to the suggestion that the
molecular basis of the dominance is the persistence of PHV and PHB
expression at developmental stages when these mRNAs are normally
destroyed (Rhoades et al. 2002). This hypothesis is consistent with
both the increased overall levels of PHB mRNA in the dominant
mutant and the increased activity of a dominant mutant phb mRNA on
the abaxial, rather than the adaxial, domain of the leaf primordium
(McConnell and Barton 1998; McConnell et al. 2001).
[0220] miR165 or miR166 is present in wheat germ extracts (FIG.
6A). miR165 and miR166 differ by a single C-to-U transition that
decreases the complementarity of miR166 to PHV and PHB by changing
a G:C base pair to a G:U wobble. Rice (Oryza) is the sequenced
genome most closely related to wheat. Although the rice genome
encodes no miR165 homolog, it encodes six copies of miR166
(Reinhart et al. 2002). Because the Northern hybridization
conditions used herein cannot distinguish between miR165 and
miR166, the endogenous wheat miRNA is referred to as
miR165/166.
[0221] To begin to test the hypothesis that plant miRNAs function
to regulate target gene expression by an RNAi-like mechanism,
target RNAs were prepared encoding a portion of the wild-type
sequence of Arabidopsis PHV or the dominant G.fwdarw.A point
mutation, which falls within the PHV sequences proposed to pair
with miR165/166. The target RNAs and relevant miRNAs are shown in
FIG. 6C. 5'-radiolabeled target RNAs were incubated with wheat germ
extract, then analyzed on a denaturing sequencing gel. In the
absence of any other exogenous RNA, the wild-type PHV target RNA,
but not the dominant G.fwdarw.A mutant, was efficiently cleaved
within the region complementary to miR165/166 (FIGS. 7A,B). This
21-nt region is identical in PHV and PHB, and a target RNA that
contained sequence from the Arabidopsis PHB mRNA was also cleaved
within the sequences complementary to miR165/166 upon incubation in
the wheat germ extract (data not shown). In the RNAi pathway, a key
feature of small RNA-directed target destruction is that
pretreatment with the single-stranded nucleic acid-specific enzyme,
micrococcal nuclease, abolishes RISC activity (Hammond et al.
2000). Cleavage of the PHV target RNA was likewise abolished by
pretreatment of the extract with micrococcal nuclease (data not
shown), consistent with the view that miR165/166 acts as a guide to
direct target cleavage. The difference in cleavage rate between
wild-type and mutant target RNAs, which differ only at a single
nucleotide, was >14-fold (FIG. 7B). Thus, the resistance of the
mutant phv RNA to cleavage by an endogenous RNAi-like nuclease can
explain why the mutation is dominant.
[0222] Next, cleavage of the PHV target RNA by various siRNAs was
analuzed in Drosophila embryo lysate (FIG. 6C). An siRNA with
perfect complementarity to the site predicted to pair with
miR165/166 and an siRNA duplex in which one strand had the sequence
of miR165 or miR166 directed cleavage of the PHV target RNA,
yielding the predicted 514-nt 5' cleavage product (FIG. 7C). None
of these three siRNAs efficiently cleaved the PHV mutant target
(FIG. 7C). Quantification of the cleavage mediated by the siRNA
with perfect complementarity as compared to that mediated by miR165
demonstrates that miR165 more efficiently mediates target cleavage.
This is presumed to be due to the fact that miR 165 forms two G:U
wobble base pairs with the target mRNA, one at position 1 and one
at position 17 (with respect to the 5' end of the antisense siRNA
strand) (FIG. 8).
[0223] The failure of the miR165-siRNA duplex to cleave mutant PHV
was a direct consequence of its reduced complementarity to the
target RNA at position 6 (with respect to the 5' end of the
antisense siRNA strand), because an siRNA with perfect
complementarity to the mutant sequence (FIG. 6B) efficiently
cleaved the mutant RNA (FIG. 7C). The 5' cleavage product produced
in the siRNA-programmed RNAi reactions comigrated with that
produced when the PHV target RNA was incubated in wheat germ
extract without exogenous siRNA (FIG. 7C).
[0224] The simplest explanation for the sequence-specificity of the
nuclease is that it is guided by miR165/166: cleavage requires a
nucleic acid component, occurs at the same site on the PHV target
RNA as directed by an siRNA duplex with the sequence of miR165 or
miR166 in Drosophila embryo lysate, and, like the siRNA, is
inefficient with the G.fwdarw.A mutant phv RNA. In the RNAi
pathway, an siRNA-programmed endonuclease complex is called an RISC
(Hammond et al. 2000). These data suggest that wheat miR165/166 is
in an RISC, supporting the proposal that plant miRNAs regulate
expression of their mRNA targets by endogenous RNAi.
Example VI
miR165/166 Directs Multiple Rounds of Target Cleavage
[0225] The next question addressed was whether the
miR165/166-programmed RISC acts as an enzyme. Quantitative Northern
hybridization demonstrates that the wheat germ extract reactions
contained 0.083 nM miR165/166 (FIG. 6B). The target RNA
concentration in these reactions was 5 nM, and more than half the
target RNA was destroyed in 80 min (FIG. 7A). Thus, each miR165/166
RNA directed cleavage of .about.30 target RNA molecules. Therefore,
the miR165/166-programmed RISC is a multiple-turnover enzyme.
[0226] Discussion
[0227] The above data show that wheat germ extracts recapitulate in
vitro many aspects of RNA silencing in plants. Wheat germ extracts
convert exogenous dsRNA into two distinct classes of small RNAs.
Detailed analysis of these small RNAs indicates that they are bona
fide siRNAs. Thus, plant siRNAs are derived directly from longer
dsRNA, just as in animals. The data indicate that distinct
Dicer-like enzymes generate the two functionally distinct classes
of siRNAs. Cloned endogenous small RNAs from Arabidopsis likewise
form two distinct length classes, whose 5' ends indicate that they
are made by distinct enzymes. An alternative view, that one or more
Dicer-like enzymes may generate both classes of small RNAs, with
the different lengths a byproduct of local sequence context, is not
consistent with the above observation that production of 24-25-nt
RNAs in wheat germ extract was inhibited by synthetic siRNA
duplexes, whereas .about.21-nt siRNA production was not. If the
production of siRNAs is tightly coupled to the assembly of
downstream effector complexes, then their production by different
Dicer orthologs may ensure that the two classes of siRNAs function
in different cellular pathways (see also Hamilton et al. 2002).
[0228] A hallmark of PTGS in plants and RNAi in nematodes is the
spreading of silencing signals along the length of the mRNA target.
In plants, spreading occurs in both the 5' and 3' directions and
requires the putative RdRP gene, SGS2. Spreading is observed even
when silencing is initiated by a single siRNA sequence (Klahre et
al. 2002). One hypothesis is that 5' spreading is initiated by the
antisense siRNA strand priming copying of the target mRNA by an
RdRP, thereby producing dsRNA. 3' spreading cannot be explained by
such a mechanism. Both 5' and 3' spreading might instead be
catalyzed by the conversion of mRNA fragments into dsRNA by an RdRP
that initiates synthesis at the 3' end of the two fragments
generated when an RISC cleaves the target RNA. This dsRNA would
then be cleaved by a Dicer-like enzyme to produce secondary siRNAs
(Lipardi et al. 2001; Sijen et al. 2001). Such RNA synthesis would
occur without the involvement of a primer. The above data
demonstrate that exogenous single-stranded RNA is copied into cRNA
in the extract by a wheat RdRP that acts without the aid of an
exogenous primer. The resulting dsRNA is cleaved preferentially
into the longer class of siRNAs, suggesting the RdRP is physically
linked to a specific Dicer ortholog. The specific biochemical
function of the 24-25-nt siRNAs generated in this reaction remains
to be determined.
[0229] miRNAs Function as siRNAs in Plants
[0230] The above data further show that miRNAs in plants function
in much the same way that siRNA duplexes function in Drosophila and
humans: as guides for an endonuclease complex. Each endonuclease
complex can catalyze multiple rounds of target cleavage, indicating
that the miRNA is not consumed in the reaction. Entry of a miRNA
into a multiple-turnover RNAi enzyme complex is not unprecedented;
in human cells, the miRNA let-7 is a component of an RISC, although
the human genome does not appear to contain any mRNA sequences with
sufficient complementarity to be cleaved by this RISC (Hutvagner
and Zamore 2002). Like the plant miR165/166-programmed RISC, the
human let-7-programmed RISC can catalyze multiple rounds of target
cleavage.
[0231] Additional support for the idea that plant miRNAs direct
cleavage of complementary mRNA targets comes from the work of
Carrington and colleagues, who recently showed that a family of
Arabidopsis mRNAs encoding SCARECROW-LIKE (SCL) transcription
factors is cleaved by an RNAi-like process directed by miR171, an
miRNA that is fully complementary to its mRNA targets, unlike
miR165/166 (Llave et al. 2002b). Like wheat miR165/166, Arabidopsis
miR171 appears to direct the endonucleolytic cleavage of its target
mRNAs. In this respect, miR171 functions as if it were a
single-stranded siRNA. Single-stranded siRNAs can trigger RNAi in
both Drosophila and mammalian cell extracts and in vivo in HeLa
cells (Martinez et al. 2002a; Schwarz et al. 2002), although much
higher concentrations of single-stranded siRNA is required than for
duplex (Schwarz et al. 2002). Furthermore, an individual human RISC
contains only one strand of the exogenous siRNA duplex used to
trigger RNAi (Martinez et al. 2002a).
[0232] The observation that, in Drosophila embryo lysate, an siRNA
with the sequence of miR165, which contains three mismatches with
its target mRNA, is at least as potent as an siRNA with perfect
complementarity to the same target sequence, demonstrates that
mismatches per se do not block target cleavage. Rather, the
specific position and sequence of siRNA:target RNA mismatches
determine if they permit or disrupt RNAi. The data also suggest
that miRNAs in plants evolved to optimize cleavage efficiency
rather than maximize complementarity to their targets. It is
predicted that three or four mismatches between an miRNA (or the
guide strand of an siRNA duplex) and its target RNA, properly
placed so as to still permit mRNA cleavage, will facilitate the
release of cleaved target RNA from the RISC complex, thereby
increasing the rate of enzyme turnover.
[0233] miRNA Function and the Spread of Silencing Signals Along a
Silenced Sequence
[0234] Spreading of silencing signals along the length of a
silenced mRNA sequence is a common feature of plant RNA silencing.
Because miRNAs act as siRNAs, one might anticipate that they would
also elicit spreading. However, miRNA-induced spreading is not
consistent with the genetics of the PHV and PHB mutants; the very
existence of a dominant PHV mutant excludes both 5' and 3'
spreading. Spreading of the silencing signal--that is, the
generation of new siRNAs 5' or 3' to the site of initial target
cleavage--would produce siRNAs containing sequences common to both
the wild-type and mutant PHV mRNAs. If such siRNAs were generated,
they would direct destruction of the mutant PHV mRNA. In such a
case, the PHV mutant could only have been recovered as a recessive,
not a dominant allele. Genetic studies (McConnell et al. 2001) show
that endonucleolytic cleavage of target RNAs by miRNA-directed RISC
complexes does not trigger spreading in plants. This remains true
even when the miRNA is the perfect complement of its mRNA target
(Llave et al. 2002b).
[0235] How, then, can the well-documented spreading phenomenon
observed for S-PTGS be reconciled with the absence of spreading in
miRNA-directed target cleavage? It is proposed that plants contain
two separate mechanisms for target mRNA destruction--endogenous
mRNAs are regulated by endonucleolytic cleavage directed by
miRNA-programmed RISC complexes, whereas exogenous silencing
triggers, such as transgenes or viruses, might initiate successive
cycles of siRNA-primed, RdRP-catalyzed dsRNA synthesis, followed by
cleavage of the dsRNA into siRNAs by Dicer-like enzymes, a
mechanism termed'random degradative PCR (Lipardi et al. 2001). RISC
complexes would play no role in the execution of target RNAs in
this cycle. The observation that a single siRNA sequence can
trigger 3' spreading (Klahre et al. 2002) is difficult to reconcile
with a priming mechanism. Intriguingly, VIGS-mediated RNA silencing
of endogenous genes is not associated with spreading of silencing
into regions of the target sequence 5' or 3' to the initial
silencing trigger (Vaistij et al. 2002), although such silencing
clearly must involve siRNAs derived from viral dsRNA, not
endogenous miRNAs.
[0236] An alternative hypothesis is that the absolute concentration
of an RNA target might determine if the 5' and 3' cleavage
fragments generated by target cleavage are converted into dsRNA by
an RdRP. Only when the products of RISC-mediated target cleavage
accumulate to a sufficiently high concentration would they serve as
substrates for the RdRP and consequently trigger spreading.
Experiments with polygalacturonase-silenced tomatoes support this
view (Han and Grierson 2002). In these plants, siRNAs were produced
from the silencing-inducing transgene but not the corresponding
silenced endogene. The siRNAs were preferentially produced from the
3' end of the transgene, consistent with the idea that plant RdRPs
act without aid of a primer. Furthermore, these authors detected
mRNA degradation products consistent with endonucleolytic cleavage
of the targeted polygalacturonase endogene. Thus, RISC-mediated
cleavage per se does not appear to trigger spreading along the
target RNA sequence. More likely, the endonucleolytic cleavage of
transgenic mRNA produces a sufficiently high concentration of mRNA
fragments to recruit an RdRP, resulting in the production of siRNAs
from the 3' cleavage product. miRNA-directed cleavage of natural
plant regulatory targets would not lead to spreading, because
endogenous mRNA targets are not present at sufficiently high
concentrations to recruit the RdRP. This model predicts that the
putative RdRP SGS2 (SDE1) required for PTGS, will not be required
for miRNA-directed destruction of endogenous mRNA targets. In fact,
no developmental abnormalities have been reported for SGS2 mutants
(Mourrain et al. 2000), including mutations likely to be strongly
hypomorphic or functionally null (Dalmay et al. 2000), suggesting
that plants lacking SGS2 protein have normal miRNA biogenesis and
function.
References
[0237] Beclin, C., Boutet, S., Waterhouse, P., and Vaucheret, H.
2002. A branched pathway for transgene-induced RNA silencing in
plants. Curr. Biol. 12: 684-688. [0238] Bernstein, E., Caudy, A.
A., Hammond, S. M., and Hannon, G. J. 2001. Role for a bidentate
ribonuclease in the initiation step of RNA interference. Nature
409: 363-366. [0239] Billy, E., Brondani, V., Zhang, H., Muller,
U., and Filipowicz, W. 2001. Specific interference with gene
expression induced by long, double-stranded RNA in mouse embryonal
teratocarcinoma cell lines. Proc. Natl. Acad. Sci. 98: 14428-14433.
[0240] Celotto, A. M. and Graveley, B. R. 2002. Exon-specific RNAi:
A tool for dissecting the functional relevance of alternative
splicing. RNA 8: 8-24. [0241] Chiu, Y.-L. and Rana, T. M. 2002.
RNAi in human cells: Basic structural and functional features of
small interfering RNA. Mol. Cell 10: 549-561. [0242] Cogoni, C. and
Macino, G. 1999. Gene silencing in Neurospora crassa requires a
protein homologous to RNA-dependent RNA polymerase. Nature 399:
166-169. [0243] Dalmay, T., Hamilton, A., Rudd, S., Angell, S., and
Baulcombe, D. C. 2000. An RNA-dependent RNA polymerase gene in
Arabidopsis is required for posttranscriptional gene silencing
mediated by a transgene but not by a virus. Cell 101: 543-553.
[0244] Djikeng, A., Shi, H., Tschudi, C., and Ullu, E. 2001. RNA
interference in Trypanosoma brucei: Cloning of small interfering
RNAs provides evidence for retroposon-derived 24-26-nucleotide
RNAs. RNA 7: 1522-1530. [0245] Elbashir, S. M., Harborth, J.,
Lendeckel, W., Yalcin, A., Weber, K., and Tuschl, T. 2001a.
Duplexes of 21-nucleotide RNAs mediate RNA interference in
mammalian cell culture. Nature 411: 494-498. [0246] Elbashir, S.
M., Lendeckel, W., and Tuschl, T. 2001b. RNA interference is
mediated by 21- and 22-nucleotide RNAs. Genes & Dev. 15:
188-200. [0247] Elbashir, S. M., Martinez, J., Patkaniowska, A.,
Lendeckel, W., and Tuschl, T. 2001c. Functional anatomy of siRNAs
for mediating efficient RNAi in Drosophila melanogaster embryo
lysate. EMBO J. 20: 6877-6888. [0248] Erickson, A. H. and Blobel,
G. 1983. Cell-free translation of messenger RNA in a wheat germ
system. Methods Enzymol. 96: 38-50. [0249] Fagard, M., Boutet, S.,
Morel, J.-B., Bellini, C., and Vaucheret, H. 2000. AGO1, QDE-2,nd
RDE-1 are related proteins required for post-transcriptional gene
silencing in plants, quelling in fungi, and RNA interference in
animals. Proc. Natl. Acad. Sci. 97: 11650-11654. [0250] Grishok,
A., Pasquinelli, A. E., Conte, D., Li, N., Parrish, S., Ha, I.,
Baillie, D. L., Fire, A., Ruvkun, G., and Mello, C. C. 2001. Genes
and mechanisms related to RNA interference regulate expression of
the small temporal RNAs that control C. elegans developmental
timing. Cell 106: 23-34. [0251] Hamilton, A. J. and Baulcombe, D.
C. 1999. A species of small antisense RNA in posttranscriptional
gene silencing in plants. Science 286: 950-952. [0252] Hamilton,
A., Voinnet, O., Chappell, L., and Baulcombe, D. 2002. Two classes
of short interfering RNA in RNA silencing. EMBO J. 21: 4671-4679.
[0253] Hammond, S. M., Bernstein, E., Beach, D., and Hannon, G. J.
2000. An RNA-directed nuclease mediates post-transcriptional gene
silencing in Drosophila cells. Nature 404: 293-296. [0254] Hammond,
S. M., Boettcher, S., Caudy, A. A., Kobayashi, R., and Hannon, G.
J. 2001. Argonaute2, a link between genetic and biochemical
analyses of RNAi. Science 293: 1146-1150. [0255] Han, Y. and
Grierson, D. 2002. Relationship between small antisense RNAs and
aberrant RNAs associated with sense transgene mediated gene
silencing in tomato. Plant J. 29: 509-519. [0256] Hannon, G. J.
2002. RNA interference. Nature 418: 244-251. [0257] Holen, T.,
Amarzguioui, M., Wiiger, M. T., Babaie, E., and Prydz, H. 2002.
Positional effects of short interfering RNAs targeting the human
coagulation trigger Tissue Factor. Nucleic Acids Res. 30:
1757-1766. [0258] Hutvagner, G. and Zamore, P. D. 2002. A microRNA
in a multiple-turnover RNAi enzyme complex. Science 297: 2056-2060.
[0259] Hutvagner, G., McLachlan, J., Pasquinelli, A. E., Balint,
E., Tuschl, T., and Zamore, P. D. 2001. A cellular function for the
RNA-interference enzyme Dicer in the maturation of the let-7 small
temporal RNA. Science 293: 834-838. [0260] Jacobsen, S. E.,
Running, M. P., and Meyerowitz, E. M. 1999. Disruption of an RNA
helicase/RNase III gene in Arabidopsis causes unregulated cell
division in floral meristems. Development 126: 5231-5243. [0261]
Kennerdell, J. R., Yamaguchi, S., and Carthew, R. W. 2002. RNAi is
activated during Drosophila oocyte maturation in a manner dependent
on aubergine and spindle-E. Genes & Dev. 16: 1884-1889. [0262]
Ketting, R. F., Fischer, S. E., Bernstein, E., Sijen, T., Hannon,
G. J., and Plasterk, R. H. 2001. Dicer functions in RNA
interference and in synthesis of small RNA involved in
developmental timing in C. elegans. Genes & Dev. 15: 2654-2659.
[0263] Klahre, U., Crete, P., Leuenberger, S. A., Iglesias, V. A.,
and Meins, F., Jr. 2002. High molecular weight RNAs and small
interfering RNAs induce systemic posttranscriptional gene silencing
in plants. Proc. Natl. Acad. Sci. 99: 11981-11986. [0264] Kooter,
J. M., Matzke, M. A., and Meyer, P. 1999. Listening to the silent
genes: Transgene silencing, gene regulation and pathogen control.
Trends Plant Sci. 4: 340-347. [0265] Lagos-Quintana, M., Rauhut,
R., Lendeckel, W., and Tuschl, T. 2001. Identification of novel
genes coding for small expressed RNAs. Science 294: 853-858. [0266]
Lagos-Quintana, M., Rauhut, R., Yalcin, A., Meyer, J., Lendeckel,
W., and Tuschl, T. 2002. Identification of tissue-specific
microRNAs from mouse. Curr. Biol. 12: 735-739. [0267] Lau, N. C.,
Lim, L. P., Weinstein, E. G., and Bartel, D. P. 2001. An abundant
class of tiny RNAs with probable regulatory roles in Caenorhabditis
elegans. Science 294: 858-862. [0268] Lee, R. C. and Ambros, V.
2001. An extensive class of small RNAs in Caenorhabditis elegans.
Science 294: 862-864. [0269] Lee, R. C., Feinbaum, R. C., and
Ambros, V. 1993. The C. elegans heterochronic gene lin-4 encodes
small RNAs with antisense complementarity to lin-14. Cell 75:
843-854. [0270] Lee, Y., Jeon, K., Lee, J. T., Kim, S., and Kim, V.
N. 2002. MicroRNA maturation: Stepwise processing and subcellular
localization. EMBO J. 21: 4663-4670. [0271] Li, W. X. and Ding, S.
W. 2001. Viral suppressors of RNA silencing. Curr. Opin.
Biotechnol. 12: 150-154. [0272] Lipardi, C., Wei, Q., and Paterson,
B. M. 2001. RNAi as random degradative PCR. siRNA primers convert
mRNA into dsRNAs that are degraded to generate new siRNAs. Cell
107: 297-307. [0273] Llave, C., Kasschau, K. D., Rector, M. A., and
Carrington, J. C. 2002a. Endogenous and silencing-associated small
RNAs implants. Plant Cell 14: 1605-1619. [0274] Llave, C., Xie, Z.,
Kasschau, K. D., and Carrington, J. C. 2002b. Cleavage of
Scarecrow-Like mRNA targets directed by a class of Arabidopsis
miRNA. Science 297: 2053-2056. [0275] Mallory, A. C., Reinhart, B.
J., Bartel, D., Vance, V. B., and Bowman, L. H. 2002. A viral
suppressor of RNA silencing differentially regulates the
accumulation of short interfering RNAs and micro-RNAs in tobacco.
Proc. Natl. Acad. Sci. 99: 15228-15233. [0276] Martens, H.,
Novotny, J., Oberstrass, J., Steck, T. L., Postlethwait, P., and
Nellen, W. 2002. RNAi in Dictyostelium: The role of RNA-directed
RNA polymerases and double-stranded RNase. Mol. Biol. Cell 13:
445-453. [0277] Martinez, J., Patkaniowska, A., Urlaub, H.,
Liihrmann, R., and Tuschl, T. 2002a. Single-stranded antisense
siRNAs guide target RNA cleavage in RNAi. Cell 110: 563. [0278]
Martinez, L. A., Naguibneva, I., Lehrmann, H., Vervisch, A.,
Tchenio, T., Lozano, G., and Harel-Bellan, A. 2002b. Synthetic
small inhibiting RNAs: Efficient tools to inactivate oncogenic
mutations and restore p53 pathways. Proc. Natl. Acad. Sci. 99:
14849-14854. [0279] Matzke, M. A., Matzke, A. J., Pruss, G. J., and
Vance, V. B. 2001. RNA-based silencing strategies in plants. Curr.
Opin. Genet. Dev. 11: 221-227. [0280] McConnell, J. R. and Barton,
M. K. 1998. Leaf polarity and meristem formation in Arabidopsis.
Development 125: 2935-2942. [0281] McConnell, J. R., Emery, J.,
Eshed, Y., Bao, N., Bowman, J., and Barton, M. K. 2001. Role of
PHABULOSA and PHAVOLUTA in determining radial patterning in shoots.
Nature 411: 709-713. [0282] Mourelatos, Z., Dostie, J., Paushkin,
S., Sharma, A. K., Charroux, B., Abel, L., Rappsilber, J., Mann,
M., and Dreyfuss, G. 2002. miRNPs: A novel class of
ribonucleoproteins containing numerous microRNAs. Genes & Dev.
16: 720-728. [0283] Mourrain, P., Beclin, C., Elmayan, T.,
Feuerbach, F., Godon, C., Morel, J. B., Jouette, D., Lacombe, A.
M., Nikic, S., Picault, N. et al. 2000. Arabidopsis SGS2 and SGS3
genes are required for posttranscriptional gene silencing and
natural virus resistance. Cell 101: 533-542. [0284] Nykanen, A.,
Haley, B., and Zamore, P. D. 2001. ATP requirements and small
interfering RNA structure in the RNA interference pathway. Cell
107: 309-321. [0285] Pal-Bhadra, M., Bhadra, U., and Birchler, J.
A. 2002. RNAi related mechanisms affect both transcriptional and
posttranscriptional transgene silencing in Drosophila. Mol. Cell 9:
315-327. [0286] Park, W., Li, J., Song, R., Messing, J., and Chen,
X. 2002. CARPEL FACTORY, a Dicer homolog, and HEN1, a novel
protein, act in microRNA metabolism in Arabidopsis thaliana. Curr.
Biol. 12: 1484-1495. [0287] Parrish, S. and Fire, A. 2001. Distinct
roles for RDE-1 and RDE-4 during RNA interference in Caenorhabditis
elegans. RNA 7: 1397-1402. [0288] Parrish, S., Fleenor, J., Xu, S.,
Mello, C., and Fire, A. 2000. Functional anatomy of a dsRNA
trigger. Differential requirement for the two trigger strands in
RNA interference. Mol. Cell 6: 1077-1087. [0289] Pasquinelli, A.
E., Reinhart, B. J., Slack, F., Martindale, M. Q., Kuroda, M. I.,
Maller, B., Hayward, D. C., Ball, E. E., Degnan, B., Muller, P. et
al. 2000. Conservation of the sequence and temporal expression of
let-7 heterochronic regulatory RNA. Nature 408: 86-89. [0290]
Plasterk, R. H. 2002. RNA silencing: The genome's immune system.
Science 296: 1263-1265. [0291] Reinhart, B. J., Slack, F. J.,
Basson, M., Pasquinelli, A. E., Bettinger, J. C., Rougvie, A. E.,
Horvitz, H. R., and Ruvkun, G. 2000. The 21-nucleotide let-7 RNA
regulates developmental timing in Caenorhabditis elegans. Nature
403: 901-906. [0292] Reinhart, B. J., Weinstein, E. G., Rhoades, M.
W., Bartel, B., and Bartel, D. P. 2002. MicroRNAs in plants. Genes
& Dev. 16: 1616-1626. [0293] Rhoades, M. W., Reinhart, B. J.,
Lim, L. P., Burge, C. B., Bartel, B., and Bartel, D. P. 2002.
Prediction of plant microRNA targets. Cell 110: 513-520. [0294]
Roberts, B. E. and Paterson, B. M. 1973. Efficient translation of
tobacco mosaic virus RNA and rabbit globin 9S RNA in a cell-free
system from commercial wheat germ. Proc. Natl. Acad. Sci. 70:
2330-2334. [0295] Roignant, J.-Y., Carre, C., Mugat, B., Szymczak,
D., Lepesant, J.-A., and Antoniewski, C. 2003. Absence of
transitive and systemic pathways allows cell-specific and
isoform-specific RNAi in Drosophila. RNA (In press). [0296] Ruvkun,
G. 2001. Molecular biology. Glimpses of a tiny RNA world. Science
294: 797-799. [0297] Sambrook, J., Fritsch, E., and Maniatis, T.
1989. Molecular cloning: A laboratory manual, 2nd ed. Cold Spring
Harbor Laboratory Press, Cold Spring Harbor, N.Y. [0298] Schiebel,
W., Pelissier, T., Riedel, L., Thalmeir, S., Schiebel, R., Kempe,
D., Lottspeich, F., Sanger, H. L., and Wassenegger, M. 1998.
Isolation of an RNA-directed RNA polymerase-specific cDNA clone
from tomato. Plant Cell 10: 2087-2101. [0299] Schwarz, D. S.,
Hutvagner, G., Haley, B., and Zamore, P. D. 2002. Evidence that
siRNAs function as guides, not primers, in the Drosophila and human
RNAi pathways. Mol. Cell 10: 537-548. [0300] Sijen, T., Fleenor,
J., Simmer, F., Thijssen, K. L., Parrish, S., Timmons, L.,
Plasterk, R. H., and Fire, A. 2001. On the role of RNA
amplification in dsRNA-triggered gene silencing. Cell 107: 465-476.
[0301] Smardon, A., Spoerke, J., Stacey, S., Klein, M., Mackin, N.,
and Maine, E. 2000. EGO-1 is related to RNA-directed RNA polymerase
and functions in germ-line development and RNA interference in C.
elegans. Curr. Biol. 10: 169-178. [0302] Tabara, H., Sarkissian,
M., Kelly, W. G., Fleenor, J., Grishok, A., Timmons, L., Fire, A.,
and Mello, C. C. 1999. The rde-1 gene, RNA interference, and
transposon silencing in C. elegans. Cell 99: 123-132. [0303]
Tijsterman, M., Ketting, R. F., Okihara, K. L., Sijen, T., and
Plasterk, R. H. 2002. RNA helicase MUT-14-dependent gene silencing
triggered in C. elegans by short antisense RNAs. Science 295:
694-697. [0304] Tuschl, T., Zamore, P. D., Lehmann, R., Bartel, D.
P., and Sharp, P. A. 1999. Targeted mRNA degradation by
double-stranded RNA in vitro. Genes & Dev. 13: 3191-3197.
[0305] Vaistij, F. E., Jones, L., and Baulcombe, D. C. 2002.
Spreading of RNA targeting and DNA methylation in RNA silencing
requires transcription of the target gene and a putative
RNA-dependent RNA polymerase. Plant Cell 14: 857-867. [0306]
Vaucheret, H., Beclin, C., and Fagard, M. 2001.
Post-transcriptional gene silencing in plants. J. Cell Sci. 114:
3083-3091. [0307] Waterhouse, P. M., Wang, M. B., and Lough, T.
2001. Gene silencing as an adaptive defence against viruses. Nature
411: 834-842. [0308] Williams, R. W. and Rubin, G. M. 2002.
ARGONAUTE1 is required for efficient RNA interference in Drosophila
embryos. Proc. Natl. Acad. Sci. 99: 6889-6894. [0309] Zamore, P.
D., Tuschl, T., Sharp, P. A., and Bartel, D. P. 2900. RNAi:
Double-stranded RNA directs the ATP-dependent cleavage of mRNA at
21 to 23 nucleotide intervals. Cell 101: 25-33.
Equivalents
[0310] Those skilled in the art will recognize, or be able to
ascertain using no more than routine experimentation, many
equivalents to the specific embodiments of the invention described
herein. Such equivalents are intended to be encompassed by the
following claims.
Sequence CWU 1
1
22121DNAArtificial Sequencesynthetic construct 1uugggaugaa
gccugguccg g 21221DNAArtificial Sequencesynthetic construct
2ccggaccagg cuucauccca a 21321DNAArtificial Sequencesynthetic
construct 3ccggaucagg cuucauccca a 21421DNAArtificial
Sequencesynthetic construct 4uugggaugaa gccugauccg g
21519DNAArtificial Sequencesynthetic construct 5cguacgcgga
auacuucga 19621DNAArtificial Sequencesynthetic construct
6ucgaaguauu ccgcguacgu g 21723DNAArtificial Sequencesynthetic
construct 7aucacguacg cggaauacuu cga 23825DNAArtificial
Sequencesynthetic construct 8ucgaaguauu ccgcguacgu gauug
25940DNAArtificial Sequencesynthetic construct 9gcgtaatacg
actcactata ggcgccggaa caagttgaag 401021DNAArtificial
Sequencesynthetic construct 10gacagtcacg gaaccaagat g
211142DNAArtificial Sequencesynthetic construct 11gcgtaatacg
actcactata ggtgagtctg tggtcgtgag tg 421221DNAArtificial
Sequencesynthetic construct 12gctgctgcta aagtcgtagg a
211359DNAArtificial Sequencesynthetic construct 13ccactgcagt
tgcgtgaaac agctacgata ccaatagaat ccggatcagg cttcatccc
5914115DNAArtificial Sequencesynthetic construct 14gacagtcacg
gaaccaagat ggacgatctt tgaggatttc agcgaccttc atgggttcta 60aactcacgag
gccacaggca cgtgctgcta ttccactgca gttgcgtgaa acagc
1151521DNAArtificial Sequencesynthetic construct 15ucggaccagg
cuucaucccc c 211621DNAArtificial Sequencesynthetic construct
16gggaugaagc cugguccgag g 211721DNAArtificial Sequencesynthetic
construct 17ucggaccagg cuucauuccc c 211821DNAArtificial
Sequencesynthetic construct 18ggaaugaagc cugguccgag a
211921DNAArtificial Sequencesynthetic construct 19ccggaccagg
cuucauccca a 212021DNAArtificial Sequencesynthetic construct
20gggaugaagc cugguccgga u 212121DNAArtificial Sequencesynthetic
construct 21ccggaucagg cuucauccca a 212221DNAArtificial
Sequencesynthetic construct 22gggaugaagc cugauccgga u 21
* * * * *