Microorganisms Having Enhanced Tolerance To Inhibitors and Stress

Abstract

The present invention provides genetically modified strains of microorganisms that display enhanced tolerance to stress and/or inhibitors such as sodium acetate and vanillin. The enhanced tolerance can be achieved by increasing the expression of a protein of the Sm-like superfamily such as a bacterial Hfq protein and a fungal Sm or Lsm protein. Further, the present invention provides methods of producing alcohol from biomass materials by using the genetically modified microorganisms of the present invention.

Description

CROSS REFERENCE TO RELATED APPLICATION

[0001] This application claims the benefit of priority from U.S. Provisional Application No. 61/184,961, filed on Jun. 8, 2009, the content of which in its entirety is incorporated herein by reference.

FIELD OF THE INVENTION

[0003] This invention generally relates to the field of microorganism and genetic modification thereof. In particular, the invention relates to microorganisms that display enhanced tolerance to stress and inhibitors as a result of increased expression of a protein of the Sm-like superfamily such as bacterial Hfq and yeast Sm or Lsm proteins. Such microorganisms are advantageous for use in fermentation of biomass materials to produce biofuels such as ethanol.

BACKGROUND OF THE INVENTION

[0004] Biomass-based bioenergy is crucial to meet the goal of making cellulosic biofuels cost-competitive with gasoline. Lignocellulosic materials represent an abundant feedstock for cellulosic-biofuel production. A core challenge in converting cellulosic material to biofuels such as ethanol and butanol is the recalcitrance of biomass to breakdown. Because of the complex structure of lignocellulosic biomass, pretreatment is necessary to make it accessible for enzymatic attack. Severe biomass pretreatments are required to release the sugars, which along with by-products of fermentation can create inhibitors in the production of ethanol or butanol, for example. During the pretreatment processes, a range of inhibitory chemicals are formed that include sugar degradation products such as furfural and hydroxymethyl furfural (HMF); weak acids such as acetic, formic, and levulinic acids; lignin degradation products such as the substituted phenolics vanillin and lignin monomers. In addition, the metabolic byproducts such as ethanol, lactate, and acetate also impact the fermentation by slowing and potentially stopping the fermentation prematurely. The increased lag phase and slower growth increases the ethanol cost due to both ethanol production rate and total ethanol yield decreases (Takahashi et al. 1999; Kadar et al. 2007).

[0005] Efficient conversion of lignocellulosic hydrolysates to biofuel requires high-yield production and resistance to industrially relevant stresses and inhibitors. To overcome the issue of inhibition caused by pretreatment processes, there are two approaches, one is to remove the inhibitor after pretreatment from the biomass physically or chemically, which requires extra equipment and time leading to increased costs. A second approach utilizes inhibitor tolerant microorganisms for efficient fermentation of lignocellulosic material to ethanol and their utility is considered an industrial requirement (Almeida et al. 2007).

[0006] Zymomonas mobilis are gram-negative facultative anaerobic bacteria with a number of desirable industrial characteristics, such as high-specific productivity and ethanol yield, unique anaerobic use of the Entner-Doudoroff pathway that results in low cell mass formation, high ethanol tolerance (12%), pH 3.5-7.5 range for ethanol production and has been generally regarded as safe (GRAS) status (Swings and De Ley 1977; Rogers et al. 1984; Gunasekaran and Raj 1999; Dien et al. 2003; Panesar et al. 2006; Rogers et al. 2007). One drawback to using wild-type Z. mobilis is its narrow substrate utilization range. However, recombinant Z. mobilis strains have been developed to ferment pentose sugars such as xylose and arabinose (Zhang et al. 1995; Deanda et al. 1996; Mohagheghi et al. 2002). On the other hand, low tolerance to acetic acid and decreased ethanol tolerance have been reported in recombinant strains (Ranatunga et al. 1997; Lawford and Rousseau 1998; Lawford et al. 2001; Dien et al. 2003).

[0007] Acetic acid is an inhibitor produced by the de-acetylation of hemicelluloses during biomass pretreatment. At pH 5.0, 36% of acetic acid is in the uncharged and undissociated form (HAc) and is able to permeate the Z. mobilis plasma membrane (Lawford and Rousseau 1993). The inhibition mechanism has been ascribed to the ability of the undissociated (protonated) form to cross the cell membrane leading to uncoupling and anion accumulation causing cytoplasmic acidification. Its importance comes from the significant concentrations of acetate that are produced relative to fermentable sugars (McMillan 1994) and the ratio of acetate to fermentable sugars is particularly high in material from hardwoods (Lawford and Rousseau 1993). Acetate may reach inhibitory levels when pretreated biomass hydrolysates are concentrated to generate high final ethanol concentrations or where process water is recycled. Acetate removal processes have been described but they are energy or chemical-intensive and their impact on processing costs have yet to be determined (McMillan 1994).

[0008] An acetate tolerant Z. mobilis mutant (AcR) has been generated by a random mutagenesis and selection strategy (Joachimstahl and Rogers 1998). The AcR mutant was capable of efficient ethanol production in the presence of 20 g/L sodium acetate while the parent ZM4 was inhibited significantly above 12 g/L sodium acetate under the same conditions. A number of studies have characterized the performance of recombinant Z. mobilis strains able to utilize both C-5 and C-6 sugars, including under acetate stress conditions (Lawford et al. 1999; Joachimsthal and Rogers 2000; Lawford and Rousseau 2001). Acetic acid was shown to be strongly inhibitory to wild-type derived strain ZM4(pZB5) on xylose medium and nuclear magnetic resonance studies indicated intracellular deenergization and acidification appeared to be the major inhibition mechanisms (Kim et al. 2000). A recombinant strain able to utilize both xylose (a C-5 sugar) and glucose (a C-6 sugar) with increased acetate resistance was generated by transforming plasmid pZBS into the AcR background (Jeon et al. 2002). Mohagheghi et al. (2004) reported a recombinant Zymomonas mobilis 8b tolerated up to 16 g/L acetic acid and achieved 82%-87% (w/w) ethanol yields from pure glucose/xylose solutions.

[0009] Acetic acid bacteria are used for the industrial production of vinegar and are intrinsically resistant to acetic acid. Although the resistance mechanism is not completely understood, progress toward this goal has been made in recent years. Spontaneous acetic acid bacteria mutants for Acetobacter aceti (Okumura et al. 1985) and several Acetobacter pasteurianus strains (Takemura et al. 1991; Chinnawirotpisan et al. 2003) showed growth defects in the presence of acetic acid, which was associated with loss of alcohol dehydrogenase activity. Fukaya et al (1990) identified the aarA, aarB, and aarC gene cluster as being important for conferring acetic acid resistance using a genetic approach (Fukaya et al. 1990). aarA encodes citrate synthase and aarC encodes a protein that is involved in acetate assimilation (Fukaya et al. 1993), and the three aar genes have been suggested to support increased flux through a complete but unusual citric acid cycle to lower cytoplasmic acetate levels (Mullins et al. 2008). The presence of a proton motive force-dependent efflux system for acetic acid has been demonstrated as being important in A. aceti acetic acid resistance, although the genetic determinant(s) remain to be identified (Matsushita et al. 2005). In E. coli, over-expression of the ATP-dependent helicase RecG has been reported to improve resistance to weak organic acids including acetate (Steiner and Sauer 2003). Baumler et al. (2006) describe the enhancement of acid tolerance in Z. mobilis by the expression of a proton-buffering peptide in acidified TSB (HCl (pH 3.0) or acetic acid (pH 3.5)), glycine-HCl buffer (pH 3.0) and sodium acetate-acetic acid buffer (pH 3.5) (Baumler et al. 2006). Baumler et al. (2006) also note that the presence of the antibiotic also significantly increased acid tolerance by an unknown mechanism.

[0010] Aerobic, stationary phase conditions were found to produce a number of inhibitory secondary metabolites from Z. mobilis when compared to anaerobic conditions at the same time point. The Z. mobilis global regulator gene hfq has been identified as associated with stress responses generated under aerobic stationary phase conditions (Yang et al., 2009). Hfq is a bacterial member of the Sm family of RNA-binding proteins, which acts by base-pairing with target mRNAs and functions as a chaperone for non-coding small RNA (sRNA) in E. coli (Valentin-Hansen et al. 2004; Zhang et al. 2002; Zhang et al. 2003). E. coli Hfq is involved in regulating various processes and deletion of hfq has pleiotropic phenotypes, including slow growth, osmosensitivity, increased oxidation of carbon sources, and altered patterns of protein synthesis in E. coli (Valentin-Hansen et al. 2004; Tsui et al. 1994). E. coli Hfq has also been reported to affect genes involved in amino acid biosynthesis, sugar uptake, metabolism and energetics (Guisbert et al. 2007). The expression of thirteen ribosomal genes was down-regulated in hfq mutant background in E. coli (Guisbert et al. 2007). Hfq also up-regulated sugar uptake transporters and enzymes involved in glycolysis and fermentation such as pgk and pykA, and adhE (Guisbert et al. 2007). E. coli Hfq is also involved in regulation of general stress responses that are mediated by alternative sigma factors such as RpoS, RpoE and RpoH. Cells lacking Hfq induce the RpoE-mediated envelope stress response and rpoH is also induced in cells lacking Hfq (Guisbert et al. 2007), which is consistent with our results that Z. mobilis hfq was less abundant in aerobic fermentation condition in ZM4 at 26 h post-inoculation and was rpoH induced (Yang et al. 2009).

SUMMARY OF THE INVENTION

[0011] It has been identified in accordance with the present invention that increased expression of a protein of the Sm-like superfamily in a microorganism confers enhanced tolerance to stress and inhibitors such as sodium acetate, ammonium acetate, potassium acetate, vanillin, furfural, hydroxymethylfurfural (HMF) and H.sub.2O.sub.2. In accordance with the present invention, microorganisms can be genetically modified to increase the expression of a protein of the Sm-like superfamily to achieve enhanced tolerance to stress and inhibitors. Such genetically modified microorganisms are particularly useful for production of biofuels based on fermentation of biomass materials.

[0012] In one aspect, the invention is directed to genetically modified microorganisms that display enhanced tolerance to stress and/or inhibitors as a result of increased expression of a protein of the Sm-like superfamily in the microorganisms.

[0013] In one embodiment, the microorganism is a genetically engineered bacterial strain, and the protein being expressed at an elevated level is a bacterial Hfq protein.

[0014] Bacteria contemplated by the present invention include both Gram-negative and Gram positive bacteria. Examples of bacteria of particular interest include Acetobacterium, Bacillus, Streptococcus, Clostridium (e.g., C. thermocellum), Zymomonas sp. (e.g., Z. mobilis), Anaerocellum (e.g., Anaerocellum thermophilum), Caldicellulosiruptor (e.g., C. saccharolyticus), Thermoanaerobacter (e.g., Thermoanaerobacter sp. X514), Gluconobacter, and E. coli.

[0015] Bacterial strains that display enhanced tolerance to stress and/or inhibitors can be generated, e.g., by introducing to a bacterial strain an expression vector which includes the coding sequence of a bacterial Hfq protein. The expression vector directs the expression of the Hfq protein as a replicative plasmid, or mediates the integration of the coding sequence into the host genome to achieve chromosomal expression. Preferably, the bacterial Hfq protein in the vector is identical with or substantially homologous with an endogenous Hfq protein of the recipient bacterial strain.

[0016] In specific embodiments, the expression vector includes the coding sequence of a bacterial Hfq protein having an amino acid sequence selected from the group consisting of SEQ ID NO: 2 (Z. mobilis ZM4), SEQ ID NO: 4 (E. coli), SEQ ID NO: 6 (Clostridium thermocellum), SEQ ID NO: 8 (Anaerocellum thermophilum), SEQ ID NO: 10 (Caldicellulosiruptor saccharolyticus), SEQ ID NO: 12 (Thermoanaerobacter sp. X514), and functional derivatives thereof.

[0017] In a further embodiment, the invention is directed to genetically engineered fungal strains that display enhanced tolerance to stress and/or inhibitors. Examples of fungi include Saccharomyces sp. (e.g., S. cerevisiae), Kluyveromyces sp., Pichia sp. (e.g., Pichia pastoris), Candida sp., and Schizosaccharomycetes sp.

[0018] Such fungal strains can be generated, e.g., by introducing to a fungal strain an expression vector which includes the coding sequence of a fungal protein of the Sm-like superfamily. Similarly, the expression vector can be a replicative vector or integrative vector. Preferably, the fungal protein of the Sm-like superfamily in the expression vector is identical with or substantially homologous with an endogenous Sm-like protein of the fungal strain.

[0019] In specific embodiments, the expression vector includes the coding sequence of a fungal protein of the Sm-like superfamily having an amino acid sequence selected from the group consisting of SEQ ID NOS: 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48 and 50 (representing 19 S. cerevisiae Sm and Lsm proteins) and functional derivatives thereof.

[0020] The genetically modified microorganisms that display enhanced tolerance to stress and inhibitors can be additionally modified as appropriate, for example, by transformation with additional recombinant genes or sequences suitable for fermentation and production of ethanol. For example, the bacterial and fungal strains can be additionally modified so as to have the ability to utilize C5 sugars such as xylose and arabinose in addition to C6 sugars.

[0021] In a further aspect, the present invent provides a method of producing biofuels from cellulosic biomass based on use of the microbial strains that are able to grow at elevated concentrations of inhibitors and/or under stress conditions.

BRIEF DESCRIPTION OF THE DRAWINGS

[0022] FIGS. 1A-1E. Domain and motif sites of Z. mobilis Hfq (A), E. coli Hfq (B), S. cerevisiae Sm B (C), and S. cerevisiae Lsm1 (D) proteins. Bacterial Hfq alignment and Clustal W (E). Residues that are identical across the species are indicated by "*", and residues that are not identical but conserved in function across the species are indicated by ":".

[0023] FIG. 2A. Graphic map of the low copy number Gateway.RTM. compatible plasmid pBBR3-DEST42. Tc(R): Tetracycline resistance gene tet; Cm: chloramphenicol resistance gene cat. attR1 and attR2 are recombination sites allowing recombinational cloning of the gene of interest from an entry clone; ccdB is ccdB gene allowing negative selection of expression clones.

[0024] FIG. 2B. The insertion position and complementation region of ZMO0347 as well as the primers and mutation position. ZMO0346, ZMO0347, and ZMO0348 are Z. mobilis ZM4 genes. hfq_MF and hfq_MR are primers used for insertional mutant construction using pKNOCK mutagenesis system. Hfq_CF and Hfq_CR are primers used to clone the hfq gene into pBBR3-DEST42 for complementation, which resulted in a plasmid called as p42-0347. The primer sequences are: hfq_MF: cggagagatggtcagtcaca (SEQ ID NO: 51); hfq_MR: ttcttgctgctgcataatcg (SEQ ID NO: 52); Hfq_CF: atggccgaaaaggtcaacaatc (SEQ ID NO: 53); Hfq_CR: atcctcgtctcgcctttctgtc (SEQ ID NO: 54).

[0025] FIGS. 3A-3C. Hfq is responsible for sodium acetate tolerance of Z. mobilis. Z. mobilis strains were grown in RM (pH5.0) overnight, 20-.mu.L culture were then transferred into 250-.mu.L RM media in the Bioscreen plate. The growth differences of different strains were monitored by Bioscreen (GrowthCurve, Mass.) under anaerobic conditions in RM (pH5.0) containing 0, 12, and 16 g/L NaAc (A, B, C respectively). Strains included in this study are: ZM4: Zymomonas mobilis ZM4 wild-type; AcR: ZM4 acetate tolerant mutant (Joachimstahl 1998); ZM4 (p42-0347): ZM4 containing a gateway plasmid p42-0347 over-expressing ZM4 gene ZMO0347; AcRIM0347: AcR insertional mutant of ZMO0347; AcRIM0347 (p42-0347): AcRIM0347 containing gateway plasmid p42-0347 over-expressing ZM4 gene ZMO0347. This experiment has been repeated at least three times with similar result. Triplicates were used for each condition.

[0026] FIGS. 4A-4E. Hfq contributes to Z. mobilis acetate tolerance. Z. mobilis strains were grown in RM (pH5.0) overnight, 5-.mu.L culture were then transferred into 250-.mu.L RM media in the Bioscreen plate. The growth differences of different strains were monitored by Bioscreen (Growth Curves USA, NJ) under anaerobic conditions; in RM, pH 5.0 (A), RM with 195 mM NaCl, pH 5.0 (B), 195 mM NaAc, pH 5.0 (C), 195mM NH.sub.4OAc, pH 5.0 (D), or 195 mM KAc, pH 5.0 (E). Strains included in this study are: ZM4: Zymomonas mobilis ZM4 wild-type; AcR: ZM4 acetate tolerant mutant; ZM4 (p42-0347): ZM4 containing a gateway plasmid p42-0347 to express ZM4 gene ZMO0347; AcRIM0347: AcR insertional mutant of ZMO0347; AcRIM0347 (p42-0347): AcRIM0347 containing gateway plasmid p42-0347. This experiment has been repeated at least three times with similar result. Duplicate biological replicates were used for each condition.

[0027] FIGS. 5A-5E. Z. mobilis Hfq conferred tolerance to different classes of pretreatment inhibitors. Z. mobilis strains were grown in RM (pH 5.0) overnight, 5-.mu.L culture were then transferred into 250-.mu.L RM media in the Bioscreen plate. The growth differences of different strains were monitored by Bioscreen (Growth Curves USA, NJ) under anaerobic conditions in RM, pH 5.0 (A), RM with 1 g/L vanillin, pH 5.0 (B), 1 g/L furfural, pH 5.0 (C), 1 g/L HMF, pH 5.0 (D) and 0.001% H.sub.2O.sub.2 (E). Strains included in this study are: ZM4: Zymomonas mobilis ZM4 wild-type; AcR: ZM4 acetate tolerant mutant; AcRIM0347: AcR insertional mutant of ZMO0347; AcRIM0347 (p42-0347): AcRIM0347 containing gateway plasmid p42-0347 over-expressing ZM4 gene ZMO0347. This experiment has been repeated at least three times with similar result for hydrogen peroxide growth and in duplicate for the vanillin growth.

[0028] FIGS. 6A-6B. Lsm-like proteins in S. cerevisiae are responsible for sodium acetate tolerance. S. cerevisiae strains were grown in CM with 2% glucose for wild-type BY4741 and the deletion mutants, CM with 2% glucose minus uracil for GST over-expression strains. Five-.mu.L culture was then transferred into 300-.mu.L CM broth in the Bioscreen plate. The growth differences of different strains were monitored by Bioscreen (Growth Curve USA, NJ) containing 40 g/L sodium acetate for yeast deletion mutants (A) and GST over-expression strains (B). This experiment has been repeated at least three times with similar result.

[0029] FIGS. 7A-7P. Lsm proteins in S. cerevisiae are involved in multiple inhibitor tolerance. S. cerevisiae strains were grown in CM with 2% glucose (CM+glucose) for wild-type BY4741 and the deletion mutants, CM with 2% glucose and 2% galactose minus uracil (CM+glucose+2% galactose) for GST overexpression strains. A 5-.mu.L culture was then transferred into 250-.mu.L CM broth in the Bioscreen plate. The growth differences of different deletion mutant strains were monitored by Bioscreen (Growth Curves USA, NJ) in CM+glucose at pH 5.5 (A), CM+glucose with 305 mM NaCl, pH 5.5 (B), 305 mM NaAc, pH 5.5 (C), 305 mM NH.sub.4OAc, pH 5.5 (D), and 305 mM KAc, pH 5.5 (E), 0.75 g/L vanillin, pH 5.5 (F), 1.5 g/L furfural, pH 5.5 (G), and 1.5 g/L HMF, pH 5.5 (H). The growth differences of different GST-over-expressing strains were monitored by Bioscreen (Growth Curves USA, NJ) in CM+glucose+2% galactose at pH 5.5 (I), CM+glucose+2% galactose with 305 mM NaCl, pH 5.5 (J), 305 mM NaAc, pH 5.5 (K), 305 mM NH.sub.4OAc, pH 5.5 (L), 305 mM KAc, pH 5.5 (M), 0.75 g/L vanillin, pH 5.5 (N), 1.5 g/L furfural, pH 5.5 (O), and 1.5 g/L HMF, pH 5.5 (P). Strains included in this study are listed in table 1. This experiment has been repeated at least three times with similar result.

DETAILED DESCRIPTION OF THE INVENTION

[0030] It has been identified in accordance with the present invention that increased expression of a protein of the Sm-like superfamily in a microorganism confers enhanced tolerance to stress and inhibitors. Based on this discovery, the present invention provides strains of microorganisms displaying enhanced tolerance to stress and/or inhibitors, which are particularly advantageous for use in fermentation of biomass materials to produce biofuels.

[0031] In one aspect, the invention is directed to genetically modified strains of microorganisms that display enhanced tolerance to stress and/or growth inhibitor as a result of increased expression of a protein of the Sm-like superfamily in the microorganisms.

[0032] Sm-like superfamily proteins are a highly conserved family of proteins found in eukaryotes, archaea and bacteria, and are characterized by an Sm-like superfamily domain having two conserved motifs referred to as Sm1 motif and Sm2 motif. The Sm1 and Sm2 motifs were first defined for human Sm snRNP proteins (Hermann et al. 1995), and were subsequently found to be highly conserved in other Sm and Lsm (Sm-like) proteins in eukaryotes including plant, drosophila, C. elegans, and S. cerevisiae. Eukaryotic Sm and Lsm proteins are integral to RNA processing and mRNA degradation complexes. Subsequently, the E. coli global response regulator Hfq was reported to be a homolog of the Sm and Lsm proteins (Zhang et al. 2002). The bacterial Hfq proteins contain a first region that shares significant similarity with the Sm1 motif found in eukaryotes, and a second region of particularly high conservation among the bacterial proteins which contains a number of conserved hydrophobic residues that align with hydrophobic residues found in the Sm2 motif of eukaryotic cells (Zhang et al. 2002). Similar to the eukaryotic Sm and Lsm proteins, the E. coli Hfq protein also forms a multisubunit ring and is believed to also function to enhance RNA-RNA pairing.

[0033] As used herein, the term "Sm-like superfamily" includes both Sm and Lsm proteins of eukaryotes and archaea, and Hfq proteins of bacteria.

[0034] A eukaryotic protein is considered to be a protein of the Sm-like superfamily in the context of the present invention if the protein contains an Sm-like superfamily domain characterized by the Sm1motif and Sm2 motif defined by Hermann et al. (1995). Specifically, the Sm1 motif typically spans 32 amino acids, with positions 13 and 23 being Gly and Asn, respectively, positions 1, 3, 11, 15, 18 and 26 being a hydrophobic residue, and positions 19 and 31 being an acidic amino acid (Asp or Glu). The Sm2 motif typically spans only 14 amino acids, and has the consensus sequence (I or L)(R or K)(G or C) at positions 6-8, with positions 1, 4, 11, 13 and 14 being a hydrophobic residue, and positions 9-10 being a hydrophilic residue. Examples of eukaryotic proteins of the Sm-like superfamily include S. cerevisiae Sm B, Sm D1, Sm D2, Sm D3, Sm E, Sm F, Sm G, Lsm1, Lsm2, Lsm3, Lsm4, Lsm5, Lsm6, Lsm7, Lsm8, Lsm9, Lsm 13, and Lsm16 (SEQ ID NOS: 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48 and 50, respectively). The locations of Sm1 and Sm2 motifs are illustrated for Sm B and Lsm1 proteins in FIGS. 1C-1D.

[0035] In the context of the present invention, a bacterial protein is considered to be an Hfq protein and therefore a protein of the Sm-like superfamily if the bacterial protein contains an Sm-like superfamily domain characterized by a first motif similar to the Sm1 motif of eukaryotic proteins defined above, and a second highly conserved region. Generally, the bacterial Sm1 motif spans 26 amino acids, and like the eukaryotic Sm1 motif, has Gly at position 13, an acidic amino acid at position 19 (typically Asp), a hydrophobic residue at positions 1 (preferably V), 3, 11 (preferably L), 15 and 18 (preferably F). Additionally, the second highly conserved region ("the bacterial Sm2 motif") generally spans 12 amino acids, and has a "KHA" sequence at positions 6-8; and preferably, with Y, I and S at positions 5, 9, and 10, respectively, and with a hydrophobic residue at positions 3-4 and 11. Examples of bacterial Hfq proteins include SEQ ID NO: 2 (Z. mobilis ZM4), SEQ ID NO: 4 (E. coli), SEQ ID NO: 6 (Clostridium thermocellum), SEQ ID NO: 8 (Anaerocellum thermophilum), SEQ ID NO: 10 (Caldicellulosiruptor saccharolyticus), and SEQ ID NO: 12 (Thermoanaerobacter sp. X514). Alignment of these bacterial Hfq proteins is provided in FIG. 1B, and the locations of the Sm-like superfamily domain including the Sm1 and Sm2 motifs of Z. mobilis and E. coli proteins are illustrated in FIG. 1A. It is clear that these six bacterial Hfq proteins share significant homologies, having conserved V, L, G, L, G, F, D and F at positions 1, 5, 8, 11, 13, 18, 19 and 21 of the SmaI motif, and Y, K, H, A, I, and S at positions 5-10 of the Sm2 motif.

[0036] Functional derivatives and homologs of a given protein of the Sm-like superfamily are also suitable for use in the present invention. As used herein, "functional derivatives" and "homologs" of a protein of the Sm-like superfamily refer to proteins that share at least 45% identity or similarity, or preferably at least 50%, 60%, 75%, or 85% identity or similarity, or more preferably 90%, 95%, 98%, or 99% identity or similarity, with the protein of the Sm-like superfamily. Similarity between two protein sequences can be determined, for example, using the well known Lipman-Pearson Protein Alignment program with the following choice of parameters: Ktuple=2, Gap Penalty=4, and Gap Length Penalty=12. Preferably, the derivatives and homologs share consensus motifs of the Sm-like superfamily, which are believed to be critical to the function of the proteins.

[0037] A functional derivative of a given protein includes derives where modifications are made to non-conserved residues, as well as a functional or enzymatically active fragment of the protein. The term "functional fragment" or "enzymatically active fragment" means a polypeptide fragment of a full length protein, which substantially retains the activity of the full-length protein. By "substantially" it is meant at least about 50%, or preferably at least 70%, or even 80% or more of the activity of the full-length protein is retained.

[0038] The genetically engineered microbial strains of the present invention display enhanced tolerance to stress and/or one or more inhibitors as a result of increased expression of a protein of the Sm-like superfamily.

[0039] The term "stress", as used herein, refers generally to environmental stress, i.e., stress received from the environment, such as high temperatures, low temperatures, low pH, oxidation (i.e., the presence of reactive oxidative species such as H.sub.2O.sub.2), osmotic, drought, the presence of inhibitors, or nutrient limit such as starvation, among others. For example, "cold stress" is stress on microorganism due to exposure to environments below the minimum optimal growth temperature of the microorganism. "Drought stress" is stress due to exposure of the microorganism to environments under the minimum optimal growth moisture concentration. "Osmotic stress" is stress on microorganisms due to exposure of the microorganisms to environments over or under the maximum or minimum optimal growth osmotic of the microorganisms.

[0040] The term "inhibitors" as used herein refer particularly to inhibitory chemical compounds that are formed during biomass pretreatments, including sugar degradation products such as furfural and hydroxymethyl furfural (HMF), weak acids such as acetic, formic, and levulinic acids, lignin degradation products such as the substituted phenolics vanillin and lignin monomers, reactive oxidative species generating hydrogen peroxide (H.sub.2O.sub.2) and vanillin, as well as metabolic byproducts such as ethanol, lactate, and acetate. A particularly desirable trait of microorganisms is an enhanced tolerance to sodium and acetate ions, e.g., in the form of sodium acetate, ammonium acetate, and potassium acetate.

[0041] In the present invention, microorganisms with enhanced tolerance to stress and/or one or more inhibitors refer to microorganisms which, as a result of genetic modification to increase the level of proteins of the Sm-like superfamily in the microorganisms, demonstrate improved tolerance as compared to microorganisms without the genetic modification. Improved tolerance can be determined by an improved growth profile (either as a shorter lag phase, a shorter doubling time, or a higher maximum density) under a given stress condition or inhibitor concentration. Alternatively, improved tolerance can be determined by an increase in the concentration of an inhibitory molecule which the microorganisms can tolerate.

[0042] For example, microorganisms having an elevated expression of Sm-like superfamily proteins exhibit enhanced tolerance to acetate. "Tolerance to acetate" is meant herein to include resistance to acetate salts including, for example, sodium acetate, ammonium acetate and potassium acetate, and/or to acetic acid. Tolerance of a strain to acetate can be determined by assessing the growth of the strain in media containing various concentrations of acetate (e.g., sodium acetate). The microbial strains containing a desirable genetic modification of the present invention are able to grow in media containing a higher concentration of acetate (e.g., sodium acetate) than the unmodified strains. For example, the concentration of sodium acetate that can be tolerated by a strain can be increased by 15%, 20%, 30%, or 50% or higher, as a result of a genetic modification. As demonstrated herein below, wild type Z. mobilis strain ZM4 is unable to grow in media containing 16 g/L (195 mM) sodium acetate, while ZM4-p42-0347 (expressing additional ZM4 Hfq proteins) is able to grow at this concentration. Alternatively, "enhanced tolerance" can be measured by a shorter lag time (e.g., shortened by 10%, 20%, 30% or 50% or greater), a shorter doubling time (e.g., shortened by 10%, 20%, 30% or 50% or greater) or a higher cell density reached at the end of the exponential growth phase (e.g., 25%, 50%, 75%, 100%, 150%, 200%, 500%, or even 1000% or higher cell density). See FIGS. 3A-3C.

[0043] Microorganisms encompassed within the scope of the present invention include both bacteria and fungi.

[0044] In accordance with the present invention, bacterial strains having enhanced tolerance to stress and inhibitors as a result of increased expression of Sm-superfamily proteins include both Gram-positive and Gram-negative bacteria. Examples of Gram-positive bacteria include those from the genus of phylum Firmicutes, particularly strains of Acetobacterium, Bacillus, Streptococcus, Clostridium (e.g., C. thermocellum), Anaerocellum (e.g., Anaerocellum thermophilum), Caldicellulosiruptor (e.g., C. saccharolyticus), and Thermoanaerobacter (e.g., Thermoanaerobacter sp. X514). Examples of Gram-negative bacteria of particular interest include those generally considered medically safe, such as Zymomonas sp. (e.g., Z. mobilis), E. coli, Gluconobacter sp. (e.g., Gluconobacter oxydans, previously known as Acetobacter suboxydans), Cyanobacteria, Green sulfur and Green non-sulfur bacteria.

[0045] Fungal strains contemplated by the present invention include filamentous and unicellular fungal species, particularly the species from the class of Ascomycota, for example, Saccharomyces sp., Kluyveromyces sp., Pichia sp., Candida sp., and Schizosaccharomycetes sp. Preferred fungal strains contemplated by the present invention are S. cerevisiae, S. pombe, and Pichia pastoris. Where the fungal strains are S. cerevisiae, additional genetic modifications are preferred besides the genetic modification that results in an increased expression of a Sm-like superfamily protein. For example, S. cerevisiae is also modified such that the strain is able to utilize C5 sugars.

[0046] Strains of microorganisms that display enhanced tolerance to stress and/or inhibitors as a result of increased expression of a Sm-like superfamily protein can be made using any of the known genetic engineering techniques. For example, the 5' upstream regulatory region of an endogenous Sm-like superfamily gene can be modified to achieve enhanced expression of the encoded endogenous Sm-like superfamily protein.

[0047] In one embodiment, a microbial strain having enhanced tolerance is created by introducing an exogenous expression vector into the strain which contains the coding sequence of a protein of the Sm-like superfamily.

[0048] In a preferred embodiment, the protein encoded by the expression vector is identical with an endogenous protein of the Sm-like superfamily or a functional derivative thereof, even though homologs from other related species can also be utilized.

[0049] Generally, the nucleotide sequence coding for a protein of the Sm-like superfamily is placed in an operably linkage to a promoter and a 3' termination sequence that are functional in a recipient microbial host. The promoter can be a constitutive promoter or an inducible promoter. The promoter can be the native promoter of the Sm-like superfamily gene being expressed, or a heterologous promoter from a different gene. Promoters suitable for use in expression in a bacterial host include, for example, lac promoter, T7, T3 and SP6 phage RNA polymerase promoters. Specific examples of promoters suitable for use in expression in Zymomonas species include Z. mobilis pdc promoter and adhB promoter. Specific examples of promoters suitable for use in expression in yeast including S. cerevisiae include adhl+(constitutive high expression), fbpl+(carbon source responsive), a tetracycline-repressible system based on the CaMV promoter, and the nmtl+(no message in thiamine) promoter. These and other examples of promoters are well documented in the art.

[0050] A variety of vector backbones can be used for purpose of the present invention. Choices of vectors suitable for transformation and expression in bacteria and fungi have been well documented in the art. For example, numerous plasmids have been reported for transformation and expression in Zymomonas, including, e.g., pZB serial plasmids developed based on Zymomonas cryptic plasmid, as described in U.S. Pat. Nos. 5,712,133, 5,726,053, and 5,843,760, and a cloning-compatible broad-host-range destination vector described by Pelletier et al. (2008), among many others.

[0051] In addition to the Sm-like superfamily protein expression unit, the expression vector can include other sequences where appropriate, such as sequences for maintenance and selection of the vector, e.g., a selection marker gene and a replication origin. The selection marker gene can be a gene that confers resistance to antibiotics such as ampicillin resistance (Amp.sup.r), tetracycline resistance (Tet.sup.r), neomycin resistance, hygromycin resistance, and zeocin resistance (Zeo.sup.r) genes, or a gene that provides selection based on media supplement and nutrition.

[0052] The vector can be a replicative vector (such as a replicating circular plasmid), or an integrative vector which mediates the introduction of the vector into a recipient cell and subsequent integration of the vector into the host genome for chromosomal expression.

[0053] For industrial applications, the inhibitors generated from the biomass pretreatments will select for plasmid maintenance where hfq expression confers an advantage to the strain (i.e., enhanced tolerance to inhibitors) in the absence of additional marker or antibiotic selection. The vectors can also be modified to include the parDE genes to enhance plasmid stability in bacteria in the absence of selection using standard molecular biology approaches, as described in the art (Brown et al., 2002; Pecota et al., 1997). Alternatively and preferably, the desired expression unit (such as an hfq coding sequence operably linked to a promoter) is integrated into the chromosome of the microorganism for expression and enhanced stability. Methods for chromosomal integration in bacteria include modified homologous Campbell-type recombination (Kalogeraki et al. 1997) or transposition (Koch et al. 2001). Methods for chromosomal integration in yeast are well known and are described in Amberg et al. (2005).

[0054] An expression vector can be introduced into a microbial host by various approaches known in the art, including transformation (e.g., chemical reagent based transformation), electroporation and conjugation.

[0055] The genetic modification to a microbial strain results in an increased expression of a Sm-like superfamily protein. Where the exogenously introduced expression unit codes for a protein identical with an endogenous protein, the level of such protein (expressed from both the native sequence and the exogenous sequence) is increased. Where the exogenously introduced expression unit codes for a protein that is not identical with any endogenous protein but is a functional derivative of or most homologous to an endogenous protein, the collective level of the endogenous protein and the exogenous protein is increased as compared to the unmodified strain. The extent of increase in expression contemplated by the present invention is at least 40%, 50%, 75%, 100% (i.e., twice the level of parental strain), or more preferably at least four or five times, or even more preferably at least ten to fifteen times, the level of parental strain. As a practical matter, the level of expression can be assessed both at the mRNA level and at the protein level.

[0056] Pretreatment of biomass by chemical or enzymatic methods yields a mixture of hexose sugars (C6 sugars, primarily glucose and mannose) and pentose sugars (C5 sugars, primarily xylose and arabinose). The fermentation of almost all the available C6 and C5 sugars to ethanol or other liquid biofuel is critical to the overall economics of these processes. Most microorganisms are able to ferment glucose but few have been reported to utilize xylose efficiently and even fewer ferment this pentose to ethanol.

[0057] The genetically modified strains of microorganisms of the present invention, which display enhanced tolerance to stress and/or one or more inhibitors as a result of increased expression of a Sm-like superfamily protein, can be additionally modified as appropriate. For example, Z. mobilis strains overexpressing Z. mobilis Hfq can be additionally modified in order to expand the range of substrates that can be utilized by the strains for efficient ethanol production. For instance, Z. mobilis strains over-expressing Hfq can also be introduced with additional genes so that the strains can ferment xylose, arabinose or other pentose sugars as the sole carbon source to produce ethanol. See, e.g., U.S. Pat. No. 5,514,583. Additionally, yeast strains over-expressing a Sm or Lsm protein, particularly S. cerevisiae strains, can be additionally modified to have an enhanced ability to ferment xylose, arabinose or other pentose sugars to produce ethanol. For example, yeast cells can be modified to overexpress (via transformation with additional expression unit) xylose reductase, xylulokinase, or xylose isomerase; or modified to have reduced expression of xylitol dehydrogenase, PHO13 or a PHO13 ortholog. See, e.g., U.S. Pat. No. 7,285,403, US 20060234364 A1, and US 20080254524 A1, the teachings of which are incorporated herein by reference.

[0058] The isolated or genetically modified microbial strains of the present invention are particularly useful for production of biofuels based on fermentation of biomass materials. Therefore, in a further aspect, the present invent provides a method of producing biofuels from cellulosic biomass based on use of the microbial strains of the present invention that are able to grow at elevated concentrations of acetate.

[0059] Biofuels contemplated by the present invention include particular the types of biologically produced fuels, such as bioalcohols, based on the action of microorganisms and enzymes through fermentation of biomass materials. Examples of bioalcohols include ethanol, butanol, and propanol.

[0060] In a typical cellulosic biomass to alcohol process, raw cellulosic biomass material is pretreated in order to convert, or partially convert, cellulosic and hemicellulosic components into enzymatically hydrolyzable components (e.g., poly- and oligo-saccharides). The pretreatment process also serves to separate the cellulosic and hemicellulosic components from solid lignin components also present in the raw cellulosic material. The pretreatment process typically involves reacting the raw cellulosic biomass material, often as a finely divided mixture or slurry in water, with an acid, such as sulfuric acid. Other common pretreatment processes include, for example, hot water treatment, wet oxidation, steam explosion, elevated temperature (e.g., boiling), alkali treatment and/or ammonia fiber explosion. The pretreated biomass is then treated by a saccharification step in which poly- and oligo-saccharides are enzymatically hydrolyzed into simple sugars. The free sugars and/or oligosaccharides produced in the saccharification step are then subjected to fermentation conditions for the production of ethanol or butanol, for example. Fermentation can be accomplished by combining one or more fermenting microorganisms with the produced sugars under conditions suitable for fermentation.

[0061] One can also add enzyme to the fermentor to aid in the degradation of substrates or to enhance alcohol production. For example, cellulase can be added to degrade cellulose to glucose simultaneously with the fermentation of glucose to ethanol by microorganisms in the same fermentor. Similarly, a hemicellulase can be added to degrade hemicellulose.

[0062] Because the pretreatment processes and by-products of fermentation can create a range of inhibitors including acetate, it is especially advantageous to utilize the genetically modified microbial strains described herein which display enhanced resistance to acetate and are able to continue fermentation despite acetate present in the fermentation broth, either in the fermentation substrate carried over from pretreatment of biomass material, or built up as a byproduct of fermentation.

[0063] For purpose of fermentation, one strain or a mixture of several strains, some or all of which display enhanced tolerance to stress and/or inhibitors, can be used.

[0064] Specific fermentation conditions can be determined by those skilled in the art, and may depend on the particular feedstock or substrates, the microorganisms chosen and the type of biofuel desired. For example, when Zymomonas mobilis is employed, the optimum pH conditions range from about 3.5 to about 7.5; substrate concentrations of up to about 25% (based on glucose), and even higher under certain conditions, may be used; and no oxygen is needed at any stage for microorganism survival. Agitation is not necessary but may enhance availability of substrate and diffusion of ethanol.

[0065] After fermentation, alcohol is separated from the fermentation broth by any of the many conventional techniques known to separate alcohol from aqueous solutions, including evaporation, distillation, solvent extraction and membrane separation. Particles of substrate or microorganisms may be removed before separation to enhance separation efficiency.

[0066] Table 1. List all the sequence identifiers for the nucleotide and protein sequences of the Sm-like superfamily molecules exemplified in the present application.

[0067] The present invention is further illustrated and by no means limited by the following examples.

TABLE-US-00001 TABLE 1 SEQ ID NO Description 1 Zymomonas mobilis hfq nucleotide 2 Zymomonas mobilis Hfq amino acid 3 E. coli hfq nucleotide 4 E. coli Hfq amino acid 5 Clostridium thermocellum hfq nucleotide 6 Clostridium thermocellum Hfq amino acid 7 Anaerocellum thermophilum hfq nucleotide 8 Anaerocellum thermophilum Hfq amino acid 9 Caldicellulosiruptor saccharolyticus hfq nucleotide 10 Caldicellulosiruptor saccharolyticus Hfq amino acid 11 Thermoanaerobacter sp. X514 hfq nucleotide 12 Thermoanaerobacter sp. X514 Hfq amino acid 13 S. cerevisiae SMB1 nucleotide 14 S. cerevisiae Sm B amino acid 15 S. cerevisiae SMD1 nucleotide 16 S. cerevisiae Sm D1 amino acid 17 S. cerevisiae SMD2 nucleotide 18 S. cerevisiae Sm D2 amino acid 19 S. cerevisiae SMD3 nucleotide 20 S. cerevisiae Sm D3 amino acid 21 S. cerevisiae SME1 nucleotide 22 S. cerevisiae Sm E amino acid 23 S. cerevisiae SMX3 nucleotide 24 S. cerevisiae Sm F amino acid 25 S. cerevisiae SMX2 nucleotide 26 S. cerevisiae Sm G amino acid 27 S. cerevisiae LSM1 nucleotide 28 S. cerevisiae Lsm1 amino acid 29 S. cerevisiae LSM2 nucleotide 30 S. cerevisiae Lsm2 amino acid 31 S. cerevisiae LSM3 nucleotide 32 S. cerevisiae Lsm3 amino acid 33 S. cerevisiae LSM4 nucleotide 34 S. cerevisiae Lsm4 amino acid 35 S. cerevisiae LSM5 nucleotide 36 S. cerevisiae Lsm5 amino acid 37 S. cerevisiae LSM6 nucleotide 38 S. cerevisiae Lsm6 amino acid 39 S. cerevisiae LSM7 nucleotide 40 S. cerevisiae Lsm7 amino acid 41 S. cerevisiae LSM8 nucleotide 42 S. cerevisiae Lsm8 amino acid 43 S. cerevisiae LSM9 nucleotide 44 S. cerevisiae Lsm9 amino acid 45 S. cerevisiae LSM12 nucleotide 46 S. cerevisiae Lsm12 amino acid 47 S. cerevisiae LSM13 nucleotide 48 S. cerevisiae Lsm13 amino acid 49 S. cerevisiae LSM16 nucleotide 50 S. cerevisiae Lsm16 amino acid

Example 1

[0068] This example describes the materials and methods used in the experiments described in the subsequent examples.

Strains and Culture Conditions

[0069] Bacterial strains and plasmids used in this study are listed in Table 2. E. coli strains were cultured using Luria-Bertani (LB) broth or plates. E. coli WM3064 was supplemented with 100 .mu.g/mL diaminopimelic acid (DAP). Z. mobilis ZM4 was obtained from the

[0070] American Type Culture Collection (ATCC31821) and the Z. mobilis acetate tolerant strain AcR has been described previously (Joachimsthal et al. 2000). ZM4 and AcR were cultured in RM medium at 30.degree. C. S. cerevisiae wild-type, deletion mutant and GST-fusion ORF over-expression strains were obtained through Open Biosystems (Huntsville, Ala.). S. cerevisiae strains were cultured in rich YPD media. CM media with 2% glucose was used for S. cerevisiae wild-type and S. cerevisiae deletion mutants, CM media with 2% glucose minus uracil was used for S. cerevisiae GST-over expressing strains, 2% galactose was used to induce the GST-fusion strains. Plasmid-containing strains were routinely grown with antibiotics at the following concentrations (.mu.g/mL): kanamycin of 50 for E. coli and 200 for ZM4; tetracycline, 10 for E. coli and 20 for ZM4; and gentamicin, 10 for E. coli. G418 of 200 for S. cerevisiae YKO deletion mutants. Growth was monitored turbidometrically by measuring optical density at 600.sub.nm periodically with the Bioscreen C automated microbiology growth curve analysis system (Growth Curve USA, Piscataway, N.J.).

PCR and DNA Manipulations

[0071] Genomic DNA from Z. mobilis was isolated using a Wizard Genomic DNA purification kit, following the manufacturer's instructions (Promega, Madison, Wis.). The QIAprep Spin Miniprep and HiSpeed Plasmid Midi kits (Qiagen, Valencia, Calif.) were used for plasmid isolation, respectively. PCR, restriction enzyme digestion, DNA ligation, DNA cloning, and DNA manipulations were done following standard molecular biology approaches (Sambrook 2000).

Construction of the Novel Tetracycline Resistant Gateway Entry Vector and ZMO0347 Over-Expression Plasmid

[0072] The construction of the broad-host-range, tetracycline resistant Gateway.RTM. compatible destination plasmid vector pBBR3DEST42 (FIG. 2A) was carried out essentially as described previously (Pelletier et al. 2008), except that pBBRMCS-3 tetracycline resistance cassette was used in this study instead of pBBRMCS-5 gentamicin resistance cassette used to construct pBBR3DEST42. Briefly, pBBR1MCS3 plasmid DNA was restricted with the KpnI and PvuI enzymes, treated with calf intestine alkaline phosphatase and purified using a Qiagen gel purification kit according to the manufacturer's instructions (Qiagen, Valencia, Calif.). The recombination region on pET-DEST42 vector DNA (Invitrogen, Carlsbad, Calif.) was PCR-amplified using the primers 42F and 42R that include KpnI and PvuI restriction sites as described previously (Pelletier et al. 2008). The gel-purified PCR product was ligated with pBBR1MCS3 KpnI/PvuI fragment with Fast-Link.TM. DNA Ligation Kit (Epicentre, Madison, Wis.). Ligation products were transformed into E. coli DB3.1 chemically competent cells (Invitrogen, Carlsbad, Calif.) and the transformants were selected by plating on LB agar plates containing tetracycline. Individual colonies were grown overnight in LB containing 30 .mu.g/mL chloramphenicol and 10 .mu.g/mL tetracycline, and plasmid DNA was prepared using QIAprep spin miniprep or HiSpeed Plasmid Midi Kit following the manufacturer's protocol (Qiagen, Valencia, Calif.). Plasmid DNA was digested with KpnI and PvuI and digestion products were analyzed on an agarose gel to confirm the presence of products of the expected sizes.

[0073] The construction of entry vector and expression clone of target gene hfq (ZMO0347) was carried out as described previously (Pelletier et al. 2008). Briefly, target gene hfq (ZMO0347) was PCR amplified using AcR genomic DNA as template and primer hfq_CF and hfq_CR as primers. PCR products were then cloned into Gateway.RTM. entry clone pDONR221 using BP Clonase II enzyme mix following the manufacturer's protocol (Invitrogen, Carlsbad, Calif.), and then transformed into chemically competent DH5a cells (Invitrogen, Carlsbad, Calif.) and plated onto LB with appropriate antibiotic selection. The inserts were confirmed by sequencing using M13 forward and reverse primers (Integrated DNA Technologies, Inc., Coralville, Iowa). The confirmed entry clone vector was then recombined with the destination vector pBBR3DEST42 using LR Clonase II enzyme mix (Invitrogen Carlsbad, Calif.) to create the expression vector as described previously (Pelletier et al. 2008). The resulting expression vector construct was designed as p42-0347. The plasmid construct p42-0347 was confirmed by sequencing using BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems Inc., Foster City, Calif.).

Mutant Plasmid Construction

[0074] Briefly, a 262-bp hfq internal part PCR product was purified and cloned into pKnock-Km suicide vector (Alexeyev 1999) digested with XbaI and HindIII restriction enzymes followed by de-phosphorylation. The plasmid construct named as pKm-0347 was then sequenced to confirm the presence of the target gene fragment, which was then electroporated into E. coli WM3064 strain. The transformant E. coli WM3064 (pKm-0347) was verified by PCR and sequencing for the presence of correct plasmid construct pKm-0347. E. coli WM3064 (pKm-0347) was then conjugated with AcR. The conjugant of potential hfq mutant grown on RM plate with kanamycin concentration of 200 .mu.g/mL and no DAP was selected based on PCR size shift by comparing the PCR size of wild-type AcR and conjugants using primer hfq_OCF and hfq_OCR (Table 2). Wild-type AcR has a 1050-bp PCR product and hfq mutant candidates have a 2.9-kb PCR product. The PCR product was sequenced for mutant confirmation.

[0075] The internal part of the Z. mobilis hfq gene (ZMO0347) was amplified by PCR using primers hfq_MF and hfq_MR supplied by MWG-Biotech (Huntsville, Ala.). The hfq gene and the primer positions used for mutant construction and an hfq gene-expressing vector are shown in FIG. 2B. The 262-bp hfq internal part PCR product was then purified and cloned into pCR2.1-TOPO and then transformed into E. coli TOPO one competent cell (Invitrogen, Carlsbad, Calif.). Transformants containing the correct construct were confirmed by PCR and sequencing. The plasmid was then extracted using Qiagen Midiprep and digested XbaI and HindIII restriction enzyme, the 262-bp hfq internal part was then purified by Qiagen Gel purification kit. Similarly, pKnock-Km suicide vector was also digested with XbaI and HindIII restriction enzyme followed by de-phosphorylation, and then ligated with 262-bp purified hfq internal part using Fast-Link.TM. DNA Ligation Kit (Epicentre, Madison, Wis.). The ligation product (pKm-0347) was then transformed into TransforMax EC100D pir-116 Electrocompetent E. coli competent cells (Epicentre, Madison, Wis.) by electroporation. Transformants containing plasmid pKm-0347 were selected on LB agar plate with 50 .mu.g/mL kanamycin. The plasmid was then extracted from the transformants, sequenced to confirm the presence of the target gene fragment, and was then electroporated into E. coli WM3064 strain. Transformants were verified by PCR and sequencing using BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems Inc., Foster City, Calif.) for the presence of the correct plasmid construct pKm-0347.

Plasmid Transformation of Z. mobilis

[0076] Z. mobilis wild-type ZM4 and acetate tolerant strain AcR cultures were grown aerobically at 30.degree. C. in RM, and E. coli WM3064 containing plasmid pKm-0347 or p42-0347 cultures were grown at 37.degree. C. in LB containing 100 .mu.g/mL DAP and 10 .mu.g/mL tetracycline to exponential phase. E. coli WM3064 cells containing plasmid pKm-0347 or p42-0347 were washed with RM for three times by centrifugation at 13,000 rpm for 1 min and resuspended in RM. AcR cells were mixed with E. coli WM3064 (pKm-0347) cells in different ratios (1:3, 1:1, and 3:1). Similarly, ZM4 or AcR cells were mixed with E. coli WM3064 (p42-0347) cells in different ratios (1:3, 1:1, and 3:1). The mixtures of cells were plated onto RM agar plates with 100 .mu.g/mL DAP and 10 .mu.g/mL tetracycline for plasmid p42-0347 conjugation or 50 .mu.g/mL kanamycin for plasmid pKm-0347 conjugation. The cells were incubated at 30.degree. C. overnight. Conjugants were selected by plating on RM agar plates containing 20 .mu.g/mL tetracycline for p42-0347 plasmid conjugants or 200 .mu.g/mL kanamycin for pKm-0347plasmid conjugants at 30.degree. C. The conjugants were confirmed for the presence of correct plasmid constructs by PCR and sequencing using BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems Inc., Foster City, Calif.).

TABLE-US-00002 TABLE 2 Bacterial strains, plasmids and primers used in this application. Strain, plasmid, or primer Genotype, phenotype, or sequence of primer (5' to 3') Reference E. coli K-12 K-12 MG1655 Wild-type strain Joachimstahl et al. (1998) DH5.alpha. F.sup.-.phi.80lacZ.DELTA.M15 .DELTA.(lacZYA-argF) U169 recA1 endA1 Novagen hsdR17(r.sub.k.sup.-, m.sub.k.sup.+) phoA supE44 .lamda..sup.- thi-1 gyrA96 relA1 DB3.1 F.sup.- gyrA462 endA1.DELTA.(sr1-recA) mcrB mrr hsdS20(r.sub.B.sup.-, m.sub.B.sup.-) Invitrogen supE44 ara-14 galK2 lacY1 proA2 rpsL20(Sm.sup.R) xyl-5.lamda.- leu mtl1 WM3064 Denef et al. (2006) BL21(DE3) F-ompT hsdSB(rB-mB-) gal dcm (DE3) Invitrogen Zymomonas mobilis ZM4 ATCC31821 AcR ZM4 acetate tolerant strain generated by random Joachimstahl et mutagenesis al. (1998) ZM4(p42-0347) ZM4 containing plasmid p42-0347 This application AcRIM0347 Insertional mutant of AcR gene ZMO0347 This application AcRIM0347 (p42-0347) AcRIM0347 containing plasmid p42-0347 This application S. cerevisiae BY4741 MATa his31.DELTA.1 leu2.DELTA.0 ura3.DELTA.0 met15.DELTA.0-s288c background Open Biosystems YSC1021-547768 Yeast: Yeast Knock Out Strain, NHA1 Open Biosystems Clone Id: 14095 Accession: YLR138W YSC1021-551633 Yeast: Yeask Knock Out Strain, VNX1 Open Biosystems Clone Id: 1123 Accession: YNL321W YSC1021-553567 Yeast: Yeast Knock Out Strain, ARR3 Open Biosystems Clone Id: 5616 Accession: YPR201W YSC1021-555633 Yeast: Yeast Knock Out Strain, NHX1 Open Biosystems Clone Id: 4290 Accession: YDR456W YSC1021-551475 Yeast: Yeast Knock Out Strain, transporter Open Biosystems Clone Id: 610 Accession: YMR034C YSC1021-551268 Yeast: Yeast Knock Out Strain, PSR1 Open Biosystems Clone Id: 1498 Accession: YLL010C YSC1021-551318 Yeast: Yeast Knock Out Strain, PSR2 Open Biosystems Clone Id: 1574 Accession: YLR019W YSC1021-555189 Yeast: Yeast Knock Out Strain Open Biosystems Clone Id: 2341 Accession: YIR005W YSC1021-554440 Yeast: Yeast Knock Out Strain Open Biosystems Clone Id: 1301 Accession: YJL124C YSC1021-552226 Yeast: Yeast Knock Out Strain Open Biosystems Clone Id: 4214 Accession: YDR378C YSC1021-556031 Yeast: Yeast Knock Out Strain Open Biosystems Clone Id: 7383 Accession: YNL147W YSC1021-552677 Yeast: Yeast Knock Out Strain Open Biosystems Clone Id: 3501 Accession: YCR020C-A YSC1021-552563 Yeast: Yeast Knock Out Strain Open Biosystems Clone Id: 1949 Accession: YHR121W YSC1021-552280 Yeast: Yeast Knock Out Strain Open Biosystems Clone Id: 255 Accession: YEL015W YSC1021-553518 Yeast: Yeast Knock Out Strain Open Biosystems Clone Id: 5544 Accession: YPR129W YSC1021-553919 Yeast: Yeast Knock Out Strain Open Biosystems Clone Id: 3618 Accession: YDR259C YAP6 YSC4515-98809240 Yeast GST-Tagged Strain Open Biosystems Clone Id: YLR138W Accession: YLR138W YSC4515-98810980 Yeast GST-Tagged Strain Open Biosystems Clone Id: YLL010C Accession: YLL010C YSC4515-98807049 Yeast GST-Tagged Strain Open Biosystems Clone Id: YJL124C Accession: YJL124C YSC4515-98805426 Yeast GST-Tagged Strain Open Biosystems Clone Id: YCR020C-A Accession: YCR020C-A YSC4515-98809076 Yeast GST-Tagged Strain Open Biosystems Clone Id: YEL015W Accession: YEL015W YSC4515-98808930 Yeast GST-Tagged Strain Open Biosystems Clone Id: YPR129W Accession: YPR129W YSC4515-98806813 Yeast GST-Tagged Strain Open Biosystems Clone Id: YHR121W Accession: YHR121W YSC4515-98811389 Yeast GST-Tagged Strain Open Biosystems Clone Id: YDR378C Accession: YDR378C YSC4515-98805850 Yeast GST-Tagged Strain Open Biosystems Clone Id: YDR259C Accession: YDR259C Plasmids pKNOCK-Km Km.sup.r, mob, broad host range cloning vector, 1.8 kb Alexeyev (1999) pET-DEST42 Ap.sup.r, Cm.sup.r, C-terminal 6xHis and V5 epitope Invitrogen pBBR1MCS-3 Tc.sup.r, mob, broad host range cloning vector pBBR3DEST42 Cm.sup.rTc.sup.r, C-terminal 6xHis and V5 epitope This application pDONR221 Km.sup.r, gateway entry vector Gm.sup.r, N-terminal GST Invitrogen p42-0347 pBBR3DEST42 containing ZM4 ZMO0347 This application Primers hfq_MF cggagagatggtcagtcaca (SEQ ID NO: 51) 262-bp hfq_MR ttcttgctgctgcataatcg (SEQ ID NO: 52) hfq_CF atggccgaaaaggtcaacaa (SEQ ID NO: 53) 483-bp hfq_CR tcaatcctcgtctcgccttt (SEQ ID NO: 54) hfq_OCF caaagcttgagctcgaattcatttttgccgtggtagttgc (SEQ ID NO: 55) 1050-bp hfq_OCR caggtacctctagaattcaccactcaatcctcgtctcg (SEQ ID NO: 56)

Example 2

[0077] This example describes the results of the experiments showing that overexpression of the Zymomonas mobilis global regulator gene hfq confers enhanced tolerance to sodium acetate.

[0078] The Z. mobilis hfq gene (SEQ ID NO: 1) was cloned into the vector pBBR3-DEST42 (FIG. 2A) and the resulting plasmid construct p42-0347 was transformed into the wild-type strain ZM4 and acetate mutant AcR through conjugation. In addition, an insertional mutant of Z. mobilis strain AcR hfq gene (ZMO0347) was created using the pKNOCK system (Brown 2006; Alexeyev 1999) and complemented with plasmid p42-0347. The hfq gene and the primer positions used for mutant construction and hfq gene over-expression are shown in FIG. 2B. An insertional mutant of hfq (ZMO0347) was generated in the AcR background and designated as strain "AcRIM0347". The hfq gene was over-expressed via plasmid p42-0347 in both wild-type ZM4 and the acetate mutant AcR backgrounds, their susceptibilities to sodium acetate and other stressors were tested in growth assays along with strains ZM4 and AcR. The AcR acetate tolerant mutant is more tolerant to sodium acetate than its wild-type ZM4 parental strain (Joachimstahl et al. 1998); however, the insertional inactivation of the hfq gene in AcR reduces its sodium acetate tolerance (FIGS. 3A-3C). These strains were tested for their growth responses in four different concentrations of sodium acetate: 0, 12 g/L, 16 g/L (195 mM) and 20 g/L (FIGS. 3A-3C).

[0079] The sum of these data show that hfq expression contributed to sodium acetate tolerance. The AcRIM0347 mutant strain grew slightly more slowly in RM medium compared to the parental strain, i.e., in the absence of the sodium acetate stressor (FIG. 3A). Strains ZM4 and AcR with intact hfq genes grew faster than the hfq mutant AcRIM0347 strain in the presence of 12 g/L sodium acetate (FIG. 3B). The AcRIM0347 mutant phenotype was mostly restored by hfq expression and complementation via plasmid p42-0347. Similar, but more dramatic growth phenotypes were observed for sodium acetate of 16 g/L with the wild-type strain unable to grow at this concentration (FIG. 3C).

Example 3

[0080] This example describes the experiments performed to compare the negative effects of pretreatment inhibitors on Z. mobilis growth, and to demonstrate that Hfq overexpression confers tolerance to pretreatment inhibitors.

[0081] Pretreatment Inhibitors had Negative Effects on Z. mobilis Growth

[0082] The growth of Z. mobilis strains was reduced in the presence of acetate, vanillin, furfural, or HMF with increased lag phases and/or slower growth rates and/or final bacterial cell densities depending on the respective condition and strain (Tables 3-4; FIGS. 4A-4E and 5A-5E). Among the different forms of acetate counter-ions tested, sodium acetate had the most significant inhibitory effect on wild-type Z. mobilis growth. This was followed by potassium acetate and ammonium acetate, and sodium chloride had the least negative influence on wild-type Z. mobilis growth (Table 3; FIGS. 4A-4E). Wild-type ZM4 growth was completely inhibited when RM medium was supplemented with 195 mM sodium acetate (Table 3; FIG. 4C). Among the pretreatment inhibitors of vanillin, furfural, and HMF, vanillin had the most significant inhibitory effect on Z. mobilis, while HMF had the least effect (Table 4). It took Z. mobilis a longer period of time to complete active growth and reach the stationary phase, which was about 16, 19 or 21 h in the presence of HMF, furfural or vanillin, respectively, as compared to 11 h without any inhibitor present in the medium (FIGS. 5A-5D).

TABLE-US-00003 TABLE 3 Growth rate and final cell density of different Z. mobilis strains in the absence or presence of different sodium and acetate ions. AcRIM0347 ZM4 ZM4 AcR AcRIM0347 (p42-0347) (p42-0347) Growth RM 0.42 .+-. 0.01 0.39 .+-. 0.01 0.32 .+-. 0.003 0.33 .+-. 0.002 0.38 .+-. 0.003 rate RM (NaCl) 0.24 .+-. 0.008 0.29 .+-. 0.005 0.21 .+-. 0.008 0.22 .+-. 0.009 0.25 .+-. 0.008 (hour.sup.-1) RM (NH.sub.4OAc) 0.20 .+-. 0.008 0.19 .+-. 0.005 NA 0.22 .+-. 0.002 0.19 .+-. 0.007 RM (Kac) 0.15 .+-. 0.004 0.12 .+-. 0.000 NA 0.09 .+-. 0.003 0.12 .+-. 0.006 RM (NaAc) NA 0.29 .+-. 0.04 0.12 .+-. 0.004 0.16 .+-. 0.002 0.27 .+-. 0.004 Final RM 0.95 .+-. 0.006 1.01 .+-. 0.006 0.94 .+-. 0.004 0.92 .+-. 0.002 1.02 .+-. 0.004 Cell RM (NaCl) 0.73 .+-. 0.01 0.96 .+-. 0.01 0.73 .+-. 0.03 0.72 .+-. 0.02 0.84 .+-. 0.01 Density RM (NH.sub.4OAc) 0.43 .+-. 0.01 0.42 .+-. 0.006 NA 0.32 .+-. 0.007 0.37 .+-. 0.008 (OD.sub.600 nm) RM (Kac) 0.42 .+-. 0.002 0.40 .+-. 0.000 NA 0.28 .+-. 0.007 0.34 .+-. 0.004 RM (NaAc) NA 0.63 .+-. 0.02 0.25 .+-. 0.001 0.45 .+-. 0.002 0.59 .+-. 0.002 "NA" indicates that the data are not available due to the lack of growth in that condition. The concentration for all the chemicals (NaCl, NH.sub.4OAc, KAc, NaAc) supplemented into the RM is 195 mM. NaCl: sodium chloride, NH.sub.4OAc: ammonium acetate, KAc: potassium acetate, NaAc: sodium acetate. Strains included in this study are: ZM4: Zymomonas mobilis ZM4 wild-type; AcR: ZM4 acetate tolerant mutant; ZM4 (p42-0347): ZM4 containing a gateway plasmid p42-0347 to express ZM4 gene ZMO0347; AcRIM0347: AcR insertional mutant of ZMO0347; AcRIM0347 (p42-0347): AcRIM0347 containing gateway plasmid p42-0347. This experiment has been repeated at least three times with similar result. Duplicate biological replicates were used for each condition.

TABLE-US-00004 TABLE 4 Growth rate and final cell density of different Z. mobilis strains in the absence or presence of different pretreatment inhibitors. AcRIM0347 ZM4 AcR AcRIM0347 (p42-0347) Growth RM 0.48 .+-. 0.03 0.46 .+-. 0.003 0.35 .+-. 0.004 0.32 .+-. 0.003 rate HMF 0.36 .+-. 0.02 0.35 .+-. 0.01 0.19 .+-. 0.02 0.22 .+-. 0.001 (hour.sup.-1) Furfural 0.31 .+-. 0.01 0.30 .+-. 0.005 0.19 .+-. 0.03 0.20 .+-. 0.01 Vanillin 0.26 .+-. 0.001 0.26 .+-. 0.01 0.20 .+-. 0.006 0.20 .+-. 0.003 Final RM 0.91 .+-. 0.01 0.98 .+-. 0.006 0.95 .+-. 0.003 0.92 .+-. 0.006 Cell HMF 0.93 .+-. 0.003 0.96 .+-. 0.006 0.67 .+-. 0.03 0.78 .+-. 0.02 Density Furfural 0.88 .+-. 0.006 0.89 .+-. 0.009 0.67 .+-. 0.001 0.80 .+-. 0.02 (OD.sub.600 nm) Vanillin 0.69 .+-. 0.006 0.71 .+-. 0.01 0.66 .+-. 0.01 0.70 .+-. 0.01 The concentration for the inhibitor supplemented into the RM is: HMF: 0.75 g/L, furfural, or vanillin: 1 g/L. Strains included in this study are: ZM4: Zymomonas mobilis ZM4 wild-type; AcR: ZM4 acetate tolerant mutant; AcRIM0347: AcR insertional mutant of ZMO0347; AcRIM0347 (p42-0347): AcRIM0347 containing gateway plasmid p42-0347. This experiment has been repeated at least three times with similar result. Duplicate biological replicates were used for each condition.

[0083] Hfq Contributes to Sodium and Acetate Ion Tolerances

[0084] Although the final cell density of hfq mutant AcRIM0347 was similar to that of AcR parental strain (Table 3; FIG. 5A), the growth rate of AcRIM0347 was reduced by about one-fifth even without any inhibitor in the RM, indicating that hfq plays a central role in normal Z. mobilis physiology. Wild-type ZM4 that contained p42-0347 was able to grow in the presence of 195 mM sodium acetate and had a similar growth rate and final cell density to that of acetate tolerant strain AcR (Table 3; FIG. 4C). The wild-type ZM4 was unable to grow under this condition.

[0085] The inactivation of the hfq gene in AcR decreased this acetate tolerant strain's resistance to both sodium ion (sodium chloride) and acetate ion (ammonium acetate and potassium acetate) (Table 3; FIGS. 4A-4E). hfq mutant AcRIM0347 was unable to grow in the presence of 195 mM ammonium acetate or potassium acetate (Table 3; FIGS. 4D-4E). Both the growth rate and final cell density of hfq mutant AcRIM0347 were reduced by at least a quarter in the presence of 195 mM sodium chloride, and about 60% in the presence of 195 mM sodium acetate compared to that of the parental strain AcR (Table 3; FIGS. 4B-4C). The AcRIM0347 hfq mutation was complemented by the introduction of an hfq-expressing plasmid (p42-0347) into the strain. The complemented mutant strain recovered at least half of the parental strains growth rate and 70% of its final cell density in the presence of 195 mM acetate ion (whether as sodium, ammonium or potassium acetate) (Table 3; FIGS. 4A-4E).

[0086] Hfq Contributes to Vanillin, Furfural, HMF and H.sub.2O.sub.2 Tolerances

[0087] AcRIM0347 growth rates were lower than that of ZM4 and AcR under all conditions tests, except for growth in RM broth (Table 4; FIGS. 5A-5D). AcRIM0347 also achieved lower final cell densities compared to ZM4 and AcR (Table 4; FIGS. 5A-5D). When AcRIM0347 was provided functional Z. mobilis Hfq via p42-0347, growth rates under all conditions were largely unchanged (Table 4). However, shorter lag phases were observed for AcRIM0347 (p42-0347) grown with vanillin, furfural or HMF and increases in final cell densities were also observed under these conditions (Table 4; FIGS. 5A-5D). These data indicate that hfq is important for optimal Z. mobilis growth and its ability to resist furfural, HMF and vanillin toxicity.

[0088] Hfq also contributed to tolerance of other stress such as the reactive oxidative species generating hydrogen peroxide (H.sub.2O.sub.2). hfq mutant AcRIM0347 was sensitive to hydrogen peroxide H.sub.2O.sub.2 and no observable growth was detected in RM medium with 0.001% H.sub.2O.sub.2 (FIG. 5E). The wild-type strain ZM4 and acetate tolerant strain AcR grew well at this concentration. Complementation of the hfq mutant strain allowed strain AcRIM0347(p42-0347) to grow in RM medium with 0.001% H.sub.2O.sub.2.

Example 4

[0089] This Example describes experiments to show that Yeast Lsm proteins contribute to pretreatment inhibitor tolerance.

[0090] Lsm Protein and Yeast Tolerance to Sodium and Acetate Ions

[0091] S. cerevisiae Sm and Sm-like (Lsm) proteins are similar to Z. mobilis Hfq at the level of protein sequence. Growth of yeast Lsm deletion mutants and Lsm over-expressing strains in 305 mM ammonium acetate, potassium acetate, or sodium acetate was assessed to test whether S. cerevisiae Lsm proteins and ZM4 Hfq had functionally similar roles.

[0092] Deletion of seven Lsm genes affecting three Lsm heteroheptameric ring components (Lsm1, Lsm6, Lsm7) and four other Lsm proteins containing an Sm domain (Lsm9, Lsm12, Lsm13, Lsm16), was shown to have negative effects on the growth of S. cerevisiae in the presence of sodium acetate 40 g/L (FIG. 6A). On the other hand, six Lsm protein over-expressing S. cerevisiae strains (Lsm1, Lsm6, Lsm9, Lsm12, Lsm13, Lsm16) displayed enhanced growth in the presence of sodium acetate 40 g/L (FIG. 6B).

[0093] Growth differences between the Lsm mutants and yeast wild-type BY4741 in the CM broth without the addition of acetate or with 305 mM NaCl were not observed (FIGS. 7A-7B, respectively). S. cerevisiae Lsm proteins involved in RNA processing ring complex formation (Lsm1, 6, 7), especially Lsm6, played a role in acetate tolerance (FIGS. 7C-7E, 7K-7M). Lsm protein deletion mutants Lsm1, 6, and 7 showed decreased acetate tolerance compared to the wild-type control strain, especially in early growth stages for acetate with sodium, ammonium and potassium counter-ions (FIGS. 7C-7E). The Lsm overexpression strains grew similarly to wild-type BY4741 without the addition of acetate or with 305 mM NaCl (FIGS. 7I, 7J), but each of the Lsm protein overexpression strains showed enhanced acetate tolerance compared to the wild-type strain with sodium, ammonium or potassium counter-ions (FIGS. 7K-7M).

[0094] Lsm Proteins and Yeast Tolerance to Vanillin, Furfural and HMF

[0095] The effect of Lsm proteins on S. cerevisiae tolerance to pretreatment inhibitors vanillin, furfural, and HMF was also investigated using the seven Lsm deletion mutants and six Lsm overexpression strains described above. Each yeast deletion mutant and each overexpression strain showed similar growth profiles compared to wild-type strain BY4741 in the absence of inhibitors (FIGS. 7A; 7I). Deletion mutants for Lsm1, 6 and 7 proteins were unable to grow or showed extended lag phases before recovery from the inhibitory effects of pretreatment inhibitors (FIGS. 7F-7H). Overexpression of Lsm proteins provided a slight growth advantage in the presence of 1.5 g/L HMF and furfural (FIGS. 7O-7P). However, a detrimental effect on growth was observed for overexpression strains when cultured in the presence of 0.75 g/L vanillin (FIG. 7N). The data indicated that Lsm proteins Lsm1, 6, and 7 especially Lsm6, which are the components of yeast RNA processing ring complex, play a role in tolerance to the model inhibitors used in this study.

REFERENCES

[0096] Alexeyev M F: The pKNOCK series of broad-host-range mobilizable suicide vectors for gene knockout and targeted DNA insertion into the chromosome of gram-negative bacteria. BioTechniques 1999, 26(5):824-826, 828. [0097] Almeida J R M, Modig T, Petersson A, Hahn-Hagerdal B, Liden G, Gorwa-Grauslund M F: Increased tolerance and conversion of inhibitors in lignocellulosic hydrolysates by Saccharomyces cerevisiae. J Chem Technol Biotechnol 2007, 82(4):340-349. [0098] Amberg D C, Burke D J, Strathern J N: Methods in Yeast Genetics: A Cold Spring Harbor Laboratory Course Manual. New York: Cold Spring Harbor Press; 2005. [0099] Baumler D J, Hung K F, Bose J L, Vykhodets B M, Cheng C M, Jeong K C, Kaspar C W: Enhancement of acid tolerance in Zymomonas mobilis by a proton-buffering peptide. Appl Biochem Biotechnol 2006, 134(1):15-26. [0100] Brown S D: Analysis of a 16 kb region of the Mesorhizobium loti R7A symbiosis island encoding bio and nad loci and a novel member of the lad family Dunedin: University of Otago; 2002. [0101] Brown S D, Martin M, Deshpande S, Seal S, Huang K, Alm E, Yang Y, Wu L, Yan T, Liu X et al: Cellular response of Shewanella oneidensis to strontium stress. Appl Environ Microbiol 2006, 72(1):890-900. [0102] Chinnawirotpisan P, Theeragool G, Limtong S, Toyama H, Adachi O O, Matsushita K: Quinoprotein alcohol dehydrogenase is involved in catabolic acetate production, while NAD-dependent alcohol dehydrogenase in ethanol assimilation in Acetobacter pasteurianus SKU1108. J Biosci Bioeng. 2003; 96(6):564-71. [0103] Deanda K, Zhang M, Eddy C, Picataggio S: Development of an arabinose-fermenting Zymomonas mobilis strain by metabolic pathway engineering. Appl Environ Microbiol 1996, 62(12):4465-4470. [0104] Dien B S, Cotta M A, Jeffries T W: Bacteria engineered for fuel ethanol production: current status. Appl Microbiol Biotechnol 2003, 63(3):258-266. [0105] Fukaya M, Takemura H, Okumura H, Kawamura Y, Horinouchi S, Beppu T: Cloning of genes responsible for acetic acid resistance in Acetobacter aceti. J Bacteriol 1990, 172(4):2096-2104. [0106] Fukaya M, Takemura H, Tayama K, Okumura H, Kawamura Y, Horinouchi S, Beppu T: The aarC gene responsible for acetic acid assimilation confers acetic acid resistance on Acetobacter aceti. J Ferment Bioeng 1993, 76(4):270-275. [0107] Gunasekaran P, Raj K C: Ethanol fermentation technology--Zymomonas mobilis. Current Science 1999, 77(1):56-68. [0108] Guisbert E. et al., "Hfq the .sigma..sup.E-Mediated Envelope Stress Response and the .sigma..sup.32-Mediated Cytoplasmic Stress Response in Escherichia coli.sup..gradient.", J Bacteriol 2007 189(5): 1963-1973. [0109] Hermann et al., EMBO J 14: 2976-2088 (1995). [0110] Jeon Y J, Svenson C J, Joachimsthal E L, Rogers P L: Kinetic analysis of ethanol production by an acetate-resistant strain of recombinant Zymomonas mobilis. Biotechnol Lett 2002, 24(10):819-824. [0111] Joachimstahl E, Haggett K D, Jang J H, Rogers P L: A mutant of Zymomonas mobilis ZM4 capable of ethanol production from glucose in the presence of high acetate concentrations. Biotechnol Lett 1998, 20(2):137-142. [0112] Joachimsthal E L, Rogers P L: Characterization of a high-productivity recombinant strain of Zymomonas mobilis for ethanol production from glucose/xylose mixtures. Appl Biochem Biotechnol 2000, 84-6:343-356. [0113] Kadar Z, Maltha S F, Szengyel Z, Reczey K, De Laat W: Ethanol fermentation of various pretreated and hydrolyzed substrates at low initial pH. Appl Biochem Biotechnol 2007, 137:847-858. [0114] Kalogeraki V S, Winans S C: Suicide plasmids containing promoterless reporter genes can simultaneously disrupt and create fusions to target genes of diverse bacteria. Gene 1997, 188(1):69-75. [0115] Koch B, Jensen L E, Nybroe O: A panel of Tn7-based vectors for insertion of the gfp marker gene or for delivery of cloned DNA into Gram-negative bacteria at a neutral chromosomal site. J Microbiol Meth 2001, 45(3):187-195. [0116] Lawford H G, Rousseau J D: Effects of pH and acetic acid on glucose and xylose metabolism by a genetically engineered ethanologenic Escherichia coli. Appl Biochem Biotechnol 1993, 39:301-322. [0117] Lawford H G, Rousseau J D: Improving fermentation performance of recombinant Zymomonas in acetic acid-containing media. Appl Biochem Biotechnol 1998, 70-2:161-172. [0118] Lawford H G, Rousseau J D, Mohagheghi A, McMillan J D: Fermentation performance characteristics of a prehydrolyzate-adapted xylose-fermenting recombinant Zymomonas in batch and continuous fermentations. Appl Biochem Biotechnol 1999, 77-9:191-204. [0119] Lawford H G, Rousseau J D, Tolan J S: Comparative ethanol productivities of different Zymomonas recombinants fermenting oat hull hydrolysate. Appl Biochem Biotechnol 2001, 91-3:133-146. [0120] Lawford H G, Rousseau J D: Fermentation performance assessment of a genomically integrated xylose-utilizing recombinant of Zymomonas mobilis 39676. Appl Biochem Biotechnol 2001, 91-3:117-131. [0121] Lawford H G, Rousseau J D: Cellulosic fuel ethanol--Alternative fermentation process designs with wild-type and recombinant Zymomonas mobilis. Appl Biochem Biotechnol 2003, 105:457-469. [0122] Matsushita K, Inoue T, Adachi O, Toyama H: Acetobacter aceti possesses a proton motive force-dependent efflux system for acetic acid. J Bacteriol 2005, 187(13):4346-4352. [0123] McMillan J D: Conversion of hemicellulose hydrolyzates to ethanol. In: Enzymatic Conversion of Biomass for Fuels Production. Edited by Himmel MEBJOORP, vol. 566; 1994: 411-437. [0124] Mohagheghi A, Evans K, Chou Y C, Zhang M: Cofermentation of glucose, xylose, and arabinose by genomic DNA-integrated xylose/arabinose fermenting strain of Zymomonas mobilis AX101. Appl Biochem Biotechnol 2002, 98-100:885-898. [0125] Mohagheghi A, Dowe N, Schell D, Chou Y C, Eddy C, Zhang M: Performance of a newly developed integrant of Zymomonas mobilis for ethanol production on corn stover hydrolysate. Biotechnol Lett 2004, 26(4):321-325. [0126] Mullins E A, Francois J A, Kappock T J: A specialized citric acid cycle requiring succinyl-coenzyme A (CoA): Acetate CoA-transferase (AarC) confers acetic acid resistance on the acidophile Acetobacter aceti. J Bacteriol 2008, 190(14):4933-4940. [0127] Okumura H, Uozumi T, Beppu T: Biochemical characteristics of spontaneous mutants of Acetobacter aceti deficient in ethanol oxidation. Agri Biological Chem 1985, 49(8):2485-2487. [0128] Panesar P S, Marwaha S S, Kennedy J F: Zymomonas mobilis: an alternative ethanol producer. J Chem Technol Biotechnol 2006, 81(4):623-635. [0129] Pecota D C, Kim C S, Wu K W, Gerdes K, Wood T K: Combining the hok/sok, parDE, and pnd postsegregational killer loci to enhance plasmid stability. Appl Environ Microbiol 1997, 63(5):1917-1924. [0130] Pelletier et al. "A general system for studying protein-protein interactions in gram-negative bacteria", J. Proteome Research 2008, 7(8):3319-3328. [0131] Ranatunga T D, Jervis J, Helm R F, McMillan J D, Hatzis C: Identification of inhibitory components toxic toward Zymomonas mobilis CP4(pZB5) xylose fermentation. Appl Biochem Biotechnol 1997, 67(3):185-198. [0132] Rogers P L, Goodman A E, Heyes R H: Zymomonas ethanol fermentations. Microbiol Sci 1984, 1(6):133-136. [0133] Rogers P L, Jeon Y J, Lee K J, Lawford H G: Zymomonas mobilis for fuel ethanol and higher value products. In: Biofuels. vol. 108; 2007: 263-288. [0134] Steiner P, Sauer U: Overexpression of the ATP-dependent helicase RecG improves resistance to weak organic acids in Escherichia coli. Appl Microbiol Biotechnol 2003, 63(3):293-299. [0135] Swings J, De Ley J: The biology of Zymomonas mobilis. Bacteriol Rev 1977, 41:1-46. [0136] Takahashi C M, Takahashi D F, Carvalhal M L C, Alterthum F: Effects of acetate on the growth and fermentation performance of Escherichia coli KO11. Appl Biochem Biotechnol 1999, 81(3):193-203. [0137] Takemura H, Horinouchi S, Beppu T: Novel insertion sequence IS1380 from Acetobacter pasteurianus is involved in loss of ethanol oxidizing ability. J Bacteriol 1991, 173(22):7070-7076. [0138] Tiffany Ho-Ching et al., "Characterization of broadly pleiotropic phenotypes caused by an hfq insertion mutation in Escherichia coli K-12", Mol Microbiol 1994 13(1): 35-49. [0139] Tsui H C, Leung H C, Winkler M E.: Characterization of broadly pleiotropic phenotypes caused by an hfq insertion mutation in Escherichia coli K-12. Mol Microbiol. 1994 July; 13(1):35-49. [0140] Valentin-Hansen et al. "The bacterial Sm-like protein Hfq: a key player in RNA transactions", Mol Microbiol 2004, 51(6): 1525-1533. [0141] Yang S, Tschaplinski T J, Engle N L, Carroll S L, Martin S L, Davison B H, Palumbo A V, Rodriguez M Jr, Brown S D: Transcriptomic and metabolomic profiling of Zymomonas mobilis during aerobic and anaerobic fermentations. BMC Genomics. 2009 Jan. 20; 10:34. [0142] Zhang A. et al., "The Sm-like Hfq Protein Increases OxyS RNA Interaction with Target mRNAs", Mol Cell 2002 9: 11-22. [0143] Zhang A. et al., "Global analysis of small RNA and mRNA targets of Hfq", Mol Microbiol 2003, 50(4): 1111-1124. [0144] Zhang M, Eddy C, Deanda K, Finkestein M, Picataggio S: Metabolic engineering of a pentose metabolism pathway in ethanologenic Zymomonas mobilis. Science 1995, 267(5195):240-243.

Sequence CWU 1

1

561486DNAZymomonas mobilis 1atggccgaaa aggtcaacaa tcttcaggat tttttcctta ataccttgcg caagacccgc 60acaccggtga cgatgttttt ggtaaaaggt gtcaaattac agggcgttat cacctggttt 120gacaattttt ctattctgct gcggagagat ggtcagtcac agctggtcta taaacacgct 180atttctacca ttattccggc gcatccgctg gaacagctgc gcgaaagccg cagtttgatg 240gctgaacgta aatccagttt gcttcaggat gtctttttat cggcgattat gcagcagcaa 300gaaccggtga caatgttttt gataaacggg gtcatgttgc aaggtgaaat tgccgccttc 360gatttattct gcgtcttgtt gacccgtaat gacgacgcgc agctggttta taaacatgcg 420gtttcaacag tgcagcctgt gaaatctgta gatttgacaa tgacagaaag gcgagacgag 480gattga 4862161PRTZymomonas mobilis 2Met Ala Glu Lys Val Asn Asn Leu Gln Asp Phe Phe Leu Asn Thr Leu1 5 10 15Arg Lys Thr Arg Thr Pro Val Thr Met Phe Leu Val Lys Gly Val Lys 20 25 30Leu Gln Gly Val Ile Thr Trp Phe Asp Asn Phe Ser Ile Leu Leu Arg 35 40 45Arg Asp Gly Gln Ser Gln Leu Val Tyr Lys His Ala Ile Ser Thr Ile 50 55 60Ile Pro Ala His Pro Leu Glu Gln Leu Arg Glu Ser Arg Ser Leu Met65 70 75 80Ala Glu Arg Lys Ser Ser Leu Leu Gln Asp Val Phe Leu Ser Ala Ile 85 90 95Met Gln Gln Gln Glu Pro Val Thr Met Phe Leu Ile Asn Gly Val Met 100 105 110Leu Gln Gly Glu Ile Ala Ala Phe Asp Leu Phe Cys Val Leu Leu Thr 115 120 125Arg Asn Asp Asp Ala Gln Leu Val Tyr Lys His Ala Val Ser Thr Val 130 135 140Gln Pro Val Lys Ser Val Asp Leu Thr Met Thr Glu Arg Arg Asp Glu145 150 155 160Asp3309DNAEscherichia coli 3atggctaagg ggcaatcttt acaagatccg ttcctgaacg cactgcgtcg ggaacgtgtt 60ccagtttcta tttatttggt gaatggtatt aagctgcaag ggcaaatcga gtcttttgat 120cagttcgtga tcctgttgaa aaacacggtc agccagatgg tttacaagca cgcgatttct 180actgttgtcc cgtctcgccc ggtttctcat cacagtaaca acgccggtgg cggtaccagc 240agtaactacc atcatggtag cagcgcgcag aatacttccg cgcaacagga cagcgaagaa 300accgaataa 3094102PRTEscherichia coli 4Met Ala Lys Gly Gln Ser Leu Gln Asp Pro Phe Leu Asn Ala Leu Arg1 5 10 15Arg Glu Arg Val Pro Val Ser Ile Tyr Leu Val Asn Gly Ile Lys Leu 20 25 30Gln Gly Gln Ile Glu Ser Phe Asp Gln Phe Val Ile Leu Leu Lys Asn 35 40 45Thr Val Ser Gln Met Val Tyr Lys His Ala Ile Ser Thr Val Val Pro 50 55 60Ser Arg Pro Val Ser His His Ser Asn Asn Ala Gly Gly Gly Thr Ser65 70 75 80Ser Asn Tyr His His Gly Ser Ser Ala Gln Asn Thr Ser Ala Gln Gln 85 90 95Asp Ser Glu Glu Thr Glu 1005249DNAClostridium thermoalcaliphilum 5gtggtgagca aaaataatat taatttacag gacgtttttc taaaccaggt aagaaaagaa 60catattccgg ttactgttta tcttaccaac ggattccagt taaaaggaac ggtaaaggga 120tttgacaatt ttaccgttgt gcttgacagt gagggaaggc agcagctgat ttataaacat 180gcaatttcaa caataagccc catgaaaatt gttagcttga ttttcaacga caataacaga 240tcggaataa 249682PRTClostridium thermoalcaliphilum 6Met Val Ser Lys Asn Asn Ile Asn Leu Gln Asp Val Phe Leu Asn Gln1 5 10 15Val Arg Lys Glu His Ile Pro Val Thr Val Tyr Leu Thr Asn Gly Phe 20 25 30Gln Leu Lys Gly Thr Val Lys Gly Phe Asp Asn Phe Thr Val Val Leu 35 40 45Asp Ser Glu Gly Arg Gln Gln Leu Ile Tyr Lys His Ala Ile Ser Thr 50 55 60Ile Ser Pro Met Lys Ile Val Ser Leu Ile Phe Asn Asp Asn Asn Arg65 70 75 80Ser Glu7279DNAAnaerocellum thermophilum 7gtggcgaaag gaagtttaaa cttgcaggac ttatttttaa atcagttaag aaaagaaaaa 60gtgaatgtta caatttttct gctcagcggt tttcagttaa aaggagttat caagggtttt 120gataacttta cattgattgt agagactgac aataacaagc agcaactaat ttacaagcac 180gctatatctt caatcatgcc ctcaaagcca ataaactata tggctcaggc acagaataat 240caacaagctt ctcaacaatc aaataataat caaggttaa 279892PRTAnaerocellum thermophilum 8Met Ala Lys Gly Ser Leu Asn Leu Gln Asp Leu Phe Leu Asn Gln Leu1 5 10 15Arg Lys Glu Lys Val Asn Val Thr Ile Phe Leu Leu Ser Gly Phe Gln 20 25 30Leu Lys Gly Val Ile Lys Gly Phe Asp Asn Phe Thr Leu Ile Val Glu 35 40 45Thr Asp Asn Asn Lys Gln Gln Leu Ile Tyr Lys His Ala Ile Ser Ser 50 55 60Ile Met Pro Ser Lys Pro Ile Asn Tyr Met Ala Gln Ala Gln Asn Asn65 70 75 80Gln Gln Ala Ser Gln Gln Ser Asn Asn Asn Gln Gly 85 909300DNACaldicellulosiruptor saccharolyticus 9gtggcaaaag gaaatttgaa cttgcaggat ttatttttaa accagcttcg aaaagaaaaa 60gtcaacgtta caatcttttt actgagcgga ttccaattga aaggagttat caaaggtttt 120gataacttta cattggtggt agagacagaa aataacaaac agcagctcat ttacaaacat 180gcaatttctt ctattctacc atcaaagcca ataaactaca tggctcaagt tcaaaactca 240caagtgcaaa acacagcttc tcagcaaagt aacaataacc aaaatcaaga gtcaaaataa 3001099PRTCaldicellulosiruptor saccharolyticus 10Val Ala Lys Gly Asn Leu Asn Leu Gln Asp Leu Phe Leu Asn Gln Leu1 5 10 15Arg Lys Glu Lys Val Asn Val Thr Ile Phe Leu Leu Ser Gly Phe Gln 20 25 30Leu Lys Gly Val Ile Lys Gly Phe Asp Asn Phe Thr Leu Val Val Glu 35 40 45Thr Glu Asn Asn Lys Gln Gln Leu Ile Tyr Lys His Ala Ile Ser Ser 50 55 60Ile Leu Pro Ser Lys Pro Ile Asn Tyr Met Ala Gln Val Gln Asn Ser65 70 75 80Gln Val Gln Asn Thr Ala Ser Gln Gln Ser Asn Asn Asn Gln Asn Gln 85 90 95Glu Ser Lys11261DNAThermoanaerobacter sp. 11atggcaagtt caaaagcagc tattaattta caggatatct ttttaaatca agtgaggaaa 60gagcatgtac cagtaactgt ctacttaatc aacggatttc aattaaaggg tttagtgaaa 120ggatttgata attttacagt ggtgttggag tcagagaaca aacagcaact tcttatctac 180aaacatgcta tttcgacaat tacacctcaa aagcctgtga tcttctctgc ttctgataaa 240gatgagaaga gagaagagtg a 2611286PRTThermoanaerobacter sp. 12Met Ala Ser Ser Lys Ala Ala Ile Asn Leu Gln Asp Ile Phe Leu Asn1 5 10 15Gln Val Arg Lys Glu His Val Pro Val Thr Val Tyr Leu Ile Asn Gly 20 25 30Phe Gln Leu Lys Gly Leu Val Lys Gly Phe Asp Asn Phe Thr Val Val 35 40 45Leu Glu Ser Glu Asn Lys Gln Gln Leu Leu Ile Tyr Lys His Ala Ile 50 55 60Ser Thr Ile Thr Pro Gln Lys Pro Val Ile Phe Ser Ala Ser Asp Lys65 70 75 80Asp Glu Lys Arg Glu Glu 8513591DNASaccharomyces cerevisiae 13atgagcaaaa tacaggtggc acatagcagc cgactagcca accttattga ttataagctg 60agggttctca ctcaagatgg ccgcgtttac atcgggcaat tgatggcatt tgataaacat 120atgaatttag tgttgaatga gtgtatagaa gagagggtac ccaaaactca actagataaa 180ttaagaccga gaaaagattc aaaagatgga accactttga acatcaaggt agaaaaaaga 240gtgttgggac tgactatact aagaggagaa cagatcttat ccacagtggt ggaggataag 300ccgctactat ccaagaagga aagactagtg agagataaaa aggaaaagaa acaagcgcaa 360aagcagacga aactaagaaa agagaaagag aaaaagccgg gaaagatcgc taaacctaac 420acggccaatg cgaagcatac tagtagcaat tctagggaga ttgcccaacc atcgtcgagc 480agatacaatg gtggcaacga taatatcggc gcaaataggt cgaggtttaa taatgaagcg 540ccccctcaaa caaggaagtt tcagccccca ccaggtttta aaagaaaata a 59114196PRTSaccharomyces cerevisiae 14Met Ser Lys Ile Gln Val Ala His Ser Ser Arg Leu Ala Asn Leu Ile1 5 10 15Asp Tyr Lys Leu Arg Val Leu Thr Gln Asp Gly Arg Val Tyr Ile Gly 20 25 30Gln Leu Met Ala Phe Asp Lys His Met Asn Leu Val Leu Asn Glu Cys 35 40 45Ile Glu Glu Arg Val Pro Lys Thr Gln Leu Asp Lys Leu Arg Pro Arg 50 55 60Lys Asp Ser Lys Asp Gly Thr Thr Leu Asn Ile Lys Val Glu Lys Arg65 70 75 80Val Leu Gly Leu Thr Ile Leu Arg Gly Glu Gln Ile Leu Ser Thr Val 85 90 95Val Glu Asp Lys Pro Leu Leu Ser Lys Lys Glu Arg Leu Val Arg Asp 100 105 110Lys Lys Glu Lys Lys Gln Ala Gln Lys Gln Thr Lys Leu Arg Lys Glu 115 120 125Lys Glu Lys Lys Pro Gly Lys Ile Ala Lys Pro Asn Thr Ala Asn Ala 130 135 140Lys His Thr Ser Ser Asn Ser Arg Glu Ile Ala Gln Pro Ser Ser Ser145 150 155 160Arg Tyr Asn Gly Gly Asn Asp Asn Ile Gly Ala Asn Arg Ser Arg Phe 165 170 175Asn Asn Glu Ala Pro Pro Gln Thr Arg Lys Phe Gln Pro Pro Pro Gly 180 185 190Phe Lys Arg Lys 19515441DNASaccharomyces cerevisiae 15atgaagttgg ttaacttttt aaaaaagctg cgcaatgagc aggttaccat agaactaaaa 60aacggtacca ccgtttgggg tacactgcag tcggtatcac cacaaatgaa tgctatctta 120actgacgtga agttgaccct accacaaccc cgactaaata aattgaacag taatggtatt 180gcgatggcta gtctgtactt gactggagga cagcaaccta ctgcaagtga caacatagca 240agtttgcaat acataaacat tagaggcaat accataagac agataatctt acctgattcc 300ttgaacctgg attcactttt ggttgaccaa aagcaactta attccctaag aagatcgggt 360caaattgcaa atgaccccag caaaaagaga aggcgcgatt ttggtgcacc agcgaataaa 420aggccaagaa gaggtctatg a 44116146PRTSaccharomyces cerevisiae 16Met Lys Leu Val Asn Phe Leu Lys Lys Leu Arg Asn Glu Gln Val Thr1 5 10 15Ile Glu Leu Lys Asn Gly Thr Thr Val Trp Gly Thr Leu Gln Ser Val 20 25 30Ser Pro Gln Met Asn Ala Ile Leu Thr Asp Val Lys Leu Thr Leu Pro 35 40 45Gln Pro Arg Leu Asn Lys Leu Asn Ser Asn Gly Ile Ala Met Ala Ser 50 55 60Leu Tyr Leu Thr Gly Gly Gln Gln Pro Thr Ala Ser Asp Asn Ile Ala65 70 75 80Ser Leu Gln Tyr Ile Asn Ile Arg Gly Asn Thr Ile Arg Gln Ile Ile 85 90 95Leu Pro Asp Ser Leu Asn Leu Asp Ser Leu Leu Val Asp Gln Lys Gln 100 105 110Leu Asn Ser Leu Arg Arg Ser Gly Gln Ile Ala Asn Asp Pro Ser Lys 115 120 125Lys Arg Arg Arg Asp Phe Gly Ala Pro Ala Asn Lys Arg Pro Arg Arg 130 135 140Gly Leu14517333DNASaccharomyces cerevisiae 17atgtcttcac aaataattga tcgtccaaaa catgaactct ctagagcaga attagaggaa 60ctagaagaat ttgaattcaa acatggtcca atgtccctga taaatgatgc tatggtgaca 120agaacacctg tgataatctc attaagaaac aatcataaaa taatagcgag agtgaaagct 180ttcgacaggc attgtaatat ggttttagaa aatgtgaagg agctttggac agagaagaag 240ggcaaaaatg taattaatcg ggaaagattc ataagtaaac tattcttaag aggtgattca 300gttatcgttg tgttaaaaac ccctgttgag taa 33318110PRTSaccharomyces cerevisiae 18Met Ser Ser Gln Ile Ile Asp Arg Pro Lys His Glu Leu Ser Arg Ala1 5 10 15Glu Leu Glu Glu Leu Glu Glu Phe Glu Phe Lys His Gly Pro Met Ser 20 25 30Leu Ile Asn Asp Ala Met Val Thr Arg Thr Pro Val Ile Ile Ser Leu 35 40 45Arg Asn Asn His Lys Ile Ile Ala Arg Val Lys Ala Phe Asp Arg His 50 55 60Cys Asn Met Val Leu Glu Asn Val Lys Glu Leu Trp Thr Glu Lys Lys65 70 75 80Gly Lys Asn Val Ile Asn Arg Glu Arg Phe Ile Ser Lys Leu Phe Leu 85 90 95Arg Gly Asp Ser Val Ile Val Val Leu Lys Thr Pro Val Glu 100 105 11019306DNASaccharomyces cerevisiae 19atgactatga atggaatacc agtgaaatta ttaaatgagg cacagggaca tatcgtttct 60ctggagctaa caacgggagc gacttatcgt ggtaaacttg ttgaaagcga agatagcatg 120aacgtacagc taagagatgt aatagctaca gagccccagg gggctgtaac acacatggat 180caaatattcg tacgtgggtc acagatcaaa tttatcgttg ttccagatct cttaaagaat 240gcaccattat tcaaaaaaaa ctcatcaaga cctatgccac caataagagg acctaagaga 300aggtga 30620101PRTSaccharomyces cerevisiae 20Met Thr Met Asn Gly Ile Pro Val Lys Leu Leu Asn Glu Ala Gln Gly1 5 10 15His Ile Val Ser Leu Glu Leu Thr Thr Gly Ala Thr Tyr Arg Gly Lys 20 25 30Leu Val Glu Ser Glu Asp Ser Met Asn Val Gln Leu Arg Asp Val Ile 35 40 45Ala Thr Glu Pro Gln Gly Ala Val Thr His Met Asp Gln Ile Phe Val 50 55 60Arg Gly Ser Gln Ile Lys Phe Ile Val Val Pro Asp Leu Leu Lys Asn65 70 75 80Ala Pro Leu Phe Lys Lys Asn Ser Ser Arg Pro Met Pro Pro Ile Arg 85 90 95Gly Pro Lys Arg Arg 10021285DNASaccharomyces cerevisiae 21atgtcgaaca aagttaaaac caaggccatg gtgccaccaa taaattgcat atttaacttc 60ttacaacagc aaacaccagt aacgatatgg ttattcgagc aaatcggcat aagaatcaag 120ggtaaaatag ttggatttga tgagttcatg aatgttgtca tcgatgaagc cgtggaaatt 180cctgtgaata gtgccgatgg taaagaagat gtggagaagg gcacgccctt ggggaagatc 240ctgttgaaag gcgataatat cacattgata acatcagcgg actga 2852294PRTSaccharomyces cerevisiae 22Met Ser Asn Lys Val Lys Thr Lys Ala Met Val Pro Pro Ile Asn Cys1 5 10 15Ile Phe Asn Phe Leu Gln Gln Gln Thr Pro Val Thr Ile Trp Leu Phe 20 25 30Glu Gln Ile Gly Ile Arg Ile Lys Gly Lys Ile Val Gly Phe Asp Glu 35 40 45Phe Met Asn Val Val Ile Asp Glu Ala Val Glu Ile Pro Val Asn Ser 50 55 60Ala Asp Gly Lys Glu Asp Val Glu Lys Gly Thr Pro Leu Gly Lys Ile65 70 75 80Leu Leu Lys Gly Asp Asn Ile Thr Leu Ile Thr Ser Ala Asp 85 9023261DNASaccharomyces cerevisiae 23atgagcgaga gcagtgatat cagcgcgatg cagccggtga acccgaagcc gttcctcaaa 60ggcctggtca accatcgtgt aggcgtcaag cttaagttca acagcaccga atatagaggt 120acgctcgtgt ccacggacaa ctactttaac ctgcagctga acgaagcaga agagtttgtt 180gcgggtgtct cgcacggcac cctgggcgag atattcatcc gctgcaataa cgtgctgtac 240atcagggagc tgccgaacta a 2612486PRTSaccharomyces cerevisiae 24Met Ser Glu Ser Ser Asp Ile Ser Ala Met Gln Pro Val Asn Pro Lys1 5 10 15Pro Phe Leu Lys Gly Leu Val Asn His Arg Val Gly Val Lys Leu Lys 20 25 30Phe Asn Ser Thr Glu Tyr Arg Gly Thr Leu Val Ser Thr Asp Asn Tyr 35 40 45Phe Asn Leu Gln Leu Asn Glu Ala Glu Glu Phe Val Ala Gly Val Ser 50 55 60His Gly Thr Leu Gly Glu Ile Phe Ile Arg Cys Asn Asn Val Leu Tyr65 70 75 80Ile Arg Glu Leu Pro Asn 8525234DNASaccharomyces cerevisiae 25atggtttcta cccctgaact gaagaaatat atggacaaga agatattgct gaatataaat 60ggatctagga aagtggcagg aattttgcga ggctacgata ttttcttaaa cgtcgttctt 120gatgatgcaa tggagataaa tggtgaagac cctgccaata accaccagct aggcttgcag 180accgtcatta ggggcaactc cataatatcc ctagaggctc tagatgccat ataa 2342677PRTSaccharomyces cerevisiae 26Met Val Ser Thr Pro Glu Leu Lys Lys Tyr Met Asp Lys Lys Ile Leu1 5 10 15Leu Asn Ile Asn Gly Ser Arg Lys Val Ala Gly Ile Leu Arg Gly Tyr 20 25 30Asp Ile Phe Leu Asn Val Val Leu Asp Asp Ala Met Glu Ile Asn Gly 35 40 45Glu Asp Pro Ala Asn Asn His Gln Leu Gly Leu Gln Thr Val Ile Arg 50 55 60Gly Asn Ser Ile Ile Ser Leu Glu Ala Leu Asp Ala Ile65 70 7527519DNASaccharomyces cerevisiae 27atgtctgcaa atagcaagga cagaaatcag tccaatcagg atgcgaagcg acaacagcag 60aatttcccaa agaagatttc agaaggtgag gccgatttat atctcgacca gtataacttc 120actaccaccg ctgctattgt aagctcagta gaccgtaaaa tcttcgttct tttgcgtgat 180ggaagaatgc tattcggtgt actaagaacc tttgaccaat atgcaaattt gatacttcaa 240gattgcgtgg agagaatata ttttagcgaa gaaaacaaat acgctgaaga agaccgcggc 300atattcatga ttcgtggtga aaatgttgtc atgttaggcg aagtagacat cgataaagaa 360gatcaacccc ttgaggccat ggaacgcata ccatttaagg aggcttggct gaccaagcaa 420aaaaatgatg agaaaaggtt taaagaggaa acccacaaag gtaaaaaaat ggcccgccat 480ggtatcgttt acgatttcca taaatctgac atgtactaa 51928172PRTSaccharomyces cerevisiae 28Met Ser Ala Asn Ser Lys Asp Arg Asn Gln Ser Asn Gln Asp Ala Lys1 5 10 15Arg Gln Gln Gln Asn Phe Pro Lys Lys Ile Ser Glu Gly Glu Ala Asp 20 25 30Leu Tyr Leu Asp Gln Tyr Asn Phe Thr Thr Thr Ala Ala Ile Val Ser 35

40 45Ser Val Asp Arg Lys Ile Phe Val Leu Leu Arg Asp Gly Arg Met Leu 50 55 60Phe Gly Val Leu Arg Thr Phe Asp Gln Tyr Ala Asn Leu Ile Leu Gln65 70 75 80Asp Cys Val Glu Arg Ile Tyr Phe Ser Glu Glu Asn Lys Tyr Ala Glu 85 90 95Glu Asp Arg Gly Ile Phe Met Ile Arg Gly Glu Asn Val Val Met Leu 100 105 110Gly Glu Val Asp Ile Asp Lys Glu Asp Gln Pro Leu Glu Ala Met Glu 115 120 125Arg Ile Pro Phe Lys Glu Ala Trp Leu Thr Lys Gln Lys Asn Asp Glu 130 135 140Lys Arg Phe Lys Glu Glu Thr His Lys Gly Lys Lys Met Ala Arg His145 150 155 160Gly Ile Val Tyr Asp Phe His Lys Ser Asp Met Tyr 165 17029288DNASaccharomyces cerevisiae 29atgcttttct tctccttttt caagacttta gttgaccaag aagtggtcgt agagttaaaa 60aacgacattg aaataaaagg tacactacaa tcagttgacc aatttttgaa tctgaaacta 120gacaacatat catgcacaga tgaaaaaaaa tatccacact tgggttccgt aaggaatatt 180tttataagag gttcaacagt caggtacgtt tacttgaata agaacatggt agatacgaat 240ttgctacaag acgctaccag aagggaggta atgactgaaa gaaaataa 2883095PRTSaccharomyces cerevisiae 30Met Leu Phe Phe Ser Phe Phe Lys Thr Leu Val Asp Gln Glu Val Val1 5 10 15Val Glu Leu Lys Asn Asp Ile Glu Ile Lys Gly Thr Leu Gln Ser Val 20 25 30Asp Gln Phe Leu Asn Leu Lys Leu Asp Asn Ile Ser Cys Thr Asp Glu 35 40 45Lys Lys Tyr Pro His Leu Gly Ser Val Arg Asn Ile Phe Ile Arg Gly 50 55 60Ser Thr Val Arg Tyr Val Tyr Leu Asn Lys Asn Met Val Asp Thr Asn65 70 75 80Leu Leu Gln Asp Ala Thr Arg Arg Glu Val Met Thr Glu Arg Lys 85 90 9531270DNASaccharomyces cerevisiae 31atggagacac ctttggattt attgaaactc aatctcgatg agagggtgta catcaagctg 60cgcggggcca ggacgctggt gggcacactg caagcgttcg actcacactg caacatcgtg 120ctgagtgatg cagtagagac catataccaa ttaaacaacg aggagttgag tgagtccgaa 180agacgatgtg aaatggtgtt catcagagga gacacagtga ctctaatcag cacgccctct 240gaagatgacg atggcgcagt ggagatataa 2703289PRTSaccharomyces cerevisiae 32Met Glu Thr Pro Leu Asp Leu Leu Lys Leu Asn Leu Asp Glu Arg Val1 5 10 15Tyr Ile Lys Leu Arg Gly Ala Arg Thr Leu Val Gly Thr Leu Gln Ala 20 25 30Phe Asp Ser His Cys Asn Ile Val Leu Ser Asp Ala Val Glu Thr Ile 35 40 45Tyr Gln Leu Asn Asn Glu Glu Leu Ser Glu Ser Glu Arg Arg Cys Glu 50 55 60Met Val Phe Ile Arg Gly Asp Thr Val Thr Leu Ile Ser Thr Pro Ser65 70 75 80Glu Asp Asp Asp Gly Ala Val Glu Ile 8533564DNASaccharomyces cerevisiae 33atgctacctt tatatctttt aacaaatgcg aagggacaac aaatgcaaat agaattgaaa 60aacggtgaaa ttatacaagg gatattgacc aacgtagata actggatgaa ccttacttta 120tctaatgtaa ccgaatatag tgaagaaagc gcaattaatt cagaagacaa tgctgagagc 180agtaaagccg taaaattgaa cgaaatttat attagaggga cttttatcaa gtttatcaaa 240ttgcaagata atataattga caaggtcaag cagcaaatta actccaacaa taactctaat 300agtaacggcc ctgggcataa aagatactac aacaataggg attcaaacaa caatagaggt 360aactacaaca gaagaaataa taataacggc aacagcaacc gccgtccata ctctcaaaac 420cgtcaataca acaacagcaa cagcagtaac attaacaaca gtatcaacag tatcaatagc 480aacaaccaaa atatgaacaa tggtttaggt gggtccgtcc aacatcattt taacagctct 540tctccacaaa aggtcgaatt ttaa 56434187PRTSaccharomyces cerevisiae 34Met Leu Pro Leu Tyr Leu Leu Thr Asn Ala Lys Gly Gln Gln Met Gln1 5 10 15Ile Glu Leu Lys Asn Gly Glu Ile Ile Gln Gly Ile Leu Thr Asn Val 20 25 30Asp Asn Trp Met Asn Leu Thr Leu Ser Asn Val Thr Glu Tyr Ser Glu 35 40 45Glu Ser Ala Ile Asn Ser Glu Asp Asn Ala Glu Ser Ser Lys Ala Val 50 55 60Lys Leu Asn Glu Ile Tyr Ile Arg Gly Thr Phe Ile Lys Phe Ile Lys65 70 75 80Leu Gln Asp Asn Ile Ile Asp Lys Val Lys Gln Gln Ile Asn Ser Asn 85 90 95Asn Asn Ser Asn Ser Asn Gly Pro Gly His Lys Arg Tyr Tyr Asn Asn 100 105 110Arg Asp Ser Asn Asn Asn Arg Gly Asn Tyr Asn Arg Arg Asn Asn Asn 115 120 125Asn Gly Asn Ser Asn Arg Arg Pro Tyr Ser Gln Asn Arg Gln Tyr Asn 130 135 140Asn Ser Asn Ser Ser Asn Ile Asn Asn Ser Ile Asn Ser Ile Asn Ser145 150 155 160Asn Asn Gln Asn Met Asn Asn Gly Leu Gly Gly Ser Val Gln His His 165 170 175Phe Asn Ser Ser Ser Pro Gln Lys Val Glu Phe 180 18535282DNASaccharomyces cerevisiae 35atgagtctac cggagatttt gcctttggaa gtcatagata aaacaattaa ccagaaagtg 60ttgattgtgc tgcagtcgaa ccgcgagttc gagggcacgt tagttggttt cgacgacttc 120gtcaacgtta tactggaaga cgctgtcgag tggcttatcg atcctgagga cgagagcaga 180aatgagaaag ttatgcagca ccatggcaga atgcttttaa gcggcaacaa tattgccatc 240cttgtgccag gcggcaaaaa gacccctacg gaggcgttgt aa 2823693PRTSaccharomyces cerevisiae 36Met Ser Leu Pro Glu Ile Leu Pro Leu Glu Val Ile Asp Lys Thr Ile1 5 10 15Asn Gln Lys Val Leu Ile Val Leu Gln Ser Asn Arg Glu Phe Glu Gly 20 25 30Thr Leu Val Gly Phe Asp Asp Phe Val Asn Val Ile Leu Glu Asp Ala 35 40 45Val Glu Trp Leu Ile Asp Pro Glu Asp Glu Ser Arg Asn Glu Lys Val 50 55 60Met Gln His His Gly Arg Met Leu Leu Ser Gly Asn Asn Ile Ala Ile65 70 75 80Leu Val Pro Gly Gly Lys Lys Thr Pro Thr Glu Ala Leu 85 9037261DNASaccharomyces cerevisiae 37atgtccggaa aagcttctac agagggtagc gttactacgg agtttctctc tgatatcatt 60ggtaagacag tgaacgtcaa acttgcctcg ggtttactct acagcggaag attggaatcc 120attgatggtt ttatgaatgt tgcactatcg agtgccactg aacactacga gagtaataac 180aataagcttc taaataagtt caatagtgat gtctttttga ggggcacgca ggtcatgtat 240atcagtgaac aaaaaatata g 2613886PRTSaccharomyces cerevisiae 38Met Ser Gly Lys Ala Ser Thr Glu Gly Ser Val Thr Thr Glu Phe Leu1 5 10 15Ser Asp Ile Ile Gly Lys Thr Val Asn Val Lys Leu Ala Ser Gly Leu 20 25 30Leu Tyr Ser Gly Arg Leu Glu Ser Ile Asp Gly Phe Met Asn Val Ala 35 40 45Leu Ser Ser Ala Thr Glu His Tyr Glu Ser Asn Asn Asn Lys Leu Leu 50 55 60Asn Lys Phe Asn Ser Asp Val Phe Leu Arg Gly Thr Gln Val Met Tyr65 70 75 80Ile Ser Glu Gln Lys Ile 8539348DNASaccharomyces cerevisiae 39atgcatcagc aacactccaa atcagagaac aaaccacaac agcaaaggaa aaaattcgaa 60ggccctaaaa gagaagctat tctggattta gcgaagtata aagattctaa aattcgcgtc 120aaattaatgg gtggtaaatt agttataggt gtcctaaaag gctatgatca actgatgaac 180ttggtacttg atgatacagt agaatatatg tctaatcctg atgatgaaaa caacactgaa 240ctgatttcta aaaacgcaag aaagctaggt ttgaccgtca taagaggtac tattttggtc 300tctttaagtt ccgccgaagg ttctgatgta ctatatatgc aaaaatag 34840115PRTSaccharomyces cerevisiae 40Met His Gln Gln His Ser Lys Ser Glu Asn Lys Pro Gln Gln Gln Arg1 5 10 15Lys Lys Phe Glu Gly Pro Lys Arg Glu Ala Ile Leu Asp Leu Ala Lys 20 25 30Tyr Lys Asp Ser Lys Ile Arg Val Lys Leu Met Gly Gly Lys Leu Val 35 40 45Ile Gly Val Leu Lys Gly Tyr Asp Gln Leu Met Asn Leu Val Leu Asp 50 55 60Asp Thr Val Glu Tyr Met Ser Asn Pro Asp Asp Glu Asn Asn Thr Glu65 70 75 80Leu Ile Ser Lys Asn Ala Arg Lys Leu Gly Leu Thr Val Ile Arg Gly 85 90 95Thr Ile Leu Val Ser Leu Ser Ser Ala Glu Gly Ser Asp Val Leu Tyr 100 105 110Met Gln Lys 11541330DNASaccharomyces cerevisiae 41atgtcagcca ccttgaaaga ctacttaaat aaaagagttg ttataatcaa agttgacggc 60gaatgcctca tagcaagcct aaacggcttc gacaaaaata ctaatctatt cataaccaat 120gttttcaacc gcataagcaa ggaattcatc tgcaaggcac agttacttcg aggcagcgag 180attgctcttg ttggcctcat agatgcagaa aatgatgaca gtctagctcc tatagacgaa 240aagaaggtcc caatgctaaa ggacaccaag aataaaatcg aaaatgagca tgtaatatgg 300gaaaaagtgt acgaatcaaa gacaaaataa 33042109PRTSaccharomyces cerevisiae 42Met Ser Ala Thr Leu Lys Asp Tyr Leu Asn Lys Arg Val Val Ile Ile1 5 10 15Lys Val Asp Gly Glu Cys Leu Ile Ala Ser Leu Asn Gly Phe Asp Lys 20 25 30Asn Thr Asn Leu Phe Ile Thr Asn Val Phe Asn Arg Ile Ser Lys Glu 35 40 45Phe Ile Cys Lys Ala Gln Leu Leu Arg Gly Ser Glu Ile Ala Leu Val 50 55 60Gly Leu Ile Asp Ala Glu Asn Asp Asp Ser Leu Ala Pro Ile Asp Glu65 70 75 80Lys Lys Val Pro Met Leu Lys Asp Thr Lys Asn Lys Ile Glu Asn Glu 85 90 95His Val Ile Trp Glu Lys Val Tyr Glu Ser Lys Thr Lys 100 10543267DNASaccharomyces cerevisiae 43atggacatct tgaaactgtc agattttatt ggaaatactt taatagtttc ccttacagaa 60gatcgtattt tagttggaag cttggttgct gtagatgccc aaatgaattt gctattagat 120catgttgagg aacgtatggg ctccagtagt agaatgatgg gcctagtcag cgtccctagg 180cgttccgtta agaccataat gattgataag cctgttctgc aggagcttac tgcgaataaa 240gttgaattga tggctaatat tgtttag 2674488PRTSaccharomyces cerevisiae 44Met Asp Ile Leu Lys Leu Ser Asp Phe Ile Gly Asn Thr Leu Ile Val1 5 10 15Ser Leu Thr Glu Asp Arg Ile Leu Val Gly Ser Leu Val Ala Val Asp 20 25 30Ala Gln Met Asn Leu Leu Leu Asp His Val Glu Glu Arg Met Gly Ser 35 40 45Ser Ser Arg Met Met Gly Leu Val Ser Val Pro Arg Arg Ser Val Lys 50 55 60Thr Ile Met Ile Asp Lys Pro Val Leu Gln Glu Leu Thr Ala Asn Lys65 70 75 80Val Glu Leu Met Ala Asn Ile Val 8545564DNASaccharomyces cerevisiae 45atgagtgtca gccttgagca aacgctcgga ttcagaataa aagttacgaa cgtgttggat 60gtagttactg aaggaagatt gtattcgttc aattcatcca acaacactct tactatccaa 120acaacaaaga agaatcaatc tccacaaaac ttcaaggtga taaaatgtac attcatcaag 180catttggaag tcattggtga taagccctcg tttaactcat tcaaaaagca acaaatcaaa 240ccctcatatg tcaacgtgga aagagttgag aagcttttga aagaaagtgt aatagcatct 300aaaaagaaag aactcttaag gggcaagggt gtgagtgcag agggtcagtt cattttcgat 360caaatcttca agaccatagg agatactaag tgggtggcta aagacatcat tattcttgat 420gacgttaagg tgcaacctcc atacaaggtc gaagatatca aagtgctaca tgagggaagt 480aaccaatcca ttacattaat tcaaagaata gtggaaagaa gctgggagca gctagaacaa 540gacgatggta ggaaaggtgg atag 56446187PRTSaccharomyces cerevisiae 46Met Ser Val Ser Leu Glu Gln Thr Leu Gly Phe Arg Ile Lys Val Thr1 5 10 15Asn Val Leu Asp Val Val Thr Glu Gly Arg Leu Tyr Ser Phe Asn Ser 20 25 30Ser Asn Asn Thr Leu Thr Ile Gln Thr Thr Lys Lys Asn Gln Ser Pro 35 40 45Gln Asn Phe Lys Val Ile Lys Cys Thr Phe Ile Lys His Leu Glu Val 50 55 60Ile Gly Asp Lys Pro Ser Phe Asn Ser Phe Lys Lys Gln Gln Ile Lys65 70 75 80Pro Ser Tyr Val Asn Val Glu Arg Val Glu Lys Leu Leu Lys Glu Ser 85 90 95Val Ile Ala Ser Lys Lys Lys Glu Leu Leu Arg Gly Lys Gly Val Ser 100 105 110Ala Glu Gly Gln Phe Ile Phe Asp Gln Ile Phe Lys Thr Ile Gly Asp 115 120 125Thr Lys Trp Val Ala Lys Asp Ile Ile Ile Leu Asp Asp Val Lys Val 130 135 140Gln Pro Pro Tyr Lys Val Glu Asp Ile Lys Val Leu His Glu Gly Ser145 150 155 160Asn Gln Ser Ile Thr Leu Ile Gln Arg Ile Val Glu Arg Ser Trp Glu 165 170 175Gln Leu Glu Gln Asp Asp Gly Arg Lys Gly Gly 180 185471050DNASaccharomyces cerevisiae 47atgtcgcagt acatcggtaa aactatttct ttaatctctg tgactgacaa cagatatgtg 60gggctgttag aagatattga ctctgaaaag ggtaccgtga ctttgaaaga agttcgctgt 120tttggtacag aaggtcgcaa gaactggggt cctgaagaaa tttatccgaa tcctacggta 180tacaattctg taaagttcaa cggcagtgaa gtcaaggatt taagcatttt agatgctaac 240atcaatgaca tacagccggt tgttcctcaa atgatgccac ccgcttcaca attccctcct 300caacaagctc aatctccacc ccaggctcaa gctcaagcac acgtgcaaac aaacccccaa 360gttccaaagc ccgaatccaa tgtgccagca gctgtcgctg gatatggtgt ttacacccca 420acttcgacag aaaccgctac tgctagtatg aatgataaga gcactcctca agacaccaat 480gtaaactcgc aaagtaggga aagaggtaaa aatggtgaaa atgagccaaa atatcaaaga 540aacaagaata gatcaagtaa tcgccctcct caatccaacc gcaatttcaa agtcgatatt 600ccgaatgaag attttgactt tcaatcaaat aatgcaaaat tcacgaaagg tgattccact 660gatgtggaaa aagaaaaaga attagaatca gctgttcaca agcaggatga atctgatgag 720cagttttata ataaaaaatc gtcttttttc gacaccatct ccacttctac tgaaactaat 780accaatatga gatggcaaga agaaaaaatg ttgaacgttg acacctttgg acaagcttct 840gccagaccaa gatttcactc tagaggcctc ggtcgtgggc gtggaaatta taggggaaac 900agaggaaaca gaggaagagg cggccaacgt ggaaactacc aaaacagaaa taactaccaa 960aatgatagtg gcgcctatca gaaccaaaac gactcgtaca gcagaccagc caaccagttt 1020tcgcaacctc cttccaacgt tgaattttaa 105048349PRTSaccharomyces cerevisiae 48Met Ser Gln Tyr Ile Gly Lys Thr Ile Ser Leu Ile Ser Val Thr Asp1 5 10 15Asn Arg Tyr Val Gly Leu Leu Glu Asp Ile Asp Ser Glu Lys Gly Thr 20 25 30Val Thr Leu Lys Glu Val Arg Cys Phe Gly Thr Glu Gly Arg Lys Asn 35 40 45Trp Gly Pro Glu Glu Ile Tyr Pro Asn Pro Thr Val Tyr Asn Ser Val 50 55 60Lys Phe Asn Gly Ser Glu Val Lys Asp Leu Ser Ile Leu Asp Ala Asn65 70 75 80Ile Asn Asp Ile Gln Pro Val Val Pro Gln Met Met Pro Pro Ala Ser 85 90 95Gln Phe Pro Pro Gln Gln Ala Gln Ser Pro Pro Gln Ala Gln Ala Gln 100 105 110Ala His Val Gln Thr Asn Pro Gln Val Pro Lys Pro Glu Ser Asn Val 115 120 125Pro Ala Ala Val Ala Gly Tyr Gly Val Tyr Thr Pro Thr Ser Thr Glu 130 135 140Thr Ala Thr Ala Ser Met Asn Asp Lys Ser Thr Pro Gln Asp Thr Asn145 150 155 160Val Asn Ser Gln Ser Arg Glu Arg Gly Lys Asn Gly Glu Asn Glu Pro 165 170 175Lys Tyr Gln Arg Asn Lys Asn Arg Ser Ser Asn Arg Pro Pro Gln Ser 180 185 190Asn Arg Asn Phe Lys Val Asp Ile Pro Asn Glu Asp Phe Asp Phe Gln 195 200 205Ser Asn Asn Ala Lys Phe Thr Lys Gly Asp Ser Thr Asp Val Glu Lys 210 215 220Glu Lys Glu Leu Glu Ser Ala Val His Lys Gln Asp Glu Ser Asp Glu225 230 235 240Gln Phe Tyr Asn Lys Lys Ser Ser Phe Phe Asp Thr Ile Ser Thr Ser 245 250 255Thr Glu Thr Asn Thr Asn Met Arg Trp Gln Glu Glu Lys Met Leu Asn 260 265 270Val Asp Thr Phe Gly Gln Ala Ser Ala Arg Pro Arg Phe His Ser Arg 275 280 285Gly Leu Gly Arg Gly Arg Gly Asn Tyr Arg Gly Asn Arg Gly Asn Arg 290 295 300Gly Arg Gly Gly Gln Arg Gly Asn Tyr Gln Asn Arg Asn Asn Tyr Gln305 310 315 320Asn Asp Ser Gly Ala Tyr Gln Asn Gln Asn Asp Ser Tyr Ser Arg Pro 325 330 335Ala Asn Gln Phe Ser Gln Pro Pro Ser Asn Val Glu Phe 340 345491656DNASaccharomyces cerevisiae 49atgtcacaat ttgttggttt cggagtacaa gtggagctaa aagatgggaa gctcattcag 60gggaaaattg ccaaagcaac ctcaaaagga ttgactttaa atgacgttca attcggcgat 120ggtggtaaat ctcaagcttt caaagtgagg gcgtcaaggc taaaggactt aaaggttcta 180actgttgcct ctcaatccgg gaaaaggaag cagcaaagac aacagcagca acaaaacgat 240tataatcaaa atcgcggtga acatattgat tggcaagatg atgatgttag taagataaaa 300caacaggaag atttcgattt ccaaagaaat ttgggcatgt ttaacaaaaa agacgtcttc 360gcacaattaa agcaaaatga cgatatatta ccggagaata gattacaggg acataacaga 420aagcaaaccc aattgcagca aaataattat caaaatgatg aattggttat tccagatgca 480aagaaagatt catggaacaa gatttcttca agaaatgagc aaagcacaca ccaatctcag 540ccgcaacaag atgctcaaga tgatctggtt ttggaagatg atgaacatga atacgatgtc 600gatgatatcg atgatcccaa atacctacca ataactcagt ctttgaatat tacacattta

660attcactctg caactaactc tccatccata aatgataaaa cgaaaggtac agttataaat 720gataaggatc aggtactagc taaattaggc cagatgatca tcagccagtc aagatccaac 780tcaacatcct tgccagctgc aaataaacaa acaaccatca gatcaaagaa cactaagcag 840aacattccta tggctacacc agtacaacta ctagaaatgg agagcatcac gtccgaattt 900ttcagtatta actcggcagg gctactagaa aattttgctg taaacgcatc gttcttctta 960aagcagaaac taggtggccg tgcacgttta cgtttacaaa attctaatcc ggaaccttta 1020gtagtaatac tagcctcaga ttccaacaga tctggtgcga aagctctggc gttgggtaga 1080catctttgcc aaacggggca tatccgtgtc ataacattat ttacatgttc tcaaaatgaa 1140ctacaggatt ccatggtcaa aaagcaaaca gatatttaca agaagtgtgg cggaaaaatt 1200gttaatagtg tatcgtcgct ggaatctgct atggaaacat taaatagccc tgtagaaata 1260gtcatcgatg ccatgcaggg atatgactgt acattgagcg atctggcggg gacgtcggaa 1320gttattgaaa gcagaattaa aagcatgata tcatggtgta acaaacagcg aggatctact 1380aaagtgtggt ctttggatat tccaaatggg tttgatgcgg gatccggcat gccagatatt 1440ttcttttcag acaggattga agcaacagga attatttgtt ctggctggcc tttgattgcc 1500atcaacaact taattgcaaa tttgccaagt ctagaagatg ctgttttgat tgatataggt 1560ataccacagg gcgcctattc acagagaact tctttgcgta agttccaaaa ctgtgatctt 1620ttcgtcactg acgggtccct gctattagat ttgtaa 165650551PRTSaccharomyces cerevisiae 50Met Ser Gln Phe Val Gly Phe Gly Val Gln Val Glu Leu Lys Asp Gly1 5 10 15Lys Leu Ile Gln Gly Lys Ile Ala Lys Ala Thr Ser Lys Gly Leu Thr 20 25 30Leu Asn Asp Val Gln Phe Gly Asp Gly Gly Lys Ser Gln Ala Phe Lys 35 40 45Val Arg Ala Ser Arg Leu Lys Asp Leu Lys Val Leu Thr Val Ala Ser 50 55 60Gln Ser Gly Lys Arg Lys Gln Gln Arg Gln Gln Gln Gln Gln Asn Asp65 70 75 80Tyr Asn Gln Asn Arg Gly Glu His Ile Asp Trp Gln Asp Asp Asp Val 85 90 95Ser Lys Ile Lys Gln Gln Glu Asp Phe Asp Phe Gln Arg Asn Leu Gly 100 105 110Met Phe Asn Lys Lys Asp Val Phe Ala Gln Leu Lys Gln Asn Asp Asp 115 120 125Ile Leu Pro Glu Asn Arg Leu Gln Gly His Asn Arg Lys Gln Thr Gln 130 135 140Leu Gln Gln Asn Asn Tyr Gln Asn Asp Glu Leu Val Ile Pro Asp Ala145 150 155 160Lys Lys Asp Ser Trp Asn Lys Ile Ser Ser Arg Asn Glu Gln Ser Thr 165 170 175His Gln Ser Gln Pro Gln Gln Asp Ala Gln Asp Asp Leu Val Leu Glu 180 185 190Asp Asp Glu His Glu Tyr Asp Val Asp Asp Ile Asp Asp Pro Lys Tyr 195 200 205Leu Pro Ile Thr Gln Ser Leu Asn Ile Thr His Leu Ile His Ser Ala 210 215 220Thr Asn Ser Pro Ser Ile Asn Asp Lys Thr Lys Gly Thr Val Ile Asn225 230 235 240Asp Lys Asp Gln Val Leu Ala Lys Leu Gly Gln Met Ile Ile Ser Gln 245 250 255Ser Arg Ser Asn Ser Thr Ser Leu Pro Ala Ala Asn Lys Gln Thr Thr 260 265 270Ile Arg Ser Lys Asn Thr Lys Gln Asn Ile Pro Met Ala Thr Pro Val 275 280 285Gln Leu Leu Glu Met Glu Ser Ile Thr Ser Glu Phe Phe Ser Ile Asn 290 295 300Ser Ala Gly Leu Leu Glu Asn Phe Ala Val Asn Ala Ser Phe Phe Leu305 310 315 320Lys Gln Lys Leu Gly Gly Arg Ala Arg Leu Arg Leu Gln Asn Ser Asn 325 330 335Pro Glu Pro Leu Val Val Ile Leu Ala Ser Asp Ser Asn Arg Ser Gly 340 345 350Ala Lys Ala Leu Ala Leu Gly Arg His Leu Cys Gln Thr Gly His Ile 355 360 365Arg Val Ile Thr Leu Phe Thr Cys Ser Gln Asn Glu Leu Gln Asp Ser 370 375 380Met Val Lys Lys Gln Thr Asp Ile Tyr Lys Lys Cys Gly Gly Lys Ile385 390 395 400Val Asn Ser Val Ser Ser Leu Glu Ser Ala Met Glu Thr Leu Asn Ser 405 410 415Pro Val Glu Ile Val Ile Asp Ala Met Gln Gly Tyr Asp Cys Thr Leu 420 425 430Ser Asp Leu Ala Gly Thr Ser Glu Val Ile Glu Ser Arg Ile Lys Ser 435 440 445Met Ile Ser Trp Cys Asn Lys Gln Arg Gly Ser Thr Lys Val Trp Ser 450 455 460Leu Asp Ile Pro Asn Gly Phe Asp Ala Gly Ser Gly Met Pro Asp Ile465 470 475 480Phe Phe Ser Asp Arg Ile Glu Ala Thr Gly Ile Ile Cys Ser Gly Trp 485 490 495Pro Leu Ile Ala Ile Asn Asn Leu Ile Ala Asn Leu Pro Ser Leu Glu 500 505 510Asp Ala Val Leu Ile Asp Ile Gly Ile Pro Gln Gly Ala Tyr Ser Gln 515 520 525Arg Thr Ser Leu Arg Lys Phe Gln Asn Cys Asp Leu Phe Val Thr Asp 530 535 540Gly Ser Leu Leu Leu Asp Leu545 5505120DNAArtificial SequenceSynthetic oligonucleotide primer 51cggagagatg gtcagtcaca 205220DNAArtificial SequenceSynthetic oligonucleotide primer 52ttcttgctgc tgcataatcg 205320DNAArtificial SequenceSynthetic oligonucleotide primer 53atggccgaaa aggtcaacaa 205420DNAArtificial SequenceSynthetic oligonucleotide primer 54tcaatcctcg tctcgccttt 205540DNAArtificial SequenceSynthetic oligonucleotide primer 55caaagcttga gctcgaattc atttttgccg tggtagttgc 405638PRTArtificial SequenceSynthetic oligonucleotide primer 56Cys Ala Gly Gly Thr Ala Cys Cys Thr Cys Thr Ala Gly Ala Ala Thr1 5 10 15Thr Cys Ala Cys Cys Ala Cys Thr Cys Ala Ala Thr Cys Cys Thr Cys 20 25 30Gly Thr Cys Thr Cys Gly 35

Claims

1. A genetically modified microorganism, wherein said genetic modification comprises introduction of an expression vector comprising the coding sequence of a protein of the Sm-like superfamily, and wherein said genetic modification results in elevated tolerance to stress or at least one inhibitor as compared to without the genetic modification.

2. The microorganism of claim 1, wherein said microorganism is selected from bacteria or fungi.

3. The microorganism of claim 2, wherein said microorganism is a bacterium selected from the group consisting of Acetobacterium, Bacillus, Streptococcus, Clostridium, Zymomonas, Anaerocellum, Caldicellulosiruptor, Thermoanaerobacter, Gluconobacter, and E. coli.

4. The microorganism of claim 3, wherein said bacterium is selected from the group consisting of C. thermocellum, Z. mobilis, Anaerocellum thermophilum, Caldicellulosiruptor saccharolyticus), Thermoanaerobacter sp. X514, and E. coli.

5. The microorganism of claim 2, wherein said microorganism is a bacterium and wherein said protein of the Sm-like superfamily is a bacterial Hfq protein.

6. The microorganism of claim 5, wherein said Hfq protein comprises an amino acid sequence selected from SEQ ID NO: 2, 4, 6, 8 or 10, or a functional derivative or homolog thereof that shares at least 95% sequence identity therewith.

7. The microorganism of claim 5, wherein said microorganism is Z. mobilis.

8. The microorganism of claim 7, wherein said Hfq protein comprises the sequence as set forth in SEQ ID NO: 2.

9. The microorganism of claim 2, wherein said microorganism is a fungal species selected from Saccharomyces sp., Kluyveromyces sp., Pichia sp., Candida sp., and Schizosaccharomycetes sp.

10. The microorganism of claim 9, wherein said fungal species is yeast selected from S. cerevisiae or P. pastoris.

11. The microorganism of claim 10, wherein said protein of the Sm-like superfamily is a yeast Sm or Lsm protein.

12. The microorganism of claim 11, wherein said protein comprises an amino acid sequence selected from any one of SEQ ID NOS: 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48 or 50, or a functional derivative or homolog thereof that shares at least 95% sequence identity therewith.

13. The microorganism of claim 1, wherein said expression vector is a replicative vector or an integrative vector.

14. The microorganism of claim 1, wherein said stress is environmental stress selected from the group of high temperatures, low temperatures, low pH, oxidation, osmotic, and drought.

15. The microorganism of claim 1, wherein said at least one inhibitor is selected from the group consisting of an acetate salt, vanillin, furfural, hydroxymethylfurfural (HMF) and H.sub.2O.sub.2.

16. The microorganism of claim 15, wherein said acetate salt is selected from the group consisting of sodium acetate, ammonium acetate and potassium acetate.

17. The microorganism of claim 1, wherein said enhanced tolerance is characterized by ability to grow in a media containing sodium acetate at a concentration of 195 mM.

18. A method of producing alcohol from a cellulosic biomass material, comprising adding a genetically modified microorganism according to any one of claims 1-17 to a fermentation mixture comprising a cellulosic biomass material and/or fermentation substrates derived from said cellulosic biomass material, allowing said microorganism to ferment and produce alcohol, and recover alcohol produced.